#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_TTotCov	i_TVarCov	i_Transcript_Id	i_Trna_alt1	i_Trna_alt2	i_Trna_ref	i_Trna_tot	i_Trna_var	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
PRAMEF2	65122	bcgsc.ca	37	1	12920067	12920067	+	Silent	SNP	C	C	G	rs17038709	byFrequency	TCGA-OR-A5KU-01A-11D-A29I-10	TCGA-OR-A5KU-10A-01D-A29L-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9652ca0-126e-4332-909a-4e2d2fc489ef	68f72637-d9e1-41a6-8bd0-b4f99bbc13a1	g.chr1:12920067C>G	ENST00000240189.2	+	3	894	c.807C>G	c.(805-807)ctC>ctG	p.L269L		NM_023014.1	NP_075390.1	O60811	PRAM2_HUMAN	PRAME family member 2	269					negative regulation of apoptotic process (GO:0043066)|negative regulation of cell differentiation (GO:0045596)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cell proliferation (GO:0008284)					breast(2)|endometrium(1)|kidney(2)|large_intestine(2)|lung(22)|prostate(6)|skin(3)|upper_aerodigestive_tract(4)	42	Ovarian(185;0.249)	Renal(390;0.000469)|Lung NSC(185;0.00143)|all_lung(284;0.00181)|Colorectal(325;0.00215)|Breast(348;0.00224)|Myeloproliferative disorder(586;0.0393)|Hepatocellular(190;0.0623)|Ovarian(437;0.0731)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00812)|Colorectal(212;2.4e-06)|Kidney(185;4.89e-05)|COAD - Colon adenocarcinoma(227;0.000152)|KIRC - Kidney renal clear cell carcinoma(229;0.000194)|BRCA - Breast invasive adenocarcinoma(304;0.000293)|STAD - Stomach adenocarcinoma(313;0.0072)|READ - Rectum adenocarcinoma(331;0.0649)		TGGAACACCTCCAGTTGCTTA	0.463													.|||	548	0.109425	0.1263	0.0994	5008	,	,		21768	0.131		0.1083	False		,,,				2504	0.0726				p.L269L		.											.	PRAMEF2-68	0			c.C807G						.	C		618,3788	260.7+/-263.8	63,492,1648	91.0	91.0	91.0		807	0.8	0.0	1	dbSNP_123	91	978,7610	209.0+/-250.3	81,816,3397	no	coding-synonymous	PRAMEF2	NM_023014.1		144,1308,5045	GG,GC,CC		11.388,14.0263,12.2826		269/475	12920067	1596,11398	2203	4294	6497	SO:0001819	synonymous_variant	65122	exon3			ACACCTCCAGTTG		CCDS149.1	1p36.21	2013-01-17			ENSG00000120952	ENSG00000120952		"""-"""	28841	protein-coding gene	gene with protein product							Standard	NM_023014		Approved	FLJ43580	uc001aum.1	O60811	OTTHUMG00000001986	ENST00000240189.2:c.807C>G	1.37:g.12920067C>G		Somatic	107	1		WXS	Illumina GAIIx	Phase_I	48	4	NM_023014	0	0	0	0	0		Silent	SNP	ENST00000240189.2	37	CCDS149.1																																																																																			C|0.887;G|0.113		0.463	PRAMEF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000005517.1	NM_023014	
PINK1	65018	hgsc.bcm.edu	37	1	20960230	20960230	+	Silent	SNP	C	C	T	rs45540544|rs45630563|rs45530340	byFrequency	TCGA-OR-A5KU-01A-11D-A29I-10	TCGA-OR-A5KU-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9652ca0-126e-4332-909a-4e2d2fc489ef	68f72637-d9e1-41a6-8bd0-b4f99bbc13a1	g.chr1:20960230C>T	ENST00000321556.4	+	1	283	c.189C>T	c.(187-189)ctC>ctT	p.L63L		NM_032409.2	NP_115785.1	Q9BXM7	PINK1_HUMAN	PTEN induced putative kinase 1	63					activation of protein kinase B activity (GO:0032148)|cell death (GO:0008219)|cellular response to hypoxia (GO:0071456)|cellular response to toxic substance (GO:0097237)|intracellular signal transduction (GO:0035556)|mitochondrion degradation (GO:0000422)|mitochondrion organization (GO:0007005)|negative regulation of gene expression (GO:0010629)|negative regulation of hydrogen peroxide-induced neuron intrinsic apoptotic signaling pathway (GO:1903384)|negative regulation of JNK cascade (GO:0046329)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of oxidative stress-induced cell death (GO:1903202)|negative regulation of oxidative stress-induced intrinsic apoptotic signaling pathway (GO:1902176)|negative regulation of oxidative stress-induced neuron death (GO:1903204)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|peptidyl-serine autophosphorylation (GO:0036289)|peptidyl-serine phosphorylation (GO:0018105)|phosphorylation (GO:0016310)|positive regulation of dopamine secretion (GO:0033603)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of mitochondrial electron transport, NADH to ubiquinone (GO:1902958)|positive regulation of peptidase activity (GO:0010952)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of synaptic transmission, dopaminergic (GO:0032226)|positive regulation of ubiquitin-protein transferase activity (GO:0051443)|protein phosphorylation (GO:0006468)|protein ubiquitination (GO:0016567)|regulation of mitochondrial membrane potential (GO:0051881)|regulation of mitochondrion degradation (GO:1903146)|regulation of protein complex assembly (GO:0043254)|regulation of protein ubiquitination (GO:0031396)|regulation of reactive oxygen species metabolic process (GO:2000377)|regulation of synaptic vesicle transport (GO:1902803)|response to oxidative stress (GO:0006979)|response to stress (GO:0006950)|TORC2 signaling (GO:0038203)|ubiquitin-dependent protein catabolic process (GO:0006511)	astrocyte projection (GO:0097449)|axon (GO:0030424)|cell body (GO:0044297)|chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|integral component of mitochondrial outer membrane (GO:0031307)|Lewy body (GO:0097413)|membrane (GO:0016020)|mitochondrial inner membrane (GO:0005743)|mitochondrial intermembrane space (GO:0005758)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	ATP binding (GO:0005524)|C3HC4-type RING finger domain binding (GO:0055131)|calcium-dependent protein kinase activity (GO:0010857)|kinase activity (GO:0016301)|magnesium ion binding (GO:0000287)|peptidase activator activity (GO:0016504)|protease binding (GO:0002020)|protein kinase B binding (GO:0043422)|protein serine/threonine kinase activity (GO:0004674)|ubiquitin protein ligase binding (GO:0031625)			central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(4)|ovary(2)	14		all_lung(284;2.72e-05)|Lung NSC(340;2.94e-05)|Colorectal(325;3.46e-05)|Renal(390;0.000147)|Breast(348;0.00179)|Ovarian(437;0.00327)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0182)|COAD - Colon adenocarcinoma(152;1.21e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000146)|Kidney(64;0.000182)|GBM - Glioblastoma multiforme(114;0.000497)|KIRC - Kidney renal clear cell carcinoma(64;0.00269)|STAD - Stomach adenocarcinoma(196;0.00308)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.199)		GGCTCGGGCTCCCTAACCGTC	0.791													C|||	644	0.128594	0.053	0.1571	5008	,	,		6081	0.127		0.1938	False		,,,				2504	0.1452				p.L63L	Esophageal Squamous(145;853 1803 8146 34412 35011)	.											.	PINK1-380	0			c.C189T						.	C		165,3267		4,157,1555	3.0	4.0	3.0		189	0.4	0.9	1	dbSNP_127	3	1114,5976		93,928,2524	no	coding-synonymous	PINK1	NM_032409.2		97,1085,4079	TT,TC,CC		15.7123,4.8077,12.1555		63/582	20960230	1279,9243	1716	3545	5261	SO:0001819	synonymous_variant	65018	exon1			CGGGCTCCCTAAC	AB053323	CCDS211.1	1p36.12	2011-07-21			ENSG00000158828	ENSG00000158828		"""Parkinson disease"""	14581	protein-coding gene	gene with protein product		608309	"""Parkinson disease (autosomal recessive) 6"""	PARK6		11494141, 15349860	Standard	NM_032409		Approved		uc001bdm.3	Q9BXM7	OTTHUMG00000002841	ENST00000321556.4:c.189C>T	1.37:g.20960230C>T		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	5	5	NM_032409	0	0	0	2	2	Q8N6T9|Q8NBU3|Q96DE4	Silent	SNP	ENST00000321556.4	37	CCDS211.1																																																																																			C|0.868;T|0.132		0.791	PINK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000007954.1	NM_032409	
OPRD1	4985	hgsc.bcm.edu	37	1	29138975	29138975	+	Missense_Mutation	SNP	G	G	T	rs1042114	byFrequency	TCGA-OR-A5KU-01A-11D-A29I-10	TCGA-OR-A5KU-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9652ca0-126e-4332-909a-4e2d2fc489ef	68f72637-d9e1-41a6-8bd0-b4f99bbc13a1	g.chr1:29138975G>T	ENST00000234961.2	+	1	322	c.80G>T	c.(79-81)tGc>tTc	p.C27F		NM_000911.3	NP_000902.3	P41143	OPRD_HUMAN	opioid receptor, delta 1	27			C -> F (improved maturation and increased expression at the cell surface; dbSNP:rs1042114). {ECO:0000269|PubMed:10982041, ECO:0000269|PubMed:8201839, ECO:0000269|Ref.4}.		adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|adult locomotory behavior (GO:0008344)|cellular response to growth factor stimulus (GO:0071363)|cellular response to hypoxia (GO:0071456)|cellular response to toxic substance (GO:0097237)|G-protein coupled receptor signaling pathway (GO:0007186)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|immune response (GO:0006955)|negative regulation of gene expression (GO:0010629)|negative regulation of protein oligomerization (GO:0032460)|neuropeptide signaling pathway (GO:0007218)|opioid receptor signaling pathway (GO:0038003)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|positive regulation of CREB transcription factor activity (GO:0032793)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|protein import into nucleus, translocation (GO:0000060)|regulation of calcium ion transport (GO:0051924)|regulation of mitochondrial membrane potential (GO:0051881)|regulation of sensory perception of pain (GO:0051930)	axon terminus (GO:0043679)|cytoplasm (GO:0005737)|dendrite membrane (GO:0032590)|integral component of plasma membrane (GO:0005887)|intrinsic component of plasma membrane (GO:0031226)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|vesicle (GO:0031982)	enkephalin receptor activity (GO:0038046)|opioid receptor activity (GO:0004985)			breast(1)|central_nervous_system(1)|kidney(3)|large_intestine(1)|lung(2)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	15		Colorectal(325;3.46e-05)|Lung NSC(340;0.000947)|all_lung(284;0.00131)|Renal(390;0.00758)|Breast(348;0.00765)|all_neural(195;0.0199)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0563)|Medulloblastoma(700;0.123)		Colorectal(126;1.29e-07)|COAD - Colon adenocarcinoma(152;7.51e-06)|STAD - Stomach adenocarcinoma(196;0.00306)|BRCA - Breast invasive adenocarcinoma(304;0.0241)|READ - Rectum adenocarcinoma(331;0.0649)|KIRC - Kidney renal clear cell carcinoma(1967;0.147)	Alvimopan(DB06274)|Amitriptyline(DB00321)|Buprenorphine(DB00921)|Butorphanol(DB00611)|Codeine(DB00318)|Dextromethorphan(DB00514)|Dextropropoxyphene(DB00647)|Diphenoxylate(DB01081)|Fentanyl(DB00813)|Heroin(DB01452)|Hydrocodone(DB00956)|Hydromorphone(DB00327)|Ketamine(DB01221)|Ketobemidone(DB06738)|Levorphanol(DB00854)|Loperamide(DB00836)|Methadone(DB00333)|Morphine(DB00295)|Nalbuphine(DB00844)|Naloxone(DB01183)|Naltrexone(DB00704)|Oxycodone(DB00497)|Oxymorphone(DB01192)|Remifentanil(DB00899)|Sufentanil(DB00708)|Tapentadol(DB06204)|Tramadol(DB00193)	CCTAGCGCCTGCCCCAGCGCT	0.771													T|||	4730	0.944489	0.9796	0.9193	5008	,	,		9147	1.0		0.8678	False		,,,				2504	0.9366				p.C27F		.											.	OPRD1-69	0			c.G80T						.	T	PHE/CYS	3689,115		1788,113,1	4.0	6.0	5.0	http://www.ncbi.nlm.nih.gov/omim/103780,165195|http://omim.org/entry/165195|http://omim.org/entry/103780	80	2.9	1.0	1	dbSNP_86	5	6762,846		2982,798,24	no	missense	OPRD1	NM_000911.3	205	4770,911,25	TT,TG,GG		11.1199,3.0231,8.421	benign	27/373	29138975	10451,961	1902	3804	5706	SO:0001583	missense	4985	exon1			GCGCCTGCCCCAG	U10504	CCDS329.1	1p36.1-p34.3	2012-08-08			ENSG00000116329	ENSG00000116329		"""GPCR / Class A : Opioid receptors"""	8153	protein-coding gene	gene with protein product		165195				8415697	Standard	NM_000911		Approved		uc001brf.1	P41143	OTTHUMG00000003646	ENST00000234961.2:c.80G>T	1.37:g.29138975G>T	ENSP00000234961:p.Cys27Phe	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	7	7	NM_000911	0	0	0	0	0	B5B0B8	Missense_Mutation	SNP	ENST00000234961.2	37	CCDS329.1	2035	0.9317765567765568	474	0.9634146341463414	331	0.914364640883978	572	1.0	658	0.8680738786279684	T	0.016	-1.513433	0.00975	0.969769	0.888801	ENSG00000116329	ENST00000234961;ENST00000536280	T	0.67698	-0.28	4.0	2.89	0.33648	.	1.802200	0.02327	N	0.073605	T	0.00012	0.0000	N	0.01874	-0.695	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.41342	-0.9514	9	0.09338	T	0.73	.	3.8109	0.08796	0.0:0.1144:0.2238:0.6618	rs1042114;rs59349662;rs1042114	27	P41143	OPRD_HUMAN	F	27	ENSP00000234961:C27F	ENSP00000234961:C27F	C	+	2	0	OPRD1	29011562	0.002000	0.14202	0.992000	0.48379	0.116000	0.19942	0.521000	0.22893	0.713000	0.32060	-0.694000	0.03704	TGC	G|0.061;T|0.939		0.771	OPRD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000010330.1	NM_000911	
NOTCH2	4853	hgsc.bcm.edu	37	1	120611964	120611964	+	Missense_Mutation	SNP	G	G	C	rs11810554	byFrequency	TCGA-OR-A5KU-01A-11D-A29I-10	TCGA-OR-A5KU-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9652ca0-126e-4332-909a-4e2d2fc489ef	68f72637-d9e1-41a6-8bd0-b4f99bbc13a1	g.chr1:120611964G>C	ENST00000256646.2	-	1	276	c.57C>G	c.(55-57)tgC>tgG	p.C19W		NM_024408.3	NP_077719.2	Q04721	NOTC2_HUMAN	notch 2	19					apoptotic process (GO:0006915)|atrial septum morphogenesis (GO:0060413)|bone remodeling (GO:0046849)|cell cycle arrest (GO:0007050)|cell fate determination (GO:0001709)|cell growth (GO:0016049)|ciliary body morphogenesis (GO:0061073)|determination of left/right symmetry (GO:0007368)|embryonic limb morphogenesis (GO:0030326)|gene expression (GO:0010467)|hemopoiesis (GO:0030097)|humoral immune response (GO:0006959)|in utero embryonic development (GO:0001701)|inflammatory response to antigenic stimulus (GO:0002437)|interleukin-4 secretion (GO:0072602)|intracellular receptor signaling pathway (GO:0030522)|morphogenesis of an epithelial sheet (GO:0002011)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nervous system development (GO:0007399)|Notch receptor processing (GO:0007220)|Notch signaling involved in heart development (GO:0061314)|Notch signaling pathway (GO:0007219)|organ morphogenesis (GO:0009887)|placenta blood vessel development (GO:0060674)|positive regulation of apoptotic process (GO:0043065)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of cell proliferation (GO:0008284)|positive regulation of Ras protein signal transduction (GO:0046579)|pulmonary valve morphogenesis (GO:0003184)|regulation of transcription, DNA-templated (GO:0006355)|stem cell maintenance (GO:0019827)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cell surface (GO:0009986)|cilium (GO:0005929)|endoplasmic reticulum membrane (GO:0005789)|extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|ligand-activated RNA polymerase II transcription factor binding transcription factor activity (GO:0038049)|receptor activity (GO:0004872)	p.C19W(1)		breast(4)|central_nervous_system(6)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(9)|kidney(9)|large_intestine(19)|liver(1)|lung(57)|ovary(4)|pancreas(1)|prostate(7)|skin(24)|stomach(2)|upper_aerodigestive_tract(5)|urinary_tract(1)	158	all_neural(166;0.153)	all_lung(203;1.96e-06)|Lung NSC(69;1.47e-05)|all_epithelial(167;0.000809)		Lung(183;0.0242)|LUSC - Lung squamous cell carcinoma(189;0.133)		CGGGGGCCGCGCAGCACAGCC	0.766			"""N, F, Mis"""		"""marginal zone lymphoma, DLBCL"""				Alagille Syndrome																												p.C19W		.		Dom	yes		1	1p13-p11	4853	Notch homolog 2		L	.	NOTCH2-1441	1	Substitution - Missense(1)	central_nervous_system(1)	c.C57G						.						6.0	8.0	8.0					1																	120611964		1705	3721	5426	SO:0001583	missense	4853	exon1	Familial Cancer Database	ALGS1, ALGS2.Alagille-Watson syndrome	GGCCGCGCAGCAC	AF315356	CCDS908.1	1p13-p11	2013-01-10	2010-06-24		ENSG00000134250	ENSG00000134250		"""Ankyrin repeat domain containing"""	7882	protein-coding gene	gene with protein product		600275	"""Notch (Drosophila) homolog 2"", ""Notch homolog 2 (Drosophila)"""			7698746	Standard	NM_001200001		Approved		uc001eik.3	Q04721	OTTHUMG00000012177	ENST00000256646.2:c.57C>G	1.37:g.120611964G>C	ENSP00000256646:p.Cys19Trp	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	10	6	NM_024408	0	0	1	1	0	Q5T3X7|Q99734|Q9H240	Missense_Mutation	SNP	ENST00000256646.2	37	CCDS908.1	697|697	0.3191391941391941|0.3191391941391941	81|81	0.16463414634146342|0.16463414634146342	112|112	0.30939226519337015|0.30939226519337015	224|224	0.3916083916083916|0.3916083916083916	280|280	0.36939313984168864|0.36939313984168864	G|G	6.292|6.292	0.421956|0.421956	0.11928|0.11928	.|.	.|.	ENSG00000134250|ENSG00000134250	ENST00000538680|ENST00000256646	.|T	.|0.57436	.|0.4	3.09|3.09	2.04|2.04	0.26737|0.26737	.|.	.|.	.|.	.|.	.|.	T|T	0.14917|0.14917	0.0360|0.0360	N|N	0.14661|0.14661	0.345|0.345	0.26751|0.26751	N|N	0.970205|0.970205	.|B;B	.|0.09022	.|0.001;0.002	.|B;B	.|0.01281	.|0.0;0.0	T|T	0.14337|0.14337	-1.0476|-1.0476	6|9	0.87932|0.37606	D|T	0|0.19	.|.	6.7594|6.7594	0.23532|0.23532	0.0:0.0:0.7206:0.2794|0.0:0.0:0.7206:0.2794	rs11810554|rs11810554	.|19;19	.|Q6IQ50;Q04721	.|.;NOTC2_HUMAN	G|W	36|19	.|ENSP00000256646:C19W	ENSP00000439516:A36G|ENSP00000256646:C19W	A|C	-|-	2|3	0|2	NOTCH2|NOTCH2	120413487|120413487	0.998000|0.998000	0.40836|0.40836	0.998000|0.998000	0.56505|0.56505	0.313000|0.313000	0.28021|0.28021	0.766000|0.766000	0.26560|0.26560	1.760000|1.760000	0.52011|0.52011	0.184000|0.184000	0.17185|0.17185	GCG|TGC	G|0.680;C|0.320		0.766	NOTCH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033679.1	NM_024408	
NOTCH2	4853	hgsc.bcm.edu	37	1	120612006	120612006	+	Silent	SNP	G	G	A	rs4021006	byFrequency	TCGA-OR-A5KU-01A-11D-A29I-10	TCGA-OR-A5KU-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9652ca0-126e-4332-909a-4e2d2fc489ef	68f72637-d9e1-41a6-8bd0-b4f99bbc13a1	g.chr1:120612006G>A	ENST00000256646.2	-	1	234	c.15C>T	c.(13-15)cgC>cgT	p.R5R		NM_024408.3	NP_077719.2	Q04721	NOTC2_HUMAN	notch 2	5					apoptotic process (GO:0006915)|atrial septum morphogenesis (GO:0060413)|bone remodeling (GO:0046849)|cell cycle arrest (GO:0007050)|cell fate determination (GO:0001709)|cell growth (GO:0016049)|ciliary body morphogenesis (GO:0061073)|determination of left/right symmetry (GO:0007368)|embryonic limb morphogenesis (GO:0030326)|gene expression (GO:0010467)|hemopoiesis (GO:0030097)|humoral immune response (GO:0006959)|in utero embryonic development (GO:0001701)|inflammatory response to antigenic stimulus (GO:0002437)|interleukin-4 secretion (GO:0072602)|intracellular receptor signaling pathway (GO:0030522)|morphogenesis of an epithelial sheet (GO:0002011)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nervous system development (GO:0007399)|Notch receptor processing (GO:0007220)|Notch signaling involved in heart development (GO:0061314)|Notch signaling pathway (GO:0007219)|organ morphogenesis (GO:0009887)|placenta blood vessel development (GO:0060674)|positive regulation of apoptotic process (GO:0043065)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of cell proliferation (GO:0008284)|positive regulation of Ras protein signal transduction (GO:0046579)|pulmonary valve morphogenesis (GO:0003184)|regulation of transcription, DNA-templated (GO:0006355)|stem cell maintenance (GO:0019827)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cell surface (GO:0009986)|cilium (GO:0005929)|endoplasmic reticulum membrane (GO:0005789)|extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|ligand-activated RNA polymerase II transcription factor binding transcription factor activity (GO:0038049)|receptor activity (GO:0004872)			breast(4)|central_nervous_system(6)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(9)|kidney(9)|large_intestine(19)|liver(1)|lung(57)|ovary(4)|pancreas(1)|prostate(7)|skin(24)|stomach(2)|upper_aerodigestive_tract(5)|urinary_tract(1)	158	all_neural(166;0.153)	all_lung(203;1.96e-06)|Lung NSC(69;1.47e-05)|all_epithelial(167;0.000809)		Lung(183;0.0242)|LUSC - Lung squamous cell carcinoma(189;0.133)		GCAGAGCGGGGCGCAGGGCGG	0.761			"""N, F, Mis"""		"""marginal zone lymphoma, DLBCL"""				Alagille Syndrome				g|||	1973	0.39397	0.2632	0.4049	5008	,	,		21911	0.4315		0.4423	False		,,,				2504	0.4744				p.R5R		.		Dom	yes		1	1p13-p11	4853	Notch homolog 2		L	.	NOTCH2-1441	0			c.C15T						.						6.0	8.0	8.0					1																	120612006		1838	3882	5720	SO:0001819	synonymous_variant	4853	exon1	Familial Cancer Database	ALGS1, ALGS2.Alagille-Watson syndrome	AGCGGGGCGCAGG	AF315356	CCDS908.1	1p13-p11	2013-01-10	2010-06-24		ENSG00000134250	ENSG00000134250		"""Ankyrin repeat domain containing"""	7882	protein-coding gene	gene with protein product		600275	"""Notch (Drosophila) homolog 2"", ""Notch homolog 2 (Drosophila)"""			7698746	Standard	NM_001200001		Approved		uc001eik.3	Q04721	OTTHUMG00000012177	ENST00000256646.2:c.15C>T	1.37:g.120612006G>A		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	8	5	NM_024408	0	0	2	2	0	Q5T3X7|Q99734|Q9H240	Silent	SNP	ENST00000256646.2	37	CCDS908.1	.	.	.	.	.	.	.	.	.	.	G	9.758	1.169358	0.21621	.	.	ENSG00000134250	ENST00000538680	.	.	.	2.9	1.95	0.26073	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	5.0819	0.14661	0.1818:0.0:0.8182:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	NOTCH2	120413529	0.988000	0.35896	0.959000	0.39883	0.588000	0.36517	1.074000	0.30703	0.543000	0.28864	0.184000	0.17185	.	G|0.500;A|0.500		0.761	NOTCH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033679.1	NM_024408	
HRNR	388697	bcgsc.ca	37	1	152185882	152185882	+	Silent	SNP	G	G	C	rs41266126	byFrequency	TCGA-OR-A5KU-01A-11D-A29I-10	TCGA-OR-A5KU-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9652ca0-126e-4332-909a-4e2d2fc489ef	68f72637-d9e1-41a6-8bd0-b4f99bbc13a1	g.chr1:152185882G>C	ENST00000368801.2	-	3	8298	c.8223C>G	c.(8221-8223)ggC>ggG	p.G2741G	FLG-AS1_ENST00000420707.1_RNA|FLG-AS1_ENST00000593011.1_RNA	NM_001009931.1	NP_001009931.1	Q86YZ3	HORN_HUMAN	hornerin	2741					establishment of skin barrier (GO:0061436)|hematopoietic progenitor cell differentiation (GO:0002244)|keratinization (GO:0031424)	cornified envelope (GO:0001533)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)	p.G2741G(1)		autonomic_ganglia(1)|breast(6)|central_nervous_system(2)|cervix(2)|endometrium(22)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(19)|liver(1)|lung(84)|ovary(5)|prostate(6)|skin(12)|stomach(9)|upper_aerodigestive_tract(5)|urinary_tract(6)	192	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			TGGAAGACTGGCCTGTGCTAG	0.577																																					p.G2741G		.											.	HRNR-93	1	Substitution - coding silent(1)	prostate(1)	c.C8223G						.						28.0	16.0	20.0					1																	152185882		2167	4065	6232	SO:0001819	synonymous_variant	388697	exon3			AGACTGGCCTGTG	AB104446	CCDS30859.1	1q21.3	2013-01-10			ENSG00000197915	ENSG00000197915		"""EF-hand domain containing"""	20846	protein-coding gene	gene with protein product	"""filaggrin family member 3"""						Standard	NM_001009931		Approved	S100a18, S100A16, FLG3	uc001ezt.2	Q86YZ3	OTTHUMG00000012243	ENST00000368801.2:c.8223C>G	1.37:g.152185882G>C		Somatic	116	0		WXS	Illumina GAIIx	Phase_I	43	11	NM_001009931	0	0	0	0	0	Q5DT20|Q5U1F4	Silent	SNP	ENST00000368801.2	37	CCDS30859.1																																																																																			A|1.000;|0.000		0.577	HRNR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000034016.1	XM_373868	
DENND4B	9909	hgsc.bcm.edu	37	1	153907297	153907297	+	Silent	SNP	C	C	T	rs557071025|rs544489048	byFrequency	TCGA-OR-A5KU-01A-11D-A29I-10	TCGA-OR-A5KU-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9652ca0-126e-4332-909a-4e2d2fc489ef	68f72637-d9e1-41a6-8bd0-b4f99bbc13a1	g.chr1:153907297C>T	ENST00000361217.4	-	18	3130	c.2712G>A	c.(2710-2712)caG>caA	p.Q904Q	DENND4B_ENST00000474386.1_5'Flank	NM_014856.2	NP_055671.2	O75064	DEN4B_HUMAN	DENN/MADD domain containing 4B	904	Gln-rich.				positive regulation of Rab GTPase activity (GO:0032851)|regulation of Rab protein signal transduction (GO:0032483)	Golgi apparatus (GO:0005794)|nucleus (GO:0005634)	Rab guanyl-nucleotide exchange factor activity (GO:0017112)			NS(1)|breast(1)|cervix(1)|endometrium(7)|kidney(2)|large_intestine(6)|lung(9)|ovary(1)|prostate(5)|skin(2)|urinary_tract(1)	36	all_lung(78;2.89e-32)|Lung NSC(65;2.27e-30)|Hepatocellular(266;0.0877)|Melanoma(130;0.199)		LUSC - Lung squamous cell carcinoma(543;0.151)			gctgctgctgctgctgctgtt	0.632													c|||	1	0.000199681	0.0	0.0	5008	,	,		16455	0.0		0.0	False		,,,				2504	0.001				p.Q904Q		.											.	DENND4B-69	0			c.G2712A						.						28.0	36.0	33.0					1																	153907297		2179	4277	6456	SO:0001819	synonymous_variant	9909	exon18			CTGCTGCTGCTGC	AB007945	CCDS44228.1	1q21.3	2012-10-03	2006-01-27	2006-01-27	ENSG00000198837	ENSG00000198837		"""DENN/MADD domain containing"""	29044	protein-coding gene	gene with protein product			"""KIAA0476"""	KIAA0476		9455484, 12906859	Standard	NM_014856		Approved		uc001fdd.1	O75064	OTTHUMG00000037157	ENST00000361217.4:c.2712G>A	1.37:g.153907297C>T		Somatic	66	0		WXS	Illumina GAIIx	Phase_I	82	7	NM_014856	0	0	39	47	8	Q5T4K0	Silent	SNP	ENST00000361217.4	37	CCDS44228.1																																																																																			.		0.632	DENND4B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090278.2	XM_375806	
GON4L	54856	broad.mit.edu	37	1	155733245	155733245	+	Silent	SNP	C	C	T			TCGA-OR-A5KU-01A-11D-A29I-10	TCGA-OR-A5KU-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9652ca0-126e-4332-909a-4e2d2fc489ef	68f72637-d9e1-41a6-8bd0-b4f99bbc13a1	g.chr1:155733245C>T	ENST00000368331.1	-	22	4632	c.4584G>A	c.(4582-4584)gaG>gaA	p.E1528E	GON4L_ENST00000437809.1_Silent_p.E1528E|GON4L_ENST00000271883.5_Silent_p.E1528E|GON4L_ENST00000471341.1_5'Flank	NM_001282858.1|NM_001282860.1	NP_001269787.1|NP_001269789.1	Q3T8J9	GON4L_HUMAN	gon-4-like (C. elegans)	1528	Glu-rich.				regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)	p.E1528E(2)		NS(2)|breast(4)|cervix(1)|endometrium(7)|kidney(4)|large_intestine(7)|lung(10)|ovary(3)|prostate(3)|skin(2)|stomach(1)|urinary_tract(1)	45	Hepatocellular(266;0.0997)|all_hematologic(923;0.145)|all_neural(408;0.195)					cttcttcttcctcctcttctt	0.488																																					p.E1528E		.											.	GON4L-93	2	Substitution - coding silent(2)	endometrium(2)	c.G4584A						.						35.0	35.0	35.0					1																	155733245		1944	4157	6101	SO:0001819	synonymous_variant	54856	exon22			TTCTTCCTCCTCT	AB046826	CCDS1121.1, CCDS44242.1, CCDS60296.1	1q22	2013-10-31	2006-11-08	2006-02-16	ENSG00000116580	ENSG00000116580			25973	protein-coding gene	gene with protein product		610393	"""gon-4 homolog (C.elegans)"""	GON4		16545939, 21454521	Standard	XM_005245283		Approved	FLJ20203, GON-4	uc001fly.1	Q3T8J9	OTTHUMG00000014106	ENST00000368331.1:c.4584G>A	1.37:g.155733245C>T		Somatic	53	1		WXS	Illumina GAIIx	Phase_I	32	4	NM_001037533	0	0	0	0	0	B7ZBL4|Q14C93|Q3T8J8|Q5VYZ5|Q5W0D5|Q6AWA6|Q6P1Q6|Q7Z3L3|Q8IY79|Q9BQI1|Q9HCG6	Silent	SNP	ENST00000368331.1	37																																																																																				.		0.488	GON4L-201	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding		NM_032292	
PVRL4	81607	hgsc.bcm.edu	37	1	161049499	161049499	+	Missense_Mutation	SNP	G	G	A	rs78105657	byFrequency	TCGA-OR-A5KU-01A-11D-A29I-10	TCGA-OR-A5KU-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9652ca0-126e-4332-909a-4e2d2fc489ef	68f72637-d9e1-41a6-8bd0-b4f99bbc13a1	g.chr1:161049499G>A	ENST00000368012.3	-	2	622	c.320C>T	c.(319-321)cCc>cTc	p.P107L		NM_030916.2	NP_112178.2	Q96NY8	PVRL4_HUMAN	poliovirus receptor-related 4	107	Ig-like V-type 1.				adherens junction organization (GO:0034332)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|viral process (GO:0016032)	cell junction (GO:0030054)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(9)|ovary(2)|urinary_tract(1)	20	all_cancers(52;8.9e-20)|Breast(13;0.00188)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.00165)			GCCGTCCAGGGGGTTGCGTGG	0.692													g|||	21	0.00419329	0.0	0.0058	5008	,	,		16028	0.0		0.0119	False		,,,				2504	0.0051				p.P107L	NSCLC(76;1160 1387 14476 16172 29359)	.											.	PVRL4-92	0			c.C320T						.	G	LEU/PRO	3,4337		0,3,2167	19.0	21.0	20.0		320	5.5	1.0	1	dbSNP_131	20	66,8436		0,66,4185	yes	missense	PVRL4	NM_030916.2	98	0,69,6352	AA,AG,GG		0.7763,0.0691,0.5373	benign	107/511	161049499	69,12773	2170	4251	6421	SO:0001583	missense	81607	exon2			TCCAGGGGGTTGC	AF426163	CCDS1216.1	1q22-q23.2	2013-01-14			ENSG00000143217	ENSG00000143217		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"""	19688	protein-coding gene	gene with protein product		609607				11544254	Standard	NM_030916		Approved	nectin-4, PRR4, LNIR	uc001fxo.2	Q96NY8	OTTHUMG00000031475	ENST00000368012.3:c.320C>T	1.37:g.161049499G>A	ENSP00000356991:p.Pro107Leu	Somatic	2	0		WXS	Illumina GAIIx	Phase_I	39	32	NM_030916	0	0	0	0	0	B4DQW3|Q96K15	Missense_Mutation	SNP	ENST00000368012.3	37	CCDS1216.1	11	0.005036630036630037	0	0.0	2	0.0055248618784530384	0	0.0	9	0.011873350923482849	g	23.6	4.433206	0.83776	6.91E-4	0.007763	ENSG00000143217	ENST00000368012	T	0.64991	-0.13	5.51	5.51	0.81932	Immunoglobulin subtype (1);Immunoglobulin V-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.64402	D	0.000015	T	0.56587	0.1995	N	0.26042	0.785	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.52193	-0.8608	10	0.10636	T	0.68	.	16.9215	0.86165	0.0:0.0:1.0:0.0	.	107	Q96NY8	PVRL4_HUMAN	L	107	ENSP00000356991:P107L	ENSP00000356991:P107L	P	-	2	0	PVRL4	159316123	0.999000	0.42202	0.973000	0.42090	0.837000	0.47467	3.786000	0.55431	2.574000	0.86865	0.650000	0.86243	CCC	G|0.994;A|0.006		0.692	PVRL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077074.1	NM_030916	
SHCBP1L	81626	hgsc.bcm.edu	37	1	182922067	182922067	+	Missense_Mutation	SNP	G	G	T	rs188196867	byFrequency	TCGA-OR-A5KU-01A-11D-A29I-10	TCGA-OR-A5KU-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9652ca0-126e-4332-909a-4e2d2fc489ef	68f72637-d9e1-41a6-8bd0-b4f99bbc13a1	g.chr1:182922067G>T	ENST00000367547.3	-	1	438	c.202C>A	c.(202-204)Ctg>Atg	p.L68M	SHCBP1L_ENST00000423786.1_5'Flank|SHCBP1L_ENST00000488956.1_5'UTR	NM_030933.2	NP_112195.2	Q9BZQ2	SHP1L_HUMAN	SHC SH2-domain binding protein 1-like	140								p.L68M(1)		breast(1)|endometrium(2)|kidney(2)|large_intestine(3)|liver(1)|lung(2)|pancreas(1)|prostate(1)|skin(2)	15						TGGAGCCGCAGCCTGGCCGTC	0.761													G|||	65	0.0129792	0.0015	0.0447	5008	,	,		12094	0.0		0.0219	False		,,,				2504	0.0102				p.L68M		.											.	SHCBP1L-91	1	Substitution - Missense(1)	breast(1)	c.C202A						.	G	MET/LEU	22,3042		0,22,1510	2.0	3.0	3.0		202	3.0	1.0	1		3	167,6229		1,165,3032	no	missense	SHCBP1L	NM_030933.2	15	1,187,4542	TT,TG,GG		2.611,0.718,1.9979	benign	68/654	182922067	189,9271	1532	3198	4730	SO:0001583	missense	81626	exon1			GCCGCAGCCTGGC	AF288397	CCDS30955.1	1q25	2011-01-24	2011-01-24	2011-01-24	ENSG00000157060	ENSG00000157060			16788	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 14"""	C1orf14		11318611	Standard	NM_030933		Approved		uc001gpu.3	Q9BZQ2	OTTHUMG00000035419	ENST00000367547.3:c.202C>A	1.37:g.182922067G>T	ENSP00000356518:p.Leu68Met	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	9	6	NM_030933	0	0	0	0	0	Q4G195|Q9BZQ3|Q9H2B6	Missense_Mutation	SNP	ENST00000367547.3	37	CCDS30955.1	41	0.018772893772893772	7	0.014227642276422764	14	0.03867403314917127	0	0.0	20	0.026385224274406333	G	8.485	0.860773	0.17178	0.00718	0.02611	ENSG00000157060	ENST00000367547;ENST00000287709	T	0.46063	0.88	3.9	2.98	0.34508	.	0.716137	0.11457	N	0.562144	T	0.05044	0.0135	N	0.08118	0	0.80722	D	1	P	0.37276	0.589	B	0.34779	0.189	T	0.02132	-1.1208	10	0.31617	T	0.26	-4.4958	7.9824	0.30192	0.1203:0.0:0.8797:0.0	.	68	Q9BZQ2-3	.	M	68;137	ENSP00000356518:L68M	ENSP00000287709:L137M	L	-	1	2	SHCBP1L	181188690	0.878000	0.30173	0.996000	0.52242	0.343000	0.28985	0.241000	0.18065	0.752000	0.32923	-0.657000	0.03884	CTG	G|0.981;T|0.019		0.761	SHCBP1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000085956.1	NM_030933	
C1orf106	55765	hgsc.bcm.edu	37	1	200880978	200880978	+	Missense_Mutation	SNP	C	C	T	rs296520	byFrequency	TCGA-OR-A5KU-01A-11D-A29I-10	TCGA-OR-A5KU-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9652ca0-126e-4332-909a-4e2d2fc489ef	68f72637-d9e1-41a6-8bd0-b4f99bbc13a1	g.chr1:200880978C>T	ENST00000367342.4	+	9	1812	c.1612C>T	c.(1612-1614)Cgc>Tgc	p.R538C	C1orf106_ENST00000413687.2_Missense_Mutation_p.R453C	NM_018265.3	NP_060735.3	Q3KP66	CA106_HUMAN	chromosome 1 open reading frame 106	538			R -> C (in dbSNP:rs296520). {ECO:0000269|PubMed:14702039, ECO:0000269|PubMed:15489334}.							endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(6)|ovary(1)|prostate(2)|skin(3)|stomach(1)|urinary_tract(2)	21						GTGGGAGCTGCGCCGCGCAGC	0.736													T|||	3966	0.791933	0.6089	0.8213	5008	,	,		12017	0.997		0.7256	False		,,,				2504	0.8753				p.R552C		.											.	C1orf106-93	0			c.C1654T						.	T	CYS/ARG,CYS/ARG	2547,1503		890,767,368	5.0	7.0	6.0		1357,1612	0.8	0.0	1	dbSNP_79	6	5587,2355		2124,1339,508	no	missense,missense	C1orf106	NM_001142569.2,NM_018265.3	180,180	3014,2106,876	TT,TC,CC		29.6525,37.1111,32.1714	benign,benign	453/579,538/664	200880978	8134,3858	2025	3971	5996	SO:0001583	missense	55765	exon9			GAGCTGCGCCGCG	AK001763	CCDS44292.1	1q32.1	2011-02-15			ENSG00000163362	ENSG00000163362			25599	protein-coding gene	gene with protein product						14702039	Standard	NM_018265		Approved	FLJ10901	uc001gvo.4	Q3KP66	OTTHUMG00000035789	ENST00000367342.4:c.1612C>T	1.37:g.200880978C>T	ENSP00000356311:p.Arg538Cys	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	8	8	NM_018265	0	0	0	0	0	B4E1K9|E9PFY0|Q9NV65|Q9NVI0	Missense_Mutation	SNP	ENST00000367342.4	37		1677	0.7678571428571429	261	0.5304878048780488	285	0.787292817679558	569	0.9947552447552448	562	0.741424802110818	T	0.366	-0.936884	0.02340	0.628889	0.703475	ENSG00000163362	ENST00000367342;ENST00000413687	T;T	0.28454	1.61;1.61	3.39	0.759	0.18438	.	0.912041	0.09365	N	0.812206	T	0.00012	0.0000	N	0.01576	-0.805	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.16188	-1.0411	9	0.29301	T	0.29	-23.0614	3.796	0.08740	0.0:0.2241:0.1856:0.5903	rs296520;rs7519373;rs56757010	538	Q3KP66	CA106_HUMAN	C	538;453	ENSP00000356311:R538C;ENSP00000392105:R453C	ENSP00000356311:R538C	R	+	1	0	C1orf106	199147601	0.004000	0.15560	0.002000	0.10522	0.007000	0.05969	-0.731000	0.04909	-0.124000	0.11724	-0.381000	0.06696	CGC	C|0.242;T|0.758		0.736	C1orf106-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000087057.2	NM_018265	
OR2T4	127074	bcgsc.ca	37	1	248524967	248524967	+	Missense_Mutation	SNP	A	A	G	rs200915140	byFrequency	TCGA-OR-A5KU-01A-11D-A29I-10	TCGA-OR-A5KU-10A-01D-A29L-10	A	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9652ca0-126e-4332-909a-4e2d2fc489ef	68f72637-d9e1-41a6-8bd0-b4f99bbc13a1	g.chr1:248524967A>G	ENST00000366475.1	+	1	85	c.85A>G	c.(85-87)Atg>Gtg	p.M29V		NM_001004696.1	NP_001004696.1	Q8NH00	OR2T4_HUMAN	olfactory receptor, family 2, subfamily T, member 4	29						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(3)|liver(2)|lung(47)	56	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0265)			CAAACATCCAATGGCCAATAT	0.498													N|||	140	0.0279553	0.0	0.0259	5008	,	,		15202	0.0665		0.0099	False		,,,				2504	0.046				p.M29V		.											.	OR2T4-68	0			c.A85G						.						108.0	92.0	98.0					1																	248524967		2200	4243	6443	SO:0001583	missense	127074	exon1			CATCCAATGGCCA	BK004464	CCDS31113.1	1q44	2012-08-09			ENSG00000196944	ENSG00000196944		"""GPCR / Class A : Olfactory receptors"""	15016	protein-coding gene	gene with protein product							Standard	NM_001004696		Approved	OR2T4Q	uc001ieh.1	Q8NH00	OTTHUMG00000040453	ENST00000366475.1:c.85A>G	1.37:g.248524967A>G	ENSP00000355431:p.Met29Val	Somatic	288	2		WXS	Illumina GAIIx	Phase_I	97	8	NM_001004696	0	0	0	0	0	Q6IEZ8	Missense_Mutation	SNP	ENST00000366475.1	37	CCDS31113.1	.	.	.	.	.	.	.	.	.	.	A	5.874	0.345427	0.11126	.	.	ENSG00000196944	ENST00000366475	T	0.01516	4.81	1.03	1.03	0.20045	.	0.000000	0.50627	D	0.000118	T	0.01254	0.0041	L	0.27053	0.805	0.09310	N	1	B	0.31435	0.323	B	0.30316	0.114	T	0.47623	-0.9103	10	0.54805	T	0.06	.	1.7485	0.02967	0.4978:0.0:0.2193:0.2829	.	29	Q8NH00	OR2T4_HUMAN	V	29	ENSP00000355431:M29V	ENSP00000355431:M29V	M	+	1	0	OR2T4	246591590	0.804000	0.28969	0.451000	0.26982	0.234000	0.25298	0.925000	0.28791	0.382000	0.24878	0.076000	0.15429	ATG	.		0.498	OR2T4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097349.2	NM_001004696	
PROSER2	254427	hgsc.bcm.edu	37	10	11912144	11912144	+	Silent	SNP	C	C	T	rs17851505	byFrequency	TCGA-OR-A5KU-01A-11D-A29I-10	TCGA-OR-A5KU-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9652ca0-126e-4332-909a-4e2d2fc489ef	68f72637-d9e1-41a6-8bd0-b4f99bbc13a1	g.chr10:11912144C>T	ENST00000277570.5	+	4	1201	c.1047C>T	c.(1045-1047)caC>caT	p.H349H	PROSER2_ENST00000379200.1_Silent_p.H153H|PROSER2-AS1_ENST00000453242.1_RNA|PROSER2-AS1_ENST00000445498.1_RNA	NM_153256.3	NP_694988.3	Q86WR7	PRSR2_HUMAN	proline and serine rich 2	349																	CAAGTGCGCACGAGGCCCTGA	0.766													C|||	360	0.071885	0.0923	0.049	5008	,	,		5950	0.001		0.0805	False		,,,				2504	0.1247				p.H349H		.											.	.	0			c.C1047T						.	C		209,2543		3,203,1170	2.0	3.0	2.0		1047	-2.8	0.7	10	dbSNP_123	2	285,5043		6,273,2385	no	coding-synonymous	C10orf47	NM_153256.3		9,476,3555	TT,TC,CC		5.3491,7.5945,6.1139		349/436	11912144	494,7586	1376	2664	4040	SO:0001819	synonymous_variant	254427	exon4			TGCGCACGAGGCC	BC017269	CCDS7085.1	10p14	2014-02-19	2014-02-19	2012-12-05	ENSG00000148426	ENSG00000148426			23728	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 47"", ""proline and serine-rich protein 2"""	C10orf47		12477932	Standard	NM_153256		Approved	MGC35403	uc001ikx.3	Q86WR7	OTTHUMG00000017673	ENST00000277570.5:c.1047C>T	10.37:g.11912144C>T		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	6	6	NM_153256	0	0	0	0	0	D3DRR8|Q5W0J9|Q5W0K0|Q5W0K1|Q5W0K2|Q6PJC8|Q8N317	Silent	SNP	ENST00000277570.5	37	CCDS7085.1																																																																																			C|0.932;T|0.068		0.766	PROSER2-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090189.2	NM_153256	
GPRIN2	9721	hgsc.bcm.edu	37	10	47000217	47000217	+	Missense_Mutation	SNP	G	G	A	rs72780221	byFrequency	TCGA-OR-A5KU-01A-11D-A29I-10	TCGA-OR-A5KU-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9652ca0-126e-4332-909a-4e2d2fc489ef	68f72637-d9e1-41a6-8bd0-b4f99bbc13a1	g.chr10:47000217G>A	ENST00000374317.1	+	3	1610	c.1337G>A	c.(1336-1338)cGc>cAc	p.R446H	GPRIN2_ENST00000374314.4_Missense_Mutation_p.R446H	NM_014696.3	NP_055511.2	O60269	GRIN2_HUMAN	G protein regulated inducer of neurite outgrowth 2	446								p.R446H(1)		breast(2)|central_nervous_system(1)|endometrium(6)|kidney(1)|large_intestine(1)|lung(6)|prostate(1)	18						TCCCTGCGGCGCCCCAGCTGC	0.716																																					p.R446H		.											.	GPRIN2-90	1	Substitution - Missense(1)	prostate(1)	c.G1337A						.						8.0	9.0	9.0					10																	47000217		2121	4098	6219	SO:0001583	missense	9721	exon3			TGCGGCGCCCCAG	BC011672	CCDS73101.1	10q11.22	2006-08-24	2006-08-24	2006-08-24	ENSG00000204175	ENSG00000204175			23730	protein-coding gene	gene with protein product		611240	"""KIAA0514"""	KIAA0514		9628581	Standard	NM_014696		Approved	MGC15171	uc001jec.3	O60269	OTTHUMG00000018107	ENST00000374317.1:c.1337G>A	10.37:g.47000217G>A	ENSP00000363436:p.Arg446His	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	15	7	NM_014696	0	0	0	0	0	Q5SVF0	Missense_Mutation	SNP	ENST00000374317.1	37	CCDS31192.1	220	0.10073260073260074	86	0.17479674796747968	30	0.08287292817679558	25	0.043706293706293704	79	0.10422163588390501	G	13.52	2.261176	0.39995	.	.	ENSG00000204175	ENST00000374317;ENST00000374314	T;T	0.26223	1.75;1.75	5.11	3.2	0.36748	.	0.744361	0.10758	N	0.637492	T	0.00073	0.0002	L	0.49350	1.555	0.09310	N	1	B	0.24533	0.105	B	0.17433	0.018	T	0.22243	-1.0222	10	0.34782	T	0.22	-0.7153	5.5226	0.16941	0.1777:0.1655:0.6568:0.0	.	446	O60269	GRIN2_HUMAN	H	446	ENSP00000363436:R446H;ENSP00000363433:R446H	ENSP00000363433:R446H	R	+	2	0	GPRIN2	46420223	0.000000	0.05858	0.420000	0.26596	0.986000	0.74619	0.143000	0.16115	0.639000	0.30564	0.561000	0.74099	CGC	G|0.901;A|0.099		0.716	GPRIN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047836.1	NM_014696	
MUC6	4588	bcgsc.ca	37	11	1017249	1017249	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5KU-01A-11D-A29I-10	TCGA-OR-A5KU-10A-01D-A29L-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9652ca0-126e-4332-909a-4e2d2fc489ef	68f72637-d9e1-41a6-8bd0-b4f99bbc13a1	g.chr11:1017249C>T	ENST00000421673.2	-	31	5602	c.5552G>A	c.(5551-5553)aGt>aAt	p.S1851N		NM_005961.2	NP_005952.2	Q6W4X9	MUC6_HUMAN	mucin 6, oligomeric mucus/gel-forming	1851	Approximate repeats.|Thr-rich.				cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular region (GO:0005576)|Golgi lumen (GO:0005796)	extracellular matrix structural constituent (GO:0005201)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(8)|kidney(10)|large_intestine(6)|lung(43)|ovary(4)|prostate(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	80		all_cancers(49;3.3e-08)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		all cancers(45;1.24e-24)|BRCA - Breast invasive adenocarcinoma(625;0.00031)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)		CGTGTGAGTACTTGGAGTCAC	0.542																																					p.S1851N		.											.	MUC6-23	0			c.G5552A						.																																			SO:0001583	missense	4588	exon31			TGAGTACTTGGAG	U97698, AY312160	CCDS44513.1	11p15.5	2008-02-05	2006-03-14		ENSG00000184956	ENSG00000184956		"""Mucins"""	7517	protein-coding gene	gene with protein product		158374	"""mucin 6, gastric"""			7680650	Standard	NM_005961		Approved		uc001lsw.2	Q6W4X9	OTTHUMG00000165140	ENST00000421673.2:c.5552G>A	11.37:g.1017249C>T	ENSP00000406861:p.Ser1851Asn	Somatic	1009	23		WXS	Illumina GAIIx	Phase_I	931	52	NM_005961	0	0	0	0	0	O15329|Q14394|Q2TUQ5|Q4L207|Q8N8I1|Q8NAK1	Missense_Mutation	SNP	ENST00000421673.2	37	CCDS44513.1	.	.	.	.	.	.	.	.	.	.	C	4.088	0.014305	0.07959	.	.	ENSG00000184956	ENST00000421673	T	0.19532	2.14	2.55	-0.458	0.12182	.	.	.	.	.	T	0.20901	0.0503	L	0.53249	1.67	0.09310	N	1	B	0.28128	0.201	B	0.38428	0.273	T	0.43410	-0.9393	9	0.15066	T	0.55	.	7.3143	0.26491	0.0:0.3432:0.4818:0.175	.	1851	Q6W4X9	MUC6_HUMAN	N	1851	ENSP00000406861:S1851N	ENSP00000406861:S1851N	S	-	2	0	MUC6	1007249	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	0.080000	0.14802	-0.083000	0.12618	-3.978000	0.00014	AGT	.		0.542	MUC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382120.2	XM_290540	
MUC2	4583	hgsc.bcm.edu	37	11	1093204	1093204	+	Missense_Mutation	SNP	C	C	A	rs56299570		TCGA-OR-A5KU-01A-11D-A29I-10	TCGA-OR-A5KU-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9652ca0-126e-4332-909a-4e2d2fc489ef	68f72637-d9e1-41a6-8bd0-b4f99bbc13a1	g.chr11:1093204C>A	ENST00000441003.2	+	30	5050	c.5023C>A	c.(5023-5025)Cca>Aca	p.P1675T	MUC2_ENST00000361558.6_Intron|MUC2_ENST00000359061.5_Missense_Mutation_p.P1642T|MUC2_ENST00000333592.6_5'Flank	NM_002457.2	NP_002448.2	Q02817	MUC2_HUMAN	mucin 2, oligomeric mucus/gel-forming	0	Approximate repeats.				cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi lumen (GO:0005796)|inner mucus layer (GO:0070702)|outer mucus layer (GO:0070703)		p.P1675T(1)|p.P1642T(1)		NS(3)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(26)|haematopoietic_and_lymphoid_tissue(4)|kidney(11)|large_intestine(5)|lung(22)|ovary(2)|prostate(16)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	102		all_cancers(49;1.08e-07)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.191)		BRCA - Breast invasive adenocarcinoma(625;0.000207)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)	Pranlukast(DB01411)	gtccccaaccccaacagccat	0.627																																					p.P1675T		.											.	MUC2-90	2	Substitution - Missense(2)	kidney(2)	c.C5023A						.																																			SO:0001583	missense	4583	exon30			CCAACCCCAACAG	L21998		11p15.5	2011-01-28	2006-03-14		ENSG00000198788	ENSG00000198788		"""Mucins"""	7512	protein-coding gene	gene with protein product		158370	"""mucin 2, intestinal/tracheal"""			15081123	Standard	NM_002457		Approved		uc001lsx.1	Q02817	OTTHUMG00000156800	ENST00000441003.2:c.5023C>A	11.37:g.1093204C>A	ENSP00000415183:p.Pro1675Thr	Somatic	59	0		WXS	Illumina GAIIx	Phase_I	78	5	NM_002457	0	0	0	0	0	Q14878	Missense_Mutation	SNP	ENST00000441003.2	37		.	.	.	.	.	.	.	.	.	.	C	0.954	-0.705464	0.03255	.	.	ENSG00000198788	ENST00000441003;ENST00000359061	T;T	0.09073	3.02;3.53	1.75	-3.49	0.04724	.	0.575351	0.10542	U	0.662513	T	0.04092	0.0114	.	.	.	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.45381	-0.9265	9	0.16896	T	0.51	.	6.9769	0.24681	0.6778:0.3222:0.0:0.0	rs56299570	1675	E7EUV1	.	T	1675;1642	ENSP00000415183:P1675T;ENSP00000351956:P1642T	ENSP00000351956:P1642T	P	+	1	0	MUC2	1083204	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	-3.268000	0.00533	-1.450000	0.01936	0.184000	0.17185	CCA	.		0.627	MUC2-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000345894.2	NM_002457	
MUC2	4583	bcgsc.ca	37	11	1093295	1093295	+	Missense_Mutation	SNP	C	C	T	rs200837746|rs200145328		TCGA-OR-A5KU-01A-11D-A29I-10	TCGA-OR-A5KU-10A-01D-A29L-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9652ca0-126e-4332-909a-4e2d2fc489ef	68f72637-d9e1-41a6-8bd0-b4f99bbc13a1	g.chr11:1093295C>T	ENST00000441003.2	+	30	5141	c.5114C>T	c.(5113-5115)aCt>aTt	p.T1705I	MUC2_ENST00000361558.6_Intron|MUC2_ENST00000359061.5_Missense_Mutation_p.T1672I|MUC2_ENST00000333592.6_5'Flank	NM_002457.2	NP_002448.2	Q02817	MUC2_HUMAN	mucin 2, oligomeric mucus/gel-forming	0	Approximate repeats.				cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi lumen (GO:0005796)|inner mucus layer (GO:0070702)|outer mucus layer (GO:0070703)		p.T1705I(1)|p.T1672I(1)		NS(3)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(26)|haematopoietic_and_lymphoid_tissue(4)|kidney(11)|large_intestine(5)|lung(22)|ovary(2)|prostate(16)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	102		all_cancers(49;1.08e-07)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.191)		BRCA - Breast invasive adenocarcinoma(625;0.000207)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)	Pranlukast(DB01411)	accaccaccactacggtgacc	0.642																																					p.T1705I		.											.	MUC2-90	2	Substitution - Missense(2)	large_intestine(2)	c.C5114T						.						113.0	161.0	144.0					11																	1093295		1882	3466	5348	SO:0001583	missense	4583	exon30			CCACCACTACGGT	L21998		11p15.5	2011-01-28	2006-03-14		ENSG00000198788	ENSG00000198788		"""Mucins"""	7512	protein-coding gene	gene with protein product		158370	"""mucin 2, intestinal/tracheal"""			15081123	Standard	NM_002457		Approved		uc001lsx.1	Q02817	OTTHUMG00000156800	ENST00000441003.2:c.5114C>T	11.37:g.1093295C>T	ENSP00000415183:p.Thr1705Ile	Somatic	126	1		WXS	Illumina GAIIx	Phase_I	113	8	NM_002457	0	0	0	0	0	Q14878	Missense_Mutation	SNP	ENST00000441003.2	37		.	.	.	.	.	.	.	.	.	.	C	0.775	-0.764347	0.02996	.	.	ENSG00000198788	ENST00000441003;ENST00000359061	T;T	0.11277	3.02;2.79	1.6	-0.698	0.11280	.	0.547305	0.11728	U	0.535177	T	0.05868	0.0153	.	.	.	0.09310	N	1	B	0.06786	0.001	B	0.01281	0.0	T	0.38457	-0.9660	9	0.34782	T	0.22	.	3.0673	0.06219	0.0:0.5189:0.2842:0.1969	.	1705	E7EUV1	.	I	1705;1672	ENSP00000415183:T1705I;ENSP00000351956:T1672I	ENSP00000351956:T1672I	T	+	2	0	MUC2	1083295	0.002000	0.14202	0.001000	0.08648	0.001000	0.01503	0.065000	0.14466	-0.392000	0.07751	-1.238000	0.01547	ACT	.		0.642	MUC2-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000345894.2	NM_002457	
MUC5B	727897	hgsc.bcm.edu	37	11	1250946	1250946	+	Missense_Mutation	SNP	T	T	A			TCGA-OR-A5KU-01A-11D-A29I-10	TCGA-OR-A5KU-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9652ca0-126e-4332-909a-4e2d2fc489ef	68f72637-d9e1-41a6-8bd0-b4f99bbc13a1	g.chr11:1250946T>A	ENST00000529681.1	+	10	1187	c.1129T>A	c.(1129-1131)Tct>Act	p.S377T	MUC5B_ENST00000531082.1_3'UTR|MUC5B_ENST00000447027.1_Missense_Mutation_p.S380T	NM_002458.2	NP_002449.2	Q9HC84	MUC5B_HUMAN	mucin 5B, oligomeric mucus/gel-forming	377	TIL 1.				cellular protein metabolic process (GO:0044267)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to glucocorticoid stimulus (GO:0071385)|cellular response to retinoic acid (GO:0071300)|epithelial cell differentiation (GO:0030855)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|response to lipopolysaccharide (GO:0032496)|response to ozone (GO:0010193)|response to sulfur dioxide (GO:0010477)|response to vitamin A (GO:0033189)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)				cervix(2)|endometrium(36)|kidney(9)|lung(89)|urinary_tract(1)	137		all_cancers(49;6.97e-08)|all_epithelial(84;3.45e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00141)|Lung(200;0.0853)|LUSC - Lung squamous cell carcinoma(625;0.1)		CATCACGCACTCTGGCTGCCT	0.692																																					p.S377T		.											.	.	0			c.T1129A						.						14.0	17.0	16.0					11																	1250946		2121	4213	6334	SO:0001583	missense	727897	exon10			ACGCACTCTGGCT	U95031, AF086604	CCDS44515.1, CCDS44515.2	11p15.5	2007-01-19	2006-03-14			ENSG00000117983		"""Mucins"""	7516	protein-coding gene	gene with protein product		600770	"""mucin 5, subtype B, tracheobronchial"""	MUC5		9804771	Standard	NM_002458		Approved	MG1	uc001lta.3	Q9HC84		ENST00000529681.1:c.1129T>A	11.37:g.1250946T>A	ENSP00000436812:p.Ser377Thr	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	25	21	NM_002458	0	0	0	0	0	O00447|O00573|O14985|O15494|O95291|O95451|Q14881|Q7M4S5|Q99552|Q9UE28	Missense_Mutation	SNP	ENST00000529681.1	37	CCDS44515.2	.	.	.	.	.	.	.	.	.	.	T	9.377	1.072017	0.20147	.	.	ENSG00000117983	ENST00000529681;ENST00000447027;ENST00000349637;ENST00000406844	T;T	0.55234	0.53;0.53	3.82	-4.96	0.03038	Protease inhibitor I8, cysteine-rich trypsin inhibitor-like (2);	.	.	.	.	T	0.25827	0.0629	N	0.12831	0.26	0.09310	N	1	B;B;B	0.30326	0.004;0.276;0.276	B;B;B	0.29267	0.006;0.1;0.1	T	0.19451	-1.0305	9	0.87932	D	0	.	1.6986	0.02867	0.3036:0.0805:0.328:0.2878	.	377;1036;380	Q9HC84;A7Y9J9;E9PBJ0	MUC5B_HUMAN;.;.	T	377;380;378;413	ENSP00000436812:S377T;ENSP00000415793:S380T	ENSP00000343037:S378T	S	+	1	0	MUC5B	1207522	0.000000	0.05858	0.000000	0.03702	0.563000	0.35712	-3.677000	0.00396	-0.942000	0.03695	0.260000	0.18958	TCT	.		0.692	MUC5B-002	NOVEL	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000390041.2	XM_001126093	
COPB1	1315	broad.mit.edu;bcgsc.ca	37	11	14490270	14490270	+	Missense_Mutation	SNP	T	T	C			TCGA-OR-A5KU-01A-11D-A29I-10	TCGA-OR-A5KU-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9652ca0-126e-4332-909a-4e2d2fc489ef	68f72637-d9e1-41a6-8bd0-b4f99bbc13a1	g.chr11:14490270T>C	ENST00000249923.3	-	16	2402	c.2102A>G	c.(2101-2103)cAg>cGg	p.Q701R	COPB1_ENST00000439561.2_Missense_Mutation_p.Q701R	NM_016451.4	NP_057535.1	P53618	COPB_HUMAN	coatomer protein complex, subunit beta 1	701					COPI coating of Golgi vesicle (GO:0048205)|intra-Golgi vesicle-mediated transport (GO:0006891)|intracellular protein transport (GO:0006886)|membrane organization (GO:0061024)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)|viral process (GO:0016032)	COPI vesicle coat (GO:0030126)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|Golgi-associated vesicle (GO:0005798)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|plasma membrane (GO:0005886)	structural molecule activity (GO:0005198)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(9)|lung(12)|ovary(1)|prostate(1)|skin(1)|stomach(1)|urinary_tract(2)	36						CTCTTTCCTCTGTGTGTTACC	0.398																																					p.Q701R		.											.	COPB1-91	0			c.A2102G						.						179.0	158.0	165.0					11																	14490270		2200	4294	6494	SO:0001583	missense	1315	exon16			TTCCTCTGTGTGT	BC037280	CCDS7815.1	11p15.2	2011-05-20	2006-06-30	2006-06-30	ENSG00000129083	ENSG00000129083			2231	protein-coding gene	gene with protein product		600959	"""coatomer protein complex, subunit beta"""	COPB		7982906	Standard	NM_016451		Approved		uc001mlg.2	P53618	OTTHUMG00000165824	ENST00000249923.3:c.2102A>G	11.37:g.14490270T>C	ENSP00000249923:p.Gln701Arg	Somatic	97	0		WXS	Illumina GAIIx	Phase_I	79	5	NM_001144062	0	0	35	36	1	D3DQX0|Q6GTT7|Q9NTK2|Q9UNW7	Missense_Mutation	SNP	ENST00000249923.3	37	CCDS7815.1	.	.	.	.	.	.	.	.	.	.	T	12.97	2.096167	0.36952	.	.	ENSG00000129083	ENST00000249923;ENST00000439561	T;T	0.43294	0.95;0.95	5.33	5.33	0.75918	Coatomer, beta subunit, C-terminal (1);	0.000000	0.85682	D	0.000000	T	0.23410	0.0566	N	0.04880	-0.145	0.80722	D	1	B	0.02656	0.0	B	0.04013	0.001	T	0.08249	-1.0731	10	0.18276	T	0.48	.	15.2948	0.73894	0.0:0.0:0.0:1.0	.	701	P53618	COPB_HUMAN	R	701	ENSP00000249923:Q701R;ENSP00000397873:Q701R	ENSP00000249923:Q701R	Q	-	2	0	COPB1	14446846	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.749000	0.85096	2.021000	0.59480	0.533000	0.62120	CAG	.		0.398	COPB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000386410.1	NM_016451	
INSC	387755	bcgsc.ca	37	11	15199912	15199912	+	Missense_Mutation	SNP	G	G	T	rs199801018	byFrequency	TCGA-OR-A5KU-01A-11D-A29I-10	TCGA-OR-A5KU-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9652ca0-126e-4332-909a-4e2d2fc489ef	68f72637-d9e1-41a6-8bd0-b4f99bbc13a1	g.chr11:15199912G>T	ENST00000379554.3	+	5	685	c.639G>T	c.(637-639)aaG>aaT	p.K213N	INSC_ENST00000528567.1_Missense_Mutation_p.K166N|INSC_ENST00000525218.1_Missense_Mutation_p.K166N|INSC_ENST00000530161.1_Missense_Mutation_p.K166N|INSC_ENST00000379556.3_Missense_Mutation_p.K166N|INSC_ENST00000424273.1_Missense_Mutation_p.K166N	NM_001031853.3	NP_001027024.3	Q1MX18	INSC_HUMAN	inscuteable homolog (Drosophila)	213					establishment of mitotic spindle orientation (GO:0000132)|lung epithelial cell differentiation (GO:0060487)|nervous system development (GO:0007399)	apical part of cell (GO:0045177)|cytoplasm (GO:0005737)				NS(2)|breast(1)|central_nervous_system(2)|endometrium(6)|kidney(4)|large_intestine(3)|lung(24)|ovary(3)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	49						AGTCAATGAAGGCCTGCGTGA	0.582													G|||	2	0.000399361	0.0	0.0014	5008	,	,		19638	0.0		0.001	False		,,,				2504	0.0				p.K213N		.											.	INSC-94	0			c.G639T						.	G	ASN/LYS,ASN/LYS	3,3973		0,3,1985	104.0	103.0	103.0		639,498	3.5	1.0	11		103	20,8290		1,18,4136	yes	missense,missense	INSC	NM_001031853.3,NM_001042536.1	94,94	1,21,6121	TT,TG,GG		0.2407,0.0755,0.1872	probably-damaging,probably-damaging	213/580,166/533	15199912	23,12263	1988	4155	6143	SO:0001583	missense	387755	exon5			AATGAAGGCCTGC	AB231744	CCDS41621.1, CCDS41622.1, CCDS60735.1, CCDS60736.1	11p15.2	2014-02-05			ENSG00000188487	ENSG00000188487			33116	protein-coding gene	gene with protein product	"""inscuteable spindle orientation adaptor protein"""	610668				16458856	Standard	NM_001031853		Approved		uc001mly.4	Q1MX18	OTTHUMG00000165838	ENST00000379554.3:c.639G>T	11.37:g.15199912G>T	ENSP00000368872:p.Lys213Asn	Somatic	40	0		WXS	Illumina GAIIx	Phase_I	53	4	NM_001031853	0	0	0	0	0	A0PJX5|Q1MX19|Q3C1V6|Q4AC95|Q4AC96|Q4AC97|Q4AC98	Missense_Mutation	SNP	ENST00000379554.3	37	CCDS41621.1	2	9.157509157509158E-4	0	0.0	1	0.0027624309392265192	0	0.0	1	0.0013192612137203166	G	17.04	3.287523	0.59976	7.55E-4	0.002407	ENSG00000188487	ENST00000379554;ENST00000379556;ENST00000424273;ENST00000416761;ENST00000528567;ENST00000530161;ENST00000525218	T;T;T;T;T;T	0.44881	1.25;1.27;0.91;1.24;1.27;0.91	5.41	3.55	0.40652	Armadillo-like helical (1);Armadillo-type fold (1);	0.046012	0.85682	D	0.000000	T	0.54481	0.1861	L	0.56769	1.78	0.42079	D	0.991248	D;D;D;D	0.76494	0.999;0.996;0.999;0.999	D;P;D;D	0.70487	0.969;0.876;0.935;0.935	T	0.54364	-0.8305	10	0.72032	D	0.01	-38.2965	7.0151	0.24883	0.3808:0.0:0.6192:0.0	.	166;166;166;213	Q1MX18-5;Q1MX18-4;A0PJX5;Q1MX18	.;.;.;INSC_HUMAN	N	213;166;166;166;166;166;166	ENSP00000368872:K213N;ENSP00000368874:K166N;ENSP00000389161:K166N;ENSP00000435022:K166N;ENSP00000436194:K166N;ENSP00000436113:K166N	ENSP00000368872:K213N	K	+	3	2	INSC	15156488	1.000000	0.71417	1.000000	0.80357	0.907000	0.53573	2.020000	0.41010	0.671000	0.31185	-0.219000	0.12488	AAG	G|0.999;T|0.001		0.582	INSC-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000386590.1	NM_001031853	
LGALS12	85329	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	63276354	63276354	+	Missense_Mutation	SNP	A	A	G			TCGA-OR-A5KU-01A-11D-A29I-10	TCGA-OR-A5KU-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9652ca0-126e-4332-909a-4e2d2fc489ef	68f72637-d9e1-41a6-8bd0-b4f99bbc13a1	g.chr11:63276354A>G	ENST00000394618.3	+	3	620	c.329A>G	c.(328-330)aAc>aGc	p.N110S	LGALS12_ENST00000340246.5_Missense_Mutation_p.N111S|LGALS12_ENST00000425950.2_Missense_Mutation_p.N49S|LGALS12_ENST00000255684.5_Missense_Mutation_p.N110S|LGALS12_ENST00000415491.2_Missense_Mutation_p.N49S	NM_001142535.1|NM_033101.3	NP_001136007.1|NP_149092.2	Q96DT0	LEG12_HUMAN	lectin, galactoside-binding, soluble, 12	110	Galectin 1. {ECO:0000255|PROSITE- ProRule:PRU00639}.				intrinsic apoptotic signaling pathway (GO:0097193)	nucleus (GO:0005634)	lactose binding (GO:0030395)			breast(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(5)|ovary(2)|upper_aerodigestive_tract(1)	16						GTCATCTGCAACACCCTGCAT	0.612																																					p.N111S		.											.	LGALS12-92	0			c.A332G						.						80.0	79.0	79.0					11																	63276354		2201	4298	6499	SO:0001583	missense	85329	exon3			TCTGCAACACCCT	AF222695	CCDS8045.1, CCDS44633.1, CCDS44634.1, CCDS44635.1, CCDS53648.1	11q13	2011-08-04	2008-07-25		ENSG00000133317	ENSG00000133317		"""Lectins, galactoside-binding"""	15788	protein-coding gene	gene with protein product	"""galectin 12"""	606096				11283015, 11435439	Standard	NM_033101		Approved	GRIP1	uc001nxc.2	Q96DT0	OTTHUMG00000167807	ENST00000394618.3:c.329A>G	11.37:g.63276354A>G	ENSP00000378116:p.Asn110Ser	Somatic	112	0		WXS	Illumina GAIIx	Phase_I	133	36	NM_001142535	0	0	0	0	0	B2R9N2|G5E970|Q96DS9|Q96PR9|Q9H258|Q9H259|Q9NZ02	Missense_Mutation	SNP	ENST00000394618.3	37	CCDS8045.1	.	.	.	.	.	.	.	.	.	.	A	16.98	3.271019	0.59540	.	.	ENSG00000133317	ENST00000255684;ENST00000394618;ENST00000340246;ENST00000415491;ENST00000425950	T;T;T;T;T	0.34072	2.16;2.16;1.38;2.16;2.16	5.63	5.63	0.86233	Concanavalin A-like lectin/glucanase (1);Galectin, carbohydrate recognition domain (4);Concanavalin A-like lectin/glucanase, subgroup (1);	0.000000	0.64402	D	0.000003	T	0.71962	0.3402	H	0.96662	3.86	0.40030	D	0.975517	D;D;D;D	0.89917	0.996;0.998;1.0;0.986	P;P;D;P	0.72338	0.908;0.903;0.977;0.782	T	0.82583	-0.0385	10	0.87932	D	0	-28.4029	14.0959	0.65021	1.0:0.0:0.0:0.0	.	70;111;110;110	Q9NZ03;G5E970;Q96DT0-3;Q96DT0	.;.;.;LEG12_HUMAN	S	110;110;111;49;49	ENSP00000255684:N110S;ENSP00000378116:N110S;ENSP00000339374:N111S;ENSP00000394659:N49S;ENSP00000399093:N49S	ENSP00000255684:N110S	N	+	2	0	LGALS12	63032930	1.000000	0.71417	1.000000	0.80357	0.460000	0.32559	5.591000	0.67536	2.279000	0.76181	0.533000	0.62120	AAC	.		0.612	LGALS12-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000396378.1	NM_033101	
LOC100996455	100996455	bcgsc.ca	37	11	64217564	64217564	+	Missense_Mutation	SNP	G	G	T			TCGA-OR-A5KU-01A-11D-A29I-10	TCGA-OR-A5KU-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9652ca0-126e-4332-909a-4e2d2fc489ef	68f72637-d9e1-41a6-8bd0-b4f99bbc13a1	g.chr11:64217564G>T	ENST00000316124.2	+	2	775	c.304G>T	c.(304-306)Gct>Tct	p.A102S																								gggatgcccggctcgtttaat	0.587																																					.		.											.	.	0			.						.																																			SO:0001583	missense	0	.			TGCCCGGCTCGTT																												ENST00000316124.2:c.304G>T	11.37:g.64217564G>T	ENSP00000325219:p.Ala102Ser	Somatic	102	0		WXS	Illumina GAIIx	Phase_I	98	5	.	0	0	2	2	0		RNA	SNP	ENST00000316124.2	37		.	.	.	.	.	.	.	.	.	.	G	5.835	0.338293	0.11069	.	.	ENSG00000181908	ENST00000316124	.	.	.	2.26	0.177	0.15054	.	.	.	.	.	T	0.37489	0.1005	.	.	.	.	.	.	.	.	.	.	.	.	T	0.47341	-0.9125	4	0.87932	D	0	.	3.3789	0.07247	0.1682:0.273:0.5588:0.0	.	.	.	.	S	102	.	ENSP00000325219:A102S	A	+	1	0	AP003774.4	63974140	0.001000	0.12720	0.002000	0.10522	0.003000	0.03518	-0.058000	0.11750	0.049000	0.15920	0.563000	0.77884	GCT	.		0.587	AP003774.4-001	PUTATIVE	basic|appris_principal|exp_conf	protein_coding	protein_coding	OTTHUMT00000106328.2		
EHBP1L1	254102	broad.mit.edu;bcgsc.ca	37	11	65358004	65358004	+	Missense_Mutation	SNP	G	G	T			TCGA-OR-A5KU-01A-11D-A29I-10	TCGA-OR-A5KU-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9652ca0-126e-4332-909a-4e2d2fc489ef	68f72637-d9e1-41a6-8bd0-b4f99bbc13a1	g.chr11:65358004G>T	ENST00000309295.4	+	16	4489	c.4224G>T	c.(4222-4224)tgG>tgT	p.W1408C	EHBP1L1_ENST00000533364.1_5'Flank	NM_001099409.1	NP_001092879.1	Q8N3D4	EH1L1_HUMAN	EH domain binding protein 1-like 1	1408						membrane (GO:0016020)				central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(3)|lung(6)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)	23						TCCAGGAGTGGTTCACCCTGG	0.632																																					p.W1408C		.											.	EHBP1L1-69	0			c.G4224T						.						73.0	82.0	79.0					11																	65358004		2130	4238	6368	SO:0001583	missense	254102	exon16			GGAGTGGTTCACC	AL834433	CCDS44649.1	11q13.1	2008-02-05			ENSG00000173442	ENSG00000173442			30682	protein-coding gene	gene with protein product							Standard	NM_001099409		Approved	DKFZp762C186, TANGERIN	uc001oeo.4	Q8N3D4	OTTHUMG00000166520	ENST00000309295.4:c.4224G>T	11.37:g.65358004G>T	ENSP00000312671:p.Trp1408Cys	Somatic	60	0		WXS	Illumina GAIIx	Phase_I	48	5	NM_001099409	0	0	2	2	0	Q8TB89|Q9H7M7	Missense_Mutation	SNP	ENST00000309295.4	37	CCDS44649.1	.	.	.	.	.	.	.	.	.	.	G	20.5	3.999321	0.74818	.	.	ENSG00000173442	ENST00000309295	T	0.56941	0.43	4.3	4.3	0.51218	Domain of unknown function DUF3585 (1);	0.000000	0.64402	D	0.000003	T	0.76550	0.4003	M	0.89601	3.045	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.82388	-0.0482	10	0.87932	D	0	.	14.3155	0.66446	0.0:0.0:1.0:0.0	.	1408	Q8N3D4	EH1L1_HUMAN	C	1408	ENSP00000312671:W1408C	ENSP00000312671:W1408C	W	+	3	0	EHBP1L1	65114580	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	8.396000	0.90190	2.243000	0.73865	0.514000	0.50259	TGG	.		0.632	EHBP1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390145.1	XM_170658	
CCDC67	159989	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	93088643	93088643	+	Nonsense_Mutation	SNP	C	C	T	rs374648091		TCGA-OR-A5KU-01A-11D-A29I-10	TCGA-OR-A5KU-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9652ca0-126e-4332-909a-4e2d2fc489ef	68f72637-d9e1-41a6-8bd0-b4f99bbc13a1	g.chr11:93088643C>T	ENST00000298050.3	+	3	236	c.136C>T	c.(136-138)Cga>Tga	p.R46*	CCDC67_ENST00000527307.1_Nonsense_Mutation_p.R46*|CCDC67_ENST00000530053.1_3'UTR	NM_181645.3	NP_857596.2	Q05D60	DEUP1_HUMAN	coiled-coil domain containing 67	46					cell projection organization (GO:0030030)|de novo centriole assembly (GO:0098535)	cytoplasm (GO:0005737)|deuterosome (GO:0098536)				endometrium(3)|kidney(1)|large_intestine(1)|lung(10)|ovary(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	22		Acute lymphoblastic leukemia(157;2.35e-05)|all_hematologic(158;0.00824)				TTTGGAGACACGATTAGATCT	0.388																																					p.R46X		.											.	CCDC67-91	0			c.C136T						.						105.0	107.0	106.0					11																	93088643		1879	4099	5978	SO:0001587	stop_gained	159989	exon3			GAGACACGATTAG	AK058122	CCDS44707.1	11q21	2014-02-20				ENSG00000165325			26344	protein-coding gene	gene with protein product						24240477	Standard	NM_181645		Approved	FLJ25393	uc001pdq.3	Q05D60		ENST00000298050.3:c.136C>T	11.37:g.93088643C>T	ENSP00000298050:p.Arg46*	Somatic	150	0		WXS	Illumina GAIIx	Phase_I	119	84	NM_181645	0	0	0	0	0	Q8NEF1|Q96LL7	Nonsense_Mutation	SNP	ENST00000298050.3	37	CCDS44707.1	.	.	.	.	.	.	.	.	.	.	C	25.5	4.645274	0.87859	.	.	ENSG00000165325	ENST00000534747;ENST00000298050;ENST00000532819;ENST00000527307	.	.	.	5.54	1.18	0.20946	.	0.445552	0.20432	N	0.092454	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.05833	T	0.94	.	5.1073	0.14790	0.4125:0.4189:0.0919:0.0768	.	.	.	.	X	46	.	ENSP00000298050:R46X	R	+	1	2	CCDC67	92728291	0.998000	0.40836	0.995000	0.50966	0.994000	0.84299	1.260000	0.32968	0.656000	0.30886	0.491000	0.48974	CGA	.		0.388	CCDC67-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_181645	
PTS	5805	broad.mit.edu	37	11	112097182	112097182	+	Missense_Mutation	SNP	G	G	T			TCGA-OR-A5KU-01A-11D-A29I-10	TCGA-OR-A5KU-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9652ca0-126e-4332-909a-4e2d2fc489ef	68f72637-d9e1-41a6-8bd0-b4f99bbc13a1	g.chr11:112097182G>T	ENST00000280362.3	+	1	95	c.16G>T	c.(16-18)Ggt>Tgt	p.G6C	PTS_ENST00000525803.1_Missense_Mutation_p.G6C|PTS_ENST00000524931.1_5'Flank	NM_000317.2	NP_000308.1	Q03393	PTPS_HUMAN	6-pyruvoyltetrahydropterin synthase	6					cellular amino acid metabolic process (GO:0006520)|central nervous system development (GO:0007417)|nitric oxide metabolic process (GO:0046209)|regulation of nitric-oxide synthase activity (GO:0050999)|small molecule metabolic process (GO:0044281)|tetrahydrobiopterin biosynthetic process (GO:0006729)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|mitochondrion (GO:0005739)	6-pyruvoyltetrahydropterin synthase activity (GO:0003874)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)			breast(1)|large_intestine(1)	2		all_cancers(61;2.51e-14)|all_epithelial(67;1.64e-08)|Melanoma(852;8.81e-06)|all_hematologic(158;0.000405)|Acute lymphoblastic leukemia(157;0.000967)|Breast(348;0.0112)|all_neural(223;0.0281)|Medulloblastoma(222;0.0425)		Epithelial(105;1.27e-06)|BRCA - Breast invasive adenocarcinoma(274;1.43e-06)|all cancers(92;2.1e-05)|OV - Ovarian serous cystadenocarcinoma(223;0.0519)		CACGGAAGGTGGTGGCCGTCG	0.716																																					p.G6C		.											.	PTS-90	0			c.G16T						.						23.0	20.0	21.0					11																	112097182		2171	4244	6415	SO:0001583	missense	5805	exon1			GAAGGTGGTGGCC	U63382	CCDS8359.1	11q22.3	2014-04-01				ENSG00000150787	4.2.3.12		9689	protein-coding gene	gene with protein product		612719				8188266	Standard	NM_000317		Approved	PTPS	uc001pnj.4	Q03393		ENST00000280362.3:c.16G>T	11.37:g.112097182G>T	ENSP00000280362:p.Gly6Cys	Somatic	33	0		WXS	Illumina GAIIx	Phase_I	142	4	NM_000317	0	0	30	30	0	B0YJ87|Q8WVG8	Missense_Mutation	SNP	ENST00000280362.3	37	CCDS8359.1	.	.	.	.	.	.	.	.	.	.	G	12.67	2.008589	0.35415	.	.	ENSG00000150787	ENST00000280362;ENST00000525803	D;D	0.99445	-5.91;-4.52	4.36	-8.72	0.00845	.	1.419100	0.04574	N	0.393763	D	0.96393	0.8823	N	0.14661	0.345	0.09310	N	0.999996	B	0.02656	0.0	B	0.01281	0.0	D	0.93600	0.6929	10	0.54805	T	0.06	-18.4996	7.0276	0.24948	0.0921:0.5063:0.2926:0.1091	.	6	Q03393	PTPS_HUMAN	C	6	ENSP00000280362:G6C;ENSP00000431750:G6C	ENSP00000280362:G6C	G	+	1	0	PTS	111602392	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-1.707000	0.01893	-2.695000	0.00402	-0.867000	0.03001	GGT	.		0.716	PTS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393541.1	NM_000317	
AICDA	57379	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	8759524	8759524	+	Silent	SNP	G	G	A			TCGA-OR-A5KU-01A-11D-A29I-10	TCGA-OR-A5KU-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9652ca0-126e-4332-909a-4e2d2fc489ef	68f72637-d9e1-41a6-8bd0-b4f99bbc13a1	g.chr12:8759524G>A	ENST00000229335.6	-	2	196	c.93C>T	c.(91-93)taC>taT	p.Y31Y	AICDA_ENST00000537228.1_Silent_p.Y31Y	NM_020661.2	NP_065712.1	Q9GZX7	AICDA_HUMAN	activation-induced cytidine deaminase	31					B cell differentiation (GO:0030183)|cellular response to lipopolysaccharide (GO:0071222)|DNA demethylation (GO:0080111)|isotype switching (GO:0045190)|mRNA processing (GO:0006397)|negative regulation of methylation-dependent chromatin silencing (GO:0090310)|somatic diversification of immunoglobulins (GO:0016445)|somatic hypermutation of immunoglobulin genes (GO:0016446)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	cytidine deaminase activity (GO:0004126)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(4)|ovary(2)|pancreas(1)	16	Lung SC(5;0.184)					TCTTCACTACGTAGCACAGGT	0.473																																					p.Y31Y	GBM(62;896 1067 5527 26594 30137)	.											.	AICDA-229	0			c.C93T	GRCh37	CM064965	AICDA	M		.						84.0	80.0	81.0					12																	8759524		1960	4148	6108	SO:0001819	synonymous_variant	57379	exon2			CACTACGTAGCAC	AB040430	CCDS41747.1	12p13	2014-09-17			ENSG00000111732	ENSG00000111732		"""Apolipoprotein B mRNA editing enzymes"""	13203	protein-coding gene	gene with protein product		605257					Standard	NM_020661		Approved	HIGM2, CDA2, ARP2, AID	uc001qur.2	Q9GZX7	OTTHUMG00000168676	ENST00000229335.6:c.93C>T	12.37:g.8759524G>A		Somatic	133	0		WXS	Illumina GAIIx	Phase_I	217	110	NM_020661	0	0	0	0	0	Q6QJ81|Q8NFC1	Silent	SNP	ENST00000229335.6	37	CCDS41747.1	.	.	.	.	.	.	.	.	.	.	g	9.641	1.139088	0.21205	.	.	ENSG00000111732	ENST00000543081;ENST00000544516;ENST00000545512	.	.	.	5.36	-6.38	0.01957	.	.	.	.	.	T	0.62696	0.2449	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.65582	-0.6133	4	.	.	.	-24.8465	15.3664	0.74526	0.5478:0.0:0.4522:0.0	.	.	.	.	M	30	.	.	T	-	2	0	AICDA	8650791	0.001000	0.12720	0.896000	0.35187	0.951000	0.60555	-1.257000	0.02866	-1.218000	0.02601	-0.592000	0.04112	ACG	.		0.473	AICDA-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000400575.1	NM_020661	
PKP2	5318	hgsc.bcm.edu	37	12	33049590	33049590	+	Missense_Mutation	SNP	C	C	T	rs143004808	byFrequency	TCGA-OR-A5KU-01A-11D-A29I-10	TCGA-OR-A5KU-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9652ca0-126e-4332-909a-4e2d2fc489ef	68f72637-d9e1-41a6-8bd0-b4f99bbc13a1	g.chr12:33049590C>T	ENST00000070846.6	-	1	100	c.76G>A	c.(76-78)Gac>Aac	p.D26N	PKP2_ENST00000546741.1_5'Flank|PKP2_ENST00000340811.4_Missense_Mutation_p.D26N	NM_004572.3	NP_004563.2	Q99959	PKP2_HUMAN	plakophilin 2	26			D -> N (associated with increased susceptibility to arrhythmogenic right ventricular cardiomyopathy; dbSNP:rs143004808). {ECO:0000269|PubMed:19955750, ECO:0000269|PubMed:20031617}.		adherens junction maintenance (GO:0034334)|bundle of His cell to Purkinje myocyte communication (GO:0086069)|cardiac muscle cell action potential (GO:0086001)|cardiac muscle cell action potential involved in contraction (GO:0086002)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cell-cell signaling involved in cardiac conduction (GO:0086019)|desmosome assembly (GO:0002159)|gap junction assembly (GO:0016264)|heart development (GO:0007507)|intermediate filament bundle assembly (GO:0045110)|lipid homeostasis (GO:0055088)|maintenance of organ identity (GO:0048496)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|positive regulation of sodium ion transport (GO:0010765)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of tight junction assembly (GO:2000810)|single organismal cell-cell adhesion (GO:0016337)|ventricular cardiac muscle cell action potential (GO:0086005)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)	adherens junction (GO:0005912)|cell junction (GO:0030054)|cell-cell junction (GO:0005911)|desmosome (GO:0030057)|integral component of membrane (GO:0016021)|intercalated disc (GO:0014704)|intermediate filament (GO:0005882)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	intermediate filament binding (GO:0019215)|ion channel binding (GO:0044325)|protein complex scaffold (GO:0032947)|protein kinase C binding (GO:0005080)|sodium channel regulator activity (GO:0017080)			NS(1)|breast(2)|endometrium(1)|kidney(9)|large_intestine(8)|lung(21)|ovary(1)|pancreas(2)|prostate(2)|skin(2)|urinary_tract(1)	50	Lung NSC(5;9.35e-07)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.0429)|Esophageal squamous(101;0.239)					CTGGAGCTGTCCAGTTGTCCC	0.716													C|||	15	0.00299521	0.0008	0.0014	5008	,	,		8671	0.0		0.0109	False		,,,				2504	0.002				p.D26N		.											.	PKP2-92	0			c.G76A	GRCh37	CM061172	PKP2	M	rs143004808	.	C	ASN/ASP,ASN/ASP	4,4140		0,4,2068	7.0	7.0	7.0		76,76	4.1	1.0	12	dbSNP_134	7	56,8144		0,56,4044	no	missense,missense	PKP2	NM_001005242.2,NM_004572.3	23,23	0,60,6112	TT,TC,CC		0.6829,0.0965,0.4861	possibly-damaging,possibly-damaging	26/838,26/882	33049590	60,12284	2072	4100	6172	SO:0001583	missense	5318	exon1			AGCTGTCCAGTTG	X97675	CCDS8731.1, CCDS31771.1	12p11	2014-09-17				ENSG00000057294		"""Armadillo repeat containing"""	9024	protein-coding gene	gene with protein product		602861				8922383	Standard	NM_001005242		Approved		uc001rlj.4	Q99959	OTTHUMG00000169500	ENST00000070846.6:c.76G>A	12.37:g.33049590C>T	ENSP00000070846:p.Asp26Asn	Somatic	2	0		WXS	Illumina GAIIx	Phase_I	20	13	NM_004572	0	0	2	2	0	A0AV37|B8QFA1|B8QGS6|B8QGS7|D3DUW9|Q4VC01|Q99960	Missense_Mutation	SNP	ENST00000070846.6	37	CCDS8731.1	6	0.0027472527472527475	0	0.0	0	0.0	0	0.0	6	0.0079155672823219	C	33	5.290752	0.95546	9.65E-4	0.006829	ENSG00000057294	ENST00000340811;ENST00000070846;ENST00000537278	D;D	0.83591	-1.74;-1.72	4.07	4.07	0.47477	.	0.127072	0.34802	N	0.003678	T	0.79822	0.4512	L	0.29908	0.895	0.47659	D	0.999482	D;D;D	0.63046	0.992;0.986;0.986	P;P;P	0.60415	0.874;0.751;0.859	D	0.83985	0.0334	10	0.54805	T	0.06	-24.6581	15.4098	0.74908	0.0:1.0:0.0:0.0	.	26;26;26	Q99959-2;A0AV37;Q99959	.;.;PKP2_HUMAN	N	26	ENSP00000342800:D26N;ENSP00000070846:D26N	ENSP00000070846:D26N	D	-	1	0	PKP2	32940857	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	3.560000	0.53763	2.081000	0.62600	0.491000	0.48974	GAC	C|0.997;T|0.003		0.716	PKP2-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000404449.1	NM_004572	
KRT76	51350	broad.mit.edu	37	12	53162773	53162775	+	In_Frame_Del	DEL	ACT	ACT	-	rs1464423|rs370657661|rs576463918|rs201384439	byFrequency	TCGA-OR-A5KU-01A-11D-A29I-10	TCGA-OR-A5KU-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9652ca0-126e-4332-909a-4e2d2fc489ef	68f72637-d9e1-41a6-8bd0-b4f99bbc13a1	g.chr12:53162773_53162775delACT	ENST00000332411.2	-	9	1692_1694	c.1639_1641delAGT	c.(1639-1641)agtdel	p.S547del		NM_015848.4	NP_056932.2	Q01546	K22O_HUMAN	keratin 76	547	Tail.				cytoskeleton organization (GO:0007010)	extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)|keratin filament (GO:0045095)|nucleus (GO:0005634)	structural molecule activity (GO:0005198)	p.S547_G548insS(1)		breast(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(10)|prostate(1)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	27						ctccatagccactgctgctgctg	0.635																																					p.547_547del		.											.	KRT76-154	1	Insertion - In frame(1)	prostate(1)	c.1639_1641del						.																																			SO:0001651	inframe_deletion	51350	exon9			ATAGCCACTGCTG	M99063	CCDS8838.1	12q13.13	2013-06-25			ENSG00000185069	ENSG00000185069		"""-"", ""Intermediate filaments type II, keratins (basic)"""	24430	protein-coding gene	gene with protein product						1282112, 16831889	Standard	NM_015848		Approved	HUMCYT2A, KRT2B, KRT2P	uc001sax.3	Q01546	OTTHUMG00000169797	ENST00000332411.2:c.1639_1641delAGT	12.37:g.53162773_53162775delACT	ENSP00000330101:p.Ser547del	Somatic	77	0		WXS	Illumina GAIIx	Phase_I	154	8	NM_015848	0	0	0	0	0	B4DRR3|Q7Z795	In_Frame_Del	DEL	ENST00000332411.2	37	CCDS8838.1																																																																																			.		0.635	KRT76-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405928.1	NM_015848	
KRT8	3856	broad.mit.edu	37	12	53298675	53298675	+	Missense_Mutation	SNP	A	A	C			TCGA-OR-A5KU-01A-11D-A29I-10	TCGA-OR-A5KU-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9652ca0-126e-4332-909a-4e2d2fc489ef	68f72637-d9e1-41a6-8bd0-b4f99bbc13a1	g.chr12:53298675A>C	ENST00000552551.1	-	2	523	c.91T>G	c.(91-93)Tcc>Gcc	p.S31A	KRT8_ENST00000546897.1_Missense_Mutation_p.S31A|KRT8_ENST00000293308.6_Missense_Mutation_p.S31A|KRT8_ENST00000552150.1_Missense_Mutation_p.S59A			P05787	K2C8_HUMAN	keratin 8	31	Head.|Ser-rich.				cell differentiation involved in embryonic placenta development (GO:0060706)|extrinsic apoptotic signaling pathway (GO:0097191)|hepatocyte apoptotic process (GO:0097284)|response to hydrostatic pressure (GO:0051599)|response to other organism (GO:0051707)|sarcomere organization (GO:0045214)|tumor necrosis factor-mediated signaling pathway (GO:0033209)|viral process (GO:0016032)	cell-cell junction (GO:0005911)|costamere (GO:0043034)|cytoplasm (GO:0005737)|dystrophin-associated glycoprotein complex (GO:0016010)|extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)|keratin filament (GO:0045095)|nucleus (GO:0005634)|sarcolemma (GO:0042383)|Z disc (GO:0030018)	scaffold protein binding (GO:0097110)|structural molecule activity (GO:0005198)	p.S31A(4)		endometrium(5)|large_intestine(1)|liver(1)|lung(3)|ovary(1)|prostate(1)|skin(1)	13				BRCA - Breast invasive adenocarcinoma(357;0.108)	Tenecteplase(DB00031)	CTGATGCGGGAACCGGGCCCA	0.662																																					p.S59A		.											.	KRT8-92	4	Substitution - Missense(4)	endometrium(2)|prostate(1)|liver(1)	c.T175G						.						12.0	14.0	13.0					12																	53298675		2120	4158	6278	SO:0001583	missense	3856	exon2			TGCGGGAACCGGG	BC000654	CCDS8841.1, CCDS58234.1	12q13.13	2013-01-16			ENSG00000170421	ENSG00000170421		"""-"", ""Intermediate filaments type II, keratins (basic)"""	6446	protein-coding gene	gene with protein product		148060				2434381, 1705144, 16831889	Standard	NM_002273		Approved	CARD2, K8, CK8, CYK8, K2C8, KO	uc009zmk.1	P05787	OTTHUMG00000169881	ENST00000552551.1:c.91T>G	12.37:g.53298675A>C	ENSP00000447566:p.Ser31Ala	Somatic	46	0		WXS	Illumina GAIIx	Phase_I	130	4	NM_001256282	0	0	0	0	0	A8K4H3|B0AZN5|F8VXB4|Q14099|Q14716|Q14717|Q53GJ0|Q6DHW5|Q6GMY0|Q6P4C7|Q96J60	Missense_Mutation	SNP	ENST00000552551.1	37	CCDS8841.1	.	.	.	.	.	.	.	.	.	.	-	0.012	-1.651707	0.00785	.	.	ENSG00000170421	ENST00000552551;ENST00000293308;ENST00000547916;ENST00000546897;ENST00000552150;ENST00000546826;ENST00000548998;ENST00000547413;ENST00000546542	T;T;T;T;T;T;T;T	0.80393	-1.37;-1.37;-1.37;-1.37;-1.37;-1.37;-1.37;-1.37	4.05	-8.11	0.01082	.	0.706613	0.13676	N	0.370518	T	0.40619	0.1124	N	0.01197	-0.965	0.09310	N	1	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.04013	0.001;0.001;0.0	T	0.43589	-0.9382	10	0.05351	T	0.99	.	6.5956	0.22672	0.4212:0.312:0.0:0.2668	.	59;31;31	F8VXB4;F8VU64;P05787	.;.;K2C8_HUMAN	A	31;31;31;31;59;31;71;31;109	ENSP00000447566:S31A;ENSP00000293308:S31A;ENSP00000447402:S31A;ENSP00000449404:S59A;ENSP00000447881:S31A;ENSP00000447040:S71A;ENSP00000448681:S31A;ENSP00000450228:S109A	ENSP00000293308:S31A	S	-	1	0	KRT8	51584942	0.005000	0.15991	0.000000	0.03702	0.065000	0.16274	-0.018000	0.12568	-3.264000	0.00201	-0.290000	0.09829	TCC	.		0.662	KRT8-001	KNOWN	alternative_5_UTR|overlapping_uORF|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406385.1	NM_002273	
NAV3	89795	broad.mit.edu;bcgsc.ca	37	12	78392165	78392165	+	Silent	SNP	C	C	G			TCGA-OR-A5KU-01A-11D-A29I-10	TCGA-OR-A5KU-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9652ca0-126e-4332-909a-4e2d2fc489ef	68f72637-d9e1-41a6-8bd0-b4f99bbc13a1	g.chr12:78392165C>G	ENST00000397909.2	+	7	962	c.789C>G	c.(787-789)gtC>gtG	p.V263V	NAV3_ENST00000228327.6_Silent_p.V263V|NAV3_ENST00000536525.2_Silent_p.V263V|NAV3_ENST00000266692.7_Silent_p.V263V			Q8IVL0	NAV3_HUMAN	neuron navigator 3	263						membrane (GO:0016020)|nuclear envelope (GO:0005635)				NS(2)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(13)|kidney(16)|large_intestine(39)|liver(2)|lung(126)|ovary(5)|pancreas(3)|prostate(6)|skin(5)|stomach(2)|upper_aerodigestive_tract(8)|urinary_tract(1)	236						GCAGCAAGGTCCAGGGAGCCT	0.398										HNSCC(70;0.22)																											p.V263V		.											.	NAV3-279	0			c.C789G						.						50.0	46.0	48.0					12																	78392165		1818	4080	5898	SO:0001819	synonymous_variant	89795	exon7			CAAGGTCCAGGGA	AB023155	CCDS41815.1, CCDS66432.1	12q14.3	2008-08-05				ENSG00000067798			15998	protein-coding gene	gene with protein product	"""pore membrane and/or filament interacting like protein 1"", ""steerin 3"""	611629				12079279, 12062803	Standard	XM_005269215		Approved	KIAA0938, POMFIL1	uc001syo.3	Q8IVL0	OTTHUMG00000170001	ENST00000397909.2:c.789C>G	12.37:g.78392165C>G		Somatic	81	0		WXS	Illumina GAIIx	Phase_I	144	5	NM_014903	0	0	0	0	0	Q8NFW7|Q9Y2E7	Silent	SNP	ENST00000397909.2	37		.	.	.	.	.	.	.	.	.	.	C	9.250	1.040592	0.19669	.	.	ENSG00000067798	ENST00000550503	.	.	.	5.57	1.53	0.23141	.	.	.	.	.	T	0.46210	0.1381	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.24693	-1.0153	4	.	.	.	0.0067	4.2246	0.10574	0.2717:0.4607:0.0:0.2676	.	.	.	.	A	87	.	.	P	+	1	0	NAV3	76916296	0.992000	0.36948	0.824000	0.32777	0.979000	0.70002	0.929000	0.28844	0.243000	0.21327	0.650000	0.86243	CCA	.		0.398	NAV3-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000406812.1	NM_001024383	
NCOR2	9612	hgsc.bcm.edu	37	12	124819002	124819002	+	Silent	SNP	G	G	C	rs201853086	byFrequency	TCGA-OR-A5KU-01A-11D-A29I-10	TCGA-OR-A5KU-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9652ca0-126e-4332-909a-4e2d2fc489ef	68f72637-d9e1-41a6-8bd0-b4f99bbc13a1	g.chr12:124819002G>C	ENST00000405201.1	-	41	6573	c.6573C>G	c.(6571-6573)gcC>gcG	p.A2191A	NCOR2_ENST00000404121.2_Silent_p.A1752A|NCOR2_ENST00000429285.2_Silent_p.A2181A|NCOR2_ENST00000356219.3_Silent_p.A2198A|NCOR2_ENST00000404621.1_Silent_p.A2181A|NCOR2_ENST00000397355.1_Silent_p.A2182A			Q9Y618	NCOR2_HUMAN	nuclear receptor corepressor 2	2202					cellular lipid metabolic process (GO:0044255)|gene expression (GO:0010467)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|Notch signaling pathway (GO:0007219)|regulation of cellular ketone metabolic process by negative regulation of transcription from RNA polymerase II promoter (GO:0072365)|small molecule metabolic process (GO:0044281)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	membrane (GO:0016020)|nuclear body (GO:0016604)|nuclear matrix (GO:0016363)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|histone deacetylase binding (GO:0042826)|Notch binding (GO:0005112)|protein N-terminus binding (GO:0047485)|transcription corepressor activity (GO:0003714)			breast(5)|central_nervous_system(2)|endometrium(7)|kidney(5)|large_intestine(7)|lung(28)|ovary(3)|pancreas(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	69	all_neural(191;0.0804)|Medulloblastoma(191;0.163)			Epithelial(86;3.99e-05)|OV - Ovarian serous cystadenocarcinoma(86;9.14e-05)|all cancers(50;0.000402)|BRCA - Breast invasive adenocarcinoma(302;0.0764)		GGGAGCCACGGGCCGGGGCAC	0.726													g|||	2	0.000399361	0.0	0.0029	5008	,	,		10982	0.0		0.0	False		,,,				2504	0.0				p.A2191A		.											.	NCOR2-229	0			c.C6573G						.		,,	2,3502		0,2,1750	4.0	6.0	5.0		6543,6543,6573	0.5	0.8	12		5	7,7715		0,7,3854	no	coding-synonymous,coding-synonymous,coding-synonymous	NCOR2	NM_001077261.3,NM_001206654.1,NM_006312.5	,,	0,9,5604	CC,CG,GG		0.0907,0.0571,0.0802	,,	2181/2459,2181/2505,2191/2515	124819002	9,11217	1752	3861	5613	SO:0001819	synonymous_variant	9612	exon43			GCCACGGGCCGGG	U37146	CCDS41857.1, CCDS41858.1, CCDS41857.2, CCDS41858.2, CCDS55892.1	12q24	2010-06-10	2010-06-10		ENSG00000196498	ENSG00000196498			7673	protein-coding gene	gene with protein product		600848	"""nuclear receptor co-repressor 2"""			7566127, 8813722	Standard	NM_001077261		Approved	SMRT, SMRTE, TRAC-1, CTG26, TNRC14	uc010tbb.2	Q9Y618	OTTHUMG00000150455	ENST00000405201.1:c.6573C>G	12.37:g.124819002G>C		Somatic	3	0		WXS	Illumina GAIIx	Phase_I	91	36	NM_006312	0	0	24	45	21	O00613|O15416|O15421|Q13354|Q56D06|Q59GM0|Q9Y5U0	Silent	SNP	ENST00000405201.1	37	CCDS41858.2	4	0.0018315018315018315	0	0.0	3	0.008287292817679558	0	0.0	1	0.0013192612137203166	g	9.220	1.033225	0.19590	5.71E-4	9.07E-4	ENSG00000196498	ENST00000443451	.	.	.	4.49	0.499	0.16914	.	.	.	.	.	T	0.18882	0.0453	.	.	.	0.30136	N	0.804331	.	.	.	.	.	.	T	0.24693	-1.0153	4	.	.	.	-25.0273	1.03	0.01536	0.2231:0.113:0.3232:0.3407	.	.	.	.	R	64	.	.	P	-	2	0	NCOR2	123384955	0.814000	0.29104	0.780000	0.31762	0.879000	0.50718	0.003000	0.13083	-0.216000	0.10048	0.550000	0.68814	CCC	G|0.998;C|0.002		0.726	NCOR2-005	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000318173.2	NM_006312	
ZNF84	7637	hgsc.bcm.edu	37	12	133634812	133634814	+	In_Frame_Del	DEL	ATC	ATC	-			TCGA-OR-A5KU-01A-11D-A29I-10	TCGA-OR-A5KU-10A-01D-A29L-10	ATC	ATC	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9652ca0-126e-4332-909a-4e2d2fc489ef	68f72637-d9e1-41a6-8bd0-b4f99bbc13a1	g.chr12:133634812_133634814delATC	ENST00000327668.7	+	5	2091_2093	c.1511_1513delATC	c.(1510-1515)aatcat>aat	p.H505del	ZNF84_ENST00000539354.1_In_Frame_Del_p.H505del|ZNF84_ENST00000535439.1_Intron|ZNF84_ENST00000392319.2_In_Frame_Del_p.H505del|ZNF84_ENST00000543758.1_In_Frame_Del_p.H504del			P51523	ZNF84_HUMAN	zinc finger protein 84	505					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			breast(1)|large_intestine(7)|liver(1)|lung(2)|ovary(1)|prostate(1)	13	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_cancers(7;0.000535)|all_epithelial(31;0.142)		OV - Ovarian serous cystadenocarcinoma(86;4.04e-08)|Epithelial(86;7.85e-07)|all cancers(50;2.74e-05)		AGTCTCACTAATCATCAAAGAAT	0.389																																					p.504_505del		.											.	ZNF84-90	0			c.1511_1513del						.																																			SO:0001651	inframe_deletion	7637	exon5			TCACTAATCATCA	M27878	CCDS31940.1	12q24.33	2013-01-08	2006-05-12					"""Zinc fingers, C2H2-type"", ""-"""	13159	protein-coding gene	gene with protein product			"""zinc finger protein 84 (HPF2)"""				Standard	XM_005266184		Approved	HPF2	uc009zyz.3	P51523		ENST00000327668.7:c.1511_1513delATC	12.37:g.133634815_133634817delATC	ENSP00000331465:p.His505del	Somatic	21	0		WXS	Illumina GAIIx	Phase_I	44	16	NM_001127372	0	0	0	0	0	B2RAK5|D3DXJ1|Q3ZCV9|Q5D057|Q86XU8|Q9NNX7|Q9UC17|Q9UC18	In_Frame_Del	DEL	ENST00000327668.7	37	CCDS31940.1																																																																																			.		0.389	ZNF84-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000397158.1	NM_003428	
TPTE2	93492	bcgsc.ca	37	13	20056686	20056686	+	Splice_Site	SNP	T	T	C	rs201542496		TCGA-OR-A5KU-01A-11D-A29I-10	TCGA-OR-A5KU-10A-01D-A29L-10	T	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9652ca0-126e-4332-909a-4e2d2fc489ef	68f72637-d9e1-41a6-8bd0-b4f99bbc13a1	g.chr13:20056686T>C	ENST00000400230.2	-	4	165	c.121A>G	c.(121-123)Atg>Gtg	p.M41V	TPTE2_ENST00000382975.4_Splice_Site_p.M41V|TPTE2_ENST00000457266.2_Splice_Site_p.M41V|TPTE2_ENST00000382978.1_Splice_Site_p.M41V|TPTE2_ENST00000255310.6_Intron|TPTE2_ENST00000390680.2_Intron|TPTE2_ENST00000400103.2_Splice_Site_p.M41V|TPTE2_ENST00000382977.4_Splice_Site_p.M41V			Q6XPS3	TPTE2_HUMAN	transmembrane phosphoinositide 3-phosphatase and tensin homolog 2	41					phosphatidylinositol biosynthetic process (GO:0006661)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum (GO:0005783)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	ion channel activity (GO:0005216)|phosphatidylinositol-3,4,5-trisphosphate 3-phosphatase activity (GO:0016314)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)			NS(2)|breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(7)|large_intestine(8)|lung(21)|pancreas(1)|prostate(8)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	65		all_cancers(29;1.23e-20)|all_lung(29;1.97e-20)|all_epithelial(30;5.86e-20)|Lung NSC(5;3.36e-17)|Lung SC(185;0.0262)|Ovarian(182;0.162)		all cancers(112;1.73e-05)|Epithelial(112;7.42e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.000785)|Lung(94;0.0176)|LUSC - Lung squamous cell carcinoma(192;0.089)		CGTTCTAACATACTTTAGCCA	0.313																																					p.M41V		.											.	TPTE2-92	0			c.A121G						.						47.0	46.0	47.0					13																	20056686		2202	4298	6500	SO:0001630	splice_region_variant	93492	exon5			CTAACATACTTTA	AJ421032	CCDS9285.1, CCDS45013.1, CCDS45014.1	13q12.11	2012-12-10			ENSG00000132958	ENSG00000132958		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : PTENs"""	17299	protein-coding gene	gene with protein product		606791				11716755, 12717346, 15057823	Standard	NM_130785		Approved	TPIP	uc001umd.3	Q6XPS3	OTTHUMG00000016493	ENST00000400230.2:c.120-1A>G	13.37:g.20056686T>C		Somatic	291	2		WXS	Illumina GAIIx	Phase_I	164	6	NM_199254	0	0	0	0	0	A1A4X0|A1A4X1|A8MX64|B1AQ16|B4DWZ2|Q5VUH2|Q8WWL4|Q8WWL5	Missense_Mutation	SNP	ENST00000400230.2	37	CCDS45014.1	.	.	.	.	.	.	.	.	.	.	T	0	-2.805163	0.00075	.	.	ENSG00000132958	ENST00000382978;ENST00000400103;ENST00000400230;ENST00000382977;ENST00000382975;ENST00000457266;ENST00000343548	D;D;D;D;D;D	0.94376	-3.41;-3.33;-3.28;-3.28;-3.41;-3.33	2.06	0.838	0.18902	.	0.589765	0.15086	U	0.281346	D	0.83399	0.5246	N	0.19112	0.55	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.68424	-0.5412	9	.	.	.	0.2742	3.9369	0.09310	0.0:0.1886:0.0:0.8114	.	41;41	A8MX64;Q6XPS3	.;TPTE2_HUMAN	V	41	ENSP00000372438:M41V;ENSP00000382974:M41V;ENSP00000383089:M41V;ENSP00000372437:M41V;ENSP00000372435:M41V;ENSP00000442218:M41V	.	M	-	1	0	TPTE2	18954686	0.001000	0.12720	0.000000	0.03702	0.001000	0.01503	-0.105000	0.10907	0.235000	0.21160	0.383000	0.25322	ATG	.		0.313	TPTE2-205	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_199254	Missense_Mutation
RGCC	28984	ucsc.edu	37	13	42032572	42032572	+	Silent	SNP	T	T	C	rs7136	byFrequency	TCGA-OR-A5KU-01A-11D-A29I-10	TCGA-OR-A5KU-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9652ca0-126e-4332-909a-4e2d2fc489ef	68f72637-d9e1-41a6-8bd0-b4f99bbc13a1	g.chr13:42032572T>C	ENST00000379359.3	+	2	350	c.201T>C	c.(199-201)agT>agC	p.S67S		NM_014059.2	NP_054778.2	Q9H4X1	RGCC_HUMAN	regulator of cell cycle	67	Ser/Thr-rich.				cellular response to hypoxia (GO:0071456)|complement activation (GO:0006956)|fibroblast activation (GO:0072537)|mitotic cell cycle arrest (GO:0071850)|negative regulation of angiogenesis (GO:0016525)|negative regulation of blood vessel endothelial cell migration (GO:0043537)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell-cell adhesion mediated by cadherin (GO:2000048)|negative regulation of cytokine secretion (GO:0050710)|negative regulation of endothelial cell proliferation (GO:0001937)|negative regulation of exit from mitosis (GO:0001100)|negative regulation of fibroblast growth factor production (GO:0090272)|negative regulation of mitotic cell cycle phase transition (GO:1901991)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of collagen biosynthetic process (GO:0032967)|positive regulation of cyclin-dependent protein serine/threonine kinase activity involved in G1/S transition of mitotic cell cycle (GO:0031659)|positive regulation of cytokine secretion (GO:0050715)|positive regulation of DNA biosynthetic process (GO:2000573)|positive regulation of endothelial cell apoptotic process (GO:2000353)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of extracellular matrix constituent secretion (GO:0003331)|positive regulation of gene expression (GO:0010628)|positive regulation of gene expression involved in extracellular matrix organization (GO:1901313)|positive regulation of mitosis (GO:0045840)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of stress fiber assembly (GO:0051496)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	protein kinase activator activity (GO:0030295)|protein kinase binding (GO:0019901)|R-SMAD binding (GO:0070412)										GCAGCGCCAGTGTCAGCGACA	0.682													.|||	2788	0.556709	0.7829	0.5447	5008	,	,		14651	0.6766		0.3946	False		,,,				2504	0.3027				p.S67S		.											.	.	0			c.T201C						.	C		2432,1322		809,814,254	8.0	9.0	9.0		201	3.6	1.0	13	dbSNP_52	9	3009,5139		592,1825,1657	no	coding-synonymous	C13orf15	NM_014059.2		1401,2639,1911	CC,CT,TT		36.9293,35.2158,45.715		67/138	42032572	5441,6461	1877	4074	5951	SO:0001819	synonymous_variant	28984	exon2			CGCCAGTGTCAGC	AF036549	CCDS41880.1	13q14.11	2012-02-20	2012-02-20	2012-02-20	ENSG00000102760	ENSG00000102760			20369	protein-coding gene	gene with protein product	"""response gene to complement 32"""	610077	"""chromosome 13 open reading frame 15"""	C13orf15		17146433, 19158077, 19652095	Standard	NM_014059		Approved	bA157L14.2, RGC-32, RGC32	uc001uyi.2	Q9H4X1	OTTHUMG00000016796	ENST00000379359.3:c.201T>C	13.37:g.42032572T>C		Somatic	14	2		WXS	Illumina GAIIx	Phase_I	25	18	NM_014059	0	0	2	4	2	Q6NZ48|Q9UL69	Silent	SNP	ENST00000379359.3	37	CCDS41880.1																																																																																			T|0.426;C|0.574		0.682	RGCC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044684.1	NM_014059	
ZNF219	51222	hgsc.bcm.edu	37	14	21560706	21560706	+	Silent	SNP	C	C	G	rs370417468|rs1065496	byFrequency	TCGA-OR-A5KU-01A-11D-A29I-10	TCGA-OR-A5KU-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9652ca0-126e-4332-909a-4e2d2fc489ef	68f72637-d9e1-41a6-8bd0-b4f99bbc13a1	g.chr14:21560706C>G	ENST00000360947.3	-	3	1161	c.750G>C	c.(748-750)ccG>ccC	p.P250P	RP11-998D10.7_ENST00000554733.2_lincRNA|ZNF219_ENST00000451119.2_Silent_p.P250P|ZNF219_ENST00000556101.1_5'Flank|ZNF219_ENST00000421093.2_Silent_p.P250P	NM_016423.2	NP_057507.2	Q9P2Y4	ZN219_HUMAN	zinc finger protein 219	250					negative regulation of transcription, DNA-templated (GO:0045892)|regulation of neurotransmitter levels (GO:0001505)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	integral component of membrane (GO:0016021)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histamine receptor activity (GO:0004969)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|central_nervous_system(1)|cervix(1)|large_intestine(1)|lung(1)|ovary(1)|prostate(2)	8	all_cancers(95;0.00185)		OV - Ovarian serous cystadenocarcinoma(11;9.86e-11)|Epithelial(56;1.27e-08)|all cancers(55;6.06e-08)	GBM - Glioblastoma multiforme(265;0.0191)		gttcgggctccggctccggct	0.726											OREG0022565	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	C|||	448	0.0894569	0.1097	0.049	5008	,	,		11470	0.0942		0.0785	False		,,,				2504	0.0971				p.P250P		.											.	ZNF219-90	0			c.G750C						.	C	,,	331,3629		14,303,1663	6.0	7.0	7.0		750,750,750	-8.1	0.1	14	dbSNP_86	7	434,7432		9,416,3508	no	coding-synonymous,coding-synonymous,coding-synonymous	ZNF219	NM_001101672.1,NM_001102454.1,NM_016423.2	,,	23,719,5171	GG,GC,CC		5.5174,8.3586,6.4688	,,	250/723,250/723,250/723	21560706	765,11061	1980	3933	5913	SO:0001819	synonymous_variant	51222	exon3			GGGCTCCGGCTCC	AB015427	CCDS9568.1	14q11	2013-01-08			ENSG00000165804	ENSG00000165804		"""Zinc fingers, C2H2-type"""	13011	protein-coding gene	gene with protein product		605036				10819330	Standard	NM_016423		Approved		uc001vzs.2	Q9P2Y4	OTTHUMG00000029647	ENST00000360947.3:c.750G>C	14.37:g.21560706C>G		Somatic	2	0	749	WXS	Illumina GAIIx	Phase_I	23	20	NM_001102454	0	0	0	19	19	D3DS16|Q53Y57|Q8IYC1|Q9BW28	Silent	SNP	ENST00000360947.3	37	CCDS9568.1																																																																																			C|0.100;G|0.900		0.726	ZNF219-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000073931.2		
PNN	5411	broad.mit.edu	37	14	39649736	39649736	+	Missense_Mutation	SNP	G	G	T			TCGA-OR-A5KU-01A-11D-A29I-10	TCGA-OR-A5KU-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9652ca0-126e-4332-909a-4e2d2fc489ef	68f72637-d9e1-41a6-8bd0-b4f99bbc13a1	g.chr14:39649736G>T	ENST00000216832.4	+	9	890	c.823G>T	c.(823-825)Gca>Tca	p.A275S	PNN_ENST00000557680.1_3'UTR	NM_002687.3	NP_002678	Q9H307	PININ_HUMAN	pinin, desmosome associated protein	275	Glu-rich.|Necessary for interaction with RNPS1.|Sufficient for PSAP complex assembly.				cell adhesion (GO:0007155)|mRNA splicing, via spliceosome (GO:0000398)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	catalytic step 2 spliceosome (GO:0071013)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|intermediate filament (GO:0005882)|membrane (GO:0016020)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)|structural molecule activity (GO:0005198)			breast(2)|endometrium(5)|kidney(1)|large_intestine(6)|lung(9)|ovary(1)|skin(2)|stomach(1)	27	Hepatocellular(127;0.213)		LUAD - Lung adenocarcinoma(48;0.000565)|Lung(238;0.000711)	GBM - Glioblastoma multiforme(112;0.0119)		CATCGAATTTGCAGAACAAAT	0.338																																					p.A275S		.											.	PNN-91	0			c.G823T						.						61.0	64.0	63.0					14																	39649736		2203	4300	6503	SO:0001583	missense	5411	exon9			GAATTTGCAGAAC	U77718	CCDS9671.1	14q21.1	2010-07-02			ENSG00000100941	ENSG00000100941			9162	protein-coding gene	gene with protein product		603154				8922384	Standard	NM_002687		Approved	memA	uc001wuw.4	Q9H307	OTTHUMG00000028821	ENST00000216832.4:c.823G>T	14.37:g.39649736G>T	ENSP00000216832:p.Ala275Ser	Somatic	81	0		WXS	Illumina GAIIx	Phase_I	82	5	NM_002687	0	0	8	8	0	B4DZX8|O60899|Q53EM7|Q6P5X4|Q7KYL1|Q99738|Q9UHZ9|Q9UQR9	Missense_Mutation	SNP	ENST00000216832.4	37	CCDS9671.1	.	.	.	.	.	.	.	.	.	.	G	17.03	3.283919	0.59867	.	.	ENSG00000100941	ENST00000216832	T	0.33865	1.39	5.97	5.08	0.68730	.	0.000000	0.85682	D	0.000000	T	0.49695	0.1572	M	0.61703	1.905	0.80722	D	1	D	0.67145	0.996	P	0.57425	0.82	T	0.44159	-0.9346	10	0.18276	T	0.48	-9.6353	15.3016	0.73955	0.0671:0.0:0.9329:0.0	.	275	Q9H307	PININ_HUMAN	S	275	ENSP00000216832:A275S	ENSP00000216832:A275S	A	+	1	0	PNN	38719487	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.834000	0.92094	1.532000	0.49169	0.655000	0.94253	GCA	.		0.338	PNN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276776.2	NM_002687	
IRF2BPL	64207	broad.mit.edu	37	14	77493762	77493767	+	In_Frame_Del	DEL	TGCTGC	TGCTGC	-	rs553703325|rs556445214|rs200317113	byFrequency	TCGA-OR-A5KU-01A-11D-A29I-10	TCGA-OR-A5KU-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9652ca0-126e-4332-909a-4e2d2fc489ef	68f72637-d9e1-41a6-8bd0-b4f99bbc13a1	g.chr14:77493762_77493767delTGCTGC	ENST00000238647.3	-	1	1267_1272	c.369_374delGCAGCA	c.(367-375)cagcagcaa>caa	p.123_125QQQ>Q		NM_024496.3	NP_078772.1	Q9H1B7	I2BPL_HUMAN	interferon regulatory factor 2 binding protein-like	123	Poly-Gln.				development of secondary female sexual characteristics (GO:0046543)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	extracellular space (GO:0005615)|nucleus (GO:0005634)	metal ion binding (GO:0046872)			endometrium(2)|kidney(1)|lung(3)|ovary(1)|prostate(1)|skin(1)|urinary_tract(2)	11						GAgctgttgttgctgctgctgctgct	0.714														4658	0.930112	0.9297	0.9769	5008	,	,		7189	0.872		0.9712	False		,,,				2504	0.9151				p.123_125del		.											.	IRF2BPL-90	0			c.369_374del						.																																			SO:0001651	inframe_deletion	64207	exon1			TGTTGTTGCTGCT	AJ277365	CCDS9854.1	14q24.3	2011-02-23	2011-02-23	2011-02-23	ENSG00000119669	ENSG00000119669			14282	protein-coding gene	gene with protein product	"""enhanced at puberty 1"""	611720	"""chromosome 14 open reading frame 4"""	C14orf4		11095982, 17627301	Standard	NM_024496		Approved	EAP1, KIAA1865	uc001xsy.4	Q9H1B7		ENST00000238647.3:c.369_374delGCAGCA	14.37:g.77493768_77493773delTGCTGC	ENSP00000238647:p.Gln125_Gln126del	Somatic	5	0		WXS	Illumina GAIIx	Phase_I	23	14	NM_024496	0	0	0	0	0	Q8NDQ2|Q96JG2|Q9H3I7	In_Frame_Del	DEL	ENST00000238647.3	37	CCDS9854.1																																																																																			CTG|1.000;|0.000		0.714	IRF2BPL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414298.1	NM_024496	
GALK2	2585	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	15	49611899	49611899	+	Missense_Mutation	SNP	A	A	G			TCGA-OR-A5KU-01A-11D-A29I-10	TCGA-OR-A5KU-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9652ca0-126e-4332-909a-4e2d2fc489ef	68f72637-d9e1-41a6-8bd0-b4f99bbc13a1	g.chr15:49611899A>G	ENST00000560031.1	+	9	1373	c.1066A>G	c.(1066-1068)Atg>Gtg	p.M356V	GALK2_ENST00000561014.1_3'UTR|GALK2_ENST00000396509.2_Missense_Mutation_p.M332V|GALK2_ENST00000559454.1_Missense_Mutation_p.M332V|GALK2_ENST00000327171.3_Missense_Mutation_p.M345V|GALK2_ENST00000544523.1_Missense_Mutation_p.M332V|GALK2_ENST00000543495.1_3'UTR			Q01415	GALK2_HUMAN	galactokinase 2	356					carbohydrate metabolic process (GO:0005975)|galactose metabolic process (GO:0006012)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|galactokinase activity (GO:0004335)|N-acetylgalactosamine kinase activity (GO:0033858)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|liver(2)|lung(7)|skin(1)|upper_aerodigestive_tract(1)	19		all_lung(180;0.000325)		all cancers(107;3.71e-08)|GBM - Glioblastoma multiforme(94;7e-05)		ACCTGAAAACATGGTCCAGCT	0.532																																					p.M356V		.											.	GALK2-160	0			c.A1066G						.						81.0	74.0	77.0					15																	49611899		2196	4295	6491	SO:0001583	missense	2585	exon9			GAAAACATGGTCC		CCDS32236.1, CCDS42034.1, CCDS73724.1	15q21.1-q21.2	2013-09-20			ENSG00000156958	ENSG00000156958	2.7.1.6		4119	protein-coding gene	gene with protein product		137028					Standard	XM_005254279		Approved	GK2	uc001zxj.1	Q01415	OTTHUMG00000172325	ENST00000560031.1:c.1066A>G	15.37:g.49611899A>G	ENSP00000453129:p.Met356Val	Somatic	134	0		WXS	Illumina GAIIx	Phase_I	162	79	NM_002044	0	0	6	14	8	Q7Z4Q4	Missense_Mutation	SNP	ENST00000560031.1	37	CCDS42034.1	.	.	.	.	.	.	.	.	.	.	A	10.78	1.446885	0.25987	.	.	ENSG00000156958	ENST00000327171;ENST00000396509;ENST00000544523	D;D	0.90324	-2.65;-2.65	5.89	-6.5	0.01884	GHMP kinase, C-terminal (1);	1.147800	0.05976	N	0.643313	T	0.70072	0.3182	N	0.00960	-1.095	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.63673	-0.6584	10	0.11182	T	0.66	-35.1665	12.2908	0.54817	0.2678:0.0:0.6326:0.0996	.	356;345	Q01415;Q7Z4Q4	GALK2_HUMAN;.	V	345;356;332	ENSP00000316632:M345V;ENSP00000440312:M332V	ENSP00000316632:M345V	M	+	1	0	GALK2	47399191	0.000000	0.05858	0.008000	0.14137	0.995000	0.86356	0.425000	0.21346	-0.787000	0.04510	0.533000	0.62120	ATG	.		0.532	GALK2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000417854.1		
FAM63B	54629	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	15	59102553	59102553	+	Missense_Mutation	SNP	T	T	C			TCGA-OR-A5KU-01A-11D-A29I-10	TCGA-OR-A5KU-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9652ca0-126e-4332-909a-4e2d2fc489ef	68f72637-d9e1-41a6-8bd0-b4f99bbc13a1	g.chr15:59102553T>C	ENST00000559228.1	+	4	1170	c.1088T>C	c.(1087-1089)aTt>aCt	p.I363T	FAM63B_ENST00000450403.2_Missense_Mutation_p.I363T			Q8NBR6	FA63B_HUMAN	family with sequence similarity 63, member B	363										central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(1)|liver(2)|lung(4)|ovary(1)|prostate(1)|skin(1)|urinary_tract(1)	15						CTTCTTGATATTCCTTTGTAC	0.343																																					p.I363T		.											.	FAM63B-90	0			c.T1088C						.						143.0	138.0	140.0					15																	59102553		1833	4085	5918	SO:0001583	missense	54629	exon4			TTGATATTCCTTT	AK075319	CCDS42046.1, CCDS45268.1	15q21.3	2005-08-09							26954	protein-coding gene	gene with protein product						10574461	Standard	NM_001040450		Approved	KIAA1164	uc002afj.3	Q8NBR6		ENST00000559228.1:c.1088T>C	15.37:g.59102553T>C	ENSP00000452885:p.Ile363Thr	Somatic	132	0		WXS	Illumina GAIIx	Phase_I	146	35	NM_001040450	0	0	1	1	0	B2RTT8|Q9ULQ6	Missense_Mutation	SNP	ENST00000559228.1	37	CCDS42046.1	.	.	.	.	.	.	.	.	.	.	T	24.5	4.539526	0.85917	.	.	ENSG00000128923	ENST00000316848;ENST00000450403	T	0.62232	0.04	5.58	5.58	0.84498	.	0.000000	0.85682	D	0.000000	T	0.82254	0.4997	M	0.88031	2.925	0.58432	D	0.999999	D;D	0.89917	1.0;1.0	D;D	0.79108	0.992;0.987	D	0.86025	0.1509	10	0.87932	D	0	-2.3202	15.7387	0.77866	0.0:0.0:0.0:1.0	.	363;363	Q8NBR6;Q8NBR6-2	FA63B_HUMAN;.	T	363	ENSP00000393231:I363T	ENSP00000326194:I363T	I	+	2	0	FAM63B	56889845	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	8.036000	0.88901	2.101000	0.63845	0.482000	0.46254	ATT	.		0.343	FAM63B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000416230.1	NM_019092	
LACTB	114294	hgsc.bcm.edu	37	15	63414083	63414083	+	Missense_Mutation	SNP	A	A	C	rs34317102	byFrequency	TCGA-OR-A5KU-01A-11D-A29I-10	TCGA-OR-A5KU-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9652ca0-126e-4332-909a-4e2d2fc489ef	68f72637-d9e1-41a6-8bd0-b4f99bbc13a1	g.chr15:63414083A>C	ENST00000261893.4	+	1	85	c.13A>C	c.(13-15)Atg>Ctg	p.M5L	LACTB_ENST00000413507.2_Missense_Mutation_p.M5L	NM_032857.3	NP_116246.2	P83111	LACTB_HUMAN	lactamase, beta	5				M -> L (in Ref. 1 and 2). {ECO:0000305}.		cytoplasm (GO:0005737)|mitochondrion (GO:0005739)	hydrolase activity (GO:0016787)			NS(1)|breast(1)|kidney(1)|large_intestine(3)|lung(3)|prostate(1)|skin(1)|stomach(1)	12						GTACCGGCTCATGTCAGCAGT	0.751													C|||	3981	0.794928	0.6725	0.8256	5008	,	,		8367	0.997		0.7316	False		,,,				2504	0.7955				p.M5L	Melanoma(85;443 1381 6215 27308 35583)	.											.	LACTB-90	0			c.A13C						.	C	LEU/MET,LEU/MET	1936,668		733,470,99	4.0	4.0	4.0		13,13	3.1	1.0	15	dbSNP_126	4	4375,1183		1737,901,141	yes	missense,missense	LACTB	NM_032857.3,NM_171846.2	15,15	2470,1371,240	CC,CA,AA		21.2846,25.6528,22.6783	benign,benign	5/548,5/374	63414083	6311,1851	1302	2779	4081	SO:0001583	missense	114294	exon1			CGGCTCATGTCAG	AK027808	CCDS10182.1, CCDS45275.1	15q22.1	2012-11-14	2001-12-12	2001-12-14	ENSG00000103642	ENSG00000103642		"""Mitochondrial ribosomal proteins / large subunits"""	16468	protein-coding gene	gene with protein product		608440	"""mitochondrial ribosomal protein L56"""	MRPL56		11707067	Standard	NM_032857		Approved	FLJ14902	uc002alw.3	P83111	OTTHUMG00000132807	ENST00000261893.4:c.13A>C	15.37:g.63414083A>C	ENSP00000261893:p.Met5Leu	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	6	5	NM_171846	0	0	0	1	1	P83096	Missense_Mutation	SNP	ENST00000261893.4	37	CCDS10182.1	1713	0.7843406593406593	304	0.6178861788617886	287	0.7928176795580111	568	0.993006993006993	554	0.7308707124010554	C	0.674	-0.800779	0.02841	0.743472	0.787154	ENSG00000103642	ENST00000261893;ENST00000413507	T	0.33216	1.42	3.1	3.1	0.35709	.	0.592824	0.14749	N	0.300689	T	0.00012	0.0000	N	0.02539	-0.55	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.37842	-0.9688	9	0.02654	T	1	0.0321	7.626	0.28212	0.2541:0.7459:0.0:0.0	rs34317102	5	P83111	LACTB_HUMAN	L	5	ENSP00000261893:M5L	ENSP00000261893:M5L	M	+	1	0	LACTB	61201136	0.994000	0.37717	0.956000	0.39512	0.117000	0.20001	0.346000	0.19997	0.640000	0.30582	-0.677000	0.03784	ATG	A|0.226;C|0.774		0.751	LACTB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256224.1	NM_032857	
ADAMTS7	11173	bcgsc.ca	37	15	79057989	79057989	+	Missense_Mutation	SNP	C	C	T	rs200769684		TCGA-OR-A5KU-01A-11D-A29I-10	TCGA-OR-A5KU-10A-01D-A29L-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9652ca0-126e-4332-909a-4e2d2fc489ef	68f72637-d9e1-41a6-8bd0-b4f99bbc13a1	g.chr15:79057989C>T	ENST00000388820.4	-	19	4474	c.4264G>A	c.(4264-4266)Gag>Aag	p.E1422K	ADAMTS7_ENST00000566303.1_5'Flank	NM_014272.3	NP_055087.2	Q9UKP4	ATS7_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 7	1422	TSP type-1 5. {ECO:0000255|PROSITE- ProRule:PRU00210}.				cellular response to BMP stimulus (GO:0071773)|cellular response to interleukin-1 (GO:0071347)|cellular response to tumor necrosis factor (GO:0071356)|negative regulation of chondrocyte differentiation (GO:0032331)|proteolysis involved in cellular protein catabolic process (GO:0051603)	cell surface (GO:0009986)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)	p.E1422K(3)		NS(1)|breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(2)|lung(23)|ovary(1)|prostate(8)|skin(9)	54						CCACTTGCCTCGCTCCAGTTT	0.657																																					p.E1422K		.											.	ADAMTS7-226	3	Substitution - Missense(3)	skin(2)|NS(1)	c.G4264A						.						31.0	34.0	33.0					15																	79057989		2188	4275	6463	SO:0001583	missense	11173	exon19			TTGCCTCGCTCCA	AF140675	CCDS32303.1	15q25.1	2012-05-16	2005-08-19		ENSG00000136378	ENSG00000136378		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	223	protein-coding gene	gene with protein product	"""COMPase"", ""a disintegrin and metalloprotease with thrombospondin motifs-7 preproprotein"""	605009	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 7"""			10464288	Standard	NM_014272		Approved	ADAM-TS7, DKFZp434H204	uc002bej.4	Q9UKP4	OTTHUMG00000172907	ENST00000388820.4:c.4264G>A	15.37:g.79057989C>T	ENSP00000373472:p.Glu1422Lys	Somatic	86	2		WXS	Illumina GAIIx	Phase_I	208	21	NM_014272	0	0	0	0	0	Q14F51|Q6P7J9	Missense_Mutation	SNP	ENST00000388820.4	37	CCDS32303.1	.	.	.	.	.	.	.	.	.	.	c	8.994	0.978370	0.18812	.	.	ENSG00000136378	ENST00000388820	T	0.54279	0.58	4.21	-8.41	0.00961	.	0.609972	0.15843	N	0.241932	T	0.35248	0.0925	L	0.51914	1.62	0.19775	N	0.999954	B	0.14012	0.009	B	0.10450	0.005	T	0.45483	-0.9258	10	0.07325	T	0.83	.	13.64	0.62243	0.0:0.6736:0.1359:0.1905	.	1422	Q9UKP4	ATS7_HUMAN	K	1422	ENSP00000373472:E1422K	ENSP00000373472:E1422K	E	-	1	0	ADAMTS7	76845044	0.010000	0.17322	0.706000	0.30403	0.289000	0.27227	-0.206000	0.09398	-1.547000	0.01715	-2.551000	0.00177	GAG	C|0.999;T|0.001		0.657	ADAMTS7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000421331.1	NM_014272	
ADAMTS7	11173	bcgsc.ca	37	15	79058090	79058090	+	Missense_Mutation	SNP	A	A	G	rs2929158	byFrequency	TCGA-OR-A5KU-01A-11D-A29I-10	TCGA-OR-A5KU-10A-01D-A29L-10	A	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9652ca0-126e-4332-909a-4e2d2fc489ef	68f72637-d9e1-41a6-8bd0-b4f99bbc13a1	g.chr15:79058090A>G	ENST00000388820.4	-	19	4373	c.4163T>C	c.(4162-4164)gTc>gCc	p.V1388A	ADAMTS7_ENST00000566303.1_5'Flank	NM_014272.3	NP_055087.2	Q9UKP4	ATS7_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 7	1388					cellular response to BMP stimulus (GO:0071773)|cellular response to interleukin-1 (GO:0071347)|cellular response to tumor necrosis factor (GO:0071356)|negative regulation of chondrocyte differentiation (GO:0032331)|proteolysis involved in cellular protein catabolic process (GO:0051603)	cell surface (GO:0009986)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(2)|lung(23)|ovary(1)|prostate(8)|skin(9)	54						GGTCTCAGGGACTCTGTGGCT	0.687																																					p.V1388A		.											.	ADAMTS7-226	0			c.T4163C						.						22.0	29.0	26.0					15																	79058090		2166	4248	6414	SO:0001583	missense	11173	exon19			TCAGGGACTCTGT	AF140675	CCDS32303.1	15q25.1	2012-05-16	2005-08-19		ENSG00000136378	ENSG00000136378		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	223	protein-coding gene	gene with protein product	"""COMPase"", ""a disintegrin and metalloprotease with thrombospondin motifs-7 preproprotein"""	605009	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 7"""			10464288	Standard	NM_014272		Approved	ADAM-TS7, DKFZp434H204	uc002bej.4	Q9UKP4	OTTHUMG00000172907	ENST00000388820.4:c.4163T>C	15.37:g.79058090A>G	ENSP00000373472:p.Val1388Ala	Somatic	24	2		WXS	Illumina GAIIx	Phase_I	94	23	NM_014272	0	0	20	20	0	Q14F51|Q6P7J9	Missense_Mutation	SNP	ENST00000388820.4	37	CCDS32303.1	249	0.11401098901098901	2	0.0040650406504065045	43	0.11878453038674033	198	0.34615384615384615	6	0.0079155672823219	a	0.637	-0.814774	0.02776	.	.	ENSG00000136378	ENST00000388820	T	0.58506	0.33	3.65	-3.31	0.04988	.	0.591257	0.16562	N	0.209003	T	0.00012	0.0000	N	0.02916	-0.46	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.35724	-0.9777	9	0.15066	T	0.55	.	0.8256	0.01120	0.1904:0.2419:0.3106:0.2571	rs2929158	1388	Q9UKP4	ATS7_HUMAN	A	1388	ENSP00000373472:V1388A	ENSP00000373472:V1388A	V	-	2	0	ADAMTS7	76845145	0.000000	0.05858	0.052000	0.19188	0.008000	0.06430	-1.706000	0.01895	-0.534000	0.06315	-2.103000	0.00360	GTC	A|0.898;G|0.102		0.687	ADAMTS7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000421331.1	NM_014272	
PRSS22	64063	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	16	2903974	2903974	+	Silent	SNP	G	G	A			TCGA-OR-A5KU-01A-11D-A29I-10	TCGA-OR-A5KU-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9652ca0-126e-4332-909a-4e2d2fc489ef	68f72637-d9e1-41a6-8bd0-b4f99bbc13a1	g.chr16:2903974G>A	ENST00000161006.3	-	5	674	c.609C>T	c.(607-609)atC>atT	p.I203I	PRSS22_ENST00000574768.1_5'Flank|PRSS22_ENST00000571228.1_Silent_p.I93I	NM_022119.3	NP_071402.1	Q9GZN4	BSSP4_HUMAN	protease, serine, 22	203	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.					extracellular region (GO:0005576)	serine-type endopeptidase activity (GO:0004252)			central_nervous_system(1)|large_intestine(2)|lung(3)|prostate(2)|skin(2)	10						CTTCCGAGTCGATGATAGGAA	0.602																																					p.I203I		.											.	PRSS22-90	0			c.C609T						.						84.0	81.0	82.0					16																	2903974		2198	4300	6498	SO:0001819	synonymous_variant	64063	exon5			CGAGTCGATGATA	AF321182	CCDS10481.1	16p13.3	2010-05-07			ENSG00000005001	ENSG00000005001		"""Serine peptidases / Serine peptidases"""	14368	protein-coding gene	gene with protein product	"""brain-specific serine protease 4"""	609343				11602603, 15701722	Standard	XM_005255473		Approved	hBSSP-4, BSSP-4, SP001LA	uc002cry.1	Q9GZN4	OTTHUMG00000128961	ENST00000161006.3:c.609C>T	16.37:g.2903974G>A		Somatic	81	0		WXS	Illumina GAIIx	Phase_I	117	21	NM_022119	0	0	0	0	0	O43342|Q6UXE0	Silent	SNP	ENST00000161006.3	37	CCDS10481.1																																																																																			.		0.602	PRSS22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250943.1	NM_022119	
MEFV	4210	hgsc.bcm.edu	37	16	3304573	3304573	+	Silent	SNP	G	G	T	rs224223	byFrequency	TCGA-OR-A5KU-01A-11D-A29I-10	TCGA-OR-A5KU-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9652ca0-126e-4332-909a-4e2d2fc489ef	68f72637-d9e1-41a6-8bd0-b4f99bbc13a1	g.chr16:3304573G>T	ENST00000219596.1	-	2	534	c.495C>A	c.(493-495)gcC>gcA	p.A165A	MEFV_ENST00000339854.4_Intron|MEFV_ENST00000536379.1_Intron|MEFV_ENST00000541159.1_Intron	NM_000243.2	NP_000234.1	O15553	MEFV_HUMAN	Mediterranean fever	165					inflammatory response (GO:0006954)|innate immune response (GO:0045087)|negative regulation of inflammatory response (GO:0050728)|negative regulation of interleukin-1 beta production (GO:0032691)|negative regulation of interleukin-12 production (GO:0032695)|negative regulation of macrophage inflammatory protein 1 alpha production (GO:0071641)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|positive regulation of cysteine-type endopeptidase activity (GO:2001056)	cell projection (GO:0042995)|cytosol (GO:0005829)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|nucleus (GO:0005634)	actin binding (GO:0003779)|zinc ion binding (GO:0008270)	p.A165A(2)		NS(2)|biliary_tract(1)|breast(5)|central_nervous_system(2)|endometrium(2)|kidney(3)|large_intestine(6)|lung(19)|ovary(3)|prostate(1)|skin(6)	50						GGCCCTCCGAGGCCTTCTCTC	0.766													G|||	1935	0.386382	0.528	0.5965	5008	,	,		10896	0.1667		0.4732	False		,,,				2504	0.183				p.A165A		.											.	MEFV-228	2	Substitution - coding silent(2)	prostate(2)	c.C495A						.	G	,	2112,2188		580,952,618	7.0	7.0	7.0		495,	2.9	0.0	16	dbSNP_79	7	3826,4590		964,1898,1346	no	coding-synonymous,intron	MEFV	NM_000243.2,NM_001198536.1	,	1544,2850,1964	TT,TG,GG		45.461,49.1163,46.6971	,	165/782,	3304573	5938,6778	2150	4208	6358	SO:0001819	synonymous_variant	4210	exon2			CTCCGAGGCCTTC	AF018080	CCDS10498.1, CCDS55981.1	16p13.3	2014-09-17			ENSG00000103313	ENSG00000103313		"""Tripartite motif containing / Tripartite motif containing"""	6998	protein-coding gene	gene with protein product	"""pyrin"""	608107		MEF		9288094	Standard	NM_000243		Approved	FMF, TRIM20	uc002cun.1	O15553	OTTHUMG00000129324	ENST00000219596.1:c.495C>A	16.37:g.3304573G>T		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	11	6	NM_000243	0	0	0	0	0	D3DUC0|F5H0Q3|Q3MJ84|Q96PN4|Q96PN5	Silent	SNP	ENST00000219596.1	37	CCDS10498.1																																																																																			G|0.570;T|0.430		0.766	MEFV-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251464.1	NM_000243	
ZNF174	7727	broad.mit.edu;ucsc.edu;bcgsc.ca	37	16	3454512	3454512	+	Silent	SNP	G	G	A	rs140705448		TCGA-OR-A5KU-01A-11D-A29I-10	TCGA-OR-A5KU-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9652ca0-126e-4332-909a-4e2d2fc489ef	68f72637-d9e1-41a6-8bd0-b4f99bbc13a1	g.chr16:3454512G>A	ENST00000268655.4	+	2	1074	c.489G>A	c.(487-489)ccG>ccA	p.P163P	ZNF174_ENST00000571936.1_Silent_p.P163P|ZNF174_ENST00000344823.5_Silent_p.P163P|ZNF174_ENST00000572544.1_Silent_p.P163P|ZNF174_ENST00000575752.1_Silent_p.P163P	NM_003450.2	NP_003441.1	Q15697	ZN174_HUMAN	zinc finger protein 174	163					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|transcription from RNA polymerase II promoter (GO:0006366)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			endometrium(2)|large_intestine(3)|lung(3)|prostate(2)|urinary_tract(2)	12						ACTTTCAACCGCAGACTCCTA	0.557													G|||	1	0.000199681	0.0008	0.0	5008	,	,		17550	0.0		0.0	False		,,,				2504	0.0				p.P163P		.											.	ZNF174-90	0			c.G489A						.	G	,	2,4392	4.2+/-10.8	0,2,2195	99.0	110.0	106.0		489,489	-7.0	0.0	16	dbSNP_134	106	0,8600		0,0,4300	no	coding-synonymous,coding-synonymous	ZNF174	NM_001032292.2,NM_003450.2	,	0,2,6495	AA,AG,GG		0.0,0.0455,0.0154	,	163/235,163/408	3454512	2,12992	2197	4300	6497	SO:0001819	synonymous_variant	7727	exon2			TCAACCGCAGACT	U31248	CCDS10504.1, CCDS32380.1	16p13	2013-01-09			ENSG00000103343	ENSG00000103343		"""-"", ""Zinc fingers, C2H2-type"""	12963	protein-coding gene	gene with protein product		603900					Standard	NM_003450		Approved	ZSCAN8	uc002cvc.3	Q15697	OTTHUMG00000129358	ENST00000268655.4:c.489G>A	16.37:g.3454512G>A		Somatic	91	1		WXS	Illumina GAIIx	Phase_I	96	15	NM_001032292	0	0	9	13	4	Q53Y68|Q9BQ34	Silent	SNP	ENST00000268655.4	37	CCDS10504.1																																																																																			G|1.000;A|0.000		0.557	ZNF174-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251510.1	NM_003450	
ITGAL	3683	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	16	30492905	30492905	+	Splice_Site	SNP	C	C	T			TCGA-OR-A5KU-01A-11D-A29I-10	TCGA-OR-A5KU-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9652ca0-126e-4332-909a-4e2d2fc489ef	68f72637-d9e1-41a6-8bd0-b4f99bbc13a1	g.chr16:30492905C>T	ENST00000356798.6	+	7	902	c.722C>T	c.(721-723)gCg>gTg	p.A241V	ITGAL_ENST00000433423.2_Intron|RP11-297C4.3_ENST00000562525.1_RNA|RNU7-61P_ENST00000515897.1_RNA|RP11-297C4.2_ENST00000569459.1_RNA|ITGAL_ENST00000358164.5_Splice_Site_p.A158V|ITGAL_ENST00000454514.2_3'UTR	NM_002209.2	NP_002200.2	P20701	ITAL_HUMAN	integrin, alpha L (antigen CD11A (p180), lymphocyte function-associated antigen 1; alpha polypeptide)	241	VWFA. {ECO:0000255|PROSITE- ProRule:PRU00219}.				activated T cell proliferation (GO:0050798)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell-matrix adhesion (GO:0007160)|cellular component movement (GO:0006928)|extracellular matrix organization (GO:0030198)|heterophilic cell-cell adhesion (GO:0007157)|inflammatory response (GO:0006954)|integrin-mediated signaling pathway (GO:0007229)|leukocyte cell-cell adhesion (GO:0007159)|leukocyte migration (GO:0050900)|positive regulation of calcium-mediated signaling (GO:0050850)|positive regulation of cell-cell adhesion (GO:0022409)|positive regulation of T cell proliferation (GO:0042102)|receptor clustering (GO:0043113)|regulation of immune response (GO:0050776)|signal transduction (GO:0007165)|T cell activation via T cell receptor contact with antigen bound to MHC molecule on antigen presenting cell (GO:0002291)	cell surface (GO:0009986)|cell-cell junction (GO:0005911)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|immunological synapse (GO:0001772)|integrin alphaL-beta2 complex (GO:0034687)|integrin complex (GO:0008305)|membrane (GO:0016020)|plasma membrane (GO:0005886)	cell adhesion molecule binding (GO:0050839)|ICAM-3 receptor activity (GO:0030369)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(3)|cervix(1)|endometrium(10)|kidney(4)|large_intestine(12)|lung(32)|ovary(3)|prostate(4)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	76					Antithymocyte globulin(DB00098)|Efalizumab(DB00095)|Lovastatin(DB00227)	AATTATGTCGCGTGAGTTCCC	0.483																																					p.A241V	NSCLC(110;1462 1641 3311 33990 49495)	.											.	ITGAL-994	0			c.C722T						.						129.0	91.0	104.0					16																	30492905		2197	4300	6497	SO:0001630	splice_region_variant	3683	exon7			ATGTCGCGTGAGT		CCDS32433.1, CCDS45461.1	16p13.1-p11	2010-03-23				ENSG00000005844		"""CD molecules"", ""Integrins"""	6148	protein-coding gene	gene with protein product		153370		CD11A		3284962	Standard	NM_002209		Approved	LFA-1	uc002dyi.4	P20701		ENST00000356798.6:c.722+1C>T	16.37:g.30492905C>T		Somatic	140	0		WXS	Illumina GAIIx	Phase_I	199	33	NM_002209	0	0	0	0	0	O43746|Q45H73|Q96HB1|Q9UBC8	Missense_Mutation	SNP	ENST00000356798.6	37	CCDS32433.1	.	.	.	.	.	.	.	.	.	.	C	4.496	0.091905	0.08632	.	.	ENSG00000005844	ENST00000356798;ENST00000358164	D;D	0.82526	-1.62;-1.62	5.54	0.136	0.14780	von Willebrand factor, type A (3);	0.657383	0.13301	N	0.398251	T	0.53254	0.1785	N	0.02142	-0.665	0.80722	D	1	B;B	0.16166	0.016;0.007	B;B	0.10450	0.005;0.002	T	0.51787	-0.8661	10	0.02654	T	1	.	8.3278	0.32167	0.0:0.4851:0.0:0.5149	.	158;241	Q96HB1;P20701	.;ITAL_HUMAN	V	241;158	ENSP00000349252:A241V;ENSP00000350886:A158V	ENSP00000349252:A241V	A	+	2	0	ITGAL	30400406	0.671000	0.27521	0.726000	0.30738	0.803000	0.45373	0.014000	0.13333	0.142000	0.18901	0.404000	0.27445	GCG	.		0.483	ITGAL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000434508.2		Missense_Mutation
CCDC102A	92922	hgsc.bcm.edu	37	16	57562804	57562804	+	Missense_Mutation	SNP	G	G	A	rs12935069		TCGA-OR-A5KU-01A-11D-A29I-10	TCGA-OR-A5KU-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9652ca0-126e-4332-909a-4e2d2fc489ef	68f72637-d9e1-41a6-8bd0-b4f99bbc13a1	g.chr16:57562804G>A	ENST00000258214.2	-	2	532	c.286C>T	c.(286-288)Cgg>Tgg	p.R96W		NM_033212.3	NP_149989.2	Q96A19	C102A_HUMAN	coiled-coil domain containing 102A	96				R -> W (in Ref. 2; AAH08285/AAH09941). {ECO:0000305}.						endometrium(1)|large_intestine(1)|lung(4)|ovary(1)|prostate(1)	8						TCCGACCACCGGCGCATGGTC	0.731													A|||	5008	1.0	1.0	1.0	5008	,	,		3757	1.0		1.0	False		,,,				2504	1.0				p.R96W		.											.	CCDC102A-91	0			c.C286T						.						8.0	10.0	9.0					16																	57562804		1834	3717	5551	SO:0001583	missense	92922	exon2			ACCACCGGCGCAT	BC008285	CCDS10784.1	16q13	2008-02-05			ENSG00000135736	ENSG00000135736			28097	protein-coding gene	gene with protein product						12477932	Standard	NM_033212		Approved	MGC10992	uc002elw.3	Q96A19	OTTHUMG00000133472	ENST00000258214.2:c.286C>T	16.37:g.57562804G>A	ENSP00000258214:p.Arg96Trp	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	4	4	NM_033212	0	0	0	0	0	Q9BT74	Missense_Mutation	SNP	ENST00000258214.2	37	CCDS10784.1	2180	0.9981684981684982	492	1.0	360	0.994475138121547	570	0.9965034965034965	758	1.0	A	10.17	1.277909	0.23307	.	.	ENSG00000135736	ENST00000258214	T	0.37752	1.18	4.82	4.82	0.62117	.	0.000000	0.64402	N	0.000001	T	0.00012	0.0000	N	0.00049	-2.415	0.40217	P	0.022302999999999962	B	0.02656	0.0	B	0.01281	0.0	T	0.44787	-0.9305	9	0.33141	T	0.24	-23.2491	9.5348	0.39216	0.9152:0.0:0.0848:0.0	rs12935069;rs12935069	96	Q96A19	C102A_HUMAN	W	96	ENSP00000258214:R96W	ENSP00000258214:R96W	R	-	1	2	CCDC102A	56120305	1.000000	0.71417	1.000000	0.80357	0.971000	0.66376	6.801000	0.75170	0.698000	0.31739	-0.556000	0.04195	CGG	G|0.001;A|0.999		0.731	CCDC102A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257348.1	NM_033212	
PKD1L3	342372	bcgsc.ca	37	16	72020134	72020134	+	RNA	SNP	T	T	C	rs12708923	byFrequency	TCGA-OR-A5KU-01A-11D-A29I-10	TCGA-OR-A5KU-10A-01D-A29L-10	T	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9652ca0-126e-4332-909a-4e2d2fc489ef	68f72637-d9e1-41a6-8bd0-b4f99bbc13a1	g.chr16:72020134T>C	ENST00000534738.1	-	0	819							Q7Z443	PK1L3_HUMAN	polycystic kidney disease 1-like 3						cation transport (GO:0006812)|cellular response to acidic pH (GO:0071468)|detection of chemical stimulus involved in sensory perception of sour taste (GO:0001581)|neuropeptide signaling pathway (GO:0007218)|sensory perception of sour taste (GO:0050915)	cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium channel activity (GO:0005262)|carbohydrate binding (GO:0030246)			autonomic_ganglia(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|lung(3)|skin(2)	22						CCAGATGCCTTCTGCAATGAC	0.468													T|||	2570	0.513179	0.6808	0.4107	5008	,	,		21655	0.4534		0.508	False		,,,				2504	0.4264				.		.											.	PKD1L3-68	0			.						.	T	GLU/LYS	935,449		312,311,69	152.0	119.0	129.0		820	3.4	0.0	16	dbSNP_121	129	1668,1514		436,796,359	yes	missense	PKD1L3	NM_181536.1	56	748,1107,428	CC,CT,TT		47.5801,32.4422,42.9917	benign	274/1733	72020134	2603,1963	692	1591	2283			342372	.			ATGCCTTCTGCAA	AY164485	CCDS73912.1	16q22.2	2008-02-05				ENSG00000277481			21716	protein-coding gene	gene with protein product		607895				12782129	Standard	NM_181536		Approved		uc010vmm.2	Q7Z443			16.37:g.72020134T>C		Somatic	239	2		WXS	Illumina GAIIx	Phase_I	274	9	.	0	0	0	0	0		RNA	SNP	ENST00000534738.1	37																																																																																				C|0.529;N|0.000		0.468	PKD1L3-001	KNOWN	basic	processed_transcript	processed_transcript	OTTHUMT00000387876.1	NM_181536	
PIEZO1	9780	bcgsc.ca	37	16	88800395	88800395	+	Missense_Mutation	SNP	C	C	G	rs144777557|rs144269709|rs202139830	byFrequency	TCGA-OR-A5KU-01A-11D-A29I-10	TCGA-OR-A5KU-10A-01D-A29L-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9652ca0-126e-4332-909a-4e2d2fc489ef	68f72637-d9e1-41a6-8bd0-b4f99bbc13a1	g.chr16:88800395C>G	ENST00000301015.9	-	17	2494	c.2248G>C	c.(2248-2250)Gag>Cag	p.E750Q	RP5-1142A6.2_ENST00000567968.1_RNA|RP5-1142A6.2_ENST00000440406.2_RNA	NM_001142864.2	NP_001136336.2	Q92508	PIEZ1_HUMAN	piezo-type mechanosensitive ion channel component 1	750				Missing (in Ref. 3; BAA13240 and 4; AAI50272). {ECO:0000305}.	cation transmembrane transport (GO:0098655)|cation transport (GO:0006812)|detection of mechanical stimulus (GO:0050982)|positive regulation of cell-cell adhesion mediated by integrin (GO:0033634)|positive regulation of integrin activation (GO:0033625)|regulation of membrane potential (GO:0042391)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	cation channel activity (GO:0005261)|mechanically-gated ion channel activity (GO:0008381)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(2)|prostate(2)|skin(1)	10						tcctcctcctcctgctgctgc	0.667													c|||	215	0.0429313	0.1422	0.0144	5008	,	,		18034	0.002		0.005	False		,,,				2504	0.0102				p.E750Q		.											.	.	0			c.G2248C						.						8.0	11.0	10.0					16																	88800395		685	1579	2264	SO:0001583	missense	9780	exon17			CCTCCTCCTGCTG	D87071	CCDS54058.1	16q24.3	2011-08-31	2011-08-31	2011-08-31	ENSG00000103335	ENSG00000103335			28993	protein-coding gene	gene with protein product		611184	"""family with sequence similarity 38, member A"""	FAM38A		20813920, 21056836, 21299953, 21696149	Standard	NM_001142864		Approved	KIAA0233	uc010vpb.2	Q92508	OTTHUMG00000156776	ENST00000301015.9:c.2248G>C	16.37:g.88800395C>G	ENSP00000301015:p.Glu750Gln	Somatic	93	0		WXS	Illumina GAIIx	Phase_I	105	3	NM_001142864	0	0	0	0	0	A6NHT9|A7E2B7|Q0KKZ9	Missense_Mutation	SNP	ENST00000301015.9	37	CCDS54058.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	1.314|1.314	-0.601304|-0.601304	0.03744|0.03744	.|.	.|.	ENSG00000103335|ENSG00000103335	ENST00000301015|ENST00000451779	T|.	0.42513|.	0.97|.	0.95|0.95	-0.894|-0.894	0.10563|0.10563	.|.	6.054080|.	0.02478|.	U|.	0.088226|.	T|T	0.24928|0.24928	0.0605|0.0605	L|L	0.32530|0.32530	0.975|0.975	0.22851|0.22851	N|N	0.998657|0.998657	B|.	0.02656|.	0.0|.	B|.	0.04013|.	0.001|.	T|T	0.28808|0.28808	-1.0032|-1.0032	10|5	0.14252|.	T|.	0.57|.	.|.	4.7743|4.7743	0.13171|0.13171	0.0:0.5999:0.4001:0.0|0.0:0.5999:0.4001:0.0	.|.	750|.	Q92508|.	PIEZ1_HUMAN|.	Q|A	750|695	ENSP00000301015:E750Q|.	ENSP00000301015:E750Q|.	E|G	-|-	1|2	0|0	FAM38A|FAM38A	87327896|87327896	0.001000|0.001000	0.12720|0.12720	0.479000|0.479000	0.27329|0.27329	0.108000|0.108000	0.19459|0.19459	0.550000|0.550000	0.23345|0.23345	-0.003000|-0.003000	0.14444|0.14444	0.000000|0.000000	0.15137|0.15137	GAG|GGA	.		0.667	PIEZO1-001	NOVEL	not_organism_supported|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000345699.4	NM_014745	
CRK	1398	bcgsc.ca	37	17	1359363	1359363	+	Silent	SNP	T	T	G	rs2229075	byFrequency	TCGA-OR-A5KU-01A-11D-A29I-10	TCGA-OR-A5KU-10A-01D-A29L-10	T	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9652ca0-126e-4332-909a-4e2d2fc489ef	68f72637-d9e1-41a6-8bd0-b4f99bbc13a1	g.chr17:1359363T>G	ENST00000300574.2	-	1	189	c.49A>C	c.(49-51)Agg>Cgg	p.R17R	CRK_ENST00000574295.1_Silent_p.R17R|CRK_ENST00000398970.5_Silent_p.R17R|CRK_ENST00000572145.1_Intron	NM_016823.3	NP_058431.2	P46108	CRK_HUMAN	v-crk avian sarcoma virus CT10 oncogene homolog	17	SH2. {ECO:0000255|PROSITE- ProRule:PRU00191}.				activation of MAPKK activity (GO:0000186)|blood coagulation (GO:0007596)|ephrin receptor signaling pathway (GO:0048013)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|neurotrophin TRK receptor signaling pathway (GO:0048011)|platelet activation (GO:0030168)|positive regulation of signal transduction (GO:0009967)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of Rac protein signal transduction (GO:0035020)|regulation of Rho GTPase activity (GO:0032319)|regulation of transcription from RNA polymerase II promoter (GO:0006357)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ephrin receptor binding (GO:0046875)|SH2 domain binding (GO:0042169)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(3)|prostate(2)	9				UCEC - Uterine corpus endometrioid carcinoma (25;0.083)		CGACTCAACCTCCCCCAGTAC	0.721													G|||	3645	0.727835	0.9213	0.7104	5008	,	,		9691	0.5149		0.7018	False		,,,				2504	0.7249				p.R17R		.											.	CRK-1270	0			c.A49C						.	G	,	3740,508		1659,422,43	17.0	17.0	17.0		49,49	5.1	1.0	17	dbSNP_98	17	6091,2317		2224,1643,337	no	coding-synonymous,coding-synonymous	CRK	NM_005206.3,NM_016823.2	,	3883,2065,380	GG,GT,TT		27.5571,11.9586,22.3214	,	17/205,17/305	1359363	9831,2825	2124	4204	6328	SO:0001819	synonymous_variant	1398	exon1			TCAACCTCCCCCA	D10656	CCDS11002.1, CCDS45561.1	17p13	2013-07-09	2013-07-09		ENSG00000167193	ENSG00000167193		"""SH2 domain containing"""	2362	protein-coding gene	gene with protein product		164762				1690891	Standard	NM_005206		Approved		uc002fsl.3	P46108	OTTHUMG00000090317	ENST00000300574.2:c.49A>C	17.37:g.1359363T>G		Somatic	8	0		WXS	Illumina GAIIx	Phase_I	59	49	NM_016823	0	0	0	0	0	A8MWE8|B0LPE8|D3DTH6|Q96GA9|Q96HJ0	Silent	SNP	ENST00000300574.2	37	CCDS11002.1																																																																																			T|0.151;G|0.509;C|0.239;A|0.100		0.721	CRK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206679.1	NM_016823	
CTC1	80169	broad.mit.edu	37	17	8140717	8140717	+	Silent	SNP	G	G	T			TCGA-OR-A5KU-01A-11D-A29I-10	TCGA-OR-A5KU-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9652ca0-126e-4332-909a-4e2d2fc489ef	68f72637-d9e1-41a6-8bd0-b4f99bbc13a1	g.chr17:8140717G>T	ENST00000315684.8	-	5	775	c.768C>A	c.(766-768)gtC>gtA	p.V256V	CTC1_ENST00000581671.1_5'UTR	NM_025099.5	NP_079375.3	Q2NKJ3	CTC1_HUMAN	CTS telomere maintenance complex component 1	256					bone marrow development (GO:0048539)|cellular response to DNA damage stimulus (GO:0006974)|hematopoietic stem cell proliferation (GO:0071425)|multicellular organism growth (GO:0035264)|positive regulation of DNA replication (GO:0045740)|positive regulation of fibroblast proliferation (GO:0048146)|regulation of G2/M transition of mitotic cell cycle (GO:0010389)|replicative senescence (GO:0090399)|spleen development (GO:0048536)|telomere maintenance (GO:0000723)|telomere maintenance via telomere lengthening (GO:0010833)|thymus development (GO:0048538)	nuclear chromosome, telomeric region (GO:0000784)|nucleus (GO:0005634)|Stn1-Ten1 complex (GO:0070188)	single-stranded DNA binding (GO:0003697)			NS(1)|endometrium(6)|kidney(3)|large_intestine(6)|lung(8)|ovary(1)|skin(4)	29						ACACGTGGGTGACAGCTGGGT	0.498																																					p.V256V		.											.	CTC1-93	0			c.C768A						.						115.0	116.0	116.0					17																	8140717		2044	4173	6217	SO:0001819	synonymous_variant	80169	exon5			GTGGGTGACAGCT	AL831955	CCDS42259.1	17p13.1	2011-02-21	2011-02-21	2011-02-21	ENSG00000178971	ENSG00000178971			26169	protein-coding gene	gene with protein product	"""conserved telomere maintenance component 1"", ""alpha accessory factor 132"", ""conserved telomere capping protein 1"""	613129	"""tmp494178"", ""chromosome 17 open reading frame 68"""	C17orf68		19854130, 19854131	Standard	NM_025099		Approved	FLJ22170, AAF132	uc002gkq.4	Q2NKJ3		ENST00000315684.8:c.768C>A	17.37:g.8140717G>T		Somatic	150	0		WXS	Illumina GAIIx	Phase_I	119	5	NM_025099	0	0	1	1	0	B3KR66|C9JEX5|Q1PCD1|Q2TBE3|Q8N3S6|Q9H6L0	Silent	SNP	ENST00000315684.8	37	CCDS42259.1																																																																																			.		0.498	CTC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000442012.1	NM_025099	
NT5M	56953	hgsc.bcm.edu;ucsc.edu	37	17	17250223	17250223	+	Missense_Mutation	SNP	G	G	T			TCGA-OR-A5KU-01A-11D-A29I-10	TCGA-OR-A5KU-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9652ca0-126e-4332-909a-4e2d2fc489ef	68f72637-d9e1-41a6-8bd0-b4f99bbc13a1	g.chr17:17250223G>T	ENST00000389022.4	+	5	865	c.649G>T	c.(649-651)Gac>Tac	p.D217Y	NT5M_ENST00000582909.1_3'UTR	NM_020201.3	NP_064586.1	Q9NPB1	NT5M_HUMAN	5',3'-nucleotidase, mitochondrial	217					dephosphorylation (GO:0016311)|DNA replication (GO:0006260)|dUMP catabolic process (GO:0046079)|nucleobase-containing small molecule metabolic process (GO:0055086)|pyrimidine deoxyribonucleotide catabolic process (GO:0009223)|pyrimidine nucleobase metabolic process (GO:0006206)|pyrimidine nucleoside catabolic process (GO:0046135)|small molecule metabolic process (GO:0044281)	mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	5'-nucleotidase activity (GO:0008253)|metal ion binding (GO:0046872)|nucleotidase activity (GO:0008252)|nucleotide binding (GO:0000166)			endometrium(1)|kidney(1)|large_intestine(1)|lung(1)	4						GTGGGCGGACGACTGGAAGGC	0.687																																					p.D217Y		.											.	NT5M-90	0			c.G649T						.						37.0	44.0	42.0					17																	17250223		2203	4300	6503	SO:0001583	missense	56953	exon5			GCGGACGACTGGA	AF210652	CCDS32581.1	17p11.2	2007-08-01	2002-05-23		ENSG00000205309	ENSG00000205309	3.1.3.5		15769	protein-coding gene	gene with protein product		605292	"""5' nucleotidase, mitochondrial"""			10899995	Standard	XM_005256731		Approved	dNT-2, dNT2, mdN	uc002grf.3	Q9NPB1	OTTHUMG00000059277	ENST00000389022.4:c.649G>T	17.37:g.17250223G>T	ENSP00000373674:p.Asp217Tyr	Somatic	18	0		WXS	Illumina GAIIx	Phase_I	41	4	NM_020201	0	0	4	4	0		Missense_Mutation	SNP	ENST00000389022.4	37	CCDS32581.1	.	.	.	.	.	.	.	.	.	.	G	15.76	2.929204	0.52759	.	.	ENSG00000205309	ENST00000389022	T	0.41400	1.0	5.79	3.81	0.43845	HAD-like domain (2);	.	.	.	.	T	0.57533	0.2060	L	0.59436	1.845	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.80764	0.994;0.994	T	0.60250	-0.7300	9	0.72032	D	0.01	-6.1642	10.9015	0.47054	0.1526:0.0:0.8474:0.0	.	223;217	Q2I378;Q9NPB1	.;NT5M_HUMAN	Y	217	ENSP00000373674:D217Y	ENSP00000373674:D217Y	D	+	1	0	NT5M	17190948	1.000000	0.71417	0.955000	0.39395	0.185000	0.23345	3.924000	0.56476	1.449000	0.47699	-0.258000	0.10820	GAC	.		0.687	NT5M-007	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000446045.1		
AATK	9625	hgsc.bcm.edu	37	17	79096115	79096115	+	Missense_Mutation	SNP	C	C	T	rs61738821	byFrequency	TCGA-OR-A5KU-01A-11D-A29I-10	TCGA-OR-A5KU-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9652ca0-126e-4332-909a-4e2d2fc489ef	68f72637-d9e1-41a6-8bd0-b4f99bbc13a1	g.chr17:79096115C>T	ENST00000326724.4	-	11	1645	c.1621G>A	c.(1621-1623)Gcc>Acc	p.A541T	AATK_ENST00000417379.1_Missense_Mutation_p.A438T|AATK_ENST00000572339.1_5'Flank|MIR657_ENST00000385003.1_RNA	NM_001080395.2	NP_001073864.2	Q6ZMQ8	LMTK1_HUMAN	apoptosis-associated tyrosine kinase	541				A -> T (in Ref. 1; BAD18544). {ECO:0000305}.	brain development (GO:0007420)|negative regulation of axon extension (GO:0030517)|neuron apoptotic process (GO:0051402)|peptidyl-tyrosine autophosphorylation (GO:0038083)|Rab protein signal transduction (GO:0032482)	axonal growth cone (GO:0044295)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|perinuclear region of cytoplasm (GO:0048471)|recycling endosome (GO:0055037)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)|protein tyrosine kinase activity (GO:0004713)			endometrium(2)|kidney(2)|lung(8)|ovary(3)|prostate(1)|stomach(4)|upper_aerodigestive_tract(1)	21	all_neural(118;0.101)		BRCA - Breast invasive adenocarcinoma(99;0.0228)|OV - Ovarian serous cystadenocarcinoma(97;0.0524)			TCGTGGCCGGCGGCGGGTGCG	0.756													C|||	710	0.141773	0.2451	0.0836	5008	,	,		7975	0.0337		0.1342	False		,,,				2504	0.1626				p.A541T		.											.	AATK-933	0			c.G1621A						.						2.0	2.0	2.0					17																	79096115		1391	2783	4174	SO:0001583	missense	9625	exon11			GGCCGGCGGCGGG	AB014541	CCDS45807.1, CCDS58607.1	17q25.3	2014-06-12			ENSG00000181409	ENSG00000181409			21	protein-coding gene	gene with protein product	"""lemur tyrosine kinase 1"", ""protein phosphatase 1, regulatory subunit 77"""	605276				9734811, 10083745	Standard	NM_001080395		Approved	AATYK, KIAA0641, LMTK1, LMR1, AATYK1, PPP1R77	uc010dia.3	Q6ZMQ8	OTTHUMG00000132717	ENST00000326724.4:c.1621G>A	17.37:g.79096115C>T	ENSP00000324196:p.Ala541Thr	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	8	8	NM_001080395	0	0	0	0	0	O75136|Q6ZN31|Q86X28	Missense_Mutation	SNP	ENST00000326724.4	37	CCDS45807.1	322	0.14743589743589744	149	0.30284552845528456	49	0.13535911602209943	11	0.019230769230769232	113	0.14907651715039577	C	10.34	1.324257	0.24080	.	.	ENSG00000181409	ENST00000326724;ENST00000374792	T;T	0.77489	-1.1;-1.09	4.26	3.26	0.37387	.	0.388682	0.24547	N	0.037589	T	0.00012	0.0000	L	0.48642	1.525	0.80722	P	0.0	P	0.45986	0.87	B	0.27608	0.081	T	0.05716	-1.0868	9	0.29301	T	0.29	.	11.2582	0.49067	0.1833:0.8167:0.0:0.0	rs61738821	541	Q6ZMQ8	LMTK1_HUMAN	T	541;505	ENSP00000324196:A541T;ENSP00000363924:A505T	ENSP00000324196:A541T	A	-	1	0	AATK	76710710	0.009000	0.17119	0.030000	0.17652	0.032000	0.12392	0.876000	0.28092	0.731000	0.32448	0.561000	0.74099	GCC	C|0.850;T|0.150		0.756	AATK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256055.1	NM_004920	
AATK	9625	hgsc.bcm.edu	37	17	79096352	79096352	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5KU-01A-11D-A29I-10	TCGA-OR-A5KU-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9652ca0-126e-4332-909a-4e2d2fc489ef	68f72637-d9e1-41a6-8bd0-b4f99bbc13a1	g.chr17:79096352C>T	ENST00000326724.4	-	11	1408	c.1384G>A	c.(1384-1386)Ggc>Agc	p.G462S	AATK_ENST00000417379.1_Missense_Mutation_p.G359S|AATK_ENST00000572339.1_5'Flank|MIR657_ENST00000385003.1_RNA	NM_001080395.2	NP_001073864.2	Q6ZMQ8	LMTK1_HUMAN	apoptosis-associated tyrosine kinase	462					brain development (GO:0007420)|negative regulation of axon extension (GO:0030517)|neuron apoptotic process (GO:0051402)|peptidyl-tyrosine autophosphorylation (GO:0038083)|Rab protein signal transduction (GO:0032482)	axonal growth cone (GO:0044295)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|perinuclear region of cytoplasm (GO:0048471)|recycling endosome (GO:0055037)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)|protein tyrosine kinase activity (GO:0004713)			endometrium(2)|kidney(2)|lung(8)|ovary(3)|prostate(1)|stomach(4)|upper_aerodigestive_tract(1)	21	all_neural(118;0.101)		BRCA - Breast invasive adenocarcinoma(99;0.0228)|OV - Ovarian serous cystadenocarcinoma(97;0.0524)			ACGTCGTCGCCGTCCGCGTGG	0.726																																					p.G462S		.											.	AATK-933	0			c.G1384A						.						3.0	4.0	3.0					17																	79096352		1547	3349	4896	SO:0001583	missense	9625	exon11			CGTCGCCGTCCGC	AB014541	CCDS45807.1, CCDS58607.1	17q25.3	2014-06-12			ENSG00000181409	ENSG00000181409			21	protein-coding gene	gene with protein product	"""lemur tyrosine kinase 1"", ""protein phosphatase 1, regulatory subunit 77"""	605276				9734811, 10083745	Standard	NM_001080395		Approved	AATYK, KIAA0641, LMTK1, LMR1, AATYK1, PPP1R77	uc010dia.3	Q6ZMQ8	OTTHUMG00000132717	ENST00000326724.4:c.1384G>A	17.37:g.79096352C>T	ENSP00000324196:p.Gly462Ser	Somatic	2	0		WXS	Illumina GAIIx	Phase_I	27	21	NM_001080395	0	0	0	0	0	O75136|Q6ZN31|Q86X28	Missense_Mutation	SNP	ENST00000326724.4	37	CCDS45807.1	.	.	.	.	.	.	.	.	.	.	C	15.07	2.725244	0.48833	.	.	ENSG00000181409	ENST00000326724;ENST00000374792	T;T	0.77750	-1.12;-1.0	4.12	2.1	0.27182	.	0.254658	0.37483	N	0.002072	T	0.61085	0.2319	L	0.41236	1.265	0.42650	D	0.993444	D	0.57257	0.979	B	0.38985	0.287	T	0.56619	-0.7949	10	0.14656	T	0.56	.	7.9682	0.30111	0.0:0.7909:0.0:0.2091	.	462	Q6ZMQ8	LMTK1_HUMAN	S	462	ENSP00000324196:G462S;ENSP00000363924:G462S	ENSP00000324196:G462S	G	-	1	0	AATK	76710947	0.390000	0.25213	0.034000	0.17996	0.832000	0.47134	2.584000	0.46102	0.366000	0.24427	0.561000	0.74099	GGC	.		0.726	AATK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256055.1	NM_004920	
NEDD4L	23327	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	18	56035075	56035075	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5KU-01A-11D-A29I-10	TCGA-OR-A5KU-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9652ca0-126e-4332-909a-4e2d2fc489ef	68f72637-d9e1-41a6-8bd0-b4f99bbc13a1	g.chr18:56035075G>A	ENST00000400345.3	+	22	2444	c.2161G>A	c.(2161-2163)Gta>Ata	p.V721I	NEDD4L_ENST00000586263.1_Missense_Mutation_p.V693I|NEDD4L_ENST00000456986.1_Missense_Mutation_p.V600I|NEDD4L_ENST00000431212.2_Missense_Mutation_p.V600I|NEDD4L_ENST00000356462.6_Missense_Mutation_p.V657I|NEDD4L_ENST00000256832.7_Missense_Mutation_p.V581I|NEDD4L_ENST00000256830.9_Missense_Mutation_p.V617I|NEDD4L_ENST00000382850.4_Missense_Mutation_p.V701I|NEDD4L_ENST00000456173.2_Missense_Mutation_p.V580I|NEDD4L_ENST00000589054.1_Intron|NEDD4L_ENST00000357895.5_Missense_Mutation_p.V713I|NEDD4L_ENST00000435432.2_Missense_Mutation_p.V580I	NM_001144967.2	NP_001138439.1	Q96PU5	NED4L_HUMAN	neural precursor cell expressed, developmentally down-regulated 4-like, E3 ubiquitin protein ligase	721	HECT. {ECO:0000255|PROSITE- ProRule:PRU00104}.				cellular sodium ion homeostasis (GO:0006883)|excretion (GO:0007588)|gene expression (GO:0010467)|ion transmembrane transport (GO:0034220)|negative regulation of potassium ion transmembrane transport (GO:1901380)|negative regulation of potassium ion transmembrane transporter activity (GO:1901017)|negative regulation of protein localization to cell surface (GO:2000009)|negative regulation of sodium ion transmembrane transport (GO:1902306)|negative regulation of sodium ion transmembrane transporter activity (GO:2000650)|negative regulation of systemic arterial blood pressure (GO:0003085)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|positive regulation of cation channel activity (GO:2001259)|positive regulation of caveolin-mediated endocytosis (GO:2001288)|positive regulation of endocytosis (GO:0045807)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of sodium ion transport (GO:0010765)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein K48-linked ubiquitination (GO:0070936)|protein monoubiquitination (GO:0006513)|protein ubiquitination (GO:0016567)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|regulation of ion transmembrane transport (GO:0034765)|regulation of membrane depolarization (GO:0003254)|regulation of membrane potential (GO:0042391)|regulation of membrane repolarization (GO:0060306)|regulation of potassium ion transmembrane transporter activity (GO:1901016)|regulation of protein catabolic process (GO:0042176)|regulation of tight junction assembly (GO:2000810)|response to metal ion (GO:0010038)|response to salt stress (GO:0009651)|sodium ion transport (GO:0006814)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|transmembrane transport (GO:0055085)|ubiquitin-dependent protein catabolic process via the multivesicular body sorting pathway (GO:0043162)|ventricular cardiac muscle cell action potential (GO:0086005)|viral life cycle (GO:0019058)|viral process (GO:0016032)|water homeostasis (GO:0030104)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ion channel binding (GO:0044325)|ligase activity (GO:0016874)|potassium channel inhibitor activity (GO:0019870)|potassium channel regulator activity (GO:0015459)|sodium channel inhibitor activity (GO:0019871)|sodium channel regulator activity (GO:0017080)|ubiquitin-protein transferase activity (GO:0004842)			breast(1)|endometrium(7)|kidney(3)|large_intestine(10)|lung(11)|ovary(1)|prostate(4)	37						TGGTCTGGCCGTATTTCATGG	0.428																																					p.V721I		.											.	NEDD4L-658	0			c.G2161A						.						114.0	103.0	106.0					18																	56035075		1888	4096	5984	SO:0001583	missense	23327	exon22			CTGGCCGTATTTC	AF210730	CCDS45872.1, CCDS45873.1, CCDS45874.1, CCDS45875.1, CCDS45876.1, CCDS58632.1, CCDS59323.1	18q21.31	2014-08-12	2012-02-23		ENSG00000049759				7728	protein-coding gene	gene with protein product		606384	"""neural precursor cell expressed, developmentally down-regulated 4-like"""			10594025, 11244092, 18322022	Standard	NM_001144965		Approved	KIAA0439, RSP5, NEDD4-2	uc002lgy.3	Q96PU5	OTTHUMG00000179875	ENST00000400345.3:c.2161G>A	18.37:g.56035075G>A	ENSP00000383199:p.Val721Ile	Somatic	199	0		WXS	Illumina GAIIx	Phase_I	172	21	NM_001144967	0	0	0	0	0	O43165|Q3LSM7|Q7Z5F1|Q7Z5F2|Q7Z5N3|Q8N5A7|Q8WUU9|Q9BW58|Q9H2W4|Q9NT88	Missense_Mutation	SNP	ENST00000400345.3	37	CCDS45872.1	.	.	.	.	.	.	.	.	.	.	G	22.0	4.233082	0.79688	.	.	ENSG00000049759	ENST00000400345;ENST00000382850;ENST00000356462;ENST00000256830;ENST00000256832;ENST00000456986;ENST00000357895;ENST00000435432;ENST00000456173;ENST00000431212	T;T;T;T;T;T;T;T;T;T	0.36340	1.26;1.26;1.26;1.26;1.26;1.26;1.26;1.26;1.26;1.26	5.42	5.42	0.78866	HECT (4);	0.000000	0.85682	D	0.000000	T	0.44746	0.1308	N	0.12527	0.23	0.80722	D	1	D;P;D;P;D;P	0.89917	0.981;0.943;0.979;0.896;1.0;0.912	P;P;D;D;D;P	0.91635	0.895;0.852;0.984;0.932;0.999;0.852	T	0.48234	-0.9053	10	0.41790	T	0.15	.	19.5873	0.95495	0.0:0.0:1.0:0.0	.	693;713;580;657;721;701	Q96PU5-6;Q96PU5-7;Q3LSM7;Q96PU5-2;Q96PU5;Q96PU5-5	.;.;.;.;NED4L_HUMAN;.	I	721;701;657;617;581;600;713;580;580;600	ENSP00000383199:V721I;ENSP00000372301:V701I;ENSP00000348847:V657I;ENSP00000256830:V617I;ENSP00000256832:V581I;ENSP00000411947:V600I;ENSP00000350569:V713I;ENSP00000393395:V580I;ENSP00000405440:V580I;ENSP00000389406:V600I	ENSP00000256830:V617I	V	+	1	0	NEDD4L	54186055	1.000000	0.71417	0.818000	0.32626	0.915000	0.54546	9.813000	0.99286	2.702000	0.92279	0.650000	0.86243	GTA	.		0.428	NEDD4L-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000448749.1		
PMAIP1	5366	hgsc.bcm.edu	37	18	57567464	57567464	+	Missense_Mutation	SNP	G	G	C			TCGA-OR-A5KU-01A-11D-A29I-10	TCGA-OR-A5KU-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9652ca0-126e-4332-909a-4e2d2fc489ef	68f72637-d9e1-41a6-8bd0-b4f99bbc13a1	g.chr18:57567464G>C	ENST00000316660.6	+	1	285	c.55G>C	c.(55-57)Gca>Cca	p.A19P	PMAIP1_ENST00000269518.9_Missense_Mutation_p.A19P	NM_021127.2	NP_066950.1	Q13794	APR_HUMAN	phorbol-12-myristate-13-acetate-induced protein 1	19					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|apoptotic process (GO:0006915)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|defense response to virus (GO:0051607)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of mitochondrial membrane potential (GO:0010917)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043517)|positive regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902043)|positive regulation of glucose metabolic process (GO:0010907)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|proteasomal protein catabolic process (GO:0010498)|reactive oxygen species metabolic process (GO:0072593)|regulation of mitochondrial membrane permeability (GO:0046902)|release of cytochrome c from mitochondria (GO:0001836)|response to dsRNA (GO:0043331)|response to UV (GO:0009411)|response to X-ray (GO:0010165)|T cell homeostasis (GO:0043029)	cytosol (GO:0005829)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)|nucleus (GO:0005634)				breast(1)	1		Colorectal(73;0.0946)				GCGGGCTCCAGCAGGTACCGA	0.746																																					p.A19P		.											.	PMAIP1-658	0			c.G55C						.						3.0	4.0	4.0					18																	57567464		1769	3605	5374	SO:0001583	missense	5366	exon1			GCTCCAGCAGGTA	D90070	CCDS11975.1	18q21.32	2014-03-07			ENSG00000141682	ENSG00000141682			9108	protein-coding gene	gene with protein product		604959				2398525, 12879012	Standard	NM_021127		Approved	APR, NOXA	uc002lic.2	Q13794	OTTHUMG00000132765	ENST00000316660.6:c.55G>C	18.37:g.57567464G>C	ENSP00000326119:p.Ala19Pro	Somatic	3	0		WXS	Illumina GAIIx	Phase_I	34	29	NM_021127	0	0	0	0	0	B2R4T7|Q8N589	Missense_Mutation	SNP	ENST00000316660.6	37	CCDS11975.1	.	.	.	.	.	.	.	.	.	.	G	11.85	1.761063	0.31137	.	.	ENSG00000141682	ENST00000316660;ENST00000269518	.	.	.	2.76	1.84	0.25277	.	0.257065	0.20543	U	0.090271	T	0.56140	0.1965	.	.	.	0.18873	N	0.999989	D;P	0.76494	0.999;0.661	D;P	0.69479	0.964;0.61	T	0.41610	-0.9499	8	0.87932	D	0	.	6.8348	0.23931	0.0:0.0:0.7241:0.2759	.	19;19	Q8N589;Q13794	.;APR_HUMAN	P	19	.	ENSP00000269518:A19P	A	+	1	0	PMAIP1	55718444	0.015000	0.18098	0.432000	0.26747	0.070000	0.16714	0.104000	0.15313	0.684000	0.31448	0.462000	0.41574	GCA	.		0.746	PMAIP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256137.1	NM_021127	
ARID3A	1820	hgsc.bcm.edu	37	19	929753	929753	+	Silent	SNP	A	A	G	rs1799595	byFrequency	TCGA-OR-A5KU-01A-11D-A29I-10	TCGA-OR-A5KU-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9652ca0-126e-4332-909a-4e2d2fc489ef	68f72637-d9e1-41a6-8bd0-b4f99bbc13a1	g.chr19:929753A>G	ENST00000263620.3	+	2	552	c.225A>G	c.(223-225)ccA>ccG	p.P75P	AC005391.2_ENST00000585647.1_RNA	NM_005224.2	NP_005215.1	Q99856	ARI3A_HUMAN	AT rich interactive domain 3A (BRIGHT-like)	75						cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|membrane raft (GO:0045121)|nucleolus (GO:0005730)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(2)|ovary(1)	10		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;1.04e-05)|all_lung(49;1.53e-05)|Breast(49;9.42e-05)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		TGGGACACCCAGCCAGCCCCG	0.751													t|||	4428	0.884185	0.9062	0.804	5008	,	,		8534	0.998		0.836	False		,,,				2504	0.8436				p.P75P	Pancreas(29;54 1022 32760 50921)	.											.	ARID3A-90	0			c.A225G						.	G		3389,305		1555,279,13	4.0	5.0	5.0		225	-6.8	0.0	19	dbSNP_89	5	6619,1123		2834,951,86	no	coding-synonymous	ARID3A	NM_005224.2		4389,1230,99	GG,GA,AA		14.5053,8.2566,12.4869		75/594	929753	10008,1428	1847	3871	5718	SO:0001819	synonymous_variant	1820	exon2			ACACCCAGCCAGC	U88047	CCDS12050.1	19p13.3	2013-02-07	2006-11-08	2004-01-30		ENSG00000116017		"""-"""	3031	protein-coding gene	gene with protein product		603265	"""dead ringer-like 1 (Drosophila)"", ""AT rich interactive domain 3A (BRIGHT- like)"""	DRIL1		9722953	Standard	NM_005224		Approved	BRIGHT	uc002lql.3	Q99856		ENST00000263620.3:c.225A>G	19.37:g.929753A>G		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	7	7	NM_005224	0	0	0	8	8	Q5I858|Q6P9C6|Q8IZA7|Q8N4Z3	Silent	SNP	ENST00000263620.3	37	CCDS12050.1																																																																																			A|0.114;G|0.886		0.751	ARID3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458219.1	NM_005224	
MATK	4145	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	3778527	3778527	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5KU-01A-11D-A29I-10	TCGA-OR-A5KU-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9652ca0-126e-4332-909a-4e2d2fc489ef	68f72637-d9e1-41a6-8bd0-b4f99bbc13a1	g.chr19:3778527G>A	ENST00000310132.6	-	13	1662	c.1264C>T	c.(1264-1266)Cgg>Tgg	p.R422W	MATK_ENST00000585778.1_Missense_Mutation_p.R421W|MATK_ENST00000395045.2_Missense_Mutation_p.R423W|MATK_ENST00000395040.2_Missense_Mutation_p.R381W	NM_139355.2	NP_647612.1	P42679	MATK_HUMAN	megakaryocyte-associated tyrosine kinase	422	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cell proliferation (GO:0008283)|mesoderm development (GO:0007498)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of cell proliferation (GO:0008284)|protein phosphorylation (GO:0006468)	cytosol (GO:0005829)|membrane (GO:0016020)	ATP binding (GO:0005524)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein tyrosine kinase activity (GO:0004713)			central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(13)|ovary(1)|skin(2)|stomach(2)|urinary_tract(1)	26		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.00461)|STAD - Stomach adenocarcinoma(1328;0.18)		TACGGAGCCCGTCCATATGAG	0.647																																					p.R423W		.											.	MATK-521	0			c.C1267T						.						57.0	62.0	60.0					19																	3778527		2203	4299	6502	SO:0001583	missense	4145	exon13			GAGCCCGTCCATA	L18974	CCDS12113.1, CCDS12114.1, CCDS42468.1	19p13.3	2013-02-14						"""SH2 domain containing"""	6906	protein-coding gene	gene with protein product	"""Csk-homologous kinase"", ""tyrosine-protein kinase CTK"", ""protein kinase HYL"", ""hematopoietic consensus tyrosine-lacking kinase"", ""tyrosylprotein kinase"", ""hydroxyaryl-protein kinase"", ""Csk-type protein tyrosine kinase"", ""HYL tyrosine kinase"", ""tyrosine kinase MATK"", ""leukocyte carboxyl-terminal src kinase related"""	600038				8288563, 7530249	Standard	NM_139355		Approved	HYLTK, CTK, HYL, Lsk, CHK, HHYLTK, DKFZp434N1212, MGC1708, MGC2101	uc002lyt.3	P42679		ENST00000310132.6:c.1264C>T	19.37:g.3778527G>A	ENSP00000308734:p.Arg422Trp	Somatic	85	0		WXS	Illumina GAIIx	Phase_I	211	45	NM_002378	0	0	0	0	0	B3KNZ9|Q9NST8	Missense_Mutation	SNP	ENST00000310132.6	37	CCDS12114.1	.	.	.	.	.	.	.	.	.	.	g	14.86	2.660245	0.47572	.	.	ENSG00000007264	ENST00000395045;ENST00000310132;ENST00000395040	D;D;D	0.83250	-1.7;-1.7;-1.7	3.74	0.116	0.14647	Serine-threonine/tyrosine-protein kinase (2);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.079304	0.51477	D	0.000084	D	0.88815	0.6539	M	0.80028	2.48	0.46981	D	0.99927	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.999;0.999	D	0.86446	0.1770	10	0.87932	D	0	-28.0087	8.4034	0.32601	0.0:0.1434:0.5757:0.2809	.	422;423;422	F1T0G6;B3KNZ9;P42679	.;.;MATK_HUMAN	W	423;422;381	ENSP00000378485:R423W;ENSP00000308734:R422W;ENSP00000378481:R381W	ENSP00000308734:R422W	R	-	1	2	MATK	3729527	1.000000	0.71417	0.784000	0.31847	0.492000	0.33523	2.550000	0.45811	-0.058000	0.13177	-0.240000	0.12126	CGG	.		0.647	MATK-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000453639.1	NM_139355	
C19orf10	56005	hgsc.bcm.edu	37	19	4670313	4670313	+	Missense_Mutation	SNP	C	C	G	rs2270090	byFrequency	TCGA-OR-A5KU-01A-11D-A29I-10	TCGA-OR-A5KU-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9652ca0-126e-4332-909a-4e2d2fc489ef	68f72637-d9e1-41a6-8bd0-b4f99bbc13a1	g.chr19:4670313C>G	ENST00000262947.3	-	1	69	c.34G>C	c.(34-36)Ggc>Cgc	p.G12R	C19orf10_ENST00000599630.1_Missense_Mutation_p.G12R	NM_019107.3	NP_061980.1	Q969H8	CS010_HUMAN	chromosome 19 open reading frame 10	12			G -> R (in dbSNP:rs2270090).		activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)	endoplasmic reticulum lumen (GO:0005788)|extracellular vesicular exosome (GO:0070062)				haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)	2		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.015)		AAGCTCGCGCCGACGCCGTTC	0.756													c|||	1444	0.288339	0.6589	0.098	5008	,	,		7783	0.2411		0.1103	False		,,,				2504	0.1544				p.G12R		.											.	C19orf10-90	0			c.G34C						.	C	ARG/GLY	1761,2025		414,933,546	4.0	5.0	4.0		34	-4.8	0.0	19	dbSNP_100	4	578,6710		38,502,3104	yes	missense	C19orf10	NM_019107.3	125	452,1435,3650	GG,GC,CC		7.9308,46.5135,21.1215	benign	12/174	4670313	2339,8735	1893	3644	5537	SO:0001583	missense	56005	exon1			TCGCGCCGACGCC	AF282264	CCDS12133.1	19p13.3	2013-11-27	2003-06-25	2003-06-27	ENSG00000074842	ENSG00000074842			16948	protein-coding gene	gene with protein product		606746	"""interleukin 27 working designation"""	IL27, IL27w		17362502, 21128247	Standard	NM_019107		Approved	R33729_1, IL25, SF20, IL-25, IL-27	uc002may.3	Q969H8		ENST00000262947.3:c.34G>C	19.37:g.4670313C>G	ENSP00000262947:p.Gly12Arg	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	9	4	NM_019107	0	0	2	6	4	D6W628|O75256|O75272|Q9BTK7|Q9NP69	Missense_Mutation	SNP	ENST00000262947.3	37	CCDS12133.1	541	0.24771062271062272	295	0.5995934959349594	32	0.08839779005524862	134	0.23426573426573427	80	0.10554089709762533	C	13.04	2.119829	0.37436	0.465135	0.079308	ENSG00000074842	ENST00000262947	T	0.47177	0.85	3.82	-4.84	0.03151	.	1.090020	0.07201	U	0.857494	T	0.00012	0.0000	N	0.02011	-0.69	0.80722	P	0.0	B	0.09022	0.002	B	0.15052	0.012	T	0.44329	-0.9335	9	0.59425	D	0.04	-5.96	1.5568	0.02586	0.118:0.2656:0.2321:0.3842	rs2270090;rs60071392	12	Q969H8	CS010_HUMAN	R	12	ENSP00000262947:G12R	ENSP00000262947:G12R	G	-	1	0	C19orf10	4621313	0.000000	0.05858	0.000000	0.03702	0.035000	0.12851	-2.427000	0.01026	-1.087000	0.03081	-0.513000	0.04457	GGC	C|0.752;G|0.248		0.756	C19orf10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458937.1	NM_019107	
CACNA1A	773	hgsc.bcm.edu	37	19	13319693	13319693	+	Silent	SNP	A	A	G	rs16051	byFrequency	TCGA-OR-A5KU-01A-11D-A29I-10	TCGA-OR-A5KU-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9652ca0-126e-4332-909a-4e2d2fc489ef	68f72637-d9e1-41a6-8bd0-b4f99bbc13a1	g.chr19:13319693A>G	ENST00000360228.5	-	46	6656	c.6657T>C	c.(6655-6657)caT>caC	p.H2219H	CACNA1A_ENST00000573710.2_Silent_p.H2220H	NM_000068.3|NM_001127222.1|NM_001174080.1|NM_023035.2	NP_000059.3|NP_001120694.1|NP_001167551.1|NP_075461.2	O00555	CAC1A_HUMAN	calcium channel, voltage-dependent, P/Q type, alpha 1A subunit	2220	Poly-His.				adult walking behavior (GO:0007628)|behavioral response to pain (GO:0048266)|calcium ion import (GO:0070509)|calcium ion-dependent exocytosis (GO:0017156)|calcium ion-dependent exocytosis of neurotransmitter (GO:0048791)|cell death (GO:0008219)|cell growth (GO:0016049)|cellular chloride ion homeostasis (GO:0030644)|cerebellar molecular layer development (GO:0021679)|cerebellar Purkinje cell differentiation (GO:0021702)|cerebellum maturation (GO:0021590)|dendrite morphogenesis (GO:0048813)|energy reserve metabolic process (GO:0006112)|gamma-aminobutyric acid secretion (GO:0014051)|gamma-aminobutyric acid signaling pathway (GO:0007214)|glucose metabolic process (GO:0006006)|hormone metabolic process (GO:0042445)|membrane depolarization (GO:0051899)|membrane depolarization during action potential (GO:0086010)|musculoskeletal movement, spinal reflex action (GO:0050883)|negative regulation of hormone biosynthetic process (GO:0032353)|negative regulation of neuron apoptotic process (GO:0043524)|neuromuscular process controlling balance (GO:0050885)|neuromuscular synaptic transmission (GO:0007274)|neurotransmitter metabolic process (GO:0042133)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|receptor clustering (GO:0043113)|regulation of acetylcholine secretion, neurotransmission (GO:0014056)|regulation of axonogenesis (GO:0050770)|regulation of calcium ion-dependent exocytosis (GO:0017158)|regulation of insulin secretion (GO:0050796)|rhythmic synaptic transmission (GO:0060024)|small molecule metabolic process (GO:0044281)|spinal cord motor neuron differentiation (GO:0021522)|sulfur amino acid metabolic process (GO:0000096)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transmission of nerve impulse (GO:0019226)|vestibular nucleus development (GO:0021750)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	high voltage-gated calcium channel activity (GO:0008331)|metal ion binding (GO:0046872)|syntaxin binding (GO:0019905)|voltage-gated calcium channel activity (GO:0005245)			breast(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(25)|prostate(2)|urinary_tract(1)	42			OV - Ovarian serous cystadenocarcinoma(19;5.07e-21)		Bepridil(DB01244)|Loperamide(DB00836)|Pregabalin(DB00230)|Spironolactone(DB00421)|Verapamil(DB00661)	GGGGCGGGGGAtggtggtggt	0.731													g|||	3440	0.686901	0.7874	0.6081	5008	,	,		6615	0.7897		0.6252	False		,,,				2504	0.5644				p.H2220H		.											.	CACNA1A-67	0			c.T6660C						.		,,,,	2283,905		898,487,209	3.0	4.0	3.0		6675,6660,6657,6666,6675		1.0	19	dbSNP_54	3	3993,3127		1321,1351,888	no	coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous	CACNA1A	NM_000068.3,NM_001127221.1,NM_001127222.1,NM_001174080.1,NM_023035.2	,,,,	2219,1838,1097	GG,GA,AA		43.9185,28.3877,39.1153	,,,,	2225/2267,2220/2262,2219/2507,2222/2264,2225/2513	13319693	6276,4032	1594	3560	5154	SO:0001819	synonymous_variant	773	exon46			CGGGGGATGGTGG	U79666	CCDS45998.1, CCDS45999.1	19p13	2014-09-17			ENSG00000141837	ENSG00000141837		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1388	protein-coding gene	gene with protein product		601011		CACNL1A4, SCA6, MHP1, MHP		8825650, 16382099, 23827678	Standard	NM_000068		Approved	Cav2.1, EA2, APCA, HPCA, FHM	uc010xne.2	O00555	OTTHUMG00000044590	ENST00000360228.5:c.6657T>C	19.37:g.13319693A>G		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	23	9	NM_001127221	0	0	0	0	0	J3KP41|P78510|P78511|Q16290|Q92690|Q99790|Q99791|Q99792|Q99793|Q9NS88|Q9UDC4	Silent	SNP	ENST00000360228.5	37	CCDS45998.1																																																																																			A|0.360;G|0.640		0.731	CACNA1A-001	KNOWN	non_canonical_U12|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000104062.2	NM_000068	
RAB8A	4218	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	16222725	16222725	+	Missense_Mutation	SNP	A	A	G			TCGA-OR-A5KU-01A-11D-A29I-10	TCGA-OR-A5KU-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9652ca0-126e-4332-909a-4e2d2fc489ef	68f72637-d9e1-41a6-8bd0-b4f99bbc13a1	g.chr19:16222725A>G	ENST00000300935.3	+	1	287	c.14A>G	c.(13-15)tAc>tGc	p.Y5C	RAB8A_ENST00000586682.1_Missense_Mutation_p.Y5C|RAB8A_ENST00000588105.1_3'UTR	NM_005370.4	NP_005361.2	P61006	RAB8A_HUMAN	RAB8A, member RAS oncogene family	5					axonogenesis (GO:0007409)|cellular response to insulin stimulus (GO:0032869)|cilium assembly (GO:0042384)|G2/M transition of mitotic cell cycle (GO:0000086)|Golgi vesicle fusion to target membrane (GO:0048210)|GTP catabolic process (GO:0006184)|membrane organization (GO:0061024)|mitotic cell cycle (GO:0000278)|protein localization to plasma membrane (GO:0072659)|protein transport (GO:0015031)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of protein transport (GO:0051223)|small GTPase mediated signal transduction (GO:0007264)|vesicle docking involved in exocytosis (GO:0006904)	centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cilium (GO:0005929)|cytoplasmic vesicle membrane (GO:0030659)|dendrite (GO:0030425)|extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|neuronal cell body (GO:0043025)|nonmotile primary cilium (GO:0031513)|phagocytic vesicle (GO:0045335)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|primary cilium (GO:0072372)|recycling endosome membrane (GO:0055038)|trans-Golgi network transport vesicle (GO:0030140)	GDP binding (GO:0019003)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|myosin V binding (GO:0031489)|Rab GTPase binding (GO:0017137)			endometrium(2)|large_intestine(1)|lung(2)|prostate(2)|skin(1)	8						GCGAAGACCTACGATTACCTG	0.602																																					p.Y5C		.											.	RAB8A-227	0			c.A14G						.						180.0	180.0	180.0					19																	16222725		2203	4300	6503	SO:0001583	missense	4218	exon1			AGACCTACGATTA		CCDS12339.1	19p13.2-p13.1	2008-05-14	2004-01-30	2004-01-30		ENSG00000167461		"""RAB, member RAS oncogene"""	7007	protein-coding gene	gene with protein product		165040	"""mel transforming oncogene (derived from cell line NK14)"""	MEL		1886711, 8408203	Standard	NM_005370		Approved	RAB8	uc002ndn.4	P61006		ENST00000300935.3:c.14A>G	19.37:g.16222725A>G	ENSP00000300935:p.Tyr5Cys	Somatic	84	0		WXS	Illumina GAIIx	Phase_I	105	40	NM_005370	0	0	1	3	2	B4DEK7|P24407|Q6FHV5	Missense_Mutation	SNP	ENST00000300935.3	37	CCDS12339.1	.	.	.	.	.	.	.	.	.	.	A	25.5	4.640217	0.87859	.	.	ENSG00000167461	ENST00000300935	T	0.80304	-1.36	4.54	4.54	0.55810	.	0.000000	0.85682	D	0.000000	D	0.87446	0.6179	M	0.63843	1.955	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.88765	0.3260	10	0.87932	D	0	.	13.478	0.61320	1.0:0.0:0.0:0.0	.	5;5	B4DEK7;P61006	.;RAB8A_HUMAN	C	5	ENSP00000300935:Y5C	ENSP00000300935:Y5C	Y	+	2	0	RAB8A	16083725	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.845000	0.75394	2.034000	0.60081	0.402000	0.26972	TAC	.		0.602	RAB8A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000460186.1	NM_005370	
CRTC1	23373	hgsc.bcm.edu	37	19	18879375	18879375	+	Silent	SNP	G	G	A			TCGA-OR-A5KU-01A-11D-A29I-10	TCGA-OR-A5KU-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9652ca0-126e-4332-909a-4e2d2fc489ef	68f72637-d9e1-41a6-8bd0-b4f99bbc13a1	g.chr19:18879375G>A	ENST00000321949.8	+	10	1118	c.1092G>A	c.(1090-1092)ccG>ccA	p.P364P	CRTC1_ENST00000338797.6_Silent_p.P380P|CRTC1_ENST00000601916.1_Intron|CRTC1_ENST00000594658.1_Silent_p.P323P	NM_015321.2	NP_056136.2			CREB regulated transcription coactivator 1										CRTC1/MAML2(516)	NS(1)|breast(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(6)|ovary(1)|skin(1)	19						AGCAgccaccgccgcagcccc	0.751																																					p.P380P		.											.	CRTC1-1361	0			c.G1140A						.						5.0	6.0	6.0					19																	18879375		1744	3552	5296	SO:0001819	synonymous_variant	23373	exon11			GCCACCGCCGCAG	AY040323	CCDS32963.1, CCDS42525.1	19p13	2012-07-31	2005-11-24	2005-11-24					16062	protein-coding gene	gene with protein product	"""transducer of regulated cAMP response element-binding protein"""	607536	"""mucoepidermoid carcinoma translocated 1"""	MECT1		12539049, 14536081, 14506290	Standard	NM_015321		Approved	KIAA0616, FLJ14027, TORC1	uc010ebv.3	Q6UUV9		ENST00000321949.8:c.1092G>A	19.37:g.18879375G>A		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	26	13	NM_001098482	0	0	1	2	1		Silent	SNP	ENST00000321949.8	37	CCDS32963.1																																																																																			.		0.751	CRTC1-002	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465151.3	NM_025021	
GDF1	2657	hgsc.bcm.edu	37	19	18980172	18980172	+	Missense_Mutation	SNP	G	G	A	rs4808863	byFrequency	TCGA-OR-A5KU-01A-11D-A29I-10	TCGA-OR-A5KU-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9652ca0-126e-4332-909a-4e2d2fc489ef	68f72637-d9e1-41a6-8bd0-b4f99bbc13a1	g.chr19:18980172G>A	ENST00000247005.6	-	8	1698	c.353C>T	c.(352-354)gCc>gTc	p.A118V	CERS1_ENST00000427170.2_3'UTR			P27539	GDF1_HUMAN	growth differentiation factor 1	118			A -> V (in dbSNP:rs4808863). {ECO:0000269|PubMed:2034669}.		growth (GO:0040007)	extracellular space (GO:0005615)											CGCGGCCGAGGCAGGCTCCGA	0.716													g|||	1171	0.233826	0.0401	0.4986	5008	,	,		5099	0.1687		0.3946	False		,,,				2504	0.2096				p.A118V		.											.	GDF1-226	0			c.C353T						.						2.0	2.0	2.0					19																	18980172		1157	2328	3485	SO:0001583	missense	2657	exon8			GCCGAGGCAGGCT	M62302	CCDS42526.1	19p13.11	2014-01-30			ENSG00000130283	ENSG00000130283		"""Endogenous ligands"""	4214	protein-coding gene	gene with protein product		602880				2034669	Standard	NM_001492		Approved			P27539		ENST00000247005.6:c.353C>T	19.37:g.18980172G>A	ENSP00000247005:p.Ala118Val	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	6	6	NM_001492	0	0	0	5	5	O43344	Missense_Mutation	SNP	ENST00000247005.6	37	CCDS42526.1	621	0.28434065934065933	39	0.07926829268292683	184	0.5082872928176796	110	0.19230769230769232	288	0.37994722955145116	g	11.82	1.752739	0.31046	.	.	ENSG00000130283	ENST00000247005	T	0.78481	-1.18	3.33	0.926	0.19430	.	0.692776	0.14240	U	0.332130	T	0.00012	0.0000	L	0.44542	1.39	0.58432	P	1.0000000000287557E-6	.	.	.	.	.	.	T	0.41805	-0.9488	7	0.16896	T	0.51	.	9.0728	0.36502	0.0:0.4429:0.5571:0.0	rs4808863	.	.	.	V	118	ENSP00000247005:A118V	ENSP00000247005:A118V	A	-	2	0	GDF1	18841172	0.000000	0.05858	0.001000	0.08648	0.008000	0.06430	0.201000	0.17276	-0.047000	0.13423	-0.546000	0.04227	GCC	G|0.715;A|0.285		0.716	GDF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465926.1	NM_001492	
DMKN	93099	hgsc.bcm.edu	37	19	36002386	36002386	+	Missense_Mutation	SNP	C	C	T	rs56743379|rs117522133		TCGA-OR-A5KU-01A-11D-A29I-10	TCGA-OR-A5KU-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9652ca0-126e-4332-909a-4e2d2fc489ef	68f72637-d9e1-41a6-8bd0-b4f99bbc13a1	g.chr19:36002386C>T	ENST00000339686.3	-	5	1021	c.845G>A	c.(844-846)aGt>aAt	p.S282N	DMKN_ENST00000472252.2_5'Flank|DMKN_ENST00000461300.1_5'Flank|DMKN_ENST00000429837.1_Intron|DMKN_ENST00000492341.2_5'Flank|DMKN_ENST00000602781.1_5'Flank|DMKN_ENST00000392206.2_5'Flank|DMKN_ENST00000458071.1_5'Flank|DMKN_ENST00000488892.1_5'Flank|DMKN_ENST00000414866.2_5'Flank|DMKN_ENST00000419602.1_Intron|DMKN_ENST00000436012.1_5'Flank|DMKN_ENST00000462126.1_5'Flank|DMKN_ENST00000418261.1_Missense_Mutation_p.S282N|DMKN_ENST00000402589.2_5'Flank|DMKN_ENST00000474928.1_5'Flank|DMKN_ENST00000424570.2_Missense_Mutation_p.S282N|DMKN_ENST00000467637.1_5'Flank|DMKN_ENST00000443640.1_5'Flank|DMKN_ENST00000451297.2_Missense_Mutation_p.S282N|DMKN_ENST00000440396.1_Missense_Mutation_p.S282N|DMKN_ENST00000480502.1_5'Flank|DMKN_ENST00000447113.2_Missense_Mutation_p.S282N	NM_033317.4	NP_201574	Q6E0U4	DMKN_HUMAN	dermokine	282	Gly-rich.					extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)		p.S274_S290del(1)		NS(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(8)|lung(7)|ovary(1)|prostate(1)|skin(2)	27	all_lung(56;1.89e-08)|Lung NSC(56;2.9e-08)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0724)			gctgccgccactgctgccgcc	0.632																																					p.S282N		.											.	DMKN-155	1	Deletion - In frame(1)	ovary(1)	c.G845A						.						26.0	20.0	22.0					19																	36002386		2190	4261	6451	SO:0001583	missense	93099	exon5			CCGCCACTGCTGC	BC035311	CCDS12463.1, CCDS42549.1, CCDS46051.1, CCDS46052.1, CCDS46053.1, CCDS46054.1, CCDS46054.2, CCDS54250.1, CCDS54251.1, CCDS54252.1	19q13.12	2008-10-27			ENSG00000161249	ENSG00000161249			25063	protein-coding gene	gene with protein product						16374476	Standard	NM_001035516		Approved	ZD52F10	uc002nzm.4	Q6E0U4	OTTHUMG00000048101	ENST00000339686.3:c.845G>A	19.37:g.36002386C>T	ENSP00000342012:p.Ser282Asn	Somatic	78	0		WXS	Illumina GAIIx	Phase_I	92	19	NM_001126058	0	0	0	0	0	A3EZ79|A3EZ80|A3EZ81|A3EZ82|A3EZ83|C9J4P6|C9J5N8|C9JAL3|Q32W58|Q32W62|Q32W63|Q32W64|Q32W65|Q32W66|Q32W67|Q6E0U5|Q6UXC7|Q96EW8|Q9BSY6	Missense_Mutation	SNP	ENST00000339686.3	37	CCDS12463.1	.	.	.	.	.	.	.	.	.	.	C	9.113	1.007164	0.19199	.	.	ENSG00000161249	ENST00000339686;ENST00000392207;ENST00000447113;ENST00000440396;ENST00000418261;ENST00000424570;ENST00000451297	T;T;T;T;T;T	0.48201	0.82;0.82;0.82;0.82;0.82;0.82	3.03	0.883	0.19177	.	1.984400	0.02204	N	0.062511	T	0.35098	0.0920	L	0.32530	0.975	0.09310	N	1	B;B;B;B;B	0.09022	0.002;0.002;0.002;0.002;0.001	B;B;B;B;B	0.10450	0.005;0.005;0.005;0.005;0.005	T	0.09862	-1.0655	10	0.12766	T	0.61	.	5.3636	0.16101	0.0:0.731:0.0:0.2689	.	282;282;282;282;282	E7EUS0;Q6E0U4-7;Q6E0U4-3;Q6E0U4-5;Q6E0U4	.;.;.;.;DMKN_HUMAN	N	282	ENSP00000342012:S282N;ENSP00000394908:S282N;ENSP00000415277:S282N;ENSP00000414743:S282N;ENSP00000388404:S282N;ENSP00000409513:S282N	ENSP00000342012:S282N	S	-	2	0	DMKN	40694226	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	0.157000	0.16402	0.352000	0.24053	-0.221000	0.12465	AGT	C|0.945;T|0.055		0.632	DMKN-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000109461.2	NM_033317	
DMKN	93099	hgsc.bcm.edu	37	19	36002410	36002412	+	In_Frame_Del	DEL	CTG	CTG	-	rs56743379|rs111543270|rs199498909		TCGA-OR-A5KU-01A-11D-A29I-10	TCGA-OR-A5KU-10A-01D-A29L-10	CTG	CTG	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9652ca0-126e-4332-909a-4e2d2fc489ef	68f72637-d9e1-41a6-8bd0-b4f99bbc13a1	g.chr19:36002410_36002412delCTG	ENST00000339686.3	-	5	995_997	c.819_821delCAG	c.(817-822)agcagt>agt	p.273_274SS>S	DMKN_ENST00000472252.2_5'Flank|DMKN_ENST00000461300.1_5'Flank|DMKN_ENST00000429837.1_Intron|DMKN_ENST00000492341.2_5'Flank|DMKN_ENST00000602781.1_5'Flank|DMKN_ENST00000392206.2_5'Flank|DMKN_ENST00000458071.1_5'Flank|DMKN_ENST00000488892.1_5'Flank|DMKN_ENST00000414866.2_5'Flank|DMKN_ENST00000419602.1_Intron|DMKN_ENST00000436012.1_5'Flank|DMKN_ENST00000462126.1_5'Flank|DMKN_ENST00000418261.1_In_Frame_Del_p.273_274SS>S|DMKN_ENST00000402589.2_5'Flank|DMKN_ENST00000474928.1_5'Flank|DMKN_ENST00000424570.2_In_Frame_Del_p.273_274SS>S|DMKN_ENST00000467637.1_5'Flank|DMKN_ENST00000443640.1_5'Flank|DMKN_ENST00000451297.2_In_Frame_Del_p.273_274SS>S|DMKN_ENST00000440396.1_In_Frame_Del_p.273_274SS>S|DMKN_ENST00000480502.1_5'Flank|DMKN_ENST00000447113.2_In_Frame_Del_p.273_274SS>S	NM_033317.4	NP_201574	Q6E0U4	DMKN_HUMAN	dermokine	273	Gly-rich.					extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)		p.S274_S290del(1)		NS(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(8)|lung(7)|ovary(1)|prostate(1)|skin(2)	27	all_lung(56;1.89e-08)|Lung NSC(56;2.9e-08)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0724)			gctgctgccactgctgctgccac	0.655																																					p.273_274del		.											.	DMKN-155	1	Deletion - In frame(1)	ovary(1)	c.819_821del						.																																			SO:0001651	inframe_deletion	93099	exon5			CTGCCACTGCTGC	BC035311	CCDS12463.1, CCDS42549.1, CCDS46051.1, CCDS46052.1, CCDS46053.1, CCDS46054.1, CCDS46054.2, CCDS54250.1, CCDS54251.1, CCDS54252.1	19q13.12	2008-10-27			ENSG00000161249	ENSG00000161249			25063	protein-coding gene	gene with protein product						16374476	Standard	NM_001035516		Approved	ZD52F10	uc002nzm.4	Q6E0U4	OTTHUMG00000048101	ENST00000339686.3:c.819_821delCAG	19.37:g.36002416_36002418delCTG	ENSP00000342012:p.Ser274del	Somatic	72	0		WXS	Illumina GAIIx	Phase_I	101	22	NM_001126058	0	0	0	0	0	A3EZ79|A3EZ80|A3EZ81|A3EZ82|A3EZ83|C9J4P6|C9J5N8|C9JAL3|Q32W58|Q32W62|Q32W63|Q32W64|Q32W65|Q32W66|Q32W67|Q6E0U5|Q6UXC7|Q96EW8|Q9BSY6	In_Frame_Del	DEL	ENST00000339686.3	37	CCDS12463.1																																																																																			.		0.655	DMKN-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000109461.2	NM_033317	
FBXO17	115290	hgsc.bcm.edu	37	19	39440918	39440918	+	Silent	SNP	T	T	C	rs2304117	byFrequency	TCGA-OR-A5KU-01A-11D-A29I-10	TCGA-OR-A5KU-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9652ca0-126e-4332-909a-4e2d2fc489ef	68f72637-d9e1-41a6-8bd0-b4f99bbc13a1	g.chr19:39440918T>C	ENST00000292852.4	-	2	383	c.42A>G	c.(40-42)ccA>ccG	p.P14P	SARS2_ENST00000448145.2_5'Flank|FBXO17_ENST00000595329.1_Silent_p.P14P|CTC-360G5.8_ENST00000599996.1_5'Flank	NM_024907.5	NP_079183.4	Q96EF6	FBX17_HUMAN	F-box protein 17	14						SCF ubiquitin ligase complex (GO:0019005)	glycoprotein binding (GO:0001948)			breast(1)|endometrium(1)|large_intestine(1)|lung(3)|prostate(1)	7	all_cancers(60;8.37e-07)|all_lung(34;3.71e-07)|Lung NSC(34;4.17e-07)|all_epithelial(25;1.13e-06)|Ovarian(47;0.0454)		Lung(45;0.000419)|LUSC - Lung squamous cell carcinoma(53;0.000554)			GGGCCAGGGATGGGTCCGCCG	0.731													c|||	2378	0.47484	0.3336	0.3746	5008	,	,		11867	0.6796		0.4195	False		,,,				2504	0.5828				p.P23P		.											.	FBXO17-226	0			c.A69G						.		,	1052,2556		213,626,965	3.0	4.0	3.0		42,69	0.5	0.0	19	dbSNP_100	3	2265,4819		496,1273,1773	no	coding-synonymous,coding-synonymous	FBXO17	NM_024907.5,NM_148169.1	,	709,1899,2738	CC,CT,TT		31.9735,29.1574,31.0232	,	14/279,23/288	39440918	3317,7375	1804	3542	5346	SO:0001819	synonymous_variant	115290	exon2			CAGGGATGGGTCC	AF386743	CCDS12526.1	19q13.2	2010-07-02	2004-06-15	2004-06-16		ENSG00000269190		"""F-boxes /  ""other"""""	18754	protein-coding gene	gene with protein product	"""F-box only protein 26"""	609094	"""F-box only protein 17"""	FBXO26			Standard	NM_148169		Approved	FBG4, FLJ25205, MGC9379, FLJ11798, Fbx17		Q96EF6		ENST00000292852.4:c.42A>G	19.37:g.39440918T>C		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	22	8	NM_148169	0	0	0	1	1	Q96LQ4	Silent	SNP	ENST00000292852.4	37	CCDS12526.1																																																																																			T|0.545;C|0.455		0.731	FBXO17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463273.1	NM_024907	
CLASRP	11129	hgsc.bcm.edu	37	19	45567668	45567668	+	Missense_Mutation	SNP	C	C	A	rs71352251	byFrequency	TCGA-OR-A5KU-01A-11D-A29I-10	TCGA-OR-A5KU-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9652ca0-126e-4332-909a-4e2d2fc489ef	68f72637-d9e1-41a6-8bd0-b4f99bbc13a1	g.chr19:45567668C>A	ENST00000221455.3	+	13	1287	c.1189C>A	c.(1189-1191)Cgc>Agc	p.R397S	CLASRP_ENST00000391953.4_Missense_Mutation_p.R335S|CLASRP_ENST00000544944.2_Missense_Mutation_p.R397S	NM_007056.2	NP_008987	Q8N2M8	CLASR_HUMAN	CLK4-associating serine/arginine rich protein	397	Arg-rich.|Ser-rich.				mRNA processing (GO:0006397)|RNA splicing (GO:0008380)	nucleus (GO:0005634)				breast(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(6)|pancreas(2)|prostate(1)	16						ctccagctctcgctccagctc	0.751													C|||	9	0.00179712	0.0	0.0014	5008	,	,		8999	0.0		0.008	False		,,,				2504	0.0				p.R397S		.											.	CLASRP-154	0			c.C1189A						.	C	SER/ARG	15,3921		0,15,1953	7.0	8.0	8.0		1189	2.2	0.9	19	dbSNP_130	8	110,7628		0,110,3759	yes	missense	CLASRP	NM_007056.2	110	0,125,5712	AA,AC,CC		1.4216,0.3811,1.0708	benign	397/675	45567668	125,11549	1968	3869	5837	SO:0001583	missense	11129	exon13			AGCTCTCGCTCCA	AF042800	CCDS12652.2, CCDS62710.1	19q13.3	2010-09-21	2010-09-21	2010-09-21	ENSG00000104859	ENSG00000104859			17731	protein-coding gene	gene with protein product	"""Clk4 associating SR-related protein"""		"""splicing factor, arginine/serine-rich 16"""	SFRS16		12169693	Standard	NM_007056		Approved	SWAP2, CLASP	uc002pak.3	Q8N2M8	OTTHUMG00000150189	ENST00000221455.3:c.1189C>A	19.37:g.45567668C>A	ENSP00000221455:p.Arg397Ser	Somatic	4	0		WXS	Illumina GAIIx	Phase_I	33	9	NM_007056	0	0	1	5	4	B4DDT8|F8WAG9|O96026|Q6UW71|Q96DX2	Missense_Mutation	SNP	ENST00000221455.3	37	CCDS12652.2	8	0.003663003663003663	0	0.0	1	0.0027624309392265192	0	0.0	7	0.009234828496042216	C	9.225	1.034325	0.19590	0.003811	0.014216	ENSG00000104859	ENST00000221455;ENST00000391952;ENST00000391953;ENST00000544944	T;T;T;T	0.10960	2.82;2.83;2.82;2.82	4.39	2.19	0.27852	.	0.442461	0.16641	N	0.205652	T	0.03695	0.0105	N	0.19112	0.55	0.47698	D	0.999495	B;B;B	0.06786	0.001;0.0;0.0	B;B;B	0.11329	0.006;0.001;0.0	T	0.29305	-1.0016	10	0.02654	T	1	-2.0521	9.152	0.36969	0.4644:0.5356:0.0:0.0	.	335;397;397	F8WAG9;F5H0Q6;Q8N2M8	.;.;CLASR_HUMAN	S	397;397;335;397	ENSP00000221455:R397S;ENSP00000375814:R397S;ENSP00000375815:R335S;ENSP00000438702:R397S	ENSP00000221455:R397S	R	+	1	0	CLASRP	50259508	0.075000	0.21258	0.922000	0.36590	0.800000	0.45204	0.653000	0.24902	0.414000	0.25790	0.563000	0.77884	CGC	C|0.996;A|0.004		0.751	CLASRP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316749.1	NM_007056	
NTN5	126147	hgsc.bcm.edu	37	19	49164952	49164952	+	Silent	SNP	A	A	G	rs281392	byFrequency	TCGA-OR-A5KU-01A-11D-A29I-10	TCGA-OR-A5KU-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9652ca0-126e-4332-909a-4e2d2fc489ef	68f72637-d9e1-41a6-8bd0-b4f99bbc13a1	g.chr19:49164952A>G	ENST00000270235.4	-	7	1547	c.1452T>C	c.(1450-1452)agT>agC	p.S484S	SEC1P_ENST00000430145.2_RNA	NM_145807.1	NP_665806.1	Q8WTR8	NET5_HUMAN	netrin 5	484						extracellular region (GO:0005576)				central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(4)|pancreas(1)|prostate(1)	10						CCGGCCTGGGACTGGGTGTGG	0.687													G|||	2669	0.532947	0.351	0.4669	5008	,	,		9559	0.5625		0.6421	False		,,,				2504	0.683				p.S484S		.											.	NTN5-136	0			c.T1452C						.	G		1663,2349		390,883,733	9.0	9.0	9.0		1452	2.2	0.0	19	dbSNP_79	9	5217,2785		1816,1585,600	no	coding-synonymous	NTN5	NM_145807.1		2206,2468,1333	GG,GA,AA		34.8038,41.4506,42.7335		484/490	49164952	6880,5134	2006	4001	6007	SO:0001819	synonymous_variant	126147	exon7			CCTGGGACTGGGT		CCDS33068.1	19q13.33	2013-03-01			ENSG00000142233	ENSG00000142233		"""Netrins"""	25208	protein-coding gene	gene with protein product	"""Netrin-5"""					12477932	Standard	NM_145807		Approved		uc002pkb.3	Q8WTR8		ENST00000270235.4:c.1452T>C	19.37:g.49164952A>G		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	8	8	NM_145807	0	0	0	3	3	Q8N4X9|Q8WU63	Silent	SNP	ENST00000270235.4	37	CCDS33068.1																																																																																			A|0.464;G|0.536		0.687	NTN5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466176.1	NM_145807	
RASIP1	54922	hgsc.bcm.edu	37	19	49232226	49232226	+	Missense_Mutation	SNP	G	G	A	rs2287922	byFrequency	TCGA-OR-A5KU-01A-11D-A29I-10	TCGA-OR-A5KU-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9652ca0-126e-4332-909a-4e2d2fc489ef	68f72637-d9e1-41a6-8bd0-b4f99bbc13a1	g.chr19:49232226G>A	ENST00000222145.4	-	5	2005	c.1801C>T	c.(1801-1803)Cgc>Tgc	p.R601C	RASIP1_ENST00000594232.1_5'Flank	NM_017805.2	NP_060275.2	Q5U651	RAIN_HUMAN	Ras interacting protein 1	601	Dilute. {ECO:0000255|PROSITE- ProRule:PRU00503}.		R -> C (in dbSNP:rs2287922). {ECO:0000269|PubMed:15031288}.		angiogenesis (GO:0001525)|branching morphogenesis of an epithelial tube (GO:0048754)|negative regulation of autophagy (GO:0010507)|regulation of Rho GTPase activity (GO:0032319)|signal transduction (GO:0007165)|vasculogenesis (GO:0001570)	Golgi apparatus (GO:0005794)				central_nervous_system(1)|endometrium(2)|large_intestine(5)|lung(7)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	21		all_lung(116;4.89e-06)|all_epithelial(76;7.04e-06)|Lung NSC(112;9.34e-06)|all_neural(266;0.0189)|Ovarian(192;0.0261)		OV - Ovarian serous cystadenocarcinoma(262;9.98e-05)|all cancers(93;0.000272)|Epithelial(262;0.0155)|GBM - Glioblastoma multiforme(486;0.0222)		CGGGCCAGGCGGCCCAGCAGT	0.731													G|||	1076	0.214856	0.1157	0.2997	5008	,	,		8786	0.0198		0.4791	False		,,,				2504	0.2178				p.R601C		.											.	RASIP1-228	0			c.C1801T						.	G	CYS/ARG	456,2624		82,292,1166	2.0	3.0	3.0		1801	4.2	1.0	19	dbSNP_100	3	2661,3381		645,1371,1005	yes	missense	RASIP1	NM_017805.2	180	727,1663,2171	AA,AG,GG		44.0417,14.8052,34.1701	probably-damaging	601/964	49232226	3117,6005	1540	3021	4561	SO:0001583	missense	54922	exon5			CCAGGCGGCCCAG	BC028614	CCDS12731.1	19q13.33	2008-02-05				ENSG00000105538			24716	protein-coding gene	gene with protein product		609623				15031288	Standard	NM_017805		Approved	FLJ20401, RAIN	uc002pki.3	Q5U651		ENST00000222145.4:c.1801C>T	19.37:g.49232226G>A	ENSP00000222145:p.Arg601Cys	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	6	4	NM_017805	0	0	0	2	2	Q6U676	Missense_Mutation	SNP	ENST00000222145.4	37	CCDS12731.1	571	0.26144688644688646	65	0.13211382113821138	127	0.35082872928176795	21	0.03671328671328671	358	0.47229551451187335	G	17.28	3.350878	0.61183	0.148052	0.440417	ENSG00000105538	ENST00000222145	T	0.27557	1.66	4.17	4.17	0.49024	Dilute (1);	0.331247	0.23983	N	0.042644	T	0.00012	0.0000	L	0.39898	1.24	0.22701	P	0.99883638	D	0.76494	0.999	P	0.54590	0.756	T	0.48328	-0.9045	9	0.66056	D	0.02	-0.9078	9.7493	0.40466	0.0:0.0:0.7933:0.2067	rs2287922	601	Q5U651	RAIN_HUMAN	C	601	ENSP00000222145:R601C	ENSP00000222145:R601C	R	-	1	0	RASIP1	53924038	1.000000	0.71417	1.000000	0.80357	0.642000	0.38348	3.181000	0.50903	2.023000	0.59567	0.462000	0.41574	CGC	G|0.738;A|0.262		0.731	RASIP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466185.1	NM_017805	
NR1H2	7376	ucsc.edu	37	19	50881825	50881825	+	Silent	SNP	G	G	A	rs55817866	byFrequency	TCGA-OR-A5KU-01A-11D-A29I-10	TCGA-OR-A5KU-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9652ca0-126e-4332-909a-4e2d2fc489ef	68f72637-d9e1-41a6-8bd0-b4f99bbc13a1	g.chr19:50881825G>A	ENST00000253727.5	+	6	754	c.519G>A	c.(517-519)caG>caA	p.Q173Q	NR1H2_ENST00000598168.1_Silent_p.Q173Q|NR1H2_ENST00000411902.2_Silent_p.Q76Q|NR1H2_ENST00000593926.1_Silent_p.Q173Q|NR1H2_ENST00000542413.1_5'UTR|NR1H2_ENST00000599105.1_Silent_p.Q173Q	NM_007121.5	NP_009052	P55055	NR1H2_HUMAN	nuclear receptor subfamily 1, group H, member 2	173					cellular lipid metabolic process (GO:0044255)|gene expression (GO:0010467)|negative regulation of cholesterol storage (GO:0010887)|negative regulation of interferon-gamma-mediated signaling pathway (GO:0060336)|negative regulation of lipid transport (GO:0032369)|negative regulation of macrophage derived foam cell differentiation (GO:0010745)|negative regulation of pinocytosis (GO:0048550)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cellular protein metabolic process (GO:0032270)|positive regulation of cholesterol efflux (GO:0010875)|positive regulation of cholesterol transport (GO:0032376)|positive regulation of fatty acid biosynthetic process (GO:0045723)|positive regulation of lipoprotein lipase activity (GO:0051006)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of triglyceride biosynthetic process (GO:0010867)|regulation of cholesterol homeostasis (GO:2000188)|retinoic acid receptor signaling pathway (GO:0048384)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	apolipoprotein A-I receptor binding (GO:0034191)|ATPase binding (GO:0051117)|DNA binding (GO:0003677)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific transcription regulatory region DNA binding RNA polymerase II transcription factor recruiting transcription factor activity (GO:0001133)|steroid hormone receptor activity (GO:0003707)|zinc ion binding (GO:0008270)			endometrium(2)|large_intestine(1)|lung(3)|upper_aerodigestive_tract(2)	8		all_neural(266;0.057)		OV - Ovarian serous cystadenocarcinoma(262;0.00757)|GBM - Glioblastoma multiforme(134;0.0186)		TTCGGAAACAGCAGCAGGAGT	0.637																																					p.Q173Q		.											.	NR1H2-186	0			c.G519A						.						38.0	47.0	44.0					19																	50881825		2140	4249	6389	SO:0001819	synonymous_variant	7376	exon6			GAAACAGCAGCAG	U14534	CCDS42593.1, CCDS58673.1	19q13.3	2013-01-16				ENSG00000131408		"""Nuclear hormone receptors"""	7965	protein-coding gene	gene with protein product	"""liver X receptor-beta"""	600380	"""ubiquitously-expressed nuclear receptor"""	UNR		7782080, 7971966	Standard	NM_007121		Approved	NER, NER-I, RIP15, LXR-b	uc010enw.4	P55055		ENST00000253727.5:c.519G>A	19.37:g.50881825G>A		Somatic	64	0		WXS	Illumina GAIIx	Phase_I	112	5	NM_007121	0	0	0	0	0	A8K490|B4DNM6|E7EWA6|Q12970|Q5I0Y1	Silent	SNP	ENST00000253727.5	37	CCDS42593.1																																																																																			G|0.903;A|0.097		0.637	NR1H2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464724.2		
EPN1	29924	hgsc.bcm.edu	37	19	56203229	56203229	+	Missense_Mutation	SNP	C	C	T	rs199806653	byFrequency	TCGA-OR-A5KU-01A-11D-A29I-10	TCGA-OR-A5KU-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9652ca0-126e-4332-909a-4e2d2fc489ef	68f72637-d9e1-41a6-8bd0-b4f99bbc13a1	g.chr19:56203229C>T	ENST00000270460.6	+	7	1183	c.872C>T	c.(871-873)cCc>cTc	p.P291L	EPN1_ENST00000411543.2_Missense_Mutation_p.P377L|AC010525.4_ENST00000585559.1_RNA|EPN1_ENST00000085079.7_Missense_Mutation_p.P266L	NM_001130072.1	NP_001123544.1	Q9Y6I3	EPN1_HUMAN	epsin 1	291	8 X 3 AA repeats of [ED]-P-W.|Ala/Gly/Pro-rich.				embryonic organ development (GO:0048568)|endocytosis (GO:0006897)|epidermal growth factor receptor signaling pathway (GO:0007173)|female pregnancy (GO:0007565)|in utero embryonic development (GO:0001701)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|Notch signaling pathway (GO:0007219)	coated pit (GO:0005905)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	lipid binding (GO:0008289)			endometrium(5)|kidney(1)|large_intestine(2)|lung(8)|skin(1)	17		Colorectal(82;0.00244)|Ovarian(87;0.133)		GBM - Glioblastoma multiforme(193;0.112)		ACGGCTGCCCCCACCTCGGAC	0.741													C|||	19	0.00379393	0.0008	0.0115	5008	,	,		10553	0.0		0.008	False		,,,				2504	0.002				p.P377L		.											.	.	0			c.C1130T						.	C	LEU/PRO,LEU/PRO,LEU/PRO	0,3656		0,0,1828	21.0	25.0	24.0		797,872,1130	3.0	0.2	19		24	52,8060		0,52,4004	no	missense,missense,missense	EPN1	NM_013333.3,NM_001130072.1,NM_001130071.1	98,98,98	0,52,5832	TT,TC,CC		0.641,0.0,0.4419	benign,benign,benign	266/551,291/577,377/663	56203229	52,11716	1828	4056	5884	SO:0001583	missense	29924	exon7			CTGCCCCCACCTC	AF073727	CCDS46198.1, CCDS46199.1, CCDS46200.1	19q13.42	2014-08-12			ENSG00000063245	ENSG00000063245			21604	protein-coding gene	gene with protein product		607262				9723620, 10557078	Standard	NM_001130072		Approved		uc002qlx.3	Q9Y6I3	OTTHUMG00000180911	ENST00000270460.6:c.872C>T	19.37:g.56203229C>T	ENSP00000270460:p.Pro291Leu	Somatic	1	0		WXS	Illumina GAIIx	Phase_I	40	22	NM_001130071	0	0	14	37	23	Q86ST3|Q9HA18	Missense_Mutation	SNP	ENST00000270460.6	37	CCDS46199.1	15	0.006868131868131868	2	0.0040650406504065045	7	0.019337016574585635	0	0.0	6	0.0079155672823219	C	15.42	2.827463	0.50845	0.0	0.00641	ENSG00000063245	ENST00000270460;ENST00000085079;ENST00000544375;ENST00000411543	T;T;T	0.17528	2.33;2.31;2.27	3.05	3.05	0.35203	.	0.565789	0.14428	N	0.320171	T	0.08891	0.0220	M	0.64170	1.965	0.80722	D	1	B;B;B;P	0.42518	0.421;0.288;0.421;0.782	B;B;B;B	0.36244	0.039;0.22;0.039;0.086	T	0.14699	-1.0463	10	0.27082	T	0.32	-9.0195	14.0049	0.64456	0.0:1.0:0.0:0.0	.	252;377;291;266	B4DU91;Q9Y6I3-1;Q9Y6I3;Q9Y6I3-3	.;.;EPN1_HUMAN;.	L	291;266;252;377	ENSP00000270460:P291L;ENSP00000085079:P266L;ENSP00000406209:P377L	ENSP00000085079:P266L	P	+	2	0	EPN1	60895041	0.002000	0.14202	0.157000	0.22605	0.710000	0.40934	0.972000	0.29409	2.030000	0.59900	0.462000	0.41574	CCC	C|0.994;T|0.006		0.741	EPN1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000453610.1	NM_013333	
SIX3	6496	hgsc.bcm.edu	37	2	45171842	45171842	+	Silent	SNP	A	A	G	rs338074	byFrequency	TCGA-OR-A5KU-01A-11D-A29I-10	TCGA-OR-A5KU-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9652ca0-126e-4332-909a-4e2d2fc489ef	68f72637-d9e1-41a6-8bd0-b4f99bbc13a1	g.chr2:45171842A>G	ENST00000260653.3	+	2	1284	c.942A>G	c.(940-942)gcA>gcG	p.A314A	SIX3-AS1_ENST00000419364.1_RNA	NM_005413.3	NP_005404.1	O95343	SIX3_HUMAN	SIX homeobox 3	314					brain development (GO:0007420)|circadian behavior (GO:0048512)|diencephalon development (GO:0021536)|eye development (GO:0001654)|forebrain anterior/posterior pattern specification (GO:0021797)|forebrain dorsal/ventral pattern formation (GO:0021798)|lens induction in camera-type eye (GO:0060235)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of Wnt signaling pathway (GO:0030178)|protein import into nucleus (GO:0006606)|telencephalon development (GO:0021537)|visual perception (GO:0007601)	nucleus (GO:0005634)	RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001205)|transcription corepressor binding (GO:0001222)			haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(7)|skin(1)	11		all_hematologic(82;0.151)|Acute lymphoblastic leukemia(82;0.175)				CGGAGCGCGCAGACACCGGCA	0.697													G|||	4695	0.9375	0.9773	0.9323	5008	,	,		10095	0.9901		0.9165	False		,,,				2504	0.8548				p.A314A		.											.	SIX3-90	0			c.A942G						.	G		4039,129		1959,121,4	18.0	19.0	19.0		942	1.0	1.0	2	dbSNP_129	19	7494,648		3453,588,30	yes	coding-synonymous	SIX3	NM_005413.3		5412,709,34	GG,GA,AA		7.9587,3.095,6.3119		314/333	45171842	11533,777	2084	4071	6155	SO:0001819	synonymous_variant	6496	exon2			GCGCGCAGACACC	AF092047	CCDS1821.1	2p21	2011-06-20	2007-07-13		ENSG00000138083	ENSG00000138083		"""Homeoboxes / SINE class"""	10889	protein-coding gene	gene with protein product		603714	"""holoprosencephaly 2, alobar or semilobar"", ""sine oculis homeobox homolog 3 (Drosophila)"""	HPE2		9889003, 10369266	Standard	NM_005413		Approved		uc002run.2	O95343	OTTHUMG00000152424	ENST00000260653.3:c.942A>G	2.37:g.45171842A>G		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	4	4	NM_005413	0	0	0	0	0	D6W5A5|Q53T42	Silent	SNP	ENST00000260653.3	37	CCDS1821.1																																																																																			A|0.059;G|0.941		0.697	SIX3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000326192.1	NM_005413	
TMEM247	388946	ucsc.edu	37	2	46707808	46707808	+	Missense_Mutation	SNP	C	C	G	rs70940616|rs74318890		TCGA-OR-A5KU-01A-11D-A29I-10	TCGA-OR-A5KU-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9652ca0-126e-4332-909a-4e2d2fc489ef	68f72637-d9e1-41a6-8bd0-b4f99bbc13a1	g.chr2:46707808C>G	ENST00000434431.1	+	2	382	c.382C>G	c.(382-384)Cag>Gag	p.Q128E		NM_001145051.2	NP_001138523.1	A6NEH6	TM247_HUMAN	transmembrane protein 247	128						endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)											GAACCAGCGGCAGCGGCAGCA	0.662																																					p.Q128E		.											.	.	0			c.C382G						.						30.0	40.0	37.0					2																	46707808		692	1591	2283	SO:0001583	missense	388946	exon2			CAGCGGCAGCGGC		CCDS56117.1	2p21	2012-04-11			ENSG00000187600	ENSG00000187600			42967	protein-coding gene	gene with protein product							Standard	NM_001145051		Approved		uc010yod.3	A6NEH6	OTTHUMG00000153137	ENST00000434431.1:c.382C>G	2.37:g.46707808C>G	ENSP00000388684:p.Gln128Glu	Somatic	132	2		WXS	Illumina GAIIx	Phase_I	230	26	NM_001145051	0	0	0	0	0		Missense_Mutation	SNP	ENST00000434431.1	37	CCDS56117.1	.	.	.	.	.	.	.	.	.	.	C	17.67	3.447093	0.63178	.	.	ENSG00000187600	ENST00000434431	.	.	.	4.76	4.76	0.60689	.	0.000000	0.39475	N	0.001353	T	0.65606	0.2707	L	0.34521	1.04	.	.	.	D	0.56035	0.974	D	0.70487	0.969	T	0.71735	-0.4503	8	0.54805	T	0.06	-28.7409	14.7885	0.69821	0.0:1.0:0.0:0.0	.	128	A6NEH6	YB028_HUMAN	E	128	.	ENSP00000388684:Q128E	Q	+	1	0	AC018682.6	46561312	1.000000	0.71417	1.000000	0.80357	0.569000	0.35902	3.910000	0.56371	2.484000	0.83849	0.563000	0.77884	CAG	G|1.000;|0.000		0.662	TMEM247-001	KNOWN	mRNA_end_NF|cds_end_NF|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000329726.1	NM_001145051	
RNF149	284996	hgsc.bcm.edu	37	2	101925026	101925026	+	Missense_Mutation	SNP	T	T	C	rs11123868	byFrequency	TCGA-OR-A5KU-01A-11D-A29I-10	TCGA-OR-A5KU-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9652ca0-126e-4332-909a-4e2d2fc489ef	68f72637-d9e1-41a6-8bd0-b4f99bbc13a1	g.chr2:101925026T>C	ENST00000295317.3	-	1	132	c.25A>G	c.(25-27)Agc>Ggc	p.S9G	MIR5696_ENST00000578474.1_RNA	NM_173647.3	NP_775918.2	Q8NC42	RN149_HUMAN	ring finger protein 149	9			S -> G (in dbSNP:rs11123868). {ECO:0000269|PubMed:14702039, ECO:0000269|PubMed:15489334}.		cellular response to drug (GO:0035690)|negative regulation of MAPK cascade (GO:0043409)|regulation of protein stability (GO:0031647)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(3)|ovary(1)|prostate(1)	12						GCCCCGACGCTGGCTTCGCGC	0.726													C|||	2397	0.478634	0.7678	0.4582	5008	,	,		13525	0.3175		0.3917	False		,,,				2504	0.3579				p.S9G	Colon(25;331 612 6521 7355 31028)	.											.	RNF149-290	0			c.A25G						.	C	GLY/SER	1794,1350		547,700,325	4.0	6.0	5.0		25	-2.5	0.0	2	dbSNP_120	5	2382,4344		496,1390,1477	no	missense	RNF149	NM_173647.3	56	1043,2090,1802	CC,CT,TT		35.4148,42.9389,42.31	benign	9/401	101925026	4176,5694	1572	3363	4935	SO:0001583	missense	284996	exon1			CGACGCTGGCTTC	AK074985	CCDS2051.1	2q12.1	2013-01-09			ENSG00000163162	ENSG00000163162		"""RING-type (C3HC4) zinc fingers"""	23137	protein-coding gene	gene with protein product							Standard	NM_173647		Approved	FLJ90504	uc002taz.2	Q8NC42	OTTHUMG00000130685	ENST00000295317.3:c.25A>G	2.37:g.101925026T>C	ENSP00000295317:p.Ser9Gly	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	4	4	NM_173647	0	0	0	1	1	Q53S14|Q8N5I8|Q8NBY5|Q8WUU3	Missense_Mutation	SNP	ENST00000295317.3	37	CCDS2051.1	1023	0.4684065934065934	378	0.7682926829268293	162	0.44751381215469616	189	0.3304195804195804	294	0.38786279683377306	C	1.566	-0.535355	0.04082	0.570611	0.354148	ENSG00000163162	ENST00000295317	T	0.08634	3.07	3.96	-2.45	0.06481	.	4.553570	0.01792	N	0.032390	T	0.00012	0.0000	N	0.00926	-1.1	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.30327	-0.9982	9	0.16896	T	0.51	.	7.6769	0.28490	0.0:0.1603:0.4369:0.4028	rs11123868;rs17856944;rs56755384	9	Q8NC42	RN149_HUMAN	G	9	ENSP00000295317:S9G	ENSP00000295317:S9G	S	-	1	0	RNF149	101291458	0.000000	0.05858	0.003000	0.11579	0.044000	0.14063	-0.581000	0.05820	-0.783000	0.04534	-0.374000	0.07098	AGC	T|0.543;C|0.457		0.726	RNF149-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253180.2	NM_173647	
SOWAHC	65124	hgsc.bcm.edu	37	2	110372192	110372192	+	Silent	SNP	A	A	G	rs6594048		TCGA-OR-A5KU-01A-11D-A29I-10	TCGA-OR-A5KU-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9652ca0-126e-4332-909a-4e2d2fc489ef	68f72637-d9e1-41a6-8bd0-b4f99bbc13a1	g.chr2:110372192A>G	ENST00000356454.3	+	1	282	c.126A>G	c.(124-126)ctA>ctG	p.L42L	SEPT10_ENST00000545389.1_5'Flank|SEPT10_ENST00000437928.1_5'Flank|SEPT10_ENST00000356688.4_5'Flank|SEPT10_ENST00000397712.2_5'Flank|SEPT10_ENST00000415095.1_5'Flank|SEPT10_ENST00000397714.2_5'Flank|SEPT10_ENST00000334001.6_5'Flank	NM_023016.3	NP_075392.2	Q53LP3	SWAHC_HUMAN	sosondowah ankyrin repeat domain family member C	42																	GGGGCGCCCTAGGCGGCGAAC	0.771													G|||	5008	1.0	1.0	1.0	5008	,	,		6158	1.0		1.0	False		,,,				2504	1.0				p.L42L		.											.	.	0			c.A126G						.						1.0	2.0	2.0					2																	110372192		1239	2477	3716	SO:0001819	synonymous_variant	65124	exon1			CGCCCTAGGCGGC	AK023346	CCDS33270.1	2q13	2013-01-10	2012-01-12	2012-01-12	ENSG00000198142	ENSG00000198142		"""Ankyrin repeat domain containing"""	26149	protein-coding gene	gene with protein product			"""ankyrin repeat domain 57"""	C2orf26, ANKRD57		22234889	Standard	NM_023016		Approved	FLJ21870	uc002tfb.3	Q53LP3	OTTHUMG00000153219	ENST00000356454.3:c.126A>G	2.37:g.110372192A>G		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	6	6	NM_023016	0	0	0	0	0	Q8NE15|Q9H6U1	Silent	SNP	ENST00000356454.3	37	CCDS33270.1																																																																																			A|0.029;G|0.971		0.771	SOWAHC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000330168.1	NM_023016	
ANKRD30BL	554226	bcgsc.ca	37	2	133014602	133014602	+	Intron	SNP	G	G	C	rs75245503	byFrequency	TCGA-OR-A5KU-01A-11D-A29I-10	TCGA-OR-A5KU-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9652ca0-126e-4332-909a-4e2d2fc489ef	68f72637-d9e1-41a6-8bd0-b4f99bbc13a1	g.chr2:133014602G>C	ENST00000470729.1	-	1	441				MIR663B_ENST00000408361.1_RNA	NR_027020.2		A7E2S9	A30BL_HUMAN	ankyrin repeat domain 30B-like											endometrium(1)|kidney(3)	4						GCCACAGACAGGAGGGAGGTA	0.721																																					.		.											.	.	0			.						.						27.0	45.0	39.0					2																	133014602		1553	3578	5131	SO:0001627	intron_variant	100313824	.			CAGACAGGAGGGA			2q21.2	2013-01-22	2010-06-14	2010-06-14	ENSG00000163046	ENSG00000163046		"""Ankyrin repeat domain containing"""	35167	protein-coding gene	gene with protein product			"""non-protein coding RNA 164"", ""ankyrin repeat domain 30B pseudogene 3"""	NCRNA00164, ANKRD30BP3		17114284	Standard	NR_027019		Approved		uc002tti.3	A7E2S9	OTTHUMG00000153491	ENST00000470729.1:c.984+499C>G	2.37:g.133014602G>C		Somatic	31	2		WXS	Illumina GAIIx	Phase_I	134	51	.	0	0	0	0	0	B8ZZL7	RNA	SNP	ENST00000470729.1	37																																																																																				G|0.500;C|0.500		0.721	ANKRD30BL-002	KNOWN	basic	processed_transcript	protein_coding	OTTHUMT00000331354.1	NR_027019	
ANKRD30BL	554226	bcgsc.ca	37	2	133014612	133014612	+	Intron	SNP	A	A	C	rs199913868|rs74853538	byFrequency	TCGA-OR-A5KU-01A-11D-A29I-10	TCGA-OR-A5KU-10A-01D-A29L-10	A	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9652ca0-126e-4332-909a-4e2d2fc489ef	68f72637-d9e1-41a6-8bd0-b4f99bbc13a1	g.chr2:133014612A>C	ENST00000470729.1	-	1	441				MIR663B_ENST00000408361.1_RNA	NR_027020.2		A7E2S9	A30BL_HUMAN	ankyrin repeat domain 30B-like											endometrium(1)|kidney(3)	4						GGAGGGAGGTACCGCAGCGAC	0.716																																					.		.											.	.	0			.						.						27.0	46.0	40.0					2																	133014612		1553	3577	5130	SO:0001627	intron_variant	100313824	.			GGAGGTACCGCAG			2q21.2	2013-01-22	2010-06-14	2010-06-14	ENSG00000163046	ENSG00000163046		"""Ankyrin repeat domain containing"""	35167	protein-coding gene	gene with protein product			"""non-protein coding RNA 164"", ""ankyrin repeat domain 30B pseudogene 3"""	NCRNA00164, ANKRD30BP3		17114284	Standard	NR_027019		Approved		uc002tti.3	A7E2S9	OTTHUMG00000153491	ENST00000470729.1:c.984+489T>G	2.37:g.133014612A>C		Somatic	31	1		WXS	Illumina GAIIx	Phase_I	143	55	.	0	0	0	0	0	B8ZZL7	RNA	SNP	ENST00000470729.1	37																																																																																				A|0.333;C|0.667		0.716	ANKRD30BL-002	KNOWN	basic	processed_transcript	protein_coding	OTTHUMT00000331354.1	NR_027019	
TTC21B	79809	bcgsc.ca	37	2	166773971	166773971	+	Silent	SNP	G	G	A	rs6750044	byFrequency	TCGA-OR-A5KU-01A-11D-A29I-10	TCGA-OR-A5KU-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9652ca0-126e-4332-909a-4e2d2fc489ef	68f72637-d9e1-41a6-8bd0-b4f99bbc13a1	g.chr2:166773971G>A	ENST00000243344.7	-	14	1832	c.1695C>T	c.(1693-1695)taC>taT	p.Y565Y		NM_024753.4	NP_079029.3	Q7Z4L5	TT21B_HUMAN	tetratricopeptide repeat domain 21B	565					forebrain dorsal/ventral pattern formation (GO:0021798)|intraciliary retrograde transport (GO:0035721)|intraciliary transport involved in cilium morphogenesis (GO:0035735)|protein localization to cilium (GO:0061512)|regulation of smoothened signaling pathway (GO:0008589)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|smoothened signaling pathway (GO:0007224)|ventricular system development (GO:0021591)	cilium (GO:0005929)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|intraciliary transport particle A (GO:0030991)|nuclear chromatin (GO:0000790)				breast(2)|cervix(1)|endometrium(9)|kidney(2)|large_intestine(9)|lung(28)|ovary(2)|pancreas(2)|skin(2)|urinary_tract(1)	58						TTATCAAATGGTATAAAGGAT	0.313													A|||	1461	0.291733	0.3094	0.2291	5008	,	,		17512	0.2014		0.3668	False		,,,				2504	0.3282				p.Y565Y		.											.	TTC21B-94	0			c.C1695T						.	A		1353,3053	688.4+/-405.0	210,933,1060	125.0	120.0	121.0		1695	3.5	1.0	2	dbSNP_116	121	3345,5253	642.6+/-399.8	636,2073,1590	no	coding-synonymous	TTC21B	NM_024753.3		846,3006,2650	AA,AG,GG		38.9044,30.7081,36.1273		565/1317	166773971	4698,8306	2203	4299	6502	SO:0001819	synonymous_variant	79809	exon14			CAAATGGTATAAA	AB082523	CCDS33315.1	2q24.3	2014-09-04			ENSG00000123607	ENSG00000123607		"""Tetratricopeptide (TTC) repeat domain containing"", ""Intraflagellar transport homologs"""	25660	protein-coding gene	gene with protein product		612014				12056414, 21258341	Standard	NM_024753		Approved	FLJ11457, JBTS11, NPHP12, IFT139, THM1	uc002udk.3	Q7Z4L5	OTTHUMG00000154083	ENST00000243344.7:c.1695C>T	2.37:g.166773971G>A		Somatic	47	0		WXS	Illumina GAIIx	Phase_I	45	4	NM_024753	0	0	2	2	0	A8MUZ3|Q3LIE4|Q53T84|Q6P4A1|Q6PIF5|Q8NCN3|Q96MA4|Q9HAK8	Silent	SNP	ENST00000243344.7	37	CCDS33315.1																																																																																			G|0.668;A|0.332		0.313	TTC21B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000333770.1	NM_024753	
SCN9A	6335	hgsc.bcm.edu	37	2	167055351	167055351	+	Missense_Mutation	SNP	G	G	T			TCGA-OR-A5KU-01A-11D-A29I-10	TCGA-OR-A5KU-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9652ca0-126e-4332-909a-4e2d2fc489ef	68f72637-d9e1-41a6-8bd0-b4f99bbc13a1	g.chr2:167055351G>T	ENST00000409435.1	-	26	5797	c.5798C>A	c.(5797-5799)gCt>gAt	p.A1933D	SCN9A_ENST00000409672.1_Missense_Mutation_p.A1922D|SCN9A_ENST00000375387.4_Missense_Mutation_p.A1934D|AC010127.3_ENST00000447809.2_RNA|SCN9A_ENST00000303354.6_Missense_Mutation_p.A1934D			Q15858	SCN9A_HUMAN	sodium channel, voltage-gated, type IX, alpha subunit	1933					behavioral response to pain (GO:0048266)|inflammatory response (GO:0006954)|membrane depolarization during action potential (GO:0086010)|neuronal action potential (GO:0019228)|post-embryonic development (GO:0009791)|response to toxic substance (GO:0009636)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)	sodium ion binding (GO:0031402)|voltage-gated sodium channel activity (GO:0005248)			NS(1)|breast(5)|central_nervous_system(6)|endometrium(6)|kidney(3)|large_intestine(27)|lung(38)|ovary(6)|prostate(8)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	108					Lacosamide(DB06218)|Lidocaine(DB00281)|Ranolazine(DB00243)|Rufinamide(DB06201)|Valproic Acid(DB00313)|Zonisamide(DB00909)	ATTATCAAAAGCCATATCTTT	0.338																																					p.A1922D		.											.	SCN9A-181	0			c.C5765A						.						82.0	78.0	79.0					2																	167055351		1926	4142	6068	SO:0001583	missense	6335	exon27			TCAAAAGCCATAT	X82835	CCDS46441.1	2q24	2014-09-17	2007-01-23		ENSG00000169432	ENSG00000169432		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10597	protein-coding gene	gene with protein product		603415	"""sodium channel, voltage-gated, type IX, alpha polypeptide"""			7720699, 10198179, 16382098	Standard	NM_002977		Approved	Nav1.7, PN1, NE-NA, NENA, ETHA	uc010fpl.3	Q15858	OTTHUMG00000154044	ENST00000409435.1:c.5798C>A	2.37:g.167055351G>T	ENSP00000386330:p.Ala1933Asp	Somatic	105	0		WXS	Illumina GAIIx	Phase_I	68	4	NM_002977	0	0	0	0	0	A1BUH5|Q6B4R9|Q6B4S0|Q6B4S1|Q70HX1|Q70HX2|Q8WTU1|Q8WWN4	Missense_Mutation	SNP	ENST00000409435.1	37	CCDS46441.1	.	.	.	.	.	.	.	.	.	.	G	1.046	-0.677414	0.03378	.	.	ENSG00000169432	ENST00000409672;ENST00000375387;ENST00000303354;ENST00000409435	D;D;D;D	0.96073	-3.87;-3.9;-3.9;-3.9	6.06	-0.426	0.12314	.	0.449263	0.20964	N	0.082514	D	0.86053	0.5841	N	0.12182	0.205	0.09310	N	1	B	0.09022	0.002	B	0.15052	0.012	T	0.76094	-0.3085	10	0.56958	D	0.05	.	2.351	0.04283	0.5837:0.1156:0.1896:0.1111	.	1922	E7EUN6	.	D	1922;1934;1934;1933	ENSP00000386306:A1922D;ENSP00000364536:A1934D;ENSP00000304748:A1934D;ENSP00000386330:A1933D	ENSP00000304748:A1934D	A	-	2	0	SCN9A	166763597	0.000000	0.05858	0.582000	0.28627	0.002000	0.02628	0.012000	0.13287	-0.107000	0.12088	-2.238000	0.00288	GCT	.		0.338	SCN9A-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000333639.1	NM_002977	
EEF1B2	1933	broad.mit.edu	37	2	207025366	207025366	+	Silent	SNP	G	G	A			TCGA-OR-A5KU-01A-11D-A29I-10	TCGA-OR-A5KU-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9652ca0-126e-4332-909a-4e2d2fc489ef	68f72637-d9e1-41a6-8bd0-b4f99bbc13a1	g.chr2:207025366G>A	ENST00000392222.2	+	2	510	c.135G>A	c.(133-135)ccG>ccA	p.P45P	NDUFS1_ENST00000432169.1_5'Flank|SNORA41_ENST00000384675.1_RNA|NDUFS1_ENST00000457011.1_5'Flank|NDUFS1_ENST00000233190.6_5'Flank|EEF1B2_ENST00000236957.5_Silent_p.P45P|NDUFS1_ENST00000423725.1_5'Flank|NDUFS1_ENST00000455934.2_5'Flank|EEF1B2_ENST00000392221.1_Silent_p.P45P|NDUFS1_ENST00000440274.1_5'Flank|SNORD51_ENST00000384320.2_RNA|NDUFS1_ENST00000449699.1_5'Flank	NM_001959.3	NP_001950.1	P24534	EF1B_HUMAN	eukaryotic translation elongation factor 1 beta 2	45	GST C-terminal.				cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|translation (GO:0006412)|translational elongation (GO:0006414)	cytosol (GO:0005829)|eukaryotic translation elongation factor 1 complex (GO:0005853)	translation elongation factor activity (GO:0003746)	p.P45P(5)		breast(1)|endometrium(5)|kidney(3)|large_intestine(1)|lung(6)	16						CCAGCCCACCGCCTGCCGACT	0.448																																					p.P45P		.											.	EEF1B2-227	5	Substitution - coding silent(5)	kidney(2)|endometrium(2)|lung(1)	c.G135A						.						109.0	99.0	102.0					2																	207025366		2203	4300	6503	SO:0001819	synonymous_variant	1933	exon3			CCCACCGCCTGCC	X60489	CCDS2367.1	2q33.3	2011-04-28			ENSG00000114942	ENSG00000114942			3208	protein-coding gene	gene with protein product		600655				8250921	Standard	NM_001959		Approved		uc002vbf.1	P24534	OTTHUMG00000132891	ENST00000392222.2:c.135G>A	2.37:g.207025366G>A		Somatic	174	0		WXS	Illumina GAIIx	Phase_I	168	5	NM_021121	0	0	137	137	0	A8K795|Q6IBH9	Silent	SNP	ENST00000392222.2	37	CCDS2367.1																																																																																			.		0.448	EEF1B2-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336436.1	NM_001037663	
EFHD1	80303	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	233527635	233527635	+	Silent	SNP	C	C	T			TCGA-OR-A5KU-01A-11D-A29I-10	TCGA-OR-A5KU-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9652ca0-126e-4332-909a-4e2d2fc489ef	68f72637-d9e1-41a6-8bd0-b4f99bbc13a1	g.chr2:233527635C>T	ENST00000264059.3	+	2	903	c.426C>T	c.(424-426)ttC>ttT	p.F142F	EFHD1_ENST00000409613.1_Silent_p.F46F|EFHD1_ENST00000409708.1_Silent_p.F30F|EFHD1_ENST00000410095.1_Silent_p.F30F	NM_025202.3	NP_079478.1	Q9BUP0	EFHD1_HUMAN	EF-hand domain family, member D1	142	EF-hand 2. {ECO:0000255|PROSITE- ProRule:PRU00448}.				neuron projection development (GO:0031175)	extracellular vesicular exosome (GO:0070062)|mitochondrial inner membrane (GO:0005743)	calcium ion binding (GO:0005509)			NS(1)|breast(1)|large_intestine(2)|lung(3)	7		all_hematologic(139;0.0123)|Acute lymphoblastic leukemia(138;0.0182)|Breast(86;0.0199)|Renal(207;0.025)		Epithelial(121;2.08e-16)|BRCA - Breast invasive adenocarcinoma(100;0.000383)|LUSC - Lung squamous cell carcinoma(224;0.00825)|Lung(119;0.0101)		ATGAGGACTTCGATGGCAAGC	0.617																																					p.F142F		.											.	EFHD1-90	0			c.C426T						.						90.0	92.0	92.0					2																	233527635		2203	4300	6503	SO:0001819	synonymous_variant	80303	exon2			GGACTTCGATGGC		CCDS2497.1, CCDS58755.1	2q37.1	2014-07-01	2005-01-25		ENSG00000115468	ENSG00000115468		"""EF-hand domain containing"""	29556	protein-coding gene	gene with protein product	"""swiprosin-2"""	611617	"""EF hand domain containing 1"""			21244694	Standard	NM_025202		Approved	FLJ13612	uc002vtc.3	Q9BUP0	OTTHUMG00000133263	ENST00000264059.3:c.426C>T	2.37:g.233527635C>T		Somatic	106	0		WXS	Illumina GAIIx	Phase_I	86	66	NM_025202	0	0	0	1	1	B2RD83|E9PFH3|Q9BTF8|Q9H8I2|Q9HBQ0	Silent	SNP	ENST00000264059.3	37	CCDS2497.1																																																																																			.		0.617	EFHD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257040.2	NM_025202	
DGKD	8527	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	234354288	234354288	+	Missense_Mutation	SNP	C	C	T	rs139149715		TCGA-OR-A5KU-01A-11D-A29I-10	TCGA-OR-A5KU-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9652ca0-126e-4332-909a-4e2d2fc489ef	68f72637-d9e1-41a6-8bd0-b4f99bbc13a1	g.chr2:234354288C>T	ENST00000264057.2	+	11	1226	c.1214C>T	c.(1213-1215)cCg>cTg	p.P405L	DGKD_ENST00000409813.3_Missense_Mutation_p.P361L	NM_152879.2	NP_690618.2	Q16760	DGKD_HUMAN	diacylglycerol kinase, delta 130kDa	405	DAGKc. {ECO:0000255|PROSITE- ProRule:PRU00783}.				blood coagulation (GO:0007596)|cell growth (GO:0016049)|diacylglycerol metabolic process (GO:0046339)|endocytosis (GO:0006897)|epidermal growth factor receptor signaling pathway (GO:0007173)|multicellular organismal development (GO:0007275)|platelet activation (GO:0030168)|protein homooligomerization (GO:0051260)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|protein transport (GO:0015031)|response to organic substance (GO:0010033)|second-messenger-mediated signaling (GO:0019932)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|diacylglycerol binding (GO:0019992)|diacylglycerol kinase activity (GO:0004143)|metal ion binding (GO:0046872)|NAD+ kinase activity (GO:0003951)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)			central_nervous_system(2)|endometrium(4)|kidney(1)|large_intestine(13)|lung(15)|ovary(1)|pancreas(1)|skin(1)	38		Breast(86;0.0013)|Renal(207;0.00339)|all_hematologic(139;0.0116)|all_lung(227;0.0179)|Acute lymphoblastic leukemia(138;0.0326)|Lung NSC(271;0.0538)		Epithelial(121;1.31e-16)|BRCA - Breast invasive adenocarcinoma(100;0.000416)|Lung(119;0.00285)|LUSC - Lung squamous cell carcinoma(224;0.00655)	Phosphatidylserine(DB00144)	GGAGTGCTGCCGCTCGGCACA	0.652																																					p.P405L		.											.	DGKD-676	0			c.C1214T						.	C	LEU/PRO,LEU/PRO	0,4406		0,0,2203	68.0	67.0	68.0		1082,1214	4.4	1.0	2	dbSNP_134	68	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense	DGKD	NM_003648.2,NM_152879.2	98,98	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging,probably-damaging	361/1171,405/1215	234354288	1,13005	2203	4300	6503	SO:0001583	missense	8527	exon11			TGCTGCCGCTCGG	D63479	CCDS2504.1, CCDS46546.1	2q37	2013-01-10	2002-08-29		ENSG00000077044	ENSG00000077044		"""Sterile alpha motif (SAM) domain containing"", ""Pleckstrin homology (PH) domain containing"""	2851	protein-coding gene	gene with protein product	"""diglyceride kinase"""	601826	"""diacylglycerol kinase, delta (130kD)"""			8626538, 12810723	Standard	NM_003648		Approved	KIAA0145, DGKdelta	uc002vui.1	Q16760	OTTHUMG00000133290	ENST00000264057.2:c.1214C>T	2.37:g.234354288C>T	ENSP00000264057:p.Pro405Leu	Somatic	126	0		WXS	Illumina GAIIx	Phase_I	136	85	NM_152879	0	0	0	0	0	Q14158|Q6PK55|Q8NG53	Missense_Mutation	SNP	ENST00000264057.2	37	CCDS2504.1	.	.	.	.	.	.	.	.	.	.	C	17.27	3.347233	0.61183	0.0	1.16E-4	ENSG00000077044	ENST00000264057;ENST00000409813	T;T	0.69806	-0.43;-0.43	4.37	4.37	0.52481	Diacylglycerol kinase, catalytic domain (3);	0.079304	0.50627	D	0.000107	D	0.89371	0.6696	H	0.98754	4.32	0.80722	D	1	D;D;D	0.89917	1.0;0.973;1.0	D;P;D	0.97110	1.0;0.455;1.0	D	0.93905	0.7192	10	0.87932	D	0	.	17.4856	0.87687	0.0:1.0:0.0:0.0	.	289;361;405	Q53SE4;Q16760-2;Q16760	.;.;DGKD_HUMAN	L	405;361	ENSP00000264057:P405L;ENSP00000386455:P361L	ENSP00000264057:P405L	P	+	2	0	DGKD	234019027	1.000000	0.71417	0.953000	0.39169	0.010000	0.07245	7.651000	0.83577	2.446000	0.82766	0.462000	0.41574	CCG	C|1.000;T|0.000		0.652	DGKD-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000257072.2	NM_003648	
ANO7	50636	broad.mit.edu	37	2	242141634	242141634	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5KU-01A-11D-A29I-10	TCGA-OR-A5KU-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9652ca0-126e-4332-909a-4e2d2fc489ef	68f72637-d9e1-41a6-8bd0-b4f99bbc13a1	g.chr2:242141634C>T	ENST00000274979.8	+	8	903	c.800C>T	c.(799-801)cCg>cTg	p.P267L	ANO7_ENST00000402430.3_Missense_Mutation_p.P266L	NM_001001891.3	NP_001001891.2	Q6IWH7	ANO7_HUMAN	anoctamin 7	267					calcium activated galactosylceramide scrambling (GO:0061591)|calcium activated phosphatidylcholine scrambling (GO:0061590)|calcium activated phosphatidylserine scrambling (GO:0061589)|chloride transport (GO:0006821)|ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	cell junction (GO:0030054)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|intracellular (GO:0005622)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	intracellular calcium activated chloride channel activity (GO:0005229)|phospholipid scramblase activity (GO:0017128)			NS(1)|central_nervous_system(1)|endometrium(3)|large_intestine(5)|lung(14)|pancreas(2)|prostate(1)|skin(3)|urinary_tract(2)	32						GCCAAGACCCCGTATGGCCAC	0.597																																					p.P267L		.											.	ANO7-92	0			c.C800T						.						83.0	71.0	75.0					2																	242141634		2203	4300	6503	SO:0001583	missense	50636	exon8			AGACCCCGTATGG	AY617079	CCDS33423.1, CCDS46563.1	2q37.3	2014-04-09	2008-08-28	2008-08-28	ENSG00000146205	ENSG00000146205		"""Ion channels / Chloride channels : Calcium activated : Anoctamins"""	31677	protein-coding gene	gene with protein product		605096	"""transmembrane protein 16G"""	PCANAP5, TMEM16G		14981236, 15375614, 24692353	Standard	NM_001001891		Approved	NGEP, PCANAP5L, IPCA-5	uc002wax.2	Q6IWH7	OTTHUMG00000151702	ENST00000274979.8:c.800C>T	2.37:g.242141634C>T	ENSP00000274979:p.Pro267Leu	Somatic	74	0		WXS	Illumina GAIIx	Phase_I	51	3	NM_001001891	0	0	0	0	0	Q6IWH6	Missense_Mutation	SNP	ENST00000274979.8	37	CCDS33423.1	.	.	.	.	.	.	.	.	.	.	C	10.27	1.304559	0.23736	.	.	ENSG00000146205	ENST00000274979;ENST00000402430	T;T	0.66460	-0.21;-0.21	3.77	0.398	0.16319	.	0.780921	0.10872	N	0.624763	T	0.57799	0.2078	M	0.65975	2.015	0.09310	N	0.999999	B	0.14438	0.01	B	0.08055	0.003	T	0.45963	-0.9225	10	0.27082	T	0.32	.	5.2553	0.15544	0.3042:0.5855:0.0:0.1102	.	267	Q6IWH7	ANO7_HUMAN	L	267;266	ENSP00000274979:P267L;ENSP00000385418:P266L	ENSP00000274979:P267L	P	+	2	0	ANO7	241790307	0.000000	0.05858	0.290000	0.24890	0.828000	0.46876	-0.173000	0.09854	0.575000	0.29434	0.467000	0.42956	CCG	.		0.597	ANO7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323509.1	NM_001001891	
RRBP1	6238	broad.mit.edu	37	20	17617260	17617260	+	Silent	SNP	G	G	T	rs137981542	byFrequency	TCGA-OR-A5KU-01A-11D-A29I-10	TCGA-OR-A5KU-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9652ca0-126e-4332-909a-4e2d2fc489ef	68f72637-d9e1-41a6-8bd0-b4f99bbc13a1	g.chr20:17617260G>T	ENST00000377813.1	-	6	2602	c.2299C>A	c.(2299-2301)Cgg>Agg	p.R767R	RRBP1_ENST00000360807.4_Silent_p.R334R|RRBP1_ENST00000246043.4_Silent_p.R767R|RRBP1_ENST00000377807.2_Silent_p.R334R|RRBP1_ENST00000455029.2_Silent_p.R108R			Q9P2E9	RRBP1_HUMAN	ribosome binding protein 1	767					osteoblast differentiation (GO:0001649)|protein transport (GO:0015031)|translation (GO:0006412)	endoplasmic reticulum (GO:0005783)|integral component of endoplasmic reticulum membrane (GO:0030176)|membrane (GO:0016020)|ribosome (GO:0005840)	poly(A) RNA binding (GO:0044822)|receptor activity (GO:0004872)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(9)|ovary(2)|prostate(6)	28						ACGTGCTCCCGGTAGCTGGCC	0.652																																					p.R334R		.											.	RRBP1-92	0			c.C1000A						.						86.0	77.0	80.0					20																	17617260		2203	4300	6503	SO:0001819	synonymous_variant	6238	exon6			GCTCCCGGTAGCT	AB037819	CCDS13128.1	20p12	2012-12-07	2012-12-07		ENSG00000125844	ENSG00000125844			10448	protein-coding gene	gene with protein product		601418	"""ribosome binding protein 1 (dog 180kD homolog)"", ""ribosome binding protein 1 homolog 180kDa (dog)"""			8812507	Standard	NM_001042576		Approved	ES/130, hES	uc002wpw.1	Q9P2E9	OTTHUMG00000031945	ENST00000377813.1:c.2299C>A	20.37:g.17617260G>T		Somatic	69	0		WXS	Illumina GAIIx	Phase_I	142	4	NM_004587	0	1	216	217	0	A2A2S6|A6NCN6|O75300|O75301|Q5W165|Q96SB2|Q9BWP1|Q9H476	Silent	SNP	ENST00000377813.1	37																																																																																				G|0.999;A|0.001		0.652	RRBP1-002	NOVEL	basic	protein_coding	protein_coding	OTTHUMT00000078125.1	NM_001042576	
ACTR5	79913	hgsc.bcm.edu	37	20	37377139	37377139	+	Silent	SNP	C	C	T	rs2254105	byFrequency	TCGA-OR-A5KU-01A-11D-A29I-10	TCGA-OR-A5KU-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9652ca0-126e-4332-909a-4e2d2fc489ef	68f72637-d9e1-41a6-8bd0-b4f99bbc13a1	g.chr20:37377139C>T	ENST00000243903.4	+	1	55	c.18C>T	c.(16-18)ttC>ttT	p.F6F		NM_024855.3	NP_079131.3	Q9H9F9	ARP5_HUMAN	ARP5 actin-related protein 5 homolog (yeast)	6					DNA recombination (GO:0006310)|double-strand break repair (GO:0006302)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)|UV-damage excision repair (GO:0070914)	cytoplasm (GO:0005737)|Ino80 complex (GO:0031011)|nucleus (GO:0005634)				kidney(2)|large_intestine(2)|liver(1)|lung(5)|skin(2)	12		Myeloproliferative disorder(115;0.00878)				CGAACGTGTTCCCGTTCCGCG	0.756													C|||	1227	0.245008	0.205	0.2334	5008	,	,		10427	0.2679		0.2565	False		,,,				2504	0.272				p.F6F		.											.	ACTR5-90	0			c.C18T						.						3.0	4.0	4.0					20																	37377139		1470	2633	4103	SO:0001819	synonymous_variant	79913	exon1			CGTGTTCCCGTTC	AK022847	CCDS13308.1	20q12	2011-07-06	2001-11-28		ENSG00000101442	ENSG00000101442		"""INO80 complex subunits"""	14671	protein-coding gene	gene with protein product	"""INO80 complex subunit M"""		"""ARP5 (actin-related protein 5, yeast) homolog"""			16230350	Standard	NM_024855		Approved	FLJ12785, Arp5, INO80M	uc002xjd.2	Q9H9F9	OTTHUMG00000032456	ENST00000243903.4:c.18C>T	20.37:g.37377139C>T		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	13	11	NM_024855	0	0	0	0	0	Q86WF7|Q8IUY5|Q8N724|Q9BRN0|Q9BVB7	Silent	SNP	ENST00000243903.4	37	CCDS13308.1																																																																																			C|0.769;T|0.231		0.756	ACTR5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079205.2	NM_024855	
NRIP1	8204	broad.mit.edu	37	21	16340849	16340849	+	Splice_Site	SNP	T	T	A			TCGA-OR-A5KU-01A-11D-A29I-10	TCGA-OR-A5KU-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9652ca0-126e-4332-909a-4e2d2fc489ef	68f72637-d9e1-41a6-8bd0-b4f99bbc13a1	g.chr21:16340849T>A	ENST00000400202.1	-	3	379		c.e3-2		NRIP1_ENST00000400199.1_Splice_Site|AF127577.11_ENST00000436429.1_RNA|NRIP1_ENST00000318948.4_Splice_Site			P48552	NRIP1_HUMAN	nuclear receptor interacting protein 1						androgen receptor signaling pathway (GO:0030521)|lipid storage (GO:0019915)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|ovarian follicle rupture (GO:0001543)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	cell junction (GO:0030054)|histone deacetylase complex (GO:0000118)|nucleus (GO:0005634)	androgen receptor binding (GO:0050681)|estrogen receptor binding (GO:0030331)|glucocorticoid receptor binding (GO:0035259)|nuclear hormone receptor binding (GO:0035257)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)			cervix(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(6)|lung(13)|prostate(4)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(4)	39				Epithelial(23;1.19e-05)|all cancers(11;4.64e-05)|COAD - Colon adenocarcinoma(22;0.000232)|Colorectal(24;0.0006)|OV - Ovarian serous cystadenocarcinoma(11;0.00418)|Lung(58;0.199)|LUSC - Lung squamous cell carcinoma(23;0.24)		ATCAGTGTTCTAAAAAAAATA	0.294																																					.		.											.	NRIP1-186	0			.						.																																			SO:0001630	splice_region_variant	8204	.			GTGTTCTAAAAAA	X84373	CCDS13568.1	21q11.2	2008-07-31			ENSG00000180530	ENSG00000180530			8001	protein-coding gene	gene with protein product	"""receptor interacting protein 140"", ""nuclear factor RIP140"""	602490				7641693, 9521594	Standard	NM_003489		Approved	RIP140	uc002yjx.2	P48552	OTTHUMG00000074323	ENST00000400202.1:c.334-2A>T	21.37:g.16340849T>A		Somatic	47	1		WXS	Illumina GAIIx	Phase_I	87	4	.	0	0	0	0	0	Q8IWE8	Splice_Site	SNP	ENST00000400202.1	37	CCDS13568.1																																																																																			.		0.294	NRIP1-002	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000157926.1	NM_003489	Intron
CLIC6	54102	hgsc.bcm.edu	37	21	36042579	36042579	+	Missense_Mutation	SNP	C	C	G	rs13049028	byFrequency	TCGA-OR-A5KU-01A-11D-A29I-10	TCGA-OR-A5KU-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9652ca0-126e-4332-909a-4e2d2fc489ef	68f72637-d9e1-41a6-8bd0-b4f99bbc13a1	g.chr21:36042579C>G	ENST00000360731.3	+	1	892	c.892C>G	c.(892-894)Caa>Gaa	p.Q298E	CLIC6_ENST00000349499.2_Missense_Mutation_p.Q298E			Q96NY7	CLIC6_HUMAN	chloride intracellular channel 6	298						chloride channel complex (GO:0034707)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	voltage-gated chloride channel activity (GO:0005247)			breast(1)|central_nervous_system(2)|endometrium(2)|kidney(3)|large_intestine(2)|lung(2)|ovary(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	19						TGAGCCGCAGCAATCGGGGGA	0.756													G|||	1116	0.222843	0.2648	0.1657	5008	,	,		8796	0.1825		0.2137	False		,,,				2504	0.2577				p.Q298E		.											.	CLIC6-91	0			c.C892G						.	G	GLU/GLN	454,2348		41,372,988	2.0	2.0	2.0		892	-0.8	0.0	21	dbSNP_121	2	925,5025		74,777,2124	no	missense	CLIC6	NM_053277.1	29	115,1149,3112	GG,GC,CC		15.5462,16.2027,15.7564	benign	298/687	36042579	1379,7373	1401	2975	4376	SO:0001583	missense	54102	exon1			CCGCAGCAATCGG	AF426169	CCDS13638.1	21q22.12	2012-09-26			ENSG00000159212	ENSG00000159212		"""Ion channels / Chloride channels : Intracellular"""	2065	protein-coding gene	gene with protein product		615321		CLIC1L		10830953	Standard	NM_053277		Approved	CLIC5	uc002yuf.1	Q96NY7	OTTHUMG00000086237	ENST00000360731.3:c.892C>G	21.37:g.36042579C>G	ENSP00000353959:p.Gln298Glu	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	22	7	NM_053277	0	0	0	0	0	A8K0U8|Q8IX31	Missense_Mutation	SNP	ENST00000360731.3	37		434	0.1987179487179487	125	0.2540650406504065	63	0.17403314917127072	81	0.14160839160839161	165	0.21767810026385223	G	0.195	-1.050076	0.01981	0.162027	0.155462	ENSG00000159212	ENST00000360731;ENST00000349499	T;T	0.21361	2.02;2.01	3.75	-0.792	0.10925	.	.	.	.	.	T	0.00012	0.0000	N	0.02539	-0.55	0.80722	P	0.0	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.43861	-0.9365	8	0.02654	T	1	-10.3162	7.3436	0.26650	0.1642:0.3831:0.4527:0.0	rs13049028	298;298	Q96NY7;Q96NY7-2	CLIC6_HUMAN;.	E	298	ENSP00000353959:Q298E;ENSP00000290332:Q298E	ENSP00000290332:Q298E	Q	+	1	0	CLIC6	34964449	0.256000	0.24012	0.012000	0.15200	0.009000	0.06853	0.804000	0.27098	-0.082000	0.12640	-0.676000	0.03789	CAA	C|0.802;G|0.198		0.756	CLIC6-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000194156.1		
CLIC6	54102	hgsc.bcm.edu	37	21	36042584	36042584	+	Silent	SNP	G	G	A	rs13049239	byFrequency	TCGA-OR-A5KU-01A-11D-A29I-10	TCGA-OR-A5KU-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9652ca0-126e-4332-909a-4e2d2fc489ef	68f72637-d9e1-41a6-8bd0-b4f99bbc13a1	g.chr21:36042584G>A	ENST00000360731.3	+	1	897	c.897G>A	c.(895-897)tcG>tcA	p.S299S	CLIC6_ENST00000349499.2_Silent_p.S299S			Q96NY7	CLIC6_HUMAN	chloride intracellular channel 6	299						chloride channel complex (GO:0034707)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	voltage-gated chloride channel activity (GO:0005247)			breast(1)|central_nervous_system(2)|endometrium(2)|kidney(3)|large_intestine(2)|lung(2)|ovary(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	19						CGCAGCAATCGGGGGACGGCA	0.751													A|||	1101	0.219848	0.2549	0.1628	5008	,	,		9144	0.1825		0.2137	False		,,,				2504	0.2577				p.S299S		.											.	CLIC6-91	0			c.G897A						.	A		412,2410		18,376,1017	2.0	2.0	2.0		897	-0.2	0.0	21	dbSNP_121	2	842,5136		42,758,2189	no	coding-synonymous	CLIC6	NM_053277.1		60,1134,3206	AA,AG,GG		14.085,14.5996,14.25		299/687	36042584	1254,7546	1411	2989	4400	SO:0001819	synonymous_variant	54102	exon1			GCAATCGGGGGAC	AF426169	CCDS13638.1	21q22.12	2012-09-26			ENSG00000159212	ENSG00000159212		"""Ion channels / Chloride channels : Intracellular"""	2065	protein-coding gene	gene with protein product		615321		CLIC1L		10830953	Standard	NM_053277		Approved	CLIC5	uc002yuf.1	Q96NY7	OTTHUMG00000086237	ENST00000360731.3:c.897G>A	21.37:g.36042584G>A		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	20	7	NM_053277	0	0	0	0	0	A8K0U8|Q8IX31	Silent	SNP	ENST00000360731.3	37																																																																																				G|0.803;A|0.197		0.751	CLIC6-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000194156.1		
KRTAP10-7	386675	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	21	46021002	46021002	+	Missense_Mutation	SNP	T	T	C			TCGA-OR-A5KU-01A-11D-A29I-10	TCGA-OR-A5KU-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9652ca0-126e-4332-909a-4e2d2fc489ef	68f72637-d9e1-41a6-8bd0-b4f99bbc13a1	g.chr21:46021002T>C	ENST00000380102.2	+	1	506	c.481T>C	c.(481-483)Tgt>Cgt	p.C161R	TSPEAR_ENST00000323084.4_Intron	NM_198689.2	NP_941962.1	P60409	KR107_HUMAN	keratin associated protein 10-7	161	30 X 5 AA repeats of C-C-X(3).					keratin filament (GO:0045095)				breast(1)|large_intestine(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	8						GCAGGCCTGCTGTGTGCCCAT	0.607																																					p.C156R		.											.	.	0			c.T466C						.						52.0	55.0	54.0					21																	46021002		2199	4274	6473	SO:0001583	missense	386675	exon2			GCCTGCTGTGTGC	AJ566385	CCDS74803.1	21q22.3	2014-04-10			ENSG00000205441	ENSG00000272804		"""Keratin associated proteins"""	22970	protein-coding gene	gene with protein product				KRTAP18-7			Standard	NM_198689		Approved	KAP10.7, KAP18.7	uc002zfn.4	P60409	OTTHUMG00000188307	ENST00000380102.2:c.481T>C	21.37:g.46021002T>C	ENSP00000369445:p.Cys161Arg	Somatic	524	0		WXS	Illumina GAIIx	Phase_I	1047	70	NM_198689	0	0	0	0	0	Q0VDJ8|Q70LJ2	Missense_Mutation	SNP	ENST00000380102.2	37		.	.	.	.	.	.	.	.	.	.	N	6.110	0.388618	0.11581	.	.	ENSG00000205441	ENST00000380102	T	0.02498	4.27	3.93	2.76	0.32466	.	.	.	.	.	T	0.08846	0.0219	H	0.95780	3.72	0.45962	D	0.998788	B	0.27656	0.184	B	0.27170	0.077	T	0.00597	-1.1652	9	0.66056	D	0.02	.	7.4598	0.27287	0.0:0.1111:0.0:0.8889	.	156	P60409-2	.	R	161	ENSP00000369445:C161R	ENSP00000369445:C161R	C	+	1	0	KRTAP10-7	44845430	0.340000	0.24792	0.163000	0.22734	0.091000	0.18340	0.700000	0.25601	0.502000	0.28037	0.377000	0.23210	TGT	.		0.607	KRTAP10-7-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000128038.1	NM_198689	
PRR14L	253143	broad.mit.edu	37	22	32108480	32108480	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5KU-01A-11D-A29I-10	TCGA-OR-A5KU-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9652ca0-126e-4332-909a-4e2d2fc489ef	68f72637-d9e1-41a6-8bd0-b4f99bbc13a1	g.chr22:32108480G>A	ENST00000327423.6	-	4	5534	c.5345C>T	c.(5344-5346)aCt>aTt	p.T1782I	PRR14L_ENST00000397493.2_Missense_Mutation_p.T1782I|PRR14L_ENST00000434485.1_Missense_Mutation_p.T1782I	NM_173566.2	NP_775837.2	Q5THK1	PR14L_HUMAN	proline rich 14-like	1782										endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|lung(5)|skin(1)|urinary_tract(2)	14						ATGGACGCCAGTGTCTTCCCT	0.577																																					p.T1782I		.											.	PRR14L-91	0			c.C5345T						.						104.0	114.0	111.0					22																	32108480		692	1591	2283	SO:0001583	missense	253143	exon4			ACGCCAGTGTCTT	BC040859	CCDS13900.2	22q12.2	2011-01-25	2011-01-25	2011-01-25	ENSG00000183530	ENSG00000183530			28738	protein-coding gene	gene with protein product			"""chromosome 22 open reading frame 30"""	C22orf30		12477932	Standard	NM_173566		Approved	MGC50372	uc003alp.4	Q5THK1	OTTHUMG00000030139	ENST00000327423.6:c.5345C>T	22.37:g.32108480G>A	ENSP00000331845:p.Thr1782Ile	Somatic	86	0		WXS	Illumina GAIIx	Phase_I	66	4	NM_173566	0	0	1	1	0	Q5THK4|Q6ZNN1|Q6ZWH0|Q8IW74|Q9H5T4	Missense_Mutation	SNP	ENST00000327423.6	37	CCDS13900.2	.	.	.	.	.	.	.	.	.	.	G	15.22	2.769436	0.49680	.	.	ENSG00000183530	ENST00000397493;ENST00000327423;ENST00000434485	T;T;T	0.07567	3.19;3.22;3.18	5.59	3.41	0.39046	.	0.658044	0.14662	N	0.305917	T	0.06962	0.0177	L	0.34521	1.04	0.09310	N	0.999998	B;B;B	0.28850	0.225;0.225;0.225	B;B;B	0.27262	0.078;0.047;0.078	T	0.20605	-1.0270	10	0.35671	T	0.21	-0.0724	9.5255	0.39162	0.0749:0.0:0.7819:0.1432	.	1782;1782;1782	Q5THK1-2;Q5THK1;Q5THK1-4	.;PR14L_HUMAN;.	I	1782	ENSP00000380630:T1782I;ENSP00000331845:T1782I;ENSP00000388314:T1782I	ENSP00000331845:T1782I	T	-	2	0	PRR14L	30438480	0.299000	0.24426	0.983000	0.44433	0.918000	0.54935	2.884000	0.48562	2.621000	0.88768	0.655000	0.94253	ACT	.		0.577	PRR14L-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000074993.2	NM_173566	
SYNGR1	9145	broad.mit.edu	37	22	39777908	39777908	+	Nonsense_Mutation	SNP	C	C	T			TCGA-OR-A5KU-01A-11D-A29I-10	TCGA-OR-A5KU-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9652ca0-126e-4332-909a-4e2d2fc489ef	68f72637-d9e1-41a6-8bd0-b4f99bbc13a1	g.chr22:39777908C>T	ENST00000328933.5	+	4	706	c.691C>T	c.(691-693)Cag>Tag	p.Q231*		NM_004711.4	NP_004702.2	O43759	SNG1_HUMAN	synaptogyrin 1	231					protein targeting (GO:0006605)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of short-term neuronal synaptic plasticity (GO:0048172)	cell junction (GO:0030054)|integral component of membrane (GO:0016021)|synaptic vesicle membrane (GO:0030672)				endometrium(1)|kidney(1)|large_intestine(1)|lung(3)|skin(1)	7	Melanoma(58;0.04)					CTACCAGTCGCAGGGCTACTG	0.716																																					p.Q231X		.											.	SYNGR1-90	0			c.C691T						.						20.0	20.0	20.0					22																	39777908		2203	4297	6500	SO:0001587	stop_gained	9145	exon4			CAGTCGCAGGGCT	AJ002303	CCDS13989.1, CCDS13990.1, CCDS13991.1	22q13	2008-06-10			ENSG00000100321	ENSG00000100321			11498	protein-coding gene	gene with protein product		603925				9760194, 10595519	Standard	NM_004711		Approved			O43759	OTTHUMG00000030978	ENST00000328933.5:c.691C>T	22.37:g.39777908C>T	ENSP00000332287:p.Gln231*	Somatic	18	0		WXS	Illumina GAIIx	Phase_I	108	4	NM_004711	0	0	0	0	0	A6NP69|A8K0E2|O43757|O43758|Q53Y02|Q96J56|Q9UGZ4	Nonsense_Mutation	SNP	ENST00000328933.5	37	CCDS13989.1	.	.	.	.	.	.	.	.	.	.	C	32	5.159777	0.94727	.	.	ENSG00000100321	ENST00000328933	.	.	.	4.66	4.66	0.58398	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.72032	D	0.01	.	17.7429	0.88412	0.0:1.0:0.0:0.0	.	.	.	.	X	231	.	ENSP00000332287:Q231X	Q	+	1	0	SYNGR1	38107854	1.000000	0.71417	0.998000	0.56505	0.984000	0.73092	7.053000	0.76641	2.399000	0.81585	0.462000	0.41574	CAG	.		0.716	SYNGR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000075866.2	NM_004711	
ITPR1	3708	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	4715944	4715944	+	Missense_Mutation	SNP	G	G	C			TCGA-OR-A5KU-01A-11D-A29I-10	TCGA-OR-A5KU-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9652ca0-126e-4332-909a-4e2d2fc489ef	68f72637-d9e1-41a6-8bd0-b4f99bbc13a1	g.chr3:4715944G>C	ENST00000443694.2	+	19	2470	c.2470G>C	c.(2470-2472)Gag>Cag	p.E824Q	ITPR1_ENST00000302640.8_Missense_Mutation_p.E824Q|ITPR1_ENST00000544951.1_Intron|ITPR1_ENST00000354582.6_Missense_Mutation_p.E839Q|ITPR1_ENST00000423119.2_Missense_Mutation_p.E839Q|ITPR1_ENST00000357086.4_Missense_Mutation_p.E839Q|ITPR1_ENST00000456211.2_Missense_Mutation_p.E824Q			Q14643	ITPR1_HUMAN	inositol 1,4,5-trisphosphate receptor, type 1	839					activation of phospholipase C activity (GO:0007202)|blood coagulation (GO:0007596)|calcium ion transport (GO:0006816)|endoplasmic reticulum calcium ion homeostasis (GO:0032469)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|inositol phosphate-mediated signaling (GO:0048016)|intrinsic apoptotic signaling pathway in response to endoplasmic reticulum stress (GO:0070059)|negative regulation of calcium-mediated signaling (GO:0050849)|neurotrophin TRK receptor signaling pathway (GO:0048011)|platelet activation (GO:0030168)|post-embryonic development (GO:0009791)|regulation of insulin secretion (GO:0050796)|release of sequestered calcium ion into cytosol (GO:0051209)|response to hypoxia (GO:0001666)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|voluntary musculoskeletal movement (GO:0050882)	calcineurin complex (GO:0005955)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nuclear inner membrane (GO:0005637)|nucleolus (GO:0005730)|platelet dense granule membrane (GO:0031088)|platelet dense tubular network (GO:0031094)|platelet dense tubular network membrane (GO:0031095)|postsynaptic density (GO:0014069)|sarcoplasmic reticulum (GO:0016529)	calcium channel inhibitor activity (GO:0019855)|calcium ion transmembrane transporter activity (GO:0015085)|inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity (GO:0005220)|intracellular ligand-gated calcium channel activity (GO:0005218)|phosphatidylinositol binding (GO:0035091)			NS(1)|autonomic_ganglia(1)|breast(10)|endometrium(15)|kidney(6)|large_intestine(27)|liver(1)|lung(27)|ovary(6)|pancreas(1)|prostate(4)|skin(5)|urinary_tract(2)	106				Epithelial(13;0.0199)|OV - Ovarian serous cystadenocarcinoma(96;0.0361)|all cancers(10;0.0982)	Caffeine(DB00201)	TCAGACCATGGAGTTTGTGGA	0.363																																					p.E839Q		.											.	ITPR1-710	0			c.G2515C						.						159.0	151.0	153.0					3																	4715944		1831	4081	5912	SO:0001583	missense	3708	exon22			ACCATGGAGTTTG	D26070	CCDS46740.1, CCDS46740.2, CCDS54550.1, CCDS54551.1	3p26.1	2014-06-12	2011-04-28			ENSG00000150995		"""Ion channels / Inositol triphosphate receptors"""	6180	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 94"""	147265	"""spinocerebellar ataxia 15"", ""spinocerebellar ataxia 16"", ""spinocerebellar ataxia 29"""	SCA15, SCA16, SCA29		7945203, 7500840, 17590087, 17932120, 22986007	Standard	NM_001099952		Approved	Insp3r1, IP3R1, ACV, PPP1R94	uc003bqc.3	Q14643		ENST00000443694.2:c.2470G>C	3.37:g.4715944G>C	ENSP00000401671:p.Glu824Gln	Somatic	78	0		WXS	Illumina GAIIx	Phase_I	69	29	NM_001099952	0	0	0	0	0	E7EPX7|E9PDE9|Q14660|Q99897	Missense_Mutation	SNP	ENST00000443694.2	37	CCDS54551.1	.	.	.	.	.	.	.	.	.	.	G	16.75	3.208290	0.58343	.	.	ENSG00000150995	ENST00000356617;ENST00000302640;ENST00000354582;ENST00000423119;ENST00000357086;ENST00000456211;ENST00000443694	D;D;D;D;D;D	0.91011	-2.77;-2.76;-2.77;-2.77;-2.77;-2.77	5.5	5.5	0.81552	.	0.094233	0.64402	D	0.000001	D	0.85831	0.5788	N	0.17474	0.49	0.80722	D	1	B;B;B	0.21147	0.003;0.002;0.052	B;B;B	0.31442	0.011;0.004;0.13	T	0.79588	-0.1741	10	0.26408	T	0.33	.	19.6014	0.95563	0.0:0.0:1.0:0.0	.	824;839;839	E7EPX7;Q14643;G5E9P1	.;ITPR1_HUMAN;.	Q	839;824;839;839;839;824;824	ENSP00000306253:E824Q;ENSP00000346595:E839Q;ENSP00000405934:E839Q;ENSP00000349597:E839Q;ENSP00000397885:E824Q;ENSP00000401671:E824Q	ENSP00000306253:E824Q	E	+	1	0	ITPR1	4690944	1.000000	0.71417	0.996000	0.52242	0.991000	0.79684	9.173000	0.94815	2.854000	0.98071	0.655000	0.94253	GAG	.		0.363	ITPR1-004	KNOWN	non_canonical_conserved|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000337982.3	NM_002222	
CTNNB1	1499	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	41266124	41266124	+	Missense_Mutation	SNP	A	A	G	rs121913412		TCGA-OR-A5KU-01A-11D-A29I-10	TCGA-OR-A5KU-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9652ca0-126e-4332-909a-4e2d2fc489ef	68f72637-d9e1-41a6-8bd0-b4f99bbc13a1	g.chr3:41266124A>G	ENST00000349496.5	+	3	401	c.121A>G	c.(121-123)Acc>Gcc	p.T41A	CTNNB1_ENST00000396183.3_Missense_Mutation_p.T41A|CTNNB1_ENST00000453024.1_Missense_Mutation_p.T34A|CTNNB1_ENST00000405570.1_Missense_Mutation_p.T41A|CTNNB1_ENST00000396185.3_Missense_Mutation_p.T41A	NM_001904.3	NP_001895.1	P35222	CTNB1_HUMAN	catenin (cadherin-associated protein), beta 1, 88kDa	41			T -> A (in hepatoblastoma and hepatocellular carcinoma; also in a desmoid tumor; strongly reduces phosphorylation and degradation; abolishes phosphorylation on Ser-33 and Ser-37 and enhances transactivation of target genes). {ECO:0000269|PubMed:10391090, ECO:0000269|PubMed:10398436, ECO:0000269|PubMed:10435629, ECO:0000269|PubMed:10655994, ECO:0000269|PubMed:9927029}.|T -> I (in PTR, hepatocellular carcinoma and ovarian cancer). {ECO:0000269|PubMed:10192393, ECO:0000269|PubMed:10391090, ECO:0000269|PubMed:10435629}.		adherens junction assembly (GO:0034333)|androgen receptor signaling pathway (GO:0030521)|anterior/posterior axis specification (GO:0009948)|apoptotic process (GO:0006915)|bone resorption (GO:0045453)|branching involved in ureteric bud morphogenesis (GO:0001658)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|canonical Wnt signaling pathway involved in positive regulation of cardiac outflow tract cell proliferation (GO:0061324)|canonical Wnt signaling pathway involved in positive regulation of epithelial to mesenchymal transition (GO:0044334)|cell adhesion (GO:0007155)|cell fate specification (GO:0001708)|cell maturation (GO:0048469)|cell-matrix adhesion (GO:0007160)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to growth factor stimulus (GO:0071363)|cellular response to indole-3-methanol (GO:0071681)|cellular response to mechanical stimulus (GO:0071260)|central nervous system vasculogenesis (GO:0022009)|cytoskeletal anchoring at plasma membrane (GO:0007016)|determination of dorsal/ventral asymmetry (GO:0048262)|dorsal/ventral axis specification (GO:0009950)|ectoderm development (GO:0007398)|embryonic axis specification (GO:0000578)|embryonic digit morphogenesis (GO:0042733)|embryonic foregut morphogenesis (GO:0048617)|embryonic forelimb morphogenesis (GO:0035115)|embryonic heart tube development (GO:0035050)|embryonic hindlimb morphogenesis (GO:0035116)|embryonic limb morphogenesis (GO:0030326)|embryonic skeletal limb joint morphogenesis (GO:0036023)|endodermal cell fate commitment (GO:0001711)|endothelial tube morphogenesis (GO:0061154)|epithelial cell differentiation involved in prostate gland development (GO:0060742)|epithelial to mesenchymal transition (GO:0001837)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|fungiform papilla formation (GO:0061198)|gastrulation with mouth forming second (GO:0001702)|genitalia morphogenesis (GO:0035112)|glial cell fate determination (GO:0007403)|hair cell differentiation (GO:0035315)|hair follicle morphogenesis (GO:0031069)|hair follicle placode formation (GO:0060789)|hindbrain development (GO:0030902)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|layer formation in cerebral cortex (GO:0021819)|lens morphogenesis in camera-type eye (GO:0002089)|liver development (GO:0001889)|lung cell differentiation (GO:0060479)|lung induction (GO:0060492)|lung-associated mesenchyme development (GO:0060484)|male genitalia development (GO:0030539)|mesenchymal cell proliferation involved in lung development (GO:0060916)|mesenchymal to epithelial transition involved in metanephros morphogenesis (GO:0003337)|midgut development (GO:0007494)|muscle cell differentiation (GO:0042692)|myoblast differentiation (GO:0045445)|negative regulation of apoptotic signaling pathway (GO:2001234)|negative regulation of cell proliferation (GO:0008285)|negative regulation of chondrocyte differentiation (GO:0032331)|negative regulation of heart induction by canonical Wnt signaling pathway (GO:0003136)|negative regulation of neuron death (GO:1901215)|negative regulation of oligodendrocyte differentiation (GO:0048715)|negative regulation of osteoclast differentiation (GO:0045671)|negative regulation of protein sumoylation (GO:0033234)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|nephron tubule formation (GO:0072079)|neural plate development (GO:0001840)|neuron migration (GO:0001764)|odontogenesis of dentin-containing tooth (GO:0042475)|oocyte development (GO:0048599)|osteoclast differentiation (GO:0030316)|oviduct development (GO:0060066)|pancreas development (GO:0031016)|patterning of blood vessels (GO:0001569)|positive regulation of apoptotic process (GO:0043065)|positive regulation of branching involved in lung morphogenesis (GO:0061047)|positive regulation of determination of dorsal identity (GO:2000017)|positive regulation of endothelial cell differentiation (GO:0045603)|positive regulation of epithelial cell proliferation involved in prostate gland development (GO:0060769)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of fibroblast growth factor receptor signaling pathway (GO:0045743)|positive regulation of heparan sulfate proteoglycan biosynthetic process (GO:0010909)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of neuroblast proliferation (GO:0002052)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of type I interferon production (GO:0032481)|protein heterooligomerization (GO:0051291)|protein localization to cell surface (GO:0034394)|proximal/distal pattern formation (GO:0009954)|regulation of angiogenesis (GO:0045765)|regulation of calcium ion import (GO:0090279)|regulation of centriole-centriole cohesion (GO:0030997)|regulation of centromeric sister chromatid cohesion (GO:0070602)|regulation of fibroblast proliferation (GO:0048145)|regulation of myelination (GO:0031641)|regulation of nephron tubule epithelial cell differentiation (GO:0072182)|regulation of protein localization to cell surface (GO:2000008)|regulation of secondary heart field cardioblast proliferation (GO:0003266)|regulation of smooth muscle cell proliferation (GO:0048660)|regulation of T cell proliferation (GO:0042129)|renal inner medulla development (GO:0072053)|renal outer medulla development (GO:0072054)|renal vesicle formation (GO:0072033)|response to cadmium ion (GO:0046686)|response to cytokine (GO:0034097)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|Schwann cell proliferation (GO:0014010)|single organismal cell-cell adhesion (GO:0016337)|smooth muscle cell differentiation (GO:0051145)|synapse organization (GO:0050808)|synaptic vesicle transport (GO:0048489)|T cell differentiation in thymus (GO:0033077)|thymus development (GO:0048538)|tongue morphogenesis (GO:0043587)|trachea formation (GO:0060440)|transcription, DNA-templated (GO:0006351)|Wnt signaling pathway (GO:0016055)	adherens junction (GO:0005912)|apical part of cell (GO:0045177)|basolateral plasma membrane (GO:0016323)|beta-catenin destruction complex (GO:0030877)|beta-catenin-TCF7L2 complex (GO:0070369)|catenin complex (GO:0016342)|cell cortex (GO:0005938)|cell junction (GO:0030054)|cell periphery (GO:0071944)|cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|desmosome (GO:0030057)|extracellular vesicular exosome (GO:0070062)|fascia adherens (GO:0005916)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|membrane (GO:0016020)|microvillus membrane (GO:0031528)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|protein-DNA complex (GO:0032993)|Scrib-APC-beta-catenin complex (GO:0034750)|synapse (GO:0045202)|tight junction (GO:0005923)|transcription factor complex (GO:0005667)|Z disc (GO:0030018)|zonula adherens (GO:0005915)	alpha-catenin binding (GO:0045294)|androgen receptor binding (GO:0050681)|cadherin binding (GO:0045296)|chromatin binding (GO:0003682)|double-stranded DNA binding (GO:0003690)|enzyme binding (GO:0019899)|estrogen receptor binding (GO:0030331)|I-SMAD binding (GO:0070411)|ion channel binding (GO:0044325)|kinase binding (GO:0019900)|nuclear hormone receptor binding (GO:0035257)|protein C-terminus binding (GO:0008022)|protein kinase binding (GO:0019901)|protein phosphatase binding (GO:0019903)|R-SMAD binding (GO:0070412)|RNA polymerase II activating transcription factor binding (GO:0001102)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)|SMAD binding (GO:0046332)|structural molecule activity (GO:0005198)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)	p.T41A(550)|p.A5_A80del(53)|p.A5_Q143del(7)|p.A5_A80>D(7)|p.T41P(6)|p.Q28_H134del(5)|p.?(4)|p.W25_I140del(3)|p.T41S(3)|p.T3_A126del(2)|p.A5fs*7(2)|p.D32_S47del(2)|p.M5_N141>D(2)|p.L10_N141del(2)|p.A5_Y142>D(2)|p.A5_Q143>E(1)|p.S37_G48>C(1)|p.A13_R151del(1)|p.H36_E53>L(1)|p.M14_S45del(1)|p.T40_L46del(1)|p.A20_N141del(1)|p.T41_N51del(1)|p.M1_A87del(1)|p.D11_Y142>H(1)|p.I35_T41del(1)|p.I35_K170del(1)|p.Y30_A97del(1)|p.V22_T102del(1)|p.A20_A80del(1)|p.V22_S71>A(1)|p.Q28_A43del(1)|p.A5_T59del(1)|p.M1_V173del(1)|p.E15_I140>V(1)|p.H24_M131del(1)|p.A21_A80del(1)|p.A5_T40del(1)|p.A5_E54del(1)|p.M8_A80del(1)|p.P16_K133del(1)|p.V22_Y64del(1)|p.Q28_Q61del(1)|p.A20_S111del(1)|p.A39_T42del(1)|p.Y30_A80del(1)	CTNNB1/PLAG1(60)	NS(4)|adrenal_gland(103)|biliary_tract(43)|bone(21)|breast(7)|central_nervous_system(260)|cervix(9)|endometrium(293)|eye(1)|haematopoietic_and_lymphoid_tissue(60)|kidney(202)|large_intestine(269)|liver(1010)|lung(63)|oesophagus(6)|ovary(106)|pancreas(126)|parathyroid(11)|pituitary(111)|pleura(2)|prostate(31)|salivary_gland(13)|skin(103)|small_intestine(17)|soft_tissue(792)|stomach(165)|thyroid(55)|upper_aerodigestive_tract(2)|urinary_tract(8)	3893				KIRC - Kidney renal clear cell carcinoma(284;0.0028)|Kidney(284;0.00294)		TGGTGCCACTACCACAGCTCC	0.507	T41A(CCK81_LARGE_INTESTINE)	15	"""H, Mis, T"""	PLAG1	"""colorectal, cvarian,  hepatoblastoma, others, pleomorphic salivary adenoma"""				Pilomatrixoma, Familial Clustering of																												p.T41A	Colon(6;3 56 14213 18255)	.		Dom	yes		3	3p22-p21.3	1499	"""catenin (cadherin-associated protein), beta 1"""		"""E, M, O"""	.	CTNNB1-24361	681	Substitution - Missense(559)|Deletion - In frame(96)|Complex - deletion inframe(17)|Unknown(7)|Deletion - Frameshift(2)	soft_tissue(387)|liver(158)|large_intestine(61)|endometrium(17)|kidney(11)|stomach(8)|biliary_tract(7)|ovary(6)|small_intestine(4)|lung(4)|prostate(4)|adrenal_gland(3)|haematopoietic_and_lymphoid_tissue(3)|skin(3)|upper_aerodigestive_tract(1)|central_nervous_system(1)|salivary_gland(1)|pituitary(1)|pancreas(1)	c.A121G						.						89.0	77.0	81.0					3																	41266124		2203	4300	6503	SO:0001583	missense	1499	exon3	Familial Cancer Database	Pilomatricoma, Familial Clustering of, Epithelioma Calcificans of Malherbe	GCCACTACCACAG	X87838	CCDS2694.1	3p21	2013-02-15	2002-08-29		ENSG00000168036	ENSG00000168036		"""Armadillo repeat containing"""	2514	protein-coding gene	gene with protein product		116806	"""catenin (cadherin-associated protein), beta 1 (88kD)"""	CTNNB		7829088	Standard	NM_001098210		Approved	beta-catenin, armadillo	uc003ckr.2	P35222	OTTHUMG00000131393	ENST00000349496.5:c.121A>G	3.37:g.41266124A>G	ENSP00000344456:p.Thr41Ala	Somatic	170	0		WXS	Illumina GAIIx	Phase_I	167	63	NM_001098209	0	0	28	51	23	A8K1L7|Q8NEW9|Q8NI94|Q9H391	Missense_Mutation	SNP	ENST00000349496.5	37	CCDS2694.1	.	.	.	.	.	.	.	.	.	.	A	23.7	4.449381	0.84101	.	.	ENSG00000168036	ENST00000426215;ENST00000405570;ENST00000431914;ENST00000396183;ENST00000349496;ENST00000453024;ENST00000396185;ENST00000450969;ENST00000441708	T;T;T;T;T;T;T;T;T	0.48201	0.82;0.82;0.82;0.82;0.82;0.82;0.82;0.82;0.82	5.91	5.91	0.95273	.	0.000000	0.85682	D	0.000000	T	0.63117	0.2484	M	0.79258	2.445	0.80722	D	1	P	0.50943	0.94	P	0.52267	0.694	T	0.68561	-0.5376	10	0.87932	D	0	-8.9189	16.3453	0.83126	1.0:0.0:0.0:0.0	.	41	P35222	CTNB1_HUMAN	A	34;41;41;41;41;34;41;41;41	ENSP00000400508:T34A;ENSP00000385604:T41A;ENSP00000412219:T41A;ENSP00000379486:T41A;ENSP00000344456:T41A;ENSP00000411226:T34A;ENSP00000379488:T41A;ENSP00000409302:T41A;ENSP00000401599:T41A	ENSP00000344456:T41A	T	+	1	0	CTNNB1	41241128	1.000000	0.71417	0.994000	0.49952	0.993000	0.82548	9.339000	0.96797	2.261000	0.74972	0.533000	0.62120	ACC	.		0.507	CTNNB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254182.2	NM_001098210	
CAMKV	79012	broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	49898695	49898695	+	Silent	SNP	C	C	T	rs200717131	byFrequency	TCGA-OR-A5KU-01A-11D-A29I-10	TCGA-OR-A5KU-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9652ca0-126e-4332-909a-4e2d2fc489ef	68f72637-d9e1-41a6-8bd0-b4f99bbc13a1	g.chr3:49898695C>T	ENST00000477224.1	-	6	958	c.480G>A	c.(478-480)tcG>tcA	p.S160S	CAMKV_ENST00000488336.1_Silent_p.S160S|CAMKV_ENST00000466940.1_Silent_p.S117S|CAMKV_ENST00000498324.1_5'Flank|RN7SL217P_ENST00000584520.1_RNA|CAMKV_ENST00000463537.1_Silent_p.S160S|CAMKV_ENST00000296471.7_Silent_p.S160S|CAMKV_ENST00000467248.1_Silent_p.S85S			Q8NCB2	CAMKV_HUMAN	CaM kinase-like vesicle-associated	160	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.					cytoplasmic vesicle (GO:0031410)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)			central_nervous_system(1)|large_intestine(2)|lung(2)|ovary(2)	7				BRCA - Breast invasive adenocarcinoma(193;4.62e-05)|KIRC - Kidney renal clear cell carcinoma(197;0.00551)|Kidney(197;0.00621)		TGACAATCTTCGAGTTCTTCA	0.542													C|||	2	0.000399361	0.0	0.0014	5008	,	,		15382	0.0		0.0	False		,,,				2504	0.001				p.S160S		.											.	CAMKV-613	0			c.G480A						.	C		0,4406		0,0,2203	85.0	79.0	81.0		480	-10.8	0.1	3		81	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	CAMKV	NM_024046.3		0,1,6502	TT,TC,CC		0.0116,0.0,0.0077		160/502	49898695	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	79012	exon6			AATCTTCGAGTTC	BC017363	CCDS33762.1	3p21.31	2005-03-04			ENSG00000164076	ENSG00000164076			28788	protein-coding gene	gene with protein product		614993				12477932	Standard	XM_005265478		Approved	MGC8407, VACAMKL	uc003cxt.1	Q8NCB2	OTTHUMG00000158288	ENST00000477224.1:c.480G>A	3.37:g.49898695C>T		Somatic	96	2		WXS	Illumina GAIIx	Phase_I	101	28	NM_024046	0	0	0	0	0	A6NFD4|Q6FIB8|Q8NBS8|Q8NC85|Q8NDU4|Q8WTT8|Q9BQC9|Q9H0Q5	Silent	SNP	ENST00000477224.1	37	CCDS33762.1																																																																																			C|1.000;T|0.000		0.542	CAMKV-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350584.4	NM_024046	
PHLDB2	90102	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	111632246	111632246	+	Silent	SNP	C	C	T	rs112434778		TCGA-OR-A5KU-01A-11D-A29I-10	TCGA-OR-A5KU-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9652ca0-126e-4332-909a-4e2d2fc489ef	68f72637-d9e1-41a6-8bd0-b4f99bbc13a1	g.chr3:111632246C>T	ENST00000431670.2	+	3	1827	c.1416C>T	c.(1414-1416)acC>acT	p.T472T	PHLDB2_ENST00000477695.1_Silent_p.T472T|PHLDB2_ENST00000481953.1_Silent_p.T472T|PHLDB2_ENST00000412622.1_Silent_p.T472T|PHLDB2_ENST00000393925.3_Silent_p.T472T|PHLDB2_ENST00000393923.3_Silent_p.T499T|PHLDB2_ENST00000495180.1_Silent_p.T58T	NM_001134438.1	NP_001127910.1	Q86SQ0	PHLB2_HUMAN	pleckstrin homology-like domain, family B, member 2	472						cytoplasm (GO:0005737)|intermediate filament cytoskeleton (GO:0045111)|plasma membrane (GO:0005886)		p.T472T(2)|p.T499T(1)		breast(2)|central_nervous_system(1)|endometrium(7)|large_intestine(8)|lung(23)|ovary(6)|skin(7)|stomach(1)	55						CTGGGACCACCGTGGAAGATG	0.522													C|||	1	0.000199681	0.0008	0.0	5008	,	,		19291	0.0		0.0	False		,,,				2504	0.0				p.T499T		.											.	PHLDB2-96	3	Substitution - coding silent(3)	lung(3)	c.C1497T						.	C	,,,	1,4405	2.1+/-5.4	0,1,2202	113.0	111.0	112.0		1497,1416,1416,1416	-5.1	0.8	3	dbSNP_132	112	0,8600		0,0,4300	no	coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous	PHLDB2	NM_001134437.1,NM_001134438.1,NM_001134439.1,NM_145753.2	,,,	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	,,,	499/1238,472/1254,472/1254,472/1211	111632246	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	90102	exon4			GACCACCGTGGAA		CCDS2962.1, CCDS46885.1, CCDS46886.1	3q13.13	2013-01-10			ENSG00000144824	ENSG00000144824		"""Pleckstrin homology (PH) domain containing"""	29573	protein-coding gene	gene with protein product		610298				12376540	Standard	NM_145753		Approved	LL5beta, FLJ21791, LL5b	uc003dyg.3	Q86SQ0	OTTHUMG00000159282	ENST00000431670.2:c.1416C>T	3.37:g.111632246C>T		Somatic	73	0		WXS	Illumina GAIIx	Phase_I	73	23	NM_001134437	0	0	1	1	0	A5PKZ3|Q59EA8|Q68CY3|Q6NT98|Q8N8U8|Q8NAB1|Q8NCU5	Silent	SNP	ENST00000431670.2	37	CCDS46886.1																																																																																			C|0.998;T|0.002		0.522	PHLDB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354337.1	NM_145753	
PLXNA1	5361	broad.mit.edu	37	3	126707544	126707544	+	Silent	SNP	T	T	G			TCGA-OR-A5KU-01A-11D-A29I-10	TCGA-OR-A5KU-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9652ca0-126e-4332-909a-4e2d2fc489ef	68f72637-d9e1-41a6-8bd0-b4f99bbc13a1	g.chr3:126707544T>G	ENST00000393409.2	+	1	108	c.108T>G	c.(106-108)ggT>ggG	p.G36G	PLXNA1_ENST00000251772.4_Silent_p.G13G	NM_032242.3	NP_115618.3	Q9UIW2	PLXA1_HUMAN	plexin A1	36	Sema. {ECO:0000255|PROSITE- ProRule:PRU00352}.				axon guidance (GO:0007411)|dichotomous subdivision of terminal units involved in salivary gland branching (GO:0060666)|multicellular organismal development (GO:0007275)|regulation of smooth muscle cell migration (GO:0014910)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|semaphorin receptor complex (GO:0002116)	receptor activity (GO:0004872)|semaphorin receptor activity (GO:0017154)	p.G13G(4)		breast(3)|central_nervous_system(5)|endometrium(10)|kidney(5)|large_intestine(4)|lung(32)|ovary(2)|pancreas(1)|prostate(2)|skin(3)	67				GBM - Glioblastoma multiforme(114;0.155)		CAGGCGGGGGTTCACAGCCCC	0.682																																					p.G36G		.											.	PLXNA1-93	4	Substitution - coding silent(4)	lung(2)|kidney(2)	c.T108G						.						26.0	27.0	27.0					3																	126707544		2203	4300	6503	SO:0001819	synonymous_variant	5361	exon1			CGGGGGTTCACAG	X87832	CCDS33847.1, CCDS33847.2	3q21.2	2006-12-19				ENSG00000114554		"""Plexins"""	9099	protein-coding gene	gene with protein product		601055		PLXN1		8570614	Standard	NM_032242		Approved	NOV	uc003ejg.3	Q9UIW2		ENST00000393409.2:c.108T>G	3.37:g.126707544T>G		Somatic	48	6		WXS	Illumina GAIIx	Phase_I	119	23	NM_032242	0	0	2	3	1		Silent	SNP	ENST00000393409.2	37	CCDS33847.2																																																																																			.		0.682	PLXNA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356451.1	NM_032242	
PRR23A	729627	hgsc.bcm.edu	37	3	138725072	138725072	+	Silent	SNP	C	C	A	rs185399823	byFrequency	TCGA-OR-A5KU-01A-11D-A29I-10	TCGA-OR-A5KU-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9652ca0-126e-4332-909a-4e2d2fc489ef	68f72637-d9e1-41a6-8bd0-b4f99bbc13a1	g.chr3:138725072C>A	ENST00000383163.2	-	1	38	c.39G>T	c.(37-39)gcG>gcT	p.A13A	MRPS22_ENST00000495075.1_Intron	NM_001134659.1	NP_001128131.1	A6NEV1	PR23A_HUMAN	proline rich 23A	13										endometrium(3)|kidney(1)|lung(7)	11						CCCACCAGGGCGCAGGGAAGG	0.736													C|||	4	0.000798722	0.0	0.0	5008	,	,		11959	0.0		0.004	False		,,,				2504	0.0				p.A13A		.											.	.	0			c.G39T						.																																			SO:0001819	synonymous_variant	729627	exon1			CCAGGGCGCAGGG		CCDS46923.1	3q22.3	2014-06-03				ENSG00000206260			37172	protein-coding gene	gene with protein product							Standard	NM_001134659		Approved		uc011bms.2	A6NEV1		ENST00000383163.2:c.39G>T	3.37:g.138725072C>A		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	14	8	NM_001134659	0	0	0	0	0		Silent	SNP	ENST00000383163.2	37	CCDS46923.1																																																																																			C|0.998;A|0.002		0.736	PRR23A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000361503.1	NM_001134659	
ZNF141	7700	bcgsc.ca	37	4	367169	367169	+	Missense_Mutation	SNP	G	G	A	rs145966198		TCGA-OR-A5KU-01A-11D-A29I-10	TCGA-OR-A5KU-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9652ca0-126e-4332-909a-4e2d2fc489ef	68f72637-d9e1-41a6-8bd0-b4f99bbc13a1	g.chr4:367169G>A	ENST00000240499.7	+	4	1092	c.943G>A	c.(943-945)Gaa>Aaa	p.E315K	ZNF141_ENST00000505939.1_Intron|ZNF141_ENST00000512994.1_Intron	NM_003441.2	NP_003432.1	Q15928	ZN141_HUMAN	zinc finger protein 141	315					anatomical structure morphogenesis (GO:0009653)|limb morphogenesis (GO:0035108)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|kidney(3)|large_intestine(5)|lung(8)|upper_aerodigestive_tract(1)	18						CAAATGTGAAGAATGTGGCAA	0.388																																					p.E315K		.											.	ZNF141-90	0			c.G943A						.																																			SO:0001583	missense	7700	exon4			TGTGAAGAATGTG	L15309	CCDS33931.1	4p16.3	2013-01-08	2006-06-13			ENSG00000131127		"""Zinc fingers, C2H2-type"", ""-"""	12926	protein-coding gene	gene with protein product		194648	"""zinc finger protein 141 (clone pHZ-44)"""	D4S90		8268908	Standard	NM_003441		Approved	pHZ-44	uc003gaa.2	Q15928		ENST00000240499.7:c.943G>A	4.37:g.367169G>A	ENSP00000240499:p.Glu315Lys	Somatic	54	1		WXS	Illumina GAIIx	Phase_I	61	13	NM_003441	0	0	28	43	15	Q6DK07	Missense_Mutation	SNP	ENST00000240499.7	37	CCDS33931.1	.	.	.	.	.	.	.	.	.	.	G	13.74	2.327325	0.41197	.	.	ENSG00000131127	ENST00000240499	T	0.07327	3.2	1.24	1.24	0.21308	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.13030	0.0316	L	0.42487	1.325	0.80722	P	0.0	P	0.39624	0.681	P	0.51833	0.681	T	0.18871	-1.0323	7	.	.	.	.	7.8922	0.29684	0.0:0.0:1.0:0.0	.	315	Q15928	ZN141_HUMAN	K	315	ENSP00000240499:E315K	.	E	+	1	0	ZNF141	357169	0.000000	0.05858	0.076000	0.20297	0.968000	0.65278	-0.068000	0.11561	0.591000	0.29711	0.313000	0.20887	GAA	.		0.388	ZNF141-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357710.1	NM_003441	
ZNF141	7700	bcgsc.ca	37	4	367199	367199	+	Missense_Mutation	SNP	A	A	T	rs114931928		TCGA-OR-A5KU-01A-11D-A29I-10	TCGA-OR-A5KU-10A-01D-A29L-10	A	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9652ca0-126e-4332-909a-4e2d2fc489ef	68f72637-d9e1-41a6-8bd0-b4f99bbc13a1	g.chr4:367199A>T	ENST00000240499.7	+	4	1122	c.973A>T	c.(973-975)Acc>Tcc	p.T325S	ZNF141_ENST00000505939.1_Intron|ZNF141_ENST00000512994.1_Intron	NM_003441.2	NP_003432.1	Q15928	ZN141_HUMAN	zinc finger protein 141	325					anatomical structure morphogenesis (GO:0009653)|limb morphogenesis (GO:0035108)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|kidney(3)|large_intestine(5)|lung(8)|upper_aerodigestive_tract(1)	18						TAGGTCCACAACCCTTACTAA	0.383																																					p.T325S		.											.	ZNF141-90	0			c.A973T						.						56.0	62.0	60.0					4																	367199		2197	4296	6493	SO:0001583	missense	7700	exon4			TCCACAACCCTTA	L15309	CCDS33931.1	4p16.3	2013-01-08	2006-06-13			ENSG00000131127		"""Zinc fingers, C2H2-type"", ""-"""	12926	protein-coding gene	gene with protein product		194648	"""zinc finger protein 141 (clone pHZ-44)"""	D4S90		8268908	Standard	NM_003441		Approved	pHZ-44	uc003gaa.2	Q15928		ENST00000240499.7:c.973A>T	4.37:g.367199A>T	ENSP00000240499:p.Thr325Ser	Somatic	33	1		WXS	Illumina GAIIx	Phase_I	52	17	NM_003441	0	0	0	0	0	Q6DK07	Missense_Mutation	SNP	ENST00000240499.7	37	CCDS33931.1	.	.	.	.	.	.	.	.	.	.	A	3.741	-0.053524	0.07362	.	.	ENSG00000131127	ENST00000240499	T	0.07216	3.21	1.24	-0.0286	0.13921	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.03220	0.0094	N	0.04636	-0.2	0.09310	N	1	B	0.19200	0.034	B	0.22152	0.038	T	0.47995	-0.9073	8	.	.	.	.	4.1736	0.10341	0.7434:0.0:0.2566:0.0	.	325	Q15928	ZN141_HUMAN	S	325	ENSP00000240499:T325S	.	T	+	1	0	ZNF141	357199	0.000000	0.05858	0.216000	0.23742	0.983000	0.72400	-6.049000	0.00083	0.495000	0.27882	0.260000	0.18958	ACC	A|0.881;T|0.119		0.383	ZNF141-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357710.1	NM_003441	
ZNF141	7700	bcgsc.ca	37	4	367201	367201	+	Silent	SNP	C	C	A	rs111394409		TCGA-OR-A5KU-01A-11D-A29I-10	TCGA-OR-A5KU-10A-01D-A29L-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9652ca0-126e-4332-909a-4e2d2fc489ef	68f72637-d9e1-41a6-8bd0-b4f99bbc13a1	g.chr4:367201C>A	ENST00000240499.7	+	4	1124	c.975C>A	c.(973-975)acC>acA	p.T325T	ZNF141_ENST00000505939.1_Intron|ZNF141_ENST00000512994.1_Intron	NM_003441.2	NP_003432.1	Q15928	ZN141_HUMAN	zinc finger protein 141	325					anatomical structure morphogenesis (GO:0009653)|limb morphogenesis (GO:0035108)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|kidney(3)|large_intestine(5)|lung(8)|upper_aerodigestive_tract(1)	18						GGTCCACAACCCTTACTAAAC	0.383																																					p.T325T		.											.	ZNF141-90	0			c.C975A						.						56.0	61.0	59.0					4																	367201		2198	4296	6494	SO:0001819	synonymous_variant	7700	exon4			CACAACCCTTACT	L15309	CCDS33931.1	4p16.3	2013-01-08	2006-06-13			ENSG00000131127		"""Zinc fingers, C2H2-type"", ""-"""	12926	protein-coding gene	gene with protein product		194648	"""zinc finger protein 141 (clone pHZ-44)"""	D4S90		8268908	Standard	NM_003441		Approved	pHZ-44	uc003gaa.2	Q15928		ENST00000240499.7:c.975C>A	4.37:g.367201C>A		Somatic	33	1		WXS	Illumina GAIIx	Phase_I	52	17	NM_003441	0	0	0	0	0	Q6DK07	Silent	SNP	ENST00000240499.7	37	CCDS33931.1																																																																																			A|1.000;|0.000		0.383	ZNF141-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357710.1	NM_003441	
ZNF141	7700	bcgsc.ca	37	4	367206	367206	+	Missense_Mutation	SNP	C	C	G	rs113884485		TCGA-OR-A5KU-01A-11D-A29I-10	TCGA-OR-A5KU-10A-01D-A29L-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9652ca0-126e-4332-909a-4e2d2fc489ef	68f72637-d9e1-41a6-8bd0-b4f99bbc13a1	g.chr4:367206C>G	ENST00000240499.7	+	4	1129	c.980C>G	c.(979-981)aCt>aGt	p.T327S	ZNF141_ENST00000505939.1_Intron|ZNF141_ENST00000512994.1_Intron	NM_003441.2	NP_003432.1	Q15928	ZN141_HUMAN	zinc finger protein 141	327					anatomical structure morphogenesis (GO:0009653)|limb morphogenesis (GO:0035108)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|kidney(3)|large_intestine(5)|lung(8)|upper_aerodigestive_tract(1)	18						ACAACCCTTACTAAACATAAG	0.378																																					p.T327S		.											.	ZNF141-90	0			c.C980G						.						53.0	58.0	56.0					4																	367206		2200	4295	6495	SO:0001583	missense	7700	exon4			CCCTTACTAAACA	L15309	CCDS33931.1	4p16.3	2013-01-08	2006-06-13			ENSG00000131127		"""Zinc fingers, C2H2-type"", ""-"""	12926	protein-coding gene	gene with protein product		194648	"""zinc finger protein 141 (clone pHZ-44)"""	D4S90		8268908	Standard	NM_003441		Approved	pHZ-44	uc003gaa.2	Q15928		ENST00000240499.7:c.980C>G	4.37:g.367206C>G	ENSP00000240499:p.Thr327Ser	Somatic	33	1		WXS	Illumina GAIIx	Phase_I	51	17	NM_003441	0	0	0	0	0	Q6DK07	Missense_Mutation	SNP	ENST00000240499.7	37	CCDS33931.1	.	.	.	.	.	.	.	.	.	.	C	10.85	1.468247	0.26335	.	.	ENSG00000131127	ENST00000240499	T	0.35973	1.28	1.24	0.227	0.15359	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.14700	0.0355	N	0.10733	0.035	0.09310	N	1	B	0.14012	0.009	B	0.15870	0.014	T	0.27502	-1.0072	8	.	.	.	.	3.3488	0.07145	0.0:0.4599:0.0:0.5401	.	327	Q15928	ZN141_HUMAN	S	327	ENSP00000240499:T327S	.	T	+	2	0	ZNF141	357206	0.000000	0.05858	0.576000	0.28549	0.982000	0.71751	-2.477000	0.00985	0.591000	0.29711	0.313000	0.20887	ACT	G|1.000;|0.000		0.378	ZNF141-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357710.1	NM_003441	
IDUA	3425	broad.mit.edu	37	4	996204	996204	+	Missense_Mutation	SNP	A	A	C			TCGA-OR-A5KU-01A-11D-A29I-10	TCGA-OR-A5KU-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9652ca0-126e-4332-909a-4e2d2fc489ef	68f72637-d9e1-41a6-8bd0-b4f99bbc13a1	g.chr4:996204A>C	ENST00000247933.4	+	8	1208	c.1120A>C	c.(1120-1122)Acc>Ccc	p.T374P	IDUA_ENST00000514224.1_Missense_Mutation_p.T242P|IDUA_ENST00000453894.1_Missense_Mutation_p.T396P	NM_000203.3	NP_000194.2	P35475	IDUA_HUMAN	iduronidase, alpha-L-	374					carbohydrate metabolic process (GO:0005975)|cell morphogenesis (GO:0000902)|chemical homeostasis (GO:0048878)|chondroitin sulfate catabolic process (GO:0030207)|chondroitin sulfate metabolic process (GO:0030204)|dermatan sulfate catabolic process (GO:0030209)|disaccharide metabolic process (GO:0005984)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|limb morphogenesis (GO:0035108)|lysosome organization (GO:0007040)|skeletal system morphogenesis (GO:0048705)|small molecule metabolic process (GO:0044281)	coated vesicle (GO:0030135)|extracellular vesicular exosome (GO:0070062)|lysosomal lumen (GO:0043202)	L-iduronidase activity (GO:0003940)			breast(1)|endometrium(3)|kidney(1)|large_intestine(1)|lung(5)|upper_aerodigestive_tract(1)	12			OV - Ovarian serous cystadenocarcinoma(23;0.0158)			GGTCAACAACACCCGCCCGCC	0.711																																					p.T374P		.											.	IDUA-91	0			c.A1120C						.						26.0	28.0	27.0					4																	996204		2185	4282	6467	SO:0001583	missense	3425	exon8			AACAACACCCGCC	M74715	CCDS3343.1	4p16.3	2012-10-02			ENSG00000127415	ENSG00000127415	3.2.1.76		5391	protein-coding gene	gene with protein product		252800				1832239	Standard	NM_000203		Approved	MPS1	uc003gby.3	P35475	OTTHUMG00000088901	ENST00000247933.4:c.1120A>C	4.37:g.996204A>C	ENSP00000247933:p.Thr374Pro	Somatic	50	3		WXS	Illumina GAIIx	Phase_I	224	87	NM_000203	0	0	10	15	5	B3KWK6	Missense_Mutation	SNP	ENST00000247933.4	37	CCDS3343.1	.	.	.	.	.	.	.	.	.	.	A	21.2	4.117066	0.77323	.	.	ENSG00000127415	ENST00000247933;ENST00000453894;ENST00000514224	D;D;D	0.94280	-3.39;-3.39;-3.39	5.31	5.31	0.75309	Glycoside hydrolase, subgroup, catalytic domain (1);Glycoside hydrolase, superfamily (1);	0.156849	0.56097	D	0.000026	D	0.96611	0.8894	M	0.86178	2.8	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.995	D	0.96508	0.9376	10	0.46703	T	0.11	-7.29	13.2474	0.60029	1.0:0.0:0.0:0.0	.	396;374	B3KWK6;P35475	.;IDUA_HUMAN	P	374;396;242	ENSP00000247933:T374P;ENSP00000396458:T396P;ENSP00000425081:T242P	ENSP00000247933:T374P	T	+	1	0	IDUA	986204	1.000000	0.71417	0.995000	0.50966	0.426000	0.31534	5.967000	0.70403	2.024000	0.59613	0.454000	0.30748	ACC	.		0.711	IDUA-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000201812.1	NM_000203	
CRIPAK	285464	hgsc.bcm.edu	37	4	1388974	1388974	+	Silent	SNP	T	T	C	rs71614969	byFrequency	TCGA-OR-A5KU-01A-11D-A29I-10	TCGA-OR-A5KU-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9652ca0-126e-4332-909a-4e2d2fc489ef	68f72637-d9e1-41a6-8bd0-b4f99bbc13a1	g.chr4:1388974T>C	ENST00000324803.4	+	1	3635	c.675T>C	c.(673-675)gaT>gaC	p.D225D		NM_175918.3	NP_787114.2	Q8N1N5	CRPAK_HUMAN	cysteine-rich PAK1 inhibitor	225					negative regulation of intracellular estrogen receptor signaling pathway (GO:0033147)|negative regulation of protein kinase activity (GO:0006469)|regulation of cytoskeleton organization (GO:0051493)|response to estrogen (GO:0043627)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				NS(3)|breast(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(11)|ovary(1)|pancreas(2)|prostate(6)|skin(4)|urinary_tract(1)	35			OV - Ovarian serous cystadenocarcinoma(23;0.0106)			CACGTGCCGATGCGGAGTGCC	0.667													N|||	706	0.140974	0.087	0.1888	5008	,	,		14021	0.0268		0.2326	False		,,,				2504	0.2035				p.D225D		.											.	CRIPAK-90	0			c.T675C						.						177.0	128.0	145.0					4																	1388974		2168	4272	6440	SO:0001819	synonymous_variant	285464	exon1			TGCCGATGCGGAG	AK096209	CCDS3349.1	4p16.3	2011-02-10	2006-09-04		ENSG00000179979	ENSG00000179979			26619	protein-coding gene	gene with protein product		610203	"""cysteine-rich PAK1inhibitor"""			16278681	Standard	NM_175918		Approved	FLJ34443	uc003gdf.2	Q8N1N5	OTTHUMG00000121131	ENST00000324803.4:c.675T>C	4.37:g.1388974T>C		Somatic	1	0		WXS	Illumina GAIIx	Phase_I	8	5	NM_175918	0	0	19	31	12	Q8NB03	Silent	SNP	ENST00000324803.4	37	CCDS3349.1																																																																																			C|1.000;|0.000		0.667	CRIPAK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000241607.2	NM_175918	
HTRA3	94031	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	8293291	8293291	+	Splice_Site	SNP	C	C	T			TCGA-OR-A5KU-01A-11D-A29I-10	TCGA-OR-A5KU-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9652ca0-126e-4332-909a-4e2d2fc489ef	68f72637-d9e1-41a6-8bd0-b4f99bbc13a1	g.chr4:8293291C>T	ENST00000307358.2	+	4	1107	c.903C>T	c.(901-903)aaC>aaT	p.N301N	HTRA3_ENST00000382512.3_Splice_Site_p.N301N	NM_053044.3	NP_444272.1	P83110	HTRA3_HUMAN	HtrA serine peptidase 3	301	Serine protease.				negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|proteolysis (GO:0006508)|regulation of cell growth (GO:0001558)	extracellular region (GO:0005576)	endopeptidase activity (GO:0004175)|serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)			central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(2)|liver(1)|lung(6)|ovary(2)|prostate(1)|urinary_tract(1)	18						CCATCATCAACGTGAGTCCCA	0.652																																					p.N301N		.											.	HTRA3-91	0			c.C903T						.						24.0	22.0	22.0					4																	8293291		2198	4297	6495	SO:0001630	splice_region_variant	94031	exon4			CATCAACGTGAGT	AY040094	CCDS3400.1, CCDS75105.1	4p16.1	2008-02-05			ENSG00000170801	ENSG00000170801			30406	protein-coding gene	gene with protein product	"""pregnancy-related serine protease"""	608785				12513693, 14500695	Standard	XM_005248040		Approved	Tasp, Prsp	uc003gla.3	P83110	OTTHUMG00000090561	ENST00000307358.2:c.903+1C>T	4.37:g.8293291C>T		Somatic	116	0		WXS	Illumina GAIIx	Phase_I	128	51	NM_053044	0	0	0	0	0	Q7Z7A2	Silent	SNP	ENST00000307358.2	37	CCDS3400.1																																																																																			.		0.652	HTRA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000092669.1	NM_053044	Silent
NR3C2	4306	broad.mit.edu	37	4	149356630	149356630	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5KU-01A-11D-A29I-10	TCGA-OR-A5KU-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9652ca0-126e-4332-909a-4e2d2fc489ef	68f72637-d9e1-41a6-8bd0-b4f99bbc13a1	g.chr4:149356630C>T	ENST00000358102.3	-	2	1745	c.1383G>A	c.(1381-1383)atG>atA	p.M461I	NR3C2_ENST00000512865.1_Missense_Mutation_p.M461I|NR3C2_ENST00000344721.4_Missense_Mutation_p.M461I|NR3C2_ENST00000355292.3_Missense_Mutation_p.M461I|NR3C2_ENST00000511528.1_Missense_Mutation_p.M461I	NM_000901.4|NM_001166104.1	NP_000892.2|NP_001159576.1	P08235	MCR_HUMAN	nuclear receptor subfamily 3, group C, member 2	461	Modulating.				gene expression (GO:0010467)|signal transduction (GO:0007165)|transcription initiation from RNA polymerase II promoter (GO:0006367)	endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|receptor complex (GO:0043235)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|steroid binding (GO:0005496)|steroid hormone receptor activity (GO:0003707)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(14)|liver(1)|lung(11)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	41	all_hematologic(180;0.151)			GBM - Glioblastoma multiforme(119;0.0614)	Drospirenone(DB01395)|Eplerenone(DB00700)|Felodipine(DB01023)|Fludrocortisone(DB00687)|Fluticasone Propionate(DB00588)|Nimodipine(DB00393)|Progesterone(DB00396)|Spironolactone(DB00421)	CTTTATCATCCATAAAGGAAA	0.423																																					p.M461I	Melanoma(27;428 957 40335 51025 51111)	.											.	NR3C2-154	0			c.G1383A						.						61.0	60.0	60.0					4																	149356630		2203	4300	6503	SO:0001583	missense	4306	exon2			ATCATCCATAAAG	M16801	CCDS3772.1, CCDS54811.1	4q31	2013-01-16			ENSG00000151623	ENSG00000151623		"""Nuclear hormone receptors"""	7979	protein-coding gene	gene with protein product		600983		MLR		2558856	Standard	NM_000901		Approved	MR	uc003ilj.4	P08235	OTTHUMG00000161455	ENST00000358102.3:c.1383G>A	4.37:g.149356630C>T	ENSP00000350815:p.Met461Ile	Somatic	31	0		WXS	Illumina GAIIx	Phase_I	41	3	NM_001166104	0	0	1	1	0	B0ZBF5|B0ZBF7|Q2NKL1|Q96KQ8|Q96KQ9	Missense_Mutation	SNP	ENST00000358102.3	37	CCDS3772.1	.	.	.	.	.	.	.	.	.	.	C	13.25	2.181063	0.38511	.	.	ENSG00000151623	ENST00000344721;ENST00000355292;ENST00000358102;ENST00000512865;ENST00000544252;ENST00000342437;ENST00000511528	D;D;D;D;D;D	0.90004	-2.59;-2.6;-2.59;-2.2;-2.2;-2.6	5.4	5.4	0.78164	.	0.035654	0.85682	D	0.000000	D	0.86611	0.5974	N	0.24115	0.695	0.51233	D	0.999914	D;D	0.60575	0.967;0.988	B;P	0.49887	0.437;0.625	D	0.85314	0.1080	9	.	.	.	.	19.5373	0.95257	0.0:1.0:0.0:0.0	.	461;461	B0ZBF5;B0ZBF6	.;.	I	461	ENSP00000341390:M461I;ENSP00000347441:M461I;ENSP00000350815:M461I;ENSP00000423510:M461I;ENSP00000343907:M461I;ENSP00000421481:M461I	.	M	-	3	0	NR3C2	149576080	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	5.681000	0.68175	2.681000	0.91329	0.655000	0.94253	ATG	.		0.423	NR3C2-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364986.1		
EGFLAM	133584	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	5	38435283	38435283	+	Silent	SNP	C	C	T			TCGA-OR-A5KU-01A-11D-A29I-10	TCGA-OR-A5KU-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9652ca0-126e-4332-909a-4e2d2fc489ef	68f72637-d9e1-41a6-8bd0-b4f99bbc13a1	g.chr5:38435283C>T	ENST00000354891.3	+	16	2557	c.2211C>T	c.(2209-2211)ggC>ggT	p.G737G	EGFLAM_ENST00000336740.6_Silent_p.G503G|EGFLAM_ENST00000397202.2_Silent_p.G103G|EGFLAM_ENST00000322350.5_Silent_p.G737G	NM_001205301.1	NP_001192230.1	Q63HQ2	EGFLA_HUMAN	EGF-like, fibronectin type III and laminin G domains	737	Laminin G-like 2. {ECO:0000255|PROSITE- ProRule:PRU00122}.				extracellular matrix organization (GO:0030198)|peptide cross-linking via chondroitin 4-sulfate glycosaminoglycan (GO:0019800)|positive regulation of cell-substrate adhesion (GO:0010811)	basement membrane (GO:0005604)|cell junction (GO:0030054)|interstitial matrix (GO:0005614)|synapse (GO:0045202)	glycosaminoglycan binding (GO:0005539)			NS(1)|breast(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|lung(43)|ovary(1)|pancreas(3)|prostate(1)|skin(8)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	85	all_lung(31;0.000385)					TTTTCATTGGCGGAGTCCCCA	0.423																																					p.G737G	Colon(62;485 1295 3347 17454)	.											.	EGFLAM-187	0			c.C2211T						.						108.0	107.0	107.0					5																	38435283		2203	4300	6503	SO:0001819	synonymous_variant	133584	exon16			CATTGGCGGAGTC	AK097549	CCDS3924.1, CCDS3925.1, CCDS47199.1, CCDS56363.1	5p13.2-p13.1	2014-04-03			ENSG00000164318	ENSG00000164318		"""Fibronectin type III domain containing"""	26810	protein-coding gene	gene with protein product	"""pikachurin"", ""agrin-like"""					18641643, 20078962, 22760553	Standard	NM_182801		Approved	FLJ39155, AGRINL, AGRNL, PIKA	uc003jlc.2	Q63HQ2	OTTHUMG00000131139	ENST00000354891.3:c.2211C>T	5.37:g.38435283C>T		Somatic	68	0		WXS	Illumina GAIIx	Phase_I	97	7	NM_001205301	0	0	0	0	0	A8K6D7|Q5U643|Q6P3V1|Q8N124|Q8N197|Q8N7Y0|Q8N8N5|Q8NAL2	Silent	SNP	ENST00000354891.3	37	CCDS56363.1																																																																																			.		0.423	EGFLAM-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000367323.1	NM_152403	
SOWAHA	134548	hgsc.bcm.edu	37	5	132149684	132149684	+	Missense_Mutation	SNP	G	G	C	rs40274	byFrequency	TCGA-OR-A5KU-01A-11D-A29I-10	TCGA-OR-A5KU-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9652ca0-126e-4332-909a-4e2d2fc489ef	68f72637-d9e1-41a6-8bd0-b4f99bbc13a1	g.chr5:132149684G>C	ENST00000378693.2	+	1	652	c.371G>C	c.(370-372)cGg>cCg	p.R124P		NM_175873.4	NP_787069.3	Q2M3V2	SWAHA_HUMAN	sosondowah ankyrin repeat domain family member A	124	Pro-rich.		R -> P (in dbSNP:rs40274).														CCCTTGGTCCGGGTGCCGCGG	0.776																																					p.R124P		.											.	.	0			c.G371C						.	C	PRO/ARG	2599,13		1293,13,0	2.0	3.0	3.0		371	-0.3	0.0	5	dbSNP_76	3	6177,193		2993,191,1	no	missense	ANKRD43	NM_175873.4	103	4286,204,1	CC,CG,GG		3.0298,0.4977,2.2935	benign	124/550	132149684	8776,206	1306	3185	4491	SO:0001583	missense	134548	exon1			TGGTCCGGGTGCC	AK090823	CCDS43361.1	5q23.3	2013-01-10	2012-01-12	2012-01-12	ENSG00000198944	ENSG00000198944		"""Ankyrin repeat domain containing"""	27033	protein-coding gene	gene with protein product			"""ankyrin repeat domain 43"""	ANKRD43		22234889	Standard	NM_175873		Approved		uc003kxw.3	Q2M3V2	OTTHUMG00000059844	ENST00000378693.2:c.371G>C	5.37:g.132149684G>C	ENSP00000367965:p.Arg124Pro	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	5	5	NM_175873	0	0	0	0	0	Q8NAE7	Missense_Mutation	SNP	ENST00000378693.2	37	CCDS43361.1	2142	0.9807692307692307	482	0.9796747967479674	357	0.9861878453038674	562	0.9825174825174825	741	0.9775725593667546	c	9.833	1.188835	0.21954	0.995023	0.969702	ENSG00000198944	ENST00000378693	T	0.38077	1.16	4.27	-0.265	0.12946	.	2.345400	0.02245	N	0.066177	T	0.00012	0.0000	N	0.08118	0	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.36261	-0.9755	9	0.30078	T	0.28	-5.2019	3.6102	0.08057	0.2245:0.4439:0.2467:0.085	rs40274	124	Q2M3V2	ANR43_HUMAN	P	124	ENSP00000367965:R124P	ENSP00000367965:R124P	R	+	2	0	ANKRD43	132177583	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-1.768000	0.01794	-0.003000	0.14444	-3.153000	0.00058	CGG	G|0.980;C|0.020		0.776	SOWAHA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000133062.1	NM_175873	
NRG2	9542	hgsc.bcm.edu	37	5	139227532	139227532	+	Silent	SNP	C	C	T	rs373462739	byFrequency	TCGA-OR-A5KU-01A-11D-A29I-10	TCGA-OR-A5KU-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9652ca0-126e-4332-909a-4e2d2fc489ef	68f72637-d9e1-41a6-8bd0-b4f99bbc13a1	g.chr5:139227532C>T	ENST00000361474.1	-	10	2747	c.2523G>A	c.(2521-2523)ccG>ccA	p.P841P	NRG2_ENST00000545385.1_Silent_p.P843P|NRG2_ENST00000541337.1_Silent_p.P775P|NRG2_ENST00000358522.3_Silent_p.P843P|NRG2_ENST00000289409.4_Silent_p.P835P|CTB-35F21.4_ENST00000504413.1_RNA|NRG2_ENST00000340391.3_Silent_p.P638P|NRG2_ENST00000394770.1_3'UTR|NRG2_ENST00000289422.7_Silent_p.P849P	NM_004883.2	NP_004874.1	O14511	NRG2_HUMAN	neuregulin 2	841					embryo development (GO:0009790)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|signal transduction (GO:0007165)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	receptor binding (GO:0005102)			breast(2)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(5)|ovary(1)|pancreas(2)|prostate(1)|skin(1)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(1)	25			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GCTTggcccgcgggggcggcc	0.721													C|||	41	0.0081869	0.0	0.0418	5008	,	,		4075	0.004		0.006	False		,,,				2504	0.002				p.P849P		.											.	NRG2-526	0			c.G2547A						.						2.0	2.0	2.0					5																	139227532		1135	2073	3208	SO:0001819	synonymous_variant	9542	exon11			GGCCCGCGGGGGC		CCDS4217.1, CCDS54910.1	5q23-q33	2013-01-11			ENSG00000158458	ENSG00000158458		"""Immunoglobulin superfamily / I-set domain containing"""	7998	protein-coding gene	gene with protein product	"""neural- and thymus-derived activator for ErbB kinases"", ""divergent of neuregulin-1"""	603818				9168114, 9168115	Standard	NM_004883		Approved	Don-1, NTAK, HRG2	uc003lev.2	O14511	OTTHUMG00000129241	ENST00000361474.1:c.2523G>A	5.37:g.139227532C>T		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	16	8	NM_013982	0	0	0	1	1		Silent	SNP	ENST00000361474.1	37	CCDS4217.1																																																																																			.		0.721	NRG2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000251340.1	NM_013982	
PCDHB10	56126	hgsc.bcm.edu	37	5	140573844	140573844	+	Silent	SNP	C	C	T			TCGA-OR-A5KU-01A-11D-A29I-10	TCGA-OR-A5KU-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9652ca0-126e-4332-909a-4e2d2fc489ef	68f72637-d9e1-41a6-8bd0-b4f99bbc13a1	g.chr5:140573844C>T	ENST00000239446.4	+	1	1903	c.1719C>T	c.(1717-1719)acC>acT	p.T573T		NM_018930.3	NP_061753.1	Q9UN67	PCDBA_HUMAN	protocadherin beta 10	573	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|homophilic cell adhesion (GO:0007156)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(14)|lung(30)|ovary(4)|prostate(5)|skin(3)|upper_aerodigestive_tract(4)|urinary_tract(2)	76			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			CGCCCTGCACCGAGCTGGTGC	0.711																																					p.T573T		.											.	PCDHB10-92	0			c.C1719T						.						7.0	10.0	9.0					5																	140573844		1626	3527	5153	SO:0001819	synonymous_variant	56126	exon1			CTGCACCGAGCTG	AF152489	CCDS4252.1	5q31.3	2010-06-15			ENSG00000120324	ENSG00000120324		"""Cadherins / Protocadherins : Clustered"""	8681	other	protocadherin		606336				10380929	Standard	NM_018930		Approved		uc003lix.3	Q9UN67	OTTHUMG00000129626	ENST00000239446.4:c.1719C>T	5.37:g.140573844C>T		Somatic	1	0		WXS	Illumina GAIIx	Phase_I	58	24	NM_018930	0	0	30	48	18	Q96T99	Silent	SNP	ENST00000239446.4	37	CCDS4252.1																																																																																			.		0.711	PCDHB10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251821.1	NM_018930	
ARL10	285598	hgsc.bcm.edu	37	5	175792605	175792605	+	Silent	SNP	G	G	C	rs2303667	byFrequency	TCGA-OR-A5KU-01A-11D-A29I-10	TCGA-OR-A5KU-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9652ca0-126e-4332-909a-4e2d2fc489ef	68f72637-d9e1-41a6-8bd0-b4f99bbc13a1	g.chr5:175792605G>C	ENST00000310389.5	+	1	135	c.39G>C	c.(37-39)ctG>ctC	p.L13L	MIR1271_ENST00000408537.1_RNA	NM_173664.4	NP_775935.1	Q8N8L6	ARL10_HUMAN	ADP-ribosylation factor-like 10	13					small GTPase mediated signal transduction (GO:0007264)	intracellular (GO:0005622)	GTP binding (GO:0005525)			endometrium(2)|lung(1)|ovary(1)	4	all_cancers(89;0.0064)|Renal(175;0.000269)|Lung NSC(126;0.0105)|all_lung(126;0.0168)	Medulloblastoma(196;0.0208)|all_neural(177;0.0416)|all_hematologic(541;0.214)	Kidney(164;3.85e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	Kidney(146;0.0965)		TGCTGGCGCTGGGCGGCGCCG	0.756													G|||	2787	0.55651	0.5938	0.4928	5008	,	,		9772	0.5556		0.6093	False		,,,				2504	0.498				p.L13L		.											.	ARL10-91	0			c.G39C						.	G		1858,1528		603,652,438	3.0	4.0	3.0		39	3.2	0.8	5	dbSNP_100	3	4085,2705		1416,1253,726	no	coding-synonymous	ARL10	NM_173664.4		2019,1905,1164	CC,CG,GG		39.838,45.127,41.5979		13/245	175792605	5943,4233	1693	3395	5088	SO:0001819	synonymous_variant	285598	exon1			GGCGCTGGGCGGC	BK001673	CCDS4400.1	5q35.3	2014-05-09	2005-11-03	2005-11-03	ENSG00000175414	ENSG00000175414		"""ADP-ribosylation factors-like"", ""ADP-ribosylation factors"""	22042	protein-coding gene	gene with protein product			"""ADP-ribosylation factor-like 10A"""	ARL10A			Standard	NM_173664		Approved		uc003mec.1	Q8N8L6	OTTHUMG00000130655	ENST00000310389.5:c.39G>C	5.37:g.175792605G>C		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	11	10	NM_173664	0	0	0	0	0		Silent	SNP	ENST00000310389.5	37	CCDS4400.1																																																																																			G|0.585;C|0.415		0.756	ARL10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253145.2	NM_173664	
BTNL9	153579	hgsc.bcm.edu	37	5	180486404	180486404	+	Missense_Mutation	SNP	C	C	T	rs186444058	byFrequency	TCGA-OR-A5KU-01A-11D-A29I-10	TCGA-OR-A5KU-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9652ca0-126e-4332-909a-4e2d2fc489ef	68f72637-d9e1-41a6-8bd0-b4f99bbc13a1	g.chr5:180486404C>T	ENST00000327705.9	+	11	1381	c.1150C>T	c.(1150-1152)Cac>Tac	p.H384Y	BTNL9_ENST00000376842.3_Missense_Mutation_p.H385Y	NM_152547.4	NP_689760.2	Q6UXG8	BTNL9_HUMAN	butyrophilin-like 9	384	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.					integral component of membrane (GO:0016021)				breast(2)|central_nervous_system(1)|kidney(4)|large_intestine(1)|lung(10)|ovary(1)	19	all_cancers(89;2.45e-05)|all_epithelial(37;3.77e-06)|Renal(175;0.000159)|Lung NSC(126;0.00211)|all_lung(126;0.00371)|Breast(19;0.114)	all_cancers(40;0.0801)|Medulloblastoma(196;0.0392)|all_neural(177;0.0529)|all_hematologic(541;0.191)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			CGCCGGCCGCCACTACTGGGA	0.796													C|||	19	0.00379393	0.0	0.0101	5008	,	,		8064	0.0		0.0089	False		,,,				2504	0.0031				p.H384Y		.											.	BTNL9-91	0			c.C1150T						.						1.0	2.0	1.0					5																	180486404		836	1977	2813	SO:0001583	missense	153579	exon11			GGCCGCCACTACT	AK057097	CCDS4460.2	5q35.3	2014-01-14			ENSG00000165810	ENSG00000165810		"""Immunoglobulin superfamily / V-set domain containing"", ""Butyrophilins"""	24176	protein-coding gene	gene with protein product							Standard	NM_152547		Approved	FLJ32535, BTN8	uc003mmt.3	Q6UXG8	OTTHUMG00000133152	ENST00000327705.9:c.1150C>T	5.37:g.180486404C>T	ENSP00000330200:p.His384Tyr	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	19	16	NM_152547	0	0	0	0	0	A6NL42|Q6P660|Q96DM5	Missense_Mutation	SNP	ENST00000327705.9	37	CCDS4460.2	38	0.0173992673992674	7	0.014227642276422764	5	0.013812154696132596	5	0.008741258741258742	21	0.027704485488126648	c	21.1	4.096472	0.76870	.	.	ENSG00000165810	ENST00000327705;ENST00000376842	T;T	0.68479	-0.33;-0.33	4.71	4.71	0.59529	Concanavalin A-like lectin/glucanase (1);SPla/RYanodine receptor subgroup (1);Butyrophylin-like (1);B30.2/SPRY domain (1);SPla/RYanodine receptor SPRY (1);	0.217602	0.23321	U	0.049449	T	0.65575	0.2704	M	0.76938	2.355	0.30133	N	0.804617	B	0.28233	0.204	P	0.55615	0.78	T	0.75714	-0.3221	10	0.48119	T	0.1	.	15.5784	0.76410	0.0:1.0:0.0:0.0	.	384	Q6UXG8	BTNL9_HUMAN	Y	384;385	ENSP00000330200:H384Y;ENSP00000366038:H385Y	ENSP00000330200:H384Y	H	+	1	0	BTNL9	180419010	0.959000	0.32827	1.000000	0.80357	0.530000	0.34684	2.310000	0.43708	2.365000	0.80145	0.298000	0.19748	CAC	C|0.983;T|0.017		0.796	BTNL9-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000157342.3	NM_152547	
BTN2A3P	54718	broad.mit.edu	37	6	26431805	26431805	+	RNA	SNP	C	C	A	rs143823882	byFrequency	TCGA-OR-A5KU-01A-11D-A29I-10	TCGA-OR-A5KU-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9652ca0-126e-4332-909a-4e2d2fc489ef	68f72637-d9e1-41a6-8bd0-b4f99bbc13a1	g.chr6:26431805C>A	ENST00000466808.2	+	0	1753							Q96KV6	BT2A3_HUMAN	butyrophilin, subfamily 2, member A3, pseudogene							integral component of membrane (GO:0016021)											GCATAGGGAACTAGTTGTTCC	0.483													C|||	14	0.00279553	0.0008	0.0043	5008	,	,		23513	0.0		0.001	False		,,,				2504	0.0092				.		.											.	.	0			.						.	C		0,4406		0,0,2203	117.0	117.0	117.0			-3.9	0.0	6	dbSNP_134	117	9,8591	7.1+/-27.0	0,9,4291	no	intergenic				0,9,6494	AA,AC,CC		0.1047,0.0,0.0692			26431805	9,12997	2203	4300	6503			54718	.			AGGGAACTAGTTG	AL021917		6p22.1	2014-01-14	2011-09-06	2011-09-06	ENSG00000124549	ENSG00000124549		"""Butyrophilins"""	13229	pseudogene	pseudogene		613592	"""butyrophilin, subfamily 2, member A3"""	BTN2A3			Standard	NR_027795		Approved	BTN2.3	uc011dkl.1	Q96KV6	OTTHUMG00000014453		6.37:g.26431805C>A		Somatic	113	0		WXS	Illumina GAIIx	Phase_I	120	4	.	0	0	1	1	0	A6NEF4	RNA	SNP	ENST00000466808.2	37																																																																																				C|0.999;A|0.001		0.483	BTN2A3P-001	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000040118.4	NR_027795	
MUC21	394263	bcgsc.ca	37	6	30954298	30954298	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5KU-01A-11D-A29I-10	TCGA-OR-A5KU-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9652ca0-126e-4332-909a-4e2d2fc489ef	68f72637-d9e1-41a6-8bd0-b4f99bbc13a1	g.chr6:30954298G>A	ENST00000376296.3	+	2	587	c.346G>A	c.(346-348)Ggg>Agg	p.G116R	MUC21_ENST00000486149.2_5'UTR	NM_001010909.2	NP_001010909.2	Q5SSG8	MUC21_HUMAN	mucin 21, cell surface associated	116	28 X 15 AA approximate tandem repeats.|Ser-rich.				cellular protein metabolic process (GO:0044267)|negative regulation of cell-cell adhesion (GO:0022408)|negative regulation of cell-substrate adhesion (GO:0010812)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(4)|breast(1)|central_nervous_system(2)|endometrium(1)|kidney(1)|large_intestine(7)|lung(11)|ovary(3)|prostate(4)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	42						AACCTCCAGTGGGGCCAGCAC	0.597																																					p.G116R		.											.	MUC21-92	0			c.G346A						.						182.0	167.0	172.0					6																	30954298		2203	4300	6503	SO:0001583	missense	394263	exon2			TCCAGTGGGGCCA	AK056612	CCDS34388.1	6p21.33	2008-05-14	2008-05-14	2008-05-14	ENSG00000204544	ENSG00000204544		"""Mucins"""	21661	protein-coding gene	gene with protein product	"""epiglycanin"""		"""chromosome 6 open reading frame 205"""	C6orf205		17977904	Standard	NM_001010909		Approved	bCX31G15.2	uc003nsh.2	Q5SSG8	OTTHUMG00000031216	ENST00000376296.3:c.346G>A	6.37:g.30954298G>A	ENSP00000365473:p.Gly116Arg	Somatic	318	6		WXS	Illumina GAIIx	Phase_I	278	16	NM_001010909	0	0	0	0	0	B0UZT7|B4DQ55|C9JMK2|D9N007|Q0VGF1|Q3B7T2|Q5SS94|Q6UXC5	Missense_Mutation	SNP	ENST00000376296.3	37	CCDS34388.1	.	.	.	.	.	.	.	.	.	.	G	10.63	1.403136	0.25291	.	.	ENSG00000204544	ENST00000450707;ENST00000376296	T	0.03065	4.06	3.34	-2.49	0.06403	.	.	.	.	.	T	0.00724	0.0024	L	0.27053	0.805	0.09310	N	1	B	0.23891	0.093	B	0.20184	0.028	T	0.46938	-0.9155	8	.	.	.	.	3.8039	0.08768	0.2867:0.0:0.4337:0.2796	.	116	Q5SSG8	MUC21_HUMAN	R	116	ENSP00000365473:G116R	.	G	+	1	0	MUC21	31062277	0.077000	0.21312	0.000000	0.03702	0.005000	0.04900	1.890000	0.39728	-0.305000	0.08831	-0.714000	0.03626	GGG	.		0.597	MUC21-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000128579.3	NM_001010909	
PEX6	5190	hgsc.bcm.edu	37	6	42946490	42946490	+	Silent	SNP	C	C	A	rs9462858	byFrequency	TCGA-OR-A5KU-01A-11D-A29I-10	TCGA-OR-A5KU-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9652ca0-126e-4332-909a-4e2d2fc489ef	68f72637-d9e1-41a6-8bd0-b4f99bbc13a1	g.chr6:42946490C>A	ENST00000304611.8	-	1	468	c.399G>T	c.(397-399)gtG>gtT	p.V133V	PEX6_ENST00000244546.4_Silent_p.V133V	NM_000287.3	NP_000278.3	Q13608	PEX6_HUMAN	peroxisomal biogenesis factor 6	133					ATP catabolic process (GO:0006200)|peroxisome organization (GO:0007031)|protein import into peroxisome matrix, translocation (GO:0016561)|protein stabilization (GO:0050821)|protein targeting to peroxisome (GO:0006625)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|peroxisomal membrane (GO:0005778)|peroxisome (GO:0005777)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|ATPase activity, coupled (GO:0042623)|protein C-terminus binding (GO:0008022)|protein complex binding (GO:0032403)			NS(1)|breast(1)|endometrium(2)|large_intestine(2)|lung(5)|ovary(1)|prostate(3)	15			all cancers(41;0.00235)|Colorectal(64;0.00237)|COAD - Colon adenocarcinoma(64;0.00473)|KIRC - Kidney renal clear cell carcinoma(15;0.02)|Kidney(15;0.0388)|OV - Ovarian serous cystadenocarcinoma(102;0.0562)			GCGGTCCGGGCACTGGGAGGG	0.746													C|||	1662	0.331869	0.3691	0.3516	5008	,	,		10923	0.1002		0.4612	False		,,,				2504	0.3732				p.V133V		.											.	PEX6-91	0			c.G399T						.	C		1002,2080		214,574,753	2.0	3.0	3.0	http://www.ncbi.nlm.nih.gov/sites/varvu?gene	399	2.1	0.9	6	dbSNP_119	3	2653,4001		636,1381,1310	no	coding-synonymous	PEX6	NM_000287.3		850,1955,2063	AA,AC,CC		39.8708,32.5114,37.5411		133/981	42946490	3655,6081	1541	3327	4868	SO:0001819	synonymous_variant	5190	exon1			TCCGGGCACTGGG	U56602	CCDS4877.1	6p22-p11	2010-04-21			ENSG00000124587	ENSG00000124587		"""ATPases / AAA-type"""	8859	protein-coding gene	gene with protein product		601498				8670792	Standard	NM_000287		Approved	PXAAA1, PAF-2	uc003otf.3	Q13608	OTTHUMG00000014713	ENST00000304611.8:c.399G>T	6.37:g.42946490C>A		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	5	5	NM_000287	0	0	0	1	1	Q5T8W1|Q8WYQ0|Q8WYQ1|Q8WYQ2|Q99476	Silent	SNP	ENST00000304611.8	37	CCDS4877.1																																																																																			C|0.673;A|0.327		0.746	PEX6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040569.1	NM_000287	
GJA1	2697	broad.mit.edu	37	6	121768897	121768897	+	Missense_Mutation	SNP	A	A	G			TCGA-OR-A5KU-01A-11D-A29I-10	TCGA-OR-A5KU-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9652ca0-126e-4332-909a-4e2d2fc489ef	68f72637-d9e1-41a6-8bd0-b4f99bbc13a1	g.chr6:121768897A>G	ENST00000282561.3	+	2	1061	c.904A>G	c.(904-906)Aac>Gac	p.N302D		NM_000165.3	NP_000156.1	P17302	CXA1_HUMAN	gap junction protein, alpha 1, 43kDa	302					adult heart development (GO:0007512)|apoptotic process (GO:0006915)|ATP transport (GO:0015867)|atrial cardiac muscle cell action potential (GO:0086014)|atrial ventricular junction remodeling (GO:0003294)|blood vessel morphogenesis (GO:0048514)|cell communication by chemical coupling (GO:0010643)|cell communication by electrical coupling (GO:0010644)|cell-cell signaling (GO:0007267)|cellular response to mechanical stimulus (GO:0071260)|chronic inflammatory response (GO:0002544)|embryonic digit morphogenesis (GO:0042733)|endothelium development (GO:0003158)|epithelial cell maturation (GO:0002070)|gap junction assembly (GO:0016264)|heart development (GO:0007507)|heart looping (GO:0001947)|in utero embryonic development (GO:0001701)|ion transmembrane transport (GO:0034220)|lens development in camera-type eye (GO:0002088)|membrane organization (GO:0061024)|milk ejection (GO:0060156)|muscle contraction (GO:0006936)|negative regulation of cardiac muscle cell proliferation (GO:0060044)|negative regulation of gene expression (GO:0010629)|neuron migration (GO:0001764)|neuron projection morphogenesis (GO:0048812)|osteoblast differentiation (GO:0001649)|positive regulation of behavioral fear response (GO:2000987)|positive regulation of cell communication by chemical coupling (GO:0010652)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of gene expression (GO:0010628)|positive regulation of glomerular filtration (GO:0003104)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of striated muscle tissue development (GO:0045844)|positive regulation of vasoconstriction (GO:0045907)|positive regulation of vasodilation (GO:0045909)|protein oligomerization (GO:0051259)|regulation of atrial cardiac muscle cell membrane depolarization (GO:0060371)|regulation of bone mineralization (GO:0030500)|regulation of bone remodeling (GO:0046850)|regulation of calcium ion transport (GO:0051924)|regulation of tight junction assembly (GO:2000810)|regulation of ventricular cardiac muscle cell membrane depolarization (GO:0060373)|regulation of ventricular cardiac muscle cell membrane repolarization (GO:0060307)|response to fluid shear stress (GO:0034405)|response to peptide hormone (GO:0043434)|response to pH (GO:0009268)|signal transduction (GO:0007165)|skeletal muscle tissue regeneration (GO:0043403)|transmembrane transport (GO:0055085)|transport (GO:0006810)|vascular transport (GO:0010232)	apical plasma membrane (GO:0016324)|connexon complex (GO:0005922)|contractile fiber (GO:0043292)|cytosol (GO:0005829)|early endosome (GO:0005769)|endoplasmic reticulum membrane (GO:0005789)|extracellular vesicular exosome (GO:0070062)|fascia adherens (GO:0005916)|focal adhesion (GO:0005925)|gap junction (GO:0005921)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|Golgi-associated vesicle membrane (GO:0030660)|integral component of plasma membrane (GO:0005887)|intercalated disc (GO:0014704)|intermediate filament (GO:0005882)|lateral plasma membrane (GO:0016328)|lysosome (GO:0005764)|membrane raft (GO:0045121)|mitochondrial outer membrane (GO:0005741)|multivesicular body (GO:0005771)|plasma membrane (GO:0005886)	gap junction channel activity (GO:0005243)|ion transmembrane transporter activity (GO:0015075)|signal transducer activity (GO:0004871)			autonomic_ganglia(1)|breast(1)|cervix(2)|endometrium(2)|large_intestine(10)|liver(2)|lung(13)|ovary(2)	33				GBM - Glioblastoma multiforme(226;0.00252)	Carvedilol(DB01136)	CCGCAATTACAACAAGCAAGC	0.512																																					p.N302D		.											.	GJA1-92	0			c.A904G						.						77.0	76.0	77.0					6																	121768897		2203	4300	6503	SO:0001583	missense	2697	exon2			AATTACAACAAGC	BC026329	CCDS5123.1	6q22.31	2013-05-10	2007-01-16		ENSG00000152661	ENSG00000152661		"""Ion channels / Gap junction proteins (connexins)"""	4274	protein-coding gene	gene with protein product	"""oculodentodigital dysplasia (syndactyly type III)"", ""connexin 43"""	121014	"""gap junction protein, alpha-like"", ""gap junction protein, alpha 1, 43kDa (connexin 43)"""	ODDD, GJAL		10331943, 1646158	Standard	NM_000165		Approved	CX43, ODD, ODOD, SDTY3	uc003pyr.3	P17302	OTTHUMG00000015479	ENST00000282561.3:c.904A>G	6.37:g.121768897A>G	ENSP00000282561:p.Asn302Asp	Somatic	83	0		WXS	Illumina GAIIx	Phase_I	68	5	NM_000165	0	0	30	30	0	B2R5U9|Q6FHU1|Q9Y5I8	Missense_Mutation	SNP	ENST00000282561.3	37	CCDS5123.1	.	.	.	.	.	.	.	.	.	.	A	12.93	2.084194	0.36758	.	.	ENSG00000152661	ENST00000440608;ENST00000282561	D	0.82526	-1.62	5.08	5.08	0.68730	Gap junction alpha-1 protein (Cx43), C-terminal (1);	0.000000	0.85682	D	0.000000	T	0.65165	0.2665	L	0.29908	0.895	0.54753	D	0.999984	B	0.09022	0.002	B	0.19666	0.026	T	0.65055	-0.6261	10	0.41790	T	0.15	.	14.189	0.65625	1.0:0.0:0.0:0.0	.	302	P17302	CXA1_HUMAN	D	286;302	ENSP00000282561:N302D	ENSP00000282561:N302D	N	+	1	0	GJA1	121810596	1.000000	0.71417	1.000000	0.80357	0.633000	0.38033	8.709000	0.91379	2.131000	0.65755	0.477000	0.44152	AAC	.		0.512	GJA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042023.1	NM_000165	
CTGF	1490	hgsc.bcm.edu	37	6	132271952	132271952	+	Missense_Mutation	SNP	G	G	C	rs7451102		TCGA-OR-A5KU-01A-11D-A29I-10	TCGA-OR-A5KU-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9652ca0-126e-4332-909a-4e2d2fc489ef	68f72637-d9e1-41a6-8bd0-b4f99bbc13a1	g.chr6:132271952G>C	ENST00000367976.3	-	2	447	c.247C>G	c.(247-249)Cac>Gac	p.H83D	RP11-69I8.3_ENST00000435287.1_RNA	NM_001901.2	NP_001892	P29279	CTGF_HUMAN	connective tissue growth factor	83	IGFBP N-terminal. {ECO:0000255|PROSITE- ProRule:PRU00653}.		H -> D (in dbSNP:rs7451102). {ECO:0000269|PubMed:1293144, ECO:0000269|PubMed:1654338, ECO:0000269|PubMed:9054739, ECO:0000269|Ref.12, ECO:0000269|Ref.4, ECO:0000269|Ref.5, ECO:0000269|Ref.6, ECO:0000269|Ref.7}.		angiogenesis (GO:0001525)|cartilage condensation (GO:0001502)|cell differentiation (GO:0030154)|cell migration (GO:0016477)|cell-matrix adhesion (GO:0007160)|cellular lipid metabolic process (GO:0044255)|chondrocyte proliferation (GO:0035988)|cytosolic calcium ion transport (GO:0060401)|DNA replication (GO:0006260)|epidermis development (GO:0008544)|extracellular matrix constituent secretion (GO:0070278)|fibroblast growth factor receptor signaling pathway (GO:0008543)|gene expression (GO:0010467)|integrin-mediated signaling pathway (GO:0007229)|intracellular signal transduction (GO:0035556)|lung development (GO:0030324)|negative regulation of cell death (GO:0060548)|negative regulation of gene expression (GO:0010629)|organ senescence (GO:0010260)|ossification (GO:0001503)|positive regulation of cardiac muscle contraction (GO:0060452)|positive regulation of cell activation (GO:0050867)|positive regulation of cell death (GO:0010942)|positive regulation of cell differentiation (GO:0045597)|positive regulation of cell proliferation (GO:0008284)|positive regulation of collagen biosynthetic process (GO:0032967)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of G0 to G1 transition (GO:0070318)|positive regulation of gene expression (GO:0010628)|positive regulation of JNK cascade (GO:0046330)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of stress fiber assembly (GO:0051496)|reactive oxygen species metabolic process (GO:0072593)|regulation of cell growth (GO:0001558)|regulation of chondrocyte differentiation (GO:0032330)|response to amino acid (GO:0043200)|response to anoxia (GO:0034059)|response to estradiol (GO:0032355)|response to fatty acid (GO:0070542)|response to glucose (GO:0009749)|response to mineralocorticoid (GO:0051385)|response to peptide hormone (GO:0043434)|response to wounding (GO:0009611)|small molecule metabolic process (GO:0044281)|tissue homeostasis (GO:0001894)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cell cortex (GO:0005938)|cis-Golgi network (GO:0005801)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)	heparin binding (GO:0008201)|insulin-like growth factor binding (GO:0005520)			breast(1)|endometrium(6)|kidney(1)|large_intestine(1)|lung(3)|prostate(1)	13	Breast(56;0.0602)			GBM - Glioblastoma multiforme(226;0.015)|OV - Ovarian serous cystadenocarcinoma(155;0.0169)		GAGCCGAAGTGACAGAATAGG	0.711													C|||	5007	0.9998	1.0	1.0	5008	,	,		8487	1.0		0.999	False		,,,				2504	1.0				p.H83D	Esophageal Squamous(127;510 1660 12817 24400 38449)	.											.	CTGF-90	0			c.C247G						.						7.0	8.0	7.0					6																	132271952		2119	4187	6306	SO:0001583	missense	1490	exon2			CGAAGTGACAGAA	X78947	CCDS5151.1	6q23.2	2008-02-05			ENSG00000118523	ENSG00000118523			2500	protein-coding gene	gene with protein product		121009				1654338	Standard	NM_001901		Approved	IGFBP8, CCN2	uc003qcz.3	P29279	OTTHUMG00000015573	ENST00000367976.3:c.247C>G	6.37:g.132271952G>C	ENSP00000356954:p.His83Asp	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	4	4	NM_001901	0	0	0	0	0	E1P578|Q6LCY0|Q96A79|Q96QX2|Q9UDL6	Missense_Mutation	SNP	ENST00000367976.3	37	CCDS5151.1	2184	1.0	492	1.0	362	1.0	572	1.0	758	1.0	C	8.018	0.758919	0.15846	.	.	ENSG00000118523	ENST00000367976	T	0.62232	0.04	5.28	5.28	0.74379	Insulin-like growth factor-binding protein, IGFBP (2);	0.048665	0.85682	N	0.000000	T	0.06781	0.0173	N	0.00042	-2.475	0.40675	P	0.017750000000000044	B	0.02656	0.0	B	0.01281	0.0	T	0.27739	-1.0065	9	0.02654	T	1	.	15.7931	0.78384	0.0:0.863:0.137:0.0	rs7451102;rs59294435	83	P29279	CTGF_HUMAN	D	83	ENSP00000356954:H83D	ENSP00000356954:H83D	H	-	1	0	CTGF	132313645	1.000000	0.71417	0.923000	0.36655	0.645000	0.38454	4.000000	0.57039	1.236000	0.43740	-0.293000	0.09583	CAC	G|0.000;C|1.000		0.711	CTGF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042239.2	NM_001901	
CTGF	1490	hgsc.bcm.edu	37	6	132271959	132271959	+	Silent	SNP	T	T	G	rs12206231		TCGA-OR-A5KU-01A-11D-A29I-10	TCGA-OR-A5KU-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9652ca0-126e-4332-909a-4e2d2fc489ef	68f72637-d9e1-41a6-8bd0-b4f99bbc13a1	g.chr6:132271959T>G	ENST00000367976.3	-	2	440	c.240A>C	c.(238-240)ctA>ctC	p.L80L	RP11-69I8.3_ENST00000435287.1_RNA	NM_001901.2	NP_001892	P29279	CTGF_HUMAN	connective tissue growth factor	80	IGFBP N-terminal. {ECO:0000255|PROSITE- ProRule:PRU00653}.				angiogenesis (GO:0001525)|cartilage condensation (GO:0001502)|cell differentiation (GO:0030154)|cell migration (GO:0016477)|cell-matrix adhesion (GO:0007160)|cellular lipid metabolic process (GO:0044255)|chondrocyte proliferation (GO:0035988)|cytosolic calcium ion transport (GO:0060401)|DNA replication (GO:0006260)|epidermis development (GO:0008544)|extracellular matrix constituent secretion (GO:0070278)|fibroblast growth factor receptor signaling pathway (GO:0008543)|gene expression (GO:0010467)|integrin-mediated signaling pathway (GO:0007229)|intracellular signal transduction (GO:0035556)|lung development (GO:0030324)|negative regulation of cell death (GO:0060548)|negative regulation of gene expression (GO:0010629)|organ senescence (GO:0010260)|ossification (GO:0001503)|positive regulation of cardiac muscle contraction (GO:0060452)|positive regulation of cell activation (GO:0050867)|positive regulation of cell death (GO:0010942)|positive regulation of cell differentiation (GO:0045597)|positive regulation of cell proliferation (GO:0008284)|positive regulation of collagen biosynthetic process (GO:0032967)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of G0 to G1 transition (GO:0070318)|positive regulation of gene expression (GO:0010628)|positive regulation of JNK cascade (GO:0046330)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of stress fiber assembly (GO:0051496)|reactive oxygen species metabolic process (GO:0072593)|regulation of cell growth (GO:0001558)|regulation of chondrocyte differentiation (GO:0032330)|response to amino acid (GO:0043200)|response to anoxia (GO:0034059)|response to estradiol (GO:0032355)|response to fatty acid (GO:0070542)|response to glucose (GO:0009749)|response to mineralocorticoid (GO:0051385)|response to peptide hormone (GO:0043434)|response to wounding (GO:0009611)|small molecule metabolic process (GO:0044281)|tissue homeostasis (GO:0001894)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cell cortex (GO:0005938)|cis-Golgi network (GO:0005801)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)	heparin binding (GO:0008201)|insulin-like growth factor binding (GO:0005520)			breast(1)|endometrium(6)|kidney(1)|large_intestine(1)|lung(3)|prostate(1)	13	Breast(56;0.0602)			GBM - Glioblastoma multiforme(226;0.015)|OV - Ovarian serous cystadenocarcinoma(155;0.0169)		AGTGACAGAATAGGCCCTTGT	0.701													G|||	5008	1.0	1.0	1.0	5008	,	,		8368	1.0		1.0	False		,,,				2504	1.0				p.L80L	Esophageal Squamous(127;510 1660 12817 24400 38449)	.											.	CTGF-90	0			c.A240C						.						7.0	8.0	7.0					6																	132271959		2127	4192	6319	SO:0001819	synonymous_variant	1490	exon2			ACAGAATAGGCCC	X78947	CCDS5151.1	6q23.2	2008-02-05			ENSG00000118523	ENSG00000118523			2500	protein-coding gene	gene with protein product		121009				1654338	Standard	NM_001901		Approved	IGFBP8, CCN2	uc003qcz.3	P29279	OTTHUMG00000015573	ENST00000367976.3:c.240A>C	6.37:g.132271959T>G		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	4	4	NM_001901	0	0	0	0	0	E1P578|Q6LCY0|Q96A79|Q96QX2|Q9UDL6	Silent	SNP	ENST00000367976.3	37	CCDS5151.1																																																																																			T|0.000;G|1.000		0.701	CTGF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042239.2	NM_001901	
CTGF	1490	hgsc.bcm.edu	37	6	132271980	132271980	+	Silent	SNP	T	T	G	rs6934749		TCGA-OR-A5KU-01A-11D-A29I-10	TCGA-OR-A5KU-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9652ca0-126e-4332-909a-4e2d2fc489ef	68f72637-d9e1-41a6-8bd0-b4f99bbc13a1	g.chr6:132271980T>G	ENST00000367976.3	-	2	419	c.219A>C	c.(217-219)ccA>ccC	p.P73P	RP11-69I8.3_ENST00000435287.1_RNA	NM_001901.2	NP_001892	P29279	CTGF_HUMAN	connective tissue growth factor	73	IGFBP N-terminal. {ECO:0000255|PROSITE- ProRule:PRU00653}.				angiogenesis (GO:0001525)|cartilage condensation (GO:0001502)|cell differentiation (GO:0030154)|cell migration (GO:0016477)|cell-matrix adhesion (GO:0007160)|cellular lipid metabolic process (GO:0044255)|chondrocyte proliferation (GO:0035988)|cytosolic calcium ion transport (GO:0060401)|DNA replication (GO:0006260)|epidermis development (GO:0008544)|extracellular matrix constituent secretion (GO:0070278)|fibroblast growth factor receptor signaling pathway (GO:0008543)|gene expression (GO:0010467)|integrin-mediated signaling pathway (GO:0007229)|intracellular signal transduction (GO:0035556)|lung development (GO:0030324)|negative regulation of cell death (GO:0060548)|negative regulation of gene expression (GO:0010629)|organ senescence (GO:0010260)|ossification (GO:0001503)|positive regulation of cardiac muscle contraction (GO:0060452)|positive regulation of cell activation (GO:0050867)|positive regulation of cell death (GO:0010942)|positive regulation of cell differentiation (GO:0045597)|positive regulation of cell proliferation (GO:0008284)|positive regulation of collagen biosynthetic process (GO:0032967)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of G0 to G1 transition (GO:0070318)|positive regulation of gene expression (GO:0010628)|positive regulation of JNK cascade (GO:0046330)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of stress fiber assembly (GO:0051496)|reactive oxygen species metabolic process (GO:0072593)|regulation of cell growth (GO:0001558)|regulation of chondrocyte differentiation (GO:0032330)|response to amino acid (GO:0043200)|response to anoxia (GO:0034059)|response to estradiol (GO:0032355)|response to fatty acid (GO:0070542)|response to glucose (GO:0009749)|response to mineralocorticoid (GO:0051385)|response to peptide hormone (GO:0043434)|response to wounding (GO:0009611)|small molecule metabolic process (GO:0044281)|tissue homeostasis (GO:0001894)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cell cortex (GO:0005938)|cis-Golgi network (GO:0005801)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)	heparin binding (GO:0008201)|insulin-like growth factor binding (GO:0005520)			breast(1)|endometrium(6)|kidney(1)|large_intestine(1)|lung(3)|prostate(1)	13	Breast(56;0.0602)			GBM - Glioblastoma multiforme(226;0.015)|OV - Ovarian serous cystadenocarcinoma(155;0.0169)		GCGGGTCGCATGGGTCGCGCT	0.716													G|||	5008	1.0	1.0	1.0	5008	,	,		7576	1.0		1.0	False		,,,				2504	1.0				p.P73P	Esophageal Squamous(127;510 1660 12817 24400 38449)	.											.	CTGF-90	0			c.A219C						.						6.0	8.0	7.0					6																	132271980		2100	4127	6227	SO:0001819	synonymous_variant	1490	exon2			GTCGCATGGGTCG	X78947	CCDS5151.1	6q23.2	2008-02-05			ENSG00000118523	ENSG00000118523			2500	protein-coding gene	gene with protein product		121009				1654338	Standard	NM_001901		Approved	IGFBP8, CCN2	uc003qcz.3	P29279	OTTHUMG00000015573	ENST00000367976.3:c.219A>C	6.37:g.132271980T>G		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	4	4	NM_001901	0	0	0	1	1	E1P578|Q6LCY0|Q96A79|Q96QX2|Q9UDL6	Silent	SNP	ENST00000367976.3	37	CCDS5151.1																																																																																			T|0.000;G|1.000		0.716	CTGF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042239.2	NM_001901	
SPAM1	6677	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	123599735	123599735	+	Silent	SNP	G	G	A			TCGA-OR-A5KU-01A-11D-A29I-10	TCGA-OR-A5KU-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9652ca0-126e-4332-909a-4e2d2fc489ef	68f72637-d9e1-41a6-8bd0-b4f99bbc13a1	g.chr7:123599735G>A	ENST00000439500.1	+	6	1855	c.1242G>A	c.(1240-1242)aaG>aaA	p.K414K	SPAM1_ENST00000402183.2_Silent_p.K414K|SPAM1_ENST00000340011.5_Silent_p.K414K|SPAM1_ENST00000460182.1_Silent_p.K414K|SPAM1_ENST00000223028.7_Silent_p.K414K	NM_001174045.1|NM_001174046.1	NP_001167516.1|NP_001167517.1	P38567	HYALP_HUMAN	sperm adhesion molecule 1 (PH-20 hyaluronidase, zona pellucida binding)	414					binding of sperm to zona pellucida (GO:0007339)|carbohydrate metabolic process (GO:0005975)|cell adhesion (GO:0007155)|fusion of sperm to egg plasma membrane (GO:0007342)|multicellular organism reproduction (GO:0032504)|single fertilization (GO:0007338)|sperm-egg recognition (GO:0035036)	anchored component of membrane (GO:0031225)|plasma membrane (GO:0005886)	hyalurononglucosaminidase activity (GO:0004415)			breast(1)|cervix(1)|endometrium(3)|kidney(5)|large_intestine(5)|lung(23)|ovary(3)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	46						AAGGTGGAAAGTTCACAGTAC	0.403																																					p.K414K		.											.	SPAM1-94	0			c.G1242A						.						106.0	102.0	103.0					7																	123599735		2203	4300	6503	SO:0001819	synonymous_variant	6677	exon5			TGGAAAGTTCACA	L13781	CCDS5790.1, CCDS5791.1	7q31	2008-05-02			ENSG00000106304	ENSG00000106304			11217	protein-coding gene	gene with protein product		600930				8282124, 8575780	Standard	NM_153189		Approved	HYAL5, PH-20, SPAG15	uc003vle.3	P38567	OTTHUMG00000157284	ENST00000439500.1:c.1242G>A	7.37:g.123599735G>A		Somatic	67	0		WXS	Illumina GAIIx	Phase_I	77	12	NM_153189	0	0	0	0	0	Q8TC30	Silent	SNP	ENST00000439500.1	37	CCDS5791.1																																																																																			.		0.403	SPAM1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000348309.1		
TMEM229A	730130	hgsc.bcm.edu	37	7	123672532	123672532	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5KU-01A-11D-A29I-10	TCGA-OR-A5KU-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9652ca0-126e-4332-909a-4e2d2fc489ef	68f72637-d9e1-41a6-8bd0-b4f99bbc13a1	g.chr7:123672532G>A	ENST00000455783.1	-	1	991	c.526C>T	c.(526-528)Cgc>Tgc	p.R176C	RP5-921G16.1_ENST00000484322.1_RNA	NM_001136002.1	NP_001129474.1	B2RXF0	T229A_HUMAN	transmembrane protein 229A	176						host cell nucleus (GO:0042025)|integral component of membrane (GO:0016021)	sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(3)|kidney(3)	6						CGCAGGAAGCGCTTCAGGAAC	0.731																																					p.R176C		.											.	.	0			c.C526T						.						10.0	12.0	12.0					7																	123672532		690	1590	2280	SO:0001583	missense	730130	exon1			GGAAGCGCTTCAG	BC157828	CCDS47694.1	7q31.32	2009-09-22			ENSG00000234224	ENSG00000234224			37279	protein-coding gene	gene with protein product							Standard	NM_001136002		Approved		uc011kob.2	B2RXF0	OTTHUMG00000154762	ENST00000455783.1:c.526C>T	7.37:g.123672532G>A	ENSP00000395244:p.Arg176Cys	Somatic	4	0		WXS	Illumina GAIIx	Phase_I	22	15	NM_001136002	0	0	0	0	0	A4D0X6	Missense_Mutation	SNP	ENST00000455783.1	37	CCDS47694.1	.	.	.	.	.	.	.	.	.	.	G	13.09	2.132310	0.37630	.	.	ENSG00000234224	ENST00000455783	.	.	.	4.18	3.17	0.36434	.	.	.	.	.	T	0.45597	0.1350	L	0.29908	0.895	0.30182	N	0.800311	D	0.89917	1.0	P	0.59487	0.858	T	0.41822	-0.9487	8	0.72032	D	0.01	.	9.8079	0.40803	0.0:0.0:0.7795:0.2205	.	176	B2RXF0	T229A_HUMAN	C	176	.	ENSP00000395244:R176C	R	-	1	0	TMEM229A	123459768	0.949000	0.32298	1.000000	0.80357	0.122000	0.20287	0.100000	0.15231	1.889000	0.54706	0.484000	0.47621	CGC	.		0.731	TMEM229A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336960.3	NM_001136002	
RP1L1	94137	hgsc.bcm.edu	37	8	10468989	10468989	+	Silent	SNP	G	G	A			TCGA-OR-A5KU-01A-11D-A29I-10	TCGA-OR-A5KU-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9652ca0-126e-4332-909a-4e2d2fc489ef	68f72637-d9e1-41a6-8bd0-b4f99bbc13a1	g.chr8:10468989G>A	ENST00000382483.3	-	4	2842	c.2619C>T	c.(2617-2619)acC>acT	p.T873T		NM_178857.5	NP_849188.4	Q8IWN7	RP1L1_HUMAN	retinitis pigmentosa 1-like 1	873					cell projection organization (GO:0030030)|intracellular signal transduction (GO:0035556)|photoreceptor cell development (GO:0042461)|photoreceptor cell maintenance (GO:0045494)|visual perception (GO:0007601)	axoneme (GO:0005930)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|photoreceptor connecting cilium (GO:0032391)|photoreceptor outer segment (GO:0001750)				breast(5)|central_nervous_system(2)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(4)|kidney(5)|large_intestine(16)|lung(82)|ovary(8)|prostate(5)|skin(6)|upper_aerodigestive_tract(4)|urinary_tract(3)	148				COAD - Colon adenocarcinoma(149;0.0811)		GGCTGCTGCCGGTGCTCCCAC	0.736																																					p.T873T		.											.	RP1L1-139	0			c.C2619T						.						3.0	5.0	4.0					8																	10468989		1667	3758	5425	SO:0001819	synonymous_variant	94137	exon4			GCTGCCGGTGCTC	AY168346	CCDS43708.1	8p23.1	2011-12-06			ENSG00000183638	ENSG00000183638			15946	protein-coding gene	gene with protein product		608581				12634863	Standard	NM_178857		Approved	DCDC4B	uc003wtc.3	Q8IWN7	OTTHUMG00000163806	ENST00000382483.3:c.2619C>T	8.37:g.10468989G>A		Somatic	1	0		WXS	Illumina GAIIx	Phase_I	22	13	NM_178857	0	0	0	0	0	Q86SQ1|Q8IWN8|Q8IWN9|Q8IWP0|Q8IWP1|Q8IWP2	Silent	SNP	ENST00000382483.3	37	CCDS43708.1																																																																																			.		0.736	RP1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000375673.1		
PCMTD1	115294	bcgsc.ca	37	8	52733110	52733110	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5KU-01A-11D-A29I-10	TCGA-OR-A5KU-10A-01D-A29L-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9652ca0-126e-4332-909a-4e2d2fc489ef	68f72637-d9e1-41a6-8bd0-b4f99bbc13a1	g.chr8:52733110C>T	ENST00000360540.5	-	7	1281	c.875G>A	c.(874-876)gGt>gAt	p.G292D	PCMTD1_ENST00000519559.1_5'UTR|PCMTD1_ENST00000522514.1_Missense_Mutation_p.G292D|PCMTD1_ENST00000544451.1_Missense_Mutation_p.G216D	NM_052937.2	NP_443169.2	Q96MG8	PCMD1_HUMAN	protein-L-isoaspartate (D-aspartate) O-methyltransferase domain containing 1	292						cytoplasm (GO:0005737)	protein-L-isoaspartate (D-aspartate) O-methyltransferase activity (GO:0004719)			NS(2)|endometrium(1)|kidney(3)|large_intestine(3)|lung(17)|prostate(2)|skin(8)|soft_tissue(1)	37		Lung NSC(129;0.0795)|all_lung(136;0.144)				AAGCTGATTACCCACAAATAC	0.398																																					p.G292D		.											.	PCMTD1-68	0			c.G875A						.						192.0	187.0	189.0					8																	52733110		2203	4300	6503	SO:0001583	missense	115294	exon6			TGATTACCCACAA		CCDS6148.1, CCDS69480.1	8q11.23	2010-08-05			ENSG00000168300	ENSG00000168300			30483	protein-coding gene	gene with protein product							Standard	XM_005251146		Approved	FLJ10883	uc003xqx.4	Q96MG8	OTTHUMG00000164246	ENST00000360540.5:c.875G>A	8.37:g.52733110C>T	ENSP00000353739:p.Gly292Asp	Somatic	222	3		WXS	Illumina GAIIx	Phase_I	242	22	NM_052937	0	0	10	10	0	Q96FK9	Missense_Mutation	SNP	ENST00000360540.5	37	CCDS6148.1	.	.	.	.	.	.	.	.	.	.	C	17.90	3.501676	0.64298	.	.	ENSG00000168300	ENST00000360540;ENST00000544451;ENST00000522514	T;T;T	0.44482	0.92;0.92;0.92	5.97	5.97	0.96955	.	0.000000	0.85682	D	0.000000	T	0.51193	0.1660	N	0.25485	0.75	0.80722	D	1	D;D;B	0.89917	0.976;1.0;0.004	P;D;B	0.97110	0.661;1.0;0.006	T	0.26258	-1.0108	10	0.08381	T	0.77	-32.1559	20.4239	0.99064	0.0:1.0:0.0:0.0	.	162;216;292	B4E2B4;F5H1M8;Q96MG8	.;.;PCMD1_HUMAN	D	292;216;292	ENSP00000353739:G292D;ENSP00000444026:G216D;ENSP00000428099:G292D	ENSP00000353739:G292D	G	-	2	0	PCMTD1	52895663	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	7.046000	0.76592	2.828000	0.97474	0.655000	0.94253	GGT	.		0.398	PCMTD1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377909.2	NM_052937	
PCMTD1	115294	bcgsc.ca	37	8	52733144	52733144	+	Missense_Mutation	SNP	C	C	T	rs200246241		TCGA-OR-A5KU-01A-11D-A29I-10	TCGA-OR-A5KU-10A-01D-A29L-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9652ca0-126e-4332-909a-4e2d2fc489ef	68f72637-d9e1-41a6-8bd0-b4f99bbc13a1	g.chr8:52733144C>T	ENST00000360540.5	-	7	1247	c.841G>A	c.(841-843)Gtt>Att	p.V281I	PCMTD1_ENST00000519559.1_5'UTR|PCMTD1_ENST00000522514.1_Missense_Mutation_p.V281I|PCMTD1_ENST00000544451.1_Missense_Mutation_p.V205I	NM_052937.2	NP_443169.2	Q96MG8	PCMD1_HUMAN	protein-L-isoaspartate (D-aspartate) O-methyltransferase domain containing 1	281						cytoplasm (GO:0005737)	protein-L-isoaspartate (D-aspartate) O-methyltransferase activity (GO:0004719)			NS(2)|endometrium(1)|kidney(3)|large_intestine(3)|lung(17)|prostate(2)|skin(8)|soft_tissue(1)	37		Lung NSC(129;0.0795)|all_lung(136;0.144)				CTCTGTTTAACTCTCTTTCTT	0.393																																					p.V281I		.											.	PCMTD1-68	0			c.G841A						.																																			SO:0001583	missense	115294	exon6			GTTTAACTCTCTT		CCDS6148.1, CCDS69480.1	8q11.23	2010-08-05			ENSG00000168300	ENSG00000168300			30483	protein-coding gene	gene with protein product							Standard	XM_005251146		Approved	FLJ10883	uc003xqx.4	Q96MG8	OTTHUMG00000164246	ENST00000360540.5:c.841G>A	8.37:g.52733144C>T	ENSP00000353739:p.Val281Ile	Somatic	247	3		WXS	Illumina GAIIx	Phase_I	277	30	NM_052937	0	0	5	5	0	Q96FK9	Missense_Mutation	SNP	ENST00000360540.5	37	CCDS6148.1	.	.	.	.	.	.	.	.	.	.	C	11.99	1.803545	0.31869	.	.	ENSG00000168300	ENST00000360540;ENST00000544451;ENST00000522514	T;T;T	0.46451	0.87;0.87;0.87	5.97	5.97	0.96955	.	0.260164	0.36972	N	0.002316	T	0.37128	0.0992	L	0.42245	1.32	0.27985	N	0.935891	B;B;B	0.32467	0.039;0.372;0.001	B;B;B	0.35770	0.024;0.21;0.002	T	0.27905	-1.0060	10	0.21540	T	0.41	-33.7683	13.3218	0.60436	0.2592:0.7408:0.0:0.0	.	151;205;281	B4E2B4;F5H1M8;Q96MG8	.;.;PCMD1_HUMAN	I	281;205;281	ENSP00000353739:V281I;ENSP00000444026:V205I;ENSP00000428099:V281I	ENSP00000353739:V281I	V	-	1	0	PCMTD1	52895697	1.000000	0.71417	0.998000	0.56505	0.982000	0.71751	5.921000	0.70028	2.828000	0.97474	0.655000	0.94253	GTT	.		0.393	PCMTD1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377909.2	NM_052937	
NSMAF	8439	hgsc.bcm.edu	37	8	59571856	59571856	+	Intron	SNP	A	A	C	rs59606339	byFrequency	TCGA-OR-A5KU-01A-11D-A29I-10	TCGA-OR-A5KU-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9652ca0-126e-4332-909a-4e2d2fc489ef	68f72637-d9e1-41a6-8bd0-b4f99bbc13a1	g.chr8:59571856A>C	ENST00000038176.3	-	1	272				snoU13_ENST00000459488.1_RNA|NSMAF_ENST00000427130.2_Missense_Mutation_p.I17S	NM_003580.3	NP_003571.2	Q92636	FAN_HUMAN	neutral sphingomyelinase (N-SMase) activation associated factor						ceramide metabolic process (GO:0006672)|intracellular signal transduction (GO:0035556)|positive regulation of apoptotic process (GO:0043065)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)	receptor signaling protein activity (GO:0005057)|sphingomyelin phosphodiesterase activator activity (GO:0016230)			autonomic_ganglia(1)|central_nervous_system(1)|endometrium(7)|kidney(3)|large_intestine(7)|lung(11)|ovary(1)|pancreas(1)|prostate(2)|skin(3)|urinary_tract(1)	38		all_lung(136;0.174)|Lung NSC(129;0.2)				GCACTGCCGGATAGCTCGGCA	0.761													C|||	1348	0.269169	0.4697	0.1037	5008	,	,		10863	0.497		0.0467	False		,,,				2504	0.1094				p.I17S		.											.	NSMAF-91	0			c.T50G						.						4.0	7.0	6.0					8																	59571856		613	1513	2126	SO:0001627	intron_variant	8439	exon1			TGCCGGATAGCTC	X96586	CCDS6173.1, CCDS47864.1	8q12-q13	2013-01-10			ENSG00000035681	ENSG00000035681		"""WD repeat domain containing"""	8017	protein-coding gene	gene with protein product		603043				8808629, 10640829	Standard	NM_003580		Approved	FAN	uc011lee.2	Q92636	OTTHUMG00000164352	ENST00000038176.3:c.59+275T>G	8.37:g.59571856A>C		Somatic	2	0		WXS	Illumina GAIIx	Phase_I	14	4	NM_001144772	0	0	0	0	0	B4DFB0|E9PCH0|Q8IW26	Missense_Mutation	SNP	ENST00000038176.3	37	CCDS6173.1	496	0.2271062271062271	186	0.3780487804878049	31	0.0856353591160221	244	0.42657342657342656	35	0.04617414248021108	C	0.151	-1.090991	0.01858	.	.	ENSG00000035681	ENST00000427130	T	0.55413	0.52	1.89	-0.128	0.13506	.	.	.	.	.	T	0.00012	0.0000	.	.	.	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.45308	-0.9270	6	.	.	.	.	0.796	0.01066	0.2394:0.3623:0.2355:0.1628	rs59606339	17	Q92636-2	.	S	17	ENSP00000411012:I17S	.	I	-	2	0	NSMAF	59734410	0.000000	0.05858	0.000000	0.03702	0.005000	0.04900	0.459000	0.21908	-0.396000	0.07703	-0.358000	0.07595	ATC	A|0.754;C|0.246		0.761	NSMAF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378384.1	NM_003580	
PLEC	5339	hgsc.bcm.edu	37	8	144998190	144998190	+	Silent	SNP	A	A	G	rs2857829	byFrequency	TCGA-OR-A5KU-01A-11D-A29I-10	TCGA-OR-A5KU-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9652ca0-126e-4332-909a-4e2d2fc489ef	68f72637-d9e1-41a6-8bd0-b4f99bbc13a1	g.chr8:144998190A>G	ENST00000322810.4	-	31	6487	c.6318T>C	c.(6316-6318)gcT>gcC	p.A2106A	PLEC_ENST00000354589.3_Silent_p.A1969A|PLEC_ENST00000354958.2_Silent_p.A1947A|PLEC_ENST00000356346.3_Silent_p.A1955A|PLEC_ENST00000357649.2_Silent_p.A1973A|PLEC_ENST00000398774.2_Silent_p.A1937A|PLEC_ENST00000345136.3_Silent_p.A1969A|PLEC_ENST00000527096.1_Silent_p.A1992A|PLEC_ENST00000436759.2_Silent_p.A1996A	NM_201380.2	NP_958782.1	Q15149	PLEC_HUMAN	plectin	2106	Central fibrous rod domain.				apoptotic process (GO:0006915)|cell junction assembly (GO:0034329)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)	costamere (GO:0043034)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|hemidesmosome (GO:0030056)|intermediate filament cytoskeleton (GO:0045111)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|sarcoplasm (GO:0016528)	ankyrin binding (GO:0030506)|poly(A) RNA binding (GO:0044822)|structural constituent of muscle (GO:0008307)			NS(1)|breast(3)|central_nervous_system(4)|cervix(7)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(8)|lung(57)|ovary(4)|pancreas(2)|prostate(11)|skin(9)|stomach(2)|upper_aerodigestive_tract(10)	137						GCTGCCTCGCAGCCTCCAGCT	0.746													a|||	1156	0.230831	0.028	0.2968	5008	,	,		12955	0.1429		0.4274	False		,,,				2504	0.3466				p.A2106A		.											.	PLEC-141	0			c.T6318C						.	G	,,,,,,,	343,3813		21,301,1756	7.0	8.0	8.0		5988,5865,5841,6318,5811,5907,5919,5907	-8.1	0.0	8	dbSNP_100	8	3082,5166		620,1842,1662	no	coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous	PLEC	NM_000445.3,NM_201378.2,NM_201379.1,NM_201380.2,NM_201381.1,NM_201382.2,NM_201383.1,NM_201384.1	,,,,,,,	641,2143,3418	GG,GA,AA		37.3666,8.2531,27.6121	,,,,,,,	1996/4575,1955/4534,1947/4526,2106/4685,1937/4516,1969/4548,1973/4552,1969/4548	144998190	3425,8979	2078	4124	6202	SO:0001819	synonymous_variant	5339	exon31			CCTCGCAGCCTCC	U53204	CCDS43769.1, CCDS43770.1, CCDS43771.1, CCDS43772.1, CCDS43773.1, CCDS43774.1, CCDS43775.1, CCDS47936.1	8q24	2010-02-04	2010-02-04	2010-02-04	ENSG00000178209	ENSG00000178209			9069	protein-coding gene	gene with protein product		601282	"""plectin 1, intermediate filament binding protein, 500kD"", ""epidermolysis bullosa simplex 1 (Ogna)"", ""plectin 1, intermediate filament binding protein 500kDa"""	EBS1, PLEC1		8633055, 8696340	Standard	XM_005250976		Approved	PCN, PLTN	uc003zaf.1	Q15149	OTTHUMG00000165291	ENST00000322810.4:c.6318T>C	8.37:g.144998190A>G		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	10	4	NM_201380	0	0	4	5	1	Q15148|Q16640|Q6S376|Q6S377|Q6S378|Q6S379|Q6S380|Q6S381|Q6S382|Q6S383	Silent	SNP	ENST00000322810.4	37	CCDS43772.1																																																																																			A|0.738;G|0.262		0.746	PLEC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383281.1	NM_000445	
ERMP1	79956	hgsc.bcm.edu	37	9	5832728	5832728	+	Silent	SNP	G	G	C	rs1131727	byFrequency	TCGA-OR-A5KU-01A-11D-A29I-10	TCGA-OR-A5KU-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9652ca0-126e-4332-909a-4e2d2fc489ef	68f72637-d9e1-41a6-8bd0-b4f99bbc13a1	g.chr9:5832728G>C	ENST00000339450.5	-	1	389	c.300C>G	c.(298-300)gcC>gcG	p.A100A	ERMP1_ENST00000214893.5_5'UTR|ERMP1_ENST00000381506.3_5'Flank	NM_024896.2	NP_079172.2	Q7Z2K6	ERMP1_HUMAN	endoplasmic reticulum metallopeptidase 1	100						endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	metal ion binding (GO:0046872)|metallopeptidase activity (GO:0008237)			endometrium(2)|kidney(1)|large_intestine(9)|lung(4)|ovary(1)|prostate(2)|skin(1)	20		Acute lymphoblastic leukemia(23;0.158)		GBM - Glioblastoma multiforme(50;0.00115)|Lung(218;0.111)		GGTGTCCAGCGGCCCCGCGTA	0.741													G|||	2021	0.403554	0.1309	0.428	5008	,	,		3601	0.7093		0.34	False		,,,				2504	0.5051				p.A100A		.											.	ERMP1-69	0			c.C300G						.						4.0	3.0	3.0					9																	5832728		1620	3326	4946	SO:0001819	synonymous_variant	79956	exon1			TCCAGCGGCCCCG	AB058718	CCDS34983.1	9p24	2008-02-05	2007-07-05	2007-07-05	ENSG00000099219	ENSG00000099219			23703	protein-coding gene	gene with protein product	"""Felix-ina"""	611156	"""KIAA1815"""	KIAA1815		11347906	Standard	XM_005251587		Approved	FLJ23309, FXNA	uc003zjm.1	Q7Z2K6	OTTHUMG00000019508	ENST00000339450.5:c.300C>G	9.37:g.5832728G>C		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	11	11	NM_024896	0	0	0	3	3	B2RNA4|B3KSB1|Q8N5T5|Q9H5M1	Silent	SNP	ENST00000339450.5	37	CCDS34983.1																																																																																			G|0.572;C|0.428		0.741	ERMP1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354877.1	NM_024896	
OBP2B	29989	bcgsc.ca	37	9	136081319	136081319	+	Missense_Mutation	SNP	C	C	T	rs11244035	byFrequency	TCGA-OR-A5KU-01A-11D-A29I-10	TCGA-OR-A5KU-10A-01D-A29L-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9652ca0-126e-4332-909a-4e2d2fc489ef	68f72637-d9e1-41a6-8bd0-b4f99bbc13a1	g.chr9:136081319C>T	ENST00000372034.3	-	6	540	c.499G>A	c.(499-501)Gtt>Att	p.V167I	OBP2B_ENST00000372032.2_3'UTR|OBP2B_ENST00000461961.1_5'UTR	NM_014581.2	NP_055396.1	Q9NPH6	OBP2B_HUMAN	odorant binding protein 2B	167			V -> I (in dbSNP:rs11244035).		chemosensory behavior (GO:0007635)|sensory perception of smell (GO:0007608)|transport (GO:0006810)	extracellular region (GO:0005576)	odorant binding (GO:0005549)			central_nervous_system(2)|large_intestine(1)|lung(3)|skin(1)	7				OV - Ovarian serous cystadenocarcinoma(145;3.41e-06)|Epithelial(140;1.88e-05)		TGTTCGGGAACGCAGCTTCCT	0.627													C|||	209	0.0417332	0.0098	0.072	5008	,	,		17199	0.002		0.1143	False		,,,				2504	0.0297				p.V167I		.											.	OBP2B-68	0			c.G499A						.	C	ILE/VAL	122,4284	91.1+/-129.8	2,118,2083	190.0	173.0	179.0		499	-3.3	0.0	9	dbSNP_120	179	883,7717	197.1+/-241.8	26,831,3443	no	missense	OBP2B	NM_014581.2	29	28,949,5526	TT,TC,CC		10.2674,2.769,7.7272	benign	167/171	136081319	1005,12001	2203	4300	6503	SO:0001583	missense	29989	exon6			CGGGAACGCAGCT	AJ251026	CCDS6961.1	9q34	2014-01-22			ENSG00000171102	ENSG00000171102		"""Lipocalins"""	23381	protein-coding gene	gene with protein product		604606					Standard	NM_001288987		Approved	hOBPIIb, LCN14	uc004ccz.3	Q9NPH6	OTTHUMG00000020860	ENST00000372034.3:c.499G>A	9.37:g.136081319C>T	ENSP00000361104:p.Val167Ile	Somatic	177	1		WXS	Illumina GAIIx	Phase_I	176	8	NM_014581	0	0	0	0	0	Q5VSP6|Q9NY51|Q9NY52	Missense_Mutation	SNP	ENST00000372034.3	37	CCDS6961.1	111	0.050824175824175824	8	0.016260162601626018	23	0.06353591160220995	0	0.0	80	0.10554089709762533	C	0.261	-0.999515	0.02128	0.02769	0.102674	ENSG00000171102	ENST00000372034	T	0.13307	2.6	1.64	-3.29	0.05017	Calycin-like (1);	3.990570	0.01469	N	0.016193	T	0.00144	0.0004	N	0.11313	0.125	0.80722	P	0.0	B	0.25312	0.123	B	0.15870	0.014	T	0.25152	-1.0140	9	0.11182	T	0.66	5.7215	4.1974	0.10450	0.162:0.3804:0.0:0.4576	rs11244035;rs17359368;rs11244035	167	Q9NPH6	OBP2B_HUMAN	I	167	ENSP00000361104:V167I	ENSP00000361104:V167I	V	-	1	0	OBP2B	135071140	0.000000	0.05858	0.000000	0.03702	0.015000	0.08874	-1.055000	0.03493	-1.541000	0.01727	-1.281000	0.01382	GTT	C|0.932;T|0.068		0.627	OBP2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054851.1	NM_014581	
MAGEB5	347541	bcgsc.ca	37	X	26235962	26235962	+	Missense_Mutation	SNP	G	G	A	rs566246526		TCGA-OR-A5KU-01A-11D-A29I-10	TCGA-OR-A5KU-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9652ca0-126e-4332-909a-4e2d2fc489ef	68f72637-d9e1-41a6-8bd0-b4f99bbc13a1	g.chrX:26235962G>A	ENST00000602297.1	+	2	791	c.544G>A	c.(544-546)Gtg>Atg	p.V182M	MAGEB5_ENST00000379029.2_Missense_Mutation_p.V182M	NM_001271752.1	NP_001258681.1	Q9BZ81	MAGB5_HUMAN	melanoma antigen family B, 5	182	MAGE. {ECO:0000255|PROSITE- ProRule:PRU00127}.									lung(1)|ovary(1)	2						TCAGGATTTCGTGAGGCTAAC	0.458													G|||	17	0.00450331	0.0	0.0	3775	,	,		15882	0.0		0.0	False		,,,				2504	0.0174				p.V182M		.											.	MAGEB5-109	0			c.G544A						.																																			SO:0001583	missense	347541	exon2			GATTTCGTGAGGC	AF333705	CCDS65233.1	Xp22	2012-04-20			ENSG00000188408	ENSG00000188408			23795	protein-coding gene	gene with protein product	"""cancer/testis antigen family 3, member 3"""	300466				10861452	Standard	NM_001271752		Approved	MAGE-B5, CT3.3	uc031thc.1	Q9BZ81	OTTHUMG00000021288	ENST00000602297.1:c.544G>A	X.37:g.26235962G>A	ENSP00000473493:p.Val182Met	Somatic	202	1		WXS	Illumina GAIIx	Phase_I	248	112	NM_001271752	0	0	0	0	0		Missense_Mutation	SNP	ENST00000602297.1	37		.	.	.	.	.	.	.	.	.	.	G	8.783	0.928671	0.18131	.	.	ENSG00000188408	ENST00000379029	T	0.08896	3.04	4.06	2.27	0.28462	.	0.076727	0.51477	U	0.000098	T	0.25754	0.0627	H	0.94582	3.555	0.09310	N	1	.	.	.	.	.	.	T	0.14615	-1.0466	8	0.87932	D	0	.	4.3167	0.10997	0.1195:0.0:0.658:0.2225	.	.	.	.	M	182	ENSP00000368315:V182M	ENSP00000368315:V182M	V	+	1	0	MAGEB5	26145883	0.249000	0.23941	0.010000	0.14722	0.069000	0.16628	1.288000	0.33296	0.482000	0.27582	-0.174000	0.13273	GTG	.		0.458	MAGEB5-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000056126.2	XM_293407	
CCDC22	28952	broad.mit.edu;ucsc.edu;bcgsc.ca	37	X	49093667	49093667	+	Silent	SNP	T	T	A			TCGA-OR-A5KU-01A-11D-A29I-10	TCGA-OR-A5KU-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9652ca0-126e-4332-909a-4e2d2fc489ef	68f72637-d9e1-41a6-8bd0-b4f99bbc13a1	g.chrX:49093667T>A	ENST00000376227.3	+	2	335	c.165T>A	c.(163-165)ccT>ccA	p.P55P	CCDC22_ENST00000496651.1_3'UTR	NM_014008.3	NP_054727.1	O60826	CCD22_HUMAN	coiled-coil domain containing 22	55										NS(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(5)|prostate(2)|skin(1)	18						GCCTCAGCCCTCTGCTGCCTC	0.627																																					p.P55P		.											.	CCDC22-130	0			c.T165A						.						86.0	62.0	70.0					X																	49093667		2203	4300	6503	SO:0001819	synonymous_variant	28952	exon2			CAGCCCTCTGCTG	BC000972	CCDS14322.1	Xp11.23	2008-02-05	2005-07-24	2005-07-24	ENSG00000101997	ENSG00000101997			28909	protein-coding gene	gene with protein product		300859	"""chromosome X open reading frame 37"""	CXorf37		12477932	Standard	NM_014008		Approved	JM1	uc004dnd.2	O60826	OTTHUMG00000024141	ENST00000376227.3:c.165T>A	X.37:g.49093667T>A		Somatic	66	1		WXS	Illumina GAIIx	Phase_I	82	25	NM_014008	0	0	13	13	0	A8K7G1	Silent	SNP	ENST00000376227.3	37	CCDS14322.1																																																																																			.		0.627	CCDC22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060822.1	NM_014008	
OCRL	4952	broad.mit.edu;ucsc.edu;bcgsc.ca	37	X	128721082	128721082	+	Missense_Mutation	SNP	A	A	G			TCGA-OR-A5KU-01A-11D-A29I-10	TCGA-OR-A5KU-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9652ca0-126e-4332-909a-4e2d2fc489ef	68f72637-d9e1-41a6-8bd0-b4f99bbc13a1	g.chrX:128721082A>G	ENST00000371113.4	+	20	2408	c.2243A>G	c.(2242-2244)tAc>tGc	p.Y748C	OCRL_ENST00000357121.5_Missense_Mutation_p.Y740C	NM_000276.3	NP_000267.2	Q01968	OCRL_HUMAN	oculocerebrorenal syndrome of Lowe	748	Rho-GAP. {ECO:0000255|PROSITE- ProRule:PRU00172}.				cilium assembly (GO:0042384)|in utero embryonic development (GO:0001701)|inositol phosphate metabolic process (GO:0043647)|lipid metabolic process (GO:0006629)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol dephosphorylation (GO:0046856)|phospholipid metabolic process (GO:0006644)|positive regulation of Rac GTPase activity (GO:0032855)|regulation of Rac GTPase activity (GO:0032314)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|small molecule metabolic process (GO:0044281)	clathrin-coated vesicle (GO:0030136)|coated pit (GO:0005905)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|early endosome (GO:0005769)|extracellular vesicular exosome (GO:0070062)|Golgi stack (GO:0005795)|Golgi-associated vesicle (GO:0005798)|nucleus (GO:0005634)|photoreceptor outer segment (GO:0001750)|plasma membrane (GO:0005886)|trans-Golgi network (GO:0005802)	inositol phosphate phosphatase activity (GO:0052745)|phosphatidylinositol-4,5-bisphosphate 5-phosphatase activity (GO:0004439)|Rac GTPase activator activity (GO:0030675)|Rac GTPase binding (GO:0048365)			breast(1)|endometrium(3)|kidney(4)|large_intestine(11)|lung(24)|ovary(2)|upper_aerodigestive_tract(3)	48						CTATTCAAATACGCCTGTCAC	0.463																																					p.Y748C		.											.	OCRL-206	0			c.A2243G						.						137.0	123.0	128.0					X																	128721082		2203	4300	6503	SO:0001583	missense	4952	exon20			TCAAATACGCCTG	U57627	CCDS35393.1, CCDS35394.1	Xq25	2014-06-18			ENSG00000122126	ENSG00000122126			8108	protein-coding gene	gene with protein product		300535					Standard	NM_001587		Approved	OCRL1	uc004euq.3	Q01968	OTTHUMG00000022706	ENST00000371113.4:c.2243A>G	X.37:g.128721082A>G	ENSP00000360154:p.Tyr748Cys	Somatic	275	1		WXS	Illumina GAIIx	Phase_I	299	59	NM_000276	0	0	0	0	0	A6NKI1|A8KAP2|B7ZLX2|O60800|Q15684|Q15774|Q4VY09|Q4VY10|Q5JQF1|Q5JQF2|Q9UJG5|Q9UMA5	Missense_Mutation	SNP	ENST00000371113.4	37	CCDS35393.1	.	.	.	.	.	.	.	.	.	.	A	13.72	2.322827	0.41096	.	.	ENSG00000122126	ENST00000371113;ENST00000357121	T;T	0.19250	2.16;2.16	5.46	5.46	0.80206	Rho GTPase-activating protein domain (4);Rho GTPase activation protein (1);	0.290276	0.36409	N	0.002605	T	0.34629	0.0904	L	0.43923	1.385	0.20196	N	0.999926	P;D	0.63046	0.907;0.992	P;P	0.61874	0.517;0.895	T	0.13575	-1.0504	10	0.42905	T	0.14	.	13.3441	0.60561	1.0:0.0:0.0:0.0	.	740;748	Q01968-2;Q01968	.;OCRL_HUMAN	C	748;740	ENSP00000360154:Y748C;ENSP00000349635:Y740C	ENSP00000349635:Y740C	Y	+	2	0	OCRL	128548763	0.956000	0.32656	0.018000	0.16275	0.122000	0.20287	6.523000	0.73787	1.830000	0.53286	0.481000	0.45027	TAC	.		0.463	OCRL-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058917.1	NM_000276	
CNGA2	1260	broad.mit.edu;ucsc.edu;bcgsc.ca	37	X	150912699	150912699	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5KU-01A-11D-A29I-10	TCGA-OR-A5KU-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9652ca0-126e-4332-909a-4e2d2fc489ef	68f72637-d9e1-41a6-8bd0-b4f99bbc13a1	g.chrX:150912699G>A	ENST00000329903.4	+	6	1757	c.1724G>A	c.(1723-1725)cGg>cAg	p.R575Q		NM_005140.1	NP_005131.1	Q16280	CNGA2_HUMAN	cyclic nucleotide gated channel alpha 2	575					phototransduction, visible light (GO:0007603)|potassium ion transmembrane transport (GO:0071805)|regulation of membrane potential (GO:0042391)|sensory perception of smell (GO:0007608)	integral component of plasma membrane (GO:0005887)	cAMP binding (GO:0030552)|cGMP binding (GO:0030553)|intracellular cGMP activated cation channel activity (GO:0005223)|voltage-gated potassium channel activity (GO:0005249)			breast(4)|endometrium(4)|large_intestine(5)|lung(34)|prostate(2)	49	Acute lymphoblastic leukemia(192;6.56e-05)					GAGAGGGGTCGGGAGATCCTC	0.537																																					p.R575Q		.											.	CNGA2-193	0			c.G1724A						.						140.0	122.0	128.0					X																	150912699		2203	4300	6503	SO:0001583	missense	1260	exon7			GGGGTCGGGAGAT	S76067	CCDS14701.1	Xq27	2011-07-05			ENSG00000183862	ENSG00000183862		"""Voltage-gated ion channels / Cyclic nucleotide-regulated channels"""	2149	protein-coding gene	gene with protein product		300338		CNCA1, CNCA		7532814, 16382102	Standard	NM_005140		Approved	CNG2, OCNC1, OCNCa, OCNCALPHA, OCNCalpha, FLJ46312	uc004fey.1	Q16280	OTTHUMG00000024173	ENST00000329903.4:c.1724G>A	X.37:g.150912699G>A	ENSP00000328478:p.Arg575Gln	Somatic	126	1		WXS	Illumina GAIIx	Phase_I	166	43	NM_005140	0	0	0	0	0	A0AVD0	Missense_Mutation	SNP	ENST00000329903.4	37	CCDS14701.1	.	.	.	.	.	.	.	.	.	.	G	16.57	3.160490	0.57368	.	.	ENSG00000183862	ENST00000329903	D	0.97710	-4.5	5.33	5.33	0.75918	Cyclic nucleotide-binding-like (1);RmlC-like jelly roll fold (1);Cyclic nucleotide-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.95395	0.8505	M	0.68593	2.085	0.58432	D	0.99999	P	0.48503	0.911	B	0.28991	0.097	D	0.95662	0.8716	10	0.62326	D	0.03	.	15.3498	0.74373	0.0:0.0:1.0:0.0	.	575	Q16280	CNGA2_HUMAN	Q	575	ENSP00000328478:R575Q	ENSP00000328478:R575Q	R	+	2	0	CNGA2	150663355	1.000000	0.71417	0.996000	0.52242	0.871000	0.50021	6.413000	0.73308	2.216000	0.71823	0.529000	0.55759	CGG	.		0.537	CNGA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060888.1	NM_005140	
IGDCC4	57722	hgsc.bcm.edu;broad.mit.edu	37	15	65688115	65688116	+	In_Frame_Ins	INS	-	-	GCC			TCGA-OR-A5KU-01A-11D-A29I-10	TCGA-OR-A5KU-10A-01D-A29L-10	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9652ca0-126e-4332-909a-4e2d2fc489ef	68f72637-d9e1-41a6-8bd0-b4f99bbc13a1	g.chr15:65688115_65688116insGCC	ENST00000352385.2	-	7	1592_1593	c.1383_1384insGGC	c.(1381-1386)ggcttc>ggcGGCttc	p.461_462insG		NM_020962.1	NP_066013.1	Q8TDY8	IGDC4_HUMAN	immunoglobulin superfamily, DCC subclass, member 4	461	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(1)|central_nervous_system(1)|endometrium(1)|large_intestine(7)|lung(24)|ovary(1)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(3)	44						TGGAGAGAGAAGCCGATGATCT	0.693																																					p.F462delinsGF		.											.	IGDCC4-93	0			c.1384_1385insGGC						.																																			SO:0001652	inframe_insertion	57722	exon7			GAGAGAAGCCGAT		CCDS10206.1	15q22.31	2013-02-11			ENSG00000103742	ENSG00000103742		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	13770	protein-coding gene	gene with protein product	"""likely ortholog of mouse neighbor of Punc E11"""						Standard	NM_020962		Approved	NOPE, LOC57722	uc002aou.1	Q8TDY8	OTTHUMG00000133136	ENST00000352385.2:c.1381_1383dupGGC	15.37:g.65688116_65688118dupGCC	ENSP00000319623:p.Gly461_Gly461dup	Somatic	8	0		WXS	Illumina GAIIx	Phase_I	47	10	NM_020962	0	0	0	0	0	Q9HCE4	In_Frame_Ins	INS	ENST00000352385.2	37	CCDS10206.1																																																																																			.		0.693	IGDCC4-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000256825.2	NM_020962	
DMKN	93099	bcgsc.ca	37	19	36002413	36002414	+	Frame_Shift_Ins	INS	-	-	CCAGGAGGACTCACTGCCGCTGTCACCTCTGCTGCCACCACTGTTGCCAC	rs149670759|rs12973565		TCGA-OR-A5KU-01A-11D-A29I-10	TCGA-OR-A5KU-10A-01D-A29L-10	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9652ca0-126e-4332-909a-4e2d2fc489ef	68f72637-d9e1-41a6-8bd0-b4f99bbc13a1	g.chr19:36002413_36002414insCCAGGAGGACTCACTGCCGCTGTCACCTCTGCTGCCACCACTGTTGCCAC	ENST00000339686.3	-	5	993_994	c.817_818insGTGGCAACAGTGGTGGCAGCAGAGGTGACAGCGGCAGTGAGTCCTCCTGG	c.(817-819)agcfs	p.-273fs	DMKN_ENST00000472252.2_5'Flank|DMKN_ENST00000461300.1_5'Flank|DMKN_ENST00000429837.1_Intron|DMKN_ENST00000492341.2_5'Flank|DMKN_ENST00000602781.1_5'Flank|DMKN_ENST00000392206.2_5'Flank|DMKN_ENST00000458071.1_5'Flank|DMKN_ENST00000488892.1_5'Flank|DMKN_ENST00000414866.2_5'Flank|DMKN_ENST00000419602.1_Intron|DMKN_ENST00000436012.1_5'Flank|DMKN_ENST00000462126.1_5'Flank|DMKN_ENST00000418261.1_Frame_Shift_Ins_p.-273fs|DMKN_ENST00000402589.2_5'Flank|DMKN_ENST00000474928.1_5'Flank|DMKN_ENST00000424570.2_Frame_Shift_Ins_p.-273fs|DMKN_ENST00000467637.1_5'Flank|DMKN_ENST00000443640.1_5'Flank|DMKN_ENST00000451297.2_Frame_Shift_Ins_p.-273fs|DMKN_ENST00000440396.1_Frame_Shift_Ins_p.-273fs|DMKN_ENST00000480502.1_5'Flank|DMKN_ENST00000447113.2_Frame_Shift_Ins_p.-273fs	NM_033317.4	NP_201574	Q6E0U4	DMKN_HUMAN	dermokine							extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)				NS(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(8)|lung(7)|ovary(1)|prostate(1)|skin(2)	27	all_lung(56;1.89e-08)|Lung NSC(56;2.9e-08)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0724)			gctgccactgctgctgccacca	0.653																																					p.S273fs		.											.	DMKN-155	0			c.818_819insGTGGCAACAGTGGTGGCAGCAGAGGTGACAGCGGCAGTGAGTCCTCCTGG						.																																			SO:0001589	frameshift_variant	93099	exon5			CCACTGCTGCTGC	BC035311	CCDS12463.1, CCDS42549.1, CCDS46051.1, CCDS46052.1, CCDS46053.1, CCDS46054.1, CCDS46054.2, CCDS54250.1, CCDS54251.1, CCDS54252.1	19q13.12	2008-10-27			ENSG00000161249	ENSG00000161249			25063	protein-coding gene	gene with protein product						16374476	Standard	NM_001035516		Approved	ZD52F10	uc002nzm.4	Q6E0U4	OTTHUMG00000048101	ENST00000339686.3:c.817_818insGTGGCAACAGTGGTGGCAGCAGAGGTGACAGCGGCAGTGAGTCCTCCTGG	19.37:g.36002413_36002414insCCAGGAGGACTCACTGCCGCTGTCACCTCTGCTGCCACCACTGTTGCCAC	ENSP00000342012:p.Ser273fs	Somatic	72	0		WXS	Illumina GAIIx	Phase_I	108	0	NM_001126058	0	0	0	0	0	A3EZ79|A3EZ80|A3EZ81|A3EZ82|A3EZ83|C9J4P6|C9J5N8|C9JAL3|Q32W58|Q32W62|Q32W63|Q32W64|Q32W65|Q32W66|Q32W67|Q6E0U5|Q6UXC7|Q96EW8|Q9BSY6	Frame_Shift_Ins	INS	ENST00000339686.3	37	CCDS12463.1																																																																																			.		0.653	DMKN-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000109461.2	NM_033317	
TMEM247	388946	hgsc.bcm.edu	37	2	46707846	46707847	+	In_Frame_Ins	INS	-	-	GAGCGGCAGCACGAGGTGGTGATGGAGCAGCTGCAGCGG			TCGA-OR-A5KU-01A-11D-A29I-10	TCGA-OR-A5KU-10A-01D-A29L-10	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9652ca0-126e-4332-909a-4e2d2fc489ef	68f72637-d9e1-41a6-8bd0-b4f99bbc13a1	g.chr2:46707846_46707847insGAGCGGCAGCACGAGGTGGTGATGGAGCAGCTGCAGCGG	ENST00000434431.1	+	2	420_421	c.420_421insGAGCGGCAGCACGAGGTGGTGATGGAGCAGCTGCAGCGG	c.(421-423)gag>GAGCGGCAGCACGAGGTGGTGATGGAGCAGCTGCAGCGGgag	p.141_141E>ERQHEVVMEQLQRE		NM_001145051.2	NP_001138523.1	A6NEH6	TM247_HUMAN	transmembrane protein 247	141						endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)											AGCTGCAGCGGGAGCGGCAGCA	0.663																																					p.R140delinsRERQHEVVMEQLQR		.											.	.	0			c.420_421insGAGCGGCAGCACGAGGTGGTGATGGAGCAGCTGCAGCGG						.																																			SO:0001652	inframe_insertion	388946	exon2			GCAGCGGGAGCGG		CCDS56117.1	2p21	2012-04-11			ENSG00000187600	ENSG00000187600			42967	protein-coding gene	gene with protein product							Standard	NM_001145051		Approved		uc010yod.3	A6NEH6	OTTHUMG00000153137	Exception_encountered	2.37:g.46707846_46707847insGAGCGGCAGCACGAGGTGGTGATGGAGCAGCTGCAGCGG	ENSP00000388684:p.ArgGlnHisGluValValMetGluGlnLeuGlnArgGlu141dup	Somatic	63	0		WXS	Illumina GAIIx	Phase_I	178	0	NM_001145051	0	0	0	0	0		In_Frame_Ins	INS	ENST00000434431.1	37	CCDS56117.1																																																																																			.		0.663	TMEM247-001	KNOWN	mRNA_end_NF|cds_end_NF|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000329726.1	NM_001145051	
BHLHB9	80823	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	X	102003966	102003967	+	Frame_Shift_Ins	INS	-	-	A			TCGA-OR-A5KU-01A-11D-A29I-10	TCGA-OR-A5KU-10A-01D-A29L-10	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9652ca0-126e-4332-909a-4e2d2fc489ef	68f72637-d9e1-41a6-8bd0-b4f99bbc13a1	g.chrX:102003966_102003967insA	ENST00000372735.1	+	4	628_629	c.43_44insA	c.(43-45)gaafs	p.E15fs	BHLHB9_ENST00000448867.1_Frame_Shift_Ins_p.E15fs|BHLHB9_ENST00000361229.4_Frame_Shift_Ins_p.E15fs|BHLHB9_ENST00000447531.1_Frame_Shift_Ins_p.E15fs|BHLHB9_ENST00000457056.1_Frame_Shift_Ins_p.E15fs			Q6PI77	BHLH9_HUMAN	basic helix-loop-helix domain containing, class B, 9	15					learning or memory (GO:0007611)|negative regulation of neuron apoptotic process (GO:0043524)|positive regulation of dendritic spine morphogenesis (GO:0061003)|positive regulation of neurogenesis (GO:0050769)|positive regulation of synapse assembly (GO:0051965)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	protein homodimerization activity (GO:0042803)			cervix(1)|endometrium(6)|kidney(3)|large_intestine(1)|lung(8)|ovary(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	26						GGCCAAAACTGAAAAAAAGGCT	0.5																																					p.E15fs		.											.	BHLHB9-132	0			c.43_44insA						.																																			SO:0001589	frameshift_variant	80823	exon4			AAAACTGAAAAAA	AB051488	CCDS14502.1	Xq23	2014-03-21			ENSG00000198908	ENSG00000198908		"""Basic helix-loop-helix proteins"", ""Armadillo repeat containing"""	29353	protein-coding gene	gene with protein product		300921				11214970, 15034937, 16221301	Standard	NM_030639		Approved	p60TRP, KIAA1701, GASP3	uc011mrv.2	Q6PI77	OTTHUMG00000022060	ENST00000372735.1:c.50dupA	X.37:g.102003973_102003973dupA	ENSP00000361820:p.Glu15fs	Somatic	354	0		WXS	Illumina GAIIx	Phase_I	340	75	NM_001142524	0	0	0	0	0	Q9C0G2	Frame_Shift_Ins	INS	ENST00000372735.1	37	CCDS14502.1																																																																																			.		0.500	BHLHB9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057630.1	NM_030639	
