#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_TTotCov	i_TVarCov	i_Transcript_Id	i_Trna_alt1	i_Trna_alt2	i_Trna_ref	i_Trna_tot	i_Trna_var	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
C1orf127	148345	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	11008485	11008485	+	Silent	SNP	C	C	A			TCGA-OR-A5KW-01A-11D-A29I-10	TCGA-OR-A5KW-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	67dfc56a-abc7-40c7-a901-6512ec38d5f5	804ec9eb-9f16-4ab9-b2dd-2abb72a53348	g.chr1:11008485C>A	ENST00000377008.4	-	11	1652	c.1206G>T	c.(1204-1206)ggG>ggT	p.G402G	C1orf127_ENST00000377004.4_Silent_p.G569G			Q8N9H9	CA127_HUMAN	chromosome 1 open reading frame 127	402										NS(2)|breast(1)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(7)|lung(9)|ovary(1)|prostate(2)|skin(5)	32	Ovarian(185;0.249)	Lung NSC(185;0.000226)|all_lung(284;0.000302)|Renal(390;0.000469)|Colorectal(325;0.0062)|Breast(348;0.0139)|Hepatocellular(190;0.0305)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0731)	STAD - Stomach adenocarcinoma(5;0.0224)	UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;3.71e-07)|COAD - Colon adenocarcinoma(227;7.79e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000305)|Kidney(185;0.000785)|KIRC - Kidney renal clear cell carcinoma(229;0.00262)|READ - Rectum adenocarcinoma(331;0.0509)		CAGCCACATCCCCGCTTGACA	0.637																																					p.G569G		.											.	C1orf127-91	0			c.G1707T						.						28.0	29.0	29.0					1																	11008485		2203	4300	6503	SO:0001819	synonymous_variant	148345	exon12			CACATCCCCGCTT	AK094437	CCDS53267.1	1p36.22	2008-02-05			ENSG00000175262	ENSG00000175262			26730	protein-coding gene	gene with protein product						14702039	Standard	NM_001170754		Approved	FLJ37118	uc010oao.2	Q8N9H9	OTTHUMG00000002032	ENST00000377008.4:c.1206G>T	1.37:g.11008485C>A		Somatic	119	0		WXS	Illumina GAIIx	Phase_I	97	80	NM_001170754	0	0	2	2	0	A0AVG8|A6NKM7|Q5VXJ2	Silent	SNP	ENST00000377008.4	37		.	.	.	.	.	.	.	.	.	.	C	3.736	-0.054541	0.07362	.	.	ENSG00000175262	ENST00000418570;ENST00000520253	T;T	0.29655	1.99;1.56	4.38	-2.93	0.05598	.	2.239560	0.02143	N	0.057359	T	0.23886	0.0578	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.20571	-1.0271	7	0.51188	T	0.08	-4.0258	3.1239	0.06401	0.3045:0.3188:0.0:0.3766	.	.	.	.	V	404;521	ENSP00000387816:G404V;ENSP00000429704:G521V	ENSP00000387816:G404V	G	-	2	0	C1orf127	10931072	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-1.499000	0.02285	-0.438000	0.07232	0.313000	0.20887	GGG	.		0.637	C1orf127-202	KNOWN	basic	protein_coding	protein_coding		NM_173507	
VWA5B1	127731	broad.mit.edu	37	1	20669623	20669623	+	Missense_Mutation	SNP	A	A	C			TCGA-OR-A5KW-01A-11D-A29I-10	TCGA-OR-A5KW-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	67dfc56a-abc7-40c7-a901-6512ec38d5f5	804ec9eb-9f16-4ab9-b2dd-2abb72a53348	g.chr1:20669623A>C	ENST00000375079.2	+	16	2559	c.2363A>C	c.(2362-2364)gAc>gCc	p.D788A	VWA5B1_ENST00000375083.4_Missense_Mutation_p.D788A|VWA5B1_ENST00000525343.1_3'UTR|VWA5B1_ENST00000289815.8_Missense_Mutation_p.D788A	NM_001039500.2	NP_001034589.2	Q5TIE3	VW5B1_HUMAN	von Willebrand factor A domain containing 5B1	788						extracellular region (GO:0005576)				central_nervous_system(1)|endometrium(3)|kidney(1)|prostate(1)|skin(1)	7						TCGGACTGGGACCCCCCAGCC	0.701																																					p.D788A		.											.	.	0			c.A2363C						.						7.0	11.0	10.0					1																	20669623		683	1575	2258	SO:0001583	missense	127731	exon16			ACTGGGACCCCCC	AK125833, AK057346		1p36.12	2014-02-12			ENSG00000158816	ENSG00000158816			26538	protein-coding gene	gene with protein product							Standard	NM_001039500		Approved	FLJ32784	uc009vps.2	Q5TIE3	OTTHUMG00000002835	ENST00000375079.2:c.2363A>C	1.37:g.20669623A>C	ENSP00000364220:p.Asp788Ala	Somatic	72	7		WXS	Illumina GAIIx	Phase_I	124	26	NM_001039500	0	0	0	0	0	A4IF35|A4IF36|Q3ZCM4|Q6ZUB4|Q96M71	Missense_Mutation	SNP	ENST00000375079.2	37		.	.	.	.	.	.	.	.	.	.	a	13.40	2.227098	0.39399	.	.	ENSG00000158816	ENST00000375089;ENST00000289815;ENST00000375083;ENST00000375079	T;T;T	0.13420	2.59;2.59;2.59	3.89	3.89	0.44902	.	1.579240	0.03851	U	0.272332	T	0.12646	0.0307	N	0.19112	0.55	0.80722	D	1	B;B;B	0.14012	0.0;0.009;0.004	B;B;B	0.14023	0.001;0.01;0.01	T	0.08806	-1.0704	10	0.72032	D	0.01	0.5451	10.1452	0.42760	1.0:0.0:0.0:0.0	.	788;788;788	Q5TIE3;Q5TIE3-5;Q5TIE3-2	VW5B1_HUMAN;.;.	A	788	ENSP00000289815:D788A;ENSP00000364224:D788A;ENSP00000364220:D788A	ENSP00000289815:D788A	D	+	2	0	VWA5B1	20542210	1.000000	0.71417	0.914000	0.36105	0.097000	0.18754	4.551000	0.60740	1.398000	0.46701	0.139000	0.15985	GAC	.		0.701	VWA5B1-001	NOVEL	not_organism_supported|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000007945.4	XM_001722222	
LOR	4014	hgsc.bcm.edu	37	1	153233701	153233701	+	Silent	SNP	A	A	C	rs1143390	byFrequency	TCGA-OR-A5KW-01A-11D-A29I-10	TCGA-OR-A5KW-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	67dfc56a-abc7-40c7-a901-6512ec38d5f5	804ec9eb-9f16-4ab9-b2dd-2abb72a53348	g.chr1:153233701A>C	ENST00000368742.3	+	2	333	c.276A>C	c.(274-276)ggA>ggC	p.G92G		NM_000427.2	NP_000418.2	P23490	LORI_HUMAN	loricrin	92					keratinization (GO:0031424)|keratinocyte differentiation (GO:0030216)|peptide cross-linking (GO:0018149)	cornified envelope (GO:0001533)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	protein binding, bridging (GO:0030674)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)			lung(2)	2	all_lung(78;3.35e-32)|Lung NSC(65;1.22e-30)|Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.171)			AGTACTCcggaggcggcggct	0.786													a|||	1994	0.398163	0.416	0.3703	5008	,	,		4732	0.3562		0.3797	False		,,,				2504	0.456				p.G92G		.											.	LOR-90	0			c.A276C						.						1.0	1.0	1.0					1																	153233701		392	1110	1502	SO:0001819	synonymous_variant	4014	exon2			CTCCGGAGGCGGC	M61120	CCDS30870.1	1q21	2008-02-05			ENSG00000203782	ENSG00000203782			6663	protein-coding gene	gene with protein product		152445				2007607, 1355480	Standard	NM_000427		Approved		uc001fbm.3	P23490	OTTHUMG00000013938	ENST00000368742.3:c.276A>C	1.37:g.153233701A>C		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	4	4	NM_000427	0	0	0	0	0	Q5T869|Q5XKF8	Silent	SNP	ENST00000368742.3	37	CCDS30870.1																																																																																			A|0.594;C|0.406		0.786	LOR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039107.1	NM_000427	
SUCO	51430	ucsc.edu	37	1	172579236	172579236	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5KW-01A-11D-A29I-10	TCGA-OR-A5KW-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	67dfc56a-abc7-40c7-a901-6512ec38d5f5	804ec9eb-9f16-4ab9-b2dd-2abb72a53348	g.chr1:172579236C>T	ENST00000263688.3	+	24	3821	c.3602C>T	c.(3601-3603)gCt>gTt	p.A1201V	SUCO_ENST00000610051.1_Missense_Mutation_p.A830V|SUCO_ENST00000367723.4_Missense_Mutation_p.A1352V|SUCO_ENST00000608151.1_Missense_Mutation_p.A1353V	NM_014283.3	NP_055098.1	Q9UBS9	SUCO_HUMAN	SUN domain containing ossification factor	1201					multicellular organismal development (GO:0007275)|ossification (GO:0001503)|positive regulation of collagen biosynthetic process (GO:0032967)|positive regulation of osteoblast differentiation (GO:0045669)|regulation of bone remodeling (GO:0046850)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|rough endoplasmic reticulum (GO:0005791)											GAGAAGAGGGCTTTAAAACGA	0.403																																					p.A1201V		.											.	.	0			c.C3602T						.						63.0	63.0	63.0					1																	172579236		2203	4299	6502	SO:0001583	missense	51430	exon24			AGAGGGCTTTAAA	AF097535	CCDS1303.1, CCDS65726.1, CCDS65727.1, CCDS72984.1	1q24	2012-07-10	2012-07-10	2012-07-10	ENSG00000094975	ENSG00000094975			1240	protein-coding gene	gene with protein product	"""SUN-like protein 1"", ""osteopotentia"""		"""chromosome 1 open reading frame 9"""	C1orf9		10673381, 20440000	Standard	NM_001282750		Approved	CH1, SLP1, OPT	uc001giq.4	Q9UBS9	OTTHUMG00000034839	ENST00000263688.3:c.3602C>T	1.37:g.172579236C>T	ENSP00000263688:p.Ala1201Val	Somatic	113	0		WXS	Illumina GAIIx	Phase_I	91	1	NM_014283	0	0	25	30	5	B2RNU4|Q9BQB9|Q9BXQ2|Q9UL04	Missense_Mutation	SNP	ENST00000263688.3	37	CCDS1303.1	.	.	.	.	.	.	.	.	.	.	C	17.40	3.379624	0.61845	.	.	ENSG00000094975	ENST00000367723;ENST00000263688	.	.	.	5.56	4.64	0.57946	.	0.119853	0.56097	D	0.000027	T	0.55401	0.1918	M	0.65975	2.015	0.43058	D	0.994676	D;P;P	0.57257	0.979;0.835;0.605	P;B;B	0.49999	0.628;0.322;0.244	T	0.62315	-0.6880	9	0.66056	D	0.02	-16.7926	13.5945	0.61982	0.0:0.9228:0.0:0.0772	.	830;1353;1201	B4DYM4;Q5H945;Q9UBS9	.;.;OSPT_HUMAN	V	1353;1201	.	ENSP00000263688:A1201V	A	+	2	0	C1orf9	170845859	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.370000	0.59517	2.617000	0.88574	0.650000	0.86243	GCT	.		0.403	SUCO-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084273.1	NM_016227	
LBR	3930	broad.mit.edu	37	1	225600346	225600346	+	Splice_Site	SNP	T	T	A			TCGA-OR-A5KW-01A-11D-A29I-10	TCGA-OR-A5KW-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	67dfc56a-abc7-40c7-a901-6512ec38d5f5	804ec9eb-9f16-4ab9-b2dd-2abb72a53348	g.chr1:225600346T>A	ENST00000338179.2	-	8	1019	c.894A>T	c.(892-894)ggA>ggT	p.G298G	LBR_ENST00000272163.4_Splice_Site_p.G298G|AC092811.1_ENST00000366845.2_5'Flank	NM_194442.2	NP_919424.1	Q14739	LBR_HUMAN	lamin B receptor	298					cholesterol biosynthetic process (GO:0006695)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|integral component of nuclear inner membrane (GO:0005639)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)	chromo shadow domain binding (GO:0070087)|DNA binding (GO:0003677)|lamin binding (GO:0005521)|oxidoreductase activity, acting on the CH-CH group of donors, NAD or NADP as acceptor (GO:0016628)|poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(5)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	22	Breast(184;0.165)			GBM - Glioblastoma multiforme(131;0.117)		AAGCATAGAATCCTTTAAAAA	0.348																																					p.G298G		.											.	LBR-228	0			c.A894T						.						30.0	32.0	32.0					1																	225600346		2203	4300	6503	SO:0001630	splice_region_variant	3930	exon8			ATAGAATCCTTTA	L25931	CCDS1545.1	1q42.1	2013-01-23			ENSG00000143815	ENSG00000143815		"""Tudor domain containing"""	6518	protein-coding gene	gene with protein product	"""tudor domain containing 18"""	600024				8157663, 9878250	Standard	NM_194442		Approved	DHCR14B, TDRD18	uc001hoy.3	Q14739	OTTHUMG00000037520	ENST00000338179.2:c.893-1A>T	1.37:g.225600346T>A		Somatic	77	10		WXS	Illumina GAIIx	Phase_I	90	15	NM_194442	0	0	0	0	0	B2R5P3|Q14740|Q53GU7|Q59FE6	Silent	SNP	ENST00000338179.2	37	CCDS1545.1																																																																																			.		0.348	LBR-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000091398.1	NM_002296	Silent
EGLN1	54583	hgsc.bcm.edu	37	1	231557164	231557164	+	Missense_Mutation	SNP	C	C	G	rs61750991	byFrequency	TCGA-OR-A5KW-01A-11D-A29I-10	TCGA-OR-A5KW-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	67dfc56a-abc7-40c7-a901-6512ec38d5f5	804ec9eb-9f16-4ab9-b2dd-2abb72a53348	g.chr1:231557164C>G	ENST00000366641.3	-	1	3626	c.471G>C	c.(469-471)caG>caC	p.Q157H	EGLN1_ENST00000476717.1_5'Flank	NM_022051.2	NP_071334.1			egl-9 family hypoxia-inducible factor 1											breast(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(1)|lung(4)|prostate(1)|urinary_tract(1)	16		Prostate(94;0.194)|Acute lymphoblastic leukemia(190;0.244)				TCGCCTTCTCCTGGAACAGCG	0.766													C|||	33	0.00658946	0.0	0.0029	5008	,	,		9987	0.001		0.0268	False		,,,				2504	0.0031				p.Q157H		.											.	EGLN1-226	0			c.G471C						.	C	HIS/GLN	17,3709		0,17,1846	6.0	6.0	6.0		471	-2.4	0.0	1	dbSNP_129	6	157,7197		2,153,3522	yes	missense	EGLN1	NM_022051.2	24	2,170,5368	GG,GC,CC		2.1349,0.4563,1.5704	possibly-damaging	157/427	231557164	174,10906	1863	3677	5540	SO:0001583	missense	54583	exon1			CTTCTCCTGGAAC	AJ310543	CCDS1595.1	1q42.1	2013-08-21	2013-08-21	2001-08-24	ENSG00000135766	ENSG00000135766		"""Zinc fingers, MYND-type"""	1232	protein-coding gene	gene with protein product	"""HIF prolyl hydroxylase 2"""	606425	"""EGL nine (C.elegans) homolog 1"", ""egl nine homolog 1 (C. elegans)"""	C1orf12		11056053	Standard	NM_022051		Approved	SM-20, PHD2, ZMYND6, HIFPH2	uc001huv.2	Q9GZT9	OTTHUMG00000038027	ENST00000366641.3:c.471G>C	1.37:g.231557164C>G	ENSP00000355601:p.Gln157His	Somatic	2	0		WXS	Illumina GAIIx	Phase_I	26	24	NM_022051	0	0	0	2	2		Missense_Mutation	SNP	ENST00000366641.3	37	CCDS1595.1	27	0.012362637362637362	4	0.008130081300813009	2	0.0055248618784530384	0	0.0	21	0.027704485488126648	C	14.92	2.680157	0.47886	0.004563	0.021349	ENSG00000135766	ENST00000366641	D	0.86164	-2.08	4.06	-2.39	0.06602	.	.	.	.	.	T	0.49201	0.1543	N	0.14661	0.345	0.09310	N	1	B	0.30664	0.289	B	0.28916	0.096	T	0.53788	-0.8389	9	0.38643	T	0.18	0.2922	5.8621	0.18754	0.1263:0.41:0.3885:0.0752	rs61750991	157	Q9GZT9	EGLN1_HUMAN	H	157	ENSP00000355601:Q157H	ENSP00000355601:Q157H	Q	-	3	2	EGLN1	229623787	0.007000	0.16637	0.000000	0.03702	0.015000	0.08874	0.147000	0.16202	-0.278000	0.09180	0.557000	0.71058	CAG	C|0.988;G|0.012		0.766	EGLN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000092879.1	NM_022051	
CEP170	9859	broad.mit.edu	37	1	243333027	243333027	+	Silent	SNP	A	A	G	rs200644784		TCGA-OR-A5KW-01A-11D-A29I-10	TCGA-OR-A5KW-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	67dfc56a-abc7-40c7-a901-6512ec38d5f5	804ec9eb-9f16-4ab9-b2dd-2abb72a53348	g.chr1:243333027A>G	ENST00000366542.1	-	12	1797	c.1746T>C	c.(1744-1746)cgT>cgC	p.R582R	CEP170_ENST00000366543.1_Silent_p.R484R|CEP170_ENST00000366544.1_Silent_p.R484R|RP11-261C10.4_ENST00000437499.1_RNA|RP11-261C10.4_ENST00000422938.1_RNA	NM_014812.2	NP_055627.2	Q5SW79	CE170_HUMAN	centrosomal protein 170kDa	582						centriole (GO:0005814)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|microtubule (GO:0005874)|nuclear membrane (GO:0031965)		p.R582R(3)		NS(1)|breast(2)|endometrium(18)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(12)|lung(14)|ovary(1)|prostate(2)|skin(3)|stomach(1)|urinary_tract(1)	62	all_neural(11;0.101)	all_cancers(173;0.003)	all cancers(7;5.81e-06)|GBM - Glioblastoma multiforme(7;0.000443)|OV - Ovarian serous cystadenocarcinoma(106;0.0101)			GTGAAACCCAACGTTTGCTTC	0.398																																					p.R582R		.											.	CEP170-93	3	Substitution - coding silent(3)	kidney(3)	c.T1746C						.						103.0	92.0	95.0					1																	243333027		1878	4106	5984	SO:0001819	synonymous_variant	9859	exon12			AACCCAACGTTTG	AB022657	CCDS44337.1, CCDS44338.1, CCDS44339.1	1q44	2014-02-20	2006-01-12	2006-01-12	ENSG00000143702	ENSG00000143702			28920	protein-coding gene	gene with protein product	"""KARP 1 binding protein"", ""XRCC5 binding protein"""	613023	"""KIAA0470"""	KIAA0470		15616186	Standard	NM_014812		Approved	KAB, FAM68A	uc021plo.1	Q5SW79	OTTHUMG00000039862	ENST00000366542.1:c.1746T>C	1.37:g.243333027A>G		Somatic	534	1		WXS	Illumina GAIIx	Phase_I	407	9	NM_014812	0	0	1	1	0	O75058|Q5SW77|Q5SW78|Q7LGA9|Q86W31|Q9UQ08|Q9UQ09	Silent	SNP	ENST00000366542.1	37	CCDS44339.1	.	.	.	.	.	.	.	.	.	.	A	9.754	1.168273	0.21621	.	.	ENSG00000143702	ENST00000336415	.	.	.	4.66	-6.75	0.01738	.	.	.	.	.	T	0.46833	0.1413	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.51576	-0.8688	4	.	.	.	-8.1159	6.5973	0.22681	0.3246:0.0:0.4436:0.2317	.	.	.	.	A	546	.	.	V	-	2	0	CEP170	241399650	0.846000	0.29590	0.974000	0.42286	0.957000	0.61999	-0.087000	0.11215	-0.781000	0.04548	-0.555000	0.04198	GTT	.		0.398	CEP170-003	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096178.2	NM_014812	
OR2M5	127059	ucsc.edu	37	1	248309020	248309020	+	Missense_Mutation	SNP	G	G	A	rs139290187	byFrequency	TCGA-OR-A5KW-01A-11D-A29I-10	TCGA-OR-A5KW-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	67dfc56a-abc7-40c7-a901-6512ec38d5f5	804ec9eb-9f16-4ab9-b2dd-2abb72a53348	g.chr1:248309020G>A	ENST00000366476.1	+	1	571	c.571G>A	c.(571-573)Gac>Aac	p.D191N		NM_001004690.1	NP_001004690.1	A3KFT3	OR2M5_HUMAN	olfactory receptor, family 2, subfamily M, member 5	191						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|endometrium(5)|kidney(2)|large_intestine(7)|liver(1)|lung(25)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	49	all_cancers(71;0.000149)|all_epithelial(71;1.27e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0388)			CTCATGCAATGACACATCAAT	0.418																																					p.D191N		.											.	OR2M5-71	0			c.G571A						.						284.0	272.0	276.0					1																	248309020		2203	4300	6503	SO:0001583	missense	127059	exon1			TGCAATGACACAT		CCDS31105.1	1q44	2012-08-09		2004-03-10	ENSG00000162727	ENSG00000162727		"""GPCR / Class A : Olfactory receptors"""	19576	protein-coding gene	gene with protein product				OR2M5P			Standard	NM_001004690		Approved		uc010pze.2	A3KFT3	OTTHUMG00000040447	ENST00000366476.1:c.571G>A	1.37:g.248309020G>A	ENSP00000355432:p.Asp191Asn	Somatic	276	1		WXS	Illumina GAIIx	Phase_I	59	6	NM_001004690	0	0	0	0	0		Missense_Mutation	SNP	ENST00000366476.1	37	CCDS31105.1	.	.	.	.	.	.	.	.	.	.	g	13.27	2.186763	0.38609	.	.	ENSG00000162727	ENST00000366476	T	0.00231	8.49	3.05	-0.584	0.11702	GPCR, rhodopsin-like superfamily (1);	0.000000	0.33691	U	0.004660	T	0.00178	0.0005	M	0.63843	1.955	0.09310	N	1	B	0.20052	0.041	B	0.25405	0.06	T	0.40739	-0.9547	10	0.52906	T	0.07	.	6.3472	0.21355	0.2028:0.2355:0.5617:0.0	.	191	A3KFT3	OR2M5_HUMAN	N	191	ENSP00000355432:D191N	ENSP00000355432:D191N	D	+	1	0	OR2M5	246375643	0.002000	0.14202	0.001000	0.08648	0.566000	0.35808	0.608000	0.24223	-0.004000	0.14419	0.492000	0.49549	GAC	G|0.999;A|0.001		0.418	OR2M5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097343.1	NM_001004690	
FAM208B	54906	bcgsc.ca	37	10	5799613	5799613	+	Missense_Mutation	SNP	A	A	G	rs2275774	byFrequency	TCGA-OR-A5KW-01A-11D-A29I-10	TCGA-OR-A5KW-10A-01D-A29L-10	A	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	67dfc56a-abc7-40c7-a901-6512ec38d5f5	804ec9eb-9f16-4ab9-b2dd-2abb72a53348	g.chr10:5799613A>G	ENST00000328090.5	+	17	7488	c.6863A>G	c.(6862-6864)aAg>aGg	p.K2288R		NM_017782.4	NP_060252	Q5VWN6	F208B_HUMAN	family with sequence similarity 208, member B	2288			K -> R (in dbSNP:rs2275774).														TCAGATGACAAGATACTAGAA	0.418													A|||	416	0.0830671	0.0212	0.0994	5008	,	,		21518	0.0595		0.1759	False		,,,				2504	0.0838				p.K2288R		.											.	.	0			c.A6863G						.	A	ARG/LYS	156,3632		2,152,1740	243.0	230.0	234.0		6863	-3.2	0.0	10	dbSNP_100	234	1587,6647		160,1267,2690	yes	missense	FAM208B	NM_017782.4	26	162,1419,4430	GG,GA,AA		19.2737,4.1183,14.4984	benign	2288/2431	5799613	1743,10279	1894	4117	6011	SO:0001583	missense	54906	exon17			ATGACAAGATACT	BX649177	CCDS41485.1	10p15.1	2011-09-14	2011-09-14	2011-09-14	ENSG00000108021	ENSG00000108021			23484	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 18"""	C10orf18		12477932	Standard	NM_017782		Approved	FLJ20360, bA318E3.2, KIAA2006	uc001iij.3	Q5VWN6	OTTHUMG00000017605	ENST00000328090.5:c.6863A>G	10.37:g.5799613A>G	ENSP00000328426:p.Lys2288Arg	Somatic	158	2		WXS	Illumina GAIIx	Phase_I	149	6	NM_017782	0	0	18	18	0	Q2YD91|Q5VWN5|Q6ZRQ8|Q8IVG4|Q9BUZ7|Q9H5J9|Q9H7A4|Q9H996|Q9NXA1	Missense_Mutation	SNP	ENST00000328090.5	37	CCDS41485.1	226	0.10347985347985347	14	0.028455284552845527	42	0.11602209944751381	35	0.06118881118881119	135	0.17810026385224276	A	7.930	0.740551	0.15642	0.041183	0.192737	ENSG00000108021	ENST00000328090;ENST00000442808	T	0.42900	0.96	5.59	-3.17	0.05202	.	0.622148	0.15979	N	0.235401	T	0.00039	0.0001	L	0.36672	1.1	0.80722	P	0.0	B	0.19200	0.034	B	0.14023	0.01	T	0.15983	-1.0418	9	0.27082	T	0.32	.	1.7479	0.02966	0.4115:0.2225:0.2581:0.1079	rs2275774;rs56581575;rs58161058;rs2275774	2288	Q5VWN6	F208B_HUMAN	R	2288;1483	ENSP00000328426:K2288R	ENSP00000328426:K2288R	K	+	2	0	C10orf18	5839619	0.000000	0.05858	0.005000	0.12908	0.046000	0.14306	-0.019000	0.12546	-0.495000	0.06659	0.533000	0.62120	AAG	A|0.887;G|0.113		0.418	FAM208B-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046571.2	NM_017782	
SFTPD	6441	broad.mit.edu;bcgsc.ca	37	10	81706389	81706389	+	Silent	SNP	C	C	A			TCGA-OR-A5KW-01A-11D-A29I-10	TCGA-OR-A5KW-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	67dfc56a-abc7-40c7-a901-6512ec38d5f5	804ec9eb-9f16-4ab9-b2dd-2abb72a53348	g.chr10:81706389C>A	ENST00000372292.3	-	2	67	c.27G>T	c.(25-27)ctG>ctT	p.L9L		NM_003019.4	NP_003010.4	P35247	SFTPD_HUMAN	surfactant protein D	9					defense response to bacterium (GO:0042742)|innate immune response (GO:0045087)|lung alveolus development (GO:0048286)|macrophage chemotaxis (GO:0048246)|negative regulation of interleukin-2 biosynthetic process (GO:0045085)|negative regulation of T cell proliferation (GO:0042130)|positive regulation of phagocytosis (GO:0050766)|reactive oxygen species metabolic process (GO:0072593)|receptor-mediated endocytosis (GO:0006898)|regulation of cytokine production (GO:0001817)|respiratory gaseous exchange (GO:0007585)|surfactant homeostasis (GO:0043129)	collagen trimer (GO:0005581)|endocytic vesicle (GO:0030139)|extracellular region (GO:0005576)|lysosome (GO:0005764)|proteinaceous extracellular matrix (GO:0005578)	carbohydrate binding (GO:0030246)			endometrium(1)|kidney(3)|large_intestine(5)|lung(3)|skin(4)|urinary_tract(1)	17	Breast(12;0.000615)|Prostate(51;0.0095)|all_epithelial(25;0.027)		Epithelial(14;0.0244)|all cancers(16;0.0558)|Colorectal(32;0.109)			TGAGCAGGACCAGTGCAGAGA	0.532																																					p.L9L		.											.	SFTPD-91	0			c.G27T						.						96.0	82.0	87.0					10																	81706389		2203	4300	6503	SO:0001819	synonymous_variant	6441	exon2			CAGGACCAGTGCA	L05485	CCDS7362.1	10q22.2-q23.1	2012-11-02	2008-08-26		ENSG00000133661	ENSG00000133661		"""Collectins"""	10803	protein-coding gene	gene with protein product		178635	"""surfactant, pulmonary-associated protein D"""	SFTP4		1898081, 1339284	Standard	NM_003019		Approved	SP-D, COLEC7	uc001kbh.3	P35247	OTTHUMG00000018590	ENST00000372292.3:c.27G>T	10.37:g.81706389C>A		Somatic	161	0		WXS	Illumina GAIIx	Phase_I	151	7	NM_003019	0	0	0	0	0	Q5T0M3|Q6FH08|Q86YK9|Q8TCD8|Q9UCJ2|Q9UCJ3	Silent	SNP	ENST00000372292.3	37	CCDS7362.1																																																																																			.		0.532	SFTPD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049011.1		
ABCC2	1244	broad.mit.edu	37	10	101594155	101594155	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5KW-01A-11D-A29I-10	TCGA-OR-A5KW-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	67dfc56a-abc7-40c7-a901-6512ec38d5f5	804ec9eb-9f16-4ab9-b2dd-2abb72a53348	g.chr10:101594155G>A	ENST00000370449.4	+	24	3390	c.3277G>A	c.(3277-3279)Gac>Aac	p.D1093N		NM_000392.3	NP_000383	Q92887	MRP2_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP), member 2	1093	ABC transmembrane type-1 2. {ECO:0000255|PROSITE-ProRule:PRU00441}.				cellular chloride ion homeostasis (GO:0030644)|drug transmembrane transport (GO:0006855)|prostaglandin transport (GO:0015732)|response to arsenic-containing substance (GO:0046685)|response to estrogen (GO:0043627)|response to heat (GO:0009408)|response to methotrexate (GO:0031427)|response to oxidative stress (GO:0006979)|thyroid hormone transport (GO:0070327)|transmembrane transport (GO:0055085)|transport (GO:0006810)	apical plasma membrane (GO:0016324)|cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|intercellular canaliculus (GO:0046581)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|organic anion transmembrane transporter activity (GO:0008514)			NS(1)|breast(5)|endometrium(9)|kidney(2)|large_intestine(20)|liver(1)|lung(20)|ovary(2)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	67		Colorectal(252;0.234)		Epithelial(162;2.77e-10)|all cancers(201;2.47e-08)	Adenosine triphosphate(DB00171)|Aminohippurate(DB00345)|Arsenic trioxide(DB01169)|Atorvastatin(DB01076)|Canagliflozin(DB08907)|Carbamazepine(DB00564)|Carboplatin(DB00958)|Cisplatin(DB00515)|Clotrimazole(DB00257)|Conjugated Estrogens(DB00286)|Cyclosporine(DB00091)|Daunorubicin(DB00694)|Dexamethasone(DB01234)|Docetaxel(DB01248)|Doxorubicin(DB00997)|Eprosartan(DB00876)|Ethinyl Estradiol(DB00977)|Etoposide(DB00773)|Ezetimibe(DB00973)|Furosemide(DB00695)|Fusidic Acid(DB02703)|Gadoxetate(DB08884)|Glutathione(DB00143)|Glyburide(DB01016)|Indinavir(DB00224)|Indomethacin(DB00328)|Irinotecan(DB00762)|Ivermectin(DB00602)|Lamivudine(DB00709)|Leucovorin(DB00650)|Levetiracetam(DB01202)|Lomefloxacin(DB00978)|Lovastatin(DB00227)|Methotrexate(DB00563)|Mycophenolate mofetil(DB00688)|Nifedipine(DB01115)|Norgestimate(DB00957)|Ofloxacin(DB01165)|Olmesartan(DB00275)|Oxaliplatin(DB00526)|Paclitaxel(DB01229)|Phenobarbital(DB01174)|Phenytoin(DB00252)|Pitavastatin(DB08860)|Pranlukast(DB01411)|Pravastatin(DB00175)|Probenecid(DB01032)|Quinidine(DB00908)|Reserpine(DB00206)|Rifampicin(DB01045)|Ritonavir(DB00503)|Saquinavir(DB01232)|Simvastatin(DB00641)|Sorafenib(DB00398)|Sparfloxacin(DB01208)|Spironolactone(DB00421)|Sulfasalazine(DB00795)|Sulfinpyrazone(DB01138)|Sunitinib(DB01268)|Tamoxifen(DB00675)|Telmisartan(DB00966)|Tenofovir(DB00300)|Tetrahydrofolic acid(DB00116)|Ursodeoxycholic acid(DB01586)|Vasopressin(DB00067)|Verapamil(DB00661)|Vinblastine(DB00570)|Vincristine(DB00541)	CACAGTGGATGACACCCTGCC	0.468																																					p.D1093N		.											.	ABCC2-91	0			c.G3277A						.						227.0	176.0	193.0					10																	101594155		2203	4300	6503	SO:0001583	missense	1244	exon24			GTGGATGACACCC	U63970	CCDS7484.1	10q24	2012-03-14			ENSG00000023839	ENSG00000023839		"""ATP binding cassette transporters / subfamily C"""	53	protein-coding gene	gene with protein product		601107	"""canalicular multispecific organic anion transporter 1"""	CMOAT		8797578, 9284939	Standard	XM_006717630		Approved	DJS, MRP2, cMRP	uc001kqf.2	Q92887	OTTHUMG00000018895	ENST00000370449.4:c.3277G>A	10.37:g.101594155G>A	ENSP00000359478:p.Asp1093Asn	Somatic	191	0		WXS	Illumina GAIIx	Phase_I	146	5	NM_000392	0	0	0	0	0	B2RMT8|Q14022|Q5T2B1|Q92500|Q92798|Q99663|Q9UMS2	Missense_Mutation	SNP	ENST00000370449.4	37	CCDS7484.1	.	.	.	.	.	.	.	.	.	.	G	13.96	2.391770	0.42410	.	.	ENSG00000023839	ENST00000370449	D	0.90197	-2.63	5.28	5.28	0.74379	ABC transporter, transmembrane domain, type 1 (1);ABC transporter, integral membrane type 1 (1);ABC transporter, transmembrane domain (1);	0.137820	0.64402	D	0.000005	D	0.84447	0.5474	N	0.17723	0.515	0.80722	D	1	B	0.18863	0.031	B	0.22880	0.042	T	0.79155	-0.1920	10	0.16896	T	0.51	-5.9054	18.9134	0.92494	0.0:0.0:1.0:0.0	.	1093	Q92887	MRP2_HUMAN	N	1093	ENSP00000359478:D1093N	ENSP00000359478:D1093N	D	+	1	0	ABCC2	101584145	1.000000	0.71417	0.964000	0.40570	0.403000	0.30841	9.424000	0.97464	2.463000	0.83235	0.511000	0.50034	GAC	.		0.468	ABCC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049825.1	NM_000392	
PLEKHS1	79949	bcgsc.ca	37	10	115526177	115526177	+	Silent	SNP	A	A	G	rs10885500	byFrequency	TCGA-OR-A5KW-01A-11D-A29I-10	TCGA-OR-A5KW-10A-01D-A29L-10	A	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	67dfc56a-abc7-40c7-a901-6512ec38d5f5	804ec9eb-9f16-4ab9-b2dd-2abb72a53348	g.chr10:115526177A>G	ENST00000369310.3	+	2	580	c.18A>G	c.(16-18)caA>caG	p.Q6Q	PLEKHS1_ENST00000361048.1_Silent_p.Q12Q|PLEKHS1_ENST00000369312.4_5'UTR	NM_182601.1	NP_872407.1	Q5SXH7	PKHS1_HUMAN	pleckstrin homology domain containing, family S member 1	6																	TAGGCAAACAATTTACATTTT	0.338													A|||	1168	0.233227	0.0234	0.4625	5008	,	,		18429	0.1379		0.4175	False		,,,				2504	0.2628				p.Q12Q		.											.	.	0			c.A36G						.	A	,,,	381,4023	190.2+/-216.2	23,335,1844	74.0	77.0	76.0		,,36,18	3.1	0.8	10	dbSNP_120	76	3479,5117	507.1+/-376.8	719,2041,1538	no	utr-5,intron,coding-synonymous,coding-synonymous	C10orf81	NM_001193434.1,NM_001193435.1,NM_024889.4,NM_182601.1	,,,	742,2376,3382	GG,GA,AA		40.4723,8.6512,29.6923	,,,	,,12/364,6/466	115526177	3860,9140	2202	4298	6500	SO:0001819	synonymous_variant	79949	exon3			CAAACAATTTACA	AK027190	CCDS7583.1, CCDS53580.1, CCDS53581.1	10q26.11	2013-01-11	2012-05-31	2012-05-31	ENSG00000148735	ENSG00000148735		"""Pleckstrin homology (PH) domain containing"""	26285	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 81"""	C10orf81		12477932	Standard	NM_024889		Approved	FLJ23537, bA211N11.2	uc001lat.2	Q5SXH7	OTTHUMG00000019074	ENST00000369310.3:c.18A>G	10.37:g.115526177A>G		Somatic	121	1		WXS	Illumina GAIIx	Phase_I	79	4	NM_024889	0	0	0	0	0	A8KA02|B3KX00|B6EDE1|Q5SXH8|Q5SXI0|Q6ZQR5|Q8NE42|Q9H5D9	Silent	SNP	ENST00000369310.3	37	CCDS53580.1																																																																																			A|0.729;G|0.271		0.338	PLEKHS1-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000050432.1	NM_024889	
MUC5B	727897	bcgsc.ca	37	11	1266716	1266716	+	Missense_Mutation	SNP	T	T	C	rs200243273	byFrequency	TCGA-OR-A5KW-01A-11D-A29I-10	TCGA-OR-A5KW-10A-01D-A29L-10	T	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	67dfc56a-abc7-40c7-a901-6512ec38d5f5	804ec9eb-9f16-4ab9-b2dd-2abb72a53348	g.chr11:1266716T>C	ENST00000529681.1	+	31	8664	c.8606T>C	c.(8605-8607)aTg>aCg	p.M2869T	MUC5B_ENST00000447027.1_Missense_Mutation_p.M2872T|RP11-532E4.2_ENST00000532061.2_RNA	NM_002458.2	NP_002449.2	Q9HC84	MUC5B_HUMAN	mucin 5B, oligomeric mucus/gel-forming	2869	7 X Cys-rich subdomain repeats.|Thr-rich.			Missing (in Ref. 6; AAB61398). {ECO:0000305}.	cellular protein metabolic process (GO:0044267)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to glucocorticoid stimulus (GO:0071385)|cellular response to retinoic acid (GO:0071300)|epithelial cell differentiation (GO:0030855)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|response to lipopolysaccharide (GO:0032496)|response to ozone (GO:0010193)|response to sulfur dioxide (GO:0010477)|response to vitamin A (GO:0033189)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)				cervix(2)|endometrium(36)|kidney(9)|lung(89)|urinary_tract(1)	137		all_cancers(49;6.97e-08)|all_epithelial(84;3.45e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00141)|Lung(200;0.0853)|LUSC - Lung squamous cell carcinoma(625;0.1)		GTGGTGACCATGGGCTGTGAG	0.657													-|||	1477	0.294928	0.2284	0.2752	5008	,	,		10473	0.4812		0.2266	False		,,,				2504	0.2771				p.M2869T		.											.	.	0			c.T8606C						.						43.0	51.0	49.0					11																	1266716		1683	3765	5448	SO:0001583	missense	727897	exon31			TGACCATGGGCTG	U95031, AF086604	CCDS44515.1, CCDS44515.2	11p15.5	2007-01-19	2006-03-14			ENSG00000117983		"""Mucins"""	7516	protein-coding gene	gene with protein product		600770	"""mucin 5, subtype B, tracheobronchial"""	MUC5		9804771	Standard	NM_002458		Approved	MG1	uc001lta.3	Q9HC84		ENST00000529681.1:c.8606T>C	11.37:g.1266716T>C	ENSP00000436812:p.Met2869Thr	Somatic	28	0		WXS	Illumina GAIIx	Phase_I	79	47	NM_002458	0	0	0	0	0	O00447|O00573|O14985|O15494|O95291|O95451|Q14881|Q7M4S5|Q99552|Q9UE28	Missense_Mutation	SNP	ENST00000529681.1	37	CCDS44515.2	.	.	.	.	.	.	.	.	.	.	-	1.479	-0.557829	0.03967	.	.	ENSG00000117983	ENST00000529681;ENST00000447027;ENST00000349637;ENST00000406844	T;T	0.15718	2.4;2.59	1.67	-1.74	0.08056	.	.	.	.	.	T	0.05686	0.0149	N	0.02539	-0.55	0.80722	P	0.0	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.29882	-0.9997	8	0.87932	D	0	.	3.4419	0.07466	0.1749:0.468:0.0:0.3571	rs2860626;rs2943499;rs2943524;rs3965637	3452;2872	A7Y9J9;E9PBJ0	.;.	T	2869;2872;2841;2829	ENSP00000436812:M2869T;ENSP00000415793:M2872T	ENSP00000343037:M2841T	M	+	2	0	MUC5B	1223292	0.003000	0.15002	0.000000	0.03702	0.007000	0.05969	0.117000	0.15583	-1.035000	0.03291	-0.471000	0.05019	ATG	C|1.000;|0.000		0.657	MUC5B-002	NOVEL	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000390041.2	XM_001126093	
KCNJ11	3767	bcgsc.ca	37	11	17408831	17408831	+	Missense_Mutation	SNP	G	G	C	rs1800467	byFrequency	TCGA-OR-A5KW-01A-11D-A29I-10	TCGA-OR-A5KW-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	67dfc56a-abc7-40c7-a901-6512ec38d5f5	804ec9eb-9f16-4ab9-b2dd-2abb72a53348	g.chr11:17408831G>C	ENST00000339994.4	-	1	1375	c.808C>G	c.(808-810)Ctg>Gtg	p.L270V	KCNJ11_ENST00000526747.1_5'Flank|KCNJ11_ENST00000528731.1_Missense_Mutation_p.L183V	NM_000525.3	NP_000516.3	Q14654	KCJ11_HUMAN	potassium inwardly-rectifying channel, subfamily J, member 11	270			L -> V (in dbSNP:rs1800467). {ECO:0000269|PubMed:8897013, ECO:0000269|PubMed:9032109}.		cellular response to glucose stimulus (GO:0071333)|cellular response to nicotine (GO:0071316)|cellular response to tumor necrosis factor (GO:0071356)|energy reserve metabolic process (GO:0006112)|glucose metabolic process (GO:0006006)|negative regulation of insulin secretion (GO:0046676)|neurological system process (GO:0050877)|positive regulation of cation channel activity (GO:2001259)|potassium ion import (GO:0010107)|potassium ion transmembrane transport (GO:0071805)|regulation of insulin secretion (GO:0050796)|regulation of membrane potential (GO:0042391)|response to ATP (GO:0033198)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|response to ischemia (GO:0002931)|response to testosterone (GO:0033574)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)	ATP-sensitive potassium channel complex (GO:0008282)|axolemma (GO:0030673)|cell body fiber (GO:0070852)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|integral component of plasma membrane (GO:0005887)|intercalated disc (GO:0014704)|mitochondrion (GO:0005739)|myelin sheath (GO:0043209)|neuronal cell body (GO:0043025)|nuclear envelope (GO:0005635)|plasma membrane (GO:0005886)|T-tubule (GO:0030315)|voltage-gated potassium channel complex (GO:0008076)	ankyrin binding (GO:0030506)|ATP binding (GO:0005524)|ATP-activated inward rectifier potassium channel activity (GO:0015272)|ion channel binding (GO:0044325)|potassium ion binding (GO:0030955)|voltage-gated potassium channel activity (GO:0005249)			endometrium(2)|large_intestine(2)|lung(6)|ovary(1)|prostate(3)|skin(2)	16				READ - Rectum adenocarcinoma(2;0.0276)|Colorectal(2;0.0633)	Diazoxide(DB01119)|Glimepiride(DB00222)|Glyburide(DB01016)|Ibutilide(DB00308)|Levosimendan(DB00922)|Thiamylal(DB01154)|Verapamil(DB00661)|Yohimbine(DB01392)	CTGGGTGCCAGGTCGTAGAGT	0.617											OREG0020810	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	G|||	76	0.0151757	0.003	0.0245	5008	,	,		20338	0.0		0.0507	False		,,,				2504	0.0041				p.L270V		.											.	KCNJ11-91	0			c.C808G						.	G	VAL/LEU,VAL/LEU	31,4369	36.8+/-68.6	0,31,2169	139.0	127.0	131.0		808,547	5.4	1.0	11	dbSNP_89	131	403,8183	127.7+/-186.0	5,393,3895	yes	missense,missense	KCNJ11	NM_000525.3,NM_001166290.1	32,32	5,424,6064	CC,CG,GG		4.6937,0.7045,3.3421	benign,benign	270/391,183/304	17408831	434,12552	2200	4293	6493	SO:0001583	missense	3767	exon1			GTGCCAGGTCGTA	D50582	CCDS31436.1, CCDS53606.1	11p15.1	2011-07-05						"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Inwardly rectifying"""	6257	protein-coding gene	gene with protein product		600937				7502040, 16382105	Standard	NM_001166290		Approved	Kir6.2, BIR	uc001mna.3	Q14654		ENST00000339994.4:c.808C>G	11.37:g.17408831G>C	ENSP00000345708:p.Leu270Val	Somatic	192	2	717	WXS	Illumina GAIIx	Phase_I	175	6	NM_000525	0	0	0	0	0	B4DWI4|E9PNK0|Q2M1H7|Q58EX3|Q8IW96	Missense_Mutation	SNP	ENST00000339994.4	37	CCDS31436.1	48	0.02197802197802198	1	0.0020325203252032522	14	0.03867403314917127	0	0.0	33	0.04353562005277045	G	7.898	0.733876	0.15574	0.007045	0.046937	ENSG00000187486	ENST00000339994;ENST00000528731	D;D	0.94723	-3.5;-3.5	5.43	5.43	0.79202	.	0.160775	0.42548	D	0.000688	T	0.65080	0.2657	L	0.38649	1.16	0.42195	D	0.991748	B	0.10296	0.003	B	0.12156	0.007	T	0.75966	-0.3131	10	0.49607	T	0.09	.	5.5084	0.16866	0.1558:0.0:0.6647:0.1794	rs1800467;rs8192538;rs1800467	270	B2RC52	.	V	270;183	ENSP00000345708:L270V;ENSP00000434755:L183V	ENSP00000345708:L270V	L	-	1	2	KCNJ11	17365407	1.000000	0.71417	1.000000	0.80357	0.357000	0.29423	1.095000	0.30964	2.548000	0.85928	0.561000	0.74099	CTG	G|0.734;C|0.266		0.617	KCNJ11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387037.1	NM_000525	
NRXN2	9379	hgsc.bcm.edu	37	11	64480641	64480641	+	Silent	SNP	G	G	A	rs2518907	byFrequency	TCGA-OR-A5KW-01A-11D-A29I-10	TCGA-OR-A5KW-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	67dfc56a-abc7-40c7-a901-6512ec38d5f5	804ec9eb-9f16-4ab9-b2dd-2abb72a53348	g.chr11:64480641G>A	ENST00000377551.1	-	1	742	c.531C>T	c.(529-531)ggC>ggT	p.G177G	NRXN2_ENST00000265459.6_Silent_p.G177G|NRXN2_ENST00000409571.1_Silent_p.G177G|NRXN2_ENST00000377559.3_Silent_p.G177G			Q9P2S2	NRX2A_HUMAN	neurexin 2	177	Laminin G-like 1. {ECO:0000255|PROSITE- ProRule:PRU00122}.				adult behavior (GO:0030534)|gephyrin clustering (GO:0097116)|neuroligin clustering (GO:0097118)|neuron cell-cell adhesion (GO:0007158)|neurotransmitter secretion (GO:0007269)|postsynaptic density protein 95 clustering (GO:0097119)|postsynaptic membrane assembly (GO:0097104)|social behavior (GO:0035176)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)|vocal learning (GO:0042297)|vocalization behavior (GO:0071625)	integral component of membrane (GO:0016021)	calcium channel regulator activity (GO:0005246)|cell adhesion molecule binding (GO:0050839)|metal ion binding (GO:0046872)|neuroligin family protein binding (GO:0097109)			breast(2)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(6)|liver(1)|lung(34)|ovary(6)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(6)|urinary_tract(1)	71						TGGCCAAGAGGCCGCGGAAGG	0.756													G|||	2672	0.533546	0.2216	0.5403	5008	,	,		8112	0.5407		0.7604	False		,,,				2504	0.7096				p.G177G		.											.	NRXN2-232	0			c.C531T						.	G	,	1316,1684		331,654,515	2.0	2.0	2.0		531,531	1.3	1.0	11	dbSNP_100	2	4949,1205		2080,789,208	no	coding-synonymous,coding-synonymous	NRXN2	NM_015080.3,NM_138732.2	,	2411,1443,723	AA,AG,GG		19.5808,43.8667,31.56	,	177/1713,177/1643	64480641	6265,2889	1500	3077	4577	SO:0001819	synonymous_variant	9379	exon2			CAAGAGGCCGCGG		CCDS8077.1, CCDS31597.1, CCDS8078.1	11q13	2008-07-18			ENSG00000110076	ENSG00000110076			8009	protein-coding gene	gene with protein product	"""neurexin II"""	600566				1621094	Standard	NM_015080		Approved		uc021qkw.1	P58401	OTTHUMG00000045214	ENST00000377551.1:c.531C>T	11.37:g.64480641G>A		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	6	6	NM_138732	0	0	0	0	0	A7E2C1|Q9Y2D6	Silent	SNP	ENST00000377551.1	37	CCDS8077.1																																																																																			G|0.449;A|0.551		0.756	NRXN2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000104967.3	NM_015080	
MEN1	4221	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	64573817	64573817	+	Nonsense_Mutation	SNP	G	G	C	rs386134260		TCGA-OR-A5KW-01A-11D-A29I-10	TCGA-OR-A5KW-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	67dfc56a-abc7-40c7-a901-6512ec38d5f5	804ec9eb-9f16-4ab9-b2dd-2abb72a53348	g.chr11:64573817G>C	ENST00000337652.1	-	7	1454	c.951C>G	c.(949-951)taC>taG	p.Y317*	MEN1_ENST00000394374.2_Nonsense_Mutation_p.Y317*|MEN1_ENST00000377326.3_Nonsense_Mutation_p.Y312*|MEN1_ENST00000312049.6_Nonsense_Mutation_p.Y312*|MEN1_ENST00000377316.2_Nonsense_Mutation_p.Y312*|MEN1_ENST00000315422.4_Nonsense_Mutation_p.Y312*|MEN1_ENST00000377321.1_Nonsense_Mutation_p.Y277*|MEN1_ENST00000394376.1_Nonsense_Mutation_p.Y317*|MEN1_ENST00000478548.1_5'UTR|MEN1_ENST00000377313.1_Nonsense_Mutation_p.Y317*|MEN1_ENST00000443283.1_Nonsense_Mutation_p.Y317*	NM_130803.2	NP_570715	O00255	MEN1_HUMAN	multiple endocrine neoplasia I	317	Interaction with FANCD2.				brain development (GO:0007420)|cell cycle arrest (GO:0007050)|cellular response to DNA damage stimulus (GO:0006974)|chromatin remodeling (GO:0006338)|DNA repair (GO:0006281)|embryonic skeletal system morphogenesis (GO:0048704)|gene expression (GO:0010467)|hemopoiesis (GO:0030097)|histone lysine methylation (GO:0034968)|leukocyte homeostasis (GO:0001776)|MAPK cascade (GO:0000165)|maternal process involved in female pregnancy (GO:0060135)|negative regulation of cell cycle (GO:0045786)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of JNK cascade (GO:0046329)|negative regulation of organ growth (GO:0046621)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of telomerase activity (GO:0051974)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|osteoblast development (GO:0002076)|osteoblast fate commitment (GO:0002051)|palate development (GO:0060021)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell division (GO:0051781)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of histone methylation (GO:0031062)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of protein binding (GO:0032092)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|regulation of activin receptor signaling pathway (GO:0032925)|response to gamma radiation (GO:0010332)|response to UV (GO:0009411)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	chromatin (GO:0000785)|cleavage furrow (GO:0032154)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|histone methyltransferase complex (GO:0035097)|nuclear matrix (GO:0016363)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)	chromatin binding (GO:0003682)|double-stranded DNA binding (GO:0003690)|four-way junction DNA binding (GO:0000400)|protein binding, bridging (GO:0030674)|protein N-terminus binding (GO:0047485)|R-SMAD binding (GO:0070412)|sequence-specific DNA binding (GO:0043565)|transcription regulatory region DNA binding (GO:0044212)|Y-form DNA binding (GO:0000403)			NS(7)|adrenal_gland(5)|breast(2)|central_nervous_system(5)|endometrium(1)|gastrointestinal_tract_(site_indeterminate)(15)|large_intestine(2)|lung(21)|ovary(1)|pancreas(64)|parathyroid(181)|pituitary(7)|prostate(4)|retroperitoneum(1)|skin(1)|small_intestine(13)|soft_tissue(4)|stomach(1)|thymus(2)	337						CATCCCGATAGTAGGTCTTGG	0.627			"""D, Mis, N, F, S"""		"""parathyroid tumors, Pancreatic neuroendocrine tumors"""	"""parathyroid adenoma, pituitary adenoma, pancreatic islet cell, carcinoid"""			Multiple Endocrine Neoplasia, type 1;Hyperparathyroidism, Familial Isolated		OREG0004014	type=REGULATORY REGION|Gene=MEN1|Dataset=Stanford ENCODE Dataset|EvidenceSubtype=Transient transfection luciferase assay																									p.Y317X	Esophageal Squamous(1;83 158 15500 18603 18803 29295)	.	yes	Rec	yes	Multiple Endocrine Neoplasia Type 1	11	11q13	4221	multiple endocrine neoplasia type 1 gene		E	.	MEN1-3017	0			c.C951G	GRCh37	CM970934|CM981270	MEN1	M		.						250.0	223.0	232.0					11																	64573817		2201	4297	6498	SO:0001587	stop_gained	4221	exon7	Familial Cancer Database	MEN1, Wermer disease;FIHP, FIHPT, HRPT1, Familial Isolated Primary Hyperparathyroidism	CCGATAGTAGGTC	U93236	CCDS8083.1, CCDS31600.1	11q13	2014-09-17			ENSG00000133895	ENSG00000133895			7010	protein-coding gene	gene with protein product	"""menin"""	613733					Standard	NM_130799		Approved		uc001obn.3	O00255	OTTHUMG00000045366	ENST00000337652.1:c.951C>G	11.37:g.64573817G>C	ENSP00000337088:p.Tyr317*	Somatic	340	1	1077	WXS	Illumina GAIIx	Phase_I	272	230	NM_130800	0	0	0	4	4	A5HBC6|A5HBC7|A5HBC8|A5HBC9|A5HBD0|A5HBD1|A5HBD2|O00632|Q9BUF0|Q9BUK2	Nonsense_Mutation	SNP	ENST00000337652.1	37	CCDS8083.1	.	.	.	.	.	.	.	.	.	.	G	36	5.663527	0.96745	.	.	ENSG00000133895	ENST00000377316;ENST00000377321;ENST00000377326;ENST00000312049;ENST00000315422;ENST00000337652;ENST00000394376;ENST00000394374;ENST00000443283;ENST00000377313;ENST00000440873	.	.	.	3.86	3.86	0.44501	.	0.263609	0.31809	U	0.007025	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-7.5213	13.7318	0.62792	0.0:0.0:1.0:0.0	.	.	.	.	X	312;277;312;312;312;317;317;317;317;317;312	.	ENSP00000308975:Y312X	Y	-	3	2	MEN1	64330393	1.000000	0.71417	1.000000	0.80357	0.848000	0.48234	5.489000	0.66875	1.891000	0.54761	0.400000	0.26472	TAC	.		0.627	MEN1-201	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000143881.1		
GAL3ST3	89792	hgsc.bcm.edu	37	11	65810209	65810209	+	Silent	SNP	C	C	T	rs61895584	byFrequency	TCGA-OR-A5KW-01A-11D-A29I-10	TCGA-OR-A5KW-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	67dfc56a-abc7-40c7-a901-6512ec38d5f5	804ec9eb-9f16-4ab9-b2dd-2abb72a53348	g.chr11:65810209C>T	ENST00000312006.4	-	3	1346	c.1065G>A	c.(1063-1065)ccG>ccA	p.P355P	GAL3ST3_ENST00000527878.1_Silent_p.P355P	NM_033036.2	NP_149025.1	Q96A11	G3ST3_HUMAN	galactose-3-O-sulfotransferase 3	355					monosaccharide metabolic process (GO:0005996)|oligosaccharide metabolic process (GO:0009311)|poly-N-acetyllactosamine metabolic process (GO:0030309)|proteoglycan biosynthetic process (GO:0030166)|sulfur compound metabolic process (GO:0006790)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	3'-phosphoadenosine 5'-phosphosulfate binding (GO:0050656)|carbohydrate binding (GO:0030246)|galactose 3-O-sulfotransferase activity (GO:0050694)|galactosylceramide sulfotransferase activity (GO:0001733)|proteoglycan sulfotransferase activity (GO:0050698)			kidney(1)|lung(9)|ovary(2)|skin(2)	14						TGGGCTGCCACGGCTGCAGCT	0.741													C|||	3763	0.751398	0.5408	0.8746	5008	,	,		7225	0.7649		0.8549	False		,,,				2504	0.8282				p.P355P		.											.	GAL3ST3-91	0			c.G1065A						.	C		1752,666		619,514,76	3.0	2.0	2.0		1065	-9.2	0.7	11	dbSNP_129	2	4565,363		2119,327,18	no	coding-synonymous	GAL3ST3	NM_033036.2		2738,841,94	TT,TC,CC		7.3661,27.5434,14.0076		355/432	65810209	6317,1029	1209	2464	3673	SO:0001819	synonymous_variant	89792	exon3			CTGCCACGGCTGC	AY026481	CCDS8128.1	11q13.1	2014-08-12			ENSG00000175229	ENSG00000175229		"""Sulfotransferases, membrane-bound"""	24144	protein-coding gene	gene with protein product		608234				11323440, 11356829	Standard	NM_033036		Approved	GAL3ST2	uc001ogw.3	Q96A11	OTTHUMG00000166667	ENST00000312006.4:c.1065G>A	11.37:g.65810209C>T		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	4	4	NM_033036	0	0	0	0	0	Q14D05	Silent	SNP	ENST00000312006.4	37	CCDS8128.1																																																																																			C|0.233;T|0.767		0.741	GAL3ST3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391052.1	NM_033036	
TMPRSS12	283471	bcgsc.ca	37	12	51237684	51237684	+	Missense_Mutation	SNP	G	G	A	rs375889456		TCGA-OR-A5KW-01A-11D-A29I-10	TCGA-OR-A5KW-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	67dfc56a-abc7-40c7-a901-6512ec38d5f5	804ec9eb-9f16-4ab9-b2dd-2abb72a53348	g.chr12:51237684G>A	ENST00000398458.3	+	2	279	c.247G>A	c.(247-249)Gaa>Aaa	p.E83K	RN7SL519P_ENST00000497925.2_RNA|TMPRSS12_ENST00000551456.1_Missense_Mutation_p.E83K	NM_182559.2	NP_872365	Q86WS5	TMPSC_HUMAN	transmembrane (C-terminal) protease, serine 12	83	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.					integral component of membrane (GO:0016021)	serine-type endopeptidase activity (GO:0004252)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(7)|ovary(1)|skin(1)|urinary_tract(1)	18						AGGGGGCACCGAAGCACAAGC	0.473																																					p.E83K		.											.	.	0			c.G247A						.	G	LYS/GLU	0,3994		0,0,1997	45.0	46.0	46.0		247	3.8	0.0	12		46	1,8323		0,1,4161	no	missense	TMPRSS12	NM_182559.2	56	0,1,6158	AA,AG,GG		0.012,0.0,0.0081	possibly-damaging	83/349	51237684	1,12317	1997	4162	6159	SO:0001583	missense	283471	exon2			GGCACCGAAGCAC	BC048112	CCDS44881.1	12q13.12	2014-08-12	2010-04-21		ENSG00000186452	ENSG00000186452		"""Serine peptidases / Transmembrane"""	28779	protein-coding gene	gene with protein product			"""transmembrane protease, serine 12"""				Standard	NM_182559		Approved	MGC57341, CT151	uc001rwx.4	Q86WS5	OTTHUMG00000169483	ENST00000398458.3:c.247G>A	12.37:g.51237684G>A	ENSP00000381476:p.Glu83Lys	Somatic	93	1		WXS	Illumina GAIIx	Phase_I	134	5	NM_182559	0	0	0	0	0	B9ZVX2	Missense_Mutation	SNP	ENST00000398458.3	37	CCDS44881.1	.	.	.	.	.	.	.	.	.	.	G	15.23	2.772300	0.49680	0.0	1.2E-4	ENSG00000186452	ENST00000551456;ENST00000398458	D;D	0.88975	-2.45;-2.45	5.7	3.82	0.43975	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	0.755543	0.12052	N	0.504025	T	0.79890	0.4524	L	0.38692	1.165	0.09310	N	1	P;P	0.44429	0.589;0.835	B;B	0.35413	0.105;0.202	T	0.67027	-0.5774	10	0.20046	T	0.44	-6.0964	8.0235	0.30423	0.0883:0.1658:0.7459:0.0	.	83;83	F8WBX2;Q86WS5	.;TMPSC_HUMAN	K	83	ENSP00000447259:E83K;ENSP00000381476:E83K	ENSP00000381476:E83K	E	+	1	0	TMPRSS12	49523951	0.002000	0.14202	0.006000	0.13384	0.277000	0.26821	1.038000	0.30254	1.355000	0.45865	0.563000	0.77884	GAA	.		0.473	TMPRSS12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404289.1	NM_182559	
BTBD11	121551	hgsc.bcm.edu	37	12	107713511	107713511	+	Missense_Mutation	SNP	G	G	C	rs961498	byFrequency	TCGA-OR-A5KW-01A-11D-A29I-10	TCGA-OR-A5KW-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	67dfc56a-abc7-40c7-a901-6512ec38d5f5	804ec9eb-9f16-4ab9-b2dd-2abb72a53348	g.chr12:107713511G>C	ENST00000280758.5	+	1	1322	c.794G>C	c.(793-795)gGg>gCg	p.G265A	BTBD11_ENST00000420571.2_Missense_Mutation_p.G265A|BTBD11_ENST00000490090.2_Missense_Mutation_p.G265A	NM_001018072.1	NP_001018082.1	A6QL63	BTBDB_HUMAN	BTB (POZ) domain containing 11	265						integral component of membrane (GO:0016021)				NS(1)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(13)|lung(18)|ovary(1)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	53						AGTGGCCCTGGGTCAGGCTCG	0.751													G|||	1975	0.394369	0.2194	0.4539	5008	,	,		9398	0.4127		0.492	False		,,,				2504	0.4693				p.G265A		.											.	BTBD11-93	0			c.G794C						.	G	ALA/GLY	786,2720		135,516,1102	5.0	3.0	3.0		794	4.2	0.1	12	dbSNP_86	3	2882,3822		730,1422,1200	no	missense	BTBD11	NM_001018072.1	60	865,1938,2302	CC,CG,GG		42.9893,22.4187,35.9256	benign	265/1105	107713511	3668,6542	1753	3352	5105	SO:0001583	missense	121551	exon1			GCCCTGGGTCAGG	AK091276	CCDS31893.1, CCDS41827.1	12q24.11	2013-10-02			ENSG00000151136	ENSG00000151136		"""BTB/POZ domain containing"", ""Ankyrin repeat domain containing"""	23844	protein-coding gene	gene with protein product							Standard	XM_005268645		Approved	FLJ33957, ABTB2B	uc001tmk.1	A6QL63	OTTHUMG00000150413	ENST00000280758.5:c.794G>C	12.37:g.107713511G>C	ENSP00000280758:p.Gly265Ala	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	4	4	NM_001018072	0	0	0	0	0	A4FU41|B3KXG3|C9J019|C9JK80|E9PHS4|Q3ZTQ4|Q52M89|Q6ZV99|Q8N245	Missense_Mutation	SNP	ENST00000280758.5	37	CCDS31893.1	899	0.4116300366300366	119	0.241869918699187	158	0.43646408839779005	241	0.42132867132867136	381	0.5026385224274407	G	11.75	1.731449	0.30684	0.224187	0.429893	ENSG00000151136	ENST00000280758;ENST00000420571;ENST00000490090	T;T;T	0.33865	1.39;1.48;1.43	4.15	4.15	0.48705	Histone-fold (1);	0.272599	0.26478	N	0.024144	T	0.00012	0.0000	L	0.52905	1.665	0.09310	P	1.0	B;B;B	0.28971	0.229;0.088;0.143	B;B;B	0.29176	0.099;0.017;0.061	T	0.47898	-0.9081	9	0.54805	T	0.06	.	13.8733	0.63634	0.0:0.0:1.0:0.0	rs961498	265;265;265	A6QL63-2;A6QL63;A6QL63-3	.;BTBDB_HUMAN;.	A	265	ENSP00000280758:G265A;ENSP00000413889:G265A;ENSP00000447319:G265A	ENSP00000280758:G265A	G	+	2	0	BTBD11	106237641	0.973000	0.33851	0.080000	0.20451	0.808000	0.45660	2.685000	0.46959	2.308000	0.77769	0.549000	0.68633	GGG	G|0.588;C|0.412		0.751	BTBD11-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000318003.1	NM_152322	
FAM109A	144717	hgsc.bcm.edu	37	12	111800827	111800835	+	In_Frame_Del	DEL	GCCACCCCC	GCCACCCCC	-	rs3840795|rs139032867|rs199734407|rs200911236	byFrequency	TCGA-OR-A5KW-01A-11D-A29I-10	TCGA-OR-A5KW-10A-01D-A29L-10	GCCACCCCC	GCCACCCCC	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	67dfc56a-abc7-40c7-a901-6512ec38d5f5	804ec9eb-9f16-4ab9-b2dd-2abb72a53348	g.chr12:111800827_111800835delGCCACCCCC	ENST00000547838.2	-	2	494_502	c.397_405delGGGGGTGGC	c.(397-405)gggggtggcdel	p.GGG133del	FAM109A_ENST00000392658.5_In_Frame_Del_p.GGG133del|FAM109A_ENST00000548163.1_In_Frame_Del_p.GGG133del|FAM109A_ENST00000450786.2_In_Frame_Del_p.113_116AGVA>A|FAM109A_ENST00000361483.3_In_Frame_Del_p.GGG146del			Q8N4B1	SESQ1_HUMAN	family with sequence similarity 109, member A	133					endosome organization (GO:0007032)|receptor recycling (GO:0001881)|retrograde transport, endosome to Golgi (GO:0042147)	clathrin-coated vesicle (GO:0030136)|early endosome (GO:0005769)|recycling endosome (GO:0055037)|trans-Golgi network (GO:0005802)	protein homodimerization activity (GO:0042803)	p.G133M(1)|p.G146_G148delGGG(1)|p.G133_G135delGGG(1)		breast(1)|endometrium(1)|lung(1)|ovary(1)	4						gcagggCCATGCCACCCCCGCCACGTACA	0.732														1710	0.341454	0.233	0.3732	5008	,	,		9526	0.6518		0.2078	False		,,,				2504	0.2832				p.146_148del		.											.	FAM109A-90	3	Deletion - In frame(2)|Substitution - Missense(1)	breast(2)|ovary(1)	c.436_444del						.		,,	674,3090		134,406,1342				http://www.ncbi.nlm.nih.gov/sites/varvu?gene	,,	-4.5	0.0		dbSNP_107	6	1126,6432		186,754,2839	no	coding,coding,coding	FAM109A	NM_144671.4,NM_001177997.1,NM_001177996.1	,,	320,1160,4181	A1A1,A1R,RR		14.8981,17.9065,15.8983	,,	,,		1800,9522				SO:0001651	inframe_deletion	144717	exon4			GGCCATGCCACCC	BC034809	CCDS9152.1, CCDS53833.1	12q24.12	2013-01-10			ENSG00000198324	ENSG00000198324		"""Pleckstrin homology (PH) domain containing"""	26509	protein-coding gene	gene with protein product		614239				12477932	Standard	NM_144671		Approved	FLJ32356	uc009zvu.3	Q8N4B1	OTTHUMG00000169547	ENST00000547838.2:c.397_405delGGGGGTGGC	12.37:g.111800827_111800835delGCCACCCCC	ENSP00000447353:p.Gly133_Gly135del	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	16	14	NM_001177996	0	0	0	0	0	J3KP50|Q6PJL9|Q96MH8	In_Frame_Del	DEL	ENST00000547838.2	37	CCDS9152.1																																																																																			.		0.732	FAM109A-007	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404768.2	NM_144671	
SETDB2	83852	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	13	50050649	50050649	+	Missense_Mutation	SNP	A	A	G			TCGA-OR-A5KW-01A-11D-A29I-10	TCGA-OR-A5KW-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	67dfc56a-abc7-40c7-a901-6512ec38d5f5	804ec9eb-9f16-4ab9-b2dd-2abb72a53348	g.chr13:50050649A>G	ENST00000317257.8	+	7	1204	c.379A>G	c.(379-381)Aaa>Gaa	p.K127E	SETDB2_ENST00000258672.5_Missense_Mutation_p.K115E|SETDB2_ENST00000354234.4_Missense_Mutation_p.K115E	NM_031915.2	NP_114121.2	Q96T68	SETB2_HUMAN	SET domain, bifurcated 2	127					chromosome segregation (GO:0007059)|heart looping (GO:0001947)|histone H3-K9 methylation (GO:0051567)|left/right axis specification (GO:0070986)|mitotic nuclear division (GO:0007067)|negative regulation of transcription, DNA-templated (GO:0045892)	chromosome (GO:0005694)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone methyltransferase activity (H3-K9 specific) (GO:0046974)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(3)|lung(2)|ovary(1)|upper_aerodigestive_tract(1)	15		Lung NSC(96;0.000408)|Breast(56;0.00131)|Prostate(109;0.00446)|Hepatocellular(98;0.0556)|Glioma(44;0.236)	KIRC - Kidney renal clear cell carcinoma(9;0.206)	GBM - Glioblastoma multiforme(99;3.1e-09)		TCTTGAAGATAAAGTTGTAGA	0.294																																					p.K127E		.											.	SETDB2-91	0			c.A379G						.						67.0	75.0	73.0					13																	50050649		2203	4300	6503	SO:0001583	missense	83852	exon7			GAAGATAAAGTTG	AF334407	CCDS9417.1, CCDS53868.1	13q14	2011-07-01	2003-05-06	2003-05-09	ENSG00000136169	ENSG00000136169		"""Chromatin-modifying enzymes / K-methyltransferases"""	20263	protein-coding gene	gene with protein product		607865	"""chromosome 13 open reading frame 4"""	C13orf4		11306461	Standard	NM_031915		Approved	CLLD8, CLLL8, KMT1F	uc001vda.3	Q96T68	OTTHUMG00000016918	ENST00000317257.8:c.379A>G	13.37:g.50050649A>G	ENSP00000326477:p.Lys127Glu	Somatic	84	1		WXS	Illumina GAIIx	Phase_I	120	42	NM_031915	0	0	7	8	1	Q5TC65|Q5TC66|Q5W0A7|Q659A7|Q86UD6|Q96AI6	Missense_Mutation	SNP	ENST00000317257.8	37	CCDS9417.1	.	.	.	.	.	.	.	.	.	.	A	0.510	-0.866792	0.02590	.	.	ENSG00000136169	ENST00000354234;ENST00000317257;ENST00000258672	D;D;T	0.86030	-2.05;-2.06;1.25	5.96	1.52	0.23074	.	0.868203	0.10351	N	0.685133	T	0.79064	0.4383	L	0.45581	1.43	0.27076	N	0.963193	B;B;B	0.14805	0.011;0.002;0.001	B;B;B	0.13407	0.009;0.006;0.003	T	0.62296	-0.6884	10	0.27082	T	0.32	.	9.1669	0.37056	0.6326:0.0:0.3674:0.0	.	127;115;127	Q96T68-3;Q96T68-2;Q96T68	.;.;SETB2_HUMAN	E	115;127;115	ENSP00000346175:K115E;ENSP00000326477:K127E;ENSP00000258672:K115E	ENSP00000258672:K115E	K	+	1	0	SETDB2	48948650	0.897000	0.30589	0.500000	0.27589	0.133000	0.20885	0.227000	0.17795	-0.036000	0.13669	-0.256000	0.11100	AAA	.		0.294	SETDB2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000044925.1	NM_031915	
FOXG1	2290	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	14	29237769	29237769	+	Silent	SNP	G	G	A			TCGA-OR-A5KW-01A-11D-A29I-10	TCGA-OR-A5KW-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	67dfc56a-abc7-40c7-a901-6512ec38d5f5	804ec9eb-9f16-4ab9-b2dd-2abb72a53348	g.chr14:29237769G>A	ENST00000313071.4	+	1	1483	c.1284G>A	c.(1282-1284)tcG>tcA	p.S428S	FOXG1_ENST00000382535.3_Silent_p.S428S	NM_005249.4	NP_005240.3	P55316	FOXG1_HUMAN	forkhead box G1	428					aging (GO:0007568)|axon midline choice point recognition (GO:0016199)|brain development (GO:0007420)|dorsal/ventral pattern formation (GO:0009953)|inner ear morphogenesis (GO:0042472)|negative regulation of neuron differentiation (GO:0045665)|negative regulation of transcription, DNA-templated (GO:0045892)|neuron fate determination (GO:0048664)|positive regulation of cell cycle (GO:0045787)|positive regulation of neuroblast proliferation (GO:0002052)|pyramidal neuron migration (GO:0021852)|regulation of mitotic cell cycle (GO:0007346)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.S428S(1)		breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(9)|lung(23)|ovary(2)|pancreas(1)|prostate(1)|skin(1)|urinary_tract(2)	43			LUAD - Lung adenocarcinoma(48;0.011)|Lung(238;0.0575)	GBM - Glioblastoma multiforme(265;0.00413)		CAATGACTTCGCAGAGCAGCA	0.642																																					p.S428S		.											.	FOXG1-660	1	Substitution - coding silent(1)	large_intestine(1)	c.G1284A						.						57.0	52.0	53.0					14																	29237769		2203	4300	6503	SO:0001819	synonymous_variant	2290	exon1			GACTTCGCAGAGC		CCDS9636.1	14q11-q13	2007-10-05	2007-05-16	2007-05-16	ENSG00000176165	ENSG00000176165		"""Forkhead boxes"""	3811	protein-coding gene	gene with protein product		164874	"""forkhead box G1B"", ""forkhead box G1C"", ""forkhead box G1A"""	FKHL2, FOXG1B, FKHL4, FKH2, FKHL1, FOXG1C, FKHL3, FOXG1A		7959731, 17260156	Standard	NM_005249		Approved	HFK2, QIN, BF1, HFK1, HFK3, HBF-3	uc001wqe.4	P55316	OTTHUMG00000140187	ENST00000313071.4:c.1284G>A	14.37:g.29237769G>A		Somatic	94	0		WXS	Illumina GAIIx	Phase_I	116	15	NM_005249	0	0	0	0	0	A6NFY2|P55315|Q14488|Q86XT7	Silent	SNP	ENST00000313071.4	37	CCDS9636.1																																																																																			.		0.642	FOXG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276559.3		
CCDC85C	317762	hgsc.bcm.edu	37	14	100069576	100069576	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5KW-01A-11D-A29I-10	TCGA-OR-A5KW-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	67dfc56a-abc7-40c7-a901-6512ec38d5f5	804ec9eb-9f16-4ab9-b2dd-2abb72a53348	g.chr14:100069576C>T	ENST00000380243.4	-	1	787	c.721G>A	c.(721-723)Gga>Aga	p.G241R	RP11-543C4.1_ENST00000502101.2_lincRNA	NM_001144995.1	NP_001138467.1	A6NKD9	CC85C_HUMAN	coiled-coil domain containing 85C	241					cerebral cortex development (GO:0021987)	apical junction complex (GO:0043296)|tight junction (GO:0005923)				endometrium(1)|skin(1)	2						CGTGTGGCTCCTGCCTTGCCG	0.751																																					p.G241R		.											.	.	0			c.G721A						.						5.0	8.0	7.0					14																	100069576		656	1546	2202	SO:0001583	missense	317762	exon1			TGGCTCCTGCCTT		CCDS45161.1	14q32.31	2009-02-18				ENSG00000205476			35459	protein-coding gene	gene with protein product							Standard	NM_001144995		Approved		uc010avr.3	A6NKD9		ENST00000380243.4:c.721G>A	14.37:g.100069576C>T	ENSP00000369592:p.Gly241Arg	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	12	12	NM_001144995	0	0	0	1	1		Missense_Mutation	SNP	ENST00000380243.4	37	CCDS45161.1	.	.	.	.	.	.	.	.	.	.	C	14.12	2.440667	0.43326	.	.	ENSG00000205476	ENST00000380243	.	.	.	4.46	2.57	0.30868	.	0.511724	0.18977	U	0.125996	T	0.42944	0.1225	L	0.58101	1.795	0.80722	D	1	P	0.40050	0.7	B	0.38327	0.271	T	0.18967	-1.0320	9	0.15952	T	0.53	1.1553	8.0448	0.30542	0.1596:0.7551:0.0:0.0853	.	241	A6NKD9	CC85C_HUMAN	R	241	.	ENSP00000369592:G241R	G	-	1	0	CCDC85C	99139329	0.476000	0.25901	0.049000	0.19019	0.090000	0.18270	4.303000	0.59098	0.845000	0.35118	0.454000	0.30748	GGA	.		0.751	CCDC85C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000413802.1	NM_001144995	
JAG2	3714	broad.mit.edu;bcgsc.ca;mdanderson.org	37	14	105622156	105622156	+	Missense_Mutation	SNP	C	C	A			TCGA-OR-A5KW-01A-11D-A29I-10	TCGA-OR-A5KW-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	67dfc56a-abc7-40c7-a901-6512ec38d5f5	804ec9eb-9f16-4ab9-b2dd-2abb72a53348	g.chr14:105622156C>A	ENST00000331782.3	-	4	1049	c.646G>T	c.(646-648)Gac>Tac	p.D216Y	RP11-44N21.4_ENST00000548203.1_RNA|JAG2_ENST00000347004.2_Missense_Mutation_p.D216Y	NM_002226.4	NP_002217.3	Q9Y219	JAG2_HUMAN	jagged 2	216	DSL. {ECO:0000255|PROSITE- ProRule:PRU00377}.				auditory receptor cell fate commitment (GO:0009912)|cell cycle (GO:0007049)|cell differentiation (GO:0030154)|epithelial cell apoptotic process involved in palatal shelf morphogenesis (GO:1990134)|gamma-delta T cell differentiation (GO:0042492)|in utero embryonic development (GO:0001701)|morphogenesis of embryonic epithelium (GO:0016331)|Notch receptor processing (GO:0007220)|Notch signaling pathway (GO:0007219)|odontogenesis of dentin-containing tooth (GO:0042475)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of cell proliferation (GO:0042127)|respiratory system process (GO:0003016)|skeletal system development (GO:0001501)|spermatogenesis (GO:0007283)|T cell differentiation (GO:0030217)|thymic T cell selection (GO:0045061)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|growth factor activity (GO:0008083)|Notch binding (GO:0005112)			breast(2)|endometrium(2)|kidney(3)|large_intestine(1)|lung(7)|prostate(2)|skin(5)	22		all_cancers(154;0.0336)|all_epithelial(191;0.0729)|Melanoma(154;0.155)	OV - Ovarian serous cystadenocarcinoma(23;0.00989)|all cancers(16;0.0114)|Epithelial(46;0.0272)	Epithelial(152;0.047)|OV - Ovarian serous cystadenocarcinoma(161;0.148)|all cancers(159;0.208)		CCGAAAAAGTCGTTGCGGGGC	0.637																																					p.D216Y		.											.	JAG2-846	0			c.G646T						.						85.0	62.0	70.0					14																	105622156		2196	4297	6493	SO:0001583	missense	3714	exon4			AAAAGTCGTTGCG	AF020201	CCDS9998.1, CCDS9999.1	14q32	2008-08-01			ENSG00000184916	ENSG00000184916			6189	protein-coding gene	gene with protein product		602570				9315665, 10662552	Standard	NM_002226		Approved		uc001yqg.4	Q9Y219	OTTHUMG00000140172	ENST00000331782.3:c.646G>T	14.37:g.105622156C>A	ENSP00000328169:p.Asp216Tyr	Somatic	123	1		WXS	Illumina GAIIx	Phase_I	432	123	NM_145159	0	0	3	3	0	Q9UE17|Q9UE99|Q9UNK8|Q9Y6P9|Q9Y6Q0	Missense_Mutation	SNP	ENST00000331782.3	37	CCDS9998.1	.	.	.	.	.	.	.	.	.	.	C	20.5	4.005511	0.74932	.	.	ENSG00000184916	ENST00000331782;ENST00000347004	D;D	0.97303	-4.33;-4.33	4.18	4.18	0.49190	Delta/Serrate/lag-2 (DSL) protein (3);	0.000000	0.85682	U	0.000000	D	0.98871	0.9618	H	0.95151	3.63	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.99675	1.0997	10	0.87932	D	0	.	15.476	0.75481	0.0:1.0:0.0:0.0	.	216;216	Q9Y219-2;Q9Y219	.;JAG2_HUMAN	Y	216	ENSP00000328169:D216Y;ENSP00000328566:D216Y	ENSP00000328169:D216Y	D	-	1	0	JAG2	104693201	1.000000	0.71417	0.995000	0.50966	0.537000	0.34900	5.872000	0.69636	1.864000	0.54056	0.563000	0.77884	GAC	.		0.637	JAG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276506.2		
LACTB	114294	hgsc.bcm.edu	37	15	63414083	63414083	+	Missense_Mutation	SNP	A	A	C	rs34317102	byFrequency	TCGA-OR-A5KW-01A-11D-A29I-10	TCGA-OR-A5KW-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	67dfc56a-abc7-40c7-a901-6512ec38d5f5	804ec9eb-9f16-4ab9-b2dd-2abb72a53348	g.chr15:63414083A>C	ENST00000261893.4	+	1	85	c.13A>C	c.(13-15)Atg>Ctg	p.M5L	LACTB_ENST00000413507.2_Missense_Mutation_p.M5L	NM_032857.3	NP_116246.2	P83111	LACTB_HUMAN	lactamase, beta	5				M -> L (in Ref. 1 and 2). {ECO:0000305}.		cytoplasm (GO:0005737)|mitochondrion (GO:0005739)	hydrolase activity (GO:0016787)			NS(1)|breast(1)|kidney(1)|large_intestine(3)|lung(3)|prostate(1)|skin(1)|stomach(1)	12						GTACCGGCTCATGTCAGCAGT	0.751													C|||	3981	0.794928	0.6725	0.8256	5008	,	,		8367	0.997		0.7316	False		,,,				2504	0.7955				p.M5L	Melanoma(85;443 1381 6215 27308 35583)	.											.	LACTB-90	0			c.A13C						.	C	LEU/MET,LEU/MET	1936,668		733,470,99	4.0	4.0	4.0		13,13	3.1	1.0	15	dbSNP_126	4	4375,1183		1737,901,141	yes	missense,missense	LACTB	NM_032857.3,NM_171846.2	15,15	2470,1371,240	CC,CA,AA		21.2846,25.6528,22.6783	benign,benign	5/548,5/374	63414083	6311,1851	1302	2779	4081	SO:0001583	missense	114294	exon1			CGGCTCATGTCAG	AK027808	CCDS10182.1, CCDS45275.1	15q22.1	2012-11-14	2001-12-12	2001-12-14	ENSG00000103642	ENSG00000103642		"""Mitochondrial ribosomal proteins / large subunits"""	16468	protein-coding gene	gene with protein product		608440	"""mitochondrial ribosomal protein L56"""	MRPL56		11707067	Standard	NM_032857		Approved	FLJ14902	uc002alw.3	P83111	OTTHUMG00000132807	ENST00000261893.4:c.13A>C	15.37:g.63414083A>C	ENSP00000261893:p.Met5Leu	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	9	9	NM_171846	0	0	0	4	4	P83096	Missense_Mutation	SNP	ENST00000261893.4	37	CCDS10182.1	1713	0.7843406593406593	304	0.6178861788617886	287	0.7928176795580111	568	0.993006993006993	554	0.7308707124010554	C	0.674	-0.800779	0.02841	0.743472	0.787154	ENSG00000103642	ENST00000261893;ENST00000413507	T	0.33216	1.42	3.1	3.1	0.35709	.	0.592824	0.14749	N	0.300689	T	0.00012	0.0000	N	0.02539	-0.55	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.37842	-0.9688	9	0.02654	T	1	0.0321	7.626	0.28212	0.2541:0.7459:0.0:0.0	rs34317102	5	P83111	LACTB_HUMAN	L	5	ENSP00000261893:M5L	ENSP00000261893:M5L	M	+	1	0	LACTB	61201136	0.994000	0.37717	0.956000	0.39512	0.117000	0.20001	0.346000	0.19997	0.640000	0.30582	-0.677000	0.03784	ATG	A|0.226;C|0.774		0.751	LACTB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256224.1	NM_032857	
DAPK2	23604	broad.mit.edu	37	15	64275869	64275869	+	Missense_Mutation	SNP	G	G	T			TCGA-OR-A5KW-01A-11D-A29I-10	TCGA-OR-A5KW-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	67dfc56a-abc7-40c7-a901-6512ec38d5f5	804ec9eb-9f16-4ab9-b2dd-2abb72a53348	g.chr15:64275869G>T	ENST00000457488.1	-	3	207	c.177C>A	c.(175-177)agC>agA	p.S59R	DAPK2_ENST00000558069.1_Missense_Mutation_p.S59R|DAPK2_ENST00000558482.1_5'UTR|DAPK2_ENST00000261891.3_Missense_Mutation_p.S59R	NM_014326.3	NP_055141.2	Q9UIK4	DAPK2_HUMAN	death-associated protein kinase 2	59	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				anoikis (GO:0043276)|apoptotic process (GO:0006915)|intracellular signal transduction (GO:0035556)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of apoptotic process (GO:0042981)|regulation of autophagy (GO:0010506)|regulation of intrinsic apoptotic signaling pathway (GO:2001242)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)	ATP binding (GO:0005524)|calmodulin binding (GO:0005516)|calmodulin-dependent protein kinase activity (GO:0004683)|identical protein binding (GO:0042802)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(2)|skin(1)|stomach(1)	11				LUAD - Lung adenocarcinoma(2;0.215)		GGCTCGCCCGGCTCTGCCGCT	0.627																																					p.S59R		.											.	DAPK2-333	0			c.C177A						.						35.0	34.0	34.0					15																	64275869		2203	4300	6503	SO:0001583	missense	23604	exon3			CGCCCGGCTCTGC	AB018001	CCDS10188.1	15q22.1	2008-07-18			ENSG00000035664	ENSG00000035664			2675	protein-coding gene	gene with protein product						10376525	Standard	XM_005254265		Approved	DRP-1, MGC119312	uc002amr.3	Q9UIK4	OTTHUMG00000132947	ENST00000457488.1:c.177C>A	15.37:g.64275869G>T	ENSP00000408277:p.Ser59Arg	Somatic	47	1		WXS	Illumina GAIIx	Phase_I	167	11	NM_014326	0	0	7	7	0	E9JGM7|O75892|Q24JS1	Missense_Mutation	SNP	ENST00000457488.1	37	CCDS10188.1	.	.	.	.	.	.	.	.	.	.	G	9.143	1.014356	0.19277	.	.	ENSG00000035664	ENST00000261891;ENST00000457488	T;T	0.64618	-0.11;-0.11	5.35	3.47	0.39725	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.276343	0.32416	N	0.006131	T	0.38931	0.1059	N	0.10664	0.02	0.58432	D	0.999995	P;B	0.34699	0.464;0.053	B;B	0.35859	0.212;0.021	T	0.17992	-1.0351	10	0.37606	T	0.19	.	7.8339	0.29360	0.144:0.0:0.7236:0.1324	.	59;59	E9JGM7;Q9UIK4	.;DAPK2_HUMAN	R	59	ENSP00000261891:S59R;ENSP00000408277:S59R	ENSP00000261891:S59R	S	-	3	2	DAPK2	62062922	0.118000	0.22208	0.937000	0.37676	0.567000	0.35839	0.372000	0.20467	0.635000	0.30488	0.555000	0.69702	AGC	.		0.627	DAPK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256479.1	NM_014326	
LCTL	197021	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	15	66850065	66850065	+	Missense_Mutation	SNP	T	T	C			TCGA-OR-A5KW-01A-11D-A29I-10	TCGA-OR-A5KW-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	67dfc56a-abc7-40c7-a901-6512ec38d5f5	804ec9eb-9f16-4ab9-b2dd-2abb72a53348	g.chr15:66850065T>C	ENST00000341509.5	-	8	1048	c.917A>G	c.(916-918)tAc>tGc	p.Y306C	LCTL_ENST00000537670.1_Missense_Mutation_p.Y133C	NM_207338.2	NP_997221.2	Q6UWM7	LCTL_HUMAN	lactase-like	306					carbohydrate metabolic process (GO:0005975)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	hydrolase activity, hydrolyzing O-glycosyl compounds (GO:0004553)			NS(1)|breast(1)|endometrium(4)|kidney(1)|large_intestine(6)|lung(10)|ovary(2)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	32						CTCACCAATGTAGTCCTTCAT	0.512																																					p.Y306C		.											.	LCTL-92	0			c.A917G						.						78.0	79.0	79.0					15																	66850065		2201	4299	6500	SO:0001583	missense	197021	exon8			CCAATGTAGTCCT	AY358729	CCDS10220.1, CCDS61678.1	15q21.3	2008-02-05			ENSG00000188501	ENSG00000188501			15583	protein-coding gene	gene with protein product	"""klotho gamma"", ""KL lactase phlorizin hydrolase"""					12084582	Standard	NM_207338		Approved	KLPH, FLJ33279, KLG	uc002aqc.3	Q6UWM7	OTTHUMG00000133207	ENST00000341509.5:c.917A>G	15.37:g.66850065T>C	ENSP00000343490:p.Tyr306Cys	Somatic	105	0		WXS	Illumina GAIIx	Phase_I	120	7	NM_207338	0	0	0	0	0	B3KQY0	Missense_Mutation	SNP	ENST00000341509.5	37	CCDS10220.1	.	.	.	.	.	.	.	.	.	.	T	11.46	1.646757	0.29246	.	.	ENSG00000188501	ENST00000537670;ENST00000341509	T;T	0.53640	0.61;1.47	5.44	-3.76	0.04359	Glycoside hydrolase, subgroup, catalytic domain (1);Glycoside hydrolase, superfamily (1);	0.798245	0.12228	N	0.487714	T	0.52141	0.1716	M	0.83118	2.625	0.09310	N	1	D;D	0.54397	0.966;0.957	P;P	0.49829	0.591;0.623	T	0.51284	-0.8725	10	0.39692	T	0.17	-2.7945	8.4287	0.32744	0.115:0.158:0.0:0.7269	.	133;306	B3KQY0;Q6UWM7	.;LCTL_HUMAN	C	133;306	ENSP00000445419:Y133C;ENSP00000343490:Y306C	ENSP00000343490:Y306C	Y	-	2	0	LCTL	64637119	0.003000	0.15002	0.023000	0.16930	0.306000	0.27790	0.674000	0.25218	-0.513000	0.06496	-0.250000	0.11733	TAC	.		0.512	LCTL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256921.2	NM_207338	
ADAMTS7	11173	broad.mit.edu	37	15	79059160	79059160	+	Silent	SNP	T	T	G			TCGA-OR-A5KW-01A-11D-A29I-10	TCGA-OR-A5KW-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	67dfc56a-abc7-40c7-a901-6512ec38d5f5	804ec9eb-9f16-4ab9-b2dd-2abb72a53348	g.chr15:79059160T>G	ENST00000388820.4	-	19	3303	c.3093A>C	c.(3091-3093)tcA>tcC	p.S1031S	ADAMTS7_ENST00000566303.1_5'Flank	NM_014272.3	NP_055087.2	Q9UKP4	ATS7_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 7	1031					cellular response to BMP stimulus (GO:0071773)|cellular response to interleukin-1 (GO:0071347)|cellular response to tumor necrosis factor (GO:0071356)|negative regulation of chondrocyte differentiation (GO:0032331)|proteolysis involved in cellular protein catabolic process (GO:0051603)	cell surface (GO:0009986)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(2)|lung(23)|ovary(1)|prostate(8)|skin(9)	54						ATGAGGCGGGTGAAGGGCGTG	0.652																																					p.S1031S		.											.	ADAMTS7-226	0			c.A3093C						.						15.0	18.0	17.0					15																	79059160		2144	4169	6313	SO:0001819	synonymous_variant	11173	exon19			GGCGGGTGAAGGG	AF140675	CCDS32303.1	15q25.1	2012-05-16	2005-08-19		ENSG00000136378	ENSG00000136378		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	223	protein-coding gene	gene with protein product	"""COMPase"", ""a disintegrin and metalloprotease with thrombospondin motifs-7 preproprotein"""	605009	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 7"""			10464288	Standard	NM_014272		Approved	ADAM-TS7, DKFZp434H204	uc002bej.4	Q9UKP4	OTTHUMG00000172907	ENST00000388820.4:c.3093A>C	15.37:g.79059160T>G		Somatic	17	2		WXS	Illumina GAIIx	Phase_I	89	30	NM_014272	0	0	24	30	6	Q14F51|Q6P7J9	Silent	SNP	ENST00000388820.4	37	CCDS32303.1																																																																																			.		0.652	ADAMTS7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000421331.1	NM_014272	
PLIN1	5346	hgsc.bcm.edu	37	15	90209135	90209135	+	Silent	SNP	G	G	A	rs8179074	byFrequency	TCGA-OR-A5KW-01A-11D-A29I-10	TCGA-OR-A5KW-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	67dfc56a-abc7-40c7-a901-6512ec38d5f5	804ec9eb-9f16-4ab9-b2dd-2abb72a53348	g.chr15:90209135G>A	ENST00000300055.5	-	9	1413	c.1248C>T	c.(1246-1248)ttC>ttT	p.F416F	PLIN1_ENST00000430628.2_Silent_p.F416F	NM_002666.4	NP_002657.3	O60240	PLIN1_HUMAN	perilipin 1	416					lipid metabolic process (GO:0006629)|small molecule metabolic process (GO:0044281)|triglyceride catabolic process (GO:0019433)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|lipid particle (GO:0005811)	lipid binding (GO:0008289)			NS(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(4)|skin(2)	13						CGATGTCCCGGAATTCGCTCT	0.741													G|||	104	0.0207668	0.0015	0.0288	5008	,	,		8462	0.0		0.0716	False		,,,				2504	0.0102				p.F416F		.											.	PLIN1-91	0			c.C1248T						.	G	,	31,3055		0,31,1512	4.0	5.0	4.0		1248,1248	0.6	1.0	15	dbSNP_117	4	256,5878		2,252,2813	no	coding-synonymous,coding-synonymous	PLIN1	NM_001145311.1,NM_002666.4	,	2,283,4325	AA,AG,GG		4.1735,1.0045,3.1128	,	416/523,416/523	90209135	287,8933	1543	3067	4610	SO:0001819	synonymous_variant	5346	exon9			GTCCCGGAATTCG	AB005293	CCDS10353.1	15q26	2009-08-12	2009-08-12	2009-08-12	ENSG00000166819	ENSG00000166819		"""Perilipins"""	9076	protein-coding gene	gene with protein product		170290	"""perilipin"""	PLIN		9521880, 19638644	Standard	NM_002666		Approved		uc010upx.1	O60240	OTTHUMG00000149813	ENST00000300055.5:c.1248C>T	15.37:g.90209135G>A		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	8	6	NM_001145311	0	0	0	0	0	Q8N5Y6	Silent	SNP	ENST00000300055.5	37	CCDS10353.1																																																																																			G|0.976;A|0.024		0.741	PLIN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313424.2	NM_002666	
SMG1	23049	hgsc.bcm.edu	37	16	18937330	18937330	+	Missense_Mutation	SNP	T	T	C	rs190057031	byFrequency	TCGA-OR-A5KW-01A-11D-A29I-10	TCGA-OR-A5KW-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	67dfc56a-abc7-40c7-a901-6512ec38d5f5	804ec9eb-9f16-4ab9-b2dd-2abb72a53348	g.chr16:18937330T>C	ENST00000446231.2	-	1	446	c.34A>G	c.(34-36)Agc>Ggc	p.S12G	SMG1_ENST00000567737.1_5'UTR|SMG1_ENST00000389467.3_Missense_Mutation_p.S12G|CTD-2288F12.1_ENST00000565782.1_RNA			Q96Q15	SMG1_HUMAN	SMG1 phosphatidylinositol 3-kinase-related kinase	12	Interaction with SMG8 and SMG9.				DNA repair (GO:0006281)|gene expression (GO:0010467)|mRNA export from nucleus (GO:0006406)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|peptidyl-serine phosphorylation (GO:0018105)|phosphatidylinositol phosphorylation (GO:0046854)|protein autophosphorylation (GO:0046777)|response to stress (GO:0006950)|RNA metabolic process (GO:0016070)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			NS(2)|breast(8)|cervix(2)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(16)|lung(37)|ovary(1)|skin(1)|stomach(4)|urinary_tract(1)	92						ccgccgccgctgcTCAGCCGA	0.736													T|||	19	0.00379393	0.0038	0.0072	5008	,	,		9587	0.001		0.006	False		,,,				2504	0.002				p.S12G		.											.	SMG1-1160	0			c.A34G						.						3.0	5.0	4.0					16																	18937330		1189	3103	4292	SO:0001583	missense	23049	exon1			CGCCGCTGCTCAG	AB061371	CCDS45430.1	16p12.3	2013-07-02	2013-07-02		ENSG00000157106	ENSG00000157106			30045	protein-coding gene	gene with protein product	"""phosphatidylinositol 3-kinase-related kinase"""	607032	"""smg-1 homolog, phosphatidylinositol 3-kinase-related kinase (C. elegans)"""			9455477, 11331269, 17229728	Standard	NM_015092		Approved	LIP, KIAA0421, ATX	uc002dfm.3	Q96Q15	OTTHUMG00000166900	ENST00000446231.2:c.34A>G	16.37:g.18937330T>C	ENSP00000402515:p.Ser12Gly	Somatic	3	0		WXS	Illumina GAIIx	Phase_I	70	26	NM_015092	0	0	1	4	3	O43305|Q13284|Q8NFX2|Q96QV0|Q96RW3	Missense_Mutation	SNP	ENST00000446231.2	37	CCDS45430.1	56	0.02564102564102564	34	0.06910569105691057	10	0.027624309392265192	3	0.005244755244755245	9	0.011873350923482849	t	16.40	3.112756	0.56398	.	.	ENSG00000157106	ENST00000446231;ENST00000389467	T;T	0.01252	5.1;5.1	4.19	4.19	0.49359	.	0.256528	0.31134	N	0.008187	T	0.00144	0.0004	N	0.19112	0.55	0.30658	N	0.754677	B	0.02656	0.0	B	0.01281	0.0	T	0.32348	-0.9910	10	0.72032	D	0.01	.	6.7847	0.23668	0.0:0.1536:0.0:0.8464	.	12	Q96Q15	SMG1_HUMAN	G	12	ENSP00000402515:S12G;ENSP00000374118:S12G	ENSP00000374118:S12G	S	-	1	0	SMG1	18844831	1.000000	0.71417	0.999000	0.59377	0.967000	0.64934	2.875000	0.48491	1.749000	0.51849	0.374000	0.22700	AGC	T|0.974;C|0.026		0.736	SMG1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000391817.1	NM_015092	
SEZ6L2	26470	hgsc.bcm.edu	37	16	29908433	29908433	+	Missense_Mutation	SNP	C	C	G	rs11649499	byFrequency	TCGA-OR-A5KW-01A-11D-A29I-10	TCGA-OR-A5KW-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	67dfc56a-abc7-40c7-a901-6512ec38d5f5	804ec9eb-9f16-4ab9-b2dd-2abb72a53348	g.chr16:29908433C>G	ENST00000308713.5	-	3	748	c.221G>C	c.(220-222)cGg>cCg	p.R74P	SEZ6L2_ENST00000537485.1_Missense_Mutation_p.R30P|SEZ6L2_ENST00000346932.5_Missense_Mutation_p.R74P|SEZ6L2_ENST00000350527.3_Intron|SEZ6L2_ENST00000562159.1_5'UTR	NM_001114099.2|NM_201575.3	NP_001107571.1|NP_963869.2	Q6UXD5	SE6L2_HUMAN	seizure related 6 homolog (mouse)-like 2	74	Pro-rich.		R -> P (in dbSNP:rs11649499). {ECO:0000269|PubMed:12975309, ECO:0000269|PubMed:14702039, ECO:0000269|PubMed:15489334}.		adult locomotory behavior (GO:0008344)|cerebellar Purkinje cell layer development (GO:0021680)|regulation of protein kinase C signaling (GO:0090036)|synapse maturation (GO:0060074)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)				breast(2)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(10)|lung(16)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	39						CGTGGGGTCCCGATCAGATCC	0.667													G|||	3761	0.750998	0.9932	0.7464	5008	,	,		9668	0.6052		0.827	False		,,,				2504	0.499				p.R74P		.											.	SEZ6L2-92	0			c.G221C						.	G	,PRO/ARG,,PRO/ARG	4084,194		1951,182,6	7.0	10.0	9.0		,221,,221	2.8	1.0	16	dbSNP_120	9	7159,1331		3016,1127,102	yes	intron,missense,intron,missense	SEZ6L2	NM_001114099.2,NM_001114100.2,NM_012410.3,NM_201575.3	,103,,103	4967,1309,108	GG,GC,CC		15.6773,4.5348,11.9439	,benign,,benign	,74/810,,74/911	29908433	11243,1525	2139	4245	6384	SO:0001583	missense	26470	exon3			GGGTCCCGATCAG	AY358404	CCDS10658.1, CCDS10659.1, CCDS45458.1, CCDS58447.1, CCDS73865.1	16p12.1	2008-02-05			ENSG00000174938	ENSG00000174938			30844	protein-coding gene	gene with protein product	"""type I transmembrane receptor (seizure related protein)"""					12975309	Standard	NM_012410		Approved	PSK-1, FLJ90517	uc010vec.2	Q6UXD5	OTTHUMG00000132112	ENST00000308713.5:c.221G>C	16.37:g.29908433C>G	ENSP00000312550:p.Arg74Pro	Somatic	2	0		WXS	Illumina GAIIx	Phase_I	6	4	NM_001243332	0	0	1	1	0	B7Z1N0|F5H293|H7BXQ6|Q9BW82|Q9UJ45|Q9UJ46|Q9UJ47	Missense_Mutation	SNP	ENST00000308713.5	37	CCDS10659.1	1718	0.7866300366300366	484	0.983739837398374	282	0.7790055248618785	322	0.5629370629370629	630	0.8311345646437994	G	0.009	-1.806021	0.00606	0.954652	0.843227	ENSG00000174938	ENST00000308713;ENST00000346932;ENST00000537485	T;T;T	0.45276	0.9;0.9;0.9	5.17	2.85	0.33270	.	0.128667	0.35436	N	0.003211	T	0.00012	0.0000	N	0.03608	-0.345	0.50632	P	1.1099999999997223E-4	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.30621	-0.9972	8	.	.	.	.	7.5026	0.27526	0.1787:0.1431:0.6783:0.0	rs11649499;rs60390109;rs11649499	30;74	F5H293;Q6UXD5	.;SE6L2_HUMAN	P	74;74;30	ENSP00000312550:R74P;ENSP00000319215:R74P;ENSP00000439412:R30P	.	R	-	2	0	SEZ6L2	29815934	0.685000	0.27652	1.000000	0.80357	0.050000	0.14768	0.504000	0.22626	0.600000	0.29862	-0.998000	0.02512	CGG	C|0.218;G|0.782		0.667	SEZ6L2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000255154.2	NM_012410	
KAT8	84148	hgsc.bcm.edu	37	16	31129108	31129108	+	Missense_Mutation	SNP	C	C	G	rs201871085	byFrequency	TCGA-OR-A5KW-01A-11D-A29I-10	TCGA-OR-A5KW-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	67dfc56a-abc7-40c7-a901-6512ec38d5f5	804ec9eb-9f16-4ab9-b2dd-2abb72a53348	g.chr16:31129108C>G	ENST00000543774.2	+	2	441	c.106C>G	c.(106-108)Cca>Gca	p.P36A	KAT8_ENST00000219797.4_Missense_Mutation_p.P36A|RP11-196G11.4_ENST00000576336.1_RNA|KAT8_ENST00000448516.2_Missense_Mutation_p.P36A			Q9H7Z6	KAT8_HUMAN	K(lysine) acetyltransferase 8	36					chromatin organization (GO:0006325)|histone acetylation (GO:0016573)|histone H4-K16 acetylation (GO:0043984)|histone H4-K5 acetylation (GO:0043981)|histone H4-K8 acetylation (GO:0043982)|myeloid cell differentiation (GO:0030099)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	histone acetyltransferase complex (GO:0000123)|kinetochore (GO:0000776)|MLL1 complex (GO:0071339)|MSL complex (GO:0072487)|nuclear membrane (GO:0031965)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	acetyltransferase activity (GO:0016407)|histone acetyltransferase activity (GO:0004402)|metal ion binding (GO:0046872)|methylated histone binding (GO:0035064)|transcription factor binding (GO:0008134)										GGGGACCGCCCCATCCCCGGG	0.756													C|||	26	0.00519169	0.0008	0.0058	5008	,	,		5970	0.0		0.0199	False		,,,				2504	0.001				p.P36A		.											.	.	0			c.C106G						.						2.0	2.0	2.0					16																	31129108		1314	2756	4070	SO:0001583	missense	84148	exon1			ACCGCCCCATCCC	AF217501	CCDS10706.1, CCDS45468.1	16p11.1	2013-01-10	2011-07-21	2011-07-21	ENSG00000103510	ENSG00000103510	2.3.1.48	"""Chromatin-modifying enzymes / K-acetyltransferases"", ""Zinc fingers, C2HC-type containing"""	17933	protein-coding gene	gene with protein product		609912	"""MYST histone acetyltransferase 1"""	MYST1		10786633	Standard	NM_032188		Approved	MOF, FLJ14040, hMOF, ZC2HC8	uc002eax.3	Q9H7Z6	OTTHUMG00000132410	ENST00000543774.2:c.106C>G	16.37:g.31129108C>G	ENSP00000456933:p.Pro36Ala	Somatic	1	0		WXS	Illumina GAIIx	Phase_I	30	11	NM_182958	0	0	8	11	3	A8K4Z1|G5E9P2|Q659G0|Q7LC17|Q8IY59|Q8WYB4|Q8WZ14|Q9HAC5|Q9NR35	Missense_Mutation	SNP	ENST00000543774.2	37	CCDS10706.1	27	0.012362637362637362	2	0.0040650406504065045	7	0.019337016574585635	0	0.0	18	0.023746701846965697	C	16.04	3.010830	0.54361	.	.	ENSG00000103510	ENST00000219797;ENST00000448516	.	.	.	5.11	5.11	0.69529	.	0.372608	0.29783	N	0.011217	T	0.10766	0.0263	N	0.08118	0	0.23665	N	0.997163	B;B	0.15141	0.012;0.008	B;B	0.18871	0.017;0.023	T	0.10613	-1.0622	9	0.11485	T	0.65	-14.8804	11.0185	0.47705	0.1855:0.8145:0.0:0.0	.	36;36	Q9H7Z6;G5E9P2	KAT8_HUMAN;.	A	36	.	ENSP00000219797:P36A	P	+	1	0	KAT8	31036609	0.917000	0.31117	0.957000	0.39632	0.939000	0.58152	2.367000	0.44213	2.665000	0.90641	0.655000	0.94253	CCA	C|0.988;G|0.012		0.756	KAT8-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000255546.3	NM_032188	
ARMC5	79798	hgsc.bcm.edu	37	16	31475864	31475864	+	Missense_Mutation	SNP	C	C	T	rs142376949	byFrequency	TCGA-OR-A5KW-01A-11D-A29I-10	TCGA-OR-A5KW-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	67dfc56a-abc7-40c7-a901-6512ec38d5f5	804ec9eb-9f16-4ab9-b2dd-2abb72a53348	g.chr16:31475864C>T	ENST00000563544.1	+	5	2066	c.1520C>T	c.(1519-1521)cCg>cTg	p.P507L	ARMC5_ENST00000408912.3_Missense_Mutation_p.P602L|ARMC5_ENST00000457010.2_Missense_Mutation_p.P507L|ARMC5_ENST00000538189.1_Missense_Mutation_p.P539L|ARMC5_ENST00000412665.2_Missense_Mutation_p.P151L|ARMC5_ENST00000268314.4_Missense_Mutation_p.P507L			Q96C12	ARMC5_HUMAN	armadillo repeat containing 5	507										central_nervous_system(1)|endometrium(4)|large_intestine(3)|liver(2)|lung(12)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	28						CAACGCACTCCGGGCCGCAGC	0.746													C|||	64	0.0127796	0.0015	0.0043	5008	,	,		9253	0.0		0.0179	False		,,,				2504	0.0419				p.P507L		.											.	ARMC5-24	0			c.C1520T						.	C	LEU/PRO,LEU/PRO	20,3726		0,20,1853	5.0	8.0	7.0		1520,1520	0.4	0.0	16	dbSNP_134	7	141,7601		0,141,3730	no	missense,missense	ARMC5	NM_001105247.1,NM_024742.2	98,98	0,161,5583	TT,TC,CC		1.8212,0.5339,1.4015	benign,benign	507/936,507/726	31475864	161,11327	1873	3871	5744	SO:0001583	missense	79798	exon4			GCACTCCGGGCCG	AY217348	CCDS42155.1, CCDS45472.1, CCDS73874.1	16p11	2013-02-14			ENSG00000140691	ENSG00000140691		"""Armadillo repeat containing"""	25781	protein-coding gene	gene with protein product		615549					Standard	NM_024742		Approved	FLJ13063	uc002ecc.3	Q96C12	OTTHUMG00000176618	ENST00000563544.1:c.1520C>T	16.37:g.31475864C>T	ENSP00000456877:p.Pro507Leu	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	13	6	NM_024742	0	0	3	11	8	Q86WM9|Q9H7P8|Q9H925	Missense_Mutation	SNP	ENST00000563544.1	37	CCDS45472.1	19	0.0086996336996337	2	0.0040650406504065045	0	0.0	0	0.0	17	0.022427440633245383	C	12.56	1.974694	0.34848	0.005339	0.018212	ENSG00000140691	ENST00000408912;ENST00000538189;ENST00000268314;ENST00000457010;ENST00000412665	T;T;T;T;T	0.22945	1.93;1.93;1.93;1.93;1.93	5.83	0.452	0.16634	.	0.629960	0.16046	N	0.232195	T	0.06781	0.0173	L	0.27053	0.805	0.09310	N	1	B;B;B;B;B	0.12630	0.001;0.001;0.003;0.001;0.006	B;B;B;B;B	0.04013	0.001;0.001;0.001;0.001;0.001	T	0.18840	-1.0324	10	0.33141	T	0.24	-24.8415	4.723	0.12927	0.1372:0.4886:0.0:0.3742	.	539;539;602;507;507	B4DH27;F5H156;B4DIU9;Q96C12;Q96C12-4	.;.;.;ARMC5_HUMAN;.	L	602;539;507;507;151	ENSP00000386125:P602L;ENSP00000443995:P539L;ENSP00000268314:P507L;ENSP00000399561:P507L;ENSP00000400183:P151L	ENSP00000268314:P507L	P	+	2	0	ARMC5	31383365	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.656000	0.05342	-0.113000	0.11958	-0.140000	0.14226	CCG	C|0.991;T|0.009		0.746	ARMC5-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000432847.1	NM_024742	
CMTM1	113540	broad.mit.edu	37	16	66600431	66600431	+	Silent	SNP	C	C	T			TCGA-OR-A5KW-01A-11D-A29I-10	TCGA-OR-A5KW-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	67dfc56a-abc7-40c7-a901-6512ec38d5f5	804ec9eb-9f16-4ab9-b2dd-2abb72a53348	g.chr16:66600431C>T	ENST00000457188.2	+	1	136	c.15C>T	c.(13-15)caC>caT	p.H5H	CMTM1_ENST00000528324.1_Silent_p.H5H|CMTM1_ENST00000328020.6_Silent_p.H5H|CMTM1_ENST00000531885.1_Silent_p.H5H|CMTM1_ENST00000336328.6_Silent_p.H5H|CMTM1_ENST00000533953.1_Silent_p.H5H|CMTM1_ENST00000533666.1_Silent_p.H5H|CMTM1_ENST00000529506.1_5'UTR|CMTM1_ENST00000332695.7_Silent_p.H5H|CKLF-CMTM1_ENST00000527729.1_Intron|CMTM1_ENST00000379500.2_Silent_p.H5H|CMTM1_ENST00000535705.1_Silent_p.H5H	NM_181269.2	NP_851786.1	Q8IZ96	CKLF1_HUMAN	CKLF-like MARVEL transmembrane domain containing 1	5					chemotaxis (GO:0006935)	extracellular space (GO:0005615)|integral component of membrane (GO:0016021)				breast(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(2)	7		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0702)|Epithelial(162;0.222)		ATCCTGAACACGCCAAACCTG	0.637																																					p.H5H		.											.	CMTM1-90	0			c.C15T						.						85.0	65.0	72.0					16																	66600431		2201	4300	6501	SO:0001819	synonymous_variant	113540	exon1			TGAACACGCCAAA	AF278577	CCDS10810.1, CCDS10811.1, CCDS10812.2, CCDS45503.1, CCDS45504.1, CCDS54019.1, CCDS54020.1, CCDS54021.1	16q22.1	2009-10-06	2005-11-08	2005-11-08	ENSG00000089505	ENSG00000089505			19172	protein-coding gene	gene with protein product		607884	"""chemokine-like factor super family 1"", ""chemokine-like factor superfamily 1"""	CKLFSF1		12782130	Standard	NM_181268		Approved	CKLFH1a, CKLFH	uc002epr.4	Q8IZ96	OTTHUMG00000137502	ENST00000457188.2:c.15C>T	16.37:g.66600431C>T		Somatic	36	1		WXS	Illumina GAIIx	Phase_I	61	29	NM_181271	0	0	2	3	1	Q2PPY5|Q6PEV5|Q8IU76|Q8IU83|Q8IU86|Q8IU93|Q8IZ87|Q8IZ88|Q8IZ89|Q8IZ90|Q8IZ91|Q8IZ92|Q8IZ93|Q8IZ94|Q8IZ95|Q96JC2|Q96JC3	Silent	SNP	ENST00000457188.2	37	CCDS45503.1																																																																																			.		0.637	CMTM1-015	NOVEL	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000390261.2	NM_052999	
ZFPM1	161882	hgsc.bcm.edu	37	16	88599696	88599697	+	Frame_Shift_Del	DEL	GA	GA	-	rs368520732|rs67712719	byFrequency	TCGA-OR-A5KW-01A-11D-A29I-10	TCGA-OR-A5KW-10A-01D-A29L-10	GA	GA	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	67dfc56a-abc7-40c7-a901-6512ec38d5f5	804ec9eb-9f16-4ab9-b2dd-2abb72a53348	g.chr16:88599696_88599697delGA	ENST00000319555.3	+	10	1652_1653	c.1330_1331delGA	c.(1330-1332)gagfs	p.E444fs	RP11-21B21.4_ENST00000563243.1_RNA	NM_153813.2	NP_722520.2	Q8IX07	FOG1_HUMAN	zinc finger protein, FOG family member 1	444				EPLA -> AP (in Ref. 1; AAN45858). {ECO:0000305}.	atrial septum morphogenesis (GO:0060413)|atrioventricular valve morphogenesis (GO:0003181)|blood coagulation (GO:0007596)|cardiac muscle tissue morphogenesis (GO:0055008)|definitive erythrocyte differentiation (GO:0060318)|embryonic hemopoiesis (GO:0035162)|erythrocyte differentiation (GO:0030218)|granulocyte differentiation (GO:0030851)|megakaryocyte development (GO:0035855)|megakaryocyte differentiation (GO:0030219)|mitral valve formation (GO:0003192)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of interleukin-4 biosynthetic process (GO:0045403)|negative regulation of mast cell differentiation (GO:0060377)|negative regulation of protein binding (GO:0032091)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|outflow tract morphogenesis (GO:0003151)|platelet formation (GO:0030220)|positive regulation of interferon-gamma biosynthetic process (GO:0045078)|primitive erythrocyte differentiation (GO:0060319)|regulation of chemokine production (GO:0032642)|regulation of definitive erythrocyte differentiation (GO:0010724)|T-helper cell lineage commitment (GO:0002295)|transcriptional activation by promoter-enhancer looping (GO:0071733)|tricuspid valve formation (GO:0003195)|ventricular septum morphogenesis (GO:0060412)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|transcription factor complex (GO:0005667)|transcriptional repressor complex (GO:0017053)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II transcription factor binding (GO:0001085)|transcription factor binding (GO:0008134)			central_nervous_system(1)|ovary(2)|urinary_tract(1)	4				BRCA - Breast invasive adenocarcinoma(80;0.0478)		GGCCAGAGCGGAGCCTCTGGCC	0.743														4881	0.974641	0.9138	0.9914	5008	,	,		7261	0.996		1.0	False		,,,				2504	0.9969				p.444_444del	Pancreas(49;850 1106 29641 32847 38344)	.											.	ZFPM1-90	0			c.1330_1331del						.			2219,383		1063,93,145						-6.5	0.0		dbSNP_130	3	4709,133		2339,31,51	no	frameshift	ZFPM1	NM_153813.2		3402,124,196	A1A1,A1R,RR		2.7468,14.7194,6.9318				6928,516				SO:0001589	frameshift_variant	161882	exon10			AGAGCGGAGCCTC	AF488691	CCDS32502.1	16q24.2	2013-01-10	2012-11-27		ENSG00000179588	ENSG00000179588		"""Zinc fingers, C2H2-type"", ""Zinc fingers, C2HC-type containing"""	19762	protein-coding gene	gene with protein product		601950	"""zinc finger protein, multitype 1"""				Standard	NM_153813		Approved	FOG1, FOG, ZNF89A, ZC2HC11A	uc002fkv.3	Q8IX07	OTTHUMG00000173152	ENST00000319555.3:c.1330_1331delGA	16.37:g.88599696_88599697delGA	ENSP00000326630:p.Glu444fs	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	28	13	NM_153813	0	0	0	0	0		Frame_Shift_Del	DEL	ENST00000319555.3	37	CCDS32502.1																																																																																			.		0.743	ZFPM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000422270.2		
ZFPM1	161882	hgsc.bcm.edu	37	16	88599697	88599705	+	In_Frame_Del	DEL	AGCCTCTGG	AGCCTCTGG	-	rs67873604|rs149145771|rs368520732|rs67322929|rs201915453|rs67712719	byFrequency	TCGA-OR-A5KW-01A-11D-A29I-10	TCGA-OR-A5KW-10A-01D-A29L-10	AGCCTCTGG	AGCCTCTGG	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	67dfc56a-abc7-40c7-a901-6512ec38d5f5	804ec9eb-9f16-4ab9-b2dd-2abb72a53348	g.chr16:88599697_88599705delAGCCTCTGG	ENST00000319555.3	+	10	1653_1661	c.1331_1339delAGCCTCTGG	c.(1330-1341)gagcctctggcc>gcc	p.EPL444del	RP11-21B21.4_ENST00000563243.1_RNA	NM_153813.2	NP_722520.2	Q8IX07	FOG1_HUMAN	zinc finger protein, FOG family member 1	444				EPLA -> AP (in Ref. 1; AAN45858). {ECO:0000305}.	atrial septum morphogenesis (GO:0060413)|atrioventricular valve morphogenesis (GO:0003181)|blood coagulation (GO:0007596)|cardiac muscle tissue morphogenesis (GO:0055008)|definitive erythrocyte differentiation (GO:0060318)|embryonic hemopoiesis (GO:0035162)|erythrocyte differentiation (GO:0030218)|granulocyte differentiation (GO:0030851)|megakaryocyte development (GO:0035855)|megakaryocyte differentiation (GO:0030219)|mitral valve formation (GO:0003192)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of interleukin-4 biosynthetic process (GO:0045403)|negative regulation of mast cell differentiation (GO:0060377)|negative regulation of protein binding (GO:0032091)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|outflow tract morphogenesis (GO:0003151)|platelet formation (GO:0030220)|positive regulation of interferon-gamma biosynthetic process (GO:0045078)|primitive erythrocyte differentiation (GO:0060319)|regulation of chemokine production (GO:0032642)|regulation of definitive erythrocyte differentiation (GO:0010724)|T-helper cell lineage commitment (GO:0002295)|transcriptional activation by promoter-enhancer looping (GO:0071733)|tricuspid valve formation (GO:0003195)|ventricular septum morphogenesis (GO:0060412)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|transcription factor complex (GO:0005667)|transcriptional repressor complex (GO:0017053)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II transcription factor binding (GO:0001085)|transcription factor binding (GO:0008134)			central_nervous_system(1)|ovary(2)|urinary_tract(1)	4				BRCA - Breast invasive adenocarcinoma(80;0.0478)		GCCAGAGCGGAGCCTCTGGCCCAGAATGG	0.746																																					p.444_447del	Pancreas(49;850 1106 29641 32847 38344)	.											.	ZFPM1-90	0			c.1331_1339del						.																																			SO:0001651	inframe_deletion	161882	exon10			GAGCGGAGCCTCT	AF488691	CCDS32502.1	16q24.2	2013-01-10	2012-11-27		ENSG00000179588	ENSG00000179588		"""Zinc fingers, C2H2-type"", ""Zinc fingers, C2HC-type containing"""	19762	protein-coding gene	gene with protein product		601950	"""zinc finger protein, multitype 1"""				Standard	NM_153813		Approved	FOG1, FOG, ZNF89A, ZC2HC11A	uc002fkv.3	Q8IX07	OTTHUMG00000173152	ENST00000319555.3:c.1331_1339delAGCCTCTGG	16.37:g.88599697_88599705delAGCCTCTGG	ENSP00000326630:p.Glu444_Leu446del	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	27	0	NM_153813	0	0	0	0	0		In_Frame_Del	DEL	ENST00000319555.3	37	CCDS32502.1																																																																																			.		0.746	ZFPM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000422270.2		
ZFPM1	161882	hgsc.bcm.edu	37	16	88599701	88599701	+	Frame_Shift_Del	DEL	T	T	-	rs67322929|rs149145771	byFrequency	TCGA-OR-A5KW-01A-11D-A29I-10	TCGA-OR-A5KW-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	67dfc56a-abc7-40c7-a901-6512ec38d5f5	804ec9eb-9f16-4ab9-b2dd-2abb72a53348	g.chr16:88599701delT	ENST00000319555.3	+	10	1657	c.1335delT	c.(1333-1335)cctfs	p.P445fs	RP11-21B21.4_ENST00000563243.1_RNA	NM_153813.2	NP_722520.2	Q8IX07	FOG1_HUMAN	zinc finger protein, FOG family member 1	445				EPLA -> AP (in Ref. 1; AAN45858). {ECO:0000305}.	atrial septum morphogenesis (GO:0060413)|atrioventricular valve morphogenesis (GO:0003181)|blood coagulation (GO:0007596)|cardiac muscle tissue morphogenesis (GO:0055008)|definitive erythrocyte differentiation (GO:0060318)|embryonic hemopoiesis (GO:0035162)|erythrocyte differentiation (GO:0030218)|granulocyte differentiation (GO:0030851)|megakaryocyte development (GO:0035855)|megakaryocyte differentiation (GO:0030219)|mitral valve formation (GO:0003192)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of interleukin-4 biosynthetic process (GO:0045403)|negative regulation of mast cell differentiation (GO:0060377)|negative regulation of protein binding (GO:0032091)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|outflow tract morphogenesis (GO:0003151)|platelet formation (GO:0030220)|positive regulation of interferon-gamma biosynthetic process (GO:0045078)|primitive erythrocyte differentiation (GO:0060319)|regulation of chemokine production (GO:0032642)|regulation of definitive erythrocyte differentiation (GO:0010724)|T-helper cell lineage commitment (GO:0002295)|transcriptional activation by promoter-enhancer looping (GO:0071733)|tricuspid valve formation (GO:0003195)|ventricular septum morphogenesis (GO:0060412)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|transcription factor complex (GO:0005667)|transcriptional repressor complex (GO:0017053)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II transcription factor binding (GO:0001085)|transcription factor binding (GO:0008134)			central_nervous_system(1)|ovary(2)|urinary_tract(1)	4				BRCA - Breast invasive adenocarcinoma(80;0.0478)		GAGCGGAGCCTCTGGCCCAGA	0.746													-|T|-|insertion	4871	0.972644	0.9145	0.9899	5008	,	,		7405	0.995		0.994	False		,,,				2504	0.9939				p.P445fs	Pancreas(49;850 1106 29641 32847 38344)	.											.	ZFPM1-90	0			c.1335delT						.						1.0	1.0	1.0					16																	88599701		392	657	1049	SO:0001589	frameshift_variant	161882	exon10			GGAGCCTCTGGCC	AF488691	CCDS32502.1	16q24.2	2013-01-10	2012-11-27		ENSG00000179588	ENSG00000179588		"""Zinc fingers, C2H2-type"", ""Zinc fingers, C2HC-type containing"""	19762	protein-coding gene	gene with protein product		601950	"""zinc finger protein, multitype 1"""				Standard	NM_153813		Approved	FOG1, FOG, ZNF89A, ZC2HC11A	uc002fkv.3	Q8IX07	OTTHUMG00000173152	ENST00000319555.3:c.1335delT	16.37:g.88599701delT	ENSP00000326630:p.Pro445fs	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	17	13	NM_153813	0	0	0	0	0		Frame_Shift_Del	DEL	ENST00000319555.3	37	CCDS32502.1																																																																																			.		0.746	ZFPM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000422270.2		
ZFPM1	161882	hgsc.bcm.edu	37	16	88599703	88599705	+	In_Frame_Del	DEL	TGG	TGG	-	rs149145771|rs67873604	byFrequency	TCGA-OR-A5KW-01A-11D-A29I-10	TCGA-OR-A5KW-10A-01D-A29L-10	TGG	TGG	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	67dfc56a-abc7-40c7-a901-6512ec38d5f5	804ec9eb-9f16-4ab9-b2dd-2abb72a53348	g.chr16:88599703_88599705delTGG	ENST00000319555.3	+	10	1659_1661	c.1337_1339delTGG	c.(1336-1341)ctggcc>ccc	p.446_447LA>P	RP11-21B21.4_ENST00000563243.1_RNA	NM_153813.2	NP_722520.2	Q8IX07	FOG1_HUMAN	zinc finger protein, FOG family member 1	446				EPLA -> AP (in Ref. 1; AAN45858). {ECO:0000305}.	atrial septum morphogenesis (GO:0060413)|atrioventricular valve morphogenesis (GO:0003181)|blood coagulation (GO:0007596)|cardiac muscle tissue morphogenesis (GO:0055008)|definitive erythrocyte differentiation (GO:0060318)|embryonic hemopoiesis (GO:0035162)|erythrocyte differentiation (GO:0030218)|granulocyte differentiation (GO:0030851)|megakaryocyte development (GO:0035855)|megakaryocyte differentiation (GO:0030219)|mitral valve formation (GO:0003192)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of interleukin-4 biosynthetic process (GO:0045403)|negative regulation of mast cell differentiation (GO:0060377)|negative regulation of protein binding (GO:0032091)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|outflow tract morphogenesis (GO:0003151)|platelet formation (GO:0030220)|positive regulation of interferon-gamma biosynthetic process (GO:0045078)|primitive erythrocyte differentiation (GO:0060319)|regulation of chemokine production (GO:0032642)|regulation of definitive erythrocyte differentiation (GO:0010724)|T-helper cell lineage commitment (GO:0002295)|transcriptional activation by promoter-enhancer looping (GO:0071733)|tricuspid valve formation (GO:0003195)|ventricular septum morphogenesis (GO:0060412)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|transcription factor complex (GO:0005667)|transcriptional repressor complex (GO:0017053)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II transcription factor binding (GO:0001085)|transcription factor binding (GO:0008134)			central_nervous_system(1)|ovary(2)|urinary_tract(1)	4				BRCA - Breast invasive adenocarcinoma(80;0.0478)		GCGGAGCCTCTGGCCCAGAATGG	0.739														4871	0.972644	0.9145	0.9899	5008	,	,		7191	0.995		0.994	False		,,,				2504	0.9939				p.446_447del	Pancreas(49;850 1106 29641 32847 38344)	.											.	ZFPM1-90	0			c.1337_1339del						.																																			SO:0001651	inframe_deletion	161882	exon10			AGCCTCTGGCCCA	AF488691	CCDS32502.1	16q24.2	2013-01-10	2012-11-27		ENSG00000179588	ENSG00000179588		"""Zinc fingers, C2H2-type"", ""Zinc fingers, C2HC-type containing"""	19762	protein-coding gene	gene with protein product		601950	"""zinc finger protein, multitype 1"""				Standard	NM_153813		Approved	FOG1, FOG, ZNF89A, ZC2HC11A	uc002fkv.3	Q8IX07	OTTHUMG00000173152	ENST00000319555.3:c.1337_1339delTGG	16.37:g.88599703_88599705delTGG	ENSP00000326630:p.Leu446_Ala447delinsPro	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	15	13	NM_153813	0	0	0	0	0		In_Frame_Del	DEL	ENST00000319555.3	37	CCDS32502.1																																																																																			.		0.739	ZFPM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000422270.2		
GAS8	2622	bcgsc.ca	37	16	90095558	90095558	+	Intron	SNP	C	C	T	rs76646627		TCGA-OR-A5KW-01A-11D-A29I-10	TCGA-OR-A5KW-10A-01D-A29L-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	67dfc56a-abc7-40c7-a901-6512ec38d5f5	804ec9eb-9f16-4ab9-b2dd-2abb72a53348	g.chr16:90095558C>T	ENST00000268699.4	+	2	212				GAS8_ENST00000540721.1_Intron|GAS8_ENST00000536122.1_Intron|C16orf3_ENST00000408886.2_Missense_Mutation_p.G65S	NM_001481.2	NP_001472.1	O95995	GAS8_HUMAN	growth arrest-specific 8						cellular protein localization (GO:0034613)|negative regulation of cell proliferation (GO:0008285)|sperm motility (GO:0030317)	Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|motile cilium (GO:0031514)		p.G65S(1)		endometrium(3)|large_intestine(2)|lung(6)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	14		all_cancers(9;4.44e-13)|Lung NSC(15;1.56e-06)|all_lung(18;2.18e-06)|all_neural(9;0.00118)|all_hematologic(23;0.0194)		BRCA - Breast invasive adenocarcinoma(80;0.029)		acggggcagcctacggggcag	0.672																																					p.G65S		.											.	C16orf3-90	1	Substitution - Missense(1)	lung(1)	c.G193A						.						25.0	20.0	21.0					16																	90095558		2191	4298	6489	SO:0001627	intron_variant	750	exon1			GGCAGCCTACGGG	AF050079	CCDS10992.1, CCDS67101.1, CCDS73932.1	16q24.3	2014-07-18	2003-01-16	2003-01-17	ENSG00000141013	ENSG00000141013			4166	protein-coding gene	gene with protein product		605178	"""growth arrest-specific 11"""	GAS11		9790751	Standard	NM_001481		Approved		uc002fqi.1	O95995	OTTHUMG00000138988	ENST00000268699.4:c.90+1428C>T	16.37:g.90095558C>T		Somatic	81	1		WXS	Illumina GAIIx	Phase_I	185	11	NM_001214	0	0	0	0	0	B2RCT1|B7Z4U1|G3V1L5|Q2M234	Missense_Mutation	SNP	ENST00000268699.4	37	CCDS10992.1	.	.	.	.	.	.	.	.	.	.	C	9.046	0.990885	0.18966	.	.	ENSG00000221819	ENST00000408886	T	0.57595	0.39	1.2	-1.14	0.09741	.	.	.	.	.	T	0.23492	0.0568	N	0.08118	0	0.09310	N	1	B	0.22604	0.072	B	0.14578	0.011	T	0.14755	-1.0461	8	.	.	.	.	2.4936	0.04616	0.0:0.4385:0.3231:0.2384	.	73	O95177	CP003_HUMAN	S	65	ENSP00000386218:G65S	.	G	-	1	0	C16orf3	88623059	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-0.145000	0.10265	-0.326000	0.08564	0.407000	0.27541	GGC	C|0.500;T|0.500		0.672	GAS8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000272877.2		
GAS8	2622	bcgsc.ca	37	16	90095573	90095573	+	Intron	SNP	C	C	T	rs77382359		TCGA-OR-A5KW-01A-11D-A29I-10	TCGA-OR-A5KW-10A-01D-A29L-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	67dfc56a-abc7-40c7-a901-6512ec38d5f5	804ec9eb-9f16-4ab9-b2dd-2abb72a53348	g.chr16:90095573C>T	ENST00000268699.4	+	2	212				GAS8_ENST00000540721.1_Intron|GAS8_ENST00000536122.1_Intron|C16orf3_ENST00000408886.2_Missense_Mutation_p.V60I	NM_001481.2	NP_001472.1	O95995	GAS8_HUMAN	growth arrest-specific 8						cellular protein localization (GO:0034613)|negative regulation of cell proliferation (GO:0008285)|sperm motility (GO:0030317)	Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|motile cilium (GO:0031514)				endometrium(3)|large_intestine(2)|lung(6)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	14		all_cancers(9;4.44e-13)|Lung NSC(15;1.56e-06)|all_lung(18;2.18e-06)|all_neural(9;0.00118)|all_hematologic(23;0.0194)		BRCA - Breast invasive adenocarcinoma(80;0.029)		gggcaggctacggggcagctt	0.672																																					p.V60I		.											.	C16orf3-90	0			c.G178A						.						22.0	20.0	21.0					16																	90095573		2194	4299	6493	SO:0001627	intron_variant	750	exon1			AGGCTACGGGGCA	AF050079	CCDS10992.1, CCDS67101.1, CCDS73932.1	16q24.3	2014-07-18	2003-01-16	2003-01-17	ENSG00000141013	ENSG00000141013			4166	protein-coding gene	gene with protein product		605178	"""growth arrest-specific 11"""	GAS11		9790751	Standard	NM_001481		Approved		uc002fqi.1	O95995	OTTHUMG00000138988	ENST00000268699.4:c.90+1443C>T	16.37:g.90095573C>T		Somatic	62	0		WXS	Illumina GAIIx	Phase_I	155	14	NM_001214	0	0	0	0	0	B2RCT1|B7Z4U1|G3V1L5|Q2M234	Missense_Mutation	SNP	ENST00000268699.4	37	CCDS10992.1	.	.	.	.	.	.	.	.	.	.	c	0.708	-0.788068	0.02884	.	.	ENSG00000221819	ENST00000408886	T	0.47177	0.85	.	.	.	.	.	.	.	.	T	0.22244	0.0536	N	0.08118	0	0.09310	N	1	.	.	.	.	.	.	T	0.22208	-1.0223	4	.	.	.	.	.	.	.	.	68	O95177	CP003_HUMAN	I	60	ENSP00000386218:V60I	.	V	-	1	0	C16orf3	88623074	0.031000	0.19500	0.015000	0.15790	0.017000	0.09413	0.000000	0.12993	0.000000	0.14550	0.000000	0.15137	GTA	C|0.500;T|0.500		0.672	GAS8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000272877.2		
GSG2	83903	hgsc.bcm.edu	37	17	3627456	3627456	+	Missense_Mutation	SNP	T	T	A	rs11653889	byFrequency	TCGA-OR-A5KW-01A-11D-A29I-10	TCGA-OR-A5KW-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	67dfc56a-abc7-40c7-a901-6512ec38d5f5	804ec9eb-9f16-4ab9-b2dd-2abb72a53348	g.chr17:3627456T>A	ENST00000325418.4	+	1	246	c.227T>A	c.(226-228)gTg>gAg	p.V76E	CTD-3195I5.3_ENST00000571741.1_RNA|ITGAE_ENST00000571185.1_5'Flank|ITGAE_ENST00000263087.4_Intron	NM_031965.2	NP_114171.2	Q8TF76	HASP_HUMAN	germ cell associated 2 (haspin)	76			V -> E (in dbSNP:rs11653889). {ECO:0000269|PubMed:17344846}.		histone H3-T3 phosphorylation involved in chromosome passenger complex localization to kinetochore (GO:2000751)|intracellular signal transduction (GO:0035556)|mitotic sister chromatid cohesion (GO:0007064)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|protein localization to chromosome, centromeric region (GO:0071459)|protein phosphorylation (GO:0006468)|regulation of spindle checkpoint (GO:0090231)	centrosome (GO:0005813)|chromosome (GO:0005694)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|spindle (GO:0005819)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|histone kinase activity (H3-T3 specific) (GO:0072354)|protein kinase activity (GO:0004672)										GGCAGCCCGGTGAGGCGGCGG	0.711													T|||	16	0.00319489	0.0	0.0014	5008	,	,		12080	0.0		0.0119	False		,,,				2504	0.0031				p.V76E		.											.	GSG2-297	0			c.T227A						.	T	,GLU/VAL	6,4170		0,6,2082	6.0	10.0	9.0		,227	-0.7	0.0	17	dbSNP_120	9	87,8123		0,87,4018	yes	intron,missense	ITGAE,GSG2	NM_002208.4,NM_031965.2	,121	0,93,6100	AA,AT,TT		1.0597,0.1437,0.7508	,possibly-damaging	,76/799	3627456	93,12293	2088	4105	6193	SO:0001583	missense	83903	exon1			GCCCGGTGAGGCG	AB039834	CCDS11036.1	17p13	2005-01-19			ENSG00000177602	ENSG00000177602			19682	protein-coding gene	gene with protein product		609240					Standard	NM_031965		Approved	haspin	uc002fwp.3	Q8TF76	OTTHUMG00000090703	ENST00000325418.4:c.227T>A	17.37:g.3627456T>A	ENSP00000325290:p.Val76Glu	Somatic	1	0		WXS	Illumina GAIIx	Phase_I	16	13	NM_031965	0	0	0	1	1	Q5U5K3|Q96MN1|Q9BXS7	Missense_Mutation	SNP	ENST00000325418.4	37	CCDS11036.1	8	0.003663003663003663	2	0.0040650406504065045	0	0.0	0	0.0	6	0.0079155672823219	T	9.790	1.177619	0.21787	0.001437	0.010597	ENSG00000177602	ENST00000325418	T	0.07800	3.16	3.98	-0.668	0.11392	.	1.462810	0.04797	N	0.432724	T	0.04679	0.0127	N	0.24115	0.695	0.09310	N	1	P	0.40476	0.718	B	0.39299	0.296	T	0.36939	-0.9727	10	0.87932	D	0	-27.3067	6.569	0.22529	0.0:0.422:0.1416:0.4364	rs11653889	76	Q8TF76	HASP_HUMAN	E	76	ENSP00000325290:V76E	ENSP00000325290:V76E	V	+	2	0	GSG2	3574205	0.046000	0.20272	0.015000	0.15790	0.108000	0.19459	0.710000	0.25748	-0.167000	0.10871	-0.456000	0.05471	GTG	T|0.995;A|0.005		0.711	GSG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207391.1	NM_031965	
ENO3	2027	bcgsc.ca	37	17	4856580	4856580	+	Missense_Mutation	SNP	T	T	C	rs238239	byFrequency	TCGA-OR-A5KW-01A-11D-A29I-10	TCGA-OR-A5KW-10A-01D-A29L-10	T	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	67dfc56a-abc7-40c7-a901-6512ec38d5f5	804ec9eb-9f16-4ab9-b2dd-2abb72a53348	g.chr17:4856580T>C	ENST00000323997.6	+	5	386	c.254T>C	c.(253-255)gTg>gCg	p.V85A	ENO3_ENST00000519584.1_Intron|ENO3_ENST00000518175.1_Missense_Mutation_p.V85A	NM_001976.4|NM_053013.3	NP_001967.3|NP_443739.3	P13929	ENOB_HUMAN	enolase 3 (beta, muscle)	85			V -> A (in dbSNP:rs238239). {ECO:0000269|PubMed:14702039, ECO:0000269|PubMed:15489334, ECO:0000269|PubMed:2336366, ECO:0000269|PubMed:8513787}.		aging (GO:0007568)|carbohydrate metabolic process (GO:0005975)|gluconeogenesis (GO:0006094)|glucose metabolic process (GO:0006006)|glycolytic process (GO:0006096)|response to drug (GO:0042493)|skeletal muscle tissue regeneration (GO:0043403)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|phosphopyruvate hydratase complex (GO:0000015)|plasma membrane (GO:0005886)	magnesium ion binding (GO:0000287)|phosphopyruvate hydratase activity (GO:0004634)			cervix(1)|endometrium(1)|large_intestine(4)|lung(8)|ovary(1)	15						CTAAGCGTTGTGGATCAAGAA	0.473													T|||	1522	0.303914	0.1445	0.4481	5008	,	,		20657	0.1548		0.5437	False		,,,				2504	0.3241				p.V85A		.											.	ENO3-227	0			c.T254C						.	T	,ALA/VAL,ALA/VAL	1009,3397	375.9+/-321.8	112,785,1306	160.0	166.0	164.0		,254,254	4.4	1.0	17	dbSNP_79	164	4845,3755	616.5+/-396.5	1369,2107,824	no	intron,missense,missense	ENO3	NM_001193503.1,NM_001976.4,NM_053013.3	,64,64	1481,2892,2130	CC,CT,TT		43.6628,22.9006,45.01	,benign,benign	,85/435,85/435	4856580	5854,7152	2203	4300	6503	SO:0001583	missense	2027	exon5			GCGTTGTGGATCA	X16504	CCDS11062.1, CCDS54070.1	17p13.2	2013-09-19	2004-11-22		ENSG00000108515	ENSG00000108515	4.2.1.11		3354	protein-coding gene	gene with protein product		131370	"""enolase 3, (beta, muscle)"""				Standard	NM_001976		Approved		uc002gab.4	P13929	OTTHUMG00000099394	ENST00000323997.6:c.254T>C	17.37:g.4856580T>C	ENSP00000324105:p.Val85Ala	Somatic	199	2		WXS	Illumina GAIIx	Phase_I	179	10	NM_001976	0	0	1	1	0	B4DUI6|B4DUM6|D3DTL2|E7ENK8|Q96AE2	Missense_Mutation	SNP	ENST00000323997.6	37	CCDS11062.1	762	0.3489010989010989	84	0.17073170731707318	178	0.49171270718232046	82	0.14335664335664336	418	0.5514511873350924	T	16.43	3.121456	0.56613	0.229006	0.563372	ENSG00000108515	ENST00000522798;ENST00000519602;ENST00000323997;ENST00000522249;ENST00000518175	T;T;T;T;T	0.29397	1.57;1.57;1.57;1.57;1.57	5.52	4.42	0.53409	.	.	.	.	.	T	0.00012	0.0000	.	.	.	0.22240	P	0.999268271	B	0.02656	0.0	B	0.17722	0.019	T	0.41413	-0.9510	7	0.59425	D	0.04	-4.8798	11.2677	0.49120	0.0:0.0:0.1529:0.8471	rs238239;rs1133199;rs3178310;rs3194733;rs11537780;rs52795865;rs56655488;rs238239	85	D3DTL2	.	A	85	ENSP00000428502:V85A;ENSP00000430055:V85A;ENSP00000324105:V85A;ENSP00000428811:V85A;ENSP00000431087:V85A	ENSP00000324105:V85A	V	+	2	0	ENO3	4797326	1.000000	0.71417	0.998000	0.56505	0.992000	0.81027	5.019000	0.64060	0.998000	0.38996	0.533000	0.62120	GTG	T|0.602;C|0.398		0.473	ENO3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000216851.2		
NLGN2	57555	hgsc.bcm.edu	37	17	7320874	7320874	+	Missense_Mutation	SNP	C	C	T	rs62061174	byFrequency	TCGA-OR-A5KW-01A-11D-A29I-10	TCGA-OR-A5KW-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	67dfc56a-abc7-40c7-a901-6512ec38d5f5	804ec9eb-9f16-4ab9-b2dd-2abb72a53348	g.chr17:7320874C>T	ENST00000302926.2	+	7	2337	c.2264C>T	c.(2263-2265)gCg>gTg	p.A755V	SPEM1_ENST00000323675.3_5'Flank|NLGN2_ENST00000575301.1_Missense_Mutation_p.A755V|RP11-104H15.7_ENST00000575310.1_RNA	NM_020795.2	NP_065846.1	Q8NFZ4	NLGN2_HUMAN	neuroligin 2	755					cell-cell junction maintenance (GO:0045217)|gephyrin clustering (GO:0097116)|locomotory exploration behavior (GO:0035641)|neuromuscular process controlling balance (GO:0050885)|neuron cell-cell adhesion (GO:0007158)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of inhibitory postsynaptic membrane potential (GO:0097151)|positive regulation of synapse assembly (GO:0051965)|positive regulation of synaptic transmission, GABAergic (GO:0032230)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|postsynaptic density protein 95 clustering (GO:0097119)|postsynaptic membrane assembly (GO:0097104)|presynaptic membrane assembly (GO:0097105)|protein localization to synapse (GO:0035418)|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000311)|regulation of respiratory gaseous exchange by neurological system process (GO:0002087)|regulation of synaptic transmission (GO:0050804)|sensory perception of pain (GO:0019233)|single organismal cell-cell adhesion (GO:0016337)|synapse assembly (GO:0007416)|synapse organization (GO:0050808)|terminal button organization (GO:0072553)	cell junction (GO:0030054)|cell surface (GO:0009986)|inhibitory synapse (GO:0060077)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|postsynaptic membrane (GO:0045211)|synapse (GO:0045202)	cell adhesion molecule binding (GO:0050839)|neurexin family protein binding (GO:0042043)|receptor activity (GO:0004872)			central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(3)|lung(7)|prostate(2)|skin(3)	22		Prostate(122;0.157)				GGCGTCGGGGCGGACCCTGCC	0.761													C|||	53	0.0105831	0.0008	0.0187	5008	,	,		6326	0.0		0.0338	False		,,,				2504	0.0051				p.A755V		.											.	NLGN2-90	0			c.C2264T						.	C	VAL/ALA	15,3913		0,15,1949	5.0	5.0	5.0		2264	2.3	1.0	17	dbSNP_129	5	206,7598		3,200,3699	yes	missense	NLGN2	NM_020795.2	64	3,215,5648	TT,TC,CC		2.6397,0.3819,1.8837	benign	755/836	7320874	221,11511	1964	3902	5866	SO:0001583	missense	57555	exon7			TCGGGGCGGACCC	AB037787	CCDS11103.1	17p13.2	2008-07-18			ENSG00000169992	ENSG00000169992			14290	protein-coding gene	gene with protein product		606479				10767552, 10819331	Standard	NM_020795		Approved	KIAA1366	uc002ggt.1	Q8NFZ4	OTTHUMG00000108138	ENST00000302926.2:c.2264C>T	17.37:g.7320874C>T	ENSP00000305288:p.Ala755Val	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	11	9	NM_020795	0	0	0	1	1	Q9P2I1	Missense_Mutation	SNP	ENST00000302926.2	37	CCDS11103.1	30	0.013736263736263736	0	0.0	6	0.016574585635359115	2	0.0034965034965034965	22	0.029023746701846966	C	9.067	0.995877	0.19043	0.003819	0.026397	ENSG00000169992	ENST00000302926	T	0.64803	-0.12	3.42	2.33	0.28932	.	0.633271	0.13495	N	0.383697	T	0.15739	0.0379	N	0.08118	0	0.28833	N	0.897033	B	0.09022	0.002	B	0.01281	0.0	T	0.07028	-1.0794	10	0.14656	T	0.56	.	10.3885	0.44154	0.0:0.798:0.202:0.0	rs62061174	755	Q8NFZ4	NLGN2_HUMAN	V	755	ENSP00000305288:A755V	ENSP00000305288:A755V	A	+	2	0	NLGN2	7261598	0.090000	0.21635	0.981000	0.43875	0.746000	0.42486	2.934000	0.48956	1.904000	0.55121	0.448000	0.29417	GCG	C|0.986;T|0.014		0.761	NLGN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000226941.2	NM_020795	
MAPK7	5598	broad.mit.edu	37	17	19285118	19285118	+	Missense_Mutation	SNP	C	C	A			TCGA-OR-A5KW-01A-11D-A29I-10	TCGA-OR-A5KW-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	67dfc56a-abc7-40c7-a901-6512ec38d5f5	804ec9eb-9f16-4ab9-b2dd-2abb72a53348	g.chr17:19285118C>A	ENST00000308406.5	+	5	1888	c.1502C>A	c.(1501-1503)gCt>gAt	p.A501D	MFAP4_ENST00000574313.2_5'Flank|MAPK7_ENST00000299612.7_Missense_Mutation_p.A362D|MAPK7_ENST00000395604.3_Missense_Mutation_p.A501D|MAPK7_ENST00000571657.1_Intron|MAPK7_ENST00000395602.4_Missense_Mutation_p.A501D	NM_139033.2	NP_620602.2	Q13164	MK07_HUMAN	mitogen-activated protein kinase 7	501	May not be required for kinase activity; required to stimulate MEF2C activity. {ECO:0000250}.|Pro-rich.				cAMP-mediated signaling (GO:0019933)|cell cycle (GO:0007049)|cell differentiation (GO:0030154)|cellular response to growth factor stimulus (GO:0071363)|cellular response to hydrogen peroxide (GO:0070301)|cellular response to laminar fluid shear stress (GO:0071499)|cellular response to transforming growth factor beta stimulus (GO:0071560)|innate immune response (GO:0045087)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of cAMP catabolic process (GO:0030821)|negative regulation of cyclic-nucleotide phosphodiesterase activity (GO:0051344)|negative regulation of endothelial cell apoptotic process (GO:2000352)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|negative regulation of heterotypic cell-cell adhesion (GO:0034115)|negative regulation of inflammatory response (GO:0050728)|negative regulation of NFAT protein import into nucleus (GO:0051534)|negative regulation of oxidative stress-induced intrinsic apoptotic signaling pathway (GO:1902176)|negative regulation of response to cytokine stimulus (GO:0060761)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-serine phosphorylation (GO:0018105)|positive regulation of protein metabolic process (GO:0051247)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase II promoter in response to stress (GO:0036003)|regulation of angiogenesis (GO:0045765)|signal transduction (GO:0007165)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)	ATP binding (GO:0005524)|MAP kinase activity (GO:0004707)|mitogen-activated protein kinase binding (GO:0051019)	p.A501D(1)		autonomic_ganglia(1)|central_nervous_system(4)|endometrium(5)|kidney(2)|large_intestine(4)|lung(9)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	30	all_cancers(12;2.87e-05)|all_epithelial(12;0.00114)|Hepatocellular(7;0.00345)|Breast(13;0.206)					CCCCTGGAGGCTCCTGAGCCT	0.672																																					p.A501D		.											.	MAPK7-1402	1	Substitution - Missense(1)	endometrium(1)	c.C1502A						.						10.0	17.0	15.0					17																	19285118		2162	4232	6394	SO:0001583	missense	5598	exon5			TGGAGGCTCCTGA	U25278	CCDS11206.1, CCDS11207.1	17p11.2	2011-06-09			ENSG00000166484	ENSG00000166484	2.7.11.24	"""Mitogen-activated protein kinase cascade / Kinases"""	6880	protein-coding gene	gene with protein product	"""BMK1 kinase"", ""extracellular-signal-regulated kinase 5"""	602521		PRKM7		10072598, 7759517	Standard	NM_139032		Approved	BMK1, ERK5	uc002gvp.3	Q13164	OTTHUMG00000059587	ENST00000308406.5:c.1502C>A	17.37:g.19285118C>A	ENSP00000311005:p.Ala501Asp	Somatic	11	0		WXS	Illumina GAIIx	Phase_I	56	9	NM_002749	0	0	24	25	1	Q16634|Q59F50|Q6QLU7|Q7L4P4|Q969G1|Q96G51	Missense_Mutation	SNP	ENST00000308406.5	37	CCDS11206.1	.	.	.	.	.	.	.	.	.	.	C	16.89	3.248312	0.59103	.	.	ENSG00000166484	ENST00000308406;ENST00000299612;ENST00000395604;ENST00000395602	T;T;T;T	0.74209	-0.57;-0.82;-0.57;-0.57	4.36	3.39	0.38822	.	0.278335	0.34291	N	0.004097	T	0.62792	0.2457	N	0.22421	0.69	0.33339	D	0.569546	P	0.50943	0.94	P	0.47299	0.543	T	0.71846	-0.4469	10	0.87932	D	0	-7.5638	6.6062	0.22726	0.0:0.7883:0.0:0.2117	.	501	Q13164	MK07_HUMAN	D	501;362;501;501	ENSP00000311005:A501D;ENSP00000299612:A362D;ENSP00000378968:A501D;ENSP00000378966:A501D	ENSP00000299612:A362D	A	+	2	0	MAPK7	19225711	0.988000	0.35896	0.980000	0.43619	0.970000	0.65996	1.704000	0.37857	1.055000	0.40461	0.561000	0.74099	GCT	.		0.672	MAPK7-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000132506.1	NM_139033	
KRTAP16-1	100505753	bcgsc.ca	37	17	39464736	39464736	+	Missense_Mutation	SNP	C	C	G	rs2074284	byFrequency	TCGA-OR-A5KW-01A-11D-A29I-10	TCGA-OR-A5KW-10A-01D-A29L-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	67dfc56a-abc7-40c7-a901-6512ec38d5f5	804ec9eb-9f16-4ab9-b2dd-2abb72a53348	g.chr17:39464736C>G	ENST00000391352.1	-	1	769	c.770G>C	c.(769-771)aGt>aCt	p.S257T		NM_001146182.1	NP_001139654.1	A8MUX0	KR161_HUMAN	keratin associated protein 16-1	257	11 X 5 AA repeats of C-C-X(3).					keratin filament (GO:0045095)				haematopoietic_and_lymphoid_tissue(1)	1						CTCTGAGCAACTTGGCTCACA	0.607													G|||	1605	0.320487	0.4818	0.1974	5008	,	,		22646	0.371		0.2634	False		,,,				2504	0.1963				p.S257T		.											.	.	0			c.G770C						.																																			SO:0001583	missense	100505753	exon1			GAGCAACTTGGCT	AP001708	CCDS56032.1	17q21.2	2012-07-04			ENSG00000212657	ENSG00000212657		"""Keratin associated proteins"""	18916	protein-coding gene	gene with protein product							Standard	NM_001146182		Approved	KAP16.1	uc021txi.1	A8MUX0	OTTHUMG00000133640	ENST00000391352.1:c.770G>C	17.37:g.39464736C>G	ENSP00000375147:p.Ser257Thr	Somatic	260	1		WXS	Illumina GAIIx	Phase_I	205	7	NM_001146182	0	0	0	0	0		Missense_Mutation	SNP	ENST00000391352.1	37	CCDS56032.1	717	0.3282967032967033	229	0.4654471544715447	79	0.21823204419889503	206	0.36013986013986016	203	0.2678100263852243	G	3.035	-0.198720	0.06219	.	.	ENSG00000212657	ENST00000391352	T	0.01787	4.64	5.1	4.13	0.48395	.	.	.	.	.	T	0.00012	0.0000	L	0.34521	1.04	0.51482	P	7.599999999996498E-5	.	.	.	.	.	.	T	0.19160	-1.0314	6	0.23891	T	0.37	.	3.6587	0.08230	0.0883:0.1689:0.5671:0.1757	rs2074284;rs2074284	.	.	.	T	257	ENSP00000375147:S257T	ENSP00000375147:S257T	S	-	2	0	KRTAP16-1	36718262	0.176000	0.23096	0.878000	0.34440	0.005000	0.04900	1.025000	0.30090	1.527000	0.49086	-0.120000	0.15030	AGT	C|0.432;G|0.568		0.607	KRTAP16-1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257785.1	NM_001146182	
G6PC	2538	hgsc.bcm.edu;bcgsc.ca	37	17	41063167	41063167	+	Silent	SNP	C	C	T			TCGA-OR-A5KW-01A-11D-A29I-10	TCGA-OR-A5KW-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	67dfc56a-abc7-40c7-a901-6512ec38d5f5	804ec9eb-9f16-4ab9-b2dd-2abb72a53348	g.chr17:41063167C>T	ENST00000253801.2	+	5	877	c.798C>T	c.(796-798)ggC>ggT	p.G266G	G6PC_ENST00000592383.1_3'UTR|G6PC_ENST00000585489.1_3'UTR	NM_000151.3	NP_000142.2	P35575	G6PC_HUMAN	glucose-6-phosphatase, catalytic subunit	266			G -> V (in GSD1A). {ECO:0000269|PubMed:10094563}.		carbohydrate metabolic process (GO:0005975)|cholesterol homeostasis (GO:0042632)|dephosphorylation (GO:0016311)|gluconeogenesis (GO:0006094)|glucose 6-phosphate metabolic process (GO:0051156)|glucose homeostasis (GO:0042593)|glucose transport (GO:0015758)|glucose-6-phosphate transport (GO:0015760)|glycogen catabolic process (GO:0005980)|glycogen metabolic process (GO:0005977)|hexose transport (GO:0008645)|multicellular organism growth (GO:0035264)|regulation of gene expression (GO:0010468)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|transmembrane transport (GO:0055085)|triglyceride metabolic process (GO:0006641)|urate metabolic process (GO:0046415)	endoplasmic reticulum membrane (GO:0005789)|integral component of endoplasmic reticulum membrane (GO:0030176)|integral component of membrane (GO:0016021)	glucose-6-phosphatase activity (GO:0004346)|phosphate ion binding (GO:0042301)|phosphotransferase activity, alcohol group as acceptor (GO:0016773)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(9)|ovary(1)|prostate(1)|skin(1)	23		Breast(137;0.000143)		BRCA - Breast invasive adenocarcinoma(366;0.113)		AGAACCTGGGCACGCTCTTTG	0.587																																					p.G266G		.											.	G6PC-292	0			c.C798T						.						84.0	75.0	78.0					17																	41063167		2203	4300	6503	SO:0001819	synonymous_variant	2538	exon5			CCTGGGCACGCTC	U01120	CCDS11446.1, CCDS59291.1	17q21	2014-09-17	2006-06-28			ENSG00000131482	3.1.3.9		4056	protein-coding gene	gene with protein product	"""glycogen storage disease type I, von Gierke disease"""	613742	"""glucose-6-phosphatase, catalytic (glycogen storage disease type I, von Gierke disease)"""	G6PT		7774924	Standard	NM_000151		Approved	GSD1a	uc002icb.2	P35575		ENST00000253801.2:c.798C>T	17.37:g.41063167C>T		Somatic	156	0		WXS	Illumina GAIIx	Phase_I	148	8	NM_000151	0	0	0	0	0	A1L4C0|B4E1C3|K7EL82	Silent	SNP	ENST00000253801.2	37	CCDS11446.1																																																																																			.		0.587	G6PC-001	KNOWN	upstream_ATG|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452451.1	NM_000151	
SCRN2	90507	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	45916995	45916995	+	Missense_Mutation	SNP	C	C	T	rs552628767		TCGA-OR-A5KW-01A-11D-A29I-10	TCGA-OR-A5KW-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	67dfc56a-abc7-40c7-a901-6512ec38d5f5	804ec9eb-9f16-4ab9-b2dd-2abb72a53348	g.chr17:45916995C>T	ENST00000290216.9	-	4	496	c.371G>A	c.(370-372)cGg>cAg	p.R124Q	SCRN2_ENST00000407215.3_Missense_Mutation_p.R124Q|SCRN2_ENST00000584123.1_Missense_Mutation_p.R132Q	NM_001145023.1|NM_138355.3	NP_001138495.1|NP_612364.2	Q96FV2	SCRN2_HUMAN	secernin 2	124						extracellular vesicular exosome (GO:0070062)	dipeptidase activity (GO:0016805)			cervix(1)|kidney(2)|large_intestine(2)|lung(7)|ovary(1)|skin(1)	14						AGAGCTGCTCCGTTCCAAAGC	0.607													C|||	1	0.000199681	0.0	0.0	5008	,	,		20315	0.001		0.0	False		,,,				2504	0.0				p.R124Q		.											.	SCRN2-91	0			c.G371A						.						92.0	91.0	91.0					17																	45916995		2203	4300	6503	SO:0001583	missense	90507	exon4			CTGCTCCGTTCCA	BC002980	CCDS11519.1, CCDS45723.1	17q21	2008-02-05							30381	protein-coding gene	gene with protein product		614966				12221138	Standard	NM_001145023		Approved		uc002imd.3	Q96FV2		ENST00000290216.9:c.371G>A	17.37:g.45916995C>T	ENSP00000290216:p.Arg124Gln	Somatic	142	1		WXS	Illumina GAIIx	Phase_I	123	111	NM_138355	0	0	0	4	4	A8K3N1|B7Z8S7|E9PBV5|Q96AC3|Q9BU04	Missense_Mutation	SNP	ENST00000290216.9	37	CCDS11519.1	.	.	.	.	.	.	.	.	.	.	C	35	5.477535	0.96291	.	.	ENSG00000141295	ENST00000290216;ENST00000407215	T;T	0.24350	1.86;1.86	5.34	5.34	0.76211	.	0.000000	0.85682	D	0.000000	T	0.62392	0.2424	M	0.92833	3.35	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.87578	0.998;0.998;0.998	T	0.72666	-0.4224	10	0.87932	D	0	-39.723	17.8079	0.88607	0.0:1.0:0.0:0.0	.	124;124;124	E9PBV5;Q96FV2;B7Z8S7	.;SCRN2_HUMAN;.	Q	124	ENSP00000290216:R124Q;ENSP00000383935:R124Q	ENSP00000290216:R124Q	R	-	2	0	SCRN2	43271994	1.000000	0.71417	1.000000	0.80357	0.944000	0.59088	7.781000	0.85668	2.504000	0.84457	0.561000	0.74099	CGG	.		0.607	SCRN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000441383.1	NM_138355	
AATK	9625	hgsc.bcm.edu	37	17	79096115	79096115	+	Missense_Mutation	SNP	C	C	T	rs61738821	byFrequency	TCGA-OR-A5KW-01A-11D-A29I-10	TCGA-OR-A5KW-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	67dfc56a-abc7-40c7-a901-6512ec38d5f5	804ec9eb-9f16-4ab9-b2dd-2abb72a53348	g.chr17:79096115C>T	ENST00000326724.4	-	11	1645	c.1621G>A	c.(1621-1623)Gcc>Acc	p.A541T	AATK_ENST00000417379.1_Missense_Mutation_p.A438T|AATK_ENST00000572339.1_5'Flank|MIR657_ENST00000385003.1_RNA	NM_001080395.2	NP_001073864.2	Q6ZMQ8	LMTK1_HUMAN	apoptosis-associated tyrosine kinase	541				A -> T (in Ref. 1; BAD18544). {ECO:0000305}.	brain development (GO:0007420)|negative regulation of axon extension (GO:0030517)|neuron apoptotic process (GO:0051402)|peptidyl-tyrosine autophosphorylation (GO:0038083)|Rab protein signal transduction (GO:0032482)	axonal growth cone (GO:0044295)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|perinuclear region of cytoplasm (GO:0048471)|recycling endosome (GO:0055037)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)|protein tyrosine kinase activity (GO:0004713)			endometrium(2)|kidney(2)|lung(8)|ovary(3)|prostate(1)|stomach(4)|upper_aerodigestive_tract(1)	21	all_neural(118;0.101)		BRCA - Breast invasive adenocarcinoma(99;0.0228)|OV - Ovarian serous cystadenocarcinoma(97;0.0524)			TCGTGGCCGGCGGCGGGTGCG	0.756													C|||	710	0.141773	0.2451	0.0836	5008	,	,		7975	0.0337		0.1342	False		,,,				2504	0.1626				p.A541T		.											.	AATK-933	0			c.G1621A						.						2.0	2.0	2.0					17																	79096115		1391	2783	4174	SO:0001583	missense	9625	exon11			GGCCGGCGGCGGG	AB014541	CCDS45807.1, CCDS58607.1	17q25.3	2014-06-12			ENSG00000181409	ENSG00000181409			21	protein-coding gene	gene with protein product	"""lemur tyrosine kinase 1"", ""protein phosphatase 1, regulatory subunit 77"""	605276				9734811, 10083745	Standard	NM_001080395		Approved	AATYK, KIAA0641, LMTK1, LMR1, AATYK1, PPP1R77	uc010dia.3	Q6ZMQ8	OTTHUMG00000132717	ENST00000326724.4:c.1621G>A	17.37:g.79096115C>T	ENSP00000324196:p.Ala541Thr	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	4	4	NM_001080395	0	0	0	0	0	O75136|Q6ZN31|Q86X28	Missense_Mutation	SNP	ENST00000326724.4	37	CCDS45807.1	322	0.14743589743589744	149	0.30284552845528456	49	0.13535911602209943	11	0.019230769230769232	113	0.14907651715039577	C	10.34	1.324257	0.24080	.	.	ENSG00000181409	ENST00000326724;ENST00000374792	T;T	0.77489	-1.1;-1.09	4.26	3.26	0.37387	.	0.388682	0.24547	N	0.037589	T	0.00012	0.0000	L	0.48642	1.525	0.80722	P	0.0	P	0.45986	0.87	B	0.27608	0.081	T	0.05716	-1.0868	9	0.29301	T	0.29	.	11.2582	0.49067	0.1833:0.8167:0.0:0.0	rs61738821	541	Q6ZMQ8	LMTK1_HUMAN	T	541;505	ENSP00000324196:A541T;ENSP00000363924:A505T	ENSP00000324196:A541T	A	-	1	0	AATK	76710710	0.009000	0.17119	0.030000	0.17652	0.032000	0.12392	0.876000	0.28092	0.731000	0.32448	0.561000	0.74099	GCC	C|0.850;T|0.150		0.756	AATK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256055.1	NM_004920	
TGIF1	7050	broad.mit.edu	37	18	3452223	3452223	+	Frame_Shift_Del	DEL	T	T	-	rs11571510|rs557543525|rs202189171	byFrequency	TCGA-OR-A5KW-01A-11D-A29I-10	TCGA-OR-A5KW-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	67dfc56a-abc7-40c7-a901-6512ec38d5f5	804ec9eb-9f16-4ab9-b2dd-2abb72a53348	g.chr18:3452223delT	ENST00000330513.5	+	1	549	c.246delT	c.(244-246)cctfs	p.P85fs	TGIF1_ENST00000345133.5_Intron|TGIF1_ENST00000401449.1_Intron|TGIF1_ENST00000551541.1_Intron|TGIF1_ENST00000400167.2_5'Flank|TGIF1_ENST00000551402.1_Intron|TGIF1_ENST00000343820.5_Intron|TGIF1_ENST00000548489.2_Intron|TGIF1_ENST00000405385.3_Intron|TGIF1_ENST00000577543.1_Intron|TGIF1_ENST00000407501.2_Intron	NM_170695.2	NP_733796.2	Q15583	TGIF1_HUMAN	TGFB-induced factor homeobox 1	85					determination of left/right symmetry (GO:0007368)|dorsal/ventral pattern formation (GO:0009953)|gene expression (GO:0010467)|multicellular organismal development (GO:0007275)|negative regulation of cell proliferation (GO:0008285)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neural tube closure (GO:0001843)|nodal signaling pathway (GO:0038092)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of neuron differentiation (GO:0045666)|regulation of gastrulation (GO:0010470)|response to drug (GO:0042493)|retina development in camera-type eye (GO:0060041)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	nucleoplasm (GO:0005654)	chromatin binding (GO:0003682)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)	p.P83fs*51(1)		cervix(1)|endometrium(3)|large_intestine(4)|lung(2)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	13	Esophageal squamous(4;0.0859)	Colorectal(8;0.0104)				GCGCCCCCCCTCCTCCACCGG	0.766													T|T|-|deletion	1280	0.255591	0.3419	0.2349	5008	,	,		10884	0.0109		0.4304	False		,,,				2504	0.226				p.P82fs		.											.	TGIF1-227	1	Deletion - Frameshift(1)	large_intestine(1)	c.246delT						.						10.0	11.0	10.0					18																	3452223		2031	3818	5849	SO:0001589	frameshift_variant	7050	exon1			CCCCCCTCCTCCA	X89750	CCDS11832.1, CCDS11833.1, CCDS11834.1, CCDS11835.1	18p11.31	2011-06-20	2007-01-30	2007-01-30	ENSG00000177426	ENSG00000177426		"""Homeoboxes / TALE class"""	11776	protein-coding gene	gene with protein product		602630	"""TGFB-induced factor (TALE family homeobox)"""	HPE4, TGIF		8537382, 10835638	Standard	NM_173211		Approved		uc002klz.3	Q15583	OTTHUMG00000131511	ENST00000330513.5:c.246delT	18.37:g.3452223delT	ENSP00000327959:p.Pro85fs	Somatic	5	0		WXS	Illumina GAIIx	Phase_I	15	7	NM_170695	0	0	0	0	0	A6NE42|A6NLU7|F8VZB6|Q6ICR0|Q8N5X9|Q9NRS0	Frame_Shift_Del	DEL	ENST00000330513.5	37	CCDS11834.1																																																																																			.		0.766	TGIF1-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000254368.4	NM_170695	
ARHGAP28	79822	bcgsc.ca	37	18	6890434	6890434	+	Silent	SNP	A	A	G	rs1116757	byFrequency	TCGA-OR-A5KW-01A-11D-A29I-10	TCGA-OR-A5KW-10A-01D-A29L-10	A	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	67dfc56a-abc7-40c7-a901-6512ec38d5f5	804ec9eb-9f16-4ab9-b2dd-2abb72a53348	g.chr18:6890434A>G	ENST00000383472.4	+	14	1844	c.1740A>G	c.(1738-1740)ccA>ccG	p.P580P	ARHGAP28_ENST00000262227.3_Silent_p.P528P|ARHGAP28_ENST00000400091.2_Silent_p.P580P|ARHGAP28_ENST00000314319.3_Silent_p.P421P|ARHGAP28_ENST00000419673.2_Silent_p.P421P|ARHGAP28_ENST00000532996.1_Silent_p.P403P|ARHGAP28_ENST00000531294.1_Silent_p.P416P|ARHGAP28_ENST00000418986.1_Silent_p.P421P			Q9P2N2	RHG28_HUMAN	Rho GTPase activating protein 28	580					regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cell junction (GO:0030054)|cytosol (GO:0005829)|nucleus (GO:0005634)	GTPase activator activity (GO:0005096)			breast(1)|central_nervous_system(1)|kidney(2)|large_intestine(10)|lung(17)|ovary(1)|pancreas(1)|skin(2)|urinary_tract(2)	37		Colorectal(10;0.168)				TCCAGGTTCCATCTTTCTTAA	0.458													G|||	2820	0.563099	0.5719	0.5331	5008	,	,		19204	0.6052		0.5686	False		,,,				2504	0.5235				p.P421P		.											.	ARHGAP28-91	0			c.A1263G						.	G		2530,1876	540.2+/-375.5	711,1108,384	76.0	74.0	74.0		1263	-7.3	0.4	18	dbSNP_86	74	4832,3768	532.5+/-382.2	1327,2178,795	no	coding-synonymous	ARHGAP28	NM_001010000.2		2038,3286,1179	GG,GA,AA		43.814,42.5783,43.3954		421/571	6890434	7362,5644	2203	4300	6503	SO:0001819	synonymous_variant	79822	exon13			GGTTCCATCTTTC	BC033668	CCDS32785.1	18p11.23	2011-06-29				ENSG00000088756		"""Rho GTPase activating proteins"""	25509	protein-coding gene	gene with protein product		610592				10718198	Standard	NM_001010000		Approved	KIAA1314, FLJ10312	uc002kne.3	Q9P2N2		ENST00000383472.4:c.1740A>G	18.37:g.6890434A>G		Somatic	242	3		WXS	Illumina GAIIx	Phase_I	174	8	NM_001010000	0	0	0	0	0	A8MQB7|A8MU88|Q6P160|Q8N4T3|Q9NW53	Silent	SNP	ENST00000383472.4	37																																																																																				A|0.426;G|0.574		0.458	ARHGAP28-006	NOVEL	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000442123.3	XM_371108	
DSG2	1829	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	18	29102113	29102113	+	Silent	SNP	C	C	G			TCGA-OR-A5KW-01A-11D-A29I-10	TCGA-OR-A5KW-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	67dfc56a-abc7-40c7-a901-6512ec38d5f5	804ec9eb-9f16-4ab9-b2dd-2abb72a53348	g.chr18:29102113C>G	ENST00000261590.8	+	6	800	c.591C>G	c.(589-591)tcC>tcG	p.S197S	DSG2_ENST00000585206.1_Silent_p.S197S	NM_001943.3	NP_001934.2	Q14126	DSG2_HUMAN	desmoglein 2	197	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				apoptotic process (GO:0006915)|bundle of His cell to Purkinje myocyte communication (GO:0086069)|cell adhesion (GO:0007155)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|homophilic cell adhesion (GO:0007156)|maternal process involved in female pregnancy (GO:0060135)|regulation of heart rate by cardiac conduction (GO:0086091)|response to progesterone (GO:0032570)|ventricular cardiac muscle cell action potential (GO:0086005)	apical plasma membrane (GO:0016324)|cell surface (GO:0009986)|cell-cell junction (GO:0005911)|desmosome (GO:0030057)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|lateral plasma membrane (GO:0016328)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(2)|central_nervous_system(6)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(17)|ovary(2)|prostate(4)|skin(2)|urinary_tract(1)	49			OV - Ovarian serous cystadenocarcinoma(10;0.0068)			CGAAAATTTCCTATAGAATCG	0.383																																					p.S197S		.											.	DSG2-563	0			c.C591G						.						99.0	95.0	97.0					18																	29102113		1859	4096	5955	SO:0001819	synonymous_variant	1829	exon6			AATTTCCTATAGA	Z26317	CCDS42423.1	18q12.1	2014-09-17				ENSG00000046604		"""Cadherins / Major cadherins"""	3049	protein-coding gene	gene with protein product		125671				1612610	Standard	NM_001943		Approved	CDHF5	uc002kwu.4	Q14126		ENST00000261590.8:c.591C>G	18.37:g.29102113C>G		Somatic	148	0		WXS	Illumina GAIIx	Phase_I	83	69	NM_001943	0	0	0	0	0	Q4KKU6	Silent	SNP	ENST00000261590.8	37	CCDS42423.1																																																																																			.		0.383	DSG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000447506.1	NM_001943	
ABCA7	10347	hgsc.bcm.edu	37	19	1065044	1065044	+	Silent	SNP	C	C	T	rs4147935	byFrequency	TCGA-OR-A5KW-01A-11D-A29I-10	TCGA-OR-A5KW-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	67dfc56a-abc7-40c7-a901-6512ec38d5f5	804ec9eb-9f16-4ab9-b2dd-2abb72a53348	g.chr19:1065044C>T	ENST00000263094.6	+	46	6390	c.6159C>T	c.(6157-6159)ggC>ggT	p.G2053G	HMHA1_ENST00000539243.2_5'Flank|HMHA1_ENST00000586866.1_5'Flank|HMHA1_ENST00000590214.1_5'Flank|ABCA7_ENST00000433129.1_Silent_p.G2053G|ABCA7_ENST00000435683.2_Silent_p.G1915G|HMHA1_ENST00000313093.2_5'Flank|HMHA1_ENST00000536472.1_5'Flank	NM_019112.3	NP_061985.2	Q8IZY2	ABCA7_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 7	2053					apolipoprotein A-I-mediated signaling pathway (GO:0038027)|ATP catabolic process (GO:0006200)|cholesterol efflux (GO:0033344)|high-density lipoprotein particle assembly (GO:0034380)|memory (GO:0007613)|negative regulation of amyloid precursor protein biosynthetic process (GO:0042985)|negative regulation of ATPase activity (GO:0032780)|negative regulation of beta-amyloid formation (GO:1902430)|peptide cross-linking (GO:0018149)|phagocytosis (GO:0006909)|phospholipid efflux (GO:0033700)|phospholipid scrambling (GO:0017121)|positive regulation of ATPase activity (GO:0032781)|positive regulation of beta-amyloid clearance (GO:1900223)|positive regulation of cholesterol efflux (GO:0010875)|positive regulation of engulfment of apoptotic cell (GO:1901076)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of phagocytosis (GO:0050766)|positive regulation of phospholipid efflux (GO:1902995)|protein localization to nucleus (GO:0034504)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|ATP-binding cassette (ABC) transporter complex (GO:0043190)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|phagocytic cup (GO:0001891)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)	apolipoprotein A-I receptor activity (GO:0034188)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|phospholipid transporter activity (GO:0005548)|transporter activity (GO:0005215)			NS(1)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(7)|lung(22)|ovary(1)|pancreas(7)|prostate(4)|skin(3)|upper_aerodigestive_tract(1)	65		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;1.04e-05)|all_lung(49;1.53e-05)|Breast(49;9.42e-05)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		CACATGGAGGCCGCCTGCGCT	0.736																																					p.G2053G		.											.	ABCA7-98	0			c.C6159T						.	C		327,3757		20,287,1735	5.0	6.0	6.0		6159	1.5	0.8	19	dbSNP_110	6	2858,5242		553,1752,1745	no	coding-synonymous	ABCA7	NM_019112.3		573,2039,3480	TT,TC,CC		35.284,8.0069,26.1408		2053/2147	1065044	3185,8999	2042	4050	6092	SO:0001819	synonymous_variant	10347	exon46			TGGAGGCCGCCTG	AF328787	CCDS12055.1	19p13.3	2012-03-14			ENSG00000064687	ENSG00000064687		"""ATP binding cassette transporters / subfamily A"""	37	protein-coding gene	gene with protein product		605414					Standard	NM_019112		Approved	ABCX	uc002lqw.4	Q8IZY2	OTTHUMG00000167547	ENST00000263094.6:c.6159C>T	19.37:g.1065044C>T		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	12	8	NM_019112	0	0	6	8	2	Q96S58|Q9BZC4|Q9NR73|Q9UKP8	Silent	SNP	ENST00000263094.6	37	CCDS12055.1																																																																																			C|0.766;T|0.234		0.736	ABCA7-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000394993.1	NM_019112	
PGLS	25796	hgsc.bcm.edu	37	19	17622614	17622614	+	Silent	SNP	C	C	T	rs11086075	byFrequency	TCGA-OR-A5KW-01A-11D-A29I-10	TCGA-OR-A5KW-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	67dfc56a-abc7-40c7-a901-6512ec38d5f5	804ec9eb-9f16-4ab9-b2dd-2abb72a53348	g.chr19:17622614C>T	ENST00000252603.2	+	1	177	c.133C>T	c.(133-135)Ctg>Ttg	p.L45L	CTD-3131K8.2_ENST00000596643.1_lincRNA	NM_012088.2	NP_036220.1	O95336	6PGL_HUMAN	6-phosphogluconolactonase	45					carbohydrate metabolic process (GO:0005975)|pentose-phosphate shunt (GO:0006098)|pentose-phosphate shunt, oxidative branch (GO:0009051)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	6-phosphogluconolactonase activity (GO:0017057)|monosaccharide binding (GO:0048029)			endometrium(1)|lung(1)	2						CGCGCTCGGCCTGTCGGGCGG	0.736													C|||	1862	0.371805	0.2496	0.4207	5008	,	,		10575	0.377		0.4851	False		,,,				2504	0.3804				p.L45L		.											.	PGLS-90	0			c.C133T						.	C		662,2504		107,448,1028	2.0	2.0	2.0		133	2.6	1.0	19	dbSNP_120	2	2200,4094		507,1186,1454	no	coding-synonymous	PGLS	NM_012088.2		614,1634,2482	TT,TC,CC		34.9539,20.9097,30.2537		45/259	17622614	2862,6598	1583	3147	4730	SO:0001819	synonymous_variant	25796	exon1			CTCGGCCTGTCGG	AJ243972	CCDS12361.1	19p13.2	2008-02-05				ENSG00000130313	3.1.1.31		8903	protein-coding gene	gene with protein product		604951				10518023	Standard	NM_012088		Approved	6PGL	uc002ngw.3	O95336		ENST00000252603.2:c.133C>T	19.37:g.17622614C>T		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	5	5	NM_012088	0	0	0	27	27		Silent	SNP	ENST00000252603.2	37	CCDS12361.1																																																																																			C|0.617;T|0.383		0.736	PGLS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464154.1		
CILP2	148113	hgsc.bcm.edu	37	19	19651140	19651140	+	Silent	SNP	A	A	G	rs4808970	byFrequency	TCGA-OR-A5KW-01A-11D-A29I-10	TCGA-OR-A5KW-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	67dfc56a-abc7-40c7-a901-6512ec38d5f5	804ec9eb-9f16-4ab9-b2dd-2abb72a53348	g.chr19:19651140A>G	ENST00000291495.5	+	3	376	c.291A>G	c.(289-291)gaA>gaG	p.E97E	CILP2_ENST00000586018.1_Silent_p.E103E	NM_153221.2	NP_694953.2	Q8IUL8	CILP2_HUMAN	cartilage intermediate layer protein 2	97						extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)				NS(1)|breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(3)|lung(17)|ovary(2)|prostate(2)|skin(1)|urinary_tract(1)	32						TGGCGCTGGAAGCGCGCACCA	0.726													A|||	593	0.118411	0.1626	0.1167	5008	,	,		10102	0.0		0.168	False		,,,				2504	0.1309				p.E97E		.											.	CILP2-91	0			c.A291G						.	A		612,3678		42,528,1575	10.0	11.0	11.0		291	3.2	1.0	19	dbSNP_111	11	1223,7149		89,1045,3052	no	coding-synonymous	CILP2	NM_153221.2		131,1573,4627	GG,GA,AA		14.6082,14.2657,14.4922		97/1157	19651140	1835,10827	2145	4186	6331	SO:0001819	synonymous_variant	148113	exon3			GCTGGAAGCGCGC	AF542080	CCDS12405.1	19p13.11	2013-01-14				ENSG00000160161		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	24213	protein-coding gene	gene with protein product		612419				12477932	Standard	NM_153221		Approved	MGC45771	uc002nmv.4	Q8IUL8		ENST00000291495.5:c.291A>G	19.37:g.19651140A>G		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	11	11	NM_153221	0	0	0	0	0	Q6NV88|Q8N4A6|Q8WV21	Silent	SNP	ENST00000291495.5	37	CCDS12405.1																																																																																			A|0.873;G|0.127		0.726	CILP2-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000459738.3	NM_153221	
ERCC2	2068	hgsc.bcm.edu	37	19	45867259	45867259	+	Missense_Mutation	SNP	C	C	T	rs1799793	byFrequency	TCGA-OR-A5KW-01A-11D-A29I-10	TCGA-OR-A5KW-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	67dfc56a-abc7-40c7-a901-6512ec38d5f5	804ec9eb-9f16-4ab9-b2dd-2abb72a53348	g.chr19:45867259C>T	ENST00000391945.4	-	10	1011	c.934G>A	c.(934-936)Gac>Aac	p.D312N	ERCC2_ENST00000221481.6_3'UTR|ERCC2_ENST00000485403.2_Missense_Mutation_p.D288N|ERCC2_ENST00000391944.3_Missense_Mutation_p.D234N|ERCC2_ENST00000391940.4_Missense_Mutation_p.D288N	NM_000400.3	NP_000391.1	P18074	ERCC2_HUMAN	excision repair cross-complementation group 2	312			D -> N (in dbSNP:rs1799793). {ECO:0000269|PubMed:11245433, ECO:0000269|PubMed:11470747, ECO:0000269|PubMed:11709541, ECO:0000269|Ref.3}.		7-methylguanosine mRNA capping (GO:0006370)|aging (GO:0007568)|apoptotic process (GO:0006915)|ATP catabolic process (GO:0006200)|bone mineralization (GO:0030282)|cell proliferation (GO:0008283)|central nervous system myelin formation (GO:0032289)|chromosome segregation (GO:0007059)|DNA duplex unwinding (GO:0032508)|DNA repair (GO:0006281)|embryonic cleavage (GO:0040016)|erythrocyte maturation (GO:0043249)|extracellular matrix organization (GO:0030198)|gene expression (GO:0010467)|hair cell differentiation (GO:0035315)|hair follicle maturation (GO:0048820)|hematopoietic stem cell differentiation (GO:0060218)|in utero embryonic development (GO:0001701)|multicellular organism growth (GO:0035264)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA damage removal (GO:0000718)|nucleotide-excision repair, DNA incision (GO:0033683)|positive regulation of DNA binding (GO:0043388)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of viral transcription (GO:0050434)|post-embryonic development (GO:0009791)|protein phosphorylation (GO:0006468)|regulation of mitotic cell cycle phase transition (GO:1901990)|response to hypoxia (GO:0001666)|response to oxidative stress (GO:0006979)|small molecule metabolic process (GO:0044281)|spinal cord development (GO:0021510)|termination of RNA polymerase I transcription (GO:0006363)|transcription elongation from RNA polymerase I promoter (GO:0006362)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase I promoter (GO:0006360)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase I promoter (GO:0006361)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription-coupled nucleotide-excision repair (GO:0006283)|UV protection (GO:0009650)|viral process (GO:0016032)	cytoplasm (GO:0005737)|holo TFIIH complex (GO:0005675)|MMXD complex (GO:0071817)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle (GO:0005819)	4 iron, 4 sulfur cluster binding (GO:0051539)|5'-3' DNA helicase activity (GO:0043139)|ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|DNA binding (GO:0003677)|DNA-dependent ATPase activity (GO:0008094)|metal ion binding (GO:0046872)|protein C-terminus binding (GO:0008022)|protein N-terminus binding (GO:0047485)			large_intestine(4)|lung(2)|ovary(1)|pancreas(1)|stomach(1)	9		Ovarian(192;0.0728)|all_neural(266;0.112)		OV - Ovarian serous cystadenocarcinoma(262;0.0226)		AGCACTTCGTCGGGCAGCACG	0.746			"""Mis, N, F, S"""			"""skin basal cell, skin squamous cell, melanoma"""		Nucleotide excision repair (NER)	Xeroderma Pigmentosum				C|||	974	0.194489	0.0734	0.1988	5008	,	,		10423	0.0496		0.3588	False		,,,				2504	0.3354				p.D312N		.	yes	Rec		Xeroderma pigmentosum (D)	19	19q13.2-q13.3	2068	"""excision repair cross-complementing rodent repair deficiency, complementation group 2 (xeroderma pigmentosum D)"""		E	.	ERCC2-848	0			c.G934A	GRCh37	CM015299	ERCC2	M	rs1799793	.	C	ASN/ASP,ASN/ASP	387,3577		30,327,1625	5.0	8.0	7.0		934,862	5.2	0.5	19	dbSNP_89	7	2507,5397		444,1619,1889	no	missense,missense	ERCC2	NM_000400.3,NM_001130867.1	23,23	474,1946,3514	TT,TC,CC		31.7181,9.7629,24.3849	benign,benign	312/761,288/406	45867259	2894,8974	1982	3952	5934	SO:0001583	missense	2068	exon10	Familial Cancer Database	incl. XPA, XPB, XPC, XPD, XPE, XPF, XPG, XP Variant, XPV	CTTCGTCGGGCAG		CCDS33049.1, CCDS46112.1	19q13.3	2014-09-17	2014-03-07		ENSG00000104884	ENSG00000104884	3.6.4.12	"""General transcription factor IIH complex subunits"""	3434	protein-coding gene	gene with protein product	"""excision repair cross-complementing rodent repair deficiency, complementation group 2 protein"", ""TFIIH basal transcription factor complex helicase XPB subunit"""	126340	"""xeroderma pigmentosum complementary group D"", ""excision repair cross-complementing rodent repair deficiency, complementation group 2"""	XPD		8413672, 2184031	Standard	NM_000400		Approved	MAG, EM9, MGC102762, MGC126218, MGC126219, TFIIH	uc002pbj.2	P18074	OTTHUMG00000048190	ENST00000391945.4:c.934G>A	19.37:g.45867259C>T	ENSP00000375809:p.Asp312Asn	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	4	4	NM_000400	0	0	0	15	15	Q2TB78|Q2YDY2|Q7KZU6|Q8N721	Missense_Mutation	SNP	ENST00000391945.4	37	CCDS33049.1	423	0.1936813186813187	34	0.06910569105691057	70	0.19337016574585636	38	0.06643356643356643	281	0.370712401055409	C	20.0	3.930510	0.73327	0.097629	0.317181	ENSG00000104884	ENST00000391941;ENST00000391942;ENST00000391945;ENST00000391944;ENST00000391940	T;T;T	0.64438	-0.1;-0.1;-0.1	5.15	5.15	0.70609	Domain of unknown function DUF1227 (1);	0.000000	0.85682	D	0.000000	T	0.00012	0.0000	L	0.46947	1.48	0.09310	P	1.0	B;P;B	0.34639	0.065;0.461;0.053	B;B;B	0.35353	0.059;0.201;0.051	T	0.28267	-1.0049	9	0.33940	T	0.23	-30.0006	16.1268	0.81402	0.0:1.0:0.0:0.0	rs1799793;rs3916814;rs58989209;rs1799793	234;288;312	E7EVE9;Q7KZU6;P18074	.;.;ERCC2_HUMAN	N	262;288;312;234;288	ENSP00000375809:D312N;ENSP00000375808:D234N;ENSP00000375804:D288N	ENSP00000375804:D288N	D	-	1	0	ERCC2	50559099	1.000000	0.71417	0.523000	0.27875	0.865000	0.49528	7.192000	0.77771	2.388000	0.81334	0.561000	0.74099	GAC	C|0.804;T|0.196		0.746	ERCC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109626.2	NM_000400	
PTGIR	5739	hgsc.bcm.edu	37	19	47127324	47127324	+	Silent	SNP	C	C	G	rs2229128	byFrequency	TCGA-OR-A5KW-01A-11D-A29I-10	TCGA-OR-A5KW-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	67dfc56a-abc7-40c7-a901-6512ec38d5f5	804ec9eb-9f16-4ab9-b2dd-2abb72a53348	g.chr19:47127324C>G	ENST00000291294.2	-	2	292	c.159G>C	c.(157-159)gtG>gtC	p.V53V	PTGIR_ENST00000596260.1_Silent_p.V53V|PTGIR_ENST00000594275.1_Intron|PTGIR_ENST00000598865.1_Intron|PTGIR_ENST00000597185.1_Intron	NM_000960.3	NP_000951.1	P43119	PI2R_HUMAN	prostaglandin I2 (prostacyclin) receptor (IP)	53					adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|blood coagulation (GO:0007596)|cell-cell signaling (GO:0007267)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|negative regulation of platelet-derived growth factor receptor signaling pathway (GO:0010642)|negative regulation of smooth muscle cell proliferation (GO:0048662)|positive regulation of cAMP biosynthetic process (GO:0030819)|positive regulation of cAMP-mediated signaling (GO:0043950)|positive regulation of GTPase activity (GO:0043547)|response to lipopolysaccharide (GO:0032496)	cytosol (GO:0005829)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|guanyl-nucleotide exchange factor activity (GO:0005085)			endometrium(1)|kidney(1)|large_intestine(1)|lung(5)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	13		Ovarian(192;0.0129)|all_neural(266;0.0459)|Breast(70;0.212)		OV - Ovarian serous cystadenocarcinoma(262;0.000327)|all cancers(93;0.000641)|Epithelial(262;0.0174)|GBM - Glioblastoma multiforme(486;0.0331)	Dinoprost Tromethamine(DB01160)|Epoprostenol(DB01240)|Iloprost(DB01088)|Treprostinil(DB00374)	CCAGTCCGGTCACCAGCACCG	0.731													G|||	1139	0.227436	0.1362	0.2133	5008	,	,		13968	0.3313		0.2465	False		,,,				2504	0.2342				p.V53V		.											.	PTGIR-522	0			c.G159C						.	G		523,3103		62,399,1352	3.0	5.0	5.0		159	2.2	1.0	19	dbSNP_98	5	1678,5498		231,1216,2141	no	coding-synonymous	PTGIR	NM_000960.3		293,1615,3493	GG,GC,CC		23.3835,14.4236,20.3759		53/387	47127324	2201,8601	1813	3588	5401	SO:0001819	synonymous_variant	5739	exon2			TCCGGTCACCAGC		CCDS12686.1	19q13.3	2012-08-08				ENSG00000160013		"""GPCR / Class A : Prostanoid receptors"""	9602	protein-coding gene	gene with protein product		600022				7759114	Standard	NM_000960		Approved	IP	uc002pex.3	P43119		ENST00000291294.2:c.159G>C	19.37:g.47127324C>G		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	12	12	NM_000960	0	0	0	0	0		Silent	SNP	ENST00000291294.2	37	CCDS12686.1																																																																																			C|0.254;G|0.746		0.731	PTGIR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466581.1		
ELSPBP1	64100	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	19	48525476	48525476	+	Silent	SNP	T	T	C			TCGA-OR-A5KW-01A-11D-A29I-10	TCGA-OR-A5KW-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	67dfc56a-abc7-40c7-a901-6512ec38d5f5	804ec9eb-9f16-4ab9-b2dd-2abb72a53348	g.chr19:48525476T>C	ENST00000339841.2	+	6	742	c.564T>C	c.(562-564)taT>taC	p.Y188Y	ELSPBP1_ENST00000597519.1_Silent_p.Y40Y	NM_022142.4	NP_071425.3	Q96BH3	ESPB1_HUMAN	epididymal sperm binding protein 1	188	Fibronectin type-II 4. {ECO:0000255|PROSITE-ProRule:PRU00479}.				single fertilization (GO:0007338)	extracellular region (GO:0005576)				NS(1)|breast(1)|kidney(1)|large_intestine(1)|lung(6)	10		all_cancers(25;8.7e-09)|all_lung(116;1.15e-06)|all_epithelial(76;1.17e-06)|Lung NSC(112;2.56e-06)|all_neural(266;0.0138)|Ovarian(192;0.0261)|Breast(70;0.203)		OV - Ovarian serous cystadenocarcinoma(262;0.000253)|all cancers(93;0.00129)|Epithelial(262;0.0314)|GBM - Glioblastoma multiforme(486;0.0606)		CGTTCAACTATAAAAACAAGA	0.443																																					p.Y188Y		.											.	ELSPBP1-90	0			c.T564C						.						172.0	157.0	162.0					19																	48525476		2203	4300	6503	SO:0001819	synonymous_variant	64100	exon6			CAACTATAAAAAC	AJ278478	CCDS12708.1	19q13.33	2009-09-17							14417	protein-coding gene	gene with protein product	"""epididymal protein 12"""	607443					Standard	NM_022142		Approved	HE12, E12, EDDM12	uc002pht.3	Q96BH3		ENST00000339841.2:c.564T>C	19.37:g.48525476T>C		Somatic	166	0		WXS	Illumina GAIIx	Phase_I	305	22	NM_022142	0	0	6	6	0	Q96RT0|Q9H4C8	Silent	SNP	ENST00000339841.2	37	CCDS12708.1																																																																																			.		0.443	ELSPBP1-001	KNOWN	upstream_ATG|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465207.1		
NTN5	126147	hgsc.bcm.edu	37	19	49164952	49164952	+	Silent	SNP	A	A	G	rs281392	byFrequency	TCGA-OR-A5KW-01A-11D-A29I-10	TCGA-OR-A5KW-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	67dfc56a-abc7-40c7-a901-6512ec38d5f5	804ec9eb-9f16-4ab9-b2dd-2abb72a53348	g.chr19:49164952A>G	ENST00000270235.4	-	7	1547	c.1452T>C	c.(1450-1452)agT>agC	p.S484S	SEC1P_ENST00000430145.2_RNA	NM_145807.1	NP_665806.1	Q8WTR8	NET5_HUMAN	netrin 5	484						extracellular region (GO:0005576)				central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(4)|pancreas(1)|prostate(1)	10						CCGGCCTGGGACTGGGTGTGG	0.687													G|||	2669	0.532947	0.351	0.4669	5008	,	,		9559	0.5625		0.6421	False		,,,				2504	0.683				p.S484S		.											.	NTN5-136	0			c.T1452C						.	G		1663,2349		390,883,733	9.0	9.0	9.0		1452	2.2	0.0	19	dbSNP_79	9	5217,2785		1816,1585,600	no	coding-synonymous	NTN5	NM_145807.1		2206,2468,1333	GG,GA,AA		34.8038,41.4506,42.7335		484/490	49164952	6880,5134	2006	4001	6007	SO:0001819	synonymous_variant	126147	exon7			CCTGGGACTGGGT		CCDS33068.1	19q13.33	2013-03-01			ENSG00000142233	ENSG00000142233		"""Netrins"""	25208	protein-coding gene	gene with protein product	"""Netrin-5"""					12477932	Standard	NM_145807		Approved		uc002pkb.3	Q8WTR8		ENST00000270235.4:c.1452T>C	19.37:g.49164952A>G		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	6	6	NM_145807	0	0	0	2	2	Q8N4X9|Q8WU63	Silent	SNP	ENST00000270235.4	37	CCDS33068.1																																																																																			A|0.464;G|0.536		0.687	NTN5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466176.1	NM_145807	
HRC	3270	hgsc.bcm.edu	37	19	49657751	49657751	+	Silent	SNP	A	A	G			TCGA-OR-A5KW-01A-11D-A29I-10	TCGA-OR-A5KW-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	67dfc56a-abc7-40c7-a901-6512ec38d5f5	804ec9eb-9f16-4ab9-b2dd-2abb72a53348	g.chr19:49657751A>G	ENST00000252825.4	-	1	930	c.744T>C	c.(742-744)gaT>gaC	p.D248D	HRC_ENST00000595625.1_Silent_p.D248D	NM_002152.2	NP_002143.1	P23327	SRCH_HUMAN	histidine rich calcium binding protein	248	4 X tandem repeats, acidic.|6 X approximate tandem repeats.|Asp-rich (acidic).				cytosolic calcium ion homeostasis (GO:0051480)|muscle contraction (GO:0006936)|positive regulation of heart contraction (GO:0045823)|positive regulation of heart rate (GO:0010460)|positive regulation of relaxation of cardiac muscle (GO:1901899)|regulation of calcium ion transmembrane transport (GO:1903169)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of cell communication by electrical coupling involved in cardiac conduction (GO:1901844)|regulation of heart rate (GO:0002027)|regulation of peptidyl-serine phosphorylation (GO:0033135)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)|regulation of ryanodine-sensitive calcium-release channel activity (GO:0060314)	sarcoplasmic reticulum lumen (GO:0033018)|sarcoplasmic reticulum membrane (GO:0033017)|Z disc (GO:0030018)	ATPase binding (GO:0051117)|calcium ion binding (GO:0005509)|ion channel binding (GO:0044325)	p.D248D(1)		endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(10)|lung(10)|ovary(1)|prostate(3)|urinary_tract(2)	34		all_lung(116;3.16e-06)|Lung NSC(112;6.25e-06)|all_neural(266;0.0189)|Ovarian(192;0.0392)		all cancers(93;2.01e-05)|OV - Ovarian serous cystadenocarcinoma(262;0.00019)|GBM - Glioblastoma multiforme(486;0.00279)|Epithelial(262;0.00622)		catcatcatcatcgtcatctt	0.507																																					p.D248D	Melanoma(37;75 1097 24567 25669 30645)	.											.	HRC-91	1	Substitution - coding silent(1)	large_intestine(1)	c.T744C						.						132.0	95.0	107.0					19																	49657751		2203	4300	6503	SO:0001819	synonymous_variant	3270	exon1			ATCATCATCGTCA		CCDS12759.1	19q13.3	2008-07-16	2001-11-28			ENSG00000130528			5178	protein-coding gene	gene with protein product		142705	"""histidine-rich calcium-binding protein"""			2037293	Standard	XR_243928		Approved	MGC133236	uc002pmv.3	P23327		ENST00000252825.4:c.744T>C	19.37:g.49657751A>G		Somatic	78	0		WXS	Illumina GAIIx	Phase_I	150	13	NM_002152	0	0	0	0	0	Q504Y6	Silent	SNP	ENST00000252825.4	37	CCDS12759.1																																																																																			A|0.998;G|0.002		0.507	HRC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465649.1	NM_002152	
ASPDH	554235	hgsc.bcm.edu	37	19	51015404	51015404	+	Missense_Mutation	SNP	T	T	C	rs12977172	byFrequency	TCGA-OR-A5KW-01A-11D-A29I-10	TCGA-OR-A5KW-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	67dfc56a-abc7-40c7-a901-6512ec38d5f5	804ec9eb-9f16-4ab9-b2dd-2abb72a53348	g.chr19:51015404T>C	ENST00000389208.4	-	6	858	c.797A>G	c.(796-798)cAg>cGg	p.Q266R	JOSD2_ENST00000601423.1_5'Flank|ASPDH_ENST00000597030.1_5'Flank|JOSD2_ENST00000598418.1_5'Flank|JOSD2_ENST00000391815.3_5'Flank|JOSD2_ENST00000595669.1_5'Flank|ASPDH_ENST00000376916.3_Missense_Mutation_p.Q161R	NM_001114598.1	NP_001108070.1	A6ND91	ASPD_HUMAN	aspartate dehydrogenase domain containing	266			Q -> R (in dbSNP:rs12977172). {ECO:0000269|PubMed:15489334, ECO:0000269|Ref.1}.		NAD biosynthetic process (GO:0009435)|NADP catabolic process (GO:0006742)		aspartate dehydrogenase activity (GO:0033735)|NADP binding (GO:0050661)			endometrium(1)|large_intestine(1)|lung(1)	3						CAGGAGGCTCTGCCAGAAGGC	0.706													C|||	3986	0.795927	0.9728	0.7781	5008	,	,		10864	0.7143		0.6849	False		,,,				2504	0.7679				p.Q266R		.											.	ASPDH-90	0			c.A797G						.	C	ARG/GLN,ARG/GLN	3799,331		1771,257,37	6.0	9.0	8.0		482,797	1.9	1.0	19	dbSNP_121	8	5527,2593		1919,1689,452	no	missense,missense	ASPDH	NM_001024656.2,NM_001114598.1	43,43	3690,1946,489	CC,CT,TT		31.9335,8.0145,23.8694	benign,benign	161/179,266/284	51015404	9326,2924	2065	4060	6125	SO:0001583	missense	554235	exon6			AGGCTCTGCCAGA		CCDS33082.1, CCDS46153.1	19q13.33	2012-10-02			ENSG00000204653	ENSG00000204653			33856	protein-coding gene	gene with protein product							Standard	NM_001024656		Approved		uc010enz.3	A6ND91		ENST00000389208.4:c.797A>G	19.37:g.51015404T>C	ENSP00000373860:p.Gln266Arg	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	22	22	NM_001114598	0	0	0	1	1	Q6NZ37	Missense_Mutation	SNP	ENST00000389208.4	37	CCDS46153.1	1681	0.7696886446886447	481	0.9776422764227642	273	0.7541436464088398	412	0.7202797202797203	515	0.679419525065963	C	3.606	-0.080592	0.07141	0.919855	0.680665	ENSG00000204653	ENST00000376916;ENST00000389208	T;T	0.39997	1.05;1.05	2.95	1.88	0.25563	Aspartate dehydrogenase (1);	1.158050	0.06646	N	0.761872	T	0.00012	0.0000	N	0.01705	-0.755	0.80722	P	0.0	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.0	T	0.30794	-0.9966	9	0.06099	T	0.92	-1.7519	4.8935	0.13738	0.0:0.6813:0.0:0.3187	rs12977172	266;161	A6ND91;A6ND91-2	ASPD_HUMAN;.	R	161;266	ENSP00000366114:Q161R;ENSP00000373860:Q266R	ENSP00000366114:Q161R	Q	-	2	0	ASPDH	55707216	0.916000	0.31088	0.989000	0.46669	0.553000	0.35397	0.171000	0.16685	0.125000	0.18397	-0.355000	0.07637	CAG	T|0.228;C|0.772		0.706	ASPDH-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464861.1	NM_001024656	
ZNF808	388558	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	53058713	53058713	+	Silent	SNP	A	A	G			TCGA-OR-A5KW-01A-11D-A29I-10	TCGA-OR-A5KW-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	67dfc56a-abc7-40c7-a901-6512ec38d5f5	804ec9eb-9f16-4ab9-b2dd-2abb72a53348	g.chr19:53058713A>G	ENST00000359798.4	+	5	2724	c.2544A>G	c.(2542-2544)aaA>aaG	p.K848K		NM_001039886.3	NP_001034975.2	Q8N4W9	ZN808_HUMAN	zinc finger protein 808	848					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(8)|kidney(3)|lung(12)|urinary_tract(1)	24				OV - Ovarian serous cystadenocarcinoma(262;0.00501)|GBM - Glioblastoma multiforme(134;0.0213)		AACCTTACAAATGTGAAGCAT	0.368																																					p.K848K		.											.	.	0			c.A2544G						.						91.0	95.0	94.0					19																	53058713		2203	4300	6503	SO:0001819	synonymous_variant	388558	exon5			TTACAAATGTGAA	CR749856	CCDS46167.1	19q13.41	2013-01-08			ENSG00000198482	ENSG00000198482		"""Zinc fingers, C2H2-type"", ""-"""	33230	protein-coding gene	gene with protein product							Standard	NM_001039886		Approved		uc010epq.1	Q8N4W9	OTTHUMG00000158230	ENST00000359798.4:c.2544A>G	19.37:g.53058713A>G		Somatic	52	0		WXS	Illumina GAIIx	Phase_I	108	39	NM_001039886	0	0	4	4	0	Q68CN7	Silent	SNP	ENST00000359798.4	37	CCDS46167.1																																																																																			.		0.368	ZNF808-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350447.3	NM_001039886	
ZNF787	126208	hgsc.bcm.edu	37	19	56599438	56599440	+	In_Frame_Del	DEL	TCG	TCG	-	rs5828672|rs71696054	byFrequency	TCGA-OR-A5KW-01A-11D-A29I-10	TCGA-OR-A5KW-10A-01D-A29L-10	TCG	TCG	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	67dfc56a-abc7-40c7-a901-6512ec38d5f5	804ec9eb-9f16-4ab9-b2dd-2abb72a53348	g.chr19:56599438_56599440delTCG	ENST00000270459.3	-	3	1219_1221	c.1101_1103delCGA	c.(1099-1104)gacgag>gag	p.D367del		NM_001002836.2	NP_001002836	Q6DD87	ZN787_HUMAN	zinc finger protein 787	367					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(1)|lung(2)|pancreas(1)	5		Colorectal(82;3.46e-05)|Ovarian(87;0.0822)|Renal(1328;0.157)		GBM - Glioblastoma multiforme(193;0.0559)		GCCCGCGGCCTCGTCGTCGTCGT	0.778														4509	0.900359	0.9939	0.732	5008	,	,		3238	0.7252		0.9821	False		,,,				2504	0.9898				p.367_368del		.											.	ZNF787-69	0			c.1101_1103del						.																																			SO:0001651	inframe_deletion	126208	exon3			GCGGCCTCGTCGT	BC077728, AF000560	CCDS42634.1	19q13.42	2013-01-08				ENSG00000142409		"""Zinc fingers, C2H2-type"""	26998	protein-coding gene	gene with protein product							Standard	NM_001002836		Approved		uc010eth.1	Q6DD87		ENST00000270459.3:c.1101_1103delCGA	19.37:g.56599447_56599449delTCG	ENSP00000270459:p.Asp367del	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	10	10	NM_001002836	0	0	0	0	0	O00455	In_Frame_Del	DEL	ENST00000270459.3	37	CCDS42634.1																																																																																			.		0.778	ZNF787-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000457498.1	NM_001002836	
SNTG2	54221	bcgsc.ca	37	2	1271230	1271230	+	Missense_Mutation	SNP	A	A	G	rs13023962	byFrequency	TCGA-OR-A5KW-01A-11D-A29I-10	TCGA-OR-A5KW-10A-01D-A29L-10	A	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	67dfc56a-abc7-40c7-a901-6512ec38d5f5	804ec9eb-9f16-4ab9-b2dd-2abb72a53348	g.chr2:1271230A>G	ENST00000308624.5	+	14	1300	c.1171A>G	c.(1171-1173)Atc>Gtc	p.I391V	SNTG2_ENST00000407292.1_Missense_Mutation_p.I264V	NM_018968.3	NP_061841.2	Q9NY99	SNTG2_HUMAN	syntrophin, gamma 2	391	PH.		I -> V (in dbSNP:rs13023962).		central nervous system development (GO:0007417)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|syntrophin complex (GO:0016013)	PDZ domain binding (GO:0030165)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(9)|lung(20)|ovary(1)|pancreas(1)|prostate(2)|skin(2)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	52	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.0797)	all_cancers(51;0.00469)		all cancers(51;0.0178)|OV - Ovarian serous cystadenocarcinoma(76;0.07)|Epithelial(75;0.0864)|GBM - Glioblastoma multiforme(21;0.173)		TTGCTTCAGCATCGTGGCCGG	0.517													G|||	1803	0.360024	0.5015	0.232	5008	,	,		17276	0.3204		0.2515	False		,,,				2504	0.4121				p.I391V		.											.	SNTG2-136	0			c.A1171G						.	G	VAL/ILE	1707,2159		401,905,627	53.0	52.0	53.0		1171	1.7	0.0	2	dbSNP_121	53	1994,6276		238,1518,2379	yes	missense	SNTG2	NM_018968.3	29	639,2423,3006	GG,GA,AA		24.1112,44.1542,30.496	benign	391/540	1271230	3701,8435	1933	4135	6068	SO:0001583	missense	54221	exon14			TTCAGCATCGTGG	AJ003029	CCDS46220.1	2p25	2008-05-23			ENSG00000172554	ENSG00000172554			13741	protein-coding gene	gene with protein product		608715				10747910	Standard	NM_018968		Approved	SYN5, G2SYN	uc002qwq.3	Q9NY99	OTTHUMG00000151370	ENST00000308624.5:c.1171A>G	2.37:g.1271230A>G	ENSP00000311837:p.Ile391Val	Somatic	182	0		WXS	Illumina GAIIx	Phase_I	225	7	NM_018968	0	0	0	0	0	Q05AH5	Missense_Mutation	SNP	ENST00000308624.5	37	CCDS46220.1	660	0.3021978021978022	217	0.4410569105691057	76	0.20994475138121546	177	0.3094405594405594	190	0.25065963060686014	G	0	-2.618827	0.00118	0.441542	0.241112	ENSG00000172554	ENST00000308624;ENST00000407292	T;T	0.68765	1.34;-0.35	4.61	1.67	0.24075	Pleckstrin homology domain (1);	0.208918	0.41097	N	0.000951	T	0.00012	0.0000	N	0.00387	-1.565	0.46774	P	8.010000000000517E-4	B;B	0.06786	0.001;0.0	B;B	0.06405	0.002;0.0	T	0.38308	-0.9667	9	0.02654	T	1	.	5.3079	0.15813	0.2331:0.2745:0.4924:0.0	rs13023962;rs60136596	264;391	Q9NY99-2;Q9NY99	.;SNTG2_HUMAN	V	391;264	ENSP00000311837:I391V;ENSP00000385020:I264V	ENSP00000311837:I391V	I	+	1	0	SNTG2	1253811	0.999000	0.42202	0.047000	0.18901	0.028000	0.11728	1.877000	0.39598	-0.223000	0.09943	-0.733000	0.03571	ATC	A|0.705;G|0.295		0.517	SNTG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000322454.1	NM_018968	
TPO	7173	hgsc.bcm.edu	37	2	1481231	1481231	+	Missense_Mutation	SNP	G	G	C	rs2175977	byFrequency	TCGA-OR-A5KW-01A-11D-A29I-10	TCGA-OR-A5KW-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	67dfc56a-abc7-40c7-a901-6512ec38d5f5	804ec9eb-9f16-4ab9-b2dd-2abb72a53348	g.chr2:1481231G>C	ENST00000345913.4	+	8	1284	c.1193G>C	c.(1192-1194)aGc>aCc	p.S398T	TPO_ENST00000346956.3_Missense_Mutation_p.S398T|TPO_ENST00000349624.3_Intron|TPO_ENST00000329066.4_Missense_Mutation_p.S398T|TPO_ENST00000382201.3_Missense_Mutation_p.S398T|TPO_ENST00000497517.2_Intron|TPO_ENST00000382198.1_Intron|TPO_ENST00000337415.3_Missense_Mutation_p.S398T	NM_000547.5	NP_000538.3	P07202	PERT_HUMAN	thyroid peroxidase	398			S -> T (in dbSNP:rs2175977). {ECO:0000269|PubMed:7550241}.		cellular nitrogen compound metabolic process (GO:0034641)|embryonic hemopoiesis (GO:0035162)|hormone biosynthetic process (GO:0042446)|hydrogen peroxide catabolic process (GO:0042744)|small molecule metabolic process (GO:0044281)|thyroid hormone generation (GO:0006590)	extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|heme binding (GO:0020037)|iodide peroxidase activity (GO:0004447)|peroxidase activity (GO:0004601)			breast(1)|central_nervous_system(3)|endometrium(8)|kidney(4)|large_intestine(14)|liver(2)|lung(33)|ovary(8)|pancreas(6)|prostate(4)|skin(7)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	95	all_hematologic(175;0.0487)|Acute lymphoblastic leukemia(172;0.0627)	all_cancers(51;0.0338)		all cancers(51;0.0356)|OV - Ovarian serous cystadenocarcinoma(76;0.0748)|Epithelial(75;0.12)	Carbimazole(DB00389)|Dextrothyroxine(DB00509)|Methimazole(DB00763)|Propylthiouracil(DB00550)	GGCCGCGCCAGCGAGGTCCCC	0.761													G|||	3557	0.710264	0.8185	0.6571	5008	,	,		9157	0.7758		0.6034	False		,,,				2504	0.6442				p.S398T		.											.	TPO-332	0			c.G1193C						.	G	THR/SER,THR/SER,THR/SER,THR/SER,THR/SER,	2498,394		1072,354,20	2.0	2.0	2.0		1193,1193,1193,1193,1193,	4.1	1.0	2	dbSNP_96	2	4199,1477		1511,1177,150	no	missense,missense,missense,missense,missense,intron	TPO	NM_000547.5,NM_001206744.1,NM_001206745.1,NM_175719.3,NM_175721.3,NM_175722.3	58,58,58,58,58,	2583,1531,170	CC,CG,GG		26.0218,13.6238,21.8371	probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging,	398/934,398/934,398/877,398/877,398/890,	1481231	6697,1871	1446	2838	4284	SO:0001583	missense	7173	exon8			GCGCCAGCGAGGT		CCDS1643.1, CCDS1644.1, CCDS1646.1	2p25	2008-02-05			ENSG00000115705	ENSG00000115705	1.11.1.7		12015	protein-coding gene	gene with protein product		606765					Standard	NM_175722		Approved	TPX	uc002qww.3	P07202	OTTHUMG00000090271	ENST00000345913.4:c.1193G>C	2.37:g.1481231G>C	ENSP00000318820:p.Ser398Thr	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	4	4	NM_175719	0	0	0	0	0	P09934|P09935|Q8IUL0|Q8NF94|Q8NF95|Q8NF96|Q8NF97|Q8TCI9	Missense_Mutation	SNP	ENST00000345913.4	37	CCDS1643.1	1512|1512	0.6923076923076923|0.6923076923076923	388|388	0.7886178861788617|0.7886178861788617	227|227	0.6270718232044199|0.6270718232044199	438|438	0.7657342657342657|0.7657342657342657	459|459	0.6055408970976254|0.6055408970976254	G|G	18.72|18.72	3.683431|3.683431	0.68157|0.68157	0.863762|0.863762	0.739782|0.739782	ENSG00000115705|ENSG00000115705	ENST00000536482|ENST00000337415;ENST00000345913;ENST00000346956;ENST00000329066;ENST00000382201;ENST00000422464	.|T;T;T;T;T;T	.|0.73897	.|-0.79;-0.79;-0.79;-0.79;-0.79;-0.79	4.99|4.99	4.08|4.08	0.47627|0.47627	.|.	.|0.142496	.|0.64402	.|N	.|0.000004	T|T	0.00012|0.00012	0.0000|0.0000	M|M	0.62723|0.62723	1.935|1.935	0.09310|0.09310	P|P	1.0|1.0	.|D;D;D	.|0.76494	.|0.998;0.998;0.999	.|D;D;D	.|0.69654	.|0.956;0.94;0.965	T|T	0.30060|0.30060	-0.9991|-0.9991	5|9	0.48119|0.56958	T|D	0.1|0.05	-48.0867|-48.0867	8.6411|8.6411	0.33978|0.33978	0.08:0.1541:0.7659:0.0|0.08:0.1541:0.7659:0.0	rs2175977|rs2175977	.|398;398;398	.|P07202-4;P07202-2;P07202	.|.;.;PERT_HUMAN	H|T	81|398;398;398;398;398;327	.|ENSP00000337263:S398T;ENSP00000318820:S398T;ENSP00000263886:S398T;ENSP00000329869:S398T;ENSP00000371636:S398T;ENSP00000405788:S327T	ENSP00000439133:Q81H|ENSP00000329869:S398T	Q|S	+|+	3|2	2|0	TPO|TPO	1460238|1460238	0.956000|0.956000	0.32656|0.32656	1.000000|1.000000	0.80357|0.80357	0.986000|0.986000	0.74619|0.74619	1.297000|1.297000	0.33400|0.33400	1.031000|1.031000	0.39867|0.39867	0.460000|0.460000	0.39030|0.39030	CAG|AGC	G|0.301;C|0.699		0.761	TPO-202	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000206594.2	NM_000547	
C2orf81	388963	broad.mit.edu	37	2	74642280	74642280	+	Missense_Mutation	SNP	T	T	G			TCGA-OR-A5KW-01A-11D-A29I-10	TCGA-OR-A5KW-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	67dfc56a-abc7-40c7-a901-6512ec38d5f5	804ec9eb-9f16-4ab9-b2dd-2abb72a53348	g.chr2:74642280T>G	ENST00000517883.1	-	1	1430	c.739A>C	c.(739-741)Acc>Ccc	p.T247P	C2orf81_ENST00000290390.5_Missense_Mutation_p.T315P			A6NN90	CB081_HUMAN	chromosome 2 open reading frame 81	308										endometrium(3)|kidney(1)	4						GAGGGGCGGGTGGCGCCGCCC	0.716																																					p.T315P		.											.	.	0			c.A943C						.						7.0	10.0	9.0					2																	74642280		682	1575	2257	SO:0001583	missense	388963	exon4			GGCGGGTGGCGCC	AC005041, CH471053		2p13.1	2012-08-07			ENSG00000159239	ENSG00000159239			34350	protein-coding gene	gene with protein product						15815621	Standard	NM_001145054		Approved	LOC388963, hCG40743	uc010yrq.1	A6NN90	OTTHUMG00000164184	ENST00000517883.1:c.739A>C	2.37:g.74642280T>G	ENSP00000431103:p.Thr247Pro	Somatic	34	3		WXS	Illumina GAIIx	Phase_I	83	24	NM_001145054	0	0	1	1	0		Missense_Mutation	SNP	ENST00000517883.1	37		.	.	.	.	.	.	.	.	.	.	t	12.14	1.849844	0.32699	.	.	ENSG00000159239	ENST00000517883;ENST00000290390	.	.	.	3.91	-3.99	0.04069	.	1.321610	0.05237	N	0.511487	T	0.30135	0.0755	L	0.44542	1.39	0.09310	N	1	B	0.19073	0.033	B	0.22601	0.04	T	0.39396	-0.9616	9	0.72032	D	0.01	-3.9874	1.2321	0.01946	0.1409:0.2887:0.2874:0.283	.	315	G3XAA6	.	P	247;315	.	ENSP00000290390:T315P	T	-	1	0	C2orf81	74495788	0.007000	0.16637	0.000000	0.03702	0.008000	0.06430	0.309000	0.19332	-0.435000	0.07264	0.454000	0.30748	ACC	.		0.716	C2orf81-002	PUTATIVE	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000377683.1	NM_001145054	
CXCR4	7852	broad.mit.edu	37	2	136872768	136872768	+	Frame_Shift_Del	DEL	G	G	-			TCGA-OR-A5KW-01A-11D-A29I-10	TCGA-OR-A5KW-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	67dfc56a-abc7-40c7-a901-6512ec38d5f5	804ec9eb-9f16-4ab9-b2dd-2abb72a53348	g.chr2:136872768delG	ENST00000241393.3	-	2	834	c.730delC	c.(730-732)ctcfs	p.L244fs	CXCR4_ENST00000466288.1_5'UTR|CXCR4_ENST00000409817.1_Frame_Shift_Del_p.L248fs	NM_003467.2	NP_003458.1	P61073	CXCR4_HUMAN	chemokine (C-X-C motif) receptor 4	244				VIL -> IIP (in Ref. 12; AAK29630). {ECO:0000305}.	activation of MAPK activity (GO:0000187)|ameboidal cell migration (GO:0001667)|apoptotic process (GO:0006915)|brain development (GO:0007420)|calcium-mediated signaling (GO:0019722)|cellular response to cytokine stimulus (GO:0071345)|chemokine-mediated signaling pathway (GO:0070098)|dendritic cell chemotaxis (GO:0002407)|entry into host cell (GO:0030260)|G-protein coupled receptor signaling pathway (GO:0007186)|germ cell development (GO:0007281)|germ cell migration (GO:0008354)|inflammatory response (GO:0006954)|motor neuron axon guidance (GO:0008045)|myelin maintenance (GO:0043217)|neural precursor cell proliferation (GO:0061351)|neuron migration (GO:0001764)|neutrophil activation (GO:0042119)|patterning of blood vessels (GO:0001569)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of oligodendrocyte differentiation (GO:0048714)|regulation of cell migration (GO:0030334)|regulation of chemotaxis (GO:0050920)|response to hypoxia (GO:0001666)|response to virus (GO:0009615)|T cell proliferation (GO:0042098)|viral process (GO:0016032)	cell leading edge (GO:0031252)|cell surface (GO:0009986)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytoplasmic vesicle (GO:0031410)|early endosome (GO:0005769)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|growth cone (GO:0030426)|integral component of membrane (GO:0016021)|late endosome (GO:0005770)|lysosome (GO:0005764)|plasma membrane (GO:0005886)	actin binding (GO:0003779)|C-X-C chemokine receptor activity (GO:0016494)|coreceptor activity (GO:0015026)|G-protein coupled receptor activity (GO:0004930)|myosin light chain binding (GO:0032027)|ubiquitin binding (GO:0043130)|ubiquitin protein ligase binding (GO:0031625)|virus receptor activity (GO:0001618)			haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(14)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	25				BRCA - Breast invasive adenocarcinoma(221;0.155)	Framycetin(DB00452)|Plerixafor(DB06809)	GCCAGGATGAGGATGACTGTG	0.512																																					p.L248fs		.											.	CXCR4-1082	0			c.742delC						.						177.0	163.0	168.0					2																	136872768		2203	4300	6503	SO:0001589	frameshift_variant	7852	exon1			GGATGAGGATGAC	AF005058	CCDS33295.1, CCDS46420.1	2q21	2014-09-17	2002-08-22		ENSG00000121966	ENSG00000121966		"""CD molecules"", ""GPCR / Class A : Chemokine receptors : C-X-C motif"""	2561	protein-coding gene	gene with protein product		162643	"""chemokine (C-X-C motif), receptor 4 (fusin)"""			9599023, 9379028	Standard	NM_001008540		Approved	LESTR, NPY3R, HM89, NPYY3R, D2S201E, fusin, HSY3RR, NPYR, CD184	uc002tuz.3	P61073	OTTHUMG00000153583	ENST00000241393.3:c.730delC	2.37:g.136872768delG	ENSP00000241393:p.Leu244fs	Somatic	208	0		WXS	Illumina GAIIx	Phase_I	188	8	NM_001008540	0	0	0	0	0	B2R5N0|O60835|P30991|P56438|Q53S69|Q9BXA0|Q9UKN2	Frame_Shift_Del	DEL	ENST00000241393.3	37	CCDS46420.1																																																																																			.		0.512	CXCR4-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000331732.1		
ITGB6	3694	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	2	160994644	160994644	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5KW-01A-11D-A29I-10	TCGA-OR-A5KW-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	67dfc56a-abc7-40c7-a901-6512ec38d5f5	804ec9eb-9f16-4ab9-b2dd-2abb72a53348	g.chr2:160994644C>T	ENST00000283249.2	-	9	1411	c.1174G>A	c.(1174-1176)Gcc>Acc	p.A392T	ITGB6_ENST00000409872.1_Missense_Mutation_p.A392T|ITGB6_ENST00000409967.2_Missense_Mutation_p.A392T|ITGB6_ENST00000428609.2_Missense_Mutation_p.A350T	NM_001282353.1|NM_001282354.1|NM_001282388.1	NP_001269282.1|NP_001269283.1|NP_001269317.1	P18564	ITB6_HUMAN	integrin, beta 6	392					cell adhesion (GO:0007155)|cell-matrix adhesion (GO:0007160)|extracellular matrix organization (GO:0030198)|inflammatory response (GO:0006954)|integrin-mediated signaling pathway (GO:0007229)|multicellular organismal development (GO:0007275)|viral process (GO:0016032)	external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integrin complex (GO:0008305)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	virus receptor activity (GO:0001618)			breast(1)|endometrium(1)|kidney(2)|large_intestine(8)|lung(7)|ovary(1)|pancreas(1)|prostate(1)|skin(1)	23						TTACAGATGGCTGTAAATGAC	0.428																																					p.A392T		.											.	ITGB6-227	0			c.G1174A						.						265.0	223.0	237.0					2																	160994644		2203	4300	6503	SO:0001583	missense	3694	exon9			AGATGGCTGTAAA		CCDS2212.1, CCDS63040.1, CCDS74596.1, CCDS74597.1	2q24.2	2010-03-23			ENSG00000115221	ENSG00000115221		"""Integrins"""	6161	protein-coding gene	gene with protein product		147558				1729173, 8120056	Standard	NM_001282353		Approved		uc002ubh.2	P18564	OTTHUMG00000132026	ENST00000283249.2:c.1174G>A	2.37:g.160994644C>T	ENSP00000283249:p.Ala392Thr	Somatic	221	0		WXS	Illumina GAIIx	Phase_I	175	15	NM_000888	0	0	0	0	0	B2R9W5|C9JA97|Q0VA95|Q16500|Q53RG5|Q53RR6	Missense_Mutation	SNP	ENST00000283249.2	37	CCDS2212.1	.	.	.	.	.	.	.	.	.	.	C	15.72	2.917390	0.52546	.	.	ENSG00000115221	ENST00000283249;ENST00000428609;ENST00000409967;ENST00000409872	T;T;T;T	0.64618	-0.11;-0.11;-0.11;-0.11	5.3	4.38	0.52667	Integrin beta subunit, N-terminal (2);	0.057596	0.64402	D	0.000002	T	0.55862	0.1947	L	0.43646	1.37	0.54753	D	0.999981	B;B	0.26577	0.153;0.153	B;B	0.24848	0.056;0.056	T	0.59332	-0.7474	10	0.62326	D	0.03	.	15.8753	0.79156	0.1356:0.8644:0.0:0.0	.	350;392	E9PEE8;P18564	.;ITB6_HUMAN	T	392;350;392;392	ENSP00000283249:A392T;ENSP00000408024:A350T;ENSP00000386828:A392T;ENSP00000386367:A392T	ENSP00000283249:A392T	A	-	1	0	ITGB6	160702890	0.900000	0.30661	0.985000	0.45067	0.649000	0.38597	1.856000	0.39389	2.648000	0.89879	0.650000	0.86243	GCC	.		0.428	ITGB6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255036.1	NM_000888	
SCRN3	79634	bcgsc.ca	37	2	175263063	175263063	+	Missense_Mutation	SNP	G	G	A	rs10497410	byFrequency	TCGA-OR-A5KW-01A-11D-A29I-10	TCGA-OR-A5KW-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	67dfc56a-abc7-40c7-a901-6512ec38d5f5	804ec9eb-9f16-4ab9-b2dd-2abb72a53348	g.chr2:175263063G>A	ENST00000272732.6	+	2	134	c.52G>A	c.(52-54)Gat>Aat	p.D18N	SCRN3_ENST00000409673.3_Intron|CIR1_ENST00000362053.5_5'Flank|CIR1_ENST00000342016.3_5'Flank	NM_001193528.1|NM_024583.4	NP_001180457.1|NP_078859.2	Q0VDG4	SCRN3_HUMAN	secernin 3	18			D -> N (in dbSNP:rs10497410).				dipeptidase activity (GO:0016805)			endometrium(1)|kidney(1)|large_intestine(1)|lung(6)|ovary(1)|urinary_tract(3)	13			OV - Ovarian serous cystadenocarcinoma(117;0.229)			AGCAACAGTCGATAACAGGAT	0.333													G|||	426	0.0850639	0.0121	0.1556	5008	,	,		14445	0.006		0.2127	False		,,,				2504	0.0838				p.D18N		.											.	SCRN3-91	0			c.G52A						.	G	,ASN/ASP	203,4203	117.1+/-155.0	6,191,2006	108.0	115.0	113.0		,52	4.2	0.0	2	dbSNP_119	113	1948,6652	338.3+/-322.7	224,1500,2576	yes	intron,missense	SCRN3	NM_001193528.1,NM_024583.4	,23	230,1691,4582	AA,AG,GG		22.6512,4.6074,16.5385	,benign	,18/425	175263063	2151,10855	2203	4300	6503	SO:0001583	missense	79634	exon2			ACAGTCGATAACA	AF279776	CCDS2258.1, CCDS54420.1	2q31	2008-02-05			ENSG00000144306	ENSG00000144306			30382	protein-coding gene	gene with protein product		614967				12221138	Standard	NM_024583		Approved	FLJ23142	uc002uiq.3	Q0VDG4	OTTHUMG00000132332	ENST00000272732.6:c.52G>A	2.37:g.175263063G>A	ENSP00000272732:p.Asp18Asn	Somatic	51	0		WXS	Illumina GAIIx	Phase_I	40	4	NM_024583	0	0	5	5	0	B4DI11|C9JPC1|D3DPE0|Q7L1C5|Q9H5R5	Missense_Mutation	SNP	ENST00000272732.6	37	CCDS2258.1	229	0.10485347985347986	7	0.014227642276422764	61	0.1685082872928177	4	0.006993006993006993	157	0.20712401055408972	G	11.60	1.686750	0.29962	0.046074	0.226512	ENSG00000144306	ENST00000458563;ENST00000272732;ENST00000424069;ENST00000427038;ENST00000548031	T;T;T;T;T	0.29917	2.16;3.01;1.55;1.55;2.16	6.06	4.25	0.50352	.	0.404667	0.31347	N	0.007802	T	0.00012	0.0000	L	0.35723	1.085	0.53005	P	3.2999999999949736E-5	P	0.36249	0.545	B	0.28784	0.094	T	0.28744	-1.0034	9	0.10377	T	0.69	0.007	12.0732	0.53628	0.0657:0.1212:0.8131:0.0	rs10497410;rs17255662;rs52797928;rs57473616;rs10497410	18	Q0VDG4	SCRN3_HUMAN	N	18	ENSP00000396884:D18N;ENSP00000272732:D18N;ENSP00000402086:D18N;ENSP00000408376:D18N;ENSP00000446727:D18N	ENSP00000272732:D18N	D	+	1	0	SCRN3	174971309	1.000000	0.71417	0.024000	0.17045	0.978000	0.69477	6.412000	0.73303	0.881000	0.35993	0.643000	0.83706	GAT	G|0.866;A|0.134		0.333	SCRN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255451.2	NM_024583	
PDE11A	50940	bcgsc.ca	37	2	178762824	178762824	+	Silent	SNP	T	T	C	rs71423514	byFrequency	TCGA-OR-A5KW-01A-11D-A29I-10	TCGA-OR-A5KW-10A-01D-A29L-10	T	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	67dfc56a-abc7-40c7-a901-6512ec38d5f5	804ec9eb-9f16-4ab9-b2dd-2abb72a53348	g.chr2:178762824T>C	ENST00000286063.6	-	4	1580	c.1263A>G	c.(1261-1263)gaA>gaG	p.E421E	PDE11A_ENST00000449286.2_Silent_p.E63E|PDE11A_ENST00000497003.1_5'UTR|PDE11A_ENST00000358450.4_Silent_p.E171E|PDE11A_ENST00000409504.1_Silent_p.E63E	NM_016953.3	NP_058649.3	Q9HCR9	PDE11_HUMAN	phosphodiesterase 11A	421	GAF 2.				blood coagulation (GO:0007596)|cAMP catabolic process (GO:0006198)|cGMP catabolic process (GO:0046069)|signal transduction (GO:0007165)	cytosol (GO:0005829)|perikaryon (GO:0043204)	3',5'-cyclic-GMP phosphodiesterase activity (GO:0047555)|3',5'-cyclic-nucleotide phosphodiesterase activity (GO:0004114)|cAMP binding (GO:0030552)|cGMP binding (GO:0030553)|cGMP-stimulated cyclic-nucleotide phosphodiesterase activity (GO:0004118)|cyclic-nucleotide phosphodiesterase activity (GO:0004112)|metal ion binding (GO:0046872)			breast(2)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(13)|lung(28)|ovary(4)|skin(3)|upper_aerodigestive_tract(3)	58			OV - Ovarian serous cystadenocarcinoma(117;0.00121)|Epithelial(96;0.00455)|all cancers(119;0.02)		Caffeine(DB00201)|Tadalafil(DB00820)	CAGAACAGCGTTCACATTTCA	0.378									Primary Pigmented Nodular Adrenocortical Disease, Familial				T|||	301	0.0601038	0.0061	0.0735	5008	,	,		15586	0.0149		0.1362	False		,,,				2504	0.092				p.E421E		.											.	PDE11A-93	0			c.A1263G						.	T	,,	137,4269	98.0+/-136.7	4,129,2070	142.0	134.0	137.0		513,189,1263	1.7	1.0	2	dbSNP_130	137	1324,7276	260.3+/-283.2	92,1140,3068	no	coding-synonymous,coding-synonymous,coding-synonymous	PDE11A	NM_001077197.1,NM_001077358.1,NM_016953.3	,,	96,1269,5138	CC,CT,TT		15.3953,3.1094,11.2333	,,	171/684,63/576,421/934	178762824	1461,11545	2203	4300	6503	SO:0001819	synonymous_variant	50940	exon4	Familial Cancer Database	iPPNAD, PPNAD1, incl. familial micronodular adrenocortical hyperplasia, PPNAD2	ACAGCGTTCACAT	AJ251509	CCDS33334.1, CCDS42785.1, CCDS42786.1, CCDS46459.1	2q31.3	2010-06-22			ENSG00000128655	ENSG00000128655	3.1.4.17	"""Phosphodiesterases"""	8773	protein-coding gene	gene with protein product		604961				10725373	Standard	NM_001077196		Approved		uc002ulq.3	Q9HCR9	OTTHUMG00000154188	ENST00000286063.6:c.1263A>G	2.37:g.178762824T>C		Somatic	77	0		WXS	Illumina GAIIx	Phase_I	76	5	NM_016953	0	0	0	0	0	Q14CD1|Q53T16|Q96S76|Q9GZY7|Q9HB46|Q9NY45	Silent	SNP	ENST00000286063.6	37	CCDS33334.1	159	0.07280219780219781	6	0.012195121951219513	29	0.08011049723756906	14	0.024475524475524476	110	0.14511873350923482	T	9.875	1.199996	0.22121	0.031094	0.153953	ENSG00000128655	ENST00000433879	.	.	.	5.89	1.66	0.24008	.	.	.	.	.	T	0.00356	0.0011	.	.	.	0.09310	P	1.0	.	.	.	.	.	.	T	0.11036	-1.0604	3	.	.	.	.	10.0467	0.42190	0.0:0.3364:0.0:0.6636	.	.	.	.	S	60	.	.	N	-	2	0	PDE11A	178471070	0.994000	0.37717	1.000000	0.80357	0.998000	0.95712	0.296000	0.19083	0.431000	0.26258	0.533000	0.62120	AAC	T|0.895;C|0.105		0.378	PDE11A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000334313.2		
DOCK10	55619	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	225702542	225702542	+	Silent	SNP	C	C	G			TCGA-OR-A5KW-01A-11D-A29I-10	TCGA-OR-A5KW-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	67dfc56a-abc7-40c7-a901-6512ec38d5f5	804ec9eb-9f16-4ab9-b2dd-2abb72a53348	g.chr2:225702542C>G	ENST00000258390.7	-	25	2854	c.2787G>C	c.(2785-2787)ctG>ctC	p.L929L	DOCK10_ENST00000409592.3_Silent_p.L923L	NM_014689.2	NP_055504.2	Q96BY6	DOC10_HUMAN	dedicator of cytokinesis 10	929					regulation of cell migration (GO:0030334)|small GTPase mediated signal transduction (GO:0007264)	extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)			NS(1)|breast(3)|cervix(1)|endometrium(6)|kidney(10)|large_intestine(16)|lung(40)|ovary(2)|pancreas(1)|prostate(2)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	87		Renal(207;0.0113)|all_lung(227;0.0486)|Lung NSC(271;0.0653)|all_hematologic(139;0.14)		Epithelial(121;2.37e-10)|all cancers(144;2.26e-07)|Lung(261;0.0143)|LUSC - Lung squamous cell carcinoma(224;0.0178)		CAATGTCGGTCAGAACCCTGC	0.443																																					p.L929L		.											.	DOCK10-92	0			c.G2787C						.						71.0	69.0	70.0					2																	225702542		1921	4140	6061	SO:0001819	synonymous_variant	55619	exon25			GTCGGTCAGAACC	AB014594	CCDS46528.1, CCDS74661.1	2q36.3	2013-01-10			ENSG00000135905	ENSG00000135905		"""Pleckstrin homology (PH) domain containing"""	23479	protein-coding gene	gene with protein product	"""zizimin3"""	611518				12432077	Standard	NM_014689		Approved	ZIZ3, KIAA0694	uc010fwz.1	Q96BY6	OTTHUMG00000153428	ENST00000258390.7:c.2787G>C	2.37:g.225702542C>G		Somatic	37	0		WXS	Illumina GAIIx	Phase_I	37	24	NM_014689	0	0	0	0	0	B3FL70|O75178|Q9NW06|Q9NXI8	Silent	SNP	ENST00000258390.7	37	CCDS46528.1																																																																																			.		0.443	DOCK10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000331246.1		
AQP12B	653437	ucsc.edu	37	2	241622195	241622195	+	Silent	SNP	T	T	C	rs184458523	byFrequency	TCGA-OR-A5KW-01A-11D-A29I-10	TCGA-OR-A5KW-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	67dfc56a-abc7-40c7-a901-6512ec38d5f5	804ec9eb-9f16-4ab9-b2dd-2abb72a53348	g.chr2:241622195T>C	ENST00000407834.3	-	1	122	c.60A>G	c.(58-60)gcA>gcG	p.A20A		NM_001102467.1	NP_001095937.1	A6NM10	AQ12B_HUMAN	aquaporin 12B	20						integral component of membrane (GO:0016021)	transporter activity (GO:0005215)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(1)|lung(8)|ovary(1)	13		all_epithelial(40;1.71e-15)|Breast(86;2.14e-05)|Renal(207;0.00183)|Ovarian(221;0.0228)|all_lung(227;0.0294)|all_neural(83;0.0459)|Lung NSC(271;0.094)|all_hematologic(139;0.158)|Melanoma(123;0.16)|Hepatocellular(293;0.244)		Epithelial(32;2.2e-31)|all cancers(36;1.08e-28)|OV - Ovarian serous cystadenocarcinoma(60;2.13e-15)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;7.52e-06)|Lung(119;0.00163)|LUSC - Lung squamous cell carcinoma(224;0.008)|Colorectal(34;0.0124)|COAD - Colon adenocarcinoma(134;0.0757)		CCCGCCTGGCTGCCTCACAGA	0.672																																					p.A20A		.											.	.	0			c.A60G						.			66,4230		3,60,2085	43.0	50.0	48.0		60	1.3	0.2	2		48	171,8367		8,155,4106	no	coding-synonymous	AQP12B	NM_001102467.1		11,215,6191	CC,CT,TT		2.0028,1.5363,1.8467		20/308	241622195	237,12597	2148	4269	6417	SO:0001819	synonymous_variant	653437	exon1			CCTGGCTGCCTCA	BC041460	CCDS46560.1	2q37.3	2007-12-14	2005-05-26	2005-05-26	ENSG00000185176	ENSG00000185176		"""Ion channels / Aquaporins"""	6096	protein-coding gene	gene with protein product			"""insulin synthesis associated 3"""	INSSA3			Standard	NM_001102467		Approved		uc010fzj.3	A6NM10	OTTHUMG00000152263	ENST00000407834.3:c.60A>G	2.37:g.241622195T>C		Somatic	63	6		WXS	Illumina GAIIx	Phase_I	80	76	NM_001102467	0	0	0	0	0	A4QPB9	Silent	SNP	ENST00000407834.3	37	CCDS46560.1																																																																																			T|0.907;C|0.093		0.672	AQP12B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000325625.1		
FAM182A	284800	broad.mit.edu	37	20	26061818	26061818	+	RNA	SNP	G	G	C	rs112101451		TCGA-OR-A5KW-01A-11D-A29I-10	TCGA-OR-A5KW-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	67dfc56a-abc7-40c7-a901-6512ec38d5f5	804ec9eb-9f16-4ab9-b2dd-2abb72a53348	g.chr20:26061818G>C	ENST00000376398.2	+	0	838					NR_026713.1		Q5T1J6	F182A_HUMAN	family with sequence similarity 182, member A											breast(1)|endometrium(2)|kidney(1)	4						GATTTCTCCTGCTTAGAAATG	0.463																																					.		.											.	.	0			.						.						12.0	11.0	11.0					20																	26061818		692	1579	2271			284800	.			TCTCCTGCTTAGA	AL391119		20p11	2013-03-18	2008-08-05	2008-08-05	ENSG00000125804	ENSG00000125804			16222	other	unknown			"""chromosome 20 open reading frame 91"""	C20orf91			Standard	NR_026713		Approved	bB329D4.1, C20orf91A	uc010gdq.3	Q5T1J6	OTTHUMG00000032144		20.37:g.26061818G>C		Somatic	80	1		WXS	Illumina GAIIx	Phase_I	69	5	.	0	0	0	0	0	A2RRD0|Q8N947	RNA	SNP	ENST00000376398.2	37		.	.	.	.	.	.	.	.	.	.	N	7.694	0.691703	0.15039	.	.	ENSG00000125804	ENST00000376398;ENST00000246000	.	.	.	0.368	0.368	0.16146	.	.	.	.	.	T	0.47322	0.1439	.	.	.	0.30118	N	0.805912	.	.	.	.	.	.	T	0.53092	-0.8487	4	0.87932	D	0	.	.	.	.	.	.	.	.	S	57	.	ENSP00000246000:C57S	C	+	2	0	FAM182A	26009818	1.000000	0.71417	0.427000	0.26684	0.468000	0.32798	0.774000	0.26675	0.451000	0.26802	0.123000	0.15791	TGC	G|0.994;C|0.006		0.463	FAM182A-001	KNOWN	basic	lincRNA	processed_transcript	OTTHUMT00000078473.2		
CNBD2	140894	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	20	34618419	34618419	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5KW-01A-11D-A29I-10	TCGA-OR-A5KW-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	67dfc56a-abc7-40c7-a901-6512ec38d5f5	804ec9eb-9f16-4ab9-b2dd-2abb72a53348	g.chr20:34618419C>T	ENST00000373973.3	+	12	1753	c.1580C>T	c.(1579-1581)cCt>cTt	p.P527L	CNBD2_ENST00000538900.1_3'UTR|CNBD2_ENST00000349339.1_Missense_Mutation_p.P523L			Q96M20	CNBD2_HUMAN	cyclic nucleotide binding domain containing 2	527																	ATCTACAACCCTAAGTCTGTG	0.483																																					p.P523L		.											.	.	0			c.C1568T						.						173.0	158.0	163.0					20																	34618419		2203	4300	6503	SO:0001583	missense	140894	exon12			ACAACCCTAAGTC	AL359828	CCDS13270.1, CCDS56189.1	20q11.23	2012-11-15	2012-11-15	2012-11-15	ENSG00000149646	ENSG00000149646			16145	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 152"", ""cyclic nucleotide (cNMP) binding domain containing 1"""	C20orf152, CNMPD1		11780052	Standard	NM_080834		Approved	dJ954P9.1	uc002xer.1	Q96M20	OTTHUMG00000032371	ENST00000373973.3:c.1580C>T	20.37:g.34618419C>T	ENSP00000363084:p.Pro527Leu	Somatic	255	0		WXS	Illumina GAIIx	Phase_I	200	21	NM_080834	0	0	1	1	0	Q14C79|Q5JWY7|Q5T3S1|Q9BR36|Q9BWY5	Missense_Mutation	SNP	ENST00000373973.3	37		.	.	.	.	.	.	.	.	.	.	C	11.47	1.648263	0.29336	.	.	ENSG00000149646	ENST00000373973;ENST00000349339	T;T	0.16457	2.35;2.34	5.42	3.39	0.38822	.	0.693442	0.13540	N	0.380320	T	0.14570	0.0352	L	0.42245	1.32	0.09310	N	0.999995	B	0.20671	0.047	B	0.20955	0.032	T	0.24548	-1.0157	10	0.62326	D	0.03	-0.9264	5.6897	0.17823	0.1904:0.7007:0.0:0.1089	.	523	Q96M20-2	.	L	527;523	ENSP00000363084:P527L;ENSP00000340954:P523L	ENSP00000340954:P523L	P	+	2	0	C20orf152	34081833	0.002000	0.14202	0.001000	0.08648	0.057000	0.15508	1.403000	0.34612	0.590000	0.29694	0.561000	0.74099	CCT	.		0.483	CNBD2-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000078960.2	NM_080834	
DIDO1	11083	hgsc.bcm.edu	37	20	61512424	61512424	+	Silent	SNP	C	C	T	rs146466196	byFrequency	TCGA-OR-A5KW-01A-11D-A29I-10	TCGA-OR-A5KW-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	67dfc56a-abc7-40c7-a901-6512ec38d5f5	804ec9eb-9f16-4ab9-b2dd-2abb72a53348	g.chr20:61512424C>T	ENST00000266070.4	-	16	5209	c.4884G>A	c.(4882-4884)ggG>ggA	p.G1628G	DIDO1_ENST00000395343.1_Silent_p.G1628G	NM_033081.2	NP_149072.2	Q9BTC0	DIDO1_HUMAN	death inducer-obliterator 1	1628					apoptotic signaling pathway (GO:0097190)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			NS(6)|breast(5)|central_nervous_system(1)|cervix(3)|endometrium(6)|kidney(1)|large_intestine(17)|lung(39)|ovary(8)|prostate(3)|skin(7)|stomach(2)|upper_aerodigestive_tract(1)	99	Breast(26;5.68e-08)					CCTGCTCGGACCCCGCTGGGG	0.721													C|||	73	0.0145767	0.0045	0.0461	5008	,	,		12063	0.0		0.0318	False		,,,				2504	0.0031				p.G1628G	Melanoma(25;381 482 3385 5362 7955 17159 17174 40604 47095)	.											.	DIDO1-96	0			c.G4884A						.	C	,	18,3720		0,18,1851	8.0	10.0	9.0		4884,4884	-7.0	0.0	20	dbSNP_134	9	163,7457		2,159,3649	no	coding-synonymous,coding-synonymous	DIDO1	NM_001193369.1,NM_033081.2	,	2,177,5500	TT,TC,CC		2.1391,0.4815,1.5936	,	1628/2241,1628/2241	61512424	181,11177	1869	3810	5679	SO:0001819	synonymous_variant	11083	exon16			CTCGGACCCCGCT	AB002331	CCDS13508.2, CCDS13509.1, CCDS33506.1	20q13.33	2013-01-28	2005-11-11	2005-11-11	ENSG00000101191	ENSG00000101191		"""Zinc fingers, PHD-type"""	2680	protein-coding gene	gene with protein product		604140	"""chromosome 20 open reading frame 158"", ""death associated transcription factor 1"""	C20orf158, DATF1		10393935	Standard	NM_033081		Approved	DIO1, dJ885L7.8, FLJ11265, KIAA0333, DIO-1, BYE1	uc002ydr.2	Q9BTC0	OTTHUMG00000032945	ENST00000266070.4:c.4884G>A	20.37:g.61512424C>T		Somatic	2	0		WXS	Illumina GAIIx	Phase_I	8	7	NM_001193369	0	0	0	2	2	A8MY65|B9EH82|E1P5I1|O15043|Q3ZTL7|Q3ZTL8|Q4VXS1|Q4VXS2|Q4VXV8|Q4VXV9|Q96D72|Q9BQW0|Q9BW03|Q9H4G6|Q9H4G7|Q9NTU8|Q9NUM8|Q9UFB6	Silent	SNP	ENST00000266070.4	37	CCDS33506.1																																																																																			C|0.981;T|0.019		0.721	DIDO1-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000080091.2	NM_080796	
RFPL1	5988	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	22	29837551	29837551	+	Missense_Mutation	SNP	G	G	C			TCGA-OR-A5KW-01A-11D-A29I-10	TCGA-OR-A5KW-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	67dfc56a-abc7-40c7-a901-6512ec38d5f5	804ec9eb-9f16-4ab9-b2dd-2abb72a53348	g.chr22:29837551G>C	ENST00000354373.2	+	2	603	c.394G>C	c.(394-396)Gac>Cac	p.D132H	RFPL1S_ENST00000461286.3_RNA|RFPL1S_ENST00000539579.1_RNA	NM_021026.2	NP_066306.2	O75677	RFPL1_HUMAN	ret finger protein-like 1	132	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.						zinc ion binding (GO:0008270)			endometrium(3)|large_intestine(1)|lung(6)|prostate(2)|skin(2)|stomach(1)|urinary_tract(1)	16						CTTGGATGCCGACACAGCCAA	0.488																																					p.D132H		.											.	RFPL1-90	0			c.G394C						.						114.0	100.0	105.0					22																	29837551		2203	4300	6503	SO:0001583	missense	5988	exon2			GATGCCGACACAG	AJ010228	CCDS13857.2	22q12	2006-04-25			ENSG00000128250	ENSG00000128250		"""RING-type (C3HC4) zinc fingers"""	9977	protein-coding gene	gene with protein product		605968				10508838	Standard	NM_021026		Approved	RNF78	uc003afn.3	O75677	OTTHUMG00000150516	ENST00000354373.2:c.394G>C	22.37:g.29837551G>C	ENSP00000346342:p.Asp132His	Somatic	173	1		WXS	Illumina GAIIx	Phase_I	188	133	NM_021026	0	0	1	2	1	Q6IC06|Q9UJ97	Missense_Mutation	SNP	ENST00000354373.2	37	CCDS13857.2	.	.	.	.	.	.	.	.	.	.	-	15.63	2.890074	0.52014	.	.	ENSG00000128250	ENST00000354373	T	0.12465	2.68	1.1	1.1	0.20463	Concanavalin A-like lectin/glucanase (1);SPRY-associated (1);Butyrophylin-like (1);B30.2/SPRY domain (1);	.	.	.	.	T	0.34250	0.0891	M	0.81614	2.55	0.24859	N	0.992351	D	0.71674	0.998	D	0.72338	0.977	T	0.04723	-1.0931	9	0.72032	D	0.01	.	8.0526	0.30587	0.0:0.0:1.0:0.0	.	132	O75677	RFPL1_HUMAN	H	132	ENSP00000346342:D132H	ENSP00000346342:D132H	D	+	1	0	RFPL1	28167551	0.010000	0.17322	0.192000	0.23308	0.425000	0.31504	0.958000	0.29227	0.896000	0.36366	0.424000	0.28305	GAC	.		0.488	RFPL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318719.1	NM_021026	
IL17RC	84818	hgsc.bcm.edu	37	3	9975245	9975256	+	In_Frame_Del	DEL	GGCGCGGGACCT	GGCGCGGGACCT	-	rs183956	byFrequency	TCGA-OR-A5KW-01A-11D-A29I-10	TCGA-OR-A5KW-10A-01D-A29L-10	GGCGCGGGACCT	GGCGCGGGACCT	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	67dfc56a-abc7-40c7-a901-6512ec38d5f5	804ec9eb-9f16-4ab9-b2dd-2abb72a53348	g.chr3:9975245_9975256delGGCGCGGGACCT	ENST00000295981.3	+	19	2562_2573	c.2344_2355delGGCGCGGGACCT	c.(2344-2355)ggcgcgggacctdel	p.GAGP782del	CRELD1_ENST00000383811.3_5'Flank|IL17RC_ENST00000498214.1_3'UTR|CRELD1_ENST00000326434.5_5'Flank|IL17RC_ENST00000413608.1_In_Frame_Del_p.GAGP698del|IL17RC_ENST00000383812.4_In_Frame_Del_p.GAGP696del|IL17RC_ENST00000416074.2_In_Frame_Del_p.GAGP537del|IL17RC_ENST00000455057.1_In_Frame_Del_p.GAGP679del|RP11-1020A11.1_ENST00000602411.1_RNA|CRELD1_ENST00000452070.1_5'Flank|IL17RC_ENST00000403601.3_In_Frame_Del_p.GAGP711del|CRELD1_ENST00000397170.3_5'Flank	NM_153461.3	NP_703191	Q8NAC3	I17RC_HUMAN	interleukin 17 receptor C	782					cytokine-mediated signaling pathway (GO:0019221)|positive regulation of cytokine production involved in inflammatory response (GO:1900017)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	interleukin-17 receptor activity (GO:0030368)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(3)|ovary(3)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	22						GGTGGGACCAGGCGCGGGACCTGGGGCGGGGG	0.656																																					p.782_785del		.											.	IL17RC-92	0			c.2344_2355del						.																																			SO:0001651	inframe_deletion	84818	exon19			GGACCAGGCGCGG	BC006411	CCDS2590.1, CCDS2591.2, CCDS46746.1, CCDS56240.1, CCDS56241.1, CCDS74898.1	3p25.3	2008-02-05			ENSG00000163702	ENSG00000163702		"""Interleukins and interleukin receptors"""	18358	protein-coding gene	gene with protein product		610925				11706037	Standard	NM_153460		Approved	IL17-RL	uc003bua.3	Q8NAC3	OTTHUMG00000128648	ENST00000295981.3:c.2344_2355delGGCGCGGGACCT	3.37:g.9975245_9975256delGGCGCGGGACCT	ENSP00000295981:p.Gly782_Pro785del	Somatic	3	0		WXS	Illumina GAIIx	Phase_I	16	15	NM_153461	0	0	0	0	0	E9PHG1|E9PHJ6|Q6UVY3|Q6UWD4|Q8NFS1|Q9BR97	In_Frame_Del	DEL	ENST00000295981.3	37	CCDS2590.1																																																																																			.		0.656	IL17RC-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000250526.2	NM_032732	
FANCD2	2177	ucsc.edu	37	3	10091153	10091153	+	Silent	SNP	C	C	T	rs35652360	byFrequency	TCGA-OR-A5KW-01A-11D-A29I-10	TCGA-OR-A5KW-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	67dfc56a-abc7-40c7-a901-6512ec38d5f5	804ec9eb-9f16-4ab9-b2dd-2abb72a53348	g.chr3:10091153C>T	ENST00000419585.1	+	17	1670	c.1509C>T	c.(1507-1509)aaC>aaT	p.N503N	FANCD2_ENST00000287647.3_Silent_p.N503N|FANCD2_ENST00000383806.1_Silent_p.N503N|FANCD2_ENST00000383807.1_Silent_p.N503N			Q9BXW9	FACD2_HUMAN	Fanconi anemia, complementation group D2	503					DNA repair (GO:0006281)|gamete generation (GO:0007276)|response to gamma radiation (GO:0010332)|synapsis (GO:0007129)	condensed chromosome (GO:0000793)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA polymerase binding (GO:0070182)			NS(1)|breast(3)|central_nervous_system(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|lung(10)|ovary(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(3)	51				OV - Ovarian serous cystadenocarcinoma(96;0.148)		TAGTGTTAAACCCATCTGCTA	0.408			"""D, Mis, N, F"""			"""AML, leukemia"""		Involved in tolerance or repair of DNA crosslinks	Fanconi Anemia																												p.N503N		.	yes	Rec		Fanconi anaemia D2	3	3p26	2177	"""Fanconi anemia, complementation group D2"""		L	.	FANCD2-229	0			c.C1509T						.						237.0	256.0	249.0					3																	10091153		2201	4296	6497	SO:0001819	synonymous_variant	2177	exon17	Familial Cancer Database	Pancytopenia Dysmelia, FA (several complementation groups)	GTTAAACCCATCT	AF340183	CCDS2595.1, CCDS33696.1	3p25.3	2014-09-17		2001-10-05	ENSG00000144554	ENSG00000144554		"""Fanconi anemia, complementation groups"""	3585	protein-coding gene	gene with protein product		613984		FACD, FANCD		7581463, 11239453, 18475298	Standard	XM_005264946		Approved	FAD, FA-D2	uc003buw.3	Q9BXW9	OTTHUMG00000128670	ENST00000419585.1:c.1509C>T	3.37:g.10091153C>T		Somatic	133	28		WXS	Illumina GAIIx	Phase_I	69	54	NM_001018115	0	0	0	1	1	Q2LA86|Q69YP9|Q6PJN7|Q9BQ06|Q9H9T9	Silent	SNP	ENST00000419585.1	37	CCDS33696.1																																																																																			C|0.429;T|0.571		0.408	FANCD2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000339873.1		
P4HTM	54681	broad.mit.edu;bcgsc.ca	37	3	49044142	49044142	+	Missense_Mutation	SNP	C	C	G			TCGA-OR-A5KW-01A-11D-A29I-10	TCGA-OR-A5KW-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	67dfc56a-abc7-40c7-a901-6512ec38d5f5	804ec9eb-9f16-4ab9-b2dd-2abb72a53348	g.chr3:49044142C>G	ENST00000383729.4	+	9	1682	c.1311C>G	c.(1309-1311)gaC>gaG	p.D437E	WDR6_ENST00000415265.2_5'Flank|P4HTM_ENST00000343546.4_Missense_Mutation_p.D498E|WDR6_ENST00000608424.1_5'Flank|WDR6_ENST00000448293.1_5'Flank|WDR6_ENST00000395474.3_5'Flank	NM_177939.2	NP_808808.1	Q9NXG6	P4HTM_HUMAN	prolyl 4-hydroxylase, transmembrane (endoplasmic reticulum)	437	Fe2OG dioxygenase. {ECO:0000255|PROSITE- ProRule:PRU00805}.					endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	calcium ion binding (GO:0005509)|iron ion binding (GO:0005506)|L-ascorbic acid binding (GO:0031418)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors (GO:0016706)			NS(1)|breast(2)|kidney(1)|large_intestine(1)|lung(10)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|urinary_tract(1)	21					Vitamin C(DB00126)	ACGTAGACGACTACTCGCTGC	0.612																																					p.D498E		.											.	P4HTM-205	0			c.C1494G						.						46.0	44.0	45.0					3																	49044142		2203	4300	6503	SO:0001583	missense	54681	exon9			AGACGACTACTCG		CCDS2781.2, CCDS43089.1	3p21.31	2009-01-14			ENSG00000178467	ENSG00000178467			28858	protein-coding gene	gene with protein product	"""Prolyl hydroxlase domain-containing 4"", ""hypoxia inducible factor prolyl 4 hydroxylase"""	614584				12163023, 17726031	Standard	XR_245139		Approved	P4H-TM, PHD4, PH4, HIFPH4, FLJ20262, EGLN4, PH-4	uc003cvh.3	Q9NXG6	OTTHUMG00000074057	ENST00000383729.4:c.1311C>G	3.37:g.49044142C>G	ENSP00000373235:p.Asp437Glu	Somatic	275	0		WXS	Illumina GAIIx	Phase_I	261	9	NM_177938	0	0	123	127	4	Q6PAG6|Q8TCJ9|Q8WV55|Q96F22|Q9BW77	Missense_Mutation	SNP	ENST00000383729.4	37	CCDS43089.1	.	.	.	.	.	.	.	.	.	.	C	7.802	0.713925	0.15306	.	.	ENSG00000178467	ENST00000383729;ENST00000343546	T	0.59083	0.29	5.47	1.27	0.21489	Oxoglutarate/iron-dependent oxygenase (2);Prolyl 4-hydroxylase, alpha subunit (1);	0.161867	0.56097	N	0.000035	T	0.21718	0.0523	N	0.01250	-0.93	0.27800	N	0.942513	B;B	0.13145	0.007;0.002	B;B	0.10450	0.003;0.005	T	0.18681	-1.0329	10	0.18710	T	0.47	-31.0769	5.7683	0.18239	0.1242:0.4756:0.3229:0.0773	.	498;437	Q9NXG6-3;Q9NXG6	.;P4HTM_HUMAN	E	437;498	ENSP00000373235:D437E	ENSP00000341422:D498E	D	+	3	2	P4HTM	49019146	0.450000	0.25697	1.000000	0.80357	0.975000	0.68041	-0.190000	0.09615	0.665000	0.31066	0.650000	0.86243	GAC	.		0.612	P4HTM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000157211.1	NM_177938	
RBM6	10180	broad.mit.edu	37	3	50103899	50103899	+	Silent	SNP	T	T	C			TCGA-OR-A5KW-01A-11D-A29I-10	TCGA-OR-A5KW-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	67dfc56a-abc7-40c7-a901-6512ec38d5f5	804ec9eb-9f16-4ab9-b2dd-2abb72a53348	g.chr3:50103899T>C	ENST00000266022.4	+	17	3166	c.2907T>C	c.(2905-2907)gtT>gtC	p.V969V	RBM6_ENST00000422955.1_Silent_p.V447V|RBM6_ENST00000443081.1_Silent_p.V837V|RBM6_ENST00000539992.1_Silent_p.V311V|RBM6_ENST00000421682.1_5'UTR|RBM6_ENST00000442092.1_Silent_p.V447V	NM_005777.2	NP_005768.1	P78332	RBM6_HUMAN	RNA binding motif protein 6	969					RNA processing (GO:0006396)	nucleus (GO:0005634)	DNA binding (GO:0003677)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(10)|ovary(3)|prostate(1)|skin(4)|urinary_tract(1)	33				BRCA - Breast invasive adenocarcinoma(193;6.81e-05)|KIRC - Kidney renal clear cell carcinoma(197;0.0084)|Kidney(197;0.00977)		ATAAAGAAGTTCTGATCAAAC	0.473																																					p.V969V		.											.	RBM6-280	0			c.T2907C						.						129.0	140.0	136.0					3																	50103899		2203	4300	6503	SO:0001819	synonymous_variant	10180	exon17			AGAAGTTCTGATC	AF069517	CCDS2809.1, CCDS54586.1	3p21.3	2013-01-28			ENSG00000004534	ENSG00000004534		"""RNA binding motif (RRM) containing"", ""G patch domain containing"""	9903	protein-coding gene	gene with protein product		606886				10352938	Standard	NM_001167582		Approved	DEF-3, 3G2, NY-LU-12, g16, DEF3	uc003cyc.3	P78332	OTTHUMG00000156736	ENST00000266022.4:c.2907T>C	3.37:g.50103899T>C		Somatic	61	0		WXS	Illumina GAIIx	Phase_I	56	4	NM_005777	0	0	33	37	4	O60549|O75524|Q86SS3	Silent	SNP	ENST00000266022.4	37	CCDS2809.1																																																																																			.		0.473	RBM6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000345528.4	NM_005777	
ITIH1	3697	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	52819196	52819196	+	Missense_Mutation	SNP	T	T	C			TCGA-OR-A5KW-01A-11D-A29I-10	TCGA-OR-A5KW-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	67dfc56a-abc7-40c7-a901-6512ec38d5f5	804ec9eb-9f16-4ab9-b2dd-2abb72a53348	g.chr3:52819196T>C	ENST00000273283.2	+	12	1568	c.1544T>C	c.(1543-1545)aTt>aCt	p.I515T	ITIH1_ENST00000542827.1_Missense_Mutation_p.I515T|ITIH1_ENST00000540715.1_Missense_Mutation_p.I373T|ITIH1_ENST00000537050.1_Missense_Mutation_p.I227T|ITIH1_ENST00000405128.3_5'Flank	NM_002215.3	NP_002206.2	P19827	ITIH1_HUMAN	inter-alpha-trypsin inhibitor heavy chain 1	515	Hyaluronan-binding.				hyaluronan metabolic process (GO:0030212)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)|serine-type endopeptidase inhibitor activity (GO:0004867)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(16)|lung(18)|ovary(4)|prostate(3)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	52				BRCA - Breast invasive adenocarcinoma(193;7.04e-05)|Kidney(197;0.000659)|KIRC - Kidney renal clear cell carcinoma(197;0.000795)|OV - Ovarian serous cystadenocarcinoma(275;0.0498)		GCCGGGCGCATTGCTGACAAC	0.572																																					p.I515T		.											.	ITIH1-93	0			c.T1544C						.						134.0	123.0	127.0					3																	52819196		2203	4300	6503	SO:0001583	missense	3697	exon12			GGCGCATTGCTGA		CCDS2864.1, CCDS54595.1	3p21.1	2011-10-26	2011-10-26		ENSG00000055957	ENSG00000055957			6166	protein-coding gene	gene with protein product		147270	"""inter-alpha (globulin) inhibitor, H1 polypeptide"""			1385302, 10100603	Standard	NM_002215		Approved	H1P, IATIH, ITIH	uc003dfs.3	P19827	OTTHUMG00000150312	ENST00000273283.2:c.1544T>C	3.37:g.52819196T>C	ENSP00000273283:p.Ile515Thr	Somatic	157	1		WXS	Illumina GAIIx	Phase_I	131	117	NM_002215	0	0	0	0	0	A8K9N5|B2RAH9|B7Z558|B7Z8C0|F5H165|F5H7Y8|P78455|Q01746|Q562G1	Missense_Mutation	SNP	ENST00000273283.2	37	CCDS2864.1	.	.	.	.	.	.	.	.	.	.	T	17.06	3.291224	0.59976	.	.	ENSG00000055957	ENST00000542827;ENST00000273283;ENST00000540715;ENST00000537050;ENST00000428133	T;T;T;T;T	0.12879	2.64;2.64;2.64;2.64;2.64	4.88	4.88	0.63580	.	0.311813	0.35615	N	0.003085	T	0.23572	0.0570	M	0.79258	2.445	0.30161	N	0.802155	P;P;P	0.39003	0.654;0.501;0.474	B;B;B	0.41088	0.347;0.058;0.272	T	0.20974	-1.0259	10	0.87932	D	0	-17.1399	14.3166	0.66454	0.0:0.0:0.0:1.0	.	373;116;515	F5H165;Q9P1C5;P19827	.;.;ITIH1_HUMAN	T	515;515;373;227;68	ENSP00000442584:I515T;ENSP00000273283:I515T;ENSP00000443973:I373T;ENSP00000443847:I227T;ENSP00000395836:I68T	ENSP00000273283:I515T	I	+	2	0	ITIH1	52794236	0.948000	0.32251	1.000000	0.80357	0.989000	0.77384	7.297000	0.78799	2.068000	0.61886	0.443000	0.29094	ATT	.		0.572	ITIH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317522.1	NM_002215	
NAALADL2	254827	bcgsc.ca	37	3	174951756	174951756	+	Missense_Mutation	SNP	T	T	C	rs4371530	byFrequency	TCGA-OR-A5KW-01A-11D-A29I-10	TCGA-OR-A5KW-10A-01D-A29L-10	T	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	67dfc56a-abc7-40c7-a901-6512ec38d5f5	804ec9eb-9f16-4ab9-b2dd-2abb72a53348	g.chr3:174951756T>C	ENST00000454872.1	+	3	709	c.581T>C	c.(580-582)aTg>aCg	p.M194T	NAALADL2-AS2_ENST00000424690.1_RNA|NAALADL2_ENST00000473253.1_3'UTR	NM_207015.2	NP_996898.2	Q58DX5	NADL2_HUMAN	N-acetylated alpha-linked acidic dipeptidase-like 2	194			M -> T (in dbSNP:rs4371530).			integral component of membrane (GO:0016021)		p.M194T(1)		central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(5)|lung(20)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)	49	Ovarian(172;0.0102)	all_cancers(1;0.0272)|all_epithelial(1;0.0553)	OV - Ovarian serous cystadenocarcinoma(80;9.26e-28)	Colorectal(1;1.66e-10)|COAD - Colon adenocarcinoma(1;2.1e-07)|STAD - Stomach adenocarcinoma(1;0.00261)|READ - Rectum adenocarcinoma(3;0.0284)		GAAGATGACATGGAAATTTCA	0.323													t|||	3199	0.638778	0.5764	0.5749	5008	,	,		17689	0.6181		0.7167	False		,,,				2504	0.7096				p.M194T		.											.	NAALADL2-47	1	Substitution - Missense(1)	stomach(1)	c.T581C						.	C	THR/MET	2295,1373		738,819,277	58.0	54.0	55.0		581	-3.1	0.0	3	dbSNP_111	55	6004,2176		2211,1582,297	yes	missense	NAALADL2	NM_207015.2	81	2949,2401,574	CC,CT,TT		26.6015,37.4318,29.9544	benign	194/796	174951756	8299,3549	1834	4090	5924	SO:0001583	missense	254827	exon3			ATGACATGGAAAT		CCDS46960.1	3q26.3	2011-08-16			ENSG00000177694	ENSG00000177694			23219	protein-coding gene	gene with protein product	"""glutamate carboxypeptidase II-type non-peptidase homologue"""	608806				15168106	Standard	NM_207015		Approved		uc003fir.3	Q58DX5	OTTHUMG00000157120	ENST00000454872.1:c.581T>C	3.37:g.174951756T>C	ENSP00000404705:p.Met194Thr	Somatic	78	0		WXS	Illumina GAIIx	Phase_I	72	6	NM_207015	0	0	0	0	0	Q658X9|Q6H9J8|Q6H9J9|Q6PG38	Missense_Mutation	SNP	ENST00000454872.1	37	CCDS46960.1	1423	0.6515567765567766	295	0.5995934959349594	212	0.585635359116022	376	0.6573426573426573	540	0.712401055408971	C	2.040	-0.420179	0.04734	0.625682	0.733985	ENSG00000177694	ENST00000454872;ENST00000316366	T	0.38560	1.13	5.87	-3.1	0.05315	.	0.852250	0.10159	N	0.708521	T	0.00012	0.0000	N	0.08118	0	0.80722	P	0.0	B;B	0.02656	0.0;0.0	B;B	0.11329	0.006;0.0	T	0.40979	-0.9534	9	0.87932	D	0	1.6698	11.7373	0.51773	0.0:0.5504:0.0773:0.3723	rs4371530;rs52816374;rs60384769;rs4371530	177;194	Q58DX5-2;Q58DX5	.;NADL2_HUMAN	T	194;1	ENSP00000404705:M194T	ENSP00000314951:M1T	M	+	2	0	NAALADL2	176434450	0.004000	0.15560	0.004000	0.12327	0.593000	0.36681	-1.106000	0.03319	-1.349000	0.02202	-0.990000	0.02549	ATG	T|0.343;C|0.657		0.323	NAALADL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347390.2	NM_207015	
FXR1	8087	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	180685937	180685937	+	Nonsense_Mutation	SNP	C	C	T			TCGA-OR-A5KW-01A-11D-A29I-10	TCGA-OR-A5KW-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	67dfc56a-abc7-40c7-a901-6512ec38d5f5	804ec9eb-9f16-4ab9-b2dd-2abb72a53348	g.chr3:180685937C>T	ENST00000357559.4	+	14	1681	c.1297C>T	c.(1297-1299)Cga>Tga	p.R433*	FXR1_ENST00000480918.1_Nonsense_Mutation_p.R420*|FXR1_ENST00000445140.2_Nonsense_Mutation_p.R433*|FXR1_ENST00000305586.7_Nonsense_Mutation_p.R348*|FXR1_ENST00000491062.1_Nonsense_Mutation_p.R384*|FXR1_ENST00000468861.1_Nonsense_Mutation_p.R348*	NM_001013438.2|NM_005087.3	NP_001013456.1|NP_005078.2	P51114	FXR1_HUMAN	fragile X mental retardation, autosomal homolog 1	433					apoptotic process (GO:0006915)|cell differentiation (GO:0030154)|muscle organ development (GO:0007517)|negative regulation of translation (GO:0017148)	costamere (GO:0043034)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleolus (GO:0005730)|polysome (GO:0005844)	G-quadruplex RNA binding (GO:0002151)|mRNA 3'-UTR binding (GO:0003730)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			breast(3)|endometrium(4)|large_intestine(5)|lung(12)|skin(2)	26	all_cancers(143;6.07e-14)|Ovarian(172;0.0212)		Epithelial(37;3.05e-35)|OV - Ovarian serous cystadenocarcinoma(80;2.4e-22)			TCGAGACAGCCGACATCAGCG	0.542																																					p.R433X		.											.	FXR1-153	0			c.C1297T						.						120.0	109.0	113.0					3																	180685937		2203	4300	6503	SO:0001587	stop_gained	8087	exon14			GACAGCCGACATC	M67468	CCDS3238.1, CCDS33894.1, CCDS46965.1	3q28	2014-01-28			ENSG00000114416	ENSG00000114416			4023	protein-coding gene	gene with protein product		600819				7781595, 9642279	Standard	NM_005087		Approved		uc003fkq.3	P51114	OTTHUMG00000158138	ENST00000357559.4:c.1297C>T	3.37:g.180685937C>T	ENSP00000350170:p.Arg433*	Somatic	203	0		WXS	Illumina GAIIx	Phase_I	199	173	NM_001013438	0	0	1	12	11	A8K9B8|Q7Z450|Q8N6R8	Nonsense_Mutation	SNP	ENST00000357559.4	37	CCDS3238.1	.	.	.	.	.	.	.	.	.	.	C	26.8	4.774823	0.90108	.	.	ENSG00000114416	ENST00000357559;ENST00000305586;ENST00000491062;ENST00000468861;ENST00000445140;ENST00000480918	.	.	.	5.51	3.6	0.41247	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-7.0524	15.3593	0.74457	0.3259:0.6741:0.0:0.0	.	.	.	.	X	433;348;384;348;433;420	.	ENSP00000307633:R348X	R	+	1	2	FXR1	182168631	0.991000	0.36638	0.986000	0.45419	0.973000	0.67179	1.389000	0.34453	1.434000	0.47414	0.591000	0.81541	CGA	.		0.542	FXR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350265.5		
TNIP2	79155	hgsc.bcm.edu	37	4	2757800	2757800	+	Missense_Mutation	SNP	G	G	C	rs74548850	byFrequency	TCGA-OR-A5KW-01A-11D-A29I-10	TCGA-OR-A5KW-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	67dfc56a-abc7-40c7-a901-6512ec38d5f5	804ec9eb-9f16-4ab9-b2dd-2abb72a53348	g.chr4:2757800G>C	ENST00000315423.7	-	1	303	c.217C>G	c.(217-219)Cgc>Ggc	p.R73G	TNIP2_ENST00000510267.1_5'UTR|TNIP2_ENST00000503235.1_Missense_Mutation_p.R73G	NM_024309.3	NP_077285.3			TNFAIP3 interacting protein 2											breast(2)|central_nervous_system(1)|large_intestine(4)|lung(6)|prostate(1)	14				UCEC - Uterine corpus endometrioid carcinoma (64;0.168)		TCCCGGAAGCGCGCAACCTGC	0.756													G|||	210	0.0419329	0.025	0.0447	5008	,	,		6355	0.0288		0.0408	False		,,,				2504	0.0777				p.R73G		.											.	TNIP2-90	0			c.C217G						.	G	GLY/ARG	60,3592		0,60,1766	5.0	7.0	6.0		217	2.8	1.0	4	dbSNP_131	6	267,7455		4,259,3598	no	missense	TNIP2	NM_024309.3	125	4,319,5364	CC,CG,GG		3.4577,1.6429,2.875	probably-damaging	73/430	2757800	327,11047	1826	3861	5687	SO:0001583	missense	79155	exon1			GGAAGCGCGCAAC	BC002740	CCDS3362.1, CCDS54714.1, CCDS75093.1	4p16.3	2008-08-01			ENSG00000168884	ENSG00000168884			19118	protein-coding gene	gene with protein product		610669				11390377, 12933576	Standard	NM_024309		Approved	ABIN-2, MGC4289, KLIP, FLIP1	uc003gfg.2	Q8NFZ5	OTTHUMG00000090267	ENST00000315423.7:c.217C>G	4.37:g.2757800G>C	ENSP00000321203:p.Arg73Gly	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	12	7	NM_024309	0	0	2	3	1		Missense_Mutation	SNP	ENST00000315423.7	37	CCDS3362.1	94	0.04304029304029304	17	0.034552845528455285	18	0.049723756906077346	18	0.03146853146853147	41	0.05408970976253298	G	19.51	3.841781	0.71488	0.016429	0.034577	ENSG00000168884	ENST00000315423;ENST00000503235	T;T	0.48522	0.82;0.81	3.62	2.75	0.32379	.	0.480578	0.20050	N	0.100314	T	0.14399	0.0348	M	0.65975	2.015	0.27856	N	0.940558	D;P	0.62365	0.991;0.481	P;B	0.52217	0.693;0.071	T	0.11299	-1.0593	10	0.23302	T	0.38	-8.2753	9.2129	0.37328	0.0:0.0:0.7823:0.2177	.	73;73	D6RGJ2;Q8NFZ5	.;TNIP2_HUMAN	G	73	ENSP00000321203:R73G;ENSP00000426314:R73G	ENSP00000321203:R73G	R	-	1	0	TNIP2	2727598	0.882000	0.30256	1.000000	0.80357	0.927000	0.56198	1.083000	0.30815	0.689000	0.31550	0.498000	0.49722	CGC	G|0.957;C|0.043		0.756	TNIP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206589.5	NM_024309	
CCDC96	257236	hgsc.bcm.edu	37	4	7044357	7044357	+	Silent	SNP	A	A	G	rs871133	byFrequency	TCGA-OR-A5KW-01A-11D-A29I-10	TCGA-OR-A5KW-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	67dfc56a-abc7-40c7-a901-6512ec38d5f5	804ec9eb-9f16-4ab9-b2dd-2abb72a53348	g.chr4:7044357A>G	ENST00000310085.4	-	1	371	c.309T>C	c.(307-309)gtT>gtC	p.V103V	TADA2B_ENST00000310074.7_5'Flank|RP11-367J11.2_ENST00000500031.1_RNA|TADA2B_ENST00000512388.1_5'Flank	NM_153376.2	NP_699207.1	Q2M329	CCD96_HUMAN	coiled-coil domain containing 96	103	Glu-rich.									endometrium(3)|kidney(1)|large_intestine(3)|lung(2)|skin(1)|urinary_tract(1)	11						CCTCAGCCCCAACCTCGGCCG	0.766													G|||	4833	0.965056	0.8979	0.9856	5008	,	,		11811	1.0		0.9702	False		,,,				2504	1.0				p.V103V		.											.	CCDC96-90	0			c.T309C						.	G		2893,205		1348,197,4	3.0	3.0	3.0		309	-4.5	0.0	4	dbSNP_86	3	6689,125		3282,125,0	no	coding-synonymous	CCDC96	NM_153376.2		4630,322,4	GG,GA,AA		1.8345,6.6172,3.3293		103/556	7044357	9582,330	1549	3407	4956	SO:0001819	synonymous_variant	257236	exon1			AGCCCCAACCTCG	AK075056	CCDS3395.1	4p16.1	2008-02-05			ENSG00000173013	ENSG00000173013			26900	protein-coding gene	gene with protein product							Standard	NM_153376		Approved	FLJ90575	uc003gjv.2	Q2M329	OTTHUMG00000125511	ENST00000310085.4:c.309T>C	4.37:g.7044357A>G		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	9	9	NM_153376	0	0	0	2	2	Q8N2I7	Silent	SNP	ENST00000310085.4	37	CCDS3395.1																																																																																			A|0.036;G|0.964		0.766	CCDC96-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000246838.1	NM_153376	
GPR78	27201	hgsc.bcm.edu	37	4	8583231	8583231	+	Silent	SNP	C	C	A	rs61741008	byFrequency	TCGA-OR-A5KW-01A-11D-A29I-10	TCGA-OR-A5KW-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	67dfc56a-abc7-40c7-a901-6512ec38d5f5	804ec9eb-9f16-4ab9-b2dd-2abb72a53348	g.chr4:8583231C>A	ENST00000382487.4	+	1	939	c.522C>A	c.(520-522)gcC>gcA	p.A174A	GPR78_ENST00000509216.1_Intron	NM_080819.4	NP_543009.2	Q96P69	GPR78_HUMAN	G protein-coupled receptor 78	174					adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			central_nervous_system(4)|kidney(4)|large_intestine(1)|lung(8)|ovary(3)|prostate(3)|skin(1)|upper_aerodigestive_tract(2)	26						CCTTCACCGCCACGCTCCATG	0.697													C|||	24	0.00479233	0.0	0.0043	5008	,	,		16694	0.0		0.0189	False		,,,				2504	0.002				p.A174A		.											.	GPR78-516	0			c.C522A						.	C		8,4196		0,8,2094	10.0	11.0	10.0		522	-1.0	0.0	4	dbSNP_129	10	97,8169		0,97,4036	no	coding-synonymous	GPR78	NM_080819.2		0,105,6130	AA,AC,CC		1.1735,0.1903,0.842		174/364	8583231	105,12365	2102	4133	6235	SO:0001819	synonymous_variant	27201	exon1			CACCGCCACGCTC	AF411107	CCDS3403.1	4p16.1	2012-08-21			ENSG00000155269	ENSG00000155269		"""GPCR / Class A : Orphans"""	4528	protein-coding gene	gene with protein product		606921				11574155	Standard	NM_080819		Approved		uc003glk.4	Q96P69	OTTHUMG00000128483	ENST00000382487.4:c.522C>A	4.37:g.8583231C>A		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	15	10	NM_080819	0	0	0	0	0	Q8NGV3	Silent	SNP	ENST00000382487.4	37	CCDS3403.1																																																																																			C|0.992;A|0.008		0.697	GPR78-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359201.1		
ZAR1	326340	hgsc.bcm.edu	37	4	48492434	48492434	+	Missense_Mutation	SNP	G	G	C	rs10008444	byFrequency	TCGA-OR-A5KW-01A-11D-A29I-10	TCGA-OR-A5KW-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	67dfc56a-abc7-40c7-a901-6512ec38d5f5	804ec9eb-9f16-4ab9-b2dd-2abb72a53348	g.chr4:48492434G>C	ENST00000327939.4	+	1	166	c.126G>C	c.(124-126)caG>caC	p.Q42H		NM_175619.1	NP_783318.1	Q86SH2	ZAR1_HUMAN	zygote arrest 1	42					multicellular organismal development (GO:0007275)	cytoplasm (GO:0005737)				endometrium(1)|large_intestine(4)	5						GCTGGCAGCAGCGCGGCAGGG	0.756													C|||	4938	0.986022	0.9493	0.9957	5008	,	,		9261	1.0		1.0	False		,,,				2504	1.0				p.Q42H		.											.	ZAR1-90	0			c.G126C						.	C	HIS/GLN	2851,89		1381,89,0	2.0	3.0	3.0		126	-0.2	0.0	4	dbSNP_119	3	6474,0		3237,0,0	no	missense	ZAR1	NM_175619.1	24	4618,89,0	CC,CG,GG		0.0,3.0272,0.9454	benign	42/425	48492434	9325,89	1470	3237	4707	SO:0001583	missense	326340	exon1			GCAGCAGCGCGGC	AY193890	CCDS3483.1	4p11	2014-02-20			ENSG00000182223	ENSG00000182223			20436	protein-coding gene	gene with protein product	"""zinc finger, 3CxxC-type 6"""	607520				12539046	Standard	NM_175619		Approved	Z3CXXC6	uc003gyd.3	Q86SH2	OTTHUMG00000102093	ENST00000327939.4:c.126G>C	4.37:g.48492434G>C	ENSP00000329803:p.Gln42His	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	18	18	NM_175619	0	0	0	0	0		Missense_Mutation	SNP	ENST00000327939.4	37	CCDS3483.1	2130	0.9752747252747253	449	0.9126016260162602	359	0.9917127071823204	565	0.9877622377622378	757	0.9986807387862797	C	0.021	-1.426522	0.01117	0.969728	1.0	ENSG00000182223	ENST00000327939	.	.	.	4.09	-0.185	0.13276	.	0.811302	0.10779	N	0.635071	T	0.00012	0.0000	N	0.03608	-0.345	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.22103	-1.0226	8	0.14252	T	0.57	-31.571	6.2995	0.21105	0.0:0.2927:0.4307:0.2766	rs10008444;rs58304706	42	Q86SH2	ZAR1_HUMAN	H	42	.	ENSP00000329803:Q42H	Q	+	3	2	ZAR1	48187191	0.000000	0.05858	0.000000	0.03702	0.070000	0.16714	0.053000	0.14184	-0.405000	0.07599	-0.676000	0.03789	CAG	G|0.025;C|0.975		0.756	ZAR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219927.3		
PROL1	58503	broad.mit.edu;bcgsc.ca	37	4	71275326	71275326	+	Missense_Mutation	SNP	G	G	T			TCGA-OR-A5KW-01A-11D-A29I-10	TCGA-OR-A5KW-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	67dfc56a-abc7-40c7-a901-6512ec38d5f5	804ec9eb-9f16-4ab9-b2dd-2abb72a53348	g.chr4:71275326G>T	ENST00000399575.2	+	3	455	c.281G>T	c.(280-282)aGa>aTa	p.R94I	PROL1_ENST00000514338.1_3'UTR	NM_021225.4	NP_067048.4	Q99935	PROL1_HUMAN	proline rich, lacrimal 1	94	Pro-rich.				negative regulation of endopeptidase activity (GO:0010951)|regulation of sensory perception of pain (GO:0051930)|retina homeostasis (GO:0001895)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	endopeptidase inhibitor activity (GO:0004866)|peptidase inhibitor activity (GO:0030414)			endometrium(1)|kidney(1)|large_intestine(2)|lung(7)|prostate(1)|skin(3)	15		all_hematologic(202;0.196)				GAATCTATTAGACAACCTCGA	0.423																																					p.R94I		.											.	PROL1-135	0			c.G281T						.						219.0	204.0	209.0					4																	71275326		1861	4096	5957	SO:0001583	missense	58503	exon3			CTATTAGACAACC	S83198	CCDS43235.1	4q13.3	2011-10-28	2005-02-07		ENSG00000171199	ENSG00000171199			17279	protein-coding gene	gene with protein product		608936	"""proline rich 1"""			8670737	Standard	NM_021225		Approved	BPLP, PRL1, opiorphin	uc003hfi.3	Q99935	OTTHUMG00000160845	ENST00000399575.2:c.281G>T	4.37:g.71275326G>T	ENSP00000382485:p.Arg94Ile	Somatic	159	0		WXS	Illumina GAIIx	Phase_I	217	9	NM_021225	0	0	0	0	0	A8MZ07|P85047	Missense_Mutation	SNP	ENST00000399575.2	37	CCDS43235.1	.	.	.	.	.	.	.	.	.	.	G	7.398	0.632078	0.14322	.	.	ENSG00000171199	ENST00000399575	T	0.29142	1.58	1.69	-0.262	0.12958	.	.	.	.	.	T	0.14570	0.0352	N	0.22421	0.69	0.09310	N	1	P	0.34662	0.462	B	0.24974	0.057	T	0.17837	-1.0356	9	0.87932	D	0	.	2.3018	0.04164	0.1942:0.0:0.5107:0.2951	.	94	Q99935	PROL1_HUMAN	I	94	ENSP00000382485:R94I	ENSP00000382485:R94I	R	+	2	0	PROL1	71309915	0.000000	0.05858	0.000000	0.03702	0.007000	0.05969	-0.268000	0.08607	-0.113000	0.11958	0.591000	0.81541	AGA	.		0.423	PROL1-001	PUTATIVE	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000362639.1	NM_021225	
DSPP	1834	hgsc.bcm.edu	37	4	88537078	88537213	+	Frame_Shift_Del	DEL	TGACAGCAGCAATAGCAGTGACAGCAGCGATAGCAGCGACAGCAGCGACAGCAGCGATAGCAGTGACAGCAGCGATAGCAGTGACAGCAGTGACAGCAGCAATAGCAGTGACAGCAGTGACAGCAGCGACAGCAGT	TGACAGCAGCAATAGCAGTGACAGCAGCGATAGCAGCGACAGCAGCGACAGCAGCGATAGCAGTGACAGCAGCGATAGCAGTGACAGCAGTGACAGCAGCAATAGCAGTGACAGCAGTGACAGCAGCGACAGCAGT	-	rs529175881|rs563891927|rs151217478|rs201186956|rs201078954|rs551655835|rs199799532|rs201754564|rs376726974|rs551176886|rs536124533|rs374679002|rs367717407|rs531156875|rs370267258|rs200796238|rs200745922|rs373236680|rs373805744|rs553101049|rs372453629|rs201399566|rs553323131|rs199671813|rs534854783|rs143067236|rs376515601|rs369973717|rs368984442|rs200276196	byFrequency	TCGA-OR-A5KW-01A-11D-A29I-10	TCGA-OR-A5KW-10A-01D-A29L-10	TGACAGCAGCAATAGCAGTGACAGCAGCGATAGCAGCGACAGCAGCGACAGCAGCGATAGCAGTGACAGCAGCGATAGCAGTGACAGCAGTGACAGCAGCAATAGCAGTGACAGCAGTGACAGCAGCGACAGCAGT	TGACAGCAGCAATAGCAGTGACAGCAGCGATAGCAGCGACAGCAGCGACAGCAGCGATAGCAGTGACAGCAGCGATAGCAGTGACAGCAGTGACAGCAGCAATAGCAGTGACAGCAGTGACAGCAGCGACAGCAGT	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	67dfc56a-abc7-40c7-a901-6512ec38d5f5	804ec9eb-9f16-4ab9-b2dd-2abb72a53348	g.chr4:88537078_88537213delTGACAGCAGCAATAGCAGTGACAGCAGCGATAGCAGCGACAGCAGCGACAGCAGCGATAGCAGTGACAGCAGCGATAGCAGTGACAGCAGTGACAGCAGCAATAGCAGTGACAGCAGTGACAGCAGCGACAGCAGT	ENST00000282478.7	+	4	3297_3432	c.3264_3399delTGACAGCAGCAATAGCAGTGACAGCAGCGATAGCAGCGACAGCAGCGACAGCAGCGATAGCAGTGACAGCAGCGATAGCAGTGACAGCAGTGACAGCAGCAATAGCAGTGACAGCAGTGACAGCAGCGACAGCAGT	c.(3262-3399)agtgacagcagcaatagcagtgacagcagcgatagcagcgacagcagcgacagcagcgatagcagtgacagcagcgatagcagtgacagcagtgacagcagcaatagcagtgacagcagtgacagcagcgacagcagtfs	p.SDSSNSSDSSDSSDSSDSSDSSDSSDSSDSSDSSNSSDSSDSSDSS1088fs	DSPP_ENST00000399271.1_Frame_Shift_Del_p.SDSSNSSDSSDSSDSSDSSDSSDSSDSSDSSDSSNSSDSSDSSDSS1088fs|RP11-742B18.1_ENST00000506480.1_RNA			Q9NZW4	DSPP_HUMAN	dentin sialophosphoprotein	1088	Asp/Ser-rich.				biomineral tissue development (GO:0031214)|cellular response to cell-matrix adhesion (GO:0071460)|extracellular matrix organization (GO:0030198)|multicellular organismal development (GO:0007275)|ossification (GO:0001503)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|collagen binding (GO:0005518)|extracellular matrix structural constituent (GO:0005201)			breast(2)|central_nervous_system(1)|endometrium(9)|kidney(4)|large_intestine(8)|lung(13)|ovary(1)|skin(3)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	47		Hepatocellular(203;0.114)|all_hematologic(202;0.236)		OV - Ovarian serous cystadenocarcinoma(123;0.000508)		gtgatagcagtgacagcagcaatagcagtgacagcagcgatagcagcgacagcagcgacagcagcgatagcagtgacagcagcgatagcagtgacagcagtgacagcagcaatagcagtgacagcagtgacagcagcgacagcagtgatagcagtg	0.554																																					p.1088_1133del		.											.	DSPP-90	0			c.3264_3399del						.																																			SO:0001589	frameshift_variant	1834	exon5			TAGCAGTGACAGC	AF163151	CCDS43248.1	4q21.3	2008-02-05			ENSG00000152591	ENSG00000152591			3054	protein-coding gene	gene with protein product		125485		DFNA39, DGI1		8995371, 9533027	Standard	NM_014208		Approved	DMP3	uc003hqu.3	Q9NZW4	OTTHUMG00000161061	ENST00000282478.7:c.3264_3399delTGACAGCAGCAATAGCAGTGACAGCAGCGATAGCAGCGACAGCAGCGACAGCAGCGATAGCAGTGACAGCAGCGATAGCAGTGACAGCAGTGACAGCAGCAATAGCAGTGACAGCAGTGACAGCAGCGACAGCAGT	4.37:g.88537078_88537213delTGACAGCAGCAATAGCAGTGACAGCAGCGATAGCAGCGACAGCAGCGACAGCAGCGATAGCAGTGACAGCAGCGATAGCAGTGACAGCAGTGACAGCAGCAATAGCAGTGACAGCAGTGACAGCAGCGACAGCAGT	ENSP00000282478:p.Ser1088fs	Somatic	354	0		WXS	Illumina GAIIx	Phase_I	488	0	NM_014208	0	0	0	0	0	A8MUI0|O95815	Frame_Shift_Del	DEL	ENST00000282478.7	37	CCDS43248.1																																																																																			.		0.554	DSPP-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000363616.3	NM_014208	
DSPP	1834	ucsc.edu	37	4	88537081	88537081	+	Silent	SNP	C	C	T	rs367717407|rs370267258	byFrequency	TCGA-OR-A5KW-01A-11D-A29I-10	TCGA-OR-A5KW-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	67dfc56a-abc7-40c7-a901-6512ec38d5f5	804ec9eb-9f16-4ab9-b2dd-2abb72a53348	g.chr4:88537081C>T	ENST00000282478.7	+	4	3300	c.3267C>T	c.(3265-3267)gaC>gaT	p.D1089D	DSPP_ENST00000399271.1_Silent_p.D1089D|RP11-742B18.1_ENST00000506480.1_RNA			Q9NZW4	DSPP_HUMAN	dentin sialophosphoprotein	1089	Asp/Ser-rich.				biomineral tissue development (GO:0031214)|cellular response to cell-matrix adhesion (GO:0071460)|extracellular matrix organization (GO:0030198)|multicellular organismal development (GO:0007275)|ossification (GO:0001503)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|collagen binding (GO:0005518)|extracellular matrix structural constituent (GO:0005201)			breast(2)|central_nervous_system(1)|endometrium(9)|kidney(4)|large_intestine(8)|lung(13)|ovary(1)|skin(3)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	47		Hepatocellular(203;0.114)|all_hematologic(202;0.236)		OV - Ovarian serous cystadenocarcinoma(123;0.000508)		atagcagtgacagcagcaata	0.537													c|||	838	0.167332	0.2292	0.2133	5008	,	,		14171	0.1131		0.1461	False		,,,				2504	0.1288				p.D1089D		.											.	DSPP-90	0			c.C3267T						.	C		1383,707		577,229,239	19.0	24.0	22.0		3267	0.6	0.0	4		22	2123,1867		754,615,626	no	coding-synonymous	DSPP	NM_014208.3		1331,844,865	TT,TC,CC		46.792,33.8278,42.3355		1089/1302	88537081	3506,2574	1045	1995	3040	SO:0001819	synonymous_variant	1834	exon5			CAGTGACAGCAGC	AF163151	CCDS43248.1	4q21.3	2008-02-05			ENSG00000152591	ENSG00000152591			3054	protein-coding gene	gene with protein product		125485		DFNA39, DGI1		8995371, 9533027	Standard	NM_014208		Approved	DMP3	uc003hqu.3	Q9NZW4	OTTHUMG00000161061	ENST00000282478.7:c.3267C>T	4.37:g.88537081C>T		Somatic	332	2		WXS	Illumina GAIIx	Phase_I	427	144	NM_014208	0	0	0	0	0	A8MUI0|O95815	Silent	SNP	ENST00000282478.7	37	CCDS43248.1																																																																																			.		0.537	DSPP-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000363616.3	NM_014208	
MAML3	55534	broad.mit.edu	37	4	141074334	141074334	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5KW-01A-11D-A29I-10	TCGA-OR-A5KW-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	67dfc56a-abc7-40c7-a901-6512ec38d5f5	804ec9eb-9f16-4ab9-b2dd-2abb72a53348	g.chr4:141074334C>T	ENST00000509479.2	-	1	1004	c.148G>A	c.(148-150)Gca>Aca	p.A50T		NM_018717.4	NP_061187			mastermind-like 3 (Drosophila)											breast(1)|endometrium(7)|kidney(2)|large_intestine(1)|lung(9)|ovary(1)|prostate(2)|urinary_tract(2)	25	all_hematologic(180;0.162)					CCACCGGCTGCCGGGTGATTG	0.677																																					p.A50T		.											.	MAML3-455	0			c.G148A						.						2.0	3.0	3.0					4																	141074334		1611	3558	5169	SO:0001583	missense	55534	exon1			CGGCTGCCGGGTG	AB058719	CCDS54805.1	4q31.1	2014-08-12	2003-09-24		ENSG00000196782	ENSG00000196782			16272	protein-coding gene	gene with protein product	"""mastermind (drosophila)-like 3"""	608991	"""trinucleotide repeat containing 3"""	TNRC3		12370315, 12386158	Standard	NM_018717		Approved	KIAA1816, MAM2, CAGH3, GDN	uc021xsg.1	Q96JK9	OTTHUMG00000161441	ENST00000509479.2:c.148G>A	4.37:g.141074334C>T	ENSP00000421180:p.Ala50Thr	Somatic	31	0		WXS	Illumina GAIIx	Phase_I	46	4	NM_018717	0	0	0	0	0		Missense_Mutation	SNP	ENST00000509479.2	37	CCDS54805.1	.	.	.	.	.	.	.	.	.	.	C	13.67	2.305167	0.40795	.	.	ENSG00000196782	ENST00000509479	T	0.23754	1.89	3.94	3.07	0.35406	.	.	.	.	.	T	0.13798	0.0334	N	0.08118	0	0.80722	D	1	B;B	0.23377	0.084;0.084	B;B	0.18263	0.021;0.021	T	0.06499	-1.0823	9	0.62326	D	0.03	.	11.4637	0.50225	0.182:0.818:0.0:0.0	.	50;50	E7EVW8;Q96JK9	.;MAML3_HUMAN	T	50	ENSP00000421180:A50T	ENSP00000421180:A50T	A	-	1	0	MAML3	141293784	0.741000	0.28217	0.998000	0.56505	0.947000	0.59692	0.000000	0.12993	0.594000	0.29761	0.485000	0.47835	GCA	.		0.677	MAML3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364934.2		
HEXB	3074	hgsc.bcm.edu;broad.mit.edu;mdanderson.org	37	5	73981246	73981246	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5KW-01A-11D-A29I-10	TCGA-OR-A5KW-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	67dfc56a-abc7-40c7-a901-6512ec38d5f5	804ec9eb-9f16-4ab9-b2dd-2abb72a53348	g.chr5:73981246C>T	ENST00000261416.7	+	1	278	c.161C>T	c.(160-162)cCg>cTg	p.P54L	HEXB_ENST00000511181.1_Intron	NM_000521.3	NP_000512	P07686	HEXB_HUMAN	hexosaminidase B (beta polypeptide)	54					astrocyte cell migration (GO:0043615)|carbohydrate metabolic process (GO:0005975)|cell death (GO:0008219)|cellular calcium ion homeostasis (GO:0006874)|cellular protein metabolic process (GO:0044267)|chondroitin sulfate catabolic process (GO:0030207)|chondroitin sulfate metabolic process (GO:0030204)|ganglioside catabolic process (GO:0006689)|glycosaminoglycan metabolic process (GO:0030203)|glycosphingolipid metabolic process (GO:0006687)|hyaluronan catabolic process (GO:0030214)|hyaluronan metabolic process (GO:0030212)|keratan sulfate catabolic process (GO:0042340)|keratan sulfate metabolic process (GO:0042339)|lipid storage (GO:0019915)|locomotory behavior (GO:0007626)|lysosome organization (GO:0007040)|male courtship behavior (GO:0008049)|myelination (GO:0042552)|neuromuscular process controlling balance (GO:0050885)|oligosaccharide catabolic process (GO:0009313)|oogenesis (GO:0048477)|penetration of zona pellucida (GO:0007341)|phospholipid biosynthetic process (GO:0008654)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of cell shape (GO:0008360)|sensory perception of sound (GO:0007605)|skeletal system development (GO:0001501)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)	acrosomal vesicle (GO:0001669)|extracellular vesicular exosome (GO:0070062)|lysosomal lumen (GO:0043202)|membrane (GO:0016020)	beta-N-acetylhexosaminidase activity (GO:0004563)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)			endometrium(2)|kidney(3)|large_intestine(4)|ovary(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	14		all_lung(232;0.00101)|Lung NSC(167;0.00278)|Ovarian(174;0.0129)|Breast(144;0.231)		OV - Ovarian serous cystadenocarcinoma(47;1.72e-57)		AAGCCGGGGCCGGCGCTGTGG	0.692																																					p.P54L	Melanoma(66;841 1270 13391 18706 27225)	.											.	HEXB-91	0			c.C161T						.						6.0	9.0	8.0					5																	73981246		2130	4191	6321	SO:0001583	missense	3074	exon1			CGGGGCCGGCGCT	M13519	CCDS4022.1	5q13.3	2012-10-02			ENSG00000049860	ENSG00000049860	3.2.1.52		4879	protein-coding gene	gene with protein product		606873				2579389, 3013851	Standard	NM_000521		Approved		uc003kdf.4	P07686	OTTHUMG00000102057	ENST00000261416.7:c.161C>T	5.37:g.73981246C>T	ENSP00000261416:p.Pro54Leu	Somatic	11	0		WXS	Illumina GAIIx	Phase_I	42	19	NM_000521	0	0	24	32	8		Missense_Mutation	SNP	ENST00000261416.7	37	CCDS4022.1	.	.	.	.	.	.	.	.	.	.	C	12.16	1.855839	0.32791	.	.	ENSG00000049860	ENST00000261416	D	0.96685	-4.09	4.13	-3.32	0.04973	.	1.231350	0.05546	N	0.566692	D	0.88317	0.6404	N	0.08118	0	0.09310	N	0.999994	B	0.17667	0.023	B	0.08055	0.003	T	0.78932	-0.2009	10	0.45353	T	0.12	0.0049	3.8422	0.08918	0.289:0.4564:0.0:0.2546	.	54	P07686	HEXB_HUMAN	L	54	ENSP00000261416:P54L	ENSP00000261416:P54L	P	+	2	0	HEXB	74017002	0.000000	0.05858	0.000000	0.03702	0.124000	0.20399	-1.379000	0.02554	-0.555000	0.06142	-0.258000	0.10820	CCG	.		0.692	HEXB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219859.6	NM_000521	
DUSP1	1843	hgsc.bcm.edu	37	5	172197790	172197790	+	Missense_Mutation	SNP	C	C	T	rs34013988	byFrequency	TCGA-OR-A5KW-01A-11D-A29I-10	TCGA-OR-A5KW-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	67dfc56a-abc7-40c7-a901-6512ec38d5f5	804ec9eb-9f16-4ab9-b2dd-2abb72a53348	g.chr5:172197790C>T	ENST00000239223.3	-	1	408	c.166G>A	c.(166-168)Gcc>Acc	p.A56T	RP11-779O18.3_ENST00000523005.1_RNA	NM_004417.3	NP_004408.1	P28562	DUS1_HUMAN	dual specificity phosphatase 1	56	Rhodanese. {ECO:0000255|PROSITE- ProRule:PRU00173}.		A -> T (in dbSNP:rs34013988). {ECO:0000269|Ref.3}.		cellular response to hormone stimulus (GO:0032870)|endoderm formation (GO:0001706)|inactivation of MAPK activity (GO:0000188)|intracellular signal transduction (GO:0035556)|mitotic cell cycle arrest (GO:0071850)|negative regulation of apoptotic process (GO:0043066)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of meiotic cell cycle (GO:0051447)|peptidyl-threonine dephosphorylation (GO:0035970)|peptidyl-tyrosine dephosphorylation (GO:0035335)|positive regulation of apoptotic process (GO:0043065)|protein dephosphorylation (GO:0006470)|regulation of apoptotic process (GO:0042981)|regulation of mitotic cell cycle spindle assembly checkpoint (GO:0090266)|response to calcium ion (GO:0051592)|response to cAMP (GO:0051591)|response to estradiol (GO:0032355)|response to glucocorticoid (GO:0051384)|response to hydrogen peroxide (GO:0042542)|response to light stimulus (GO:0009416)|response to oxidative stress (GO:0006979)|response to retinoic acid (GO:0032526)|response to testosterone (GO:0033574)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	MAP kinase tyrosine/serine/threonine phosphatase activity (GO:0017017)|non-membrane spanning protein tyrosine phosphatase activity (GO:0004726)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)|protein tyrosine/threonine phosphatase activity (GO:0008330)			NS(1)|breast(2)|endometrium(1)|large_intestine(1)|liver(1)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	10	Renal(175;0.000159)|Lung NSC(126;0.00431)|all_lung(126;0.00729)	all_hematologic(541;4.11e-18)|Breast(839;0.00637)|Medulloblastoma(196;0.0208)|all_neural(177;0.0416)|Ovarian(839;0.15)	Kidney(164;7.24e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000516)	GBM - Glioblastoma multiforme(465;0.0103)		GCGCCCTTGGCCCGGCGCCGC	0.701													C|||	59	0.0117812	0.0	0.0115	5008	,	,		11210	0.001		0.0427	False		,,,				2504	0.0072				p.A56T		.											.	DUSP1-659	0			c.G166A						.	C	THR/ALA	16,3446		0,16,1715	2.0	3.0	3.0		166	4.9	1.0	5	dbSNP_126	3	138,6720		0,138,3291	yes	missense	DUSP1	NM_004417.3	58	0,154,5006	TT,TC,CC		2.0122,0.4622,1.4922	benign	56/368	172197790	154,10166	1731	3429	5160	SO:0001583	missense	1843	exon1			CCTTGGCCCGGCG	X68277	CCDS4380.1	5q35.1	2011-06-09			ENSG00000120129	ENSG00000120129		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : MAP kinase phosphatases"""	3064	protein-coding gene	gene with protein product		600714		PTPN10		1406996, 7806236	Standard	NM_004417		Approved	HVH1, CL100, MKP-1	uc003mbv.2	P28562	OTTHUMG00000130523	ENST00000239223.3:c.166G>A	5.37:g.172197790C>T	ENSP00000239223:p.Ala56Thr	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	24	10	NM_004417	0	0	31	46	15	D3DQL9|Q2V508	Missense_Mutation	SNP	ENST00000239223.3	37	CCDS4380.1	53	0.024267399267399268	5	0.01016260162601626	3	0.008287292817679558	1	0.0017482517482517483	44	0.05804749340369393	C	29.0	4.971475	0.92919	0.004622	0.020122	ENSG00000120129	ENST00000239223;ENST00000457103	T	0.39997	1.05	4.91	4.91	0.64330	Rhodanese-like (5);	0.000000	0.85682	D	0.000000	T	0.11024	0.0269	M	0.85710	2.77	0.80722	D	1	B	0.18013	0.025	B	0.26416	0.069	T	0.41161	-0.9524	10	0.49607	T	0.09	.	18.1069	0.89523	0.0:1.0:0.0:0.0	rs34013988	56	P28562	DUS1_HUMAN	T	56	ENSP00000239223:A56T	ENSP00000239223:A56T	A	-	1	0	DUSP1	172130396	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.586000	0.67503	2.253000	0.74438	0.491000	0.48974	GCC	C|0.976;T|0.024		0.701	DUSP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252943.3	NM_004417	
PPP1R3G	648791	hgsc.bcm.edu	37	6	5086070	5086070	+	Silent	SNP	A	A	G	rs667752		TCGA-OR-A5KW-01A-11D-A29I-10	TCGA-OR-A5KW-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	67dfc56a-abc7-40c7-a901-6512ec38d5f5	804ec9eb-9f16-4ab9-b2dd-2abb72a53348	g.chr6:5086070A>G	ENST00000405617.2	+	1	351	c.351A>G	c.(349-351)gcA>gcG	p.A117A		NM_001145115.1	NP_001138587.1	B7ZBB8	PP13G_HUMAN	protein phosphatase 1, regulatory subunit 3G	117					glucose homeostasis (GO:0042593)|positive regulation of glycogen (starch) synthase activity (GO:2000467)|positive regulation of glycogen biosynthetic process (GO:0045725)	cytoplasm (GO:0005737)	glycogen binding (GO:2001069)			kidney(2)	2						CGGAGGACGCACAGCTCGGCC	0.692													G|||	5008	1.0	1.0	1.0	5008	,	,		12505	1.0		1.0	False		,,,				2504	1.0				p.A117A		.											.	PPP1R3G-136	0			c.A351G						.						1.0	2.0	2.0					6																	5086070		400	1062	1462	SO:0001819	synonymous_variant	648791	exon1			GGACGCACAGCTC		CCDS47366.1	6p25.1	2012-04-17	2011-10-04		ENSG00000219607	ENSG00000219607		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	14945	protein-coding gene	gene with protein product			"""protein phosphatase 1, regulatory (inhibitor) subunit 3G"""			11948623	Standard	NM_001145115		Approved		uc011dia.1	B7ZBB8	OTTHUMG00000014172	ENST00000405617.2:c.351A>G	6.37:g.5086070A>G		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	4	4	NM_001145115	0	0	0	3	3		Silent	SNP	ENST00000405617.2	37	CCDS47366.1																																																																																			A|0.006;G|0.994		0.692	PPP1R3G-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039740.3	NM_001145115	
PPP1R3G	648791	hgsc.bcm.edu	37	6	5086211	5086211	+	Silent	SNP	G	G	C	rs584962		TCGA-OR-A5KW-01A-11D-A29I-10	TCGA-OR-A5KW-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	67dfc56a-abc7-40c7-a901-6512ec38d5f5	804ec9eb-9f16-4ab9-b2dd-2abb72a53348	g.chr6:5086211G>C	ENST00000405617.2	+	1	492	c.492G>C	c.(490-492)ctG>ctC	p.L164L		NM_001145115.1	NP_001138587.1	B7ZBB8	PP13G_HUMAN	protein phosphatase 1, regulatory subunit 3G	164					glucose homeostasis (GO:0042593)|positive regulation of glycogen (starch) synthase activity (GO:2000467)|positive regulation of glycogen biosynthetic process (GO:0045725)	cytoplasm (GO:0005737)	glycogen binding (GO:2001069)			kidney(2)	2						TCTCGCGCCTGCGAAGCTTCC	0.736													C|||	5008	1.0	1.0	1.0	5008	,	,		12118	1.0		1.0	False		,,,				2504	1.0				p.L164L		.											.	PPP1R3G-136	0			c.G492C						.						1.0	2.0	1.0					6																	5086211		271	872	1143	SO:0001819	synonymous_variant	648791	exon1			GCGCCTGCGAAGC		CCDS47366.1	6p25.1	2012-04-17	2011-10-04		ENSG00000219607	ENSG00000219607		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	14945	protein-coding gene	gene with protein product			"""protein phosphatase 1, regulatory (inhibitor) subunit 3G"""			11948623	Standard	NM_001145115		Approved		uc011dia.1	B7ZBB8	OTTHUMG00000014172	ENST00000405617.2:c.492G>C	6.37:g.5086211G>C		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	5	5	NM_001145115	0	0	0	2	2		Silent	SNP	ENST00000405617.2	37	CCDS47366.1																																																																																			G|0.000;C|1.000		0.736	PPP1R3G-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039740.3	NM_001145115	
BLOC1S5	63915	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	8041503	8041503	+	Splice_Site	SNP	T	T	A			TCGA-OR-A5KW-01A-11D-A29I-10	TCGA-OR-A5KW-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	67dfc56a-abc7-40c7-a901-6512ec38d5f5	804ec9eb-9f16-4ab9-b2dd-2abb72a53348	g.chr6:8041503T>A	ENST00000397457.2	-	3	233		c.e3-2		EEF1E1-BLOC1S5_ENST00000397456.2_Splice_Site|BLOC1S5_ENST00000543936.1_Splice_Site|BLOC1S5-TXNDC5_ENST00000439343.2_Splice_Site	NM_001199323.1|NM_201280.2	NP_001186252.1|NP_958437.1	Q8TDH9	BL1S5_HUMAN	biogenesis of lysosomal organelles complex-1, subunit 5, muted						anterograde axon cargo transport (GO:0008089)|anterograde synaptic vesicle transport (GO:0048490)|endosome to melanosome transport (GO:0035646)|melanosome organization (GO:0032438)|melanosome transport (GO:0032402)|neuron projection development (GO:0031175)|otolith morphogenesis (GO:0032474)|positive regulation of pigment cell differentiation (GO:0050942)	BLOC-1 complex (GO:0031083)|transport vesicle (GO:0030133)											ACGTTTTTCCTATTAAAAGAA	0.358																																					.		.											.	.	0			c.4-2A>T						.						79.0	77.0	78.0					6																	8041503		2203	4300	6503	SO:0001630	splice_region_variant	63915	exon5			TTTTCCTATTAAA	AF426434	CCDS4506.1, CCDS75394.1	6p25.1-p24.3	2012-08-01	2012-08-01	2012-08-01		ENSG00000188428		"""Biogenesis of lysosomal organelles complex-1 subunits"""	18561	protein-coding gene	gene with protein product		607289	"""muted homolog (mouse)"""	MUTED		11912185	Standard	NM_001199322		Approved	MU, dJ303A1.3		Q8TDH9	OTTHUMG00000014220	ENST00000397457.2:c.196-2A>T	6.37:g.8041503T>A		Somatic	22	0		WXS	Illumina GAIIx	Phase_I	32	21	NM_001199322	0	0	0	0	0	B4DVM2|Q0VDJ6|Q0VDJ7|Q5THS1|Q68D56|Q8N5F9|Q9NU16	Splice_Site	SNP	ENST00000397457.2	37	CCDS4506.1	.	.	.	.	.	.	.	.	.	.	T	18.75	3.691036	0.68271	.	.	ENSG00000188428	ENST00000397457;ENST00000543936	.	.	.	5.57	5.57	0.84162	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.4108	0.74917	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	-	.	.	MUTED	7986502	1.000000	0.71417	1.000000	0.80357	0.923000	0.55619	5.116000	0.64661	2.126000	0.65437	0.482000	0.46254	.	.		0.358	BLOC1S5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039797.2	NM_201280	Intron
RNF39	80352	hgsc.bcm.edu	37	6	30039364	30039364	+	Missense_Mutation	SNP	C	C	A	rs11753382	byFrequency	TCGA-OR-A5KW-01A-11D-A29I-10	TCGA-OR-A5KW-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	67dfc56a-abc7-40c7-a901-6512ec38d5f5	804ec9eb-9f16-4ab9-b2dd-2abb72a53348	g.chr6:30039364C>A	ENST00000244360.6	-	4	884	c.787G>T	c.(787-789)Ggc>Tgc	p.G263C	RNF39_ENST00000376751.3_Missense_Mutation_p.G263C	NM_025236.3	NP_079512.2	Q9H2S5	RNF39_HUMAN	ring finger protein 39	263	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.					cytoplasm (GO:0005737)	zinc ion binding (GO:0008270)										CGCTTGGGGCCGTCAGGGGGC	0.741													c|||	749	0.149561	0.2489	0.134	5008	,	,		10967	0.1528		0.0447	False		,,,				2504	0.1309				p.G263C	NSCLC(8;188 360 1520 20207 31481)	.											.	RNF39-226	0			c.G787T						.		CYS/GLY,CYS/GLY	414,2026		21,372,827	3.0	2.0	2.0		787,787	0.5	0.1	6	dbSNP_120	2	229,4029		6,217,1906	yes	missense,missense	RNF39	NM_025236.3,NM_170769.2	159,159	27,589,2733	AA,AC,CC		5.3781,16.9672,9.5999	benign,benign	263/421,263/355	30039364	643,6055	1220	2129	3349	SO:0001583	missense	80352	exon4			TGGGGCCGTCAGG	AF238315	CCDS4673.1, CCDS4674.1	6p21.3	2013-01-09			ENSG00000204618	ENSG00000204618		"""RING-type (C3HC4) zinc fingers"""	18064	protein-coding gene	gene with protein product		607524				11130983, 11716498	Standard	NM_170769		Approved	HZFw1, LIRF	uc003npe.3	Q9H2S5	OTTHUMG00000031288	ENST00000244360.6:c.787G>T	6.37:g.30039364C>A	ENSP00000244360:p.Gly263Cys	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	4	4	NM_025236	0	0	0	0	0	A2BEK3|A6NCD6|B0S858|Q5SPM8|Q5SPM9|Q5SPN0|Q5SRJ9|Q5SRK1|Q5SS29|Q9H2S3|Q9H2S4	Missense_Mutation	SNP	ENST00000244360.6	37	CCDS4673.1	299	0.13690476190476192	120	0.24390243902439024	56	0.15469613259668508	90	0.15734265734265734	33	0.04353562005277045	c	11.55	1.672102	0.29693	0.169672	0.053781	ENSG00000204618	ENST00000376751;ENST00000244360	T;T	0.10382	2.88;2.88	4.7	0.543	0.17179	Concanavalin A-like lectin/glucanase (1);SPRY-associated (1);B30.2/SPRY domain (1);	0.296117	0.23738	N	0.045041	T	0.03348	0.0097	N	0.19112	0.55	0.48696	P	3.009999999999957E-4	B;P	0.48407	0.06;0.91	B;P	0.47626	0.092;0.552	T	0.41305	-0.9516	9	0.56958	D	0.05	-19.3451	7.7639	0.28968	0.0:0.4441:0.0:0.5559	rs11753382	263;263	Q9H2S5;Q9H2S5-2	RNF39_HUMAN;.	C	263	ENSP00000365942:G263C;ENSP00000244360:G263C	ENSP00000244360:G263C	G	-	1	0	RNF39	30147343	0.003000	0.15002	0.059000	0.19551	0.050000	0.14768	0.158000	0.16422	-0.104000	0.12154	0.466000	0.42574	GGC	C|0.862;A|0.138		0.741	RNF39-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000076625.3	NM_170769	
HLA-B	3106	bcgsc.ca	37	6	31324643	31324643	+	Silent	SNP	G	G	C	rs1050517	byFrequency	TCGA-OR-A5KW-01A-11D-A29I-10	TCGA-OR-A5KW-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	67dfc56a-abc7-40c7-a901-6512ec38d5f5	804ec9eb-9f16-4ab9-b2dd-2abb72a53348	g.chr6:31324643G>C	ENST00000412585.2	-	2	193	c.165C>G	c.(163-165)acC>acG	p.T55T		NM_005514.6	NP_005505.2	P30486	1B48_HUMAN	major histocompatibility complex, class I, B	55	Alpha-1.				antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|immune response (GO:0006955)|positive regulation of T cell mediated cytotoxicity (GO:0001916)|viral process (GO:0016032)	cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|MHC class I protein complex (GO:0042612)	peptide antigen binding (GO:0042605)			endometrium(4)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(4)|lung(4)|prostate(1)|upper_aerodigestive_tract(2)	27						TCACGAACTGGGTGTCGTCCA	0.672									Melanoma, Familial Clustering of;Lichen Sclerosis et Atrophicus, Familial Clustering of				.|||	1882	0.375799	0.3283	0.4323	5008	,	,		9531	0.3631		0.4732	False		,,,				2504	0.3129				p.T55T		.											.	HLA-B-90	0			c.C165G						.	C		1189,3113		329,531,1291	38.0	30.0	33.0	http://www.ncbi.nlm.nih.gov/sites/varvu?gene	165	1.4	1.0	6	dbSNP_86	33	3132,5168		1013,1106,2031	no	coding-synonymous	HLA-B	NM_005514.6		1342,1637,3322	CC,CG,GG		37.7349,27.6383,34.2882		55/363	31324643	4321,8281	2151	4150	6301	SO:0001819	synonymous_variant	3106	exon2	Familial Cancer Database	;Lichen Sclerosis, Familial	GAACTGGGTGTCG	M15470	CCDS34394.1	6p21.3	2013-01-11			ENSG00000234745	ENSG00000234745		"""Histocompatibility complex"", ""Immunoglobulin superfamily / C1-set domain containing"""	4932	protein-coding gene	gene with protein product		142830	"""ankylosing spondylitis"""	AS		3459708	Standard	NM_005514		Approved		uc011imz.2	P01889	OTTHUMG00000031153	ENST00000412585.2:c.165C>G	6.37:g.31324643G>C		Somatic	64	2		WXS	Illumina GAIIx	Phase_I	31	11	NM_005514	0	0	27	27	0	Q29764	Silent	SNP	ENST00000412585.2	37	CCDS34394.1																																																																																			G|0.419;C|0.581		0.672	HLA-B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076280.4	NM_005514	
MICA	100507436	bcgsc.ca	37	6	31378977	31378977	+	Missense_Mutation	SNP	G	G	A	rs1051792	byFrequency	TCGA-OR-A5KW-01A-11D-A29I-10	TCGA-OR-A5KW-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	67dfc56a-abc7-40c7-a901-6512ec38d5f5	804ec9eb-9f16-4ab9-b2dd-2abb72a53348	g.chr6:31378977G>A	ENST00000449934.2	+	3	508	c.454G>A	c.(454-456)Gtg>Atg	p.V152M	HCP5_ENST00000414046.2_RNA	NM_001177519.1	NP_001170990.1			MHC class I polypeptide-related sequence A											breast(1)|endometrium(3)|kidney(1)	5		Ovarian(999;0.0253)				GGAATGGACAGTGCCCCAGTC	0.517													g|||	1827	0.364816	0.4788	0.4078	5008	,	,		20742	0.3006		0.3141	False		,,,				2504	0.2986				p.V152M		.											.	.	0			c.G454A						.	G	MET/VAL	580,804		132,316,244	100.0	85.0	89.0		454	-0.6	0.0	6	dbSNP_86	89	919,2263		126,667,798	no	missense	MICA	NM_001177519.1	21	258,983,1042	AA,AG,GG		28.8812,41.9075,32.8296	probably-damaging	152/333	31378977	1499,3067	692	1591	2283	SO:0001583	missense	100507436	exon3			TGGACAGTGCCCC	L14848	CCDS56412.1, CCDS75421.1	6p21.3	2013-01-11			ENSG00000204520	ENSG00000204520		"""Immunoglobulin superfamily / C1-set domain containing"""	7090	protein-coding gene	gene with protein product		600169				8022771	Standard	NM_000247		Approved	PERB11.1	uc003ntk.1	Q29983	OTTHUMG00000031073	ENST00000449934.2:c.454G>A	6.37:g.31378977G>A	ENSP00000413079:p.Val152Met	Somatic	218	3		WXS	Illumina GAIIx	Phase_I	206	9	NM_001177519	0	0	50	50	0		Missense_Mutation	SNP	ENST00000449934.2	37	CCDS56412.1	800|800	0.3663003663003663|0.3663003663003663	228|228	0.4634146341463415|0.4634146341463415	169|169	0.46685082872928174|0.46685082872928174	160|160	0.27972027972027974|0.27972027972027974	243|243	0.32058047493403696|0.32058047493403696	.|N	0.869|0.869	-0.732690|-0.732690	0.03135|0.03135	0.419075|0.419075	0.288812|0.288812	ENSG00000204520|ENSG00000204520	ENST00000399172|ENST00000364810;ENST00000449934	.|T	.|0.00730	.|5.77	1.41|1.41	-0.635|-0.635	0.11512|0.11512	.|.	.|.	.|.	.|.	.|.	.|T	.|0.00440	.|0.0014	.|.	.|.	.|.	0.80722|0.80722	P|P	0.0|0.0	.|D	.|0.53462	.|0.96	.|P	.|0.51550	.|0.673	.|T	.|0.51841	.|-0.8654	.|7	.|0.40728	.|T	.|0.16	.|.	2.6169|2.6169	0.04906|0.04906	0.3636:0.2644:0.372:0.0|0.3636:0.2644:0.372:0.0	rs1051792;rs3192169;rs3819270;rs16897487;rs17845518;rs17858408;rs17885687;rs1051792|rs1051792;rs3192169;rs3819270;rs16897487;rs17845518;rs17858408;rs17885687;rs1051792	.|152	.|Q96QC4	.|.	.|M	-1|152	.|ENSP00000413079:V152M	.|ENSP00000365394:V152M	.|V	+|+	.|1	.|0	MICA|MICA	31486956|31486956	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.000000|0.000000	0.00434|0.00434	0.136000|0.136000	0.15974|0.15974	-0.189000|-0.189000	0.10482|0.10482	-0.667000|-0.667000	0.03836|0.03836	.|GTG	G|0.653;A|0.347		0.517	MICA-001	KNOWN	not_best_in_genome_evidence|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076101.7	NM_001177519	
HLA-DQB1	3119	bcgsc.ca	37	6	32628022	32628022	+	Silent	SNP	A	A	G	rs1140347	byFrequency	TCGA-OR-A5KW-01A-11D-A29I-10	TCGA-OR-A5KW-10A-01D-A29L-10	A	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	67dfc56a-abc7-40c7-a901-6512ec38d5f5	804ec9eb-9f16-4ab9-b2dd-2abb72a53348	g.chr6:32628022A>G	ENST00000399082.3	-	3	440	c.396T>C	c.(394-396)ctT>ctC	p.L132L	HLA-DQB1_ENST00000434651.2_Silent_p.L259L|HLA-DQB1_ENST00000460185.1_5'UTR|HLA-DQB1_ENST00000399084.1_Silent_p.L259L|HLA-DQB1_ENST00000374943.4_Silent_p.L267L|XXbac-BPG254F23.6_ENST00000443574.1_RNA|HLA-DQB1-AS1_ENST00000419852.1_RNA|HLA-DQB1_ENST00000399079.3_Silent_p.L222L			P01920	DQB1_HUMAN	major histocompatibility complex, class II, DQ beta 1	0	Beta-2.|Ig-like C1-type.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|cytokine-mediated signaling pathway (GO:0019221)|humoral immune response mediated by circulating immunoglobulin (GO:0002455)|immune response (GO:0006955)|immunoglobulin production involved in immunoglobulin mediated immune response (GO:0002381)|interferon-gamma-mediated signaling pathway (GO:0060333)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)	clathrin-coated endocytic vesicle membrane (GO:0030669)|endocytic vesicle membrane (GO:0030666)|endosome (GO:0005768)|ER to Golgi transport vesicle membrane (GO:0012507)|Golgi membrane (GO:0000139)|integral component of lumenal side of endoplasmic reticulum membrane (GO:0071556)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|MHC class II protein complex (GO:0042613)|plasma membrane (GO:0005886)|trans-Golgi network membrane (GO:0032588)|transport vesicle membrane (GO:0030658)	MHC class II receptor activity (GO:0032395)|peptide antigen binding (GO:0042605)			breast(1)|large_intestine(1)|lung(1)|pancreas(1)	4					"""""""Insulin(DB00071)"""	GTCAGTGCAGAAGCCCTGGAG	0.542									T-cell Lymphoma, (Cutaneous) , Familial Clustering of;Sjgren syndrome;Melanoma, Familial Clustering of;ACTH-independent macronodular adrenal hyperplasia																												p.L267L	Esophageal Squamous(151;720 1825 15000 40336 43415)	.											.	HLA-DQB1-22	0			c.T801C						.						67.0	62.0	64.0					6																	32628022		1986	4056	6042	SO:0001819	synonymous_variant	3119	exon6	Familial Cancer Database	incl.: Mycosis Fungoides, Sezary syndrome, Adult T-cell Lymphoma;Sjogren syndrome; ;AIMAH, Cushing disease, Adrenal, Familial	GTGCAGAAGCCCT		CCDS43451.1, CCDS59006.1	6p21.3	2013-01-11			ENSG00000179344	ENSG00000179344		"""Histocompatibility complex"", ""Immunoglobulin superfamily / C1-set domain containing"""	4944	protein-coding gene	gene with protein product		604305		HLA-DQB			Standard	NM_001243962		Approved	IDDM1, CELIAC1	uc031snw.1	P01920	OTTHUMG00000031124	ENST00000399082.3:c.396T>C	6.37:g.32628022A>G		Somatic	142	2		WXS	Illumina GAIIx	Phase_I	19	6	NM_001243961	0	0	1	1	0	A1KR27|A2RPH3|A4Q9R4|A4USG2|A4USG5|A6N8I7|A9YQA0|B0S7Y7|B1A0K6|B1GXI3|B3VLT3|B5BLN7|B7VU69|C0MQ34|C0MQ35|C8ZL52|C8ZLJ8|C8ZLJ9|C9DRQ3|O19708|O19713|O19724|O62861|O78046|O78221|O78223|O98034|O98201|P01917|P01918|P01919|P03992|P05537|P79482|P79526|P79544|P79551|Q08GC8|Q09035|Q0E4V9|Q1M312|Q29731|Q29877|Q29884|Q29915|Q29966|Q2P9N3|Q2QK85|Q30061|Q30075|Q30076|Q30080|Q30081|Q30082|Q30083|Q30084|Q30089|Q30095|Q31633|Q38I47|Q45UE3|Q4QZB5|Q53I44|Q564J6|Q5G841|Q5ISH1|Q5ISH3|Q5W1E1|Q5Y7G8|Q643R4|Q6B9X1|Q70VH8|Q7YP69|Q8HWH0|Q8MH58|Q8SNB4|Q8SND1|Q8SP70|Q8WMA3|Q9BD17|Q9MYH2|Q9TPA9|Q9XRY6|Q9XRY7|Q9XRZ2	Silent	SNP	ENST00000399082.3	37																																																																																				A|0.440;G|0.560		0.542	HLA-DQB1-007	NOVEL	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000276131.1	NM_002123	
PNPLA1	285848	bcgsc.ca	37	6	36269725	36269725	+	Missense_Mutation	SNP	A	A	G	rs34598813	byFrequency	TCGA-OR-A5KW-01A-11D-A29I-10	TCGA-OR-A5KW-10A-01D-A29L-10	A	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	67dfc56a-abc7-40c7-a901-6512ec38d5f5	804ec9eb-9f16-4ab9-b2dd-2abb72a53348	g.chr6:36269725A>G	ENST00000394571.2	+	6	863	c.863A>G	c.(862-864)gAg>gGg	p.E288G	PNPLA1_ENST00000388715.3_Missense_Mutation_p.E193G|PNPLA1_ENST00000312917.5_Missense_Mutation_p.E202G	NM_001145717.1	NP_001139189.2	Q8N8W4	PLPL1_HUMAN	patatin-like phospholipase domain containing 1	288					lipid catabolic process (GO:0016042)	cytoplasm (GO:0005737)	hydrolase activity (GO:0016787)			breast(1)|kidney(1)|large_intestine(4)|lung(9)|pancreas(1)|skin(4)|upper_aerodigestive_tract(2)	22						CTTGGCAATGAGTGCCCTGAA	0.522											OREG0017382	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	A|||	393	0.0784744	0.1331	0.0346	5008	,	,		20119	0.0813		0.0437	False		,,,				2504	0.0685				p.E288G		.											.	PNPLA1-137	0			c.A863G						.	A	GLY/GLU,GLY/GLU,GLY/GLU	534,3872	242.1+/-252.3	37,460,1706	82.0	80.0	81.0		605,863,578	3.0	0.0	6	dbSNP_126	81	509,8091	144.8+/-200.6	14,481,3805	yes	missense,missense,missense	PNPLA1	NM_001145716.1,NM_001145717.1,NM_173676.2	98,98,98	51,941,5511	GG,GA,AA		5.9186,12.1198,8.0194	possibly-damaging,possibly-damaging,possibly-damaging	202/447,288/533,193/438	36269725	1043,11963	2203	4300	6503	SO:0001583	missense	285848	exon6			GCAATGAGTGCCC		CCDS34438.1, CCDS47416.1, CCDS54997.1	6p21.31	2009-01-12			ENSG00000180316	ENSG00000180316		"""Patatin-like phospholipase domain containing"""	21246	protein-coding gene	gene with protein product		612121				16799181, 19029121	Standard	NM_001145717		Approved	FLJ38755, dJ50J22.1	uc010jwf.2	Q8N8W4	OTTHUMG00000014590	ENST00000394571.2:c.863A>G	6.37:g.36269725A>G	ENSP00000378072:p.Glu288Gly	Somatic	116	0	861	WXS	Illumina GAIIx	Phase_I	92	6	NM_001145717	0	0	2	2	0	A3RMU3|J3JS20|Q2A6N1|Q3SY95|Q3SY96|Q5R3L2	Missense_Mutation	SNP	ENST00000394571.2	37	CCDS54997.1	155	0.07097069597069597	61	0.12398373983739837	14	0.03867403314917127	44	0.07692307692307693	36	0.047493403693931395	A	16.86	3.238826	0.58995	0.121198	0.059186	ENSG00000180316	ENST00000388715;ENST00000312917;ENST00000457797;ENST00000394571	T;T;T;T	0.37752	1.45;1.45;1.18;1.19	5.54	3.02	0.34903	.	0.626222	0.14117	N	0.340328	T	0.20700	0.0498	L	0.34521	1.04	0.80722	P	0.0	P;P	0.49559	0.734;0.925	B;P	0.49752	0.254;0.621	T	0.03278	-1.1053	9	0.66056	D	0.02	-16.6995	9.6897	0.40120	0.6609:0.3391:0.0:0.0	rs34598813	288;202	Q8N8W4;Q8N8W4-3	PLPL1_HUMAN;.	G	193;202;289;288	ENSP00000373367:E193G;ENSP00000321116:E202G;ENSP00000391868:E289G;ENSP00000378072:E288G	ENSP00000321116:E202G	E	+	2	0	PNPLA1	36377703	0.006000	0.16342	0.015000	0.15790	0.449000	0.32228	1.272000	0.33109	0.336000	0.23639	0.533000	0.62120	GAG	A|0.923;G|0.077		0.522	PNPLA1-201	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		NM_173676	
OSTM1	28962	broad.mit.edu	37	6	108395512	108395512	+	Missense_Mutation	SNP	C	C	A			TCGA-OR-A5KW-01A-11D-A29I-10	TCGA-OR-A5KW-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	67dfc56a-abc7-40c7-a901-6512ec38d5f5	804ec9eb-9f16-4ab9-b2dd-2abb72a53348	g.chr6:108395512C>A	ENST00000193322.3	-	1	429	c.344G>T	c.(343-345)tGc>tTc	p.C115F		NM_014028.3	NP_054747.2	Q86WC4	OSTM1_HUMAN	osteopetrosis associated transmembrane protein 1	115					ion transmembrane transport (GO:0034220)|osteoclast differentiation (GO:0030316)|transmembrane transport (GO:0055085)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|lysosomal membrane (GO:0005765)|nucleus (GO:0005634)				central_nervous_system(2)|endometrium(1)|lung(2)|ovary(1)|upper_aerodigestive_tract(2)	8		all_cancers(87;3.82e-07)|Acute lymphoblastic leukemia(125;2.66e-08)|all_hematologic(75;1.13e-06)|all_epithelial(87;0.000195)|Colorectal(196;0.0293)|all_lung(197;0.0938)		BRCA - Breast invasive adenocarcinoma(108;0.0131)|Epithelial(106;0.0438)|OV - Ovarian serous cystadenocarcinoma(136;0.0571)|all cancers(137;0.0581)		GAGGGGGTAGCAGGTCTGACA	0.657																																					p.C115F	Melanoma(162;1427 1909 3096 17430 21396)	.											.	OSTM1-68	0			c.G344T						.						22.0	25.0	24.0					6																	108395512		2203	4300	6503	SO:0001583	missense	28962	exon1			GGGTAGCAGGTCT	AF533891	CCDS5062.1	6q21	2014-06-17			ENSG00000081087	ENSG00000081087			21652	protein-coding gene	gene with protein product	"""CLCN7 accessory beta subunit"""	607649				12627228, 21527911	Standard	NM_014028		Approved	HSPC019, GL	uc003psd.3	Q86WC4	OTTHUMG00000015317	ENST00000193322.3:c.344G>T	6.37:g.108395512C>A	ENSP00000193322:p.Cys115Phe	Somatic	59	1		WXS	Illumina GAIIx	Phase_I	101	9	NM_014028	0	0	10	10	0	E1P5E3|Q5R391|Q6PCA7|Q7RTW6|Q8NC29|Q8TC82|Q9Y2S9	Missense_Mutation	SNP	ENST00000193322.3	37	CCDS5062.1	.	.	.	.	.	.	.	.	.	.	C	26.5	4.744956	0.89663	.	.	ENSG00000081087	ENST00000193322	D	0.82344	-1.6	5.3	5.3	0.74995	.	0.000000	0.85682	D	0.000000	D	0.90096	0.6906	M	0.81802	2.56	0.80722	D	1	D	0.89917	1.0	D	0.76071	0.987	D	0.91325	0.5085	10	0.87932	D	0	-12.5225	16.7097	0.85382	0.0:1.0:0.0:0.0	.	115	Q86WC4	OSTM1_HUMAN	F	115	ENSP00000193322:C115F	ENSP00000193322:C115F	C	-	2	0	OSTM1	108502205	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	4.592000	0.61027	2.480000	0.83734	0.655000	0.94253	TGC	.		0.657	OSTM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041709.3	NM_014028	
SMOC2	64094	hgsc.bcm.edu	37	6	168842113	168842113	+	Silent	SNP	T	T	G	rs73270928	byFrequency	TCGA-OR-A5KW-01A-11D-A29I-10	TCGA-OR-A5KW-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	67dfc56a-abc7-40c7-a901-6512ec38d5f5	804ec9eb-9f16-4ab9-b2dd-2abb72a53348	g.chr6:168842113T>G	ENST00000356284.2	+	1	283	c.63T>G	c.(61-63)gcT>gcG	p.A21A	SMOC2_ENST00000354536.5_Silent_p.A21A	NM_001166412.1	NP_001159884.1	Q9H3U7	SMOC2_HUMAN	SPARC related modular calcium binding 2	21					extracellular matrix organization (GO:0030198)|positive regulation of cell-substrate adhesion (GO:0010811)|signal transduction (GO:0007165)	basement membrane (GO:0005604)|interstitial matrix (GO:0005614)	calcium ion binding (GO:0005509)|heparin binding (GO:0008201)			NS(1)|autonomic_ganglia(1)|breast(2)|endometrium(1)|kidney(1)|large_intestine(6)|lung(12)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	32		Breast(66;0.000141)|Esophageal squamous(34;0.222)|Ovarian(120;0.231)		OV - Ovarian serous cystadenocarcinoma(33;1.31e-19)|BRCA - Breast invasive adenocarcinoma(81;3.06e-06)|GBM - Glioblastoma multiforme(31;0.00109)		CGGTGCCCGCTCAGAAGTTCT	0.751													G|||	1980	0.395367	0.5787	0.2839	5008	,	,		9314	0.4593		0.167	False		,,,				2504	0.3957				p.A21A		.											.	SMOC2-91	0			c.T63G						.	G	,	924,2074		89,746,664	2.0	3.0	3.0		63,63	-0.4	1.0	6	dbSNP_131	3	645,5799		34,577,2611	no	coding-synonymous,coding-synonymous	SMOC2	NM_001166412.1,NM_022138.2	,	123,1323,3275	GG,GT,TT		10.0093,30.8205,16.6172	,	21/447,21/458	168842113	1569,7873	1499	3222	4721	SO:0001819	synonymous_variant	64094	exon1			GCCCGCTCAGAAG	AB014730	CCDS5307.1, CCDS55076.1	6q27	2013-01-10			ENSG00000112562	ENSG00000112562		"""EF-hand domain containing"""	20323	protein-coding gene	gene with protein product		607223				12031507	Standard	NM_022138		Approved	SMAP2	uc003qwr.2	Q9H3U7	OTTHUMG00000016050	ENST00000356284.2:c.63T>G	6.37:g.168842113T>G		Somatic	4	0		WXS	Illumina GAIIx	Phase_I	13	9	NM_022138	0	0	0	0	0	B3KPS7|Q4G169|Q5TAT7|Q5TAT8|Q86VV9|Q96SF3|Q9H1L3|Q9H1L4|Q9H3U0|Q9H4F7|Q9HCV2	Silent	SNP	ENST00000356284.2	37	CCDS55076.1																																																																																			T|0.654;G|0.346		0.751	SMOC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043201.1		
AP5Z1	9907	broad.mit.edu	37	7	4827402	4827402	+	Missense_Mutation	SNP	G	G	T			TCGA-OR-A5KW-01A-11D-A29I-10	TCGA-OR-A5KW-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	67dfc56a-abc7-40c7-a901-6512ec38d5f5	804ec9eb-9f16-4ab9-b2dd-2abb72a53348	g.chr7:4827402G>T	ENST00000348624.4	+	11	1543	c.1449G>T	c.(1447-1449)caG>caT	p.Q483H	AP5Z1_ENST00000401897.1_Missense_Mutation_p.Q483H|MIR4656_ENST00000579503.1_RNA	NM_014855.2	NP_055670.1	O43299	AP5Z1_HUMAN	adaptor-related protein complex 5, zeta 1 subunit	483					cell death (GO:0008219)|double-strand break repair via homologous recombination (GO:0000724)|endosomal transport (GO:0016197)|protein transport (GO:0015031)	AP-5 adaptor complex (GO:0044599)|AP-type membrane coat adaptor complex (GO:0030119)|cytoplasm (GO:0005737)|nucleus (GO:0005634)											TGGACCTGCAGCTCAGGTGGG	0.706																																					p.Q483H		.											.	.	0			c.G1449T						.						14.0	18.0	17.0					7																	4827402		1984	3947	5931	SO:0001583	missense	9907	exon11			CCTGCAGCTCAGG	AB007875	CCDS47528.1	7p22.1	2012-03-20	2012-03-20	2012-03-20	ENSG00000242802	ENSG00000242802			22197	protein-coding gene	gene with protein product		613653	"""KIAA0415"""	KIAA0415		20613862, 22022230	Standard	NM_014855		Approved	SPG48, zeta	uc003sne.3	O43299	OTTHUMG00000151754	ENST00000348624.4:c.1449G>T	7.37:g.4827402G>T	ENSP00000297562:p.Gln483His	Somatic	10	0		WXS	Illumina GAIIx	Phase_I	117	11	NM_014855	0	0	0	0	0	Q8N3X2|Q96H80	Missense_Mutation	SNP	ENST00000348624.4	37	CCDS47528.1	.	.	.	.	.	.	.	.	.	.	G	12.16	1.854221	0.32791	.	.	ENSG00000242802	ENST00000348624;ENST00000401897	T;T	0.48836	0.81;0.8	4.73	2.77	0.32553	.	0.129357	0.52532	D	0.000063	T	0.45518	0.1346	M	0.82323	2.585	0.48135	D	0.999592	B	0.25609	0.13	B	0.21708	0.036	T	0.49943	-0.8885	10	0.56958	D	0.05	.	4.7521	0.13066	0.0852:0.1506:0.609:0.1552	.	483	O43299	K0415_HUMAN	H	483	ENSP00000297562:Q483H;ENSP00000384980:Q483H	ENSP00000297562:Q483H	Q	+	3	2	KIAA0415	4793928	1.000000	0.71417	1.000000	0.80357	0.732000	0.41865	2.161000	0.42358	1.108000	0.41662	0.549000	0.68633	CAG	.		0.706	AP5Z1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323771.1		
POM121L12	285877	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	7	53103984	53103984	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5KW-01A-11D-A29I-10	TCGA-OR-A5KW-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	67dfc56a-abc7-40c7-a901-6512ec38d5f5	804ec9eb-9f16-4ab9-b2dd-2abb72a53348	g.chr7:53103984G>A	ENST00000408890.4	+	1	636	c.620G>A	c.(619-621)aGg>aAg	p.R207K		NM_182595.3	NP_872401.3	Q8N7R1	P1L12_HUMAN	POM121 transmembrane nucleoporin-like 12	207										endometrium(5)|kidney(1)|large_intestine(5)|lung(44)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)	61						AAGGGTGGCAGGCGGAACCTG	0.662																																					p.R207K		.											.	.	0			c.G620A						.						47.0	57.0	53.0					7																	53103984		1990	4134	6124	SO:0001583	missense	285877	exon1			GTGGCAGGCGGAA		CCDS43584.1	7p12.1	2012-03-13	2012-03-13		ENSG00000221900	ENSG00000221900			25369	protein-coding gene	gene with protein product			"""POM121 membrane glycoprotein-like 12"""				Standard	NM_182595		Approved	DKFZp564N2472	uc003tpz.3	Q8N7R1	OTTHUMG00000155995	ENST00000408890.4:c.620G>A	7.37:g.53103984G>A	ENSP00000386133:p.Arg207Lys	Somatic	65	0		WXS	Illumina GAIIx	Phase_I	127	56	NM_182595	0	0	0	0	0	Q8NDI9	Missense_Mutation	SNP	ENST00000408890.4	37	CCDS43584.1	.	.	.	.	.	.	.	.	.	.	G	9.345	1.064056	0.20067	.	.	ENSG00000221900	ENST00000408890	T	0.12361	2.69	1.84	-0.111	0.13576	.	.	.	.	.	T	0.09730	0.0239	L	0.38175	1.15	0.09310	N	1	B	0.24920	0.114	B	0.25405	0.06	T	0.33777	-0.9855	9	0.44086	T	0.13	.	4.0789	0.09917	0.0:0.2656:0.4629:0.2714	.	207	Q8N7R1	P1L12_HUMAN	K	207	ENSP00000386133:R207K	ENSP00000386133:R207K	R	+	2	0	POM121L12	53071478	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.323000	0.07997	-0.047000	0.13423	-0.218000	0.12543	AGG	.		0.662	POM121L12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000342656.1	NM_182595	
MLXIPL	51085	hgsc.bcm.edu;broad.mit.edu	37	7	73011760	73011760	+	Missense_Mutation	SNP	G	G	T			TCGA-OR-A5KW-01A-11D-A29I-10	TCGA-OR-A5KW-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	67dfc56a-abc7-40c7-a901-6512ec38d5f5	804ec9eb-9f16-4ab9-b2dd-2abb72a53348	g.chr7:73011760G>T	ENST00000313375.3	-	9	1402	c.1355C>A	c.(1354-1356)cCt>cAt	p.P452H	MLXIPL_ENST00000395189.1_Missense_Mutation_p.P359H|MLXIPL_ENST00000354613.1_Missense_Mutation_p.P452H|MLXIPL_ENST00000429400.2_Missense_Mutation_p.P452H|MLXIPL_ENST00000434326.1_Missense_Mutation_p.P359H|MLXIPL_ENST00000414749.2_Missense_Mutation_p.P452H	NM_032951.2|NM_032953.2	NP_116569.1|NP_116571.1	Q9NP71	MLXPL_HUMAN	MLX interacting protein-like	452					anatomical structure morphogenesis (GO:0009653)|energy reserve metabolic process (GO:0006112)|fatty acid homeostasis (GO:0055089)|glucose homeostasis (GO:0042593)|glucose mediated signaling pathway (GO:0010255)|intracellular signal transduction (GO:0035556)|negative regulation of cell cycle arrest (GO:0071157)|negative regulation of oxidative phosphorylation (GO:0090324)|negative regulation of peptidyl-serine phosphorylation (GO:0033137)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cellular metabolic process (GO:0031325)|positive regulation of fatty acid biosynthetic process (GO:0045723)|positive regulation of glycolytic process (GO:0045821)|positive regulation of lipid biosynthetic process (GO:0046889)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of energy homeostasis (GO:2000505)|regulation of fatty acid biosynthetic process (GO:0042304)|regulation of transcription, DNA-templated (GO:0006355)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)|triglyceride homeostasis (GO:0070328)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	carbohydrate response element binding (GO:0035538)|DNA binding (GO:0003677)|protein heterodimerization activity (GO:0046982)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)			cervix(1)|kidney(1)|large_intestine(1)|lung(5)|ovary(1)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)	13		Lung NSC(55;0.0659)|all_lung(88;0.152)				GAAGGCTGCAGGAGCAGGCAG	0.647																																					p.P452H		.											.	MLXIPL-91	0			c.C1355A						.						27.0	19.0	22.0					7																	73011760		1986	3971	5957	SO:0001583	missense	51085	exon9			GCTGCAGGAGCAG	AK055029	CCDS5553.1, CCDS5554.1, CCDS47605.1, CCDS47606.1	7q11.23	2013-05-21	2005-10-31	2005-10-31	ENSG00000009950	ENSG00000009950			12744	protein-coding gene	gene with protein product	"""carbohydrate response element binding protein"""	605678	"""Williams Beuren syndrome chromosome region 14"""	WBSCR14		9860302	Standard	XM_005250399		Approved	WS-bHLH, MIO, CHREBP, MONDOB, bHLHd14	uc003tyn.1	Q9NP71	OTTHUMG00000129995	ENST00000313375.3:c.1355C>A	7.37:g.73011760G>T	ENSP00000320886:p.Pro452His	Somatic	12	0		WXS	Illumina GAIIx	Phase_I	27	6	NM_032954	0	0	6	14	8	C5HU02|C5HU03|C5HU04|Q96E48|Q9BY03|Q9BY04|Q9BY05|Q9BY06|Q9Y2P3	Missense_Mutation	SNP	ENST00000313375.3	37	CCDS5553.1	.	.	.	.	.	.	.	.	.	.	G	9.524	1.108995	0.20714	.	.	ENSG00000009950	ENST00000414749;ENST00000429400;ENST00000313375;ENST00000354613;ENST00000395189;ENST00000434326	T;T;T;T;T;T	0.23754	2.52;2.51;2.51;2.52;1.9;1.89	4.01	3.04	0.35103	.	1.037060	0.07628	N	0.928189	T	0.37265	0.0997	L	0.29908	0.895	0.09310	N	1	D;D;D;D;D;D	0.76494	0.999;0.998;0.999;0.999;0.999;0.999	P;P;P;D;D;D	0.64237	0.907;0.865;0.839;0.923;0.923;0.923	T	0.33929	-0.9849	10	0.72032	D	0.01	-11.6666	11.0658	0.47974	0.0:0.1904:0.8096:0.0	.	359;359;452;452;452;452	C5HU01;Q9NP71-6;Q9NP71;Q9NP71-2;Q9NP71-3;Q9NP71-4	.;.;MLXPL_HUMAN;.;.;.	H	452;452;452;452;359;359	ENSP00000412330:P452H;ENSP00000406296:P452H;ENSP00000320886:P452H;ENSP00000346629:P452H;ENSP00000378616:P359H;ENSP00000392636:P359H	ENSP00000320886:P452H	P	-	2	0	MLXIPL	72649696	0.484000	0.25964	0.431000	0.26735	0.151000	0.21798	3.987000	0.56944	1.970000	0.57323	0.423000	0.28283	CCT	.		0.647	MLXIPL-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000252262.1	NM_032951	
MBLAC1	255374	hgsc.bcm.edu	37	7	99725210	99725210	+	Silent	SNP	G	G	T	rs142426754	byFrequency	TCGA-OR-A5KW-01A-11D-A29I-10	TCGA-OR-A5KW-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	67dfc56a-abc7-40c7-a901-6512ec38d5f5	804ec9eb-9f16-4ab9-b2dd-2abb72a53348	g.chr7:99725210G>T	ENST00000398075.2	+	2	591	c.192G>T	c.(190-192)ggG>ggT	p.G64G	RP11-506M12.1_ENST00000494221.1_RNA	NM_203397.1	NP_981942.1	A4D2B0	MBLC1_HUMAN	metallo-beta-lactamase domain containing 1	64							hydrolase activity (GO:0016787)|metal ion binding (GO:0046872)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(1)|skin(1)	7						CCCCGCGCGGGAGTGGCGGCG	0.786													G|||	71	0.0141773	0.0023	0.0259	5008	,	,		10477	0.004		0.0388	False		,,,				2504	0.0072				p.G64G		.											.	MBLAC1-135	0			c.G192T						.	G		29,3009		0,29,1490	4.0	4.0	4.0		192	3.7	0.0	7	dbSNP_134	4	266,6806		2,262,3272	no	coding-synonymous	MBLAC1	NM_203397.1		2,291,4762	TT,TG,GG		3.7613,0.9546,2.9179		64/267	99725210	295,9815	1519	3536	5055	SO:0001819	synonymous_variant	255374	exon2			GCGCGGGAGTGGC	BC031288	CCDS43620.1	7q22	2014-02-12	2009-04-08		ENSG00000214309	ENSG00000214309			22180	protein-coding gene	gene with protein product							Standard	XM_005250250		Approved	MGC49416	uc003utp.3	A4D2B0	OTTHUMG00000154846	ENST00000398075.2:c.192G>T	7.37:g.99725210G>T		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	11	7	NM_203397	0	0	0	1	1	Q8N5X8	Silent	SNP	ENST00000398075.2	37	CCDS43620.1																																																																																			G|0.976;T|0.024		0.786	MBLAC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337353.1	NM_203397	
FLNC	2318	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	128496863	128496863	+	Missense_Mutation	SNP	C	C	G			TCGA-OR-A5KW-01A-11D-A29I-10	TCGA-OR-A5KW-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	67dfc56a-abc7-40c7-a901-6512ec38d5f5	804ec9eb-9f16-4ab9-b2dd-2abb72a53348	g.chr7:128496863C>G	ENST00000325888.8	+	45	7710	c.7449C>G	c.(7447-7449)aaC>aaG	p.N2483K	RP11-309L24.2_ENST00000469965.1_RNA|FLNC_ENST00000346177.6_Missense_Mutation_p.N2450K	NM_001458.4	NP_001449.3	Q14315	FLNC_HUMAN	filamin C, gamma	2483	Interaction with INPPL1.				cell junction assembly (GO:0034329)	costamere (GO:0043034)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|sarcoplasm (GO:0016528)	ankyrin binding (GO:0030506)|cytoskeletal protein binding (GO:0008092)	p.N2483N(2)		biliary_tract(1)|breast(7)|central_nervous_system(1)|cervix(1)|endometrium(19)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(19)|lung(59)|ovary(2)|pancreas(2)|prostate(1)|skin(6)|upper_aerodigestive_tract(2)	128						TCAAGTTCAACGGTGCCCACA	0.597																																					p.N2483K		.											.	FLNC-141	2	Substitution - coding silent(2)	lung(1)|breast(1)	c.C7449G						.						97.0	101.0	100.0					7																	128496863		2198	4296	6494	SO:0001583	missense	2318	exon45			GTTCAACGGTGCC	AB208865	CCDS43644.1, CCDS47705.1	7q32-q35	2014-09-17	2009-07-23		ENSG00000128591	ENSG00000128591			3756	protein-coding gene	gene with protein product	"""actin binding protein 280"""	102565	"""filamin C, gamma (actin binding protein 280)"""	FLN2		7689010, 8088838	Standard	NM_001458		Approved	ABP-280, ABPL	uc003vnz.4	Q14315	OTTHUMG00000023627	ENST00000325888.8:c.7449C>G	7.37:g.128496863C>G	ENSP00000327145:p.Asn2483Lys	Somatic	217	0		WXS	Illumina GAIIx	Phase_I	303	123	NM_001458	0	0	1	1	0	B2ZZ88|O95303|Q07985|Q9NS12|Q9NYE5|Q9UMR8|Q9Y503	Missense_Mutation	SNP	ENST00000325888.8	37	CCDS43644.1	.	.	.	.	.	.	.	.	.	.	T	14.95	2.689631	0.48097	.	.	ENSG00000128591	ENST00000325888;ENST00000346177	D;D	0.84370	-1.84;-1.84	5.52	-7.78	0.01223	Immunoglobulin E-set (1);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	D	0.89612	0.6765	M	0.66297	2.02	0.30829	N	0.736966	D;D	0.89917	0.999;1.0	D;D	0.85130	0.997;0.996	D	0.88719	0.3228	10	0.87932	D	0	.	20.1034	0.97882	0.0:0.7219:0.0:0.2781	.	2450;2483	Q14315-2;Q14315	.;FLNC_HUMAN	K	2483;2450	ENSP00000327145:N2483K;ENSP00000344002:N2450K	ENSP00000327145:N2483K	N	+	3	2	FLNC	128284099	0.000000	0.05858	0.268000	0.24571	0.732000	0.41865	-5.880000	0.00093	-2.239000	0.00711	-3.299000	0.00046	AAC	.		0.597	FLNC-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000059948.3		
KEL	3792	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	142651025	142651025	+	Missense_Mutation	SNP	C	C	A	rs374530605	byFrequency	TCGA-OR-A5KW-01A-11D-A29I-10	TCGA-OR-A5KW-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	67dfc56a-abc7-40c7-a901-6512ec38d5f5	804ec9eb-9f16-4ab9-b2dd-2abb72a53348	g.chr7:142651025C>A	ENST00000355265.2	-	9	1417	c.943G>T	c.(943-945)Gac>Tac	p.D315Y	KEL_ENST00000479768.2_5'UTR	NM_000420.2	NP_000411.1	P23276	KELL_HUMAN	Kell blood group, metallo-endopeptidase	315					vasoconstriction (GO:0042310)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)|metalloendopeptidase activity (GO:0004222)			central_nervous_system(1)|endometrium(3)|kidney(5)|large_intestine(11)|lung(34)|ovary(3)|prostate(2)|skin(1)	60	Melanoma(164;0.059)					GACAACCAGTCGATGGCGGGG	0.522																																					p.D315Y		.											.	KEL-93	0			c.G943T						.						94.0	90.0	91.0					7																	142651025		2203	4300	6503	SO:0001583	missense	3792	exon9			ACCAGTCGATGGC	BC003135	CCDS34766.1	7q33	2014-07-19	2006-10-10		ENSG00000197993	ENSG00000197993		"""CD molecules"", ""Blood group antigens"""	6308	protein-coding gene	gene with protein product		613883	"""Kell blood group"", ""Kell blood group, metalloendopeptidase"""			1712490, 7683930	Standard	NM_000420		Approved	ECE3, CD238	uc003wcb.3	P23276	OTTHUMG00000157159	ENST00000355265.2:c.943G>T	7.37:g.142651025C>A	ENSP00000347409:p.Asp315Tyr	Somatic	74	0		WXS	Illumina GAIIx	Phase_I	114	50	NM_000420	0	0	0	0	0	B2RBV4|Q96RS8|Q99885	Missense_Mutation	SNP	ENST00000355265.2	37	CCDS34766.1	.	.	.	.	.	.	.	.	.	.	C	22.3	4.267790	0.80469	.	.	ENSG00000197993	ENST00000355265	D	0.84944	-1.92	5.9	5.9	0.94986	Peptidase M13 (1);	0.188743	0.36893	N	0.002358	D	0.92237	0.7538	M	0.79475	2.455	0.46774	D	0.99919	D	0.89917	1.0	D	0.91635	0.999	D	0.92595	0.6086	10	0.87932	D	0	-17.8437	15.8327	0.78769	0.0:1.0:0.0:0.0	.	315	P23276	KELL_HUMAN	Y	315	ENSP00000347409:D315Y	ENSP00000347409:D315Y	D	-	1	0	KEL	142361147	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	2.945000	0.49043	2.817000	0.96982	0.478000	0.44815	GAC	.		0.522	KEL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347671.2	NM_000420	
ASIC3	9311	broad.mit.edu	37	7	150746080	150746080	+	Silent	SNP	C	C	A			TCGA-OR-A5KW-01A-11D-A29I-10	TCGA-OR-A5KW-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	67dfc56a-abc7-40c7-a901-6512ec38d5f5	804ec9eb-9f16-4ab9-b2dd-2abb72a53348	g.chr7:150746080C>A	ENST00000349064.5	+	1	306	c.108C>A	c.(106-108)ggC>ggA	p.G36G	ASIC3_ENST00000357922.4_Silent_p.G36G|ASIC3_ENST00000297512.8_Silent_p.G36G	NM_004769.3|NM_020321.3	NP_004760.1|NP_064717.1	Q9UHC3	ASIC3_HUMAN	acid-sensing (proton-gated) ion channel 3	36					cation transmembrane transport (GO:0098655)|detection of chemical stimulus involved in sensory perception of pain (GO:0050968)|detection of mechanical stimulus involved in sensory perception of pain (GO:0050966)|detection of temperature stimulus involved in sensory perception of pain (GO:0050965)|ion transmembrane transport (GO:0034220)|response to acid chemical (GO:0001101)|response to acidic pH (GO:0010447)|response to heat (GO:0009408)|sensory perception (GO:0007600)|sensory perception of sour taste (GO:0050915)|signal transduction (GO:0007165)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)|transport (GO:0006810)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	cation channel activity (GO:0005261)|enterobactin transporter activity (GO:0042931)|ligand-gated sodium channel activity (GO:0015280)|sodium channel activity (GO:0005272)										TCGGGCCAGGCAGCCTGAGCC	0.697																																					p.G36G		.											.	.	0			c.C108A						.						39.0	41.0	40.0					7																	150746080		2202	4298	6500	SO:0001819	synonymous_variant	9311	exon1			GCCAGGCAGCCTG	AB010575	CCDS5914.1, CCDS5915.1, CCDS5916.1	7q35	2012-02-23	2012-02-22	2012-02-22	ENSG00000213199	ENSG00000213199		"""Ion channels / Acid-sensing (proton-gated) ion channels"""	101	protein-coding gene	gene with protein product	"""testis sodium channel 1"""	611741	"""amiloride-sensitive cation channel 3, testis"", ""amiloride-sensitive cation channel 3"""	ACCN3		9571199, 9744806	Standard	NM_004769		Approved	TNaC1, DRASIC	uc003wio.3	Q9UHC3	OTTHUMG00000158685	ENST00000349064.5:c.108C>A	7.37:g.150746080C>A		Somatic	20	0		WXS	Illumina GAIIx	Phase_I	126	15	NM_020322	0	0	2	2	0	B2R9V0|O60263|O75906|Q59FN9|Q9UER8|Q9UHC4	Silent	SNP	ENST00000349064.5	37	CCDS5916.1																																																																																			.		0.697	ASIC3-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351725.1	NM_004769	
BHLHE22	27319	hgsc.bcm.edu	37	8	65493532	65493532	+	Missense_Mutation	SNP	T	T	A	rs62519835	byFrequency	TCGA-OR-A5KW-01A-11D-A29I-10	TCGA-OR-A5KW-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	67dfc56a-abc7-40c7-a901-6512ec38d5f5	804ec9eb-9f16-4ab9-b2dd-2abb72a53348	g.chr8:65493532T>A	ENST00000321870.1	+	1	719	c.185T>A	c.(184-186)cTg>cAg	p.L62Q	RP11-21C4.1_ENST00000517909.1_RNA	NM_152414.4	NP_689627.1	Q8NFJ8	BHE22_HUMAN	basic helix-loop-helix family, member e22	62					anterior commissure morphogenesis (GO:0021960)|cerebral cortex regionalization (GO:0021796)|corpus callosum morphogenesis (GO:0021540)|corticospinal tract morphogenesis (GO:0021957)|negative regulation of transcription, DNA-templated (GO:0045892)|retinal bipolar neuron differentiation (GO:0060040)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)	p.L62Q(1)		NS(1)|central_nervous_system(1)|lung(1)|prostate(1)|skin(1)	5						TCGTCGCCCCTGGGCTGCTTC	0.776													T|||	233	0.0465256	0.0053	0.0706	5008	,	,		6928	0.004		0.1481	False		,,,				2504	0.0245				p.L62Q	Colon(113;104 1586 2865 9855 18065)	.											.	BHLHE22-90	1	Substitution - Missense(1)	NS(1)	c.T185A						.	T	GLN/LEU	38,3528		0,38,1745	4.0	5.0	4.0		185	2.0	1.0	8	dbSNP_129	4	573,6683		11,551,3066	no	missense	BHLHE22	NM_152414.4	113	11,589,4811	AA,AT,TT		7.8969,1.0656,5.6459	probably-damaging	62/382	65493532	611,10211	1783	3628	5411	SO:0001583	missense	27319	exon1			CGCCCCTGGGCTG	U80755	CCDS6179.1	8q12.1	2009-01-12	2009-01-12	2009-01-12		ENSG00000180828		"""Basic helix-loop-helix proteins"""	11963	protein-coding gene	gene with protein product		613483	"""trinucleotide repeat containing 20"", ""basic helix-loop-helix domain containing, class B, 5"""	TNRC20, BHLHB5		9225980, 12213201, 18557763	Standard	NM_152414		Approved	CAGL85, Beta3, bHLHe22	uc003xvi.3	Q8NFJ8		ENST00000321870.1:c.185T>A	8.37:g.65493532T>A	ENSP00000318799:p.Leu62Gln	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	9	9	NM_152414	0	0	0	0	0		Missense_Mutation	SNP	ENST00000321870.1	37	CCDS6179.1	139	0.06364468864468864	5	0.01016260162601626	24	0.06629834254143646	1	0.0017482517482517483	109	0.1437994722955145	T	14.21	2.468289	0.43839	0.010656	0.078969	ENSG00000180828	ENST00000321870	D	0.97888	-4.59	3.18	1.96	0.26148	.	0.107189	0.40144	U	0.001175	T	0.10252	0.0251	N	0.24115	0.695	0.35078	P	0.23685	B	0.34015	0.435	B	0.31337	0.128	T	0.66941	-0.5796	9	0.54805	T	0.06	-9.9523	5.2123	0.15325	0.0:0.1025:0.1827:0.7148	rs62519835	62	Q8NFJ8	BHE22_HUMAN	Q	62	ENSP00000318799:L62Q	ENSP00000318799:L62Q	L	+	2	0	BHLHE22	65656086	0.992000	0.36948	1.000000	0.80357	0.982000	0.71751	2.935000	0.48963	0.410000	0.25675	0.374000	0.22700	CTG	T|0.935;A|0.065		0.776	BHLHE22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378549.1	NM_152414	
ZBTB10	65986	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	8	81399960	81399962	+	In_Frame_Del	DEL	CCT	CCT	-	rs368014947		TCGA-OR-A5KW-01A-11D-A29I-10	TCGA-OR-A5KW-10A-01D-A29L-10	CCT	CCT	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	67dfc56a-abc7-40c7-a901-6512ec38d5f5	804ec9eb-9f16-4ab9-b2dd-2abb72a53348	g.chr8:81399960_81399962delCCT	ENST00000430430.1	+	2	1694_1696	c.915_917delCCT	c.(913-918)accctc>acc	p.L308del	ZBTB10_ENST00000455036.3_In_Frame_Del_p.L308del|Y_RNA_ENST00000605948.1_RNA|ZBTB10_ENST00000426744.2_In_Frame_Del_p.L308del|ZBTB10_ENST00000379091.4_Intron	NM_001277145.1	NP_001264074.1	Q96DT7	ZBT10_HUMAN	zinc finger and BTB domain containing 10	308					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(7)|ovary(1)|upper_aerodigestive_tract(4)	20	all_cancers(3;1.68e-09)|all_epithelial(4;5.13e-11)|Lung NSC(7;1.75e-07)|all_lung(9;7.38e-07)|Breast(3;2.96e-06)		BRCA - Breast invasive adenocarcinoma(6;0.000434)|Epithelial(68;0.00486)|all cancers(69;0.0296)			ACAAGAAAACCCTCCTCCTGAGG	0.557																																					p.305_306del		.											.	ZBTB10-522	0			c.915_917del						.																																			SO:0001651	inframe_deletion	65986	exon1			GAAAACCCTCCTC	AK022814	CCDS47880.1, CCDS64920.1	8q13-q21.1	2013-01-09			ENSG00000205189	ENSG00000205189		"""-"", ""BTB/POZ domain containing"", ""Zinc fingers, C2H2-type"""	30953	protein-coding gene	gene with protein product						12477932	Standard	NM_001105539		Approved	RINZF, FLJ12752	uc003ybx.5	Q96DT7	OTTHUMG00000155016	ENST00000430430.1:c.915_917delCCT	8.37:g.81399966_81399968delCCT	ENSP00000387462:p.Leu308del	Somatic	39	0		WXS	Illumina GAIIx	Phase_I	68	33	NM_023929	0	0	0	0	0	A4FVD0|Q86W96|Q8IXI9|Q96MH9	In_Frame_Del	DEL	ENST00000430430.1	37	CCDS47880.1																																																																																			.		0.557	ZBTB10-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000338055.2	NM_023929	
EPPK1	83481	bcgsc.ca	37	8	144940450	144940450	+	Silent	SNP	G	G	C	rs56258403		TCGA-OR-A5KW-01A-11D-A29I-10	TCGA-OR-A5KW-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	67dfc56a-abc7-40c7-a901-6512ec38d5f5	804ec9eb-9f16-4ab9-b2dd-2abb72a53348	g.chr8:144940450G>C	ENST00000525985.1	-	2	7043	c.6972C>G	c.(6970-6972)gcC>gcG	p.A2324A				P58107	EPIPL_HUMAN	epiplakin 1	2324						cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)	poly(A) RNA binding (GO:0044822)			NS(1)|autonomic_ganglia(1)|breast(1)|central_nervous_system(5)|cervix(1)|endometrium(8)|kidney(4)|large_intestine(2)|lung(30)|ovary(2)|pancreas(1)|prostate(10)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	71	all_cancers(97;1.42e-10)|all_epithelial(106;1.99e-09)|Lung NSC(106;0.000126)|all_lung(105;0.000354)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;2.46e-41)|Epithelial(56;2.88e-40)|all cancers(56;1.82e-35)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.105)			CCTTCTGCATGGCCTGGAAGA	0.697																																					p.A2324A		.											.	EPPK1-25	0			c.C6972G						.						198.0	193.0	195.0					8																	144940450		2181	4258	6439	SO:0001819	synonymous_variant	83481	exon1			CTGCATGGCCTGG	AB051895	CCDS75800.1	8q24.3	2014-09-17				ENSG00000261150			15577	protein-coding gene	gene with protein product	"""epidermal autoantigen 450K"""	607553				11278896, 15671067	Standard	NM_031308		Approved	EPIPL1	uc003zaa.1	P58107		ENST00000525985.1:c.6972C>G	8.37:g.144940450G>C		Somatic	123	1		WXS	Illumina GAIIx	Phase_I	427	18	NM_031308	0	0	1	1	0	Q76E58|Q9NSU9	Silent	SNP	ENST00000525985.1	37																																																																																				.		0.697	EPPK1-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000382675.1	NM_031308	
EPPK1	83481	bcgsc.ca	37	8	144940462	144940462	+	Silent	SNP	G	G	A	rs56146920		TCGA-OR-A5KW-01A-11D-A29I-10	TCGA-OR-A5KW-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	67dfc56a-abc7-40c7-a901-6512ec38d5f5	804ec9eb-9f16-4ab9-b2dd-2abb72a53348	g.chr8:144940462G>A	ENST00000525985.1	-	2	7031	c.6960C>T	c.(6958-6960)tcC>tcT	p.S2320S				P58107	EPIPL_HUMAN	epiplakin 1	2320						cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)	poly(A) RNA binding (GO:0044822)			NS(1)|autonomic_ganglia(1)|breast(1)|central_nervous_system(5)|cervix(1)|endometrium(8)|kidney(4)|large_intestine(2)|lung(30)|ovary(2)|pancreas(1)|prostate(10)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	71	all_cancers(97;1.42e-10)|all_epithelial(106;1.99e-09)|Lung NSC(106;0.000126)|all_lung(105;0.000354)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;2.46e-41)|Epithelial(56;2.88e-40)|all cancers(56;1.82e-35)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.105)			CCTGGAAGAGGGAGATCTGCT	0.701																																					p.S2320S		.											.	EPPK1-25	0			c.C6960T						.	G		13,4351		0,13,2169	199.0	190.0	193.0		6960	-0.8	1.0	8	dbSNP_129	193	1,8519		0,1,4259	no	coding-synonymous	EPPK1	NM_031308.1		0,14,6428	AA,AG,GG		0.0117,0.2979,0.1087		2320/2420	144940462	14,12870	2182	4260	6442	SO:0001819	synonymous_variant	83481	exon1			GAAGAGGGAGATC	AB051895	CCDS75800.1	8q24.3	2014-09-17				ENSG00000261150			15577	protein-coding gene	gene with protein product	"""epidermal autoantigen 450K"""	607553				11278896, 15671067	Standard	NM_031308		Approved	EPIPL1	uc003zaa.1	P58107		ENST00000525985.1:c.6960C>T	8.37:g.144940462G>A		Somatic	124	2		WXS	Illumina GAIIx	Phase_I	420	14	NM_031308	0	0	0	0	0	Q76E58|Q9NSU9	Silent	SNP	ENST00000525985.1	37																																																																																				G|0.500;A|0.500		0.701	EPPK1-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000382675.1	NM_031308	
EPPK1	83481	bcgsc.ca	37	8	144940474	144940474	+	Silent	SNP	C	C	T	rs56015972		TCGA-OR-A5KW-01A-11D-A29I-10	TCGA-OR-A5KW-10A-01D-A29L-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	67dfc56a-abc7-40c7-a901-6512ec38d5f5	804ec9eb-9f16-4ab9-b2dd-2abb72a53348	g.chr8:144940474C>T	ENST00000525985.1	-	2	7019	c.6948G>A	c.(6946-6948)ggG>ggA	p.G2316G				P58107	EPIPL_HUMAN	epiplakin 1	2316						cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)	poly(A) RNA binding (GO:0044822)			NS(1)|autonomic_ganglia(1)|breast(1)|central_nervous_system(5)|cervix(1)|endometrium(8)|kidney(4)|large_intestine(2)|lung(30)|ovary(2)|pancreas(1)|prostate(10)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	71	all_cancers(97;1.42e-10)|all_epithelial(106;1.99e-09)|Lung NSC(106;0.000126)|all_lung(105;0.000354)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;2.46e-41)|Epithelial(56;2.88e-40)|all cancers(56;1.82e-35)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.105)			AGATCTGCTGCCCGGTGTAGG	0.706																																					p.G2316G		.											.	EPPK1-25	0			c.G6948A						.	C		17,4343		0,17,2163	198.0	188.0	192.0		6948	-1.0	1.0	8	dbSNP_129	192	4,8524		0,4,4260	no	coding-synonymous	EPPK1	NM_031308.1		0,21,6423	TT,TC,CC		0.0469,0.3899,0.1629		2316/2420	144940474	21,12867	2180	4264	6444	SO:0001819	synonymous_variant	83481	exon1			CTGCTGCCCGGTG	AB051895	CCDS75800.1	8q24.3	2014-09-17				ENSG00000261150			15577	protein-coding gene	gene with protein product	"""epidermal autoantigen 450K"""	607553				11278896, 15671067	Standard	NM_031308		Approved	EPIPL1	uc003zaa.1	P58107		ENST00000525985.1:c.6948G>A	8.37:g.144940474C>T		Somatic	115	1		WXS	Illumina GAIIx	Phase_I	398	12	NM_031308	0	0	0	0	0	Q76E58|Q9NSU9	Silent	SNP	ENST00000525985.1	37																																																																																				C|0.500;T|0.500		0.706	EPPK1-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000382675.1	NM_031308	
PLEC	5339	hgsc.bcm.edu	37	8	144990528	144990528	+	Silent	SNP	A	A	G	rs7014582	byFrequency	TCGA-OR-A5KW-01A-11D-A29I-10	TCGA-OR-A5KW-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	67dfc56a-abc7-40c7-a901-6512ec38d5f5	804ec9eb-9f16-4ab9-b2dd-2abb72a53348	g.chr8:144990528A>G	ENST00000322810.4	-	32	14041	c.13872T>C	c.(13870-13872)gcT>gcC	p.A4624A	PLEC_ENST00000527096.1_Silent_p.A4510A|PLEC_ENST00000357649.2_Silent_p.A4491A|PLEC_ENST00000345136.3_Silent_p.A4487A|PLEC_ENST00000354958.2_Silent_p.A4465A|PLEC_ENST00000356346.3_Silent_p.A4473A|PLEC_ENST00000354589.3_Silent_p.A4487A|PLEC_ENST00000398774.2_Silent_p.A4455A|PLEC_ENST00000436759.2_Silent_p.A4514A	NM_201380.2	NP_958782.1	Q15149	PLEC_HUMAN	plectin	4624	Globular 2.				apoptotic process (GO:0006915)|cell junction assembly (GO:0034329)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)	costamere (GO:0043034)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|hemidesmosome (GO:0030056)|intermediate filament cytoskeleton (GO:0045111)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|sarcoplasm (GO:0016528)	ankyrin binding (GO:0030506)|poly(A) RNA binding (GO:0044822)|structural constituent of muscle (GO:0008307)			NS(1)|breast(3)|central_nervous_system(4)|cervix(7)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(8)|lung(57)|ovary(4)|pancreas(2)|prostate(11)|skin(9)|stomach(2)|upper_aerodigestive_tract(10)	137						TGCGGGAGCCAGCGGTAGAGC	0.716													G|||	2389	0.477037	0.8979	0.3746	5008	,	,		8857	0.1508		0.4404	False		,,,				2504	0.3548				p.A4624A		.											.	PLEC-141	0			c.T13872C						.	G	,,,,,,,	2833,621		1197,439,91	12.0	16.0	15.0		13542,13419,13395,13872,13365,13461,13473,13461	-8.1	0.0	8	dbSNP_116	15	3324,4610		785,1754,1428	no	coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous	PLEC	NM_000445.3,NM_201378.2,NM_201379.1,NM_201380.2,NM_201381.1,NM_201382.2,NM_201383.1,NM_201384.1	,,,,,,,	1982,2193,1519	GG,GA,AA		41.8956,17.9792,45.9343	,,,,,,,	4514/4575,4473/4534,4465/4526,4624/4685,4455/4516,4487/4548,4491/4552,4487/4548	144990528	6157,5231	1727	3967	5694	SO:0001819	synonymous_variant	5339	exon32			GGAGCCAGCGGTA	U53204	CCDS43769.1, CCDS43770.1, CCDS43771.1, CCDS43772.1, CCDS43773.1, CCDS43774.1, CCDS43775.1, CCDS47936.1	8q24	2010-02-04	2010-02-04	2010-02-04	ENSG00000178209	ENSG00000178209			9069	protein-coding gene	gene with protein product		601282	"""plectin 1, intermediate filament binding protein, 500kD"", ""epidermolysis bullosa simplex 1 (Ogna)"", ""plectin 1, intermediate filament binding protein 500kDa"""	EBS1, PLEC1		8633055, 8696340	Standard	XM_005250976		Approved	PCN, PLTN	uc003zaf.1	Q15149	OTTHUMG00000165291	ENST00000322810.4:c.13872T>C	8.37:g.144990528A>G		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	28	10	NM_201380	0	0	30	50	20	Q15148|Q16640|Q6S376|Q6S377|Q6S378|Q6S379|Q6S380|Q6S381|Q6S382|Q6S383	Silent	SNP	ENST00000322810.4	37	CCDS43772.1																																																																																			A|0.536;G|0.464		0.716	PLEC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383281.1	NM_000445	
PLEC	5339	hgsc.bcm.edu	37	8	144990784	144990784	+	Missense_Mutation	SNP	G	G	A	rs113513807	byFrequency	TCGA-OR-A5KW-01A-11D-A29I-10	TCGA-OR-A5KW-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	67dfc56a-abc7-40c7-a901-6512ec38d5f5	804ec9eb-9f16-4ab9-b2dd-2abb72a53348	g.chr8:144990784G>A	ENST00000322810.4	-	32	13785	c.13616C>T	c.(13615-13617)aCg>aTg	p.T4539M	PLEC_ENST00000527096.1_Missense_Mutation_p.T4425M|PLEC_ENST00000357649.2_Missense_Mutation_p.T4406M|PLEC_ENST00000345136.3_Missense_Mutation_p.T4402M|PLEC_ENST00000354958.2_Missense_Mutation_p.T4380M|PLEC_ENST00000356346.3_Missense_Mutation_p.T4388M|PLEC_ENST00000354589.3_Missense_Mutation_p.T4402M|PLEC_ENST00000398774.2_Missense_Mutation_p.T4370M|PLEC_ENST00000436759.2_Missense_Mutation_p.T4429M	NM_201380.2	NP_958782.1	Q15149	PLEC_HUMAN	plectin	4539	Globular 2.				apoptotic process (GO:0006915)|cell junction assembly (GO:0034329)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)	costamere (GO:0043034)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|hemidesmosome (GO:0030056)|intermediate filament cytoskeleton (GO:0045111)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|sarcoplasm (GO:0016528)	ankyrin binding (GO:0030506)|poly(A) RNA binding (GO:0044822)|structural constituent of muscle (GO:0008307)			NS(1)|breast(3)|central_nervous_system(4)|cervix(7)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(8)|lung(57)|ovary(4)|pancreas(2)|prostate(11)|skin(9)|stomach(2)|upper_aerodigestive_tract(10)	137						GCGGCCCGGCGTGTCGGGCTC	0.711													G|||	41	0.0081869	0.0023	0.0086	5008	,	,		12325	0.0		0.0209	False		,,,				2504	0.0112				p.T4539M		.											.	PLEC-141	0			c.C13616T						.	G	MET/THR,MET/THR,MET/THR,MET/THR,MET/THR,MET/THR,MET/THR,MET/THR	14,3822		0,14,1904	19.0	24.0	22.0		13286,13163,13139,13616,13109,13205,13217,13205	-3.7	0.0	8	dbSNP_132	22	209,7973		4,201,3886	yes	missense,missense,missense,missense,missense,missense,missense,missense	PLEC	NM_000445.3,NM_201378.2,NM_201379.1,NM_201380.2,NM_201381.1,NM_201382.2,NM_201383.1,NM_201384.1	81,81,81,81,81,81,81,81	4,215,5790	AA,AG,GG		2.5544,0.365,1.8556	probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging	4429/4575,4388/4534,4380/4526,4539/4685,4370/4516,4402/4548,4406/4552,4402/4548	144990784	223,11795	1918	4091	6009	SO:0001583	missense	5339	exon32			CCCGGCGTGTCGG	U53204	CCDS43769.1, CCDS43770.1, CCDS43771.1, CCDS43772.1, CCDS43773.1, CCDS43774.1, CCDS43775.1, CCDS47936.1	8q24	2010-02-04	2010-02-04	2010-02-04	ENSG00000178209	ENSG00000178209			9069	protein-coding gene	gene with protein product		601282	"""plectin 1, intermediate filament binding protein, 500kD"", ""epidermolysis bullosa simplex 1 (Ogna)"", ""plectin 1, intermediate filament binding protein 500kDa"""	EBS1, PLEC1		8633055, 8696340	Standard	XM_005250976		Approved	PCN, PLTN	uc003zaf.1	Q15149	OTTHUMG00000165291	ENST00000322810.4:c.13616C>T	8.37:g.144990784G>A	ENSP00000323856:p.Thr4539Met	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	35	15	NM_201380	0	0	42	72	30	Q15148|Q16640|Q6S376|Q6S377|Q6S378|Q6S379|Q6S380|Q6S381|Q6S382|Q6S383	Missense_Mutation	SNP	ENST00000322810.4	37	CCDS43772.1	22	0.010073260073260074	2	0.0040650406504065045	4	0.011049723756906077	0	0.0	16	0.021108179419525065	G	1.795	-0.478413	0.04414	0.00365	0.025544	ENSG00000178209	ENST00000345136;ENST00000357649;ENST00000354589;ENST00000398774;ENST00000322810;ENST00000354958;ENST00000356346;ENST00000436759;ENST00000527096	T;T;T;T;T;T;T;T;T	0.79454	-1.27;-1.27;-1.27;-1.27;-1.27;-1.27;-1.27;-1.27;-1.27	5.05	-3.73	0.04398	.	1.783410	0.03800	N	0.264398	T	0.53498	0.1800	L	0.61218	1.895	0.09310	N	1	B;B;B;B;B;B;B;B	0.11235	0.004;0.004;0.004;0.004;0.004;0.004;0.004;0.004	B;B;B;B;B;B;B;B	0.10450	0.003;0.003;0.003;0.005;0.003;0.003;0.003;0.003	T	0.57854	-0.7739	10	0.49607	T	0.09	.	11.9977	0.53212	0.5313:0.0:0.4687:0.0	.	4429;4388;4380;4539;4370;4402;4406;4402	Q15149-2;Q15149-9;Q15149-8;Q15149;Q15149-7;Q15149-5;Q15149-6;Q15149-4	.;.;.;PLEC_HUMAN;.;.;.;.	M	4402;4406;4402;4370;4539;4380;4388;4429;4425	ENSP00000344848:T4402M;ENSP00000350277:T4406M;ENSP00000346602:T4402M;ENSP00000381756:T4370M;ENSP00000323856:T4539M;ENSP00000347044:T4380M;ENSP00000348702:T4388M;ENSP00000388180:T4429M;ENSP00000434583:T4425M	ENSP00000323856:T4539M	T	-	2	0	PLEC	145062772	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	-0.310000	0.08135	-1.195000	0.02680	-0.766000	0.03442	ACG	A|0.013;C|0.000;G|0.987		0.711	PLEC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383281.1	NM_000445	
PLEC	5339	hgsc.bcm.edu	37	8	144999417	144999417	+	Silent	SNP	C	C	T	rs55836855	byFrequency	TCGA-OR-A5KW-01A-11D-A29I-10	TCGA-OR-A5KW-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	67dfc56a-abc7-40c7-a901-6512ec38d5f5	804ec9eb-9f16-4ab9-b2dd-2abb72a53348	g.chr8:144999417C>T	ENST00000322810.4	-	31	5260	c.5091G>A	c.(5089-5091)gcG>gcA	p.A1697A	PLEC_ENST00000527096.1_Silent_p.A1583A|PLEC_ENST00000357649.2_Silent_p.A1564A|PLEC_ENST00000345136.3_Silent_p.A1560A|PLEC_ENST00000354958.2_Silent_p.A1538A|PLEC_ENST00000356346.3_Silent_p.A1546A|PLEC_ENST00000354589.3_Silent_p.A1560A|PLEC_ENST00000398774.2_Silent_p.A1528A|PLEC_ENST00000436759.2_Silent_p.A1587A	NM_201380.2	NP_958782.1	Q15149	PLEC_HUMAN	plectin	1697	Central fibrous rod domain.				apoptotic process (GO:0006915)|cell junction assembly (GO:0034329)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)	costamere (GO:0043034)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|hemidesmosome (GO:0030056)|intermediate filament cytoskeleton (GO:0045111)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|sarcoplasm (GO:0016528)	ankyrin binding (GO:0030506)|poly(A) RNA binding (GO:0044822)|structural constituent of muscle (GO:0008307)			NS(1)|breast(3)|central_nervous_system(4)|cervix(7)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(8)|lung(57)|ovary(4)|pancreas(2)|prostate(11)|skin(9)|stomach(2)|upper_aerodigestive_tract(10)	137						GTACCTGCCGCGCTCGCTCCA	0.741													C|||	1156	0.230831	0.028	0.2954	5008	,	,		8861	0.1429		0.4274	False		,,,				2504	0.3476				p.A1697A		.											.	PLEC-141	0			c.G5091A						.	C	,,,,,,,	258,3112		16,226,1443	6.0	7.0	7.0		4761,4638,4614,5091,4584,4680,4692,4680	-9.4	0.1	8	dbSNP_129	7	2520,4470		444,1632,1419	no	coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous	PLEC	NM_000445.3,NM_201378.2,NM_201379.1,NM_201380.2,NM_201381.1,NM_201382.2,NM_201383.1,NM_201384.1	,,,,,,,	460,1858,2862	TT,TC,CC		36.0515,7.6558,26.8147	,,,,,,,	1587/4575,1546/4534,1538/4526,1697/4685,1528/4516,1560/4548,1564/4552,1560/4548	144999417	2778,7582	1685	3495	5180	SO:0001819	synonymous_variant	5339	exon31			CTGCCGCGCTCGC	U53204	CCDS43769.1, CCDS43770.1, CCDS43771.1, CCDS43772.1, CCDS43773.1, CCDS43774.1, CCDS43775.1, CCDS47936.1	8q24	2010-02-04	2010-02-04	2010-02-04	ENSG00000178209	ENSG00000178209			9069	protein-coding gene	gene with protein product		601282	"""plectin 1, intermediate filament binding protein, 500kD"", ""epidermolysis bullosa simplex 1 (Ogna)"", ""plectin 1, intermediate filament binding protein 500kDa"""	EBS1, PLEC1		8633055, 8696340	Standard	XM_005250976		Approved	PCN, PLTN	uc003zaf.1	Q15149	OTTHUMG00000165291	ENST00000322810.4:c.5091G>A	8.37:g.144999417C>T		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	6	5	NM_201380	0	0	1	1	0	Q15148|Q16640|Q6S376|Q6S377|Q6S378|Q6S379|Q6S380|Q6S381|Q6S382|Q6S383	Silent	SNP	ENST00000322810.4	37	CCDS43772.1																																																																																			C|0.731;T|0.269		0.741	PLEC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383281.1	NM_000445	
CPSF1	29894	broad.mit.edu	37	8	145623200	145623200	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5KW-01A-11D-A29I-10	TCGA-OR-A5KW-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	67dfc56a-abc7-40c7-a901-6512ec38d5f5	804ec9eb-9f16-4ab9-b2dd-2abb72a53348	g.chr8:145623200C>T	ENST00000349769.3	-	20	2136	c.2042G>A	c.(2041-2043)cGc>cAc	p.R681H	MIR1234_ENST00000408875.1_RNA	NM_013291.2	NP_037423.2	Q10570	CPSF1_HUMAN	cleavage and polyadenylation specific factor 1, 160kDa	681					gene expression (GO:0010467)|mRNA 3'-end processing (GO:0031124)|mRNA cleavage (GO:0006379)|mRNA export from nucleus (GO:0006406)|mRNA polyadenylation (GO:0006378)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	mRNA cleavage and polyadenylation specificity factor complex (GO:0005847)|nucleoplasm (GO:0005654)	mRNA 3'-UTR binding (GO:0003730)			NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(5)|lung(15)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	38	all_cancers(97;6.64e-12)|all_epithelial(106;2.89e-10)|Lung NSC(106;5.7e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;2.88e-41)|Epithelial(56;1.67e-40)|all cancers(56;1.2e-35)|BRCA - Breast invasive adenocarcinoma(115;0.0323)|Colorectal(110;0.055)			CAGCGCCAGGCGGTGGTGGCG	0.692																																					p.R681H	NSCLC(133;1088 1848 27708 34777 35269)	.											.	CPSF1-91	0			c.G2042A						.						60.0	61.0	61.0					8																	145623200		2201	4295	6496	SO:0001583	missense	29894	exon20			GCCAGGCGGTGGT	U37012	CCDS34966.1	8q24	2014-05-06	2002-08-29		ENSG00000071894	ENSG00000071894			2324	protein-coding gene	gene with protein product		606027	"""cleavage and polyadenylation specific factor 1, 160kD subunit"""			7651824, 7590244	Standard	NM_013291		Approved		uc003zcj.3	Q10570	OTTHUMG00000174612	ENST00000349769.3:c.2042G>A	8.37:g.145623200C>T	ENSP00000339353:p.Arg681His	Somatic	28	2		WXS	Illumina GAIIx	Phase_I	85	5	NM_013291	0	0	22	22	0	Q96AF0	Missense_Mutation	SNP	ENST00000349769.3	37	CCDS34966.1	.	.	.	.	.	.	.	.	.	.	C	31	5.070171	0.93950	.	.	ENSG00000071894	ENST00000349769	T	0.33216	1.42	5.43	5.43	0.79202	.	0.000000	0.85682	D	0.000000	T	0.39036	0.1063	M	0.62723	1.935	0.80722	D	1	D	0.69078	0.997	P	0.47251	0.542	T	0.33420	-0.9869	10	0.66056	D	0.02	-11.3556	14.7099	0.69222	0.0:1.0:0.0:0.0	.	681	Q10570	CPSF1_HUMAN	H	681	ENSP00000339353:R681H	ENSP00000339353:R681H	R	-	2	0	CPSF1	145594008	1.000000	0.71417	1.000000	0.80357	0.768000	0.43524	6.606000	0.74159	2.541000	0.85698	0.491000	0.48974	CGC	.		0.692	CPSF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382422.2	NM_013291	
KIF12	113220	broad.mit.edu	37	9	116854241	116854241	+	Missense_Mutation	SNP	G	G	T			TCGA-OR-A5KW-01A-11D-A29I-10	TCGA-OR-A5KW-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	67dfc56a-abc7-40c7-a901-6512ec38d5f5	804ec9eb-9f16-4ab9-b2dd-2abb72a53348	g.chr9:116854241G>T	ENST00000374118.3	-	16	1679	c.1442C>A	c.(1441-1443)gCc>gAc	p.A481D	KIF12_ENST00000473174.1_5'Flank	NM_138424.1	NP_612433.1	Q96FN5	KIF12_HUMAN	kinesin family member 12	614	Pro-rich.				ATP catabolic process (GO:0006200)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			breast(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(5)|prostate(1)|skin(1)|urinary_tract(1)	17						GTCTCTGAGGGCCTCCAGTCT	0.672																																					p.A481D		.											.	KIF12-90	0			c.C1442A						.						33.0	34.0	34.0					9																	116854241		2203	4300	6503	SO:0001583	missense	113220	exon16			CTGAGGGCCTCCA	BC010626	CCDS6801.1	9q33.1	2008-02-05			ENSG00000136883	ENSG00000136883		"""Kinesins"""	21495	protein-coding gene	gene with protein product		611278					Standard	NM_138424		Approved		uc004bif.3	Q96FN5	OTTHUMG00000020533	ENST00000374118.3:c.1442C>A	9.37:g.116854241G>T	ENSP00000363232:p.Ala481Asp	Somatic	83	1		WXS	Illumina GAIIx	Phase_I	102	10	NM_138424	0	0	0	0	0	Q5TBE0	Missense_Mutation	SNP	ENST00000374118.3	37	CCDS6801.1	.	.	.	.	.	.	.	.	.	.	G	18.89	3.718943	0.68844	.	.	ENSG00000136883	ENST00000374118;ENST00000259410	T	0.76060	-0.99	3.86	3.86	0.44501	.	0.106806	0.41294	D	0.000901	T	0.62221	0.2410	L	0.32530	0.975	0.29827	N	0.830327	P	0.41313	0.745	B	0.37346	0.247	T	0.68062	-0.5508	10	0.87932	D	0	.	11.6029	0.51015	0.0:0.0:1.0:0.0	.	614	Q96FN5	KIF12_HUMAN	D	481;614	ENSP00000363232:A481D	ENSP00000259410:A614D	A	-	2	0	KIF12	115894062	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	2.655000	0.46707	2.454000	0.82982	0.442000	0.29010	GCC	.		0.672	KIF12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053751.1	NM_138424	
SRPX	8406	broad.mit.edu	37	X	38079976	38079978	+	In_Frame_Del	DEL	GCA	GCA	-	rs35523939|rs72249350|rs139109693		TCGA-OR-A5KW-01A-11D-A29I-10	TCGA-OR-A5KW-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	67dfc56a-abc7-40c7-a901-6512ec38d5f5	804ec9eb-9f16-4ab9-b2dd-2abb72a53348	g.chrX:38079976_38079978delGCA	ENST00000378533.3	-	1	174_176	c.68_70delTGC	c.(67-72)ctgcgc>cgc	p.L23del	SRPX_ENST00000432886.2_In_Frame_Del_p.L23del|RP13-43E11.1_ENST00000423919.1_RNA|TM4SF2_ENST00000465127.1_Intron|SRPX_ENST00000544439.1_In_Frame_Del_p.L23del|SRPX_ENST00000343800.6_Intron|SRPX_ENST00000538295.1_In_Frame_Del_p.L23del	NM_006307.4	NP_006298.1	P78539	SRPX_HUMAN	sushi-repeat containing protein, X-linked	23			Missing. {ECO:0000269|PubMed:14702039, ECO:0000269|PubMed:8634709, ECO:0000269|PubMed:9162095}.		autophagy (GO:0006914)|cell adhesion (GO:0007155)|negative regulation of cell proliferation involved in contact inhibition (GO:0060244)|phagolysosome assembly (GO:0001845)|positive regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001241)|response to endoplasmic reticulum stress (GO:0034976)	autophagic vacuole (GO:0005776)|endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)		p.L23delL(2)		autonomic_ganglia(1)|breast(2)|endometrium(5)|large_intestine(5)|lung(10)|prostate(2)	25						GGCGGGACGCgcagcagcagcag	0.729											OREG0019726	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)		636	0.168477	0.1657	0.1398	3775	,	,		8591	0.0129		0.2028	False		,,,				2504	0.1053				p.23_24del		.											.	SRPX-130	2	Deletion - In frame(2)	prostate(2)	c.68_70del						.																																			SO:0001651	inframe_deletion	8406	exon1			GGACGCGCAGCAG	U78093	CCDS14245.1, CCDS55400.1, CCDS55401.1, CCDS55402.1	Xp21.1	2011-01-25	2011-01-25		ENSG00000101955	ENSG00000101955			11309	protein-coding gene	gene with protein product		300187	"""sushi-repeat-containing protein, X chromosome"", ""sushi-repeat-containing protein, X-linked"""			8634708, 8634709	Standard	NM_006307		Approved	ETX1	uc004ddy.2	P78539	OTTHUMG00000021362	ENST00000378533.3:c.68_70delTGC	X.37:g.38079985_38079987delGCA	ENSP00000367794:p.Leu23del	Somatic	6	0	875	WXS	Illumina GAIIx	Phase_I	56	13	NM_001170751	0	0	0	0	0	A8K065|B3KWP8|B4DDB8|B4DQH5|F5H4D7|G3V1L0|Q4VX66|Q99652|Q99913	In_Frame_Del	DEL	ENST00000378533.3	37	CCDS14245.1																																																																																			-|1.000;|0.000		0.729	SRPX-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056243.1	NM_006307	
ZNF157	7712	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	47230123	47230123	+	Missense_Mutation	SNP	C	C	A	rs186352953		TCGA-OR-A5KW-01A-11D-A29I-10	TCGA-OR-A5KW-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	67dfc56a-abc7-40c7-a901-6512ec38d5f5	804ec9eb-9f16-4ab9-b2dd-2abb72a53348	g.chrX:47230123C>A	ENST00000377073.3	+	1	142	c.56C>A	c.(55-57)cCt>cAt	p.P19H		NM_003446.3	NP_003437.2	P51786	ZN157_HUMAN	zinc finger protein 157	19					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|endometrium(2)|large_intestine(2)|lung(5)|upper_aerodigestive_tract(1)	11						CCAGGAGAACCTGGCAGATCT	0.413																																					p.P19H		.											.	ZNF157-130	0			c.C56A						.						73.0	60.0	64.0					X																	47230123		2203	4300	6503	SO:0001583	missense	7712	exon1			GAGAACCTGGCAG	U28687	CCDS14278.1	Xp11.2	2013-01-08	2006-08-22		ENSG00000147117	ENSG00000147117		"""Zinc fingers, C2H2-type"", ""-"""	12942	protein-coding gene	gene with protein product		300024	"""zinc finger protein 157 (HZF22)"""			8586441	Standard	NM_003446		Approved	HZF22	uc004dhr.1	P51786	OTTHUMG00000021443	ENST00000377073.3:c.56C>A	X.37:g.47230123C>A	ENSP00000366273:p.Pro19His	Somatic	251	0		WXS	Illumina GAIIx	Phase_I	375	180	NM_003446	0	0	0	0	0	Q96LE9	Missense_Mutation	SNP	ENST00000377073.3	37	CCDS14278.1	.	.	.	.	.	.	.	.	.	.	c	0.007	-1.975935	0.00452	.	.	ENSG00000147117	ENST00000377073	T	0.07444	3.19	3.29	1.49	0.22878	.	.	.	.	.	T	0.05227	0.0139	N	0.13098	0.295	0.09310	N	1	P	0.47604	0.898	P	0.44623	0.455	T	0.33007	-0.9885	9	0.36615	T	0.2	.	3.4193	0.07388	0.2516:0.6073:0.0:0.1411	.	19	P51786	ZN157_HUMAN	H	19	ENSP00000366273:P19H	ENSP00000366273:P19H	P	+	2	0	ZNF157	47115067	0.998000	0.40836	0.173000	0.22940	0.006000	0.05464	0.232000	0.17891	0.268000	0.21939	-0.306000	0.09157	CCT	C|1.000;T|0.000		0.413	ZNF157-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056415.1	NM_003446	
MAGEA12	4111	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	X	151900366	151900366	+	Silent	SNP	G	G	A			TCGA-OR-A5KW-01A-11D-A29I-10	TCGA-OR-A5KW-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	67dfc56a-abc7-40c7-a901-6512ec38d5f5	804ec9eb-9f16-4ab9-b2dd-2abb72a53348	g.chrX:151900366G>A	ENST00000357916.4	-	2	590	c.435C>T	c.(433-435)gaC>gaT	p.D145D	CSAG4_ENST00000361201.4_RNA|CSAG1_ENST00000370291.2_5'Flank|MAGEA12_ENST00000393869.3_Silent_p.D145D|CSAG1_ENST00000452779.2_5'Flank|MAGEA12_ENST00000393900.3_Silent_p.D145D|CSAG1_ENST00000370287.3_5'Flank	NM_005367.5	NP_005358.2	P43365	MAGAC_HUMAN	melanoma antigen family A, 12	145	MAGE. {ECO:0000255|PROSITE- ProRule:PRU00127}.									breast(5)|large_intestine(5)|liver(1)|lung(14)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	28	Acute lymphoblastic leukemia(192;6.56e-05)					CAGGAAAGAAGTCCTGGAAAT	0.507																																					p.D145D		.											.	MAGEA12-131	0			c.C435T						.						147.0	140.0	142.0					X																	151900366		2203	4300	6503	SO:0001819	synonymous_variant	4111	exon2			AAAGAAGTCCTGG		CCDS76048.1	Xq28	2009-03-13			ENSG00000213401	ENSG00000213401			6799	protein-coding gene	gene with protein product	"""cancer/testis antigen family 1, member 12"""	300177		MAGE12		8575766	Standard	NM_001166386		Approved	CT1.12	uc004fgc.3	P43365	OTTHUMG00000022650	ENST00000357916.4:c.435C>T	X.37:g.151900366G>A		Somatic	680	0		WXS	Illumina GAIIx	Phase_I	539	39	NM_005367	0	0	0	0	0	Q9NSD3	Silent	SNP	ENST00000357916.4	37	CCDS14710.1																																																																																			.		0.507	MAGEA12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058764.1	NM_005367	
CELSR2	1952	hgsc.bcm.edu	37	1	109792735	109792736	+	In_Frame_Ins	INS	-	-	CGC	rs377757908|rs59201433|rs144034706	byFrequency	TCGA-OR-A5KW-01A-11D-A29I-10	TCGA-OR-A5KW-10A-01D-A29L-10	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	67dfc56a-abc7-40c7-a901-6512ec38d5f5	804ec9eb-9f16-4ab9-b2dd-2abb72a53348	g.chr1:109792735_109792736insCGC	ENST00000271332.3	+	1	95_96	c.34_35insCGC	c.(34-36)acg>aCGCcg	p.16_17insP		NM_001408.2	NP_001399.1	Q9HCU4	CELR2_HUMAN	cadherin, EGF LAG seven-pass G-type receptor 2	16					cerebrospinal fluid secretion (GO:0033326)|cilium assembly (GO:0042384)|cilium movement (GO:0003341)|dendrite morphogenesis (GO:0048813)|G-protein coupled receptor signaling pathway (GO:0007186)|homophilic cell adhesion (GO:0007156)|neural plate anterior/posterior regionalization (GO:0021999)|neuron migration (GO:0001764)|neuropeptide signaling pathway (GO:0007218)|regulation of cell-cell adhesion (GO:0022407)|regulation of protein localization (GO:0032880)|regulation of transcription, DNA-templated (GO:0006355)|ventricular system development (GO:0021591)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)			NS(1)|autonomic_ganglia(1)|breast(3)|central_nervous_system(1)|cervix(3)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(14)|lung(27)|ovary(5)|prostate(1)|skin(3)|urinary_tract(2)	82		all_epithelial(167;0.000114)|all_lung(203;0.000321)|Lung NSC(277;0.000626)|Breast(1374;0.244)		Colorectal(144;0.0296)|Lung(183;0.067)|COAD - Colon adenocarcinoma(174;0.114)|Epithelial(280;0.193)|all cancers(265;0.219)		CCCCCTCCCAACgccgccgccg	0.752														2846	0.568291	0.4198	0.6311	5008	,	,		10222	0.5298		0.7276	False		,,,				2504	0.6002				p.T12delinsTP	NSCLC(158;1285 2011 34800 34852 42084)	.											.	CELSR2-526	0			c.34_35insCGC						.			1363,1439		473,417,511						3.0	0.1		dbSNP_130	6	4135,1897		1679,777,560	no	coding	CELSR2	NM_001408.2		2152,1194,1071	A1A1,A1R,RR		31.4489,48.6438,37.7632				5498,3336				SO:0001652	inframe_insertion	1952	exon1			CTCCCAACGCCGC	D87469	CCDS796.1	1p13.3	2014-08-08	2013-02-18		ENSG00000143126	ENSG00000143126		"""Cadherins / Major cadherins"", ""-"", ""GPCR / Class B : Orphans"""	3231	protein-coding gene	gene with protein product		604265	"""cadherin, EGF LAG seven-pass G-type receptor 2, flamingo (Drosophila) homolog"""	EGFL2		9693030, 10907856	Standard	NM_001408		Approved	KIAA0279, MEGF3, Flamingo1, CDHF10	uc001dxa.4	Q9HCU4	OTTHUMG00000012003	ENST00000271332.3:c.47_49dupCGC	1.37:g.109792742_109792744dupCGC	ENSP00000271332:p.Pro16_Pro16dup	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	15	15	NM_001408	0	0	0	0	0	Q5T2Y7|Q92566	In_Frame_Ins	INS	ENST00000271332.3	37	CCDS796.1																																																																																			-|0.389;CGC|0.611		0.752	CELSR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033200.1	NM_001408	
AVL9	23080	broad.mit.edu	37	7	32535342	32535343	+	Frame_Shift_Ins	INS	-	-	G			TCGA-OR-A5KW-01A-11D-A29I-10	TCGA-OR-A5KW-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	67dfc56a-abc7-40c7-a901-6512ec38d5f5	804ec9eb-9f16-4ab9-b2dd-2abb72a53348	g.chr7:32535342_32535343insG	ENST00000318709.4	+	1	242_243	c.21_22insG	c.(22-24)gggfs	p.G8fs	AVL9_ENST00000459629.1_3'UTR|AVL9_ENST00000409301.1_Frame_Shift_Ins_p.G8fs|AVL9_ENST00000404479.1_Frame_Shift_Ins_p.G8fs|LSM5_ENST00000409952.3_5'Flank|LSM5_ENST00000409909.3_5'Flank	NM_015060.1	NP_055875.1	Q8NBF6	AVL9_HUMAN	AVL9 homolog (S. cerevisiase)	8					cell migration (GO:0016477)	integral component of membrane (GO:0016021)|recycling endosome (GO:0055037)				endometrium(3)|kidney(1)|large_intestine(3)|lung(7)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	18						CCAGGAGAGGCGGGGATGGCGT	0.718																																					p.G7fs		.											.	AVL9-90	0			c.21_22insG						.			54,3176		7,40,1568						-1.4	0.0			11	106,6304		12,82,3111	no	frameshift	AVL9	NM_015060.1		19,122,4679	A1A1,A1R,RR		1.6537,1.6718,1.6598				160,9480				SO:0001589	frameshift_variant	23080	exon1			GAGAGGCGGGGAT	D87682	CCDS34613.1	7p14.3	2013-05-01	2008-10-03	2008-10-03	ENSG00000105778	ENSG00000105778			28994	protein-coding gene	gene with protein product		612927	"""KIAA0241"""	KIAA0241		17229886, 22595670	Standard	XM_005249668		Approved		uc003tcv.1	Q8NBF6	OTTHUMG00000152929	ENST00000318709.4:c.25dupG	7.37:g.32535346_32535346dupG	ENSP00000315568:p.Gly8fs	Somatic	17	0		WXS	Illumina GAIIx	Phase_I	192	7	NM_015060	0	0	0	0	0	Q92573	Frame_Shift_Ins	INS	ENST00000318709.4	37	CCDS34613.1																																																																																			.		0.718	AVL9-003	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000328643.1	NM_015060	
