#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_TTotCov	i_TVarCov	i_Transcript_Id	i_Trna_alt1	i_Trna_alt2	i_Trna_ref	i_Trna_tot	i_Trna_var	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
ATP13A2	23400	bcgsc.ca	37	1	17326540	17326540	+	Silent	SNP	G	G	A	rs56290406	byFrequency	TCGA-OR-A5KX-01A-11D-A29I-10	TCGA-OR-A5KX-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8369398d-9d6a-48dd-b20d-4e699ceddc1b	4b83e274-a5a1-430f-8ea8-70a4a64581c9	g.chr1:17326540G>A	ENST00000326735.8	-	11	1038	c.1005C>T	c.(1003-1005)gcC>gcT	p.A335A	RP1-37C10.3_ENST00000446261.1_RNA|ATP13A2_ENST00000341676.5_Silent_p.A330A|ATP13A2_ENST00000502860.1_5'UTR|ATP13A2_ENST00000452699.1_Silent_p.A330A			Q9NQ11	AT132_HUMAN	ATPase type 13A2	335					cell death (GO:0008219)|cellular response to manganese ion (GO:0071287)	integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(4)|lung(11)|ovary(4)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	32		Colorectal(325;0.000147)|Breast(348;0.00104)|Renal(390;0.00145)|Lung NSC(340;0.00566)|all_lung(284;0.00797)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0646)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00462)|COAD - Colon adenocarcinoma(227;1.11e-05)|BRCA - Breast invasive adenocarcinoma(304;1.99e-05)|Kidney(64;0.000171)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00645)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.182)		TGCACTCGCCGGCCACCAGGG	0.662													g|||	174	0.0347444	0.084	0.0159	5008	,	,		10754	0.0		0.0398	False		,,,				2504	0.0123				p.A335A		.											.	ATP13A2-93	0			c.C1005T						.	A	,,	249,4155	136.1+/-172.1	4,241,1957	24.0	25.0	25.0		990,990,1005	-9.2	0.3	1	dbSNP_129	25	279,8321	100.3+/-161.8	3,273,4024	no	coding-synonymous,coding-synonymous,coding-synonymous	ATP13A2	NM_001141973.1,NM_001141974.1,NM_022089.2	,,	7,514,5981	AA,AG,GG		3.2442,5.654,4.0603	,,	330/1176,330/1159,335/1181	17326540	528,12476	2202	4300	6502	SO:0001819	synonymous_variant	23400	exon11			CTCGCCGGCCACC	AL354615	CCDS175.1, CCDS44072.1, CCDS44073.1	1p36	2014-09-17			ENSG00000159363	ENSG00000159363		"""ATPases / P-type"", ""Parkinson disease"""	30213	protein-coding gene	gene with protein product		610513	"""Parkinson disease (autosomal recessive) 9 (Kufor-Rakeb syndrome)"""	PARK9		15381061, 16964263	Standard	XM_005245809		Approved	HSA9947, CLN12	uc001baa.2	Q9NQ11	OTTHUMG00000002293	ENST00000326735.8:c.1005C>T	1.37:g.17326540G>A		Somatic	130	1		WXS	Illumina GAIIx	Phase_I	100	6	NM_022089	0	0	5	5	0	O75700|Q5JXY1|Q5JXY2|Q6S9Z9	Silent	SNP	ENST00000326735.8	37	CCDS175.1	74	0.03388278388278388	38	0.07723577235772358	5	0.013812154696132596	0	0.0	31	0.040897097625329816	g	2.272	-0.366820	0.05069	0.05654	0.032442	ENSG00000159363	ENST00000510069	.	.	.	4.6	-9.19	0.00685	.	.	.	.	.	T	0.04407	0.0121	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.57642	-0.7776	4	.	.	.	-6.9897	11.1112	0.48235	0.1813:0.0758:0.6331:0.1098	rs56290406	.	.	.	W	310	.	.	R	-	1	2	ATP13A2	17199127	0.000000	0.05858	0.300000	0.25030	0.240000	0.25518	-4.559000	0.00216	-2.724000	0.00387	-1.329000	0.01275	CGG	G|0.962;A|0.038		0.662	ATP13A2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000006617.1	NM_022089	
SDHB	6390	bcgsc.ca	37	1	17371278	17371278	+	Missense_Mutation	SNP	T	T	C	rs34599281	byFrequency	TCGA-OR-A5KX-01A-11D-A29I-10	TCGA-OR-A5KX-10A-01D-A29L-10	T	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8369398d-9d6a-48dd-b20d-4e699ceddc1b	4b83e274-a5a1-430f-8ea8-70a4a64581c9	g.chr1:17371278T>C	ENST00000375499.3	-	2	328	c.178A>G	c.(178-180)Act>Gct	p.T60A	SDHB_ENST00000466613.1_5'UTR	NM_003000.2	NP_002991.2	P21912	SDHB_HUMAN	succinate dehydrogenase complex, subunit B, iron sulfur (Ip)	60	2Fe-2S ferredoxin-type. {ECO:0000255|PROSITE-ProRule:PRU00465}.				aerobic respiration (GO:0009060)|cellular metabolic process (GO:0044237)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)|succinate metabolic process (GO:0006105)|tricarboxylic acid cycle (GO:0006099)	extracellular vesicular exosome (GO:0070062)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex II (GO:0005749)|mitochondrion (GO:0005739)	2 iron, 2 sulfur cluster binding (GO:0051537)|3 iron, 4 sulfur cluster binding (GO:0051538)|4 iron, 4 sulfur cluster binding (GO:0051539)|electron carrier activity (GO:0009055)|metal ion binding (GO:0046872)|succinate dehydrogenase (ubiquinone) activity (GO:0008177)|ubiquinone binding (GO:0048039)			breast(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(4)	10		Colorectal(325;3.46e-05)|Breast(348;0.000162)|Lung NSC(340;0.000419)|Renal(390;0.000518)|all_lung(284;0.00054)|Ovarian(437;0.00669)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0049)|COAD - Colon adenocarcinoma(227;1.18e-05)|BRCA - Breast invasive adenocarcinoma(304;2.41e-05)|Kidney(64;0.000188)|KIRC - Kidney renal clear cell carcinoma(64;0.00273)|STAD - Stomach adenocarcinoma(196;0.00656)|READ - Rectum adenocarcinoma(331;0.0656)|Lung(427;0.19)	Succinic acid(DB00139)	ACTTCATAAGTCTGCATATGA	0.463			"""Mis, N, F"""			"""paraganglioma, pheochromocytoma"""			Familial Paragangliomas;Cowden syndrome;Carney-Stratakis syndrome																												p.T60A		.	yes	Rec		Familial paraganglioma	1	1p36.1-p35	6390	"""succinate dehydrogenase complex, subunit B, iron sulfur (Ip)"""		O	.	SDHB-658	0			c.A178G						.	T	ALA/THR	0,4406		0,0,2203	124.0	120.0	121.0		178	5.7	1.0	1	dbSNP_126	121	2,8598	2.2+/-6.3	0,2,4298	yes	missense	SDHB	NM_003000.2	58	0,2,6501	CC,CT,TT		0.0233,0.0,0.0154	benign	60/281	17371278	2,13004	2203	4300	6503	SO:0001583	missense	6390	exon2	Familial Cancer Database	Hereditary Glomus Tumors, Familial Paragangliomas, Hereditary Paragangliomas, type 1-3: PGL1, PGL2, PGL3, incl. Familial Carotid Body Paraganglioma and Sensorineural Hearing Loss;CS, Cowden disease, Multiple Hamartoma Syndrome, incl.: Lhermitte-Duclos; part of PTEN hamartoma tumour syndrome (PHTS) / PTEN-MATCHS, Cowden-like syndrome;Carney-Stratakis dyad, Paraganglioma-Gastric Stromal Sarcoma dyad	CATAAGTCTGCAT	U17248	CCDS176.1	1p36.1-p35	2014-09-17			ENSG00000117118	ENSG00000117118	1.3.99.1	"""Mitochondrial respiratory chain complex / Complex II"""	10681	protein-coding gene	gene with protein product		185470		SDH1, SDH			Standard	NM_003000		Approved		uc001bae.3	P21912	OTTHUMG00000002289	ENST00000375499.3:c.178A>G	1.37:g.17371278T>C	ENSP00000364649:p.Thr60Ala	Somatic	72	0		WXS	Illumina GAIIx	Phase_I	60	4	NM_003000	0	0	73	73	0	B2R545|Q0QEY7|Q9NQ12	Missense_Mutation	SNP	ENST00000375499.3	37	CCDS176.1	.	.	.	.	.	.	.	.	.	.	T	17.72	3.460204	0.63401	0.0	2.33E-4	ENSG00000117118	ENST00000375499	D	0.98822	-5.16	5.65	5.65	0.86999	Beta-grasp fold, ferredoxin-type (1);Ferredoxin (2);	0.000000	0.85682	D	0.000000	D	0.97996	0.9340	M	0.83312	2.635	0.80722	D	1	B	0.06786	0.001	B	0.10450	0.005	D	0.96481	0.9356	10	0.66056	D	0.02	-20.9608	14.8428	0.70237	0.0:0.0:0.0:1.0	rs34599281	60	P21912	DHSB_HUMAN	A	60	ENSP00000364649:T60A	ENSP00000364649:T60A	T	-	1	0	SDHB	17243865	1.000000	0.71417	0.976000	0.42696	0.875000	0.50365	6.969000	0.76092	2.371000	0.80710	0.533000	0.62120	ACT	T|1.000;C|0.000		0.463	SDHB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000006603.1	NM_003000	
AKR7L	246181	bcgsc.ca	37	1	19600386	19600386	+	RNA	SNP	C	C	T	rs112053480	byFrequency	TCGA-OR-A5KX-01A-11D-A29I-10	TCGA-OR-A5KX-10A-01D-A29L-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8369398d-9d6a-48dd-b20d-4e699ceddc1b	4b83e274-a5a1-430f-8ea8-70a4a64581c9	g.chr1:19600386C>T	ENST00000429712.1	-	0	302				AKR7L_ENST00000420396.2_RNA			Q8NHP1	ARK74_HUMAN	aldo-keto reductase family 7-like							extracellular vesicular exosome (GO:0070062)	oxidoreductase activity (GO:0016491)			breast(1)|endometrium(2)|ovary(1)|prostate(1)|urinary_tract(1)	6						TTCGGAGCCCCAGGCCGCCAA	0.682													C|||	536	0.107029	0.2859	0.0764	5008	,	,		15326	0.0		0.0944	False		,,,				2504	0.0102				.		.											.	AKR7L-90	0			.						.	C		353,1027		53,247,390	34.0	40.0	38.0			3.2	1.0	1	dbSNP_132	38	305,2877		25,255,1311	no	intergenic				78,502,1701	TT,TC,CC		9.5852,25.5797,14.4235			19600386	658,3904	690	1591	2281			246181	.			GAGCCCCAGGCCG			1p36.1-p35	2008-12-09			ENSG00000211454	ENSG00000211454			24056	protein-coding gene	gene with protein product		608478				12879023	Standard	NR_040288		Approved	AFAR3	uc021ohn.1	Q8NHP1	OTTHUMG00000002520		1.37:g.19600386C>T		Somatic	403	3		WXS	Illumina GAIIx	Phase_I	297	12	.	0	0	0	0	0	Q5U614	RNA	SNP	ENST00000429712.1	37		237	0.10851648351648352	134	0.27235772357723576	31	0.0856353591160221	0	0.0	72	0.09498680738786279	C	1.618	-0.522172	0.04171	0.255797	0.095852	ENSG00000211454	ENST00000457194	.	.	.	3.15	3.15	0.36227	.	.	.	.	.	.	.	.	.	.	.	0.09310	P	1.0	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.3012	0.60326	0.0:1.0:0.0:0.0	.	.	.	.	X	17	.	.	W	-	2	0	AKR7L	19472973	1.000000	0.71417	1.000000	0.80357	0.043000	0.13939	4.448000	0.60027	1.772000	0.52199	0.195000	0.17529	TGG	C|0.896;T|0.104		0.682	AKR7L-001	KNOWN	basic	polymorphic_pseudogene	polymorphic_pseudogene	OTTHUMT00000007163.3	NM_201252	
HDAC1	3065	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	32797321	32797321	+	Missense_Mutation	SNP	G	G	A	rs1140658		TCGA-OR-A5KX-01A-11D-A29I-10	TCGA-OR-A5KX-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8369398d-9d6a-48dd-b20d-4e699ceddc1b	4b83e274-a5a1-430f-8ea8-70a4a64581c9	g.chr1:32797321G>A	ENST00000373548.3	+	11	1217	c.1133G>A	c.(1132-1134)gGg>gAg	p.G378E	HDAC1_ENST00000373541.2_Missense_Mutation_p.G185E|HDAC1_ENST00000490081.1_3'UTR	NM_004964.2	NP_004955.2	Q13547	HDAC1_HUMAN	histone deacetylase 1	378					ATP-dependent chromatin remodeling (GO:0043044)|blood coagulation (GO:0007596)|chromatin modification (GO:0016568)|chromatin remodeling (GO:0006338)|circadian regulation of gene expression (GO:0032922)|embryonic digit morphogenesis (GO:0042733)|epidermal cell differentiation (GO:0009913)|eyelid development in camera-type eye (GO:0061029)|fungiform papilla formation (GO:0061198)|gene expression (GO:0010467)|hair follicle placode formation (GO:0060789)|histone deacetylation (GO:0016575)|histone H3 deacetylation (GO:0070932)|histone H4 deacetylation (GO:0070933)|mitotic cell cycle (GO:0000278)|negative regulation by host of viral transcription (GO:0043922)|negative regulation of androgen receptor signaling pathway (GO:0060766)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell cycle (GO:0045786)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|neurotrophin TRK receptor signaling pathway (GO:0048011)|Notch signaling pathway (GO:0007219)|odontogenesis of dentin-containing tooth (GO:0042475)|positive regulation of cell proliferation (GO:0008284)|positive regulation of receptor biosynthetic process (GO:0010870)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein deacetylation (GO:0006476)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|histone deacetylase complex (GO:0000118)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|NuRD complex (GO:0016581)|protein complex (GO:0043234)|Sin3 complex (GO:0016580)	activating transcription factor binding (GO:0033613)|core promoter binding (GO:0001047)|deacetylase activity (GO:0019213)|enzyme binding (GO:0019899)|histone deacetylase activity (GO:0004407)|histone deacetylase binding (GO:0042826)|NAD-dependent histone deacetylase activity (H3-K14 specific) (GO:0032041)|NAD-dependent histone deacetylase activity (H3-K18 specific) (GO:0097372)|NAD-dependent histone deacetylase activity (H3-K9 specific) (GO:0046969)|NAD-dependent histone deacetylase activity (H4-K16 specific) (GO:0046970)|protein deacetylase activity (GO:0033558)|repressing transcription factor binding (GO:0070491)|RNA polymerase II repressing transcription factor binding (GO:0001103)|RNA polymerase II transcription corepressor activity (GO:0001106)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|transcription regulatory region sequence-specific DNA binding (GO:0000976)			NS(1)|breast(3)|endometrium(1)|kidney(2)|large_intestine(2)|lung(6)|ovary(1)|skin(2)	18		Breast(348;0.000523)|Lung NSC(340;0.000992)|Ovarian(437;0.0221)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0837)|Lung SC(1967;0.113)		KIRC - Kidney renal clear cell carcinoma(1967;0.138)	Vorinostat(DB02546)	CACGCACCTGGGGTCCAAATG	0.582																																					p.G378E		.											.	HDAC1-659	0			c.G1133A						.						96.0	92.0	94.0					1																	32797321		2203	4300	6503	SO:0001583	missense	3065	exon11			CACCTGGGGTCCA	D50405	CCDS360.1	1p34	2008-02-05			ENSG00000116478	ENSG00000116478			4852	protein-coding gene	gene with protein product		601241		RPD3L1		8602529	Standard	NM_004964		Approved	HD1, GON-10	uc001bvb.1	Q13547	OTTHUMG00000007529	ENST00000373548.3:c.1133G>A	1.37:g.32797321G>A	ENSP00000362649:p.Gly378Glu	Somatic	190	1		WXS	Illumina GAIIx	Phase_I	130	80	NM_004964	0	0	31	77	46	Q92534	Missense_Mutation	SNP	ENST00000373548.3	37	CCDS360.1	.	.	.	.	.	.	.	.	.	.	G	17.24	3.338085	0.60963	.	.	ENSG00000116478	ENST00000373548;ENST00000373541	T;T	0.74737	-0.87;-0.55	4.28	4.28	0.50868	Histone deacetylase domain (1);	0.000000	0.85682	D	0.000000	T	0.80110	0.4563	M	0.84948	2.725	0.80722	D	1	B	0.24651	0.108	B	0.32342	0.144	T	0.82100	-0.0624	10	0.72032	D	0.01	-10.5477	17.6011	0.88025	0.0:0.0:1.0:0.0	.	378	Q13547	HDAC1_HUMAN	E	378;185	ENSP00000362649:G378E;ENSP00000362642:G185E	ENSP00000362642:G185E	G	+	2	0	HDAC1	32569908	1.000000	0.71417	1.000000	0.80357	0.655000	0.38815	9.770000	0.98971	2.330000	0.79161	0.563000	0.77884	GGG	G|1.000;|0.000		0.582	HDAC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000019815.3	NM_004964	
BTBD19	149478	broad.mit.edu	37	1	45275923	45275923	+	Missense_Mutation	SNP	T	T	G			TCGA-OR-A5KX-01A-11D-A29I-10	TCGA-OR-A5KX-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8369398d-9d6a-48dd-b20d-4e699ceddc1b	4b83e274-a5a1-430f-8ea8-70a4a64581c9	g.chr1:45275923T>G	ENST00000450269.1	+	2	464	c.125T>G	c.(124-126)gTa>gGa	p.V42G	BTBD19_ENST00000453418.1_Missense_Mutation_p.V42G|BTBD19_ENST00000409335.2_Missense_Mutation_p.V42G|TCTEX1D4_ENST00000372200.1_5'Flank	NM_001136537.1	NP_001130009.1	C9JJ37	BTBDJ_HUMAN	BTB (POZ) domain containing 19	42	BTB. {ECO:0000255|PROSITE- ProRule:PRU00037}.									breast(1)|endometrium(1)	2						CGGCAGGAGGTATTTGCCCAT	0.607																																					p.V42G		.											.	.	0			c.T125G						.						67.0	60.0	62.0					1																	45275923		692	1591	2283	SO:0001583	missense	149478	exon2			AGGAGGTATTTGC			1p34.1	2013-01-08			ENSG00000222009	ENSG00000222009		"""BTB/POZ domain containing"""	27145	protein-coding gene	gene with protein product							Standard	NM_001136537		Approved		uc010ole.1	C9JJ37	OTTHUMG00000008493	ENST00000450269.1:c.125T>G	1.37:g.45275923T>G	ENSP00000395461:p.Val42Gly	Somatic	94	16		WXS	Illumina GAIIx	Phase_I	73	12	NM_001136537	0	0	0	0	0	B4E384|B7ZC36|B7ZC37	Missense_Mutation	SNP	ENST00000450269.1	37		.	.	.	.	.	.	.	.	.	.	T	20.8	4.049084	0.75846	.	.	ENSG00000222009	ENST00000450269;ENST00000453418;ENST00000409335	T;T;T	0.69175	-0.38;-0.38;-0.38	5.1	5.1	0.69264	BTB/POZ-like (2);BTB/POZ (1);BTB/POZ fold (2);	.	.	.	.	T	0.81361	0.4806	M	0.87269	2.87	0.51233	D	0.999913	P	0.42941	0.794	P	0.55667	0.781	D	0.84695	0.0725	9	0.87932	D	0	-10.627	14.091	0.64990	0.0:0.0:0.0:1.0	.	42	C9JJ37	BTBDJ_HUMAN	G	42	ENSP00000395461:V42G;ENSP00000405193:V42G;ENSP00000386506:V42G	ENSP00000386506:V42G	V	+	2	0	BTBD19	45048510	1.000000	0.71417	0.998000	0.56505	0.936000	0.57629	5.741000	0.68638	1.911000	0.55334	0.459000	0.35465	GTA	.		0.607	BTBD19-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_001136537	
SARS	6301	broad.mit.edu;bcgsc.ca	37	1	109772188	109772188	+	Silent	SNP	C	C	T	rs574107646		TCGA-OR-A5KX-01A-11D-A29I-10	TCGA-OR-A5KX-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8369398d-9d6a-48dd-b20d-4e699ceddc1b	4b83e274-a5a1-430f-8ea8-70a4a64581c9	g.chr1:109772188C>T	ENST00000234677.2	+	4	516	c.441C>T	c.(439-441)aaC>aaT	p.N147N	SARS_ENST00000369923.4_Silent_p.N147N	NM_006513.3	NP_006504.2	P49591	SYSC_HUMAN	seryl-tRNA synthetase	147					gene expression (GO:0010467)|selenocysteinyl-tRNA(Sec) biosynthetic process (GO:0097056)|seryl-tRNA aminoacylation (GO:0006434)|translation (GO:0006412)|tRNA aminoacylation for protein translation (GO:0006418)|tRNA processing (GO:0008033)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|RNA binding (GO:0003723)|serine-tRNA ligase activity (GO:0004828)			central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(3)|lung(5)|ovary(1)|prostate(3)|upper_aerodigestive_tract(1)	17		all_epithelial(167;7.64e-05)|all_lung(203;0.000321)|Lung NSC(277;0.000626)|Breast(1374;0.244)		Colorectal(144;0.0301)|Lung(183;0.0677)|COAD - Colon adenocarcinoma(174;0.116)|Epithelial(280;0.233)	L-Serine(DB00133)	CCATCAGTAACGATGAGGTAG	0.577													C|||	1	0.000199681	0.0	0.0	5008	,	,		19401	0.0		0.0	False		,,,				2504	0.001				p.N147N		.											.	SARS-90	0			c.C441T						.						143.0	140.0	141.0					1																	109772188		2203	4300	6503	SO:0001819	synonymous_variant	6301	exon4			CAGTAACGATGAG	BC009390	CCDS795.1	1p13.3	2011-07-01			ENSG00000031698	ENSG00000031698	6.1.1.11	"""Aminoacyl tRNA synthetases / Class II"""	10537	protein-coding gene	gene with protein product	"""serine tRNA ligase 1, cytoplasmic"""	607529				9431993	Standard	NM_006513		Approved	SERS	uc001dwu.2	P49591	OTTHUMG00000011726	ENST00000234677.2:c.441C>T	1.37:g.109772188C>T		Somatic	204	1		WXS	Illumina GAIIx	Phase_I	166	10	NM_006513	0	0	0	0	0	B2R6Y9|Q5T5C8|Q9NSE3	Silent	SNP	ENST00000234677.2	37	CCDS795.1																																																																																			.		0.577	SARS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000032394.2	NM_006513	
KRTCAP2	200185	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	155141958	155141958	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5KX-01A-11D-A29I-10	TCGA-OR-A5KX-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8369398d-9d6a-48dd-b20d-4e699ceddc1b	4b83e274-a5a1-430f-8ea8-70a4a64581c9	g.chr1:155141958G>A	ENST00000473363.2	-	5	679	c.680C>T	c.(679-681)tCa>tTa	p.S227L	KRTCAP2_ENST00000295682.4_Silent_p.L149L|KRTCAP2_ENST00000490672.1_5'UTR																							TGGCTGGTGTGAGGACTGGAG	0.463																																					p.L149L		.											.	KRTCAP2-90	0			c.C447T						.						158.0	121.0	134.0					1																	155141958		2203	4300	6503	SO:0001583	missense	200185	exon5			TGGTGTGAGGACT																												ENST00000473363.2:c.680C>T	1.37:g.155141958G>A	ENSP00000477381:p.Ser227Leu	Somatic	271	0		WXS	Illumina GAIIx	Phase_I	260	170	NM_173852	0	0	107	333	226		Silent	SNP	ENST00000473363.2	37																																																																																				.		0.463	RP11-201K10.3-001	PUTATIVE	mRNA_start_NF|mRNA_end_NF|cds_start_NF|cds_end_NF|basic|appris_principal|readthrough_transcript	protein_coding	protein_coding	OTTHUMT00000471530.1		
TOR1AIP2	163590	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	1	179816744	179816745	+	Frame_Shift_Del	DEL	TG	TG	-			TCGA-OR-A5KX-01A-11D-A29I-10	TCGA-OR-A5KX-10A-01D-A29L-10	TG	TG	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8369398d-9d6a-48dd-b20d-4e699ceddc1b	4b83e274-a5a1-430f-8ea8-70a4a64581c9	g.chr1:179816744_179816745delTG	ENST00000367612.3	-	5	967_968	c.580_581delCA	c.(580-582)caafs	p.Q194fs	TOR1AIP2_ENST00000609928.1_Frame_Shift_Del_p.Q194fs	NM_145034.4	NP_659471.1	Q9H496	IFG15_HUMAN	torsin A interacting protein 2	0										cervix(1)|endometrium(3)|large_intestine(1)|lung(10)|ovary(1)|skin(2)	18						TTCCAATTTTTGTGTTTGTTGT	0.361																																					p.194_194del		.											.	TOR1AIP2-69	0			c.580_581del						.																																			SO:0001589	frameshift_variant	163590	exon6			AATTTTTGTGTTT		CCDS1334.1	1q25.2	2012-02-09			ENSG00000169905	ENSG00000169905			24055	protein-coding gene	gene with protein product		614513				15767459	Standard	NM_145034		Approved	LULL1, NET9, IFRG15	uc001gnk.3	Q8NFQ8	OTTHUMG00000035265	ENST00000367612.3:c.580_581delCA	1.37:g.179816746_179816747delTG	ENSP00000356584:p.Gln194fs	Somatic	95	0		WXS	Illumina GAIIx	Phase_I	94	15	NM_001199260	0	0	0	0	0	Q05BU2	Frame_Shift_Del	DEL	ENST00000367612.3	37	CCDS1334.1																																																																																			.		0.361	TOR1AIP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000085304.1	NM_145034	
C1orf106	55765	hgsc.bcm.edu	37	1	200880978	200880978	+	Missense_Mutation	SNP	C	C	T	rs296520	byFrequency	TCGA-OR-A5KX-01A-11D-A29I-10	TCGA-OR-A5KX-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8369398d-9d6a-48dd-b20d-4e699ceddc1b	4b83e274-a5a1-430f-8ea8-70a4a64581c9	g.chr1:200880978C>T	ENST00000367342.4	+	9	1812	c.1612C>T	c.(1612-1614)Cgc>Tgc	p.R538C	C1orf106_ENST00000413687.2_Missense_Mutation_p.R453C	NM_018265.3	NP_060735.3	Q3KP66	CA106_HUMAN	chromosome 1 open reading frame 106	538			R -> C (in dbSNP:rs296520). {ECO:0000269|PubMed:14702039, ECO:0000269|PubMed:15489334}.							endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(6)|ovary(1)|prostate(2)|skin(3)|stomach(1)|urinary_tract(2)	21						GTGGGAGCTGCGCCGCGCAGC	0.736													T|||	3966	0.791933	0.6089	0.8213	5008	,	,		12017	0.997		0.7256	False		,,,				2504	0.8753				p.R552C		.											.	C1orf106-93	0			c.C1654T						.	T	CYS/ARG,CYS/ARG	2547,1503		890,767,368	5.0	7.0	6.0		1357,1612	0.8	0.0	1	dbSNP_79	6	5587,2355		2124,1339,508	no	missense,missense	C1orf106	NM_001142569.2,NM_018265.3	180,180	3014,2106,876	TT,TC,CC		29.6525,37.1111,32.1714	benign,benign	453/579,538/664	200880978	8134,3858	2025	3971	5996	SO:0001583	missense	55765	exon9			GAGCTGCGCCGCG	AK001763	CCDS44292.1	1q32.1	2011-02-15			ENSG00000163362	ENSG00000163362			25599	protein-coding gene	gene with protein product						14702039	Standard	NM_018265		Approved	FLJ10901	uc001gvo.4	Q3KP66	OTTHUMG00000035789	ENST00000367342.4:c.1612C>T	1.37:g.200880978C>T	ENSP00000356311:p.Arg538Cys	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	16	16	NM_018265	0	0	0	0	0	B4E1K9|E9PFY0|Q9NV65|Q9NVI0	Missense_Mutation	SNP	ENST00000367342.4	37		1677	0.7678571428571429	261	0.5304878048780488	285	0.787292817679558	569	0.9947552447552448	562	0.741424802110818	T	0.366	-0.936884	0.02340	0.628889	0.703475	ENSG00000163362	ENST00000367342;ENST00000413687	T;T	0.28454	1.61;1.61	3.39	0.759	0.18438	.	0.912041	0.09365	N	0.812206	T	0.00012	0.0000	N	0.01576	-0.805	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.16188	-1.0411	9	0.29301	T	0.29	-23.0614	3.796	0.08740	0.0:0.2241:0.1856:0.5903	rs296520;rs7519373;rs56757010	538	Q3KP66	CA106_HUMAN	C	538;453	ENSP00000356311:R538C;ENSP00000392105:R453C	ENSP00000356311:R538C	R	+	1	0	C1orf106	199147601	0.004000	0.15560	0.002000	0.10522	0.007000	0.05969	-0.731000	0.04909	-0.124000	0.11724	-0.381000	0.06696	CGC	C|0.242;T|0.758		0.736	C1orf106-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000087057.2	NM_018265	
SLC30A10	55532	broad.mit.edu	37	1	220101143	220101143	+	Splice_Site	SNP	C	C	T			TCGA-OR-A5KX-01A-11D-A29I-10	TCGA-OR-A5KX-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8369398d-9d6a-48dd-b20d-4e699ceddc1b	4b83e274-a5a1-430f-8ea8-70a4a64581c9	g.chr1:220101143C>T	ENST00000366926.3	-	1	801	c.640G>A	c.(640-642)Ggt>Agt	p.G214S	SLC30A10_ENST00000536992.1_Splice_Site_p.E214K|SLC30A10_ENST00000536446.1_Intron	NM_018713.2	NP_061183.2	Q6XR72	ZNT10_HUMAN	solute carrier family 30, member 10	214					zinc ion transport (GO:0006829)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	cation transmembrane transporter activity (GO:0008324)			NS(1)|endometrium(1)|large_intestine(1)|lung(9)|skin(1)	13				GBM - Glioblastoma multiforme(131;0.051)|all cancers(67;0.209)		CGAAAGGCACCTGCTACGTTT	0.632																																					p.G214S	Colon(76;360 1614 43677 51136)	.											.	SLC30A10-90	0			c.G640A						.						18.0	16.0	17.0					1																	220101143		2184	4252	6436	SO:0001630	splice_region_variant	55532	exon1			AGGCACCTGCTAC	AY212919	CCDS31026.1	1q41	2013-05-22			ENSG00000196660	ENSG00000196660		"""Solute carriers"""	25355	protein-coding gene	gene with protein product	"""zinc transporter 8"""	611146				15154973	Standard	NR_046437		Approved	DKFZp547M236, ZnT-10, ZRC1, ZNT8	uc001hlw.3	Q6XR72	OTTHUMG00000037434	ENST00000366926.3:c.640+1G>A	1.37:g.220101143C>T		Somatic	121	0		WXS	Illumina GAIIx	Phase_I	106	5	NM_018713	0	0	0	0	0	Q49AL9|Q9NPW0	Missense_Mutation	SNP	ENST00000366926.3	37	CCDS31026.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	15.90|15.90	2.968055|2.968055	0.53507|0.53507	.|.	.|.	ENSG00000196660|ENSG00000196660	ENST00000536992|ENST00000366926	T|T	0.77750|0.64991	-1.12|-0.13	4.41|4.41	4.41|4.41	0.53225|0.53225	.|.	.|0.000000	.|0.51477	.|D	.|0.000084	T|T	0.51227|0.51227	0.1662|0.1662	N|N	0.05280|0.05280	-0.08|-0.08	0.25381|0.25381	N|N	0.988612|0.988612	.|D	.|0.53745	.|0.962	.|P	.|0.53450	.|0.726	T|T	0.48139|0.48139	-0.9061|-0.9061	6|9	.|.	.|.	.|.	-15.4631|-15.4631	14.2673|14.2673	0.66126|0.66126	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|214	.|Q6XR72	.|ZNT10_HUMAN	K|S	214|214	ENSP00000440627:E214K|ENSP00000355893:G214S	.|.	E|G	-|-	1|1	0|0	SLC30A10|SLC30A10	218167766|218167766	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.035000|0.035000	0.12851|0.12851	4.870000|4.870000	0.63035|0.63035	2.150000|2.150000	0.67090|0.67090	0.655000|0.655000	0.94253|0.94253	GAA|GGT	.		0.632	SLC30A10-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357709.1	NM_018713	Missense_Mutation
OBSCN	84033	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	228561682	228561682	+	Silent	SNP	C	C	T			TCGA-OR-A5KX-01A-11D-A29I-10	TCGA-OR-A5KX-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8369398d-9d6a-48dd-b20d-4e699ceddc1b	4b83e274-a5a1-430f-8ea8-70a4a64581c9	g.chr1:228561682C>T	ENST00000422127.1	+	95	22397	c.22353C>T	c.(22351-22353)ttC>ttT	p.F7451F	OBSCN_ENST00000570156.2_Silent_p.F8408F|OBSCN_ENST00000366707.4_Silent_p.F5085F	NM_001098623.2	NP_001092093.2	Q5VST9	OBSCN_HUMAN	obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF	7451					apoptotic signaling pathway (GO:0097190)|multicellular organismal development (GO:0007275)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|protein localization to M-band (GO:0036309)|regulation of small GTPase mediated signal transduction (GO:0051056)|sarcomere organization (GO:0045214)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|M band (GO:0031430)|myofibril (GO:0030016)|Z disc (GO:0030018)	ankyrin binding (GO:0030506)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|structural constituent of muscle (GO:0008307)|titin binding (GO:0031432)			NS(2)|breast(7)|central_nervous_system(5)|cervix(2)|endometrium(30)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(37)|lung(89)|ovary(8)|pancreas(3)|prostate(13)|skin(6)|stomach(11)|upper_aerodigestive_tract(2)|urinary_tract(3)	223		Prostate(94;0.0405)				TTGCTTCCTTCCGGCTCTCAG	0.657																																					p.F8408F		.											.	OBSCN-403	0			c.C25224T						.						13.0	15.0	15.0					1																	228561682		1878	4004	5882	SO:0001819	synonymous_variant	84033	exon106			TTCCTTCCGGCTC	AJ002535	CCDS1570.2, CCDS58065.1, CCDS59204.1	1q42	2014-09-17			ENSG00000154358	ENSG00000154358		"""Rho guanine nucleotide exchange factors"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	15719	protein-coding gene	gene with protein product		608616				11448995, 11814696	Standard	NM_001098623		Approved	KIAA1556, UNC89, KIAA1639, ARHGEF30	uc001hsq.2	Q5VST9	OTTHUMG00000039772	ENST00000422127.1:c.22353C>T	1.37:g.228561682C>T		Somatic	339	0		WXS	Illumina GAIIx	Phase_I	345	83	NM_001271223	0	0	0	0	0	Q2A664|Q5T7G8|Q5T7G9|Q5VSU2|Q86YC7|Q8NHN0|Q8NHN1|Q8NHN2|Q8NHN3|Q8NHN4|Q8NHN5|Q8NHN6|Q8NHN7|Q8NHN8|Q8NHN9|Q96AA2|Q9HCD3|Q9HCL6	Silent	SNP	ENST00000422127.1	37	CCDS58065.1	.	.	.	.	.	.	.	.	.	.	C	8.282	0.815807	0.16607	.	.	ENSG00000154358	ENST00000441106	.	.	.	4.9	1.96	0.26148	.	.	.	.	.	T	0.51584	0.1683	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.37337	-0.9710	4	.	.	.	.	4.7466	0.13040	0.1706:0.6451:0.0:0.1843	.	.	.	.	S	2068	.	.	P	+	1	0	OBSCN	226628305	0.008000	0.16893	0.975000	0.42487	0.067000	0.16453	0.217000	0.17603	0.208000	0.20626	-0.379000	0.06801	CCG	.		0.657	OBSCN-204	KNOWN	basic|CCDS	protein_coding	protein_coding		NM_052843	
KMO	8564	broad.mit.edu	37	1	241752063	241752063	+	Silent	SNP	T	T	G	rs144089555	byFrequency	TCGA-OR-A5KX-01A-11D-A29I-10	TCGA-OR-A5KX-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8369398d-9d6a-48dd-b20d-4e699ceddc1b	4b83e274-a5a1-430f-8ea8-70a4a64581c9	g.chr1:241752063T>G	ENST00000366559.4	+	12	1340	c.1029T>G	c.(1027-1029)ccT>ccG	p.P343P	KMO_ENST00000366557.4_Silent_p.P343P|KMO_ENST00000366558.3_Silent_p.P343P	NM_003679.4	NP_003670.2			kynurenine 3-monooxygenase (kynurenine 3-hydroxylase)											NS(1)|breast(2)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(8)|lung(10)|ovary(2)|prostate(1)|skin(2)	33	Ovarian(103;0.103)|all_lung(81;0.23)		OV - Ovarian serous cystadenocarcinoma(106;0.0176)			TGTGTCTTCCTGTGTTCTCAA	0.368																																					p.P343P		.											.	KMO-92	0			c.T1029G						.	T		1,4405	2.1+/-5.4	0,1,2202	190.0	176.0	180.0		1029	-1.1	1.0	1	dbSNP_134	180	8,8592	5.7+/-21.5	0,8,4292	no	coding-synonymous	KMO	NM_003679.3		0,9,6494	GG,GT,TT		0.093,0.0227,0.0692		343/487	241752063	9,12997	2203	4300	6503	SO:0001819	synonymous_variant	8564	exon12			TCTTCCTGTGTTC	AF056032	CCDS1618.1	1q42-q44	2010-11-23			ENSG00000117009	ENSG00000117009	1.14.13.9		6381	protein-coding gene	gene with protein product		603538				9237672	Standard	NM_003679		Approved		uc009xgp.3	O15229	OTTHUMG00000039635	ENST00000366559.4:c.1029T>G	1.37:g.241752063T>G		Somatic	110	2		WXS	Illumina GAIIx	Phase_I	99	4	NM_003679	0	0	0	0	0		Silent	SNP	ENST00000366559.4	37	CCDS1618.1	.	.	.	.	.	.	.	.	.	.	T	2.157	-0.393209	0.04899	2.27E-4	9.3E-4	ENSG00000117009	ENST00000366555	.	.	.	5.82	-1.1	0.09872	.	.	.	.	.	T	0.39145	0.1067	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.27365	-1.0076	4	.	.	.	.	0.6397	0.00808	0.2637:0.1515:0.1368:0.448	.	.	.	.	G	29	.	.	C	+	1	0	KMO	239818686	0.393000	0.25237	0.997000	0.53966	0.197000	0.23852	-0.599000	0.05700	-0.112000	0.11979	-0.297000	0.09499	TGT	T|0.999;G|0.001		0.368	KMO-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095612.1	NM_003679	
KIF26B	55083	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	1	245851927	245851927	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5KX-01A-11D-A29I-10	TCGA-OR-A5KX-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8369398d-9d6a-48dd-b20d-4e699ceddc1b	4b83e274-a5a1-430f-8ea8-70a4a64581c9	g.chr1:245851927C>T	ENST00000407071.2	+	12	6082	c.5642C>T	c.(5641-5643)cCg>cTg	p.P1881L	KIF26B_ENST00000366518.4_Missense_Mutation_p.P1500L	NM_018012.3	NP_060482.2	Q2KJY2	KI26B_HUMAN	kinesin family member 26B	1881					establishment of cell polarity (GO:0030010)|metabolic process (GO:0008152)|positive regulation of cell-cell adhesion (GO:0022409)|ureteric bud invasion (GO:0072092)	cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|microtubule motor activity (GO:0003777)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(21)|ovary(4)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	51	all_cancers(71;3.86e-05)|all_epithelial(71;0.000121)|Ovarian(71;0.0412)|all_lung(81;0.0498)|Lung NSC(105;0.0708)|Breast(184;0.127)		OV - Ovarian serous cystadenocarcinoma(106;0.022)			GAGCTCCCGCCGGCCATGGGG	0.731																																					p.P1881L		.											.	KIF26B-25	0			c.C5642T						.						6.0	7.0	7.0					1																	245851927		1941	3991	5932	SO:0001583	missense	55083	exon12			TCCCGCCGGCCAT	AK001019	CCDS44342.1	1q44	2008-02-05			ENSG00000162849	ENSG00000162849		"""Kinesins"""	25484	protein-coding gene	gene with protein product		614026					Standard	NM_018012		Approved	FLJ10157	uc001ibf.1	Q2KJY2	OTTHUMG00000040079	ENST00000407071.2:c.5642C>T	1.37:g.245851927C>T	ENSP00000385545:p.Pro1881Leu	Somatic	32	0		WXS	Illumina GAIIx	Phase_I	51	44	NM_018012	0	0	0	0	0	Q6ZQR9|Q6ZUZ0|Q8IUN3|Q8IVR1|Q9NWB4	Missense_Mutation	SNP	ENST00000407071.2	37	CCDS44342.1	.	.	.	.	.	.	.	.	.	.	C	27.0	4.790178	0.90367	.	.	ENSG00000162849	ENST00000407071;ENST00000366518;ENST00000413001	D;D	0.82893	-1.66;-1.66	5.18	5.18	0.71444	.	.	.	.	.	D	0.91791	0.7403	M	0.83603	2.65	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.74348	0.974;0.983	D	0.92945	0.6375	9	0.87932	D	0	.	18.6823	0.91551	0.0:1.0:0.0:0.0	.	1500;1881	B7WPD9;Q2KJY2	.;KI26B_HUMAN	L	1881;1500;1497	ENSP00000385545:P1881L;ENSP00000355475:P1500L	ENSP00000355475:P1500L	P	+	2	0	KIF26B	243918550	1.000000	0.71417	0.997000	0.53966	0.993000	0.82548	7.618000	0.83043	2.409000	0.81822	0.462000	0.41574	CCG	.		0.731	KIF26B-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381037.1	XM_371354	
C10orf111	221060	bcgsc.ca	37	10	15138615	15138615	+	Missense_Mutation	SNP	C	C	T	rs7896053	byFrequency	TCGA-OR-A5KX-01A-11D-A29I-10	TCGA-OR-A5KX-10A-01D-A29L-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8369398d-9d6a-48dd-b20d-4e699ceddc1b	4b83e274-a5a1-430f-8ea8-70a4a64581c9	g.chr10:15138615C>T	ENST00000378207.3	-	2	482	c.209G>A	c.(208-210)aGg>aAg	p.R70K	RPP38_ENST00000378197.4_5'Flank|RPP38_ENST00000378202.5_5'Flank	NM_153244.1	NP_694976.1	Q8N326	CJ111_HUMAN	chromosome 10 open reading frame 111	70			R -> K (in dbSNP:rs7896053).			integral component of membrane (GO:0016021)				lung(5)|upper_aerodigestive_tract(1)	6						CGATGGTAGCCTGAGTCTCCA	0.502													T|||	1194	0.238419	0.6649	0.1182	5008	,	,		16927	0.0625		0.1113	False		,,,				2504	0.0593				p.R70K		.											.	C10orf111-90	0			c.G209A						.	T	LYS/ARG	2472,1934	549.9+/-377.9	678,1116,409	141.0	138.0	139.0		209	-1.9	0.0	10	dbSNP_116	139	923,7677	776.9+/-407.7	51,821,3428	yes	missense	C10orf111	NM_153244.1	26	729,1937,3837	TT,TC,CC		10.7326,43.8947,26.1033	benign	70/156	15138615	3395,9611	2203	4300	6503	SO:0001583	missense	221060	exon2			GGTAGCCTGAGTC	BC029034	CCDS7107.1	10p13	2004-04-20			ENSG00000176236	ENSG00000176236			28582	protein-coding gene	gene with protein product						12477932	Standard	NM_153244		Approved	MGC35468, bA455B2.4	uc001inw.3	Q8N326	OTTHUMG00000017727	ENST00000378207.3:c.209G>A	10.37:g.15138615C>T	ENSP00000367449:p.Arg70Lys	Somatic	208	2		WXS	Illumina GAIIx	Phase_I	182	6	NM_153244	0	0	0	0	0	B2RAC4	Missense_Mutation	SNP	ENST00000378207.3	37	CCDS7107.1	497	0.22756410256410256	327	0.6646341463414634	52	0.143646408839779	32	0.055944055944055944	86	0.11345646437994723	T	8.664	0.901234	0.17760	0.561053	0.107326	ENSG00000176236	ENST00000378207	T	0.53857	0.6	2.83	-1.94	0.07571	.	.	.	.	.	T	0.00012	0.0000	N	0.08118	0	0.80722	P	0.0	B	0.02656	0.0	B	0.04013	0.001	T	0.41233	-0.9520	8	0.87932	D	0	.	4.5021	0.11869	0.1568:0.5125:0.0:0.3307	rs7896053;rs52818153;rs58141984;rs7896053	70	Q8N326	CJ111_HUMAN	K	70	ENSP00000367449:R70K	ENSP00000367449:R70K	R	-	2	0	C10orf111	15178621	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-4.525000	0.00221	-0.731000	0.04862	-2.791000	0.00116	AGG	C|0.740;T|0.260		0.502	C10orf111-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046975.1	NM_153244	
SVIL	6840	bcgsc.ca	37	10	29747417	29747417	+	Silent	SNP	C	C	T	rs1887465	byFrequency	TCGA-OR-A5KX-01A-11D-A29I-10	TCGA-OR-A5KX-10A-01D-A29L-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8369398d-9d6a-48dd-b20d-4e699ceddc1b	4b83e274-a5a1-430f-8ea8-70a4a64581c9	g.chr10:29747417C>T	ENST00000355867.4	-	37	7256	c.6504G>A	c.(6502-6504)ccG>ccA	p.P2168P	PTCHD3P1_ENST00000438202.1_RNA|PTCHD3P1_ENST00000455774.1_RNA|PTCHD3P1_ENST00000446807.1_RNA|PTCHD3P1_ENST00000423223.1_RNA|PTCHD3P1_ENST00000445521.1_RNA|PTCHD3P1_ENST00000413405.1_RNA|PTCHD3P1_ENST00000430295.1_RNA|SVIL_ENST00000535393.1_Silent_p.P1082P|SVIL_ENST00000375398.2_Silent_p.P2168P|PTCHD3P1_ENST00000414457.1_RNA|SVIL_ENST00000375400.3_Silent_p.P1742P	NM_021738.2	NP_068506.2	O95425	SVIL_HUMAN	supervillin	2168	HP. {ECO:0000255|PROSITE- ProRule:PRU00595}.				cytoskeleton organization (GO:0007010)|skeletal muscle tissue development (GO:0007519)	actin cytoskeleton (GO:0015629)|cell projection (GO:0042995)|costamere (GO:0043034)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	actin filament binding (GO:0051015)			breast(1)|central_nervous_system(3)|cervix(1)|endometrium(17)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(24)|lung(35)|ovary(8)|prostate(2)|skin(4)|stomach(7)|upper_aerodigestive_tract(2)|urinary_tract(2)	112		Breast(68;0.103)				CGACCCCCTCCGGGAGTGGCC	0.552													C|||	1800	0.359425	0.2852	0.3746	5008	,	,		15050	0.5565		0.2465	False		,,,				2504	0.362				p.P2168P		.											.	SVIL-96	0			c.G6504A						.	C	,	1301,3105	436.1+/-344.5	193,915,1095	42.0	46.0	44.0		5226,6504	-8.8	0.1	10	dbSNP_92	44	1844,6756	329.8+/-318.9	197,1450,2653	no	coding-synonymous,coding-synonymous	SVIL	NM_003174.3,NM_021738.2	,	390,2365,3748	TT,TC,CC		21.4419,29.5279,24.1811	,	1742/1789,2168/2215	29747417	3145,9861	2203	4300	6503	SO:0001819	synonymous_variant	6840	exon37			CCCCTCCGGGAGT	AF051851	CCDS7163.1, CCDS7164.1	10p11.2	2008-07-29			ENSG00000197321	ENSG00000197321			11480	protein-coding gene	gene with protein product	"""archvillin"""	604126				9382871	Standard	NM_003174		Approved		uc001iut.1	O95425	OTTHUMG00000017882	ENST00000355867.4:c.6504G>A	10.37:g.29747417C>T		Somatic	128	0		WXS	Illumina GAIIx	Phase_I	115	5	NM_021738	0	0	14	14	0	D3DRW9|M1J557|O60611|O60612|Q5VZK5|Q5VZK6|Q9H1R7	Silent	SNP	ENST00000355867.4	37	CCDS7164.1																																																																																			C|0.733;T|0.267		0.552	SVIL-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000047395.1		
GPRIN2	9721	ucsc.edu	37	10	46999601	46999601	+	Missense_Mutation	SNP	G	G	A	rs9422022	byFrequency	TCGA-OR-A5KX-01A-11D-A29I-10	TCGA-OR-A5KX-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8369398d-9d6a-48dd-b20d-4e699ceddc1b	4b83e274-a5a1-430f-8ea8-70a4a64581c9	g.chr10:46999601G>A	ENST00000374317.1	+	3	994	c.721G>A	c.(721-723)Gtg>Atg	p.V241M	GPRIN2_ENST00000374314.4_Missense_Mutation_p.V241M	NM_014696.3	NP_055511.2	O60269	GRIN2_HUMAN	G protein regulated inducer of neurite outgrowth 2	241			V -> M (in dbSNP:rs9422022).	VR -> MREVG (in Ref. 1; BAA25440 and 3; AAH11672). {ECO:0000305}.						breast(2)|central_nervous_system(1)|endometrium(6)|kidney(1)|large_intestine(1)|lung(6)|prostate(1)	18						CATGAGGGAGGTGAGGGCTGG	0.632													G|||	32	0.00638978	0.0023	0.0014	5008	,	,		31210	0.0139		0.0109	False		,,,				2504	0.0031				p.V241M		.											.	GPRIN2-90	0			c.G721A						.						51.0	53.0	53.0					10																	46999601		2203	4299	6502	SO:0001583	missense	9721	exon3			AGGGAGGTGAGGG	BC011672	CCDS73101.1	10q11.22	2006-08-24	2006-08-24	2006-08-24	ENSG00000204175	ENSG00000204175			23730	protein-coding gene	gene with protein product		611240	"""KIAA0514"""	KIAA0514		9628581	Standard	NM_014696		Approved	MGC15171	uc001jec.3	O60269	OTTHUMG00000018107	ENST00000374317.1:c.721G>A	10.37:g.46999601G>A	ENSP00000363436:p.Val241Met	Somatic	124	0		WXS	Illumina GAIIx	Phase_I	116	20	NM_014696	0	0	0	0	0	Q5SVF0	Missense_Mutation	SNP	ENST00000374317.1	37	CCDS31192.1	786	0.3598901098901099	179	0.3638211382113821	126	0.34806629834254144	219	0.38286713286713286	262	0.34564643799472294	G	3.183	-0.167470	0.06461	.	.	ENSG00000204175	ENST00000374317;ENST00000374314	T;T	0.03496	3.91;3.91	5.12	-1.64	0.08318	.	1.524420	0.04254	N	0.339078	T	0.00012	0.0000	L	0.34521	1.04	0.09310	N	1	B	0.15473	0.013	B	0.09377	0.004	T	0.46978	-0.9152	10	0.27082	T	0.32	0.3266	1.758	0.02986	0.326:0.1295:0.4122:0.1323	rs9422022	241	O60269	GRIN2_HUMAN	M	241	ENSP00000363436:V241M;ENSP00000363433:V241M	ENSP00000363433:V241M	V	+	1	0	GPRIN2	46419607	0.099000	0.21834	0.004000	0.12327	0.003000	0.03518	0.140000	0.16056	-0.217000	0.10033	-0.498000	0.04607	GTG	G|0.639;A|0.361		0.632	GPRIN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047836.1	NM_014696	
RBM20	282996	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	112559623	112559623	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5KX-01A-11D-A29I-10	TCGA-OR-A5KX-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8369398d-9d6a-48dd-b20d-4e699ceddc1b	4b83e274-a5a1-430f-8ea8-70a4a64581c9	g.chr10:112559623G>A	ENST00000369519.3	+	7	1805	c.1747G>A	c.(1747-1749)Ggt>Agt	p.G583S		NM_001134363.1	NP_001127835.1	Q5T481	RBM20_HUMAN	RNA binding motif protein 20	583	RRM. {ECO:0000255|PROSITE- ProRule:PRU00176}.				heart development (GO:0007507)|mRNA processing (GO:0006397)|positive regulation of RNA splicing (GO:0033120)|RNA splicing (GO:0008380)	nucleus (GO:0005634)	nucleotide binding (GO:0000166)|RNA binding (GO:0003723)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|endometrium(4)|kidney(3)|large_intestine(1)|ovary(1)|skin(2)	12						TGTGATCAATGGTGAGAAGTT	0.423																																					p.G583S		.											.	.	0			c.G1747A						.						166.0	151.0	155.0					10																	112559623		692	1591	2283	SO:0001583	missense	282996	exon7			ATCAATGGTGAGA	BX648563	CCDS44477.1	10q25.3	2014-09-17			ENSG00000203867	ENSG00000203867		"""RNA binding motif (RRM) containing"""	27424	protein-coding gene	gene with protein product		613171					Standard	NM_001134363		Approved		uc001kzf.2	Q5T481	OTTHUMG00000019043	ENST00000369519.3:c.1747G>A	10.37:g.112559623G>A	ENSP00000358532:p.Gly583Ser	Somatic	186	0		WXS	Illumina GAIIx	Phase_I	159	49	NM_001134363	0	0	0	0	0	A6NIP5|B5A868|Q5JVI1	Missense_Mutation	SNP	ENST00000369519.3	37	CCDS44477.1	.	.	.	.	.	.	.	.	.	.	G	24.7	4.560218	0.86335	.	.	ENSG00000203867	ENST00000369519;ENST00000539821	D	0.81739	-1.53	5.19	5.19	0.71726	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (2);	0.426761	0.24078	N	0.041758	D	0.86887	0.6041	L	0.49350	1.555	0.41530	D	0.988452	D	0.62365	0.991	D	0.65140	0.932	D	0.87961	0.2730	10	0.72032	D	0.01	-15.3142	18.6947	0.91596	0.0:0.0:1.0:0.0	.	583	Q5T481	RBM20_HUMAN	S	583	ENSP00000358532:G583S	ENSP00000358532:G583S	G	+	1	0	RBM20	112549613	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.888000	0.63164	2.591000	0.87537	0.655000	0.94253	GGT	.		0.423	RBM20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050339.2	NM_001134363	
KCNJ11	3767	bcgsc.ca	37	11	17408831	17408831	+	Missense_Mutation	SNP	G	G	C	rs1800467	byFrequency	TCGA-OR-A5KX-01A-11D-A29I-10	TCGA-OR-A5KX-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8369398d-9d6a-48dd-b20d-4e699ceddc1b	4b83e274-a5a1-430f-8ea8-70a4a64581c9	g.chr11:17408831G>C	ENST00000339994.4	-	1	1375	c.808C>G	c.(808-810)Ctg>Gtg	p.L270V	KCNJ11_ENST00000528731.1_Missense_Mutation_p.L183V|KCNJ11_ENST00000526747.1_5'Flank	NM_000525.3	NP_000516.3	Q14654	KCJ11_HUMAN	potassium inwardly-rectifying channel, subfamily J, member 11	270			L -> V (in dbSNP:rs1800467). {ECO:0000269|PubMed:8897013, ECO:0000269|PubMed:9032109}.		cellular response to glucose stimulus (GO:0071333)|cellular response to nicotine (GO:0071316)|cellular response to tumor necrosis factor (GO:0071356)|energy reserve metabolic process (GO:0006112)|glucose metabolic process (GO:0006006)|negative regulation of insulin secretion (GO:0046676)|neurological system process (GO:0050877)|positive regulation of cation channel activity (GO:2001259)|potassium ion import (GO:0010107)|potassium ion transmembrane transport (GO:0071805)|regulation of insulin secretion (GO:0050796)|regulation of membrane potential (GO:0042391)|response to ATP (GO:0033198)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|response to ischemia (GO:0002931)|response to testosterone (GO:0033574)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)	ATP-sensitive potassium channel complex (GO:0008282)|axolemma (GO:0030673)|cell body fiber (GO:0070852)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|integral component of plasma membrane (GO:0005887)|intercalated disc (GO:0014704)|mitochondrion (GO:0005739)|myelin sheath (GO:0043209)|neuronal cell body (GO:0043025)|nuclear envelope (GO:0005635)|plasma membrane (GO:0005886)|T-tubule (GO:0030315)|voltage-gated potassium channel complex (GO:0008076)	ankyrin binding (GO:0030506)|ATP binding (GO:0005524)|ATP-activated inward rectifier potassium channel activity (GO:0015272)|ion channel binding (GO:0044325)|potassium ion binding (GO:0030955)|voltage-gated potassium channel activity (GO:0005249)			endometrium(2)|large_intestine(2)|lung(6)|ovary(1)|prostate(3)|skin(2)	16				READ - Rectum adenocarcinoma(2;0.0276)|Colorectal(2;0.0633)	Diazoxide(DB01119)|Glimepiride(DB00222)|Glyburide(DB01016)|Ibutilide(DB00308)|Levosimendan(DB00922)|Thiamylal(DB01154)|Verapamil(DB00661)|Yohimbine(DB01392)	CTGGGTGCCAGGTCGTAGAGT	0.617											OREG0020810	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	G|||	76	0.0151757	0.003	0.0245	5008	,	,		20338	0.0		0.0507	False		,,,				2504	0.0041				p.L270V		.											.	KCNJ11-91	0			c.C808G						.	G	VAL/LEU,VAL/LEU	31,4369	36.8+/-68.6	0,31,2169	139.0	127.0	131.0		808,547	5.4	1.0	11	dbSNP_89	131	403,8183	127.7+/-186.0	5,393,3895	yes	missense,missense	KCNJ11	NM_000525.3,NM_001166290.1	32,32	5,424,6064	CC,CG,GG		4.6937,0.7045,3.3421	benign,benign	270/391,183/304	17408831	434,12552	2200	4293	6493	SO:0001583	missense	3767	exon1			GTGCCAGGTCGTA	D50582	CCDS31436.1, CCDS53606.1	11p15.1	2011-07-05						"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Inwardly rectifying"""	6257	protein-coding gene	gene with protein product		600937				7502040, 16382105	Standard	NM_001166290		Approved	Kir6.2, BIR	uc001mna.3	Q14654		ENST00000339994.4:c.808C>G	11.37:g.17408831G>C	ENSP00000345708:p.Leu270Val	Somatic	216	1	717	WXS	Illumina GAIIx	Phase_I	237	8	NM_000525	0	0	0	0	0	B4DWI4|E9PNK0|Q2M1H7|Q58EX3|Q8IW96	Missense_Mutation	SNP	ENST00000339994.4	37	CCDS31436.1	48	0.02197802197802198	1	0.0020325203252032522	14	0.03867403314917127	0	0.0	33	0.04353562005277045	G	7.898	0.733876	0.15574	0.007045	0.046937	ENSG00000187486	ENST00000339994;ENST00000528731	D;D	0.94723	-3.5;-3.5	5.43	5.43	0.79202	.	0.160775	0.42548	D	0.000688	T	0.65080	0.2657	L	0.38649	1.16	0.42195	D	0.991748	B	0.10296	0.003	B	0.12156	0.007	T	0.75966	-0.3131	10	0.49607	T	0.09	.	5.5084	0.16866	0.1558:0.0:0.6647:0.1794	rs1800467;rs8192538;rs1800467	270	B2RC52	.	V	270;183	ENSP00000345708:L270V;ENSP00000434755:L183V	ENSP00000345708:L270V	L	-	1	2	KCNJ11	17365407	1.000000	0.71417	1.000000	0.80357	0.357000	0.29423	1.095000	0.30964	2.548000	0.85928	0.561000	0.74099	CTG	G|0.734;C|0.266		0.617	KCNJ11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387037.1	NM_000525	
NUP160	23279	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	11	47869867	47869867	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5KX-01A-11D-A29I-10	TCGA-OR-A5KX-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8369398d-9d6a-48dd-b20d-4e699ceddc1b	4b83e274-a5a1-430f-8ea8-70a4a64581c9	g.chr11:47869867C>T	ENST00000378460.2	-	1	152	c.106G>A	c.(106-108)Gcg>Acg	p.A36T	NUP160_ENST00000526870.1_Missense_Mutation_p.A36T|NUP160_ENST00000532747.1_Missense_Mutation_p.A2T|NUP160_ENST00000530326.1_5'Flank	NM_015231.1	NP_056046.1	Q12769	NU160_HUMAN	nucleoporin 160kDa	36					carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA export from nucleus (GO:0006406)|protein transport (GO:0015031)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	cytosol (GO:0005829)|nuclear envelope (GO:0005635)|nuclear pore (GO:0005643)|nuclear pore outer ring (GO:0031080)	nucleocytoplasmic transporter activity (GO:0005487)			NS(1)|biliary_tract(2)|breast(7)|central_nervous_system(1)|endometrium(3)|kidney(4)|large_intestine(8)|lung(15)|ovary(6)|prostate(2)|skin(2)|urinary_tract(2)	53						CCCGCCGCCGCCATCTTCCCG	0.687																																					p.A36T		.											.	NUP160-209	0			c.G106A						.						26.0	31.0	30.0					11																	47869867		2194	4290	6484	SO:0001583	missense	23279	exon1			CCGCCGCCATCTT	D83781	CCDS31484.1	11p11.12	2008-07-21	2002-08-29		ENSG00000030066	ENSG00000030066			18017	protein-coding gene	gene with protein product		607614	"""nucleoporin 160kD"""			11684705	Standard	NM_015231		Approved	KIAA0197, FLJ22583	uc001ngm.3	Q12769	OTTHUMG00000166534	ENST00000378460.2:c.106G>A	11.37:g.47869867C>T	ENSP00000367721:p.Ala36Thr	Somatic	52	0		WXS	Illumina GAIIx	Phase_I	88	6	NM_015231	0	0	0	0	0	B4DYE8|B4E2J9|Q08AD3|Q7Z5X6|Q96GB3|Q9H660	Missense_Mutation	SNP	ENST00000378460.2	37	CCDS31484.1	.	.	.	.	.	.	.	.	.	.	C	23.4	4.411130	0.83340	.	.	ENSG00000030066	ENST00000378460;ENST00000532747;ENST00000526870	T;T;T	0.57273	1.38;0.41;0.55	4.85	2.91	0.33838	.	0.372641	0.24788	N	0.035582	T	0.52208	0.1720	N	0.19112	0.55	0.32101	N	0.590575	D;P	0.71674	0.998;0.734	D;B	0.65684	0.937;0.398	T	0.60647	-0.7222	10	0.87932	D	0	-11.0344	8.9891	0.36012	0.0:0.763:0.1522:0.0849	.	36;36	Q12769-2;Q12769	.;NU160_HUMAN	T	36;2;36	ENSP00000367721:A36T;ENSP00000432437:A2T;ENSP00000431495:A36T	ENSP00000367721:A36T	A	-	1	0	NUP160	47826443	1.000000	0.71417	1.000000	0.80357	0.459000	0.32528	4.950000	0.63603	1.146000	0.42352	-0.479000	0.04858	GCG	.		0.687	NUP160-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390239.2	NM_015231	
EML3	256364	bcgsc.ca	37	11	62378802	62378802	+	Missense_Mutation	SNP	G	G	C			TCGA-OR-A5KX-01A-11D-A29I-10	TCGA-OR-A5KX-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8369398d-9d6a-48dd-b20d-4e699ceddc1b	4b83e274-a5a1-430f-8ea8-70a4a64581c9	g.chr11:62378802G>C	ENST00000394773.2	-	3	516	c.209C>G	c.(208-210)cCa>cGa	p.P70R	EML3_ENST00000529309.1_Missense_Mutation_p.P70R|EML3_ENST00000278845.4_Missense_Mutation_p.P71R|ROM1_ENST00000278833.3_5'Flank|EML3_ENST00000531557.1_5'Flank|EML3_ENST00000494176.2_Missense_Mutation_p.P42R|ROM1_ENST00000534093.1_5'Flank	NM_153265.2	NP_694997.2	Q32P44	EMAL3_HUMAN	echinoderm microtubule associated protein like 3	70						cytoplasm (GO:0005737)|microtubule (GO:0005874)				biliary_tract(1)|breast(3)|endometrium(4)|kidney(2)|large_intestine(1)|lung(11)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	26						TGGCAGTCCTGGGGGGGCTGC	0.607																																					p.P70R		.											.	EML3-91	0			c.C209G						.						27.0	30.0	29.0					11																	62378802		2199	4295	6494	SO:0001583	missense	256364	exon3			AGTCCTGGGGGGG	AK093146	CCDS8023.2	11q12.3	2013-01-10			ENSG00000149499	ENSG00000149499		"""WD repeat domain containing"""	26666	protein-coding gene	gene with protein product						15225882, 14744259	Standard	NM_153265		Approved	FLJ35827, ELP95	uc001ntu.1	Q32P44	OTTHUMG00000149817	ENST00000394773.2:c.209C>G	11.37:g.62378802G>C	ENSP00000378254:p.Pro70Arg	Somatic	100	0		WXS	Illumina GAIIx	Phase_I	81	4	NM_153265	0	0	2	2	0	Q6ZQW7|Q8NA55	Missense_Mutation	SNP	ENST00000394773.2	37	CCDS8023.2	.	.	.	.	.	.	.	.	.	.	G	13.89	2.372113	0.42003	.	.	ENSG00000149499	ENST00000394773;ENST00000278845;ENST00000494176;ENST00000529309;ENST00000466886;ENST00000466671;ENST00000419857	T;T;T;T	0.41400	1.76;1.74;1.0;1.66	5.05	4.14	0.48551	.	0.303076	0.28166	N	0.016345	T	0.47192	0.1432	N	0.24115	0.695	0.35236	D	0.777411	D;D;D;D	0.71674	0.998;0.997;0.998;0.998	D;P;D;D	0.76071	0.962;0.879;0.987;0.962	T	0.59847	-0.7377	10	0.72032	D	0.01	-16.4395	9.7344	0.40379	0.097:0.0:0.903:0.0	.	70;70;71;42	Q32P44-2;Q32P44;B7WPE2;G3V1D0	.;EMAL3_HUMAN;.;.	R	70;71;42;70;41;42;41	ENSP00000378254:P70R;ENSP00000278845:P71R;ENSP00000435064:P42R;ENSP00000434513:P70R	ENSP00000278845:P71R	P	-	2	0	EML3	62135378	1.000000	0.71417	1.000000	0.80357	0.260000	0.26232	3.397000	0.52572	1.270000	0.44297	0.462000	0.41574	CCA	.		0.607	EML3-001	KNOWN	NAGNAG_splice_site|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000313432.1	NM_153265	
GPR137	56834	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	11	64056752	64056777	+	Frame_Shift_Del	DEL	CCCAGGATCCTGGGGGTCGTGGCTAC	CCCAGGATCCTGGGGGTCGTGGCTAC	-	rs553703869|rs376225218|rs367703845		TCGA-OR-A5KX-01A-11D-A29I-10	TCGA-OR-A5KX-10A-01D-A29L-10	CCCAGGATCCTGGGGGTCGTGGCTAC	CCCAGGATCCTGGGGGTCGTGGCTAC	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8369398d-9d6a-48dd-b20d-4e699ceddc1b	4b83e274-a5a1-430f-8ea8-70a4a64581c9	g.chr11:64056752_64056777delCCCAGGATCCTGGGGGTCGTGGCTAC	ENST00000313074.3	+	7	1274_1299	c.1169_1194delCCCAGGATCCTGGGGGTCGTGGCTAC	c.(1168-1194)gcccaggatcctgggggtcgtggctacfs	p.AQDPGGRGY390fs	KCNK4_ENST00000422670.2_5'Flank|RP11-783K16.10_ENST00000539086.1_RNA|KCNK4_ENST00000394525.2_5'Flank|GPR137_ENST00000377702.4_3'UTR|GPR137_ENST00000539851.1_3'UTR|KCNK4_ENST00000538767.1_5'Flank|GPR137_ENST00000411458.1_Frame_Shift_Del_p.AQDPGGRGY448fs|GPR137_ENST00000438980.2_3'UTR	NM_020155.3	NP_064540.3	Q96N19	G137A_HUMAN	G protein-coupled receptor 137	390						integral component of membrane (GO:0016021)		p.Q391K(1)		central_nervous_system(1)|endometrium(3)|kidney(1)|lung(4)|skin(1)	10						CCGCTTCTTGCCCAGGATCCTGGGGGTCGTGGCTACCCCCTCCTCT	0.664																																					p.448_456del		.											.	GPR137-68	1	Substitution - Missense(1)	lung(1)	c.1343_1368del						.																																			SO:0001589	frameshift_variant	56834	exon9			TTCTTGCCCAGGA	AJ250392	CCDS8066.1, CCDS53655.1, CCDS53656.1, CCDS53657.1, CCDS53658.1	11q13.1	2014-02-12	2006-01-26		ENSG00000173264	ENSG00000173264		"""GPCR / Unclassified : 7TM orphan receptors"""	24300	protein-coding gene	gene with protein product						10873569, 12732197	Standard	NM_001170726		Approved	C11orf4, GPR137A, TM7SF1L1	uc010rni.2	Q96N19	OTTHUMG00000167817	ENST00000313074.3:c.1169_1194delCCCAGGATCCTGGGGGTCGTGGCTAC	11.37:g.64056752_64056777delCCCAGGATCCTGGGGGTCGTGGCTAC	ENSP00000321698:p.Ala390fs	Somatic	167	0		WXS	Illumina GAIIx	Phase_I	109	17	NM_001170726	0	0	0	0	0	B4DTG7|B7Z7M1|Q4G0Y9|Q8N4K6	Frame_Shift_Del	DEL	ENST00000313074.3	37	CCDS8066.1																																																																																			.		0.664	GPR137-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000396412.1	NM_020155	
FADD	8772	broad.mit.edu;bcgsc.ca	37	11	70052536	70052536	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5KX-01A-11D-A29I-10	TCGA-OR-A5KX-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8369398d-9d6a-48dd-b20d-4e699ceddc1b	4b83e274-a5a1-430f-8ea8-70a4a64581c9	g.chr11:70052536C>T	ENST00000301838.4	+	2	881	c.584C>T	c.(583-585)cCg>cTg	p.P195L	RP11-805J14.5_ENST00000526174.1_RNA|RP11-805J14.5_ENST00000527232.1_RNA	NM_003824.3	NP_003815.1	Q13158	FADD_HUMAN	Fas (TNFRSF6)-associated via death domain	195					activation of cysteine-type endopeptidase activity (GO:0097202)|activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|cellular response to mechanical stimulus (GO:0071260)|defense response to virus (GO:0051607)|extrinsic apoptotic signaling pathway (GO:0097191)|extrinsic apoptotic signaling pathway in absence of ligand (GO:0097192)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|innate immune response (GO:0045087)|lymph node development (GO:0048535)|motor neuron apoptotic process (GO:0097049)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|necroptotic signaling pathway (GO:0097527)|negative regulation of activation-induced cell death of T cells (GO:0070236)|negative regulation of necroptotic process (GO:0060546)|positive regulation of activated T cell proliferation (GO:0042104)|positive regulation of adaptive immune response (GO:0002821)|positive regulation of apoptotic process (GO:0043065)|positive regulation of CD8-positive, alpha-beta cytotoxic T cell extravasation (GO:2000454)|positive regulation of extrinsic apoptotic signaling pathway (GO:2001238)|positive regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902043)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of interleukin-8 production (GO:0032757)|positive regulation of macrophage differentiation (GO:0045651)|positive regulation of proteolysis (GO:0045862)|positive regulation of T cell mediated cytotoxicity (GO:0001916)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of tumor necrosis factor production (GO:0032760)|positive regulation of type I interferon-mediated signaling pathway (GO:0060340)|protein heterooligomerization (GO:0051291)|regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001239)|spleen development (GO:0048536)|T cell differentiation in thymus (GO:0033077)|T cell homeostasis (GO:0043029)|thymus development (GO:0048538)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)|TRAIL-activated apoptotic signaling pathway (GO:0036462)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)|viral process (GO:0016032)	CD95 death-inducing signaling complex (GO:0031265)|cell body (GO:0044297)|cytosol (GO:0005829)|death-inducing signaling complex (GO:0031264)|membrane raft (GO:0045121)|neuron projection (GO:0043005)|ripoptosome (GO:0097342)	death effector domain binding (GO:0035877)|death receptor binding (GO:0005123)|identical protein binding (GO:0042802)|protease binding (GO:0002020)|tumor necrosis factor receptor superfamily binding (GO:0032813)			endometrium(1)|lung(4)|ovary(1)|pancreas(1)|urinary_tract(2)	9	Esophageal squamous(2;1.19e-45)		LUSC - Lung squamous cell carcinoma(11;1.46e-14)|STAD - Stomach adenocarcinoma(18;0.0513)			GCCATGTCCCCGATGTCATGG	0.602																																					p.P195L		.											.	FADD-660	0			c.C584T						.						59.0	53.0	55.0					11																	70052536		2200	4294	6494	SO:0001583	missense	8772	exon2			TGTCCCCGATGTC	U24231	CCDS8196.1	11q13.3	2014-09-17			ENSG00000168040	ENSG00000168040			3573	protein-coding gene	gene with protein product	"""Fas-associating protein with death domain"", ""Fas-associating death domain-containing protein"", ""mediator of receptor-induced toxicity"", ""growth-inhibiting gene 3 protein"""	602457				7536190, 7538907	Standard	NM_003824		Approved	MORT1, GIG3	uc001opm.2	Q13158	OTTHUMG00000167264	ENST00000301838.4:c.584C>T	11.37:g.70052536C>T	ENSP00000301838:p.Pro195Leu	Somatic	153	2		WXS	Illumina GAIIx	Phase_I	123	56	NM_003824	0	0	18	38	20	Q14866|Q6IBR4	Missense_Mutation	SNP	ENST00000301838.4	37	CCDS8196.1	.	.	.	.	.	.	.	.	.	.	C	6.952	0.545551	0.13312	.	.	ENSG00000168040	ENST00000301838	T	0.76968	-1.06	3.21	1.2	0.21068	DEATH-like (1);	1.169980	0.06556	N	0.745964	T	0.60157	0.2247	L	0.27053	0.805	0.09310	N	1	B	0.13145	0.007	B	0.04013	0.001	T	0.43653	-0.9378	10	0.02654	T	1	-0.1166	6.6647	0.23035	0.0:0.8206:0.0:0.1794	.	195	Q13158	FADD_HUMAN	L	195	ENSP00000301838:P195L	ENSP00000301838:P195L	P	+	2	0	FADD	69730184	0.000000	0.05858	0.000000	0.03702	0.025000	0.11179	0.003000	0.13083	0.316000	0.23135	0.561000	0.74099	CCG	.		0.602	FADD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393902.1	NM_003824	
NOP2	4839	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	6672532	6672532	+	Silent	SNP	G	G	A			TCGA-OR-A5KX-01A-11D-A29I-10	TCGA-OR-A5KX-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8369398d-9d6a-48dd-b20d-4e699ceddc1b	4b83e274-a5a1-430f-8ea8-70a4a64581c9	g.chr12:6672532G>A	ENST00000322166.5	-	8	958	c.837C>T	c.(835-837)tcC>tcT	p.S279S	NOP2_ENST00000399466.2_Silent_p.S275S|NOP2_ENST00000382421.3_Silent_p.S312S|NOP2_ENST00000545200.1_Silent_p.S275S|NOP2_ENST00000541778.1_Silent_p.S275S|NOP2_ENST00000537442.1_Silent_p.S279S|NOP2_ENST00000542015.1_Intron	NM_001258308.1|NM_006170.3	NP_001245237.1|NP_006161.2	P46087	NOP2_HUMAN	NOP2 nucleolar protein	279					positive regulation of cell proliferation (GO:0008284)|rRNA processing (GO:0006364)	nucleolus (GO:0005730)	poly(A) RNA binding (GO:0044822)|S-adenosylmethionine-dependent methyltransferase activity (GO:0008757)			breast(1)|kidney(2)|large_intestine(5)|lung(8)|ovary(2)|upper_aerodigestive_tract(1)	19						AGTCTCCATAGGAGTAGTAAA	0.512											OREG0021630	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.S312S		.											.	NOP2-92	0			c.C936T						.						66.0	70.0	69.0					12																	6672532		1934	4124	6058	SO:0001819	synonymous_variant	4839	exon9			TCCATAGGAGTAG		CCDS44811.1, CCDS58202.1, CCDS58203.1, CCDS58204.1	12p13	2012-12-10	2012-12-10	2008-10-13	ENSG00000111641	ENSG00000111641		"""NOP2/Sun domain containing"""	7867	protein-coding gene	gene with protein product	"""NOP2/Sun domain family, member 1"""	164031	"""nucleolar protein 1 (120kD)"", ""nucleolar protein 1, 120kDa"", ""nucleolar protein 2 homolog (yeast)"", ""NOP2 nucleolar protein homolog (yeast)"""	NOL1		8088812	Standard	NM_006170		Approved	NOP120, NSUN1, p120	uc021qtz.2	P46087	OTTHUMG00000169163	ENST00000322166.5:c.837C>T	12.37:g.6672532G>A		Somatic	84	0	635	WXS	Illumina GAIIx	Phase_I	77	40	NM_001258309	0	0	2	5	3	A1A4Z3|B3KPD6|Q05BA7|Q0P5S5|Q3KQS4|Q58F30	Silent	SNP	ENST00000322166.5	37	CCDS58203.1																																																																																			.		0.512	NOP2-007	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402614.1	NM_006170	
TUBA1C	84790	ucsc.edu	37	12	49666152	49666152	+	Silent	SNP	G	G	A	rs199599214	byFrequency	TCGA-OR-A5KX-01A-11D-A29I-10	TCGA-OR-A5KX-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8369398d-9d6a-48dd-b20d-4e699ceddc1b	4b83e274-a5a1-430f-8ea8-70a4a64581c9	g.chr12:49666152G>A	ENST00000301072.6	+	4	767	c.492G>A	c.(490-492)aaG>aaA	p.K164K	RP11-161H23.5_ENST00000550468.2_RNA|TUBA1C_ENST00000541364.1_Silent_p.K234K	NM_032704.3	NP_116093.1	Q9BQE3	TBA1C_HUMAN	tubulin, alpha 1c	164					'de novo' posttranslational protein folding (GO:0051084)|cell division (GO:0051301)|cellular protein metabolic process (GO:0044267)|cytoskeleton-dependent intracellular transport (GO:0030705)|microtubule-based process (GO:0007017)|protein folding (GO:0006457)|protein polymerization (GO:0051258)	cytoplasmic microtubule (GO:0005881)|microtubule (GO:0005874)|nucleus (GO:0005634)|vesicle (GO:0031982)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)	p.K164K(1)		endometrium(1)|large_intestine(3)|liver(1)|lung(7)|skin(1)	13						ATGGCAAGAAGTCCAAGCTGG	0.547																																					p.K164K		.											.	TUBA1C-90	1	Substitution - coding silent(1)	large_intestine(1)	c.G492A						.						56.0	58.0	57.0					12																	49666152		2203	4300	6503	SO:0001819	synonymous_variant	84790	exon4			CAAGAAGTCCAAG	BC004949	CCDS8782.1	12q13.12	2007-03-16	2007-02-12	2007-02-12		ENSG00000167553		"""Tubulins"""	20768	protein-coding gene	gene with protein product			"""tubulin, alpha 6"""	TUBA6		7821789	Standard	NM_032704		Approved	MGC14580, MGC10851, bcm948	uc001rtt.1	Q9BQE3		ENST00000301072.6:c.492G>A	12.37:g.49666152G>A		Somatic	340	22		WXS	Illumina GAIIx	Phase_I	421	20	NM_032704	1	0	490	794	303		Silent	SNP	ENST00000301072.6	37	CCDS8782.1																																																																																			G|0.998;A|0.002		0.547	TUBA1C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404424.1	NM_032704	
KRT6A	3853	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	52882329	52882329	+	Missense_Mutation	SNP	C	C	T	rs372637888		TCGA-OR-A5KX-01A-11D-A29I-10	TCGA-OR-A5KX-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8369398d-9d6a-48dd-b20d-4e699ceddc1b	4b83e274-a5a1-430f-8ea8-70a4a64581c9	g.chr12:52882329C>T	ENST00000330722.6	-	7	1275	c.1207G>A	c.(1207-1209)Gcc>Acc	p.A403T		NM_005554.3	NP_005545.1	P02538	K2C6A_HUMAN	keratin 6A	403	Coil 2.|Rod.				cell differentiation (GO:0030154)|positive regulation of cell proliferation (GO:0008284)	extracellular vesicular exosome (GO:0070062)|keratin filament (GO:0045095)|membrane (GO:0016020)|nucleus (GO:0005634)	structural constituent of cytoskeleton (GO:0005200)			breast(2)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|liver(1)|lung(14)|ovary(4)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	39				BRCA - Breast invasive adenocarcinoma(357;0.189)		TGCAGGTTGGCGCACTGGAAG	0.562																																					p.A403T		.											.	KRT6A-27	0			c.G1207A						.	C	THR/ALA	1,4405	2.1+/-5.4	0,1,2202	65.0	61.0	62.0		1207	4.2	0.7	12		62	2,8598	2.2+/-6.3	0,2,4298	no	missense	KRT6A	NM_005554.3	58	0,3,6500	TT,TC,CC		0.0233,0.0227,0.0231	benign	403/565	52882329	3,13003	2203	4300	6503	SO:0001583	missense	3853	exon7			GGTTGGCGCACTG	BC014152, L42593, L42610	CCDS41786.1	12q13.13	2013-01-16			ENSG00000205420	ENSG00000205420		"""-"", ""Intermediate filaments type II, keratins (basic)"""	6443	protein-coding gene	gene with protein product		148041	"""keratin 6C"", ""keratin 6D"""	KRT6C, KRT6D		1713141, 16831889	Standard	NM_005554		Approved	CK6C, K6C, CK6D, K6D	uc001sam.3	P02538	OTTHUMG00000169597	ENST00000330722.6:c.1207G>A	12.37:g.52882329C>T	ENSP00000369317:p.Ala403Thr	Somatic	302	0		WXS	Illumina GAIIx	Phase_I	296	160	NM_005554	0	0	0	0	0	A4QPC1|P48667|Q08AR4|Q6NT67|Q96CL4	Missense_Mutation	SNP	ENST00000330722.6	37	CCDS41786.1	.	.	.	.	.	.	.	.	.	.	c	14.77	2.635495	0.47049	2.27E-4	2.33E-4	ENSG00000205420	ENST00000330722;ENST00000452121	D	0.89415	-2.51	5.15	4.25	0.50352	Filament (1);	0.000000	0.64402	D	0.000017	D	0.88822	0.6541	M	0.78049	2.395	0.43924	D	0.996576	P	0.41673	0.759	B	0.40038	0.317	D	0.88209	0.2889	10	0.41790	T	0.15	.	14.3456	0.66662	0.0:0.9274:0.0:0.0726	.	403	P02538	K2C6A_HUMAN	T	403;359	ENSP00000369317:A403T	ENSP00000369317:A403T	A	-	1	0	KRT6A	51168596	0.196000	0.23350	0.730000	0.30809	0.035000	0.12851	0.804000	0.27098	1.284000	0.44531	0.655000	0.94253	GCC	.		0.562	KRT6A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404978.2	NM_005554	
KRT77	374454	bcgsc.ca	37	12	53088567	53088567	+	Missense_Mutation	SNP	G	G	T			TCGA-OR-A5KX-01A-11D-A29I-10	TCGA-OR-A5KX-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8369398d-9d6a-48dd-b20d-4e699ceddc1b	4b83e274-a5a1-430f-8ea8-70a4a64581c9	g.chr12:53088567G>T	ENST00000341809.3	-	5	951	c.923C>A	c.(922-924)tCt>tAt	p.S308Y	RP11-641A6.3_ENST00000547533.1_RNA|KRT77_ENST00000537195.1_Missense_Mutation_p.S75Y	NM_175078.2	NP_778253.2	Q7Z794	K2C1B_HUMAN	keratin 77	308	Coil 1B.|Rod.					cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|keratin filament (GO:0045095)	structural molecule activity (GO:0005198)			NS(2)|endometrium(2)|large_intestine(3)|lung(11)|ovary(2)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)	25						CTGCACCTGAGACAGCTCCTG	0.597																																					p.S308Y		.											.	KRT77-187	0			c.C923A						.						134.0	103.0	113.0					12																	53088567		2203	4300	6503	SO:0001583	missense	374454	exon5			ACCTGAGACAGCT	BK000975	CCDS8837.1	12q13.13	2013-06-25	2006-07-17	2006-07-17	ENSG00000189182	ENSG00000189182		"""-"", ""Intermediate filaments type II, keratins (basic)"""	20411	protein-coding gene	gene with protein product		611158	"""keratin 1B"""	KRT1B		11683385, 16831889	Standard	NM_175078		Approved		uc001saw.3	Q7Z794	OTTHUMG00000169450	ENST00000341809.3:c.923C>A	12.37:g.53088567G>T	ENSP00000342710:p.Ser308Tyr	Somatic	108	0		WXS	Illumina GAIIx	Phase_I	121	5	NM_175078	0	0	0	0	0	Q7RTS8	Missense_Mutation	SNP	ENST00000341809.3	37	CCDS8837.1	.	.	.	.	.	.	.	.	.	.	G	16.81	3.225713	0.58668	.	.	ENSG00000189182	ENST00000341809;ENST00000537195	T;D	0.89552	-1.4;-2.53	4.94	4.03	0.46877	Filament (1);	.	.	.	.	D	0.95357	0.8493	M	0.90252	3.1	0.28558	N	0.911258	D	0.89917	1.0	D	0.83275	0.996	D	0.90995	0.4838	9	0.87932	D	0	.	15.1859	0.73002	0.0:0.1421:0.8579:0.0	.	308	Q7Z794	K2C1B_HUMAN	Y	308;75	ENSP00000342710:S308Y;ENSP00000440803:S75Y	ENSP00000342710:S308Y	S	-	2	0	KRT77	51374834	0.001000	0.12720	0.999000	0.59377	0.807000	0.45602	0.966000	0.29331	1.196000	0.43129	0.555000	0.69702	TCT	.		0.597	KRT77-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404111.1	NM_175078	
STAB2	55576	bcgsc.ca	37	12	104100617	104100617	+	Silent	SNP	C	C	T	rs697212	byFrequency	TCGA-OR-A5KX-01A-11D-A29I-10	TCGA-OR-A5KX-10A-01D-A29L-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8369398d-9d6a-48dd-b20d-4e699ceddc1b	4b83e274-a5a1-430f-8ea8-70a4a64581c9	g.chr12:104100617C>T	ENST00000388887.2	+	38	4248	c.4044C>T	c.(4042-4044)tgC>tgT	p.C1348C		NM_017564.9	NP_060034.9			stabilin 2											NS(4)|breast(7)|central_nervous_system(1)|cervix(1)|endometrium(15)|kidney(11)|large_intestine(26)|lung(77)|ovary(10)|pancreas(1)|prostate(5)|skin(14)|stomach(2)	174						GCCAGCCCTGCCCAGGGAATG	0.547													C|||	2158	0.430911	0.1203	0.3256	5008	,	,		20375	0.747		0.504	False		,,,				2504	0.5245				p.C1348C		.											.	STAB2-104	0			c.C4044T						.	C		862,3544	338.1+/-305.1	88,686,1429	126.0	117.0	120.0		4044	3.5	1.0	12	dbSNP_86	120	4234,4366	573.2+/-389.8	1044,2146,1110	no	coding-synonymous	STAB2	NM_017564.9		1132,2832,2539	TT,TC,CC		49.2326,19.5642,39.1819		1348/2552	104100617	5096,7910	2203	4300	6503	SO:0001819	synonymous_variant	55576	exon38			GCCCTGCCCAGGG	AF160476	CCDS31888.1	12q23.3	2007-01-29				ENSG00000136011			18629	protein-coding gene	gene with protein product	"""hyaluronic acid receptor for endocytosis"""	608561				11829752, 12077138	Standard	XR_429107		Approved	DKFZP434E0321, FELL, STAB-2, HARE, FEEL-2	uc001tjw.3	Q8WWQ8	OTTHUMG00000170056	ENST00000388887.2:c.4044C>T	12.37:g.104100617C>T		Somatic	226	2		WXS	Illumina GAIIx	Phase_I	238	10	NM_017564	0	0	0	0	0		Silent	SNP	ENST00000388887.2	37	CCDS31888.1																																																																																			T|0.306;G|0.121		0.547	STAB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407089.1		
N4BP2L2	10443	broad.mit.edu;bcgsc.ca	37	13	33017802	33017802	+	Missense_Mutation	SNP	G	G	C			TCGA-OR-A5KX-01A-11D-A29I-10	TCGA-OR-A5KX-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8369398d-9d6a-48dd-b20d-4e699ceddc1b	4b83e274-a5a1-430f-8ea8-70a4a64581c9	g.chr13:33017802G>C	ENST00000504114.1	-	6	918	c.827C>G	c.(826-828)tCt>tGt	p.S276C	N4BP2L2_ENST00000357505.6_Missense_Mutation_p.S276C|N4BP2L2_ENST00000446957.2_Intron|N4BP2L2_ENST00000399396.3_Missense_Mutation_p.S291C|N4BP2L2_ENST00000380121.3_5'UTR			Q92802	N42L2_HUMAN	NEDD4 binding protein 2-like 2	0					negative regulation of hematopoietic stem cell differentiation (GO:1902037)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of hematopoietic stem cell proliferation (GO:1902035)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|transcriptional repressor complex (GO:0017053)	enzyme binding (GO:0019899)|RNA polymerase II transcription corepressor activity (GO:0001106)			kidney(4)|large_intestine(3)|liver(1)|lung(6)|skin(1)|urinary_tract(1)	16		Lung SC(185;0.0262)		all cancers(112;9.5e-07)|Epithelial(112;5.07e-06)|OV - Ovarian serous cystadenocarcinoma(117;0.00196)|BRCA - Breast invasive adenocarcinoma(63;0.00438)|GBM - Glioblastoma multiforme(144;0.243)		CTTCATGCCAGAGCAGTCATC	0.388																																					p.S291C		.											.	N4BP2L2-68	0			c.C872G						.						98.0	91.0	94.0					13																	33017802		1875	4115	5990	SO:0001583	missense	10443	exon7			ATGCCAGAGCAGT	U50532	CCDS9346.1, CCDS45024.1, CCDS61307.1	13q13.1	2010-12-02			ENSG00000244754	ENSG00000244754			26916	protein-coding gene	gene with protein product	"""phosphonoformate immuno-associated protein 5"""	615788				8812419	Standard	NM_014887		Approved	CG005, PFAAP5	uc010abe.1	Q92802	OTTHUMG00000016700	ENST00000504114.1:c.827C>G	13.37:g.33017802G>C	ENSP00000427477:p.Ser276Cys	Somatic	280	0		WXS	Illumina GAIIx	Phase_I	249	9	NM_033111	0	0	0	0	0	A3KME8	Missense_Mutation	SNP	ENST00000504114.1	37		.	.	.	.	.	.	.	.	.	.	G	16.20	3.054956	0.55325	.	.	ENSG00000139617;ENSG00000139617;ENSG00000244754;ENSG00000244754;ENSG00000244754	ENST00000380121;ENST00000503296;ENST00000504114;ENST00000357505;ENST00000399396	.	.	.	4.91	4.04	0.47022	.	1.144740	0.06291	N	0.699163	T	0.66416	0.2787	M	0.62723	1.935	0.09310	N	1	D;D;D;D	0.76494	0.997;0.997;0.999;0.999	D;D;D;D	0.66351	0.912;0.912;0.943;0.943	T	0.49485	-0.8935	9	0.66056	D	0.02	-1.7176	11.4498	0.50145	0.0:0.0:0.8195:0.1805	.	276;291;174;174	B4DPY1;Q92802-3;Q96KV2;Q9Y3H6	.;.;.;.	C	174;203;276;276;291	.	ENSP00000350104:S276C	S	-	2	0	N4BP2L2;RP11-298P3.4	31915802	0.002000	0.14202	0.017000	0.16124	0.183000	0.23260	0.613000	0.24299	0.985000	0.38656	0.655000	0.94253	TCT	.		0.388	N4BP2L2-004	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000361380.1	NM_014887	
ING1	3621	hgsc.bcm.edu	37	13	111368316	111368316	+	Silent	SNP	C	C	T	rs9555726	byFrequency	TCGA-OR-A5KX-01A-11D-A29I-10	TCGA-OR-A5KX-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8369398d-9d6a-48dd-b20d-4e699ceddc1b	4b83e274-a5a1-430f-8ea8-70a4a64581c9	g.chr13:111368316C>T	ENST00000375774.3	+	1	988	c.526C>T	c.(526-528)Ctg>Ttg	p.L176L	ING1_ENST00000338450.7_Intron|ING1_ENST00000375775.3_Intron|ING1_ENST00000464141.1_Intron|CARS2_ENST00000535398.1_5'Flank|ING1_ENST00000333219.7_Intron	NM_005537.4	NP_005528.3	Q9UK53	ING1_HUMAN	inhibitor of growth family, member 1	176					cell cycle (GO:0007049)|chromatin modification (GO:0016568)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|positive regulation of transcription, DNA-templated (GO:0045893)|protein import into nucleus (GO:0006606)|regulation of cell death (GO:0010941)	nucleus (GO:0005634)	methylated histone binding (GO:0035064)|zinc ion binding (GO:0008270)			endometrium(4)|large_intestine(6)|lung(1)|ovary(1)	12	all_lung(23;3.61e-05)|Lung NSC(43;0.00144)|Lung SC(71;0.0753)|all_neural(89;0.077)|Medulloblastoma(90;0.148)		BRCA - Breast invasive adenocarcinoma(86;0.188)			GGCCGCATCTCTGCTGACCCG	0.706													C|||	2912	0.58147	0.23	0.6816	5008	,	,		11066	0.7252		0.6909	False		,,,				2504	0.7249				p.L176L		.											.	ING1-515	0			c.C526T						.	C	,,,	1347,2085		295,757,664	14.0	24.0	21.0		526,,,	-5.6	0.0	13	dbSNP_119	21	5238,1736		2020,1198,269	no	coding-synonymous,intron,intron,intron	ING1	NM_005537.3,NM_198217.1,NM_198218.1,NM_198219.1	,,,	2315,1955,933	TT,TC,CC		24.8925,39.2483,36.7192	,,,	176/423,,,	111368316	6585,3821	1716	3487	5203	SO:0001819	synonymous_variant	3621	exon1			GCATCTCTGCTGA		CCDS9515.1, CCDS9516.1, CCDS9517.1, CCDS9518.1	13q34	2013-01-28			ENSG00000153487	ENSG00000153487		"""Zinc fingers, PHD-type"""	6062	protein-coding gene	gene with protein product	"""inhibitor of growth 1"", ""tumor suppressor ING1"", ""growth inhibitor ING1"", ""growth inhibitory protein ING1"""	601566				8944021, 9186514	Standard	NM_198219		Approved	p33ING1, p33ING1b, p24ING1c, p33, p47, p47ING1a	uc001vri.3	Q9UK53	OTTHUMG00000017346	ENST00000375774.3:c.526C>T	13.37:g.111368316C>T		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	4	4	NM_005537	0	0	0	0	0	O00532|O43658|Q53ZR3|Q5T9G8|Q5T9G9|Q5T9H0|Q5T9H1|Q9H007|Q9HD98|Q9HD99|Q9NS83|Q9P0U6|Q9UBC6|Q9UIJ1|Q9UIJ2|Q9UIJ3|Q9UIJ4|Q9UK52	Silent	SNP	ENST00000375774.3	37	CCDS9517.1																																																																																			C|0.372;T|0.628		0.706	ING1-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000045770.2	NM_005537	
ARHGEF40	55701	bcgsc.ca	37	14	21542766	21542766	+	Missense_Mutation	SNP	A	A	G	rs12889267	byFrequency	TCGA-OR-A5KX-01A-11D-A29I-10	TCGA-OR-A5KX-10A-01D-A29L-10	A	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8369398d-9d6a-48dd-b20d-4e699ceddc1b	4b83e274-a5a1-430f-8ea8-70a4a64581c9	g.chr14:21542766A>G	ENST00000298694.4	+	3	1004	c.877A>G	c.(877-879)Aag>Gag	p.K293E	ARHGEF40_ENST00000298693.3_Missense_Mutation_p.K293E			Q8TER5	ARH40_HUMAN	Rho guanine nucleotide exchange factor (GEF) 40	293	Gly-rich.			K -> E (in Ref. 1; BAB15753). {ECO:0000305}.		cytoplasm (GO:0005737)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)			large_intestine(4)|ovary(3)|upper_aerodigestive_tract(2)	9						GATGCACCAGAAGGGCCTGGG	0.726													A|||	589	0.117612	0.0076	0.3256	5008	,	,		16427	0.0298		0.1332	False		,,,				2504	0.1933				p.K293E		.											.	ARHGEF40-228	0			c.A877G						.	A	GLU/LYS	145,4217		2,141,2038	9.0	12.0	11.0		877	3.9	1.0	14	dbSNP_121	11	1243,7299		89,1065,3117	no	missense	ARHGEF40	NM_018071.3	56	91,1206,5155	GG,GA,AA		14.5516,3.3242,10.7564	possibly-damaging	293/1520	21542766	1388,11516	2181	4271	6452	SO:0001583	missense	55701	exon3			CACCAGAAGGGCC		CCDS32041.1	14q11.2	2012-07-24			ENSG00000165801	ENSG00000165801		"""Rho guanine nucleotide exchange factors"""	25516	protein-coding gene	gene with protein product		610018				16143467	Standard	NM_001278529		Approved	solo, FLJ10357	uc001vzp.3	Q8TER5		ENST00000298694.4:c.877A>G	14.37:g.21542766A>G	ENSP00000298694:p.Lys293Glu	Somatic	28	0		WXS	Illumina GAIIx	Phase_I	56	4	NM_018071	0	0	7	7	0	A5PL07|Q9BWP5|Q9H7L6|Q9NTF9|Q9NW24	Missense_Mutation	SNP	ENST00000298694.4	37	CCDS32041.1	238	0.10897435897435898	5	0.01016260162601626	111	0.30662983425414364	16	0.027972027972027972	106	0.13984168865435356	A	13.06	2.123470	0.37436	0.033242	0.145516	ENSG00000165801	ENST00000298694;ENST00000555038;ENST00000298693	T;T	0.02737	4.23;4.18	5.12	3.91	0.45181	.	0.125962	0.36167	N	0.002751	T	0.00012	0.0000	N	0.24115	0.695	0.35578	P	0.193959	P;D	0.54207	0.646;0.965	B;P	0.52454	0.175;0.699	T	0.59085	-0.7520	9	0.40728	T	0.16	.	9.8244	0.40903	0.8276:0.1724:0.0:0.0	rs12889267	293;293	Q8TER5;G3V3N2	ARH40_HUMAN;.	E	293	ENSP00000298694:K293E;ENSP00000298693:K293E	ENSP00000298693:K293E	K	+	1	0	ARHGEF40	20612606	0.852000	0.29690	1.000000	0.80357	0.269000	0.26545	0.992000	0.29667	1.941000	0.56285	0.459000	0.35465	AAG	A|0.891;G|0.109		0.726	ARHGEF40-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000413122.1		
NID2	22795	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	14	52520649	52520649	+	Silent	SNP	G	G	A			TCGA-OR-A5KX-01A-11D-A29I-10	TCGA-OR-A5KX-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8369398d-9d6a-48dd-b20d-4e699ceddc1b	4b83e274-a5a1-430f-8ea8-70a4a64581c9	g.chr14:52520649G>A	ENST00000216286.5	-	5	1076	c.1077C>T	c.(1075-1077)tcC>tcT	p.S359S	NID2_ENST00000541773.1_Silent_p.S306S	NM_007361.3	NP_031387.3	Q14112	NID2_HUMAN	nidogen 2 (osteonidogen)	359					basement membrane organization (GO:0071711)|cell adhesion (GO:0007155)|cell-matrix adhesion (GO:0007160)|extracellular matrix organization (GO:0030198)	basement membrane (GO:0005604)|cell surface (GO:0009986)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)|collagen binding (GO:0005518)			NS(1)|breast(5)|endometrium(9)|kidney(4)|large_intestine(11)|liver(1)|lung(40)|ovary(2)|pancreas(2)|prostate(2)|skin(3)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	87	Breast(41;0.0639)|all_epithelial(31;0.123)					GATCCAAGGTGGAAGATTCTG	0.502																																					p.S359S		.											.	NID2-158	0			c.C1077T						.						66.0	65.0	65.0					14																	52520649		2203	4300	6503	SO:0001819	synonymous_variant	22795	exon5			CAAGGTGGAAGAT	AB009799	CCDS9706.1	14q22.1	2008-05-14			ENSG00000087303	ENSG00000087303			13389	protein-coding gene	gene with protein product		605399				9733643	Standard	NM_007361		Approved		uc001wzo.3	Q14112	OTTHUMG00000140298	ENST00000216286.5:c.1077C>T	14.37:g.52520649G>A		Somatic	100	0		WXS	Illumina GAIIx	Phase_I	109	41	NM_007361	0	0	0	0	0	A8K6I7|B4DU19|O43710	Silent	SNP	ENST00000216286.5	37	CCDS9706.1																																																																																			.		0.502	NID2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276888.1		
TTLL5	23093	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	14	76232414	76232414	+	Missense_Mutation	SNP	A	A	C			TCGA-OR-A5KX-01A-11D-A29I-10	TCGA-OR-A5KX-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8369398d-9d6a-48dd-b20d-4e699ceddc1b	4b83e274-a5a1-430f-8ea8-70a4a64581c9	g.chr14:76232414A>C	ENST00000298832.9	+	20	1923	c.1718A>C	c.(1717-1719)cAa>cCa	p.Q573P	TTLL5_ENST00000555422.1_3'UTR|TTLL5_ENST00000556893.1_Missense_Mutation_p.Q124P|TTLL5_ENST00000557636.1_Missense_Mutation_p.Q587P|TTLL5_ENST00000554510.1_Missense_Mutation_p.Q82P	NM_015072.4	NP_055887.3	Q6EMB2	TTLL5_HUMAN	tubulin tyrosine ligase-like family, member 5	573					fertilization (GO:0009566)|protein polyglutamylation (GO:0018095)|sperm axoneme assembly (GO:0007288)|sperm motility (GO:0030317)|transcription, DNA-templated (GO:0006351)	centrosome (GO:0005813)|cilium (GO:0005929)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	ligase activity (GO:0016874)			NS(2)|breast(2)|central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|kidney(1)|large_intestine(3)|lung(22)|ovary(2)|pancreas(1)|prostate(2)|skin(2)|urinary_tract(2)	50				BRCA - Breast invasive adenocarcinoma(234;0.029)		GTGATTACCCAACCAGCTGAA	0.393																																					p.Q573P		.											.	TTLL5-92	0			c.A1718C						.						71.0	69.0	69.0					14																	76232414		2203	4300	6503	SO:0001583	missense	23093	exon20			TTACCCAACCAGC	AF107885	CCDS32124.1	14q24.3	2014-09-09	2005-07-29	2005-07-29	ENSG00000119685	ENSG00000119685		"""Tubulin tyrosine ligase-like family"""	19963	protein-coding gene	gene with protein product		612268	"""KIAA0998"""	KIAA0998		15890843	Standard	NM_015072		Approved		uc001xrx.3	Q6EMB2	OTTHUMG00000171611	ENST00000298832.9:c.1718A>C	14.37:g.76232414A>C	ENSP00000298832:p.Gln573Pro	Somatic	77	0		WXS	Illumina GAIIx	Phase_I	62	29	NM_015072	0	0	0	0	0	B9EGH8|B9EGH9|Q9BUB0|Q9H0G4|Q9H7W2|Q9P1V5|Q9UPZ4	Missense_Mutation	SNP	ENST00000298832.9	37	CCDS32124.1	.	.	.	.	.	.	.	.	.	.	A	13.58	2.280409	0.40294	.	.	ENSG00000119685	ENST00000418433;ENST00000557636;ENST00000298832;ENST00000393826;ENST00000556893;ENST00000554510	T;T;T;T	0.26957	3.9;3.96;1.7;1.75	5.02	3.88	0.44766	.	1.165510	0.06215	N	0.685711	T	0.21103	0.0508	L	0.40543	1.245	0.35195	D	0.773717	B;P;B	0.49358	0.256;0.923;0.052	B;B;B	0.36608	0.176;0.229;0.053	T	0.30937	-0.9961	10	0.52906	T	0.07	.	8.5864	0.33660	0.9109:0.0:0.0891:0.0	.	587;124;573	G3V2J9;Q6EMB2-2;Q6EMB2	.;.;TTLL5_HUMAN	P	260;587;573;124;124;82	ENSP00000450713:Q587P;ENSP00000298832:Q573P;ENSP00000452524:Q124P;ENSP00000451946:Q82P	ENSP00000298832:Q573P	Q	+	2	0	TTLL5	75302167	0.938000	0.31826	1.000000	0.80357	0.995000	0.86356	4.388000	0.59633	1.910000	0.55303	0.378000	0.23410	CAA	.		0.393	TTLL5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414453.1	NM_015072	
SEL1L	6400	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	14	81961479	81961479	+	Silent	SNP	A	A	C			TCGA-OR-A5KX-01A-11D-A29I-10	TCGA-OR-A5KX-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8369398d-9d6a-48dd-b20d-4e699ceddc1b	4b83e274-a5a1-430f-8ea8-70a4a64581c9	g.chr14:81961479A>C	ENST00000336735.4	-	11	1247	c.1131T>G	c.(1129-1131)gtT>gtG	p.V377V		NM_005065.5	NP_005056.3	Q9UBV2	SE1L1_HUMAN	sel-1 suppressor of lin-12-like (C. elegans)	377	Interaction with ERLEC1, OS9 and SYVN1.				Notch signaling pathway (GO:0007219)|response to endoplasmic reticulum stress (GO:0034976)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)				breast(2)|central_nervous_system(1)|endometrium(4)|large_intestine(7)|lung(7)|ovary(1)|pancreas(1)|prostate(2)|urinary_tract(3)	28				BRCA - Breast invasive adenocarcinoma(234;0.0299)		GTCCAAGACCAACCTGAAAAT	0.438																																					p.V377V		.											.	SEL1L-227	0			c.T1131G						.						119.0	93.0	102.0					14																	81961479		2203	4300	6503	SO:0001819	synonymous_variant	6400	exon11			AAGACCAACCTGA		CCDS9876.1, CCDS58333.1	14q31	2011-03-31	2001-11-28		ENSG00000071537	ENSG00000071537			10717	protein-coding gene	gene with protein product	"""sel-1 suppressor of lin-12-like 1 (C. elegans)"""	602329	"""sel-1 (suppressor of lin-12, C.elegans)-like"""			9417916, 10051412, 16331677	Standard	NM_005065		Approved	IBD2, SEL1L1	uc010tvv.2	Q9UBV2		ENST00000336735.4:c.1131T>G	14.37:g.81961479A>C		Somatic	168	0		WXS	Illumina GAIIx	Phase_I	110	21	NM_005065	0	0	0	0	0	Q6UWT6|Q9P1T9|Q9UHK7	Silent	SNP	ENST00000336735.4	37	CCDS9876.1																																																																																			.		0.438	SEL1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000413325.1	NM_005065	
AHNAK2	113146	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	14	105407448	105407448	+	Silent	SNP	T	T	C			TCGA-OR-A5KX-01A-11D-A29I-10	TCGA-OR-A5KX-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8369398d-9d6a-48dd-b20d-4e699ceddc1b	4b83e274-a5a1-430f-8ea8-70a4a64581c9	g.chr14:105407448T>C	ENST00000333244.5	-	7	14459	c.14340A>G	c.(14338-14340)gaA>gaG	p.E4780E	AHNAK2_ENST00000557457.1_Intron	NM_138420.2	NP_612429.2	Q8IVF2	AHNK2_HUMAN	AHNAK nucleoprotein 2	4780						costamere (GO:0043034)|cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)				cervix(4)|endometrium(4)|large_intestine(3)|lung(14)|ovary(2)|prostate(2)|skin(1)|stomach(3)	33		all_cancers(154;0.115)|Melanoma(154;0.155)|all_epithelial(191;0.183)	all cancers(16;0.000479)|OV - Ovarian serous cystadenocarcinoma(23;0.00659)|Epithelial(46;0.0151)|GBM - Glioblastoma multiforme(11;0.116)			GAATAGAAGATTCAAAGTGAG	0.493																																					p.E4780E		.											.	AHNAK2-47	0			c.A14340G						.						93.0	98.0	96.0					14																	105407448		1941	4133	6074	SO:0001819	synonymous_variant	113146	exon7			AGAAGATTCAAAG	AB095939	CCDS45177.1	14q32.33	2010-04-01	2007-03-26	2007-03-26	ENSG00000185567	ENSG00000185567			20125	protein-coding gene	gene with protein product		608570	"""chromosome 14 open reading frame 78"""	C14orf78		15007166	Standard	NM_138420		Approved		uc010axc.1	Q8IVF2		ENST00000333244.5:c.14340A>G	14.37:g.105407448T>C		Somatic	143	0		WXS	Illumina GAIIx	Phase_I	252	84	NM_138420	0	0	0	0	0	Q5BKX7|Q7Z343|Q7Z358|Q7Z394|Q7Z3G0|Q86WQ6|Q8IYY1|Q8N3G4|Q96EX9	Silent	SNP	ENST00000333244.5	37	CCDS45177.1																																																																																			.		0.493	AHNAK2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000410300.1	NM_138420	
PCSK6	5046	bcgsc.ca	37	15	101922323	101922323	+	Silent	SNP	A	A	G	rs1058260	byFrequency	TCGA-OR-A5KX-01A-11D-A29I-10	TCGA-OR-A5KX-10A-01D-A29L-10	A	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8369398d-9d6a-48dd-b20d-4e699ceddc1b	4b83e274-a5a1-430f-8ea8-70a4a64581c9	g.chr15:101922323A>G	ENST00000348070.1	-	12	1502	c.1503T>C	c.(1501-1503)tgT>tgC	p.C501C	PCSK6_ENST00000358417.3_Silent_p.C501C|PCSK6_ENST00000398181.2_Silent_p.C501C|PCSK6_ENST00000331826.7_Silent_p.C336C|PCSK6_ENST00000561177.1_5'UTR|PCSK6_ENST00000344273.2_Silent_p.C501C	NM_002570.3|NM_138320.1	NP_002561.1|NP_612193.1	P29122	PCSK6_HUMAN	proprotein convertase subtilisin/kexin type 6	502					determination of left/right symmetry (GO:0007368)|glycoprotein metabolic process (GO:0009100)|nerve growth factor processing (GO:0032455)|nerve growth factor production (GO:0032902)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptide hormone processing (GO:0016486)|protein processing (GO:0016485)|regulation of BMP signaling pathway (GO:0030510)|secretion by cell (GO:0032940)|zygotic determination of anterior/posterior axis, embryo (GO:0007354)	cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|extracellular matrix (GO:0031012)|extracellular space (GO:0005615)|Golgi lumen (GO:0005796)|membrane (GO:0016020)	endopeptidase activity (GO:0004175)|heparin binding (GO:0008201)|nerve growth factor binding (GO:0048406)|serine-type endopeptidase activity (GO:0004252)			breast(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(5)|lung(17)|pancreas(2)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	32	Lung NSC(78;0.00102)|all_lung(78;0.00128)|Melanoma(26;0.00505)		OV - Ovarian serous cystadenocarcinoma(32;0.000803)|LUSC - Lung squamous cell carcinoma(107;0.187)|Lung(145;0.23)			AGGCGGCCACACACATGTGCT	0.537													A|||	1181	0.235823	0.2874	0.2305	5008	,	,		21150	0.125		0.2575	False		,,,				2504	0.2618				.		.											.	PCSK6-46	0			.						.	A	,,,,,,	1161,3203		154,853,1175	59.0	65.0	63.0		1504,1504,1504,1504,1504,1504,1504	-9.1	0.0	15	dbSNP_86	63	2067,6481		248,1571,2455	yes	coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous	PCSK6	NM_002570.3,NM_138319.2,NM_138320.1,NM_138321.1,NM_138323.1,NM_138324.1,NM_138325.2	,,,,,,	402,2424,3630	GG,GA,AA		24.1811,26.604,25.0	,,,,,,	502/970,502/957,502/976,502/963,502/624,502/653,502/665	101922323	3228,9684	2182	4274	6456	SO:0001819	synonymous_variant	5046	.			GGCCACACACATG		CCDS73789.1, CCDS73790.1, CCDS73791.1, CCDS73792.1, CCDS73793.1	15q26	2008-07-18	2004-06-14	2004-06-16		ENSG00000140479			8569	protein-coding gene	gene with protein product	"""subtilisin-like protease"", ""subtilisin-like proprotein convertase 4"", ""subtilisin/kexin-like protease PACE4"""	167405	"""paired basic amino acid cleaving system 4"""	PACE4		1741956	Standard	NM_002570		Approved	SPC4	uc002bwy.3	P29122		ENST00000348070.1:c.1503T>C	15.37:g.101922323A>G		Somatic	123	0		WXS	Illumina GAIIx	Phase_I	93	5	.	0	0	11	11	0	Q15099|Q15100|Q9UEG7|Q9UEJ1|Q9UEJ2|Q9UEJ7|Q9UEJ8|Q9UEJ9|Q9Y4G9|Q9Y4H0|Q9Y4H1	Silent	SNP	ENST00000348070.1	37																																																																																				A|0.764;G|0.236		0.537	PCSK6-203	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding		NM_002570	
CLCN7	1186	bcgsc.ca	37	16	1500501	1500501	+	Silent	SNP	C	C	T	rs117461525	byFrequency	TCGA-OR-A5KX-01A-11D-A29I-10	TCGA-OR-A5KX-10A-01D-A29L-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8369398d-9d6a-48dd-b20d-4e699ceddc1b	4b83e274-a5a1-430f-8ea8-70a4a64581c9	g.chr16:1500501C>T	ENST00000382745.4	-	17	2219	c.1614G>A	c.(1612-1614)gcG>gcA	p.A538A	LA16c-390E6.4_ENST00000563610.1_RNA|CLCN7_ENST00000448525.1_Silent_p.A514A|CLCN7_ENST00000262318.8_Silent_p.A514A	NM_001287.5	NP_001278.1	P51798	CLCN7_HUMAN	chloride channel, voltage-sensitive 7	538					chloride transmembrane transport (GO:1902476)|ion transmembrane transport (GO:0034220)|response to pH (GO:0009268)|transmembrane transport (GO:0055085)|transport (GO:0006810)	cytoplasmic vesicle (GO:0031410)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)	antiporter activity (GO:0015297)|ATP binding (GO:0005524)|chloride channel activity (GO:0005254)|voltage-gated chloride channel activity (GO:0005247)			breast(2)|central_nervous_system(3)|endometrium(3)|kidney(3)|large_intestine(2)|lung(8)|ovary(1)|skin(2)	24		Hepatocellular(780;0.0893)				CACTCACCGCCGCCCCCGTGA	0.697													C|||	187	0.0373403	0.0189	0.0749	5008	,	,		11861	0.0		0.0875	False		,,,				2504	0.0225				p.A538A		.											.	CLCN7-92	0			c.G1614A						.	C	,	145,4175		2,141,2017	15.0	18.0	17.0		1542,1614	-9.0	0.9	16	dbSNP_132	17	851,7713		35,781,3466	no	coding-synonymous,coding-synonymous	CLCN7	NM_001114331.1,NM_001287.4	,	37,922,5483	TT,TC,CC		9.9369,3.3565,7.7305	,	514/782,538/806	1500501	996,11888	2160	4282	6442	SO:0001819	synonymous_variant	1186	exon17			CACCGCCGCCCCC	Z67743	CCDS32361.1, CCDS45378.1	16p13	2012-09-26	2012-02-23		ENSG00000103249	ENSG00000103249		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Ion channels / Chloride channels : Voltage-sensitive"""	2025	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 63"""	602727	"""chloride channel 7"""			8543009	Standard	NM_001114331		Approved	CLC-7, OPTA2, CLC7, ClC-7, PPP1R63	uc002clv.3	P51798	OTTHUMG00000044467	ENST00000382745.4:c.1614G>A	16.37:g.1500501C>T		Somatic	67	0		WXS	Illumina GAIIx	Phase_I	64	4	NM_001287	0	0	1	1	0	A6NEJ7|A8K5T9|A8K7X1|B3KPN3|E9PDB9|Q9NYX5	Silent	SNP	ENST00000382745.4	37	CCDS32361.1																																																																																			C|0.940;T|0.060		0.697	CLCN7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000103598.2	NM_001287	
CLCN7	1186	bcgsc.ca	37	16	1502857	1502857	+	Missense_Mutation	SNP	C	C	T	rs12926089	byFrequency	TCGA-OR-A5KX-01A-11D-A29I-10	TCGA-OR-A5KX-10A-01D-A29L-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8369398d-9d6a-48dd-b20d-4e699ceddc1b	4b83e274-a5a1-430f-8ea8-70a4a64581c9	g.chr16:1502857C>T	ENST00000382745.4	-	15	1857	c.1252G>A	c.(1252-1254)Gtg>Atg	p.V418M	LA16c-390E6.4_ENST00000563610.1_RNA|CLCN7_ENST00000448525.1_Missense_Mutation_p.V394M|CLCN7_ENST00000262318.8_Missense_Mutation_p.V394M	NM_001287.5	NP_001278.1	P51798	CLCN7_HUMAN	chloride channel, voltage-sensitive 7	418			V -> M (in dbSNP:rs12926089). {ECO:0000269|PubMed:14584882}.		chloride transmembrane transport (GO:1902476)|ion transmembrane transport (GO:0034220)|response to pH (GO:0009268)|transmembrane transport (GO:0055085)|transport (GO:0006810)	cytoplasmic vesicle (GO:0031410)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)	antiporter activity (GO:0015297)|ATP binding (GO:0005524)|chloride channel activity (GO:0005254)|voltage-gated chloride channel activity (GO:0005247)			breast(2)|central_nervous_system(3)|endometrium(3)|kidney(3)|large_intestine(2)|lung(8)|ovary(1)|skin(2)	24		Hepatocellular(780;0.0893)				GCCACCAGCACGGCCTCAATC	0.677													T|||	395	0.0788738	0.1604	0.0951	5008	,	,		15111	0.0		0.0924	False		,,,				2504	0.0245				p.V418M		.											.	CLCN7-92	0			c.G1252A	GRCh37	CM057585	CLCN7	M	rs12926089	.	T	MET/VAL,MET/VAL	711,3631		63,585,1523	14.0	14.0	14.0		1180,1252	2.9	1.0	16	dbSNP_121	14	887,7653		48,791,3431	yes	missense,missense	CLCN7	NM_001114331.1,NM_001287.4	21,21	111,1376,4954	TT,TC,CC		10.3864,16.3749,12.4049	benign,benign	394/782,418/806	1502857	1598,11284	2171	4270	6441	SO:0001583	missense	1186	exon15			CCAGCACGGCCTC	Z67743	CCDS32361.1, CCDS45378.1	16p13	2012-09-26	2012-02-23		ENSG00000103249	ENSG00000103249		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Ion channels / Chloride channels : Voltage-sensitive"""	2025	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 63"""	602727	"""chloride channel 7"""			8543009	Standard	NM_001114331		Approved	CLC-7, OPTA2, CLC7, ClC-7, PPP1R63	uc002clv.3	P51798	OTTHUMG00000044467	ENST00000382745.4:c.1252G>A	16.37:g.1502857C>T	ENSP00000372193:p.Val418Met	Somatic	249	3		WXS	Illumina GAIIx	Phase_I	189	9	NM_001287	0	0	4	4	0	A6NEJ7|A8K5T9|A8K7X1|B3KPN3|E9PDB9|Q9NYX5	Missense_Mutation	SNP	ENST00000382745.4	37	CCDS32361.1	200	0.09157509157509157	83	0.16869918699186992	38	0.10497237569060773	0	0.0	79	0.10422163588390501	T	0.173	-1.069814	0.01918	0.163749	0.103864	ENSG00000103249	ENST00000448525;ENST00000262318;ENST00000382745;ENST00000428756	D;D	0.94723	-3.5;-3.5	5.15	2.86	0.33363	Chloride channel, core (2);	0.115098	0.85682	N	0.000000	T	0.01320	0.0043	N	0.16862	0.45	0.53005	P	3.799999999998249E-5	B;B	0.16603	0.018;0.005	B;B	0.17722	0.019;0.007	T	0.44267	-0.9339	9	0.23302	T	0.38	-20.2438	8.1552	0.31165	0.0:0.2533:0.0:0.7467	rs12926089;rs59307144;rs12926089	394;418	E9PDB9;P51798	.;CLCN7_HUMAN	M	394;371;418;360	ENSP00000410907:V394M;ENSP00000372193:V418M	ENSP00000262318:V371M	V	-	1	0	CLCN7	1442858	1.000000	0.71417	0.997000	0.53966	0.326000	0.28443	1.084000	0.30828	0.005000	0.14708	-0.361000	0.07541	GTG	C|0.889;T|0.111		0.677	CLCN7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000103598.2	NM_001287	
CLCN7	1186	bcgsc.ca	37	16	1502864	1502864	+	Silent	SNP	A	A	G	rs12926669	byFrequency	TCGA-OR-A5KX-01A-11D-A29I-10	TCGA-OR-A5KX-10A-01D-A29L-10	A	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8369398d-9d6a-48dd-b20d-4e699ceddc1b	4b83e274-a5a1-430f-8ea8-70a4a64581c9	g.chr16:1502864A>G	ENST00000382745.4	-	15	1850	c.1245T>C	c.(1243-1245)atT>atC	p.I415I	LA16c-390E6.4_ENST00000563610.1_RNA|CLCN7_ENST00000448525.1_Silent_p.I391I|CLCN7_ENST00000262318.8_Silent_p.I391I	NM_001287.5	NP_001278.1	P51798	CLCN7_HUMAN	chloride channel, voltage-sensitive 7	415				I -> V (in Ref. 2; BAG51745). {ECO:0000305}.	chloride transmembrane transport (GO:1902476)|ion transmembrane transport (GO:0034220)|response to pH (GO:0009268)|transmembrane transport (GO:0055085)|transport (GO:0006810)	cytoplasmic vesicle (GO:0031410)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)	antiporter activity (GO:0015297)|ATP binding (GO:0005524)|chloride channel activity (GO:0005254)|voltage-gated chloride channel activity (GO:0005247)			breast(2)|central_nervous_system(3)|endometrium(3)|kidney(3)|large_intestine(2)|lung(8)|ovary(1)|skin(2)	24		Hepatocellular(780;0.0893)				GCACGGCCTCAATCACCTGCA	0.672													G|||	311	0.0621006	0.1051	0.0836	5008	,	,		15014	0.0		0.0895	False		,,,				2504	0.0245				p.I415I		.											.	CLCN7-92	0			c.T1245C						.	G	,	496,3848		24,448,1700	14.0	14.0	14.0		1173,1245	-10.3	0.1	16	dbSNP_121	14	846,7700		39,768,3466	no	coding-synonymous,coding-synonymous	CLCN7	NM_001114331.1,NM_001287.4	,	63,1216,5166	GG,GA,AA		9.8994,11.418,10.4112	,	391/782,415/806	1502864	1342,11548	2172	4273	6445	SO:0001819	synonymous_variant	1186	exon15			GGCCTCAATCACC	Z67743	CCDS32361.1, CCDS45378.1	16p13	2012-09-26	2012-02-23		ENSG00000103249	ENSG00000103249		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Ion channels / Chloride channels : Voltage-sensitive"""	2025	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 63"""	602727	"""chloride channel 7"""			8543009	Standard	NM_001114331		Approved	CLC-7, OPTA2, CLC7, ClC-7, PPP1R63	uc002clv.3	P51798	OTTHUMG00000044467	ENST00000382745.4:c.1245T>C	16.37:g.1502864A>G		Somatic	256	2		WXS	Illumina GAIIx	Phase_I	192	8	NM_001287	0	0	5	5	0	A6NEJ7|A8K5T9|A8K7X1|B3KPN3|E9PDB9|Q9NYX5	Silent	SNP	ENST00000382745.4	37	CCDS32361.1																																																																																			A|0.912;G|0.088		0.672	CLCN7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000103598.2	NM_001287	
ERI2	112479	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	16	20810279	20810279	+	Silent	SNP	C	C	T			TCGA-OR-A5KX-01A-11D-A29I-10	TCGA-OR-A5KX-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8369398d-9d6a-48dd-b20d-4e699ceddc1b	4b83e274-a5a1-430f-8ea8-70a4a64581c9	g.chr16:20810279C>T	ENST00000357967.4	-	9	885	c.843G>A	c.(841-843)aaG>aaA	p.K281K	ERI2_ENST00000300005.3_Intron|ERI2_ENST00000389345.5_Silent_p.K16K|ERI2_ENST00000563117.1_Silent_p.K188K|ERI2_ENST00000564349.1_Silent_p.K188K|ERI2_ENST00000569729.1_Intron	NM_001142725.1	NP_001136197.1	A8K979	ERI2_HUMAN	ERI1 exoribonuclease family member 2	281							exonuclease activity (GO:0004527)|nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)			endometrium(1)|kidney(1)|large_intestine(5)|lung(2)|prostate(2)	11						TTTTAGGCTCCTTATTATATA	0.328																																					p.K281K		.											.	ERI2-153	0			c.G843A						.						31.0	24.0	26.0					16																	20810279		692	1587	2279	SO:0001819	synonymous_variant	112479	exon9			AGGCTCCTTATTA	BC010503	CCDS10590.1, CCDS45436.1	16p12.3	2014-02-18	2009-10-07	2008-12-16	ENSG00000196678	ENSG00000196678		"""Enhanced RNAi three prime mRNA exonucleases"""	30541	protein-coding gene	gene with protein product	"""enhanced RNAi three prime mRNA exonuclease homolog 2 (C.elegans)"", ""exoribonuclease 2"", ""zinc finger, GRF-type containing 5"""		"""exonuclease domain containing 1"""	EXOD1		10819331	Standard	NM_080663		Approved	KIAA1504, MGC16943, ZGRF5	uc010vbb.1	A8K979	OTTHUMG00000131557	ENST00000357967.4:c.843G>A	16.37:g.20810279C>T		Somatic	47	0		WXS	Illumina GAIIx	Phase_I	62	8	NM_001142725	0	0	1	2	1	Q6ZSJ2|Q96FR9|Q9P224|Q9Y6V3	Silent	SNP	ENST00000357967.4	37	CCDS45436.1																																																																																			.		0.328	ERI2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_080663	
CES3	23491	bcgsc.ca	37	16	67006838	67006838	+	Silent	SNP	G	G	A	rs3848289	byFrequency	TCGA-OR-A5KX-01A-11D-A29I-10	TCGA-OR-A5KX-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8369398d-9d6a-48dd-b20d-4e699ceddc1b	4b83e274-a5a1-430f-8ea8-70a4a64581c9	g.chr16:67006838G>A	ENST00000303334.4	+	13	1673	c.1602G>A	c.(1600-1602)cgG>cgA	p.R534R	CES3_ENST00000394037.1_Silent_p.R531R|CES3_ENST00000543856.1_Silent_p.R173R	NM_024922.5	NP_079198.2	Q6UWW8	EST3_HUMAN	carboxylesterase 3	534						endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)	carboxylic ester hydrolase activity (GO:0052689)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(4)|lung(6)|ovary(3)|skin(1)	24		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0488)|Epithelial(162;0.127)		CAGTGCCACGGGCCGGACAGA	0.572													G|||	216	0.043131	0.0015	0.0836	5008	,	,		19260	0.0675		0.0527	False		,,,				2504	0.0358				p.R534R		.											.	CES3-517	0			c.G1602A						.	G	,,	54,4346	52.9+/-88.7	0,54,2146	89.0	88.0	88.0		519,1593,1602	-7.4	0.0	16	dbSNP_108	88	419,8181	130.8+/-188.7	11,397,3892	no	coding-synonymous,coding-synonymous,coding-synonymous	CES3	NM_001185176.1,NM_001185177.1,NM_024922.5	,,	11,451,6038	AA,AG,GG		4.8721,1.2273,3.6385	,,	173/211,531/569,534/572	67006838	473,12527	2200	4300	6500	SO:0001819	synonymous_variant	23491	exon13			GCCACGGGCCGGA	AK025389	CCDS10826.1, CCDS54022.1, CCDS54023.1	16q22.1	2014-05-13	2008-07-25		ENSG00000172828	ENSG00000172828		"""Carboxylesterases"""	1865	protein-coding gene	gene with protein product	"""esterase 31"", ""brain carboxylesterase BR3"""	605279	"""carboxylesterase 3 (brain)"""			10518925, 14581373, 15100172, 20931200	Standard	NM_001185176		Approved	FLJ21736, ES31	uc002eqt.3	Q6UWW8	OTTHUMG00000137525	ENST00000303334.4:c.1602G>A	16.37:g.67006838G>A		Somatic	214	0		WXS	Illumina GAIIx	Phase_I	221	7	NM_024922	0	0	0	0	0	B2Z3W9|F5H242|Q7Z6J1|Q9H6X7	Silent	SNP	ENST00000303334.4	37	CCDS10826.1																																																																																			G|0.955;A|0.045		0.572	CES3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000268848.1	NM_024922	
PKD1L3	342372	broad.mit.edu	37	16	72001136	72001136	+	RNA	SNP	G	G	A	rs4788587	byFrequency	TCGA-OR-A5KX-01A-11D-A29I-10	TCGA-OR-A5KX-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8369398d-9d6a-48dd-b20d-4e699ceddc1b	4b83e274-a5a1-430f-8ea8-70a4a64581c9	g.chr16:72001136G>A	ENST00000534738.1	-	0	2364							Q7Z443	PK1L3_HUMAN	polycystic kidney disease 1-like 3						cation transport (GO:0006812)|cellular response to acidic pH (GO:0071468)|detection of chemical stimulus involved in sensory perception of sour taste (GO:0001581)|neuropeptide signaling pathway (GO:0007218)|sensory perception of sour taste (GO:0050915)	cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium channel activity (GO:0005262)|carbohydrate binding (GO:0030246)			autonomic_ganglia(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|lung(3)|skin(2)	22						AGGCCCCCTCGTTCAAAGACT	0.552													G|||	1319	0.263379	0.2383	0.2305	5008	,	,		17400	0.4058		0.174	False		,,,				2504	0.2658				.		.											.	PKD1L3-68	0			.						.	G	stop/ARG	306,1078		36,234,422	64.0	62.0	63.0		2365	1.3	0.3	16	dbSNP_111	63	632,2550		56,520,1015	yes	stop-gained	PKD1L3	NM_181536.1		92,754,1437	AA,AG,GG		19.8617,22.1098,20.5431		789/1733	72001136	938,3628	692	1591	2283			342372	.			CCCCTCGTTCAAA	AY164485	CCDS73912.1	16q22.2	2008-02-05				ENSG00000277481			21716	protein-coding gene	gene with protein product		607895				12782129	Standard	NM_181536		Approved		uc010vmm.2	Q7Z443			16.37:g.72001136G>A		Somatic	124	1		WXS	Illumina GAIIx	Phase_I	87	6	.	0	0	0	0	0		RNA	SNP	ENST00000534738.1	37																																																																																				G|0.739;A|0.261		0.552	PKD1L3-001	KNOWN	basic	processed_transcript	processed_transcript	OTTHUMT00000387876.1	NM_181536	
NAA38	84316	bcgsc.ca	37	17	7760704	7760704	+	Silent	SNP	A	A	G	rs8522	byFrequency	TCGA-OR-A5KX-01A-11D-A29I-10	TCGA-OR-A5KX-10A-01D-A29L-10	A	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8369398d-9d6a-48dd-b20d-4e699ceddc1b	4b83e274-a5a1-430f-8ea8-70a4a64581c9	g.chr17:7760704A>G	ENST00000335155.5	-	1	77	c.78T>C	c.(76-78)gcT>gcC	p.A26A	LSMD1_ENST00000576384.1_5'Flank|LSMD1_ENST00000575208.1_Intron|LSMD1_ENST00000570555.1_5'Flank|CYB5D1_ENST00000570446.1_5'Flank|LSMD1_ENST00000575071.1_5'UTR|LSMD1_ENST00000575771.1_5'UTR|LSMD1_ENST00000333775.5_Missense_Mutation_p.L13P|CYB5D1_ENST00000332439.4_5'Flank|CYB5D1_ENST00000571846.1_5'Flank|LSMD1_ENST00000576861.1_Intron			Q9BRA0	LSMD1_HUMAN		26					negative regulation of apoptotic process (GO:0043066)	cytoplasm (GO:0005737)|NatC complex (GO:0031417)|nucleus (GO:0005634)				endometrium(1)|lung(2)|ovary(1)	4		all_cancers(10;0.11)|Prostate(122;0.219)				TGCTAACCCCAGCACTGGAGC	0.637													G|||	2185	0.436302	0.388	0.3905	5008	,	,		15269	0.7956		0.1948	False		,,,				2504	0.4121				p.L13P	GBM(66;626 1401 29924 42527)	.											.	LSMD1-91	0			c.T38C						.	G	PRO/LEU	1544,2862	641.0+/-397.4	272,1000,931	42.0	52.0	49.0		38	-5.0	0.9	17	dbSNP_52	49	1882,6718	711.5+/-405.8	209,1464,2627	yes	missense	LSMD1	NM_032356.3	98	481,2464,3558	GG,GA,AA		21.8837,35.0431,26.3417	benign	13/174	7760704	3426,9580	2203	4300	6503	SO:0001819	synonymous_variant	84316	exon1			AACCCCAGCACTG																												ENST00000335155.5:c.78T>C	17.37:g.7760704A>G		Somatic	180	1		WXS	Illumina GAIIx	Phase_I	97	5	NM_032356	0	0	1	1	0	Q8N4M0	Missense_Mutation	SNP	ENST00000335155.5	37		874	0.4001831501831502	148	0.3008130081300813	127	0.35082872928176795	465	0.8129370629370629	134	0.17678100263852242	G	0.844	-0.740751	0.03088	0.350431	0.218837	ENSG00000183011	ENST00000333775	T	0.56444	0.46	5.65	-5.02	0.02982	.	0.196677	0.25469	N	0.030450	T	0.00012	0.0000	.	.	.	0.09310	P	0.999999999877715	B	0.02656	0.0	B	0.01281	0.0	T	0.32161	-0.9917	8	0.11794	T	0.64	.	3.8358	0.08893	0.5487:0.1141:0.2209:0.1162	rs8522;rs1129549;rs3826332;rs11551746;rs17855012;rs52822583;rs58072623;rs8522	13	Q9BRA0-2	.	P	13	ENSP00000332103:L13P	ENSP00000332103:L13P	L	-	2	0	LSMD1	7701429	0.911000	0.30947	0.947000	0.38551	0.581000	0.36288	-0.339000	0.07832	-0.670000	0.05282	-0.916000	0.02749	CTG	A|0.678;G|0.322		0.637	LSMD1-201	KNOWN	basic|appris_principal	protein_coding	protein_coding			
MYH4	4622	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	10358566	10358566	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5KX-01A-11D-A29I-10	TCGA-OR-A5KX-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8369398d-9d6a-48dd-b20d-4e699ceddc1b	4b83e274-a5a1-430f-8ea8-70a4a64581c9	g.chr17:10358566C>T	ENST00000255381.2	-	20	2331	c.2221G>A	c.(2221-2223)Gac>Aac	p.D741N	RP11-799N11.1_ENST00000581304.1_RNA|RP11-799N11.1_ENST00000399342.2_RNA|CTC-297N7.11_ENST00000587182.2_RNA	NM_017533.2	NP_060003.2	Q9Y623	MYH4_HUMAN	myosin, heavy chain 4, skeletal muscle	741	Myosin motor.				actin filament-based movement (GO:0030048)|ATP catabolic process (GO:0006200)|membrane organization (GO:0061024)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|response to activity (GO:0014823)	muscle myosin complex (GO:0005859)|myofibril (GO:0030016)|myosin filament (GO:0032982)|sarcomere (GO:0030017)	ATP binding (GO:0005524)|double-stranded RNA binding (GO:0003725)|microfilament motor activity (GO:0000146)			NS(4)|breast(8)|central_nervous_system(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(13)|lung(72)|ovary(10)|prostate(7)|skin(9)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	149						TTCTTGCTGTCAATGAACTGA	0.378																																					p.D741N		.											.	MYH4-102	0			c.G2221A						.						87.0	86.0	86.0					17																	10358566		2203	4300	6503	SO:0001583	missense	4622	exon20			TGCTGTCAATGAA		CCDS11154.1	17p13.1	2013-09-19	2006-09-29		ENSG00000264424	ENSG00000264424		"""Myosins / Myosin superfamily : Class II"""	7574	protein-coding gene	gene with protein product		160742	"""myosin, heavy polypeptide 4, skeletal muscle"""			8518795	Standard	NM_017533		Approved	MYH2B, MyHC-2B, MyHC-IIb	uc002gmn.3	Q9Y623	OTTHUMG00000130365	ENST00000255381.2:c.2221G>A	17.37:g.10358566C>T	ENSP00000255381:p.Asp741Asn	Somatic	102	0		WXS	Illumina GAIIx	Phase_I	62	6	NM_017533	0	0	0	0	0		Missense_Mutation	SNP	ENST00000255381.2	37	CCDS11154.1	.	.	.	.	.	.	.	.	.	.	C	28.8	4.955069	0.92726	.	.	ENSG00000141048	ENST00000255381	T	0.73258	-0.73	5.22	5.22	0.72569	Myosin head, motor domain (2);	0.000000	0.39146	U	0.001447	D	0.86632	0.5979	M	0.87381	2.88	0.80722	D	1	D	0.89917	1.0	D	0.79108	0.992	D	0.88451	0.3049	10	0.66056	D	0.02	.	19.1318	0.93410	0.0:1.0:0.0:0.0	.	741	Q9Y623	MYH4_HUMAN	N	741	ENSP00000255381:D741N	ENSP00000255381:D741N	D	-	1	0	MYH4	10299291	1.000000	0.71417	1.000000	0.80357	0.972000	0.66771	7.689000	0.84165	2.600000	0.87896	0.313000	0.20887	GAC	.		0.378	MYH4-001	KNOWN	NAGNAG_splice_site|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252731.1	NM_017533	
ELAC2	60528	hgsc.bcm.edu;broad.mit.edu	37	17	12905890	12905890	+	Silent	SNP	C	C	G			TCGA-OR-A5KX-01A-11D-A29I-10	TCGA-OR-A5KX-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8369398d-9d6a-48dd-b20d-4e699ceddc1b	4b83e274-a5a1-430f-8ea8-70a4a64581c9	g.chr17:12905890C>G	ENST00000338034.4	-	13	1325	c.1086G>C	c.(1084-1086)ggG>ggC	p.G362G	ELAC2_ENST00000395962.2_Silent_p.G343G|ELAC2_ENST00000426905.3_Silent_p.G322G|ELAC2_ENST00000609345.1_5'Flank	NM_018127.6|NM_173717.1	NP_060597.4|NP_776065.1	Q9BQ52	RNZ2_HUMAN	elaC ribonuclease Z 2	362					mitochondrial tRNA 3'-trailer cleavage, endonucleolytic (GO:0072684)	mitochondrion (GO:0005739)|nucleus (GO:0005634)	endonuclease activity (GO:0004519)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(4)|kidney(2)|large_intestine(4)|lung(8)|skin(1)	23						GGGTGTCAGGCCCAAACCTGT	0.552											OREG0024189	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.G362G		.											.	ELAC2-90	0			c.G1086C						.						95.0	89.0	91.0					17																	12905890		2203	4300	6503	SO:0001819	synonymous_variant	60528	exon13			GTCAGGCCCAAAC	AF304370	CCDS11164.1, CCDS54093.1	17p11.2	2013-05-24	2013-05-24		ENSG00000006744	ENSG00000006744	3.1.26.11		14198	protein-coding gene	gene with protein product	"""tRNase Z (long form)"""	605367	"""elaC (E. coli) homolog 2"", ""elaC homolog 2 (E. coli)"""			10986046, 16636667, 21559454	Standard	NM_018127		Approved	FLJ10530, HPC2	uc010vvr.2	Q9BQ52	OTTHUMG00000058764	ENST00000338034.4:c.1086G>C	17.37:g.12905890C>G		Somatic	162	0	683	WXS	Illumina GAIIx	Phase_I	97	5	NM_173717	0	0	0	0	0	B4DPL9|Q6IA94|Q9HAS8|Q9HAS9|Q9NVT1	Silent	SNP	ENST00000338034.4	37	CCDS11164.1	.	.	.	.	.	.	.	.	.	.	C	9.096	1.003000	0.19121	.	.	ENSG00000006744	ENST00000446899	.	.	.	5.37	0.253	0.15551	.	.	.	.	.	T	0.50446	0.1616	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.38714	-0.9648	4	.	.	.	-32.5929	4.644	0.12563	0.1316:0.3393:0.4406:0.0885	.	.	.	.	P	142	.	.	A	-	1	0	ELAC2	12846615	0.046000	0.20272	1.000000	0.80357	0.885000	0.51271	-1.317000	0.02707	0.304000	0.22809	0.561000	0.74099	GCC	.		0.552	ELAC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000129934.5		
ELAC2	60528	bcgsc.ca	37	17	12915009	12915009	+	Missense_Mutation	SNP	G	G	A	rs4792311	byFrequency	TCGA-OR-A5KX-01A-11D-A29I-10	TCGA-OR-A5KX-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8369398d-9d6a-48dd-b20d-4e699ceddc1b	4b83e274-a5a1-430f-8ea8-70a4a64581c9	g.chr17:12915009G>A	ENST00000338034.4	-	7	889	c.650C>T	c.(649-651)tCg>tTg	p.S217L	ELAC2_ENST00000395962.2_Missense_Mutation_p.S198L|ELAC2_ENST00000426905.3_Intron|ELAC2_ENST00000609345.1_5'UTR	NM_018127.6|NM_173717.1	NP_060597.4|NP_776065.1	Q9BQ52	RNZ2_HUMAN	elaC ribonuclease Z 2	217			S -> L (in HPC2; does not affect the enzymatic activity; dbSNP:rs4792311). {ECO:0000269|PubMed:10986046, ECO:0000269|PubMed:11175785, ECO:0000269|PubMed:11522646, ECO:0000269|PubMed:12515253, ECO:0000269|PubMed:12522685, ECO:0000269|PubMed:12783937, ECO:0000269|PubMed:15489334, ECO:0000269|PubMed:18987736, ECO:0000269|Ref.3}.		mitochondrial tRNA 3'-trailer cleavage, endonucleolytic (GO:0072684)	mitochondrion (GO:0005739)|nucleus (GO:0005634)	endonuclease activity (GO:0004519)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(4)|kidney(2)|large_intestine(4)|lung(8)|skin(1)	23						ATTTTCATTCGACTCGGAGTC	0.478													G|||	1074	0.214457	0.233	0.245	5008	,	,		20610	0.0347		0.3151	False		,,,				2504	0.2495				p.S217L		.											.	ELAC2-90	0			c.C650T	GRCh37	CM010219	ELAC2	M	rs4792311	.	G	,LEU/SER,LEU/SER	1034,3372	382.5+/-324.5	119,796,1288	186.0	159.0	168.0	http://www.ncbi.nlm.nih.gov/sites/varvu?gene	,650,650	3.2	0.0	17	dbSNP_111	168	2552,6048	416.5+/-352.1	391,1770,2139	yes	intron,missense,missense	ELAC2	NM_001165962.1,NM_018127.6,NM_173717.1	,145,145	510,2566,3427	AA,AG,GG		29.6744,23.468,27.5719	,benign,benign	,217/827,217/826	12915009	3586,9420	2203	4300	6503	SO:0001583	missense	60528	exon7			TCATTCGACTCGG	AF304370	CCDS11164.1, CCDS54093.1	17p11.2	2013-05-24	2013-05-24		ENSG00000006744	ENSG00000006744	3.1.26.11		14198	protein-coding gene	gene with protein product	"""tRNase Z (long form)"""	605367	"""elaC (E. coli) homolog 2"", ""elaC homolog 2 (E. coli)"""			10986046, 16636667, 21559454	Standard	NM_018127		Approved	FLJ10530, HPC2	uc010vvr.2	Q9BQ52	OTTHUMG00000058764	ENST00000338034.4:c.650C>T	17.37:g.12915009G>A	ENSP00000337445:p.Ser217Leu	Somatic	185	3		WXS	Illumina GAIIx	Phase_I	93	6	NM_173717	0	0	5	5	0	B4DPL9|Q6IA94|Q9HAS8|Q9HAS9|Q9NVT1	Missense_Mutation	SNP	ENST00000338034.4	37	CCDS11164.1	450	0.20604395604395603	102	0.2073170731707317	85	0.23480662983425415	15	0.026223776223776224	248	0.32717678100263853	G	9.668	1.146016	0.21288	0.23468	0.296744	ENSG00000006744	ENST00000338034;ENST00000395962	T;T	0.65916	-0.16;-0.18	4.2	3.23	0.37069	.	0.515394	0.21989	N	0.066197	T	0.00012	0.0000	M	0.64997	1.995	0.53688	P	2.6999999999999247E-5	B;P;P;B	0.39782	0.05;0.488;0.688;0.356	B;B;B;B	0.29785	0.015;0.075;0.107;0.023	T	0.29882	-0.9997	9	0.12103	T	0.63	-1.3048	8.0532	0.30589	0.1087:0.0:0.8913:0.0	rs4792311;rs17849809;rs17857665;rs61070692;rs4792311	200;198;40;217	E9PGJ0;G5E9D5;E7ES68;Q9BQ52	.;.;.;RNZ2_HUMAN	L	217;198	ENSP00000337445:S217L;ENSP00000379291:S198L	ENSP00000337445:S217L	S	-	2	0	ELAC2	12855734	0.065000	0.20965	0.002000	0.10522	0.003000	0.03518	3.696000	0.54757	1.372000	0.46190	-0.148000	0.13756	TCG	G|0.755;A|0.245		0.478	ELAC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000129934.5		
FOXN1	8456	broad.mit.edu	37	17	26862078	26862078	+	Missense_Mutation	SNP	A	A	C			TCGA-OR-A5KX-01A-11D-A29I-10	TCGA-OR-A5KX-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8369398d-9d6a-48dd-b20d-4e699ceddc1b	4b83e274-a5a1-430f-8ea8-70a4a64581c9	g.chr17:26862078A>C	ENST00000226247.2	+	7	1518	c.1489A>C	c.(1489-1491)Acc>Ccc	p.T497P	FOXN1_ENST00000579795.1_Missense_Mutation_p.T497P	NM_003593.2	NP_003584.2	O15353	FOXN1_HUMAN	forkhead box N1	497					defense response (GO:0006952)|epidermis development (GO:0008544)|epithelial cell proliferation (GO:0050673)|hair follicle development (GO:0001942)|keratinocyte differentiation (GO:0030216)|lymphocyte homeostasis (GO:0002260)|nail development (GO:0035878)|organ morphogenesis (GO:0009887)|regulation of T cell differentiation in thymus (GO:0033081)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|thymus development (GO:0048538)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(1)|large_intestine(3)|lung(8)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	19	Lung NSC(42;0.00431)					GCCTGCCCACACCCCACCCAG	0.682																																					p.T497P		.											.	FOXN1-226	0			c.A1489C						.						36.0	34.0	35.0					17																	26862078		2203	4300	6503	SO:0001583	missense	8456	exon7			GCCCACACCCCAC	Y11739	CCDS11232.1	17q11-q12	2014-09-17	2003-06-12	2003-06-13	ENSG00000109101	ENSG00000109101		"""Forkhead boxes"""	12765	protein-coding gene	gene with protein product		600838	"""winged-helix nude"", ""Rowett nude"""	WHN, RONU		9321431	Standard	NM_003593		Approved	FKHL20	uc002hbj.3	O15353	OTTHUMG00000132603	ENST00000226247.2:c.1489A>C	17.37:g.26862078A>C	ENSP00000226247:p.Thr497Pro	Somatic	74	8		WXS	Illumina GAIIx	Phase_I	96	14	NM_003593	0	0	0	0	0	B2R9Q7|O15352	Missense_Mutation	SNP	ENST00000226247.2	37	CCDS11232.1	.	.	.	.	.	.	.	.	.	.	A	16.57	3.160710	0.57368	.	.	ENSG00000109101	ENST00000226247	D	0.94138	-3.36	4.35	4.35	0.52113	.	0.000000	0.64402	D	0.000004	D	0.94499	0.8229	M	0.73217	2.22	0.43714	D	0.996189	D	0.67145	0.996	P	0.56788	0.806	D	0.94411	0.7632	10	0.72032	D	0.01	.	9.7494	0.40466	0.8456:0.0:0.0:0.1544	.	497	O15353	FOXN1_HUMAN	P	497	ENSP00000226247:T497P	ENSP00000226247:T497P	T	+	1	0	FOXN1	23886205	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	3.158000	0.50723	1.826000	0.53198	0.459000	0.35465	ACC	.		0.682	FOXN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255832.1		
MIR193A	406968	bcgsc.ca	37	17	29887061	29887061	+	RNA	SNP	G	G	C			TCGA-OR-A5KX-01A-11D-A29I-10	TCGA-OR-A5KX-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8369398d-9d6a-48dd-b20d-4e699ceddc1b	4b83e274-a5a1-430f-8ea8-70a4a64581c9	g.chr17:29887061G>C	ENST00000384882.1	+	0	47					NR_029710.1				microRNA 193a																		AGATGAGGGTGTCGGATCAAC	0.711																																					.		.											.	.	0			.						.						51.0	58.0	56.0					17																	29887061		1567	3580	5147			406968	.			GAGGGTGTCGGAT			17q11.2	2011-09-12	2005-06-30	2008-12-18	ENSG00000207614	ENSG00000207614		"""ncRNAs / Micro RNAs"""	31563	non-coding RNA	RNA, micro		614733	"""microRNA 193"""	MIRN193, MIRN193A			Standard	NR_029710		Approved	hsa-mir-193, hsa-mir-193a	uc010wbv.1				17.37:g.29887061G>C		Somatic	69	0		WXS	Illumina GAIIx	Phase_I	73	4	.	0	0	0	0	0		RNA	SNP	ENST00000384882.1	37																																																																																				.		0.711	MIR193A-201	KNOWN	basic	miRNA	miRNA		NR_029710	
GPS1	2873	bcgsc.ca	37	17	80012449	80012449	+	Silent	SNP	G	G	A	rs11077966	byFrequency	TCGA-OR-A5KX-01A-11D-A29I-10	TCGA-OR-A5KX-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8369398d-9d6a-48dd-b20d-4e699ceddc1b	4b83e274-a5a1-430f-8ea8-70a4a64581c9	g.chr17:80012449G>A	ENST00000306823.6	+	4	407	c.384G>A	c.(382-384)acG>acA	p.T128T	GPS1_ENST00000578552.1_Silent_p.T124T|RFNG_ENST00000310496.4_5'Flank|GPS1_ENST00000355130.2_Silent_p.T164T|GPS1_ENST00000392358.2_Silent_p.T164T|GPS1_ENST00000320548.4_Silent_p.T108T			Q13098	CSN1_HUMAN	G protein pathway suppressor 1	128					cell cycle (GO:0007049)|cullin deneddylation (GO:0010388)|inactivation of MAPK activity (GO:0000188)|JNK cascade (GO:0007254)	COP9 signalosome (GO:0008180)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	GTPase inhibitor activity (GO:0005095)			breast(1)|central_nervous_system(1)|endometrium(3)|liver(1)|lung(4)|prostate(1)|skin(2)	13	all_neural(118;0.0878)|Ovarian(332;0.227)|all_lung(278;0.246)		BRCA - Breast invasive adenocarcinoma(99;0.0114)|OV - Ovarian serous cystadenocarcinoma(97;0.0211)			CCCTGGACACGGCCTGGGTGG	0.637													.|||	490	0.0978435	0.1377	0.0879	5008	,	,		16365	0.0833		0.0994	False		,,,				2504	0.0644				p.T164T		.											.	GPS1-226	0			c.G492A						.	G	,	544,3834		36,472,1681	22.0	20.0	21.0		384,492	-7.2	0.9	17	dbSNP_120	21	701,7887		25,651,3618	no	coding-synonymous,coding-synonymous	GPS1	NM_004127.4,NM_212492.1	,	61,1123,5299	AA,AG,GG		8.1626,12.4258,9.602	,	128/492,164/528	80012449	1245,11721	2189	4294	6483	SO:0001819	synonymous_variant	2873	exon4			GGACACGGCCTGG		CCDS11800.1, CCDS32774.1	17q25.3	2013-03-14				ENSG00000169727			4549	protein-coding gene	gene with protein product	"""COP9 signalosome subunit 1"""	601934				9535219	Standard	NM_212492		Approved	COPS1, CSN1	uc002kdl.1	Q13098		ENST00000306823.6:c.384G>A	17.37:g.80012449G>A		Somatic	81	0		WXS	Illumina GAIIx	Phase_I	79	5	NM_212492	0	0	41	41	0	Q8NA10|Q9BWL1	Silent	SNP	ENST00000306823.6	37	CCDS32774.1																																																																																			G|0.901;A|0.099		0.637	GPS1-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000442176.1	NM_212492	
LAMA1	284217	broad.mit.edu;ucsc.edu;bcgsc.ca	37	18	7011370	7011370	+	Missense_Mutation	SNP	C	C	T	rs202168119		TCGA-OR-A5KX-01A-11D-A29I-10	TCGA-OR-A5KX-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8369398d-9d6a-48dd-b20d-4e699ceddc1b	4b83e274-a5a1-430f-8ea8-70a4a64581c9	g.chr18:7011370C>T	ENST00000389658.3	-	25	3709	c.3616G>A	c.(3616-3618)Gcc>Acc	p.A1206T		NM_005559.3	NP_005550.2	P25391	LAMA1_HUMAN	laminin, alpha 1	1206	Laminin IV type A 2. {ECO:0000255|PROSITE-ProRule:PRU00458}.				axon guidance (GO:0007411)|branching involved in salivary gland morphogenesis (GO:0060445)|cell adhesion (GO:0007155)|cell surface receptor signaling pathway (GO:0007166)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|establishment of epithelial cell apical/basal polarity (GO:0045198)|extracellular matrix organization (GO:0030198)|morphogenesis of an epithelial sheet (GO:0002011)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of embryonic development (GO:0045995)|retinal blood vessel morphogenesis (GO:0061304)	basement membrane (GO:0005604)|cell-cell junction (GO:0005911)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|laminin-1 complex (GO:0005606)|laminin-3 complex (GO:0005608)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent (GO:0005201)|glycosphingolipid binding (GO:0043208)			NS(4)|breast(7)|central_nervous_system(3)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(12)|large_intestine(49)|liver(1)|lung(71)|ovary(9)|pancreas(3)|prostate(5)|skin(11)|stomach(7)|upper_aerodigestive_tract(8)|urinary_tract(3)	205		Colorectal(10;0.172)				CGGACGGTGGCGGCATCCAGC	0.637													C|||	1	0.000199681	0.0008	0.0	5008	,	,		12340	0.0		0.0	False		,,,				2504	0.0				p.A1206T		.											.	LAMA1-149	0			c.G3616A						.						23.0	24.0	24.0					18																	7011370		2203	4300	6503	SO:0001583	missense	284217	exon25			CGGTGGCGGCATC	X58531	CCDS32787.1	18p11.3	2013-03-01			ENSG00000101680	ENSG00000101680		"""Laminins"""	6481	protein-coding gene	gene with protein product		150320		LAMA		2591971	Standard	NM_005559		Approved		uc002knm.3	P25391	OTTHUMG00000133478	ENST00000389658.3:c.3616G>A	18.37:g.7011370C>T	ENSP00000374309:p.Ala1206Thr	Somatic	160	1		WXS	Illumina GAIIx	Phase_I	194	38	NM_005559	0	0	0	0	0		Missense_Mutation	SNP	ENST00000389658.3	37	CCDS32787.1	1	4.578754578754579E-4	1	0.0020325203252032522	0	0.0	0	0.0	0	0.0	C	7.943	0.743262	0.15642	.	.	ENSG00000101680	ENST00000389658	T	0.16457	2.34	5.87	0.704	0.18121	Laminin B type IV (1);	0.919613	0.09120	N	0.845811	T	0.07007	0.0178	N	0.22421	0.69	0.09310	N	1	P	0.41784	0.762	B	0.22880	0.042	T	0.31943	-0.9925	10	0.15066	T	0.55	.	6.5622	0.22493	0.2181:0.6043:0.0:0.1777	.	1206	P25391	LAMA1_HUMAN	T	1206	ENSP00000374309:A1206T	ENSP00000374309:A1206T	A	-	1	0	LAMA1	7001370	0.000000	0.05858	0.000000	0.03702	0.013000	0.08279	-0.397000	0.07269	0.083000	0.17047	0.643000	0.83706	GCC	C|0.999;T|0.000		0.637	LAMA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257369.1	NM_005559	
LAMA1	284217	broad.mit.edu	37	18	7034664	7034664	+	Missense_Mutation	SNP	T	T	A			TCGA-OR-A5KX-01A-11D-A29I-10	TCGA-OR-A5KX-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8369398d-9d6a-48dd-b20d-4e699ceddc1b	4b83e274-a5a1-430f-8ea8-70a4a64581c9	g.chr18:7034664T>A	ENST00000389658.3	-	14	1958	c.1865A>T	c.(1864-1866)cAg>cTg	p.Q622L		NM_005559.3	NP_005550.2	P25391	LAMA1_HUMAN	laminin, alpha 1	622	Laminin IV type A 1. {ECO:0000255|PROSITE-ProRule:PRU00458}.				axon guidance (GO:0007411)|branching involved in salivary gland morphogenesis (GO:0060445)|cell adhesion (GO:0007155)|cell surface receptor signaling pathway (GO:0007166)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|establishment of epithelial cell apical/basal polarity (GO:0045198)|extracellular matrix organization (GO:0030198)|morphogenesis of an epithelial sheet (GO:0002011)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of embryonic development (GO:0045995)|retinal blood vessel morphogenesis (GO:0061304)	basement membrane (GO:0005604)|cell-cell junction (GO:0005911)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|laminin-1 complex (GO:0005606)|laminin-3 complex (GO:0005608)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent (GO:0005201)|glycosphingolipid binding (GO:0043208)			NS(4)|breast(7)|central_nervous_system(3)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(12)|large_intestine(49)|liver(1)|lung(71)|ovary(9)|pancreas(3)|prostate(5)|skin(11)|stomach(7)|upper_aerodigestive_tract(8)|urinary_tract(3)	205		Colorectal(10;0.172)				ACCCTCAGCCTGTGTGCTTAA	0.333																																					p.Q622L		.											.	LAMA1-149	0			c.A1865T						.						114.0	103.0	107.0					18																	7034664		2203	4300	6503	SO:0001583	missense	284217	exon14			TCAGCCTGTGTGC	X58531	CCDS32787.1	18p11.3	2013-03-01			ENSG00000101680	ENSG00000101680		"""Laminins"""	6481	protein-coding gene	gene with protein product		150320		LAMA		2591971	Standard	NM_005559		Approved		uc002knm.3	P25391	OTTHUMG00000133478	ENST00000389658.3:c.1865A>T	18.37:g.7034664T>A	ENSP00000374309:p.Gln622Leu	Somatic	138	0		WXS	Illumina GAIIx	Phase_I	121	4	NM_005559	0	0	0	0	0		Missense_Mutation	SNP	ENST00000389658.3	37	CCDS32787.1	.	.	.	.	.	.	.	.	.	.	T	10.96	1.497375	0.26861	.	.	ENSG00000101680	ENST00000389658	T	0.34667	1.35	5.9	1.15	0.20763	Laminin B type IV (2);Laminin B, subgroup (1);	0.567679	0.16609	N	0.206962	T	0.13114	0.0318	N	0.02916	-0.46	0.24700	N	0.993264	B	0.23249	0.082	B	0.24701	0.055	T	0.33650	-0.9860	10	0.11485	T	0.65	.	7.7173	0.28712	0.0:0.5235:0.0:0.4765	.	622	P25391	LAMA1_HUMAN	L	622	ENSP00000374309:Q622L	ENSP00000374309:Q622L	Q	-	2	0	LAMA1	7024664	1.000000	0.71417	0.988000	0.46212	0.788000	0.44548	1.852000	0.39348	0.518000	0.28383	0.533000	0.62120	CAG	.		0.333	LAMA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257369.1	NM_005559	
C3	718	bcgsc.ca	37	19	6710782	6710782	+	Silent	SNP	G	G	T	rs2230203	byFrequency	TCGA-OR-A5KX-01A-11D-A29I-10	TCGA-OR-A5KX-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8369398d-9d6a-48dd-b20d-4e699ceddc1b	4b83e274-a5a1-430f-8ea8-70a4a64581c9	g.chr19:6710782G>T	ENST00000245907.6	-	13	1646	c.1554C>A	c.(1552-1554)ccC>ccA	p.P518P		NM_000064.2	NP_000055.2	P01024	CO3_HUMAN	complement component 3	518					complement activation (GO:0006956)|complement activation, alternative pathway (GO:0006957)|complement activation, classical pathway (GO:0006958)|fatty acid metabolic process (GO:0006631)|G-protein coupled receptor signaling pathway (GO:0007186)|immune response (GO:0006955)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|positive regulation of activation of membrane attack complex (GO:0001970)|positive regulation of angiogenesis (GO:0045766)|positive regulation of apoptotic cell clearance (GO:2000427)|positive regulation of G-protein coupled receptor protein signaling pathway (GO:0045745)|positive regulation of glucose transport (GO:0010828)|positive regulation of lipid storage (GO:0010884)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of type IIa hypersensitivity (GO:0001798)|positive regulation vascular endothelial growth factor production (GO:0010575)|regulation of complement activation (GO:0030449)|regulation of immune response (GO:0050776)|regulation of triglyceride biosynthetic process (GO:0010866)|signal transduction (GO:0007165)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	C5L2 anaphylatoxin chemotactic receptor binding (GO:0031715)|endopeptidase inhibitor activity (GO:0004866)|receptor binding (GO:0005102)			breast(5)|endometrium(7)|kidney(6)|large_intestine(18)|liver(1)|lung(18)|ovary(1)|pancreas(1)|prostate(5)|skin(7)|upper_aerodigestive_tract(3)	72				GBM - Glioblastoma multiforme(1328;1.36e-05)|Lung(535;0.00661)	Intravenous Immunoglobulin(DB00028)	TGATGGACAGGGGCAGCACCA	0.657													G|||	319	0.0636981	0.0098	0.0807	5008	,	,		17642	0.003		0.1859	False		,,,				2504	0.0613				p.P518P		.											.	C3-95	0			c.C1554A						.	G		159,4247	104.7+/-143.2	1,157,2045	64.0	63.0	63.0		1554	-10.4	0.0	19	dbSNP_98	63	1579,7021	287.5+/-298.3	136,1307,2857	no	coding-synonymous	C3	NM_000064.2		137,1464,4902	TT,TG,GG		18.3605,3.6087,13.3631		518/1664	6710782	1738,11268	2203	4300	6503	SO:0001819	synonymous_variant	718	exon13			GGACAGGGGCAGC	J04763	CCDS32883.1	19p13.3-p13.2	2014-09-17			ENSG00000125730	ENSG00000125730	3.4.21.43	"""Complement system"", ""Endogenous ligands"""	1318	protein-coding gene	gene with protein product	"""C3a anaphylatoxin"", ""complement component C3a"", ""complement component C3b"", ""prepro-C3"""	120700					Standard	NM_000064		Approved	CPAMD1, ARMD9, C3a, C3b	uc002mfm.3	P01024	OTTHUMG00000150335	ENST00000245907.6:c.1554C>A	19.37:g.6710782G>T		Somatic	258	2		WXS	Illumina GAIIx	Phase_I	275	9	NM_000064	0	0	3	4	1	A7E236	Silent	SNP	ENST00000245907.6	37	CCDS32883.1																																																																																			G|0.888;T|0.112		0.657	C3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317636.2	NM_000064	
PRDX2	7001	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	19	12907982	12907983	+	Splice_Site	DEL	TG	TG	-	rs534044309		TCGA-OR-A5KX-01A-11D-A29I-10	TCGA-OR-A5KX-10A-01D-A29L-10	TG	TG	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8369398d-9d6a-48dd-b20d-4e699ceddc1b	4b83e274-a5a1-430f-8ea8-70a4a64581c9	g.chr19:12907982_12907983delTG	ENST00000301522.2	-	6	640		c.e6-2		PRDX2_ENST00000334482.5_Splice_Site|CTD-2659N19.10_ENST00000585496.1_RNA	NM_005809.4	NP_005800.3	P32119	PRDX2_HUMAN	peroxiredoxin 2						cellular response to oxidative stress (GO:0034599)|hydrogen peroxide catabolic process (GO:0042744)|negative regulation of apoptotic process (GO:0043066)|negative regulation of neuron apoptotic process (GO:0043524)|regulation of apoptotic process (GO:0042981)|removal of superoxide radicals (GO:0019430)|response to oxidative stress (GO:0006979)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	antioxidant activity (GO:0016209)|thioredoxin peroxidase activity (GO:0008379)			endometrium(1)|large_intestine(1)|lung(1)|prostate(1)	4						CGGGACAAACTGTGGGAAGACA	0.51											OREG0025274	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									.		.											.	PRDX2-90	0			.						.																																			SO:0001630	splice_region_variant	7001	.			ACAAACTGTGGGA		CCDS12281.1	19p13.2	2008-07-17			ENSG00000167815	ENSG00000167815			9353	protein-coding gene	gene with protein product	"""thioredoxin-dependent peroxide reductase 1"", ""thiol-specific antioxidant 1"", ""natural killer-enhancing factor B"", ""thioredoxin peroxidase 1"", ""torin"""	600538		TDPX1		7607688	Standard	NM_005809		Approved	PRP, NKEFB, TSA, PRXII, PRX2, MGC4104	uc002mvd.4	P32119	OTTHUMG00000134285	ENST00000301522.2:c.512-2CA>-	19.37:g.12907984_12907985delTG		Somatic	116	0	683	WXS	Illumina GAIIx	Phase_I	155	17	.	0	0	0	0	0	A8K0C0|P31945|P32118|P35701|Q6FHG4|Q92763|Q9UC23	Splice_Site	DEL	ENST00000301522.2	37	CCDS12281.1																																																																																			.		0.510	PRDX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000258950.2	NM_005809	Intron
IL27RA	9466	ucsc.edu;bcgsc.ca	37	19	14161650	14161650	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5KX-01A-11D-A29I-10	TCGA-OR-A5KX-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8369398d-9d6a-48dd-b20d-4e699ceddc1b	4b83e274-a5a1-430f-8ea8-70a4a64581c9	g.chr19:14161650G>A	ENST00000263379.2	+	11	1608	c.1483G>A	c.(1483-1485)Gct>Act	p.A495T		NM_004843.3	NP_004834.1	Q6UWB1	I27RA_HUMAN	interleukin 27 receptor, alpha	495	Fibronectin type-III 3. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell surface receptor signaling pathway (GO:0007166)|defense response to Gram-positive bacterium (GO:0050830)|immune response (GO:0006955)|negative regulation of type 2 immune response (GO:0002829)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of T-helper 1 type immune response (GO:0002827)|regulation of isotype switching to IgG isotypes (GO:0048302)	integral component of plasma membrane (GO:0005887)	interleukin-27 receptor activity (GO:0045509)|transmembrane signaling receptor activity (GO:0004888)			breast(3)|endometrium(3)|kidney(2)|large_intestine(8)|lung(7)|ovary(1)|skin(1)|urinary_tract(1)	26						ATCTACCATCGCTGGACAGGG	0.592																																					p.A495T	Colon(164;1849 1896 4443 37792 47834)	.											.	IL27RA-90	0			c.G1483A						.						98.0	74.0	82.0					19																	14161650		2203	4300	6503	SO:0001583	missense	9466	exon11			ACCATCGCTGGAC	AF053004	CCDS12303.1	19p13.11	2013-02-11				ENSG00000104998		"""Interleukins and interleukin receptors"", ""Fibronectin type III domain containing"""	17290	protein-coding gene	gene with protein product	"""T-cell cytokine receptor type 1"""	605350				9600072, 11057672	Standard	NM_004843		Approved	WSX-1, TCCR, CRL1, WSX1, zcytor1, IL-27R	uc002mxx.4	Q6UWB1		ENST00000263379.2:c.1483G>A	19.37:g.14161650G>A	ENSP00000263379:p.Ala495Thr	Somatic	128	2		WXS	Illumina GAIIx	Phase_I	179	23	NM_004843	0	0	3	3	0	A0N0L1|O60624	Missense_Mutation	SNP	ENST00000263379.2	37	CCDS12303.1	.	.	.	.	.	.	.	.	.	.	G	14.60	2.584207	0.46110	.	.	ENSG00000104998	ENST00000263379	T	0.57907	0.37	4.69	4.69	0.59074	Fibronectin, type III (3);Immunoglobulin-like fold (1);	0.000000	0.39615	N	0.001318	T	0.61324	0.2338	L	0.32530	0.975	0.20074	N	0.999933	D	0.89917	1.0	D	0.83275	0.996	T	0.55289	-0.8164	10	0.72032	D	0.01	.	13.1198	0.59318	0.0:0.0:1.0:0.0	.	495	Q6UWB1	I27RA_HUMAN	T	495	ENSP00000263379:A495T	ENSP00000263379:A495T	A	+	1	0	IL27RA	14022650	0.807000	0.29009	0.138000	0.22173	0.034000	0.12701	3.006000	0.49529	2.151000	0.67156	0.461000	0.40582	GCT	.		0.592	IL27RA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458539.1	NM_004843	
NOTCH3	4854	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	19	15300189	15300189	+	Missense_Mutation	SNP	C	C	G			TCGA-OR-A5KX-01A-11D-A29I-10	TCGA-OR-A5KX-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8369398d-9d6a-48dd-b20d-4e699ceddc1b	4b83e274-a5a1-430f-8ea8-70a4a64581c9	g.chr19:15300189C>G	ENST00000263388.2	-	7	1162	c.1087G>C	c.(1087-1089)Gat>Cat	p.D363H		NM_000435.2	NP_000426.2	Q9UM47	NOTC3_HUMAN	notch 3	363	EGF-like 9. {ECO:0000255|PROSITE- ProRule:PRU00076}.				forebrain development (GO:0030900)|gene expression (GO:0010467)|glomerular capillary formation (GO:0072104)|negative regulation of neuron differentiation (GO:0045665)|neuron fate commitment (GO:0048663)|Notch receptor processing (GO:0007220)|Notch signaling pathway (GO:0007219)|positive regulation of smooth muscle cell proliferation (GO:0048661)|regulation of transcription, DNA-templated (GO:0006355)|transcription initiation from RNA polymerase II promoter (GO:0006367)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)			breast(4)|central_nervous_system(3)|endometrium(10)|kidney(3)|large_intestine(16)|liver(1)|lung(31)|ovary(8)|prostate(3)|skin(7)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	93			OV - Ovarian serous cystadenocarcinoma(3;2.6e-20)|Epithelial(3;1.34e-16)|all cancers(3;5.13e-15)			CAGATAGCATCCTCGTGGCAG	0.592																																					p.D363H		.											.	NOTCH3-855	0			c.G1087C						.						93.0	97.0	96.0					19																	15300189		2203	4300	6503	SO:0001583	missense	4854	exon7			TAGCATCCTCGTG	U97669	CCDS12326.1	19p13.2-p13.1	2013-01-10	2010-06-24			ENSG00000074181		"""Ankyrin repeat domain containing"""	7883	protein-coding gene	gene with protein product		600276	"""Notch (Drosophila) homolog 3"", ""Notch homolog 3 (Drosophila)"""	CADASIL		7835890	Standard	NM_000435		Approved	CASIL	uc002nan.3	Q9UM47		ENST00000263388.2:c.1087G>C	19.37:g.15300189C>G	ENSP00000263388:p.Asp363His	Somatic	143	0		WXS	Illumina GAIIx	Phase_I	543	43	NM_000435	0	0	0	0	0	Q9UEB3|Q9UPL3|Q9Y6L8	Missense_Mutation	SNP	ENST00000263388.2	37	CCDS12326.1	.	.	.	.	.	.	.	.	.	.	C	21.3	4.129093	0.77549	.	.	ENSG00000074181	ENST00000263388;ENST00000539383	D	0.92911	-3.13	4.68	4.68	0.58851	EGF (1);Epidermal growth factor-like (1);Epidermal growth factor-like, type 3 (1);	.	.	.	.	D	0.93488	0.7922	L	0.33093	0.98	0.54753	D	0.999984	D;D	0.89917	1.0;0.999	D;D	0.75484	0.986;0.981	D	0.94519	0.7725	9	0.72032	D	0.01	.	16.4553	0.84011	0.0:1.0:0.0:0.0	.	366;363	Q59FL3;Q9UM47	.;NOTC3_HUMAN	H	363;365	ENSP00000263388:D363H	ENSP00000263388:D363H	D	-	1	0	NOTCH3	15161189	1.000000	0.71417	1.000000	0.80357	0.697000	0.40408	7.336000	0.79245	2.175000	0.68902	0.306000	0.20318	GAT	.		0.592	NOTCH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465714.1	NM_000435	
CHERP	10523	broad.mit.edu	37	19	16640581	16640583	+	In_Frame_Del	DEL	TGC	TGC	-			TCGA-OR-A5KX-01A-11D-A29I-10	TCGA-OR-A5KX-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8369398d-9d6a-48dd-b20d-4e699ceddc1b	4b83e274-a5a1-430f-8ea8-70a4a64581c9	g.chr19:16640581_16640583delTGC	ENST00000198939.6	-	8	1074_1076	c.1038_1040delGCA	c.(1036-1041)cagcaa>caa	p.346_347QQ>Q	CHERP_ENST00000546361.2_In_Frame_Del_p.335_336QQ>Q|CTD-3222D19.2_ENST00000409035.1_Intron					calcium homeostasis endoplasmic reticulum protein											endometrium(3)|kidney(2)|large_intestine(4)|lung(9)|ovary(2)|stomach(1)|urinary_tract(3)	24						ctgctgctgttgctgctgctgct	0.67																																					p.335_336del		.											.	CHERP-92	0			c.1005_1007del						.																																			SO:0001651	inframe_deletion	10523	exon8			TGCTGTTGCTGCT	U94836	CCDS42518.1	19p13.1	2013-01-28				ENSG00000085872		"""G patch domain containing"""	16930	protein-coding gene	gene with protein product						8896557, 10794731	Standard	NM_006387		Approved	ERPROT213-21, DAN16	uc002nei.1	Q8IWX8	OTTHUMG00000169304	ENST00000198939.6:c.1038_1040delGCA	19.37:g.16640590_16640592delTGC	ENSP00000198939:p.Gln352del	Somatic	102	0		WXS	Illumina GAIIx	Phase_I	311	9	NM_006387	0	0	0	0	0		In_Frame_Del	DEL	ENST00000198939.6	37																																																																																				.		0.670	CHERP-003	NOVEL	not_organism_supported|basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000403372.1	NM_006387	
PGLS	25796	hgsc.bcm.edu	37	19	17622614	17622614	+	Silent	SNP	C	C	T	rs11086075	byFrequency	TCGA-OR-A5KX-01A-11D-A29I-10	TCGA-OR-A5KX-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8369398d-9d6a-48dd-b20d-4e699ceddc1b	4b83e274-a5a1-430f-8ea8-70a4a64581c9	g.chr19:17622614C>T	ENST00000252603.2	+	1	177	c.133C>T	c.(133-135)Ctg>Ttg	p.L45L	CTD-3131K8.2_ENST00000596643.1_lincRNA	NM_012088.2	NP_036220.1	O95336	6PGL_HUMAN	6-phosphogluconolactonase	45					carbohydrate metabolic process (GO:0005975)|pentose-phosphate shunt (GO:0006098)|pentose-phosphate shunt, oxidative branch (GO:0009051)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	6-phosphogluconolactonase activity (GO:0017057)|monosaccharide binding (GO:0048029)			endometrium(1)|lung(1)	2						CGCGCTCGGCCTGTCGGGCGG	0.736													C|||	1862	0.371805	0.2496	0.4207	5008	,	,		10575	0.377		0.4851	False		,,,				2504	0.3804				p.L45L		.											.	PGLS-90	0			c.C133T						.	C		662,2504		107,448,1028	2.0	2.0	2.0		133	2.6	1.0	19	dbSNP_120	2	2200,4094		507,1186,1454	no	coding-synonymous	PGLS	NM_012088.2		614,1634,2482	TT,TC,CC		34.9539,20.9097,30.2537		45/259	17622614	2862,6598	1583	3147	4730	SO:0001819	synonymous_variant	25796	exon1			CTCGGCCTGTCGG	AJ243972	CCDS12361.1	19p13.2	2008-02-05				ENSG00000130313	3.1.1.31		8903	protein-coding gene	gene with protein product		604951				10518023	Standard	NM_012088		Approved	6PGL	uc002ngw.3	O95336		ENST00000252603.2:c.133C>T	19.37:g.17622614C>T		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	8	8	NM_012088	0	0	0	1	1		Silent	SNP	ENST00000252603.2	37	CCDS12361.1																																																																																			C|0.617;T|0.383		0.736	PGLS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464154.1		
KIAA1683	80726	broad.mit.edu	37	19	18375608	18375608	+	Intron	SNP	G	G	A	rs8102923	byFrequency	TCGA-OR-A5KX-01A-11D-A29I-10	TCGA-OR-A5KX-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8369398d-9d6a-48dd-b20d-4e699ceddc1b	4b83e274-a5a1-430f-8ea8-70a4a64581c9	g.chr19:18375608G>A	ENST00000600328.3	-	3	2810				KIAA1683_ENST00000600359.3_Intron|KIAA1683_ENST00000392413.4_Silent_p.A914A			Q9H0B3	K1683_HUMAN	KIAA1683							mitochondrion (GO:0005739)|nucleus (GO:0005634)				breast(1)|endometrium(7)|kidney(2)|large_intestine(7)|lung(11)|ovary(2)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)	37						CCTTGGACAGGGCCTGGTTCA	0.632													G|||	1504	0.300319	0.4561	0.2478	5008	,	,		18615	0.3165		0.1581	False		,,,				2504	0.2566				p.A914A		.											.	KIAA1683-92	0			c.C2742T						.	G	,,	593,791		121,351,220	29.0	32.0	31.0		2742,,	1.0	1.0	19	dbSNP_116	31	517,2665		42,433,1116	no	coding-synonymous,intron,intron	KIAA1683	NM_001145304.1,NM_001145305.1,NM_025249.3	,,	163,784,1336	AA,AG,GG		16.2476,42.8468,24.3101	,,	914/1368,,	18375608	1110,3456	692	1591	2283	SO:0001627	intron_variant	80726	exon3			GGACAGGGCCTGG	AB051470	CCDS32958.1, CCDS46017.1, CCDS46018.1	19p13.1	2008-02-05				ENSG00000130518			29350	protein-coding gene	gene with protein product						11214970, 11230166	Standard	NM_025249		Approved		uc010ebn.2	Q9H0B3		ENST00000600328.3:c.2616+125C>T	19.37:g.18375608G>A		Somatic	155	2		WXS	Illumina GAIIx	Phase_I	140	5	NM_001145304	0	0	1	1	0	B4DYH2|E9PDE0|E9PH54|Q2KHR5|Q8N4G8|Q96M14|Q9C0I0	Silent	SNP	ENST00000600328.3	37	CCDS32958.1																																																																																			G|0.726;A|0.274		0.632	KIAA1683-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000466312.3		
MAG	4099	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	35800808	35800808	+	Silent	SNP	C	C	T	rs200957534		TCGA-OR-A5KX-01A-11D-A29I-10	TCGA-OR-A5KX-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8369398d-9d6a-48dd-b20d-4e699ceddc1b	4b83e274-a5a1-430f-8ea8-70a4a64581c9	g.chr19:35800808C>T	ENST00000392213.3	+	8	1422	c.1263C>T	c.(1261-1263)tgC>tgT	p.C421C	MAG_ENST00000361922.4_Silent_p.C421C|MAG_ENST00000537831.2_Silent_p.C396C|MAG_ENST00000593348.1_3'UTR	NM_002361.3	NP_002352.1	P20916	MAG_HUMAN	myelin associated glycoprotein	421	Ig-like C2-type 4.				blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|leukocyte migration (GO:0050900)|negative regulation of axonogenesis (GO:0050771)|neurotrophin TRK receptor signaling pathway (GO:0048011)|regulation of axonogenesis (GO:0050770)|substantia nigra development (GO:0021762)	integral component of membrane (GO:0016021)|paranode region of axon (GO:0033270)|plasma membrane (GO:0005886)|Schmidt-Lanterman incisure (GO:0043220)	carbohydrate binding (GO:0030246)	p.C421C(2)		NS(1)|breast(4)|central_nervous_system(1)|endometrium(3)|large_intestine(10)|lung(11)|skin(2)|upper_aerodigestive_tract(2)	34	all_lung(56;2.37e-08)|Lung NSC(56;3.66e-08)|Esophageal squamous(110;0.162)	Renal(1328;0.242)	Epithelial(14;3.14e-19)|OV - Ovarian serous cystadenocarcinoma(14;1.5e-18)|all cancers(14;1.5e-16)|LUSC - Lung squamous cell carcinoma(66;0.0417)			AGTCCCACTGCGCGGCAGCCC	0.677																																					p.C421C		.											.	MAG-947	2	Substitution - coding silent(2)	large_intestine(2)	c.C1263T						.						65.0	72.0	70.0					19																	35800808		2203	4298	6501	SO:0001819	synonymous_variant	4099	exon8			CCACTGCGCGGCA	M29273	CCDS12455.1, CCDS12456.1, CCDS56090.1	19q13.1	2013-01-29			ENSG00000105695	ENSG00000105695		"""Sialic acid binding Ig-like lectins"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6783	protein-coding gene	gene with protein product	"""sialic acid binding Ig-like lectin 4A"""	159460		GMA		2476987, 8432525	Standard	NM_080600		Approved	SIGLEC4A, SIGLEC-4A, S-MAG	uc002nyy.2	P20916		ENST00000392213.3:c.1263C>T	19.37:g.35800808C>T		Somatic	70	0		WXS	Illumina GAIIx	Phase_I	218	160	NM_080600	0	0	0	0	0	B7Z2E5|F5GYC0|Q567S4	Silent	SNP	ENST00000392213.3	37	CCDS12455.1																																																																																			.		0.677	MAG-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000466071.1	NM_080600	
PNKP	11284	broad.mit.edu	37	19	50370408	50370408	+	Silent	SNP	T	T	C			TCGA-OR-A5KX-01A-11D-A29I-10	TCGA-OR-A5KX-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8369398d-9d6a-48dd-b20d-4e699ceddc1b	4b83e274-a5a1-430f-8ea8-70a4a64581c9	g.chr19:50370408T>C	ENST00000322344.3	-	2	163	c.54A>G	c.(52-54)ggA>ggG	p.G18G	PNKP_ENST00000600910.1_Silent_p.G18G|PNKP_ENST00000600573.1_Silent_p.G18G|PNKP_ENST00000596014.1_Silent_p.G18G|PNKP_ENST00000595792.1_5'UTR	NM_007254.3	NP_009185.2	Q96T60	PNKP_HUMAN	polynucleotide kinase 3'-phosphatase	18	FHA.			G -> E (in Ref. 1; AAD51135). {ECO:0000305}.	dephosphorylation (GO:0016311)|DNA damage response, detection of DNA damage (GO:0042769)|DNA repair (GO:0006281)|DNA-dependent DNA replication (GO:0006261)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|nucleotide phosphorylation (GO:0046939)|nucleotide-excision repair, DNA damage removal (GO:0000718)|polynucleotide 3' dephosphorylation (GO:0098506)|response to oxidative stress (GO:0006979)|response to radiation (GO:0009314)	membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent polydeoxyribonucleotide 5'-hydroxyl-kinase activity (GO:0046404)|damaged DNA binding (GO:0003684)|double-stranded DNA binding (GO:0003690)|endonuclease activity (GO:0004519)|nucleotide kinase activity (GO:0019201)|polynucleotide 3'-phosphatase activity (GO:0046403)|purine nucleotide binding (GO:0017076)			breast(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(1)|lung(10)|ovary(1)|urinary_tract(1)	19		all_lung(116;1.05e-05)|Lung NSC(112;3.77e-05)|all_neural(266;0.107)|Ovarian(192;0.231)		GBM - Glioblastoma multiforme(134;0.0118)|OV - Ovarian serous cystadenocarcinoma(262;0.0134)		TGGGGGGCGCTCCCCCAGGGG	0.711								Other BER factors																													p.G18G		.											.	PNKP-253	0			c.A54G						.						13.0	16.0	15.0					19																	50370408		2177	4247	6424	SO:0001819	synonymous_variant	11284	exon2			GGGCGCTCCCCCA	AF126486	CCDS12783.1	19q13.3-q13.4	2008-02-05				ENSG00000039650			9154	protein-coding gene	gene with protein product		605610				10446192, 10446193	Standard	NM_007254		Approved	PNK	uc002pqj.3	Q96T60		ENST00000322344.3:c.54A>G	19.37:g.50370408T>C		Somatic	43	6		WXS	Illumina GAIIx	Phase_I	87	21	NM_007254	0	0	28	31	3	Q9BUL2|Q9P1V2|Q9UKU8|Q9UNF8|Q9UNI0	Silent	SNP	ENST00000322344.3	37	CCDS12783.1																																																																																			.		0.711	PNKP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465830.1	NM_007254	
ASPDH	554235	hgsc.bcm.edu	37	19	51015404	51015404	+	Missense_Mutation	SNP	T	T	C	rs12977172	byFrequency	TCGA-OR-A5KX-01A-11D-A29I-10	TCGA-OR-A5KX-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8369398d-9d6a-48dd-b20d-4e699ceddc1b	4b83e274-a5a1-430f-8ea8-70a4a64581c9	g.chr19:51015404T>C	ENST00000389208.4	-	6	858	c.797A>G	c.(796-798)cAg>cGg	p.Q266R	JOSD2_ENST00000601423.1_5'Flank|ASPDH_ENST00000376916.3_Missense_Mutation_p.Q161R|ASPDH_ENST00000597030.1_5'Flank|JOSD2_ENST00000598418.1_5'Flank|JOSD2_ENST00000391815.3_5'Flank|JOSD2_ENST00000595669.1_5'Flank	NM_001114598.1	NP_001108070.1	A6ND91	ASPD_HUMAN	aspartate dehydrogenase domain containing	266			Q -> R (in dbSNP:rs12977172). {ECO:0000269|PubMed:15489334, ECO:0000269|Ref.1}.		NAD biosynthetic process (GO:0009435)|NADP catabolic process (GO:0006742)		aspartate dehydrogenase activity (GO:0033735)|NADP binding (GO:0050661)			endometrium(1)|large_intestine(1)|lung(1)	3						CAGGAGGCTCTGCCAGAAGGC	0.706													C|||	3986	0.795927	0.9728	0.7781	5008	,	,		10864	0.7143		0.6849	False		,,,				2504	0.7679				p.Q266R		.											.	ASPDH-90	0			c.A797G						.	C	ARG/GLN,ARG/GLN	3799,331		1771,257,37	6.0	9.0	8.0		482,797	1.9	1.0	19	dbSNP_121	8	5527,2593		1919,1689,452	no	missense,missense	ASPDH	NM_001024656.2,NM_001114598.1	43,43	3690,1946,489	CC,CT,TT		31.9335,8.0145,23.8694	benign,benign	161/179,266/284	51015404	9326,2924	2065	4060	6125	SO:0001583	missense	554235	exon6			AGGCTCTGCCAGA		CCDS33082.1, CCDS46153.1	19q13.33	2012-10-02			ENSG00000204653	ENSG00000204653			33856	protein-coding gene	gene with protein product							Standard	NM_001024656		Approved		uc010enz.3	A6ND91		ENST00000389208.4:c.797A>G	19.37:g.51015404T>C	ENSP00000373860:p.Gln266Arg	Somatic	2	0		WXS	Illumina GAIIx	Phase_I	23	17	NM_001114598	0	0	0	0	0	Q6NZ37	Missense_Mutation	SNP	ENST00000389208.4	37	CCDS46153.1	1681	0.7696886446886447	481	0.9776422764227642	273	0.7541436464088398	412	0.7202797202797203	515	0.679419525065963	C	3.606	-0.080592	0.07141	0.919855	0.680665	ENSG00000204653	ENST00000376916;ENST00000389208	T;T	0.39997	1.05;1.05	2.95	1.88	0.25563	Aspartate dehydrogenase (1);	1.158050	0.06646	N	0.761872	T	0.00012	0.0000	N	0.01705	-0.755	0.80722	P	0.0	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.0	T	0.30794	-0.9966	9	0.06099	T	0.92	-1.7519	4.8935	0.13738	0.0:0.6813:0.0:0.3187	rs12977172	266;161	A6ND91;A6ND91-2	ASPD_HUMAN;.	R	161;266	ENSP00000366114:Q161R;ENSP00000373860:Q266R	ENSP00000366114:Q161R	Q	-	2	0	ASPDH	55707216	0.916000	0.31088	0.989000	0.46669	0.553000	0.35397	0.171000	0.16685	0.125000	0.18397	-0.355000	0.07637	CAG	T|0.228;C|0.772		0.706	ASPDH-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464861.1	NM_001024656	
LRRC4B	94030	hgsc.bcm.edu	37	19	51052015	51052015	+	Silent	SNP	G	G	A	rs190220944	byFrequency	TCGA-OR-A5KX-01A-11D-A29I-10	TCGA-OR-A5KX-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8369398d-9d6a-48dd-b20d-4e699ceddc1b	4b83e274-a5a1-430f-8ea8-70a4a64581c9	g.chr19:51052015G>A	ENST00000599957.1	-	2	278	c.81C>T	c.(79-81)ctC>ctT	p.L27L	LRRC4B_ENST00000389201.3_Silent_p.L27L			Q9NT99	LRC4B_HUMAN	leucine rich repeat containing 4B	27					positive regulation of synapse assembly (GO:0051965)	cell junction (GO:0030054)|cerebellar mossy fiber (GO:0044300)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|synapse (GO:0045202)				breast(1)|central_nervous_system(1)|endometrium(4)|large_intestine(6)|liver(1)|lung(11)|prostate(4)|skin(1)|urinary_tract(1)	30		all_neural(266;0.131)		OV - Ovarian serous cystadenocarcinoma(262;0.00284)|GBM - Glioblastoma multiforme(134;0.0188)		AGAAGAGCCAGAGGAAGAGCA	0.741													-|||	13	0.00259585	0.0	0.0029	5008	,	,		11668	0.0		0.0109	False		,,,				2504	0.0				p.L27L		.											.	LRRC4B-205	0			c.C81T						.	G		2,3512		0,2,1755	3.0	5.0	4.0		81	1.0	1.0	19		4	42,7618		0,42,3788	no	coding-synonymous	LRRC4B	NM_001080457.1		0,44,5543	AA,AG,GG		0.5483,0.0569,0.3938		27/714	51052015	44,11130	1757	3830	5587	SO:0001819	synonymous_variant	94030	exon2			GAGCCAGAGGAAG	BC032460	CCDS42595.1	19q13.33	2014-01-30	2004-06-14	2004-06-16	ENSG00000131409	ENSG00000131409		"""Immunoglobulin superfamily / I-set domain containing"", ""Endogenous ligands"""	25042	protein-coding gene	gene with protein product	"""netrin-G3 ligand"""		"""leucine-rich repeats and immunoglobulin-like domains 4"""	LRIG4		11441184	Standard	NM_001080457		Approved	DKFZp761A179, HSM	uc002pss.3	Q9NT99		ENST00000599957.1:c.81C>T	19.37:g.51052015G>A		Somatic	2	0		WXS	Illumina GAIIx	Phase_I	20	13	NM_001080457	0	0	0	0	0	Q3ZCQ4|Q58F20	Silent	SNP	ENST00000599957.1	37	CCDS42595.1																																																																																			G|0.995;A|0.005		0.741	LRRC4B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464907.1	NM_001080457	
LRRC4B	94030	hgsc.bcm.edu	37	19	51052073	51052073	+	Missense_Mutation	SNP	G	G	A	rs142075522	byFrequency	TCGA-OR-A5KX-01A-11D-A29I-10	TCGA-OR-A5KX-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8369398d-9d6a-48dd-b20d-4e699ceddc1b	4b83e274-a5a1-430f-8ea8-70a4a64581c9	g.chr19:51052073G>A	ENST00000599957.1	-	2	220	c.23C>T	c.(22-24)cCg>cTg	p.P8L	LRRC4B_ENST00000389201.3_Missense_Mutation_p.P8L			Q9NT99	LRC4B_HUMAN	leucine rich repeat containing 4B	8					positive regulation of synapse assembly (GO:0051965)	cell junction (GO:0030054)|cerebellar mossy fiber (GO:0044300)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|synapse (GO:0045202)				breast(1)|central_nervous_system(1)|endometrium(4)|large_intestine(6)|liver(1)|lung(11)|prostate(4)|skin(1)|urinary_tract(1)	30		all_neural(266;0.131)		OV - Ovarian serous cystadenocarcinoma(262;0.00284)|GBM - Glioblastoma multiforme(134;0.0188)		CGGGGGGCACGGGGAGCCGCG	0.706													-|||	13	0.00259585	0.0	0.0029	5008	,	,		11306	0.0		0.0109	False		,,,				2504	0.0				p.P8L		.											.	LRRC4B-205	0			c.C23T						.	G	LEU/PRO	1,2957		0,1,1478	2.0	3.0	3.0		23	-2.3	1.0	19	dbSNP_134	3	29,6617		0,29,3294	yes	missense	LRRC4B	NM_001080457.1	98	0,30,4772	AA,AG,GG		0.4364,0.0338,0.3124	benign	8/714	51052073	30,9574	1479	3323	4802	SO:0001583	missense	94030	exon2			GGGCACGGGGAGC	BC032460	CCDS42595.1	19q13.33	2014-01-30	2004-06-14	2004-06-16	ENSG00000131409	ENSG00000131409		"""Immunoglobulin superfamily / I-set domain containing"", ""Endogenous ligands"""	25042	protein-coding gene	gene with protein product	"""netrin-G3 ligand"""		"""leucine-rich repeats and immunoglobulin-like domains 4"""	LRIG4		11441184	Standard	NM_001080457		Approved	DKFZp761A179, HSM	uc002pss.3	Q9NT99		ENST00000599957.1:c.23C>T	19.37:g.51052073G>A	ENSP00000471502:p.Pro8Leu	Somatic	3	0		WXS	Illumina GAIIx	Phase_I	7	5	NM_001080457	0	0	0	0	0	Q3ZCQ4|Q58F20	Missense_Mutation	SNP	ENST00000599957.1	37	CCDS42595.1	10	0.004578754578754579	0	0.0	2	0.0055248618784530384	0	0.0	8	0.010554089709762533	G	11.74	1.727840	0.30593	3.38E-4	0.004364	ENSG00000131409	ENST00000389201;ENST00000535879	T	0.57436	0.4	3.96	-2.31	0.06765	.	.	.	.	.	T	0.16769	0.0403	N	0.08118	0	0.32949	D	0.51948	B	0.02656	0.0	B	0.01281	0.0	T	0.25117	-1.0141	9	0.17832	T	0.49	.	3.5379	0.07800	0.4111:0.0:0.4157:0.1732	.	8	Q9NT99	LRC4B_HUMAN	L	8	ENSP00000373853:P8L	ENSP00000373853:P8L	P	-	2	0	LRRC4B	55743885	0.001000	0.12720	0.985000	0.45067	0.986000	0.74619	-1.006000	0.03671	-0.402000	0.07633	-0.284000	0.09977	CCG	G|0.995;A|0.005		0.706	LRRC4B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464907.1	NM_001080457	
ZNF814	730051	ucsc.edu	37	19	58384739	58384739	+	Silent	SNP	A	A	G			TCGA-OR-A5KX-01A-11D-A29I-10	TCGA-OR-A5KX-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8369398d-9d6a-48dd-b20d-4e699ceddc1b	4b83e274-a5a1-430f-8ea8-70a4a64581c9	g.chr19:58384739A>G	ENST00000435989.2	-	3	2253	c.2019T>C	c.(2017-2019)ggT>ggC	p.G673G	ZNF814_ENST00000595295.1_Intron|ZNF814_ENST00000597832.1_Intron|ZNF814_ENST00000597342.1_Intron|ZNF814_ENST00000596604.1_Intron|ZNF814_ENST00000600634.1_Intron	NM_001144989.1	NP_001138461.1	B7Z6K7	ZN814_HUMAN	zinc finger protein 814	673					regulation of transcription, DNA-templated (GO:0006355)	intracellular (GO:0005622)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|central_nervous_system(2)|endometrium(3)|kidney(9)|lung(2)|prostate(4)|skin(1)|urinary_tract(3)	25						GAATGAGGTTACCCTTGTGAC	0.403																																					p.G673G		.											.	.	0			c.T2019C						.						72.0	60.0	64.0					19																	58384739		692	1591	2283	SO:0001819	synonymous_variant	730051	exon3			GAGGTTACCCTTG		CCDS46212.1	19q13.43	2013-01-08			ENSG00000204514	ENSG00000204514		"""Zinc fingers, C2H2-type"", ""-"""	33258	protein-coding gene	gene with protein product							Standard	NM_001144989		Approved		uc002qqo.2	B7Z6K7		ENST00000435989.2:c.2019T>C	19.37:g.58384739A>G		Somatic	229	1		WXS	Illumina GAIIx	Phase_I	318	2	NM_001144989	0	0	10	13	3	A6NF35	Silent	SNP	ENST00000435989.2	37	CCDS46212.1																																																																																			.		0.403	ZNF814-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466976.1	XM_001725708	
MARCH4	57574	broad.mit.edu;bcgsc.ca	37	2	217124172	217124172	+	Missense_Mutation	SNP	C	C	T	rs370447341		TCGA-OR-A5KX-01A-11D-A29I-10	TCGA-OR-A5KX-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8369398d-9d6a-48dd-b20d-4e699ceddc1b	4b83e274-a5a1-430f-8ea8-70a4a64581c9	g.chr2:217124172C>T	ENST00000273067.4	-	4	2862	c.1096G>A	c.(1096-1098)Ggc>Agc	p.G366S	AC012513.6_ENST00000417481.1_RNA	NM_020814.2	NP_065865.1	Q9P2E8	MARH4_HUMAN	membrane-associated ring finger (C3HC4) 4, E3 ubiquitin protein ligase	366						Golgi stack (GO:0005795)|integral component of membrane (GO:0016021)|trans-Golgi network (GO:0005802)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(1)|large_intestine(5)|lung(11)|ovary(1)|prostate(1)|skin(1)	20		Renal(323;0.0854)		Epithelial(149;2.19e-05)|all cancers(144;0.00121)|LUSC - Lung squamous cell carcinoma(224;0.00902)|Lung(261;0.0125)		GAGGGGTGGCCGGCAGCCTGG	0.642																																					p.G366S		.											.	MARCH4-69	0			c.G1096A						.	C	SER/GLY	2,4404	4.2+/-10.8	0,2,2201	54.0	57.0	56.0		1096	-1.2	0.9	2		56	1,8599	1.2+/-3.3	0,1,4299	no	missense	MARCH4	NM_020814.2	56	0,3,6500	TT,TC,CC		0.0116,0.0454,0.0231	benign	366/411	217124172	3,13003	2203	4300	6503	SO:0001583	missense	57574	exon4			GGTGGCCGGCAGC	AB037820	CCDS33376.1	2q35	2013-01-09	2012-02-23		ENSG00000144583	ENSG00000144583		"""MARCH membrane-associated ring fingers"", ""RING-type (C3HC4) zinc fingers"""	29269	protein-coding gene	gene with protein product		608208	"""membrane-associated ring finger (C3HC4) 4"""			10718198, 14722266	Standard	NM_020814		Approved	KIAA1399, MARCH-IV, RNF174	uc002vgb.3	Q9P2E8	OTTHUMG00000154824	ENST00000273067.4:c.1096G>A	2.37:g.217124172C>T	ENSP00000273067:p.Gly366Ser	Somatic	119	1		WXS	Illumina GAIIx	Phase_I	199	7	NM_020814	0	0	0	0	0	Q4KMN7|Q86WR8	Missense_Mutation	SNP	ENST00000273067.4	37	CCDS33376.1	.	.	.	.	.	.	.	.	.	.	C	0.198	-1.046933	0.01997	4.54E-4	1.16E-4	ENSG00000144583	ENST00000273067	T	0.13901	2.55	5.47	-1.23	0.09465	.	1.203180	0.05391	N	0.539034	T	0.06690	0.0171	N	0.10874	0.06	0.20196	N	0.999929	B	0.02656	0.0	B	0.04013	0.001	T	0.36407	-0.9749	10	0.02654	T	1	4.0733	10.7449	0.46175	0.0:0.4748:0.0:0.5252	.	366	Q9P2E8	MARH4_HUMAN	S	366	ENSP00000273067:G366S	ENSP00000273067:G366S	G	-	1	0	MARCH4	216832417	1.000000	0.71417	0.911000	0.35937	0.149000	0.21700	1.153000	0.31676	-0.200000	0.10300	-1.267000	0.01435	GGC	.		0.642	MARCH4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337272.2	NM_020814	
ACSL3	2181	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	223789243	223789243	+	Missense_Mutation	SNP	C	C	G			TCGA-OR-A5KX-01A-11D-A29I-10	TCGA-OR-A5KX-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8369398d-9d6a-48dd-b20d-4e699ceddc1b	4b83e274-a5a1-430f-8ea8-70a4a64581c9	g.chr2:223789243C>G	ENST00000357430.3	+	11	1753	c.1222C>G	c.(1222-1224)Ctg>Gtg	p.L408V	ACSL3_ENST00000392066.3_Missense_Mutation_p.L408V	NM_004457.3	NP_004448.2	O95573	ACSL3_HUMAN	acyl-CoA synthetase long-chain family member 3	408					brain development (GO:0007420)|fatty acid biosynthetic process (GO:0006633)|long-chain fatty acid import (GO:0044539)|positive regulation of Golgi to plasma membrane protein transport (GO:0042998)|positive regulation of phosphatidylcholine biosynthetic process (GO:2001247)|positive regulation of secretion (GO:0051047)|response to nutrient (GO:0007584)|response to organic cyclic compound (GO:0014070)|very-low-density lipoprotein particle assembly (GO:0034379)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|lipid particle (GO:0005811)|membrane (GO:0016020)|mitochondrial outer membrane (GO:0005741)|perinuclear region of cytoplasm (GO:0048471)|peroxisome (GO:0005777)	ATP binding (GO:0005524)|long-chain fatty acid-CoA ligase activity (GO:0004467)|protein domain specific binding (GO:0019904)|protein kinase binding (GO:0019901)			cervix(1)|endometrium(3)|kidney(1)|large_intestine(7)|lung(5)|ovary(2)|prostate(1)|skin(2)	22		Renal(207;0.0183)		Epithelial(121;1.28e-10)|all cancers(144;8.06e-08)|Lung(261;0.00834)|LUSC - Lung squamous cell carcinoma(224;0.00864)	Icosapent(DB00159)	TCAACGTAATCTGTTTATTCT	0.333			T	ETV1	prostate																																p.L408V		.		Dom	yes		2	2q36	2181	acyl-CoA synthetase long-chain family member 3		E	.	ACSL3-228	0			c.C1222G						.						94.0	91.0	92.0					2																	223789243		2203	4299	6502	SO:0001583	missense	2181	exon10			CGTAATCTGTTTA	D89053	CCDS2455.1	2q34-q35	2008-02-05	2004-02-19	2004-02-20	ENSG00000123983	ENSG00000123983		"""Acyl-CoA synthetase family"""	3570	protein-coding gene	gene with protein product		602371	"""fatty-acid-Coenzyme A ligase, long-chain 3"""	FACL3			Standard	NM_004457		Approved	ACS3, PRO2194	uc002vnj.3	O95573	OTTHUMG00000133160	ENST00000357430.3:c.1222C>G	2.37:g.223789243C>G	ENSP00000350012:p.Leu408Val	Somatic	197	0		WXS	Illumina GAIIx	Phase_I	381	83	NM_203372	0	0	7	7	0	Q60I92|Q8IUM9	Missense_Mutation	SNP	ENST00000357430.3	37	CCDS2455.1	.	.	.	.	.	.	.	.	.	.	C	18.08	3.542793	0.65198	.	.	ENSG00000123983	ENST00000357430;ENST00000392066;ENST00000421680	T;T;T	0.74632	1.05;1.05;-0.86	5.78	1.63	0.23807	AMP-dependent synthetase/ligase (1);	0.000000	0.85682	D	0.000000	T	0.82111	0.4966	M	0.69523	2.12	0.80722	D	1	D	0.62365	0.991	D	0.72075	0.976	T	0.80513	-0.1349	10	0.66056	D	0.02	-9.4264	9.2834	0.37742	0.0:0.671:0.0:0.329	.	408	O95573	ACSL3_HUMAN	V	408;408;178	ENSP00000350012:L408V;ENSP00000375918:L408V;ENSP00000404182:L178V	ENSP00000350012:L408V	L	+	1	2	ACSL3	223497487	0.981000	0.34729	0.699000	0.30290	0.934000	0.57294	1.616000	0.36933	0.271000	0.22005	-0.186000	0.12905	CTG	.		0.333	ACSL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256862.2	NM_004457	
MFF	56947	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	228195447	228195447	+	Silent	SNP	G	G	A			TCGA-OR-A5KX-01A-11D-A29I-10	TCGA-OR-A5KX-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8369398d-9d6a-48dd-b20d-4e699ceddc1b	4b83e274-a5a1-430f-8ea8-70a4a64581c9	g.chr2:228195447G>A	ENST00000353339.3	+	4	585	c.144G>A	c.(142-144)agG>agA	p.R48R	MFF_ENST00000337110.7_Silent_p.R22R|MFF_ENST00000409616.1_Silent_p.R22R|MFF_ENST00000349901.7_Silent_p.R22R|MFF_ENST00000476924.1_Intron|MFF_ENST00000524634.1_Intron|MFF_ENST00000409565.1_Silent_p.R22R|MFF_ENST00000304593.9_Silent_p.R22R|MFF_ENST00000354503.6_Silent_p.R22R|MFF_ENST00000392059.1_Silent_p.R48R	NM_001277061.1	NP_001263990.1	Q9GZY8	MFF_HUMAN	mitochondrial fission factor	48					mitochondrial fission (GO:0000266)|mitochondrial fragmentation involved in apoptotic process (GO:0043653)|mitochondrial fusion (GO:0008053)|mitochondrion morphogenesis (GO:0070584)|peroxisome fission (GO:0016559)|positive regulation of mitochondrial fission (GO:0090141)|positive regulation of protein targeting to membrane (GO:0090314)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|protein homooligomerization (GO:0051260)|protein targeting to mitochondrion (GO:0006626)|regulation of mitochondrion organization (GO:0010821)|regulation of peroxisome organization (GO:1900063)|release of cytochrome c from mitochondria (GO:0001836)	cell junction (GO:0030054)|cytoplasmic vesicle (GO:0031410)|integral component of mitochondrial membrane (GO:0032592)|mitochondrial outer membrane (GO:0005741)|peroxisome (GO:0005777)|synapse (GO:0045202)	protein homodimerization activity (GO:0042803)	p.R48S(1)		breast(3)|endometrium(2)|kidney(3)|large_intestine(7)|lung(4)|stomach(2)	21						AGCGAATGAGGGTCCCAGAAA	0.463																																					p.R48R		.											.	MFF-153	1	Substitution - Missense(1)	lung(1)	c.G144A						.						93.0	79.0	84.0					2																	228195447		2203	4300	6503	SO:0001819	synonymous_variant	56947	exon4			AATGAGGGTCCCA	AF258660	CCDS2465.1, CCDS63139.1, CCDS63140.1, CCDS63141.1, CCDS63142.1, CCDS74662.1	2q36	2008-05-29	2008-05-29	2008-05-29	ENSG00000168958	ENSG00000168958			24858	protein-coding gene	gene with protein product		614785	"""chromosome 2 open reading frame 33"""	C2orf33		18353969	Standard	NM_001277061		Approved	GL004	uc002voy.4	Q9GZY8	OTTHUMG00000133180	ENST00000353339.3:c.144G>A	2.37:g.228195447G>A		Somatic	319	0		WXS	Illumina GAIIx	Phase_I	420	69	NM_020194	0	0	59	75	16	Q567U1|Q658R6|Q9BVZ1|Q9H690|Q9NRG8	Silent	SNP	ENST00000353339.3	37	CCDS2465.1																																																																																			.		0.463	MFF-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000256887.2	NM_020194	
DDRGK1	65992	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	20	3181069	3181069	+	Silent	SNP	C	C	T	rs148502836		TCGA-OR-A5KX-01A-11D-A29I-10	TCGA-OR-A5KX-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8369398d-9d6a-48dd-b20d-4e699ceddc1b	4b83e274-a5a1-430f-8ea8-70a4a64581c9	g.chr20:3181069C>T	ENST00000354488.3	-	3	384	c.327G>A	c.(325-327)gcG>gcA	p.A109A	DDRGK1_ENST00000380201.2_Silent_p.A109A	NM_023935.1	NP_076424.1	Q96HY6	DDRGK_HUMAN	DDRGK domain containing 1	109						endoplasmic reticulum (GO:0005783)				endometrium(1)|kidney(1)|large_intestine(1)|lung(1)|skin(2)|urinary_tract(1)	7						GGTGAGTTTCCGCTGGCTTCT	0.567													C|||	1	0.000199681	0.0	0.0	5008	,	,		19538	0.0		0.0	False		,,,				2504	0.001				p.A109A		.											.	DDRGK1-90	0			c.G327A						.	C		1,4403		0,1,2201	66.0	57.0	60.0		327	-6.4	0.1	20	dbSNP_134	60	0,8588		0,0,4294	no	coding-synonymous	DDRGK1	NM_023935.1		0,1,6495	TT,TC,CC		0.0,0.0227,0.0077		109/315	3181069	1,12991	2202	4294	6496	SO:0001819	synonymous_variant	65992	exon3			AGTTTCCGCTGGC	AL121891	CCDS13050.1	20p13	2011-08-18	2008-10-03	2008-10-03	ENSG00000198171	ENSG00000198171			16110	protein-coding gene	gene with protein product	"""Dashurin"""		"""chromosome 20 open reading frame 116"""	C20orf116		20036718, 20228063, 21494687	Standard	NM_023935		Approved	dJ1187M17.3	uc002wic.3	Q96HY6	OTTHUMG00000031732	ENST00000354488.3:c.327G>A	20.37:g.3181069C>T		Somatic	120	0		WXS	Illumina GAIIx	Phase_I	173	42	NM_023935	0	0	152	222	70	A6NIU5|C9JSZ5|Q9BW47	Silent	SNP	ENST00000354488.3	37	CCDS13050.1																																																																																			C|1.000;T|0.000		0.567	DDRGK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077709.2	NM_023935	
MCM8	84515	ucsc.edu;bcgsc.ca	37	20	5939263	5939263	+	Missense_Mutation	SNP	G	G	A	rs373810010		TCGA-OR-A5KX-01A-11D-A29I-10	TCGA-OR-A5KX-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8369398d-9d6a-48dd-b20d-4e699ceddc1b	4b83e274-a5a1-430f-8ea8-70a4a64581c9	g.chr20:5939263G>A	ENST00000378896.3	+	7	1057	c.680G>A	c.(679-681)cGt>cAt	p.R227H	MCM8_ENST00000378883.1_Missense_Mutation_p.R227H|MCM8_ENST00000378886.2_Missense_Mutation_p.R227H|MCM8_ENST00000265187.4_Missense_Mutation_p.R227H	NM_001281520.1|NM_032485.4|NM_182802.1	NP_001268449.1|NP_115874.3|NP_877954.1	Q9UJA3	MCM8_HUMAN	minichromosome maintenance complex component 8	227					cellular response to DNA damage stimulus (GO:0006974)|DNA replication (GO:0006260)|DNA strand elongation involved in DNA replication (GO:0006271)|double-strand break repair via homologous recombination (GO:0000724)|female gamete generation (GO:0007292)|G1/S transition of mitotic cell cycle (GO:0000082)|male gamete generation (GO:0048232)|mitotic cell cycle (GO:0000278)	MCM8-MCM9 complex (GO:0097362)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)			cervix(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(9)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	23						ACAGTGGTTCGTGTCAGTAAT	0.403																																					p.R227H		.											.	MCM8-227	0			c.G680A						.	G	HIS/ARG,HIS/ARG	0,4406		0,0,2203	133.0	118.0	123.0		680,680	5.8	1.0	20		123	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense	MCM8	NM_032485.4,NM_182802.1	29,29	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	probably-damaging,probably-damaging	227/841,227/825	5939263	1,13005	2203	4300	6503	SO:0001583	missense	84515	exon7			TGGTTCGTGTCAG	AJ439063	CCDS13094.1, CCDS13095.1, CCDS63226.1, CCDS63227.1	20p12.3	2007-04-04	2007-04-04	2003-07-09	ENSG00000125885	ENSG00000125885			16147	protein-coding gene	gene with protein product	"""REC homolog (Drosophila)"""	608187	"""chromosome 20 open reading frame 154"""	C20orf154		12527764	Standard	NM_032485		Approved	MGC4816, MGC12866, MGC119522, MGC119523, dJ967N21.5, REC	uc002wmi.3	Q9UJA3	OTTHUMG00000031822	ENST00000378896.3:c.680G>A	20.37:g.5939263G>A	ENSP00000368174:p.Arg227His	Somatic	170	3		WXS	Illumina GAIIx	Phase_I	213	133	NM_032485	0	0	0	2	2	B2RBG7|D3DW08|E7EQU7|Q495R4|Q495R6|Q495R7|Q86US4|Q969I5	Missense_Mutation	SNP	ENST00000378896.3	37	CCDS13094.1	.	.	.	.	.	.	.	.	.	.	G	34	5.363806	0.95877	0.0	1.16E-4	ENSG00000125885	ENST00000378896;ENST00000378883;ENST00000378886;ENST00000265187	T;T;T;T	0.08370	3.1;3.1;3.1;3.1	5.78	5.78	0.91487	Nucleic acid-binding, OB-fold-like (1);Nucleic acid-binding, OB-fold (1);	0.000000	0.85682	D	0.000000	T	0.45915	0.1366	H	0.96080	3.765	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;0.999;1.0	D;D;D;D	0.87578	0.998;0.996;0.968;0.996	T	0.62229	-0.6898	10	0.87932	D	0	-11.6392	20.0204	0.97499	0.0:0.0:1.0:0.0	.	227;227;227;227	Q9UJA3-2;E7EQU7;Q9UJA3-3;Q9UJA3	.;.;.;MCM8_HUMAN	H	227	ENSP00000368174:R227H;ENSP00000368161:R227H;ENSP00000368164:R227H;ENSP00000265187:R227H	ENSP00000265187:R227H	R	+	2	0	MCM8	5887263	1.000000	0.71417	0.992000	0.48379	0.999000	0.98932	9.630000	0.98420	2.729000	0.93468	0.650000	0.86243	CGT	.		0.403	MCM8-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000077900.1	NM_032485	
FAM182B	728882	broad.mit.edu	37	20	25755510	25755510	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5KX-01A-11D-A29I-10	TCGA-OR-A5KX-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8369398d-9d6a-48dd-b20d-4e699ceddc1b	4b83e274-a5a1-430f-8ea8-70a4a64581c9	g.chr20:25755510C>T	ENST00000376403.1	-	3	824	c.446G>A	c.(445-447)cGc>cAc	p.R149H	FAM182B_ENST00000478164.1_Intron|FAM182B_ENST00000376404.2_Intron			Q5T319	F182B_HUMAN	family with sequence similarity 182, member B	149										lung(1)	1						CCTTCCATCGCGGCCACCATG	0.706																																					.		.											.	.	0			.						.																																			SO:0001583	missense	728882	.			CCATCGCGGCCAC			20p11.1	2010-07-14			ENSG00000175170	ENSG00000175170			34503	pseudogene	pseudogene							Standard	NR_027061		Approved			Q5T319	OTTHUMG00000032136	ENST00000376403.1:c.446G>A	20.37:g.25755510C>T	ENSP00000365585:p.Arg149His	Somatic	49	1		WXS	Illumina GAIIx	Phase_I	83	5	.	0	0	4	4	0	Q4G0Q1	RNA	SNP	ENST00000376403.1	37		.	.	.	.	.	.	.	.	.	.	.	2.423	-0.332565	0.05314	.	.	ENSG00000175170	ENST00000376403	.	.	.	.	.	.	.	.	.	.	.	T	0.18425	0.0442	.	.	.	0.09310	N	0.999999	.	.	.	.	.	.	T	0.30822	-0.9965	3	0.15066	T	0.55	.	.	.	.	.	.	.	.	H	149	.	ENSP00000365585:R149H	R	-	2	0	FAM182B	25703510	0.001000	0.12720	0.047000	0.18901	0.048000	0.14542	-1.599000	0.02085	0.064000	0.16427	0.064000	0.15345	CGC	.		0.706	FAM182B-003	PUTATIVE	basic|appris_candidate_longest|exp_conf	protein_coding	protein_coding	OTTHUMT00000078463.2	NR_026714	
ZFP64	55734	broad.mit.edu;ucsc.edu;bcgsc.ca	37	20	50769031	50769031	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5KX-01A-11D-A29I-10	TCGA-OR-A5KX-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8369398d-9d6a-48dd-b20d-4e699ceddc1b	4b83e274-a5a1-430f-8ea8-70a4a64581c9	g.chr20:50769031G>A	ENST00000216923.4	-	6	2049	c.1700C>T	c.(1699-1701)cCg>cTg	p.P567L	ZFP64_ENST00000371518.2_Intron|ZFP64_ENST00000371515.4_Missense_Mutation_p.P565L|ZFP64_ENST00000346617.4_Missense_Mutation_p.P513L|ZFP64_ENST00000477786.1_Intron|ZFP64_ENST00000361387.2_Intron	NM_018197.2|NM_199426.1	NP_060667.2|NP_955458.1	Q9NPA5	ZF64A_HUMAN	ZFP64 zinc finger protein	567					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(2)|endometrium(5)|large_intestine(8)|lung(11)|ovary(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	33						CAGGACAGCCGGCTGGGTCAT	0.682																																					p.P567L		.											.	ZFP64-155	0			c.C1700T						.						34.0	36.0	35.0					20																	50769031		2203	4300	6503	SO:0001583	missense	55734	exon6			ACAGCCGGCTGGG	AK001596	CCDS13439.1, CCDS13440.1, CCDS13441.1, CCDS13442.1	20q13.11-q13.13	2013-01-08	2012-11-27		ENSG00000020256	ENSG00000020256		"""Zinc fingers, C2H2-type"""	15940	protein-coding gene	gene with protein product			"""zinc finger protein 338"", ""zinc finger protein 64 homolog (mouse)"", ""zinc finger protein 64"""	ZNF338		9034307	Standard	NM_199427		Approved	FLJ10734, dJ831D17.1, FLJ12628, dJ548G19.1	uc002xwl.3	Q9NPA5	OTTHUMG00000032756	ENST00000216923.4:c.1700C>T	20.37:g.50769031G>A	ENSP00000216923:p.Pro567Leu	Somatic	56	1		WXS	Illumina GAIIx	Phase_I	100	35	NM_018197	0	0	8	15	7	Q9NTS7|Q9NVH4	Missense_Mutation	SNP	ENST00000216923.4	37	CCDS13440.1	.	.	.	.	.	.	.	.	.	.	G	11.44	1.640648	0.29157	.	.	ENSG00000020256	ENST00000216923;ENST00000346617;ENST00000371515;ENST00000546083	T;T;T	0.08102	3.13;3.18;3.13	5.46	5.46	0.80206	.	0.000000	0.53938	D	0.000046	T	0.06600	0.0169	L	0.29908	0.895	0.54753	D	0.999986	B;B;B	0.31817	0.341;0.231;0.231	B;B;B	0.19148	0.024;0.01;0.01	T	0.25467	-1.0131	10	0.07325	T	0.83	-25.9667	19.3237	0.94253	0.0:0.0:1.0:0.0	.	513;565;567	Q9NPA5-2;Q5JWM1;Q9NPA5	.;.;ZF64A_HUMAN	L	567;513;565;409	ENSP00000216923:P567L;ENSP00000344615:P513L;ENSP00000360570:P565L	ENSP00000216923:P567L	P	-	2	0	ZFP64	50202438	1.000000	0.71417	0.987000	0.45799	0.114000	0.19823	4.106000	0.57804	2.563000	0.86464	0.650000	0.86243	CCG	.		0.682	ZFP64-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000079744.1	NM_018197	
TXNRD2	10587	bcgsc.ca	37	22	19867771	19867771	+	Silent	SNP	C	C	T	rs1139795	byFrequency	TCGA-OR-A5KX-01A-11D-A29I-10	TCGA-OR-A5KX-10A-01D-A29L-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8369398d-9d6a-48dd-b20d-4e699ceddc1b	4b83e274-a5a1-430f-8ea8-70a4a64581c9	g.chr22:19867771C>T	ENST00000400521.1	-	14	1212	c.1206G>A	c.(1204-1206)ccG>ccA	p.P402P	TXNRD2_ENST00000542719.1_Silent_p.P372P|TXNRD2_ENST00000400518.1_Silent_p.P372P|TXNRD2_ENST00000400519.1_Silent_p.P401P|TXNRD2_ENST00000535882.1_Silent_p.P401P	NM_006440.3	NP_006431.2	Q9NNW7	TRXR2_HUMAN	thioredoxin reductase 2	402					cell redox homeostasis (GO:0045454)|heart development (GO:0007507)|hemopoiesis (GO:0030097)|response to oxygen radical (GO:0000305)	mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	flavin adenine dinucleotide binding (GO:0050660)|NADP binding (GO:0050661)|thioredoxin-disulfide reductase activity (GO:0004791)			breast(1)|endometrium(7)|kidney(1)|large_intestine(4)|lung(12)|ovary(3)|urinary_tract(2)	30	Colorectal(54;0.0993)					CATACTCCAGCGGGGTGAAGA	0.627													C|||	1348	0.269169	0.6415	0.1729	5008	,	,		18114	0.0327		0.1581	False		,,,				2504	0.1922				.		.											.	TXNRD2-92	0			.						.	C		2405,1993	558.9+/-380.1	664,1077,458	44.0	57.0	53.0		1206	-9.4	0.1	22	dbSNP_86	53	1389,7209	261.2+/-283.7	122,1145,3032	no	coding-synonymous	TXNRD2	NM_006440.3		786,2222,3490	TT,TC,CC		16.1549,45.3161,29.1936		402/525	19867771	3794,9202	2199	4299	6498	SO:0001819	synonymous_variant	10587	.			CTCCAGCGGGGTG	AF106697	CCDS42981.1, CCDS63402.1	22q11.21	2014-09-17			ENSG00000184470	ENSG00000184470			18155	protein-coding gene	gene with protein product	"""thioredoxin reductase beta"", ""selenoprotein Z"""	606448				9923614, 10215850, 11012661	Standard	NM_006440		Approved	TR, TRXR2, TR3	uc021wlj.1	Q9NNW7	OTTHUMG00000149975	ENST00000400521.1:c.1206G>A	22.37:g.19867771C>T		Somatic	148	0		WXS	Illumina GAIIx	Phase_I	71	4	.	0	0	51	51	0	O95840|Q96IJ2|Q9H2Z5|Q9NZV3|Q9NZV4|Q9P2Y0|Q9P2Y1|Q9UQU8	Silent	SNP	ENST00000400521.1	37	CCDS42981.1																																																																																			C|0.782;T|0.218		0.627	TXNRD2-003	KNOWN	NMD_exception|basic|appris_candidate_longest|CCDS|seleno	protein_coding	protein_coding	OTTHUMT00000314903.3	NM_006440	
ZNF280A	129025	bcgsc.ca	37	22	22869085	22869085	+	Silent	SNP	C	C	T	rs61746878	byFrequency	TCGA-OR-A5KX-01A-11D-A29I-10	TCGA-OR-A5KX-10A-01D-A29L-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8369398d-9d6a-48dd-b20d-4e699ceddc1b	4b83e274-a5a1-430f-8ea8-70a4a64581c9	g.chr22:22869085C>T	ENST00000302097.3	-	2	1122	c.870G>A	c.(868-870)ccG>ccA	p.P290P		NM_080740.3	NP_542778.1	P59817	Z280A_HUMAN	zinc finger protein 280A	290					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(1)|large_intestine(4)|lung(8)|ovary(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	18	all_hematologic(9;0.0135)|Acute lymphoblastic leukemia(84;0.17)	all_hematologic(6;1.74e-30)|Acute lymphoblastic leukemia(6;7.75e-22)		READ - Rectum adenocarcinoma(21;0.145)		TCTTCTGTTCCGGCTGCCCAT	0.388													C|||	74	0.0147764	0.003	0.0303	5008	,	,		20559	0.0		0.0388	False		,,,				2504	0.0102				p.P290P		.											.	ZNF280A-69	0			c.G870A						.	C		34,4372	39.2+/-71.8	0,34,2169	124.0	114.0	117.0		870	0.5	0.0	22	dbSNP_129	117	300,8300	109.2+/-169.8	3,294,4003	no	coding-synonymous	ZNF280A	NM_080740.3		3,328,6172	TT,TC,CC		3.4884,0.7717,2.568		290/543	22869085	334,12672	2203	4300	6503	SO:0001819	synonymous_variant	129025	exon2			CTGTTCCGGCTGC	D87009	CCDS13800.1	22q11.21	2007-09-20	2007-09-20	2007-09-20	ENSG00000169548	ENSG00000169548			18597	protein-coding gene	gene with protein product			"""zinc finger protein 280"", ""suppressor of hairy wing homolog 1 (Drosophila)"""	ZNF280, SUHW1		9074928	Standard	NM_080740		Approved	3'OY11.1, ZNF636	uc002zwe.3	P59817	OTTHUMG00000030545	ENST00000302097.3:c.870G>A	22.37:g.22869085C>T		Somatic	199	0		WXS	Illumina GAIIx	Phase_I	115	5	NM_080740	0	0	1	1	0		Silent	SNP	ENST00000302097.3	37	CCDS13800.1																																																																																			C|0.976;T|0.024		0.388	ZNF280A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000075433.3	NM_080740	
FBXO7	25793	broad.mit.edu	37	22	32881102	32881102	+	Silent	SNP	C	C	T	rs61752254	byFrequency	TCGA-OR-A5KX-01A-11D-A29I-10	TCGA-OR-A5KX-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8369398d-9d6a-48dd-b20d-4e699ceddc1b	4b83e274-a5a1-430f-8ea8-70a4a64581c9	g.chr22:32881102C>T	ENST00000266087.7	+	4	1020	c.693C>T	c.(691-693)agC>agT	p.S231S	FBXO7_ENST00000397426.1_Silent_p.S117S|FBXO7_ENST00000382058.3_Silent_p.S152S	NM_012179.3	NP_036311.3	Q9Y3I1	FBX7_HUMAN	F-box protein 7	231	Important for dimerization and interaction with PSMF1.				cell death (GO:0008219)|mitochondrion degradation (GO:0000422)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of lymphocyte differentiation (GO:0045620)|protein targeting to mitochondrion (GO:0006626)|protein ubiquitination (GO:0016567)|regulation of protein stability (GO:0031647)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytosol (GO:0005829)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|protein complex (GO:0043234)|ubiquitin ligase complex (GO:0000151)	ubiquitin-protein transferase activity (GO:0004842)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(3)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	19						GGAAGTTGAGCGGGGTGTATA	0.488													C|||	9	0.00179712	0.0008	0.0029	5008	,	,		18000	0.0		0.003	False		,,,				2504	0.0031				p.S231S		.											.	FBXO7-228	0			c.C693T						.	C	,	5,4401	9.9+/-24.2	0,5,2198	140.0	121.0	128.0		456,693	-10.8	0.0	22	dbSNP_129	128	48,8552	31.2+/-83.2	0,48,4252	no	coding-synonymous,coding-synonymous	FBXO7	NM_001033024.1,NM_012179.3	,	0,53,6450	TT,TC,CC		0.5581,0.1135,0.4075	,	152/444,231/523	32881102	53,12953	2203	4300	6503	SO:0001819	synonymous_variant	25793	exon4			GTTGAGCGGGGTG	AF129537	CCDS13907.1, CCDS58806.1	22q12.3	2013-09-19	2004-06-15		ENSG00000100225	ENSG00000100225		"""F-boxes /  ""other"""", ""Parkinson disease"""	13586	protein-coding gene	gene with protein product		605648	"""F-box only protein 7"""			10531035, 10531037, 19038853	Standard	NM_001257990		Approved	FBX7, Fbx, PARK15	uc003amq.3	Q9Y3I1	OTTHUMG00000030674	ENST00000266087.7:c.693C>T	22.37:g.32881102C>T		Somatic	202	1		WXS	Illumina GAIIx	Phase_I	101	4	NM_012179	0	0	32	32	0	B4DNB3|B4DWX5|Q5TGC4|Q5TI86|Q96HM6|Q9UF21|Q9UKT2	Silent	SNP	ENST00000266087.7	37	CCDS13907.1																																																																																			C|0.996;T|0.004		0.488	FBXO7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000129001.1		
SAMM50	25813	bcgsc.ca	37	22	44368204	44368204	+	Silent	SNP	A	A	G	rs3177036	byFrequency	TCGA-OR-A5KX-01A-11D-A29I-10	TCGA-OR-A5KX-10A-01D-A29L-10	A	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8369398d-9d6a-48dd-b20d-4e699ceddc1b	4b83e274-a5a1-430f-8ea8-70a4a64581c9	g.chr22:44368204A>G	ENST00000350028.4	+	5	568	c.411A>G	c.(409-411)ggA>ggG	p.G137G	SAMM50_ENST00000493161.1_3'UTR|SAMM50_ENST00000396202.3_Intron	NM_015380.4	NP_056195.3	Q9Y512	SAM50_HUMAN	SAMM50 sorting and assembly machinery component	137					cellular protein metabolic process (GO:0044267)|protein import into mitochondrial outer membrane (GO:0045040)|protein targeting to mitochondrion (GO:0006626)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial outer membrane (GO:0005741)|mitochondrial sorting and assembly machinery complex (GO:0001401)|mitochondrion (GO:0005739)				endometrium(3)|large_intestine(5)|liver(1)|lung(5)|ovary(1)|prostate(1)|skin(1)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	22		all_neural(38;0.0966)|Ovarian(80;0.105)|Glioma(61;0.222)				CCATGGTTGGAAACAATGAAG	0.368													A|||	3483	0.695487	0.7496	0.5692	5008	,	,		18461	0.8185		0.5477	False		,,,				2504	0.7372				p.G137G		.											.	SAMM50-91	0			c.A411G						.	A		3090,1316	694.3+/-405.8	1093,904,206	127.0	117.0	120.0		411	-5.5	1.0	22	dbSNP_105	120	4254,4346	568.0+/-388.9	1058,2138,1104	no	coding-synonymous	SAMM50	NM_015380.4		2151,3042,1310	GG,GA,AA		49.4651,29.8684,43.5338		137/470	44368204	7344,5662	2203	4300	6503	SO:0001819	synonymous_variant	25813	exon5			GGTTGGAAACAAT	AK001087	CCDS14055.1	22q13.31	2013-08-21	2013-08-21	2005-11-20	ENSG00000100347	ENSG00000100347			24276	protein-coding gene	gene with protein product		612058	"""sorting and assembly machinery component 50 homolog (S. cerevisiae)"""			15644312	Standard	NM_015380		Approved	CGI-51, TRG-3, YNL026W, OMP85, TOB55	uc003bej.3	Q9Y512	OTTHUMG00000150557	ENST00000350028.4:c.411A>G	22.37:g.44368204A>G		Somatic	219	1		WXS	Illumina GAIIx	Phase_I	110	6	NM_015380	0	0	16	16	0	Q53HC4|Q56VW7|Q969Y9|Q96I46|Q9NW85|Q9UQM9	Silent	SNP	ENST00000350028.4	37	CCDS14055.1																																																																																			A|0.383;G|0.617		0.368	SAMM50-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318898.2	NM_015380	
CHCHD4	131474	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	3	14154643	14154644	+	Frame_Shift_Del	DEL	CC	CC	-			TCGA-OR-A5KX-01A-11D-A29I-10	TCGA-OR-A5KX-10A-01D-A29L-10	CC	CC	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8369398d-9d6a-48dd-b20d-4e699ceddc1b	4b83e274-a5a1-430f-8ea8-70a4a64581c9	g.chr3:14154643_14154644delCC	ENST00000396914.3	-	3	353_354	c.172_173delGG	c.(172-174)ggafs	p.G58fs	CHCHD4_ENST00000295767.5_Frame_Shift_Del_p.G71fs	NM_001098502.1	NP_001091972.1	Q8N4Q1	MIA40_HUMAN	coiled-coil-helix-coiled-coil-helix domain containing 4	58	CHCH.				'de novo' posttranslational protein folding (GO:0051084)|cellular protein metabolic process (GO:0044267)|protein import into mitochondrial intermembrane space (GO:0045041)|protein maturation by protein folding (GO:0022417)|protein targeting to mitochondrion (GO:0006626)	mitochondrial intermembrane space (GO:0005758)	protein disulfide oxidoreductase activity (GO:0015035)			kidney(1)|large_intestine(1)|lung(2)|prostate(1)	5						GCTGGCCATTCCCCCAAGGCAT	0.46																																					p.71_71del		.											.	CHCHD4-90	0			c.211_212del						.																																			SO:0001589	frameshift_variant	131474	exon4			GCCATTCCCCCAA	BC017082	CCDS2617.1, CCDS43054.1	3p25.1	2012-10-15			ENSG00000163528	ENSG00000163528		"""Coiled-coil-helix-coiled-coil-helix domain containing"""	26467	protein-coding gene	gene with protein product	"""translocase of inner mitochondrial membrane 40 homolog (S. cerevisiae)"", ""mitochondrial intermembrane space import and assembly 40 homolog (S. cerevisiae)"""	611077				22214851	Standard	NM_001098502		Approved	FLJ31709, TIMM40, MIA40	uc003byj.4	Q8N4Q1	OTTHUMG00000129805	ENST00000396914.3:c.172_173delGG	3.37:g.14154645_14154646delCC	ENSP00000380122:p.Gly58fs	Somatic	231	0		WXS	Illumina GAIIx	Phase_I	228	0	NM_144636	0	0	0	0	0	A8K3Z9|Q96AI2|Q96MY6	Frame_Shift_Del	DEL	ENST00000396914.3	37	CCDS43054.1																																																																																			.		0.460	CHCHD4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340423.1	NM_144636	
DCP1A	55802	broad.mit.edu;bcgsc.ca	37	3	53326623	53326623	+	Frame_Shift_Del	DEL	C	C	-			TCGA-OR-A5KX-01A-11D-A29I-10	TCGA-OR-A5KX-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8369398d-9d6a-48dd-b20d-4e699ceddc1b	4b83e274-a5a1-430f-8ea8-70a4a64581c9	g.chr3:53326623delC	ENST00000607628.1	-	7	968	c.859delG	c.(859-861)gaafs	p.E287fs	Y_RNA_ENST00000384175.1_RNA|DCP1A_ENST00000480258.1_5'UTR|DCP1A_ENST00000294241.6_Frame_Shift_Del_p.E287fs|DCP1A_ENST00000606822.1_Frame_Shift_Del_p.E249fs	NM_018403.5	NP_060873.4	Q9NPI6	DCP1A_HUMAN	decapping mRNA 1A	287					exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay (GO:0043928)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|RNA metabolic process (GO:0016070)	cytoplasmic mRNA processing body (GO:0000932)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)	hydrolase activity (GO:0016787)|identical protein binding (GO:0042802)			breast(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	10				BRCA - Breast invasive adenocarcinoma(193;0.000164)|KIRC - Kidney renal clear cell carcinoma(197;0.00525)|Kidney(197;0.00579)|OV - Ovarian serous cystadenocarcinoma(275;0.0647)		GTGGTGATTTCAGGCTGGACT	0.532																																					p.E287fs		.											.	DCP1A-90	0			c.859delG						.						64.0	70.0	68.0					3																	53326623		2017	4189	6206	SO:0001589	frameshift_variant	55802	exon7			TGATTTCAGGCTG	AJ275986	CCDS74946.1	3p21.1	2013-05-02	2013-05-02		ENSG00000162290	ENSG00000272886			18714	protein-coding gene	gene with protein product		607010	"""DCP1 decapping enzyme homolog A (S. cerevisiae)"""				Standard	XM_005278360		Approved	HSA275986, SMIF, SMAD4IP1	uc021wzi.1	Q9NPI6	OTTHUMG00000158193	ENST00000607628.1:c.859delG	3.37:g.53326623delC	ENSP00000475920:p.Glu287fs	Somatic	232	0		WXS	Illumina GAIIx	Phase_I	342	36	NM_018403	0	0	0	0	0	B4DHN9|U3KQM8	Frame_Shift_Del	DEL	ENST00000607628.1	37																																																																																				.		0.532	DCP1A-203	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding		NM_018403	
DCP1A	55802	broad.mit.edu;bcgsc.ca	37	3	53326625	53326625	+	Frame_Shift_Del	DEL	G	G	-			TCGA-OR-A5KX-01A-11D-A29I-10	TCGA-OR-A5KX-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8369398d-9d6a-48dd-b20d-4e699ceddc1b	4b83e274-a5a1-430f-8ea8-70a4a64581c9	g.chr3:53326625delG	ENST00000607628.1	-	7	966	c.857delC	c.(856-858)cctfs	p.P286fs	Y_RNA_ENST00000384175.1_RNA|DCP1A_ENST00000480258.1_5'UTR|DCP1A_ENST00000294241.6_Frame_Shift_Del_p.P286fs|DCP1A_ENST00000606822.1_Frame_Shift_Del_p.P248fs	NM_018403.5	NP_060873.4	Q9NPI6	DCP1A_HUMAN	decapping mRNA 1A	286					exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay (GO:0043928)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|RNA metabolic process (GO:0016070)	cytoplasmic mRNA processing body (GO:0000932)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)	hydrolase activity (GO:0016787)|identical protein binding (GO:0042802)			breast(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	10				BRCA - Breast invasive adenocarcinoma(193;0.000164)|KIRC - Kidney renal clear cell carcinoma(197;0.00525)|Kidney(197;0.00579)|OV - Ovarian serous cystadenocarcinoma(275;0.0647)		GGTGATTTCAGGCTGGACTGA	0.527																																					p.P286fs		.											.	DCP1A-90	0			c.857delC						.						65.0	70.0	69.0					3																	53326625		2016	4184	6200	SO:0001589	frameshift_variant	55802	exon7			ATTTCAGGCTGGA	AJ275986	CCDS74946.1	3p21.1	2013-05-02	2013-05-02		ENSG00000162290	ENSG00000272886			18714	protein-coding gene	gene with protein product		607010	"""DCP1 decapping enzyme homolog A (S. cerevisiae)"""				Standard	XM_005278360		Approved	HSA275986, SMIF, SMAD4IP1	uc021wzi.1	Q9NPI6	OTTHUMG00000158193	ENST00000607628.1:c.857delC	3.37:g.53326625delG	ENSP00000475920:p.Pro286fs	Somatic	221	0		WXS	Illumina GAIIx	Phase_I	314	36	NM_018403	0	0	0	0	0	B4DHN9|U3KQM8	Frame_Shift_Del	DEL	ENST00000607628.1	37																																																																																				.		0.527	DCP1A-203	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding		NM_018403	
DCP1A	55802	broad.mit.edu;bcgsc.ca	37	3	53326628	53326628	+	Frame_Shift_Del	DEL	T	T	-			TCGA-OR-A5KX-01A-11D-A29I-10	TCGA-OR-A5KX-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8369398d-9d6a-48dd-b20d-4e699ceddc1b	4b83e274-a5a1-430f-8ea8-70a4a64581c9	g.chr3:53326628delT	ENST00000607628.1	-	7	963	c.854delA	c.(853-855)cagfs	p.Q285fs	Y_RNA_ENST00000384175.1_RNA|DCP1A_ENST00000480258.1_5'UTR|DCP1A_ENST00000294241.6_Frame_Shift_Del_p.Q285fs|DCP1A_ENST00000606822.1_Frame_Shift_Del_p.Q247fs	NM_018403.5	NP_060873.4	Q9NPI6	DCP1A_HUMAN	decapping mRNA 1A	285					exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay (GO:0043928)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|RNA metabolic process (GO:0016070)	cytoplasmic mRNA processing body (GO:0000932)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)	hydrolase activity (GO:0016787)|identical protein binding (GO:0042802)			breast(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	10				BRCA - Breast invasive adenocarcinoma(193;0.000164)|KIRC - Kidney renal clear cell carcinoma(197;0.00525)|Kidney(197;0.00579)|OV - Ovarian serous cystadenocarcinoma(275;0.0647)		GATTTCAGGCTGGACTGAATG	0.522																																					p.Q285fs		.											.	DCP1A-90	0			c.854delA						.						63.0	69.0	67.0					3																	53326628		2009	4181	6190	SO:0001589	frameshift_variant	55802	exon7			TCAGGCTGGACTG	AJ275986	CCDS74946.1	3p21.1	2013-05-02	2013-05-02		ENSG00000162290	ENSG00000272886			18714	protein-coding gene	gene with protein product		607010	"""DCP1 decapping enzyme homolog A (S. cerevisiae)"""				Standard	XM_005278360		Approved	HSA275986, SMIF, SMAD4IP1	uc021wzi.1	Q9NPI6	OTTHUMG00000158193	ENST00000607628.1:c.854delA	3.37:g.53326628delT	ENSP00000475920:p.Gln285fs	Somatic	214	0		WXS	Illumina GAIIx	Phase_I	306	36	NM_018403	0	0	0	0	0	B4DHN9|U3KQM8	Frame_Shift_Del	DEL	ENST00000607628.1	37																																																																																				.		0.522	DCP1A-203	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding		NM_018403	
DCP1A	55802	broad.mit.edu;bcgsc.ca	37	3	53326635	53326635	+	Frame_Shift_Del	DEL	A	A	-			TCGA-OR-A5KX-01A-11D-A29I-10	TCGA-OR-A5KX-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8369398d-9d6a-48dd-b20d-4e699ceddc1b	4b83e274-a5a1-430f-8ea8-70a4a64581c9	g.chr3:53326635delA	ENST00000607628.1	-	7	956	c.847delT	c.(847-849)tcafs	p.S283fs	Y_RNA_ENST00000384175.1_RNA|DCP1A_ENST00000480258.1_5'UTR|DCP1A_ENST00000294241.6_Frame_Shift_Del_p.S283fs|DCP1A_ENST00000606822.1_Frame_Shift_Del_p.S245fs	NM_018403.5	NP_060873.4	Q9NPI6	DCP1A_HUMAN	decapping mRNA 1A	283					exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay (GO:0043928)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|RNA metabolic process (GO:0016070)	cytoplasmic mRNA processing body (GO:0000932)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)	hydrolase activity (GO:0016787)|identical protein binding (GO:0042802)			breast(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	10				BRCA - Breast invasive adenocarcinoma(193;0.000164)|KIRC - Kidney renal clear cell carcinoma(197;0.00525)|Kidney(197;0.00579)|OV - Ovarian serous cystadenocarcinoma(275;0.0647)		GGCTGGACTGAATGGTGGGCA	0.532																																					p.S283fs		.											.	DCP1A-90	0			c.847delT						.						64.0	69.0	68.0					3																	53326635		2001	4180	6181	SO:0001589	frameshift_variant	55802	exon7			GGACTGAATGGTG	AJ275986	CCDS74946.1	3p21.1	2013-05-02	2013-05-02		ENSG00000162290	ENSG00000272886			18714	protein-coding gene	gene with protein product		607010	"""DCP1 decapping enzyme homolog A (S. cerevisiae)"""				Standard	XM_005278360		Approved	HSA275986, SMIF, SMAD4IP1	uc021wzi.1	Q9NPI6	OTTHUMG00000158193	ENST00000607628.1:c.847delT	3.37:g.53326635delA	ENSP00000475920:p.Ser283fs	Somatic	192	0		WXS	Illumina GAIIx	Phase_I	288	35	NM_018403	0	0	0	0	0	B4DHN9|U3KQM8	Frame_Shift_Del	DEL	ENST00000607628.1	37																																																																																				.		0.532	DCP1A-203	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding		NM_018403	
LRIG1	26018	hgsc.bcm.edu	37	3	66550756	66550756	+	Missense_Mutation	SNP	G	G	C	rs1403625	byFrequency	TCGA-OR-A5KX-01A-11D-A29I-10	TCGA-OR-A5KX-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8369398d-9d6a-48dd-b20d-4e699ceddc1b	4b83e274-a5a1-430f-8ea8-70a4a64581c9	g.chr3:66550756G>C	ENST00000273261.3	-	1	600	c.76C>G	c.(76-78)Ctt>Gtt	p.L26V	LRIG1_ENST00000383703.3_Missense_Mutation_p.L26V	NM_015541.2	NP_056356.2	Q96JA1	LRIG1_HUMAN	leucine-rich repeats and immunoglobulin-like domains 1	26				LLL -> VLV (in Ref. 1; AAK62357 and 3; AAH71561). {ECO:0000305}.	innervation (GO:0060384)|otolith morphogenesis (GO:0032474)|sensory perception of sound (GO:0007605)	integral component of membrane (GO:0016021)				NS(2)|breast(2)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(7)|lung(12)|ovary(3)|prostate(1)|skin(4)|stomach(4)|urinary_tract(1)	42		Lung NSC(201;0.0101)		BRCA - Breast invasive adenocarcinoma(55;0.00047)		TCCAGCCGAAGCAAAAGCAGC	0.761													g|||	3605	0.719848	0.1808	0.8833	5008	,	,		8093	0.8284		0.9732	False		,,,				2504	0.9601				p.L26V		.											.	LRIG1-230	0			c.C76G						.		VAL/LEU	1298,1386		255,788,299	3.0	4.0	4.0		76	2.9	0.5	3	dbSNP_88	4	5191,89		2555,81,4	yes	missense	LRIG1	NM_015541.2	32	2810,869,303	CC,CG,GG		1.6856,48.3607,18.5208	benign	26/1094	66550756	6489,1475	1342	2640	3982	SO:0001583	missense	26018	exon1			GCCGAAGCAAAAG	AB050468	CCDS33783.1	3p14	2013-01-14			ENSG00000144749	ENSG00000144749		"""Immunoglobulin superfamily / I-set domain containing"""	17360	protein-coding gene	gene with protein product	"""ortholog of mouse integral membrane glycoprotein LIG-1"", ""leucine-rich repeat protein LRIG1"""	608868				11414704, 12234026	Standard	NM_015541		Approved	LIG-1, DKFZP586O1624, LIG1	uc003dmx.3	Q96JA1	OTTHUMG00000158727	ENST00000273261.3:c.76C>G	3.37:g.66550756G>C	ENSP00000273261:p.Leu26Val	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	6	6	NM_015541	0	0	0	0	0	Q6IQ51|Q96CF9|Q9BYB8|Q9UFI4	Missense_Mutation	SNP	ENST00000273261.3	37	CCDS33783.1	1666	0.7628205128205128	118	0.23983739837398374	325	0.8977900552486188	489	0.8548951048951049	734	0.9683377308707124	g	6.572	0.473779	0.12521	0.483607	0.983144	ENSG00000144749	ENST00000273261;ENST00000383703	T;T	0.67345	-0.26;-0.13	3.84	2.93	0.34026	.	0.847359	0.09512	U	0.792175	T	0.00012	0.0000	N	0.19112	0.55	0.80722	P	0.0	P;P	0.44139	0.827;0.484	B;B	0.37731	0.257;0.096	T	0.48854	-0.8998	9	0.23302	T	0.38	.	8.6883	0.34251	0.1185:0.0:0.8815:0.0	rs1403625;rs13083628	26;26	Q96JA1-2;Q96JA1	.;LRIG1_HUMAN	V	26	ENSP00000273261:L26V;ENSP00000373208:L26V	ENSP00000273261:L26V	L	-	1	0	LRIG1	66633446	.	.	0.520000	0.27837	0.020000	0.10135	.	.	1.845000	0.53610	0.472000	0.43445	CTT	G|0.237;C|0.763		0.761	LRIG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351930.1	NM_015541	
LRIG1	26018	hgsc.bcm.edu	37	3	66550762	66550762	+	Missense_Mutation	SNP	G	G	C	rs1403626	byFrequency	TCGA-OR-A5KX-01A-11D-A29I-10	TCGA-OR-A5KX-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8369398d-9d6a-48dd-b20d-4e699ceddc1b	4b83e274-a5a1-430f-8ea8-70a4a64581c9	g.chr3:66550762G>C	ENST00000273261.3	-	1	594	c.70C>G	c.(70-72)Ctt>Gtt	p.L24V	LRIG1_ENST00000383703.3_Missense_Mutation_p.L24V	NM_015541.2	NP_056356.2	Q96JA1	LRIG1_HUMAN	leucine-rich repeats and immunoglobulin-like domains 1	24			L -> V (in dbSNP:rs1403626).	LLL -> VLV (in Ref. 1; AAK62357 and 3; AAH71561). {ECO:0000305}.	innervation (GO:0060384)|otolith morphogenesis (GO:0032474)|sensory perception of sound (GO:0007605)	integral component of membrane (GO:0016021)				NS(2)|breast(2)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(7)|lung(12)|ovary(3)|prostate(1)|skin(4)|stomach(4)|urinary_tract(1)	42		Lung NSC(201;0.0101)		BRCA - Breast invasive adenocarcinoma(55;0.00047)		CGAAGCAAAAGCAGCCAGAGA	0.766													g|||	3605	0.719848	0.1808	0.8833	5008	,	,		8368	0.8284		0.9732	False		,,,				2504	0.9601				p.L24V		.											.	LRIG1-230	0			c.C70G						.		VAL/LEU	1309,1447		265,779,334	3.0	4.0	4.0		70	3.1	0.5	3	dbSNP_88	4	5325,93		2620,85,4	no	missense	LRIG1	NM_015541.2	32	2885,864,338	CC,CG,GG		1.7165,47.4964,18.8402	benign	24/1094	66550762	6634,1540	1378	2709	4087	SO:0001583	missense	26018	exon1			GCAAAAGCAGCCA	AB050468	CCDS33783.1	3p14	2013-01-14			ENSG00000144749	ENSG00000144749		"""Immunoglobulin superfamily / I-set domain containing"""	17360	protein-coding gene	gene with protein product	"""ortholog of mouse integral membrane glycoprotein LIG-1"", ""leucine-rich repeat protein LRIG1"""	608868				11414704, 12234026	Standard	NM_015541		Approved	LIG-1, DKFZP586O1624, LIG1	uc003dmx.3	Q96JA1	OTTHUMG00000158727	ENST00000273261.3:c.70C>G	3.37:g.66550762G>C	ENSP00000273261:p.Leu24Val	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	7	7	NM_015541	0	0	0	0	0	Q6IQ51|Q96CF9|Q9BYB8|Q9UFI4	Missense_Mutation	SNP	ENST00000273261.3	37	CCDS33783.1	1670	0.7646520146520146	119	0.241869918699187	326	0.9005524861878453	488	0.8531468531468531	737	0.9722955145118733	g	9.592	1.126319	0.20959	0.474964	0.982835	ENSG00000144749	ENST00000273261;ENST00000383703	T;T	0.68765	-0.35;-0.2	3.11	3.11	0.35812	.	0.429988	0.15146	U	0.278020	T	0.00012	0.0000	N	0.19112	0.55	0.39998	P	0.024872000000000005	P;B	0.36282	0.546;0.282	B;B	0.32465	0.146;0.069	T	0.40572	-0.9556	9	0.23891	T	0.37	.	12.0321	0.53403	0.0:0.0:1.0:0.0	rs1403626;rs13083630;rs1403626	24;24	Q96JA1-2;Q96JA1	.;LRIG1_HUMAN	V	24	ENSP00000273261:L24V;ENSP00000373208:L24V	ENSP00000273261:L24V	L	-	1	0	LRIG1	66633452	.	.	0.546000	0.28166	0.017000	0.09413	.	.	1.734000	0.51633	0.472000	0.43445	CTT	G|0.252;C|0.748		0.766	LRIG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351930.1	NM_015541	
CCDC54	84692	bcgsc.ca	37	3	107096547	107096547	+	Missense_Mutation	SNP	G	G	A	rs709564	byFrequency	TCGA-OR-A5KX-01A-11D-A29I-10	TCGA-OR-A5KX-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8369398d-9d6a-48dd-b20d-4e699ceddc1b	4b83e274-a5a1-430f-8ea8-70a4a64581c9	g.chr3:107096547G>A	ENST00000261058.1	+	1	360	c.113G>A	c.(112-114)cGg>cAg	p.R38Q		NM_032600.2	NP_115989.1	Q8NEL0	CCD54_HUMAN	coiled-coil domain containing 54	38			R -> Q (in dbSNP:rs709564). {ECO:0000269|PubMed:15489334}.							NS(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(8)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	19						TGTAAGATTCGGCACCAAGAT	0.403													G|||	2500	0.499201	0.3442	0.5216	5008	,	,		21589	0.8919		0.2545	False		,,,				2504	0.5399				p.R38Q		.											.	CCDC54-90	0			c.G113A						.	G	GLN/ARG	1442,2964	469.4+/-355.4	262,918,1023	138.0	138.0	138.0		113	-1.0	0.0	3	dbSNP_86	138	2032,6568	354.9+/-329.7	241,1550,2509	yes	missense	CCDC54	NM_032600.2	43	503,2468,3532	AA,AG,GG		23.6279,32.7281,26.7107	benign	38/329	107096547	3474,9532	2203	4300	6503	SO:0001583	missense	84692	exon1			AGATTCGGCACCA	AF367469	CCDS2949.1	3q13.12	2013-10-11			ENSG00000138483	ENSG00000138483			30703	protein-coding gene	gene with protein product	"""sperm protein 17"""					15257753	Standard	NM_032600		Approved	NYD-SP17, FLJ25362, SP17	uc003dwi.1	Q8NEL0	OTTHUMG00000159169	ENST00000261058.1:c.113G>A	3.37:g.107096547G>A	ENSP00000261058:p.Arg38Gln	Somatic	160	0		WXS	Illumina GAIIx	Phase_I	161	6	NM_032600	0	0	0	0	0	Q96A43	Missense_Mutation	SNP	ENST00000261058.1	37	CCDS2949.1	1018	0.4661172161172161	154	0.3130081300813008	163	0.45027624309392267	507	0.8863636363636364	194	0.2559366754617414	G	0.008	-1.878422	0.00537	0.327281	0.236279	ENSG00000138483	ENST00000261058	T	0.41065	1.01	5.44	-1.05	0.10036	.	1.036590	0.07686	N	0.937852	T	0.00012	0.0000	N	0.05280	-0.08	0.80722	P	0.0	B	0.12630	0.006	B	0.08055	0.003	T	0.28618	-1.0038	9	0.11794	T	0.64	1.0994	8.8703	0.35311	0.515:0.0:0.485:0.0	rs709564;rs17845930;rs17858909;rs52834280;rs60910251;rs709564	38	Q8NEL0	CCD54_HUMAN	Q	38	ENSP00000261058:R38Q	ENSP00000261058:R38Q	R	+	2	0	CCDC54	108579237	0.000000	0.05858	0.045000	0.18777	0.112000	0.19704	-0.131000	0.10482	-0.180000	0.10637	-0.482000	0.04802	CGG	G|0.632;A|0.368		0.403	CCDC54-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353651.1	NM_032600	
PVRL3	25945	broad.mit.edu;bcgsc.ca	37	3	110831005	110831005	+	Missense_Mutation	SNP	A	A	G			TCGA-OR-A5KX-01A-11D-A29I-10	TCGA-OR-A5KX-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8369398d-9d6a-48dd-b20d-4e699ceddc1b	4b83e274-a5a1-430f-8ea8-70a4a64581c9	g.chr3:110831005A>G	ENST00000485303.1	+	2	564	c.289A>G	c.(289-291)Aaa>Gaa	p.K97E	PVRL3_ENST00000493615.1_Missense_Mutation_p.K74E|PVRL3_ENST00000488016.1_3'UTR|PVRL3_ENST00000319792.3_Missense_Mutation_p.K97E	NM_001243286.1|NM_015480.2	NP_001230215.1|NP_056295.1	Q9NQS3	PVRL3_HUMAN	poliovirus receptor-related 3	97	Ig-like V-type.				adherens junction organization (GO:0034332)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|fertilization (GO:0009566)|homophilic cell adhesion (GO:0007156)|lens morphogenesis in camera-type eye (GO:0002089)|retina morphogenesis in camera-type eye (GO:0060042)|single organismal cell-cell adhesion (GO:0016337)	apical junction complex (GO:0043296)|cell-cell adherens junction (GO:0005913)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	cell adhesion molecule binding (GO:0050839)|protein homodimerization activity (GO:0042803)			breast(1)|cervix(1)|endometrium(1)|kidney(3)|large_intestine(3)|lung(7)|upper_aerodigestive_tract(3)	19						GATACATGGCAAAAGTTCACA	0.368																																					p.K97E		.											.	PVRL3-92	0			c.A289G						.						89.0	84.0	86.0					3																	110831005		2203	4300	6503	SO:0001583	missense	25945	exon2			CATGGCAAAAGTT	AF282874	CCDS2957.1, CCDS58842.1, CCDS58843.1	3q13	2013-01-29			ENSG00000177707	ENSG00000177707		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	17664	protein-coding gene	gene with protein product		607147				11024295	Standard	NM_015480		Approved	nectin-3, PPR3, PVRR3, DKFZP566B0846, CDw113, CD113	uc003dxt.2	Q9NQS3	OTTHUMG00000159239	ENST00000485303.1:c.289A>G	3.37:g.110831005A>G	ENSP00000418070:p.Lys97Glu	Somatic	418	0		WXS	Illumina GAIIx	Phase_I	455	16	NM_001243286	0	0	0	0	0	E9PFR0|Q6NVZ3|Q8NC05|Q8WVU4|Q9BVA9|Q9Y412	Missense_Mutation	SNP	ENST00000485303.1	37	CCDS2957.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	20.2|20.2	3.955075|3.955075	0.73902|0.73902	.|.	.|.	ENSG00000177707|ENSG00000177707	ENST00000461477;ENST00000485303;ENST00000319792;ENST00000493615;ENST00000481766|ENST00000486596	T;T;T;T;T|.	0.64618|.	-0.11;-0.11;-0.11;-0.11;-0.11|.	5.84|5.84	4.69|4.69	0.59074|0.59074	Immunoglobulin subtype (1);Immunoglobulin V-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);|.	0.154140|.	0.56097|.	D|.	0.000027|.	T|T	0.47507|0.47507	0.1449|0.1449	L|L	0.33293|0.33293	1|1	0.33238|0.33238	D|D	0.556795|0.556795	D;P|.	0.58268|.	0.982;0.897|.	P;P|.	0.60117|.	0.869;0.675|.	T|T	0.57051|0.57051	-0.7877|-0.7877	10|5	0.07990|.	T|.	0.79|.	.|.	11.3294|11.3294	0.49467|0.49467	0.837:0.163:0.0:0.0|0.837:0.163:0.0:0.0	.|.	74;97|.	E9PFR0;Q9NQS3|.	.;PVRL3_HUMAN|.	E|R	50;97;97;74;82|96	ENSP00000418327:K50E;ENSP00000418070:K97E;ENSP00000321514:K97E;ENSP00000420579:K74E;ENSP00000420479:K82E|.	ENSP00000321514:K97E|.	K|Q	+|+	1|2	0|0	PVRL3|PVRL3	112313695|112313695	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.996000|0.996000	0.88848|0.88848	3.505000|3.505000	0.53356|0.53356	1.032000|1.032000	0.39892|0.39892	0.533000|0.533000	0.62120|0.62120	AAA|CAA	.		0.368	PVRL3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354045.1	NM_015480	
H1FOO	132243	bcgsc.ca	37	3	129266431	129266431	+	Missense_Mutation	SNP	C	C	A			TCGA-OR-A5KX-01A-11D-A29I-10	TCGA-OR-A5KX-10A-01D-A29L-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8369398d-9d6a-48dd-b20d-4e699ceddc1b	4b83e274-a5a1-430f-8ea8-70a4a64581c9	g.chr3:129266431C>A	ENST00000324382.2	+	2	291	c.286C>A	c.(286-288)Ctg>Atg	p.L96M	H1FOO_ENST00000503977.1_5'Flank	NM_153833.1	NP_722575.1	Q8IZA3	H1FOO_HUMAN	H1 histone family, member O, oocyte-specific	96	H15. {ECO:0000255|PROSITE- ProRule:PRU00837}.				meiotic nuclear division (GO:0007126)|negative regulation of stem cell differentiation (GO:2000737)|nucleosome assembly (GO:0006334)|nucleosome positioning (GO:0016584)|regulation of DNA methylation (GO:0044030)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|female germ cell nucleus (GO:0001674)|nucleosome (GO:0000786)|nucleus (GO:0005634)	nucleosomal DNA binding (GO:0031492)			endometrium(1)|lung(4)|skin(1)	6						CTTCAAGTACCTGCTGAAGCA	0.647																																					p.L96M		.											.	H1FOO-91	0			c.C286A						.						20.0	13.0	15.0					3																	129266431		2073	4112	6185	SO:0001583	missense	132243	exon2			AAGTACCTGCTGA	AY158091	CCDS3064.1	3q21.3	2011-01-27			ENSG00000178804	ENSG00000178804		"""Histones / Replication-independent"""	18463	protein-coding gene	gene with protein product						12408966	Standard	NM_153833		Approved		uc003emu.3	Q8IZA3	OTTHUMG00000159541	ENST00000324382.2:c.286C>A	3.37:g.129266431C>A	ENSP00000319799:p.Leu96Met	Somatic	70	0		WXS	Illumina GAIIx	Phase_I	75	4	NM_153833	0	0	0	0	0	Q86WT7	Missense_Mutation	SNP	ENST00000324382.2	37	CCDS3064.1	.	.	.	.	.	.	.	.	.	.	C	18.08	3.543264	0.65198	.	.	ENSG00000178804	ENST00000324382	T	0.24908	1.83	5.32	2.39	0.29439	Histone H1/H5 (3);Winged helix-turn-helix transcription repressor DNA-binding (1);	0.168725	0.40728	N	0.001039	T	0.38852	0.1056	L	0.58510	1.815	0.80722	D	1	D	0.54772	0.968	D	0.67725	0.953	T	0.17471	-1.0368	10	0.62326	D	0.03	-15.2014	5.7656	0.18225	0.1412:0.6346:0.0:0.2243	.	96	Q8IZA3	H1FOO_HUMAN	M	96	ENSP00000319799:L96M	ENSP00000319799:L96M	L	+	1	2	H1FOO	130749121	0.995000	0.38212	1.000000	0.80357	0.959000	0.62525	0.207000	0.17395	1.249000	0.43950	0.655000	0.94253	CTG	.		0.647	H1FOO-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356100.3	NM_153833	
SMC4	10051	broad.mit.edu;bcgsc.ca	37	3	160148531	160148531	+	Splice_Site	SNP	G	G	C			TCGA-OR-A5KX-01A-11D-A29I-10	TCGA-OR-A5KX-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8369398d-9d6a-48dd-b20d-4e699ceddc1b	4b83e274-a5a1-430f-8ea8-70a4a64581c9	g.chr3:160148531G>C	ENST00000357388.3	+	19	3391	c.2940G>C	c.(2938-2940)gaG>gaC	p.E980D	RP11-432B6.3_ENST00000483754.1_Intron|SMC4_ENST00000462787.1_Splice_Site_p.E980D|SMC4_ENST00000469762.1_Splice_Site_p.E955D|SMC4_ENST00000360111.2_Splice_Site_p.E980D|SMC4_ENST00000344722.5_Splice_Site_p.E980D	NM_001002800.1	NP_001002800.1	Q9NTJ3	SMC4_HUMAN	structural maintenance of chromosomes 4	980					kinetochore organization (GO:0051383)|meiotic chromosome condensation (GO:0010032)|meiotic chromosome segregation (GO:0045132)|mitotic cell cycle (GO:0000278)|mitotic chromosome condensation (GO:0007076)|mitotic sister chromatid segregation (GO:0000070)	condensin complex (GO:0000796)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|protein heterodimerization activity (GO:0046982)			breast(2)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(15)|lung(20)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	48			Lung(72;0.00334)|LUSC - Lung squamous cell carcinoma(72;0.00523)			ATGCTGCAGAGGTATGAGTTG	0.403																																					p.E980D		.											.	SMC4-291	0			c.G2940C						.						74.0	80.0	78.0					3																	160148531		2203	4300	6503	SO:0001630	splice_region_variant	10051	exon18			TGCAGAGGTATGA	AF092564	CCDS3189.1, CCDS75046.1	3q26.1	2006-07-06	2006-07-06	2006-07-06	ENSG00000113810	ENSG00000113810		"""Structural maintenance of chromosomes proteins"""	14013	protein-coding gene	gene with protein product		605575	"""SMC4 (structural maintenance of chromosomes 4, yeast)-like 1"", ""SMC4 structural maintenance of chromosomes 4-like 1 (yeast)"""	SMC4L1		9789013, 10319587	Standard	NM_005496		Approved	hCAP-C, CAP-C	uc003fdh.3	Q9NTJ3	OTTHUMG00000159006	ENST00000357388.3:c.2940+1G>C	3.37:g.160148531G>C		Somatic	389	0		WXS	Illumina GAIIx	Phase_I	337	13	NM_005496	0	0	1	2	1	A6NLT9|D3DNL8|O95752|Q8NDL4|Q9UNT9	Missense_Mutation	SNP	ENST00000357388.3	37	CCDS3189.1	.	.	.	.	.	.	.	.	.	.	G	16.19	3.054279	0.55218	.	.	ENSG00000113810	ENST00000357388;ENST00000360111;ENST00000469762;ENST00000462787;ENST00000344722;ENST00000545277	D;D;T;D;D	0.84800	-1.9;-1.73;-1.08;-1.73;-1.9	4.88	4.88	0.63580	RecF/RecN/SMC (1);	0.045214	0.85682	D	0.000000	D	0.90508	0.7026	M	0.77313	2.365	0.80722	D	1	D;B;P;P	0.89917	1.0;0.05;0.773;0.858	D;B;P;P	0.73708	0.981;0.128;0.552;0.532	D	0.89002	0.3422	10	0.37606	T	0.19	-16.3822	9.925	0.41487	0.095:0.0:0.905:0.0	.	980;955;955;980	Q9NTJ3-2;B3KXX5;E9PD53;Q9NTJ3	.;.;.;SMC4_HUMAN	D	980;980;955;980;980;574	ENSP00000349961:E980D;ENSP00000353225:E980D;ENSP00000417964:E955D;ENSP00000420734:E980D;ENSP00000341382:E980D	ENSP00000341382:E980D	E	+	3	2	SMC4	161631225	1.000000	0.71417	1.000000	0.80357	0.431000	0.31685	3.127000	0.50484	2.662000	0.90505	0.585000	0.79938	GAG	.		0.403	SMC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352862.1		Missense_Mutation
ATP10D	57205	bcgsc.ca	37	4	47578971	47578971	+	Missense_Mutation	SNP	G	G	A	rs16851681	byFrequency	TCGA-OR-A5KX-01A-11D-A29I-10	TCGA-OR-A5KX-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8369398d-9d6a-48dd-b20d-4e699ceddc1b	4b83e274-a5a1-430f-8ea8-70a4a64581c9	g.chr4:47578971G>A	ENST00000273859.3	+	19	3817	c.3548G>A	c.(3547-3549)aGa>aAa	p.R1183K		NM_020453.3	NP_065186.3	Q9P241	AT10D_HUMAN	ATPase, class V, type 10D	1183			R -> K (in dbSNP:rs16851681).		cation transport (GO:0006812)|ion transmembrane transport (GO:0034220)|phospholipid translocation (GO:0045332)|transmembrane transport (GO:0055085)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)			NS(2)|endometrium(5)|kidney(5)|large_intestine(14)|liver(2)|lung(26)|ovary(2)|pancreas(1)|prostate(5)|skin(2)|stomach(1)|urinary_tract(1)	66						GAACTTTACAGAAGTGGTCAG	0.428													A|||	1412	0.281949	0.3707	0.3487	5008	,	,		20469	0.2004		0.2575	False		,,,				2504	0.2239				p.R1183K		.											.	ATP10D-93	0			c.G3548A						.	A	LYS/ARG	1516,2890	674.8+/-403.0	244,1028,931	95.0	88.0	90.0		3548	-6.0	0.0	4	dbSNP_123	90	2003,6597	722.2+/-406.4	232,1539,2529	yes	missense	ATP10D	NM_020453.3	26	476,2567,3460	AA,AG,GG		23.2907,34.4076,27.0567	benign	1183/1427	47578971	3519,9487	2203	4300	6503	SO:0001583	missense	57205	exon19			TTTACAGAAGTGG	AB040920	CCDS3476.1	4p12	2010-04-20	2007-09-19		ENSG00000145246	ENSG00000145246		"""ATPases / P-type"""	13549	protein-coding gene	gene with protein product			"""ATPase, Class V, type 10D"""			12532265	Standard	NM_020453		Approved	ATPVD, KIAA1487	uc003gxk.1	Q9P241	OTTHUMG00000160784	ENST00000273859.3:c.3548G>A	4.37:g.47578971G>A	ENSP00000273859:p.Arg1183Lys	Somatic	223	1		WXS	Illumina GAIIx	Phase_I	200	7	NM_020453	0	0	3	3	0	A2RRC8|D6REN2|Q8NC70|Q96SR3	Missense_Mutation	SNP	ENST00000273859.3	37	CCDS3476.1	657	0.3008241758241758	198	0.4024390243902439	134	0.3701657458563536	123	0.21503496503496503	202	0.26649076517150394	A	0.090	-1.169224	0.01660	0.344076	0.232907	ENSG00000145246	ENST00000273859	T	0.75154	-0.91	5.21	-5.96	0.02234	.	0.669752	0.15504	N	0.258904	T	0.00012	0.0000	N	0.05441	-0.05	0.80722	P	0.0	B	0.02656	0.0	B	0.04013	0.001	T	0.13229	-1.0517	9	0.02654	T	1	-2.1125	2.5327	0.04707	0.2771:0.1853:0.3696:0.168	rs16851681;rs52806274;rs61423063;rs16851681	1183	Q9P241	AT10D_HUMAN	K	1183	ENSP00000273859:R1183K	ENSP00000273859:R1183K	R	+	2	0	ATP10D	47273728	0.000000	0.05858	0.029000	0.17559	0.460000	0.32559	-0.312000	0.08113	-1.293000	0.02362	-1.322000	0.01289	AGA	G|0.728;A|0.272		0.428	ATP10D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000216900.1	NM_020453	
DSPP	1834	hgsc.bcm.edu	37	4	88537078	88537213	+	Frame_Shift_Del	DEL	TGACAGCAGCAATAGCAGTGACAGCAGCGATAGCAGCGACAGCAGCGACAGCAGCGATAGCAGTGACAGCAGCGATAGCAGTGACAGCAGTGACAGCAGCAATAGCAGTGACAGCAGTGACAGCAGCGACAGCAGT	TGACAGCAGCAATAGCAGTGACAGCAGCGATAGCAGCGACAGCAGCGACAGCAGCGATAGCAGTGACAGCAGCGATAGCAGTGACAGCAGTGACAGCAGCAATAGCAGTGACAGCAGTGACAGCAGCGACAGCAGT	-	rs529175881|rs563891927|rs151217478|rs201186956|rs201078954|rs551655835|rs199799532|rs201754564|rs376726974|rs551176886|rs536124533|rs374679002|rs367717407|rs531156875|rs370267258|rs200796238|rs200745922|rs373236680|rs373805744|rs553101049|rs372453629|rs201399566|rs553323131|rs199671813|rs534854783|rs143067236|rs376515601|rs369973717|rs368984442|rs200276196	byFrequency	TCGA-OR-A5KX-01A-11D-A29I-10	TCGA-OR-A5KX-10A-01D-A29L-10	TGACAGCAGCAATAGCAGTGACAGCAGCGATAGCAGCGACAGCAGCGACAGCAGCGATAGCAGTGACAGCAGCGATAGCAGTGACAGCAGTGACAGCAGCAATAGCAGTGACAGCAGTGACAGCAGCGACAGCAGT	TGACAGCAGCAATAGCAGTGACAGCAGCGATAGCAGCGACAGCAGCGACAGCAGCGATAGCAGTGACAGCAGCGATAGCAGTGACAGCAGTGACAGCAGCAATAGCAGTGACAGCAGTGACAGCAGCGACAGCAGT	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8369398d-9d6a-48dd-b20d-4e699ceddc1b	4b83e274-a5a1-430f-8ea8-70a4a64581c9	g.chr4:88537078_88537213delTGACAGCAGCAATAGCAGTGACAGCAGCGATAGCAGCGACAGCAGCGACAGCAGCGATAGCAGTGACAGCAGCGATAGCAGTGACAGCAGTGACAGCAGCAATAGCAGTGACAGCAGTGACAGCAGCGACAGCAGT	ENST00000282478.7	+	4	3297_3432	c.3264_3399delTGACAGCAGCAATAGCAGTGACAGCAGCGATAGCAGCGACAGCAGCGACAGCAGCGATAGCAGTGACAGCAGCGATAGCAGTGACAGCAGTGACAGCAGCAATAGCAGTGACAGCAGTGACAGCAGCGACAGCAGT	c.(3262-3399)agtgacagcagcaatagcagtgacagcagcgatagcagcgacagcagcgacagcagcgatagcagtgacagcagcgatagcagtgacagcagtgacagcagcaatagcagtgacagcagtgacagcagcgacagcagtfs	p.SDSSNSSDSSDSSDSSDSSDSSDSSDSSDSSDSSNSSDSSDSSDSS1088fs	DSPP_ENST00000399271.1_Frame_Shift_Del_p.SDSSNSSDSSDSSDSSDSSDSSDSSDSSDSSDSSNSSDSSDSSDSS1088fs|RP11-742B18.1_ENST00000506480.1_RNA			Q9NZW4	DSPP_HUMAN	dentin sialophosphoprotein	1088	Asp/Ser-rich.				biomineral tissue development (GO:0031214)|cellular response to cell-matrix adhesion (GO:0071460)|extracellular matrix organization (GO:0030198)|multicellular organismal development (GO:0007275)|ossification (GO:0001503)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|collagen binding (GO:0005518)|extracellular matrix structural constituent (GO:0005201)			breast(2)|central_nervous_system(1)|endometrium(9)|kidney(4)|large_intestine(8)|lung(13)|ovary(1)|skin(3)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	47		Hepatocellular(203;0.114)|all_hematologic(202;0.236)		OV - Ovarian serous cystadenocarcinoma(123;0.000508)		gtgatagcagtgacagcagcaatagcagtgacagcagcgatagcagcgacagcagcgacagcagcgatagcagtgacagcagcgatagcagtgacagcagtgacagcagcaatagcagtgacagcagtgacagcagcgacagcagtgatagcagtg	0.554																																					p.1088_1133del		.											.	DSPP-90	0			c.3264_3399del						.																																			SO:0001589	frameshift_variant	1834	exon5			TAGCAGTGACAGC	AF163151	CCDS43248.1	4q21.3	2008-02-05			ENSG00000152591	ENSG00000152591			3054	protein-coding gene	gene with protein product		125485		DFNA39, DGI1		8995371, 9533027	Standard	NM_014208		Approved	DMP3	uc003hqu.3	Q9NZW4	OTTHUMG00000161061	ENST00000282478.7:c.3264_3399delTGACAGCAGCAATAGCAGTGACAGCAGCGATAGCAGCGACAGCAGCGACAGCAGCGATAGCAGTGACAGCAGCGATAGCAGTGACAGCAGTGACAGCAGCAATAGCAGTGACAGCAGTGACAGCAGCGACAGCAGT	4.37:g.88537078_88537213delTGACAGCAGCAATAGCAGTGACAGCAGCGATAGCAGCGACAGCAGCGACAGCAGCGATAGCAGTGACAGCAGCGATAGCAGTGACAGCAGTGACAGCAGCAATAGCAGTGACAGCAGTGACAGCAGCGACAGCAGT	ENSP00000282478:p.Ser1088fs	Somatic	444	0		WXS	Illumina GAIIx	Phase_I	406	0	NM_014208	0	0	0	0	0	A8MUI0|O95815	Frame_Shift_Del	DEL	ENST00000282478.7	37	CCDS43248.1																																																																																			.		0.554	DSPP-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000363616.3	NM_014208	
SLC45A2	51151	broad.mit.edu;bcgsc.ca	37	5	33944896	33944896	+	Nonsense_Mutation	SNP	G	G	A			TCGA-OR-A5KX-01A-11D-A29I-10	TCGA-OR-A5KX-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8369398d-9d6a-48dd-b20d-4e699ceddc1b	4b83e274-a5a1-430f-8ea8-70a4a64581c9	g.chr5:33944896G>A	ENST00000296589.4	-	7	1596	c.1450C>T	c.(1450-1452)Cag>Tag	p.Q484*	SLC45A2_ENST00000342059.3_Nonsense_Mutation_p.Q425*	NM_016180.3	NP_057264	Q9UMX9	S45A2_HUMAN	solute carrier family 45, member 2	484					developmental pigmentation (GO:0048066)|melanin biosynthetic process (GO:0042438)|response to stimulus (GO:0050896)|visual perception (GO:0007601)	integral component of membrane (GO:0016021)				breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(25)|ovary(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	48						TGAGCCAGCTGCACCATGCAT	0.622																																					p.Q484X	Ovarian(31;380 859 8490 22203 49048)	.											.	SLC45A2-93	0			c.C1450T						.						82.0	56.0	65.0					5																	33944896		2203	4300	6503	SO:0001587	stop_gained	51151	exon7			CCAGCTGCACCAT	AF172849	CCDS3901.1, CCDS43308.1, CCDS75232.1	5p13.3	2013-08-06	2005-10-06	2005-10-06	ENSG00000164175	ENSG00000164175		"""Solute carriers"""	16472	protein-coding gene	gene with protein product		606202	"""membrane associated transporter"""	MATP		11916009, 11574907	Standard	NM_001012509		Approved	AIM-1, OCA4	uc003jid.3	Q9UMX9	OTTHUMG00000090719	ENST00000296589.4:c.1450C>T	5.37:g.33944896G>A	ENSP00000296589:p.Gln484*	Somatic	183	1		WXS	Illumina GAIIx	Phase_I	911	62	NM_016180	0	0	0	0	0	Q6P2P0|Q9BTM3	Nonsense_Mutation	SNP	ENST00000296589.4	37	CCDS3901.1	.	.	.	.	.	.	.	.	.	.	G	38	6.662346	0.97743	.	.	ENSG00000164175	ENST00000296589;ENST00000342059	.	.	.	5.81	5.81	0.92471	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.52906	T	0.07	-14.3284	20.0784	0.97758	0.0:0.0:1.0:0.0	.	.	.	.	X	484;425	.	ENSP00000296589:Q484X	Q	-	1	0	SLC45A2	33980653	1.000000	0.71417	0.997000	0.53966	0.998000	0.95712	9.589000	0.98235	2.736000	0.93811	0.655000	0.94253	CAG	.		0.622	SLC45A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207443.2	NM_016180	
ATP6AP1L	92270	broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	81613911	81613911	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5KX-01A-11D-A29I-10	TCGA-OR-A5KX-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8369398d-9d6a-48dd-b20d-4e699ceddc1b	4b83e274-a5a1-430f-8ea8-70a4a64581c9	g.chr5:81613911C>T	ENST00000380167.4	+	10	1792	c.467C>T	c.(466-468)tCc>tTc	p.S156F	ATP6AP1L_ENST00000508366.1_Intron|ATP6AP1L_ENST00000439350.1_Missense_Mutation_p.S156F			Q52LC2	VAS1L_HUMAN	ATPase, H+ transporting, lysosomal accessory protein 1-like	156					ATP hydrolysis coupled proton transport (GO:0015991)	integral component of membrane (GO:0016021)|proton-transporting V-type ATPase, V1 domain (GO:0033180)	proton-transporting ATP synthase activity, rotational mechanism (GO:0046933)|proton-transporting ATPase activity, rotational mechanism (GO:0046961)			breast(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(4)|urinary_tract(1)	12						CTGGCAATGTCCCTGATCCTG	0.552																																					p.S156F		.											.	ATP6AP1L-90	0			c.C467T						.						94.0	82.0	86.0					5																	81613911		2203	4300	6503	SO:0001583	missense	92270	exon4			CAATGTCCCTGAT	AK022625	CCDS34196.1	5q14.2	2010-03-10				ENSG00000205464			28091	protein-coding gene	gene with protein product							Standard	XR_112744		Approved		uc003khw.3	Q52LC2		ENST00000380167.4:c.467C>T	5.37:g.81613911C>T	ENSP00000369513:p.Ser156Phe	Somatic	204	1		WXS	Illumina GAIIx	Phase_I	217	95	NM_001017971	0	0	0	0	0		Missense_Mutation	SNP	ENST00000380167.4	37	CCDS34196.1	.	.	.	.	.	.	.	.	.	.	C	16.47	3.131863	0.56828	.	.	ENSG00000205464	ENST00000380167;ENST00000439350	.	.	.	5.75	5.75	0.90469	.	0.000000	0.85682	D	0.000000	D	0.85221	0.5647	M	0.86420	2.815	0.58432	D	0.999993	D	0.89917	1.0	D	0.87578	0.998	D	0.86770	0.1972	9	0.72032	D	0.01	.	19.9341	0.97130	0.0:1.0:0.0:0.0	.	156	Q52LC2	VAS1L_HUMAN	F	156	.	ENSP00000369513:S156F	S	+	2	0	ATP6AP1L	81649667	0.999000	0.42202	0.566000	0.28421	0.023000	0.10783	3.968000	0.56809	2.711000	0.92665	0.563000	0.77884	TCC	.		0.552	ATP6AP1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000369562.3	NM_001017971	
RGMB	285704	broad.mit.edu	37	5	98128940	98128940	+	Missense_Mutation	SNP	G	G	C			TCGA-OR-A5KX-01A-11D-A29I-10	TCGA-OR-A5KX-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8369398d-9d6a-48dd-b20d-4e699ceddc1b	4b83e274-a5a1-430f-8ea8-70a4a64581c9	g.chr5:98128940G>C	ENST00000513185.1	+	3	1233	c.797G>C	c.(796-798)gGc>gCc	p.G266A	RGMB_ENST00000308234.7_Missense_Mutation_p.G307A			Q6NW40	RGMB_HUMAN	repulsive guidance molecule family member b	266					axon guidance (GO:0007411)|BMP signaling pathway (GO:0030509)|cell adhesion (GO:0007155)|positive regulation of transcription, DNA-templated (GO:0045893)|signal transduction (GO:0007165)	anchored component of plasma membrane (GO:0046658)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)	identical protein binding (GO:0042802)			haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(2)|upper_aerodigestive_tract(1)	10		all_cancers(142;2.76e-08)|all_epithelial(76;2.98e-11)|all_lung(232;0.000485)|Lung NSC(167;0.000693)|Prostate(80;0.000986)|Ovarian(225;0.024)|Colorectal(57;0.117)		COAD - Colon adenocarcinoma(37;0.0587)		AGGGAGAGTGGCCACTATGTG	0.597																																					p.G307A		.											.	.	0			c.G920C						.						54.0	57.0	56.0					5																	98128940		2152	4257	6409	SO:0001583	missense	285704	exon5			AGAGTGGCCACTA	AK074887	CCDS47251.1	5q21.1	2013-11-06	2013-11-06		ENSG00000174136	ENSG00000174136			26896	protein-coding gene	gene with protein product		612687	"""RGM domain family, member B"""			19324014	Standard	NM_001012761		Approved	FLJ90406, DRAGON	uc003knc.3	Q6NW40	OTTHUMG00000162745	ENST00000513185.1:c.797G>C	5.37:g.98128940G>C	ENSP00000423256:p.Gly266Ala	Somatic	257	0		WXS	Illumina GAIIx	Phase_I	250	7	NM_001012761	0	0	5	5	0	D6R9A0|Q8NC92	Missense_Mutation	SNP	ENST00000513185.1	37		.	.	.	.	.	.	.	.	.	.	G	28.0	4.881283	0.91740	.	.	ENSG00000174136	ENST00000308234;ENST00000513185	D;D	0.86694	-2.16;-2.16	5.75	5.75	0.90469	Repulsive guidance molecule, C-terminal (1);	0.000000	0.85682	D	0.000000	D	0.94238	0.8150	M	0.83384	2.64	0.80722	D	1	D	0.89917	1.0	D	0.81914	0.995	D	0.94392	0.7615	10	0.87932	D	0	-26.9703	19.9165	0.97064	0.0:0.0:1.0:0.0	.	266	Q6NW40	RGMB_HUMAN	A	307;266	ENSP00000308219:G307A;ENSP00000423256:G266A	ENSP00000308219:G307A	G	+	2	0	RGMB	98156840	1.000000	0.71417	0.995000	0.50966	0.957000	0.61999	9.786000	0.99046	2.705000	0.92388	0.563000	0.77884	GGC	.		0.597	RGMB-003	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000370308.1	NM_173670	
FBN2	2201	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	127728908	127728908	+	Missense_Mutation	SNP	G	G	T			TCGA-OR-A5KX-01A-11D-A29I-10	TCGA-OR-A5KX-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8369398d-9d6a-48dd-b20d-4e699ceddc1b	4b83e274-a5a1-430f-8ea8-70a4a64581c9	g.chr5:127728908G>T	ENST00000508053.1	-	16	2359	c.1385C>A	c.(1384-1386)cCt>cAt	p.P462H	FBN2_ENST00000508989.1_Missense_Mutation_p.P429H|FBN2_ENST00000262464.4_Missense_Mutation_p.P462H			P35556	FBN2_HUMAN	fibrillin 2	462					anatomical structure morphogenesis (GO:0009653)|bone trabecula formation (GO:0060346)|embryonic limb morphogenesis (GO:0030326)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|positive regulation of bone mineralization (GO:0030501)|positive regulation of osteoblast differentiation (GO:0045669)|sequestering of TGFbeta in extracellular matrix (GO:0035583)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|microfibril (GO:0001527)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|extracellular matrix structural constituent (GO:0005201)			NS(1)|autonomic_ganglia(1)|biliary_tract(1)|breast(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(37)|liver(1)|lung(89)|ovary(9)|pancreas(2)|prostate(6)|skin(10)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	197		all_cancers(142;0.0216)|Prostate(80;0.0551)	KIRC - Kidney renal clear cell carcinoma(527;0.0268)|Kidney(363;0.0488)	OV - Ovarian serous cystadenocarcinoma(64;0.0821)|Epithelial(69;0.146)		ATTGCCTCCAGGGATGGGGAT	0.597																																					p.P462H		.											.	FBN2-146	0			c.C1385A						.						85.0	83.0	84.0					5																	127728908		2203	4300	6503	SO:0001583	missense	2201	exon10			CCTCCAGGGATGG	U03272	CCDS34222.1	5q23-q31	2008-08-01	2008-08-01			ENSG00000138829			3604	protein-coding gene	gene with protein product	"""fibrillin 5"""	612570	"""congenital contractural arachnodactyly"""	CCA		1852206, 8120105	Standard	NM_001999		Approved	DA9	uc003kuu.3	P35556		ENST00000508053.1:c.1385C>A	5.37:g.127728908G>T	ENSP00000424571:p.Pro462His	Somatic	105	0		WXS	Illumina GAIIx	Phase_I	84	44	NM_001999	0	0	0	0	0	B4DU01|Q59ES6	Missense_Mutation	SNP	ENST00000508053.1	37	CCDS34222.1	.	.	.	.	.	.	.	.	.	.	G	17.47	3.397777	0.62177	.	.	ENSG00000138829	ENST00000262464;ENST00000508053;ENST00000508989	D;D;D	0.86297	-1.89;-1.89;-2.1	3.98	3.98	0.46160	.	0.000000	0.64402	D	0.000003	D	0.90689	0.7079	L	0.54908	1.71	0.50467	D	0.999878	D;D	0.76494	0.999;0.999	D;D	0.77557	0.99;0.99	D	0.87234	0.2262	10	0.15066	T	0.55	.	17.3754	0.87391	0.0:0.0:1.0:0.0	.	429;462	D6RJI3;P35556	.;FBN2_HUMAN	H	462;462;429	ENSP00000262464:P462H;ENSP00000424571:P462H;ENSP00000425596:P429H	ENSP00000262464:P462H	P	-	2	0	FBN2	127756807	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.768000	0.68858	2.505000	0.84491	0.563000	0.77884	CCT	.		0.597	FBN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000371618.2	NM_001999	
TTC1	7265	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	159491977	159491977	+	Missense_Mutation	SNP	T	T	G			TCGA-OR-A5KX-01A-11D-A29I-10	TCGA-OR-A5KX-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8369398d-9d6a-48dd-b20d-4e699ceddc1b	4b83e274-a5a1-430f-8ea8-70a4a64581c9	g.chr5:159491977T>G	ENST00000231238.5	+	8	894	c.784T>G	c.(784-786)Ttt>Gtt	p.F262V	TTC1_ENST00000522793.1_Missense_Mutation_p.F262V|TTC1_ENST00000520274.1_3'UTR	NM_001282500.1|NM_003314.1	NP_001269429.1|NP_003305.1	Q99614	TTC1_HUMAN	tetratricopeptide repeat domain 1	262					protein folding (GO:0006457)	peroxisomal membrane (GO:0005778)	unfolded protein binding (GO:0051082)			breast(1)|endometrium(1)|kidney(1)|large_intestine(4)|liver(2)|lung(1)|prostate(1)|skin(1)	12	Renal(175;0.00196)	all_hematologic(541;0.00014)|Breast(839;0.0101)|all_neural(177;0.0281)|Medulloblastoma(196;0.0425)|Lung NSC(249;0.119)|all_lung(500;0.163)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	Epithelial(171;8.37e-05)|all cancers(165;0.000694)|OV - Ovarian serous cystadenocarcinoma(192;0.0402)		TCTCCGACCTTTTGGGCTCTC	0.383																																					p.F262V		.											.	TTC1-91	0			c.T784G						.						71.0	72.0	72.0					5																	159491977		2203	4300	6503	SO:0001583	missense	7265	exon8			CGACCTTTTGGGC	U46570	CCDS4348.1	5q32-q33.2	2013-01-10			ENSG00000113312	ENSG00000113312		"""Tetratricopeptide (TTC) repeat domain containing"""	12391	protein-coding gene	gene with protein product		601963				8836031	Standard	NM_003314		Approved	TPR1	uc003lxu.3	Q99614	OTTHUMG00000130326	ENST00000231238.5:c.784T>G	5.37:g.159491977T>G	ENSP00000231238:p.Phe262Val	Somatic	62	0		WXS	Illumina GAIIx	Phase_I	56	34	NM_003314	0	0	49	102	53	B2RCT2|D3DQJ8|Q9BVT3	Missense_Mutation	SNP	ENST00000231238.5	37	CCDS4348.1	.	.	.	.	.	.	.	.	.	.	T	24.8	4.567774	0.86439	.	.	ENSG00000113312	ENST00000231238;ENST00000522793;ENST00000518560	T;T	0.25085	1.82;1.82	5.66	4.5	0.54988	.	0.000000	0.85682	D	0.000000	T	0.48714	0.1515	M	0.75264	2.295	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.45702	-0.9243	10	0.45353	T	0.12	-15.0156	11.3807	0.49754	0.0:0.0716:0.0:0.9284	.	262	Q99614	TTC1_HUMAN	V	262;262;94	ENSP00000231238:F262V;ENSP00000429225:F262V	ENSP00000231238:F262V	F	+	1	0	TTC1	159424555	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.357000	0.79456	1.089000	0.41292	0.533000	0.62120	TTT	.		0.383	TTC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252675.3	NM_003314	
KIAA1244	57221	bcgsc.ca	37	6	138613011	138613011	+	Silent	SNP	C	C	A			TCGA-OR-A5KX-01A-11D-A29I-10	TCGA-OR-A5KX-10A-01D-A29L-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8369398d-9d6a-48dd-b20d-4e699ceddc1b	4b83e274-a5a1-430f-8ea8-70a4a64581c9	g.chr6:138613011C>A	ENST00000251691.4	+	19	3355	c.3189C>A	c.(3187-3189)ccC>ccA	p.P1063P		NM_020340.4	NP_065073.3			KIAA1244											NS(1)|breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(11)|lung(17)|ovary(2)|skin(2)	44	Breast(32;0.135)			OV - Ovarian serous cystadenocarcinoma(155;0.00102)|GBM - Glioblastoma multiforme(68;0.00259)		GCTCGCCCCCCGAGCACAGCC	0.726																																					p.P1063P		.											.	KIAA1244-228	0			c.C3189A						.						11.0	12.0	12.0					6																	138613011		2172	4260	6432	SO:0001819	synonymous_variant	57221	exon19			GCCCCCCGAGCAC	AB033070	CCDS5189.2	6q23.3	2012-04-17			ENSG00000112379	ENSG00000112379		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	21213	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 33"""		"""chromosome 6 open reading frame 92"""	C6orf92			Standard	NM_020340		Approved	dJ171N11.1, BIG3, PPP1R33	uc003qhu.3	Q5TH69	OTTHUMG00000015670	ENST00000251691.4:c.3189C>A	6.37:g.138613011C>A		Somatic	88	3		WXS	Illumina GAIIx	Phase_I	110	50	NM_020340	0	0	0	0	0		Silent	SNP	ENST00000251691.4	37	CCDS5189.2																																																																																			.		0.726	KIAA1244-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042425.4	NM_020340	
USP42	84132	hgsc.bcm.edu	37	7	6193521	6193521	+	Missense_Mutation	SNP	G	G	C	rs61729726	byFrequency	TCGA-OR-A5KX-01A-11D-A29I-10	TCGA-OR-A5KX-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8369398d-9d6a-48dd-b20d-4e699ceddc1b	4b83e274-a5a1-430f-8ea8-70a4a64581c9	g.chr7:6193521G>C	ENST00000306177.5	+	15	2494	c.2336G>C	c.(2335-2337)cGc>cCc	p.R779P		NM_032172.2	NP_115548.1	Q9H9J4	UBP42_HUMAN	ubiquitin specific peptidase 42	779	Pro-rich.				cell differentiation (GO:0030154)|protein deubiquitination (GO:0016579)|spermatogenesis (GO:0007283)|ubiquitin-dependent protein catabolic process (GO:0006511)		ubiquitin-specific protease activity (GO:0004843)			breast(1)|central_nervous_system(1)|endometrium(5)|kidney(4)|large_intestine(2)|lung(14)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|urinary_tract(1)	35		Ovarian(82;0.0423)		UCEC - Uterine corpus endometrioid carcinoma (126;0.108)|OV - Ovarian serous cystadenocarcinoma(56;5.77e-14)		CCGCCGCCCCGCGATCCCGGC	0.756													C|||	2895	0.578075	0.8638	0.4121	5008	,	,		10724	0.7331		0.3082	False		,,,				2504	0.4274				p.R779P		.											.	USP42-659	0			c.G2336C						.	C	PRO/ARG	2157,1125		751,655,235	4.0	6.0	5.0		2336	2.6	0.0	7	dbSNP_129	5	1843,5693		290,1263,2215	no	missense	USP42	NM_032172.2	103	1041,1918,2450	CC,CG,GG		24.4559,34.2779,36.9754	benign	779/1317	6193521	4000,6818	1641	3768	5409	SO:0001583	missense	84132	exon15			CGCCCCGCGATCC	AK022759	CCDS47535.1	7p22.2	2005-08-08	2005-08-08		ENSG00000106346	ENSG00000106346		"""Ubiquitin-specific peptidases"""	20068	protein-coding gene	gene with protein product			"""ubiquitin specific protease 42"""			12838346	Standard	NM_032172		Approved	FLJ12697	uc011jwp.2	Q9H9J4	OTTHUMG00000151888	ENST00000306177.5:c.2336G>C	7.37:g.6193521G>C	ENSP00000301962:p.Arg779Pro	Somatic	3	0		WXS	Illumina GAIIx	Phase_I	8	6	NM_032172	0	0	0	0	0	A2RUE3|B5MDA5|Q0VIN8|Q3C166|Q6P9B4	Missense_Mutation	SNP	ENST00000306177.5	37	CCDS47535.1	1188	0.5439560439560439	401	0.8150406504065041	130	0.35911602209944754	440	0.7692307692307693	217	0.2862796833773087	C	10.95	1.494372	0.26774	0.657221	0.244559	ENSG00000106346	ENST00000306177;ENST00000426246	T;T	0.14266	2.52;2.93	5.46	2.59	0.31030	.	0.841331	0.10600	N	0.655737	T	0.00012	0.0000	N	0.08118	0	0.80722	P	0.0	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.09164	-1.0687	9	0.28530	T	0.3	.	2.8136	0.05448	0.1458:0.5508:0.1414:0.162	rs61729726	779;779	Q9H9J4-2;Q9H9J4	.;UBP42_HUMAN	P	779;625	ENSP00000301962:R779P;ENSP00000408217:R625P	ENSP00000301962:R779P	R	+	2	0	USP42	6160046	0.001000	0.12720	0.000000	0.03702	0.000000	0.00434	0.469000	0.22067	0.265000	0.21872	-0.120000	0.15030	CGC	G|0.456;C|0.544		0.756	USP42-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000324262.3	XM_166526	
GARS	2617	hgsc.bcm.edu	37	7	30634661	30634661	+	Missense_Mutation	SNP	C	C	G	rs1049402	byFrequency	TCGA-OR-A5KX-01A-11D-A29I-10	TCGA-OR-A5KX-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8369398d-9d6a-48dd-b20d-4e699ceddc1b	4b83e274-a5a1-430f-8ea8-70a4a64581c9	g.chr7:30634661C>G	ENST00000389266.3	+	1	365	c.124C>G	c.(124-126)Ccc>Gcc	p.P42A	AC005154.6_ENST00000578994.1_RNA|AC005154.6_ENST00000579174.1_RNA|AC005154.6_ENST00000583664.1_RNA|AC005154.6_ENST00000581665.1_RNA|AC005154.6_ENST00000580440.1_RNA|AC005154.6_ENST00000584199.1_RNA|AC005154.6_ENST00000584372.1_RNA|AC005154.6_ENST00000582549.1_RNA	NM_002047.2	NP_002038.2	P41250	SYG_HUMAN	glycyl-tRNA synthetase	42			P -> A (in dbSNP:rs1049402). {ECO:0000269|PubMed:14702039, ECO:0000269|PubMed:15489334, ECO:0000269|PubMed:7753621, ECO:0000269|PubMed:7961834, ECO:0000269|PubMed:7962006}.		cell death (GO:0008219)|diadenosine tetraphosphate biosynthetic process (GO:0015966)|gene expression (GO:0010467)|glycyl-tRNA aminoacylation (GO:0006426)|tRNA aminoacylation for protein translation (GO:0006418)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|mitochondrial matrix (GO:0005759)|nucleus (GO:0005634)|secretory granule (GO:0030141)	ATP binding (GO:0005524)|glycine-tRNA ligase activity (GO:0004820)|protein dimerization activity (GO:0046983)	p.P42fs*20(1)		breast(3)|endometrium(2)|kidney(1)|large_intestine(4)|lung(9)|ovary(1)|skin(3)|urinary_tract(1)	24					Glycine(DB00145)	GGCCTCCTGCCCCCCGATCTC	0.736													G|||	3252	0.649361	0.5219	0.7147	5008	,	,		13746	0.6677		0.7634	False		,,,				2504	0.6391				p.P42A		.											.	GARS-91	1	Insertion - Frameshift(1)	large_intestine(1)	c.C124G						.	G	ALA/PRO	2445,1427		776,893,267	5.0	8.0	7.0		124	-6.6	0.0	7	dbSNP_86	7	6367,1671		2577,1213,229	no	missense	GARS	NM_002047.2	27	3353,2106,496	GG,GC,CC		20.7888,36.8543,26.0118	benign	42/740	30634661	8812,3098	1936	4019	5955	SO:0001583	missense	2617	exon1			TCCTGCCCCCCGA	AK074524	CCDS43564.1	7p15	2014-09-17	2004-02-13		ENSG00000106105	ENSG00000106105	6.1.1.14	"""Aminoacyl tRNA synthetases / Class II"""	4162	protein-coding gene	gene with protein product	"""glycine tRNA ligase"""	600287	"""Charcot-Marie-Tooth neuropathy 2D"""	CMT2D		8595897, 8872480	Standard	NM_002047		Approved	GlyRS, DSMAV, SMAD1	uc003tbm.3	P41250	OTTHUMG00000152769	ENST00000389266.3:c.124C>G	7.37:g.30634661C>G	ENSP00000373918:p.Pro42Ala	Somatic	1	0		WXS	Illumina GAIIx	Phase_I	10	5	NM_002047	0	0	1	4	3	B3KQA2|B4DIA0|Q969Y1	Missense_Mutation	SNP	ENST00000389266.3	37	CCDS43564.1	1456	0.6666666666666666	278	0.5650406504065041	268	0.7403314917127072	337	0.5891608391608392	573	0.7559366754617414	G	0.005	-2.164835	0.00318	0.631457	0.792112	ENSG00000106105	ENST00000389266	T	0.80393	-1.37	3.31	-6.63	0.01807	.	1.037800	0.07609	N	0.925137	T	0.00012	0.0000	N	0.08118	0	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.13575	-1.0504	9	0.08179	T	0.78	.	5.5596	0.17135	0.0726:0.2689:0.1197:0.5389	rs1049402;rs3189564;rs11553500;rs17856223;rs17856227;rs1049402	42	P41250	SYG_HUMAN	A	42	ENSP00000373918:P42A	ENSP00000373918:P42A	P	+	1	0	GARS	30601186	0.000000	0.05858	0.000000	0.03702	0.037000	0.13140	-0.671000	0.05250	-2.551000	0.00479	-0.744000	0.03518	CCC	C|0.329;G|0.671		0.736	GARS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000327735.1	NM_002047	
LAT2	7462	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	73636002	73636002	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5KX-01A-11D-A29I-10	TCGA-OR-A5KX-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8369398d-9d6a-48dd-b20d-4e699ceddc1b	4b83e274-a5a1-430f-8ea8-70a4a64581c9	g.chr7:73636002G>A	ENST00000460943.1	+	10	1257	c.368G>A	c.(367-369)cGg>cAg	p.R123Q	LAT2_ENST00000398475.1_Missense_Mutation_p.R123Q|LAT2_ENST00000344995.5_Missense_Mutation_p.R123Q|LAT2_ENST00000275635.7_Missense_Mutation_p.R123Q	NM_032464.2	NP_115853.2	Q9UHI5	LAT2_HUMAN	linker for activation of T cells family, member 2	0					amino acid transport (GO:0006865)|blood coagulation (GO:0007596)|cellular amino acid metabolic process (GO:0006520)|ion transport (GO:0006811)|leukocyte migration (GO:0050900)|metal ion homeostasis (GO:0055065)|neutral amino acid transport (GO:0015804)|organic cation transport (GO:0015695)|response to toxic substance (GO:0009636)|toxin transport (GO:1901998)|transmembrane transport (GO:0055085)|transport (GO:0006810)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	amino acid transmembrane transporter activity (GO:0015171)|L-amino acid transmembrane transporter activity (GO:0015179)|neutral amino acid transmembrane transporter activity (GO:0015175)|organic cation transmembrane transporter activity (GO:0015101)|peptide antigen binding (GO:0042605)|toxin transporter activity (GO:0019534)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(1)|prostate(1)	6					L-Alanine(DB00160)|L-DOPA(DB01235)|L-Glutamine(DB00130)|L-Phenylalanine(DB00120)	AACTGGGGGCGGTTCTCGAAG	0.582																																					p.R123Q		.											.	LAT2-90	0			c.G368A						.						98.0	104.0	102.0					7																	73636002		1875	4102	5977	SO:0001583	missense	7462	exon10			GGGGGCGGTTCTC	AF257135	CCDS5566.2	7q11.23	2011-11-01	2005-04-26	2005-04-26	ENSG00000086730	ENSG00000086730			12749	protein-coding gene	gene with protein product	"""linker for activation of B cells"", ""non-T cell activation linker"", ""linker for activation of T cells, transmembrane adaptor 2"""	605719	"""Williams-Beuren syndrome chromosome region 5"""	WBSCR15, WBSCR5		8812460, 12514734	Standard	NM_032464		Approved	WSCR5, HSPC046, LAB, NTAL	uc003uai.3	Q9GZY6	OTTHUMG00000130151	ENST00000460943.1:c.368G>A	7.37:g.73636002G>A	ENSP00000420494:p.Arg123Gln	Somatic	68	0		WXS	Illumina GAIIx	Phase_I	72	13	NM_032464	0	0	1	1	0	B2R8Q4|B4DKT4|B4DTV6|D3DS46|F2Z2J4|Q86U05|Q9UKQ6|Q9UKQ7|Q9UKQ8|Q9Y445	Missense_Mutation	SNP	ENST00000460943.1	37	CCDS5566.2	.	.	.	.	.	.	.	.	.	.	G	6.680	0.494101	0.12702	.	.	ENSG00000086730	ENST00000344995;ENST00000460943;ENST00000398475;ENST00000275635	T;T;T;T	0.04194	3.68;3.68;3.68;3.68	3.38	-0.834	0.10779	.	133.025000	0.00166	N	0.000000	T	0.02688	0.0081	N	0.08118	0	0.09310	N	1	B	0.16396	0.017	B	0.11329	0.006	T	0.39313	-0.9620	10	0.15952	T	0.53	0.0011	3.7025	0.08387	0.3723:0.2077:0.42:0.0	.	123	Q9GZY6	NTAL_HUMAN	Q	123	ENSP00000344881:R123Q;ENSP00000420494:R123Q;ENSP00000381492:R123Q;ENSP00000275635:R123Q	ENSP00000275635:R123Q	R	+	2	0	LAT2	73273938	0.000000	0.05858	0.000000	0.03702	0.030000	0.12068	-1.008000	0.03663	-0.181000	0.10619	0.561000	0.74099	CGG	.		0.582	LAT2-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000277062.1		
CACNA2D1	781	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	7	81591223	81591224	+	Frame_Shift_Del	DEL	CA	CA	-			TCGA-OR-A5KX-01A-11D-A29I-10	TCGA-OR-A5KX-10A-01D-A29L-10	CA	CA	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8369398d-9d6a-48dd-b20d-4e699ceddc1b	4b83e274-a5a1-430f-8ea8-70a4a64581c9	g.chr7:81591223_81591224delCA	ENST00000356253.5	-	36	3243_3244	c.2988_2989delTG	c.(2986-2991)tgtggafs	p.CG996fs	CACNA2D1_ENST00000535308.1_Frame_Shift_Del_p.CG196fs|CACNA2D1_ENST00000356860.3_Frame_Shift_Del_p.CG984fs			P54289	CA2D1_HUMAN	calcium channel, voltage-dependent, alpha 2/delta subunit 1	996					calcium ion transport (GO:0006816)|regulation of calcium ion transport (GO:0051924)	extracellular vesicular exosome (GO:0070062)|sarcoplasmic reticulum (GO:0016529)|T-tubule (GO:0030315)|voltage-gated calcium channel complex (GO:0005891)	metal ion binding (GO:0046872)|voltage-gated calcium channel activity (GO:0005245)			breast(2)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(15)|liver(1)|lung(42)|ovary(6)|pancreas(1)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	81					Amlodipine(DB00381)|Cyclandelate(DB04838)|Felodipine(DB01023)|Gabapentin(DB00996)|Ibutilide(DB00308)|Isradipine(DB00270)|Magnesium Sulfate(DB00653)|Nicardipine(DB00622)|Nifedipine(DB01115)|Nilvadipine(DB06712)|Nisoldipine(DB00401)|Nitrendipine(DB01054)|Spironolactone(DB00421)	GAACAGTTTCCACAGTCTAATA	0.342																																					p.984_985del		.											.	CACNA2D1-96	0			c.2952_2953del						.																																			SO:0001589	frameshift_variant	781	exon36			AGTTTCCACAGTC	M76559	CCDS5598.1	7q21-q22	2014-09-17			ENSG00000153956	ENSG00000153956		"""Calcium channel subunits"""	1399	protein-coding gene	gene with protein product		114204	"""long intergenic non-protein coding RNA 1112"""	CACNL2A, CACNA2, MHS3, LINC01112		8188232	Standard	XM_005250570		Approved	lncRNA-N3	uc003uhr.1	P54289	OTTHUMG00000023622	ENST00000356253.5:c.2988_2989delTG	7.37:g.81591225_81591226delCA	ENSP00000348589:p.Cys996fs	Somatic	69	0		WXS	Illumina GAIIx	Phase_I	71	22	NM_000722	0	0	0	0	0	Q17R45|Q9UD80|Q9UD81|Q9UD82	Frame_Shift_Del	DEL	ENST00000356253.5	37																																																																																				.		0.342	CACNA2D1-201	KNOWN	basic	protein_coding	protein_coding			
PUS7	54517	broad.mit.edu	37	7	105122864	105122864	+	Missense_Mutation	SNP	T	T	G			TCGA-OR-A5KX-01A-11D-A29I-10	TCGA-OR-A5KX-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8369398d-9d6a-48dd-b20d-4e699ceddc1b	4b83e274-a5a1-430f-8ea8-70a4a64581c9	g.chr7:105122864T>G	ENST00000356362.2	-	8	1158	c.944A>C	c.(943-945)cAc>cCc	p.H315P	PUS7_ENST00000469408.1_Missense_Mutation_p.H315P	NM_019042.3	NP_061915.2	Q96PZ0	PUS7_HUMAN	pseudouridylate synthase 7 (putative)	315					pseudouridine synthesis (GO:0001522)|tRNA processing (GO:0008033)		enzyme binding (GO:0019899)|poly(A) RNA binding (GO:0044822)|pseudouridine synthase activity (GO:0009982)			breast(1)|endometrium(2)|kidney(1)|large_intestine(9)|lung(8)|pancreas(1)|skin(1)	23						CTTATTCAGGTGGGCAAGTCT	0.353																																					p.H315P	Colon(138;2387 3051 17860)	.											.	PUS7-90	0			c.A944C						.						139.0	140.0	140.0					7																	105122864		2203	4300	6503	SO:0001583	missense	54517	exon8			TTCAGGTGGGCAA	AK128629	CCDS34725.1	7q22.3	2014-02-14	2014-02-14		ENSG00000091127	ENSG00000091127			26033	protein-coding gene	gene with protein product			"""pseudouridylate synthase 7 homolog (S. cerevisiae)"""			11572484	Standard	NM_019042		Approved	FLJ20485	uc003vcx.3	Q96PZ0	OTTHUMG00000157399	ENST00000356362.2:c.944A>C	7.37:g.105122864T>G	ENSP00000348722:p.His315Pro	Somatic	33	1		WXS	Illumina GAIIx	Phase_I	28	3	NM_019042	0	0	1	1	0	Q75MG4|Q9NX19	Missense_Mutation	SNP	ENST00000356362.2	37	CCDS34725.1	.	.	.	.	.	.	.	.	.	.	T	14.85	2.657788	0.47467	.	.	ENSG00000091127	ENST00000356362;ENST00000544995;ENST00000469408	T;T	0.40476	1.03;1.03	5.21	5.21	0.72293	Pseudouridine synthase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.52108	0.1714	L	0.38175	1.15	0.80722	D	1	B;D	0.76494	0.14;0.999	B;D	0.68621	0.079;0.959	T	0.46091	-0.9216	10	0.31617	T	0.26	-19.0069	14.5634	0.68156	0.0:0.0:0.0:1.0	.	315;315	B3KY42;Q96PZ0	.;PUS7_HUMAN	P	315	ENSP00000348722:H315P;ENSP00000417402:H315P	ENSP00000348722:H315P	H	-	2	0	PUS7	104910100	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.606000	0.82863	2.081000	0.62600	0.383000	0.25322	CAC	.		0.353	PUS7-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348681.1	NM_019042	
CSGALNACT1	55790	bcgsc.ca	37	8	19263441	19263441	+	Silent	SNP	G	G	A	rs35971700	byFrequency	TCGA-OR-A5KX-01A-11D-A29I-10	TCGA-OR-A5KX-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8369398d-9d6a-48dd-b20d-4e699ceddc1b	4b83e274-a5a1-430f-8ea8-70a4a64581c9	g.chr8:19263441G>A	ENST00000454498.2	-	10	2462	c.1449C>T	c.(1447-1449)gaC>gaT	p.D483D	CSGALNACT1_ENST00000544602.1_Silent_p.D483D|CSGALNACT1_ENST00000311540.4_Silent_p.D483D|CSGALNACT1_ENST00000332246.6_Silent_p.D483D|CSGALNACT1_ENST00000522854.1_Silent_p.D483D	NM_001130518.1	NP_001123990.1	Q8TDX6	CGAT1_HUMAN	chondroitin sulfate N-acetylgalactosaminyltransferase 1	483					anatomical structure morphogenesis (GO:0009653)|carbohydrate metabolic process (GO:0005975)|cartilage development (GO:0051216)|cell proliferation (GO:0008283)|cell recognition (GO:0008037)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate metabolic process (GO:0030204)|chondroitin sulfate proteoglycan biosynthetic process (GO:0050650)|chondroitin sulfate proteoglycan biosynthetic process, polysaccharide chain biosynthetic process (GO:0050653)|dermatan sulfate proteoglycan biosynthetic process (GO:0050651)|endochondral ossification (GO:0001958)|extracellular matrix organization (GO:0030198)|glycosaminoglycan metabolic process (GO:0030203)|heparan sulfate proteoglycan biosynthetic process, polysaccharide chain biosynthetic process (GO:0015014)|heparin biosynthetic process (GO:0030210)|nervous system development (GO:0007399)|proteoglycan biosynthetic process (GO:0030166)|small molecule metabolic process (GO:0044281)|UDP-glucuronate metabolic process (GO:0046398)|UDP-N-acetylgalactosamine metabolic process (GO:0019276)	Golgi cisterna membrane (GO:0032580)|Golgi membrane (GO:0000139)|integral component of Golgi membrane (GO:0030173)|intracellular (GO:0005622)	acetylgalactosaminyltransferase activity (GO:0008376)|glucuronosyl-N-acetylgalactosaminyl-proteoglycan 4-beta-N-acetylgalactosaminyltransferase activity (GO:0047238)|glucuronosyltransferase activity (GO:0015020)|glucuronylgalactosylproteoglycan 4-beta-N-acetylgalactosaminyltransferase activity (GO:0047237)|metal ion binding (GO:0046872)|peptidoglycan glycosyltransferase activity (GO:0008955)			NS(1)|central_nervous_system(2)|endometrium(3)|kidney(1)|large_intestine(4)|lung(15)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	31				Colorectal(111;0.182)		GGGTCAGCTCGTCCATGCAGC	0.572													G|||	213	0.0425319	0.0197	0.036	5008	,	,		17009	0.0248		0.0636	False		,,,				2504	0.0746				p.D483D		.											.	CSGALNACT1-70	0			c.C1449T						.	G	,	130,4276	95.7+/-134.4	0,130,2073	174.0	138.0	150.0		1449,1449	-7.6	0.4	8	dbSNP_126	150	628,7972	162.6+/-215.3	25,578,3697	no	coding-synonymous,coding-synonymous	CSGALNACT1	NM_001130518.1,NM_018371.4	,	25,708,5770	AA,AG,GG		7.3023,2.9505,5.8281	,	483/533,483/533	19263441	758,12248	2203	4300	6503	SO:0001819	synonymous_variant	55790	exon10			CAGCTCGTCCATG	AK002126	CCDS6010.1	8p21.3	2013-02-19				ENSG00000147408		"""Beta 4-glycosyltransferases"""	24290	protein-coding gene	gene with protein product	"""chondroitin beta1,4 N-acetylgalactosaminyltransferase"""					17145758, 12446672	Standard	NM_018371		Approved	CSGalNAcT-1, FLJ11264, ChGn	uc011kyo.2	Q8TDX6		ENST00000454498.2:c.1449C>T	8.37:g.19263441G>A		Somatic	174	0		WXS	Illumina GAIIx	Phase_I	90	5	NM_018371	0	0	16	16	0	B2RBE4|Q6P9G6|Q8IUF9|Q9NSQ7|Q9NUM9	Silent	SNP	ENST00000454498.2	37	CCDS6010.1																																																																																			G|0.945;A|0.055		0.572	CSGALNACT1-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000375204.1	NM_018371	
BIN3	55909	bcgsc.ca	37	8	22494440	22494440	+	Frame_Shift_Del	DEL	A	A	-			TCGA-OR-A5KX-01A-11D-A29I-10	TCGA-OR-A5KX-10A-01D-A29L-10	A	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8369398d-9d6a-48dd-b20d-4e699ceddc1b	4b83e274-a5a1-430f-8ea8-70a4a64581c9	g.chr8:22494440delA	ENST00000276416.6	-	3	161	c.93delT	c.(91-93)cttfs	p.L31fs	BIN3_ENST00000519513.1_Intron|BIN3_ENST00000520292.1_Frame_Shift_Del_p.L31fs|BIN3_ENST00000519335.1_5'UTR|BIN3_ENST00000399977.4_Frame_Shift_Del_p.F4fs	NM_018688.4	NP_061158.1	Q9NQY0	BIN3_HUMAN	bridging integrator 3	31	BAR. {ECO:0000255|PROSITE- ProRule:PRU00361}.				actin filament organization (GO:0007015)|barrier septum assembly (GO:0000917)|cytokinesis (GO:0000910)|myoblast migration involved in skeletal muscle regeneration (GO:0014839)|protein localization (GO:0008104)|regulation of lamellipodium assembly (GO:0010591)|skeletal muscle fiber development (GO:0048741)|unidimensional cell growth (GO:0009826)	actin filament (GO:0005884)|cytoplasm (GO:0005737)	cytoskeletal adaptor activity (GO:0008093)			kidney(1)|large_intestine(1)|lung(4)|ovary(1)|prostate(1)|urinary_tract(1)	9		Prostate(55;0.0424)|Breast(100;0.102)|all_epithelial(46;0.143)		BRCA - Breast invasive adenocarcinoma(99;0.00664)|Colorectal(74;0.0189)|COAD - Colon adenocarcinoma(73;0.0727)		CTCACTGCTGAAGTTTTCCAT	0.547																																					p.L31fs		.											.	.	0			c.93delT						.						91.0	96.0	94.0					8																	22494440		1950	4118	6068	SO:0001589	frameshift_variant	55909	exon3			CTGCTGAAGTTTT		CCDS47825.1	8p21.2	2008-07-04			ENSG00000147439	ENSG00000147439			1054	protein-coding gene	gene with protein product		606396				16524918	Standard	NM_018688		Approved		uc003xcl.3	Q9NQY0	OTTHUMG00000163844	ENST00000276416.6:c.93delT	8.37:g.22494440delA	ENSP00000276416:p.Leu31fs	Somatic	148	0		WXS	Illumina GAIIx	Phase_I	91	12	NM_018688	0	0	0	0	0	Q9BVG2|Q9NVY9	Frame_Shift_Del	DEL	ENST00000276416.6	37	CCDS47825.1																																																																																			.		0.547	BIN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000375895.1		
BIN3	55909	bcgsc.ca	37	8	22494441	22494441	+	Missense_Mutation	SNP	A	A	T	rs200762212		TCGA-OR-A5KX-01A-11D-A29I-10	TCGA-OR-A5KX-10A-01D-A29L-10	A	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8369398d-9d6a-48dd-b20d-4e699ceddc1b	4b83e274-a5a1-430f-8ea8-70a4a64581c9	g.chr8:22494441A>T	ENST00000276416.6	-	3	160	c.92T>A	c.(91-93)cTt>cAt	p.L31H	BIN3_ENST00000519513.1_Intron|BIN3_ENST00000520292.1_Missense_Mutation_p.L31H|BIN3_ENST00000519335.1_5'UTR|BIN3_ENST00000399977.4_Missense_Mutation_p.F4I	NM_018688.4	NP_061158.1	Q9NQY0	BIN3_HUMAN	bridging integrator 3	31	BAR. {ECO:0000255|PROSITE- ProRule:PRU00361}.				actin filament organization (GO:0007015)|barrier septum assembly (GO:0000917)|cytokinesis (GO:0000910)|myoblast migration involved in skeletal muscle regeneration (GO:0014839)|protein localization (GO:0008104)|regulation of lamellipodium assembly (GO:0010591)|skeletal muscle fiber development (GO:0048741)|unidimensional cell growth (GO:0009826)	actin filament (GO:0005884)|cytoplasm (GO:0005737)	cytoskeletal adaptor activity (GO:0008093)			kidney(1)|large_intestine(1)|lung(4)|ovary(1)|prostate(1)|urinary_tract(1)	9		Prostate(55;0.0424)|Breast(100;0.102)|all_epithelial(46;0.143)		BRCA - Breast invasive adenocarcinoma(99;0.00664)|Colorectal(74;0.0189)|COAD - Colon adenocarcinoma(73;0.0727)		TCACTGCTGAAGTTTTCCATA	0.547																																					p.L31H		.											.	.	0			c.T92A						.						92.0	96.0	95.0					8																	22494441		1952	4117	6069	SO:0001583	missense	55909	exon3			TGCTGAAGTTTTC		CCDS47825.1	8p21.2	2008-07-04			ENSG00000147439	ENSG00000147439			1054	protein-coding gene	gene with protein product		606396				16524918	Standard	NM_018688		Approved		uc003xcl.3	Q9NQY0	OTTHUMG00000163844	ENST00000276416.6:c.92T>A	8.37:g.22494441A>T	ENSP00000276416:p.Leu31His	Somatic	145	0		WXS	Illumina GAIIx	Phase_I	90	12	NM_018688	0	0	0	0	0	Q9BVG2|Q9NVY9	Missense_Mutation	SNP	ENST00000276416.6	37	CCDS47825.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	25.5|25.5	4.641969|4.641969	0.87859|0.87859	.|.	.|.	ENSG00000147439|ENSG00000147439	ENST00000399977|ENST00000276416;ENST00000520292	.|T;T	.|0.62498	.|0.02;0.02	5.94|5.94	5.94|5.94	0.96194|0.96194	.|BAR (3);	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.74038|0.74038	0.3664|0.3664	L|L	0.50333|0.50333	1.59|1.59	0.80722|0.80722	D|D	1|1	.|D	.|0.89917	.|1.0	.|D	.|0.74674	.|0.984	T|T	0.76383|0.76383	-0.2979|-0.2979	6|10	0.19590|0.87932	T|D	0.45|0	-19.3043|-19.3043	14.3499|14.3499	0.66694|0.66694	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	.|31	.|Q9NQY0	.|BIN3_HUMAN	I|H	4|31	.|ENSP00000276416:L31H;ENSP00000429660:L31H	ENSP00000382859:F4I|ENSP00000276416:L31H	F|L	-|-	1|2	0|0	BIN3|BIN3	22550386|22550386	1.000000|1.000000	0.71417|0.71417	0.999000|0.999000	0.59377|0.59377	0.989000|0.989000	0.77384|0.77384	7.932000|7.932000	0.87634|0.87634	2.279000|2.279000	0.76181|0.76181	0.459000|0.459000	0.35465|0.35465	TTC|CTT	A|0.999;G|0.001		0.547	BIN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000375895.1		
GPR124	25960	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	8	37702542	37702542	+	IGR	SNP	C	C	T			TCGA-OR-A5KX-01A-11D-A29I-10	TCGA-OR-A5KX-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8369398d-9d6a-48dd-b20d-4e699ceddc1b	4b83e274-a5a1-430f-8ea8-70a4a64581c9	g.chr8:37702542C>T	ENST00000412232.2	+	0	5651				BRF2_ENST00000520601.1_3'UTR|BRF2_ENST00000220659.6_Silent_p.R242R	NM_032777.9	NP_116166.9	Q96PE1	GP124_HUMAN	G protein-coupled receptor 124						central nervous system development (GO:0007417)|endothelial cell migration (GO:0043542)|G-protein coupled receptor signaling pathway (GO:0007186)|negative regulation of vascular endothelial growth factor signaling pathway (GO:1900747)|neuropeptide signaling pathway (GO:0007218)|positive regulation of endothelial cell migration (GO:0010595)|regulation of angiogenesis (GO:0045765)|regulation of chemotaxis (GO:0050920)|regulation of establishment of blood-brain barrier (GO:0090210)|sprouting angiogenesis (GO:0002040)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(4)|lung(16)|ovary(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	37			BRCA - Breast invasive adenocarcinoma(5;2.75e-24)|LUSC - Lung squamous cell carcinoma(8;3.5e-10)			AACATGAAAGCCGATCTGCAG	0.607																																					p.R242R		.											.	BRF2-90	0			c.G726A						.						31.0	33.0	32.0					8																	37702542		2203	4300	6503	SO:0001628	intergenic_variant	55290	exon4			TGAAAGCCGATCT	AB040964	CCDS6097.2	8p11.22	2014-08-08			ENSG00000020181	ENSG00000020181		"""-"", ""GPCR / Class B : Orphans"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	17849	protein-coding gene	gene with protein product	"""tumor endothelial marker 5"""	606823				11559528, 12565841	Standard	NM_032777		Approved	TEM5, DKFZp434C211, DKFZp434J0911, KIAA1531, FLJ14390	uc003xkj.3	Q96PE1	OTTHUMG00000156182		8.37:g.37702542C>T		Somatic	137	0		WXS	Illumina GAIIx	Phase_I	703	51	NM_018310	0	0	97	111	14	A6H8W3|D3DSW4|Q8N3R1|Q8TEM3|Q96KB2|Q9P1Z7|Q9UFY4	Silent	SNP	ENST00000412232.2	37	CCDS6097.2																																																																																			.		0.607	GPR124-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000343331.2		
PABPC1	26986	broad.mit.edu	37	8	101724606	101724606	+	Missense_Mutation	SNP	G	G	A	rs202060459		TCGA-OR-A5KX-01A-11D-A29I-10	TCGA-OR-A5KX-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8369398d-9d6a-48dd-b20d-4e699ceddc1b	4b83e274-a5a1-430f-8ea8-70a4a64581c9	g.chr8:101724606G>A	ENST00000318607.5	-	7	2084	c.956C>T	c.(955-957)aCa>aTa	p.T319I	PABPC1_ENST00000519596.1_5'UTR|PABPC1_ENST00000519004.1_Missense_Mutation_p.T274I|PABPC1_ENST00000522387.1_Missense_Mutation_p.T287I	NM_002568.3	NP_002559.2	P11940	PABP1_HUMAN	poly(A) binding protein, cytoplasmic 1	319	RRM 4. {ECO:0000255|PROSITE- ProRule:PRU00176}.				cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|gene silencing by RNA (GO:0031047)|mRNA metabolic process (GO:0016071)|mRNA polyadenylation (GO:0006378)|mRNA splicing, via spliceosome (GO:0000398)|mRNA stabilization (GO:0048255)|negative regulation of nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:2000623)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|positive regulation of nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:1900153)|positive regulation of nuclear-transcribed mRNA poly(A) tail shortening (GO:0060213)|positive regulation of translation (GO:0045727)|RNA metabolic process (GO:0016070)|translation (GO:0006412)|translational initiation (GO:0006413)	catalytic step 2 spliceosome (GO:0071013)|cytoplasm (GO:0005737)|cytoplasmic ribonucleoprotein granule (GO:0036464)|cytoplasmic stress granule (GO:0010494)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	nucleotide binding (GO:0000166)|poly(A) binding (GO:0008143)|poly(A) RNA binding (GO:0044822)|poly(U) RNA binding (GO:0008266)|protein C-terminus binding (GO:0008022)|translation activator activity (GO:0008494)	p.T319I(2)		breast(2)|endometrium(4)|kidney(15)|large_intestine(4)|lung(13)|prostate(1)|skin(1)	40	all_cancers(14;6.8e-05)|all_epithelial(15;3.16e-07)|Lung NSC(17;0.000453)|all_lung(17;0.00125)		Epithelial(11;6.37e-11)|all cancers(13;1.11e-08)|OV - Ovarian serous cystadenocarcinoma(57;3.91e-05)|STAD - Stomach adenocarcinoma(118;0.206)			ACTAGTGATTGTACCAAATGG	0.284																																					p.T319I		.											.	PABPC1-68	2	Substitution - Missense(2)	kidney(1)|endometrium(1)	c.C956T						.						154.0	166.0	162.0					8																	101724606		2203	4298	6501	SO:0001583	missense	26986	exon7			GTGATTGTACCAA	Y00345	CCDS6289.1	8q22.2-q23	2013-02-12	2004-04-20		ENSG00000070756	ENSG00000070756		"""RNA binding motif (RRM) containing"""	8554	protein-coding gene	gene with protein product		604679	"""poly(A)-binding protein, cytoplasmic 2"""	PAB1, PABPC2		2885805	Standard	XM_005250861		Approved	PABP1, PABPL1	uc003yjs.1	P11940	OTTHUMG00000164779	ENST00000318607.5:c.956C>T	8.37:g.101724606G>A	ENSP00000313007:p.Thr319Ile	Somatic	147	1		WXS	Illumina GAIIx	Phase_I	147	5	NM_002568	0	0	269	269	0	Q15097|Q93004	Missense_Mutation	SNP	ENST00000318607.5	37	CCDS6289.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	26.8|26.8	4.768189|4.768189	0.90020|0.90020	.|.	.|.	ENSG00000070756|ENSG00000070756	ENST00000519100|ENST00000318607;ENST00000347137;ENST00000519004;ENST00000522387	.|T;T;T	.|0.16196	.|2.36;2.36;2.36	5.65|5.65	5.65|5.65	0.86999|0.86999	.|Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (3);	.|0.000000	.|0.64402	.|D	.|0.000009	.|T	.|0.37652	.|0.1011	M|M	0.62154|0.62154	1.92|1.92	0.80722|0.80722	D|D	1|1	.|P;P;D	.|0.54964	.|0.917;0.784;0.969	.|P;B;P	.|0.56916	.|0.747;0.442;0.809	.|T	.|0.03784	.|-1.1004	.|10	.|0.87932	.|D	.|0	.|.	20.0919|20.0919	0.97823|0.97823	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|287;319;319	.|E7ERJ7;B3KT93;P11940	.|.;.;PABP1_HUMAN	X|I	188|319;319;274;287	.|ENSP00000313007:T319I;ENSP00000429594:T274I;ENSP00000429395:T287I	.|ENSP00000313007:T319I	Q|T	-|-	1|2	0|0	PABPC1|PABPC1	101793782|101793782	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.999000|0.999000	0.98932|0.98932	9.776000|9.776000	0.99001|0.99001	2.824000|2.824000	0.97209|0.97209	0.655000|0.655000	0.94253|0.94253	CAA|ACA	.		0.284	PABPC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380217.1	NM_002568	
MAL2	114569	hgsc.bcm.edu	37	8	120220776	120220776	+	Splice_Site	DEL	G	G	-	rs398009582|rs71302978		TCGA-OR-A5KX-01A-11D-A29I-10	TCGA-OR-A5KX-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8369398d-9d6a-48dd-b20d-4e699ceddc1b	4b83e274-a5a1-430f-8ea8-70a4a64581c9	g.chr8:120220776delG	ENST00000276681.6	+	1	167	c.65delG	c.(64-66)cgg>cg	p.R22fs	MAL2_ENST00000521748.1_3'UTR	NM_052886.2	NP_443118.1	Q969L2	MAL2_HUMAN	mal, T-cell differentiation protein 2 (gene/pseudogene)	22						cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)						all_cancers(13;1.91e-26)|Lung NSC(37;8.61e-08)|Ovarian(258;0.018)|Hepatocellular(40;0.161)		STAD - Stomach adenocarcinoma(47;0.000967)			CCGCCGCCCCGGGGTCACCCT	0.771													GGG|GGGG|GGG|insertion	5008	1.0	1.0	1.0	5008	,	,		6681	1.0		1.0	False		,,,				2504	1.0				.		.											.	.	0			c.64+1G>-						.			1571,11		785,1,5	1.0	1.0	1.0			0.7	0.8	8	dbSNP_130	1	4116,22		2057,2,10	no	frameshift	MAL2	NM_052886.2		2842,3,15	A1A1,A1R,RR		0.5317,0.6953,0.5769			120220776	5687,33	184	483	667	SO:0001630	splice_region_variant	114569	exon1			CGCCCCGGGGTCA	AL117612	CCDS75780.1	8q23	2011-01-26	2011-01-26			ENSG00000147676			13634	protein-coding gene	gene with protein product	"""MAL proteolipid protein 2"""	609684				11549320	Standard	NM_052886		Approved		uc003yop.3	Q969L2		ENST00000276681.6:c.66+1G>-	8.37:g.120220776delG		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	11	11	NM_052886	0	0	0	0	0	B2R520|Q6ZMD9	Splice_Site	DEL	ENST00000276681.6	37																																																																																				.		0.771	MAL2-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_052886	Frame_Shift_Del
ENPP2	5168	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	8	120581567	120581567	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5KX-01A-11D-A29I-10	TCGA-OR-A5KX-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8369398d-9d6a-48dd-b20d-4e699ceddc1b	4b83e274-a5a1-430f-8ea8-70a4a64581c9	g.chr8:120581567C>T	ENST00000075322.6	-	21	2019	c.1961G>A	c.(1960-1962)cGg>cAg	p.R654Q	ENPP2_ENST00000427067.2_Missense_Mutation_p.R675Q|ENPP2_ENST00000522826.1_Missense_Mutation_p.R679Q|ENPP2_ENST00000259486.6_Missense_Mutation_p.R706Q|ENPP2_ENST00000522167.1_Missense_Mutation_p.R289Q	NM_001040092.2	NP_001035181.1	Q13822	ENPP2_HUMAN	ectonucleotide pyrophosphatase/phosphodiesterase 2	654					cellular component movement (GO:0006928)|chemotaxis (GO:0006935)|G-protein coupled receptor signaling pathway (GO:0007186)|immune response (GO:0006955)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|phosphate-containing compound metabolic process (GO:0006796)|phosphatidylcholine catabolic process (GO:0034638)|phospholipid catabolic process (GO:0009395)|regulation of cell migration (GO:0030334)	extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	alkylglycerophosphoethanolamine phosphodiesterase activity (GO:0047391)|calcium ion binding (GO:0005509)|hydrolase activity (GO:0016787)|lysophospholipase activity (GO:0004622)|nucleic acid binding (GO:0003676)|nucleotide diphosphatase activity (GO:0004551)|phosphodiesterase I activity (GO:0004528)|polysaccharide binding (GO:0030247)|scavenger receptor activity (GO:0005044)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(15)|lung(30)|ovary(2)|prostate(2)|skin(4)|upper_aerodigestive_tract(4)	69	Lung NSC(37;5.03e-06)|Ovarian(258;0.0249)|Hepatocellular(40;0.161)		STAD - Stomach adenocarcinoma(47;0.00185)			GACATCAGGCCGGACGCAACT	0.512																																					p.R706Q	Melanoma(20;305 879 2501 4818 31020)	.											.	ENPP2-292	0			c.G2117A						.						125.0	113.0	117.0					8																	120581567		2203	4300	6503	SO:0001583	missense	5168	exon22			TCAGGCCGGACGC	D45421	CCDS6329.1, CCDS34936.1, CCDS47914.1	8q24.12	2014-04-09	2008-08-01		ENSG00000136960	ENSG00000136960	3.1.4.1, 3.6.1.9		3357	protein-coding gene	gene with protein product	"""autotaxin"""	601060		PDNP2		8586446	Standard	NM_001040092		Approved	ATX, PD-IALPHA	uc003yos.2	Q13822	OTTHUMG00000164995	ENST00000075322.6:c.1961G>A	8.37:g.120581567C>T	ENSP00000075322:p.Arg654Gln	Somatic	135	0		WXS	Illumina GAIIx	Phase_I	141	10	NM_006209	0	0	151	151	0	A8UHA1|E9PHP7|Q13827|Q14555|Q15117|Q9UCQ8|Q9UCR0|Q9UCR1|Q9UCR2|Q9UCR3|Q9UCR4	Missense_Mutation	SNP	ENST00000075322.6	37	CCDS34936.1	.	.	.	.	.	.	.	.	.	.	C	28.8	4.947462	0.92593	.	.	ENSG00000136960	ENST00000259486;ENST00000427067;ENST00000522167;ENST00000522826;ENST00000075322	T;T;T;T;T	0.66280	-0.2;-0.2;-0.2;-0.2;-0.2	5.36	5.36	0.76844	DNA/RNA non-specific endonuclease (2);Extracellular Endonuclease, subunit A (2);	0.000000	0.85682	D	0.000000	T	0.81673	0.4872	M	0.83223	2.63	0.80722	D	1	B;D;D;D;D	0.89917	0.1;1.0;1.0;1.0;1.0	B;D;D;D;D	0.91635	0.172;0.999;0.999;0.999;0.999	D	0.83591	0.0123	10	0.59425	D	0.04	.	19.1047	0.93290	0.0:1.0:0.0:0.0	.	192;679;654;706;289	B4DJD3;E9PHP7;Q13822;Q13822-2;E5RIA2	.;.;ENPP2_HUMAN;.;.	Q	706;675;289;679;654	ENSP00000259486:R706Q;ENSP00000403315:R675Q;ENSP00000429476:R289Q;ENSP00000428291:R679Q;ENSP00000075322:R654Q	ENSP00000075322:R654Q	R	-	2	0	ENPP2	120650748	0.999000	0.42202	0.991000	0.47740	0.725000	0.41563	5.450000	0.66626	2.515000	0.84797	0.650000	0.86243	CGG	.		0.512	ENPP2-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000381390.1		
GSDMC	56169	bcgsc.ca	37	8	130760774	130760774	+	Silent	SNP	C	C	T	rs4733559	byFrequency	TCGA-OR-A5KX-01A-11D-A29I-10	TCGA-OR-A5KX-10A-01D-A29L-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8369398d-9d6a-48dd-b20d-4e699ceddc1b	4b83e274-a5a1-430f-8ea8-70a4a64581c9	g.chr8:130760774C>T	ENST00000276708.4	-	14	2381	c.1500G>A	c.(1498-1500)tcG>tcA	p.S500S		NM_031415.2	NP_113603.1	Q9BYG8	GSDMC_HUMAN	gasdermin C	500						cytoplasm (GO:0005737)|microtubule organizing center (GO:0005815)|mitochondrion (GO:0005739)				autonomic_ganglia(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(5)|ovary(2)|pancreas(1)|skin(5)|stomach(2)|upper_aerodigestive_tract(1)	26						GCTGCAGCAACGAGAGAGTCC	0.582													C|||	516	0.103035	0.0121	0.2147	5008	,	,		14276	0.0218		0.2157	False		,,,				2504	0.1145				p.S500S		.											.	GSDMC-93	0			c.G1500A						.	C		202,4204	126.6+/-163.6	8,186,2009	129.0	123.0	125.0		1500	-9.5	0.0	8	dbSNP_111	125	1878,6722	334.5+/-321.0	212,1454,2634	no	coding-synonymous	GSDMC	NM_031415.2		220,1640,4643	TT,TC,CC		21.8372,4.5847,15.9926		500/509	130760774	2080,10926	2203	4300	6503	SO:0001819	synonymous_variant	56169	exon14			CAGCAACGAGAGA	AB042405	CCDS6360.1	8q24.21	2014-05-14	2008-07-31	2008-07-31	ENSG00000147697	ENSG00000147697			7151	protein-coding gene	gene with protein product		608384	"""melanoma-derived leucine zipper, extra-nuclear factor"""	MLZE		17350798	Standard	NM_031415		Approved		uc003ysr.3	Q9BYG8	OTTHUMG00000164851	ENST00000276708.4:c.1500G>A	8.37:g.130760774C>T		Somatic	202	0		WXS	Illumina GAIIx	Phase_I	163	7	NM_031415	0	0	0	0	0	Q5XKF3|Q6P494	Silent	SNP	ENST00000276708.4	37	CCDS6360.1																																																																																			C|0.868;T|0.132		0.582	GSDMC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380586.1		
SCRIB	23513	hgsc.bcm.edu	37	8	144874554	144874554	+	Silent	SNP	T	T	C	rs6991873	byFrequency	TCGA-OR-A5KX-01A-11D-A29I-10	TCGA-OR-A5KX-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8369398d-9d6a-48dd-b20d-4e699ceddc1b	4b83e274-a5a1-430f-8ea8-70a4a64581c9	g.chr8:144874554T>C	ENST00000320476.3	-	32	4356	c.4350A>G	c.(4348-4350)ccA>ccG	p.P1450P	RP11-429J17.8_ENST00000534089.1_RNA|RP11-429J17.8_ENST00000527139.1_RNA|RP11-429J17.8_ENST00000532625.1_RNA|SCRIB_ENST00000546337.1_5'Flank|SCRIB_ENST00000356994.2_Silent_p.P1450P|SCRIB_ENST00000377533.3_Silent_p.P1369P	NM_015356.4	NP_056171	Q14160	SCRIB_HUMAN	scribbled planar cell polarity protein	1450					activation of Rac GTPase activity (GO:0032863)|apoptotic process involved in morphogenesis (GO:0060561)|astrocyte cell migration (GO:0043615)|asymmetric protein localization (GO:0008105)|auditory receptor cell stereocilium organization (GO:0060088)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|cochlear nucleus development (GO:0021747)|establishment of apical/basal cell polarity (GO:0035089)|mammary gland duct morphogenesis (GO:0060603)|negative regulation of mitotic cell cycle (GO:0045930)|neural tube closure (GO:0001843)|positive chemotaxis (GO:0050918)|positive regulation of apoptotic process (GO:0043065)|positive regulation of receptor recycling (GO:0001921)|protein localization to adherens junction (GO:0071896)|single organismal cell-cell adhesion (GO:0016337)|synaptic vesicle endocytosis (GO:0048488)|synaptic vesicle targeting (GO:0016080)|viral process (GO:0016032)|wound healing (GO:0042060)	basolateral plasma membrane (GO:0016323)|cell projection (GO:0042995)|cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|extracellular vesicular exosome (GO:0070062)|myelin sheath abaxonal region (GO:0035748)|plasma membrane (GO:0005886)|Scrib-APC-beta-catenin complex (GO:0034750)				NS(1)|autonomic_ganglia(1)|central_nervous_system(2)|endometrium(3)|kidney(3)|large_intestine(3)|lung(20)|ovary(2)|pancreas(1)|skin(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	42	all_cancers(97;2.31e-11)|all_epithelial(106;1.58e-09)|Lung NSC(106;0.00013)|all_lung(105;0.000374)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;2.46e-41)|Epithelial(56;1.23e-39)|all cancers(56;1.12e-34)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.18)			CTCCCAGGGGTGGGGGGGACG	0.751													T|||	4958	0.990016	0.9652	0.9971	5008	,	,		8428	1.0		0.998	False		,,,				2504	1.0				p.P1450P	Pancreas(51;966 1133 10533 14576 29674)	.											.	SCRIB-228	0			c.A4350G						.	T	,	3300,62		1619,62,0	3.0	4.0	4.0		4350,4350	-2.9	0.0	8	dbSNP_116	4	7076,4		3536,4,0	no	coding-synonymous,coding-synonymous	SCRIB	NM_015356.3,NM_182706.3	,	5155,66,0	CC,CT,TT		0.0565,1.8441,0.6321	,	1450/1631,1450/1656	144874554	10376,66	1681	3540	5221	SO:0001819	synonymous_variant	23513	exon32			CAGGGGTGGGGGG	AY062238	CCDS6411.1, CCDS6412.1	8q24.3	2013-03-05	2013-03-05		ENSG00000180900	ENSG00000180900			30377	protein-coding gene	gene with protein product		607733	"""scribbled homolog (Drosophila)"""			11027293, 14681682	Standard	NM_182706		Approved	KIAA0147, SCRB1, Vartul	uc003yzo.1	Q14160	OTTHUMG00000165154	ENST00000320476.3:c.4350A>G	8.37:g.144874554T>C		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	4	4	NM_015356	0	0	0	13	13	Q6P496|Q7Z5D1|Q8WWV8|Q96C69|Q96GG1	Silent	SNP	ENST00000320476.3	37	CCDS6411.1	2162	0.98992673992674	472	0.959349593495935	361	0.9972375690607734	572	1.0	757	0.9986807387862797	T	5.986	0.365776	0.11352	0.981559	0.999435	ENSG00000180900	ENST00000526832	.	.	.	4.01	-2.89	0.05665	.	.	.	.	.	T	0.00012	0.0000	.	.	.	0.80722	P	0.0	.	.	.	.	.	.	T	0.20773	-1.0265	3	.	.	.	.	6.6143	0.22769	0.0:0.6476:0.1513:0.201	rs6991873	.	.	.	A	470	.	.	T	-	1	0	SCRIB	144946542	0.000000	0.05858	0.000000	0.03702	0.031000	0.12232	-0.411000	0.07142	-0.857000	0.04115	-0.386000	0.06593	ACC	T|0.010;C|0.990		0.751	SCRIB-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000382215.1	NM_015356	
PLEC	5339	hgsc.bcm.edu	37	8	144999417	144999417	+	Silent	SNP	C	C	T	rs55836855	byFrequency	TCGA-OR-A5KX-01A-11D-A29I-10	TCGA-OR-A5KX-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8369398d-9d6a-48dd-b20d-4e699ceddc1b	4b83e274-a5a1-430f-8ea8-70a4a64581c9	g.chr8:144999417C>T	ENST00000322810.4	-	31	5260	c.5091G>A	c.(5089-5091)gcG>gcA	p.A1697A	PLEC_ENST00000345136.3_Silent_p.A1560A|PLEC_ENST00000398774.2_Silent_p.A1528A|PLEC_ENST00000354958.2_Silent_p.A1538A|PLEC_ENST00000436759.2_Silent_p.A1587A|PLEC_ENST00000356346.3_Silent_p.A1546A|PLEC_ENST00000527096.1_Silent_p.A1583A|PLEC_ENST00000354589.3_Silent_p.A1560A|PLEC_ENST00000357649.2_Silent_p.A1564A	NM_201380.2	NP_958782.1	Q15149	PLEC_HUMAN	plectin	1697	Central fibrous rod domain.				apoptotic process (GO:0006915)|cell junction assembly (GO:0034329)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)	costamere (GO:0043034)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|hemidesmosome (GO:0030056)|intermediate filament cytoskeleton (GO:0045111)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|sarcoplasm (GO:0016528)	ankyrin binding (GO:0030506)|poly(A) RNA binding (GO:0044822)|structural constituent of muscle (GO:0008307)			NS(1)|breast(3)|central_nervous_system(4)|cervix(7)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(8)|lung(57)|ovary(4)|pancreas(2)|prostate(11)|skin(9)|stomach(2)|upper_aerodigestive_tract(10)	137						GTACCTGCCGCGCTCGCTCCA	0.741													C|||	1156	0.230831	0.028	0.2954	5008	,	,		8861	0.1429		0.4274	False		,,,				2504	0.3476				p.A1697A		.											.	PLEC-141	0			c.G5091A						.	C	,,,,,,,	258,3112		16,226,1443	6.0	7.0	7.0		4761,4638,4614,5091,4584,4680,4692,4680	-9.4	0.1	8	dbSNP_129	7	2520,4470		444,1632,1419	no	coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous	PLEC	NM_000445.3,NM_201378.2,NM_201379.1,NM_201380.2,NM_201381.1,NM_201382.2,NM_201383.1,NM_201384.1	,,,,,,,	460,1858,2862	TT,TC,CC		36.0515,7.6558,26.8147	,,,,,,,	1587/4575,1546/4534,1538/4526,1697/4685,1528/4516,1560/4548,1564/4552,1560/4548	144999417	2778,7582	1685	3495	5180	SO:0001819	synonymous_variant	5339	exon31			CTGCCGCGCTCGC	U53204	CCDS43769.1, CCDS43770.1, CCDS43771.1, CCDS43772.1, CCDS43773.1, CCDS43774.1, CCDS43775.1, CCDS47936.1	8q24	2010-02-04	2010-02-04	2010-02-04	ENSG00000178209	ENSG00000178209			9069	protein-coding gene	gene with protein product		601282	"""plectin 1, intermediate filament binding protein, 500kD"", ""epidermolysis bullosa simplex 1 (Ogna)"", ""plectin 1, intermediate filament binding protein 500kDa"""	EBS1, PLEC1		8633055, 8696340	Standard	XM_005250976		Approved	PCN, PLTN	uc003zaf.1	Q15149	OTTHUMG00000165291	ENST00000322810.4:c.5091G>A	8.37:g.144999417C>T		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	5	5	NM_201380	0	0	0	0	0	Q15148|Q16640|Q6S376|Q6S377|Q6S378|Q6S379|Q6S380|Q6S381|Q6S382|Q6S383	Silent	SNP	ENST00000322810.4	37	CCDS43772.1																																																																																			C|0.731;T|0.269		0.741	PLEC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383281.1	NM_000445	
UNC13B	10497	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	35375173	35375173	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5KX-01A-11D-A29I-10	TCGA-OR-A5KX-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8369398d-9d6a-48dd-b20d-4e699ceddc1b	4b83e274-a5a1-430f-8ea8-70a4a64581c9	g.chr9:35375173G>A	ENST00000378495.3	+	13	1565	c.1343G>A	c.(1342-1344)cGc>cAc	p.R448H	UNC13B_ENST00000396787.1_Missense_Mutation_p.R460H|UNC13B_ENST00000378496.4_Missense_Mutation_p.R448H	NM_006377.3	NP_006368.3	O14795	UN13B_HUMAN	unc-13 homolog B (C. elegans)	448					apoptotic process (GO:0006915)|excretion (GO:0007588)|innervation (GO:0060384)|intracellular signal transduction (GO:0035556)|neuromuscular junction development (GO:0007528)|positive regulation of inhibitory postsynaptic membrane potential (GO:0097151)|positive regulation of synaptic vesicle priming (GO:0010808)|regulation of short-term neuronal synaptic plasticity (GO:0048172)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|synaptic vesicle docking involved in exocytosis (GO:0016081)|synaptic vesicle priming (GO:0016082)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|neuromuscular junction (GO:0031594)|plasma membrane (GO:0005886)|presynaptic active zone (GO:0048786)|terminal bouton (GO:0043195)	diacylglycerol binding (GO:0019992)|metal ion binding (GO:0046872)|receptor activity (GO:0004872)|signal transducer activity (GO:0004871)			breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(16)|liver(2)|lung(17)|ovary(3)|pancreas(1)|prostate(3)|skin(6)|upper_aerodigestive_tract(3)|urinary_tract(1)	63	all_epithelial(49;0.212)		LUSC - Lung squamous cell carcinoma(32;0.00343)|Lung(28;0.00778)|STAD - Stomach adenocarcinoma(86;0.194)			ATGGCTACACGCACTTCTCTT	0.512																																					p.R448H		.											.	UNC13B-157	0			c.G1343A						.						229.0	202.0	211.0					9																	35375173		2203	4300	6503	SO:0001583	missense	10497	exon13			CTACACGCACTTC	AF020202	CCDS6579.1	9p13.3	2008-05-15	2003-10-17	2003-10-17	ENSG00000198722	ENSG00000198722			12566	protein-coding gene	gene with protein product		605836	"""unc-13-like (C. elegans)"""	UNC13		9607201	Standard	NM_006377		Approved	hmunc13, Unc13h2	uc003zwq.3	O14795	OTTHUMG00000019856	ENST00000378495.3:c.1343G>A	9.37:g.35375173G>A	ENSP00000367756:p.Arg448His	Somatic	222	0		WXS	Illumina GAIIx	Phase_I	187	82	NM_006377	0	0	1	2	1	Q5VYM8	Missense_Mutation	SNP	ENST00000378495.3	37	CCDS6579.1	.	.	.	.	.	.	.	.	.	.	G	34	5.295038	0.95574	.	.	ENSG00000198722	ENST00000396787;ENST00000378495;ENST00000378496;ENST00000535471	T;T;T	0.62788	0.0;0.0;0.0	5.81	5.81	0.92471	.	0.000000	0.85682	D	0.000000	T	0.78916	0.4359	M	0.62088	1.915	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.83275	0.996;0.994	T	0.79361	-0.1835	10	0.87932	D	0	-13.4584	20.0749	0.97738	0.0:0.0:1.0:0.0	.	448;448	F8W8M9;O14795	.;UN13B_HUMAN	H	460;448;448;35	ENSP00000380006:R460H;ENSP00000367756:R448H;ENSP00000367757:R448H	ENSP00000367756:R448H	R	+	2	0	UNC13B	35365173	1.000000	0.71417	0.995000	0.50966	0.918000	0.54935	6.272000	0.72575	2.759000	0.94783	0.591000	0.81541	CGC	.		0.512	UNC13B-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000052296.1	NM_006377	
TGFBR1	7046	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	101894969	101894969	+	Silent	SNP	T	T	A			TCGA-OR-A5KX-01A-11D-A29I-10	TCGA-OR-A5KX-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8369398d-9d6a-48dd-b20d-4e699ceddc1b	4b83e274-a5a1-430f-8ea8-70a4a64581c9	g.chr9:101894969T>A	ENST00000374994.4	+	3	639	c.522T>A	c.(520-522)ggT>ggA	p.G174G	TGFBR1_ENST00000374990.2_Intron|TGFBR1_ENST00000550253.1_Silent_p.G105G|TGFBR1_ENST00000552516.1_Silent_p.G178G	NM_004612.2	NP_004603.1	P36897	TGFR1_HUMAN	transforming growth factor, beta receptor 1	174					activation of MAPKK activity (GO:0000186)|angiogenesis (GO:0001525)|anterior/posterior pattern specification (GO:0009952)|apoptotic process (GO:0006915)|artery morphogenesis (GO:0048844)|blastocyst development (GO:0001824)|cell cycle arrest (GO:0007050)|cell motility (GO:0048870)|cellular response to transforming growth factor beta stimulus (GO:0071560)|collagen fibril organization (GO:0030199)|embryonic cranial skeleton morphogenesis (GO:0048701)|endothelial cell migration (GO:0043542)|epithelial to mesenchymal transition (GO:0001837)|extracellular structure organization (GO:0043062)|germ cell migration (GO:0008354)|heart development (GO:0007507)|in utero embryonic development (GO:0001701)|kidney development (GO:0001822)|lens development in camera-type eye (GO:0002088)|mesenchymal cell differentiation (GO:0048762)|negative regulation of apoptotic process (GO:0043066)|negative regulation of chondrocyte differentiation (GO:0032331)|negative regulation of endothelial cell proliferation (GO:0001937)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron fate commitment (GO:0048663)|palate development (GO:0060021)|parathyroid gland development (GO:0060017)|pathway-restricted SMAD protein phosphorylation (GO:0060389)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|pharyngeal system development (GO:0060037)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of cell growth (GO:0030307)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cellular component movement (GO:0051272)|positive regulation of filopodium assembly (GO:0051491)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of SMAD protein import into nucleus (GO:0060391)|positive regulation of transcription, DNA-templated (GO:0045893)|post-embryonic development (GO:0009791)|protein phosphorylation (GO:0006468)|regulation of protein binding (GO:0043393)|regulation of protein ubiquitination (GO:0031396)|regulation of transcription, DNA-templated (GO:0006355)|response to cholesterol (GO:0070723)|signal transduction (GO:0007165)|skeletal system development (GO:0001501)|skeletal system morphogenesis (GO:0048705)|thymus development (GO:0048538)|transforming growth factor beta receptor signaling pathway (GO:0007179)|wound healing (GO:0042060)	endosome (GO:0005768)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|tight junction (GO:0005923)|transforming growth factor beta receptor homodimeric complex (GO:0070022)	ATP binding (GO:0005524)|I-SMAD binding (GO:0070411)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|receptor signaling protein serine/threonine kinase activity (GO:0004702)|SMAD binding (GO:0046332)|transforming growth factor beta binding (GO:0050431)|transforming growth factor beta receptor activity, type I (GO:0005025)|transforming growth factor beta-activated receptor activity (GO:0005024)|type II transforming growth factor beta receptor binding (GO:0005114)			endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(10)|liver(1)|lung(7)|ovary(1)|prostate(1)|skin(1)	27		Acute lymphoblastic leukemia(62;0.0559)				TTTCAGAGGGTACTACGTTGA	0.383																																					p.G174G		.											.	TGFBR1-954	0			c.T522A						.						119.0	104.0	109.0					9																	101894969		2203	4300	6503	SO:0001819	synonymous_variant	7046	exon3			AGAGGGTACTACG		CCDS6738.1, CCDS47998.1	9q22	2014-01-30	2008-07-31		ENSG00000106799	ENSG00000106799			11772	protein-coding gene	gene with protein product	"""activin A receptor type II-like kinase, 53kDa"""	190181	"""transforming growth factor, beta receptor I (activin A receptor type II-like kinase, 53kD)"", ""multiple self-healing squamous epithelioma"""	MSSE, ESS1		1319842, 8530052, 21358634	Standard	NM_001130916		Approved	ALK-5, ACVRLK4	uc004azc.3	P36897	OTTHUMG00000020353	ENST00000374994.4:c.522T>A	9.37:g.101894969T>A		Somatic	146	1		WXS	Illumina GAIIx	Phase_I	122	46	NM_004612	0	0	0	0	0	Q6IR47|Q706C0|Q706C1	Silent	SNP	ENST00000374994.4	37	CCDS6738.1																																																																																			.		0.383	TGFBR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053390.3		
NOXA1	10811	hgsc.bcm.edu	37	9	140317999	140317999	+	Missense_Mutation	SNP	C	C	G	rs112864733	byFrequency	TCGA-OR-A5KX-01A-11D-A29I-10	TCGA-OR-A5KX-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8369398d-9d6a-48dd-b20d-4e699ceddc1b	4b83e274-a5a1-430f-8ea8-70a4a64581c9	g.chr9:140317999C>G	ENST00000341349.2	+	1	198	c.18C>G	c.(16-18)gaC>gaG	p.D6E	EXD3_ENST00000340951.4_5'Flank|EXD3_ENST00000475006.1_5'Flank|EXD3_ENST00000479452.1_5'Flank|snoU13_ENST00000606918.1_RNA|EXD3_ENST00000465160.2_5'Flank|EXD3_ENST00000342129.4_5'Flank|NOXA1_ENST00000392815.2_Missense_Mutation_p.D6E	NM_001256067.1|NM_006647.1	NP_001242996.1|NP_006638.1	Q86UR1	NOXA1_HUMAN	NADPH oxidase activator 1	6	Mediates interaction with RAC1.				positive regulation of catalytic activity (GO:0043085)|regulation of hydrogen peroxide metabolic process (GO:0010310)|regulation of respiratory burst (GO:0060263)|superoxide metabolic process (GO:0006801)	cytoplasm (GO:0005737)|NADPH oxidase complex (GO:0043020)	enzyme binding (GO:0019899)|Rac GTPase binding (GO:0048365)|SH3 domain binding (GO:0017124)|superoxide-generating NADPH oxidase activator activity (GO:0016176)			cervix(1)|large_intestine(2)|lung(2)|skin(3)|upper_aerodigestive_tract(1)	9	all_cancers(76;0.0926)			OV - Ovarian serous cystadenocarcinoma(145;0.000238)|Epithelial(140;0.000982)		CTCTGGGGGACCTGGTGCGCG	0.811													c|||	278	0.0555112	0.0401	0.049	5008	,	,		6061	0.005		0.1213	False		,,,				2504	0.0654				p.D6E		.											.	NOXA1-90	0			c.C18G						.		GLU/ASP	116,3312		1,114,1599	4.0	5.0	5.0		18	-2.8	0.8	9	dbSNP_132	5	595,6781		18,559,3111	no	missense	NOXA1	NM_006647.1	45	19,673,4710	GG,GC,CC		8.0667,3.3839,6.5809	probably-damaging	6/484	140317999	711,10093	1714	3688	5402	SO:0001583	missense	10811	exon1			GGGGGACCTGGTG	AF039697	CCDS7042.1, CCDS59157.1	9q34.3	2013-09-20	2002-12-09	2002-12-13	ENSG00000188747	ENSG00000188747			10668	protein-coding gene	gene with protein product		611255	"""serologically defined colon cancer antigen 31"""	SDCCAG31		9610721	Standard	NM_001256067		Approved	NY-CO-31, FLJ25475	uc004cmu.3	Q86UR1	OTTHUMG00000131781	ENST00000341349.2:c.18C>G	9.37:g.140317999C>G	ENSP00000342848:p.Asp6Glu	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	8	4	NM_006647	0	0	0	0	0	O60533|Q29VU9|Q29VV0|Q2TAM1|Q8IUS3	Missense_Mutation	SNP	ENST00000341349.2	37	CCDS7042.1	143	0.06547619047619048	20	0.04065040650406504	22	0.06077348066298342	4	0.006993006993006993	97	0.1279683377308707	c	14.61	2.587081	0.46110	0.033839	0.080667	ENSG00000188747	ENST00000341349;ENST00000392815	D;D	0.86627	-1.91;-2.15	4.24	-2.81	0.05805	.	0.176261	0.47455	D	0.000234	T	0.02230	0.0069	L	0.27053	0.805	0.58432	P	2.9999999999752447E-6	P;B;B	0.48230	0.907;0.24;0.201	P;B;B	0.48795	0.59;0.05;0.094	T	0.64118	-0.6482	9	0.02654	T	1	.	5.957	0.19279	0.0:0.3375:0.4365:0.2261	.	6;6;6	Q86UR1-3;Q86UR1;Q86UR1-2	.;NOXA1_HUMAN;.	E	6	ENSP00000342848:D6E;ENSP00000376562:D6E	ENSP00000342848:D6E	D	+	3	2	NOXA1	139437820	0.486000	0.25980	0.844000	0.33320	0.587000	0.36485	-0.046000	0.11983	-0.407000	0.07576	0.387000	0.25754	GAC	C|0.934;G|0.066		0.811	NOXA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254713.1		
SPIN2B	474343	hgsc.bcm.edu;bcgsc.ca	37	X	57146333	57146333	+	Missense_Mutation	SNP	C	C	G			TCGA-OR-A5KX-01A-11D-A29I-10	TCGA-OR-A5KX-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8369398d-9d6a-48dd-b20d-4e699ceddc1b	4b83e274-a5a1-430f-8ea8-70a4a64581c9	g.chrX:57146333C>G	ENST00000333933.3	-	2	1040	c.730G>C	c.(730-732)Gat>Cat	p.D244H	SPIN2B_ENST00000460948.1_Intron|SPIN2B_ENST00000275988.5_Missense_Mutation_p.D244H|RP3-323P24.3_ENST00000439622.1_RNA|SPIN2B_ENST00000374912.5_Missense_Mutation_p.D244H|SPIN2B_ENST00000374910.3_Missense_Mutation_p.D143H	NM_001006681.1	NP_001006682.1	Q9BPZ2	SPI2B_HUMAN	spindlin family, member 2B	244					apoptotic process (GO:0006915)|cell cycle (GO:0007049)|gamete generation (GO:0007276)|regulation of cell cycle (GO:0051726)	nucleus (GO:0005634)				endometrium(3)|large_intestine(1)|skin(1)	5						AAATCATCATCAAACTTGATG	0.383																																					p.D244H		.											.	SPIN2B-90	0			c.G730C						.						98.0	84.0	88.0					X																	57146333		2203	4299	6502	SO:0001583	missense	474343	exon2			CATCATCAAACTT	AF356353	CCDS35311.1, CCDS65274.1	Xp11.1	2014-02-12	2006-12-05		ENSG00000186787	ENSG00000186787			33147	protein-coding gene	gene with protein product		300517				12145692	Standard	XM_005262010		Approved	SPIN-2	uc004dva.3	Q9BPZ2	OTTHUMG00000021680	ENST00000333933.3:c.730G>C	X.37:g.57146333C>G	ENSP00000335008:p.Asp244His	Somatic	1499	2		WXS	Illumina GAIIx	Phase_I	1390	416	NM_001006683	0	0	4	4	0	Q7Z2M0	Missense_Mutation	SNP	ENST00000333933.3	37	CCDS35311.1	.	.	.	.	.	.	.	.	.	.	.	13.29	2.194121	0.38707	.	.	ENSG00000186787	ENST00000275988;ENST00000374912;ENST00000374910;ENST00000333933;ENST00000434397	T;T;T;T;T	0.53206	0.63;0.63;0.63;0.63;0.63	2.61	2.61	0.31194	.	0.068006	0.56097	D	0.000037	T	0.51618	0.1685	L	0.60455	1.87	0.48696	D	0.999691	P	0.38788	0.647	P	0.49502	0.613	T	0.48293	-0.9048	10	0.30854	T	0.27	-6.8253	10.5947	0.45329	0.0:1.0:0.0:0.0	.	244	Q9BPZ2	SPI2B_HUMAN	H	244;244;143;244;244	ENSP00000275988:D244H;ENSP00000364047:D244H;ENSP00000364045:D143H;ENSP00000335008:D244H;ENSP00000404314:D244H	ENSP00000275988:D244H	D	-	1	0	SPIN2B	57163058	1.000000	0.71417	1.000000	0.80357	0.602000	0.36980	6.363000	0.73082	1.612000	0.50221	0.171000	0.16805	GAT	.		0.383	SPIN2B-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056912.1	NM_001006681	
ZXDB	158586	hgsc.bcm.edu;broad.mit.edu;mdanderson.org	37	X	57619015	57619015	+	Silent	SNP	G	G	A			TCGA-OR-A5KX-01A-11D-A29I-10	TCGA-OR-A5KX-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8369398d-9d6a-48dd-b20d-4e699ceddc1b	4b83e274-a5a1-430f-8ea8-70a4a64581c9	g.chrX:57619015G>A	ENST00000374888.1	+	1	747	c.534G>A	c.(532-534)ttG>ttA	p.L178L		NM_007157.3	NP_009088.1	P98169	ZXDB_HUMAN	zinc finger, X-linked, duplicated B	178					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)			NS(1)|central_nervous_system(2)|endometrium(5)|kidney(1)|large_intestine(1)|lung(7)|ovary(2)|prostate(2)|skin(6)	27						ACCTGCTGTTGCGCTTTGAGA	0.731																																					p.L178L		.											.	ZXDB-130	0			c.G534A						.						9.0	12.0	11.0					X																	57619015		2155	4160	6315	SO:0001819	synonymous_variant	158586	exon1			GCTGTTGCGCTTT	L14788	CCDS35313.1	Xp11.1	2013-01-08			ENSG00000198455	ENSG00000198455		"""Zinc fingers, C2H2-type"""	13199	protein-coding gene	gene with protein product		300236				8268913	Standard	NM_007157		Approved	ZNF905	uc004dvd.3	P98169	OTTHUMG00000021685	ENST00000374888.1:c.534G>A	X.37:g.57619015G>A		Somatic	75	0		WXS	Illumina GAIIx	Phase_I	119	38	NM_007157	0	0	0	0	0	A8K151|Q9UBB3	Silent	SNP	ENST00000374888.1	37	CCDS35313.1																																																																																			.		0.731	ZXDB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056922.1	NM_007157	
HEPH	9843	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	X	65423292	65423292	+	Nonsense_Mutation	SNP	C	C	T	rs372982785		TCGA-OR-A5KX-01A-11D-A29I-10	TCGA-OR-A5KX-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8369398d-9d6a-48dd-b20d-4e699ceddc1b	4b83e274-a5a1-430f-8ea8-70a4a64581c9	g.chrX:65423292C>T	ENST00000343002.2	+	12	2828	c.2164C>T	c.(2164-2166)Caa>Taa	p.Q722*	HEPH_ENST00000441993.2_Nonsense_Mutation_p.Q725*|HEPH_ENST00000519389.1_Nonsense_Mutation_p.Q776*|HEPH_ENST00000374727.3_Nonsense_Mutation_p.Q725*|HEPH_ENST00000336279.5_Nonsense_Mutation_p.Q455*|HEPH_ENST00000419594.1_Nonsense_Mutation_p.Q533*			Q9BQS7	HEPH_HUMAN	hephaestin	722					cellular iron ion homeostasis (GO:0006879)|copper ion transport (GO:0006825)|iron ion transport (GO:0006826)|transmembrane transport (GO:0055085)	basolateral plasma membrane (GO:0016323)|integral component of membrane (GO:0016021)|intracellular (GO:0005622)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	copper ion binding (GO:0005507)|ferrous iron binding (GO:0008198)|ferroxidase activity (GO:0004322)			endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(5)|lung(56)|ovary(5)|prostate(1)|skin(8)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	89						TCCTGGCCACCAAGCCACCCC	0.537																																					p.Q776X		.											.	HEPH-135	0			c.C2326T						.						89.0	70.0	76.0					X																	65423292		2203	4300	6503	SO:0001587	stop_gained	9843	exon13			GGCCACCAAGCCA	AB014598	CCDS14384.2, CCDS14385.1, CCDS48133.1, CCDS14384.3, CCDS65277.1	Xq11-q12	2008-02-05			ENSG00000089472	ENSG00000089472			4866	protein-coding gene	gene with protein product		300167				9988272, 9734811	Standard	NM_014799		Approved	KIAA0698, CPL	uc011moz.2	Q9BQS7	OTTHUMG00000021732	ENST00000343002.2:c.2164C>T	X.37:g.65423292C>T	ENSP00000343939:p.Gln722*	Somatic	219	0		WXS	Illumina GAIIx	Phase_I	237	12	NM_138737	0	0	0	0	0	B1AJX8|D3DVT7|E9PHN8|O75180|Q6UW45|Q9C058	Nonsense_Mutation	SNP	ENST00000343002.2	37		.	.	.	.	.	.	.	.	.	.	C	18.47	3.631175	0.67015	.	.	ENSG00000089472	ENST00000519389;ENST00000374727;ENST00000336279;ENST00000441993;ENST00000419594;ENST00000343002;ENST00000425114	.	.	.	4.58	1.5	0.22942	.	1.361120	0.04383	N	0.361100	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.06236	T	0.91	.	6.7643	0.23558	0.5001:0.3389:0.161:0.0	.	.	.	.	X	776;725;455;725;533;722;679	.	ENSP00000337418:Q455X	Q	+	1	0	HEPH	65340017	0.000000	0.05858	0.006000	0.13384	0.137000	0.21094	0.049000	0.14099	0.437000	0.26423	-0.222000	0.12452	CAA	.		0.537	HEPH-002	KNOWN	alternative_5_UTR|basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000056995.1	NM_138737	
GUCY2F	2986	broad.mit.edu;bcgsc.ca	37	X	108635183	108635183	+	Missense_Mutation	SNP	T	T	A			TCGA-OR-A5KX-01A-11D-A29I-10	TCGA-OR-A5KX-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8369398d-9d6a-48dd-b20d-4e699ceddc1b	4b83e274-a5a1-430f-8ea8-70a4a64581c9	g.chrX:108635183T>A	ENST00000218006.2	-	14	3029	c.2738A>T	c.(2737-2739)tAc>tTc	p.Y913F		NM_001522.2	NP_001513.2	P51841	GUC2F_HUMAN	guanylate cyclase 2F, retinal	913	Guanylate cyclase. {ECO:0000255|PROSITE- ProRule:PRU00099}.				intracellular signal transduction (GO:0035556)|phototransduction, visible light (GO:0007603)|receptor guanylyl cyclase signaling pathway (GO:0007168)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|rhodopsin mediated signaling pathway (GO:0016056)|visual perception (GO:0007601)	integral component of plasma membrane (GO:0005887)|nuclear outer membrane (GO:0005640)|photoreceptor disc membrane (GO:0097381)	ATP binding (GO:0005524)|GTP binding (GO:0005525)|guanylate cyclase activity (GO:0004383)|protein kinase activity (GO:0004672)|receptor activity (GO:0004872)			breast(3)|central_nervous_system(2)|endometrium(5)|kidney(6)|large_intestine(14)|lung(33)|prostate(3)|skin(1)	67						AAAGAGTGTGTACAGGTCATT	0.413																																					p.Y913F		.											.	GUCY2F-540	0			c.A2738T						.						112.0	92.0	99.0					X																	108635183		2203	4300	6503	SO:0001583	missense	2986	exon14			AGTGTGTACAGGT	L37378	CCDS14545.1	Xq22	2008-08-01			ENSG00000101890	ENSG00000101890			4691	protein-coding gene	gene with protein product	"""guanylate cyclase 2D-like, membrane (retina-specific)"""	300041				8838319, 7777544	Standard	NM_001522		Approved	GUC2DL, GC-F, RetGC-2, ROS-GC2, CYGF	uc004eod.4	P51841	OTTHUMG00000022184	ENST00000218006.2:c.2738A>T	X.37:g.108635183T>A	ENSP00000218006:p.Tyr913Phe	Somatic	474	1		WXS	Illumina GAIIx	Phase_I	489	23	NM_001522	0	0	0	0	0	Q9UJF1	Missense_Mutation	SNP	ENST00000218006.2	37	CCDS14545.1	.	.	.	.	.	.	.	.	.	.	T	17.74	3.463646	0.63513	.	.	ENSG00000101890	ENST00000218006	D	0.82711	-1.64	4.33	3.16	0.36331	Adenylyl cyclase class-3/4/guanylyl cyclase (5);	0.063406	0.64402	D	0.000004	D	0.85137	0.5628	L	0.42245	1.32	0.51482	D	0.999925	D	0.89917	1.0	D	0.91635	0.999	T	0.83216	-0.0071	10	0.54805	T	0.06	.	7.1745	0.25736	0.0:0.1102:0.0:0.8898	.	913	P51841	GUC2F_HUMAN	F	913	ENSP00000218006:Y913F	ENSP00000218006:Y913F	Y	-	2	0	GUCY2F	108521839	1.000000	0.71417	0.992000	0.48379	0.693000	0.40251	6.092000	0.71414	0.786000	0.33708	0.486000	0.48141	TAC	.		0.413	GUCY2F-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057884.1	NM_001522	
RBMXL3	139804	broad.mit.edu	37	X	114426385	114426385	+	Missense_Mutation	SNP	G	G	A	rs80194951		TCGA-OR-A5KX-01A-11D-A29I-10	TCGA-OR-A5KX-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8369398d-9d6a-48dd-b20d-4e699ceddc1b	4b83e274-a5a1-430f-8ea8-70a4a64581c9	g.chrX:114426385G>A	ENST00000424776.3	+	1	2423	c.2381G>A	c.(2380-2382)cGc>cAc	p.R794H	LRCH2_ENST00000317135.8_Intron|LRCH2_ENST00000538422.1_Intron	NM_001145346.1	NP_001138818.1	Q8N7X1	RMXL3_HUMAN	RNA binding motif protein, X-linked-like 3	794	Gly-rich.			R -> H (in Ref. 1; AK097568). {ECO:0000305}.			nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			endometrium(13)|kidney(2)|skin(1)	16						AGCGGAGGCCGCTCACCCAAT	0.662													G|||	220	0.0582781	0.0038	0.0533	3775	,	,		13082	0.002		0.1123	False		,,,				2504	0.0644				p.R794H		.											.	.	0			c.G2381A						.	G	HIS/ARG,	34,1175		1,25,7,491,168	30.0	32.0	32.0		2381,	0.9	0.0	X	dbSNP_131	32	387,2004		18,212,139,570,652	yes	missense,intron	LRCH2,RBMXL3	NM_001145346.1,NM_020871.3	29,	19,237,146,1061,820	AA,AG,A,GG,G		16.1857,2.8122,11.6944	possibly-damaging,	794/1068,	114426385	421,3179	692	1591	2283	SO:0001583	missense	139804	exon1			GAGGCCGCTCACC	AK097568	CCDS55478.1	Xq23	2013-02-12	2009-03-24	2009-03-24	ENSG00000175718	ENSG00000175718		"""RNA binding motif (RRM) containing"""	26859	protein-coding gene	gene with protein product			"""chromosome X open reading frame 55"""	CXorf55			Standard	NM_001145346		Approved	FLJ40249	uc011mte.1	Q8N7X1	OTTHUMG00000022230	ENST00000424776.3:c.2381G>A	X.37:g.114426385G>A	ENSP00000417451:p.Arg794His	Somatic	301	0		WXS	Illumina GAIIx	Phase_I	300	6	NM_001145346	0	0	0	0	0	B4DXC0	Missense_Mutation	SNP	ENST00000424776.3	37	CCDS55478.1	117	0.0705244122965642	3	0.006122448979591836	20	0.056179775280898875	2	0.0034965034965034965	53	0.07703488372093023	G	14.93	2.683230	0.47991	0.028122	0.161857	ENSG00000175718	ENST00000424776	T	0.05996	3.36	0.92	0.92	0.19397	.	.	.	.	.	T	0.00039	0.0001	N	0.08118	0	0.45567	P	0.0014840000000000408	D	0.56521	0.976	P	0.46629	0.522	T	0.49844	-0.8896	8	0.87932	D	0	.	7.6329	0.28249	1.0E-4:0.0:0.9999:0.0	.	794	Q8N7X1	RMXL3_HUMAN	H	794	ENSP00000417451:R794H	ENSP00000417451:R794H	R	+	2	0	RBMXL3	114332641	0.003000	0.15002	0.013000	0.15412	0.014000	0.08584	0.066000	0.14489	0.179000	0.19938	0.181000	0.17075	CGC	G|0.928;A|0.072		0.662	RBMXL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057968.3	NM_001145346	
FRMD7	90167	broad.mit.edu;bcgsc.ca	37	X	131216403	131216403	+	Missense_Mutation	SNP	C	C	G			TCGA-OR-A5KX-01A-11D-A29I-10	TCGA-OR-A5KX-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8369398d-9d6a-48dd-b20d-4e699ceddc1b	4b83e274-a5a1-430f-8ea8-70a4a64581c9	g.chrX:131216403C>G	ENST00000298542.4	-	9	1068	c.893G>C	c.(892-894)aGt>aCt	p.S298T	FRMD7_ENST00000464296.1_Missense_Mutation_p.S283T|FRMD7_ENST00000370879.1_Missense_Mutation_p.S178T	NM_194277.2	NP_919253.1	Q6ZUT3	FRMD7_HUMAN	FERM domain containing 7	298					regulation of neuron projection development (GO:0010975)	cytoskeleton (GO:0005856)|extracellular space (GO:0005615)|growth cone (GO:0030426)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)				breast(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(12)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)	24	Acute lymphoblastic leukemia(192;0.000127)					ATAGCGGAAACTGGAACCCTT	0.448																																					p.S298T		.											.	FRMD7-228	0			c.G893C						.						297.0	291.0	293.0					X																	131216403		2203	4300	6503	SO:0001583	missense	90167	exon9			CGGAAACTGGAAC	AL161984	CCDS35397.1	Xq26.2	2014-09-17	2006-09-01	2006-09-01	ENSG00000165694	ENSG00000165694			8079	protein-coding gene	gene with protein product		300628	"""nystagmus 1, congenital"""	NYS, NYS1		2063919, 17013395	Standard	NM_194277		Approved	FLJ43346	uc004ewn.3	Q6ZUT3	OTTHUMG00000022421	ENST00000298542.4:c.893G>C	X.37:g.131216403C>G	ENSP00000298542:p.Ser298Thr	Somatic	183	0		WXS	Illumina GAIIx	Phase_I	196	8	NM_194277	0	0	0	0	0	C0LLJ3|Q5JX99	Missense_Mutation	SNP	ENST00000298542.4	37	CCDS35397.1	.	.	.	.	.	.	.	.	.	.	C	18.58	3.653954	0.67472	.	.	ENSG00000165694	ENST00000370879;ENST00000298542;ENST00000464296	D;D;D	0.87029	-2.2;-2.2;-2.2	5.39	5.39	0.77823	FERM adjacent (FA) (1);	0.094087	0.64402	D	0.000001	D	0.90553	0.7039	L	0.59436	1.845	0.42989	D	0.994485	D;D	0.62365	0.986;0.991	P;D	0.65140	0.84;0.932	D	0.90935	0.4793	10	0.62326	D	0.03	.	10.9329	0.47228	0.0:0.9124:0.0:0.0876	.	283;298	Q6ZUT3-2;Q6ZUT3	.;FRMD7_HUMAN	T	178;298;283	ENSP00000359916:S178T;ENSP00000298542:S298T;ENSP00000417996:S283T	ENSP00000298542:S298T	S	-	2	0	FRMD7	131044084	1.000000	0.71417	1.000000	0.80357	0.972000	0.66771	3.226000	0.51254	2.392000	0.81423	0.600000	0.82982	AGT	.		0.448	FRMD7-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000355031.1	NM_194277	
SMIM10	644538	broad.mit.edu;bcgsc.ca	37	X	134125311	134125311	+	Missense_Mutation	SNP	G	G	C			TCGA-OR-A5KX-01A-11D-A29I-10	TCGA-OR-A5KX-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8369398d-9d6a-48dd-b20d-4e699ceddc1b	4b83e274-a5a1-430f-8ea8-70a4a64581c9	g.chrX:134125311G>C	ENST00000330288.4	+	1	344	c.186G>C	c.(184-186)aaG>aaC	p.K62N		NM_001163438.1	NP_001156910.1	Q96HG1	SIM10_HUMAN	small integral membrane protein 10	62						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)											GGCTGCGCAAGAACTTCTTTT	0.577																																					p.K62N		.											.	.	0			c.G186C						.						37.0	35.0	36.0					X																	134125311		692	1591	2283	SO:0001583	missense	644538	exon1			GCGCAAGAACTTC		CCDS55502.1	Xq26.3	2012-11-29	2012-11-29	2012-11-29	ENSG00000184785	ENSG00000184785			41913	protein-coding gene	gene with protein product			"""chromosome X open reading frame 69"""	CXorf69			Standard	NM_001163438		Approved		uc011mvs.2	Q96HG1		ENST00000330288.4:c.186G>C	X.37:g.134125311G>C	ENSP00000328335:p.Lys62Asn	Somatic	199	0		WXS	Illumina GAIIx	Phase_I	200	8	NM_001163438	0	0	0	0	0		Missense_Mutation	SNP	ENST00000330288.4	37	CCDS55502.1	.	.	.	.	.	.	.	.	.	.	G	8.003	0.755731	0.15846	.	.	ENSG00000184785	ENST00000330288	.	.	.	3.39	-3.26	0.05064	.	0.596292	0.13979	U	0.349628	T	0.27313	0.0670	.	.	.	0.09310	N	1	B	0.19331	0.035	B	0.12156	0.007	T	0.11717	-1.0576	8	0.66056	D	0.02	.	7.0651	0.25147	0.2894:0.5227:0.1879:0.0	.	62	Q96HG1	CX069_HUMAN	N	62	.	ENSP00000328335:K62N	K	+	3	2	Z83826.1	133952977	0.559000	0.26562	0.000000	0.03702	0.001000	0.01503	0.191000	0.17076	-1.071000	0.03145	-2.348000	0.00243	AAG	.		0.577	SMIM10-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_001163438	
GABRE	2564	ucsc.edu;bcgsc.ca;mdanderson.org	37	X	151128149	151128149	+	Intron	SNP	C	C	G			TCGA-OR-A5KX-01A-11D-A29I-10	TCGA-OR-A5KX-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8369398d-9d6a-48dd-b20d-4e699ceddc1b	4b83e274-a5a1-430f-8ea8-70a4a64581c9	g.chrX:151128149C>G	ENST00000370328.3	-	6	838				MIR452_ENST00000385020.1_RNA|AF274855.1_ENST00000582865.1_RNA|GABRE_ENST00000393914.3_Intron|MIR224_ENST00000384889.1_RNA|GABRE_ENST00000370325.1_Intron	NM_004961.3	NP_004952.2	P78334	GBRE_HUMAN	gamma-aminobutyric acid (GABA) A receptor, epsilon						gamma-aminobutyric acid signaling pathway (GO:0007214)|transport (GO:0006810)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|integral component of plasma membrane (GO:0005887)|postsynaptic membrane (GO:0045211)	chloride channel activity (GO:0005254)|extracellular ligand-gated ion channel activity (GO:0005230)|GABA-A receptor activity (GO:0004890)			breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(9)|ovary(2)|skin(1)	27	Acute lymphoblastic leukemia(192;6.56e-05)				Acamprosate(DB00659)|Adinazolam(DB00546)|Alprazolam(DB00404)|Amoxapine(DB00543)|Bromazepam(DB01558)|Butabarbital(DB00237)|Butalbital(DB00241)|Chlordiazepoxide(DB00475)|Cinolazepam(DB01594)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Clotiazepam(DB01559)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ergoloid mesylate(DB01049)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Fludiazepam(DB01567)|Flumazenil(DB01205)|Flurazepam(DB00690)|Glutethimide(DB01437)|Halazepam(DB00801)|Halothane(DB01159)|Isoflurane(DB00753)|Ketazolam(DB01587)|Lorazepam(DB00186)|Meprobamate(DB00371)|Methoxyflurane(DB01028)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Olanzapine(DB00334)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Prazepam(DB01588)|Primidone(DB00794)|Propofol(DB00818)|Quazepam(DB01589)|Sevoflurane(DB01236)|Talbutal(DB00306)|Temazepam(DB00231)|Topiramate(DB00273)|Triazolam(DB00897)	GTTACAAAGTCTCAGTTTCCT	0.418																																					.		.											.	.	0			.						.						134.0	111.0	118.0					X																	151128149		1568	3582	5150	SO:0001627	intron_variant	574412	.			CAAAGTCTCAGTT	Y09765	CCDS14703.1	Xq28	2012-06-22			ENSG00000102287	ENSG00000102287		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	4085	protein-coding gene	gene with protein product	"""GABA(A) receptor, epsilon"""	300093				9039914, 9084408	Standard	NM_004961		Approved		uc004ffi.3	P78334	OTTHUMG00000024176	ENST00000370328.3:c.784+161G>C	X.37:g.151128149C>G		Somatic	227	0		WXS	Illumina GAIIx	Phase_I	270	77	.	0	0	0	0	0	E7ET93|O15345|O15346|Q6PCD2|Q99520	RNA	SNP	ENST00000370328.3	37	CCDS14703.1																																																																																			.		0.418	GABRE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060903.1	NM_004961, NM_021990, NM_021984	
GABRE	2564	ucsc.edu;bcgsc.ca	37	X	151128169	151128169	+	Intron	SNP	G	G	T			TCGA-OR-A5KX-01A-11D-A29I-10	TCGA-OR-A5KX-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8369398d-9d6a-48dd-b20d-4e699ceddc1b	4b83e274-a5a1-430f-8ea8-70a4a64581c9	g.chrX:151128169G>T	ENST00000370328.3	-	6	838				MIR452_ENST00000385020.1_RNA|AF274855.1_ENST00000582865.1_RNA|GABRE_ENST00000393914.3_Intron|MIR224_ENST00000384889.1_RNA|GABRE_ENST00000370325.1_Intron	NM_004961.3	NP_004952.2	P78334	GBRE_HUMAN	gamma-aminobutyric acid (GABA) A receptor, epsilon						gamma-aminobutyric acid signaling pathway (GO:0007214)|transport (GO:0006810)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|integral component of plasma membrane (GO:0005887)|postsynaptic membrane (GO:0045211)	chloride channel activity (GO:0005254)|extracellular ligand-gated ion channel activity (GO:0005230)|GABA-A receptor activity (GO:0004890)			breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(9)|ovary(2)|skin(1)	27	Acute lymphoblastic leukemia(192;6.56e-05)				Acamprosate(DB00659)|Adinazolam(DB00546)|Alprazolam(DB00404)|Amoxapine(DB00543)|Bromazepam(DB01558)|Butabarbital(DB00237)|Butalbital(DB00241)|Chlordiazepoxide(DB00475)|Cinolazepam(DB01594)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Clotiazepam(DB01559)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ergoloid mesylate(DB01049)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Fludiazepam(DB01567)|Flumazenil(DB01205)|Flurazepam(DB00690)|Glutethimide(DB01437)|Halazepam(DB00801)|Halothane(DB01159)|Isoflurane(DB00753)|Ketazolam(DB01587)|Lorazepam(DB00186)|Meprobamate(DB00371)|Methoxyflurane(DB01028)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Olanzapine(DB00334)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Prazepam(DB01588)|Primidone(DB00794)|Propofol(DB00818)|Quazepam(DB01589)|Sevoflurane(DB01236)|Talbutal(DB00306)|Temazepam(DB00231)|Topiramate(DB00273)|Triazolam(DB00897)	TCTGCAAACAGTTGTAAGTGC	0.423																																					.		.											.	.	0			.						.						103.0	87.0	92.0					X																	151128169		1568	3582	5150	SO:0001627	intron_variant	574412	.			CAAACAGTTGTAA	Y09765	CCDS14703.1	Xq28	2012-06-22			ENSG00000102287	ENSG00000102287		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	4085	protein-coding gene	gene with protein product	"""GABA(A) receptor, epsilon"""	300093				9039914, 9084408	Standard	NM_004961		Approved		uc004ffi.3	P78334	OTTHUMG00000024176	ENST00000370328.3:c.784+141C>A	X.37:g.151128169G>T		Somatic	191	1		WXS	Illumina GAIIx	Phase_I	230	60	.	0	0	0	0	0	E7ET93|O15345|O15346|Q6PCD2|Q99520	RNA	SNP	ENST00000370328.3	37	CCDS14703.1																																																																																			.		0.423	GABRE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060903.1	NM_004961, NM_021990, NM_021984	
CENPF	1063	hgsc.bcm.edu;bcgsc.ca	37	1	214814882	214814883	+	Frame_Shift_Ins	INS	-	-	A			TCGA-OR-A5KX-01A-11D-A29I-10	TCGA-OR-A5KX-10A-01D-A29L-10	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8369398d-9d6a-48dd-b20d-4e699ceddc1b	4b83e274-a5a1-430f-8ea8-70a4a64581c9	g.chr1:214814882_214814883insA	ENST00000366955.3	+	12	3369_3370	c.3201_3202insA	c.(3202-3204)aaafs	p.K1068fs		NM_016343.3	NP_057427.3	P49454	CENPF_HUMAN	centromere protein F, 350/400kDa	0					cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|chromosome segregation (GO:0007059)|DNA replication (GO:0006260)|G2/M transition of mitotic cell cycle (GO:0000086)|kinetochore assembly (GO:0051382)|metaphase plate congression (GO:0051310)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic spindle assembly checkpoint (GO:0007094)|muscle organ development (GO:0007517)|negative regulation of transcription, DNA-templated (GO:0045892)|protein transport (GO:0015031)|regulation of cell cycle (GO:0051726)|regulation of G2/M transition of mitotic cell cycle (GO:0010389)|regulation of striated muscle tissue development (GO:0016202)|response to drug (GO:0042493)	chromosome, centromeric region (GO:0000775)|condensed chromosome outer kinetochore (GO:0000940)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinetochore (GO:0000776)|midbody (GO:0030496)|nuclear envelope (GO:0005635)|nuclear matrix (GO:0016363)|nucleus (GO:0005634)|pronucleus (GO:0045120)|spindle (GO:0005819)|spindle pole (GO:0000922)	chromatin binding (GO:0003682)|dynein binding (GO:0045502)|protein C-terminus binding (GO:0008022)|protein homodimerization activity (GO:0042803)|transcription factor binding (GO:0008134)			NS(2)|breast(2)|central_nervous_system(4)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(37)|lung(47)|ovary(7)|prostate(3)|skin(6)|stomach(1)|urinary_tract(1)	126				all cancers(67;0.00836)|OV - Ovarian serous cystadenocarcinoma(81;0.00855)|GBM - Glioblastoma multiforme(131;0.0694)|Epithelial(68;0.0833)		GTGAAAATAGGAAAAATGAGTT	0.332																																					p.R1067fs	Colon(80;575 1284 11000 14801 43496)	.											.	CENPF-567	0			c.3201_3202insA						.																																			SO:0001589	frameshift_variant	1063	exon12			AAATAGGAAAAAT	U30872	CCDS31023.1	1q41	2013-11-05	2013-01-17		ENSG00000117724	ENSG00000117724			1857	protein-coding gene	gene with protein product	"""mitosin"""	600236	"""centromere protein F, 350/400kDa (mitosin)"""			7904902, 7851898	Standard	NM_016343		Approved	hcp-1	uc001hkm.3	P49454	OTTHUMG00000036955	ENST00000366955.3:c.3206dupA	1.37:g.214814887_214814887dupA	ENSP00000355922:p.Lys1068fs	Somatic	244	2		WXS	Illumina GAIIx	Phase_I	221	149	NM_016343	0	0	0	0	0	Q13171|Q13246|Q5VVM7	Frame_Shift_Ins	INS	ENST00000366955.3	37	CCDS31023.1																																																																																			.		0.332	CENPF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000089749.1	NM_016343	
NCOR2	9612	broad.mit.edu	37	12	124824721	124824722	+	In_Frame_Ins	INS	-	-	GCCGCTGCT	rs61519723|rs112797765|rs143952466	byFrequency	TCGA-OR-A5KX-01A-11D-A29I-10	TCGA-OR-A5KX-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8369398d-9d6a-48dd-b20d-4e699ceddc1b	4b83e274-a5a1-430f-8ea8-70a4a64581c9	g.chr12:124824721_124824722insGCCGCTGCT	ENST00000405201.1	-	37	5517_5518	c.5517_5518insAGCAGCGGC	c.(5515-5520)ggcggg>ggcAGCAGCGGCggg	p.1838_1839insGSS	NCOR2_ENST00000404621.1_In_Frame_Ins_p.1828_1829insGSS|NCOR2_ENST00000356219.3_In_Frame_Ins_p.1845_1846insGSS|NCOR2_ENST00000397355.1_In_Frame_Ins_p.1829_1830insGSS|NCOR2_ENST00000429285.2_In_Frame_Ins_p.1828_1829insGSS|NCOR2_ENST00000404121.2_In_Frame_Ins_p.1399_1400insGSS			Q9Y618	NCOR2_HUMAN	nuclear receptor corepressor 2	1849					cellular lipid metabolic process (GO:0044255)|gene expression (GO:0010467)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|Notch signaling pathway (GO:0007219)|regulation of cellular ketone metabolic process by negative regulation of transcription from RNA polymerase II promoter (GO:0072365)|small molecule metabolic process (GO:0044281)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	membrane (GO:0016020)|nuclear body (GO:0016604)|nuclear matrix (GO:0016363)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|histone deacetylase binding (GO:0042826)|Notch binding (GO:0005112)|protein N-terminus binding (GO:0047485)|transcription corepressor activity (GO:0003714)			breast(5)|central_nervous_system(2)|endometrium(7)|kidney(5)|large_intestine(7)|lung(28)|ovary(3)|pancreas(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	69	all_neural(191;0.0804)|Medulloblastoma(191;0.163)			Epithelial(86;3.99e-05)|OV - Ovarian serous cystadenocarcinoma(86;9.14e-05)|all cancers(50;0.000402)|BRCA - Breast invasive adenocarcinoma(302;0.0764)		cccccacccccgccgctgctgc	0.713														4762	0.950879	0.8979	0.9496	5008	,	,		14227	0.9633		0.9672	False		,,,				2504	0.9939				p.G1840delinsSSGG		.											.	NCOR2-229	0			c.5518_5519insAGCAGCGGC						.																																			SO:0001652	inframe_insertion	9612	exon39			CACCCCCGCCGCT	U37146	CCDS41857.1, CCDS41858.1, CCDS41857.2, CCDS41858.2, CCDS55892.1	12q24	2010-06-10	2010-06-10		ENSG00000196498	ENSG00000196498			7673	protein-coding gene	gene with protein product		600848	"""nuclear receptor co-repressor 2"""			7566127, 8813722	Standard	NM_001077261		Approved	SMRT, SMRTE, TRAC-1, CTG26, TNRC14	uc010tbb.2	Q9Y618	OTTHUMG00000150455	ENST00000405201.1:c.5509_5517dupAGCAGCGGC	12.37:g.124824722_124824730dupGCCGCTGCT	ENSP00000384018:p.Gly1836_Ser1838dup	Somatic	13	0		WXS	Illumina GAIIx	Phase_I	21	8	NM_006312	0	0	0	0	0	O00613|O15416|O15421|Q13354|Q56D06|Q59GM0|Q9Y5U0	In_Frame_Ins	INS	ENST00000405201.1	37	CCDS41858.2																																																																																			.		0.713	NCOR2-005	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000318173.2	NM_006312	
SH2D6	284948	bcgsc.ca	37	2	85662863	85662864	+	Frame_Shift_Ins	INS	-	-	GGCCGGGTCTTCAACAT			TCGA-OR-A5KX-01A-11D-A29I-10	TCGA-OR-A5KX-10A-01D-A29L-10	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8369398d-9d6a-48dd-b20d-4e699ceddc1b	4b83e274-a5a1-430f-8ea8-70a4a64581c9	g.chr2:85662863_85662864insGGCCGGGTCTTCAACAT	ENST00000340326.2	+	3	488_489	c.327_328insGGCCGGGTCTTCAACAT	c.(328-330)ggcfs	p.-110fs	SH2D6_ENST00000481426.2_3'UTR|Y_RNA_ENST00000384478.1_RNA|SH2D6_ENST00000389938.2_Frame_Shift_Ins_p.-78fs	NM_198482.1	NP_940884.1	Q7Z4S9	SH2D6_HUMAN	SH2 domain containing 6											central_nervous_system(1)|lung(2)	3						TGCTTCTCCGAGGCCGGGTCTT	0.673																																					p.R109fs		.											.	SH2D6-226	0			c.327_328insGGCCGGGTCTTCAACAT						.																																			SO:0001589	frameshift_variant	284948	exon3			TCTCCGAGGCCGG	AF450483	CCDS1976.1	2p11.2	2013-02-14			ENSG00000152292	ENSG00000152292		"""SH2 domain containing"""	30439	protein-coding gene	gene with protein product						12477932	Standard	NM_198482		Approved	FLJ35993	uc002spq.3	Q7Z4S9	OTTHUMG00000130176	ENST00000340326.2:c.328_344dupGGCCGGGTCTTCAACAT	2.37:g.85662863_85662864insGGCCGGGTCTTCAACAT	ENSP00000341867:p.Gly110fs	Somatic	110	0		WXS	Illumina GAIIx	Phase_I	59	6	NM_198482	0	0	0	0	0	A6ND14|Q6R306	Frame_Shift_Ins	INS	ENST00000340326.2	37	CCDS1976.1																																																																																			.		0.673	SH2D6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252493.2	NM_198482	
DCP1A	55802	broad.mit.edu;bcgsc.ca	37	3	53326631	53326632	+	Frame_Shift_Ins	INS	-	-	GG			TCGA-OR-A5KX-01A-11D-A29I-10	TCGA-OR-A5KX-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8369398d-9d6a-48dd-b20d-4e699ceddc1b	4b83e274-a5a1-430f-8ea8-70a4a64581c9	g.chr3:53326631_53326632insGG	ENST00000607628.1	-	7	959_960	c.850_851insCC	c.(850-852)gtcfs	p.V284fs	Y_RNA_ENST00000384175.1_RNA|DCP1A_ENST00000480258.1_5'UTR|DCP1A_ENST00000294241.6_Frame_Shift_Ins_p.V284fs|DCP1A_ENST00000606822.1_Frame_Shift_Ins_p.V246fs	NM_018403.5	NP_060873.4	Q9NPI6	DCP1A_HUMAN	decapping mRNA 1A	284					exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay (GO:0043928)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|RNA metabolic process (GO:0016070)	cytoplasmic mRNA processing body (GO:0000932)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)	hydrolase activity (GO:0016787)|identical protein binding (GO:0042802)			breast(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	10				BRCA - Breast invasive adenocarcinoma(193;0.000164)|KIRC - Kidney renal clear cell carcinoma(197;0.00525)|Kidney(197;0.00579)|OV - Ovarian serous cystadenocarcinoma(275;0.0647)		TTCAGGCTGGACTGAATGGTGG	0.525																																					p.V284fs		.											.	DCP1A-90	0			c.851_852insCC						.																																			SO:0001589	frameshift_variant	55802	exon7			GGCTGGACTGAAT	AJ275986	CCDS74946.1	3p21.1	2013-05-02	2013-05-02		ENSG00000162290	ENSG00000272886			18714	protein-coding gene	gene with protein product		607010	"""DCP1 decapping enzyme homolog A (S. cerevisiae)"""				Standard	XM_005278360		Approved	HSA275986, SMIF, SMAD4IP1	uc021wzi.1	Q9NPI6	OTTHUMG00000158193	ENST00000607628.1:c.850_851insCC	3.37:g.53326631_53326632insGG	ENSP00000475920:p.Val284fs	Somatic	201	0		WXS	Illumina GAIIx	Phase_I	294	0	NM_018403	0	0	0	0	0	B4DHN9|U3KQM8	Frame_Shift_Ins	INS	ENST00000607628.1	37																																																																																				.		0.525	DCP1A-203	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding		NM_018403	
PRDM6	93166	broad.mit.edu	37	5	122425971	122425972	+	In_Frame_Ins	INS	-	-	CCTCCGCCT	rs368034022|rs199942027|rs70988558	byFrequency	TCGA-OR-A5KX-01A-11D-A29I-10	TCGA-OR-A5KX-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8369398d-9d6a-48dd-b20d-4e699ceddc1b	4b83e274-a5a1-430f-8ea8-70a4a64581c9	g.chr5:122425971_122425972insCCTCCGCCT	ENST00000407847.4	+	2	676_677	c.262_263insCCTCCGCCT	c.(262-264)acc>aCCTCCGCCTcc	p.94_95insSAS	AC106786.1_ENST00000458103.2_RNA|AC106786.1_ENST00000442777.2_RNA	NM_001136239.1	NP_001129711.1	Q9NQX0	PRDM6_HUMAN	PR domain containing 6	94					negative regulation of smooth muscle cell differentiation (GO:0051151)|negative regulation of transcription, DNA-templated (GO:0045892)|neurogenesis (GO:0022008)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	histone-lysine N-methyltransferase activity (GO:0018024)|metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)			NS(1)|breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|skin(1)	7						Ttcctcttccacctccgcctcc	0.782														1116	0.222843	0.2784	0.2637	5008	,	,		7182	0.0337		0.3966	False		,,,				2504	0.135				p.T88delinsTSAS		.											.	.	0			c.262_263insCCTCCGCCT						.			191,705		83,25,340						1.8	1.0			1	597,1391		268,61,665	no	coding	PRDM6	NM_001136239.1		351,86,1005	A1A1,A1R,RR		30.0302,21.317,27.3232				788,2096				SO:0001652	inframe_insertion	93166	exon2			TCTTCCACCTCCG	AF272898	CCDS47259.1	5q21-q23	2013-01-08			ENSG00000061455	ENSG00000061455		"""Zinc fingers, C2H2-type"""	9350	protein-coding gene	gene with protein product							Standard	NM_001136239		Approved		uc003kti.3	Q9NQX0	OTTHUMG00000150469	ENST00000407847.4:c.272_280dupCCTCCGCCT	5.37:g.122425972_122425980dupCCTCCGCCT	ENSP00000384725:p.Ser92_Ser94dup	Somatic	4	0		WXS	Illumina GAIIx	Phase_I	5	2	NM_001136239	0	0	0	0	0	B5MCJ4|Q9NQW9	In_Frame_Ins	INS	ENST00000407847.4	37	CCDS47259.1																																																																																			-|0.756;CCTCCGCCT|0.244		0.782	PRDM6-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318226.2	XM_049619	
RP3-470B24.5	0	broad.mit.edu	37	6	168376971	168376972	+	lincRNA	INS	-	-	A			TCGA-OR-A5KX-01A-11D-A29I-10	TCGA-OR-A5KX-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8369398d-9d6a-48dd-b20d-4e699ceddc1b	4b83e274-a5a1-430f-8ea8-70a4a64581c9	g.chr6:168376971_168376972insA	ENST00000538528.1	-	0	647_648																											AGTGTGTTGGGAGGAGGAGGCA	0.639																																					p.S121fs		.											.	.	0			c.362_363insT						.			41,2507		5,31,1238						0.9	0.0			16	155,4577		18,119,2229	no	frameshift	HGC6.3	NM_001129895.2		23,150,3467	A1A1,A1R,RR		3.2756,1.6091,2.6923				196,7084						0	exon1			TGTTGGGAGGAGG																													6.37:g.168376972_168376972dupA		Somatic	136	1		WXS	Illumina GAIIx	Phase_I	128	7	NM_001129895	0	0	0	0	0		Frame_Shift_Ins	INS	ENST00000538528.1	37																																																																																				.		0.639	RP3-470B24.5-201	KNOWN	basic	lincRNA	lincRNA			
