#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_TTotCov	i_TVarCov	i_Transcript_Id	i_Trna_alt1	i_Trna_alt2	i_Trna_ref	i_Trna_tot	i_Trna_var	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
HES3	390992	hgsc.bcm.edu	37	1	6305292	6305292	+	Missense_Mutation	SNP	C	C	A	rs61760836	byFrequency	TCGA-OR-A5KY-01A-11D-A29I-10	TCGA-OR-A5KY-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	72f9e1d9-c852-423a-94ff-17f763fa2713	f6e93da3-9ee7-4a65-bc04-30f8bb730eef	g.chr1:6305292C>A	ENST00000377898.3	+	4	351	c.286C>A	c.(286-288)Ccc>Acc	p.P96T		NM_001024598.3	NP_001019769.1	Q5TGS1	HES3_HUMAN	hes family bHLH transcription factor 3	96	Orange.				hindbrain morphogenesis (GO:0021575)|in utero embryonic development (GO:0001701)|midbrain development (GO:0030901)|midbrain-hindbrain boundary morphogenesis (GO:0021555)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|oculomotor nerve development (GO:0021557)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of timing of neuron differentiation (GO:0060164)|transcription, DNA-templated (GO:0006351)|trochlear nerve development (GO:0021558)	nucleus (GO:0005634)	DNA binding (GO:0003677)|transcription factor binding (GO:0008134)			lung(2)|skin(1)	3	Ovarian(185;0.0634)	all_cancers(23;2.48e-32)|all_epithelial(116;1.14e-17)|all_lung(118;2.85e-06)|all_neural(13;3.68e-06)|all_hematologic(16;2.39e-05)|Lung NSC(185;3.77e-05)|Acute lymphoblastic leukemia(12;0.000372)|Glioma(11;0.00127)|Renal(390;0.00188)|Colorectal(325;0.00342)|Breast(487;0.00475)|Hepatocellular(190;0.0218)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.15)		Epithelial(90;1.2e-37)|GBM - Glioblastoma multiforme(13;3.2e-29)|OV - Ovarian serous cystadenocarcinoma(86;2.52e-19)|Colorectal(212;1.19e-07)|COAD - Colon adenocarcinoma(227;1.3e-05)|Kidney(185;4.88e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.000871)|BRCA - Breast invasive adenocarcinoma(365;0.00105)|STAD - Stomach adenocarcinoma(132;0.00308)|READ - Rectum adenocarcinoma(331;0.0642)|Lung(427;0.241)		CCCCCTGGTGCCCGAGAGCGC	0.751													C|||	2794	0.557907	0.3079	0.755	5008	,	,		7447	0.5615		0.6849	False		,,,				2504	0.6217				p.P96T		.											.	HES3-514	0			c.C286A						.	C	THR/PRO	1430,1518		391,648,435	2.0	3.0	2.0		286	2.4	0.2	1	dbSNP_129	2	4911,1731		1926,1059,336	no	missense	HES3	NM_001024598.3	38	2317,1707,771	AA,AC,CC		26.0614,48.5075,33.879	benign	96/187	6305292	6341,3249	1474	3321	4795	SO:0001583	missense	390992	exon4			CTGGTGCCCGAGA		CCDS41238.1	1p36.31	2013-10-17	2013-10-17		ENSG00000173673	ENSG00000173673		"""Basic helix-loop-helix proteins"""	26226	protein-coding gene	gene with protein product		609971	"""hairy and enhancer of split 3 (Drosophila)"""				Standard	NM_001024598		Approved	bHLHb43	uc009vly.2	Q5TGS1	OTTHUMG00000001271	ENST00000377898.3:c.286C>A	1.37:g.6305292C>A	ENSP00000367130:p.Pro96Thr	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	4	4	NM_001024598	0	0	0	0	0	Q5TGS0	Missense_Mutation	SNP	ENST00000377898.3	37	CCDS41238.1	1241	0.5682234432234432	158	0.32113821138211385	254	0.7016574585635359	313	0.5472027972027972	516	0.6807387862796834	C	2.270	-0.367136	0.05069	0.485075	0.739386	ENSG00000173673	ENST00000377898	T	0.29397	1.57	3.31	2.4	0.29515	.	.	.	.	.	T	0.00012	0.0000	N	0.14661	0.345	0.80722	P	0.0	B	0.22003	0.063	B	0.17098	0.017	T	0.30765	-0.9967	8	0.11794	T	0.64	-26.1056	6.4315	0.21798	0.0:0.8639:0.0:0.1361	rs61760836	96	Q5TGS1	HES3_HUMAN	T	96	ENSP00000367130:P96T	ENSP00000367130:P96T	P	+	1	0	HES3	6227879	0.724000	0.28038	0.207000	0.23584	0.040000	0.13550	1.220000	0.32491	0.982000	0.38575	0.289000	0.19496	CCC	C|0.430;A|0.570		0.751	HES3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000003716.3	NM_001024598	
KIAA1522	57648	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	33235634	33235634	+	Missense_Mutation	SNP	G	G	C			TCGA-OR-A5KY-01A-11D-A29I-10	TCGA-OR-A5KY-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	72f9e1d9-c852-423a-94ff-17f763fa2713	f6e93da3-9ee7-4a65-bc04-30f8bb730eef	g.chr1:33235634G>C	ENST00000373480.1	+	6	780	c.677G>C	c.(676-678)gGc>gCc	p.G226A	KIAA1522_ENST00000294521.3_Intron|KIAA1522_ENST00000401073.2_Missense_Mutation_p.G285A|KIAA1522_ENST00000373481.3_Missense_Mutation_p.G237A	NM_001198972.1	NP_001185901.1	Q9P206	K1522_HUMAN	KIAA1522	226										breast(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(2)|lung(5)|ovary(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	24		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0837)|Breast(348;0.244)				GCGGAGGCTGGCGCTGAGACA	0.697																																					p.G285A		.											.	KIAA1522-90	0			c.G854C						.						17.0	23.0	21.0					1																	33235634		2038	4182	6220	SO:0001583	missense	57648	exon6			AGGCTGGCGCTGA	AL713671	CCDS41298.1, CCDS55588.1, CCDS55589.1	1p35.1	2009-02-18			ENSG00000162522	ENSG00000162522			29301	protein-coding gene	gene with protein product						10819331	Standard	NM_020888		Approved		uc001bvu.1	Q9P206	OTTHUMG00000008088	ENST00000373480.1:c.677G>C	1.37:g.33235634G>C	ENSP00000362579:p.Gly226Ala	Somatic	103	1		WXS	Illumina GAIIx	Phase_I	179	72	NM_020888	0	0	0	0	0	B4DQU8|B5MDY0|C9JH84|Q8TCQ0	Missense_Mutation	SNP	ENST00000373480.1	37	CCDS55588.1	.	.	.	.	.	.	.	.	.	.	G	0.054	-1.241195	0.01493	.	.	ENSG00000162522	ENST00000401073;ENST00000373481;ENST00000373480	T;T;T	0.27720	1.65;1.65;1.65	3.52	1.64	0.23874	.	0.896444	0.09309	N	0.819801	T	0.20820	0.0501	N	0.25647	0.755	0.09310	N	1	P;B;P	0.41784	0.762;0.002;0.762	B;B;B	0.44278	0.348;0.004;0.445	T	0.13899	-1.0492	10	0.16896	T	0.51	-0.1333	2.9421	0.05834	0.2359:0.0:0.5465:0.2176	.	237;226;285	Q9P206-3;Q9P206;Q9P206-2	.;K1522_HUMAN;.	A	285;237;226	ENSP00000383851:G285A;ENSP00000362580:G237A;ENSP00000362579:G226A	ENSP00000362579:G226A	G	+	2	0	KIAA1522	33008221	0.029000	0.19370	0.000000	0.03702	0.019000	0.09904	1.246000	0.32803	0.478000	0.27488	0.491000	0.48974	GGC	.		0.697	KIAA1522-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000022130.1		
GJA4	2701	bcgsc.ca	37	1	35260769	35260769	+	Missense_Mutation	SNP	C	C	T	rs1764391	byFrequency	TCGA-OR-A5KY-01A-11D-A29I-10	TCGA-OR-A5KY-10A-01D-A29L-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	72f9e1d9-c852-423a-94ff-17f763fa2713	f6e93da3-9ee7-4a65-bc04-30f8bb730eef	g.chr1:35260769C>T	ENST00000342280.4	+	2	1043	c.955C>T	c.(955-957)Ccc>Tcc	p.P319S		NM_002060.2	NP_002051.2	P35212	CXA4_HUMAN	gap junction protein, alpha 4, 37kDa	319			P -> S (in allele CX37*2; dbSNP:rs1764391). {ECO:0000269|PubMed:10447790, ECO:0000269|PubMed:10728596, ECO:0000269|Ref.3, ECO:0000269|Ref.4}.		blood vessel development (GO:0001568)|calcium ion transport (GO:0006816)|cell-cell junction assembly (GO:0007043)|cell-cell signaling (GO:0007267)|endothelium development (GO:0003158)|response to pain (GO:0048265)|transport (GO:0006810)	connexon complex (GO:0005922)|gap junction (GO:0005921)|integral component of plasma membrane (GO:0005887)				NS(1)|central_nervous_system(1)|endometrium(1)|large_intestine(3)|lung(3)|prostate(4)|stomach(1)	14		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.234)				TGGCCAAAAACCCCCAAGTCG	0.577													T|||	1671	0.333666	0.5847	0.2723	5008	,	,		17834	0.1726		0.332	False		,,,				2504	0.2055				p.P319S		.											.	GJA4-90	0			c.C955T	GRCh37	CM994122	GJA4	M	rs1764391	.	T	SER/PRO	2315,2091	563.5+/-381.2	610,1095,498	43.0	41.0	42.0		955	0.0	0.9	1	dbSNP_89	42	2603,5997	677.2+/-403.4	395,1813,2092	yes	missense	GJA4	NM_002060.2	74	1005,2908,2590	TT,TC,CC		30.2674,47.458,37.8133	benign	319/334	35260769	4918,8088	2203	4300	6503	SO:0001583	missense	2701	exon2			CAAAAACCCCCAA	M96789	CCDS30669.1	1p35.1	2008-02-05	2007-01-16		ENSG00000187513	ENSG00000187513		"""Ion channels / Gap junction proteins (connexins)"""	4278	protein-coding gene	gene with protein product	"""connexin 37"""	121012	"""gap junction protein, alpha 4, 37kD (connexin 37)"", ""gap junction protein, alpha 4, 37kDa (connexin 37)"""			9843209, 7680674	Standard	XM_005270750		Approved	CX37	uc001bya.3	P35212	OTTHUMG00000004050	ENST00000342280.4:c.955C>T	1.37:g.35260769C>T	ENSP00000343676:p.Pro319Ser	Somatic	45	0		WXS	Illumina GAIIx	Phase_I	44	4	NM_002060	0	0	12	12	0	A8K698|D3DPR4|Q9P106|Q9UBL1|Q9UNA9|Q9UNB0|Q9UNB1|Q9Y5N7	Missense_Mutation	SNP	ENST00000342280.4	37	CCDS30669.1	730	0.3342490842490842	264	0.5365853658536586	109	0.3011049723756906	106	0.1853146853146853	251	0.3311345646437995	T	0.051	-1.249319	0.01469	0.52542	0.302674	ENSG00000187513	ENST00000342280	D	0.97114	-4.25	5.25	0.0125	0.14092	.	2.066470	0.02474	N	0.087865	T	0.00012	0.0000	N	0.00926	-1.1	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.42816	-0.9429	9	0.36615	T	0.2	.	5.8617	0.18752	0.0:0.4496:0.296:0.2544	rs1764391;rs16837028;rs52823203;rs1764391	319	P35212	CXA4_HUMAN	S	319	ENSP00000343676:P319S	ENSP00000343676:P319S	P	+	1	0	GJA4	35033356	0.000000	0.05858	0.865000	0.33974	0.202000	0.24057	0.155000	0.16362	0.237000	0.21200	-0.361000	0.07541	CCC	C|0.634;T|0.366		0.577	GJA4-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000011556.1	NM_002060	
HECTD3	79654	hgsc.bcm.edu	37	1	45476663	45476663	+	Silent	SNP	G	G	A	rs2298005	byFrequency	TCGA-OR-A5KY-01A-11D-A29I-10	TCGA-OR-A5KY-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	72f9e1d9-c852-423a-94ff-17f763fa2713	f6e93da3-9ee7-4a65-bc04-30f8bb730eef	g.chr1:45476663G>A	ENST00000372172.4	-	1	338	c.267C>T	c.(265-267)ctC>ctT	p.L89L	UROD_ENST00000246337.4_5'Flank|HECTD3_ENST00000372168.3_5'Flank	NM_024602.5	NP_078878.3	Q5T447	HECD3_HUMAN	HECT domain containing E3 ubiquitin protein ligase 3	89					proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)			breast(1)|central_nervous_system(1)|endometrium(6)|kidney(2)|large_intestine(5)|lung(11)|prostate(1)|stomach(1)	28	Acute lymphoblastic leukemia(166;0.155)					GGGCGGCGCGGAGGGGCCCGG	0.756													G|||	1258	0.251198	0.1732	0.4107	5008	,	,		10868	0.2897		0.2127	False		,,,				2504	0.2434				p.L89L		.											.	HECTD3-658	0			c.C267T						.	G		363,2167		35,293,937	6.0	6.0	6.0		267	-0.7	1.0	1	dbSNP_100	6	1149,4825		112,925,1950	no	coding-synonymous	HECTD3	NM_024602.5		147,1218,2887	AA,AG,GG		19.2333,14.3478,17.7799		89/862	45476663	1512,6992	1265	2987	4252	SO:0001819	synonymous_variant	79654	exon1			GGCGCGGAGGGGC	BC019105	CCDS41318.1	1p34.1	2012-02-23	2012-02-23		ENSG00000126107	ENSG00000126107			26117	protein-coding gene	gene with protein product			"""HECT domain containing 3"""			12477932	Standard	NM_024602		Approved	FLJ21156	uc009vxk.3	Q5T447	OTTHUMG00000008587	ENST00000372172.4:c.267C>T	1.37:g.45476663G>A		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	9	7	NM_024602	0	0	0	0	0	B3KPV7|B3KRH4|Q5T448|Q9H783	Silent	SNP	ENST00000372172.4	37	CCDS41318.1																																																																																			G|0.756;A|0.244		0.756	HECTD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000023734.1	NM_024602	
RSBN1	54665	hgsc.bcm.edu	37	1	114354654	114354654	+	Silent	SNP	T	T	C	rs3195954	byFrequency	TCGA-OR-A5KY-01A-11D-A29I-10	TCGA-OR-A5KY-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	72f9e1d9-c852-423a-94ff-17f763fa2713	f6e93da3-9ee7-4a65-bc04-30f8bb730eef	g.chr1:114354654T>C	ENST00000261441.5	-	1	444	c.381A>G	c.(379-381)ccA>ccG	p.P127P	RP5-1073O3.2_ENST00000418238.1_RNA|RP5-1073O3.2_ENST00000429398.1_RNA	NM_018364.3	NP_060834.2	Q5VWQ0	RSBN1_HUMAN	round spermatid basic protein 1	127	Pro-rich.					nucleus (GO:0005634)				breast(1)|endometrium(2)|large_intestine(4)|lung(16)|ovary(1)|prostate(3)|urinary_tract(2)	29	Lung SC(450;0.184)	all_cancers(81;3.78e-08)|all_epithelial(167;5.56e-08)|all_lung(203;6.97e-06)|Lung NSC(69;1.18e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|all cancers(265;0.0792)|Epithelial(280;0.0866)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)		CTGCATTCGTTGGCGGCAGCG	0.746													T|||	610	0.121805	0.0045	0.1311	5008	,	,		11529	0.2282		0.1869	False		,,,				2504	0.0971				p.P127P		.											.	RSBN1-91	0			c.A381G						.	T		149,4053		2,145,1954	13.0	24.0	21.0		381	-4.9	0.5	1	dbSNP_105	21	1412,6854		115,1182,2836	no	coding-synonymous	RSBN1	NM_018364.3		117,1327,4790	CC,CT,TT		17.082,3.5459,12.5201		127/803	114354654	1561,10907	2101	4133	6234	SO:0001819	synonymous_variant	54665	exon1			ATTCGTTGGCGGC	AK002082	CCDS862.1	1p13.1	2008-02-05			ENSG00000081019	ENSG00000081019			25642	protein-coding gene	gene with protein product		615858				12477932	Standard	NM_018364		Approved	FLJ11220, ROSBIN	uc001edq.3	Q5VWQ0	OTTHUMG00000011938	ENST00000261441.5:c.381A>G	1.37:g.114354654T>C		Somatic	4	0		WXS	Illumina GAIIx	Phase_I	23	6	NM_018364	0	0	2	2	0	A8K937|Q6AI21|Q8TC33|Q9HA80|Q9NUP6	Silent	SNP	ENST00000261441.5	37	CCDS862.1																																																																																			T|0.861;C|0.139		0.746	RSBN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033022.2	NM_018364	
SEMA6C	10500	hgsc.bcm.edu;bcgsc.ca	37	1	151105831	151105831	+	Missense_Mutation	SNP	T	T	C	rs146921438	byFrequency	TCGA-OR-A5KY-01A-11D-A29I-10	TCGA-OR-A5KY-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	72f9e1d9-c852-423a-94ff-17f763fa2713	f6e93da3-9ee7-4a65-bc04-30f8bb730eef	g.chr1:151105831T>C	ENST00000341697.3	-	19	3613	c.1922A>G	c.(1921-1923)gAg>gGg	p.E641G	SEMA6C_ENST00000479820.1_5'Flank|RP11-68I18.10_ENST00000563624.1_RNA			Q9H3T2	SEM6C_HUMAN	sema domain, transmembrane domain (TM), and cytoplasmic domain, (semaphorin) 6C	641					axon guidance (GO:0007411)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)			central_nervous_system(2)|endometrium(1)|kidney(1)|large_intestine(5)|lung(15)|ovary(1)|prostate(1)|skin(1)|urinary_tract(1)	28	Lung SC(34;0.00471)|Ovarian(49;0.0147)|all_hematologic(923;0.0597)|Hepatocellular(266;0.0997)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0486)|LUSC - Lung squamous cell carcinoma(543;0.211)			CCCCGGAGTCTCGATGTCCTT	0.731													T|||	16	0.00319489	0.0008	0.0058	5008	,	,		10130	0.0		0.0109	False		,,,				2504	0.0				p.E673G		.											.	SEMA6C-92	0			c.A2018G						.	T	GLY/GLU,GLY/GLU,GLY/GLU	3,4375		0,3,2186	15.0	20.0	18.0		2018,1898,1922	3.9	1.0	1	dbSNP_134	18	47,8521		0,47,4237	yes	missense,missense,missense	SEMA6C	NM_001178061.1,NM_001178062.1,NM_030913.4	98,98,98	0,50,6423	CC,CT,TT		0.5486,0.0685,0.3862	possibly-damaging,possibly-damaging,possibly-damaging	673/963,633/923,641/931	151105831	50,12896	2189	4284	6473	SO:0001583	missense	10500	exon20			GGAGTCTCGATGT	AF339154	CCDS984.1, CCDS53363.1, CCDS53364.1	1q21.2	2008-02-05			ENSG00000143434	ENSG00000143434		"""Semaphorins"""	10740	protein-coding gene	gene with protein product	"""m-Sema Y2"""	609294				12110693	Standard	NM_030913		Approved	KIAA1869	uc001ewv.3	Q9H3T2	OTTHUMG00000012261	ENST00000341697.3:c.1922A>G	1.37:g.151105831T>C	ENSP00000344148:p.Glu641Gly	Somatic	14	0		WXS	Illumina GAIIx	Phase_I	66	56	NM_001178061	0	0	0	0	0	D3DV15|Q5JR71|Q5JR72|Q5JR73|Q8WXT8|Q8WXT9|Q8WXU0|Q96JF8	Missense_Mutation	SNP	ENST00000341697.3	37	CCDS984.1	14	0.00641025641025641	2	0.0040650406504065045	2	0.0055248618784530384	0	0.0	10	0.013192612137203167	T	22.2	4.260472	0.80246	6.85E-4	0.005486	ENSG00000143434	ENST00000368914;ENST00000368912;ENST00000368913;ENST00000341697	T;T;T;T	0.66099	-0.19;-0.19;-0.19;-0.19	3.89	3.89	0.44902	.	5.540820	0.00357	N	0.000028	T	0.68952	0.3057	L	0.55213	1.73	0.51233	D	0.999915	D;B;D	0.67145	0.996;0.038;0.993	D;B;D	0.75484	0.986;0.062;0.968	T	0.57860	-0.7738	10	0.46703	T	0.11	.	10.7357	0.46124	0.0:0.0:0.0:1.0	.	633;673;641	Q9H3T2-2;Q9H3T2-3;Q9H3T2	.;.;SEM6C_HUMAN	G	641;633;673;641	ENSP00000357910:E641G;ENSP00000357908:E633G;ENSP00000357909:E673G;ENSP00000344148:E641G	ENSP00000344148:E641G	E	-	2	0	SEMA6C	149372455	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	2.036000	0.41165	1.628000	0.50416	0.459000	0.35465	GAG	T|0.996;C|0.004		0.731	SEMA6C-004	KNOWN	alternative_5_UTR|mRNA_start_NF|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000034074.1	NM_030913	
THEM4	117145	hgsc.bcm.edu	37	1	151881885	151881885	+	Missense_Mutation	SNP	A	A	C	rs3748805	byFrequency	TCGA-OR-A5KY-01A-11D-A29I-10	TCGA-OR-A5KY-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	72f9e1d9-c852-423a-94ff-17f763fa2713	f6e93da3-9ee7-4a65-bc04-30f8bb730eef	g.chr1:151881885A>C	ENST00000368814.3	-	1	399	c.50T>G	c.(49-51)cTg>cGg	p.L17R	THEM4_ENST00000489410.1_Missense_Mutation_p.L17R	NM_053055.4	NP_444283.2	Q5T1C6	THEM4_HUMAN	thioesterase superfamily member 4	17			L -> R (in dbSNP:rs3748805). {ECO:0000269|PubMed:11598301, ECO:0000269|PubMed:14702039, ECO:0000269|PubMed:15489334, ECO:0000269|PubMed:17013611, ECO:0000269|Ref.4}.		epidermal growth factor receptor signaling pathway (GO:0007173)|fatty acid metabolic process (GO:0006631)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|protein kinase B signaling (GO:0043491)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)	cell projection (GO:0042995)|cytosol (GO:0005829)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	palmitoyl-CoA hydrolase activity (GO:0016290)			endometrium(1)|large_intestine(4)|lung(3)|urinary_tract(1)	9	Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.14)		LUSC - Lung squamous cell carcinoma(543;0.181)			TACTGGCGGCAGGCACAGAGC	0.741													C|||	4622	0.922923	0.8986	0.9092	5008	,	,		8223	0.9494		0.9155	False		,,,				2504	0.9458				p.L17R		.											.	THEM4-522	0			c.T50G						.						1.0	1.0	1.0					1																	151881885		1068	2473	3541	SO:0001583	missense	117145	exon1			GGCGGCAGGCACA	AJ313515	CCDS1006.1	1q21.3	2008-02-05			ENSG00000159445	ENSG00000159445			17947	protein-coding gene	gene with protein product	"""C-terminal modulator protein"""	606388				11598301	Standard	NM_053055		Approved	CTMP	uc001ezj.2	Q5T1C6	OTTHUMG00000013049	ENST00000368814.3:c.50T>G	1.37:g.151881885A>C	ENSP00000357804:p.Leu17Arg	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	9	9	NM_053055	0	0	0	1	1	B2RBX2|Q96KR2	Missense_Mutation	SNP	ENST00000368814.3	37	CCDS1006.1	2023	0.9262820512820513	453	0.9207317073170732	320	0.8839779005524862	545	0.9527972027972028	705	0.9300791556728232	C	0.562	-0.845033	0.02671	.	.	ENSG00000159445	ENST00000368814;ENST00000489410	T;T	0.25579	2.45;1.79	1.92	-0.278	0.12894	.	16.336300	0.02935	N	0.139768	T	0.02455	0.0075	N	0.08118	0	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.21143	-1.0254	9	0.10111	T	0.7	0.3431	0.4569	0.00510	0.2457:0.3181:0.2427:0.1934	rs3748805;rs17855960	17	Q5T1C6	THEM4_HUMAN	R	17	ENSP00000357804:L17R;ENSP00000433304:L17R	ENSP00000357804:L17R	L	-	2	0	THEM4	150148509	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.350000	0.07721	-0.432000	0.07297	-0.358000	0.07595	CTG	T|0.073;G|0.921		0.741	THEM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000036615.1	NM_053055	
FCRL5	83416	broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	157494069	157494069	+	Splice_Site	SNP	C	C	A			TCGA-OR-A5KY-01A-11D-A29I-10	TCGA-OR-A5KY-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	72f9e1d9-c852-423a-94ff-17f763fa2713	f6e93da3-9ee7-4a65-bc04-30f8bb730eef	g.chr1:157494069C>A	ENST00000361835.3	-	10	2396	c.2239G>T	c.(2239-2241)Gtt>Ttt	p.V747F	FCRL5_ENST00000461387.1_5'Flank|FCRL5_ENST00000368191.3_Missense_Mutation_p.G662C|FCRL5_ENST00000368190.3_Missense_Mutation_p.G747C|FCRL5_ENST00000356953.4_Splice_Site_p.V747F	NM_001195388.1|NM_031281.2	NP_001182317.1|NP_112571.2	Q96RD9	FCRL5_HUMAN	Fc receptor-like 5	747					negative regulation of B cell receptor signaling pathway (GO:0050859)|negative regulation of release of sequestered calcium ion into cytosol (GO:0051280)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)				breast(5)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(10)|lung(45)|ovary(5)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	85	all_hematologic(112;0.0378)|Hepatocellular(266;0.178)	Prostate(1639;0.231)				GCCCACTCACCTGCAACTTTC	0.552																																					p.V747F		.											.	FCRL5-156	0			c.G2239T						.						40.0	44.0	42.0					1																	157494069		2203	4300	6503	SO:0001630	splice_region_variant	83416	exon10			ACTCACCTGCAAC	AF369794	CCDS1165.1	1q21	2013-01-11			ENSG00000143297	ENSG00000143297		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	18508	protein-coding gene	gene with protein product		605877				11027651, 11290337	Standard	NM_031281		Approved	FCRH5, IRTA2, BXMAS1, CD307e	uc009wsm.3	Q96RD9	OTTHUMG00000017481	ENST00000361835.3:c.2239+1G>T	1.37:g.157494069C>A		Somatic	273	1		WXS	Illumina GAIIx	Phase_I	301	108	NM_031281	0	0	0	0	0	A0N0M2|B7WNT9|B7WP94|Q495Q2|Q495Q4|Q5VYK9|Q6UY46	Missense_Mutation	SNP	ENST00000361835.3	37	CCDS1165.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	13.02|13.02	2.111073|2.111073	0.37242|0.37242	.|.	.|.	ENSG00000143297|ENSG00000143297	ENST00000368190;ENST00000368191|ENST00000361835;ENST00000356953	T;T|T;T	0.47528|0.54866	0.84;1.11|0.55;0.56	4.83|4.83	2.96|2.96	0.34315|0.34315	.|Immunoglobulin-like fold (1);	.|1.214570	.|0.06520	.|N	.|0.739472	T|T	0.43678|0.43678	0.1258|0.1258	M|M	0.91300|0.91300	3.195|3.195	0.58432|0.58432	D|D	0.999999|0.999999	D;D|B;B	0.65815|0.33919	0.993;0.995|0.382;0.432	D;P|B;B	0.63381|0.26864	0.914;0.889|0.054;0.074	T|T	0.59947|0.59947	-0.7358|-0.7358	9|10	0.52906|0.59425	T|D	0.07|0.04	.|.	7.5965|7.5965	0.28052|0.28052	0.0:0.8057:0.0:0.1943|0.0:0.8057:0.0:0.1943	.|.	662;747|747;747	F5GXJ2;Q96RD9-3|A6NJE8;Q96RD9	.;.|.;FCRL5_HUMAN	C|F	747;662|747	ENSP00000357173:G747C;ENSP00000357174:G662C|ENSP00000354691:V747F;ENSP00000349434:V747F	ENSP00000357173:G747C|ENSP00000349434:V747F	G|V	-|-	1|1	0|0	FCRL5|FCRL5	155760693|155760693	0.653000|0.653000	0.27358|0.27358	0.507000|0.507000	0.27676|0.27676	0.009000|0.009000	0.06853|0.06853	1.076000|1.076000	0.30729|0.30729	0.754000|0.754000	0.32968|0.32968	-0.145000|-0.145000	0.13849|0.13849	GGT|GTT	.		0.552	FCRL5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000046263.1	NM_031281	Missense_Mutation
CD1A	909	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	158224992	158224992	+	Missense_Mutation	SNP	C	C	A	rs559573053		TCGA-OR-A5KY-01A-11D-A29I-10	TCGA-OR-A5KY-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	72f9e1d9-c852-423a-94ff-17f763fa2713	f6e93da3-9ee7-4a65-bc04-30f8bb730eef	g.chr1:158224992C>A	ENST00000289429.5	+	2	710	c.177C>A	c.(175-177)agC>agA	p.S59R		NM_001763.2	NP_001754.2	P06126	CD1A_HUMAN	CD1a molecule	59					antigen processing and presentation (GO:0019882)|immune response (GO:0006955)	endosome (GO:0005768)|integral component of plasma membrane (GO:0005887)				NS(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(14)|pancreas(2)|prostate(4)|skin(2)|urinary_tract(1)	32	all_hematologic(112;0.0378)				Antithymocyte globulin(DB00098)	CCTGGGACAGCAATTCCAGCA	0.488													C|||	1	0.000199681	0.0	0.0	5008	,	,		20241	0.0		0.0	False		,,,				2504	0.001				p.S59R		.											.	CD1A-93	0			c.C177A						.						132.0	116.0	122.0					1																	158224992		2203	4300	6503	SO:0001583	missense	909	exon2			GGACAGCAATTCC	M28825	CCDS1174.1	1q23.1	2014-01-14	2006-03-28		ENSG00000158477	ENSG00000158477		"""CD molecules"", ""Immunoglobulin superfamily / C1-set domain containing"""	1634	protein-coding gene	gene with protein product		188370	"""CD1A antigen, a polypeptide"", ""CD1a antigen"""	CD1		2447586, 2784820	Standard	NM_001763		Approved		uc001frt.3	P06126	OTTHUMG00000017512	ENST00000289429.5:c.177C>A	1.37:g.158224992C>A	ENSP00000289429:p.Ser59Arg	Somatic	224	1		WXS	Illumina GAIIx	Phase_I	187	128	NM_001763	0	0	0	0	0	D3DVD7|Q13962|Q5TDJ8|Q9UMM4|Q9Y5M5	Missense_Mutation	SNP	ENST00000289429.5	37	CCDS1174.1	.	.	.	.	.	.	.	.	.	.	C	9.833	1.189068	0.21954	.	.	ENSG00000158477	ENST00000289429	T	0.10573	2.86	4.54	-6.34	0.01982	MHC class I, alpha chain, alpha1/alpha2 (1);MHC classes I/II-like antigen recognition protein (1);MHC class I-like antigen recognition (1);	1.162150	0.06579	N	0.749958	T	0.01730	0.0055	L	0.28740	0.885	0.09310	N	1	B	0.19935	0.04	B	0.17433	0.018	T	0.46359	-0.9197	10	0.54805	T	0.06	-0.4689	1.0698	0.01619	0.2473:0.1513:0.1352:0.4661	.	59	P06126	CD1A_HUMAN	R	59	ENSP00000289429:S59R	ENSP00000289429:S59R	S	+	3	2	CD1A	156491616	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-4.802000	0.00184	-0.951000	0.03654	-1.053000	0.02334	AGC	.		0.488	CD1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046349.2	NM_001763	
KCNT2	343450	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	196227367	196227367	+	Silent	SNP	C	C	T			TCGA-OR-A5KY-01A-11D-A29I-10	TCGA-OR-A5KY-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	72f9e1d9-c852-423a-94ff-17f763fa2713	f6e93da3-9ee7-4a65-bc04-30f8bb730eef	g.chr1:196227367C>T	ENST00000294725.9	-	26	4083	c.3168G>A	c.(3166-3168)gtG>gtA	p.V1056V	KCNT2_ENST00000609185.1_Silent_p.V989V|KCNT2_ENST00000367431.4_Silent_p.V990V|KCNT2_ENST00000367433.5_Silent_p.V1032V|KCNT2_ENST00000498426.1_5'UTR|KCNT2_ENST00000451324.2_3'UTR			Q6UVM3	KCNT2_HUMAN	potassium channel, subfamily T, member 2	1056					potassium ion transmembrane transport (GO:0071805)	voltage-gated potassium channel complex (GO:0008076)	ATP binding (GO:0005524)|calcium-activated potassium channel activity (GO:0015269)|voltage-gated potassium channel activity (GO:0005249)			NS(1)|breast(4)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|kidney(3)|large_intestine(16)|lung(43)|ovary(5)|pancreas(1)|prostate(1)|skin(11)|stomach(2)|upper_aerodigestive_tract(1)	97						TTCTATTTTTCACAAGTTCAG	0.398																																					p.V1056V		.											.	KCNT2-159	0			c.G3168A						.						109.0	113.0	111.0					1																	196227367		2203	4300	6503	SO:0001819	synonymous_variant	343450	exon26			ATTTTTCACAAGT	BX647852, AY359444, AK127807	CCDS1384.1, CCDS72994.1, CCDS72995.1	1q31.3	2012-07-05			ENSG00000162687	ENSG00000162687		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, calcium-activated"""	18866	protein-coding gene	gene with protein product	"""sodium and chloride activated ATP sensitive potassium channel"""	610044				16382103	Standard	NM_198503		Approved	KCa4.2, SLICK, SLO2.1	uc001gtd.1	Q6UVM3	OTTHUMG00000035611	ENST00000294725.9:c.3168G>A	1.37:g.196227367C>T		Somatic	46	0		WXS	Illumina GAIIx	Phase_I	47	17	NM_198503	0	0	0	0	0	Q3SY59|Q5VTN1|Q6ZMT3	Silent	SNP	ENST00000294725.9	37	CCDS1384.1																																																																																			.		0.398	KCNT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086418.2	NM_198503	
C1orf106	55765	hgsc.bcm.edu	37	1	200880978	200880978	+	Missense_Mutation	SNP	C	C	T	rs296520	byFrequency	TCGA-OR-A5KY-01A-11D-A29I-10	TCGA-OR-A5KY-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	72f9e1d9-c852-423a-94ff-17f763fa2713	f6e93da3-9ee7-4a65-bc04-30f8bb730eef	g.chr1:200880978C>T	ENST00000367342.4	+	9	1812	c.1612C>T	c.(1612-1614)Cgc>Tgc	p.R538C	C1orf106_ENST00000413687.2_Missense_Mutation_p.R453C	NM_018265.3	NP_060735.3	Q3KP66	CA106_HUMAN	chromosome 1 open reading frame 106	538			R -> C (in dbSNP:rs296520). {ECO:0000269|PubMed:14702039, ECO:0000269|PubMed:15489334}.							endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(6)|ovary(1)|prostate(2)|skin(3)|stomach(1)|urinary_tract(2)	21						GTGGGAGCTGCGCCGCGCAGC	0.736													T|||	3966	0.791933	0.6089	0.8213	5008	,	,		12017	0.997		0.7256	False		,,,				2504	0.8753				p.R552C		.											.	C1orf106-93	0			c.C1654T						.	T	CYS/ARG,CYS/ARG	2547,1503		890,767,368	5.0	7.0	6.0		1357,1612	0.8	0.0	1	dbSNP_79	6	5587,2355		2124,1339,508	no	missense,missense	C1orf106	NM_001142569.2,NM_018265.3	180,180	3014,2106,876	TT,TC,CC		29.6525,37.1111,32.1714	benign,benign	453/579,538/664	200880978	8134,3858	2025	3971	5996	SO:0001583	missense	55765	exon9			GAGCTGCGCCGCG	AK001763	CCDS44292.1	1q32.1	2011-02-15			ENSG00000163362	ENSG00000163362			25599	protein-coding gene	gene with protein product						14702039	Standard	NM_018265		Approved	FLJ10901	uc001gvo.4	Q3KP66	OTTHUMG00000035789	ENST00000367342.4:c.1612C>T	1.37:g.200880978C>T	ENSP00000356311:p.Arg538Cys	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	31	31	NM_018265	0	0	0	0	0	B4E1K9|E9PFY0|Q9NV65|Q9NVI0	Missense_Mutation	SNP	ENST00000367342.4	37		1677	0.7678571428571429	261	0.5304878048780488	285	0.787292817679558	569	0.9947552447552448	562	0.741424802110818	T	0.366	-0.936884	0.02340	0.628889	0.703475	ENSG00000163362	ENST00000367342;ENST00000413687	T;T	0.28454	1.61;1.61	3.39	0.759	0.18438	.	0.912041	0.09365	N	0.812206	T	0.00012	0.0000	N	0.01576	-0.805	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.16188	-1.0411	9	0.29301	T	0.29	-23.0614	3.796	0.08740	0.0:0.2241:0.1856:0.5903	rs296520;rs7519373;rs56757010	538	Q3KP66	CA106_HUMAN	C	538;453	ENSP00000356311:R538C;ENSP00000392105:R453C	ENSP00000356311:R538C	R	+	1	0	C1orf106	199147601	0.004000	0.15560	0.002000	0.10522	0.007000	0.05969	-0.731000	0.04909	-0.124000	0.11724	-0.381000	0.06696	CGC	C|0.242;T|0.758		0.736	C1orf106-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000087057.2	NM_018265	
CAPN2	824	bcgsc.ca	37	1	223905532	223905532	+	Splice_Site	SNP	G	G	A	rs17596	byFrequency	TCGA-OR-A5KY-01A-11D-A29I-10	TCGA-OR-A5KY-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	72f9e1d9-c852-423a-94ff-17f763fa2713	f6e93da3-9ee7-4a65-bc04-30f8bb730eef	g.chr1:223905532G>A	ENST00000295006.5	+	2	615	c.306G>A	c.(304-306)ctG>ctA	p.L102L	CAPN2_ENST00000433674.2_Splice_Site_p.L24L	NM_001748.4	NP_001739	P17655	CAN2_HUMAN	calpain 2, (m/II) large subunit	102	Calpain catalytic. {ECO:0000255|PROSITE- ProRule:PRU00239}.				blastocyst development (GO:0001824)|cellular response to amino acid stimulus (GO:0071230)|myoblast fusion (GO:0007520)|protein autoprocessing (GO:0016540)|proteolysis (GO:0006508)|proteolysis involved in cellular protein catabolic process (GO:0051603)|regulation of cytoskeleton organization (GO:0051493)|response to hypoxia (GO:0001666)	chromatin (GO:0000785)|cortical actin cytoskeleton (GO:0030864)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|membrane raft (GO:0045121)|nucleus (GO:0005634)|perinuclear endoplasmic reticulum (GO:0097038)|plasma membrane (GO:0005886)|pseudopodium (GO:0031143)	calcium ion binding (GO:0005509)|calcium-dependent cysteine-type endopeptidase activity (GO:0004198)|cysteine-type peptidase activity (GO:0008234)|cytoskeletal protein binding (GO:0008092)	p.L102L(1)		breast(3)|endometrium(1)|kidney(1)|large_intestine(9)|lung(10)|prostate(1)|skin(1)|stomach(3)	29				GBM - Glioblastoma multiforme(131;0.109)		AAGGAGCCCTGGGTAAGTGAT	0.557													G|||	2982	0.595447	0.351	0.6354	5008	,	,		19640	0.5823		0.7634	False		,,,				2504	0.7382				p.L102L		.											.	CAPN2-523	1	Substitution - coding silent(1)	stomach(1)	c.G306A						.	G	,	1925,2481	548.1+/-377.4	416,1093,694	53.0	48.0	50.0		72,306	2.6	1.0	1	dbSNP_107	50	6692,1908	727.2+/-406.6	2604,1484,212	yes	coding-synonymous-near-splice,coding-synonymous-near-splice	CAPN2	NM_001146068.1,NM_001748.4	,	3020,2577,906	AA,AG,GG		22.186,43.6904,33.746	,	24/623,102/701	223905532	8617,4389	2203	4300	6503	SO:0001630	splice_region_variant	824	exon2			AGCCCTGGGTAAG	J04700	CCDS31035.1, CCDS53478.1	1q41-q42	2013-01-10			ENSG00000162909	ENSG00000162909	3.4.22.52	"""EF-hand domain containing"""	1479	protein-coding gene	gene with protein product		114230				2852952, 2539381	Standard	NM_001748		Approved	mCANP, CANPml, CANPL2	uc001hob.4	P17655	OTTHUMG00000037376	ENST00000295006.5:c.307+1G>A	1.37:g.223905532G>A		Somatic	113	1		WXS	Illumina GAIIx	Phase_I	154	7	NM_001748	0	0	0	0	0	A6NDG7|B7ZA96|E7ES58|Q16738|Q6PJT3|Q8WU26|Q9HBB1	Silent	SNP	ENST00000295006.5	37	CCDS31035.1																																																																																			G|0.359;A|0.641		0.557	CAPN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090973.1	NM_001748	Silent
TFAM	7019	bcgsc.ca	37	10	60145342	60145342	+	Missense_Mutation	SNP	G	G	C	rs1937	byFrequency	TCGA-OR-A5KY-01A-11D-A29I-10	TCGA-OR-A5KY-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	72f9e1d9-c852-423a-94ff-17f763fa2713	f6e93da3-9ee7-4a65-bc04-30f8bb730eef	g.chr10:60145342G>C	ENST00000487519.1	+	1	561	c.35G>C	c.(34-36)aGt>aCt	p.S12T	TFAM_ENST00000373899.3_3'UTR|TFAM_ENST00000373895.3_Missense_Mutation_p.S12T	NM_001270782.1|NM_003201.2	NP_001257711.1|NP_003192.1	Q00059	TFAM_HUMAN	transcription factor A, mitochondrial	12			S -> T (in dbSNP:rs1937). {ECO:0000269|PubMed:1610904, ECO:0000269|PubMed:19054851, ECO:0000269|PubMed:19096125}.		DNA-dependent DNA replication (GO:0006261)|gene expression (GO:0010467)|mitochondrial respiratory chain complex assembly (GO:0033108)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase I promoter (GO:0006356)|transcription from mitochondrial promoter (GO:0006390)|transcription initiation from mitochondrial promoter (GO:0006391)	mitochondrial matrix (GO:0005759)|mitochondrial nucleoid (GO:0042645)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding, bending (GO:0008301)|mitochondrial light strand promoter sense binding (GO:0070363)|poly(A) RNA binding (GO:0044822)|sequence-specific DNA binding transcription factor activity (GO:0003700)			kidney(1)|large_intestine(1)|lung(4)|prostate(1)	7						GGCGTGCTGAGTGCCCTGGGA	0.642											OREG0020196	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	G|||	443	0.0884585	0.0068	0.0908	5008	,	,		15287	0.1716		0.0875	False		,,,				2504	0.1125				p.S12T		.											.	TFAM-90	0			c.G35C	GRCh37	CM086330	TFAM	M	rs1937	.	G	THR/SER	93,4305		0,93,2106	77.0	64.0	68.0		35	0.6	0.1	10	dbSNP_36	68	812,7778		32,748,3515	yes	missense	TFAM	NM_003201.1	58	32,841,5621	CC,CG,GG		9.4529,2.1146,6.968	benign	12/247	60145342	905,12083	2199	4295	6494	SO:0001583	missense	7019	exon1			TGCTGAGTGCCCT	BC018628	CCDS7253.1, CCDS59217.1	10q21	2010-09-24			ENSG00000108064	ENSG00000108064			11741	protein-coding gene	gene with protein product		600438		TCF6, TCF6L2		7789991	Standard	NM_003201		Approved		uc001jkf.4	Q00059	OTTHUMG00000018270	ENST00000487519.1:c.35G>C	10.37:g.60145342G>C	ENSP00000420588:p.Ser12Thr	Somatic	62	0	1043	WXS	Illumina GAIIx	Phase_I	104	4	NM_003201	0	0	20	20	0	A8MRB2|A9QXC6|B5BU05|Q5U0C6	Missense_Mutation	SNP	ENST00000487519.1	37	CCDS7253.1	205	0.09386446886446886	4	0.008130081300813009	33	0.09116022099447514	98	0.17132867132867133	70	0.09234828496042216	G	2.997	-0.206794	0.06180	0.021146	0.094529	ENSG00000108064	ENST00000487519;ENST00000373895	T;T	0.14766	2.49;2.48	4.97	0.598	0.17512	.	0.437414	0.25025	N	0.033729	T	0.00039	0.0001	L	0.36672	1.1	0.80722	P	0.0	B;B	0.13594	0.008;0.008	B;B	0.09377	0.004;0.002	T	0.31052	-0.9957	9	0.39692	T	0.17	.	6.523	0.22285	0.2509:0.1335:0.6156:0.0	rs1937;rs1049400;rs2228267;rs3189561;rs11006128;rs17149816;rs17847534;rs61037439;rs1937	12;12	A8MRB2;Q00059	.;TFAM_HUMAN	T	12	ENSP00000420588:S12T;ENSP00000363002:S12T	ENSP00000363002:S12T	S	+	2	0	TFAM	59815348	0.583000	0.26757	0.096000	0.21009	0.296000	0.27459	0.553000	0.23391	0.066000	0.16515	-0.797000	0.03246	AGT	G|0.919;C|0.081		0.642	TFAM-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048146.1	NM_003201	
PLAC9	219348	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	81904035	81904035	+	Silent	SNP	G	G	C			TCGA-OR-A5KY-01A-11D-A29I-10	TCGA-OR-A5KY-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	72f9e1d9-c852-423a-94ff-17f763fa2713	f6e93da3-9ee7-4a65-bc04-30f8bb730eef	g.chr10:81904035G>C	ENST00000372263.3	+	3	261	c.219G>C	c.(217-219)ctG>ctC	p.L73L	PLAC9_ENST00000372270.2_Silent_p.L31L|PLAC9_ENST00000372267.2_Intron	NM_001012973.1	NP_001012991.1	Q5JTB6	PLAC9_HUMAN	placenta-specific 9	73						extracellular region (GO:0005576)				kidney(1)|ovary(1)	2	Prostate(51;0.0095)|all_epithelial(25;0.175)		Colorectal(32;0.109)			TGCTGGGCCTGCTGGAGGAGC	0.632											OREG0020321	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.L73L		.											.	PLAC9-90	0			c.G219C						.						64.0	57.0	59.0					10																	81904035		2203	4300	6503	SO:0001819	synonymous_variant	219348	exon3			GGGCCTGCTGGAG		CCDS31232.1	10q23.2	2008-02-04			ENSG00000189129	ENSG00000189129			19255	protein-coding gene	gene with protein product		612857					Standard	NM_001012973		Approved		uc001kbp.1	Q5JTB6	OTTHUMG00000018596	ENST00000372263.3:c.219G>C	10.37:g.81904035G>C		Somatic	47	0	1209	WXS	Illumina GAIIx	Phase_I	75	29	NM_001012973	0	0	61	61	0		Silent	SNP	ENST00000372263.3	37	CCDS31232.1																																																																																			.		0.632	PLAC9-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000049019.1	NM_001012973	
HECTD2	143279	hgsc.bcm.edu	37	10	93170250	93170250	+	Missense_Mutation	SNP	C	C	G	rs7081569		TCGA-OR-A5KY-01A-11D-A29I-10	TCGA-OR-A5KY-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	72f9e1d9-c852-423a-94ff-17f763fa2713	f6e93da3-9ee7-4a65-bc04-30f8bb730eef	g.chr10:93170250C>G	ENST00000298068.5	+	1	149	c.55C>G	c.(55-57)Ccc>Gcc	p.P19A	HECTD2_ENST00000371681.4_Missense_Mutation_p.P19A|HECTD2_ENST00000446394.1_Missense_Mutation_p.P19A	NM_182765.3	NP_877497	Q5U5R9	HECD2_HUMAN	HECT domain containing E3 ubiquitin protein ligase 2	19			P -> A (in dbSNP:rs7081569). {ECO:0000269|PubMed:14702039, ECO:0000269|PubMed:15489334}.		protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)			breast(2)|endometrium(2)|kidney(4)|large_intestine(10)|lung(7)|skin(1)|urinary_tract(1)	27						GGTGGCGGCGCCCGCGCCTGA	0.761													G|||	5008	1.0	1.0	1.0	5008	,	,		7483	1.0		1.0	False		,,,				2504	1.0				p.P19A	NSCLC(12;376 469 1699 39910 41417)	.											.	HECTD2-658	0			c.C55G						.						2.0	2.0	2.0					10																	93170250		1173	2544	3717	SO:0001583	missense	143279	exon1			GCGGCGCCCGCGC	AK094625	CCDS7414.1, CCDS7415.1, CCDS60591.1	10q23.32	2013-09-20	2012-02-23		ENSG00000165338	ENSG00000165338			26736	protein-coding gene	gene with protein product			"""HECT domain containing 2"""			8619474, 9110174	Standard	NM_001284274		Approved	FLJ37306	uc001khl.2	Q5U5R9	OTTHUMG00000018742	ENST00000298068.5:c.55C>G	10.37:g.93170250C>G	ENSP00000298068:p.Pro19Ala	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	7	7	NM_182765	0	0	0	0	0	Q5VZ97|Q5VZ98|Q5VZ99|Q8N1X7|Q8TCP5	Missense_Mutation	SNP	ENST00000298068.5	37	CCDS7414.1	1998	0.9148351648351648	429	0.8719512195121951	335	0.925414364640884	529	0.9248251748251748	705	0.9300791556728232	g	1.760	-0.486925	0.04352	.	.	ENSG00000165338	ENST00000446394;ENST00000371681;ENST00000298068	T;T;T	0.36699	1.5;1.24;1.5	2.37	2.37	0.29283	.	0.964307	0.08409	N	0.950145	T	0.00012	0.0000	N	0.00538	-1.39	0.46241	P	0.001052000000000053	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.01281	0.0;0.0;0.0	T	0.32534	-0.9903	9	0.02654	T	1	.	7.1033	0.25351	0.0:0.2826:0.7174:0.0	rs7081569	19;19;19	E7ERR3;Q5U5R9;Q5VZ98	.;HECD2_HUMAN;.	A	19	ENSP00000401023:P19A;ENSP00000360746:P19A;ENSP00000298068:P19A	ENSP00000298068:P19A	P	+	1	0	HECTD2	93160230	0.858000	0.29795	0.231000	0.23993	0.735000	0.41995	-0.544000	0.06077	0.556000	0.29098	-0.370000	0.07254	CCC	C|0.154;G|0.846		0.761	HECTD2-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000098620.1		
TBC1D12	23232	hgsc.bcm.edu	37	10	96163039	96163039	+	Silent	SNP	C	C	G	rs2477534	byFrequency	TCGA-OR-A5KY-01A-11D-A29I-10	TCGA-OR-A5KY-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	72f9e1d9-c852-423a-94ff-17f763fa2713	f6e93da3-9ee7-4a65-bc04-30f8bb730eef	g.chr10:96163039C>G	ENST00000225235.4	+	1	779	c.669C>G	c.(667-669)ccC>ccG	p.P223P		NM_015188.1	NP_056003.1	O60347	TBC12_HUMAN	TBC1 domain family, member 12	223							Rab GTPase activator activity (GO:0005097)			breast(1)|central_nervous_system(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(5)|upper_aerodigestive_tract(2)	20		Colorectal(252;0.0429)				GGGACAGCCCCGCCAGCAGCT	0.751													G|||	3411	0.68111	0.6165	0.5648	5008	,	,		8936	0.8373		0.6342	False		,,,				2504	0.7382				p.P223P		.											.	TBC1D12-68	0			c.C669G						.	G		1895,863		709,477,193	2.0	3.0	3.0		669	-2.0	0.0	10	dbSNP_100	3	4435,1895		1664,1107,394	yes	coding-synonymous	TBC1D12	NM_015188.1		2373,1584,587	GG,GC,CC		29.9368,31.2908,30.3477		223/776	96163039	6330,2758	1379	3165	4544	SO:0001819	synonymous_variant	23232	exon1			CAGCCCCGCCAGC	AB011180	CCDS41553.1	10q23.33	2013-09-20			ENSG00000108239	ENSG00000108239			29082	protein-coding gene	gene with protein product						9628581	Standard	NM_015188		Approved	KIAA0608	uc001kjr.2	O60347	OTTHUMG00000018794	ENST00000225235.4:c.669C>G	10.37:g.96163039C>G		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	42	42	NM_015188	0	0	0	0	0	Q5VYA6|Q8WX26|Q8WX59|Q9UG83	Silent	SNP	ENST00000225235.4	37	CCDS41553.1																																																																																			C|0.339;G|0.661		0.751	TBC1D12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049482.2		
CNNM2	54805	hgsc.bcm.edu	37	10	104678350	104678350	+	Missense_Mutation	SNP	G	G	A	rs76057237	byFrequency	TCGA-OR-A5KY-01A-11D-A29I-10	TCGA-OR-A5KY-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	72f9e1d9-c852-423a-94ff-17f763fa2713	f6e93da3-9ee7-4a65-bc04-30f8bb730eef	g.chr10:104678350G>A	ENST00000369878.4	+	1	301	c.113G>A	c.(112-114)cGg>cAg	p.R38Q	CNNM2_ENST00000433628.2_Missense_Mutation_p.R38Q|CNNM2_ENST00000369875.3_Missense_Mutation_p.R38Q	NM_017649.4	NP_060119.3	Q9H8M5	CNNM2_HUMAN	cyclin and CBS domain divalent metal cation transport mediator 2	38			R -> Q (in dbSNP:rs76057237). {ECO:0000269|PubMed:21397062}.		magnesium ion homeostasis (GO:0010960)|magnesium ion transport (GO:0015693)	basolateral plasma membrane (GO:0016323)|integral component of membrane (GO:0016021)	adenyl nucleotide binding (GO:0030554)			central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(7)|ovary(1)|prostate(2)|urinary_tract(1)	19		Colorectal(252;0.103)|all_hematologic(284;0.152)|Breast(234;0.198)		Epithelial(162;7.89e-09)|all cancers(201;1.82e-07)|BRCA - Breast invasive adenocarcinoma(275;0.215)		GCTCGCGGCCGGGGGATCCTG	0.731													G|||	160	0.0319489	0.0514	0.0303	5008	,	,		11117	0.001		0.0547	False		,,,				2504	0.0153				p.R38Q		.											.	CNNM2-515	0			c.G113A						.	G	GLN/ARG,GLN/ARG,GLN/ARG	128,3620		0,128,1746	3.0	5.0	4.0		113,113,113	4.1	1.0	10	dbSNP_131	4	346,7028		8,330,3349	no	missense,missense,missense	CNNM2	NM_017649.3,NM_199076.1,NM_199077.1	43,43,43	8,458,5095	AA,AG,GG		4.6922,3.4152,4.2618	benign,benign,benign	38/876,38/854,38/553	104678350	474,10648	1874	3687	5561	SO:0001583	missense	54805	exon1			GCGGCCGGGGGAT	AF216962	CCDS7543.1, CCDS44474.1, CCDS44475.1	10q24.32	2014-08-08	2014-08-07		ENSG00000148842	ENSG00000148842			103	protein-coding gene	gene with protein product		607803	"""cyclin M2"""	ACDP2		21393841, 24699222	Standard	NM_017649		Approved		uc001kwm.3	Q9H8M5	OTTHUMG00000018976	ENST00000369878.4:c.113G>A	10.37:g.104678350G>A	ENSP00000358894:p.Arg38Gln	Somatic	1	0		WXS	Illumina GAIIx	Phase_I	13	11	NM_199076	0	0	3	4	1	Q5T569|Q5T570|Q8WU59|Q9H952|Q9NRK5|Q9NXT4	Missense_Mutation	SNP	ENST00000369878.4	37	CCDS44474.1	76	0.0347985347985348	23	0.046747967479674794	12	0.03314917127071823	0	0.0	41	0.05408970976253298	G	16.50	3.139907	0.56936	0.034152	0.046922	ENSG00000148842	ENST00000457502;ENST00000433628;ENST00000369875;ENST00000369878;ENST00000345419;ENST00000541201	T;T;T	0.75477	-0.76;-0.94;-0.77	5.05	4.12	0.48240	.	1.041610	0.07620	N	0.926920	T	0.14787	0.0357	N	0.08118	0	0.27062	N	0.963525	P;P;P	0.45672	0.864;0.787;0.864	B;B;B	0.30316	0.114;0.053;0.114	T	0.11991	-1.0565	10	0.46703	T	0.11	.	11.9199	0.52785	0.0:0.0:0.8254:0.1746	.	38;38;38	Q9H8M5-2;Q9H8M5;F5H1I3	.;CNNM2_HUMAN;.	Q	38	ENSP00000392875:R38Q;ENSP00000358891:R38Q;ENSP00000358894:R38Q	ENSP00000286899:R38Q	R	+	2	0	CNNM2	104668340	1.000000	0.71417	1.000000	0.80357	0.964000	0.63967	1.910000	0.39927	1.308000	0.44962	0.555000	0.69702	CGG	G|0.964;A|0.036		0.731	CNNM2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000050113.3	NM_017649	
PWWP2B	170394	hgsc.bcm.edu	37	10	134219066	134219066	+	Silent	SNP	G	G	C	rs76595411	byFrequency	TCGA-OR-A5KY-01A-11D-A29I-10	TCGA-OR-A5KY-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	72f9e1d9-c852-423a-94ff-17f763fa2713	f6e93da3-9ee7-4a65-bc04-30f8bb730eef	g.chr10:134219066G>C	ENST00000305233.5	+	2	1121	c.1062G>C	c.(1060-1062)gtG>gtC	p.V354V	PWWP2B_ENST00000368609.4_Silent_p.V354V	NM_138499.3	NP_612508.3	Q6NUJ5	PWP2B_HUMAN	PWWP domain containing 2B	354										central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(5)|urinary_tract(1)	9		all_cancers(35;6.69e-12)|all_epithelial(44;1.55e-08)|Lung NSC(174;0.000845)|all_lung(145;0.00144)|all_neural(114;0.0299)|Breast(234;0.106)|Colorectal(31;0.109)|Melanoma(40;0.123)|Glioma(114;0.203)|all_hematologic(284;0.224)		OV - Ovarian serous cystadenocarcinoma(35;7.49e-05)|Epithelial(32;0.00016)|all cancers(32;0.000186)		CCGAGCTGGTGGGGGAGCTGA	0.726													G|||	150	0.0299521	0.0083	0.0504	5008	,	,		14238	0.002		0.0636	False		,,,				2504	0.0389				p.V354V		.											.	PWWP2B-90	0			c.G1062C						.	G	,	58,4234		0,58,2088	21.0	26.0	24.0		1062,1062	-1.9	0.8	10	dbSNP_132	24	487,7941		17,453,3744	no	coding-synonymous,coding-synonymous	PWWP2B	NM_001098637.1,NM_138499.3	,	17,511,5832	CC,CG,GG		5.7784,1.3514,4.2846	,	354/500,354/591	134219066	545,12175	2146	4214	6360	SO:0001819	synonymous_variant	170394	exon2			GCTGGTGGGGGAG	AK128663	CCDS7667.2	10q26.3	2009-06-03	2007-10-22	2007-10-22	ENSG00000171813	ENSG00000171813			25150	protein-coding gene	gene with protein product			"""PWWP domain containing 2"""	PWWP2			Standard	NM_001098637		Approved	bA432J24.1, FLJ46823	uc001lll.4	Q6NUJ5	OTTHUMG00000019286	ENST00000305233.5:c.1062G>C	10.37:g.134219066G>C		Somatic	1	0		WXS	Illumina GAIIx	Phase_I	33	13	NM_001098637	0	0	37	55	18	A6NM90|B5MDQ1|H9KV61|Q5SZI0|Q6ZQX5|Q96F43	Silent	SNP	ENST00000305233.5	37	CCDS7667.2																																																																																			G|0.955;C|0.045		0.726	PWWP2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051075.3	NM_138499	
NLRP6	171389	hgsc.bcm.edu	37	11	280673	280673	+	Silent	SNP	C	C	T	rs12807092	byFrequency	TCGA-OR-A5KY-01A-11D-A29I-10	TCGA-OR-A5KY-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	72f9e1d9-c852-423a-94ff-17f763fa2713	f6e93da3-9ee7-4a65-bc04-30f8bb730eef	g.chr11:280673C>T	ENST00000312165.5	+	4	939	c.939C>T	c.(937-939)agC>agT	p.S313S	NLRP6_ENST00000534750.1_Silent_p.S313S	NM_138329.1	NP_612202.2	P59044	NALP6_HUMAN	NLR family, pyrin domain containing 6	313	NACHT. {ECO:0000255|PROSITE- ProRule:PRU00136}.				G-protein coupled receptor signaling pathway (GO:0007186)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of immune response (GO:0050777)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of toll-like receptor signaling pathway (GO:0034122)|regulation of inflammatory response (GO:0050727)|response to bacterium (GO:0009617)|wound healing (GO:0042060)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|vasopressin receptor activity (GO:0005000)			breast(1)|skin(1)|upper_aerodigestive_tract(2)	4		all_cancers(49;1.12e-06)|all_epithelial(84;0.000375)|Breast(177;0.00122)|Ovarian(85;0.0228)|Medulloblastoma(188;0.0321)|all_neural(188;0.0762)		all cancers(45;4.28e-28)|Epithelial(43;2.47e-27)|OV - Ovarian serous cystadenocarcinoma(40;4.66e-21)|BRCA - Breast invasive adenocarcinoma(625;3.57e-05)|Lung(200;0.0485)|LUSC - Lung squamous cell carcinoma(625;0.122)		GGCTGCTGAGCAAGGCGCTGC	0.796													T|||	2441	0.48742	0.2209	0.7363	5008	,	,		9841	0.2579		0.8032	False		,,,				2504	0.5828				p.S313S		.											.	NLRP6-583	0			c.C939T						.	T		1499,1341		352,795,273	3.0	4.0	4.0		939	1.1	0.7	11	dbSNP_121	4	5309,877		2280,749,64	no	coding-synonymous	NLRP6	NM_138329.1		2632,1544,337	TT,TC,CC		14.1772,47.2183,24.5735		313/893	280673	6808,2218	1420	3093	4513	SO:0001819	synonymous_variant	171389	exon4			GCTGAGCAAGGCG	AF479748	CCDS7693.1, CCDS60680.1	11p15	2006-12-08	2006-12-08	2006-12-08	ENSG00000174885	ENSG00000174885		"""Nucleotide-binding domain and leucine rich repeat containing"""	22944	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 6"""	609650	"""NACHT, leucine rich repeat and PYD containing 6"""	NALP6		12563287, 12019269	Standard	NM_138329		Approved	PYPAF5, PAN3, CLR11.4	uc010qvs.3	P59044	OTTHUMG00000119070	ENST00000312165.5:c.939C>T	11.37:g.280673C>T		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	7	7	NM_138329	0	0	0	0	0	A8K9F3|E9PJZ8	Silent	SNP	ENST00000312165.5	37	CCDS7693.1																																																																																			C|0.479;T|0.521		0.796	NLRP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000239283.1	NM_138329	
LRRC56	115399	bcgsc.ca	37	11	554018	554018	+	Silent	SNP	G	G	A	rs112033363	byFrequency	TCGA-OR-A5KY-01A-11D-A29I-10	TCGA-OR-A5KY-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	72f9e1d9-c852-423a-94ff-17f763fa2713	f6e93da3-9ee7-4a65-bc04-30f8bb730eef	g.chr11:554018G>A	ENST00000270115.7	+	14	1871	c.1371G>A	c.(1369-1371)agG>agA	p.R457R		NM_198075.3	NP_932341.1	Q8IYG6	LRC56_HUMAN	leucine rich repeat containing 56	457										kidney(1)|lung(4)|skin(1)	6		all_cancers(49;2.16e-06)|all_epithelial(84;0.000256)|Breast(177;0.00122)|Ovarian(85;0.0228)|Medulloblastoma(188;0.0321)|all_neural(188;0.0762)		all cancers(45;7.63e-28)|Epithelial(43;7.29e-27)|OV - Ovarian serous cystadenocarcinoma(40;7.15e-21)|BRCA - Breast invasive adenocarcinoma(625;3.56e-05)|Lung(200;0.0375)|LUSC - Lung squamous cell carcinoma(625;0.0703)		AGCACCCAAGGCCACGAGATT	0.667													G|||	275	0.0549121	0.0507	0.049	5008	,	,		16806	0.0466		0.0656	False		,,,				2504	0.0624				p.R457R		.											.	LRRC56-91	0			c.G1371A						.	G		274,4132	149.2+/-183.4	10,254,1939	94.0	96.0	95.0		1371	2.0	0.0	11	dbSNP_132	95	530,8068	144.8+/-200.6	21,488,3790	no	coding-synonymous	LRRC56	NM_198075.3		31,742,5729	AA,AG,GG		6.1642,6.2188,6.1827		457/543	554018	804,12200	2203	4299	6502	SO:0001819	synonymous_variant	115399	exon14			CCCAAGGCCACGA		CCDS7700.1	11p15.5	2005-10-18			ENSG00000161328	ENSG00000161328			25430	protein-coding gene	gene with protein product						12477932	Standard	NM_198075		Approved	FLJ00101, DKFZp761L1518	uc010qvz.2	Q8IYG6	OTTHUMG00000132003	ENST00000270115.7:c.1371G>A	11.37:g.554018G>A		Somatic	77	0		WXS	Illumina GAIIx	Phase_I	112	5	NM_198075	0	0	2	2	0	Q8N3Q4	Silent	SNP	ENST00000270115.7	37	CCDS7700.1																																																																																			G|0.939;A|0.061		0.667	LRRC56-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254969.1	NM_198075	
EPS8L2	64787	broad.mit.edu	37	11	726471	726471	+	Missense_Mutation	SNP	G	G	T			TCGA-OR-A5KY-01A-11D-A29I-10	TCGA-OR-A5KY-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	72f9e1d9-c852-423a-94ff-17f763fa2713	f6e93da3-9ee7-4a65-bc04-30f8bb730eef	g.chr11:726471G>T	ENST00000533256.1	+	20	2296	c.1921G>T	c.(1921-1923)Gcc>Tcc	p.A641S	AP006621.9_ENST00000527021.2_RNA|EPS8L2_ENST00000530636.1_Missense_Mutation_p.A641S|EPS8L2_ENST00000318562.8_Missense_Mutation_p.A641S|EPS8L2_ENST00000526198.1_Missense_Mutation_p.A657S			Q9H6S3	ES8L2_HUMAN	EPS8-like 2	641					positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of Rho GTPase activity (GO:0032321)|positive regulation of ruffle assembly (GO:1900029)|regulation of Rho protein signal transduction (GO:0035023)|Rho protein signal transduction (GO:0007266)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|ruffle membrane (GO:0032587)|vesicle (GO:0031982)	actin binding (GO:0003779)			NS(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(2)|pancreas(1)|prostate(2)|soft_tissue(1)|urinary_tract(1)	13		all_cancers(49;1.24e-08)|all_epithelial(84;1.87e-05)|Breast(177;0.000286)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.106)|all_lung(207;0.136)		all cancers(45;4.37e-27)|Epithelial(43;2.81e-26)|OV - Ovarian serous cystadenocarcinoma(40;1.33e-20)|BRCA - Breast invasive adenocarcinoma(625;4.29e-05)|Lung(200;0.0582)|LUSC - Lung squamous cell carcinoma(625;0.0703)		GGAAGCCAAGGCCTTCAGCCC	0.756																																					p.A641S		.											.	EPS8L2-91	0			c.G1921T						.																																			SO:0001583	missense	64787	exon19			GCCAAGGCCTTCA	AF318331	CCDS31328.1	11p15.5	2008-02-05				ENSG00000177106			21296	protein-coding gene	gene with protein product		614988				12620401	Standard	NM_022772		Approved	FLJ21935, FLJ22171, MGC3088	uc001lqt.3	Q9H6S3		ENST00000533256.1:c.1921G>T	11.37:g.726471G>T	ENSP00000435585:p.Ala641Ser	Somatic	15	1		WXS	Illumina GAIIx	Phase_I	76	6	NM_022772	0	0	0	0	0	B3KSX1|B7ZKL3|Q53GM8|Q8WYW7|Q96K06|Q9H6K9	Missense_Mutation	SNP	ENST00000533256.1	37	CCDS31328.1	.	.	.	.	.	.	.	.	.	.	G	13.36	2.212487	0.39102	.	.	ENSG00000177106	ENST00000318562;ENST00000533256;ENST00000530636;ENST00000526198	T;T;T;T	0.16196	2.36;2.36;2.36;2.36	3.3	1.09	0.20402	.	0.208508	0.29383	U	0.012303	T	0.11153	0.0272	L	0.27053	0.805	0.26101	N	0.980812	B;B	0.14438	0.01;0.01	B;B	0.10450	0.005;0.003	T	0.23297	-1.0192	10	0.45353	T	0.12	-19.1124	9.8968	0.41322	0.0:0.0:0.5629:0.4371	.	657;641	B7ZKL3;Q9H6S3	.;ES8L2_HUMAN	S	641;641;641;657	ENSP00000320828:A641S;ENSP00000435585:A641S;ENSP00000436035:A641S;ENSP00000436230:A657S	ENSP00000320828:A641S	A	+	1	0	EPS8L2	716471	1.000000	0.71417	0.995000	0.50966	0.558000	0.35554	2.264000	0.43302	0.706000	0.31912	0.298000	0.19748	GCC	.		0.756	EPS8L2-003	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382344.1	NM_022772	
MUC2	4583	broad.mit.edu	37	11	1093204	1093204	+	Missense_Mutation	SNP	C	C	A	rs56299570		TCGA-OR-A5KY-01A-11D-A29I-10	TCGA-OR-A5KY-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	72f9e1d9-c852-423a-94ff-17f763fa2713	f6e93da3-9ee7-4a65-bc04-30f8bb730eef	g.chr11:1093204C>A	ENST00000441003.2	+	30	5050	c.5023C>A	c.(5023-5025)Cca>Aca	p.P1675T	MUC2_ENST00000361558.6_Intron|MUC2_ENST00000333592.6_5'Flank|MUC2_ENST00000359061.5_Missense_Mutation_p.P1642T	NM_002457.2	NP_002448.2	Q02817	MUC2_HUMAN	mucin 2, oligomeric mucus/gel-forming	0	Approximate repeats.				cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi lumen (GO:0005796)|inner mucus layer (GO:0070702)|outer mucus layer (GO:0070703)		p.P1675T(1)|p.P1642T(1)		NS(3)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(26)|haematopoietic_and_lymphoid_tissue(4)|kidney(11)|large_intestine(5)|lung(22)|ovary(2)|prostate(16)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	102		all_cancers(49;1.08e-07)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.191)		BRCA - Breast invasive adenocarcinoma(625;0.000207)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)	Pranlukast(DB01411)	gtccccaaccccaacagccat	0.627																																					p.P1675T		.											.	MUC2-90	2	Substitution - Missense(2)	kidney(2)	c.C5023A						.																																			SO:0001583	missense	4583	exon30			CCAACCCCAACAG	L21998		11p15.5	2011-01-28	2006-03-14		ENSG00000198788	ENSG00000198788		"""Mucins"""	7512	protein-coding gene	gene with protein product		158370	"""mucin 2, intestinal/tracheal"""			15081123	Standard	NM_002457		Approved		uc001lsx.1	Q02817	OTTHUMG00000156800	ENST00000441003.2:c.5023C>A	11.37:g.1093204C>A	ENSP00000415183:p.Pro1675Thr	Somatic	71	0		WXS	Illumina GAIIx	Phase_I	64	8	NM_002457	0	0	0	0	0	Q14878	Missense_Mutation	SNP	ENST00000441003.2	37		.	.	.	.	.	.	.	.	.	.	C	0.954	-0.705464	0.03255	.	.	ENSG00000198788	ENST00000441003;ENST00000359061	T;T	0.09073	3.02;3.53	1.75	-3.49	0.04724	.	0.575351	0.10542	U	0.662513	T	0.04092	0.0114	.	.	.	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.45381	-0.9265	9	0.16896	T	0.51	.	6.9769	0.24681	0.6778:0.3222:0.0:0.0	rs56299570	1675	E7EUV1	.	T	1675;1642	ENSP00000415183:P1675T;ENSP00000351956:P1642T	ENSP00000351956:P1642T	P	+	1	0	MUC2	1083204	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	-3.268000	0.00533	-1.450000	0.01936	0.184000	0.17185	CCA	.		0.627	MUC2-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000345894.2	NM_002457	
MEN1	4221	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	64572613	64572613	+	Nonsense_Mutation	SNP	G	G	A			TCGA-OR-A5KY-01A-11D-A29I-10	TCGA-OR-A5KY-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	72f9e1d9-c852-423a-94ff-17f763fa2713	f6e93da3-9ee7-4a65-bc04-30f8bb730eef	g.chr11:64572613G>A	ENST00000337652.1	-	9	1761	c.1258C>T	c.(1258-1260)Cga>Tga	p.R420*	MEN1_ENST00000315422.4_Nonsense_Mutation_p.R415*|MEN1_ENST00000377316.2_Intron|MEN1_ENST00000394376.1_Nonsense_Mutation_p.R420*|MEN1_ENST00000443283.1_Nonsense_Mutation_p.R420*|MAP4K2_ENST00000377350.3_5'Flank|MEN1_ENST00000478548.1_5'UTR|MAP4K2_ENST00000294066.2_5'Flank|MEN1_ENST00000377326.3_Nonsense_Mutation_p.R415*|MEN1_ENST00000377313.1_Nonsense_Mutation_p.R420*|MEN1_ENST00000394374.2_Nonsense_Mutation_p.R420*|MEN1_ENST00000312049.6_Nonsense_Mutation_p.R415*|MEN1_ENST00000377321.1_Nonsense_Mutation_p.R380*|MAP4K2_ENST00000468062.1_5'Flank	NM_130803.2	NP_570715	O00255	MEN1_HUMAN	multiple endocrine neoplasia I	420			R -> P (in MEN1). {ECO:0000269|PubMed:10993647}.		brain development (GO:0007420)|cell cycle arrest (GO:0007050)|cellular response to DNA damage stimulus (GO:0006974)|chromatin remodeling (GO:0006338)|DNA repair (GO:0006281)|embryonic skeletal system morphogenesis (GO:0048704)|gene expression (GO:0010467)|hemopoiesis (GO:0030097)|histone lysine methylation (GO:0034968)|leukocyte homeostasis (GO:0001776)|MAPK cascade (GO:0000165)|maternal process involved in female pregnancy (GO:0060135)|negative regulation of cell cycle (GO:0045786)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of JNK cascade (GO:0046329)|negative regulation of organ growth (GO:0046621)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of telomerase activity (GO:0051974)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|osteoblast development (GO:0002076)|osteoblast fate commitment (GO:0002051)|palate development (GO:0060021)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell division (GO:0051781)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of histone methylation (GO:0031062)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of protein binding (GO:0032092)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|regulation of activin receptor signaling pathway (GO:0032925)|response to gamma radiation (GO:0010332)|response to UV (GO:0009411)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	chromatin (GO:0000785)|cleavage furrow (GO:0032154)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|histone methyltransferase complex (GO:0035097)|nuclear matrix (GO:0016363)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)	chromatin binding (GO:0003682)|double-stranded DNA binding (GO:0003690)|four-way junction DNA binding (GO:0000400)|protein binding, bridging (GO:0030674)|protein N-terminus binding (GO:0047485)|R-SMAD binding (GO:0070412)|sequence-specific DNA binding (GO:0043565)|transcription regulatory region DNA binding (GO:0044212)|Y-form DNA binding (GO:0000403)	p.L414_E425del(1)		NS(7)|adrenal_gland(5)|breast(2)|central_nervous_system(5)|endometrium(1)|gastrointestinal_tract_(site_indeterminate)(15)|large_intestine(2)|lung(21)|ovary(1)|pancreas(64)|parathyroid(181)|pituitary(7)|prostate(4)|retroperitoneum(1)|skin(1)|small_intestine(13)|soft_tissue(4)|stomach(1)|thymus(2)	337						TCGTAGAATCGCAGCAGGTGG	0.617			"""D, Mis, N, F, S"""		"""parathyroid tumors, Pancreatic neuroendocrine tumors"""	"""parathyroid adenoma, pituitary adenoma, pancreatic islet cell, carcinoid"""			Multiple Endocrine Neoplasia, type 1;Hyperparathyroidism, Familial Isolated																												p.R420X	Esophageal Squamous(1;83 158 15500 18603 18803 29295)	.	yes	Rec	yes	Multiple Endocrine Neoplasia Type 1	11	11q13	4221	multiple endocrine neoplasia type 1 gene		E	.	MEN1-3017	1	Deletion - In frame(1)	parathyroid(1)	c.C1258T	GRCh37	CD982775|CM970937	MEN1	D|M		.						79.0	71.0	74.0					11																	64572613		2201	4297	6498	SO:0001587	stop_gained	4221	exon9	Familial Cancer Database	MEN1, Wermer disease;FIHP, FIHPT, HRPT1, Familial Isolated Primary Hyperparathyroidism	AGAATCGCAGCAG	U93236	CCDS8083.1, CCDS31600.1	11q13	2014-09-17			ENSG00000133895	ENSG00000133895			7010	protein-coding gene	gene with protein product	"""menin"""	613733					Standard	NM_130799		Approved		uc001obn.3	O00255	OTTHUMG00000045366	ENST00000337652.1:c.1258C>T	11.37:g.64572613G>A	ENSP00000337088:p.Arg420*	Somatic	140	1		WXS	Illumina GAIIx	Phase_I	92	68	NM_130800	0	0	0	0	0	A5HBC6|A5HBC7|A5HBC8|A5HBC9|A5HBD0|A5HBD1|A5HBD2|O00632|Q9BUF0|Q9BUK2	Nonsense_Mutation	SNP	ENST00000337652.1	37	CCDS8083.1	.	.	.	.	.	.	.	.	.	.	G	36	5.959778	0.97145	.	.	ENSG00000133895	ENST00000377321;ENST00000377326;ENST00000312049;ENST00000315422;ENST00000337652;ENST00000394376;ENST00000394374;ENST00000443283;ENST00000377313	.	.	.	3.71	3.71	0.42584	.	0.363430	0.27531	N	0.018960	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-10.6431	13.4541	0.61189	0.0:0.0:1.0:0.0	.	.	.	.	X	380;415;415;415;420;420;420;420;420	.	ENSP00000308975:R415X	R	-	1	2	MEN1	64329189	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	4.548000	0.60718	2.104000	0.64026	0.456000	0.33151	CGA	.		0.617	MEN1-201	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000143881.1		
TM7SF2	7108	hgsc.bcm.edu	37	11	64880090	64880090	+	Silent	SNP	G	G	C	rs4930284	byFrequency	TCGA-OR-A5KY-01A-11D-A29I-10	TCGA-OR-A5KY-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	72f9e1d9-c852-423a-94ff-17f763fa2713	f6e93da3-9ee7-4a65-bc04-30f8bb730eef	g.chr11:64880090G>C	ENST00000279263.7	+	2	318	c.156G>C	c.(154-156)ccG>ccC	p.P52P	TM7SF2_ENST00000345348.5_Silent_p.P52P|TM7SF2_ENST00000540748.1_5'UTR|AP003068.9_ENST00000528887.1_RNA	NM_003273.2	NP_003264.2	O76062	ERG24_HUMAN	transmembrane 7 superfamily member 2	52					cholesterol biosynthetic process (GO:0006695)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of plasma membrane (GO:0005887)|receptor complex (GO:0043235)	delta14-sterol reductase activity (GO:0050613)			lung(14)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	18						CGTCCCTGCCGGGGCTGGAGG	0.756													C|||	4990	0.996406	0.9879	0.9986	5008	,	,		10438	1.0		0.999	False		,,,				2504	1.0				p.P52P		.											.	TM7SF2-91	0			c.G156C						.	C		2924,8		1458,8,0	2.0	2.0	2.0		156	-9.8	0.0	11	dbSNP_111	2	6426,0		3213,0,0	no	coding-synonymous	TM7SF2	NM_003273.2		4671,8,0	CC,CG,GG		0.0,0.2729,0.0855		52/419	64880090	9350,8	1466	3213	4679	SO:0001819	synonymous_variant	7108	exon2			CCTGCCGGGGCTG	BC012857	CCDS41669.1, CCDS60846.1	11q13.1	2013-05-23			ENSG00000149809	ENSG00000149809	1.3.1.70		11863	protein-coding gene	gene with protein product	"""delta(14)-sterol reductase"""	603414				9615229, 9286704	Standard	NM_003273		Approved	ANG1, DHCR14A, NET47	uc001oct.4	O76062	OTTHUMG00000165603	ENST00000279263.7:c.156G>C	11.37:g.64880090G>C		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	13	13	NM_003273	0	0	0	126	126	A8K4H0|O95982|Q8IY06|Q96E64|Q96GZ1	Silent	SNP	ENST00000279263.7	37	CCDS41669.1																																																																																			G|0.005;C|0.995		0.756	TM7SF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385234.1	NM_003273	
CST6	1474	hgsc.bcm.edu	37	11	65779590	65779590	+	Silent	SNP	C	C	T	rs1131544	byFrequency	TCGA-OR-A5KY-01A-11D-A29I-10	TCGA-OR-A5KY-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	72f9e1d9-c852-423a-94ff-17f763fa2713	f6e93da3-9ee7-4a65-bc04-30f8bb730eef	g.chr11:65779590C>T	ENST00000312134.2	+	1	279	c.75C>T	c.(73-75)gaC>gaT	p.D25D		NM_001323.3	NP_001314.1	Q15828	CYTM_HUMAN	cystatin E/M	25					anatomical structure morphogenesis (GO:0009653)|epidermis development (GO:0008544)|negative regulation of endopeptidase activity (GO:0010951)	cornified envelope (GO:0001533)|extracellular vesicular exosome (GO:0070062)	cysteine-type endopeptidase inhibitor activity (GO:0004869)			large_intestine(1)|lung(1)|ovary(1)	3						TGCCACGCGACGCCCGGGCCC	0.746													C|||	356	0.0710863	0.0219	0.0922	5008	,	,		12347	0.001		0.162	False		,,,				2504	0.1012				p.D25D		.											.	CST6-523	0			c.C75T						.	C		164,3936		5,154,1891	5.0	6.0	5.0		75	-4.6	0.0	11	dbSNP_86	5	1227,6867		88,1051,2908	no	coding-synonymous	CST6	NM_001323.3		93,1205,4799	TT,TC,CC		15.1594,4.0,11.4072		25/150	65779590	1391,10803	2050	4047	6097	SO:0001819	synonymous_variant	1474	exon1			ACGCGACGCCCGG	U62800	CCDS8126.1	11q13	2005-09-29			ENSG00000175315	ENSG00000175315			2478	protein-coding gene	gene with protein product		601891				9154125, 9099741	Standard	NM_001323		Approved		uc001ogr.3	Q15828	OTTHUMG00000166750	ENST00000312134.2:c.75C>T	11.37:g.65779590C>T		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	29	27	NM_001323	0	0	0	0	0	Q540N7	Silent	SNP	ENST00000312134.2	37	CCDS8126.1																																																																																			C|0.921;T|0.079		0.746	CST6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391348.1	NM_001323	
FGF4	2249	hgsc.bcm.edu	37	11	69589556	69589556	+	Silent	SNP	G	G	A	rs11600280	byFrequency	TCGA-OR-A5KY-01A-11D-A29I-10	TCGA-OR-A5KY-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	72f9e1d9-c852-423a-94ff-17f763fa2713	f6e93da3-9ee7-4a65-bc04-30f8bb730eef	g.chr11:69589556G>A	ENST00000168712.1	-	1	615	c.297C>T	c.(295-297)ctC>ctT	p.L99L	AP001888.1_ENST00000602104.1_5'Flank|FGF4_ENST00000538040.1_5'UTR	NM_002007.2	NP_001998.1	P08620	FGF4_HUMAN	fibroblast growth factor 4	99					apoptotic process involved in morphogenesis (GO:0060561)|cartilage condensation (GO:0001502)|cell-cell signaling (GO:0007267)|chondroblast differentiation (GO:0060591)|cranial suture morphogenesis (GO:0060363)|embryonic hindlimb morphogenesis (GO:0035116)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|mesenchymal cell proliferation (GO:0010463)|negative regulation of apoptotic process (GO:0043066)|neurotrophin TRK receptor signaling pathway (GO:0048011)|odontogenesis of dentin-containing tooth (GO:0042475)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cell division (GO:0051781)|positive regulation of cell proliferation (GO:0008284)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|signal transduction (GO:0007165)|stem cell maintenance (GO:0019827)	cytosol (GO:0005829)|extracellular region (GO:0005576)|nucleus (GO:0005634)	growth factor activity (GO:0008083)|heparin binding (GO:0008201)			lung(3)	3	Melanoma(5;1.89e-05)		LUSC - Lung squamous cell carcinoma(11;3.74e-15)|STAD - Stomach adenocarcinoma(18;0.0278)		Pentosan Polysulfate(DB00686)	GGCCGTCGGGGAGCGCCTGGA	0.776													G|||	145	0.0289537	0.0008	0.0548	5008	,	,		8358	0.0		0.0865	False		,,,				2504	0.0194				p.L99L		.											.	FGF4-1270	0			c.C297T						.	G		45,3935		0,45,1945	4.0	4.0	4.0		297	-0.8	1.0	11	dbSNP_120	4	419,7473		7,405,3534	no	coding-synonymous	FGF4	NM_002007.2		7,450,5479	AA,AG,GG		5.3092,1.1307,3.9084		99/207	69589556	464,11408	1990	3946	5936	SO:0001819	synonymous_variant	2249	exon1			GTCGGGGAGCGCC	M17446	CCDS8194.1	11q13.3	2014-01-30	2008-08-01		ENSG00000075388	ENSG00000075388		"""Endogenous ligands"""	3682	protein-coding gene	gene with protein product	"""human stomach cancer, transforming factor from FGF-related oncogene"", ""kaposi sarcoma oncogene"", ""transforming protein KS3"""	164980	"""heparin secretory transforming protein 1"""	HSTF1		1611909	Standard	NM_002007		Approved	K-FGF, HBGF-4, HST, HST-1, KFGF	uc001opg.1	P08620	OTTHUMG00000167887	ENST00000168712.1:c.297C>T	11.37:g.69589556G>A		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	6	6	NM_002007	0	0	0	0	0	B7U994	Silent	SNP	ENST00000168712.1	37	CCDS8194.1																																																																																			G|0.967;A|0.033		0.776	FGF4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396834.2	NM_002007	
B3GNT6	192134	hgsc.bcm.edu	37	11	76751542	76751542	+	Frame_Shift_Del	DEL	T	T	-	rs11292198		TCGA-OR-A5KY-01A-11D-A29I-10	TCGA-OR-A5KY-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	72f9e1d9-c852-423a-94ff-17f763fa2713	f6e93da3-9ee7-4a65-bc04-30f8bb730eef	g.chr11:76751542delT	ENST00000533140.1	+	2	1085	c.947delT	c.(946-948)cttfs	p.L316fs	B3GNT6_ENST00000421061.1_Intron|B3GNT6_ENST00000354301.5_Splice_Site_p.L316fs			O43505	B3GN1_HUMAN	UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 6 (core 3 synthase)	0					axon guidance (GO:0007411)|carbohydrate metabolic process (GO:0005975)|glycosaminoglycan metabolic process (GO:0030203)|keratan sulfate biosynthetic process (GO:0018146)|keratan sulfate metabolic process (GO:0042339)|poly-N-acetyllactosamine biosynthetic process (GO:0030311)|protein glycosylation (GO:0006486)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|integral component of Golgi membrane (GO:0030173)	N-acetyllactosaminide beta-1,3-N-acetylglucosaminyltransferase activity (GO:0008532)			central_nervous_system(1)|kidney(2)|lung(4)|prostate(1)	8						GGCATGTGTCTTGGAGCGCGC	0.741													T|TT|T|insertion	5008	1.0	1.0	1.0	5008	,	,		12582	1.0		1.0	False		,,,				2504	1.0				.		.											.	.	0			c.946+1T>-						.						1.0	1.0	1.0					11																	76751542		431	917	1348	SO:0001589	frameshift_variant	192134	exon2			TGTGTCTTGGAGC	AB073740	CCDS53681.1	11q13.4	2013-02-19			ENSG00000198488	ENSG00000198488		"""Beta 3-glycosyltransferases"""	24141	protein-coding gene	gene with protein product		615315				11821425	Standard	NM_138706		Approved	B3Gn-T6	uc021qnp.1	Q6ZMB0		ENST00000533140.1:c.947delT	11.37:g.76751542delT	ENSP00000435352:p.Leu316fs	Somatic	1	0		WXS	Illumina GAIIx	Phase_I	28	28	NM_138706	0	0	0	0	0	Q4TTN0	Splice_Site	DEL	ENST00000533140.1	37	CCDS53681.1																																																																																			.		0.741	B3GNT6-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000382740.2	NM_138706	
KRT7	3855	hgsc.bcm.edu	37	12	52627215	52627215	+	Silent	SNP	A	A	G	rs7308888	byFrequency	TCGA-OR-A5KY-01A-11D-A29I-10	TCGA-OR-A5KY-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	72f9e1d9-c852-423a-94ff-17f763fa2713	f6e93da3-9ee7-4a65-bc04-30f8bb730eef	g.chr12:52627215A>G	ENST00000331817.5	+	1	318	c.135A>G	c.(133-135)tcA>tcG	p.S45S		NM_005556.3	NP_005547.3	P08729	K2C7_HUMAN	keratin 7	45	Head.				viral process (GO:0016032)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)|keratin filament (GO:0045095)|nucleus (GO:0005634)	structural molecule activity (GO:0005198)			endometrium(1)|kidney(1)|large_intestine(3)|lung(5)|prostate(2)|stomach(1)|urinary_tract(1)	14				BRCA - Breast invasive adenocarcinoma(357;0.105)	Primaquine(DB01087)	TCGGCGCCTCACGGCCGCGCG	0.771													g|||	4451	0.888778	0.9781	0.8473	5008	,	,		10346	0.9048		0.8191	False		,,,				2504	0.8528				p.S45S		.											.	KRT7-90	0			c.A135G						.			3161,173		1496,169,2	4.0	6.0	5.0		135	-5.3	0.0	12	dbSNP_116	5	5763,1251		2369,1025,113	no	coding-synonymous	KRT7	NM_005556.3		3865,1194,115	GG,GA,AA		17.8358,5.189,13.7611		45/470	52627215	8924,1424	1667	3507	5174	SO:0001819	synonymous_variant	3855	exon1			CGCCTCACGGCCG		CCDS8822.1	12q13.13	2013-01-16			ENSG00000135480	ENSG00000135480		"""-"", ""Intermediate filaments type II, keratins (basic)"""	6445	protein-coding gene	gene with protein product	"""keratin, type II cytoskeletal 7"", ""cytokeratin 7"", ""sarcolectin"", ""keratin, 55K type II cytoskeletal"""	148059				1713141, 16831889	Standard	XR_245927		Approved	K7, CK7, K2C7, SCL	uc001saa.1	P08729	OTTHUMG00000169580	ENST00000331817.5:c.135A>G	12.37:g.52627215A>G		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	10	10	NM_005556	0	0	0	0	0	Q92676|Q9BUD8|Q9Y3R7	Silent	SNP	ENST00000331817.5	37	CCDS8822.1																																																																																			A|0.133;G|0.867		0.771	KRT7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404897.1	NM_005556	
KRT8	3856	broad.mit.edu	37	12	53298675	53298675	+	Missense_Mutation	SNP	A	A	C			TCGA-OR-A5KY-01A-11D-A29I-10	TCGA-OR-A5KY-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	72f9e1d9-c852-423a-94ff-17f763fa2713	f6e93da3-9ee7-4a65-bc04-30f8bb730eef	g.chr12:53298675A>C	ENST00000552551.1	-	2	523	c.91T>G	c.(91-93)Tcc>Gcc	p.S31A	KRT8_ENST00000293308.6_Missense_Mutation_p.S31A|KRT8_ENST00000546897.1_Missense_Mutation_p.S31A|KRT8_ENST00000552150.1_Missense_Mutation_p.S59A			P05787	K2C8_HUMAN	keratin 8	31	Head.|Ser-rich.				cell differentiation involved in embryonic placenta development (GO:0060706)|extrinsic apoptotic signaling pathway (GO:0097191)|hepatocyte apoptotic process (GO:0097284)|response to hydrostatic pressure (GO:0051599)|response to other organism (GO:0051707)|sarcomere organization (GO:0045214)|tumor necrosis factor-mediated signaling pathway (GO:0033209)|viral process (GO:0016032)	cell-cell junction (GO:0005911)|costamere (GO:0043034)|cytoplasm (GO:0005737)|dystrophin-associated glycoprotein complex (GO:0016010)|extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)|keratin filament (GO:0045095)|nucleus (GO:0005634)|sarcolemma (GO:0042383)|Z disc (GO:0030018)	scaffold protein binding (GO:0097110)|structural molecule activity (GO:0005198)	p.S31A(4)		endometrium(5)|large_intestine(1)|liver(1)|lung(3)|ovary(1)|prostate(1)|skin(1)	13				BRCA - Breast invasive adenocarcinoma(357;0.108)	Tenecteplase(DB00031)	CTGATGCGGGAACCGGGCCCA	0.662																																					p.S59A		.											.	KRT8-92	4	Substitution - Missense(4)	endometrium(2)|prostate(1)|liver(1)	c.T175G						.						12.0	14.0	13.0					12																	53298675		2120	4158	6278	SO:0001583	missense	3856	exon2			TGCGGGAACCGGG	BC000654	CCDS8841.1, CCDS58234.1	12q13.13	2013-01-16			ENSG00000170421	ENSG00000170421		"""-"", ""Intermediate filaments type II, keratins (basic)"""	6446	protein-coding gene	gene with protein product		148060				2434381, 1705144, 16831889	Standard	NM_002273		Approved	CARD2, K8, CK8, CYK8, K2C8, KO	uc009zmk.1	P05787	OTTHUMG00000169881	ENST00000552551.1:c.91T>G	12.37:g.53298675A>C	ENSP00000447566:p.Ser31Ala	Somatic	70	1		WXS	Illumina GAIIx	Phase_I	172	6	NM_001256282	0	0	1	1	0	A8K4H3|B0AZN5|F8VXB4|Q14099|Q14716|Q14717|Q53GJ0|Q6DHW5|Q6GMY0|Q6P4C7|Q96J60	Missense_Mutation	SNP	ENST00000552551.1	37	CCDS8841.1	.	.	.	.	.	.	.	.	.	.	-	0.012	-1.651707	0.00785	.	.	ENSG00000170421	ENST00000552551;ENST00000293308;ENST00000547916;ENST00000546897;ENST00000552150;ENST00000546826;ENST00000548998;ENST00000547413;ENST00000546542	T;T;T;T;T;T;T;T	0.80393	-1.37;-1.37;-1.37;-1.37;-1.37;-1.37;-1.37;-1.37	4.05	-8.11	0.01082	.	0.706613	0.13676	N	0.370518	T	0.40619	0.1124	N	0.01197	-0.965	0.09310	N	1	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.04013	0.001;0.001;0.0	T	0.43589	-0.9382	10	0.05351	T	0.99	.	6.5956	0.22672	0.4212:0.312:0.0:0.2668	.	59;31;31	F8VXB4;F8VU64;P05787	.;.;K2C8_HUMAN	A	31;31;31;31;59;31;71;31;109	ENSP00000447566:S31A;ENSP00000293308:S31A;ENSP00000447402:S31A;ENSP00000449404:S59A;ENSP00000447881:S31A;ENSP00000447040:S71A;ENSP00000448681:S31A;ENSP00000450228:S109A	ENSP00000293308:S31A	S	-	1	0	KRT8	51584942	0.005000	0.15991	0.000000	0.03702	0.065000	0.16274	-0.018000	0.12568	-3.264000	0.00201	-0.290000	0.09829	TCC	.		0.662	KRT8-001	KNOWN	alternative_5_UTR|overlapping_uORF|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406385.1	NM_002273	
LRIG3	121227	hgsc.bcm.edu	37	12	59313936	59313936	+	Silent	SNP	T	T	G	rs61754220	byFrequency	TCGA-OR-A5KY-01A-11D-A29I-10	TCGA-OR-A5KY-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	72f9e1d9-c852-423a-94ff-17f763fa2713	f6e93da3-9ee7-4a65-bc04-30f8bb730eef	g.chr12:59313936T>G	ENST00000320743.3	-	1	367	c.81A>C	c.(79-81)tcA>tcC	p.S27S	RP11-150C16.1_ENST00000547590.1_RNA|LRIG3_ENST00000379141.4_5'Flank	NM_153377.4	NP_700356.2	Q6UXM1	LRIG3_HUMAN	leucine-rich repeats and immunoglobulin-like domains 3	27					otolith morphogenesis (GO:0032474)	cytoplasmic vesicle (GO:0031410)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)			LRIG3/ROS1(2)	breast(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(12)|liver(1)|lung(14)|ovary(1)|prostate(3)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	48			GBM - Glioblastoma multiforme(1;1.17e-18)			CGCCGCTGTCTGACCGGCCAG	0.761			T	ROS1	NSCLC								G|||	401	0.0800719	0.0401	0.1686	5008	,	,		9411	0.0446		0.0994	False		,,,				2504	0.0879				p.S27S		.		Dom	yes		12	12q14.1	121227	leucine-rich repeats and immunoglobulin-like domains 3		E	.	LRIG3-229	0			c.A81C						.						2.0	3.0	2.0					12																	59313936		1269	2781	4050	SO:0001819	synonymous_variant	121227	exon1			GCTGTCTGACCGG	AY505340	CCDS8960.1, CCDS44933.1	12q13.2	2013-01-11				ENSG00000139263		"""Immunoglobulin superfamily / I-set domain containing"""	30991	protein-coding gene	gene with protein product		608870					Standard	NM_153377		Approved	FLJ90440, KIAA3016	uc001sqr.4	Q6UXM1	OTTHUMG00000169940	ENST00000320743.3:c.81A>C	12.37:g.59313936T>G		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	24	10	NM_153377	0	0	1	1	0	Q6UXL7|Q8NC72	Silent	SNP	ENST00000320743.3	37	CCDS8960.1																																																																																			T|0.908;G|0.092		0.761	LRIG3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406623.1	NM_153377	
FAM109A	144717	hgsc.bcm.edu	37	12	111800827	111800835	+	In_Frame_Del	DEL	GCCACCCCC	GCCACCCCC	-	rs3840795|rs139032867|rs199734407|rs200911236	byFrequency	TCGA-OR-A5KY-01A-11D-A29I-10	TCGA-OR-A5KY-10A-01D-A29L-10	GCCACCCCC	GCCACCCCC	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	72f9e1d9-c852-423a-94ff-17f763fa2713	f6e93da3-9ee7-4a65-bc04-30f8bb730eef	g.chr12:111800827_111800835delGCCACCCCC	ENST00000547838.2	-	2	494_502	c.397_405delGGGGGTGGC	c.(397-405)gggggtggcdel	p.GGG133del	FAM109A_ENST00000450786.2_In_Frame_Del_p.113_116AGVA>A|FAM109A_ENST00000392658.5_In_Frame_Del_p.GGG133del|FAM109A_ENST00000361483.3_In_Frame_Del_p.GGG146del|FAM109A_ENST00000548163.1_In_Frame_Del_p.GGG133del			Q8N4B1	SESQ1_HUMAN	family with sequence similarity 109, member A	133					endosome organization (GO:0007032)|receptor recycling (GO:0001881)|retrograde transport, endosome to Golgi (GO:0042147)	clathrin-coated vesicle (GO:0030136)|early endosome (GO:0005769)|recycling endosome (GO:0055037)|trans-Golgi network (GO:0005802)	protein homodimerization activity (GO:0042803)	p.G133M(1)|p.G146_G148delGGG(1)|p.G133_G135delGGG(1)		breast(1)|endometrium(1)|lung(1)|ovary(1)	4						gcagggCCATGCCACCCCCGCCACGTACA	0.732														1710	0.341454	0.233	0.3732	5008	,	,		9526	0.6518		0.2078	False		,,,				2504	0.2832				p.146_148del		.											.	FAM109A-90	3	Deletion - In frame(2)|Substitution - Missense(1)	breast(2)|ovary(1)	c.436_444del						.		,,	674,3090		134,406,1342				http://www.ncbi.nlm.nih.gov/sites/varvu?gene	,,	-4.5	0.0		dbSNP_107	6	1126,6432		186,754,2839	no	coding,coding,coding	FAM109A	NM_144671.4,NM_001177997.1,NM_001177996.1	,,	320,1160,4181	A1A1,A1R,RR		14.8981,17.9065,15.8983	,,	,,		1800,9522				SO:0001651	inframe_deletion	144717	exon4			GGCCATGCCACCC	BC034809	CCDS9152.1, CCDS53833.1	12q24.12	2013-01-10			ENSG00000198324	ENSG00000198324		"""Pleckstrin homology (PH) domain containing"""	26509	protein-coding gene	gene with protein product		614239				12477932	Standard	NM_144671		Approved	FLJ32356	uc009zvu.3	Q8N4B1	OTTHUMG00000169547	ENST00000547838.2:c.397_405delGGGGGTGGC	12.37:g.111800827_111800835delGCCACCCCC	ENSP00000447353:p.Gly133_Gly135del	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	16	15	NM_001177996	0	0	0	0	0	J3KP50|Q6PJL9|Q96MH8	In_Frame_Del	DEL	ENST00000547838.2	37	CCDS9152.1																																																																																			.		0.732	FAM109A-007	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404768.2	NM_144671	
TNFSF11	8600	hgsc.bcm.edu	37	13	43148546	43148546	+	Missense_Mutation	SNP	C	C	G	rs138818878	byFrequency	TCGA-OR-A5KY-01A-11D-A29I-10	TCGA-OR-A5KY-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	72f9e1d9-c852-423a-94ff-17f763fa2713	f6e93da3-9ee7-4a65-bc04-30f8bb730eef	g.chr13:43148546C>G	ENST00000239849.6	+	1	258	c.107C>G	c.(106-108)cCt>cGt	p.P36R	TNFSF11_ENST00000405262.2_Intron|TNFSF11_ENST00000358545.2_Intron|TNFSF11_ENST00000544862.1_Intron|TNFSF11_ENST00000398795.2_5'UTR			O14788	TNF11_HUMAN	tumor necrosis factor (ligand) superfamily, member 11	36					activation of JUN kinase activity (GO:0007257)|bone resorption (GO:0045453)|calcium ion homeostasis (GO:0055074)|cytokine-mediated signaling pathway (GO:0019221)|ERK1 and ERK2 cascade (GO:0070371)|immune response (GO:0006955)|mammary gland alveolus development (GO:0060749)|mammary gland epithelial cell proliferation (GO:0033598)|monocyte chemotaxis (GO:0002548)|organ morphogenesis (GO:0009887)|ossification (GO:0001503)|osteoclast differentiation (GO:0030316)|osteoclast proliferation (GO:0002158)|positive regulation of bone resorption (GO:0045780)|positive regulation of corticotropin-releasing hormone secretion (GO:0051466)|positive regulation of ERK1 and ERK2 cascade via TNFSF11-mediated signaling (GO:0071848)|positive regulation of fever generation by positive regulation of prostaglandin secretion (GO:0071812)|positive regulation of homotypic cell-cell adhesion (GO:0034112)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of intracellular signal transduction (GO:1902533)|positive regulation of JNK cascade (GO:0046330)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of osteoclast development (GO:2001206)|positive regulation of osteoclast differentiation (GO:0045672)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of T cell activation (GO:0050870)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein homooligomerization (GO:0051260)|TNFSF11-mediated signaling pathway (GO:0071847)|tumor necrosis factor-mediated signaling pathway (GO:0033209)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)	cytokine activity (GO:0005125)|tumor necrosis factor receptor binding (GO:0005164)|tumor necrosis factor receptor superfamily binding (GO:0032813)			kidney(1)|large_intestine(4)|lung(3)|prostate(1)|urinary_tract(1)	10		Lung NSC(96;1.11e-05)|Breast(139;0.00868)|Prostate(109;0.0181)|Lung SC(185;0.0262)|Hepatocellular(98;0.114)		OV - Ovarian serous cystadenocarcinoma(117;0.000249)|GBM - Glioblastoma multiforme(144;0.00119)|BRCA - Breast invasive adenocarcinoma(63;0.073)	Denosumab(DB06643)|Lenalidomide(DB00480)	CCGCCGCCGCCTGCGCCGCAC	0.736													C|||	53	0.0105831	0.0023	0.0086	5008	,	,		10305	0.001		0.0338	False		,,,				2504	0.0092				p.P36R		.											.	TNFSF11-522	0			c.C107G						.	C	ARG/PRO,	22,3538		0,22,1758	4.0	5.0	5.0		107,	3.8	0.7	13	dbSNP_134	5	178,7094		3,172,3461	no	missense,intron	TNFSF11	NM_003701.3,NM_033012.3	103,	3,194,5219	GG,GC,CC		2.4477,0.618,1.8464	probably-damaging,	36/318,	43148546	200,10632	1780	3636	5416	SO:0001583	missense	8600	exon1			CGCCGCCTGCGCC	AF013171	CCDS9384.1, CCDS9385.1	13q14	2008-02-05			ENSG00000120659	ENSG00000120659		"""Tumor necrosis factor (ligand) superfamily"", ""CD molecules"""	11926	protein-coding gene	gene with protein product		602642				9312132, 9367155	Standard	NM_003701		Approved	TRANCE, RANKL, OPGL, ODF, CD254	uc001uyu.2	O14788	OTTHUMG00000016807	ENST00000239849.6:c.107C>G	13.37:g.43148546C>G	ENSP00000239849:p.Pro36Arg	Somatic	1	0		WXS	Illumina GAIIx	Phase_I	11	9	NM_003701	0	0	0	0	0	O14723|Q96Q17|Q9P2Q3	Missense_Mutation	SNP	ENST00000239849.6	37	CCDS9384.1	41	0.018772893772893772	4	0.008130081300813009	4	0.011049723756906077	1	0.0017482517482517483	32	0.04221635883905013	C	14.80	2.644005	0.47258	0.00618	0.024477	ENSG00000120659	ENST00000239849	D	0.91351	-2.83	3.77	3.77	0.43336	.	1.146510	0.06834	N	0.794588	T	0.74809	0.3765	L	0.57536	1.79	0.35391	D	0.790799	P	0.41313	0.745	B	0.43575	0.424	T	0.79834	-0.1636	10	0.30854	T	0.27	-1.3078	13.5528	0.61743	0.0:1.0:0.0:0.0	.	36	O14788	TNF11_HUMAN	R	36	ENSP00000239849:P36R	ENSP00000239849:P36R	P	+	2	0	TNFSF11	42046546	0.227000	0.23707	0.705000	0.30386	0.785000	0.44390	2.217000	0.42880	1.950000	0.56595	0.455000	0.32223	CCT	C|0.981;G|0.019		0.736	TNFSF11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044702.2		
ZC3H13	23091	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	13	46542982	46542982	+	Nonsense_Mutation	SNP	T	T	A			TCGA-OR-A5KY-01A-11D-A29I-10	TCGA-OR-A5KY-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	72f9e1d9-c852-423a-94ff-17f763fa2713	f6e93da3-9ee7-4a65-bc04-30f8bb730eef	g.chr13:46542982T>A	ENST00000242848.4	-	14	4045	c.3697A>T	c.(3697-3699)Aga>Tga	p.R1233*	ZC3H13_ENST00000282007.3_Nonsense_Mutation_p.R1233*|ZC3H13_ENST00000378921.2_Nonsense_Mutation_p.R189*			Q5T200	ZC3HD_HUMAN	zinc finger CCCH-type containing 13	1233	Ser-rich.						metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(27)|lung(25)|ovary(2)|prostate(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	79		Lung NSC(96;7.26e-05)|Breast(56;0.000118)|Prostate(109;0.00217)|Hepatocellular(98;0.0207)|Lung SC(185;0.0262)	KIRC - Kidney renal clear cell carcinoma(16;0.234)	GBM - Glioblastoma multiforme(144;4.18e-05)		TCTCTATCTCTTGAGCCACTG	0.458																																					p.R1233X	Esophageal Squamous(187;747 2077 11056 31291 44172)	.											.	ZC3H13-92	0			c.A3697T						.						162.0	158.0	159.0					13																	46542982		2203	4300	6503	SO:0001587	stop_gained	23091	exon14			TATCTCTTGAGCC	AB020660	CCDS9400.1	13q14.11	2012-07-05	2006-05-15	2006-05-15	ENSG00000123200	ENSG00000123200		"""Zinc fingers, CCCH-type domain containing"""	20368	protein-coding gene	gene with protein product			"""KIAA0853"""	KIAA0853		10048485	Standard	XM_005266301		Approved	DKFZp434D1812	uc001vas.1	Q5T200	OTTHUMG00000016863	ENST00000242848.4:c.3697A>T	13.37:g.46542982T>A	ENSP00000242848:p.Arg1233*	Somatic	92	0		WXS	Illumina GAIIx	Phase_I	126	40	NM_015070	0	0	4	7	3	A2A323|O94936|Q5T1Z9|Q7Z7J3|Q8NDT6|Q9H0L6	Nonsense_Mutation	SNP	ENST00000242848.4	37		.	.	.	.	.	.	.	.	.	.	T	45	11.795335	0.99604	.	.	ENSG00000123200	ENST00000242848;ENST00000378921;ENST00000282007	.	.	.	5.39	4.19	0.49359	.	0.000000	0.64402	D	0.000003	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	12.8273	0.57726	0.0:0.0:0.1364:0.8635	.	.	.	.	X	1233;189;1233	.	ENSP00000242848:R1233X	R	-	1	2	ZC3H13	45440983	1.000000	0.71417	1.000000	0.80357	0.967000	0.64934	4.095000	0.57728	0.967000	0.38186	0.533000	0.62120	AGA	.		0.458	ZC3H13-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000044789.1	NM_015070	
PCDH8	5100	hgsc.bcm.edu	37	13	53421432	53421432	+	Silent	SNP	C	C	A	rs3742300	byFrequency	TCGA-OR-A5KY-01A-11D-A29I-10	TCGA-OR-A5KY-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	72f9e1d9-c852-423a-94ff-17f763fa2713	f6e93da3-9ee7-4a65-bc04-30f8bb730eef	g.chr13:53421432C>A	ENST00000377942.3	-	1	1343	c.1140G>T	c.(1138-1140)ggG>ggT	p.G380G	PCDH8_ENST00000338862.4_Silent_p.G380G	NM_002590.3	NP_002581.2	O95206	PCDH8_HUMAN	protocadherin 8	380					cell-cell signaling (GO:0007267)|homophilic cell adhesion (GO:0007156)|morphogenesis of embryonic epithelium (GO:0016331)|somitogenesis (GO:0001756)|synaptic transmission (GO:0007268)	cell junction (GO:0030054)|cell projection (GO:0042995)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	calcium ion binding (GO:0005509)			breast(1)|central_nervous_system(2)|endometrium(2)|large_intestine(5)|lung(23)|ovary(1)|skin(1)|urinary_tract(1)	36		Lung NSC(96;0.0019)|Breast(56;0.00235)|Hepatocellular(98;0.065)|Prostate(109;0.0771)|all_neural(104;0.173)		GBM - Glioblastoma multiforme(99;2.19e-08)		CGTCCGCTCCCCCGAGTGCAG	0.766													C|||	1425	0.284545	0.1876	0.2579	5008	,	,		11677	0.5119		0.2048	False		,,,				2504	0.2822				p.G380G	GBM(36;25 841 9273 49207)	.											.	PCDH8-153	0			c.G1140T						.	C	,	383,2121		30,323,899	3.0	4.0	3.0		1140,1140	-2.3	0.5	13	dbSNP_107	3	791,4555		57,677,1939	no	coding-synonymous,coding-synonymous	PCDH8	NM_002590.3,NM_032949.2	,	87,1000,2838	AA,AC,CC		14.7961,15.2955,14.9554	,	380/1071,380/974	53421432	1174,6676	1252	2673	3925	SO:0001819	synonymous_variant	5100	exon1			CGCTCCCCCGAGT	AF061573	CCDS9438.1, CCDS9439.1	13q21.1	2010-02-22			ENSG00000136099	ENSG00000136099		"""Cadherins / Protocadherins : Non-clustered"""	8660	protein-coding gene	gene with protein product		603580				9787079, 9315676	Standard	NM_002590		Approved	PAPC, ARCADLIN	uc001vhi.3	O95206	OTTHUMG00000016979	ENST00000377942.3:c.1140G>T	13.37:g.53421432C>A		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	5	5	NM_002590	0	0	0	0	0	B4DMV7|Q5TAN1|Q5TAN2|Q8IYE9|Q96SF1	Silent	SNP	ENST00000377942.3	37	CCDS9438.1																																																																																			C|0.649;A|0.351		0.766	PCDH8-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000045108.2	NM_002590	
COL4A1	1282	bcgsc.ca	37	13	110833702	110833702	+	Silent	SNP	C	C	T	rs16975492	byFrequency	TCGA-OR-A5KY-01A-11D-A29I-10	TCGA-OR-A5KY-10A-01D-A29L-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	72f9e1d9-c852-423a-94ff-17f763fa2713	f6e93da3-9ee7-4a65-bc04-30f8bb730eef	g.chr13:110833702C>T	ENST00000375820.4	-	29	2251	c.2130G>A	c.(2128-2130)ccG>ccA	p.P710P		NM_001845.4	NP_001836.2	P02462	CO4A1_HUMAN	collagen, type IV, alpha 1	710	Triple-helical region.				axon guidance (GO:0007411)|basement membrane organization (GO:0071711)|blood vessel morphogenesis (GO:0048514)|brain development (GO:0007420)|cellular response to amino acid stimulus (GO:0071230)|collagen catabolic process (GO:0030574)|epithelial cell differentiation (GO:0030855)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|neuromuscular junction development (GO:0007528)|patterning of blood vessels (GO:0001569)|renal tubule morphogenesis (GO:0061333)|retinal blood vessel morphogenesis (GO:0061304)	basement membrane (GO:0005604)|collagen type IV trimer (GO:0005587)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)	extracellular matrix constituent conferring elasticity (GO:0030023)|extracellular matrix structural constituent (GO:0005201)|platelet-derived growth factor binding (GO:0048407)			breast(2)|central_nervous_system(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(16)|lung(57)|ovary(4)|pancreas(1)|prostate(4)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	105	all_cancers(4;9.8e-13)|all_epithelial(4;9.66e-08)|all_lung(23;3.75e-06)|Lung NSC(43;0.000274)|Colorectal(4;0.00178)|all_neural(89;0.00459)|Medulloblastoma(90;0.00596)|Lung SC(71;0.0604)	Breast(118;0.2)	BRCA - Breast invasive adenocarcinoma(86;0.11)|all cancers(43;0.145)			CTGGAGTCCCCGGTGGCCCCA	0.522													C|||	1538	0.307109	0.2088	0.3516	5008	,	,		16288	0.2768		0.3628	False		,,,				2504	0.3824				p.P710P		.											.	COL4A1-654	0			c.G2130A						.	C		1092,3314	391.9+/-328.3	143,806,1254	46.0	45.0	46.0		2130	-9.7	0.0	13	dbSNP_123	46	3091,5509	464.9+/-366.4	568,1955,1777	no	coding-synonymous	COL4A1	NM_001845.4		711,2761,3031	TT,TC,CC		35.9419,24.7844,32.1621		710/1670	110833702	4183,8823	2203	4300	6503	SO:0001819	synonymous_variant	1282	exon29			AGTCCCCGGTGGC	J04217	CCDS9511.1	13q34	2013-09-05			ENSG00000187498	ENSG00000187498		"""Collagens"""	2202	protein-coding gene	gene with protein product		120130				3691802	Standard	NM_001845		Approved		uc001vqw.4	P02462	OTTHUMG00000017342	ENST00000375820.4:c.2130G>A	13.37:g.110833702C>T		Somatic	225	1		WXS	Illumina GAIIx	Phase_I	177	8	NM_001845	0	0	61	61	0	A7E2W4|B1AM70|Q1P9S9|Q5VWF6|Q86X41|Q8NF88|Q9NYC5	Silent	SNP	ENST00000375820.4	37	CCDS9511.1																																																																																			C|0.691;T|0.309		0.522	COL4A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045759.3		
COL4A1	1282	hgsc.bcm.edu	37	13	110959356	110959356	+	Missense_Mutation	SNP	C	C	G	rs9515185	byFrequency	TCGA-OR-A5KY-01A-11D-A29I-10	TCGA-OR-A5KY-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	72f9e1d9-c852-423a-94ff-17f763fa2713	f6e93da3-9ee7-4a65-bc04-30f8bb730eef	g.chr13:110959356C>G	ENST00000375820.4	-	1	140	c.19G>C	c.(19-21)Gtc>Ctc	p.V7L	COL4A2_ENST00000360467.5_5'Flank|COL4A1_ENST00000543140.1_Missense_Mutation_p.V7L	NM_001845.4	NP_001836.2	P02462	CO4A1_HUMAN	collagen, type IV, alpha 1	7			V -> L (in dbSNP:rs9515185). {ECO:0000269|PubMed:21527998}.		axon guidance (GO:0007411)|basement membrane organization (GO:0071711)|blood vessel morphogenesis (GO:0048514)|brain development (GO:0007420)|cellular response to amino acid stimulus (GO:0071230)|collagen catabolic process (GO:0030574)|epithelial cell differentiation (GO:0030855)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|neuromuscular junction development (GO:0007528)|patterning of blood vessels (GO:0001569)|renal tubule morphogenesis (GO:0061333)|retinal blood vessel morphogenesis (GO:0061304)	basement membrane (GO:0005604)|collagen type IV trimer (GO:0005587)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)	extracellular matrix constituent conferring elasticity (GO:0030023)|extracellular matrix structural constituent (GO:0005201)|platelet-derived growth factor binding (GO:0048407)			breast(2)|central_nervous_system(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(16)|lung(57)|ovary(4)|pancreas(1)|prostate(4)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	105	all_cancers(4;9.8e-13)|all_epithelial(4;9.66e-08)|all_lung(23;3.75e-06)|Lung NSC(43;0.000274)|Colorectal(4;0.00178)|all_neural(89;0.00459)|Medulloblastoma(90;0.00596)|Lung SC(71;0.0604)	Breast(118;0.2)	BRCA - Breast invasive adenocarcinoma(86;0.11)|all cancers(43;0.145)			AGCAGCCAGACGCTGAGCCGG	0.771													C|||	2124	0.424121	0.233	0.4063	5008	,	,		9436	0.6161		0.4235	False		,,,				2504	0.498				p.V7L		.											.	COL4A1-654	0			c.G19C						.						1.0	2.0	2.0					13																	110959356		993	2082	3075	SO:0001583	missense	1282	exon1			GCCAGACGCTGAG	J04217	CCDS9511.1	13q34	2013-09-05			ENSG00000187498	ENSG00000187498		"""Collagens"""	2202	protein-coding gene	gene with protein product		120130				3691802	Standard	NM_001845		Approved		uc001vqw.4	P02462	OTTHUMG00000017342	ENST00000375820.4:c.19G>C	13.37:g.110959356C>G	ENSP00000364979:p.Val7Leu	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	4	4	NM_001845	0	0	2	3	1	A7E2W4|B1AM70|Q1P9S9|Q5VWF6|Q86X41|Q8NF88|Q9NYC5	Missense_Mutation	SNP	ENST00000375820.4	37	CCDS9511.1	957	0.4381868131868132	142	0.2886178861788618	152	0.4198895027624309	352	0.6153846153846154	311	0.4102902374670185	C	0.053	-1.245778	0.01481	.	.	ENSG00000187498	ENST00000375815;ENST00000375820;ENST00000397198;ENST00000543140	D;D	0.89939	-2.59;-2.56	3.39	1.49	0.22878	.	0.926399	0.08620	N	0.918658	T	0.00012	0.0000	N	0.14661	0.345	0.09310	P	0.999999999736608	B;B	0.06786	0.001;0.001	B;B	0.04013	0.001;0.001	T	0.38178	-0.9673	9	0.09084	T	0.74	.	8.9828	0.35974	0.0:0.5683:0.4317:0.0	rs9515185	7;7	F5H5K0;P02462	.;CO4A1_HUMAN	L	7	ENSP00000364979:V7L;ENSP00000443348:V7L	ENSP00000364973:V7L	V	-	1	0	COL4A1	109757357	0.892000	0.30473	0.993000	0.49108	0.677000	0.39632	-0.118000	0.10692	0.106000	0.17784	0.462000	0.41574	GTC	C|0.560;G|0.440		0.771	COL4A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045759.3		
ING1	3621	hgsc.bcm.edu	37	13	111368316	111368316	+	Silent	SNP	C	C	T	rs9555726	byFrequency	TCGA-OR-A5KY-01A-11D-A29I-10	TCGA-OR-A5KY-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	72f9e1d9-c852-423a-94ff-17f763fa2713	f6e93da3-9ee7-4a65-bc04-30f8bb730eef	g.chr13:111368316C>T	ENST00000375774.3	+	1	988	c.526C>T	c.(526-528)Ctg>Ttg	p.L176L	ING1_ENST00000375775.3_Intron|ING1_ENST00000333219.7_Intron|CARS2_ENST00000535398.1_5'Flank|ING1_ENST00000338450.7_Intron|ING1_ENST00000464141.1_Intron	NM_005537.4	NP_005528.3	Q9UK53	ING1_HUMAN	inhibitor of growth family, member 1	176					cell cycle (GO:0007049)|chromatin modification (GO:0016568)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|positive regulation of transcription, DNA-templated (GO:0045893)|protein import into nucleus (GO:0006606)|regulation of cell death (GO:0010941)	nucleus (GO:0005634)	methylated histone binding (GO:0035064)|zinc ion binding (GO:0008270)			endometrium(4)|large_intestine(6)|lung(1)|ovary(1)	12	all_lung(23;3.61e-05)|Lung NSC(43;0.00144)|Lung SC(71;0.0753)|all_neural(89;0.077)|Medulloblastoma(90;0.148)		BRCA - Breast invasive adenocarcinoma(86;0.188)			GGCCGCATCTCTGCTGACCCG	0.706													C|||	2912	0.58147	0.23	0.6816	5008	,	,		11066	0.7252		0.6909	False		,,,				2504	0.7249				p.L176L		.											.	ING1-515	0			c.C526T						.	C	,,,	1347,2085		295,757,664	14.0	24.0	21.0		526,,,	-5.6	0.0	13	dbSNP_119	21	5238,1736		2020,1198,269	no	coding-synonymous,intron,intron,intron	ING1	NM_005537.3,NM_198217.1,NM_198218.1,NM_198219.1	,,,	2315,1955,933	TT,TC,CC		24.8925,39.2483,36.7192	,,,	176/423,,,	111368316	6585,3821	1716	3487	5203	SO:0001819	synonymous_variant	3621	exon1			GCATCTCTGCTGA		CCDS9515.1, CCDS9516.1, CCDS9517.1, CCDS9518.1	13q34	2013-01-28			ENSG00000153487	ENSG00000153487		"""Zinc fingers, PHD-type"""	6062	protein-coding gene	gene with protein product	"""inhibitor of growth 1"", ""tumor suppressor ING1"", ""growth inhibitor ING1"", ""growth inhibitory protein ING1"""	601566				8944021, 9186514	Standard	NM_198219		Approved	p33ING1, p33ING1b, p24ING1c, p33, p47, p47ING1a	uc001vri.3	Q9UK53	OTTHUMG00000017346	ENST00000375774.3:c.526C>T	13.37:g.111368316C>T		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	11	11	NM_005537	0	0	0	1	1	O00532|O43658|Q53ZR3|Q5T9G8|Q5T9G9|Q5T9H0|Q5T9H1|Q9H007|Q9HD98|Q9HD99|Q9NS83|Q9P0U6|Q9UBC6|Q9UIJ1|Q9UIJ2|Q9UIJ3|Q9UIJ4|Q9UK52	Silent	SNP	ENST00000375774.3	37	CCDS9517.1																																																																																			C|0.372;T|0.628		0.706	ING1-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000045770.2	NM_005537	
SOX1	6656	bcgsc.ca;mdanderson.org	37	13	112722101	112722101	+	Silent	SNP	C	C	A			TCGA-OR-A5KY-01A-11D-A29I-10	TCGA-OR-A5KY-10A-01D-A29L-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	72f9e1d9-c852-423a-94ff-17f763fa2713	f6e93da3-9ee7-4a65-bc04-30f8bb730eef	g.chr13:112722101C>A	ENST00000330949.1	+	1	189	c.129C>A	c.(127-129)ggC>ggA	p.G43G		NM_005986.2	NP_005977.2	O00570	SOX1_HUMAN	SRY (sex determining region Y)-box 1	43	Poly-Gly.				chromatin organization (GO:0006325)|forebrain neuron development (GO:0021884)|lens morphogenesis in camera-type eye (GO:0002089)|neuron migration (GO:0001764)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)|ventral spinal cord interneuron specification (GO:0021521)	nucleus (GO:0005634)	core promoter sequence-specific DNA binding (GO:0001046)|DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			lung(4)	4	all_lung(23;0.000652)|Lung NSC(43;0.017)|Lung SC(71;0.0753)|all_neural(89;0.0804)|Medulloblastoma(90;0.163)	all_cancers(25;0.000331)|Lung NSC(25;0.0496)|all_lung(25;0.0831)|all_epithelial(44;0.0868)|Breast(118;0.231)		OV - Ovarian serous cystadenocarcinoma(48;0.132)		gcggcgggggcgCCAAGGCCA	0.781																																					p.G43G		.											.	SOX1-468	0			c.C129A						.						11.0	13.0	12.0					13																	112722101		2183	4281	6464	SO:0001819	synonymous_variant	6656	exon1			CGGGGGCGCCAAG		CCDS9523.1	13q34	2008-07-18			ENSG00000182968	ENSG00000182968		"""SRY (sex determining region Y)-boxes"""	11189	protein-coding gene	gene with protein product	"""SRY-related HMG-box gene 1"""	602148				9337405	Standard	NM_005986		Approved		uc001vsb.1	O00570	OTTHUMG00000017362	ENST00000330949.1:c.129C>A	13.37:g.112722101C>A		Somatic	38	1		WXS	Illumina GAIIx	Phase_I	51	39	NM_005986	0	0	0	0	0	Q5W0Q1	Silent	SNP	ENST00000330949.1	37	CCDS9523.1																																																																																			.		0.781	SOX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045817.3	NM_005986	
UPF3A	65110	broad.mit.edu	37	13	115047559	115047559	+	Silent	SNP	C	C	T			TCGA-OR-A5KY-01A-11D-A29I-10	TCGA-OR-A5KY-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	72f9e1d9-c852-423a-94ff-17f763fa2713	f6e93da3-9ee7-4a65-bc04-30f8bb730eef	g.chr13:115047559C>T	ENST00000375299.3	+	2	327	c.271C>T	c.(271-273)Ctg>Ttg	p.L91L	UPF3A_ENST00000351487.5_Silent_p.L91L	NM_023011.3	NP_075387.1	Q9H1J1	REN3A_HUMAN	UPF3 regulator of nonsense transcripts homolog A (yeast)	91	Required for interaction with UPF2.				gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|mRNA transport (GO:0051028)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|nucleocytoplasmic transport (GO:0006913)|positive regulation of translation (GO:0045727)|RNA metabolic process (GO:0016070)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	nucleocytoplasmic transporter activity (GO:0005487)|nucleotide binding (GO:0000166)|RNA binding (GO:0003723)	p.L91L(8)		autonomic_ganglia(1)|central_nervous_system(2)|kidney(2)|large_intestine(2)|lung(3)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	16	Lung NSC(43;0.00299)|all_neural(89;0.0337)|Medulloblastoma(90;0.163)|Lung SC(71;0.218)	all_cancers(25;0.0191)|all_epithelial(44;0.00716)|all_lung(25;0.0173)|Lung NSC(25;0.0634)|Breast(118;0.238)	BRCA - Breast invasive adenocarcinoma(86;0.0886)	OV - Ovarian serous cystadenocarcinoma(48;0.195)|Epithelial(10;0.2)		GCTGCGCCCGCTGCCAGCACA	0.731																																					p.L91L		.											.	UPF3A-91	8	Substitution - coding silent(8)	lung(2)|prostate(2)|kidney(2)|central_nervous_system(2)	c.C271T						.						4.0	4.0	4.0					13																	115047559		1902	3804	5706	SO:0001819	synonymous_variant	65110	exon2			CGCCCGCTGCCAG	AF318575	CCDS9543.1, CCDS9544.1	13q34	2010-04-30			ENSG00000169062	ENSG00000169062			20332	protein-coding gene	gene with protein product		605530				11113196, 11163187	Standard	NM_023011		Approved	RENT3A, UPF3, HUPF3A	uc001vup.3	Q9H1J1	OTTHUMG00000017403	ENST00000375299.3:c.271C>T	13.37:g.115047559C>T		Somatic	16	0		WXS	Illumina GAIIx	Phase_I	62	5	NM_080687	0	0	22	22	0	A2A366|Q5T8C3|Q5T8C9|Q7Z6N3|Q86YK1|Q9BZI8	Silent	SNP	ENST00000375299.3	37	CCDS9543.1																																																																																			.		0.731	UPF3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045968.2		
ZNF219	51222	hgsc.bcm.edu	37	14	21560753	21560758	+	In_Frame_Del	DEL	GAGGCT	GAGGCT	-	rs71794845|rs11278664|rs3841049	byFrequency	TCGA-OR-A5KY-01A-11D-A29I-10	TCGA-OR-A5KY-10A-01D-A29L-10	GAGGCT	GAGGCT	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	72f9e1d9-c852-423a-94ff-17f763fa2713	f6e93da3-9ee7-4a65-bc04-30f8bb730eef	g.chr14:21560753_21560758delGAGGCT	ENST00000360947.3	-	3	1109_1114	c.698_703delAGCCTC	c.(697-705)cagcctcca>cca	p.QP233del	ZNF219_ENST00000451119.2_In_Frame_Del_p.QP233del|ZNF219_ENST00000556101.1_5'Flank|ZNF219_ENST00000421093.2_In_Frame_Del_p.QP233del|RP11-998D10.7_ENST00000554733.2_lincRNA	NM_016423.2	NP_057507.2	Q9P2Y4	ZN219_HUMAN	zinc finger protein 219	233				Missing (in Ref. 4; AAH00694). {ECO:0000305}.	negative regulation of transcription, DNA-templated (GO:0045892)|regulation of neurotransmitter levels (GO:0001505)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	integral component of membrane (GO:0016021)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histamine receptor activity (GO:0004969)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.Q233_P234delQP(3)		breast(1)|central_nervous_system(1)|cervix(1)|large_intestine(1)|lung(1)|ovary(1)|prostate(2)	8	all_cancers(95;0.00185)		OV - Ovarian serous cystadenocarcinoma(11;9.86e-11)|Epithelial(56;1.27e-08)|all cancers(55;6.06e-08)	GBM - Glioblastoma multiforme(265;0.0191)		ggctggggtggaggctgaggctgagg	0.743											OREG0022565	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)		1230	0.245607	0.2549	0.3775	5008	,	,		14407	0.125		0.1879	False		,,,				2504	0.3231				p.233_235del		.											.	ZNF219-90	3	Deletion - In frame(3)	large_intestine(1)|prostate(1)|breast(1)	c.698_703del						.		,,	821,2789		238,345,1222					,,	2.7	1.0		dbSNP_107	4	1173,6075		279,615,2730	no	coding,coding,coding	ZNF219	NM_016423.2,NM_001102454.1,NM_001101672.1	,,	517,960,3952	A1A1,A1R,RR		16.1838,22.7424,18.3643	,,	,,		1994,8864				SO:0001651	inframe_deletion	51222	exon3			GGGGTGGAGGCTG	AB015427	CCDS9568.1	14q11	2013-01-08			ENSG00000165804	ENSG00000165804		"""Zinc fingers, C2H2-type"""	13011	protein-coding gene	gene with protein product		605036				10819330	Standard	NM_016423		Approved		uc001vzs.2	Q9P2Y4	OTTHUMG00000029647	ENST00000360947.3:c.698_703delAGCCTC	14.37:g.21560759_21560764delGAGGCT	ENSP00000354206:p.Gln233_Pro234del	Somatic	4	2	749	WXS	Illumina GAIIx	Phase_I	43	23	NM_001102454	0	0	0	0	0	D3DS16|Q53Y57|Q8IYC1|Q9BW28	In_Frame_Del	DEL	ENST00000360947.3	37	CCDS9568.1																																																																																			.		0.743	ZNF219-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000073931.2		
SSTR1	6751	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	14	38679311	38679311	+	Silent	SNP	C	C	A			TCGA-OR-A5KY-01A-11D-A29I-10	TCGA-OR-A5KY-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	72f9e1d9-c852-423a-94ff-17f763fa2713	f6e93da3-9ee7-4a65-bc04-30f8bb730eef	g.chr14:38679311C>A	ENST00000267377.2	+	3	1334	c.717C>A	c.(715-717)atC>atA	p.I239I		NM_001049.2	NP_001040.1	P30872	SSR1_HUMAN	somatostatin receptor 1	239					cell surface receptor signaling pathway (GO:0007166)|cell-cell signaling (GO:0007267)|cellular response to estradiol stimulus (GO:0071392)|cerebellum development (GO:0021549)|digestion (GO:0007586)|forebrain development (GO:0030900)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|glutamate receptor signaling pathway (GO:0007215)|negative regulation of cell proliferation (GO:0008285)|response to nutrient (GO:0007584)|response to starvation (GO:0042594)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	somatostatin receptor activity (GO:0004994)			breast(1)|central_nervous_system(3)|endometrium(6)|kidney(1)|large_intestine(6)|lung(8)|ovary(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	29	Hepatocellular(127;0.213)|Esophageal squamous(585;0.22)		Lung(238;3.93e-06)|LUAD - Lung adenocarcinoma(48;2.62e-05)|Epithelial(34;0.187)	GBM - Glioblastoma multiforme(112;0.00444)	Octreotide(DB00104)|Pasireotide(DB06663)	TGGGGGCTATCTGCCTGTGCT	0.597																																					p.I239I		.											.	SSTR1-947	0			c.C717A						.						51.0	49.0	49.0					14																	38679311		2203	4300	6503	SO:0001819	synonymous_variant	6751	exon3			GGCTATCTGCCTG		CCDS9666.1	14q13	2012-08-08			ENSG00000139874	ENSG00000139874		"""GPCR / Class A : Somatostatin receptors"""	11330	protein-coding gene	gene with protein product		182451				8449518	Standard	NM_001049		Approved		uc001wul.1	P30872	OTTHUMG00000140249	ENST00000267377.2:c.717C>A	14.37:g.38679311C>A		Somatic	140	0		WXS	Illumina GAIIx	Phase_I	133	40	NM_001049	0	0	0	0	0		Silent	SNP	ENST00000267377.2	37	CCDS9666.1																																																																																			.		0.597	SSTR1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000409930.2		
IRF2BPL	64207	hgsc.bcm.edu	37	14	77493809	77493809	+	Silent	SNP	C	C	T	rs61991638		TCGA-OR-A5KY-01A-11D-A29I-10	TCGA-OR-A5KY-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	72f9e1d9-c852-423a-94ff-17f763fa2713	f6e93da3-9ee7-4a65-bc04-30f8bb730eef	g.chr14:77493809C>T	ENST00000238647.3	-	1	1225	c.327G>A	c.(325-327)caG>caA	p.Q109Q		NM_024496.3	NP_078772.1	Q9H1B7	I2BPL_HUMAN	interferon regulatory factor 2 binding protein-like	109	Poly-Gln.				development of secondary female sexual characteristics (GO:0046543)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	extracellular space (GO:0005615)|nucleus (GO:0005634)	metal ion binding (GO:0046872)			endometrium(2)|kidney(1)|lung(3)|ovary(1)|prostate(1)|skin(1)|urinary_tract(2)	11						gctgctgctgctgctgttgct	0.687																																					p.Q109Q		.											.	IRF2BPL-90	0			c.G327A						.						2.0	2.0	2.0					14																	77493809		1179	2145	3324	SO:0001819	synonymous_variant	64207	exon1			CTGCTGCTGCTGT	AJ277365	CCDS9854.1	14q24.3	2011-02-23	2011-02-23	2011-02-23	ENSG00000119669	ENSG00000119669			14282	protein-coding gene	gene with protein product	"""enhanced at puberty 1"""	611720	"""chromosome 14 open reading frame 4"""	C14orf4		11095982, 17627301	Standard	NM_024496		Approved	EAP1, KIAA1865	uc001xsy.4	Q9H1B7		ENST00000238647.3:c.327G>A	14.37:g.77493809C>T		Somatic	4	0		WXS	Illumina GAIIx	Phase_I	13	10	NM_024496	0	0	3	5	2	Q8NDQ2|Q96JG2|Q9H3I7	Silent	SNP	ENST00000238647.3	37	CCDS9854.1																																																																																			C|0.978;T|0.022		0.687	IRF2BPL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414298.1	NM_024496	
KIF26A	26153	hgsc.bcm.edu	37	14	104644099	104644099	+	Silent	SNP	T	T	C	rs2497297	byFrequency	TCGA-OR-A5KY-01A-11D-A29I-10	TCGA-OR-A5KY-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	72f9e1d9-c852-423a-94ff-17f763fa2713	f6e93da3-9ee7-4a65-bc04-30f8bb730eef	g.chr14:104644099T>C	ENST00000423312.2	+	12	4974	c.4974T>C	c.(4972-4974)agT>agC	p.S1658S	KIF26A_ENST00000315264.7_Silent_p.S1519S	NM_015656.1	NP_056471.1	Q9ULI4	KI26A_HUMAN	kinesin family member 26A	1658					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|blood coagulation (GO:0007596)|enteric nervous system development (GO:0048484)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|negative regulation of signal transduction (GO:0009968)|regulation of cell growth by extracellular stimulus (GO:0001560)	cytosol (GO:0005829)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|microtubule binding (GO:0008017)|microtubule motor activity (GO:0003777)			autonomic_ganglia(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(8)|pancreas(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(2)	21		all_cancers(154;0.109)|Melanoma(154;0.0525)|all_epithelial(191;0.0767)	Epithelial(46;0.152)	Epithelial(152;0.161)		GTGGCAGCAGTGGCTATGAGA	0.711													C|||	2031	0.405551	0.5764	0.2911	5008	,	,		13449	0.3185		0.3718	False		,,,				2504	0.3804				p.S1658S		.											.	KIF26A-24	0			c.T4974C						.	C		1381,1865		360,661,602	3.0	4.0	4.0		4974	-0.8	1.0	14	dbSNP_100	4	2221,5011		464,1293,1859	no	coding-synonymous	KIF26A	NM_015656.1		824,1954,2461	CC,CT,TT		30.7107,42.5447,34.3768		1658/1883	104644099	3602,6876	1623	3616	5239	SO:0001819	synonymous_variant	26153	exon12			CAGCAGTGGCTAT	AB033062	CCDS45171.1	14q32.33	2009-03-19			ENSG00000066735	ENSG00000066735		"""Kinesins"""	20226	protein-coding gene	gene with protein product		613231				10574462, 11416179	Standard	NM_015656		Approved	KIAA1236, DKFZP434N178	uc001yos.4	Q9ULI4	OTTHUMG00000154986	ENST00000423312.2:c.4974T>C	14.37:g.104644099T>C		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	12	11	NM_015656	0	0	0	5	5	Q8TAZ7|Q96GK3|Q9UFL3	Silent	SNP	ENST00000423312.2	37	CCDS45171.1																																																																																			T|0.603;C|0.397		0.711	KIF26A-002	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414356.1		
EXD1	161829	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	15	41501767	41501767	+	Missense_Mutation	SNP	G	G	T	rs113822955		TCGA-OR-A5KY-01A-11D-A29I-10	TCGA-OR-A5KY-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	72f9e1d9-c852-423a-94ff-17f763fa2713	f6e93da3-9ee7-4a65-bc04-30f8bb730eef	g.chr15:41501767G>T	ENST00000314992.5	-	5	482	c.292C>A	c.(292-294)Cag>Aag	p.Q98K	EXD1_ENST00000458580.2_Missense_Mutation_p.Q156K	NM_152596.2	NP_689809.2	Q8NHP7	EXD1_HUMAN	exonuclease 3'-5' domain containing 1	98	3'-5' exonuclease.						3'-5' exonuclease activity (GO:0008408)|nucleic acid binding (GO:0003676)			large_intestine(5)|liver(1)|lung(4)|ovary(2)|prostate(2)|skin(2)	16						AGGACATTCTGCTTCTTGATA	0.388																																					p.Q98K		.											.	EXD1-91	0			c.C292A						.						64.0	58.0	60.0					15																	41501767		2203	4300	6503	SO:0001583	missense	161829	exon5			CATTCTGCTTCTT	BC030628	CCDS10072.1, CCDS66738.1	15q15.1	2009-02-24	2009-02-24	2009-02-24	ENSG00000178997	ENSG00000178997			28507	protein-coding gene	gene with protein product			"""exonuclease 3'-5' domain-like 1"""	EXDL1		12477932	Standard	NM_001286441		Approved	MGC33637	uc001znk.3	Q8NHP7	OTTHUMG00000130232	ENST00000314992.5:c.292C>A	15.37:g.41501767G>T	ENSP00000321029:p.Gln98Lys	Somatic	136	0		WXS	Illumina GAIIx	Phase_I	132	88	NM_152596	0	0	0	0	0	A8K909|B7Z839|Q6ZW94	Missense_Mutation	SNP	ENST00000314992.5	37	CCDS10072.1	.	.	.	.	.	.	.	.	.	.	G	22.0	4.227150	0.79576	.	.	ENSG00000178997	ENST00000314992;ENST00000458580	T;T	0.61742	0.08;0.08	4.77	4.77	0.60923	-5&apos (2);Ribonuclease H-like (1); exonuclease (2);3&apos (2);	0.000000	0.85682	D	0.000000	T	0.67258	0.2874	L	0.41415	1.275	0.46222	D	0.998935	D;D	0.76494	0.999;0.999	D;D	0.91635	0.999;0.997	T	0.64575	-0.6375	10	0.37606	T	0.19	-6.523	15.148	0.72674	0.0:0.0:1.0:0.0	.	156;98	B7Z839;Q8NHP7	.;EXD1_HUMAN	K	98;156	ENSP00000321029:Q98K;ENSP00000415056:Q156K	ENSP00000321029:Q98K	Q	-	1	0	EXD1	39289059	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	5.834000	0.69361	2.642000	0.89623	0.591000	0.81541	CAG	G|0.500;A|0.500		0.388	EXD1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000252553.2	NM_152596	
IGDCC4	57722	hgsc.bcm.edu	37	15	65688236	65688236	+	Silent	SNP	G	G	T	rs145183412	byFrequency	TCGA-OR-A5KY-01A-11D-A29I-10	TCGA-OR-A5KY-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	72f9e1d9-c852-423a-94ff-17f763fa2713	f6e93da3-9ee7-4a65-bc04-30f8bb730eef	g.chr15:65688236G>T	ENST00000352385.2	-	7	1472	c.1263C>A	c.(1261-1263)gcC>gcA	p.A421A		NM_020962.1	NP_066013.1	Q8TDY8	IGDC4_HUMAN	immunoglobulin superfamily, DCC subclass, member 4	421	Ig-like C2-type 4.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(1)|central_nervous_system(1)|endometrium(1)|large_intestine(7)|lung(24)|ovary(1)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(3)	44						GCACCACCACGGCCAGCGACG	0.706													G|||	2	0.000399361	0.0	0.0	5008	,	,		10654	0.0		0.002	False		,,,				2504	0.0				p.A421A		.											.	IGDCC4-93	0			c.C1263A						.	G		1,4351		0,1,2175	13.0	13.0	13.0		1263	-8.9	0.1	15	dbSNP_134	13	14,8516		0,14,4251	no	coding-synonymous	IGDCC4	NM_020962.1		0,15,6426	TT,TG,GG		0.1641,0.023,0.1164		421/1251	65688236	15,12867	2176	4265	6441	SO:0001819	synonymous_variant	57722	exon7			CACCACGGCCAGC		CCDS10206.1	15q22.31	2013-02-11			ENSG00000103742	ENSG00000103742		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	13770	protein-coding gene	gene with protein product	"""likely ortholog of mouse neighbor of Punc E11"""						Standard	NM_020962		Approved	NOPE, LOC57722	uc002aou.1	Q8TDY8	OTTHUMG00000133136	ENST00000352385.2:c.1263C>A	15.37:g.65688236G>T		Somatic	2	0		WXS	Illumina GAIIx	Phase_I	43	12	NM_020962	0	0	1	1	0	Q9HCE4	Silent	SNP	ENST00000352385.2	37	CCDS10206.1																																																																																			G|0.998;T|0.002		0.706	IGDCC4-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000256825.2	NM_020962	
NTRK3	4916	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	15	88678334	88678334	+	Missense_Mutation	SNP	G	G	T			TCGA-OR-A5KY-01A-11D-A29I-10	TCGA-OR-A5KY-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	72f9e1d9-c852-423a-94ff-17f763fa2713	f6e93da3-9ee7-4a65-bc04-30f8bb730eef	g.chr15:88678334G>T	ENST00000360948.2	-	9	1363	c.1202C>A	c.(1201-1203)cCa>cAa	p.P401Q	NTRK3_ENST00000357724.2_Missense_Mutation_p.P401Q|NTRK3_ENST00000394480.2_Missense_Mutation_p.P401Q|NTRK3_ENST00000557856.1_Missense_Mutation_p.P401Q|NTRK3_ENST00000558676.1_Missense_Mutation_p.P401Q|NTRK3_ENST00000542733.2_Missense_Mutation_p.P303Q|NTRK3_ENST00000540489.2_Missense_Mutation_p.P401Q|NTRK3_ENST00000317501.3_Missense_Mutation_p.P401Q|NTRK3_ENST00000355254.2_Missense_Mutation_p.P401Q	NM_001012338.2	NP_001012338.1	Q16288	NTRK3_HUMAN	neurotrophic tyrosine kinase, receptor, type 3	401					activation of MAPK activity (GO:0000187)|activation of protein kinase B activity (GO:0032148)|activation of Ras GTPase activity (GO:0032856)|cellular response to retinoic acid (GO:0071300)|circadian rhythm (GO:0007623)|cochlea development (GO:0090102)|lens fiber cell differentiation (GO:0070306)|mechanoreceptor differentiation (GO:0042490)|modulation by virus of host transcription (GO:0019056)|negative regulation of astrocyte differentiation (GO:0048712)|negative regulation of cell death (GO:0060548)|negative regulation of protein phosphorylation (GO:0001933)|neuron fate specification (GO:0048665)|neuron migration (GO:0001764)|neurotrophin signaling pathway (GO:0038179)|positive regulation of actin cytoskeleton reorganization (GO:2000251)|positive regulation of axon extension involved in regeneration (GO:0048691)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of positive chemotaxis (GO:0050927)|protein autophosphorylation (GO:0046777)|response to axon injury (GO:0048678)|response to corticosterone (GO:0051412)|response to ethanol (GO:0045471)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|neurotrophin binding (GO:0043121)|neurotrophin receptor activity (GO:0005030)|p53 binding (GO:0002039)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)		ETV6/NTRK3(238)	breast(3)|central_nervous_system(3)|endometrium(6)|kidney(1)|large_intestine(22)|lung(63)|ovary(6)|pancreas(3)|prostate(1)|skin(4)|stomach(5)|upper_aerodigestive_tract(2)	119			BRCA - Breast invasive adenocarcinoma(143;0.211)			GCCCTCACCTGGAAAGGGCTC	0.532			T	ETV6	"""congenital fibrosarcoma, Secretory breast """					TSP Lung(13;0.10)																											p.P401Q		.		Dom	yes		15	15q25	4916	"""neurotrophic tyrosine kinase, receptor, type 3"""		"""E, M"""	.	NTRK3-3538	0			c.C1202A						.						178.0	162.0	168.0					15																	88678334		2201	4299	6500	SO:0001583	missense	4916	exon10			TCACCTGGAAAGG	U05012	CCDS10340.1, CCDS32322.1, CCDS32323.1, CCDS58399.1	15q24-q25	2013-01-11			ENSG00000140538	ENSG00000140538	2.7.10.1	"""Immunoglobulin superfamily / I-set domain containing"""	8033	protein-coding gene	gene with protein product		191316				7806211	Standard	NM_001012338		Approved	TRKC	uc002bme.2	Q16288	OTTHUMG00000148677	ENST00000360948.2:c.1202C>A	15.37:g.88678334G>T	ENSP00000354207:p.Pro401Gln	Somatic	257	0		WXS	Illumina GAIIx	Phase_I	212	83	NM_001243101	0	0	0	0	0	B7Z4C5|E9PG56|H0YND1|O75682|Q12827|Q16289	Missense_Mutation	SNP	ENST00000360948.2	37	CCDS32322.1	.	.	.	.	.	.	.	.	.	.	G	13.89	2.373379	0.42105	.	.	ENSG00000140538	ENST00000394480;ENST00000360948;ENST00000357724;ENST00000355254;ENST00000542733;ENST00000540489;ENST00000317501	T;T;T;T;T;T;T	0.73789	-0.78;-0.74;-0.77;-0.78;-0.66;0.07;0.07	5.28	5.28	0.74379	.	0.478104	0.25335	N	0.031401	T	0.58864	0.2152	N	0.19112	0.55	0.40701	D	0.982487	B;B;B;P;P;B	0.42785	0.13;0.346;0.035;0.79;0.478;0.07	B;B;B;B;B;B	0.34931	0.035;0.077;0.065;0.192;0.174;0.065	T	0.60934	-0.7164	10	0.22706	T	0.39	.	17.9192	0.88961	0.0:0.0:1.0:0.0	.	303;401;401;401;401;401	B7Z7U4;E9PG56;B7Z4C5;Q96CY4;Q16288-3;Q16288	.;.;.;.;.;NTRK3_HUMAN	Q	401;401;401;401;303;401;401	ENSP00000377990:P401Q;ENSP00000354207:P401Q;ENSP00000350356:P401Q;ENSP00000347397:P401Q;ENSP00000437773:P303Q;ENSP00000444673:P401Q;ENSP00000318328:P401Q	ENSP00000318328:P401Q	P	-	2	0	NTRK3	86479338	1.000000	0.71417	1.000000	0.80357	0.882000	0.50991	2.901000	0.48695	2.466000	0.83321	0.563000	0.77884	CCA	.		0.532	NTRK3-204	KNOWN	basic|CCDS	protein_coding	protein_coding			
NTRK3	4916	bcgsc.ca	37	15	88680684	88680684	+	Silent	SNP	G	G	A	rs1128994	byFrequency	TCGA-OR-A5KY-01A-11D-A29I-10	TCGA-OR-A5KY-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	72f9e1d9-c852-423a-94ff-17f763fa2713	f6e93da3-9ee7-4a65-bc04-30f8bb730eef	g.chr15:88680684G>A	ENST00000360948.2	-	6	734	c.573C>T	c.(571-573)aaC>aaT	p.N191N	NTRK3_ENST00000357724.2_Silent_p.N191N|NTRK3_ENST00000394480.2_Silent_p.N191N|NTRK3_ENST00000557856.1_Silent_p.N191N|NTRK3_ENST00000558676.1_Silent_p.N191N|NTRK3_ENST00000542733.2_Silent_p.N93N|NTRK3_ENST00000540489.2_Silent_p.N191N|NTRK3_ENST00000317501.3_Silent_p.N191N|NTRK3_ENST00000355254.2_Silent_p.N191N	NM_001012338.2	NP_001012338.1	Q16288	NTRK3_HUMAN	neurotrophic tyrosine kinase, receptor, type 3	191	LRRCT.				activation of MAPK activity (GO:0000187)|activation of protein kinase B activity (GO:0032148)|activation of Ras GTPase activity (GO:0032856)|cellular response to retinoic acid (GO:0071300)|circadian rhythm (GO:0007623)|cochlea development (GO:0090102)|lens fiber cell differentiation (GO:0070306)|mechanoreceptor differentiation (GO:0042490)|modulation by virus of host transcription (GO:0019056)|negative regulation of astrocyte differentiation (GO:0048712)|negative regulation of cell death (GO:0060548)|negative regulation of protein phosphorylation (GO:0001933)|neuron fate specification (GO:0048665)|neuron migration (GO:0001764)|neurotrophin signaling pathway (GO:0038179)|positive regulation of actin cytoskeleton reorganization (GO:2000251)|positive regulation of axon extension involved in regeneration (GO:0048691)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of positive chemotaxis (GO:0050927)|protein autophosphorylation (GO:0046777)|response to axon injury (GO:0048678)|response to corticosterone (GO:0051412)|response to ethanol (GO:0045471)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|neurotrophin binding (GO:0043121)|neurotrophin receptor activity (GO:0005030)|p53 binding (GO:0002039)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)		ETV6/NTRK3(238)	breast(3)|central_nervous_system(3)|endometrium(6)|kidney(1)|large_intestine(22)|lung(63)|ovary(6)|pancreas(3)|prostate(1)|skin(4)|stomach(5)|upper_aerodigestive_tract(2)	119			BRCA - Breast invasive adenocarcinoma(143;0.211)			AGCCATCAGCGTTGATGCAGT	0.587			T	ETV6	"""congenital fibrosarcoma, Secretory breast """					TSP Lung(13;0.10)			G|||	1356	0.270767	0.3555	0.2046	5008	,	,		19398	0.2222		0.2624	False		,,,				2504	0.2618				p.N191N		.		Dom	yes		15	15q25	4916	"""neurotrophic tyrosine kinase, receptor, type 3"""		"""E, M"""	.	NTRK3-3538	0			c.C573T						.	G	,,	1624,2778	498.8+/-364.2	300,1024,877	141.0	105.0	117.0		573,573,573	-2.5	0.0	15	dbSNP_86	117	2317,6281	390.4+/-343.3	295,1727,2277	no	coding-synonymous,coding-synonymous,coding-synonymous	NTRK3	NM_001007156.2,NM_001012338.2,NM_002530.3	,,	595,2751,3154	AA,AG,GG		26.9481,36.8923,30.3154	,,	191/613,191/840,191/826	88680684	3941,9059	2201	4299	6500	SO:0001819	synonymous_variant	4916	exon7			ATCAGCGTTGATG	U05012	CCDS10340.1, CCDS32322.1, CCDS32323.1, CCDS58399.1	15q24-q25	2013-01-11			ENSG00000140538	ENSG00000140538	2.7.10.1	"""Immunoglobulin superfamily / I-set domain containing"""	8033	protein-coding gene	gene with protein product		191316				7806211	Standard	NM_001012338		Approved	TRKC	uc002bme.2	Q16288	OTTHUMG00000148677	ENST00000360948.2:c.573C>T	15.37:g.88680684G>A		Somatic	132	0		WXS	Illumina GAIIx	Phase_I	163	6	NM_001243101	0	0	1	1	0	B7Z4C5|E9PG56|H0YND1|O75682|Q12827|Q16289	Silent	SNP	ENST00000360948.2	37	CCDS32322.1																																																																																			G|0.705;A|0.295		0.587	NTRK3-204	KNOWN	basic|CCDS	protein_coding	protein_coding			
MRPS34	65993	hgsc.bcm.edu	37	16	1822947	1822947	+	Silent	SNP	C	C	G	rs1076695	byFrequency	TCGA-OR-A5KY-01A-11D-A29I-10	TCGA-OR-A5KY-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	72f9e1d9-c852-423a-94ff-17f763fa2713	f6e93da3-9ee7-4a65-bc04-30f8bb730eef	g.chr16:1822947C>G	ENST00000397375.2	-	1	209	c.174G>C	c.(172-174)gtG>gtC	p.V58V	NME3_ENST00000219302.3_5'Flank|EME2_ENST00000568449.1_5'Flank|EME2_ENST00000307394.7_5'Flank|MRPS34_ENST00000177742.3_Silent_p.V58V|NME3_ENST00000563498.1_5'Flank	NM_023936.1	NP_076425.1	P82930	RT34_HUMAN	mitochondrial ribosomal protein S34	58						mitochondrion (GO:0005739)|ribosome (GO:0005840)				breast(1)|skin(2)	3						TCTCGCGGCGCACGTCGGCCC	0.726													C|||	251	0.0501198	0.0061	0.0965	5008	,	,		10499	0.002		0.1421	False		,,,				2504	0.0317				p.V58V		.											.	MRPS34-92	0			c.G174C						.	C		25,2311		0,25,1143	1.0	2.0	2.0		174	1.7	1.0	16	dbSNP_86	2	405,4871		9,387,2242	no	coding-synonymous	MRPS34	NM_023936.1		9,412,3385	GG,GC,CC		7.6763,1.0702,5.649		58/219	1822947	430,7182	1168	2638	3806	SO:0001819	synonymous_variant	65993	exon1			GCGGCGCACGTCG	BC001182	CCDS10444.1, CCDS73805.1	16p13.3	2012-09-13			ENSG00000074071	ENSG00000074071		"""Mitochondrial ribosomal proteins / small subunits"""	16618	protein-coding gene	gene with protein product		611994					Standard	NM_023936		Approved	MRP-S12, MGC2616	uc002cmo.3	P82930	OTTHUMG00000128636	ENST00000397375.2:c.174G>C	16.37:g.1822947C>G		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	11	8	NM_023936	0	0	6	23	17	Q9BVI7	Silent	SNP	ENST00000397375.2	37	CCDS10444.1																																																																																			C|0.923;G|0.077		0.726	MRPS34-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250506.1	NM_023936	
ZNF598	90850	hgsc.bcm.edu	37	16	2059674	2059674	+	Missense_Mutation	SNP	T	T	C	rs71384660		TCGA-OR-A5KY-01A-11D-A29I-10	TCGA-OR-A5KY-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	72f9e1d9-c852-423a-94ff-17f763fa2713	f6e93da3-9ee7-4a65-bc04-30f8bb730eef	g.chr16:2059674T>C	ENST00000431526.1	-	2	88	c.74A>G	c.(73-75)gAa>gGa	p.E25G	ZNF598_ENST00000563630.1_5'UTR|ZNF598_ENST00000562103.1_5'UTR	NM_178167.2	NP_835461.2	Q86UK7	ZN598_HUMAN	zinc finger protein 598	25							poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|lung(7)|skin(1)|urinary_tract(1)	16						GCTCCCGCCTTCCCGCTCAGG	0.766													C|||	5008	1.0	1.0	1.0	5008	,	,		5162	1.0		1.0	False		,,,				2504	1.0				p.E25G		.											.	ZNF598-432	0			c.A74G						.						1.0	2.0	2.0					16																	2059674		1089	2314	3403	SO:0001583	missense	90850	exon2			CCGCCTTCCCGCT	BC029270		16p13.3	2008-05-02				ENSG00000167962		"""Zinc fingers, C2H2-type"""	28079	protein-coding gene	gene with protein product							Standard	NM_178167		Approved	FLJ00086	uc002cof.2	Q86UK7		ENST00000431526.1:c.74A>G	16.37:g.2059674T>C	ENSP00000411409:p.Glu25Gly	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	9	9	NM_178167	0	0	0	6	6	Q8IW49|Q8N3D9|Q96FG3|Q9H7J3	Missense_Mutation	SNP	ENST00000431526.1	37		2168	0.9926739926739927	487	0.9898373983739838	361	0.9972375690607734	568	0.993006993006993	752	0.9920844327176781	N	1.560	-0.537056	0.04082	.	.	ENSG00000167962	ENST00000431526	T	0.77098	-1.07	3.3	3.3	0.37823	.	0.415485	0.23105	N	0.051871	T	0.00012	0.0000	.	.	.	0.48696	P	3.1000000000003247E-4	.	.	.	.	.	.	T	0.34650	-0.9820	6	0.22706	T	0.39	-7.8624	8.393	0.32540	0.0:0.8796:0.0:0.1204	.	.	.	.	G	25	ENSP00000411409:E25G	ENSP00000411409:E25G	E	-	2	0	ZNF598	1999675	1.000000	0.71417	1.000000	0.80357	0.107000	0.19398	0.911000	0.28584	0.691000	0.31592	-0.642000	0.03964	GAA	T|0.007;C|0.993		0.766	ZNF598-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_178167	
FTO	79068	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	16	53860242	53860242	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5KY-01A-11D-A29I-10	TCGA-OR-A5KY-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	72f9e1d9-c852-423a-94ff-17f763fa2713	f6e93da3-9ee7-4a65-bc04-30f8bb730eef	g.chr16:53860242C>T	ENST00000471389.1	+	3	812	c.590C>T	c.(589-591)gCa>gTa	p.A197V	FTO_ENST00000394647.3_Intron	NM_001080432.2	NP_001073901.1	Q9C0B1	FTO_HUMAN	fat mass and obesity associated	197	Fe2OG dioxygenase domain.				adipose tissue development (GO:0060612)|DNA dealkylation involved in DNA repair (GO:0006307)|DNA demethylation (GO:0080111)|oxidative demethylation (GO:0070989)|oxidative single-stranded DNA demethylation (GO:0035552)|oxidative single-stranded RNA demethylation (GO:0035553)|regulation of lipid storage (GO:0010883)|regulation of multicellular organism growth (GO:0040014)|regulation of respiratory system process (GO:0044065)|regulation of white fat cell proliferation (GO:0070350)|RNA repair (GO:0042245)|temperature homeostasis (GO:0001659)	nuclear speck (GO:0016607)|nucleus (GO:0005634)	DNA-N1-methyladenine dioxygenase activity (GO:0043734)|ferrous iron binding (GO:0008198)|oxidative DNA demethylase activity (GO:0035516)|oxidative RNA demethylase activity (GO:0035515)			endometrium(1)|kidney(2)|large_intestine(7)|lung(13)|prostate(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	29						AAGAGCAGAGCAGCATACAAC	0.458																																					p.A197V		.											.	FTO-68	0			c.C590T						.						163.0	143.0	150.0					16																	53860242		2198	4300	6498	SO:0001583	missense	79068	exon3			GCAGAGCAGCATA	BC003583	CCDS32448.1	16q12.2	2013-11-15			ENSG00000140718	ENSG00000140718		"""Alkylation repair homologs"""	24678	protein-coding gene	gene with protein product	"""AlkB homolog 9"", ""alpha-ketoglutarate-dependent dioxygenase"""	610966				17434869, 17991826, 22002720	Standard	NM_001080432		Approved	KIAA1752, MGC5149, ALKBH9	uc002ehr.3	Q9C0B1	OTTHUMG00000158780	ENST00000471389.1:c.590C>T	16.37:g.53860242C>T	ENSP00000418823:p.Ala197Val	Somatic	240	0		WXS	Illumina GAIIx	Phase_I	277	90	NM_001080432	0	0	3	5	2	A2RUH1|B2RNS0|Q0P676|Q7Z785	Missense_Mutation	SNP	ENST00000471389.1	37	CCDS32448.1	.	.	.	.	.	.	.	.	.	.	C	11.91	1.778753	0.31502	.	.	ENSG00000140718	ENST00000471389	T	0.64438	-0.1	5.32	5.32	0.75619	Alpha-ketoglutarate-dependent dioxygenase FTO, catalytic domain (1);	0.546950	0.21307	N	0.076712	T	0.57110	0.2031	L	0.45581	1.43	0.25529	N	0.987297	B	0.32653	0.379	B	0.38378	0.272	T	0.48714	-0.9011	10	0.14252	T	0.57	-12.279	13.9126	0.63876	0.1522:0.8478:0.0:0.0	.	197	Q9C0B1	FTO_HUMAN	V	197	ENSP00000418823:A197V	ENSP00000418823:A197V	A	+	2	0	FTO	52417743	0.997000	0.39634	0.219000	0.23793	0.981000	0.71138	3.553000	0.53713	2.486000	0.83907	0.655000	0.94253	GCA	.		0.458	FTO-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352196.1	NM_001080432	
IRX3	79191	hgsc.bcm.edu	37	16	54318528	54318528	+	Missense_Mutation	SNP	A	A	G	rs1450355	byFrequency	TCGA-OR-A5KY-01A-11D-A29I-10	TCGA-OR-A5KY-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	72f9e1d9-c852-423a-94ff-17f763fa2713	f6e93da3-9ee7-4a65-bc04-30f8bb730eef	g.chr16:54318528A>G	ENST00000329734.3	-	2	1977	c.1265T>C	c.(1264-1266)cTg>cCg	p.L422P		NM_024336.2	NP_077312.2	P78415	IRX3_HUMAN	iroquois homeobox 3	422	Pro-rich.		L -> P (in dbSNP:rs1450355). {ECO:0000269|PubMed:15489334}.		mesoderm development (GO:0007498)|metanephros development (GO:0001656)|negative regulation of neuron differentiation (GO:0045665)|positive regulation of neuron differentiation (GO:0045666)|regulation of transcription, DNA-templated (GO:0006355)|specification of loop of Henle identity (GO:0072086)|transcription, DNA-templated (GO:0006351)	axon (GO:0030424)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)			endometrium(2)|kidney(1)|large_intestine(5)|lung(3)|ovary(1)|soft_tissue(1)|urinary_tract(1)	14						GAGCGGGTGCAGGCGGGGGCC	0.776													g|||	4851	0.96865	0.888	0.987	5008	,	,		8017	1.0		1.0	False		,,,				2504	1.0				p.L422P	GBM(143;1830 1866 4487 4646 37383)	.											.	IRX3-90	0			c.T1265C						.	T	PRO/LEU	1678,102		788,102,0	1.0	2.0	2.0		1265	2.5	1.0	16	dbSNP_88	2	4195,3		2096,3,0	no	missense	IRX3	NM_024336.2	98	2884,105,0	GG,GA,AA		0.0715,5.7303,1.7564	benign	422/502	54318528	5873,105	890	2099	2989	SO:0001583	missense	79191	exon2			GGGTGCAGGCGGG	U90308	CCDS10750.1	16q12.2	2011-06-20	2007-07-13		ENSG00000177508	ENSG00000177508		"""Homeoboxes / TALE class"""	14360	protein-coding gene	gene with protein product		612985					Standard	NM_024336		Approved	IRX-1	uc002eht.1	P78415	OTTHUMG00000133200	ENST00000329734.3:c.1265T>C	16.37:g.54318528A>G	ENSP00000331608:p.Leu422Pro	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	15	15	NM_024336	0	0	0	1	1	Q7Z4A4|Q7Z4A5|Q8IVC6	Missense_Mutation	SNP	ENST00000329734.3	37	CCDS10750.1	2108	0.9652014652014652	433	0.8800813008130082	354	0.9779005524861878	567	0.9912587412587412	754	0.9947229551451188	g	5.642	0.303067	0.10678	0.942697	0.999285	ENSG00000177508	ENST00000329734	T	0.54279	0.58	4.4	2.45	0.29901	.	0.652897	0.14990	N	0.286760	T	0.00012	0.0000	N	0.01352	-0.895	0.29914	P	0.82336	B	0.02656	0.0	B	0.01281	0.0	T	0.21861	-1.0233	9	0.33940	T	0.23	-4.0049	5.143	0.14969	0.1733:0.0:0.6627:0.164	rs1450355;rs17852160;rs60836119	422	P78415	IRX3_HUMAN	P	422	ENSP00000331608:L422P	ENSP00000331608:L422P	L	-	2	0	IRX3	52876029	1.000000	0.71417	0.984000	0.44739	0.000000	0.00434	1.455000	0.35190	0.155000	0.19261	-1.528000	0.00924	CTG	T|0.035;G|0.004		0.776	IRX3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256910.2		
CCDC102A	92922	hgsc.bcm.edu	37	16	57562804	57562804	+	Missense_Mutation	SNP	G	G	A	rs12935069		TCGA-OR-A5KY-01A-11D-A29I-10	TCGA-OR-A5KY-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	72f9e1d9-c852-423a-94ff-17f763fa2713	f6e93da3-9ee7-4a65-bc04-30f8bb730eef	g.chr16:57562804G>A	ENST00000258214.2	-	2	532	c.286C>T	c.(286-288)Cgg>Tgg	p.R96W		NM_033212.3	NP_149989.2	Q96A19	C102A_HUMAN	coiled-coil domain containing 102A	96				R -> W (in Ref. 2; AAH08285/AAH09941). {ECO:0000305}.						endometrium(1)|large_intestine(1)|lung(4)|ovary(1)|prostate(1)	8						TCCGACCACCGGCGCATGGTC	0.731													A|||	5008	1.0	1.0	1.0	5008	,	,		3757	1.0		1.0	False		,,,				2504	1.0				p.R96W		.											.	CCDC102A-91	0			c.C286T						.						8.0	10.0	9.0					16																	57562804		1834	3717	5551	SO:0001583	missense	92922	exon2			ACCACCGGCGCAT	BC008285	CCDS10784.1	16q13	2008-02-05			ENSG00000135736	ENSG00000135736			28097	protein-coding gene	gene with protein product						12477932	Standard	NM_033212		Approved	MGC10992	uc002elw.3	Q96A19	OTTHUMG00000133472	ENST00000258214.2:c.286C>T	16.37:g.57562804G>A	ENSP00000258214:p.Arg96Trp	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	6	6	NM_033212	0	0	0	0	0	Q9BT74	Missense_Mutation	SNP	ENST00000258214.2	37	CCDS10784.1	2180	0.9981684981684982	492	1.0	360	0.994475138121547	570	0.9965034965034965	758	1.0	A	10.17	1.277909	0.23307	.	.	ENSG00000135736	ENST00000258214	T	0.37752	1.18	4.82	4.82	0.62117	.	0.000000	0.64402	N	0.000001	T	0.00012	0.0000	N	0.00049	-2.415	0.40217	P	0.022302999999999962	B	0.02656	0.0	B	0.01281	0.0	T	0.44787	-0.9305	9	0.33141	T	0.24	-23.2491	9.5348	0.39216	0.9152:0.0:0.0848:0.0	rs12935069;rs12935069	96	Q96A19	C102A_HUMAN	W	96	ENSP00000258214:R96W	ENSP00000258214:R96W	R	-	1	2	CCDC102A	56120305	1.000000	0.71417	1.000000	0.80357	0.971000	0.66376	6.801000	0.75170	0.698000	0.31739	-0.556000	0.04195	CGG	G|0.001;A|0.999		0.731	CCDC102A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257348.1	NM_033212	
ZFPM1	161882	hgsc.bcm.edu	37	16	88599696	88599697	+	Frame_Shift_Del	DEL	GA	GA	-	rs368520732|rs67712719	byFrequency	TCGA-OR-A5KY-01A-11D-A29I-10	TCGA-OR-A5KY-10A-01D-A29L-10	GA	GA	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	72f9e1d9-c852-423a-94ff-17f763fa2713	f6e93da3-9ee7-4a65-bc04-30f8bb730eef	g.chr16:88599696_88599697delGA	ENST00000319555.3	+	10	1652_1653	c.1330_1331delGA	c.(1330-1332)gagfs	p.E444fs	RP11-21B21.4_ENST00000563243.1_RNA	NM_153813.2	NP_722520.2	Q8IX07	FOG1_HUMAN	zinc finger protein, FOG family member 1	444				EPLA -> AP (in Ref. 1; AAN45858). {ECO:0000305}.	atrial septum morphogenesis (GO:0060413)|atrioventricular valve morphogenesis (GO:0003181)|blood coagulation (GO:0007596)|cardiac muscle tissue morphogenesis (GO:0055008)|definitive erythrocyte differentiation (GO:0060318)|embryonic hemopoiesis (GO:0035162)|erythrocyte differentiation (GO:0030218)|granulocyte differentiation (GO:0030851)|megakaryocyte development (GO:0035855)|megakaryocyte differentiation (GO:0030219)|mitral valve formation (GO:0003192)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of interleukin-4 biosynthetic process (GO:0045403)|negative regulation of mast cell differentiation (GO:0060377)|negative regulation of protein binding (GO:0032091)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|outflow tract morphogenesis (GO:0003151)|platelet formation (GO:0030220)|positive regulation of interferon-gamma biosynthetic process (GO:0045078)|primitive erythrocyte differentiation (GO:0060319)|regulation of chemokine production (GO:0032642)|regulation of definitive erythrocyte differentiation (GO:0010724)|T-helper cell lineage commitment (GO:0002295)|transcriptional activation by promoter-enhancer looping (GO:0071733)|tricuspid valve formation (GO:0003195)|ventricular septum morphogenesis (GO:0060412)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|transcription factor complex (GO:0005667)|transcriptional repressor complex (GO:0017053)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II transcription factor binding (GO:0001085)|transcription factor binding (GO:0008134)			central_nervous_system(1)|ovary(2)|urinary_tract(1)	4				BRCA - Breast invasive adenocarcinoma(80;0.0478)		GGCCAGAGCGGAGCCTCTGGCC	0.743														4881	0.974641	0.9138	0.9914	5008	,	,		7261	0.996		1.0	False		,,,				2504	0.9969				p.444_444del	Pancreas(49;850 1106 29641 32847 38344)	.											.	ZFPM1-90	0			c.1330_1331del						.			2219,383		1063,93,145						-6.5	0.0		dbSNP_130	3	4709,133		2339,31,51	no	frameshift	ZFPM1	NM_153813.2		3402,124,196	A1A1,A1R,RR		2.7468,14.7194,6.9318				6928,516				SO:0001589	frameshift_variant	161882	exon10			AGAGCGGAGCCTC	AF488691	CCDS32502.1	16q24.2	2013-01-10	2012-11-27		ENSG00000179588	ENSG00000179588		"""Zinc fingers, C2H2-type"", ""Zinc fingers, C2HC-type containing"""	19762	protein-coding gene	gene with protein product		601950	"""zinc finger protein, multitype 1"""				Standard	NM_153813		Approved	FOG1, FOG, ZNF89A, ZC2HC11A	uc002fkv.3	Q8IX07	OTTHUMG00000173152	ENST00000319555.3:c.1330_1331delGA	16.37:g.88599696_88599697delGA	ENSP00000326630:p.Glu444fs	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	20	14	NM_153813	0	0	0	0	0		Frame_Shift_Del	DEL	ENST00000319555.3	37	CCDS32502.1																																																																																			.		0.743	ZFPM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000422270.2		
ZFPM1	161882	hgsc.bcm.edu	37	16	88599697	88599705	+	In_Frame_Del	DEL	AGCCTCTGG	AGCCTCTGG	-	rs67873604|rs149145771|rs368520732|rs67322929|rs201915453|rs67712719	byFrequency	TCGA-OR-A5KY-01A-11D-A29I-10	TCGA-OR-A5KY-10A-01D-A29L-10	AGCCTCTGG	AGCCTCTGG	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	72f9e1d9-c852-423a-94ff-17f763fa2713	f6e93da3-9ee7-4a65-bc04-30f8bb730eef	g.chr16:88599697_88599705delAGCCTCTGG	ENST00000319555.3	+	10	1653_1661	c.1331_1339delAGCCTCTGG	c.(1330-1341)gagcctctggcc>gcc	p.EPL444del	RP11-21B21.4_ENST00000563243.1_RNA	NM_153813.2	NP_722520.2	Q8IX07	FOG1_HUMAN	zinc finger protein, FOG family member 1	444				EPLA -> AP (in Ref. 1; AAN45858). {ECO:0000305}.	atrial septum morphogenesis (GO:0060413)|atrioventricular valve morphogenesis (GO:0003181)|blood coagulation (GO:0007596)|cardiac muscle tissue morphogenesis (GO:0055008)|definitive erythrocyte differentiation (GO:0060318)|embryonic hemopoiesis (GO:0035162)|erythrocyte differentiation (GO:0030218)|granulocyte differentiation (GO:0030851)|megakaryocyte development (GO:0035855)|megakaryocyte differentiation (GO:0030219)|mitral valve formation (GO:0003192)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of interleukin-4 biosynthetic process (GO:0045403)|negative regulation of mast cell differentiation (GO:0060377)|negative regulation of protein binding (GO:0032091)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|outflow tract morphogenesis (GO:0003151)|platelet formation (GO:0030220)|positive regulation of interferon-gamma biosynthetic process (GO:0045078)|primitive erythrocyte differentiation (GO:0060319)|regulation of chemokine production (GO:0032642)|regulation of definitive erythrocyte differentiation (GO:0010724)|T-helper cell lineage commitment (GO:0002295)|transcriptional activation by promoter-enhancer looping (GO:0071733)|tricuspid valve formation (GO:0003195)|ventricular septum morphogenesis (GO:0060412)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|transcription factor complex (GO:0005667)|transcriptional repressor complex (GO:0017053)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II transcription factor binding (GO:0001085)|transcription factor binding (GO:0008134)			central_nervous_system(1)|ovary(2)|urinary_tract(1)	4				BRCA - Breast invasive adenocarcinoma(80;0.0478)		GCCAGAGCGGAGCCTCTGGCCCAGAATGG	0.746																																					p.444_447del	Pancreas(49;850 1106 29641 32847 38344)	.											.	ZFPM1-90	0			c.1331_1339del						.																																			SO:0001651	inframe_deletion	161882	exon10			GAGCGGAGCCTCT	AF488691	CCDS32502.1	16q24.2	2013-01-10	2012-11-27		ENSG00000179588	ENSG00000179588		"""Zinc fingers, C2H2-type"", ""Zinc fingers, C2HC-type containing"""	19762	protein-coding gene	gene with protein product		601950	"""zinc finger protein, multitype 1"""				Standard	NM_153813		Approved	FOG1, FOG, ZNF89A, ZC2HC11A	uc002fkv.3	Q8IX07	OTTHUMG00000173152	ENST00000319555.3:c.1331_1339delAGCCTCTGG	16.37:g.88599697_88599705delAGCCTCTGG	ENSP00000326630:p.Glu444_Leu446del	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	20	0	NM_153813	0	0	0	0	0		In_Frame_Del	DEL	ENST00000319555.3	37	CCDS32502.1																																																																																			.		0.746	ZFPM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000422270.2		
ZFPM1	161882	hgsc.bcm.edu	37	16	88599701	88599701	+	Frame_Shift_Del	DEL	T	T	-	rs67322929|rs149145771	byFrequency	TCGA-OR-A5KY-01A-11D-A29I-10	TCGA-OR-A5KY-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	72f9e1d9-c852-423a-94ff-17f763fa2713	f6e93da3-9ee7-4a65-bc04-30f8bb730eef	g.chr16:88599701delT	ENST00000319555.3	+	10	1657	c.1335delT	c.(1333-1335)cctfs	p.P445fs	RP11-21B21.4_ENST00000563243.1_RNA	NM_153813.2	NP_722520.2	Q8IX07	FOG1_HUMAN	zinc finger protein, FOG family member 1	445				EPLA -> AP (in Ref. 1; AAN45858). {ECO:0000305}.	atrial septum morphogenesis (GO:0060413)|atrioventricular valve morphogenesis (GO:0003181)|blood coagulation (GO:0007596)|cardiac muscle tissue morphogenesis (GO:0055008)|definitive erythrocyte differentiation (GO:0060318)|embryonic hemopoiesis (GO:0035162)|erythrocyte differentiation (GO:0030218)|granulocyte differentiation (GO:0030851)|megakaryocyte development (GO:0035855)|megakaryocyte differentiation (GO:0030219)|mitral valve formation (GO:0003192)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of interleukin-4 biosynthetic process (GO:0045403)|negative regulation of mast cell differentiation (GO:0060377)|negative regulation of protein binding (GO:0032091)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|outflow tract morphogenesis (GO:0003151)|platelet formation (GO:0030220)|positive regulation of interferon-gamma biosynthetic process (GO:0045078)|primitive erythrocyte differentiation (GO:0060319)|regulation of chemokine production (GO:0032642)|regulation of definitive erythrocyte differentiation (GO:0010724)|T-helper cell lineage commitment (GO:0002295)|transcriptional activation by promoter-enhancer looping (GO:0071733)|tricuspid valve formation (GO:0003195)|ventricular septum morphogenesis (GO:0060412)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|transcription factor complex (GO:0005667)|transcriptional repressor complex (GO:0017053)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II transcription factor binding (GO:0001085)|transcription factor binding (GO:0008134)			central_nervous_system(1)|ovary(2)|urinary_tract(1)	4				BRCA - Breast invasive adenocarcinoma(80;0.0478)		GAGCGGAGCCTCTGGCCCAGA	0.746													-|T|-|insertion	4871	0.972644	0.9145	0.9899	5008	,	,		7405	0.995		0.994	False		,,,				2504	0.9939				p.P445fs	Pancreas(49;850 1106 29641 32847 38344)	.											.	ZFPM1-90	0			c.1335delT						.						1.0	1.0	1.0					16																	88599701		392	657	1049	SO:0001589	frameshift_variant	161882	exon10			GGAGCCTCTGGCC	AF488691	CCDS32502.1	16q24.2	2013-01-10	2012-11-27		ENSG00000179588	ENSG00000179588		"""Zinc fingers, C2H2-type"", ""Zinc fingers, C2HC-type containing"""	19762	protein-coding gene	gene with protein product		601950	"""zinc finger protein, multitype 1"""				Standard	NM_153813		Approved	FOG1, FOG, ZNF89A, ZC2HC11A	uc002fkv.3	Q8IX07	OTTHUMG00000173152	ENST00000319555.3:c.1335delT	16.37:g.88599701delT	ENSP00000326630:p.Pro445fs	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	16	14	NM_153813	0	0	0	0	0		Frame_Shift_Del	DEL	ENST00000319555.3	37	CCDS32502.1																																																																																			.		0.746	ZFPM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000422270.2		
ZFPM1	161882	hgsc.bcm.edu	37	16	88599703	88599705	+	In_Frame_Del	DEL	TGG	TGG	-	rs149145771|rs67873604	byFrequency	TCGA-OR-A5KY-01A-11D-A29I-10	TCGA-OR-A5KY-10A-01D-A29L-10	TGG	TGG	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	72f9e1d9-c852-423a-94ff-17f763fa2713	f6e93da3-9ee7-4a65-bc04-30f8bb730eef	g.chr16:88599703_88599705delTGG	ENST00000319555.3	+	10	1659_1661	c.1337_1339delTGG	c.(1336-1341)ctggcc>ccc	p.446_447LA>P	RP11-21B21.4_ENST00000563243.1_RNA	NM_153813.2	NP_722520.2	Q8IX07	FOG1_HUMAN	zinc finger protein, FOG family member 1	446				EPLA -> AP (in Ref. 1; AAN45858). {ECO:0000305}.	atrial septum morphogenesis (GO:0060413)|atrioventricular valve morphogenesis (GO:0003181)|blood coagulation (GO:0007596)|cardiac muscle tissue morphogenesis (GO:0055008)|definitive erythrocyte differentiation (GO:0060318)|embryonic hemopoiesis (GO:0035162)|erythrocyte differentiation (GO:0030218)|granulocyte differentiation (GO:0030851)|megakaryocyte development (GO:0035855)|megakaryocyte differentiation (GO:0030219)|mitral valve formation (GO:0003192)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of interleukin-4 biosynthetic process (GO:0045403)|negative regulation of mast cell differentiation (GO:0060377)|negative regulation of protein binding (GO:0032091)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|outflow tract morphogenesis (GO:0003151)|platelet formation (GO:0030220)|positive regulation of interferon-gamma biosynthetic process (GO:0045078)|primitive erythrocyte differentiation (GO:0060319)|regulation of chemokine production (GO:0032642)|regulation of definitive erythrocyte differentiation (GO:0010724)|T-helper cell lineage commitment (GO:0002295)|transcriptional activation by promoter-enhancer looping (GO:0071733)|tricuspid valve formation (GO:0003195)|ventricular septum morphogenesis (GO:0060412)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|transcription factor complex (GO:0005667)|transcriptional repressor complex (GO:0017053)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II transcription factor binding (GO:0001085)|transcription factor binding (GO:0008134)			central_nervous_system(1)|ovary(2)|urinary_tract(1)	4				BRCA - Breast invasive adenocarcinoma(80;0.0478)		GCGGAGCCTCTGGCCCAGAATGG	0.739														4871	0.972644	0.9145	0.9899	5008	,	,		7191	0.995		0.994	False		,,,				2504	0.9939				p.446_447del	Pancreas(49;850 1106 29641 32847 38344)	.											.	ZFPM1-90	0			c.1337_1339del						.																																			SO:0001651	inframe_deletion	161882	exon10			AGCCTCTGGCCCA	AF488691	CCDS32502.1	16q24.2	2013-01-10	2012-11-27		ENSG00000179588	ENSG00000179588		"""Zinc fingers, C2H2-type"", ""Zinc fingers, C2HC-type containing"""	19762	protein-coding gene	gene with protein product		601950	"""zinc finger protein, multitype 1"""				Standard	NM_153813		Approved	FOG1, FOG, ZNF89A, ZC2HC11A	uc002fkv.3	Q8IX07	OTTHUMG00000173152	ENST00000319555.3:c.1337_1339delTGG	16.37:g.88599703_88599705delTGG	ENSP00000326630:p.Leu446_Ala447delinsPro	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	16	14	NM_153813	0	0	0	0	0		In_Frame_Del	DEL	ENST00000319555.3	37	CCDS32502.1																																																																																			.		0.739	ZFPM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000422270.2		
GLTPD2	388323	hgsc.bcm.edu	37	17	4693342	4693342	+	Missense_Mutation	SNP	C	C	A	rs35910358	byFrequency	TCGA-OR-A5KY-01A-11D-A29I-10	TCGA-OR-A5KY-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	72f9e1d9-c852-423a-94ff-17f763fa2713	f6e93da3-9ee7-4a65-bc04-30f8bb730eef	g.chr17:4693342C>A	ENST00000331264.7	+	4	680	c.627C>A	c.(625-627)gaC>gaA	p.D209E		NM_001014985.2	NP_001014985	A6NH11	GLTD2_HUMAN	glycolipid transfer protein domain containing 2	209				D -> E (in Ref. 2; AAI50537). {ECO:0000305}.		cytoplasm (GO:0005737)	glycolipid binding (GO:0051861)|glycolipid transporter activity (GO:0017089)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(1)	4						GAGGCCCGGACGCGGGCGTGC	0.761													C|||	4904	0.979233	0.9228	1.0	5008	,	,		11019	1.0		0.998	False		,,,				2504	1.0				p.D209E		.											.	GLTPD2-68	0			c.C627A						.	C	GLU/ASP	2706,78		1314,78,0	2.0	2.0	2.0		627	0.2	0.1	17	dbSNP_126	2	6028,0		3014,0,0	no	missense	GLTPD2	NM_001014985.2	45	4328,78,0	AA,AC,CC		0.0,2.8017,0.8852	benign	209/292	4693342	8734,78	1392	3014	4406	SO:0001583	missense	388323	exon4			CCCGGACGCGGGC	BC029290	CCDS32534.1	17p13.2	2007-12-19				ENSG00000182327			33756	protein-coding gene	gene with protein product							Standard	NM_001014985		Approved		uc002fza.2	A6NH11		ENST00000331264.7:c.627C>A	17.37:g.4693342C>A	ENSP00000328070:p.Asp209Glu	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	13	12	NM_001014985	0	0	0	0	0	A7E2T2	Missense_Mutation	SNP	ENST00000331264.7	37	CCDS32534.1	2151	0.9848901098901099	466	0.9471544715447154	362	1.0	572	1.0	751	0.9907651715039578	C	9.155	1.017148	0.19355	0.971983	1.0	ENSG00000182327	ENST00000331264	.	.	.	4.58	0.162	0.14981	Glycolipid transfer protein domain (3);	.	.	.	.	T	0.00012	0.0000	L	0.41027	1.25	0.80722	P	0.0	B	0.22080	0.064	B	0.31614	0.133	T	0.34650	-0.9820	7	0.12103	T	0.63	-20.1635	5.889	0.18897	0.0:0.5269:0.298:0.1751	rs35910358	209	A6NH11	GLTD2_HUMAN	E	209	.	ENSP00000328070:D209E	D	+	3	2	GLTPD2	4640082	0.004000	0.15560	0.082000	0.20525	0.081000	0.17604	0.011000	0.13264	-0.068000	0.12953	0.555000	0.69702	GAC	C|0.015;A|0.985		0.761	GLTPD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000439781.1	NM_001014985	
TP53	7157	bcgsc.ca	37	17	7578526	7578526	+	Missense_Mutation	SNP	C	C	T	rs587781991		TCGA-OR-A5KY-01A-11D-A29I-10	TCGA-OR-A5KY-10A-01D-A29L-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	72f9e1d9-c852-423a-94ff-17f763fa2713	f6e93da3-9ee7-4a65-bc04-30f8bb730eef	g.chr17:7578526C>T	ENST00000269305.4	-	5	593	c.404G>A	c.(403-405)tGc>tAc	p.C135Y	TP53_ENST00000359597.4_Missense_Mutation_p.C135Y|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000413465.2_Missense_Mutation_p.C135Y|TP53_ENST00000455263.2_Missense_Mutation_p.C135Y|TP53_ENST00000445888.2_Missense_Mutation_p.C135Y|TP53_ENST00000420246.2_Missense_Mutation_p.C135Y	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	135	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		C -> F (in sporadic cancers; somatic mutation).|C -> G (in sporadic cancers; somatic mutation).|C -> R (in sporadic cancers; somatic mutation).|C -> S (in sporadic cancers; somatic mutation).|C -> T (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).|C -> W (in sporadic cancers; somatic mutation).|C -> Y (in sporadic cancers; somatic mutation; decreased E6-mediated binding to E6-AP).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.C135Y(60)|p.C135F(43)|p.C135S(8)|p.0?(8)|p.C42Y(4)|p.C3Y(4)|p.C135fs*9(3)|p.N131fs*27(2)|p.C3F(2)|p.C42F(2)|p.F134_T140>S(1)|p.K132_A138delKMFCQLA(1)|p.S127_Q136del10(1)|p.C135T(1)|p.V73fs*9(1)|p.C135fs*15(1)|p.C135fs*14(1)|p.Y126fs*11(1)|p.C3fs*9(1)|p.C42fs*9(1)|p.C135_A138delCQLA(1)|p.C42S(1)|p.M133fs*13(1)|p.C3S(1)|p.C135_T140delCQLAKT(1)|p.Q136fs*13(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	GGCCAGTTGGCAAAACATCTT	0.572		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											p.C135Y	Pancreas(47;798 1329 9957 10801)	.	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	.	TP53-70225	152	Substitution - Missense(126)|Deletion - Frameshift(10)|Whole gene deletion(8)|Deletion - In frame(4)|Insertion - Frameshift(3)|Complex - deletion inframe(1)	large_intestine(19)|breast(17)|oesophagus(16)|haematopoietic_and_lymphoid_tissue(13)|urinary_tract(13)|upper_aerodigestive_tract(12)|prostate(11)|lung(9)|ovary(9)|liver(7)|bone(6)|stomach(5)|central_nervous_system(5)|soft_tissue(2)|autonomic_ganglia(2)|eye(1)|kidney(1)|pancreas(1)|skin(1)|NS(1)|pituitary(1)	c.G404A						.						50.0	50.0	50.0					17																	7578526		2203	4300	6503	SO:0001583	missense	7157	exon5	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AGTTGGCAAAACA	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.404G>A	17.37:g.7578526C>T	ENSP00000269305:p.Cys135Tyr	Somatic	79	2		WXS	Illumina GAIIx	Phase_I	106	76	NM_000546	0	0	1	28	27	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	ENST00000269305.4	37	CCDS11118.1	.	.	.	.	.	.	.	.	.	.	C	25.4	4.639320	0.87760	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944;ENST00000414315;ENST00000508793	D;D;D;D;D;D;D;D;D	0.99800	-6.8;-6.8;-6.8;-6.8;-6.8;-6.8;-6.8;-6.8;-6.8	5.48	5.48	0.80851	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.99771	0.9906	M	0.85945	2.785	0.80722	D	1	D;D;D;D;D;D;D	0.89917	1.0;1.0;0.993;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D	0.97110	0.999;1.0;0.929;1.0;1.0;1.0;1.0	D	0.97312	0.9938	10	0.87932	D	0	-26.815	17.2272	0.86973	0.0:1.0:0.0:0.0	.	96;135;135;42;135;135;135	B4E095;P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;.;P53_HUMAN;.;.	Y	135;135;135;135;135;135;124;42;3;42;3;135	ENSP00000410739:C135Y;ENSP00000352610:C135Y;ENSP00000269305:C135Y;ENSP00000398846:C135Y;ENSP00000391127:C135Y;ENSP00000391478:C135Y;ENSP00000425104:C3Y;ENSP00000423862:C42Y;ENSP00000424104:C135Y	ENSP00000269305:C135Y	C	-	2	0	TP53	7519251	1.000000	0.71417	1.000000	0.80357	0.794000	0.44872	7.772000	0.85439	2.733000	0.93635	0.655000	0.94253	TGC	.		0.572	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546	
HSD17B1	3292	hgsc.bcm.edu	37	17	40706906	40706906	+	Missense_Mutation	SNP	G	G	A	rs605059	byFrequency	TCGA-OR-A5KY-01A-11D-A29I-10	TCGA-OR-A5KY-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	72f9e1d9-c852-423a-94ff-17f763fa2713	f6e93da3-9ee7-4a65-bc04-30f8bb730eef	g.chr17:40706906G>A	ENST00000585807.1	+	6	4657	c.937G>A	c.(937-939)Ggt>Agt	p.G313S	RP11-400F19.6_ENST00000590513.1_RNA|RP11-400F19.8_ENST00000585572.1_RNA|HSD17B1_ENST00000225929.5_Missense_Mutation_p.G314S	NM_000413.2	NP_000404.2	P14061	DHB1_HUMAN	hydroxysteroid (17-beta) dehydrogenase 1	313			G -> S (in dbSNP:rs605059). {ECO:0000269|PubMed:1327779, ECO:0000269|PubMed:14702039, ECO:0000269|PubMed:15489334, ECO:0000269|PubMed:2197970, ECO:0000269|PubMed:2330005, ECO:0000269|PubMed:2779584, ECO:0000269|PubMed:2846351, ECO:0000269|PubMed:8389226, ECO:0000269|Ref.6, ECO:0000269|Ref.9}.		bone development (GO:0060348)|cellular response to metal ion (GO:0071248)|estrogen biosynthetic process (GO:0006703)|estrogen metabolic process (GO:0008210)|small molecule metabolic process (GO:0044281)|steroid biosynthetic process (GO:0006694)|steroid metabolic process (GO:0008202)|testosterone biosynthetic process (GO:0061370)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)	catalytic activity (GO:0003824)|estradiol 17-beta-dehydrogenase activity (GO:0004303)			NS(1)|endometrium(1)|kidney(1)|lung(2)	5		all_cancers(22;5.59e-08)|all_epithelial(22;7e-07)|Ovarian(249;0.0261)		BRCA - Breast invasive adenocarcinoma(366;0.129)	Equilin(DB02187)	GGCCGGGCGCGGTGCGGTGGG	0.736													A|||	2617	0.522564	0.4849	0.4942	5008	,	,		11834	0.4534		0.5249	False		,,,				2504	0.6626				p.G313S		.											.	HSD17B1-90	0			c.G937A	GRCh37	CM057951	HSD17B1	M	rs605059	.	A	SER/GLY	2209,1645		683,843,401	3.0	5.0	4.0		937	-1.2	0.0	17	dbSNP_83	4	4593,3023		1489,1615,704	no	missense	HSD17B1	NM_000413.2	56	2172,2458,1105	AA,AG,GG		39.6928,42.6829,40.6975	benign	313/329	40706906	6802,4668	1927	3808	5735	SO:0001583	missense	3292	exon6			GGGCGCGGTGCGG		CCDS11428.1	17q11-q21	2011-09-14					1.1.1.62	"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 2"""	5210	protein-coding gene	gene with protein product	"""Estradiol 17-beta-dehydrogenase-1"", ""short chain dehydrogenase/reductase family 28CE, member 1"""	109684		EDHB17, EDH17B2		2330005, 19027726	Standard	NM_000413		Approved	HSD17, MGC138140, SDR28C1	uc002hzw.3	P14061		ENST00000585807.1:c.937G>A	17.37:g.40706906G>A	ENSP00000466799:p.Gly313Ser	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	8	7	NM_000413	0	0	0	1	1	B3KXS1|Q2M2L8	Missense_Mutation	SNP	ENST00000585807.1	37	CCDS11428.1	1065	0.4876373626373626	249	0.5060975609756098	161	0.4447513812154696	257	0.4493006993006993	398	0.525065963060686	A	1.679	-0.506941	0.04231	0.573171	0.603072	ENSG00000108786	ENST00000225929	.	.	.	0.605	-1.21	0.09524	.	15.510600	0.00792	N	0.001347	T	0.00012	0.0000	N	0.19112	0.55	0.80722	P	0.0	B;B	0.09022	0.002;0.002	B;B	0.01281	0.0;0.0	T	0.49916	-0.8888	7	0.15952	T	0.53	.	.	.	.	rs605059;rs58087383	344;313	B3RFR9;P14061	.;DHB1_HUMAN	S	313	.	ENSP00000225929:G313S	G	+	1	0	HSD17B1	37960432	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-1.026000	0.03596	-2.560000	0.00474	-1.912000	0.00520	GGT	G|0.505;A|0.495		0.736	HSD17B1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000450392.1	NM_000413	
GOSR2	9570	bcgsc.ca	37	17	45008570	45008570	+	Missense_Mutation	SNP	G	G	A	rs197922	byFrequency	TCGA-OR-A5KY-01A-11D-A29I-10	TCGA-OR-A5KY-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	72f9e1d9-c852-423a-94ff-17f763fa2713	f6e93da3-9ee7-4a65-bc04-30f8bb730eef	g.chr17:45008570G>A	ENST00000393456.2	+	3	257	c.200G>A	c.(199-201)aGa>aAa	p.R67K	GOSR2_ENST00000575949.1_Missense_Mutation_p.R67K|GOSR2_ENST00000415811.2_Missense_Mutation_p.R67K|GOSR2_ENST00000225567.4_Missense_Mutation_p.R67K|RP11-156P1.2_ENST00000571841.1_Missense_Mutation_p.R67K|GOSR2_ENST00000576910.2_Missense_Mutation_p.R67K|GOSR2_ENST00000439730.2_Missense_Mutation_p.R67K	NM_004287.3	NP_004278.2	O14653	GOSR2_HUMAN	golgi SNAP receptor complex member 2	67			R -> K (in dbSNP:rs197922).		activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|ER to Golgi vesicle-mediated transport (GO:0006888)|membrane fusion (GO:0061025)|protein transport (GO:0015031)	Golgi membrane (GO:0000139)|Golgi stack (GO:0005795)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	transporter activity (GO:0005215)			kidney(1)|large_intestine(2)|liver(1)|lung(1)|ovary(1)|skin(1)	7			BRCA - Breast invasive adenocarcinoma(9;0.102)			CAAAATGCCAGACTGTAAGTG	0.478													A|||	1733	0.346046	0.2859	0.2507	5008	,	,		17405	0.3621		0.3648	False		,,,				2504	0.4591				p.R67K		.											.	GOSR2-92	0			c.G200A						.	A	LYS/ARG,LYS/ARG,LYS/ARG	1354,3052	691.5+/-405.4	213,928,1062	59.0	59.0	59.0		200,200,200	4.8	1.0	17	dbSNP_79	59	2870,5730	673.1+/-403.0	484,1902,1914	yes	missense,missense,missense	GOSR2	NM_001012511.1,NM_004287.3,NM_054022.2	26,26,26	697,2830,2976	AA,AG,GG		33.3721,30.7308,32.4773	benign,benign,benign	67/196,67/213,67/214	45008570	4224,8782	2203	4300	6503	SO:0001583	missense	9570	exon3			ATGCCAGACTGTA	AF007548	CCDS11507.1, CCDS42355.1, CCDS45719.1	17q21	2006-02-10				ENSG00000108433			4431	protein-coding gene	gene with protein product		604027				9349823, 10198168	Standard	XM_005257843		Approved	GS27, Bos1	uc002ikz.3	O14653		ENST00000393456.2:c.200G>A	17.37:g.45008570G>A	ENSP00000377101:p.Arg67Lys	Somatic	255	3		WXS	Illumina GAIIx	Phase_I	247	7	NM_001012511	0	0	2	2	0	D3DXJ5|D3DXJ6|Q8N4B8|Q96DA5|Q9BZZ4	Missense_Mutation	SNP	ENST00000393456.2	37	CCDS42355.1	713	0.32646520146520147	153	0.31097560975609756	89	0.24585635359116023	206	0.36013986013986016	265	0.3496042216358839	A	8.208	0.799785	0.16397	0.307308	0.333721	ENSG00000108433	ENST00000225567;ENST00000393456;ENST00000415811;ENST00000439730	T;T;T;T	0.50813	0.73;0.73;0.73;1.77	5.87	4.78	0.61160	.	0.000000	0.85682	N	0.000000	T	0.00012	0.0000	N	0.01048	-1.04	0.44890	P	0.002098999999999962	B;B;B;B	0.06786	0.0;0.0;0.0;0.001	B;B;B;B	0.06405	0.001;0.0;0.001;0.002	T	0.39143	-0.9628	9	0.02654	T	1	-13.8903	9.229	0.37425	0.8122:0.1241:0.0637:0.0	rs197922;rs1132307;rs1801967;rs3178147;rs3192968;rs3815347;rs11539860;rs52811068;rs59215988;rs197922	67;67;67;67	E7EQ34;O14653;O14653-2;Q8N4B8	.;GOSR2_HUMAN;.;.	K	67	ENSP00000225567:R67K;ENSP00000377101:R67K;ENSP00000394559:R67K;ENSP00000390577:R67K	ENSP00000225567:R67K	R	+	2	0	GOSR2	42363569	1.000000	0.71417	1.000000	0.80357	0.867000	0.49689	3.772000	0.55325	0.548000	0.28955	-0.254000	0.11334	AGA	G|0.674;A|0.326		0.478	GOSR2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000440438.1		
GPR142	350383	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	72368576	72368576	+	Missense_Mutation	SNP	C	C	G			TCGA-OR-A5KY-01A-11D-A29I-10	TCGA-OR-A5KY-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	72f9e1d9-c852-423a-94ff-17f763fa2713	f6e93da3-9ee7-4a65-bc04-30f8bb730eef	g.chr17:72368576C>G	ENST00000335666.4	+	4	1274	c.1226C>G	c.(1225-1227)gCc>gGc	p.A409G		NM_181790.1	NP_861455.1	Q7Z601	GP142_HUMAN	G protein-coupled receptor 142	409						cell junction (GO:0030054)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			central_nervous_system(1)|endometrium(3)|large_intestine(3)|lung(21)|ovary(2)|prostate(1)|skin(4)	35						CACACGGCAGCCAACTTCGGC	0.597																																					p.A409G		.											.	GPR142-93	0			c.C1226G						.						95.0	80.0	85.0					17																	72368576		2203	4300	6503	SO:0001583	missense	350383	exon4			CGGCAGCCAACTT	AY255622	CCDS11698.1	17q25.2	2012-08-21				ENSG00000257008		"""GPCR / Class A : Orphans"""	20088	protein-coding gene	gene with protein product		609046				14623098	Standard	NM_181790		Approved	PGR2	uc010wqy.2	Q7Z601		ENST00000335666.4:c.1226C>G	17.37:g.72368576C>G	ENSP00000335158:p.Ala409Gly	Somatic	99	0		WXS	Illumina GAIIx	Phase_I	137	35	NM_181790	0	0	0	0	0	A4CYJ8|Q86SL3	Missense_Mutation	SNP	ENST00000335666.4	37	CCDS11698.1	.	.	.	.	.	.	.	.	.	.	C	9.976	1.226885	0.22542	.	.	ENSG00000257008	ENST00000335666	T	0.38240	1.15	4.55	3.46	0.39613	GPCR, rhodopsin-like superfamily (1);	0.293110	0.32970	N	0.005432	T	0.27524	0.0676	N	0.08118	0	0.23978	N	0.996285	B;D	0.53885	0.151;0.963	B;P	0.51453	0.148;0.67	T	0.08764	-1.0706	10	0.87932	D	0	-22.1444	10.266	0.43455	0.0:0.0812:0.0:0.9188	.	409;1371	Q7Z601;Q8NGB0	GP142_HUMAN;.	G	409	ENSP00000335158:A409G	ENSP00000335158:A409G	A	+	2	0	GPR142	69880171	1.000000	0.71417	0.855000	0.33649	0.021000	0.10359	5.920000	0.70017	0.869000	0.35703	-0.358000	0.07595	GCC	.		0.597	GPR142-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000442545.1	NM_181790	
RNF213	57674	bcgsc.ca	37	17	78346830	78346830	+	Silent	SNP	G	G	A	rs116948489	byFrequency	TCGA-OR-A5KY-01A-11D-A29I-10	TCGA-OR-A5KY-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	72f9e1d9-c852-423a-94ff-17f763fa2713	f6e93da3-9ee7-4a65-bc04-30f8bb730eef	g.chr17:78346830G>A	ENST00000582970.1	+	49	12950	c.12807G>A	c.(12805-12807)cgG>cgA	p.R4269R	RNF213_ENST00000336301.6_Silent_p.R2342R|RNF213_ENST00000508628.2_Silent_p.R4318R|CTD-2047H16.4_ENST00000575034.1_RNA|CTD-2047H16.4_ENST00000572151.1_RNA	NM_001256071.1	NP_001243000.1	Q63HN8	RN213_HUMAN	ring finger protein 213	4269					ATP catabolic process (GO:0006200)|protein autoubiquitination (GO:0051865)|protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)|membrane (GO:0016020)	ATPase activity (GO:0016887)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(1)|breast(7)|central_nervous_system(1)|cervix(3)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(23)|lung(36)|ovary(11)|pancreas(2)|prostate(4)|skin(3)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	130	all_neural(118;0.0538)		BRCA - Breast invasive adenocarcinoma(99;0.0252)|OV - Ovarian serous cystadenocarcinoma(97;0.057)			TCTGTATCCGGGTGGAGAACG	0.632													G|||	191	0.038139	0.0227	0.0288	5008	,	,		11937	0.0278		0.0656	False		,,,				2504	0.0481				p.R4269R		.											.	RNF213-577	0			c.G12807A						.	G		110,4296	84.4+/-122.9	1,108,2094	80.0	77.0	78.0		12954	-11.0	0.0	17	dbSNP_132	78	480,8120	139.2+/-195.9	16,448,3836	no	coding-synonymous	RNF213	NM_020914.4		17,556,5930	AA,AG,GG		5.5814,2.4966,4.5364		4318/5257	78346830	590,12416	2203	4300	6503	SO:0001819	synonymous_variant	57674	exon49			TATCCGGGTGGAG	AK074030	CCDS58606.1	17q25.3	2013-01-09	2007-02-08	2007-02-08		ENSG00000173821		"""RING-type (C3HC4) zinc fingers"""	14539	protein-coding gene	gene with protein product		613768	"""chromosome 17 open reading frame 27"", ""KIAA1618"", ""moyamoya disease 2"", ""Moyamoya disease 2"""	C17orf27, KIAA1618, MYMY2		10997877, 21048783, 21799892	Standard	NM_020954		Approved	KIAA1554, NET57	uc021uen.2	Q63HN8		ENST00000582970.1:c.12807G>A	17.37:g.78346830G>A		Somatic	142	1		WXS	Illumina GAIIx	Phase_I	133	6	NM_001256071	0	0	5	5	0	C9JCP4|D6RI12|F8WKS1|Q658P6|Q69YK7|Q6MZR1|Q8IWF4|Q8IZX1|Q8IZX2|Q8N406|Q8TEU0|Q9H6C9|Q9H6H9|Q9H6P3|Q9H8A9|Q9HCF4|Q9HCL8	Silent	SNP	ENST00000582970.1	37	CCDS58606.1																																																																																			G|0.958;A|0.042		0.632	RNF213-020	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000443298.1	NM_020914	
RAX	30062	hgsc.bcm.edu	37	18	56936395	56936395	+	Silent	SNP	T	T	C	rs7226481	byFrequency	TCGA-OR-A5KY-01A-11D-A29I-10	TCGA-OR-A5KY-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	72f9e1d9-c852-423a-94ff-17f763fa2713	f6e93da3-9ee7-4a65-bc04-30f8bb730eef	g.chr18:56936395T>C	ENST00000334889.3	-	3	1068	c.882A>G	c.(880-882)caA>caG	p.Q294Q	RAX_ENST00000256852.7_3'UTR	NM_013435.2	NP_038463.2	Q9Y2V3	RX_HUMAN	retina and anterior neural fold homeobox	294					camera-type eye development (GO:0043010)|hypothalamus development (GO:0021854)|limb development (GO:0060173)|pattern specification process (GO:0007389)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|visual perception (GO:0007601)	nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(2)|prostate(1)	6		Lung NSC(161;0.0804)|Colorectal(73;0.0946)		STAD - Stomach adenocarcinoma(84;0.18)		GCGCGAGAGGTTGCAGGCCGG	0.771													C|||	1143	0.228235	0.2421	0.1671	5008	,	,		8659	0.129		0.3032	False		,,,				2504	0.2781				p.Q294Q	GBM(150;770 1898 17679 24325 37807)	.											.	RAX-90	0			c.A882G						.	C		688,3078		75,538,1270	4.0	6.0	5.0		882	2.2	0.3	18	dbSNP_116	5	1688,5834		233,1222,2306	no	coding-synonymous	RAX	NM_013435.2		308,1760,3576	CC,CT,TT		22.4408,18.2687,21.0489		294/347	56936395	2376,8912	1883	3761	5644	SO:0001819	synonymous_variant	30062	exon3			GAGAGGTTGCAGG	AF115392	CCDS11972.1	18q21.31	2011-06-20			ENSG00000134438	ENSG00000134438		"""Homeoboxes / PRD class"""	18662	protein-coding gene	gene with protein product		601881				10625658, 10766016, 14662654	Standard	NM_013435		Approved	RX	uc002lhx.3	Q9Y2V3	OTTHUMG00000132757	ENST00000334889.3:c.882A>G	18.37:g.56936395T>C		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	24	19	NM_013435	0	0	0	0	0	Q86V11	Silent	SNP	ENST00000334889.3	37	CCDS11972.1																																																																																			T|0.767;C|0.233		0.771	RAX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256128.2		
NETO1	81832	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	18	70417313	70417313	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5KY-01A-11D-A29I-10	TCGA-OR-A5KY-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	72f9e1d9-c852-423a-94ff-17f763fa2713	f6e93da3-9ee7-4a65-bc04-30f8bb730eef	g.chr18:70417313C>T	ENST00000327305.6	-	9	2182	c.1525G>A	c.(1525-1527)Gat>Aat	p.D509N	NETO1_ENST00000299430.2_Missense_Mutation_p.D508N|RNA5SP460_ENST00000516789.1_RNA|NETO1_ENST00000583169.1_Missense_Mutation_p.D509N	NM_138966.3	NP_620416	Q8TDF5	NETO1_HUMAN	neuropilin (NRP) and tolloid (TLL)-like 1	509					memory (GO:0007613)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|receptor localization to synapse (GO:0097120)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|visual learning (GO:0008542)	cell junction (GO:0030054)|excitatory synapse (GO:0060076)|extracellular region (GO:0005576)|kainate selective glutamate receptor complex (GO:0032983)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)		p.D509N(1)		NS(3)|breast(2)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(7)|lung(36)|ovary(2)|prostate(3)|skin(3)|stomach(1)	63		Esophageal squamous(42;0.129)		READ - Rectum adenocarcinoma(1;0.0487)		ACGGCTTTATCGTGTCTGGAC	0.438																																					p.D509N		.											.	NETO1-94	1	Substitution - Missense(1)	lung(1)	c.G1525A						.						92.0	80.0	84.0					18																	70417313		2203	4300	6503	SO:0001583	missense	81832	exon9			CTTTATCGTGTCT	AF448838	CCDS12000.1, CCDS42444.1	18q22.2	2008-08-01			ENSG00000166342	ENSG00000166342			13823	protein-coding gene	gene with protein product		607973				11943477, 12810072	Standard	NM_138999		Approved	BTCL1, BCTL1	uc002lkw.3	Q8TDF5	OTTHUMG00000132834	ENST00000327305.6:c.1525G>A	18.37:g.70417313C>T	ENSP00000313088:p.Asp509Asn	Somatic	48	0		WXS	Illumina GAIIx	Phase_I	46	17	NM_001201465	0	0	0	0	0	Q86W85|Q8ND78|Q8TDF4	Missense_Mutation	SNP	ENST00000327305.6	37	CCDS12000.1	.	.	.	.	.	.	.	.	.	.	C	20.6	4.016065	0.75161	.	.	ENSG00000166342	ENST00000327305;ENST00000299430	T;T	0.25912	1.77;1.77	5.76	5.76	0.90799	.	0.502361	0.18910	N	0.127797	T	0.19446	0.0467	N	0.19112	0.55	0.80722	D	1	B;P	0.35551	0.33;0.509	B;B	0.26969	0.039;0.075	T	0.07083	-1.0791	10	0.87932	D	0	-32.086	19.973	0.97292	0.0:1.0:0.0:0.0	.	508;509	Q8TDF5-2;Q8TDF5	.;NETO1_HUMAN	N	509;508	ENSP00000313088:D509N;ENSP00000299430:D508N	ENSP00000299430:D508N	D	-	1	0	NETO1	68568293	1.000000	0.71417	0.998000	0.56505	0.966000	0.64601	7.452000	0.80683	2.725000	0.93324	0.460000	0.39030	GAT	.		0.438	NETO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256301.2	NM_138999	
ZNF516	9658	bcgsc.ca	37	18	74090864	74090864	+	Missense_Mutation	SNP	A	A	G	rs140499406	byFrequency	TCGA-OR-A5KY-01A-11D-A29I-10	TCGA-OR-A5KY-10A-01D-A29L-10	A	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	72f9e1d9-c852-423a-94ff-17f763fa2713	f6e93da3-9ee7-4a65-bc04-30f8bb730eef	g.chr18:74090864A>G	ENST00000443185.2	-	5	3522	c.3205T>C	c.(3205-3207)Ttt>Ctt	p.F1069L	RP11-504I13.3_ENST00000583287.1_RNA|ZNF516_ENST00000524431.2_5'UTR	NM_014643.3	NP_055458.1	Q92618	ZN516_HUMAN	zinc finger protein 516	1069					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			central_nervous_system(2)|endometrium(3)|kidney(2)|large_intestine(7)|lung(11)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	32		Prostate(75;0.0869)|Esophageal squamous(42;0.129)		OV - Ovarian serous cystadenocarcinoma(15;7.64e-06)|BRCA - Breast invasive adenocarcinoma(31;0.238)		AGGGTCGCAAAGTCCTTTGGA	0.602													A|||	14	0.00279553	0.0015	0.0043	5008	,	,		17438	0.0		0.008	False		,,,				2504	0.001				p.F1069L		.											.	ZNF516-69	0			c.T3205C						.	A	LEU/PHE	5,4081		0,5,2038	41.0	48.0	46.0		3206	-0.6	1.0	18	dbSNP_134	46	77,8287		2,73,4107	yes	missense	ZNF516	NM_014643.3	22	2,78,6145	GG,GA,AA		0.9206,0.1224,0.6586	benign	1069/1164	74090864	82,12368	2043	4182	6225	SO:0001583	missense	9658	exon5			TCGCAAAGTCCTT	D86975	CCDS74234.1	18q23	2013-01-08				ENSG00000101493		"""Zinc fingers, C2H2-type"""	28990	protein-coding gene	gene with protein product		615114				9039502	Standard	NM_014643		Approved	HsT287, KIAA0222	uc021ulp.1	Q92618		ENST00000443185.2:c.3205T>C	18.37:g.74090864A>G	ENSP00000394757:p.Phe1069Leu	Somatic	86	0		WXS	Illumina GAIIx	Phase_I	94	5	NM_014643	0	0	2	2	0		Missense_Mutation	SNP	ENST00000443185.2	37		7|7	0.003205128205128205|0.003205128205128205	0|0	0.0|0.0	2|2	0.0055248618784530384|0.0055248618784530384	0|0	0.0|0.0	5|5	0.006596306068601583|0.006596306068601583	a|a	3.367|3.367	-0.129188|-0.129188	0.06753|0.06753	0.001224|0.001224	0.009206|0.009206	ENSG00000101493|ENSG00000101493	ENST00000443185|ENST00000542818	T|.	0.05786|.	3.39|.	3.8|3.8	-0.563|-0.563	0.11778|0.11778	.|.	0.482470|.	0.19919|.	N|.	0.103134|.	T|T	0.14614|0.14614	0.0353|0.0353	N|N	0.08118|0.08118	0|0	0.31674|0.31674	N|N	0.643972|0.643972	B|.	0.02656|.	0.0|.	B|.	0.01281|.	0.0|.	T|T	0.34750|0.34750	-0.9816|-0.9816	10|5	0.02654|.	T|.	1|.	-0.2046|-0.2046	7.7942|7.7942	0.29138|0.29138	0.34:0.0:0.66:0.0|0.34:0.0:0.66:0.0	.|.	1069|.	Q92618|.	ZN516_HUMAN|.	L|P	1069|2	ENSP00000394757:F1069L|.	ENSP00000394757:F1069L|.	F|L	-|-	1|2	0|0	ZNF516|ZNF516	72219852|72219852	1.000000|1.000000	0.71417|0.71417	0.961000|0.961000	0.40146|0.40146	0.841000|0.841000	0.47740|0.47740	3.490000|3.490000	0.53245|0.53245	-0.197000|-0.197000	0.10350|0.10350	0.478000|0.478000	0.44815|0.44815	TTT|CTT	A|0.994;G|0.006		0.602	ZNF516-201	KNOWN	basic|appris_principal|exp_conf	protein_coding	protein_coding		NM_014643	
SALL3	27164	hgsc.bcm.edu	37	18	76753768	76753768	+	Missense_Mutation	SNP	C	C	G	rs2447437	byFrequency	TCGA-OR-A5KY-01A-11D-A29I-10	TCGA-OR-A5KY-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	72f9e1d9-c852-423a-94ff-17f763fa2713	f6e93da3-9ee7-4a65-bc04-30f8bb730eef	g.chr18:76753768C>G	ENST00000537592.2	+	2	1777	c.1777C>G	c.(1777-1779)Ctc>Gtc	p.L593V	SALL3_ENST00000575389.2_Missense_Mutation_p.L593V|SALL3_ENST00000536229.3_Missense_Mutation_p.L460V	NM_171999.3	NP_741996.2	Q9BXA9	SALL3_HUMAN	spalt-like transcription factor 3	593			L -> V (in dbSNP:rs2447437). {ECO:0000269|Ref.1}.		forelimb morphogenesis (GO:0035136)|hindlimb morphogenesis (GO:0035137)|negative regulation of smoothened signaling pathway (GO:0045879)|olfactory bulb interneuron development (GO:0021891)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.L593V(1)		NS(2)|breast(1)|central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(8)|lung(40)|ovary(4)|prostate(5)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	74		Esophageal squamous(42;0.129)|Melanoma(33;0.16)|Prostate(75;0.167)		OV - Ovarian serous cystadenocarcinoma(15;4.69e-06)|BRCA - Breast invasive adenocarcinoma(31;0.0256)		CGGGCCGCCCCTCACTAAAGC	0.731													C|||	3973	0.793331	0.5825	0.8444	5008	,	,		9900	0.9226		0.8648	False		,,,				2504	0.8354				p.L593V		.											.	SALL3-155	1	Substitution - Missense(1)	prostate(1)	c.C1777G						.	C	VAL/LEU	2422,1000		875,672,164	3.0	4.0	4.0		1777	5.2	0.2	18	dbSNP_100	4	6372,926		2808,756,85	yes	missense	SALL3	NM_171999.2	32	3683,1428,249	GG,GC,CC		12.6884,29.2227,17.9664	benign	593/1301	76753768	8794,1926	1711	3649	5360	SO:0001583	missense	27164	exon2			CCGCCCCTCACTA	AJ007421	CCDS12013.1	18q23	2013-10-17	2013-10-17		ENSG00000256463	ENSG00000256463		"""Zinc fingers, C2H2-type"""	10527	protein-coding gene	gene with protein product		605079	"""sal (Drosophila)-like 3"", ""sal-like 3 (Drosophila)"""			10610715	Standard	NM_171999		Approved	ZNF796	uc002lmt.3	Q9BXA9	OTTHUMG00000132896	ENST00000537592.2:c.1777C>G	18.37:g.76753768C>G	ENSP00000441823:p.Leu593Val	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	6	6	NM_171999	0	0	0	0	0	Q9UGH1	Missense_Mutation	SNP	ENST00000537592.2	37	CCDS12013.1	1724	0.7893772893772893	287	0.5833333333333334	299	0.8259668508287292	511	0.8933566433566433	627	0.8271767810026385	C	0.073	-1.197989	0.01594	0.707773	0.873116	ENSG00000256463	ENST00000537592;ENST00000536229;ENST00000543056	T	0.08984	3.03	5.2	5.2	0.72013	.	0.464067	0.17974	N	0.155779	T	0.00012	0.0000	L	0.35288	1.05	0.80722	P	0.0	B;B	0.15473	0.013;0.006	B;B	0.18561	0.022;0.002	T	0.36237	-0.9756	9	0.14656	T	0.56	-21.7235	10.231	0.43256	0.2471:0.6277:0.1252:0.0	rs2447437	325;593	F5GXY4;Q9BXA9	.;SALL3_HUMAN	V	593;593;325	ENSP00000441823:L593V	ENSP00000299466:L593V	L	+	1	0	SALL3	74854756	0.002000	0.14202	0.157000	0.22605	0.006000	0.05464	0.292000	0.19011	2.584000	0.87258	0.563000	0.77884	CTC	C|0.780;G|0.220		0.731	SALL3-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256397.1	NM_171999	
ARID3A	1820	hgsc.bcm.edu	37	19	929678	929678	+	Silent	SNP	G	G	A	rs3826948	byFrequency	TCGA-OR-A5KY-01A-11D-A29I-10	TCGA-OR-A5KY-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	72f9e1d9-c852-423a-94ff-17f763fa2713	f6e93da3-9ee7-4a65-bc04-30f8bb730eef	g.chr19:929678G>A	ENST00000263620.3	+	2	477	c.150G>A	c.(148-150)gaG>gaA	p.E50E	AC005391.2_ENST00000585647.1_RNA	NM_005224.2	NP_005215.1	Q99856	ARI3A_HUMAN	AT rich interactive domain 3A (BRIGHT-like)	50						cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|membrane raft (GO:0045121)|nucleolus (GO:0005730)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(2)|ovary(1)	10		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;1.04e-05)|all_lung(49;1.53e-05)|Breast(49;9.42e-05)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		GAGAGCCCGAGAGTGCCCGGA	0.766													g|||	2308	0.460863	0.1112	0.487	5008	,	,		7932	0.6756		0.6223	False		,,,				2504	0.5276				p.E50E	Pancreas(29;54 1022 32760 50921)	.											.	ARID3A-90	0			c.G150A						.	G		470,2552		61,348,1102	3.0	4.0	3.0		150	1.1	0.4	19	dbSNP_107	3	3721,3153		1076,1569,792	no	coding-synonymous	ARID3A	NM_005224.2		1137,1917,1894	AA,AG,GG		45.8685,15.5526,42.3504		50/594	929678	4191,5705	1511	3437	4948	SO:0001819	synonymous_variant	1820	exon2			GCCCGAGAGTGCC	U88047	CCDS12050.1	19p13.3	2013-02-07	2006-11-08	2004-01-30		ENSG00000116017		"""-"""	3031	protein-coding gene	gene with protein product		603265	"""dead ringer-like 1 (Drosophila)"", ""AT rich interactive domain 3A (BRIGHT- like)"""	DRIL1		9722953	Standard	NM_005224		Approved	BRIGHT	uc002lql.3	Q99856		ENST00000263620.3:c.150G>A	19.37:g.929678G>A		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	4	4	NM_005224	0	0	0	0	0	Q5I858|Q6P9C6|Q8IZA7|Q8N4Z3	Silent	SNP	ENST00000263620.3	37	CCDS12050.1																																																																																			T|0.495;C|0.504		0.766	ARID3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458219.1	NM_005224	
ARID3A	1820	hgsc.bcm.edu	37	19	929753	929753	+	Silent	SNP	A	A	G	rs1799595	byFrequency	TCGA-OR-A5KY-01A-11D-A29I-10	TCGA-OR-A5KY-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	72f9e1d9-c852-423a-94ff-17f763fa2713	f6e93da3-9ee7-4a65-bc04-30f8bb730eef	g.chr19:929753A>G	ENST00000263620.3	+	2	552	c.225A>G	c.(223-225)ccA>ccG	p.P75P	AC005391.2_ENST00000585647.1_RNA	NM_005224.2	NP_005215.1	Q99856	ARI3A_HUMAN	AT rich interactive domain 3A (BRIGHT-like)	75						cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|membrane raft (GO:0045121)|nucleolus (GO:0005730)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(2)|ovary(1)	10		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;1.04e-05)|all_lung(49;1.53e-05)|Breast(49;9.42e-05)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		TGGGACACCCAGCCAGCCCCG	0.751													t|||	4428	0.884185	0.9062	0.804	5008	,	,		8534	0.998		0.836	False		,,,				2504	0.8436				p.P75P	Pancreas(29;54 1022 32760 50921)	.											.	ARID3A-90	0			c.A225G						.	G		3389,305		1555,279,13	4.0	5.0	5.0		225	-6.8	0.0	19	dbSNP_89	5	6619,1123		2834,951,86	no	coding-synonymous	ARID3A	NM_005224.2		4389,1230,99	GG,GA,AA		14.5053,8.2566,12.4869		75/594	929753	10008,1428	1847	3871	5718	SO:0001819	synonymous_variant	1820	exon2			ACACCCAGCCAGC	U88047	CCDS12050.1	19p13.3	2013-02-07	2006-11-08	2004-01-30		ENSG00000116017		"""-"""	3031	protein-coding gene	gene with protein product		603265	"""dead ringer-like 1 (Drosophila)"", ""AT rich interactive domain 3A (BRIGHT- like)"""	DRIL1		9722953	Standard	NM_005224		Approved	BRIGHT	uc002lql.3	Q99856		ENST00000263620.3:c.225A>G	19.37:g.929753A>G		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	11	11	NM_005224	0	0	0	1	1	Q5I858|Q6P9C6|Q8IZA7|Q8N4Z3	Silent	SNP	ENST00000263620.3	37	CCDS12050.1																																																																																			A|0.114;G|0.886		0.751	ARID3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458219.1	NM_005224	
TCF3	6929	hgsc.bcm.edu	37	19	1619333	1619333	+	Silent	SNP	G	G	A	rs1140828	byFrequency	TCGA-OR-A5KY-01A-11D-A29I-10	TCGA-OR-A5KY-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	72f9e1d9-c852-423a-94ff-17f763fa2713	f6e93da3-9ee7-4a65-bc04-30f8bb730eef	g.chr19:1619333G>A	ENST00000262965.5	-	15	1652	c.1308C>T	c.(1306-1308)ggC>ggT	p.G436G	RNU6-1223P_ENST00000517124.1_RNA|TCF3_ENST00000395423.3_Silent_p.G385G|TCF3_ENST00000588136.1_Silent_p.G436G|TCF3_ENST00000344749.5_Silent_p.G436G|TCF3_ENST00000453954.2_Silent_p.G352G	NM_003200.3	NP_003191.1	Q9HCS4	TF7L1_HUMAN	transcription factor 3	0					anterior/posterior axis specification, embryo (GO:0008595)|axial mesoderm morphogenesis (GO:0048319)|brain development (GO:0007420)|canonical Wnt signaling pathway (GO:0060070)|chromatin organization (GO:0006325)|generation of neurons (GO:0048699)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription from RNA polymerase II promoter during mitosis (GO:0046022)|regulation of stem cell maintenance (GO:2000036)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)|regulation of Wnt signaling pathway (GO:0030111)|skin development (GO:0043588)|somatic stem cell maintenance (GO:0035019)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			breast(2)|central_nervous_system(1)|kidney(2)|large_intestine(2)|lung(6)|ovary(1)|skin(2)	16		Acute lymphoblastic leukemia(61;5.94e-12)|all_hematologic(61;1.27e-07)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		CGTGCCGCCCGCCCAGTGACA	0.746			T	"""PBX1, HLF, TFPT"""	pre B-ALL								G|||	1179	0.235423	0.1702	0.2435	5008	,	,		13595	0.2897		0.3032	False		,,,				2504	0.1922				p.G436G		.		Dom	yes		19	19p13.3	6929	transcription factor 3 (E2A immunoglobulin enhancer binding factors E12/E47)		L	.	TCF3-721	0			c.C1308T						.	G	,	770,3572		79,612,1480	11.0	14.0	13.0		1308,1308	-3.3	0.4	19	dbSNP_86	13	2644,5770		436,1772,1999	no	coding-synonymous,coding-synonymous	TCF3	NM_001136139.2,NM_003200.3	,	515,2384,3479	AA,AG,GG		31.4238,17.7338,26.7639	,	436/652,436/655	1619333	3414,9342	2171	4207	6378	SO:0001819	synonymous_variant	6929	exon15			CCGCCCGCCCAGT	M65214	CCDS12074.1, CCDS45899.1	19p13.3	2014-02-13	2013-02-26		ENSG00000071564	ENSG00000071564		"""Basic helix-loop-helix proteins"""	11633	protein-coding gene	gene with protein product	"""transcription factor E2-alpha"", ""immunoglobulin transcription factor 1"", ""kappa-E2-binding factor"", ""E2A immunoglobulin enhancer-binding factor E12/E47"", ""VDR interacting repressor"""	147141				2308859, 1967983	Standard	NM_003200		Approved	E2A, ITF1, MGC129647, MGC129648, bHLHb21, VDIR, E47	uc002ltt.4	P15923	OTTHUMG00000180031	ENST00000262965.5:c.1308C>T	19.37:g.1619333G>A		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	15	4	NM_003200	0	0	26	26	0	Q53R97|Q6PD70|Q9NP00	Silent	SNP	ENST00000262965.5	37	CCDS12074.1																																																																																			G|0.749;A|0.251		0.746	TCF3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000449367.1	NM_003200	
TCF3	6929	hgsc.bcm.edu	37	19	1619339	1619339	+	Silent	SNP	T	T	C	rs8140	byFrequency	TCGA-OR-A5KY-01A-11D-A29I-10	TCGA-OR-A5KY-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	72f9e1d9-c852-423a-94ff-17f763fa2713	f6e93da3-9ee7-4a65-bc04-30f8bb730eef	g.chr19:1619339T>C	ENST00000262965.5	-	15	1646	c.1302A>G	c.(1300-1302)tcA>tcG	p.S434S	RNU6-1223P_ENST00000517124.1_RNA|TCF3_ENST00000395423.3_Silent_p.S383S|TCF3_ENST00000588136.1_Silent_p.S434S|TCF3_ENST00000344749.5_Silent_p.S434S|TCF3_ENST00000453954.2_Silent_p.S350S	NM_003200.3	NP_003191.1	Q9HCS4	TF7L1_HUMAN	transcription factor 3	0					anterior/posterior axis specification, embryo (GO:0008595)|axial mesoderm morphogenesis (GO:0048319)|brain development (GO:0007420)|canonical Wnt signaling pathway (GO:0060070)|chromatin organization (GO:0006325)|generation of neurons (GO:0048699)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription from RNA polymerase II promoter during mitosis (GO:0046022)|regulation of stem cell maintenance (GO:2000036)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)|regulation of Wnt signaling pathway (GO:0030111)|skin development (GO:0043588)|somatic stem cell maintenance (GO:0035019)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			breast(2)|central_nervous_system(1)|kidney(2)|large_intestine(2)|lung(6)|ovary(1)|skin(2)	16		Acute lymphoblastic leukemia(61;5.94e-12)|all_hematologic(61;1.27e-07)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		GCCCGCCCAGTGACATGGGGC	0.746			T	"""PBX1, HLF, TFPT"""	pre B-ALL								C|||	3124	0.623802	0.7723	0.5187	5008	,	,		13680	0.8839		0.3658	False		,,,				2504	0.4949				p.S434S		.		Dom	yes		19	19p13.3	6929	transcription factor 3 (E2A immunoglobulin enhancer binding factors E12/E47)		L	.	TCF3-721	0			c.A1302G						.	C	,	3016,1346		1071,874,236	11.0	14.0	13.0		1302,1302	-7.1	0.0	19	dbSNP_52	13	3268,5190		653,1962,1614	no	coding-synonymous,coding-synonymous	TCF3	NM_001136139.2,NM_003200.3	,	1724,2836,1850	CC,CT,TT		38.638,30.8574,49.0172	,	434/652,434/655	1619339	6284,6536	2181	4229	6410	SO:0001819	synonymous_variant	6929	exon15			GCCCAGTGACATG	M65214	CCDS12074.1, CCDS45899.1	19p13.3	2014-02-13	2013-02-26		ENSG00000071564	ENSG00000071564		"""Basic helix-loop-helix proteins"""	11633	protein-coding gene	gene with protein product	"""transcription factor E2-alpha"", ""immunoglobulin transcription factor 1"", ""kappa-E2-binding factor"", ""E2A immunoglobulin enhancer-binding factor E12/E47"", ""VDR interacting repressor"""	147141				2308859, 1967983	Standard	NM_003200		Approved	E2A, ITF1, MGC129647, MGC129648, bHLHb21, VDIR, E47	uc002ltt.4	P15923	OTTHUMG00000180031	ENST00000262965.5:c.1302A>G	19.37:g.1619339T>C		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	16	4	NM_003200	0	0	25	25	0	Q53R97|Q6PD70|Q9NP00	Silent	SNP	ENST00000262965.5	37	CCDS12074.1																																																																																			T|0.403;C|0.597		0.746	TCF3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000449367.1	NM_003200	
ADAT3	113179	hgsc.bcm.edu	37	19	1912817	1912817	+	Silent	SNP	C	C	T	rs35870594	byFrequency	TCGA-OR-A5KY-01A-11D-A29I-10	TCGA-OR-A5KY-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	72f9e1d9-c852-423a-94ff-17f763fa2713	f6e93da3-9ee7-4a65-bc04-30f8bb730eef	g.chr19:1912817C>T	ENST00000602400.1	+	2	951	c.723C>T	c.(721-723)taC>taT	p.Y241Y	SCAMP4_ENST00000414057.2_Intron|ADAT3_ENST00000329478.2_Silent_p.Y257Y|SCAMP4_ENST00000316097.8_Intron|SCAMP4_ENST00000409472.1_Intron			Q96EY9	ADAT3_HUMAN	adenosine deaminase, tRNA-specific 3	241					tRNA processing (GO:0008033)		hydrolase activity (GO:0016787)|zinc ion binding (GO:0008270)			breast(1)|kidney(3)|pancreas(1)|skin(2)	7		Ovarian(11;2.11e-07)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		GCGGCACCTACGACTTCAGAC	0.741													C|||	483	0.0964457	0.0968	0.1527	5008	,	,		9567	0.122		0.0636	False		,,,				2504	0.0634				p.Y257Y		.											.	ADAT3-154	0			c.C771T						.	C	,	245,3961		8,229,1866	7.0	9.0	8.0		,723	-9.6	0.0	19	dbSNP_126	8	305,7811		7,291,3760	no	intron,coding-synonymous	SCAMP4,ADAT3	NM_079834.2,NM_138422.1	,	15,520,5626	TT,TC,CC		3.758,5.825,4.4636	,	,241/352	1912817	550,11772	2103	4058	6161	SO:0001819	synonymous_variant	113179	exon2			CACCTACGACTTC	BC011824	CCDS12076.1, CCDS12076.2	19p13.3	2011-05-19	2011-05-19		ENSG00000213638	ENSG00000213638			25151	protein-coding gene	gene with protein product	"""tRNA-specific adenosine deaminase 3 homolog (S. cerevisiae)"""	615302	"""adenosine deaminase, tRNA-specific 3, TAD3 homolog (S. cerevisiae)"""			12457566	Standard	NM_138422		Approved	TAD3	uc002luh.4	Q96EY9	OTTHUMG00000154591	ENST00000602400.1:c.723C>T	19.37:g.1912817C>T		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	17	7	NM_138422	0	0	2	2	0		Silent	SNP	ENST00000602400.1	37																																																																																				C|0.899;T|0.101		0.741	ADAT3-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_138422	
ZNF555	148254	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	2853644	2853644	+	Silent	SNP	G	G	C			TCGA-OR-A5KY-01A-11D-A29I-10	TCGA-OR-A5KY-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	72f9e1d9-c852-423a-94ff-17f763fa2713	f6e93da3-9ee7-4a65-bc04-30f8bb730eef	g.chr19:2853644G>C	ENST00000334241.4	+	4	1719	c.1581G>C	c.(1579-1581)gtG>gtC	p.V527V	ZNF555_ENST00000591539.1_Silent_p.V526V|AC006130.3_ENST00000589365.1_RNA	NM_001172775.1|NM_152791.4	NP_001166246.1|NP_690004.4	Q8NEP9	ZN555_HUMAN	zinc finger protein 555	527					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(2)|kidney(2)|large_intestine(6)|lung(3)|ovary(1)|prostate(1)|skin(3)|urinary_tract(4)	23				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		AACAACATGTGAGAACGCACA	0.423																																					p.V527V		.											.	ZNF555-91	0			c.G1581C						.						125.0	109.0	115.0					19																	2853644		2203	4300	6503	SO:0001819	synonymous_variant	148254	exon4			ACATGTGAGAACG	AL832140	CCDS12096.1, CCDS59329.1	19p13.3	2013-09-20			ENSG00000186300	ENSG00000186300		"""Zinc fingers, C2H2-type"", ""-"""	28382	protein-coding gene	gene with protein product						12477932	Standard	NM_152791		Approved	MGC26707	uc002lwo.3	Q8NEP9	OTTHUMG00000180500	ENST00000334241.4:c.1581G>C	19.37:g.2853644G>C		Somatic	110	0		WXS	Illumina GAIIx	Phase_I	156	40	NM_152791	0	0	0	1	1	A8KA89|K7EQM2|Q8NA46|Q96MP1	Silent	SNP	ENST00000334241.4	37	CCDS12096.1																																																																																			.		0.423	ZNF555-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000451637.3	NM_152791	
TBXA2R	6915	broad.mit.edu	37	19	3600465	3600465	+	Silent	SNP	A	A	C			TCGA-OR-A5KY-01A-11D-A29I-10	TCGA-OR-A5KY-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	72f9e1d9-c852-423a-94ff-17f763fa2713	f6e93da3-9ee7-4a65-bc04-30f8bb730eef	g.chr19:3600465A>C	ENST00000375190.4	-	2	561	c.168T>G	c.(166-168)ggT>ggG	p.G56G	TBXA2R_ENST00000589966.1_Silent_p.G56G|TBXA2R_ENST00000587717.1_5'Flank|TBXA2R_ENST00000411851.3_Silent_p.G56G	NM_001060.5|NM_201636.2	NP_001051.1|NP_963998.2	P21731	TA2R_HUMAN	thromboxane A2 receptor	56					blood coagulation (GO:0007596)|G-protein coupled receptor signaling pathway (GO:0007186)|inflammatory response (GO:0006954)|platelet activation (GO:0030168)|positive regulation of angiogenesis (GO:0045766)|positive regulation of blood pressure (GO:0045777)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of GTPase activity (GO:0043547)|positive regulation of smooth muscle contraction (GO:0045987)|positive regulation of vasoconstriction (GO:0045907)|response to drug (GO:0042493)|response to lipopolysaccharide (GO:0032496)|response to nutrient (GO:0007584)|second-messenger-mediated signaling (GO:0019932)|thromboxane A2 signaling pathway (GO:0038193)	acrosomal vesicle (GO:0001669)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	guanyl-nucleotide exchange factor activity (GO:0005085)|thromboxane A2 receptor activity (GO:0004961)			kidney(1)|lung(2)|ovary(1)|prostate(3)|upper_aerodigestive_tract(1)	8		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.00253)|STAD - Stomach adenocarcinoma(1328;0.18)	Ridogrel(DB01207)	GCGTGTGCGAACCCCCCTGCC	0.706																																					p.G56G		.											.	TBXA2R-90	0			c.T168G						.						28.0	43.0	38.0					19																	3600465		2153	4216	6369	SO:0001819	synonymous_variant	6915	exon2			GTGCGAACCCCCC		CCDS42467.1, CCDS54198.1	19p13.3	2014-09-17						"""GPCR / Class A : Prostanoid receptors"""	11608	protein-coding gene	gene with protein product		188070				1825698	Standard	NM_001060		Approved		uc021umv.1	P21731		ENST00000375190.4:c.168T>G	19.37:g.3600465A>C		Somatic	26	2		WXS	Illumina GAIIx	Phase_I	203	43	NM_201636	0	0	10	10	0	O75228|Q6DK52|Q9UCY1|Q9UCY2	Silent	SNP	ENST00000375190.4	37	CCDS42467.1																																																																																			.		0.706	TBXA2R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000453081.2		
KANK3	256949	hgsc.bcm.edu	37	19	8399628	8399628	+	Silent	SNP	A	A	G	rs710949	byFrequency	TCGA-OR-A5KY-01A-11D-A29I-10	TCGA-OR-A5KY-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	72f9e1d9-c852-423a-94ff-17f763fa2713	f6e93da3-9ee7-4a65-bc04-30f8bb730eef	g.chr19:8399628A>G	ENST00000593649.1	-	3	1148	c.1083T>C	c.(1081-1083)agT>agC	p.S361S	KANK3_ENST00000330915.3_Silent_p.S361S			Q6NY19	KANK3_HUMAN	KN motif and ankyrin repeat domains 3	361										breast(1)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(3)|skin(1)|urinary_tract(1)	9						GGTGCTCCAGACTGGCGCGCA	0.766													G|||	3017	0.602436	0.7443	0.6153	5008	,	,		10732	0.4147		0.5984	False		,,,				2504	0.5992				p.S361S		.											.	KANK3-90	0			c.T1083C						.	G		1917,541		783,351,95	1.0	1.0	1.0		1083	3.4	1.0	19	dbSNP_86	1	3649,1585		1364,921,332	no	coding-synonymous	KANK3	NM_198471.2		2147,1272,427	GG,GA,AA		30.2828,22.0098,27.6391		361/822	8399628	5566,2126	1229	2617	3846	SO:0001819	synonymous_variant	256949	exon3			CTCCAGACTGGCG	AK128815	CCDS12199.1	19p13.2	2013-01-10	2008-01-29	2008-01-29		ENSG00000186994		"""KN motif and ankyrin repeat domain containing"", ""Ankyrin repeat domain containing"""	24796	protein-coding gene	gene with protein product		614611	"""ankyrin repeat domain 47"""	ANKRD47		17996375, 19554261	Standard	NM_198471		Approved	FLJ46061	uc010dwa.3	Q6NY19		ENST00000593649.1:c.1083T>C	19.37:g.8399628A>G		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	16	12	NM_198471	0	0	1	1	0	Q6NZI1|Q6ZQR3|Q8IUV2	Silent	SNP	ENST00000593649.1	37																																																																																				A|0.411;G|0.589		0.766	KANK3-002	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000461379.1	NM_198471	
KANK3	256949	hgsc.bcm.edu	37	19	8399635	8399635	+	Missense_Mutation	SNP	C	C	T	rs890853	byFrequency	TCGA-OR-A5KY-01A-11D-A29I-10	TCGA-OR-A5KY-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	72f9e1d9-c852-423a-94ff-17f763fa2713	f6e93da3-9ee7-4a65-bc04-30f8bb730eef	g.chr19:8399635C>T	ENST00000593649.1	-	3	1141	c.1076G>A	c.(1075-1077)cGc>cAc	p.R359H	KANK3_ENST00000330915.3_Missense_Mutation_p.R359H			Q6NY19	KANK3_HUMAN	KN motif and ankyrin repeat domains 3	359			R -> H (in dbSNP:rs890853).							breast(1)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(3)|skin(1)|urinary_tract(1)	9						CAGACTGGCGCGCAGCAGCTC	0.761													C|||	962	0.192093	0.093	0.3847	5008	,	,		10548	0.2113		0.2545	False		,,,				2504	0.1053				p.R359H		.											.	KANK3-90	0			c.G1076A						.						1.0	1.0	1.0					19																	8399635		1163	2476	3639	SO:0001583	missense	256949	exon3			CTGGCGCGCAGCA	AK128815	CCDS12199.1	19p13.2	2013-01-10	2008-01-29	2008-01-29		ENSG00000186994		"""KN motif and ankyrin repeat domain containing"", ""Ankyrin repeat domain containing"""	24796	protein-coding gene	gene with protein product		614611	"""ankyrin repeat domain 47"""	ANKRD47		17996375, 19554261	Standard	NM_198471		Approved	FLJ46061	uc010dwa.3	Q6NY19		ENST00000593649.1:c.1076G>A	19.37:g.8399635C>T	ENSP00000470728:p.Arg359His	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	13	9	NM_198471	0	0	0	0	0	Q6NZI1|Q6ZQR3|Q8IUV2	Missense_Mutation	SNP	ENST00000593649.1	37		505	0.23122710622710624	63	0.12804878048780488	131	0.36187845303867405	117	0.20454545454545456	194	0.2559366754617414	C	13.09	2.134512	0.37630	.	.	ENSG00000186994	ENST00000330915	T	0.54071	0.59	4.52	0.959	0.19624	.	.	.	.	.	T	0.00012	0.0000	L	0.29908	0.895	0.53688	P	2.8999999999945736E-5	B	0.16396	0.017	B	0.09377	0.004	T	0.33394	-0.9870	8	0.54805	T	0.06	-23.4019	6.9118	0.24338	0.0:0.5682:0.0:0.4318	rs890853	359	Q6NY19-2	.	H	359	ENSP00000328923:R359H	ENSP00000328923:R359H	R	-	2	0	KANK3	8305635	0.014000	0.17966	0.688000	0.30117	0.060000	0.15804	0.173000	0.16724	0.468000	0.27243	0.297000	0.19635	CGC	C|0.769;T|0.231		0.761	KANK3-002	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000461379.1	NM_198471	
MUC16	94025	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	9058325	9058325	+	Missense_Mutation	SNP	G	G	T			TCGA-OR-A5KY-01A-11D-A29I-10	TCGA-OR-A5KY-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	72f9e1d9-c852-423a-94ff-17f763fa2713	f6e93da3-9ee7-4a65-bc04-30f8bb730eef	g.chr19:9058325G>T	ENST00000397910.4	-	3	29324	c.29121C>A	c.(29119-29121)agC>agA	p.S9707R		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	9709	Ser-rich.|Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						CAGGACCCCTGCTCATAAGAT	0.483																																					p.S9707R		.											.	MUC16-566	0			c.C29121A						.						86.0	80.0	82.0					19																	9058325		1924	4137	6061	SO:0001583	missense	94025	exon3			ACCCCTGCTCATA	AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.29121C>A	19.37:g.9058325G>T	ENSP00000381008:p.Ser9707Arg	Somatic	207	0		WXS	Illumina GAIIx	Phase_I	301	67	NM_024690	0	0	0	0	0	Q6ZQW5|Q96RK2	Missense_Mutation	SNP	ENST00000397910.4	37	CCDS54212.1	.	.	.	.	.	.	.	.	.	.	g	4.887	0.164907	0.09287	.	.	ENSG00000181143	ENST00000397910	T	0.30448	1.53	2.8	-0.541	0.11858	.	.	.	.	.	T	0.29749	0.0743	L	0.27053	0.805	.	.	.	D	0.57571	0.98	P	0.57152	0.814	T	0.37820	-0.9689	8	0.87932	D	0	.	5.1709	0.15110	0.4301:0.0:0.5699:0.0	.	9707	B5ME49	.	R	9707	ENSP00000381008:S9707R	ENSP00000381008:S9707R	S	-	3	2	MUC16	8919325	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	0.538000	0.23160	-0.024000	0.13941	-0.225000	0.12378	AGC	.		0.483	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402806.1	NM_024690	
ZSWIM4	65249	hgsc.bcm.edu	37	19	13941597	13941597	+	Silent	SNP	C	C	T	rs112676900	byFrequency	TCGA-OR-A5KY-01A-11D-A29I-10	TCGA-OR-A5KY-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	72f9e1d9-c852-423a-94ff-17f763fa2713	f6e93da3-9ee7-4a65-bc04-30f8bb730eef	g.chr19:13941597C>T	ENST00000254323.2	+	13	2892	c.2703C>T	c.(2701-2703)gcC>gcT	p.A901A	ZSWIM4_ENST00000440752.2_Silent_p.A735A	NM_023072.2	NP_075560.2	Q9H7M6	ZSWM4_HUMAN	zinc finger, SWIM-type containing 4	901							zinc ion binding (GO:0008270)			central_nervous_system(3)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(11)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	27			OV - Ovarian serous cystadenocarcinoma(19;2.94e-23)|Epithelial(5;4.58e-19)			CACGCCGGGCCGCCAAGCCAC	0.682													C|||	465	0.0928514	0.1142	0.0591	5008	,	,		10708	0.0645		0.0646	False		,,,				2504	0.1462				p.A901A		.											.	ZSWIM4-90	0			c.C2703T						.	C		409,3935		21,367,1784	17.0	22.0	20.0		2703	-8.7	0.0	19	dbSNP_132	20	513,7955		11,491,3732	no	coding-synonymous	ZSWIM4	NM_023072.2		32,858,5516	TT,TC,CC		6.0581,9.4153,7.1964		901/990	13941597	922,11890	2172	4234	6406	SO:0001819	synonymous_variant	65249	exon13			CCGGGCCGCCAAG	AK022283	CCDS32924.1	19p13.13	2012-02-23			ENSG00000132003	ENSG00000132003		"""Zinc fingers, SWIM-type"""	25704	protein-coding gene	gene with protein product							Standard	NM_023072		Approved	FLJ12221	uc002mxh.1	Q9H7M6		ENST00000254323.2:c.2703C>T	19.37:g.13941597C>T		Somatic	4	0		WXS	Illumina GAIIx	Phase_I	44	19	NM_023072	0	0	4	7	3		Silent	SNP	ENST00000254323.2	37	CCDS32924.1																																																																																			C|0.927;T|0.073		0.682	ZSWIM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000457457.1	XM_031342	
OCEL1	79629	hgsc.bcm.edu	37	19	17337555	17337555	+	Silent	SNP	C	C	A	rs3745163	byFrequency	TCGA-OR-A5KY-01A-11D-A29I-10	TCGA-OR-A5KY-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	72f9e1d9-c852-423a-94ff-17f763fa2713	f6e93da3-9ee7-4a65-bc04-30f8bb730eef	g.chr19:17337555C>A	ENST00000215061.4	+	2	167	c.123C>A	c.(121-123)acC>acA	p.T41T	OCEL1_ENST00000601529.1_Silent_p.T41T|OCEL1_ENST00000597836.1_5'UTR|OCEL1_ENST00000601576.1_3'UTR	NM_024578.1	NP_078854.1	Q9H607	OCEL1_HUMAN	occludin/ELL domain containing 1	41	Pro-rich.									central_nervous_system(2)|endometrium(2)|kidney(1)|lung(2)	7						CCCGCAGGACCCGCCCATCAG	0.746													C|||	1146	0.228834	0.1702	0.2522	5008	,	,		10081	0.4018		0.2018	False		,,,				2504	0.1411				p.T41T		.											.	OCEL1-68	0			c.C123A						.	C		573,3093		51,471,1311	4.0	6.0	5.0		123	-3.2	0.0	19	dbSNP_107	5	1379,6017		128,1123,2447	no	coding-synonymous	OCEL1	NM_024578.1		179,1594,3758	AA,AC,CC		18.6452,15.6301,17.646		41/265	17337555	1952,9110	1833	3698	5531	SO:0001819	synonymous_variant	79629	exon2			CAGGACCCGCCCA	BC029361	CCDS12351.1	19p13.11	2008-02-05				ENSG00000099330			26221	protein-coding gene	gene with protein product						12477932	Standard	NM_024578		Approved	FLJ22709	uc002nfp.3	Q9H607		ENST00000215061.4:c.123C>A	19.37:g.17337555C>A		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	20	8	NM_024578	0	0	13	29	16		Silent	SNP	ENST00000215061.4	37	CCDS12351.1																																																																																			C|0.734;A|0.266		0.746	OCEL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463307.1	NM_024578	
WDR87	83889	broad.mit.edu	37	19	38377392	38377409	+	In_Frame_Del	DEL	CCTCCTCCTCCTCCCTTA	CCTCCTCCTCCTCCCTTA	-	rs7252765|rs201328117		TCGA-OR-A5KY-01A-11D-A29I-10	TCGA-OR-A5KY-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	72f9e1d9-c852-423a-94ff-17f763fa2713	f6e93da3-9ee7-4a65-bc04-30f8bb730eef	g.chr19:38377392_38377409delCCTCCTCCTCCTCCCTTA	ENST00000303868.5	-	6	7009_7026	c.6785_6802delTAAGGGAGGAGGAGGAGG	c.(6784-6804)gtaagggaggaggaggaggaa>gaa	p.VREEEE2262del	WDR87_ENST00000447313.2_In_Frame_Del_p.VREEEE2301del	NM_031951.3	NP_114157.3	Q6ZQQ6	WDR87_HUMAN	WD repeat domain 87	2262	Glu-rich.									NS(4)|autonomic_ganglia(2)|breast(3)|central_nervous_system(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|lung(2)|prostate(1)|skin(3)|stomach(1)	36						tccttcctttcctcctcctcctcccttacctcctcctc	0.486																																					p.2262_2268del		.											.	.	0			c.6785_6802del						.			1388,1236		603,182,527						0.2	0.0		dbSNP_134	64	2355,3029		947,461,1284	no	coding	WDR87	NM_031951.3		1550,643,1811	A1A1,A1R,RR		43.7407,47.1037,46.7408				3743,4265				SO:0001651	inframe_deletion	83889	exon6			TCCTTTCCTCCTC	AK128826	CCDS46063.1, CCDS74356.1	19q13.13	2013-01-09			ENSG00000171804	ENSG00000171804		"""WD repeat domain containing"""	29934	protein-coding gene	gene with protein product							Standard	XM_005259304		Approved	NYD-SP11	uc010efu.2	Q6ZQQ6	OTTHUMG00000048187	ENST00000303868.5:c.6785_6802delTAAGGGAGGAGGAGGAGG	19.37:g.38377392_38377409delCCTCCTCCTCCTCCCTTA	ENSP00000368025:p.Val2262_Glu2267del	Somatic	36	0		WXS	Illumina GAIIx	Phase_I	61	30	NM_031951	0	0	0	0	0	Q9BWV9	In_Frame_Del	DEL	ENST00000303868.5	37	CCDS46063.1																																																																																			.		0.486	WDR87-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000314628.2	XM_940478	
RASGRP4	115727	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	19	38905653	38905653	+	Silent	SNP	G	G	C			TCGA-OR-A5KY-01A-11D-A29I-10	TCGA-OR-A5KY-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	72f9e1d9-c852-423a-94ff-17f763fa2713	f6e93da3-9ee7-4a65-bc04-30f8bb730eef	g.chr19:38905653G>C	ENST00000587738.1	-	9	1135	c.1065C>G	c.(1063-1065)ctC>ctG	p.L355L	RASGRP4_ENST00000426920.2_Intron|RASGRP4_ENST00000433821.2_Intron|RASGRP4_ENST00000293062.9_Silent_p.L258L|RASGRP4_ENST00000586305.1_Silent_p.L341L|RASGRP4_ENST00000454404.2_Silent_p.L321L|RASGRP4_ENST00000587753.1_Intron			Q8TDF6	GRP4_HUMAN	RAS guanyl releasing protein 4	355	Ras-GEF. {ECO:0000255|PROSITE- ProRule:PRU00168}.				activation of phospholipase C activity (GO:0007202)|cell growth (GO:0016049)|cell proliferation (GO:0008283)|myeloid cell differentiation (GO:0030099)|positive regulation of Ras GTPase activity (GO:0032320)|positive regulation of Ras protein signal transduction (GO:0046579)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|response to extracellular stimulus (GO:0009991)|small GTPase mediated signal transduction (GO:0007264)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cytoplasm (GO:0005737)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|diacylglycerol binding (GO:0019992)|GTP-dependent protein binding (GO:0030742)|Ras guanyl-nucleotide exchange factor activity (GO:0005088)			cervix(1)|kidney(1)|large_intestine(4)|lung(12)|pancreas(1)|prostate(3)|skin(1)	23	all_cancers(60;4.21e-06)		Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)			CCAGGTCCTTGAGGTGCACGC	0.657																																					p.L355L		.											.	RASGRP4-660	0			c.C1065G						.						21.0	27.0	25.0					19																	38905653		2041	4195	6236	SO:0001819	synonymous_variant	115727	exon9			GTCCTTGAGGTGC	AY048119	CCDS46068.1, CCDS54262.1, CCDS54263.1, CCDS54264.1	19q13.1	2013-01-10						"""EF-hand domain containing"""	18958	protein-coding gene	gene with protein product		607320				11956218	Standard	NM_170604		Approved		uc021uub.1	Q8TDF6		ENST00000587738.1:c.1065C>G	19.37:g.38905653G>C		Somatic	139	0		WXS	Illumina GAIIx	Phase_I	287	16	NM_170604	0	0	0	0	0	A6H8M4|C0LTP2|C0LTP3|C0LTP4|C0LTP5|C0LTP7|C9J416|C9JHZ1|Q8N858|Q96QN5|Q96QN6|Q96QN7	Silent	SNP	ENST00000587738.1	37	CCDS46068.1																																																																																			.		0.657	RASGRP4-013	KNOWN	non_canonical_other|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000460540.1	NM_170604	
LTBP4	8425	broad.mit.edu	37	19	41119074	41119074	+	Silent	SNP	G	G	T			TCGA-OR-A5KY-01A-11D-A29I-10	TCGA-OR-A5KY-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	72f9e1d9-c852-423a-94ff-17f763fa2713	f6e93da3-9ee7-4a65-bc04-30f8bb730eef	g.chr19:41119074G>T	ENST00000308370.7	+	19	2604	c.2604G>T	c.(2602-2604)gcG>gcT	p.A868A	LTBP4_ENST00000396819.3_Silent_p.A801A|LTBP4_ENST00000545697.1_Silent_p.A321A|LTBP4_ENST00000602240.1_3'UTR|LTBP4_ENST00000204005.9_Silent_p.A831A|LTBP4_ENST00000243562.9_5'Flank	NM_001042544.1	NP_001036009.1	Q8N2S1	LTBP4_HUMAN	latent transforming growth factor beta binding protein 4	868	Cys-rich.|EGF-like 9; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				extracellular matrix organization (GO:0030198)|growth hormone secretion (GO:0030252)|multicellular organismal development (GO:0007275)|protein folding (GO:0006457)|regulation of cell differentiation (GO:0045595)|regulation of cell growth (GO:0001558)|regulation of proteolysis (GO:0030162)|regulation of transforming growth factor beta receptor signaling pathway (GO:0017015)|transforming growth factor beta receptor signaling pathway (GO:0007179)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|glycosaminoglycan binding (GO:0005539)|integrin binding (GO:0005178)|transforming growth factor beta binding (GO:0050431)|transforming growth factor beta-activated receptor activity (GO:0005024)	p.A868A(1)		central_nervous_system(1)	1			Lung(22;0.000158)|LUSC - Lung squamous cell carcinoma(20;0.000384)			GCTACCGGGCGCCGTCGGGTC	0.692																																					.		.											.	LTBP4-93	1	Substitution - coding silent(1)	prostate(1)	.						.						14.0	15.0	14.0					19																	41119074		1885	4101	5986	SO:0001819	synonymous_variant	8425	.			CCGGGCGCCGTCG	Y13622	CCDS74368.1, CCDS74369.1, CCDS74370.1	19q13.1-q13.2	2011-10-20				ENSG00000090006		"""Latent transforming growth factor, beta binding proteins"""	6717	protein-coding gene	gene with protein product		604710				9660815, 9271198	Standard	NM_003573		Approved	LTBP-4, LTBP-4L, FLJ46318, FLJ90018	uc002ooh.1	Q8N2S1		ENST00000308370.7:c.2604G>T	19.37:g.41119074G>T		Somatic	26	2		WXS	Illumina GAIIx	Phase_I	98	8	.	0	0	28	28	0	O00508|O75412|O75413	Silent	SNP	ENST00000308370.7	37																																																																																				.		0.692	LTBP4-203	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding		NM_003573	
ZNF234	10780	bcgsc.ca	37	19	44660967	44660967	+	Silent	SNP	A	A	G	rs12609635	byFrequency	TCGA-OR-A5KY-01A-11D-A29I-10	TCGA-OR-A5KY-10A-01D-A29L-10	A	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	72f9e1d9-c852-423a-94ff-17f763fa2713	f6e93da3-9ee7-4a65-bc04-30f8bb730eef	g.chr19:44660967A>G	ENST00000426739.2	+	6	1056	c.798A>G	c.(796-798)ggA>ggG	p.G266G	ZNF234_ENST00000592437.1_Silent_p.G266G	NM_006630.2	NP_006621.1	Q14588	ZN234_HUMAN	zinc finger protein 234	266					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(2)|lung(11)|ovary(1)|prostate(1)	23		Prostate(69;0.0435)				AGGAATGTGGAAGGGCCTTCA	0.418													G|||	2851	0.569289	0.9418	0.4726	5008	,	,		23488	0.4931		0.3668	False		,,,				2504	0.4213				p.G266G		.											.	.	0			c.A798G						.	G	,	3702,704	272.5+/-270.8	1568,566,69	136.0	144.0	142.0		798,798	-4.3	0.0	19	dbSNP_120	142	3162,5438	643.0+/-399.9	577,2008,1715	no	coding-synonymous,coding-synonymous	ZNF234	NM_001144824.1,NM_006630.2	,	2145,2574,1784	GG,GA,AA		36.7674,15.9782,47.2244	,	266/701,266/701	44660967	6864,6142	2203	4300	6503	SO:0001819	synonymous_variant	10780	exon6			ATGTGGAAGGGCC	X78927	CCDS46101.1	19q13	2013-01-08				ENSG00000263002		"""Zinc fingers, C2H2-type"", ""-"""	13027	protein-coding gene	gene with protein product		604750		ZNF269		7865130	Standard	NM_006630		Approved	HZF4	uc002oyl.4	Q14588		ENST00000426739.2:c.798A>G	19.37:g.44660967A>G		Somatic	121	0		WXS	Illumina GAIIx	Phase_I	162	5	NM_006630	0	0	9	9	0	A8K1C8|Q96IR4|Q9NS45|Q9NYT7	Silent	SNP	ENST00000426739.2	37	CCDS46101.1																																																																																			A|0.448;G|0.552		0.418	ZNF234-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000460586.2		
ERCC2	2068	hgsc.bcm.edu	37	19	45867259	45867259	+	Missense_Mutation	SNP	C	C	T	rs1799793	byFrequency	TCGA-OR-A5KY-01A-11D-A29I-10	TCGA-OR-A5KY-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	72f9e1d9-c852-423a-94ff-17f763fa2713	f6e93da3-9ee7-4a65-bc04-30f8bb730eef	g.chr19:45867259C>T	ENST00000391945.4	-	10	1011	c.934G>A	c.(934-936)Gac>Aac	p.D312N	ERCC2_ENST00000391944.3_Missense_Mutation_p.D234N|ERCC2_ENST00000391940.4_Missense_Mutation_p.D288N|ERCC2_ENST00000221481.6_3'UTR|ERCC2_ENST00000485403.2_Missense_Mutation_p.D288N	NM_000400.3	NP_000391.1	P18074	ERCC2_HUMAN	excision repair cross-complementation group 2	312			D -> N (in dbSNP:rs1799793). {ECO:0000269|PubMed:11245433, ECO:0000269|PubMed:11470747, ECO:0000269|PubMed:11709541, ECO:0000269|Ref.3}.		7-methylguanosine mRNA capping (GO:0006370)|aging (GO:0007568)|apoptotic process (GO:0006915)|ATP catabolic process (GO:0006200)|bone mineralization (GO:0030282)|cell proliferation (GO:0008283)|central nervous system myelin formation (GO:0032289)|chromosome segregation (GO:0007059)|DNA duplex unwinding (GO:0032508)|DNA repair (GO:0006281)|embryonic cleavage (GO:0040016)|erythrocyte maturation (GO:0043249)|extracellular matrix organization (GO:0030198)|gene expression (GO:0010467)|hair cell differentiation (GO:0035315)|hair follicle maturation (GO:0048820)|hematopoietic stem cell differentiation (GO:0060218)|in utero embryonic development (GO:0001701)|multicellular organism growth (GO:0035264)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA damage removal (GO:0000718)|nucleotide-excision repair, DNA incision (GO:0033683)|positive regulation of DNA binding (GO:0043388)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of viral transcription (GO:0050434)|post-embryonic development (GO:0009791)|protein phosphorylation (GO:0006468)|regulation of mitotic cell cycle phase transition (GO:1901990)|response to hypoxia (GO:0001666)|response to oxidative stress (GO:0006979)|small molecule metabolic process (GO:0044281)|spinal cord development (GO:0021510)|termination of RNA polymerase I transcription (GO:0006363)|transcription elongation from RNA polymerase I promoter (GO:0006362)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase I promoter (GO:0006360)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase I promoter (GO:0006361)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription-coupled nucleotide-excision repair (GO:0006283)|UV protection (GO:0009650)|viral process (GO:0016032)	cytoplasm (GO:0005737)|holo TFIIH complex (GO:0005675)|MMXD complex (GO:0071817)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle (GO:0005819)	4 iron, 4 sulfur cluster binding (GO:0051539)|5'-3' DNA helicase activity (GO:0043139)|ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|DNA binding (GO:0003677)|DNA-dependent ATPase activity (GO:0008094)|metal ion binding (GO:0046872)|protein C-terminus binding (GO:0008022)|protein N-terminus binding (GO:0047485)			large_intestine(4)|lung(2)|ovary(1)|pancreas(1)|stomach(1)	9		Ovarian(192;0.0728)|all_neural(266;0.112)		OV - Ovarian serous cystadenocarcinoma(262;0.0226)		AGCACTTCGTCGGGCAGCACG	0.746			"""Mis, N, F, S"""			"""skin basal cell, skin squamous cell, melanoma"""		Nucleotide excision repair (NER)	Xeroderma Pigmentosum				C|||	974	0.194489	0.0734	0.1988	5008	,	,		10423	0.0496		0.3588	False		,,,				2504	0.3354				p.D312N		.	yes	Rec		Xeroderma pigmentosum (D)	19	19q13.2-q13.3	2068	"""excision repair cross-complementing rodent repair deficiency, complementation group 2 (xeroderma pigmentosum D)"""		E	.	ERCC2-848	0			c.G934A	GRCh37	CM015299	ERCC2	M	rs1799793	.	C	ASN/ASP,ASN/ASP	387,3577		30,327,1625	5.0	8.0	7.0		934,862	5.2	0.5	19	dbSNP_89	7	2507,5397		444,1619,1889	no	missense,missense	ERCC2	NM_000400.3,NM_001130867.1	23,23	474,1946,3514	TT,TC,CC		31.7181,9.7629,24.3849	benign,benign	312/761,288/406	45867259	2894,8974	1982	3952	5934	SO:0001583	missense	2068	exon10	Familial Cancer Database	incl. XPA, XPB, XPC, XPD, XPE, XPF, XPG, XP Variant, XPV	CTTCGTCGGGCAG		CCDS33049.1, CCDS46112.1	19q13.3	2014-09-17	2014-03-07		ENSG00000104884	ENSG00000104884	3.6.4.12	"""General transcription factor IIH complex subunits"""	3434	protein-coding gene	gene with protein product	"""excision repair cross-complementing rodent repair deficiency, complementation group 2 protein"", ""TFIIH basal transcription factor complex helicase XPB subunit"""	126340	"""xeroderma pigmentosum complementary group D"", ""excision repair cross-complementing rodent repair deficiency, complementation group 2"""	XPD		8413672, 2184031	Standard	NM_000400		Approved	MAG, EM9, MGC102762, MGC126218, MGC126219, TFIIH	uc002pbj.2	P18074	OTTHUMG00000048190	ENST00000391945.4:c.934G>A	19.37:g.45867259C>T	ENSP00000375809:p.Asp312Asn	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	44	44	NM_000400	0	0	0	20	20	Q2TB78|Q2YDY2|Q7KZU6|Q8N721	Missense_Mutation	SNP	ENST00000391945.4	37	CCDS33049.1	423	0.1936813186813187	34	0.06910569105691057	70	0.19337016574585636	38	0.06643356643356643	281	0.370712401055409	C	20.0	3.930510	0.73327	0.097629	0.317181	ENSG00000104884	ENST00000391941;ENST00000391942;ENST00000391945;ENST00000391944;ENST00000391940	T;T;T	0.64438	-0.1;-0.1;-0.1	5.15	5.15	0.70609	Domain of unknown function DUF1227 (1);	0.000000	0.85682	D	0.000000	T	0.00012	0.0000	L	0.46947	1.48	0.09310	P	1.0	B;P;B	0.34639	0.065;0.461;0.053	B;B;B	0.35353	0.059;0.201;0.051	T	0.28267	-1.0049	9	0.33940	T	0.23	-30.0006	16.1268	0.81402	0.0:1.0:0.0:0.0	rs1799793;rs3916814;rs58989209;rs1799793	234;288;312	E7EVE9;Q7KZU6;P18074	.;.;ERCC2_HUMAN	N	262;288;312;234;288	ENSP00000375809:D312N;ENSP00000375808:D234N;ENSP00000375804:D288N	ENSP00000375804:D288N	D	-	1	0	ERCC2	50559099	1.000000	0.71417	0.523000	0.27875	0.865000	0.49528	7.192000	0.77771	2.388000	0.81334	0.561000	0.74099	GAC	C|0.804;T|0.196		0.746	ERCC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109626.2	NM_000400	
ZC3H4	23211	hgsc.bcm.edu	37	19	47570199	47570199	+	Missense_Mutation	SNP	G	G	A	rs202213560	byFrequency	TCGA-OR-A5KY-01A-11D-A29I-10	TCGA-OR-A5KY-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	72f9e1d9-c852-423a-94ff-17f763fa2713	f6e93da3-9ee7-4a65-bc04-30f8bb730eef	g.chr19:47570199G>A	ENST00000253048.5	-	15	3363	c.3326C>T	c.(3325-3327)cCg>cTg	p.P1109L	ZC3H4_ENST00000594019.1_5'UTR	NM_015168.1	NP_055983.1	Q9UPT8	ZC3H4_HUMAN	zinc finger CCCH-type containing 4	1109							metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			NS(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(6)|lung(13)|ovary(4)|prostate(2)|skin(7)|upper_aerodigestive_tract(1)	41		all_cancers(25;3.3e-08)|all_epithelial(76;2.28e-06)|all_lung(116;7.86e-06)|Lung NSC(112;2.31e-05)|all_neural(266;0.026)|Ovarian(192;0.0392)|Breast(70;0.0889)		OV - Ovarian serous cystadenocarcinoma(262;5.76e-05)|all cancers(93;7.69e-05)|Epithelial(262;0.00354)|GBM - Glioblastoma multiforme(486;0.0372)		ATCCCCACTCGGGCTGGCGGT	0.751													G|||	34	0.00678914	0.0	0.0115	5008	,	,		9855	0.001		0.0189	False		,,,				2504	0.0061				p.P1109L		.											.	ZC3H4-74	0			c.C3326T						.	G	LEU/PRO	11,3613		0,11,1801	6.0	9.0	8.0		3326	5.5	1.0	19		8	142,7742		0,142,3800	no	missense	ZC3H4	NM_015168.1	98	0,153,5601	AA,AG,GG		1.8011,0.3035,1.3295	probably-damaging	1109/1304	47570199	153,11355	1812	3942	5754	SO:0001583	missense	23211	exon15			CCACTCGGGCTGG	AB028987	CCDS42582.1	19q13.33	2012-07-05	2007-10-18	2007-10-18		ENSG00000130749		"""Zinc fingers, CCCH-type domain containing"""	17808	protein-coding gene	gene with protein product			"""chromosome 19 open reading frame 7"""	C19orf7			Standard	NM_015168		Approved	KIAA1064	uc002pga.4	Q9UPT8		ENST00000253048.5:c.3326C>T	19.37:g.47570199G>A	ENSP00000253048:p.Pro1109Leu	Somatic	2	0		WXS	Illumina GAIIx	Phase_I	25	12	NM_015168	0	0	10	13	3	Q9Y420	Missense_Mutation	SNP	ENST00000253048.5	37	CCDS42582.1	.	.	.	.	.	.	.	.	.	.	G	13.45	2.241545	0.39598	0.003035	0.018011	ENSG00000130749	ENST00000253048	T	0.18338	2.22	5.54	5.54	0.83059	.	0.529823	0.19238	N	0.119245	T	0.05593	0.0147	L	0.33485	1.01	0.44711	D	0.997704	P	0.41475	0.751	B	0.22601	0.04	T	0.21999	-1.0229	10	0.25106	T	0.35	.	18.2536	0.90012	0.0:0.0:1.0:0.0	.	1109	Q9UPT8	ZC3H4_HUMAN	L	1109	ENSP00000253048:P1109L	ENSP00000253048:P1109L	P	-	2	0	ZC3H4	52262039	1.000000	0.71417	0.971000	0.41717	0.016000	0.09150	6.894000	0.75655	2.612000	0.88384	0.563000	0.77884	CCG	.		0.751	ZC3H4-001	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466667.1		
KCNJ14	3770	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	48965218	48965218	+	Silent	SNP	C	C	G			TCGA-OR-A5KY-01A-11D-A29I-10	TCGA-OR-A5KY-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	72f9e1d9-c852-423a-94ff-17f763fa2713	f6e93da3-9ee7-4a65-bc04-30f8bb730eef	g.chr19:48965218C>G	ENST00000391884.1	+	1	713	c.237C>G	c.(235-237)acC>acG	p.T79T	KCNJ14_ENST00000342291.2_Silent_p.T79T			Q9UNX9	KCJ14_HUMAN	potassium inwardly-rectifying channel, subfamily J, member 14	79					potassium ion transmembrane transport (GO:0071805)|synaptic transmission (GO:0007268)	dendrite (GO:0030425)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	inward rectifier potassium channel activity (GO:0005242)			cervix(1)|endometrium(2)|large_intestine(2)|lung(2)|skin(2)|urinary_tract(1)	10		all_epithelial(76;2.38e-06)|all_lung(116;4.89e-06)|Lung NSC(112;9.34e-06)|all_neural(266;0.0189)|Ovarian(192;0.0261)		OV - Ovarian serous cystadenocarcinoma(262;0.000109)|all cancers(93;0.000129)|Epithelial(262;0.0081)|GBM - Glioblastoma multiforme(486;0.0222)	Yohimbine(DB01392)	ACCTGTTCACCACATGCGTGG	0.652																																					p.A79A	NSCLC(148;170 3504 35216)	.											.	KCNJ14-91	0			c.C237G						.						69.0	39.0	49.0					19																	48965218		2203	4300	6503	SO:0001819	synonymous_variant	3770	exon2			GTTCACCACATGC	BC042033	CCDS12721.1	19q13	2011-07-05				ENSG00000182324		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Inwardly rectifying"""	6260	protein-coding gene	gene with protein product		603953				9592090, 10723734, 16382105	Standard	NM_013348		Approved	Kir2.4, IRK4	uc002pje.2	Q9UNX9		ENST00000391884.1:c.237C>G	19.37:g.48965218C>G		Somatic	147	0		WXS	Illumina GAIIx	Phase_I	327	69	NM_013348	0	0	0	1	1		Silent	SNP	ENST00000391884.1	37	CCDS12721.1																																																																																			.		0.652	KCNJ14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466127.1	NM_013348	
RASIP1	54922	hgsc.bcm.edu	37	19	49232226	49232226	+	Missense_Mutation	SNP	G	G	A	rs2287922	byFrequency	TCGA-OR-A5KY-01A-11D-A29I-10	TCGA-OR-A5KY-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	72f9e1d9-c852-423a-94ff-17f763fa2713	f6e93da3-9ee7-4a65-bc04-30f8bb730eef	g.chr19:49232226G>A	ENST00000222145.4	-	5	2005	c.1801C>T	c.(1801-1803)Cgc>Tgc	p.R601C	RASIP1_ENST00000594232.1_5'Flank	NM_017805.2	NP_060275.2	Q5U651	RAIN_HUMAN	Ras interacting protein 1	601	Dilute. {ECO:0000255|PROSITE- ProRule:PRU00503}.		R -> C (in dbSNP:rs2287922). {ECO:0000269|PubMed:15031288}.		angiogenesis (GO:0001525)|branching morphogenesis of an epithelial tube (GO:0048754)|negative regulation of autophagy (GO:0010507)|regulation of Rho GTPase activity (GO:0032319)|signal transduction (GO:0007165)|vasculogenesis (GO:0001570)	Golgi apparatus (GO:0005794)				central_nervous_system(1)|endometrium(2)|large_intestine(5)|lung(7)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	21		all_lung(116;4.89e-06)|all_epithelial(76;7.04e-06)|Lung NSC(112;9.34e-06)|all_neural(266;0.0189)|Ovarian(192;0.0261)		OV - Ovarian serous cystadenocarcinoma(262;9.98e-05)|all cancers(93;0.000272)|Epithelial(262;0.0155)|GBM - Glioblastoma multiforme(486;0.0222)		CGGGCCAGGCGGCCCAGCAGT	0.731													G|||	1076	0.214856	0.1157	0.2997	5008	,	,		8786	0.0198		0.4791	False		,,,				2504	0.2178				p.R601C		.											.	RASIP1-228	0			c.C1801T						.	G	CYS/ARG	456,2624		82,292,1166	2.0	3.0	3.0		1801	4.2	1.0	19	dbSNP_100	3	2661,3381		645,1371,1005	yes	missense	RASIP1	NM_017805.2	180	727,1663,2171	AA,AG,GG		44.0417,14.8052,34.1701	probably-damaging	601/964	49232226	3117,6005	1540	3021	4561	SO:0001583	missense	54922	exon5			CCAGGCGGCCCAG	BC028614	CCDS12731.1	19q13.33	2008-02-05				ENSG00000105538			24716	protein-coding gene	gene with protein product		609623				15031288	Standard	NM_017805		Approved	FLJ20401, RAIN	uc002pki.3	Q5U651		ENST00000222145.4:c.1801C>T	19.37:g.49232226G>A	ENSP00000222145:p.Arg601Cys	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	11	10	NM_017805	0	0	20	66	46	Q6U676	Missense_Mutation	SNP	ENST00000222145.4	37	CCDS12731.1	571	0.26144688644688646	65	0.13211382113821138	127	0.35082872928176795	21	0.03671328671328671	358	0.47229551451187335	G	17.28	3.350878	0.61183	0.148052	0.440417	ENSG00000105538	ENST00000222145	T	0.27557	1.66	4.17	4.17	0.49024	Dilute (1);	0.331247	0.23983	N	0.042644	T	0.00012	0.0000	L	0.39898	1.24	0.22701	P	0.99883638	D	0.76494	0.999	P	0.54590	0.756	T	0.48328	-0.9045	9	0.66056	D	0.02	-0.9078	9.7493	0.40466	0.0:0.0:0.7933:0.2067	rs2287922	601	Q5U651	RAIN_HUMAN	C	601	ENSP00000222145:R601C	ENSP00000222145:R601C	R	-	1	0	RASIP1	53924038	1.000000	0.71417	1.000000	0.80357	0.642000	0.38348	3.181000	0.50903	2.023000	0.59567	0.462000	0.41574	CGC	G|0.738;A|0.262		0.731	RASIP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466185.1	NM_017805	
CDC42EP5	148170	hgsc.bcm.edu	37	19	54976356	54976356	+	Missense_Mutation	SNP	C	C	T	rs10017	byFrequency	TCGA-OR-A5KY-01A-11D-A29I-10	TCGA-OR-A5KY-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	72f9e1d9-c852-423a-94ff-17f763fa2713	f6e93da3-9ee7-4a65-bc04-30f8bb730eef	g.chr19:54976356C>T	ENST00000301200.2	-	3	717	c.376G>A	c.(376-378)Ggg>Agg	p.G126R	LENG9_ENST00000333834.4_5'Flank	NM_145057.2	NP_659494.2	Q6NZY7	BORG3_HUMAN	CDC42 effector protein (Rho GTPase binding) 5	126					JNK cascade (GO:0007254)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of pseudopodium assembly (GO:0031274)|regulation of cell shape (GO:0008360)|Rho protein signal transduction (GO:0007266)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|membrane (GO:0016020)|plasma membrane (GO:0005886)	GTP-Rho binding (GO:0017049)			lung(1)|skin(1)	2	Ovarian(34;0.19)			GBM - Glioblastoma multiforme(193;0.138)		GGCTGCGTCCCGGGGCGGGGT	0.756													C|||	10	0.00199681	0.0	0.0043	5008	,	,		6720	0.0		0.004	False		,,,				2504	0.0031				p.G126R		.											.	CDC42EP5-90	0			c.G376A						.	C	ARG/GLY	3,2953		0,3,1475	3.0	3.0	3.0		376	1.9	0.0	19	dbSNP_52	3	31,5983		0,31,2976	no	missense	CDC42EP5	NM_145057.2	125	0,34,4451	TT,TC,CC		0.5155,0.1015,0.379	benign	126/149	54976356	34,8936	1478	3007	4485	SO:0001583	missense	148170	exon3			GCGTCCCGGGGCG	BC024327	CCDS12896.1	19q13.42	2008-02-05			ENSG00000167617	ENSG00000167617			17408	protein-coding gene	gene with protein product		609171					Standard	NM_145057		Approved	CEP5, Borg3	uc002qfz.1	Q6NZY7	OTTHUMG00000065699	ENST00000301200.2:c.376G>A	19.37:g.54976356C>T	ENSP00000301200:p.Gly126Arg	Somatic	1	0		WXS	Illumina GAIIx	Phase_I	14	11	NM_145057	0	0	0	1	1	B0VJZ2|Q8TB51	Missense_Mutation	SNP	ENST00000301200.2	37	CCDS12896.1	.	.	.	.	.	.	.	.	.	.	C	13.93	2.382721	0.42207	0.001015	0.005155	ENSG00000167617	ENST00000301200	T	0.29917	1.55	2.97	1.86	0.25419	.	0.537116	0.12651	N	0.450446	T	0.12817	0.0311	L	0.31294	0.92	0.09310	N	1	B	0.27416	0.178	B	0.15870	0.014	T	0.20538	-1.0272	10	0.16420	T	0.52	-1.2346	8.3827	0.32481	0.0:0.8737:0.0:0.1263	rs10017;rs3199354;rs17295588	126	Q6NZY7	BORG3_HUMAN	R	126	ENSP00000301200:G126R	ENSP00000301200:G126R	G	-	1	0	CDC42EP5	59668168	0.000000	0.05858	0.002000	0.10522	0.189000	0.23516	-0.004000	0.12878	0.560000	0.29169	0.555000	0.69702	GGG	C|1.000;|0.000		0.756	CDC42EP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000140804.1	NM_145057	
ZNF787	126208	hgsc.bcm.edu	37	19	56599438	56599440	+	In_Frame_Del	DEL	TCG	TCG	-	rs5828672|rs71696054	byFrequency	TCGA-OR-A5KY-01A-11D-A29I-10	TCGA-OR-A5KY-10A-01D-A29L-10	TCG	TCG	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	72f9e1d9-c852-423a-94ff-17f763fa2713	f6e93da3-9ee7-4a65-bc04-30f8bb730eef	g.chr19:56599438_56599440delTCG	ENST00000270459.3	-	3	1219_1221	c.1101_1103delCGA	c.(1099-1104)gacgag>gag	p.D367del		NM_001002836.2	NP_001002836	Q6DD87	ZN787_HUMAN	zinc finger protein 787	367					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(1)|lung(2)|pancreas(1)	5		Colorectal(82;3.46e-05)|Ovarian(87;0.0822)|Renal(1328;0.157)		GBM - Glioblastoma multiforme(193;0.0559)		GCCCGCGGCCTCGTCGTCGTCGT	0.778														4509	0.900359	0.9939	0.732	5008	,	,		3238	0.7252		0.9821	False		,,,				2504	0.9898				p.367_368del		.											.	ZNF787-69	0			c.1101_1103del						.																																			SO:0001651	inframe_deletion	126208	exon3			GCGGCCTCGTCGT	BC077728, AF000560	CCDS42634.1	19q13.42	2013-01-08				ENSG00000142409		"""Zinc fingers, C2H2-type"""	26998	protein-coding gene	gene with protein product							Standard	NM_001002836		Approved		uc010eth.1	Q6DD87		ENST00000270459.3:c.1101_1103delCGA	19.37:g.56599447_56599449delTCG	ENSP00000270459:p.Asp367del	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	27	27	NM_001002836	0	0	0	0	0	O00455	In_Frame_Del	DEL	ENST00000270459.3	37	CCDS42634.1																																																																																			.		0.778	ZNF787-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000457498.1	NM_001002836	
ZNF814	730051	ucsc.edu	37	19	58384739	58384739	+	Silent	SNP	A	A	G			TCGA-OR-A5KY-01A-11D-A29I-10	TCGA-OR-A5KY-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	72f9e1d9-c852-423a-94ff-17f763fa2713	f6e93da3-9ee7-4a65-bc04-30f8bb730eef	g.chr19:58384739A>G	ENST00000435989.2	-	3	2253	c.2019T>C	c.(2017-2019)ggT>ggC	p.G673G	ZNF814_ENST00000597342.1_Intron|ZNF814_ENST00000596604.1_Intron|ZNF814_ENST00000600634.1_Intron|ZNF814_ENST00000595295.1_Intron|ZNF814_ENST00000597832.1_Intron	NM_001144989.1	NP_001138461.1	B7Z6K7	ZN814_HUMAN	zinc finger protein 814	673					regulation of transcription, DNA-templated (GO:0006355)	intracellular (GO:0005622)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|central_nervous_system(2)|endometrium(3)|kidney(9)|lung(2)|prostate(4)|skin(1)|urinary_tract(3)	25						GAATGAGGTTACCCTTGTGAC	0.403																																					p.G673G		.											.	.	0			c.T2019C						.						72.0	60.0	64.0					19																	58384739		692	1591	2283	SO:0001819	synonymous_variant	730051	exon3			GAGGTTACCCTTG		CCDS46212.1	19q13.43	2013-01-08			ENSG00000204514	ENSG00000204514		"""Zinc fingers, C2H2-type"", ""-"""	33258	protein-coding gene	gene with protein product							Standard	NM_001144989		Approved		uc002qqo.2	B7Z6K7		ENST00000435989.2:c.2019T>C	19.37:g.58384739A>G		Somatic	226	1		WXS	Illumina GAIIx	Phase_I	353	1	NM_001144989	0	0	10	12	2	A6NF35	Silent	SNP	ENST00000435989.2	37	CCDS46212.1																																																																																			.		0.403	ZNF814-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466976.1	XM_001725708	
CMPK2	129607	hgsc.bcm.edu	37	2	7005369	7005369	+	Silent	SNP	A	A	G	rs11678810	byFrequency	TCGA-OR-A5KY-01A-11D-A29I-10	TCGA-OR-A5KY-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	72f9e1d9-c852-423a-94ff-17f763fa2713	f6e93da3-9ee7-4a65-bc04-30f8bb730eef	g.chr2:7005369A>G	ENST00000256722.5	-	1	458	c.459T>C	c.(457-459)tgT>tgC	p.C153C	CMPK2_ENST00000404168.1_Silent_p.C153C|CMPK2_ENST00000458098.1_Silent_p.C153C|CMPK2_ENST00000478738.1_Intron	NM_207315.3	NP_997198.2	Q5EBM0	CMPK2_HUMAN	cytidine monophosphate (UMP-CMP) kinase 2, mitochondrial	153					cellular response to lipopolysaccharide (GO:0071222)|dTDP biosynthetic process (GO:0006233)|dUDP biosynthetic process (GO:0006227)|nucleoside diphosphate phosphorylation (GO:0006165)|nucleoside triphosphate biosynthetic process (GO:0009142)	mitochondrion (GO:0005739)|nucleus (GO:0005634)	ATP binding (GO:0005524)|cytidylate kinase activity (GO:0004127)|nucleoside diphosphate kinase activity (GO:0004550)|thymidylate kinase activity (GO:0004798)|UMP kinase activity (GO:0033862)			large_intestine(1)|lung(13)|prostate(1)|upper_aerodigestive_tract(1)	16	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)					GTGCCTCCTGACAGGCGCCCA	0.741													G|||	4998	0.998003	0.9924	1.0	5008	,	,		10694	1.0		1.0	False		,,,				2504	1.0				p.C153C		.											.	CMPK2-68	0			c.T459C						.	G		3605,39		1783,39,0	3.0	4.0	4.0		459	1.6	0.0	2	dbSNP_120	4	7874,0		3937,0,0	no	coding-synonymous	CMPK2	NM_207315.2		5720,39,0	GG,GA,AA		0.0,1.0703,0.3386		153/450	7005369	11479,39	1822	3937	5759	SO:0001819	synonymous_variant	129607	exon1			CTCCTGACAGGCG		CCDS42648.1, CCDS58695.1, CCDS58696.1	2p25.2	2008-01-25			ENSG00000134326	ENSG00000134326	2.7.4.14		27015	protein-coding gene	gene with protein product	"""cytidylate kinase 2"""	611787				17999954	Standard	NM_207315		Approved	TYKi, UMP-CMPK2	uc002qyo.4	Q5EBM0	OTTHUMG00000151629	ENST00000256722.5:c.459T>C	2.37:g.7005369A>G		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	4	4	NM_001256478	0	0	0	0	0	A2RUB0|A5D8T2|B7ZM18|Q6ZRU2|Q96AL8	Silent	SNP	ENST00000256722.5	37	CCDS42648.1																																																																																			A|0.003;G|0.997		0.741	CMPK2-002	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323339.2	NM_207315	
TMEM247	388946	ucsc.edu;bcgsc.ca	37	2	46707808	46707808	+	Missense_Mutation	SNP	C	C	G	rs70940616|rs74318890		TCGA-OR-A5KY-01A-11D-A29I-10	TCGA-OR-A5KY-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	72f9e1d9-c852-423a-94ff-17f763fa2713	f6e93da3-9ee7-4a65-bc04-30f8bb730eef	g.chr2:46707808C>G	ENST00000434431.1	+	2	382	c.382C>G	c.(382-384)Cag>Gag	p.Q128E		NM_001145051.2	NP_001138523.1	A6NEH6	TM247_HUMAN	transmembrane protein 247	128						endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)											GAACCAGCGGCAGCGGCAGCA	0.662																																					p.Q128E		.											.	.	0			c.C382G						.						30.0	40.0	37.0					2																	46707808		692	1591	2283	SO:0001583	missense	388946	exon2			CAGCGGCAGCGGC		CCDS56117.1	2p21	2012-04-11			ENSG00000187600	ENSG00000187600			42967	protein-coding gene	gene with protein product							Standard	NM_001145051		Approved		uc010yod.3	A6NEH6	OTTHUMG00000153137	ENST00000434431.1:c.382C>G	2.37:g.46707808C>G	ENSP00000388684:p.Gln128Glu	Somatic	160	2		WXS	Illumina GAIIx	Phase_I	284	41	NM_001145051	0	0	0	0	0		Missense_Mutation	SNP	ENST00000434431.1	37	CCDS56117.1	.	.	.	.	.	.	.	.	.	.	C	17.67	3.447093	0.63178	.	.	ENSG00000187600	ENST00000434431	.	.	.	4.76	4.76	0.60689	.	0.000000	0.39475	N	0.001353	T	0.65606	0.2707	L	0.34521	1.04	.	.	.	D	0.56035	0.974	D	0.70487	0.969	T	0.71735	-0.4503	8	0.54805	T	0.06	-28.7409	14.7885	0.69821	0.0:1.0:0.0:0.0	.	128	A6NEH6	YB028_HUMAN	E	128	.	ENSP00000388684:Q128E	Q	+	1	0	AC018682.6	46561312	1.000000	0.71417	1.000000	0.80357	0.569000	0.35902	3.910000	0.56371	2.484000	0.83849	0.563000	0.77884	CAG	G|1.000;|0.000		0.662	TMEM247-001	KNOWN	mRNA_end_NF|cds_end_NF|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000329726.1	NM_001145051	
USP34	9736	bcgsc.ca	37	2	61566536	61566536	+	Silent	SNP	T	T	C	rs17008405	byFrequency	TCGA-OR-A5KY-01A-11D-A29I-10	TCGA-OR-A5KY-10A-01D-A29L-10	T	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	72f9e1d9-c852-423a-94ff-17f763fa2713	f6e93da3-9ee7-4a65-bc04-30f8bb730eef	g.chr2:61566536T>C	ENST00000398571.2	-	18	2770	c.2694A>G	c.(2692-2694)caA>caG	p.Q898Q		NM_014709.3	NP_055524.3	Q70CQ2	UBP34_HUMAN	ubiquitin specific peptidase 34	898					positive regulation of canonical Wnt signaling pathway (GO:0090263)|protein deubiquitination (GO:0016579)|protein K48-linked deubiquitination (GO:0071108)|ubiquitin-dependent protein catabolic process (GO:0006511)|Wnt signaling pathway (GO:0016055)		cysteine-type endopeptidase activity (GO:0004197)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)			autonomic_ganglia(1)|breast(14)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(24)|lung(52)|ovary(8)|prostate(10)|skin(6)|urinary_tract(2)	138			Epithelial(17;0.229)			TCATTCGAATTTGTCTATCTG	0.294													T|||	573	0.114417	0.2118	0.0836	5008	,	,		16460	0.0169		0.1421	False		,,,				2504	0.0767				p.Q898Q		.											.	USP34-579	0			c.A2694G						.	T		781,2821		90,601,1110	85.0	78.0	80.0		2694	0.9	1.0	2	dbSNP_123	80	1186,6950		90,1006,2972	no	coding-synonymous	USP34	NM_014709.3		180,1607,4082	CC,CT,TT		14.5772,21.6824,16.7575		898/3547	61566536	1967,9771	1801	4068	5869	SO:0001819	synonymous_variant	9736	exon18			TCGAATTTGTCTA	AB011142	CCDS42686.1	2p16.1-p15	2005-08-08	2005-08-08		ENSG00000115464	ENSG00000115464		"""Ubiquitin-specific peptidases"""	20066	protein-coding gene	gene with protein product		615295	"""ubiquitin specific protease 34"""			12838346	Standard	NM_014709		Approved	KIAA0570, KIAA0729	uc002sbe.3	Q70CQ2	OTTHUMG00000152265	ENST00000398571.2:c.2694A>G	2.37:g.61566536T>C		Somatic	156	0		WXS	Illumina GAIIx	Phase_I	116	5	NM_014709	0	0	2	2	0	A8MWD0|B3KWU9|O60316|O94834|Q3B777|Q6P6C9|Q7L8P6|Q8N3T9|Q8TBW2|Q9UGA1	Silent	SNP	ENST00000398571.2	37	CCDS42686.1																																																																																			T|0.872;C|0.128		0.294	USP34-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000325650.4		
SOWAHC	65124	hgsc.bcm.edu	37	2	110372192	110372192	+	Silent	SNP	A	A	G	rs6594048		TCGA-OR-A5KY-01A-11D-A29I-10	TCGA-OR-A5KY-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	72f9e1d9-c852-423a-94ff-17f763fa2713	f6e93da3-9ee7-4a65-bc04-30f8bb730eef	g.chr2:110372192A>G	ENST00000356454.3	+	1	282	c.126A>G	c.(124-126)ctA>ctG	p.L42L	SEPT10_ENST00000545389.1_5'Flank|SEPT10_ENST00000356688.4_5'Flank|SEPT10_ENST00000437928.1_5'Flank|SEPT10_ENST00000415095.1_5'Flank|SEPT10_ENST00000397714.2_5'Flank|SEPT10_ENST00000397712.2_5'Flank|SEPT10_ENST00000334001.6_5'Flank	NM_023016.3	NP_075392.2	Q53LP3	SWAHC_HUMAN	sosondowah ankyrin repeat domain family member C	42																	GGGGCGCCCTAGGCGGCGAAC	0.771													G|||	5008	1.0	1.0	1.0	5008	,	,		6158	1.0		1.0	False		,,,				2504	1.0				p.L42L		.											.	.	0			c.A126G						.						1.0	2.0	2.0					2																	110372192		1239	2477	3716	SO:0001819	synonymous_variant	65124	exon1			CGCCCTAGGCGGC	AK023346	CCDS33270.1	2q13	2013-01-10	2012-01-12	2012-01-12	ENSG00000198142	ENSG00000198142		"""Ankyrin repeat domain containing"""	26149	protein-coding gene	gene with protein product			"""ankyrin repeat domain 57"""	C2orf26, ANKRD57		22234889	Standard	NM_023016		Approved	FLJ21870	uc002tfb.3	Q53LP3	OTTHUMG00000153219	ENST00000356454.3:c.126A>G	2.37:g.110372192A>G		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	10	10	NM_023016	0	0	0	0	0	Q8NE15|Q9H6U1	Silent	SNP	ENST00000356454.3	37	CCDS33270.1																																																																																			A|0.029;G|0.971		0.771	SOWAHC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000330168.1	NM_023016	
SP5	389058	hgsc.bcm.edu	37	2	171573185	171573185	+	Silent	SNP	G	G	T	rs1134626	byFrequency	TCGA-OR-A5KY-01A-11D-A29I-10	TCGA-OR-A5KY-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	72f9e1d9-c852-423a-94ff-17f763fa2713	f6e93da3-9ee7-4a65-bc04-30f8bb730eef	g.chr2:171573185G>T	ENST00000375281.3	+	2	630	c.468G>T	c.(466-468)ccG>ccT	p.P156P	AC007405.2_ENST00000409786.1_5'Flank	NM_001003845.2	NP_001003845.1	Q6BEB4	SP5_HUMAN	Sp5 transcription factor	156					bone morphogenesis (GO:0060349)|post-anal tail morphogenesis (GO:0036342)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)	p.P156P(1)		NS(1)|endometrium(2)|lung(1)|prostate(1)	5						CCGCGCTGCCGCCAGGCTACT	0.751													G|||	1034	0.20647	0.0242	0.2017	5008	,	,		6711	0.1815		0.3579	False		,,,				2504	0.3262				p.P156P		.											.	SP5-90	1	Substitution - coding silent(1)	NS(1)	c.G468T						.	G		219,2535		16,187,1174	5.0	6.0	6.0		468	-7.5	0.4	2	dbSNP_86	6	2090,4520		318,1454,1533	no	coding-synonymous	SP5	NM_001003845.2		334,1641,2707	TT,TG,GG		31.6188,7.9521,24.6583		156/399	171573185	2309,7055	1377	3305	4682	SO:0001819	synonymous_variant	389058	exon2			GCTGCCGCCAGGC		CCDS33322.1	2q31	2013-01-08			ENSG00000204335	ENSG00000204335		"""Specificity protein transcription factors"", ""Zinc fingers, C2H2-type"""	14529	protein-coding gene	gene with protein product		609391					Standard	NM_001003845		Approved		uc002uge.3	Q6BEB4	OTTHUMG00000154053	ENST00000375281.3:c.468G>T	2.37:g.171573185G>T		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	9	8	NM_001003845	0	0	0	0	0		Silent	SNP	ENST00000375281.3	37	CCDS33322.1																																																																																			G|0.766;T|0.234		0.751	SP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000333670.1	XM_371581	
INPP1	3628	bcgsc.ca	37	2	191231458	191231458	+	Silent	SNP	G	G	A	rs11544940|rs2067445	byFrequency	TCGA-OR-A5KY-01A-11D-A29I-10	TCGA-OR-A5KY-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	72f9e1d9-c852-423a-94ff-17f763fa2713	f6e93da3-9ee7-4a65-bc04-30f8bb730eef	g.chr2:191231458G>A	ENST00000322522.4	+	4	759	c.303G>A	c.(301-303)gaG>gaA	p.E101E	INPP1_ENST00000392329.2_Silent_p.E101E|INPP1_ENST00000541441.1_Silent_p.E101E	NM_002194.3	NP_002185.1	P49441	INPP_HUMAN	inositol polyphosphate-1-phosphatase	101					dephosphorylation (GO:0016311)|inositol phosphate metabolic process (GO:0043647)|phosphate-containing compound metabolic process (GO:0006796)|phosphatidylinositol phosphorylation (GO:0046854)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	inositol-1,3,4-trisphosphate 1-phosphatase activity (GO:0052829)|inositol-1,4-bisphosphate 1-phosphatase activity (GO:0004441)|metal ion binding (GO:0046872)			cervix(1)|large_intestine(2)|lung(6)|ovary(1)|urinary_tract(1)	11			OV - Ovarian serous cystadenocarcinoma(117;0.000286)|Epithelial(96;0.0186)|all cancers(119;0.057)			CAACAGAGGAGGAAACAGCAG	0.443													A|||	3464	0.691693	0.8147	0.7968	5008	,	,		21478	0.7579		0.5775	False		,,,				2504	0.5				p.E101E	Melanoma(130;184 1743 2185 19805 38428)	.											.	INPP1-228	0			c.G303A						.	A	,	3442,964	363.9+/-316.7	1345,752,106	158.0	157.0	157.0		303,303	-0.9	0.8	2	dbSNP_120	157	4962,3638	525.3+/-380.7	1427,2108,765	no	coding-synonymous,coding-synonymous	INPP1	NM_001128928.1,NM_002194.3	,	2772,2860,871	AA,AG,GG		42.3023,21.8793,35.3837	,	101/400,101/400	191231458	8404,4602	2203	4300	6503	SO:0001819	synonymous_variant	3628	exon4			AGAGGAGGAAACA		CCDS2305.1	2q32	2008-02-07			ENSG00000151689	ENSG00000151689	3.1.3.57		6071	protein-coding gene	gene with protein product		147263				8390685	Standard	NM_002194		Approved		uc010fsb.3	P49441	OTTHUMG00000132672	ENST00000322522.4:c.303G>A	2.37:g.191231458G>A		Somatic	174	0		WXS	Illumina GAIIx	Phase_I	163	7	NM_002194	0	0	25	25	0		Silent	SNP	ENST00000322522.4	37	CCDS2305.1																																																																																			G|0.333;A|0.667		0.443	INPP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255932.2		
AQP12A	375318	broad.mit.edu	37	2	241631584	241631584	+	Missense_Mutation	SNP	G	G	T	rs199880904		TCGA-OR-A5KY-01A-11D-A29I-10	TCGA-OR-A5KY-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	72f9e1d9-c852-423a-94ff-17f763fa2713	f6e93da3-9ee7-4a65-bc04-30f8bb730eef	g.chr2:241631584G>T	ENST00000337801.4	+	2	286	c.217G>T	c.(217-219)Gtc>Ttc	p.V73F	AC011298.2_ENST00000407635.2_lincRNA|AQP12A_ENST00000429564.1_Missense_Mutation_p.V85F	NM_198998.2	NP_945349.1	Q8IXF9	AQ12A_HUMAN	aquaporin 12A	73						integral component of membrane (GO:0016021)	transporter activity (GO:0005215)			endometrium(2)|kidney(3)|large_intestine(2)|lung(7)	14		all_epithelial(40;7.49e-12)|Breast(86;0.000148)|Renal(207;0.00571)|Ovarian(221;0.104)|all_neural(83;0.107)|all_hematologic(139;0.182)|all_lung(227;0.186)|Melanoma(123;0.238)		Epithelial(32;2.2e-31)|all cancers(36;1.08e-28)|OV - Ovarian serous cystadenocarcinoma(60;2.13e-15)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;7.52e-06)|Lung(119;0.00163)|LUSC - Lung squamous cell carcinoma(224;0.008)|Colorectal(34;0.0124)|COAD - Colon adenocarcinoma(134;0.0757)		GGCGCACGGGGTCACCTTGGA	0.667																																					p.V73F		.											.	AQP12A-22	0			c.G217T						.						30.0	45.0	40.0					2																	241631584		2151	4265	6416	SO:0001583	missense	375318	exon2			CACGGGGTCACCT	AB040748		2q37.3	2013-06-03	2005-05-26	2005-05-26	ENSG00000184945	ENSG00000184945		"""Ion channels / Aquaporins"""	19941	protein-coding gene	gene with protein product		609789	"""aquaporin 12"""	AQP12			Standard	NM_198998		Approved		uc002vzu.3	Q8IXF9	OTTHUMG00000183906	ENST00000337801.4:c.217G>T	2.37:g.241631584G>T	ENSP00000337144:p.Val73Phe	Somatic	108	3		WXS	Illumina GAIIx	Phase_I	196	11	NM_198998	0	0	0	0	0		Missense_Mutation	SNP	ENST00000337801.4	37		.	.	.	.	.	.	.	.	.	.	.	1.073	-0.669235	0.03403	.	.	ENSG00000184945	ENST00000337801;ENST00000429564;ENST00000420599	T;T	0.11277	2.79;2.79	2.58	2.58	0.30949	Aquaporin-like (2);	0.350897	0.29198	N	0.012848	T	0.03434	0.0099	N	0.02916	-0.46	0.09310	N	0.999998	B	0.11235	0.004	B	0.12837	0.008	T	0.45600	-0.9250	10	0.09843	T	0.71	.	6.7793	0.23636	0.0:0.0:0.7211:0.2789	.	73	Q8IXF9	AQ12A_HUMAN	F	73;85;58	ENSP00000337144:V73F;ENSP00000405899:V85F	ENSP00000337144:V73F	V	+	1	0	AQP12A	241280257	0.003000	0.15002	0.643000	0.29450	0.067000	0.16453	1.019000	0.30014	1.474000	0.48178	0.186000	0.17326	GTC	.		0.667	AQP12A-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000257185.2	NM_198998	
TMEM189-UBE2V1	387522	hgsc.bcm.edu	37	20	48770159	48770159	+	Missense_Mutation	SNP	T	T	C	rs232733		TCGA-OR-A5KY-01A-11D-A29I-10	TCGA-OR-A5KY-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	72f9e1d9-c852-423a-94ff-17f763fa2713	f6e93da3-9ee7-4a65-bc04-30f8bb730eef	g.chr20:48770159T>C	ENST00000341698.2	-	1	15	c.16A>G	c.(16-18)Aac>Gac	p.N6D	TMEM189_ENST00000371650.5_Missense_Mutation_p.N6D|TMEM189_ENST00000557021.1_Missense_Mutation_p.N6D|TMEM189_ENST00000371652.4_Missense_Mutation_p.N6D	NM_001257399.1	NP_001244328.1			TMEM189-UBE2V1 readthrough											breast(1)|endometrium(4)|large_intestine(6)|lung(6)	17			BRCA - Breast invasive adenocarcinoma(9;8.29e-07)			CCCGGCCAGTTCTCGGCGCCC	0.766													C|||	5008	1.0	1.0	1.0	5008	,	,		6103	1.0		1.0	False		,,,				2504	1.0				p.N6D		.											.	TMEM189-22	0			c.A16G						.						2.0	2.0	2.0					20																	48770159		1101	2248	3349	SO:0001583	missense	387521	exon1			GCCAGTTCTCGGC	U39361	CCDS13424.1	20q13.13	2011-05-31			ENSG00000124208	ENSG00000124208			33521	other	readthrough						11076860	Standard	NM_199203		Approved	Kua-UEV, CROC-1B	uc002xvf.3		OTTHUMG00000033085	ENST00000341698.2:c.16A>G	20.37:g.48770159T>C	ENSP00000344166:p.Asn6Asp	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	6	6	NM_199129	0	0	0	1	1		Missense_Mutation	SNP	ENST00000341698.2	37	CCDS13424.1	2182	0.9990842490842491	492	1.0	360	0.994475138121547	572	1.0	758	1.0	C	0.054	-1.242740	0.01481	.	.	ENSG00000124208;ENSG00000240849;ENSG00000240849;ENSG00000240849	ENST00000341698;ENST00000557021;ENST00000371650;ENST00000371652	T;T;T;T	0.46819	0.86;0.86;1.11;1.11	3.81	0.707	0.18139	.	.	.	.	.	T	0.00012	0.0000	N	0.08118	0	0.80722	P	0.0	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.01281	0.0;0.0;0.0	T	0.40757	-0.9546	8	0.02654	T	1	.	3.4688	0.07559	0.1731:0.5239:0.0:0.303	rs232733;rs674252;rs56654084	6;6;6	Q5TGE1;A5PLL7;G3V2F7	.;TM189_HUMAN;.	D	6	ENSP00000344166:N6D;ENSP00000450635:N6D;ENSP00000360713:N6D;ENSP00000360715:N6D	ENSP00000360713:N6D	N	-	1	0	TMEM189-UBE2V1;TMEM189	48203566	1.000000	0.71417	0.503000	0.27626	0.073000	0.16967	0.497000	0.22514	-0.274000	0.09232	-2.268000	0.00277	AAC	C|0.999;T|0.001		0.766	TMEM189-UBE2V1-001	KNOWN	basic|appris_principal|readthrough_transcript|CCDS	protein_coding	protein_coding	OTTHUMT00000080532.5		
ZNF217	7764	bcgsc.ca	37	20	52193088	52193088	+	Missense_Mutation	SNP	C	C	T	rs6063966	byFrequency	TCGA-OR-A5KY-01A-11D-A29I-10	TCGA-OR-A5KY-10A-01D-A29L-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	72f9e1d9-c852-423a-94ff-17f763fa2713	f6e93da3-9ee7-4a65-bc04-30f8bb730eef	g.chr20:52193088C>T	ENST00000371471.2	-	4	2640	c.2215G>A	c.(2215-2217)Gtt>Att	p.V739I	RP4-724E16.2_ENST00000424252.1_RNA|ZNF217_ENST00000302342.3_Missense_Mutation_p.V739I			O75362	ZN217_HUMAN	zinc finger protein 217	739			V -> I (in dbSNP:rs6063966).		negative regulation of transcription, DNA-templated (GO:0045892)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	histone deacetylase complex (GO:0000118)|nucleoplasm (GO:0005654)	metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)	p.V739I(1)		NS(1)|breast(3)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(13)|lung(17)|ovary(1)|prostate(4)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	50	all_cancers(1;6.75e-17)|all_epithelial(1;1.76e-18)|Breast(2;3.83e-14)|Lung NSC(4;9.04e-07)|all_lung(4;2.5e-06)|Ovarian(1;0.0398)		BRCA - Breast invasive adenocarcinoma(1;9.88e-17)|Epithelial(1;1.56e-14)|all cancers(1;9.44e-13)|STAD - Stomach adenocarcinoma(23;0.0474)|Colorectal(105;0.198)			TTTTTATGAACGTCAGGATTG	0.438													C|||	785	0.156749	0.2602	0.1066	5008	,	,		19555	0.0833		0.1203	False		,,,				2504	0.1656				p.V739I		.											.	ZNF217-723	1	Substitution - Missense(1)	stomach(1)	c.G2215A						.	C	ILE/VAL	931,3475	356.4+/-313.5	107,717,1379	75.0	77.0	76.0		2215	-9.8	0.0	20	dbSNP_114	76	1060,7540	224.1+/-260.6	59,942,3299	yes	missense	ZNF217	NM_006526.2	29	166,1659,4678	TT,TC,CC		12.3256,21.1303,15.3083	benign	739/1049	52193088	1991,11015	2203	4300	6503	SO:0001583	missense	7764	exon3			TATGAACGTCAGG	AF041259	CCDS13443.1	20q13.2	2013-01-08			ENSG00000171940	ENSG00000171940		"""Zinc fingers, C2H2-type"""	13009	protein-coding gene	gene with protein product		602967				9671742	Standard	NM_006526		Approved	ZABC1	uc002xwq.4	O75362	OTTHUMG00000032764	ENST00000371471.2:c.2215G>A	20.37:g.52193088C>T	ENSP00000360526:p.Val739Ile	Somatic	92	0		WXS	Illumina GAIIx	Phase_I	128	5	NM_006526	0	0	0	0	0	E1P5Y6|Q14DB8	Missense_Mutation	SNP	ENST00000371471.2	37	CCDS13443.1	296	0.13553113553113552	138	0.2804878048780488	41	0.1132596685082873	33	0.057692307692307696	84	0.11081794195250659	C	3.852	-0.031630	0.07543	0.211303	0.123256	ENSG00000171940	ENST00000371471;ENST00000302342	T;T	0.09445	2.98;2.98	5.45	-9.83	0.00482	.	2.230010	0.01570	N	0.020552	T	0.00012	0.0000	N	0.03967	-0.31	0.80722	P	0.0	B	0.13145	0.007	B	0.04013	0.001	T	0.36089	-0.9762	9	0.11182	T	0.66	-0.48	4.7667	0.13135	0.0985:0.4318:0.2022:0.2675	rs6063966;rs16998239;rs60939286;rs6063966	739	O75362	ZN217_HUMAN	I	739	ENSP00000360526:V739I;ENSP00000304308:V739I	ENSP00000304308:V739I	V	-	1	0	ZNF217	51626495	0.000000	0.05858	0.000000	0.03702	0.011000	0.07611	-0.738000	0.04871	-2.542000	0.00485	-0.300000	0.09419	GTT	C|0.859;T|0.141		0.438	ZNF217-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079757.2	NM_006526	
POTED	317754	bcgsc.ca	37	21	15011924	15011924	+	Nonsense_Mutation	SNP	C	C	T			TCGA-OR-A5KY-01A-11D-A29I-10	TCGA-OR-A5KY-10A-01D-A29L-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	72f9e1d9-c852-423a-94ff-17f763fa2713	f6e93da3-9ee7-4a65-bc04-30f8bb730eef	g.chr21:15011924C>T	ENST00000299443.5	+	10	1550	c.1498C>T	c.(1498-1500)Cag>Tag	p.Q500*		NM_174981.3|NM_207355.2	NP_778146.2|NP_997238.2	Q86YR6	POTED_HUMAN	POTE ankyrin domain family, member D	500						plasma membrane (GO:0005886)				central_nervous_system(1)|large_intestine(10)|liver(2)|lung(8)|ovary(4)|pancreas(1)|prostate(1)|skin(5)|stomach(1)	33						TAAACAAAAGCAGATAGAAGT	0.294																																					p.Q500X		.											.	POTED-74	0			c.C1498T						.						4.0	5.0	5.0					21																	15011924		770	2706	3476	SO:0001587	stop_gained	317754	exon10			CAAAAGCAGATAG	AY172978	CCDS13562.1	21q11.2	2013-01-10	2008-11-26	2008-11-26	ENSG00000166351	ENSG00000166351		"""POTE ankyrin domain containing"", ""Ankyrin repeat domain containing"""	23822	protein-coding gene	gene with protein product	"""cancer/testis antigen family 104, member 1"""	607549	"""ankyrin repeat domain 21"", ""ANKRD26-like family B, member 3"""	ANKRD21, A26B3		12475935, 15276201, 16364570	Standard	NM_174981		Approved	POTE, POTE-21, POTE21, CT104.1	uc002yjb.1	Q86YR6	OTTHUMG00000074197	ENST00000299443.5:c.1498C>T	21.37:g.15011924C>T	ENSP00000299443:p.Gln500*	Somatic	167	0		WXS	Illumina GAIIx	Phase_I	190	91	NM_174981	0	0	0	0	0	C9JCF7	Nonsense_Mutation	SNP	ENST00000299443.5	37	CCDS13562.1	.	.	.	.	.	.	.	.	.	.	C	13.20	2.166066	0.38217	.	.	ENSG00000166351	ENST00000299443	.	.	.	1.86	-0.294	0.12831	.	.	.	.	.	.	.	.	.	.	.	0.42803	D	0.99393	.	.	.	.	.	.	.	.	.	.	0.22109	T	0.4	.	3.0865	0.06279	0.1961:0.2911:0.5128:0.0	.	.	.	.	X	500	.	ENSP00000299443:Q500X	Q	+	1	0	POTED	13933795	0.998000	0.40836	0.000000	0.03702	0.002000	0.02628	2.167000	0.42415	-0.258000	0.09446	-0.851000	0.03033	CAG	.		0.294	POTED-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000157660.1	NM_174981	
OLIG1	116448	hgsc.bcm.edu	37	21	34443344	34443344	+	Silent	SNP	C	C	A	rs369461854	byFrequency	TCGA-OR-A5KY-01A-11D-A29I-10	TCGA-OR-A5KY-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	72f9e1d9-c852-423a-94ff-17f763fa2713	f6e93da3-9ee7-4a65-bc04-30f8bb730eef	g.chr21:34443344C>A	ENST00000382348.1	+	1	895	c.792C>A	c.(790-792)gcC>gcA	p.A264A	AP000282.2_ENST00000420356.1_RNA|OLIG1_ENST00000333063.5_Silent_p.A248A|AP000282.2_ENST00000454622.1_RNA	NM_138983.2	NP_620450.2	Q8TAK6	OLIG1_HUMAN	oligodendrocyte transcription factor 1	264					neuron fate commitment (GO:0048663)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)			central_nervous_system(1)	1						GCCTGGCCGCCGTGCAGGCGC	0.761													C|||	10	0.00199681	0.0	0.0029	5008	,	,		8103	0.0		0.008	False		,,,				2504	0.0				p.A264A		.											.	OLIG1-446	0			c.C792A						.	C		2,2464		0,2,1231	2.0	2.0	2.0		792	-8.4	0.4	21		2	11,5829		0,11,2909	no	coding-synonymous	OLIG1	NM_138983.2		0,13,4140	AA,AC,CC		0.1884,0.0811,0.1565		264/272	34443344	13,8293	1233	2920	4153	SO:0001819	synonymous_variant	116448	exon1			GGCCGCCGTGCAG	AP000109	CCDS42920.1, CCDS42920.2	21q22.11	2013-05-21			ENSG00000184221	ENSG00000184221		"""Basic helix-loop-helix proteins"""	16983	protein-coding gene	gene with protein product	"""oligodendrocyte-specific bHLH transcription factor 1"", ""oligodendrocyte lineage transcription factor 1"", ""basic domain, helix-loop-helix protein, class B, 6"""	606385				11526205	Standard	NM_138983		Approved	BHLHB6, bHLHe21	uc002yqz.3	Q8TAK6	OTTHUMG00000065064	ENST00000382348.1:c.792C>A	21.37:g.34443344C>A		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	28	15	NM_138983	0	0	0	0	0	Q7RTS0	Silent	SNP	ENST00000382348.1	37	CCDS42920.2	.	.	.	.	.	.	.	.	.	.	C	10.27	1.302564	0.23736	8.11E-4	0.001884	ENSG00000184221	ENST00000426947	.	.	.	4.38	-8.41	0.00961	.	.	.	.	.	T	0.59059	0.2166	.	.	.	0.54753	D	0.999985	.	.	.	.	.	.	T	0.65869	-0.6063	4	.	.	.	.	13.8352	0.63404	0.0:0.1085:0.6574:0.2341	.	.	.	.	Q	25	.	.	P	+	2	0	OLIG1	33365214	0.001000	0.12720	0.383000	0.26132	0.980000	0.70556	-1.725000	0.01863	-1.302000	0.02335	-0.674000	0.03794	CCG	.		0.761	OLIG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000139730.1	NM_138983	
CLIC6	54102	hgsc.bcm.edu	37	21	36042579	36042579	+	Missense_Mutation	SNP	C	C	G	rs13049028	byFrequency	TCGA-OR-A5KY-01A-11D-A29I-10	TCGA-OR-A5KY-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	72f9e1d9-c852-423a-94ff-17f763fa2713	f6e93da3-9ee7-4a65-bc04-30f8bb730eef	g.chr21:36042579C>G	ENST00000360731.3	+	1	892	c.892C>G	c.(892-894)Caa>Gaa	p.Q298E	CLIC6_ENST00000349499.2_Missense_Mutation_p.Q298E			Q96NY7	CLIC6_HUMAN	chloride intracellular channel 6	298						chloride channel complex (GO:0034707)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	voltage-gated chloride channel activity (GO:0005247)			breast(1)|central_nervous_system(2)|endometrium(2)|kidney(3)|large_intestine(2)|lung(2)|ovary(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	19						TGAGCCGCAGCAATCGGGGGA	0.756													G|||	1116	0.222843	0.2648	0.1657	5008	,	,		8796	0.1825		0.2137	False		,,,				2504	0.2577				p.Q298E		.											.	CLIC6-91	0			c.C892G						.	G	GLU/GLN	454,2348		41,372,988	2.0	2.0	2.0		892	-0.8	0.0	21	dbSNP_121	2	925,5025		74,777,2124	no	missense	CLIC6	NM_053277.1	29	115,1149,3112	GG,GC,CC		15.5462,16.2027,15.7564	benign	298/687	36042579	1379,7373	1401	2975	4376	SO:0001583	missense	54102	exon1			CCGCAGCAATCGG	AF426169	CCDS13638.1	21q22.12	2012-09-26			ENSG00000159212	ENSG00000159212		"""Ion channels / Chloride channels : Intracellular"""	2065	protein-coding gene	gene with protein product		615321		CLIC1L		10830953	Standard	NM_053277		Approved	CLIC5	uc002yuf.1	Q96NY7	OTTHUMG00000086237	ENST00000360731.3:c.892C>G	21.37:g.36042579C>G	ENSP00000353959:p.Gln298Glu	Somatic	2	0		WXS	Illumina GAIIx	Phase_I	37	29	NM_053277	0	0	0	0	0	A8K0U8|Q8IX31	Missense_Mutation	SNP	ENST00000360731.3	37		434	0.1987179487179487	125	0.2540650406504065	63	0.17403314917127072	81	0.14160839160839161	165	0.21767810026385223	G	0.195	-1.050076	0.01981	0.162027	0.155462	ENSG00000159212	ENST00000360731;ENST00000349499	T;T	0.21361	2.02;2.01	3.75	-0.792	0.10925	.	.	.	.	.	T	0.00012	0.0000	N	0.02539	-0.55	0.80722	P	0.0	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.43861	-0.9365	8	0.02654	T	1	-10.3162	7.3436	0.26650	0.1642:0.3831:0.4527:0.0	rs13049028	298;298	Q96NY7;Q96NY7-2	CLIC6_HUMAN;.	E	298	ENSP00000353959:Q298E;ENSP00000290332:Q298E	ENSP00000290332:Q298E	Q	+	1	0	CLIC6	34964449	0.256000	0.24012	0.012000	0.15200	0.009000	0.06853	0.804000	0.27098	-0.082000	0.12640	-0.676000	0.03789	CAA	C|0.802;G|0.198		0.756	CLIC6-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000194156.1		
CLIC6	54102	hgsc.bcm.edu	37	21	36042584	36042584	+	Silent	SNP	G	G	A	rs13049239	byFrequency	TCGA-OR-A5KY-01A-11D-A29I-10	TCGA-OR-A5KY-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	72f9e1d9-c852-423a-94ff-17f763fa2713	f6e93da3-9ee7-4a65-bc04-30f8bb730eef	g.chr21:36042584G>A	ENST00000360731.3	+	1	897	c.897G>A	c.(895-897)tcG>tcA	p.S299S	CLIC6_ENST00000349499.2_Silent_p.S299S			Q96NY7	CLIC6_HUMAN	chloride intracellular channel 6	299						chloride channel complex (GO:0034707)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	voltage-gated chloride channel activity (GO:0005247)			breast(1)|central_nervous_system(2)|endometrium(2)|kidney(3)|large_intestine(2)|lung(2)|ovary(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	19						CGCAGCAATCGGGGGACGGCA	0.751													A|||	1101	0.219848	0.2549	0.1628	5008	,	,		9144	0.1825		0.2137	False		,,,				2504	0.2577				p.S299S		.											.	CLIC6-91	0			c.G897A						.	A		412,2410		18,376,1017	2.0	2.0	2.0		897	-0.2	0.0	21	dbSNP_121	2	842,5136		42,758,2189	no	coding-synonymous	CLIC6	NM_053277.1		60,1134,3206	AA,AG,GG		14.085,14.5996,14.25		299/687	36042584	1254,7546	1411	2989	4400	SO:0001819	synonymous_variant	54102	exon1			GCAATCGGGGGAC	AF426169	CCDS13638.1	21q22.12	2012-09-26			ENSG00000159212	ENSG00000159212		"""Ion channels / Chloride channels : Intracellular"""	2065	protein-coding gene	gene with protein product		615321		CLIC1L		10830953	Standard	NM_053277		Approved	CLIC5	uc002yuf.1	Q96NY7	OTTHUMG00000086237	ENST00000360731.3:c.897G>A	21.37:g.36042584G>A		Somatic	2	0		WXS	Illumina GAIIx	Phase_I	38	30	NM_053277	0	0	0	0	0	A8K0U8|Q8IX31	Silent	SNP	ENST00000360731.3	37																																																																																				G|0.803;A|0.197		0.751	CLIC6-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000194156.1		
SCARF2	91179	hgsc.bcm.edu	37	22	20780091	20780091	+	Silent	SNP	C	C	G	rs759610		TCGA-OR-A5KY-01A-11D-A29I-10	TCGA-OR-A5KY-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	72f9e1d9-c852-423a-94ff-17f763fa2713	f6e93da3-9ee7-4a65-bc04-30f8bb730eef	g.chr22:20780091C>G	ENST00000266214.5	-	11	2291	c.2187G>C	c.(2185-2187)ccG>ccC	p.P729P	SCARF2_ENST00000405555.3_Silent_p.P724P	NM_153334.4	NP_699165.2	Q96GP6	SREC2_HUMAN	scavenger receptor class F, member 2	729	Pro-rich.				cell adhesion (GO:0007155)	focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)				breast(1)|central_nervous_system(1)|kidney(1)|large_intestine(1)|lung(3)|prostate(1)|skin(2)	10	Melanoma(16;0.000465)|Ovarian(15;0.00167)|Colorectal(54;0.0221)|all_neural(72;0.219)	Lung SC(17;0.0262)	LUSC - Lung squamous cell carcinoma(15;0.00102)|Lung(15;0.0173)			CGGGCAGCCCCGGGGGGCGCG	0.781																																					p.P729P		.											.	SCARF2-341	0			c.G2187C						.	G	,	3110,60		1525,60,0	4.0	5.0	4.0		2187,2172	-6.8	0.1	22	dbSNP_86	4	5974,118		2928,118,0	no	coding-synonymous,coding-synonymous	SCARF2	NM_153334.4,NM_182895.2	,	4453,178,0	GG,GC,CC		1.937,1.8927,1.9218	,	729/871,724/866	20780091	9084,178	1585	3046	4631	SO:0001819	synonymous_variant	91179	exon11			CAGCCCCGGGGGG	AF522196	CCDS13779.1, CCDS46666.1	22q11.21	2011-10-10			ENSG00000244486	ENSG00000244486			19869	protein-coding gene	gene with protein product		613619				12154095	Standard	XM_006724364		Approved	SREC-II, SREC2, HUMZD58C02	uc002zsk.2	Q96GP6	OTTHUMG00000150779	ENST00000266214.5:c.2187G>C	22.37:g.20780091C>G		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	10	10	NM_153334	0	0	0	0	0	E5RFB8|Q58A83|Q8IXF3|Q9BW74	Silent	SNP	ENST00000266214.5	37	CCDS13779.1																																																																																			C|0.138;G|0.862		0.781	SCARF2-001	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000320047.1		
SCARF2	91179	hgsc.bcm.edu	37	22	20780097	20780097	+	Silent	SNP	G	G	C	rs759609		TCGA-OR-A5KY-01A-11D-A29I-10	TCGA-OR-A5KY-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	72f9e1d9-c852-423a-94ff-17f763fa2713	f6e93da3-9ee7-4a65-bc04-30f8bb730eef	g.chr22:20780097G>C	ENST00000266214.5	-	11	2285	c.2181C>G	c.(2179-2181)cgC>cgG	p.R727R	SCARF2_ENST00000405555.3_Silent_p.R722R	NM_153334.4	NP_699165.2	Q96GP6	SREC2_HUMAN	scavenger receptor class F, member 2	727	Pro-rich.				cell adhesion (GO:0007155)	focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)				breast(1)|central_nervous_system(1)|kidney(1)|large_intestine(1)|lung(3)|prostate(1)|skin(2)	10	Melanoma(16;0.000465)|Ovarian(15;0.00167)|Colorectal(54;0.0221)|all_neural(72;0.219)	Lung SC(17;0.0262)	LUSC - Lung squamous cell carcinoma(15;0.00102)|Lung(15;0.0173)			GCCCCGGGGGGCGCGGCGTTG	0.781																																					p.R727R		.											.	SCARF2-341	0			c.C2181G						.	C	,	3271,119		1585,101,9	5.0	5.0	5.0		2181,2166	-5.3	0.0	22	dbSNP_86	5	6306,190		3060,186,2	no	coding-synonymous,coding-synonymous	SCARF2	NM_153334.4,NM_182895.2	,	4645,287,11	CC,CG,GG		2.9249,3.5103,3.1256	,	727/871,722/866	20780097	9577,309	1695	3248	4943	SO:0001819	synonymous_variant	91179	exon11			CGGGGGGCGCGGC	AF522196	CCDS13779.1, CCDS46666.1	22q11.21	2011-10-10			ENSG00000244486	ENSG00000244486			19869	protein-coding gene	gene with protein product		613619				12154095	Standard	XM_006724364		Approved	SREC-II, SREC2, HUMZD58C02	uc002zsk.2	Q96GP6	OTTHUMG00000150779	ENST00000266214.5:c.2181C>G	22.37:g.20780097G>C		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	10	10	NM_153334	0	0	0	0	0	E5RFB8|Q58A83|Q8IXF3|Q9BW74	Silent	SNP	ENST00000266214.5	37	CCDS13779.1																																																																																			G|0.826;C|0.174		0.781	SCARF2-001	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000320047.1		
MYO18B	84700	bcgsc.ca	37	22	26159289	26159289	+	Missense_Mutation	SNP	G	G	A	rs133885	byFrequency	TCGA-OR-A5KY-01A-11D-A29I-10	TCGA-OR-A5KY-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	72f9e1d9-c852-423a-94ff-17f763fa2713	f6e93da3-9ee7-4a65-bc04-30f8bb730eef	g.chr22:26159289G>A	ENST00000407587.2	+	3	300	c.131G>A	c.(130-132)gGg>gAg	p.G44E	MYO18B_ENST00000536101.1_Missense_Mutation_p.G44E|MYO18B_ENST00000335473.7_Missense_Mutation_p.G44E			Q8IUG5	MY18B_HUMAN	myosin XVIIIB	44			G -> E (in dbSNP:rs133885).			cytoplasm (GO:0005737)|nucleus (GO:0005634)|unconventional myosin complex (GO:0016461)	ATP binding (GO:0005524)|motor activity (GO:0003774)			NS(2)|breast(6)|central_nervous_system(3)|endometrium(12)|haematopoietic_and_lymphoid_tissue(4)|kidney(5)|large_intestine(27)|liver(2)|lung(60)|ovary(7)|prostate(8)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(2)	146						CTGGTCCGGGGGACTGAAAAA	0.552													A|||	3514	0.701677	0.9221	0.6585	5008	,	,		19596	0.8185		0.4374	False		,,,				2504	0.5859				p.G44E		.											.	MYO18B-142	0			c.G131A	GRCh37	CM065332	MYO18B	M	rs133885	.	A	GLU/GLY	3219,589		1371,477,56	36.0	37.0	37.0		131	5.1	1.0	22	dbSNP_78	37	3665,4585		810,2045,1270	yes	missense	MYO18B	NM_032608.5	98	2181,2522,1326	AA,AG,GG		44.4242,15.4674,42.9093	benign	44/2568	26159289	6884,5174	1904	4125	6029	SO:0001583	missense	84700	exon3			TCCGGGGGACTGA	AJ310931	CCDS54507.1	22q12.1	2011-09-27			ENSG00000133454	ENSG00000133454		"""Myosins / Myosin superfamily : Class XVIII"""	18150	protein-coding gene	gene with protein product		607295				12209013, 12547197	Standard	NM_032608		Approved	BK125H2.1	uc003abz.1	Q8IUG5	OTTHUMG00000151129	ENST00000407587.2:c.131G>A	22.37:g.26159289G>A	ENSP00000386096:p.Gly44Glu	Somatic	58	0		WXS	Illumina GAIIx	Phase_I	85	4	NM_032608	0	0	0	0	0	B2RWP3|F5GYU7|Q8NDI8|Q8TE65|Q8WWS0|Q96KH2|Q96KR8|Q96KR9	Missense_Mutation	SNP	ENST00000407587.2	37		1489	0.6817765567765568	436	0.8861788617886179	237	0.6546961325966851	482	0.8426573426573427	334	0.44063324538258575	A	4.637	0.118450	0.08881	0.845326	0.444242	ENSG00000133454	ENST00000536101;ENST00000335473;ENST00000407587	T;T;T	0.80653	-1.38;-1.38;-1.4	5.09	5.09	0.68999	.	0.000000	0.40554	N	0.001076	T	0.00012	0.0000	N	0.00104	-2.125	0.45150	P	0.001835000000000031	B	0.02656	0.0	B	0.01281	0.0	T	0.42949	-0.9421	9	0.02654	T	1	.	8.8503	0.35194	0.9131:0.0:0.0869:0.0	rs133885;rs17697137;rs57973156;rs133885	44	F5GYU7	.	E	44	ENSP00000441229:G44E;ENSP00000334563:G44E;ENSP00000386096:G44E	ENSP00000334563:G44E	G	+	2	0	MYO18B	24489289	1.000000	0.71417	1.000000	0.80357	0.936000	0.57629	3.620000	0.54203	0.892000	0.36259	-0.516000	0.04426	GGG	G|0.307;A|0.693		0.552	MYO18B-006	NOVEL	non_canonical_conserved|basic|appris_candidate_longest|exp_conf	protein_coding	protein_coding	OTTHUMT00000400691.1	NM_032608	
ZNRF3	84133	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	22	29439356	29439372	+	Frame_Shift_Del	DEL	CTGATGAACATCGTCAA	CTGATGAACATCGTCAA	-			TCGA-OR-A5KY-01A-11D-A29I-10	TCGA-OR-A5KY-10A-01D-A29L-10	CTGATGAACATCGTCAA	CTGATGAACATCGTCAA	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	72f9e1d9-c852-423a-94ff-17f763fa2713	f6e93da3-9ee7-4a65-bc04-30f8bb730eef	g.chr22:29439356_29439372delCTGATGAACATCGTCAA	ENST00000544604.2	+	4	746_762	c.571_587delCTGATGAACATCGTCAA	c.(571-588)ctgatgaacatcgtcaacfs	p.LMNIVN191fs	ZNRF3_ENST00000406323.3_Frame_Shift_Del_p.LMNIVN91fs|ZNRF3_ENST00000402174.1_Frame_Shift_Del_p.LMNIVN91fs|ZNRF3_ENST00000332811.4_Frame_Shift_Del_p.LMNIVN91fs	NM_001206998.1	NP_001193927.1	Q9ULT6	ZNRF3_HUMAN	zinc and ring finger 3	191					canonical Wnt signaling pathway (GO:0060070)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of non-canonical Wnt signaling pathway (GO:2000051)|protein ubiquitination (GO:0016567)|stem cell proliferation (GO:0072089)|ubiquitin-dependent protein catabolic process (GO:0006511)|Wnt receptor catabolic process (GO:0038018)|Wnt signaling pathway, planar cell polarity pathway (GO:0060071)	integral component of plasma membrane (GO:0005887)	frizzled binding (GO:0005109)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|liver(4)|lung(9)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)	28						TGCCATTAAGCTGATGAACATCGTCAACAAGCAGAAA	0.558																																					p.191_196del		.											.	ZNRF3-69	0			c.571_587del						.																																			SO:0001589	frameshift_variant	84133	exon4			ATTAAGCTGATGA	AB051436	CCDS42999.1, CCDS56225.1	22q12.1	2013-01-09			ENSG00000183579	ENSG00000183579		"""RING-type (C3HC4) zinc fingers"""	18126	protein-coding gene	gene with protein product		612062				10574461	Standard	NM_032173		Approved	KIAA1133, BK747E2.3, FLJ22057, RNF203	uc003aeg.3	Q9ULT6	OTTHUMG00000151009	ENST00000544604.2:c.571_587delCTGATGAACATCGTCAA	22.37:g.29439356_29439372delCTGATGAACATCGTCAA	ENSP00000443824:p.Leu191fs	Somatic	102	0		WXS	Illumina GAIIx	Phase_I	45	16	NM_001206998	0	0	0	0	0	B3KU18|Q6ICH1|Q6NTF8|Q8WU18	Frame_Shift_Del	DEL	ENST00000544604.2	37	CCDS56225.1																																																																																			.		0.558	ZNRF3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000320943.2	XM_290972	
RHOA	387	broad.mit.edu	37	3	49395503	49395503	+	IGR	SNP	C	C	A			TCGA-OR-A5KY-01A-11D-A29I-10	TCGA-OR-A5KY-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	72f9e1d9-c852-423a-94ff-17f763fa2713	f6e93da3-9ee7-4a65-bc04-30f8bb730eef	g.chr3:49395503C>A	ENST00000418115.1	-	0	2031				GPX1_ENST00000496791.1_5'UTR|GPX1_ENST00000419349.1_Missense_Mutation_p.G70V|GPX1_ENST00000419783.1_Missense_Mutation_p.G70V	NM_001664.2	NP_001655.1	P61586	RHOA_HUMAN	ras homolog family member A						actin cytoskeleton organization (GO:0030036)|androgen receptor signaling pathway (GO:0030521)|apical junction assembly (GO:0043297)|apolipoprotein A-I-mediated signaling pathway (GO:0038027)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell-matrix adhesion (GO:0007160)|cerebral cortex cell migration (GO:0021795)|cleavage furrow formation (GO:0036089)|forebrain radial glial cell differentiation (GO:0021861)|negative chemotaxis (GO:0050919)|negative regulation of axonogenesis (GO:0050771)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of intracellular steroid hormone receptor signaling pathway (GO:0033144)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of neuron differentiation (GO:0045665)|neurotrophin TRK receptor signaling pathway (GO:0048011)|ossification involved in bone maturation (GO:0043931)|phosphatidylinositol-mediated signaling (GO:0048015)|platelet activation (GO:0030168)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of axonogenesis (GO:0050772)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell growth (GO:0030307)|positive regulation of cell migration (GO:0030335)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of cytokinesis (GO:0032467)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of NF-kappaB import into nucleus (GO:0042346)|positive regulation of podosome assembly (GO:0071803)|positive regulation of smooth muscle contraction (GO:0045987)|positive regulation of stress fiber assembly (GO:0051496)|positive regulation of translation (GO:0045727)|positive regulation of vasoconstriction (GO:0045907)|regulation of axonogenesis (GO:0050770)|regulation of calcium ion transport (GO:0051924)|regulation of cell migration (GO:0030334)|regulation of dendrite development (GO:0050773)|regulation of neural precursor cell proliferation (GO:2000177)|regulation of osteoblast proliferation (GO:0033688)|regulation of small GTPase mediated signal transduction (GO:0051056)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to amino acid (GO:0043200)|response to drug (GO:0042493)|response to ethanol (GO:0045471)|response to glucocorticoid (GO:0051384)|response to glucose (GO:0009749)|response to hypoxia (GO:0001666)|response to mechanical stimulus (GO:0009612)|Rho protein signal transduction (GO:0007266)|skeletal muscle tissue development (GO:0007519)|small GTPase mediated signal transduction (GO:0007264)|spindle assembly involved in mitosis (GO:0090307)|stress fiber assembly (GO:0043149)|stress-activated protein kinase signaling cascade (GO:0031098)|substantia nigra development (GO:0021762)|trabecula morphogenesis (GO:0061383)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	apical junction complex (GO:0043296)|axon (GO:0030424)|cell cortex (GO:0005938)|cell junction (GO:0030054)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)	GDP binding (GO:0019003)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|myosin binding (GO:0017022)			cervix(1)|kidney(1)|large_intestine(5)|lung(1)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	12				BRCA - Breast invasive adenocarcinoma(193;8.58e-05)|Kidney(197;0.0023)|KIRC - Kidney renal clear cell carcinoma(197;0.00258)		CACCACCAGGCCCCGGGGTCC	0.697																																					.		.											.	GPX1-68	0			.						.						12.0	16.0	15.0					3																	49395503		1862	4073	5935	SO:0001628	intergenic_variant	2876	.			ACCAGGCCCCGGG	BC001360	CCDS2795.1	3p21.3	2012-02-27	2012-02-27	2004-03-23	ENSG00000067560	ENSG00000067560			667	protein-coding gene	gene with protein product		165390	"""ras homolog gene family, member A"""	ARH12, ARHA		9605859	Standard	NM_001664		Approved	RhoA, Rho12, RHOH12	uc003cwu.3	P61586	OTTHUMG00000156838		3.37:g.49395503C>A		Somatic	94	1		WXS	Illumina GAIIx	Phase_I	172	12	.	0	0	780	786	6	P06749|Q53HM4|Q5U024|Q9UDJ0|Q9UEJ4	Missense_Mutation	SNP	ENST00000418115.1	37	CCDS2795.1	.	.	.	.	.	.	.	.	.	.	C	29.4	5.006075	0.93287	.	.	ENSG00000233276	ENST00000419783;ENST00000419349	T;T	0.37058	3.13;1.22	5.88	5.0	0.66597	Thioredoxin-like fold (2);	0.055039	0.64402	D	0.000001	T	0.69260	0.3091	M	0.94142	3.5	0.80722	D	1	D;D	0.69078	0.997;0.989	D;D	0.67103	0.949;0.94	T	0.79813	-0.1645	10	0.87932	D	0	.	15.2504	0.73539	0.1414:0.8586:0.0:0.0	.	70;70	E9PAS1;P07203	.;GPX1_HUMAN	V	70	ENSP00000407375:G70V;ENSP00000391316:G70V	ENSP00000391316:G70V	G	-	2	0	GPX1	49370507	1.000000	0.71417	1.000000	0.80357	0.784000	0.44337	6.006000	0.70724	1.484000	0.48361	0.555000	0.69702	GGC	.		0.697	RHOA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346157.3	NM_001664	
LRIG1	26018	hgsc.bcm.edu	37	3	66550762	66550762	+	Missense_Mutation	SNP	G	G	C	rs1403626	byFrequency	TCGA-OR-A5KY-01A-11D-A29I-10	TCGA-OR-A5KY-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	72f9e1d9-c852-423a-94ff-17f763fa2713	f6e93da3-9ee7-4a65-bc04-30f8bb730eef	g.chr3:66550762G>C	ENST00000273261.3	-	1	594	c.70C>G	c.(70-72)Ctt>Gtt	p.L24V	LRIG1_ENST00000383703.3_Missense_Mutation_p.L24V	NM_015541.2	NP_056356.2	Q96JA1	LRIG1_HUMAN	leucine-rich repeats and immunoglobulin-like domains 1	24			L -> V (in dbSNP:rs1403626).	LLL -> VLV (in Ref. 1; AAK62357 and 3; AAH71561). {ECO:0000305}.	innervation (GO:0060384)|otolith morphogenesis (GO:0032474)|sensory perception of sound (GO:0007605)	integral component of membrane (GO:0016021)				NS(2)|breast(2)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(7)|lung(12)|ovary(3)|prostate(1)|skin(4)|stomach(4)|urinary_tract(1)	42		Lung NSC(201;0.0101)		BRCA - Breast invasive adenocarcinoma(55;0.00047)		CGAAGCAAAAGCAGCCAGAGA	0.766													g|||	3605	0.719848	0.1808	0.8833	5008	,	,		8368	0.8284		0.9732	False		,,,				2504	0.9601				p.L24V		.											.	LRIG1-230	0			c.C70G						.		VAL/LEU	1309,1447		265,779,334	3.0	4.0	4.0		70	3.1	0.5	3	dbSNP_88	4	5325,93		2620,85,4	no	missense	LRIG1	NM_015541.2	32	2885,864,338	CC,CG,GG		1.7165,47.4964,18.8402	benign	24/1094	66550762	6634,1540	1378	2709	4087	SO:0001583	missense	26018	exon1			GCAAAAGCAGCCA	AB050468	CCDS33783.1	3p14	2013-01-14			ENSG00000144749	ENSG00000144749		"""Immunoglobulin superfamily / I-set domain containing"""	17360	protein-coding gene	gene with protein product	"""ortholog of mouse integral membrane glycoprotein LIG-1"", ""leucine-rich repeat protein LRIG1"""	608868				11414704, 12234026	Standard	NM_015541		Approved	LIG-1, DKFZP586O1624, LIG1	uc003dmx.3	Q96JA1	OTTHUMG00000158727	ENST00000273261.3:c.70C>G	3.37:g.66550762G>C	ENSP00000273261:p.Leu24Val	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	4	4	NM_015541	0	0	0	0	0	Q6IQ51|Q96CF9|Q9BYB8|Q9UFI4	Missense_Mutation	SNP	ENST00000273261.3	37	CCDS33783.1	1670	0.7646520146520146	119	0.241869918699187	326	0.9005524861878453	488	0.8531468531468531	737	0.9722955145118733	g	9.592	1.126319	0.20959	0.474964	0.982835	ENSG00000144749	ENST00000273261;ENST00000383703	T;T	0.68765	-0.35;-0.2	3.11	3.11	0.35812	.	0.429988	0.15146	U	0.278020	T	0.00012	0.0000	N	0.19112	0.55	0.39998	P	0.024872000000000005	P;B	0.36282	0.546;0.282	B;B	0.32465	0.146;0.069	T	0.40572	-0.9556	9	0.23891	T	0.37	.	12.0321	0.53403	0.0:0.0:1.0:0.0	rs1403626;rs13083630;rs1403626	24;24	Q96JA1-2;Q96JA1	.;LRIG1_HUMAN	V	24	ENSP00000273261:L24V;ENSP00000373208:L24V	ENSP00000273261:L24V	L	-	1	0	LRIG1	66633452	.	.	0.546000	0.28166	0.017000	0.09413	.	.	1.734000	0.51633	0.472000	0.43445	CTT	G|0.252;C|0.748		0.766	LRIG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351930.1	NM_015541	
FRMD4B	23150	broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	69246086	69246086	+	Missense_Mutation	SNP	G	G	T			TCGA-OR-A5KY-01A-11D-A29I-10	TCGA-OR-A5KY-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	72f9e1d9-c852-423a-94ff-17f763fa2713	f6e93da3-9ee7-4a65-bc04-30f8bb730eef	g.chr3:69246086G>T	ENST00000398540.3	-	13	1140	c.1057C>A	c.(1057-1059)Cag>Aag	p.Q353K	FRMD4B_ENST00000478263.1_Missense_Mutation_p.Q5K|FRMD4B_ENST00000542259.1_Missense_Mutation_p.Q299K	NM_015123.1	NP_055938	Q9Y2L6	FRM4B_HUMAN	FERM domain containing 4B	353	FERM. {ECO:0000255|PROSITE- ProRule:PRU00084}.				establishment of epithelial cell polarity (GO:0090162)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular space (GO:0005615)|ruffle (GO:0001726)				NS(2)|central_nervous_system(2)|endometrium(1)|kidney(2)|large_intestine(3)|lung(1)|ovary(3)|prostate(3)|skin(2)	19		Lung NSC(201;0.0138)|Prostate(884;0.11)		BRCA - Breast invasive adenocarcinoma(55;0.000201)|Epithelial(33;0.00141)|LUSC - Lung squamous cell carcinoma(21;0.00999)|Lung(16;0.0182)		AACTGATGCTGACTAATTGCC	0.408																																					p.Q353K		.											.	FRMD4B-72	0			c.C1057A						.						103.0	99.0	100.0					3																	69246086		1902	4132	6034	SO:0001583	missense	23150	exon13			GATGCTGACTAAT	AL832231	CCDS46863.1	3p14.2	2006-04-12			ENSG00000114541	ENSG00000114541			24886	protein-coding gene	gene with protein product						10231032, 11445584	Standard	XM_005264720		Approved	KIAA1013, GRSP1	uc003dnv.2	Q9Y2L6	OTTHUMG00000158772	ENST00000398540.3:c.1057C>A	3.37:g.69246086G>T	ENSP00000381549:p.Gln353Lys	Somatic	152	1		WXS	Illumina GAIIx	Phase_I	118	36	NM_015123	0	0	1	1	0	Q8TAI3	Missense_Mutation	SNP	ENST00000398540.3	37	CCDS46863.1	.	.	.	.	.	.	.	.	.	.	G	35	5.413963	0.96072	.	.	ENSG00000114541	ENST00000398540;ENST00000542259;ENST00000478263;ENST00000462512;ENST00000489817	D;D;D	0.83075	-1.68;-1.68;-1.68	5.9	5.9	0.94986	FERM, C-terminal PH-like domain (1);FERM domain (1);Pleckstrin homology-type (1);	0.000000	0.85682	D	0.000000	D	0.91676	0.7369	M	0.77103	2.36	0.80722	D	1	D;D	0.76494	0.999;0.996	D;D	0.81914	0.995;0.968	D	0.91520	0.5234	10	0.66056	D	0.02	-20.4802	20.27	0.98469	0.0:0.0:1.0:0.0	.	197;353	B4DHD5;Q9Y2L6	.;FRM4B_HUMAN	K	353;299;5;64;5	ENSP00000381549:Q353K;ENSP00000437658:Q299K;ENSP00000419869:Q64K	ENSP00000381549:Q353K	Q	-	1	0	FRMD4B	69328776	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	9.864000	0.99589	2.790000	0.95986	0.650000	0.86243	CAG	.		0.408	FRMD4B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352111.1		
CNTN3	5067	bcgsc.ca	37	3	74413676	74413676	+	Silent	SNP	T	T	C	rs6549590	byFrequency	TCGA-OR-A5KY-01A-11D-A29I-10	TCGA-OR-A5KY-10A-01D-A29L-10	T	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	72f9e1d9-c852-423a-94ff-17f763fa2713	f6e93da3-9ee7-4a65-bc04-30f8bb730eef	g.chr3:74413676T>C	ENST00000263665.6	-	9	1182	c.1155A>G	c.(1153-1155)caA>caG	p.Q385Q		NM_020872.1	NP_065923.1	Q9P232	CNTN3_HUMAN	contactin 3 (plasmacytoma associated)	385	Ig-like C2-type 4.				cell adhesion (GO:0007155)|nervous system development (GO:0007399)	anchored component of membrane (GO:0031225)|plasma membrane (GO:0005886)				NS(2)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(14)|lung(39)|ovary(1)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	83		Lung NSC(201;0.138)|Lung SC(41;0.21)		Epithelial(33;0.00212)|BRCA - Breast invasive adenocarcinoma(55;0.00258)|LUSC - Lung squamous cell carcinoma(21;0.00461)|Lung(16;0.01)		CTGCTATGCATTGGAACATGC	0.358													T|||	2254	0.45008	0.3147	0.5173	5008	,	,		17968	0.4653		0.5586	False		,,,				2504	0.4581				p.Q385Q		.											.	CNTN3-137	0			c.A1155G						.	T		1454,2952	469.8+/-355.6	236,982,985	200.0	179.0	186.0		1155	0.1	1.0	3	dbSNP_116	186	4690,3910	605.8+/-395.0	1290,2110,900	no	coding-synonymous	CNTN3	NM_020872.1		1526,3092,1885	CC,CT,TT		45.4651,33.0005,47.2397		385/1029	74413676	6144,6862	2203	4300	6503	SO:0001819	synonymous_variant	5067	exon9			TATGCATTGGAAC	AB040929	CCDS33790.1	3p12.3	2013-02-11			ENSG00000113805	ENSG00000113805		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	2173	protein-coding gene	gene with protein product		601325		PANG		8661054, 8586965	Standard	XM_005264757		Approved	BIG-1	uc003dpm.1	Q9P232	OTTHUMG00000158813	ENST00000263665.6:c.1155A>G	3.37:g.74413676T>C		Somatic	122	0		WXS	Illumina GAIIx	Phase_I	75	4	NM_020872	0	0	0	0	0	B9EK50|Q9H039	Silent	SNP	ENST00000263665.6	37	CCDS33790.1																																																																																			T|0.536;C|0.464		0.358	CNTN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352306.1	NM_020872	
ARGFX	503582	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	121289622	121289622	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5KY-01A-11D-A29I-10	TCGA-OR-A5KY-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	72f9e1d9-c852-423a-94ff-17f763fa2713	f6e93da3-9ee7-4a65-bc04-30f8bb730eef	g.chr3:121289622C>T	ENST00000334384.3	+	1	72	c.62C>T	c.(61-63)tCc>tTc	p.S21F		NM_001012659.1	NP_001012677.1	A6NJG6	ARGFX_HUMAN	arginine-fifty homeobox	21					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)			kidney(1)|large_intestine(3)|lung(6)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	15				GBM - Glioblastoma multiforme(114;0.152)		AGGAATTATTCCAACATGAAG	0.478																																					p.S21F		.											.	ARGFX-93	0			c.C62T						.						103.0	94.0	97.0					3																	121289622		2203	4300	6503	SO:0001583	missense	503582	exon2			ATTATTCCAACAT		CCDS33834.1	3q13.33	2011-06-20			ENSG00000186103	ENSG00000186103		"""Homeoboxes / PRD class"""	30146	protein-coding gene	gene with protein product		611164					Standard	XM_005247505		Approved		uc003eef.3	A6NJG6	OTTHUMG00000159395	ENST00000334384.3:c.62C>T	3.37:g.121289622C>T	ENSP00000335578:p.Ser21Phe	Somatic	350	1		WXS	Illumina GAIIx	Phase_I	303	115	NM_001012659	0	0	0	0	0		Missense_Mutation	SNP	ENST00000334384.3	37	CCDS33834.1	.	.	.	.	.	.	.	.	.	.	C	3.631	-0.075507	0.07184	.	.	ENSG00000186103	ENST00000334384	D	0.89050	-2.46	2.56	-3.45	0.04781	.	1.306960	0.05812	N	0.614097	T	0.79793	0.4507	L	0.32530	0.975	0.09310	N	1	B	0.09022	0.002	B	0.06405	0.002	T	0.61461	-0.7058	10	0.48119	T	0.1	7.9882	2.6073	0.04881	0.3612:0.2558:0.0:0.383	.	21	A6NJG6	ARGFX_HUMAN	F	21	ENSP00000335578:S21F	ENSP00000335578:S21F	S	+	2	0	ARGFX	122772312	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-1.476000	0.02333	-0.973000	0.03555	-0.142000	0.14014	TCC	.		0.478	ARGFX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355096.2	NM_001012659	
HEG1	57493	broad.mit.edu;bcgsc.ca	37	3	124746146	124746146	+	Silent	SNP	G	G	A	rs61750908		TCGA-OR-A5KY-01A-11D-A29I-10	TCGA-OR-A5KY-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	72f9e1d9-c852-423a-94ff-17f763fa2713	f6e93da3-9ee7-4a65-bc04-30f8bb730eef	g.chr3:124746146G>A	ENST00000311127.4	-	3	883	c.816C>T	c.(814-816)acC>acT	p.T272T		NM_020733.1	NP_065784.1	Q9ULI3	HEG1_HUMAN	heart development protein with EGF-like domains 1	272					cardiac atrium morphogenesis (GO:0003209)|cell-cell junction assembly (GO:0007043)|endothelial cell morphogenesis (GO:0001886)|in utero embryonic development (GO:0001701)|lung development (GO:0030324)|lymph circulation (GO:0003017)|lymph vessel development (GO:0001945)|multicellular organism growth (GO:0035264)|pericardium development (GO:0060039)|post-embryonic development (GO:0009791)|regulation of body fluid levels (GO:0050878)|vasculogenesis (GO:0001570)|venous blood vessel morphogenesis (GO:0048845)|ventricular septum development (GO:0003281)	cell-cell junction (GO:0005911)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|integral component of membrane (GO:0016021)	calcium ion binding (GO:0005509)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(7)|lung(24)|ovary(2)|urinary_tract(4)	47						TAGAAGGCGTGGTCAGCTCTC	0.542													G|||	1	0.000199681	0.0	0.0014	5008	,	,		18613	0.0		0.0	False		,,,				2504	0.0				p.T272T		.											.	HEG1-70	0			c.C816T						.	G		0,3966		0,0,1983	60.0	65.0	63.0		816	-0.4	0.0	3	dbSNP_129	63	36,8254		0,36,4109	no	coding-synonymous	HEG1	NM_020733.1		0,36,6092	AA,AG,GG		0.4343,0.0,0.2937		272/1382	124746146	36,12220	1983	4145	6128	SO:0001819	synonymous_variant	57493	exon3			AGGCGTGGTCAGC	AK074987	CCDS46898.1	3q21.2	2013-03-08	2013-03-08		ENSG00000173706	ENSG00000173706			29227	protein-coding gene	gene with protein product	"""heart of glass"""	614182	"""HEG homolog 1 (zebrafish)"""			10574462, 19151727, 23007647	Standard	NM_020733		Approved	KIAA1237, HEG	uc003ehs.4	Q9ULI3	OTTHUMG00000159486	ENST00000311127.4:c.816C>T	3.37:g.124746146G>A		Somatic	233	1		WXS	Illumina GAIIx	Phase_I	200	7	NM_020733	0	0	0	0	0	Q6NX66|Q8NC40|Q9BSV0	Silent	SNP	ENST00000311127.4	37	CCDS46898.1																																																																																			G|0.997;A|0.003		0.542	HEG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355732.2	XM_087386	
COPG1	22820	hgsc.bcm.edu	37	3	128974928	128974928	+	Missense_Mutation	SNP	C	C	A			TCGA-OR-A5KY-01A-11D-A29I-10	TCGA-OR-A5KY-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	72f9e1d9-c852-423a-94ff-17f763fa2713	f6e93da3-9ee7-4a65-bc04-30f8bb730eef	g.chr3:128974928C>A	ENST00000314797.6	+	8	614	c.510C>A	c.(508-510)agC>agA	p.S170R		NM_016128.3	NP_057212.1	Q9Y678	COPG1_HUMAN	coatomer protein complex, subunit gamma 1	170					COPI coating of Golgi vesicle (GO:0048205)|establishment of Golgi localization (GO:0051683)|intracellular protein transport (GO:0006886)|membrane organization (GO:0061024)|organelle transport along microtubule (GO:0072384)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)	COPI vesicle coat (GO:0030126)|cytosol (GO:0005829)|Golgi membrane (GO:0000139)	structural molecule activity (GO:0005198)										TGAAGTGCAGCTTTGACGTGG	0.527																																					p.S170R		.											.	.	0			c.C510A						.						162.0	138.0	146.0					3																	128974928		2203	4300	6503	SO:0001583	missense	22820	exon8			GTGCAGCTTTGAC	AB047846	CCDS33851.1	3q21.3	2012-02-23	2012-02-23	2012-02-23	ENSG00000181789	ENSG00000181789			2236	protein-coding gene	gene with protein product	"""coat protein gamma-cop"""	615525	"""coatomer protein complex, subunit gamma"""	COPG		11056392	Standard	NM_016128		Approved		uc003els.3	Q9Y678	OTTHUMG00000159451	ENST00000314797.6:c.510C>A	3.37:g.128974928C>A	ENSP00000325002:p.Ser170Arg	Somatic	131	0		WXS	Illumina GAIIx	Phase_I	155	8	NM_016128	0	0	58	61	3	A8K6M8|B3KMF6|Q54AC4	Missense_Mutation	SNP	ENST00000314797.6	37	CCDS33851.1	.	.	.	.	.	.	.	.	.	.	C	15.03	2.712683	0.48517	.	.	ENSG00000181789	ENST00000314797	T	0.13538	2.58	4.21	2.37	0.29283	Clathrin/coatomer adaptor, adaptin-like, N-terminal (1);Armadillo-like helical (1);Armadillo-type fold (1);	0.206074	0.42682	D	0.000662	T	0.25158	0.0611	L	0.54323	1.7	0.41217	D	0.986489	D	0.67145	0.996	D	0.75020	0.985	T	0.01587	-1.1318	10	0.40728	T	0.16	-17.348	6.4463	0.21877	0.0:0.6919:0.0:0.3081	.	170	Q9Y678	COPG_HUMAN	R	170	ENSP00000325002:S170R	ENSP00000325002:S170R	S	+	3	2	COPG	130457618	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	2.370000	0.44240	1.003000	0.39130	-0.189000	0.12847	AGC	.		0.527	COPG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355456.1	NM_016128	
KY	339855	bcgsc.ca	37	3	134322814	134322814	+	Silent	SNP	G	G	C	rs2293294	byFrequency	TCGA-OR-A5KY-01A-11D-A29I-10	TCGA-OR-A5KY-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	72f9e1d9-c852-423a-94ff-17f763fa2713	f6e93da3-9ee7-4a65-bc04-30f8bb730eef	g.chr3:134322814G>C	ENST00000423778.2	-	11	1654	c.1593C>G	c.(1591-1593)ggC>ggG	p.G531G	KY_ENST00000508956.1_Silent_p.G510G|KY_ENST00000503669.1_3'UTR	NM_178554.4	NP_848649.3	Q8NBH2	KY_HUMAN	kyphoscoliosis peptidase	531					muscle organ development (GO:0007517)|neuromuscular junction development (GO:0007528)	cytoskeleton (GO:0005856)|Z disc (GO:0030018)	peptidase activity (GO:0008233)	p.G531G(1)		central_nervous_system(1)|endometrium(3)|kidney(1)|lung(12)|ovary(2)|upper_aerodigestive_tract(2)	21						GGGCAAACTTGCCTGCATGGG	0.527													G|||	1482	0.295927	0.413	0.2349	5008	,	,		20559	0.1101		0.33	False		,,,				2504	0.3374				p.G531G		.											.	KY-24	1	Substitution - coding silent(1)	stomach(1)	c.C1593G						.	G		1556,2496		331,894,801	79.0	81.0	80.0		1593	3.8	1.0	3	dbSNP_100	80	2993,5407		564,1865,1771	no	coding-synonymous	KY	NM_178554.4		895,2759,2572	CC,CG,GG		35.631,38.4008,36.5323		531/662	134322814	4549,7903	2026	4200	6226	SO:0001819	synonymous_variant	339855	exon11			AAACTTGCCTGCA	AK090526	CCDS46920.1	3q22.1	2010-11-23			ENSG00000174611	ENSG00000174611			26576	protein-coding gene	gene with protein product		605739					Standard	NM_178554		Approved	FLJ33207	uc010hty.3	Q8NBH2	OTTHUMG00000159788	ENST00000423778.2:c.1593C>G	3.37:g.134322814G>C		Somatic	153	1		WXS	Illumina GAIIx	Phase_I	105	5	NM_178554	0	0	0	0	0	B7Z1S4|Q6ZT15	Silent	SNP	ENST00000423778.2	37	CCDS46920.1																																																																																			G|0.693;C|0.307		0.527	KY-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357320.1	NM_178554	
PRR23C	389152	hgsc.bcm.edu	37	3	138763343	138763343	+	Silent	SNP	T	T	G	rs6804898	byFrequency	TCGA-OR-A5KY-01A-11D-A29I-10	TCGA-OR-A5KY-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	72f9e1d9-c852-423a-94ff-17f763fa2713	f6e93da3-9ee7-4a65-bc04-30f8bb730eef	g.chr3:138763343T>G	ENST00000413199.1	-	1	391	c.120A>C	c.(118-120)cgA>cgC	p.R40R	PRR23C_ENST00000502927.2_Silent_p.R40R|MRPS22_ENST00000495075.1_Intron	NM_001134657.1	NP_001128129.1	Q6ZRP0	PR23C_HUMAN	proline rich 23C	40										breast(2)|lung(7)|skin(2)	11						TGGGCGCCGCTCGGGATTCGG	0.761													G|||	852	0.170128	0.1301	0.2651	5008	,	,		10616	0.2718		0.0845	False		,,,				2504	0.1401				p.R40R		.											.	PRR23C-23	0			c.A120C						.						3.0	5.0	4.0					3																	138763343		573	1394	1967	SO:0001819	synonymous_variant	389152	exon1			CGCCGCTCGGGAT		CCDS46924.1	3q22.3	2014-06-03				ENSG00000233701			37173	protein-coding gene	gene with protein product							Standard	NM_001134657		Approved	FLJ46210	uc011bmt.1	Q6ZRP0		ENST00000413199.1:c.120A>C	3.37:g.138763343T>G		Somatic	1	0		WXS	Illumina GAIIx	Phase_I	16	10	NM_001134657	0	0	0	0	0		Silent	SNP	ENST00000413199.1	37	CCDS46924.1																																																																																			T|0.848;G|0.152		0.761	PRR23C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000361502.1	NM_001134657	
CRIPAK	285464	hgsc.bcm.edu	37	4	1388974	1388974	+	Silent	SNP	T	T	C	rs71614969	byFrequency	TCGA-OR-A5KY-01A-11D-A29I-10	TCGA-OR-A5KY-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	72f9e1d9-c852-423a-94ff-17f763fa2713	f6e93da3-9ee7-4a65-bc04-30f8bb730eef	g.chr4:1388974T>C	ENST00000324803.4	+	1	3635	c.675T>C	c.(673-675)gaT>gaC	p.D225D		NM_175918.3	NP_787114.2	Q8N1N5	CRPAK_HUMAN	cysteine-rich PAK1 inhibitor	225					negative regulation of intracellular estrogen receptor signaling pathway (GO:0033147)|negative regulation of protein kinase activity (GO:0006469)|regulation of cytoskeleton organization (GO:0051493)|response to estrogen (GO:0043627)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				NS(3)|breast(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(11)|ovary(1)|pancreas(2)|prostate(6)|skin(4)|urinary_tract(1)	35			OV - Ovarian serous cystadenocarcinoma(23;0.0106)			CACGTGCCGATGCGGAGTGCC	0.667													N|||	706	0.140974	0.087	0.1888	5008	,	,		14021	0.0268		0.2326	False		,,,				2504	0.2035				p.D225D		.											.	CRIPAK-90	0			c.T675C						.						177.0	128.0	145.0					4																	1388974		2168	4272	6440	SO:0001819	synonymous_variant	285464	exon1			TGCCGATGCGGAG	AK096209	CCDS3349.1	4p16.3	2011-02-10	2006-09-04		ENSG00000179979	ENSG00000179979			26619	protein-coding gene	gene with protein product		610203	"""cysteine-rich PAK1inhibitor"""			16278681	Standard	NM_175918		Approved	FLJ34443	uc003gdf.2	Q8N1N5	OTTHUMG00000121131	ENST00000324803.4:c.675T>C	4.37:g.1388974T>C		Somatic	2	0		WXS	Illumina GAIIx	Phase_I	18	10	NM_175918	0	0	14	26	12	Q8NB03	Silent	SNP	ENST00000324803.4	37	CCDS3349.1																																																																																			C|1.000;|0.000		0.667	CRIPAK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000241607.2	NM_175918	
OTOP1	133060	broad.mit.edu	37	4	4228274	4228282	+	In_Frame_Del	DEL	CCACAGCAG	CCACAGCAG	-	rs75328065|rs199840382|rs111245977|rs377667898|rs200554408|rs201436152	byFrequency	TCGA-OR-A5KY-01A-11D-A29I-10	TCGA-OR-A5KY-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	72f9e1d9-c852-423a-94ff-17f763fa2713	f6e93da3-9ee7-4a65-bc04-30f8bb730eef	g.chr4:4228274_4228282delCCACAGCAG	ENST00000296358.4	-	1	334_342	c.310_318delCTGCTGTGG	c.(310-318)ctgctgtggdel	p.LLW104del		NM_177998.1	NP_819056.1	Q7RTM1	OTOP1_HUMAN	otopetrin 1	104					biomineral tissue development (GO:0031214)|detection of gravity (GO:0009590)|inner ear morphogenesis (GO:0042472)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)		p.L104_W106delLLW(1)		NS(1)|breast(1)|central_nervous_system(2)|endometrium(1)|kidney(2)|large_intestine(3)|liver(4)|lung(14)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	34				UCEC - Uterine corpus endometrioid carcinoma (64;0.168)		ACCACAGCATCCACAGCAGCTGCAGCAGC	0.727																																					p.104_106del		.											.	OTOP1-92	1	Deletion - In frame(1)	upper_aerodigestive_tract(1)	c.310_318del						.																																			SO:0001651	inframe_deletion	133060	exon1			CAGCATCCACAGC	BK000653	CCDS3372.1	4p16.2	2008-02-05			ENSG00000163982	ENSG00000163982			19656	protein-coding gene	gene with protein product		607806				12651873	Standard	NM_177998		Approved		uc003ghp.1	Q7RTM1	OTTHUMG00000090301	ENST00000296358.4:c.310_318delCTGCTGTGG	4.37:g.4228274_4228282delCCACAGCAG	ENSP00000296358:p.Leu104_Trp106del	Somatic	9	0		WXS	Illumina GAIIx	Phase_I	61	10	NM_177998	0	0	0	0	0	A1L476	In_Frame_Del	DEL	ENST00000296358.4	37	CCDS3372.1																																																																																			.		0.727	OTOP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206661.2	NM_177998	
OTOP1	133060	hgsc.bcm.edu	37	4	4228456	4228456	+	Silent	SNP	G	G	T	rs73191872		TCGA-OR-A5KY-01A-11D-A29I-10	TCGA-OR-A5KY-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	72f9e1d9-c852-423a-94ff-17f763fa2713	f6e93da3-9ee7-4a65-bc04-30f8bb730eef	g.chr4:4228456G>T	ENST00000296358.4	-	1	160	c.136C>A	c.(136-138)Cgg>Agg	p.R46R		NM_177998.1	NP_819056.1	Q7RTM1	OTOP1_HUMAN	otopetrin 1	46					biomineral tissue development (GO:0031214)|detection of gravity (GO:0009590)|inner ear morphogenesis (GO:0042472)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)				NS(1)|breast(1)|central_nervous_system(2)|endometrium(1)|kidney(2)|large_intestine(3)|liver(4)|lung(14)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	34				UCEC - Uterine corpus endometrioid carcinoma (64;0.168)		ACAccgccccgccggggggcc	0.736																																					p.R46R		.											.	OTOP1-92	0			c.C136A						.						4.0	4.0	4.0					4																	4228456		1989	3880	5869	SO:0001819	synonymous_variant	133060	exon1			CGCCCCGCCGGGG	BK000653	CCDS3372.1	4p16.2	2008-02-05			ENSG00000163982	ENSG00000163982			19656	protein-coding gene	gene with protein product		607806				12651873	Standard	NM_177998		Approved		uc003ghp.1	Q7RTM1	OTTHUMG00000090301	ENST00000296358.4:c.136C>A	4.37:g.4228456G>T		Somatic	7	0		WXS	Illumina GAIIx	Phase_I	66	15	NM_177998	0	0	0	0	0	A1L476	Silent	SNP	ENST00000296358.4	37	CCDS3372.1																																																																																			.		0.736	OTOP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206661.2	NM_177998	
OTOP1	133060	hgsc.bcm.edu	37	4	4228472	4228472	+	Silent	SNP	T	T	C	rs76810534		TCGA-OR-A5KY-01A-11D-A29I-10	TCGA-OR-A5KY-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	72f9e1d9-c852-423a-94ff-17f763fa2713	f6e93da3-9ee7-4a65-bc04-30f8bb730eef	g.chr4:4228472T>C	ENST00000296358.4	-	1	144	c.120A>G	c.(118-120)gaA>gaG	p.E40E		NM_177998.1	NP_819056.1	Q7RTM1	OTOP1_HUMAN	otopetrin 1	40				E -> K (in Ref. 1; AAI30431/AAI30433). {ECO:0000305}.	biomineral tissue development (GO:0031214)|detection of gravity (GO:0009590)|inner ear morphogenesis (GO:0042472)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)				NS(1)|breast(1)|central_nervous_system(2)|endometrium(1)|kidney(2)|large_intestine(3)|liver(4)|lung(14)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	34				UCEC - Uterine corpus endometrioid carcinoma (64;0.168)		gggccggggATTCCGGGGACC	0.756																																					p.E40E		.											.	OTOP1-92	0			c.A120G						.						3.0	4.0	4.0					4																	4228472		1916	3754	5670	SO:0001819	synonymous_variant	133060	exon1			CGGGGATTCCGGG	BK000653	CCDS3372.1	4p16.2	2008-02-05			ENSG00000163982	ENSG00000163982			19656	protein-coding gene	gene with protein product		607806				12651873	Standard	NM_177998		Approved		uc003ghp.1	Q7RTM1	OTTHUMG00000090301	ENST00000296358.4:c.120A>G	4.37:g.4228472T>C		Somatic	5	0		WXS	Illumina GAIIx	Phase_I	44	12	NM_177998	0	0	0	0	0	A1L476	Silent	SNP	ENST00000296358.4	37	CCDS3372.1																																																																																			.		0.756	OTOP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206661.2	NM_177998	
CCDC96	257236	hgsc.bcm.edu	37	4	7044357	7044357	+	Silent	SNP	A	A	G	rs871133	byFrequency	TCGA-OR-A5KY-01A-11D-A29I-10	TCGA-OR-A5KY-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	72f9e1d9-c852-423a-94ff-17f763fa2713	f6e93da3-9ee7-4a65-bc04-30f8bb730eef	g.chr4:7044357A>G	ENST00000310085.4	-	1	371	c.309T>C	c.(307-309)gtT>gtC	p.V103V	TADA2B_ENST00000512388.1_5'Flank|RP11-367J11.2_ENST00000500031.1_RNA|TADA2B_ENST00000310074.7_5'Flank	NM_153376.2	NP_699207.1	Q2M329	CCD96_HUMAN	coiled-coil domain containing 96	103	Glu-rich.									endometrium(3)|kidney(1)|large_intestine(3)|lung(2)|skin(1)|urinary_tract(1)	11						CCTCAGCCCCAACCTCGGCCG	0.766													G|||	4833	0.965056	0.8979	0.9856	5008	,	,		11811	1.0		0.9702	False		,,,				2504	1.0				p.V103V		.											.	CCDC96-90	0			c.T309C						.	G		2893,205		1348,197,4	3.0	3.0	3.0		309	-4.5	0.0	4	dbSNP_86	3	6689,125		3282,125,0	no	coding-synonymous	CCDC96	NM_153376.2		4630,322,4	GG,GA,AA		1.8345,6.6172,3.3293		103/556	7044357	9582,330	1549	3407	4956	SO:0001819	synonymous_variant	257236	exon1			AGCCCCAACCTCG	AK075056	CCDS3395.1	4p16.1	2008-02-05			ENSG00000173013	ENSG00000173013			26900	protein-coding gene	gene with protein product							Standard	NM_153376		Approved	FLJ90575	uc003gjv.2	Q2M329	OTTHUMG00000125511	ENST00000310085.4:c.309T>C	4.37:g.7044357A>G		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	11	11	NM_153376	0	0	0	1	1	Q8N2I7	Silent	SNP	ENST00000310085.4	37	CCDS3395.1																																																																																			A|0.036;G|0.964		0.766	CCDC96-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000246838.1	NM_153376	
FAM184B	27146	hgsc.bcm.edu	37	4	17643848	17643848	+	Missense_Mutation	SNP	G	G	A	rs2286771	byFrequency	TCGA-OR-A5KY-01A-11D-A29I-10	TCGA-OR-A5KY-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	72f9e1d9-c852-423a-94ff-17f763fa2713	f6e93da3-9ee7-4a65-bc04-30f8bb730eef	g.chr4:17643848G>A	ENST00000265018.3	-	13	2562	c.2350C>T	c.(2350-2352)Cgg>Tgg	p.R784W		NM_015688.1	NP_056503.1	Q9ULE4	F184B_HUMAN	family with sequence similarity 184, member B	784				R -> W (in Ref. 1; BAA86590). {ECO:0000305}.						NS(1)|central_nervous_system(1)|endometrium(1)|prostate(1)	4						GGGCCGCCCCGCTCCTGAGGA	0.701													G|||	2697	0.538538	0.1725	0.6599	5008	,	,		10215	0.8522		0.6233	False		,,,				2504	0.5368				p.R784W		.											.	FAM184B-23	0			c.C2350T						.						1.0	2.0	2.0					4																	17643848		374	1044	1418	SO:0001583	missense	27146	exon13			CGCCCCGCTCCTG		CCDS47033.1	4p16	2009-04-22			ENSG00000047662	ENSG00000047662			29235	protein-coding gene	gene with protein product						10574462	Standard	NM_015688		Approved	KIAA1276	uc003gpm.4	Q9ULE4	OTTHUMG00000160287	ENST00000265018.3:c.2350C>T	4.37:g.17643848G>A	ENSP00000265018:p.Arg784Trp	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	6	6	NM_015688	0	0	0	0	0		Missense_Mutation	SNP	ENST00000265018.3	37	CCDS47033.1	1272	0.5824175824175825	75	0.1524390243902439	232	0.6408839779005525	493	0.8618881118881119	472	0.6226912928759895	G	13.83	2.354233	0.41700	.	.	ENSG00000047662	ENST00000265018	T	0.34072	1.38	3.29	-3.67	0.04476	.	3.541600	0.00901	N	0.002342	T	0.00012	0.0000	N	0.14661	0.345	0.80722	P	0.0	D	0.56968	0.978	B	0.40741	0.339	T	0.48547	-0.9026	9	0.72032	D	0.01	2.0681	6.7491	0.23477	0.107:0.2547:0.5506:0.0877	rs2286771;rs58699512;rs2286771	784	Q9ULE4	F184B_HUMAN	W	784	ENSP00000265018:R784W	ENSP00000265018:R784W	R	-	1	2	FAM184B	17252946	0.000000	0.05858	0.000000	0.03702	0.516000	0.34256	-0.323000	0.07997	-1.014000	0.03379	-0.369000	0.07265	CGG	G|0.440;A|0.560		0.701	FAM184B-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000360137.1	NM_015688	
SOWAHB	345079	hgsc.bcm.edu	37	4	77818202	77818202	+	Silent	SNP	T	T	C	rs2645674	byFrequency	TCGA-OR-A5KY-01A-11D-A29I-10	TCGA-OR-A5KY-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	72f9e1d9-c852-423a-94ff-17f763fa2713	f6e93da3-9ee7-4a65-bc04-30f8bb730eef	g.chr4:77818202T>C	ENST00000334306.2	-	1	800	c.801A>G	c.(799-801)acA>acG	p.T267T		NM_001029870.1	NP_001025041.1	A6NEL2	SWAHB_HUMAN	sosondowah ankyrin repeat domain family member B	267	Ala-rich.																AAGCCCTGCTTGTCGCAGCCT	0.726													C|||	1670	0.333466	0.4887	0.2392	5008	,	,		13358	0.2292		0.332	False		,,,				2504	0.2996				p.T267T		.											.	.	0			c.A801G						.	C		1258,2610		207,844,883	3.0	5.0	4.0		801	-3.8	0.0	4	dbSNP_100	4	1803,5973		226,1351,2311	no	coding-synonymous	ANKRD56	NM_001029870.1		433,2195,3194	CC,CT,TT		23.1867,32.5233,26.2882		267/794	77818202	3061,8583	1934	3888	5822	SO:0001819	synonymous_variant	345079	exon1			CCTGCTTGTCGCA		CCDS34017.1	4q21.1	2013-01-10	2012-01-12	2012-01-12	ENSG00000186212	ENSG00000186212		"""Ankyrin repeat domain containing"""	32958	protein-coding gene	gene with protein product			"""ankyrin repeat domain 56"""	ANKRD56		22234889	Standard	NM_001029870		Approved		uc003hki.3	A6NEL2	OTTHUMG00000160876	ENST00000334306.2:c.801A>G	4.37:g.77818202T>C		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	9	7	NM_001029870	0	0	0	0	0	B2RP29	Silent	SNP	ENST00000334306.2	37	CCDS34017.1																																																																																			T|0.691;C|0.309		0.726	SOWAHB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000362762.1	NM_001029870	
HNRNPD	3184	hgsc.bcm.edu	37	4	83294784	83294784	+	Silent	SNP	C	C	T			TCGA-OR-A5KY-01A-11D-A29I-10	TCGA-OR-A5KY-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	72f9e1d9-c852-423a-94ff-17f763fa2713	f6e93da3-9ee7-4a65-bc04-30f8bb730eef	g.chr4:83294784C>T	ENST00000313899.7	-	1	325	c.48G>A	c.(46-48)acG>acA	p.T16T	HNRNPD_ENST00000352301.4_Silent_p.T16T|RP11-127B20.3_ENST00000609575.1_RNA|HNRNPD_ENST00000543098.1_Silent_p.T16T|HNRNPD_ENST00000353341.4_Silent_p.T16T|HNRNPD_ENST00000541060.1_5'UTR|RP11-127B20.3_ENST00000609552.1_RNA	NM_031370.2	NP_112738.1	Q14103	HNRPD_HUMAN	heterogeneous nuclear ribonucleoprotein D (AU-rich element RNA binding protein 1, 37kDa)	16	Ala-rich.				circadian regulation of translation (GO:0097167)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|mRNA splicing, via spliceosome (GO:0000398)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of translation (GO:0045727)|regulation of circadian rhythm (GO:0042752)|regulation of mRNA stability (GO:0043488)|regulation of transcription, DNA-templated (GO:0006355)|RNA catabolic process (GO:0006401)|RNA metabolic process (GO:0016070)|RNA processing (GO:0006396)|RNA splicing (GO:0008380)|transcription, DNA-templated (GO:0006351)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|telomeric DNA binding (GO:0042162)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(1)	7						ctaccgccgccgttgccgctg	0.771																																					p.T16T		.											.	HNRNPD-22	0			c.G48A						.																																			SO:0001819	synonymous_variant	3184	exon1			CGCCGCCGTTGCC	AF026126	CCDS3590.1, CCDS3591.1, CCDS3592.1	4q21	2013-02-12	2002-08-29	2008-04-18	ENSG00000138668	ENSG00000138668		"""RNA binding motif (RRM) containing"""	5036	protein-coding gene	gene with protein product		601324	"""heterogeneous nuclear ribonucleoprotein D (AU-rich element RNA-binding protein 1, 37kD)"""	AUF1, HNRPD		9615222	Standard	NM_001003810		Approved		uc003hmm.1	Q14103	OTTHUMG00000130290	ENST00000313899.7:c.48G>A	4.37:g.83294784C>T		Somatic	1	0		WXS	Illumina GAIIx	Phase_I	9	6	NM_031370	0	0	1	32	31	A8K9J2|P07029|Q01858|Q14100|Q14101|Q14102|Q4W5A1|Q9UCE8|Q9UCE9	Silent	SNP	ENST00000313899.7	37	CCDS3592.1	.	.	.	.	.	.	.	.	.	.	C	11.14	1.550397	0.27739	.	.	ENSG00000138668	ENST00000307213	.	.	.	3.49	1.45	0.22620	.	.	.	.	.	T	0.49081	0.1536	.	.	.	0.45567	D	0.998518	.	.	.	.	.	.	T	0.51204	-0.8735	5	0.59425	D	0.04	.	1.4939	0.02462	0.2106:0.4467:0.206:0.1367	.	.	.	.	S	15	.	ENSP00000307544:G15S	G	-	1	0	HNRNPD	83513808	0.458000	0.25760	0.998000	0.56505	0.853000	0.48598	0.107000	0.15375	0.762000	0.33152	0.430000	0.28490	GGC	.		0.771	HNRNPD-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000252630.2	NM_031370	
IRF2	3660	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	4	185340713	185340715	+	In_Frame_Del	DEL	TCT	TCT	-			TCGA-OR-A5KY-01A-11D-A29I-10	TCGA-OR-A5KY-10A-01D-A29L-10	TCT	TCT	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	72f9e1d9-c852-423a-94ff-17f763fa2713	f6e93da3-9ee7-4a65-bc04-30f8bb730eef	g.chr4:185340713_185340715delTCT	ENST00000393593.3	-	3	302_304	c.95_97delAGA	c.(94-99)aagatt>att	p.K32del	IRF2_ENST00000512020.1_5'UTR	NM_002199.3	NP_002190.2	P14316	IRF2_HUMAN	interferon regulatory factor 2	32					blood coagulation (GO:0007596)|cell proliferation (GO:0008283)|cytokine-mediated signaling pathway (GO:0019221)|interferon-gamma-mediated signaling pathway (GO:0060333)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)|type I interferon signaling pathway (GO:0060337)	cytosol (GO:0005829)|nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|regulatory region DNA binding (GO:0000975)|sequence-specific DNA binding transcription factor activity (GO:0003700)			cervix(1)|endometrium(2)|kidney(1)|large_intestine(4)|liver(2)|lung(3)|ovary(2)|prostate(1)|skin(3)|stomach(1)|urinary_tract(2)	22		all_lung(41;7.86e-14)|Lung NSC(41;1.87e-13)|Colorectal(36;0.00146)|Hepatocellular(41;0.00826)|Renal(120;0.00992)|Prostate(90;0.0115)|all_neural(102;0.0573)|all_hematologic(60;0.0592)		all cancers(43;3.94e-27)|Epithelial(43;5.3e-24)|OV - Ovarian serous cystadenocarcinoma(60;1.06e-10)|Colorectal(24;7.98e-07)|STAD - Stomach adenocarcinoma(60;3.95e-05)|GBM - Glioblastoma multiforme(59;8.3e-05)|COAD - Colon adenocarcinoma(29;0.000106)|BRCA - Breast invasive adenocarcinoma(30;0.000311)|LUSC - Lung squamous cell carcinoma(40;0.0128)|READ - Rectum adenocarcinoma(43;0.0419)		ATCTGAAAAATCTTCTTTTCCTG	0.414																																					p.32_33del		.											.	IRF2-91	0			c.95_97del						.																																			SO:0001651	inframe_deletion	3660	exon3			GAAAAATCTTCTT		CCDS3835.1	4q34.1-q35.1	2008-07-29				ENSG00000168310			6117	protein-coding gene	gene with protein product		147576				2475256	Standard	NM_002199		Approved		uc003iwf.4	P14316		ENST00000393593.3:c.95_97delAGA	4.37:g.185340716_185340718delTCT	ENSP00000377218:p.Lys32del	Somatic	39	0		WXS	Illumina GAIIx	Phase_I	24	13	NM_002199	0	0	0	0	0	D6RCK5|H0Y8S3|Q6IAS7|Q96B99	In_Frame_Del	DEL	ENST00000393593.3	37	CCDS3835.1																																																																																			.		0.414	IRF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000361393.1		
TERT	7015	broad.mit.edu;bcgsc.ca	37	5	1253890	1253890	+	Missense_Mutation	SNP	C	C	A			TCGA-OR-A5KY-01A-11D-A29I-10	TCGA-OR-A5KY-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	72f9e1d9-c852-423a-94ff-17f763fa2713	f6e93da3-9ee7-4a65-bc04-30f8bb730eef	g.chr5:1253890C>A	ENST00000310581.5	-	16	3409	c.3352G>T	c.(3352-3354)Gca>Tca	p.A1118S	TERT_ENST00000334602.6_Missense_Mutation_p.A1055S|TERT_ENST00000296820.5_3'UTR	NM_001193376.1|NM_198253.2	NP_001180305.1|NP_937983.2	O14746	TERT_HUMAN	telomerase reverse transcriptase	1118	CTE.				DNA strand elongation (GO:0022616)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|replicative senescence (GO:0090399)|telomere formation via telomerase (GO:0032203)|telomere maintenance (GO:0000723)|telomere maintenance via telomerase (GO:0007004)	chromosome, telomeric region (GO:0000781)|cytoplasm (GO:0005737)|nuclear telomere cap complex (GO:0000783)|nucleoplasm (GO:0005654)|telomerase holoenzyme complex (GO:0005697)	metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|telomerase activity (GO:0003720)|telomeric DNA binding (GO:0042162)|telomeric RNA binding (GO:0070034)|telomeric template RNA reverse transcriptase activity (GO:0003721)			NS(1)|breast(1)|central_nervous_system(3)|endometrium(2)|kidney(4)|large_intestine(3)|lung(22)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)	41	all_cancers(3;3.17e-16)|Lung NSC(6;8.55e-15)|all_lung(6;7.2e-14)|all_epithelial(6;1.87e-10)		Epithelial(17;0.00105)|all cancers(22;0.00178)|OV - Ovarian serous cystadenocarcinoma(19;0.00239)|Lung(60;0.185)		Zidovudine(DB00495)	GGGTTGGCTGCGGCCTCCAGG	0.662									TERT Mutation-Associated Haematological Disorders;Pulmonary Fibrosis, Idiopathic;Congenital Dyskeratosis																												p.A1118S		.											.	TERT-1272	0			c.G3352T						.						21.0	30.0	27.0					5																	1253890		2175	4260	6435	SO:0001583	missense	7015	exon16	Familial Cancer Database	;Hamman-Rich syndrome, Fibrocystic Pulmonary Dysplasia;Zinsser-Engman-Cole syndrome, Dyskeratosis Congenita	TGGCTGCGGCCTC	AF015950	CCDS3861.2, CCDS54831.1	5p15.33	2014-09-17			ENSG00000164362	ENSG00000164362			11730	protein-coding gene	gene with protein product		187270				9252327	Standard	NM_198253		Approved	TRT, TP2, TCS1, hEST2, EST2	uc003jcb.1	O14746	OTTHUMG00000090357	ENST00000310581.5:c.3352G>T	5.37:g.1253890C>A	ENSP00000309572:p.Ala1118Ser	Somatic	178	1		WXS	Illumina GAIIx	Phase_I	271	23	NM_198253	0	0	0	0	0	O14783|Q2XS35|Q8N6C3|Q8NG38|Q8NG46	Missense_Mutation	SNP	ENST00000310581.5	37	CCDS3861.2	.	.	.	.	.	.	.	.	.	.	c	16.30	3.085312	0.55861	.	.	ENSG00000164362	ENST00000310581;ENST00000334602	D;D	0.97041	-4.22;-4.05	3.82	2.94	0.34122	.	0.123616	0.53938	D	0.000048	D	0.97483	0.9176	M	0.83483	2.645	0.19300	N	0.999973	D;D	0.63880	0.971;0.993	P;P	0.59595	0.594;0.86	D	0.92740	0.6207	10	0.49607	T	0.09	-9.0968	7.4193	0.27063	0.0:0.8792:0.0:0.1208	.	1055;1118	O14746-3;O14746	.;TERT_HUMAN	S	1118;1055	ENSP00000309572:A1118S;ENSP00000334346:A1055S	ENSP00000309572:A1118S	A	-	1	0	TERT	1306890	0.006000	0.16342	0.003000	0.11579	0.001000	0.01503	0.817000	0.27281	0.951000	0.37770	-0.266000	0.10368	GCA	.		0.662	TERT-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000206729.2		
CCDC125	202243	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	68599726	68599726	+	Missense_Mutation	SNP	C	C	G			TCGA-OR-A5KY-01A-11D-A29I-10	TCGA-OR-A5KY-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	72f9e1d9-c852-423a-94ff-17f763fa2713	f6e93da3-9ee7-4a65-bc04-30f8bb730eef	g.chr5:68599726C>G	ENST00000396496.2	-	7	755	c.648G>C	c.(646-648)gaG>gaC	p.E216D	CCDC125_ENST00000396499.1_Missense_Mutation_p.E216D|CCDC125_ENST00000383374.2_Missense_Mutation_p.E215D|CCDC125_ENST00000511257.1_Missense_Mutation_p.E91D|CCDC125_ENST00000460090.1_Intron			Q86Z20	CC125_HUMAN	coiled-coil domain containing 125	216						cytoplasm (GO:0005737)				breast(2)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(5)|lung(7)|urinary_tract(1)	19		Lung NSC(167;7.26e-05)|Prostate(74;0.0143)|Ovarian(174;0.0448)|Breast(144;0.198)		OV - Ovarian serous cystadenocarcinoma(47;2.2e-56)|Epithelial(20;2.31e-52)|all cancers(19;5.85e-48)|Lung(70;0.0183)		CTTTCAAATTCTCTTTGAGGA	0.308																																					p.E216D		.											.	CCDC125-90	0			c.G648C						.						123.0	116.0	119.0					5																	68599726		2202	4296	6498	SO:0001583	missense	202243	exon6			CAAATTCTCTTTG	AB024691	CCDS4000.1, CCDS75255.1	5q13.2	2008-02-05			ENSG00000183323	ENSG00000183323			28924	protein-coding gene	gene with protein product		613781					Standard	XM_005248461		Approved	KENAE	uc003jvv.1	Q86Z20	OTTHUMG00000131259	ENST00000396496.2:c.648G>C	5.37:g.68599726C>G	ENSP00000379754:p.Glu216Asp	Somatic	31	0		WXS	Illumina GAIIx	Phase_I	29	8	NM_176816	0	0	1	2	1	Q86Z19	Missense_Mutation	SNP	ENST00000396496.2	37	CCDS4000.1	.	.	.	.	.	.	.	.	.	.	C	18.33	3.599948	0.66332	.	.	ENSG00000183323	ENST00000396496;ENST00000396499;ENST00000383374;ENST00000511257	T;T;T;T	0.54071	0.59;0.59;0.59;0.59	5.75	1.17	0.20885	.	0.156846	0.56097	D	0.000030	T	0.64260	0.2582	M	0.77103	2.36	0.27693	N	0.946035	D;D	0.61697	0.971;0.99	P;P	0.59643	0.816;0.861	T	0.58763	-0.7579	10	0.51188	T	0.08	-6.3437	9.1852	0.37165	0.0:0.223:0.0:0.777	.	91;216	Q86Z20-2;Q86Z20	.;CC125_HUMAN	D	216;216;215;91	ENSP00000379754:E216D;ENSP00000379756:E216D;ENSP00000372865:E215D;ENSP00000426795:E91D	ENSP00000372865:E215D	E	-	3	2	CCDC125	68635482	1.000000	0.71417	0.556000	0.28293	0.993000	0.82548	1.404000	0.34623	-0.014000	0.14175	0.650000	0.86243	GAG	.		0.308	CCDC125-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254027.4	NM_176816	
SOWAHA	134548	hgsc.bcm.edu	37	5	132149684	132149684	+	Missense_Mutation	SNP	G	G	C	rs40274	byFrequency	TCGA-OR-A5KY-01A-11D-A29I-10	TCGA-OR-A5KY-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	72f9e1d9-c852-423a-94ff-17f763fa2713	f6e93da3-9ee7-4a65-bc04-30f8bb730eef	g.chr5:132149684G>C	ENST00000378693.2	+	1	652	c.371G>C	c.(370-372)cGg>cCg	p.R124P		NM_175873.4	NP_787069.3	Q2M3V2	SWAHA_HUMAN	sosondowah ankyrin repeat domain family member A	124	Pro-rich.		R -> P (in dbSNP:rs40274).														CCCTTGGTCCGGGTGCCGCGG	0.776																																					p.R124P		.											.	.	0			c.G371C						.	C	PRO/ARG	2599,13		1293,13,0	2.0	3.0	3.0		371	-0.3	0.0	5	dbSNP_76	3	6177,193		2993,191,1	no	missense	ANKRD43	NM_175873.4	103	4286,204,1	CC,CG,GG		3.0298,0.4977,2.2935	benign	124/550	132149684	8776,206	1306	3185	4491	SO:0001583	missense	134548	exon1			TGGTCCGGGTGCC	AK090823	CCDS43361.1	5q23.3	2013-01-10	2012-01-12	2012-01-12	ENSG00000198944	ENSG00000198944		"""Ankyrin repeat domain containing"""	27033	protein-coding gene	gene with protein product			"""ankyrin repeat domain 43"""	ANKRD43		22234889	Standard	NM_175873		Approved		uc003kxw.3	Q2M3V2	OTTHUMG00000059844	ENST00000378693.2:c.371G>C	5.37:g.132149684G>C	ENSP00000367965:p.Arg124Pro	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	9	8	NM_175873	0	0	0	0	0	Q8NAE7	Missense_Mutation	SNP	ENST00000378693.2	37	CCDS43361.1	2142	0.9807692307692307	482	0.9796747967479674	357	0.9861878453038674	562	0.9825174825174825	741	0.9775725593667546	c	9.833	1.188835	0.21954	0.995023	0.969702	ENSG00000198944	ENST00000378693	T	0.38077	1.16	4.27	-0.265	0.12946	.	2.345400	0.02245	N	0.066177	T	0.00012	0.0000	N	0.08118	0	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.36261	-0.9755	9	0.30078	T	0.28	-5.2019	3.6102	0.08057	0.2245:0.4439:0.2467:0.085	rs40274	124	Q2M3V2	ANR43_HUMAN	P	124	ENSP00000367965:R124P	ENSP00000367965:R124P	R	+	2	0	ANKRD43	132177583	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-1.768000	0.01794	-0.003000	0.14444	-3.153000	0.00058	CGG	G|0.980;C|0.020		0.776	SOWAHA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000133062.1	NM_175873	
PROB1	389333	hgsc.bcm.edu	37	5	138730037	138730037	+	Missense_Mutation	SNP	T	T	C	rs11748963	byFrequency	TCGA-OR-A5KY-01A-11D-A29I-10	TCGA-OR-A5KY-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	72f9e1d9-c852-423a-94ff-17f763fa2713	f6e93da3-9ee7-4a65-bc04-30f8bb730eef	g.chr5:138730037T>C	ENST00000434752.2	-	1	848	c.734A>G	c.(733-735)cAg>cGg	p.Q245R		NM_001161546.1	NP_001155018.1	E7EW31	PROB1_HUMAN	proline-rich basic protein 1	245																	CGCGGCGGCCTGCAGGGGGCC	0.781													T|||	1773	0.354034	0.146	0.2839	5008	,	,		10752	0.6151		0.3042	False		,,,				2504	0.4673				p.Q245R		.											.	.	0			c.A734G						.						5.0	7.0	6.0					5																	138730037		671	1537	2208	SO:0001583	missense	389333	exon1			GCGGCCTGCAGGG	AK316483	CCDS54909.1	5q31.2	2012-10-01	2012-10-01	2012-10-01	ENSG00000228672	ENSG00000228672			41906	protein-coding gene	gene with protein product			"""chromosome 5 open reading frame 65"""	C5orf65			Standard	NM_001161546		Approved		uc011czc.1	E7EW31		ENST00000434752.2:c.734A>G	5.37:g.138730037T>C	ENSP00000416033:p.Gln245Arg	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	23	14	NM_001161546	0	0	0	0	0	B4E007	Missense_Mutation	SNP	ENST00000434752.2	37	CCDS54909.1	803	0.3676739926739927	105	0.21341463414634146	108	0.2983425414364641	366	0.6398601398601399	224	0.2955145118733509	T	21.8	4.205823	0.79127	.	.	ENSG00000228672	ENST00000434752	.	.	.	4.26	4.26	0.50523	.	.	.	.	.	T	0.00012	0.0000	L	0.36672	1.1	0.33628	P	0.39427599999999996	D	0.76494	0.999	D	0.83275	0.996	T	0.45483	-0.9258	7	0.52906	T	0.07	.	11.6588	0.51334	0.0:0.0:0.0:1.0	rs11748963	245	E7EW31	CE065_HUMAN	R	245	.	ENSP00000416033:Q245R	Q	-	2	0	AC135457.1	138757936	0.990000	0.36364	0.998000	0.56505	0.770000	0.43624	2.116000	0.41930	1.919000	0.55581	0.459000	0.35465	CAG	T|0.632;C|0.368		0.781	PROB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000470735.1	NM_001161546	
PCDHB3	56132	broad.mit.edu	37	5	140482256	140482256	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5KY-01A-11D-A29I-10	TCGA-OR-A5KY-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	72f9e1d9-c852-423a-94ff-17f763fa2713	f6e93da3-9ee7-4a65-bc04-30f8bb730eef	g.chr5:140482256G>A	ENST00000231130.2	+	1	2023	c.2023G>A	c.(2023-2025)Gag>Aag	p.E675K	AC005754.7_ENST00000607216.1_RNA	NM_018937.2	NP_061760.1	Q9Y5E6	PCDB3_HUMAN	protocadherin beta 3	675					calcium-dependent cell-cell adhesion (GO:0016339)|cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			NS(2)|breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(19)|lung(24)|ovary(1)|pancreas(1)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	72			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			GCCTCTCCCGGAGGCGGCACC	0.667																																					p.E675K		.											.	PCDHB3-92	0			c.G2023A						.						61.0	68.0	66.0					5																	140482256		2163	4224	6387	SO:0001583	missense	56132	exon1			CTCCCGGAGGCGG	AF152496	CCDS4245.1	5q31	2010-01-26			ENSG00000113205	ENSG00000113205		"""Cadherins / Protocadherins : Clustered"""	8688	other	protocadherin		606329				10380929	Standard	NM_018937		Approved	PCDH-BETA3	uc003lio.3	Q9Y5E6	OTTHUMG00000129622	ENST00000231130.2:c.2023G>A	5.37:g.140482256G>A	ENSP00000231130:p.Glu675Lys	Somatic	50	0		WXS	Illumina GAIIx	Phase_I	160	7	NM_018937	0	0	0	0	0	B2R8P2	Missense_Mutation	SNP	ENST00000231130.2	37	CCDS4245.1	.	.	.	.	.	.	.	.	.	.	G	31	5.089988	0.94149	.	.	ENSG00000113205	ENST00000231130	T	0.50548	0.74	4.29	4.29	0.51040	.	.	.	.	.	T	0.61464	0.2349	M	0.89478	3.035	0.36498	D	0.868824	P	0.49090	0.919	P	0.51453	0.67	T	0.73129	-0.4080	9	0.72032	D	0.01	.	7.6449	0.28315	0.0918:0.1675:0.7407:0.0	.	675	Q9Y5E6	PCDB3_HUMAN	K	675	ENSP00000231130:E675K	ENSP00000231130:E675K	E	+	1	0	PCDHB3	140462440	0.991000	0.36638	0.141000	0.22245	0.725000	0.41563	3.665000	0.54532	2.095000	0.63458	0.485000	0.47835	GAG	.		0.667	PCDHB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251817.2	NM_018937	
FAM114A2	10827	broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	153372546	153372546	+	Missense_Mutation	SNP	A	A	G	rs202197693		TCGA-OR-A5KY-01A-11D-A29I-10	TCGA-OR-A5KY-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	72f9e1d9-c852-423a-94ff-17f763fa2713	f6e93da3-9ee7-4a65-bc04-30f8bb730eef	g.chr5:153372546A>G	ENST00000351797.4	-	14	1584	c.1508T>C	c.(1507-1509)tTa>tCa	p.L503S	FAM114A2_ENST00000520667.1_Missense_Mutation_p.L503S|FAM114A2_ENST00000518946.1_5'UTR|FAM114A2_ENST00000522858.1_Missense_Mutation_p.L503S|FAM114A2_ENST00000520313.1_Missense_Mutation_p.L433S	NM_018691.2	NP_061161.2	Q9NRY5	F1142_HUMAN	family with sequence similarity 114, member A2	503							purine nucleotide binding (GO:0017076)			NS(1)|breast(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(1)|lung(9)|skin(1)|urinary_tract(1)	18						TCAATGTTCTAACAAAGGTTT	0.473																																					p.L503S		.											.	FAM114A2-90	0			c.T1508C						.						174.0	164.0	167.0					5																	153372546		2203	4300	6503	SO:0001583	missense	10827	exon14			TGTTCTAACAAAG	AF159700	CCDS4323.1	5q31-q33	2008-06-13	2008-06-13	2008-06-13	ENSG00000055147	ENSG00000055147			1333	protein-coding gene	gene with protein product			"""chromosome 5 open reading frame 3"""	C5orf3		10843801	Standard	XM_005268359		Approved	133K02	uc003lvc.3	Q9NRY5	OTTHUMG00000130147	ENST00000351797.4:c.1508T>C	5.37:g.153372546A>G	ENSP00000341597:p.Leu503Ser	Somatic	115	1		WXS	Illumina GAIIx	Phase_I	115	54	NM_018691	0	0	6	22	16	B2R8D8|Q9H7E0	Missense_Mutation	SNP	ENST00000351797.4	37	CCDS4323.1	.	.	.	.	.	.	.	.	.	.	A	0.008	-1.921204	0.00498	.	.	ENSG00000055147	ENST00000351797;ENST00000522858;ENST00000520667;ENST00000520313	T;T;T;T	0.16597	2.6;2.6;2.6;2.33	5.51	-0.646	0.11472	.	2.423390	0.01927	N	0.040938	T	0.08758	0.0217	N	0.08118	0	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.24012	-1.0172	10	0.23302	T	0.38	3.1526	4.7556	0.13082	0.3478:0.3859:0.2663:0.0	.	433;503	E7ESJ7;Q9NRY5	.;F1142_HUMAN	S	503;503;503;433	ENSP00000341597:L503S;ENSP00000430489:L503S;ENSP00000430384:L503S;ENSP00000429088:L433S	ENSP00000341597:L503S	L	-	2	0	FAM114A2	153352739	0.000000	0.05858	0.002000	0.10522	0.054000	0.15201	-0.079000	0.11357	0.031000	0.15407	-0.242000	0.12053	TTA	A|0.999;G|0.001		0.473	FAM114A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252455.1	NM_018691	
RMND5B	64777	bcgsc.ca	37	5	177565255	177565255	+	Silent	SNP	C	C	T	rs61749659	byFrequency	TCGA-OR-A5KY-01A-11D-A29I-10	TCGA-OR-A5KY-10A-01D-A29L-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	72f9e1d9-c852-423a-94ff-17f763fa2713	f6e93da3-9ee7-4a65-bc04-30f8bb730eef	g.chr5:177565255C>T	ENST00000515098.1	+	4	486	c.135C>T	c.(133-135)agC>agT	p.S45S	RMND5B_ENST00000313386.4_Silent_p.S45S|RMND5B_ENST00000542098.1_Intron			Q96G75	RMD5B_HUMAN	required for meiotic nuclear division 5 homolog B (S. cerevisiae)	45										endometrium(3)|large_intestine(5)|lung(6)|ovary(1)|skin(2)	17	all_cancers(89;0.00294)|Renal(175;0.000269)|Lung NSC(126;0.00858)|all_lung(126;0.0139)	all_neural(177;0.00802)|Medulloblastoma(196;0.0145)|all_hematologic(541;0.248)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			AGCTGGCCAGCGCAGGTGGGT	0.637													C|||	110	0.0219649	0.0129	0.0202	5008	,	,		16289	0.0218		0.0278	False		,,,				2504	0.0297				p.S45S		.											.	RMND5B-227	0			c.C135T						.	C		77,4329	65.8+/-103.3	0,77,2126	36.0	30.0	32.0		135	-10.9	0.0	5	dbSNP_129	32	192,8406	82.6+/-145.2	6,180,4113	no	coding-synonymous	RMND5B	NM_022762.3		6,257,6239	TT,TC,CC		2.2331,1.7476,2.0686		45/394	177565255	269,12735	2203	4299	6502	SO:0001819	synonymous_variant	64777	exon3			GGCCAGCGCAGGT	BC009911	CCDS4431.1, CCDS75382.1	5q35.3	2012-07-20			ENSG00000145916	ENSG00000145916			26181	protein-coding gene	gene with protein product	"""GID complex subunit 2 homolog B"""					12975309	Standard	NM_022762		Approved	FLJ22318, GID2, GID2B	uc003mim.3	Q96G75	OTTHUMG00000130897	ENST00000515098.1:c.135C>T	5.37:g.177565255C>T		Somatic	109	0		WXS	Illumina GAIIx	Phase_I	182	6	NM_022762	0	0	2	2	0	Q1HE27|Q6UVY7|Q9H6F6	Silent	SNP	ENST00000515098.1	37	CCDS4431.1																																																																																			C|0.977;T|0.023		0.637	RMND5B-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000373542.1	NM_022762	
PHYKPL	85007	hgsc.bcm.edu	37	5	177659519	177659519	+	Silent	SNP	C	C	G	rs116735771	byFrequency	TCGA-OR-A5KY-01A-11D-A29I-10	TCGA-OR-A5KY-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	72f9e1d9-c852-423a-94ff-17f763fa2713	f6e93da3-9ee7-4a65-bc04-30f8bb730eef	g.chr5:177659519C>G	ENST00000308158.5	-	1	267	c.33G>C	c.(31-33)acG>acC	p.T11T	PHYKPL_ENST00000481811.1_5'Flank|PHYKPL_ENST00000476170.2_Silent_p.T11T	NM_153373.2	NP_699204.1	Q8IUZ5	AT2L2_HUMAN	5-phosphohydroxy-L-lysine phospho-lyase	11						mitochondrion (GO:0005739)	lyase activity (GO:0016829)|pyridoxal phosphate binding (GO:0030170)|transaminase activity (GO:0008483)									L-Alanine(DB00160)	TCAGGGCCAGCGTGTCGGCCT	0.776													G|||	765	0.152756	0.3419	0.0663	5008	,	,		8862	0.1052		0.0755	False		,,,				2504	0.0869				p.T11T		.											.	AGXT2L2-91	0			c.G33C						.	G		758,2778		67,624,1077	3.0	3.0	3.0		33	-4.8	0.9	5	dbSNP_132	3	393,6805		10,373,3216	no	coding-synonymous	AGXT2L2	NM_153373.2		77,997,4293	GG,GC,CC		5.4598,21.4367,10.7229		11/451	177659519	1151,9583	1768	3599	5367	SO:0001819	synonymous_variant	85007	exon1			GGCCAGCGTGTCG	BC037567	CCDS4434.1	5q35.3	2013-06-12	2013-06-12	2013-06-12	ENSG00000175309	ENSG00000175309	4.2.3.134		28249	protein-coding gene	gene with protein product	"""5-phosphonooxy-L-lysine phospho-lyase"""	614683	"""alanine-glyoxylate aminotransferase 2-like 2"""	AGXT2L2		22241472	Standard	NM_153373		Approved	MGC15875	uc003miz.3	Q8IUZ5	OTTHUMG00000130892	ENST00000308158.5:c.33G>C	5.37:g.177659519C>G		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	15	9	NM_153373	0	0	3	5	2	A8K7P6|B3KN36|D3DWP9|Q8WYS6|Q96HW8	Silent	SNP	ENST00000308158.5	37	CCDS4434.1																																																																																			C|0.854;G|0.146		0.776	PHYKPL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253477.1	NM_032921	
PPP1R3G	648791	hgsc.bcm.edu	37	6	5086070	5086070	+	Silent	SNP	A	A	G	rs667752		TCGA-OR-A5KY-01A-11D-A29I-10	TCGA-OR-A5KY-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	72f9e1d9-c852-423a-94ff-17f763fa2713	f6e93da3-9ee7-4a65-bc04-30f8bb730eef	g.chr6:5086070A>G	ENST00000405617.2	+	1	351	c.351A>G	c.(349-351)gcA>gcG	p.A117A		NM_001145115.1	NP_001138587.1	B7ZBB8	PP13G_HUMAN	protein phosphatase 1, regulatory subunit 3G	117					glucose homeostasis (GO:0042593)|positive regulation of glycogen (starch) synthase activity (GO:2000467)|positive regulation of glycogen biosynthetic process (GO:0045725)	cytoplasm (GO:0005737)	glycogen binding (GO:2001069)			kidney(2)	2						CGGAGGACGCACAGCTCGGCC	0.692													G|||	5008	1.0	1.0	1.0	5008	,	,		12505	1.0		1.0	False		,,,				2504	1.0				p.A117A		.											.	PPP1R3G-136	0			c.A351G						.						1.0	2.0	2.0					6																	5086070		400	1062	1462	SO:0001819	synonymous_variant	648791	exon1			GGACGCACAGCTC		CCDS47366.1	6p25.1	2012-04-17	2011-10-04		ENSG00000219607	ENSG00000219607		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	14945	protein-coding gene	gene with protein product			"""protein phosphatase 1, regulatory (inhibitor) subunit 3G"""			11948623	Standard	NM_001145115		Approved		uc011dia.1	B7ZBB8	OTTHUMG00000014172	ENST00000405617.2:c.351A>G	6.37:g.5086070A>G		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	6	6	NM_001145115	0	0	0	2	2		Silent	SNP	ENST00000405617.2	37	CCDS47366.1																																																																																			A|0.006;G|0.994		0.692	PPP1R3G-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039740.3	NM_001145115	
HIST1H2AG	8969	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	27101075	27101075	+	Missense_Mutation	SNP	G	G	C			TCGA-OR-A5KY-01A-11D-A29I-10	TCGA-OR-A5KY-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	72f9e1d9-c852-423a-94ff-17f763fa2713	f6e93da3-9ee7-4a65-bc04-30f8bb730eef	g.chr6:27101075G>C	ENST00000359193.2	+	1	244	c.225G>C	c.(223-225)aaG>aaC	p.K75N	HIST1H2BJ_ENST00000541790.1_5'Flank|HIST1H2BJ_ENST00000607124.1_5'Flank|HIST1H2BJ_ENST00000339812.2_5'Flank	NM_021064.4	NP_066408.1	P0C0S8	H2A1_HUMAN	histone cluster 1, H2ag	75						extracellular vesicular exosome (GO:0070062)|nucleosome (GO:0000786)|nucleus (GO:0005634)	DNA binding (GO:0003677)|enzyme binding (GO:0019899)			biliary_tract(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(1)|lung(4)|ovary(1)|urinary_tract(1)	17						GCGACAACAAGAAGACCCGCA	0.662																																					p.K75N		.											.	HIST1H2AG-68	0			c.G225C						.						85.0	85.0	85.0					6																	27101075		2203	4300	6503	SO:0001583	missense	8969	exon1			CAACAAGAAGACC	L19778	CCDS4619.1	6p22.1	2011-01-27	2006-10-11	2003-02-21	ENSG00000196787	ENSG00000196787		"""Histones / Replication-dependent"""	4737	protein-coding gene	gene with protein product		615012	"""H2A histone family, member P"", ""histone 1, H2ag"""	H2AFP		8179821, 12408966	Standard	NM_021064		Approved	pH2A/f, H2A/p, H2A.1b	uc003niw.3	P0C0S8	OTTHUMG00000014469	ENST00000359193.2:c.225G>C	6.37:g.27101075G>C	ENSP00000352119:p.Lys75Asn	Somatic	242	0		WXS	Illumina GAIIx	Phase_I	301	212	NM_021064	0	0	2	4	2	P02261|Q2M1R2|Q76PA6	Missense_Mutation	SNP	ENST00000359193.2	37	CCDS4619.1	.	.	.	.	.	.	.	.	.	.	G	19.75	3.885947	0.72410	.	.	ENSG00000196787	ENST00000359193	T	0.75050	-0.9	4.08	4.08	0.47627	Histone-fold (2);Histone core (1);Histone H2A (2);	0.000000	0.42053	D	0.000768	T	0.72898	0.3518	.	.	.	0.39604	D	0.969783	P	0.35107	0.484	P	0.46543	0.52	T	0.78593	-0.2144	9	0.72032	D	0.01	.	14.6102	0.68510	0.0:0.0:1.0:0.0	.	75	P0C0S8	H2A1_HUMAN	N	75	ENSP00000352119:K75N	ENSP00000352119:K75N	K	+	3	2	HIST1H2AG	27209054	1.000000	0.71417	1.000000	0.80357	0.915000	0.54546	4.653000	0.61462	2.217000	0.71921	0.655000	0.94253	AAG	.		0.662	HIST1H2AG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040137.1	NM_021064	
RNF39	80352	hgsc.bcm.edu	37	6	30039364	30039364	+	Missense_Mutation	SNP	C	C	A	rs11753382	byFrequency	TCGA-OR-A5KY-01A-11D-A29I-10	TCGA-OR-A5KY-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	72f9e1d9-c852-423a-94ff-17f763fa2713	f6e93da3-9ee7-4a65-bc04-30f8bb730eef	g.chr6:30039364C>A	ENST00000244360.6	-	4	884	c.787G>T	c.(787-789)Ggc>Tgc	p.G263C	RNF39_ENST00000376751.3_Missense_Mutation_p.G263C	NM_025236.3	NP_079512.2	Q9H2S5	RNF39_HUMAN	ring finger protein 39	263	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.					cytoplasm (GO:0005737)	zinc ion binding (GO:0008270)										CGCTTGGGGCCGTCAGGGGGC	0.741													c|||	749	0.149561	0.2489	0.134	5008	,	,		10967	0.1528		0.0447	False		,,,				2504	0.1309				p.G263C	NSCLC(8;188 360 1520 20207 31481)	.											.	RNF39-226	0			c.G787T						.		CYS/GLY,CYS/GLY	414,2026		21,372,827	3.0	2.0	2.0		787,787	0.5	0.1	6	dbSNP_120	2	229,4029		6,217,1906	yes	missense,missense	RNF39	NM_025236.3,NM_170769.2	159,159	27,589,2733	AA,AC,CC		5.3781,16.9672,9.5999	benign,benign	263/421,263/355	30039364	643,6055	1220	2129	3349	SO:0001583	missense	80352	exon4			TGGGGCCGTCAGG	AF238315	CCDS4673.1, CCDS4674.1	6p21.3	2013-01-09			ENSG00000204618	ENSG00000204618		"""RING-type (C3HC4) zinc fingers"""	18064	protein-coding gene	gene with protein product		607524				11130983, 11716498	Standard	NM_170769		Approved	HZFw1, LIRF	uc003npe.3	Q9H2S5	OTTHUMG00000031288	ENST00000244360.6:c.787G>T	6.37:g.30039364C>A	ENSP00000244360:p.Gly263Cys	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	18	15	NM_025236	0	0	0	0	0	A2BEK3|A6NCD6|B0S858|Q5SPM8|Q5SPM9|Q5SPN0|Q5SRJ9|Q5SRK1|Q5SS29|Q9H2S3|Q9H2S4	Missense_Mutation	SNP	ENST00000244360.6	37	CCDS4673.1	299	0.13690476190476192	120	0.24390243902439024	56	0.15469613259668508	90	0.15734265734265734	33	0.04353562005277045	c	11.55	1.672102	0.29693	0.169672	0.053781	ENSG00000204618	ENST00000376751;ENST00000244360	T;T	0.10382	2.88;2.88	4.7	0.543	0.17179	Concanavalin A-like lectin/glucanase (1);SPRY-associated (1);B30.2/SPRY domain (1);	0.296117	0.23738	N	0.045041	T	0.03348	0.0097	N	0.19112	0.55	0.48696	P	3.009999999999957E-4	B;P	0.48407	0.06;0.91	B;P	0.47626	0.092;0.552	T	0.41305	-0.9516	9	0.56958	D	0.05	-19.3451	7.7639	0.28968	0.0:0.4441:0.0:0.5559	rs11753382	263;263	Q9H2S5;Q9H2S5-2	RNF39_HUMAN;.	C	263	ENSP00000365942:G263C;ENSP00000244360:G263C	ENSP00000244360:G263C	G	-	1	0	RNF39	30147343	0.003000	0.15002	0.059000	0.19551	0.050000	0.14768	0.158000	0.16422	-0.104000	0.12154	0.466000	0.42574	GGC	C|0.862;A|0.138		0.741	RNF39-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000076625.3	NM_170769	
HLA-B	3106	bcgsc.ca	37	6	31324489	31324489	+	Missense_Mutation	SNP	C	C	G	rs3180380|rs554035740	byFrequency	TCGA-OR-A5KY-01A-11D-A29I-10	TCGA-OR-A5KY-10A-01D-A29L-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	72f9e1d9-c852-423a-94ff-17f763fa2713	f6e93da3-9ee7-4a65-bc04-30f8bb730eef	g.chr6:31324489C>G	ENST00000412585.2	-	2	347	c.319G>C	c.(319-321)Ggc>Cgc	p.G107R		NM_005514.6	NP_005505.2	P30486	1B48_HUMAN	major histocompatibility complex, class I, B	107	Alpha-1.				antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|immune response (GO:0006955)|positive regulation of T cell mediated cytotoxicity (GO:0001916)|viral process (GO:0016032)	cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|MHC class I protein complex (GO:0042612)	peptide antigen binding (GO:0042605)			endometrium(4)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(4)|lung(4)|prostate(1)|upper_aerodigestive_tract(2)	27						TTGTAGTAGCCGCGCAGGTTC	0.682									Melanoma, Familial Clustering of;Lichen Sclerosis et Atrophicus, Familial Clustering of					1199	0.239417	0.3056	0.1657	5008	,	,		7077	0.1567		0.1889	False		,,,				2504	0.3395				p.G107R		.											.	HLA-B-90	0			c.G319C						.	C	ARG/GLY	189,4071		22,145,1963	39.0	42.0	41.0	http://www.ncbi.nlm.nih.gov/sites/varvu?gene	319	-1.0	0.0	6	dbSNP_105	41	392,7988		50,292,3848	no	missense	HLA-B	NM_005514.6	125	72,437,5811	GG,GC,CC		4.6778,4.4366,4.5965		107/363	31324489	581,12059	2130	4190	6320	SO:0001583	missense	3106	exon2	Familial Cancer Database	;Lichen Sclerosis, Familial	AGTAGCCGCGCAG	M15470	CCDS34394.1	6p21.3	2013-01-11			ENSG00000234745	ENSG00000234745		"""Histocompatibility complex"", ""Immunoglobulin superfamily / C1-set domain containing"""	4932	protein-coding gene	gene with protein product		142830	"""ankylosing spondylitis"""	AS		3459708	Standard	NM_005514		Approved		uc011imz.2	P01889	OTTHUMG00000031153	ENST00000412585.2:c.319G>C	6.37:g.31324489C>G	ENSP00000399168:p.Gly107Arg	Somatic	49	0		WXS	Illumina GAIIx	Phase_I	21	9	NM_005514	0	0	188	188	0	Q29764	Missense_Mutation	SNP	ENST00000412585.2	37	CCDS34394.1	335	0.1533882783882784	112	0.22764227642276422	45	0.12430939226519337	77	0.1346153846153846	101	0.13324538258575197	N	4.097	0.016016	0.07959	0.044366	0.046778	ENSG00000234745	ENST00000412585;ENST00000434333	T;T	0.00011	9.37;9.37	3.2	-0.991	0.10235	MHC class I, alpha chain, alpha1/alpha2 (4);MHC classes I/II-like antigen recognition protein (2);MHC class I-like antigen recognition (2);	0.716624	0.10407	N	0.678426	T	0.00039	0.0001	N	0.16903	0.455	0.80722	P	0.0	B;B;D	0.89917	0.067;0.004;1.0	B;B;D	0.97110	0.027;0.022;1.0	T	0.34104	-0.9842	9	0.25106	T	0.35	.	7.1932	0.25837	0.0:0.5584:0.3329:0.1087	rs3180380;rs9266159	107;107;82	P30480;P01889;Q92671	1B42_HUMAN;1B07_HUMAN;.	R	107;118	ENSP00000399168:G107R;ENSP00000405931:G118R	ENSP00000399168:G107R	G	-	1	0	HLA-B	31432468	0.000000	0.05858	0.008000	0.14137	0.000000	0.00434	-1.685000	0.01930	-0.410000	0.07542	-2.476000	0.00200	GGC	G|0.370;C|0.630		0.682	HLA-B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076280.4	NM_005514	
SLC44A4	80736	broad.mit.edu	37	6	31842716	31842716	+	Missense_Mutation	SNP	G	G	C			TCGA-OR-A5KY-01A-11D-A29I-10	TCGA-OR-A5KY-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	72f9e1d9-c852-423a-94ff-17f763fa2713	f6e93da3-9ee7-4a65-bc04-30f8bb730eef	g.chr6:31842716G>C	ENST00000229729.6	-	5	352	c.332C>G	c.(331-333)cCc>cGc	p.P111R	SLC44A4_ENST00000375562.4_Missense_Mutation_p.P111R|SLC44A4_ENST00000544672.1_Missense_Mutation_p.P35R|SLC44A4_ENST00000465707.1_5'UTR	NM_025257.2	NP_079533.2	Q53GD3	CTL4_HUMAN	solute carrier family 44, member 4	111					acetylcholine biosynthetic process (GO:0008292)|acetylcholine secretion (GO:0061526)|glycerophospholipid biosynthetic process (GO:0046474)|phosphatidylcholine biosynthetic process (GO:0006656)|phospholipid metabolic process (GO:0006644)|positive regulation of cell growth (GO:0030307)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(11)|ovary(2)|prostate(3)|skin(1)|urinary_tract(2)	35					Choline(DB00122)	CTGGGGTGTGGGGCACTGTAG	0.567																																					p.P111R		.											.	SLC44A4-156	0			c.C332G						.						135.0	151.0	145.0					6																	31842716		1511	2709	4220	SO:0001583	missense	80736	exon5			GGTGTGGGGCACT	AF134726	CCDS4724.2, CCDS54989.1, CCDS54990.1	6p21.3	2014-02-17	2005-09-06	2005-09-06	ENSG00000204385	ENSG00000204385		"""Solute carriers"""	13941	protein-coding gene	gene with protein product		606107	"""chromosome 6 open reading frame 29"""	C6orf29		10677542, 15715662, 24379411	Standard	NM_025257		Approved	NG22, CTL4, FLJ14491, TPPT	uc010jti.3	Q53GD3	OTTHUMG00000031133	ENST00000229729.6:c.332C>G	6.37:g.31842716G>C	ENSP00000229729:p.Pro111Arg	Somatic	46	2		WXS	Illumina GAIIx	Phase_I	79	31	NM_001178044	0	0	0	0	0	A2BED3|B0UXX8|B0UZY8|B4DU94|B4DWM2|E9PEK7|Q5JP84|Q5JQ93|Q658S8|Q6UX89|Q8TEW4|Q96C58|Q96K59|Q9Y332	Missense_Mutation	SNP	ENST00000229729.6	37	CCDS4724.2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	g|g	17.54|17.54	3.415745|3.415745	0.62511|0.62511	.|.	.|.	ENSG00000204385|ENSG00000204385	ENST00000414427|ENST00000229729;ENST00000375562;ENST00000544672	T|T;T;T	0.67345|0.67523	-0.26|-0.27;-0.27;-0.27	5.19|5.19	5.19|5.19	0.71726|0.71726	.|.	0.124815|0.124815	0.53938|0.53938	D|D	0.000043|0.000043	T|T	0.81278|0.81278	0.4789|0.4789	M|M	0.88906|0.88906	2.99|2.99	0.58432|0.58432	D|D	0.999999|0.999999	.|D;D	.|0.71674	.|0.998;0.997	.|D;D	.|0.78314	.|0.991;0.949	D|D	0.84056|0.84056	0.0372|0.0372	8|10	0.56958|0.72032	D|D	0.05|0.01	-13.1994|-13.1994	14.0933|14.0933	0.65004|0.65004	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|111;111	.|E9PEK7;Q53GD3	.|.;CTL4_HUMAN	A|R	107|111;111;35	ENSP00000398901:P107A|ENSP00000229729:P111R;ENSP00000364712:P111R;ENSP00000444109:P35R	ENSP00000398901:P107A|ENSP00000229729:P111R	P|P	-|-	1|2	0|0	SLC44A4|SLC44A4	31950695|31950695	1.000000|1.000000	0.71417|0.71417	0.948000|0.948000	0.38648|0.38648	0.333000|0.333000	0.28666|0.28666	5.054000|5.054000	0.64275|0.64275	2.707000|2.707000	0.92482|0.92482	0.651000|0.651000	0.88453|0.88453	CCA|CCC	.		0.567	SLC44A4-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076234.3		
USP42	84132	hgsc.bcm.edu	37	7	6193521	6193521	+	Missense_Mutation	SNP	G	G	C	rs61729726	byFrequency	TCGA-OR-A5KY-01A-11D-A29I-10	TCGA-OR-A5KY-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	72f9e1d9-c852-423a-94ff-17f763fa2713	f6e93da3-9ee7-4a65-bc04-30f8bb730eef	g.chr7:6193521G>C	ENST00000306177.5	+	15	2494	c.2336G>C	c.(2335-2337)cGc>cCc	p.R779P		NM_032172.2	NP_115548.1	Q9H9J4	UBP42_HUMAN	ubiquitin specific peptidase 42	779	Pro-rich.				cell differentiation (GO:0030154)|protein deubiquitination (GO:0016579)|spermatogenesis (GO:0007283)|ubiquitin-dependent protein catabolic process (GO:0006511)		ubiquitin-specific protease activity (GO:0004843)			breast(1)|central_nervous_system(1)|endometrium(5)|kidney(4)|large_intestine(2)|lung(14)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|urinary_tract(1)	35		Ovarian(82;0.0423)		UCEC - Uterine corpus endometrioid carcinoma (126;0.108)|OV - Ovarian serous cystadenocarcinoma(56;5.77e-14)		CCGCCGCCCCGCGATCCCGGC	0.756													C|||	2895	0.578075	0.8638	0.4121	5008	,	,		10724	0.7331		0.3082	False		,,,				2504	0.4274				p.R779P		.											.	USP42-659	0			c.G2336C						.	C	PRO/ARG	2157,1125		751,655,235	4.0	6.0	5.0		2336	2.6	0.0	7	dbSNP_129	5	1843,5693		290,1263,2215	no	missense	USP42	NM_032172.2	103	1041,1918,2450	CC,CG,GG		24.4559,34.2779,36.9754	benign	779/1317	6193521	4000,6818	1641	3768	5409	SO:0001583	missense	84132	exon15			CGCCCCGCGATCC	AK022759	CCDS47535.1	7p22.2	2005-08-08	2005-08-08		ENSG00000106346	ENSG00000106346		"""Ubiquitin-specific peptidases"""	20068	protein-coding gene	gene with protein product			"""ubiquitin specific protease 42"""			12838346	Standard	NM_032172		Approved	FLJ12697	uc011jwp.2	Q9H9J4	OTTHUMG00000151888	ENST00000306177.5:c.2336G>C	7.37:g.6193521G>C	ENSP00000301962:p.Arg779Pro	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	27	12	NM_032172	0	0	0	0	0	A2RUE3|B5MDA5|Q0VIN8|Q3C166|Q6P9B4	Missense_Mutation	SNP	ENST00000306177.5	37	CCDS47535.1	1188	0.5439560439560439	401	0.8150406504065041	130	0.35911602209944754	440	0.7692307692307693	217	0.2862796833773087	C	10.95	1.494372	0.26774	0.657221	0.244559	ENSG00000106346	ENST00000306177;ENST00000426246	T;T	0.14266	2.52;2.93	5.46	2.59	0.31030	.	0.841331	0.10600	N	0.655737	T	0.00012	0.0000	N	0.08118	0	0.80722	P	0.0	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.09164	-1.0687	9	0.28530	T	0.3	.	2.8136	0.05448	0.1458:0.5508:0.1414:0.162	rs61729726	779;779	Q9H9J4-2;Q9H9J4	.;UBP42_HUMAN	P	779;625	ENSP00000301962:R779P;ENSP00000408217:R625P	ENSP00000301962:R779P	R	+	2	0	USP42	6160046	0.001000	0.12720	0.000000	0.03702	0.000000	0.00434	0.469000	0.22067	0.265000	0.21872	-0.120000	0.15030	CGC	G|0.456;C|0.544		0.756	USP42-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000324262.3	XM_166526	
DNAH11	8701	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	21778372	21778372	+	Nonsense_Mutation	SNP	G	G	T			TCGA-OR-A5KY-01A-11D-A29I-10	TCGA-OR-A5KY-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	72f9e1d9-c852-423a-94ff-17f763fa2713	f6e93da3-9ee7-4a65-bc04-30f8bb730eef	g.chr7:21778372G>T	ENST00000409508.3	+	47	7730	c.7699G>T	c.(7699-7701)Gga>Tga	p.G2567*	DNAH11_ENST00000328843.6_Nonsense_Mutation_p.G2574*	NM_001277115.1	NP_001264044.1	Q96DT5	DYH11_HUMAN	dynein, axonemal, heavy chain 11	2574	AAA 3. {ECO:0000250}.				microtubule-based movement (GO:0007018)	cilium (GO:0005929)|cytoplasm (GO:0005737)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(1)|autonomic_ganglia(1)|breast(13)|central_nervous_system(3)|cervix(4)|endometrium(18)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(50)|lung(101)|ovary(10)|pancreas(4)|prostate(7)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	230						TGGTCCTGGAGGAAATAAAAA	0.388									Kartagener syndrome																												.		.											.	DNAH11-146	0			.						.						50.0	50.0	50.0					7																	21778372		2016	4196	6212	SO:0001587	stop_gained	8701	.	Familial Cancer Database	Ciliary Dyskinesia, Primary (CILD1 - CILD13), Immotile Cilia Syndrome	CCTGGAGGAAATA	U83569	CCDS64602.1	7p21	2008-07-18	2006-09-04					"""Axonemal dyneins"""	2942	protein-coding gene	gene with protein product	"""dynein, ciliary, heavy chain 11"", ""dynein, heavy chain beta-like"""	603339	"""dynein, axonemal, heavy polypeptide 11"""			9256245	Standard	NM_001277115		Approved	Dnahc11, DPL11, CILD7, DNAHC11, DNAHBL, DNHBL	uc031swp.1	Q96DT5		ENST00000409508.3:c.7699G>T	7.37:g.21778372G>T	ENSP00000475939:p.Gly2567*	Somatic	60	0		WXS	Illumina GAIIx	Phase_I	80	23	.	0	0	3	3	0	Q9UJ82	Nonsense_Mutation	SNP	ENST00000409508.3	37		.	.	.	.	.	.	.	.	.	.	G	47	13.366820	0.99737	.	.	ENSG00000105877	ENST00000328843	.	.	.	5.41	5.41	0.78517	.	0.104089	0.64402	D	0.000005	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.59425	D	0.04	.	13.8476	0.63477	0.0757:0.0:0.9243:0.0	.	.	.	.	X	2574	.	ENSP00000330671:G2574X	G	+	1	0	DNAH11	21744897	1.000000	0.71417	0.998000	0.56505	0.017000	0.09413	4.229000	0.58625	2.689000	0.91719	0.655000	0.94253	GGA	.		0.388	DNAH11-001	KNOWN	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000326582.6	NM_003777	
GARS	2617	hgsc.bcm.edu	37	7	30634661	30634661	+	Missense_Mutation	SNP	C	C	G	rs1049402	byFrequency	TCGA-OR-A5KY-01A-11D-A29I-10	TCGA-OR-A5KY-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	72f9e1d9-c852-423a-94ff-17f763fa2713	f6e93da3-9ee7-4a65-bc04-30f8bb730eef	g.chr7:30634661C>G	ENST00000389266.3	+	1	365	c.124C>G	c.(124-126)Ccc>Gcc	p.P42A	AC005154.6_ENST00000579174.1_RNA|AC005154.6_ENST00000584199.1_RNA|AC005154.6_ENST00000584372.1_RNA|AC005154.6_ENST00000583664.1_RNA|AC005154.6_ENST00000580440.1_RNA|AC005154.6_ENST00000578994.1_RNA|AC005154.6_ENST00000581665.1_RNA|AC005154.6_ENST00000582549.1_RNA	NM_002047.2	NP_002038.2	P41250	SYG_HUMAN	glycyl-tRNA synthetase	42			P -> A (in dbSNP:rs1049402). {ECO:0000269|PubMed:14702039, ECO:0000269|PubMed:15489334, ECO:0000269|PubMed:7753621, ECO:0000269|PubMed:7961834, ECO:0000269|PubMed:7962006}.		cell death (GO:0008219)|diadenosine tetraphosphate biosynthetic process (GO:0015966)|gene expression (GO:0010467)|glycyl-tRNA aminoacylation (GO:0006426)|tRNA aminoacylation for protein translation (GO:0006418)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|mitochondrial matrix (GO:0005759)|nucleus (GO:0005634)|secretory granule (GO:0030141)	ATP binding (GO:0005524)|glycine-tRNA ligase activity (GO:0004820)|protein dimerization activity (GO:0046983)	p.P42fs*20(1)		breast(3)|endometrium(2)|kidney(1)|large_intestine(4)|lung(9)|ovary(1)|skin(3)|urinary_tract(1)	24					Glycine(DB00145)	GGCCTCCTGCCCCCCGATCTC	0.736													G|||	3252	0.649361	0.5219	0.7147	5008	,	,		13746	0.6677		0.7634	False		,,,				2504	0.6391				p.P42A		.											.	GARS-91	1	Insertion - Frameshift(1)	large_intestine(1)	c.C124G						.	G	ALA/PRO	2445,1427		776,893,267	5.0	8.0	7.0		124	-6.6	0.0	7	dbSNP_86	7	6367,1671		2577,1213,229	no	missense	GARS	NM_002047.2	27	3353,2106,496	GG,GC,CC		20.7888,36.8543,26.0118	benign	42/740	30634661	8812,3098	1936	4019	5955	SO:0001583	missense	2617	exon1			TCCTGCCCCCCGA	AK074524	CCDS43564.1	7p15	2014-09-17	2004-02-13		ENSG00000106105	ENSG00000106105	6.1.1.14	"""Aminoacyl tRNA synthetases / Class II"""	4162	protein-coding gene	gene with protein product	"""glycine tRNA ligase"""	600287	"""Charcot-Marie-Tooth neuropathy 2D"""	CMT2D		8595897, 8872480	Standard	NM_002047		Approved	GlyRS, DSMAV, SMAD1	uc003tbm.3	P41250	OTTHUMG00000152769	ENST00000389266.3:c.124C>G	7.37:g.30634661C>G	ENSP00000373918:p.Pro42Ala	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	15	8	NM_002047	0	0	9	31	22	B3KQA2|B4DIA0|Q969Y1	Missense_Mutation	SNP	ENST00000389266.3	37	CCDS43564.1	1456	0.6666666666666666	278	0.5650406504065041	268	0.7403314917127072	337	0.5891608391608392	573	0.7559366754617414	G	0.005	-2.164835	0.00318	0.631457	0.792112	ENSG00000106105	ENST00000389266	T	0.80393	-1.37	3.31	-6.63	0.01807	.	1.037800	0.07609	N	0.925137	T	0.00012	0.0000	N	0.08118	0	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.13575	-1.0504	9	0.08179	T	0.78	.	5.5596	0.17135	0.0726:0.2689:0.1197:0.5389	rs1049402;rs3189564;rs11553500;rs17856223;rs17856227;rs1049402	42	P41250	SYG_HUMAN	A	42	ENSP00000373918:P42A	ENSP00000373918:P42A	P	+	1	0	GARS	30601186	0.000000	0.05858	0.000000	0.03702	0.037000	0.13140	-0.671000	0.05250	-2.551000	0.00479	-0.744000	0.03518	CCC	C|0.329;G|0.671		0.736	GARS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000327735.1	NM_002047	
RAMP3	10268	hgsc.bcm.edu	37	7	45197433	45197433	+	Silent	SNP	G	G	A	rs67477213	byFrequency	TCGA-OR-A5KY-01A-11D-A29I-10	TCGA-OR-A5KY-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	72f9e1d9-c852-423a-94ff-17f763fa2713	f6e93da3-9ee7-4a65-bc04-30f8bb730eef	g.chr7:45197433G>A	ENST00000242249.4	+	1	44	c.6G>A	c.(4-6)gaG>gaA	p.E2E	RAMP3_ENST00000496212.1_Silent_p.E2E|RAMP3_ENST00000481345.1_Silent_p.E2E	NM_005856.2	NP_005847.1	O60896	RAMP3_HUMAN	receptor (G protein-coupled) activity modifying protein 3	2					calcium ion transport (GO:0006816)|cellular response to estradiol stimulus (GO:0071392)|G-protein coupled receptor signaling pathway involved in heart process (GO:0086103)|intracellular protein transport (GO:0006886)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|positive regulation of receptor recycling (GO:0001921)|protein localization to plasma membrane (GO:0072659)|protein transport (GO:0015031)|receptor internalization (GO:0031623)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)	cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)|lysosome (GO:0005764)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	coreceptor activity (GO:0015026)|protein transporter activity (GO:0008565)|receptor activity (GO:0004872)			breast(1)|endometrium(1)|large_intestine(4)|lung(4)|stomach(1)	11					Pramlintide(DB01278)	CAGCCATGGAGACTGGAGCGC	0.771													G|||	1244	0.248403	0.4947	0.1657	5008	,	,		7876	0.0159		0.2276	False		,,,				2504	0.2352				p.E2E		.											.	RAMP3-90	0			c.G6A						.	G		1194,2386		196,802,792	3.0	3.0	3.0		6	2.0	0.0	7	dbSNP_130	3	1312,6004		141,1030,2487	no	coding-synonymous	RAMP3	NM_005856.2		337,1832,3279	AA,AG,GG		17.9333,33.352,22.9993		2/149	45197433	2506,8390	1790	3658	5448	SO:0001819	synonymous_variant	10268	exon1			CATGGAGACTGGA	AJ001016	CCDS5503.1	7p13-p12	2006-11-21	2006-11-21		ENSG00000122679	ENSG00000122679		"""Receptor (G protein-coupled) activity modifying proteins"""	9845	protein-coding gene	gene with protein product		605155	"""receptor activity modifying protein 3"", ""receptor (calcitonin) activity modifying protein 3"""				Standard	NM_005856		Approved		uc003tnb.3	O60896	OTTHUMG00000023729	ENST00000242249.4:c.6G>A	7.37:g.45197433G>A		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	17	8	NM_005856	0	0	7	11	4	Q7Z2Y1	Silent	SNP	ENST00000242249.4	37	CCDS5503.1																																																																																			G|0.760;A|0.240		0.771	RAMP3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000251343.1	NM_005856	
ARPC1B	10095	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	7	98988567	98988567	+	Silent	SNP	G	G	A	rs199528626		TCGA-OR-A5KY-01A-11D-A29I-10	TCGA-OR-A5KY-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	72f9e1d9-c852-423a-94ff-17f763fa2713	f6e93da3-9ee7-4a65-bc04-30f8bb730eef	g.chr7:98988567G>A	ENST00000451682.1	+	8	861	c.552G>A	c.(550-552)ccG>ccA	p.P184P	ARPC1B_ENST00000252725.5_Silent_p.P184P|PDAP1_ENST00000496335.1_5'Flank			O15143	ARC1B_HUMAN	actin related protein 2/3 complex, subunit 1B, 41kDa	184					Arp2/3 complex-mediated actin nucleation (GO:0034314)|cellular component movement (GO:0006928)	actin cytoskeleton (GO:0015629)|Arp2/3 protein complex (GO:0005885)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)	structural constituent of cytoskeleton (GO:0005200)			central_nervous_system(1)|endometrium(2)|large_intestine(5)|liver(2)|lung(1)	11	all_cancers(62;3.49e-09)|all_epithelial(64;2.57e-10)|Lung NSC(181;0.0053)|all_lung(186;0.00895)|Esophageal squamous(72;0.0166)		STAD - Stomach adenocarcinoma(171;0.215)			CACCCACCCCGTGGGGCTCCA	0.597													G|||	1	0.000199681	0.0	0.0014	5008	,	,		18631	0.0		0.0	False		,,,				2504	0.0				p.P184P		.											.	ARPC1B-90	0			c.G552A						.						47.0	47.0	47.0					7																	98988567		2203	4300	6503	SO:0001819	synonymous_variant	10095	exon6			CACCCCGTGGGGC	AF006084	CCDS5661.1	7q22.1	2013-03-14	2002-08-29		ENSG00000130429	ENSG00000130429		"""Actin related protein 2/3 complex subunits"", ""WD repeat domain containing"""	704	protein-coding gene	gene with protein product	"""ARP2/3 protein complex subunit p41"", ""actin related protein 2/3 complex, subunit 1A (41 kD)"""	604223	"""actin related protein 2/3 complex, subunit 1B (41 kD)"""			9230079, 9359840	Standard	NM_005720		Approved	ARC41, p40-ARC, p41-ARC	uc003upz.3	O15143	OTTHUMG00000154552	ENST00000451682.1:c.552G>A	7.37:g.98988567G>A		Somatic	70	0		WXS	Illumina GAIIx	Phase_I	91	25	NM_005720	0	0	125	160	35	Q9BU00	Silent	SNP	ENST00000451682.1	37	CCDS5661.1																																																																																			G|0.999;A|0.000		0.597	ARPC1B-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335894.1	NM_005720	
HYAL4	23553	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	123516971	123516971	+	Missense_Mutation	SNP	C	C	A			TCGA-OR-A5KY-01A-11D-A29I-10	TCGA-OR-A5KY-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	72f9e1d9-c852-423a-94ff-17f763fa2713	f6e93da3-9ee7-4a65-bc04-30f8bb730eef	g.chr7:123516971C>A	ENST00000223026.4	+	5	1846	c.1208C>A	c.(1207-1209)gCa>gAa	p.A403E	HYAL4_ENST00000476325.1_Missense_Mutation_p.A403E	NM_012269.2	NP_036401.2	Q2M3T9	HYAL4_HUMAN	hyaluronoglucosaminidase 4	403					carbohydrate metabolic process (GO:0005975)|chondroitin sulfate catabolic process (GO:0030207)|glycosaminoglycan catabolic process (GO:0006027)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)	hyalurononglucosaminidase activity (GO:0004415)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(8)|ovary(1)|skin(2)|upper_aerodigestive_tract(2)	23						TTGAACCCTGCAAGTTACCAC	0.502																																					p.A403E		.											.	HYAL4-91	0			c.C1208A						.						131.0	123.0	126.0					7																	123516971		2203	4300	6503	SO:0001583	missense	23553	exon5			ACCCTGCAAGTTA	AF009010	CCDS5789.1	7q31.3	2010-01-14			ENSG00000106302	ENSG00000106302			5323	protein-coding gene	gene with protein product	"""hyaluronidase 4"""	604510				10493834	Standard	NM_012269		Approved		uc003vlc.3	Q2M3T9	OTTHUMG00000157349	ENST00000223026.4:c.1208C>A	7.37:g.123516971C>A	ENSP00000223026:p.Ala403Glu	Somatic	201	0		WXS	Illumina GAIIx	Phase_I	222	57	NM_012269	0	0	0	0	0	D0VXG1|Q9UL99|Q9Y6T9	Missense_Mutation	SNP	ENST00000223026.4	37	CCDS5789.1	.	.	.	.	.	.	.	.	.	.	C	0.013	-1.618940	0.00828	.	.	ENSG00000106302	ENST00000223026;ENST00000476325	T;T	0.16597	2.33;2.33	5.86	2.62	0.31277	Epidermal growth factor-like (1);	1.042050	0.07469	N	0.902029	T	0.10078	0.0247	L	0.37800	1.135	0.09310	N	1	B	0.23442	0.085	B	0.19666	0.026	T	0.40251	-0.9573	10	0.02654	T	1	-2.5202	1.8186	0.03105	0.3751:0.351:0.1165:0.1574	.	403	Q2M3T9	HYAL4_HUMAN	E	403	ENSP00000223026:A403E;ENSP00000417186:A403E	ENSP00000223026:A403E	A	+	2	0	HYAL4	123304207	0.000000	0.05858	0.054000	0.19295	0.293000	0.27360	0.067000	0.14510	0.912000	0.36772	-0.142000	0.14014	GCA	.		0.502	HYAL4-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348545.1	NM_012269	
PODXL	5420	hgsc.bcm.edu	37	7	131241030	131241035	+	In_Frame_Del	DEL	GGCGAC	GGCGAC	-	rs11277659|rs547816245|rs532078953	byFrequency	TCGA-OR-A5KY-01A-11D-A29I-10	TCGA-OR-A5KY-10A-01D-A29L-10	GGCGAC	GGCGAC	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	72f9e1d9-c852-423a-94ff-17f763fa2713	f6e93da3-9ee7-4a65-bc04-30f8bb730eef	g.chr7:131241030_131241035delGGCGAC	ENST00000378555.3	-	1	331_336	c.84_89delGTCGCC	c.(82-90)ccgtcgccc>ccc	p.28_30PSP>P	PODXL_ENST00000537928.1_In_Frame_Del_p.28_30PSP>P|PODXL_ENST00000322985.9_In_Frame_Del_p.28_30PSP>P|PODXL_ENST00000541194.1_In_Frame_Del_p.28_30PSP>P|PODXL_ENST00000465001.1_Intron			O00592	PODXL_HUMAN	podocalyxin-like	28					cell adhesion (GO:0007155)|cell migration (GO:0016477)|epithelial tube formation (GO:0072175)|glomerular visceral epithelial cell development (GO:0072015)|leukocyte migration (GO:0050900)|negative regulation of cell adhesion (GO:0007162)|negative regulation of cell-cell adhesion (GO:0022408)|positive regulation of cell migration (GO:0030335)|positive regulation of cell-cell adhesion mediated by integrin (GO:0033634)|regulation of microvillus assembly (GO:0032534)	apical plasma membrane (GO:0016324)|cell body (GO:0044297)|cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|integral component of plasma membrane (GO:0005887)|lamellipodium (GO:0030027)|microvillus membrane (GO:0031528)|plasma membrane (GO:0005886)|ruffle (GO:0001726)|slit diaphragm (GO:0036057)		p.P30_S31delPS(2)		NS(1)|breast(3)|endometrium(3)|kidney(3)|large_intestine(4)|lung(4)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	24	Melanoma(18;0.162)					ATTCTGGGAGggcgacggcgacggcg	0.748																																					p.28_30del		.											.	PODXL-136	2	Deletion - In frame(2)	prostate(2)	c.84_89del						.																																			SO:0001651	inframe_deletion	5420	exon1			TGGGAGGGCGACG		CCDS34755.1, CCDS47714.1	7q32-q33	2008-07-18			ENSG00000128567	ENSG00000128567			9171	protein-coding gene	gene with protein product		602632					Standard	NM_001018111		Approved	PCLP, Gp200, PC	uc003vqx.4	O00592	OTTHUMG00000154918	ENST00000378555.3:c.84_89delGTCGCC	7.37:g.131241036_131241041delGGCGAC	ENSP00000367817:p.Pro30_Ser31del	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	35	17	NM_001018111	0	0	0	0	0	A6NHX8|Q52LZ7|Q53ER6	In_Frame_Del	DEL	ENST00000378555.3	37	CCDS34755.1																																																																																			.		0.748	PODXL-005	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000337627.2	NM_001018111	
MCPH1	79648	broad.mit.edu	37	8	6264212	6264212	+	Splice_Site	SNP	T	T	G			TCGA-OR-A5KY-01A-11D-A29I-10	TCGA-OR-A5KY-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	72f9e1d9-c852-423a-94ff-17f763fa2713	f6e93da3-9ee7-4a65-bc04-30f8bb730eef	g.chr8:6264212T>G	ENST00000344683.5	+	1	98		c.e1+2		RP11-115C21.2_ENST00000500118.2_RNA|RP11-115C21.2_ENST00000523225.1_RNA|RP11-115C21.2_ENST00000606853.1_RNA|MCPH1_ENST00000519480.1_Splice_Site|MCPH1_ENST00000522905.1_Splice_Site	NM_024596.3	NP_078872	Q8NEM0	MCPH1_HUMAN	microcephalin 1						cerebral cortex development (GO:0021987)|mitotic cell cycle (GO:0000278)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleoplasm (GO:0005654)	identical protein binding (GO:0042802)		AGPAT5/MCPH1(2)	central_nervous_system(1)|large_intestine(4)|skin(1)	6		Hepatocellular(245;0.0663)		Colorectal(4;0.0505)		TCCTGAAAGGTGAGGTACTTC	0.726																																					.	Colon(95;1448 1467 8277 34473 35819)	.											.	MCPH1-229	0			c.22+2T>G						.						19.0	25.0	24.0					8																	6264212		1866	4099	5965	SO:0001630	splice_region_variant	79648	exon1			GAAAGGTGAGGTA	AK022909	CCDS43689.1, CCDS55190.1, CCDS55191.1	8p23.1	2012-11-26	2007-11-26		ENSG00000147316	ENSG00000147316			6954	protein-coding gene	gene with protein product	"""BRCT-repeat inhibitor of TERT expression 1"""	607117	"""microcephaly, primary autosomal recessive 1"""			9683597, 17925396	Standard	NM_024596		Approved	FLJ12847, BRIT1	uc003wqi.3	Q8NEM0	OTTHUMG00000163618	ENST00000344683.5:c.22+2T>G	8.37:g.6264212T>G		Somatic	56	2		WXS	Illumina GAIIx	Phase_I	99	12	NM_001172575	0	0	0	0	0	B4DWW2|E9PGU5|E9PH63|Q66GU1|Q9H9C7	Splice_Site	SNP	ENST00000344683.5	37	CCDS43689.1	.	.	.	.	.	.	.	.	.	.	T	12.94	2.087971	0.36855	.	.	ENSG00000147316	ENST00000344683;ENST00000519480;ENST00000522905	.	.	.	1.22	1.22	0.21188	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	4.6018	0.12357	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	+	.	.	MCPH1	6251620	1.000000	0.71417	0.954000	0.39281	0.217000	0.24651	0.730000	0.26043	0.814000	0.34374	0.383000	0.25322	.	.		0.726	MCPH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374532.2	NM_024596	Intron
MTUS1	57509	bcgsc.ca	37	8	17601155	17601155	+	Missense_Mutation	SNP	G	G	C			TCGA-OR-A5KY-01A-11D-A29I-10	TCGA-OR-A5KY-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	72f9e1d9-c852-423a-94ff-17f763fa2713	f6e93da3-9ee7-4a65-bc04-30f8bb730eef	g.chr8:17601155G>C	ENST00000262102.6	-	3	2469	c.2245C>G	c.(2245-2247)Cga>Gga	p.R749G	MTUS1_ENST00000381869.3_Missense_Mutation_p.R749G|MTUS1_ENST00000519263.1_Missense_Mutation_p.R749G|MTUS1_ENST00000381862.3_Missense_Mutation_p.R749G	NM_001001924.2	NP_001001924.1	Q9ULD2	MTUS1_HUMAN	microtubule associated tumor suppressor 1	749					cellular response to peptide hormone stimulus (GO:0071375)|regulation of macrophage chemotaxis (GO:0010758)	extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				breast(1)|central_nervous_system(1)|endometrium(4)|kidney(4)|large_intestine(14)|lung(8)|ovary(1)|skin(2)|urinary_tract(1)	36				Colorectal(111;0.0778)		GATACGGCTCGATCAGCACTG	0.453																																					p.R749G		.											.	MTUS1-92	0			c.C2245G						.						69.0	70.0	70.0					8																	17601155		1874	4107	5981	SO:0001583	missense	57509	exon3			CGGCTCGATCAGC	AL096842	CCDS43716.1, CCDS43717.1, CCDS43718.1, CCDS43719.1, CCDS55204.1	8p22	2013-01-17	2009-10-20		ENSG00000129422	ENSG00000129422			29789	protein-coding gene	gene with protein product	"""AT2 receptor-interacting protein"", ""AT2R binding protein"", ""mitochondrial tumor suppressor gene 1"""	609589	"""mitochondrial tumor suppressor 1"""			10574462, 12692079	Standard	NM_001001931		Approved	MTSG1, KIAA1288, DKFZp586D1519, FLJ14295, ATIP1, MP44, ATBP, ICIS	uc003wxv.3	Q9ULD2	OTTHUMG00000163756	ENST00000262102.6:c.2245C>G	8.37:g.17601155G>C	ENSP00000262102:p.Arg749Gly	Somatic	119	9		WXS	Illumina GAIIx	Phase_I	108	11	NM_001001924	0	0	1	1	0	A8K135|B2RBJ6|B3KWJ9|B4DH03|B9EGA1|D3DSP8|Q63HJ6|Q659F4|Q6PK49|Q6URW7|Q8N4M6|Q8WTT9|Q9H7T2	Missense_Mutation	SNP	ENST00000262102.6	37	CCDS43717.1	.	.	.	.	.	.	.	.	.	.	G	9.834	1.189305	0.21954	.	.	ENSG00000129422	ENST00000381869;ENST00000262102;ENST00000519263;ENST00000381862	T;T;T;T	0.35789	2.72;1.29;2.72;1.7	4.87	2.95	0.34219	.	0.390125	0.23043	N	0.052590	T	0.45796	0.1360	L	0.36672	1.1	0.09310	N	1	P;B;D	0.89917	0.641;0.089;1.0	B;B;D	0.87578	0.244;0.043;0.998	T	0.20042	-1.0287	10	0.72032	D	0.01	-6.027	8.6585	0.34077	0.0:0.1603:0.6607:0.179	.	749;749;749	Q9ULD2-5;Q9ULD2-2;Q9ULD2	.;.;MTUS1_HUMAN	G	749	ENSP00000371293:R749G;ENSP00000262102:R749G;ENSP00000430167:R749G;ENSP00000371286:R749G	ENSP00000262102:R749G	R	-	1	2	MTUS1	17645435	0.015000	0.18098	0.037000	0.18230	0.027000	0.11550	0.967000	0.29344	0.675000	0.31264	0.655000	0.94253	CGA	.		0.453	MTUS1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000375247.1	XM_372031	
BHLHE22	27319	hgsc.bcm.edu	37	8	65493532	65493532	+	Missense_Mutation	SNP	T	T	A	rs62519835	byFrequency	TCGA-OR-A5KY-01A-11D-A29I-10	TCGA-OR-A5KY-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	72f9e1d9-c852-423a-94ff-17f763fa2713	f6e93da3-9ee7-4a65-bc04-30f8bb730eef	g.chr8:65493532T>A	ENST00000321870.1	+	1	719	c.185T>A	c.(184-186)cTg>cAg	p.L62Q	RP11-21C4.1_ENST00000517909.1_RNA	NM_152414.4	NP_689627.1	Q8NFJ8	BHE22_HUMAN	basic helix-loop-helix family, member e22	62					anterior commissure morphogenesis (GO:0021960)|cerebral cortex regionalization (GO:0021796)|corpus callosum morphogenesis (GO:0021540)|corticospinal tract morphogenesis (GO:0021957)|negative regulation of transcription, DNA-templated (GO:0045892)|retinal bipolar neuron differentiation (GO:0060040)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)	p.L62Q(1)		NS(1)|central_nervous_system(1)|lung(1)|prostate(1)|skin(1)	5						TCGTCGCCCCTGGGCTGCTTC	0.776													T|||	233	0.0465256	0.0053	0.0706	5008	,	,		6928	0.004		0.1481	False		,,,				2504	0.0245				p.L62Q	Colon(113;104 1586 2865 9855 18065)	.											.	BHLHE22-90	1	Substitution - Missense(1)	NS(1)	c.T185A						.	T	GLN/LEU	38,3528		0,38,1745	4.0	5.0	4.0		185	2.0	1.0	8	dbSNP_129	4	573,6683		11,551,3066	no	missense	BHLHE22	NM_152414.4	113	11,589,4811	AA,AT,TT		7.8969,1.0656,5.6459	probably-damaging	62/382	65493532	611,10211	1783	3628	5411	SO:0001583	missense	27319	exon1			CGCCCCTGGGCTG	U80755	CCDS6179.1	8q12.1	2009-01-12	2009-01-12	2009-01-12		ENSG00000180828		"""Basic helix-loop-helix proteins"""	11963	protein-coding gene	gene with protein product		613483	"""trinucleotide repeat containing 20"", ""basic helix-loop-helix domain containing, class B, 5"""	TNRC20, BHLHB5		9225980, 12213201, 18557763	Standard	NM_152414		Approved	CAGL85, Beta3, bHLHe22	uc003xvi.3	Q8NFJ8		ENST00000321870.1:c.185T>A	8.37:g.65493532T>A	ENSP00000318799:p.Leu62Gln	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	16	16	NM_152414	0	0	0	0	0		Missense_Mutation	SNP	ENST00000321870.1	37	CCDS6179.1	139	0.06364468864468864	5	0.01016260162601626	24	0.06629834254143646	1	0.0017482517482517483	109	0.1437994722955145	T	14.21	2.468289	0.43839	0.010656	0.078969	ENSG00000180828	ENST00000321870	D	0.97888	-4.59	3.18	1.96	0.26148	.	0.107189	0.40144	U	0.001175	T	0.10252	0.0251	N	0.24115	0.695	0.35078	P	0.23685	B	0.34015	0.435	B	0.31337	0.128	T	0.66941	-0.5796	9	0.54805	T	0.06	-9.9523	5.2123	0.15325	0.0:0.1025:0.1827:0.7148	rs62519835	62	Q8NFJ8	BHE22_HUMAN	Q	62	ENSP00000318799:L62Q	ENSP00000318799:L62Q	L	+	2	0	BHLHE22	65656086	0.992000	0.36948	1.000000	0.80357	0.982000	0.71751	2.935000	0.48963	0.410000	0.25675	0.374000	0.22700	CTG	T|0.935;A|0.065		0.776	BHLHE22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378549.1	NM_152414	
MAL2	114569	hgsc.bcm.edu	37	8	120220776	120220776	+	Splice_Site	DEL	G	G	-	rs398009582|rs71302978		TCGA-OR-A5KY-01A-11D-A29I-10	TCGA-OR-A5KY-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	72f9e1d9-c852-423a-94ff-17f763fa2713	f6e93da3-9ee7-4a65-bc04-30f8bb730eef	g.chr8:120220776delG	ENST00000276681.6	+	1	167	c.65delG	c.(64-66)cgg>cg	p.R22fs	MAL2_ENST00000521748.1_3'UTR	NM_052886.2	NP_443118.1	Q969L2	MAL2_HUMAN	mal, T-cell differentiation protein 2 (gene/pseudogene)	22						cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)						all_cancers(13;1.91e-26)|Lung NSC(37;8.61e-08)|Ovarian(258;0.018)|Hepatocellular(40;0.161)		STAD - Stomach adenocarcinoma(47;0.000967)			CCGCCGCCCCGGGGTCACCCT	0.771													GGG|GGGG|GGG|insertion	5008	1.0	1.0	1.0	5008	,	,		6681	1.0		1.0	False		,,,				2504	1.0				.		.											.	.	0			c.64+1G>-						.			1571,11		785,1,5	1.0	1.0	1.0			0.7	0.8	8	dbSNP_130	1	4116,22		2057,2,10	no	frameshift	MAL2	NM_052886.2		2842,3,15	A1A1,A1R,RR		0.5317,0.6953,0.5769			120220776	5687,33	184	483	667	SO:0001630	splice_region_variant	114569	exon1			CGCCCCGGGGTCA	AL117612	CCDS75780.1	8q23	2011-01-26	2011-01-26			ENSG00000147676			13634	protein-coding gene	gene with protein product	"""MAL proteolipid protein 2"""	609684				11549320	Standard	NM_052886		Approved		uc003yop.3	Q969L2		ENST00000276681.6:c.66+1G>-	8.37:g.120220776delG		Somatic	2	2		WXS	Illumina GAIIx	Phase_I	22	21	NM_052886	0	0	0	0	0	B2R520|Q6ZMD9	Splice_Site	DEL	ENST00000276681.6	37																																																																																				.		0.771	MAL2-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_052886	Frame_Shift_Del
SHARPIN	81858	hgsc.bcm.edu	37	8	145158503	145158503	+	Silent	SNP	G	G	T	rs11136254	byFrequency	TCGA-OR-A5KY-01A-11D-A29I-10	TCGA-OR-A5KY-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	72f9e1d9-c852-423a-94ff-17f763fa2713	f6e93da3-9ee7-4a65-bc04-30f8bb730eef	g.chr8:145158503G>T	ENST00000398712.2	-	1	590	c.154C>A	c.(154-156)Cgg>Agg	p.R52R	SHARPIN_ENST00000533948.1_Intron|MAF1_ENST00000532522.1_5'Flank|MAF1_ENST00000322428.5_5'Flank|MAF1_ENST00000534585.1_5'Flank	NM_030974.3	NP_112236.3	Q9H0F6	SHRPN_HUMAN	SHANK-associated RH domain interactor	52	Self-association. {ECO:0000250}.				apoptotic nuclear changes (GO:0030262)|brain development (GO:0007420)|keratinization (GO:0031424)|mitochondrion organization (GO:0007005)|negative regulation of inflammatory response (GO:0050728)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|protein homooligomerization (GO:0051260)|protein linear polyubiquitination (GO:0097039)|regulation of CD40 signaling pathway (GO:2000348)|regulation of tumor necrosis factor-mediated signaling pathway (GO:0010803)	cell junction (GO:0030054)|cytosol (GO:0005829)|dendrite (GO:0030425)|LUBAC complex (GO:0071797)|postsynaptic density (GO:0014069)	polyubiquitin binding (GO:0031593)|zinc ion binding (GO:0008270)			breast(1)|endometrium(1)|kidney(1)|lung(2)|ovary(2)	7	all_cancers(97;2.87e-11)|all_epithelial(106;2.16e-09)|Lung NSC(106;5.89e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;4.1e-42)|Epithelial(56;1.58e-40)|all cancers(56;6.12e-36)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.105)			CGCCCAGGCCGCTCAGGGTCC	0.771													G|||	4431	0.884784	0.6884	0.9366	5008	,	,		10154	0.999		0.9115	False		,,,				2504	0.9683				p.R52R		.											.	SHARPIN-523	0			c.C154A						.	G		1990,374		815,360,7	2.0	2.0	2.0		154	2.7	0.6	8	dbSNP_120	2	5503,323		2593,317,3	no	coding-synonymous	SHARPIN	NM_030974.3		3408,677,10	TT,TG,GG		5.5441,15.8206,8.5104		52/388	145158503	7493,697	1182	2913	4095	SO:0001819	synonymous_variant	81858	exon1			CAGGCCGCTCAGG	AL136816	CCDS43777.1	8q24.3	2005-08-09				ENSG00000179526			25321	protein-coding gene	gene with protein product		611885				11178875, 12753155	Standard	NM_030974		Approved	DKFZP434N1923, SIPL1	uc003zba.3	Q9H0F6		ENST00000398712.2:c.154C>A	8.37:g.145158503G>T		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	4	4	NM_030974	0	0	0	19	19	A6NEG3|C0L3L2|D3DWL3|Q8IXF5|Q8IXF6|Q8N2E7|Q8TB25|Q9BUE4	Silent	SNP	ENST00000398712.2	37	CCDS43777.1																																																																																			G|0.108;T|0.892		0.771	SHARPIN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382901.1	NM_030974	
TONSL	4796	hgsc.bcm.edu	37	8	145661675	145661675	+	Missense_Mutation	SNP	G	G	A	rs7830832	byFrequency	TCGA-OR-A5KY-01A-11D-A29I-10	TCGA-OR-A5KY-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	72f9e1d9-c852-423a-94ff-17f763fa2713	f6e93da3-9ee7-4a65-bc04-30f8bb730eef	g.chr8:145661675G>A	ENST00000409379.3	-	17	2170	c.2141C>T	c.(2140-2142)gCc>gTc	p.A714V	AC084125.4_ENST00000544423.1_RNA|AC084125.4_ENST00000442850.1_RNA	NM_013432.4	NP_038460.4	Q96HA7	TONSL_HUMAN	tonsoku-like, DNA repair protein	714			A -> V (in dbSNP:rs7830832). {ECO:0000269|PubMed:15489334}.		cytoplasmic sequestering of transcription factor (GO:0042994)|double-strand break repair via homologous recombination (GO:0000724)|regulation of RNA biosynthetic process (GO:2001141)|replication fork processing (GO:0031297)	cytoplasm (GO:0005737)|nuclear replication fork (GO:0043596)|nucleus (GO:0005634)	histone binding (GO:0042393)|transcription corepressor activity (GO:0003714)			biliary_tract(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(2)|lung(14)|ovary(3)|prostate(1)|skin(1)	26						CCTGACATGGGCCTGAGAGGC	0.652													G|||	2215	0.442292	0.3192	0.4265	5008	,	,		13977	0.4246		0.4662	False		,,,				2504	0.6135				p.A714V		.											.	TONSL-92	0			c.C2141T						.	G	VAL/ALA	1506,2844		286,934,955	19.0	26.0	24.0		2141	2.8	0.1	8	dbSNP_116	24	3865,4627		955,1955,1336	yes	missense	TONSL	NM_013432.4	64	1241,2889,2291	AA,AG,GG		45.5134,34.6207,41.8237	probably-damaging	714/1379	145661675	5371,7471	2175	4246	6421	SO:0001583	missense	4796	exon17			ACATGGGCCTGAG		CCDS34968.2	8q24.3	2013-01-10	2010-12-02	2010-11-30	ENSG00000160949	ENSG00000160949		"""Ankyrin repeat domain containing"""	7801	protein-coding gene	gene with protein product		604546	"""nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor-like 2"""	NFKBIL2		7738005, 11246458	Standard	NM_013432		Approved	IKBR	uc011llg.2	Q96HA7	OTTHUMG00000153122	ENST00000409379.3:c.2141C>T	8.37:g.145661675G>A	ENSP00000386239:p.Ala714Val	Somatic	1	0		WXS	Illumina GAIIx	Phase_I	10	9	NM_013432	0	0	0	12	12	B5MDP0|C9JKB1|C9JNV8|Q13006|Q9UGJ2	Missense_Mutation	SNP	ENST00000409379.3	37	CCDS34968.2	856	0.39194139194139194	153	0.31097560975609756	148	0.4088397790055249	216	0.3776223776223776	339	0.4472295514511873	G	20.8	4.054738	0.75960	0.346207	0.455134	ENSG00000160949	ENST00000409379;ENST00000422691	T	0.48836	0.8	3.73	2.85	0.33270	.	0.748949	0.12251	N	0.485589	T	0.00012	0.0000	L	0.36672	1.1	0.80722	P	0.0	B	0.14805	0.011	B	0.14578	0.011	T	0.45249	-0.9274	9	0.26408	T	0.33	-5.5318	7.1129	0.25401	0.1264:0.0:0.8736:0.0	rs7830832;rs17850384;rs59752457;rs7830832	714	Q96HA7	TONSL_HUMAN	V	714;713	ENSP00000386239:A714V	ENSP00000386239:A714V	A	-	2	0	TONSL	145632483	0.001000	0.12720	0.074000	0.20217	0.742000	0.42306	0.522000	0.22909	0.902000	0.36520	0.462000	0.41574	GCC	G|0.593;A|0.407		0.652	TONSL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000329668.2	NM_013432	
AKAP2	11217	hgsc.bcm.edu	37	9	112811038	112811038	+	Missense_Mutation	SNP	C	C	T	rs78923754	byFrequency	TCGA-OR-A5KY-01A-11D-A29I-10	TCGA-OR-A5KY-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	72f9e1d9-c852-423a-94ff-17f763fa2713	f6e93da3-9ee7-4a65-bc04-30f8bb730eef	g.chr9:112811038C>T	ENST00000374525.1	+	1	63	c.59C>T	c.(58-60)cCg>cTg	p.P20L	PALM2-AKAP2_ENST00000302798.7_Intron|AKAP2_ENST00000510514.5_Intron|AKAP2_ENST00000555236.1_Intron|PALM2-AKAP2_ENST00000374530.3_Intron|AKAP2_ENST00000434623.2_Missense_Mutation_p.P20L	NM_001004065.4	NP_001004065.2	Q9Y2D5	AKAP2_HUMAN	A kinase (PRKA) anchor protein 2	374										breast(1)|endometrium(3)|kidney(2)|large_intestine(5)|lung(16)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	33						CCTGGACCCCCGGAGTCTCCT	0.776													-|||	379	0.0756789	0.0703	0.0879	5008	,	,		9335	0.0298		0.0954	False		,,,				2504	0.1012				p.P20L		.											.	AKAP2-24	0			c.C59T						.	C	LEU/PRO,LEU/PRO,,	146,2418		2,142,1138	2.0	3.0	2.0		59,59,,	0.3	0.0	9	dbSNP_132	2	557,5611		13,531,2540	no	missense,missense,intron,intron	AKAP2,PALM2-AKAP2	NM_001004065.4,NM_001198656.1,NM_007203.4,NM_147150.2	98,98,,	15,673,3678	TT,TC,CC		9.0305,5.6942,8.0508	,,,	20/949,20/962,,	112811038	703,8029	1282	3084	4366	SO:0001583	missense	11217	exon1			GACCCCCGGAGTC	AB023137	CCDS43861.1, CCDS48003.1, CCDS56581.1	9q31.3	2009-10-16			ENSG00000241978	ENSG00000241978		"""A-kinase anchor proteins"""	372	protein-coding gene	gene with protein product	"""protein kinase A2"""	604582		PRKA2		10231032	Standard	NM_001136562		Approved	AKAP-KL, KIAA0920, DKFZp564L0716		Q9Y2D5	OTTHUMG00000156811	ENST00000374525.1:c.59C>T	9.37:g.112811038C>T	ENSP00000363649:p.Pro20Leu	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	23	14	NM_001004065	0	0	0	0	0	B1ALX9|B2RTU4|B3KQ00|B4DTZ2|B7ZW07|B9EJB5|Q9UG26	Missense_Mutation	SNP	ENST00000374525.1	37	CCDS43861.1	184	0.08424908424908426	48	0.0975609756097561	42	0.11602209944751381	16	0.027972027972027972	78	0.10290237467018469	-	6.449	0.450901	0.12223	0.056942	0.090305	ENSG00000241978	ENST00000434623;ENST00000374525	T;T	0.44482	1.5;0.92	3.3	0.302	0.15786	.	.	.	.	.	T	0.00412	0.0013	.	.	.	0.58432	P	5.000000000032756E-6	B;B	0.11235	0.001;0.004	B;B	0.04013	0.001;0.001	T	0.06972	-1.0797	7	0.72032	D	0.01	-9.3294	7.3755	0.26825	0.0:0.6472:0.0:0.3528	.	20;21	Q9Y2D5-7;B1ALY1	.;.	L	20	ENSP00000404782:P20L;ENSP00000363649:P20L	ENSP00000363649:P20L	P	+	2	0	AKAP2	111850859	0.208000	0.23494	0.001000	0.08648	0.000000	0.00434	0.026000	0.13599	-0.068000	0.12953	-1.980000	0.00456	CCG	C|0.917;T|0.083		0.776	AKAP2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000053609.3	NM_001004065	
MEGF9	1955	hgsc.bcm.edu	37	9	123476135	123476135	+	Missense_Mutation	SNP	T	T	C	rs201806643	byFrequency	TCGA-OR-A5KY-01A-11D-A29I-10	TCGA-OR-A5KY-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	72f9e1d9-c852-423a-94ff-17f763fa2713	f6e93da3-9ee7-4a65-bc04-30f8bb730eef	g.chr9:123476135T>C	ENST00000373930.3	-	1	613	c.502A>G	c.(502-504)Acg>Gcg	p.T168A	MEGF9_ENST00000426959.1_Missense_Mutation_p.T160A	NM_001080497.2	NP_001073966.2	Q9H1U4	MEGF9_HUMAN	multiple EGF-like-domains 9	168	Pro-rich.					integral component of membrane (GO:0016021)				endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(2)|lung(9)|upper_aerodigestive_tract(1)	16						CGGGGAGTCGTGGGCGCCGGT	0.731													T|||	14	0.00279553	0.0	0.0014	5008	,	,		8111	0.0		0.005	False		,,,				2504	0.0082				p.T168A		.											.	.	0			c.A502G						.	T	ALA/THR	0,3716		0,0,1858	18.0	24.0	22.0		502	3.6	0.6	9		22	11,8097		0,11,4043	no	missense	MEGF9	NM_001080497.2	58	0,11,5901	CC,CT,TT		0.1357,0.0,0.093	benign	168/603	123476135	11,11813	1858	4054	5912	SO:0001583	missense	1955	exon1			GAGTCGTGGGCGC	AB011542	CCDS48010.1, CCDS48010.2	9q32-q33.3	2008-07-21	2006-03-31	2006-03-31	ENSG00000106780	ENSG00000106780			3234	protein-coding gene	gene with protein product		604268	"""EGF-like-domain, multiple 5"""	EGFL5		9693030	Standard	NM_001080497		Approved		uc022bms.1	Q9H1U4	OTTHUMG00000021039	ENST00000373930.3:c.502A>G	9.37:g.123476135T>C	ENSP00000363040:p.Thr168Ala	Somatic	8	0		WXS	Illumina GAIIx	Phase_I	60	30	NM_001080497	0	0	0	0	0	B7Z315|O75098	Missense_Mutation	SNP	ENST00000373930.3	37	CCDS48010.2	.	.	.	.	.	.	.	.	.	.	T	18.02	3.531104	0.64972	0.0	0.001357	ENSG00000106780	ENST00000373930;ENST00000426959	T;T	0.20881	2.26;2.04	3.56	3.56	0.40772	.	0.462231	0.16121	N	0.228644	T	0.12092	0.0294	N	0.24115	0.695	0.26736	N	0.970496	B;B	0.32302	0.363;0.043	B;B	0.26202	0.067;0.022	T	0.16247	-1.0409	10	0.19590	T	0.45	-4.2484	10.4035	0.44243	0.0:0.0:0.0:1.0	.	168;160	Q9H1U4;C9J1K8	MEGF9_HUMAN;.	A	168;160	ENSP00000363040:T168A;ENSP00000392666:T160A	ENSP00000363040:T168A	T	-	1	0	MEGF9	122515956	0.987000	0.35691	0.562000	0.28370	0.014000	0.08584	1.214000	0.32419	1.620000	0.50308	0.467000	0.42956	ACG	.		0.731	MEGF9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055513.1	NM_001080497	
CRB2	286204	hgsc.bcm.edu	37	9	126135715	126135715	+	Missense_Mutation	SNP	A	A	G	rs2488601	byFrequency	TCGA-OR-A5KY-01A-11D-A29I-10	TCGA-OR-A5KY-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	72f9e1d9-c852-423a-94ff-17f763fa2713	f6e93da3-9ee7-4a65-bc04-30f8bb730eef	g.chr9:126135715A>G	ENST00000373631.3	+	10	2906	c.2905A>G	c.(2905-2907)Acc>Gcc	p.T969A	CRB2_ENST00000373629.2_Missense_Mutation_p.T637A|CRB2_ENST00000359999.3_Missense_Mutation_p.T969A	NM_173689.5	NP_775960.4	Q5IJ48	CRUM2_HUMAN	crumbs family member 2	969	Laminin G-like 3. {ECO:0000255|PROSITE- ProRule:PRU00122}.			T -> A (in Ref. 2; AK123000/BAC86684). {ECO:0000305}.	cardiovascular system development (GO:0072358)|maintenance of epithelial cell apical/basal polarity (GO:0045199)|mesoderm formation (GO:0001707)|negative regulation of endopeptidase activity (GO:0010951)|notochord formation (GO:0014028)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|somitogenesis (GO:0001756)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	calcium ion binding (GO:0005509)|enzyme binding (GO:0019899)			NS(2)|breast(1)|cervix(1)|endometrium(2)|lung(11)|ovary(1)|prostate(2)|skin(3)	23						CCCGGCGGCCACCACCTCGCG	0.761													G|||	4889	0.976238	0.9123	0.9957	5008	,	,		7816	1.0		1.0	False		,,,				2504	1.0				p.T969A		.											.	CRB2-91	0			c.A2905G						.	G	ALA/THR	1952,154		899,154,0	2.0	2.0	2.0		2905	1.4	0.0	9	dbSNP_100	2	4451,7		2222,7,0	no	missense	CRB2	NM_173689.5	58	3121,161,0	GG,GA,AA		0.157,7.3124,2.4528	benign	969/1286	126135715	6403,161	1053	2229	3282	SO:0001583	missense	286204	exon10			GCGGCCACCACCT	AK095783	CCDS6852.2	9q33.2	2014-02-06	2014-02-06		ENSG00000148204	ENSG00000148204			18688	protein-coding gene	gene with protein product		609720	"""crumbs homolog 2 (Drosophila)"""			14767562	Standard	XM_005251934		Approved	FLJ38464, FLJ16786	uc004bnx.1	Q5IJ48	OTTHUMG00000020638	ENST00000373631.3:c.2905A>G	9.37:g.126135715A>G	ENSP00000362734:p.Thr969Ala	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	9	9	NM_173689	0	0	0	0	0	A2A3N4|Q0QD46|Q5JS41|Q5JS43|Q6ZTA9|Q6ZWI6	Missense_Mutation	SNP	ENST00000373631.3	37	CCDS6852.2	2136	0.978021978021978	447	0.9085365853658537	359	0.9917127071823204	572	1.0	758	1.0	.	0.004	-2.243394	0.00271	0.926876	0.99843	ENSG00000148204	ENST00000359999;ENST00000373631;ENST00000373629	D;D;D	0.90069	-2.05;-1.96;-2.61	3.63	1.35	0.21983	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Laminin G domain (2);Laminin G, subdomain 2 (1);	0.899723	0.09018	N	0.860551	T	0.00012	0.0000	N	0.00347	-1.61	0.80722	P	0.0	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.35475	-0.9787	9	0.15952	T	0.53	.	3.8071	0.08782	0.1918:0.1493:0.5421:0.1167	rs2488601	969;969	Q5IJ48;Q5IJ48-2	CRUM2_HUMAN;.	A	969;969;637	ENSP00000353092:T969A;ENSP00000362734:T969A;ENSP00000362732:T637A	ENSP00000353092:T969A	T	+	1	0	CRB2	125175536	0.000000	0.05858	0.001000	0.08648	0.004000	0.04260	-0.362000	0.07602	0.092000	0.17331	-2.954000	0.00084	ACC	T|0.022;G|0.004		0.761	CRB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053990.3	NM_173689	
WDR34	89891	hgsc.bcm.edu	37	9	131418828	131418828	+	Missense_Mutation	SNP	A	A	C	rs4837292		TCGA-OR-A5KY-01A-11D-A29I-10	TCGA-OR-A5KY-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	72f9e1d9-c852-423a-94ff-17f763fa2713	f6e93da3-9ee7-4a65-bc04-30f8bb730eef	g.chr9:131418828A>C	ENST00000372715.2	-	1	238	c.178T>G	c.(178-180)Tgg>Ggg	p.W60G		NM_052844.3	NP_443076.2	Q96EX3	WDR34_HUMAN	WD repeat domain 34	60				W -> G (in Ref. 2; AAH11874/AAH01614). {ECO:0000305}.		axoneme (GO:0005930)|centriole (GO:0005814)|ciliary basal body (GO:0036064)				central_nervous_system(2)|lung(5)|skin(1)|urinary_tract(1)	9						ACCGTCTCCCAGCGGATGCCC	0.806																																					p.W60G		.											.	WDR34-92	0			c.T178G						.	C	GLY/TRP	1803,9		897,9,0	1.0	1.0	1.0		178	2.1	1.0	9	dbSNP_111	1	3858,0		1929,0,0	no	missense	WDR34	NM_052844.3	184	2826,9,0	CC,CA,AA		0.0,0.4967,0.1587	benign	60/537	131418828	5661,9	906	1929	2835	SO:0001583	missense	89891	exon1			TCTCCCAGCGGAT	BC011874	CCDS6906.2	9q34.11	2013-11-15	2013-02-19	2013-02-19	ENSG00000119333	ENSG00000119333		"""WD repeat domain containing"""	28296	protein-coding gene	gene with protein product		613363				19521662, 21953912, 24183451	Standard	NM_052844		Approved	DIC5, MGC20486, bA216B9.3, FAP133	uc004bvq.1	Q96EX3	OTTHUMG00000020750	ENST00000372715.2:c.178T>G	9.37:g.131418828A>C	ENSP00000361800:p.Trp60Gly	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	7	7	NM_052844	0	0	0	0	0	Q5VXV4|Q9BV46	Missense_Mutation	SNP	ENST00000372715.2	37	CCDS6906.2	2170	0.9935897435897436	486	0.9878048780487805	362	1.0	571	0.9982517482517482	751	0.9907651715039578	C	7.343	0.621247	0.14193	0.995033	1.0	ENSG00000119333	ENST00000372715;ENST00000451652;ENST00000419989	T;T;T	0.74106	-0.81;-0.81;-0.81	4.02	2.12	0.27331	.	0.538297	0.18788	N	0.131154	T	0.00012	0.0000	N	0.00538	-1.39	0.58432	P	1.999999999946489E-6	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.34625	-0.9821	9	0.08381	T	0.77	-3.0135	7.4804	0.27402	0.1755:0.4462:0.3784:0.0	rs4837292;rs56752541	45;60	A2A3F8;Q96EX3	.;WDR34_HUMAN	G	60;51;45	ENSP00000361800:W60G;ENSP00000411370:W51G;ENSP00000415421:W45G	ENSP00000361800:W60G	W	-	1	0	WDR34	130458649	1.000000	0.71417	0.994000	0.49952	0.970000	0.65996	0.709000	0.25734	0.259000	0.21709	-0.126000	0.14955	TGG	A|0.006;C|0.994		0.806	WDR34-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054463.1	NM_052844	
NOTCH1	4851	hgsc.bcm.edu	37	9	139400219	139400219	+	Missense_Mutation	SNP	G	G	A	rs61751542	byFrequency	TCGA-OR-A5KY-01A-11D-A29I-10	TCGA-OR-A5KY-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	72f9e1d9-c852-423a-94ff-17f763fa2713	f6e93da3-9ee7-4a65-bc04-30f8bb730eef	g.chr9:139400219G>A	ENST00000277541.6	-	25	4204	c.4129C>T	c.(4129-4131)Ccc>Tcc	p.P1377S		NM_017617.3	NP_060087.3	P46531	NOTC1_HUMAN	notch 1	1377	EGF-like 35. {ECO:0000255|PROSITE- ProRule:PRU00076}.				anagen (GO:0042640)|aortic valve morphogenesis (GO:0003180)|apoptotic process involved in embryonic digit morphogenesis (GO:1902263)|arterial endothelial cell differentiation (GO:0060842)|atrioventricular node development (GO:0003162)|atrioventricular valve morphogenesis (GO:0003181)|auditory receptor cell fate commitment (GO:0009912)|axonogenesis (GO:0007409)|branching morphogenesis of an epithelial tube (GO:0048754)|cardiac atrium morphogenesis (GO:0003209)|cardiac chamber formation (GO:0003207)|cardiac epithelial to mesenchymal transition (GO:0060317)|cardiac left ventricle morphogenesis (GO:0003214)|cardiac muscle cell proliferation (GO:0060038)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac right atrium morphogenesis (GO:0003213)|cardiac right ventricle formation (GO:0003219)|cardiac septum morphogenesis (GO:0060411)|cardiac vascular smooth muscle cell development (GO:0060948)|cardiac ventricle morphogenesis (GO:0003208)|cell fate specification (GO:0001708)|cell migration involved in endocardial cushion formation (GO:0003273)|cellular response to follicle-stimulating hormone stimulus (GO:0071372)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|cilium morphogenesis (GO:0060271)|collecting duct development (GO:0072044)|compartment pattern specification (GO:0007386)|coronary artery morphogenesis (GO:0060982)|coronary vein morphogenesis (GO:0003169)|determination of left/right symmetry (GO:0007368)|distal tubule development (GO:0072017)|embryonic hindlimb morphogenesis (GO:0035116)|endocardial cell differentiation (GO:0060956)|endocardial cushion morphogenesis (GO:0003203)|endocardium development (GO:0003157)|endocardium morphogenesis (GO:0003160)|endoderm development (GO:0007492)|epithelial to mesenchymal transition (GO:0001837)|epithelial to mesenchymal transition involved in endocardial cushion formation (GO:0003198)|forebrain development (GO:0030900)|foregut morphogenesis (GO:0007440)|gene expression (GO:0010467)|glial cell differentiation (GO:0010001)|glomerular mesangial cell development (GO:0072144)|growth involved in heart morphogenesis (GO:0003241)|hair follicle morphogenesis (GO:0031069)|heart development (GO:0007507)|heart looping (GO:0001947)|heart trabecula morphogenesis (GO:0061384)|humoral immune response (GO:0006959)|immune response (GO:0006955)|in utero embryonic development (GO:0001701)|inflammatory response to antigenic stimulus (GO:0002437)|interleukin-4 secretion (GO:0072602)|keratinocyte differentiation (GO:0030216)|left/right axis specification (GO:0070986)|liver development (GO:0001889)|lung development (GO:0030324)|mesenchymal cell development (GO:0014031)|mitral valve formation (GO:0003192)|negative regulation of anoikis (GO:2000811)|negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of calcium ion-dependent exocytosis (GO:0045955)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of catalytic activity (GO:0043086)|negative regulation of cell migration involved in sprouting angiogenesis (GO:0090051)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell-substrate adhesion (GO:0010812)|negative regulation of endothelial cell chemotaxis (GO:2001027)|negative regulation of glial cell proliferation (GO:0060253)|negative regulation of myoblast differentiation (GO:0045662)|negative regulation of myotube differentiation (GO:0010832)|negative regulation of neurogenesis (GO:0050768)|negative regulation of oligodendrocyte differentiation (GO:0048715)|negative regulation of ossification (GO:0030279)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of photoreceptor cell differentiation (GO:0046533)|negative regulation of pro-B cell differentiation (GO:2000974)|negative regulation of stem cell differentiation (GO:2000737)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|neural tube development (GO:0021915)|neuronal stem cell maintenance (GO:0097150)|Notch receptor processing (GO:0007220)|Notch signaling involved in heart development (GO:0061314)|Notch signaling pathway (GO:0007219)|Notch signaling pathway involved in regulation of secondary heart field cardioblast proliferation (GO:0003270)|pericardium morphogenesis (GO:0003344)|positive regulation of apoptotic process (GO:0043065)|positive regulation of astrocyte differentiation (GO:0048711)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of cardiac muscle cell proliferation (GO:0060045)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of JAK-STAT cascade (GO:0046427)|positive regulation of keratinocyte differentiation (GO:0045618)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061419)|positive regulation of transcription of Notch receptor target (GO:0007221)|positive regulation of transcription, DNA-templated (GO:0045893)|prostate gland epithelium morphogenesis (GO:0060740)|pulmonary valve morphogenesis (GO:0003184)|regulation of epithelial cell proliferation involved in prostate gland development (GO:0060768)|regulation of extracellular matrix assembly (GO:1901201)|regulation of somitogenesis (GO:0014807)|regulation of transcription from RNA polymerase II promoter involved in myocardial precursor cell differentiation (GO:0003256)|regulation of transcription, DNA-templated (GO:0006355)|response to muramyl dipeptide (GO:0032495)|secretory columnal luminar epithelial cell differentiation involved in prostate glandular acinus development (GO:0060528)|skeletal muscle cell differentiation (GO:0035914)|somatic stem cell division (GO:0048103)|sprouting angiogenesis (GO:0002040)|transcription initiation from RNA polymerase II promoter (GO:0006367)|tube formation (GO:0035148)|vasculogenesis involved in coronary vascular morphogenesis (GO:0060979)|venous endothelial cell differentiation (GO:0060843)|ventricular septum morphogenesis (GO:0060412)|ventricular trabecula myocardium morphogenesis (GO:0003222)	cell surface (GO:0009986)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|MAML1-RBP-Jkappa- ICN1 complex (GO:0002193)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|chromatin DNA binding (GO:0031490)|core promoter binding (GO:0001047)|enzyme binding (GO:0019899)|enzyme inhibitor activity (GO:0004857)|receptor activity (GO:0004872)|RNA polymerase II transcription factor binding transcription factor activity involved in positive regulation of transcription (GO:0001190)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(16)|central_nervous_system(17)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1183)|kidney(4)|large_intestine(1)|lung(57)|oesophagus(2)|ovary(3)|pancreas(1)|prostate(3)|skin(21)|upper_aerodigestive_tract(39)|urinary_tract(3)	1359	all_cancers(76;0.223)	Myeloproliferative disorder(178;0.0511)		OV - Ovarian serous cystadenocarcinoma(145;5.34e-06)|Epithelial(140;7.77e-06)		CCCGTGAAGGGGCCCAGGCAC	0.701			"""T, Mis, O"""	TRB@	T-ALL					HNSCC(8;0.001)			G|||	32	0.00638978	0.0023	0.013	5008	,	,		12596	0.0		0.0199	False		,,,				2504	0.0				p.P1377S		.		Dom	yes		9	9q34.3	4851	"""Notch homolog 1, translocation-associated (Drosophila) (TAN1)"""		L	.	NOTCH1-5459	0			c.C4129T						.	G	SER/PRO	11,3633		0,11,1811	10.0	13.0	12.0		4129	-2.5	0.1	9	dbSNP_129	12	186,7758		1,184,3787	no	missense	NOTCH1	NM_017617.3	74	1,195,5598	AA,AG,GG		2.3414,0.3019,1.7	benign	1377/2556	139400219	197,11391	1822	3972	5794	SO:0001583	missense	4851	exon25			TGAAGGGGCCCAG	AF308602	CCDS43905.1	9q34.3	2013-01-10	2010-06-24		ENSG00000148400	ENSG00000148400		"""Ankyrin repeat domain containing"""	7881	protein-coding gene	gene with protein product		190198	"""Notch (Drosophila) homolog 1 (translocation-associated)"", ""Notch homolog 1, translocation-associated (Drosophila)"""	TAN1		1831692	Standard	NM_017617		Approved		uc004chz.3	P46531	OTTHUMG00000020935	ENST00000277541.6:c.4129C>T	9.37:g.139400219G>A	ENSP00000277541:p.Pro1377Ser	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	18	14	NM_017617	0	0	3	6	3	Q59ED8|Q5SXM3	Missense_Mutation	SNP	ENST00000277541.6	37	CCDS43905.1	19	0.0086996336996337	2	0.0040650406504065045	5	0.013812154696132596	0	0.0	12	0.0158311345646438	G	0.224	-1.026363	0.02045	0.003019	0.023414	ENSG00000148400	ENST00000277541	D	0.96104	-3.91	4.73	-2.49	0.06403	Epidermal growth factor-like (1);EGF-like region, conserved site (2);Epidermal growth factor-like, type 3 (1);	0.409618	0.22755	N	0.056033	T	0.79724	0.4495	N	0.10837	0.055	0.09310	N	0.999999	B	0.02656	0.0	B	0.04013	0.001	T	0.71094	-0.4692	10	0.52906	T	0.07	.	12.2794	0.54755	0.1533:0.663:0.1836:0.0	rs61751542	1377	P46531	NOTC1_HUMAN	S	1377	ENSP00000277541:P1377S	ENSP00000277541:P1377S	P	-	1	0	NOTCH1	138520040	0.001000	0.12720	0.051000	0.19133	0.189000	0.23516	-0.105000	0.10907	-0.995000	0.03459	-0.189000	0.12847	CCC	G|0.990;A|0.010		0.701	NOTCH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055087.1	NM_017617	
KRTAP5-5	439915	hgsc.bcm.edu	37	11	1651199	1651200	+	In_Frame_Ins	INS	-	-	GGCCGTGGCTCC	rs71025763|rs144216147	byFrequency	TCGA-OR-A5KY-01A-11D-A29I-10	TCGA-OR-A5KY-10A-01D-A29L-10	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	72f9e1d9-c852-423a-94ff-17f763fa2713	f6e93da3-9ee7-4a65-bc04-30f8bb730eef	g.chr11:1651199_1651200insGGCCGTGGCTCC	ENST00000399676.2	+	1	167_168	c.129_130insGGCCGTGGCTCC	c.(130-132)ggc>GGCCGTGGCTCCggc	p.44_44G>GRGSG		NM_001001480.2	NP_001001480.2	Q701N2	KRA55_HUMAN	keratin associated protein 5-5	44						keratin filament (GO:0045095)				endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(17)|ovary(2)|prostate(5)|urinary_tract(1)	33		all_epithelial(84;0.00018)|Ovarian(85;0.0014)|Breast(177;0.00147)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.000614)|Lung(200;0.0681)|LUSC - Lung squamous cell carcinoma(625;0.082)		ccggctgtggaggctgtggggg	0.713																																					p.G43delinsGGRGS		.											.	KRTAP5-5-23	0			c.129_130insGGCCGTGGCTCC						.																																			SO:0001652	inframe_insertion	439915	exon1			CTGTGGAGGCTGT	AB125074	CCDS41592.1	11p15.5	2008-10-30			ENSG00000185940	ENSG00000185940		"""Keratin associated proteins"""	23601	protein-coding gene	gene with protein product						15144888	Standard	NM_001001480		Approved	KRTAP5.5, KRTAP5-11	uc001lty.3	Q701N2	OTTHUMG00000057554	Exception_encountered	11.37:g.1651199_1651200insGGCCGTGGCTCC	Exception_encountered	Somatic	29	0		WXS	Illumina GAIIx	Phase_I	49	18	NM_001001480	0	0	0	0	0	A8MWN2	In_Frame_Ins	INS	ENST00000399676.2	37	CCDS41592.1																																																																																			.		0.713	KRTAP5-5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000127919.1		
HSPBP1	23640	broad.mit.edu	37	19	55790886	55790887	+	In_Frame_Ins	INS	-	-	GCCGCCGCC	rs199849782|rs10701478|rs3040014		TCGA-OR-A5KY-01A-11D-A29I-10	TCGA-OR-A5KY-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	72f9e1d9-c852-423a-94ff-17f763fa2713	f6e93da3-9ee7-4a65-bc04-30f8bb730eef	g.chr19:55790886_55790887insGCCGCCGCC	ENST00000255631.5	-	3	400_401	c.90_91insGGCGGCGGC	c.(88-93)ggctcc>ggcGGCGGCGGCtcc	p.29_30insGGG	HSPBP1_ENST00000376343.3_In_Frame_Ins_p.29_30insGGG|HSPBP1_ENST00000433386.2_In_Frame_Ins_p.29_30insGGG|BRSK1_ENST00000590333.1_5'Flank|HSPBP1_ENST00000587922.1_In_Frame_Ins_p.29_30insGGG	NM_001130106.1|NM_012267.4	NP_001123578.1|NP_036399.3	Q9NZL4	HPBP1_HUMAN	HSPA (heat shock 70kDa) binding protein, cytoplasmic cochaperone 1	29	Gly-rich.				negative regulation of catalytic activity (GO:0043086)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of protein ubiquitination (GO:0031398)|protein folding (GO:0006457)		enzyme inhibitor activity (GO:0004857)			endometrium(1)|kidney(1)|large_intestine(2)|lung(2)|prostate(1)|urinary_tract(1)	8			BRCA - Breast invasive adenocarcinoma(297;0.209)	GBM - Glioblastoma multiforme(193;0.0452)		CCAGCCGAGGAGCCGCCGCCGC	0.713																																					p.S31delinsGGGS		.											.	HSPBP1-90	0			c.91_92insGGCGGCGGC						.																																			SO:0001652	inframe_insertion	23640	exon3			CCGAGGAGCCGCC		CCDS33111.1	19q13.42	2008-12-16			ENSG00000133265	ENSG00000133265			24989	protein-coding gene	gene with protein product	"""hsp70 interacting protein"", ""Hsp70 binding protein 1"""	612939				10786638, 9830037	Standard	NM_001130106		Approved	HspBP1, FES1	uc002qkd.3	Q9NZL4		ENST00000255631.5:c.82_90dupGGCGGCGGC	19.37:g.55790887_55790895dupGCCGCCGCC	ENSP00000255631:p.Gly27_Gly29dup	Somatic	19	0		WXS	Illumina GAIIx	Phase_I	91	16	NM_001130106	0	0	0	0	0	B3KQP0|B4DG11|O95351|Q6ZNU5	In_Frame_Ins	INS	ENST00000255631.5	37	CCDS33111.1																																																																																			.		0.713	HSPBP1-001	KNOWN	NAGNAG_splice_site|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452670.1	NM_012267	
KRTAP10-6	386674	broad.mit.edu	37	21	46012219	46012220	+	In_Frame_Ins	INS	-	-	GGGGCGCAGCAGCTG	rs374776064|rs587611810|rs71199613	byFrequency	TCGA-OR-A5KY-01A-11D-A29I-10	TCGA-OR-A5KY-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	72f9e1d9-c852-423a-94ff-17f763fa2713	f6e93da3-9ee7-4a65-bc04-30f8bb730eef	g.chr21:46012219_46012220insGGGGCGCAGCAGCTG	ENST00000400368.1	-	1	166_167	c.146_147insCAGCTGCTGCGCCCC	c.(145-147)ccg>ccCAGCTGCTGCGCCCCg	p.49_49P>PSCCAP	TSPEAR_ENST00000323084.4_Intron	NM_198688.2	NP_941961.2	P60371	KR106_HUMAN	keratin associated protein 10-6	49	29 X 5 AA repeats of C-C-X(3).					keratin filament (GO:0045095)				endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(3)|lung(6)|prostate(3)|skin(1)|stomach(1)|urinary_tract(1)	23						GGCAGGGGGCCGGGGCGCAGCA	0.688														1042	0.208067	0.1188	0.2522	5008	,	,		15055	0.1379		0.3231	False		,,,				2504	0.2515				p.P49delinsPSCCAP		.											.	KRTAP10-6-90	0			c.147_148insCAGCTGCTGCGCCCC						.																																			SO:0001652	inframe_insertion	386674	exon1			GGGGGCCGGGGCG	AB076353	CCDS42959.1	21q22.3	2006-03-13	2004-07-12	2004-07-14	ENSG00000188155	ENSG00000188155		"""Keratin associated proteins"""	20523	protein-coding gene	gene with protein product			"""keratin associated protein 18-6"""	KRTAP18-6			Standard	NM_198688		Approved	KRTAP18.6, KAP18.6, KAP10.6	uc002zfm.3	P60371	OTTHUMG00000057634	ENST00000400368.1:c.146_147insCAGCTGCTGCGCCCC	21.37:g.46012219_46012220insGGGGCGCAGCAGCTG	Exception_encountered	Somatic	24	0		WXS	Illumina GAIIx	Phase_I	75	9	NM_198688	0	0	0	0	0		In_Frame_Ins	INS	ENST00000400368.1	37	CCDS42959.1																																																																																			.		0.688	KRTAP10-6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128037.1	NM_198688	
TBP	6908	broad.mit.edu	37	6	170871013	170871014	+	In_Frame_Ins	INS	-	-	CAG	rs201732168|rs113202486|rs574714675|rs71010672	byFrequency	TCGA-OR-A5KY-01A-11D-A29I-10	TCGA-OR-A5KY-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	72f9e1d9-c852-423a-94ff-17f763fa2713	f6e93da3-9ee7-4a65-bc04-30f8bb730eef	g.chr6:170871013_170871014insCAG	ENST00000392092.2	+	3	468_469	c.189_190insCAG	c.(190-192)cag>CAGcag	p.64_64Q>QQ	TBP_ENST00000540980.1_In_Frame_Ins_p.44_44Q>QQ|TBP_ENST00000230354.6_In_Frame_Ins_p.64_64Q>QQ	NM_003194.4	NP_003185.1	P20226	TBP_HUMAN	TATA box binding protein	64	Poly-Gln.				cell death (GO:0008219)|gene expression (GO:0010467)|positive regulation of transcription, DNA-templated (GO:0045893)|spermatogenesis (GO:0007283)|termination of RNA polymerase I transcription (GO:0006363)|transcription elongation from RNA polymerase I promoter (GO:0006362)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase I promoter (GO:0006360)|transcription from RNA polymerase II promoter (GO:0006366)|transcription from RNA polymerase III promoter (GO:0006383)|transcription initiation from RNA polymerase I promoter (GO:0006361)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	cytoplasm (GO:0005737)|female pronucleus (GO:0001939)|male pronucleus (GO:0001940)|nuclear euchromatin (GO:0005719)|nucleoplasm (GO:0005654)|transcription factor TFIIA complex (GO:0005672)|transcription factor TFIID complex (GO:0005669)	repressing transcription factor binding (GO:0070491)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)	p.Q63_Q64insQ(1)|p.Q63Q(1)		breast(2)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(2)|lung(9)|ovary(1)|prostate(4)|urinary_tract(1)	26		Breast(66;5.08e-05)|Ovarian(120;0.125)|Esophageal squamous(34;0.246)		OV - Ovarian serous cystadenocarcinoma(33;1.07e-22)|BRCA - Breast invasive adenocarcinoma(81;5.01e-06)|GBM - Glioblastoma multiforme(31;0.00591)		agcaacaacaacagcagcagca	0.55																																					p.Q63delinsQQ		.											.	TBP-91	2	Insertion - In frame(1)|Substitution - coding silent(1)	prostate(1)|breast(1)	c.189_190insCAG						.																																			SO:0001652	inframe_insertion	6908	exon3			ACAACAACAGCAG	M55654	CCDS5315.1, CCDS55077.1	6q27	2014-04-02			ENSG00000112592	ENSG00000112592		"""General transcription factors"""	11588	protein-coding gene	gene with protein product		600075		GTF2D1, SCA17		2194289, 11448935	Standard	NM_003194		Approved	TFIID	uc003qxu.3	P20226	OTTHUMG00000016084	ENST00000392092.2:c.211_213dupCAG	6.37:g.170871020_170871022dupCAG	ENSP00000375942:p.Gln95dup	Somatic	62	0		WXS	Illumina GAIIx	Phase_I	53	29	NM_003194	0	0	0	0	0	B4E3B3|F5H869|Q16845|Q6IBM6|Q9UC02	In_Frame_Ins	INS	ENST00000392092.2	37	CCDS5315.1																																																																																			-|0.138;CAG|0.862		0.550	TBP-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000043271.2	NM_003194	
MFF	56947	bcgsc.ca	37	2	228194480	228194481	+	Missense_Mutation	DNP	AG	AG	TT	rs3211098|rs3211097|rs386655869	byFrequency	TCGA-OR-A5KY-01A-11D-A29I-10	TCGA-OR-A5KY-10A-01D-A29L-10	AG	AG	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	72f9e1d9-c852-423a-94ff-17f763fa2713	f6e93da3-9ee7-4a65-bc04-30f8bb730eef	g.chr2:228194480_228194481AG>TT	ENST00000353339.3	+	3	460_461	c.19_20AG>TT	c.(19-21)AGt>TTt	p.S7F	MFF_ENST00000349901.7_Intron|MFF_ENST00000524634.1_Intron|MFF_ENST00000476924.1_Intron|MFF_ENST00000409565.1_Intron|MFF_ENST00000354503.6_Intron|MFF_ENST00000304593.9_Intron|MFF_ENST00000392059.1_Missense_Mutation_p.S7F|MFF_ENST00000337110.7_Intron|MFF_ENST00000409616.1_5'UTR	NM_001277061.1	NP_001263990.1	Q9GZY8	MFF_HUMAN	mitochondrial fission factor	7			S -> C (in dbSNP:rs3211097).|S -> I (in dbSNP:rs3211098).		mitochondrial fission (GO:0000266)|mitochondrial fragmentation involved in apoptotic process (GO:0043653)|mitochondrial fusion (GO:0008053)|mitochondrion morphogenesis (GO:0070584)|peroxisome fission (GO:0016559)|positive regulation of mitochondrial fission (GO:0090141)|positive regulation of protein targeting to membrane (GO:0090314)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|protein homooligomerization (GO:0051260)|protein targeting to mitochondrion (GO:0006626)|regulation of mitochondrion organization (GO:0010821)|regulation of peroxisome organization (GO:1900063)|release of cytochrome c from mitochondria (GO:0001836)	cell junction (GO:0030054)|cytoplasmic vesicle (GO:0031410)|integral component of mitochondrial membrane (GO:0032592)|mitochondrial outer membrane (GO:0005741)|peroxisome (GO:0005777)|synapse (GO:0045202)	protein homodimerization activity (GO:0042803)			breast(3)|endometrium(2)|kidney(3)|large_intestine(7)|lung(4)|stomach(2)	21						AGGAACAAGCAGTGACACATCA	0.366																																					p.S7F		.											.	MFF-153	0			c.G20T						.																																			SO:0001583	missense	56947	exon3			CAAGCAGTGACAC	AF258660	CCDS2465.1, CCDS63139.1, CCDS63140.1, CCDS63141.1, CCDS63142.1, CCDS74662.1	2q36	2008-05-29	2008-05-29	2008-05-29	ENSG00000168958	ENSG00000168958			24858	protein-coding gene	gene with protein product		614785	"""chromosome 2 open reading frame 33"""	C2orf33		18353969	Standard	NM_001277061		Approved	GL004	uc002voy.4	Q9GZY8	OTTHUMG00000133180	Exception_encountered	2.37:g.228194480_228194481delinsTT	ENSP00000302037:p.Ser7Phe	Somatic	336	1		WXS	Illumina GAIIx	Phase_I	224	0	NM_020194	0	0	0	0	0	Q567U1|Q658R6|Q9BVZ1|Q9H690|Q9NRG8	Missense_Mutation	DNP	ENST00000353339.3	37	CCDS2465.1																																																																																			G|0.737;T|0.263		0.366	MFF-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000256887.2	NM_020194	
GABRA6	2559	broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	161113302	161113303	+	Missense_Mutation	DNP	CC	CC	AA			TCGA-OR-A5KY-01A-11D-A29I-10	TCGA-OR-A5KY-10A-01D-A29L-10	CC	CC	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	72f9e1d9-c852-423a-94ff-17f763fa2713	f6e93da3-9ee7-4a65-bc04-30f8bb730eef	g.chr5:161113302_161113303CC>AA	ENST00000274545.5	+	2	538_539	c.105_106CC>AA	c.(103-108)atCCtg>atAAtg	p.L36M	GABRA6_ENST00000522269.1_3'UTR|RP11-348M17.2_ENST00000521984.1_RNA|GABRA6_ENST00000523217.1_Missense_Mutation_p.L36M			Q16445	GBRA6_HUMAN	gamma-aminobutyric acid (GABA) A receptor, alpha 6	36					gamma-aminobutyric acid signaling pathway (GO:0007214)|ion transmembrane transport (GO:0034220)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|transport (GO:0006810)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	benzodiazepine receptor activity (GO:0008503)|chloride channel activity (GO:0005254)|extracellular ligand-gated ion channel activity (GO:0005230)|GABA-A receptor activity (GO:0004890)			breast(1)|central_nervous_system(2)|endometrium(6)|large_intestine(9)|liver(2)|lung(22)|ovary(7)|skin(6)|urinary_tract(2)	57	Renal(175;0.00259)	Medulloblastoma(196;0.0208)|all_neural(177;0.0672)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)		Acamprosate(DB00659)|Alprazolam(DB00404)|Amobarbital(DB01351)|Amoxapine(DB00543)|Aprobarbital(DB01352)|Bromazepam(DB01558)|Butabarbital(DB00237)|Butalbital(DB00241)|Butethal(DB01353)|Chlordiazepoxide(DB00475)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ergoloid mesylate(DB01049)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Flumazenil(DB01205)|Flunitrazepam(DB01544)|Flurazepam(DB00690)|Glutethimide(DB01437)|Halazepam(DB00801)|Halothane(DB01159)|Heptabarbital(DB01354)|Hexobarbital(DB01355)|Isoflurane(DB00753)|Lorazepam(DB00186)|Meprobamate(DB00371)|Methoxyflurane(DB01028)|Methylphenobarbital(DB00849)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Olanzapine(DB00334)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Prazepam(DB01588)|Primidone(DB00794)|Propofol(DB00818)|Quazepam(DB01589)|Secobarbital(DB00418)|Sevoflurane(DB01236)|Talbutal(DB00306)|Temazepam(DB00231)|Thiopental(DB00599)|Topiramate(DB00273)|Triazolam(DB00897)	TCAGTCGGATCCTGGACAACTT	0.485										TCGA Ovarian(5;0.080)																											p.L36M		.											.	GABRA6-163	0			c.C106A						.																																			SO:0001583	missense	2559	exon2			CGGATCCTGGACA		CCDS4356.1	5q34	2012-06-22			ENSG00000145863	ENSG00000145863		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	4080	protein-coding gene	gene with protein product	"""GABA(A) receptor, alpha 6"""	137143				8020978	Standard	NM_000811		Approved		uc003lyu.2	Q16445	OTTHUMG00000130351	Exception_encountered	5.37:g.161113302_161113303delinsAA	ENSP00000274545:p.Leu36Met	Somatic	124	0		WXS	Illumina GAIIx	Phase_I	208	5	NM_000811	0	0	0	0	0	A8K096|Q4VAV2	Missense_Mutation	DNP	ENST00000274545.5	37	CCDS4356.1																																																																																			.		0.485	GABRA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252707.2		
