#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_TTotCov	i_TVarCov	i_Transcript_Id	i_Trna_alt1	i_Trna_alt2	i_Trna_ref	i_Trna_tot	i_Trna_var	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
CCNL2	81669	broad.mit.edu;bcgsc.ca	37	1	1334591	1334591	+	Silent	SNP	C	C	A			TCGA-OR-A5L2-01A-11D-A30A-10	TCGA-OR-A5L2-10A-01D-A30A-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b99bd79e-aa33-4896-8d10-2517c793f439	48e26b1d-b84d-432b-940b-9907c81ddf5b	g.chr1:1334591C>A	ENST00000400809.3	-	1	101	c.96G>T	c.(94-96)tcG>tcT	p.S32S	CCNL2_ENST00000408952.5_5'Flank|RP4-758J18.2_ENST00000448629.2_5'Flank|RP4-758J18.2_ENST00000576232.1_5'Flank|CCNL2_ENST00000408918.4_Silent_p.S32S|RP4-758J18.2_ENST00000444362.1_5'Flank|MRPL20_ENST00000493287.1_5'Flank	NM_030937.4	NP_112199.2	Q96S94	CCNL2_HUMAN	cyclin L2	32					regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|regulation of transcription, DNA-templated (GO:0006355)|RNA processing (GO:0006396)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)				central_nervous_system(1)|endometrium(3)|large_intestine(2)|lung(3)|ovary(2)|prostate(2)	13	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;8.75e-19)|all_lung(118;2.3e-08)|Lung NSC(185;2.38e-06)|Renal(390;0.00183)|Breast(487;0.00354)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Lung SC(97;0.128)		Epithelial(90;2.03e-36)|OV - Ovarian serous cystadenocarcinoma(86;4.17e-22)|Colorectal(212;0.000159)|COAD - Colon adenocarcinoma(227;0.000193)|Kidney(185;0.0023)|BRCA - Breast invasive adenocarcinoma(365;0.00465)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0342)|Lung(427;0.146)		GCACCCCCTGCGACCCTGAGG	0.706																																					p.S32S		.											.	CCNL2-70	0			c.G96T						.						40.0	37.0	38.0					1																	1334591		2202	4300	6502	SO:0001819	synonymous_variant	81669	exon1			CCCCTGCGACCCT	AF251294	CCDS30557.1, CCDS30558.1	1p36.33	2014-07-03			ENSG00000221978	ENSG00000221978			20570	protein-coding gene	gene with protein product	"""cyclin S"""	613482	"""cyclin M"""	CCNM		14725631	Standard	NM_030937		Approved	ania-6b, PCEE, SB138, HLA-ISO, CCNS	uc001afi.2	Q96S94	OTTHUMG00000002917	ENST00000400809.3:c.96G>T	1.37:g.1334591C>A		Somatic	57	1		WXS	Illumina GAIIx	Phase_I	71	39	NM_030937	0	0	0	0	0	A8K8A3|B1B152|Q5T2N5|Q5T2N6|Q6IQ12|Q7Z4Z8|Q8N3C9|Q8N3D5|Q8NHE3|Q8TEL0|Q96B00	Silent	SNP	ENST00000400809.3	37	CCDS30557.1																																																																																			.		0.706	CCNL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000008146.2	NM_030937	
C1orf158	93190	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	12815709	12815709	+	Missense_Mutation	SNP	C	C	A			TCGA-OR-A5L2-01A-11D-A30A-10	TCGA-OR-A5L2-10A-01D-A30A-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b99bd79e-aa33-4896-8d10-2517c793f439	48e26b1d-b84d-432b-940b-9907c81ddf5b	g.chr1:12815709C>A	ENST00000288048.5	+	2	387	c.171C>A	c.(169-171)ttC>ttA	p.F57L	C1orf158_ENST00000376210.3_Intron	NM_152290.2	NP_689503.2	Q8N1D5	CA158_HUMAN	chromosome 1 open reading frame 158	57										central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|lung(1)|ovary(1)|skin(2)|urinary_tract(3)	10	Ovarian(185;0.249)	Renal(390;0.000469)|Lung NSC(185;0.00143)|all_lung(284;0.00181)|Colorectal(325;0.00215)|Breast(348;0.0042)|Myeloproliferative disorder(586;0.0393)|Hepatocellular(190;0.0623)|Ovarian(437;0.0731)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;6.06e-06)|COAD - Colon adenocarcinoma(227;0.000273)|BRCA - Breast invasive adenocarcinoma(304;0.000311)|Kidney(185;0.00216)|KIRC - Kidney renal clear cell carcinoma(229;0.00575)|STAD - Stomach adenocarcinoma(313;0.00743)|READ - Rectum adenocarcinoma(331;0.0649)		ACATCCCCTTCCCAGACCACA	0.502																																					p.F57L		.											.	C1orf158-92	0			c.C171A						.						106.0	99.0	102.0					1																	12815709		2203	4300	6503	SO:0001583	missense	93190	exon2			CCCCTTCCCAGAC	BX647383	CCDS147.1	1p36.21	2008-02-05			ENSG00000157330	ENSG00000157330			28567	protein-coding gene	gene with protein product						12477932	Standard	NM_152290		Approved	MGC35194	uc001auh.3	Q8N1D5	OTTHUMG00000001888	ENST00000288048.5:c.171C>A	1.37:g.12815709C>A	ENSP00000288048:p.Phe57Leu	Somatic	340	1		WXS	Illumina GAIIx	Phase_I	354	162	NM_152290	0	0	0	0	0	Q5VUY4	Missense_Mutation	SNP	ENST00000288048.5	37	CCDS147.1	.	.	.	.	.	.	.	.	.	.	C	8.769	0.925544	0.18056	.	.	ENSG00000157330	ENST00000288048	T	0.42900	0.96	4.98	1.89	0.25635	.	0.351846	0.30109	N	0.010386	T	0.29355	0.0731	L	0.45137	1.4	0.80722	D	1	B;B	0.14805	0.011;0.004	B;B	0.13407	0.009;0.004	T	0.06917	-1.0800	10	0.41790	T	0.15	-8.4098	4.2765	0.10811	0.0:0.5806:0.1865:0.2329	.	57;57	B4DQE0;Q8N1D5	.;CA158_HUMAN	L	57	ENSP00000288048:F57L	ENSP00000288048:F57L	F	+	3	2	C1orf158	12738296	0.571000	0.26659	0.722000	0.30670	0.042000	0.13812	0.180000	0.16860	0.074000	0.16767	0.561000	0.74099	TTC	.		0.502	C1orf158-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000005325.1	NM_152290	
NIPAL3	57185	broad.mit.edu	37	1	24766704	24766704	+	Missense_Mutation	SNP	G	G	T			TCGA-OR-A5L2-01A-11D-A30A-10	TCGA-OR-A5L2-10A-01D-A30A-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b99bd79e-aa33-4896-8d10-2517c793f439	48e26b1d-b84d-432b-940b-9907c81ddf5b	g.chr1:24766704G>T	ENST00000374399.4	+	3	504	c.136G>T	c.(136-138)Gtg>Ttg	p.V46L	NIPAL3_ENST00000358028.4_Missense_Mutation_p.V46L|NIPAL3_ENST00000428131.1_Missense_Mutation_p.V46L|NIPAL3_ENST00000339255.2_Missense_Mutation_p.V46L|NIPAL3_ENST00000003912.3_5'UTR	NM_020448.4	NP_065181.1	Q6P499	NPAL3_HUMAN	NIPA-like domain containing 3	46						integral component of membrane (GO:0016021)	magnesium ion transmembrane transporter activity (GO:0015095)			endometrium(1)|kidney(1)|large_intestine(6)|lung(5)|skin(1)	14						CGGGCACCTCGTGGTCAGCAT	0.547																																					p.V46L		.											.	NIPAL3-90	0			c.G136T						.						112.0	98.0	103.0					1																	24766704		2203	4300	6503	SO:0001583	missense	57185	exon3			CACCTCGTGGTCA	BX640883	CCDS30631.1	1p36.12-p35.1	2009-03-24		2009-03-24	ENSG00000001461	ENSG00000001461			25233	protein-coding gene	gene with protein product				NPAL3		8619474, 9110174	Standard	NM_020448		Approved	DJ462O23.2	uc001bjh.3	Q6P499	OTTHUMG00000003299	ENST00000374399.4:c.136G>T	1.37:g.24766704G>T	ENSP00000363520:p.Val46Leu	Somatic	85	1		WXS	Illumina GAIIx	Phase_I	127	4	NM_020448	0	0	0	0	0	A2A298|Q6MZT9|Q9BVE6	Missense_Mutation	SNP	ENST00000374399.4	37	CCDS30631.1	.	.	.	.	.	.	.	.	.	.	G	11.09	1.536949	0.27475	.	.	ENSG00000001461	ENST00000374399;ENST00000358028;ENST00000339255;ENST00000428131	D;D;D;D	0.90069	-2.61;-2.61;-2.61;-2.61	4.99	4.99	0.66335	.	0.066743	0.64402	D	0.000016	T	0.78168	0.4241	N	0.04820	-0.15	0.50039	D	0.99984	B;B;B	0.23990	0.081;0.076;0.095	B;B;B	0.25291	0.042;0.039;0.059	T	0.73833	-0.3858	10	0.13108	T	0.6	-27.5427	18.2839	0.90107	0.0:0.0:1.0:0.0	.	46;46;46	Q6P499-3;Q6P499;A6NN97	.;NPAL3_HUMAN;.	L	46	ENSP00000363520:V46L;ENSP00000350722:V46L;ENSP00000343549:V46L;ENSP00000406509:V46L	ENSP00000343549:V46L	V	+	1	0	NIPAL3	24639291	1.000000	0.71417	0.997000	0.53966	0.800000	0.45204	4.851000	0.62896	2.321000	0.78463	0.591000	0.81541	GTG	.		0.547	NIPAL3-007	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276996.1	NM_020448	
TRNP1	388610	hgsc.bcm.edu	37	1	27320356	27320356	+	Missense_Mutation	SNP	T	T	C	rs6689941	byFrequency	TCGA-OR-A5L2-01A-11D-A30A-10	TCGA-OR-A5L2-10A-01D-A30A-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b99bd79e-aa33-4896-8d10-2517c793f439	48e26b1d-b84d-432b-940b-9907c81ddf5b	g.chr1:27320356T>C	ENST00000522111.2	+	1	159	c.79T>C	c.(79-81)Tgg>Cgg	p.W27R		NM_001013642.2	NP_001013664	Q6NT89	TRNP1_HUMAN	TMF1-regulated nuclear protein 1	27	Pro-rich.		W -> R (in dbSNP:rs6689941). {ECO:0000269|PubMed:15489334}.		cell cycle (GO:0007049)|cerebellar cortex morphogenesis (GO:0021696)|neural precursor cell proliferation (GO:0061351)|regulation of cell cycle (GO:0051726)|regulation of cell proliferation (GO:0042127)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nuclear euchromatin (GO:0005719)|nucleus (GO:0005634)	DNA binding (GO:0003677)										gccgccgccctgggatcccat	0.781													t|||	4918	0.982029	0.9334	0.9971	5008	,	,		5184	1.0		1.0	False		,,,				2504	1.0				p.W27R		.											.	TRNP1-44	0			c.T79C						.		ARG/TRP	1872,78		897,78,0	2.0	3.0	3.0		79	0.8	0.8	1	dbSNP_116	3	4889,5		2442,5,0	no	missense	TRNP1	NM_001013642.2	101	3339,83,0	CC,CT,TT		0.1022,4.0,1.2127	benign	27/228	27320356	6761,83	975	2447	3422	SO:0001583	missense	388610	exon1			CCGCCCTGGGATC	AI366714, AL356390, BC069216, CH471059	CCDS41289.1	1p36.11	2012-10-03	2009-02-19	2009-02-19	ENSG00000253368	ENSG00000253368			34348	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 225"""	C1orf225		12477932	Standard	NM_001013642		Approved	LOC388610	uc001bnj.4	Q6NT89	OTTHUMG00000004277	ENST00000522111.2:c.79T>C	1.37:g.27320356T>C	ENSP00000429216:p.Trp27Arg	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	4	4	NM_001013642	0	0	0	0	0		Missense_Mutation	SNP	ENST00000522111.2	37	CCDS41289.1	2118	0.9697802197802198	448	0.9105691056910569	356	0.9834254143646409	569	0.9947552447552448	745	0.9828496042216359	t	10.07	1.249893	0.22880	0.96	0.998978	ENSG00000253368	ENST00000522111	T	0.39229	1.09	2.9	0.764	0.18465	.	1.465370	0.05478	N	0.554332	T	0.00012	0.0000	N	0.03608	-0.345	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.28522	-1.0041	9	0.06757	T	0.87	.	5.0244	0.14378	0.0:0.4477:0.4194:0.1329	rs6689941;rs58716663	27	Q6NT89	TRNP1_HUMAN	R	27	ENSP00000429216:W27R	ENSP00000429216:W27R	W	+	1	0	TRNP1	27192943	1.000000	0.71417	0.821000	0.32701	0.096000	0.18686	0.270000	0.18607	-0.207000	0.10187	-0.411000	0.06167	TGG	T|0.030;C|0.970		0.781	TRNP1-001	KNOWN	NMD_exception|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000012346.3	NM_001013642	
MACF1	23499	ucsc.edu;bcgsc.ca;mdanderson.org	37	1	39851188	39851188	+	Missense_Mutation	SNP	G	G	T			TCGA-OR-A5L2-01A-11D-A30A-10	TCGA-OR-A5L2-10A-01D-A30A-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b99bd79e-aa33-4896-8d10-2517c793f439	48e26b1d-b84d-432b-940b-9907c81ddf5b	g.chr1:39851188G>T	ENST00000372915.3	+	56	14033	c.13946G>T	c.(13945-13947)gGa>gTa	p.G4649V	MACF1_ENST00000545844.1_Missense_Mutation_p.G2582V|MACF1_ENST00000361689.2_Missense_Mutation_p.G2582V|MACF1_ENST00000289893.4_Missense_Mutation_p.G3084V|MACF1_ENST00000567887.1_Missense_Mutation_p.G4681V|MACF1_ENST00000564288.1_Missense_Mutation_p.G4644V|MACF1_ENST00000539005.1_Missense_Mutation_p.G2561V|MACF1_ENST00000317713.7_Missense_Mutation_p.G2582V			Q9UPN3	MACF1_HUMAN	microtubule-actin crosslinking factor 1	4649					ATP catabolic process (GO:0006200)|cell cycle arrest (GO:0007050)|Golgi to plasma membrane protein transport (GO:0043001)|positive regulation of Wnt signaling pathway (GO:0030177)|regulation of epithelial cell migration (GO:0010632)|regulation of focal adhesion assembly (GO:0051893)|regulation of microtubule-based process (GO:0032886)|Wnt signaling pathway (GO:0016055)|wound healing (GO:0042060)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|ATPase activity (GO:0016887)|calcium ion binding (GO:0005509)|poly(A) RNA binding (GO:0044822)			breast(11)|central_nervous_system(5)|endometrium(18)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(36)|lung(78)|ovary(12)|prostate(2)|skin(9)|stomach(2)|upper_aerodigestive_tract(8)|urinary_tract(10)	203	Lung NSC(20;5.57e-06)|Ovarian(52;0.00769)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;7.78e-19)|Epithelial(16;1.73e-17)|all cancers(16;2.49e-16)|LUSC - Lung squamous cell carcinoma(16;0.00146)|Lung(16;0.00204)			ACAGGCCCTGGAGATGTCTCT	0.478																																					p.G2582V		.											.	MACF1-165	0			c.G7745T						.						59.0	52.0	55.0					1																	39851188		2203	4300	6503	SO:0001583	missense	23499	exon53			GCCCTGGAGATGT	AB007934	CCDS435.1	1p32-p31	2013-01-10			ENSG00000127603	ENSG00000127603		"""EF-hand domain containing"""	13664	protein-coding gene	gene with protein product	"""actin cross-linking factor"", ""620 kDa actin binding protein"", ""macrophin 1"", ""trabeculin-alpha"", ""actin cross-linking family protein 7"""	608271				7635207, 10529403	Standard	NM_012090		Approved	KIAA0465, ACF7, ABP620, KIAA1251, MACF, FLJ45612, FLJ46776	uc031pmc.1	Q9UPN3	OTTHUMG00000007754	ENST00000372915.3:c.13946G>T	1.37:g.39851188G>T	ENSP00000362006:p.Gly4649Val	Somatic	172	2		WXS	Illumina GAIIx	Phase_I	166	65	NM_012090	0	0	0	0	0	B1ALC5|E9PJT0|O75053|Q5VW20|Q8WXY1|Q8WXY2|Q96PK2|Q9H540|Q9UKP0|Q9ULG9	Missense_Mutation	SNP	ENST00000372915.3	37		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	16.65|16.65	3.182084|3.182084	0.57800|0.57800	.|.	.|.	ENSG00000127603|ENSG00000127603	ENST00000545844;ENST00000372915;ENST00000361689;ENST00000317713;ENST00000539005;ENST00000289893|ENST00000372925	T;T;T;T;T;T|.	0.65364|.	-0.12;-0.06;-0.12;-0.15;0.05;1.01|.	6.17|6.17	5.27|5.27	0.74061|0.74061	.|.	0.000000|.	0.64402|.	D|.	0.000011|.	T|T	0.71517|0.71517	0.3349|0.3349	M|M	0.69823|0.69823	2.125|2.125	0.80722|0.80722	D|D	1|1	D;D;D|.	0.89917|.	1.0;0.999;0.995|.	D;D;D|.	0.91635|.	0.999;0.981;0.948|.	T|T	0.71672|0.71672	-0.4522|-0.4522	10|5	0.52906|.	T|.	0.07|.	.|.	12.482|12.482	0.55850|0.55850	0.133:0.0:0.867:0.0|0.133:0.0:0.867:0.0	.|.	4649;2582;2526|.	Q9UPN3;F8W8Q1;Q9UPN3-3|.	MACF1_HUMAN;.;.|.	V|C	2582;4649;2582;2582;2561;3084|1694	ENSP00000439537:G2582V;ENSP00000362006:G4649V;ENSP00000354573:G2582V;ENSP00000313438:G2582V;ENSP00000444364:G2561V;ENSP00000289893:G3084V|.	ENSP00000289893:G3084V|.	G|W	+|+	2|3	0|0	MACF1|MACF1	39623775|39623775	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.874000|0.874000	0.50279|0.50279	6.472000|6.472000	0.73567|0.73567	1.636000|1.636000	0.50526|0.50526	-0.136000|-0.136000	0.14681|0.14681	GGA|TGG	.		0.478	MACF1-028	NOVEL	not_organism_supported|basic|appris_candidate|exp_conf	protein_coding	protein_coding	OTTHUMT00000392096.1	NM_033044	
RPRD2	23248	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	150443166	150443166	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5L2-01A-11D-A30A-10	TCGA-OR-A5L2-10A-01D-A30A-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b99bd79e-aa33-4896-8d10-2517c793f439	48e26b1d-b84d-432b-940b-9907c81ddf5b	g.chr1:150443166G>A	ENST00000369068.4	+	11	1746	c.1742G>A	c.(1741-1743)aGt>aAt	p.S581N	RPRD2_ENST00000492220.1_3'UTR|RPRD2_ENST00000401000.4_Missense_Mutation_p.S555N|RPRD2_ENST00000539519.1_Missense_Mutation_p.S555N	NM_015203.3	NP_056018.2	Q5VT52	RPRD2_HUMAN	regulation of nuclear pre-mRNA domain containing 2	581	Ser-rich.					DNA-directed RNA polymerase II, holoenzyme (GO:0016591)				central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(4)|lung(20)|ovary(1)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	37						CTGCCCTCCAGTGCCCAACCT	0.502																																					p.S581N		.											.	RPRD2-23	0			c.G1742A						.						73.0	67.0	69.0					1																	150443166		1885	4123	6008	SO:0001583	missense	23248	exon11			CCTCCAGTGCCCA	BX641025	CCDS44216.1, CCDS72907.1	1q21.2	2012-02-09	2008-08-15	2008-07-28	ENSG00000163125	ENSG00000163125			29039	protein-coding gene	gene with protein product		614695	"""KIAA0460"""	KIAA0460		22231121	Standard	XM_005245033		Approved	FLJ32145, HSPC099	uc009wlr.3	Q5VT52	OTTHUMG00000012808	ENST00000369068.4:c.1742G>A	1.37:g.150443166G>A	ENSP00000358064:p.Ser581Asn	Somatic	66	0		WXS	Illumina GAIIx	Phase_I	80	40	NM_015203	0	0	0	0	0	A8K6N8|B3KPT1|B4E2Q6|O75048|Q5VT51|Q5VT53|Q6MZL4|Q86XD2|Q9P0D7	Missense_Mutation	SNP	ENST00000369068.4	37	CCDS44216.1	.	.	.	.	.	.	.	.	.	.	G	0.006	-2.080227	0.00375	.	.	ENSG00000163125	ENST00000401000;ENST00000539519;ENST00000369068	T;T;T	0.43294	0.98;0.95;0.98	5.1	-9.01	0.00744	.	0.683997	0.14727	N	0.301988	T	0.03263	0.0095	N	0.02539	-0.55	0.09310	N	1	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.04013	0.0;0.0;0.001	T	0.26710	-1.0095	10	0.06494	T	0.89	-0.0665	13.0218	0.58791	0.2941:0.0:0.603:0.1029	.	555;581;555	B4E2Q6;Q5VT52;Q5VT52-3	.;RPRD2_HUMAN;.	N	555;555;581	ENSP00000383785:S555N;ENSP00000445482:S555N;ENSP00000358064:S581N	ENSP00000358064:S581N	S	+	2	0	RPRD2	148709790	0.000000	0.05858	0.112000	0.21494	0.104000	0.19210	-0.982000	0.03762	-2.208000	0.00740	-1.583000	0.00853	AGT	.		0.502	RPRD2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000035844.1	NM_015203	
INTS3	65123	broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	153721204	153721204	+	Missense_Mutation	SNP	G	G	C			TCGA-OR-A5L2-01A-11D-A30A-10	TCGA-OR-A5L2-10A-01D-A30A-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b99bd79e-aa33-4896-8d10-2517c793f439	48e26b1d-b84d-432b-940b-9907c81ddf5b	g.chr1:153721204G>C	ENST00000318967.2	+	6	1125	c.557G>C	c.(556-558)aGt>aCt	p.S186T	INTS3_ENST00000435409.2_Missense_Mutation_p.S186T|INTS3_ENST00000512605.1_5'Flank|RP11-216N14.8_ENST00000453778.1_RNA|INTS3_ENST00000456435.1_5'UTR|RP11-216N14.9_ENST00000434575.1_RNA	NM_023015.3	NP_075391.3	Q68E01	INT3_HUMAN	integrator complex subunit 3	187					cellular response to DNA damage stimulus (GO:0006974)|DNA repair (GO:0006281)|mitotic cell cycle checkpoint (GO:0007093)|response to ionizing radiation (GO:0010212)|snRNA processing (GO:0016180)	integrator complex (GO:0032039)|nucleus (GO:0005634)|SOSS complex (GO:0070876)				breast(1)|cervix(4)|endometrium(10)|kidney(1)|large_intestine(6)|lung(9)|ovary(2)|pancreas(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	38	all_lung(78;3.75e-32)|Lung NSC(65;1.37e-30)|Hepatocellular(266;0.0877)|Melanoma(130;0.199)		LUSC - Lung squamous cell carcinoma(543;0.151)			TTGGCAGAAAGTGTTCTGGAT	0.463																																					p.S186T		.											.	INTS3-93	0			c.G557C						.						225.0	229.0	228.0					1																	153721204		2203	4300	6503	SO:0001583	missense	65123	exon6			CAGAAAGTGTTCT	BX640950	CCDS1052.1	1q21.3	2012-03-16	2006-03-15	2006-03-15	ENSG00000143624	ENSG00000143624			26153	protein-coding gene	gene with protein product	"""sensor of single-strand DNA complex subunit A"""	611347	"""chromosome 1 open reading frame 60"""	C1orf60		16239144	Standard	NM_023015		Approved	FLJ21919, INT3, SOSS-A	uc001fct.3	Q68E01	OTTHUMG00000037089	ENST00000318967.2:c.557G>C	1.37:g.153721204G>C	ENSP00000318641:p.Ser186Thr	Somatic	129	2		WXS	Illumina GAIIx	Phase_I	197	55	NM_023015	0	0	0	0	0	A8K1W0|B4DQC8|B4E3U9|D3DV57|Q4G0E5|Q5VUQ5|Q5VUQ6|Q5VUR0|Q5VUR1|Q68DJ1|Q69YR5|Q6AI57|Q6DKG7|Q6MZQ4|Q6MZZ9|Q8NC46|Q8TB23|Q9H6S9	Missense_Mutation	SNP	ENST00000318967.2	37	CCDS1052.1	.	.	.	.	.	.	.	.	.	.	G	13.71	2.318503	0.40996	.	.	ENSG00000143624	ENST00000318967;ENST00000435409	.	.	.	5.52	4.58	0.56647	.	0.092352	0.85682	D	0.000000	T	0.27798	0.0684	L	0.31578	0.945	0.80722	D	1	B	0.06786	0.001	B	0.04013	0.001	T	0.13255	-1.0516	9	0.40728	T	0.16	.	8.6983	0.34310	0.1649:0.0:0.8351:0.0	.	186	Q68E01-2	.	T	186	.	ENSP00000318641:S186T	S	+	2	0	INTS3	151987828	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	1.509000	0.35780	2.873000	0.98535	0.563000	0.77884	AGT	.		0.463	INTS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090045.2	NM_023015	
KCNN3	3782	hgsc.bcm.edu	37	1	154842250	154842250	+	Missense_Mutation	SNP	G	G	T			TCGA-OR-A5L2-01A-11D-A30A-10	TCGA-OR-A5L2-10A-01D-A30A-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b99bd79e-aa33-4896-8d10-2517c793f439	48e26b1d-b84d-432b-940b-9907c81ddf5b	g.chr1:154842250G>T	ENST00000271915.4	-	1	506	c.191C>A	c.(190-192)cCg>cAg	p.P64Q	KCNN3_ENST00000358505.2_5'Flank	NM_001204087.1|NM_002249.5	NP_001191016.1|NP_002240.3	Q9UGI6	KCNN3_HUMAN	potassium intermediate/small conductance calcium-activated channel, subfamily N, member 3	64	Gln-rich.|Pro-rich.				potassium ion transmembrane transport (GO:0071805)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	calmodulin binding (GO:0005516)|small conductance calcium-activated potassium channel activity (GO:0016286)			cervix(1)|endometrium(3)|kidney(2)|large_intestine(6)|lung(11)|prostate(4)|skin(1)	28	all_lung(78;2.29e-27)|all_hematologic(923;0.088)|Hepatocellular(266;0.108)|all_neural(408;0.245)		BRCA - Breast invasive adenocarcinoma(34;0.00819)		Miconazole(DB01110)|Procaine(DB00721)	ctgaagctgcggaggctgagg	0.697																																					p.P64Q		.											.	KCNN3-91	0			c.C191A						.						5.0	4.0	5.0					1																	154842250		1971	3893	5864	SO:0001583	missense	3782	exon1			AGCTGCGGAGGCT	AF031815	CCDS1072.1, CCDS30880.1, CCDS72928.1	1q21.3	2012-07-05			ENSG00000143603	ENSG00000143603		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, calcium-activated"""	6292	protein-coding gene	gene with protein product		602983				9491810, 16382103	Standard	NM_002249		Approved	KCa2.3, hSK3, SKCA3	uc021pah.1	Q9UGI6	OTTHUMG00000037260	ENST00000271915.4:c.191C>A	1.37:g.154842250G>T	ENSP00000271915:p.Pro64Gln	Somatic	14	0		WXS	Illumina GAIIx	Phase_I	60	11	NM_001204087	0	0	0	0	0	B1ANX0|O43517|Q86VF9|Q8WXG7	Missense_Mutation	SNP	ENST00000271915.4	37	CCDS30880.1	.	.	.	.	.	.	.	.	.	.	g	0.383	-0.927562	0.02377	.	.	ENSG00000143603	ENST00000271915;ENST00000539103	T	0.56776	0.44	4.41	3.47	0.39725	.	4.657150	0.00567	N	0.000284	T	0.17916	0.0430	N	0.03608	-0.345	0.80722	D	1	.	.	.	.	.	.	T	0.04115	-1.0976	8	0.27082	T	0.32	-7.4946	9.6132	0.39676	0.0:0.0:0.7634:0.2366	.	.	.	.	Q	64;159	ENSP00000271915:P64Q	ENSP00000271915:P64Q	P	-	2	0	KCNN3	153108874	0.000000	0.05858	0.998000	0.56505	0.997000	0.91878	0.235000	0.17948	1.372000	0.46190	0.563000	0.77884	CCG	.		0.697	KCNN3-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090688.3	NM_002249	
HAPLN2	60484	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	156593357	156593357	+	Silent	SNP	A	A	G			TCGA-OR-A5L2-01A-11D-A30A-10	TCGA-OR-A5L2-10A-01D-A30A-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b99bd79e-aa33-4896-8d10-2517c793f439	48e26b1d-b84d-432b-940b-9907c81ddf5b	g.chr1:156593357A>G	ENST00000255039.1	+	3	482	c.75A>G	c.(73-75)caA>caG	p.Q25Q		NM_021817.2	NP_068589.1	Q9GZV7	HPLN2_HUMAN	hyaluronan and proteoglycan link protein 2	25					cell adhesion (GO:0007155)|establishment of blood-nerve barrier (GO:0008065)|extracellular matrix assembly (GO:0085029)	proteinaceous extracellular matrix (GO:0005578)	hyaluronic acid binding (GO:0005540)			NS(1)|endometrium(2)|large_intestine(1)|lung(1)|skin(1)|urinary_tract(1)	7	all_hematologic(923;0.088)|Hepatocellular(266;0.158)					ACAAAGCCCAAGGAGACCCAG	0.627																																					p.Q25Q		.											.	HAPLN2-90	0			c.A75G						.						60.0	50.0	54.0					1																	156593357		2203	4300	6503	SO:0001819	synonymous_variant	60484	exon3			AGCCCAAGGAGAC	AB049054	CCDS1148.1	1q23.1	2013-01-11			ENSG00000132702	ENSG00000132702		"""Immunoglobulin superfamily / V-set domain containing"""	17410	protein-coding gene	gene with protein product	"""brain link protein 1"""					11027579, 11873941	Standard	NM_021817		Approved	BRAL1	uc001fpn.1	Q9GZV7	OTTHUMG00000033205	ENST00000255039.1:c.75A>G	1.37:g.156593357A>G		Somatic	67	0		WXS	Illumina GAIIx	Phase_I	53	6	NM_021817	0	0	0	0	0	Q5T3J0	Silent	SNP	ENST00000255039.1	37	CCDS1148.1																																																																																			.		0.627	HAPLN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000081039.1	NM_021817	
GPA33	10223	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	167042639	167042639	+	Missense_Mutation	SNP	G	G	T			TCGA-OR-A5L2-01A-11D-A30A-10	TCGA-OR-A5L2-10A-01D-A30A-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b99bd79e-aa33-4896-8d10-2517c793f439	48e26b1d-b84d-432b-940b-9907c81ddf5b	g.chr1:167042639G>T	ENST00000367868.3	-	2	524	c.181C>A	c.(181-183)Ctc>Atc	p.L61I	GPA33_ENST00000527955.1_5'UTR	NM_005814.1	NP_005805.1	Q99795	GPA33_HUMAN	glycoprotein A33 (transmembrane)	61	Ig-like V-type.					extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	receptor activity (GO:0004872)			endometrium(4)|large_intestine(1)|lung(6)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	15						GTGAGGAGGAGCTTATCCCAT	0.507																																					p.L61I		.											.	GPA33-90	0			c.C181A						.						169.0	143.0	152.0					1																	167042639		2203	4300	6503	SO:0001583	missense	10223	exon2			GGAGGAGCTTATC	U79725	CCDS1258.1	1q24.1	2013-01-29			ENSG00000143167	ENSG00000143167		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	4445	protein-coding gene	gene with protein product		602171				9012807, 9245713	Standard	NM_005814		Approved	A33	uc001gea.1	Q99795	OTTHUMG00000034435	ENST00000367868.3:c.181C>A	1.37:g.167042639G>T	ENSP00000356842:p.Leu61Ile	Somatic	145	0		WXS	Illumina GAIIx	Phase_I	130	29	NM_005814	0	0	0	0	0	Q5VZP6	Missense_Mutation	SNP	ENST00000367868.3	37	CCDS1258.1	.	.	.	.	.	.	.	.	.	.	G	8.623	0.891891	0.17613	.	.	ENSG00000143167	ENST00000367868	T	0.04317	3.65	5.26	4.34	0.51931	Immunoglobulin V-set (1);Immunoglobulin-like (1);Immunoglobulin V-set, subgroup (1);Immunoglobulin-like fold (1);	0.739002	0.13437	N	0.387996	T	0.04497	0.0123	L	0.45137	1.4	0.34369	D	0.691875	D	0.71674	0.998	D	0.69824	0.966	T	0.18335	-1.0340	10	0.07175	T	0.84	.	9.6052	0.39630	0.0967:0.0:0.9033:0.0	.	61	Q99795	GPA33_HUMAN	I	61	ENSP00000356842:L61I	ENSP00000356842:L61I	L	-	1	0	GPA33	165309263	1.000000	0.71417	0.992000	0.48379	0.005000	0.04900	2.852000	0.48310	1.200000	0.43188	0.655000	0.94253	CTC	.		0.507	GPA33-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000083245.1	NM_005814	
TNN	63923	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	175046673	175046673	+	Missense_Mutation	SNP	T	T	A			TCGA-OR-A5L2-01A-11D-A30A-10	TCGA-OR-A5L2-10A-01D-A30A-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b99bd79e-aa33-4896-8d10-2517c793f439	48e26b1d-b84d-432b-940b-9907c81ddf5b	g.chr1:175046673T>A	ENST00000239462.4	+	2	232	c.119T>A	c.(118-120)gTc>gAc	p.V40D		NM_022093.1	NP_071376.1	Q9UQP3	TENN_HUMAN	tenascin N	40					axonogenesis (GO:0007409)|cell growth (GO:0016049)|cell migration (GO:0016477)|cell-matrix adhesion (GO:0007160)	cell surface (GO:0009986)|proteinaceous extracellular matrix (GO:0005578)				NS(1)|central_nervous_system(2)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(29)|liver(1)|lung(81)|ovary(5)|prostate(6)|skin(5)|stomach(4)|upper_aerodigestive_tract(3)|urinary_tract(3)	156		Breast(1374;0.000962)		KIRC - Kidney renal clear cell carcinoma(1967;0.00198)		GAGCAACAGGTCACTGTCAGC	0.612																																					p.V40D		.											.	TNN-138	0			c.T119A						.						79.0	60.0	66.0					1																	175046673		2203	4300	6503	SO:0001583	missense	63923	exon2			AACAGGTCACTGT	AK127044	CCDS30943.1	1q23-q24	2013-02-11			ENSG00000120332	ENSG00000120332		"""Fibrinogen C domain containing"", ""Fibronectin type III domain containing"""	22942	protein-coding gene	gene with protein product							Standard	NM_022093		Approved		uc001gkl.1	Q9UQP3	OTTHUMG00000034882	ENST00000239462.4:c.119T>A	1.37:g.175046673T>A	ENSP00000239462:p.Val40Asp	Somatic	145	0		WXS	Illumina GAIIx	Phase_I	144	57	NM_022093	0	0	0	0	0	B9EGP3|Q5R360	Missense_Mutation	SNP	ENST00000239462.4	37	CCDS30943.1	.	.	.	.	.	.	.	.	.	.	T	21.0	4.078243	0.76528	.	.	ENSG00000120332	ENST00000239462;ENST00000539081	T	0.36340	1.26	5.51	4.37	0.52481	.	0.318283	0.29424	N	0.012197	T	0.56307	0.1976	M	0.70595	2.14	0.53005	D	0.999965	D;D	0.76494	0.996;0.999	P;D	0.68943	0.806;0.961	T	0.58864	-0.7561	10	0.87932	D	0	.	11.6076	0.51041	0.1335:0.0:0.0:0.8665	.	40;40	B3KXB6;Q9UQP3	.;TENN_HUMAN	D	40	ENSP00000239462:V40D	ENSP00000239462:V40D	V	+	2	0	TNN	173313296	0.999000	0.42202	0.986000	0.45419	0.901000	0.52897	3.641000	0.54360	0.905000	0.36596	0.533000	0.62120	GTC	.		0.612	TNN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084422.1	XM_040527	
PRG4	10216	bcgsc.ca	37	1	186276284	186276286	+	In_Frame_Del	DEL	CTC	CTC	-	rs200031345|rs145095882|rs143141440	byFrequency	TCGA-OR-A5L2-01A-11D-A30A-10	TCGA-OR-A5L2-10A-01D-A30A-10	CTC	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b99bd79e-aa33-4896-8d10-2517c793f439	48e26b1d-b84d-432b-940b-9907c81ddf5b	g.chr1:186276284_186276286delCTC	ENST00000445192.2	+	7	1478_1480	c.1433_1435delCTC	c.(1432-1437)actccc>acc	p.P479del	PRG4_ENST00000367484.3_Intron|PRG4_ENST00000367485.4_In_Frame_Del_p.P386del|PRG4_ENST00000367483.4_In_Frame_Del_p.P438del|PRG4_ENST00000367486.3_In_Frame_Del_p.P436del	NM_005807.3	NP_005798.2	Q92954	PRG4_HUMAN	proteoglycan 4	479	59 X 8 AA repeats of K-X-P-X-P-T-T-X.				cell proliferation (GO:0008283)|hematopoietic stem cell proliferation (GO:0071425)|immune response (GO:0006955)|negative regulation of interleukin-6 biosynthetic process (GO:0045409)|regulation of cell proliferation (GO:0042127)	extracellular space (GO:0005615)	polysaccharide binding (GO:0030247)|scavenger receptor activity (GO:0005044)	p.P479delP(1)		NS(2)|breast(1)|central_nervous_system(1)|endometrium(26)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(12)|lung(33)|prostate(7)|skin(9)|upper_aerodigestive_tract(2)|urinary_tract(1)	102						GCACCCACCACTCCCAAAGAGCC	0.65																																					p.478_479del		.											.	PRG4-91	1	Deletion - In frame(1)	large_intestine(1)	c.1433_1435del						.		,,,	348,3912		14,320,1796					,,,	-1.4	0.0			89	1023,7215		71,881,3167	no	coding,coding,coding,coding	PRG4	NM_005807.3,NM_001127710.1,NM_001127709.1,NM_001127708.1	,,,	85,1201,4963	A1A1,A1R,RR		12.4181,8.169,10.9698	,,,	,,,		1371,11127				SO:0001651	inframe_deletion	10216	exon7			CCACCACTCCCAA	U70136	CCDS1369.1, CCDS44287.1, CCDS44288.1	1q25-q31	2008-07-18	2004-11-15		ENSG00000116690	ENSG00000116690			9364	protein-coding gene	gene with protein product	"""lubricin"", ""megakaryocyte stimulating factor"", ""articular superficial zone protein"", ""Jacobs camptodactyly-arthropathy-pericarditis syndrome"", ""camptodactyly, arthropathy, coxa vara, pericarditis syndrome"", ""bG174L6.2 (MSF: megakaryocyte stimulating factor )"""	604283	"""proteoglycan 4, (megakaryocyte stimulating factor, articular superficial zone protein, camptodactyly, arthropathy, coxa vara, pericarditis syndrome)"""	CACP		10545950, 9920774	Standard	NM_005807		Approved	JCAP, SZP, MSF, HAPO, bG174L6.2, FLJ32635	uc001gru.4	Q92954	OTTHUMG00000035574	ENST00000445192.2:c.1433_1435delCTC	1.37:g.186276284_186276286delCTC	ENSP00000399679:p.Pro479del	Somatic	34	2		WXS	Illumina GAIIx	Phase_I	24	10	NM_005807	0	0	0	0	0	Q6DNC4|Q6DNC5|Q6ZMZ5|Q9BX49	In_Frame_Del	DEL	ENST00000445192.2	37	CCDS1369.1																																																																																			.		0.650	PRG4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000086346.1	NM_005807	
ZNF281	23528	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	200378016	200378016	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5L2-01A-11D-A30A-10	TCGA-OR-A5L2-10A-01D-A30A-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b99bd79e-aa33-4896-8d10-2517c793f439	48e26b1d-b84d-432b-940b-9907c81ddf5b	g.chr1:200378016G>A	ENST00000294740.3	-	2	942	c.818C>T	c.(817-819)tCc>tTc	p.S273F	ZNF281_ENST00000367352.3_Missense_Mutation_p.S237F|ZNF281_ENST00000367353.1_Missense_Mutation_p.S273F	NM_001281293.1|NM_001281294.1|NM_012482.4	NP_001268222.1|NP_001268223.1|NP_036614.1	Q9Y2X9	ZN281_HUMAN	zinc finger protein 281	273					embryonic body morphogenesis (GO:0010172)|negative regulation of gene expression (GO:0010629)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription, DNA-templated (GO:0045893)|stem cell differentiation (GO:0048863)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	core promoter binding (GO:0001047)|metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)|transcription regulatory region DNA binding (GO:0044212)			breast(4)|endometrium(3)|kidney(3)|large_intestine(6)|lung(7)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	27						CAGGTGATAGGAGCTTCGGAA	0.468																																					p.S273F		.											.	ZNF281-154	0			c.C818T						.						89.0	84.0	85.0					1																	200378016		2203	4300	6503	SO:0001583	missense	23528	exon2			TGATAGGAGCTTC	AF125158	CCDS1402.1, CCDS60384.1	1q32.1	2012-08-08			ENSG00000162702	ENSG00000162702		"""Zinc fingers, C2H2-type"""	13075	protein-coding gene	gene with protein product						10448078	Standard	NM_012482		Approved	ZBP-99	uc001gve.3	Q9Y2X9	OTTHUMG00000035724	ENST00000294740.3:c.818C>T	1.37:g.200378016G>A	ENSP00000294740:p.Ser273Phe	Somatic	159	0		WXS	Illumina GAIIx	Phase_I	179	35	NM_012482	0	0	0	0	0	A6NF48|B3KMX2|Q5RKW5|Q9NY92	Missense_Mutation	SNP	ENST00000294740.3	37	CCDS1402.1	.	.	.	.	.	.	.	.	.	.	G	17.11	3.304822	0.60305	.	.	ENSG00000162702	ENST00000294740;ENST00000367353;ENST00000367352	T;T;T	0.08008	3.14;3.14;3.14	5.64	4.72	0.59763	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.85682	D	0.000000	T	0.21468	0.0517	L	0.52573	1.65	0.53005	D	0.999963	D;D	0.64830	0.994;0.994	P;P	0.60173	0.819;0.87	T	0.00706	-1.1601	10	0.72032	D	0.01	-2.9801	16.6577	0.85233	0.0:0.1299:0.8701:0.0	.	237;273	A6NF48;Q9Y2X9	.;ZN281_HUMAN	F	273;273;237	ENSP00000294740:S273F;ENSP00000356322:S273F;ENSP00000356321:S237F	ENSP00000294740:S273F	S	-	2	0	ZNF281	198644639	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.683000	0.84093	1.359000	0.45940	0.655000	0.94253	TCC	.		0.468	ZNF281-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000086879.2	NM_012482	
FLVCR1	28982	broad.mit.edu	37	1	213037122	213037122	+	Missense_Mutation	SNP	A	A	G			TCGA-OR-A5L2-01A-11D-A30A-10	TCGA-OR-A5L2-10A-01D-A30A-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b99bd79e-aa33-4896-8d10-2517c793f439	48e26b1d-b84d-432b-940b-9907c81ddf5b	g.chr1:213037122A>G	ENST00000366971.4	+	2	992	c.794A>G	c.(793-795)aAt>aGt	p.N265S		NM_014053.3	NP_054772.1	Q9Y5Y0	FLVC1_HUMAN	feline leukemia virus subgroup C cellular receptor 1	265					blood vessel development (GO:0001568)|cell death (GO:0008219)|cellular iron ion homeostasis (GO:0006879)|embryonic digit morphogenesis (GO:0042733)|embryonic skeletal system morphogenesis (GO:0048704)|erythrocyte differentiation (GO:0030218)|erythrocyte maturation (GO:0043249)|head morphogenesis (GO:0060323)|heme export (GO:0097037)|heme transport (GO:0015886)|in utero embryonic development (GO:0001701)|mitochondrial transport (GO:0006839)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|regulation of organ growth (GO:0046620)|spleen development (GO:0048536)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of plasma membrane (GO:0005887)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	heme transporter activity (GO:0015232)|transporter activity (GO:0005215)			cervix(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(1)|ovary(1)|prostate(1)|stomach(1)|urinary_tract(2)	12				OV - Ovarian serous cystadenocarcinoma(81;0.00733)|all cancers(67;0.013)|GBM - Glioblastoma multiforme(131;0.0845)|Epithelial(68;0.11)		AACACACAGAATGACACAAAT	0.368																																					p.N265S	Esophageal Squamous(199;2235 2952 19233 26256)	.											.	FLVCR1-90	0			c.A794G						.						162.0	149.0	153.0					1																	213037122		2203	4300	6503	SO:0001583	missense	28982	exon2			CACAGAATGACAC	AF118637	CCDS1510.1	1q32.3	2014-05-30			ENSG00000162769	ENSG00000162769		"""Solute carriers"""	24682	protein-coding gene	gene with protein product		609144	"""ataxia, posterior column 1, with retinitis pigmentosa"""	AXPC1		10400745, 10648427, 21070897	Standard	NM_014053		Approved	FLVCR, MFSD7B, PCA	uc001hjt.3	Q9Y5Y0	OTTHUMG00000036924	ENST00000366971.4:c.794A>G	1.37:g.213037122A>G	ENSP00000355938:p.Asn265Ser	Somatic	113	0		WXS	Illumina GAIIx	Phase_I	103	4	NM_014053	0	0	0	0	0	Q1HE16|Q86XY9|Q9NVR9	Missense_Mutation	SNP	ENST00000366971.4	37	CCDS1510.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	12.16|12.16	1.854670|1.854670	0.32791|0.32791	.|.	.|.	ENSG00000162769|ENSG00000162769	ENST00000419102|ENST00000366971	.|D	.|0.81821	.|-1.54	5.5|5.5	5.5|5.5	0.81552|0.81552	.|Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	.|0.257024	.|0.43110	.|D	.|0.000609	T|T	0.68586|0.68586	0.3017|0.3017	N|N	0.20685|0.20685	0.6|0.6	0.33604|0.33604	D|D	0.602672|0.602672	.|B	.|0.21821	.|0.061	.|B	.|0.25759	.|0.063	T|T	0.69375|0.69375	-0.5162|-0.5162	5|10	.|0.16420	.|T	.|0.52	-34.2407|-34.2407	14.7671|14.7671	0.69648|0.69648	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	.|265	.|Q9Y5Y0	.|FLVC1_HUMAN	V|S	111|265	.|ENSP00000355938:N265S	.|ENSP00000355938:N265S	M|N	+|+	1|2	0|0	FLVCR1|FLVCR1	211103745|211103745	1.000000|1.000000	0.71417|0.71417	0.988000|0.988000	0.46212|0.46212	0.825000|0.825000	0.46686|0.46686	8.681000|8.681000	0.91228|0.91228	2.080000|2.080000	0.62538|0.62538	0.455000|0.455000	0.32223|0.32223	ATG|AAT	.		0.368	FLVCR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000089678.2	NM_014053	
CENPF	1063	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	214816433	214816433	+	Silent	SNP	C	C	T	rs200241672		TCGA-OR-A5L2-01A-11D-A30A-10	TCGA-OR-A5L2-10A-01D-A30A-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b99bd79e-aa33-4896-8d10-2517c793f439	48e26b1d-b84d-432b-940b-9907c81ddf5b	g.chr1:214816433C>T	ENST00000366955.3	+	12	4920	c.4752C>T	c.(4750-4752)ctC>ctT	p.L1584L		NM_016343.3	NP_057427.3	P49454	CENPF_HUMAN	centromere protein F, 350/400kDa	1680	2 X 96 AA approximate tandem repeats.		Missing. {ECO:0000269|PubMed:7651420}.		cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|chromosome segregation (GO:0007059)|DNA replication (GO:0006260)|G2/M transition of mitotic cell cycle (GO:0000086)|kinetochore assembly (GO:0051382)|metaphase plate congression (GO:0051310)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic spindle assembly checkpoint (GO:0007094)|muscle organ development (GO:0007517)|negative regulation of transcription, DNA-templated (GO:0045892)|protein transport (GO:0015031)|regulation of cell cycle (GO:0051726)|regulation of G2/M transition of mitotic cell cycle (GO:0010389)|regulation of striated muscle tissue development (GO:0016202)|response to drug (GO:0042493)	chromosome, centromeric region (GO:0000775)|condensed chromosome outer kinetochore (GO:0000940)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinetochore (GO:0000776)|midbody (GO:0030496)|nuclear envelope (GO:0005635)|nuclear matrix (GO:0016363)|nucleus (GO:0005634)|pronucleus (GO:0045120)|spindle (GO:0005819)|spindle pole (GO:0000922)	chromatin binding (GO:0003682)|dynein binding (GO:0045502)|protein C-terminus binding (GO:0008022)|protein homodimerization activity (GO:0042803)|transcription factor binding (GO:0008134)			NS(2)|breast(2)|central_nervous_system(4)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(37)|lung(47)|ovary(7)|prostate(3)|skin(6)|stomach(1)|urinary_tract(1)	126				all cancers(67;0.00836)|OV - Ovarian serous cystadenocarcinoma(81;0.00855)|GBM - Glioblastoma multiforme(131;0.0694)|Epithelial(68;0.0833)		TTCAAGAGCTCGAGCAGTTAT	0.443																																					p.L1584L	Colon(80;575 1284 11000 14801 43496)	.											.	CENPF-567	0			c.C4752T						.						53.0	56.0	55.0					1																	214816433		2203	4300	6503	SO:0001819	synonymous_variant	1063	exon12			AGAGCTCGAGCAG	U30872	CCDS31023.1	1q41	2013-11-05	2013-01-17		ENSG00000117724	ENSG00000117724			1857	protein-coding gene	gene with protein product	"""mitosin"""	600236	"""centromere protein F, 350/400kDa (mitosin)"""			7904902, 7851898	Standard	NM_016343		Approved	hcp-1	uc001hkm.3	P49454	OTTHUMG00000036955	ENST00000366955.3:c.4752C>T	1.37:g.214816433C>T		Somatic	102	0		WXS	Illumina GAIIx	Phase_I	102	47	NM_016343	0	0	0	0	0	Q13171|Q13246|Q5VVM7	Silent	SNP	ENST00000366955.3	37	CCDS31023.1																																																																																			C|0.999;G|0.001		0.443	CENPF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000089749.1	NM_016343	
USH2A	7399	broad.mit.edu	37	1	216363571	216363571	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5L2-01A-11D-A30A-10	TCGA-OR-A5L2-10A-01D-A30A-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b99bd79e-aa33-4896-8d10-2517c793f439	48e26b1d-b84d-432b-940b-9907c81ddf5b	g.chr1:216363571C>T	ENST00000307340.3	-	20	4776	c.4390G>A	c.(4390-4392)Gca>Aca	p.A1464T	USH2A_ENST00000366942.3_Missense_Mutation_p.A1464T|USH2A_ENST00000366943.2_Missense_Mutation_p.A1464T	NM_206933.2	NP_996816	O75445	USH2A_HUMAN	Usher syndrome 2A (autosomal recessive, mild)	1464	Fibronectin type-III 4. {ECO:0000255|PROSITE-ProRule:PRU00316}.				hair cell differentiation (GO:0035315)|inner ear receptor cell differentiation (GO:0060113)|maintenance of organ identity (GO:0048496)|photoreceptor cell maintenance (GO:0045494)|response to stimulus (GO:0050896)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	apical plasma membrane (GO:0016324)|basement membrane (GO:0005604)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|stereocilia ankle link complex (GO:0002142)|stereocilium bundle (GO:0032421)|stereocilium membrane (GO:0060171)	collagen binding (GO:0005518)|myosin binding (GO:0017022)			NS(7)|breast(20)|central_nervous_system(3)|cervix(2)|endometrium(32)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(71)|liver(2)|lung(282)|ovary(25)|pancreas(2)|prostate(12)|skin(22)|stomach(7)|upper_aerodigestive_tract(20)|urinary_tract(3)	527				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)		TTACCTGCTGCTAAAGTTTGT	0.348										HNSCC(13;0.011)																											p.A1464T		.											.	USH2A-115	0			c.G4390A						.						95.0	92.0	93.0					1																	216363571		2203	4300	6503	SO:0001583	missense	7399	exon20			CTGCTGCTAAAGT	AF055580	CCDS1516.1, CCDS31025.1	1q41	2013-02-11			ENSG00000042781	ENSG00000042781		"""Fibronectin type III domain containing"""	12601	protein-coding gene	gene with protein product	"""usherin"""	608400		USH2		9624053, 10729113	Standard	NM_007123		Approved	RP39	uc001hku.1	O75445	OTTHUMG00000037079	ENST00000307340.3:c.4390G>A	1.37:g.216363571C>T	ENSP00000305941:p.Ala1464Thr	Somatic	81	0		WXS	Illumina GAIIx	Phase_I	67	4	NM_206933	0	0	0	0	0	Q5VVM9|Q6S362|Q9NS27	Missense_Mutation	SNP	ENST00000307340.3	37	CCDS31025.1	.	.	.	.	.	.	.	.	.	.	C	17.13	3.310510	0.60414	.	.	ENSG00000042781	ENST00000307340;ENST00000366943;ENST00000366942	T;T;T	0.54279	0.58;0.58;0.58	5.22	4.3	0.51218	Fibronectin, type III (1);Immunoglobulin-like fold (1);	0.000000	0.43416	U	0.000576	T	0.64091	0.2567	M	0.64997	1.995	0.36612	D	0.875271	P;D	0.67145	0.897;0.996	P;P	0.57204	0.624;0.815	T	0.71768	-0.4493	10	0.44086	T	0.13	.	15.2241	0.73336	0.0:0.7335:0.2665:0.0	.	1464;1464	O75445-2;O75445	.;USH2A_HUMAN	T	1464	ENSP00000305941:A1464T;ENSP00000355910:A1464T;ENSP00000355909:A1464T	ENSP00000305941:A1464T	A	-	1	0	USH2A	214430194	1.000000	0.71417	0.892000	0.35008	0.704000	0.40688	2.898000	0.48672	1.310000	0.45006	0.655000	0.94253	GCA	.		0.348	USH2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128138.1	NM_007123	
OBSCN	84033	hgsc.bcm.edu	37	1	228399799	228399799	+	Silent	SNP	C	C	T	rs11582369	byFrequency	TCGA-OR-A5L2-01A-11D-A30A-10	TCGA-OR-A5L2-10A-01D-A30A-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b99bd79e-aa33-4896-8d10-2517c793f439	48e26b1d-b84d-432b-940b-9907c81ddf5b	g.chr1:228399799C>T	ENST00000422127.1	+	2	359	c.315C>T	c.(313-315)tgC>tgT	p.C105C	OBSCN_ENST00000366709.4_5'UTR|OBSCN_ENST00000284548.11_Silent_p.C105C|OBSCN_ENST00000570156.2_Silent_p.C105C|C1orf145_ENST00000295012.5_Intron|OBSCN_ENST00000366707.4_5'UTR	NM_001098623.2	NP_001092093.2	Q5VST9	OBSCN_HUMAN	obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF	105					apoptotic signaling pathway (GO:0097190)|multicellular organismal development (GO:0007275)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|protein localization to M-band (GO:0036309)|regulation of small GTPase mediated signal transduction (GO:0051056)|sarcomere organization (GO:0045214)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|M band (GO:0031430)|myofibril (GO:0030016)|Z disc (GO:0030018)	ankyrin binding (GO:0030506)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|structural constituent of muscle (GO:0008307)|titin binding (GO:0031432)			NS(2)|breast(7)|central_nervous_system(5)|cervix(2)|endometrium(30)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(37)|lung(89)|ovary(8)|pancreas(3)|prostate(13)|skin(6)|stomach(11)|upper_aerodigestive_tract(2)|urinary_tract(3)	223		Prostate(94;0.0405)				AGGCCGCGTGCGCCGAGCAGG	0.736													C|||	254	0.0507188	0.0129	0.0591	5008	,	,		8585	0.121		0.0338	False		,,,				2504	0.0409				p.C105C		.											.	OBSCN-403	0			c.C315T						.	C	,	63,3177		0,63,1557	6.0	7.0	6.0		315,315	-4.9	0.0	1	dbSNP_120	6	259,6741		4,251,3245	no	coding-synonymous,coding-synonymous	OBSCN	NM_001098623.1,NM_052843.2	,	4,314,4802	TT,TC,CC		3.7,1.9444,3.1445	,	105/7969,105/6621	228399799	322,9918	1620	3500	5120	SO:0001819	synonymous_variant	84033	exon2			CGCGTGCGCCGAG	AJ002535	CCDS1570.2, CCDS58065.1, CCDS59204.1	1q42	2014-09-17			ENSG00000154358	ENSG00000154358		"""Rho guanine nucleotide exchange factors"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	15719	protein-coding gene	gene with protein product		608616				11448995, 11814696	Standard	NM_001098623		Approved	KIAA1556, UNC89, KIAA1639, ARHGEF30	uc001hsq.2	Q5VST9	OTTHUMG00000039772	ENST00000422127.1:c.315C>T	1.37:g.228399799C>T		Somatic	1	0		WXS	Illumina GAIIx	Phase_I	23	9	NM_001271223	0	0	0	0	0	Q2A664|Q5T7G8|Q5T7G9|Q5VSU2|Q86YC7|Q8NHN0|Q8NHN1|Q8NHN2|Q8NHN3|Q8NHN4|Q8NHN5|Q8NHN6|Q8NHN7|Q8NHN8|Q8NHN9|Q96AA2|Q9HCD3|Q9HCL6	Silent	SNP	ENST00000422127.1	37	CCDS58065.1																																																																																			C|0.943;T|0.057		0.736	OBSCN-204	KNOWN	basic|CCDS	protein_coding	protein_coding		NM_052843	
OBSCN	84033	hgsc.bcm.edu	37	1	228504670	228504670	+	Missense_Mutation	SNP	C	C	T	rs11810627	byFrequency	TCGA-OR-A5L2-01A-11D-A30A-10	TCGA-OR-A5L2-10A-01D-A30A-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b99bd79e-aa33-4896-8d10-2517c793f439	48e26b1d-b84d-432b-940b-9907c81ddf5b	g.chr1:228504670C>T	ENST00000422127.1	+	51	13590	c.13546C>T	c.(13546-13548)Cgg>Tgg	p.R4516W	OBSCN_ENST00000284548.11_Missense_Mutation_p.R4516W|OBSCN_ENST00000366707.4_Missense_Mutation_p.R2150W|OBSCN_ENST00000366709.4_Missense_Mutation_p.R1635W|OBSCN_ENST00000570156.2_Missense_Mutation_p.R5473W	NM_001098623.2	NP_001092093.2	Q5VST9	OBSCN_HUMAN	obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF	4516	Ig-like 46.		R -> W (in dbSNP:rs11810627).		apoptotic signaling pathway (GO:0097190)|multicellular organismal development (GO:0007275)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|protein localization to M-band (GO:0036309)|regulation of small GTPase mediated signal transduction (GO:0051056)|sarcomere organization (GO:0045214)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|M band (GO:0031430)|myofibril (GO:0030016)|Z disc (GO:0030018)	ankyrin binding (GO:0030506)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|structural constituent of muscle (GO:0008307)|titin binding (GO:0031432)			NS(2)|breast(7)|central_nervous_system(5)|cervix(2)|endometrium(30)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(37)|lung(89)|ovary(8)|pancreas(3)|prostate(13)|skin(6)|stomach(11)|upper_aerodigestive_tract(2)|urinary_tract(3)	223		Prostate(94;0.0405)				GGCCTCTGCGCGGCTCACCGT	0.736													c|||	1654	0.330272	0.2791	0.4006	5008	,	,		13971	0.249		0.4861	False		,,,				2504	0.273				p.R5473W		.											.	OBSCN-403	0			c.C16417T						.		TRP/ARG,TRP/ARG	923,2833		165,593,1120	5.0	6.0	6.0		13546,13546	-1.0	0.0	1	dbSNP_120	6	3333,4245		861,1611,1317	yes	missense,missense	OBSCN	NM_001098623.1,NM_052843.2	101,101	1026,2204,2437	TT,TC,CC		43.9826,24.574,37.5507	probably-damaging,probably-damaging	4516/7969,4516/6621	228504670	4256,7078	1878	3789	5667	SO:0001583	missense	84033	exon62			TCTGCGCGGCTCA	AJ002535	CCDS1570.2, CCDS58065.1, CCDS59204.1	1q42	2014-09-17			ENSG00000154358	ENSG00000154358		"""Rho guanine nucleotide exchange factors"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	15719	protein-coding gene	gene with protein product		608616				11448995, 11814696	Standard	NM_001098623		Approved	KIAA1556, UNC89, KIAA1639, ARHGEF30	uc001hsq.2	Q5VST9	OTTHUMG00000039772	ENST00000422127.1:c.13546C>T	1.37:g.228504670C>T	ENSP00000409493:p.Arg4516Trp	Somatic	4	0		WXS	Illumina GAIIx	Phase_I	64	53	NM_001271223	0	0	0	0	0	Q2A664|Q5T7G8|Q5T7G9|Q5VSU2|Q86YC7|Q8NHN0|Q8NHN1|Q8NHN2|Q8NHN3|Q8NHN4|Q8NHN5|Q8NHN6|Q8NHN7|Q8NHN8|Q8NHN9|Q96AA2|Q9HCD3|Q9HCL6	Missense_Mutation	SNP	ENST00000422127.1	37	CCDS58065.1	774	0.3543956043956044	137	0.2784552845528455	144	0.39779005524861877	134	0.23426573426573427	359	0.4736147757255937	c	11.94	1.787178	0.31593	0.24574	0.439826	ENSG00000154358	ENST00000284548;ENST00000422127;ENST00000366707;ENST00000366709	T;T;T;T	0.77098	-1.07;-1.07;0.2;0.2	5.41	-0.971	0.10303	Immunoglobulin subtype (1);Fibronectin, type III (1);Immunoglobulin-like fold (1);	0.167607	0.36519	N	0.002550	T	0.00012	0.0000	L	0.41824	1.3	0.50632	P	1.1499999999997623E-4	B;B	0.22541	0.071;0.067	B;B	0.12156	0.007;0.007	T	0.42275	-0.9461	9	0.45353	T	0.12	.	10.3619	0.43998	0.6084:0.317:0.0:0.0747	rs11810627	4516;4516	Q5VST9;Q5VST9-3	OBSCN_HUMAN;.	W	4516;4516;2150;1635	ENSP00000284548:R4516W;ENSP00000409493:R4516W;ENSP00000355668:R2150W;ENSP00000355670:R1635W	ENSP00000284548:R4516W	R	+	1	2	OBSCN	226571293	0.968000	0.33430	0.013000	0.15412	0.016000	0.09150	2.032000	0.41127	-0.028000	0.13850	0.550000	0.68814	CGG	C|0.643;T|0.357		0.736	OBSCN-204	KNOWN	basic|CCDS	protein_coding	protein_coding		NM_052843	
OBSCN	84033	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	228563506	228563506	+	Silent	SNP	T	T	C			TCGA-OR-A5L2-01A-11D-A30A-10	TCGA-OR-A5L2-10A-01D-A30A-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b99bd79e-aa33-4896-8d10-2517c793f439	48e26b1d-b84d-432b-940b-9907c81ddf5b	g.chr1:228563506T>C	ENST00000422127.1	+	98	22811	c.22767T>C	c.(22765-22767)atT>atC	p.I7589I	OBSCN_ENST00000366707.4_Silent_p.I5223I|OBSCN_ENST00000570156.2_Silent_p.I8546I	NM_001098623.2	NP_001092093.2	Q5VST9	OBSCN_HUMAN	obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF	7589	Fibronectin type-III 4. {ECO:0000255|PROSITE-ProRule:PRU00316}.				apoptotic signaling pathway (GO:0097190)|multicellular organismal development (GO:0007275)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|protein localization to M-band (GO:0036309)|regulation of small GTPase mediated signal transduction (GO:0051056)|sarcomere organization (GO:0045214)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|M band (GO:0031430)|myofibril (GO:0030016)|Z disc (GO:0030018)	ankyrin binding (GO:0030506)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|structural constituent of muscle (GO:0008307)|titin binding (GO:0031432)			NS(2)|breast(7)|central_nervous_system(5)|cervix(2)|endometrium(30)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(37)|lung(89)|ovary(8)|pancreas(3)|prostate(13)|skin(6)|stomach(11)|upper_aerodigestive_tract(2)|urinary_tract(3)	223		Prostate(94;0.0405)				TGACCTACATTGTGCAGTGCA	0.652																																					p.I8546I		.											.	OBSCN-403	0			c.T25638C						.						77.0	91.0	87.0					1																	228563506		2115	4225	6340	SO:0001819	synonymous_variant	84033	exon109			CTACATTGTGCAG	AJ002535	CCDS1570.2, CCDS58065.1, CCDS59204.1	1q42	2014-09-17			ENSG00000154358	ENSG00000154358		"""Rho guanine nucleotide exchange factors"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	15719	protein-coding gene	gene with protein product		608616				11448995, 11814696	Standard	NM_001098623		Approved	KIAA1556, UNC89, KIAA1639, ARHGEF30	uc001hsq.2	Q5VST9	OTTHUMG00000039772	ENST00000422127.1:c.22767T>C	1.37:g.228563506T>C		Somatic	204	1		WXS	Illumina GAIIx	Phase_I	208	82	NM_001271223	0	0	0	0	0	Q2A664|Q5T7G8|Q5T7G9|Q5VSU2|Q86YC7|Q8NHN0|Q8NHN1|Q8NHN2|Q8NHN3|Q8NHN4|Q8NHN5|Q8NHN6|Q8NHN7|Q8NHN8|Q8NHN9|Q96AA2|Q9HCD3|Q9HCL6	Silent	SNP	ENST00000422127.1	37	CCDS58065.1	.	.	.	.	.	.	.	.	.	.	t	13.28	2.191277	0.38707	.	.	ENSG00000154358	ENST00000441106	.	.	.	5.33	-3.85	0.04243	.	.	.	.	.	T	0.56659	0.2000	.	.	.	0.58432	D	0.999997	.	.	.	.	.	.	T	0.55673	-0.8104	4	.	.	.	.	11.9992	0.53220	0.0:0.3827:0.0:0.6173	.	.	.	.	R	2206	.	.	C	+	1	0	OBSCN	226630129	0.000000	0.05858	0.403000	0.26384	0.690000	0.40134	-3.403000	0.00483	-0.898000	0.03906	-0.392000	0.06488	TGT	.		0.652	OBSCN-204	KNOWN	basic|CCDS	protein_coding	protein_coding		NM_052843	
PCNXL2	80003	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	1	233388165	233388165	+	Missense_Mutation	SNP	C	C	G			TCGA-OR-A5L2-01A-11D-A30A-10	TCGA-OR-A5L2-10A-01D-A30A-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b99bd79e-aa33-4896-8d10-2517c793f439	48e26b1d-b84d-432b-940b-9907c81ddf5b	g.chr1:233388165C>G	ENST00000258229.9	-	7	2297	c.2063G>C	c.(2062-2064)gGg>gCg	p.G688A	PCNXL2_ENST00000430153.1_5'UTR	NM_014801.3	NP_055616.3	A6NKB5	PCX2_HUMAN	pecanex-like 2 (Drosophila)	688						integral component of membrane (GO:0016021)				NS(1)|autonomic_ganglia(1)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(16)|kidney(7)|large_intestine(19)|lung(30)|pancreas(1)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	86		all_cancers(173;0.0347)|Prostate(94;0.137)				TGTTTCAGGCCCACTGATGAC	0.383																																					p.G688A		.											.	PCNXL2-91	0			c.G2063C						.						131.0	123.0	125.0					1																	233388165		1907	4123	6030	SO:0001583	missense	80003	exon7			TCAGGCCCACTGA	AK055374	CCDS44335.1	1q42.2	2008-02-05	2001-11-28		ENSG00000135749	ENSG00000135749			8736	protein-coding gene	gene with protein product			"""pecanex (Drosophila)-like 2"""			12477932	Standard	NM_014801		Approved	KIAA0435, FLJ11383	uc001hvl.2	A6NKB5	OTTHUMG00000037824	ENST00000258229.9:c.2063G>C	1.37:g.233388165C>G	ENSP00000258229:p.Gly688Ala	Somatic	229	0		WXS	Illumina GAIIx	Phase_I	237	15	NM_014801	0	0	0	0	0	O43162|Q5T9Z8|Q5TDF1|Q8TEP4|Q96HP9|Q9HAL8	Missense_Mutation	SNP	ENST00000258229.9	37	CCDS44335.1	.	.	.	.	.	.	.	.	.	.	C	22.5	4.298658	0.81025	.	.	ENSG00000135749	ENST00000258229	T	0.37235	1.21	5.35	5.35	0.76521	.	.	.	.	.	T	0.48714	0.1515	L	0.29908	0.895	0.80722	D	1	D	0.76494	0.999	D	0.64237	0.923	T	0.47195	-0.9136	9	0.56958	D	0.05	.	19.4403	0.94817	0.0:1.0:0.0:0.0	.	688	A6NKB5	PCX2_HUMAN	A	688	ENSP00000258229:G688A	ENSP00000258229:G688A	G	-	2	0	PCNXL2	231454788	1.000000	0.71417	1.000000	0.80357	0.970000	0.65996	4.377000	0.59562	2.666000	0.90696	0.557000	0.71058	GGG	.		0.383	PCNXL2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000092480.3	NM_014801	
HEATR1	55127	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	236722384	236722384	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5L2-01A-11D-A30A-10	TCGA-OR-A5L2-10A-01D-A30A-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b99bd79e-aa33-4896-8d10-2517c793f439	48e26b1d-b84d-432b-940b-9907c81ddf5b	g.chr1:236722384C>T	ENST00000366582.3	-	35	4936	c.4822G>A	c.(4822-4824)Gtg>Atg	p.V1608M	HEATR1_ENST00000366581.2_Missense_Mutation_p.V1527M	NM_018072.5	NP_060542.4	Q9H583	HEAT1_HUMAN	HEAT repeat containing 1	1608					rRNA processing (GO:0006364)	membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	poly(A) RNA binding (GO:0044822)			NS(2)|breast(7)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(18)|lung(28)|ovary(3)|prostate(1)|skin(4)|stomach(3)|upper_aerodigestive_tract(3)	87	Ovarian(103;0.0634)|Breast(184;0.133)	all_cancers(173;0.0255)|Prostate(94;0.175)	OV - Ovarian serous cystadenocarcinoma(106;0.00117)			GGATTGCCCACCAGCCCTCTG	0.408																																					p.V1608M		.											.	HEATR1-93	0			c.G4822A						.						98.0	93.0	94.0					1																	236722384		2203	4300	6503	SO:0001583	missense	55127	exon35			TGCCCACCAGCCC	BC065205	CCDS31066.1	1q43	2011-08-12			ENSG00000119285	ENSG00000119285			25517	protein-coding gene	gene with protein product	"""UTP10, small subunit (SSU) processome component, homolog (yeast)"""					17699751	Standard	NM_018072		Approved	FLJ10359, BAP28, UTP10	uc001hyd.2	Q9H583	OTTHUMG00000040061	ENST00000366582.3:c.4822G>A	1.37:g.236722384C>T	ENSP00000355541:p.Val1608Met	Somatic	27	0		WXS	Illumina GAIIx	Phase_I	59	23	NM_018072	0	0	0	0	0	Q5T3Q8|Q6P197|Q9NW23	Missense_Mutation	SNP	ENST00000366582.3	37	CCDS31066.1	.	.	.	.	.	.	.	.	.	.	C	12.58	1.981976	0.34942	.	.	ENSG00000119285	ENST00000366582;ENST00000366581	T;T	0.64991	-0.13;-0.13	5.79	0.265	0.15612	Armadillo-like helical (1);Armadillo-type fold (1);	0.261301	0.41001	D	0.000978	T	0.29126	0.0724	N	0.02391	-0.57	0.80722	D	1	B;B	0.10296	0.003;0.001	B;B	0.06405	0.002;0.001	T	0.02431	-1.1160	10	0.25751	T	0.34	.	6.8994	0.24275	0.0995:0.1504:0.6342:0.1159	.	1527;1608	Q5T3Q7;Q9H583	.;HEAT1_HUMAN	M	1608;1527	ENSP00000355541:V1608M;ENSP00000355540:V1527M	ENSP00000355540:V1527M	V	-	1	0	HEATR1	234789007	0.873000	0.30073	0.900000	0.35374	0.980000	0.70556	1.014000	0.29950	0.330000	0.23485	0.650000	0.86243	GTG	.		0.408	HEATR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096635.1	XM_375853	
LIPN	643418	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	90528645	90528645	+	Missense_Mutation	SNP	T	T	C			TCGA-OR-A5L2-01A-11D-A30A-10	TCGA-OR-A5L2-10A-01D-A30A-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b99bd79e-aa33-4896-8d10-2517c793f439	48e26b1d-b84d-432b-940b-9907c81ddf5b	g.chr10:90528645T>C	ENST00000404459.1	+	5	632	c.632T>C	c.(631-633)aTt>aCt	p.I211T		NM_001102469.1	NP_001095939.1	Q5VXI9	LIPN_HUMAN	lipase, family member N	211					lipid catabolic process (GO:0016042)	extracellular region (GO:0005576)	hydrolase activity, acting on ester bonds (GO:0016788)			endometrium(1)|kidney(1)|large_intestine(5)|lung(1)|skin(1)	9		Colorectal(252;0.0161)		Colorectal(12;4.83e-05)|COAD - Colon adenocarcinoma(12;6.5e-05)		CCCACGGGCATTTTTACCAGG	0.388																																					p.I211T		.											.	.	0			c.T632C						.						101.0	96.0	97.0					10																	90528645		1803	4064	5867	SO:0001583	missense	643418	exon5			CGGGCATTTTTAC		CCDS44456.1	10q23.31	2013-09-20	2007-02-27	2007-02-27	ENSG00000204020	ENSG00000204020			23452	protein-coding gene	gene with protein product		613924	"""lipase-like, ab-hydrolase domain containing 4"""	LIPL4			Standard	NM_001102469		Approved	bA186O14.3	uc010qmw.2	Q5VXI9	OTTHUMG00000018694	ENST00000404459.1:c.632T>C	10.37:g.90528645T>C	ENSP00000383923:p.Ile211Thr	Somatic	68	0		WXS	Illumina GAIIx	Phase_I	68	33	NM_001102469	0	0	0	0	0	A7KIH9	Missense_Mutation	SNP	ENST00000404459.1	37	CCDS44456.1	.	.	.	.	.	.	.	.	.	.	T	8.596	0.885690	0.17540	.	.	ENSG00000204020	ENST00000404459	T	0.70282	-0.47	4.6	3.42	0.39159	Alpha/beta hydrolase fold-1 (1);	0.645960	0.14322	N	0.326970	T	0.59307	0.2184	L	0.42487	1.325	0.09310	N	1	B	0.29955	0.263	B	0.29440	0.102	T	0.54629	-0.8265	10	0.56958	D	0.05	-11.6782	6.2337	0.20750	0.0:0.1838:0.0:0.8162	.	211	Q5VXI9	LIPN_HUMAN	T	211	ENSP00000383923:I211T	ENSP00000383923:I211T	I	+	2	0	LIPN	90518625	0.530000	0.26330	0.211000	0.23655	0.817000	0.46193	3.332000	0.52083	1.923000	0.55706	0.477000	0.44152	ATT	.		0.388	LIPN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049254.2	XM_926751	
IFIT1B	439996	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	10	91143636	91143636	+	Missense_Mutation	SNP	A	A	T			TCGA-OR-A5L2-01A-11D-A30A-10	TCGA-OR-A5L2-10A-01D-A30A-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b99bd79e-aa33-4896-8d10-2517c793f439	48e26b1d-b84d-432b-940b-9907c81ddf5b	g.chr10:91143636A>T	ENST00000371809.3	+	2	646	c.566A>T	c.(565-567)gAt>gTt	p.D189V	LIPA_ENST00000371837.1_Intron	NM_001010987.2	NP_001010987.1	Q5T764	IFT1B_HUMAN	interferon-induced protein with tetratricopeptide repeats 1B	189										endometrium(2)|large_intestine(3)|lung(8)	13						TATCGCCTGGATAAATTTAAC	0.443																																					p.D189V		.											.	IFIT1B-90	0			c.A566T						.						213.0	221.0	218.0					10																	91143636		2203	4300	6503	SO:0001583	missense	439996	exon2			GCCTGGATAAATT		CCDS31242.1	10q23.31	2014-05-22	2010-03-22	2010-03-22	ENSG00000204010	ENSG00000204010		"""Tetratricopeptide (TTC) repeat domain containing"""	23442	protein-coding gene	gene with protein product			"""interferon-induced protein with tetratricopeptide repeats 1-like"""	IFIT1L			Standard	NM_001010987		Approved	bA149I23.6	uc001kgh.3	Q5T764	OTTHUMG00000018709	ENST00000371809.3:c.566A>T	10.37:g.91143636A>T	ENSP00000360874:p.Asp189Val	Somatic	80	0		WXS	Illumina GAIIx	Phase_I	79	12	NM_001010987	0	0	0	0	0	A7E245	Missense_Mutation	SNP	ENST00000371809.3	37	CCDS31242.1	.	.	.	.	.	.	.	.	.	.	A	15.71	2.913428	0.52439	.	.	ENSG00000204010	ENST00000371809	T	0.64260	-0.09	4.58	3.43	0.39272	Tetratricopeptide-like helical (1);Tetratricopeptide repeat-containing (1);	0.420734	0.24033	U	0.042174	T	0.74419	0.3714	M	0.87180	2.865	0.23903	N	0.996513	D	0.67145	0.996	P	0.56563	0.801	T	0.66408	-0.5931	10	0.48119	T	0.1	.	9.2122	0.37326	0.9129:0.0:0.0871:0.0	.	189	Q5T764	IFT1B_HUMAN	V	189	ENSP00000360874:D189V	ENSP00000360874:D189V	D	+	2	0	IFIT1B	91133616	0.998000	0.40836	0.018000	0.16275	0.053000	0.15095	4.409000	0.59768	0.603000	0.29913	0.455000	0.32223	GAT	.		0.443	IFIT1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049296.3	NM_001010987	
PLCE1	51196	broad.mit.edu;bcgsc.ca	37	10	95931233	95931233	+	Missense_Mutation	SNP	C	C	G			TCGA-OR-A5L2-01A-11D-A30A-10	TCGA-OR-A5L2-10A-01D-A30A-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b99bd79e-aa33-4896-8d10-2517c793f439	48e26b1d-b84d-432b-940b-9907c81ddf5b	g.chr10:95931233C>G	ENST00000371380.3	+	3	2024	c.1789C>G	c.(1789-1791)Ctg>Gtg	p.L597V	PLCE1_ENST00000371375.1_Missense_Mutation_p.L289V|PLCE1_ENST00000371385.3_Missense_Mutation_p.L289V|PLCE1_ENST00000260766.3_Missense_Mutation_p.L597V			Q9P212	PLCE1_HUMAN	phospholipase C, epsilon 1	597	Ras-GEF. {ECO:0000255|PROSITE- ProRule:PRU00168}.				activation of MAPK activity (GO:0000187)|calcium-mediated signaling (GO:0019722)|cell proliferation (GO:0008283)|cytoskeleton organization (GO:0007010)|diacylglycerol biosynthetic process (GO:0006651)|epidermal growth factor receptor signaling pathway (GO:0007173)|glomerulus development (GO:0032835)|heart development (GO:0007507)|inositol phosphate metabolic process (GO:0043647)|inositol phosphate-mediated signaling (GO:0048016)|lipid catabolic process (GO:0016042)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|phospholipid metabolic process (GO:0006644)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of GTPase activity (GO:0043547)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|Ras protein signal transduction (GO:0007265)|regulation of cell growth (GO:0001558)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|regulation of protein kinase activity (GO:0045859)|regulation of Ras protein signal transduction (GO:0046578)|regulation of smooth muscle contraction (GO:0006940)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|enzyme binding (GO:0019899)|guanyl-nucleotide exchange factor activity (GO:0005085)|phosphatidylinositol phospholipase C activity (GO:0004435)|phospholipase C activity (GO:0004629)|Ras GTPase binding (GO:0017016)|receptor signaling protein activity (GO:0005057)			liver(1)|ovary(2)|skin(4)|upper_aerodigestive_tract(1)	8		Colorectal(252;0.0458)				CCTTGAAGATCTGGTGATGAG	0.473																																					p.L597V		.											.	PLCE1-229	0			c.C1789G						.						104.0	103.0	103.0					10																	95931233		2010	4174	6184	SO:0001583	missense	51196	exon4			GAAGATCTGGTGA		CCDS41552.1, CCDS53555.1	10q23	2010-02-22			ENSG00000138193	ENSG00000138193	3.1.4.11		17175	protein-coding gene	gene with protein product	"""nephrosis type 3"""	608414				11022047, 11022048	Standard	NM_016341		Approved	KIAA1516, PLCE, NPHS3	uc001kjk.3	Q9P212	OTTHUMG00000018789	ENST00000371380.3:c.1789C>G	10.37:g.95931233C>G	ENSP00000360431:p.Leu597Val	Somatic	252	0		WXS	Illumina GAIIx	Phase_I	269	9	NM_016341	0	0	0	0	0	A6NGW0|A6NLA1|A7MBN7|A8K1D7|B9EIJ6|Q1X6H8|Q5VWL4|Q5VWL5|Q9H9X8|Q9HBX6|Q9HC53|Q9UHV3	Missense_Mutation	SNP	ENST00000371380.3	37	CCDS41552.1	.	.	.	.	.	.	.	.	.	.	C	26.0	4.696528	0.88830	.	.	ENSG00000138193	ENST00000260766;ENST00000371380;ENST00000371385;ENST00000371375	T;T;T;T	0.28895	1.59;1.59;1.59;1.59	5.84	5.84	0.93424	Guanine-nucleotide dissociation stimulator CDC25 (4);Ras guanine nucleotide exchange factor, domain (1);	0.079841	0.51477	D	0.000092	T	0.58722	0.2142	M	0.69823	2.125	0.53688	D	0.999971	D;D;D	0.89917	0.999;0.999;1.0	D;D;D	0.91635	0.999;0.997;0.999	T	0.59182	-0.7502	10	0.87932	D	0	.	20.1533	0.98095	0.0:1.0:0.0:0.0	.	597;289;597	B7ZM61;Q9P212-2;Q9P212	.;.;PLCE1_HUMAN	V	597;597;289;289	ENSP00000260766:L597V;ENSP00000360431:L597V;ENSP00000360438:L289V;ENSP00000360426:L289V	ENSP00000260766:L597V	L	+	1	2	PLCE1	95921223	1.000000	0.71417	1.000000	0.80357	0.929000	0.56500	6.840000	0.75369	2.758000	0.94735	0.655000	0.94253	CTG	.		0.473	PLCE1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000049469.3	NM_016341	
CFAP58	159686	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	10	106159171	106159171	+	Missense_Mutation	SNP	A	A	T			TCGA-OR-A5L2-01A-11D-A30A-10	TCGA-OR-A5L2-10A-01D-A30A-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b99bd79e-aa33-4896-8d10-2517c793f439	48e26b1d-b84d-432b-940b-9907c81ddf5b	g.chr10:106159171A>T	ENST00000369704.3	+	12	1862	c.1728A>T	c.(1726-1728)gaA>gaT	p.E576D	snoU13_ENST00000458914.1_RNA	NM_001008723.1	NP_001008723.1	Q5T655	CC147_HUMAN		576						extracellular space (GO:0005615)				NS(1)|breast(1)|central_nervous_system(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(16)|ovary(3)|pancreas(1)|prostate(3)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(2)	52		Colorectal(252;0.103)|Breast(234;0.122)		Epithelial(162;7.55e-10)|all cancers(201;3.37e-08)|BRCA - Breast invasive adenocarcinoma(275;0.0189)		ACTTTATTGAAAAGCAAGAAG	0.458																																					p.E576D		.											.	CCDC147-71	0			c.A1728T						.						69.0	68.0	68.0					10																	106159171		2203	4300	6503	SO:0001583	missense	159686	exon12			TATTGAAAAGCAA																												ENST00000369704.3:c.1728A>T	10.37:g.106159171A>T	ENSP00000358718:p.Glu576Asp	Somatic	101	0		WXS	Illumina GAIIx	Phase_I	89	15	NM_001008723	0	0	0	0	0	D3DRA6|Q8NA27	Missense_Mutation	SNP	ENST00000369704.3	37	CCDS31282.1	.	.	.	.	.	.	.	.	.	.	A	12.12	1.843401	0.32606	.	.	ENSG00000120051	ENST00000369704	T	0.44083	0.93	5.54	1.78	0.24846	.	0.201998	0.52532	N	0.000073	T	0.23249	0.0562	L	0.31207	0.915	0.80722	D	1	B	0.02656	0.0	B	0.08055	0.003	T	0.06935	-1.0799	10	0.25106	T	0.35	-8.7297	2.4815	0.04588	0.6173:0.1277:0.1324:0.1226	.	576	Q5T655	CC147_HUMAN	D	576	ENSP00000358718:E576D	ENSP00000358718:E576D	E	+	3	2	CCDC147	106149161	1.000000	0.71417	0.999000	0.59377	0.984000	0.73092	2.211000	0.42825	0.109000	0.17891	-0.343000	0.07986	GAA	.		0.458	CCDC147-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050216.1		
TCF7L2	6934	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	10	114711350	114711350	+	Nonsense_Mutation	SNP	C	C	A			TCGA-OR-A5L2-01A-11D-A30A-10	TCGA-OR-A5L2-10A-01D-A30A-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b99bd79e-aa33-4896-8d10-2517c793f439	48e26b1d-b84d-432b-940b-9907c81ddf5b	g.chr10:114711350C>A	ENST00000355995.4	+	3	872	c.365C>A	c.(364-366)tCg>tAg	p.S122*	TCF7L2_ENST00000369395.1_Nonsense_Mutation_p.S122*|TCF7L2_ENST00000355717.4_Nonsense_Mutation_p.S122*|TCF7L2_ENST00000369397.4_Nonsense_Mutation_p.S122*|TCF7L2_ENST00000538897.1_Nonsense_Mutation_p.S122*|TCF7L2_ENST00000352065.5_Nonsense_Mutation_p.S122*|TCF7L2_ENST00000545257.1_Nonsense_Mutation_p.S122*|TCF7L2_ENST00000534894.1_Nonsense_Mutation_p.S122*|TCF7L2_ENST00000349937.2_Nonsense_Mutation_p.S122*|RP11-57H14.2_ENST00000369391.3_RNA|TCF7L2_ENST00000536810.1_Nonsense_Mutation_p.S122*|TCF7L2_ENST00000542695.1_5'UTR|TCF7L2_ENST00000543371.1_Nonsense_Mutation_p.S122*			Q9NQB0	TF7L2_HUMAN	transcription factor 7-like 2 (T-cell specific, HMG-box)	122					blood vessel development (GO:0001568)|bone mineralization (GO:0030282)|brain development (GO:0007420)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in positive regulation of epithelial to mesenchymal transition (GO:0044334)|catenin import into nucleus (GO:0035411)|cell cycle arrest (GO:0007050)|cell proliferation (GO:0008283)|cellular response to starvation (GO:0009267)|embryonic digestive tract morphogenesis (GO:0048557)|embryonic genitalia morphogenesis (GO:0030538)|embryonic hindgut morphogenesis (GO:0048619)|face morphogenesis (GO:0060325)|fat cell differentiation (GO:0045444)|generation of neurons (GO:0048699)|glucose homeostasis (GO:0042593)|glucose metabolic process (GO:0006006)|glycogen metabolic process (GO:0005977)|insulin metabolic process (GO:1901142)|maintenance of DNA repeat elements (GO:0043570)|multicellular organism growth (GO:0035264)|myoblast fate commitment (GO:0048625)|negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of fibroblast growth factor receptor signaling pathway (GO:0040037)|negative regulation of organ growth (GO:0046621)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of type B pancreatic cell apoptotic process (GO:2000675)|neural tube development (GO:0021915)|odontogenesis of dentin-containing tooth (GO:0042475)|oligodendrocyte development (GO:0014003)|pancreas development (GO:0031016)|pituitary gland development (GO:0021983)|positive regulation of apoptotic process (GO:0043065)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of gluconeogenesis (GO:0045722)|positive regulation of heparan sulfate proteoglycan biosynthetic process (GO:0010909)|positive regulation of insulin secretion (GO:0032024)|positive regulation of protein binding (GO:0032092)|positive regulation of protein export from nucleus (GO:0046827)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of triglyceride biosynthetic process (GO:0010867)|post-embryonic development (GO:0009791)|regulation of hormone metabolic process (GO:0032350)|regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0061178)|regulation of myelination (GO:0031641)|regulation of oligodendrocyte differentiation (GO:0048713)|regulation of skeletal muscle tissue development (GO:0048641)|regulation of smooth muscle cell proliferation (GO:0048660)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to glucose (GO:0009749)|secretory granule localization (GO:0032252)|skin development (GO:0043588)|somatic stem cell maintenance (GO:0035019)|transcription, DNA-templated (GO:0006351)	beta-catenin-TCF7L2 complex (GO:0070369)|cytoplasm (GO:0005737)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein-DNA complex (GO:0032993)|transcription factor complex (GO:0005667)	armadillo repeat domain binding (GO:0070016)|beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|gamma-catenin binding (GO:0045295)|nuclear hormone receptor binding (GO:0035257)|protein kinase binding (GO:0019901)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II repressing transcription factor binding (GO:0001103)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)		VTI1A/TCF7L2(8)	central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(24)|liver(2)|lung(8)|ovary(1)|skin(1)	41		Breast(234;0.058)|Colorectal(252;0.0615)		Epithelial(162;0.00554)|all cancers(201;0.02)		GGATCGCTCTCGCCCACCGCC	0.741			T	VTI1A	colorectal																																p.S122X		.		Dom	yes		10	10q25.3	6934	transcription factor 7-like 2		E	.	TCF7L2-586	0			c.C365A						.						23.0	22.0	22.0					10																	114711350		2200	4299	6499	SO:0001587	stop_gained	6934	exon3			CGCTCTCGCCCAC	X62871	CCDS7576.1, CCDS53578.1, CCDS55729.1, CCDS73196.1, CCDS73197.1, CCDS73198.1	10q25.3	2006-11-24			ENSG00000148737	ENSG00000148737			11641	protein-coding gene	gene with protein product		602228		TCF4		1741298	Standard	NM_001146283		Approved	TCF-4	uc001lae.4	Q9NQB0	OTTHUMG00000019070	ENST00000355995.4:c.365C>A	10.37:g.114711350C>A	ENSP00000348274:p.Ser122*	Somatic	114	0		WXS	Illumina GAIIx	Phase_I	114	26	NM_001198526	0	0	0	0	0	B4DRJ8|B9X074|C6ZRJ8|C6ZRK0|E2GH14|E2GH19|E2GH20|E2GH24|E2GH25|E9PFH9|F8W742|F8W7T5|O00185|Q9NQB1|Q9NQB2|Q9NQB3|Q9NQB4|Q9NQB5|Q9NQB6|Q9NQB7|Q9ULC2	Nonsense_Mutation	SNP	ENST00000355995.4	37		.	.	.	.	.	.	.	.	.	.	c	38	7.090041	0.98055	.	.	ENSG00000148737	ENST00000355995;ENST00000545257;ENST00000543371;ENST00000536810;ENST00000355717;ENST00000538897;ENST00000534894;ENST00000369397;ENST00000349937;ENST00000352065;ENST00000369395;ENST00000346198	.	.	.	2.6	2.6	0.31112	.	0.203527	0.31834	U	0.006993	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-21.2016	13.7986	0.63186	0.0:1.0:0.0:0.0	.	.	.	.	X	122;122;122;122;122;122;122;122;122;122;122;69	.	ENSP00000345640:S69X	S	+	2	0	TCF7L2	114701340	1.000000	0.71417	1.000000	0.80357	0.000000	0.00434	6.246000	0.72405	1.242000	0.43836	0.000000	0.15137	TCG	.		0.741	TCF7L2-203	KNOWN	basic	protein_coding	protein_coding		NM_030756	
MUC2	4583	bcgsc.ca	37	11	1092926	1092926	+	Missense_Mutation	SNP	C	C	G	rs377100070		TCGA-OR-A5L2-01A-11D-A30A-10	TCGA-OR-A5L2-10A-01D-A30A-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b99bd79e-aa33-4896-8d10-2517c793f439	48e26b1d-b84d-432b-940b-9907c81ddf5b	g.chr11:1092926C>G	ENST00000441003.2	+	30	4772	c.4745C>G	c.(4744-4746)aCa>aGa	p.T1582R	MUC2_ENST00000361558.6_Intron|MUC2_ENST00000359061.5_Missense_Mutation_p.T1583R|MUC2_ENST00000333592.6_5'Flank	NM_002457.2	NP_002448.2	Q02817	MUC2_HUMAN	mucin 2, oligomeric mucus/gel-forming	0	Approximate repeats.				cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi lumen (GO:0005796)|inner mucus layer (GO:0070702)|outer mucus layer (GO:0070703)		p.T1582R(1)|p.T1583R(1)		NS(3)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(26)|haematopoietic_and_lymphoid_tissue(4)|kidney(11)|large_intestine(5)|lung(22)|ovary(2)|prostate(16)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	102		all_cancers(49;1.08e-07)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.191)		BRCA - Breast invasive adenocarcinoma(625;0.000207)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)	Pranlukast(DB01411)	cagaccccaacatcgacaccc	0.632																																					p.T1582R		.											.	MUC2-90	2	Substitution - Missense(2)	prostate(2)	c.C4745G						.	C	ARG/THR	24,3818		0,24,1897	77.0	115.0	102.0		4742	0.5	0.0	11		102	140,6992		0,140,3426	no	missense	MUC2	NM_002457.2	71	0,164,5323	GG,GC,CC		1.963,0.6247,1.4944	benign	1581/2813	1092926	164,10810	1921	3566	5487	SO:0001583	missense	4583	exon30			CCCCAACATCGAC	L21998		11p15.5	2011-01-28	2006-03-14		ENSG00000198788	ENSG00000198788		"""Mucins"""	7512	protein-coding gene	gene with protein product		158370	"""mucin 2, intestinal/tracheal"""			15081123	Standard	NM_002457		Approved		uc001lsx.1	Q02817	OTTHUMG00000156800	ENST00000441003.2:c.4745C>G	11.37:g.1092926C>G	ENSP00000415183:p.Thr1582Arg	Somatic	151	2		WXS	Illumina GAIIx	Phase_I	168	10	NM_002457	0	0	0	0	0	Q14878	Missense_Mutation	SNP	ENST00000441003.2	37		.	.	.	.	.	.	.	.	.	.	C	2.792	-0.251014	0.05867	0.006247	0.01963	ENSG00000198788	ENST00000441003;ENST00000359061	T;T	0.14144	2.53;2.91	1.75	0.53	0.17102	.	18.926900	0.00496	U	0.000153	T	0.05227	0.0139	.	.	.	0.09310	N	1	B	0.16802	0.019	B	0.11329	0.006	T	0.28364	-1.0046	9	0.45353	T	0.12	.	7.5493	0.27786	0.0:0.7315:0.2684:0.0	.	1582	E7EUV1	.	R	1582;1583	ENSP00000415183:T1582R;ENSP00000351956:T1583R	ENSP00000351956:T1583R	T	+	2	0	MUC2	1082926	0.001000	0.12720	0.001000	0.08648	0.035000	0.12851	0.551000	0.23361	1.016000	0.39470	0.121000	0.15741	ACA	.		0.632	MUC2-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000345894.2	NM_002457	
MUC2	4583	broad.mit.edu	37	11	1093413	1093413	+	Silent	SNP	G	G	T			TCGA-OR-A5L2-01A-11D-A30A-10	TCGA-OR-A5L2-10A-01D-A30A-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b99bd79e-aa33-4896-8d10-2517c793f439	48e26b1d-b84d-432b-940b-9907c81ddf5b	g.chr11:1093413G>T	ENST00000441003.2	+	30	5259	c.5232G>T	c.(5230-5232)acG>acT	p.T1744T	MUC2_ENST00000361558.6_Intron|MUC2_ENST00000359061.5_Silent_p.T1711T|MUC2_ENST00000333592.6_Silent_p.T32T	NM_002457.2	NP_002448.2	Q02817	MUC2_HUMAN	mucin 2, oligomeric mucus/gel-forming	0	Approximate repeats.				cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi lumen (GO:0005796)|inner mucus layer (GO:0070702)|outer mucus layer (GO:0070703)				NS(3)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(26)|haematopoietic_and_lymphoid_tissue(4)|kidney(11)|large_intestine(5)|lung(22)|ovary(2)|prostate(16)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	102		all_cancers(49;1.08e-07)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.191)		BRCA - Breast invasive adenocarcinoma(625;0.000207)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)	Pranlukast(DB01411)	ccccaaccacgacacccatca	0.642																																					p.T1744T		.											.	MUC2-90	0			c.G5232T						.																																			SO:0001819	synonymous_variant	4583	exon30			AACCACGACACCC	L21998		11p15.5	2011-01-28	2006-03-14		ENSG00000198788	ENSG00000198788		"""Mucins"""	7512	protein-coding gene	gene with protein product		158370	"""mucin 2, intestinal/tracheal"""			15081123	Standard	NM_002457		Approved		uc001lsx.1	Q02817	OTTHUMG00000156800	ENST00000441003.2:c.5232G>T	11.37:g.1093413G>T		Somatic	122	0		WXS	Illumina GAIIx	Phase_I	160	6	NM_002457	0	0	0	0	0	Q14878	Silent	SNP	ENST00000441003.2	37																																																																																				.		0.642	MUC2-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000345894.2	NM_002457	
MUC5B	727897	bcgsc.ca	37	11	1268449	1268449	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5L2-01A-11D-A30A-10	TCGA-OR-A5L2-10A-01D-A30A-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b99bd79e-aa33-4896-8d10-2517c793f439	48e26b1d-b84d-432b-940b-9907c81ddf5b	g.chr11:1268449G>A	ENST00000529681.1	+	31	10397	c.10339G>A	c.(10339-10341)Gtg>Atg	p.V3447M	MUC5B_ENST00000447027.1_Missense_Mutation_p.V3450M|RP11-532E4.2_ENST00000532061.2_RNA	NM_002458.2	NP_002449.2	Q9HC84	MUC5B_HUMAN	mucin 5B, oligomeric mucus/gel-forming	3447	17 X approximate tandem repeats, Ser/Thr- rich.|7 X Cys-rich subdomain repeats.|Thr-rich.			Missing (in Ref. 6; AAB61398). {ECO:0000305}.	cellular protein metabolic process (GO:0044267)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to glucocorticoid stimulus (GO:0071385)|cellular response to retinoic acid (GO:0071300)|epithelial cell differentiation (GO:0030855)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|response to lipopolysaccharide (GO:0032496)|response to ozone (GO:0010193)|response to sulfur dioxide (GO:0010477)|response to vitamin A (GO:0033189)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)				cervix(2)|endometrium(36)|kidney(9)|lung(89)|urinary_tract(1)	137		all_cancers(49;6.97e-08)|all_epithelial(84;3.45e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00141)|Lung(200;0.0853)|LUSC - Lung squamous cell carcinoma(625;0.1)		CACACCCCCAGTGCCGAACAC	0.692																																					p.V3447M		.											.	.	0			c.G10339A						.						52.0	83.0	72.0					11																	1268449		2107	4216	6323	SO:0001583	missense	727897	exon31			CCCCCAGTGCCGA	U95031, AF086604	CCDS44515.1, CCDS44515.2	11p15.5	2007-01-19	2006-03-14			ENSG00000117983		"""Mucins"""	7516	protein-coding gene	gene with protein product		600770	"""mucin 5, subtype B, tracheobronchial"""	MUC5		9804771	Standard	NM_002458		Approved	MG1	uc001lta.3	Q9HC84		ENST00000529681.1:c.10339G>A	11.37:g.1268449G>A	ENSP00000436812:p.Val3447Met	Somatic	728	2		WXS	Illumina GAIIx	Phase_I	913	82	NM_002458	0	0	0	0	0	O00447|O00573|O14985|O15494|O95291|O95451|Q14881|Q7M4S5|Q99552|Q9UE28	Missense_Mutation	SNP	ENST00000529681.1	37	CCDS44515.2	.	.	.	.	.	.	.	.	.	.	G	4.296	0.054246	0.08291	.	.	ENSG00000117983	ENST00000529681;ENST00000447027;ENST00000349637;ENST00000406844	T;T	0.21734	1.99;2.17	2.65	-0.963	0.10330	.	.	.	.	.	T	0.29288	0.0729	L	0.46157	1.445	0.09310	N	1	D;P	0.57571	0.98;0.79	D;B	0.64237	0.923;0.276	T	0.15093	-1.0449	9	0.87932	D	0	.	3.59	0.07985	0.3616:0.0:0.4617:0.1767	.	3975;3450	A7Y9J9;E9PBJ0	.;.	M	3447;3450;3419;3352	ENSP00000436812:V3447M;ENSP00000415793:V3450M	ENSP00000343037:V3419M	V	+	1	0	MUC5B	1225025	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	0.552000	0.23376	0.038000	0.15604	0.305000	0.20034	GTG	.		0.692	MUC5B-002	NOVEL	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000390041.2	XM_001126093	
KRTAP5-1	387264	hgsc.bcm.edu	37	11	1606121	1606150	+	In_Frame_Del	DEL	CCACAGCCACCCTTGGATCCCCCACAAGAG	CCACAGCCACCCTTGGATCCCCCACAAGAG	-	rs138363822|rs199501537|rs80025267|rs76191756	byFrequency	TCGA-OR-A5L2-01A-11D-A30A-10	TCGA-OR-A5L2-10A-01D-A30A-10	CCACAGCCACCCTTGGATCCCCCACAAGAG	CCACAGCCACCCTTGGATCCCCCACAAGAG	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b99bd79e-aa33-4896-8d10-2517c793f439	48e26b1d-b84d-432b-940b-9907c81ddf5b	g.chr11:1606121_1606150delCCACAGCCACCCTTGGATCCCCCACAAGAG	ENST00000382171.2	-	1	363_392	c.330_359delCTCTTGTGGGGGATCCAAGGGTGGCTGTGG	c.(328-360)ggctcttgtgggggatccaagggtggctgtggt>ggt	p.110_120GSCGGSKGGCG>G	KRTAP5-AS1_ENST00000424148.1_RNA|KRTAP5-AS1_ENST00000534077.1_RNA|KRTAP5-AS1_ENST00000524947.1_RNA|KRTAP5-AS1_ENST00000532922.1_RNA	NM_001005922.1	NP_001005922.1	Q6L8H4	KRA51_HUMAN	keratin associated protein 5-1	110	8 X 4 AA repeats of C-C-X-P.					keratin filament (GO:0045095)				endometrium(3)|kidney(1)|lung(9)|skin(2)|upper_aerodigestive_tract(1)	16		all_epithelial(84;0.00018)|Ovarian(85;0.0014)|Breast(177;0.00147)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.000614)|Lung(200;0.0681)|LUSC - Lung squamous cell carcinoma(625;0.082)		ACAGCCGGAACCACAGCCACCCTTGGATCCCCCACAAGAGCCACAGCCCC	0.661																																					p.110_120del		.											.	KRTAP5-1-44	0			c.330_359del						.			2171,2035		609,953,541						-5.2	0.0			71	4129,4059		1127,1875,1092	no	coding	KRTAP5-1	NM_001005922.1		1736,2828,1633	A1A1,A1R,RR		49.5725,48.3833,49.169				6300,6094				SO:0001651	inframe_deletion	387264	exon1			CCGGAACCACAGC	AB126070	CCDS31330.1	11p15.5	2008-02-05			ENSG00000205869	ENSG00000205869		"""Keratin associated proteins"""	23596	protein-coding gene	gene with protein product		148022	"""keratin, cuticle, ultrahigh sulphur 1-like"""	KRN1L		15144888	Standard	NM_001005922		Approved	KRTAP5.1	uc001ltu.1	Q6L8H4	OTTHUMG00000057557	ENST00000382171.2:c.330_359delCTCTTGTGGGGGATCCAAGGGTGGCTGTGG	11.37:g.1606121_1606150delCCACAGCCACCCTTGGATCCCCCACAAGAG	ENSP00000371606:p.Gly110_Cys119del	Somatic	101	0		WXS	Illumina GAIIx	Phase_I	122	0	NM_001005922	0	0	0	0	0		In_Frame_Del	DEL	ENST00000382171.2	37	CCDS31330.1																																																																																			.		0.661	KRTAP5-1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000127922.1	NM_001005922	
TH	7054	hgsc.bcm.edu;broad.mit.edu	37	11	2189798	2189798	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5L2-01A-11D-A30A-10	TCGA-OR-A5L2-10A-01D-A30A-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b99bd79e-aa33-4896-8d10-2517c793f439	48e26b1d-b84d-432b-940b-9907c81ddf5b	g.chr11:2189798C>T	ENST00000381178.1	-	4	521	c.503G>A	c.(502-504)cGc>cAc	p.R168H	TH_ENST00000381175.1_Missense_Mutation_p.R164H|TH_ENST00000352909.3_Missense_Mutation_p.R137H|TH_ENST00000333684.5_Missense_Mutation_p.R141H	NM_199292.2	NP_954986.2	P07101	TY3H_HUMAN	tyrosine hydroxylase	168					anatomical structure morphogenesis (GO:0009653)|catecholamine biosynthetic process (GO:0042423)|cellular nitrogen compound metabolic process (GO:0034641)|cellular response to drug (GO:0035690)|cellular response to glucose stimulus (GO:0071333)|cellular response to growth factor stimulus (GO:0071363)|cellular response to manganese ion (GO:0071287)|cellular response to nicotine (GO:0071316)|cerebral cortex development (GO:0021987)|circadian sleep/wake cycle (GO:0042745)|dopamine biosynthetic process (GO:0042416)|dopamine biosynthetic process from tyrosine (GO:0006585)|eating behavior (GO:0042755)|embryonic camera-type eye morphogenesis (GO:0048596)|epinephrine biosynthetic process (GO:0042418)|eye photoreceptor cell development (GO:0042462)|fatty acid metabolic process (GO:0006631)|glycoside metabolic process (GO:0016137)|heart development (GO:0007507)|heart morphogenesis (GO:0003007)|isoquinoline alkaloid metabolic process (GO:0033076)|learning (GO:0007612)|locomotory behavior (GO:0007626)|mating behavior (GO:0007617)|memory (GO:0007613)|multicellular organismal aging (GO:0010259)|neurotransmitter biosynthetic process (GO:0042136)|norepinephrine biosynthetic process (GO:0042421)|organ morphogenesis (GO:0009887)|phthalate metabolic process (GO:0018963)|phytoalexin metabolic process (GO:0052314)|pigmentation (GO:0043473)|regulation of heart contraction (GO:0008016)|response to activity (GO:0014823)|response to amphetamine (GO:0001975)|response to corticosterone (GO:0051412)|response to electrical stimulus (GO:0051602)|response to estradiol (GO:0032355)|response to ethanol (GO:0045471)|response to ether (GO:0045472)|response to herbicide (GO:0009635)|response to hypoxia (GO:0001666)|response to light stimulus (GO:0009416)|response to lipopolysaccharide (GO:0032496)|response to nutrient levels (GO:0031667)|response to peptide hormone (GO:0043434)|response to pyrethroid (GO:0046684)|response to salt stress (GO:0009651)|response to water deprivation (GO:0009414)|response to zinc ion (GO:0010043)|sensory perception of sound (GO:0007605)|small molecule metabolic process (GO:0044281)|social behavior (GO:0035176)|sphingolipid metabolic process (GO:0006665)|synaptic transmission, dopaminergic (GO:0001963)|synaptic vesicle amine transport (GO:0015842)|terpene metabolic process (GO:0042214)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|dendrite (GO:0030425)|melanosome membrane (GO:0033162)|mitochondrion (GO:0005739)|neuron projection (GO:0043005)|nucleus (GO:0005634)|perikaryon (GO:0043204)|smooth endoplasmic reticulum (GO:0005790)|synaptic vesicle (GO:0008021)|terminal bouton (GO:0043195)	amino acid binding (GO:0016597)|dopamine binding (GO:0035240)|enzyme binding (GO:0019899)|ferric iron binding (GO:0008199)|ferrous iron binding (GO:0008198)|oxygen binding (GO:0019825)|tetrahydrobiopterin binding (GO:0034617)|tyrosine 3-monooxygenase activity (GO:0004511)			NS(1)|endometrium(1)|large_intestine(1)|lung(7)|skin(1)	11		all_epithelial(84;1.46e-23)|Lung NSC(207;4.44e-11)|all_lung(207;1.11e-09)|Ovarian(85;1.78e-06)|Breast(177;1.78e-05)|Medulloblastoma(188;0.0208)|all_neural(188;0.0416)	Colorectal(5;0.00245)|COAD - Colon adenocarcinoma(6;0.0239)	BRCA - Breast invasive adenocarcinoma(625;8.45e-09)|Lung(200;0.000152)|LUSC - Lung squamous cell carcinoma(625;0.00154)	L-Phenylalanine(DB00120)|L-Tyrosine(DB00135)|Metyrosine(DB00765)|Tetrahydrobiopterin(DB00360)	GTCCCCTCGGCGCACCTCGAG	0.677																																					p.R168H		.											.	TH-90	0			c.G503A						.						13.0	16.0	15.0					11																	2189798		2189	4284	6473	SO:0001583	missense	7054	exon4			CCTCGGCGCACCT	X05290	CCDS7730.1, CCDS7731.1, CCDS31338.1	11p15.5	2013-06-03			ENSG00000180176	ENSG00000180176	1.14.16.2		11782	protein-coding gene	gene with protein product	"""tyrosine 3-monooxygenase"""	191290					Standard	NM_199292		Approved	DYT5b	uc001lvq.3	P07101	OTTHUMG00000009559	ENST00000381178.1:c.503G>A	11.37:g.2189798C>T	ENSP00000370571:p.Arg168His	Somatic	22	0		WXS	Illumina GAIIx	Phase_I	95	12	NM_199292	0	0	0	0	0	B7ZL70|B7ZL73|Q0PWM2|Q0PWM3|Q15585|Q15588|Q15589|Q2M3B4	Missense_Mutation	SNP	ENST00000381178.1	37	CCDS7731.1	.	.	.	.	.	.	.	.	.	.	C	5.981	0.364877	0.11296	.	.	ENSG00000180176	ENST00000381178;ENST00000381175;ENST00000352909;ENST00000333684	D;D;D;D	0.98090	-4.71;-4.71;-4.71;-4.71	3.31	1.16	0.20824	.	0.112865	0.64402	U	0.000014	D	0.88789	0.6532	N	0.02225	-0.63	0.21473	N	0.999672	B;B;B;B;B;B	0.02656	0.0;0.0;0.0;0.0;0.0;0.0	B;B;B;B;B;B	0.01281	0.0;0.0;0.0;0.0;0.0;0.0	T	0.81486	-0.0911	10	0.19590	T	0.45	.	6.5202	0.22271	0.0:0.2732:0.4513:0.2755	.	141;141;137;137;168;164	B7ZL73;Q0PWM2;Q0PWM3;P07101-3;P07101;P07101-2	.;.;.;.;TY3H_HUMAN;.	H	168;164;137;141	ENSP00000370571:R168H;ENSP00000370567:R164H;ENSP00000325951:R137H;ENSP00000328814:R141H	ENSP00000328814:R141H	R	-	2	0	TH	2146374	1.000000	0.71417	0.852000	0.33557	0.010000	0.07245	1.953000	0.40352	0.502000	0.28037	-0.339000	0.08088	CGC	.		0.677	TH-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000026597.1	NM_000360	
OR51E2	81285	broad.mit.edu	37	11	4703475	4703475	+	Frame_Shift_Del	DEL	A	A	-			TCGA-OR-A5L2-01A-11D-A30A-10	TCGA-OR-A5L2-10A-01D-A30A-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b99bd79e-aa33-4896-8d10-2517c793f439	48e26b1d-b84d-432b-940b-9907c81ddf5b	g.chr11:4703475delA	ENST00000396950.3	-	2	706	c.467delT	c.(466-468)ttcfs	p.F156fs		NM_030774.3	NP_110401.1	Q9H255	O51E2_HUMAN	olfactory receptor, family 51, subfamily E, member 2	156					cellular response to fatty acid (GO:0071398)|detection of chemical stimulus involved in sensory perception of smell (GO:0050911)|positive regulation of blood pressure (GO:0045777)|positive regulation of renin secretion into blood stream (GO:1900135)|steroid hormone mediated signaling pathway (GO:0043401)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)|signaling receptor activity (GO:0038023)|steroid hormone receptor activity (GO:0003707)			NS(1)|central_nervous_system(1)|endometrium(1)|large_intestine(2)|lung(12)|ovary(2)|prostate(1)|skin(3)	23		Medulloblastoma(188;0.0075)|Breast(177;0.0461)|all_neural(188;0.0577)		Epithelial(150;3e-12)|BRCA - Breast invasive adenocarcinoma(625;0.00476)|LUSC - Lung squamous cell carcinoma(625;0.2)		AGGCAGTGGGAAAAAAAAGAG	0.552																																					p.F156fs		.											.	OR51E2-502	0			c.467delT						.						65.0	62.0	63.0					11																	4703475		2201	4298	6499	SO:0001589	frameshift_variant	81285	exon2			AGTGGGAAAAAAA	AY033942	CCDS7751.1	11p15	2012-08-09			ENSG00000167332	ENSG00000167332		"""GPCR / Class A : Olfactory receptors"""	15195	protein-coding gene	gene with protein product		611268				11118034	Standard	NM_030774		Approved	PSGR	uc001lzk.2	Q9H255	OTTHUMG00000133362	ENST00000396950.3:c.467delT	11.37:g.4703475delA	ENSP00000380153:p.Phe156fs	Somatic	106	0		WXS	Illumina GAIIx	Phase_I	105	9	NM_030774	0	0	0	0	0	B2RA63|Q6IF94	Frame_Shift_Del	DEL	ENST00000396950.3	37	CCDS7751.1																																																																																			.		0.552	OR51E2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257198.1	NM_030774	
OR56A3	390083	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	5969056	5969056	+	Silent	SNP	T	T	C			TCGA-OR-A5L2-01A-11D-A30A-10	TCGA-OR-A5L2-10A-01D-A30A-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b99bd79e-aa33-4896-8d10-2517c793f439	48e26b1d-b84d-432b-940b-9907c81ddf5b	g.chr11:5969056T>C	ENST00000329564.6	+	1	487	c.480T>C	c.(478-480)acT>acC	p.T160T	AC025016.1_ENST00000528915.1_lincRNA	NM_001003443.2	NP_001003443.2	Q8NH54	O56A3_HUMAN	olfactory receptor, family 56, subfamily A, member 3	160						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.T160T(1)		endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(27)|stomach(1)|upper_aerodigestive_tract(1)	41		Medulloblastoma(188;0.00776)|all_neural(188;0.0652)|Breast(177;0.114)		Epithelial(150;9.41e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		TGCTTATGACTCTGCCCATCC	0.448																																					p.T160T		.											.	OR56A3-68	1	Substitution - coding silent(1)	lung(1)	c.T480C						.						126.0	127.0	127.0					11																	5969056		2189	4295	6484	SO:0001819	synonymous_variant	390083	exon1			TATGACTCTGCCC		CCDS41614.1	11p15.4	2012-08-09		2004-03-10	ENSG00000184478	ENSG00000184478		"""GPCR / Class A : Olfactory receptors"""	14786	protein-coding gene	gene with protein product				OR56A6, OR56A3P			Standard	NM_001003443		Approved		uc010qzt.2	Q8NH54	OTTHUMG00000165373	ENST00000329564.6:c.480T>C	11.37:g.5969056T>C		Somatic	151	0		WXS	Illumina GAIIx	Phase_I	165	42	NM_001003443	0	0	0	0	0	A6NN77|Q6IFF7	Silent	SNP	ENST00000329564.6	37	CCDS41614.1																																																																																			.		0.448	OR56A3-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383753.1	NM_001003443	
CTR9	9646	broad.mit.edu;bcgsc.ca;mdanderson.org	37	11	10796822	10796822	+	Missense_Mutation	SNP	G	G	A	rs372648972		TCGA-OR-A5L2-01A-11D-A30A-10	TCGA-OR-A5L2-10A-01D-A30A-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b99bd79e-aa33-4896-8d10-2517c793f439	48e26b1d-b84d-432b-940b-9907c81ddf5b	g.chr11:10796822G>A	ENST00000361367.2	+	23	3380	c.2954G>A	c.(2953-2955)cGt>cAt	p.R985H		NM_014633.3	NP_055448.1	Q6PD62	CTR9_HUMAN	CTR9, Paf1/RNA polymerase II complex component	985	Lys-rich.				cellular response to lipopolysaccharide (GO:0071222)|endodermal cell fate commitment (GO:0001711)|histone H2B ubiquitination (GO:0033523)|histone H3-K4 trimethylation (GO:0080182)|histone monoubiquitination (GO:0010390)|interleukin-6-mediated signaling pathway (GO:0070102)|JAK-STAT cascade (GO:0007259)|negative regulation of myeloid cell differentiation (GO:0045638)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of histone H3-K4 methylation (GO:0051571)|positive regulation of histone H3-K79 methylation (GO:2001162)|positive regulation of transcription elongation from RNA polymerase II promoter (GO:0032968)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|stem cell maintenance (GO:0019827)|transcription, DNA-templated (GO:0006351)|Wnt signaling pathway (GO:0016055)	Cdc73/Paf1 complex (GO:0016593)|transcriptionally active chromatin (GO:0035327)				breast(4)|central_nervous_system(2)|cervix(1)|endometrium(7)|kidney(3)|large_intestine(7)|lung(12)|ovary(2)|pancreas(1)|stomach(1)	40				all cancers(16;1.64e-07)|Epithelial(150;2.47e-07)|BRCA - Breast invasive adenocarcinoma(625;0.111)		AAAAAACGACGTCCACCAAAA	0.388																																					p.R985H		.											.	CTR9-92	0			c.G2954A						.		HIS/ARG	0,4402		0,0,2201	112.0	105.0	107.0		2954	5.6	1.0	11		107	1,8587	1.2+/-3.3	0,1,4293	no	missense	CTR9	NM_014633.3	29	0,1,6494	AA,AG,GG		0.0116,0.0,0.0077	possibly-damaging	985/1174	10796822	1,12989	2201	4294	6495	SO:0001583	missense	9646	exon23			AACGACGTCCACC	D63875	CCDS7805.1	11p15.3	2013-07-03	2013-07-03	2006-05-22	ENSG00000198730	ENSG00000198730		"""Tetratricopeptide (TTC) repeat domain containing"""	16850	protein-coding gene	gene with protein product		609366	"""SH2 domain binding protein 1 (tetratricopeptide repeat containing)"", ""Ctr9, Paf1/RNA polymerase II complex component, homolog (S. cerevisiae)"""	SH2BP1		8590280, 8636124	Standard	NM_014633		Approved	KIAA0155, TSBP, p150TSP	uc001mja.3	Q6PD62	OTTHUMG00000165789	ENST00000361367.2:c.2954G>A	11.37:g.10796822G>A	ENSP00000355013:p.Arg985His	Somatic	77	2		WXS	Illumina GAIIx	Phase_I	80	15	NM_014633	0	0	0	0	0	D3DQV8|Q15015	Missense_Mutation	SNP	ENST00000361367.2	37	CCDS7805.1	.	.	.	.	.	.	.	.	.	.	G	15.92	2.974069	0.53720	0.0	1.16E-4	ENSG00000198730	ENST00000361367	T	0.51574	0.7	5.55	5.55	0.83447	.	0.000000	0.85682	D	0.000000	T	0.26159	0.0638	N	0.14661	0.345	0.58432	D	0.999994	P	0.42337	0.776	B	0.28465	0.09	T	0.15694	-1.0428	10	0.51188	T	0.08	-12.2969	12.808	0.57624	0.0747:0.0:0.9253:0.0	.	985	Q6PD62	CTR9_HUMAN	H	985	ENSP00000355013:R985H	ENSP00000355013:R985H	R	+	2	0	CTR9	10753398	1.000000	0.71417	0.974000	0.42286	0.033000	0.12548	5.964000	0.70379	2.605000	0.88082	0.563000	0.77884	CGT	.		0.388	CTR9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000386215.1	NM_014633	
OR4C16	219428	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	11	55339779	55339779	+	Missense_Mutation	SNP	T	T	A			TCGA-OR-A5L2-01A-11D-A30A-10	TCGA-OR-A5L2-10A-01D-A30A-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b99bd79e-aa33-4896-8d10-2517c793f439	48e26b1d-b84d-432b-940b-9907c81ddf5b	g.chr11:55339779T>A	ENST00000314634.3	+	1	176	c.176T>A	c.(175-177)tTc>tAc	p.F59Y		NM_001004701.2	NP_001004701.2	Q8NGL9	OR4CG_HUMAN	olfactory receptor, family 4, subfamily C, member 16 (gene/pseudogene)	59						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(3)|large_intestine(1)|lung(28)|ovary(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	41		all_epithelial(135;0.0748)				CCAATGTTCTTCTTCCTTTTC	0.388																																					p.F59Y		.											.	OR4C16-70	0			c.T176A						.						280.0	254.0	263.0					11																	55339779		2201	4296	6497	SO:0001583	missense	219428	exon1			TGTTCTTCTTCCT	AB065773	CCDS31502.1	11q11	2013-10-10	2013-10-10		ENSG00000181935	ENSG00000181935		"""GPCR / Class A : Olfactory receptors"""	15172	protein-coding gene	gene with protein product			"""olfactory receptor, family 4, subfamily C, member 16"""				Standard	NM_001004701		Approved		uc010rih.2	Q8NGL9	OTTHUMG00000165198	ENST00000314634.3:c.176T>A	11.37:g.55339779T>A	ENSP00000324913:p.Phe59Tyr	Somatic	159	0		WXS	Illumina GAIIx	Phase_I	217	12	NM_001004701	0	0	0	0	0	Q6IEV8	Missense_Mutation	SNP	ENST00000314634.3	37	CCDS31502.1	.	.	.	.	.	.	.	.	.	.	T	11.02	1.517091	0.27123	.	.	ENSG00000181935	ENST00000314634	T	0.01092	5.35	4.98	2.49	0.30216	GPCR, rhodopsin-like superfamily (1);	0.000000	0.64402	D	0.000002	T	0.01800	0.0057	M	0.77103	2.36	0.23981	N	0.996274	B	0.20459	0.045	B	0.21151	0.033	T	0.39683	-0.9602	10	0.51188	T	0.08	.	3.9017	0.09164	0.3287:0.0892:0.0:0.5821	.	59	Q8NGL9	OR4CG_HUMAN	Y	59	ENSP00000324913:F59Y	ENSP00000324913:F59Y	F	+	2	0	OR4C16	55096355	0.238000	0.23825	0.998000	0.56505	0.339000	0.28857	2.294000	0.43567	0.903000	0.36546	0.448000	0.29417	TTC	.		0.388	OR4C16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382627.1	NM_001004701	
OR4C6	219432	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	55432669	55432669	+	Missense_Mutation	SNP	A	A	C			TCGA-OR-A5L2-01A-11D-A30A-10	TCGA-OR-A5L2-10A-01D-A30A-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b99bd79e-aa33-4896-8d10-2517c793f439	48e26b1d-b84d-432b-940b-9907c81ddf5b	g.chr11:55432669A>C	ENST00000314259.3	+	1	56	c.27A>C	c.(25-27)gaA>gaC	p.E9D		NM_001004704.1	NP_001004704.1	Q8NH72	OR4C6_HUMAN	olfactory receptor, family 4, subfamily C, member 6	9						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(2)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(4)|lung(49)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	71						ATGTGACTGAATTCATTCTTC	0.368																																					p.E9D		.											.	OR4C6-70	0			c.A27C						.						111.0	105.0	107.0					11																	55432669		2200	4296	6496	SO:0001583	missense	219432	exon1			GACTGAATTCATT	CR593785	CCDS31506.1	11q11	2012-08-09			ENSG00000181903	ENSG00000181903		"""GPCR / Class A : Olfactory receptors"""	14743	protein-coding gene	gene with protein product							Standard	NM_001004704		Approved		uc010rik.2	Q8NH72	OTTHUMG00000166800	ENST00000314259.3:c.27A>C	11.37:g.55432669A>C	ENSP00000324769:p.Glu9Asp	Somatic	28	0		WXS	Illumina GAIIx	Phase_I	33	7	NM_001004704	0	0	0	0	0	B2RP11|Q6IFD2	Missense_Mutation	SNP	ENST00000314259.3	37	CCDS31506.1	.	.	.	.	.	.	.	.	.	.	A	8.253	0.809440	0.16537	.	.	ENSG00000181903	ENST00000314259	T	0.00566	6.55	3.83	-0.887	0.10587	.	0.589948	0.14075	N	0.343150	T	0.00637	0.0021	M	0.73319	2.225	0.22127	N	0.999347	B	0.20164	0.042	B	0.26614	0.071	T	0.44544	-0.9321	10	0.62326	D	0.03	.	2.9909	0.05982	0.5389:0.0:0.281:0.1802	.	9	Q8NH72	OR4C6_HUMAN	D	9	ENSP00000324769:E9D	ENSP00000324769:E9D	E	+	3	2	OR4C6	55189245	0.000000	0.05858	0.978000	0.43139	0.074000	0.17049	-2.016000	0.01446	-0.545000	0.06224	-0.565000	0.04167	GAA	.		0.368	OR4C6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391504.1	NM_001004704	
OR5L2	26338	broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	55595126	55595126	+	Silent	SNP	G	G	A			TCGA-OR-A5L2-01A-11D-A30A-10	TCGA-OR-A5L2-10A-01D-A30A-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b99bd79e-aa33-4896-8d10-2517c793f439	48e26b1d-b84d-432b-940b-9907c81ddf5b	g.chr11:55595126G>A	ENST00000378397.1	+	1	432	c.432G>A	c.(430-432)ctG>ctA	p.L144L		NM_001004739.1	NP_001004739.1	Q8NGL0	OR5L2_HUMAN	olfactory receptor, family 5, subfamily L, member 2	144						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(2)|kidney(1)|large_intestine(1)|lung(42)|ovary(1)|prostate(3)|skin(1)|stomach(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	59		all_epithelial(135;0.208)				GTGTGGAGCTGACCTCTTGCT	0.507										HNSCC(27;0.073)																											p.L144L		.											.	OR5L2-69	0			c.G432A						.						217.0	185.0	196.0					11																	55595126		2200	4296	6496	SO:0001819	synonymous_variant	26338	exon1			GGAGCTGACCTCT	AB065782	CCDS31511.1	11q11	2012-08-09			ENSG00000205030	ENSG00000205030		"""GPCR / Class A : Olfactory receptors"""	8351	protein-coding gene	gene with protein product						1370859	Standard	NM_001004739		Approved	HTPCRX16, HSHTPCRX16	uc001nhy.1	Q8NGL0	OTTHUMG00000166812	ENST00000378397.1:c.432G>A	11.37:g.55595126G>A		Somatic	226	1		WXS	Illumina GAIIx	Phase_I	238	51	NM_001004739	0	0	0	0	0	Q6IF66|Q96RB2	Silent	SNP	ENST00000378397.1	37	CCDS31511.1																																																																																			.		0.507	OR5L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391516.1	NM_001004739	
NRXN2	9379	hgsc.bcm.edu	37	11	64480641	64480641	+	Silent	SNP	G	G	A	rs2518907	byFrequency	TCGA-OR-A5L2-01A-11D-A30A-10	TCGA-OR-A5L2-10A-01D-A30A-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b99bd79e-aa33-4896-8d10-2517c793f439	48e26b1d-b84d-432b-940b-9907c81ddf5b	g.chr11:64480641G>A	ENST00000377551.1	-	1	742	c.531C>T	c.(529-531)ggC>ggT	p.G177G	NRXN2_ENST00000265459.6_Silent_p.G177G|NRXN2_ENST00000409571.1_Silent_p.G177G|NRXN2_ENST00000377559.3_Silent_p.G177G			Q9P2S2	NRX2A_HUMAN	neurexin 2	177	Laminin G-like 1. {ECO:0000255|PROSITE- ProRule:PRU00122}.				adult behavior (GO:0030534)|gephyrin clustering (GO:0097116)|neuroligin clustering (GO:0097118)|neuron cell-cell adhesion (GO:0007158)|neurotransmitter secretion (GO:0007269)|postsynaptic density protein 95 clustering (GO:0097119)|postsynaptic membrane assembly (GO:0097104)|social behavior (GO:0035176)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)|vocal learning (GO:0042297)|vocalization behavior (GO:0071625)	integral component of membrane (GO:0016021)	calcium channel regulator activity (GO:0005246)|cell adhesion molecule binding (GO:0050839)|metal ion binding (GO:0046872)|neuroligin family protein binding (GO:0097109)			breast(2)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(6)|liver(1)|lung(34)|ovary(6)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(6)|urinary_tract(1)	71						TGGCCAAGAGGCCGCGGAAGG	0.756													G|||	2672	0.533546	0.2216	0.5403	5008	,	,		8112	0.5407		0.7604	False		,,,				2504	0.7096				p.G177G		.											.	NRXN2-232	0			c.C531T						.	G	,	1316,1684		331,654,515	2.0	2.0	2.0		531,531	1.3	1.0	11	dbSNP_100	2	4949,1205		2080,789,208	no	coding-synonymous,coding-synonymous	NRXN2	NM_015080.3,NM_138732.2	,	2411,1443,723	AA,AG,GG		19.5808,43.8667,31.56	,	177/1713,177/1643	64480641	6265,2889	1500	3077	4577	SO:0001819	synonymous_variant	9379	exon2			CAAGAGGCCGCGG		CCDS8077.1, CCDS31597.1, CCDS8078.1	11q13	2008-07-18			ENSG00000110076	ENSG00000110076			8009	protein-coding gene	gene with protein product	"""neurexin II"""	600566				1621094	Standard	NM_015080		Approved		uc021qkw.1	P58401	OTTHUMG00000045214	ENST00000377551.1:c.531C>T	11.37:g.64480641G>A		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	4	4	NM_138732	0	0	0	0	0	A7E2C1|Q9Y2D6	Silent	SNP	ENST00000377551.1	37	CCDS8077.1																																																																																			G|0.449;A|0.551		0.756	NRXN2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000104967.3	NM_015080	
TM7SF2	7108	hgsc.bcm.edu	37	11	64880090	64880090	+	Silent	SNP	G	G	C	rs4930284	byFrequency	TCGA-OR-A5L2-01A-11D-A30A-10	TCGA-OR-A5L2-10A-01D-A30A-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b99bd79e-aa33-4896-8d10-2517c793f439	48e26b1d-b84d-432b-940b-9907c81ddf5b	g.chr11:64880090G>C	ENST00000279263.7	+	2	318	c.156G>C	c.(154-156)ccG>ccC	p.P52P	AP003068.9_ENST00000528887.1_RNA|TM7SF2_ENST00000345348.5_Silent_p.P52P|TM7SF2_ENST00000540748.1_5'UTR	NM_003273.2	NP_003264.2	O76062	ERG24_HUMAN	transmembrane 7 superfamily member 2	52					cholesterol biosynthetic process (GO:0006695)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of plasma membrane (GO:0005887)|receptor complex (GO:0043235)	delta14-sterol reductase activity (GO:0050613)			lung(14)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	18						CGTCCCTGCCGGGGCTGGAGG	0.756													C|||	4990	0.996406	0.9879	0.9986	5008	,	,		10438	1.0		0.999	False		,,,				2504	1.0				p.P52P		.											.	TM7SF2-91	0			c.G156C						.	C		2924,8		1458,8,0	2.0	2.0	2.0		156	-9.8	0.0	11	dbSNP_111	2	6426,0		3213,0,0	no	coding-synonymous	TM7SF2	NM_003273.2		4671,8,0	CC,CG,GG		0.0,0.2729,0.0855		52/419	64880090	9350,8	1466	3213	4679	SO:0001819	synonymous_variant	7108	exon2			CCTGCCGGGGCTG	BC012857	CCDS41669.1, CCDS60846.1	11q13.1	2013-05-23			ENSG00000149809	ENSG00000149809	1.3.1.70		11863	protein-coding gene	gene with protein product	"""delta(14)-sterol reductase"""	603414				9615229, 9286704	Standard	NM_003273		Approved	ANG1, DHCR14A, NET47	uc001oct.4	O76062	OTTHUMG00000165603	ENST00000279263.7:c.156G>C	11.37:g.64880090G>C		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	10	10	NM_003273	0	0	0	0	0	A8K4H0|O95982|Q8IY06|Q96E64|Q96GZ1	Silent	SNP	ENST00000279263.7	37	CCDS41669.1																																																																																			G|0.005;C|0.995		0.756	TM7SF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385234.1	NM_003273	
GAL3ST3	89792	hgsc.bcm.edu	37	11	65810209	65810209	+	Silent	SNP	C	C	T	rs61895584	byFrequency	TCGA-OR-A5L2-01A-11D-A30A-10	TCGA-OR-A5L2-10A-01D-A30A-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b99bd79e-aa33-4896-8d10-2517c793f439	48e26b1d-b84d-432b-940b-9907c81ddf5b	g.chr11:65810209C>T	ENST00000312006.4	-	3	1346	c.1065G>A	c.(1063-1065)ccG>ccA	p.P355P	GAL3ST3_ENST00000527878.1_Silent_p.P355P	NM_033036.2	NP_149025.1	Q96A11	G3ST3_HUMAN	galactose-3-O-sulfotransferase 3	355					monosaccharide metabolic process (GO:0005996)|oligosaccharide metabolic process (GO:0009311)|poly-N-acetyllactosamine metabolic process (GO:0030309)|proteoglycan biosynthetic process (GO:0030166)|sulfur compound metabolic process (GO:0006790)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	3'-phosphoadenosine 5'-phosphosulfate binding (GO:0050656)|carbohydrate binding (GO:0030246)|galactose 3-O-sulfotransferase activity (GO:0050694)|galactosylceramide sulfotransferase activity (GO:0001733)|proteoglycan sulfotransferase activity (GO:0050698)			kidney(1)|lung(9)|ovary(2)|skin(2)	14						TGGGCTGCCACGGCTGCAGCT	0.741													C|||	3763	0.751398	0.5408	0.8746	5008	,	,		7225	0.7649		0.8549	False		,,,				2504	0.8282				p.P355P		.											.	GAL3ST3-91	0			c.G1065A						.	C		1752,666		619,514,76	3.0	2.0	2.0		1065	-9.2	0.7	11	dbSNP_129	2	4565,363		2119,327,18	no	coding-synonymous	GAL3ST3	NM_033036.2		2738,841,94	TT,TC,CC		7.3661,27.5434,14.0076		355/432	65810209	6317,1029	1209	2464	3673	SO:0001819	synonymous_variant	89792	exon3			CTGCCACGGCTGC	AY026481	CCDS8128.1	11q13.1	2014-08-12			ENSG00000175229	ENSG00000175229		"""Sulfotransferases, membrane-bound"""	24144	protein-coding gene	gene with protein product		608234				11323440, 11356829	Standard	NM_033036		Approved	GAL3ST2	uc001ogw.3	Q96A11	OTTHUMG00000166667	ENST00000312006.4:c.1065G>A	11.37:g.65810209C>T		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	19	15	NM_033036	0	0	0	0	0	Q14D05	Silent	SNP	ENST00000312006.4	37	CCDS8128.1																																																																																			C|0.233;T|0.767		0.741	GAL3ST3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391052.1	NM_033036	
TMEM151A	256472	hgsc.bcm.edu	37	11	66062588	66062588	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5L2-01A-11D-A30A-10	TCGA-OR-A5L2-10A-01D-A30A-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b99bd79e-aa33-4896-8d10-2517c793f439	48e26b1d-b84d-432b-940b-9907c81ddf5b	g.chr11:66062588G>A	ENST00000327259.4	+	2	1015	c.871G>A	c.(871-873)Gtg>Atg	p.V291M		NM_153266.3	NP_694998.1	Q8N4L1	T151A_HUMAN	transmembrane protein 151A	291						integral component of membrane (GO:0016021)				central_nervous_system(1)|kidney(4)|lung(6)	11						CTTCTGGCTCGTGTCGGCGGC	0.697																																					p.V291M		.											.	TMEM151A-90	0			c.G871A						.						7.0	7.0	7.0					11																	66062588		2016	3973	5989	SO:0001583	missense	256472	exon2			TGGCTCGTGTCGG	BC033898	CCDS8133.1	11q13.2	2007-10-25	2007-10-25	2007-10-25	ENSG00000179292	ENSG00000179292			28497	protein-coding gene	gene with protein product			"""transmembrane protein 151"""	TMEM151		12477932	Standard	NM_153266		Approved	MGC33486	uc001ohl.3	Q8N4L1	OTTHUMG00000166920	ENST00000327259.4:c.871G>A	11.37:g.66062588G>A	ENSP00000326244:p.Val291Met	Somatic	7	0		WXS	Illumina GAIIx	Phase_I	65	32	NM_153266	0	0	0	0	0	Q8ND14	Missense_Mutation	SNP	ENST00000327259.4	37	CCDS8133.1	.	.	.	.	.	.	.	.	.	.	G	15.20	2.764123	0.49574	.	.	ENSG00000179292	ENST00000327259	.	.	.	4.23	3.31	0.37934	.	0.175744	0.37053	N	0.002277	T	0.30230	0.0758	N	0.08118	0	0.35601	D	0.807885	B	0.24675	0.109	B	0.14023	0.01	T	0.31138	-0.9954	9	0.46703	T	0.11	.	11.0799	0.48053	0.0937:0.0:0.9063:0.0	.	291	Q8N4L1	T151A_HUMAN	M	291	.	ENSP00000326244:V291M	V	+	1	0	TMEM151A	65819164	1.000000	0.71417	0.944000	0.38274	0.283000	0.27025	5.430000	0.66501	0.985000	0.38656	0.655000	0.94253	GTG	.		0.697	TMEM151A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391897.1	NM_153266	
UNC93B1	81622	broad.mit.edu	37	11	67763107	67763107	+	Silent	SNP	A	A	G			TCGA-OR-A5L2-01A-11D-A30A-10	TCGA-OR-A5L2-10A-01D-A30A-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b99bd79e-aa33-4896-8d10-2517c793f439	48e26b1d-b84d-432b-940b-9907c81ddf5b	g.chr11:67763107A>G	ENST00000227471.2	-	10	1414	c.1335T>C	c.(1333-1335)agT>agC	p.S445S	UNC93B1_ENST00000530331.1_5'UTR	NM_030930.2	NP_112192.2	Q9H1C4	UN93B_HUMAN	unc-93 homolog B1 (C. elegans)	446					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|defense response to virus (GO:0051607)|innate immune response (GO:0045087)|intracellular protein transport (GO:0006886)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 7 signaling pathway (GO:0034154)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)	early phagosome (GO:0032009)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|endosome (GO:0005768)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)											TGTTCAGGGCACTGCCCACAC	0.617																																					.		.											.	.	0			.						.						10.0	10.0	10.0					11																	67763107		1758	3730	5488	SO:0001819	synonymous_variant	81622	.			CAGGGCACTGCCC	AJ271326	CCDS73334.1	11q13.2	2014-09-17	2001-11-28		ENSG00000110057	ENSG00000110057			13481	protein-coding gene	gene with protein product		608204	"""unc93 (C. elegans) homolog B1"""			11867227	Standard	NM_030930		Approved	UNC93	uc001omw.1	Q9H1C4	OTTHUMG00000167472	ENST00000227471.2:c.1335T>C	11.37:g.67763107A>G		Somatic	74	1		WXS	Illumina GAIIx	Phase_I	216	4	.	0	0	0	0	0	O95764|Q569H6|Q710D4	Silent	SNP	ENST00000227471.2	37																																																																																				.		0.617	UNC93B1-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_030930	
PPFIA1	8500	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	11	70228237	70228237	+	Silent	SNP	G	G	A			TCGA-OR-A5L2-01A-11D-A30A-10	TCGA-OR-A5L2-10A-01D-A30A-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b99bd79e-aa33-4896-8d10-2517c793f439	48e26b1d-b84d-432b-940b-9907c81ddf5b	g.chr11:70228237G>A	ENST00000253925.7	+	27	3809	c.3594G>A	c.(3592-3594)agG>agA	p.R1198R	AP000487.5_ENST00000524619.1_RNA|AP000487.5_ENST00000500185.2_RNA|AP000487.5_ENST00000530690.1_RNA|PPFIA1_ENST00000530548.1_3'UTR	NM_003626.3	NP_003617.1	Q13136	LIPA1_HUMAN	protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), alpha 1	1198					cell-matrix adhesion (GO:0007160)|negative regulation of establishment of protein localization to plasma membrane (GO:0090005)|negative regulation of stress fiber assembly (GO:0051497)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|presynaptic active zone (GO:0048786)	signal transducer activity (GO:0004871)			breast(3)|cervix(1)|endometrium(5)|kidney(5)|large_intestine(11)|lung(31)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	65			BRCA - Breast invasive adenocarcinoma(2;1.04e-44)|LUSC - Lung squamous cell carcinoma(11;1.46e-14)|STAD - Stomach adenocarcinoma(18;0.0513)			CTACAGTCAGGACTTACTCCT	0.517											OREG0021174	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.R1198R		.											.	PPFIA1-228	0			c.G3594A						.						108.0	86.0	93.0					11																	70228237		2200	4294	6494	SO:0001819	synonymous_variant	8500	exon27			AGTCAGGACTTAC	U22816	CCDS31627.1, CCDS31628.1	11q13.3	2013-01-10			ENSG00000131626	ENSG00000131626		"""Sterile alpha motif (SAM) domain containing"""	9245	protein-coding gene	gene with protein product	"""Liprin-alpha1"""	611054				7796809, 9624153	Standard	NM_003626		Approved	LIP.1, LIPRIN	uc001opo.3	Q13136	OTTHUMG00000167266	ENST00000253925.7:c.3594G>A	11.37:g.70228237G>A		Somatic	76	0	1120	WXS	Illumina GAIIx	Phase_I	215	19	NM_003626	0	0	0	0	0	A6NLE3|Q13135|Q14567|Q8N4I2	Silent	SNP	ENST00000253925.7	37	CCDS31627.1																																																																																			.		0.517	PPFIA1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000393905.1	NM_003626	
SHANK2	22941	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	70333395	70333395	+	Silent	SNP	G	G	A			TCGA-OR-A5L2-01A-11D-A30A-10	TCGA-OR-A5L2-10A-01D-A30A-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b99bd79e-aa33-4896-8d10-2517c793f439	48e26b1d-b84d-432b-940b-9907c81ddf5b	g.chr11:70333395G>A	ENST00000423696.2	-	15	1902	c.1866C>T	c.(1864-1866)taC>taT	p.Y622Y	SHANK2_ENST00000409161.1_Silent_p.Y405Y|SHANK2_ENST00000449833.2_Silent_p.Y406Y|SHANK2_ENST00000338508.4_Silent_p.Y1002Y			Q9UPX8	SHAN2_HUMAN	SH3 and multiple ankyrin repeat domains 2	622					adult behavior (GO:0030534)|learning (GO:0007612)|long term synaptic depression (GO:0060292)|long-term synaptic potentiation (GO:0060291)|social behavior (GO:0035176)|synapse assembly (GO:0007416)|vocalization behavior (GO:0071625)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|cell junction (GO:0030054)|ciliary membrane (GO:0060170)|cytoplasm (GO:0005737)|dendritic spine (GO:0043197)|growth cone (GO:0030426)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|photoreceptor inner segment (GO:0001917)|photoreceptor outer segment (GO:0001750)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)	GKAP/Homer scaffold activity (GO:0030160)|ionotropic glutamate receptor binding (GO:0035255)			NS(2)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(4)|lung(30)|ovary(3)|pancreas(2)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	62			LUSC - Lung squamous cell carcinoma(11;4.72e-09)|STAD - Stomach adenocarcinoma(18;0.071)			TGGCGGGGACGTAGACGGCTT	0.617																																					p.Y413Y		.											.	SHANK2-94	0			c.C1239T						.						114.0	121.0	118.0					11																	70333395		2200	4294	6494	SO:0001819	synonymous_variant	22941	exon10			GGGGACGTAGACG	AF141901		11q13.2	2013-01-10			ENSG00000162105	ENSG00000162105		"""Sterile alpha motif (SAM) domain containing"", ""Ankyrin repeat domain containing"""	14295	protein-coding gene	gene with protein product		603290	"""cortactin binding protein 1"""	CORTBP1		10506216	Standard	XM_005277930		Approved	CTTNBP1, ProSAP1, SHANK, SPANK-3	uc001oqc.3	Q9UPX8	OTTHUMG00000154615	ENST00000423696.2:c.1866C>T	11.37:g.70333395G>A		Somatic	167	0		WXS	Illumina GAIIx	Phase_I	335	82	NM_133266	0	0	0	0	0	C0SPG8|C0SPG9|Q3Y8G9|Q52LK2|Q9UKP1	Silent	SNP	ENST00000423696.2	37																																																																																				.		0.617	SHANK2-203	KNOWN	basic	protein_coding	protein_coding		NM_012309	
WNT11	7481	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	11	75898196	75898196	+	Silent	SNP	G	G	A			TCGA-OR-A5L2-01A-11D-A30A-10	TCGA-OR-A5L2-10A-01D-A30A-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b99bd79e-aa33-4896-8d10-2517c793f439	48e26b1d-b84d-432b-940b-9907c81ddf5b	g.chr11:75898196G>A	ENST00000322563.3	-	5	1102	c.978C>T	c.(976-978)gtC>gtT	p.V326V		NM_004626.2	NP_004617.2	O96014	WNT11_HUMAN	wingless-type MMTV integration site family, member 11	326					adrenal gland development (GO:0030325)|artery morphogenesis (GO:0048844)|bone mineralization (GO:0030282)|canonical Wnt signaling pathway (GO:0060070)|cell fate commitment (GO:0045165)|cellular response to retinoic acid (GO:0071300)|cloacal septation (GO:0060197)|embryonic skeletal system development (GO:0048706)|lung-associated mesenchyme development (GO:0060484)|mesonephric duct development (GO:0072177)|negative regulation of apoptotic process (GO:0043066)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cartilage development (GO:0061037)|negative regulation of cell death (GO:0060548)|negative regulation of cell growth (GO:0030308)|negative regulation of cell migration (GO:0030336)|negative regulation of fibroblast growth factor production (GO:0090272)|negative regulation of mesenchymal cell proliferation (GO:0072201)|negative regulation of transcription, DNA-templated (GO:0045892)|neuroendocrine cell differentiation (GO:0061101)|neuron differentiation (GO:0030182)|non-canonical Wnt signaling pathway (GO:0035567)|osteoblast differentiation (GO:0001649)|outflow tract morphogenesis (GO:0003151)|palate development (GO:0060021)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell migration (GO:0030335)|positive regulation of gene expression (GO:0010628)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of protein kinase C signaling (GO:0090037)|positive regulation of Ras GTPase activity (GO:0032320)|positive regulation of stress fiber assembly (GO:0051496)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transforming growth factor beta2 production (GO:0032915)|protein localization to cell surface (GO:0034394)|protein phosphorylation (GO:0006468)|response to nutrient levels (GO:0031667)|tight junction assembly (GO:0070830)|ureteric bud morphogenesis (GO:0060675)|ventricular septum morphogenesis (GO:0060412)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	frizzled binding (GO:0005109)|protein kinase activator activity (GO:0030295)|Ras GTPase activator activity (GO:0005099)|transcription regulatory region DNA binding (GO:0044212)			breast(1)|large_intestine(5)|lung(6)|ovary(2)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)	20						GGCACCGCTCGACCACGCGGT	0.617																																					p.V326V		.											.	WNT11-562	0			c.C978T						.						174.0	127.0	143.0					11																	75898196		2200	4292	6492	SO:0001819	synonymous_variant	7481	exon5			CCGCTCGACCACG	Y12692	CCDS8242.1	11q13.5	2008-02-05			ENSG00000085741	ENSG00000085741		"""Wingless-type MMTV integration sites"""	12776	protein-coding gene	gene with protein product		603699				9757009	Standard	NM_004626		Approved		uc001oxe.3	O96014	OTTHUMG00000165264	ENST00000322563.3:c.978C>T	11.37:g.75898196G>A		Somatic	80	0		WXS	Illumina GAIIx	Phase_I	163	14	NM_004626	0	0	0	0	0	B2R8Z6|Q14DE8|Q8WZ98	Silent	SNP	ENST00000322563.3	37	CCDS8242.1																																																																																			.		0.617	WNT11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383083.1	NM_004626	
B3GNT6	192134	hgsc.bcm.edu	37	11	76751543	76751604	+	Frame_Shift_Del	DEL	TGGAGCGCGCCGGCCTGGCGCCCAGCGGCCACGAGGGCATCCTGGCCCTTCGGCGTGCAGCT	TGGAGCGCGCCGGCCTGGCGCCCAGCGGCCACGAGGGCATCCTGGCCCTTCGGCGTGCAGCT	-	rs544232471|rs34153015|rs182310862|rs11292200|rs77209527|rs539994853|rs201940118|rs11292199|rs200788398	byFrequency	TCGA-OR-A5L2-01A-11D-A30A-10	TCGA-OR-A5L2-10A-01D-A30A-10	TGGAGCGCGCCGGCCTGGCGCCCAGCGGCCACGAGGGCATCCTGGCCCTTCGGCGTGCAGCT	TGGAGCGCGCCGGCCTGGCGCCCAGCGGCCACGAGGGCATCCTGGCCCTTCGGCGTGCAGCT	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b99bd79e-aa33-4896-8d10-2517c793f439	48e26b1d-b84d-432b-940b-9907c81ddf5b	g.chr11:76751543_76751604delTGGAGCGCGCCGGCCTGGCGCCCAGCGGCCACGAGGGCATCCTGGCCCTTCGGCGTGCAGCT	ENST00000533140.1	+	2	1086_1147	c.948_1009delTGGAGCGCGCCGGCCTGGCGCCCAGCGGCCACGAGGGCATCCTGGCCCTTCGGCGTGCAGCT	c.(946-1011)cttggagcgcgccggcctggcgcccagcggccacgagggcatcctggcccttcggcgtgcagcttgfs	p.LGARRPGAQRPRGHPGPSACSL316fs	B3GNT6_ENST00000354301.5_Splice_Site_p.LERAGLAPSGHEGILALRRAA316fs|B3GNT6_ENST00000421061.1_Splice_Site_p.GARRPGAQRPRGHPGP200fs			O43505	B3GN1_HUMAN	UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 6 (core 3 synthase)	0					axon guidance (GO:0007411)|carbohydrate metabolic process (GO:0005975)|glycosaminoglycan metabolic process (GO:0030203)|keratan sulfate biosynthetic process (GO:0018146)|keratan sulfate metabolic process (GO:0042339)|poly-N-acetyllactosamine biosynthetic process (GO:0030311)|protein glycosylation (GO:0006486)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|integral component of Golgi membrane (GO:0030173)	N-acetyllactosaminide beta-1,3-N-acetylglucosaminyltransferase activity (GO:0008532)			central_nervous_system(1)|kidney(2)|lung(4)|prostate(1)	8						GCATGTGTCTTGGAGCGCGCCGGCCTGGCGCCCAGCGGCCACGAGGGCATCCTGGCCCTTCGGCGTGCAGCTTGCCTGGCGC	0.71																																					p.316_336del		.											.	.	0			c.947_1006del						.																																			SO:0001589	frameshift_variant	192134	exon3			GTGTCTTGGAGCG	AB073740	CCDS53681.1	11q13.4	2013-02-19			ENSG00000198488	ENSG00000198488		"""Beta 3-glycosyltransferases"""	24141	protein-coding gene	gene with protein product		615315				11821425	Standard	NM_138706		Approved	B3Gn-T6	uc021qnp.1	Q6ZMB0		ENST00000533140.1:c.948_1009delTGGAGCGCGCCGGCCTGGCGCCCAGCGGCCACGAGGGCATCCTGGCCCTTCGGCGTGCAGCT	11.37:g.76751543_76751604delTGGAGCGCGCCGGCCTGGCGCCCAGCGGCCACGAGGGCATCCTGGCCCTTCGGCGTGCAGCT	ENSP00000435352:p.Leu316fs	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	25	0	NM_138706	0	0	0	0	0	Q4TTN0	In_Frame_Del	DEL	ENST00000533140.1	37	CCDS53681.1																																																																																			.		0.710	B3GNT6-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000382740.2	NM_138706	
SIK2	23235	broad.mit.edu	37	11	111591721	111591721	+	Missense_Mutation	SNP	G	G	C			TCGA-OR-A5L2-01A-11D-A30A-10	TCGA-OR-A5L2-10A-01D-A30A-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b99bd79e-aa33-4896-8d10-2517c793f439	48e26b1d-b84d-432b-940b-9907c81ddf5b	g.chr11:111591721G>C	ENST00000304987.3	+	12	2052	c.1879G>C	c.(1879-1881)Gag>Cag	p.E627Q		NM_015191.1	NP_056006.1	Q9H0K1	SIK2_HUMAN	salt-inducible kinase 2	627					insulin receptor signaling pathway (GO:0008286)|intracellular signal transduction (GO:0035556)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of insulin receptor signaling pathway (GO:0046626)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|protein serine/threonine kinase activity (GO:0004674)	p.E627K(1)		breast(1)|central_nervous_system(2)|cervix(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(7)|prostate(3)|skin(1)|upper_aerodigestive_tract(3)	30						AATAGGACCGGAGGCAGACCC	0.517																																					p.E627Q		.											.	SIK2-783	1	Substitution - Missense(1)	cervix(1)	c.G1879C						.						81.0	86.0	84.0					11																	111591721		2201	4297	6498	SO:0001583	missense	23235	exon12			GGACCGGAGGCAG	AB018324	CCDS8347.1	11q23.1	2008-12-23	2008-12-23	2008-12-23	ENSG00000170145	ENSG00000170145			21680	protein-coding gene	gene with protein product		608973	"""SNF1-like kinase 2"""	SNF1LK2		15067358	Standard	NM_015191		Approved	KIAA0781, QIK, DKFZp434K1115, LOH11CR1I	uc001plt.3	Q9H0K1	OTTHUMG00000150644	ENST00000304987.3:c.1879G>C	11.37:g.111591721G>C	ENSP00000305976:p.Glu627Gln	Somatic	78	0		WXS	Illumina GAIIx	Phase_I	85	4	NM_015191	0	0	0	0	0	A8K5B8|B0YJ94|O94878|Q17RV0|Q6AZE2|Q76N03|Q8NCV7|Q96CZ8	Missense_Mutation	SNP	ENST00000304987.3	37	CCDS8347.1	.	.	.	.	.	.	.	.	.	.	G	17.82	3.483654	0.63962	.	.	ENSG00000170145	ENST00000304987	T	0.73152	-0.72	6.17	5.25	0.73442	.	0.317810	0.37761	N	0.001947	T	0.63283	0.2498	L	0.50333	1.59	0.31314	N	0.686771	B	0.23735	0.09	B	0.22880	0.042	T	0.59847	-0.7377	10	0.08837	T	0.75	.	15.7024	0.77552	0.0666:0.0:0.9334:0.0	.	627	Q9H0K1	SIK2_HUMAN	Q	627	ENSP00000305976:E627Q	ENSP00000305976:E627Q	E	+	1	0	SIK2	111096931	1.000000	0.71417	0.446000	0.26920	0.391000	0.30476	3.732000	0.55021	1.596000	0.50062	0.655000	0.94253	GAG	.		0.517	SIK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319352.3	NM_015191	
USP28	57646	broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	113679796	113679796	+	Missense_Mutation	SNP	G	G	C			TCGA-OR-A5L2-01A-11D-A30A-10	TCGA-OR-A5L2-10A-01D-A30A-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b99bd79e-aa33-4896-8d10-2517c793f439	48e26b1d-b84d-432b-940b-9907c81ddf5b	g.chr11:113679796G>C	ENST00000003302.4	-	17	2221	c.2153C>G	c.(2152-2154)tCt>tGt	p.S718C	USP28_ENST00000545540.1_Missense_Mutation_p.S593C|USP28_ENST00000260188.5_Missense_Mutation_p.S718C|USP28_ENST00000544967.1_Missense_Mutation_p.S426C	NM_020886.2	NP_065937.1	Q96RU2	UBP28_HUMAN	ubiquitin specific peptidase 28	718					cell proliferation (GO:0008283)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to UV (GO:0034644)|DNA damage checkpoint (GO:0000077)|DNA repair (GO:0006281)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|protein deubiquitination (GO:0016579)|response to ionizing radiation (GO:0010212)|ubiquitin-dependent protein catabolic process (GO:0006511)	nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)	ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)			breast(4)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(12)|lung(24)|ovary(1)|prostate(5)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	59		all_cancers(61;3.74e-18)|all_epithelial(67;3.75e-11)|Melanoma(852;1.46e-05)|all_hematologic(158;4.65e-05)|Acute lymphoblastic leukemia(157;0.000967)|Breast(348;0.0101)|Prostate(24;0.0153)|all_neural(223;0.0281)|Medulloblastoma(222;0.0425)		BRCA - Breast invasive adenocarcinoma(274;3.93e-06)|Epithelial(105;0.000122)|all cancers(92;0.00104)		TTGTGATGTAGAGTAGTCCTG	0.498																																					p.S718C	Melanoma(4;162 555 7664)|GBM(79;500 2010 17506)|Esophageal Squamous(9;463 924 15765)	.											.	USP28-706	0			c.C2153G						.						222.0	209.0	213.0					11																	113679796		2201	4296	6497	SO:0001583	missense	57646	exon17			GATGTAGAGTAGT	AB040948	CCDS31680.1, CCDS73394.1	11q23	2008-04-11	2005-08-08		ENSG00000048028	ENSG00000048028		"""Ubiquitin-specific peptidases"""	12625	protein-coding gene	gene with protein product		610748	"""ubiquitin specific protease 28"""			12838346, 11597335	Standard	XM_005271630		Approved	KIAA1515	uc001poh.3	Q96RU2	OTTHUMG00000168205	ENST00000003302.4:c.2153C>G	11.37:g.113679796G>C	ENSP00000003302:p.Ser718Cys	Somatic	283	2		WXS	Illumina GAIIx	Phase_I	250	61	NM_020886	0	0	0	0	0	B0YJC0|B0YJC1|Q9P213	Missense_Mutation	SNP	ENST00000003302.4	37	CCDS31680.1	.	.	.	.	.	.	.	.	.	.	G	14.09	2.431441	0.43122	.	.	ENSG00000048028	ENST00000003302;ENST00000260188;ENST00000544967;ENST00000545540	T;T;T;T	0.46451	1.4;1.46;0.87;1.47	4.9	4.9	0.64082	.	0.630500	0.16625	N	0.206332	T	0.40670	0.1126	L	0.38175	1.15	0.28214	N	0.92681	D;D;D	0.57257	0.979;0.966;0.973	P;P;P	0.50192	0.594;0.571;0.634	T	0.33059	-0.9883	10	0.59425	D	0.04	-16.9757	9.066	0.36465	0.0975:0.0:0.9025:0.0	.	593;718;426	B4E3L3;Q96RU2;G3V1N5	.;UBP28_HUMAN;.	C	718;718;426;593	ENSP00000003302:S718C;ENSP00000260188:S718C;ENSP00000442431:S426C;ENSP00000444991:S593C	ENSP00000003302:S718C	S	-	2	0	USP28	113185006	0.999000	0.42202	0.978000	0.43139	0.693000	0.40251	3.123000	0.50453	2.540000	0.85666	0.462000	0.41574	TCT	.		0.498	USP28-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398789.1		
VSIG2	23584	broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	124618582	124618582	+	Nonsense_Mutation	SNP	G	G	A			TCGA-OR-A5L2-01A-11D-A30A-10	TCGA-OR-A5L2-10A-01D-A30A-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b99bd79e-aa33-4896-8d10-2517c793f439	48e26b1d-b84d-432b-940b-9907c81ddf5b	g.chr11:124618582G>A	ENST00000326621.5	-	5	764	c.664C>T	c.(664-666)Cag>Tag	p.Q222*	VSIG2_ENST00000403470.1_Nonsense_Mutation_p.Q222*|RP11-677M14.2_ENST00000531241.1_RNA	NM_014312.3	NP_055127.2	Q96IQ7	VSIG2_HUMAN	V-set and immunoglobulin domain containing 2	222	Ig-like C2-type.					integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)				central_nervous_system(1)|cervix(1)|kidney(2)|large_intestine(2)|lung(8)|ovary(5)	19	all_hematologic(175;0.215)	Breast(109;0.00663)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;1.49e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0215)		CTGCCCATCTGGTTGGTGGCC	0.602																																					p.Q222X		.											.	VSIG2-93	0			c.C664T						.						133.0	108.0	117.0					11																	124618582		2201	4299	6500	SO:0001587	stop_gained	23584	exon5			CCATCTGGTTGGT	AF061022	CCDS8452.1	11q24	2013-01-11			ENSG00000019102	ENSG00000019102		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / I-set domain containing"""	17149	protein-coding gene	gene with protein product		606011				9862345	Standard	NM_014312		Approved	CTXL, CTH	uc001qas.3	Q96IQ7	OTTHUMG00000150357	ENST00000326621.5:c.664C>T	11.37:g.124618582G>A	ENSP00000318684:p.Gln222*	Somatic	158	1		WXS	Illumina GAIIx	Phase_I	149	45	NM_014312	0	0	0	0	0	O95791|Q9NX42	Nonsense_Mutation	SNP	ENST00000326621.5	37	CCDS8452.1	.	.	.	.	.	.	.	.	.	.	G	32	5.107218	0.94292	.	.	ENSG00000019102	ENST00000326621;ENST00000403470	.	.	.	5.44	5.44	0.79542	.	0.184647	0.38381	N	0.001712	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.08837	T	0.75	.	14.6271	0.68629	0.0:0.0:1.0:0.0	.	.	.	.	X	222	.	ENSP00000318684:Q222X	Q	-	1	0	VSIG2	124123792	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.008000	0.49544	2.835000	0.97688	0.591000	0.81541	CAG	.		0.602	VSIG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317785.1	NM_014312	
FGF23	8074	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	12	4488634	4488634	+	Missense_Mutation	SNP	G	G	C			TCGA-OR-A5L2-01A-11D-A30A-10	TCGA-OR-A5L2-10A-01D-A30A-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b99bd79e-aa33-4896-8d10-2517c793f439	48e26b1d-b84d-432b-940b-9907c81ddf5b	g.chr12:4488634G>C	ENST00000237837.1	-	1	260	c.115C>G	c.(115-117)Ctg>Gtg	p.L39V		NM_020638.2	NP_065689.1	Q9GZV9	FGF23_HUMAN	fibroblast growth factor 23	39					cell differentiation (GO:0030154)|cellular phosphate ion homeostasis (GO:0030643)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|negative regulation of bone mineralization (GO:0030502)|negative regulation of hormone secretion (GO:0046888)|negative regulation of osteoblast differentiation (GO:0045668)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphate ion homeostasis (GO:0055062)|phosphate-containing compound metabolic process (GO:0006796)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of MAPKKK cascade by fibroblast growth factor receptor signaling pathway (GO:0090080)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of vitamin D 24-hydroxylase activity (GO:0010980)|regulation of phosphate transport (GO:0010966)|vitamin D catabolic process (GO:0042369)	extracellular region (GO:0005576)|extracellular space (GO:0005615)				NS(1)|breast(2)|kidney(1)|large_intestine(1)|lung(7)|ovary(2)|pancreas(1)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)	22			Colorectal(7;0.00165)|COAD - Colon adenocarcinoma(12;0.0229)|STAD - Stomach adenocarcinoma(119;0.206)			AGGTGGATCAGGCCACCCCAG	0.602																																					p.L39V		.											.	FGF23-660	0			c.C115G						.						127.0	98.0	108.0					12																	4488634		2203	4300	6503	SO:0001583	missense	8074	exon1			GGATCAGGCCACC	AF263537	CCDS8526.1	12p13	2008-07-04			ENSG00000118972	ENSG00000118972			3680	protein-coding gene	gene with protein product		605380				11032749, 18310961	Standard	NM_020638		Approved		uc001qmq.1	Q9GZV9	OTTHUMG00000168241	ENST00000237837.1:c.115C>G	12.37:g.4488634G>C	ENSP00000237837:p.Leu39Val	Somatic	54	0		WXS	Illumina GAIIx	Phase_I	107	9	NM_020638	0	0	0	0	0	Q4V758	Missense_Mutation	SNP	ENST00000237837.1	37	CCDS8526.1	.	.	.	.	.	.	.	.	.	.	G	16.92	3.254817	0.59212	.	.	ENSG00000118972	ENST00000237837	T	0.81330	-1.48	3.96	3.96	0.45880	.	0.235397	0.36854	N	0.002364	D	0.88012	0.6323	M	0.74881	2.28	0.40871	D	0.983915	D	0.76494	0.999	D	0.70716	0.97	D	0.85970	0.1476	10	0.22109	T	0.4	-15.0123	17.3281	0.87255	0.0:0.0:1.0:0.0	.	39	Q9GZV9	FGF23_HUMAN	V	39	ENSP00000237837:L39V	ENSP00000237837:L39V	L	-	1	2	FGF23	4358895	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	3.735000	0.55044	2.496000	0.84212	0.655000	0.94253	CTG	.		0.602	FGF23-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398936.1		
SCNN1A	6337	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	6457898	6457898	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5L2-01A-11D-A30A-10	TCGA-OR-A5L2-10A-01D-A30A-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b99bd79e-aa33-4896-8d10-2517c793f439	48e26b1d-b84d-432b-940b-9907c81ddf5b	g.chr12:6457898C>T	ENST00000228916.2	-	12	1722	c.1624G>A	c.(1624-1626)Gtc>Atc	p.V542I	SCNN1A_ENST00000540037.1_Missense_Mutation_p.V242I|SCNN1A_ENST00000358945.3_Missense_Mutation_p.V564I|SCNN1A_ENST00000360168.3_Missense_Mutation_p.V601I|SCNN1A_ENST00000396966.2_3'UTR|SCNN1A_ENST00000543768.1_Missense_Mutation_p.V565I	NM_001038.5	NP_001029.1	P37088	SCNNA_HUMAN	sodium channel, non-voltage-gated 1 alpha subunit	542					excretion (GO:0007588)|ion transmembrane transport (GO:0034220)|multicellular organismal water homeostasis (GO:0050891)|response to stimulus (GO:0050896)|sensory perception of taste (GO:0050909)|sodium ion homeostasis (GO:0055078)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|ciliary membrane (GO:0060170)|cortical actin cytoskeleton (GO:0030864)|cytosol (GO:0005829)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|motile cilium (GO:0031514)|plasma membrane (GO:0005886)|sodium channel complex (GO:0034706)	ligand-gated sodium channel activity (GO:0015280)|WW domain binding (GO:0050699)			central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|liver(2)|lung(6)|prostate(1)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	27					Amiloride(DB00594)|Triamterene(DB00384)	CCTACCGTGACAGAGGGAGAC	0.532																																					p.V601I		.											.	SCNN1A-90	0			c.G1801A						.						135.0	121.0	126.0					12																	6457898		2203	4300	6503	SO:0001583	missense	6337	exon11			CCGTGACAGAGGG	Z92978	CCDS8543.1, CCDS53738.1, CCDS53739.1	12p13	2012-02-28	2012-02-28		ENSG00000111319	ENSG00000111319		"""Ion channels / Sodium channel, nonvoltage-gated"", ""Sodium channels"""	10599	protein-coding gene	gene with protein product		600228	"""sodium channel, nonvoltage-gated 1 alpha"", ""sodium channel, non-voltage-gated 1 alpha"""	SCNN1		7896277	Standard	NM_001038		Approved	ENaCalpha	uc001qnw.3	P37088	OTTHUMG00000168268	ENST00000228916.2:c.1624G>A	12.37:g.6457898C>T	ENSP00000228916:p.Val542Ile	Somatic	178	0		WXS	Illumina GAIIx	Phase_I	175	24	NM_001159576	0	0	0	0	0	A5X2U9|B4E2Q5|C5HTZ0|O43271|Q6GSQ6|Q9UM64	Missense_Mutation	SNP	ENST00000228916.2	37	CCDS8543.1	.	.	.	.	.	.	.	.	.	.	C	13.80	2.345864	0.41599	.	.	ENSG00000111319	ENST00000360168;ENST00000358945;ENST00000540037;ENST00000228916;ENST00000543768	T;T;T;T;T	0.63096	-0.02;-0.02;-0.02;-0.02;-0.02	5.0	5.0	0.66597	.	0.201781	0.33457	N	0.004884	T	0.52917	0.1764	L	0.45470	1.425	0.29709	N	0.839533	P;B;P	0.38827	0.649;0.267;0.537	B;B;B	0.42462	0.388;0.336;0.155	T	0.49418	-0.8942	10	0.07813	T	0.8	-39.9318	9.4189	0.38539	0.0:0.9029:0.0:0.0971	.	565;542;601	B4E2Q5;P37088;P37088-2	.;SCNNA_HUMAN;.	I	601;564;242;542;565	ENSP00000353292:V601I;ENSP00000351825:V564I;ENSP00000440876:V242I;ENSP00000228916:V542I;ENSP00000438739:V565I	ENSP00000228916:V542I	V	-	1	0	SCNN1A	6328159	0.987000	0.35691	0.990000	0.47175	0.881000	0.50899	2.715000	0.47210	2.331000	0.79229	0.591000	0.81541	GTC	.		0.532	SCNN1A-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000399055.1		
PTPN6	5777	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	12	7060782	7060782	+	Nonsense_Mutation	SNP	C	C	T			TCGA-OR-A5L2-01A-11D-A30A-10	TCGA-OR-A5L2-10A-01D-A30A-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b99bd79e-aa33-4896-8d10-2517c793f439	48e26b1d-b84d-432b-940b-9907c81ddf5b	g.chr12:7060782C>T	ENST00000318974.9	+	2	263	c.19C>T	c.(19-21)Cga>Tga	p.R7*	PTPN6_ENST00000456013.1_Nonsense_Mutation_p.R7*|PTPN6_ENST00000447931.2_Intron|PTPN6_ENST00000399448.1_Nonsense_Mutation_p.R9*	NM_002831.5	NP_002822.2	P29350	PTN6_HUMAN	protein tyrosine phosphatase, non-receptor type 6	7	SH2 1. {ECO:0000255|PROSITE- ProRule:PRU00191}.				abortive mitotic cell cycle (GO:0033277)|apoptotic process (GO:0006915)|B cell receptor signaling pathway (GO:0050853)|blood coagulation (GO:0007596)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cytokine-mediated signaling pathway (GO:0019221)|G-protein coupled receptor signaling pathway (GO:0007186)|interferon-gamma-mediated signaling pathway (GO:0060333)|JAK-STAT cascade involved in growth hormone signaling pathway (GO:0060397)|leukocyte migration (GO:0050900)|megakaryocyte development (GO:0035855)|natural killer cell mediated cytotoxicity (GO:0042267)|negative regulation of B cell receptor signaling pathway (GO:0050859)|negative regulation of cell proliferation (GO:0008285)|negative regulation of humoral immune response mediated by circulating immunoglobulin (GO:0002924)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of peptidyl-tyrosine phosphorylation (GO:0050732)|negative regulation of T cell proliferation (GO:0042130)|negative regulation of T cell receptor signaling pathway (GO:0050860)|peptidyl-tyrosine dephosphorylation (GO:0035335)|peptidyl-tyrosine phosphorylation (GO:0018108)|platelet aggregation (GO:0070527)|platelet formation (GO:0030220)|positive regulation of cell adhesion mediated by integrin (GO:0033630)|positive regulation of cell proliferation (GO:0008284)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|protein dephosphorylation (GO:0006470)|regulation of B cell differentiation (GO:0045577)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of G1/S transition of mitotic cell cycle (GO:2000045)|regulation of interferon-gamma-mediated signaling pathway (GO:0060334)|regulation of release of sequestered calcium ion into cytosol (GO:0051279)|regulation of type I interferon-mediated signaling pathway (GO:0060338)|T cell costimulation (GO:0031295)|type I interferon signaling pathway (GO:0060337)	alpha-beta T cell receptor complex (GO:0042105)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	protein kinase binding (GO:0019901)|protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			breast(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(5)|prostate(3)	18						GTGGTTTCACCGAGACCTCAG	0.662																																					p.R9X		.											.	PTPN6-703	0			c.C25T						.						51.0	57.0	55.0					12																	7060782		1969	4166	6135	SO:0001587	stop_gained	5777	exon2			TTTCACCGAGACC		CCDS41744.1, CCDS44820.1, CCDS44821.1	12p13.31	2013-02-14			ENSG00000111679	ENSG00000111679		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Non-receptor"", ""SH2 domain containing"""	9658	protein-coding gene	gene with protein product		176883				1639416	Standard	NM_080548		Approved	HCP, HCPH, PTP-1C, SHP-1, SHP1	uc001qsa.1	P29350	OTTHUMG00000168518	ENST00000318974.9:c.19C>T	12.37:g.7060782C>T	ENSP00000326010:p.Arg7*	Somatic	113	0		WXS	Illumina GAIIx	Phase_I	115	9	NM_080548	0	0	0	0	0	A8K306|G3V0F8|Q969V8|Q9UK67	Nonsense_Mutation	SNP	ENST00000318974.9	37	CCDS44820.1	.	.	.	.	.	.	.	.	.	.	C	37	6.322460	0.97471	.	.	ENSG00000111679	ENST00000543115;ENST00000399448;ENST00000538715;ENST00000318974;ENST00000456013;ENST00000536521;ENST00000541698	.	.	.	4.72	3.76	0.43208	.	0.000000	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	14.26	0.66078	0.0:0.8502:0.1498:0.0	.	.	.	.	X	28;9;7;7;7;7;7	.	ENSP00000326010:R7X	R	+	1	2	PTPN6	6931043	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	2.616000	0.46376	2.168000	0.68352	0.491000	0.48974	CGA	.		0.662	PTPN6-008	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400023.1	NM_002831	
CD163L1	283316	broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	7522051	7522051	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5L2-01A-11D-A30A-10	TCGA-OR-A5L2-10A-01D-A30A-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b99bd79e-aa33-4896-8d10-2517c793f439	48e26b1d-b84d-432b-940b-9907c81ddf5b	g.chr12:7522051C>T	ENST00000313599.3	-	15	3998	c.3941G>A	c.(3940-3942)cGg>cAg	p.R1314Q	CD163L1_ENST00000396630.1_Missense_Mutation_p.R1314Q|CD163L1_ENST00000416109.2_Missense_Mutation_p.R1324Q			Q9NR16	C163B_HUMAN	CD163 molecule-like 1	1314	SRCR 12. {ECO:0000255|PROSITE- ProRule:PRU00196}.					extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	scavenger receptor activity (GO:0005044)			breast(5)|central_nervous_system(3)|endometrium(8)|kidney(3)|large_intestine(18)|lung(37)|ovary(8)|prostate(3)|skin(6)|stomach(1)|urinary_tract(4)	96						TCCTTTGCACCGCATGTCATC	0.567																																					p.R1314Q		.											.	CD163L1-100	0			c.G3941A						.						146.0	132.0	137.0					12																	7522051		2203	4300	6503	SO:0001583	missense	283316	exon15			TTGCACCGCATGT	AF264014	CCDS8577.1, CCDS73434.1	12p13.31	2006-03-28	2006-03-28			ENSG00000177675			30375	protein-coding gene	gene with protein product		606079	"""CD163 antigen-like 1"""			11124526, 11086079	Standard	XM_005253348		Approved	M160, CD163B	uc001qsy.3	Q9NR16		ENST00000313599.3:c.3941G>A	12.37:g.7522051C>T	ENSP00000315945:p.Arg1314Gln	Somatic	71	1		WXS	Illumina GAIIx	Phase_I	88	28	NM_174941	0	0	0	0	0	B4E0G7|C9JHR7|E7EVK4|Q2M3B7|Q6UWC2	Missense_Mutation	SNP	ENST00000313599.3	37	CCDS8577.1	.	.	.	.	.	.	.	.	.	.	C	1.694	-0.503193	0.04261	.	.	ENSG00000177675	ENST00000313599;ENST00000416109;ENST00000396630	T;T;T	0.35236	1.32;1.32;1.32	2.67	-3.33	0.04958	Speract/scavenger receptor (2);Speract/scavenger receptor-related (2);	1.561810	0.04732	N	0.421283	T	0.14013	0.0339	N	0.05031	-0.125	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.06405	0.002;0.0	T	0.15983	-1.0418	10	0.09590	T	0.72	.	3.7428	0.08537	0.1667:0.344:0.0:0.4892	.	1324;1314	E7EVK4;Q9NR16	.;C163B_HUMAN	Q	1314;1324;1314	ENSP00000315945:R1314Q;ENSP00000393474:R1324Q;ENSP00000379871:R1314Q	ENSP00000315945:R1314Q	R	-	2	0	CD163L1	7413318	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-0.225000	0.09151	-0.772000	0.04602	-1.307000	0.01316	CGG	.		0.567	CD163L1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000399329.1	NM_174941	
ARID2	196528	broad.mit.edu	37	12	46211485	46211485	+	Missense_Mutation	SNP	G	G	T			TCGA-OR-A5L2-01A-11D-A30A-10	TCGA-OR-A5L2-10A-01D-A30A-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b99bd79e-aa33-4896-8d10-2517c793f439	48e26b1d-b84d-432b-940b-9907c81ddf5b	g.chr12:46211485G>T	ENST00000334344.6	+	5	623	c.451G>T	c.(451-453)Gac>Tac	p.D151Y	ARID2_ENST00000422737.1_Missense_Mutation_p.D2Y	NM_152641.2	NP_689854.2	Q68CP9	ARID2_HUMAN	AT rich interactive domain 2 (ARID, RFX-like)	151					chromatin modification (GO:0016568)|nucleosome disassembly (GO:0006337)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|autonomic_ganglia(1)|breast(7)|central_nervous_system(3)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(21)|liver(20)|lung(34)|ovary(7)|pancreas(1)|prostate(2)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	116	Lung SC(27;0.192)|Renal(347;0.236)	Lung NSC(34;0.106)|all_lung(34;0.22)	OV - Ovarian serous cystadenocarcinoma(5;0.00691)	GBM - Glioblastoma multiforme(48;0.0153)		GCTGTCCATGGACTTTAATTC	0.348			"""N, S, F"""		hepatocellular carcinoma																																p.D151Y		.		Rec	yes		12	12q12	196528	AT rich interactive domain 2		E	.	ARID2-100	0			c.G451T						.						76.0	74.0	75.0					12																	46211485		2203	4300	6503	SO:0001583	missense	196528	exon5			TCCATGGACTTTA		CCDS31783.1	12q13.11	2013-02-07			ENSG00000189079	ENSG00000189079		"""-"""	18037	protein-coding gene	gene with protein product		609539					Standard	NM_152641		Approved	KIAA1557, DKFZp686G052, FLJ30619, BAF200	uc001ros.1	Q68CP9	OTTHUMG00000150487	ENST00000334344.6:c.451G>T	12.37:g.46211485G>T	ENSP00000335044:p.Asp151Tyr	Somatic	36	0		WXS	Illumina GAIIx	Phase_I	33	4	NM_152641	0	0	0	0	0	Q15KG9|Q5EB51|Q645I3|Q6ZRY5|Q7Z3I5|Q86T28|Q96SJ6|Q9HCL5	Missense_Mutation	SNP	ENST00000334344.6	37	CCDS31783.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	27.3|27.3	4.819241|4.819241	0.90873|0.90873	.|.	.|.	ENSG00000189079|ENSG00000189079	ENST00000334344;ENST00000422737|ENST00000549153;ENST00000338636	T|.	0.34859|.	1.34|.	5.62|5.62	5.62|5.62	0.85841|0.85841	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.75744|0.75744	0.3891|0.3891	L|L	0.61218|0.61218	1.895|1.895	0.80722|0.80722	D|D	1|1	D|.	0.89917|.	1.0|.	D|.	0.85130|.	0.997|.	T|T	0.77225|0.77225	-0.2666|-0.2666	10|6	0.62326|0.87932	D|D	0.03|0	-7.5109|-7.5109	19.6643|19.6643	0.95887|0.95887	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	151|.	Q68CP9|.	ARID2_HUMAN|.	Y|C	151;2|42	ENSP00000335044:D151Y|.	ENSP00000335044:D151Y|ENSP00000339739:W42C	D|W	+|+	1|3	0|0	ARID2|ARID2	44497752|44497752	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.997000|0.997000	0.91878|0.91878	9.854000|9.854000	0.99522|0.99522	2.628000|2.628000	0.89032|0.89032	0.650000|0.650000	0.86243|0.86243	GAC|TGG	.		0.348	ARID2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318380.2	XM_350875	
HDAC7	51564	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	48189737	48189737	+	Silent	SNP	T	T	G			TCGA-OR-A5L2-01A-11D-A30A-10	TCGA-OR-A5L2-10A-01D-A30A-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b99bd79e-aa33-4896-8d10-2517c793f439	48e26b1d-b84d-432b-940b-9907c81ddf5b	g.chr12:48189737T>G	ENST00000427332.2	-	9	897	c.741A>C	c.(739-741)acA>acC	p.T247T	HDAC7_ENST00000080059.7_Silent_p.T286T|HDAC7_ENST00000552960.1_Silent_p.T269T|HDAC7_ENST00000354334.3_Intron|HDAC7_ENST00000380610.4_Silent_p.T303T			Q8WUI4	HDAC7_HUMAN	histone deacetylase 7	247	Transcription repression 1. {ECO:0000250}.|Transcription repression 2. {ECO:0000250}.			Missing (in Ref. 1; AAF63491). {ECO:0000305}.	cell-cell junction assembly (GO:0007043)|negative regulation of interleukin-2 production (GO:0032703)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|Notch signaling pathway (GO:0007219)|positive regulation of cell migration involved in sprouting angiogenesis (GO:0090050)|transcription, DNA-templated (GO:0006351)|vasculogenesis (GO:0001570)	cytoplasm (GO:0005737)|histone deacetylase complex (GO:0000118)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	14-3-3 protein binding (GO:0071889)|activating transcription factor binding (GO:0033613)|chromatin binding (GO:0003682)|metal ion binding (GO:0046872)|NAD-dependent histone deacetylase activity (H3-K14 specific) (GO:0032041)|NAD-dependent histone deacetylase activity (H3-K18 specific) (GO:0097372)|NAD-dependent histone deacetylase activity (H3-K9 specific) (GO:0046969)|NAD-dependent histone deacetylase activity (H4-K16 specific) (GO:0046970)|protein kinase binding (GO:0019901)|protein kinase C binding (GO:0005080)|repressing transcription factor binding (GO:0070491)|transcription corepressor activity (GO:0003714)			breast(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(6)|lung(11)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	25				GBM - Glioblastoma multiforme(48;0.137)		GCAAGGACACTGTCGGCAAGG	0.692																																					p.T286T		.											.	HDAC7-289	0			c.A858C						.						7.0	7.0	7.0					12																	48189737		2109	4074	6183	SO:0001819	synonymous_variant	51564	exon9			GGACACTGTCGGC	AF239243	CCDS8756.2, CCDS41776.1	12q13.1	2008-02-25	2008-02-25	2008-02-25	ENSG00000061273	ENSG00000061273			14067	protein-coding gene	gene with protein product		606542	"""histone deacetylase 7A"""	HDAC7A		10922406, 10640276	Standard	NM_015401		Approved	DKFZP586J0917	uc010slo.2	Q8WUI4	OTTHUMG00000152968	ENST00000427332.2:c.741A>C	12.37:g.48189737T>G		Somatic	80	0		WXS	Illumina GAIIx	Phase_I	122	20	NM_015401	0	0	0	0	0	B3KY08|B4DWI0|B4E0Q5|Q6P1W9|Q6W9G7|Q7Z4K2|Q7Z5I1|Q96K01|Q9BR73|Q9H7L0|Q9NW41|Q9NWA9|Q9NYK9|Q9UFU7	Silent	SNP	ENST00000427332.2	37																																																																																				.		0.692	HDAC7-013	NOVEL	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000328804.2		
TMBIM6	7009	broad.mit.edu;bcgsc.ca	37	12	50136045	50136045	+	Intron	SNP	A	A	G			TCGA-OR-A5L2-01A-11D-A30A-10	TCGA-OR-A5L2-10A-01D-A30A-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b99bd79e-aa33-4896-8d10-2517c793f439	48e26b1d-b84d-432b-940b-9907c81ddf5b	g.chr12:50136045A>G	ENST00000267115.5	+	1	55				TMBIM6_ENST00000552699.1_Silent_p.G42G|TMBIM6_ENST00000549385.1_Intron|TMBIM6_ENST00000423828.1_Silent_p.G42G	NM_003217.2	NP_003208.2	P55061	BI1_HUMAN	transmembrane BAX inhibitor motif containing 6						apoptotic process (GO:0006915)|negative regulation of apoptotic process (GO:0043066)|response to unfolded protein (GO:0006986)	endoplasmic reticulum (GO:0005783)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|nucleus (GO:0005634)				lung(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	6						CTCTTTTCGGATTGGTTACCT	0.597																																					p.G42G		.											.	TMBIM6-90	0			c.A126G						.						29.0	33.0	32.0					12																	50136045		1902	4100	6002	SO:0001627	intron_variant	7009	exon1			TTTCGGATTGGTT	X75861	CCDS31797.1, CCDS44875.1	12q13.12	2013-10-08	2008-09-17	2008-09-17	ENSG00000139644	ENSG00000139644			11723	protein-coding gene	gene with protein product	"""BAX inhibitor 1"""	600748	"""testis enhanced gene transcript"""	TEGT		8530040, 9660918	Standard	NM_001098576		Approved	BI-1, BAXI1	uc001ruy.2	P55061	OTTHUMG00000169652	ENST00000267115.5:c.-31+651A>G	12.37:g.50136045A>G		Somatic	56	1		WXS	Illumina GAIIx	Phase_I	81	10	NM_001098576	0	0	0	0	0	B2R5M4|F8W034|O14938|Q643A7|Q96J50	Silent	SNP	ENST00000267115.5	37	CCDS31797.1																																																																																			.		0.597	TMBIM6-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000405289.1	NM_003217	
KIF5A	3798	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	57976934	57976934	+	Missense_Mutation	SNP	C	C	G			TCGA-OR-A5L2-01A-11D-A30A-10	TCGA-OR-A5L2-10A-01D-A30A-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b99bd79e-aa33-4896-8d10-2517c793f439	48e26b1d-b84d-432b-940b-9907c81ddf5b	g.chr12:57976934C>G	ENST00000455537.2	+	28	3345	c.3071C>G	c.(3070-3072)cCt>cGt	p.P1024R	KIF5A_ENST00000286452.5_Missense_Mutation_p.P935R	NM_004984.2	NP_004975.2	Q12840	KIF5A_HUMAN	kinesin family member 5A	1024	Globular.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell death (GO:0008219)|cytoskeleton-dependent intracellular transport (GO:0030705)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|protein localization (GO:0008104)|synaptic transmission (GO:0007268)	cytosol (GO:0005829)|kinesin complex (GO:0005871)|membrane (GO:0016020)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|motor activity (GO:0003774)|plus-end-directed microtubule motor activity (GO:0008574)			breast(2)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(11)|liver(1)|lung(32)|ovary(2)|prostate(2)|skin(2)	62						AAGCTTTTCCCTCTCCACCAA	0.557											OREG0021947	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.P1024R		.											.	KIF5A-517	0			c.C3071G						.						89.0	65.0	73.0					12																	57976934		2203	4300	6503	SO:0001583	missense	3798	exon28			TTTTCCCTCTCCA	U06698	CCDS8945.1	12q13.13	2011-07-15	2004-02-13			ENSG00000155980		"""Kinesins"""	6323	protein-coding gene	gene with protein product		602821	"""spastic paraplegia 10 (autosomal dominant)"""	SPG10		9858832, 10441583, 16489470	Standard	NM_004984		Approved	D12S1889, NKHC, MY050	uc001sor.1	Q12840	OTTHUMG00000170143	ENST00000455537.2:c.3071C>G	12.37:g.57976934C>G	ENSP00000408979:p.Pro1024Arg	Somatic	90	0	1027	WXS	Illumina GAIIx	Phase_I	130	31	NM_004984	0	0	0	0	0	A6H8M5|Q4LE26	Missense_Mutation	SNP	ENST00000455537.2	37	CCDS8945.1	.	.	.	.	.	.	.	.	.	.	C	14.12	2.440911	0.43326	.	.	ENSG00000155980	ENST00000455537;ENST00000286452;ENST00000547989	T;T	0.73258	-0.73;-0.72	4.79	4.79	0.61399	.	0.132628	0.51477	D	0.000090	T	0.56426	0.1984	N	0.22421	0.69	0.40458	D	0.980214	B;P	0.40476	0.396;0.718	B;B	0.32864	0.064;0.154	T	0.66069	-0.6015	10	0.66056	D	0.02	.	17.8124	0.88620	0.0:1.0:0.0:0.0	.	935;1024	B7Z2M7;Q12840	.;KIF5A_HUMAN	R	1024;935;118	ENSP00000408979:P1024R;ENSP00000286452:P935R	ENSP00000286452:P935R	P	+	2	0	KIF5A	56263201	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	1.766000	0.38491	2.941000	0.99782	0.655000	0.94253	CCT	.		0.557	KIF5A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407634.1	NM_004984	
SYCP3	50511	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	102122734	102122734	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5L2-01A-11D-A30A-10	TCGA-OR-A5L2-10A-01D-A30A-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b99bd79e-aa33-4896-8d10-2517c793f439	48e26b1d-b84d-432b-940b-9907c81ddf5b	g.chr12:102122734G>A	ENST00000392927.3	-	9	813	c.682C>T	c.(682-684)Cgg>Tgg	p.R228W	SYCP3_ENST00000392924.1_Missense_Mutation_p.R228W|CHPT1_ENST00000229266.3_3'UTR|SYCP3_ENST00000266743.2_Missense_Mutation_p.R228W	NM_001177948.1|NM_001177949.1|NM_153694.4	NP_001171419.1|NP_001171420.1|NP_710161.1	Q8IZU3	SYCP3_HUMAN	synaptonemal complex protein 3	228	Gln-rich.				male meiosis I (GO:0007141)|spermatogenesis, exchange of chromosomal proteins (GO:0035093)	chromosome (GO:0005694)|nucleus (GO:0005634)	DNA binding (GO:0003677)			endometrium(2)|kidney(2)|large_intestine(1)|lung(5)|skin(1)	11						AGAGACTTCCGAACACTTGCT	0.303																																					p.R228W		.											.	SYCP3-90	0			c.C682T						.						114.0	111.0	112.0					12																	102122734		2203	4297	6500	SO:0001583	missense	50511	exon9			ACTTCCGAACACT	AF492003, AI075991	CCDS9087.1	12q23.2	2007-02-05			ENSG00000139351	ENSG00000139351			18130	protein-coding gene	gene with protein product		604759				12213195, 10854409	Standard	NM_153694		Approved		uc001tis.3	Q8IZU3	OTTHUMG00000150132	ENST00000392927.3:c.682C>T	12.37:g.102122734G>A	ENSP00000376658:p.Arg228Trp	Somatic	71	0		WXS	Illumina GAIIx	Phase_I	90	20	NM_001177949	0	0	0	0	0		Missense_Mutation	SNP	ENST00000392927.3	37	CCDS9087.1	.	.	.	.	.	.	.	.	.	.	G	19.21	3.782839	0.70222	.	.	ENSG00000139351	ENST00000266743;ENST00000392927;ENST00000392924	.	.	.	5.46	5.46	0.80206	.	0.000000	0.64402	D	0.000001	T	0.59032	0.2164	M	0.79805	2.47	0.80722	D	1	P	0.42757	0.789	B	0.31101	0.124	T	0.70375	-0.4889	9	0.87932	D	0	-2.195	19.2917	0.94102	0.0:0.0:1.0:0.0	.	228	Q8IZU3	SYCP3_HUMAN	W	228	.	ENSP00000266743:R228W	R	-	1	2	SYCP3	100646865	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	8.581000	0.90788	2.557000	0.86248	0.455000	0.32223	CGG	.		0.303	SYCP3-001	KNOWN	alternative_5_UTR|upstream_ATG|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316478.2	NM_153694	
MMAB	326625	broad.mit.edu	37	12	110011235	110011235	+	Silent	SNP	G	G	T			TCGA-OR-A5L2-01A-11D-A30A-10	TCGA-OR-A5L2-10A-01D-A30A-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b99bd79e-aa33-4896-8d10-2517c793f439	48e26b1d-b84d-432b-940b-9907c81ddf5b	g.chr12:110011235G>T	ENST00000545712.2	-	1	444	c.51C>A	c.(49-51)ggC>ggA	p.G17G	MVK_ENST00000539575.1_5'Flank|MVK_ENST00000541384.1_5'Flank|MVK_ENST00000228510.3_5'Flank|MMAB_ENST00000540016.1_Silent_p.G17G|MVK_ENST00000392727.3_5'Flank|MVK_ENST00000535044.1_3'UTR|MMAB_ENST00000266839.5_5'UTR|MVK_ENST00000539696.1_5'Flank	NM_052845.3	NP_443077.1	Q96EY8	MMAB_HUMAN	methylmalonic aciduria (cobalamin deficiency) cblB type	17					cobalamin biosynthetic process (GO:0009236)|cobalamin metabolic process (GO:0009235)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	mitochondrial matrix (GO:0005759)	ATP binding (GO:0005524)|cob(I)yrinic acid a,c-diamide adenosyltransferase activity (GO:0008817)			cervix(1)|kidney(1)|large_intestine(2)|lung(1)|urinary_tract(1)	6					Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)	ACCCGCGCAGGCCAAGACGGC	0.711																																					p.G17G		.											.	MMAB-90	0			c.C51A						.						15.0	17.0	16.0					12																	110011235		2193	4293	6486	SO:0001819	synonymous_variant	326625	exon1			GCGCAGGCCAAGA	AF550404	CCDS9131.1	12q24	2014-07-18	2005-07-11		ENSG00000139428	ENSG00000139428			19331	protein-coding gene	gene with protein product	"""ATP:cob(I)alamin adenosyltransferase"", ""cilia and flagella associated protein 23"""	607568	"""methylmalonic aciduria (cobalamin deficiency) type B"""			12471062, 12514191	Standard	NM_052845		Approved	cblB, CFAP23	uc001tou.3	Q96EY8	OTTHUMG00000169255	ENST00000545712.2:c.51C>A	12.37:g.110011235G>T		Somatic	42	0		WXS	Illumina GAIIx	Phase_I	94	12	NM_052845	0	0	0	0	0	C5HU05|Q9BSH0	Silent	SNP	ENST00000545712.2	37	CCDS9131.1																																																																																			.		0.711	MMAB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403128.2		
LHX5	64211	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	12	113906071	113906071	+	Missense_Mutation	SNP	T	T	C			TCGA-OR-A5L2-01A-11D-A30A-10	TCGA-OR-A5L2-10A-01D-A30A-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b99bd79e-aa33-4896-8d10-2517c793f439	48e26b1d-b84d-432b-940b-9907c81ddf5b	g.chr12:113906071T>C	ENST00000261731.3	-	3	1109	c.536A>G	c.(535-537)aAg>aGg	p.K179R		NM_022363.2	NP_071758.1	Q9H2C1	LHX5_HUMAN	LIM homeobox 5	179					cell proliferation in forebrain (GO:0021846)|cerebellar Purkinje cell differentiation (GO:0021702)|cerebellar Purkinje cell-granule cell precursor cell signaling involved in regulation of granule cell precursor cell proliferation (GO:0021937)|forebrain neuron differentiation (GO:0021879)|hippocampus development (GO:0021766)|positive regulation of transcription, DNA-templated (GO:0045893)|spinal cord association neuron differentiation (GO:0021527)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|zinc ion binding (GO:0008270)			NS(1)|endometrium(2)|large_intestine(1)|lung(4)|prostate(1)|skin(1)	10						GCCGCGCCGCTTGGTGCCCGA	0.667																																					p.K179R		.											.	LHX5-90	0			c.A536G						.						118.0	101.0	107.0					12																	113906071		2203	4300	6503	SO:0001583	missense	64211	exon3			CGCCGCTTGGTGC	AF291181	CCDS9171.1	12q24.13	2014-01-15			ENSG00000089116	ENSG00000089116		"""Homeoboxes / LIM class"""	14216	protein-coding gene	gene with protein product		605992					Standard	NM_022363		Approved		uc001tvj.1	Q9H2C1	OTTHUMG00000169552	ENST00000261731.3:c.536A>G	12.37:g.113906071T>C	ENSP00000261731:p.Lys179Arg	Somatic	173	0		WXS	Illumina GAIIx	Phase_I	268	14	NM_022363	0	0	0	0	0	Q32MA4	Missense_Mutation	SNP	ENST00000261731.3	37	CCDS9171.1	.	.	.	.	.	.	.	.	.	.	T	32	5.105690	0.94292	.	.	ENSG00000089116	ENST00000261731	D	0.95821	-3.82	4.7	4.7	0.59300	Homeodomain-related (1);Homeobox (1);Homeodomain-like (1);	0.000000	0.56097	D	0.000037	D	0.96827	0.8964	L	0.61218	1.895	0.80722	D	1	D	0.89917	1.0	D	0.78314	0.991	D	0.96558	0.9413	10	0.44086	T	0.13	.	14.175	0.65534	0.0:0.0:0.0:1.0	.	179	Q9H2C1	LHX5_HUMAN	R	179	ENSP00000261731:K179R	ENSP00000261731:K179R	K	-	2	0	LHX5	112390454	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	7.999000	0.88496	1.731000	0.51592	0.402000	0.26972	AAG	.		0.667	LHX5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404788.3	NM_022363	
RNFT2	84900	hgsc.bcm.edu	37	12	117187907	117187907	+	Silent	SNP	T	T	C	rs111256849	byFrequency	TCGA-OR-A5L2-01A-11D-A30A-10	TCGA-OR-A5L2-10A-01D-A30A-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b99bd79e-aa33-4896-8d10-2517c793f439	48e26b1d-b84d-432b-940b-9907c81ddf5b	g.chr12:117187907T>C	ENST00000257575.4	+	4	578	c.345T>C	c.(343-345)caT>caC	p.H115H	RNFT2_ENST00000319176.7_Silent_p.H115H|RNFT2_ENST00000407967.3_Silent_p.H115H|RNFT2_ENST00000392549.2_Silent_p.H115H			Q96EX2	RNFT2_HUMAN	ring finger protein, transmembrane 2	115	His-rich.					integral component of membrane (GO:0016021)	zinc ion binding (GO:0008270)			endometrium(1)|large_intestine(3)|lung(1)|urinary_tract(1)	6	all_neural(191;0.117)|Medulloblastoma(191;0.163)			BRCA - Breast invasive adenocarcinoma(302;0.034)		CCCACCACCATTTCCACCATG	0.746													C|||	1284	0.25639	0.4826	0.1326	5008	,	,		12011	0.1786		0.166	False		,,,				2504	0.2117				p.H115H		.											.	.	0			c.T345C						.	C	,	1295,2539		234,827,856	3.0	4.0	4.0		345,345	3.2	1.0	12	dbSNP_132	4	888,6786		67,754,3016	no	coding-synonymous,coding-synonymous	RNFT2	NM_001109903.1,NM_032814.3	,	301,1581,3872	CC,CT,TT		11.5715,33.7767,18.9694	,	115/445,115/421	117187907	2183,9325	1917	3837	5754	SO:0001819	synonymous_variant	84900	exon4			CCACCATTTCCAC	AK027533	CCDS9180.2, CCDS44987.1	12q24.22	2013-01-09	2008-02-26	2008-02-26	ENSG00000135119	ENSG00000135119		"""RING-type (C3HC4) zinc fingers"""	25905	protein-coding gene	gene with protein product			"""transmembrane protein 118"""	TMEM118		12477932	Standard	NM_032814		Approved	FLJ14627	uc009zwn.3	Q96EX2	OTTHUMG00000150882	ENST00000257575.4:c.345T>C	12.37:g.117187907T>C		Somatic	1	0		WXS	Illumina GAIIx	Phase_I	25	14	NM_001109903	0	0	0	0	0	E9PAM7|Q96SU5	Silent	SNP	ENST00000257575.4	37	CCDS44987.1																																																																																			T|0.767;C|0.233		0.746	RNFT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320417.1	NM_032814	
NOS1	4842	broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	117725978	117725978	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5L2-01A-11D-A30A-10	TCGA-OR-A5L2-10A-01D-A30A-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b99bd79e-aa33-4896-8d10-2517c793f439	48e26b1d-b84d-432b-940b-9907c81ddf5b	g.chr12:117725978G>A	ENST00000338101.4	-	4	1032	c.1028C>T	c.(1027-1029)cCt>cTt	p.P343L	NOS1_ENST00000317775.6_Missense_Mutation_p.P343L|NOS1_ENST00000344089.3_Missense_Mutation_p.L362F			Q8WY41	NANO1_HUMAN	nitric oxide synthase 1 (neuronal)	0					cell migration (GO:0016477)|epithelial cell migration (GO:0010631)|negative regulation of translation (GO:0017148)	cytoplasm (GO:0005737)|perinuclear region of cytoplasm (GO:0048471)	RNA binding (GO:0003723)|translation repressor activity (GO:0030371)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(3)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(17)|large_intestine(21)|lung(43)|ovary(3)|pancreas(1)|prostate(6)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	117	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)			BRCA - Breast invasive adenocarcinoma(302;0.0561)		ATGCTGAGAAGGATGCATGAT	0.468																																					p.P343L	Esophageal Squamous(162;1748 2599 51982 52956)	.											.	NOS1-154	0			c.C1028T						.						113.0	110.0	111.0					12																	117725978		1947	4155	6102	SO:0001583	missense	4842	exon5			TGAGAAGGATGCA		CCDS41842.1, CCDS55890.1	12q24.22	2013-09-19			ENSG00000089250	ENSG00000089250	1.14.13.39		7872	protein-coding gene	gene with protein product		163731		NOS		1385308, 7682706	Standard	NM_001204213		Approved	nNOS	uc001twn.2	P29475	OTTHUMG00000137376	ENST00000338101.4:c.1028C>T	12.37:g.117725978G>A	ENSP00000337459:p.Pro343Leu	Somatic	104	1		WXS	Illumina GAIIx	Phase_I	130	61	NM_000620	0	0	0	0	0		Missense_Mutation	SNP	ENST00000338101.4	37	CCDS55890.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	13.54|13.54	2.266753|2.266753	0.40095|0.40095	.|.	.|.	ENSG00000089250|ENSG00000089250	ENST00000344089|ENST00000397605;ENST00000317775;ENST00000541241;ENST00000338101	T|T;T	0.09163|0.40476	3.01|1.03;1.03	5.93|5.93	5.04|5.04	0.67666|0.67666	.|Nitric oxide synthase, oxygenase domain (2);	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.69557|0.69557	0.3124|0.3124	M|M	0.89287|0.89287	3.02|3.02	0.31155|0.31155	N|N	0.704984|0.704984	.|D	.|0.89917	.|1.0	.|D	.|0.97110	.|1.0	T|T	0.76881|0.76881	-0.2795|-0.2795	7|10	0.87932|0.49607	D|T	0|0.09	-9.0806|-9.0806	15.2208|15.2208	0.73310|0.73310	0.0674:0.0:0.9326:0.0|0.0674:0.0:0.9326:0.0	.|.	.|343	.|P29475	.|NOS1_HUMAN	F|L	362|343	ENSP00000339862:L362F|ENSP00000320758:P343L;ENSP00000337459:P343L	ENSP00000339862:L362F|ENSP00000320758:P343L	L|P	-|-	1|2	0|0	NOS1|NOS1	116210361|116210361	1.000000|1.000000	0.71417|0.71417	0.041000|0.041000	0.18516|0.18516	0.121000|0.121000	0.20230|0.20230	7.190000|7.190000	0.77755|0.77755	1.515000|1.515000	0.48885|0.48885	0.563000|0.563000	0.77884|0.77884	CTT|CCT	.		0.468	NOS1-002	NOVEL	basic|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000268053.1		
SRRM4	84530	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	119583269	119583269	+	Silent	SNP	C	C	T	rs201517536		TCGA-OR-A5L2-01A-11D-A30A-10	TCGA-OR-A5L2-10A-01D-A30A-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b99bd79e-aa33-4896-8d10-2517c793f439	48e26b1d-b84d-432b-940b-9907c81ddf5b	g.chr12:119583269C>T	ENST00000267260.4	+	9	1243	c.855C>T	c.(853-855)taC>taT	p.Y285Y		NM_194286.3	NP_919262.2	A7MD48	SRRM4_HUMAN	serine/arginine repetitive matrix 4	285	Ser-rich.				cell differentiation (GO:0030154)|mRNA processing (GO:0006397)|nervous system development (GO:0007399)|regulation of alternative mRNA splicing, via spliceosome (GO:0000381)|regulation of RNA splicing (GO:0043484)|RNA splicing (GO:0008380)|sensory perception of sound (GO:0007605)	nucleus (GO:0005634)	mRNA binding (GO:0003729)			breast(2)|central_nervous_system(2)|endometrium(5)|kidney(1)|large_intestine(2)|lung(8)|ovary(3)|upper_aerodigestive_tract(1)	24						CCCAGGAGTACGACTCAGGAA	0.607													C|||	1	0.000199681	0.0008	0.0	5008	,	,		14485	0.0		0.0	False		,,,				2504	0.0				p.Y285Y		.											.	SRRM4-2	0			c.C855T						.						32.0	36.0	35.0					12																	119583269		2004	4161	6165	SO:0001819	synonymous_variant	84530	exon9			GGAGTACGACTCA	AB058756	CCDS44994.1	12q24.23	2009-09-22	2009-09-21	2009-09-21	ENSG00000139767	ENSG00000139767			29389	protein-coding gene	gene with protein product	"""neural-specific SR-related protein of 100 kDa"""	613103	"""KIAA1853"""	KIAA1853		19737518	Standard	NM_194286		Approved	nSR100	uc001txa.2	A7MD48	OTTHUMG00000168928	ENST00000267260.4:c.855C>T	12.37:g.119583269C>T		Somatic	102	0		WXS	Illumina GAIIx	Phase_I	103	40	NM_194286	0	0	0	0	0	A8K5P6|B2RZH7|Q7Z5F0|Q96JH4	Silent	SNP	ENST00000267260.4	37	CCDS44994.1																																																																																			C|1.000;T|0.000		0.607	SRRM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401640.2	NM_194286	
GCN1L1	10985	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	120589045	120589045	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5L2-01A-11D-A30A-10	TCGA-OR-A5L2-10A-01D-A30A-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b99bd79e-aa33-4896-8d10-2517c793f439	48e26b1d-b84d-432b-940b-9907c81ddf5b	g.chr12:120589045C>T	ENST00000300648.6	-	34	4225	c.4213G>A	c.(4213-4215)Gtg>Atg	p.V1405M		NM_006836.1	NP_006827	Q92616	GCN1L_HUMAN	GCN1 general control of amino-acid synthesis 1-like 1 (yeast)	1405					regulation of translation (GO:0006417)|translation (GO:0006412)	cytoplasm (GO:0005737)|membrane (GO:0016020)|ribosome (GO:0005840)	poly(A) RNA binding (GO:0044822)|translation factor activity, nucleic acid binding (GO:0008135)			NS(2)|breast(2)|cervix(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(13)|liver(1)|lung(36)|ovary(4)|prostate(7)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	94	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)					AGGCCCTTCACCAGGCCCGCC	0.602																																					p.V1405M		.											.	GCN1L1-94	0			c.G4213A						.						50.0	56.0	54.0					12																	120589045		2146	4249	6395	SO:0001583	missense	10985	exon34			CCTTCACCAGGCC	U77700	CCDS41847.1	12q24.2	2008-07-03	2001-11-28						4199	protein-coding gene	gene with protein product		605614	"""GCN1 (general control of amino-acid synthesis 1, yeast)-like 1"""			9234705	Standard	NM_006836		Approved	KIAA0219, GCN1, GCN1L	uc001txo.3	Q92616	OTTHUMG00000169338	ENST00000300648.6:c.4213G>A	12.37:g.120589045C>T	ENSP00000300648:p.Val1405Met	Somatic	105	0		WXS	Illumina GAIIx	Phase_I	101	15	NM_006836	0	0	0	0	0	A8KAY1|O95001|O95651|Q6P2S3|Q86X65|Q8N5I5|Q8WU80|Q99736|Q9UE60	Missense_Mutation	SNP	ENST00000300648.6	37	CCDS41847.1	.	.	.	.	.	.	.	.	.	.	C	21.4	4.144788	0.77888	.	.	ENSG00000089154	ENST00000300648	T	0.66638	-0.22	5.28	5.28	0.74379	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	D	0.84727	0.5536	M	0.91972	3.26	0.80722	D	1	D	0.64830	0.994	P	0.61328	0.887	D	0.88388	0.3006	10	0.87932	D	0	-21.2775	18.9124	0.92491	0.0:1.0:0.0:0.0	.	1405	Q92616	GCN1L_HUMAN	M	1405	ENSP00000300648:V1405M	ENSP00000300648:V1405M	V	-	1	0	GCN1L1	119073428	1.000000	0.71417	1.000000	0.80357	0.488000	0.33401	7.583000	0.82559	2.490000	0.84030	0.561000	0.74099	GTG	.		0.602	GCN1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403592.1		
CLIP1	6249	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	122812908	122812908	+	Missense_Mutation	SNP	C	C	G			TCGA-OR-A5L2-01A-11D-A30A-10	TCGA-OR-A5L2-10A-01D-A30A-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b99bd79e-aa33-4896-8d10-2517c793f439	48e26b1d-b84d-432b-940b-9907c81ddf5b	g.chr12:122812908C>G	ENST00000540338.1	-	15	2974	c.2933G>C	c.(2932-2934)aGt>aCt	p.S978T	CLIP1_ENST00000537178.1_Missense_Mutation_p.S932T|CLIP1_ENST00000302528.7_Missense_Mutation_p.S967T|CLIP1_ENST00000358808.2_Missense_Mutation_p.S967T|CLIP1_ENST00000361654.4_Missense_Mutation_p.S856T|CLIP1_ENST00000545889.1_Missense_Mutation_p.S553T			P30622	CLIP1_HUMAN	CAP-GLY domain containing linker protein 1	978					microtubule bundle formation (GO:0001578)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|positive regulation of microtubule polymerization (GO:0031116)|transport (GO:0006810)	cell projection (GO:0042995)|centrosome (GO:0005813)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|endosome (GO:0005768)|intermediate filament (GO:0005882)|kinetochore (GO:0000776)|membrane (GO:0016020)|microtubule (GO:0005874)|microtubule cytoskeleton (GO:0015630)	metal ion binding (GO:0046872)|microtubule binding (GO:0008017)|microtubule plus-end binding (GO:0051010)|nucleic acid binding (GO:0003676)|protein homodimerization activity (GO:0042803)|tubulin binding (GO:0015631)|zinc ion binding (GO:0008270)			NS(1)|breast(5)|endometrium(4)|kidney(5)|large_intestine(16)|liver(1)|lung(21)|ovary(2)|prostate(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	60	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;1.81e-05)|Epithelial(86;6.85e-05)|BRCA - Breast invasive adenocarcinoma(302;0.226)		GTCCTCAATACTTTTTTGCAG	0.358																																					p.S978T		.											.	CLIP1-155	0			c.G2933C						.						133.0	132.0	132.0					12																	122812908		2203	4300	6503	SO:0001583	missense	6249	exon16			TCAATACTTTTTT		CCDS9232.1, CCDS9233.1, CCDS58285.1	12q24.3	2013-01-17	2007-01-05	2007-01-05	ENSG00000130779	ENSG00000130779			10461	protein-coding gene	gene with protein product	"""restin"""	179838	"""restin (Reed-Steinberg cell-expressed intermediate filament-associated protein)"""	RSN		8222754	Standard	NM_001247997		Approved	CYLN1, CLIP170, CLIP, CLIP-170	uc001ucg.2	P30622	OTTHUMG00000168922	ENST00000540338.1:c.2933G>C	12.37:g.122812908C>G	ENSP00000439093:p.Ser978Thr	Somatic	50	0		WXS	Illumina GAIIx	Phase_I	71	14	NM_001247997	0	0	0	0	0	A0AVD3|Q17RS4|Q29RG0	Missense_Mutation	SNP	ENST00000540338.1	37	CCDS58285.1	.	.	.	.	.	.	.	.	.	.	C	10.44	1.349491	0.24426	.	.	ENSG00000130779	ENST00000545889;ENST00000302528;ENST00000358808;ENST00000542885;ENST00000392458;ENST00000537178;ENST00000540338	T;T;T;T;T	0.78481	2.71;-1.18;-1.18;0.7;0.71	5.32	2.31	0.28768	.	0.440622	0.27072	N	0.021063	T	0.60779	0.2295	L	0.31294	0.92	0.25087	N	0.990884	B;B;B	0.06786	0.001;0.001;0.0	B;B;B	0.12837	0.008;0.008;0.004	T	0.48175	-0.9058	10	0.38643	T	0.18	-3.9354	4.075	0.09899	0.0:0.4854:0.1685:0.3461	.	932;967;978	P30622-2;P30622-1;P30622	.;.;CLIP1_HUMAN	T	553;967;967;697;9;932;978	ENSP00000438743:S553T;ENSP00000303585:S967T;ENSP00000351665:S967T;ENSP00000445531:S932T;ENSP00000439093:S978T	ENSP00000303585:S967T	S	-	2	0	CLIP1	121378861	0.141000	0.22595	0.994000	0.49952	0.823000	0.46562	0.016000	0.13377	0.737000	0.32582	0.561000	0.74099	AGT	.		0.358	CLIP1-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000401625.1	NM_002956	
RIMBP2	23504	hgsc.bcm.edu	37	12	130921471	130921471	+	Silent	SNP	T	T	C	rs2292663	byFrequency	TCGA-OR-A5L2-01A-11D-A30A-10	TCGA-OR-A5L2-10A-01D-A30A-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b99bd79e-aa33-4896-8d10-2517c793f439	48e26b1d-b84d-432b-940b-9907c81ddf5b	g.chr12:130921471T>C	ENST00000261655.4	-	10	2134	c.1971A>G	c.(1969-1971)ccA>ccG	p.P657P	RIMBP2_ENST00000535703.1_Silent_p.P565P|RIMBP2_ENST00000536002.1_Silent_p.P565P	NM_015347.4	NP_056162.4	O15034	RIMB2_HUMAN	RIMS binding protein 2	657	Pro-rich.				negative regulation of phosphatase activity (GO:0010923)	cell junction (GO:0030054)|plasma membrane (GO:0005886)|synapse (GO:0045202)				NS(2)|breast(1)|central_nervous_system(5)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(23)|lung(33)|ovary(3)|pancreas(1)|prostate(3)|skin(6)|upper_aerodigestive_tract(5)|urinary_tract(1)	96	all_neural(191;0.101)|Medulloblastoma(191;0.163)	all_epithelial(31;0.213)		OV - Ovarian serous cystadenocarcinoma(86;4.29e-06)|all cancers(50;4.56e-05)|Epithelial(86;5.41e-05)		CCTGTGGCTGTGGCAGGATGC	0.736													C|||	734	0.146565	0.1657	0.1599	5008	,	,		11830	0.256		0.1054	False		,,,				2504	0.0409				p.P657P		.											.	RIMBP2-142	0			c.A1971G						.	C		577,3799		41,495,1652	12.0	18.0	16.0		1971	-0.1	1.0	12	dbSNP_100	16	861,7691		48,765,3463	no	coding-synonymous	RIMBP2	NM_015347.4		89,1260,5115	CC,CT,TT		10.0678,13.1856,11.1231		657/1053	130921471	1438,11490	2188	4276	6464	SO:0001819	synonymous_variant	23504	exon10			TGGCTGTGGCAGG	AB002316	CCDS31925.1	12q24.33	2014-06-13				ENSG00000060709			30339	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 133"""	611602				10748113	Standard	NM_015347		Approved	KIAA0318, RBP2, MGC15831, RIM-BP2, PPP1R133	uc001uil.2	O15034		ENST00000261655.4:c.1971A>G	12.37:g.130921471T>C		Somatic	2	0		WXS	Illumina GAIIx	Phase_I	86	49	NM_015347	0	0	0	0	0	Q96ID2	Silent	SNP	ENST00000261655.4	37	CCDS31925.1																																																																																			T|0.868;C|0.132		0.736	RIMBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399520.1	NM_015347	
GSX1	219409	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	13	28367932	28367932	+	Silent	SNP	C	C	T			TCGA-OR-A5L2-01A-11D-A30A-10	TCGA-OR-A5L2-10A-01D-A30A-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b99bd79e-aa33-4896-8d10-2517c793f439	48e26b1d-b84d-432b-940b-9907c81ddf5b	g.chr13:28367932C>T	ENST00000302945.2	+	2	690	c.642C>T	c.(640-642)ggC>ggT	p.G214G		NM_145657.1	NP_663632.1	Q9H4S2	GSX1_HUMAN	GS homeobox 1	214	Poly-Gly.				adenohypophysis development (GO:0021984)|hypothalamus development (GO:0021854)|neuron fate commitment (GO:0048663)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|spinal cord association neuron differentiation (GO:0021527)	nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding (GO:0043565)			endometrium(1)|large_intestine(1)|lung(1)|ovary(1)	4		Lung SC(185;0.0161)	Colorectal(13;0.000157)|READ - Rectum adenocarcinoma(15;0.105)	GBM - Glioblastoma multiforme(144;0.0402)|all cancers(112;0.0404)|OV - Ovarian serous cystadenocarcinoma(117;0.197)		ATCgtggcggcggcggcgggg	0.632																																					p.G214G		.											.	GSX1-69	0			c.C642T						.						36.0	37.0	36.0					13																	28367932		2203	4300	6503	SO:0001819	synonymous_variant	219409	exon2			TGGCGGCGGCGGC	AB044157	CCDS9326.1	13q12.2	2012-03-09		2007-07-26	ENSG00000169840	ENSG00000169840		"""Homeoboxes / ANTP class : HOXL subclass"""	20374	protein-coding gene	gene with protein product				GSH1			Standard	NM_145657		Approved	Gsh-1	uc001urr.1	Q9H4S2	OTTHUMG00000016637	ENST00000302945.2:c.642C>T	13.37:g.28367932C>T		Somatic	98	1		WXS	Illumina GAIIx	Phase_I	180	80	NM_145657	0	0	0	0	0	Q9UD62	Silent	SNP	ENST00000302945.2	37	CCDS9326.1																																																																																			.		0.632	GSX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044309.2	NM_145657	
TEP1	7011	hgsc.bcm.edu;broad.mit.edu	37	14	20869174	20869174	+	Frame_Shift_Del	DEL	C	C	-			TCGA-OR-A5L2-01A-11D-A30A-10	TCGA-OR-A5L2-10A-01D-A30A-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b99bd79e-aa33-4896-8d10-2517c793f439	48e26b1d-b84d-432b-940b-9907c81ddf5b	g.chr14:20869174delC	ENST00000262715.5	-	9	1558	c.1518delG	c.(1516-1518)gggfs	p.G506fs	TEP1_ENST00000556935.1_Frame_Shift_Del_p.G398fs	NM_007110.4	NP_009041.2	Q99973	TEP1_HUMAN	telomerase-associated protein 1	506	TROVE. {ECO:0000255|PROSITE- ProRule:PRU00343}.				RNA-dependent DNA replication (GO:0006278)|telomere maintenance via recombination (GO:0000722)	chromosome, telomeric region (GO:0000781)|cytoplasm (GO:0005737)|nuclear matrix (GO:0016363)|ribonucleoprotein complex (GO:0030529)|telomerase holoenzyme complex (GO:0005697)	ATP binding (GO:0005524)|RNA binding (GO:0003723)			NS(4)|breast(1)|central_nervous_system(4)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(9)|lung(48)|ovary(7)|pancreas(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	96	all_cancers(95;0.00123)	all_lung(585;0.235)	Epithelial(56;7.42e-08)|all cancers(55;6.46e-07)	GBM - Glioblastoma multiforme(265;0.028)|READ - Rectum adenocarcinoma(17;0.233)		ACGCTTTGTTCCCCCGTAGGC	0.552																																					p.G506fs		.											.	TEP1-95	0			c.1518delG						.						144.0	117.0	126.0					14																	20869174		2203	4300	6503	SO:0001589	frameshift_variant	7011	exon9			TTTGTTCCCCCGT		CCDS9548.1	14q11.2	2013-01-10			ENSG00000129566	ENSG00000129566		"""WD repeat domain containing"""	11726	protein-coding gene	gene with protein product	"""TROVE domain family, member 1"""	601686				9403057	Standard	NM_007110		Approved	TP1, TLP1, VAULT2, p240, TROVE1	uc001vxe.3	Q99973	OTTHUMG00000029515	ENST00000262715.5:c.1518delG	14.37:g.20869174delC	ENSP00000262715:p.Gly506fs	Somatic	144	0		WXS	Illumina GAIIx	Phase_I	221	13	NM_007110	0	0	0	0	0	A0AUV9	Frame_Shift_Del	DEL	ENST00000262715.5	37	CCDS9548.1																																																																																			.		0.552	TEP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000073563.2	NM_007110	
CEBPE	1053	broad.mit.edu	37	14	23588089	23588089	+	Missense_Mutation	SNP	C	C	A			TCGA-OR-A5L2-01A-11D-A30A-10	TCGA-OR-A5L2-10A-01D-A30A-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b99bd79e-aa33-4896-8d10-2517c793f439	48e26b1d-b84d-432b-940b-9907c81ddf5b	g.chr14:23588089C>A	ENST00000206513.5	-	1	736	c.212G>T	c.(211-213)gGc>gTc	p.G71V		NM_001805.3	NP_001796.2	Q15744	CEBPE_HUMAN	CCAAT/enhancer binding protein (C/EBP), epsilon	71					cellular response to lipopolysaccharide (GO:0071222)|cytokine biosynthetic process (GO:0042089)|defense response (GO:0006952)|defense response to bacterium (GO:0042742)|macrophage differentiation (GO:0030225)|phagocytosis (GO:0006909)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			large_intestine(2)|lung(3)|ovary(2)|prostate(1)|skin(1)	9	all_cancers(95;4.6e-05)			GBM - Glioblastoma multiforme(265;0.0064)		GGTTCCGGGGCCCTTGAGGCC	0.647																																					p.G71V	NSCLC(63;1230 1818 14565 22565)	.											.	CEBPE-92	0			c.G212T						.						36.0	40.0	38.0					14																	23588089		2203	4300	6503	SO:0001583	missense	1053	exon1			CCGGGGCCCTTGA		CCDS9589.1	14q11.2	2014-09-17			ENSG00000092067	ENSG00000092067		"""basic leucine zipper proteins"""	1836	protein-coding gene	gene with protein product		600749				8661101	Standard	NM_001805		Approved	CRP1	uc001wiv.2	Q15744	OTTHUMG00000028719	ENST00000206513.5:c.212G>T	14.37:g.23588089C>A	ENSP00000206513:p.Gly71Val	Somatic	63	0		WXS	Illumina GAIIx	Phase_I	90	9	NM_001805	0	0	0	0	0	Q15745|Q8IYI2|Q99803	Missense_Mutation	SNP	ENST00000206513.5	37	CCDS9589.1	.	.	.	.	.	.	.	.	.	.	C	14.58	2.576903	0.45902	.	.	ENSG00000092067	ENST00000206513	T	0.33216	1.42	4.36	2.43	0.29744	.	0.279884	0.25619	N	0.029421	T	0.44767	0.1309	L	0.58810	1.83	0.58432	D	0.999996	D	0.69078	0.997	D	0.68765	0.96	T	0.15954	-1.0419	10	0.30078	T	0.28	-11.4505	9.6677	0.39994	0.159:0.6875:0.1535:0.0	.	71	Q15744	CEBPE_HUMAN	V	71	ENSP00000206513:G71V	ENSP00000206513:G71V	G	-	2	0	CEBPE	22657929	0.978000	0.34361	0.546000	0.28166	0.803000	0.45373	1.387000	0.34430	0.406000	0.25560	0.561000	0.74099	GGC	.		0.647	CEBPE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000071716.2	NM_001805	
SAMD4A	23034	hgsc.bcm.edu	37	14	55227103	55227103	+	Silent	SNP	C	C	T	rs12879706	byFrequency	TCGA-OR-A5L2-01A-11D-A30A-10	TCGA-OR-A5L2-10A-01D-A30A-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b99bd79e-aa33-4896-8d10-2517c793f439	48e26b1d-b84d-432b-940b-9907c81ddf5b	g.chr14:55227103C>T	ENST00000554335.1	+	7	2064	c.1401C>T	c.(1399-1401)gcC>gcT	p.A467A	SAMD4A_ENST00000555192.1_Silent_p.A58A|SAMD4A_ENST00000357634.3_Silent_p.A466A|SAMD4A_ENST00000392067.3_Silent_p.A467A|SAMD4A_ENST00000251091.5_Silent_p.A379A			Q9UPU9	SMAG1_HUMAN	sterile alpha motif domain containing 4A	467					negative regulation of translation (GO:0017148)|positive regulation of translation (GO:0045727)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|neuron projection (GO:0043005)|synapse (GO:0045202)	poly(A) RNA binding (GO:0044822)|translation repressor activity (GO:0030371)			breast(2)|central_nervous_system(2)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(9)|lung(10)|prostate(1)|skin(1)	29						CGGCCGGGGCCAGCGGGGGGC	0.751													C|||	109	0.0217652	0.0038	0.036	5008	,	,		10140	0.001		0.0527	False		,,,				2504	0.0256				p.A467A		.											.	SAMD4A-90	0			c.C1401T						.	C	,,	26,3040		0,26,1507	3.0	5.0	4.0		1134,174,1398	2.5	1.0	14	dbSNP_121	4	374,6284		6,362,2961	no	coding-synonymous,coding-synonymous,coding-synonymous	SAMD4A	NM_001161576.2,NM_001161577.1,NM_015589.5	,,	6,388,4468	TT,TC,CC		5.6173,0.848,4.1135	,,	378/630,58/346,466/718	55227103	400,9324	1533	3329	4862	SO:0001819	synonymous_variant	23034	exon6			CGGGGCCAGCGGG	AB028976	CCDS32084.1, CCDS55917.1, CCDS55918.1, CCDS32084.2, CCDS55917.2	14q22.2	2013-01-10	2006-01-27	2006-01-27	ENSG00000020577	ENSG00000020577		"""Sterile alpha motif (SAM) domain containing"""	23023	protein-coding gene	gene with protein product	"""smaug homolog (Drosophila)"""	610747	"""sterile alpha motif domain containing 4"""	SAMD4		16221671	Standard	NM_001161577		Approved	KIAA1053, DKFZP434H0350, Smaug, SMG, SMGA, hSmaug1	uc001xbb.4	Q9UPU9	OTTHUMG00000170999	ENST00000554335.1:c.1401C>T	14.37:g.55227103C>T		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	5	5	NM_015589	0	0	0	0	0	A8MPZ5|Q0VA96|Q6PEW4	Silent	SNP	ENST00000554335.1	37	CCDS32084.2																																																																																			C|0.973;T|0.027		0.751	SAMD4A-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000411186.1	NM_015589	
ALKBH1	8846	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	14	78161095	78161095	+	Missense_Mutation	SNP	G	G	T			TCGA-OR-A5L2-01A-11D-A30A-10	TCGA-OR-A5L2-10A-01D-A30A-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b99bd79e-aa33-4896-8d10-2517c793f439	48e26b1d-b84d-432b-940b-9907c81ddf5b	g.chr14:78161095G>T	ENST00000216489.3	-	3	456	c.441C>A	c.(439-441)agC>agA	p.S147R	ALKBH1_ENST00000554097.1_5'UTR	NM_006020.2	NP_006011.2	Q13686	ALKB1_HUMAN	alkB, alkylation repair homolog 1 (E. coli)	147					developmental growth (GO:0048589)|DNA catabolic process, endonucleolytic (GO:0000737)|DNA dealkylation involved in DNA repair (GO:0006307)|DNA demethylation (GO:0080111)|DNA repair (GO:0006281)|in utero embryonic development (GO:0001701)|negative regulation of neuron apoptotic process (GO:0043524)|neuron migration (GO:0001764)|neuron projection development (GO:0031175)|oxidative demethylation (GO:0070989)|placenta development (GO:0001890)|RNA repair (GO:0042245)	mitochondrion (GO:0005739)|nuclear euchromatin (GO:0005719)	chemoattractant activity (GO:0042056)|DNA-(apurinic or apyrimidinic site) lyase activity (GO:0003906)|ferrous iron binding (GO:0008198)|methylcytosine dioxygenase activity (GO:0070579)			endometrium(2)|lung(4)|ovary(1)|prostate(1)|skin(1)	9			Kidney(204;0.164)	BRCA - Breast invasive adenocarcinoma(234;0.0291)		GGAACTCTTTGCTCTGTTCCC	0.403																																					p.S147R		.											.	ALKBH1-228	0			c.C441A						.						202.0	199.0	200.0					14																	78161095		2203	4300	6503	SO:0001583	missense	8846	exon3			CTCTTTGCTCTGT	X91992	CCDS32127.1	14q24	2014-07-23	2006-02-09	2006-02-09	ENSG00000100601	ENSG00000100601		"""Alkylation repair homologs"""	17911	protein-coding gene	gene with protein product		605345	"""alkB, alkylation repair homolog (E. coli)"""	ALKBH		8600462	Standard	XM_005268165		Approved	hABH, alkB, ABH	uc001xuc.1	Q13686	OTTHUMG00000171542	ENST00000216489.3:c.441C>A	14.37:g.78161095G>T	ENSP00000216489:p.Ser147Arg	Somatic	72	0		WXS	Illumina GAIIx	Phase_I	77	6	NM_006020	0	0	0	0	0	Q8TAU1|Q9ULA7	Missense_Mutation	SNP	ENST00000216489.3	37	CCDS32127.1	.	.	.	.	.	.	.	.	.	.	G	14.12	2.440762	0.43326	.	.	ENSG00000100601	ENST00000216489	T	0.32753	1.44	6.17	3.1	0.35709	.	0.000000	0.85682	D	0.000000	T	0.45135	0.1327	L	0.56280	1.765	0.58432	D	0.999991	D	0.89917	1.0	D	0.91635	0.999	T	0.19778	-1.0295	10	0.26408	T	0.33	-27.5885	9.9345	0.41543	0.2775:0.0:0.7225:0.0	.	147	Q13686	ALKB1_HUMAN	R	147	ENSP00000216489:S147R	ENSP00000216489:S147R	S	-	3	2	ALKBH1	77230848	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	1.082000	0.30803	0.804000	0.34136	0.655000	0.94253	AGC	.		0.403	ALKBH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414037.1	NM_006020	
SNW1	22938	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	14	78205323	78205323	+	Nonsense_Mutation	SNP	C	C	A			TCGA-OR-A5L2-01A-11D-A30A-10	TCGA-OR-A5L2-10A-01D-A30A-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b99bd79e-aa33-4896-8d10-2517c793f439	48e26b1d-b84d-432b-940b-9907c81ddf5b	g.chr14:78205323C>A	ENST00000261531.7	-	4	474	c.412G>T	c.(412-414)Gaa>Taa	p.E138*	SNW1_ENST00000554775.1_Intron|SLIRP_ENST00000557431.1_Intron|SNW1_ENST00000555761.1_Nonsense_Mutation_p.E138*	NM_012245.2	NP_036377.1	Q13573	SNW1_HUMAN	SNW domain containing 1	138					cellular response to retinoic acid (GO:0071300)|gene expression (GO:0010467)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mRNA splicing, via spliceosome (GO:0000398)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|Notch signaling pathway (GO:0007219)|positive regulation by host of viral transcription (GO:0043923)|positive regulation of histone H3-K4 methylation (GO:0051571)|positive regulation of mRNA splicing, via spliceosome (GO:0048026)|positive regulation of neurogenesis (GO:0050769)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|positive regulation of vitamin D receptor signaling pathway (GO:0070564)|regulation of retinoic acid receptor signaling pathway (GO:0048385)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of vitamin D receptor signaling pathway (GO:0070562)|retinoic acid receptor signaling pathway (GO:0048384)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	catalytic step 2 spliceosome (GO:0071013)|chromatin (GO:0000785)|nuclear matrix (GO:0016363)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)	Notch binding (GO:0005112)|nuclear hormone receptor binding (GO:0035257)|poly(A) RNA binding (GO:0044822)|retinoic acid receptor binding (GO:0042974)|SMAD binding (GO:0046332)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)|vitamin D receptor binding (GO:0042809)			NS(1)|endometrium(3)|kidney(3)|large_intestine(6)|lung(6)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	24			Kidney(204;0.164)	BRCA - Breast invasive adenocarcinoma(234;0.0291)		TTAATAGCTTCTTCATCGGGC	0.363																																					p.E138X		.											.	SNW1-187	0			c.G412T						.						278.0	295.0	289.0					14																	78205323		2203	4300	6503	SO:0001587	stop_gained	22938	exon4			TAGCTTCTTCATC	AF045184	CCDS9867.1	14q22.1-q22.3	2005-09-13	2005-09-13	2005-09-13		ENSG00000100603			16696	protein-coding gene	gene with protein product		603055	"""SKI interacting protein"""	SKIIP		8973337, 9632709	Standard	NM_012245		Approved	NCoA-62, SKIP, Prp45, PRPF45, Bx42	uc001xuf.3	Q13573		ENST00000261531.7:c.412G>T	14.37:g.78205323C>A	ENSP00000261531:p.Glu138*	Somatic	134	0		WXS	Illumina GAIIx	Phase_I	143	13	NM_012245	0	0	0	0	0	A8K8A9|Q13483|Q32N03|Q5D0D6	Nonsense_Mutation	SNP	ENST00000261531.7	37	CCDS9867.1	.	.	.	.	.	.	.	.	.	.	C	25.9	4.680715	0.88542	.	.	ENSG00000100603	ENST00000261531;ENST00000555761;ENST00000416259;ENST00000554324	.	.	.	5.63	5.63	0.86233	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.42905	T	0.14	.	19.6779	0.95945	0.0:1.0:0.0:0.0	.	.	.	.	X	138	.	ENSP00000261531:E138X	E	-	1	0	SNW1	77275076	1.000000	0.71417	1.000000	0.80357	0.930000	0.56654	7.445000	0.80570	2.656000	0.90262	0.460000	0.39030	GAA	.		0.363	SNW1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000413912.1	NM_012245	
DYNC1H1	1778	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	14	102484794	102484794	+	Silent	SNP	G	G	A			TCGA-OR-A5L2-01A-11D-A30A-10	TCGA-OR-A5L2-10A-01D-A30A-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b99bd79e-aa33-4896-8d10-2517c793f439	48e26b1d-b84d-432b-940b-9907c81ddf5b	g.chr14:102484794G>A	ENST00000360184.4	+	41	8348	c.8184G>A	c.(8182-8184)ctG>ctA	p.L2728L		NM_001376.4	NP_001367.2	Q14204	DYHC1_HUMAN	dynein, cytoplasmic 1, heavy chain 1	2728	AAA 3. {ECO:0000250}.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|cell death (GO:0008219)|cytoplasmic mRNA processing body assembly (GO:0033962)|G2/M transition of mitotic cell cycle (GO:0000086)|microtubule-based movement (GO:0007018)|mitotic cell cycle (GO:0000278)|mitotic spindle organization (GO:0007052)|stress granule assembly (GO:0034063)|transport (GO:0006810)	centrosome (GO:0005813)|cytoplasmic dynein complex (GO:0005868)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|membrane (GO:0016020)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|poly(A) RNA binding (GO:0044822)			NS(1)|biliary_tract(1)|breast(4)|central_nervous_system(5)|cervix(1)|endometrium(21)|haematopoietic_and_lymphoid_tissue(3)|kidney(10)|large_intestine(28)|lung(60)|ovary(9)|pancreas(1)|prostate(6)|skin(7)|stomach(3)|upper_aerodigestive_tract(4)|urinary_tract(2)	166						ACAGGTTCCTGCGCCACGTGC	0.657																																					p.L2728L		.											.	DYNC1H1-98	0			c.G8184A						.						72.0	53.0	60.0					14																	102484794		2203	4300	6503	SO:0001819	synonymous_variant	1778	exon41			GTTCCTGCGCCAC	AB002323	CCDS9966.1	14q32.31	2006-12-21	2005-11-24	2005-11-24		ENSG00000197102		"""Cytoplasmic dyneins"""	2961	protein-coding gene	gene with protein product		600112	"""dynein, cytoplasmic, heavy polypeptide 1"""	DNECL, DNCL, DNCH1		16260502, 8666668	Standard	NM_001376		Approved	Dnchc1, HL-3, p22, DHC1	uc001yks.2	Q14204		ENST00000360184.4:c.8184G>A	14.37:g.102484794G>A		Somatic	79	0		WXS	Illumina GAIIx	Phase_I	79	7	NM_001376	0	0	0	0	0	B0I1R0|Q6DKQ7|Q8WU28|Q92814|Q9Y4G5	Silent	SNP	ENST00000360184.4	37	CCDS9966.1																																																																																			.		0.657	DYNC1H1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414574.1	NM_001376	
CDC42BPB	9578	bcgsc.ca	37	14	103447136	103447136	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5L2-01A-11D-A30A-10	TCGA-OR-A5L2-10A-01D-A30A-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b99bd79e-aa33-4896-8d10-2517c793f439	48e26b1d-b84d-432b-940b-9907c81ddf5b	g.chr14:103447136C>T	ENST00000361246.2	-	8	1402	c.1114G>A	c.(1114-1116)Gtg>Atg	p.V372M		NM_006035.3	NP_006026.3			CDC42 binding protein kinase beta (DMPK-like)											NS(1)|breast(4)|central_nervous_system(1)|endometrium(6)|kidney(3)|large_intestine(11)|liver(1)|lung(14)|ovary(2)|prostate(2)|skin(3)|stomach(1)	49		Melanoma(154;0.155)		Colorectal(3;0.0129)|READ - Rectum adenocarcinoma(2;0.0419)|Epithelial(152;0.0474)|all cancers(159;0.199)		TCGTCATCCACGTCGAAGTTG	0.493																																					p.V372M		.											.	CDC42BPB-581	0			c.G1114A						.						112.0	90.0	98.0					14																	103447136		2203	4300	6503	SO:0001583	missense	9578	exon8			CATCCACGTCGAA	AF128625	CCDS9978.1	14q32.32	2010-05-12	2001-11-28		ENSG00000198752	ENSG00000198752			1738	protein-coding gene	gene with protein product		614062	"""CDC42-binding protein kinase beta (DMPK-like)"""			10198171	Standard	NM_006035		Approved	MRCKB, KIAA1124	uc001ymi.1	Q9Y5S2		ENST00000361246.2:c.1114G>A	14.37:g.103447136C>T	ENSP00000355237:p.Val372Met	Somatic	149	0		WXS	Illumina GAIIx	Phase_I	166	8	NM_006035	0	0	0	0	0		Missense_Mutation	SNP	ENST00000361246.2	37	CCDS9978.1	.	.	.	.	.	.	.	.	.	.	C	25.2	4.617961	0.87359	.	.	ENSG00000198752	ENST00000361246	T	0.40225	1.04	5.41	5.41	0.78517	Protein kinase, C-terminal (1);AGC-kinase, C-terminal (2);	0.000000	0.85682	D	0.000000	T	0.65780	0.2724	M	0.84082	2.675	0.80722	D	1	D	0.76494	0.999	P	0.59171	0.853	T	0.71606	-0.4542	10	0.87932	D	0	.	19.193	0.93675	0.0:1.0:0.0:0.0	.	372	Q9Y5S2	MRCKB_HUMAN	M	372	ENSP00000355237:V372M	ENSP00000355237:V372M	V	-	1	0	CDC42BPB	102516889	1.000000	0.71417	0.998000	0.56505	0.652000	0.38707	7.792000	0.85828	2.562000	0.86427	0.655000	0.94253	GTG	.		0.493	CDC42BPB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000415711.1	NM_006035	
EXOC3L4	91828	hgsc.bcm.edu	37	14	103568729	103568729	+	Silent	SNP	A	A	G	rs10142200	byFrequency	TCGA-OR-A5L2-01A-11D-A30A-10	TCGA-OR-A5L2-10A-01D-A30A-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b99bd79e-aa33-4896-8d10-2517c793f439	48e26b1d-b84d-432b-940b-9907c81ddf5b	g.chr14:103568729A>G	ENST00000380069.3	+	2	745	c.669A>G	c.(667-669)gaA>gaG	p.E223E		NM_001077594.1	NP_001071062.1	Q17RC7	EX3L4_HUMAN	exocyst complex component 3-like 4	223					exocytosis (GO:0006887)	exocyst (GO:0000145)				cervix(2)|endometrium(2)|lung(4)|ovary(1)|skin(1)	10						CGGAGGAGGAAGCCCACCCTT	0.756													G|||	2646	0.528355	0.5666	0.5303	5008	,	,		12079	0.6042		0.3917	False		,,,				2504	0.5378				p.E223E		.											.	EXOC3L4-23	0			c.A669G						.	G		2098,2000		603,892,554	5.0	5.0	5.0		669	2.5	0.8	14	dbSNP_119	5	2949,5055		663,1623,1716	no	coding-synonymous	EXOC3L4	NM_001077594.1		1266,2515,2270	GG,GA,AA		36.8441,48.8043,41.7039		223/723	103568729	5047,7055	2049	4002	6051	SO:0001819	synonymous_variant	91828	exon2			GGAGGAAGCCCAC	AK000671	CCDS32163.1	14q32.32	2011-01-31	2011-01-31	2011-01-31	ENSG00000205436	ENSG00000205436			20120	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 73"""	C14orf73			Standard	NM_001077594		Approved		uc001ymk.3	Q17RC7		ENST00000380069.3:c.669A>G	14.37:g.103568729A>G		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	9	9	NM_001077594	0	0	0	0	0	Q14CR2	Silent	SNP	ENST00000380069.3	37	CCDS32163.1																																																																																			A|0.486;G|0.514		0.756	EXOC3L4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000415663.1	XM_941093	
C14orf180	400258	hgsc.bcm.edu	37	14	105055119	105055127	+	Stop_Codon_Del	DEL	GACGGGCAG	GACGGGCAG	-	rs111285011|rs569942489|rs11278058	byFrequency	TCGA-OR-A5L2-01A-11D-A30A-10	TCGA-OR-A5L2-10A-01D-A30A-10	GACGGGCAG	GACGGGCAG	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b99bd79e-aa33-4896-8d10-2517c793f439	48e26b1d-b84d-432b-940b-9907c81ddf5b	g.chr14:105055119_105055127delGACGGGCAG	ENST00000557649.1	+	0	818_826				C14orf180_ENST00000410013.1_Stop_Codon_Del|C14orf180_ENST00000331952.2_In_Frame_Del_p.TGR153del|RP11-614O9.1_ENST00000556073.1_RNA			Q8N912	NRAC_HUMAN	chromosome 14 open reading frame 180							integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)							Melanoma(154;0.226)	all cancers(16;0.00405)|OV - Ovarian serous cystadenocarcinoma(23;0.0319)|Epithelial(46;0.0784)|GBM - Glioblastoma multiforme(11;0.116)	Epithelial(152;0.127)		CTGCGGCTCTgacgggcaggacgggcagg	0.718														3012	0.601438	0.8079	0.6095	5008	,	,		14598	0.6954		0.4235	False		,,,				2504	0.4029				p.161_161del		.											.	C14orf180-492	0			c.482_784del						.			1070,740		494,82,329						3.0	0.1		dbSNP_132	3	1279,3127		502,275,1426	no	coding	C14orf180	NM_001008404.1		996,357,1755	A1A1,A1R,RR		29.0286,40.884,37.7896				2349,3867				SO:0001567	stop_retained_variant	400258	exon5			GGCTCTGACGGGC		CCDS32166.1, CCDS66722.1	14q32.33	2012-11-12	2012-11-12	2012-11-12	ENSG00000184601	ENSG00000184601			33795	protein-coding gene	gene with protein product	"""nutritionally-regulated adipose and cardiac-enriched"""		"""chromosome 14 open reading frame 77"""	C14orf77		23029450	Standard	XM_005267638		Approved	NRAC	uc001yow.1	Q8N912	OTTHUMG00000029806	Exception_encountered	14.37:g.105055128_105055136delGACGGGCAG		Somatic	2	0		WXS	Illumina GAIIx	Phase_I	18	4	NM_001008404	0	0	0	0	0		Frame_Shift_Del	DEL	ENST00000557649.1	37	CCDS32166.1																																																																																			-|1.000;|0.000		0.718	C14orf180-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000410580.1	NM_001008404	
SKOR1	390598	hgsc.bcm.edu	37	15	68120014	68120014	+	Silent	SNP	C	C	T	rs62015251	byFrequency	TCGA-OR-A5L2-01A-11D-A30A-10	TCGA-OR-A5L2-10A-01D-A30A-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b99bd79e-aa33-4896-8d10-2517c793f439	48e26b1d-b84d-432b-940b-9907c81ddf5b	g.chr15:68120014C>T	ENST00000380035.2	+	2	1906	c.1848C>T	c.(1846-1848)taC>taT	p.Y616Y	SKOR1_ENST00000554054.1_Silent_p.Y588Y|SKOR1_ENST00000341418.5_Silent_p.Y556Y|SKOR1_ENST00000554240.1_Silent_p.Y577Y|SKOR1_ENST00000389002.1_Silent_p.Y572Y			P84550	SKOR1_HUMAN	SKI family transcriptional corepressor 1	616					negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	SMAD binding (GO:0046332)|transcription corepressor activity (GO:0003714)			endometrium(8)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(4)|lung(7)|urinary_tract(1)	23						GGGAGGCGTACGGCGCGGGGC	0.716													C|||	430	0.0858626	0.0106	0.121	5008	,	,		9530	0.1101		0.1193	False		,,,				2504	0.1033				p.Y556Y		.											.	SKOR1-90	0			c.C1668T						.	C		62,3022		0,62,1480	3.0	4.0	4.0		1716	-1.9	0.1	15	dbSNP_129	4	460,5730		9,442,2644	no	coding-synonymous	SKOR1	NM_001031807.1		9,504,4124	TT,TC,CC		7.4313,2.0104,5.6286		572/922	68120014	522,8752	1542	3095	4637	SO:0001819	synonymous_variant	390598	exon7			GGCGTACGGCGCG		CCDS58374.1	15q23	2011-08-04	2010-06-23	2010-06-23	ENSG00000188779	ENSG00000188779		"""SKI transcriptional corepressors"""	21326	protein-coding gene	gene with protein product	"""transcriptional corepressor CORL1"", ""functional smad suppressing element 15"", ""corepressor for LBX1"""	611273	"""Lbxcor1 homolog (mouse)"""	LBXCOR1		15528197	Standard	NM_001258024		Approved	CORL1, FUSSEL15	uc031qsn.1	P84550		ENST00000380035.2:c.1848C>T	15.37:g.68120014C>T		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	20	15	NM_001258024	0	0	0	0	0	A6NIP4|A6NJY0|Q2VWA5	Silent	SNP	ENST00000380035.2	37																																																																																				C|0.908;T|0.092		0.716	SKOR1-003	KNOWN	not_organism_supported|basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000410832.1	NM_001031807	
C15orf59	388135	broad.mit.edu	37	15	74032929	74032929	+	Missense_Mutation	SNP	C	C	A			TCGA-OR-A5L2-01A-11D-A30A-10	TCGA-OR-A5L2-10A-01D-A30A-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b99bd79e-aa33-4896-8d10-2517c793f439	48e26b1d-b84d-432b-940b-9907c81ddf5b	g.chr15:74032929C>A	ENST00000569673.1	-	3	1415	c.211G>T	c.(211-213)Gac>Tac	p.D71Y	C15orf59_ENST00000558834.1_5'UTR|C15orf59_ENST00000379822.4_Missense_Mutation_p.D71Y			Q2T9L4	CO059_HUMAN	chromosome 15 open reading frame 59	71										breast(1)|endometrium(2)|large_intestine(2)|lung(6)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	15						GTCCAGTCGTCCGGCTCCAGT	0.617																																					p.D71Y		.											.	C15orf59-91	0			c.G211T						.						159.0	162.0	161.0					15																	74032929		2198	4297	6495	SO:0001583	missense	388135	exon2			AGTCGTCCGGCTC		CCDS32289.1	15q24.1	2012-09-27			ENSG00000205363	ENSG00000205363			33753	protein-coding gene	gene with protein product							Standard	XM_005254369		Approved	MGC131524, LOC388135	uc002avy.3	Q2T9L4	OTTHUMG00000172556	ENST00000569673.1:c.211G>T	15.37:g.74032929C>A	ENSP00000457205:p.Asp71Tyr	Somatic	239	2		WXS	Illumina GAIIx	Phase_I	313	7	NM_001039614	0	0	0	0	0		Missense_Mutation	SNP	ENST00000569673.1	37	CCDS32289.1	.	.	.	.	.	.	.	.	.	.	C	22.0	4.230755	0.79688	.	.	ENSG00000205363	ENST00000379822	T	0.63096	-0.02	4.85	4.85	0.62838	.	0.000000	0.85682	D	0.000000	T	0.77532	0.4144	M	0.62723	1.935	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.80542	-0.1336	10	0.87932	D	0	.	17.5722	0.87937	0.0:1.0:0.0:0.0	.	71	Q2T9L4	CO059_HUMAN	Y	71	ENSP00000369150:D71Y	ENSP00000369150:D71Y	D	-	1	0	C15orf59	71819982	1.000000	0.71417	0.856000	0.33681	0.946000	0.59487	7.120000	0.77153	2.221000	0.72209	0.561000	0.74099	GAC	.		0.617	C15orf59-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000419077.2	NM_001039614	
CSPG4	1464	broad.mit.edu	37	15	75981765	75981765	+	Missense_Mutation	SNP	G	G	T	rs149356457	byFrequency	TCGA-OR-A5L2-01A-11D-A30A-10	TCGA-OR-A5L2-10A-01D-A30A-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b99bd79e-aa33-4896-8d10-2517c793f439	48e26b1d-b84d-432b-940b-9907c81ddf5b	g.chr15:75981765G>T	ENST00000308508.5	-	3	1733	c.1641C>A	c.(1639-1641)aaC>aaA	p.N547K		NM_001897.4	NP_001888.2	Q6UVK1	CSPG4_HUMAN	chondroitin sulfate proteoglycan 4	547	Globular or compact configuration stabilized by disulfide bonds.|Neurite growth inhibition. {ECO:0000250}.				activation of MAPK activity (GO:0000187)|angiogenesis (GO:0001525)|carbohydrate metabolic process (GO:0005975)|cell proliferation (GO:0008283)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate catabolic process (GO:0030207)|chondroitin sulfate metabolic process (GO:0030204)|dermatan sulfate biosynthetic process (GO:0030208)|glial cell migration (GO:0008347)|glycosaminoglycan metabolic process (GO:0030203)|intracellular signal transduction (GO:0035556)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|small molecule metabolic process (GO:0044281)|tissue remodeling (GO:0048771)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cell projection (GO:0042995)|cell surface (GO:0009986)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|lysosomal lumen (GO:0043202)	protein kinase binding (GO:0019901)|signal transducer activity (GO:0004871)			breast(1)|cervix(2)|endometrium(5)|kidney(5)|large_intestine(3)|liver(2)|lung(18)|ovary(2)|pancreas(2)|prostate(4)|skin(4)	48						CATTGACAGGGTTGACCTGGA	0.622													G|||	5	0.000998403	0.0	0.0	5008	,	,		20725	0.0		0.001	False		,,,				2504	0.0041				p.N547K		.											.	CSPG4-229	0			c.C1641A						.	G	LYS/ASN	1,4393		0,1,2196	35.0	31.0	32.0		1641	3.2	0.1	15	dbSNP_134	32	13,8563		0,13,4275	no	missense	CSPG4	NM_001897.4	94	0,14,6471	TT,TG,GG		0.1516,0.0228,0.1079	benign	547/2323	75981765	14,12956	2197	4288	6485	SO:0001583	missense	1464	exon3			GACAGGGTTGACC	X96753, AY359468	CCDS10284.1	15q24.2	2010-04-19	2007-02-16		ENSG00000173546	ENSG00000173546		"""Proteoglycans / Cell surface : Other"""	2466	protein-coding gene	gene with protein product	"""melanoma-associated chondroitin sulfate proteoglycan"""	601172	"""chondroitin sulfate proteoglycan 4 (melanoma-associated)"""			8790396, 16407841	Standard	NM_001897		Approved	MCSPG, MEL-CSPG, MSK16, NG2, MCSP, HMW-MAA	uc002baw.3	Q6UVK1	OTTHUMG00000142836	ENST00000308508.5:c.1641C>A	15.37:g.75981765G>T	ENSP00000312506:p.Asn547Lys	Somatic	185	2		WXS	Illumina GAIIx	Phase_I	226	9	NM_001897	0	0	0	0	0	D3DW77|Q92675	Missense_Mutation	SNP	ENST00000308508.5	37	CCDS10284.1	.	.	.	.	.	.	.	.	.	.	.	2.454	-0.325794	0.05350	2.28E-4	0.001516	ENSG00000173546	ENST00000308508	T	0.45668	0.89	5.21	3.23	0.37069	.	0.608532	0.16274	N	0.221645	T	0.29288	0.0729	L	0.60455	1.87	0.41510	D	0.988332	B	0.32302	0.363	B	0.26969	0.075	T	0.08785	-1.0705	10	0.06236	T	0.91	.	5.9733	0.19365	0.1589:0.0:0.6881:0.153	.	547	Q6UVK1	CSPG4_HUMAN	K	547	ENSP00000312506:N547K	ENSP00000312506:N547K	N	-	3	2	CSPG4	73768820	0.381000	0.25140	0.100000	0.21137	0.055000	0.15305	0.522000	0.22909	0.507000	0.28148	0.555000	0.69702	AAC	G|0.998;T|0.002		0.622	CSPG4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000286472.1	NM_001897	
RASGRF1	5923	broad.mit.edu;bcgsc.ca	37	15	79290464	79290464	+	Missense_Mutation	SNP	C	C	G			TCGA-OR-A5L2-01A-11D-A30A-10	TCGA-OR-A5L2-10A-01D-A30A-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b99bd79e-aa33-4896-8d10-2517c793f439	48e26b1d-b84d-432b-940b-9907c81ddf5b	g.chr15:79290464C>G	ENST00000419573.3	-	20	3262	c.2988G>C	c.(2986-2988)gaG>gaC	p.E996D	RASGRF1_ENST00000394745.3_Missense_Mutation_p.E212D|RASGRF1_ENST00000560334.1_5'UTR|RASGRF1_ENST00000558480.2_Missense_Mutation_p.E980D	NM_002891.4	NP_002882.3	Q13972	RGRF1_HUMAN	Ras protein-specific guanine nucleotide-releasing factor 1	996					activation of Rac GTPase activity (GO:0032863)|cell proliferation (GO:0008283)|long-term memory (GO:0007616)|neuron projection development (GO:0031175)|positive regulation of Ras GTPase activity (GO:0032320)|positive regulation of Ras protein signal transduction (GO:0046579)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|regulation of neuronal synaptic plasticity (GO:0048168)|regulation of Rac protein signal transduction (GO:0035020)|regulation of Ras protein signal transduction (GO:0046578)|regulation of synaptic plasticity (GO:0048167)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)|synaptic transmission (GO:0007268)	cytosol (GO:0005829)|growth cone (GO:0030426)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)	guanyl-nucleotide exchange factor activity (GO:0005085)|Ras guanyl-nucleotide exchange factor activity (GO:0005088)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(2)|central_nervous_system(2)|endometrium(7)|kidney(4)|large_intestine(18)|lung(23)|ovary(2)|prostate(6)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	71						CAGCCTTCCGCTCCTGGGTCA	0.587																																					p.E996D		.											.	RASGRF1-662	0			c.G2988C						.						126.0	104.0	112.0					15																	79290464		2196	4293	6489	SO:0001583	missense	5923	exon20			CTTCCGCTCCTGG	M91815	CCDS10309.1, CCDS42065.1, CCDS45320.1	15q24	2013-01-10			ENSG00000058335	ENSG00000058335		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	9875	protein-coding gene	gene with protein product		606600		GRF1		7684828, 1379731	Standard	NM_153815		Approved	CDC25L, CDC25, GRF55, H-GRF55, GNRP, PP13187	uc002beq.3	Q13972	OTTHUMG00000144172	ENST00000419573.3:c.2988G>C	15.37:g.79290464C>G	ENSP00000405963:p.Glu996Asp	Somatic	156	0		WXS	Illumina GAIIx	Phase_I	223	9	NM_002891	0	0	0	0	0	F8VPA5|H0YKF2|J3KQP9|Q16027	Missense_Mutation	SNP	ENST00000419573.3	37	CCDS10309.1	.	.	.	.	.	.	.	.	.	.	C	17.86	3.493523	0.64186	.	.	ENSG00000058335	ENST00000419573;ENST00000394741;ENST00000394745	T;T	0.31769	1.48;1.48	4.34	2.42	0.29668	Ras guanine nucleotide exchange factor, domain (1);Ras-like guanine nucleotide exchange factor, N-terminal (1);	0.000000	0.85682	D	0.000000	T	0.42177	0.1191	L	0.55990	1.75	0.50039	D	0.999846	D;P;D;P	0.76494	0.999;0.716;0.997;0.712	D;P;D;P	0.70016	0.967;0.484;0.935;0.525	T	0.19745	-1.0296	10	0.21014	T	0.42	.	8.6248	0.33883	0.0:0.801:0.0:0.199	.	392;980;998;980	B7Z6Z6;Q8IUU5;Q13972;F8VPA5	.;.;RGRF1_HUMAN;.	D	996;980;212	ENSP00000405963:E996D;ENSP00000378228:E212D	ENSP00000378224:E980D	E	-	3	2	RASGRF1	77077519	0.935000	0.31712	1.000000	0.80357	0.949000	0.60115	0.065000	0.14466	1.152000	0.42452	0.491000	0.48974	GAG	.		0.587	RASGRF1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000291371.3	NM_002891	
HOMER2	9455	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	15	83527785	83527785	+	Missense_Mutation	SNP	G	G	C			TCGA-OR-A5L2-01A-11D-A30A-10	TCGA-OR-A5L2-10A-01D-A30A-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b99bd79e-aa33-4896-8d10-2517c793f439	48e26b1d-b84d-432b-940b-9907c81ddf5b	g.chr15:83527785G>C	ENST00000304231.8	-	5	715	c.523C>G	c.(523-525)Cag>Gag	p.Q175E	HOMER2_ENST00000399166.2_Missense_Mutation_p.Q164E|HOMER2_ENST00000426485.1_Missense_Mutation_p.Q175E|HOMER2_ENST00000450735.2_Missense_Mutation_p.Q164E	NM_199330.2	NP_955362.1	Q9NSB8	HOME2_HUMAN	homer homolog 2 (Drosophila)	175					behavioral response to cocaine (GO:0048148)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|chemical homeostasis within a tissue (GO:0048875)|G-protein coupled glutamate receptor signaling pathway (GO:0007216)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)	apical part of cell (GO:0045177)|cell junction (GO:0030054)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|neuronal cell body (GO:0043025)|nucleolus (GO:0005730)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)				cervix(1)|endometrium(2)|lung(6)	9						CCTTACCTCTGCGTCAAGGCA	0.498																																					p.Q175E		.											.	HOMER2-67	0			c.C523G						.						118.0	122.0	121.0					15																	83527785		2000	4160	6160	SO:0001583	missense	9455	exon5			ACCTCTGCGTCAA	AF093264	CCDS45334.1, CCDS45336.1	15q24.3	2008-02-05				ENSG00000103942			17513	protein-coding gene	gene with protein product		604799				9808459, 9808458	Standard	NM_199330		Approved	CPD, Cupidin, Vesl-2, HOMER-2B, HOMER-2, HOMER-2A	uc002bjg.3	Q9NSB8		ENST00000304231.8:c.523C>G	15.37:g.83527785G>C	ENSP00000305632:p.Gln175Glu	Somatic	107	0		WXS	Illumina GAIIx	Phase_I	123	42	NM_199330	0	0	0	0	0	O95269|O95349|Q9NSB6|Q9NSB7|Q9UNT7	Missense_Mutation	SNP	ENST00000304231.8	37	CCDS45334.1	.	.	.	.	.	.	.	.	.	.	g	0.823	-0.747897	0.03065	.	.	ENSG00000103942	ENST00000304231;ENST00000450735;ENST00000426485;ENST00000399166	T;T;T;T	0.76448	2.17;-1.02;2.64;2.61	5.92	5.92	0.95590	.	0.344001	0.31809	N	0.007024	T	0.70859	0.3272	L	0.37697	1.125	0.47905	D	0.999543	B;B;B;B	0.11235	0.0;0.003;0.004;0.003	B;B;B;B	0.11329	0.005;0.004;0.006;0.004	T	0.63752	-0.6566	10	0.17832	T	0.49	.	19.31	0.94184	0.0:0.0:1.0:0.0	.	164;175;164;175	F8W826;E9PAZ1;Q9NSB8-2;Q9NSB8	.;.;.;HOME2_HUMAN	E	175;164;175;164	ENSP00000305632:Q175E;ENSP00000407634:Q164E;ENSP00000394293:Q175E;ENSP00000382119:Q164E	ENSP00000305632:Q175E	Q	-	1	0	HOMER2	81324839	1.000000	0.71417	0.969000	0.41365	0.165000	0.22458	6.927000	0.75840	2.801000	0.96364	0.651000	0.88453	CAG	.		0.498	HOMER2-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000418689.1		
SEC11A	23478	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	15	85230912	85230912	+	Silent	SNP	A	A	G	rs71395463		TCGA-OR-A5L2-01A-11D-A30A-10	TCGA-OR-A5L2-10A-01D-A30A-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b99bd79e-aa33-4896-8d10-2517c793f439	48e26b1d-b84d-432b-940b-9907c81ddf5b	g.chr15:85230912A>G	ENST00000268220.7	-	3	895	c.255T>C	c.(253-255)ttT>ttC	p.F85F	SEC11A_ENST00000558134.1_Silent_p.F85F|SEC11A_ENST00000560266.1_Silent_p.F85F|SEC11A_ENST00000455959.3_Silent_p.F59F|RP11-245C17.2_ENST00000558044.1_RNA	NM_014300.2	NP_055115.1	P67812	SC11A_HUMAN	SEC11 homolog A (S. cerevisiae)	85					cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|regulation of insulin secretion (GO:0050796)|signal peptide processing (GO:0006465)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)	endoplasmic reticulum membrane (GO:0005789)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	serine-type peptidase activity (GO:0008236)			ovary(1)	1			BRCA - Breast invasive adenocarcinoma(143;0.199)			CTTCTATCCTAAAAACAACAA	0.383																																					p.F85F		.											.	SEC11A-23	0			c.T255C						.						187.0	173.0	177.0					15																	85230912		1845	4096	5941	SO:0001819	synonymous_variant	23478	exon3			TATCCTAAAAACA	AF061737	CCDS45340.1, CCDS61742.1, CCDS61743.1, CCDS61744.1, CCDS73776.1	15q25.2	2006-11-07	2006-11-07	2006-11-07		ENSG00000140612			17718	protein-coding gene	gene with protein product			"""SEC11-like 1 (S. cerevisiae)"""	SEC11L1			Standard	NM_001271919		Approved	SPC18, sid2895, SPCS4A	uc031qtg.1	P67812		ENST00000268220.7:c.255T>C	15.37:g.85230912A>G		Somatic	92	0		WXS	Illumina GAIIx	Phase_I	113	7	NM_014300	0	0	0	0	0	B2RAD7|B4DUL4|H0YK72|H0YK83|O75957|P21378|Q53FQ8	Silent	SNP	ENST00000268220.7	37	CCDS45340.1																																																																																			A|0.500;T|0.500		0.383	SEC11A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000418777.1	NM_014300	
RCCD1	91433	hgsc.bcm.edu	37	15	91500017	91500017	+	Missense_Mutation	SNP	G	G	T			TCGA-OR-A5L2-01A-11D-A30A-10	TCGA-OR-A5L2-10A-01D-A30A-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b99bd79e-aa33-4896-8d10-2517c793f439	48e26b1d-b84d-432b-940b-9907c81ddf5b	g.chr15:91500017G>T	ENST00000394258.2	+	2	255	c.53G>T	c.(52-54)gGg>gTg	p.G18V	AC068831.6_ENST00000553321.1_RNA|RCCD1_ENST00000556618.1_Missense_Mutation_p.G18V|RCCD1_ENST00000556774.1_Intron|RCCD1_ENST00000555155.1_Missense_Mutation_p.G18V	NM_001017919.1|NM_033544.2	NP_001017919.1|NP_291022.2	A6NED2	RCCD1_HUMAN	RCC1 domain containing 1	18						cytoplasm (GO:0005737)|plasma membrane (GO:0005886)				breast(1)|kidney(1)|large_intestine(2)	4	Lung NSC(78;0.0987)|all_lung(78;0.175)		Lung(145;0.189)			TGCGGCTTCGGGCAGGAGCTG	0.771											OREG0023477	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.G18V		.											.	RCCD1-90	0			c.G53T						.						6.0	10.0	9.0					15																	91500017		2100	4118	6218	SO:0001583	missense	91433	exon2			GCTTCGGGCAGGA		CCDS32333.1	15q26.1	2005-10-21	2005-10-21			ENSG00000166965			30457	protein-coding gene	gene with protein product						12477932	Standard	XM_006720763		Approved	MGC14386	uc002bqk.3	A6NED2		ENST00000394258.2:c.53G>T	15.37:g.91500017G>T	ENSP00000377801:p.Gly18Val	Somatic	4	0	1283	WXS	Illumina GAIIx	Phase_I	37	13	NM_001017919	0	0	0	0	0	B2RTP9|Q29RX6	Missense_Mutation	SNP	ENST00000394258.2	37	CCDS32333.1	.	.	.	.	.	.	.	.	.	.	G	21.3	4.126738	0.77549	.	.	ENSG00000166965	ENST00000394258;ENST00000555155;ENST00000556618	D;D;D	0.87571	-2.27;-2.27;-2.27	4.27	4.27	0.50696	Regulator of chromosome condensation/beta-lactamase-inhibitor protein II (2);	0.324062	0.26832	N	0.022266	D	0.91243	0.7240	L	0.59436	1.845	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.998	D	0.91692	0.5367	10	0.87932	D	0	.	12.4283	0.55559	0.0:0.0:1.0:0.0	.	18;18	G3V2I3;A6NED2	.;RCCD1_HUMAN	V	18	ENSP00000377801:G18V;ENSP00000450678:G18V;ENSP00000451963:G18V	ENSP00000377801:G18V	G	+	2	0	RCCD1	89301021	1.000000	0.71417	1.000000	0.80357	0.711000	0.40976	3.507000	0.53371	2.386000	0.81285	0.555000	0.69702	GGG	.		0.771	RCCD1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000414748.1	NM_033544	
C16orf89	146556	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	16	5097933	5097933	+	Missense_Mutation	SNP	G	G	T			TCGA-OR-A5L2-01A-11D-A30A-10	TCGA-OR-A5L2-10A-01D-A30A-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b99bd79e-aa33-4896-8d10-2517c793f439	48e26b1d-b84d-432b-940b-9907c81ddf5b	g.chr16:5097933G>T	ENST00000315997.5	-	7	1102	c.901C>A	c.(901-903)Caa>Aaa	p.Q301K	C16orf89_ENST00000350219.4_Missense_Mutation_p.Q339K|ALG1_ENST00000588623.1_Intron|C16orf89_ENST00000472572.3_Missense_Mutation_p.Q301K|C16orf89_ENST00000474471.3_Missense_Mutation_p.Q333K|C16orf89_ENST00000422873.1_Missense_Mutation_p.Q339K	NM_152459.4	NP_689672.4	Q6UX73	CP089_HUMAN	chromosome 16 open reading frame 89	301						cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	protein homodimerization activity (GO:0042803)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(4)|ovary(1)|skin(1)|urinary_tract(1)	12						TGCTGATATTGAATAGCTTTA	0.323																																					p.Q301K		.											.	C16orf89-92	0			c.C901A						.						66.0	59.0	61.0					16																	5097933		1803	4069	5872	SO:0001583	missense	146556	exon7			GATATTGAATAGC		CCDS42116.1, CCDS45404.1, CCDS42116.2, CCDS45404.2	16p13.3	2011-12-12			ENSG00000153446	ENSG00000153446			28687	protein-coding gene	gene with protein product						12975309, 20578903	Standard	NM_001098514		Approved	MGC45438	uc010bud.3	Q6UX73	OTTHUMG00000159314	ENST00000315997.5:c.901C>A	16.37:g.5097933G>T	ENSP00000324672:p.Gln301Lys	Somatic	29	0		WXS	Illumina GAIIx	Phase_I	39	18	NM_001098514	0	0	0	0	0	B4DUM5|Q8N2I3|Q8N4T1	Missense_Mutation	SNP	ENST00000315997.5	37	CCDS42116.2	.	.	.	.	.	.	.	.	.	.	G	10.63	1.403295	0.25291	.	.	ENSG00000153446	ENST00000474471;ENST00000472572;ENST00000477550;ENST00000422873;ENST00000350219;ENST00000315997	T;T;T;T	0.40225	1.09;1.04;1.04;1.09	4.67	1.23	0.21249	.	0.835381	0.10367	N	0.683340	T	0.29423	0.0733	L	0.44542	1.39	0.09310	N	1	B;B	0.29716	0.255;0.137	B;B	0.21917	0.024;0.037	T	0.18587	-1.0332	10	0.12430	T	0.62	-10.4613	9.1691	0.37069	0.0:0.3777:0.4824:0.1399	.	301;339	Q6UX73;G3V0F0	CP089_HUMAN;.	K	333;301;301;339;339;333	ENSP00000417158:Q333K;ENSP00000420566:Q301K;ENSP00000390402:Q339K;ENSP00000283478:Q339K	ENSP00000324672:Q333K	Q	-	1	0	C16orf89	5037934	0.001000	0.12720	0.000000	0.03702	0.173000	0.22820	0.634000	0.24614	0.450000	0.26774	0.561000	0.74099	CAA	.		0.323	C16orf89-001	KNOWN	upstream_ATG|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000354524.1	NM_152459	
ABCC6	368	broad.mit.edu	37	16	16302676	16302676	+	Missense_Mutation	SNP	C	C	A			TCGA-OR-A5L2-01A-11D-A30A-10	TCGA-OR-A5L2-10A-01D-A30A-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b99bd79e-aa33-4896-8d10-2517c793f439	48e26b1d-b84d-432b-940b-9907c81ddf5b	g.chr16:16302676C>A	ENST00000205557.7	-	7	732	c.703G>T	c.(703-705)Gac>Tac	p.D235Y	ABCC6_ENST00000574094.1_5'UTR	NM_001171.5	NP_001162	O95255	MRP6_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP), member 6	235					response to drug (GO:0042493)|transmembrane transport (GO:0055085)|transport (GO:0006810)|visual perception (GO:0007601)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|transporter activity (GO:0005215)	p.D235Y(1)		NS(1)|breast(1)|central_nervous_system(2)|cervix(2)|endometrium(6)|kidney(3)|large_intestine(10)|lung(10)|ovary(1)|skin(6)|urinary_tract(1)	43				UCEC - Uterine corpus endometrioid carcinoma (3;0.123)	Cisplatin(DB00515)|Dactinomycin(DB00970)|Daunorubicin(DB00694)|Doxorubicin(DB00997)|Etoposide(DB00773)|Indomethacin(DB00328)|Probenecid(DB01032)|Sulfinpyrazone(DB01138)|Teniposide(DB00444)|Vinblastine(DB00570)	GACCAGAGGTCTTTTGGTCTC	0.567																																					p.D235Y		.											.	ABCC6-93	1	Substitution - Missense(1)	large_intestine(1)	c.G703T						.						28.0	28.0	28.0					16																	16302676		2195	4273	6468	SO:0001583	missense	368	exon7			AGAGGTCTTTTGG	AF076622	CCDS10568.1, CCDS58430.1	16p13.11	2013-01-08			ENSG00000091262	ENSG00000091262		"""ATP binding cassette transporters / subfamily C"""	57	protein-coding gene	gene with protein product		603234	"""pseudoxanthoma elasticum"""	ARA, PXE		9721217, 11439001	Standard	NM_001079528		Approved	MRP6, EST349056, MLP1, URG7	uc002den.4	O95255	OTTHUMG00000129967	ENST00000205557.7:c.703G>T	16.37:g.16302676C>A	ENSP00000205557:p.Asp235Tyr	Somatic	303	2		WXS	Illumina GAIIx	Phase_I	310	87	NM_001171	0	0	0	0	0	A2RRN8|A8KIG6|A8Y988|E7ESW8|P78420|Q8TCY8|Q9UMZ7	Missense_Mutation	SNP	ENST00000205557.7	37	CCDS10568.1	.	.	.	.	.	.	.	.	.	.	.	15.34	2.803965	0.50315	.	.	ENSG00000091262	ENST00000205557;ENST00000456970;ENST00000546056	D;D	0.97114	-4.25;-4.25	4.09	4.09	0.47781	.	0.000000	0.51477	U	0.000090	D	0.98785	0.9591	H	0.95328	3.655	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.79108	0.992;0.982	D	0.99429	1.0935	10	0.87932	D	0	.	13.3002	0.60321	0.0:1.0:0.0:0.0	.	247;235	F5GWQ0;O95255	.;MRP6_HUMAN	Y	235;235;247	ENSP00000205557:D235Y;ENSP00000405002:D235Y	ENSP00000205557:D235Y	D	-	1	0	ABCC6	16210177	1.000000	0.71417	0.928000	0.36995	0.543000	0.35085	4.699000	0.61796	1.857000	0.53885	0.479000	0.44913	GAC	.		0.567	ABCC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252232.2		
CLN3	1201	bcgsc.ca	37	16	28502861	28502861	+	Missense_Mutation	SNP	G	G	T			TCGA-OR-A5L2-01A-11D-A30A-10	TCGA-OR-A5L2-10A-01D-A30A-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b99bd79e-aa33-4896-8d10-2517c793f439	48e26b1d-b84d-432b-940b-9907c81ddf5b	g.chr16:28502861G>T	ENST00000569430.1	-	4	886	c.67C>A	c.(67-69)Ccc>Acc	p.P23T	CLN3_ENST00000357806.7_Missense_Mutation_p.P23T|CLN3_ENST00000357857.9_Intron|CLN3_ENST00000359984.7_Missense_Mutation_p.P23T|CLN3_ENST00000567963.1_Missense_Mutation_p.P23T|CLN3_ENST00000565316.1_Missense_Mutation_p.P23T|CLN3_ENST00000333496.9_Missense_Mutation_p.P23T|CLN3_ENST00000355477.5_Missense_Mutation_p.P23T|CLN3_ENST00000395653.4_Intron|CLN3_ENST00000535392.1_Intron|CLN3_ENST00000360019.2_Missense_Mutation_p.P23T|CLN3_ENST00000354630.5_Missense_Mutation_p.P23T|CLN3_ENST00000568224.1_Intron|CLN3_ENST00000357076.5_Missense_Mutation_p.P23T|CLN3_ENST00000567160.1_5'Flank			Q13286	CLN3_HUMAN	ceroid-lipofuscinosis, neuronal 3	23					action potential (GO:0001508)|amyloid precursor protein catabolic process (GO:0042987)|arginine transport (GO:0015809)|associative learning (GO:0008306)|autophagic vacuole fusion (GO:0000046)|cell death (GO:0008219)|cellular amino acid metabolic process (GO:0006520)|ceramide metabolic process (GO:0006672)|cytosolic calcium ion homeostasis (GO:0051480)|galactosylceramide metabolic process (GO:0006681)|globoside metabolic process (GO:0001575)|glucosylceramide metabolic process (GO:0006678)|ionotropic glutamate receptor signaling pathway (GO:0035235)|lysosomal lumen acidification (GO:0007042)|lysosomal lumen pH elevation (GO:0035752)|lysosome organization (GO:0007040)|macroautophagy (GO:0016236)|membrane organization (GO:0061024)|negative regulation of apoptotic process (GO:0043066)|negative regulation of catalytic activity (GO:0043086)|negative regulation of macroautophagy (GO:0016242)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of proteolysis (GO:0045861)|neuromuscular process controlling balance (GO:0050885)|neurotransmitter metabolic process (GO:0042133)|protein catabolic process (GO:0030163)|protein processing (GO:0016485)|receptor-mediated endocytosis (GO:0006898)|sphingomyelin metabolic process (GO:0006684)|vacuolar transport (GO:0007034)|vesicle transport along microtubule (GO:0047496)	autophagic vacuole (GO:0005776)|caveola (GO:0005901)|cytoplasm (GO:0005737)|early endosome (GO:0005769)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|Golgi stack (GO:0005795)|integral component of endoplasmic reticulum membrane (GO:0030176)|integral component of membrane (GO:0016021)|late endosome (GO:0005770)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|membrane raft (GO:0045121)|mitochondrion (GO:0005739)|neuron projection (GO:0043005)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|synaptic vesicle (GO:0008021)|trans-Golgi network (GO:0005802)	unfolded protein binding (GO:0051082)			breast(1)|large_intestine(2)|lung(11)|upper_aerodigestive_tract(1)	15						GGGAGCCGGGGCTCCGGGACG	0.647											OREG0023706	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.P23T		.											.	CLN3-90	0			c.C67A						.						28.0	29.0	29.0					16																	28502861		2197	4300	6497	SO:0001583	missense	1201	exon3			GCCGGGGCTCCGG	U32680	CCDS10632.1, CCDS73852.1, CCDS73853.1, CCDS73854.1, CCDS73855.1	16p12	2014-09-17	2008-07-29		ENSG00000188603	ENSG00000188603			2074	protein-coding gene	gene with protein product	"""juvenile neuronal ceroid lipofuscinosis"""	607042	"""Batten, Spielmeyer-Vogt disease"""	BTS		18317235	Standard	NM_001042432		Approved	JNCL	uc002dpp.3	Q13286	OTTHUMG00000097024	ENST00000569430.1:c.67C>A	16.37:g.28502861G>T	ENSP00000454229:p.Pro23Thr	Somatic	86	0	802	WXS	Illumina GAIIx	Phase_I	72	4	NM_001042432	0	0	0	0	0	B2R7J1|O00668|O95089|Q549S9|Q9UP09|Q9UP11|Q9UP12|Q9UP13|Q9UP14	Missense_Mutation	SNP	ENST00000569430.1	37	CCDS10632.1	.	.	.	.	.	.	.	.	.	.	G	15.13	2.741149	0.49151	.	.	ENSG00000188603	ENST00000359984;ENST00000360019;ENST00000354630;ENST00000355477;ENST00000333496;ENST00000357806;ENST00000357076	T;T;T;T;T;D;D	0.93906	0.19;0.19;0.19;0.19;0.19;-3.31;-3.23	4.93	1.67	0.24075	Major facilitator superfamily domain, general substrate transporter (1);	0.391297	0.23660	N	0.045827	T	0.81564	0.4849	N	0.08118	0	0.09310	N	1	B;B;B;B;B;B;B;B	0.27416	0.004;0.178;0.037;0.012;0.164;0.021;0.004;0.047	B;B;B;B;B;B;B;B	0.24394	0.003;0.053;0.013;0.005;0.04;0.007;0.003;0.027	T	0.73620	-0.3925	10	0.72032	D	0.01	-3.7534	3.8364	0.08896	0.1989:0.0:0.6105:0.1906	.	23;23;23;74;23;23;23;23	B4DXL3;Q13286-3;Q13286-4;B4DIA8;O95090;Q13286-2;Q13286;O95089	.;.;.;.;.;.;CLN3_HUMAN;.	T	23	ENSP00000353073:P23T;ENSP00000353116:P23T;ENSP00000346650:P23T;ENSP00000347660:P23T;ENSP00000329171:P23T;ENSP00000350457:P23T;ENSP00000349586:P23T	ENSP00000329171:P23T	P	-	1	0	CLN3	28410362	0.000000	0.05858	0.001000	0.08648	0.416000	0.31233	-0.012000	0.12699	0.771000	0.33359	0.651000	0.88453	CCC	.		0.647	CLN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214115.2		
APOBR	55911	bcgsc.ca	37	16	28508069	28508069	+	Silent	SNP	C	C	T	rs151174	byFrequency	TCGA-OR-A5L2-01A-11D-A30A-10	TCGA-OR-A5L2-10A-01D-A30A-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b99bd79e-aa33-4896-8d10-2517c793f439	48e26b1d-b84d-432b-940b-9907c81ddf5b	g.chr16:28508069C>T	ENST00000431282.1	+	3	1690	c.1680C>T	c.(1678-1680)ggC>ggT	p.G560G	CLN3_ENST00000569430.1_5'Flank|APOBR_ENST00000328423.5_Silent_p.G560G|APOBR_ENST00000564831.1_Silent_p.G569G|CLN3_ENST00000567160.1_5'Flank			Q0VD83	APOBR_HUMAN	apolipoprotein B receptor	560	Glu-rich.				cholesterol metabolic process (GO:0008203)|lipid transport (GO:0006869)|triglyceride metabolic process (GO:0006641)	chylomicron (GO:0042627)|low-density lipoprotein particle (GO:0034362)|membrane (GO:0016020)|plasma membrane (GO:0005886)|very-low-density lipoprotein particle (GO:0034361)	very-low-density lipoprotein particle receptor activity (GO:0030229)			breast(1)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(11)|prostate(1)|skin(2)|stomach(1)	29						TGATGGGGGGCGCCCAGACCC	0.637													C|||	1194	0.238419	0.2156	0.4135	5008	,	,		17870	0.0933		0.3469	False		,,,				2504	0.183				p.G569G		.											.	APOBR-90	0			c.C1707T						.	C		977,3027		149,679,1174	8.0	9.0	9.0		1680	-9.6	0.0	16	dbSNP_79	9	3211,5119		667,1877,1621	no	coding-synonymous	APOBR	NM_018690.3		816,2556,2795	TT,TC,CC		38.5474,24.4006,33.9549		560/1089	28508069	4188,8146	2002	4165	6167	SO:0001819	synonymous_variant	55911	exon2			GGGGGGCGCCCAG	AK025123	CCDS58442.1	16p11.2	2011-02-14			ENSG00000184730	ENSG00000184730			24087	protein-coding gene	gene with protein product	"""apolipoprotein B48 receptor"", ""apolipoprotein B100 receptor"""	605220				10852956	Standard	NM_018690		Approved	APOB48R, APOB100R	uc002dqb.2	Q0VD83		ENST00000431282.1:c.1680C>T	16.37:g.28508069C>T		Somatic	197	0		WXS	Illumina GAIIx	Phase_I	208	7	NM_018690	0	0	0	0	0	H3BU97|Q0VD81|Q8NC15|Q9NPJ9	Silent	SNP	ENST00000431282.1	37																																																																																				C|0.746;T|0.254		0.637	APOBR-202	KNOWN	basic|appris_candidate	protein_coding	protein_coding		NM_182804	
VPS35	55737	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	16	46705646	46705646	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5L2-01A-11D-A30A-10	TCGA-OR-A5L2-10A-01D-A30A-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b99bd79e-aa33-4896-8d10-2517c793f439	48e26b1d-b84d-432b-940b-9907c81ddf5b	g.chr16:46705646G>A	ENST00000299138.7	-	12	1553	c.1495C>T	c.(1495-1497)Cgc>Tgc	p.R499C	VPS35_ENST00000568642.1_5'Flank	NM_018206.4	NP_060676.2	Q96QK1	VPS35_HUMAN	vacuolar protein sorting 35 homolog (S. cerevisiae)	499					cell death (GO:0008219)|protein transport (GO:0015031)|retrograde transport, endosome to Golgi (GO:0042147)	cytosol (GO:0005829)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|lysosomal membrane (GO:0005765)|retromer complex (GO:0030904)				breast(2)|endometrium(2)|kidney(2)|large_intestine(3)|lung(11)|pancreas(1)|prostate(1)|urinary_tract(1)	23		all_cancers(37;7.65e-05)|all_epithelial(9;0.000154)|all_lung(18;0.00585)|Lung NSC(13;0.0496)|Breast(268;0.116)				TCCTCAGAGCGCAGCAGATGA	0.468																																					p.R499C		.											.	VPS35-90	0			c.C1495T						.						66.0	58.0	61.0					16																	46705646		2203	4300	6503	SO:0001583	missense	55737	exon12			CAGAGCGCAGCAG	AF175265	CCDS10721.1	16q12	2012-06-27	2006-12-19		ENSG00000069329	ENSG00000069329		"""Parkinson disease"""	13487	protein-coding gene	gene with protein product		601501	"""vacuolar protein sorting 35 (yeast homolog)"", ""vacuolar protein sorting 35 (yeast)"""			11112353, 21763482	Standard	NM_018206		Approved	FLJ10752, MEM3, PARK17	uc002eef.4	Q96QK1	OTTHUMG00000132542	ENST00000299138.7:c.1495C>T	16.37:g.46705646G>A	ENSP00000299138:p.Arg499Cys	Somatic	147	0		WXS	Illumina GAIIx	Phase_I	154	29	NM_018206	0	0	0	0	0	Q561W2|Q9H016|Q9H096|Q9H4P3|Q9H8J0|Q9NRS7|Q9NVG2|Q9NX80|Q9NZK2	Missense_Mutation	SNP	ENST00000299138.7	37	CCDS10721.1	.	.	.	.	.	.	.	.	.	.	.	8.437	0.849846	0.17034	.	.	ENSG00000069329	ENST00000299138;ENST00000541330	T	0.65916	-0.18	5.34	2.18	0.27775	.	0.160364	0.53938	D	0.000041	T	0.54532	0.1864	L	0.48642	1.525	0.34625	D	0.718991	D;B	0.59357	0.985;0.015	P;B	0.45071	0.468;0.004	T	0.65582	-0.6133	10	0.54805	T	0.06	-12.8024	9.4018	0.38437	0.068:0.0:0.6787:0.2534	.	499;364	Q96QK1;F5GYF5	VPS35_HUMAN;.	C	499;364	ENSP00000299138:R499C	ENSP00000299138:R499C	R	-	1	0	VPS35	45263147	0.999000	0.42202	0.026000	0.17262	0.042000	0.13812	5.610000	0.67668	0.582000	0.29556	-0.500000	0.04577	CGC	.		0.468	VPS35-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255742.3		
DNAJA2	10294	broad.mit.edu;bcgsc.ca	37	16	47005448	47005448	+	Missense_Mutation	SNP	T	T	A			TCGA-OR-A5L2-01A-11D-A30A-10	TCGA-OR-A5L2-10A-01D-A30A-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b99bd79e-aa33-4896-8d10-2517c793f439	48e26b1d-b84d-432b-940b-9907c81ddf5b	g.chr16:47005448T>A	ENST00000317089.5	-	3	390	c.175A>T	c.(175-177)Aat>Tat	p.N59Y	RP11-169E6.1_ENST00000562536.1_RNA	NM_005880.3	NP_005871.1	O60884	DNJA2_HUMAN	DnaJ (Hsp40) homolog, subfamily A, member 2	59	J.				positive regulation of cell proliferation (GO:0008284)|protein refolding (GO:0042026)|response to heat (GO:0009408)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|metal ion binding (GO:0046872)|unfolded protein binding (GO:0051082)			endometrium(1)|kidney(1)|large_intestine(2)|lung(7)|prostate(2)|upper_aerodigestive_tract(1)	14		all_cancers(37;0.00125)|all_lung(18;0.00338)|all_epithelial(9;0.00358)|Lung NSC(13;0.0309)|Breast(268;0.116)				TTCTCAGGATTTGATAGTACT	0.378																																					p.N59Y		.											.	DNAJA2-226	0			c.A175T						.						142.0	149.0	147.0					16																	47005448		2203	4300	6503	SO:0001583	missense	10294	exon3			CAGGATTTGATAG	AF116720	CCDS10726.1	16q12.1	2011-09-02			ENSG00000069345	ENSG00000069345		"""Heat shock proteins / DNAJ (HSP40)"""	14884	protein-coding gene	gene with protein product		611322				9710638, 11147971	Standard	NM_005880		Approved	HIRIP4, DNAJ, CPR3, DNJ3	uc002eeo.2	O60884	OTTHUMG00000133104	ENST00000317089.5:c.175A>T	16.37:g.47005448T>A	ENSP00000314030:p.Asn59Tyr	Somatic	68	1		WXS	Illumina GAIIx	Phase_I	52	17	NM_005880	0	0	0	0	0	B2R7L7|O14711	Missense_Mutation	SNP	ENST00000317089.5	37	CCDS10726.1	.	.	.	.	.	.	.	.	.	.	T	21.9	4.214932	0.79352	.	.	ENSG00000069345	ENST00000317089	T	0.74106	-0.81	5.95	3.72	0.42706	Heat shock protein DnaJ, N-terminal (5);Heat shock protein DnaJ, conserved site (1);	0.000000	0.85682	D	0.000000	D	0.86789	0.6017	M	0.91459	3.21	0.80722	D	1	D	0.63046	0.992	D	0.65684	0.937	D	0.87043	0.2142	10	0.87932	D	0	-28.9298	10.3577	0.43974	0.0:0.1321:0.0:0.8679	.	59	O60884	DNJA2_HUMAN	Y	59	ENSP00000314030:N59Y	ENSP00000314030:N59Y	N	-	1	0	DNAJA2	45562949	1.000000	0.71417	0.976000	0.42696	0.998000	0.95712	5.162000	0.64942	0.505000	0.28104	0.533000	0.62120	AAT	.		0.378	DNAJA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256769.2		
ABCC11	85320	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	16	48261750	48261750	+	Nonsense_Mutation	SNP	G	G	C			TCGA-OR-A5L2-01A-11D-A30A-10	TCGA-OR-A5L2-10A-01D-A30A-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b99bd79e-aa33-4896-8d10-2517c793f439	48e26b1d-b84d-432b-940b-9907c81ddf5b	g.chr16:48261750G>C	ENST00000394747.1	-	3	711	c.362C>G	c.(361-363)tCa>tGa	p.S121*	ABCC11_ENST00000537808.1_Nonsense_Mutation_p.S121*|ABCC11_ENST00000394748.1_Nonsense_Mutation_p.S121*|ABCC11_ENST00000353782.5_Nonsense_Mutation_p.S121*|ABCC11_ENST00000356608.2_Nonsense_Mutation_p.S121*	NM_033151.3	NP_149163.2	Q96J66	ABCCB_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP), member 11	121					organic anion transport (GO:0015711)|purine nucleotide transport (GO:0015865)|transmembrane transport (GO:0055085)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|organic anion transmembrane transporter activity (GO:0008514)|purine nucleotide transmembrane transporter activity (GO:0015216)			breast(3)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(12)|lung(42)|ovary(3)|prostate(2)|skin(5)|urinary_tract(2)	83		all_cancers(37;0.127)|all_lung(18;0.132)|Breast(268;0.166)			Conjugated Estrogens(DB00286)|Folic Acid(DB00158)|Indomethacin(DB00328)|Methotrexate(DB00563)|Probenecid(DB01032)	ATCATGGACTGACAGTGGAGG	0.502																																					p.S121X		.											.	ABCC11-95	0			c.C362G						.						158.0	143.0	148.0					16																	48261750		2200	4300	6500	SO:0001587	stop_gained	85320	exon3			TGGACTGACAGTG	AF367202	CCDS10732.1, CCDS10733.1	16q12	2012-03-14			ENSG00000121270	ENSG00000121270		"""ATP binding cassette transporters / subfamily C"""	14639	protein-coding gene	gene with protein product		607040				11483364, 11435397	Standard	NM_033151		Approved	MRP8	uc002efg.1	Q96J66	OTTHUMG00000133146	ENST00000394747.1:c.362C>G	16.37:g.48261750G>C	ENSP00000378230:p.Ser121*	Somatic	151	0		WXS	Illumina GAIIx	Phase_I	111	20	NM_033151	0	0	0	0	0	Q8TDJ0|Q96JA6|Q9BX80	Nonsense_Mutation	SNP	ENST00000394747.1	37	CCDS10732.1	.	.	.	.	.	.	.	.	.	.	G	37	5.986469	0.97173	.	.	ENSG00000121270	ENST00000353782;ENST00000356608;ENST00000394748;ENST00000394747;ENST00000537808	.	.	.	5.53	4.58	0.56647	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.05959	T	0.93	-10.6164	10.257	0.43403	0.0909:0.0:0.9091:0.0	.	.	.	.	X	121	.	ENSP00000311326:S121X	S	-	2	0	ABCC11	46819251	0.997000	0.39634	0.648000	0.29521	0.448000	0.32197	3.178000	0.50879	1.348000	0.45733	0.655000	0.94253	TCA	.		0.502	ABCC11-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000429984.1	NM_032583	
CDH5	1003	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	16	66420935	66420935	+	Missense_Mutation	SNP	A	A	G			TCGA-OR-A5L2-01A-11D-A30A-10	TCGA-OR-A5L2-10A-01D-A30A-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b99bd79e-aa33-4896-8d10-2517c793f439	48e26b1d-b84d-432b-940b-9907c81ddf5b	g.chr16:66420935A>G	ENST00000341529.3	+	3	582	c.434A>G	c.(433-435)aAc>aGc	p.N145S	CDH5_ENST00000563425.2_Missense_Mutation_p.N145S	NM_001795.3	NP_001786.2	P33151	CADH5_HUMAN	cadherin 5, type 2 (vascular endothelium)	145	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|blood vessel maturation (GO:0001955)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)|negative regulation of cell proliferation (GO:0008285)|regulation of establishment of cell polarity (GO:2000114)	cell junction (GO:0030054)|cell-cell junction (GO:0005911)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|tight junction (GO:0005923)	beta-catenin binding (GO:0008013)|calcium ion binding (GO:0005509)|ion channel binding (GO:0044325)|receptor binding (GO:0005102)			central_nervous_system(1)|endometrium(3)|kidney(18)|large_intestine(2)|lung(17)|ovary(2)|prostate(5)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	54		Ovarian(137;0.0955)		OV - Ovarian serous cystadenocarcinoma(108;0.107)	Lenalidomide(DB00480)	CATGACGTGAACGACAACTGG	0.542																																					p.N145S		.											.	CDH5-525	0			c.A434G						.						134.0	103.0	113.0					16																	66420935		2202	4300	6502	SO:0001583	missense	1003	exon3			ACGTGAACGACAA	X79981	CCDS10804.1	16q22.1	2010-01-26	2008-07-25		ENSG00000179776	ENSG00000179776		"""CD molecules"", ""Cadherins / Major cadherins"""	1764	protein-coding gene	gene with protein product	"""VE-cadherin"""	601120	"""cadherin 5, type 2, VE-cadherin (vascular epithelium)"""			2059658	Standard	NM_001795		Approved	7B4, CD144	uc002eom.4	P33151	OTTHUMG00000137495	ENST00000341529.3:c.434A>G	16.37:g.66420935A>G	ENSP00000344115:p.Asn145Ser	Somatic	272	0		WXS	Illumina GAIIx	Phase_I	345	18	NM_001795	0	0	0	0	0	Q4VAI5|Q4VAI6	Missense_Mutation	SNP	ENST00000341529.3	37	CCDS10804.1	.	.	.	.	.	.	.	.	.	.	A	24.8	4.572509	0.86542	.	.	ENSG00000179776	ENST00000341529;ENST00000379531	D	0.85171	-1.95	5.49	5.49	0.81192	Cadherin (3);Cadherin conserved site (1);Cadherin-like (1);	.	.	.	.	D	0.95601	0.8570	H	0.99058	4.415	0.80722	D	1	D	0.89917	1.0	D	0.76575	0.988	D	0.97334	0.9952	9	0.87932	D	0	.	14.7103	0.69225	1.0:0.0:0.0:0.0	.	145	P33151	CADH5_HUMAN	S	145	ENSP00000344115:N145S	ENSP00000344115:N145S	N	+	2	0	CDH5	64978436	1.000000	0.71417	0.060000	0.19600	0.940000	0.58332	8.621000	0.90949	2.208000	0.71279	0.533000	0.62120	AAC	.		0.542	CDH5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268767.1	NM_001795	
KLHDC4	54758	bcgsc.ca	37	16	87788864	87788864	+	Missense_Mutation	SNP	G	G	A	rs2303771	byFrequency	TCGA-OR-A5L2-01A-11D-A30A-10	TCGA-OR-A5L2-10A-01D-A30A-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b99bd79e-aa33-4896-8d10-2517c793f439	48e26b1d-b84d-432b-940b-9907c81ddf5b	g.chr16:87788864G>A	ENST00000270583.5	-	4	363	c.305C>T	c.(304-306)aCc>aTc	p.T102I	KLHDC4_ENST00000347925.5_Missense_Mutation_p.T102I|KLHDC4_ENST00000353170.5_Missense_Mutation_p.T45I	NM_017566.3	NP_060036.2	Q8TBB5	KLDC4_HUMAN	kelch domain containing 4	102			T -> I (in dbSNP:rs2303771). {ECO:0000269|PubMed:15489334}.							breast(2)|endometrium(3)|lung(10)|pancreas(2)|prostate(1)|skin(1)|urinary_tract(2)	21				BRCA - Breast invasive adenocarcinoma(80;0.0283)		GTCCTTTCTGGTATTGTAGAC	0.483													A|||	2039	0.407149	0.3888	0.4481	5008	,	,		22238	0.3403		0.3539	False		,,,				2504	0.5266				p.T102I		.											.	KLHDC4-182	0			c.C305T						.	A	ILE/THR,ILE/THR,ILE/THR	1665,2731	654.8+/-399.8	318,1029,851	186.0	172.0	177.0		134,305,305	1.5	0.1	16	dbSNP_100	177	3025,5575	663.6+/-402.1	541,1943,1816	yes	missense,missense,missense	KLHDC4	NM_001184854.1,NM_001184856.1,NM_017566.3	89,89,89	859,2972,2667	AA,AG,GG		35.1744,37.8753,36.088	benign,benign,benign	45/464,102/490,102/521	87788864	4690,8306	2198	4300	6498	SO:0001583	missense	54758	exon4			TTTCTGGTATTGT	AK001742	CCDS10963.1, CCDS54050.1, CCDS54051.1	16q24	2008-02-05			ENSG00000104731	ENSG00000104731			25272	protein-coding gene	gene with protein product							Standard	NM_001184854		Approved	DKFZp434G0522	uc002fki.3	Q8TBB5	OTTHUMG00000137657	ENST00000270583.5:c.305C>T	16.37:g.87788864G>A	ENSP00000270583:p.Thr102Ile	Somatic	188	0		WXS	Illumina GAIIx	Phase_I	145	8	NM_001184856	0	0	0	0	0	D3DUN3|D3DUN4|D3DUN5|Q96F29|Q9BVN3	Missense_Mutation	SNP	ENST00000270583.5	37	CCDS10963.1	830	0.38003663003663	195	0.39634146341463417	152	0.4198895027624309	207	0.3618881118881119	276	0.3641160949868074	A	0.013	-1.635015	0.00806	0.378753	0.351744	ENSG00000104731	ENST00000270583;ENST00000347925;ENST00000353170	T;T;T	0.65549	1.1;1.1;-0.16	5.12	1.51	0.23008	Kelch-type beta propeller (1);	0.047155	0.85682	N	0.000000	T	0.00012	0.0000	N	0.00315	-1.66	0.53005	P	3.100000000000325E-5	B;B;B	0.09022	0.001;0.002;0.0	B;B;B	0.04013	0.001;0.001;0.001	T	0.42582	-0.9443	9	0.02654	T	1	-2.372	9.2513	0.37557	0.7072:0.0:0.2928:0.0	rs2303771;rs17845301;rs17858136;rs2303771	45;102;102	Q8TBB5-2;Q8TBB5-3;Q8TBB5	.;.;KLDC4_HUMAN	I	102;102;45	ENSP00000270583:T102I;ENSP00000325717:T102I;ENSP00000262530:T45I	ENSP00000270583:T102I	T	-	2	0	KLHDC4	86346365	1.000000	0.71417	0.068000	0.19968	0.048000	0.14542	4.201000	0.58439	-0.011000	0.14247	-0.361000	0.07541	ACC	G|0.634;A|0.366		0.483	KLHDC4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000269109.2	NM_017566	
RPL13	6137	hgsc.bcm.edu	37	16	89627671	89627671	+	Silent	SNP	C	C	T	rs174035	byFrequency	TCGA-OR-A5L2-01A-11D-A30A-10	TCGA-OR-A5L2-10A-01D-A30A-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b99bd79e-aa33-4896-8d10-2517c793f439	48e26b1d-b84d-432b-940b-9907c81ddf5b	g.chr16:89627671C>T	ENST00000393099.3	+	2	390	c.141C>T	c.(139-141)gcC>gcT	p.A47A	RPL13_ENST00000567815.1_Silent_p.A47A|RPL13_ENST00000311528.5_Silent_p.A47A|RPL13_ENST00000452368.3_Silent_p.A47A|SNORD68_ENST00000363214.1_RNA	NM_033251.2	NP_150254.1	P26373	RL13_HUMAN	ribosomal protein L13	47					cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|RNA metabolic process (GO:0016070)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)|translational elongation (GO:0006414)|translational initiation (GO:0006413)|translational termination (GO:0006415)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral transcription (GO:0019083)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|cytosolic large ribosomal subunit (GO:0022625)|cytosolic ribosome (GO:0022626)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|structural constituent of ribosome (GO:0003735)			lung(3)|skin(1)|upper_aerodigestive_tract(2)	6		all_hematologic(23;0.0748)		all cancers(4;1.15e-07)|OV - Ovarian serous cystadenocarcinoma(4;7.8e-06)|BRCA - Breast invasive adenocarcinoma(80;0.0139)		GCCGCATCGCCCCGCGCCCCG	0.741													C|||	720	0.14377	0.1256	0.1282	5008	,	,		12083	0.13		0.1839	False		,,,				2504	0.1524				p.A47A		.											.	RPL13-90	0			c.C141T						.	C	,	382,2954		24,334,1310	3.0	4.0	3.0		141,141	0.9	1.0	16	dbSNP_79	3	1125,5851		71,983,2434	no	coding-synonymous,coding-synonymous	RPL13	NM_000977.3,NM_033251.2	,	95,1317,3744	TT,TC,CC		16.1267,11.4508,14.614	,	47/212,47/212	89627671	1507,8805	1668	3488	5156	SO:0001819	synonymous_variant	6137	exon3			CATCGCCCCGCGC	AB007172	CCDS10979.1, CCDS58492.1	16q24.3	2011-04-06			ENSG00000167526	ENSG00000167526		"""L ribosomal proteins"""	10303	protein-coding gene	gene with protein product		113703				9582194	Standard	NM_000977		Approved	D16S444E, BBC1, L13	uc002fnm.2	P26373	OTTHUMG00000133770	ENST00000393099.3:c.141C>T	16.37:g.89627671C>T		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	20	12	NM_001243131	0	0	0	0	0	B4DLX3|F5H1S2|Q3KQT8|Q567Q8|Q9BPX0	Silent	SNP	ENST00000393099.3	37	CCDS10979.1																																																																																			C|0.846;T|0.154		0.741	RPL13-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000258294.2	NM_000977	
NOS2	4843	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	26110037	26110037	+	Missense_Mutation	SNP	A	A	T			TCGA-OR-A5L2-01A-11D-A30A-10	TCGA-OR-A5L2-10A-01D-A30A-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b99bd79e-aa33-4896-8d10-2517c793f439	48e26b1d-b84d-432b-940b-9907c81ddf5b	g.chr17:26110037A>T	ENST00000313735.6	-	6	796	c.563T>A	c.(562-564)tTc>tAc	p.F188Y		NM_000625.4	NP_000616.3	P35228	NOS2_HUMAN	nitric oxide synthase 2, inducible	188					arginine catabolic process (GO:0006527)|blood coagulation (GO:0007596)|cellular response to interferon-gamma (GO:0071346)|cellular response to lipopolysaccharide (GO:0071222)|circadian rhythm (GO:0007623)|defense response to bacterium (GO:0042742)|defense response to Gram-negative bacterium (GO:0050829)|inflammatory response (GO:0006954)|innate immune response in mucosa (GO:0002227)|interaction with host (GO:0051701)|negative regulation of blood pressure (GO:0045776)|negative regulation of gene expression (GO:0010629)|negative regulation of protein catabolic process (GO:0042177)|nitric oxide biosynthetic process (GO:0006809)|nitric oxide mediated signal transduction (GO:0007263)|peptidyl-cysteine S-nitrosylation (GO:0018119)|phagosome maturation (GO:0090382)|positive regulation of guanylate cyclase activity (GO:0031284)|positive regulation of killing of cells of other organism (GO:0051712)|positive regulation of leukocyte mediated cytotoxicity (GO:0001912)|positive regulation of vasodilation (GO:0045909)|regulation of cell proliferation (GO:0042127)|regulation of cellular respiration (GO:0043457)|regulation of insulin secretion (GO:0050796)|response to bacterium (GO:0009617)|response to hypoxia (GO:0001666)|superoxide metabolic process (GO:0006801)	cortical cytoskeleton (GO:0030863)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|intracellular (GO:0005622)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|peroxisome (GO:0005777)	arginine binding (GO:0034618)|flavin adenine dinucleotide binding (GO:0050660)|FMN binding (GO:0010181)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|NADP binding (GO:0050661)|NADPH-hemoprotein reductase activity (GO:0003958)|nitric-oxide synthase activity (GO:0004517)|protein homodimerization activity (GO:0042803)|receptor binding (GO:0005102)|tetrahydrobiopterin binding (GO:0034617)			autonomic_ganglia(1)|breast(2)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(8)|lung(28)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	56					Dexamethasone(DB01234)|Doxorubicin(DB00997)|L-Arginine(DB00125)|L-Citrulline(DB00155)|Miconazole(DB01110)|Triflusal(DB08814)	CTTGGTGGCGAAGATGAGCTC	0.552																																					p.F188Y		.											.	NOS2-156	0			c.T563A						.						251.0	176.0	201.0					17																	26110037		2203	4300	6503	SO:0001583	missense	4843	exon6			GTGGCGAAGATGA	U20141	CCDS11223.1	17q11.2	2014-06-12	2008-09-16	2008-09-16	ENSG00000007171	ENSG00000007171	1.14.13.39		7873	protein-coding gene	gene with protein product		163730	"""nitric oxide synthase 2A (inducible, hepatocytes)"""	NOS2A		7682706	Standard	NM_000625		Approved	iNOS, NOS, HEP-NOS	uc002gzu.3	P35228	OTTHUMG00000132445	ENST00000313735.6:c.563T>A	17.37:g.26110037A>T	ENSP00000327251:p.Phe188Tyr	Somatic	147	1		WXS	Illumina GAIIx	Phase_I	228	45	NM_000625	0	0	0	0	0	A1L3U5|B7ZLY2|O60757|O94994|Q16263|Q16692|Q4TTS5|Q9UD42	Missense_Mutation	SNP	ENST00000313735.6	37	CCDS11223.1	.	.	.	.	.	.	.	.	.	.	A	8.831	0.939976	0.18281	.	.	ENSG00000007171	ENST00000313735;ENST00000379105;ENST00000302153	T	0.19394	2.15	5.62	-0.0521	0.13824	Nitric oxide synthase, oxygenase domain (3);	0.486738	0.21246	N	0.077722	T	0.08582	0.0213	N	0.10874	0.06	0.42659	D	0.993472	B;B	0.14012	0.009;0.005	B;B	0.18561	0.006;0.022	T	0.30563	-0.9974	10	0.12766	T	0.61	.	7.4507	0.27237	0.3792:0.098:0.0:0.5228	.	188;188	F8WEM3;P35228	.;NOS2_HUMAN	Y	188	ENSP00000327251:F188Y	ENSP00000305638:F188Y	F	-	2	0	NOS2	23134164	0.974000	0.33945	0.497000	0.27552	0.907000	0.53573	1.894000	0.39768	-0.007000	0.14345	-0.395000	0.06472	TTC	.		0.552	NOS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255597.1	NM_000625	
ASIC2	40	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	31618452	31618452	+	Intron	SNP	G	G	C			TCGA-OR-A5L2-01A-11D-A30A-10	TCGA-OR-A5L2-10A-01D-A30A-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b99bd79e-aa33-4896-8d10-2517c793f439	48e26b1d-b84d-432b-940b-9907c81ddf5b	g.chr17:31618452G>C	ENST00000359872.6	-	2	1317				ASIC2_ENST00000448983.1_5'UTR|ASIC2_ENST00000225823.2_Missense_Mutation_p.L228V	NM_001094.4	NP_001085.2	Q16515	ASIC2_HUMAN	acid-sensing (proton-gated) ion channel 2						central nervous system development (GO:0007417)|detection of mechanical stimulus involved in sensory perception (GO:0050974)|ion transmembrane transport (GO:0034220)|monovalent inorganic cation transport (GO:0015672)|negative regulation of apoptotic process (GO:0043066)|peripheral nervous system development (GO:0007422)|phototransduction (GO:0007602)|positive regulation of synapse assembly (GO:0051965)|protein localization to synapse (GO:0035418)|regulation of blood coagulation (GO:0030193)|regulation of gene expression (GO:0010468)|regulation of membrane potential (GO:0042391)|regulation of systemic arterial blood pressure by aortic arch baroreceptor feedback (GO:0003026)|regulation of vasoconstriction (GO:0019229)|response to acid chemical (GO:0001101)|response to acidic pH (GO:0010447)|sensory perception of sound (GO:0007605)|sensory perception of sour taste (GO:0050915)|sodium ion transmembrane transport (GO:0035725)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	dendritic spine (GO:0043197)|integral component of plasma membrane (GO:0005887)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|synapse (GO:0045202)	ion gated channel activity (GO:0022839)|ligand-gated sodium channel activity (GO:0015280)|voltage-gated sodium channel activity (GO:0005248)									Amiloride(DB00594)	GGCCCGCAGAGCTCGCCGCGG	0.697																																					p.L228V		.											.	.	0			c.C682G						.						22.0	26.0	24.0					17																	31618452		2191	4275	6466	SO:0001627	intron_variant	40	exon1			CGCAGAGCTCGCC	AL834182	CCDS11276.1, CCDS42296.1	17q11.2-q12	2012-02-23	2012-02-22	2012-02-22	ENSG00000108684	ENSG00000108684		"""Ion channels / Acid-sensing (proton-gated) ion channels"""	99	protein-coding gene	gene with protein product	"""degenerin"""	601784	"""amiloride-sensitive cation channel 1, neuronal"""	ACCN, ACCN1		8921408	Standard	NM_183377		Approved	ASIC2a, BNC1, BNaC1, hBNaC1, MDEG	uc002hhu.3	Q16515	OTTHUMG00000132885	ENST00000359872.6:c.556-179367C>G	17.37:g.31618452G>C		Somatic	85	0		WXS	Illumina GAIIx	Phase_I	116	17	NM_183377	0	0	0	0	0	E9PBX2|Q13553|Q6DJU1|Q8N3E2	Missense_Mutation	SNP	ENST00000359872.6	37	CCDS42296.1	.	.	.	.	.	.	.	.	.	.	G	9.519	1.107706	0.20714	.	.	ENSG00000108684	ENST00000225823	T	0.62788	0.0	4.74	4.74	0.60224	.	0.697027	0.13809	N	0.361253	T	0.45094	0.1325	N	0.14661	0.345	0.80722	D	1	B	0.11235	0.004	B	0.17098	0.017	T	0.33497	-0.9866	10	0.34782	T	0.22	-14.056	11.0251	0.47741	0.0:0.1882:0.8118:0.0	.	228	E9PBX2	.	V	228	ENSP00000225823:L228V	ENSP00000225823:L228V	L	-	1	0	ACCN1	28642565	1.000000	0.71417	1.000000	0.80357	0.764000	0.43329	2.054000	0.41335	2.454000	0.82982	0.313000	0.20887	CTC	.		0.697	ASIC2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000447552.1	NM_183377, NM_001094	
RAD51D	5892	broad.mit.edu	37	17	33428353	33428353	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5L2-01A-11D-A30A-10	TCGA-OR-A5L2-10A-01D-A30A-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b99bd79e-aa33-4896-8d10-2517c793f439	48e26b1d-b84d-432b-940b-9907c81ddf5b	g.chr17:33428353C>T	ENST00000345365.6	-	9	1025	c.770G>A	c.(769-771)aGc>aAc	p.S257N	RAD51L3-RFFL_ENST00000593039.1_Missense_Mutation_p.S98N|RAD51D_ENST00000460118.2_Missense_Mutation_p.S138N|RAD51D_ENST00000360276.3_Missense_Mutation_p.S212N|RAD51D_ENST00000394589.4_Missense_Mutation_p.S257N|RAD51D_ENST00000590016.1_Missense_Mutation_p.S277N|RAD51D_ENST00000590380.1_5'UTR|RAD51D_ENST00000335858.7_Missense_Mutation_p.S145N	NM_002878.3	NP_002869.3	O75771	RA51D_HUMAN	RAD51 paralog D	257					ATP catabolic process (GO:0006200)|DNA repair (GO:0006281)|double-strand break repair via homologous recombination (GO:0000724)|reciprocal meiotic recombination (GO:0007131)|strand invasion (GO:0042148)|telomere maintenance (GO:0000723)	centrosome (GO:0005813)|chromosome, telomeric region (GO:0000781)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|Rad51B-Rad51C-Rad51D-XRCC2 complex (GO:0033063)|replication fork (GO:0005657)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA-dependent ATPase activity (GO:0008094)|gamma-tubulin binding (GO:0043015)|single-stranded DNA binding (GO:0003697)	p.S145N(1)|p.S277N(1)|p.S257N(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|large_intestine(2)|liver(1)|lung(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	13						GAGCCTCCCGCTGTCCCTGTC	0.552								Direct reversal of damage																													p.S277N		.											.	RAD51D-228	3	Substitution - Missense(3)	endometrium(3)	c.G830A						.						101.0	91.0	94.0					17																	33428353		2203	4300	6503	SO:0001583	missense	5892	exon9			CTCCCGCTGTCCC	AF034956	CCDS11287.1, CCDS11288.1, CCDS45646.1	17q11	2014-09-17	2013-07-02	2011-07-01	ENSG00000185379	ENSG00000185379			9823	protein-coding gene	gene with protein product	"""recombination repair protein"", ""DNA repair protein RAD51 homolog 4"""	602954	"""RAD51 (S. cerevisiae)-like 3"", ""RAD51-like 3 (S. cerevisiae)"", ""RAD51 homolog D (S. cerevisiae)"""	RAD51L3		9570954	Standard	NM_001142571		Approved	R51H3, Trad, HsTRAD	uc010ctj.2	O75771	OTTHUMG00000132930	ENST00000345365.6:c.770G>A	17.37:g.33428353C>T	ENSP00000338790:p.Ser257Asn	Somatic	41	0		WXS	Illumina GAIIx	Phase_I	65	3	NM_001142571	0	0	0	0	0	B4DJU7|E1P637|O43537|O60355|O75196|O75847|O75848|O76073|O76085|O94908|Q9UFU5	Missense_Mutation	SNP	ENST00000345365.6	37	CCDS11287.1	.	.	.	.	.	.	.	.	.	.	C	11.55	1.671386	0.29693	.	.	ENSG00000185379	ENST00000345365;ENST00000394589;ENST00000335858;ENST00000360276;ENST00000345766	T;T	0.65364	-0.15;-0.15	4.86	3.88	0.44766	ATPase, AAA+ type, core (1);DNA recombination and repair protein Rad51, C-terminal (1);	0.296032	0.42294	D	0.000736	T	0.47581	0.1453	N	0.21373	0.66	0.80722	D	1	B;B;B;B	0.21147	0.007;0.052;0.001;0.003	B;B;B;B	0.17433	0.007;0.018;0.01;0.004	T	0.49244	-0.8960	10	0.72032	D	0.01	-10.5839	11.8253	0.52263	0.0:0.6587:0.3413:0.0	.	277;145;257;257	B4DJU7;O75771-3;O75771;F8W8E6	.;.;RA51D_HUMAN;.	N	257;277;257;212;145	ENSP00000338790:S257N;ENSP00000353417:S212N	ENSP00000338408:S257N	S	-	2	0	RAD51D	30452466	0.229000	0.23729	0.860000	0.33809	0.834000	0.47266	0.555000	0.23422	1.394000	0.46624	0.655000	0.94253	AGC	.		0.552	RAD51D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256446.1	NM_002878	
AATF	26574	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	35310421	35310421	+	Missense_Mutation	SNP	G	G	C			TCGA-OR-A5L2-01A-11D-A30A-10	TCGA-OR-A5L2-10A-01D-A30A-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b99bd79e-aa33-4896-8d10-2517c793f439	48e26b1d-b84d-432b-940b-9907c81ddf5b	g.chr17:35310421G>C	ENST00000225402.5	+	3	770	c.519G>C	c.(517-519)gaG>gaC	p.E173D		NM_012138.3	NP_036270.1	Q9NY61	AATF_HUMAN	apoptosis antagonizing transcription factor	173	Glu-rich.				apoptotic signaling pathway (GO:0097190)|cell adhesion (GO:0007155)|cellular response to DNA damage stimulus (GO:0006974)|embryonic cleavage (GO:0040016)|negative regulation of amyloid precursor protein biosynthetic process (GO:0042985)|negative regulation of apoptotic process (GO:0043066)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of superoxide anion generation (GO:0032929)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of mitotic cell cycle (GO:0007346)|ribosome biogenesis (GO:0042254)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|nucleolus (GO:0005730)|nucleus (GO:0005634)	leucine zipper domain binding (GO:0043522)|poly(A) RNA binding (GO:0044822)|sequence-specific DNA binding transcription factor activity (GO:0003700)			cervix(2)|endometrium(1)|large_intestine(4)|lung(7)|ovary(2)|skin(2)	18		Breast(25;0.00607)				GTGAGGAGGAGGAAGACGAAG	0.517																																					p.E173D	NSCLC(49;901 1159 19183 41572 46244)	.											.	AATF-90	0			c.G519C						.						171.0	155.0	160.0					17																	35310421		2203	4300	6503	SO:0001583	missense	26574	exon3			GGAGGAGGAAGAC	AF083208	CCDS32632.1	17q12	2014-05-06			ENSG00000108270	ENSG00000275700			19235	protein-coding gene	gene with protein product		608463				11027528, 10783144	Standard	NM_012138		Approved	DED, CHE-1, CHE1, BFR2	uc002hni.3	Q9NY61	OTTHUMG00000188458	ENST00000225402.5:c.519G>C	17.37:g.35310421G>C	ENSP00000225402:p.Glu173Asp	Somatic	244	0		WXS	Illumina GAIIx	Phase_I	306	116	NM_012138	0	0	0	0	0	A6NCJ6|B3KQ26|Q9P0A4|Q9UNX5	Missense_Mutation	SNP	ENST00000225402.5	37	CCDS32632.1	.	.	.	.	.	.	.	.	.	.	G	4.825	0.153363	0.09185	.	.	ENSG00000108270	ENST00000225402	T	0.37058	1.22	5.57	-2.04	0.07343	.	0.438178	0.28971	N	0.013554	T	0.23171	0.0560	L	0.46157	1.445	0.30997	N	0.720718	B	0.18610	0.029	B	0.09377	0.004	T	0.29119	-1.0022	10	0.16896	T	0.51	-13.2614	7.8973	0.29715	0.5835:0.1209:0.2956:0.0	.	173	Q9NY61	AATF_HUMAN	D	173	ENSP00000225402:E173D	ENSP00000225402:E173D	E	+	3	2	AATF	32384534	0.017000	0.18338	0.887000	0.34795	0.892000	0.51952	-1.013000	0.03645	-0.624000	0.05611	-0.150000	0.13652	GAG	.		0.517	AATF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451543.1	NM_012138	
C17orf78	284099	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	35734873	35734873	+	Missense_Mutation	SNP	G	G	A	rs184660990	byFrequency	TCGA-OR-A5L2-01A-11D-A30A-10	TCGA-OR-A5L2-10A-01D-A30A-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b99bd79e-aa33-4896-8d10-2517c793f439	48e26b1d-b84d-432b-940b-9907c81ddf5b	g.chr17:35734873G>A	ENST00000300618.4	+	2	165	c.115G>A	c.(115-117)Gtg>Atg	p.V39M	ACACA_ENST00000416895.1_Intron|C17orf78_ENST00000586700.1_Missense_Mutation_p.V39M|ACACA_ENST00000353139.5_Intron	NM_173625.3	NP_775896.3	Q8N4C9	CQ078_HUMAN	chromosome 17 open reading frame 78	39						integral component of membrane (GO:0016021)				NS(1)|endometrium(1)|large_intestine(1)|lung(2)|stomach(1)	6		Breast(25;0.00295)|Ovarian(249;0.15)				CCCAAAAGACGTGAGAAGCAT	0.478													G|||	4	0.000798722	0.003	0.0	5008	,	,		11858	0.0		0.0	False		,,,				2504	0.0				p.V39M		.											.	.	0			c.G115A						.	G	MET/VAL,,	22,3702		0,22,1840	85.0	82.0	83.0		115,,	2.5	0.8	17		83	1,8207		0,1,4103	yes	missense,intron,intron	ACACA,C17orf78	NM_173625.3,NM_198834.1,NM_198839.1	21,,	0,23,5943	AA,AG,GG		0.0122,0.5908,0.1928	probably-damaging,,	39/276,,	35734873	23,11909	1862	4104	5966	SO:0001583	missense	284099	exon2			AAAGACGTGAGAA	BC034672	CCDS45655.1	17q12	2014-05-06			ENSG00000167230	ENSG00000278505			26831	protein-coding gene	gene with protein product						14702039	Standard	NM_173625		Approved	FLJ39647	uc002hns.3	Q8N4C9	OTTHUMG00000188467	ENST00000300618.4:c.115G>A	17.37:g.35734873G>A	ENSP00000300618:p.Val39Met	Somatic	262	0		WXS	Illumina GAIIx	Phase_I	323	49	NM_173625	0	0	0	0	0	Q8N8D2	Missense_Mutation	SNP	ENST00000300618.4	37	CCDS45655.1	3	0.0013736263736263737	3	0.006097560975609756	0	0.0	0	0.0	0	0.0	G	9.734	1.163160	0.21538	0.005908	1.22E-4	ENSG00000167230	ENST00000300618;ENST00000321564	T	0.48836	0.8	4.62	2.48	0.30137	.	0.809641	0.10650	N	0.649957	T	0.18841	0.0452	N	0.20986	0.625	0.24988	N	0.991559	P;P	0.42961	0.795;0.708	B;B	0.31101	0.086;0.124	T	0.06770	-1.0808	10	0.44086	T	0.13	0.0789	5.715	0.17954	0.2489:0.0:0.7511:0.0	.	39;39	Q8N4C9-2;Q8N4C9	.;CQ078_HUMAN	M	39	ENSP00000300618:V39M	ENSP00000300618:V39M	V	+	1	0	C17orf78	32808986	0.995000	0.38212	0.765000	0.31456	0.862000	0.49288	0.389000	0.20751	1.170000	0.42753	0.650000	0.86243	GTG	G|0.999;A|0.001		0.478	C17orf78-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451570.2	NM_173625	
KRTAP4-11	653240	broad.mit.edu	37	17	39274069	39274069	+	Missense_Mutation	SNP	G	G	C	rs349771	byFrequency	TCGA-OR-A5L2-01A-11D-A30A-10	TCGA-OR-A5L2-10A-01D-A30A-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b99bd79e-aa33-4896-8d10-2517c793f439	48e26b1d-b84d-432b-940b-9907c81ddf5b	g.chr17:39274069G>C	ENST00000391413.2	-	1	537	c.499C>G	c.(499-501)Cga>Gga	p.R167G		NM_033059.3	NP_149048.2	Q9BYQ6	KR411_HUMAN	keratin associated protein 4-11	167				R -> G (in Ref. 1; CAC27583 and 3; AAI26132/AAI30563). {ECO:0000305}.		keratin filament (GO:0045095)				endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|lung(8)|prostate(5)|skin(1)	33		Breast(137;0.000496)	STAD - Stomach adenocarcinoma(17;0.000371)			CAGGAGACTCGGCCACAGACT	0.662													g|||	2320	0.463259	0.4365	0.487	5008	,	,		17612	0.252		0.661	False		,,,				2504	0.4969				p.R167G		.											.	.	0			c.C499G						.						35.0	39.0	38.0					17																	39274069		692	1590	2282	SO:0001583	missense	653240	exon1			AGACTCGGCCACA	AC025904	CCDS45675.1	17q21.2	2013-06-25			ENSG00000212721	ENSG00000212721		"""Keratin associated proteins"""	18911	protein-coding gene	gene with protein product			"""keratin associated protein 4-14"""	KRTAP4-14			Standard	NM_033059		Approved	KAP4.11, KAP4.14	uc002hvz.3	Q9BYQ6	OTTHUMG00000133586	ENST00000391413.2:c.499C>G	17.37:g.39274069G>C	ENSP00000375232:p.Arg167Gly	Somatic	140	0		WXS	Illumina GAIIx	Phase_I	206	6	NM_033059	0	0	0	0	0	A0AUY2	Missense_Mutation	SNP	ENST00000391413.2	37	CCDS45675.1	994	0.4551282051282051	207	0.42073170731707316	186	0.5138121546961326	136	0.23776223776223776	465	0.6134564643799473	.	12.44	1.937647	0.34189	.	.	ENSG00000212721	ENST00000391413	T	0.00622	6.16	3.95	2.95	0.34219	.	.	.	.	.	T	0.00012	0.0000	L	0.36672	1.1	0.44643	P	0.0023760000000000447	B	0.29646	0.253	B	0.28305	0.088	T	0.00202	-1.1925	8	0.51188	T	0.08	.	11.1465	0.48434	0.0:0.0:0.8133:0.1867	rs349771;rs62066327	167	Q9BYQ6	KR411_HUMAN	G	167	ENSP00000375232:R167G	ENSP00000375232:R167G	R	-	1	2	KRTAP4-11	36527595	0.116000	0.22171	0.948000	0.38648	0.879000	0.50718	2.143000	0.42187	0.934000	0.37316	0.609000	0.83330	CGA	G|0.750;C|0.250		0.662	KRTAP4-11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257690.1		
KRT32	3882	broad.mit.edu	37	17	39619136	39619136	+	Missense_Mutation	SNP	C	C	T	rs553131906	byFrequency	TCGA-OR-A5L2-01A-11D-A30A-10	TCGA-OR-A5L2-10A-01D-A30A-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b99bd79e-aa33-4896-8d10-2517c793f439	48e26b1d-b84d-432b-940b-9907c81ddf5b	g.chr17:39619136C>T	ENST00000225899.3	-	6	1266	c.1163G>A	c.(1162-1164)cGg>cAg	p.R388Q		NM_002278.3	NP_002269.3	Q14532	K1H2_HUMAN	keratin 32	388	Coil 2.|Rod.				epidermis development (GO:0008544)	extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)	structural molecule activity (GO:0005198)			central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(6)|ovary(1)|prostate(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	21		Breast(137;0.000812)				GCCCTCCAGCCGGGCCCGGAC	0.632													C|||	2	0.000399361	0.0	0.0	5008	,	,		16397	0.0		0.0	False		,,,				2504	0.002				p.R388Q		.											.	KRT32-90	0			c.G1163A						.						75.0	76.0	75.0					17																	39619136		2203	4300	6503	SO:0001583	missense	3882	exon6			TCCAGCCGGGCCC	X90761	CCDS11393.1	17q21.2	2013-01-16	2006-07-17	2006-07-17	ENSG00000108759	ENSG00000108759		"""-"", ""Intermediate filaments type I, keratins (acidic)"""	6449	protein-coding gene	gene with protein product	"""hard keratin type I"""	602760	"""keratin, hair, acidic, 2"""	KRTHA2		7556444, 8823373, 16831889	Standard	NM_002278		Approved	Ha-2	uc002hwr.3	Q14532	OTTHUMG00000133430	ENST00000225899.3:c.1163G>A	17.37:g.39619136C>T	ENSP00000225899:p.Arg388Gln	Somatic	100	2		WXS	Illumina GAIIx	Phase_I	156	20	NM_002278	0	0	0	0	0		Missense_Mutation	SNP	ENST00000225899.3	37	CCDS11393.1	.	.	.	.	.	.	.	.	.	.	C	27.7	4.855185	0.91355	.	.	ENSG00000108759	ENST00000225899	D	0.89552	-2.53	5.07	5.07	0.68467	Filament (1);	0.000000	0.36409	N	0.002614	D	0.94218	0.8144	M	0.86028	2.79	0.37177	D	0.903297	D	0.89917	1.0	D	0.97110	1.0	D	0.95741	0.8783	10	0.72032	D	0.01	.	11.3137	0.49379	0.0:0.9165:0.0:0.0835	.	388	Q14532	K1H2_HUMAN	Q	388	ENSP00000225899:R388Q	ENSP00000225899:R388Q	R	-	2	0	KRT32	36872662	0.996000	0.38824	1.000000	0.80357	0.841000	0.47740	3.382000	0.52463	2.493000	0.84123	0.561000	0.74099	CGG	.		0.632	KRT32-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257293.1	NM_002278	
KLHL10	317719	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	17	39998282	39998282	+	Silent	SNP	A	A	T			TCGA-OR-A5L2-01A-11D-A30A-10	TCGA-OR-A5L2-10A-01D-A30A-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b99bd79e-aa33-4896-8d10-2517c793f439	48e26b1d-b84d-432b-940b-9907c81ddf5b	g.chr17:39998282A>T	ENST00000293303.4	+	2	555	c.402A>T	c.(400-402)tcA>tcT	p.S134S	KLHL10_ENST00000485613.1_3'UTR	NM_152467.3	NP_689680.2	Q6JEL2	KLH10_HUMAN	kelch-like family member 10	134					cell morphogenesis (GO:0000902)|fertilization (GO:0009566)|homeostasis of number of cells within a tissue (GO:0048873)|male genitalia morphogenesis (GO:0048808)|male gonad development (GO:0008584)|protein ubiquitination (GO:0016567)|spermatid development (GO:0007286)	cytoplasm (GO:0005737)				breast(1)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(5)|lung(7)|ovary(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	26		Breast(137;0.000162)				TCCTCAAGTCAGAGCTGTGCT	0.498																																					p.S134S		.											.	KLHL10-227	0			c.A402T						.						124.0	114.0	117.0					17																	39998282		1990	4168	6158	SO:0001819	synonymous_variant	317719	exon2			CAAGTCAGAGCTG	AK057224	CCDS42340.1	17q21.2	2013-01-30	2013-01-30		ENSG00000161594	ENSG00000161594		"""Kelch-like"", ""BTB/POZ domain containing"""	18829	protein-coding gene	gene with protein product		608778	"""kelch-like 10 (Drosophila)"""				Standard	NM_152467		Approved	FLJ32662	uc010cxr.3	Q6JEL2	OTTHUMG00000152510	ENST00000293303.4:c.402A>T	17.37:g.39998282A>T		Somatic	229	0		WXS	Illumina GAIIx	Phase_I	301	20	NM_152467	0	0	0	0	0	Q6NW28|Q96MC0	Silent	SNP	ENST00000293303.4	37	CCDS42340.1																																																																																			.		0.498	KLHL10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000326535.1	NM_152467	
TBX21	30009	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	45821703	45821703	+	Missense_Mutation	SNP	C	C	G			TCGA-OR-A5L2-01A-11D-A30A-10	TCGA-OR-A5L2-10A-01D-A30A-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b99bd79e-aa33-4896-8d10-2517c793f439	48e26b1d-b84d-432b-940b-9907c81ddf5b	g.chr17:45821703C>G	ENST00000177694.1	+	4	1122	c.911C>G	c.(910-912)gCc>gGc	p.A304G		NM_013351.1	NP_037483.1	Q9UL17	TBX21_HUMAN	T-box 21	304					cellular response to organic substance (GO:0071310)|lymphocyte migration (GO:0072676)|multicellular organismal development (GO:0007275)|positive regulation of isotype switching to IgG isotypes (GO:0048304)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|response to virus (GO:0009615)|T cell differentiation (GO:0030217)|transcription, DNA-templated (GO:0006351)	neuronal cell body (GO:0043025)|nucleus (GO:0005634)	sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			NS(1)|endometrium(1)|large_intestine(3)|lung(14)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)	22						GCCGTGACTGCCTACCAGAAT	0.577																																					p.A304G		.											.	TBX21-90	0			c.C911G						.						72.0	69.0	70.0					17																	45821703		2203	4300	6503	SO:0001583	missense	30009	exon4			TGACTGCCTACCA	AF093098	CCDS11514.1	17q21.2	2008-06-23				ENSG00000073861		"""T-boxes"""	11599	protein-coding gene	gene with protein product		604895					Standard	NM_013351		Approved	TBLYM, T-bet	uc002ilv.1	Q9UL17		ENST00000177694.1:c.911C>G	17.37:g.45821703C>G	ENSP00000177694:p.Ala304Gly	Somatic	177	0		WXS	Illumina GAIIx	Phase_I	211	26	NM_013351	0	0	0	0	0		Missense_Mutation	SNP	ENST00000177694.1	37	CCDS11514.1	.	.	.	.	.	.	.	.	.	.	C	29.4	5.006507	0.93287	.	.	ENSG00000073861	ENST00000177694	D	0.93307	-3.2	5.29	5.29	0.74685	p53-like transcription factor, DNA-binding (1);	0.000000	0.85682	D	0.000000	D	0.97813	0.9282	H	0.95504	3.68	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	D	0.99056	1.0829	10	0.87932	D	0	.	17.7017	0.88296	0.0:1.0:0.0:0.0	.	304	Q9UL17	TBX21_HUMAN	G	304	ENSP00000177694:A304G	ENSP00000177694:A304G	A	+	2	0	TBX21	43176702	1.000000	0.71417	0.998000	0.56505	0.971000	0.66376	7.796000	0.85898	2.465000	0.83290	0.563000	0.77884	GCC	.		0.577	TBX21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000441365.1	NM_013351	
WFIKKN2	124857	broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	48916914	48916914	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5L2-01A-11D-A30A-10	TCGA-OR-A5L2-10A-01D-A30A-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b99bd79e-aa33-4896-8d10-2517c793f439	48e26b1d-b84d-432b-940b-9907c81ddf5b	g.chr17:48916914G>A	ENST00000311378.4	+	2	793	c.265G>A	c.(265-267)Gtg>Atg	p.V89M	RP11-506D12.5_ENST00000572491.2_RNA|WFIKKN2_ENST00000426127.1_5'UTR	NM_175575.5	NP_783165.1	Q8TEU8	WFKN2_HUMAN	WAP, follistatin/kazal, immunoglobulin, kunitz and netrin domain containing 2	89	WAP. {ECO:0000255|PROSITE- ProRule:PRU00722}.				muscle fiber development (GO:0048747)|negative regulation of DNA binding (GO:0043392)|negative regulation of protein binding (GO:0032091)|palate development (GO:0060021)|skeletal system development (GO:0001501)|transforming growth factor beta receptor signaling pathway (GO:0007179)	extracellular region (GO:0005576)	metalloendopeptidase inhibitor activity (GO:0008191)|serine-type endopeptidase inhibitor activity (GO:0004867)			cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(3)|lung(13)|ovary(4)|skin(1)	29			BRCA - Breast invasive adenocarcinoma(22;1.09e-08)			CAAGAGCTGCGTGGCGGCCCG	0.582																																					p.V89M		.											.	WFIKKN2-93	0			c.G265A						.						45.0	46.0	45.0					17																	48916914		2203	4300	6503	SO:0001583	missense	124857	exon2			AGCTGCGTGGCGG	AY358142	CCDS11575.1	17q21.33	2013-01-21			ENSG00000173714	ENSG00000173714		"""Immunoglobulin superfamily / I-set domain containing"", ""WAP four-disulfide core domain containing"""	30916	protein-coding gene	gene with protein product	"""WAP four-disulfide core domain 20B"""	610895				11928817, 12709070	Standard	NM_175575		Approved	WFIKKNRP, WFDC20B	uc002isv.4	Q8TEU8	OTTHUMG00000162274	ENST00000311378.4:c.265G>A	17.37:g.48916914G>A	ENSP00000311184:p.Val89Met	Somatic	186	1		WXS	Illumina GAIIx	Phase_I	270	98	NM_175575	0	0	0	0	0	Q6UXZ9	Missense_Mutation	SNP	ENST00000311378.4	37	CCDS11575.1	.	.	.	.	.	.	.	.	.	.	G	22.9	4.345922	0.82022	.	.	ENSG00000173714	ENST00000311378	T	0.73152	-0.72	5.53	5.53	0.82687	Whey acidic protein, 4-disulphide core (5);	0.000000	0.85682	D	0.000000	D	0.85703	0.5758	M	0.80028	2.48	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.86972	0.2098	10	0.72032	D	0.01	.	19.4998	0.95089	0.0:0.0:1.0:0.0	.	89	Q8TEU8	WFKN2_HUMAN	M	89	ENSP00000311184:V89M	ENSP00000311184:V89M	V	+	1	0	WFIKKN2	46271913	1.000000	0.71417	0.952000	0.39060	0.938000	0.57974	9.866000	0.99616	2.593000	0.87608	0.645000	0.84053	GTG	.		0.582	WFIKKN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000368358.1	NM_175575	
TOM1L1	10040	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	52993172	52993172	+	Missense_Mutation	SNP	G	G	C			TCGA-OR-A5L2-01A-11D-A30A-10	TCGA-OR-A5L2-10A-01D-A30A-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b99bd79e-aa33-4896-8d10-2517c793f439	48e26b1d-b84d-432b-940b-9907c81ddf5b	g.chr17:52993172G>C	ENST00000575882.1	+	7	1022	c.669G>C	c.(667-669)ttG>ttC	p.L223F	TOM1L1_ENST00000575333.1_Missense_Mutation_p.L223F|TOM1L1_ENST00000540336.1_Missense_Mutation_p.L111F|TOM1L1_ENST00000445275.2_Missense_Mutation_p.L223F|TOM1L1_ENST00000572405.1_Missense_Mutation_p.L188F|TOM1L1_ENST00000572158.1_Missense_Mutation_p.L216F|TOM1L1_ENST00000570371.1_Missense_Mutation_p.L223F|TOM1L1_ENST00000348161.4_Missense_Mutation_p.L146F|TOM1L1_ENST00000536554.1_Missense_Mutation_p.L146F	NM_005486.2	NP_005477.2	O75674	TM1L1_HUMAN	target of myb1 (chicken)-like 1	223	GAT. {ECO:0000255|PROSITE- ProRule:PRU00373}.				activation of protein kinase activity (GO:0032147)|intracellular protein transport (GO:0006886)|negative regulation of mitosis (GO:0045839)|positive regulation of protein autophosphorylation (GO:0031954)|signal transduction (GO:0007165)|ubiquitin-dependent protein catabolic process via the multivesicular body sorting pathway (GO:0043162)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|lysosome (GO:0005764)|membrane (GO:0016020)	clathrin binding (GO:0030276)|protein kinase activator activity (GO:0030295)|protein kinase binding (GO:0019901)|ubiquitin binding (GO:0043130)			cervix(1)|endometrium(2)|kidney(3)|large_intestine(1)|lung(5)|ovary(1)|prostate(1)|skin(1)	15						CCGCCATATTGATGGAGAATA	0.428																																					p.L223F		.											.	TOM1L1-91	0			c.G669C						.						207.0	184.0	192.0					17																	52993172		2203	4300	6503	SO:0001583	missense	10040	exon7			CATATTGATGGAG	AJ010071	CCDS11582.1	17q23.2	2008-01-03	2007-01-12			ENSG00000141198			11983	protein-coding gene	gene with protein product		604701	"""target of myb1 (chicken) homolog-like 1"""			10329004, 15611048, 17977829	Standard	NM_005486		Approved	SRCASM	uc002iud.2	O75674		ENST00000575882.1:c.669G>C	17.37:g.52993172G>C	ENSP00000460823:p.Leu223Phe	Somatic	156	0		WXS	Illumina GAIIx	Phase_I	161	32	NM_005486	0	0	0	0	0	Q53G06|Q8N749	Missense_Mutation	SNP	ENST00000575882.1	37	CCDS11582.1	.	.	.	.	.	.	.	.	.	.	G	19.79	3.892567	0.72524	.	.	ENSG00000141198	ENST00000445275;ENST00000540336;ENST00000348161;ENST00000536554	T;T;T;T	0.67523	-0.27;-0.27;-0.27;-0.27	6.17	4.06	0.47325	GAT (2);	0.000000	0.53938	D	0.000048	T	0.79505	0.4457	M	0.82517	2.595	0.46609	D	0.999124	D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D	0.97110	0.999;1.0;0.999;1.0;1.0;1.0	T	0.80384	-0.1405	10	0.87932	D	0	-8.5239	6.1904	0.20520	0.3301:0.0:0.6699:0.0	.	111;216;146;223;223;146	B4DUW5;B4E1N0;B7Z9E2;O75674;Q8N749;B4E1M9	.;.;.;TM1L1_HUMAN;.;.	F	223;111;146;146	ENSP00000408958:L223F;ENSP00000441242:L111F;ENSP00000343901:L146F;ENSP00000443099:L146F	ENSP00000343901:L146F	L	+	3	2	TOM1L1	50348171	0.997000	0.39634	0.980000	0.43619	0.969000	0.65631	0.739000	0.26173	1.529000	0.49120	0.655000	0.94253	TTG	.		0.428	TOM1L1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000439029.2	NM_005486	
TBX4	9496	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	59560686	59560686	+	Nonsense_Mutation	SNP	C	C	T			TCGA-OR-A5L2-01A-11D-A30A-10	TCGA-OR-A5L2-10A-01D-A30A-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b99bd79e-aa33-4896-8d10-2517c793f439	48e26b1d-b84d-432b-940b-9907c81ddf5b	g.chr17:59560686C>T	ENST00000240335.1	+	8	1492	c.1447C>T	c.(1447-1449)Cga>Tga	p.R483*	TBX4_ENST00000589449.1_3'UTR|TBX4_ENST00000393853.4_Nonsense_Mutation_p.R484*	NM_018488.2	NP_060958.2	P57082	TBX4_HUMAN	T-box 4	483					angiogenesis (GO:0001525)|embryonic limb morphogenesis (GO:0030326)|limb morphogenesis (GO:0035108)|lung development (GO:0030324)|morphogenesis of an epithelium (GO:0002009)|multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|skeletal system morphogenesis (GO:0048705)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(1)|kidney(2)|large_intestine(6)|liver(2)|lung(15)|ovary(4)|prostate(2)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	40						GTCTCAGGTCCGAGAGCGGGG	0.617																																					p.R483X		.											.	TBX4-227	0			c.C1447T						.						58.0	60.0	59.0					17																	59560686		2203	4300	6503	SO:0001587	stop_gained	9496	exon8			CAGGTCCGAGAGC	AF188703	CCDS11629.1	17q21-q22	2005-10-11				ENSG00000121075		"""T-boxes"""	11603	protein-coding gene	gene with protein product		601719				10945475	Standard	NM_018488		Approved		uc002izi.3	P57082		ENST00000240335.1:c.1447C>T	17.37:g.59560686C>T	ENSP00000240335:p.Arg483*	Somatic	168	0		WXS	Illumina GAIIx	Phase_I	173	58	NM_018488	0	0	0	0	0	A5PKU7|B2RMT1|B7ZLV3	Nonsense_Mutation	SNP	ENST00000240335.1	37	CCDS11629.1	.	.	.	.	.	.	.	.	.	.	C	37	6.224765	0.97390	.	.	ENSG00000121075	ENST00000393853;ENST00000240335	.	.	.	5.34	5.34	0.76211	.	0.588886	0.18962	N	0.126367	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.0352	0.89298	0.0:1.0:0.0:0.0	.	.	.	.	X	484;483	.	.	R	+	1	2	TBX4	56915468	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	5.198000	0.65147	2.497000	0.84241	0.655000	0.94253	CGA	.		0.617	TBX4-002	KNOWN	alternative_5_UTR|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000449649.1	NM_018488	
PITPNC1	26207	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	65683182	65683182	+	Intron	SNP	A	A	G			TCGA-OR-A5L2-01A-11D-A30A-10	TCGA-OR-A5L2-10A-01D-A30A-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b99bd79e-aa33-4896-8d10-2517c793f439	48e26b1d-b84d-432b-940b-9907c81ddf5b	g.chr17:65683182A>G	ENST00000581322.1	+	9	682				PITPNC1_ENST00000299954.9_Splice_Site_p.D228G|PITPNC1_ENST00000580974.1_Splice_Site_p.D228G|PITPNC1_ENST00000335257.6_Intron			Q9UKF7	PITC1_HUMAN	phosphatidylinositol transfer protein, cytoplasmic 1						phospholipid transport (GO:0015914)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)	lipid binding (GO:0008289)|phosphatidylinositol transporter activity (GO:0008526)			breast(1)|kidney(2)|large_intestine(3)|liver(2)|lung(4)|prostate(2)|skin(3)	17	all_cancers(12;3.03e-10)		BRCA - Breast invasive adenocarcinoma(8;2.08e-08)|Colorectal(3;0.198)			CCTCTTTCAGATATGACAATG	0.423																																					p.D228G		.											.	PITPNC1-226	0			c.A683G						.						105.0	100.0	101.0					17																	65683182		1905	4124	6029	SO:0001627	intron_variant	26207	exon9			TTTCAGATATGAC	AF171102	CCDS58587.1, CCDS58588.1	17q24.3	2008-02-05							21045	protein-coding gene	gene with protein product		605134				10531358	Standard	NM_012417		Approved	RDGBB1, RDGBB, RDGB-BETA	uc002jgc.4	Q9UKF7		ENST00000581322.1:c.683-5506A>G	17.37:g.65683182A>G		Somatic	96	0		WXS	Illumina GAIIx	Phase_I	138	27	NM_181671	0	0	0	0	0	A8K473|J3QR20|Q96I07	Missense_Mutation	SNP	ENST00000581322.1	37	CCDS58588.1	.	.	.	.	.	.	.	.	.	.	A	13.75	2.328845	0.41197	.	.	ENSG00000154217	ENST00000299954	T	0.39056	1.1	5.13	5.13	0.70059	.	.	.	.	.	T	0.20659	0.0497	N	0.02708	-0.52	0.80722	D	1	B	0.11235	0.004	B	0.15052	0.012	T	0.10200	-1.0640	8	.	.	.	.	15.2284	0.73369	1.0:0.0:0.0:0.0	.	228	Q9UKF7-2	.	G	228	ENSP00000299954:D228G	.	D	+	2	0	PITPNC1	63113644	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	7.871000	0.87180	2.046000	0.60703	0.482000	0.46254	GAT	.		0.423	PITPNC1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000447194.1	NM_012417	
RBFOX3	146713	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	17	77093792	77093792	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5L2-01A-11D-A30A-10	TCGA-OR-A5L2-10A-01D-A30A-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b99bd79e-aa33-4896-8d10-2517c793f439	48e26b1d-b84d-432b-940b-9907c81ddf5b	g.chr17:77093792C>T	ENST00000453134.2	-	10	1116	c.604G>A	c.(604-606)Ggg>Agg	p.G202R	RBFOX3_ENST00000584778.1_Missense_Mutation_p.G202R|RBFOX3_ENST00000583458.1_Missense_Mutation_p.G201R|RBFOX3_ENST00000582043.1_Missense_Mutation_p.G171R|RBFOX3_ENST00000415831.1_Missense_Mutation_p.G202R|RBFOX3_ENST00000580155.1_Missense_Mutation_p.G202R			A6NFN3	RFOX3_HUMAN	RNA binding protein, fox-1 homolog (C. elegans) 3	202					mRNA processing (GO:0006397)|regulation of alternative mRNA splicing, via spliceosome (GO:0000381)|RNA splicing (GO:0008380)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|perikaryon (GO:0043204)	DNA binding (GO:0003677)|nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			endometrium(2)	2						AATTCAGGCCCGTAGACTGCG	0.607																																					p.D202N		.											.	.	0			c.G604A						.						90.0	87.0	88.0					17																	77093792		692	1591	2283	SO:0001583	missense	146713	exon10			CAGGCCCGTAGAC		CCDS45805.1	17q25.3	2013-02-12			ENSG00000167281	ENSG00000167281		"""RNA binding motif (RRM) containing"""	27097	protein-coding gene	gene with protein product	"""neuronal nuclei"", ""hexaribonucleotide binding protein 3"""					16260614	Standard	NM_001082575		Approved	FOX-3, NeuN, HRNBP3	uc010dhs.4	A6NFN3	OTTHUMG00000150183	ENST00000453134.2:c.604G>A	17.37:g.77093792C>T	ENSP00000393262:p.Gly202Arg	Somatic	221	0		WXS	Illumina GAIIx	Phase_I	350	62	NM_001082575	0	0	0	0	0	B4DEG6|B4DF29	Missense_Mutation	SNP	ENST00000453134.2	37	CCDS45805.1	.	.	.	.	.	.	.	.	.	.	C	14.46	2.542657	0.45280	.	.	ENSG00000167281	ENST00000338834;ENST00000415831;ENST00000453134	T;T	0.25250	1.81;1.81	4.27	4.27	0.50696	.	0.269330	0.29321	N	0.012483	T	0.17577	0.0422	N	0.19112	0.55	0.80722	D	1	B;B	0.32382	0.368;0.066	B;B	0.26094	0.066;0.01	T	0.08027	-1.0742	10	0.48119	T	0.1	-12.4672	16.4828	0.84162	0.0:1.0:0.0:0.0	.	202;202	B4DF29;A6NFN3	.;RFOX3_HUMAN	R	201;202;202	ENSP00000408395:G202R;ENSP00000393262:G202R	ENSP00000344726:G201R	G	-	1	0	RBFOX3	74605387	0.989000	0.36119	0.996000	0.52242	0.754000	0.42855	2.837000	0.48191	2.198000	0.70561	0.448000	0.29417	GGG	.		0.607	RBFOX3-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000437658.1	NM_001082575	
NPLOC4	55666	ucsc.edu;bcgsc.ca	37	17	79577266	79577266	+	Silent	SNP	C	C	T			TCGA-OR-A5L2-01A-11D-A30A-10	TCGA-OR-A5L2-10A-01D-A30A-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b99bd79e-aa33-4896-8d10-2517c793f439	48e26b1d-b84d-432b-940b-9907c81ddf5b	g.chr17:79577266C>T	ENST00000331134.6	-	5	620	c.405G>A	c.(403-405)ttG>ttA	p.L135L	NPLOC4_ENST00000539314.1_Intron|NPLOC4_ENST00000374747.5_Silent_p.L135L|NPLOC4_ENST00000574344.1_5'UTR	NM_017921.2	NP_060391.2	Q8TAT6	NPL4_HUMAN	nuclear protein localization 4 homolog (S. cerevisiae)	135					ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|Golgi organization (GO:0007030)|membrane fusion (GO:0061025)	endoplasmic reticulum (GO:0005783)|nuclear outer membrane-endoplasmic reticulum membrane network (GO:0042175)|nucleus (GO:0005634)	zinc ion binding (GO:0008270)			central_nervous_system(1)|kidney(1)|large_intestine(3)|lung(5)|ovary(1)	11	all_neural(118;0.0878)|Melanoma(429;0.242)|all_lung(278;0.246)		BRCA - Breast invasive adenocarcinoma(99;0.0282)|OV - Ovarian serous cystadenocarcinoma(97;0.0739)			CGCATTTCCCCAAAGGGCCGT	0.577																																					p.L135L		.											.	NPLOC4-24	0			c.G405A						.						31.0	34.0	33.0					17																	79577266		2084	4205	6289	SO:0001819	synonymous_variant	55666	exon5			TTTCCCCAAAGGG	AB040932	CCDS45812.1	17q25.3	2012-09-20			ENSG00000182446	ENSG00000182446			18261	protein-coding gene	gene with protein product		606590				11574150, 10811609	Standard	NM_017921		Approved	NPL4, FLJ20657, KIAA1499	uc002kas.3	Q8TAT6	OTTHUMG00000177990	ENST00000331134.6:c.405G>A	17.37:g.79577266C>T		Somatic	352	4		WXS	Illumina GAIIx	Phase_I	422	143	NM_017921	0	0	0	0	0	Q8N3J1|Q9H8V2|Q9H964|Q9NWR5|Q9P229	Silent	SNP	ENST00000331134.6	37	CCDS45812.1																																																																																			.		0.577	NPLOC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000440140.1		
CCDC178	374864	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	18	30926226	30926226	+	Missense_Mutation	SNP	C	C	G	rs530740303		TCGA-OR-A5L2-01A-11D-A30A-10	TCGA-OR-A5L2-10A-01D-A30A-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b99bd79e-aa33-4896-8d10-2517c793f439	48e26b1d-b84d-432b-940b-9907c81ddf5b	g.chr18:30926226C>G	ENST00000383096.3	-	9	789	c.607G>C	c.(607-609)Gac>Cac	p.D203H	CCDC178_ENST00000402325.1_Missense_Mutation_p.D203H|CCDC178_ENST00000583930.1_Missense_Mutation_p.D203H|CCDC178_ENST00000403303.1_Missense_Mutation_p.D203H|CCDC178_ENST00000579947.1_Missense_Mutation_p.D203H|CCDC178_ENST00000406524.2_Missense_Mutation_p.D203H|CCDC178_ENST00000579916.1_Intron|CCDC178_ENST00000300227.8_Missense_Mutation_p.D203H			Q5BJE1	CC178_HUMAN	coiled-coil domain containing 178	203																	GACCAAGAGTCAATTTTCATG	0.388													C|||	1	0.000199681	0.0	0.0014	5008	,	,		13814	0.0		0.0	False		,,,				2504	0.0				p.D203H		.											.	.	0			c.G607C						.						115.0	115.0	115.0					18																	30926226		2203	4300	6503	SO:0001583	missense	374864	exon8			AAGAGTCAATTTT	AK126038	CCDS11906.1, CCDS42424.1	18q12.1	2012-10-15	2012-10-15	2012-10-15	ENSG00000166960	ENSG00000166960			29588	protein-coding gene	gene with protein product			"""chromosome 18 open reading frame 34"""	C18orf34			Standard	NM_198995		Approved	FLJ44050	uc002kxn.2	Q5BJE1	OTTHUMG00000132279	ENST00000383096.3:c.607G>C	18.37:g.30926226C>G	ENSP00000372576:p.Asp203His	Somatic	95	0		WXS	Illumina GAIIx	Phase_I	96	9	NM_001105528	0	0	0	0	0	A6NDC6|J3KS92|Q6ZP67|Q6ZU20	Missense_Mutation	SNP	ENST00000383096.3	37	CCDS42424.1	.	.	.	.	.	.	.	.	.	.	C	11.35	1.614116	0.28712	.	.	ENSG00000166960	ENST00000403303;ENST00000383096;ENST00000300227;ENST00000406524;ENST00000402325;ENST00000399177	T;T;T;T;T;T	0.60548	1.56;1.56;1.63;1.57;1.62;0.18	5.59	5.59	0.84812	.	.	.	.	.	T	0.72301	0.3443	L	0.55990	1.75	0.38630	D	0.951353	D;D;D;D	0.89917	1.0;0.998;0.998;0.998	D;D;D;D	0.97110	1.0;0.971;0.971;0.971	T	0.74562	-0.3624	9	0.54805	T	0.06	-27.7455	16.5129	0.84290	0.0:1.0:0.0:0.0	.	203;203;203;203	F8W7A7;B5MD75;Q5BJE1-2;Q5BJE1	.;.;.;CR034_HUMAN	H	203	ENSP00000385591:D203H;ENSP00000372576:D203H;ENSP00000300227:D203H;ENSP00000385867:D203H;ENSP00000385234:D203H;ENSP00000382130:D203H	ENSP00000300227:D203H	D	-	1	0	C18orf34	29180224	1.000000	0.71417	1.000000	0.80357	0.803000	0.45373	4.659000	0.61504	2.636000	0.89361	0.557000	0.71058	GAC	.		0.388	CCDC178-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000255373.2	NM_198995	
LOXHD1	125336	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	18	44118286	44118286	+	Missense_Mutation	SNP	T	T	C			TCGA-OR-A5L2-01A-11D-A30A-10	TCGA-OR-A5L2-10A-01D-A30A-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b99bd79e-aa33-4896-8d10-2517c793f439	48e26b1d-b84d-432b-940b-9907c81ddf5b	g.chr18:44118286T>C	ENST00000398722.4	-	19	3093	c.3094A>G	c.(3094-3096)Atc>Gtc	p.I1032V	LOXHD1_ENST00000582408.1_Missense_Mutation_p.I199V|LOXHD1_ENST00000300591.6_Missense_Mutation_p.I199V|LOXHD1_ENST00000579038.1_Missense_Mutation_p.I103V|LOXHD1_ENST00000536736.1_Missense_Mutation_p.I1310V|LOXHD1_ENST00000441893.2_Missense_Mutation_p.I243V|LOXHD1_ENST00000441551.2_Missense_Mutation_p.I1104V			Q8IVV2	LOXH1_HUMAN	lipoxygenase homology domains 1	1032	PLAT 8. {ECO:0000255|PROSITE- ProRule:PRU00152}.				calcium ion transmembrane transport (GO:0070588)|detection of mechanical stimulus (GO:0050982)|sensory perception of sound (GO:0007605)	membrane (GO:0016020)|stereocilium (GO:0032420)	calcium channel activity (GO:0005262)			NS(3)|autonomic_ganglia(1)|breast(4)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|lung(2)|pancreas(1)|prostate(4)|skin(4)|stomach(1)	36						TAGAGGGTGATCTCGTAAGGA	0.502																																					p.I1310V		.											.	.	0			c.A3928G						.						142.0	122.0	128.0					18																	44118286		692	1591	2283	SO:0001583	missense	125336	exon26			GGGTGATCTCGTA	AK057232	CCDS45861.1, CCDS45862.1, CCDS54184.1	18q21.1	2009-09-11			ENSG00000167210	ENSG00000167210			26521	protein-coding gene	gene with protein product		613072	"""deafness, autosomal recessive 77"""	DFNB77		19732867	Standard	NM_144612		Approved	FLJ32670, LH2D1	uc010xcw.1	Q8IVV2	OTTHUMG00000132644	ENST00000398722.4:c.3094A>G	18.37:g.44118286T>C	ENSP00000381707:p.Ile1032Val	Somatic	118	0		WXS	Illumina GAIIx	Phase_I	134	27	NM_144612	0	0	0	0	0	B7WNN3|B7WNT1|B7WPI9|Q6ZRY7|Q86WW9|Q96DL7	Missense_Mutation	SNP	ENST00000398722.4	37		.	.	.	.	.	.	.	.	.	.	T	12.90	2.077293	0.36662	.	.	ENSG00000167210	ENST00000300591;ENST00000398722;ENST00000536736;ENST00000441893;ENST00000335730;ENST00000536111	T;T;T;T;T	0.58940	0.3;0.3;0.3;0.3;0.3	5.5	5.5	0.81552	Lipoxygenase, LH2 (3);Lipase/lipooxygenase, PLAT/LH2 (1);	0.000000	0.85682	D	0.000000	T	0.59609	0.2206	L	0.28115	0.83	0.44012	D	0.996725	P;P;P;P	0.49961	0.808;0.93;0.803;0.905	P;P;D;D	0.68039	0.867;0.902;0.924;0.955	T	0.54990	-0.8210	10	0.18276	T	0.48	.	10.77	0.46316	0.0:0.0739:0.0:0.9261	.	1310;243;1032;1032	F5GZB4;F8WA52;Q8IVV2-2;Q8IVV2	.;.;.;LOXH1_HUMAN	V	199;1032;1310;243;1032;212	ENSP00000300591:I199V;ENSP00000381707:I1032V;ENSP00000444586:I1310V;ENSP00000409062:I243V;ENSP00000440060:I212V	ENSP00000300591:I199V	I	-	1	0	LOXHD1	42372284	1.000000	0.71417	1.000000	0.80357	0.969000	0.65631	6.211000	0.72182	2.093000	0.63338	0.459000	0.35465	ATC	.		0.502	LOXHD1-201	KNOWN	basic	protein_coding	protein_coding		NM_144612	
ARID3A	1820	hgsc.bcm.edu	37	19	929753	929753	+	Silent	SNP	A	A	G	rs1799595	byFrequency	TCGA-OR-A5L2-01A-11D-A30A-10	TCGA-OR-A5L2-10A-01D-A30A-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b99bd79e-aa33-4896-8d10-2517c793f439	48e26b1d-b84d-432b-940b-9907c81ddf5b	g.chr19:929753A>G	ENST00000263620.3	+	2	552	c.225A>G	c.(223-225)ccA>ccG	p.P75P	AC005391.2_ENST00000585647.1_RNA	NM_005224.2	NP_005215.1	Q99856	ARI3A_HUMAN	AT rich interactive domain 3A (BRIGHT-like)	75						cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|membrane raft (GO:0045121)|nucleolus (GO:0005730)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(2)|ovary(1)	10		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;1.04e-05)|all_lung(49;1.53e-05)|Breast(49;9.42e-05)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		TGGGACACCCAGCCAGCCCCG	0.751													t|||	4428	0.884185	0.9062	0.804	5008	,	,		8534	0.998		0.836	False		,,,				2504	0.8436				p.P75P	Pancreas(29;54 1022 32760 50921)	.											.	ARID3A-90	0			c.A225G						.	G		3389,305		1555,279,13	4.0	5.0	5.0		225	-6.8	0.0	19	dbSNP_89	5	6619,1123		2834,951,86	no	coding-synonymous	ARID3A	NM_005224.2		4389,1230,99	GG,GA,AA		14.5053,8.2566,12.4869		75/594	929753	10008,1428	1847	3871	5718	SO:0001819	synonymous_variant	1820	exon2			ACACCCAGCCAGC	U88047	CCDS12050.1	19p13.3	2013-02-07	2006-11-08	2004-01-30		ENSG00000116017		"""-"""	3031	protein-coding gene	gene with protein product		603265	"""dead ringer-like 1 (Drosophila)"", ""AT rich interactive domain 3A (BRIGHT- like)"""	DRIL1		9722953	Standard	NM_005224		Approved	BRIGHT	uc002lql.3	Q99856		ENST00000263620.3:c.225A>G	19.37:g.929753A>G		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	11	11	NM_005224	0	0	0	0	0	Q5I858|Q6P9C6|Q8IZA7|Q8N4Z3	Silent	SNP	ENST00000263620.3	37	CCDS12050.1																																																																																			A|0.114;G|0.886		0.751	ARID3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458219.1	NM_005224	
KLF16	83855	hgsc.bcm.edu	37	19	1854557	1854557	+	Silent	SNP	A	A	G	rs3746045	byFrequency	TCGA-OR-A5L2-01A-11D-A30A-10	TCGA-OR-A5L2-10A-01D-A30A-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b99bd79e-aa33-4896-8d10-2517c793f439	48e26b1d-b84d-432b-940b-9907c81ddf5b	g.chr19:1854557A>G	ENST00000250916.4	-	2	730	c.660T>C	c.(658-660)ccT>ccC	p.P220P	CTB-31O20.6_ENST00000592884.1_RNA|KLF16_ENST00000592313.1_5'UTR	NM_031918.3	NP_114124.1	Q9BXK1	KLF16_HUMAN	Kruppel-like factor 16	220	Pro/Ser-rich.				dopamine receptor signaling pathway (GO:0007212)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			lung(1)	1		Ovarian(11;1.78e-06)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		TGCGGGCACCAGGGCGCCGGA	0.756													A|||	2119	0.423123	0.6785	0.4611	5008	,	,		10654	0.3829		0.2177	False		,,,				2504	0.3037				p.P220P		.											.	KLF16-90	0			c.T660C						.	A		2319,1817		694,931,443	10.0	16.0	14.0		660	-6.7	0.2	19	dbSNP_107	14	1682,6356		211,1260,2548	no	coding-synonymous	KLF16	NM_031918.3		905,2191,2991	GG,GA,AA		20.9256,43.9313,32.8651		220/253	1854557	4001,8173	2068	4019	6087	SO:0001819	synonymous_variant	83855	exon2			GGCACCAGGGCGC	AF327440	CCDS12075.1	19p13.3	2013-10-15			ENSG00000129911	ENSG00000129911		"""Kruppel-like transcription factors"", ""Zinc fingers, C2H2-type"""	16857	protein-coding gene	gene with protein product		606139				11438660	Standard	NM_031918		Approved	NSLP2, BTEB4, DRRF	uc002luc.3	Q9BXK1	OTTHUMG00000179994	ENST00000250916.4:c.660T>C	19.37:g.1854557A>G		Somatic	2	0		WXS	Illumina GAIIx	Phase_I	28	13	NM_031918	0	0	0	0	0		Silent	SNP	ENST00000250916.4	37	CCDS12075.1																																																																																			A|0.591;G|0.409		0.756	KLF16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000449214.1		
ABHD17A	81926	broad.mit.edu	37	19	1881527	1881527	+	Frame_Shift_Del	DEL	G	G	-	rs377128884		TCGA-OR-A5L2-01A-11D-A30A-10	TCGA-OR-A5L2-10A-01D-A30A-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b99bd79e-aa33-4896-8d10-2517c793f439	48e26b1d-b84d-432b-940b-9907c81ddf5b	g.chr19:1881527delG	ENST00000292577.7	-	2	472	c.39delC	c.(37-39)ttcfs	p.F13fs	ABHD17A_ENST00000250974.9_Frame_Shift_Del_p.F13fs|ABHD17A_ENST00000590661.1_Frame_Shift_Del_p.F13fs	NM_001130111.1	NP_001123583.1	Q96GS6	AB17A_HUMAN	abhydrolase domain containing 17A	13						extracellular region (GO:0005576)|membrane (GO:0016020)	hydrolase activity (GO:0016787)	p.F13delF(1)									GCGGGCAGCAGAAGAGGCAGC	0.756																																					p.F13fs		.											.	FAM108A1-90	1	Deletion - In frame(1)	upper_aerodigestive_tract(1)	c.39delC						.						9.0	13.0	11.0					19																	1881527		2041	4133	6174	SO:0001589	frameshift_variant	81926	exon2			GCAGCAGAAGAGG	BC020512	CCDS32867.1, CCDS45902.1	19p13.3	2013-03-15	2013-03-15	2013-03-15	ENSG00000129968	ENSG00000129968		"""Abhydrolase domain containing"""	28756	protein-coding gene	gene with protein product			"""chromosome 19 open reading frame 27"", ""family with sequence similarity 108, member A1"""	C19orf27, FAM108A1		14702039	Standard	NM_031213		Approved	MGC5244	uc002lug.3	Q96GS6	OTTHUMG00000171872	ENST00000292577.7:c.39delC	19.37:g.1881527delG	ENSP00000292577:p.Phe13fs	Somatic	16	0		WXS	Illumina GAIIx	Phase_I	69	7	NM_031213	0	0	0	0	0	A8K0G8|D6W5Z9|Q6PJU2|Q8WUH9|Q9BWL0|Q9H7Q9	Frame_Shift_Del	DEL	ENST00000292577.7	37	CCDS45902.1																																																																																			.		0.756	ABHD17A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000415556.2	NM_031213	
ABHD17A	81926	broad.mit.edu	37	19	1881529	1881530	+	Frame_Shift_Del	DEL	AG	AG	-			TCGA-OR-A5L2-01A-11D-A30A-10	TCGA-OR-A5L2-10A-01D-A30A-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b99bd79e-aa33-4896-8d10-2517c793f439	48e26b1d-b84d-432b-940b-9907c81ddf5b	g.chr19:1881529_1881530delAG	ENST00000292577.7	-	2	469_470	c.36_37delCT	c.(34-39)ctcttcfs	p.F13fs	ABHD17A_ENST00000250974.9_Frame_Shift_Del_p.F13fs|ABHD17A_ENST00000590661.1_Frame_Shift_Del_p.F13fs	NM_001130111.1	NP_001123583.1	Q96GS6	AB17A_HUMAN	abhydrolase domain containing 17A	13						extracellular region (GO:0005576)|membrane (GO:0016020)	hydrolase activity (GO:0016787)										GGGCAGCAGAAGAGGCAGCAGA	0.762																																					p.12_13del		.											.	FAM108A1-90	0			c.36_37del						.																																			SO:0001589	frameshift_variant	81926	exon2			AGCAGAAGAGGCA	BC020512	CCDS32867.1, CCDS45902.1	19p13.3	2013-03-15	2013-03-15	2013-03-15	ENSG00000129968	ENSG00000129968		"""Abhydrolase domain containing"""	28756	protein-coding gene	gene with protein product			"""chromosome 19 open reading frame 27"", ""family with sequence similarity 108, member A1"""	C19orf27, FAM108A1		14702039	Standard	NM_031213		Approved	MGC5244	uc002lug.3	Q96GS6	OTTHUMG00000171872	ENST00000292577.7:c.36_37delCT	19.37:g.1881531_1881532delAG	ENSP00000292577:p.Phe13fs	Somatic	16	0		WXS	Illumina GAIIx	Phase_I	68	7	NM_031213	0	0	0	0	0	A8K0G8|D6W5Z9|Q6PJU2|Q8WUH9|Q9BWL0|Q9H7Q9	Frame_Shift_Del	DEL	ENST00000292577.7	37	CCDS45902.1																																																																																			.		0.762	ABHD17A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000415556.2	NM_031213	
ADAT3	113179	hgsc.bcm.edu	37	19	1912251	1912251	+	Missense_Mutation	SNP	A	A	G	rs150715312	byFrequency	TCGA-OR-A5L2-01A-11D-A30A-10	TCGA-OR-A5L2-10A-01D-A30A-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b99bd79e-aa33-4896-8d10-2517c793f439	48e26b1d-b84d-432b-940b-9907c81ddf5b	g.chr19:1912251A>G	ENST00000602400.1	+	2	385	c.157A>G	c.(157-159)Aag>Gag	p.K53E	SCAMP4_ENST00000414057.2_Intron|SCAMP4_ENST00000409472.1_Intron|SCAMP4_ENST00000316097.8_Intron|ADAT3_ENST00000329478.2_Missense_Mutation_p.K69E			Q96EY9	ADAT3_HUMAN	adenosine deaminase, tRNA-specific 3	53					tRNA processing (GO:0008033)		hydrolase activity (GO:0016787)|zinc ion binding (GO:0008270)			breast(1)|kidney(3)|pancreas(1)|skin(2)	7		Ovarian(11;2.11e-07)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		CGTCCTGGACAAGCGCCAGAC	0.731													A|||	14	0.00279553	0.0008	0.0072	5008	,	,		11791	0.0		0.008	False		,,,				2504	0.0				p.K69E		.											.	ADAT3-154	0			c.A205G						.	A	,GLU/LYS	19,4335		0,19,2158	12.0	13.0	13.0		,157	3.8	0.9	19	dbSNP_134	13	144,8388		0,144,4122	yes	intron,missense	SCAMP4,ADAT3	NM_079834.2,NM_138422.1	,56	0,163,6280	GG,GA,AA		1.6878,0.4364,1.2649	,probably-damaging	,53/352	1912251	163,12723	2177	4266	6443	SO:0001583	missense	113179	exon2			CTGGACAAGCGCC	BC011824	CCDS12076.1, CCDS12076.2	19p13.3	2011-05-19	2011-05-19		ENSG00000213638	ENSG00000213638			25151	protein-coding gene	gene with protein product	"""tRNA-specific adenosine deaminase 3 homolog (S. cerevisiae)"""	615302	"""adenosine deaminase, tRNA-specific 3, TAD3 homolog (S. cerevisiae)"""			12457566	Standard	NM_138422		Approved	TAD3	uc002luh.4	Q96EY9	OTTHUMG00000154591	ENST00000602400.1:c.157A>G	19.37:g.1912251A>G	ENSP00000473571:p.Lys53Glu	Somatic	10	0		WXS	Illumina GAIIx	Phase_I	64	18	NM_138422	0	0	0	0	0		Missense_Mutation	SNP	ENST00000602400.1	37		9	0.004120879120879121	1	0.0020325203252032522	2	0.0055248618784530384	0	0.0	6	0.0079155672823219	a	15.08	2.726322	0.48833	0.004364	0.016878	ENSG00000213638	ENST00000329478;ENST00000454697	.	.	.	4.81	3.79	0.43588	.	0.168491	0.50627	D	0.000108	T	0.41119	0.1145	M	0.69185	2.1	0.41829	D	0.990062	P	0.40970	0.734	B	0.42798	0.398	T	0.52034	-0.8629	9	0.56958	D	0.05	-18.1231	9.6141	0.39681	0.797:0.203:0.0:0.0	.	53	Q96EY9	ADAT3_HUMAN	E	53	.	ENSP00000332448:K53E	K	+	1	0	ADAT3	1863251	1.000000	0.71417	0.864000	0.33941	0.072000	0.16883	2.446000	0.44908	0.712000	0.32039	0.523000	0.50628	AAG	A|0.993;G|0.007		0.731	ADAT3-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_138422	
DOHH	83475	broad.mit.edu	37	19	3496745	3496745	+	Missense_Mutation	SNP	G	G	T			TCGA-OR-A5L2-01A-11D-A30A-10	TCGA-OR-A5L2-10A-01D-A30A-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b99bd79e-aa33-4896-8d10-2517c793f439	48e26b1d-b84d-432b-940b-9907c81ddf5b	g.chr19:3496745G>T	ENST00000427575.1	-	2	519	c.68C>A	c.(67-69)gCc>gAc	p.A23D	DOHH_ENST00000250937.3_Missense_Mutation_p.A23D	NM_001145165.1	NP_001138637.1			deoxyhypusine hydroxylase/monooxygenase											central_nervous_system(1)|large_intestine(1)|lung(1)	3				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.00253)|STAD - Stomach adenocarcinoma(1328;0.18)		CCGGAAGCGGGCCTGCAGGGG	0.672																																					p.A23D		.											.	DOHH-90	0			c.C68A						.						30.0	34.0	33.0					19																	3496745		2203	4299	6502	SO:0001583	missense	83475	exon2			AAGCGGGCCTGCA	BC002817	CCDS12108.1	19p13.3	2008-02-05	2006-05-22	2006-05-22		ENSG00000129932			28662	protein-coding gene	gene with protein product		611262	"""HEAT-like (PBS lyase) repeat containing 1"""	HLRC1		16371467, 16533814	Standard	NM_031304		Approved	MGC4293	uc002lxs.3	Q9BU89		ENST00000427575.1:c.68C>A	19.37:g.3496745G>T	ENSP00000398882:p.Ala23Asp	Somatic	24	1		WXS	Illumina GAIIx	Phase_I	147	12	NM_001145165	0	0	0	0	0		Missense_Mutation	SNP	ENST00000427575.1	37	CCDS12108.1	.	.	.	.	.	.	.	.	.	.	G	6.366	0.435651	0.12104	.	.	ENSG00000129932	ENST00000427575;ENST00000250937	.	.	.	4.28	4.28	0.50868	Armadillo-like helical (1);	0.572614	0.17864	N	0.159432	T	0.30324	0.0761	L	0.45352	1.415	0.26414	N	0.97622	B	0.06786	0.001	B	0.08055	0.003	T	0.16364	-1.0405	9	0.12766	T	0.61	-7.5811	8.1479	0.31124	0.1119:0.0:0.8881:0.0	.	23	Q9BU89	DOHH_HUMAN	D	23	.	ENSP00000250937:A23D	A	-	2	0	DOHH	3447745	0.999000	0.42202	1.000000	0.80357	0.689000	0.40095	4.666000	0.61554	1.947000	0.56498	0.561000	0.74099	GCC	.		0.672	DOHH-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452932.1	NM_031304	
C19orf10	56005	hgsc.bcm.edu	37	19	4670313	4670313	+	Missense_Mutation	SNP	C	C	G	rs2270090	byFrequency	TCGA-OR-A5L2-01A-11D-A30A-10	TCGA-OR-A5L2-10A-01D-A30A-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b99bd79e-aa33-4896-8d10-2517c793f439	48e26b1d-b84d-432b-940b-9907c81ddf5b	g.chr19:4670313C>G	ENST00000262947.3	-	1	69	c.34G>C	c.(34-36)Ggc>Cgc	p.G12R	C19orf10_ENST00000599630.1_Missense_Mutation_p.G12R	NM_019107.3	NP_061980.1	Q969H8	CS010_HUMAN	chromosome 19 open reading frame 10	12			G -> R (in dbSNP:rs2270090).		activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)	endoplasmic reticulum lumen (GO:0005788)|extracellular vesicular exosome (GO:0070062)				haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)	2		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.015)		AAGCTCGCGCCGACGCCGTTC	0.756													c|||	1444	0.288339	0.6589	0.098	5008	,	,		7783	0.2411		0.1103	False		,,,				2504	0.1544				p.G12R		.											.	C19orf10-90	0			c.G34C						.	C	ARG/GLY	1761,2025		414,933,546	4.0	5.0	4.0		34	-4.8	0.0	19	dbSNP_100	4	578,6710		38,502,3104	yes	missense	C19orf10	NM_019107.3	125	452,1435,3650	GG,GC,CC		7.9308,46.5135,21.1215	benign	12/174	4670313	2339,8735	1893	3644	5537	SO:0001583	missense	56005	exon1			TCGCGCCGACGCC	AF282264	CCDS12133.1	19p13.3	2013-11-27	2003-06-25	2003-06-27	ENSG00000074842	ENSG00000074842			16948	protein-coding gene	gene with protein product		606746	"""interleukin 27 working designation"""	IL27, IL27w		17362502, 21128247	Standard	NM_019107		Approved	R33729_1, IL25, SF20, IL-25, IL-27	uc002may.3	Q969H8		ENST00000262947.3:c.34G>C	19.37:g.4670313C>G	ENSP00000262947:p.Gly12Arg	Somatic	1	0		WXS	Illumina GAIIx	Phase_I	9	7	NM_019107	0	0	0	0	0	D6W628|O75256|O75272|Q9BTK7|Q9NP69	Missense_Mutation	SNP	ENST00000262947.3	37	CCDS12133.1	541	0.24771062271062272	295	0.5995934959349594	32	0.08839779005524862	134	0.23426573426573427	80	0.10554089709762533	C	13.04	2.119829	0.37436	0.465135	0.079308	ENSG00000074842	ENST00000262947	T	0.47177	0.85	3.82	-4.84	0.03151	.	1.090020	0.07201	U	0.857494	T	0.00012	0.0000	N	0.02011	-0.69	0.80722	P	0.0	B	0.09022	0.002	B	0.15052	0.012	T	0.44329	-0.9335	9	0.59425	D	0.04	-5.96	1.5568	0.02586	0.118:0.2656:0.2321:0.3842	rs2270090;rs60071392	12	Q969H8	CS010_HUMAN	R	12	ENSP00000262947:G12R	ENSP00000262947:G12R	G	-	1	0	C19orf10	4621313	0.000000	0.05858	0.000000	0.03702	0.035000	0.12851	-2.427000	0.01026	-1.087000	0.03081	-0.513000	0.04457	GGC	C|0.752;G|0.248		0.756	C19orf10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458937.1	NM_019107	
TNFSF9	8744	broad.mit.edu	37	19	6534816	6534816	+	Missense_Mutation	SNP	G	G	T			TCGA-OR-A5L2-01A-11D-A30A-10	TCGA-OR-A5L2-10A-01D-A30A-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b99bd79e-aa33-4896-8d10-2517c793f439	48e26b1d-b84d-432b-940b-9907c81ddf5b	g.chr19:6534816G>T	ENST00000245817.3	+	3	542	c.504G>T	c.(502-504)caG>caT	p.Q168H		NM_003811.3	NP_003802.1	P41273	TNFL9_HUMAN	tumor necrosis factor (ligand) superfamily, member 9	168					apoptotic process (GO:0006915)|cell proliferation (GO:0008283)|cell-cell signaling (GO:0007267)|immune response (GO:0006955)|myeloid dendritic cell differentiation (GO:0043011)|positive regulation of activated T cell proliferation (GO:0042104)|positive regulation of cytotoxic T cell differentiation (GO:0045585)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of interleukin-12 production (GO:0032735)|positive regulation of interleukin-6 production (GO:0032755)|signal transduction (GO:0007165)	extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	receptor binding (GO:0005102)			central_nervous_system(1)|lung(1)|ovary(1)|prostate(1)|skin(1)	5						TGCACCTGCAGCCACTGCGCT	0.667																																					p.Q168H		.											.	TNFSF9-227	0			c.G504T						.						22.0	24.0	24.0					19																	6534816		2193	4293	6486	SO:0001583	missense	8744	exon3			CCTGCAGCCACTG	U03398	CCDS12169.1	19p13.3	2008-07-22				ENSG00000125657		"""Tumor necrosis factor (ligand) superfamily"""	11939	protein-coding gene	gene with protein product	"""receptor 4-1BB ligand"", ""homolog of mouse 4-1BB-L"""	606182				8405064, 8088337	Standard	NM_003811		Approved	4-1BB-L	uc002mfh.2	P41273		ENST00000245817.3:c.504G>T	19.37:g.6534816G>T	ENSP00000245817:p.Gln168His	Somatic	23	1		WXS	Illumina GAIIx	Phase_I	82	8	NM_003811	0	0	0	0	0	Q2M3S2	Missense_Mutation	SNP	ENST00000245817.3	37	CCDS12169.1	.	.	.	.	.	.	.	.	.	.	g	15.84	2.953140	0.53293	.	.	ENSG00000125657	ENST00000245817	D	0.94537	-3.45	4.22	3.16	0.36331	Tumour necrosis factor (3);Tumour necrosis factor-like (2);	0.894418	0.09236	U	0.829901	D	0.94515	0.8234	L	0.51422	1.61	0.09310	N	1	D	0.63046	0.992	P	0.57425	0.82	D	0.86711	0.1936	10	0.52906	T	0.07	-13.2152	7.3277	0.26566	0.1224:0.0:0.8776:0.0	.	168	P41273	TNFL9_HUMAN	H	168	ENSP00000245817:Q168H	ENSP00000245817:Q168H	Q	+	3	2	TNFSF9	6485816	0.003000	0.15002	0.138000	0.22173	0.018000	0.09664	0.539000	0.23175	2.075000	0.62263	0.537000	0.68136	CAG	.		0.667	TNFSF9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000457856.1	NM_003811	
CD209	30835	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	7808071	7808071	+	Missense_Mutation	SNP	C	C	T	rs200282091		TCGA-OR-A5L2-01A-11D-A30A-10	TCGA-OR-A5L2-10A-01D-A30A-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b99bd79e-aa33-4896-8d10-2517c793f439	48e26b1d-b84d-432b-940b-9907c81ddf5b	g.chr19:7808071C>T	ENST00000315599.7	-	7	1091	c.1069G>A	c.(1069-1071)Gcg>Acg	p.A357T	CD209_ENST00000301357.8_Missense_Mutation_p.A221T|CD209_ENST00000601951.1_Missense_Mutation_p.A333T|CD209_ENST00000315591.8_Missense_Mutation_p.A333T|CD209_ENST00000394161.5_Missense_Mutation_p.A121T|CD209_ENST00000394173.4_Missense_Mutation_p.A196T|CD209_ENST00000593660.1_Missense_Mutation_p.A287T|CD209_ENST00000602261.1_Missense_Mutation_p.A265T|CD209_ENST00000601256.1_Missense_Mutation_p.R295H|CD209_ENST00000354397.6_Missense_Mutation_p.A351T|CD209_ENST00000204801.8_Missense_Mutation_p.A313T|CD209_ENST00000593821.1_Missense_Mutation_p.A221T	NM_001144895.1|NM_001144897.1|NM_021155.3	NP_001138367.1|NP_001138369.1|NP_066978.1	Q9NNX6	CD209_HUMAN	CD209 molecule	357	C-type lectin. {ECO:0000255|PROSITE- ProRule:PRU00040}.				antigen processing and presentation (GO:0019882)|cell-cell recognition (GO:0009988)|endocytosis (GO:0006897)|heterophilic cell-cell adhesion (GO:0007157)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|intracellular transport of virus (GO:0075733)|leukocyte cell-cell adhesion (GO:0007159)|modulation by virus of host morphology or physiology (GO:0019048)|peptide antigen transport (GO:0046968)|regulation of T cell proliferation (GO:0042129)|viral genome replication (GO:0019079)|virion attachment to host cell (GO:0019062)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)|mannose binding (GO:0005537)|metal ion binding (GO:0046872)|peptide antigen binding (GO:0042605)|virion binding (GO:0046790)			endometrium(7)|kidney(3)|large_intestine(6)|lung(10)|ovary(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	35						CTAAATTCCGCGCAGTCTTCC	0.527													c|||	1	0.000199681	0.0008	0.0	5008	,	,		19290	0.0		0.0	False		,,,				2504	0.0				p.A357T		.											.	CD209-91	0			c.G1069A						.	C	THR/ALA,THR/ALA,THR/ALA,THR/ALA,THR/ALA,THR/ALA,THR/ALA	0,4406		0,0,2203	251.0	229.0	236.0		661,937,793,997,1051,586,1069	3.5	0.0	19		236	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense,missense,missense,missense,missense,missense	CD209	NM_001144893.1,NM_001144894.1,NM_001144895.1,NM_001144896.1,NM_001144897.1,NM_001144899.1,NM_021155.3	58,58,58,58,58,58,58	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	benign,benign,benign,benign,benign,benign,benign	221/269,313/361,265/313,333/381,351/399,196/244,357/405	7808071	1,13005	2203	4300	6503	SO:0001583	missense	30835	exon7			ATTCCGCGCAGTC	M98457	CCDS12186.1, CCDS45949.1, CCDS45950.1, CCDS45951.1, CCDS45952.1, CCDS59344.1, CCDS59345.1	19p13	2011-08-30	2006-03-28			ENSG00000090659		"""C-type lectin domain containing"", ""CD molecules"""	1641	protein-coding gene	gene with protein product		604672	"""CD209 antigen"""			1518869	Standard	NM_021155		Approved	DC-SIGN, CDSIGN, DC-SIGN1, CLEC4L	uc002mht.2	Q9NNX6		ENST00000315599.7:c.1069G>A	19.37:g.7808071C>T	ENSP00000315477:p.Ala357Thr	Somatic	130	0		WXS	Illumina GAIIx	Phase_I	147	44	NM_021155	0	0	0	0	0	A8KAM4|A8MVQ9|G5E9C4|Q2TB19|Q96QP7|Q96QP8|Q96QP9|Q96QQ0|Q96QQ1|Q96QQ2|Q96QQ3|Q96QQ4|Q96QQ5|Q96QQ6|Q96QQ7|Q96QQ8	Missense_Mutation	SNP	ENST00000315599.7	37	CCDS12186.1	1	4.578754578754579E-4	1	0.0020325203252032522	0	0.0	0	0.0	0	0.0	C	14.08	2.427520	0.43122	0.0	1.16E-4	ENSG00000090659	ENST00000315599;ENST00000354397;ENST00000315591;ENST00000204801;ENST00000394173;ENST00000301357;ENST00000394161	T;T;T;T;T;T	0.20463	2.07;2.07;2.07;2.07;2.07;2.07	3.45	3.45	0.39498	C-type lectin fold (1);C-type lectin, conserved site (1);C-type lectin-like (1);C-type lectin (3);	.	.	.	.	T	0.40815	0.1132	M	0.69463	2.115	0.09310	N	1	B;D;D;D;P;B;D;D;D;P;D	0.69078	0.438;0.997;0.985;0.996;0.93;0.379;0.975;0.957;0.986;0.903;0.96	B;D;B;D;B;B;B;B;P;B;B	0.65573	0.054;0.936;0.351;0.933;0.182;0.024;0.432;0.15;0.556;0.064;0.239	T	0.08391	-1.0724	9	0.66056	D	0.02	.	10.7263	0.46070	0.0:1.0:0.0:0.0	.	357;121;351;313;221;333;265;357;287;333;357	B2R907;Q9NNX6-4;Q9NNX6-2;Q9NNX6-7;Q9NNX6-8;Q9NNX6-6;G5E9C4;Q9NNX6;Q9NNX6-11;Q9NNX6-10;Q9NNX6-5	.;.;.;.;.;.;.;CD209_HUMAN;.;.;.	T	357;351;333;313;265;221;121	ENSP00000315477:A357T;ENSP00000346373:A351T;ENSP00000315407:A333T;ENSP00000204801:A313T;ENSP00000301357:A221T;ENSP00000377716:A121T	ENSP00000204801:A313T	A	-	1	0	CD209	7714071	0.006000	0.16342	0.012000	0.15200	0.015000	0.08874	2.594000	0.46189	2.221000	0.72209	0.455000	0.32223	GCG	C|0.999;T|0.000		0.527	CD209-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000462241.1	NM_021155	
HNRNPM	4670	broad.mit.edu	37	19	8550869	8550869	+	Frame_Shift_Del	DEL	C	C	-	rs575586653	byFrequency	TCGA-OR-A5L2-01A-11D-A30A-10	TCGA-OR-A5L2-10A-01D-A30A-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b99bd79e-aa33-4896-8d10-2517c793f439	48e26b1d-b84d-432b-940b-9907c81ddf5b	g.chr19:8550869delC	ENST00000325495.4	+	14	1598	c.1557delC	c.(1555-1557)ggcfs	p.G519fs	HNRNPM_ENST00000348943.3_Frame_Shift_Del_p.G480fs	NM_005968.4	NP_005959.2	P52272	HNRPM_HUMAN	heterogeneous nuclear ribonucleoprotein M	519	27 X 6 AA repeats of [GEVSTPAN]-[ILMV]- [DE]-[RH]-[MLVI]-[GAV].				alternative mRNA splicing, via spliceosome (GO:0000380)|gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)	catalytic step 2 spliceosome (GO:0071013)|extracellular matrix (GO:0031012)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|nuclear matrix (GO:0016363)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|paraspeckles (GO:0042382)|spliceosomal complex (GO:0005681)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|protein domain specific binding (GO:0019904)|RNA binding (GO:0003723)			endometrium(5)|kidney(2)|large_intestine(7)|lung(10)|ovary(1)	25						AGCGCATGGGCCCTGCCATCG	0.687																																					p.G519fs		.											.	HNRNPM-68	0			c.1557delC						.						47.0	50.0	49.0					19																	8550869		2202	4298	6500	SO:0001589	frameshift_variant	4670	exon14			CATGGGCCCTGCC	L03532	CCDS12203.1, CCDS12204.1	19p13.2	2013-06-12		2008-04-18	ENSG00000099783	ENSG00000099783		"""RNA binding motif (RRM) containing"""	5046	protein-coding gene	gene with protein product	"""CEA receptor"""	160994		NAGR1, HNRPM		8441656, 7558047	Standard	NM_005968		Approved	HTGR1, HNRNPM4, HNRPM4, CEAR	uc010dwe.3	P52272	OTTHUMG00000182383	ENST00000325495.4:c.1557delC	19.37:g.8550869delC	ENSP00000325376:p.Gly519fs	Somatic	39	0		WXS	Illumina GAIIx	Phase_I	168	11	NM_005968	0	0	0	0	0	Q15584|Q8WZ44|Q96H56|Q9BWL9|Q9Y492	Frame_Shift_Del	DEL	ENST00000325495.4	37	CCDS12203.1																																																																																			.		0.687	HNRNPM-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000460894.1		
HNRNPM	4670	hgsc.bcm.edu	37	19	8550870	8550870	+	Missense_Mutation	SNP	C	C	T	rs376409485|rs575586653	byFrequency	TCGA-OR-A5L2-01A-11D-A30A-10	TCGA-OR-A5L2-10A-01D-A30A-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b99bd79e-aa33-4896-8d10-2517c793f439	48e26b1d-b84d-432b-940b-9907c81ddf5b	g.chr19:8550870C>T	ENST00000325495.4	+	14	1599	c.1558C>T	c.(1558-1560)Cct>Tct	p.P520S	HNRNPM_ENST00000348943.3_Missense_Mutation_p.P481S	NM_005968.4	NP_005959.2	P52272	HNRPM_HUMAN	heterogeneous nuclear ribonucleoprotein M	520	27 X 6 AA repeats of [GEVSTPAN]-[ILMV]- [DE]-[RH]-[MLVI]-[GAV].				alternative mRNA splicing, via spliceosome (GO:0000380)|gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)	catalytic step 2 spliceosome (GO:0071013)|extracellular matrix (GO:0031012)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|nuclear matrix (GO:0016363)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|paraspeckles (GO:0042382)|spliceosomal complex (GO:0005681)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|protein domain specific binding (GO:0019904)|RNA binding (GO:0003723)			endometrium(5)|kidney(2)|large_intestine(7)|lung(10)|ovary(1)	25						GCGCATGGGCCCTGCCATCGA	0.692																																					p.P520S		.											.	HNRNPM-68	0			c.C1558T						.	C	SER/PRO,SER/PRO	0,4404		0,0,2202	47.0	50.0	49.0		1558,1441	4.6	1.0	19		49	2,8592		0,2,4295	no	missense,missense	HNRNPM	NM_005968.4,NM_031203.3	74,74	0,2,6497	TT,TC,CC		0.0233,0.0,0.0154	benign,benign	520/731,481/692	8550870	2,12996	2202	4297	6499	SO:0001583	missense	4670	exon14			ATGGGCCCTGCCA	L03532	CCDS12203.1, CCDS12204.1	19p13.2	2013-06-12		2008-04-18	ENSG00000099783	ENSG00000099783		"""RNA binding motif (RRM) containing"""	5046	protein-coding gene	gene with protein product	"""CEA receptor"""	160994		NAGR1, HNRPM		8441656, 7558047	Standard	NM_005968		Approved	HTGR1, HNRNPM4, HNRPM4, CEAR	uc010dwe.3	P52272	OTTHUMG00000182383	ENST00000325495.4:c.1558C>T	19.37:g.8550870C>T	ENSP00000325376:p.Pro520Ser	Somatic	39	0		WXS	Illumina GAIIx	Phase_I	168	23	NM_005968	0	0	0	0	0	Q15584|Q8WZ44|Q96H56|Q9BWL9|Q9Y492	Missense_Mutation	SNP	ENST00000325495.4	37	CCDS12203.1	.	.	.	.	.	.	.	.	.	.	C	10.35	1.325620	0.24080	0.0	2.33E-4	ENSG00000099783	ENST00000325495;ENST00000348943;ENST00000544159;ENST00000539473	T;T	0.17691	2.26;2.61	5.63	4.57	0.56435	.	0.171248	0.53938	D	0.000049	T	0.04588	0.0125	N	0.01352	-0.895	0.39801	D	0.972579	B;B;B;B	0.13145	0.007;0.0;0.002;0.002	B;B;B;B	0.12156	0.007;0.001;0.004;0.004	T	0.39840	-0.9594	10	0.17832	T	0.49	.	4.2807	0.10831	0.2417:0.583:0.0:0.1753	.	360;520;481;405	Q7KYM9;P52272;P52272-2;Q59ES8	.;HNRPM_HUMAN;.;.	S	520;481;405;77	ENSP00000325376:P520S;ENSP00000325732:P481S	ENSP00000325376:P520S	P	+	1	0	HNRNPM	8456870	0.001000	0.12720	1.000000	0.80357	0.998000	0.95712	0.371000	0.20450	2.644000	0.89710	0.591000	0.81541	CCT	.		0.692	HNRNPM-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000460894.1		
HNRNPM	4670	hgsc.bcm.edu	37	19	8550874	8550874	+	Missense_Mutation	SNP	C	C	G	rs370937476|rs575586653	byFrequency	TCGA-OR-A5L2-01A-11D-A30A-10	TCGA-OR-A5L2-10A-01D-A30A-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b99bd79e-aa33-4896-8d10-2517c793f439	48e26b1d-b84d-432b-940b-9907c81ddf5b	g.chr19:8550874C>G	ENST00000325495.4	+	14	1603	c.1562C>G	c.(1561-1563)gCc>gGc	p.A521G	HNRNPM_ENST00000348943.3_Missense_Mutation_p.A482G	NM_005968.4	NP_005959.2	P52272	HNRPM_HUMAN	heterogeneous nuclear ribonucleoprotein M	521	27 X 6 AA repeats of [GEVSTPAN]-[ILMV]- [DE]-[RH]-[MLVI]-[GAV].				alternative mRNA splicing, via spliceosome (GO:0000380)|gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)	catalytic step 2 spliceosome (GO:0071013)|extracellular matrix (GO:0031012)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|nuclear matrix (GO:0016363)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|paraspeckles (GO:0042382)|spliceosomal complex (GO:0005681)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|protein domain specific binding (GO:0019904)|RNA binding (GO:0003723)			endometrium(5)|kidney(2)|large_intestine(7)|lung(10)|ovary(1)	25						ATGGGCCCTGCCATCGAGCGC	0.697													C|||	5	0.000998403	0.0015	0.0	5008	,	,		15677	0.0		0.003	False		,,,				2504	0.0				p.A521G		.											.	HNRNPM-68	0			c.C1562G						.	C	GLY/ALA,GLY/ALA	0,4404		0,0,2202	47.0	50.0	49.0		1562,1445	5.4	1.0	19		49	2,8594		0,2,4296	no	missense,missense	HNRNPM	NM_005968.4,NM_031203.3	60,60	0,2,6498	GG,GC,CC		0.0233,0.0,0.0154	benign,benign	521/731,482/692	8550874	2,12998	2202	4298	6500	SO:0001583	missense	4670	exon14			GCCCTGCCATCGA	L03532	CCDS12203.1, CCDS12204.1	19p13.2	2013-06-12		2008-04-18	ENSG00000099783	ENSG00000099783		"""RNA binding motif (RRM) containing"""	5046	protein-coding gene	gene with protein product	"""CEA receptor"""	160994		NAGR1, HNRPM		8441656, 7558047	Standard	NM_005968		Approved	HTGR1, HNRNPM4, HNRPM4, CEAR	uc010dwe.3	P52272	OTTHUMG00000182383	ENST00000325495.4:c.1562C>G	19.37:g.8550874C>G	ENSP00000325376:p.Ala521Gly	Somatic	39	0		WXS	Illumina GAIIx	Phase_I	167	38	NM_005968	0	0	0	0	0	Q15584|Q8WZ44|Q96H56|Q9BWL9|Q9Y492	Missense_Mutation	SNP	ENST00000325495.4	37	CCDS12203.1	.	.	.	.	.	.	.	.	.	.	C	8.300	0.819643	0.16607	0.0	2.33E-4	ENSG00000099783	ENST00000325495;ENST00000348943;ENST00000544159;ENST00000539473	T;T	0.12879	2.64;2.96	5.43	5.43	0.79202	.	0.148125	0.64402	D	0.000014	T	0.05273	0.0140	N	0.01729	-0.75	0.29766	N	0.835121	B;B;B;B	0.06786	0.001;0.0;0.0;0.0	B;B;B;B	0.06405	0.001;0.001;0.002;0.001	T	0.23797	-1.0178	10	0.13108	T	0.6	.	12.9774	0.58544	0.0:0.7331:0.2668:0.0	.	361;521;482;406	Q7KYM9;P52272;P52272-2;Q59ES8	.;HNRPM_HUMAN;.;.	G	521;482;406;78	ENSP00000325376:A521G;ENSP00000325732:A482G	ENSP00000325376:A521G	A	+	2	0	HNRNPM	8456874	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	5.052000	0.64263	2.537000	0.85549	0.591000	0.81541	GCC	.		0.697	HNRNPM-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000460894.1		
HNRNPM	4670	hgsc.bcm.edu	37	19	8550876	8550876	+	Missense_Mutation	SNP	A	A	G	rs373994547|rs575586653	byFrequency	TCGA-OR-A5L2-01A-11D-A30A-10	TCGA-OR-A5L2-10A-01D-A30A-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b99bd79e-aa33-4896-8d10-2517c793f439	48e26b1d-b84d-432b-940b-9907c81ddf5b	g.chr19:8550876A>G	ENST00000325495.4	+	14	1605	c.1564A>G	c.(1564-1566)Atc>Gtc	p.I522V	HNRNPM_ENST00000348943.3_Missense_Mutation_p.I483V	NM_005968.4	NP_005959.2	P52272	HNRPM_HUMAN	heterogeneous nuclear ribonucleoprotein M	522	27 X 6 AA repeats of [GEVSTPAN]-[ILMV]- [DE]-[RH]-[MLVI]-[GAV].				alternative mRNA splicing, via spliceosome (GO:0000380)|gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)	catalytic step 2 spliceosome (GO:0071013)|extracellular matrix (GO:0031012)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|nuclear matrix (GO:0016363)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|paraspeckles (GO:0042382)|spliceosomal complex (GO:0005681)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|protein domain specific binding (GO:0019904)|RNA binding (GO:0003723)			endometrium(5)|kidney(2)|large_intestine(7)|lung(10)|ovary(1)	25						GGGCCCTGCCATCGAGCGCAT	0.692																																					p.I522V		.											.	HNRNPM-68	0			c.A1564G						.	A	VAL/ILE,VAL/ILE	0,4404		0,0,2202	48.0	51.0	50.0		1564,1447	5.4	1.0	19		50	2,8594		0,2,4296	no	missense,missense	HNRNPM	NM_005968.4,NM_031203.3	29,29	0,2,6498	GG,GA,AA		0.0233,0.0,0.0154	benign,benign	522/731,483/692	8550876	2,12998	2202	4298	6500	SO:0001583	missense	4670	exon14			CCTGCCATCGAGC	L03532	CCDS12203.1, CCDS12204.1	19p13.2	2013-06-12		2008-04-18	ENSG00000099783	ENSG00000099783		"""RNA binding motif (RRM) containing"""	5046	protein-coding gene	gene with protein product	"""CEA receptor"""	160994		NAGR1, HNRPM		8441656, 7558047	Standard	NM_005968		Approved	HTGR1, HNRNPM4, HNRPM4, CEAR	uc010dwe.3	P52272	OTTHUMG00000182383	ENST00000325495.4:c.1564A>G	19.37:g.8550876A>G	ENSP00000325376:p.Ile522Val	Somatic	40	0		WXS	Illumina GAIIx	Phase_I	170	24	NM_005968	0	0	0	0	0	Q15584|Q8WZ44|Q96H56|Q9BWL9|Q9Y492	Missense_Mutation	SNP	ENST00000325495.4	37	CCDS12203.1	.	.	.	.	.	.	.	.	.	.	A	13.26	2.184337	0.38609	0.0	2.33E-4	ENSG00000099783	ENST00000325495;ENST00000348943;ENST00000544159;ENST00000539473	T;T	0.14022	2.54;2.87	5.43	5.43	0.79202	.	0.235442	0.49916	D	0.000140	T	0.12475	0.0303	L	0.34521	1.04	0.34455	D	0.701075	B;B;B;B	0.20780	0.048;0.003;0.006;0.011	B;B;B;B	0.19148	0.024;0.005;0.015;0.014	T	0.09707	-1.0662	10	0.39692	T	0.17	.	14.3119	0.66422	1.0:0.0:0.0:0.0	.	362;522;483;407	Q7KYM9;P52272;P52272-2;Q59ES8	.;HNRPM_HUMAN;.;.	V	522;483;407;79	ENSP00000325376:I522V;ENSP00000325732:I483V	ENSP00000325376:I522V	I	+	1	0	HNRNPM	8456876	1.000000	0.71417	0.994000	0.49952	0.987000	0.75469	2.265000	0.43311	2.053000	0.61076	0.482000	0.46254	ATC	.		0.692	HNRNPM-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000460894.1		
HNRNPM	4670	hgsc.bcm.edu	37	19	8550878	8550878	+	Missense_Mutation	SNP	C	C	G	rs376025950|rs575586653	byFrequency	TCGA-OR-A5L2-01A-11D-A30A-10	TCGA-OR-A5L2-10A-01D-A30A-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b99bd79e-aa33-4896-8d10-2517c793f439	48e26b1d-b84d-432b-940b-9907c81ddf5b	g.chr19:8550878C>G	ENST00000325495.4	+	14	1607	c.1566C>G	c.(1564-1566)atC>atG	p.I522M	HNRNPM_ENST00000348943.3_Missense_Mutation_p.I483M	NM_005968.4	NP_005959.2	P52272	HNRPM_HUMAN	heterogeneous nuclear ribonucleoprotein M	522	27 X 6 AA repeats of [GEVSTPAN]-[ILMV]- [DE]-[RH]-[MLVI]-[GAV].				alternative mRNA splicing, via spliceosome (GO:0000380)|gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)	catalytic step 2 spliceosome (GO:0071013)|extracellular matrix (GO:0031012)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|nuclear matrix (GO:0016363)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|paraspeckles (GO:0042382)|spliceosomal complex (GO:0005681)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|protein domain specific binding (GO:0019904)|RNA binding (GO:0003723)			endometrium(5)|kidney(2)|large_intestine(7)|lung(10)|ovary(1)	25						GCCCTGCCATCGAGCGCATGG	0.692													C|||	5	0.000998403	0.0015	0.0	5008	,	,		15791	0.0		0.003	False		,,,				2504	0.0				p.I522M		.											.	HNRNPM-68	0			c.C1566G						.	C	MET/ILE,MET/ILE	0,4404		0,0,2202	48.0	51.0	50.0		1566,1449	-9.6	0.9	19		50	3,8593		0,3,4295	no	missense,missense	HNRNPM	NM_005968.4,NM_031203.3	10,10	0,3,6497	GG,GC,CC		0.0349,0.0,0.0231	benign,benign	522/731,483/692	8550878	3,12997	2202	4298	6500	SO:0001583	missense	4670	exon14			TGCCATCGAGCGC	L03532	CCDS12203.1, CCDS12204.1	19p13.2	2013-06-12		2008-04-18	ENSG00000099783	ENSG00000099783		"""RNA binding motif (RRM) containing"""	5046	protein-coding gene	gene with protein product	"""CEA receptor"""	160994		NAGR1, HNRPM		8441656, 7558047	Standard	NM_005968		Approved	HTGR1, HNRNPM4, HNRPM4, CEAR	uc010dwe.3	P52272	OTTHUMG00000182383	ENST00000325495.4:c.1566C>G	19.37:g.8550878C>G	ENSP00000325376:p.Ile522Met	Somatic	40	0		WXS	Illumina GAIIx	Phase_I	169	40	NM_005968	0	0	0	0	0	Q15584|Q8WZ44|Q96H56|Q9BWL9|Q9Y492	Missense_Mutation	SNP	ENST00000325495.4	37	CCDS12203.1	.	.	.	.	.	.	.	.	.	.	C	9.451	1.090543	0.20471	0.0	3.49E-4	ENSG00000099783	ENST00000325495;ENST00000348943;ENST00000544159;ENST00000539473	T;T	0.14391	2.51;2.84	5.43	-9.63	0.00544	.	0.235442	0.49916	N	0.000140	T	0.03651	0.0104	N	0.15975	0.35	0.28883	N	0.894307	B;B;B;B	0.16802	0.019;0.001;0.005;0.004	B;B;B;B	0.14578	0.011;0.003;0.01;0.004	T	0.29119	-1.0022	10	0.14252	T	0.57	.	3.2628	0.06854	0.0832:0.2421:0.2641:0.4106	.	362;522;483;407	Q7KYM9;P52272;P52272-2;Q59ES8	.;HNRPM_HUMAN;.;.	M	522;483;407;79	ENSP00000325376:I522M;ENSP00000325732:I483M	ENSP00000325376:I522M	I	+	3	3	HNRNPM	8456878	0.783000	0.28701	0.915000	0.36163	0.987000	0.75469	-0.325000	0.07976	-1.012000	0.03387	-0.312000	0.09012	ATC	.		0.692	HNRNPM-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000460894.1		
LPAR2	9170	broad.mit.edu;bcgsc.ca	37	19	19737970	19737970	+	Missense_Mutation	SNP	C	C	T	rs575876718		TCGA-OR-A5L2-01A-11D-A30A-10	TCGA-OR-A5L2-10A-01D-A30A-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b99bd79e-aa33-4896-8d10-2517c793f439	48e26b1d-b84d-432b-940b-9907c81ddf5b	g.chr19:19737970C>T	ENST00000542587.1	-	5	1026	c.124G>A	c.(124-126)Gtc>Atc	p.V42I	LPAR2_ENST00000586703.1_Missense_Mutation_p.V42I|LPAR2_ENST00000589311.1_5'Flank|LPAR2_ENST00000407877.3_Missense_Mutation_p.V42I			Q9HBW0	LPAR2_HUMAN	lysophosphatidic acid receptor 2	42					activation of MAPK activity (GO:0000187)|activation of phospholipase C activity (GO:0007202)|G-protein coupled receptor signaling pathway (GO:0007186)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of Rho protein signal transduction (GO:0035025)	cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|lipid binding (GO:0008289)|lysophosphatidic acid receptor activity (GO:0070915)			breast(1)|endometrium(2)|large_intestine(2)|lung(2)|ovary(1)|prostate(1)|urinary_tract(1)	10						AGCACGCTGACGGTCAGCCCC	0.597													C|||	1	0.000199681	0.0008	0.0	5008	,	,		18028	0.0		0.0	False		,,,				2504	0.0				p.V42I		.											.	LPAR2-501	0			c.G124A						.						33.0	30.0	31.0					19																	19737970		2203	4300	6503	SO:0001583	missense	9170	exon2			CGCTGACGGTCAG	AF011466	CCDS12407.1	19p12	2012-08-08	2008-04-11	2008-04-11		ENSG00000064547		"""GPCR / Class A : Lysophospholipid receptors : Lysophosphatidic acid"""	3168	protein-coding gene	gene with protein product		605110	"""endothelial differentiation, lysophosphatidic acid G-protein-coupled receptor, 4"""	EDG4		9525886, 9804623	Standard	NM_004720		Approved	EDG-4, LPA2	uc002nnb.4	Q9HBW0		ENST00000542587.1:c.124G>A	19.37:g.19737970C>T	ENSP00000443256:p.Val42Ile	Somatic	134	2		WXS	Illumina GAIIx	Phase_I	214	15	NM_004720	0	0	0	0	0	O00543|O43431	Missense_Mutation	SNP	ENST00000542587.1	37	CCDS12407.1	.	.	.	.	.	.	.	.	.	.	C	14.89	2.670619	0.47781	.	.	ENSG00000064547	ENST00000407877;ENST00000542587	T;T	0.35048	1.33;1.33	4.44	4.44	0.53790	.	0.000000	0.85682	D	0.000000	T	0.32882	0.0844	L	0.47716	1.5	0.51012	D	0.999903	D	0.55385	0.971	P	0.44732	0.459	T	0.07009	-1.0795	10	0.12103	T	0.63	.	14.5926	0.68378	0.0:1.0:0.0:0.0	.	42	Q9HBW0	LPAR2_HUMAN	I	42	ENSP00000384665:V42I;ENSP00000443256:V42I	ENSP00000384665:V42I	V	-	1	0	LPAR2	19598970	1.000000	0.71417	0.941000	0.38009	0.640000	0.38277	4.533000	0.60615	2.308000	0.77769	0.462000	0.41574	GTC	.		0.597	LPAR2-003	KNOWN	alternative_5_UTR|non_canonical_TEC|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000460544.1	NM_004720	
LSM14A	26065	broad.mit.edu	37	19	34710315	34710315	+	Silent	SNP	T	T	G	rs201741862		TCGA-OR-A5L2-01A-11D-A30A-10	TCGA-OR-A5L2-10A-01D-A30A-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b99bd79e-aa33-4896-8d10-2517c793f439	48e26b1d-b84d-432b-940b-9907c81ddf5b	g.chr19:34710315T>G	ENST00000433627.5	+	7	876	c.801T>G	c.(799-801)gcT>gcG	p.A267A	LSM14A_ENST00000540746.2_Silent_p.A226A|LSM14A_ENST00000544216.3_Silent_p.A267A	NM_001114093.1	NP_001107565.1	Q8ND56	LS14A_HUMAN	LSM14A, SCD6 homolog A (S. cerevisiae)	267					cytoplasmic mRNA processing body assembly (GO:0033962)|multicellular organismal development (GO:0007275)|positive regulation of type I interferon-mediated signaling pathway (GO:0060340)|regulation of translation (GO:0006417)|RIG-I signaling pathway (GO:0039529)	cytoplasm (GO:0005737)|cytoplasmic mRNA processing body (GO:0000932)|cytoplasmic stress granule (GO:0010494)|intracellular membrane-bounded organelle (GO:0043231)	double-stranded DNA binding (GO:0003690)|double-stranded RNA binding (GO:0003725)|poly(A) RNA binding (GO:0044822)|single-stranded RNA binding (GO:0003727)	p.A267A(2)		breast(1)|endometrium(4)|kidney(1)|large_intestine(8)|lung(7)|skin(1)	22	Esophageal squamous(110;0.162)					CTCCTTCAGCTCCAAGGAGAG	0.438																																					p.A267A		.											.	LSM14A-91	2	Substitution - coding silent(2)	endometrium(1)|kidney(1)	c.T801G						.						64.0	74.0	71.0					19																	34710315		2203	4300	6503	SO:0001819	synonymous_variant	26065	exon7			TTCAGCTCCAAGG	AL834398	CCDS12435.1, CCDS46040.1	19q13.12	2010-01-27	2006-12-21	2006-01-24		ENSG00000257103			24489	protein-coding gene	gene with protein product		610677	"""chromosome 19 open reading frame 13"", ""family with sequence similarity 61, member A"", ""LSM14 homolog A (SCD6, S. cerevisiae)"""	C19orf13, FAM61A		12477932	Standard	NM_015578		Approved	DKFZP434D1335, RAP55A, RAP55	uc002nva.4	Q8ND56		ENST00000433627.5:c.801T>G	19.37:g.34710315T>G		Somatic	60	1		WXS	Illumina GAIIx	Phase_I	67	4	NM_001114093	0	0	0	0	0	B4DTG6|Q76LX7|Q96AR3|Q96K73|Q96SN5|Q9UFR3	Silent	SNP	ENST00000433627.5	37	CCDS46040.1																																																																																			T|0.999;G|0.001		0.438	LSM14A-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000451576.3	NM_015578	
DMKN	93099	broad.mit.edu	37	19	36002403	36002404	+	Frame_Shift_Del	DEL	GC	GC	-	rs56743379|rs138902616		TCGA-OR-A5L2-01A-11D-A30A-10	TCGA-OR-A5L2-10A-01D-A30A-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b99bd79e-aa33-4896-8d10-2517c793f439	48e26b1d-b84d-432b-940b-9907c81ddf5b	g.chr19:36002403_36002404delGC	ENST00000339686.3	-	5	1003_1004	c.827_828delGC	c.(826-828)agcfs	p.S278fs	DMKN_ENST00000472252.2_5'Flank|DMKN_ENST00000419602.1_Intron|DMKN_ENST00000447113.2_Frame_Shift_Del_p.S278fs|DMKN_ENST00000443640.1_5'Flank|DMKN_ENST00000462126.1_5'Flank|DMKN_ENST00000414866.2_5'Flank|DMKN_ENST00000467637.1_5'Flank|DMKN_ENST00000440396.1_Frame_Shift_Del_p.S278fs|DMKN_ENST00000488892.1_5'Flank|DMKN_ENST00000480502.1_5'Flank|DMKN_ENST00000402589.2_5'Flank|DMKN_ENST00000436012.1_5'Flank|DMKN_ENST00000451297.2_Frame_Shift_Del_p.S278fs|DMKN_ENST00000461300.1_5'Flank|DMKN_ENST00000429837.1_Intron|DMKN_ENST00000418261.1_Frame_Shift_Del_p.S278fs|DMKN_ENST00000492341.2_5'Flank|DMKN_ENST00000424570.2_Frame_Shift_Del_p.S278fs|DMKN_ENST00000392206.2_5'Flank|DMKN_ENST00000602781.1_5'Flank|DMKN_ENST00000474928.1_5'Flank|DMKN_ENST00000458071.1_5'Flank	NM_033317.4	NP_201574	Q6E0U4	DMKN_HUMAN	dermokine	278	Gly-rich.					extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)		p.S274_S290del(1)		NS(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(8)|lung(7)|ovary(1)|prostate(1)|skin(2)	27	all_lung(56;1.89e-08)|Lung NSC(56;2.9e-08)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0724)			cgccactgctgctgccactgct	0.649																																					p.276_276del		.											.	DMKN-155	1	Deletion - In frame(1)	ovary(1)	c.827_828del						.																																			SO:0001589	frameshift_variant	93099	exon5			ACTGCTGCTGCCA	BC035311	CCDS12463.1, CCDS42549.1, CCDS46051.1, CCDS46052.1, CCDS46053.1, CCDS46054.1, CCDS46054.2, CCDS54250.1, CCDS54251.1, CCDS54252.1	19q13.12	2008-10-27			ENSG00000161249	ENSG00000161249			25063	protein-coding gene	gene with protein product						16374476	Standard	NM_001035516		Approved	ZD52F10	uc002nzm.4	Q6E0U4	OTTHUMG00000048101	ENST00000339686.3:c.827_828delGC	19.37:g.36002403_36002404delGC	ENSP00000342012:p.Ser278fs	Somatic	81	0		WXS	Illumina GAIIx	Phase_I	92	0	NM_001126058	0	0	0	0	0	A3EZ79|A3EZ80|A3EZ81|A3EZ82|A3EZ83|C9J4P6|C9J5N8|C9JAL3|Q32W58|Q32W62|Q32W63|Q32W64|Q32W65|Q32W66|Q32W67|Q6E0U5|Q6UXC7|Q96EW8|Q9BSY6	Frame_Shift_Del	DEL	ENST00000339686.3	37	CCDS12463.1																																																																																			.		0.649	DMKN-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000109461.2	NM_033317	
PRR19	284338	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	19	42814036	42814036	+	Silent	SNP	C	C	T			TCGA-OR-A5L2-01A-11D-A30A-10	TCGA-OR-A5L2-10A-01D-A30A-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b99bd79e-aa33-4896-8d10-2517c793f439	48e26b1d-b84d-432b-940b-9907c81ddf5b	g.chr19:42814036C>T	ENST00000499536.2	+	1	1111	c.300C>T	c.(298-300)ccC>ccT	p.P100P	PRR19_ENST00000598490.1_Silent_p.P100P|PRR19_ENST00000341747.3_Silent_p.P100P			A6NJB7	PRR19_HUMAN	proline rich 19	100										NS(1)|kidney(1)|large_intestine(2)|lung(2)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	10		Prostate(69;0.00682)				CAGGCAGCCCCACACTCCCCG	0.667																																					p.P100P		.											.	PRR19-68	0			c.C300T						.						41.0	52.0	49.0					19																	42814036		2203	4300	6503	SO:0001819	synonymous_variant	284338	exon2			CAGCCCCACACTC	AK124116	CCDS33036.1	19q13.2	2007-12-17				ENSG00000188368			33728	protein-coding gene	gene with protein product							Standard	NM_199285		Approved	MGC70924	uc002oti.3	A6NJB7		ENST00000499536.2:c.300C>T	19.37:g.42814036C>T		Somatic	52	0		WXS	Illumina GAIIx	Phase_I	38	5	NM_199285	0	0	0	0	0	A8K663|B3KW48|Q6P584	Silent	SNP	ENST00000499536.2	37	CCDS33036.1																																																																																			.		0.667	PRR19-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463735.1	NM_199285	
ZNF285	26974	bcgsc.ca	37	19	44891003	44891003	+	Silent	SNP	G	G	A	rs201302972		TCGA-OR-A5L2-01A-11D-A30A-10	TCGA-OR-A5L2-10A-01D-A30A-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b99bd79e-aa33-4896-8d10-2517c793f439	48e26b1d-b84d-432b-940b-9907c81ddf5b	g.chr19:44891003G>A	ENST00000330997.4	-	4	1468	c.1404C>T	c.(1402-1404)agC>agT	p.S468S	ZNF285_ENST00000544719.2_Silent_p.S468S|CTC-512J12.6_ENST00000588212.1_Intron|ZNF285_ENST00000591679.1_Silent_p.S475S	NM_152354.3	NP_689567.3	Q96NJ3	ZN285_HUMAN	zinc finger protein 285	468					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(15)|ovary(2)|prostate(5)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(2)	44						GAAGAACAGAGCTATACGCAA	0.418																																					p.S468S		.											.	ZNF285-94	0			c.C1404T						.						86.0	87.0	87.0					19																	44891003		2203	4300	6503	SO:0001819	synonymous_variant	26974	exon4			AACAGAGCTATAC	AK055309	CCDS12638.1, CCDS74389.1	19q13.32	2013-01-08	2010-04-14	2010-04-14		ENSG00000267508		"""Zinc fingers, C2H2-type"", ""-"""	13079	protein-coding gene	gene with protein product			"""zinc finger protein 285A"""	ZNF285A			Standard	XM_005258734		Approved			Q96NJ3	OTTHUMG00000178848	ENST00000330997.4:c.1404C>T	19.37:g.44891003G>A		Somatic	144	2		WXS	Illumina GAIIx	Phase_I	164	16	NM_152354	0	0	0	0	0	Q17RJ3|Q6B0A8|Q6ISR5	Silent	SNP	ENST00000330997.4	37	CCDS12638.1																																																																																			G|0.998;A|0.002		0.418	ZNF285-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000443600.1	NM_152354	
ZNF285	26974	bcgsc.ca	37	19	44891010	44891010	+	Missense_Mutation	SNP	G	G	C	rs150792548	byFrequency	TCGA-OR-A5L2-01A-11D-A30A-10	TCGA-OR-A5L2-10A-01D-A30A-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b99bd79e-aa33-4896-8d10-2517c793f439	48e26b1d-b84d-432b-940b-9907c81ddf5b	g.chr19:44891010G>C	ENST00000330997.4	-	4	1461	c.1397C>G	c.(1396-1398)gCg>gGg	p.A466G	ZNF285_ENST00000544719.2_Missense_Mutation_p.A466G|CTC-512J12.6_ENST00000588212.1_Intron|ZNF285_ENST00000591679.1_Missense_Mutation_p.A473G	NM_152354.3	NP_689567.3	Q96NJ3	ZN285_HUMAN	zinc finger protein 285	466					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.A466G(1)		breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(15)|ovary(2)|prostate(5)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(2)	44						AGAGCTATACGCAAAATCCTT	0.418																																					p.A466G		.											.	ZNF285-94	1	Substitution - Missense(1)	skin(1)	c.C1397G						.						83.0	84.0	83.0					19																	44891010		2203	4300	6503	SO:0001583	missense	26974	exon4			CTATACGCAAAAT	AK055309	CCDS12638.1, CCDS74389.1	19q13.32	2013-01-08	2010-04-14	2010-04-14		ENSG00000267508		"""Zinc fingers, C2H2-type"", ""-"""	13079	protein-coding gene	gene with protein product			"""zinc finger protein 285A"""	ZNF285A			Standard	XM_005258734		Approved			Q96NJ3	OTTHUMG00000178848	ENST00000330997.4:c.1397C>G	19.37:g.44891010G>C	ENSP00000333595:p.Ala466Gly	Somatic	147	3		WXS	Illumina GAIIx	Phase_I	178	15	NM_152354	0	0	0	0	0	Q17RJ3|Q6B0A8|Q6ISR5	Missense_Mutation	SNP	ENST00000330997.4	37	CCDS12638.1	.	.	.	.	.	.	.	.	.	.	G	9.126	1.010205	0.19277	.	.	ENSG00000062370	ENST00000544719;ENST00000330997	T	0.08008	3.14	3.46	0.829	0.18847	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.08714	0.0216	L	0.45744	1.44	0.09310	N	1	B;B	0.34399	0.452;0.0	B;B	0.36666	0.23;0.001	T	0.29488	-1.0010	9	0.56958	D	0.05	.	6.4144	0.21708	0.1094:0.3586:0.532:0.0	.	490;466	B7ZLR9;Q96NJ3	.;ZN285_HUMAN	G	489;466	ENSP00000333595:A466G	ENSP00000333595:A466G	A	-	2	0	ZNF285	49582850	0.000000	0.05858	0.002000	0.10522	0.860000	0.49131	-6.159000	0.00078	0.511000	0.28236	0.298000	0.19748	GCG	A|0.000;C|0.002;G|0.998		0.418	ZNF285-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000443600.1	NM_152354	
PTGIR	5739	hgsc.bcm.edu	37	19	47127324	47127324	+	Silent	SNP	C	C	G	rs2229128	byFrequency	TCGA-OR-A5L2-01A-11D-A30A-10	TCGA-OR-A5L2-10A-01D-A30A-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b99bd79e-aa33-4896-8d10-2517c793f439	48e26b1d-b84d-432b-940b-9907c81ddf5b	g.chr19:47127324C>G	ENST00000291294.2	-	2	292	c.159G>C	c.(157-159)gtG>gtC	p.V53V	PTGIR_ENST00000596260.1_Silent_p.V53V|PTGIR_ENST00000597185.1_Intron|PTGIR_ENST00000598865.1_Intron|PTGIR_ENST00000594275.1_Intron	NM_000960.3	NP_000951.1	P43119	PI2R_HUMAN	prostaglandin I2 (prostacyclin) receptor (IP)	53					adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|blood coagulation (GO:0007596)|cell-cell signaling (GO:0007267)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|negative regulation of platelet-derived growth factor receptor signaling pathway (GO:0010642)|negative regulation of smooth muscle cell proliferation (GO:0048662)|positive regulation of cAMP biosynthetic process (GO:0030819)|positive regulation of cAMP-mediated signaling (GO:0043950)|positive regulation of GTPase activity (GO:0043547)|response to lipopolysaccharide (GO:0032496)	cytosol (GO:0005829)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|guanyl-nucleotide exchange factor activity (GO:0005085)			endometrium(1)|kidney(1)|large_intestine(1)|lung(5)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	13		Ovarian(192;0.0129)|all_neural(266;0.0459)|Breast(70;0.212)		OV - Ovarian serous cystadenocarcinoma(262;0.000327)|all cancers(93;0.000641)|Epithelial(262;0.0174)|GBM - Glioblastoma multiforme(486;0.0331)	Dinoprost Tromethamine(DB01160)|Epoprostenol(DB01240)|Iloprost(DB01088)|Treprostinil(DB00374)	CCAGTCCGGTCACCAGCACCG	0.731													G|||	1139	0.227436	0.1362	0.2133	5008	,	,		13968	0.3313		0.2465	False		,,,				2504	0.2342				p.V53V		.											.	PTGIR-522	0			c.G159C						.	G		523,3103		62,399,1352	3.0	5.0	5.0		159	2.2	1.0	19	dbSNP_98	5	1678,5498		231,1216,2141	no	coding-synonymous	PTGIR	NM_000960.3		293,1615,3493	GG,GC,CC		23.3835,14.4236,20.3759		53/387	47127324	2201,8601	1813	3588	5401	SO:0001819	synonymous_variant	5739	exon2			TCCGGTCACCAGC		CCDS12686.1	19q13.3	2012-08-08				ENSG00000160013		"""GPCR / Class A : Prostanoid receptors"""	9602	protein-coding gene	gene with protein product		600022				7759114	Standard	NM_000960		Approved	IP	uc002pex.3	P43119		ENST00000291294.2:c.159G>C	19.37:g.47127324C>G		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	16	16	NM_000960	0	0	0	0	0		Silent	SNP	ENST00000291294.2	37	CCDS12686.1																																																																																			C|0.254;G|0.746		0.731	PTGIR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466581.1		
SLC8A2	6543	hgsc.bcm.edu	37	19	47951134	47951134	+	Silent	SNP	C	C	T	rs61748880	byFrequency	TCGA-OR-A5L2-01A-11D-A30A-10	TCGA-OR-A5L2-10A-01D-A30A-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b99bd79e-aa33-4896-8d10-2517c793f439	48e26b1d-b84d-432b-940b-9907c81ddf5b	g.chr19:47951134C>T	ENST00000236877.6	-	4	2090	c.1695G>A	c.(1693-1695)acG>acA	p.T565T	SLC8A2_ENST00000542837.1_Silent_p.T321T|SLC8A2_ENST00000539381.1_Silent_p.T28T|SLC8A2_ENST00000601757.1_5'Flank	NM_015063.2	NP_055878.1	Q9UPR5	NAC2_HUMAN	solute carrier family 8 (sodium/calcium exchanger), member 2	565	Calx-beta 2.				blood coagulation (GO:0007596)|cell communication (GO:0007154)|ion transport (GO:0006811)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium:sodium antiporter activity (GO:0005432)			breast(1)|endometrium(4)|kidney(2)|large_intestine(4)|lung(10)|ovary(2)|prostate(2)|skin(5)|stomach(1)	31		all_cancers(25;3.05e-07)|all_lung(116;4.19e-06)|Lung NSC(112;7.16e-06)|all_epithelial(76;7.65e-06)|all_neural(266;0.0652)|Ovarian(192;0.086)|Breast(70;0.173)		OV - Ovarian serous cystadenocarcinoma(262;0.000501)|all cancers(93;0.00058)|Epithelial(262;0.0181)|GBM - Glioblastoma multiforme(486;0.0457)		CGCCGCGCGCCGTGCCGTCCA	0.741													.|||	178	0.0355431	0.1233	0.0216	5008	,	,		12175	0.0		0.0	False		,,,				2504	0.0				p.T565T		.											.	SLC8A2-94	0			c.G1695A						.	C		402,3754		21,360,1697	7.0	6.0	6.0		1695	1.7	1.0	19	dbSNP_129	6	3,8149		0,3,4073	no	coding-synonymous	SLC8A2	NM_015063.2		21,363,5770	TT,TC,CC		0.0368,9.6728,3.2905		565/922	47951134	405,11903	2078	4076	6154	SO:0001819	synonymous_variant	6543	exon4			GCGCGCCGTGCCG	AB029010	CCDS33065.1	19q13.32	2013-07-15	2008-09-02		ENSG00000118160	ENSG00000118160		"""Solute carriers"""	11069	protein-coding gene	gene with protein product		601901				8021246	Standard	NM_015063		Approved	NCX2, KIAA1087	uc002pgx.3	Q9UPR5	OTTHUMG00000183529	ENST00000236877.6:c.1695G>A	19.37:g.47951134C>T		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	7	7	NM_015063	0	0	0	0	0	B4DYQ9	Silent	SNP	ENST00000236877.6	37	CCDS33065.1																																																																																			C|0.964;T|0.036		0.741	SLC8A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466997.1		
FAM83E	54854	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	19	49104471	49104471	+	Silent	SNP	T	T	C			TCGA-OR-A5L2-01A-11D-A30A-10	TCGA-OR-A5L2-10A-01D-A30A-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b99bd79e-aa33-4896-8d10-2517c793f439	48e26b1d-b84d-432b-940b-9907c81ddf5b	g.chr19:49104471T>C	ENST00000263266.3	-	5	1521	c.1332A>G	c.(1330-1332)ccA>ccG	p.P444P		NM_017708.3	NP_060178.2	Q2M2I3	FA83E_HUMAN	family with sequence similarity 83, member E	444										NS(1)|endometrium(2)|large_intestine(1)|lung(3)|ovary(1)|urinary_tract(2)	10		all_epithelial(76;2.38e-06)|all_lung(116;4.89e-06)|Lung NSC(112;9.34e-06)|all_neural(266;0.0189)|Ovarian(192;0.0261)		OV - Ovarian serous cystadenocarcinoma(262;0.000102)|all cancers(93;0.000117)|GBM - Glioblastoma multiforme(486;0.00627)|Epithelial(262;0.0158)		GCCTTCGGGCTGGGGACAGAT	0.711																																					p.P444P		.											.	FAM83E-91	0			c.A1332G						.						15.0	16.0	16.0					19																	49104471		1833	4074	5907	SO:0001819	synonymous_variant	54854	exon5			TCGGGCTGGGGAC	AK000207	CCDS42587.1	19q13.33	2013-10-24			ENSG00000105523	ENSG00000105523			25972	protein-coding gene	gene with protein product							Standard	NM_017708		Approved	FLJ20200	uc002pjn.2	Q2M2I3	OTTHUMG00000183315	ENST00000263266.3:c.1332A>G	19.37:g.49104471T>C		Somatic	54	0		WXS	Illumina GAIIx	Phase_I	71	6	NM_017708	0	0	0	0	0	Q9NXK1	Silent	SNP	ENST00000263266.3	37	CCDS42587.1																																																																																			.		0.711	FAM83E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466145.1	NM_017708	
KLK11	11012	broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	51527336	51527336	+	Missense_Mutation	SNP	A	A	G			TCGA-OR-A5L2-01A-11D-A30A-10	TCGA-OR-A5L2-10A-01D-A30A-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b99bd79e-aa33-4896-8d10-2517c793f439	48e26b1d-b84d-432b-940b-9907c81ddf5b	g.chr19:51527336A>G	ENST00000594768.1	-	4	709	c.524T>C	c.(523-525)cTc>cCc	p.L175P	KLK11_ENST00000391804.3_Missense_Mutation_p.L168P|KLK11_ENST00000319720.7_Missense_Mutation_p.L143P|KLK11_ENST00000453757.3_Missense_Mutation_p.L143P|KLK11_ENST00000600362.1_Intron|KLK11_ENST00000594458.1_5'Flank	NM_144947.1	NP_659196.1	Q9UBX7	KLK11_HUMAN	kallikrein-related peptidase 11	175	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.					extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)	serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)			breast(1)|endometrium(2)|large_intestine(1)|lung(2)|skin(1)	7		all_neural(266;0.026)		OV - Ovarian serous cystadenocarcinoma(262;0.00327)|GBM - Glioblastoma multiforme(134;0.00878)		GCCGGAAATGAGGCAGCTGGT	0.632																																					p.L175P		.											.	KLK11-650	0			c.T524C						.						44.0	28.0	33.0					19																	51527336		2203	4300	6503	SO:0001583	missense	11012	exon4			GAAATGAGGCAGC	AB012917	CCDS12818.1, CCDS12819.1, CCDS54297.1	19q13.33	2011-09-07	2006-10-27			ENSG00000167757		"""Kallikreins"", ""Serine peptidases / Serine peptidases"""	6359	protein-coding gene	gene with protein product		604434	"""kallikrein 11"""	PRSS20		9765601, 10662548, 16800724, 16800723	Standard	NM_006853		Approved	TLSP	uc002pvb.2	Q9UBX7		ENST00000594768.1:c.524T>C	19.37:g.51527336A>G	ENSP00000473047:p.Leu175Pro	Somatic	105	1		WXS	Illumina GAIIx	Phase_I	111	14	NM_144947	0	0	0	0	0	O75837|Q0WXX5|Q8IXD7|Q9NS65	Missense_Mutation	SNP	ENST00000594768.1	37	CCDS12818.1	.	.	.	.	.	.	.	.	.	.	a	15.96	2.985907	0.53934	.	.	ENSG00000167757	ENST00000391804;ENST00000319720;ENST00000453757;ENST00000319756	D;D;D	0.93488	-3.23;-3.23;-3.23	4.42	4.42	0.53409	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	0.000000	0.36002	N	0.002857	D	0.95971	0.8688	M	0.78801	2.425	0.51767	D	0.999939	D;D	0.89917	1.0;0.999	D;D	0.74023	0.982;0.979	D	0.96114	0.9079	10	0.72032	D	0.01	.	11.6635	0.51361	1.0:0.0:0.0:0.0	.	175;168	Q9UBX7;Q8IXD7	KLK11_HUMAN;.	P	168;143;143;175	ENSP00000375680:L168P;ENSP00000324269:L143P;ENSP00000413958:L143P	ENSP00000324269:L143P	L	-	2	0	KLK11	56219148	0.001000	0.12720	1.000000	0.80357	0.963000	0.63663	0.237000	0.17985	1.846000	0.53633	0.379000	0.24179	CTC	.		0.632	KLK11-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000464314.2	NM_006853	
FPR1	2357	broad.mit.edu	37	19	52249450	52249450	+	Silent	SNP	G	G	C			TCGA-OR-A5L2-01A-11D-A30A-10	TCGA-OR-A5L2-10A-01D-A30A-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b99bd79e-aa33-4896-8d10-2517c793f439	48e26b1d-b84d-432b-940b-9907c81ddf5b	g.chr19:52249450G>C	ENST00000595042.1	-	3	939	c.798C>G	c.(796-798)gtC>gtG	p.V266V	FPR1_ENST00000304748.4_Silent_p.V266V	NM_001193306.1	NP_001180235.1	P21462	FPR1_HUMAN	formyl peptide receptor 1	266					activation of MAPK activity (GO:0000187)|adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|cellular component movement (GO:0006928)|chemotaxis (GO:0006935)|G-protein coupled receptor signaling pathway (GO:0007186)|nitric oxide mediated signal transduction (GO:0007263)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|signal transduction (GO:0007165)	endosome (GO:0005768)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	N-formyl peptide receptor activity (GO:0004982)|receptor activity (GO:0004872)			endometrium(2)|kidney(2)|large_intestine(2)|lung(6)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|stomach(3)	20		all_neural(266;0.0189)|Medulloblastoma(540;0.146)		GBM - Glioblastoma multiforme(134;0.00106)|OV - Ovarian serous cystadenocarcinoma(262;0.018)	Nedocromil(DB00716)	CACGGATTCTGACTGTGGCTA	0.507																																					p.V266V		.											.	FPR1-524	0			c.C798G						.						89.0	72.0	78.0					19																	52249450		2203	4300	6503	SO:0001819	synonymous_variant	2357	exon3			GATTCTGACTGTG	M60627	CCDS12839.1	19q13.41	2014-09-17				ENSG00000171051		"""GPCR / Class A : Formyl peptide receptors"""	3826	protein-coding gene	gene with protein product		136537				2161213, 12595898	Standard	NM_001193306		Approved	FPR, FMLP	uc002pxq.3	P21462		ENST00000595042.1:c.798C>G	19.37:g.52249450G>C		Somatic	111	0		WXS	Illumina GAIIx	Phase_I	129	3	NM_001193306	0	0	0	0	0	Q14939|Q7Z6A4|Q86U52|Q9NS48	Silent	SNP	ENST00000595042.1	37	CCDS12839.1																																																																																			.		0.507	FPR1-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466905.1	NM_002029	
NLRP4	147945	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	56369429	56369429	+	Nonsense_Mutation	SNP	G	G	T			TCGA-OR-A5L2-01A-11D-A30A-10	TCGA-OR-A5L2-10A-01D-A30A-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b99bd79e-aa33-4896-8d10-2517c793f439	48e26b1d-b84d-432b-940b-9907c81ddf5b	g.chr19:56369429G>T	ENST00000301295.6	+	3	1092	c.670G>T	c.(670-672)Gag>Tag	p.E224*	NLRP4_ENST00000587891.1_Nonsense_Mutation_p.E149*|NLRP4_ENST00000346986.5_Nonsense_Mutation_p.E224*	NM_134444.4	NP_604393.2	Q96MN2	NALP4_HUMAN	NLR family, pyrin domain containing 4	224	NACHT. {ECO:0000255|PROSITE- ProRule:PRU00136}.				inflammatory response (GO:0006954)|innate immune response (GO:0045087)|positive regulation of type I interferon production (GO:0032481)|regulation of type I interferon production (GO:0032479)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)			breast(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(14)|lung(3)|ovary(6)|pancreas(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(8)	42		Colorectal(82;0.0002)|Ovarian(87;0.221)		GBM - Glioblastoma multiforme(193;0.0606)		GTCTCAACCGGAGAGACTCTT	0.552																																					p.E224X		.											.	NLRP4-216	0			c.G670T						.						81.0	80.0	80.0					19																	56369429		2203	4300	6503	SO:0001587	stop_gained	147945	exon3			CAACCGGAGAGAC	AF479747	CCDS12936.1	19q13.43	2009-03-27	2006-12-08	2006-12-08				"""Nucleotide-binding domain and leucine rich repeat containing"""	22943	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 4"", ""cancer/testis antigen 58"""	609645	"""NACHT, leucine rich repeat and PYD containing 4"""	NALP4		12563287, 12019269	Standard	NM_134444		Approved	PYPAF4, FLJ32126, PAN2, RNH2, CLR19.5, CT58	uc002qmd.4	Q96MN2		ENST00000301295.6:c.670G>T	19.37:g.56369429G>T	ENSP00000301295:p.Glu224*	Somatic	111	0		WXS	Illumina GAIIx	Phase_I	102	14	NM_134444	0	0	0	0	0	Q86W87|Q96AY6	Nonsense_Mutation	SNP	ENST00000301295.6	37	CCDS12936.1	.	.	.	.	.	.	.	.	.	.	G	37	6.258394	0.97421	.	.	ENSG00000160505	ENST00000301295;ENST00000346986	.	.	.	4.1	3.04	0.35103	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.30078	T	0.28	.	11.9098	0.52733	0.0:0.1772:0.8228:0.0	.	.	.	.	X	224	.	ENSP00000301295:E224X	E	+	1	0	NLRP4	61061241	0.750000	0.28316	0.283000	0.24790	0.091000	0.18340	0.957000	0.29215	1.059000	0.40554	0.655000	0.94253	GAG	.		0.552	NLRP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000457367.2	NM_134444	
ZNF835	90485	broad.mit.edu	37	19	57176051	57176051	+	Silent	SNP	G	G	T			TCGA-OR-A5L2-01A-11D-A30A-10	TCGA-OR-A5L2-10A-01D-A30A-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b99bd79e-aa33-4896-8d10-2517c793f439	48e26b1d-b84d-432b-940b-9907c81ddf5b	g.chr19:57176051G>T	ENST00000537055.2	-	2	747	c.516C>A	c.(514-516)ggC>ggA	p.G172G		NM_001005850.2	NP_001005850.2	Q9Y2P0	ZN835_HUMAN	zinc finger protein 835	172					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(10)|lung(22)|pancreas(3)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)	47						TGAAGGCCTTGCCGCACTCGT	0.716																																					p.G172G		.											.	ZNF835-72	0			c.C516A						.						21.0	23.0	22.0					19																	57176051		2201	4297	6498	SO:0001819	synonymous_variant	90485	exon2			GGCCTTGCCGCAC	AK023017	CCDS56105.1	19q13.43	2013-01-08			ENSG00000127903	ENSG00000127903		"""Zinc fingers, C2H2-type"""	34332	protein-coding gene	gene with protein product							Standard	NM_001005850		Approved	BC37295_3	uc010ygn.2	Q9Y2P0		ENST00000537055.2:c.516C>A	19.37:g.57176051G>T		Somatic	46	0		WXS	Illumina GAIIx	Phase_I	68	5	NM_001005850	0	0	0	0	0	B7Z5Y0|G3V1S0	Silent	SNP	ENST00000537055.2	37	CCDS56105.1																																																																																			.		0.716	ZNF835-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000459800.1	NM_001005850	
PEG3	5178	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	19	57327088	57327088	+	Missense_Mutation	SNP	C	C	A			TCGA-OR-A5L2-01A-11D-A30A-10	TCGA-OR-A5L2-10A-01D-A30A-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b99bd79e-aa33-4896-8d10-2517c793f439	48e26b1d-b84d-432b-940b-9907c81ddf5b	g.chr19:57327088C>A	ENST00000326441.9	-	10	3085	c.2722G>T	c.(2722-2724)Gtt>Ttt	p.V908F	ZIM2_ENST00000593711.1_Intron|ZIM2_ENST00000599935.1_Intron|ZIM2_ENST00000391708.3_Intron|PEG3_ENST00000598410.1_Missense_Mutation_p.V784F|ZIM2_ENST00000601070.1_Intron|PEG3_ENST00000423103.2_Missense_Mutation_p.V908F|ZIM2_ENST00000221722.5_Intron|PEG3_ENST00000593695.1_Missense_Mutation_p.V782F	NM_006210.2	NP_006201.1	Q9GZU2	PEG3_HUMAN	paternally expressed 3	908					apoptotic process (GO:0006915)|genetic imprinting (GO:0071514)|in utero embryonic development (GO:0001701)|multicellular organism growth (GO:0035264)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)			NS(1)|biliary_tract(4)|breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(27)|lung(84)|ovary(8)|pancreas(5)|prostate(6)|skin(8)|stomach(2)|upper_aerodigestive_tract(6)	170		Colorectal(82;0.000256)|all_neural(62;0.103)|Ovarian(87;0.243)		GBM - Glioblastoma multiforme(193;0.0269)		TCTCCAGGAACACTTTTCTGA	0.463																																					p.V908F		.											.	PEG3-164	0			c.G2722T						.						105.0	105.0	105.0					19																	57327088		2203	4300	6503	SO:0001583	missense	5178	exon9			CAGGAACACTTTT	AB006625	CCDS12948.1, CCDS58684.1, CCDS58685.1	19q13.4	2013-01-09				ENSG00000198300		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	8826	protein-coding gene	gene with protein product		601483				9149948	Standard	NM_006210		Approved	ZKSCAN22, KIAA0287, ZNF904, ZSCAN24	uc010etr.2	Q9GZU2		ENST00000326441.9:c.2722G>T	19.37:g.57327088C>A	ENSP00000326581:p.Val908Phe	Somatic	48	0		WXS	Illumina GAIIx	Phase_I	69	5	NM_001146184	0	0	0	0	0	A7E2B8|B4DIM4|C9JP50|P78418|Q5H9P9|Q7Z7H7|Q8TF75|Q9GZY2	Missense_Mutation	SNP	ENST00000326441.9	37	CCDS12948.1	.	.	.	.	.	.	.	.	.	.	C	6.718	0.501162	0.12822	.	.	ENSG00000198300	ENST00000326441;ENST00000423103	T;T	0.02552	4.25;4.25	4.55	-0.178	0.13303	.	1.179490	0.06331	N	0.706182	T	0.02418	0.0074	L	0.29908	0.895	.	.	.	B;B;P	0.39282	0.148;0.363;0.666	B;B;B	0.27500	0.023;0.034;0.08	T	0.48091	-0.9065	9	0.41790	T	0.15	-2.6124	10.3625	0.44003	0.0785:0.3948:0.5267:0.0	.	784;908;843	A7E2B8;Q9GZU2;Q96Q96	.;PEG3_HUMAN;.	F	908	ENSP00000326581:V908F;ENSP00000403051:V908F	ENSP00000326581:V908F	V	-	1	0	ZIM2	62018900	0.000000	0.05858	0.000000	0.03702	0.264000	0.26372	0.343000	0.19944	0.235000	0.21160	-0.165000	0.13383	GTT	.		0.463	PEG3-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000416099.2		
CMPK2	129607	hgsc.bcm.edu	37	2	7005369	7005369	+	Silent	SNP	A	A	G	rs11678810	byFrequency	TCGA-OR-A5L2-01A-11D-A30A-10	TCGA-OR-A5L2-10A-01D-A30A-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b99bd79e-aa33-4896-8d10-2517c793f439	48e26b1d-b84d-432b-940b-9907c81ddf5b	g.chr2:7005369A>G	ENST00000256722.5	-	1	458	c.459T>C	c.(457-459)tgT>tgC	p.C153C	CMPK2_ENST00000404168.1_Silent_p.C153C|CMPK2_ENST00000478738.1_Intron|CMPK2_ENST00000458098.1_Silent_p.C153C	NM_207315.3	NP_997198.2	Q5EBM0	CMPK2_HUMAN	cytidine monophosphate (UMP-CMP) kinase 2, mitochondrial	153					cellular response to lipopolysaccharide (GO:0071222)|dTDP biosynthetic process (GO:0006233)|dUDP biosynthetic process (GO:0006227)|nucleoside diphosphate phosphorylation (GO:0006165)|nucleoside triphosphate biosynthetic process (GO:0009142)	mitochondrion (GO:0005739)|nucleus (GO:0005634)	ATP binding (GO:0005524)|cytidylate kinase activity (GO:0004127)|nucleoside diphosphate kinase activity (GO:0004550)|thymidylate kinase activity (GO:0004798)|UMP kinase activity (GO:0033862)			large_intestine(1)|lung(13)|prostate(1)|upper_aerodigestive_tract(1)	16	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)					GTGCCTCCTGACAGGCGCCCA	0.741													G|||	4998	0.998003	0.9924	1.0	5008	,	,		10694	1.0		1.0	False		,,,				2504	1.0				p.C153C		.											.	CMPK2-68	0			c.T459C						.	G		3605,39		1783,39,0	3.0	4.0	4.0		459	1.6	0.0	2	dbSNP_120	4	7874,0		3937,0,0	no	coding-synonymous	CMPK2	NM_207315.2		5720,39,0	GG,GA,AA		0.0,1.0703,0.3386		153/450	7005369	11479,39	1822	3937	5759	SO:0001819	synonymous_variant	129607	exon1			CTCCTGACAGGCG		CCDS42648.1, CCDS58695.1, CCDS58696.1	2p25.2	2008-01-25			ENSG00000134326	ENSG00000134326	2.7.4.14		27015	protein-coding gene	gene with protein product	"""cytidylate kinase 2"""	611787				17999954	Standard	NM_207315		Approved	TYKi, UMP-CMPK2	uc002qyo.4	Q5EBM0	OTTHUMG00000151629	ENST00000256722.5:c.459T>C	2.37:g.7005369A>G		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	6	6	NM_001256478	0	0	0	0	0	A2RUB0|A5D8T2|B7ZM18|Q6ZRU2|Q96AL8	Silent	SNP	ENST00000256722.5	37	CCDS42648.1																																																																																			A|0.003;G|0.997		0.741	CMPK2-002	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323339.2	NM_207315	
CPSF3	51692	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	9580674	9580674	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5L2-01A-11D-A30A-10	TCGA-OR-A5L2-10A-01D-A30A-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b99bd79e-aa33-4896-8d10-2517c793f439	48e26b1d-b84d-432b-940b-9907c81ddf5b	g.chr2:9580674C>T	ENST00000238112.3	+	8	1021	c.815C>T	c.(814-816)tCa>tTa	p.S272L	CPSF3_ENST00000460593.1_Missense_Mutation_p.S235L	NM_016207.3	NP_057291.1	Q9UKF6	CPSF3_HUMAN	cleavage and polyadenylation specific factor 3, 73kDa	272					gene expression (GO:0010467)|histone mRNA 3'-end processing (GO:0006398)|mRNA 3'-end processing (GO:0031124)|mRNA cleavage (GO:0006379)|mRNA export from nucleus (GO:0006406)|mRNA polyadenylation (GO:0006378)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	mRNA cleavage and polyadenylation specificity factor complex (GO:0005847)|nucleoplasm (GO:0005654)|ribonucleoprotein complex (GO:0030529)	5'-3' exonuclease activity (GO:0008409)|endoribonuclease activity (GO:0004521)|metal ion binding (GO:0046872)|RNA binding (GO:0003723)			NS(1)|breast(3)|endometrium(1)|kidney(2)|large_intestine(5)|lung(8)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	24	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)	all_cancers(51;2.39e-25)|all_epithelial(98;8.75e-19)|Lung NSC(108;2.38e-06)|Ovarian(717;0.0308)		all cancers(51;2.2e-40)|Epithelial(75;6.71e-35)|OV - Ovarian serous cystadenocarcinoma(76;4.35e-21)|STAD - Stomach adenocarcinoma(1183;0.00644)		TACTATGCATCATCTTTGGCC	0.383																																					p.S272L	Colon(194;1259 2048 3845 5218 19985)	.											.	CPSF3-153	0			c.C815T						.						193.0	167.0	175.0					2																	9580674		2203	4300	6503	SO:0001583	missense	51692	exon8			ATGCATCATCTTT	AF171877	CCDS1664.1	2p25.1	2009-01-06	2002-08-29		ENSG00000119203	ENSG00000119203			2326	protein-coding gene	gene with protein product		606029	"""cleavage and polyadenylation specific factor 3, 73kD subunit"""			8929409	Standard	NM_016207		Approved	CPSF-73, CPSF73, YSH1	uc002qzo.2	Q9UKF6	OTTHUMG00000090415	ENST00000238112.3:c.815C>T	2.37:g.9580674C>T	ENSP00000238112:p.Ser272Leu	Somatic	145	0		WXS	Illumina GAIIx	Phase_I	142	45	NM_016207	0	0	0	0	0	O14769|Q53RS2|Q96F36	Missense_Mutation	SNP	ENST00000238112.3	37	CCDS1664.1	.	.	.	.	.	.	.	.	.	.	C	33	5.225669	0.95173	.	.	ENSG00000119203	ENST00000238112;ENST00000427001;ENST00000460593	T;T	0.53857	0.6;0.6	5.36	5.36	0.76844	Beta-Casp domain (1);	0.000000	0.85682	D	0.000000	D	0.82838	0.5124	H	0.96691	3.865	0.80722	D	1	D;D	0.89917	0.991;1.0	P;D	0.97110	0.84;1.0	D	0.88189	0.2876	10	0.66056	D	0.02	-13.3774	19.5055	0.95113	0.0:1.0:0.0:0.0	.	272;272	E7ER23;Q9UKF6	.;CPSF3_HUMAN	L	272;272;235	ENSP00000238112:S272L;ENSP00000418957:S235L	ENSP00000238112:S272L	S	+	2	0	CPSF3	9498125	1.000000	0.71417	0.601000	0.28877	0.995000	0.86356	7.726000	0.84824	2.672000	0.90937	0.551000	0.68910	TCA	.		0.383	CPSF3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206843.1	NM_016207	
CCDC121	79635	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	27850291	27850291	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5L2-01A-11D-A30A-10	TCGA-OR-A5L2-10A-01D-A30A-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b99bd79e-aa33-4896-8d10-2517c793f439	48e26b1d-b84d-432b-940b-9907c81ddf5b	g.chr2:27850291C>T	ENST00000324364.3	-	2	556	c.376G>A	c.(376-378)Gag>Aag	p.E126K	GPN1_ENST00000264718.3_5'Flank|RP11-158I13.2_ENST00000505973.1_RNA|ZNF512_ENST00000556601.1_Intron|GPN1_ENST00000610189.1_5'Flank|GPN1_ENST00000503738.1_5'Flank|GPN1_ENST00000424214.1_5'Flank|CCDC121_ENST00000394775.3_Missense_Mutation_p.E288K|GPN1_ENST00000407583.3_5'Flank|GPN1_ENST00000458167.2_5'Flank|GPN1_ENST00000515877.1_5'Flank	NM_024584.4	NP_078860.2	Q6ZUS5	CC121_HUMAN	coiled-coil domain containing 121	126										breast(1)|endometrium(3)|large_intestine(2)|lung(6)|prostate(2)	14	Acute lymphoblastic leukemia(172;0.155)					TTTGTCTCCTCCTGTAATGTC	0.438																																					p.E288K		.											.	CCDC121-68	0			c.G862A						.						141.0	148.0	146.0					2																	27850291		2203	4300	6503	SO:0001583	missense	79635	exon2			TCTCCTCCTGTAA	AK125354	CCDS1759.1, CCDS46247.1	2p23.2	2008-02-05			ENSG00000176714	ENSG00000176714			25833	protein-coding gene	gene with protein product							Standard	NM_024584		Approved	FLJ43364, FLJ13646	uc002rld.3	Q6ZUS5	OTTHUMG00000128427	ENST00000324364.3:c.376G>A	2.37:g.27850291C>T	ENSP00000339087:p.Glu126Lys	Somatic	49	0		WXS	Illumina GAIIx	Phase_I	48	13	NM_001142683	0	0	0	0	0	B3KW66|J3KQZ8|Q9H8G6	Missense_Mutation	SNP	ENST00000324364.3	37	CCDS1759.1	.	.	.	.	.	.	.	.	.	.	C	17.08	3.296536	0.60086	.	.	ENSG00000176714	ENST00000324364;ENST00000394775	T;T	0.31247	1.5;1.5	5.56	-1.66	0.08265	.	2.721120	0.01102	N	0.005390	T	0.21267	0.0512	L	0.28274	0.84	0.09310	N	1	B	0.20550	0.046	B	0.21360	0.034	T	0.12656	-1.0539	10	0.26408	T	0.33	-37.451	5.7533	0.18158	0.0:0.438:0.1524:0.4096	.	126	Q6ZUS5	CC121_HUMAN	K	126;288	ENSP00000339087:E126K;ENSP00000412150:E288K	ENSP00000339087:E126K	E	-	1	0	CCDC121	27703795	0.000000	0.05858	0.005000	0.12908	0.718000	0.41266	-1.393000	0.02521	-0.238000	0.09724	0.591000	0.81541	GAG	.		0.438	CCDC121-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000250215.1	NM_024584	
FAM179A	165186	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	29274646	29274646	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5L2-01A-11D-A30A-10	TCGA-OR-A5L2-10A-01D-A30A-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b99bd79e-aa33-4896-8d10-2517c793f439	48e26b1d-b84d-432b-940b-9907c81ddf5b	g.chr2:29274646G>A	ENST00000379558.4	+	20	3098	c.2747G>A	c.(2746-2748)cGg>cAg	p.R916Q	FAM179A_ENST00000403861.2_Missense_Mutation_p.R861Q|FAM179A_ENST00000465300.1_3'UTR	NM_199280.2	NP_954974.2	Q6ZUX3	F179A_HUMAN	family with sequence similarity 179, member A	916										breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(5)|lung(9)|ovary(3)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	26						GTTTACCCCCGGAAGCCTCAA	0.597																																					p.R916Q		.											.	FAM179A-26	0			c.G2747A						.						13.0	15.0	14.0					2																	29274646		2067	4179	6246	SO:0001583	missense	165186	exon20			ACCCCCGGAAGCC	AK125239, AK125744	CCDS1769.2	2p23.2	2008-10-30			ENSG00000189350	ENSG00000189350			33715	protein-coding gene	gene with protein product						16344560	Standard	NM_199280		Approved	FLJ43249, LOC165186	uc010ezl.3	Q6ZUX3	OTTHUMG00000128432	ENST00000379558.4:c.2747G>A	2.37:g.29274646G>A	ENSP00000368876:p.Arg916Gln	Somatic	157	0		WXS	Illumina GAIIx	Phase_I	170	16	NM_199280	0	0	0	0	0	Q6ZUF5	Missense_Mutation	SNP	ENST00000379558.4	37	CCDS1769.2	.	.	.	.	.	.	.	.	.	.	G	8.087	0.773687	0.16051	.	.	ENSG00000189350	ENST00000379558;ENST00000403861	T;T	0.20598	2.06;2.06	5.67	-0.488	0.12056	Armadillo-type fold (1);	0.327353	0.26241	N	0.025502	T	0.11281	0.0275	N	0.20574	0.59	0.09310	N	1	B;B	0.28636	0.218;0.139	B;B	0.23852	0.049;0.013	T	0.20273	-1.0280	10	0.36615	T	0.2	.	10.5535	0.45103	0.3994:0.0:0.6006:0.0	.	861;916	F8W8E4;Q6ZUX3	.;F179A_HUMAN	Q	916;861	ENSP00000368876:R916Q;ENSP00000384699:R861Q	ENSP00000368876:R916Q	R	+	2	0	FAM179A	29128150	0.008000	0.16893	0.001000	0.08648	0.127000	0.20565	0.540000	0.23191	-0.133000	0.11537	-0.808000	0.03180	CGG	.		0.597	FAM179A-003	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317848.4	NM_199280	
C2orf71	388939	broad.mit.edu;bcgsc.ca	37	2	29296788	29296788	+	Missense_Mutation	SNP	T	T	C			TCGA-OR-A5L2-01A-11D-A30A-10	TCGA-OR-A5L2-10A-01D-A30A-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b99bd79e-aa33-4896-8d10-2517c793f439	48e26b1d-b84d-432b-940b-9907c81ddf5b	g.chr2:29296788T>C	ENST00000331664.5	-	1	339	c.340A>G	c.(340-342)Att>Gtt	p.I114V		NM_001029883.2	NP_001025054.1	A6NGG8	CB071_HUMAN	chromosome 2 open reading frame 71	114					response to stimulus (GO:0050896)|visual perception (GO:0007601)	primary cilium (GO:0072372)				NS(2)|breast(5)|central_nervous_system(3)|endometrium(4)|kidney(3)|large_intestine(11)|lung(20)|ovary(2)|prostate(6)|skin(3)|stomach(1)	60						TTGAACGGAATATCCTTAGCC	0.458																																					p.I114V		.											.	C2orf71-91	0			c.A340G						.						274.0	255.0	261.0					2																	29296788		1965	4163	6128	SO:0001583	missense	388939	exon1			ACGGAATATCCTT		CCDS42669.1	2p23.2	2014-01-28			ENSG00000179270	ENSG00000179270			34383	protein-coding gene	gene with protein product		613425				20398886	Standard	NM_001029883		Approved	FLJ34931, RP54	uc002rmt.2	A6NGG8	OTTHUMG00000152024	ENST00000331664.5:c.340A>G	2.37:g.29296788T>C	ENSP00000332809:p.Ile114Val	Somatic	263	1		WXS	Illumina GAIIx	Phase_I	233	10	NM_001029883	0	0	0	0	0		Missense_Mutation	SNP	ENST00000331664.5	37	CCDS42669.1	.	.	.	.	.	.	.	.	.	.	T	3.393	-0.123846	0.06795	.	.	ENSG00000179270	ENST00000331664	T	0.19394	2.15	5.52	-6.62	0.01813	.	0.972002	0.08448	N	0.944316	T	0.15998	0.0385	L	0.53249	1.67	0.09310	N	1	B	0.20052	0.041	B	0.16722	0.016	T	0.28964	-1.0027	10	0.42905	T	0.14	1.9227	6.3332	0.21282	0.0:0.2797:0.3494:0.3709	.	114	A6NGG8	CB071_HUMAN	V	114	ENSP00000332809:I114V	ENSP00000332809:I114V	I	-	1	0	C2orf71	29150292	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-0.008000	0.12788	-1.518000	0.01778	-0.366000	0.07423	ATT	.		0.458	C2orf71-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000324924.3	NM_001029883	
PLEKHH2	130271	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	2	43984346	43984346	+	Missense_Mutation	SNP	T	T	A			TCGA-OR-A5L2-01A-11D-A30A-10	TCGA-OR-A5L2-10A-01D-A30A-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b99bd79e-aa33-4896-8d10-2517c793f439	48e26b1d-b84d-432b-940b-9907c81ddf5b	g.chr2:43984346T>A	ENST00000282406.4	+	26	3994	c.3884T>A	c.(3883-3885)gTc>gAc	p.V1295D		NM_172069.3	NP_742066.2	Q8IVE3	PKHH2_HUMAN	pleckstrin homology domain containing, family H (with MyTH4 domain) member 2	1295	FERM. {ECO:0000255|PROSITE- ProRule:PRU00084}.				negative regulation of actin filament depolymerization (GO:0030835)	cortical actin cytoskeleton (GO:0030864)|cytoplasm (GO:0005737)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)	actin binding (GO:0003779)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|kidney(4)|large_intestine(12)|lung(24)|pancreas(1)|prostate(1)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	56		all_hematologic(82;0.166)|Acute lymphoblastic leukemia(82;0.17)				CTAAAGCAAGTCATAGAGAAA	0.368																																					p.V1295D		.											.	PLEKHH2-92	0			c.T3884A						.						83.0	93.0	90.0					2																	43984346		2203	4300	6503	SO:0001583	missense	130271	exon26			AGCAAGTCATAGA	AB095948	CCDS1812.1	2p22	2013-01-10			ENSG00000152527	ENSG00000152527		"""Pleckstrin homology (PH) domain containing"""	30506	protein-coding gene	gene with protein product		612723					Standard	NM_172069		Approved	KIAA2028, PLEKHH1L	uc010yny.2	Q8IVE3	OTTHUMG00000128657	ENST00000282406.4:c.3884T>A	2.37:g.43984346T>A	ENSP00000282406:p.Val1295Asp	Somatic	102	0		WXS	Illumina GAIIx	Phase_I	108	6	NM_172069	0	0	0	0	0	Q5JPJ6|Q6P4Q1|Q8N3Q3	Missense_Mutation	SNP	ENST00000282406.4	37	CCDS1812.1	.	.	.	.	.	.	.	.	.	.	T	14.63	2.591816	0.46214	.	.	ENSG00000152527	ENST00000282406	T	0.71817	-0.6	4.93	2.57	0.30868	Band 4.1 domain (1);FERM central domain (2);FERM domain (1);FERM/acyl-CoA-binding protein, 3-helical bundle (1);	0.126827	0.52532	D	0.000061	T	0.78253	0.4254	M	0.73217	2.22	0.80722	D	1	P	0.37594	0.601	P	0.55455	0.776	T	0.76575	-0.2909	10	0.59425	D	0.04	-1.5446	7.3493	0.26680	0.0:0.2424:0.0:0.7576	.	1295	Q8IVE3	PKHH2_HUMAN	D	1295	ENSP00000282406:V1295D	ENSP00000282406:V1295D	V	+	2	0	PLEKHH2	43837850	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.104000	0.50306	0.729000	0.32403	0.533000	0.62120	GTC	.		0.368	PLEKHH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250537.1	NM_172069	
SRBD1	55133	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	45801796	45801796	+	Missense_Mutation	SNP	T	T	C			TCGA-OR-A5L2-01A-11D-A30A-10	TCGA-OR-A5L2-10A-01D-A30A-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b99bd79e-aa33-4896-8d10-2517c793f439	48e26b1d-b84d-432b-940b-9907c81ddf5b	g.chr2:45801796T>C	ENST00000263736.4	-	8	1201	c.1139A>G	c.(1138-1140)gAc>gGc	p.D380G		NM_018079.4	NP_060549.4	Q8N5C6	SRBD1_HUMAN	S1 RNA binding domain 1	380					nucleobase-containing compound metabolic process (GO:0006139)		hydrolase activity, acting on ester bonds (GO:0016788)|RNA binding (GO:0003723)			NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(13)|large_intestine(8)|lung(15)|skin(2)|stomach(1)|urinary_tract(1)	49		all_hematologic(82;0.166)|Acute lymphoblastic leukemia(82;0.17)	LUSC - Lung squamous cell carcinoma(58;0.0917)|Lung(47;0.154)			CGTGTCTTTGTCTTTAGCAAT	0.388																																					p.D380G		.											.	SRBD1-90	0			c.A1139G						.						135.0	131.0	132.0					2																	45801796		2203	4300	6503	SO:0001583	missense	55133	exon8			TCTTTGTCTTTAG	AK056536	CCDS1823.1	2p21	2008-02-05			ENSG00000068784	ENSG00000068784			25521	protein-coding gene	gene with protein product						12477932	Standard	NM_018079		Approved	FLJ10379	uc002rus.3	Q8N5C6	OTTHUMG00000128814	ENST00000263736.4:c.1139A>G	2.37:g.45801796T>C	ENSP00000263736:p.Asp380Gly	Somatic	90	0		WXS	Illumina GAIIx	Phase_I	89	21	NM_018079	0	0	0	0	0	Q53T56|Q96TA4|Q9NW11	Missense_Mutation	SNP	ENST00000263736.4	37	CCDS1823.1	.	.	.	.	.	.	.	.	.	.	T	21.8	4.200072	0.79015	.	.	ENSG00000068784	ENST00000263736	T	0.50548	0.74	5.06	5.06	0.68205	Tex-like protein, N-terminal (1);Tex-like domain (1);	0.055265	0.64402	D	0.000001	T	0.68613	0.3020	M	0.86864	2.845	0.80722	D	1	D	0.56968	0.978	P	0.58331	0.837	T	0.76055	-0.3099	10	0.87932	D	0	.	14.4616	0.67453	0.0:0.0:0.0:1.0	.	380	Q8N5C6	SRBD1_HUMAN	G	380	ENSP00000263736:D380G	ENSP00000263736:D380G	D	-	2	0	SRBD1	45655300	1.000000	0.71417	1.000000	0.80357	0.956000	0.61745	5.296000	0.65698	1.911000	0.55334	0.459000	0.35465	GAC	.		0.388	SRBD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250747.3	NM_018079	
INO80B	83444	hgsc.bcm.edu	37	2	74684659	74684659	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5L2-01A-11D-A30A-10	TCGA-OR-A5L2-10A-01D-A30A-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b99bd79e-aa33-4896-8d10-2517c793f439	48e26b1d-b84d-432b-940b-9907c81ddf5b	g.chr2:74684659G>A	ENST00000233331.7	+	5	833	c.739G>A	c.(739-741)Gcg>Acg	p.A247T	WBP1_ENST00000233615.2_5'Flank|INO80B_ENST00000409917.1_3'UTR|INO80B_ENST00000469849.1_3'UTR|WBP1_ENST00000409737.1_5'Flank|WBP1_ENST00000393972.3_5'Flank	NM_031288.3	NP_112578.2	Q9C086	IN80B_HUMAN	INO80 complex subunit B	247					chromatin remodeling (GO:0006338)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|Ino80 complex (GO:0031011)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)			endometrium(1)|large_intestine(2)|lung(5)|pancreas(1)|prostate(3)|upper_aerodigestive_tract(1)	13						CAAGACTGCGGCGACCAGTgg	0.756																																					p.A247T		.											.	INO80B-226	0			c.G739A						.						3.0	4.0	4.0					2																	74684659		1798	3588	5386	SO:0001583	missense	83444	exon5			ACTGCGGCGACCA	AB054538	CCDS1942.2	2p13.1	2011-07-06	2008-08-07	2008-08-07	ENSG00000115274	ENSG00000115274		"""Zinc fingers, HIT-type"", ""INO80 complex subunits"""	13324	protein-coding gene	gene with protein product	"""PAP-1 binding protein"", ""IES2 homolog (S. cerevisiae)"""		"""high mobility group AT-hook 1-like 4"", ""zinc finger, HIT type 4"""	HMGA1L4, ZNHIT4		16230350	Standard	NM_031288		Approved	HMGIYL4, PAPA-1, hIes2, PAP-1BP, IES2	uc002slg.3	Q9C086	OTTHUMG00000129959	ENST00000233331.7:c.739G>A	2.37:g.74684659G>A	ENSP00000233331:p.Ala247Thr	Somatic	5	0		WXS	Illumina GAIIx	Phase_I	18	6	NM_031288	0	0	0	0	0		Missense_Mutation	SNP	ENST00000233331.7	37	CCDS1942.2	.	.	.	.	.	.	.	.	.	.	G	19.67	3.871240	0.72065	.	.	ENSG00000115274	ENST00000233331	T	0.47177	0.85	4.53	4.53	0.55603	PAPA-1-like conserved region (1);	0.231094	0.41712	D	0.000832	T	0.34803	0.0910	L	0.34521	1.04	0.80722	D	1	P;B;B	0.46064	0.872;0.348;0.348	B;B;B	0.42827	0.399;0.086;0.086	T	0.04522	-1.0945	10	0.23302	T	0.38	-15.7951	8.3904	0.32524	0.1049:0.0:0.8951:0.0	.	265;232;247	B4DJ31;B4DJ22;Q9C086	.;.;IN80B_HUMAN	T	247	ENSP00000233331:A247T	ENSP00000233331:A247T	A	+	1	0	INO80B	74538167	1.000000	0.71417	0.974000	0.42286	0.957000	0.61999	2.829000	0.48128	2.361000	0.80049	0.462000	0.41574	GCG	.		0.756	INO80B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252223.2	NM_031288	
KRCC1	51315	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	88327571	88327571	+	Nonsense_Mutation	SNP	G	G	C			TCGA-OR-A5L2-01A-11D-A30A-10	TCGA-OR-A5L2-10A-01D-A30A-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b99bd79e-aa33-4896-8d10-2517c793f439	48e26b1d-b84d-432b-940b-9907c81ddf5b	g.chr2:88327571G>C	ENST00000347055.3	-	4	905	c.512C>G	c.(511-513)tCa>tGa	p.S171*		NM_016618.1	NP_057702.1	Q9NPI7	KRCC1_HUMAN	lysine-rich coiled-coil 1	171	Lys-rich.									cervix(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(3)|ovary(1)	7						CTCCTCCTCTGATTTTTCTCT	0.423																																					p.S171X		.											.	KRCC1-69	0			c.C512G						.						120.0	121.0	121.0					2																	88327571		2203	4300	6503	SO:0001587	stop_gained	51315	exon4			TCCTCTGATTTTT	AF208845	CCDS2000.1	2p11.2	2008-02-05			ENSG00000172086	ENSG00000172086			28039	protein-coding gene	gene with protein product						12477932	Standard	XM_005264360		Approved	FLJ22333	uc002sso.1	Q9NPI7	OTTHUMG00000130315	ENST00000347055.3:c.512C>G	2.37:g.88327571G>C	ENSP00000340083:p.Ser171*	Somatic	71	0		WXS	Illumina GAIIx	Phase_I	52	20	NM_016618	0	0	0	0	0	Q3B7J7	Nonsense_Mutation	SNP	ENST00000347055.3	37	CCDS2000.1	.	.	.	.	.	.	.	.	.	.	G	19.46	3.831656	0.71258	.	.	ENSG00000172086	ENST00000347055	.	.	.	5.61	3.71	0.42584	.	0.951096	0.08731	N	0.902038	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.44086	T	0.13	-10.1463	4.1717	0.10332	0.0854:0.1556:0.5982:0.1608	.	.	.	.	X	171	.	ENSP00000340083:S171X	S	-	2	0	KRCC1	88108686	0.001000	0.12720	0.002000	0.10522	0.214000	0.24535	0.500000	0.22562	1.368000	0.46115	0.650000	0.86243	TCA	.		0.423	KRCC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252664.1	NM_016618	
CNNM4	26504	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	97475185	97475185	+	Silent	SNP	C	C	T	rs187426899		TCGA-OR-A5L2-01A-11D-A30A-10	TCGA-OR-A5L2-10A-01D-A30A-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b99bd79e-aa33-4896-8d10-2517c793f439	48e26b1d-b84d-432b-940b-9907c81ddf5b	g.chr2:97475185C>T	ENST00000377075.2	+	7	2357	c.2259C>T	c.(2257-2259)gaC>gaT	p.D753D	RP11-353K11.1_ENST00000608609.1_lincRNA|CNNM4_ENST00000540067.1_3'UTR	NM_020184.3	NP_064569.3	Q6P4Q7	CNNM4_HUMAN	cyclin and CBS domain divalent metal cation transport mediator 4	753					biomineral tissue development (GO:0031214)|ion transport (GO:0006811)|response to stimulus (GO:0050896)|visual perception (GO:0007601)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	adenyl nucleotide binding (GO:0030554)			breast(2)|endometrium(4)|kidney(1)|large_intestine(1)|lung(9)|ovary(1)|prostate(2)	20						CTGTGGTGGACGAGACCACAA	0.602													C|||	1	0.000199681	0.0	0.0	5008	,	,		20392	0.0		0.001	False		,,,				2504	0.0				p.D753D		.											.	CNNM4-154	0			c.C2259T						.						120.0	94.0	103.0					2																	97475185		2203	4300	6503	SO:0001819	synonymous_variant	26504	exon7			GGTGGACGAGACC	AB046812	CCDS2024.2	2q11.2	2014-08-08	2014-08-07		ENSG00000158158	ENSG00000158158			105	protein-coding gene	gene with protein product		607805	"""cyclin M4"""	ACDP4		21393841, 24194943	Standard	XM_005263914		Approved	KIAA1592	uc002swx.3	Q6P4Q7	OTTHUMG00000130532	ENST00000377075.2:c.2259C>T	2.37:g.97475185C>T		Somatic	178	0		WXS	Illumina GAIIx	Phase_I	203	86	NM_020184	0	0	0	0	0	B7Z1U0|C7SQM3|C7SQM4|C7SQM5|Q53RE5|Q9H9G3|Q9HCI0|Q9NRN1	Silent	SNP	ENST00000377075.2	37	CCDS2024.2																																																																																			C|0.999;T|0.000		0.602	CNNM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252954.1	NM_020184	
PDCL3	79031	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	101192892	101192892	+	Silent	SNP	C	C	T	rs145184150	byFrequency	TCGA-OR-A5L2-01A-11D-A30A-10	TCGA-OR-A5L2-10A-01D-A30A-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b99bd79e-aa33-4896-8d10-2517c793f439	48e26b1d-b84d-432b-940b-9907c81ddf5b	g.chr2:101192892C>T	ENST00000264254.6	+	6	1032	c.654C>T	c.(652-654)gaC>gaT	p.D218D	snoU13_ENST00000458824.1_RNA	NM_024065.4	NP_076970.1	Q9H2J4	PDCL3_HUMAN	phosducin-like 3	218	Thioredoxin fold. {ECO:0000250}.				angiogenesis (GO:0001525)|apoptotic process (GO:0006915)|negative regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000059)|positive regulation of angiogenesis (GO:0045766)|positive regulation of endothelial cell proliferation (GO:0001938)|protein folding (GO:0006457)|regulation of peptidyl-tyrosine phosphorylation (GO:0050730)|viral process (GO:0016032)	cytoplasm (GO:0005737)	protein binding involved in protein folding (GO:0044183)			endometrium(3)|large_intestine(2)|liver(1)|lung(6)	12						CGATTGAAGACGTGTTGCTGT	0.473													C|||	7	0.00139776	0.0038	0.0029	5008	,	,		16105	0.0		0.0	False		,,,				2504	0.0				p.D218D		.											.	PDCL3-90	0			c.C654T						.	C		10,4396		0,10,2193	90.0	82.0	85.0		654	-0.1	0.0	2	dbSNP_134	85	0,8600		0,0,4300	no	coding-synonymous	PDCL3	NM_024065.4		0,10,6493	TT,TC,CC		0.0,0.227,0.0769		218/240	101192892	10,12996	2203	4300	6503	SO:0001819	synonymous_variant	79031	exon6			TGAAGACGTGTTG	AF267853	CCDS33261.1	2q12	2008-02-05			ENSG00000115539	ENSG00000115539			28860	protein-coding gene	gene with protein product		611678					Standard	NM_024065		Approved	VIAF1	uc002tao.2	Q9H2J4	OTTHUMG00000153141	ENST00000264254.6:c.654C>T	2.37:g.101192892C>T		Somatic	92	0		WXS	Illumina GAIIx	Phase_I	84	14	NM_024065	0	0	0	0	0	B2RA00|Q53S68	Silent	SNP	ENST00000264254.6	37	CCDS33261.1																																																																																			C|0.999;T|0.001		0.473	PDCL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000329734.1	NM_024065	
POU3F3	5455	hgsc.bcm.edu	37	2	105472055	105472055	+	Silent	SNP	T	T	C	rs186512421		TCGA-OR-A5L2-01A-11D-A30A-10	TCGA-OR-A5L2-10A-01D-A30A-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b99bd79e-aa33-4896-8d10-2517c793f439	48e26b1d-b84d-432b-940b-9907c81ddf5b	g.chr2:105472055T>C	ENST00000361360.2	+	1	87	c.87T>C	c.(85-87)gcT>gcC	p.A29A	RP11-13J10.1_ENST00000598623.1_RNA|AC018730.1_ENST00000447876.1_RNA	NM_006236.1	NP_006227.1	P20264	PO3F3_HUMAN	POU class 3 homeobox 3	29	Gly-rich.				central nervous system development (GO:0007417)|cerebral cortex radially oriented cell migration (GO:0021799)|forebrain ventricular zone progenitor cell division (GO:0021869)|metanephric ascending thin limb development (GO:0072218)|metanephric DCT cell differentiation (GO:0072240)|metanephric loop of Henle development (GO:0072236)|metanephric macula densa development (GO:0072227)|metanephric thick ascending limb development (GO:0072233)|negative regulation of apoptotic process (GO:0043066)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|liver(1)|lung(4)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	12						cggcaggggctggcggcggcg	0.806																																					p.A29A		.											.	POU3F3-45	0			c.T87C						.						1.0	1.0	1.0					2																	105472055		328	609	937	SO:0001819	synonymous_variant	5455	exon1			AGGGGCTGGCGGC		CCDS33265.1	2q12.1	2011-06-20	2007-07-13		ENSG00000198914	ENSG00000198914		"""Homeoboxes / POU class"""	9216	protein-coding gene	gene with protein product		602480	"""POU domain class 3, transcription factor 3"""				Standard	NM_006236		Approved	BRN1, OTF8	uc010ywg.2	P20264	OTTHUMG00000153067	ENST00000361360.2:c.87T>C	2.37:g.105472055T>C		Somatic	1	0		WXS	Illumina GAIIx	Phase_I	7	6	NM_006236	0	0	0	0	0	P78379|Q4ZG25	Silent	SNP	ENST00000361360.2	37	CCDS33265.1																																																																																			T|0.299;C|0.701		0.806	POU3F3-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000329335.2		
C2orf40	84417	hgsc.bcm.edu	37	2	106682226	106682226	+	Silent	SNP	T	T	C	rs4271786|rs543094154	byFrequency	TCGA-OR-A5L2-01A-11D-A30A-10	TCGA-OR-A5L2-10A-01D-A30A-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b99bd79e-aa33-4896-8d10-2517c793f439	48e26b1d-b84d-432b-940b-9907c81ddf5b	g.chr2:106682226T>C	ENST00000238044.3	+	1	115	c.6T>C	c.(4-6)gcT>gcC	p.A2A	C2orf40_ENST00000489174.1_Intron|C2orf40_ENST00000409944.1_Intron	NM_032411.2	NP_115787.1	Q9H1Z8	AUGN_HUMAN	chromosome 2 open reading frame 40	2					cellular senescence (GO:0090398)|cyclin catabolic process (GO:0008054)|G1 to G0 transition (GO:0070314)	cytoplasmic vesicle (GO:0031410)|extracellular space (GO:0005615)				lung(7)|urinary_tract(1)	8						CCGCCATGGCTGCCTCCCCCG	0.766													C|||	1272	0.253994	0.2753	0.1369	5008	,	,		11771	0.2411		0.2227	False		,,,				2504	0.3538				p.A2A		.											.	C2orf40-90	0			c.T6C						.	C		520,2666		23,474,1096	2.0	3.0	3.0		6	1.0	0.3	2	dbSNP_111	3	871,5647		54,763,2442	no	coding-synonymous	C2orf40	NM_032411.2		77,1237,3538	CC,CT,TT		13.363,16.3214,14.3343		2/149	106682226	1391,8313	1593	3259	4852	SO:0001819	synonymous_variant	84417	exon1			CATGGCTGCCTCC	BC021742	CCDS2072.1	2q12.2	2014-01-28			ENSG00000119147	ENSG00000119147			24642	protein-coding gene	gene with protein product	"""esophageal cancer related gene 4 protein"""	611752				12800218	Standard	NM_032411		Approved	ECRG4, augurin	uc010fjf.3	Q9H1Z8	OTTHUMG00000130921	ENST00000238044.3:c.6T>C	2.37:g.106682226T>C		Somatic	1	0		WXS	Illumina GAIIx	Phase_I	11	8	NM_032411	0	0	0	0	0	D3DVK2	Silent	SNP	ENST00000238044.3	37	CCDS2072.1																																																																																			T|0.765;C|0.235		0.766	C2orf40-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253515.2	NM_032411	
C2orf40	84417	hgsc.bcm.edu	37	2	106682235	106682235	+	Silent	SNP	C	C	G	rs4266035	byFrequency	TCGA-OR-A5L2-01A-11D-A30A-10	TCGA-OR-A5L2-10A-01D-A30A-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b99bd79e-aa33-4896-8d10-2517c793f439	48e26b1d-b84d-432b-940b-9907c81ddf5b	g.chr2:106682235C>G	ENST00000238044.3	+	1	124	c.15C>G	c.(13-15)ccC>ccG	p.P5P	C2orf40_ENST00000489174.1_Intron|C2orf40_ENST00000409944.1_Intron	NM_032411.2	NP_115787.1	Q9H1Z8	AUGN_HUMAN	chromosome 2 open reading frame 40	5					cellular senescence (GO:0090398)|cyclin catabolic process (GO:0008054)|G1 to G0 transition (GO:0070314)	cytoplasmic vesicle (GO:0031410)|extracellular space (GO:0005615)				lung(7)|urinary_tract(1)	8						CTGCCTCCCCCGCGCGGCCTG	0.751													C|||	1156	0.230831	0.18	0.1239	5008	,	,		11837	0.2391		0.2187	False		,,,				2504	0.3793				p.P5P		.											.	C2orf40-90	0			c.C15G						.						2.0	3.0	3.0					2																	106682235		1650	3370	5020	SO:0001819	synonymous_variant	84417	exon1			CTCCCCCGCGCGG	BC021742	CCDS2072.1	2q12.2	2014-01-28			ENSG00000119147	ENSG00000119147			24642	protein-coding gene	gene with protein product	"""esophageal cancer related gene 4 protein"""	611752				12800218	Standard	NM_032411		Approved	ECRG4, augurin	uc010fjf.3	Q9H1Z8	OTTHUMG00000130921	ENST00000238044.3:c.15C>G	2.37:g.106682235C>G		Somatic	1	0		WXS	Illumina GAIIx	Phase_I	15	10	NM_032411	0	0	0	0	0	D3DVK2	Silent	SNP	ENST00000238044.3	37	CCDS2072.1																																																																																			C|0.795;G|0.205		0.751	C2orf40-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253515.2	NM_032411	
MARCO	8685	broad.mit.edu	37	2	119739941	119739941	+	Missense_Mutation	SNP	G	G	T	rs202171758		TCGA-OR-A5L2-01A-11D-A30A-10	TCGA-OR-A5L2-10A-01D-A30A-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b99bd79e-aa33-4896-8d10-2517c793f439	48e26b1d-b84d-432b-940b-9907c81ddf5b	g.chr2:119739941G>T	ENST00000327097.4	+	12	1153	c.1018G>T	c.(1018-1020)Ggg>Tgg	p.G340W	MARCO_ENST00000541757.1_Missense_Mutation_p.G262W	NM_006770.3	NP_006761.1	Q9UEW3	MARCO_HUMAN	macrophage receptor with collagenous structure	340	Collagen-like.				apoptotic cell clearance (GO:0043277)|cell surface receptor signaling pathway (GO:0007166)|innate immune response (GO:0045087)|pattern recognition receptor signaling pathway (GO:0002221)	collagen trimer (GO:0005581)|endocytic vesicle membrane (GO:0030666)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	scavenger receptor activity (GO:0005044)|signaling pattern recognition receptor activity (GO:0008329)|transmembrane signaling receptor activity (GO:0004888)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(2)|large_intestine(12)|lung(37)|ovary(4)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	70						AGGGAGCCCCGGGAGTCCAGG	0.592																																					p.G340W	GBM(8;18 374 7467 11269 32796)	.											.	MARCO-95	0			c.G1018T						.	G	TRP/GLY	0,4406		0,0,2203	133.0	149.0	144.0		1018	4.8	0.1	2		144	2,8598	2.2+/-6.3	0,2,4298	yes	missense	MARCO	NM_006770.3	184	0,2,6501	TT,TG,GG		0.0233,0.0,0.0154	probably-damaging	340/521	119739941	2,13004	2203	4300	6503	SO:0001583	missense	8685	exon12			AGCCCCGGGAGTC	AF035819	CCDS2124.1	2q14.2	2011-10-11			ENSG00000019169	ENSG00000019169			6895	protein-coding gene	gene with protein product	"""scavenger receptor class A, member 2"""	604870				9468508, 7867067, 10331948	Standard	NM_006770		Approved	SCARA2	uc002tln.1	Q9UEW3	OTTHUMG00000131400	ENST00000327097.4:c.1018G>T	2.37:g.119739941G>T	ENSP00000318916:p.Gly340Trp	Somatic	114	2		WXS	Illumina GAIIx	Phase_I	128	4	NM_006770	0	0	0	0	0	B4DW79|Q9Y5S3	Missense_Mutation	SNP	ENST00000327097.4	37	CCDS2124.1	.	.	.	.	.	.	.	.	.	.	G	15.11	2.736658	0.49045	0.0	2.33E-4	ENSG00000019169	ENST00000327097;ENST00000410021;ENST00000541757	D;D	0.99637	-6.29;-6.11	4.83	4.83	0.62350	.	0.070096	0.56097	D	0.000028	D	0.99729	0.9894	H	0.96111	3.77	0.29104	N	0.881272	D	0.89917	1.0	D	0.97110	1.0	D	0.97041	0.9757	9	.	.	.	.	13.303	0.60336	0.0:0.0:1.0:0.0	.	340	Q9UEW3	MARCO_HUMAN	W	340;340;262	ENSP00000318916:G340W;ENSP00000441769:G262W	.	G	+	1	0	MARCO	119456411	0.997000	0.39634	0.115000	0.21578	0.672000	0.39443	4.843000	0.62838	2.496000	0.84212	0.563000	0.77884	GGG	.		0.592	MARCO-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254190.2	NM_006770	
NR4A2	4929	bcgsc.ca	37	2	157185931	157185931	+	Silent	SNP	G	G	T			TCGA-OR-A5L2-01A-11D-A30A-10	TCGA-OR-A5L2-10A-01D-A30A-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b99bd79e-aa33-4896-8d10-2517c793f439	48e26b1d-b84d-432b-940b-9907c81ddf5b	g.chr2:157185931G>T	ENST00000339562.4	-	3	1130	c.768C>A	c.(766-768)tcC>tcA	p.S256S	NR4A2_ENST00000409108.2_Silent_p.S256S|NR4A2_ENST00000429376.1_Silent_p.S193S|NR4A2_ENST00000409572.1_Silent_p.S256S|NR4A2_ENST00000426264.1_Silent_p.S193S|NR4A2_ENST00000539077.1_Silent_p.S267S	NM_006186.3	NP_006177.1	P43354	NR4A2_HUMAN	nuclear receptor subfamily 4, group A, member 2	256					adult locomotory behavior (GO:0008344)|cellular response to extracellular stimulus (GO:0031668)|cellular response to oxidative stress (GO:0034599)|central nervous system projection neuron axonogenesis (GO:0021952)|death (GO:0016265)|dopamine biosynthetic process (GO:0042416)|dopaminergic neuron differentiation (GO:0071542)|gene expression (GO:0010467)|general adaptation syndrome (GO:0051866)|habenula development (GO:0021986)|intracellular receptor signaling pathway (GO:0030522)|negative regulation of neuron apoptotic process (GO:0043524)|neuron maturation (GO:0042551)|neuron migration (GO:0001764)|positive regulation of catalytic activity (GO:0043085)|post-embryonic development (GO:0009791)|regulation of dopamine metabolic process (GO:0042053)|regulation of respiratory gaseous exchange (GO:0043576)|response to amphetamine (GO:0001975)|response to hypoxia (GO:0001666)|response to inorganic substance (GO:0010035)|response to insecticide (GO:0017085)|signal transduction (GO:0007165)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|steroid hormone receptor activity (GO:0003707)|zinc ion binding (GO:0008270)			breast(3)|endometrium(4)|kidney(1)|large_intestine(7)|lung(15)|ovary(5)|prostate(1)|skin(3)|urinary_tract(1)	40						CGTTGGAGGGGGAGCCCCGCG	0.677																																					p.S256S		.											.	NR4A2-189	0			c.C768A						.						19.0	20.0	20.0					2																	157185931		2202	4297	6499	SO:0001819	synonymous_variant	4929	exon3			GGAGGGGGAGCCC	X75918	CCDS2201.1	2q22-q23	2013-01-16			ENSG00000153234	ENSG00000153234		"""Nuclear hormone receptors"""	7981	protein-coding gene	gene with protein product		601828		NURR1		7706727	Standard	NM_006186		Approved	TINUR, NOT, RNR1, HZF-3	uc002tyz.4	P43354	OTTHUMG00000131950	ENST00000339562.4:c.768C>A	2.37:g.157185931G>T		Somatic	34	1		WXS	Illumina GAIIx	Phase_I	67	36	NM_006186	0	0	0	0	0	Q16311|Q53RZ2|Q6NXU0	Silent	SNP	ENST00000339562.4	37	CCDS2201.1																																																																																			.		0.677	NR4A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254909.2		
LY75	4065	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	160676404	160676404	+	Missense_Mutation	SNP	G	G	T			TCGA-OR-A5L2-01A-11D-A30A-10	TCGA-OR-A5L2-10A-01D-A30A-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b99bd79e-aa33-4896-8d10-2517c793f439	48e26b1d-b84d-432b-940b-9907c81ddf5b	g.chr2:160676404G>T	ENST00000263636.4	-	29	4013	c.3986C>A	c.(3985-3987)aCc>aAc	p.T1329N	LY75-CD302_ENST00000504764.1_Missense_Mutation_p.T1329N|LY75_ENST00000554112.1_Missense_Mutation_p.T1329N|LY75-CD302_ENST00000505052.1_Missense_Mutation_p.T1329N|LY75_ENST00000553424.1_Missense_Mutation_p.T1329N	NM_002349.3	NP_002340.2	O60449	LY75_HUMAN	lymphocyte antigen 75	1329	C-type lectin 8. {ECO:0000255|PROSITE- ProRule:PRU00040}.				endocytosis (GO:0006897)|immune response (GO:0006955)|inflammatory response (GO:0006954)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	carbohydrate binding (GO:0030246)|receptor activity (GO:0004872)			NS(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(22)|prostate(7)|skin(6)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	59				COAD - Colon adenocarcinoma(177;0.132)		TGACAGTGGGGTCTTATCAAA	0.348																																					p.T1329N		.											.	LY75-90	0			c.C3986A						.						64.0	67.0	66.0					2																	160676404		2202	4300	6502	SO:0001583	missense	4065	exon29			AGTGGGGTCTTAT	AF011333	CCDS2211.1	2q24	2011-08-30			ENSG00000054219	ENSG00000054219		"""CD molecules"", ""C-type lectin domain containing"""	6729	protein-coding gene	gene with protein product		604524				9553150	Standard	NM_002349		Approved	DEC-205, CLEC13B, CD205		O60449	OTTHUMG00000132025	ENST00000263636.4:c.3986C>A	2.37:g.160676404G>T	ENSP00000263636:p.Thr1329Asn	Somatic	58	0		WXS	Illumina GAIIx	Phase_I	54	19	NM_002349	0	0	0	0	0	O75913|Q53R46|Q53TF5|Q7Z575|Q7Z577	Missense_Mutation	SNP	ENST00000263636.4	37	CCDS2211.1	.	.	.	.	.	.	.	.	.	.	G	20.7	4.031329	0.75504	.	.	ENSG00000054219;ENSG00000054219;ENSG00000054219;ENSG00000248672;ENSG00000248672	ENST00000554112;ENST00000553424;ENST00000263636;ENST00000504764;ENST00000505052	T;T;T;T;T	0.09817	2.94;2.94;2.94;2.94;2.94	5.65	5.65	0.86999	C-type lectin fold (1);C-type lectin-like (1);C-type lectin (3);	.	.	.	.	T	0.43100	0.1232	M	0.89715	3.055	0.58432	D	0.999999	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.998;0.999;0.997	T	0.43376	-0.9395	9	0.44086	T	0.13	-13.7212	19.3228	0.94248	0.0:0.0:1.0:0.0	.	1329;1329;1329	O60449-3;O60449;O60449-2	.;LY75_HUMAN;.	N	1329	ENSP00000451511:T1329N;ENSP00000451446:T1329N;ENSP00000263636:T1329N;ENSP00000423463:T1329N;ENSP00000421035:T1329N	ENSP00000423463:T1329N	T	-	2	0	LY75;LY75-CD302	160384650	1.000000	0.71417	0.966000	0.40874	0.801000	0.45260	4.832000	0.62759	2.656000	0.90262	0.591000	0.81541	ACC	.		0.348	LY75-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000255035.1		
TTN	7273	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	179445121	179445121	+	Missense_Mutation	SNP	C	C	A			TCGA-OR-A5L2-01A-11D-A30A-10	TCGA-OR-A5L2-10A-01D-A30A-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b99bd79e-aa33-4896-8d10-2517c793f439	48e26b1d-b84d-432b-940b-9907c81ddf5b	g.chr2:179445121C>A	ENST00000591111.1	-	267	62286	c.62062G>T	c.(62062-62064)Gca>Tca	p.A20688S	TTN-AS1_ENST00000419746.1_RNA|TTN-AS1_ENST00000590807.1_RNA|TTN-AS1_ENST00000592600.1_RNA|TTN-AS1_ENST00000586831.1_RNA|TTN-AS1_ENST00000438095.1_RNA|TTN_ENST00000460472.2_Missense_Mutation_p.A13264S|TTN-AS1_ENST00000592630.1_RNA|RP11-171I2.2_ENST00000603521.1_RNA|TTN-AS1_ENST00000590932.1_RNA|TTN-AS1_ENST00000456053.1_RNA|TTN_ENST00000359218.5_Missense_Mutation_p.A13389S|TTN_ENST00000342175.6_Missense_Mutation_p.A13456S|RP11-171I2.5_ENST00000604215.1_RNA|TTN-AS1_ENST00000592750.1_RNA|TTN-AS1_ENST00000586707.1_RNA|TTN-AS1_ENST00000586452.1_RNA|TTN_ENST00000589042.1_Missense_Mutation_p.A22329S|TTN_ENST00000342992.6_Missense_Mutation_p.A19761S|TTN-AS1_ENST00000591332.1_RNA|TTN-AS1_ENST00000592689.1_RNA|TTN-AS1_ENST00000585451.1_RNA			Q8WZ42	TITIN_HUMAN	titin	20688					adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TATTTTCCTGCATCATATTTG	0.353																																					p.A22329S		.											.	TTN-636	0			c.G66985T						.						165.0	152.0	156.0					2																	179445121		1860	4096	5956	SO:0001583	missense	7273	exon317			TTCCTGCATCATA	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.62062G>T	2.37:g.179445121C>A	ENSP00000465570:p.Ala20688Ser	Somatic	116	0		WXS	Illumina GAIIx	Phase_I	93	34	NM_001267550	0	0	0	0	0	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	37		.	.	.	.	.	.	.	.	.	.	C	13.48	2.249489	0.39797	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	T;T;T;T	0.65916	-0.18;-0.18;-0.18;-0.18	5.45	4.56	0.56223	Immunoglobulin subtype (1);Immunoglobulin I-set (1);Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.48259	0.1490	N	0.17764	0.52	0.58432	D	0.999999	P;P;P;B	0.36753	0.568;0.568;0.568;0.414	B;B;B;B	0.33568	0.166;0.166;0.166;0.119	T	0.54702	-0.8254	9	0.87932	D	0	.	15.754	0.78011	0.1372:0.8628:0.0:0.0	.	13264;13389;13456;20688	D3DPF9;E7EQE6;E7ET18;Q8WZ42	.;.;.;TITIN_HUMAN	S	19761;13264;13456;13389;13262	ENSP00000343764:A19761S;ENSP00000434586:A13264S;ENSP00000340554:A13456S;ENSP00000352154:A13389S	ENSP00000340554:A13456S	A	-	1	0	TTN	179153367	1.000000	0.71417	1.000000	0.80357	0.937000	0.57800	4.936000	0.63506	1.274000	0.44362	0.563000	0.77884	GCA	.		0.353	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378	
MYL1	4632	broad.mit.edu	37	2	211179635	211179635	+	Splice_Site	SNP	C	C	G			TCGA-OR-A5L2-01A-11D-A30A-10	TCGA-OR-A5L2-10A-01D-A30A-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b99bd79e-aa33-4896-8d10-2517c793f439	48e26b1d-b84d-432b-940b-9907c81ddf5b	g.chr2:211179635C>G	ENST00000352451.3	-	1	279	c.132G>C	c.(130-132)aaG>aaC	p.K44N		NM_079420.2	NP_524144.1	P05976	MYL1_HUMAN	myosin, light chain 1, alkali; skeletal, fast	44					cardiac muscle contraction (GO:0060048)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)	cytosol (GO:0005829)|muscle myosin complex (GO:0005859)|myofibril (GO:0030016)|sarcomere (GO:0030017)	calcium ion binding (GO:0005509)|structural constituent of muscle (GO:0008307)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(5)|ovary(1)|prostate(2)|skin(1)	16				Epithelial(149;0.00573)|Lung(261;0.0422)|LUSC - Lung squamous cell carcinoma(261;0.0444)|all cancers(144;0.057)		ATTTAGTTACCTTAATGGCAG	0.502																																					p.K44N		.											.	MYL1-91	0			c.G132C						.						142.0	156.0	152.0					2																	211179635		2203	4300	6503	SO:0001630	splice_region_variant	4632	exon1			AGTTACCTTAATG		CCDS2390.1, CCDS2391.1	2q33-q34	2013-01-10	2006-09-29		ENSG00000168530	ENSG00000168530		"""Myosins / Light chain"", ""EF-hand domain containing"""	7582	protein-coding gene	gene with protein product		160780	"""myosin, light polypeptide 1, alkali; skeletal, fast"""			2304459, 3422212	Standard	NM_079422		Approved		uc002vec.3	P05976	OTTHUMG00000132992	ENST00000352451.3:c.132+1G>C	2.37:g.211179635C>G		Somatic	175	0		WXS	Illumina GAIIx	Phase_I	196	6	NM_079420	0	0	0	0	0	B2R4N6|B2R4T6|P06741|Q6IBD5	Missense_Mutation	SNP	ENST00000352451.3	37	CCDS2390.1	.	.	.	.	.	.	.	.	.	.	C	15.07	2.725033	0.48833	.	.	ENSG00000168530	ENST00000352451	D	0.86097	-2.07	5.39	5.39	0.77823	.	0.000000	0.85682	D	0.000000	D	0.84311	0.5444	M	0.79123	2.44	0.52501	D	0.999952	P	0.40638	0.725	B	0.31751	0.135	D	0.85312	0.1079	9	.	.	.	.	18.7703	0.91888	0.0:1.0:0.0:0.0	.	44	P05976	MYL1_HUMAN	N	44	ENSP00000307280:K44N	.	K	-	3	2	MYL1	210887880	1.000000	0.71417	1.000000	0.80357	0.968000	0.65278	5.295000	0.65692	2.511000	0.84671	0.655000	0.94253	AAG	.		0.502	MYL1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000256566.2	NM_079420	Missense_Mutation
DNAJB2	3300	broad.mit.edu;bcgsc.ca	37	2	220149572	220149572	+	Missense_Mutation	SNP	C	C	G			TCGA-OR-A5L2-01A-11D-A30A-10	TCGA-OR-A5L2-10A-01D-A30A-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b99bd79e-aa33-4896-8d10-2517c793f439	48e26b1d-b84d-432b-940b-9907c81ddf5b	g.chr2:220149572C>G	ENST00000336576.5	+	9	1126	c.838C>G	c.(838-840)Cag>Gag	p.Q280E	DNAJB2_ENST00000392086.4_Intron	NM_006736.5	NP_006727.2	P25686	DNJB2_HUMAN	DnaJ (Hsp40) homolog, subfamily B, member 2	280					cell death (GO:0008219)|ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of inclusion body assembly (GO:0090084)|negative regulation of protein deubiquitination (GO:0090086)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of protein ubiquitination (GO:0031398)|protein folding (GO:0006457)|protein refolding (GO:0042026)|response to unfolded protein (GO:0006986)	cytosol (GO:0005829)|inclusion body (GO:0016234)|nucleus (GO:0005634)	chaperone binding (GO:0051087)|Hsp70 protein binding (GO:0030544)|polyubiquitin binding (GO:0031593)|proteasome binding (GO:0070628)|unfolded protein binding (GO:0051082)			endometrium(4)|large_intestine(1)|lung(6)|prostate(1)|skin(1)|urinary_tract(1)	14		Renal(207;0.0474)		Epithelial(149;1.97e-06)|all cancers(144;0.00028)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		GCGGGAGGCACAGCACCGACG	0.662																																					p.Q280E		.											.	DNAJB2-226	0			c.C838G						.						20.0	21.0	21.0					2																	220149572		2198	4299	6497	SO:0001583	missense	3300	exon9			GAGGCACAGCACC		CCDS2439.1, CCDS46519.1	2q32-q34	2011-09-02			ENSG00000135924	ENSG00000135924		"""Heat shock proteins / DNAJ (HSP40)"""	5228	protein-coding gene	gene with protein product		604139		HSJ1		1599432, 10516435	Standard	NM_006736		Approved	HSPF3	uc002vkx.1	P25686	OTTHUMG00000133134	ENST00000336576.5:c.838C>G	2.37:g.220149572C>G	ENSP00000338019:p.Gln280Glu	Somatic	161	1		WXS	Illumina GAIIx	Phase_I	166	12	NM_006736	0	0	0	0	0	A8K9P6|Q8IUK1|Q8IUK2|Q96F52	Missense_Mutation	SNP	ENST00000336576.5	37	CCDS2439.1	.	.	.	.	.	.	.	.	.	.	C	8.703	0.910301	0.17833	.	.	ENSG00000135924	ENST00000336576	T	0.61274	0.12	4.25	4.25	0.50352	.	7739.210000	0.00166	N	0.000000	T	0.50803	0.1637	L	0.27053	0.805	0.27652	N	0.947364	B	0.19817	0.039	B	0.16289	0.015	T	0.39057	-0.9632	10	0.62326	D	0.03	.	11.1731	0.48584	0.3074:0.6926:0.0:0.0	.	280	P25686	DNJB2_HUMAN	E	280	ENSP00000338019:Q280E	ENSP00000338019:Q280E	Q	+	1	0	DNAJB2	219857816	0.509000	0.26163	0.600000	0.28864	0.814000	0.46013	1.749000	0.38319	2.397000	0.81536	0.456000	0.33151	CAG	.		0.662	DNAJB2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000256823.2		
SPEG	10290	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	220354432	220354432	+	Missense_Mutation	SNP	A	A	G			TCGA-OR-A5L2-01A-11D-A30A-10	TCGA-OR-A5L2-10A-01D-A30A-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b99bd79e-aa33-4896-8d10-2517c793f439	48e26b1d-b84d-432b-940b-9907c81ddf5b	g.chr2:220354432A>G	ENST00000312358.7	+	36	8824	c.8692A>G	c.(8692-8694)Act>Gct	p.T2898A	SPEG_ENST00000485813.1_3'UTR|AC053503.11_ENST00000429882.1_RNA	NM_005876.4	NP_005867.3	Q15772	SPEG_HUMAN	SPEG complex locus	2898	Pro-rich.				cardiac muscle cell development (GO:0055013)|in utero embryonic development (GO:0001701)|muscle organ development (GO:0007517)|negative regulation of cell proliferation (GO:0008285)|respiratory system development (GO:0060541)	nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			breast(2)|central_nervous_system(3)|endometrium(10)|kidney(2)|large_intestine(9)|lung(42)|ovary(5)|pancreas(1)|prostate(8)|skin(1)|stomach(9)|upper_aerodigestive_tract(4)|urinary_tract(4)	100		Renal(207;0.0183)		Epithelial(149;4.5e-10)|all cancers(144;7.93e-08)|Lung(261;0.00639)|LUSC - Lung squamous cell carcinoma(224;0.00829)|READ - Rectum adenocarcinoma(5;0.163)		GTCTTCCTCTACTCCTGTGTA	0.597																																					p.T2898A		.											.	SPEG-383	0			c.A8692G						.						143.0	148.0	147.0					2																	220354432		1976	4143	6119	SO:0001583	missense	10290	exon36			TCCTCTACTCCTG	BC006346	CCDS42824.1, CCDS54432.1	2q35	2013-01-11	2006-04-27	2006-04-27	ENSG00000072195	ENSG00000072195		"""Immunoglobulin superfamily / I-set domain containing"""	16901	protein-coding gene	gene with protein product		615950	"""aortic preferentially expressed gene 1"""	APEG1		8663449, 10973969	Standard	NM_005876		Approved	MGC12676, KIAA1297, SPEGalpha, SPEGbeta, BPEG	uc010fwg.3	Q15772	OTTHUMG00000058925	ENST00000312358.7:c.8692A>G	2.37:g.220354432A>G	ENSP00000311684:p.Thr2898Ala	Somatic	55	0		WXS	Illumina GAIIx	Phase_I	65	39	NM_005876	0	0	0	0	0	A8K0G6|A8MRU0|Q27J74|Q695L1|Q6FGA6|Q6ZQW1|Q6ZTL8|Q9P2P9	Missense_Mutation	SNP	ENST00000312358.7	37	CCDS42824.1	.	.	.	.	.	.	.	.	.	.	A	0.511	-0.866717	0.02590	.	.	ENSG00000072195	ENST00000312358;ENST00000265327	T	0.63744	-0.06	4.61	0.882	0.19172	.	1.226660	0.06124	N	0.669391	T	0.37293	0.0998	N	0.08118	0	0.09310	N	0.999999	B	0.02656	0.0	B	0.01281	0.0	T	0.20240	-1.0281	10	0.13853	T	0.58	.	5.6255	0.17480	0.481:0.3423:0.1767:0.0	.	2898	Q15772	SPEG_HUMAN	A	2898	ENSP00000311684:T2898A	ENSP00000265327:T2898A	T	+	1	0	SPEG	220062676	0.004000	0.15560	0.294000	0.24946	0.185000	0.23345	0.339000	0.19875	0.301000	0.22738	-0.560000	0.04181	ACT	.		0.597	SPEG-004	NOVEL	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000130252.2	NM_005876	
CDS2	8760	ucsc.edu;bcgsc.ca	37	20	5170814	5170814	+	Silent	SNP	C	C	T			TCGA-OR-A5L2-01A-11D-A30A-10	TCGA-OR-A5L2-10A-01D-A30A-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b99bd79e-aa33-4896-8d10-2517c793f439	48e26b1d-b84d-432b-940b-9907c81ddf5b	g.chr20:5170814C>T	ENST00000460006.1	+	13	1579	c.1272C>T	c.(1270-1272)atC>atT	p.I424I	CDS2_ENST00000379070.3_3'UTR|CDS2_ENST00000379062.4_Silent_p.I304I|CDS2_ENST00000535100.1_Silent_p.I194I	NM_003818.3	NP_003809.1	O95674	CDS2_HUMAN	CDP-diacylglycerol synthase (phosphatidate cytidylyltransferase) 2	424					CDP-diacylglycerol biosynthetic process (GO:0016024)|glycerophospholipid biosynthetic process (GO:0046474)|phosphatidylglycerol biosynthetic process (GO:0006655)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrial inner membrane (GO:0005743)	phosphatidate cytidylyltransferase activity (GO:0004605)			cervix(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(4)|prostate(1)|stomach(1)	14						AGCTCCACATCTTCAACACGC	0.532																																					p.I424I		.											.	CDS2-226	0			c.C1272T						.						85.0	70.0	75.0					20																	5170814		2203	4300	6503	SO:0001819	synonymous_variant	8760	exon13			CCACATCTTCAAC	AF069532	CCDS13088.1	20p13	2006-03-28			ENSG00000101290	ENSG00000101290	2.7.7.41		1801	protein-coding gene	gene with protein product		603549				9806839, 9889000	Standard	NM_003818		Approved		uc002wls.3	O95674	OTTHUMG00000031801	ENST00000460006.1:c.1272C>T	20.37:g.5170814C>T		Somatic	304	3		WXS	Illumina GAIIx	Phase_I	331	57	NM_003818	0	0	0	0	0	B2RDC6|D3DW04|Q5TDY2|Q5TDY3|Q5TDY4|Q5TDY5|Q9BYK5|Q9NTT2	Silent	SNP	ENST00000460006.1	37	CCDS13088.1																																																																																			.		0.532	CDS2-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077858.2		
INSM1	3642	hgsc.bcm.edu	37	20	20350152	20350152	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5L2-01A-11D-A30A-10	TCGA-OR-A5L2-10A-01D-A30A-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b99bd79e-aa33-4896-8d10-2517c793f439	48e26b1d-b84d-432b-940b-9907c81ddf5b	g.chr20:20350152C>T	ENST00000310227.1	+	1	1388	c.1241C>T	c.(1240-1242)cCc>cTc	p.P414L		NM_002196.2	NP_002187.1	Q01101	INSM1_HUMAN	insulinoma-associated 1	414					adrenal chromaffin cell differentiation (GO:0061104)|cell cycle (GO:0007049)|endocrine pancreas development (GO:0031018)|negative regulation of cell proliferation (GO:0008285)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|noradrenergic neuron development (GO:0003358)|norepinephrine biosynthetic process (GO:0042421)|pancreatic A cell differentiation (GO:0003310)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of cell differentiation (GO:0045597)|positive regulation of neural precursor cell proliferation (GO:2000179)|regulation of gene expression (GO:0010468)|regulation of protein complex assembly (GO:0043254)|sympathetic ganglion development (GO:0061549)|transcription, DNA-templated (GO:0006351)|transdifferentiation (GO:0060290)|type B pancreatic cell development (GO:0003323)|type B pancreatic cell differentiation (GO:0003309)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	chromatin DNA binding (GO:0031490)|core promoter binding (GO:0001047)|cyclin binding (GO:0030332)|histone deacetylase binding (GO:0042826)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			liver(1)|lung(3)|ovary(1)|prostate(1)	6				READ - Rectum adenocarcinoma(2;0.0649)		TACCCCGGGCCCGACGAGAAG	0.751																																					p.P414L		.											.	INSM1-91	0			c.C1241T						.						3.0	5.0	4.0					20																	20350152		1644	3538	5182	SO:0001583	missense	3642	exon1			CCGGGCCCGACGA		CCDS13143.1	20p11.2	2012-07-10			ENSG00000173404	ENSG00000173404			6090	protein-coding gene	gene with protein product		600010				8188699, 16569215	Standard	NM_002196		Approved	IA-1, IA1	uc002wrx.3	Q01101	OTTHUMG00000032004	ENST00000310227.1:c.1241C>T	20.37:g.20350152C>T	ENSP00000312631:p.Pro414Leu	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	6	4	NM_002196	0	0	0	0	0		Missense_Mutation	SNP	ENST00000310227.1	37	CCDS13143.1	.	.	.	.	.	.	.	.	.	.	C	13.37	2.215671	0.39102	.	.	ENSG00000173404	ENST00000310227	T	0.00816	5.66	3.81	3.81	0.43845	.	0.412070	0.17940	U	0.156870	T	0.01222	0.0040	N	0.19112	0.55	0.39337	D	0.965517	P	0.51791	0.948	P	0.48189	0.57	T	0.81428	-0.0937	10	0.31617	T	0.26	-5.9449	13.5348	0.61641	0.0:1.0:0.0:0.0	.	414	Q01101	INSM1_HUMAN	L	414	ENSP00000312631:P414L	ENSP00000312631:P414L	P	+	2	0	INSM1	20298152	0.000000	0.05858	0.999000	0.59377	0.726000	0.41606	0.088000	0.14979	2.110000	0.64415	0.455000	0.32223	CCC	.		0.751	INSM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078223.1	NM_002196	
FRG1B	284802	broad.mit.edu	37	20	29625956	29625956	+	Missense_Mutation	SNP	G	G	A	rs147809085		TCGA-OR-A5L2-01A-11D-A30A-10	TCGA-OR-A5L2-10A-01D-A30A-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b99bd79e-aa33-4896-8d10-2517c793f439	48e26b1d-b84d-432b-940b-9907c81ddf5b	g.chr20:29625956G>A	ENST00000278882.3	+	5	580	c.200G>A	c.(199-201)aGa>aAa	p.R67K	FRG1B_ENST00000358464.4_Missense_Mutation_p.R67K|FRG1B_ENST00000439954.2_Missense_Mutation_p.R72K			Q9BZ01	FRG1B_HUMAN	FSHD region gene 1 family, member B	67								p.R67K(2)		endometrium(10)|kidney(21)|lung(3)|pancreas(1)|prostate(9)|urinary_tract(9)	53						ATTGGACCAAGAGAACAATGG	0.338																																					.		.											.	FRG1B-22	2	Substitution - Missense(2)	kidney(2)	.						.																																			SO:0001583	missense	284802	.			GACCAAGAGAACA			20q11.1	2013-03-18	2007-10-11	2007-10-11	ENSG00000149531	ENSG00000149531			15792	other	unknown			"""chromosome 20 open reading frame 80"""	C20orf80			Standard	NR_003579		Approved	bA348I14.2	uc010ztl.1	Q9BZ01	OTTHUMG00000032157	ENST00000278882.3:c.200G>A	20.37:g.29625956G>A	ENSP00000278882:p.Arg67Lys	Somatic	153	0		WXS	Illumina GAIIx	Phase_I	169	5	.	0	0	0	0	0	C4AME5	RNA	SNP	ENST00000278882.3	37		.	.	.	.	.	.	.	.	.	.	g	9.648	1.140706	0.21205	.	.	ENSG00000149531	ENST00000278882;ENST00000439954;ENST00000358464	T	0.46063	0.88	1.68	1.68	0.24146	.	0.000000	0.85682	D	0.000000	T	0.27241	0.0668	.	.	.	0.46901	D	0.99924	B	0.02656	0.0	B	0.15484	0.013	T	0.07986	-1.0744	9	0.28530	T	0.3	.	9.3557	0.38164	0.0:0.0:1.0:0.0	.	72	F5H5R5	.	K	67;72;67	ENSP00000408863:R72K	ENSP00000278882:R67K	R	+	2	0	FRG1B	28239617	1.000000	0.71417	1.000000	0.80357	0.134000	0.20937	6.360000	0.73064	1.250000	0.43966	0.184000	0.17185	AGA	.		0.338	FRG1B-001	KNOWN	not_best_in_genome_evidence|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000078494.2	NR_003579	
FRG1B	284802	broad.mit.edu	37	20	29625971	29625971	+	Missense_Mutation	SNP	C	C	A	rs145033899		TCGA-OR-A5L2-01A-11D-A30A-10	TCGA-OR-A5L2-10A-01D-A30A-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b99bd79e-aa33-4896-8d10-2517c793f439	48e26b1d-b84d-432b-940b-9907c81ddf5b	g.chr20:29625971C>A	ENST00000278882.3	+	5	595	c.215C>A	c.(214-216)cCa>cAa	p.P72Q	FRG1B_ENST00000358464.4_Missense_Mutation_p.P72Q|FRG1B_ENST00000439954.2_Missense_Mutation_p.P77Q			Q9BZ01	FRG1B_HUMAN	FSHD region gene 1 family, member B	72										endometrium(10)|kidney(21)|lung(3)|pancreas(1)|prostate(9)|urinary_tract(9)	53						CAATGGGAACCAGTCTTTCAA	0.328																																					.		.											.	FRG1B-22	0			.						.																																			SO:0001583	missense	284802	.			GGGAACCAGTCTT			20q11.1	2013-03-18	2007-10-11	2007-10-11	ENSG00000149531	ENSG00000149531			15792	other	unknown			"""chromosome 20 open reading frame 80"""	C20orf80			Standard	NR_003579		Approved	bA348I14.2	uc010ztl.1	Q9BZ01	OTTHUMG00000032157	ENST00000278882.3:c.215C>A	20.37:g.29625971C>A	ENSP00000278882:p.Pro72Gln	Somatic	156	0		WXS	Illumina GAIIx	Phase_I	173	7	.	0	0	0	0	0	C4AME5	RNA	SNP	ENST00000278882.3	37		.	.	.	.	.	.	.	.	.	.	c	12.14	1.847531	0.32606	.	.	ENSG00000149531	ENST00000278882;ENST00000439954;ENST00000358464	T	0.49720	0.77	1.68	1.68	0.24146	.	0.112402	0.64402	D	0.000009	T	0.63271	0.2497	.	.	.	0.49483	D	0.999795	D	0.63046	0.992	D	0.79784	0.993	T	0.65948	-0.6044	9	0.66056	D	0.02	.	9.3557	0.38164	0.0:1.0:0.0:0.0	.	77	F5H5R5	.	Q	72;77;72	ENSP00000408863:P77Q	ENSP00000278882:P72Q	P	+	2	0	FRG1B	28239632	1.000000	0.71417	1.000000	0.80357	0.229000	0.25112	6.442000	0.73443	1.250000	0.43966	0.184000	0.17185	CCA	.		0.328	FRG1B-001	KNOWN	not_best_in_genome_evidence|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000078494.2	NR_003579	
NOL4L	140688	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	20	31115669	31115669	+	Silent	SNP	G	G	A			TCGA-OR-A5L2-01A-11D-A30A-10	TCGA-OR-A5L2-10A-01D-A30A-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b99bd79e-aa33-4896-8d10-2517c793f439	48e26b1d-b84d-432b-940b-9907c81ddf5b	g.chr20:31115669G>A	ENST00000201961.2	-	2	306	c.87C>T	c.(85-87)gtC>gtT	p.V29V	C20orf112_ENST00000375678.3_5'UTR			Q96MY1	NOL4L_HUMAN		187						cytoplasm (GO:0005737)|nucleus (GO:0005634)				endometrium(3)|kidney(2)|large_intestine(5)|lung(5)	15						CCACCACAGCGACCCGCTTCA	0.577																																					p.V123V		.											.	C20orf112-514	0			c.C369T						.																																			SO:0001819	synonymous_variant	140688	exon2			CACAGCGACCCGC																												ENST00000201961.2:c.87C>T	20.37:g.31115669G>A		Somatic	83	0		WXS	Illumina GAIIx	Phase_I	104	27	NM_001256798	0	0	0	0	0	Q5JYB7|Q6P0Y4|Q9BR34|Q9NQF6	Silent	SNP	ENST00000201961.2	37																																																																																				.		0.577	C20orf112-002	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000078629.3		
WFDC8	90199	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	20	44184408	44184408	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5L2-01A-11D-A30A-10	TCGA-OR-A5L2-10A-01D-A30A-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b99bd79e-aa33-4896-8d10-2517c793f439	48e26b1d-b84d-432b-940b-9907c81ddf5b	g.chr20:44184408C>T	ENST00000357199.4	-	4	455	c.377G>A	c.(376-378)aGg>aAg	p.R126K	WFDC8_ENST00000289953.2_Missense_Mutation_p.R126K	NM_181510.2	NP_852611.2	Q8IUA0	WFDC8_HUMAN	WAP four-disulfide core domain 8	126	BPTI/Kunitz inhibitor. {ECO:0000255|PROSITE-ProRule:PRU00031}.					extracellular region (GO:0005576)	serine-type endopeptidase inhibitor activity (GO:0004867)			central_nervous_system(1)|endometrium(1)|kidney(3)|large_intestine(4)|lung(4)|stomach(1)|upper_aerodigestive_tract(1)	15		Myeloproliferative disorder(115;0.0122)				TTCGCAGCCCCTGTATTTGAA	0.483																																					p.R126K		.											.	WFDC8-90	0			c.G377A						.						126.0	110.0	116.0					20																	44184408		2203	4300	6503	SO:0001583	missense	90199	exon4			CAGCCCCTGTATT	AL031663	CCDS13361.1	20q13.11	2013-01-21	2003-02-21	2003-02-21	ENSG00000158901	ENSG00000158901		"""WAP four-disulfide core domain containing"""	16163	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 170"""	C20orf170		12206714	Standard	NM_130896		Approved	dJ461P17.1, WAP8	uc002xow.3	Q8IUA0	OTTHUMG00000046342	ENST00000357199.4:c.377G>A	20.37:g.44184408C>T	ENSP00000361735:p.Arg126Lys	Somatic	77	0		WXS	Illumina GAIIx	Phase_I	94	11	NM_181510	0	0	0	0	0	E1P623|Q5TDV2|Q96A34	Missense_Mutation	SNP	ENST00000357199.4	37	CCDS13361.1	.	.	.	.	.	.	.	.	.	.	C	1.100	-0.661472	0.03454	.	.	ENSG00000158901	ENST00000357199;ENST00000289953	T;T	0.57107	0.42;0.42	4.26	-2.74	0.05932	Proteinase inhibitor I2, Kunitz metazoa (6);Proteinase inhibitor I2, Kunitz, conserved site (1);	1.539290	0.03462	N	0.212366	T	0.35128	0.0921	N	0.25201	0.72	0.09310	N	1	B	0.28470	0.213	B	0.28784	0.094	T	0.12578	-1.0542	10	0.25751	T	0.34	.	5.4418	0.16513	0.0:0.287:0.4393:0.2737	.	126	Q8IUA0	WFDC8_HUMAN	K	126	ENSP00000361735:R126K;ENSP00000289953:R126K	ENSP00000289953:R126K	R	-	2	0	WFDC8	43617822	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.856000	0.04290	-0.471000	0.06891	-0.140000	0.14226	AGG	.		0.483	WFDC8-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000106958.1		
ARFRP1	10139	bcgsc.ca	37	20	62333492	62333492	+	Silent	SNP	C	C	T	rs112359854		TCGA-OR-A5L2-01A-11D-A30A-10	TCGA-OR-A5L2-10A-01D-A30A-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b99bd79e-aa33-4896-8d10-2517c793f439	48e26b1d-b84d-432b-940b-9907c81ddf5b	g.chr20:62333492C>T	ENST00000359715.5	-	4	908	c.342G>A	c.(340-342)gcG>gcA	p.A114A	ARFRP1_ENST00000607873.1_Silent_p.A67A|ARFRP1_ENST00000440854.1_Silent_p.A114A|ARFRP1_ENST00000324228.2_Silent_p.A114A|ARFRP1_ENST00000609142.1_Silent_p.A114A|ARFRP1_ENST00000485858.1_5'Flank			Q13795	ARFRP_HUMAN	ADP-ribosylation factor related protein 1	114					gastrulation (GO:0007369)|Golgi to plasma membrane protein transport (GO:0043001)|GTP catabolic process (GO:0006184)|protein localization to Golgi apparatus (GO:0034067)|retrograde transport, endosome to Golgi (GO:0042147)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)	Golgi apparatus (GO:0005794)|membrane (GO:0016020)|trans-Golgi network (GO:0005802)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)			breast(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(2)|skin(1)	7	all_cancers(38;9.53e-13)|all_epithelial(29;2.64e-14)|Lung NSC(23;7e-10)|all_lung(23;2.53e-09)		Epithelial(9;4.09e-08)|all cancers(9;1.7e-07)|OV - Ovarian serous cystadenocarcinoma(5;0.0102)			ACTCACCAAACGCCTGCTTGG	0.617													C|||	1	0.000199681	0.0	0.0	5008	,	,		16170	0.0		0.0	False		,,,				2504	0.001				p.A114A		.											.	ARFRP1-291	0			c.G342A						.						90.0	75.0	80.0					20																	62333492		2203	4296	6499	SO:0001819	synonymous_variant	10139	exon5			ACCAAACGCCTGC	X91504	CCDS13533.1, CCDS46630.1, CCDS68172.1, CCDS68173.1	20q13.3	2014-05-09			ENSG00000101246	ENSG00000101246		"""ADP-ribosylation factors"""	662	protein-coding gene	gene with protein product		604699				8530503	Standard	NM_003224		Approved	ARP, Arp1, ARL18	uc031rup.1	Q13795	OTTHUMG00000032993	ENST00000359715.5:c.342G>A	20.37:g.62333492C>T		Somatic	38	1		WXS	Illumina GAIIx	Phase_I	63	22	NM_001134758	0	0	0	0	0	B7ZKX7|E1P5J9|Q6IBQ0	Silent	SNP	ENST00000359715.5	37	CCDS13533.1																																																																																			.		0.617	ARFRP1-007	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000472024.1		
SON	6651	broad.mit.edu;ucsc.edu;bcgsc.ca	37	21	34924819	34924819	+	Silent	SNP	G	G	A	rs536204949		TCGA-OR-A5L2-01A-11D-A30A-10	TCGA-OR-A5L2-10A-01D-A30A-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b99bd79e-aa33-4896-8d10-2517c793f439	48e26b1d-b84d-432b-940b-9907c81ddf5b	g.chr21:34924819G>A	ENST00000356577.4	+	3	3757	c.3282G>A	c.(3280-3282)tcG>tcA	p.S1094S	SON_ENST00000290239.6_Silent_p.S1094S|SON_ENST00000300278.4_Silent_p.S1094S|SON_ENST00000381679.4_Silent_p.S1094S|SON_ENST00000381692.2_Intron	NM_138927.1	NP_620305	P18583	SON_HUMAN	SON DNA binding protein	1094	14 X 6 AA repeats of [ED]-R-S-M-M-S.				cytokinesis (GO:0000910)|microtubule cytoskeleton organization (GO:0000226)|mRNA processing (GO:0006397)|negative regulation of apoptotic process (GO:0043066)|regulation of cell cycle (GO:0051726)|regulation of RNA splicing (GO:0043484)|RNA splicing (GO:0008380)	nuclear speck (GO:0016607)|nucleus (GO:0005634)	DNA binding (GO:0003677)|nucleic acid binding (GO:0003676)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			breast(3)|central_nervous_system(2)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(13)|lung(25)|ovary(4)|prostate(2)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	72						CTATGATGTCGTCATACTCTG	0.473													G|||	1	0.000199681	0.0	0.0014	5008	,	,		22222	0.0		0.0	False		,,,				2504	0.0				p.S1094S		.											.	SON-97	0			c.G3282A						.						188.0	149.0	162.0					21																	34924819		2203	4300	6503	SO:0001819	synonymous_variant	6651	exon3			GATGTCGTCATAC	AF380181	CCDS13629.1, CCDS13631.1, CCDS74784.1	21q22.1-q22.2	2013-01-28			ENSG00000159140	ENSG00000159140		"""G patch domain containing"""	11183	protein-coding gene	gene with protein product	"""NRE-binding protein"", ""negative regulatory element-binding protein"", ""Bax antagonist selected in Saccharomyces 1"""	182465		C21orf50		8318737, 21551269	Standard	NM_032195		Approved	DBP-5, NREBP, KIAA1019, BASS1, FLJ21099, FLJ33914	uc002yse.1	P18583	OTTHUMG00000065806	ENST00000356577.4:c.3282G>A	21.37:g.34924819G>A		Somatic	263	1		WXS	Illumina GAIIx	Phase_I	324	72	NM_032195	0	0	0	0	0	D3DSF5|D3DSF6|E7ETE8|E7EU67|E7EVW3|E9PFQ2|O14487|O95981|Q14120|Q6PKE0|Q9H7B1|Q9P070|Q9P072|Q9UKP9|Q9UPY0	Silent	SNP	ENST00000356577.4	37	CCDS13629.1	.	.	.	.	.	.	.	.	.	.	G	2.036	-0.421225	0.04734	.	.	ENSG00000159140	ENST00000436227	.	.	.	6.06	-8.95	0.00765	.	.	.	.	.	T	0.49440	0.1557	.	.	.	0.54753	D	0.999984	.	.	.	.	.	.	T	0.58025	-0.7709	4	.	.	.	.	9.8284	0.40925	0.6522:0.0:0.1801:0.1677	.	.	.	.	H	89	.	.	R	+	2	0	SON	33846689	0.010000	0.17322	0.276000	0.24689	0.987000	0.75469	-2.240000	0.01197	-1.696000	0.01421	-0.784000	0.03344	CGT	.		0.473	SON-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000140978.2	NM_138927	
KRTAP10-10	353333	ucsc.edu	37	21	46057625	46057625	+	Silent	SNP	T	T	C	rs66931310|rs56249559|rs55677560	byFrequency	TCGA-OR-A5L2-01A-11D-A30A-10	TCGA-OR-A5L2-10A-01D-A30A-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b99bd79e-aa33-4896-8d10-2517c793f439	48e26b1d-b84d-432b-940b-9907c81ddf5b	g.chr21:46057625T>C	ENST00000380095.1	+	1	353	c.291T>C	c.(289-291)ccT>ccC	p.P97P	TSPEAR_ENST00000323084.4_Intron	NM_181688.1	NP_859016.1	P60014	KR10A_HUMAN	keratin associated protein 10-10	97	15 X 5 AA repeats of C-C-X(3).					keratin filament (GO:0045095)				NS(1)|endometrium(2)|kidney(1)|lung(6)|prostate(1)|skin(2)	13						gctgtgtgcctgtctgctgtg	0.622																																					p.P97P		.											.	KRTAP10-10-90	0			c.T291C						.						82.0	79.0	80.0					21																	46057625		2132	4094	6226	SO:0001819	synonymous_variant	353333	exon1			TGTGCCTGTCTGC	AJ566387	CCDS33585.1	21q22.3	2006-03-13			ENSG00000221859	ENSG00000221859		"""Keratin associated proteins"""	22972	protein-coding gene	gene with protein product							Standard	NM_181688		Approved	KAP10.10, KAP18.10, KRTAP18-10	uc002zfq.3	P60014	OTTHUMG00000057631	ENST00000380095.1:c.291T>C	21.37:g.46057625T>C		Somatic	120	0		WXS	Illumina GAIIx	Phase_I	141	13	NM_181688	0	0	0	0	0		Silent	SNP	ENST00000380095.1	37	CCDS33585.1																																																																																			C|1.000;|0.000		0.622	KRTAP10-10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128034.1	NM_181688	
C21orf67	84536	broad.mit.edu;ucsc.edu;bcgsc.ca	37	21	46355733	46355733	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5L2-01A-11D-A30A-10	TCGA-OR-A5L2-10A-01D-A30A-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b99bd79e-aa33-4896-8d10-2517c793f439	48e26b1d-b84d-432b-940b-9907c81ddf5b	g.chr21:46355733G>A	ENST00000397841.1	-	2	393	c.148C>T	c.(148-150)Cat>Tat	p.H50Y	C21orf67_ENST00000380070.4_Missense_Mutation_p.H47Y|C21orf67_ENST00000330551.3_Missense_Mutation_p.H47Y|LL21NC02-1C16.2_ENST00000609953.1_RNA					chromosome 21 open reading frame 67											breast(1)	1						CGGTCCTGATGGGCAGGACGC	0.597																																					.		.											.	.	0			.						.						68.0	68.0	68.0					21																	46355733		692	1591	2283	SO:0001583	missense	84536	.			CCTGATGGGCAGG	AY040088		21q22.3	2013-01-15			ENSG00000183250	ENSG00000183250			15707	other	unknown			"""chromosome 21 open reading frame 69"""	C21orf69		11707072	Standard	NR_027128		Approved		uc011afm.2	P58512	OTTHUMG00000090294	ENST00000397841.1:c.148C>T	21.37:g.46355733G>A	ENSP00000380941:p.His50Tyr	Somatic	51	0		WXS	Illumina GAIIx	Phase_I	64	12	.	0	0	0	0	0		RNA	SNP	ENST00000397841.1	37		.	.	.	.	.	.	.	.	.	.	G	0.495	-0.873509	0.02570	.	.	ENSG00000183250	ENST00000397841;ENST00000330551;ENST00000380070	.	.	.	0.43	-0.565	0.11771	.	.	.	.	.	T	0.34745	0.0908	.	.	.	0.09310	N	1	B;B;B	0.33000	0.001;0.393;0.393	B;B;B	0.39119	0.0;0.291;0.291	T	0.38308	-0.9667	6	0.87932	D	0	.	.	.	.	.	50;47;47	P58512-3;P58512-2;P58512	.;.;CU067_HUMAN	Y	50;47;47	.	ENSP00000331610:H47Y	H	-	1	0	C21orf67	45180161	0.063000	0.20901	0.002000	0.10522	0.002000	0.02628	-0.676000	0.05221	-0.384000	0.07845	-0.379000	0.06801	CAT	.		0.597	C21orf67-002	PUTATIVE	basic|appris_candidate_longest|exp_conf	protein_coding	protein_coding	OTTHUMT00000206644.1	NR_027128	
PRODH	5625	hgsc.bcm.edu	37	22	18923745	18923745	+	Missense_Mutation	SNP	G	G	T	rs2008720	byFrequency	TCGA-OR-A5L2-01A-11D-A30A-10	TCGA-OR-A5L2-10A-01D-A30A-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b99bd79e-aa33-4896-8d10-2517c793f439	48e26b1d-b84d-432b-940b-9907c81ddf5b	g.chr22:18923745G>T	ENST00000357068.6	-	1	321	c.56C>A	c.(55-57)cCg>cAg	p.P19Q	PRODH_ENST00000420436.1_5'UTR|PRODH_ENST00000334029.2_Intron	NM_016335.4	NP_057419	O43272	PROD_HUMAN	proline dehydrogenase (oxidase) 1	19			Q -> P (moderate reduction of enzymatic activity; dbSNP:rs2008720).		4-hydroxyproline catabolic process (GO:0019470)|cellular nitrogen compound metabolic process (GO:0034641)|intrinsic apoptotic signaling pathway in response to oxidative stress (GO:0008631)|proline catabolic process (GO:0006562)|proline catabolic process to glutamate (GO:0010133)|proline metabolic process (GO:0006560)|small molecule metabolic process (GO:0044281)	mitochondrial inner membrane (GO:0005743)	FAD binding (GO:0071949)|proline dehydrogenase activity (GO:0004657)			breast(1)|endometrium(3)|lung(4)|upper_aerodigestive_tract(1)	9					L-Proline(DB00172)	CGTGGACAGCGGGACGAAGCG	0.786													.|||	2771	0.553315	0.3964	0.4899	5008	,	,		6337	0.8423		0.4463	False		,,,				2504	0.6227				p.P19Q		.											.	PRODH-289	0			c.C56A	GRCh37	CM057552	PRODH	M	rs2008720	.						1.0	3.0	2.0					22																	18923745		714	1559	2273	SO:0001583	missense	5625	exon2			GACAGCGGGACGA	AF010310	CCDS13754.1, CCDS56223.1	22q11.2	2014-07-10	2001-12-05		ENSG00000100033	ENSG00000100033	1.5.5.2		9453	protein-coding gene	gene with protein product		606810	"""proline dehydrogenase (proline oxidase )"""			9385373, 10192398	Standard	NM_001195226		Approved	HSPOX2, PRODH1, PIG6, PRODH2, TP53I6	uc002zok.4	O43272	OTTHUMG00000150163	ENST00000357068.6:c.56C>A	22.37:g.18923745G>T	ENSP00000349577:p.Pro19Gln	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	5	5	NM_016335	0	0	0	0	0	A6NF53|O14680|Q0P507|Q147W8|Q504W1|Q59FI8|Q6NV86|Q9UF13	Missense_Mutation	SNP	ENST00000357068.6	37	CCDS13754.1	1178	0.5393772893772893	199	0.40447154471544716	168	0.46408839779005523	473	0.8269230769230769	338	0.44591029023746703	.	10.99	1.507449	0.27036	.	.	ENSG00000100033	ENST00000357068;ENST00000457083	T	0.16897	2.31	2.4	-0.024	0.13941	.	0.382844	0.18568	U	0.137421	T	0.00012	0.0000	.	.	.	0.80722	P	0.0	.	.	.	.	.	.	T	0.05468	-1.0883	6	0.30854	T	0.27	-2.6546	8.2534	0.31739	0.0:0.4816:0.5184:0.0	rs2008720;rs3815656;rs2008720	.	.	.	Q	19;12	ENSP00000349577:P19Q	ENSP00000349577:P19Q	P	-	2	0	PRODH	17303745	0.000000	0.05858	0.001000	0.08648	0.041000	0.13682	-0.431000	0.06965	-0.043000	0.13513	-1.043000	0.02367	CCG	G|0.457;T|0.543		0.786	PRODH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316637.2	NM_016335	
SCARF2	91179	hgsc.bcm.edu	37	22	20780091	20780091	+	Silent	SNP	C	C	G	rs759610		TCGA-OR-A5L2-01A-11D-A30A-10	TCGA-OR-A5L2-10A-01D-A30A-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b99bd79e-aa33-4896-8d10-2517c793f439	48e26b1d-b84d-432b-940b-9907c81ddf5b	g.chr22:20780091C>G	ENST00000266214.5	-	11	2291	c.2187G>C	c.(2185-2187)ccG>ccC	p.P729P	SCARF2_ENST00000405555.3_Silent_p.P724P	NM_153334.4	NP_699165.2	Q96GP6	SREC2_HUMAN	scavenger receptor class F, member 2	729	Pro-rich.				cell adhesion (GO:0007155)	focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)				breast(1)|central_nervous_system(1)|kidney(1)|large_intestine(1)|lung(3)|prostate(1)|skin(2)	10	Melanoma(16;0.000465)|Ovarian(15;0.00167)|Colorectal(54;0.0221)|all_neural(72;0.219)	Lung SC(17;0.0262)	LUSC - Lung squamous cell carcinoma(15;0.00102)|Lung(15;0.0173)			CGGGCAGCCCCGGGGGGCGCG	0.781																																					p.P729P		.											.	SCARF2-341	0			c.G2187C						.	G	,	3110,60		1525,60,0	4.0	5.0	4.0		2187,2172	-6.8	0.1	22	dbSNP_86	4	5974,118		2928,118,0	no	coding-synonymous,coding-synonymous	SCARF2	NM_153334.4,NM_182895.2	,	4453,178,0	GG,GC,CC		1.937,1.8927,1.9218	,	729/871,724/866	20780091	9084,178	1585	3046	4631	SO:0001819	synonymous_variant	91179	exon11			CAGCCCCGGGGGG	AF522196	CCDS13779.1, CCDS46666.1	22q11.21	2011-10-10			ENSG00000244486	ENSG00000244486			19869	protein-coding gene	gene with protein product		613619				12154095	Standard	XM_006724364		Approved	SREC-II, SREC2, HUMZD58C02	uc002zsk.2	Q96GP6	OTTHUMG00000150779	ENST00000266214.5:c.2187G>C	22.37:g.20780091C>G		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	6	6	NM_153334	0	0	0	0	0	E5RFB8|Q58A83|Q8IXF3|Q9BW74	Silent	SNP	ENST00000266214.5	37	CCDS13779.1																																																																																			C|0.138;G|0.862		0.781	SCARF2-001	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000320047.1		
CHEK2	11200	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	22	29121006	29121006	+	Missense_Mutation	SNP	T	T	A			TCGA-OR-A5L2-01A-11D-A30A-10	TCGA-OR-A5L2-10A-01D-A30A-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b99bd79e-aa33-4896-8d10-2517c793f439	48e26b1d-b84d-432b-940b-9907c81ddf5b	g.chr22:29121006T>A	ENST00000405598.1	-	5	742	c.551A>T	c.(550-552)aAt>aTt	p.N184I	CHEK2_ENST00000402731.1_Missense_Mutation_p.N184I|CHEK2_ENST00000382578.1_Intron|CHEK2_ENST00000328354.6_Missense_Mutation_p.N184I|CHEK2_ENST00000382580.2_Missense_Mutation_p.N227I|CHEK2_ENST00000382565.1_Intron|CHEK2_ENST00000382566.1_Missense_Mutation_p.N184I|CHEK2_ENST00000403642.1_Intron|CHEK2_ENST00000348295.3_Missense_Mutation_p.N184I|CHEK2_ENST00000544772.1_5'UTR|CHEK2_ENST00000404276.1_Missense_Mutation_p.N184I			O96017	CHK2_HUMAN	checkpoint kinase 2	184					cellular protein catabolic process (GO:0044257)|cellular response to DNA damage stimulus (GO:0006974)|DNA damage checkpoint (GO:0000077)|DNA damage induced protein phosphorylation (GO:0006975)|double-strand break repair (GO:0006302)|G2/M transition of mitotic cell cycle (GO:0000086)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|positive regulation of transcription, DNA-templated (GO:0045893)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|protein stabilization (GO:0050821)|regulation of protein catabolic process (GO:0042176)|regulation of transcription, DNA-templated (GO:0006355)|replicative senescence (GO:0090399)|response to gamma radiation (GO:0010332)|signal transduction in response to DNA damage (GO:0042770)|signal transduction involved in intra-S DNA damage checkpoint (GO:0072428)|spindle assembly involved in mitosis (GO:0090307)|transcription, DNA-templated (GO:0006351)	nucleoplasm (GO:0005654)|PML body (GO:0016605)	ATP binding (GO:0005524)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|protein kinase binding (GO:0019901)|protein serine/threonine kinase activity (GO:0004674)|ubiquitin protein ligase binding (GO:0031625)			central_nervous_system(17)|endometrium(2)|kidney(11)|large_intestine(2)|lung(11)|ovary(1)|prostate(4)|stomach(2)	50						AGAATTGTTATTCAAAGGACG	0.353			F			breast		Direct reversal of damage;Other conserved DNA damage response genes																													p.N227I		.	yes	Rec		familial breast cancer	22	22q12.1	11200	CHK2 checkpoint homolog (S. pombe)		E	.	CHEK2-1515	0			c.A680T						.						86.0	84.0	85.0					22																	29121006		2203	4299	6502	SO:0001583	missense	11200	exon5			TTGTTATTCAAAG	AF086904	CCDS13843.1, CCDS13844.1, CCDS33629.1	22q12.1	2014-09-17	2011-11-11	2001-09-27	ENSG00000183765	ENSG00000183765			16627	protein-coding gene	gene with protein product		604373	"""CHK2 (checkpoint, S.pombe) homolog"", ""CHK2 checkpoint homolog (S. pombe)"""	RAD53		9836640, 10097108	Standard	NM_001257387		Approved	CDS1, CHK2, HuCds1, PP1425, bA444G7	uc003adt.1	O96017	OTTHUMG00000151023	ENST00000405598.1:c.551A>T	22.37:g.29121006T>A	ENSP00000386087:p.Asn184Ile	Somatic	167	0		WXS	Illumina GAIIx	Phase_I	222	15	NM_001005735	0	0	0	0	0	A8K3Y9|B7ZBF3|B7ZBF4|B7ZBF5|Q6QA03|Q6QA04|Q6QA05|Q6QA06|Q6QA07|Q6QA08|Q6QA10|Q6QA11|Q6QA12|Q6QA13|Q9HBS5|Q9HCQ8|Q9UGF0|Q9UGF1	Missense_Mutation	SNP	ENST00000405598.1	37	CCDS13843.1	.	.	.	.	.	.	.	.	.	.	T	14.53	2.563427	0.45694	.	.	ENSG00000183765	ENST00000348295;ENST00000382566;ENST00000328354;ENST00000404276;ENST00000405598;ENST00000382580;ENST00000402731;ENST00000439200	D;D;D;D;D;D;D;D	0.86769	-2.17;-2.17;-2.17;-2.17;-2.17;-2.17;-2.17;-2.17	5.87	-0.532	0.11890	Forkhead-associated (FHA) domain (2);SMAD/FHA domain (1);	0.549225	0.22047	N	0.065378	T	0.81384	0.4811	L	0.45470	1.425	0.22903	N	0.998589	B;P;P;B;B	0.37423	0.074;0.594;0.478;0.091;0.402	B;B;B;B;B	0.40038	0.317;0.124;0.05;0.158;0.196	T	0.71873	-0.4461	10	0.44086	T	0.13	-19.4855	8.771	0.34733	0.0:0.5612:0.2309:0.2079	.	184;184;184;184;227	O96017-7;A8JZZ5;O96017-12;O96017;O96017-9	.;.;.;CHK2_HUMAN;.	I	184;184;184;184;184;227;184;215	ENSP00000329012:N184I;ENSP00000372007:N184I;ENSP00000329178:N184I;ENSP00000385747:N184I;ENSP00000386087:N184I;ENSP00000372023:N227I;ENSP00000384835:N184I;ENSP00000408065:N215I	ENSP00000329178:N184I	N	-	2	0	CHEK2	27451006	0.333000	0.24731	0.996000	0.52242	0.306000	0.27790	-0.532000	0.06164	-0.045000	0.13468	0.477000	0.44152	AAT	.		0.353	CHEK2-005	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000321150.1	NM_001005735	
C22orf31	25770	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	22	29454817	29454817	+	Missense_Mutation	SNP	C	C	G			TCGA-OR-A5L2-01A-11D-A30A-10	TCGA-OR-A5L2-10A-01D-A30A-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b99bd79e-aa33-4896-8d10-2517c793f439	48e26b1d-b84d-432b-940b-9907c81ddf5b	g.chr22:29454817C>G	ENST00000216071.4	-	3	837	c.786G>C	c.(784-786)caG>caC	p.Q262H		NM_015370.1	NP_056185.1	O95567	CV031_HUMAN	chromosome 22 open reading frame 31	262										cervix(1)|endometrium(1)|kidney(17)|large_intestine(2)|lung(4)|prostate(1)|skin(1)	27						ACCGGTCCCTCTGAGCACCTT	0.542																																					p.Q262H		.											.	C22orf31-90	0			c.G786C						.						100.0	92.0	95.0					22																	29454817		2203	4300	6503	SO:0001583	missense	25770	exon3			GTCCCTCTGAGCA	AL035364	CCDS13848.1	22q12.1	2006-07-05			ENSG00000100249	ENSG00000100249			26931	protein-coding gene	gene with protein product						15461802	Standard	XM_005261490		Approved	HS747E2A, bK747E2.1	uc003aej.1	O95567	OTTHUMG00000151011	ENST00000216071.4:c.786G>C	22.37:g.29454817C>G	ENSP00000216071:p.Gln262His	Somatic	87	0		WXS	Illumina GAIIx	Phase_I	112	17	NM_015370	0	0	0	0	0	A0AV97	Missense_Mutation	SNP	ENST00000216071.4	37	CCDS13848.1	.	.	.	.	.	.	.	.	.	.	C	15.02	2.708799	0.48517	.	.	ENSG00000100249	ENST00000216071	T	0.35605	1.3	5.65	1.14	0.20703	.	0.461817	0.18895	N	0.128208	T	0.21186	0.0510	L	0.27053	0.805	0.09310	N	1	B	0.21452	0.056	B	0.17433	0.018	T	0.16129	-1.0413	10	0.66056	D	0.02	-1.98	4.5134	0.11923	0.0:0.5671:0.1604:0.2725	.	262	O95567	CV031_HUMAN	H	262	ENSP00000216071:Q262H	ENSP00000216071:Q262H	Q	-	3	2	C22orf31	27784817	0.000000	0.05858	0.000000	0.03702	0.030000	0.12068	0.150000	0.16263	0.142000	0.18901	0.655000	0.94253	CAG	.		0.542	C22orf31-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320952.1	NM_015370	
CSF2RB	1439	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	22	37333549	37333549	+	Missense_Mutation	SNP	C	C	G			TCGA-OR-A5L2-01A-11D-A30A-10	TCGA-OR-A5L2-10A-01D-A30A-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b99bd79e-aa33-4896-8d10-2517c793f439	48e26b1d-b84d-432b-940b-9907c81ddf5b	g.chr22:37333549C>G	ENST00000403662.3	+	14	1921	c.1699C>G	c.(1699-1701)Ccc>Gcc	p.P567A	CSF2RB_ENST00000262825.5_Missense_Mutation_p.P573A|CSF2RB_ENST00000406230.1_Missense_Mutation_p.P573A|CSF2RB_ENST00000536485.1_Missense_Mutation_p.P514A			P32927	IL3RB_HUMAN	colony stimulating factor 2 receptor, beta, low-affinity (granulocyte-macrophage)	567					cellular response to interleukin-3 (GO:0036016)|interleukin-3-mediated signaling pathway (GO:0038156)|interleukin-5-mediated signaling pathway (GO:0038043)|respiratory gaseous exchange (GO:0007585)|response to lipopolysaccharide (GO:0032496)|signal transduction (GO:0007165)	granulocyte macrophage colony-stimulating factor receptor complex (GO:0030526)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	cytokine receptor activity (GO:0004896)|receptor activity (GO:0004872)			breast(2)|endometrium(2)|kidney(1)|large_intestine(8)|lung(18)|ovary(3)|pancreas(1)|skin(5)|upper_aerodigestive_tract(2)	42					Sargramostim(DB00020)	AGAGCAGCCCCCCAGCCCCCA	0.642																																					p.P567A		.											.	CSF2RB-93	0			c.C1699G						.						27.0	29.0	28.0					22																	37333549		2203	4300	6503	SO:0001583	missense	1439	exon14			CAGCCCCCCAGCC	M59941	CCDS13936.1	22q12.3	2014-09-09			ENSG00000100368	ENSG00000100368		"""CD molecules"", ""Fibronectin type III domain containing"""	2436	protein-coding gene	gene with protein product		138981		IL3RB		1833064, 1424804	Standard	NM_000395		Approved	IL5RB, CD131	uc003aqa.4	P32927	OTTHUMG00000150546	ENST00000403662.3:c.1699C>G	22.37:g.37333549C>G	ENSP00000384053:p.Pro567Ala	Somatic	47	0		WXS	Illumina GAIIx	Phase_I	65	7	NM_000395	0	0	0	0	0	Q5JZI1|Q6ICE0	Missense_Mutation	SNP	ENST00000403662.3	37	CCDS13936.1	.	.	.	.	.	.	.	.	.	.	C	6.141	0.394186	0.11638	.	.	ENSG00000100368	ENST00000403662;ENST00000539104;ENST00000262825;ENST00000406230;ENST00000536485	D;D;D;D	0.91792	-2.4;-2.91;-2.91;-2.91	5.36	-8.53	0.00916	.	3.248190	0.00903	N	0.002373	D	0.83390	0.5244	L	0.60455	1.87	0.09310	N	1	B;P	0.35612	0.005;0.512	B;B	0.32677	0.012;0.15	T	0.75190	-0.3405	10	0.06365	T	0.9	-1.4315	0.6175	0.00772	0.1963:0.2523:0.1942:0.3572	.	573;567	P32927-2;P32927	.;IL3RB_HUMAN	A	567;567;573;573;514	ENSP00000384053:P567A;ENSP00000262825:P573A;ENSP00000385271:P573A;ENSP00000440003:P514A	ENSP00000262825:P573A	P	+	1	0	CSF2RB	35663495	0.000000	0.05858	0.000000	0.03702	0.248000	0.25809	-1.768000	0.01794	-0.950000	0.03659	-0.259000	0.10710	CCC	.		0.642	CSF2RB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318854.1	NM_000395	
CACNA1I	8911	broad.mit.edu	37	22	40066230	40066230	+	Missense_Mutation	SNP	G	G	A	rs373284314		TCGA-OR-A5L2-01A-11D-A30A-10	TCGA-OR-A5L2-10A-01D-A30A-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b99bd79e-aa33-4896-8d10-2517c793f439	48e26b1d-b84d-432b-940b-9907c81ddf5b	g.chr22:40066230G>A	ENST00000402142.3	+	25	4382	c.4382G>A	c.(4381-4383)cGc>cAc	p.R1461H	CACNA1I_ENST00000407673.1_Missense_Mutation_p.R1426H|CACNA1I_ENST00000401624.1_Missense_Mutation_p.R1461H|CACNA1I_ENST00000400164.3_Missense_Mutation_p.R1426H|CACNA1I_ENST00000404898.1_Missense_Mutation_p.R1426H|CACNA1I_ENST00000336649.4_Missense_Mutation_p.R1467H	NM_021096.3	NP_066919.2	Q9P0X4	CAC1I_HUMAN	calcium channel, voltage-dependent, T type, alpha 1I subunit	1461					axon guidance (GO:0007411)|calcium ion import (GO:0070509)|membrane depolarization during action potential (GO:0086010)|neuronal action potential (GO:0019228)|signal transduction (GO:0007165)|sleep (GO:0030431)|transport (GO:0006810)	plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	voltage-gated calcium channel activity (GO:0005245)			breast(2)|central_nervous_system(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|liver(2)|lung(27)|ovary(1)|pancreas(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	60	Melanoma(58;0.0749)				Cinnarizine(DB00568)|Flunarizine(DB04841)|Paramethadione(DB00617)|Spironolactone(DB00421)|Verapamil(DB00661)|Zonisamide(DB00909)	GAGAAGAAGCGCCGGAGTGAG	0.672																																					p.R1461H		.											.	CACNA1I-135	0			c.G4382A						.	G	HIS/ARG,HIS/ARG	0,4130		0,0,2065	46.0	49.0	48.0		4277,4382	4.0	1.0	22		48	1,8373		0,1,4186	no	missense,missense	CACNA1I	NM_001003406.1,NM_021096.3	29,29	0,1,6251	AA,AG,GG		0.0119,0.0,0.0080	probably-damaging,probably-damaging	1426/2189,1461/2224	40066230	1,12503	2065	4187	6252	SO:0001583	missense	8911	exon25			AGAAGCGCCGGAG	AF129133	CCDS46710.1, CCDS46711.1	22q13.1	2012-03-07	2007-02-16		ENSG00000100346	ENSG00000100346		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1396	protein-coding gene	gene with protein product		608230				10454147, 16382099	Standard	NM_021096		Approved	Cav3.3	uc003ayd.3	Q9P0X4	OTTHUMG00000151096	ENST00000402142.3:c.4382G>A	22.37:g.40066230G>A	ENSP00000385019:p.Arg1461His	Somatic	49	1		WXS	Illumina GAIIx	Phase_I	66	15	NM_021096	0	0	0	0	0	B0QY12|B0QY13|B0QY14|O95504|Q5JZ88|Q7Z6S9|Q8NFX6|Q9NZC8|Q9UH15|Q9UH30|Q9ULU9|Q9UNE6	Missense_Mutation	SNP	ENST00000402142.3	37	CCDS46710.1	.	.	.	.	.	.	.	.	.	.	G	28.2	4.899094	0.91962	0.0	1.19E-4	ENSG00000100346	ENST00000402142;ENST00000404898;ENST00000401624;ENST00000407673;ENST00000336649;ENST00000400164	D;D;D;D;D;D	0.97352	-4.33;-4.29;-4.31;-4.27;-4.35;-4.26	3.95	3.95	0.45737	.	0.072042	0.50627	D	0.000117	D	0.98365	0.9457	M	0.82323	2.585	0.58432	D	0.999998	D;D;D;D	0.89917	0.999;0.999;1.0;1.0	D;P;D;D	0.85130	0.994;0.866;0.997;0.992	D	0.99478	1.0947	10	0.66056	D	0.02	.	16.3466	0.83134	0.0:0.0:1.0:0.0	.	1426;1461;1426;1461	Q9P0X4-3;Q9P0X4-2;Q9P0X4-4;Q9P0X4	.;.;.;CAC1I_HUMAN	H	1461;1426;1461;1426;1467;1426	ENSP00000385019:R1461H;ENSP00000384093:R1426H;ENSP00000383887:R1461H;ENSP00000385680:R1426H;ENSP00000337829:R1467H;ENSP00000383028:R1426H	ENSP00000337829:R1467H	R	+	2	0	CACNA1I	38396176	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	9.673000	0.98631	1.910000	0.55303	0.555000	0.69702	CGC	.		0.672	CACNA1I-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000321290.1	NM_001003406	
ENTHD1	150350	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	22	40140106	40140106	+	Silent	SNP	G	G	A			TCGA-OR-A5L2-01A-11D-A30A-10	TCGA-OR-A5L2-10A-01D-A30A-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b99bd79e-aa33-4896-8d10-2517c793f439	48e26b1d-b84d-432b-940b-9907c81ddf5b	g.chr22:40140106G>A	ENST00000325157.6	-	7	1652	c.1402C>T	c.(1402-1404)Ctg>Ttg	p.L468L		NM_152512.3	NP_689725.2	Q8IYW4	ENTD1_HUMAN	ENTH domain containing 1	468										breast(2)|endometrium(1)|kidney(6)|large_intestine(6)|lung(11)|ovary(3)|skin(3)	32	Melanoma(58;0.0749)					GAGTGATGCAGCTTGGCTGTC	0.448																																					p.L468L		.											.	ENTHD1-93	0			c.C1402T						.						74.0	76.0	75.0					22																	40140106		2203	4300	6503	SO:0001819	synonymous_variant	150350	exon7			GATGCAGCTTGGC	AK093154	CCDS13998.1	22q13.1	2006-06-26			ENSG00000176177	ENSG00000176177			26352	protein-coding gene	gene with protein product						12477932	Standard	NM_152512		Approved	FLJ25421	uc003ayg.3	Q8IYW4	OTTHUMG00000151098	ENST00000325157.6:c.1402C>T	22.37:g.40140106G>A		Somatic	129	0		WXS	Illumina GAIIx	Phase_I	155	25	NM_152512	0	0	0	0	0	B0QYD5|Q5H9F7|Q96LK3	Silent	SNP	ENST00000325157.6	37	CCDS13998.1																																																																																			.		0.448	ENTHD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321302.1	NM_152512	
RRP7A	27341	bcgsc.ca	37	22	42912029	42912029	+	Silent	SNP	G	G	T	rs3201001	byFrequency	TCGA-OR-A5L2-01A-11D-A30A-10	TCGA-OR-A5L2-10A-01D-A30A-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b99bd79e-aa33-4896-8d10-2517c793f439	48e26b1d-b84d-432b-940b-9907c81ddf5b	g.chr22:42912029G>T	ENST00000323013.6	-	3	345	c.330C>A	c.(328-330)ccC>ccA	p.P110P		NM_015703.4	NP_056518.2	Q9Y3A4	RRP7A_HUMAN	ribosomal RNA processing 7 homolog A (S. cerevisiae)	110							nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			central_nervous_system(1)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|liver(2)|lung(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	10						GAACTGGCTTGGGATGAAAAA	0.617													G|||	1175	0.234625	0.3896	0.1239	5008	,	,		19193	0.1468		0.1978	False		,,,				2504	0.2321				p.P110P		.											.	RRP7A-91	0			c.C330A						.	G		1568,2838	482.8+/-359.5	275,1018,910	62.0	51.0	55.0		330	0.6	0.0	22	dbSNP_105	55	1832,6768	324.6+/-316.5	173,1486,2641	no	coding-synonymous	RRP7A	NM_015703.4		448,2504,3551	TT,TG,GG		21.3023,35.5878,26.1418		110/281	42912029	3400,9606	2203	4300	6503	SO:0001819	synonymous_variant	27341	exon3			TGGCTTGGGATGA	BC035992	CCDS14036.1	22q13.2	2008-08-08			ENSG00000189306	ENSG00000189306			24286	protein-coding gene	gene with protein product						10810093, 12087473	Standard	NM_015703		Approved	CGI-96	uc003bcq.3	Q9Y3A4	OTTHUMG00000150891	ENST00000323013.6:c.330C>A	22.37:g.42912029G>T		Somatic	122	1		WXS	Illumina GAIIx	Phase_I	172	8	NM_015703	0	0	0	0	0	A4FTX2|B2RBG4|Q0VAD0|Q5JZ94|Q6P4B5|Q8IVR9|Q8IVY0|Q8N5Q3|Q8NEY6|Q9Y3H5	Silent	SNP	ENST00000323013.6	37	CCDS14036.1																																																																																			G|0.748;T|0.252		0.617	RRP7A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320451.1	NM_015703	
ARPP21	10777	broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	35730810	35730810	+	Nonsense_Mutation	SNP	G	G	T			TCGA-OR-A5L2-01A-11D-A30A-10	TCGA-OR-A5L2-10A-01D-A30A-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b99bd79e-aa33-4896-8d10-2517c793f439	48e26b1d-b84d-432b-940b-9907c81ddf5b	g.chr3:35730810G>T	ENST00000187397.4	+	7	874	c.418G>T	c.(418-420)Gaa>Taa	p.E140*	ARPP21_ENST00000444190.1_Nonsense_Mutation_p.E140*|ARPP21_ENST00000337271.5_Nonsense_Mutation_p.E140*|ARPP21_ENST00000417925.1_Nonsense_Mutation_p.E140*|ARPP21_ENST00000458225.1_Nonsense_Mutation_p.E140*	NM_016300.4	NP_057384.2	Q9UBL0	ARP21_HUMAN	cAMP-regulated phosphoprotein, 21kDa	140					cellular response to heat (GO:0034605)	cytoplasm (GO:0005737)	nucleic acid binding (GO:0003676)			cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(12)|lung(31)|ovary(3)|prostate(4)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	61						TTGCAGCCAAGAATACACGGA	0.403																																					p.E140X		.											.	ARPP21-93	0			c.G418T						.						83.0	81.0	82.0					3																	35730810		2203	4300	6503	SO:0001587	stop_gained	10777	exon6			AGCCAAGAATACA	AA733082	CCDS2661.1, CCDS43063.1, CCDS58823.1, CCDS58824.1	3p24.3	2010-08-12			ENSG00000172995	ENSG00000172995			16968	protein-coding gene	gene with protein product	"""R3H domain containing 3"""	605488				8120638	Standard	NM_198399		Approved	ARPP-21, TARPP, R3HDM3	uc011axy.2	Q9UBL0	OTTHUMG00000130795	ENST00000187397.4:c.418G>T	3.37:g.35730810G>T	ENSP00000187397:p.Glu140*	Somatic	236	2		WXS	Illumina GAIIx	Phase_I	276	83	NM_001267619	0	0	0	0	0	B4DG96|Q49AK3|Q49AS6|Q4G0V4|Q6NYC3|Q86V31|Q9UF93	Nonsense_Mutation	SNP	ENST00000187397.4	37	CCDS2661.1	.	.	.	.	.	.	.	.	.	.	G	41	9.033955	0.99042	.	.	ENSG00000172995	ENST00000458225;ENST00000337271;ENST00000444190;ENST00000187397;ENST00000417925	.	.	.	5.86	5.86	0.93980	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.72032	D	0.01	-14.6575	20.5632	0.99335	0.0:0.0:1.0:0.0	.	.	.	.	X	140	.	ENSP00000187397:E140X	E	+	1	0	ARPP21	35705814	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.813000	0.99286	2.937000	0.99478	0.650000	0.86243	GAA	.		0.403	ARPP21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253334.2	NM_198399	
MLH1	4292	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	3	37055929	37055929	+	Silent	SNP	G	G	C			TCGA-OR-A5L2-01A-11D-A30A-10	TCGA-OR-A5L2-10A-01D-A30A-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b99bd79e-aa33-4896-8d10-2517c793f439	48e26b1d-b84d-432b-940b-9907c81ddf5b	g.chr3:37055929G>C	ENST00000231790.2	+	9	900	c.684G>C	c.(682-684)ctG>ctC	p.L228L	MLH1_ENST00000536378.1_5'UTR|MLH1_ENST00000539477.1_5'UTR|MLH1_ENST00000458205.2_5'UTR|MLH1_ENST00000455445.2_5'UTR|MLH1_ENST00000435176.1_Silent_p.L130L	NM_000249.3|NM_001258273.1	NP_000240.1|NP_001245202.1	P40692	MLH1_HUMAN	mutL homolog 1	228			Missing (in HNPCC2).		ATP catabolic process (GO:0006200)|double-strand break repair via nonhomologous end joining (GO:0006303)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|isotype switching (GO:0045190)|male meiosis chromosome segregation (GO:0007060)|meiotic metaphase I plate congression (GO:0043060)|mismatch repair (GO:0006298)|negative regulation of mitotic recombination (GO:0045950)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|oogenesis (GO:0048477)|resolution of meiotic recombination intermediates (GO:0000712)|somatic hypermutation of immunoglobulin genes (GO:0016446)|spermatogenesis (GO:0007283)|spindle midzone assembly involved in meiosis (GO:0051257)|synapsis (GO:0007129)	chiasma (GO:0005712)|male germ cell nucleus (GO:0001673)|membrane (GO:0016020)|MutLalpha complex (GO:0032389)|nucleus (GO:0005634)|synaptonemal complex (GO:0000795)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|guanine/thymine mispair binding (GO:0032137)	p.0?(1)		NS(1)|breast(4)|central_nervous_system(3)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(12)|kidney(2)|large_intestine(54)|lung(13)|oesophagus(7)|ovary(6)|pancreas(5)|prostate(5)|skin(2)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	127						ATAGAGAACTGATAGAAATTG	0.328		1	"""D, Mis, N, F, S"""		"""colorectal, endometrial, ovarian, CNS"""	"""colorectal, endometrial, ovarian, CNS"""		Mismatch excision repair (MMR)	Turcot syndrome;Muir-Torre syndrome;Lynch syndrome;Constitutional Mismatch Repair Deficiency Syndrome																												p.L228L		.	yes	Rec	yes	"""Hereditary non-polyposis colorectal cancer, Turcot syndrome"""	3	3p21.3	4292	E.coli MutL homolog gene		"""E, O"""	.	MLH1-2559	1	Whole gene deletion(1)	ovary(1)	c.G684C						.						51.0	51.0	51.0					3																	37055929		2203	4300	6503	SO:0001819	synonymous_variant	4292	exon9	Familial Cancer Database	Brain tumor-colorectal polyp(osis) syndrome; ;Hereditary Non-Polyposis Colorectal Cancer, HNPCC, Lynch syndromes 1 and 2 (= Cancer Family Syndrome), Hereditary Mismatch Repair Deficiency syndrome, HMRDS;Mismatch Repair Cancer syndrome, MMRCS, Childhood Cancer Syndrome, CCS, Biallelic Mismatch Repair Gene Mutations Associated Early Onset Cancer, Lynch syndrome type III	AGAACTGATAGAA	U07418	CCDS2663.1, CCDS54562.1, CCDS54563.1	3p22.3	2014-09-17	2013-09-12		ENSG00000076242	ENSG00000076242			7127	protein-coding gene	gene with protein product		120436	"""mutL (E. coli) homolog 1 (colon cancer, nonpolyposis type 2)"", ""mutL homolog 1, colon cancer, nonpolyposis type 2 (E. coli)"""	COCA2		7903889	Standard	NM_000249		Approved	HNPCC, FCC2, HNPCC2	uc003cgl.3	P40692	OTTHUMG00000130797	ENST00000231790.2:c.684G>C	3.37:g.37055929G>C		Somatic	124	0		WXS	Illumina GAIIx	Phase_I	115	9	NM_000249	0	0	0	0	0	B4DI13|B4DQ11|E9PCU2	Silent	SNP	ENST00000231790.2	37	CCDS2663.1	.	.	.	.	.	.	.	.	.	.	G	8.572	0.880173	0.17467	.	.	ENSG00000076242	ENST00000456676	.	.	.	5.7	3.46	0.39613	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-0.4834	7.2062	0.25909	0.1789:0.2314:0.5898:0.0	.	.	.	.	S	220	.	.	X	+	2	2	MLH1	37030933	1.000000	0.71417	0.999000	0.59377	0.995000	0.86356	1.723000	0.38053	0.646000	0.30693	0.655000	0.94253	TGA	.		0.328	MLH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253337.2	NM_000249	
MAGI1	9223	broad.mit.edu	37	3	65372850	65372851	+	Frame_Shift_Del	DEL	TC	TC	-	rs139764373		TCGA-OR-A5L2-01A-11D-A30A-10	TCGA-OR-A5L2-10A-01D-A30A-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b99bd79e-aa33-4896-8d10-2517c793f439	48e26b1d-b84d-432b-940b-9907c81ddf5b	g.chr3:65372850_65372851delTC	ENST00000330909.8	-	15	2466_2467	c.2467_2468delGA	c.(2467-2469)gaafs	p.E823fs	MAGI1_ENST00000497477.2_Intron|MAGI1_ENST00000483466.1_Frame_Shift_Del_p.E823fs|MAGI1_ENST00000402939.2_Intron	NM_015520.1	NP_056335.1	Q96QZ7	MAGI1_HUMAN	membrane associated guanylate kinase, WW and PDZ domain containing 1	823	PDZ 4. {ECO:0000255|PROSITE- ProRule:PRU00143}.				cell adhesion (GO:0007155)|cell surface receptor signaling pathway (GO:0007166)|neuron death (GO:0070997)|protein complex assembly (GO:0006461)	cell junction (GO:0030054)|cell projection (GO:0042995)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|tight junction (GO:0005923)	alpha-actinin binding (GO:0051393)|ATP binding (GO:0005524)|protein C-terminus binding (GO:0008022)			breast(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|liver(1)|lung(21)|pancreas(1)|skin(5)	51		Lung NSC(201;0.0016)		BRCA - Breast invasive adenocarcinoma(55;0.00138)|KIRC - Kidney renal clear cell carcinoma(15;0.0988)|Kidney(15;0.133)		GGAATTGATTTCTCTCTCTCTC	0.401																																					p.823_823del		.											.	MAGI1-661	0			c.2467_2468del						.																																			SO:0001589	frameshift_variant	9223	exon15			TTGATTTCTCTCT	AB010894	CCDS33780.1, CCDS33781.1, CCDS2904.1	3p14.1	2009-10-06	2005-05-10	2005-05-10	ENSG00000151276	ENSG00000151276			946	protein-coding gene	gene with protein product		602625	"""BAI1-associated protein 1"""	BAIAP1		9647739, 9225980	Standard	XM_005265563		Approved	BAP1, MAGI-1, TNRC19, AIP3, WWP3	uc003dmn.3	Q96QZ7	OTTHUMG00000157554	ENST00000330909.8:c.2467_2468delGA	3.37:g.65372860_65372861delTC	ENSP00000331157:p.Glu823fs	Somatic	99	0		WXS	Illumina GAIIx	Phase_I	149	12	NM_015520	0	0	0	0	0	A8K188|O00309|O43863|O75085|Q96QZ8|Q96QZ9	Frame_Shift_Del	DEL	ENST00000330909.8	37	CCDS33781.1																																																																																			.		0.401	MAGI1-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000349127.2	NM_004742	
LRIG1	26018	hgsc.bcm.edu	37	3	66550756	66550756	+	Missense_Mutation	SNP	G	G	C	rs1403625	byFrequency	TCGA-OR-A5L2-01A-11D-A30A-10	TCGA-OR-A5L2-10A-01D-A30A-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b99bd79e-aa33-4896-8d10-2517c793f439	48e26b1d-b84d-432b-940b-9907c81ddf5b	g.chr3:66550756G>C	ENST00000273261.3	-	1	600	c.76C>G	c.(76-78)Ctt>Gtt	p.L26V	LRIG1_ENST00000383703.3_Missense_Mutation_p.L26V	NM_015541.2	NP_056356.2	Q96JA1	LRIG1_HUMAN	leucine-rich repeats and immunoglobulin-like domains 1	26				LLL -> VLV (in Ref. 1; AAK62357 and 3; AAH71561). {ECO:0000305}.	innervation (GO:0060384)|otolith morphogenesis (GO:0032474)|sensory perception of sound (GO:0007605)	integral component of membrane (GO:0016021)				NS(2)|breast(2)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(7)|lung(12)|ovary(3)|prostate(1)|skin(4)|stomach(4)|urinary_tract(1)	42		Lung NSC(201;0.0101)		BRCA - Breast invasive adenocarcinoma(55;0.00047)		TCCAGCCGAAGCAAAAGCAGC	0.761													g|||	3605	0.719848	0.1808	0.8833	5008	,	,		8093	0.8284		0.9732	False		,,,				2504	0.9601				p.L26V		.											.	LRIG1-230	0			c.C76G						.		VAL/LEU	1298,1386		255,788,299	3.0	4.0	4.0		76	2.9	0.5	3	dbSNP_88	4	5191,89		2555,81,4	yes	missense	LRIG1	NM_015541.2	32	2810,869,303	CC,CG,GG		1.6856,48.3607,18.5208	benign	26/1094	66550756	6489,1475	1342	2640	3982	SO:0001583	missense	26018	exon1			GCCGAAGCAAAAG	AB050468	CCDS33783.1	3p14	2013-01-14			ENSG00000144749	ENSG00000144749		"""Immunoglobulin superfamily / I-set domain containing"""	17360	protein-coding gene	gene with protein product	"""ortholog of mouse integral membrane glycoprotein LIG-1"", ""leucine-rich repeat protein LRIG1"""	608868				11414704, 12234026	Standard	NM_015541		Approved	LIG-1, DKFZP586O1624, LIG1	uc003dmx.3	Q96JA1	OTTHUMG00000158727	ENST00000273261.3:c.76C>G	3.37:g.66550756G>C	ENSP00000273261:p.Leu26Val	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	5	5	NM_015541	0	0	0	0	0	Q6IQ51|Q96CF9|Q9BYB8|Q9UFI4	Missense_Mutation	SNP	ENST00000273261.3	37	CCDS33783.1	1666	0.7628205128205128	118	0.23983739837398374	325	0.8977900552486188	489	0.8548951048951049	734	0.9683377308707124	g	6.572	0.473779	0.12521	0.483607	0.983144	ENSG00000144749	ENST00000273261;ENST00000383703	T;T	0.67345	-0.26;-0.13	3.84	2.93	0.34026	.	0.847359	0.09512	U	0.792175	T	0.00012	0.0000	N	0.19112	0.55	0.80722	P	0.0	P;P	0.44139	0.827;0.484	B;B	0.37731	0.257;0.096	T	0.48854	-0.8998	9	0.23302	T	0.38	.	8.6883	0.34251	0.1185:0.0:0.8815:0.0	rs1403625;rs13083628	26;26	Q96JA1-2;Q96JA1	.;LRIG1_HUMAN	V	26	ENSP00000273261:L26V;ENSP00000373208:L26V	ENSP00000273261:L26V	L	-	1	0	LRIG1	66633446	.	.	0.520000	0.27837	0.020000	0.10135	.	.	1.845000	0.53610	0.472000	0.43445	CTT	G|0.237;C|0.763		0.761	LRIG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351930.1	NM_015541	
LRIG1	26018	hgsc.bcm.edu	37	3	66550762	66550762	+	Missense_Mutation	SNP	G	G	C	rs1403626	byFrequency	TCGA-OR-A5L2-01A-11D-A30A-10	TCGA-OR-A5L2-10A-01D-A30A-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b99bd79e-aa33-4896-8d10-2517c793f439	48e26b1d-b84d-432b-940b-9907c81ddf5b	g.chr3:66550762G>C	ENST00000273261.3	-	1	594	c.70C>G	c.(70-72)Ctt>Gtt	p.L24V	LRIG1_ENST00000383703.3_Missense_Mutation_p.L24V	NM_015541.2	NP_056356.2	Q96JA1	LRIG1_HUMAN	leucine-rich repeats and immunoglobulin-like domains 1	24			L -> V (in dbSNP:rs1403626).	LLL -> VLV (in Ref. 1; AAK62357 and 3; AAH71561). {ECO:0000305}.	innervation (GO:0060384)|otolith morphogenesis (GO:0032474)|sensory perception of sound (GO:0007605)	integral component of membrane (GO:0016021)				NS(2)|breast(2)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(7)|lung(12)|ovary(3)|prostate(1)|skin(4)|stomach(4)|urinary_tract(1)	42		Lung NSC(201;0.0101)		BRCA - Breast invasive adenocarcinoma(55;0.00047)		CGAAGCAAAAGCAGCCAGAGA	0.766													g|||	3605	0.719848	0.1808	0.8833	5008	,	,		8368	0.8284		0.9732	False		,,,				2504	0.9601				p.L24V		.											.	LRIG1-230	0			c.C70G						.		VAL/LEU	1309,1447		265,779,334	3.0	4.0	4.0		70	3.1	0.5	3	dbSNP_88	4	5325,93		2620,85,4	no	missense	LRIG1	NM_015541.2	32	2885,864,338	CC,CG,GG		1.7165,47.4964,18.8402	benign	24/1094	66550762	6634,1540	1378	2709	4087	SO:0001583	missense	26018	exon1			GCAAAAGCAGCCA	AB050468	CCDS33783.1	3p14	2013-01-14			ENSG00000144749	ENSG00000144749		"""Immunoglobulin superfamily / I-set domain containing"""	17360	protein-coding gene	gene with protein product	"""ortholog of mouse integral membrane glycoprotein LIG-1"", ""leucine-rich repeat protein LRIG1"""	608868				11414704, 12234026	Standard	NM_015541		Approved	LIG-1, DKFZP586O1624, LIG1	uc003dmx.3	Q96JA1	OTTHUMG00000158727	ENST00000273261.3:c.70C>G	3.37:g.66550762G>C	ENSP00000273261:p.Leu24Val	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	5	5	NM_015541	0	0	0	0	0	Q6IQ51|Q96CF9|Q9BYB8|Q9UFI4	Missense_Mutation	SNP	ENST00000273261.3	37	CCDS33783.1	1670	0.7646520146520146	119	0.241869918699187	326	0.9005524861878453	488	0.8531468531468531	737	0.9722955145118733	g	9.592	1.126319	0.20959	0.474964	0.982835	ENSG00000144749	ENST00000273261;ENST00000383703	T;T	0.68765	-0.35;-0.2	3.11	3.11	0.35812	.	0.429988	0.15146	U	0.278020	T	0.00012	0.0000	N	0.19112	0.55	0.39998	P	0.024872000000000005	P;B	0.36282	0.546;0.282	B;B	0.32465	0.146;0.069	T	0.40572	-0.9556	9	0.23891	T	0.37	.	12.0321	0.53403	0.0:0.0:1.0:0.0	rs1403626;rs13083630;rs1403626	24;24	Q96JA1-2;Q96JA1	.;LRIG1_HUMAN	V	24	ENSP00000273261:L24V;ENSP00000373208:L24V	ENSP00000273261:L24V	L	-	1	0	LRIG1	66633452	.	.	0.546000	0.28166	0.017000	0.09413	.	.	1.734000	0.51633	0.472000	0.43445	CTT	G|0.252;C|0.748		0.766	LRIG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351930.1	NM_015541	
CCDC14	64770	broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	123650270	123650270	+	Silent	SNP	C	C	T			TCGA-OR-A5L2-01A-11D-A30A-10	TCGA-OR-A5L2-10A-01D-A30A-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b99bd79e-aa33-4896-8d10-2517c793f439	48e26b1d-b84d-432b-940b-9907c81ddf5b	g.chr3:123650270C>T	ENST00000488653.2	-	11	1764	c.1674G>A	c.(1672-1674)gtG>gtA	p.V558V	CCDC14_ENST00000485727.1_Silent_p.V358V|CCDC14_ENST00000489746.1_Silent_p.V358V|CCDC14_ENST00000433542.2_Silent_p.V517V|CCDC14_ENST00000483247.1_Intron|CCDC14_ENST00000310351.4_Silent_p.V398V			Q49A88	CCD14_HUMAN	coiled-coil domain containing 14	558					substantia nigra development (GO:0021762)	centrosome (GO:0005813)				NS(1)|breast(2)|endometrium(2)|kidney(1)|large_intestine(5)|lung(10)	21		Lung NSC(201;0.0371)|Prostate(884;0.0405)|Myeloproliferative disorder(1037;0.205)		Lung(219;0.00942)|GBM - Glioblastoma multiforme(114;0.159)		GATTTTCAATCACTTTTAACA	0.289																																					p.V517V		.											.	CCDC14-68	0			c.G1551A						.						45.0	41.0	42.0					3																	123650270		2193	4285	6478	SO:0001819	synonymous_variant	64770	exon10			TTCAATCACTTTT	AL122079	CCDS3025.2	3q21.1	2014-03-20			ENSG00000175455	ENSG00000175455			25766	protein-coding gene	gene with protein product						12477932	Standard	NM_022757		Approved	FLJ12892, DKFZp434L1050	uc010hrt.3	Q49A88	OTTHUMG00000153005	ENST00000488653.2:c.1674G>A	3.37:g.123650270C>T		Somatic	31	0		WXS	Illumina GAIIx	Phase_I	22	4	NM_022757	0	0	0	0	0	B7Z2T2|B8ZZ41|B8ZZ58|D3DN98|Q7Z3N3|Q86T30|Q8IWF8|Q8WUJ8|Q96K47|Q9H9A3|Q9UFH0	Silent	SNP	ENST00000488653.2	37																																																																																				.		0.289	CCDC14-202	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding		NM_022757	
CCDC39	339829	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	180372596	180372596	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5L2-01A-11D-A30A-10	TCGA-OR-A5L2-10A-01D-A30A-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b99bd79e-aa33-4896-8d10-2517c793f439	48e26b1d-b84d-432b-940b-9907c81ddf5b	g.chr3:180372596G>A	ENST00000442201.2	-	7	1003	c.884C>T	c.(883-885)aCg>aTg	p.T295M	CCDC39_ENST00000273654.4_Missense_Mutation_p.T379M	NM_181426.1	NP_852091.1	Q9UFE4	CCD39_HUMAN	coiled-coil domain containing 39	295					axonemal dynein complex assembly (GO:0070286)|cilium-dependent cell motility (GO:0060285)|determination of digestive tract left/right asymmetry (GO:0071907)|determination of liver left/right asymmetry (GO:0071910)|determination of pancreatic left/right asymmetry (GO:0035469)|epithelial cilium movement involved in determination of left/right asymmetry (GO:0060287)|heart looping (GO:0001947)|lung development (GO:0030324)	axoneme (GO:0005930)|cytoskeleton (GO:0005856)		p.T379K(1)|p.T295K(1)		NS(1)|breast(1)|endometrium(4)|large_intestine(9)|lung(22)|ovary(6)|prostate(2)	45	all_cancers(143;9.31e-15)|Ovarian(172;0.0212)		OV - Ovarian serous cystadenocarcinoma(80;5.62e-23)|GBM - Glioblastoma multiforme(14;0.000558)			CTGATATGCCGTTCTACATTT	0.353																																					p.T295M		.											.	CCDC39-72	2	Substitution - Missense(2)	endometrium(2)	c.C884T						.						144.0	122.0	129.0					3																	180372596		1823	4088	5911	SO:0001583	missense	339829	exon7			TATGCCGTTCTAC	BC047103	CCDS46964.1	3q26.33	2012-07-27			ENSG00000145075	ENSG00000145075			25244	protein-coding gene	gene with protein product		613798				21131972	Standard	NM_181426		Approved	DKFZp434A128, CILD14, FAP59	uc010hxe.3	Q9UFE4	OTTHUMG00000157857	ENST00000442201.2:c.884C>T	3.37:g.180372596G>A	ENSP00000405708:p.Thr295Met	Somatic	74	0		WXS	Illumina GAIIx	Phase_I	95	20	NM_181426	0	0	0	0	0	B4E2H1	Missense_Mutation	SNP	ENST00000442201.2	37	CCDS46964.1	.	.	.	.	.	.	.	.	.	.	G	10.91	1.485579	0.26686	.	.	ENSG00000145075	ENST00000273654;ENST00000442201	T;T	0.78595	-1.19;-1.19	5.5	-9.16	0.00694	.	0.725798	0.13912	N	0.354195	T	0.41971	0.1182	N	0.02011	-0.69	0.09310	N	1	B	0.14012	0.009	B	0.12837	0.008	T	0.34054	-0.9844	10	0.44086	T	0.13	0.2472	6.2964	0.21089	0.6751:0.081:0.0822:0.1617	.	295	Q9UFE4	CCD39_HUMAN	M	379;295	ENSP00000273654:T379M;ENSP00000405708:T295M	ENSP00000273654:T379M	T	-	2	0	CCDC39	181855290	0.000000	0.05858	0.000000	0.03702	0.009000	0.06853	-0.617000	0.05584	-2.031000	0.00928	-0.253000	0.11424	ACG	.		0.353	CCDC39-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349783.3	XM_291028	
MCF2L2	23101	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	3	182941972	182941972	+	Missense_Mutation	SNP	C	C	G			TCGA-OR-A5L2-01A-11D-A30A-10	TCGA-OR-A5L2-10A-01D-A30A-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b99bd79e-aa33-4896-8d10-2517c793f439	48e26b1d-b84d-432b-940b-9907c81ddf5b	g.chr3:182941972C>G	ENST00000328913.3	-	19	2419	c.2122G>C	c.(2122-2124)Gat>Cat	p.D708H	MCF2L2_ENST00000473233.1_Missense_Mutation_p.D708H	NM_015078.2	NP_055893	Q86YR7	MF2L2_HUMAN	MCF.2 cell line derived transforming sequence-like 2	708	DH. {ECO:0000255|PROSITE- ProRule:PRU00062}.						Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(2)|endometrium(5)|kidney(4)|large_intestine(22)|lung(25)|ovary(3)|prostate(4)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	72	all_cancers(143;1.26e-12)|Ovarian(172;0.0355)		all cancers(12;3.35e-44)|Epithelial(37;6.48e-38)|LUSC - Lung squamous cell carcinoma(7;7.12e-25)|Lung(8;6.39e-23)|OV - Ovarian serous cystadenocarcinoma(80;6.75e-21)			ATCTGAAGATCTTCTTTCTAG	0.383																																					p.D708H		.											.	MCF2L2-293	0			c.G2122C						.						78.0	83.0	81.0					3																	182941972		2203	4300	6503	SO:0001583	missense	23101	exon19			GAAGATCTTCTTT	AB020668	CCDS3243.1	3q27	2012-07-24			ENSG00000053524	ENSG00000053524		"""Rho guanine nucleotide exchange factors"""	30319	protein-coding gene	gene with protein product							Standard	NM_015078		Approved	KIAA0861, ARHGEF22	uc003fli.1	Q86YR7	OTTHUMG00000158388	ENST00000328913.3:c.2122G>C	3.37:g.182941972C>G	ENSP00000328118:p.Asp708His	Somatic	16	0		WXS	Illumina GAIIx	Phase_I	17	8	NM_015078	0	0	0	0	0	O94942|Q6P2B8|Q6ZVJ5|Q8N318	Missense_Mutation	SNP	ENST00000328913.3	37	CCDS3243.1	.	.	.	.	.	.	.	.	.	.	C	16.98	3.270145	0.59540	.	.	ENSG00000053524	ENST00000328913;ENST00000473233	T;T	0.62941	-0.01;-0.01	4.61	4.61	0.57282	Dbl homology (DH) domain (5);	0.120897	0.56097	D	0.000034	T	0.67942	0.2947	L	0.37897	1.145	0.80722	D	1	D	0.67145	0.996	D	0.64877	0.93	T	0.69320	-0.5176	10	0.56958	D	0.05	.	13.1482	0.59474	0.0:1.0:0.0:0.0	.	708	Q86YR7	MF2L2_HUMAN	H	708	ENSP00000328118:D708H;ENSP00000420070:D708H	ENSP00000328118:D708H	D	-	1	0	MCF2L2	184424666	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	2.127000	0.42035	2.556000	0.86216	0.563000	0.77884	GAT	.		0.383	MCF2L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350868.1	NM_015078	
ECE2	9718	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	183975278	183975278	+	Missense_Mutation	SNP	C	C	G			TCGA-OR-A5L2-01A-11D-A30A-10	TCGA-OR-A5L2-10A-01D-A30A-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b99bd79e-aa33-4896-8d10-2517c793f439	48e26b1d-b84d-432b-940b-9907c81ddf5b	g.chr3:183975278C>G	ENST00000402825.3	+	2	214	c.214C>G	c.(214-216)Ctg>Gtg	p.L72V	EIF2B5_ENST00000444495.1_Intron|ECE2_ENST00000324557.4_Missense_Mutation_p.L72V	NM_014693.3	NP_055508.3	O60344	ECE2_HUMAN	endothelin converting enzyme 2	72	Methyltransferase-like region.				brain development (GO:0007420)|cardioblast differentiation (GO:0010002)|cell-cell signaling (GO:0007267)|heart development (GO:0007507)|peptide hormone processing (GO:0016486)	cytoplasmic vesicle membrane (GO:0030659)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	metal ion binding (GO:0046872)|metalloendopeptidase activity (GO:0004222)|methyltransferase activity (GO:0008168)			breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(11)|lung(13)|ovary(3)|prostate(1)|skin(4)|upper_aerodigestive_tract(4)|urinary_tract(4)	49	all_cancers(143;1.39e-10)|Ovarian(172;0.0339)		Epithelial(37;8.28e-34)|OV - Ovarian serous cystadenocarcinoma(80;2.72e-22)			GAACAGTGCCCTGAGCTACGA	0.572																																					p.L72V		.											.	ECE2-94	0			c.C214G						.						85.0	73.0	77.0					3																	183975278		2203	4300	6503	SO:0001583	missense	9718	exon2			AGTGCCCTGAGCT	AF428263	CCDS3255.1, CCDS33899.1, CCDS3256.2, CCDS43179.1, CCDS46969.1	3q27.1	2007-07-26			ENSG00000145194	ENSG00000145194			13275	protein-coding gene	gene with protein product		610145				11718899	Standard	NM_032331		Approved	KIAA0604, MGC2408	uc003fni.4	O60344	OTTHUMG00000150551	ENST00000402825.3:c.214C>G	3.37:g.183975278C>G	ENSP00000384223:p.Leu72Val	Somatic	93	0		WXS	Illumina GAIIx	Phase_I	98	9	NM_014693	0	0	0	0	0	A5PLK8|Q6NTG7|Q6UW36|Q8NFD7|Q96NX3|Q96NX4|Q9BRZ8	Missense_Mutation	SNP	ENST00000402825.3	37	CCDS3256.2	.	.	.	.	.	.	.	.	.	.	C	17.18	3.322910	0.60634	.	.	ENSG00000145194	ENST00000324557;ENST00000402825	T;T	0.64991	-0.13;-0.13	5.77	2.92	0.33932	Methyltransferase type 11 (1);	.	.	.	.	T	0.64864	0.2637	L	0.41632	1.29	0.80722	D	1	D;D	0.62365	0.985;0.991	P;P	0.59703	0.848;0.862	T	0.62383	-0.6866	9	0.56958	D	0.05	3.4322	9.3359	0.38049	0.0:0.7646:0.0:0.2354	.	72;72	O60344;O60344-4	ECE2_HUMAN;.	V	72	ENSP00000314295:L72V;ENSP00000384223:L72V	ENSP00000314295:L72V	L	+	1	2	ECE2	185457972	0.667000	0.27484	0.999000	0.59377	0.930000	0.56654	0.879000	0.28146	0.306000	0.22856	0.655000	0.94253	CTG	.		0.572	ECE2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318874.3	NM_014693	
RTP1	132112	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	3	186917619	186917619	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5L2-01A-11D-A30A-10	TCGA-OR-A5L2-10A-01D-A30A-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b99bd79e-aa33-4896-8d10-2517c793f439	48e26b1d-b84d-432b-940b-9907c81ddf5b	g.chr3:186917619C>T	ENST00000312295.4	+	2	583	c.553C>T	c.(553-555)Cgg>Tgg	p.R185W	RP11-208N14.4_ENST00000356133.3_RNA	NM_153708.2	NP_714919.2	P59025	RTP1_HUMAN	receptor (chemosensory) transporter protein 1	185					protein insertion into membrane (GO:0051205)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	olfactory receptor binding (GO:0031849)	p.R185W(1)		breast(2)|endometrium(4)|large_intestine(5)|lung(6)|ovary(3)|skin(2)	22	all_cancers(143;5.33e-12)|Ovarian(172;0.0339)		OV - Ovarian serous cystadenocarcinoma(80;5.56e-18)	GBM - Glioblastoma multiforme(93;0.0269)		GGACAACCGGCGGCACCGCGG	0.682																																					p.R185W		.											.	RTP1-155	1	Substitution - Missense(1)	breast(1)	c.C553T						.						27.0	28.0	28.0					3																	186917619		2203	4297	6500	SO:0001583	missense	132112	exon2			AACCGGCGGCACC	BC034744	CCDS3287.2	3q27.3	2014-02-20	2006-11-21		ENSG00000175077	ENSG00000175077		"""Receptor transporter proteins"""	28580	protein-coding gene	gene with protein product	"""receptor transporting protein 1"", ""zinc finger, 3CxxC-type 1"""	609137	"""receptor transporter protein 1"""			16271481, 15550249, 16720576	Standard	NM_153708		Approved	MGC35450, Z3CXXC1	uc003frg.3	P59025	OTTHUMG00000149886	ENST00000312295.4:c.553C>T	3.37:g.186917619C>T	ENSP00000311712:p.Arg185Trp	Somatic	54	0		WXS	Illumina GAIIx	Phase_I	215	26	NM_153708	0	0	0	0	0		Missense_Mutation	SNP	ENST00000312295.4	37	CCDS3287.2	.	.	.	.	.	.	.	.	.	.	C	19.46	3.831020	0.71258	.	.	ENSG00000175077	ENST00000312295	T	0.22743	1.94	5.7	3.88	0.44766	.	0.163883	0.53938	D	0.000059	T	0.27559	0.0677	L	0.36672	1.1	0.29057	N	0.884159	D	0.67145	0.996	P	0.54815	0.761	T	0.07139	-1.0788	10	0.72032	D	0.01	.	11.6259	0.51145	0.322:0.678:0.0:0.0	.	185	P59025	RTP1_HUMAN	W	185	ENSP00000311712:R185W	ENSP00000311712:R185W	R	+	1	2	RTP1	188400313	0.997000	0.39634	0.953000	0.39169	0.726000	0.41606	0.656000	0.24948	0.740000	0.32651	0.561000	0.74099	CGG	.		0.682	RTP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313731.2	NM_153708	
TMEM44	93109	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	3	194336340	194336340	+	Silent	SNP	T	T	C			TCGA-OR-A5L2-01A-11D-A30A-10	TCGA-OR-A5L2-10A-01D-A30A-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b99bd79e-aa33-4896-8d10-2517c793f439	48e26b1d-b84d-432b-940b-9907c81ddf5b	g.chr3:194336340T>C	ENST00000392432.2	-	8	1216	c.1011A>G	c.(1009-1011)caA>caG	p.Q337Q	TMEM44_ENST00000381975.3_Silent_p.Q290Q|TMEM44_ENST00000347147.4_Silent_p.Q290Q|TMEM44_ENST00000273580.7_Silent_p.Q290Q|TMEM44_ENST00000473092.1_Silent_p.Q290Q	NM_001166305.1	NP_001159777.1	Q2T9K0	TMM44_HUMAN	transmembrane protein 44	337						integral component of membrane (GO:0016021)				breast(1)|kidney(1)|large_intestine(1)|liver(1)|lung(3)|urinary_tract(1)	8	all_cancers(143;1.41e-08)|Ovarian(172;0.0634)		OV - Ovarian serous cystadenocarcinoma(49;4.34e-18)|LUSC - Lung squamous cell carcinoma(58;3.55e-06)|Lung(62;4.19e-06)	GBM - Glioblastoma multiforme(46;9.06e-06)		TCAAAAGGGCTTGGGTGTCAG	0.493																																					p.Q337Q		.											.	TMEM44-90	0			c.A1011G						.						244.0	227.0	233.0					3																	194336340		2203	4300	6503	SO:0001819	synonymous_variant	93109	exon8			AAGGGCTTGGGTG	AL833026	CCDS3308.1, CCDS33921.1, CCDS3308.2, CCDS54698.1, CCDS54699.1	3q29	2005-08-16			ENSG00000145014	ENSG00000145014			25120	protein-coding gene	gene with protein product							Standard	NM_138399		Approved	DKFZp686O18124	uc010hzn.3	Q2T9K0	OTTHUMG00000156023	ENST00000392432.2:c.1011A>G	3.37:g.194336340T>C		Somatic	108	0		WXS	Illumina GAIIx	Phase_I	129	10	NM_001166305	0	0	0	0	0	A1L3V7|B7ZLZ5|B7ZLZ6|C9JJ62|E9PGA9|Q0P6F7|Q6ZT47|Q8IXR1|Q8N4G3	Silent	SNP	ENST00000392432.2	37	CCDS54699.1																																																																																			.		0.493	TMEM44-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000342750.1	NM_138399	
GRK4	2868	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	4	2990469	2990469	+	Missense_Mutation	SNP	G	G	C			TCGA-OR-A5L2-01A-11D-A30A-10	TCGA-OR-A5L2-10A-01D-A30A-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b99bd79e-aa33-4896-8d10-2517c793f439	48e26b1d-b84d-432b-940b-9907c81ddf5b	g.chr4:2990469G>C	ENST00000398052.4	+	3	507	c.164G>C	c.(163-165)aGt>aCt	p.S55T	GRK4_ENST00000504933.1_Missense_Mutation_p.S55T|GRK4_ENST00000398051.4_Missense_Mutation_p.S23T|GRK4_ENST00000345167.6_Missense_Mutation_p.S23T	NM_182982.2	NP_892027.2	P32298	GRK4_HUMAN	G protein-coupled receptor kinase 4	55	N-terminal.|RGS. {ECO:0000255|PROSITE- ProRule:PRU00171}.				G-protein coupled receptor internalization (GO:0002031)|receptor internalization (GO:0031623)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|signal transduction (GO:0007165)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	cytosol (GO:0005829)|dendrite (GO:0030425)|neuronal cell body (GO:0043025)	ATP binding (GO:0005524)|G-protein coupled receptor kinase activity (GO:0004703)|rhodopsin kinase activity (GO:0050254)			lung(1)|upper_aerodigestive_tract(1)	2				UCEC - Uterine corpus endometrioid carcinoma (64;0.168)		GATTATAGCAGTCTTTGTGAC	0.433																																					p.S55T		.											.	GRK4-507	0			c.G164C						.						110.0	110.0	110.0					4																	2990469		2203	4300	6503	SO:0001583	missense	2868	exon3			ATAGCAGTCTTTG		CCDS33946.1, CCDS33947.1, CCDS47002.1, CCDS68656.1	4p16.3	2008-02-05	2004-02-04	2004-02-06	ENSG00000125388	ENSG00000125388			4543	protein-coding gene	gene with protein product		137026	"""G protein-coupled receptor kinase 2-like (Drosophila)"""	GPRK2L		1338872	Standard	NM_182982		Approved	GPRK4	uc003ggn.1	P32298	OTTHUMG00000159914	ENST00000398052.4:c.164G>C	4.37:g.2990469G>C	ENSP00000381129:p.Ser55Thr	Somatic	80	0		WXS	Illumina GAIIx	Phase_I	113	9	NM_182982	0	0	0	0	0	O00641|O00642|Q13293|Q13294|Q13295|Q14453|Q14725|Q15313|Q15314|Q15315|Q15316|Q17RH6|Q53EQ8	Missense_Mutation	SNP	ENST00000398052.4	37	CCDS33946.1	.	.	.	.	.	.	.	.	.	.	G	12.95	2.091214	0.36855	.	.	ENSG00000125388	ENST00000398051;ENST00000398052;ENST00000345167;ENST00000504933	T;T;T;T	0.02103	4.45;4.45;4.45;4.45	5.56	4.72	0.59763	Regulator of G protein signalling (2);Regulator of G protein signalling superfamily (1);	0.250184	0.39985	U	0.001215	T	0.05686	0.0149	M	0.76002	2.32	0.80722	D	1	P;B;P;P	0.47762	0.571;0.011;0.878;0.9	B;B;B;P	0.47402	0.065;0.01;0.318;0.546	T	0.16364	-1.0405	10	0.52906	T	0.07	-21.5942	8.6035	0.33758	0.1733:0.0:0.8267:0.0	.	23;23;55;55	P32298-3;P32298-2;P32298-4;P32298	.;.;.;GRK4_HUMAN	T	23;55;23;55	ENSP00000381128:S23T;ENSP00000381129:S55T;ENSP00000264764:S23T;ENSP00000427445:S55T	ENSP00000264764:S23T	S	+	2	0	GRK4	2960267	1.000000	0.71417	0.988000	0.46212	0.643000	0.38383	4.358000	0.59442	1.351000	0.45789	0.573000	0.79308	AGT	.		0.433	GRK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000358176.2	NM_005307	
BLOC1S4	55330	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	6718286	6718286	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5L2-01A-11D-A30A-10	TCGA-OR-A5L2-10A-01D-A30A-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b99bd79e-aa33-4896-8d10-2517c793f439	48e26b1d-b84d-432b-940b-9907c81ddf5b	g.chr4:6718286G>A	ENST00000320776.3	+	1	445	c.350G>A	c.(349-351)gGc>gAc	p.G117D		NM_018366.2	NP_060836.1	Q9NUP1	BL1S4_HUMAN	biogenesis of lysosomal organelles complex-1, subunit 4, cappuccino	117					anterograde axon cargo transport (GO:0008089)|anterograde synaptic vesicle transport (GO:0048490)|melanosome organization (GO:0032438)|membrane organization (GO:0061024)|neuromuscular process controlling balance (GO:0050885)|neuron projection development (GO:0031175)|platelet aggregation (GO:0070527)|post-Golgi vesicle-mediated transport (GO:0006892)	BLOC-1 complex (GO:0031083)|cytoplasm (GO:0005737)|cytosol (GO:0005829)											GTCAGCGAGGGCGTGCCGCGC	0.687																																					p.G117D		.											.	.	0			c.G350A						.						12.0	9.0	10.0					4																	6718286		2139	4200	6339	SO:0001583	missense	55330	exon1			GCGAGGGCGTGCC	BC001818	CCDS3393.1	4p16.1	2012-08-01	2012-08-01	2012-08-01	ENSG00000186222	ENSG00000186222		"""Biogenesis of lysosomal organelles complex-1 subunits"""	24206	protein-coding gene	gene with protein product		605695	"""cappuccino homolog (mouse)"""	CNO		12576321, 11110696	Standard	NM_018366		Approved	FLJ11230, BCAS4L	uc003gjp.1	Q9NUP1	OTTHUMG00000125510	ENST00000320776.3:c.350G>A	4.37:g.6718286G>A	ENSP00000318128:p.Gly117Asp	Somatic	32	0		WXS	Illumina GAIIx	Phase_I	85	36	NM_018366	0	0	0	0	0	Q6NVY6|Q96G84	Missense_Mutation	SNP	ENST00000320776.3	37	CCDS3393.1	.	.	.	.	.	.	.	.	.	.	G	12.26	1.883231	0.33255	.	.	ENSG00000186222	ENST00000320776	T	0.42900	0.96	3.49	2.65	0.31530	.	0.253189	0.44902	D	0.000403	T	0.31327	0.0793	L	0.51422	1.61	0.30748	N	0.745461	P	0.43352	0.804	B	0.40864	0.342	T	0.19192	-1.0313	10	0.13470	T	0.59	0.0654	7.1149	0.25411	0.123:0.0:0.877:0.0	.	117	Q9NUP1	CNO_HUMAN	D	117	ENSP00000318128:G117D	ENSP00000318128:G117D	G	+	2	0	CNO	6769187	1.000000	0.71417	0.995000	0.50966	0.260000	0.26232	3.275000	0.51639	1.059000	0.40554	0.561000	0.74099	GGC	.		0.687	BLOC1S4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000246837.1	NM_018366	
FAM184B	27146	hgsc.bcm.edu	37	4	17643848	17643848	+	Missense_Mutation	SNP	G	G	A	rs2286771	byFrequency	TCGA-OR-A5L2-01A-11D-A30A-10	TCGA-OR-A5L2-10A-01D-A30A-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b99bd79e-aa33-4896-8d10-2517c793f439	48e26b1d-b84d-432b-940b-9907c81ddf5b	g.chr4:17643848G>A	ENST00000265018.3	-	13	2562	c.2350C>T	c.(2350-2352)Cgg>Tgg	p.R784W		NM_015688.1	NP_056503.1	Q9ULE4	F184B_HUMAN	family with sequence similarity 184, member B	784				R -> W (in Ref. 1; BAA86590). {ECO:0000305}.						NS(1)|central_nervous_system(1)|endometrium(1)|prostate(1)	4						GGGCCGCCCCGCTCCTGAGGA	0.701													G|||	2697	0.538538	0.1725	0.6599	5008	,	,		10215	0.8522		0.6233	False		,,,				2504	0.5368				p.R784W		.											.	FAM184B-23	0			c.C2350T						.						1.0	2.0	2.0					4																	17643848		374	1044	1418	SO:0001583	missense	27146	exon13			CGCCCCGCTCCTG		CCDS47033.1	4p16	2009-04-22			ENSG00000047662	ENSG00000047662			29235	protein-coding gene	gene with protein product						10574462	Standard	NM_015688		Approved	KIAA1276	uc003gpm.4	Q9ULE4	OTTHUMG00000160287	ENST00000265018.3:c.2350C>T	4.37:g.17643848G>A	ENSP00000265018:p.Arg784Trp	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	18	12	NM_015688	0	0	0	0	0		Missense_Mutation	SNP	ENST00000265018.3	37	CCDS47033.1	1272	0.5824175824175825	75	0.1524390243902439	232	0.6408839779005525	493	0.8618881118881119	472	0.6226912928759895	G	13.83	2.354233	0.41700	.	.	ENSG00000047662	ENST00000265018	T	0.34072	1.38	3.29	-3.67	0.04476	.	3.541600	0.00901	N	0.002342	T	0.00012	0.0000	N	0.14661	0.345	0.80722	P	0.0	D	0.56968	0.978	B	0.40741	0.339	T	0.48547	-0.9026	9	0.72032	D	0.01	2.0681	6.7491	0.23477	0.107:0.2547:0.5506:0.0877	rs2286771;rs58699512;rs2286771	784	Q9ULE4	F184B_HUMAN	W	784	ENSP00000265018:R784W	ENSP00000265018:R784W	R	-	1	2	FAM184B	17252946	0.000000	0.05858	0.000000	0.03702	0.516000	0.34256	-0.323000	0.07997	-1.014000	0.03379	-0.369000	0.07265	CGG	G|0.440;A|0.560		0.701	FAM184B-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000360137.1	NM_015688	
LCORL	254251	hgsc.bcm.edu	37	4	18023336	18023336	+	Silent	SNP	G	G	C	rs577955980	byFrequency	TCGA-OR-A5L2-01A-11D-A30A-10	TCGA-OR-A5L2-10A-01D-A30A-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b99bd79e-aa33-4896-8d10-2517c793f439	48e26b1d-b84d-432b-940b-9907c81ddf5b	g.chr4:18023336G>C	ENST00000382226.5	-	1	147	c.39C>G	c.(37-39)gcC>gcG	p.A13A	LCORL_ENST00000512376.2_5'UTR|LCORL_ENST00000382224.1_5'Flank|LCORL_ENST00000326877.4_Silent_p.A13A|LCORL_ENST00000539056.1_5'UTR	NM_001166139.1	NP_001159611.1	Q8N3X6	LCORL_HUMAN	ligand dependent nuclear receptor corepressor-like	13	Ala-rich.				regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)			kidney(1)|large_intestine(1)|lung(1)|prostate(1)	4						cggcagcagcggcggcggcag	0.716													G|||	7	0.00139776	0.0	0.0014	5008	,	,		8001	0.0		0.006	False		,,,				2504	0.0				p.A13A		.											.	LCORL-90	0			c.C39G						.						2.0	3.0	3.0					4																	18023336		1155	2613	3768	SO:0001819	synonymous_variant	254251	exon1			AGCAGCGGCGGCG		CCDS3425.1, CCDS54749.1	4p15.32	2006-06-14			ENSG00000178177	ENSG00000178177			30776	protein-coding gene	gene with protein product		611799				12560079	Standard	NM_153686		Approved	MLR1, FLJ30696	uc021xmr.1	Q8N3X6	OTTHUMG00000128538	ENST00000382226.5:c.39C>G	4.37:g.18023336G>C		Somatic	2	0		WXS	Illumina GAIIx	Phase_I	12	5	NM_001166139	0	0	0	0	0	Q96NK1	Silent	SNP	ENST00000382226.5	37	CCDS54749.1																																																																																			.		0.716	LCORL-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_153686	
RBM47	54502	hgsc.bcm.edu	37	4	40440854	40440854	+	Silent	SNP	G	G	C	rs1052153	byFrequency	TCGA-OR-A5L2-01A-11D-A30A-10	TCGA-OR-A5L2-10A-01D-A30A-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b99bd79e-aa33-4896-8d10-2517c793f439	48e26b1d-b84d-432b-940b-9907c81ddf5b	g.chr4:40440854G>C	ENST00000381793.2	-	3	453	c.57C>G	c.(55-57)tcC>tcG	p.S19S	RBM47_ENST00000514014.1_Intron|RBM47_ENST00000295971.7_Silent_p.S19S|RBM47_ENST00000381795.6_Silent_p.S19S|RBM47_ENST00000515809.1_Intron|RBM47_ENST00000319592.4_Silent_p.S19S			A0AV96	RBM47_HUMAN	RNA binding motif protein 47	19					hematopoietic progenitor cell differentiation (GO:0002244)	nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			breast(5)|endometrium(1)|kidney(3)|large_intestine(2)|lung(9)|ovary(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(1)	29						GCACCTTGGCGGAGGACCCGG	0.662													C|||	4016	0.801917	0.6808	0.8588	5008	,	,		14653	0.7679		0.8837	False		,,,				2504	0.8763				p.S19S		.											.	RBM47-25	0			c.C57G						.	C	,	3111,1133		1151,809,162	8.0	9.0	9.0		57,57	-7.6	0.0	4	dbSNP_86	9	7487,919		3358,771,74	no	coding-synonymous,coding-synonymous	RBM47	NM_001098634.1,NM_019027.3	,	4509,1580,236	CC,CG,GG		10.9327,26.6965,16.2213	,	19/594,19/525	40440854	10598,2052	2122	4203	6325	SO:0001819	synonymous_variant	54502	exon4			CTTGGCGGAGGAC	AK000280	CCDS3460.1, CCDS43223.1	4p14	2013-02-12			ENSG00000163694	ENSG00000163694		"""RNA binding motif (RRM) containing"""	30358	protein-coding gene	gene with protein product							Standard	NM_019027		Approved	FLJ20273, NET18	uc003gvc.2	A0AV96	OTTHUMG00000128598	ENST00000381793.2:c.57C>G	4.37:g.40440854G>C		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	7	7	NM_001098634	0	0	0	0	0	A0PJK2|B5MED4|Q8NI52|Q8NI53|Q9NXG3	Silent	SNP	ENST00000381793.2	37	CCDS43223.1																																																																																			G|0.794;C|0.206		0.662	RBM47-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250456.2	NM_019027	
ATP8A1	10396	broad.mit.edu	37	4	42580310	42580310	+	Silent	SNP	A	A	C			TCGA-OR-A5L2-01A-11D-A30A-10	TCGA-OR-A5L2-10A-01D-A30A-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b99bd79e-aa33-4896-8d10-2517c793f439	48e26b1d-b84d-432b-940b-9907c81ddf5b	g.chr4:42580310A>C	ENST00000381668.5	-	12	1326	c.1095T>G	c.(1093-1095)gtT>gtG	p.V365V	ATP8A1_ENST00000264449.10_Silent_p.V365V	NM_006095.2	NP_006086.1	Q9Y2Q0	AT8A1_HUMAN	ATPase, aminophospholipid transporter (APLT), class I, type 8A, member 1	365					cation transmembrane transport (GO:0098655)|ion transmembrane transport (GO:0034220)|phospholipid translocation (GO:0045332)|transmembrane transport (GO:0055085)	cytoplasmic vesicle (GO:0031410)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)			NS(1)|central_nervous_system(3)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(13)|lung(18)|pancreas(1)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(3)	51					Phosphatidylserine(DB00144)	TAAATTTCACAACTTCTAATG	0.328																																					p.V365V		.											.	ATP8A1-92	0			c.T1095G						.						90.0	91.0	91.0					4																	42580310		2203	4300	6503	SO:0001819	synonymous_variant	10396	exon12			TTTCACAACTTCT	AF067820	CCDS3466.1, CCDS47049.1	4p13	2010-04-20	2007-09-19		ENSG00000124406	ENSG00000124406		"""ATPases / P-type"""	13531	protein-coding gene	gene with protein product		609542	"""ATPase, aminophospholipid transporter (APLT), Class I, type 8A, member 1"""			10198212, 9548971	Standard	NM_006095		Approved	ATPIA	uc003gwr.2	Q9Y2Q0	OTTHUMG00000099403	ENST00000381668.5:c.1095T>G	4.37:g.42580310A>C		Somatic	102	0		WXS	Illumina GAIIx	Phase_I	167	4	NM_001105529	0	0	0	0	0	Q32M35|Q32M36|Q4W5J7|Q4W5P2	Silent	SNP	ENST00000381668.5	37	CCDS3466.1																																																																																			.		0.328	ATP8A1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000216861.2	NM_006095	
CORIN	10699	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	47788784	47788784	+	Missense_Mutation	SNP	T	T	A			TCGA-OR-A5L2-01A-11D-A30A-10	TCGA-OR-A5L2-10A-01D-A30A-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b99bd79e-aa33-4896-8d10-2517c793f439	48e26b1d-b84d-432b-940b-9907c81ddf5b	g.chr4:47788784T>A	ENST00000273857.4	-	3	366	c.367A>T	c.(367-369)Acg>Tcg	p.T123S	CORIN_ENST00000502252.1_Intron|CORIN_ENST00000504584.1_Missense_Mutation_p.T123S|CORIN_ENST00000505909.1_Missense_Mutation_p.T123S|CORIN_ENST00000508498.1_5'UTR	NM_006587.2	NP_006578.2	Q9Y5Q5	CORIN_HUMAN	corin, serine peptidase	123					female pregnancy (GO:0007565)|peptide hormone processing (GO:0016486)|proteolysis (GO:0006508)|regulation of blood pressure (GO:0008217)|regulation of renal sodium excretion (GO:0035813)|regulation of systemic arterial blood pressure by atrial natriuretic peptide (GO:0003050)	cell surface (GO:0009986)|extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	serine-type endopeptidase activity (GO:0004252)|serine-type exopeptidase activity (GO:0070008)			NS(2)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(18)|lung(39)|ovary(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(2)	79						GAAGCATCCGTAGTCCAGGCT	0.448																																					p.T123S		.											.	CORIN-91	0			c.A367T						.						126.0	119.0	122.0					4																	47788784		2203	4300	6503	SO:0001583	missense	10699	exon3			CATCCGTAGTCCA	AF133845	CCDS3477.1, CCDS63958.1, CCDS75122.1	4p13-p12	2011-08-31	2005-08-17		ENSG00000145244	ENSG00000145244		"""Serine peptidases / Transmembrane"""	19012	protein-coding gene	gene with protein product		605236	"""corin, serine protease"""			10329693	Standard	NM_006587		Approved	PRSC, CRN, ATC2, Lrp4, TMPRSS10	uc003gxm.3	Q9Y5Q5	OTTHUMG00000099441	ENST00000273857.4:c.367A>T	4.37:g.47788784T>A	ENSP00000273857:p.Thr123Ser	Somatic	147	0		WXS	Illumina GAIIx	Phase_I	215	32	NM_006587	0	0	0	0	0	B0ZBE3|Q2TBD2|Q4W5E5|Q4W5G6|Q9UHY2	Missense_Mutation	SNP	ENST00000273857.4	37	CCDS3477.1	.	.	.	.	.	.	.	.	.	.	T	7.944	0.743340	0.15642	.	.	ENSG00000145244	ENST00000273857;ENST00000505909;ENST00000504584	D;D;D	0.92545	-2.55;-2.46;-3.06	4.82	-9.65	0.00537	.	0.872654	0.09929	N	0.737512	T	0.78033	0.4220	L	0.27053	0.805	0.09310	N	1	B;B;B	0.24483	0.038;0.004;0.104	B;B;B	0.22386	0.006;0.002;0.039	T	0.65483	-0.6157	10	0.24483	T	0.36	.	0.7915	0.01058	0.3099:0.2573:0.2727:0.1601	.	123;123;123	B7Z4R1;B4E2W9;Q9Y5Q5	.;.;CORIN_HUMAN	S	123	ENSP00000273857:T123S;ENSP00000425401:T123S;ENSP00000423216:T123S	ENSP00000273857:T123S	T	-	1	0	CORIN	47483541	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	-0.473000	0.06615	-1.540000	0.01730	0.460000	0.39030	ACG	.		0.448	CORIN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000216906.2		
TEC	7006	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	48172291	48172291	+	Missense_Mutation	SNP	C	C	A			TCGA-OR-A5L2-01A-11D-A30A-10	TCGA-OR-A5L2-10A-01D-A30A-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b99bd79e-aa33-4896-8d10-2517c793f439	48e26b1d-b84d-432b-940b-9907c81ddf5b	g.chr4:48172291C>A	ENST00000381501.3	-	5	585	c.428G>T	c.(427-429)tGt>tTt	p.C143F		NM_003215.2	NP_003206.2	P42680	TEC_HUMAN	tec protein tyrosine kinase	143					B cell receptor signaling pathway (GO:0050853)|Fc-epsilon receptor signaling pathway (GO:0038095)|innate immune response (GO:0045087)|integrin-mediated signaling pathway (GO:0007229)|intracellular signal transduction (GO:0035556)|peptidyl-tyrosine phosphorylation (GO:0018108)|protein phosphorylation (GO:0006468)|regulation of platelet activation (GO:0010543)|tissue regeneration (GO:0042246)	cell-cell junction (GO:0005911)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|lipid binding (GO:0008289)|metal ion binding (GO:0046872)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)	p.C143F(1)		breast(1)|central_nervous_system(1)|kidney(3)|large_intestine(4)|lung(16)|ovary(1)|prostate(2)|skin(2)|stomach(1)	31						GTATTTTTCACATCCGGGTGC	0.289																																					p.C143F		.											.	TEC-1004	1	Substitution - Missense(1)	lung(1)	c.G428T						.						66.0	73.0	70.0					4																	48172291		2200	4293	6493	SO:0001583	missense	7006	exon5			TTTTCACATCCGG	D29767	CCDS3481.1	4p12	2013-02-14			ENSG00000135605	ENSG00000135605		"""Pleckstrin homology (PH) domain containing"", ""SH2 domain containing"""	11719	protein-coding gene	gene with protein product		600583				7934162	Standard	NM_003215		Approved	PSCTK4	uc003gxz.3	P42680	OTTHUMG00000128623	ENST00000381501.3:c.428G>T	4.37:g.48172291C>A	ENSP00000370912:p.Cys143Phe	Somatic	185	0		WXS	Illumina GAIIx	Phase_I	194	42	NM_003215	0	0	0	0	0	B7ZKZ6|Q3MIS5	Missense_Mutation	SNP	ENST00000381501.3	37	CCDS3481.1	.	.	.	.	.	.	.	.	.	.	C	20.9	4.063656	0.76187	.	.	ENSG00000135605	ENST00000381501	D	0.99942	-8.47	5.5	5.5	0.81552	Pleckstrin homology-type (1);Zinc finger, Btk motif (4);	0.000000	0.85682	D	0.000000	D	0.99935	0.9971	M	0.84433	2.695	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.95801	0.8833	10	0.66056	D	0.02	.	19.3941	0.94598	0.0:1.0:0.0:0.0	.	143	P42680	TEC_HUMAN	F	143	ENSP00000370912:C143F	ENSP00000370912:C143F	C	-	2	0	TEC	47867048	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	6.197000	0.72100	2.575000	0.86900	0.585000	0.79938	TGT	.		0.289	TEC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250492.3		
FRAS1	80144	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	79440544	79440544	+	Missense_Mutation	SNP	C	C	G			TCGA-OR-A5L2-01A-11D-A30A-10	TCGA-OR-A5L2-10A-01D-A30A-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b99bd79e-aa33-4896-8d10-2517c793f439	48e26b1d-b84d-432b-940b-9907c81ddf5b	g.chr4:79440544C>G	ENST00000264895.6	+	67	10889	c.10449C>G	c.(10447-10449)atC>atG	p.I3483M		NM_025074.6	NP_079350.5	Q86XX4	FRAS1_HUMAN	Fraser extracellular matrix complex subunit 1	3479					cell communication (GO:0007154)|embryonic limb morphogenesis (GO:0030326)|metanephros morphogenesis (GO:0003338)|morphogenesis of an epithelium (GO:0002009)|palate development (GO:0060021)|protein transport (GO:0015031)|skin development (GO:0043588)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|sublamina densa (GO:0061618)	metal ion binding (GO:0046872)			breast(2)|central_nervous_system(2)|cervix(2)|endometrium(14)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(5)|lung(54)|prostate(7)|skin(2)|urinary_tract(4)	103						TGTCCTACATCTATGTGACAG	0.532																																					p.I3483M		.											.	FRAS1-68	0			c.C10449G						.						156.0	163.0	161.0					4																	79440544		2078	4227	6305	SO:0001583	missense	80144	exon67			CTACATCTATGTG	AB040933	CCDS54772.1	4q21.21	2014-06-25	2014-06-25		ENSG00000138759	ENSG00000138759			19185	protein-coding gene	gene with protein product		607830	"""Fraser syndrome 1"""			12766769, 3118036	Standard	NM_025074		Approved	FLJ22031, FLJ14927, KIAA1500	uc003hlb.2	Q86XX4	OTTHUMG00000160856	ENST00000264895.6:c.10449C>G	4.37:g.79440544C>G	ENSP00000264895:p.Ile3483Met	Somatic	93	0		WXS	Illumina GAIIx	Phase_I	104	42	NM_025074	0	0	0	0	0	A2RRR8|Q86UZ4|Q8N3U9|Q8NAU7|Q96JW7|Q9H6N9|Q9P228	Missense_Mutation	SNP	ENST00000264895.6	37	CCDS54771.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	16.19|16.19	3.053282|3.053282	0.55218|0.55218	.|.	.|.	ENSG00000138759|ENSG00000138759	ENST00000264895|ENST00000512123	T|.	0.19105|.	2.17|.	5.4|5.4	4.56|4.56	0.56223|0.56223	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.63212|0.63212	0.2492|0.2492	M|M	0.72894|0.72894	2.215|2.215	0.80722|0.80722	D|D	1|1	D|.	0.89917|.	1.0|.	D|.	0.91635|.	0.999|.	T|T	0.62891|0.62891	-0.6758|-0.6758	10|5	0.87932|.	D|.	0|.	.|.	6.5157|6.5157	0.22246|0.22246	0.2807:0.6039:0.0:0.1154|0.2807:0.6039:0.0:0.1154	.|.	3483|.	E9PHH6|.	.|.	M|V	3483|1712	ENSP00000264895:I3483M|.	ENSP00000264895:I3483M|.	I|L	+|+	3|1	3|2	FRAS1|FRAS1	79659568|79659568	0.999000|0.999000	0.42202|0.42202	0.999000|0.999000	0.59377|0.59377	0.707000|0.707000	0.40811|0.40811	0.691000|0.691000	0.25467|0.25467	1.274000|1.274000	0.44362|0.44362	0.491000|0.491000	0.48974|0.48974	ATC|CTA	.		0.532	FRAS1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding			
GK2	2712	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	4	80327936	80327936	+	Silent	SNP	G	G	A			TCGA-OR-A5L2-01A-11D-A30A-10	TCGA-OR-A5L2-10A-01D-A30A-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b99bd79e-aa33-4896-8d10-2517c793f439	48e26b1d-b84d-432b-940b-9907c81ddf5b	g.chr4:80327936G>A	ENST00000358842.3	-	1	1436	c.1419C>T	c.(1417-1419)agC>agT	p.S473S		NM_033214.2	NP_149991.2	Q01415	GALK2_HUMAN	glycerol kinase 2	0					carbohydrate metabolic process (GO:0005975)|galactose metabolic process (GO:0006012)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|galactokinase activity (GO:0004335)|N-acetylgalactosamine kinase activity (GO:0033858)			autonomic_ganglia(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(13)|ovary(2)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)	39						GGGGTTCAAGGCTCCAAACGC	0.478																																					p.S473S		.											.	GK2-94	0			c.C1419T						.						114.0	111.0	112.0					4																	80327936		2203	4300	6503	SO:0001819	synonymous_variant	2712	exon1			TTCAAGGCTCCAA	BC029820	CCDS3585.1	4q13	2008-02-05	2002-10-03	2002-10-04	ENSG00000196475	ENSG00000196475		"""Glycerol kinases"""	4291	protein-coding gene	gene with protein product		600148	"""glycerol kinase pseudogene 2"""	GKP2		7987308	Standard	NM_033214		Approved	GKTA	uc003hlu.3	Q14410	OTTHUMG00000130199	ENST00000358842.3:c.1419C>T	4.37:g.80327936G>A		Somatic	170	0		WXS	Illumina GAIIx	Phase_I	262	27	NM_033214	0	0	0	0	0	Q7Z4Q4	Silent	SNP	ENST00000358842.3	37	CCDS3585.1																																																																																			.		0.478	GK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252517.2	NM_033214	
COQ2	27235	hgsc.bcm.edu	37	4	84205872	84205872	+	Missense_Mutation	SNP	C	C	A	rs6818847	byFrequency	TCGA-OR-A5L2-01A-11D-A30A-10	TCGA-OR-A5L2-10A-01D-A30A-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b99bd79e-aa33-4896-8d10-2517c793f439	48e26b1d-b84d-432b-940b-9907c81ddf5b	g.chr4:84205872C>A	ENST00000311469.4	-	1	195	c.196G>T	c.(196-198)Gtg>Ttg	p.V66L	COQ2_ENST00000311461.7_Missense_Mutation_p.V16L|COQ2_ENST00000439031.2_Missense_Mutation_p.V29L	NM_015697.7	NP_056512.5	Q96H96	COQ2_HUMAN	coenzyme Q2 4-hydroxybenzoate polyprenyltransferase	16					cell death (GO:0008219)|glycerol metabolic process (GO:0006071)|isoprenoid biosynthetic process (GO:0008299)|small molecule metabolic process (GO:0044281)|ubiquinone biosynthetic process (GO:0006744)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)	4-hydroxybenzoate decaprenyltransferase activity (GO:0002083)|4-hydroxybenzoate nonaprenyltransferase activity (GO:0047293)			central_nervous_system(1)|endometrium(1)|large_intestine(3)|ovary(1)|skin(1)|stomach(1)	8		Hepatocellular(203;0.114)				GCCAGTGCCACAGCCCGCAGG	0.766													C|||	3254	0.64976	0.3775	0.647	5008	,	,		9689	0.8879		0.7227	False		,,,				2504	0.6994				p.V66L		.											.	COQ2-92	0			c.G196T						.	C	LEU/VAL	1570,1290		474,622,334	2.0	3.0	3.0		196	-2.7	0.0	4	dbSNP_116	3	4779,1627		1892,995,316	no	missense	COQ2	NM_015697.7	32	2366,1617,650	AA,AC,CC		25.3981,45.1049,31.4807	benign	66/422	84205872	6349,2917	1430	3203	4633	SO:0001583	missense	27235	exon1			GTGCCACAGCCCG		CCDS47090.1, CCDS47090.2	4q21.23	2013-05-23	2013-05-23				2.5.1.39		25223	protein-coding gene	gene with protein product	"""4-hydroxybenzoate polyprenyltransferase"""	609825	"""coenzyme Q2 homolog, prenyltransferase (yeast)"""			15153069, 17332895	Standard	NM_015697		Approved	CL640, FLJ26072	uc003hog.3	Q96H96		ENST00000311469.4:c.196G>T	4.37:g.84205872C>A	ENSP00000310873:p.Val66Leu	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	7	7	NM_015697	0	0	0	0	0	O95331|Q1JQ78|Q684R2	Missense_Mutation	SNP	ENST00000311469.4	37	CCDS47090.2	1475	0.6753663003663004	219	0.4451219512195122	244	0.6740331491712708	490	0.8566433566433567	522	0.6886543535620053	C	5.506	0.278257	0.10403	0.548951	0.746019	ENSG00000173085	ENST00000311469;ENST00000439031;ENST00000311461	T;T;T	0.77098	-1.07;-1.03;-1.0	3.59	-2.74	0.05932	.	2.205390	0.02429	N	0.083323	T	0.00012	0.0000	.	.	.	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.33445	-0.9868	8	0.07813	T	0.8	-2.056	4.7989	0.13287	0.0:0.2608:0.3311:0.4081	rs6818847;rs17850399;rs17858544	16	E2QRG7	.	L	66;29;16	ENSP00000310873:V66L;ENSP00000409275:V29L;ENSP00000311835:V16L	ENSP00000311835:V16L	V	-	1	0	COQ2	84424896	0.000000	0.05858	0.000000	0.03702	0.018000	0.09664	-1.921000	0.01569	-0.746000	0.04766	0.467000	0.42956	GTG	C|0.324;A|0.676		0.766	COQ2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000363027.3	NM_015697	
MMRN1	22915	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	4	90872784	90872784	+	Silent	SNP	G	G	A			TCGA-OR-A5L2-01A-11D-A30A-10	TCGA-OR-A5L2-10A-01D-A30A-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b99bd79e-aa33-4896-8d10-2517c793f439	48e26b1d-b84d-432b-940b-9907c81ddf5b	g.chr4:90872784G>A	ENST00000394980.1	+	8	3466	c.3147G>A	c.(3145-3147)ccG>ccA	p.P1049P	MMRN1_ENST00000508372.1_Silent_p.P791P|MMRN1_ENST00000394981.1_Silent_p.P352P|MMRN1_ENST00000264790.2_Silent_p.P1049P			Q13201	MMRN1_HUMAN	multimerin 1	1049	EGF-like. {ECO:0000255|PROSITE- ProRule:PRU00076}.				blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)	extracellular region (GO:0005576)|platelet alpha granule lumen (GO:0031093)		p.P1049P(1)		breast(2)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(12)|liver(2)|lung(34)|ovary(5)|prostate(1)|skin(6)|stomach(1)|urinary_tract(2)	72		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;6.96e-05)		GTCGGCATCCGTGCCAAAATG	0.428																																					p.P1049P		.											.	MMRN1-94	1	Substitution - coding silent(1)	lung(1)	c.G3147A						.						94.0	81.0	85.0					4																	90872784		2203	4300	6503	SO:0001819	synonymous_variant	22915	exon7			GCATCCGTGCCAA	U27109	CCDS3635.1	4q22	2008-02-05	2004-03-02	2004-03-02	ENSG00000138722	ENSG00000138722		"""EMI domain containing"""	7178	protein-coding gene	gene with protein product	"""glycoprotein Ia*"""	601456	"""multimerin"""	MMRN		7629143, 10828608	Standard	NM_007351		Approved	ECM, EMILIN4, GPIa*	uc003hst.3	Q13201	OTTHUMG00000130947	ENST00000394980.1:c.3147G>A	4.37:g.90872784G>A		Somatic	128	0		WXS	Illumina GAIIx	Phase_I	145	26	NM_007351	0	0	0	0	0	Q4W5L1|Q6P3T8|Q6ZUL9	Silent	SNP	ENST00000394980.1	37	CCDS3635.1																																																																																			.		0.428	MMRN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253546.2	NM_007351	
ZGRF1	55345	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	113505163	113505163	+	Silent	SNP	T	T	C			TCGA-OR-A5L2-01A-11D-A30A-10	TCGA-OR-A5L2-10A-01D-A30A-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b99bd79e-aa33-4896-8d10-2517c793f439	48e26b1d-b84d-432b-940b-9907c81ddf5b	g.chr4:113505163T>C	ENST00000505019.1	-	15	4394	c.4269A>G	c.(4267-4269)ccA>ccG	p.P1423P		NM_018392.4	NP_060862.3	Q86YA3	ZGRF1_HUMAN		1423						integral component of membrane (GO:0016021)	zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(2)|endometrium(3)|kidney(5)|large_intestine(6)|lung(21)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	45		Ovarian(17;0.156)		OV - Ovarian serous cystadenocarcinoma(123;0.000676)		CCTCATAAAGTGGTATCTTTT	0.373																																					p.P1423P		.											.	C4orf21-90	0			c.A4269G						.						82.0	84.0	83.0					4																	113505163		2203	4300	6503	SO:0001819	synonymous_variant	55345	exon15			ATAAAGTGGTATC																												ENST00000505019.1:c.4269A>G	4.37:g.113505163T>C		Somatic	56	0		WXS	Illumina GAIIx	Phase_I	66	18	NM_018392	0	0	0	0	0	B3KQX2|B4DSN6|B4DYU8|E9PDE1|G5EA02|Q6ZU11|Q9NSW3|Q9NUJ4	Silent	SNP	ENST00000505019.1	37																																																																																				.		0.373	C4orf21-003	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000256413.1		
QRFPR	84109	broad.mit.edu	37	4	122254171	122254171	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5L2-01A-11D-A30A-10	TCGA-OR-A5L2-10A-01D-A30A-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b99bd79e-aa33-4896-8d10-2517c793f439	48e26b1d-b84d-432b-940b-9907c81ddf5b	g.chr4:122254171C>T	ENST00000394427.2	-	4	1013	c.602G>A	c.(601-603)tGc>tAc	p.C201Y	QRFPR_ENST00000334383.5_Missense_Mutation_p.C201Y	NM_198179.2	NP_937822.2	Q96P65	QRFPR_HUMAN	pyroglutamylated RFamide peptide receptor	201					G-protein coupled receptor signaling pathway (GO:0007186)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|neuropeptide Y receptor activity (GO:0004983)			endometrium(1)|kidney(2)|large_intestine(9)|lung(10)|prostate(2)|skin(3)|stomach(1)	28						CTCTTCTAAGCAGCAGATGTG	0.393																																					p.C201Y		.											.	QRFPR-90	0			c.G602A						.						109.0	104.0	106.0					4																	122254171		2203	4300	6503	SO:0001583	missense	84109	exon4			TCTAAGCAGCAGA	AF411117	CCDS3719.1	4q27	2012-08-10	2008-12-18	2008-12-18	ENSG00000186867	ENSG00000186867		"""GPCR / Class A : RF amide peptide receptors"""	15565	protein-coding gene	gene with protein product		606925	"""G protein-coupled receptor 103"""	GPR103		11574155	Standard	NM_198179		Approved		uc010inj.1	Q96P65	OTTHUMG00000133036	ENST00000394427.2:c.602G>A	4.37:g.122254171C>T	ENSP00000377948:p.Cys201Tyr	Somatic	189	0		WXS	Illumina GAIIx	Phase_I	212	8	NM_198179	0	0	0	0	0		Missense_Mutation	SNP	ENST00000394427.2	37	CCDS3719.1	.	.	.	.	.	.	.	.	.	.	C	27.5	4.840863	0.91197	.	.	ENSG00000186867	ENST00000394427;ENST00000334383	T;T	0.61980	0.06;0.06	6.06	6.06	0.98353	GPCR, rhodopsin-like superfamily (1);	0.000000	0.85682	D	0.000000	D	0.84388	0.5461	M	0.90542	3.125	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.86101	0.1556	10	0.87932	D	0	.	20.6282	0.99521	0.0:1.0:0.0:0.0	.	201;201	Q96P65;G4XH69	QRFPR_HUMAN;.	Y	201	ENSP00000377948:C201Y;ENSP00000335610:C201Y	ENSP00000335610:C201Y	C	-	2	0	QRFPR	122473621	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.715000	0.84713	2.871000	0.98454	0.655000	0.94253	TGC	.		0.393	QRFPR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256641.2	NM_198179	
GLRB	2743	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	4	158074152	158074152	+	Missense_Mutation	SNP	G	G	T			TCGA-OR-A5L2-01A-11D-A30A-10	TCGA-OR-A5L2-10A-01D-A30A-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b99bd79e-aa33-4896-8d10-2517c793f439	48e26b1d-b84d-432b-940b-9907c81ddf5b	g.chr4:158074152G>T	ENST00000264428.4	+	9	1457	c.1187G>T	c.(1186-1188)aGc>aTc	p.S396I	GLRB_ENST00000509282.1_Missense_Mutation_p.S396I|GLRB_ENST00000512619.1_Intron|GLRB_ENST00000541722.1_Intron	NM_000824.4	NP_000815.1	P48167	GLRB_HUMAN	glycine receptor, beta	396					acrosome reaction (GO:0007340)|adult walking behavior (GO:0007628)|chloride transmembrane transport (GO:1902476)|ion transmembrane transport (GO:0034220)|ion transport (GO:0006811)|nervous system development (GO:0007399)|neuropeptide signaling pathway (GO:0007218)|protein heterooligomerization (GO:0051291)|regulation of membrane potential (GO:0042391)|righting reflex (GO:0060013)|startle response (GO:0001964)|synaptic transmission (GO:0007268)|synaptic transmission, glycinergic (GO:0060012)|transmembrane transport (GO:0055085)|visual perception (GO:0007601)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	extracellular-glycine-gated chloride channel activity (GO:0016934)|extracellular-glycine-gated ion channel activity (GO:0016933)|glycine binding (GO:0016594)			central_nervous_system(1)|endometrium(3)|large_intestine(11)|lung(6)|skin(5)|upper_aerodigestive_tract(1)	27	all_hematologic(180;0.24)	Renal(120;0.0458)		KIRC - Kidney renal clear cell carcinoma(143;0.0564)|COAD - Colon adenocarcinoma(41;0.0642)|Kidney(143;0.0707)	Enflurane(DB00228)|Glycine(DB00145)|Lindane(DB00431)	GTTCATATTAGCACTTTGCAG	0.403																																					p.S396I		.											.	GLRB-92	0			c.G1187T						.						71.0	72.0	72.0					4																	158074152		2203	4300	6503	SO:0001583	missense	2743	exon9			ATATTAGCACTTT	U33267	CCDS3796.1, CCDS54813.1	4q31.3	2008-02-05			ENSG00000109738	ENSG00000109738			4329	protein-coding gene	gene with protein product		138492				9676428, 8717357	Standard	NM_000824		Approved		uc003ipj.2	P48167	OTTHUMG00000161954	ENST00000264428.4:c.1187G>T	4.37:g.158074152G>T	ENSP00000264428:p.Ser396Ile	Somatic	118	0		WXS	Illumina GAIIx	Phase_I	81	13	NM_000824	0	0	0	0	0	A8K3K2|D3DP23|F5GWE1	Missense_Mutation	SNP	ENST00000264428.4	37	CCDS3796.1	.	.	.	.	.	.	.	.	.	.	G	18.86	3.713507	0.68730	.	.	ENSG00000109738	ENST00000264428;ENST00000509282	D;D	0.83755	-1.76;-1.76	5.12	5.12	0.69794	Neurotransmitter-gated ion-channel transmembrane domain (2);	0.083917	0.85682	D	0.000000	D	0.86965	0.6060	L	0.52573	1.65	0.80722	D	1	D	0.61697	0.99	P	0.56434	0.798	D	0.87480	0.2420	10	0.54805	T	0.06	.	18.9372	0.92590	0.0:0.0:1.0:0.0	.	396	P48167	GLRB_HUMAN	I	396	ENSP00000264428:S396I;ENSP00000427186:S396I	ENSP00000264428:S396I	S	+	2	0	GLRB	158293602	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.289000	0.96061	2.544000	0.85801	0.561000	0.74099	AGC	.		0.403	GLRB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366507.1	NM_000824	
DDX60L	91351	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	169369890	169369890	+	Missense_Mutation	SNP	A	A	C			TCGA-OR-A5L2-01A-11D-A30A-10	TCGA-OR-A5L2-10A-01D-A30A-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b99bd79e-aa33-4896-8d10-2517c793f439	48e26b1d-b84d-432b-940b-9907c81ddf5b	g.chr4:169369890A>C	ENST00000511577.1	-	9	1284	c.1037T>G	c.(1036-1038)gTt>gGt	p.V346G	DDX60L_ENST00000260184.7_Missense_Mutation_p.V346G|DDX60L_ENST00000505890.1_Missense_Mutation_p.V346G			Q5H9U9	DDX6L_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 60-like	346							ATP binding (GO:0005524)|helicase activity (GO:0004386)|RNA binding (GO:0003723)			breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(7)|lung(23)|ovary(2)|prostate(1)|skin(1)|stomach(1)	43		Prostate(90;0.00876)|Renal(120;0.0183)|all_neural(102;0.0837)|Melanoma(52;0.132)		GBM - Glioblastoma multiforme(119;0.175)		GCATCCAAAAACGTTTAAGTT	0.303																																					p.V346G		.											.	DDX60L-69	0			c.T1037G						.						54.0	49.0	51.0					4																	169369890		1813	4068	5881	SO:0001583	missense	91351	exon9			CCAAAAACGTTTA	AK092461	CCDS47161.1	4q32.3	2008-01-08				ENSG00000181381			26429	protein-coding gene	gene with protein product							Standard	XM_005263341		Approved	FLJ31033	uc003irq.4	Q5H9U9		ENST00000511577.1:c.1037T>G	4.37:g.169369890A>C	ENSP00000422423:p.Val346Gly	Somatic	210	0		WXS	Illumina GAIIx	Phase_I	260	37	NM_001012967	0	0	0	0	0	Q96ND6	Missense_Mutation	SNP	ENST00000511577.1	37		.	.	.	.	.	.	.	.	.	.	A	0.010	-1.766206	0.00651	.	.	ENSG00000181381	ENST00000260184;ENST00000511577;ENST00000505890;ENST00000505863	T;T;T;T	0.17691	2.26;2.26;2.26;2.93	2.46	-2.31	0.06765	.	2.815340	0.02431	U	0.083587	T	0.08313	0.0207	N	0.22421	0.69	0.09310	N	1	B;B;B	0.32160	0.349;0.358;0.349	B;B;B	0.24006	0.05;0.05;0.05	T	0.13469	-1.0508	10	0.20046	T	0.44	.	0.2716	0.00232	0.2835:0.1759:0.1483:0.3923	.	346;346;346	E9PAP8;D6R906;Q5H9U9	.;.;DDX6L_HUMAN	G	346;346;346;74	ENSP00000260184:V346G;ENSP00000422423:V346G;ENSP00000422202:V346G;ENSP00000421026:V74G	ENSP00000260184:V346G	V	-	2	0	DDX60L	169606465	0.000000	0.05858	0.001000	0.08648	0.035000	0.12851	-0.794000	0.04584	-0.296000	0.08947	-0.456000	0.05471	GTT	.		0.303	DDX60L-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000364839.1	NM_001012967	
ACSL1	2180	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	185686036	185686036	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5L2-01A-11D-A30A-10	TCGA-OR-A5L2-10A-01D-A30A-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b99bd79e-aa33-4896-8d10-2517c793f439	48e26b1d-b84d-432b-940b-9907c81ddf5b	g.chr4:185686036C>T	ENST00000515030.1	-	15	1728	c.1403G>A	c.(1402-1404)tGc>tAc	p.C468Y	ACSL1_ENST00000281455.2_Missense_Mutation_p.C468Y|ACSL1_ENST00000454703.2_Missense_Mutation_p.C297Y|ACSL1_ENST00000513317.1_Missense_Mutation_p.C468Y|ACSL1_ENST00000507295.1_Missense_Mutation_p.C434Y|ACSL1_ENST00000437665.3_Missense_Mutation_p.C297Y|ACSL1_ENST00000504342.1_Missense_Mutation_p.C468Y			P33121	ACSL1_HUMAN	acyl-CoA synthetase long-chain family member 1	468					adiponectin-activated signaling pathway (GO:0033211)|alpha-linolenic acid metabolic process (GO:0036109)|cellular lipid metabolic process (GO:0044255)|linoleic acid metabolic process (GO:0043651)|lipid biosynthetic process (GO:0008610)|long-chain fatty acid import (GO:0044539)|long-chain fatty acid metabolic process (GO:0001676)|long-chain fatty-acyl-CoA biosynthetic process (GO:0035338)|positive regulation of protein serine/threonine kinase activity (GO:0071902)|response to drug (GO:0042493)|response to nutrient (GO:0007584)|response to oleic acid (GO:0034201)|response to organic cyclic compound (GO:0014070)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)|unsaturated fatty acid metabolic process (GO:0033559)|xenobiotic catabolic process (GO:0042178)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)|peroxisomal membrane (GO:0005778)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|long-chain fatty acid-CoA ligase activity (GO:0004467)			NS(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(6)|liver(1)|lung(17)|ovary(2)|prostate(1)|skin(2)	38		all_lung(41;7.57e-14)|Lung NSC(41;1.81e-13)|Colorectal(36;0.00172)|Hepatocellular(41;0.00826)|Renal(120;0.00988)|Prostate(90;0.0235)|all_hematologic(60;0.0315)|all_neural(102;0.107)|Medulloblastoma(177;0.146)		all cancers(43;1.33e-28)|Epithelial(43;5.3e-25)|OV - Ovarian serous cystadenocarcinoma(60;4.88e-11)|Colorectal(24;3.59e-06)|STAD - Stomach adenocarcinoma(60;2.72e-05)|GBM - Glioblastoma multiforme(59;2.83e-05)|BRCA - Breast invasive adenocarcinoma(30;7.66e-05)|COAD - Colon adenocarcinoma(29;0.000538)|LUSC - Lung squamous cell carcinoma(40;0.008)|READ - Rectum adenocarcinoma(43;0.0419)	Adenosine monophosphate(DB00131)|Adenosine triphosphate(DB00171)	CATGGTCAGGCAGCACCCGGC	0.483																																					p.C468Y		.											.	ACSL1-92	0			c.G1403A						.						69.0	63.0	65.0					4																	185686036		2203	4300	6503	SO:0001583	missense	2180	exon15			GTCAGGCAGCACC	BC026290	CCDS3839.1, CCDS68825.1, CCDS68826.1, CCDS75213.1	4q35.1	2014-08-08	2004-02-19	2004-02-20	ENSG00000151726	ENSG00000151726	6.2.1.3	"""Acyl-CoA synthetase family"""	3569	protein-coding gene	gene with protein product	"""lignoceroyl-CoA synthase"", ""long-chain fatty-acid-coenzyme A ligase 1"""	152425	"""fatty-acid-Coenzyme A ligase, long-chain 2"""	FACL2		2341402, 1531127	Standard	XM_005262828		Approved	LACS2, LACS, ACS1, LACS1, FACL1	uc003iwu.1	P33121	OTTHUMG00000160547	ENST00000515030.1:c.1403G>A	4.37:g.185686036C>T	ENSP00000422607:p.Cys468Tyr	Somatic	222	0		WXS	Illumina GAIIx	Phase_I	157	30	NM_001995	0	0	0	0	0	B7Z452|D3DP57|P41215|Q8N8V7|Q8TA99	Missense_Mutation	SNP	ENST00000515030.1	37	CCDS3839.1	.	.	.	.	.	.	.	.	.	.	C	15.25	2.778495	0.49786	.	.	ENSG00000151726	ENST00000454703;ENST00000515030;ENST00000503407;ENST00000281455;ENST00000507295;ENST00000437665;ENST00000504342;ENST00000513317	T;T;T;T;T;T;T;T	0.10573	2.86;2.86;2.86;2.86;2.86;2.86;2.86;2.86	5.61	-1.9	0.07665	AMP-dependent synthetase/ligase (1);	0.439705	0.31031	N	0.008398	T	0.32734	0.0839	M	0.80332	2.49	0.28686	N	0.904828	P;B;B;B	0.42941	0.794;0.156;0.156;0.129	P;B;B;B	0.55260	0.772;0.317;0.217;0.183	T	0.58951	-0.7545	10	0.87932	D	0	-4.1284	24.8851	0.99992	0.0:0.1544:0.8456:0.0	.	434;468;468;468	E7EPM6;B7Z452;P33121;P33121-2	.;.;ACSL1_HUMAN;.	Y	297;468;74;468;434;297;468;468	ENSP00000407165:C297Y;ENSP00000422607:C468Y;ENSP00000425098:C74Y;ENSP00000281455:C468Y;ENSP00000426244:C434Y;ENSP00000405687:C297Y;ENSP00000425006:C468Y;ENSP00000426150:C468Y	ENSP00000281455:C468Y	C	-	2	0	ACSL1	185923030	1.000000	0.71417	0.970000	0.41538	0.690000	0.40134	2.417000	0.44653	-0.169000	0.10834	0.655000	0.94253	TGC	.		0.483	ACSL1-011	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000361112.2	NM_001995	
IRX4	50805	broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	1879672	1879672	+	Nonsense_Mutation	SNP	C	C	A			TCGA-OR-A5L2-01A-11D-A30A-10	TCGA-OR-A5L2-10A-01D-A30A-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b99bd79e-aa33-4896-8d10-2517c793f439	48e26b1d-b84d-432b-940b-9907c81ddf5b	g.chr5:1879672C>A	ENST00000505790.1	-	5	1138	c.682G>T	c.(682-684)Gag>Tag	p.E228*	IRX4_ENST00000505938.1_5'UTR|IRX4_ENST00000231357.2_Nonsense_Mutation_p.E228*|IRX4_ENST00000513692.1_Nonsense_Mutation_p.E228*	NM_001278634.1	NP_001265563.1	P78413	IRX4_HUMAN	iroquois homeobox 4	228	Poly-Glu.				establishment of organ orientation (GO:0048561)|heart development (GO:0007507)|regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)			endometrium(1)|lung(7)|ovary(1)|prostate(1)	10				GBM - Glioblastoma multiforme(108;0.242)		tcgcccccctcctcctcctcg	0.687																																					p.E228X		.											.	IRX4-226	0			c.G682T						.						30.0	29.0	29.0					5																	1879672		2201	4300	6501	SO:0001587	stop_gained	50805	exon4			CCCCCTCCTCCTC	AF124733	CCDS3867.1, CCDS75225.1	5p15.33	2011-06-20	2007-07-13		ENSG00000113430	ENSG00000113430		"""Homeoboxes / TALE class"""	6129	protein-coding gene	gene with protein product		606199	"""iroquois homeobox protein 4"""			10625552	Standard	NM_016358		Approved		uc003jcz.2	P78413	OTTHUMG00000090411	ENST00000505790.1:c.682G>T	5.37:g.1879672C>A	ENSP00000423161:p.Glu228*	Somatic	139	1		WXS	Illumina GAIIx	Phase_I	145	58	NM_016358	0	0	0	0	0	B2RMW5|D3DTC5|H1AFL0|H1AFL1|Q2NL64|Q9UHR2	Nonsense_Mutation	SNP	ENST00000505790.1	37	CCDS3867.1	.	.	.	.	.	.	.	.	.	.	C	23.4	4.411487	0.83340	.	.	ENSG00000113430	ENST00000231357;ENST00000505790;ENST00000513692	.	.	.	4.17	3.3	0.37823	.	0.057275	0.64402	D	0.000002	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.25751	T	0.34	-1.1576	10.7435	0.46166	0.0:0.9042:0.0:0.0958	.	.	.	.	X	228	.	ENSP00000231357:E228X	E	-	1	0	IRX4	1932672	1.000000	0.71417	0.023000	0.16930	0.158000	0.22134	5.023000	0.64084	0.967000	0.38186	0.462000	0.41574	GAG	.		0.687	IRX4-004	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365500.1	NM_016358	
FAM173B	134145	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	5	10239180	10239180	+	Splice_Site	SNP	A	A	T			TCGA-OR-A5L2-01A-11D-A30A-10	TCGA-OR-A5L2-10A-01D-A30A-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b99bd79e-aa33-4896-8d10-2517c793f439	48e26b1d-b84d-432b-940b-9907c81ddf5b	g.chr5:10239180A>T	ENST00000511437.1	-	2	317	c.305T>A	c.(304-306)aTt>aAt	p.I102N	FAM173B_ENST00000510047.1_Splice_Site_p.I102N|FAM173B_ENST00000510052.1_5'UTR|FAM173B_ENST00000280330.8_De_novo_Start_InFrame	NM_199133.3	NP_954584.2	Q6P4H8	F173B_HUMAN	family with sequence similarity 173, member B	102						integral component of membrane (GO:0016021)				breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(6)|skin(1)|upper_aerodigestive_tract(1)	16						AGAACTCACAATGCGTCCGTC	0.403																																					p.I102N		.											.	FAM173B-91	0			c.T305A						.						110.0	107.0	108.0					5																	10239180		1981	4139	6120	SO:0001630	splice_region_variant	134145	exon2			CTCACAATGCGTC		CCDS43301.1, CCDS58942.1	5p15.2	2008-08-08			ENSG00000150756	ENSG00000150756			27029	protein-coding gene	gene with protein product						12477932	Standard	NM_199133		Approved		uc003jeo.3	Q6P4H8	OTTHUMG00000161771	ENST00000511437.1:c.306+1T>A	5.37:g.10239180A>T		Somatic	46	0		WXS	Illumina GAIIx	Phase_I	38	17	NM_199133	0	0	0	0	0	B4DT41|B4DXK2|E9PBZ4	Missense_Mutation	SNP	ENST00000511437.1	37	CCDS43301.1	.	.	.	.	.	.	.	.	.	.	A	15.91	2.972781	0.53614	.	.	ENSG00000150756	ENST00000511437;ENST00000510047	T;T	0.33216	1.42;1.42	5.19	5.19	0.71726	.	0.156234	0.56097	D	0.000028	T	0.60521	0.2275	M	0.86651	2.83	0.52501	D	0.999958	D;D	0.89917	1.0;1.0	D;D	0.79108	0.972;0.992	T	0.68577	-0.5372	10	0.87932	D	0	-14.9513	14.2618	0.66090	1.0:0.0:0.0:0.0	.	102;102	E9PBZ4;Q6P4H8	.;F173B_HUMAN	N	102	ENSP00000422338:I102N;ENSP00000420876:I102N	ENSP00000424210:I102N	I	-	2	0	FAM173B	10292180	1.000000	0.71417	0.014000	0.15608	0.183000	0.23260	8.325000	0.90007	1.969000	0.57287	0.533000	0.62120	ATT	.		0.403	FAM173B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000366048.2	NM_199133	Missense_Mutation
MAP3K1	4214	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	56155597	56155597	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5L2-01A-11D-A30A-10	TCGA-OR-A5L2-10A-01D-A30A-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b99bd79e-aa33-4896-8d10-2517c793f439	48e26b1d-b84d-432b-940b-9907c81ddf5b	g.chr5:56155597C>T	ENST00000399503.3	+	3	689	c.689C>T	c.(688-690)gCt>gTt	p.A230V	snoU13_ENST00000459264.1_RNA|AC008937.2_ENST00000415589.1_RNA	NM_005921.1	NP_005912.1	Q13233	M3K1_HUMAN	mitogen-activated protein kinase kinase kinase 1, E3 ubiquitin protein ligase	230					activation of MAPKK activity (GO:0000186)|apoptotic mitochondrial changes (GO:0008637)|cellular response to mechanical stimulus (GO:0071260)|epithelial cell morphogenesis (GO:0003382)|eyelid development in camera-type eye (GO:0061029)|Fc-epsilon receptor signaling pathway (GO:0038095)|innate immune response (GO:0045087)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|positive regulation of actin filament polymerization (GO:0030838)|protein phosphorylation (GO:0006468)|regulation of cell migration (GO:0030334)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|transforming growth factor beta receptor signaling pathway (GO:0007179)|wound healing (GO:0042060)	cytosol (GO:0005829)	ATP binding (GO:0005524)|JUN kinase kinase activity (GO:0008545)|MAP kinase kinase kinase activity (GO:0004709)|protein kinase activity (GO:0004672)|protein kinase binding (GO:0019901)|zinc ion binding (GO:0008270)			NS(1)|breast(19)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(8)|lung(11)|ovary(1)|skin(3)|urinary_tract(1)	57		Lung NSC(810;4.65e-05)|Prostate(74;0.0132)|Breast(144;0.0321)|Ovarian(174;0.223)		OV - Ovarian serous cystadenocarcinoma(10;6.08e-40)		CACTTAGCAGCTGAGTCTCCA	0.448																																					p.A230V		.											.	MAP3K1-956	0			c.C689T						.						42.0	42.0	42.0					5																	56155597		1910	4136	6046	SO:0001583	missense	4214	exon3			TAGCAGCTGAGTC	U29671, AF042838	CCDS43318.1	5q11.2	2012-02-23	2012-02-23		ENSG00000095015	ENSG00000095015		"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	6848	protein-coding gene	gene with protein product		600982	"""mitogen-activated protein kinase kinase kinase 1"""	MEKK1		8597633	Standard	NM_005921		Approved	MEKK, MAPKKK1	uc003jqw.4	Q13233	OTTHUMG00000059486	ENST00000399503.3:c.689C>T	5.37:g.56155597C>T	ENSP00000382423:p.Ala230Val	Somatic	222	0		WXS	Illumina GAIIx	Phase_I	128	15	NM_005921	0	0	0	0	0		Missense_Mutation	SNP	ENST00000399503.3	37	CCDS43318.1	.	.	.	.	.	.	.	.	.	.	C	13.80	2.344109	0.41498	.	.	ENSG00000095015	ENST00000399503	T	0.68479	-0.33	5.72	5.72	0.89469	.	0.776287	0.12398	N	0.472368	T	0.53449	0.1797	N	0.19112	0.55	0.33365	D	0.572781	B	0.15141	0.012	B	0.15870	0.014	T	0.55101	-0.8193	10	0.30854	T	0.27	.	13.9068	0.63841	0.0:0.9214:0.0:0.0786	.	230	Q13233	M3K1_HUMAN	V	230	ENSP00000382423:A230V	ENSP00000382423:A230V	A	+	2	0	MAP3K1	56191354	0.979000	0.34478	0.441000	0.26858	0.422000	0.31414	2.902000	0.48703	2.865000	0.98341	0.655000	0.94253	GCT	.		0.448	MAP3K1-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000132309.2	XM_042066	
RASGRF2	5924	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	5	80409739	80409739	+	Splice_Site	SNP	G	G	T			TCGA-OR-A5L2-01A-11D-A30A-10	TCGA-OR-A5L2-10A-01D-A30A-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b99bd79e-aa33-4896-8d10-2517c793f439	48e26b1d-b84d-432b-940b-9907c81ddf5b	g.chr5:80409739G>T	ENST00000265080.4	+	15	2537	c.2470G>T	c.(2470-2472)Gca>Tca	p.A824S	CTD-2193P3.2_ENST00000508993.1_RNA	NM_006909.2	NP_008840.1	O14827	RGRF2_HUMAN	Ras protein-specific guanine nucleotide-releasing factor 2	824					apoptotic signaling pathway (GO:0097190)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|synaptic transmission (GO:0007268)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|plasma membrane (GO:0005886)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)			biliary_tract(1)|breast(5)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(15)|lung(28)|ovary(5)|prostate(3)|skin(4)|soft_tissue(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	75		Lung NSC(167;0.00498)|all_lung(232;0.00531)|Ovarian(174;0.0357)		OV - Ovarian serous cystadenocarcinoma(54;4.22e-42)|Epithelial(54;4.04e-35)|all cancers(79;2.52e-29)		TATTCAAAAAGGTATTATCTA	0.468																																					p.A824S		.											.	RASGRF2-725	0			c.G2470T						.						58.0	58.0	58.0					5																	80409739		2203	4300	6503	SO:0001630	splice_region_variant	5924	exon15			CAAAAAGGTATTA	AF023130	CCDS4052.1	5q13	2013-01-10			ENSG00000113319	ENSG00000113319		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	9876	protein-coding gene	gene with protein product		606614					Standard	NM_006909		Approved	GRF2, Ras-GRF2	uc003kha.2	O14827	OTTHUMG00000119015	ENST00000265080.4:c.2470+1G>T	5.37:g.80409739G>T		Somatic	55	0		WXS	Illumina GAIIx	Phase_I	42	14	NM_006909	0	0	0	0	0	B9EG89|Q9UK56	Missense_Mutation	SNP	ENST00000265080.4	37	CCDS4052.1	.	.	.	.	.	.	.	.	.	.	G	0.018	-1.470747	0.01044	.	.	ENSG00000113319	ENST00000265080	T	0.73575	-0.76	4.94	4.04	0.47022	Ras guanine nucleotide exchange factor, domain (1);Ras-like guanine nucleotide exchange factor, N-terminal (1);	1.547490	0.03535	N	0.222956	T	0.67069	0.2854	L	0.37630	1.12	0.48975	D	0.999733	B	0.15141	0.012	B	0.12156	0.007	T	0.42716	-0.9435	10	0.05620	T	0.96	.	13.876	0.63653	0.0:0.0:0.8412:0.1588	.	824	O14827	RGRF2_HUMAN	S	824	ENSP00000265080:A824S	ENSP00000265080:A824S	A	+	1	0	RASGRF2	80445495	1.000000	0.71417	0.969000	0.41365	0.010000	0.07245	3.690000	0.54713	1.026000	0.39733	0.644000	0.83932	GCA	.		0.468	RASGRF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000239215.2	NM_006909	Missense_Mutation
RGMB	285704	hgsc.bcm.edu	37	5	98109838	98109838	+	Missense_Mutation	SNP	A	A	C	rs2662263	byFrequency	TCGA-OR-A5L2-01A-11D-A30A-10	TCGA-OR-A5L2-10A-01D-A30A-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b99bd79e-aa33-4896-8d10-2517c793f439	48e26b1d-b84d-432b-940b-9907c81ddf5b	g.chr5:98109838A>C	ENST00000513185.1	+	1	500	c.64A>C	c.(64-66)Agc>Cgc	p.S22R	RGMB_ENST00000308234.7_Missense_Mutation_p.S63R|RGMB-AS1_ENST00000515003.1_RNA|RGMB-AS1_ENST00000505362.1_RNA|RGMB-AS1_ENST00000505677.1_RNA|RGMB-AS1_ENST00000498871.2_RNA|RGMB_ENST00000504776.1_3'UTR|RGMB-AS1_ENST00000501938.2_RNA			Q6NW40	RGMB_HUMAN	repulsive guidance molecule family member b	22				S -> R (in Ref. 3; AAH67736). {ECO:0000305}.	axon guidance (GO:0007411)|BMP signaling pathway (GO:0030509)|cell adhesion (GO:0007155)|positive regulation of transcription, DNA-templated (GO:0045893)|signal transduction (GO:0007165)	anchored component of plasma membrane (GO:0046658)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)	identical protein binding (GO:0042802)			haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(2)|upper_aerodigestive_tract(1)	10		all_cancers(142;2.76e-08)|all_epithelial(76;2.98e-11)|all_lung(232;0.000485)|Lung NSC(167;0.000693)|Prostate(80;0.000986)|Ovarian(225;0.024)|Colorectal(57;0.117)		COAD - Colon adenocarcinoma(37;0.0587)		gcagcgccgcagccccgggct	0.741													C|||	4970	0.992412	1.0	0.9885	5008	,	,		8183	1.0		0.9791	False		,,,				2504	0.9908				p.S63R		.											.	.	0			c.A187C						.						1.0	1.0	1.0					5																	98109838		379	926	1305	SO:0001583	missense	285704	exon3			CGCCGCAGCCCCG	AK074887	CCDS47251.1	5q21.1	2013-11-06	2013-11-06		ENSG00000174136	ENSG00000174136			26896	protein-coding gene	gene with protein product		612687	"""RGM domain family, member B"""			19324014	Standard	NM_001012761		Approved	FLJ90406, DRAGON	uc003knc.3	Q6NW40	OTTHUMG00000162745	ENST00000513185.1:c.64A>C	5.37:g.98109838A>C	ENSP00000423256:p.Ser22Arg	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	4	4	NM_001012761	0	0	0	0	0	D6R9A0|Q8NC92	Missense_Mutation	SNP	ENST00000513185.1	37		2084	0.9542124542124543	469	0.9532520325203252	342	0.9447513812154696	557	0.9737762237762237	716	0.9445910290237467	C	10.21	1.287484	0.23478	.	.	ENSG00000174136	ENST00000308234;ENST00000513185	D;D	0.93019	-3.14;-3.15	4.16	2.33	0.28932	.	.	.	.	.	T	0.00012	0.0000	N	0.01576	-0.805	0.58432	P	6.999999999979245E-6	B	0.02656	0.0	B	0.01281	0.0	T	0.34976	-0.9807	8	0.11794	T	0.64	-0.2125	4.3815	0.11297	0.1608:0.5981:0.1551:0.0861	rs2662263;rs61109719	22	Q6NW40	RGMB_HUMAN	R	63;22	ENSP00000308219:S63R;ENSP00000423256:S22R	ENSP00000308219:S63R	S	+	1	0	RGMB	98137738	0.902000	0.30710	0.372000	0.25991	0.345000	0.29048	0.380000	0.20602	0.144000	0.18951	-0.371000	0.07208	AGC	T|0.046;G|0.950		0.741	RGMB-003	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000370308.1	NM_173670	
SOWAHA	134548	hgsc.bcm.edu	37	5	132149684	132149684	+	Missense_Mutation	SNP	G	G	C	rs40274	byFrequency	TCGA-OR-A5L2-01A-11D-A30A-10	TCGA-OR-A5L2-10A-01D-A30A-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b99bd79e-aa33-4896-8d10-2517c793f439	48e26b1d-b84d-432b-940b-9907c81ddf5b	g.chr5:132149684G>C	ENST00000378693.2	+	1	652	c.371G>C	c.(370-372)cGg>cCg	p.R124P		NM_175873.4	NP_787069.3	Q2M3V2	SWAHA_HUMAN	sosondowah ankyrin repeat domain family member A	124	Pro-rich.		R -> P (in dbSNP:rs40274).														CCCTTGGTCCGGGTGCCGCGG	0.776																																					p.R124P		.											.	.	0			c.G371C						.	C	PRO/ARG	2599,13		1293,13,0	2.0	3.0	3.0		371	-0.3	0.0	5	dbSNP_76	3	6177,193		2993,191,1	no	missense	ANKRD43	NM_175873.4	103	4286,204,1	CC,CG,GG		3.0298,0.4977,2.2935	benign	124/550	132149684	8776,206	1306	3185	4491	SO:0001583	missense	134548	exon1			TGGTCCGGGTGCC	AK090823	CCDS43361.1	5q23.3	2013-01-10	2012-01-12	2012-01-12	ENSG00000198944	ENSG00000198944		"""Ankyrin repeat domain containing"""	27033	protein-coding gene	gene with protein product			"""ankyrin repeat domain 43"""	ANKRD43		22234889	Standard	NM_175873		Approved		uc003kxw.3	Q2M3V2	OTTHUMG00000059844	ENST00000378693.2:c.371G>C	5.37:g.132149684G>C	ENSP00000367965:p.Arg124Pro	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	10	10	NM_175873	0	0	0	0	0	Q8NAE7	Missense_Mutation	SNP	ENST00000378693.2	37	CCDS43361.1	2142	0.9807692307692307	482	0.9796747967479674	357	0.9861878453038674	562	0.9825174825174825	741	0.9775725593667546	c	9.833	1.188835	0.21954	0.995023	0.969702	ENSG00000198944	ENST00000378693	T	0.38077	1.16	4.27	-0.265	0.12946	.	2.345400	0.02245	N	0.066177	T	0.00012	0.0000	N	0.08118	0	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.36261	-0.9755	9	0.30078	T	0.28	-5.2019	3.6102	0.08057	0.2245:0.4439:0.2467:0.085	rs40274	124	Q2M3V2	ANR43_HUMAN	P	124	ENSP00000367965:R124P	ENSP00000367965:R124P	R	+	2	0	ANKRD43	132177583	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-1.768000	0.01794	-0.003000	0.14444	-3.153000	0.00058	CGG	G|0.980;C|0.020		0.776	SOWAHA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000133062.1	NM_175873	
AFF4	27125	hgsc.bcm.edu	37	5	132232343	132232343	+	Missense_Mutation	SNP	G	G	T			TCGA-OR-A5L2-01A-11D-A30A-10	TCGA-OR-A5L2-10A-01D-A30A-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b99bd79e-aa33-4896-8d10-2517c793f439	48e26b1d-b84d-432b-940b-9907c81ddf5b	g.chr5:132232343G>T	ENST00000265343.5	-	11	2358	c.1979C>A	c.(1978-1980)cCt>cAt	p.P660H	AFF4_ENST00000378595.3_Missense_Mutation_p.P660H	NM_014423.3	NP_055238.1	Q9UHB7	AFF4_HUMAN	AF4/FMR2 family, member 4	660					spermatid development (GO:0007286)|transcription from RNA polymerase II promoter (GO:0006366)	mitochondrion (GO:0005739)|nucleolus (GO:0005730)|nucleus (GO:0005634)|transcription elongation factor complex (GO:0008023)|transcriptionally active chromatin (GO:0035327)	sequence-specific DNA binding transcription factor activity (GO:0003700)		SEPT8/AFF4(2)	breast(2)|central_nervous_system(2)|endometrium(6)|kidney(6)|large_intestine(7)|lung(11)|ovary(3)|pancreas(1)|prostate(3)|skin(2)	43		all_cancers(142;0.145)|Breast(839;0.198)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)			TGAGGAAGGAGGAAGGCTCTC	0.413																																					p.P660H	Ovarian(126;889 1733 2942 10745 11605)	.											.	AFF4-229	0			c.C1979A						.						74.0	71.0	72.0					5																	132232343		2203	4300	6503	SO:0001583	missense	27125	exon11			GAAGGAGGAAGGC	AF197927	CCDS4164.1	5q31	2006-04-28			ENSG00000072364	ENSG00000072364			17869	protein-coding gene	gene with protein product	"""ALL1 fused gene from 5q31"""	604417				10588740	Standard	XM_005271963		Approved	AF5Q31, MCEF	uc003kyd.3	Q9UHB7	OTTHUMG00000059838	ENST00000265343.5:c.1979C>A	5.37:g.132232343G>T	ENSP00000265343:p.Pro660His	Somatic	120	0		WXS	Illumina GAIIx	Phase_I	80	4	NM_014423	0	0	0	0	0	B2RP19|B7WPD2|Q498B2|Q59FB3|Q6P592|Q8TDR1|Q9P0E4	Missense_Mutation	SNP	ENST00000265343.5	37	CCDS4164.1	.	.	.	.	.	.	.	.	.	.	G	18.91	3.723593	0.68959	.	.	ENSG00000072364	ENST00000265343;ENST00000378595	T;T	0.69175	-0.38;-0.38	5.24	3.42	0.39159	.	0.161988	0.56097	D	0.000034	T	0.74974	0.3787	M	0.65498	2.005	0.54753	D	0.999984	D;D	0.64830	0.994;0.97	P;P	0.58873	0.847;0.797	T	0.76637	-0.2886	10	0.51188	T	0.08	-11.5536	12.2238	0.54449	0.1458:0.0:0.8542:0.0	.	660;660	Q9UHB7-2;Q9UHB7	.;AFF4_HUMAN	H	660	ENSP00000265343:P660H;ENSP00000367858:P660H	ENSP00000265343:P660H	P	-	2	0	AFF4	132260242	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.235000	0.78143	1.322000	0.45245	0.563000	0.77884	CCT	.		0.413	AFF4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000133049.1	NM_014423	
HARS2	23438	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	140075331	140075331	+	Silent	SNP	C	C	T			TCGA-OR-A5L2-01A-11D-A30A-10	TCGA-OR-A5L2-10A-01D-A30A-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b99bd79e-aa33-4896-8d10-2517c793f439	48e26b1d-b84d-432b-940b-9907c81ddf5b	g.chr5:140075331C>T	ENST00000230771.3	+	6	757	c.534C>T	c.(532-534)gaC>gaT	p.D178D	HARS2_ENST00000435019.2_Silent_p.D138D|HARS2_ENST00000437649.2_Silent_p.D104D|HARS2_ENST00000432671.2_Silent_p.D64D|HARS2_ENST00000508522.1_Silent_p.D153D|HARS2_ENST00000448069.2_Silent_p.D39D	NM_012208.2	NP_036340.1	P49590	SYHM_HUMAN	histidyl-tRNA synthetase 2, mitochondrial	178					gene expression (GO:0010467)|histidyl-tRNA aminoacylation (GO:0006427)|translation (GO:0006412)|tRNA aminoacylation for protein translation (GO:0006418)	mitochondrial matrix (GO:0005759)	ATP binding (GO:0005524)|histidine-tRNA ligase activity (GO:0004821)|poly(A) RNA binding (GO:0044822)			NS(1)|endometrium(3)|large_intestine(5)|lung(10)	19			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			AGGATTTTGACATTGCTGGTC	0.433																																					p.D178D		.											.	HARS2-90	0			c.C534T						.						180.0	169.0	173.0					5																	140075331		2203	4300	6503	SO:0001819	synonymous_variant	23438	exon6			TTTTGACATTGCT	U18937	CCDS4238.1, CCDS64267.1	5q31.3	2012-07-20	2012-07-20	2007-02-23	ENSG00000112855	ENSG00000112855	6.1.1.21	"""Aminoacyl tRNA synthetases / Class II"""	4817	protein-coding gene	gene with protein product	"""histidine tRNA ligase 2, mitochondrial (putative)"""	600783	"""histidyl-tRNA synthetase-like"""	HARSL		7755634, 21464306	Standard	NM_012208		Approved	HO3, HARSR	uc003lgx.3	P49590	OTTHUMG00000129500	ENST00000230771.3:c.534C>T	5.37:g.140075331C>T		Somatic	190	0		WXS	Illumina GAIIx	Phase_I	148	22	NM_012208	0	0	0	0	0	B4DDY8	Silent	SNP	ENST00000230771.3	37	CCDS4238.1																																																																																			.		0.433	HARS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251670.2	NM_012208	
PCDHB10	56126	hgsc.bcm.edu	37	5	140573844	140573844	+	Silent	SNP	C	C	T			TCGA-OR-A5L2-01A-11D-A30A-10	TCGA-OR-A5L2-10A-01D-A30A-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b99bd79e-aa33-4896-8d10-2517c793f439	48e26b1d-b84d-432b-940b-9907c81ddf5b	g.chr5:140573844C>T	ENST00000239446.4	+	1	1903	c.1719C>T	c.(1717-1719)acC>acT	p.T573T		NM_018930.3	NP_061753.1	Q9UN67	PCDBA_HUMAN	protocadherin beta 10	573	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|homophilic cell adhesion (GO:0007156)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(14)|lung(30)|ovary(4)|prostate(5)|skin(3)|upper_aerodigestive_tract(4)|urinary_tract(2)	76			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			CGCCCTGCACCGAGCTGGTGC	0.711																																					p.T573T		.											.	PCDHB10-92	0			c.C1719T						.						7.0	10.0	9.0					5																	140573844		1626	3527	5153	SO:0001819	synonymous_variant	56126	exon1			CTGCACCGAGCTG	AF152489	CCDS4252.1	5q31.3	2010-06-15			ENSG00000120324	ENSG00000120324		"""Cadherins / Protocadherins : Clustered"""	8681	other	protocadherin		606336				10380929	Standard	NM_018930		Approved		uc003lix.3	Q9UN67	OTTHUMG00000129626	ENST00000239446.4:c.1719C>T	5.37:g.140573844C>T		Somatic	3	0		WXS	Illumina GAIIx	Phase_I	92	27	NM_018930	0	0	0	0	0	Q96T99	Silent	SNP	ENST00000239446.4	37	CCDS4252.1																																																																																			.		0.711	PCDHB10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251821.1	NM_018930	
PCDHGB7	56099	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	5	140797965	140797965	+	Missense_Mutation	SNP	T	T	C			TCGA-OR-A5L2-01A-11D-A30A-10	TCGA-OR-A5L2-10A-01D-A30A-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b99bd79e-aa33-4896-8d10-2517c793f439	48e26b1d-b84d-432b-940b-9907c81ddf5b	g.chr5:140797965T>C	ENST00000398594.2	+	1	539	c.539T>C	c.(538-540)tTg>tCg	p.L180S	PCDHGB3_ENST00000576222.1_Intron|PCDHGA6_ENST00000517434.1_Intron|PCDHGA7_ENST00000518325.1_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGB1_ENST00000523390.1_Intron|PCDHGB2_ENST00000522605.1_Intron|PCDHGA10_ENST00000398610.2_Intron|PCDHGA9_ENST00000573521.1_Intron|PCDHGB6_ENST00000520790.1_Intron|PCDHGA4_ENST00000571252.1_Intron|PCDHGA5_ENST00000518069.1_Intron|PCDHGA11_ENST00000398587.2_5'Flank|PCDHGA8_ENST00000398604.2_Intron|PCDHGA3_ENST00000253812.6_Intron|PCDHGA11_ENST00000518882.1_5'Flank|PCDHGB4_ENST00000519479.1_Intron	NM_018927.3	NP_061750.1	Q9Y5F8	PCDGJ_HUMAN	protocadherin gamma subfamily B, 7	180	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			central_nervous_system(2)|endometrium(9)|kidney(6)|large_intestine(13)|lung(15)|ovary(4)|prostate(3)|stomach(1)|upper_aerodigestive_tract(3)	56			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TATTTCTCATTGGTGGAGAAA	0.448																																					p.L180S		.											.	PCDHGB7-29	0			c.T539C						.						64.0	63.0	63.0					5																	140797965		1882	4118	6000	SO:0001583	missense	56099	exon1			TCTCATTGGTGGA	AF152523	CCDS47293.1, CCDS75344.1	5q31	2010-01-26			ENSG00000254122	ENSG00000254122		"""Cadherins / Protocadherins : Clustered"""	8714	other	protocadherin	"""cadherin ME6"""	606304				10380929	Standard	NM_032101		Approved	ME6, PCDH-GAMMA-B7		Q9Y5F8	OTTHUMG00000164054	ENST00000398594.2:c.539T>C	5.37:g.140797965T>C	ENSP00000381594:p.Leu180Ser	Somatic	122	0		WXS	Illumina GAIIx	Phase_I	122	12	NM_018927	0	0	0	0	0	Q9UN63	Missense_Mutation	SNP	ENST00000398594.2	37	CCDS47293.1	.	.	.	.	.	.	.	.	.	.	t	21.5	4.159621	0.78226	.	.	ENSG00000254122	ENST00000398594	T	0.55413	0.52	5.93	5.93	0.95920	Cadherin (4);Cadherin-like (1);	0.000000	0.23243	U	0.050330	T	0.79040	0.4379	H	0.98089	4.145	0.31400	N	0.676813	P;D	0.55172	0.935;0.97	P;P	0.53518	0.728;0.721	D	0.87165	0.2217	10	0.87932	D	0	.	16.0678	0.80897	0.0:0.0:0.0:1.0	.	180;180	Q9Y5F8;Q9Y5F8-2	PCDGJ_HUMAN;.	S	180	ENSP00000381594:L180S	ENSP00000381594:L180S	L	+	2	0	PCDHGB7	140778149	0.980000	0.34600	0.991000	0.47740	0.983000	0.72400	7.915000	0.87484	2.281000	0.76405	0.533000	0.62120	TTG	.		0.448	PCDHGB7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376973.1	NM_018927	
FLT4	2324	broad.mit.edu;bcgsc.ca	37	5	180046752	180046752	+	Missense_Mutation	SNP	C	C	T	rs144045237		TCGA-OR-A5L2-01A-11D-A30A-10	TCGA-OR-A5L2-10A-01D-A30A-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b99bd79e-aa33-4896-8d10-2517c793f439	48e26b1d-b84d-432b-940b-9907c81ddf5b	g.chr5:180046752C>T	ENST00000261937.6	-	18	2638	c.2560G>A	c.(2560-2562)Ggc>Agc	p.G854S	FLT4_ENST00000393347.3_Missense_Mutation_p.G854S|FLT4_ENST00000424276.2_5'Flank|FLT4_ENST00000502649.1_Missense_Mutation_p.G854S	NM_182925.4	NP_891555.2	P35916	VGFR3_HUMAN	fms-related tyrosine kinase 4	854	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				blood vessel morphogenesis (GO:0048514)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|lymph vessel development (GO:0001945)|lymphangiogenesis (GO:0001946)|negative regulation of apoptotic process (GO:0043066)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of cell proliferation (GO:0008284)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of JNK cascade (GO:0046330)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of protein kinase C signaling (GO:0090037)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation vascular endothelial growth factor production (GO:0010575)|protein autophosphorylation (GO:0046777)|regulation of blood vessel remodeling (GO:0060312)|sprouting angiogenesis (GO:0002040)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)|vascular endothelial growth factor signaling pathway (GO:0038084)|vasculature development (GO:0001944)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|growth factor binding (GO:0019838)|protein phosphatase binding (GO:0019903)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)|vascular endothelial growth factor-activated receptor activity (GO:0005021)			NS(1)|breast(3)|central_nervous_system(2)|endometrium(1)|kidney(6)|large_intestine(5)|liver(2)|lung(37)|ovary(6)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	71	all_cancers(89;2.21e-05)|all_epithelial(37;5.29e-06)|Renal(175;0.000159)|Lung NSC(126;0.00199)|all_lung(126;0.00351)|Breast(19;0.114)	all_cancers(40;0.00245)|Medulloblastoma(196;0.0133)|all_neural(177;0.0199)|all_hematologic(541;0.163)|Ovarian(839;0.238)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	all cancers(165;0.134)	Axitinib(DB06626)|Pazopanib(DB06589)|Regorafenib(DB08896)|Sorafenib(DB00398)|Sunitinib(DB01268)	CCGAAGGCGCCGTAGCCGAGC	0.667																																					p.G854S	Colon(97;1075 1466 27033 27547 35871)	.											.	FLT4-1490	0			c.G2560A	GRCh37	CM032227|CM078058	FLT4	M	rs144045237	.						47.0	50.0	49.0					5																	180046752		2202	4297	6499	SO:0001583	missense	2324	exon18			AGGCGCCGTAGCC	X68203	CCDS4457.1, CCDS43412.1	5q34-q35	2013-01-29			ENSG00000037280	ENSG00000037280	2.7.10.1	"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	3767	protein-coding gene	gene with protein product		136352				1319394	Standard	NM_002020		Approved	VEGFR3, PCL	uc003mlz.4	P35916	OTTHUMG00000130931	ENST00000261937.6:c.2560G>A	5.37:g.180046752C>T	ENSP00000261937:p.Gly854Ser	Somatic	187	1		WXS	Illumina GAIIx	Phase_I	242	15	NM_182925	0	0	0	0	0	A8K6L4|B5A926|Q16067|Q86W07|Q86W08	Missense_Mutation	SNP	ENST00000261937.6	37	CCDS4457.1	.	.	.	.	.	.	.	.	.	.	C	25.1	4.604820	0.87157	.	.	ENSG00000037280	ENST00000261937;ENST00000393347;ENST00000502649;ENST00000376868	D;D;D	0.99353	-5.77;-5.77;-5.77	4.28	4.28	0.50868	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	.	.	.	.	D	0.99536	0.9834	M	0.92738	3.34	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	D	0.97962	1.0338	9	0.87932	D	0	.	17.2749	0.87112	0.0:1.0:0.0:0.0	.	664;854;854	E9PFB0;E9PD35;P35916	.;.;VGFR3_HUMAN	S	854;854;854;664	ENSP00000261937:G854S;ENSP00000377016:G854S;ENSP00000426057:G854S	ENSP00000261937:G854S	G	-	1	0	FLT4	179979358	1.000000	0.71417	0.971000	0.41717	0.519000	0.34347	7.645000	0.83430	2.379000	0.81126	0.563000	0.77884	GGC	.		0.667	FLT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253527.4		
OR2Y1	134083	bcgsc.ca	37	5	180166250	180166250	+	Missense_Mutation	SNP	C	C	A			TCGA-OR-A5L2-01A-11D-A30A-10	TCGA-OR-A5L2-10A-01D-A30A-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b99bd79e-aa33-4896-8d10-2517c793f439	48e26b1d-b84d-432b-940b-9907c81ddf5b	g.chr5:180166250C>A	ENST00000307832.2	-	1	849	c.809G>T	c.(808-810)gGa>gTa	p.G270V		NM_001001657.1	NP_001001657.1	Q8NGV0	OR2Y1_HUMAN	olfactory receptor, family 2, subfamily Y, member 1	270						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(3)|lung(9)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	20	all_cancers(89;1.25e-05)|all_epithelial(37;4.36e-06)|Renal(175;0.000159)|Lung NSC(126;0.00317)|all_lung(126;0.0041)|Breast(19;0.114)	all_cancers(40;0.0834)|Medulloblastoma(196;0.0392)|all_neural(177;0.0529)|all_hematologic(541;0.191)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			AACAAATTTTCCCTCACGCTC	0.413																																					p.G270V		.											.	OR2Y1-68	0			c.G809T						.						87.0	100.0	96.0					5																	180166250		2203	4300	6503	SO:0001583	missense	134083	exon1			AATTTTCCCTCAC	AB065676	CCDS34323.1	5q35	2012-08-09			ENSG00000174339	ENSG00000174339		"""GPCR / Class A : Olfactory receptors"""	14837	protein-coding gene	gene with protein product							Standard	NM_001001657		Approved		uc003mmf.1	Q8NGV0	OTTHUMG00000162237	ENST00000307832.2:c.809G>T	5.37:g.180166250C>A	ENSP00000312403:p.Gly270Val	Somatic	44	1		WXS	Illumina GAIIx	Phase_I	33	9	NM_001001657	0	0	0	0	0	B9EIP1|Q6IFB1|Q96R16	Missense_Mutation	SNP	ENST00000307832.2	37	CCDS34323.1	.	.	.	.	.	.	.	.	.	.	c	13.08	2.130370	0.37630	.	.	ENSG00000174339	ENST00000307832	T	0.00107	8.72	4.41	3.54	0.40534	GPCR, rhodopsin-like superfamily (1);	0.000000	0.44483	D	0.000455	T	0.00384	0.0012	M	0.78916	2.43	0.20563	N	0.999888	D	0.89917	1.0	D	0.97110	1.0	T	0.37934	-0.9684	10	0.87932	D	0	.	7.0309	0.24967	0.0:0.7947:0.0:0.2053	.	270	Q8NGV0	OR2Y1_HUMAN	V	270	ENSP00000312403:G270V	ENSP00000312403:G270V	G	-	2	0	OR2Y1	180098856	0.000000	0.05858	0.008000	0.14137	0.005000	0.04900	-0.071000	0.11505	1.197000	0.43143	0.511000	0.50034	GGA	.		0.413	OR2Y1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000368059.2	XM_068682	
TXNDC5	81567	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	7904880	7904880	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5L2-01A-11D-A30A-10	TCGA-OR-A5L2-10A-01D-A30A-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b99bd79e-aa33-4896-8d10-2517c793f439	48e26b1d-b84d-432b-940b-9907c81ddf5b	g.chr6:7904880C>T	ENST00000379757.4	-	2	377	c.340G>A	c.(340-342)Gtc>Atc	p.V114I	BLOC1S5-TXNDC5_ENST00000439343.2_3'UTR|TXNDC5_ENST00000473453.1_Missense_Mutation_p.V6I|TXNDC5_ENST00000539054.1_Missense_Mutation_p.V42I	NM_030810.3	NP_110437.2	Q8NBS9	TXND5_HUMAN	thioredoxin domain containing 5 (endoplasmic reticulum)	114	Thioredoxin 1. {ECO:0000255|PROSITE- ProRule:PRU00691}.				apoptotic cell clearance (GO:0043277)|cell redox homeostasis (GO:0045454)|membrane organization (GO:0061024)|negative regulation of apoptotic process (GO:0043066)|post-Golgi vesicle-mediated transport (GO:0006892)|protein folding (GO:0006457)|response to endoplasmic reticulum stress (GO:0034976)	endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|lysosomal lumen (GO:0043202)	protein disulfide isomerase activity (GO:0003756)			breast(1)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(5)|lung(6)|prostate(1)|skin(2)	22	Ovarian(93;0.0398)					GCCACATAGACTTTGGCATCT	0.572																																					p.V114I	Ovarian(119;1430 1625 3928 26125 34589)	.											.	TXNDC5-90	0			c.G340A						.						197.0	145.0	163.0					6																	7904880		2203	4300	6503	SO:0001583	missense	81567	exon2			CATAGACTTTGGC	AK025006	CCDS4505.1, CCDS47369.1	6p24.3	2011-10-19	2009-02-23		ENSG00000239264	ENSG00000239264		"""Protein disulfide isomerases"""	21073	protein-coding gene	gene with protein product	"""protein disulfide isomerase family A, member 15"""		"""thioredoxin domain containing 5"""				Standard	NM_001145549		Approved	MGC3178, FLJ21353, FLJ90810, EndoPDI, Hcc-2, ERp46, PDIA15	uc003mxv.3	Q8NBS9	OTTHUMG00000014216	ENST00000379757.4:c.340G>A	6.37:g.7904880C>T	ENSP00000369081:p.Val114Ile	Somatic	86	0		WXS	Illumina GAIIx	Phase_I	76	13	NM_030810	0	0	0	0	0	B2RDM2|Q5TCQ0|Q8ND33|Q8TCT2|Q9BVH9	Missense_Mutation	SNP	ENST00000379757.4	37	CCDS4505.1	.	.	.	.	.	.	.	.	.	.	.	17.36	3.369351	0.61624	.	.	ENSG00000239264	ENST00000539054;ENST00000379757;ENST00000473453	T;T;T	0.03920	3.76;3.76;3.76	5.18	5.18	0.71444	Thioredoxin domain (1);Thioredoxin-like fold (3);	0.187222	0.46442	D	0.000293	T	0.03011	0.0089	L	0.31845	0.965	0.47584	D	0.999467	B;B	0.25351	0.011;0.124	B;B	0.33121	0.077;0.158	T	0.50233	-0.8852	10	0.35671	T	0.21	.	17.459	0.87615	0.0:1.0:0.0:0.0	.	42;114	Q86UY0;Q8NBS9	.;TXND5_HUMAN	I	42;114;6	ENSP00000442453:V42I;ENSP00000369081:V114I;ENSP00000420784:V6I	ENSP00000442453:V42I	V	-	1	0	TXNDC5	7849879	0.999000	0.42202	1.000000	0.80357	0.736000	0.42039	4.279000	0.58953	2.388000	0.81334	0.558000	0.71614	GTC	.		0.572	TXNDC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039792.1	NM_030810	
TRIM39	56658	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	6	30297383	30297383	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5L2-01A-11D-A30A-10	TCGA-OR-A5L2-10A-01D-A30A-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b99bd79e-aa33-4896-8d10-2517c793f439	48e26b1d-b84d-432b-940b-9907c81ddf5b	g.chr6:30297383G>A	ENST00000396547.1	+	2	449	c.289G>A	c.(289-291)Gtc>Atc	p.V97I	TRIM39-RPP21_ENST00000513556.1_Missense_Mutation_p.V9I|TRIM39_ENST00000396551.3_Missense_Mutation_p.V97I|TRIM39_ENST00000396548.1_Missense_Mutation_p.V97I|TRIM39_ENST00000376659.5_Missense_Mutation_p.V97I|HCG18_ENST00000426882.1_RNA|HCG18_ENST00000412685.2_RNA|TRIM39_ENST00000376656.4_Missense_Mutation_p.V97I|HCG18_ENST00000413358.2_RNA|TRIM39_ENST00000540416.1_Missense_Mutation_p.V97I			Q9HCM9	TRI39_HUMAN	tripartite motif containing 39	97					apoptotic process (GO:0006915)|negative regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000059)|positive regulation of apoptotic signaling pathway (GO:2001235)|protein ubiquitination (GO:0016567)	cytosol (GO:0005829)|mitochondrion (GO:0005739)	identical protein binding (GO:0042802)|ligase activity (GO:0016874)|zinc ion binding (GO:0008270)			ovary(3)	3						GCTCCAGGCCGTCAAGCGGAA	0.557																																					p.V97I		.											.	TRIM39-161	0			c.G289A						.						55.0	52.0	53.0					6																	30297383		1510	2707	4217	SO:0001583	missense	56658	exon3			CAGGCCGTCAAGC	BC034985	CCDS34377.1, CCDS34378.1	6p22.1	2013-01-09	2011-01-25	2002-06-07	ENSG00000204599	ENSG00000204599		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	10065	protein-coding gene	gene with protein product		605700	"""ring finger protein 23"", ""tripartite motif-containing 39"""	RNF23		11006080	Standard	NM_021253		Approved			Q9HCM9	OTTHUMG00000031066	ENST00000396547.1:c.289G>A	6.37:g.30297383G>A	ENSP00000379796:p.Val97Ile	Somatic	139	0		WXS	Illumina GAIIx	Phase_I	155	13	NM_021253	0	0	0	0	0	Q5STG3|Q5STG4|Q76BL3|Q8IYT9|Q96IB6	Missense_Mutation	SNP	ENST00000396547.1	37	CCDS34377.1	.	.	.	.	.	.	.	.	.	.	G	15.28	2.787415	0.49997	.	.	ENSG00000204599;ENSG00000204599;ENSG00000204599;ENSG00000204599;ENSG00000204599;ENSG00000204599;ENSG00000204599;ENSG00000204599;ENSG00000204599;ENSG00000204599;ENSG00000204599;ENSG00000248167	ENST00000458516;ENST00000396551;ENST00000376656;ENST00000545104;ENST00000540416;ENST00000449040;ENST00000412529;ENST00000428728;ENST00000396548;ENST00000376659;ENST00000396547;ENST00000513556	T;T;T;T;T;T;T;T;T	0.67345	-0.26;0.11;0.08;0.15;-0.17;0.11;0.11;0.08;0.99	5.23	4.35	0.52113	.	0.000000	0.42964	D	0.000632	T	0.32793	0.0841	L	0.34521	1.04	0.28472	N	0.915364	B;P;B	0.39311	0.048;0.667;0.177	B;B;B	0.27500	0.005;0.048;0.08	T	0.24764	-1.0151	10	0.37606	T	0.19	.	12.0746	0.53636	0.0854:0.0:0.9146:0.0	.	11;97;97	F5H2V3;Q9HCM9;Q9HCM9-2	.;TRI39_HUMAN;.	I	97;97;97;97;97;97;11;97;97;97;97;9	ENSP00000405928:V97I;ENSP00000379800:V97I;ENSP00000365844:V97I;ENSP00000439400:V97I;ENSP00000406019:V97I;ENSP00000379797:V97I;ENSP00000365847:V97I;ENSP00000379796:V97I;ENSP00000424048:V9I	ENSP00000365844:V97I	V	+	1	0	TRIM39-RPP21;TRIM39	30405362	0.823000	0.29233	0.940000	0.37924	0.732000	0.41865	2.477000	0.45180	2.719000	0.93026	0.555000	0.69702	GTC	.		0.557	TRIM39-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000076086.2	NM_172016	
SKIV2L	6499	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	31927812	31927812	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5L2-01A-11D-A30A-10	TCGA-OR-A5L2-10A-01D-A30A-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b99bd79e-aa33-4896-8d10-2517c793f439	48e26b1d-b84d-432b-940b-9907c81ddf5b	g.chr6:31927812C>T	ENST00000375394.2	+	3	265	c.152C>T	c.(151-153)gCc>gTc	p.A51V	NELFE_ENST00000375429.3_5'Flank|NELFE_ENST00000444811.2_5'Flank|SKIV2L_ENST00000488648.1_3'UTR|SKIV2L_ENST00000544581.1_Intron|NELFE_ENST00000375425.5_5'Flank	NM_006929.4	NP_008860.4	Q15477	SKIV2_HUMAN	superkiller viralicidic activity 2-like (S. cerevisiae)	51					ATP catabolic process (GO:0006200)	nucleus (GO:0005634)|Ski complex (GO:0055087)	ATP binding (GO:0005524)|ATP-dependent RNA helicase activity (GO:0004004)|RNA binding (GO:0003723)			breast(1)|central_nervous_system(1)|large_intestine(1)|ovary(1)	4						CCTCCTTGTGCCCCAGATCTG	0.532																																					p.A51V		.											.	SKIV2L-290	0			c.C152T						.						88.0	76.0	80.0					6																	31927812		1509	2709	4218	SO:0001583	missense	6499	exon3			CTTGTGCCCCAGA		CCDS4731.1	6p21	2010-02-17	2001-11-28		ENSG00000204351	ENSG00000204351			10898	protein-coding gene	gene with protein product		600478	"""superkiller viralicidic activity 2 (S. cerevisiae homolog)-like"""	SKIV2		7759100, 9799600	Standard	XM_006715168		Approved	HLP, DDX13, SKI2W, 170A	uc003nyn.1	Q15477	OTTHUMG00000031146	ENST00000375394.2:c.152C>T	6.37:g.31927812C>T	ENSP00000364543:p.Ala51Val	Somatic	81	0		WXS	Illumina GAIIx	Phase_I	75	11	NM_006929	0	0	0	0	0	O15005|Q12902|Q15476|Q5ST66	Missense_Mutation	SNP	ENST00000375394.2	37	CCDS4731.1	.	.	.	.	.	.	.	.	.	.	C	11.76	1.734632	0.30774	.	.	ENSG00000204351	ENST00000375394	T	0.41758	0.99	4.61	4.61	0.57282	.	0.241438	0.42172	D	0.000742	T	0.12860	0.0312	N	0.19112	0.55	0.80722	D	1	B	0.26744	0.158	B	0.22880	0.042	T	0.05616	-1.0874	10	0.10902	T	0.67	-20.5096	14.4976	0.67700	0.0:1.0:0.0:0.0	.	51	Q15477	SKIV2_HUMAN	V	51	ENSP00000364543:A51V	ENSP00000364543:A51V	A	+	2	0	SKIV2L	32035791	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	2.641000	0.46587	2.398000	0.81561	0.655000	0.94253	GCC	.		0.532	SKIV2L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076264.3		
SKIV2L	6499	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	31927815	31927815	+	Missense_Mutation	SNP	C	C	A			TCGA-OR-A5L2-01A-11D-A30A-10	TCGA-OR-A5L2-10A-01D-A30A-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b99bd79e-aa33-4896-8d10-2517c793f439	48e26b1d-b84d-432b-940b-9907c81ddf5b	g.chr6:31927815C>A	ENST00000375394.2	+	3	268	c.155C>A	c.(154-156)cCa>cAa	p.P52Q	NELFE_ENST00000375429.3_5'Flank|NELFE_ENST00000444811.2_5'Flank|SKIV2L_ENST00000488648.1_3'UTR|SKIV2L_ENST00000544581.1_Intron|NELFE_ENST00000375425.5_5'Flank	NM_006929.4	NP_008860.4	Q15477	SKIV2_HUMAN	superkiller viralicidic activity 2-like (S. cerevisiae)	52					ATP catabolic process (GO:0006200)	nucleus (GO:0005634)|Ski complex (GO:0055087)	ATP binding (GO:0005524)|ATP-dependent RNA helicase activity (GO:0004004)|RNA binding (GO:0003723)			breast(1)|central_nervous_system(1)|large_intestine(1)|ovary(1)	4						CCTTGTGCCCCAGATCTGCAG	0.542																																					p.P52Q		.											.	SKIV2L-290	0			c.C155A						.						88.0	76.0	81.0					6																	31927815		1509	2709	4218	SO:0001583	missense	6499	exon3			GTGCCCCAGATCT		CCDS4731.1	6p21	2010-02-17	2001-11-28		ENSG00000204351	ENSG00000204351			10898	protein-coding gene	gene with protein product		600478	"""superkiller viralicidic activity 2 (S. cerevisiae homolog)-like"""	SKIV2		7759100, 9799600	Standard	XM_006715168		Approved	HLP, DDX13, SKI2W, 170A	uc003nyn.1	Q15477	OTTHUMG00000031146	ENST00000375394.2:c.155C>A	6.37:g.31927815C>A	ENSP00000364543:p.Pro52Gln	Somatic	81	0		WXS	Illumina GAIIx	Phase_I	73	10	NM_006929	0	0	0	0	0	O15005|Q12902|Q15476|Q5ST66	Missense_Mutation	SNP	ENST00000375394.2	37	CCDS4731.1	.	.	.	.	.	.	.	.	.	.	C	12.15	1.852061	0.32699	.	.	ENSG00000204351	ENST00000375394	T	0.39787	1.06	4.61	4.61	0.57282	.	0.163492	0.43416	D	0.000580	T	0.20618	0.0496	L	0.41824	1.3	0.80722	D	1	P	0.52316	0.952	B	0.42692	0.395	T	0.01879	-1.1255	10	0.29301	T	0.29	-9.5492	10.1141	0.42581	0.1994:0.8006:0.0:0.0	.	52	Q15477	SKIV2_HUMAN	Q	52	ENSP00000364543:P52Q	ENSP00000364543:P52Q	P	+	2	0	SKIV2L	32035794	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	2.843000	0.48238	2.398000	0.81561	0.655000	0.94253	CCA	.		0.542	SKIV2L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076264.3		
SKIV2L	6499	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	31928995	31928995	+	Silent	SNP	A	A	G			TCGA-OR-A5L2-01A-11D-A30A-10	TCGA-OR-A5L2-10A-01D-A30A-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b99bd79e-aa33-4896-8d10-2517c793f439	48e26b1d-b84d-432b-940b-9907c81ddf5b	g.chr6:31928995A>G	ENST00000375394.2	+	8	734	c.621A>G	c.(619-621)ggA>ggG	p.G207G	NELFE_ENST00000375429.3_5'Flank|NELFE_ENST00000444811.2_5'Flank|SKIV2L_ENST00000488648.1_Intron|SKIV2L_ENST00000544581.1_Silent_p.G14G|NELFE_ENST00000375425.5_5'Flank	NM_006929.4	NP_008860.4	Q15477	SKIV2_HUMAN	superkiller viralicidic activity 2-like (S. cerevisiae)	207					ATP catabolic process (GO:0006200)	nucleus (GO:0005634)|Ski complex (GO:0055087)	ATP binding (GO:0005524)|ATP-dependent RNA helicase activity (GO:0004004)|RNA binding (GO:0003723)			breast(1)|central_nervous_system(1)|large_intestine(1)|ovary(1)	4						CAGCTCCTGGACTACTAAGCC	0.532																																					p.G207G		.											.	SKIV2L-290	0			c.A621G						.						65.0	63.0	64.0					6																	31928995		2203	4300	6503	SO:0001819	synonymous_variant	6499	exon8			TCCTGGACTACTA		CCDS4731.1	6p21	2010-02-17	2001-11-28		ENSG00000204351	ENSG00000204351			10898	protein-coding gene	gene with protein product		600478	"""superkiller viralicidic activity 2 (S. cerevisiae homolog)-like"""	SKIV2		7759100, 9799600	Standard	XM_006715168		Approved	HLP, DDX13, SKI2W, 170A	uc003nyn.1	Q15477	OTTHUMG00000031146	ENST00000375394.2:c.621A>G	6.37:g.31928995A>G		Somatic	133	0		WXS	Illumina GAIIx	Phase_I	147	15	NM_006929	0	0	0	0	0	O15005|Q12902|Q15476|Q5ST66	Silent	SNP	ENST00000375394.2	37	CCDS4731.1																																																																																			.		0.532	SKIV2L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076264.3		
HLA-DOB	3112	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	6	32782314	32782314	+	Silent	SNP	G	G	A			TCGA-OR-A5L2-01A-11D-A30A-10	TCGA-OR-A5L2-10A-01D-A30A-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b99bd79e-aa33-4896-8d10-2517c793f439	48e26b1d-b84d-432b-940b-9907c81ddf5b	g.chr6:32782314G>A	ENST00000438763.2	-	3	522	c.426C>T	c.(424-426)caC>caT	p.H142H	TAP2_ENST00000452392.2_Silent_p.H749H	NM_002120.3	NP_002111.1	P13765	DOB_HUMAN	major histocompatibility complex, class II, DO beta	142	Beta-2.|Ig-like C1-type.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|immune response (GO:0006955)|negative regulation of antigen processing and presentation of peptide antigen via MHC class II (GO:0002587)|signal transduction (GO:0007165)	endosome (GO:0005768)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|MHC class II protein complex (GO:0042613)	MHC class II protein complex binding (GO:0023026)|MHC class II receptor activity (GO:0032395)			endometrium(2)|large_intestine(1)|lung(2)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	9						TCACAGAGCAGTGCAGCAGAT	0.532																																					p.H142H		.											.	HLA-DOB-91	0			c.C426T						.						194.0	199.0	197.0					6																	32782314		1511	2709	4220	SO:0001819	synonymous_variant	3112	exon3			AGAGCAGTGCAGC		CCDS4754.1	6p21.3	2013-01-11			ENSG00000241106	ENSG00000241106		"""Histocompatibility complex"", ""Immunoglobulin superfamily / C1-set domain containing"""	4937	protein-coding gene	gene with protein product		600629					Standard	NM_002120		Approved			P13765	OTTHUMG00000031213	ENST00000438763.2:c.426C>T	6.37:g.32782314G>A		Somatic	134	0		WXS	Illumina GAIIx	Phase_I	137	18	NM_002120	0	0	0	0	0	B0V0Y0|Q29746|Q29825|Q6FHC2	Silent	SNP	ENST00000438763.2	37	CCDS4754.1																																																																																			.		0.532	HLA-DOB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076439.1	NM_002120	
NFYA	4800	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	41057410	41057410	+	Missense_Mutation	SNP	C	C	G			TCGA-OR-A5L2-01A-11D-A30A-10	TCGA-OR-A5L2-10A-01D-A30A-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b99bd79e-aa33-4896-8d10-2517c793f439	48e26b1d-b84d-432b-940b-9907c81ddf5b	g.chr6:41057410C>G	ENST00000341376.6	+	5	603	c.402C>G	c.(400-402)atC>atG	p.I134M	NFYA_ENST00000353205.5_Missense_Mutation_p.I105M|OARD1_ENST00000480585.1_Intron	NM_002505.4	NP_002496.1	P23511	NFYA_HUMAN	nuclear transcription factor Y, alpha	134	Gln-rich.				cellular lipid metabolic process (GO:0044255)|positive regulation of stem cell proliferation (GO:2000648)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of stem cell maintenance (GO:2000036)|regulation of transcription, DNA-templated (GO:0006355)|rhythmic process (GO:0048511)|small molecule metabolic process (GO:0044281)|transcription from RNA polymerase II promoter (GO:0006366)	CCAAT-binding factor complex (GO:0016602)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	core promoter sequence-specific DNA binding (GO:0001046)|DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			cervix(1)|endometrium(1)|large_intestine(4)|lung(2)|urinary_tract(1)	9	Ovarian(28;0.0418)|Colorectal(47;0.196)					AGATCATCATCCAGCAGCCCC	0.557																																					p.I134M		.											.	NFYA-226	0			c.C402G						.						62.0	61.0	61.0					6																	41057410		2203	4300	6503	SO:0001583	missense	4800	exon5			CATCATCCAGCAG		CCDS4849.1, CCDS4850.1	6p21.3	2008-11-11			ENSG00000001167	ENSG00000001167			7804	protein-coding gene	gene with protein product		189903				1774067, 9612081	Standard	NM_002505		Approved	HAP2, CBF-B, NF-YA	uc003opo.3	P23511	OTTHUMG00000014669	ENST00000341376.6:c.402C>G	6.37:g.41057410C>G	ENSP00000345702:p.Ile134Met	Somatic	178	0		WXS	Illumina GAIIx	Phase_I	233	33	NM_002505	0	0	0	0	0	Q8IXU0	Missense_Mutation	SNP	ENST00000341376.6	37	CCDS4849.1	.	.	.	.	.	.	.	.	.	.	C	14.50	2.554874	0.45487	.	.	ENSG00000001167	ENST00000341376;ENST00000353205	.	.	.	5.96	0.928	0.19443	.	0.000000	0.85682	D	0.000000	T	0.53190	0.1781	M	0.61703	1.905	0.45415	D	0.998394	D;P	0.54397	0.966;0.943	P;D	0.64321	0.844;0.924	T	0.54886	-0.8226	9	0.52906	T	0.07	-7.2861	5.2648	0.15593	0.2201:0.4914:0.0:0.2884	.	105;134	P23511-2;P23511	.;NFYA_HUMAN	M	134;105	.	ENSP00000345702:I134M	I	+	3	3	NFYA	41165388	0.959000	0.32827	1.000000	0.80357	0.985000	0.73830	0.146000	0.16180	0.417000	0.25871	0.650000	0.86243	ATC	.		0.557	NFYA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040496.1		
CNPY3	10695	broad.mit.edu	37	6	42897358	42897360	+	In_Frame_Del	DEL	TGC	TGC	-	rs570105218	byFrequency	TCGA-OR-A5L2-01A-11D-A30A-10	TCGA-OR-A5L2-10A-01D-A30A-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b99bd79e-aa33-4896-8d10-2517c793f439	48e26b1d-b84d-432b-940b-9907c81ddf5b	g.chr6:42897358_42897360delTGC	ENST00000372836.4	+	1	421_423	c.50_52delTGC	c.(49-54)ttgctg>ttg	p.17_18LL>L	CNPY3_ENST00000394142.3_In_Frame_Del_p.17_18LL>L	NM_006586.3	NP_006577.2	Q9BT09	CNPY3_HUMAN	canopy FGF signaling regulator 3	17					innate immune response (GO:0045087)|toll-like receptor signaling pathway (GO:0002224)	endoplasmic reticulum lumen (GO:0005788)		p.L25delL(1)		central_nervous_system(1)|endometrium(1)|lung(3)|ovary(1)	6	Colorectal(47;0.196)		all cancers(41;0.000954)|Colorectal(64;0.00237)|COAD - Colon adenocarcinoma(64;0.00473)|KIRC - Kidney renal clear cell carcinoma(15;0.02)|OV - Ovarian serous cystadenocarcinoma(102;0.0218)|Kidney(15;0.0388)			CTTCTTCCCTtgctgctgctgct	0.695																																					p.17_18del		.											.	CNPY3-69	1	Deletion - In frame(1)	central_nervous_system(1)	c.50_52del						.																																			SO:0001651	inframe_deletion	10695	exon1			TTCCCTTGCTGCT	U80744	CCDS4875.1	6p21.1	2013-09-19	2013-07-23	2007-10-22	ENSG00000137161	ENSG00000137161		"""Trinucleotide (CAG) repeat containing"""	11968	protein-coding gene	gene with protein product		610774	"""trinucleotide repeat containing 5"", ""canopy 3 homolog (zebrafish)"""	TNRC5		9225980	Standard	NM_006586		Approved	CAG4A	uc003ota.4	Q9BT09	OTTHUMG00000014708	ENST00000372836.4:c.50_52delTGC	6.37:g.42897367_42897369delTGC	ENSP00000361926:p.Leu25del	Somatic	34	0		WXS	Illumina GAIIx	Phase_I	85	9	NM_006586	0	0	0	0	0	O15412|Q0P6I2|Q8NF54|Q8WTU8|Q9P0F2	In_Frame_Del	DEL	ENST00000372836.4	37	CCDS4875.1																																																																																			.		0.695	CNPY3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040564.1	NM_006586	
CUL9	23113	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	43181477	43181477	+	Missense_Mutation	SNP	C	C	G			TCGA-OR-A5L2-01A-11D-A30A-10	TCGA-OR-A5L2-10A-01D-A30A-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b99bd79e-aa33-4896-8d10-2517c793f439	48e26b1d-b84d-432b-940b-9907c81ddf5b	g.chr6:43181477C>G	ENST00000252050.4	+	29	5599	c.5515C>G	c.(5515-5517)Ccc>Gcc	p.P1839A	CUL9_ENST00000372647.2_Intron|CUL9_ENST00000354495.3_Missense_Mutation_p.P1729A|RP3-330M21.5_ENST00000500590.1_RNA|CUL9_ENST00000502937.1_3'UTR	NM_015089.2	NP_055904.1	Q8IWT3	CUL9_HUMAN	cullin 9	1839				Missing (in Ref. 3; CAH18696). {ECO:0000305}.	microtubule cytoskeleton organization (GO:0000226)|protein ubiquitination (GO:0016567)|regulation of mitosis (GO:0007088)|ubiquitin-dependent protein catabolic process (GO:0006511)	cullin-RING ubiquitin ligase complex (GO:0031461)|cytoplasm (GO:0005737)	ATP binding (GO:0005524)|zinc ion binding (GO:0008270)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(18)|liver(1)|lung(30)|ovary(5)|prostate(3)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(4)	92						TGAGCCTGGGCCCCAGCGCAG	0.592																																					p.P1839A		.											.	CUL9-529	0			c.C5515G						.						61.0	64.0	63.0					6																	43181477		2203	4300	6503	SO:0001583	missense	23113	exon29			CCTGGGCCCCAGC	AB014608	CCDS4890.1	6p21.1	2011-05-24			ENSG00000112659	ENSG00000112659			15982	protein-coding gene	gene with protein product	"""parkin-like cytoplasmic p53 binding protein"", ""p53-associated parkin-like cytoplasmic protein"""	607489				17332328, 10521492, 12526791	Standard	NM_015089		Approved	H7AP1, KIAA0708, PARC	uc003ouk.3	Q8IWT3	OTTHUMG00000014723	ENST00000252050.4:c.5515C>G	6.37:g.43181477C>G	ENSP00000252050:p.Pro1839Ala	Somatic	52	1		WXS	Illumina GAIIx	Phase_I	69	37	NM_015089	0	0	0	0	0	O75188|Q5TCY3|Q68CP2|Q68D92|Q8N3W9|Q9BU56	Missense_Mutation	SNP	ENST00000252050.4	37	CCDS4890.1	.	.	.	.	.	.	.	.	.	.	C	2.076	-0.411885	0.04799	.	.	ENSG00000112659	ENST00000252050;ENST00000354495	T;T	0.71579	-0.58;-0.58	4.92	1.07	0.20283	.	2.825000	0.01417	N	0.014215	T	0.27866	0.0686	L	0.27053	0.805	0.09310	N	1	B;B	0.15719	0.014;0.002	B;B	0.11329	0.006;0.0	T	0.06499	-1.0823	10	0.11485	T	0.65	-1.1462	1.6369	0.02744	0.1318:0.3959:0.1464:0.3258	.	1729;1839	Q8IWT3-3;Q8IWT3	.;CUL9_HUMAN	A	1839;1729	ENSP00000252050:P1839A;ENSP00000346490:P1729A	ENSP00000252050:P1839A	P	+	1	0	CUL9	43289455	0.028000	0.19301	0.001000	0.08648	0.166000	0.22503	0.027000	0.13621	0.288000	0.22398	0.655000	0.94253	CCC	.		0.592	CUL9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040582.2	NM_015089	
PKHD1	5314	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	51890570	51890570	+	Silent	SNP	G	G	A	rs147584295	byFrequency	TCGA-OR-A5L2-01A-11D-A30A-10	TCGA-OR-A5L2-10A-01D-A30A-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b99bd79e-aa33-4896-8d10-2517c793f439	48e26b1d-b84d-432b-940b-9907c81ddf5b	g.chr6:51890570G>A	ENST00000371117.3	-	32	4313	c.4038C>T	c.(4036-4038)aaC>aaT	p.N1346N	PKHD1_ENST00000340994.4_Silent_p.N1346N	NM_138694.3	NP_619639.3	P08F94	PKHD1_HUMAN	polycystic kidney and hepatic disease 1 (autosomal recessive)	1346	IPT/TIG 8; atypical.				cellular calcium ion homeostasis (GO:0006874)|cilium assembly (GO:0042384)|homeostatic process (GO:0042592)|kidney development (GO:0001822)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cellular component movement (GO:0051271)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of protein kinase B signaling (GO:0051898)|positive regulation of cell proliferation (GO:0008284)|regulation of centrosome duplication (GO:0010824)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of TOR signaling (GO:0032006)|single organismal cell-cell adhesion (GO:0016337)	anchored component of external side of plasma membrane (GO:0031362)|apical plasma membrane (GO:0016324)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|mitotic spindle (GO:0072686)|perinuclear region of cytoplasm (GO:0048471)|primary cilium (GO:0072372)	receptor activity (GO:0004872)			NS(1)|autonomic_ganglia(1)|breast(8)|central_nervous_system(5)|cervix(1)|endometrium(16)|haematopoietic_and_lymphoid_tissue(4)|kidney(11)|large_intestine(59)|lung(139)|ovary(16)|prostate(8)|skin(20)|soft_tissue(1)|stomach(2)|upper_aerodigestive_tract(7)|urinary_tract(5)	304	Lung NSC(77;0.0605)					ACAGGCTCACGTTGCCCTGGA	0.527													G|||	2	0.000399361	0.0015	0.0	5008	,	,		21679	0.0		0.0	False		,,,				2504	0.0				p.N1346N		.											.	PKHD1-603	0			c.C4038T						.	G	,	6,4400	12.9+/-30.5	0,6,2197	101.0	90.0	94.0		4038,4038	3.8	0.0	6	dbSNP_134	94	0,8600		0,0,4300	no	coding-synonymous,coding-synonymous	PKHD1	NM_138694.3,NM_170724.2	,	0,6,6497	AA,AG,GG		0.0,0.1362,0.0461	,	1346/4075,1346/3397	51890570	6,13000	2203	4300	6503	SO:0001819	synonymous_variant	5314	exon32			GCTCACGTTGCCC	AF480064	CCDS4935.1, CCDS4936.1	6p21.2-p12	2012-11-26	2003-04-16		ENSG00000170927	ENSG00000170927			9016	protein-coding gene	gene with protein product	"""tigmin"", ""polyductin"", ""fibrocystin"""	606702	"""TIG multiple domains 1"""	TIGM1		9503014	Standard	NM_138694		Approved	ARPKD, FCYT	uc003pah.1	P08F94	OTTHUMG00000014841	ENST00000371117.3:c.4038C>T	6.37:g.51890570G>A		Somatic	148	0		WXS	Illumina GAIIx	Phase_I	134	61	NM_170724	0	0	0	0	0	Q5VUA2|Q5VUA3|Q5VWV1|Q86Z26|Q8TCZ9	Silent	SNP	ENST00000371117.3	37	CCDS4935.1																																																																																			G|0.999;A|0.001		0.527	PKHD1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000040893.1	NM_138694	
SERINC1	57515	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	6	122772896	122772925	+	Splice_Site	DEL	ATTCCTACAAAAAAAAAAAAAAAAAAATAT	ATTCCTACAAAAAAAAAAAAAAAAAAATAT	-	rs373992860|rs67317656|rs369819136|rs55740173|rs369433381|rs373266945|rs375724023|rs371239654|rs6569259		TCGA-OR-A5L2-01A-11D-A30A-10	TCGA-OR-A5L2-10A-01D-A30A-10	ATTCCTACAAAAAAAAAAAAAAAAAAATAT	ATTCCTACAAAAAAAAAAAAAAAAAAATAT	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b99bd79e-aa33-4896-8d10-2517c793f439	48e26b1d-b84d-432b-940b-9907c81ddf5b	g.chr6:122772896_122772925delATTCCTACAAAAAAAAAAAAAAAAAAATAT	ENST00000339697.4	-	7	844_847	c.760_763delATATTTTTTTTTTTTTTTTTTTGTAGGAAT	c.(760-765)atattt>tt	p.IF254del		NM_020755.2	NP_065806.1	Q9NRX5	SERC1_HUMAN	serine incorporator 1	254					L-serine transport (GO:0015825)|phosphatidylserine metabolic process (GO:0006658)|phospholipid biosynthetic process (GO:0008654)|positive regulation of transferase activity (GO:0051347)|sphingolipid metabolic process (GO:0006665)	endoplasmic reticulum membrane (GO:0005789)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	L-serine transmembrane transporter activity (GO:0015194)			endometrium(2)|kidney(2)|large_intestine(4)|liver(1)|lung(2)|ovary(1)|skin(1)	13				GBM - Glioblastoma multiforme(226;0.126)		CTTGGTTGTGATTCCTACaaaaaaaaaaaaaaaaaaatatatatatatat	0.278																																					p.254_255del		.											.	SERINC1-91	0			c.760_763del						.																																			SO:0001630	splice_region_variant	57515	exon7			GTTGTGATTCCTA	AF087902	CCDS5125.1	6q22.32	2006-02-09	2005-10-14	2005-10-14	ENSG00000111897	ENSG00000111897			13464	protein-coding gene	gene with protein product		614548	"""tumor differentially expressed 2"""	TDE2		10637174	Standard	NM_020755		Approved	TMS-2, TDE1L, KIAA1253	uc003pyy.1	Q9NRX5	OTTHUMG00000015487	ENST00000339697.4:c.760-1ATATTTTTTTTTTTTTTTTTTTGTAGGAAT>-	6.37:g.122772896_122772925delATTCCTACAAAAAAAAAAAAAAAAAAATAT		Somatic	81	0		WXS	Illumina GAIIx	Phase_I	82	12	NM_020755	0	0	0	0	0	B3KY69|E1P565|O75655|Q7Z2F5|Q8TAG1|Q9NTH8|Q9ULG7	Frame_Shift_Del	DEL	ENST00000339697.4	37	CCDS5125.1																																																																																			.		0.278	SERINC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042031.2	NM_020755	In_Frame_Del
LAMA2	3908	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	129465098	129465098	+	Missense_Mutation	SNP	A	A	C			TCGA-OR-A5L2-01A-11D-A30A-10	TCGA-OR-A5L2-10A-01D-A30A-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b99bd79e-aa33-4896-8d10-2517c793f439	48e26b1d-b84d-432b-940b-9907c81ddf5b	g.chr6:129465098A>C	ENST00000421865.2	+	5	741	c.692A>C	c.(691-693)gAa>gCa	p.E231A		NM_000426.3|NM_001079823.1	NP_000417|NP_001073291.1	P24043	LAMA2_HUMAN	laminin, alpha 2	231	Laminin N-terminal. {ECO:0000255|PROSITE- ProRule:PRU00466}.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|muscle organ development (GO:0007517)|myelination in peripheral nervous system (GO:0022011)|positive regulation of synaptic transmission, cholinergic (GO:0032224)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of embryonic development (GO:0045995)	basement membrane (GO:0005604)|dendritic spine (GO:0043197)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|laminin-1 complex (GO:0005606)|sarcolemma (GO:0042383)	structural molecule activity (GO:0005198)			NS(2)|biliary_tract(2)|breast(10)|central_nervous_system(1)|endometrium(18)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(35)|lung(84)|ovary(10)|prostate(4)|skin(9)|stomach(1)|upper_aerodigestive_tract(7)|urinary_tract(2)	194				OV - Ovarian serous cystadenocarcinoma(136;0.178)|all cancers(137;0.245)		CCTTCTCCAGAACTGCTAGAA	0.383																																					p.E231A		.											.	LAMA2-162	0			c.A692C						.						105.0	103.0	103.0					6																	129465098		2203	4300	6503	SO:0001583	missense	3908	exon5			CTCCAGAACTGCT	Z26653	CCDS5138.1	6q22-q23	2014-09-17	2008-08-01		ENSG00000196569	ENSG00000196569		"""Laminins"""	6482	protein-coding gene	gene with protein product	"""merosin"", ""congenital muscular dystrophy"""	156225		LAMM		2185464, 8294519	Standard	NM_000426		Approved		uc003qbn.3	P24043	OTTHUMG00000015545	ENST00000421865.2:c.692A>C	6.37:g.129465098A>C	ENSP00000400365:p.Glu231Ala	Somatic	59	0		WXS	Illumina GAIIx	Phase_I	71	11	NM_000426	0	0	0	0	0	Q14736|Q5VUM2|Q93022	Missense_Mutation	SNP	ENST00000421865.2	37	CCDS5138.1	.	.	.	.	.	.	.	.	.	.	A	7.069	0.567917	0.13560	.	.	ENSG00000196569	ENST00000358023;ENST00000354729;ENST00000421865	T	0.75589	-0.95	5.09	5.09	0.68999	Laminin, N-terminal (3);	0.267926	0.30602	N	0.009270	T	0.48960	0.1529	L	0.45285	1.41	0.35155	D	0.770137	B;B	0.16166	0.016;0.007	B;B	0.16289	0.015;0.015	T	0.45833	-0.9234	10	0.17832	T	0.49	.	12.2257	0.54459	0.7855:0.2145:0.0:0.0	.	231;231	A6NF00;P24043	.;LAMA2_HUMAN	A	231	ENSP00000400365:E231A	ENSP00000346769:E231A	E	+	2	0	LAMA2	129506791	0.880000	0.30214	1.000000	0.80357	0.219000	0.24729	0.450000	0.21762	2.051000	0.60960	0.383000	0.25322	GAA	.		0.383	LAMA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042180.1		
MED23	9439	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	131914268	131914268	+	Nonsense_Mutation	SNP	C	C	T			TCGA-OR-A5L2-01A-11D-A30A-10	TCGA-OR-A5L2-10A-01D-A30A-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b99bd79e-aa33-4896-8d10-2517c793f439	48e26b1d-b84d-432b-940b-9907c81ddf5b	g.chr6:131914268C>T	ENST00000368068.3	-	24	3455	c.3276G>A	c.(3274-3276)tgG>tgA	p.W1092*	MED23_ENST00000368058.1_Nonsense_Mutation_p.W1098*|MED23_ENST00000545957.1_Nonsense_Mutation_p.W733*|MED23_ENST00000403834.3_Nonsense_Mutation_p.W1098*|MED23_ENST00000368060.3_Nonsense_Mutation_p.W1092*|MED23_ENST00000354577.4_Nonsense_Mutation_p.W1098*|MED23_ENST00000479213.1_5'UTR	NM_004830.3	NP_004821.2	Q9ULK4	MED23_HUMAN	mediator complex subunit 23	1092					gene expression (GO:0010467)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)|transcription initiation from RNA polymerase II promoter (GO:0006367)	mediator complex (GO:0016592)|nucleoplasm (GO:0005654)|transcription factor complex (GO:0005667)	transcription coactivator activity (GO:0003713)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(1)|kidney(4)|large_intestine(12)|lung(15)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	44	Breast(56;0.0753)			GBM - Glioblastoma multiforme(226;0.0115)|OV - Ovarian serous cystadenocarcinoma(155;0.0608)		CATTGAATCTCCAGTCACAGT	0.468																																					p.W1098X		.											.	MED23-24	0			c.G3294A						.						96.0	83.0	87.0					6																	131914268		2203	4300	6503	SO:0001587	stop_gained	9439	exon25			GAATCTCCAGTCA	AF104255	CCDS5146.1, CCDS5147.1, CCDS59039.1	6q22.33-q24.1	2008-02-05	2007-08-08	2007-07-30	ENSG00000112282	ENSG00000112282			2372	protein-coding gene	gene with protein product		605042	"""cofactor required for Sp1 transcriptional activation, subunit 3, 130kDa"""	CRSP3		9989412	Standard	NM_004830		Approved	CRSP130, DRIP130, Sur2	uc003qcs.2	Q9ULK4	OTTHUMG00000015565	ENST00000368068.3:c.3276G>A	6.37:g.131914268C>T	ENSP00000357047:p.Trp1092*	Somatic	209	0		WXS	Illumina GAIIx	Phase_I	188	86	NM_015979	0	0	0	0	0	B9TX55|O95403|Q5JWT3|Q5JWT4|Q6P9H6|Q9H0J2|Q9NTT9|Q9NTU0|Q9Y5P7|Q9Y667	Nonsense_Mutation	SNP	ENST00000368068.3	37	CCDS5147.1	.	.	.	.	.	.	.	.	.	.	C	39	7.732031	0.98459	.	.	ENSG00000112282	ENST00000354577;ENST00000368068;ENST00000403834;ENST00000368060;ENST00000368058;ENST00000545957	.	.	.	5.53	5.53	0.82687	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-7.614	19.4828	0.95017	0.0:1.0:0.0:0.0	.	.	.	.	X	1098;1092;1098;1092;1098;733	.	ENSP00000346588:W1098X	W	-	3	0	MED23	131955961	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.764000	0.85297	2.602000	0.87976	0.650000	0.86243	TGG	.		0.468	MED23-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000042215.1		
RADIL	55698	hgsc.bcm.edu	37	7	4876135	4876135	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5L2-01A-11D-A30A-10	TCGA-OR-A5L2-10A-01D-A30A-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b99bd79e-aa33-4896-8d10-2517c793f439	48e26b1d-b84d-432b-940b-9907c81ddf5b	g.chr7:4876135G>A	ENST00000399583.3	-	3	824	c.637C>T	c.(637-639)Cgc>Tgc	p.R213C	RADIL_ENST00000538469.1_5'UTR|RADIL_ENST00000536091.1_Missense_Mutation_p.R213C	NM_018059.4	NP_060529.4	Q96JH8	RADIL_HUMAN	Ras association and DIL domains	213					multicellular organismal development (GO:0007275)|signal transduction (GO:0007165)|substrate adhesion-dependent cell spreading (GO:0034446)	microtubule (GO:0005874)				NS(1)|biliary_tract(2)|breast(1)|central_nervous_system(3)|endometrium(2)|large_intestine(2)|lung(22)|pancreas(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	41		Ovarian(82;0.0175)		UCEC - Uterine corpus endometrioid carcinoma (126;0.0986)|OV - Ovarian serous cystadenocarcinoma(56;7.41e-15)		CTGACTGTGCGGCGCAACCGG	0.731																																					p.R213C		.											.	RADIL-994	0			c.C637T						.						12.0	19.0	17.0					7																	4876135		2078	4180	6258	SO:0001583	missense	55698	exon3			CTGTGCGGCGCAA	AB058752	CCDS43544.1	7p22.1	2010-08-27			ENSG00000157927	ENSG00000157927			22226	protein-coding gene	gene with protein product		611491				16051602, 17704304	Standard	NM_018059		Approved	FLJ10324, KIAA1849, RASIP2	uc003snj.1	Q96JH8	OTTHUMG00000151753	ENST00000399583.3:c.637C>T	7.37:g.4876135G>A	ENSP00000382492:p.Arg213Cys	Somatic	8	0		WXS	Illumina GAIIx	Phase_I	49	7	NM_018059	0	0	0	0	0	A4D1Z5|A5YM49|B7ZL20|Q0VFZ9|Q75LH3|Q9BSP5|Q9H0M6|Q9NW43|Q9NWC4	Missense_Mutation	SNP	ENST00000399583.3	37	CCDS43544.1	.	.	.	.	.	.	.	.	.	.	G	19.97	3.926039	0.73327	.	.	ENSG00000157927	ENST00000399583;ENST00000316919;ENST00000536091	T;T	0.30448	2.95;1.53	4.57	4.57	0.56435	.	0.000000	0.85682	D	0.000000	T	0.52008	0.1708	M	0.81497	2.545	0.58432	D	0.99999	D	0.89917	1.0	D	0.64410	0.925	T	0.52711	-0.8539	10	0.36615	T	0.2	-37.2059	11.1566	0.48491	0.0:0.2036:0.7964:0.0	.	213	Q96JH8	RADIL_HUMAN	C	213;187;213	ENSP00000382492:R213C;ENSP00000442533:R213C	ENSP00000320946:R187C	R	-	1	0	RADIL	4842661	1.000000	0.71417	0.998000	0.56505	0.586000	0.36452	8.168000	0.89670	2.100000	0.63781	0.462000	0.41574	CGC	.		0.731	RADIL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323769.2	NM_018059	
TNRC18	84629	hgsc.bcm.edu	37	7	5372406	5372406	+	Silent	SNP	G	G	T	rs13238738	byFrequency	TCGA-OR-A5L2-01A-11D-A30A-10	TCGA-OR-A5L2-10A-01D-A30A-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b99bd79e-aa33-4896-8d10-2517c793f439	48e26b1d-b84d-432b-940b-9907c81ddf5b	g.chr7:5372406G>T	ENST00000430969.1	-	19	6342	c.5994C>A	c.(5992-5994)cgC>cgA	p.R1998R	TNRC18_ENST00000399537.4_Silent_p.R1998R	NM_001080495.2	NP_001073964.2	O15417	TNC18_HUMAN	trinucleotide repeat containing 18	1998							chromatin binding (GO:0003682)			central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(8)	11		Ovarian(82;0.142)		UCEC - Uterine corpus endometrioid carcinoma (126;0.195)|OV - Ovarian serous cystadenocarcinoma(56;5.32e-15)		TGCGCTCGCTGCGGCGCCGCG	0.756													G|||	2646	0.528355	0.3601	0.4352	5008	,	,		9503	0.7063		0.673	False		,,,				2504	0.4898				p.R1998R		.											.	TNRC18-46	0			c.C5994A						.	G		1260,1040		370,520,260	2.0	3.0	3.0		5994	2.1	1.0	7	dbSNP_121	3	3787,1581		1438,911,335	no	coding-synonymous	TNRC18	NM_001080495.2		1808,1431,595	TT,TG,GG		29.4523,45.2174,34.181		1998/2969	5372406	5047,2621	1150	2684	3834	SO:0001819	synonymous_variant	84629	exon19			CTCGCTGCGGCGC	U80753	CCDS47534.1	7p22.1	2012-04-17			ENSG00000182095	ENSG00000182095		"""Trinucleotide (CAG) repeat containing"""	11962	protein-coding gene	gene with protein product						9225980	Standard	NM_001080495		Approved	CAGL79, TNRC18A, KIAA1856	uc003soi.4	O15417	OTTHUMG00000151831	ENST00000430969.1:c.5994C>A	7.37:g.5372406G>T		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	15	10	NM_001080495	0	0	0	0	0	A8MX41|Q96JH1|Q96K91	Silent	SNP	ENST00000430969.1	37	CCDS47534.1	1284	0.5879120879120879	197	0.40040650406504064	170	0.4696132596685083	415	0.7255244755244755	502	0.662269129287599	.	11.77	1.738038	0.30774	0.547826	0.705477	ENSG00000182095	ENST00000455076	.	.	.	4.14	2.1	0.27182	.	.	.	.	.	T	0.00012	0.0000	.	.	.	0.09310	P	0.9999999999999956	.	.	.	.	.	.	T	0.35425	-0.9789	3	.	.	.	.	12.3787	0.55295	0.0:0.4664:0.5335:0.0	rs13238738	.	.	.	E	35	.	.	A	-	2	0	TNRC18	5338932	0.998000	0.40836	0.997000	0.53966	0.996000	0.88848	0.427000	0.21379	0.648000	0.30732	0.555000	0.69702	GCA	G|0.411;T|0.589		0.756	TNRC18-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding			
USP42	84132	hgsc.bcm.edu	37	7	6193521	6193521	+	Missense_Mutation	SNP	G	G	C	rs61729726	byFrequency	TCGA-OR-A5L2-01A-11D-A30A-10	TCGA-OR-A5L2-10A-01D-A30A-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b99bd79e-aa33-4896-8d10-2517c793f439	48e26b1d-b84d-432b-940b-9907c81ddf5b	g.chr7:6193521G>C	ENST00000306177.5	+	15	2494	c.2336G>C	c.(2335-2337)cGc>cCc	p.R779P		NM_032172.2	NP_115548.1	Q9H9J4	UBP42_HUMAN	ubiquitin specific peptidase 42	779	Pro-rich.				cell differentiation (GO:0030154)|protein deubiquitination (GO:0016579)|spermatogenesis (GO:0007283)|ubiquitin-dependent protein catabolic process (GO:0006511)		ubiquitin-specific protease activity (GO:0004843)			breast(1)|central_nervous_system(1)|endometrium(5)|kidney(4)|large_intestine(2)|lung(14)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|urinary_tract(1)	35		Ovarian(82;0.0423)		UCEC - Uterine corpus endometrioid carcinoma (126;0.108)|OV - Ovarian serous cystadenocarcinoma(56;5.77e-14)		CCGCCGCCCCGCGATCCCGGC	0.756													C|||	2895	0.578075	0.8638	0.4121	5008	,	,		10724	0.7331		0.3082	False		,,,				2504	0.4274				p.R779P		.											.	USP42-659	0			c.G2336C						.	C	PRO/ARG	2157,1125		751,655,235	4.0	6.0	5.0		2336	2.6	0.0	7	dbSNP_129	5	1843,5693		290,1263,2215	no	missense	USP42	NM_032172.2	103	1041,1918,2450	CC,CG,GG		24.4559,34.2779,36.9754	benign	779/1317	6193521	4000,6818	1641	3768	5409	SO:0001583	missense	84132	exon15			CGCCCCGCGATCC	AK022759	CCDS47535.1	7p22.2	2005-08-08	2005-08-08		ENSG00000106346	ENSG00000106346		"""Ubiquitin-specific peptidases"""	20068	protein-coding gene	gene with protein product			"""ubiquitin specific protease 42"""			12838346	Standard	NM_032172		Approved	FLJ12697	uc011jwp.2	Q9H9J4	OTTHUMG00000151888	ENST00000306177.5:c.2336G>C	7.37:g.6193521G>C	ENSP00000301962:p.Arg779Pro	Somatic	3	0		WXS	Illumina GAIIx	Phase_I	27	12	NM_032172	0	0	0	0	0	A2RUE3|B5MDA5|Q0VIN8|Q3C166|Q6P9B4	Missense_Mutation	SNP	ENST00000306177.5	37	CCDS47535.1	1188	0.5439560439560439	401	0.8150406504065041	130	0.35911602209944754	440	0.7692307692307693	217	0.2862796833773087	C	10.95	1.494372	0.26774	0.657221	0.244559	ENSG00000106346	ENST00000306177;ENST00000426246	T;T	0.14266	2.52;2.93	5.46	2.59	0.31030	.	0.841331	0.10600	N	0.655737	T	0.00012	0.0000	N	0.08118	0	0.80722	P	0.0	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.09164	-1.0687	9	0.28530	T	0.3	.	2.8136	0.05448	0.1458:0.5508:0.1414:0.162	rs61729726	779;779	Q9H9J4-2;Q9H9J4	.;UBP42_HUMAN	P	779;625	ENSP00000301962:R779P;ENSP00000408217:R625P	ENSP00000301962:R779P	R	+	2	0	USP42	6160046	0.001000	0.12720	0.000000	0.03702	0.000000	0.00434	0.469000	0.22067	0.265000	0.21872	-0.120000	0.15030	CGC	G|0.456;C|0.544		0.756	USP42-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000324262.3	XM_166526	
C7orf31	136895	broad.mit.edu;bcgsc.ca	37	7	25208036	25208036	+	Silent	SNP	G	G	A	rs148188847		TCGA-OR-A5L2-01A-11D-A30A-10	TCGA-OR-A5L2-10A-01D-A30A-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b99bd79e-aa33-4896-8d10-2517c793f439	48e26b1d-b84d-432b-940b-9907c81ddf5b	g.chr7:25208036G>A	ENST00000409280.1	-	3	491	c.183C>T	c.(181-183)ggC>ggT	p.G61G	C7orf31_ENST00000283905.3_Silent_p.G61G			Q8N865	CG031_HUMAN	chromosome 7 open reading frame 31	61										autonomic_ganglia(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(6)|skin(2)|stomach(1)	14						CTCTTTCAGCGCCCCAAGGAA	0.468																																					p.G61G		.											.	C7orf31-90	0			c.C183T						.	G		2,4404	4.2+/-10.8	0,2,2201	98.0	93.0	94.0		183	-11.8	0.0	7	dbSNP_134	94	0,8600		0,0,4300	no	coding-synonymous	C7orf31	NM_138811.3		0,2,6501	AA,AG,GG		0.0,0.0454,0.0154		61/591	25208036	2,13004	2203	4300	6503	SO:0001819	synonymous_variant	136895	exon3			TTCAGCGCCCCAA	AK097248	CCDS5394.1	7p15.2	2011-11-24			ENSG00000153790	ENSG00000153790			21722	protein-coding gene	gene with protein product							Standard	NM_138811		Approved		uc003sxn.1	Q8N865	OTTHUMG00000128497	ENST00000409280.1:c.183C>T	7.37:g.25208036G>A		Somatic	167	1		WXS	Illumina GAIIx	Phase_I	221	12	NM_138811	0	0	0	0	0	A4D165|Q6MZV8|Q6P989|Q7LE28|Q86XK1|Q8N1H5|Q96BN4	Silent	SNP	ENST00000409280.1	37	CCDS5394.1																																																																																			G|1.000;A|0.000		0.468	C7orf31-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000326929.1	NM_138811	
HOXA4	3201	hgsc.bcm.edu	37	7	27170145	27170145	+	Missense_Mutation	SNP	T	T	G	rs6944345	byFrequency	TCGA-OR-A5L2-01A-11D-A30A-10	TCGA-OR-A5L2-10A-01D-A30A-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b99bd79e-aa33-4896-8d10-2517c793f439	48e26b1d-b84d-432b-940b-9907c81ddf5b	g.chr7:27170145T>G	ENST00000360046.5	-	1	273	c.208A>C	c.(208-210)Act>Cct	p.T70P	HOXA-AS3_ENST00000518848.1_RNA|HOXA-AS2_ENST00000521687.1_RNA|HOXA-AS2_ENST00000517550.1_RNA|HOXA3_ENST00000521401.1_Intron|HOXA-AS2_ENST00000521159.1_RNA|RP1-170O19.22_ENST00000467897.2_RNA|HOXA4_ENST00000428284.2_Missense_Mutation_p.T70P	NM_002141.4	NP_002132.3	Q00056	HXA4_HUMAN	homeobox A4	70	Pro-rich (part of the transcriptional activation domain).		T -> P (in dbSNP:rs6944345). {ECO:0000269|PubMed:1675427}.		anatomical structure morphogenesis (GO:0009653)|anterior/posterior pattern specification (GO:0009952)|embryonic skeletal system morphogenesis (GO:0048704)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|cervix(1)|endometrium(1)|large_intestine(3)|lung(6)	12						TAGGAGGCAGTGGGCTCTCGG	0.786													G|||	4776	0.953674	0.9062	0.9741	5008	,	,		3715	0.998		0.9652	False		,,,				2504	0.9458				p.T70P		.											.	HOXA4-153	0			c.A208C						.	G	PRO/THR	1805,121		842,121,0	1.0	2.0	1.0		208	2.2	1.0	7	dbSNP_116	1	4365,101		2133,99,1	no	missense	HOXA4	NM_002141.4	38	2975,220,1	GG,GT,TT		2.2615,6.2825,3.4731	benign	70/321	27170145	6170,222	963	2233	3196	SO:0001583	missense	3201	exon1			AGGCAGTGGGCTC		CCDS5405.1	7p15.2	2011-06-20	2005-12-22		ENSG00000197576	ENSG00000197576		"""Homeoboxes / ANTP class : HOXL subclass"""	5105	protein-coding gene	gene with protein product		142953	"""homeo box A4"""	HOX1D, HOX1		1973146, 1358459	Standard	NM_002141		Approved		uc003sym.4	Q00056	OTTHUMG00000023213	ENST00000360046.5:c.208A>C	7.37:g.27170145T>G	ENSP00000353151:p.Thr70Pro	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	5	5	NM_002141	0	0	0	0	0	A4D180|O43366	Missense_Mutation	SNP	ENST00000360046.5	37	CCDS5405.1	2104	0.9633699633699634	448	0.9105691056910569	346	0.9558011049723757	571	0.9982517482517482	739	0.974934036939314	G	1.346	-0.592740	0.03771	0.937175	0.977385	ENSG00000197576	ENST00000360046;ENST00000428284	T;T	0.41065	1.01;1.01	4.04	2.2	0.27929	.	0.810434	0.10088	N	0.717489	T	0.00012	0.0000	N	0.00642	-1.3	0.58432	P	2.9999999999752447E-6	B	0.02656	0.0	B	0.01281	0.0	T	0.33979	-0.9847	9	0.02654	T	1	.	4.7868	0.13229	0.0827:0.148:0.6158:0.1535	rs6944345;rs61008002	70	Q00056	HXA4_HUMAN	P	70	ENSP00000353151:T70P;ENSP00000408845:T70P	ENSP00000353151:T70P	T	-	1	0	HOXA4	27136670	0.995000	0.38212	0.985000	0.45067	0.635000	0.38103	0.419000	0.21247	0.017000	0.15025	-1.892000	0.00534	ACT	T|0.037;G|0.963		0.786	HOXA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059534.4		
ADCYAP1R1	117	broad.mit.edu;bcgsc.ca	37	7	31123819	31123819	+	Missense_Mutation	SNP	T	T	A			TCGA-OR-A5L2-01A-11D-A30A-10	TCGA-OR-A5L2-10A-01D-A30A-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b99bd79e-aa33-4896-8d10-2517c793f439	48e26b1d-b84d-432b-940b-9907c81ddf5b	g.chr7:31123819T>A	ENST00000304166.4	+	7	681	c.392T>A	c.(391-393)tTt>tAt	p.F131Y	ADCYAP1R1_ENST00000409363.1_Missense_Mutation_p.F110Y|ADCYAP1R1_ENST00000409489.1_Missense_Mutation_p.F131Y|ADCYAP1R1_ENST00000396211.2_Missense_Mutation_p.F131Y	NM_001118.4|NM_001199635.1|NM_001199636.1	NP_001109.2|NP_001186564.1|NP_001186565.1	P41586	PACR_HUMAN	adenylate cyclase activating polypeptide 1 (pituitary) receptor type I	131	Important for ligand binding and specificity.				activation of adenylate cyclase activity (GO:0007190)|cell differentiation (GO:0030154)|cell surface receptor signaling pathway (GO:0007166)|multicellular organismal development (GO:0007275)|neurotrophin TRK receptor signaling pathway (GO:0048011)|spermatogenesis (GO:0007283)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	receptor activity (GO:0004872)|vasoactive intestinal polypeptide receptor activity (GO:0004999)			endometrium(1)|large_intestine(4)|liver(2)|lung(24)|ovary(1)|skin(2)|stomach(1)	35						CCTCATTACTTTGATGCCTGT	0.542																																					p.F131Y	Ovarian(44;225 1186 2158 11092)	.											.	ADCYAP1R1-91	0			c.T392A						.						180.0	171.0	174.0					7																	31123819		2203	4300	6503	SO:0001583	missense	117	exon7			ATTACTTTGATGC		CCDS5433.1, CCDS56480.1, CCDS56481.1	7p14.3	2012-09-20			ENSG00000078549	ENSG00000078549		"""GPCR / Class B : VIP and PACAP (ADCYAP1) receptors"""	242	protein-coding gene	gene with protein product	"""PACAP receptor 1"""	102981				7902709	Standard	NM_001199635		Approved	PAC1, PACAPR, PAC1R	uc003tcg.3	P41586	OTTHUMG00000023884	ENST00000304166.4:c.392T>A	7.37:g.31123819T>A	ENSP00000306620:p.Phe131Tyr	Somatic	152	0		WXS	Illumina GAIIx	Phase_I	219	7	NM_001118	0	0	0	0	0	A8K1Y1|B7ZLA7|B8ZZK3|Q17S10	Missense_Mutation	SNP	ENST00000304166.4	37	CCDS5433.1	.	.	.	.	.	.	.	.	.	.	T	0.411	-0.913268	0.02415	.	.	ENSG00000078549	ENST00000304166;ENST00000409363;ENST00000396211;ENST00000409489	T;T;T;T	0.59772	0.24;0.24;0.24;0.24	5.66	5.66	0.87406	GPCR, family 2, extracellular hormone receptor domain (3);	0.597438	0.17471	N	0.173082	T	0.33789	0.0875	N	0.13235	0.315	0.25949	N	0.982779	B;B;B;B;B	0.02656	0.0;0.0;0.0;0.0;0.0	B;B;B;B;B	0.10450	0.005;0.002;0.005;0.0;0.001	T	0.29488	-1.0010	10	0.02654	T	1	.	8.4105	0.32640	0.0:0.0864:0.0:0.9136	.	131;131;131;110;131	B7ZLA7;Q17S10;E9PFU5;B8ZZK3;P41586	.;.;.;.;PACR_HUMAN	Y	131;110;131;131	ENSP00000306620:F131Y;ENSP00000387335:F110Y;ENSP00000379514:F131Y;ENSP00000386395:F131Y	ENSP00000306620:F131Y	F	+	2	0	ADCYAP1R1	31090344	0.022000	0.18835	0.093000	0.20910	0.233000	0.25261	1.592000	0.36676	2.144000	0.66660	0.460000	0.39030	TTT	.		0.542	ADCYAP1R1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000215041.3	NM_001118	
RFC2	5982	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	73649931	73649931	+	Silent	SNP	G	G	A			TCGA-OR-A5L2-01A-11D-A30A-10	TCGA-OR-A5L2-10A-01D-A30A-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b99bd79e-aa33-4896-8d10-2517c793f439	48e26b1d-b84d-432b-940b-9907c81ddf5b	g.chr7:73649931G>A	ENST00000055077.3	-	10	945	c.885C>T	c.(883-885)atC>atT	p.I295I	RFC2_ENST00000352131.3_Silent_p.I261I	NM_181471.1	NP_852136.1	P35250	RFC2_HUMAN	replication factor C (activator 1) 2, 40kDa	295					DNA repair (GO:0006281)|DNA replication (GO:0006260)|DNA strand elongation involved in DNA replication (GO:0006271)|mitotic cell cycle (GO:0000278)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA gap filling (GO:0006297)|telomere maintenance (GO:0000723)|telomere maintenance via recombination (GO:0000722)|telomere maintenance via semi-conservative replication (GO:0032201)|transcription-coupled nucleotide-excision repair (GO:0006283)	DNA replication factor C complex (GO:0005663)|nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|DNA binding (GO:0003677)			central_nervous_system(1)|endometrium(2)|large_intestine(1)|liver(1)|lung(3)	8						TGTTGCCAATGATATCTTCTG	0.418																																					p.I295I		.											.	RFC2-229	0			c.C885T						.						158.0	155.0	156.0					7																	73649931		2203	4300	6503	SO:0001819	synonymous_variant	5982	exon10			GCCAATGATATCT		CCDS5567.1, CCDS5568.1, CCDS75618.1	7q11.23	2010-04-21	2002-08-29		ENSG00000049541	ENSG00000049541		"""ATPases / AAA-type"""	9970	protein-coding gene	gene with protein product	"""activator 1"""	600404	"""replication factor C (activator 1) 2 (40kD)"""			1313560, 7774928	Standard	NM_181471		Approved	A1, RFC40	uc003uaj.3	P35250	OTTHUMG00000023239	ENST00000055077.3:c.885C>T	7.37:g.73649931G>A		Somatic	114	0		WXS	Illumina GAIIx	Phase_I	168	55	NM_181471	0	0	0	0	0	B5BU07|D3DXG3|P32846|Q9BU93	Silent	SNP	ENST00000055077.3	37	CCDS5568.1																																																																																			.		0.418	RFC2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252459.2	NM_181471	
TRRAP	8295	broad.mit.edu	37	7	98529263	98529263	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5L2-01A-11D-A30A-10	TCGA-OR-A5L2-10A-01D-A30A-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b99bd79e-aa33-4896-8d10-2517c793f439	48e26b1d-b84d-432b-940b-9907c81ddf5b	g.chr7:98529263C>T	ENST00000359863.4	+	26	4036	c.3827C>T	c.(3826-3828)aCg>aTg	p.T1276M	TRRAP_ENST00000446306.3_Missense_Mutation_p.T1275M|TRRAP_ENST00000355540.3_Missense_Mutation_p.T1276M	NM_001244580.1	NP_001231509.1	Q9Y4A5	TRRAP_HUMAN	transformation/transcription domain-associated protein	1276					chromatin organization (GO:0006325)|histone acetylation (GO:0016573)|histone deubiquitination (GO:0016578)|histone H2A acetylation (GO:0043968)|histone H4 acetylation (GO:0043967)|mitotic cell cycle checkpoint (GO:0007093)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	NuA4 histone acetyltransferase complex (GO:0035267)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PCAF complex (GO:0000125)|STAGA complex (GO:0030914)|Swr1 complex (GO:0000812)|transcription factor TFTC complex (GO:0033276)	phosphotransferase activity, alcohol group as acceptor (GO:0016773)|transcription coactivator activity (GO:0003713)|transcription cofactor activity (GO:0003712)			NS(3)|breast(1)|central_nervous_system(10)|endometrium(16)|kidney(7)|large_intestine(36)|liver(1)|lung(54)|ovary(10)|pancreas(1)|prostate(8)|skin(16)|stomach(5)|upper_aerodigestive_tract(6)|urinary_tract(2)	176	all_cancers(62;6.96e-09)|all_epithelial(64;4.86e-09)|Lung NSC(181;0.01)|all_lung(186;0.016)|Esophageal squamous(72;0.0274)		STAD - Stomach adenocarcinoma(171;0.215)			AAGAGTGTCACGGTGATCATG	0.473																																					p.T1276M		.											.	TRRAP-923	0			c.C3827T						.						83.0	79.0	80.0					7																	98529263		2203	4300	6503	SO:0001583	missense	8295	exon26			GTGTCACGGTGAT	AF076974	CCDS5659.1, CCDS59066.1	7q21.2-q22.1	2010-06-22			ENSG00000196367	ENSG00000196367			12347	protein-coding gene	gene with protein product		603015				9708738, 9885574	Standard	NM_003496		Approved	TR-AP, PAF400, Tra1	uc003upp.3	Q9Y4A5	OTTHUMG00000150403	ENST00000359863.4:c.3827C>T	7.37:g.98529263C>T	ENSP00000352925:p.Thr1276Met	Somatic	121	2		WXS	Illumina GAIIx	Phase_I	119	7	NM_001244580	0	0	0	0	0	A4D265|O75218|Q9Y631|Q9Y6H4	Missense_Mutation	SNP	ENST00000359863.4	37	CCDS59066.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	29.0|29.0	4.970309|4.970309	0.92919|0.92919	.|.	.|.	ENSG00000196367|ENSG00000196367	ENST00000456197|ENST00000359863;ENST00000355540;ENST00000446306	.|T;T	.|0.65916	.|3.51;-0.18	6.06|6.06	6.06|6.06	0.98353|0.98353	.|Armadillo-like helical (1);Armadillo-type fold (1);	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.79695|0.79695	0.4490|0.4490	M|M	0.79805|0.79805	2.47|2.47	0.80722|0.80722	D|D	1|1	.|D;D;D	.|0.76494	.|0.996;0.999;0.989	.|P;P;P	.|0.62184	.|0.743;0.899;0.534	T|T	0.76653|0.76653	-0.2880|-0.2880	5|10	.|0.36615	.|T	.|0.2	.|.	20.6244|20.6244	0.99512|0.99512	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|1276;990;1276	.|Q9Y4A5-2;Q59FH1;Q9Y4A5	.|.;.;TRRAP_HUMAN	W|M	991|1276;1276;1274	.|ENSP00000352925:T1276M;ENSP00000347733:T1276M	.|ENSP00000347733:T1276M	R|T	+|+	1|2	2|0	TRRAP|TRRAP	98367199|98367199	1.000000|1.000000	0.71417|0.71417	0.992000|0.992000	0.48379|0.48379	0.908000|0.908000	0.53690|0.53690	7.484000|7.484000	0.81180|0.81180	2.879000|2.879000	0.98667|0.98667	0.650000|0.650000	0.86243|0.86243	CGG|ACG	.		0.473	TRRAP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000317978.1	NM_003496	
MOSPD3	64598	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	100212602	100212602	+	Silent	SNP	T	T	A			TCGA-OR-A5L2-01A-11D-A30A-10	TCGA-OR-A5L2-10A-01D-A30A-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b99bd79e-aa33-4896-8d10-2517c793f439	48e26b1d-b84d-432b-940b-9907c81ddf5b	g.chr7:100212602T>A	ENST00000393950.2	+	4	906	c.624T>A	c.(622-624)ccT>ccA	p.P208P	MOSPD3_ENST00000424091.2_Silent_p.P198P|MOSPD3_ENST00000379527.2_Silent_p.P208P|MOSPD3_ENST00000223054.4_Silent_p.P208P	NM_023948.4	NP_076438.1	O75425	MSPD3_HUMAN	motile sperm domain containing 3	208					heart development (GO:0007507)	integral component of membrane (GO:0016021)	structural molecule activity (GO:0005198)			breast(1)|kidney(3)|large_intestine(2)|lung(5)|ovary(2)|prostate(2)|upper_aerodigestive_tract(1)	16	Lung NSC(181;0.0261)|all_lung(186;0.0392)|Esophageal squamous(72;0.0439)					GCCAGCTGCCTCAAGTCCTGC	0.612																																					p.P208P		.											.	MOSPD3-92	0			c.T624A						.						100.0	106.0	104.0					7																	100212602		2203	4300	6503	SO:0001819	synonymous_variant	64598	exon5			GCTGCCTCAAGTC	BC011653	CCDS5701.1, CCDS47662.1	7q22	2009-11-06			ENSG00000106330	ENSG00000106330			25078	protein-coding gene	gene with protein product		609125				15533722	Standard	XM_005250531		Approved	CDS3, NET30	uc003uvs.3	O75425	OTTHUMG00000159599	ENST00000393950.2:c.624T>A	7.37:g.100212602T>A		Somatic	75	0		WXS	Illumina GAIIx	Phase_I	100	20	NM_001040098	0	0	0	0	0	A4D2D1|A6NG17|C9JE89|D6W5W1|O75423|O75424	Silent	SNP	ENST00000393950.2	37	CCDS5701.1																																																																																			.		0.612	MOSPD3-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356395.1	NM_023948	
CPED1	79974	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	7	120768496	120768496	+	Missense_Mutation	SNP	A	A	T			TCGA-OR-A5L2-01A-11D-A30A-10	TCGA-OR-A5L2-10A-01D-A30A-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b99bd79e-aa33-4896-8d10-2517c793f439	48e26b1d-b84d-432b-940b-9907c81ddf5b	g.chr7:120768496A>T	ENST00000310396.5	+	11	1830	c.1363A>T	c.(1363-1365)Atg>Ttg	p.M455L	CPED1_ENST00000423795.1_Missense_Mutation_p.M235L|CPED1_ENST00000450913.2_Missense_Mutation_p.M455L	NM_024913.4	NP_079189.4	A4D0V7	CPED1_HUMAN	cadherin-like and PC-esterase domain containing 1	455						endoplasmic reticulum (GO:0005783)											TAACTCAATTATGACTTTCAT	0.358																																					p.M455L		.											.	.	0			c.A1363T						.						84.0	87.0	86.0					7																	120768496		2203	4300	6503	SO:0001583	missense	79974	exon10			TCAATTATGACTT		CCDS34739.1, CCDS47690.1	7q31.31	2012-06-12	2012-06-12	2012-06-12	ENSG00000106034	ENSG00000106034			26159	protein-coding gene	gene with protein product			"""chromosome 7 open reading frame 58"""	C7orf58		20056006	Standard	NM_024913		Approved	FLJ21986	uc003vjq.4	A4D0V7	OTTHUMG00000156982	ENST00000310396.5:c.1363A>T	7.37:g.120768496A>T	ENSP00000309772:p.Met455Leu	Somatic	270	0		WXS	Illumina GAIIx	Phase_I	306	21	NM_001105533	0	0	0	0	0	A8K1R3|Q6UXT1|Q86T76|Q86T84|Q8N2T5|Q96NC9	Missense_Mutation	SNP	ENST00000310396.5	37	CCDS34739.1	.	.	.	.	.	.	.	.	.	.	A	8.879	0.951113	0.18431	.	.	ENSG00000106034	ENST00000310396;ENST00000428526;ENST00000450913;ENST00000423795;ENST00000443817	T;T;T;T;T	0.39997	2.39;1.05;2.07;2.06;1.66	5.74	3.32	0.38043	.	0.514561	0.22934	N	0.053867	T	0.36248	0.0960	M	0.67953	2.075	0.80722	D	1	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.01281	0.0;0.0;0.0	T	0.10753	-1.0616	10	0.19590	T	0.45	.	7.3276	0.26563	0.7055:0.1508:0.0:0.1437	.	235;455;455	G5E9U2;A4D0V7-2;A4D0V7	.;.;CG058_HUMAN	L	455;455;455;235;235	ENSP00000309772:M455L;ENSP00000398082:M455L;ENSP00000406122:M455L;ENSP00000415573:M235L;ENSP00000391952:M235L	ENSP00000309772:M455L	M	+	1	0	C7orf58	120555732	1.000000	0.71417	0.996000	0.52242	0.935000	0.57460	1.469000	0.35343	0.424000	0.26061	-0.399000	0.06403	ATG	.		0.358	CPED1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346959.1	NM_024913	
PODXL	5420	hgsc.bcm.edu	37	7	131241030	131241035	+	In_Frame_Del	DEL	GGCGAC	GGCGAC	-	rs11277659|rs547816245|rs532078953	byFrequency	TCGA-OR-A5L2-01A-11D-A30A-10	TCGA-OR-A5L2-10A-01D-A30A-10	GGCGAC	GGCGAC	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b99bd79e-aa33-4896-8d10-2517c793f439	48e26b1d-b84d-432b-940b-9907c81ddf5b	g.chr7:131241030_131241035delGGCGAC	ENST00000378555.3	-	1	331_336	c.84_89delGTCGCC	c.(82-90)ccgtcgccc>ccc	p.28_30PSP>P	PODXL_ENST00000465001.1_Intron|PODXL_ENST00000541194.1_In_Frame_Del_p.28_30PSP>P|PODXL_ENST00000322985.9_In_Frame_Del_p.28_30PSP>P|PODXL_ENST00000537928.1_In_Frame_Del_p.28_30PSP>P			O00592	PODXL_HUMAN	podocalyxin-like	28					cell adhesion (GO:0007155)|cell migration (GO:0016477)|epithelial tube formation (GO:0072175)|glomerular visceral epithelial cell development (GO:0072015)|leukocyte migration (GO:0050900)|negative regulation of cell adhesion (GO:0007162)|negative regulation of cell-cell adhesion (GO:0022408)|positive regulation of cell migration (GO:0030335)|positive regulation of cell-cell adhesion mediated by integrin (GO:0033634)|regulation of microvillus assembly (GO:0032534)	apical plasma membrane (GO:0016324)|cell body (GO:0044297)|cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|integral component of plasma membrane (GO:0005887)|lamellipodium (GO:0030027)|microvillus membrane (GO:0031528)|plasma membrane (GO:0005886)|ruffle (GO:0001726)|slit diaphragm (GO:0036057)		p.P30_S31delPS(2)		NS(1)|breast(3)|endometrium(3)|kidney(3)|large_intestine(4)|lung(4)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	24	Melanoma(18;0.162)					ATTCTGGGAGggcgacggcgacggcg	0.748																																					p.28_30del		.											.	PODXL-136	2	Deletion - In frame(2)	prostate(2)	c.84_89del						.																																			SO:0001651	inframe_deletion	5420	exon1			TGGGAGGGCGACG		CCDS34755.1, CCDS47714.1	7q32-q33	2008-07-18			ENSG00000128567	ENSG00000128567			9171	protein-coding gene	gene with protein product		602632					Standard	NM_001018111		Approved	PCLP, Gp200, PC	uc003vqx.4	O00592	OTTHUMG00000154918	ENST00000378555.3:c.84_89delGTCGCC	7.37:g.131241036_131241041delGGCGAC	ENSP00000367817:p.Pro30_Ser31del	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	18	8	NM_001018111	0	0	0	0	0	A6NHX8|Q52LZ7|Q53ER6	In_Frame_Del	DEL	ENST00000378555.3	37	CCDS34755.1																																																																																			.		0.748	PODXL-005	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000337627.2	NM_001018111	
FAM115A	9747	broad.mit.edu	37	7	143556212	143556212	+	Nonsense_Mutation	SNP	G	G	T			TCGA-OR-A5L2-01A-11D-A30A-10	TCGA-OR-A5L2-10A-01D-A30A-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b99bd79e-aa33-4896-8d10-2517c793f439	48e26b1d-b84d-432b-940b-9907c81ddf5b	g.chr7:143556212G>T	ENST00000479870.1	-	7	2418	c.2210C>A	c.(2209-2211)tCa>tAa	p.S737*	FAM115A_ENST00000392900.3_5'UTR|FAM115A_ENST00000355951.2_Nonsense_Mutation_p.S737*	NM_001206938.1|NM_001206941.1|NM_014719.2	NP_001193867.1|NP_001193870.1|NP_055534	Q9Y4C2	F115A_HUMAN	family with sequence similarity 115, member A	737	Peptidase M60.									NS(1)|endometrium(1)|lung(5)	7	Melanoma(164;0.0903)					CTCCTGCACTGACTCCAGATG	0.572																																					p.S737X		.											.	FAM115A-68	0			c.C2210A						.						18.0	18.0	18.0					7																	143556212		1707	3357	5064	SO:0001587	stop_gained	9747	exon7			TGCACTGACTCCA	AB018281	CCDS5886.1, CCDS56514.1	7q35	2011-05-03	2006-03-23	2006-03-23	ENSG00000198420	ENSG00000198420			22201	protein-coding gene	gene with protein product						9872452	Standard	NM_014719		Approved	KIAA0738	uc003wdo.2	Q9Y4C2	OTTHUMG00000157773	ENST00000479870.1:c.2210C>A	7.37:g.143556212G>T	ENSP00000419235:p.Ser737*	Somatic	238	1		WXS	Illumina GAIIx	Phase_I	410	19	NM_001206938	0	0	0	0	0	A8K6E0|Q75KM8|Q75KM9|Q7L665|Q9BW63	Nonsense_Mutation	SNP	ENST00000479870.1	37	CCDS5886.1	.	.	.	.	.	.	.	.	.	.	G	39	7.655445	0.98415	.	.	ENSG00000198420	ENST00000479870;ENST00000355951	.	.	.	3.21	3.21	0.36854	.	0.133113	0.51477	D	0.000089	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-10.8657	12.6981	0.57016	0.0:0.0:1.0:0.0	.	.	.	.	X	737	.	ENSP00000348220:S737X	S	-	2	0	FAM115A	143187145	1.000000	0.71417	0.925000	0.36789	0.992000	0.81027	7.316000	0.79007	2.102000	0.63906	0.655000	0.94253	TCA	.		0.572	FAM115A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000349583.1	NM_014719	
MYOM2	9172	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	8	2040266	2040266	+	Missense_Mutation	SNP	C	C	A			TCGA-OR-A5L2-01A-11D-A30A-10	TCGA-OR-A5L2-10A-01D-A30A-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b99bd79e-aa33-4896-8d10-2517c793f439	48e26b1d-b84d-432b-940b-9907c81ddf5b	g.chr8:2040266C>A	ENST00000262113.4	+	16	2062	c.1921C>A	c.(1921-1923)Ctg>Atg	p.L641M	MYOM2_ENST00000523438.1_Missense_Mutation_p.L66M	NM_003970.2	NP_003961.2	P54296	MYOM2_HUMAN	myomesin 2	641	Fibronectin type-III 3. {ECO:0000255|PROSITE-ProRule:PRU00316}.				muscle contraction (GO:0006936)	M band (GO:0031430)|mitochondrion (GO:0005739)|myosin filament (GO:0032982)	structural constituent of muscle (GO:0008307)			autonomic_ganglia(2)|breast(4)|central_nervous_system(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(11)|kidney(2)|large_intestine(17)|lung(39)|ovary(5)|prostate(1)|skin(10)|upper_aerodigestive_tract(3)	104		Ovarian(12;0.0572)|Colorectal(14;0.0844)|Hepatocellular(245;0.217)		BRCA - Breast invasive adenocarcinoma(11;1.85e-05)|Colorectal(4;0.0101)|READ - Rectum adenocarcinoma(4;0.148)|COAD - Colon adenocarcinoma(4;0.179)		TGAGGAGGACCTGCTGGGCTA	0.602																																					p.L641M		.											.	MYOM2-95	0			c.C1921A						.						178.0	145.0	157.0					8																	2040266		2203	4300	6503	SO:0001583	missense	9172	exon16			GAGGACCTGCTGG		CCDS5957.1	8p23.3	2014-06-06	2012-10-17		ENSG00000036448	ENSG00000036448		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	7614	protein-coding gene	gene with protein product		603509	"""myomesin (M-protein) 2 (165kD)"", ""myomesin (M-protein) 2, 165kDa"""				Standard	XM_006716237		Approved		uc003wpx.4	P54296	OTTHUMG00000129175	ENST00000262113.4:c.1921C>A	8.37:g.2040266C>A	ENSP00000262113:p.Leu641Met	Somatic	218	1		WXS	Illumina GAIIx	Phase_I	265	126	NM_003970	0	0	0	0	0	Q7Z3Y2	Missense_Mutation	SNP	ENST00000262113.4	37	CCDS5957.1	.	.	.	.	.	.	.	.	.	.	C	17.68	3.450404	0.63290	.	.	ENSG00000036448	ENST00000262113;ENST00000523438	T;T	0.58652	0.32;0.32	5.72	3.94	0.45596	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.000000	0.64402	D	0.000001	T	0.79275	0.4418	M	0.93150	3.385	0.36612	D	0.875249	D	0.89917	1.0	D	0.97110	1.0	D	0.83425	0.0035	10	0.66056	D	0.02	.	8.5707	0.33567	0.0:0.6914:0.0:0.3086	.	641	P54296	MYOM2_HUMAN	M	641;66	ENSP00000262113:L641M;ENSP00000428396:L66M	ENSP00000262113:L641M	L	+	1	2	MYOM2	2027673	0.998000	0.40836	0.996000	0.52242	0.865000	0.49528	0.942000	0.29017	0.784000	0.33661	0.555000	0.69702	CTG	.		0.602	MYOM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251249.1	NM_003970	
SGK223	157285	broad.mit.edu	37	8	8239069	8239069	+	Missense_Mutation	SNP	C	C	A			TCGA-OR-A5L2-01A-11D-A30A-10	TCGA-OR-A5L2-10A-01D-A30A-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b99bd79e-aa33-4896-8d10-2517c793f439	48e26b1d-b84d-432b-940b-9907c81ddf5b	g.chr8:8239069C>A	ENST00000520004.1	-	2	453	c.189G>T	c.(187-189)agG>agT	p.R63S	SGK223_ENST00000330777.4_Missense_Mutation_p.R63S			Q86YV5	SG223_HUMAN		63							ATP binding (GO:0005524)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)										AGTTCTCAGGCCTGGGAGGCA	0.657																																					p.R63S	GBM(34;731 755 10259 33573 33867)	.											.	.	0			c.G189T						.						48.0	49.0	49.0					8																	8239069		2004	4157	6161	SO:0001583	missense	0	exon1			CTCAGGCCTGGGA																												ENST00000520004.1:c.189G>T	8.37:g.8239069C>A	ENSP00000428054:p.Arg63Ser	Somatic	44	1		WXS	Illumina GAIIx	Phase_I	92	9	NM_001080826	0	0	0	0	0	Q8N3N5	Missense_Mutation	SNP	ENST00000520004.1	37	CCDS43706.1	.	.	.	.	.	.	.	.	.	.	C	13.44	2.236881	0.39498	.	.	ENSG00000182319	ENST00000330777;ENST00000520004	T;T	0.59083	0.29;0.29	4.49	2.69	0.31865	.	0.226672	0.30658	N	0.009160	T	0.41696	0.1170	L	0.38531	1.155	0.27832	N	0.941416	B	0.31968	0.349	B	0.24701	0.055	T	0.44802	-0.9304	10	0.72032	D	0.01	.	8.2345	0.31618	0.0:0.7459:0.0:0.2541	.	63	Q86YV5	SG223_HUMAN	S	63	ENSP00000330930:R63S;ENSP00000428054:R63S	ENSP00000330930:R63S	R	-	3	2	AC068353.1	8276479	1.000000	0.71417	0.887000	0.34795	0.775000	0.43874	0.980000	0.29513	1.272000	0.44329	-0.230000	0.12252	AGG	.		0.657	SGK223-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374864.1		
COL22A1	169044	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	139793209	139793209	+	Silent	SNP	C	C	A			TCGA-OR-A5L2-01A-11D-A30A-10	TCGA-OR-A5L2-10A-01D-A30A-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b99bd79e-aa33-4896-8d10-2517c793f439	48e26b1d-b84d-432b-940b-9907c81ddf5b	g.chr8:139793209C>A	ENST00000303045.6	-	13	2057	c.1611G>T	c.(1609-1611)ctG>ctT	p.L537L	COL22A1_ENST00000435777.1_Silent_p.L537L	NM_152888.1	NP_690848.1	Q8NFW1	COMA1_HUMAN	collagen, type XXII, alpha 1	537	Collagen-like 2.|Gly-rich.|Pro-rich.				extracellular matrix organization (GO:0030198)	collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)				breast(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(14)|large_intestine(29)|lung(107)|ovary(13)|pancreas(1)|prostate(3)|skin(12)|upper_aerodigestive_tract(15)|urinary_tract(4)	211	all_epithelial(106;1.55e-12)|Lung NSC(106;1.67e-05)|all_lung(105;3.39e-05)|Ovarian(258;0.00672)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0517)			GGGGGCCGGGCAGGCCCAGGG	0.537										HNSCC(7;0.00092)																											p.L537L		.											.	COL22A1-103	0			c.G1611T						.						73.0	77.0	76.0					8																	139793209		2203	4300	6503	SO:0001819	synonymous_variant	169044	exon13			GCCGGGCAGGCCC	AF406780	CCDS6376.1	8q24.3	2013-01-16			ENSG00000169436	ENSG00000169436		"""Collagens"""	22989	protein-coding gene	gene with protein product		610026					Standard	NM_152888		Approved		uc003yvd.3	Q8NFW1	OTTHUMG00000150035	ENST00000303045.6:c.1611G>T	8.37:g.139793209C>A		Somatic	33	0		WXS	Illumina GAIIx	Phase_I	76	39	NM_152888	0	0	0	0	0	B7ZMH0|C9K0G4|Q8IVT9	Silent	SNP	ENST00000303045.6	37	CCDS6376.1																																																																																			.		0.537	COL22A1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000315905.2	XM_291257	
FAM83H	286077	hgsc.bcm.edu	37	8	144808866	144808866	+	Missense_Mutation	SNP	C	C	T	rs431825180		TCGA-OR-A5L2-01A-11D-A30A-10	TCGA-OR-A5L2-10A-01D-A30A-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b99bd79e-aa33-4896-8d10-2517c793f439	48e26b1d-b84d-432b-940b-9907c81ddf5b	g.chr8:144808866C>T	ENST00000388913.3	-	5	2890	c.2765G>A	c.(2764-2766)cGc>cAc	p.R922H		NM_198488.3	NP_940890	Q6ZRV2	FA83H_HUMAN	family with sequence similarity 83, member H	922					biomineral tissue development (GO:0031214)					central_nervous_system(2)|endometrium(1)|large_intestine(1)|lung(12)|pancreas(1)|prostate(3)|urinary_tract(1)	21	all_cancers(97;3.74e-11)|all_epithelial(106;2.62e-09)|Lung NSC(106;0.00013)|all_lung(105;0.000374)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;3.38e-41)|Epithelial(56;6.8e-40)|all cancers(56;6.43e-35)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.146)			ACTGCTCCTGCGCTCCGGCAC	0.711																																					p.R922H		.											.	FAM83H-92	0			c.G2765A						.						6.0	8.0	7.0					8																	144808866		1899	3968	5867	SO:0001583	missense	286077	exon5			CTCCTGCGCTCCG	AK127960	CCDS6410.2	8q24.3	2014-03-13			ENSG00000180921	ENSG00000180921			24797	protein-coding gene	gene with protein product		611927				18252228	Standard	NM_198488		Approved	FLJ46072	uc003yzk.3	Q6ZRV2	OTTHUMG00000133559	ENST00000388913.3:c.2765G>A	8.37:g.144808866C>T	ENSP00000373565:p.Arg922His	Somatic	6	0		WXS	Illumina GAIIx	Phase_I	34	12	NM_198488	0	0	0	0	0	A0JLS2|Q8N4W0	Missense_Mutation	SNP	ENST00000388913.3	37	CCDS6410.2	.	.	.	.	.	.	.	.	.	.	c	14.68	2.608321	0.46527	.	.	ENSG00000180921	ENST00000388913	T	0.15487	2.42	4.68	2.72	0.32119	.	0.742449	0.11596	N	0.548220	T	0.10852	0.0265	L	0.27053	0.805	0.09310	N	0.999991	B	0.15473	0.013	B	0.06405	0.002	T	0.24048	-1.0171	10	0.44086	T	0.13	.	4.408	0.11418	0.0:0.6068:0.1876:0.2057	.	922	Q6ZRV2	FA83H_HUMAN	H	922	ENSP00000373565:R922H	ENSP00000373565:R922H	R	-	2	0	FAM83H	144880854	0.996000	0.38824	0.989000	0.46669	0.341000	0.28922	0.331000	0.19733	0.979000	0.38497	0.500000	0.49745	CGC	.		0.711	FAM83H-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257632.2	NM_198488	
PLEC	5339	hgsc.bcm.edu	37	8	144998169	144998169	+	Silent	SNP	C	C	T	rs1140522	byFrequency	TCGA-OR-A5L2-01A-11D-A30A-10	TCGA-OR-A5L2-10A-01D-A30A-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b99bd79e-aa33-4896-8d10-2517c793f439	48e26b1d-b84d-432b-940b-9907c81ddf5b	g.chr8:144998169C>T	ENST00000322810.4	-	31	6508	c.6339G>A	c.(6337-6339)gcG>gcA	p.A2113A	PLEC_ENST00000354958.2_Silent_p.A1954A|PLEC_ENST00000527096.1_Silent_p.A1999A|PLEC_ENST00000354589.3_Silent_p.A1976A|PLEC_ENST00000398774.2_Silent_p.A1944A|PLEC_ENST00000436759.2_Silent_p.A2003A|PLEC_ENST00000356346.3_Silent_p.A1962A|PLEC_ENST00000345136.3_Silent_p.A1976A|PLEC_ENST00000357649.2_Silent_p.A1980A	NM_201380.2	NP_958782.1	Q15149	PLEC_HUMAN	plectin	2113	Central fibrous rod domain.				apoptotic process (GO:0006915)|cell junction assembly (GO:0034329)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)	costamere (GO:0043034)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|hemidesmosome (GO:0030056)|intermediate filament cytoskeleton (GO:0045111)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|sarcoplasm (GO:0016528)	ankyrin binding (GO:0030506)|poly(A) RNA binding (GO:0044822)|structural constituent of muscle (GO:0008307)			NS(1)|breast(3)|central_nervous_system(4)|cervix(7)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(8)|lung(57)|ovary(4)|pancreas(2)|prostate(11)|skin(9)|stomach(2)|upper_aerodigestive_tract(10)	137						CCTCCTCCGCCGCCAGCTGCC	0.741													C|||	1156	0.230831	0.028	0.2968	5008	,	,		12421	0.1429		0.4274	False		,,,				2504	0.3466				p.A2113A		.											.	PLEC-141	0			c.G6339A						.	C	,,,,,,,	297,3657		19,259,1699	5.0	7.0	6.0		6009,5886,5862,6339,5832,5928,5940,5928	-8.9	0.0	8	dbSNP_86	6	2901,4993		551,1799,1597	no	coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous	PLEC	NM_000445.3,NM_201378.2,NM_201379.1,NM_201380.2,NM_201381.1,NM_201382.2,NM_201383.1,NM_201384.1	,,,,,,,	570,2058,3296	TT,TC,CC		36.7494,7.5114,26.9919	,,,,,,,	2003/4575,1962/4534,1954/4526,2113/4685,1944/4516,1976/4548,1980/4552,1976/4548	144998169	3198,8650	1977	3947	5924	SO:0001819	synonymous_variant	5339	exon31			CTCCGCCGCCAGC	U53204	CCDS43769.1, CCDS43770.1, CCDS43771.1, CCDS43772.1, CCDS43773.1, CCDS43774.1, CCDS43775.1, CCDS47936.1	8q24	2010-02-04	2010-02-04	2010-02-04	ENSG00000178209	ENSG00000178209			9069	protein-coding gene	gene with protein product		601282	"""plectin 1, intermediate filament binding protein, 500kD"", ""epidermolysis bullosa simplex 1 (Ogna)"", ""plectin 1, intermediate filament binding protein 500kDa"""	EBS1, PLEC1		8633055, 8696340	Standard	XM_005250976		Approved	PCN, PLTN	uc003zaf.1	Q15149	OTTHUMG00000165291	ENST00000322810.4:c.6339G>A	8.37:g.144998169C>T		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	12	8	NM_201380	0	0	0	0	0	Q15148|Q16640|Q6S376|Q6S377|Q6S378|Q6S379|Q6S380|Q6S381|Q6S382|Q6S383	Silent	SNP	ENST00000322810.4	37	CCDS43772.1																																																																																			C|0.740;T|0.260		0.741	PLEC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383281.1	NM_000445	
PLEC	5339	hgsc.bcm.edu	37	8	144998190	144998190	+	Silent	SNP	A	A	G	rs2857829	byFrequency	TCGA-OR-A5L2-01A-11D-A30A-10	TCGA-OR-A5L2-10A-01D-A30A-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b99bd79e-aa33-4896-8d10-2517c793f439	48e26b1d-b84d-432b-940b-9907c81ddf5b	g.chr8:144998190A>G	ENST00000322810.4	-	31	6487	c.6318T>C	c.(6316-6318)gcT>gcC	p.A2106A	PLEC_ENST00000354958.2_Silent_p.A1947A|PLEC_ENST00000527096.1_Silent_p.A1992A|PLEC_ENST00000354589.3_Silent_p.A1969A|PLEC_ENST00000398774.2_Silent_p.A1937A|PLEC_ENST00000436759.2_Silent_p.A1996A|PLEC_ENST00000356346.3_Silent_p.A1955A|PLEC_ENST00000345136.3_Silent_p.A1969A|PLEC_ENST00000357649.2_Silent_p.A1973A	NM_201380.2	NP_958782.1	Q15149	PLEC_HUMAN	plectin	2106	Central fibrous rod domain.				apoptotic process (GO:0006915)|cell junction assembly (GO:0034329)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)	costamere (GO:0043034)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|hemidesmosome (GO:0030056)|intermediate filament cytoskeleton (GO:0045111)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|sarcoplasm (GO:0016528)	ankyrin binding (GO:0030506)|poly(A) RNA binding (GO:0044822)|structural constituent of muscle (GO:0008307)			NS(1)|breast(3)|central_nervous_system(4)|cervix(7)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(8)|lung(57)|ovary(4)|pancreas(2)|prostate(11)|skin(9)|stomach(2)|upper_aerodigestive_tract(10)	137						GCTGCCTCGCAGCCTCCAGCT	0.746													a|||	1156	0.230831	0.028	0.2968	5008	,	,		12955	0.1429		0.4274	False		,,,				2504	0.3466				p.A2106A		.											.	PLEC-141	0			c.T6318C						.	G	,,,,,,,	343,3813		21,301,1756	7.0	8.0	8.0		5988,5865,5841,6318,5811,5907,5919,5907	-8.1	0.0	8	dbSNP_100	8	3082,5166		620,1842,1662	no	coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous	PLEC	NM_000445.3,NM_201378.2,NM_201379.1,NM_201380.2,NM_201381.1,NM_201382.2,NM_201383.1,NM_201384.1	,,,,,,,	641,2143,3418	GG,GA,AA		37.3666,8.2531,27.6121	,,,,,,,	1996/4575,1955/4534,1947/4526,2106/4685,1937/4516,1969/4548,1973/4552,1969/4548	144998190	3425,8979	2078	4124	6202	SO:0001819	synonymous_variant	5339	exon31			CCTCGCAGCCTCC	U53204	CCDS43769.1, CCDS43770.1, CCDS43771.1, CCDS43772.1, CCDS43773.1, CCDS43774.1, CCDS43775.1, CCDS47936.1	8q24	2010-02-04	2010-02-04	2010-02-04	ENSG00000178209	ENSG00000178209			9069	protein-coding gene	gene with protein product		601282	"""plectin 1, intermediate filament binding protein, 500kD"", ""epidermolysis bullosa simplex 1 (Ogna)"", ""plectin 1, intermediate filament binding protein 500kDa"""	EBS1, PLEC1		8633055, 8696340	Standard	XM_005250976		Approved	PCN, PLTN	uc003zaf.1	Q15149	OTTHUMG00000165291	ENST00000322810.4:c.6318T>C	8.37:g.144998190A>G		Somatic	5	0		WXS	Illumina GAIIx	Phase_I	22	15	NM_201380	0	0	0	0	0	Q15148|Q16640|Q6S376|Q6S377|Q6S378|Q6S379|Q6S380|Q6S381|Q6S382|Q6S383	Silent	SNP	ENST00000322810.4	37	CCDS43772.1																																																																																			A|0.738;G|0.262		0.746	PLEC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383281.1	NM_000445	
PLEC	5339	hgsc.bcm.edu	37	8	145001784	145001784	+	Silent	SNP	A	A	G	rs3135109	byFrequency	TCGA-OR-A5L2-01A-11D-A30A-10	TCGA-OR-A5L2-10A-01D-A30A-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b99bd79e-aa33-4896-8d10-2517c793f439	48e26b1d-b84d-432b-940b-9907c81ddf5b	g.chr8:145001784A>G	ENST00000322810.4	-	27	4130	c.3961T>C	c.(3961-3963)Ttg>Ctg	p.L1321L	PLEC_ENST00000354958.2_Silent_p.L1162L|PLEC_ENST00000527096.1_Silent_p.L1207L|PLEC_ENST00000354589.3_Silent_p.L1184L|PLEC_ENST00000398774.2_Silent_p.L1152L|PLEC_ENST00000436759.2_Silent_p.L1211L|PLEC_ENST00000356346.3_Silent_p.L1170L|PLEC_ENST00000345136.3_Silent_p.L1184L|PLEC_ENST00000357649.2_Silent_p.L1188L	NM_201380.2	NP_958782.1	Q15149	PLEC_HUMAN	plectin	1321	Globular 1.		L -> V (in dbSNP:rs3135109). {ECO:0000269|PubMed:8698233}.		apoptotic process (GO:0006915)|cell junction assembly (GO:0034329)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)	costamere (GO:0043034)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|hemidesmosome (GO:0030056)|intermediate filament cytoskeleton (GO:0045111)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|sarcoplasm (GO:0016528)	ankyrin binding (GO:0030506)|poly(A) RNA binding (GO:0044822)|structural constituent of muscle (GO:0008307)			NS(1)|breast(3)|central_nervous_system(4)|cervix(7)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(8)|lung(57)|ovary(4)|pancreas(2)|prostate(11)|skin(9)|stomach(2)|upper_aerodigestive_tract(10)	137						CGCTCAAGCAACTGGGCGACC	0.716													G|||	1156	0.230831	0.028	0.2954	5008	,	,		12494	0.1429		0.4274	False		,,,				2504	0.3476				p.L1321L		.											.	PLEC-141	0			c.T3961C						.	G	,,,,,,,	296,3620		20,256,1682	5.0	6.0	6.0		3631,3508,3484,3961,3454,3550,3562,3550	4.4	0.9	8	dbSNP_103	6	2835,5065		532,1771,1647	no	coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous	PLEC	NM_000445.3,NM_201378.2,NM_201379.1,NM_201380.2,NM_201381.1,NM_201382.2,NM_201383.1,NM_201384.1	,,,,,,,	552,2027,3329	GG,GA,AA		35.8861,7.5587,26.498	,,,,,,,	1211/4575,1170/4534,1162/4526,1321/4685,1152/4516,1184/4548,1188/4552,1184/4548	145001784	3131,8685	1958	3950	5908	SO:0001819	synonymous_variant	5339	exon27			CAAGCAACTGGGC	U53204	CCDS43769.1, CCDS43770.1, CCDS43771.1, CCDS43772.1, CCDS43773.1, CCDS43774.1, CCDS43775.1, CCDS47936.1	8q24	2010-02-04	2010-02-04	2010-02-04	ENSG00000178209	ENSG00000178209			9069	protein-coding gene	gene with protein product		601282	"""plectin 1, intermediate filament binding protein, 500kD"", ""epidermolysis bullosa simplex 1 (Ogna)"", ""plectin 1, intermediate filament binding protein 500kDa"""	EBS1, PLEC1		8633055, 8696340	Standard	XM_005250976		Approved	PCN, PLTN	uc003zaf.1	Q15149	OTTHUMG00000165291	ENST00000322810.4:c.3961T>C	8.37:g.145001784A>G		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	56	40	NM_201380	0	0	0	0	0	Q15148|Q16640|Q6S376|Q6S377|Q6S378|Q6S379|Q6S380|Q6S381|Q6S382|Q6S383	Silent	SNP	ENST00000322810.4	37	CCDS43772.1																																																																																			G|0.246;A|0.754		0.716	PLEC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383281.1	NM_000445	
ERMP1	79956	broad.mit.edu	37	9	5801292	5801292	+	Frame_Shift_Del	DEL	T	T	-			TCGA-OR-A5L2-01A-11D-A30A-10	TCGA-OR-A5L2-10A-01D-A30A-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b99bd79e-aa33-4896-8d10-2517c793f439	48e26b1d-b84d-432b-940b-9907c81ddf5b	g.chr9:5801292delT	ENST00000339450.5	-	11	2040	c.1951delA	c.(1951-1953)accfs	p.T651fs	ERMP1_ENST00000381506.3_3'UTR|ERMP1_ENST00000214893.5_5'UTR|ERMP1_ENST00000543230.1_Frame_Shift_Del_p.T229fs	NM_024896.2	NP_079172.2	Q7Z2K6	ERMP1_HUMAN	endoplasmic reticulum metallopeptidase 1	651						endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	metal ion binding (GO:0046872)|metallopeptidase activity (GO:0008237)			endometrium(2)|kidney(1)|large_intestine(9)|lung(4)|ovary(1)|prostate(2)|skin(1)	20		Acute lymphoblastic leukemia(23;0.158)		GBM - Glioblastoma multiforme(50;0.00115)|Lung(218;0.111)		GTTAGCATGGTTTTTTTTGTG	0.358																																					p.T651fs		.											.	ERMP1-69	0			c.1951delA						.						138.0	145.0	142.0					9																	5801292		2203	4300	6503	SO:0001589	frameshift_variant	79956	exon11			GCATGGTTTTTTT	AB058718	CCDS34983.1	9p24	2008-02-05	2007-07-05	2007-07-05	ENSG00000099219	ENSG00000099219			23703	protein-coding gene	gene with protein product	"""Felix-ina"""	611156	"""KIAA1815"""	KIAA1815		11347906	Standard	XM_005251587		Approved	FLJ23309, FXNA	uc003zjm.1	Q7Z2K6	OTTHUMG00000019508	ENST00000339450.5:c.1951delA	9.37:g.5801292delT	ENSP00000340427:p.Thr651fs	Somatic	142	0		WXS	Illumina GAIIx	Phase_I	675	8	NM_024896	0	0	0	0	0	B2RNA4|B3KSB1|Q8N5T5|Q9H5M1	Frame_Shift_Del	DEL	ENST00000339450.5	37	CCDS34983.1																																																																																			.		0.358	ERMP1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354877.1	NM_024896	
ERMP1	79956	hgsc.bcm.edu	37	9	5832728	5832728	+	Silent	SNP	G	G	C	rs1131727	byFrequency	TCGA-OR-A5L2-01A-11D-A30A-10	TCGA-OR-A5L2-10A-01D-A30A-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b99bd79e-aa33-4896-8d10-2517c793f439	48e26b1d-b84d-432b-940b-9907c81ddf5b	g.chr9:5832728G>C	ENST00000339450.5	-	1	389	c.300C>G	c.(298-300)gcC>gcG	p.A100A	ERMP1_ENST00000381506.3_5'Flank|ERMP1_ENST00000214893.5_5'UTR	NM_024896.2	NP_079172.2	Q7Z2K6	ERMP1_HUMAN	endoplasmic reticulum metallopeptidase 1	100						endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	metal ion binding (GO:0046872)|metallopeptidase activity (GO:0008237)			endometrium(2)|kidney(1)|large_intestine(9)|lung(4)|ovary(1)|prostate(2)|skin(1)	20		Acute lymphoblastic leukemia(23;0.158)		GBM - Glioblastoma multiforme(50;0.00115)|Lung(218;0.111)		GGTGTCCAGCGGCCCCGCGTA	0.741													G|||	2021	0.403554	0.1309	0.428	5008	,	,		3601	0.7093		0.34	False		,,,				2504	0.5051				p.A100A		.											.	ERMP1-69	0			c.C300G						.						4.0	3.0	3.0					9																	5832728		1620	3326	4946	SO:0001819	synonymous_variant	79956	exon1			TCCAGCGGCCCCG	AB058718	CCDS34983.1	9p24	2008-02-05	2007-07-05	2007-07-05	ENSG00000099219	ENSG00000099219			23703	protein-coding gene	gene with protein product	"""Felix-ina"""	611156	"""KIAA1815"""	KIAA1815		11347906	Standard	XM_005251587		Approved	FLJ23309, FXNA	uc003zjm.1	Q7Z2K6	OTTHUMG00000019508	ENST00000339450.5:c.300C>G	9.37:g.5832728G>C		Somatic	2	0		WXS	Illumina GAIIx	Phase_I	91	86	NM_024896	0	0	0	0	0	B2RNA4|B3KSB1|Q8N5T5|Q9H5M1	Silent	SNP	ENST00000339450.5	37	CCDS34983.1																																																																																			G|0.572;C|0.428		0.741	ERMP1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354877.1	NM_024896	
UHRF2	115426	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	9	6460639	6460639	+	Missense_Mutation	SNP	G	G	C			TCGA-OR-A5L2-01A-11D-A30A-10	TCGA-OR-A5L2-10A-01D-A30A-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b99bd79e-aa33-4896-8d10-2517c793f439	48e26b1d-b84d-432b-940b-9907c81ddf5b	g.chr9:6460639G>C	ENST00000276893.5	+	4	879	c.711G>C	c.(709-711)ttG>ttC	p.L237F		NM_152896.2	NP_690856.1	Q96PU4	UHRF2_HUMAN	ubiquitin-like with PHD and ring finger domains 2, E3 ubiquitin protein ligase	237	Interaction with PCNP.|Required for interaction with histone H3. {ECO:0000250}.				cell cycle (GO:0007049)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|positive regulation of cell cycle arrest (GO:0071158)|protein autoubiquitination (GO:0051865)|protein ubiquitination (GO:0016567)|regulation of cell cycle (GO:0051726)|ubiquitin-dependent protein catabolic process (GO:0006511)	nuclear heterochromatin (GO:0005720)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone binding (GO:0042393)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			cervix(2)|endometrium(2)|kidney(3)|large_intestine(4)|lung(5)|ovary(1)	17		Acute lymphoblastic leukemia(23;0.158)		GBM - Glioblastoma multiforme(50;0.0392)|Lung(218;0.129)		GAACCATTTTGAAATGGAATG	0.373																																					p.L237F		.											.	UHRF2-721	0			c.G711C						.						109.0	111.0	110.0					9																	6460639		2203	4300	6503	SO:0001583	missense	115426	exon4			CATTTTGAAATGG	AF274049	CCDS6469.1	9p24.1	2013-01-28	2012-02-23		ENSG00000147854	ENSG00000147854		"""RING-type (C3HC4) zinc fingers"", ""Zinc fingers, PHD-type"""	12557	protein-coding gene	gene with protein product	"""Np95-like ring finger protein"""	615211	"""ubiquitin-like with PHD and ring finger domains 2"""			12176013	Standard	NM_152896		Approved	RNF107, NIRF, URF2, MGC33463	uc003zjy.3	Q96PU4	OTTHUMG00000019521	ENST00000276893.5:c.711G>C	9.37:g.6460639G>C	ENSP00000276893:p.Leu237Phe	Somatic	67	0		WXS	Illumina GAIIx	Phase_I	85	11	NM_152896	0	0	0	0	0	Q5VYR1|Q5VYR3|Q659C8|Q8TAG7	Missense_Mutation	SNP	ENST00000276893.5	37	CCDS6469.1	.	.	.	.	.	.	.	.	.	.	G	18.32	3.598527	0.66332	.	.	ENSG00000147854	ENST00000276893;ENST00000450508	D;T	0.87809	-2.3;0.6	5.97	2.92	0.33932	Domain of unknown function DUF3590 (1);	0.075523	0.53938	D	0.000058	D	0.89255	0.6663	M	0.61703	1.905	0.80722	D	1	D;D	0.59767	0.97;0.986	P;D	0.63597	0.898;0.916	D	0.87332	0.2325	10	0.87932	D	0	-6.465	4.9406	0.13963	0.2415:0.0:0.6131:0.1454	.	14;237	B3KV82;Q96PU4	.;UHRF2_HUMAN	F	237;14	ENSP00000276893:L237F;ENSP00000399217:L14F	ENSP00000276893:L237F	L	+	3	2	UHRF2	6450639	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	1.811000	0.38942	0.774000	0.33427	0.585000	0.79938	TTG	.		0.373	UHRF2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051665.3	NM_152306	
UHRF2	115426	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	9	6460721	6460721	+	Missense_Mutation	SNP	G	G	C			TCGA-OR-A5L2-01A-11D-A30A-10	TCGA-OR-A5L2-10A-01D-A30A-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b99bd79e-aa33-4896-8d10-2517c793f439	48e26b1d-b84d-432b-940b-9907c81ddf5b	g.chr9:6460721G>C	ENST00000276893.5	+	4	961	c.793G>C	c.(793-795)Gat>Cat	p.D265H		NM_152896.2	NP_690856.1	Q96PU4	UHRF2_HUMAN	ubiquitin-like with PHD and ring finger domains 2, E3 ubiquitin protein ligase	265	Interaction with PCNP.|Required for interaction with histone H3. {ECO:0000250}.				cell cycle (GO:0007049)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|positive regulation of cell cycle arrest (GO:0071158)|protein autoubiquitination (GO:0051865)|protein ubiquitination (GO:0016567)|regulation of cell cycle (GO:0051726)|ubiquitin-dependent protein catabolic process (GO:0006511)	nuclear heterochromatin (GO:0005720)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone binding (GO:0042393)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			cervix(2)|endometrium(2)|kidney(3)|large_intestine(4)|lung(5)|ovary(1)	17		Acute lymphoblastic leukemia(23;0.158)		GBM - Glioblastoma multiforme(50;0.0392)|Lung(218;0.129)		ATTCTGGTTTGATGCAGAAAT	0.363																																					p.D265H		.											.	UHRF2-721	0			c.G793C						.						119.0	122.0	121.0					9																	6460721		2203	4300	6503	SO:0001583	missense	115426	exon4			TGGTTTGATGCAG	AF274049	CCDS6469.1	9p24.1	2013-01-28	2012-02-23		ENSG00000147854	ENSG00000147854		"""RING-type (C3HC4) zinc fingers"", ""Zinc fingers, PHD-type"""	12557	protein-coding gene	gene with protein product	"""Np95-like ring finger protein"""	615211	"""ubiquitin-like with PHD and ring finger domains 2"""			12176013	Standard	NM_152896		Approved	RNF107, NIRF, URF2, MGC33463	uc003zjy.3	Q96PU4	OTTHUMG00000019521	ENST00000276893.5:c.793G>C	9.37:g.6460721G>C	ENSP00000276893:p.Asp265His	Somatic	87	0		WXS	Illumina GAIIx	Phase_I	110	12	NM_152896	0	0	0	0	0	Q5VYR1|Q5VYR3|Q659C8|Q8TAG7	Missense_Mutation	SNP	ENST00000276893.5	37	CCDS6469.1	.	.	.	.	.	.	.	.	.	.	G	26.3	4.723019	0.89298	.	.	ENSG00000147854	ENST00000276893;ENST00000450508	D;T	0.91068	-2.78;0.02	5.97	5.97	0.96955	.	0.102387	0.64402	D	0.000005	D	0.95408	0.8509	M	0.75615	2.305	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.79108	0.992;0.992	D	0.95158	0.8279	10	0.87932	D	0	-23.4782	20.0428	0.97598	0.0:0.0:1.0:0.0	.	42;265	B3KV82;Q96PU4	.;UHRF2_HUMAN	H	265;42	ENSP00000276893:D265H;ENSP00000399217:D42H	ENSP00000276893:D265H	D	+	1	0	UHRF2	6450721	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	8.873000	0.92357	2.833000	0.97629	0.585000	0.79938	GAT	.		0.363	UHRF2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051665.3	NM_152306	
TAF1L	138474	hgsc.bcm.edu	37	9	32633584	32633584	+	Frame_Shift_Del	DEL	T	T	-			TCGA-OR-A5L2-01A-11D-A30A-10	TCGA-OR-A5L2-10A-01D-A30A-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b99bd79e-aa33-4896-8d10-2517c793f439	48e26b1d-b84d-432b-940b-9907c81ddf5b	g.chr9:32633584delT	ENST00000242310.4	-	1	2083	c.1994delA	c.(1993-1995)aagfs	p.K665fs	RP11-555J4.4_ENST00000430787.1_RNA	NM_153809.2	NP_722516.1	Q8IZX4	TAF1L_HUMAN	TAF1 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 210kDa-like	665					DNA-templated transcription, initiation (GO:0006352)|histone acetylation (GO:0016573)|male meiosis (GO:0007140)|positive regulation of transcription, DNA-templated (GO:0045893)|protein phosphorylation (GO:0006468)|regulation of transcription from RNA polymerase II promoter (GO:0006357)	transcription factor TFIID complex (GO:0005669)	DNA binding (GO:0003677)|histone acetyltransferase activity (GO:0004402)|lysine-acetylated histone binding (GO:0070577)|protein serine/threonine kinase activity (GO:0004674)|TBP-class protein binding (GO:0017025)	p.K665fs*4(2)		breast(6)|central_nervous_system(4)|endometrium(14)|kidney(11)|large_intestine(32)|liver(2)|lung(68)|ovary(2)|pancreas(2)|prostate(7)|skin(9)|stomach(1)|upper_aerodigestive_tract(1)	159			LUSC - Lung squamous cell carcinoma(29;0.0181)	GBM - Glioblastoma multiforme(74;0.00301)		CATCTTGGCCTTTTTTTTGAT	0.478																																					p.K665fs		.											.	TAF1L-870	2	Deletion - Frameshift(2)	large_intestine(2)	c.1994delA						.						151.0	142.0	145.0					9																	32633584		2203	4300	6503	SO:0001589	frameshift_variant	138474	exon1			TTGGCCTTTTTTT	AF390562	CCDS35003.1	9p12	2007-07-27	2007-07-27		ENSG00000122728	ENSG00000122728			18056	protein-coding gene	gene with protein product		607798	"""TAF1-like RNA polymerase II, TATA box binding protein (TBP)-associated factor, 210kDa"""			12217962	Standard	NM_153809		Approved		uc003zrg.1	Q8IZX4	OTTHUMG00000019747	ENST00000242310.4:c.1994delA	9.37:g.32633584delT	ENSP00000418379:p.Lys665fs	Somatic	263	1		WXS	Illumina GAIIx	Phase_I	1628	13	NM_153809	0	0	0	0	0	Q0VG57	Frame_Shift_Del	DEL	ENST00000242310.4	37	CCDS35003.1																																																																																			.		0.478	TAF1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052012.2		
AQP7	364	ucsc.edu	37	9	33385287	33385287	+	3'UTR	SNP	T	T	C	rs74557595		TCGA-OR-A5L2-01A-11D-A30A-10	TCGA-OR-A5L2-10A-01D-A30A-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b99bd79e-aa33-4896-8d10-2517c793f439	48e26b1d-b84d-432b-940b-9907c81ddf5b	g.chr9:33385287T>C	ENST00000537089.1	-	0	1145				AQP7_ENST00000377425.4_Intron			O14520	AQP7_HUMAN	aquaporin 7						excretion (GO:0007588)|generation of precursor metabolites and energy (GO:0006091)|glycerol transport (GO:0015793)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	glycerol channel activity (GO:0015254)|water channel activity (GO:0015250)			NS(1)|large_intestine(1)|lung(7)|ovary(1)|prostate(4)|skin(2)|stomach(1)	17			LUSC - Lung squamous cell carcinoma(29;0.00788)	GBM - Glioblastoma multiforme(74;0.191)		TTCTCCCCATTGCTGCAGGCA	0.612																																					p.N249D		.											.	AQP7-90	0			c.A745G						.						59.0	62.0	61.0					9																	33385287		2202	4298	6500	SO:0001624	3_prime_UTR_variant	364	exon8			CCCCATTGCTGCA	AB006190	CCDS6541.1	9p13	2008-02-05			ENSG00000165269	ENSG00000165269		"""Ion channels / Aquaporins"""	640	protein-coding gene	gene with protein product		602974		AQP7L		9252401	Standard	NM_001170		Approved	AQP9, AQPap	uc003zst.3	O14520	OTTHUMG00000019773	ENST00000537089.1:c.*329A>G	9.37:g.33385287T>C		Somatic	36	3		WXS	Illumina GAIIx	Phase_I	34	10	NM_001170	0	0	0	0	0	Q08E94|Q5T5L9|Q8NHM3	Missense_Mutation	SNP	ENST00000537089.1	37		.	.	.	.	.	.	.	.	.	.	c	9.798	1.179797	0.21787	.	.	ENSG00000165269	ENST00000379507;ENST00000297988;ENST00000439678	T;T;T	0.11063	2.81;2.81;2.81	4.27	3.35	0.38373	Aquaporin-like (2);	.	.	.	.	T	0.07683	0.0193	.	.	.	0.18873	N	0.999987	B	0.02656	0.0	B	0.01281	0.0	T	0.35301	-0.9794	8	0.39692	T	0.17	-1.4238	6.1852	0.20493	0.0:0.7595:0.0:0.2405	.	249	O14520	AQP7_HUMAN	D	248;249;157	ENSP00000368821:N248D;ENSP00000297988:N249D;ENSP00000410138:N157D	ENSP00000297988:N249D	N	-	1	0	AQP7	33375287	0.000000	0.05858	0.001000	0.08648	0.003000	0.03518	0.126000	0.15769	0.443000	0.26582	-0.251000	0.11542	AAT	.		0.612	AQP7-202	KNOWN	basic	protein_coding	protein_coding		NM_001170	
HRCT1	646962	broad.mit.edu	37	9	35906348	35906350	+	In_Frame_Del	DEL	CTG	CTG	-	rs370606246		TCGA-OR-A5L2-01A-11D-A30A-10	TCGA-OR-A5L2-10A-01D-A30A-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b99bd79e-aa33-4896-8d10-2517c793f439	48e26b1d-b84d-432b-940b-9907c81ddf5b	g.chr9:35906348_35906350delCTG	ENST00000354323.2	+	1	160_162	c.64_66delCTG	c.(64-66)ctgdel	p.L28del		NM_001039792.1	NP_001034881.1	Q6UXD1	HRCT1_HUMAN	histidine rich carboxyl terminus 1	28						integral component of membrane (GO:0016021)				NS(1)|haematopoietic_and_lymphoid_tissue(1)|lung(1)|prostate(1)	4						TGTGGCGGTCctgctgctgctgc	0.67																																					p.22_22del		.											.	HRCT1-22	0			c.64_66del						.			367,3839		38,291,1774						-8.3	0.0			23	737,7385		88,561,3412	no	coding	HRCT1	NM_001039792.1		126,852,5186	A1A1,A1R,RR		9.0741,8.7256,8.9552				1104,11224				SO:0001651	inframe_deletion	646962	exon1			GCGGTCCTGCTGC		CCDS35012.1	9p13.3	2008-09-30			ENSG00000196196	ENSG00000196196			33872	protein-coding gene	gene with protein product						12975309	Standard	NM_001039792		Approved	LGLL338, PRO537, UNQ338	uc003zyr.1	Q6UXD1	OTTHUMG00000154146	ENST00000354323.2:c.64_66delCTG	9.37:g.35906357_35906359delCTG	ENSP00000346283:p.Leu28del	Somatic	89	0		WXS	Illumina GAIIx	Phase_I	431	10	NM_001039792	0	0	0	0	0	B7ZBJ1	In_Frame_Del	DEL	ENST00000354323.2	37	CCDS35012.1																																																																																			.		0.670	HRCT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000334099.1	NM_001039792	
SPATA31A6	389730	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	43627272	43627272	+	Missense_Mutation	SNP	A	A	G	rs530611724	byFrequency	TCGA-OR-A5L2-01A-11D-A30A-10	TCGA-OR-A5L2-10A-01D-A30A-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b99bd79e-aa33-4896-8d10-2517c793f439	48e26b1d-b84d-432b-940b-9907c81ddf5b	g.chr9:43627272A>G	ENST00000332857.6	-	4	1443	c.1415T>C	c.(1414-1416)cTg>cCg	p.L472P	SPATA31A6_ENST00000496386.1_5'Flank	NM_001145196.1	NP_001138668.1	Q5VVP1	S31A6_HUMAN	SPATA31 subfamily A, member 6	472					cell differentiation (GO:0030154)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)											GCGGTGGGACAGGGGCTGGGC	0.522													A|||	3	0.000599042	0.0	0.0014	5008	,	,		14261	0.0		0.001	False		,,,				2504	0.001				p.L472P		.											.	.	0			c.T1415C						.						94.0	109.0	105.0					9																	43627272		616	1533	2149	SO:0001583	missense	389730	exon4			TGGGACAGGGGCT		CCDS75837.1	9p11.2	2012-10-15	2012-10-12	2012-10-12	ENSG00000185775	ENSG00000185775			32006	protein-coding gene	gene with protein product			"""family with sequence similarity 75, member A6"""	FAM75A6		20850414	Standard	NM_001145196		Approved	OTTHUMG00000013224	uc011lrb.2	Q5VVP1	OTTHUMG00000013224	ENST00000332857.6:c.1415T>C	9.37:g.43627272A>G	ENSP00000329825:p.Leu472Pro	Somatic	106	0		WXS	Illumina GAIIx	Phase_I	95	20	NM_001145196	0	0	0	0	0		Missense_Mutation	SNP	ENST00000332857.6	37	CCDS47973.1	.	.	.	.	.	.	.	.	.	.	A	9.407	1.079525	0.20309	.	.	ENSG00000185775	ENST00000332857	T	0.24723	1.84	2.26	-0.312	0.12758	.	1.322040	0.05368	N	0.534949	T	0.18130	0.0435	L	0.35644	1.08	0.18873	N	0.999986	P	0.40398	0.716	B	0.37780	0.258	T	0.17930	-1.0353	10	0.42905	T	0.14	0.4866	2.7066	0.05164	0.5587:0.2757:0.1656:0.0	.	472	Q5VVP1	F75A6_HUMAN	P	472	ENSP00000329825:L472P	ENSP00000329825:L472P	L	-	2	0	FAM75A6	43567268	0.000000	0.05858	0.001000	0.08648	0.003000	0.03518	-0.175000	0.09825	-0.064000	0.13043	-0.875000	0.02981	CTG	.		0.522	SPATA31A6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000036987.1	NM_001145196	
TRPM3	80036	broad.mit.edu;bcgsc.ca	37	9	73457979	73457979	+	Missense_Mutation	SNP	G	G	C	rs146744968		TCGA-OR-A5L2-01A-11D-A30A-10	TCGA-OR-A5L2-10A-01D-A30A-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b99bd79e-aa33-4896-8d10-2517c793f439	48e26b1d-b84d-432b-940b-9907c81ddf5b	g.chr9:73457979G>C	ENST00000377111.2	-	5	984	c.741C>G	c.(739-741)tgC>tgG	p.C247W	TRPM3_ENST00000396285.1_Missense_Mutation_p.C94W|TRPM3_ENST00000396292.4_Missense_Mutation_p.C94W|TRPM3_ENST00000361823.5_Missense_Mutation_p.C94W|TRPM3_ENST00000377105.1_Missense_Mutation_p.C94W|TRPM3_ENST00000377097.3_Missense_Mutation_p.C94W|TRPM3_ENST00000396283.1_Missense_Mutation_p.C94W|TRPM3_ENST00000377110.3_Missense_Mutation_p.C247W|TRPM3_ENST00000423814.3_Missense_Mutation_p.C249W|TRPM3_ENST00000377106.1_Missense_Mutation_p.C94W|TRPM3_ENST00000360823.2_Missense_Mutation_p.C94W|TRPM3_ENST00000408909.2_Missense_Mutation_p.C94W|TRPM3_ENST00000358082.3_Missense_Mutation_p.C94W|TRPM3_ENST00000377101.1_Missense_Mutation_p.C94W|TRPM3_ENST00000357533.2_Missense_Mutation_p.C249W|TRPM3_ENST00000396280.5_Missense_Mutation_p.C94W	NM_001007471.2	NP_001007472.2	Q9HCF6	TRPM3_HUMAN	transient receptor potential cation channel, subfamily M, member 3	247					calcium ion transmembrane transport (GO:0070588)|cation transport (GO:0006812)|detection of temperature stimulus (GO:0016048)|ion transmembrane transport (GO:0034220)|sensory perception of temperature stimulus (GO:0050951)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium activated cation channel activity (GO:0005227)|calcium channel activity (GO:0005262)|cation channel activity (GO:0005261)			NS(2)|breast(4)|central_nervous_system(2)|endometrium(6)|kidney(1)|large_intestine(18)|liver(1)|lung(46)|ovary(3)|pancreas(2)|prostate(5)|skin(4)|urinary_tract(1)	95						TACCTATGGTGCATATCTTTC	0.433																																					p.C247W		.											.	TRPM3-521	0			c.C741G						.						91.0	82.0	85.0					9																	73457979		2203	4300	6503	SO:0001583	missense	80036	exon5			TATGGTGCATATC	AB046836	CCDS6634.1, CCDS6635.1, CCDS6636.1, CCDS6637.1, CCDS43835.1, CCDS65064.1	9q21.11	2011-12-14			ENSG00000083067	ENSG00000083067		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	17992	protein-coding gene	gene with protein product	"""melastatin 2"""	608961				16382100	Standard	NM_206946		Approved	KIAA1616, LTRPC3, GON-2	uc004aid.3	Q9HCF6	OTTHUMG00000019997	ENST00000377111.2:c.741C>G	9.37:g.73457979G>C	ENSP00000366315:p.Cys247Trp	Somatic	83	0		WXS	Illumina GAIIx	Phase_I	123	6	NM_001007471	0	0	0	0	0	A2A3F6|A9Z1Y7|Q5VW02|Q5VW03|Q5VW04|Q5W5T7|Q86SH0|Q86SH6|Q86UL0|Q86WK1|Q86WK2|Q86WK3|Q86WK4|Q86YZ9|Q86Z00|Q86Z01|Q9H0X2	Missense_Mutation	SNP	ENST00000377111.2	37		.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	G|G|G	11.57|11.57|11.57	1.676796|1.676796|1.676796	0.29783|0.29783|0.29783	.|.|.	.|.|.	ENSG00000083067|ENSG00000083067|ENSG00000083067	ENST00000377097|ENST00000377111;ENST00000377110;ENST00000377106;ENST00000360823;ENST00000377105;ENST00000357533;ENST00000408909;ENST00000396285;ENST00000396292;ENST00000358082;ENST00000423814;ENST00000377101;ENST00000396283;ENST00000361823;ENST00000455451|ENST00000396280	.|T;T;T;T;T;T;T;T;T;T;T;T;T;T|.	.|0.36340|.	.|4.08;4.08;4.08;4.08;4.08;4.08;4.08;4.08;4.08;4.08;4.08;4.08;4.08;1.26|.	5.61|5.61|5.61	-0.574|-0.574|-0.574	0.11738|0.11738|0.11738	.|.|.	.|0.000000|.	.|0.85682|.	.|D|.	.|0.000000|.	T|T|T	0.59115|0.59115|0.59115	0.2170|0.2170|0.2170	L|L|L	0.57536|0.57536|0.57536	1.79|1.79|1.79	0.80722|0.80722|0.80722	D|D|D	1|1|1	.|P;B;B;B;B;D;B;B;D;B;B|.	.|0.76494|.	.|0.481;0.185;0.012;0.019;0.062;0.999;0.014;0.023;0.999;0.092;0.162|.	.|B;B;B;B;B;D;B;B;D;B;B|.	.|0.79784|.	.|0.122;0.12;0.012;0.062;0.038;0.993;0.029;0.028;0.993;0.064;0.085|.	T|T|T	0.55648|0.55648|0.55648	-0.8108|-0.8108|-0.8108	5|10|5	.|0.41790|.	.|T|.	.|0.15|.	-13.8643|-13.8643|-13.8643	10.7021|10.7021|10.7021	0.45933|0.45933|0.45933	0.371:0.0:0.629:0.0|0.371:0.0:0.629:0.0|0.371:0.0:0.629:0.0	.|.|.	.|247;249;94;247;247;247;249;94;94;247;94|.	.|Q9HCF6;Q4VXD2;Q504Y1;Q9HCF6-2;Q9HCF6-10;Q9HCF6-4;A2A3F7;A2A3F4;G5E9G1;Q9HCF6-8;A2A3F3|.	.|TRPM3_HUMAN;.;.;.;.;.;.;.;.;.;.|.	G|W|D	137|247;247;94;94;94;249;94;94;94;94;249;94;94;94;94|94	.|ENSP00000366315:C247W;ENSP00000366314:C247W;ENSP00000366310:C94W;ENSP00000354066:C94W;ENSP00000366309:C94W;ENSP00000350140:C249W;ENSP00000386127:C94W;ENSP00000379581:C94W;ENSP00000379587:C94W;ENSP00000350791:C94W;ENSP00000389542:C249W;ENSP00000366305:C94W;ENSP00000379579:C94W;ENSP00000355395:C94W|.	.|ENSP00000350140:C249W|.	A|C|H	-|-|-	2|3|1	0|2|0	TRPM3|TRPM3|TRPM3	72647799|72647799|72647799	1.000000|1.000000|1.000000	0.71417|0.71417|0.71417	0.998000|0.998000|0.998000	0.56505|0.56505|0.56505	0.985000|0.985000|0.985000	0.73830|0.73830|0.73830	0.704000|0.704000|0.704000	0.25661|0.25661|0.25661	-0.036000|-0.036000|-0.036000	0.13669|0.13669|0.13669	0.561000|0.561000|0.561000	0.74099|0.74099|0.74099	GCA|TGC|CAC	G|1.000;A|0.000		0.433	TRPM3-007	NOVEL	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000214157.5	NM_206945	
GADD45G	10912	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	92220393	92220393	+	Nonsense_Mutation	SNP	C	C	T			TCGA-OR-A5L2-01A-11D-A30A-10	TCGA-OR-A5L2-10A-01D-A30A-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b99bd79e-aa33-4896-8d10-2517c793f439	48e26b1d-b84d-432b-940b-9907c81ddf5b	g.chr9:92220393C>T	ENST00000252506.6	+	2	209	c.100C>T	c.(100-102)Cag>Tag	p.Q34*	GADD45G_ENST00000494726.1_3'UTR|GADD45G_ENST00000375769.1_Nonsense_Mutation_p.Q16*	NM_006705.3	NP_006696.1	O95257	GA45G_HUMAN	growth arrest and DNA-damage-inducible, gamma	34				QR -> HG (in Ref. 4; AAK00414). {ECO:0000305}.	activation of MAPKK activity (GO:0000186)|activation of MAPKKK activity (GO:0000185)|apoptotic process (GO:0006915)|cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|negative regulation of protein kinase activity (GO:0006469)|positive regulation of apoptotic process (GO:0043065)|positive regulation of JNK cascade (GO:0046330)|positive regulation of p38MAPK cascade (GO:1900745)|regulation of cell cycle (GO:0051726)|response to stress (GO:0006950)	cytoplasm (GO:0005737)|nucleus (GO:0005634)				lung(2)	2						GCTGTCGGCGCAGCGTCAGGG	0.687																																					p.Q34X	Colon(131;320 2336 18973 23919)	.											.	GADD45G-514	0			c.C100T						.						9.0	11.0	10.0					9																	92220393		2159	4223	6382	SO:0001587	stop_gained	10912	exon2			TCGGCGCAGCGTC	D83023	CCDS6686.1	9q22.1-q22.2	2008-07-21			ENSG00000130222	ENSG00000130222			4097	protein-coding gene	gene with protein product	"""gadd-related protein, 17 kD"", ""growth arrest and DNA-damage-inducible gamma"""	604949				9827804, 10496071	Standard	NM_006705		Approved	DDIT2, GADD45gamma, GRP17, CR6	uc004aqq.3	O95257	OTTHUMG00000020187	ENST00000252506.6:c.100C>T	9.37:g.92220393C>T	ENSP00000252506:p.Gln34*	Somatic	54	0		WXS	Illumina GAIIx	Phase_I	83	37	NM_006705	0	0	0	0	0	Q5VZ87|Q9C076	Nonsense_Mutation	SNP	ENST00000252506.6	37	CCDS6686.1	.	.	.	.	.	.	.	.	.	.	C	22.6	4.305557	0.81247	.	.	ENSG00000130222	ENST00000252506;ENST00000375769	.	.	.	4.34	4.34	0.51931	.	0.173137	0.50627	D	0.000106	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-0.6615	15.9877	0.80174	0.0:1.0:0.0:0.0	.	.	.	.	X	34;16	.	ENSP00000252506:Q34X	Q	+	1	0	GADD45G	91410213	1.000000	0.71417	0.966000	0.40874	0.386000	0.30323	3.405000	0.52630	2.415000	0.81967	0.561000	0.74099	CAG	.		0.687	GADD45G-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053000.1	NM_006705	
BAAT	570	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	104124861	104124861	+	Missense_Mutation	SNP	G	G	T			TCGA-OR-A5L2-01A-11D-A30A-10	TCGA-OR-A5L2-10A-01D-A30A-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b99bd79e-aa33-4896-8d10-2517c793f439	48e26b1d-b84d-432b-940b-9907c81ddf5b	g.chr9:104124861G>T	ENST00000395051.3	-	3	1176	c.1106C>A	c.(1105-1107)tCt>tAt	p.S369Y	BAAT_ENST00000259407.2_Missense_Mutation_p.S369Y			Q14032	BAAT_HUMAN	bile acid CoA:amino acid N-acyltransferase	369					acyl-CoA metabolic process (GO:0006637)|bile acid and bile salt transport (GO:0015721)|bile acid biosynthetic process (GO:0006699)|bile acid conjugation (GO:0002152)|bile acid metabolic process (GO:0008206)|fatty acid metabolic process (GO:0006631)|glycine metabolic process (GO:0006544)|liver development (GO:0001889)|organ regeneration (GO:0031100)|small molecule metabolic process (GO:0044281)|taurine metabolic process (GO:0019530)	cytosol (GO:0005829)|peroxisomal matrix (GO:0005782)|peroxisome (GO:0005777)	carboxylic ester hydrolase activity (GO:0052689)|glycine N-choloyltransferase activity (GO:0047963)|long-chain acyl-CoA hydrolase activity (GO:0052816)|medium-chain acyl-CoA hydrolase activity (GO:0052815)|N-acyltransferase activity (GO:0016410)|palmitoyl-CoA hydrolase activity (GO:0016290)|receptor binding (GO:0005102)|very long chain acyl-CoA hydrolase activity (GO:0052817)			breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(9)|ovary(1)|skin(1)	23		Acute lymphoblastic leukemia(62;0.0559)			Glycine(DB00145)	GCACAGAGGAGAATAGGGAGG	0.547																																					p.S369Y		.											.	BAAT-228	0			c.C1106A						.						204.0	176.0	185.0					9																	104124861		2203	4300	6503	SO:0001583	missense	570	exon4			AGAGGAGAATAGG	L34081	CCDS6752.1	9q22.3	2014-06-24	2014-06-24		ENSG00000136881	ENSG00000136881	2.3.1.65		932	protein-coding gene	gene with protein product	"""glycine N-choloyltransferase"""	602938	"""bile acid Coenzyme A:amino acid N-acyltransferase (glycine N-choloyltransferase)"", ""bile acid CoA: amino acid N-acyltransferase (glycine N-choloyltransferase)"""				Standard	NM_001701		Approved	BAT	uc010mtd.3	Q14032	OTTHUMG00000020377	ENST00000395051.3:c.1106C>A	9.37:g.104124861G>T	ENSP00000378491:p.Ser369Tyr	Somatic	173	1		WXS	Illumina GAIIx	Phase_I	194	79	NM_001127610	0	0	0	0	0	Q3B7W9|Q96L31	Missense_Mutation	SNP	ENST00000395051.3	37	CCDS6752.1	.	.	.	.	.	.	.	.	.	.	G	13.05	2.121265	0.37436	.	.	ENSG00000136881	ENST00000259407;ENST00000395051	T;T	0.30981	1.51;1.51	4.96	3.12	0.35913	BAAT/Acyl-CoA thioester hydrolase C-terminal (1);	0.484770	0.20376	N	0.093545	T	0.49592	0.1566	M	0.80422	2.495	0.09310	N	1	D	0.60575	0.988	P	0.61533	0.89	T	0.36187	-0.9758	10	0.48119	T	0.1	-2.0782	8.4374	0.32795	0.0855:0.1559:0.7586:0.0	.	369	Q14032	BAAT_HUMAN	Y	369	ENSP00000259407:S369Y;ENSP00000378491:S369Y	ENSP00000259407:S369Y	S	-	2	0	BAAT	103164682	0.000000	0.05858	0.019000	0.16419	0.316000	0.28119	0.655000	0.24933	0.676000	0.31285	0.655000	0.94253	TCT	.		0.547	BAAT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053433.1		
OR13C3	138803	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	107298937	107298937	+	Missense_Mutation	SNP	A	A	G			TCGA-OR-A5L2-01A-11D-A30A-10	TCGA-OR-A5L2-10A-01D-A30A-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b99bd79e-aa33-4896-8d10-2517c793f439	48e26b1d-b84d-432b-940b-9907c81ddf5b	g.chr9:107298937A>G	ENST00000374781.2	-	1	200	c.158T>C	c.(157-159)aTt>aCt	p.I53T		NM_001001961.1	NP_001001961.1	Q8NGS6	O13C3_HUMAN	olfactory receptor, family 13, subfamily C, member 3	53						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(2)|large_intestine(7)|lung(7)|pancreas(1)|prostate(1)|skin(1)	19						AACAATCTCAATCTTTGGGTA	0.373																																					p.I53T	GBM(86;1248 1274 14222 15028 46219)	.											.	OR13C3-69	0			c.T158C						.						90.0	85.0	87.0					9																	107298937		2203	4300	6503	SO:0001583	missense	138803	exon1			ATCTCAATCTTTG		CCDS35089.1	9q31.1	2013-09-24			ENSG00000204246	ENSG00000204246		"""GPCR / Class A : Olfactory receptors"""	14704	protein-coding gene	gene with protein product							Standard	NM_001001961		Approved		uc004bcb.1	Q8NGS6	OTTHUMG00000020406	ENST00000374781.2:c.158T>C	9.37:g.107298937A>G	ENSP00000363913:p.Ile53Thr	Somatic	168	1		WXS	Illumina GAIIx	Phase_I	183	32	NM_001001961	0	0	0	0	0	Q5VVG1|Q6IF52	Missense_Mutation	SNP	ENST00000374781.2	37	CCDS35089.1	.	.	.	.	.	.	.	.	.	.	A	2.552	-0.303883	0.05495	.	.	ENSG00000204246	ENST00000374781	T	0.09073	3.02	4.81	-1.17	0.09648	.	0.746559	0.11361	N	0.571906	T	0.04770	0.0129	N	0.11818	0.18	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.38394	-0.9663	10	0.51188	T	0.08	.	9.0435	0.36331	0.5422:0.0:0.4578:0.0	.	53	Q8NGS6	O13C3_HUMAN	T	53	ENSP00000363913:I53T	ENSP00000363913:I53T	I	-	2	0	OR13C3	106338758	0.000000	0.05858	0.003000	0.11579	0.225000	0.24961	0.239000	0.18023	-0.243000	0.09653	-0.290000	0.09829	ATT	.		0.373	OR13C3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053477.2		
DFNB31	25861	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	117185706	117185706	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5L2-01A-11D-A30A-10	TCGA-OR-A5L2-10A-01D-A30A-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b99bd79e-aa33-4896-8d10-2517c793f439	48e26b1d-b84d-432b-940b-9907c81ddf5b	g.chr9:117185706G>A	ENST00000362057.3	-	7	1682	c.1514C>T	c.(1513-1515)gCg>gTg	p.A505V	DFNB31_ENST00000374059.3_Missense_Mutation_p.A154V|DFNB31_ENST00000265134.6_Missense_Mutation_p.A122V	NM_001173425.1|NM_015404.3	NP_001166896.1|NP_056219	Q9P202	WHRN_HUMAN	deafness, autosomal recessive 31	505					inner ear receptor stereocilium organization (GO:0060122)|retina homeostasis (GO:0001895)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)	actin filament (GO:0005884)|cilium (GO:0005929)|cytoplasm (GO:0005737)|stereocilia ankle link complex (GO:0002142)|stereocilium (GO:0032420)				central_nervous_system(2)|endometrium(3)|kidney(1)|large_intestine(9)|liver(1)|lung(14)|ovary(5)|pancreas(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	38						GGGCTGCCGCGCCTTCATGGA	0.627																																					p.A505V		.											.	DFNB31-95	0			c.C1514T						.						81.0	79.0	80.0					9																	117185706		2203	4300	6503	SO:0001583	missense	25861	exon7			TGCCGCGCCTTCA	AK056190	CCDS6806.1, CCDS43870.1	9q32	2013-06-19			ENSG00000095397	ENSG00000095397			16361	protein-coding gene	gene with protein product	"""whirlin"""	607928				12833159, 17171570	Standard	NM_015404		Approved	CIP98, WHRN, USH2D, PDZD7B	uc004biz.4	Q9P202	OTTHUMG00000020539	ENST00000362057.3:c.1514C>T	9.37:g.117185706G>A	ENSP00000354623:p.Ala505Val	Somatic	166	0		WXS	Illumina GAIIx	Phase_I	187	47	NM_001173425	0	0	0	0	0	A5PKU1|A5PKZ9|Q5TAU9|Q5TAV0|Q5TAV1|Q5TAV2|Q96MZ9|Q9H9F4|Q9UFZ3	Missense_Mutation	SNP	ENST00000362057.3	37	CCDS6806.1	.	.	.	.	.	.	.	.	.	.	G	27.5	4.833527	0.91036	.	.	ENSG00000095397	ENST00000265134;ENST00000374059;ENST00000362057	T;T;T	0.10573	3.74;3.71;2.86	5.3	4.39	0.52855	.	0.259072	0.37178	N	0.002205	T	0.30417	0.0764	M	0.67953	2.075	0.80722	D	1	D;D;D	0.89917	0.998;0.998;1.0	P;P;D	0.69479	0.823;0.823;0.964	T	0.04005	-1.0985	10	0.66056	D	0.02	-23.6157	15.147	0.72662	0.0:0.0:0.8575:0.1425	.	505;505;154	B9EGE6;Q9P202;Q9P202-4	.;WHRN_HUMAN;.	V	122;154;505	ENSP00000265134:A122V;ENSP00000363172:A154V;ENSP00000354623:A505V	ENSP00000265134:A122V	A	-	2	0	DFNB31	116225527	1.000000	0.71417	0.842000	0.33263	0.958000	0.62258	8.960000	0.93117	1.204000	0.43247	0.555000	0.69702	GCG	.		0.627	DFNB31-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053776.2	NM_015404	
TRIM32	22954	ucsc.edu	37	9	119460913	119460913	+	Missense_Mutation	SNP	C	C	G			TCGA-OR-A5L2-01A-11D-A30A-10	TCGA-OR-A5L2-10A-01D-A30A-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b99bd79e-aa33-4896-8d10-2517c793f439	48e26b1d-b84d-432b-940b-9907c81ddf5b	g.chr9:119460913C>G	ENST00000450136.1	+	2	1053	c.892C>G	c.(892-894)Ccc>Gcc	p.P298A	ASTN2_ENST00000361477.3_Intron|ASTN2_ENST00000313400.4_Intron|ASTN2_ENST00000373996.3_Intron|TRIM32_ENST00000373983.2_Missense_Mutation_p.P298A|ASTN2_ENST00000361209.2_Intron	NM_001099679.1|NM_012210.3	NP_001093149.1|NP_036342.2	Q13049	TRI32_HUMAN	tripartite motif containing 32	298					fat cell differentiation (GO:0045444)|innate immune response (GO:0045087)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of intrinsic apoptotic signaling pathway in response to DNA damage (GO:1902230)|negative regulation of viral release from host cell (GO:1902187)|negative regulation of viral transcription (GO:0032897)|positive regulation of cell cycle (GO:0045787)|positive regulation of cell growth (GO:0030307)|positive regulation of cell migration (GO:0030335)|positive regulation of cell motility (GO:2000147)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of neurogenesis (GO:0050769)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of proteolysis (GO:0045862)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of type I interferon production (GO:0032481)|protein polyubiquitination (GO:0000209)|protein ubiquitination (GO:0016567)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|regulation of type I interferon production (GO:0032479)|response to tumor necrosis factor (GO:0034612)|response to UV (GO:0009411)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|striated muscle myosin thick filament (GO:0005863)	ligase activity (GO:0016874)|myosin binding (GO:0017022)|protein self-association (GO:0043621)|RNA binding (GO:0003723)|Tat protein binding (GO:0030957)|transcription coactivator activity (GO:0003713)|translation initiation factor binding (GO:0031369)|ubiquitin binding (GO:0043130)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(2)|endometrium(4)|kidney(3)|large_intestine(5)|liver(1)|lung(6)|prostate(1)|skin(2)|urinary_tract(1)	26						TGTTAAGAAGCCCCGGACAGT	0.557																																					p.P298A	Esophageal Squamous(92;212 1916 19711 26951)	.											.	TRIM32-650	0			c.C892G						.						55.0	46.0	49.0					9																	119460913		2203	4300	6503	SO:0001583	missense	22954	exon2			AAGAAGCCCCGGA	U18543	CCDS6817.1	9q33.1	2014-09-17	2011-01-25		ENSG00000119401	ENSG00000119401		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	16380	protein-coding gene	gene with protein product		602290	"""limb girdle muscular dystrophy 2H (autosomal recessive)"", ""tripartite motif-containing 32"""	LGMD2H		11331580, 7778269, 16606853	Standard	NM_001099679		Approved	HT2A, TATIP, BBS11	uc004bjx.2	Q13049	OTTHUMG00000021026	ENST00000450136.1:c.892C>G	9.37:g.119460913C>G	ENSP00000408292:p.Pro298Ala	Somatic	73	2		WXS	Illumina GAIIx	Phase_I	85	9	NM_012210	0	0	0	0	0	Q9NQP8	Missense_Mutation	SNP	ENST00000450136.1	37	CCDS6817.1	.	.	.	.	.	.	.	.	.	.	C	10.35	1.325663	0.24080	.	.	ENSG00000119401	ENST00000450136;ENST00000373983	D;D	0.83673	-1.75;-1.75	5.35	5.35	0.76521	.	0.078613	0.51477	D	0.000096	T	0.75155	0.3811	L	0.27053	0.805	0.48236	D	0.999612	B	0.29212	0.237	B	0.28553	0.091	T	0.70714	-0.4796	9	.	.	.	-19.2421	19.0705	0.93134	0.0:1.0:0.0:0.0	.	298	Q13049	TRI32_HUMAN	A	298	ENSP00000408292:P298A;ENSP00000363095:P298A	.	P	+	1	0	TRIM32	118500734	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.662000	0.61525	2.482000	0.83794	0.650000	0.86243	CCC	.		0.557	TRIM32-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055466.2	NM_012210	
CRB2	286204	hgsc.bcm.edu	37	9	126136139	126136139	+	Missense_Mutation	SNP	C	C	T	rs73571431	byFrequency	TCGA-OR-A5L2-01A-11D-A30A-10	TCGA-OR-A5L2-10A-01D-A30A-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b99bd79e-aa33-4896-8d10-2517c793f439	48e26b1d-b84d-432b-940b-9907c81ddf5b	g.chr9:126136139C>T	ENST00000373631.3	+	10	3330	c.3329C>T	c.(3328-3330)aCg>aTg	p.T1110M	CRB2_ENST00000373629.2_Missense_Mutation_p.T778M|CRB2_ENST00000359999.3_Missense_Mutation_p.T1110M	NM_173689.5	NP_775960.4	Q5IJ48	CRUM2_HUMAN	crumbs family member 2	1110	EGF-like 13. {ECO:0000255|PROSITE- ProRule:PRU00076}.		T -> M (in dbSNP:rs73571431). {ECO:0000269|PubMed:15851977}.		cardiovascular system development (GO:0072358)|maintenance of epithelial cell apical/basal polarity (GO:0045199)|mesoderm formation (GO:0001707)|negative regulation of endopeptidase activity (GO:0010951)|notochord formation (GO:0014028)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|somitogenesis (GO:0001756)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	calcium ion binding (GO:0005509)|enzyme binding (GO:0019899)			NS(2)|breast(1)|cervix(1)|endometrium(2)|lung(11)|ovary(1)|prostate(2)|skin(3)	23						CGCTGTCACACGCACCCCGAC	0.771													C|||	530	0.105831	0.1059	0.1873	5008	,	,		9885	0.0764		0.1412	False		,,,				2504	0.0419				p.T1110M		.											.	CRB2-91	0			c.C3329T						.	C	MET/THR	273,2733		10,253,1240	3.0	3.0	3.0		3329	2.8	0.1	9	dbSNP_131	3	523,5481		24,475,2503	no	missense	CRB2	NM_173689.5	81	34,728,3743	TT,TC,CC		8.7109,9.0818,8.8346	possibly-damaging	1110/1286	126136139	796,8214	1503	3002	4505	SO:0001583	missense	286204	exon10			GTCACACGCACCC	AK095783	CCDS6852.2	9q33.2	2014-02-06	2014-02-06		ENSG00000148204	ENSG00000148204			18688	protein-coding gene	gene with protein product		609720	"""crumbs homolog 2 (Drosophila)"""			14767562	Standard	XM_005251934		Approved	FLJ38464, FLJ16786	uc004bnx.1	Q5IJ48	OTTHUMG00000020638	ENST00000373631.3:c.3329C>T	9.37:g.126136139C>T	ENSP00000362734:p.Thr1110Met	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	12	4	NM_173689	0	0	0	0	0	A2A3N4|Q0QD46|Q5JS41|Q5JS43|Q6ZTA9|Q6ZWI6	Missense_Mutation	SNP	ENST00000373631.3	37	CCDS6852.2	272	0.12454212454212454	60	0.12195121951219512	50	0.13812154696132597	56	0.0979020979020979	106	0.13984168865435356	.	6.539	0.467763	0.12402	0.090818	0.087109	ENSG00000148204	ENST00000359999;ENST00000373631;ENST00000373629	D;D;D	0.90732	-2.1;-2.0;-2.72	3.77	2.82	0.32997	Epidermal growth factor-like (1);Epidermal growth factor-like, type 3 (1);	1.339200	0.05453	N	0.549893	T	0.01976	0.0062	N	0.12746	0.255	0.80722	P	0.0	P;D	0.56521	0.925;0.976	B;B	0.38562	0.101;0.276	T	0.57100	-0.7869	9	0.36615	T	0.2	.	3.1184	0.06382	0.0:0.4522:0.2781:0.2698	.	1110;1110	Q5IJ48;Q5IJ48-2	CRUM2_HUMAN;.	M	1110;1110;778	ENSP00000353092:T1110M;ENSP00000362734:T1110M;ENSP00000362732:T778M	ENSP00000353092:T1110M	T	+	2	0	CRB2	125175960	0.000000	0.05858	0.081000	0.20488	0.039000	0.13416	0.001000	0.13038	1.929000	0.55896	0.455000	0.32223	ACG	C|0.875;T|0.125		0.771	CRB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053990.3	NM_173689	
USP20	10868	broad.mit.edu;ucsc.edu;bcgsc.ca	37	9	132637739	132637739	+	Silent	SNP	C	C	T			TCGA-OR-A5L2-01A-11D-A30A-10	TCGA-OR-A5L2-10A-01D-A30A-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b99bd79e-aa33-4896-8d10-2517c793f439	48e26b1d-b84d-432b-940b-9907c81ddf5b	g.chr9:132637739C>T	ENST00000315480.4	+	20	2357	c.2199C>T	c.(2197-2199)acC>acT	p.T733T	USP20_ENST00000372429.3_Silent_p.T733T|USP20_ENST00000358355.1_Silent_p.T733T			Q9Y2K6	UBP20_HUMAN	ubiquitin specific peptidase 20	733	DUSP 1. {ECO:0000255|PROSITE- ProRule:PRU00613}.				endocytosis (GO:0006897)|protein deubiquitination (GO:0016579)|protein K48-linked deubiquitination (GO:0071108)|protein K63-linked deubiquitination (GO:0070536)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|ubiquitin-dependent protein catabolic process (GO:0006511)	centrosome (GO:0005813)|cytoplasm (GO:0005737)	cysteine-type endopeptidase activity (GO:0004197)|G-protein coupled receptor binding (GO:0001664)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)|zinc ion binding (GO:0008270)			breast(1)|endometrium(2)|large_intestine(3)|lung(4)|urinary_tract(1)	11		Ovarian(14;0.00556)				CCAACCAGACCTTCCTCTGCT	0.667																																					p.T733T		.											.	USP20-658	0			c.C2199T						.						55.0	63.0	60.0					9																	132637739		2074	4197	6271	SO:0001819	synonymous_variant	10868	exon20			CCAGACCTTCCTC	AB023220	CCDS43892.1	9q34.2	2014-07-15	2005-08-08		ENSG00000136878	ENSG00000136878		"""Ubiquitin-specific peptidases"""	12619	protein-coding gene	gene with protein product		615143	"""ubiquitin specific protease 20"""			12838346	Standard	NM_006676		Approved	KIAA1003	uc004byr.3	Q9Y2K6	OTTHUMG00000020793	ENST00000315480.4:c.2199C>T	9.37:g.132637739C>T		Somatic	99	1		WXS	Illumina GAIIx	Phase_I	122	16	NM_001008563	0	0	0	0	0	Q541F1|Q8IXQ1|Q96LG5|Q9UQN8|Q9UQP0	Silent	SNP	ENST00000315480.4	37	CCDS43892.1																																																																																			.		0.667	USP20-003	KNOWN	alternative_3_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054604.2		
ABL1	25	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	133760173	133760173	+	Silent	SNP	C	C	T			TCGA-OR-A5L2-01A-11D-A30A-10	TCGA-OR-A5L2-10A-01D-A30A-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b99bd79e-aa33-4896-8d10-2517c793f439	48e26b1d-b84d-432b-940b-9907c81ddf5b	g.chr9:133760173C>T	ENST00000318560.5	+	11	2877	c.2496C>T	c.(2494-2496)caC>caT	p.H832H		NM_005157.4	NP_005148.2	P00519	ABL1_HUMAN	ABL proto-oncogene 1, non-receptor tyrosine kinase	832	Pro-rich.				actin cytoskeleton organization (GO:0030036)|autophagy (GO:0006914)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cellular protein modification process (GO:0006464)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to dopamine (GO:1903351)|cellular response to oxidative stress (GO:0034599)|DNA damage induced protein phosphorylation (GO:0006975)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|mismatch repair (GO:0006298)|mitochondrial depolarization (GO:0051882)|mitotic nuclear division (GO:0007067)|muscle cell differentiation (GO:0042692)|negative regulation of phospholipase C activity (GO:1900275)|negative regulation of protein serine/threonine kinase activity (GO:0071901)|negative regulation of ubiquitin-protein transferase activity (GO:0051444)|peptidyl-tyrosine phosphorylation (GO:0018108)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of oxidoreductase activity (GO:0051353)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|regulation of actin cytoskeleton reorganization (GO:2000249)|regulation of autophagy (GO:0010506)|regulation of cell adhesion (GO:0030155)|regulation of cell motility (GO:2000145)|regulation of endocytosis (GO:0030100)|regulation of response to DNA damage stimulus (GO:2001020)|regulation of transcription, DNA-templated (GO:0006355)|response to oxidative stress (GO:0006979)|signal transduction in response to DNA damage (GO:0042770)	actin cytoskeleton (GO:0015629)|cell leading edge (GO:0031252)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	actin monomer binding (GO:0003785)|ATP binding (GO:0005524)|DNA binding (GO:0003677)|magnesium ion binding (GO:0000287)|manganese ion binding (GO:0030145)|mitogen-activated protein kinase binding (GO:0051019)|nicotinate-nucleotide adenylyltransferase activity (GO:0004515)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|proline-rich region binding (GO:0070064)|protein C-terminus binding (GO:0008022)|protein kinase activity (GO:0004672)|protein tyrosine kinase activity (GO:0004713)|SH3 domain binding (GO:0017124)|syntaxin binding (GO:0019905)			breast(3)|central_nervous_system(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1149)|kidney(3)|large_intestine(7)|lung(15)|ovary(1)|skin(4)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	1195		all_hematologic(13;0.0361)|Acute lymphoblastic leukemia(5;0.0543)|Myeloproliferative disorder(178;0.204)		OV - Ovarian serous cystadenocarcinoma(145;5.4e-05)	Adenosine triphosphate(DB00171)|Bosutinib(DB06616)|Dasatinib(DB01254)|Imatinib(DB00619)|Nilotinib(DB04868)|Ponatinib(DB08901)|Regorafenib(DB08896)	GCCTCCCCCACAAGGAAGAAG	0.667			"""T, Mis"""	"""BCR, ETV6, NUP214"""	"""CML, ALL, T-ALL"""																																p.H851H		.		Dom	yes		9	9q34.1	25	v-abl Abelson murine leukemia viral oncogene homolog 1		L	.	ABL1-3810	0			c.C2553T						.						17.0	20.0	19.0					9																	133760173		2199	4281	6480	SO:0001819	synonymous_variant	25	exon11			CCCCCACAAGGAA	M14752	CCDS35165.1, CCDS35166.1	9q34.1	2014-09-17	2014-06-26		ENSG00000097007	ENSG00000097007		"""SH2 domain containing"""	76	protein-coding gene	gene with protein product		189980	"""v-abl Abelson murine leukemia viral oncogene homolog 1"", ""c-abl oncogene 1, receptor tyrosine kinase"", ""c-abl oncogene 1, non-receptor tyrosine kinase"""	ABL		1857987, 12626632	Standard	NM_007313		Approved	JTK7, c-ABL, p150	uc004bzv.3	P00519	OTTHUMG00000020813	ENST00000318560.5:c.2496C>T	9.37:g.133760173C>T		Somatic	168	0		WXS	Illumina GAIIx	Phase_I	171	51	NM_007313	0	0	0	0	0	A3KFJ3|Q13869|Q13870|Q16133|Q17R61|Q45F09	Silent	SNP	ENST00000318560.5	37	CCDS35166.1																																																																																			.		0.667	ABL1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000054684.1	NM_007313	
SARDH	1757	broad.mit.edu	37	9	136577795	136577795	+	Missense_Mutation	SNP	G	G	T			TCGA-OR-A5L2-01A-11D-A30A-10	TCGA-OR-A5L2-10A-01D-A30A-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b99bd79e-aa33-4896-8d10-2517c793f439	48e26b1d-b84d-432b-940b-9907c81ddf5b	g.chr9:136577795G>T	ENST00000371872.4	-	10	1531	c.1274C>A	c.(1273-1275)gCc>gAc	p.A425D	SARDH_ENST00000439388.1_Missense_Mutation_p.A425D|SARDH_ENST00000422262.2_Missense_Mutation_p.A257D	NM_007101.3	NP_009032.2	Q9UL12	SARDH_HUMAN	sarcosine dehydrogenase	425					glycine catabolic process (GO:0006546)	mitochondrion (GO:0005739)	aminomethyltransferase activity (GO:0004047)|sarcosine dehydrogenase activity (GO:0008480)			central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(12)|lung(13)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(3)	44				OV - Ovarian serous cystadenocarcinoma(145;3.21e-07)|Epithelial(140;2.37e-06)|all cancers(34;2.75e-05)		GATCCAGTGGGCCAGCTCCTG	0.632																																					p.A425D		.											.	SARDH-90	0			c.C1274A						.						58.0	59.0	58.0					9																	136577795		2203	4300	6503	SO:0001583	missense	1757	exon10			CAGTGGGCCAGCT		CCDS6978.1	9q33-q34	2008-02-05			ENSG00000123453	ENSG00000123453	1.5.99.2		10536	protein-coding gene	gene with protein product		604455		DMGDHL1		10444331	Standard	NM_007101		Approved	SDH	uc004cep.4	Q9UL12	OTTHUMG00000020879	ENST00000371872.4:c.1274C>A	9.37:g.136577795G>T	ENSP00000360938:p.Ala425Asp	Somatic	36	2		WXS	Illumina GAIIx	Phase_I	53	8	NM_007101	0	0	0	0	0	B2RMR5|B4DPI2|B7ZLT6|Q5SYV0|Q9Y280|Q9Y2Y3	Missense_Mutation	SNP	ENST00000371872.4	37	CCDS6978.1	.	.	.	.	.	.	.	.	.	.	G	26.9	4.779520	0.90195	.	.	ENSG00000123453	ENST00000371872;ENST00000439388;ENST00000422262;ENST00000427237;ENST00000539227	D;D;D	0.86432	-2.12;-2.12;-2.12	4.27	4.27	0.50696	FAD dependent oxidoreductase (1);	0.000000	0.85682	D	0.000000	D	0.95629	0.8579	H	0.96365	3.81	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.97450	1.0027	10	0.87932	D	0	-26.005	16.727	0.85424	0.0:0.0:1.0:0.0	.	425	Q9UL12	SARDH_HUMAN	D	425;425;257;425;425	ENSP00000360938:A425D;ENSP00000403084:A425D;ENSP00000415537:A257D	ENSP00000360938:A425D	A	-	2	0	SARDH	135567616	1.000000	0.71417	1.000000	0.80357	0.932000	0.56968	9.441000	0.97557	1.930000	0.55929	0.467000	0.42956	GCC	.		0.632	SARDH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054931.1		
MAGEB4	4115	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	30261199	30261199	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5L2-01A-11D-A30A-10	TCGA-OR-A5L2-10A-01D-A30A-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b99bd79e-aa33-4896-8d10-2517c793f439	48e26b1d-b84d-432b-940b-9907c81ddf5b	g.chrX:30261199G>A	ENST00000378982.2	+	1	1143	c.947G>A	c.(946-948)gGa>gAa	p.G316E	MAGEB1_ENST00000397550.1_5'Flank|MAGEB1_ENST00000378981.3_5'Flank	NM_002367.3	NP_002358.1	O15481	MAGB4_HUMAN	melanoma antigen family B, 4	316										breast(2)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(12)|ovary(1)|skin(2)|upper_aerodigestive_tract(2)	27						GAGAGAGCTGGAGCCCGGCCC	0.522																																					p.G316E		.											.	MAGEB4-131	0			c.G947A						.						49.0	47.0	48.0					X																	30261199		2202	4300	6502	SO:0001583	missense	4115	exon1			GAGCTGGAGCCCG		CCDS14221.1	Xp21.3	2009-03-17			ENSG00000120289	ENSG00000120289			6811	protein-coding gene	gene with protein product	"""melanoma-associated antigen B4"", ""cancer/testis antigen family 3, member 6"""	300153				9441743	Standard	NM_002367		Approved	MGC33144, CT3.6	uc004dcb.3	O15481	OTTHUMG00000021321	ENST00000378982.2:c.947G>A	X.37:g.30261199G>A	ENSP00000368266:p.Gly316Glu	Somatic	63	0		WXS	Illumina GAIIx	Phase_I	60	19	NM_002367	0	0	0	0	0	B2R9G0|Q6FHH4|Q8IZ00	Missense_Mutation	SNP	ENST00000378982.2	37	CCDS14221.1	.	.	.	.	.	.	.	.	.	.	G	4.406	0.075076	0.08485	.	.	ENSG00000120289	ENST00000378982	T	0.01505	4.82	2.95	-5.04	0.02964	.	5.381380	0.01980	U	0.044714	T	0.01765	0.0056	L	0.31664	0.95	0.09310	N	1	B	0.10296	0.003	B	0.04013	0.001	T	0.43032	-0.9416	10	0.40728	T	0.16	.	6.6083	0.22737	0.6098:0.1386:0.2516:0.0	.	316	O15481	MAGB4_HUMAN	E	316	ENSP00000368266:G316E	ENSP00000368266:G316E	G	+	2	0	MAGEB4	30171120	0.000000	0.05858	0.000000	0.03702	0.007000	0.05969	-2.255000	0.01182	-1.897000	0.01101	-0.190000	0.12839	GGA	.		0.522	MAGEB4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056159.1	NM_002367	
FAM47A	158724	bcgsc.ca	37	X	34148842	34148842	+	Silent	SNP	G	G	A			TCGA-OR-A5L2-01A-11D-A30A-10	TCGA-OR-A5L2-10A-01D-A30A-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b99bd79e-aa33-4896-8d10-2517c793f439	48e26b1d-b84d-432b-940b-9907c81ddf5b	g.chrX:34148842G>A	ENST00000346193.3	-	1	1605	c.1554C>T	c.(1552-1554)cgC>cgT	p.R518R		NM_203408.3	NP_981953.2	Q5JRC9	FA47A_HUMAN	family with sequence similarity 47, member A	518										NS(1)|biliary_tract(1)|breast(2)|central_nervous_system(1)|endometrium(9)|kidney(5)|large_intestine(17)|lung(44)|ovary(5)|prostate(2)|skin(4)|upper_aerodigestive_tract(4)|urinary_tract(2)	97						GAGGCTCCGAGCGGAGACTGG	0.657																																					p.R518R		.											.	FAM47A-134	0			c.C1554T						.						27.0	27.0	27.0					X																	34148842		2185	4270	6455	SO:0001819	synonymous_variant	158724	exon1			CTCCGAGCGGAGA	BC026171	CCDS43926.1	Xp21.1	2004-08-09			ENSG00000185448	ENSG00000185448			29962	protein-coding gene	gene with protein product	"""similar to hypothetical protein FLJ35782"""					12477932	Standard	NM_203408		Approved	MGC27003	uc004ddg.3	Q5JRC9	OTTHUMG00000021339	ENST00000346193.3:c.1554C>T	X.37:g.34148842G>A		Somatic	101	1		WXS	Illumina GAIIx	Phase_I	103	10	NM_203408	0	0	0	0	0	A8K8I9|Q8TAA0	Silent	SNP	ENST00000346193.3	37	CCDS43926.1																																																																																			.		0.657	FAM47A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056205.1	NM_203408	
FAM47A	158724	bcgsc.ca	37	X	34148844	34148844	+	Missense_Mutation	SNP	G	G	C	rs17855514		TCGA-OR-A5L2-01A-11D-A30A-10	TCGA-OR-A5L2-10A-01D-A30A-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b99bd79e-aa33-4896-8d10-2517c793f439	48e26b1d-b84d-432b-940b-9907c81ddf5b	g.chrX:34148844G>C	ENST00000346193.3	-	1	1603	c.1552C>G	c.(1552-1554)Cgc>Ggc	p.R518G		NM_203408.3	NP_981953.2	Q5JRC9	FA47A_HUMAN	family with sequence similarity 47, member A	518										NS(1)|biliary_tract(1)|breast(2)|central_nervous_system(1)|endometrium(9)|kidney(5)|large_intestine(17)|lung(44)|ovary(5)|prostate(2)|skin(4)|upper_aerodigestive_tract(4)|urinary_tract(2)	97						GGCTCCGAGCGGAGACTGGAC	0.657																																					p.R518G		.											.	FAM47A-134	0			c.C1552G						.						27.0	27.0	27.0					X																	34148844		2183	4264	6447	SO:0001583	missense	158724	exon1			CCGAGCGGAGACT	BC026171	CCDS43926.1	Xp21.1	2004-08-09			ENSG00000185448	ENSG00000185448			29962	protein-coding gene	gene with protein product	"""similar to hypothetical protein FLJ35782"""					12477932	Standard	NM_203408		Approved	MGC27003	uc004ddg.3	Q5JRC9	OTTHUMG00000021339	ENST00000346193.3:c.1552C>G	X.37:g.34148844G>C	ENSP00000345029:p.Arg518Gly	Somatic	101	3		WXS	Illumina GAIIx	Phase_I	107	13	NM_203408	0	0	0	0	0	A8K8I9|Q8TAA0	Missense_Mutation	SNP	ENST00000346193.3	37	CCDS43926.1	.	.	.	.	.	.	.	.	.	.	g	4.430	0.079632	0.08533	.	.	ENSG00000185448	ENST00000346193	T	0.13778	2.56	0.494	0.494	0.16884	.	.	.	.	.	T	0.10895	0.0266	L	0.50333	1.59	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.39901	-0.9591	8	0.14656	T	0.56	.	.	.	.	rs17855514	518	Q5JRC9	FA47A_HUMAN	G	518	ENSP00000345029:R518G	ENSP00000345029:R518G	R	-	1	0	FAM47A	34058765	0.012000	0.17670	0.002000	0.10522	0.003000	0.03518	2.017000	0.40981	0.471000	0.27319	0.271000	0.19318	CGC	.		0.657	FAM47A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056205.1	NM_203408	
PIN4	5303	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	71417263	71417263	+	Missense_Mutation	SNP	C	C	G			TCGA-OR-A5L2-01A-11D-A30A-10	TCGA-OR-A5L2-10A-01D-A30A-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b99bd79e-aa33-4896-8d10-2517c793f439	48e26b1d-b84d-432b-940b-9907c81ddf5b	g.chrX:71417263C>G	ENST00000373669.2	+	4	390	c.358C>G	c.(358-360)Caa>Gaa	p.Q120E	PIN4_ENST00000218432.5_3'UTR|PIN4_ENST00000423432.2_Intron|RN7SL388P_ENST00000498736.2_RNA	NM_006223.3	NP_006214.2	Q9Y237	PIN4_HUMAN	protein (peptidylprolyl cis/trans isomerase) NIMA-interacting, 4 (parvulin)	95	PpiC. {ECO:0000255|PROSITE- ProRule:PRU00278}.				protein folding (GO:0006457)|rRNA processing (GO:0006364)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|nucleus (GO:0005634)|preribosome (GO:0030684)|spindle (GO:0005819)	bent DNA binding (GO:0003681)|DNA binding (GO:0003677)|double-stranded DNA binding (GO:0003690)|peptidyl-prolyl cis-trans isomerase activity (GO:0003755)|poly(A) RNA binding (GO:0044822)			large_intestine(1)|lung(2)	3	Renal(35;0.156)					GGGACCATTTCAAGAAGCAGC	0.448																																					p.Q120E		.											.	PIN4-130	0			c.C358G						.						81.0	65.0	70.0					X																	71417263		2203	4300	6503	SO:0001583	missense	5303	exon4			CCATTTCAAGAAG	AB009690	CCDS14417.1, CCDS55447.1	Xq13.1	2008-02-05	2006-01-12		ENSG00000102309	ENSG00000102309			8992	protein-coding gene	gene with protein product		300252	"""protein (peptidyl-prolyl cis/trans isomerase) NIMA-interacting, 4 (parvulin)"""			16522211, 17875217	Standard	NM_006223		Approved	PAR14, PAR17, EPVH	uc004eam.3	Q9Y237	OTTHUMG00000021811	ENST00000373669.2:c.358C>G	X.37:g.71417263C>G	ENSP00000362773:p.Gln120Glu	Somatic	350	0		WXS	Illumina GAIIx	Phase_I	442	86	NM_006223	0	0	0	0	0	A8E0G6|B3KXM0|F5H1P5|Q0D2H3|Q3MHV0|Q52M21|Q5HYW6|Q6IRW4	Missense_Mutation	SNP	ENST00000373669.2	37	CCDS14417.1	.	.	.	.	.	.	.	.	.	.	C	15.29	2.789690	0.50102	.	.	ENSG00000102309	ENST00000373669	.	.	.	5.34	5.34	0.76211	.	0.000000	0.85682	D	0.000000	T	0.39517	0.1081	N	0.03000	-0.44	0.80722	D	1	B	0.23377	0.084	B	0.37550	0.253	T	0.36138	-0.9760	9	0.15499	T	0.54	-14.9869	15.3582	0.74443	0.0:1.0:0.0:0.0	.	120	Q9Y237-2	.	E	120	.	ENSP00000362773:Q120E	Q	+	1	0	PIN4	71333988	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.250000	0.78287	2.218000	0.71995	0.600000	0.82982	CAA	.		0.448	PIN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057175.2	NM_006223	
MAGEE1	57692	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	X	75648451	75648451	+	Nonsense_Mutation	SNP	C	C	G			TCGA-OR-A5L2-01A-11D-A30A-10	TCGA-OR-A5L2-10A-01D-A30A-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b99bd79e-aa33-4896-8d10-2517c793f439	48e26b1d-b84d-432b-940b-9907c81ddf5b	g.chrX:75648451C>G	ENST00000361470.2	+	1	406	c.128C>G	c.(127-129)tCa>tGa	p.S43*		NM_020932.2	NP_065983.1	Q9HCI5	MAGE1_HUMAN	melanoma antigen family E, 1	43						dendrite (GO:0030425)|dystrophin-associated glycoprotein complex (GO:0016010)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)				breast(3)|central_nervous_system(1)|endometrium(6)|kidney(3)|large_intestine(12)|lung(20)|ovary(1)|pancreas(1)|skin(3)|urinary_tract(1)	51						GTGCCAGGCTCAGACGTCCCC	0.692																																					p.S43X		.											.	MAGEE1-262	0			c.C128G						.						24.0	20.0	21.0					X																	75648451		2134	4194	6328	SO:0001587	stop_gained	57692	exon1			CAGGCTCAGACGT	AF490507	CCDS14433.1	Xq13	2008-02-05			ENSG00000198934	ENSG00000198934			24934	protein-coding gene	gene with protein product		300759				14623885	Standard	NM_020932		Approved	KIAA1587, DAMAGE	uc004ecm.2	Q9HCI5	OTTHUMG00000021879	ENST00000361470.2:c.128C>G	X.37:g.75648451C>G	ENSP00000354912:p.Ser43*	Somatic	247	0		WXS	Illumina GAIIx	Phase_I	336	19	NM_020932	0	0	0	0	0	Q5JXC7|Q86TG0|Q8TD92|Q9H216	Nonsense_Mutation	SNP	ENST00000361470.2	37	CCDS14433.1	.	.	.	.	.	.	.	.	.	.	C	25.3	4.619170	0.87460	.	.	ENSG00000198934	ENST00000361470	.	.	.	2.14	1.26	0.21427	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.72032	D	0.01	.	4.0814	0.09927	0.0:0.7796:0.0:0.2204	.	.	.	.	X	43	.	ENSP00000354912:S43X	S	+	2	0	MAGEE1	75564855	.	.	0.005000	0.12908	0.063000	0.16089	.	.	0.329000	0.23460	0.600000	0.82982	TCA	.		0.692	MAGEE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057298.1	NM_020932	
SPANXN3	139067	broad.mit.edu;ucsc.edu;bcgsc.ca	37	X	142605206	142605206	+	Missense_Mutation	SNP	G	G	T			TCGA-OR-A5L2-01A-11D-A30A-10	TCGA-OR-A5L2-10A-01D-A30A-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b99bd79e-aa33-4896-8d10-2517c793f439	48e26b1d-b84d-432b-940b-9907c81ddf5b	g.chrX:142605206G>T	ENST00000370503.2	-	1	97	c.14C>A	c.(13-15)aCt>aAt	p.T5N	GS1-256O22.5_ENST00000431432.1_RNA	NM_001009609.2	NP_001009609.1	Q5MJ09	SPXN3_HUMAN	SPANX family, member N3	5										endometrium(1)|large_intestine(1)|lung(9)|ovary(2)|urinary_tract(1)	14	Acute lymphoblastic leukemia(192;6.56e-05)					GGTGCTGGAAGTTGGCTGTTC	0.463																																					p.T5N		.											.	SPANXN3-132	0			c.C14A						.						275.0	239.0	251.0					X																	142605206		2203	4300	6503	SO:0001583	missense	139067	exon1			CTGGAAGTTGGCT		CCDS35418.1	Xq27.3	2012-06-12			ENSG00000189252	ENSG00000189252			33176	protein-coding gene	gene with protein product	"""cancer/testis antigen family 11, member 8"""	300666				14973187, 17012309	Standard	NM_001009609		Approved	SPANX-N3, CT11.8	uc004fbw.3	Q5MJ09	OTTHUMG00000022582	ENST00000370503.2:c.14C>A	X.37:g.142605206G>T	ENSP00000359534:p.Thr5Asn	Somatic	111	2		WXS	Illumina GAIIx	Phase_I	95	23	NM_001009609	0	0	0	0	0	Q0ZNK4	Missense_Mutation	SNP	ENST00000370503.2	37	CCDS35418.1	.	.	.	.	.	.	.	.	.	.	G	11.51	1.661011	0.29515	.	.	ENSG00000189252	ENST00000370503	T	0.07800	3.16	2.36	0.4	0.16331	.	.	.	.	.	T	0.20536	0.0494	M	0.72894	2.215	0.09310	N	1	D	0.89917	1.0	D	0.77557	0.99	T	0.10428	-1.0630	9	0.59425	D	0.04	.	3.1175	0.06380	0.1821:0.2825:0.5354:0.0	.	5	Q5MJ09	SPXN3_HUMAN	N	5	ENSP00000359534:T5N	ENSP00000359534:T5N	T	-	2	0	SPANXN3	142432872	0.000000	0.05858	0.000000	0.03702	0.015000	0.08874	-0.087000	0.11215	0.026000	0.15269	0.509000	0.49947	ACT	.		0.463	SPANXN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058620.2	NM_001009609	
HNRNPM	4670	broad.mit.edu	37	19	8550873	8550874	+	Frame_Shift_Ins	INS	-	-	A	rs370937476|rs575586653	byFrequency	TCGA-OR-A5L2-01A-11D-A30A-10	TCGA-OR-A5L2-10A-01D-A30A-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b99bd79e-aa33-4896-8d10-2517c793f439	48e26b1d-b84d-432b-940b-9907c81ddf5b	g.chr19:8550873_8550874insA	ENST00000325495.4	+	14	1602_1603	c.1561_1562insA	c.(1561-1563)gccfs	p.A521fs	HNRNPM_ENST00000348943.3_Frame_Shift_Ins_p.A482fs	NM_005968.4	NP_005959.2	P52272	HNRPM_HUMAN	heterogeneous nuclear ribonucleoprotein M	521	27 X 6 AA repeats of [GEVSTPAN]-[ILMV]- [DE]-[RH]-[MLVI]-[GAV].				alternative mRNA splicing, via spliceosome (GO:0000380)|gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)	catalytic step 2 spliceosome (GO:0071013)|extracellular matrix (GO:0031012)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|nuclear matrix (GO:0016363)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|paraspeckles (GO:0042382)|spliceosomal complex (GO:0005681)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|protein domain specific binding (GO:0019904)|RNA binding (GO:0003723)			endometrium(5)|kidney(2)|large_intestine(7)|lung(10)|ovary(1)	25						CATGGGCCCTGCCATCGAGCGC	0.693																																					p.A521fs		.											.	HNRNPM-68	0			c.1561_1562insA						.																																			SO:0001589	frameshift_variant	4670	exon14			GGCCCTGCCATCG	L03532	CCDS12203.1, CCDS12204.1	19p13.2	2013-06-12		2008-04-18	ENSG00000099783	ENSG00000099783		"""RNA binding motif (RRM) containing"""	5046	protein-coding gene	gene with protein product	"""CEA receptor"""	160994		NAGR1, HNRPM		8441656, 7558047	Standard	NM_005968		Approved	HTGR1, HNRNPM4, HNRPM4, CEAR	uc010dwe.3	P52272	OTTHUMG00000182383	Exception_encountered	19.37:g.8550873_8550874insA	ENSP00000325376:p.Ala521fs	Somatic	39	0		WXS	Illumina GAIIx	Phase_I	167	10	NM_005968	0	0	0	0	0	Q15584|Q8WZ44|Q96H56|Q9BWL9|Q9Y492	Frame_Shift_Ins	INS	ENST00000325495.4	37	CCDS12203.1																																																																																			.		0.693	HNRNPM-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000460894.1		
KRTAP10-6	386674	broad.mit.edu	37	21	46012219	46012220	+	In_Frame_Ins	INS	-	-	GGGGCGCAGCAGCTG	rs374776064|rs587611810|rs71199613	byFrequency	TCGA-OR-A5L2-01A-11D-A30A-10	TCGA-OR-A5L2-10A-01D-A30A-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b99bd79e-aa33-4896-8d10-2517c793f439	48e26b1d-b84d-432b-940b-9907c81ddf5b	g.chr21:46012219_46012220insGGGGCGCAGCAGCTG	ENST00000400368.1	-	1	166_167	c.146_147insCAGCTGCTGCGCCCC	c.(145-147)ccg>ccCAGCTGCTGCGCCCCg	p.49_49P>PSCCAP	TSPEAR_ENST00000323084.4_Intron	NM_198688.2	NP_941961.2	P60371	KR106_HUMAN	keratin associated protein 10-6	49	29 X 5 AA repeats of C-C-X(3).					keratin filament (GO:0045095)				endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(3)|lung(6)|prostate(3)|skin(1)|stomach(1)|urinary_tract(1)	23						GGCAGGGGGCCGGGGCGCAGCA	0.688														1042	0.208067	0.1188	0.2522	5008	,	,		15055	0.1379		0.3231	False		,,,				2504	0.2515				p.P49delinsPSCCAP		.											.	KRTAP10-6-90	0			c.147_148insCAGCTGCTGCGCCCC						.																																			SO:0001652	inframe_insertion	386674	exon1			GGGGGCCGGGGCG	AB076353	CCDS42959.1	21q22.3	2006-03-13	2004-07-12	2004-07-14	ENSG00000188155	ENSG00000188155		"""Keratin associated proteins"""	20523	protein-coding gene	gene with protein product			"""keratin associated protein 18-6"""	KRTAP18-6			Standard	NM_198688		Approved	KRTAP18.6, KAP18.6, KAP10.6	uc002zfm.3	P60371	OTTHUMG00000057634	ENST00000400368.1:c.146_147insCAGCTGCTGCGCCCC	21.37:g.46012219_46012220insGGGGCGCAGCAGCTG	Exception_encountered	Somatic	34	0		WXS	Illumina GAIIx	Phase_I	99	9	NM_198688	0	0	0	0	0		In_Frame_Ins	INS	ENST00000400368.1	37	CCDS42959.1																																																																																			.		0.688	KRTAP10-6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128037.1	NM_198688	
RHBDD3	25807	broad.mit.edu	37	22	29661518	29661519	+	Frame_Shift_Ins	INS	-	-	C	rs150836859|rs78465643		TCGA-OR-A5L2-01A-11D-A30A-10	TCGA-OR-A5L2-10A-01D-A30A-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b99bd79e-aa33-4896-8d10-2517c793f439	48e26b1d-b84d-432b-940b-9907c81ddf5b	g.chr22:29661518_29661519insC	ENST00000216085.7	-	3	521_522	c.97_98insG	c.(97-99)gccfs	p.A33fs	EWSR1_ENST00000414183.2_5'Flank|EWSR1_ENST00000397938.2_5'Flank|EWSR1_ENST00000333395.6_5'Flank|EWSR1_ENST00000331029.7_5'Flank|EWSR1_ENST00000332050.6_5'Flank|EWSR1_ENST00000406548.1_5'Flank|EWSR1_ENST00000332035.6_5'Flank	NM_012265.1	NP_036397.1	Q9Y3P4	RHBD3_HUMAN	rhomboid domain containing 3	33					liver development (GO:0001889)|MAPK cascade (GO:0000165)|negative regulation of natural killer cell activation (GO:0032815)|positive regulation of protein catabolic process (GO:0045732)|regulation of acute inflammatory response (GO:0002673)|regulation of protein secretion (GO:0050708)|response to xenobiotic stimulus (GO:0009410)	integral component of membrane (GO:0016021)	serine-type endopeptidase activity (GO:0004252)			lung(1)|ovary(1)	2						GCCGGGGCCGGCCCCCACCAGC	0.683																																					p.A33fs		.											.	RHBDD3-91	0			c.98_99insG						.																																			SO:0001589	frameshift_variant	25807	exon3			GGGCCGGCCCCCA	AL050346	CCDS13850.1	22q12.2	2006-02-22	2006-02-22	2006-02-22	ENSG00000100263	ENSG00000100263			1308	protein-coding gene	gene with protein product			"""chromosome 22 open reading frame 3"""	C22orf3		10591208, 15105437	Standard	NM_012265		Approved	PTAG	uc003aeq.1	Q9Y3P4	OTTHUMG00000151032	ENST00000216085.7:c.98dupG	22.37:g.29661523_29661523dupC	ENSP00000216085:p.Ala33fs	Somatic	177	0		WXS	Illumina GAIIx	Phase_I	290	11	NM_012265	0	0	0	0	0	Q6I9X3|Q9UGQ7	Frame_Shift_Ins	INS	ENST00000216085.7	37	CCDS13850.1																																																																																			.		0.683	RHBDD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321085.1	NM_012265	
NUP214	8021	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	9	134073007	134073008	+	Frame_Shift_Ins	INS	-	-	C			TCGA-OR-A5L2-01A-11D-A30A-10	TCGA-OR-A5L2-10A-01D-A30A-10	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b99bd79e-aa33-4896-8d10-2517c793f439	48e26b1d-b84d-432b-940b-9907c81ddf5b	g.chr9:134073007_134073008insC	ENST00000359428.5	+	29	4270_4271	c.4126_4127insC	c.(4126-4128)gccfs	p.A1376fs	NUP214_ENST00000465486.2_3'UTR|NUP214_ENST00000411637.2_Frame_Shift_Ins_p.A1366fs|NUP214_ENST00000483497.2_Frame_Shift_Ins_p.A202fs|NUP214_ENST00000451030.1_Frame_Shift_Ins_p.A1377fs			P35658	NU214_HUMAN	nucleoporin 214kDa	1376	11 X 5 AA approximate repeats.|Pro/Ser/Thr-rich.				carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|gene expression (GO:0010467)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA export from nucleus (GO:0006406)|mRNA metabolic process (GO:0016071)|protein export from nucleus (GO:0006611)|protein import into nucleus (GO:0006606)|regulation of cell cycle (GO:0051726)|regulation of glucose transport (GO:0010827)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	cytosol (GO:0005829)|focal adhesion (GO:0005925)|intracellular membrane-bounded organelle (GO:0043231)|nuclear pore (GO:0005643)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	nucleocytoplasmic transporter activity (GO:0005487)|transporter activity (GO:0005215)			NS(1)|breast(9)|central_nervous_system(3)|endometrium(13)|kidney(2)|large_intestine(9)|liver(2)|lung(29)|ovary(2)|prostate(3)|skin(7)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	86	all_hematologic(7;0.0028)	Myeloproliferative disorder(178;0.204)		OV - Ovarian serous cystadenocarcinoma(145;3.42e-05)|Epithelial(140;0.000256)		TAATTTTACTGCCCCCCCGGTG	0.545			T	"""DEK, SET, ABL1"""	"""AML, T-ALL"""																																p.A1376fs	Pancreas(4;24 48 25510 30394 32571)	.		Dom	yes		9	9q34.1	8021	nucleoporin 214kDa (CAN)		L	.	NUP214-1131	0			c.4126_4127insC						.																																			SO:0001589	frameshift_variant	8021	exon29			TTTACTGCCCCCC	X64228	CCDS6940.1	9q34	2008-07-21	2002-08-29		ENSG00000126883	ENSG00000126883			8064	protein-coding gene	gene with protein product	"""nuclear pore complex protein Nup214"", ""CAN protein, putative oncogene"""	114350	"""nucleoporin 214kD (CAIN)"""			8108440, 2370860	Standard	NM_005085		Approved	CAIN, CAN, D9S46E, N214	uc004cag.3	P35658	OTTHUMG00000020816	ENST00000359428.5:c.4133dupC	9.37:g.134073014_134073014dupC	ENSP00000352400:p.Ala1376fs	Somatic	147	0		WXS	Illumina GAIIx	Phase_I	130	14	NM_005085	0	0	0	0	0	A6NFQ0|Q15010|Q3KQZ0|Q5JUP7|Q75R47|Q86XD3	Frame_Shift_Ins	INS	ENST00000359428.5	37	CCDS6940.1																																																																																			.		0.545	NUP214-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000054694.2	NM_005085	
C11orf96	387763	broad.mit.edu	37	11	43965005	43965006	+	IGR	DNP	CC	CC	AA			TCGA-OR-A5L2-01A-11D-A30A-10	TCGA-OR-A5L2-10A-01D-A30A-10	CC	CC	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b99bd79e-aa33-4896-8d10-2517c793f439	48e26b1d-b84d-432b-940b-9907c81ddf5b	g.chr11:43965005_43965006CC>AA	ENST00000339446.3	+	0	1308				RP11-613D13.8_ENST00000501541.1_lincRNA|RP11-613D13.4_ENST00000526408.1_RNA|C11orf96_ENST00000528572.1_Missense_Mutation_p.L301M			Q7Z7L8	CK096_HUMAN	chromosome 11 open reading frame 96											pancreas(1)	1						CCGCGCTCGCCCTGGCCCGGGA	0.698																																					p.L301M		.											.	C11orf96-46	0			.						.																																			SO:0001628	intergenic_variant	387763	.			CTCGCCCTGGCCC		CCDS73275.1	11p11.2	2012-08-10			ENSG00000187479	ENSG00000187479			38675	protein-coding gene	gene with protein product							Standard	NM_001145033		Approved	AG2	uc010rfl.2	Q7Z7L8	OTTHUMG00000166555	Exception_encountered	11.37:g.43965005_43965006delinsAA		Somatic	8	0		WXS	Illumina GAIIx	Phase_I	15	1	.	0	0	0	0	0		Missense_Mutation	DNP	ENST00000339446.3	37																																																																																				.		0.698	C11orf96-201	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding		NM_001145033	
