#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_TTotCov	i_TVarCov	i_Transcript_Id	i_Trna_alt1	i_Trna_alt2	i_Trna_ref	i_Trna_tot	i_Trna_var	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
MIB2	142678	hgsc.bcm.edu	37	1	1564067	1564067	+	Frame_Shift_Del	DEL	G	G	-			TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr1:1564067delG	ENST00000357210.4	+	16	2557	c.2341delG	c.(2341-2343)gggfs	p.G782fs	MIB2_ENST00000378708.1_Frame_Shift_Del_p.G688fs|MIB2_ENST00000518681.1_Frame_Shift_Del_p.G774fs|MIB2_ENST00000378712.1_Frame_Shift_Del_p.G659fs|MIB2_ENST00000520777.1_Frame_Shift_Del_p.G835fs|MIB2_ENST00000355826.5_Frame_Shift_Del_p.G825fs|MIB2_ENST00000360522.4_Frame_Shift_Del_p.G747fs|MIB2_ENST00000505820.2_Frame_Shift_Del_p.G839fs|MIB2_ENST00000378710.3_Frame_Shift_Del_p.G746fs|MIB2_ENST00000504599.1_Frame_Shift_Del_p.G738fs	NM_080875.2	NP_543151.2	Q96AX9	MIB2_HUMAN	mindbomb E3 ubiquitin protein ligase 2	782					Notch signaling pathway (GO:0007219)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)	early endosome (GO:0005769)|ubiquitin ligase complex (GO:0000151)	ligase activity (GO:0016874)|signal transducer activity (GO:0004871)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(5)|lung(7)|prostate(4)|upper_aerodigestive_tract(1)	18	all_cancers(77;0.000708)|all_epithelial(69;0.000943)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;6.04e-15)|all_lung(118;9.67e-07)|Lung NSC(185;5.59e-05)|Renal(390;0.00571)|Breast(487;0.0183)|Hepatocellular(190;0.0268)|Myeloproliferative disorder(586;0.028)|Ovarian(437;0.127)|Lung SC(97;0.217)		Epithelial(90;5.26e-37)|OV - Ovarian serous cystadenocarcinoma(86;2.54e-23)|GBM - Glioblastoma multiforme(42;9e-08)|Colorectal(212;0.000155)|COAD - Colon adenocarcinoma(227;0.000193)|Kidney(185;0.00227)|STAD - Stomach adenocarcinoma(132;0.00644)|BRCA - Breast invasive adenocarcinoma(365;0.00786)|KIRC - Kidney renal clear cell carcinoma(229;0.0339)|Lung(427;0.199)		TGATGGGGCCGGGGGGGACCC	0.716																																					p.G838fs		.											.	MIB2-90	0			c.2512delG						.		,,,,	22,3540		1,20,1760	6.0	10.0	9.0		,,,,	-1.3	1.0	1		9	63,7511		2,59,3726	no	frameshift,frameshift,frameshift,frameshift,frameshift	MIB2	NM_080875.2,NM_001170689.1,NM_001170688.1,NM_001170687.1,NM_001170686.1	,,,,	3,79,5486	A1A1,A1R,RR		0.8318,0.6176,0.7633	,,,,	,,,,	1564067	85,11051	1940	4054	5994	SO:0001589	frameshift_variant	142678	exon16			GGGGCCGGGGGGG	AK097106	CCDS41224.1, CCDS41224.2, CCDS53261.1, CCDS53262.1, CCDS53263.1, CCDS53264.1	1p36.33	2013-01-10	2012-02-23	2005-04-01	ENSG00000197530	ENSG00000197530		"""Zinc fingers, ZZ-type"", ""Ankyrin repeat domain containing"""	30577	protein-coding gene	gene with protein product		611141	"""zinc finger, ZZ type with ankyrin repeat domain 1"", ""mindbomb homolog 2 (Drosophila)"""	ZZANK1		12761501	Standard	NM_080875		Approved	skeletrophin, ZZZ5, FLJ39787	uc001agg.3	Q96AX9	OTTHUMG00000074647	ENST00000357210.4:c.2341delG	1.37:g.1564067delG	ENSP00000349741:p.Gly782fs	Somatic	18	1		WXS	Illumina GAIIx	Phase_I	61	22	NM_080875	0	0	0	0	0	A2AGM5|A2AGM6|B3KV93|B3KVF4|B3KXY1|B4DZ57|E9PGU1|E9PHQ1|F8WA73|J3KNZ7|Q7Z437|Q8IY62|Q8N786|Q8N897|Q8N8R2|Q8N911|Q8NB36|Q8NCY1|Q8NG59|Q8NG60|Q8NG61|Q8NI59|Q8WYN1	Frame_Shift_Del	DEL	ENST00000357210.4	37																																																																																				.		0.716	MIB2-201	KNOWN	basic|appris_candidate	protein_coding	protein_coding		NM_080875	
MORN1	79906	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	2316501	2316501	+	Silent	SNP	G	G	A			TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr1:2316501G>A	ENST00000378531.3	-	6	626	c.453C>T	c.(451-453)aaC>aaT	p.N151N	MORN1_ENST00000606372.1_5'UTR|MORN1_ENST00000378529.3_Silent_p.N151N	NM_024848.1	NP_079124.1	Q5T089	MORN1_HUMAN	MORN repeat containing 1	151										breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(1)|liver(1)|lung(1)|ovary(2)	9	all_cancers(77;0.000194)|all_epithelial(69;9.96e-05)|all_lung(157;0.016)|Lung NSC(156;0.0376)|Ovarian(185;0.0634)	all_epithelial(116;3.3e-15)|all_lung(118;1.15e-06)|Lung NSC(185;6.26e-05)|Renal(390;0.00571)|Breast(487;0.0183)|Hepatocellular(190;0.0268)|Myeloproliferative disorder(586;0.028)|Ovarian(437;0.127)|Medulloblastoma(700;0.151)|Lung SC(97;0.217)		Epithelial(90;2.21e-37)|OV - Ovarian serous cystadenocarcinoma(86;5.01e-23)|GBM - Glioblastoma multiforme(42;2.8e-08)|Colorectal(212;5.97e-05)|COAD - Colon adenocarcinoma(227;0.000241)|Kidney(185;0.00137)|BRCA - Breast invasive adenocarcinoma(365;0.00488)|STAD - Stomach adenocarcinoma(132;0.00665)|KIRC - Kidney renal clear cell carcinoma(229;0.0203)|Lung(427;0.212)		ACTTGTCACCGTTCCTGGGGG	0.711																																					p.N151N		.											.	MORN1-92	0			c.C453T						.						25.0	24.0	25.0					1																	2316501		2189	4295	6484	SO:0001819	synonymous_variant	79906	exon6			GTCACCGTTCCTG	AK024003	CCDS40.1, CCDS72688.1	1p36.33-p36.32	2008-02-05			ENSG00000116151	ENSG00000116151			25852	protein-coding gene	gene with protein product						12477932	Standard	XM_005244798		Approved	FLJ13941	uc001ajb.1	Q5T089	OTTHUMG00000001402	ENST00000378531.3:c.453C>T	1.37:g.2316501G>A		Somatic	32	0		WXS	Illumina GAIIx	Phase_I	69	29	NM_024848	0	0	0	0	0	A6NKZ6|Q8WW30|Q9H852	Silent	SNP	ENST00000378531.3	37	CCDS40.1	.	.	.	.	.	.	.	.	.	.	G	8.395	0.840681	0.16891	.	.	ENSG00000116151	ENST00000449373	.	.	.	4.62	-1.6	0.08426	.	.	.	.	.	T	0.39462	0.1079	.	.	.	0.80722	D	1	P	0.37233	0.588	B	0.32211	0.142	T	0.20140	-1.0284	7	0.87932	D	0	.	9.664	0.39972	0.6545:0.0:0.3455:0.0	.	102	Q5T088	.	M	102	.	ENSP00000390261:T102M	T	-	2	0	MORN1	2306361	0.035000	0.19736	0.950000	0.38849	0.869000	0.49853	-1.688000	0.01925	-0.560000	0.06102	-0.258000	0.10820	ACG	.		0.711	MORN1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000004055.1	NM_024848	
RPL22	6146	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	1	6246838	6246840	+	In_Frame_Del	DEL	TTC	TTC	-			TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10	TTC	TTC	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr1:6246838_6246840delTTC	ENST00000234875.4	-	4	317_319	c.279_281delGAA	c.(277-282)aagaat>aat	p.K93del	RPL22_ENST00000497965.1_In_Frame_Del_p.K60del|RPL22_ENST00000484532.1_Intron	NM_000983.3	NP_000974.1	P35268	RL22_HUMAN	ribosomal protein L22	93					alpha-beta T cell differentiation (GO:0046632)|cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|RNA metabolic process (GO:0016070)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)|translational elongation (GO:0006414)|translational initiation (GO:0006413)|translational termination (GO:0006415)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral transcription (GO:0019083)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|cytosolic large ribosomal subunit (GO:0022625)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	heparin binding (GO:0008201)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|structural constituent of ribosome (GO:0003735)			kidney(1)|large_intestine(2)|lung(2)|skin(1)	6	Ovarian(185;0.0634)	all_cancers(23;2.78e-38)|all_epithelial(116;8.88e-22)|all_lung(118;7.95e-08)|Lung NSC(185;1.6e-06)|all_neural(13;3.18e-06)|all_hematologic(16;8.99e-06)|Acute lymphoblastic leukemia(12;0.000365)|Breast(487;0.000496)|Renal(390;0.0007)|Colorectal(325;0.00104)|Glioma(11;0.00203)|Hepatocellular(190;0.00308)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0392)|Medulloblastoma(700;0.211)		Epithelial(90;4.53e-38)|GBM - Glioblastoma multiforme(13;3.33e-32)|OV - Ovarian serous cystadenocarcinoma(86;2.8e-19)|Colorectal(212;6.8e-08)|COAD - Colon adenocarcinoma(227;8.04e-06)|Kidney(185;4.89e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.000896)|BRCA - Breast invasive adenocarcinoma(365;0.00107)|STAD - Stomach adenocarcinoma(132;0.00311)|READ - Rectum adenocarcinoma(331;0.0642)|Lung(427;0.182)		ACGTAGATTATTCTTCTTCAAAT	0.394			T	RUNX1	"""AML, CML"""																																p.93_94del		.		Dom	yes		1	1p36.31	6146	ribosomal protein L22 (EAP)		L	.	RPL22-650	0			c.279_281del						.																																			SO:0001651	inframe_deletion	6146	exon4			AGATTATTCTTCT	BC058887	CCDS58.1	1p36.31	2011-04-06			ENSG00000116251	ENSG00000116251		"""L ribosomal proteins"""	10315	protein-coding gene	gene with protein product		180474				8395054	Standard	NM_000983		Approved	EAP, L22	uc001amd.3	P35268	OTTHUMG00000000953	ENST00000234875.4:c.279_281delGAA	1.37:g.6246844_6246846delTTC	ENSP00000346088:p.Lys93del	Somatic	323	0		WXS	Illumina GAIIx	Phase_I	297	191	NM_000983	0	0	0	0	0	B2R495|Q6IBD1	In_Frame_Del	DEL	ENST00000234875.4	37	CCDS58.1																																																																																			.		0.394	RPL22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000002830.1	NM_000983	
DFFA	1676	broad.mit.edu	37	1	10521671	10521671	+	Missense_Mutation	SNP	C	C	T	rs372939210		TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr1:10521671C>T	ENST00000377038.3	-	6	939	c.872G>A	c.(871-873)cGg>cAg	p.R291Q	RP5-1113E3.3_ENST00000424487.1_RNA	NM_004401.2	NP_004392.1	O00273	DFFA_HUMAN	DNA fragmentation factor, 45kDa, alpha polypeptide	291				R -> W (in Ref. 8; AAH07721). {ECO:0000305}.	apoptotic DNA fragmentation (GO:0006309)|apoptotic process (GO:0006915)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|negative regulation of apoptotic DNA fragmentation (GO:1902511)|negative regulation of execution phase of apoptosis (GO:1900118)|positive regulation of apoptotic process (GO:0043065)|thymocyte apoptotic process (GO:0070242)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)				large_intestine(3)|lung(2)	5	Ovarian(185;0.203)	all_lung(284;1.31e-05)|Lung NSC(185;2.19e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Hepatocellular(190;0.00913)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;3.25e-07)|COAD - Colon adenocarcinoma(227;7.25e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000296)|Kidney(185;0.00074)|KIRC - Kidney renal clear cell carcinoma(229;0.00258)|STAD - Stomach adenocarcinoma(132;0.0167)|READ - Rectum adenocarcinoma(331;0.0487)		GGCGAGCTCCCGCTCACAGGC	0.567																																					p.R291Q		.											.	DFFA-90	0			c.G872A						.	T	GLN/ARG,	1,4405	2.1+/-5.4	0,1,2202	81.0	82.0	82.0		872,	-1.5	0.0	1		82	0,8600		0,0,4300	no	missense,utr-3	DFFA	NM_004401.2,NM_213566.1	43,	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	benign,	291/332,	10521671	1,13005	2203	4300	6503	SO:0001583	missense	1676	exon6			AGCTCCCGCTCAC	AF087573	CCDS118.1, CCDS119.1	1p36.3-p36.2	2008-07-18	2002-08-29		ENSG00000160049	ENSG00000160049			2772	protein-coding gene	gene with protein product	"""DNA fragmentation factor, 45 kD, alpha subunit"""	601882	"""DNA fragmentation factor, 45 kD, alpha polypeptide"""			9605855, 9108473	Standard	NM_004401		Approved	DFF-45, DFF45, ICAD, DFF1	uc001arj.3	O00273	OTTHUMG00000001909	ENST00000377038.3:c.872G>A	1.37:g.10521671C>T	ENSP00000366237:p.Arg291Gln	Somatic	308	0		WXS	Illumina GAIIx	Phase_I	320	6	NM_004401	0	0	9	9	0	Q5T6G5|Q5T6G6|Q96I97|Q9Y6C6	Missense_Mutation	SNP	ENST00000377038.3	37	CCDS118.1	.	.	.	.	.	.	.	.	.	.	c	0.276	-0.989895	0.02162	2.27E-4	0.0	ENSG00000160049	ENST00000377038	.	.	.	5.28	-1.53	0.08611	DNA fragmentation factor 45kDa, C-terminal (1);	0.533386	0.22354	N	0.061180	T	0.10594	0.0259	N	0.00583	-1.355	0.49299	D	0.99977	B	0.10296	0.003	B	0.01281	0.0	T	0.39901	-0.9591	9	0.02654	T	1	-4.7106	6.3496	0.21369	0.0:0.1465:0.2547:0.5988	.	291	O00273	DFFA_HUMAN	Q	291	.	ENSP00000366237:R291Q	R	-	2	0	DFFA	10444258	0.993000	0.37304	0.010000	0.14722	0.190000	0.23558	0.607000	0.24209	-0.563000	0.06078	-1.139000	0.01908	CGG	.		0.567	DFFA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000005418.1	NM_004401	
ZBTB40	9923	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	22852723	22852723	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr1:22852723C>T	ENST00000375647.4	+	18	3761	c.3554C>T	c.(3553-3555)cCg>cTg	p.P1185L	ZBTB40_ENST00000404138.1_Missense_Mutation_p.P1185L|ZBTB40_ENST00000374651.4_Missense_Mutation_p.P1073L	NM_014870.3	NP_055685.3	Q9NUA8	ZBT40_HUMAN	zinc finger and BTB domain containing 40	1185					bone mineralization (GO:0030282)|cellular response to DNA damage stimulus (GO:0006974)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(4)|kidney(4)|large_intestine(6)|lung(8)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	26		Colorectal(325;3.46e-05)|Lung NSC(340;6.55e-05)|all_lung(284;9.87e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00308)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|OV - Ovarian serous cystadenocarcinoma(117;2.86e-26)|Colorectal(126;8.55e-08)|COAD - Colon adenocarcinoma(152;4.1e-06)|GBM - Glioblastoma multiforme(114;1.39e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000712)|KIRC - Kidney renal clear cell carcinoma(1967;0.00374)|STAD - Stomach adenocarcinoma(196;0.00645)|READ - Rectum adenocarcinoma(331;0.0693)|Lung(427;0.216)		CCGGTGGCCCCGACAGAGCAG	0.562																																					p.P1185L		.											.	ZBTB40-91	0			c.C3554T						.						80.0	81.0	80.0					1																	22852723		2203	4300	6503	SO:0001583	missense	9923	exon19			TGGCCCCGACAGA	AB007947	CCDS224.1	1p36	2013-01-08			ENSG00000184677	ENSG00000184677		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	29045	protein-coding gene	gene with protein product		612106					Standard	NM_014870		Approved	KIAA0478, ZNF923	uc001bfu.2	Q9NUA8	OTTHUMG00000002897	ENST00000375647.4:c.3554C>T	1.37:g.22852723C>T	ENSP00000364798:p.Pro1185Leu	Somatic	115	1		WXS	Illumina GAIIx	Phase_I	136	125	NM_001083621	0	0	0	0	0	O75066|Q5TFU5|Q8N1R1	Missense_Mutation	SNP	ENST00000375647.4	37	CCDS224.1	.	.	.	.	.	.	.	.	.	.	C	13.86	2.361924	0.41801	.	.	ENSG00000184677	ENST00000404138;ENST00000375647;ENST00000374651	T;T;T	0.05925	3.37;3.37;3.37	5.7	4.78	0.61160	.	0.253503	0.28482	N	0.015182	T	0.06554	0.0168	L	0.40543	1.245	0.26307	N	0.977885	P;P	0.39782	0.681;0.688	B;B	0.34301	0.179;0.087	T	0.19745	-1.0296	10	0.39692	T	0.17	-2.3837	14.0374	0.64654	0.1518:0.8482:0.0:0.0	.	1073;1185	F8WAI8;Q9NUA8	.;ZBT40_HUMAN	L	1185;1185;1073	ENSP00000384527:P1185L;ENSP00000364798:P1185L;ENSP00000363782:P1073L	ENSP00000363782:P1073L	P	+	2	0	ZBTB40	22725310	0.013000	0.17824	0.380000	0.26093	0.399000	0.30720	2.495000	0.45337	1.405000	0.46838	0.650000	0.86243	CCG	.		0.562	ZBTB40-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000008094.1	NM_014870	
HPCAL4	51440	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	40148354	40148354	+	Missense_Mutation	SNP	C	C	T	rs532685057		TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr1:40148354C>T	ENST00000372844.3	-	4	821	c.430G>A	c.(430-432)Ggg>Agg	p.G144R		NM_001282396.1|NM_001282397.1|NM_016257.2	NP_001269325.1|NP_001269326.1|NP_057341.1	Q9UM19	HPCL4_HUMAN	hippocalcin like 4	144					central nervous system development (GO:0007417)|signal transduction (GO:0007165)	intracellular (GO:0005622)	calcium channel regulator activity (GO:0005246)|calcium ion binding (GO:0005509)			breast(1)|central_nervous_system(1)|lung(5)|stomach(1)	8	all_cancers(7;4.65e-13)|Lung NSC(20;2.88e-06)|Ovarian(52;0.00167)|all_hematologic(146;0.0501)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;1.87e-18)|Epithelial(16;4.3e-17)|all cancers(16;8.48e-16)|LUSC - Lung squamous cell carcinoma(16;0.000261)|Lung(16;0.000457)			GGCGTGAGCCCGTCCTGGTTC	0.567													C|||	1	0.000199681	0.0	0.0	5008	,	,		20215	0.0		0.0	False		,,,				2504	0.001				p.G144R		.											.	HPCAL4-90	0			c.G430A						.						125.0	107.0	113.0					1																	40148354		2203	4300	6503	SO:0001583	missense	51440	exon4			TGAGCCCGTCCTG	AB001105	CCDS441.1, CCDS72761.1	1p34.2	2013-01-10			ENSG00000116983	ENSG00000116983		"""EF-hand domain containing"""	18212	protein-coding gene	gene with protein product						10520747	Standard	NM_016257		Approved	HLP4, DKFZp761G122	uc001cdr.3	Q9UM19	OTTHUMG00000009246	ENST00000372844.3:c.430G>A	1.37:g.40148354C>T	ENSP00000361935:p.Gly144Arg	Somatic	210	0		WXS	Illumina GAIIx	Phase_I	235	217	NM_016257	0	0	0	0	0	B2R5U2|D3DPU1|Q5TG97|Q8N611	Missense_Mutation	SNP	ENST00000372844.3	37	CCDS441.1	.	.	.	.	.	.	.	.	.	.	C	32	5.124695	0.94429	.	.	ENSG00000116983	ENST00000372844;ENST00000450300	T	0.72505	-0.66	4.64	4.64	0.57946	EF-hand-like domain (1);	0.063724	0.64402	D	0.000009	T	0.76463	0.3991	N	0.26162	0.8	0.80722	D	1	D;P	0.89917	1.0;0.588	D;B	0.75020	0.985;0.108	T	0.80030	-0.1553	10	0.72032	D	0.01	.	18.4036	0.90526	0.0:1.0:0.0:0.0	.	72;144	B4DGW9;Q9UM19	.;HPCL4_HUMAN	R	144;136	ENSP00000361935:G144R	ENSP00000361935:G144R	G	-	1	0	HPCAL4	39920941	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	7.655000	0.83696	2.531000	0.85337	0.313000	0.20887	GGG	.		0.567	HPCAL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000025640.1	NM_016257	
TRIT1	54802	bcgsc.ca	37	1	40309802	40309802	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr1:40309802C>T	ENST00000316891.5	-	10	1219	c.1205G>A	c.(1204-1206)cGa>cAa	p.R402Q	TRIT1_ENST00000537440.1_Missense_Mutation_p.R98Q|TRIT1_ENST00000537223.1_Missense_Mutation_p.R98Q|TRIT1_ENST00000545233.1_Missense_Mutation_p.R156Q|TRIT1_ENST00000441669.2_Missense_Mutation_p.R320Q|TRIT1_ENST00000491865.1_5'UTR|TRIT1_ENST00000541099.1_Missense_Mutation_p.R20Q|TRIT1_ENST00000372818.1_Missense_Mutation_p.R376Q	NM_017646.4	NP_060116.2	Q9H3H1	MOD5_HUMAN	tRNA isopentenyltransferase 1	402					tRNA processing (GO:0008033)	mitochondrion (GO:0005739)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|tRNA dimethylallyltransferase activity (GO:0052381)			breast(1)|large_intestine(5)|liver(1)|lung(3)|ovary(2)|pancreas(1)|stomach(1)|urinary_tract(1)	15	all_cancers(7;4.55e-14)|all_lung(5;1.23e-16)|all_epithelial(6;2.17e-16)|Lung NSC(20;7.03e-07)|Ovarian(52;0.00167)|all_hematologic(146;0.0501)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0393)	OV - Ovarian serous cystadenocarcinoma(33;3.29e-18)|Epithelial(16;3.07e-17)|all cancers(16;6.21e-16)|LUSC - Lung squamous cell carcinoma(16;0.000261)|Lung(16;0.000457)			AATGATGATTCGATCACAGAG	0.448																																					p.R402Q		.											.	TRIT1-91	0			c.G1205A						.						137.0	122.0	128.0					1																	40309802		2203	4300	6503	SO:0001583	missense	54802	exon10			ATGATTCGATCAC	AF074918	CCDS30681.1	1p34.2	2012-10-05			ENSG00000043514	ENSG00000043514	2.5.1.8		20286	protein-coding gene	gene with protein product						11111046, 15870694	Standard	NM_017646		Approved	FLJ20061, IPT	uc021olz.1	Q9H3H1	OTTHUMG00000009245	ENST00000316891.5:c.1205G>A	1.37:g.40309802C>T	ENSP00000321810:p.Arg402Gln	Somatic	81	3		WXS	Illumina GAIIx	Phase_I	92	84	NM_017646	0	0	0	7	7	A1A4X7|Q3T7B5|Q5QPK5|Q5QPK6|Q6IAC9|Q96FJ3|Q96L45|Q9NXT7	Missense_Mutation	SNP	ENST00000316891.5	37	CCDS30681.1	.	.	.	.	.	.	.	.	.	.	C	27.1	4.801567	0.90538	.	.	ENSG00000043514	ENST00000046894;ENST00000372825;ENST00000441669;ENST00000316891;ENST00000372818;ENST00000534869;ENST00000545233;ENST00000537440;ENST00000537223;ENST00000541099	T;T	0.46451	0.88;0.87	6.17	5.26	0.73747	Zinc finger, double-stranded RNA binding (1);	0.048204	0.85682	D	0.000000	T	0.62925	0.2468	M	0.65975	2.015	0.80722	D	1	D;D;D;D	0.89917	0.999;0.999;1.0;1.0	D;D;D;D	0.76071	0.981;0.973;0.977;0.987	T	0.65022	-0.6269	10	0.51188	T	0.08	-8.7436	15.699	0.77528	0.0:0.9348:0.0:0.0652	.	402;376;320;98	Q9H3H1;Q9H3H1-4;Q9H3H1-5;Q3T7B5	MOD5_HUMAN;.;.;.	Q	376;320;314;402;376;295;156;98;98;20	ENSP00000321810:R402Q;ENSP00000361905:R376Q	ENSP00000046894:R376Q	R	-	2	0	TRIT1	40082389	0.999000	0.42202	0.998000	0.56505	0.993000	0.82548	3.368000	0.52357	1.630000	0.50440	0.655000	0.94253	CGA	.		0.448	TRIT1-001	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000025627.2	NM_017646	
CYP4A22	284541	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	47610627	47610627	+	Missense_Mutation	SNP	C	C	G	rs371439568		TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr1:47610627C>G	ENST00000371891.3	+	9	1238	c.1207C>G	c.(1207-1209)Cgc>Ggc	p.R403G	CYP4A22_ENST00000371890.3_Missense_Mutation_p.R305G|CYP4A22_ENST00000294337.3_Missense_Mutation_p.R403G|CYP4A22-AS1_ENST00000444042.2_lincRNA|CYP4A22_ENST00000485117.1_3'UTR	NM_001010969.2	NP_001010969.2	Q5TCH4	CP4AM_HUMAN	cytochrome P450, family 4, subfamily A, polypeptide 22	403						endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)	alkane 1-monooxygenase activity (GO:0018685)|arachidonic acid omega-hydroxylase activity (GO:0052869)|heme binding (GO:0020037)|iron ion binding (GO:0005506)	p.R403G(1)		breast(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(4)|ovary(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	22						CCCTGATGGGCGCTCCTTGCC	0.577																																					p.R403G	Pancreas(88;1240 1470 2099 14214 37557)	.											.	CYP4A22-139	1	Substitution - Missense(1)	breast(1)	c.C1207G						.						103.0	90.0	94.0					1																	47610627		2203	4300	6503	SO:0001583	missense	284541	exon9			GATGGGCGCTCCT		CCDS30707.1	1p33	2007-12-14			ENSG00000162365	ENSG00000162365		"""Cytochrome P450s"""	20575	protein-coding gene	gene with protein product		615341					Standard	XM_005270768		Approved		uc001cqv.1	Q5TCH4	OTTHUMG00000007845	ENST00000371891.3:c.1207C>G	1.37:g.47610627C>G	ENSP00000360958:p.Arg403Gly	Somatic	206	1		WXS	Illumina GAIIx	Phase_I	194	173	NM_001010969	0	0	0	0	0	Q5TCH3|Q6JXK7|Q6JXK8|Q9NRM4	Missense_Mutation	SNP	ENST00000371891.3	37	CCDS30707.1	.	.	.	.	.	.	.	.	.	.	c	15.32	2.797832	0.50208	.	.	ENSG00000162365	ENST00000371890;ENST00000371891;ENST00000294337	T;T;T	0.69175	-0.38;-0.38;-0.38	1.83	0.836	0.18891	.	0.097903	0.64402	D	0.000002	T	0.70334	0.3212	L	0.52266	1.64	0.38728	D	0.953608	D;D	0.63046	0.992;0.974	D;P	0.71414	0.973;0.793	T	0.68938	-0.5277	10	0.87932	D	0	.	4.8554	0.13557	0.2068:0.6643:0.0:0.129	.	305;403	Q5TCH5;Q5TCH4	.;CP4AM_HUMAN	G	305;403;403	ENSP00000360957:R305G;ENSP00000360958:R403G;ENSP00000294337:R403G	ENSP00000294337:R403G	R	+	1	0	CYP4A22	47383214	0.547000	0.26465	0.911000	0.35937	0.399000	0.30720	0.547000	0.23299	0.117000	0.18138	0.194000	0.17425	CGC	.		0.577	CYP4A22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000021635.1	XM_208213	
RPF1	80135	broad.mit.edu;bcgsc.ca	37	1	84945010	84945010	+	Missense_Mutation	SNP	C	C	G			TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr1:84945010C>G	ENST00000370654.5	+	1	61	c.46C>G	c.(46-48)Cta>Gta	p.L16V	RPF1_ENST00000370656.1_Missense_Mutation_p.L16V	NM_025065.6	NP_079341.2	Q9H9Y2	RPF1_HUMAN	ribosome production factor 1 homolog (S. cerevisiae)	16					rRNA processing (GO:0006364)	nucleolus (GO:0005730)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|rRNA binding (GO:0019843)			breast(2)|endometrium(1)|kidney(3)|large_intestine(5)|lung(2)|prostate(1)	14						GAAGAAAAGTCTAAAACGGAA	0.592																																					p.L16V		.											.	RPF1-90	0			c.C46G						.						27.0	28.0	28.0					1																	84945010		2203	4300	6503	SO:0001583	missense	80135	exon1			AAAAGTCTAAAAC	AF322053	CCDS695.1	1p22.3	2009-09-25	2009-09-25	2009-09-25	ENSG00000117133	ENSG00000117133			30350	protein-coding gene	gene with protein product	"""RNA processing factor 1"", ""ribosome production factor 1"""		"""brix domain containing 5"""	BXDC5		11864606	Standard	NM_025065		Approved		uc001djv.4	Q9H9Y2	OTTHUMG00000009857	ENST00000370654.5:c.46C>G	1.37:g.84945010C>G	ENSP00000359688:p.Leu16Val	Somatic	111	1		WXS	Illumina GAIIx	Phase_I	129	7	NM_025065	0	0	15	15	0	Q5VSK7|Q6AHX1|Q8WXZ8	Missense_Mutation	SNP	ENST00000370654.5	37	CCDS695.1	.	.	.	.	.	.	.	.	.	.	C	11.58	1.680311	0.29872	.	.	ENSG00000117133	ENST00000370656;ENST00000370654	T;T	0.46063	0.88;1.55	6.17	-4.9	0.03094	.	0.615878	0.15893	N	0.239464	T	0.04497	0.0123	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.35699	-0.9778	10	0.17832	T	0.49	-4.4388	3.267	0.06869	0.0801:0.3536:0.2275:0.3387	.	16	Q9H9Y2	RPF1_HUMAN	V	16	ENSP00000359690:L16V;ENSP00000359688:L16V	ENSP00000359688:L16V	L	+	1	2	RPF1	84717598	0.000000	0.05858	0.023000	0.16930	0.658000	0.38924	-0.462000	0.06704	-0.525000	0.06391	0.655000	0.94253	CTA	.		0.592	RPF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000027238.1	NM_025065	
ZNF326	284695	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	90487883	90487883	+	Silent	SNP	G	G	A	rs146247512	byFrequency	TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr1:90487883G>A	ENST00000340281.4	+	11	1523	c.1380G>A	c.(1378-1380)gcG>gcA	p.A460A	ZNF326_ENST00000370447.3_Silent_p.A371A|ZNF326_ENST00000455342.2_Silent_p.A254A	NM_182976.2	NP_892021.1	Q5BKZ1	ZN326_HUMAN	zinc finger protein 326	460					mRNA processing (GO:0006397)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of DNA-templated transcription, elongation (GO:0032784)|RNA splicing (GO:0008380)|transcription, DNA-templated (GO:0006351)	DBIRD complex (GO:0044609)|nuclear matrix (GO:0016363)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)|RNA polymerase II core binding (GO:0000993)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(12)|lung(7)|ovary(1)	25		all_lung(203;0.0116)|Lung NSC(277;0.0417)		all cancers(265;0.00728)|Epithelial(280;0.0265)		TAGTGAAGGCGCGATATGAAC	0.328													g|||	5	0.000998403	0.0	0.0	5008	,	,		17575	0.0		0.005	False		,,,				2504	0.0				p.A460A		.											.	ZNF326-91	0			c.G1380A						.	A		0,4406		0,0,2203	195.0	215.0	209.0		1380	-10.5	0.4	1	dbSNP_134	209	11,8587	8.4+/-32.0	0,11,4288	no	coding-synonymous	ZNF326	NM_182976.2		0,11,6491	AA,AG,GG		0.1279,0.0,0.0846		460/583	90487883	11,12993	2203	4299	6502	SO:0001819	synonymous_variant	284695	exon11			GAAGGCGCGATAT	BC013102	CCDS727.1, CCDS728.1	1p22	2012-04-19			ENSG00000162664	ENSG00000162664		"""Zinc fingers, C2H2-type"""	14104	protein-coding gene	gene with protein product	"""ZNF-protein interacting with nuclear mRNPs and DBC1"""	614601				22446626	Standard	NM_182976		Approved	Zfp326, ZAN75, FLJ20403, ZIRD	uc001dnq.2	Q5BKZ1	OTTHUMG00000010675	ENST00000340281.4:c.1380G>A	1.37:g.90487883G>A		Somatic	197	0		WXS	Illumina GAIIx	Phase_I	170	152	NM_182976	0	0	0	24	24	A8MYX1|B4DLN0|B4E179|Q5VW93|Q5VW94|Q5VW96|Q5VW97|Q6NSA2|Q7Z638|Q7Z6C2	Silent	SNP	ENST00000340281.4	37	CCDS727.1																																																																																			G|0.999;A|0.001		0.328	ZNF326-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000029428.2	NM_181781	
DPYD	1806	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	1	97771791	97771791	+	Frame_Shift_Del	DEL	A	A	-			TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr1:97771791delA	ENST00000370192.3	-	17	2221	c.2121delT	c.(2119-2121)tttfs	p.F707fs	DPYD-AS1_ENST00000422980.1_RNA	NM_000110.3	NP_000101	Q12882	DPYD_HUMAN	dihydropyrimidine dehydrogenase	707					beta-alanine biosynthetic process (GO:0019483)|nucleobase-containing small molecule metabolic process (GO:0055086)|purine nucleobase catabolic process (GO:0006145)|pyrimidine nucleobase catabolic process (GO:0006208)|pyrimidine nucleobase metabolic process (GO:0006206)|pyrimidine nucleoside catabolic process (GO:0046135)|small molecule metabolic process (GO:0044281)|thymidine catabolic process (GO:0006214)|thymine catabolic process (GO:0006210)|UMP biosynthetic process (GO:0006222)|uracil catabolic process (GO:0006212)	cytoplasm (GO:0005737)|cytosol (GO:0005829)	4 iron, 4 sulfur cluster binding (GO:0051539)|dihydroorotate dehydrogenase activity (GO:0004152)|dihydropyrimidine dehydrogenase (NADP+) activity (GO:0017113)|flavin adenine dinucleotide binding (GO:0050660)|metal ion binding (GO:0046872)|NADP binding (GO:0050661)|protein homodimerization activity (GO:0042803)			NS(2)|breast(4)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(18)|lung(30)|ovary(4)|prostate(6)|skin(7)|upper_aerodigestive_tract(1)	83		all_epithelial(167;0.000185)|all_lung(203;0.00318)|Lung NSC(277;0.00994)		Colorectal(170;0.0165)|Epithelial(280;0.0526)|all cancers(265;0.104)|READ - Rectum adenocarcinoma(84;0.171)|Lung(183;0.216)	Capecitabine(DB01101)|Flavin adenine dinucleotide(DB03147)|Fluorouracil(DB00544)	TCAGCTTGGCAAAAAAAGGAA	0.428																																					p.F707fs		.											.	DPYD-278	0			c.2121delT						.						171.0	169.0	170.0					1																	97771791		2203	4300	6503	SO:0001589	frameshift_variant	1806	exon17			CTTGGCAAAAAAA	U20938	CCDS30777.1, CCDS53346.1	1p22	2014-09-17			ENSG00000188641	ENSG00000188641	1.3.1.2		3012	protein-coding gene	gene with protein product		612779				7713523	Standard	NM_000110		Approved	DPD	uc001drv.3	Q12882	OTTHUMG00000039683	ENST00000370192.3:c.2121delT	1.37:g.97771791delA	ENSP00000359211:p.Phe707fs	Somatic	72	0		WXS	Illumina GAIIx	Phase_I	87	70	NM_000110	0	0	0	0	0	A2RRQ2|A2RRQ3|A8K5A2|A8MWG9|B1AN21|E9PFN1|Q16694|Q16761|Q32NB0|Q96HL6|Q96TH1	Frame_Shift_Del	DEL	ENST00000370192.3	37	CCDS30777.1																																																																																			.		0.428	DPYD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095698.3	NM_000110	
KCNC4	3749	broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	110766300	110766300	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr1:110766300G>A	ENST00000369787.3	+	2	1420	c.1393G>A	c.(1393-1395)Gcc>Acc	p.A465T	KCNC4_ENST00000412512.2_Intron|KCNC4_ENST00000438661.2_Missense_Mutation_p.A465T|KCNC4_ENST00000413138.3_Missense_Mutation_p.A465T	NM_004978.4	NP_004969.2	Q03721	KCNC4_HUMAN	potassium voltage-gated channel, Shaw-related subfamily, member 4	465					potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|regulation of neurotransmitter secretion (GO:0046928)|synaptic transmission (GO:0007268)	axon terminus (GO:0043679)|neuromuscular junction (GO:0031594)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|potassium channel activity (GO:0005267)|voltage-gated potassium channel activity (GO:0005249)			central_nervous_system(1)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(3)|liver(2)|lung(11)|ovary(1)|skin(2)	32		all_cancers(81;9.88e-06)|all_epithelial(167;3.23e-06)|all_lung(203;0.000116)|Lung NSC(277;0.000233)		Lung(183;0.0238)|all cancers(265;0.0693)|Epithelial(280;0.0748)|Colorectal(144;0.112)|LUSC - Lung squamous cell carcinoma(189;0.135)		GCTCACCATCGCCATGCCGGT	0.597																																					p.A465T		.											.	KCNC4-154	0			c.G1393A						.						111.0	95.0	100.0					1																	110766300		2203	4300	6503	SO:0001583	missense	3749	exon2			ACCATCGCCATGC	BC101769	CCDS821.1, CCDS44193.1	1p21	2012-07-05			ENSG00000116396	ENSG00000116396		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6236	protein-coding gene	gene with protein product		176265	"""chromosome 1 open reading frame 30"""	C1orf30		1920536, 1740329, 16382104	Standard	NM_004978		Approved	Kv3.4, HKSHIIIC	uc001dzh.3	Q03721	OTTHUMG00000011037	ENST00000369787.3:c.1393G>A	1.37:g.110766300G>A	ENSP00000358802:p.Ala465Thr	Somatic	155	1		WXS	Illumina GAIIx	Phase_I	165	42	NM_001039574	0	0	0	0	0	Q3MIM4|Q5TBI6	Missense_Mutation	SNP	ENST00000369787.3	37	CCDS821.1	.	.	.	.	.	.	.	.	.	.	G	19.99	3.928092	0.73327	.	.	ENSG00000116396	ENST00000369787;ENST00000413138;ENST00000438661	D;D;D	0.98822	-5.16;-5.16;-5.16	5.04	3.13	0.36017	Ion transport (1);	0.050209	0.85682	D	0.000000	D	0.98909	0.9630	M	0.89214	3.015	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.994;0.999	D	0.99709	1.1006	10	0.87932	D	0	.	10.6741	0.45776	0.0726:0.1325:0.7949:0.0	.	465;465;465	Q03721;Q03721-3;Q03721-2	KCNC4_HUMAN;.;.	T	465	ENSP00000358802:A465T;ENSP00000388029:A465T;ENSP00000393655:A465T	ENSP00000358802:A465T	A	+	1	0	KCNC4	110567823	1.000000	0.71417	0.662000	0.29724	0.835000	0.47333	9.869000	0.99810	0.623000	0.30267	0.462000	0.41574	GCC	.		0.597	KCNC4-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000052146.2	NM_001039574	
KCNA3	3738	broad.mit.edu	37	1	111216774	111216774	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr1:111216774C>T	ENST00000369769.2	-	1	881	c.658G>A	c.(658-660)Gtg>Atg	p.V220M		NM_002232.3	NP_002223.3	P22001	KCNA3_HUMAN	potassium voltage-gated channel, shaker-related subfamily, member 3	220					potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|synaptic transmission (GO:0007268)	membrane raft (GO:0045121)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|outward rectifier potassium channel activity (GO:0015271)|voltage-gated ion channel activity (GO:0005244)			endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(13)|lung(7)|ovary(4)|pancreas(1)|prostate(3)|skin(1)	38		all_cancers(81;3.92e-06)|all_epithelial(167;1.28e-05)|all_lung(203;0.000199)|Lung NSC(277;0.000398)		Lung(183;0.0235)|Colorectal(144;0.0306)|all cancers(265;0.0752)|Epithelial(280;0.0821)|COAD - Colon adenocarcinoma(174;0.132)|LUSC - Lung squamous cell carcinoma(189;0.133)	Dalfampridine(DB06637)	AGCAGCCACACCTGGCGCTGG	0.672																																					p.V220M		.											.	KCNA3-95	0			c.G658A						.						36.0	44.0	41.0					1																	111216774		2196	4286	6482	SO:0001583	missense	3738	exon1			GCCACACCTGGCG	L23499	CCDS828.2	1p13.3	2012-07-05			ENSG00000177272	ENSG00000177272		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6221	protein-coding gene	gene with protein product		176263				2251283, 16382104	Standard	NM_002232		Approved	Kv1.3, MK3, HLK3, HPCN3	uc001dzv.1	P22001	OTTHUMG00000034493	ENST00000369769.2:c.658G>A	1.37:g.111216774C>T	ENSP00000358784:p.Val220Met	Somatic	57	0		WXS	Illumina GAIIx	Phase_I	81	4	NM_002232	0	0	0	0	0	Q5VWN2	Missense_Mutation	SNP	ENST00000369769.2	37	CCDS828.2	.	.	.	.	.	.	.	.	.	.	C	17.62	3.435686	0.62955	.	.	ENSG00000177272	ENST00000369769	T	0.68025	-0.3	4.8	4.8	0.61643	.	0.000000	0.85682	U	0.000000	T	0.68970	0.3059	L	0.48986	1.54	0.80722	D	1	P	0.48911	0.917	P	0.56788	0.806	T	0.72214	-0.4358	10	0.56958	D	0.05	.	17.82	0.88648	0.0:1.0:0.0:0.0	.	220	P22001	KCNA3_HUMAN	M	220	ENSP00000358784:V220M	ENSP00000358784:V220M	V	-	1	0	KCNA3	111018297	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.978000	0.70501	2.209000	0.71365	0.561000	0.74099	GTG	.		0.672	KCNA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000083391.1	NM_002232	
IGSF3	3321	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	117131615	117131615	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr1:117131615G>A	ENST00000369486.3	-	8	2906	c.2141C>T	c.(2140-2142)gCg>gTg	p.A714V	IGSF3_ENST00000369483.1_Missense_Mutation_p.A734V|IGSF3_ENST00000318837.6_Missense_Mutation_p.A734V	NM_001007237.1	NP_001007238.1	O75054	IGSF3_HUMAN	immunoglobulin superfamily, member 3	714	Ig-like C2-type 6.				lacrimal gland development (GO:0032808)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)				NS(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|liver(1)|lung(31)|ovary(4)|prostate(1)|skin(4)|upper_aerodigestive_tract(2)	62	Lung SC(450;0.225)	all_cancers(81;1.24e-06)|all_epithelial(167;4.85e-07)|all_lung(203;1.66e-06)|Lung NSC(69;1.11e-05)		Lung(183;0.0142)|Colorectal(144;0.0929)|LUSC - Lung squamous cell carcinoma(189;0.108)|COAD - Colon adenocarcinoma(174;0.139)|all cancers(265;0.159)|Epithelial(280;0.166)		CCAGAGCACCGCAAAGTGGGA	0.537																																					p.A734V		.											.	IGSF3-92	0			c.C2201T						.						126.0	115.0	119.0					1																	117131615		2203	4300	6503	SO:0001583	missense	3321	exon9			AGCACCGCAAAGT	AF031174	CCDS30813.1, CCDS30814.1	1p13	2013-01-29			ENSG00000143061	ENSG00000143061		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5950	protein-coding gene	gene with protein product		603491				9790749	Standard	NM_001007237		Approved	V8, EWI-3, MGC117164	uc031pnr.1	O75054	OTTHUMG00000022751	ENST00000369486.3:c.2141C>T	1.37:g.117131615G>A	ENSP00000358498:p.Ala714Val	Somatic	221	1		WXS	Illumina GAIIx	Phase_I	236	218	NM_001542	0	0	0	4	4	A6NJZ6|A6NMC7	Missense_Mutation	SNP	ENST00000369486.3	37	CCDS30813.1	.	.	.	.	.	.	.	.	.	.	G	18.19	3.570076	0.65765	.	.	ENSG00000143061	ENST00000369486;ENST00000369483;ENST00000318837	T;T;T	0.66460	-0.21;-0.21;-0.21	4.31	4.31	0.51392	Immunoglobulin subtype (1);Immunoglobulin V-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.393600	0.24554	N	0.037529	T	0.59918	0.2229	L	0.29908	0.895	0.53688	D	0.999975	D;D;D	0.64830	0.992;0.992;0.994	P;P;P	0.57620	0.731;0.824;0.824	T	0.64859	-0.6308	10	0.54805	T	0.06	-30.5031	14.3102	0.66410	0.0:0.0:1.0:0.0	.	734;714;734	O75054-2;O75054;A6NJZ6	.;IGSF3_HUMAN;.	V	714;734;734	ENSP00000358498:A714V;ENSP00000358495:A734V;ENSP00000321184:A734V	ENSP00000321184:A734V	A	-	2	0	IGSF3	116933138	0.996000	0.38824	0.879000	0.34478	0.772000	0.43724	7.011000	0.76359	2.226000	0.72624	0.462000	0.41574	GCG	.		0.537	IGSF3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000059040.1	NM_001542	
BOLA1	51027	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	149871945	149871945	+	Silent	SNP	C	C	T	rs587688660		TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr1:149871945C>T	ENST00000369153.2	+	3	997	c.333C>T	c.(331-333)ccC>ccT	p.P111P	BOLA1_ENST00000476344.1_3'UTR|BOLA1_ENST00000369150.1_Silent_p.P111P|BOLA1_ENST00000369152.5_Silent_p.P111P			Q9Y3E2	BOLA1_HUMAN	bolA family member 1	111						extracellular region (GO:0005576)|mitochondrion (GO:0005739)				endometrium(2)|kidney(1)|large_intestine(1)|lung(5)|ovary(1)	10	Breast(34;0.0124)|all_hematologic(923;0.127)		STAD - Stomach adenocarcinoma(528;0.133)|LUSC - Lung squamous cell carcinoma(543;0.221)			CACGGACCCCCGCCCAGTGGA	0.652													C|||	1	0.000199681	0.0	0.0	5008	,	,		15045	0.001		0.0	False		,,,				2504	0.0				p.P111P		.											.	BOLA1-69	0			c.C333T						.						26.0	31.0	29.0					1																	149871945		2202	4300	6502	SO:0001819	synonymous_variant	51027	exon2			GACCCCCGCCCAG	AF151901	CCDS939.1	1q21	2013-09-02	2013-09-02		ENSG00000178096	ENSG00000178096			24263	protein-coding gene	gene with protein product		613181	"""bolA-like 1 (E. coli)"", ""bolA homolog 1 (E. coli)"""			14718656	Standard	NM_016074		Approved	CGI-143	uc001etf.3	Q9Y3E2	OTTHUMG00000012087	ENST00000369153.2:c.333C>T	1.37:g.149871945C>T		Somatic	64	1		WXS	Illumina GAIIx	Phase_I	117	105	NM_016074	0	0	0	15	15	B2R7K2|D3DUZ4|Q5QNY0	Silent	SNP	ENST00000369153.2	37	CCDS939.1																																																																																			.		0.652	BOLA1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033443.2	NM_016074	
FLG	2312	broad.mit.edu;bcgsc.ca	37	1	152286313	152286313	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr1:152286313G>A	ENST00000368799.1	-	3	1084	c.1049C>T	c.(1048-1050)gCa>gTa	p.A350V	FLG-AS1_ENST00000593011.1_RNA|FLG-AS1_ENST00000392688.2_RNA|FLG-AS1_ENST00000420707.1_RNA	NM_002016.1	NP_002007.1	P20930	FILA_HUMAN	filaggrin	350	Ser-rich.				establishment of skin barrier (GO:0061436)|keratinocyte differentiation (GO:0030216)|multicellular organismal development (GO:0007275)	cytoplasmic membrane-bounded vesicle (GO:0016023)|intermediate filament (GO:0005882)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|structural molecule activity (GO:0005198)			autonomic_ganglia(1)|breast(13)|central_nervous_system(5)|cervix(2)|endometrium(38)|haematopoietic_and_lymphoid_tissue(1)|kidney(16)|large_intestine(57)|lung(211)|ovary(13)|pancreas(1)|prostate(15)|skin(24)|stomach(5)|upper_aerodigestive_tract(10)|urinary_tract(12)	424	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			GGAGCTGTCTGCAGAGTGCCC	0.542									Ichthyosis																												p.A350V		.											.	FLG-106	0			c.C1049T						.						257.0	252.0	254.0					1																	152286313		2203	4300	6503	SO:0001583	missense	2312	exon3	Familial Cancer Database	X-linked Ichthyosis, Steroid Sulfatase Deficiency, Ichthyosis Vulgaris	CTGTCTGCAGAGT	XM_048104	CCDS30860.1	1q21.3	2013-01-10			ENSG00000143631	ENSG00000143631		"""EF-hand domain containing"""	3748	protein-coding gene	gene with protein product		135940				2740331, 2248957, 16444271	Standard	NM_002016		Approved		uc001ezu.1	P20930	OTTHUMG00000012202	ENST00000368799.1:c.1049C>T	1.37:g.152286313G>A	ENSP00000357789:p.Ala350Val	Somatic	280	0		WXS	Illumina GAIIx	Phase_I	371	11	NM_002016	0	0	0	0	0	Q01720|Q5T583|Q9UC71	Missense_Mutation	SNP	ENST00000368799.1	37	CCDS30860.1	.	.	.	.	.	.	.	.	.	.	-	10.25	1.297607	0.23650	.	.	ENSG00000143631	ENST00000368799	T	0.00669	5.9	2.8	-4.04	0.04010	.	.	.	.	.	T	0.00754	0.0025	M	0.68317	2.08	0.09310	N	1	D	0.71674	0.998	D	0.71870	0.975	T	0.44952	-0.9294	9	0.40728	T	0.16	-0.253	0.6106	0.00761	0.3855:0.1967:0.2494:0.1684	.	350	P20930	FILA_HUMAN	V	350	ENSP00000357789:A350V	ENSP00000357789:A350V	A	-	2	0	FLG	150552937	0.000000	0.05858	0.000000	0.03702	0.018000	0.09664	-3.643000	0.00405	-0.769000	0.04620	-0.498000	0.04607	GCA	.		0.542	FLG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033742.1	NM_002016	
SPRR3	6707	ucsc.edu;mdanderson.org	37	1	152975715	152975715	+	Silent	SNP	C	C	T	rs28989168	byFrequency	TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr1:152975715C>T	ENST00000295367.4	+	2	261	c.219C>T	c.(217-219)ggC>ggT	p.G73G	SPRR3_ENST00000542696.1_Silent_p.G73G|SPRR3_ENST00000331860.3_Silent_p.G73G	NM_001097589.1	NP_001091058.1	Q9UBC9	SPRR3_HUMAN	small proline-rich protein 3	73	14 X 8 AA approximate tandem repeats.				epidermis development (GO:0008544)|keratinization (GO:0031424)|keratinocyte differentiation (GO:0030216)|peptide cross-linking (GO:0018149)|wound healing (GO:0042060)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	structural molecule activity (GO:0005198)			endometrium(1)|kidney(1)|large_intestine(2)|lung(1)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	11	Lung NSC(65;1.49e-28)|Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.171)			CTGAGCCAGGCTGTACCAAGG	0.577													T|||	2	0.000399361	0.0015	0.0	5008	,	,		14904	0.0		0.0	False		,,,				2504	0.0				p.G73G		.											.	SPRR3-45	0			c.C219T						.						42.0	39.0	40.0					1																	152975715		2182	4268	6450	SO:0001819	synonymous_variant	6707	exon2			GCCAGGCTGTACC	AY118269	CCDS1033.1	1q21-q22	2008-02-05			ENSG00000163209	ENSG00000163209			11268	protein-coding gene	gene with protein product		182271				8325635	Standard	NM_005416		Approved		uc001faz.4	Q9UBC9	OTTHUMG00000013872	ENST00000295367.4:c.219C>T	1.37:g.152975715C>T		Somatic	116	0		WXS	Illumina GAIIx	Phase_I	105	49	NM_001097589	0	0	0	0	0	A5YKK8|B2R4G8|D3DV32|O75597|Q4ZGI7|Q5T525|Q8NET7|Q9UDG3	Silent	SNP	ENST00000295367.4	37	CCDS1033.1																																																																																			A|0.000;C|0.697;T|0.303		0.577	SPRR3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000038910.1	NM_005416	
SPRR2G	6706	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	153122484	153122484	+	Missense_Mutation	SNP	G	G	T	rs573005165		TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr1:153122484G>T	ENST00000368748.4	-	2	141	c.103C>A	c.(103-105)Cct>Act	p.P35T		NM_001014291.3	NP_001014313.1	Q9BYE4	SPR2G_HUMAN	small proline-rich protein 2G	35	3 X 9 AA approximate tandem repeats.				epidermis development (GO:0008544)|keratinization (GO:0031424)|keratinocyte differentiation (GO:0030216)	cornified envelope (GO:0001533)|cytoplasm (GO:0005737)				endometrium(1)|lung(1)|skin(1)	3	all_lung(78;1.78e-30)|Lung NSC(65;7.29e-29)|Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.171)			GGCAGGTAAGGCTCAGGGCAC	0.612													.|||	1	0.000199681	0.0	0.0	5008	,	,		20593	0.0		0.001	False		,,,				2504	0.0				p.P35T		.											.	SPRR2G-68	0			c.C103A						.						154.0	118.0	130.0					1																	153122484		2203	4300	6503	SO:0001583	missense	6706	exon2			GGTAAGGCTCAGG	AF333957	CCDS30868.1	1q21-q22	2008-02-05			ENSG00000159516	ENSG00000159516			11267	protein-coding gene	gene with protein product						8325635, 11279051	Standard	NM_001014291		Approved		uc009wod.2	Q9BYE4	OTTHUMG00000014399	ENST00000368748.4:c.103C>A	1.37:g.153122484G>T	ENSP00000357737:p.Pro35Thr	Somatic	73	0		WXS	Illumina GAIIx	Phase_I	76	68	NM_001014291	0	0	0	0	0		Missense_Mutation	SNP	ENST00000368748.4	37	CCDS30868.1	.	.	.	.	.	.	.	.	.	.	G	6.807	0.518033	0.13005	.	.	ENSG00000159516	ENST00000368748	T	0.53206	0.63	4.74	2.88	0.33553	.	.	.	.	.	T	0.32315	0.0825	.	.	.	0.09310	N	1	D	0.55385	0.971	P	0.49853	0.624	T	0.10917	-1.0609	8	0.87932	D	0	-1.1651	7.0195	0.24907	0.2043:0.0:0.7957:0.0	.	35	Q9BYE4	SPR2G_HUMAN	T	35	ENSP00000357737:P35T	ENSP00000357737:P35T	P	-	1	0	SPRR2G	151389108	0.018000	0.18449	0.012000	0.15200	0.019000	0.09904	1.400000	0.34577	0.627000	0.30340	-0.192000	0.12808	CCT	.		0.612	SPRR2G-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040057.1		
PBXIP1	57326	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	1	154917581	154917583	+	In_Frame_Del	DEL	CTT	CTT	-			TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10	CTT	CTT	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr1:154917581_154917583delCTT	ENST00000368463.3	-	11	2184_2186	c.2113_2115delAAG	c.(2113-2115)aagdel	p.K705del	PBXIP1_ENST00000368465.1_In_Frame_Del_p.K676del|PBXIP1_ENST00000498553.1_5'Flank|PBXIP1_ENST00000542459.1_In_Frame_Del_p.K550del|PBXIP1_ENST00000539880.1_In_Frame_Del_p.K532del	NM_020524.2	NP_065385.2	Q96AQ6	PBIP1_HUMAN	pre-B-cell leukemia homeobox interacting protein 1	705					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|negative regulation of transcription, DNA-templated (GO:0045892)	cytosol (GO:0005829)|microtubule (GO:0005874)|nucleus (GO:0005634)	transcription corepressor activity (GO:0003714)			breast(1)|kidney(2)|large_intestine(6)|lung(13)|prostate(1)|urinary_tract(1)	24	all_epithelial(22;4.9e-30)|all_lung(78;4.1e-28)|all_hematologic(923;0.0359)|Hepatocellular(266;0.0877)|all_neural(408;0.245)		BRCA - Breast invasive adenocarcinoma(34;0.00034)			AGTGCTTGTCCTTCTTCCCTGAC	0.616																																					p.705_705del		.											.	PBXIP1-153	0			c.2113_2115del						.																																			SO:0001651	inframe_deletion	57326	exon11			CTTGTCCTTCTTC	AF221521	CCDS1074.1	1q22	2008-02-05	2007-01-30		ENSG00000163346	ENSG00000163346			21199	protein-coding gene	gene with protein product			"""pre-B-cell leukemia transcription factor interacting protein 1"""			7505766, 10825160	Standard	NM_020524		Approved	HPIP	uc001ffr.3	Q96AQ6	OTTHUMG00000037369	ENST00000368463.3:c.2113_2115delAAG	1.37:g.154917584_154917586delCTT	ENSP00000357448:p.Lys705del	Somatic	81	0		WXS	Illumina GAIIx	Phase_I	90	62	NM_020524	0	0	0	0	0	Q5T174|Q5T176|Q9H8X6|Q9HA02|Q9HD85	In_Frame_Del	DEL	ENST00000368463.3	37	CCDS1074.1																																																																																			.		0.616	PBXIP1-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090943.1	NM_020524	
IQGAP3	128239	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	156498355	156498355	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr1:156498355G>A	ENST00000361170.2	-	36	4629	c.4619C>T	c.(4618-4620)gCt>gTt	p.A1540V	snoU13_ENST00000458777.1_RNA	NM_178229.4	NP_839943.2	Q86VI3	IQGA3_HUMAN	IQ motif containing GTPase activating protein 3	1540					activation of MAPK activity (GO:0000187)|cellular response to organic substance (GO:0071310)|ERK1 and ERK2 cascade (GO:0070371)|G1/S transition of mitotic cell cycle (GO:0000082)|negative regulation of gene expression (GO:0010629)|positive regulation of gene expression (GO:0010628)|positive regulation of mammary gland epithelial cell proliferation (GO:0033601)|Ras protein signal transduction (GO:0007265)|regulation of cell size (GO:0008361)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|lateral plasma membrane (GO:0016328)	Ras GTPase activator activity (GO:0005099)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(8)|kidney(2)|large_intestine(14)|lung(29)|ovary(5)|prostate(5)|skin(5)|urinary_tract(3)	75	all_hematologic(923;0.088)|Hepatocellular(266;0.158)					CAGGAGCTGAGCAGCAGTGTA	0.483																																					p.A1540V		.											.	IQGAP3-96	0			c.C4619T						.						80.0	79.0	79.0					1																	156498355		2203	4300	6503	SO:0001583	missense	128239	exon36			AGCTGAGCAGCAG	AY253300	CCDS1144.1	1q21.3	2008-02-05			ENSG00000183856	ENSG00000183856			20669	protein-coding gene	gene with protein product							Standard	NM_178229		Approved		uc001fpf.3	Q86VI3	OTTHUMG00000033114	ENST00000361170.2:c.4619C>T	1.37:g.156498355G>A	ENSP00000354451:p.Ala1540Val	Somatic	64	0		WXS	Illumina GAIIx	Phase_I	60	51	NM_178229	0	0	0	1	1	Q5T3H8	Missense_Mutation	SNP	ENST00000361170.2	37	CCDS1144.1	.	.	.	.	.	.	.	.	.	.	G	34	5.312615	0.95655	.	.	ENSG00000183856	ENST00000361170	T	0.47869	0.83	4.94	4.94	0.65067	RasGAP protein, C-terminal (1);	0.059908	0.64402	D	0.000004	T	0.65133	0.2662	M	0.81802	2.56	0.58432	D	0.999995	D	0.89917	1.0	D	0.76575	0.988	T	0.68006	-0.5523	10	0.54805	T	0.06	-16.9922	16.9011	0.86114	0.0:0.0:1.0:0.0	.	1540	Q86VI3	IQGA3_HUMAN	V	1540	ENSP00000354451:A1540V	ENSP00000354451:A1540V	A	-	2	0	IQGAP3	154764979	1.000000	0.71417	0.999000	0.59377	0.969000	0.65631	6.468000	0.73551	2.585000	0.87301	0.591000	0.81541	GCT	.		0.483	IQGAP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080657.1	NM_178229	
KLHDC9	126823	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	1	161068381	161068382	+	Frame_Shift_Del	DEL	CA	CA	-			TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10	CA	CA	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr1:161068381_161068382delCA	ENST00000368011.4	+	1	198_199	c.56_57delCA	c.(55-57)ccafs	p.P19fs	PFDN2_ENST00000468311.1_5'Flank|KLHDC9_ENST00000490724.2_Intron|KLHDC9_ENST00000392192.2_Frame_Shift_Del_p.P19fs	NM_152366.4	NP_689579.3	Q8NEP7	KLDC9_HUMAN	kelch domain containing 9	19										lung(5)|upper_aerodigestive_tract(1)	6	all_cancers(52;1.28e-19)|Breast(13;0.00188)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.00165)			GCCTGGAGGCCAGTGGCGCGGG	0.693																																					p.19_19del		.											.	KLHDC9-22	0			c.56_57del						.																																			SO:0001589	frameshift_variant	126823	exon1			GGAGGCCAGTGGC	BC022077	CCDS30919.1, CCDS41425.1	1q23.3	2008-02-05			ENSG00000162755	ENSG00000162755			28489	protein-coding gene	gene with protein product	"""kelch/ankyrin repeat containing cyclin A1 interacting protein"""					15159402	Standard	NM_152366		Approved	KARCA1	uc001fxr.3	Q8NEP7	OTTHUMG00000031479	ENST00000368011.4:c.56_57delCA	1.37:g.161068381_161068382delCA	ENSP00000356990:p.Pro19fs	Somatic	72	0		WXS	Illumina GAIIx	Phase_I	131	113	NM_152366	0	0	0	0	0	Q5SY56|Q6NXT9|Q6PKN4|Q8N5E1|Q8NA16	Frame_Shift_Del	DEL	ENST00000368011.4	37	CCDS30919.1																																																																																			.		0.693	KLHDC9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077092.1	NM_152366	
TNR	7143	broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	175372700	175372700	+	Silent	SNP	C	C	T			TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr1:175372700C>T	ENST00000367674.2	-	4	1260	c.552G>A	c.(550-552)gaG>gaA	p.E184E	TNR_ENST00000263525.2_Silent_p.E184E			Q92752	TENR_HUMAN	tenascin R	184	Cys-rich.				associative learning (GO:0008306)|axon guidance (GO:0007411)|cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|locomotory exploration behavior (GO:0035641)|long-term synaptic potentiation (GO:0060291)|negative regulation of axon extension involved in regeneration (GO:0048692)|negative regulation of cell-cell adhesion (GO:0022408)|negative regulation of synaptic transmission (GO:0050805)|neuromuscular process controlling balance (GO:0050885)|neuron cell-cell adhesion (GO:0007158)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|positive regulation of transmission of nerve impulse (GO:0051971)|synapse organization (GO:0050808)|telencephalon cell migration (GO:0022029)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|membrane raft (GO:0045121)|nucleus (GO:0005634)|perineuronal net (GO:0072534)|proteinaceous extracellular matrix (GO:0005578)				NS(3)|breast(7)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(29)|lung(98)|ovary(4)|pancreas(5)|prostate(4)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	177	Renal(580;0.146)					AGCCACAGGACTCAAAGCTAA	0.577																																					p.E184E		.											.	TNR-324	0			c.G552A						.						79.0	83.0	82.0					1																	175372700		2203	4300	6503	SO:0001819	synonymous_variant	7143	exon4			ACAGGACTCAAAG	X98085	CCDS1318.1	1q24	2013-02-11	2012-07-12		ENSG00000116147	ENSG00000116147		"""Fibrinogen C domain containing"", ""Fibronectin type III domain containing"""	11953	protein-coding gene	gene with protein product	"""restrictin"", ""janusin"""	601995				8626505, 8940128	Standard	NM_003285		Approved		uc009wwu.1	Q92752	OTTHUMG00000034876	ENST00000367674.2:c.552G>A	1.37:g.175372700C>T		Somatic	161	2		WXS	Illumina GAIIx	Phase_I	190	162	NM_003285	0	0	0	0	0	C9J563|Q15568|Q5R3G0	Silent	SNP	ENST00000367674.2	37	CCDS1318.1																																																																																			.		0.577	TNR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084414.4	NM_003285	
TDRD5	163589	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	179621206	179621206	+	Silent	SNP	C	C	T			TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr1:179621206C>T	ENST00000367614.1	+	13	2393	c.2034C>T	c.(2032-2034)taC>taT	p.Y678Y	TDRD5_ENST00000444136.1_Silent_p.Y678Y|TDRD5_ENST00000294848.8_Silent_p.Y678Y	NM_001199091.1	NP_001186020.1	Q8NAT2	TDRD5_HUMAN	tudor domain containing 5	678					DNA methylation involved in gamete generation (GO:0043046)|P granule organization (GO:0030719)|spermatid development (GO:0007286)	chromatoid body (GO:0033391)|pi-body (GO:0071546)				NS(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(7)|lung(44)|ovary(2)|prostate(1)|skin(9)|stomach(1)|upper_aerodigestive_tract(2)	77						TAGCTTTATACACGACATCCA	0.418																																					p.Y678Y		.											.	TDRD5-94	0			c.C2034T						.						92.0	87.0	88.0					1																	179621206		2203	4300	6503	SO:0001819	synonymous_variant	163589	exon13			TTTATACACGACA	AK092142	CCDS1332.1, CCDS55663.1	1q24.2	2013-01-23			ENSG00000162782	ENSG00000162782		"""Tudor domain containing"""	20614	protein-coding gene	gene with protein product							Standard	NM_001199085		Approved	FLJ34823, TUDOR3	uc010pnp.2	Q8NAT2	OTTHUMG00000035259	ENST00000367614.1:c.2034C>T	1.37:g.179621206C>T		Somatic	135	0		WXS	Illumina GAIIx	Phase_I	143	127	NM_001199091	0	0	0	1	1	A1L4G5|B7ZLV0|Q5EBN4|Q5VTV0|Q6ZSK2	Silent	SNP	ENST00000367614.1	37	CCDS1332.1																																																																																			.		0.418	TDRD5-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000085295.1	NM_173533	
CFH	3075	broad.mit.edu;bcgsc.ca	37	1	196659363	196659363	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr1:196659363C>T	ENST00000359637.2	+	8	1200	c.1138C>T	c.(1138-1140)Cgt>Tgt	p.R380C	CFH_ENST00000439155.2_Missense_Mutation_p.R444C|CFH_ENST00000367429.4_Missense_Mutation_p.R444C			P08603	CFAH_HUMAN	complement factor H	444	Sushi 6. {ECO:0000255|PROSITE- ProRule:PRU00302}.				complement activation (GO:0006956)|complement activation, alternative pathway (GO:0006957)|innate immune response (GO:0045087)|regulation of complement activation (GO:0030449)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	heparan sulfate proteoglycan binding (GO:0043395)|heparin binding (GO:0008201)			NS(3)|breast(4)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(24)|lung(33)|ovary(1)|prostate(5)|skin(9)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	101						CAGATGCATCCGTGTCAGTAA	0.423																																					p.R444C		.											.	CFH-566	0			c.C1330T						.						107.0	88.0	95.0					1																	196659363		2203	4300	6503	SO:0001583	missense	3075	exon9			TGCATCCGTGTCA	Y00716	CCDS1385.1	1q32	2014-09-17	2004-08-09	2004-08-12	ENSG00000000971	ENSG00000000971		"""Complement system"""	4883	protein-coding gene	gene with protein product	"""beta-1H"", ""H factor 2 (complement)"", ""age-related maculopathy susceptibility 1"""	134370	"""H factor 1 (complement)"""	HF, HF1, HF2		2889480, 2963625	Standard	NM_000186		Approved	HUS, FHL1, ARMS1, ARMD4	uc001gtj.4	P08603	OTTHUMG00000035607	ENST00000359637.2:c.1138C>T	1.37:g.196659363C>T	ENSP00000352658:p.Arg380Cys	Somatic	417	1		WXS	Illumina GAIIx	Phase_I	464	22	NM_001014975	0	0	0	0	0	A5PL14|P78435|Q14570|Q2TAZ5|Q38G77|Q5TFM3|Q8N708|Q9NU86	Missense_Mutation	SNP	ENST00000359637.2	37		.	.	.	.	.	.	.	.	.	.	.	10.91	1.483643	0.26598	.	.	ENSG00000000971	ENST00000367429;ENST00000439155;ENST00000391986;ENST00000359637	T;T;T	0.74526	0.73;-0.85;-0.85	4.52	3.6	0.41247	Complement control module (1);Sushi/SCR/CCP (1);	.	.	.	.	D	0.85767	0.5773	M	0.89095	3.005	0.09310	N	1	D;D;D;D	0.89917	0.997;1.0;0.999;0.999	P;D;P;D	0.65987	0.73;0.94;0.693;0.911	T	0.75673	-0.3236	9	0.37606	T	0.19	.	10.7957	0.46459	0.0:0.809:0.191:0.0	.	380;444;444;444	Q5TFM2;P08603-2;P08603;F8WDX4	.;.;CFAH_HUMAN;.	C	444;444;444;380	ENSP00000356399:R444C;ENSP00000402656:R444C;ENSP00000352658:R380C	ENSP00000352658:R380C	R	+	1	0	CFH	194925986	0.000000	0.05858	0.006000	0.13384	0.018000	0.09664	0.502000	0.22594	1.493000	0.48517	0.655000	0.94253	CGT	.		0.423	CFH-002	PUTATIVE	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000087502.1	NM_000186	
F13B	2165	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	197031011	197031011	+	Silent	SNP	G	G	A	rs142562955		TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr1:197031011G>A	ENST00000367412.1	-	3	397	c.354C>T	c.(352-354)tgC>tgT	p.C118C		NM_001994.2	NP_001985.2	P05160	F13B_HUMAN	coagulation factor XIII, B polypeptide	118	Sushi 2. {ECO:0000255|PROSITE- ProRule:PRU00302}.				blood coagulation (GO:0007596)	extracellular region (GO:0005576)		p.C118C(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(5)|liver(1)|lung(40)|prostate(2)|skin(4)|upper_aerodigestive_tract(3)	66						ACCCTGAAGCGCAACCATAAC	0.403													g|||	1	0.000199681	0.0	0.0	5008	,	,		15590	0.001		0.0	False		,,,				2504	0.0				p.C118C		.											.	F13B-92	1	Substitution - coding silent(1)	upper_aerodigestive_tract(1)	c.C354T						.	A		1,4405	2.1+/-5.4	0,1,2202	133.0	111.0	118.0		354	-2.1	0.0	1	dbSNP_134	118	0,8600		0,0,4300	no	coding-synonymous	F13B	NM_001994.2		0,1,6502	AA,AG,GG		0.0,0.0227,0.0077		118/662	197031011	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	2165	exon3			TGAAGCGCAACCA	M14057	CCDS1388.1	1q31-q32.1	2012-10-02			ENSG00000143278	ENSG00000143278			3534	protein-coding gene	gene with protein product		134580				2339067, 2271707	Standard	NM_001994		Approved	FXIIIB	uc001gtt.1	P05160	OTTHUMG00000036519	ENST00000367412.1:c.354C>T	1.37:g.197031011G>A		Somatic	89	0		WXS	Illumina GAIIx	Phase_I	108	94	NM_001994	0	0	0	0	0	A8K3E5|Q5VYL5	Silent	SNP	ENST00000367412.1	37	CCDS1388.1																																																																																			G|1.000;A|0.000		0.403	F13B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000088821.2	NM_001994	
NUAK2	81788	ucsc.edu;bcgsc.ca	37	1	205273536	205273536	+	Missense_Mutation	SNP	C	C	T	rs200627742		TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr1:205273536C>T	ENST00000367157.3	-	7	1055	c.929G>A	c.(928-930)cGa>cAa	p.R310Q		NM_030952.1	NP_112214.1			NUAK family, SNF1-like kinase, 2											breast(3)|kidney(3)|large_intestine(4)|lung(4)|ovary(3)|prostate(3)|skin(1)|stomach(1)|urinary_tract(1)	23	Breast(84;0.186)		BRCA - Breast invasive adenocarcinoma(75;0.117)			CTCTCCCACTCGGGTGGCGTA	0.692													C|||	1	0.000199681	0.0	0.0	5008	,	,		16492	0.0		0.0	False		,,,				2504	0.001				p.R310Q		.											.	NUAK2-391	0			c.G929A						.	C	GLN/ARG	1,4401		0,1,2200	17.0	19.0	18.0		929	0.9	0.1	1		18	1,8591		0,1,4295	yes	missense	NUAK2	NM_030952.1	43	0,2,6495	TT,TC,CC		0.0116,0.0227,0.0154	benign	310/629	205273536	2,12992	2201	4296	6497	SO:0001583	missense	81788	exon7			CCCACTCGGGTGG	AK074830	CCDS1453.1	1q32.1	2008-02-05			ENSG00000163545	ENSG00000163545			29558	protein-coding gene	gene with protein product	"""SNF1/AMP activated protein kinase"""	608131				11230166	Standard	NM_030952		Approved	SNARK, FLJ90349	uc001hce.3	Q9H093	OTTHUMG00000037196	ENST00000367157.3:c.929G>A	1.37:g.205273536C>T	ENSP00000356125:p.Arg310Gln	Somatic	178	3		WXS	Illumina GAIIx	Phase_I	212	191	NM_030952	0	0	0	3	3		Missense_Mutation	SNP	ENST00000367157.3	37	CCDS1453.1	.	.	.	.	.	.	.	.	.	.	C	6.765	0.510045	0.12883	2.27E-4	1.16E-4	ENSG00000163545	ENST00000367157	T	0.37752	1.18	5.12	0.868	0.19090	Protein kinase-like domain (1);	0.728198	0.11873	N	0.521230	T	0.20901	0.0503	L	0.40543	1.245	0.09310	N	1	P	0.34412	0.453	B	0.18871	0.023	T	0.12682	-1.0538	10	0.22706	T	0.39	.	6.1815	0.20474	0.0:0.2935:0.4245:0.282	.	310	Q9H093	NUAK2_HUMAN	Q	310	ENSP00000356125:R310Q	ENSP00000356125:R310Q	R	-	2	0	NUAK2	203540159	0.015000	0.18098	0.080000	0.20451	0.058000	0.15608	0.044000	0.13992	0.178000	0.19917	0.511000	0.50034	CGA	.		0.692	NUAK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090390.1	NM_030952	
SLC41A1	254428	broad.mit.edu;bcgsc.ca	37	1	205760791	205760791	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr1:205760791C>T	ENST00000367137.3	-	11	2426	c.1412G>A	c.(1411-1413)gGc>gAc	p.G471D	SLC41A1_ENST00000468057.1_5'UTR	NM_173854.4	NP_776253.3	Q8IVJ1	S41A1_HUMAN	solute carrier family 41 (magnesium transporter), member 1	471					transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	cation transmembrane transporter activity (GO:0008324)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(2)|lung(4)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	17	Breast(84;0.0799)		BRCA - Breast invasive adenocarcinoma(75;0.0252)			CGGGTCCAGGCCCCGGCCCCA	0.582											OREG0014162	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.G471D		.											.	SLC41A1-92	0			c.G1412A						.						53.0	54.0	53.0					1																	205760791		2203	4300	6503	SO:0001583	missense	254428	exon11			TCCAGGCCCCGGC	AJ514402	CCDS30988.1	1q32.1	2013-07-17	2013-07-17		ENSG00000133065	ENSG00000133065		"""Solute carriers"""	19429	protein-coding gene	gene with protein product		610801				12810078, 18367447	Standard	NM_173854		Approved	MgtE	uc001hdh.1	Q8IVJ1	OTTHUMG00000036000	ENST00000367137.3:c.1412G>A	1.37:g.205760791C>T	ENSP00000356105:p.Gly471Asp	Somatic	229	0	2154	WXS	Illumina GAIIx	Phase_I	248	8	NM_173854	0	0	7	7	0	Q63HJ4|Q658Z5|Q659A4|Q6MZK2	Missense_Mutation	SNP	ENST00000367137.3	37	CCDS30988.1	.	.	.	.	.	.	.	.	.	.	C	18.24	3.579470	0.65878	.	.	ENSG00000133065	ENST00000367137	T	0.36699	1.24	5.65	5.65	0.86999	MgtE magnesium transporter, integral membrane (1);	0.054624	0.64402	D	0.000001	T	0.41282	0.1152	M	0.71581	2.175	0.58432	D	0.999999	B	0.19445	0.036	B	0.27076	0.076	T	0.21177	-1.0253	10	0.36615	T	0.2	-33.2432	13.953	0.64131	0.0:0.9252:0.0:0.0748	.	471	Q8IVJ1	S41A1_HUMAN	D	471	ENSP00000356105:G471D	ENSP00000356105:G471D	G	-	2	0	SLC41A1	204027414	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	6.093000	0.71422	2.651000	0.90000	0.655000	0.94253	GGC	.		0.582	SLC41A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087731.1		
ACBD3	64746	hgsc.bcm.edu;broad.mit.edu	37	1	226352491	226352491	+	Splice_Site	DEL	T	T	-			TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr1:226352491delT	ENST00000366812.5	-	3	622	c.568delA	c.(568-570)agg>gg	p.R190fs		NM_022735.3	NP_073572.2	Q9H3P7	GCP60_HUMAN	acyl-CoA binding domain containing 3	190	Glu-rich.				steroid biosynthetic process (GO:0006694)|transport (GO:0006810)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrion (GO:0005739)	fatty-acyl-CoA binding (GO:0000062)			breast(2)|endometrium(3)|large_intestine(5)|lung(7)|skin(1)|urinary_tract(2)	20	Breast(184;0.158)			GBM - Glioblastoma multiforme(131;0.121)		AAACTTCACCTTTTTTTTTCT	0.413																																					p.R190fs		.											.	ACBD3-226	0			c.568delA						.						170.0	131.0	144.0					1																	226352491		2203	4300	6503	SO:0001630	splice_region_variant	64746	exon3			TTCACCTTTTTTT	AB043587	CCDS1551.1	1q41	2013-10-16	2010-04-30	2003-11-12	ENSG00000182827	ENSG00000182827		"""A-kinase anchor proteins"""	15453	protein-coding gene	gene with protein product	"""PBR- and PKA-associated protein 7"""	606809	"""golgi complex associated protein 1, 60kDa"", ""acyl-Coenzyme A binding domain containing 3"""	GOLPH1, GOCAP1		12692076, 20150326	Standard	NM_022735		Approved	GCP60, PAP7	uc001hpy.3	Q9H3P7	OTTHUMG00000037560	ENST00000366812.5:c.569+1A>-	1.37:g.226352491delT		Somatic	127	0		WXS	Illumina GAIIx	Phase_I	120	30	NM_022735	0	0	0	0	0	B2RB29|Q5VTJ0|Q6P9F1|Q8IZC5|Q8N4D6|Q9H6U3	Frame_Shift_Del	DEL	ENST00000366812.5	37	CCDS1551.1																																																																																			.		0.413	ACBD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000091528.1	NM_022735	Frame_Shift_Del
PCNXL2	80003	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	233135059	233135059	+	Missense_Mutation	SNP	G	G	A	rs201746355		TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr1:233135059G>A	ENST00000258229.9	-	31	5629	c.5395C>T	c.(5395-5397)Cgc>Tgc	p.R1799C	PCNXL2_ENST00000344698.2_Missense_Mutation_p.R451C	NM_014801.3	NP_055616.3	A6NKB5	PCX2_HUMAN	pecanex-like 2 (Drosophila)	1799						integral component of membrane (GO:0016021)				NS(1)|autonomic_ganglia(1)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(16)|kidney(7)|large_intestine(19)|lung(30)|pancreas(1)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	86		all_cancers(173;0.0347)|Prostate(94;0.137)				TCCGGATTGCGGTTGCGAAGA	0.552																																					p.R1799C		.											.	PCNXL2-91	0			c.C5395T						.	G	CYS/ARG	1,3859		0,1,1929	35.0	36.0	36.0		5395	3.8	1.0	1		36	0,8268		0,0,4134	yes	missense	PCNXL2	NM_014801.3	180	0,1,6063	AA,AG,GG		0.0,0.0259,0.0082	probably-damaging	1799/2138	233135059	1,12127	1930	4134	6064	SO:0001583	missense	80003	exon31			GATTGCGGTTGCG	AK055374	CCDS44335.1	1q42.2	2008-02-05	2001-11-28		ENSG00000135749	ENSG00000135749			8736	protein-coding gene	gene with protein product			"""pecanex (Drosophila)-like 2"""			12477932	Standard	NM_014801		Approved	KIAA0435, FLJ11383	uc001hvl.2	A6NKB5	OTTHUMG00000037824	ENST00000258229.9:c.5395C>T	1.37:g.233135059G>A	ENSP00000258229:p.Arg1799Cys	Somatic	113	0		WXS	Illumina GAIIx	Phase_I	98	35	NM_014801	0	0	2	5	3	O43162|Q5T9Z8|Q5TDF1|Q8TEP4|Q96HP9|Q9HAL8	Missense_Mutation	SNP	ENST00000258229.9	37	CCDS44335.1	.	.	.	.	.	.	.	.	.	.	G	20.6	4.012825	0.75161	2.59E-4	0.0	ENSG00000135749	ENST00000344698;ENST00000258229	T;T	0.49720	0.77;0.77	5.66	3.81	0.43845	.	0.102031	0.64402	D	0.000001	T	0.70868	0.3273	M	0.87456	2.885	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.999	T	0.75178	-0.3409	10	0.87932	D	0	.	12.3484	0.55134	0.1365:0.0:0.8635:0.0	.	1799;451	A6NKB5;A6NKB5-3	PCX2_HUMAN;.	C	451;1799	ENSP00000340759:R451C;ENSP00000258229:R1799C	ENSP00000258229:R1799C	R	-	1	0	PCNXL2	231201682	1.000000	0.71417	1.000000	0.80357	0.480000	0.33159	7.640000	0.83355	0.762000	0.33152	0.555000	0.69702	CGC	.		0.552	PCNXL2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000092480.3	NM_014801	
IDI1	3422	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	1088637	1088637	+	Missense_Mutation	SNP	C	C	A			TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr10:1088637C>A	ENST00000381344.3	-	4	638	c.472G>T	c.(472-474)Gcc>Tcc	p.A158S	IDI2-AS1_ENST00000437374.1_RNA|IDI1_ENST00000491735.1_5'UTR|IDI2-AS1_ENST00000536039.1_RNA|IDI2-AS1_ENST00000420381.1_RNA|RNU7-163P_ENST00000459467.1_RNA|IDI2-AS1_ENST00000428780.2_RNA	NM_004508.2	NP_004499.2	Q13907	IDI1_HUMAN	isopentenyl-diphosphate delta isomerase 1	101	Nudix hydrolase. {ECO:0000255|PROSITE- ProRule:PRU00794}.				cholesterol biosynthetic process (GO:0006695)|dimethylallyl diphosphate biosynthetic process (GO:0050992)|isoprenoid biosynthetic process (GO:0008299)|response to stilbenoid (GO:0035634)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|mitochondrion (GO:0005739)|peroxisome (GO:0005777)	hydrolase activity (GO:0016787)|isopentenyl-diphosphate delta-isomerase activity (GO:0004452)|magnesium ion binding (GO:0000287)|manganese ion binding (GO:0030145)|metal ion binding (GO:0046872)			large_intestine(3)|lung(2)|prostate(1)	6		all_epithelial(10;0.107)|Colorectal(49;0.14)	OV - Ovarian serous cystadenocarcinoma(33;0.221)	Epithelial(11;0.0972)		ACTCCAAGGGCGTCACTTTCC	0.468																																					p.A158S		.											.	IDI1-90	0			c.G472T						.						109.0	96.0	101.0					10																	1088637		2203	4300	6503	SO:0001583	missense	3422	exon4			CAAGGGCGTCACT	BC006999	CCDS7056.1	10p15.3	2003-11-12	2005-07-25		ENSG00000067064	ENSG00000067064	5.3.3.2		5387	protein-coding gene	gene with protein product	"""IPP isomerase"""	604055	"""isopentenyl-diphosphate delta isomerase"""			8020941	Standard	NM_004508		Approved		uc001iga.3	Q13907	OTTHUMG00000017536	ENST00000381344.3:c.472G>T	10.37:g.1088637C>A	ENSP00000370748:p.Ala158Ser	Somatic	94	1		WXS	Illumina GAIIx	Phase_I	196	32	NM_004508	0	1	366	443	76	B4E155|Q32Q13|Q53GQ6|Q86U81|Q8WUX8|Q96IZ4|Q9BQ74	Missense_Mutation	SNP	ENST00000381344.3	37	CCDS7056.1	.	.	.	.	.	.	.	.	.	.	C	13.76	2.331927	0.41297	.	.	ENSG00000067064	ENST00000381344;ENST00000427898;ENST00000429642	.	.	.	4.5	4.5	0.54988	.	0.000000	0.85682	D	0.000000	T	0.68879	0.3049	L	0.52364	1.645	0.80722	D	1	P	0.34815	0.47	P	0.47470	0.548	T	0.70887	-0.4750	9	0.49607	T	0.09	-3.4306	17.5646	0.87916	0.0:1.0:0.0:0.0	.	158	Q13907-2	.	S	158;72;101	.	ENSP00000370748:A158S	A	-	1	0	IDI1	1078637	1.000000	0.71417	0.304000	0.25085	0.023000	0.10783	7.131000	0.77243	2.172000	0.68678	0.563000	0.77884	GCC	.		0.468	IDI1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046409.2	NM_004508	
FBXO18	84893	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	5948345	5948345	+	Missense_Mutation	SNP	A	A	G			TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr10:5948345A>G	ENST00000362091.4	+	3	618	c.503A>G	c.(502-504)gAc>gGc	p.D168G	FBXO18_ENST00000379999.5_Missense_Mutation_p.D219G|FBXO18_ENST00000470089.1_3'UTR|FBXO18_ENST00000397269.3_5'UTR	NM_001258453.1|NM_178150.2	NP_001245382.1|NP_835363.1	Q8NFZ0	FBX18_HUMAN	F-box protein, helicase, 18	168	F-box. {ECO:0000255|PROSITE- ProRule:PRU00080}.				DNA catabolic process, endonucleolytic (GO:0000737)|positive regulation of intrinsic apoptotic signaling pathway in response to DNA damage (GO:1902231)|positive regulation of protein phosphorylation (GO:0001934)|response to intra-S DNA damage checkpoint signaling (GO:0072429)	nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|DNA binding (GO:0003677)			NS(2)|breast(2)|kidney(2)|large_intestine(16)|lung(9)|ovary(2)|prostate(3)|skin(3)|stomach(1)	40						GAAGCAGAGGACAGTACGTCT	0.577																																					p.D219G		.											.	FBXO18-228	0			c.A656G						.						57.0	51.0	53.0					10																	5948345		2203	4300	6503	SO:0001583	missense	84893	exon4			CAGAGGACAGTAC	AK095343	CCDS7072.1, CCDS7073.1, CCDS73064.1	10p15.1	2004-08-24	2004-06-15		ENSG00000134452	ENSG00000134452		"""F-boxes /  ""other"""""	13620	protein-coding gene	gene with protein product		607222	"""F-box only protein 18"""			10531037, 11956208	Standard	NM_032807		Approved	FBH1, FLJ14590, Fbx18	uc001iit.4	Q8NFZ0	OTTHUMG00000017609	ENST00000362091.4:c.503A>G	10.37:g.5948345A>G	ENSP00000355415:p.Asp168Gly	Somatic	225	0		WXS	Illumina GAIIx	Phase_I	464	99	NM_032807	0	0	11	15	4	Q5JVB0|Q5JVB1|Q7Z4Q6|Q7Z4R0|Q8N1P5|Q8N586|Q96E82|Q96K67|Q96SW7|Q9UFB2	Missense_Mutation	SNP	ENST00000362091.4	37	CCDS7072.1	.	.	.	.	.	.	.	.	.	.	A	0.019	-1.461449	0.01062	.	.	ENSG00000134452	ENST00000362091;ENST00000379999	.	.	.	5.76	2.18	0.27775	.	0.660669	0.16801	N	0.198994	T	0.27765	0.0683	L	0.44542	1.39	0.18873	N	0.999987	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.04013	0.001;0.0;0.001	T	0.23013	-1.0200	9	0.12766	T	0.61	-11.491	5.1436	0.14973	0.6721:0.0:0.1991:0.1288	.	219;168;94	Q8NFZ0-2;Q8NFZ0;Q2TAK1	.;FBX18_HUMAN;.	G	168;219	.	ENSP00000355415:D168G	D	+	2	0	FBXO18	5988351	0.000000	0.05858	0.065000	0.19835	0.009000	0.06853	0.109000	0.15417	0.436000	0.26393	0.533000	0.62120	GAC	.		0.577	FBXO18-009	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046596.1	NM_032807	
SFMBT2	57713	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	7269870	7269870	+	Missense_Mutation	SNP	C	C	G			TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr10:7269870C>G	ENST00000361972.4	-	10	1240	c.1150G>C	c.(1150-1152)Gat>Cat	p.D384H	SFMBT2_ENST00000397167.1_Missense_Mutation_p.D384H	NM_001018039.1	NP_001018049.1	Q5VUG0	SMBT2_HUMAN	Scm-like with four mbt domains 2	384					negative regulation of gene expression (GO:0010629)|regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	histone binding (GO:0042393)			NS(2)|breast(3)|central_nervous_system(4)|endometrium(7)|kidney(2)|large_intestine(26)|lung(34)|ovary(5)|pancreas(2)|skin(9)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	99						TTGTGATAATCTGCCCAGTCG	0.433																																					p.D384H		.											.	SFMBT2-141	0			c.G1150C						.						57.0	60.0	59.0					10																	7269870		2203	4300	6503	SO:0001583	missense	57713	exon10			GATAATCTGCCCA	AB046837	CCDS31138.1	10p15.1	2013-01-10	2003-11-14		ENSG00000198879	ENSG00000198879		"""Sterile alpha motif (SAM) domain containing"""	20256	protein-coding gene	gene with protein product		615392	"""Scm-related gene containing four mbt domains 2"""			10997877	Standard	NM_001029880		Approved	KIAA1617	uc009xio.2	Q5VUG0	OTTHUMG00000017630	ENST00000361972.4:c.1150G>C	10.37:g.7269870C>G	ENSP00000355109:p.Asp384His	Somatic	54	0		WXS	Illumina GAIIx	Phase_I	108	59	NM_001029880	0	0	0	0	0	A7MD09|Q9HCF5	Missense_Mutation	SNP	ENST00000361972.4	37	CCDS31138.1	.	.	.	.	.	.	.	.	.	.	C	23.1	4.380857	0.82792	.	.	ENSG00000198879	ENST00000361972;ENST00000397167	T;T	0.16324	2.35;2.35	5.21	5.21	0.72293	.	0.042884	0.85682	D	0.000000	T	0.43700	0.1259	M	0.71581	2.175	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.26780	-1.0093	10	0.52906	T	0.07	.	18.715	0.91672	0.0:1.0:0.0:0.0	.	384	Q5VUG0	SMBT2_HUMAN	H	384	ENSP00000355109:D384H;ENSP00000380353:D384H	ENSP00000355109:D384H	D	-	1	0	SFMBT2	7309876	1.000000	0.71417	0.993000	0.49108	0.997000	0.91878	5.975000	0.70475	2.588000	0.87417	0.563000	0.77884	GAT	.		0.433	SFMBT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046673.1	NM_001029880	
TAF3	83860	hgsc.bcm.edu;broad.mit.edu;mdanderson.org	37	10	8051255	8051255	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr10:8051255G>A	ENST00000344293.5	+	5	2736	c.2530G>A	c.(2530-2532)Gtg>Atg	p.V844M		NM_031923.3	NP_114129.1	Q5VWG9	TAF3_HUMAN	TAF3 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 140kDa	844					maintenance of protein location in nucleus (GO:0051457)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|transcription factor TFIID complex (GO:0005669)	zinc ion binding (GO:0008270)			NS(2)|breast(4)|endometrium(2)|kidney(1)|large_intestine(6)|lung(16)|ovary(3)|prostate(4)|skin(2)	40						CAAAGCCCCCGTGCGCAGCGT	0.721																																					p.V844M		.											.	TAF3-69	0			c.G2530A						.						11.0	11.0	11.0					10																	8051255		1723	3626	5349	SO:0001583	missense	83860	exon5			GCCCCCGTGCGCA	AJ292190	CCDS41487.1	10p15.1	2013-01-28	2002-08-29		ENSG00000165632	ENSG00000165632		"""Zinc fingers, PHD-type"""	17303	protein-coding gene	gene with protein product		606576	"""TAF3 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 140 kD"""			11438666, 18549481	Standard	NM_031923		Approved	TAF140, TAFII140	uc010qbd.3	Q5VWG9	OTTHUMG00000017643	ENST00000344293.5:c.2530G>A	10.37:g.8051255G>A	ENSP00000340271:p.Val844Met	Somatic	17	0		WXS	Illumina GAIIx	Phase_I	75	37	NM_031923	0	0	5	15	10	Q05DA0|Q6GMS5|Q6P6B5|Q86VY6|Q9BQS9|Q9UFI8	Missense_Mutation	SNP	ENST00000344293.5	37	CCDS41487.1	.	.	.	.	.	.	.	.	.	.	G	17.00	3.277971	0.59758	.	.	ENSG00000165632	ENST00000344293	D	0.85258	-1.96	6.07	5.17	0.71159	Zinc finger, FYVE/PHD-type (1);	0.000000	0.56097	D	0.000027	D	0.86460	0.5938	M	0.73962	2.25	0.58432	D	0.999997	D	0.56746	0.977	P	0.46299	0.511	D	0.85639	0.1275	10	0.30854	T	0.27	-21.776	15.5075	0.75753	0.0661:0.0:0.9339:0.0	.	844	Q5VWG9	TAF3_HUMAN	M	844	ENSP00000340271:V844M	ENSP00000340271:V844M	V	+	1	0	TAF3	8091261	1.000000	0.71417	0.062000	0.19696	0.029000	0.11900	9.397000	0.97276	1.581000	0.49865	0.655000	0.94253	GTG	.		0.721	TAF3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046725.1	NM_031923	
KIAA1217	56243	hgsc.bcm.edu;ucsc.edu	37	10	24783527	24783527	+	Missense_Mutation	SNP	C	C	T	rs148941784		TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr10:24783527C>T	ENST00000376454.3	+	7	1808	c.1778C>T	c.(1777-1779)gCg>gTg	p.A593V	KIAA1217_ENST00000307544.6_Intron|KIAA1217_ENST00000458595.1_Intron|KIAA1217_ENST00000376451.2_Intron|KIAA1217_ENST00000376462.1_Missense_Mutation_p.A513V|KIAA1217_ENST00000396446.1_Intron|KIAA1217_ENST00000376452.3_Intron|KIAA1217_ENST00000396445.1_Intron|KIAA1217_ENST00000430453.2_Intron	NM_019590.3	NP_062536.2	Q5T5P2	SKT_HUMAN	KIAA1217	593					embryonic skeletal system development (GO:0048706)	cytoplasm (GO:0005737)				breast(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(4)|kidney(3)|large_intestine(19)|lung(19)|ovary(5)|prostate(3)|skin(3)|urinary_tract(1)	70						AGCAAAGATGCGTCTAGGTAA	0.343													C|||	1	0.000199681	0.0008	0.0	5008	,	,		18392	0.0		0.0	False		,,,				2504	0.0				p.A593V		.											.	KIAA1217-98	0			c.C1778T						.	C	VAL/ALA,,VAL/ALA	5,4401	9.9+/-24.2	0,5,2198	76.0	72.0	73.0		1538,,1778	5.8	1.0	10	dbSNP_134	73	0,8600		0,0,4300	yes	missense,intron,missense	KIAA1217	NM_001098500.1,NM_001098501.1,NM_019590.3	64,,64	0,5,6498	TT,TC,CC		0.0,0.1135,0.0384	possibly-damaging,,possibly-damaging	513/1265,,593/1944	24783527	5,13001	2203	4300	6503	SO:0001583	missense	56243	exon7			AAGATGCGTCTAG	BX640796	CCDS31165.1, CCDS41496.1, CCDS60501.1, CCDS60502.1, CCDS60504.1, CCDS60505.1	10p12.31	2009-09-16			ENSG00000120549	ENSG00000120549			25428	protein-coding gene	gene with protein product	"""sickle tail"""					10574462	Standard	XM_005252500		Approved	DKFZP761L0424, SKT	uc001iru.4	Q5T5P2	OTTHUMG00000017824	ENST00000376454.3:c.1778C>T	10.37:g.24783527C>T	ENSP00000365637:p.Ala593Val	Somatic	19	0		WXS	Illumina GAIIx	Phase_I	56	6	NM_019590	0	0	0	0	0	A5LHW9|A6NLF3|A6PVQ5|A6PVQ6|A6PVQ7|B9EGK4|Q4KMG4|Q5T5P3|Q5T7H3|Q6MZZ6|Q6ZUI4|Q8WV45|Q9NSR2|Q9ULK3	Missense_Mutation	SNP	ENST00000376454.3	37	CCDS31165.1	2	9.157509157509158E-4	2	0.0040650406504065045	0	0.0	0	0.0	0	0.0	C	14.98	2.697119	0.48202	0.001135	0.0	ENSG00000120549	ENST00000376462;ENST00000376454	T;T	0.52295	0.67;0.67	5.78	5.78	0.91487	.	0.541874	0.20009	N	0.101172	T	0.37705	0.1013	L	0.35723	1.085	0.80722	D	1	P	0.42357	0.777	B	0.31016	0.123	T	0.22800	-1.0206	10	0.30854	T	0.27	.	20.3681	0.98887	0.0:1.0:0.0:0.0	.	593	Q5T5P2	SKT_HUMAN	V	513;593	ENSP00000365645:A513V;ENSP00000365637:A593V	ENSP00000365637:A593V	A	+	2	0	KIAA1217	24823533	0.990000	0.36364	0.969000	0.41365	0.966000	0.64601	2.929000	0.48916	2.890000	0.99128	0.655000	0.94253	GCG	C|0.999;T|0.001		0.343	KIAA1217-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000047223.2	NM_019590	
PTCHD3	374308	hgsc.bcm.edu;broad.mit.edu	37	10	27687470	27687470	+	Frame_Shift_Del	DEL	T	T	-			TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr10:27687470delT	ENST00000438700.3	-	4	2174	c.2057delA	c.(2056-2058)aatfs	p.N686fs		NM_001034842.3	NP_001030014.2	Q3KNS1	PTHD3_HUMAN	patched domain containing 3	686					spermatid development (GO:0007286)	integral component of membrane (GO:0016021)|sperm midpiece (GO:0097225)	hedgehog receptor activity (GO:0008158)			NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|lung(17)|ovary(3)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(3)	55						TACATAGACATTTTTTTCAAA	0.303																																					p.N686fs		.											.	PTCHD3-94	0			c.2057delA						.						36.0	38.0	38.0					10																	27687470		2199	4289	6488	SO:0001589	frameshift_variant	374308	exon4			TAGACATTTTTTT	AK126025	CCDS31173.1	10p12.1	2006-05-26			ENSG00000182077	ENSG00000182077			24776	protein-coding gene	gene with protein product		611791					Standard	NM_001034842		Approved	FLJ44037, PTR	uc001itu.2	Q3KNS1	OTTHUMG00000017860	ENST00000438700.3:c.2057delA	10.37:g.27687470delT	ENSP00000417658:p.Asn686fs	Somatic	17	0		WXS	Illumina GAIIx	Phase_I	33	12	NM_001034842	0	0	0	0	0	I3L499|Q6ZU28	Frame_Shift_Del	DEL	ENST00000438700.3	37	CCDS31173.1																																																																																			.		0.303	PTCHD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047325.3	XM_370541	
ZNF25	219749	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	10	38241708	38241710	+	In_Frame_Del	DEL	AGA	AGA	-	rs1208607		TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10	AGA	AGA	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr10:38241708_38241710delAGA	ENST00000302609.7	-	6	928_930	c.716_718delTCT	c.(715-720)ttctat>tat	p.F239del	ZNF25_ENST00000374633.1_5'UTR|AL117337.1_ENST00000582458.1_RNA	NM_145011.2	NP_659448.1	P17030	ZNF25_HUMAN	zinc finger protein 25	239					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(3)|central_nervous_system(1)|endometrium(3)|large_intestine(5)|lung(11)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	28		all_neural(218;0.0218)|Breast(68;0.0389)|Ovarian(717;0.0443)|Renal(717;0.157)				GCCTTCACATAGAAGAACTTCCC	0.438																																					p.239_240del		.											.	ZNF25-154	0			c.716_718del						.																																			SO:0001651	inframe_deletion	219749	exon6			TCACATAGAAGAA	AK056452	CCDS7195.1	10p11.2	2013-01-08	2006-05-10		ENSG00000175395	ENSG00000175395		"""Zinc fingers, C2H2-type"", ""-"""	13043	protein-coding gene	gene with protein product		194528	"""zinc finger protein 25 (KOX 19)"""			1639412, 8464732	Standard	NM_145011		Approved	KOX19, FLJ31890, Zfp9	uc001ize.1	P17030	OTTHUMG00000019344	ENST00000302609.7:c.716_718delTCT	10.37:g.38241711_38241713delAGA	ENSP00000302222:p.Phe239del	Somatic	117	0		WXS	Illumina GAIIx	Phase_I	195	74	NM_145011	0	0	0	0	0	A9Z1X5|Q8IYE3|Q8NDD6|Q96MU2	In_Frame_Del	DEL	ENST00000302609.7	37	CCDS7195.1																																																																																			.		0.438	ZNF25-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051214.1	NM_145011, NM_006966	
RASSF4	83937	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	45484790	45484790	+	Silent	SNP	G	G	A			TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr10:45484790G>A	ENST00000340258.5	+	7	713	c.600G>A	c.(598-600)ctG>ctA	p.L200L	RASSF4_ENST00000374417.2_3'UTR|RASSF4_ENST00000334940.6_Silent_p.L209L|RASSF4_ENST00000472561.1_3'UTR	NM_032023.3	NP_114412.2	Q8WYP3	RIN2_HUMAN	Ras association (RalGDS/AF-6) domain family member 4	816					endocytosis (GO:0006897)|positive regulation of Rab GTPase activity (GO:0032851)|regulation of catalytic activity (GO:0050790)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)	GTPase activator activity (GO:0005096)|Rab guanyl-nucleotide exchange factor activity (GO:0017112)|small GTPase regulator activity (GO:0005083)			NS(1)|endometrium(2)|large_intestine(6)|lung(4)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	16						TGACAACCCTGCAGGTGCTCA	0.557																																					p.L200L		.											.	RASSF4-290	0			c.G600A						.						90.0	77.0	81.0					10																	45484790		2203	4300	6503	SO:0001819	synonymous_variant	83937	exon7			AACCCTGCAGGTG	BC032593	CCDS7208.1	10q11.1	2008-02-22	2008-02-22		ENSG00000107551	ENSG00000107551			20793	protein-coding gene	gene with protein product		610559					Standard	NM_032023		Approved	AD037, MGC44914	uc001jbo.3	Q9H2L5	OTTHUMG00000018060	ENST00000340258.5:c.600G>A	10.37:g.45484790G>A		Somatic	162	0		WXS	Illumina GAIIx	Phase_I	299	148	NM_032023	0	0	2	3	1	Q00425|Q5TFT8|Q9BQL3|Q9H071	Silent	SNP	ENST00000340258.5	37	CCDS7208.1																																																																																			.		0.557	RASSF4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047745.2	NM_032023	
NCOA4	8031	broad.mit.edu	37	10	51579175	51579175	+	Missense_Mutation	SNP	A	A	C			TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr10:51579175A>C	ENST00000443446.1	+	2	263	c.34A>C	c.(34-36)Agt>Cgt	p.S12R	NCOA4_ENST00000452682.1_Missense_Mutation_p.S28R|NCOA4_ENST00000344348.6_Missense_Mutation_p.S12R|NCOA4_ENST00000374087.4_Missense_Mutation_p.S12R|NCOA4_ENST00000498586.1_Intron|NCOA4_ENST00000438493.1_Missense_Mutation_p.S28R|NCOA4_ENST00000414907.2_Intron|NCOA4_ENST00000430396.2_Intron|NCOA4_ENST00000374082.1_Missense_Mutation_p.S12R	NM_001145262.1	NP_001138734.1	Q13772	NCOA4_HUMAN	nuclear receptor coactivator 4	12					androgen receptor signaling pathway (GO:0030521)|male gonad development (GO:0008584)|positive regulation of transcription, DNA-templated (GO:0045893)|response to hormone (GO:0009725)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	androgen receptor binding (GO:0050681)|transcription coactivator activity (GO:0003713)			NS(1)|central_nervous_system(1)|kidney(1)|large_intestine(1)|skin(1)	5						TGGCAGCTCCAGTAATAGAGA	0.408			T	RET	papillary thyroid																																p.S28R		.		Dom	yes		10	10q11.2	8031	nuclear receptor coactivator 4 - PTC3 (ELE1)		E	.	NCOA4-1042	0			c.A82C						.						48.0	55.0	53.0					10																	51579175		2203	4300	6503	SO:0001583	missense	8031	exon3			AGCTCCAGTAATA	L49399	CCDS73092.1, CCDS73093.1, CCDS73094.1	10q11.2	2014-04-10			ENSG00000138293	ENSG00000266412			7671	protein-coding gene	gene with protein product	"""RET-activating gene ELE1"""	601984				8290261, 8643607, 24695223	Standard	NM_001145260		Approved	ARA70, RFG, ELE1, PTC3, DKFZp762E1112	uc009xon.3	Q13772	OTTHUMG00000188314	ENST00000443446.1:c.34A>C	10.37:g.51579175A>C	ENSP00000390713:p.Ser12Arg	Somatic	45	0		WXS	Illumina GAIIx	Phase_I	90	10	NM_001145261	0	0	15	16	1	A8K8W5|B4E260|E9PAV7|J3KQN8|Q14239	Missense_Mutation	SNP	ENST00000443446.1	37	CCDS7237.1	.	.	.	.	.	.	.	.	.	.	A	19.95	3.921905	0.73213	.	.	ENSG00000138293	ENST00000438493;ENST00000452682;ENST00000374087;ENST00000330923;ENST00000344348;ENST00000374082;ENST00000443446	T;T;T;T;T;T	0.21191	2.36;2.34;2.34;2.34;2.02;2.34	5.79	5.79	0.91817	.	0.460516	0.24321	N	0.039555	T	0.23806	0.0576	L	0.32530	0.975	0.80722	D	1	P;D;P	0.53619	0.931;0.961;0.808	P;P;P	0.49752	0.621;0.621;0.467	T	0.01262	-1.1402	10	0.66056	D	0.02	-18.2451	11.0233	0.47730	0.8279:0.0:0.0:0.1721	.	28;28;12	B4E260;E9PAV7;Q13772	.;.;NCOA4_HUMAN	R	28;28;12;12;12;12;12	ENSP00000405146:S28R;ENSP00000395465:S28R;ENSP00000363200:S12R;ENSP00000344552:S12R;ENSP00000363195:S12R;ENSP00000390713:S12R	ENSP00000332421:S12R	S	+	1	0	NCOA4	51249181	0.809000	0.29036	0.998000	0.56505	0.989000	0.77384	0.888000	0.28268	2.212000	0.71576	0.533000	0.62120	AGT	.		0.408	NCOA4-204	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048052.1	NM_005437	
ASAH2B	653308	ucsc.edu;bcgsc.ca;mdanderson.org	37	10	52502717	52502717	+	Silent	SNP	G	G	A	rs2820742		TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr10:52502717G>A	ENST00000374006.1	+	2	98	c.33G>A	c.(31-33)acG>acA	p.T11T	ASAH2B_ENST00000374007.1_5'UTR|ASAH2B_ENST00000483649.1_3'UTR|ASAH2B_ENST00000185907.9_5'UTR	NM_001079516.1	NP_001072984.1	P0C7U1	ASA2B_HUMAN	N-acylsphingosine amidohydrolase (non-lysosomal ceramidase) 2B	11										large_intestine(2)|lung(2)	4						TGGACCGCACGCATTATCTGC	0.448																																					p.T11T		.											.	.	0			c.G33A						.						351.0	305.0	320.0					10																	52502717		2203	4300	6503	SO:0001819	synonymous_variant	653308	exon2			CCGCACGCATTAT	BI553338	CCDS31203.1	10q11.23	2010-05-04			ENSG00000204147	ENSG00000204147			23456	protein-coding gene	gene with protein product		610987				17334805	Standard	NM_001079516		Approved	bA449O16.3, ASAH2L	uc001jjg.4	P0C7U1	OTTHUMG00000018239	ENST00000374006.1:c.33G>A	10.37:g.52502717G>A		Somatic	589	3		WXS	Illumina GAIIx	Phase_I	1088	394	NM_001079516	0	0	4	8	4	B7Z261	Silent	SNP	ENST00000374006.1	37	CCDS31203.1																																																																																			G|0.500;A|0.500		0.448	ASAH2B-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000048084.1		
PCDH15	65217	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	56423995	56423995	+	Missense_Mutation	SNP	A	A	C			TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr10:56423995A>C	ENST00000320301.6	-	2	422	c.28T>G	c.(28-30)Tgt>Ggt	p.C10G	PCDH15_ENST00000373965.2_Missense_Mutation_p.C10G|PCDH15_ENST00000395433.1_Missense_Mutation_p.C10G|PCDH15_ENST00000409834.1_5'UTR|PCDH15_ENST00000373957.3_Missense_Mutation_p.C10G|PCDH15_ENST00000395430.1_Missense_Mutation_p.C10G|PCDH15_ENST00000373955.1_Missense_Mutation_p.C10G|PCDH15_ENST00000395432.2_Missense_Mutation_p.C10G|PCDH15_ENST00000395440.1_Missense_Mutation_p.C10G|PCDH15_ENST00000361849.3_Missense_Mutation_p.C10G|PCDH15_ENST00000414778.1_Missense_Mutation_p.C10G|PCDH15_ENST00000395442.1_Missense_Mutation_p.C10G|PCDH15_ENST00000395445.1_Missense_Mutation_p.C10G|PCDH15_ENST00000437009.1_Missense_Mutation_p.C10G|PCDH15_ENST00000395446.1_Missense_Mutation_p.C10G|PCDH15_ENST00000395438.1_Missense_Mutation_p.C10G	NM_033056.3	NP_149045.3	Q96QU1	PCD15_HUMAN	protocadherin-related 15	10					equilibrioception (GO:0050957)|homophilic cell adhesion (GO:0007156)|photoreceptor cell maintenance (GO:0045494)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|photoreceptor outer segment (GO:0001750)|plasma membrane (GO:0005886)|stereocilium (GO:0032420)|synapse (GO:0045202)	calcium ion binding (GO:0005509)			NS(3)|breast(6)|central_nervous_system(1)|cervix(3)|endometrium(18)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(39)|lung(108)|ovary(5)|pancreas(6)|prostate(6)|skin(12)|upper_aerodigestive_tract(12)|urinary_tract(1)	237		Melanoma(3;0.117)|Lung SC(717;0.238)				GAAGCTAAACATGTCCAGAGA	0.398										HNSCC(58;0.16)																											p.C10G		.											.	PCDH15-193	0			c.T28G						.						86.0	77.0	80.0					10																	56423995		2203	4300	6503	SO:0001583	missense	65217	exon2			CTAAACATGTCCA	AY029205	CCDS7248.1, CCDS44400.1, CCDS44401.1, CCDS44403.1, CCDS44404.1, CCDS73134.1, CCDS73135.1, CCDS73136.1, CCDS73137.1, CCDS73138.1	10q21.1	2013-01-08	2010-01-25		ENSG00000150275	ENSG00000150275		"""Cadherins / Cadherin-related"""	14674	protein-coding gene	gene with protein product	"""cadherin-related family member 15"""	605514	"""deafness, autosomal recessive 23"", ""protocadherin 15"""	USH1F, DFNB23		11398101, 14570705	Standard	NM_033056		Approved	CDHR15	uc010qhy.1	Q96QU1	OTTHUMG00000018259	ENST00000320301.6:c.28T>G	10.37:g.56423995A>C	ENSP00000322604:p.Cys10Gly	Somatic	44	0		WXS	Illumina GAIIx	Phase_I	108	51	NM_001142763	0	0	0	0	0	A6NL19|C6ZEF5|C6ZEF6|C6ZEF7|Q5VY38|Q5VY39|Q6TRH8|Q8NDB9|Q96QT8	Missense_Mutation	SNP	ENST00000320301.6	37	CCDS7248.1	.	.	.	.	.	.	.	.	.	.	A	9.830	1.188250	0.21954	.	.	ENSG00000150275	ENST00000373965;ENST00000414778;ENST00000455746;ENST00000395438;ENST00000395445;ENST00000395446;ENST00000395442;ENST00000395440;ENST00000395432;ENST00000361849;ENST00000395433;ENST00000373957;ENST00000320301;ENST00000395430;ENST00000417177;ENST00000437009;ENST00000373955;ENST00000458638	T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T	0.68331	0.52;0.57;0.44;0.45;0.45;0.68;0.58;0.35;0.39;-0.32;0.15;0.39;0.39;0.45;0.58;0.86	5.8	2.04	0.26737	.	.	.	.	.	T	0.46229	0.1382	N	0.19112	0.55	0.09310	N	1	B;B;B;B;B;B;B;B;P;P;P;B;B;B;B	0.35793	0.069;0.276;0.276;0.276;0.374;0.276;0.069;0.095;0.521;0.521;0.51;0.017;0.068;0.081;0.276	B;B;B;B;B;B;B;B;B;B;B;B;B;B;B	0.34138	0.041;0.101;0.101;0.129;0.084;0.129;0.041;0.046;0.142;0.142;0.101;0.039;0.176;0.064;0.101	T	0.29882	-0.9997	9	0.44086	T	0.13	.	4.7504	0.13057	0.7066:0.0:0.1543:0.1392	.	10;10;10;10;10;10;10;10;10;10;10;10;10;10;10	A2A3E8;E7EMG4;A2A3E7;C9JIG1;E7EM53;E7EMG0;A2A3E6;A2A3E3;C6ZEF5;A2A3E2;C6ZEF7;C9J4F3;Q96QU1-3;A2A3D8;Q96QU1	.;.;.;.;.;.;.;.;.;.;.;.;.;.;PCD15_HUMAN	G	10	ENSP00000363076:C10G;ENSP00000410304:C10G;ENSP00000378826:C10G;ENSP00000378832:C10G;ENSP00000378833:C10G;ENSP00000378829:C10G;ENSP00000378827:C10G;ENSP00000378820:C10G;ENSP00000354950:C10G;ENSP00000378821:C10G;ENSP00000363068:C10G;ENSP00000322604:C10G;ENSP00000378818:C10G;ENSP00000412628:C10G;ENSP00000363066:C10G;ENSP00000394465:C10G	ENSP00000322604:C10G	C	-	1	0	PCDH15	56094001	0.913000	0.31002	0.005000	0.12908	0.563000	0.35712	0.853000	0.27777	0.090000	0.17273	0.402000	0.26972	TGT	.		0.398	PCDH15-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000048121.2	NM_033056	
EGR2	1959	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	64573625	64573625	+	Missense_Mutation	SNP	A	A	G			TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr10:64573625A>G	ENST00000242480.3	-	2	1098	c.773T>C	c.(772-774)gTg>gCg	p.V258A	EGR2_ENST00000493899.2_5'Flank|EGR2_ENST00000411732.1_Missense_Mutation_p.V208A|EGR2_ENST00000439032.1_Missense_Mutation_p.V258A	NM_000399.3|NM_001136177.1	NP_000390.2|NP_001129649.1	P11161	EGR2_HUMAN	early growth response 2	258					brain development (GO:0007420)|brain segmentation (GO:0035284)|cell death (GO:0008219)|cellular response to cAMP (GO:0071320)|cellular response to gonadotropin stimulus (GO:0071371)|facial nerve structural organization (GO:0021612)|fat cell differentiation (GO:0045444)|learning or memory (GO:0007611)|motor neuron axon guidance (GO:0008045)|myelination (GO:0042552)|negative regulation of apoptotic process (GO:0043066)|peripheral nervous system development (GO:0007422)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein export from nucleus (GO:0006611)|protein sumoylation (GO:0016925)|regulation of neuronal synaptic plasticity (GO:0048168)|regulation of ossification (GO:0030278)|response to insulin (GO:0032868)|rhombomere 3 formation (GO:0021660)|rhombomere 5 formation (GO:0021666)|rhythmic behavior (GO:0007622)|Schwann cell differentiation (GO:0014037)|skeletal muscle cell differentiation (GO:0035914)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|ligase activity (GO:0016874)|metal ion binding (GO:0046872)|RNA polymerase II activating transcription factor binding (GO:0001102)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)			endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(10)|lung(13)|ovary(2)|prostate(4)|upper_aerodigestive_tract(1)	36	Prostate(12;0.0297)|all_hematologic(501;0.228)					TGGAGGGGGCACCCGCAGGGT	0.617																																					p.V258A		.											.	EGR2-92	0			c.T773C						.						37.0	41.0	40.0					10																	64573625		2203	4300	6503	SO:0001583	missense	1959	exon2			GGGGGCACCCGCA	BC035625	CCDS7267.1, CCDS44409.1	10q21.1	2014-09-17	2009-04-23		ENSG00000122877	ENSG00000122877		"""Zinc fingers, C2H2-type"""	3239	protein-coding gene	gene with protein product	"""Krox-20 homolog, Drosophila"""	129010	"""early growth response 2 (Krox-20 homolog, Drosophila)"""	KROX20			Standard	NM_000399		Approved		uc001jmi.3	P11161	OTTHUMG00000018308	ENST00000242480.3:c.773T>C	10.37:g.64573625A>G	ENSP00000242480:p.Val258Ala	Somatic	108	0		WXS	Illumina GAIIx	Phase_I	146	62	NM_000399	0	0	0	0	0	B2R724|B3KRD7|Q68CZ5|Q8IV26|Q9UNA6	Missense_Mutation	SNP	ENST00000242480.3	37	CCDS7267.1	.	.	.	.	.	.	.	.	.	.	A	12.04	1.819324	0.32145	.	.	ENSG00000122877	ENST00000242480;ENST00000439032;ENST00000411732	T;T;T	0.13089	2.62;2.62;2.68	4.96	4.96	0.65561	.	0.073313	0.52532	D	0.000061	T	0.14743	0.0356	M	0.64404	1.975	0.40954	D	0.98456	B;B	0.27229	0.172;0.056	B;B	0.23716	0.048;0.008	T	0.03887	-1.0995	10	0.41790	T	0.15	-26.2377	8.8388	0.35129	0.9126:0.0:0.0874:0.0	.	208;258	P11161-2;P11161	.;EGR2_HUMAN	A	258;258;208	ENSP00000242480:V258A;ENSP00000402040:V258A;ENSP00000387634:V208A	ENSP00000242480:V258A	V	-	2	0	EGR2	64243631	0.495000	0.26051	1.000000	0.80357	0.961000	0.63080	2.945000	0.49043	2.069000	0.61940	0.533000	0.62120	GTG	.		0.617	EGR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048245.2	NM_000399	
UNC5B	219699	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	73046620	73046620	+	Missense_Mutation	SNP	G	G	A	rs143653939	byFrequency	TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr10:73046620G>A	ENST00000335350.6	+	5	1143	c.727G>A	c.(727-729)Gtc>Atc	p.V243I	UNC5B_ENST00000373192.4_Missense_Mutation_p.V243I	NM_170744.4	NP_734465.2	Q8IZJ1	UNC5B_HUMAN	unc-5 homolog B (C. elegans)	243					anterior/posterior axon guidance (GO:0033564)|apoptotic process (GO:0006915)|axon guidance (GO:0007411)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|negative regulation of neuron apoptotic process (GO:0043524)|positive regulation of apoptotic process (GO:0043065)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|regulation of apoptotic process (GO:0042981)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)				breast(2)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(8)|lung(17)|ovary(4)|prostate(4)|skin(4)	49						CACCGTCATCGTCTACGGTGC	0.652													G|||	5	0.000998403	0.0038	0.0	5008	,	,		20310	0.0		0.0	False		,,,				2504	0.0				p.V243I		.											.	UNC5B-228	0			c.G727A						.	G	ILE/VAL	12,4394	19.1+/-41.9	0,12,2191	115.0	112.0	113.0		727	4.4	0.9	10	dbSNP_134	113	0,8600		0,0,4300	no	missense	UNC5B	NM_170744.4	29	0,12,6491	AA,AG,GG		0.0,0.2724,0.0923	probably-damaging	243/946	73046620	12,12994	2203	4300	6503	SO:0001583	missense	219699	exon5			GTCATCGTCTACG	AB096256	CCDS7309.1, CCDS58083.1	10q22.2	2013-01-11	2001-11-28		ENSG00000107731	ENSG00000107731		"""Immunoglobulin superfamily / I-set domain containing"""	12568	protein-coding gene	gene with protein product		607870	"""unc5 (C.elegans homolog) b"""				Standard	NM_170744		Approved	UNC5H2, p53RDL1	uc001jro.3	Q8IZJ1	OTTHUMG00000018422	ENST00000335350.6:c.727G>A	10.37:g.73046620G>A	ENSP00000334329:p.Val243Ile	Somatic	160	1		WXS	Illumina GAIIx	Phase_I	274	126	NM_001244889	0	0	0	0	0	Q5T3R9|Q5T3S0|Q86SN3|Q8N1Y2|Q9H9F3	Missense_Mutation	SNP	ENST00000335350.6	37	CCDS7309.1	1	4.578754578754579E-4	1	0.0020325203252032522	0	0.0	0	0.0	0	0.0	G	18.28	3.589177	0.66105	0.002724	0.0	ENSG00000107731	ENST00000335350;ENST00000373192	T;T	0.74209	-0.82;-0.82	5.34	4.43	0.53597	Immunoglobulin I-set (1);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	D	0.85084	0.5616	M	0.78637	2.42	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.85130	0.996;0.997	D	0.84842	0.0808	10	0.38643	T	0.18	-37.0881	13.8955	0.63768	0.0733:0.0:0.9267:0.0	.	243;243	Q8IZJ1-2;Q8IZJ1	.;UNC5B_HUMAN	I	243	ENSP00000334329:V243I;ENSP00000362288:V243I	ENSP00000334329:V243I	V	+	1	0	UNC5B	72716626	1.000000	0.71417	0.885000	0.34714	0.115000	0.19883	8.029000	0.88807	1.261000	0.44149	0.561000	0.74099	GTC	G|0.999;A|0.001		0.652	UNC5B-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048541.1	NM_170744	
HTR7	3363	broad.mit.edu	37	10	92617259	92617259	+	Missense_Mutation	SNP	G	G	T	rs574621431		TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr10:92617259G>T	ENST00000336152.3	-	1	196	c.170C>A	c.(169-171)gCg>gAg	p.A57E	HTR7_ENST00000277874.6_Missense_Mutation_p.A57E|HTR7_ENST00000371721.3_Missense_Mutation_p.A57E|HTR7_ENST00000371719.2_Missense_Mutation_p.A57E	NM_019859.3	NP_062873.1	P34969	5HT7R_HUMAN	5-hydroxytryptamine (serotonin) receptor 7, adenylate cyclase-coupled	57					blood circulation (GO:0008015)|circadian rhythm (GO:0007623)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|serotonin receptor signaling pathway (GO:0007210)|smooth muscle contraction (GO:0006939)|synaptic transmission (GO:0007268)|vasoconstriction (GO:0042310)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	serotonin receptor activity (GO:0004993)			NS(1)|endometrium(3)|kidney(2)|large_intestine(9)|lung(11)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	30					Amisulpride(DB06288)|Amitriptyline(DB00321)|Amoxapine(DB00543)|Aripiprazole(DB01238)|Asenapine(DB06216)|Bromocriptine(DB01200)|Cabergoline(DB00248)|Chlorpromazine(DB00477)|Clozapine(DB00363)|Dopamine(DB00988)|Eletriptan(DB00216)|Epinastine(DB00751)|Ergoloid mesylate(DB01049)|Iloperidone(DB04946)|Imipramine(DB00458)|Loxapine(DB00408)|Lurasidone(DB08815)|Maprotiline(DB00934)|Methysergide(DB00247)|Mianserin(DB06148)|Mirtazapine(DB00370)|Olanzapine(DB00334)|Quetiapine(DB01224)|Ziprasidone(DB00246)	CCAGGTGGGCGCCGGGCTGGC	0.711																																					p.A57E		.											.	HTR7-91	0			c.C170A						.						20.0	18.0	18.0					10																	92617259		2200	4295	6495	SO:0001583	missense	3363	exon1			GTGGGCGCCGGGC	BC047526	CCDS7408.1, CCDS7409.1, CCDS7410.1	10q21-q24	2012-08-08	2012-02-03		ENSG00000148680	ENSG00000148680		"""5-HT (serotonin) receptors"", ""GPCR / Class A : 5-HT (serotonin) receptors, GPCR only"""	5302	protein-coding gene	gene with protein product		182137	"""5-hydroxytryptamine (serotonin) receptor 7 (adenylate cyclase-coupled)"""			8226867	Standard	NM_000872		Approved	5-HT7	uc001kha.3	P34969	OTTHUMG00000018732	ENST00000336152.3:c.170C>A	10.37:g.92617259G>T	ENSP00000337949:p.Ala57Glu	Somatic	27	0		WXS	Illumina GAIIx	Phase_I	85	5	NM_019860	0	0	0	0	0	B5BUP6|P78336|P78372|P78516|Q5VX01|Q5VX02|Q5VX03	Missense_Mutation	SNP	ENST00000336152.3	37	CCDS7408.1	.	.	.	.	.	.	.	.	.	.	G	12.05	1.820329	0.32145	.	.	ENSG00000148680	ENST00000336152;ENST00000277874;ENST00000371719;ENST00000371721	T;T;T;T	0.64085	-0.08;-0.03;-0.02;-0.08	3.94	-2.18	0.07037	.	0.942859	0.08921	N	0.874458	T	0.31606	0.0802	N	0.08118	0	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.001	T	0.20240	-1.0281	10	0.10636	T	0.68	.	3.8374	0.08900	0.1078:0.1228:0.519:0.2504	.	57;57	P34969;P34969-2	5HT7R_HUMAN;.	E	57	ENSP00000337949:A57E;ENSP00000277874:A57E;ENSP00000360784:A57E;ENSP00000360786:A57E	ENSP00000277874:A57E	A	-	2	0	HTR7	92607239	0.007000	0.16637	0.314000	0.25224	0.946000	0.59487	1.450000	0.35134	-0.126000	0.11682	0.435000	0.28638	GCG	.		0.711	HTR7-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000049343.1	NM_000872	
MYOF	26509	broad.mit.edu;bcgsc.ca	37	10	95191176	95191176	+	Missense_Mutation	SNP	G	G	T			TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr10:95191176G>T	ENST00000359263.4	-	4	333	c.334C>A	c.(334-336)Caa>Aaa	p.Q112K	MYOF_ENST00000371501.4_Missense_Mutation_p.Q112K|MYOF_ENST00000358334.5_Missense_Mutation_p.Q112K|MYOF_ENST00000371489.1_Missense_Mutation_p.Q112K|MYOF_ENST00000371488.3_Missense_Mutation_p.Q112K|MYOF_ENST00000371502.4_Missense_Mutation_p.Q112K	NM_013451.3	NP_038479.1	Q9NZM1	MYOF_HUMAN	myoferlin	112					blood circulation (GO:0008015)|cellular response to heat (GO:0034605)|muscle contraction (GO:0006936)|plasma membrane repair (GO:0001778)|regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030947)	caveola (GO:0005901)|cytoplasmic vesicle (GO:0031410)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|nuclear envelope (GO:0005635)|plasma membrane (GO:0005886)	phospholipid binding (GO:0005543)			NS(2)|autonomic_ganglia(1)|breast(3)|endometrium(7)|kidney(7)|large_intestine(15)|lung(14)|ovary(4)|prostate(4)|skin(6)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	67						CCAGTATCTTGCCCTTTTTCA	0.473																																					p.Q112K		.											.	MYOF-93	0			c.C334A						.						100.0	94.0	96.0					10																	95191176		1913	4133	6046	SO:0001583	missense	26509	exon4			TATCTTGCCCTTT	AB033033	CCDS41550.1, CCDS41551.1	10q24	2014-06-27	2008-11-26	2008-11-26	ENSG00000138119	ENSG00000138119			3656	protein-coding gene	gene with protein product	"""fer-1-like family member 3"""	604603	"""fer-1 (C.elegans)-like 3 (myoferlin)"", ""fer-1-like 3, myoferlin (C. elegans)"""	FER1L3		10607832, 10995573, 17702744	Standard	NM_013451		Approved	KIAA1207	uc001kin.3	Q9NZM1	OTTHUMG00000018772	ENST00000359263.4:c.334C>A	10.37:g.95191176G>T	ENSP00000352208:p.Gln112Lys	Somatic	152	0		WXS	Illumina GAIIx	Phase_I	225	8	NM_133337	0	0	0	0	0	B3KQN5|Q5VWW2|Q5VWW3|Q5VWW4|Q5VWW5|Q7Z642|Q8IWH0|Q9HBU3|Q9NZM0|Q9ULL3|Q9Y4U4	Missense_Mutation	SNP	ENST00000359263.4	37	CCDS41551.1	.	.	.	.	.	.	.	.	.	.	G	13.75	2.331434	0.41297	.	.	ENSG00000138119	ENST00000358334;ENST00000359263;ENST00000371501;ENST00000371502;ENST00000371489;ENST00000371488	T;T;T;T;T;T	0.37752	1.18;1.18;1.18;1.18;1.18;1.18	6.03	6.03	0.97812	C2 calcium/lipid-binding domain, CaLB (1);	0.169398	0.53938	D	0.000050	T	0.37598	0.1009	L	0.53249	1.67	0.47905	D	0.99954	B;B;B	0.18166	0.012;0.002;0.026	B;B;B	0.20767	0.031;0.016;0.011	T	0.06197	-1.0840	10	0.29301	T	0.29	-8.215	17.492	0.87707	0.0:0.0:1.0:0.0	.	94;112;112	Q9NZM1-8;Q9NZM1-6;Q9NZM1	.;.;MYOF_HUMAN	K	112	ENSP00000351094:Q112K;ENSP00000352208:Q112K;ENSP00000360556:Q112K;ENSP00000360557:Q112K;ENSP00000360544:Q112K;ENSP00000360543:Q112K	ENSP00000351094:Q112K	Q	-	1	0	MYOF	95181166	1.000000	0.71417	1.000000	0.80357	0.381000	0.30169	3.946000	0.56644	2.868000	0.98415	0.557000	0.71058	CAA	.		0.473	MYOF-005	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000049423.2	NM_013451	
GBF1	8729	broad.mit.edu;ucsc.edu;bcgsc.ca	37	10	104136514	104136514	+	Silent	SNP	C	C	T	rs139000128		TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr10:104136514C>T	ENST00000369983.3	+	32	4502	c.4242C>T	c.(4240-4242)tgC>tgT	p.C1414C		NM_001199378.1|NM_001199379.1|NM_004193.2	NP_001186307.1|NP_001186308.1|NP_004184.1	Q92538	GBF1_HUMAN	golgi brefeldin A resistant guanine nucleotide exchange factor 1	1414					COPI coating of Golgi vesicle (GO:0048205)|membrane organization (GO:0061024)|positive regulation of GTPase activity (GO:0043547)|post-Golgi vesicle-mediated transport (GO:0006892)|regulation of ARF protein signal transduction (GO:0032012)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)|vesicle-mediated transport (GO:0016192)|viral process (GO:0016032)	cis-Golgi network (GO:0005801)|endoplasmic reticulum lumen (GO:0005788)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|Golgi stack (GO:0005795)|membrane (GO:0016020)|mitochondrion (GO:0005739)|peroxisome (GO:0005777)|trans-Golgi network (GO:0005802)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)			NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(14)|kidney(8)|large_intestine(15)|lung(19)|ovary(1)|pancreas(1)|prostate(3)|upper_aerodigestive_tract(3)|urinary_tract(2)	71		Colorectal(252;0.0236)		Epithelial(162;5.16e-08)|all cancers(201;1.19e-06)		TTGAGCTCTGCGTCAAGACTC	0.552																																					p.C1415C		.											.	GBF1-91	0			c.C4245T						.	C	,,	1,4405	2.1+/-5.4	0,1,2202	75.0	72.0	73.0		4245,4242,4242	-8.3	0.6	10	dbSNP_134	73	0,8600		0,0,4300	no	coding-synonymous,coding-synonymous,coding-synonymous	GBF1	NM_001199378.1,NM_001199379.1,NM_004193.2	,,	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	,,	1415/1857,1414/1856,1414/1860	104136514	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	8729	exon32			GCTCTGCGTCAAG	D87435	CCDS7533.1	10q24	2010-02-12	2010-02-12		ENSG00000107862	ENSG00000107862			4181	protein-coding gene	gene with protein product		603698	"""golgi-specific brefeldin A resistance factor 1"""			9828135	Standard	NM_004193		Approved	KIAA0248, ARF1GEF	uc001kux.2	Q92538	OTTHUMG00000018955	ENST00000369983.3:c.4242C>T	10.37:g.104136514C>T		Somatic	30	1		WXS	Illumina GAIIx	Phase_I	40	6	NM_001199378	0	0	47	57	10	Q5VXX3|Q96CK6|Q96HZ3|Q9H473	Silent	SNP	ENST00000369983.3	37	CCDS7533.1																																																																																			C|1.000;T|0.000		0.552	GBF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050051.1		
C10orf95	79946	hgsc.bcm.edu	37	10	104210735	104210735	+	Missense_Mutation	SNP	C	C	A	rs2281878	byFrequency	TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr10:104210735C>A	ENST00000239125.1	-	2	327	c.253G>T	c.(253-255)Gct>Tct	p.A85S	RP11-18I14.10_ENST00000596045.1_RNA|RP11-18I14.10_ENST00000596366.1_RNA|RP11-18I14.10_ENST00000473970.2_RNA|RP11-18I14.10_ENST00000494270.2_RNA|RP11-18I14.10_ENST00000492465.2_RNA|RP11-18I14.10_ENST00000594818.1_RNA	NM_024886.1	NP_079162.1	Q9H7T3	CJ095_HUMAN	chromosome 10 open reading frame 95	85	Arg/Pro-rich.									liver(1)	1		Colorectal(252;0.207)		Epithelial(162;8.34e-09)|all cancers(201;1.95e-07)|BRCA - Breast invasive adenocarcinoma(275;0.213)		GCTGCGGAAGCTGTGGGCCTG	0.766													C|||	1422	0.283946	0.2481	0.2147	5008	,	,		8527	0.3661		0.2107	False		,,,				2504	0.3722				p.A85S		.											.	C10orf95-91	0			c.G253T						.	C	SER/ALA	686,2688		69,548,1070	4.0	6.0	5.0		253	0.9	1.0	10	dbSNP_100	5	1301,5815		124,1053,2381	yes	missense	C10orf95	NM_024886.1	99	193,1601,3451	AA,AC,CC		18.2827,20.332,18.9418	possibly-damaging	85/258	104210735	1987,8503	1687	3558	5245	SO:0001583	missense	79946	exon2			CGGAAGCTGTGGG	AK024342	CCDS7534.1	10q24.32	2014-02-19	2014-02-19	2014-02-19	ENSG00000120055	ENSG00000120055			25880	protein-coding gene	gene with protein product							Standard	NM_024886		Approved	FLJ14280	uc001kvo.1	Q9H7T3	OTTHUMG00000018959	ENST00000239125.1:c.253G>T	10.37:g.104210735C>A	ENSP00000239125:p.Ala85Ser	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	4	4	NM_024886	0	0	1	1	0	A0AVQ7	Missense_Mutation	SNP	ENST00000239125.1	37	CCDS7534.1	525	0.2403846153846154	101	0.20528455284552846	71	0.19613259668508287	200	0.34965034965034963	153	0.20184696569920843	C	12.47	1.948662	0.34377	0.20332	0.182827	ENSG00000120055	ENST00000239125	.	.	.	4.68	0.951	0.19579	.	0.773948	0.10608	N	0.654824	T	0.00012	0.0000	N	0.08118	0	0.53688	P	2.5000000000052758E-5	B	0.33807	0.426	B	0.32090	0.14	T	0.45891	-0.9230	8	0.33940	T	0.23	-38.6243	6.6233	0.22816	0.0:0.3488:0.0:0.6512	rs2281878	85	Q9H7T3	CJ095_HUMAN	S	85	.	ENSP00000239125:A85S	A	-	1	0	C10orf95	104200725	0.997000	0.39634	0.987000	0.45799	0.038000	0.13279	0.038000	0.13862	0.047000	0.15862	-0.350000	0.07774	GCT	C|0.759;A|0.241		0.766	C10orf95-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050065.1	NM_024886	
CALHM1	255022	bcgsc.ca	37	10	105215373	105215373	+	Silent	SNP	C	C	T			TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr10:105215373C>T	ENST00000329905.5	-	2	823	c.687G>A	c.(685-687)aaG>aaA	p.K229K	CALHM2_ENST00000393235.1_5'Flank|RP11-225H22.4_ENST00000411906.1_RNA	NM_001001412.3	NP_001001412.3	Q8IU99	CAHM1_HUMAN	calcium homeostasis modulator 1	229					ATP transport (GO:0015867)|cation transport (GO:0006812)|protein homooligomerization (GO:0051260)|regulation of ion transmembrane transport (GO:0034765)|sensory perception of bitter taste (GO:0050913)|sensory perception of sweet taste (GO:0050916)|sensory perception of umami taste (GO:0050917)	endoplasmic reticulum (GO:0005783)|integral component of plasma membrane (GO:0005887)	calcium activated cation channel activity (GO:0005227)|calcium channel activity (GO:0005262)|identical protein binding (GO:0042802)|voltage-gated ion channel activity (GO:0005244)			large_intestine(2)|liver(1)|lung(5)|ovary(1)	9						CGTCGAAGAGCTTGCGCTCGA	0.592																																					p.K229K		.											.	CALHM1-91	0			c.G687A						.						82.0	67.0	72.0					10																	105215373		2203	4300	6503	SO:0001819	synonymous_variant	255022	exon2			GAAGAGCTTGCGC	BC036208	CCDS7550.1	10q24.33	2008-07-02	2008-07-02	2008-07-02	ENSG00000185933	ENSG00000185933			23494	protein-coding gene	gene with protein product		612234	"""family with sequence similarity 26, member C"""	FAM26C		18585350	Standard	NM_001001412		Approved		uc001kxe.2	Q8IU99	OTTHUMG00000018991	ENST00000329905.5:c.687G>A	10.37:g.105215373C>T		Somatic	156	4		WXS	Illumina GAIIx	Phase_I	323	152	NM_001001412	0	0	0	0	0	Q5W091	Silent	SNP	ENST00000329905.5	37	CCDS7550.1																																																																																			.		0.592	CALHM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050165.1	NM_001001412	
ADRA2A	150	broad.mit.edu	37	10	112839104	112839104	+	Silent	SNP	C	C	T			TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr10:112839104C>T	ENST00000280155.2	+	1	2315	c.1350C>T	c.(1348-1350)cgC>cgT	p.R450R		NM_000681.3	NP_000672.3	P08913	ADA2A_HUMAN	adrenoceptor alpha 2A	435					actin cytoskeleton organization (GO:0030036)|activation of MAPK activity by adrenergic receptor signaling pathway (GO:0071883)|activation of protein kinase activity (GO:0032147)|activation of protein kinase B activity (GO:0032148)|acute inflammatory response (GO:0002526)|adenylate cyclase-inhibiting adrenergic receptor signaling pathway (GO:0071881)|blood coagulation (GO:0007596)|cellular component movement (GO:0006928)|cellular response to hormone stimulus (GO:0032870)|DNA replication (GO:0006260)|energy reserve metabolic process (GO:0006112)|epidermal growth factor-activated receptor transactivation by G-protein coupled receptor signaling pathway (GO:0035625)|fear response (GO:0042596)|female pregnancy (GO:0007565)|G-protein coupled receptor signaling pathway (GO:0007186)|glucose homeostasis (GO:0042593)|intestinal absorption (GO:0050892)|negative regulation of adenylate cyclase activity (GO:0007194)|negative regulation of adrenergic receptor signaling pathway (GO:0071878)|negative regulation of calcium ion transmembrane transporter activity (GO:1901020)|negative regulation of calcium ion transport (GO:0051926)|negative regulation of calcium ion-dependent exocytosis (GO:0045955)|negative regulation of cAMP biosynthetic process (GO:0030818)|negative regulation of epinephrine secretion (GO:0032811)|negative regulation of insulin secretion (GO:0046676)|negative regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0061179)|negative regulation of lipid catabolic process (GO:0050995)|negative regulation of norepinephrine secretion (GO:0010700)|negative regulation of uterine smooth muscle contraction (GO:0070473)|phospholipase C-activating adrenergic receptor signaling pathway (GO:0071882)|platelet activation (GO:0030168)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cytokine production (GO:0001819)|positive regulation of epidermal growth factor-activated receptor activity (GO:0045741)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of membrane protein ectodomain proteolysis (GO:0051044)|positive regulation of potassium ion transport (GO:0043268)|positive regulation of vasodilation (GO:0045909)|positive regulation of wound healing (GO:0090303)|Ras protein signal transduction (GO:0007265)|regulation of insulin secretion (GO:0050796)|regulation of vasoconstriction (GO:0019229)|Rho protein signal transduction (GO:0007266)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|thermoception (GO:0050955)	basolateral plasma membrane (GO:0016323)|cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|synapse (GO:0045202)	alpha-1B adrenergic receptor binding (GO:0031692)|alpha-2C adrenergic receptor binding (GO:0031696)|alpha2-adrenergic receptor activity (GO:0004938)|epinephrine binding (GO:0051379)|heterotrimeric G-protein binding (GO:0032795)|norepinephrine binding (GO:0051380)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|protein kinase binding (GO:0019901)|thioesterase binding (GO:0031996)			breast(1)|cervix(3)|endometrium(6)|large_intestine(3)|lung(5)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	21		Breast(234;0.0735)|Lung NSC(174;0.238)		Epithelial(162;0.000316)|all cancers(201;0.00501)|BRCA - Breast invasive adenocarcinoma(275;0.118)	Amitriptyline(DB00321)|Amoxapine(DB00543)|Amphetamine(DB00182)|Apomorphine(DB00714)|Apraclonidine(DB00964)|Aripiprazole(DB01238)|Asenapine(DB06216)|Benzphetamine(DB00865)|Bethanidine(DB00217)|Brimonidine(DB00484)|Bromocriptine(DB01200)|Cabergoline(DB00248)|Carvedilol(DB01136)|Chlorpromazine(DB00477)|Clonidine(DB00575)|Clozapine(DB00363)|Desipramine(DB01151)|Dexmedetomidine(DB00633)|Dihydroergotamine(DB00320)|Dipivefrin(DB00449)|Doxepin(DB01142)|Dronedarone(DB04855)|Droxidopa(DB06262)|Ephedra(DB01363)|Epinastine(DB00751)|Epinephrine(DB00668)|Ergoloid mesylate(DB01049)|Ergotamine(DB00696)|Fenoldopam(DB00800)|Flupirtine(DB06623)|Guanabenz(DB00629)|Guanfacine(DB01018)|Lisuride(DB00589)|Lofexidine(DB04948)|Loxapine(DB00408)|Lurasidone(DB08815)|Maprotiline(DB00934)|Mephentermine(DB01365)|Methamphetamine(DB01577)|Methotrimeprazine(DB01403)|Methyldopa(DB00968)|Mianserin(DB06148)|Mirtazapine(DB00370)|Naphazoline(DB06711)|Nefazodone(DB01149)|Norepinephrine(DB00368)|Nortriptyline(DB00540)|Olanzapine(DB00334)|Oxymetazoline(DB00935)|Paliperidone(DB01267)|Pergolide(DB01186)|Phenoxybenzamine(DB00925)|Phentolamine(DB00692)|Phenylpropanolamine(DB00397)|Pramipexole(DB00413)|Prazosin(DB00457)|Propericiazine(DB01608)|Pseudoephedrine(DB00852)|Quetiapine(DB01224)|Risperidone(DB00734)|Ropinirole(DB00268)|Tizanidine(DB00697)|Tolazoline(DB00797)|Trazodone(DB00656)|Trimipramine(DB00726)|Xylometazoline(DB06694)|Yohimbine(DB01392)|Ziprasidone(DB00246)	ATTTCCGCCGCGCCTTCAAGA	0.602																																					p.R450R	Esophageal Squamous(173;605 2658 7278 49362)	.											.	ADRA2A-90	0			c.C1350T						.						95.0	94.0	95.0					10																	112839104		2203	4300	6503	SO:0001819	synonymous_variant	150	exon1			CCGCCGCGCCTTC	AF284095	CCDS7569.2	10q25.2	2012-08-08	2012-05-09		ENSG00000150594	ENSG00000150594		"""GPCR / Class A : Adrenoceptors : alpha"""	281	protein-coding gene	gene with protein product	"""alpha-2AAR subtype C10"", "" alpha-2A-adrenergic receptor"""	104210	"""adrenergic, alpha-2A-, receptor"""	ADRA2, ADRA2R			Standard	NM_000681		Approved	ADRAR	uc001kzo.3	P08913	OTTHUMG00000019050	ENST00000280155.2:c.1350C>T	10.37:g.112839104C>T		Somatic	86	1		WXS	Illumina GAIIx	Phase_I	190	5	NM_000681	0	0	32	33	1	B0LPF6|Q2I8G2|Q2XN99|Q86TH8|Q9BZK1	Silent	SNP	ENST00000280155.2	37	CCDS7569.2																																																																																			.		0.602	ADRA2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050372.2	NM_000681	
CCDC186	55088	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	10	115904312	115904312	+	Missense_Mutation	SNP	C	C	T	rs201374071		TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr10:115904312C>T	ENST00000369287.3	-	6	1431	c.1165G>A	c.(1165-1167)Gtc>Atc	p.V389I	C10orf118_ENST00000543782.1_5'UTR	NM_018017.2	NP_060487.2	Q7Z3E2	CC186_HUMAN		389										NS(1)|autonomic_ganglia(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(5)|lung(9)|ovary(2)	24		Colorectal(252;0.172)|Breast(234;0.188)		Epithelial(162;0.0161)|all cancers(201;0.0397)		ACTTTGATGACGTGAGAGTTA	0.313													C|||	1	0.000199681	0.0	0.0	5008	,	,		17046	0.001		0.0	False		,,,				2504	0.0				p.V389I		.											.	C10orf118-92	0			c.G1165A						.						204.0	192.0	196.0					10																	115904312		2202	4298	6500	SO:0001583	missense	55088	exon6			TGATGACGTGAGA																												ENST00000369287.3:c.1165G>A	10.37:g.115904312C>T	ENSP00000358293:p.Val389Ile	Somatic	120	0		WXS	Illumina GAIIx	Phase_I	238	35	NM_018017	0	0	3	3	0	Q2M2V6|Q3ZB81|Q6NS91|Q7RTP1|Q8N117|Q8N3G3|Q8N6C2|Q9NWA3	Missense_Mutation	SNP	ENST00000369287.3	37	CCDS7587.1	1|1	4.578754578754579E-4|4.578754578754579E-4	0|0	0.0|0.0	0|0	0.0|0.0	1|1	0.0017482517482517483|0.0017482517482517483	0|0	0.0|0.0	C|C	5.364|5.364	0.252383|0.252383	0.10185|0.10185	.|.	.|.	ENSG00000165813|ENSG00000165813	ENST00000428953|ENST00000369287;ENST00000430353	.|T	.|0.46451	.|0.87	5.42|5.42	-1.75|-1.75	0.08031|0.08031	.|.	.|0.440664	.|0.26048	.|N	.|0.026642	T|T	0.17195|0.17195	0.0413|0.0413	N|N	0.10733|0.10733	0.035|0.035	0.80722|0.80722	D|D	1|1	.|B	.|0.06786	.|0.001	.|B	.|0.04013	.|0.001	T|T	0.02975|0.02975	-1.1087|-1.1087	5|10	.|0.33940	.|T	.|0.23	.|.	5.9526|5.9526	0.19255|0.19255	0.0:0.4628:0.163:0.3742|0.0:0.4628:0.163:0.3742	.|.	.|389	.|Q7Z3E2	.|CJ118_HUMAN	H|I	17|389;495	.|ENSP00000358293:V389I	.|ENSP00000358293:V389I	R|V	-|-	2|1	0|0	C10orf118|C10orf118	115894302|115894302	0.998000|0.998000	0.40836|0.40836	0.971000|0.971000	0.41717|0.41717	0.985000|0.985000	0.73830|0.73830	0.582000|0.582000	0.23834|0.23834	-0.233000|-0.233000	0.09797|0.09797	-0.458000|-0.458000	0.05436|0.05436	CGT|GTC	C|0.999;T|0.000		0.313	C10orf118-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050455.1		
PNLIPRP3	119548	hgsc.bcm.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	118220558	118220558	+	Missense_Mutation	SNP	G	G	A	rs114674677	byFrequency	TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr10:118220558G>A	ENST00000369230.3	+	6	792	c.646G>A	c.(646-648)Gtt>Att	p.V216I		NM_001011709.2	NP_001011709.2	Q17RR3	LIPR3_HUMAN	pancreatic lipase-related protein 3	216					lipid catabolic process (GO:0016042)	extracellular region (GO:0005576)	triglyceride lipase activity (GO:0004806)	p.V216I(1)|p.V216F(1)		breast(3)|central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(9)|lung(29)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	50				all cancers(201;0.0131)		CTTTGTTGACGTTATTCATAC	0.438													G|||	5	0.000998403	0.003	0.0014	5008	,	,		19043	0.0		0.0	False		,,,				2504	0.0				p.V216I		.											.	PNLIPRP3-91	2	Substitution - Missense(2)	large_intestine(1)|kidney(1)	c.G646A						.	G	ILE/VAL	8,4398	14.3+/-33.2	0,8,2195	140.0	125.0	130.0		646	2.8	0.0	10	dbSNP_132	130	2,8598	2.2+/-6.3	0,2,4298	yes	missense	PNLIPRP3	NM_001011709.2	29	0,10,6493	AA,AG,GG		0.0233,0.1816,0.0769	probably-damaging	216/468	118220558	10,12996	2203	4300	6503	SO:0001583	missense	119548	exon6			GTTGACGTTATTC	BC015840	CCDS31292.1	10q26.12	2014-03-14			ENSG00000203837	ENSG00000203837	3.1.1.3		23492	protein-coding gene	gene with protein product							Standard	NM_001011709		Approved		uc001lcl.4	Q17RR3	OTTHUMG00000019100	ENST00000369230.3:c.646G>A	10.37:g.118220558G>A	ENSP00000358232:p.Val216Ile	Somatic	106	0		WXS	Illumina GAIIx	Phase_I	182	80	NM_001011709	0	0	1	1	0		Missense_Mutation	SNP	ENST00000369230.3	37	CCDS31292.1	5	0.0022893772893772895	4	0.008130081300813009	1	0.0027624309392265192	0	0.0	0	0.0	G	20.3	3.962150	0.74016	0.001816	2.33E-4	ENSG00000203837	ENST00000369230	D	0.91945	-2.94	4.93	2.85	0.33270	Lipase, N-terminal (1);	0.119302	0.34959	N	0.003545	D	0.84151	0.5409	L	0.51853	1.615	0.23747	N	0.996955	P	0.40875	0.731	B	0.37198	0.243	T	0.77713	-0.2485	10	0.56958	D	0.05	.	10.1136	0.42576	0.2401:0.0:0.7599:0.0	.	216	Q17RR3	LIPR3_HUMAN	I	216	ENSP00000358232:V216I	ENSP00000358232:V216I	V	+	1	0	PNLIPRP3	118210548	0.981000	0.34729	0.006000	0.13384	0.586000	0.36452	1.605000	0.36815	0.537000	0.28751	0.591000	0.81541	GTT	G|0.999;A|0.001		0.438	PNLIPRP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050520.1	XM_058404	
PRLHR	2834	broad.mit.edu	37	10	120354224	120354224	+	Missense_Mutation	SNP	T	T	C			TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr10:120354224T>C	ENST00000369169.1	-	1	532	c.533A>G	c.(532-534)tAc>tGc	p.Y178C	PRLHR_ENST00000239032.2_Missense_Mutation_p.Y178C			P49683	PRLHR_HUMAN	prolactin releasing hormone receptor	178					feeding behavior (GO:0007631)|female pregnancy (GO:0007565)|G-protein coupled receptor signaling pathway (GO:0007186)|hormone metabolic process (GO:0042445)|neuropeptide signaling pathway (GO:0007218)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|neuropeptide receptor activity (GO:0008188)|neuropeptide Y receptor activity (GO:0004983)			large_intestine(2)|lung(8)|ovary(1)|skin(1)	12		Colorectal(252;0.0429)|Lung NSC(174;0.142)|all_lung(145;0.175)		all cancers(201;0.0166)		CAGCACAGCGTAGGCGCTGAG	0.687																																					p.Y178C		.											.	PRLHR-90	0			c.A533G						.						18.0	20.0	19.0					10																	120354224		2197	4291	6488	SO:0001583	missense	2834	exon2			ACAGCGTAGGCGC	AB048946	CCDS7606.1	10q25.3-q26	2014-02-21	2005-11-24	2005-11-24	ENSG00000119973	ENSG00000119973		"""GPCR / Class A : RF amide peptide receptors"""	4464	protein-coding gene	gene with protein product		600895	"""G protein-coupled receptor 10"""	GPR10		8666380, 15885496	Standard	NM_004248		Approved	PrRPR	uc001ldp.1	P49683	OTTHUMG00000019136	ENST00000369169.1:c.533A>G	10.37:g.120354224T>C	ENSP00000358167:p.Tyr178Cys	Somatic	8	0		WXS	Illumina GAIIx	Phase_I	21	4	NM_004248	0	0	0	0	0	O75194|Q502U8|Q5VXR9	Missense_Mutation	SNP	ENST00000369169.1	37	CCDS7606.1	.	.	.	.	.	.	.	.	.	.	T	11.53	1.665554	0.29604	.	.	ENSG00000119973	ENST00000239032;ENST00000369169	T;T	0.71817	-0.6;-0.6	4.54	2.15	0.27550	GPCR, rhodopsin-like superfamily (1);	0.410669	0.24935	N	0.034431	T	0.53465	0.1798	L	0.28115	0.83	0.34124	D	0.664482	P	0.39404	0.672	B	0.37989	0.262	T	0.61342	-0.7082	10	0.36615	T	0.2	.	8.7758	0.34760	0.0:0.1591:0.0:0.8409	.	178	P49683	PRLHR_HUMAN	C	178	ENSP00000239032:Y178C;ENSP00000358167:Y178C	ENSP00000239032:Y178C	Y	-	2	0	PRLHR	120344214	1.000000	0.71417	0.995000	0.50966	0.992000	0.81027	2.221000	0.42917	0.794000	0.33899	0.533000	0.62120	TAC	.		0.687	PRLHR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050610.1	NM_004248	
FAM45A	404636	broad.mit.edu;ucsc.edu;bcgsc.ca	37	10	120879946	120879946	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr10:120879946C>T	ENST00000361432.2	+	5	601	c.575C>T	c.(574-576)gCg>gTg	p.A192V	FAM45A_ENST00000489988.1_3'UTR|FAM45A_ENST00000544016.1_Missense_Mutation_p.A41V|FAM45A_ENST00000535029.1_Intron	NM_207009.2	NP_996892.1	Q8TCE6	FA45A_HUMAN	family with sequence similarity 45, member A	192										breast(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(4)|ovary(2)|urinary_tract(1)	14		Lung NSC(174;0.094)|all_lung(145;0.123)		all cancers(201;0.0293)		AAGATAGAAGCGGTCCAGGAG	0.408																																					p.A192V		.											.	FAM45A-91	0			c.C575T						.						89.0	85.0	86.0					10																	120879946		2203	4300	6503	SO:0001583	missense	404636	exon5			TAGAAGCGGTCCA	AF168713	CCDS7609.1	10q25	2008-09-04			ENSG00000119979	ENSG00000119979			31793	protein-coding gene	gene with protein product							Standard	NM_207009		Approved			Q8TCE6	OTTHUMG00000019143	ENST00000361432.2:c.575C>T	10.37:g.120879946C>T	ENSP00000354688:p.Ala192Val	Somatic	273	2		WXS	Illumina GAIIx	Phase_I	517	102	NM_207009	0	0	15	19	4	B1AMV6|B4DDC3|D3DRC8|Q9NXW4	Missense_Mutation	SNP	ENST00000361432.2	37	CCDS7609.1	.	.	.	.	.	.	.	.	.	.	C	13.99	2.402207	0.42613	.	.	ENSG00000119979	ENST00000361432;ENST00000544016	.	.	.	5.96	4.13	0.48395	.	0.048738	0.85682	N	0.000000	T	0.58337	0.2115	M	0.65975	2.015	0.58432	D	0.999999	B;B;B;B	0.18310	0.01;0.027;0.008;0.006	B;B;B;B	0.15052	0.007;0.012;0.004;0.01	T	0.54351	-0.8307	9	0.37606	T	0.19	.	11.1671	0.48550	0.0:0.8585:0.0:0.1415	.	119;41;184;192	B4DNL9;B4DMU4;Q8TCE6-2;Q8TCE6	.;.;.;FA45A_HUMAN	V	192;41	.	ENSP00000354688:A192V	A	+	2	0	FAM45A	120869936	1.000000	0.71417	0.973000	0.42090	0.855000	0.48748	4.200000	0.58433	0.872000	0.35775	0.655000	0.94253	GCG	.		0.408	FAM45A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050623.1	NM_207009	
DOCK1	1793	ucsc.edu;bcgsc.ca	37	10	128830513	128830513	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr10:128830513G>A	ENST00000280333.6	+	18	1887	c.1778G>A	c.(1777-1779)gGg>gAg	p.G593E		NM_001380.3	NP_001371.1	Q14185	DOCK1_HUMAN	dedicator of cytokinesis 1	593	DHR-1.				apoptotic process (GO:0006915)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell migration (GO:0016477)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|hematopoietic progenitor cell differentiation (GO:0002244)|innate immune response (GO:0045087)|integrin-mediated signaling pathway (GO:0007229)|phagocytosis, engulfment (GO:0006911)|positive regulation of GTPase activity (GO:0043547)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)	GTPase activator activity (GO:0005096)|guanyl-nucleotide exchange factor activity (GO:0005085)			NS(2)|breast(1)|central_nervous_system(7)|endometrium(13)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(10)|lung(15)|ovary(4)|prostate(3)|stomach(2)|upper_aerodigestive_tract(5)|urinary_tract(1)	72		all_epithelial(44;2.3e-07)|all_lung(145;0.00466)|Lung NSC(174;0.00685)|Colorectal(57;0.0107)|Renal(717;0.0113)|Breast(234;0.0492)|all_neural(114;0.108)|all_hematologic(284;0.14)		BRCA - Breast invasive adenocarcinoma(275;0.0221)|Colorectal(40;0.115)		CAGAGCCTTGGGAGCTGCACC	0.567																																					p.G593E		.											.	DOCK1-698	0			c.G1778A						.						26.0	28.0	27.0					10																	128830513		2149	4244	6393	SO:0001583	missense	1793	exon18			GCCTTGGGAGCTG	D50857	CCDS73222.1	10q26.13-q26.3	2009-10-28			ENSG00000150760	ENSG00000150760			2987	protein-coding gene	gene with protein product	"""DOwnstream of CrK"""	601403	"""dedicator of cyto-kinesis 1"""			8657152, 8661160	Standard	XM_006717681		Approved	DOCK180, ced5	uc001ljt.3	Q14185	OTTHUMG00000019249	ENST00000280333.6:c.1778G>A	10.37:g.128830513G>A	ENSP00000280333:p.Gly593Glu	Somatic	286	2		WXS	Illumina GAIIx	Phase_I	620	277	NM_001380	0	0	0	5	5	A9Z1Z5	Missense_Mutation	SNP	ENST00000280333.6	37		.	.	.	.	.	.	.	.	.	.	G	17.77	3.471318	0.63625	.	.	ENSG00000150760	ENST00000280333	T	0.12465	2.68	3.85	3.85	0.44370	.	0.118870	0.56097	D	0.000033	T	0.20210	0.0486	L	0.60455	1.87	0.54753	D	0.999985	B;B	0.33000	0.393;0.393	B;B	0.39971	0.315;0.315	T	0.05733	-1.0867	10	0.26408	T	0.33	.	17.1159	0.86688	0.0:0.0:1.0:0.0	.	593;593	B2RUU3;Q14185	.;DOCK1_HUMAN	E	593	ENSP00000280333:G593E	ENSP00000280333:G593E	G	+	2	0	DOCK1	128720503	1.000000	0.71417	0.232000	0.24009	0.973000	0.67179	5.314000	0.65804	2.415000	0.81967	0.655000	0.94253	GGG	.		0.567	DOCK1-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000050979.2	NM_001380	
PWWP2B	170394	broad.mit.edu	37	10	134218800	134218800	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr10:134218800G>A	ENST00000305233.5	+	2	855	c.796G>A	c.(796-798)Gtg>Atg	p.V266M	PWWP2B_ENST00000368609.4_Missense_Mutation_p.V266M	NM_138499.3	NP_612508.3	Q6NUJ5	PWP2B_HUMAN	PWWP domain containing 2B	266										central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(5)|urinary_tract(1)	9		all_cancers(35;6.69e-12)|all_epithelial(44;1.55e-08)|Lung NSC(174;0.000845)|all_lung(145;0.00144)|all_neural(114;0.0299)|Breast(234;0.106)|Colorectal(31;0.109)|Melanoma(40;0.123)|Glioma(114;0.203)|all_hematologic(284;0.224)		OV - Ovarian serous cystadenocarcinoma(35;7.49e-05)|Epithelial(32;0.00016)|all cancers(32;0.000186)		CAAGGGAGAGGTGGTCAAGAT	0.701																																					p.V266M		.											.	PWWP2B-90	0			c.G796A						.						15.0	20.0	18.0					10																	134218800		2189	4283	6472	SO:0001583	missense	170394	exon2			GGAGAGGTGGTCA	AK128663	CCDS7667.2	10q26.3	2009-06-03	2007-10-22	2007-10-22	ENSG00000171813	ENSG00000171813			25150	protein-coding gene	gene with protein product			"""PWWP domain containing 2"""	PWWP2			Standard	NM_001098637		Approved	bA432J24.1, FLJ46823	uc001lll.4	Q6NUJ5	OTTHUMG00000019286	ENST00000305233.5:c.796G>A	10.37:g.134218800G>A	ENSP00000306324:p.Val266Met	Somatic	103	0		WXS	Illumina GAIIx	Phase_I	344	8	NM_001098637	0	0	47	48	1	A6NM90|B5MDQ1|H9KV61|Q5SZI0|Q6ZQX5|Q96F43	Missense_Mutation	SNP	ENST00000305233.5	37	CCDS7667.2	.	.	.	.	.	.	.	.	.	.	G	28.6	4.930647	0.92389	.	.	ENSG00000171813	ENST00000305233;ENST00000368609	T;T	0.61627	0.09;1.07	4.65	4.65	0.58169	.	0.000000	0.64402	U	0.000005	T	0.68293	0.2985	L	0.36672	1.1	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.72459	-0.4287	10	0.87932	D	0	-12.4493	16.9232	0.86168	0.0:0.0:1.0:0.0	.	266	Q6NUJ5	PWP2B_HUMAN	M	266	ENSP00000306324:V266M;ENSP00000357598:V266M	ENSP00000306324:V266M	V	+	1	0	PWWP2B	134068790	1.000000	0.71417	1.000000	0.80357	0.905000	0.53344	8.906000	0.92626	2.318000	0.78349	0.563000	0.77884	GTG	.		0.701	PWWP2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051075.3	NM_138499	
KRTAP5-5	439915	broad.mit.edu	37	11	1651158	1651169	+	In_Frame_Del	DEL	GGCTGTGGCTCT	GGCTGTGGCTCT	-	rs71454095|rs71454094	byFrequency	TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr11:1651158_1651169delGGCTGTGGCTCT	ENST00000399676.2	+	1	126_137	c.88_99delGGCTGTGGCTCT	c.(88-99)ggctgtggctctdel	p.GCGS30del		NM_001001480.2	NP_001001480.2	Q701N2	KRA55_HUMAN	keratin associated protein 5-5	30						keratin filament (GO:0045095)				endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(17)|ovary(2)|prostate(5)|urinary_tract(1)	33		all_epithelial(84;0.00018)|Ovarian(85;0.0014)|Breast(177;0.00147)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.000614)|Lung(200;0.0681)|LUSC - Lung squamous cell carcinoma(625;0.082)		cggctgtggaggctgtggctctggctgtgggg	0.708																																					p.30_33del		.											.	KRTAP5-5-23	0			c.88_99del						.			96,3734		5,86,1824						0.1	0.0			33	221,7503		7,207,3648	no	coding	KRTAP5-5	NM_001001480.2		12,293,5472	A1A1,A1R,RR		2.8612,2.5065,2.7436				317,11237				SO:0001651	inframe_deletion	439915	exon1			TGTGGAGGCTGTG	AB125074	CCDS41592.1	11p15.5	2008-10-30			ENSG00000185940	ENSG00000185940		"""Keratin associated proteins"""	23601	protein-coding gene	gene with protein product						15144888	Standard	NM_001001480		Approved	KRTAP5.5, KRTAP5-11	uc001lty.3	Q701N2	OTTHUMG00000057554	ENST00000399676.2:c.88_99delGGCTGTGGCTCT	11.37:g.1651158_1651169delGGCTGTGGCTCT	ENSP00000382584:p.Gly30_Ser33del	Somatic	17	0		WXS	Illumina GAIIx	Phase_I	72	7	NM_001001480	0	0	0	0	0	A8MWN2	In_Frame_Del	DEL	ENST00000399676.2	37	CCDS41592.1																																																																																			.		0.708	KRTAP5-5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000127919.1		
SYT8	90019	hgsc.bcm.edu;ucsc.edu	37	11	1858479	1858479	+	Missense_Mutation	SNP	G	G	A	rs138799724	byFrequency	TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr11:1858479G>A	ENST00000381968.3	+	9	1152	c.1024G>A	c.(1024-1026)Gta>Ata	p.V342I	TNNI2_ENST00000381905.3_5'Flank|TNNI2_ENST00000381906.1_5'Flank|TNNI2_ENST00000381911.1_5'Flank|SYT8_ENST00000341958.3_Missense_Mutation_p.V328I|SYT8_ENST00000535046.1_3'UTR|TNNI2_ENST00000252898.7_5'Flank	NM_138567.3	NP_612634	Q8NBV8	SYT8_HUMAN	synaptotagmin VIII	342	C2 2. {ECO:0000255|PROSITE- ProRule:PRU00041}.				acrosome reaction (GO:0007340)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|synaptic vesicle (GO:0008021)	transporter activity (GO:0005215)			breast(1)|large_intestine(1)|lung(2)|ovary(1)|skin(1)	6		all_epithelial(84;0.000138)|Breast(177;0.000962)|Ovarian(85;0.0014)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00136)|Lung(200;0.0681)|LUSC - Lung squamous cell carcinoma(625;0.082)		AACTGAGCCCGTAGGCAAGGT	0.692													G|||	4	0.000798722	0.0	0.0	5008	,	,		15423	0.0		0.003	False		,,,				2504	0.001				p.V342I		.											.	SYT8-91	0			c.G1024A						.	G	ILE/VAL	1,4383		0,1,2191	22.0	24.0	24.0		1024	0.4	0.4	11	dbSNP_134	24	18,8546		0,18,4264	yes	missense	SYT8	NM_138567.3	29	0,19,6455	AA,AG,GG		0.2102,0.0228,0.1467	probably-damaging	342/402	1858479	19,12929	2192	4282	6474	SO:0001583	missense	90019	exon9			GAGCCCGTAGGCA	AL137708	CCDS7726.2	11p15.5	2013-01-21			ENSG00000149043	ENSG00000149043		"""Synaptotagmins"""	19264	protein-coding gene	gene with protein product		607719				7791877	Standard	XM_005253216		Approved	DKFZp434K0322	uc001lue.1	Q8NBV8	OTTHUMG00000009026	ENST00000381968.3:c.1024G>A	11.37:g.1858479G>A	ENSP00000371394:p.Val342Ile	Somatic	17	0		WXS	Illumina GAIIx	Phase_I	24	11	NM_138567	0	0	0	0	0	A6NFJ4|Q9NSV9	Missense_Mutation	SNP	ENST00000381968.3	37	CCDS7726.2	1|1	4.578754578754579E-4|4.578754578754579E-4	0|0	0.0|0.0	0|0	0.0|0.0	0|0	0.0|0.0	1|1	0.0013192612137203166|0.0013192612137203166	g|g	0.008|0.008	-1.861462|-1.861462	0.00552|0.00552	2.28E-4|2.28E-4	0.002102|0.002102	ENSG00000149043|ENSG00000149043	ENST00000381978|ENST00000381968;ENST00000341958	.|T;T	.|0.05319	.|3.46;3.46	3.61|3.61	0.398|0.398	0.16319|0.16319	.|C2 membrane targeting protein (1);C2 calcium-dependent membrane targeting (2);C2 calcium/lipid-binding domain, CaLB (1);Synaptotagmin (1);	.|.	.|.	.|.	.|.	T|T	0.01695|0.01695	0.0054|0.0054	N|N	0.03209|0.03209	-0.39|-0.39	0.80722|0.80722	D|D	1|1	.|B;B	.|0.28512	.|0.214;0.013	.|B;B	.|0.17433	.|0.018;0.009	T|T	0.44862|0.44862	-0.9300|-0.9300	5|9	.|0.02654	.|T	.|1	.|.	2.9829|2.9829	0.05958|0.05958	0.4954:0.0:0.2995:0.2051|0.4954:0.0:0.2995:0.2051	.|.	.|342;328	.|Q8NBV8;A6NCR4	.|SYT8_HUMAN;.	H|I	340|342;328	.|ENSP00000371394:V342I;ENSP00000343691:V328I	.|ENSP00000343691:V328I	R|V	+|+	2|1	0|0	SYT8|SYT8	1815055|1815055	0.059000|0.059000	0.20769|0.20769	0.428000|0.428000	0.26697|0.26697	0.031000|0.031000	0.12232|0.12232	0.511000|0.511000	0.22739|0.22739	0.353000|0.353000	0.24079|0.24079	-0.436000|-0.436000	0.05848|0.05848	CGT|GTA	G|0.998;A|0.002		0.692	SYT8-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000025013.4		
DNHD1	144132	broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	6550209	6550209	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr11:6550209G>A	ENST00000527990.2	+	10	2205	c.2205G>A	c.(2203-2205)atG>atA	p.M735I	DNHD1_ENST00000254579.6_Missense_Mutation_p.M735I			Q96M86	DNHD1_HUMAN	dynein heavy chain domain 1	735					microtubule-based movement (GO:0007018)	dynein complex (GO:0030286)|extracellular vesicular exosome (GO:0070062)	microtubule motor activity (GO:0003777)			NS(1)|autonomic_ganglia(1)|breast(4)|endometrium(13)|kidney(6)|large_intestine(11)|lung(14)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	55		Medulloblastoma(188;0.00776)|all_neural(188;0.0652)|Breast(177;0.171)		Epithelial(150;3.93e-08)|BRCA - Breast invasive adenocarcinoma(625;0.13)		TGGAAGACATGAGAGGTGGTC	0.532																																					p.M735I		.											.	DNHD1-24	0			c.G2205A						.						123.0	117.0	119.0					11																	6550209		692	1591	2283	SO:0001583	missense	144132	exon12			AGACATGAGAGGT	AK128064	CCDS44532.1, CCDS7767.1	11p15.4	2011-02-10		2005-11-28	ENSG00000179532	ENSG00000179532			26532	protein-coding gene	gene with protein product			"""chromosome 11 open reading frame 47"", ""dynein heavy chain domain 1-like"", ""coiled-coil domain containing 35"""	DHCD1, C11orf47, DNHD1L, CCDC35		12975309	Standard	NM_173589		Approved	FLJ32752, FLJ46184, FLJ35709, DKFZp686J0796	uc001mdw.4	Q96M86	OTTHUMG00000133403	ENST00000527990.2:c.2205G>A	11.37:g.6550209G>A	ENSP00000436180:p.Met735Ile	Somatic	142	2		WXS	Illumina GAIIx	Phase_I	149	128	NM_144666	0	0	0	0	0	Q2NKK8|Q6UWI9|Q8NAA2|Q8TEE6|Q9NSZ9	Missense_Mutation	SNP	ENST00000527990.2	37	CCDS44532.1	.	.	.	.	.	.	.	.	.	.	G	3.269	-0.149610	0.06585	.	.	ENSG00000179532	ENST00000254579;ENST00000527990;ENST00000534210	T;T	0.25912	1.77;1.77	5.3	4.39	0.52855	.	.	.	.	.	T	0.18299	0.0439	L	0.29908	0.895	0.24162	N	0.995657	B	0.14438	0.01	B	0.10450	0.005	T	0.21621	-1.0240	9	0.20519	T	0.43	.	9.94	0.41574	0.0939:0.0:0.9061:0.0	.	735	Q96M86	DNHD1_HUMAN	I	735;735;1	ENSP00000254579:M735I;ENSP00000436180:M735I	ENSP00000254579:M735I	M	+	3	0	DNHD1	6506785	0.996000	0.38824	0.981000	0.43875	0.053000	0.15095	1.449000	0.35123	1.236000	0.43740	-0.145000	0.13849	ATG	.		0.532	DNHD1-007	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000384673.2	NM_144666	
RNF141	50862	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	11	10540661	10540663	+	In_Frame_Del	DEL	CTC	CTC	-	rs377654959|rs139943988|rs140916965	byFrequency	TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10	CTC	CTC	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr11:10540661_10540663delCTC	ENST00000265981.2	-	5	602_604	c.460_462delGAG	c.(460-462)gagdel	p.E154del	RNF141_ENST00000528665.1_In_Frame_Del_p.E154del	NM_016422.3	NP_057506.2	Q8WVD5	RN141_HUMAN	ring finger protein 141	154					protein autoubiquitination (GO:0051865)|regulation of transcription, DNA-templated (GO:0006355)		DNA binding (GO:0003677)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(1)|endometrium(2)|large_intestine(2)|lung(3)|urinary_tract(1)	9				all cancers(16;4.63e-08)|Epithelial(150;1.38e-07)|BRCA - Breast invasive adenocarcinoma(625;0.064)		AGATACAACACTCCTCCTCATCG	0.414																																					p.154_154del	Ovarian(8;377 410 25844 26058 41491)	.											.	RNF141-226	0			c.460_462del						.																																			SO:0001651	inframe_deletion	50862	exon5			ACAACACTCCTCC	AF214680	CCDS7803.1	11p15.3	2013-01-09			ENSG00000110315	ENSG00000110315		"""RING-type (C3HC4) zinc fingers"""	21159	protein-coding gene	gene with protein product						11672448	Standard	NM_016422		Approved	ZFP26, ZNF230	uc001mis.1	Q8WVD5		ENST00000265981.2:c.460_462delGAG	11.37:g.10540667_10540669delCTC	ENSP00000265981:p.Glu154del	Somatic	34	0		WXS	Illumina GAIIx	Phase_I	44	35	NM_016422	0	0	0	0	0	A8K149|Q9NZB4	In_Frame_Del	DEL	ENST00000265981.2	37	CCDS7803.1																																																																																			.		0.414	RNF141-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385888.1	NM_016422	
KCNJ11	3767	bcgsc.ca	37	11	17409071	17409071	+	Missense_Mutation	SNP	C	C	T	rs77131926	byFrequency	TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr11:17409071C>T	ENST00000339994.4	-	1	1135	c.568G>A	c.(568-570)Gcc>Acc	p.A190T	KCNJ11_ENST00000528731.1_Missense_Mutation_p.A103T|KCNJ11_ENST00000526747.1_5'Flank	NM_000525.3	NP_000516.3	Q14654	KCJ11_HUMAN	potassium inwardly-rectifying channel, subfamily J, member 11	190					cellular response to glucose stimulus (GO:0071333)|cellular response to nicotine (GO:0071316)|cellular response to tumor necrosis factor (GO:0071356)|energy reserve metabolic process (GO:0006112)|glucose metabolic process (GO:0006006)|negative regulation of insulin secretion (GO:0046676)|neurological system process (GO:0050877)|positive regulation of cation channel activity (GO:2001259)|potassium ion import (GO:0010107)|potassium ion transmembrane transport (GO:0071805)|regulation of insulin secretion (GO:0050796)|regulation of membrane potential (GO:0042391)|response to ATP (GO:0033198)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|response to ischemia (GO:0002931)|response to testosterone (GO:0033574)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)	ATP-sensitive potassium channel complex (GO:0008282)|axolemma (GO:0030673)|cell body fiber (GO:0070852)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|integral component of plasma membrane (GO:0005887)|intercalated disc (GO:0014704)|mitochondrion (GO:0005739)|myelin sheath (GO:0043209)|neuronal cell body (GO:0043025)|nuclear envelope (GO:0005635)|plasma membrane (GO:0005886)|T-tubule (GO:0030315)|voltage-gated potassium channel complex (GO:0008076)	ankyrin binding (GO:0030506)|ATP binding (GO:0005524)|ATP-activated inward rectifier potassium channel activity (GO:0015272)|ion channel binding (GO:0044325)|potassium ion binding (GO:0030955)|voltage-gated potassium channel activity (GO:0005249)			endometrium(2)|large_intestine(2)|lung(6)|ovary(1)|prostate(3)|skin(2)	16				READ - Rectum adenocarcinoma(2;0.0276)|Colorectal(2;0.0633)	Diazoxide(DB01119)|Glimepiride(DB00222)|Glyburide(DB01016)|Ibutilide(DB00308)|Levosimendan(DB00922)|Thiamylal(DB01154)|Verapamil(DB00661)|Yohimbine(DB01392)	TGGCGCAGGGCGATCACCGCA	0.592											OREG0020810	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	C|||	3	0.000599042	0.0	0.0014	5008	,	,		21929	0.0		0.002	False		,,,				2504	0.0				p.A190T		.											.	KCNJ11-91	0			c.G568A						.	C	THR/ALA,THR/ALA	2,4398	4.2+/-10.8	0,2,2198	61.0	43.0	49.0		568,307	4.0	1.0	11	dbSNP_131	49	0,8586		0,0,4293	yes	missense,missense	KCNJ11	NM_000525.3,NM_001166290.1	58,58	0,2,6491	TT,TC,CC		0.0,0.0455,0.0154	benign,benign	190/391,103/304	17409071	2,12984	2200	4293	6493	SO:0001583	missense	3767	exon1			GCAGGGCGATCAC	D50582	CCDS31436.1, CCDS53606.1	11p15.1	2011-07-05						"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Inwardly rectifying"""	6257	protein-coding gene	gene with protein product		600937				7502040, 16382105	Standard	NM_001166290		Approved	Kir6.2, BIR	uc001mna.3	Q14654		ENST00000339994.4:c.568G>A	11.37:g.17409071C>T	ENSP00000345708:p.Ala190Thr	Somatic	107	3	717	WXS	Illumina GAIIx	Phase_I	93	82	NM_000525	0	0	0	0	0	B4DWI4|E9PNK0|Q2M1H7|Q58EX3|Q8IW96	Missense_Mutation	SNP	ENST00000339994.4	37	CCDS31436.1	3	0.0013736263736263737	0	0.0	1	0.0027624309392265192	0	0.0	2	0.002638522427440633	C	13.02	2.112827	0.37242	4.55E-4	0.0	ENSG00000187486	ENST00000339994;ENST00000528731;ENST00000526912	D;D;D	0.94537	-3.45;-3.45;-3.45	5.16	3.97	0.46021	.	0.243784	0.41712	N	0.000831	D	0.89364	0.6694	L	0.44542	1.39	0.36043	D	0.84024	P	0.44578	0.838	B	0.33960	0.173	D	0.89183	0.3545	10	0.45353	T	0.12	.	11.2969	0.49284	0.0:0.8885:0.0:0.1115	.	190	B2RC52	.	T	190;103;103	ENSP00000345708:A190T;ENSP00000434755:A103T;ENSP00000432729:A103T	ENSP00000345708:A190T	A	-	1	0	KCNJ11	17365647	1.000000	0.71417	0.993000	0.49108	0.983000	0.72400	2.567000	0.45956	0.819000	0.34492	0.462000	0.41574	GCC	C|0.999;T|0.001		0.592	KCNJ11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387037.1	NM_000525	
ABCC8	6833	bcgsc.ca	37	11	17452492	17452492	+	Silent	SNP	G	G	A	rs1799857	byFrequency	TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr11:17452492G>A	ENST00000389817.3	-	12	1754	c.1686C>T	c.(1684-1686)caC>caT	p.H562H	ABCC8_ENST00000302539.4_Silent_p.H562H|ABCC8_ENST00000528202.1_5'UTR			Q09428	ABCC8_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP), member 8	562	ABC transmembrane type-1 1. {ECO:0000255|PROSITE-ProRule:PRU00441}.				carbohydrate metabolic process (GO:0005975)|energy reserve metabolic process (GO:0006112)|potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|regulation of insulin secretion (GO:0050796)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|ion channel binding (GO:0044325)|potassium ion transmembrane transporter activity (GO:0015079)|sulfonylurea receptor activity (GO:0008281)			NS(1)|breast(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(14)|lung(38)|ovary(1)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	67				READ - Rectum adenocarcinoma(2;0.0325)|Colorectal(2;0.1)	Adenosine triphosphate(DB00171)|Chlorpropamide(DB00672)|Gliclazide(DB01120)|Glimepiride(DB00222)|Glipizide(DB01067)|Gliquidone(DB01251)|Glyburide(DB01016)|Glycodiazine(DB01382)|Mitiglinide(DB01252)|Nateglinide(DB00731)|Repaglinide(DB00912)|Tolbutamide(DB01124)	AGAAGCTGACGTGGCCCACGA	0.597													A|||	2153	0.429912	0.4841	0.3516	5008	,	,		20682	0.3125		0.4404	False		,,,				2504	0.5225				p.H562H		.											.	ABCC8-91	0			c.C1686T						.	A		2081,2319	603.7+/-390.2	497,1087,616	70.0	65.0	66.0		1686	-6.9	0.6	11	dbSNP_89	66	3876,4710	606.5+/-395.1	850,2176,1267	no	coding-synonymous	ABCC8	NM_000352.3		1347,3263,1883	AA,AG,GG		45.1433,47.2955,45.8725		562/1582	17452492	5957,7029	2200	4293	6493	SO:0001819	synonymous_variant	6833	exon12			GCTGACGTGGCCC	L78207	CCDS31437.1, CCDS73264.1	11p15.1	2014-09-17			ENSG00000006071	ENSG00000006071		"""ATP binding cassette transporters / subfamily C"""	59	protein-coding gene	gene with protein product	"""sulfonylurea receptor (hyperinsulinemia)"""	600509		SUR, HRINS		7920639, 7716548	Standard	NM_000352		Approved	HI, PHHI, SUR1, MRP8, ABC36, HHF1, TNDM2	uc001mnc.3	Q09428	OTTHUMG00000166316	ENST00000389817.3:c.1686C>T	11.37:g.17452492G>A		Somatic	156	1		WXS	Illumina GAIIx	Phase_I	182	7	NM_000352	0	0	0	0	0	A6NMX8|E3UYX6|O75948|Q16583	Silent	SNP	ENST00000389817.3	37	CCDS31437.1																																																																																			G|0.566;A|0.434		0.597	ABCC8-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000389093.1	NM_000352	
HPS5	11234	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	18303703	18303703	+	Silent	SNP	C	C	T	rs558229020		TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr11:18303703C>T	ENST00000349215.3	-	22	3400	c.3123G>A	c.(3121-3123)acG>acA	p.T1041T	HPS5_ENST00000438420.2_Silent_p.T927T|HPS5_ENST00000537258.1_Silent_p.T148T|HPS5_ENST00000396253.3_Silent_p.T927T|HPS5_ENST00000352460.3_5'UTR	NM_181507.1	NP_852608.1	Q9UPZ3	HPS5_HUMAN	Hermansky-Pudlak syndrome 5	1041					blood coagulation (GO:0007596)|organelle organization (GO:0006996)|pigmentation (GO:0043473)	BLOC-2 complex (GO:0031084)				breast(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(17)|ovary(1)|pancreas(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	30						GGGCTGGCCTCGTGCTCTTGC	0.542									Hermansky-Pudlak syndrome																												p.T1041T		.											.	HPS5-133	0			c.G3123A						.						70.0	74.0	72.0					11																	18303703		2199	4293	6492	SO:0001819	synonymous_variant	11234	exon22	Familial Cancer Database	HPS, HPS1-8	TGGCCTCGTGCTC	AB023234	CCDS7836.1, CCDS7837.1	11p14	2014-06-18			ENSG00000110756	ENSG00000110756			17022	protein-coding gene	gene with protein product		607521				10231032, 10094488	Standard	NM_181507		Approved		uc001mod.1	Q9UPZ3	OTTHUMG00000166612	ENST00000349215.3:c.3123G>A	11.37:g.18303703C>T		Somatic	85	0		WXS	Illumina GAIIx	Phase_I	72	66	NM_181507	0	0	0	14	14	A8K6J8|A8K8S1|D3DQX9|D3DQY0|O95942|Q8N4U0	Silent	SNP	ENST00000349215.3	37	CCDS7836.1																																																																																			.		0.542	HPS5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390808.1	NM_181507	
BDNF	627	ucsc.edu;bcgsc.ca	37	11	27681195	27681195	+	5'UTR	SNP	T	T	C	rs376982344|rs200712840|rs5790661|rs202011320	byFrequency	TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr11:27681195T>C	ENST00000525528.1	-	0	10				BDNF-AS_ENST00000532965.1_RNA|BDNF_ENST00000525950.1_Intron|BDNF-AS_ENST00000499008.3_RNA|BDNF_ENST00000533131.1_Intron|BDNF-AS_ENST00000500662.2_RNA|BDNF_ENST00000356660.4_Intron|BDNF_ENST00000439476.2_5'UTR|BDNF-AS_ENST00000502161.2_RNA|BDNF_ENST00000533246.1_Intron|BDNF_ENST00000395986.2_Intron|BDNF-AS_ENST00000499568.2_RNA|BDNF_ENST00000395978.3_Intron|BDNF_ENST00000395981.3_Intron|BDNF_ENST00000584049.1_Intron|BDNF-AS_ENST00000530313.1_RNA|BDNF_ENST00000420794.1_Intron|BDNF_ENST00000395980.2_Intron|BDNF_ENST00000418212.1_Intron|BDNF_ENST00000395983.3_Intron|BDNF-AS_ENST00000501176.2_RNA|BDNF_ENST00000314915.6_Intron|BDNF-AS_ENST00000530686.1_RNA|BDNF_ENST00000532997.1_Intron|BDNF_ENST00000530861.1_Intron|BDNF_ENST00000438929.1_Intron	NM_170735.5	NP_733931.1	P23560	BDNF_HUMAN	brain-derived neurotrophic factor						axon extension (GO:0048675)|axon guidance (GO:0007411)|axon target recognition (GO:0007412)|behavioral fear response (GO:0001662)|chronic inflammatory response (GO:0002544)|circadian rhythm (GO:0007623)|dendrite development (GO:0016358)|dendrite extension (GO:0097484)|feeding behavior (GO:0007631)|gamma-aminobutyric acid signaling pathway (GO:0007214)|glutamate secretion (GO:0014047)|inner ear development (GO:0048839)|learning or memory (GO:0007611)|mechanoreceptor differentiation (GO:0042490)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of striated muscle tissue development (GO:0045843)|negative regulation of synaptic transmission, GABAergic (GO:0032229)|nerve development (GO:0021675)|nervous system development (GO:0007399)|neuron recognition (GO:0008038)|positive regulation of long-term neuronal synaptic plasticity (GO:0048170)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of synapse assembly (GO:0051965)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of retinal cell programmed cell death (GO:0046668)|regulation of short-term neuronal synaptic plasticity (GO:0048172)|response to anesthetic (GO:0072347)|response to fluoxetine (GO:0014076)|response to hormone (GO:0009725)|response to hyperoxia (GO:0055093)|response to hypoxia (GO:0001666)|response to vitamin A (GO:0033189)|taste bud development (GO:0061193)|ureteric bud development (GO:0001657)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|perinuclear region of cytoplasm (GO:0048471)|synaptic vesicle (GO:0008021)	growth factor activity (GO:0008083)			breast(1)|large_intestine(3)|lung(2)	6						tgtgtgtgtgtgcgcgcgcgc	0.438													T|||	31	0.0061901	0.0159	0.0029	5008	,	,		15764	0.0		0.006	False		,,,				2504	0.002				.		.											.	BDNF-514	0			.						.																																			SO:0001623	5_prime_UTR_variant	627	.			TGTGTGTGCGCGC	AB038670	CCDS7865.1, CCDS7866.1, CCDS44558.1, CCDS41628.1	11p14.1	2014-01-30			ENSG00000176697	ENSG00000176697		"""Endogenous ligands"""	1033	protein-coding gene	gene with protein product	"""neurotrophin"""	113505				2236018, 1889806, 17942328, 17493809	Standard	NM_170731		Approved		uc009yje.3	P23560	OTTHUMG00000178797	ENST00000525528.1:c.-1084A>G	11.37:g.27681195T>C		Somatic	39	1		WXS	Illumina GAIIx	Phase_I	38	34	.	0	0	3	3	0	A7LA85|A7LA92|D3DQZ2|Q598Q1|Q6DN19|Q6YNR2|Q6YNR3|Q9BYY7|Q9UC24	Splice_Site	SNP	ENST00000525528.1	37	CCDS7866.1																																																																																			.		0.438	BDNF-016	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000388135.1	NM_170735	
SLC39A13	91252	broad.mit.edu	37	11	47433996	47433996	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr11:47433996G>A	ENST00000362021.4	+	4	557	c.515G>A	c.(514-516)aGc>aAc	p.S172N	SLC39A13_ENST00000524928.1_Missense_Mutation_p.S172N|SLC39A13_ENST00000533076.1_Missense_Mutation_p.S172N|SLC39A13_ENST00000354884.4_Missense_Mutation_p.S172N|SLC39A13_ENST00000529740.1_3'UTR	NM_001128225.2	NP_001121697	Q96H72	S39AD_HUMAN	solute carrier family 39 (zinc transporter), member 13	172					cellular zinc ion homeostasis (GO:0006882)|connective tissue development (GO:0061448)|zinc ion transmembrane transport (GO:0071577)	Golgi apparatus (GO:0005794)|integral component of Golgi membrane (GO:0030173)|integral component of membrane (GO:0016021)|perinuclear region of cytoplasm (GO:0048471)	protein homodimerization activity (GO:0042803)|zinc ion transmembrane transporter activity (GO:0005385)			breast(1)|kidney(1)|lung(1)|prostate(1)	4				Lung(87;0.0936)		TTCCTGGACAGCAAGGAGGAG	0.632											OREG0020959	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.S172N		.											.	SLC39A13-90	0			c.G515A						.						60.0	54.0	56.0					11																	47433996		2201	4298	6499	SO:0001583	missense	91252	exon4			TGGACAGCAAGGA		CCDS7934.1, CCDS44592.1	11p11.2	2013-05-22			ENSG00000165915	ENSG00000165915		"""Solute carriers"""	20859	protein-coding gene	gene with protein product		608735	"""solute carrier family 39 (metal ion transporter), member 13"""			12659941	Standard	NM_001128225		Approved	FLJ25785	uc009ylq.3	Q96H72	OTTHUMG00000166890	ENST00000362021.4:c.515G>A	11.37:g.47433996G>A	ENSP00000354689:p.Ser172Asn	Somatic	141	0	946	WXS	Illumina GAIIx	Phase_I	129	4	NM_152264	0	0	31	31	0	D3DQR6|D3DQR7|E9PLY1|E9PQV3|Q659D9|Q8N7C9|Q8WV10	Missense_Mutation	SNP	ENST00000362021.4	37	CCDS44592.1	.	.	.	.	.	.	.	.	.	.	G	12.32	1.902267	0.33628	.	.	ENSG00000165915	ENST00000533076;ENST00000531419;ENST00000531865;ENST00000362021;ENST00000354884;ENST00000526614;ENST00000524928	T;T;T;T;T;T;T	0.72167	0.82;0.87;-0.63;0.82;0.82;0.82;0.82	4.77	3.86	0.44501	.	0.486125	0.25208	N	0.032340	T	0.64951	0.2645	L	0.57536	1.79	0.37809	D	0.927963	B;B;P	0.48589	0.044;0.006;0.912	B;B;P	0.45794	0.027;0.016;0.493	T	0.63506	-0.6622	10	0.17369	T	0.5	-13.7147	7.4286	0.27113	0.2736:0.0:0.7264:0.0	.	172;172;172	Q96H72;Q96H72-2;E9PNE7	S39AD_HUMAN;.;.	N	172	ENSP00000434290:S172N;ENSP00000432302:S172N;ENSP00000434684:S172N;ENSP00000354689:S172N;ENSP00000346956:S172N;ENSP00000432499:S172N;ENSP00000437186:S172N	ENSP00000346956:S172N	S	+	2	0	SLC39A13	47390572	1.000000	0.71417	1.000000	0.80357	0.908000	0.53690	1.815000	0.38981	1.228000	0.43614	0.462000	0.41574	AGC	.		0.632	SLC39A13-012	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000395652.1	NM_152264	
PGA5	5222	ucsc.edu;bcgsc.ca;mdanderson.org	37	11	61018642	61018642	+	Silent	SNP	C	C	T	rs12280940	byFrequency	TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr11:61018642C>T	ENST00000312403.5	+	9	1241	c.1056C>T	c.(1054-1056)aaC>aaT	p.N352N	PGA4_ENST00000422676.2_Silent_p.N352N|PGA5_ENST00000451616.2_Silent_p.N198N|PGA5_ENST00000541528.1_Silent_p.N92N|CTD-2331C18.5_ENST00000537594.1_RNA	NM_014224.2	NP_055039.1	P0DJD9	PEPA5_HUMAN	pepsinogen 5, group I (pepsinogen A)	352					digestion (GO:0007586)	extracellular vesicular exosome (GO:0070062)	aspartic-type endopeptidase activity (GO:0004190)			large_intestine(1)|skin(1)	2						AGGGCATGAACGTCCCCACCG	0.572													c|||	508	0.101438	0.3177	0.0216	5008	,	,		17841	0.001		0.0109	False		,,,				2504	0.0624				p.N352N		.											.	PGA5-91	0			c.C1056T						.	C		1120,3284	400.4+/-331.6	165,790,1247	174.0	165.0	168.0		1056	0.7	0.0	11	dbSNP_120	168	39,8559	25.1+/-72.6	0,39,4260	no	coding-synonymous	PGA5	NM_014224.2		165,829,5507	TT,TC,CC		0.4536,25.4314,8.914		352/389	61018642	1159,11843	2202	4299	6501	SO:0001819	synonymous_variant	5222	exon9			CATGAACGTCCCC	BC029055	CCDS8001.1	11q13	2012-10-02			ENSG00000256713	ENSG00000256713	3.4.23.1		8887	protein-coding gene	gene with protein product		169730					Standard	NM_014224		Approved		uc001nqz.3	P0DJD9	OTTHUMG00000168075	ENST00000312403.5:c.1056C>T	11.37:g.61018642C>T		Somatic	462	1		WXS	Illumina GAIIx	Phase_I	524	103	NM_014224	0	0	0	0	0	A8K749|B7ZW62|B7ZW75|P00790|Q7M4R0|Q8N1E3	Silent	SNP	ENST00000312403.5	37	CCDS8001.1																																																																																			C|0.912;T|0.088		0.572	PGA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000397972.1	NM_014224	
MIR194-2	406970	ucsc.edu;bcgsc.ca	37	11	64658846	64658846	+	lincRNA	SNP	A	A	T			TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr11:64658846A>T	ENST00000601517.1	-	0	0				MIR194-2_ENST00000384864.1_lincRNA|MIR192_ENST00000384915.1_RNA																							GCCCCAGATAACAGCAGCCCC	0.652																																					.		.											.	.	0			.						.						13.0	15.0	15.0					11																	64658846		1565	3578	5143			406970	.			CAGATAACAGCAG																													11.37:g.64658846A>T		Somatic	135	3		WXS	Illumina GAIIx	Phase_I	167	150	.	0	0	0	0	0		RNA	SNP	ENST00000601517.1	37																																																																																				.		0.652	RP11-665N17.4-001	KNOWN	basic	lincRNA	lincRNA	OTTHUMT00000464673.1		
DPP3	10072	broad.mit.edu	37	11	66272116	66272116	+	Missense_Mutation	SNP	C	C	T	rs147163996	byFrequency	TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr11:66272116C>T	ENST00000360510.2	+	17	1977	c.1912C>T	c.(1912-1914)Cgg>Tgg	p.R638W	DPP3_ENST00000541961.1_Missense_Mutation_p.R638W|DPP3_ENST00000530165.1_Missense_Mutation_p.R608W|DPP3_ENST00000532677.1_Missense_Mutation_p.R657W|DPP3_ENST00000453114.1_Missense_Mutation_p.R638W|DPP3_ENST00000531863.1_Missense_Mutation_p.R658W			Q9NY33	DPP3_HUMAN	dipeptidyl-peptidase 3	638					proteolysis (GO:0006508)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	dipeptidyl-peptidase activity (GO:0008239)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(8)|ovary(1)|prostate(1)|skin(2)|stomach(1)	23						GGCCGGAGGGCGGGCCCTGTA	0.602													C|||	2	0.000399361	0.0	0.0029	5008	,	,		17981	0.0		0.0	False		,,,				2504	0.0				p.R638W		.											.	DPP3-46	0			c.C1912T						.	C	TRP/ARG,TRP/ARG	0,4400		0,0,2200	90.0	81.0	84.0		1912,1912	2.5	1.0	11	dbSNP_134	84	2,8588	2.2+/-6.3	0,2,4293	no	missense,missense	DPP3	NM_005700.3,NM_130443.2	101,101	0,2,6493	TT,TC,CC		0.0233,0.0,0.0154	probably-damaging,probably-damaging	638/738,638/738	66272116	2,12988	2200	4295	6495	SO:0001583	missense	10072	exon17			GGAGGGCGGGCCC	AB017970	CCDS8141.1, CCDS58147.1	11q12-q13.1	2008-02-05	2006-01-12		ENSG00000254986	ENSG00000254986	3.4.14.4		3008	protein-coding gene	gene with protein product		606818	"""dipeptidylpeptidase III"", ""dipeptidylpeptidase 3"""			10773679	Standard	NM_005700		Approved		uc001oif.2	Q9NY33	OTTHUMG00000167143	ENST00000360510.2:c.1912C>T	11.37:g.66272116C>T	ENSP00000353701:p.Arg638Trp	Somatic	66	0		WXS	Illumina GAIIx	Phase_I	63	3	NM_130443	0	0	18	19	1	B2RDB5|B4DLX4|F5H8L6|O95748|Q969H2|Q9BV67|Q9HAL6	Missense_Mutation	SNP	ENST00000360510.2	37	CCDS8141.1	.	.	.	.	.	.	.	.	.	.	C	17.33	3.361725	0.61403	0.0	2.33E-4	ENSG00000254986	ENST00000531863;ENST00000532677;ENST00000360510;ENST00000453114;ENST00000541961;ENST00000530165;ENST00000543807;ENST00000347422	T;T;T;T;T;T	0.23552	1.9;1.9;1.9;1.9;1.9;1.9	5.57	2.53	0.30540	.	0.000000	0.85682	D	0.000000	T	0.48660	0.1512	M	0.77486	2.375	0.47183	D	0.999348	D;D	0.89917	1.0;0.999	D;D	0.67725	0.95;0.953	T	0.51450	-0.8704	10	0.87932	D	0	.	12.8941	0.58089	0.4241:0.5759:0.0:0.0	.	657;638	G3V1D3;Q9NY33	.;DPP3_HUMAN	W	658;657;638;638;638;608;536;218	ENSP00000432782:R658W;ENSP00000435284:R657W;ENSP00000353701:R638W;ENSP00000389943:R638W;ENSP00000440502:R638W;ENSP00000436941:R608W	ENSP00000309957:R218W	R	+	1	2	DPP3	66028692	0.714000	0.27936	0.989000	0.46669	0.721000	0.41392	0.250000	0.18235	0.272000	0.22027	0.543000	0.68304	CGG	C|1.000;T|0.000		0.602	DPP3-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393424.2		
CCS	9973	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	66361154	66361154	+	Silent	SNP	C	C	T	rs543925670		TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr11:66361154C>T	ENST00000533244.1	+	2	522	c.81C>T	c.(79-81)gaC>gaT	p.D27D	CCDC87_ENST00000333861.3_5'Flank|CCS_ENST00000310190.4_Silent_p.D8D	NM_005125.1	NP_005116.1	O14618	CCS_HUMAN	copper chaperone for superoxide dismutase	27	HMA. {ECO:0000255|PROSITE- ProRule:PRU00280}.				copper ion transmembrane transport (GO:0035434)|intracellular copper ion transport (GO:0015680)|positive regulation of oxidoreductase activity (GO:0051353)|removal of superoxide radicals (GO:0019430)|superoxide metabolic process (GO:0006801)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	copper ion binding (GO:0005507)|copper ion transmembrane transporter activity (GO:0005375)|protein disulfide oxidoreductase activity (GO:0015035)|superoxide dismutase activity (GO:0004784)|zinc ion binding (GO:0008270)			breast(2)|cervix(1)|large_intestine(2)|lung(3)|stomach(1)	9						GCTGTGTGGACGCGGTGCGCA	0.567													C|||	1	0.000199681	0.0	0.0	5008	,	,		18983	0.0		0.0	False		,,,				2504	0.001				p.D27D		.											.	CCS-90	0			c.C81T						.						86.0	76.0	79.0					11																	66361154		2200	4295	6495	SO:0001819	synonymous_variant	9973	exon2			TGTGGACGCGGTG	AF002210	CCDS8146.1	11q13.2	2012-09-20			ENSG00000173992	ENSG00000173992			1613	protein-coding gene	gene with protein product		603864				9295278	Standard	NM_005125		Approved		uc001oir.3	O14618	OTTHUMG00000167238	ENST00000533244.1:c.81C>T	11.37:g.66361154C>T		Somatic	99	1		WXS	Illumina GAIIx	Phase_I	98	89	NM_005125	0	0	1	29	28	Q2M366|Q8NEV0	Silent	SNP	ENST00000533244.1	37	CCDS8146.1																																																																																			.		0.567	CCS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393826.1	NM_005125	
MYO7A	4647	broad.mit.edu;bcgsc.ca	37	11	76900479	76900479	+	Silent	SNP	C	C	T			TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr11:76900479C>T	ENST00000409709.3	+	28	3866	c.3594C>T	c.(3592-3594)tgC>tgT	p.C1198C	MYO7A_ENST00000458637.2_Silent_p.C1198C|MYO7A_ENST00000409619.2_Silent_p.C1187C	NM_000260.3	NP_000251.3	Q13402	MYO7A_HUMAN	myosin VIIA	1198	MyTH4 1. {ECO:0000255|PROSITE- ProRule:PRU00359}.				actin filament-based movement (GO:0030048)|auditory receptor cell stereocilium organization (GO:0060088)|equilibrioception (GO:0050957)|eye photoreceptor cell development (GO:0042462)|intracellular protein transport (GO:0006886)|lysosome organization (GO:0007040)|metabolic process (GO:0008152)|phagolysosome assembly (GO:0001845)|pigment granule transport (GO:0051904)|post-embryonic organ morphogenesis (GO:0048563)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	apical plasma membrane (GO:0016324)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|lysosomal membrane (GO:0005765)|melanosome (GO:0042470)|myosin VII complex (GO:0031477)|photoreceptor connecting cilium (GO:0032391)|photoreceptor inner segment (GO:0001917)|photoreceptor outer segment (GO:0001750)|stereocilium (GO:0032420)|synapse (GO:0045202)	actin filament binding (GO:0051015)|actin-dependent ATPase activity (GO:0030898)|ADP binding (GO:0043531)|ATP binding (GO:0005524)|calmodulin binding (GO:0005516)|microfilament motor activity (GO:0000146)|spectrin binding (GO:0030507)			NS(2)|breast(2)|central_nervous_system(1)|endometrium(7)|kidney(1)|large_intestine(10)|lung(32)|ovary(4)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	64						TGTCTCTCTGCGTGGGCTGTT	0.627																																					p.C1198C		.											.	MYO7A-138	0			c.C3594T						.						90.0	100.0	96.0					11																	76900479		2016	4155	6171	SO:0001819	synonymous_variant	4647	exon28			TCTCTGCGTGGGC	U39226	CCDS53683.1, CCDS53684.1, CCDS53685.1	11q13.5	2013-01-08	2005-09-12		ENSG00000137474	ENSG00000137474		"""A-kinase anchor proteins"", ""Myosins / Myosin superfamily : Class VII"""	7606	protein-coding gene	gene with protein product		276903	"""myosin VIIA (Usher syndrome 1B (autosomal recessive, severe))"""	USH1B, DFNB2, DFNA11		8884266	Standard	NM_000260		Approved	NSRD2	uc001oyb.2	Q13402	OTTHUMG00000152822	ENST00000409709.3:c.3594C>T	11.37:g.76900479C>T		Somatic	121	1		WXS	Illumina GAIIx	Phase_I	83	5	NM_000260	0	0	0	0	0	B9A011|F8VUN5|P78427|Q13321|Q14785|Q92821|Q92822	Silent	SNP	ENST00000409709.3	37	CCDS53683.1																																																																																			.		0.627	MYO7A-001	KNOWN	non_canonical_conserved|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000328133.1	NM_000260	
CADM1	23705	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	115111112	115111112	+	Silent	SNP	G	G	A	rs138296059		TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr11:115111112G>A	ENST00000452722.3	-	2	173	c.153C>T	c.(151-153)gaC>gaT	p.D51D	CADM1_ENST00000537058.1_Silent_p.D51D|CADM1_ENST00000331581.6_Silent_p.D51D|CADM1_ENST00000542447.2_Silent_p.D51D|CADM1_ENST00000537140.1_5'UTR|CADM1_ENST00000536727.1_Silent_p.D51D	NM_014333.3	NP_055148.3			cell adhesion molecule 1											cervix(1)|endometrium(4)|kidney(4)|large_intestine(11)|lung(9)|ovary(2)|skin(1)	32	all_hematologic(175;0.0628)	all_cancers(61;2.98e-14)|all_epithelial(67;2.64e-08)|all_hematologic(158;0.000154)|Melanoma(852;0.000952)|Acute lymphoblastic leukemia(157;0.00101)|Breast(348;0.0102)|Medulloblastoma(222;0.0429)|Prostate(24;0.145)|all_neural(223;0.237)		BRCA - Breast invasive adenocarcinoma(274;5.01e-06)|Epithelial(105;0.000305)|all cancers(92;0.00303)		TCACTGTCACGTCTTTCGTAA	0.418																																					p.D51D		.											.	CADM1-92	0			c.C153T						.	G	,	0,4402		0,0,2201	93.0	86.0	88.0		153,153	1.5	1.0	11	dbSNP_134	88	1,8591	1.2+/-3.3	0,1,4295	no	coding-synonymous,coding-synonymous	CADM1	NM_001098517.1,NM_014333.3	,	0,1,6496	AA,AG,GG		0.0116,0.0,0.0077	,	51/415,51/443	115111112	1,12993	2201	4296	6497	SO:0001819	synonymous_variant	23705	exon2			TGTCACGTCTTTC	AB017563	CCDS8373.1, CCDS53711.1, CCDS73397.1, CCDS73398.1, CCDS73399.1	11q23.2	2013-01-29	2007-02-07	2007-02-07	ENSG00000182985	ENSG00000182985		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5951	protein-coding gene	gene with protein product	"""nectin-like 2"""	605686	"""tumor suppressor in lung cancer 1"", ""immunoglobulin superfamily, member 4"""	TSLC1, IGSF4		10610705	Standard	NM_014333		Approved	NECL2, ST17, BL2, SYNCAM, IGSF4A, Necl-2, SYNCAM1, RA175	uc001ppi.4	Q9BY67	OTTHUMG00000168202	ENST00000452722.3:c.153C>T	11.37:g.115111112G>A		Somatic	96	0		WXS	Illumina GAIIx	Phase_I	86	34	NM_014333	0	0	8	14	6		Silent	SNP	ENST00000452722.3	37	CCDS8373.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	9.009|9.009	0.982092|0.982092	0.18889|0.18889	0.0|0.0	1.16E-4|1.16E-4	ENSG00000182985|ENSG00000182985	ENST00000545380|ENST00000543249	.|.	.|.	.|.	5.97|5.97	1.55|1.55	0.23275|0.23275	.|.	.|.	.|.	.|.	.|.	T|T	0.61874|0.61874	0.2382|0.2382	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|T	0.59059|0.59059	-0.7525|-0.7525	4|4	.|.	.|.	.|.	.|.	12.6831|12.6831	0.56932|0.56932	0.3169:0.0:0.6831:0.0|0.3169:0.0:0.6831:0.0	.|.	.|.	.|.	.|.	C|M	50|35	.|.	.|.	R|T	-|-	1|2	0|0	CADM1|CADM1	114616322|114616322	0.882000|0.882000	0.30256|0.30256	1.000000|1.000000	0.80357|0.80357	0.994000|0.994000	0.84299|0.84299	-0.006000|-0.006000	0.12833|0.12833	0.442000|0.442000	0.26555|0.26555	0.650000|0.650000	0.86243|0.86243	CGT|ACG	G|1.000;A|0.000		0.418	CADM1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000398753.2	NM_014333	
SIK3	23387	ucsc.edu;bcgsc.ca	37	11	116734454	116734454	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr11:116734454G>A	ENST00000292055.4	-	15	1750	c.1715C>T	c.(1714-1716)gCg>gTg	p.A572V	SIK3_ENST00000446921.2_Missense_Mutation_p.A630V|SIK3_ENST00000434315.2_Missense_Mutation_p.A471V|SIK3_ENST00000375288.1_Nonsense_Mutation_p.R4*|SIK3_ENST00000375300.1_Missense_Mutation_p.A630V|SIK3_ENST00000542607.1_Missense_Mutation_p.A572V|SIK3_ENST00000488337.1_5'UTR	NM_025164.3	NP_079440.3	Q9Y2K2	SIK3_HUMAN	SIK family kinase 3	572					protein phosphorylation (GO:0006468)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|protein serine/threonine kinase activity (GO:0004674)			breast(6)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|liver(1)|lung(18)|ovary(4)|pancreas(1)|prostate(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)	57						CTGGATGCTCGCAGCCCCATC	0.542																																					p.A572V		.											.	SIK3-919	0			c.C1715T						.						155.0	150.0	151.0					11																	116734454		2201	4296	6497	SO:0001583	missense	23387	exon15			ATGCTCGCAGCCC	AB023216	CCDS8379.1, CCDS60974.1, CCDS8379.2	11q23.3	2010-02-17			ENSG00000160584	ENSG00000160584			29165	protein-coding gene	gene with protein product		614776				10231032, 8889548	Standard	NM_025164		Approved	FLJ12240, L19, KIAA0999, QSK	uc001ppy.3	Q9Y2K2	OTTHUMG00000066628	ENST00000292055.4:c.1715C>T	11.37:g.116734454G>A	ENSP00000292055:p.Ala572Val	Somatic	196	2		WXS	Illumina GAIIx	Phase_I	214	192	NM_025164	1	0	0	5	4	A1A5A8|Q59FY2|Q5M9N1|Q6P3R6|Q8IYM8|Q9HA50	Missense_Mutation	SNP	ENST00000292055.4	37	CCDS8379.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	g|g	52|52	18.675634|18.675634	0.99909|0.99909	.|.	.|.	ENSG00000160584|ENSG00000160584	ENST00000375300;ENST00000292055;ENST00000542607;ENST00000434315|ENST00000375288	T;T;T;T|.	0.79033|.	-1.21;-1.23;-1.22;-0.74|.	5.53|5.53	5.53|5.53	0.82687|0.82687	Protein kinase-like domain (1);|.	0.000000|.	0.41097|.	U|.	0.000942|.	T|.	0.57475|.	0.2056|.	L|L	0.34521|0.34521	1.04|1.04	0.80722|0.80722	A|A	1|1	D;D;D|.	0.89917|.	1.0;1.0;1.0|.	D;D;D|.	0.85130|.	0.997;0.997;0.996|.	T|.	0.51268|.	-0.8727|.	9|.	0.72032|0.02654	D|T	0.01|1	.|.	19.4611|19.4611	0.94918|0.94918	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	572;471;572|.	A1A5A8;A1A5A9;Q9Y2K2|.	.;.;SIK3_HUMAN|.	V|X	630;572;572;471|4	ENSP00000364449:A630V;ENSP00000292055:A572V;ENSP00000438108:A572V;ENSP00000415873:A471V|.	ENSP00000292055:A572V|ENSP00000364437:R4X	A|R	-|-	2|1	0|2	SIK3|SIK3	116239664|116239664	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.994000|0.994000	0.84299|0.84299	9.476000|9.476000	0.97823|0.97823	2.592000|2.592000	0.87571|0.87571	0.561000|0.561000	0.74099|0.74099	GCG|CGA	.		0.542	SIK3-201	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		NM_025164	
KMT2A	4297	broad.mit.edu	37	11	118344186	118344186	+	Frame_Shift_Del	DEL	C	C	-			TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr11:118344186delC	ENST00000389506.5	+	3	2312	c.2312delC	c.(2311-2313)accfs	p.T771fs	KMT2A_ENST00000534358.1_Frame_Shift_Del_p.T771fs|KMT2A_ENST00000354520.4_Frame_Shift_Del_p.T771fs			Q03164	KMT2A_HUMAN	lysine (K)-specific methyltransferase 2A	771					anterior/posterior pattern specification (GO:0009952)|apoptotic process (GO:0006915)|DNA methylation (GO:0006306)|embryonic hemopoiesis (GO:0035162)|histone H3-K4 methylation (GO:0051568)|histone H3-K4 trimethylation (GO:0080182)|histone H4-K16 acetylation (GO:0043984)|negative regulation of cell proliferation (GO:0008285)|positive regulation of cellular response to drug (GO:2001040)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transporter activity (GO:0032411)|protein complex assembly (GO:0006461)|regulation of histone H3-K4 methylation (GO:0051569)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|histone methyltransferase complex (GO:0035097)|MLL1 complex (GO:0071339)|nucleus (GO:0005634)	AT DNA binding (GO:0003680)|chromatin binding (GO:0003682)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|identical protein binding (GO:0042802)|lysine-acetylated histone binding (GO:0070577)|protein homodimerization activity (GO:0042803)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)|unmethylated CpG binding (GO:0045322)|zinc ion binding (GO:0008270)										TCACCTCTCACCCCCCCGTCT	0.453																																					p.T771fs		.											.	MLL-1255	0			c.2312delC						.						197.0	169.0	178.0					11																	118344186		2200	4296	6496	SO:0001589	frameshift_variant	4297	exon3			CTCTCACCCCCCC	L04284	CCDS31686.1, CCDS55791.1	11q23	2014-09-17	2013-05-09	2013-05-09	ENSG00000118058	ENSG00000118058		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	7132	protein-coding gene	gene with protein product		159555	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax (Drosophila) homolog)"", ""myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila)"""	MLL		1720549	Standard	NM_001197104		Approved	TRX1, HRX, ALL-1, HTRX1, CXXC7, MLL1A		Q03164	OTTHUMG00000166337	ENST00000389506.5:c.2312delC	11.37:g.118344186delC	ENSP00000374157:p.Thr771fs	Somatic	128	0		WXS	Illumina GAIIx	Phase_I	119	8	NM_001197104	0	0	0	0	0	E9PQG7|Q13743|Q13744|Q14845|Q16364|Q59FF2|Q6UBD1|Q9HBJ3|Q9UD94|Q9UMA3	Frame_Shift_Del	DEL	ENST00000389506.5	37	CCDS31686.1																																																																																			.		0.453	KMT2A-015	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000399085.2	NM_005933	
KMT2A	4297	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	11	118344494	118344495	+	Frame_Shift_Del	DEL	AG	AG	-	rs369821804		TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10	AG	AG	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr11:118344494_118344495delAG	ENST00000389506.5	+	3	2620_2621	c.2620_2621delAG	c.(2620-2622)agafs	p.R874fs	KMT2A_ENST00000534358.1_Frame_Shift_Del_p.R874fs|KMT2A_ENST00000354520.4_Frame_Shift_Del_p.R874fs			Q03164	KMT2A_HUMAN	lysine (K)-specific methyltransferase 2A	874					anterior/posterior pattern specification (GO:0009952)|apoptotic process (GO:0006915)|DNA methylation (GO:0006306)|embryonic hemopoiesis (GO:0035162)|histone H3-K4 methylation (GO:0051568)|histone H3-K4 trimethylation (GO:0080182)|histone H4-K16 acetylation (GO:0043984)|negative regulation of cell proliferation (GO:0008285)|positive regulation of cellular response to drug (GO:2001040)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transporter activity (GO:0032411)|protein complex assembly (GO:0006461)|regulation of histone H3-K4 methylation (GO:0051569)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|histone methyltransferase complex (GO:0035097)|MLL1 complex (GO:0071339)|nucleus (GO:0005634)	AT DNA binding (GO:0003680)|chromatin binding (GO:0003682)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|identical protein binding (GO:0042802)|lysine-acetylated histone binding (GO:0070577)|protein homodimerization activity (GO:0042803)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)|unmethylated CpG binding (GO:0045322)|zinc ion binding (GO:0008270)										ggacaagagtagagagagagac	0.48																																					p.874_874del		.											.	MLL-1255	0			c.2620_2621del						.																																			SO:0001589	frameshift_variant	4297	exon3			AAGAGTAGAGAGA	L04284	CCDS31686.1, CCDS55791.1	11q23	2014-09-17	2013-05-09	2013-05-09	ENSG00000118058	ENSG00000118058		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	7132	protein-coding gene	gene with protein product		159555	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax (Drosophila) homolog)"", ""myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila)"""	MLL		1720549	Standard	NM_001197104		Approved	TRX1, HRX, ALL-1, HTRX1, CXXC7, MLL1A		Q03164	OTTHUMG00000166337	ENST00000389506.5:c.2620_2621delAG	11.37:g.118344502_118344503delAG	ENSP00000374157:p.Arg874fs	Somatic	47	0		WXS	Illumina GAIIx	Phase_I	46	38	NM_001197104	0	0	0	0	0	E9PQG7|Q13743|Q13744|Q14845|Q16364|Q59FF2|Q6UBD1|Q9HBJ3|Q9UD94|Q9UMA3	Frame_Shift_Del	DEL	ENST00000389506.5	37	CCDS31686.1																																																																																			.		0.480	KMT2A-015	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000399085.2	NM_005933	
KMT2A	4297	bcgsc.ca	37	11	118367048	118367048	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr11:118367048C>T	ENST00000389506.5	+	20	5621	c.5621C>T	c.(5620-5622)gCg>gTg	p.A1874V	KMT2A_ENST00000354520.4_Missense_Mutation_p.A1836V|KMT2A_ENST00000534358.1_Missense_Mutation_p.A1877V			Q03164	KMT2A_HUMAN	lysine (K)-specific methyltransferase 2A	1874					anterior/posterior pattern specification (GO:0009952)|apoptotic process (GO:0006915)|DNA methylation (GO:0006306)|embryonic hemopoiesis (GO:0035162)|histone H3-K4 methylation (GO:0051568)|histone H3-K4 trimethylation (GO:0080182)|histone H4-K16 acetylation (GO:0043984)|negative regulation of cell proliferation (GO:0008285)|positive regulation of cellular response to drug (GO:2001040)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transporter activity (GO:0032411)|protein complex assembly (GO:0006461)|regulation of histone H3-K4 methylation (GO:0051569)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|histone methyltransferase complex (GO:0035097)|MLL1 complex (GO:0071339)|nucleus (GO:0005634)	AT DNA binding (GO:0003680)|chromatin binding (GO:0003682)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|identical protein binding (GO:0042802)|lysine-acetylated histone binding (GO:0070577)|protein homodimerization activity (GO:0042803)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)|unmethylated CpG binding (GO:0045322)|zinc ion binding (GO:0008270)										AGACAGTGTGCGTTATGTTTG	0.433																																					p.A1877V		.											.	MLL-1255	0			c.C5630T						.						192.0	174.0	180.0					11																	118367048		2200	4296	6496	SO:0001583	missense	4297	exon20			AGTGTGCGTTATG	L04284	CCDS31686.1, CCDS55791.1	11q23	2014-09-17	2013-05-09	2013-05-09	ENSG00000118058	ENSG00000118058		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	7132	protein-coding gene	gene with protein product		159555	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax (Drosophila) homolog)"", ""myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila)"""	MLL		1720549	Standard	NM_001197104		Approved	TRX1, HRX, ALL-1, HTRX1, CXXC7, MLL1A		Q03164	OTTHUMG00000166337	ENST00000389506.5:c.5621C>T	11.37:g.118367048C>T	ENSP00000374157:p.Ala1874Val	Somatic	128	3		WXS	Illumina GAIIx	Phase_I	123	110	NM_001197104	0	0	0	0	0	E9PQG7|Q13743|Q13744|Q14845|Q16364|Q59FF2|Q6UBD1|Q9HBJ3|Q9UD94|Q9UMA3	Missense_Mutation	SNP	ENST00000389506.5	37	CCDS31686.1	.	.	.	.	.	.	.	.	.	.	C	17.12	3.307219	0.60305	.	.	ENSG00000118058	ENST00000534358;ENST00000389506;ENST00000354520;ENST00000359313	D;D;D	0.82255	-1.59;-1.59;-1.57	5.43	5.43	0.79202	.	0.126178	0.53938	D	0.000054	T	0.75102	0.3804	L	0.41824	1.3	0.52501	D	0.999953	P;P	0.47762	0.717;0.9	B;B	0.33960	0.173;0.166	T	0.76225	-0.3037	10	0.32370	T	0.25	.	19.2491	0.93914	0.0:1.0:0.0:0.0	.	1877;1874	E9PQG7;Q03164	.;MLL1_HUMAN	V	1877;1874;1836;784	ENSP00000436786:A1877V;ENSP00000374157:A1874V;ENSP00000346516:A1836V	ENSP00000346516:A1836V	A	+	2	0	MLL	117872258	0.996000	0.38824	0.957000	0.39632	0.753000	0.42808	3.393000	0.52544	2.564000	0.86499	0.305000	0.20034	GCG	.		0.433	KMT2A-015	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000399085.2	NM_005933	
CCDC77	84318	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	539878	539878	+	Missense_Mutation	SNP	A	A	C			TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr12:539878A>C	ENST00000239830.4	+	7	738	c.559A>C	c.(559-561)Agt>Cgt	p.S187R	CCDC77_ENST00000540180.1_Missense_Mutation_p.S155R|CCDC77_ENST00000422000.1_Missense_Mutation_p.S155R|CCDC77_ENST00000540344.1_3'UTR|CCDC77_ENST00000412006.2_Missense_Mutation_p.S155R	NM_032358.3	NP_115734.1	Q9BR77	CCD77_HUMAN	coiled-coil domain containing 77	187						centrosome (GO:0005813)|membrane (GO:0016020)				cervix(1)|endometrium(1)|large_intestine(5)|liver(2)|lung(6)|ovary(1)|skin(2)|urinary_tract(1)	19	all_cancers(10;0.0149)|all_epithelial(11;0.035)|all_lung(10;0.111)|Ovarian(42;0.142)|Lung NSC(10;0.156)		OV - Ovarian serous cystadenocarcinoma(31;0.00123)|BRCA - Breast invasive adenocarcinoma(9;0.033)			ATGTGAGCAGAGTGAATCTTC	0.413																																					p.S187R		.											.	CCDC77-91	0			c.A559C						.						135.0	130.0	131.0					12																	539878		2203	4300	6503	SO:0001583	missense	84318	exon7			GAGCAGAGTGAAT	AK027638	CCDS8503.1, CCDS44781.1	12p13.33	2006-02-16			ENSG00000120647	ENSG00000120647			28203	protein-coding gene	gene with protein product						12477932	Standard	NM_001130148		Approved	MGC13183	uc001qig.3	Q9BR77	OTTHUMG00000129214	ENST00000239830.4:c.559A>C	12.37:g.539878A>C	ENSP00000239830:p.Ser187Arg	Somatic	94	0		WXS	Illumina GAIIx	Phase_I	169	77	NM_032358	0	0	3	8	5	B4DDE8	Missense_Mutation	SNP	ENST00000239830.4	37	CCDS8503.1	.	.	.	.	.	.	.	.	.	.	A	7.892	0.732621	0.15507	.	.	ENSG00000120647	ENST00000540180;ENST00000422000;ENST00000543504;ENST00000239830;ENST00000412006	T;T;T;T;T	0.30448	1.53;1.53;1.53;1.53;1.53	4.08	2.92	0.33932	.	0.626869	0.15678	N	0.250048	T	0.17874	0.0429	N	0.19112	0.55	0.20638	N	0.999873	B	0.26195	0.144	B	0.18871	0.023	T	0.15809	-1.0424	10	0.33141	T	0.24	-4.3436	8.8525	0.35208	0.9042:0.0:0.0958:0.0	.	187	Q9BR77	CCD77_HUMAN	R	155;155;155;187;155	ENSP00000440554:S155R;ENSP00000391870:S155R;ENSP00000445873:S155R;ENSP00000239830:S187R;ENSP00000412925:S155R	ENSP00000239830:S187R	S	+	1	0	CCDC77	410139	0.998000	0.40836	0.085000	0.20634	0.245000	0.25701	3.558000	0.53749	0.692000	0.31613	0.392000	0.25879	AGT	.		0.413	CCDC77-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251296.1	NM_032358	
CRACR2A	84766	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	3736625	3736625	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr12:3736625G>A	ENST00000440314.2	-	17	2382	c.1909C>T	c.(1909-1911)Cgg>Tgg	p.R637W		NM_001144958.1	NP_001138430.1	Q9BSW2	EFC4B_HUMAN		0					activation of store-operated calcium channel activity (GO:0032237)|immune system process (GO:0002376)|positive regulation of calcium ion transport (GO:0051928)|store-operated calcium entry (GO:0002115)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)			breast(1)|endometrium(3)|large_intestine(2)|liver(1)|lung(12)|ovary(1)|pancreas(2)|prostate(1)|upper_aerodigestive_tract(1)	24			OV - Ovarian serous cystadenocarcinoma(31;0.00287)|COAD - Colon adenocarcinoma(12;0.0264)			AGCCACCGCCGGACCGACAGG	0.557																																					p.R637W		.											.	EFCAB4B-92	0			c.C1909T						.						60.0	65.0	64.0					12																	3736625		692	1591	2283	SO:0001583	missense	84766	exon17			ACCGCCGGACCGA																												ENST00000440314.2:c.1909C>T	12.37:g.3736625G>A	ENSP00000409382:p.Arg637Trp	Somatic	91	0		WXS	Illumina GAIIx	Phase_I	198	35	NM_001144958	0	0	0	0	0	B4E1X0|B9EK63	Missense_Mutation	SNP	ENST00000440314.2	37	CCDS44803.1	.	.	.	.	.	.	.	.	.	.	G	19.82	3.897851	0.72639	.	.	ENSG00000130038	ENST00000440314	T	0.78126	-1.15	5.54	4.64	0.57946	.	0.000000	0.85682	D	0.000000	D	0.87374	0.6161	.	.	.	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.88492	0.3076	9	0.87932	D	0	.	11.7576	0.51884	0.0:0.0:0.8238:0.1762	.	637	Q9BSW2-2	.	W	637	ENSP00000409382:R637W	ENSP00000409382:R637W	R	-	1	2	EFCAB4B	3606886	0.076000	0.21285	0.869000	0.34112	0.984000	0.73092	1.125000	0.31332	1.323000	0.45263	-0.182000	0.12963	CGG	.		0.557	EFCAB4B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398640.2		
VWF	7450	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	6219643	6219643	+	Silent	SNP	G	G	A	rs202062122		TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr12:6219643G>A	ENST00000261405.5	-	5	683	c.429C>T	c.(427-429)agC>agT	p.S143S	VWF_ENST00000572068.1_Silent_p.S180S	NM_000552.3	NP_000543	P04275	VWF_HUMAN	von Willebrand factor	143	VWFD 1. {ECO:0000255|PROSITE- ProRule:PRU00580}.				blood coagulation (GO:0007596)|blood coagulation, intrinsic pathway (GO:0007597)|cell adhesion (GO:0007155)|cell-substrate adhesion (GO:0031589)|extracellular matrix organization (GO:0030198)|hemostasis (GO:0007599)|liver development (GO:0001889)|placenta development (GO:0001890)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|protein homooligomerization (GO:0051260)|response to wounding (GO:0009611)	endoplasmic reticulum (GO:0005783)|external side of plasma membrane (GO:0009897)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|platelet alpha granule (GO:0031091)|platelet alpha granule lumen (GO:0031093)|proteinaceous extracellular matrix (GO:0005578)|Weibel-Palade body (GO:0033093)	chaperone binding (GO:0051087)|collagen binding (GO:0005518)|glycoprotein binding (GO:0001948)|identical protein binding (GO:0042802)|immunoglobulin binding (GO:0019865)|integrin binding (GO:0005178)|protease binding (GO:0002020)|protein homodimerization activity (GO:0042803)|protein N-terminus binding (GO:0047485)			NS(1)|breast(6)|central_nervous_system(5)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(25)|lung(41)|ovary(7)|pancreas(2)|prostate(6)|skin(15)|stomach(1)|upper_aerodigestive_tract(5)	129					Antihemophilic Factor(DB00025)	GAAAGTTGCCGCTGCCATCGA	0.512													G|||	1	0.000199681	0.0	0.0014	5008	,	,		20519	0.0		0.0	False		,,,				2504	0.0				p.S143S		.											.	VWF-163	0			c.C429T						.						127.0	128.0	128.0					12																	6219643		2203	4300	6503	SO:0001819	synonymous_variant	7450	exon5			GTTGCCGCTGCCA		CCDS8539.1	12p13.3	2014-09-17			ENSG00000110799	ENSG00000110799		"""Endogenous ligands"""	12726	protein-coding gene	gene with protein product		613160		F8VWF		2251280	Standard	NM_000552		Approved		uc001qnn.1	P04275	OTTHUMG00000168265	ENST00000261405.5:c.429C>T	12.37:g.6219643G>A		Somatic	148	1		WXS	Illumina GAIIx	Phase_I	315	163	NM_000552	0	0	15	15	0	Q8TCE8|Q99806	Silent	SNP	ENST00000261405.5	37	CCDS8539.1																																																																																			G|0.999;A|0.000		0.512	VWF-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399020.1	NM_000552	
IFFO1	25900	hgsc.bcm.edu;bcgsc.ca	37	12	6657974	6657974	+	Frame_Shift_Del	DEL	C	C	-			TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr12:6657974delC	ENST00000396840.2	-	5	1130	c.1089delG	c.(1087-1089)gggfs	p.G363fs	IFFO1_ENST00000465801.1_Frame_Shift_Del_p.G59fs|IFFO1_ENST00000436152.2_Frame_Shift_Del_p.G59fs|IFFO1_ENST00000356896.4_Frame_Shift_Del_p.G366fs|IFFO1_ENST00000336604.4_Frame_Shift_Del_p.G366fs			Q0D2I5	IFFO1_HUMAN	intermediate filament family orphan 1	363						intermediate filament (GO:0005882)		p.R364fs*19(1)		central_nervous_system(1)|endometrium(1)|large_intestine(4)|lung(12)|ovary(1)|upper_aerodigestive_tract(1)	20						CCCGCTTCCGCCCCCCCATGG	0.677																																					p.G374fs		.											.	IFFO1-68	1	Insertion - Frameshift(1)	large_intestine(1)	c.1122delG						.						20.0	19.0	19.0					12																	6657974		2203	4298	6501	SO:0001589	frameshift_variant	25900	exon6			CTTCCGCCCCCCC	AF124432	CCDS8550.1, CCDS41741.1, CCDS8550.2, CCDS73425.1	12p13.31	2013-01-16	2008-09-11	2008-09-11	ENSG00000010295	ENSG00000010295		"""Intermediate filament family orphans"""	24970	protein-coding gene	gene with protein product		610495	"""intermediate filament family orphan"""	IFFO		8771189, 3052284	Standard	NM_001193457		Approved	HOM-TES-103	uc010sfe.2	Q0D2I5	OTTHUMG00000141264	ENST00000396840.2:c.1089delG	12.37:g.6657974delC	ENSP00000380052:p.Gly363fs	Somatic	153	1		WXS	Illumina GAIIx	Phase_I	343	48	NM_001193457	0	0	0	0	0	Q24JT6|Q7L5J9|Q7Z5X4|Q9BQ46	Frame_Shift_Del	DEL	ENST00000396840.2	37																																																																																				.		0.677	IFFO1-008	KNOWN	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000280428.1	NM_080730	
LPAR5	57121	broad.mit.edu	37	12	6729418	6729418	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr12:6729418C>T	ENST00000329858.4	-	2	1753	c.997G>A	c.(997-999)Gaa>Aaa	p.E333K	LPAR5_ENST00000540335.1_5'Flank|LPAR5_ENST00000431922.1_Missense_Mutation_p.E333K	NM_020400.5	NP_065133.1	Q9H1C0	LPAR5_HUMAN	lysophosphatidic acid receptor 5	333						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			endometrium(2)|large_intestine(1)|lung(1)|ovary(1)|skin(2)	7						GCGGACCTTTCGGATTGCGCG	0.711																																					p.E333K	NSCLC(74;891 2312 37538)	.											.	LPAR5-70	0			c.G997A						.						36.0	28.0	30.0					12																	6729418		2195	4296	6491	SO:0001583	missense	57121	exon2			ACCTTTCGGATTG	AJ272207	CCDS8553.1	12p13.31	2012-08-08	2008-04-11	2008-04-11		ENSG00000184574		"""GPCR / Class A : Lysophospholipid receptors : Lysophosphatidic acid"""	13307	protein-coding gene	gene with protein product		606926	"""G protein-coupled receptor 92"""	GPR93, GPR92		11062477, 11574155, 16774927, 16651401	Standard	NM_020400		Approved	KPG_010, LPA5	uc009zer.2	Q9H1C0		ENST00000329858.4:c.997G>A	12.37:g.6729418C>T	ENSP00000327875:p.Glu333Lys	Somatic	33	0		WXS	Illumina GAIIx	Phase_I	72	3	NM_001142961	0	0	0	0	0		Missense_Mutation	SNP	ENST00000329858.4	37	CCDS8553.1	.	.	.	.	.	.	.	.	.	.	C	16.09	3.025337	0.54683	.	.	ENSG00000184574	ENST00000329858;ENST00000431922;ENST00000435659	T;T	0.69040	-0.37;-0.37	4.84	-0.899	0.10547	.	2.040850	0.02863	N	0.130552	T	0.45597	0.1350	N	0.08118	0	0.09310	N	1	B	0.27117	0.168	B	0.17722	0.019	T	0.28073	-1.0055	10	0.20046	T	0.44	.	11.0569	0.47925	0.0:0.3776:0.544:0.0784	.	333	Q9H1C0	LPAR5_HUMAN	K	333	ENSP00000327875:E333K;ENSP00000393098:E333K	ENSP00000327875:E333K	E	-	1	0	LPAR5	6599679	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-0.249000	0.08842	-0.046000	0.13446	-0.479000	0.04858	GAA	.		0.711	LPAR5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400699.1	NM_020400	
ZNF384	171017	hgsc.bcm.edu	37	12	6787405	6787405	+	Frame_Shift_Del	DEL	G	G	-			TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr12:6787405delG	ENST00000396801.3	-	6	781	c.574delC	c.(574-576)cggfs	p.R192fs	ZNF384_ENST00000319770.3_Frame_Shift_Del_p.R176fs|ZNF384_ENST00000361959.3_Frame_Shift_Del_p.R192fs|ZNF384_ENST00000396795.1_Frame_Shift_Del_p.R192fs|ZNF384_ENST00000355772.4_Frame_Shift_Del_p.R137fs|ZNF384_ENST00000396799.2_Frame_Shift_Del_p.R192fs	NM_001135734.2	NP_001129206.1	Q8TF68	ZN384_HUMAN	zinc finger protein 384	192					nucleocytoplasmic transport (GO:0006913)|positive regulation of protein secretion (GO:0050714)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	focal adhesion (GO:0005925)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)		EWSR1/ZNF384(4)	breast(3)|central_nervous_system(3)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(6)|prostate(1)|urinary_tract(1)	18						TTCCGGCCCCGGGGTGGCTTA	0.592			T	"""EWSR1, TAF15 """	ALL																																p.R192fs		.		Dom	yes		12	12p13	171017	zinc finger protein 384 (CIZ/NMP4)		L	.	ZNF384-1083	0			c.574delC						.						72.0	74.0	73.0					12																	6787405		2203	4300	6503	SO:0001589	frameshift_variant	171017	exon6			GGCCCCGGGGTGG	U80738	CCDS8557.1, CCDS31732.1, CCDS44817.1	12p12	2013-01-08	2002-05-23	2002-05-24		ENSG00000126746		"""Zinc fingers, C2H2-type"""	11955	protein-coding gene	gene with protein product		609951	"""trinucleotide repeat containing 1"""	TNRC1		9225980, 11149472	Standard	NM_001135734		Approved	CAGH1A, CIZ, NMP4, NP	uc010sfh.2	Q8TF68		ENST00000396801.3:c.574delC	12.37:g.6787405delG	ENSP00000380019:p.Arg192fs	Somatic	88	1		WXS	Illumina GAIIx	Phase_I	189	23	NM_133476	0	0	0	0	0	O15407|Q7Z722|Q8N938	Frame_Shift_Del	DEL	ENST00000396801.3	37	CCDS44817.1																																																																																			.		0.592	ZNF384-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400712.1		
ATN1	1822	ucsc.edu	37	12	7045912	7045912	+	Silent	SNP	G	G	A	rs144280633	byFrequency	TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr12:7045912G>A	ENST00000356654.4	+	5	1719	c.1482G>A	c.(1480-1482)caG>caA	p.Q494Q	ATN1_ENST00000396684.2_Silent_p.Q494Q	NM_001007026.1	NP_001007027.1	P54259	ATN1_HUMAN	atrophin 1	494	Poly-Gln.				cell migration (GO:0016477)|central nervous system development (GO:0007417)|maintenance of cell polarity (GO:0030011)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuron apoptotic process (GO:0051402)|toxin metabolic process (GO:0009404)|transcription, DNA-templated (GO:0006351)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|nuclear matrix (GO:0016363)|nucleus (GO:0005634)	protein domain specific binding (GO:0019904)|transcription corepressor activity (GO:0003714)			breast(5)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(15)|ovary(2)|pancreas(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(2)	40						agcagcagcagcagcagcagc	0.642																																					p.Q494Q		.											.	ATN1-139	0			c.G1482A						.						39.0	49.0	46.0					12																	7045912		2183	4256	6439	SO:0001819	synonymous_variant	1822	exon5			GCAGCAGCAGCAG	U23851	CCDS31734.1	12p	2007-08-01	2005-03-15	2005-03-17		ENSG00000111676			3033	protein-coding gene	gene with protein product		607462	"""dentatorubral-pallidoluysian atrophy (atrophin-1)"""	D12S755E, DRPLA		8136826	Standard	NM_001940		Approved	B37	uc001qrw.1	P54259		ENST00000356654.4:c.1482G>A	12.37:g.7045912G>A		Somatic	131	0		WXS	Illumina GAIIx	Phase_I	202	29	NM_001007026	4	1	3220	3285	60	Q99495|Q99621|Q9UEK7	Silent	SNP	ENST00000356654.4	37	CCDS31734.1																																																																																			G|0.972;A|0.028		0.642	ATN1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401948.2	NM_001940	
PEX5	5830	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	7356126	7356126	+	Silent	SNP	T	T	G			TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr12:7356126T>G	ENST00000455147.2	+	11	1525	c.945T>G	c.(943-945)ctT>ctG	p.L315L	PEX5_ENST00000412720.2_Silent_p.L336L|PEX5_ENST00000420616.2_Silent_p.L315L|PEX5_ENST00000266564.3_Silent_p.L307L|PEX5_ENST00000266563.5_Silent_p.L278L|PEX5_ENST00000434354.2_Silent_p.L330L	NM_001131026.1	NP_001124498.1	P50542	PEX5_HUMAN	peroxisomal biogenesis factor 5	315					cell development (GO:0048468)|cerebral cortex cell migration (GO:0021795)|cerebral cortex neuron differentiation (GO:0021895)|endoplasmic reticulum organization (GO:0007029)|fatty acid beta-oxidation (GO:0006635)|mitochondrial membrane organization (GO:0007006)|negative regulation of protein homotetramerization (GO:1901094)|neuromuscular process (GO:0050905)|neuron migration (GO:0001764)|positive regulation of multicellular organism growth (GO:0040018)|protein import into peroxisome matrix (GO:0016558)|protein import into peroxisome matrix, docking (GO:0016560)|protein import into peroxisome matrix, translocation (GO:0016561)|protein import into peroxisome membrane (GO:0045046)|protein targeting to peroxisome (GO:0006625)|protein tetramerization (GO:0051262)|very long-chain fatty acid metabolic process (GO:0000038)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|intracellular (GO:0005622)|membrane (GO:0016020)|mitochondrion (GO:0005739)|peroxisomal matrix (GO:0005782)|peroxisomal membrane (GO:0005778)|peroxisome (GO:0005777)|protein complex (GO:0043234)	enzyme binding (GO:0019899)|peroxisome matrix targeting signal-1 binding (GO:0005052)|peroxisome targeting sequence binding (GO:0000268)|protein C-terminus binding (GO:0008022)|protein N-terminus binding (GO:0047485)|small GTPase binding (GO:0031267)			breast(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(8)|ovary(1)|prostate(1)|skin(1)	21						ATGATGACCTTACGTCAGCTA	0.443																																					p.L330L		.											.	PEX5-91	0			c.T990G						.						95.0	84.0	88.0					12																	7356126		2203	4300	6503	SO:0001819	synonymous_variant	5830	exon10			TGACCTTACGTCA	U19721	CCDS8576.1, CCDS44822.1, CCDS44823.1, CCDS44824.1, CCDS73433.1	12p	2013-01-10	2004-03-17	2004-03-19		ENSG00000139197		"""Tetratricopeptide (TTC) repeat domain containing"""	9719	protein-coding gene	gene with protein product		600414	"""peroxisome receptor 1"""	PXR1			Standard	NM_000319		Approved	PTS1R	uc010sgc.2	P50542		ENST00000455147.2:c.945T>G	12.37:g.7356126T>G		Somatic	123	0		WXS	Illumina GAIIx	Phase_I	245	138	NM_001131023	0	0	8	12	4	A8K891|B4DZ45|B7ZAD5|D3DUT8|Q15115|Q15266|Q96FN7	Silent	SNP	ENST00000455147.2	37	CCDS44823.1																																																																																			.		0.443	PEX5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398611.1	NM_000319	
MAGOHB	55110	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	10766108	10766108	+	Silent	SNP	G	G	A			TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr12:10766108G>A	ENST00000320756.2	-	1	114	c.24C>T	c.(22-24)taC>taT	p.Y8Y	MAGOHB_ENST00000539554.1_Intron|MAGOHB_ENST00000381881.2_Silent_p.Y8Y	NM_018048.3	NP_060518.1	Q96A72	MGN2_HUMAN	mago-nashi homolog B (Drosophila)	8					mRNA processing (GO:0006397)|mRNA transport (GO:0051028)|RNA splicing (GO:0008380)	nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			breast(2)|large_intestine(2)	4						AGTAGCGCAGGTAGAAATCGC	0.607																																					p.Y8Y		.											.	MAGOHB-153	0			c.C24T						.						92.0	87.0	88.0					12																	10766108		2203	4300	6503	SO:0001819	synonymous_variant	55110	exon1			GCGCAGGTAGAAA		CCDS8628.1	12p13.2	2014-02-12	2008-01-24		ENSG00000111196	ENSG00000111196			25504	protein-coding gene	gene with protein product							Standard	NM_018048		Approved	FLJ10292, MGN2	uc001qyq.2	Q96A72	OTTHUMG00000168407	ENST00000320756.2:c.24C>T	12.37:g.10766108G>A		Somatic	89	0		WXS	Illumina GAIIx	Phase_I	260	107	NM_018048	0	0	13	19	6		Silent	SNP	ENST00000320756.2	37	CCDS8628.1																																																																																			.		0.607	MAGOHB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399616.1	NM_018048	
PRB3	5544	hgsc.bcm.edu	37	12	11420332	11420458	+	Frame_Shift_Del	DEL	GAGGGTGGGGGACCTTGAGGTTTGTTGCCTCCTTGTGAAGGTGGTCCTTCTGGCTTTCCTGGACGAGGTGGGGGACCTTGGGACTGGTTTCCTCCTTGTGGGGGTGGTCCTTCTGGCTTTCCTGGAC	GAGGGTGGGGGACCTTGAGGTTTGTTGCCTCCTTGTGAAGGTGGTCCTTCTGGCTTTCCTGGACGAGGTGGGGGACCTTGGGACTGGTTTCCTCCTTGTGGGGGTGGTCCTTCTGGCTTTCCTGGAC	-	rs370093235|rs528598166|rs191804141|rs369321112|rs374590900|rs200549053|rs11054202|rs201237059|rs11054201|rs12818734|rs28435564|rs28605625|rs3842295|rs71057716|rs148140654|rs377511579|rs12813039|rs113187893|rs369202988|rs12813034	byFrequency	TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10	GAGGGTGGGGGACCTTGAGGTTTGTTGCCTCCTTGTGAAGGTGGTCCTTCTGGCTTTCCTGGACGAGGTGGGGGACCTTGGGACTGGTTTCCTCCTTGTGGGGGTGGTCCTTCTGGCTTTCCTGGAC	GAGGGTGGGGGACCTTGAGGTTTGTTGCCTCCTTGTGAAGGTGGTCCTTCTGGCTTTCCTGGACGAGGTGGGGGACCTTGGGACTGGTTTCCTCCTTGTGGGGGTGGTCCTTCTGGCTTTCCTGGAC	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr12:11420332_11420458delGAGGGTGGGGGACCTTGAGGTTTGTTGCCTCCTTGTGAAGGTGGTCCTTCTGGCTTTCCTGGACGAGGTGGGGGACCTTGGGACTGGTTTCCTCCTTGTGGGGGTGGTCCTTCTGGCTTTCCTGGAC	ENST00000279573.7	-	3	860_986	c.725_851delGTCCAGGAAAGCCAGAAGGACCACCCCCACAAGGAGGAAACCAGTCCCAAGGTCCCCCACCTCGTCCAGGAAAGCCAGAAGGACCACCTTCACAAGGAGGCAACAAACCTCAAGGTCCCCCACCCTC	c.(724-852)cgtccaggaaagccagaaggaccacccccacaaggaggaaaccagtcccaaggtcccccacctcgtccaggaaagccagaaggaccaccttcacaaggaggcaacaaacctcaaggtcccccaccctcafs	p.RPGKPEGPPPQGGNQSQGPPPRPGKPEGPPSQGGNKPQGPPPS242fs	PRB3_ENST00000440870.3_5'UTR|PRB3_ENST00000381842.3_Splice_Site_p.GPGKPEGPPPQGGNQSQGPPPRPGKPEGPPSQGGNKPQGPP202fs|PRB3_ENST00000538488.1_Splice_Site_p.GPGKPEGPPPQGGNQSQGPPPRPGKPEGPPSQGGNKPQGPP202fs			Q04118	PRB3_HUMAN	proline-rich protein BstNI subfamily 3	179	10 X 21 AA tandem repeats of [RH]-P-G-K- P-[EQ]-G-[PQS]-P-[PS]-Q-[GE]-G-N-[QK]- [SP]-[QR]-[GR]-P-P-P.|Pro-rich.				defense response to Gram-negative bacterium (GO:0050829)	extracellular region (GO:0005576)		p.R221S(4)|p.G232E(2)		breast(2)|endometrium(1)|kidney(2)|large_intestine(1)|lung(13)|ovary(1)|skin(5)	25			OV - Ovarian serous cystadenocarcinoma(49;0.201)			TTTCCTGGATGAGGGTGGGGGACCTTGAGGTTTGTTGCCTCCTTGTGAAGGTGGTCCTTCTGGCTTTCCTGGACGAGGTGGGGGACCTTGGGACTGGTTTCCTCCTTGTGGGGGTGGTCCTTCTGGCTTTCCTGGACGAGGTGGGGG	0.602																																					.		.											.	PRB3-1	6	Substitution - Missense(6)	lung(6)	.						.																																			SO:0001589	frameshift_variant	5544	.			CTGGATGAGGGTG			12p13.2	2012-10-02				ENSG00000197870			9339	protein-coding gene	gene with protein product		168840				1894623	Standard	NM_006249		Approved	PRG	uc001qzs.3	Q04118		ENST00000279573.7:c.725_851delGTCCAGGAAAGCCAGAAGGACCACCCCCACAAGGAGGAAACCAGTCCCAAGGTCCCCCACCTCGTCCAGGAAAGCCAGAAGGACCACCTTCACAAGGAGGCAACAAACCTCAAGGTCCCCCACCCTC	12.37:g.11420332_11420458delGAGGGTGGGGGACCTTGAGGTTTGTTGCCTCCTTGTGAAGGTGGTCCTTCTGGCTTTCCTGGACGAGGTGGGGGACCTTGGGACTGGTTTCCTCCTTGTGGGGGTGGTCCTTCTGGCTTTCCTGGAC	ENSP00000279573:p.Arg242fs	Somatic	35	0		WXS	Illumina GAIIx	Phase_I	87	0	.	0	0	0	0	0	Q15188|Q4VAY3|Q4VAY4|Q7M4M9|Q9UCT9	Splice_Site	DEL	ENST00000279573.7	37																																																																																				.		0.602	PRB3-001	KNOWN	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000402119.5	NM_006249	
C12orf36	283422	broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	13526224	13526224	+	Missense_Mutation	SNP	G	G	T			TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr12:13526224G>T	ENST00000318426.2	-	3	548	c.331C>A	c.(331-333)Cag>Aag	p.Q111K	C12orf36_ENST00000531049.1_5'Flank|C12orf36_ENST00000527705.2_Missense_Mutation_p.Q111K					chromosome 12 open reading frame 36											lung(3)|skin(3)	6				BRCA - Breast invasive adenocarcinoma(232;0.198)		AAAGCCGTCTGTCCACTCTTC	0.478																																					.		.											.	C12orf36-90	0			.						.						227.0	215.0	219.0					12																	13526224		2203	4300	6503	SO:0001583	missense	283422	.			CCGTCTGTCCACT	AK091129		12p13.1	2012-08-14			ENSG00000180861	ENSG00000180861			26598	protein-coding gene	gene with protein product							Standard	NR_036555		Approved	FLJ33810	uc001rbs.2	Q495D7	OTTHUMG00000167562	ENST00000318426.2:c.331C>A	12.37:g.13526224G>T	ENSP00000443007:p.Gln111Lys	Somatic	68	1		WXS	Illumina GAIIx	Phase_I	156	65	.	0	0	0	0	0		RNA	SNP	ENST00000318426.2	37		.	.	.	.	.	.	.	.	.	.	G	7.078	0.569653	0.13560	.	.	ENSG00000180861	ENST00000318426;ENST00000527705	T;T	0.26373	1.74;1.74	4.05	-0.623	0.11556	.	.	.	.	.	T	0.15522	0.0374	.	.	.	0.09310	N	1	B	0.25169	0.119	B	0.21917	0.037	T	0.30090	-0.9990	8	0.87932	D	0	.	1.9979	0.03460	0.1573:0.2123:0.4672:0.1632	.	111	Q495D7	CL036_HUMAN	K	111	ENSP00000443007:Q111K;ENSP00000443346:Q111K	ENSP00000443007:Q111K	Q	-	1	0	C12orf36	13417491	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-1.074000	0.03427	-0.096000	0.12329	-0.137000	0.14449	CAG	.		0.478	C12orf36-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000395025.2	NM_182558	
KIF21A	55605	broad.mit.edu;bcgsc.ca	37	12	39751149	39751149	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr12:39751149G>A	ENST00000361418.5	-	9	1321	c.1306C>T	c.(1306-1308)Cgt>Tgt	p.R436C	KIF21A_ENST00000395670.3_Missense_Mutation_p.R436C|KIF21A_ENST00000544797.2_Missense_Mutation_p.R436C|KIF21A_ENST00000541463.2_Missense_Mutation_p.R436C|KIF21A_ENST00000361961.3_Missense_Mutation_p.R436C			Q7Z4S6	KI21A_HUMAN	kinesin family member 21A	436					ATP catabolic process (GO:0006200)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(1)|breast(1)|central_nervous_system(1)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(14)|lung(41)|ovary(5)|pancreas(1)|prostate(1)|skin(4)|stomach(1)|urinary_tract(2)	86		Lung NSC(34;0.179)|all_lung(34;0.213)				ATTCTTACACGCAGGTTATTA	0.418																																					p.R436C		.											.	KIF21A-97	0			c.C1306T						.						158.0	146.0	150.0					12																	39751149		2203	4300	6503	SO:0001583	missense	55605	exon9			TTACACGCAGGTT	AK000059	CCDS31773.1, CCDS53774.1, CCDS53775.1, CCDS53776.1	12q12	2013-01-10						"""Kinesins"", ""WD repeat domain containing"""	19349	protein-coding gene	gene with protein product		608283	"""fibrosis of the extraocular muscles, congenital, 1"""	FEOM1		10225949	Standard	NM_017641		Approved	FLJ20052	uc001rly.3	Q7Z4S6	OTTHUMG00000169335	ENST00000361418.5:c.1306C>T	12.37:g.39751149G>A	ENSP00000354878:p.Arg436Cys	Somatic	100	1		WXS	Illumina GAIIx	Phase_I	234	7	NM_001173463	0	0	1	1	0	A8MX28|B0I1R9|B9EGE4|F5H0C3|F5H219|Q2UVF1|Q6UKL9|Q7Z668|Q86WZ5|Q8IVZ8|Q9C0F5|Q9NXU4|Q9Y590	Missense_Mutation	SNP	ENST00000361418.5	37	CCDS53776.1	.	.	.	.	.	.	.	.	.	.	G	23.2	4.393480	0.83011	.	.	ENSG00000139116	ENST00000361961;ENST00000395670;ENST00000341813;ENST00000544797;ENST00000361418;ENST00000541463;ENST00000552908	T;T;T;T;T;D	0.83591	-0.52;-0.52;-0.52;-0.52;-0.52;-1.74	4.55	4.55	0.56014	.	0.000000	0.52532	D	0.000067	D	0.91399	0.7286	M	0.81497	2.545	0.80722	D	1	P;D;D;D;D	0.89917	0.87;1.0;1.0;1.0;1.0	B;D;D;D;D	0.87578	0.354;0.988;0.993;0.998;0.988	D	0.92879	0.6321	10	0.87932	D	0	.	17.6979	0.88286	0.0:0.0:1.0:0.0	.	436;436;436;436;436	F5H219;B9EGE4;F5H0C3;Q7Z4S6;Q7Z4S6-2	.;.;.;KI21A_HUMAN;.	C	436;436;436;436;436;436;259	ENSP00000354851:R436C;ENSP00000379029:R436C;ENSP00000445606:R436C;ENSP00000354878:R436C;ENSP00000438075:R436C;ENSP00000449700:R259C	ENSP00000344501:R436C	R	-	1	0	KIF21A	38037416	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	5.979000	0.70508	2.236000	0.73375	0.655000	0.94253	CGT	.		0.418	KIF21A-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403581.1	NM_017641	
SLC2A13	114134	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	40422218	40422218	+	Silent	SNP	T	T	A			TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr12:40422218T>A	ENST00000280871.4	-	3	860	c.810A>T	c.(808-810)ggA>ggT	p.G270G	SLC2A13_ENST00000380858.1_Silent_p.G270G	NM_052885.3	NP_443117.3	Q96QE2	MYCT_HUMAN	solute carrier family 2 (facilitated glucose transporter), member 13	270					transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	substrate-specific transmembrane transporter activity (GO:0022891)			central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(12)|ovary(1)|prostate(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	29		Lung NSC(34;0.105)|all_lung(34;0.123)				TCTGAGTCTGTCCTTTCTGAA	0.433										HNSCC(50;0.14)																											p.G270G		.											.	SLC2A13-515	0			c.A810T						.						102.0	106.0	105.0					12																	40422218		2203	4300	6503	SO:0001819	synonymous_variant	114134	exon3			AGTCTGTCCTTTC	AJ315644	CCDS8736.2	12q12	2013-05-22			ENSG00000151229	ENSG00000151229		"""Solute carriers"""	15956	protein-coding gene	gene with protein product	"""H(+)-myo-inositol symporter"""	611036				11500374	Standard	NM_052885		Approved	HMIT	uc010skm.2	Q96QE2	OTTHUMG00000059743	ENST00000280871.4:c.810A>T	12.37:g.40422218T>A		Somatic	42	0		WXS	Illumina GAIIx	Phase_I	62	9	NM_052885	0	0	4	4	0	Q17S07	Silent	SNP	ENST00000280871.4	37	CCDS8736.2																																																																																			.		0.433	SLC2A13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000132849.2		
CACNB3	784	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	49218962	49218962	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr12:49218962C>T	ENST00000301050.2	+	7	708	c.509C>T	c.(508-510)cCa>cTa	p.P170L	CACNB3_ENST00000536187.2_Missense_Mutation_p.P169L|CACNB3_ENST00000547230.1_Missense_Mutation_p.P129L|CACNB3_ENST00000540990.1_Missense_Mutation_p.P157L|CACNB3_ENST00000547392.1_Intron	NM_000725.3	NP_000716.2	P54284	CACB3_HUMAN	calcium channel, voltage-dependent, beta 3 subunit	170					axon guidance (GO:0007411)|calcium ion transport (GO:0006816)|membrane depolarization (GO:0051899)|synaptic transmission (GO:0007268)|T cell receptor signaling pathway (GO:0050852)|transport (GO:0006810)	apical plasma membrane (GO:0016324)|cytosol (GO:0005829)|membrane (GO:0016020)|voltage-gated calcium channel complex (GO:0005891)	voltage-gated calcium channel activity (GO:0005245)			autonomic_ganglia(1)|breast(1)|large_intestine(5)|lung(4)|prostate(1)	12					Dronedarone(DB04855)|Nimodipine(DB00393)|Spironolactone(DB00421)|Verapamil(DB00661)	CATGTTCCCCCATATGACGTG	0.577																																					p.P170L		.											.	CACNB3-90	0			c.C509T						.						76.0	57.0	64.0					12																	49218962		2203	4300	6503	SO:0001583	missense	784	exon7			TTCCCCCATATGA		CCDS8769.1, CCDS55821.1, CCDS55822.1, CCDS55823.1	12q13	2008-05-02				ENSG00000167535		"""Calcium channel subunits"""	1403	protein-coding gene	gene with protein product		601958		CACNLB3		8119293	Standard	NM_000725		Approved		uc010sly.2	P54284		ENST00000301050.2:c.509C>T	12.37:g.49218962C>T	ENSP00000301050:p.Pro170Leu	Somatic	161	0		WXS	Illumina GAIIx	Phase_I	333	59	NM_000725	0	0	4	6	2	A8K0Z4|B7Z4Q1|B7Z973|B7ZAK8|F5GZW7|F5H2P6|F8VSG3|Q13913	Missense_Mutation	SNP	ENST00000301050.2	37	CCDS8769.1	.	.	.	.	.	.	.	.	.	.	C	33	5.215279	0.95104	.	.	ENSG00000167535	ENST00000540990;ENST00000536187;ENST00000301050;ENST00000547230	D;D;D;T	0.83837	-1.77;-1.77;-1.77;0.99	5.74	5.74	0.90152	Src homology-3 domain (1);	0.000000	0.85682	D	0.000000	D	0.92551	0.7634	M	0.87269	2.87	0.80722	D	1	D;D;D;D	0.89917	0.991;1.0;1.0;1.0	P;D;D;D	0.91635	0.714;0.999;0.998;0.998	D	0.93269	0.6650	10	0.87932	D	0	-15.2226	18.6855	0.91562	0.0:1.0:0.0:0.0	.	169;157;170;157	F5GZW7;F5H2P6;P54284;B7Z973	.;.;CACB3_HUMAN;.	L	157;169;170;129	ENSP00000445495:P157L;ENSP00000444160:P169L;ENSP00000301050:P170L;ENSP00000448304:P129L	ENSP00000301050:P170L	P	+	2	0	CACNB3	47505229	1.000000	0.71417	0.985000	0.45067	0.978000	0.69477	7.736000	0.84948	2.700000	0.92200	0.655000	0.94253	CCA	.		0.577	CACNB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408886.1		
LETMD1	25875	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	51453177	51453177	+	Missense_Mutation	SNP	T	T	C			TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr12:51453177T>C	ENST00000262055.4	+	9	1085	c.1046T>C	c.(1045-1047)gTc>gCc	p.V349A	LETMD1_ENST00000552739.1_Missense_Mutation_p.V232A|LETMD1_ENST00000418425.2_Missense_Mutation_p.V362A|LETMD1_ENST00000547008.1_Missense_Mutation_p.V225A|LETMD1_ENST00000550929.1_Missense_Mutation_p.V293A|LETMD1_ENST00000548516.1_3'UTR|LETMD1_ENST00000380123.2_3'UTR	NM_015416.4	NP_056231.3	Q6P1Q0	LTMD1_HUMAN	LETM1 domain containing 1	349						integral component of membrane (GO:0016021)|mitochondrial outer membrane (GO:0005741)				central_nervous_system(2)|endometrium(1)|kidney(3)|large_intestine(2)|lung(4)|skin(1)|urinary_tract(3)	16						CACAACGTGGTCCTGCTCTCC	0.488																																					p.V362A		.											.	LETMD1-90	0			c.T1085C						.						254.0	182.0	206.0					12																	51453177		2203	4300	6503	SO:0001583	missense	25875	exon9			ACGTGGTCCTGCT	AF195651	CCDS8806.1, CCDS58231.1, CCDS73469.1	12q13.13	2006-04-12				ENSG00000050426			24241	protein-coding gene	gene with protein product	"""cervical cancer 1 protooncogene"""					12879013, 12061725	Standard	NM_015416		Approved	HCCR1	uc009zlw.3	Q6P1Q0	OTTHUMG00000169538	ENST00000262055.4:c.1046T>C	12.37:g.51453177T>C	ENSP00000262055:p.Val349Ala	Somatic	175	0		WXS	Illumina GAIIx	Phase_I	406	187	NM_001243689	0	0	32	59	27	A6NER7|B3KXK7|Q6X2E4|Q6X2E5|Q7L2G9|Q7L690|Q8WXW6|Q96PK7|Q9BY59|Q9Y3X3	Missense_Mutation	SNP	ENST00000262055.4	37	CCDS8806.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	23.4|23.4	4.416913|4.416913	0.83449|0.83449	.|.	.|.	ENSG00000050426|ENSG00000050426	ENST00000547256;ENST00000551931|ENST00000550929;ENST00000262055;ENST00000547660;ENST00000418425;ENST00000547008;ENST00000552739;ENST00000553043	.|T;T;T;T	.|0.54675	.|0.76;0.7;0.63;0.56	4.32|4.32	4.32|4.32	0.51571|0.51571	.|.	.|0.000000	.|0.64402	.|D	.|0.000001	T|T	0.59891|0.59891	0.2227|0.2227	L|L	0.34521|0.34521	1.04|1.04	0.80722|0.80722	D|D	1|1	.|D;D;D;D	.|0.89917	.|0.999;0.982;1.0;0.999	.|D;D;D;D	.|0.83275	.|0.991;0.968;0.996;0.991	T|T	0.57825|0.57825	-0.7744|-0.7744	5|10	.|0.34782	.|T	.|0.22	-2.1151|-2.1151	12.9156|12.9156	0.58205|0.58205	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	.|362;225;232;349	.|B3KXK7;F8W1Z2;F8VP71;Q6P1Q0	.|.;.;.;LTMD1_HUMAN	P|A	99;133|293;349;104;362;225;232;85	.|ENSP00000450163:V293A;ENSP00000262055:V349A;ENSP00000389903:V362A;ENSP00000447419:V225A	.|ENSP00000262055:V349A	S|V	+|+	1|2	0|0	LETMD1|LETMD1	49739444|49739444	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	3.483000|3.483000	0.53194|0.53194	1.940000|1.940000	0.56252|0.56252	0.528000|0.528000	0.53228|0.53228	TCC|GTC	.		0.488	LETMD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404710.1	NM_015416	
HOXC4	3221	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	54448765	54448765	+	Missense_Mutation	SNP	C	C	A			TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr12:54448765C>A	ENST00000430889.2	+	2	617	c.571C>A	c.(571-573)Cac>Aac	p.H191N	HOXC4_ENST00000303406.4_Missense_Mutation_p.H191N|HOXC4_ENST00000609810.1_Missense_Mutation_p.H191N	NM_153633.2	NP_705897.1	P09017	HXC4_HUMAN	homeobox C4	191					multicellular organismal development (GO:0007275)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			cervix(1)|kidney(2)|large_intestine(4)|lung(3)|ovary(1)|prostate(1)|urinary_tract(1)	13						CGAGATCGCCCACTCGCTGTG	0.532																																					p.H191N		.											.	HOXC4-91	0			c.C571A						.						49.0	45.0	46.0					12																	54448765		2203	4300	6503	SO:0001583	missense	3221	exon4			ATCGCCCACTCGC		CCDS8873.1	12q13.13	2011-06-20	2005-12-22		ENSG00000198353	ENSG00000198353		"""Homeoboxes / ANTP class : HOXL subclass"""	5126	protein-coding gene	gene with protein product		142974	"""homeo box C4"""	HOX3, HOX3E		1973146, 1358459	Standard	NM_014620		Approved		uc001sex.3	P09017	OTTHUMG00000160036	ENST00000430889.2:c.571C>A	12.37:g.54448765C>A	ENSP00000399808:p.His191Asn	Somatic	200	0		WXS	Illumina GAIIx	Phase_I	430	196	NM_014620	0	0	5	8	3		Missense_Mutation	SNP	ENST00000430889.2	37	CCDS8873.1	.	.	.	.	.	.	.	.	.	.	C	18.23	3.578434	0.65878	.	.	ENSG00000198353	ENST00000303406;ENST00000430889	D;D	0.95885	-3.84;-3.84	3.85	3.85	0.44370	Homeodomain-related (1);Homeobox (3);Homeodomain-like (1);Homeobox, conserved site (1);	0.000000	0.85682	D	0.000000	D	0.93989	0.8075	N	0.05177	-0.1	0.80722	D	1	D	0.76494	0.999	D	0.91635	0.999	D	0.95593	0.8656	10	0.87932	D	0	.	15.0798	0.72106	0.0:1.0:0.0:0.0	.	191	P09017	HXC4_HUMAN	N	191	ENSP00000305973:H191N;ENSP00000399808:H191N	ENSP00000305973:H191N	H	+	1	0	HOXC4	52735032	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.568000	0.82369	2.139000	0.66308	0.448000	0.29417	CAC	.		0.532	HOXC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000358963.1		
CBX5	23468	hgsc.bcm.edu;broad.mit.edu	37	12	54645832	54645832	+	Frame_Shift_Del	DEL	T	T	-			TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr12:54645832delT	ENST00000439541.2	-	3	442	c.317delA	c.(316-318)aagfs	p.K106fs	CBX5_ENST00000209875.4_Frame_Shift_Del_p.K106fs|CBX5_ENST00000550411.1_Frame_Shift_Del_p.K106fs	NM_001127321.1	NP_001120793.1	P45973	CBX5_HUMAN	chromobox homolog 5	106					blood coagulation (GO:0007596)|negative regulation of transcription, DNA-templated (GO:0045892)|viral process (GO:0016032)	chromocenter (GO:0010369)|histone deacetylase complex (GO:0000118)|histone methyltransferase complex (GO:0035097)|kinetochore (GO:0000776)|nuclear envelope (GO:0005635)|nuclear heterochromatin (GO:0005720)|nuclear pericentric heterochromatin (GO:0031618)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	chromatin binding (GO:0003682)|methylated histone binding (GO:0035064)|protein binding, bridging (GO:0030674)|repressing transcription factor binding (GO:0070491)			endometrium(1)|kidney(1)|large_intestine(2)|lung(1)|prostate(1)|skin(2)	8						TACCTCTCTCTTTTTTTTAGA	0.323																																					p.K106fs	Colon(153;588 2459 18334 48613)	.											.	CBX5-226	0			c.317delA						.						142.0	148.0	146.0					12																	54645832		2203	4300	6503	SO:0001589	frameshift_variant	23468	exon3			TCTCTCTTTTTTT	U26311	CCDS8875.1	12q13.13	2010-07-06	2010-06-24		ENSG00000094916	ENSG00000094916			1555	protein-coding gene	gene with protein product	"""HP1 alpha homolog (Drosophila)"""	604478	"""chromobox homolog 5 (Drosophila HP1 alpha)"", ""chromobox homolog 5 (HP1 alpha homolog, Drosophila)"""			8663349	Standard	NM_012117		Approved	HP1Hs-alpha, HP1, HP1-ALPHA	uc001sfj.4	P45973		ENST00000439541.2:c.317delA	12.37:g.54645832delT	ENSP00000401009:p.Lys106fs	Somatic	13	0		WXS	Illumina GAIIx	Phase_I	25	13	NM_012117	0	0	0	0	0	B2R8T9	Frame_Shift_Del	DEL	ENST00000439541.2	37	CCDS8875.1																																																																																			.		0.323	CBX5-004	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000405468.1	NM_012117	
LRP1	4035	broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	57579562	57579562	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr12:57579562G>A	ENST00000243077.3	+	41	7178	c.6712G>A	c.(6712-6714)Gcc>Acc	p.A2238T		NM_002332.2	NP_002323.2	Q07954	LRP1_HUMAN	low density lipoprotein receptor-related protein 1	2238					aging (GO:0007568)|aorta morphogenesis (GO:0035909)|apoptotic cell clearance (GO:0043277)|beta-amyloid clearance (GO:0097242)|cell proliferation (GO:0008283)|cholesterol metabolic process (GO:0008203)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of platelet-derived growth factor receptor-beta signaling pathway (GO:2000587)|negative regulation of smooth muscle cell migration (GO:0014912)|negative regulation of Wnt signaling pathway (GO:0030178)|phototransduction, visible light (GO:0007603)|positive regulation of cholesterol efflux (GO:0010875)|positive regulation of lipid transport (GO:0032370)|positive regulation of protein transport (GO:0051222)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|receptor-mediated endocytosis (GO:0006898)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of cholesterol transport (GO:0032374)|regulation of phospholipase A2 activity (GO:0032429)|retinoid metabolic process (GO:0001523)	clathrin-coated vesicle (GO:0030136)|coated pit (GO:0005905)|dendrite (GO:0030425)|endocytic vesicle membrane (GO:0030666)|endosome (GO:0005768)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	apolipoprotein binding (GO:0034185)|calcium ion binding (GO:0005509)|lipoprotein particle receptor binding (GO:0070325)|lipoprotein transporter activity (GO:0042954)|poly(A) RNA binding (GO:0044822)|protein complex binding (GO:0032403)|receptor activity (GO:0004872)			NS(1)|breast(9)|central_nervous_system(3)|cervix(3)|endometrium(33)|haematopoietic_and_lymphoid_tissue(4)|kidney(10)|large_intestine(26)|lung(58)|ovary(10)|pancreas(2)|prostate(11)|skin(7)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(5)	184				BRCA - Breast invasive adenocarcinoma(357;0.0103)	Antihemophilic Factor(DB00025)|Coagulation Factor IX(DB00100)|Tenecteplase(DB00031)	GAACGTCATCGCCCTGGCCTT	0.577																																					p.A2238T		.											.	LRP1-596	0			c.G6712A						.						127.0	111.0	116.0					12																	57579562		2203	4300	6503	SO:0001583	missense	4035	exon41			GTCATCGCCCTGG	X13916	CCDS8932.1	12q13.3	2013-05-28	2010-01-26		ENSG00000123384	ENSG00000123384		"""CD molecules"", ""Low density lipoprotein receptors"""	6692	protein-coding gene	gene with protein product		107770	"""alpha-2-macroglobulin receptor"""	APR, A2MR		2548950	Standard	NM_002332		Approved	LRP, CD91, LRP1A, APOER	uc001snd.3	Q07954	OTTHUMG00000044412	ENST00000243077.3:c.6712G>A	12.37:g.57579562G>A	ENSP00000243077:p.Ala2238Thr	Somatic	119	2		WXS	Illumina GAIIx	Phase_I	243	106	NM_002332	0	0	2	2	0	Q2PP12|Q86SW0|Q8IVG8	Missense_Mutation	SNP	ENST00000243077.3	37	CCDS8932.1	.	.	.	.	.	.	.	.	.	.	G	34	5.336135	0.95758	.	.	ENSG00000123384	ENST00000243077	D	0.91843	-2.92	5.03	5.03	0.67393	Six-bladed beta-propeller, TolB-like (1);	0.000000	0.64402	D	0.000002	D	0.92355	0.7574	M	0.79123	2.44	0.80722	D	1	D	0.54964	0.969	B	0.43251	0.413	D	0.93517	0.6858	10	0.62326	D	0.03	.	17.1412	0.86754	0.0:0.0:1.0:0.0	.	2238	Q07954	LRP1_HUMAN	T	2238	ENSP00000243077:A2238T	ENSP00000243077:A2238T	A	+	1	0	LRP1	55865829	1.000000	0.71417	0.430000	0.26722	0.920000	0.55202	9.869000	0.99810	2.340000	0.79590	0.491000	0.48974	GCC	.		0.577	LRP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412772.2	NM_002332	
XPOT	11260	hgsc.bcm.edu;broad.mit.edu	37	12	64812755	64812755	+	Frame_Shift_Del	DEL	T	T	-			TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr12:64812755delT	ENST00000332707.5	+	6	899	c.370delT	c.(370-372)tttfs	p.F126fs		NM_007235.4	NP_009166.2	O43592	XPOT_HUMAN	exportin, tRNA	126	Necessary for interaction with Ran, nuclear localization and nuclear import.				intracellular protein transport (GO:0006886)|tRNA export from nucleus (GO:0006409)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	tRNA binding (GO:0000049)	p.F126fs*6(1)		NS(1)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(7)|lung(12)|ovary(4)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	45				GBM - Glioblastoma multiforme(28;0.0404)		GTGGCCCAAGTTTTTTTTTGA	0.443																																					p.F124fs		.											.	XPOT-652	1	Deletion - Frameshift(1)	large_intestine(1)	c.370delT						.						118.0	114.0	115.0					12																	64812755		2203	4300	6503	SO:0001589	frameshift_variant	11260	exon6			CCCAAGTTTTTTT	AF039022	CCDS31852.1	12q14.1	2012-10-17	2012-10-17		ENSG00000184575	ENSG00000184575		"""Exportins"""	12826	protein-coding gene	gene with protein product		603180	"""exportin, tRNA (nuclear export receptor for tRNAs)"""			9660920, 9512417	Standard	NM_007235		Approved	XPO3	uc001ssb.3	O43592	OTTHUMG00000168794	ENST00000332707.5:c.370delT	12.37:g.64812755delT	ENSP00000327821:p.Phe126fs	Somatic	122	0		WXS	Illumina GAIIx	Phase_I	250	135	NM_007235	0	0	0	0	0	A6NLH1|O43784|Q8WUG2|Q9BVS7	Frame_Shift_Del	DEL	ENST00000332707.5	37	CCDS31852.1																																																																																			.		0.443	XPOT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401122.1	NM_007235	
KRR1	11103	hgsc.bcm.edu;broad.mit.edu	37	12	75893593	75893593	+	Frame_Shift_Del	DEL	T	T	-	rs140273898		TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr12:75893593delT	ENST00000229214.4	-	10	1165	c.1142delA	c.(1141-1143)aagfs	p.K381fs	KRR1_ENST00000438169.2_Frame_Shift_Del_p.K324fs|GLIPR1_ENST00000266659.3_3'UTR	NM_007043.6	NP_008974.5	Q13601	KRR1_HUMAN	KRR1, small subunit (SSU) processome component, homolog (yeast)	381	Lys-rich.				rRNA processing (GO:0006364)	cytoplasm (GO:0005737)|intercellular bridge (GO:0045171)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	poly(A) RNA binding (GO:0044822)			breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(3)|liver(1)|lung(1)|ovary(1)|pancreas(1)|urinary_tract(1)	11						GGTATGTTACTTTTTTTTCTT	0.348																																					p.K381fs		.											.	KRR1-92	0			c.1142delA						.						69.0	66.0	67.0					12																	75893593		2202	4299	6501	SO:0001589	frameshift_variant	11103	exon10			TGTTACTTTTTTT	U55766	CCDS9012.1	12q	2011-03-15	2006-05-18	2006-05-18	ENSG00000111615	ENSG00000111615			5176	protein-coding gene	gene with protein product		612817	"""HIV-1 rev binding protein 2"", ""HIV-1 Rev binding protein 2"""	HRB2		7505766, 11027267, 11359931, 8675026	Standard	NM_007043		Approved	RIP-1	uc001sxt.3	Q13601	OTTHUMG00000169759	ENST00000229214.4:c.1142delA	12.37:g.75893593delT	ENSP00000229214:p.Lys381fs	Somatic	24	0		WXS	Illumina GAIIx	Phase_I	59	19	NM_007043	0	0	0	0	0	A0FIK6|A0JLP0|B2R989|E7EUQ0|Q8NEA8|Q8TC37|Q96AT5	Frame_Shift_Del	DEL	ENST00000229214.4	37	CCDS9012.1																																																																																			.		0.348	KRR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405727.1	NM_007043	
CCDC53	51019	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	102437938	102437938	+	Missense_Mutation	SNP	T	T	C			TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr12:102437938T>C	ENST00000240079.6	-	4	430	c.269A>G	c.(268-270)aAt>aGt	p.N90S	CCDC53_ENST00000545679.1_Missense_Mutation_p.N90S|CCDC53_ENST00000539515.1_5'UTR	NM_016053.2	NP_057137.1	Q9Y3C0	CCD53_HUMAN	coiled-coil domain containing 53	90						actin cytoskeleton (GO:0015629)|intracellular membrane-bounded organelle (GO:0043231)|WASH complex (GO:0071203)				endometrium(1)|kidney(1)|large_intestine(1)|lung(1)	4						ACTGGTGACATTTAAAGGAGA	0.398																																					p.N90S		.											.	.	0			c.A269G						.						91.0	83.0	86.0					12																	102437938		1906	4153	6059	SO:0001583	missense	51019	exon4			GTGACATTTAAAG	AF151874	CCDS44959.1, CCDS73512.1	12q23.3	2014-05-09			ENSG00000120860	ENSG00000120860			24256	protein-coding gene	gene with protein product						10810093, 20498093	Standard	XM_005268939		Approved	CGI-116	uc010svw.2	Q9Y3C0	OTTHUMG00000168187	ENST00000240079.6:c.269A>G	12.37:g.102437938T>C	ENSP00000240079:p.Asn90Ser	Somatic	85	0		WXS	Illumina GAIIx	Phase_I	224	96	NM_016053	0	0	65	105	40	B2RC74|Q53FF0|Q6IAI4|Q96QK0	Missense_Mutation	SNP	ENST00000240079.6	37	CCDS44959.1	.	.	.	.	.	.	.	.	.	.	T	0.015	-1.569167	0.00895	.	.	ENSG00000120860	ENST00000240079;ENST00000545679;ENST00000542923	.	.	.	4.72	-4.53	0.03462	.	0.726167	0.14000	N	0.348190	T	0.17577	0.0422	N	0.12746	0.255	0.09310	N	1	B;B	0.09022	0.001;0.002	B;B	0.10450	0.003;0.005	T	0.37957	-0.9683	9	0.02654	T	1	-18.2592	11.803	0.52139	0.0:0.3613:0.0:0.6387	.	90;90	F5GZ97;Q9Y3C0	.;CCD53_HUMAN	S	90;90;40	.	ENSP00000240079:N90S	N	-	2	0	CCDC53	100962068	0.069000	0.21087	0.061000	0.19648	0.411000	0.31082	-0.181000	0.09740	-0.678000	0.05224	-0.313000	0.08912	AAT	.		0.398	CCDC53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398685.1	NM_016053	
ALDH1L2	160428	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	105446693	105446693	+	Missense_Mutation	SNP	T	T	A			TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr12:105446693T>A	ENST00000258494.9	-	11	1444	c.1304A>T	c.(1303-1305)aAt>aTt	p.N435I	ALDH1L2_ENST00000424857.2_Missense_Mutation_p.N435I	NM_001034173.3	NP_001029345.2	Q3SY69	AL1L2_HUMAN	aldehyde dehydrogenase 1 family, member L2	435					10-formyltetrahydrofolate catabolic process (GO:0009258)|biosynthetic process (GO:0009058)|one-carbon metabolic process (GO:0006730)	extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)	formyltetrahydrofolate dehydrogenase activity (GO:0016155)|hydroxymethyl-, formyl- and related transferase activity (GO:0016742)|methyltransferase activity (GO:0008168)|oxidoreductase activity, acting on the aldehyde or oxo group of donors, NAD or NADP as acceptor (GO:0016620)			breast(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(13)|prostate(2)|skin(3)|stomach(2)	35						CATGATTTCATTGACCTCCTT	0.363											OREG0022073	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.N435I		.											.	ALDH1L2-91	0			c.A1304T						.						149.0	118.0	129.0					12																	105446693		2203	4300	6503	SO:0001583	missense	160428	exon11			ATTTCATTGACCT	AK095827	CCDS31891.1	12q23.3	2014-09-11			ENSG00000136010	ENSG00000136010	1.5.1.6	"""Aldehyde dehydrogenases"""	26777	protein-coding gene	gene with protein product	"""mitochondrial 10-formyltetrahydrofolate dehydrogenase"""	613584				20498374	Standard	NM_001034173		Approved	FLJ38508, mtFDH	uc001tlc.3	Q3SY69	OTTHUMG00000169823	ENST00000258494.9:c.1304A>T	12.37:g.105446693T>A	ENSP00000258494:p.Asn435Ile	Somatic	108	0	1389	WXS	Illumina GAIIx	Phase_I	196	68	NM_001034173	0	0	0	0	0	Q3SY68|Q68D62|Q6AI55|Q8N922	Missense_Mutation	SNP	ENST00000258494.9	37	CCDS31891.1	.	.	.	.	.	.	.	.	.	.	T	23.5	4.424472	0.83667	.	.	ENSG00000136010	ENST00000258494;ENST00000424857	T;T	0.15017	2.46;3.02	5.76	5.76	0.90799	Aldehyde/histidinol dehydrogenase (1);	0.000000	0.85682	D	0.000000	T	0.29556	0.0737	M	0.85299	2.745	0.80722	D	1	P	0.39520	0.676	B	0.38225	0.268	T	0.20338	-1.0278	10	0.87932	D	0	.	16.087	0.81065	0.0:0.0:0.0:1.0	.	435	Q3SY69	AL1L2_HUMAN	I	435	ENSP00000258494:N435I;ENSP00000389608:N435I	ENSP00000258494:N435I	N	-	2	0	ALDH1L2	103970823	1.000000	0.71417	0.993000	0.49108	0.859000	0.49053	7.736000	0.84948	2.202000	0.70862	0.533000	0.62120	AAT	.		0.363	ALDH1L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406098.1	XM_090294	
CUX2	23316	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	111760254	111760254	+	Silent	SNP	C	C	T			TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr12:111760254C>T	ENST00000261726.6	+	18	2950	c.2796C>T	c.(2794-2796)agC>agT	p.S932S		NM_015267.3	NP_056082.2	O14529	CUX2_HUMAN	cut-like homeobox 2	932					cellular response to organic substance (GO:0071310)|cognition (GO:0050890)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of dendrite morphogenesis (GO:0050775)|positive regulation of dendritic spine morphogenesis (GO:0061003)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of gene expression (GO:0010628)|positive regulation of synapse assembly (GO:0051965)|short-term memory (GO:0007614)|transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|sequence-specific DNA binding (GO:0043565)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(2)|large_intestine(9)|lung(24)|ovary(5)|prostate(4)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	55						GCAGCGTGAGCGACATGCTGT	0.697																																					p.S932S		.											.	CUX2-140	0			c.C2796T						.						11.0	13.0	12.0					12																	111760254		2184	4272	6456	SO:0001819	synonymous_variant	23316	exon18			CGTGAGCGACATG	AB006631	CCDS41837.1	12q24.12	2011-06-20	2007-11-07	2007-11-07	ENSG00000111249	ENSG00000111249		"""Homeoboxes / CUT class"""	19347	protein-coding gene	gene with protein product		610648	"""cut-like 2 (Drosophila)"""	CUTL2			Standard	NM_015267		Approved	KIAA0293, CDP2	uc001tsa.2	O14529	OTTHUMG00000169546	ENST00000261726.6:c.2796C>T	12.37:g.111760254C>T		Somatic	58	1		WXS	Illumina GAIIx	Phase_I	318	175	NM_015267	0	0	0	0	0	A7E2Y4	Silent	SNP	ENST00000261726.6	37	CCDS41837.1																																																																																			.		0.697	CUX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404765.1	NM_015267	
SETD1B	23067	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	12	122242658	122242658	+	Frame_Shift_Del	DEL	C	C	-			TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr12:122242658delC	ENST00000604567.1	+	2	83	c.15delC	c.(13-15)cacfs	p.H5fs	RHOF_ENST00000545544.1_5'Flank|SETD1B_ENST00000267197.5_Frame_Shift_Del_p.H5fs|SETD1B_ENST00000542440.1_Frame_Shift_Del_p.H5fs|RP11-347I19.8_ENST00000609067.1_lincRNA			Q9UPS6	SET1B_HUMAN	SET domain containing 1B	5					histone H3-K4 methylation (GO:0051568)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	chromosome (GO:0005694)|histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)|Set1C/COMPASS complex (GO:0048188)	histone-lysine N-methyltransferase activity (GO:0018024)|nucleotide binding (GO:0000166)|RNA binding (GO:0003723)	p.H8fs*27(2)		NS(1)|endometrium(6)|kidney(2)|prostate(2)	11						AGAACAGTCACCCCCCCCACC	0.632																																					p.H5fs		.											.	SETD1B-86	2	Deletion - Frameshift(2)	large_intestine(2)	c.15delC						.						37.0	44.0	42.0					12																	122242658		692	1591	2283	SO:0001589	frameshift_variant	23067	exon1			CAGTCACCCCCCC	AB028999	CCDS53838.1	12q24.31	2013-02-12			ENSG00000139718	ENSG00000139718		"""Chromatin-modifying enzymes / K-methyltransferases"", ""RNA binding motif (RRM) containing"""	29187	protein-coding gene	gene with protein product		611055				10470851, 17355966	Standard	NM_015048		Approved	KIAA1076, Set1B, KMT2G	uc001ubi.3	Q9UPS6	OTTHUMG00000169080	ENST00000604567.1:c.15delC	12.37:g.122242658delC	ENSP00000474253:p.His5fs	Somatic	87	0		WXS	Illumina GAIIx	Phase_I	164	70	NM_015048	0	0	0	0	0	F6MFW1	Frame_Shift_Del	DEL	ENST00000604567.1	37																																																																																				.		0.632	SETD1B-002	PUTATIVE	non_canonical_U12|basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000468264.1	XM_037523	
EP400	57634	ucsc.edu;bcgsc.ca	37	12	132547090	132547090	+	Silent	SNP	A	A	G	rs7974276	byFrequency	TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr12:132547090A>G	ENST00000333577.4	+	48	8395	c.8286A>G	c.(8284-8286)caA>caG	p.Q2762Q	EP400_ENST00000330386.6_Silent_p.Q2645Q|EP400_ENST00000332482.4_Silent_p.Q2689Q|EP400_ENST00000389562.2_Silent_p.Q2725Q|EP400_ENST00000389561.2_Silent_p.Q2726Q			Q96L91	EP400_HUMAN	E1A binding protein p400	2762	Interaction with ZNF42. {ECO:0000250}.|Poly-Gln.				chromatin organization (GO:0006325)|histone H2A acetylation (GO:0043968)|histone H4 acetylation (GO:0043967)	NuA4 histone acetyltransferase complex (GO:0035267)|nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|Swr1 complex (GO:0000812)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|helicase activity (GO:0004386)			NS(1)|breast(6)|central_nervous_system(10)|cervix(1)|endometrium(21)|kidney(13)|large_intestine(25)|lung(56)|ovary(5)|prostate(8)|skin(6)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(3)	161	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.198)		OV - Ovarian serous cystadenocarcinoma(86;3.01e-08)|Epithelial(86;3.43e-07)|all cancers(50;2.01e-06)		agcagcagcaacaacagcagc	0.557													G|||	1450	0.289537	0.6316	0.1671	5008	,	,		15386	0.1865		0.1322	False		,,,				2504	0.182				p.Q2726Q		.											.	EP400-520	0			c.A8178G						.						26.0	30.0	29.0					12																	132547090		2181	4250	6431	SO:0001819	synonymous_variant	57634	exon47			GCAGCAACAACAG	U80743	CCDS31929.1, CCDS31929.2	12q24.33	2008-02-01	2002-02-05	2002-02-08		ENSG00000183495			11958	protein-coding gene	gene with protein product		606265	"""trinucleotide repeat containing 12"""	TNRC12		9225980, 11509179	Standard	NM_015409		Approved	CAGH32, KIAA1498, P400, KIAA1818, DKFZP434I225	uc001ujn.3	Q96L91		ENST00000333577.4:c.8286A>G	12.37:g.132547090A>G		Somatic	164	2		WXS	Illumina GAIIx	Phase_I	291	81	NM_015409	0	1	6	79	72	O15411|Q6P2F5|Q8N8Q7|Q8NE05|Q96JK7|Q9P230	Silent	SNP	ENST00000333577.4	37																																																																																				A|0.794;G|0.206		0.557	EP400-203	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding		NM_015409	
EP400	57634	bcgsc.ca	37	12	132547093	132547093	+	Silent	SNP	A	A	G	rs10902490|rs528214697	byFrequency	TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10	A	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr12:132547093A>G	ENST00000333577.4	+	48	8398	c.8289A>G	c.(8287-8289)caA>caG	p.Q2763Q	EP400_ENST00000330386.6_Silent_p.Q2646Q|EP400_ENST00000332482.4_Silent_p.Q2690Q|EP400_ENST00000389562.2_Silent_p.Q2726Q|EP400_ENST00000389561.2_Silent_p.Q2727Q			Q96L91	EP400_HUMAN	E1A binding protein p400	2763	Interaction with ZNF42. {ECO:0000250}.|Poly-Gln.				chromatin organization (GO:0006325)|histone H2A acetylation (GO:0043968)|histone H4 acetylation (GO:0043967)	NuA4 histone acetyltransferase complex (GO:0035267)|nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|Swr1 complex (GO:0000812)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|helicase activity (GO:0004386)	p.Q2726Q(9)		NS(1)|breast(6)|central_nervous_system(10)|cervix(1)|endometrium(21)|kidney(13)|large_intestine(25)|lung(56)|ovary(5)|prostate(8)|skin(6)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(3)	161	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.198)		OV - Ovarian serous cystadenocarcinoma(86;3.01e-08)|Epithelial(86;3.43e-07)|all cancers(50;2.01e-06)		agcagcaacaacagcagcagc	0.567																																					p.Q2727Q		.											.	EP400-520	9	Substitution - coding silent(9)	lung(3)|kidney(2)|endometrium(2)|central_nervous_system(2)	c.A8181G						.						25.0	29.0	28.0					12																	132547093		2173	4217	6390	SO:0001819	synonymous_variant	57634	exon47			GCAACAACAGCAG	U80743	CCDS31929.1, CCDS31929.2	12q24.33	2008-02-01	2002-02-05	2002-02-08		ENSG00000183495			11958	protein-coding gene	gene with protein product		606265	"""trinucleotide repeat containing 12"""	TNRC12		9225980, 11509179	Standard	NM_015409		Approved	CAGH32, KIAA1498, P400, KIAA1818, DKFZP434I225	uc001ujn.3	Q96L91		ENST00000333577.4:c.8289A>G	12.37:g.132547093A>G		Somatic	169	3		WXS	Illumina GAIIx	Phase_I	298	77	NM_015409	0	0	6	43	37	O15411|Q6P2F5|Q8N8Q7|Q8NE05|Q96JK7|Q9P230	Silent	SNP	ENST00000333577.4	37																																																																																				A|0.500;G|0.500		0.567	EP400-203	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding		NM_015409	
NUFIP1	26747	broad.mit.edu;ucsc.edu;bcgsc.ca	37	13	45563471	45563471	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr13:45563471C>T	ENST00000379161.4	-	1	147	c.101G>A	c.(100-102)cGg>cAg	p.R34Q	GPALPP1_ENST00000361121.2_5'Flank|GPALPP1_ENST00000379151.4_5'Flank|RP11-321C24.1_ENST00000437748.2_lincRNA	NM_012345.2	NP_036477.2	Q9UHK0	NUFP1_HUMAN	nuclear fragile X mental retardation protein interacting protein 1	34	Pro-rich.				box C/D snoRNP assembly (GO:0000492)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|RNA processing (GO:0006396)	cytosolic ribosome (GO:0022626)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleus (GO:0005634)|perichromatin fibrils (GO:0005726)|pre-snoRNP complex (GO:0070761)|presynaptic active zone (GO:0048786)|transcription elongation factor complex (GO:0008023)	DNA binding (GO:0003677)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|protein binding, bridging (GO:0030674)|RNA binding (GO:0003723)			breast(2)|cervix(1)|endometrium(2)|large_intestine(2)|lung(4)|prostate(4)|skin(3)	18		Lung NSC(96;8.23e-05)|Breast(139;0.00378)|Prostate(109;0.0107)|all_hematologic(4;0.014)|Lung SC(185;0.0262)|Hepatocellular(98;0.0524)|Acute lymphoblastic leukemia(4;0.143)	KIRC - Kidney renal clear cell carcinoma(16;0.234)	GBM - Glioblastoma multiforme(144;0.000306)|BRCA - Breast invasive adenocarcinoma(63;0.125)		CCAGCTGTCCCGCGGCGGGGC	0.647																																					p.R34Q		.											.	NUFIP1-90	0			c.G101A						.						15.0	18.0	17.0					13																	45563471		2189	4281	6470	SO:0001583	missense	26747	exon1			CTGTCCCGCGGCG	AF159548	CCDS9393.1	13q14	2008-02-05			ENSG00000083635	ENSG00000083635			8057	protein-coding gene	gene with protein product		604354				10556305, 10894927	Standard	NM_012345		Approved	NUFIP	uc001uzp.2	Q9UHK0	OTTHUMG00000016842	ENST00000379161.4:c.101G>A	13.37:g.45563471C>T	ENSP00000368459:p.Arg34Gln	Somatic	90	1		WXS	Illumina GAIIx	Phase_I	128	111	NM_012345	0	0	0	1	1	Q8WVM5|Q96SG1	Missense_Mutation	SNP	ENST00000379161.4	37	CCDS9393.1	.	.	.	.	.	.	.	.	.	.	C	12.11	1.838871	0.32513	.	.	ENSG00000083635	ENST00000379161	T	0.42900	0.96	4.82	-4.06	0.03986	.	1.522330	0.04251	N	0.338673	T	0.27454	0.0674	N	0.17082	0.46	0.09310	N	1	B	0.12013	0.005	B	0.08055	0.003	T	0.21793	-1.0235	10	0.26408	T	0.33	5.7253	12.4829	0.55854	0.0:0.624:0.2238:0.1522	.	34	Q9UHK0	NUFP1_HUMAN	Q	34	ENSP00000368459:R34Q	ENSP00000368459:R34Q	R	-	2	0	NUFIP1	44461471	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.720000	0.04969	-1.403000	0.02053	-0.344000	0.07964	CGG	.		0.647	NUFIP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044755.2	NM_012345	
TRIM13	10206	ucsc.edu;bcgsc.ca;mdanderson.org	37	13	50590277	50590277	+	3'UTR	SNP	C	C	A			TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr13:50590277C>A	ENST00000378182.3	+	0	4939				KCNRG_ENST00000312942.1_Intron|KCNRG_ENST00000360473.4_Intron|TRIM13_ENST00000478111.1_Intron	NM_001007278.1|NM_005798.3|NM_052811.2|NM_213590.1	NP_001007279.1|NP_005789.2|NP_434698.1|NP_998755.1	O60858	TRI13_HUMAN	tripartite motif containing 13						anatomical structure morphogenesis (GO:0009653)|ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|innate immune response (GO:0045087)|negative regulation of viral release from host cell (GO:1902187)|negative regulation of viral transcription (GO:0032897)|positive regulation of cell death (GO:0010942)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of macroautophagy (GO:0016239)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein autoubiquitination (GO:0051865)|response to gamma radiation (GO:0010332)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|perinuclear endoplasmic reticulum (GO:0097038)	ligase activity (GO:0016874)|signal transducer activity (GO:0004871)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			large_intestine(5)|lung(2)|ovary(2)|upper_aerodigestive_tract(1)	10		Acute lymphoblastic leukemia(7;3.41e-06)|Lung NSC(96;3.08e-05)|Breast(56;9.7e-05)|Prostate(109;0.00174)|Hepatocellular(98;0.0207)|Myeloproliferative disorder(33;0.163)|Lung SC(185;0.187)|all_neural(104;0.19)		GBM - Glioblastoma multiforme(99;1.53e-10)|COAD - Colon adenocarcinoma(199;0.205)		CTTGAAGTTCCTCAGGCCTGT	0.358																																					.		.											.	TRIM13-228	0			.						.																																			SO:0001624	3_prime_UTR_variant	10206	.			AAGTTCCTCAGGC	AF220127	CCDS9423.1, CCDS41888.1	13q14	2013-01-09	2011-01-25	2006-09-26	ENSG00000204977	ENSG00000204977		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	9976	protein-coding gene	gene with protein product		605661	"""ret finger protein 2"", ""tripartite motif-containing 13"""	RFP2		9599022	Standard	NM_213590		Approved	Leu5, RNF77, DLEU5	uc001vdp.1	O60858	OTTHUMG00000016926	ENST00000378182.3:c.*2977C>A	13.37:g.50590277C>A		Somatic	54	0		WXS	Illumina GAIIx	Phase_I	63	24	.	0	0	0	0	0	B2RB49|Q5UBW0|Q5W0U8|Q5W0U9|Q9BQ47|Q9C021	RNA	SNP	ENST00000378182.3	37	CCDS9423.1																																																																																			.		0.358	TRIM13-005	KNOWN	alternative_5_UTR|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000354875.1	NM_001007278	
SLITRK1	114798	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	13	84454943	84454943	+	Missense_Mutation	SNP	C	C	A			TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr13:84454943C>A	ENST00000377084.2	-	1	1585	c.700G>T	c.(700-702)Gcc>Tcc	p.A234S		NM_001281503.1|NM_052910.1	NP_001268432.1|NP_443142.1	Q96PX8	SLIK1_HUMAN	SLIT and NTRK-like family, member 1	234	LRRCT 1.				adult behavior (GO:0030534)|axonogenesis (GO:0007409)|homeostatic process (GO:0042592)|multicellular organism growth (GO:0035264)	integral component of membrane (GO:0016021)				NS(2)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(22)|liver(1)|lung(36)|ovary(4)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	80	Medulloblastoma(90;0.18)	Breast(118;0.212)		GBM - Glioblastoma multiforme(99;0.07)		CCGATCAGGGCATTCTTGGGA	0.522																																					p.A234S		.											.	SLITRK1-94	0			c.G700T						.						59.0	59.0	59.0					13																	84454943		2203	4300	6503	SO:0001583	missense	114798	exon1			TCAGGGCATTCTT	AB067497	CCDS9464.1	13q31.1	2004-01-08	2004-01-08		ENSG00000178235	ENSG00000178235			20297	protein-coding gene	gene with protein product		609678	"""leucine rich repeat containing 12"""	LRRC12		14557068, 12975309	Standard	NM_001281503		Approved	KIAA1910	uc001vlk.3	Q96PX8	OTTHUMG00000017149	ENST00000377084.2:c.700G>T	13.37:g.84454943C>A	ENSP00000366288:p.Ala234Ser	Somatic	117	1		WXS	Illumina GAIIx	Phase_I	107	86	NM_052910	0	0	0	0	0	Q5U5I6|Q96SF9	Missense_Mutation	SNP	ENST00000377084.2	37	CCDS9464.1	.	.	.	.	.	.	.	.	.	.	C	11.17	1.558513	0.27827	.	.	ENSG00000178235	ENST00000377084	T	0.52526	0.66	4.72	4.72	0.59763	Cysteine-rich flanking region, C-terminal (1);	0.000000	0.85682	D	0.000000	T	0.39489	0.1080	L	0.32530	0.975	0.58432	D	0.999997	B	0.14438	0.01	B	0.22601	0.04	T	0.16070	-1.0415	10	0.27785	T	0.31	-10.4089	16.4091	0.83701	0.0:1.0:0.0:0.0	.	234	Q96PX8	SLIK1_HUMAN	S	234	ENSP00000366288:A234S	ENSP00000366288:A234S	A	-	1	0	SLITRK1	83352944	1.000000	0.71417	1.000000	0.80357	0.843000	0.47879	5.926000	0.70070	2.461000	0.83175	0.561000	0.74099	GCC	.		0.522	SLITRK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045396.1	NM_052910	
SLC15A1	6564	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	13	99339879	99339879	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr13:99339879C>T	ENST00000376503.5	-	21	1838	c.1783G>A	c.(1783-1785)Gaa>Aaa	p.E595K		NM_005073.3	NP_005064.1	P46059	S15A1_HUMAN	solute carrier family 15 (oligopeptide transporter), member 1	595					digestion (GO:0007586)|ion transport (GO:0006811)|protein transport (GO:0015031)|proton transport (GO:0015992)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	peptide:proton symporter activity (GO:0015333)|proton-dependent oligopeptide secondary active transmembrane transporter activity (GO:0005427)			breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(6)|lung(10)|ovary(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	30	all_neural(89;0.101)|Medulloblastoma(90;0.18)|Lung SC(71;0.184)				Aminolevulinic acid(DB00855)|Amoxicillin(DB01060)|Ampicillin(DB00415)|Azidocillin(DB08795)|Benazepril(DB00542)|Benzylpenicillin(DB01053)|Captopril(DB01197)|Cefaclor(DB00833)|Cefadroxil(DB01140)|Cefalotin(DB00456)|Cefdinir(DB00535)|Cefepime(DB01413)|Cefixime(DB00671)|Cefmetazole(DB00274)|Cefotaxime(DB00493)|Cefradine(DB01333)|Ceftazidime(DB00438)|Ceftibuten(DB01415)|Ceftizoxime(DB01332)|Ceftriaxone(DB01212)|Cefuroxime(DB01112)|Cephalexin(DB00567)|Chlorpropamide(DB00672)|Cilazapril(DB01340)|Cloxacillin(DB01147)|Cyclacillin(DB01000)|Dicloxacillin(DB00485)|Enalapril(DB00584)|Fluvastatin(DB01095)|Fosinopril(DB00492)|Glyburide(DB01016)|L-DOPA(DB01235)|Lisinopril(DB00722)|Methyldopa(DB00968)|Midodrine(DB00211)|Moexipril(DB00691)|Nateglinide(DB00731)|Oseltamivir(DB00198)|Oxacillin(DB00713)|Perindopril(DB00790)|Quinapril(DB00881)|Ramipril(DB00178)|Spirapril(DB01348)|Tolbutamide(DB01124)|Trandolapril(DB00519)|Valaciclovir(DB00577)|Valganciclovir(DB01610)	AAGACCACTTCGCCACAGGTG	0.448																																					p.E595K		.											.	SLC15A1-91	0			c.G1783A						.						133.0	122.0	125.0					13																	99339879		2203	4300	6503	SO:0001583	missense	6564	exon21			CCACTTCGCCACA	U13173	CCDS9489.1	13q32.3	2013-05-22			ENSG00000088386	ENSG00000088386		"""Solute carriers"""	10920	protein-coding gene	gene with protein product	"""peptide transporter HPEPT1"", ""bA551M18.1.1 (solute carrier family 15 (oligopeptide transporter) member 1)"", ""solute carrier family 15 oligopeptide transporter member 1"""	600544				7896779	Standard	NM_005073		Approved	PEPT1, HPECT1, HPEPT1	uc001vno.3	P46059	OTTHUMG00000017255	ENST00000376503.5:c.1783G>A	13.37:g.99339879C>T	ENSP00000365686:p.Glu595Lys	Somatic	116	0		WXS	Illumina GAIIx	Phase_I	118	19	NM_005073	0	0	0	0	0	Q5VW82	Missense_Mutation	SNP	ENST00000376503.5	37	CCDS9489.1	.	.	.	.	.	.	.	.	.	.	C	35	5.569532	0.96540	.	.	ENSG00000088386	ENST00000376503	T	0.52754	0.65	5.58	5.58	0.84498	Major facilitator superfamily domain, general substrate transporter (1);	0.000000	0.85682	D	0.000000	T	0.76471	0.3992	M	0.91768	3.24	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.81848	-0.0744	10	0.87932	D	0	-26.721	18.354	0.90351	0.0:1.0:0.0:0.0	.	595	P46059	S15A1_HUMAN	K	595	ENSP00000365686:E595K	ENSP00000365686:E595K	E	-	1	0	SLC15A1	98137880	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	7.218000	0.77991	2.624000	0.88883	0.655000	0.94253	GAA	.		0.448	SLC15A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045560.3	NM_005073	
CCDC168	643677	hgsc.bcm.edu;broad.mit.edu	37	13	103381996	103381996	+	Frame_Shift_Del	DEL	A	A	-	rs74709711|rs397851855		TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr13:103381996delA	ENST00000322527.2	-	1	7163	c.7164delT	c.(7162-7164)tttfs	p.F2388fs		NM_001146197.1	NP_001139669.1	Q8NDH2	CC168_HUMAN	coiled-coil domain containing 168	2388																	GTACACAGGCAAAAAAAAAGG	0.408																																					p.F7017fs		.											.	.	0			c.21051delT						.			28,1990		2,24,983	94.0	105.0	101.0			4.3	1.0	13	dbSNP_126	104	35,4075		2,31,2022	no	frameshift	CCDC168	NM_001146197.1		4,55,3005	A1A1,A1R,RR		0.8516,1.3875,1.0281			103381996	63,6065	692	1591	2283	SO:0001589	frameshift_variant	643677	exon4			ACAGGCAAAAAAA		CCDS73596.1	13q33.1	2014-06-17	2011-08-09	2011-08-09	ENSG00000175820	ENSG00000175820			26851	protein-coding gene	gene with protein product			"""chromosome 13 open reading frame 40"""	C13orf40			Standard	NM_001146197		Approved	FLJ40176	uc001vpm.3	Q8NDH2	OTTHUMG00000187287	ENST00000322527.2:c.7164delT	13.37:g.103381996delA	ENSP00000320232:p.Phe2388fs	Somatic	55	0		WXS	Illumina GAIIx	Phase_I	70	21	NM_001146197	0	0	0	0	0	Q8N800	Frame_Shift_Del	DEL	ENST00000322527.2	37																																																																																				.		0.408	CCDC168-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_001146197	
CCDC168	643677	hgsc.bcm.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	13	103391148	103391148	+	5'Flank	SNP	C	C	A			TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr13:103391148C>A	ENST00000322527.2	-	0	0					NM_001146197.1	NP_001139669.1	Q8NDH2	CC168_HUMAN	coiled-coil domain containing 168																		CTCCAAATCTCAACTTCTTTA	0.378																																					p.E3967X		.											.	.	0			c.G11899T						.						137.0	110.0	118.0					13																	103391148		692	1591	2283	SO:0001631	upstream_gene_variant	643677	exon4			AAATCTCAACTTC		CCDS73596.1	13q33.1	2014-06-17	2011-08-09	2011-08-09	ENSG00000175820	ENSG00000175820			26851	protein-coding gene	gene with protein product			"""chromosome 13 open reading frame 40"""	C13orf40			Standard	NM_001146197		Approved	FLJ40176	uc001vpm.3	Q8NDH2	OTTHUMG00000187287		13.37:g.103391148C>A	Exception_encountered	Somatic	40	0		WXS	Illumina GAIIx	Phase_I	37	32	NM_001146197	0	0	0	0	0	Q8N800	Nonsense_Mutation	SNP	ENST00000322527.2	37																																																																																				.		0.378	CCDC168-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_001146197	
SLC10A2	6555	broad.mit.edu;bcgsc.ca	37	13	103718400	103718400	+	Missense_Mutation	SNP	C	C	T	rs201168803		TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr13:103718400C>T	ENST00000245312.3	-	1	796	c.200G>A	c.(199-201)gGc>gAc	p.G67D		NM_000452.2	NP_000443	Q12908	NTCP2_HUMAN	solute carrier family 10 (sodium/bile acid cotransporter), member 2	67					bile acid and bile salt transport (GO:0015721)|bile acid metabolic process (GO:0008206)|small molecule metabolic process (GO:0044281)|transport (GO:0006810)	apical plasma membrane (GO:0016324)|integral component of plasma membrane (GO:0005887)|microvillus (GO:0005902)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|proteasome complex (GO:0000502)	bile acid:sodium symporter activity (GO:0008508)			breast(1)|endometrium(2)|large_intestine(6)|lung(16)|ovary(3)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	34	all_neural(89;0.0662)|Medulloblastoma(90;0.163)|Lung SC(71;0.211)				Aciclovir(DB00787)|Cyclosporine(DB00091)|Ursodeoxycholic acid(DB01586)|Valaciclovir(DB00577)	AACACAAATGCCCCACGGCCG	0.532																																					p.G67D		.											.	SLC10A2-94	0			c.G200A						.						132.0	130.0	131.0					13																	103718400		2203	4300	6503	SO:0001583	missense	6555	exon1			CAAATGCCCCACG	U10417	CCDS9506.1	13q33	2013-07-18	2013-07-18		ENSG00000125255	ENSG00000125255		"""Solute carriers"""	10906	protein-coding gene	gene with protein product		601295		ASBT, ISBT		8661017	Standard	NM_000452		Approved		uc001vpy.4	Q12908	OTTHUMG00000017313	ENST00000245312.3:c.200G>A	13.37:g.103718400C>T	ENSP00000245312:p.Gly67Asp	Somatic	139	0		WXS	Illumina GAIIx	Phase_I	158	15	NM_000452	0	0	0	0	0	A1L4F4|Q13839	Missense_Mutation	SNP	ENST00000245312.3	37	CCDS9506.1	.	.	.	.	.	.	.	.	.	.	C	22.7	4.319853	0.81469	.	.	ENSG00000125255	ENST00000245312	T	0.11604	2.76	5.4	5.4	0.78164	.	0.000000	0.85682	D	0.000000	T	0.29882	0.0747	L	0.54908	1.71	0.58432	D	0.999999	D	0.76494	0.999	D	0.79108	0.992	T	0.00423	-1.1748	10	0.33940	T	0.23	-10.3771	19.1895	0.93658	0.0:1.0:0.0:0.0	.	67	Q12908	NTCP2_HUMAN	D	67	ENSP00000245312:G67D	ENSP00000245312:G67D	G	-	2	0	SLC10A2	102516401	1.000000	0.71417	1.000000	0.80357	0.879000	0.50718	5.980000	0.70516	2.528000	0.85240	0.655000	0.94253	GGC	.		0.532	SLC10A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045716.1		
RPGRIP1	57096	bcgsc.ca	37	14	21793413	21793413	+	Silent	SNP	G	G	T			TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr14:21793413G>T	ENST00000400017.2	+	15	2238	c.2238G>T	c.(2236-2238)ggG>ggT	p.G746G	RPGRIP1_ENST00000556336.1_Intron|RPGRIP1_ENST00000206660.6_Silent_p.G746G|RPGRIP1_ENST00000553500.1_3'UTR|RPGRIP1_ENST00000307974.4_Silent_p.G105G|RPGRIP1_ENST00000557771.1_Silent_p.G708G|RPGRIP1_ENST00000382933.4_Intron	NM_020366.3	NP_065099.3	Q96KN7	RPGR1_HUMAN	retinitis pigmentosa GTPase regulator interacting protein 1	746			G -> E (in LCA6). {ECO:0000269|PubMed:11528500}.		eye photoreceptor cell development (GO:0042462)|response to stimulus (GO:0050896)|retina development in camera-type eye (GO:0060041)|visual perception (GO:0007601)	axoneme (GO:0005930)|nonmotile primary cilium (GO:0031513)				breast(3)|endometrium(2)|kidney(4)|large_intestine(11)|lung(10)|ovary(4)|pancreas(1)|prostate(3)|stomach(1)	39	all_cancers(95;0.0017)	all_cancers(140;0.0973)	Epithelial(56;6.24e-07)|all cancers(55;6.56e-06)	GBM - Glioblastoma multiforme(265;0.00888)		AAGAGTTCGGGGTTCTAGAGT	0.498																																					p.G746G		.											.	RPGRIP1-140	0			c.G2238T						.						49.0	48.0	48.0					14																	21793413		1878	4111	5989	SO:0001819	synonymous_variant	57096	exon15			GTTCGGGGTTCTA	AF227257	CCDS45080.1	14q11.2	2013-06-06			ENSG00000092200	ENSG00000092200			13436	protein-coding gene	gene with protein product		605446		RPGRIP		10958647, 10958648	Standard	NM_020366		Approved	RGI1, LCA6, CORD13	uc001wag.3	Q96KN7	OTTHUMG00000170758	ENST00000400017.2:c.2238G>T	14.37:g.21793413G>T		Somatic	128	4		WXS	Illumina GAIIx	Phase_I	261	120	NM_020366	0	0	0	0	0	Q7Z2W6|Q8IXV5|Q96QA8|Q9HB94|Q9HB95|Q9HBK6|Q9NR40	Silent	SNP	ENST00000400017.2	37	CCDS45080.1																																																																																			.		0.498	RPGRIP1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000410258.1	NM_020366	
SALL2	6297	broad.mit.edu;bcgsc.ca	37	14	21992636	21992636	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr14:21992636C>T	ENST00000327430.3	-	2	1520	c.1226G>A	c.(1225-1227)cGt>cAt	p.R409H	AE000658.22_ENST00000535893.1_RNA|SALL2_ENST00000538754.1_Intron|SALL2_ENST00000317492.5_Intron|SALL2_ENST00000450879.2_Missense_Mutation_p.R272H	NM_005407.1	NP_005398.1	Q9Y467	SALL2_HUMAN	spalt-like transcription factor 2	409					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.R409H(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(12)|lung(12)|ovary(2)|skin(6)|urinary_tract(2)	43	all_cancers(95;0.000662)			GBM - Glioblastoma multiforme(265;0.0151)		GGTGGTAAAACGGTTTCCACA	0.537																																					p.R409H		.											.	SALL2-92	1	Substitution - Missense(1)	large_intestine(1)	c.G1226A						.						124.0	103.0	110.0					14																	21992636		2203	4300	6503	SO:0001583	missense	6297	exon2			GTAAAACGGTTTC	AB002358	CCDS32045.1	14q11.1-q12.1	2013-10-17	2013-10-17		ENSG00000165821	ENSG00000165821		"""Zinc fingers, C2H2-type"""	10526	protein-coding gene	gene with protein product		602219	"""sal (Drosophila)-like 2"", ""sal-like 2 (Drosophila)"""			8975705	Standard	XM_005267983		Approved	KIAA0360, Hsal2, ZNF795	uc001wbe.3	Q9Y467	OTTHUMG00000168826	ENST00000327430.3:c.1226G>A	14.37:g.21992636C>T	ENSP00000333537:p.Arg409His	Somatic	290	1		WXS	Illumina GAIIx	Phase_I	548	12	NM_005407	0	0	8	8	0	B2RMX6|B9EGK8|Q8N656|Q9Y4G1	Missense_Mutation	SNP	ENST00000327430.3	37	CCDS32045.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	21.5|21.5	4.160985|4.160985	0.78226|0.78226	.|.	.|.	ENSG00000165821|ENSG00000165821	ENST00000327430;ENST00000450879;ENST00000541876|ENST00000546363	T;T|.	0.53640|.	0.61;0.61|.	4.63|4.63	4.63|4.63	0.57726|0.57726	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);|.	0.000000|.	0.38111|.	N|.	0.001809|.	T|T	0.55893|0.55893	0.1949|0.1949	L|L	0.33093|0.33093	0.98|0.98	0.58432|0.58432	D|D	0.999999|0.999999	D;D;D;D|.	0.89917|.	1.0;1.0;1.0;1.0|.	D;D;D;D|.	0.91635|.	0.999;0.999;0.999;0.999|.	T|T	0.51896|0.51896	-0.8647|-0.8647	10|5	0.87932|.	D|.	0|.	-36.6116|-36.6116	15.0135|15.0135	0.71567|0.71567	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	272;272;407;409|.	B4DK65;E7EW59;B4DFD9;Q9Y467|.	.;.;.;SALL2_HUMAN|.	H|I	409;272;409|268	ENSP00000333537:R409H;ENSP00000396773:R272H|.	ENSP00000333537:R409H|.	R|V	-|-	2|1	0|0	SALL2|SALL2	21062476|21062476	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.905000|0.905000	0.53344|0.53344	7.651000|7.651000	0.83577|0.83577	2.398000|2.398000	0.81561|0.81561	0.655000|0.655000	0.94253|0.94253	CGT|GTT	.		0.537	SALL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401242.1	NM_005407	
REM2	161253	broad.mit.edu;bcgsc.ca	37	14	23355347	23355347	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr14:23355347C>T	ENST00000267396.4	+	4	757	c.634C>T	c.(634-636)Cgg>Tgg	p.R212W	REM2_ENST00000536884.1_Missense_Mutation_p.S187L	NM_173527.2	NP_775798.2	Q8IYK8	REM2_HUMAN	RAS (RAD and GEM)-like GTP binding 2	212					small GTPase mediated signal transduction (GO:0007264)	plasma membrane (GO:0005886)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)			breast(1)|central_nervous_system(1)|large_intestine(2)|ovary(1)	5	all_cancers(95;4.69e-05)			GBM - Glioblastoma multiforme(265;0.012)		GACCCTACTTCGGCTCCGGGC	0.612																																					p.R212W		.											.	REM2-704	0			c.C634T						.						42.0	48.0	46.0					14																	23355347		1929	4127	6056	SO:0001583	missense	161253	exon4			CTACTTCGGCTCC		CCDS45082.1	14q11.2	2014-05-09	2006-12-14		ENSG00000139890	ENSG00000139890			20248	protein-coding gene	gene with protein product			"""RAS (RAD and GEM) like GTP binding 2"""			10727423	Standard	NM_173527		Approved	FLJ38964	uc001whf.1	Q8IYK8	OTTHUMG00000170277	ENST00000267396.4:c.634C>T	14.37:g.23355347C>T	ENSP00000267396:p.Arg212Trp	Somatic	134	1		WXS	Illumina GAIIx	Phase_I	281	13	NM_173527	0	0	0	0	0	B7Z5P1|Q8N8R8	Missense_Mutation	SNP	ENST00000267396.4	37	CCDS45082.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	14.04|14.04	2.416874|2.416874	0.42918|0.42918	.|.	.|.	ENSG00000139890|ENSG00000139890	ENST00000267396|ENST00000536884	T|T	0.77358|0.36699	-1.09|1.24	5.48|5.48	0.199|0.199	0.15175|0.15175	.|.	0.224273|.	0.39985|.	N|.	0.001202|.	T|T	0.29028|0.29028	0.0721|0.0721	L|L	0.51422|0.51422	1.61|1.61	0.22213|0.22213	N|N	0.999287|0.999287	B|B	0.12013|0.13594	0.005|0.008	B|B	0.09377|0.08055	0.004|0.003	T|T	0.29852|0.29852	-0.9998|-0.9998	10|9	0.72032|0.87932	D|D	0.01|0	.|.	5.4466|5.4466	0.16539|0.16539	0.3641:0.4516:0.1176:0.0667|0.3641:0.4516:0.1176:0.0667	.|.	212|187	Q8IYK8|B7Z5P1	REM2_HUMAN|.	W|L	212|187	ENSP00000267396:R212W|ENSP00000442774:S187L	ENSP00000267396:R212W|ENSP00000442774:S187L	R|S	+|+	1|2	2|0	REM2|REM2	22425187|22425187	0.986000|0.986000	0.35501|0.35501	0.791000|0.791000	0.31998|0.31998	0.650000|0.650000	0.38633|0.38633	1.139000|1.139000	0.31504|0.31504	-0.157000|-0.157000	0.11059|0.11059	-1.452000|-1.452000	0.01034|0.01034	CGG|TCG	.		0.612	REM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408290.1	NM_173527	
ACIN1	22985	bcgsc.ca	37	14	23549785	23549785	+	Missense_Mutation	SNP	T	T	C	rs3811182	byFrequency	TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10	T	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr14:23549785T>C	ENST00000262710.1	-	6	1260	c.933A>G	c.(931-933)atA>atG	p.I311M	ACIN1_ENST00000605057.1_Missense_Mutation_p.I253M|ACIN1_ENST00000457657.1_Missense_Mutation_p.I271M|ACIN1_ENST00000555053.1_Missense_Mutation_p.I311M|ACIN1_ENST00000555352.1_5'Flank	NM_001164814.1|NM_014977.3	NP_001158286.1|NP_055792	Q9UKV3	ACINU_HUMAN	apoptotic chromatin condensation inducer 1	311	Glu-rich.		I -> M (in dbSNP:rs3811182).		apoptotic chromosome condensation (GO:0030263)|apoptotic process (GO:0006915)|ATP catabolic process (GO:0006200)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|erythrocyte differentiation (GO:0030218)|mRNA processing (GO:0006397)|negative regulation of mRNA splicing, via spliceosome (GO:0048025)|positive regulation of apoptotic process (GO:0043065)|positive regulation of monocyte differentiation (GO:0045657)|RNA splicing (GO:0008380)	ASAP complex (GO:0061574)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATPase activity (GO:0016887)|enzyme binding (GO:0019899)|nucleic acid binding (GO:0003676)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(6)|kidney(4)|large_intestine(9)|lung(10)|ovary(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	37	all_cancers(95;1.36e-05)			GBM - Glioblastoma multiforme(265;0.00816)		TTACTCTAGGTATCTCTTCCC	0.458													C|||	2508	0.500799	0.6914	0.3689	5008	,	,		20323	0.4554		0.3777	False		,,,				2504	0.5102				p.I311M		.											.	ACIN1-156	0			c.A933G						.	C	MET/ILE,MET/ILE,MET/ILE	2869,1537	486.4+/-360.6	935,999,269	245.0	214.0	224.0		933,813,933	0.1	0.0	14	dbSNP_107	224	3543,5057	630.5+/-398.4	721,2101,1478	yes	missense,missense,missense	ACIN1	NM_001164814.1,NM_001164815.1,NM_014977.3	10,10,10	1656,3100,1747	CC,CT,TT		41.1977,34.8842,49.3003	benign,benign,benign	311/1329,271/1302,311/1342	23549785	6412,6594	2203	4300	6503	SO:0001583	missense	22985	exon6			TCTAGGTATCTCT	AB014570	CCDS9587.1, CCDS53887.1, CCDS53888.1, CCDS53889.1, CCDS55905.1	14q11.2	2008-11-25	2004-03-31	2004-04-01	ENSG00000100813	ENSG00000100813			17066	protein-coding gene	gene with protein product	"""functional spliceosome-associated protein 152"""	604562	"""apoptotic chromatin condensation inducer in the nucleus"""	ACINUS		9734811, 10490026	Standard	NM_014977		Approved	KIAA0670, fSAP152	uc001wit.4	Q9UKV3	OTTHUMG00000028716	ENST00000262710.1:c.933A>G	14.37:g.23549785T>C	ENSP00000262710:p.Ile311Met	Somatic	122	2		WXS	Illumina GAIIx	Phase_I	249	7	NM_001164814	0	0	20	20	0	B2RTT4|D3DS45|O75158|Q9UG91|Q9UKV1|Q9UKV2	Missense_Mutation	SNP	ENST00000262710.1	37	CCDS9587.1	989	0.45283882783882784	320	0.6504065040650406	136	0.3756906077348066	259	0.4527972027972028	274	0.36147757255936674	C	0.001	-3.379418	0.00015	0.651158	0.411977	ENSG00000100813	ENST00000262710;ENST00000457657;ENST00000555053	T;T;T	0.16457	2.34;2.34;2.34	4.16	0.113	0.14631	.	0.806596	0.10782	N	0.634812	T	0.00012	0.0000	N	0.02539	-0.55	0.80722	P	0.0	B;B	0.06786	0.001;0.001	B;B	0.06405	0.002;0.001	T	0.25433	-1.0132	9	0.32370	T	0.25	3.4746	3.2091	0.06676	0.2982:0.3234:0.0:0.3784	rs3811182;rs57721090;rs3811182	311;311	G3V3M7;Q9UKV3	.;ACINU_HUMAN	M	311;271;311	ENSP00000262710:I311M;ENSP00000405677:I271M;ENSP00000451328:I311M	ENSP00000262710:I311M	I	-	3	3	ACIN1	22619625	0.000000	0.05858	0.000000	0.03702	0.185000	0.23345	-3.042000	0.00632	-0.194000	0.10399	-2.211000	0.00300	ATA	T|0.511;C|0.489		0.458	ACIN1-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000071707.3	NM_014977	
EFS	10278	broad.mit.edu	37	14	23829997	23829997	+	Frame_Shift_Del	DEL	G	G	-			TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr14:23829997delG	ENST00000216733.3	-	2	671	c.64delC	c.(64-66)cagfs	p.Q22fs	EFS_ENST00000429593.2_Intron|EFS_ENST00000351354.3_Intron	NM_005864.2	NP_005855.1	O43281	EFS_HUMAN	embryonal Fyn-associated substrate	22	SH3. {ECO:0000255|PROSITE- ProRule:PRU00192}.				cell adhesion (GO:0007155)|intracellular signal transduction (GO:0035556)	cytoplasm (GO:0005737)	protein domain specific binding (GO:0019904)			endometrium(2)|kidney(1)|large_intestine(1)|liver(1)|lung(5)|pancreas(1)|prostate(3)|upper_aerodigestive_tract(2)	16	all_cancers(95;7.12e-06)			GBM - Glioblastoma multiforme(265;0.00649)		GACAGCTCCTGGGGGGACTCA	0.657																																					p.Q22fs		.											.	EFS-153	0			c.64delC						.						28.0	28.0	28.0					14																	23829997		2203	4298	6501	SO:0001589	frameshift_variant	10278	exon2			GCTCCTGGGGGGA	AB001466	CCDS9595.1, CCDS9596.1, CCDS61404.1	14q11.2-q12	2011-04-13			ENSG00000100842	ENSG00000100842		"""Cas scaffolding proteins"""	16898	protein-coding gene	gene with protein product	"""Cas scaffolding protein family member 3"""	609906				9349509	Standard	NM_005864		Approved	EFS2, EFS1, HEFS, SIN, CASS3	uc001wjo.4	O43281	OTTHUMG00000028741	ENST00000216733.3:c.64delC	14.37:g.23829997delG	ENSP00000216733:p.Gln22fs	Somatic	84	0		WXS	Illumina GAIIx	Phase_I	213	9	NM_005864	0	0	0	0	0	B2RAJ7|B4DJ56|E9PGU2|O43282	Frame_Shift_Del	DEL	ENST00000216733.3	37	CCDS9595.1																																																																																			.		0.657	EFS-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000071770.2		
MYH6	4624	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	14	23859651	23859651	+	Missense_Mutation	SNP	C	C	T	rs369247906		TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr14:23859651C>T	ENST00000356287.3	-	25	3376	c.3347G>A	c.(3346-3348)cGc>cAc	p.R1116H	MYH6_ENST00000405093.3_Missense_Mutation_p.R1116H|MIR208A_ENST00000362287.1_RNA			P13533	MYH6_HUMAN	myosin, heavy chain 6, cardiac muscle, alpha	1116					adult heart development (GO:0007512)|ATP catabolic process (GO:0006200)|atrial cardiac muscle tissue morphogenesis (GO:0055009)|BMP signaling pathway (GO:0030509)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle fiber development (GO:0048739)|in utero embryonic development (GO:0001701)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|myofibril assembly (GO:0030239)|regulation of ATPase activity (GO:0043462)|regulation of blood pressure (GO:0008217)|regulation of heart contraction (GO:0008016)|regulation of heart growth (GO:0060420)|regulation of heart rate (GO:0002027)|regulation of the force of heart contraction (GO:0002026)|sarcomere organization (GO:0045214)|striated muscle contraction (GO:0006941)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)|visceral muscle development (GO:0007522)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|muscle myosin complex (GO:0005859)|myofibril (GO:0030016)|myosin complex (GO:0016459)|myosin filament (GO:0032982)|nucleus (GO:0005634)|sarcomere (GO:0030017)|stress fiber (GO:0001725)|Z disc (GO:0030018)	actin-dependent ATPase activity (GO:0030898)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microfilament motor activity (GO:0000146)|protein kinase binding (GO:0019901)			breast(4)|cervix(2)|endometrium(8)|kidney(2)|large_intestine(16)|liver(1)|lung(60)|ovary(2)|pancreas(3)|prostate(6)|skin(6)|stomach(3)|upper_aerodigestive_tract(4)|urinary_tract(2)	119	all_cancers(95;2.54e-05)			GBM - Glioblastoma multiforme(265;0.00764)|READ - Rectum adenocarcinoma(4;0.0289)|Colorectal(4;0.0441)		ctcctcGATGCGTGCCTGGGT	0.632																																					p.R1116H		.											.	MYH6-94	0			c.G3347A						.	C	HIS/ARG	0,4406		0,0,2203	17.0	19.0	18.0		3347	4.2	0.9	14		18	1,8595		0,1,4297	no	missense	MYH6	NM_002471.3	29	0,1,6500	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging	1116/1940	23859651	1,13001	2203	4298	6501	SO:0001583	missense	4624	exon26			TCGATGCGTGCCT	D00943	CCDS9600.1	14q11.2-q13	2014-09-17	2008-08-01		ENSG00000197616	ENSG00000197616		"""Myosins / Myosin superfamily : Class II"""	7576	protein-coding gene	gene with protein product	"""cardiomyopathy, hypertrophic 1"""	160710	"""myosin, heavy polypeptide 6, cardiac muscle, alpha (cardiomyopathy, hypertrophic 1)"""			2144212	Standard	NM_002471		Approved		uc001wjv.3	P13533	OTTHUMG00000028753	ENST00000356287.3:c.3347G>A	14.37:g.23859651C>T	ENSP00000348634:p.Arg1116His	Somatic	23	0		WXS	Illumina GAIIx	Phase_I	103	39	NM_002471	0	0	0	0	0	A2RTX1|D9YZU2|Q13943|Q14906|Q14907	Missense_Mutation	SNP	ENST00000356287.3	37	CCDS9600.1	.	.	.	.	.	.	.	.	.	.	c	17.51	3.407393	0.62399	0.0	1.16E-4	ENSG00000197616	ENST00000405093;ENST00000356287	D;D	0.81579	-1.51;-1.51	4.25	4.25	0.50352	Myosin tail (1);	.	.	.	.	D	0.91099	0.7198	M	0.88241	2.94	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.93254	0.6637	9	0.87932	D	0	.	17.0442	0.86498	0.0:1.0:0.0:0.0	.	1116	P13533	MYH6_HUMAN	H	1116	ENSP00000386041:R1116H;ENSP00000348634:R1116H	ENSP00000348634:R1116H	R	-	2	0	MYH6	22929491	1.000000	0.71417	0.906000	0.35671	0.076000	0.17211	7.575000	0.82447	2.092000	0.63282	0.561000	0.74099	CGC	.		0.632	MYH6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000071796.3		
AP1G2	8906	bcgsc.ca	37	14	24031492	24031495	+	Splice_Site	DEL	CTTA	CTTA	-			TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10	CTTA	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr14:24031492_24031495delCTTA	ENST00000308724.5	-	15	2384		c.e15+1		AP1G2_ENST00000556277.1_5'Flank|RP11-66N24.3_ENST00000555968.1_RNA|AP1G2_ENST00000397120.3_Splice_Site|RP11-66N24.4_ENST00000553985.1_RNA	NM_003917.2	NP_003908.1	O75843	AP1G2_HUMAN	adaptor-related protein complex 1, gamma 2 subunit						intracellular protein transport (GO:0006886)|vesicle-mediated transport (GO:0016192)|viral process (GO:0016032)	AP-1 adaptor complex (GO:0030121)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|Golgi-associated vesicle (GO:0005798)|membrane (GO:0016020)|transport vesicle (GO:0030133)	protein transporter activity (GO:0008565)			breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(10)|lung(4)|ovary(1)|pancreas(1)|stomach(1)	28	all_cancers(95;0.000251)			GBM - Glioblastoma multiforme(265;0.00672)		GGGACCCCTTCTTACTTGTTGTCC	0.583											OREG0022605	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									.		.											.	AP1G2-45	0			.						.																																			SO:0001630	splice_region_variant	8906	.			CCCCTTCTTACTT	AB015318	CCDS9602.1	14q11.2	2008-07-03			ENSG00000213983	ENSG00000213983			556	protein-coding gene	gene with protein product		603534				9733768, 9762922	Standard	XM_005268167		Approved	G2AD	uc001wkl.2	O75843	OTTHUMG00000028760	ENST00000308724.5:c.1628+1TAAG>-	14.37:g.24031492_24031495delCTTA		Somatic	191	1	768	WXS	Illumina GAIIx	Phase_I	321	154	.	0	0	0	0	0	D3DS51|O75504	Splice_Site	DEL	ENST00000308724.5	37	CCDS9602.1																																																																																			.		0.583	AP1G2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000071812.4	NM_003917	Intron
LRRC16B	90668	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	14	24538366	24538366	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr14:24538366C>T	ENST00000342740.5	+	39	4157	c.4003C>T	c.(4003-4005)Cgg>Tgg	p.R1335W	LRRC16B_ENST00000334420.7_Missense_Mutation_p.R388W|CPNE6_ENST00000537691.1_5'Flank|CPNE6_ENST00000216775.2_5'Flank|CPNE6_ENST00000397016.2_5'Flank	NM_138360.3	NP_612369.3	Q8ND23	LR16B_HUMAN	leucine rich repeat containing 16B	1335						cytoplasm (GO:0005737)				breast(3)|central_nervous_system(2)|cervix(3)|endometrium(7)|kidney(1)|large_intestine(9)|liver(1)|lung(15)|ovary(2)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(4)	52				GBM - Glioblastoma multiforme(265;0.019)		TCCAGGCCGGCGGACTGCCCC	0.617																																					p.R1335W		.											.	LRRC16B-139	0			c.C4003T						.						37.0	40.0	39.0					14																	24538366		2203	4300	6503	SO:0001583	missense	90668	exon39			GGCCGGCGGACTG	AI017934	CCDS32054.1	14q11.2-q12	2010-09-10	2008-02-12	2008-02-12					20272	protein-coding gene	gene with protein product		614716	"""chromosome 14 open reading frame 121"""	C14orf121		19846667	Standard	NM_138360		Approved	BC008134, crml-1, CARMIL3	uc001wlj.2	Q8ND23		ENST00000342740.5:c.4003C>T	14.37:g.24538366C>T	ENSP00000340467:p.Arg1335Trp	Somatic	128	0		WXS	Illumina GAIIx	Phase_I	241	106	NM_138360	0	0	0	0	0	Q8TEF7|Q96HS9	Missense_Mutation	SNP	ENST00000342740.5	37	CCDS32054.1	.	.	.	.	.	.	.	.	.	.	C	19.82	3.897674	0.72639	.	.	ENSG00000186648	ENST00000342740;ENST00000334420	T;T	0.61627	0.09;0.09	5.18	3.19	0.36642	.	0.000000	0.39687	N	0.001293	T	0.58991	0.2161	N	0.19112	0.55	0.31332	N	0.684713	D;D	0.89917	1.0;1.0	D;D	0.83275	0.996;0.99	T	0.62992	-0.6736	10	0.62326	D	0.03	-23.1754	10.0437	0.42173	0.3873:0.6127:0.0:0.0	.	388;1335	Q8ND23-2;Q8ND23	.;LR16B_HUMAN	W	1335;388	ENSP00000340467:R1335W;ENSP00000334701:R388W	ENSP00000334701:R388W	R	+	1	2	LRRC16B	23608206	0.526000	0.26298	0.997000	0.53966	0.954000	0.61252	0.240000	0.18042	1.384000	0.46424	0.655000	0.94253	CGG	.		0.617	LRRC16B-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000416527.1	NM_138360	
NYNRIN	57523	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	14	24885257	24885258	+	Frame_Shift_Del	DEL	CT	CT	-			TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10	CT	CT	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr14:24885257_24885258delCT	ENST00000382554.3	+	9	4620_4621	c.4302_4303delCT	c.(4300-4305)ggctctfs	p.S1435fs		NM_025081.2	NP_079357.2	Q9P2P1	NYNRI_HUMAN	NYN domain and retroviral integrase containing	1435					DNA integration (GO:0015074)	integral component of membrane (GO:0016021)	nucleic acid binding (GO:0003676)			breast(3)|central_nervous_system(1)|endometrium(7)|kidney(6)|large_intestine(8)|lung(21)|ovary(2)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	56						CCTACCGGGGCTCTCTGTTTGC	0.594																																					p.1434_1435del		.											.	NYNRIN-3	0			c.4302_4303del						.																																			SO:0001589	frameshift_variant	57523	exon9			CCGGGGCTCTCTG	AB037726	CCDS45090.1	14q11.2	2009-10-14	2009-10-14	2009-10-14		ENSG00000205978			20165	protein-coding gene	gene with protein product	"""Cousin of GIN1"""		"""KIAA1305"""	KIAA1305		19561090, 17114934	Standard	NM_025081		Approved	FLJ11811, CGIN1	uc001wpf.4	Q9P2P1		ENST00000382554.3:c.4302_4303delCT	14.37:g.24885261_24885262delCT	ENSP00000371994:p.Ser1435fs	Somatic	68	0		WXS	Illumina GAIIx	Phase_I	124	74	NM_025081	0	0	0	0	0	Q6P153|Q86TR3|Q9HAC4	Frame_Shift_Del	DEL	ENST00000382554.3	37	CCDS45090.1																																																																																			.		0.594	NYNRIN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412939.1		
C14orf23	387978	bcgsc.ca	37	14	29261305	29261305	+	Frame_Shift_Del	DEL	A	A	-	rs202195469|rs200251419		TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10	A	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr14:29261305delA	ENST00000399387.4	+	3	446	c.342delA	c.(340-342)ctafs	p.L114fs	C14orf23_ENST00000550266.1_Intron|C14orf23_ENST00000548213.1_Intron					chromosome 14 open reading frame 23											central_nervous_system(1)	1						CTTCAGCACTAAAAAAAACAA	0.378																																					.		.											.	C14orf23-23	0			.						.																																			SO:0001589	frameshift_variant	387978	.			AGCACTAAAAAAA			14q11.2	2013-01-15			ENSG00000186960	ENSG00000186960			19828	other	unknown							Standard	NR_026731		Approved		uc001wqf.3	Q86U37	OTTHUMG00000029410	ENST00000399387.4:c.342delA	14.37:g.29261305delA	ENSP00000382318:p.Leu114fs	Somatic	72	9		WXS	Illumina GAIIx	Phase_I	152	83	.	0	0	0	0	0		RNA	DEL	ENST00000399387.4	37																																																																																				-|0.667;AAC|0.333		0.378	C14orf23-003	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000134019.2	NR_026731	
INSM2	84684	broad.mit.edu	37	14	36004658	36004658	+	Silent	SNP	C	C	A			TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr14:36004658C>A	ENST00000307169.3	+	1	1411	c.1200C>A	c.(1198-1200)ggC>ggA	p.G400G		NM_032594.3	NP_115983.3	Q96T92	INSM2_HUMAN	insulinoma-associated 2	400					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(3)|kidney(1)|large_intestine(1)|lung(3)|skin(1)|urinary_tract(1)	10	Breast(36;0.122)|Hepatocellular(127;0.158)		LUAD - Lung adenocarcinoma(9;2.16e-07)|Lung(238;2.63e-07)|Epithelial(34;0.00145)|all cancers(34;0.00452)	GBM - Glioblastoma multiforme(112;0.0223)		TGCCTCAGGGCCCCTACACGG	0.682																																					p.G400G		.											.	INSM2-226	0			c.C1200A						.						24.0	30.0	28.0					14																	36004658		2160	4279	6439	SO:0001819	synonymous_variant	84684	exon1			TCAGGGCCCCTAC	AF260323	CCDS9657.1	14q13.1	2013-01-08			ENSG00000168348	ENSG00000168348		"""Zinc fingers, C2H2-type"""	17539	protein-coding gene	gene with protein product	"""mlt 1"""	614027					Standard	NM_032594		Approved	IA-6	uc001wth.1	Q96T92	OTTHUMG00000140223	ENST00000307169.3:c.1200C>A	14.37:g.36004658C>A		Somatic	39	1		WXS	Illumina GAIIx	Phase_I	146	5	NM_032594	0	0	0	0	0	A1L432|J9Y024|Q8N8K7|Q96Q84	Silent	SNP	ENST00000307169.3	37	CCDS9657.1																																																																																			.		0.682	INSM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276686.1		
FBXO34	55030	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	14	55818555	55818555	+	Frame_Shift_Del	DEL	T	T	-			TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr14:55818555delT	ENST00000313833.4	+	2	1692	c.1447delT	c.(1447-1449)tttfs	p.F484fs	FBXO34_ENST00000440021.1_Frame_Shift_Del_p.F484fs	NM_017943.3	NP_060413.2	Q9NWN3	FBX34_HUMAN	F-box protein 34	484										breast(2)|kidney(2)|large_intestine(4)|lung(5)|ovary(3)|pancreas(1)|skin(2)|stomach(3)	22						AGGGATGTTGTTTTTTTTGCC	0.443																																					p.F483fs		.											.	FBXO34-228	0			c.1447delT						.						95.0	94.0	94.0					14																	55818555		2203	4300	6503	SO:0001589	frameshift_variant	55030	exon2			ATGTTGTTTTTTT	AK000732	CCDS32086.1	14q22.1	2004-08-24	2004-06-15			ENSG00000178974		"""F-boxes /  ""other"""""	20201	protein-coding gene	gene with protein product		609104	"""F-box only protein 34"""				Standard	NM_017943		Approved	FLJ20725, Fbx34	uc010aoo.3	Q9NWN3		ENST00000313833.4:c.1447delT	14.37:g.55818555delT	ENSP00000313159:p.Phe484fs	Somatic	106	0		WXS	Illumina GAIIx	Phase_I	197	78	NM_017943	0	0	0	0	0	Q2VPB5|Q4VBP5|Q86TY4	Frame_Shift_Del	DEL	ENST00000313833.4	37	CCDS32086.1																																																																																			.		0.443	FBXO34-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000411322.1		
SYNE2	23224	broad.mit.edu;ucsc.edu;bcgsc.ca	37	14	64596621	64596621	+	Splice_Site	SNP	T	T	C			TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr14:64596621T>C	ENST00000344113.4	+	75	14351		c.e75+2		ESR2_ENST00000542956.1_Intron|SYNE2_ENST00000394768.2_Splice_Site|SYNE2_ENST00000357395.3_Splice_Site|SYNE2_ENST00000554584.1_Splice_Site|SYNE2_ENST00000555002.1_Splice_Site|SYNE2_ENST00000358025.3_Splice_Site	NM_015180.4	NP_055995.4	Q8WXH0	SYNE2_HUMAN	spectrin repeat containing, nuclear envelope 2						centrosome localization (GO:0051642)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment or maintenance of cell polarity (GO:0007163)|fibroblast migration (GO:0010761)|nuclear envelope organization (GO:0006998)|nuclear migration (GO:0007097)|nuclear migration along microfilament (GO:0031022)|positive regulation of cell migration (GO:0030335)|protein localization to nucleus (GO:0034504)	aggresome (GO:0016235)|cytoplasm (GO:0005737)|filopodium membrane (GO:0031527)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|intermediate filament cytoskeleton (GO:0045111)|lamellipodium membrane (GO:0031258)|mitochondrion (GO:0005739)|nuclear envelope (GO:0005635)|nuclear lumen (GO:0031981)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|sarcoplasmic reticulum (GO:0016529)|SUN-KASH complex (GO:0034993)|Z disc (GO:0030018)	actin binding (GO:0003779)			NS(5)|breast(17)|central_nervous_system(3)|cervix(8)|endometrium(17)|haematopoietic_and_lymphoid_tissue(2)|kidney(21)|large_intestine(34)|lung(75)|ovary(10)|pancreas(2)|prostate(8)|skin(8)|stomach(1)|upper_aerodigestive_tract(9)|urinary_tract(4)	224				all cancers(60;0.00153)|OV - Ovarian serous cystadenocarcinoma(108;0.00444)|BRCA - Breast invasive adenocarcinoma(234;0.0681)		AAATTAGAGGTATGCCTGAGC	0.468																																					.		.											.	SYNE2-164	0			c.14139+2T>C						.						111.0	109.0	110.0					14																	64596621		2203	4300	6503	SO:0001630	splice_region_variant	23224	exon75			TAGAGGTATGCCT	AB023228	CCDS9761.2, CCDS41963.1, CCDS45124.1, CCDS45125.1	14q22.1-q22.3	2014-09-17			ENSG00000054654	ENSG00000054654			17084	protein-coding gene	gene with protein product	"""nuclear envelope spectrin repeat-2"", ""nucleus and actin connecting element"""	608442				10231032, 10878022	Standard	NM_182910		Approved	SYNE-2, DKFZP434H2235, Nesprin-2, NUANCE, NUA, KIAA1011, Nesp2	uc001xgl.3	Q8WXH0	OTTHUMG00000140349	ENST00000344113.4:c.14139+2T>C	14.37:g.64596621T>C		Somatic	91	2		WXS	Illumina GAIIx	Phase_I	230	95	NM_182914	0	0	0	0	0	Q540G1|Q8N1S3|Q8NF49|Q8TER7|Q8WWW3|Q8WWW4|Q8WWW5|Q8WXH1|Q9NU50|Q9UFQ4|Q9Y2L4|Q9Y4R1	Splice_Site	SNP	ENST00000344113.4	37	CCDS41963.1	.	.	.	.	.	.	.	.	.	.	T	18.37	3.609547	0.66558	.	.	ENSG00000054654	ENST00000358025;ENST00000357395;ENST00000344113;ENST00000554584;ENST00000261678;ENST00000555002;ENST00000394768	.	.	.	4.81	4.81	0.61882	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.6679	0.68921	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	+	.	.	SYNE2	63666374	1.000000	0.71417	0.981000	0.43875	0.808000	0.45660	5.753000	0.68736	1.947000	0.56498	0.533000	0.62120	.	.		0.468	SYNE2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276994.2	NM_182914	Intron
ZBTB1	22890	broad.mit.edu	37	14	64989787	64989787	+	Frame_Shift_Del	DEL	A	A	-			TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr14:64989787delA	ENST00000554015.1	+	4	1996	c.1565delA	c.(1564-1566)caafs	p.Q522fs	RP11-973N13.4_ENST00000554918.1_RNA|ZBTB1_ENST00000358738.3_Frame_Shift_Del_p.Q522fs|ZBTB1_ENST00000394712.2_Frame_Shift_Del_p.Q522fs			Q9Y2K1	ZBTB1_HUMAN	zinc finger and BTB domain containing 1	522					B cell differentiation (GO:0030183)|innate immune response (GO:0045087)|mRNA transcription from RNA polymerase II promoter (GO:0042789)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of natural killer cell differentiation (GO:0032825)|positive regulation of pro-T cell differentiation (GO:2000176)|positive regulation of T cell differentiation (GO:0045582)|positive regulation of T cell mediated immunity (GO:0002711)|protein homooligomerization (GO:0051260)|T cell differentiation in thymus (GO:0033077)|thymus development (GO:0048538)	nuclear body (GO:0016604)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)			kidney(1)|large_intestine(3)|lung(7)|prostate(1)|skin(1)	13		all_lung(585;0.000567)|Myeloproliferative disorder(585;0.0255)|all_neural(303;0.0294)		UCEC - Uterine corpus endometrioid carcinoma (185;0.0182)|all cancers(60;3.78e-43)|OV - Ovarian serous cystadenocarcinoma(108;1.22e-20)|BRCA - Breast invasive adenocarcinoma(234;6.75e-06)|KIRC - Kidney renal clear cell carcinoma(182;0.00269)|STAD - Stomach adenocarcinoma(64;0.012)		AACAGTATCCAAAAAAAGCAG	0.378																																					p.Q522fs		.											.	ZBTB1-91	0			c.1565delA						.						142.0	148.0	146.0					14																	64989787		2203	4300	6503	SO:0001589	frameshift_variant	22890	exon2			GTATCCAAAAAAA	AB023214	CCDS32097.1, CCDS45126.1	14q23.3	2013-01-09			ENSG00000126804	ENSG00000126804		"""-"", ""BTB/POZ domain containing"", ""Zinc fingers, C2H2-type"""	20259	protein-coding gene	gene with protein product						10231032	Standard	NM_014950		Approved	KIAA0997, ZNF909	uc010aqg.3	Q9Y2K1		ENST00000554015.1:c.1565delA	14.37:g.64989787delA	ENSP00000451000:p.Gln522fs	Somatic	108	0		WXS	Illumina GAIIx	Phase_I	198	13	NM_014950	0	0	0	0	0	A8K6S8|Q86SW8	Frame_Shift_Del	DEL	ENST00000554015.1	37	CCDS45126.1																																																																																			.		0.378	ZBTB1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000411912.1		
GPR68	8111	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	14	91701094	91701094	+	Missense_Mutation	SNP	G	G	T			TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr14:91701094G>T	ENST00000531499.2	-	2	640	c.301C>A	c.(301-303)Ctg>Atg	p.L101M	GPR68_ENST00000529300.1_5'Flank|GPR68_ENST00000535815.1_Missense_Mutation_p.L101M|GPR68_ENST00000238699.3_Missense_Mutation_p.L111M			Q15743	OGR1_HUMAN	G protein-coupled receptor 68	101					cellular response to pH (GO:0071467)|G-protein coupled receptor signaling pathway (GO:0007186)|inflammatory response (GO:0006954)|negative regulation of monocyte differentiation (GO:0045656)|positive regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0035774)|positive regulation of osteoclast development (GO:2001206)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			central_nervous_system(2)|endometrium(1)|kidney(1)|lung(2)|skin(1)|urinary_tract(1)	8		all_cancers(154;0.0555)		COAD - Colon adenocarcinoma(157;0.21)		TTCTCGTACAGGAGGATGCCG	0.612																																					p.L101M		.											.	GPR68-91	0			c.C301A						.						69.0	55.0	60.0					14																	91701094		2203	4300	6503	SO:0001583	missense	8111	exon2			CGTACAGGAGGAT	U48405	CCDS9894.1, CCDS9894.2	14q31	2012-08-21				ENSG00000119714		"""GPCR / Class A : Orphans"""	4519	protein-coding gene	gene with protein product		601404				8661159	Standard	NM_001177676		Approved	OGR1	uc001xzg.3	Q15743		ENST00000531499.2:c.301C>A	14.37:g.91701094G>T	ENSP00000434045:p.Leu101Met	Somatic	186	0		WXS	Illumina GAIIx	Phase_I	405	199	NM_001177676	0	0	0	0	0	Q13334|Q4VBB4|Q6IX34	Missense_Mutation	SNP	ENST00000531499.2	37	CCDS9894.2	.	.	.	.	.	.	.	.	.	.	G	13.37	2.216892	0.39201	.	.	ENSG00000119714	ENST00000531499;ENST00000238699;ENST00000535815;ENST00000529102	T;T;T;T	0.37915	1.17;1.17;1.17;1.17	5.28	5.28	0.74379	GPCR, rhodopsin-like superfamily (1);	0.000000	0.64402	D	0.000002	T	0.47469	0.1447	L	0.41236	1.265	0.42351	D	0.992374	D;D	0.89917	1.0;1.0	D;D	0.83275	0.996;0.996	T	0.33007	-0.9885	10	0.32370	T	0.25	.	10.5608	0.45144	0.1501:0.0:0.8499:0.0	.	101;101	Q6NWR5;Q15743	.;OGR1_HUMAN	M	101;111;101;101	ENSP00000434045:L101M;ENSP00000238699:L111M;ENSP00000440797:L101M;ENSP00000432740:L101M	ENSP00000238699:L111M	L	-	1	2	GPR68	90770847	1.000000	0.71417	0.972000	0.41901	0.996000	0.88848	3.626000	0.54245	2.455000	0.83008	0.561000	0.74099	CTG	.		0.612	GPR68-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395245.2		
GSC	145258	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	14	95235475	95235475	+	Silent	SNP	C	C	T			TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr14:95235475C>T	ENST00000238558.3	-	2	644	c.435G>A	c.(433-435)tcG>tcA	p.S145S		NM_173849.2	NP_776248.1	P56915	GSC_HUMAN	goosecoid homeobox	145					dorsal/ventral neural tube patterning (GO:0021904)|embryonic skeletal system morphogenesis (GO:0048704)|forebrain development (GO:0030900)|gastrulation (GO:0007369)|middle ear morphogenesis (GO:0042474)|muscle organ morphogenesis (GO:0048644)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of Wnt signaling pathway (GO:0030178)|neural crest cell fate specification (GO:0014036)|signal transduction involved in regulation of gene expression (GO:0023019)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	RNA polymerase II repressing transcription factor binding (GO:0001103)|RNA polymerase II transcription factor binding (GO:0001085)|sequence-specific DNA binding (GO:0043565)			skin(1)	1		all_cancers(154;0.0896)|all_epithelial(191;0.219)		COAD - Colon adenocarcinoma(157;0.202)|Epithelial(152;0.239)		GCTCGGTGCGCGACAGCGTGC	0.657																																					p.S145S	Pancreas(105;2165 2186 4892 18008)	.											.	GSC-90	0			c.G435A						.						21.0	16.0	18.0					14																	95235475		2193	4294	6487	SO:0001819	synonymous_variant	145258	exon2			GGTGCGCGACAGC		CCDS9930.1	14q32.13	2011-06-20	2007-07-11			ENSG00000133937		"""Homeoboxes / PRD class"""	4612	protein-coding gene	gene with protein product		138890				7916327	Standard	NM_173849		Approved		uc001ydu.3	P56915		ENST00000238558.3:c.435G>A	14.37:g.95235475C>T		Somatic	114	0		WXS	Illumina GAIIx	Phase_I	343	83	NM_173849	0	0	0	0	0	Q86YR1	Silent	SNP	ENST00000238558.3	37	CCDS9930.1																																																																																			.		0.657	GSC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000410746.1		
BDKRB2	624	broad.mit.edu;bcgsc.ca;mdanderson.org	37	14	96706741	96706741	+	Splice_Site	SNP	G	G	A	rs200693201		TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr14:96706741G>A	ENST00000306005.3	+	3	272	c.76G>A	c.(76-78)Gcc>Acc	p.A26T	BDKRB2_ENST00000539359.1_5'UTR|BDKRB2_ENST00000554311.1_Splice_Site_p.A26T|RP11-404P21.8_ENST00000553811.1_Intron|BDKRB2_ENST00000542454.2_5'UTR	NM_000623.3	NP_000614.1	P30411	BKRB2_HUMAN	bradykinin receptor B2	26					arachidonic acid secretion (GO:0050482)|blood circulation (GO:0008015)|cell surface receptor signaling pathway (GO:0007166)|G-protein coupled receptor signaling pathway (GO:0007186)|inflammatory response (GO:0006954)|metabolic process (GO:0008152)|negative regulation of intrinsic apoptotic signaling pathway in response to osmotic stress by p53 class mediator (GO:1902239)|negative regulation of peptidyl-serine phosphorylation (GO:0033137)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|regulation of vascular permeability (GO:0043114)|regulation of vasoconstriction (GO:0019229)|response to salt stress (GO:0009651)|smooth muscle contraction (GO:0006939)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|vasoconstriction (GO:0042310)|vasodilation (GO:0042311)	endosome (GO:0005768)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	bradykinin receptor activity (GO:0004947)|phosphatidylinositol phospholipase C activity (GO:0004435)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|type 1 angiotensin receptor binding (GO:0031702)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(5)|lung(7)|ovary(3)|skin(1)	24		all_cancers(154;0.0678)|Melanoma(154;0.155)|all_epithelial(191;0.179)		COAD - Colon adenocarcinoma(157;0.226)	Icatibant(DB06196)	TTCTTTCAGCGCCGACATGCT	0.552																																					p.A26T		.											.	BDKRB2-662	0			c.G76A						.						200.0	217.0	211.0					14																	96706741		2202	4300	6502	SO:0001630	splice_region_variant	624	exon3			TTCAGCGCCGACA	S56772	CCDS9942.1	14q32.1-q32.2	2012-08-08				ENSG00000168398		"""GPCR / Class A : Bradykinin receptors"""	1030	protein-coding gene	gene with protein product		113503				7916737	Standard	NM_000623		Approved	BK-2	uc010avm.1	P30411		ENST00000306005.3:c.75-1G>A	14.37:g.96706741G>A		Somatic	86	1		WXS	Illumina GAIIx	Phase_I	148	68	NM_000623	0	0	0	0	0		Missense_Mutation	SNP	ENST00000306005.3	37	CCDS9942.1	.	.	.	.	.	.	.	.	.	.	g	8.420	0.846275	0.16963	.	.	ENSG00000168398	ENST00000554311;ENST00000306005	T;T	0.70986	-0.53;-0.53	4.83	-7.43	0.01383	.	2.294120	0.01971	N	0.044132	T	0.37293	0.0998	N	0.08118	0	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.49437	-0.8940	10	0.02654	T	1	-0.0964	0.7593	0.01004	0.3814:0.1132:0.1789:0.3265	.	26	P30411	BKRB2_HUMAN	T	26	ENSP00000450482:A26T;ENSP00000307713:A26T	ENSP00000307713:A26T	A	+	1	0	BDKRB2	95776494	0.000000	0.05858	0.000000	0.03702	0.033000	0.12548	-1.280000	0.02804	-1.391000	0.02085	-0.215000	0.12644	GCC	.		0.552	BDKRB2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000413294.1		Missense_Mutation
ADSSL1	122622	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	14	105201420	105201420	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr14:105201420C>T	ENST00000330877.2	+	2	341	c.256C>T	c.(256-258)Ccc>Tcc	p.P86S	ADSSL1_ENST00000332972.5_Missense_Mutation_p.P129S	NM_152328.3	NP_689541.1			adenylosuccinate synthase like 1											central_nervous_system(1)|cervix(1)|kidney(1)|lung(5)|ovary(2)|prostate(1)	11		all_cancers(154;0.0896)|Melanoma(154;0.155)|all_epithelial(191;0.172)	all cancers(16;0.00153)|OV - Ovarian serous cystadenocarcinoma(23;0.0148)|Epithelial(46;0.0396)|GBM - Glioblastoma multiforme(11;0.116)	Epithelial(152;0.18)		CCACCTGCTGCCCAGCGGCAT	0.627																																					p.P129S		.											.	ADSSL1-515	0			c.C385T						.						74.0	58.0	63.0					14																	105201420		2203	4300	6503	SO:0001583	missense	122622	exon2			CTGCTGCCCAGCG	AK095921	CCDS9990.1, CCDS9991.1	14q32.33	2010-08-05			ENSG00000185100	ENSG00000185100			20093	protein-coding gene	gene with protein product		612498					Standard	NM_199165		Approved	FLJ38602	uc001ype.3	Q8N142		ENST00000330877.2:c.256C>T	14.37:g.105201420C>T	ENSP00000331260:p.Pro86Ser	Somatic	201	1		WXS	Illumina GAIIx	Phase_I	459	89	NM_199165	0	0	3	5	2		Missense_Mutation	SNP	ENST00000330877.2	37	CCDS9990.1	.	.	.	.	.	.	.	.	.	.	C	26.5	4.741179	0.89573	.	.	ENSG00000185100	ENST00000330877;ENST00000332972	T;T	0.73681	-0.77;-0.77	3.72	3.72	0.42706	.	0.000000	0.85682	D	0.000000	D	0.90765	0.7101	H	0.97365	3.99	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.997;0.998	D	0.94331	0.7562	10	0.87932	D	0	-12.0502	15.6745	0.77303	0.0:1.0:0.0:0.0	.	129;86	Q8N142-2;Q8N142	.;PURA1_HUMAN	S	86;129	ENSP00000331260:P86S;ENSP00000333019:P129S	ENSP00000331260:P86S	P	+	1	0	ADSSL1	104272465	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	7.491000	0.81471	1.914000	0.55421	0.561000	0.74099	CCC	.		0.627	ADSSL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000410529.1		
ADSSL1	122622	broad.mit.edu	37	14	105201447	105201447	+	Missense_Mutation	SNP	G	G	A	rs554970016		TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr14:105201447G>A	ENST00000330877.2	+	2	368	c.283G>A	c.(283-285)Gtg>Atg	p.V95M	ADSSL1_ENST00000332972.5_Missense_Mutation_p.V138M	NM_152328.3	NP_689541.1			adenylosuccinate synthase like 1											central_nervous_system(1)|cervix(1)|kidney(1)|lung(5)|ovary(2)|prostate(1)	11		all_cancers(154;0.0896)|Melanoma(154;0.155)|all_epithelial(191;0.172)	all cancers(16;0.00153)|OV - Ovarian serous cystadenocarcinoma(23;0.0148)|Epithelial(46;0.0396)|GBM - Glioblastoma multiforme(11;0.116)	Epithelial(152;0.18)		CACCAAGGCCGTGTCCTTCAT	0.647																																					p.V138M		.											.	ADSSL1-515	0			c.G412A						.						65.0	50.0	55.0					14																	105201447		2203	4300	6503	SO:0001583	missense	122622	exon2			AAGGCCGTGTCCT	AK095921	CCDS9990.1, CCDS9991.1	14q32.33	2010-08-05			ENSG00000185100	ENSG00000185100			20093	protein-coding gene	gene with protein product		612498					Standard	NM_199165		Approved	FLJ38602	uc001ype.3	Q8N142		ENST00000330877.2:c.283G>A	14.37:g.105201447G>A	ENSP00000331260:p.Val95Met	Somatic	197	0		WXS	Illumina GAIIx	Phase_I	462	10	NM_199165	0	0	0	0	0		Missense_Mutation	SNP	ENST00000330877.2	37	CCDS9990.1	.	.	.	.	.	.	.	.	.	.	G	12.61	1.990160	0.35131	.	.	ENSG00000185100	ENST00000330877;ENST00000332972	T;T	0.44881	0.91;0.91	3.72	1.84	0.25277	.	0.471926	0.22193	N	0.063342	T	0.24661	0.0598	L	0.42487	1.325	0.58432	D	0.999998	P;B	0.36171	0.541;0.149	B;B	0.24269	0.052;0.022	T	0.05937	-1.0855	10	0.51188	T	0.08	-12.6825	3.1947	0.06629	0.3615:0.2102:0.4283:0.0	.	138;95	Q8N142-2;Q8N142	.;PURA1_HUMAN	M	95;138	ENSP00000331260:V95M;ENSP00000333019:V138M	ENSP00000331260:V95M	V	+	1	0	ADSSL1	104272492	0.940000	0.31905	0.552000	0.28243	0.484000	0.33280	1.899000	0.39818	0.254000	0.21573	-0.264000	0.10439	GTG	.		0.647	ADSSL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000410529.1		
CEP170B	283638	broad.mit.edu	37	14	105352885	105352890	+	In_Frame_Del	DEL	GCAGGA	GCAGGA	-	rs60001925|rs150426191	byFrequency	TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr14:105352885_105352890delGCAGGA	ENST00000414716.3	+	12	2537_2542	c.2309_2314delGCAGGA	c.(2308-2316)cgcaggagc>cgc	p.RS771del	CEP170B_ENST00000453495.1_In_Frame_Del_p.RS772del|CEP170B_ENST00000556508.1_In_Frame_Del_p.RS701del|CEP170B_ENST00000418279.1_In_Frame_Del_p.RS701del	NM_001112726.2	NP_001106197.1	Q9Y4F5	C170B_HUMAN	centrosomal protein 170B	771						cytoplasm (GO:0005737)|microtubule (GO:0005874)											GACAGCAGACGCAGGAGCCCCCAGGA	0.694														358	0.0714856	0.0061	0.1196	5008	,	,		13278	0.1091		0.0775	False		,,,				2504	0.0808				p.770_772del		.											.	.	0			c.2309_2314del						.		,	62,3458		5,52,1703					,	3.2	0.0		dbSNP_129	9	575,7107		59,457,3325	no	coding,coding	KIAA0284	NM_015005.2,NM_001112726.2	,	64,509,5028	A1A1,A1R,RR		7.485,1.7614,5.6865	,	,		637,10565				SO:0001651	inframe_deletion	283638	exon12			GCAGACGCAGGAG	AB006622	CCDS45175.1, CCDS45176.1, CCDS45176.2	14q32.33	2014-02-20	2012-11-30	2012-11-30	ENSG00000099814	ENSG00000099814			20362	protein-coding gene	gene with protein product	"""Cep170-related"""		"""KIAA0284"""	KIAA0284		23087211	Standard	NM_015005		Approved	FAM68C, Cep170R	uc010axb.4	Q9Y4F5	OTTHUMG00000170763	ENST00000414716.3:c.2309_2314delGCAGGA	14.37:g.105352885_105352890delGCAGGA	ENSP00000404151:p.Arg771_Ser772del	Somatic	6	0		WXS	Illumina GAIIx	Phase_I	24	10	NM_001112726	0	0	0	0	0	Q2KHR7|Q86TI7	In_Frame_Del	DEL	ENST00000414716.3	37	CCDS45175.1																																																																																			.		0.694	CEP170B-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000410289.2	NM_001112726	
APBA2	321	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	15	29393975	29393975	+	Silent	SNP	C	C	T			TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr15:29393975C>T	ENST00000558402.1	+	11	2111	c.1512C>T	c.(1510-1512)ttC>ttT	p.F504F	APBA2_ENST00000411764.1_Silent_p.F492F|APBA2_ENST00000558330.1_Silent_p.F492F|APBA2_ENST00000558259.1_Silent_p.F504F|APBA2_ENST00000561069.1_Silent_p.F504F			Q99767	APBA2_HUMAN	amyloid beta (A4) precursor protein-binding, family A, member 2	504	PID. {ECO:0000255|PROSITE- ProRule:PRU00148}.				in utero embryonic development (GO:0001701)|locomotory behavior (GO:0007626)|multicellular organism growth (GO:0035264)|nervous system development (GO:0007399)|protein transport (GO:0015031)|regulation of gene expression (GO:0010468)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)	beta-amyloid binding (GO:0001540)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(7)|liver(2)|lung(33)|stomach(1)|urinary_tract(1)	59		all_lung(180;1.73e-12)|Breast(32;2.89e-05)|Colorectal(260;0.234)		all cancers(64;7.44e-11)|Epithelial(43;5.74e-10)|GBM - Glioblastoma multiforme(186;0.026)|BRCA - Breast invasive adenocarcinoma(123;0.0286)|Lung(196;0.24)		GCCATGTGTTCGAGTCGGAGG	0.617																																					p.F504F		.											.	APBA2-90	0			c.C1512T						.						68.0	50.0	56.0					15																	29393975		2203	4299	6502	SO:0001819	synonymous_variant	321	exon9			TGTGTTCGAGTCG	AB014719	CCDS10022.1, CCDS45197.1	15q11-q12	2008-07-18	2008-07-18		ENSG00000034053	ENSG00000034053			579	protein-coding gene	gene with protein product		602712	"""X11-like"", ""amyloid beta (A4) precursor protein-binding, family A, member 2 (X11-like)"""	X11L, MINT2		8955346	Standard	NM_005503		Approved	D15S1518E, LIN-10, MGC:14091, HsT16821	uc001zck.3	Q99767	OTTHUMG00000129255	ENST00000558402.1:c.1512C>T	15.37:g.29393975C>T		Somatic	132	0		WXS	Illumina GAIIx	Phase_I	308	132	NM_005503	0	0	0	0	0	E9PGI4|O60571|Q5XKC0	Silent	SNP	ENST00000558402.1	37	CCDS10022.1																																																																																			.		0.617	APBA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251362.3	NM_005503	
RYR3	6263	ucsc.edu;bcgsc.ca	37	15	34080629	34080629	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr15:34080629C>T	ENST00000389232.4	+	67	9870	c.9800C>T	c.(9799-9801)cCc>cTc	p.P3267L	RYR3_ENST00000415757.3_Missense_Mutation_p.P3267L	NM_001036.3	NP_001027.3	Q15413	RYR3_HUMAN	ryanodine receptor 3	3267					calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|cellular response to ATP (GO:0071318)|cellular response to caffeine (GO:0071313)|cellular response to calcium ion (GO:0071277)|cellular response to magnesium ion (GO:0071286)|ion transmembrane transport (GO:0034220)|negative regulation of cytosolic calcium ion concentration (GO:0051481)|protein homotetramerization (GO:0051289)|striated muscle contraction (GO:0006941)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|junctional membrane complex (GO:0030314)|perinuclear region of cytoplasm (GO:0048471)|sarcoplasmic reticulum membrane (GO:0033017)	calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|ryanodine-sensitive calcium-release channel activity (GO:0005219)			NS(3)|breast(9)|central_nervous_system(8)|cervix(2)|endometrium(29)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(55)|lung(148)|ovary(7)|pancreas(1)|prostate(13)|skin(4)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(3)	311		all_lung(180;7.18e-09)		all cancers(64;8.95e-12)|GBM - Glioblastoma multiforme(186;0.00109)|BRCA - Breast invasive adenocarcinoma(123;0.0363)		GCCTTCTACCCCATGCTGATC	0.552																																					p.P3267L		.											.	RYR3-520	0			c.C9800T						.						62.0	64.0	63.0					15																	34080629		2020	4206	6226	SO:0001583	missense	6263	exon67			TCTACCCCATGCT		CCDS45210.1, CCDS58351.1	15q14-q15	2013-01-10				ENSG00000198838		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10485	protein-coding gene	gene with protein product		180903				8276408	Standard	NM_001036		Approved		uc001zhi.3	Q15413		ENST00000389232.4:c.9800C>T	15.37:g.34080629C>T	ENSP00000373884:p.Pro3267Leu	Somatic	131	2		WXS	Illumina GAIIx	Phase_I	283	124	NM_001243996	0	0	0	0	0	O15175|Q15412	Missense_Mutation	SNP	ENST00000389232.4	37	CCDS45210.1	.	.	.	.	.	.	.	.	.	.	C	21.1	4.098078	0.76870	.	.	ENSG00000198838	ENST00000389232;ENST00000415757;ENST00000361728	T;T	0.62639	0.01;0.01	4.4	4.4	0.53042	.	0.000000	0.85682	D	0.000000	T	0.81945	0.4930	M	0.86953	2.85	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	D	0.85916	0.1443	10	0.87932	D	0	.	17.529	0.87808	0.0:1.0:0.0:0.0	.	3267;3267	Q15413-2;Q15413	.;RYR3_HUMAN	L	3267	ENSP00000373884:P3267L;ENSP00000399610:P3267L	ENSP00000354735:P3267L	P	+	2	0	RYR3	31867921	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.609000	0.82925	2.447000	0.82792	0.655000	0.94253	CCC	.		0.552	RYR3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000417514.1		
LPCAT4	254531	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	15	34651423	34651423	+	Nonsense_Mutation	SNP	G	G	A			TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr15:34651423G>A	ENST00000314891.6	-	14	1657	c.1480C>T	c.(1480-1482)Cga>Tga	p.R494*		NM_153613.2	NP_705841.2	Q643R3	LPCT4_HUMAN	lysophosphatidylcholine acyltransferase 4	494					cellular lipid metabolic process (GO:0044255)|glycerophospholipid biosynthetic process (GO:0046474)|phosphatidic acid biosynthetic process (GO:0006654)|phosphatidylcholine acyl-chain remodeling (GO:0036151)|phosphatidylethanolamine acyl-chain remodeling (GO:0036152)|phosphatidylglycerol acyl-chain remodeling (GO:0036148)|phosphatidylserine acyl-chain remodeling (GO:0036150)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	1-acylglycerophosphocholine O-acyltransferase activity (GO:0047184)|1-alkenylglycerophosphoethanolamine O-acyltransferase activity (GO:0047166)|1-alkylglycerophosphocholine O-acetyltransferase activity (GO:0047192)|calcium ion binding (GO:0005509)|lysophospholipid acyltransferase activity (GO:0071617)			NS(1)|breast(1)|large_intestine(2)|lung(5)|prostate(1)	10						GAGGTGCCTCGAGAGGTGTGT	0.577																																					p.R494X		.											.	LPCAT4-90	0			c.C1480T						.						88.0	84.0	86.0					15																	34651423		2200	4298	6498	SO:0001587	stop_gained	254531	exon14			TGCCTCGAGAGGT	AF542964	CCDS32191.1	15q14	2008-07-02	2008-06-24	2008-06-24		ENSG00000176454			30059	protein-coding gene	gene with protein product	"""lysophosphatidylethanolamine acyltransferase 2"""	612039	"""acyltransferase like 3"", ""1-acylglycerol-3-phosphate O-acyltransferase 7 (lysophosphatidic acid acyltransferase, eta)"""	AYTL3, AGPAT7		8619474, 9110174, 16243729, 18458083	Standard	XR_243087		Approved	FLJ10257, LPAAT-eta, LPEAT2	uc001zig.3	Q643R3		ENST00000314891.6:c.1480C>T	15.37:g.34651423G>A	ENSP00000317300:p.Arg494*	Somatic	41	0		WXS	Illumina GAIIx	Phase_I	93	48	NM_153613	0	0	22	29	7	A8K2K8|O43412|Q7Z4P4|Q8IUL7|Q8TB38	Nonsense_Mutation	SNP	ENST00000314891.6	37	CCDS32191.1	.	.	.	.	.	.	.	.	.	.	G	37	6.537817	0.97646	.	.	ENSG00000176454	ENST00000314891	.	.	.	4.01	4.01	0.46588	.	0.835795	0.10066	N	0.720260	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.12430	T	0.62	-0.0668	13.0494	0.58946	0.0:0.0:1.0:0.0	.	.	.	.	X	494	.	ENSP00000317300:R494X	R	-	1	2	LPCAT4	32438715	0.996000	0.38824	0.994000	0.49952	0.987000	0.75469	0.789000	0.26886	1.748000	0.51833	0.313000	0.20887	CGA	.		0.577	LPCAT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000418028.2	NM_153613	
SPRED1	161742	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	15	38643332	38643332	+	Missense_Mutation	SNP	A	A	G			TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr15:38643332A>G	ENST00000299084.4	+	7	1662	c.802A>G	c.(802-804)Aaa>Gaa	p.K268E		NM_152594.2	NP_689807.1	Q7Z699	SPRE1_HUMAN	sprouty-related, EVH1 domain containing 1	268	KBD. {ECO:0000255|PROSITE- ProRule:PRU00821}.				inactivation of MAPK activity (GO:0000188)|multicellular organismal development (GO:0007275)|negative regulation of peptidyl-threonine phosphorylation (GO:0010801)|negative regulation of phosphatase activity (GO:0010923)|positive regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043517)|regulation of protein deacetylation (GO:0090311)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	phosphatase binding (GO:0019902)|protein kinase binding (GO:0019901)|protein serine/threonine kinase inhibitor activity (GO:0030291)|stem cell factor receptor binding (GO:0005173)			kidney(6)|large_intestine(7)|lung(6)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	25		all_cancers(109;4.88e-13)|all_epithelial(112;1.83e-11)|Lung NSC(122;2.21e-09)|all_lung(180;4.64e-08)|Melanoma(134;0.091)		GBM - Glioblastoma multiforme(113;2.41e-08)|BRCA - Breast invasive adenocarcinoma(123;0.0244)		TGACATGTGGAAAAATGACTT	0.393									Legius syndrome																												p.K268E	Melanoma(196;2146 2959 7698 16532)	.											.	SPRED1-1085	0			c.A802G						.						90.0	88.0	89.0					15																	38643332		2200	4297	6497	SO:0001583	missense	161742	exon7	Familial Cancer Database	Neurofibromatosis type 1 - like syndrome, SPRED1 disorder	ATGTGGAAAAATG	AK091222	CCDS32193.1	15q14	2014-06-13			ENSG00000166068	ENSG00000166068			20249	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 147"""	609291					Standard	NM_152594		Approved	FLJ33903, PPP1R147	uc001zka.4	Q7Z699		ENST00000299084.4:c.802A>G	15.37:g.38643332A>G	ENSP00000299084:p.Lys268Glu	Somatic	83	0		WXS	Illumina GAIIx	Phase_I	171	29	NM_152594	0	0	7	11	4	B2RPJ8|Q05D53|Q8N256	Missense_Mutation	SNP	ENST00000299084.4	37	CCDS32193.1	.	.	.	.	.	.	.	.	.	.	A	15.30	2.791835	0.50102	.	.	ENSG00000166068	ENST00000299084	D	0.84944	-1.92	5.83	5.83	0.93111	c-Kit-binding domain (1);	0.089688	0.85682	D	0.000000	D	0.82646	0.5082	L	0.43152	1.355	0.43745	D	0.996241	D	0.53151	0.958	P	0.49252	0.604	T	0.79396	-0.1821	10	0.17832	T	0.49	-0.1089	12.0913	0.53728	0.8567:0.1433:0.0:0.0	.	268	Q7Z699	SPRE1_HUMAN	E	268	ENSP00000299084:K268E	ENSP00000299084:K268E	K	+	1	0	SPRED1	36430624	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	5.932000	0.70121	2.217000	0.71921	0.528000	0.53228	AAA	.		0.393	SPRED1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000418217.1		
RASGRP1	10125	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	15	38786797	38786797	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr15:38786797C>T	ENST00000310803.5	-	16	2222	c.2045G>A	c.(2044-2046)gGc>gAc	p.G682D	RASGRP1_ENST00000558164.1_Intron|RASGRP1_ENST00000561180.1_Missense_Mutation_p.G733D|RASGRP1_ENST00000539159.1_Missense_Mutation_p.G634D|RASGRP1_ENST00000450598.2_Missense_Mutation_p.G647D|RASGRP1_ENST00000559830.1_Intron	NM_001128602.1|NM_005739.3	NP_001122074.1|NP_005730.2	O95267	GRP1_HUMAN	RAS guanyl releasing protein 1 (calcium and DAG-regulated)	682					activation of Rho GTPase activity (GO:0032862)|blood coagulation (GO:0007596)|cell differentiation (GO:0030154)|cytokine production (GO:0001816)|Fc-epsilon receptor signaling pathway (GO:0038095)|inflammatory response to antigenic stimulus (GO:0002437)|innate immune response (GO:0045087)|mast cell degranulation (GO:0043303)|platelet activation (GO:0030168)|Ras protein signal transduction (GO:0007265)|regulation of phosphatidylinositol 3-kinase signaling (GO:0014066)|secretory granule localization (GO:0032252)|signal transduction (GO:0007165)|vesicle transport along microtubule (GO:0047496)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|mast cell granule (GO:0042629)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|guanyl-nucleotide exchange factor activity (GO:0005085)|lipid binding (GO:0008289)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(8)|lung(2)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	20		all_cancers(109;6.38e-17)|all_epithelial(112;5.51e-15)|Lung NSC(122;2.12e-11)|all_lung(180;5.63e-10)|Melanoma(134;0.0574)		GBM - Glioblastoma multiforme(113;1.97e-07)|BRCA - Breast invasive adenocarcinoma(123;0.00248)		GCCCTCACTGCCAATCCAAGG	0.547																																					p.G682D		.											.	RASGRP1-697	0			c.G2045A						.						29.0	30.0	30.0					15																	38786797		1899	4106	6005	SO:0001583	missense	10125	exon16			TCACTGCCAATCC	AF106071	CCDS45221.1, CCDS45222.1	15q15	2013-01-10				ENSG00000172575		"""EF-hand domain containing"""	9878	protein-coding gene	gene with protein product		603962				10087292, 9789079	Standard	NM_005739		Approved	CalDAG-GEFII, RASGRP	uc001zke.4	O95267		ENST00000310803.5:c.2045G>A	15.37:g.38786797C>T	ENSP00000310244:p.Gly682Asp	Somatic	78	0		WXS	Illumina GAIIx	Phase_I	142	68	NM_005739	0	0	0	2	2	Q56CZ0|Q58G75|Q59HB1|Q5I3A8|Q6GV31|Q6NX39|Q7LDG6|Q9UI94|Q9UNN9	Missense_Mutation	SNP	ENST00000310803.5	37	CCDS45222.1	.	.	.	.	.	.	.	.	.	.	C	14.29	2.491091	0.44249	.	.	ENSG00000172575	ENST00000310803;ENST00000450598;ENST00000539159	T;T;T	0.79554	-1.06;-1.28;-1.15	5.01	4.1	0.47936	.	0.233339	0.35970	N	0.002874	T	0.66557	0.2801	L	0.27053	0.805	0.32844	D	0.505731	B;B	0.23058	0.078;0.079	B;B	0.23150	0.044;0.037	T	0.68819	-0.5308	10	0.62326	D	0.03	-10.8209	5.4897	0.16769	0.0:0.6437:0.1796:0.1766	.	682;647	O95267;O95267-2	GRP1_HUMAN;.	D	682;647;634	ENSP00000310244:G682D;ENSP00000388540:G647D;ENSP00000444762:G634D	ENSP00000310244:G682D	G	-	2	0	RASGRP1	36574089	0.110000	0.22057	0.876000	0.34364	0.644000	0.38419	0.714000	0.25808	1.363000	0.46019	-0.142000	0.14014	GGC	.		0.547	RASGRP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000418223.1	NM_005739	
INO80	54617	broad.mit.edu	37	15	41337219	41337219	+	Silent	SNP	G	G	T			TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr15:41337219G>T	ENST00000361937.3	-	24	3214	c.2790C>A	c.(2788-2790)cgC>cgA	p.R930R	INO80_ENST00000401393.3_Silent_p.R930R			Q9ULG1	INO80_HUMAN	INO80 complex subunit	930	Assembles INO80 complex module consisting of conserved components INO80B, INO80C, ACTR5, RVBL1, RVBL2.				ATP catabolic process (GO:0006200)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|chromatin remodeling (GO:0006338)|DNA duplex unwinding (GO:0032508)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|mitotic sister chromatid segregation (GO:0000070)|positive regulation of cell growth (GO:0030307)|positive regulation of nuclear cell cycle DNA replication (GO:0010571)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of G1/S transition of mitotic cell cycle (GO:2000045)|spindle assembly (GO:0051225)|UV-damage excision repair (GO:0070914)	Ino80 complex (GO:0031011)|microtubule (GO:0005874)|nucleus (GO:0005634)	alpha-tubulin binding (GO:0043014)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)			NS(1)|breast(4)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(10)|lung(10)|ovary(3)|pancreas(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(2)	49						CTCCCCAGGAGCGTAGCTGAT	0.507																																					p.R930R		.											.	INO80-72	0			c.C2790A						.						82.0	86.0	84.0					15																	41337219		2203	4300	6503	SO:0001819	synonymous_variant	54617	exon24			CCAGGAGCGTAGC	AB033085	CCDS10071.1	15q15.1	2013-08-21	2013-08-21	2008-08-07	ENSG00000128908	ENSG00000128908	3.6.1.3	"""INO80 complex subunits"""	26956	protein-coding gene	gene with protein product	"""INO80 complex subunit A"""	610169	"""INO80 complex homolog 1 (S. cerevisiae)"", ""INO80 homolog (S. cerevisiae)"""	INOC1		16298340, 16230350, 20237820	Standard	NM_017553		Approved	KIAA1259, Ino80, hINO80, INO80A	uc001zni.3	Q9ULG1	OTTHUMG00000130209	ENST00000361937.3:c.2790C>A	15.37:g.41337219G>T		Somatic	46	1		WXS	Illumina GAIIx	Phase_I	97	5	NM_017553	0	0	12	14	2	A6H8X4|Q9NTG6	Silent	SNP	ENST00000361937.3	37	CCDS10071.1																																																																																			.		0.507	INO80-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252527.2	NM_017553	
SPTBN5	51332	bcgsc.ca	37	15	42169369	42169369	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr15:42169369C>T	ENST00000320955.6	-	18	3883	c.3656G>A	c.(3655-3657)gGt>gAt	p.G1219D		NM_016642.2	NP_057726.4	Q9NRC6	SPTN5_HUMAN	spectrin, beta, non-erythrocytic 5	1219					actin cytoskeleton organization (GO:0030036)|actin filament capping (GO:0051693)|axon guidance (GO:0007411)|Golgi organization (GO:0007030)|lysosomal transport (GO:0007041)|protein homooligomerization (GO:0051260)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|photoreceptor connecting cilium (GO:0032391)|photoreceptor disc membrane (GO:0097381)|spectrin (GO:0008091)	actin binding (GO:0003779)|dynactin binding (GO:0034452)|dynein intermediate chain binding (GO:0045505)|kinesin binding (GO:0019894)|myosin tail binding (GO:0032029)|protein self-association (GO:0043621)|spectrin binding (GO:0030507)			NS(1)|breast(1)|central_nervous_system(3)|endometrium(9)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(6)|lung(18)|ovary(5)|prostate(8)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	62		all_cancers(109;1.84e-17)|all_epithelial(112;1.12e-15)|Lung NSC(122;7.6e-10)|all_lung(180;4.15e-09)|Melanoma(134;0.0179)|Ovarian(310;0.143)|Colorectal(260;0.173)		all cancers(2;4.33e-34)|Epithelial(2;1.72e-25)|OV - Ovarian serous cystadenocarcinoma(18;8.32e-20)|GBM - Glioblastoma multiforme(94;4.69e-07)|Colorectal(2;0.00104)|COAD - Colon adenocarcinoma(120;0.0405)|READ - Rectum adenocarcinoma(92;0.0908)		GGCAGTGAAACCATCCACTTC	0.607																																					p.G1184D		.											.	SPTBN5-91	0			c.G3551A						.						66.0	76.0	73.0					15																	42169369		2146	4258	6404	SO:0001583	missense	51332	exon18			GTGAAACCATCCA	AF233523	CCDS61599.1	15q21	2010-08-17			ENSG00000137877	ENSG00000137877			15680	protein-coding gene	gene with protein product	"""beta V spectrin"""	605916				10764729	Standard	NM_016642		Approved	HUSPECV, BSPECV, HUBSPECV	uc001zos.4	Q9NRC6		ENST00000320955.6:c.3656G>A	15.37:g.42169369C>T	ENSP00000317790:p.Gly1219Asp	Somatic	351	4		WXS	Illumina GAIIx	Phase_I	656	620	NM_016642	0	0	0	0	0		Missense_Mutation	SNP	ENST00000320955.6	37		.	.	.	.	.	.	.	.	.	.	.	12.34	1.910020	0.33721	.	.	ENSG00000137877	ENST00000320955	T	0.39406	1.08	4.96	1.96	0.26148	.	0.172740	0.38381	N	0.001702	T	0.26991	0.0661	L	0.41027	1.25	0.20196	N	0.99993	B	0.26512	0.151	B	0.30105	0.111	T	0.30592	-0.9973	10	0.05620	T	0.96	.	7.5259	0.27656	0.134:0.7159:0.0:0.1501	.	1219	Q9NRC6	SPTN5_HUMAN	D	1219	ENSP00000317790:G1219D	ENSP00000317790:G1219D	G	-	2	0	SPTBN5	39956661	0.007000	0.16637	0.659000	0.29680	0.989000	0.77384	0.693000	0.25497	0.203000	0.20529	0.561000	0.74099	GGT	.		0.607	SPTBN5-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000420237.1	NM_016642	
B2M	567	hgsc.bcm.edu	37	15	45003781	45003782	+	Frame_Shift_Del	DEL	CT	CT	-			TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10	CT	CT	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr15:45003781_45003782delCT	ENST00000558401.1	+	1	107_108	c.37_38delCT	c.(37-39)ctcfs	p.L13fs	B2M_ENST00000559916.1_Frame_Shift_Del_p.L13fs|PATL2_ENST00000558573.1_5'Flank|B2M_ENST00000544417.1_Frame_Shift_Del_p.L13fs	NM_004048.2	NP_004039.1	P61769	B2MG_HUMAN	beta-2-microglobulin	13					antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-independent (GO:0002480)|antigen processing and presentation of exogenous protein antigen via MHC class Ib, TAP-dependent (GO:0002481)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cytokine-mediated signaling pathway (GO:0019221)|innate immune response (GO:0045087)|interferon-gamma-mediated signaling pathway (GO:0060333)|positive regulation of T cell mediated cytotoxicity (GO:0001916)|protein refolding (GO:0042026)|regulation of defense response to virus by virus (GO:0050690)|regulation of immune response (GO:0050776)|response to cadmium ion (GO:0046686)|response to drug (GO:0042493)|response to molecule of bacterial origin (GO:0002237)|retina homeostasis (GO:0001895)|T cell differentiation in thymus (GO:0033077)|viral process (GO:0016032)	cytoplasm (GO:0005737)|early endosome lumen (GO:0031905)|early endosome membrane (GO:0031901)|endoplasmic reticulum lumen (GO:0005788)|ER to Golgi transport vesicle membrane (GO:0012507)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|membrane (GO:0016020)|MHC class I protein complex (GO:0042612)|phagocytic vesicle membrane (GO:0030670)|plasma membrane (GO:0005886)	identical protein binding (GO:0042802)	p.L15fs*41(4)|p.A11fs*42(1)|p.L13F(1)		breast(2)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(30)|kidney(8)|large_intestine(6)|lung(6)|ovary(2)|skin(2)|urinary_tract(1)	59		all_cancers(109;1.88e-13)|all_epithelial(112;2.13e-11)|Lung NSC(122;2.22e-07)|all_lung(180;1.81e-06)|Melanoma(134;0.0122)		all cancers(107;4.16e-21)|GBM - Glioblastoma multiforme(94;8.97e-07)|COAD - Colon adenocarcinoma(120;0.0357)|Colorectal(105;0.0377)|Lung(196;0.0903)|LUSC - Lung squamous cell carcinoma(244;0.192)		GCTCGCGCTACTCTCTCTTTCT	0.614																																					p.13_13del		.											.	B2M-93	6	Deletion - Frameshift(5)|Substitution - Missense(1)	large_intestine(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|skin(1)	c.37_38del						.																																			SO:0001589	frameshift_variant	567	exon1			GCGCTACTCTCTC	AB021288	CCDS10113.1	15q21-q22.2	2013-01-11			ENSG00000166710	ENSG00000166710		"""Immunoglobulin superfamily / C1-set domain containing"""	914	protein-coding gene	gene with protein product		109700					Standard	NM_004048		Approved		uc001zuc.3	P61769	OTTHUMG00000131247	ENST00000558401.1:c.37_38delCT	15.37:g.45003787_45003788delCT	ENSP00000452780:p.Leu13fs	Somatic	65	2		WXS	Illumina GAIIx	Phase_I	201	177	NM_004048	0	0	0	0	0	P01884|Q540F8|Q6IAT8|Q9UCK0|Q9UD48|Q9UDF4	Frame_Shift_Del	DEL	ENST00000558401.1	37	CCDS10113.1																																																																																			.		0.614	B2M-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000254007.2	NM_004048	
SPATA5L1	79029	hgsc.bcm.edu	37	15	45695445	45695445	+	Missense_Mutation	SNP	C	C	G	rs143453038	byFrequency	TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr15:45695445C>G	ENST00000305560.6	+	1	917	c.818C>G	c.(817-819)tCc>tGc	p.S273C	SPATA5L1_ENST00000559860.1_Missense_Mutation_p.S273C|GATM_ENST00000458245.5_5'Flank	NM_024063.2	NP_076968.2	Q9BVQ7	SPA5L_HUMAN	spermatogenesis associated 5-like 1	273						cytoplasm (GO:0005737)	ATP binding (GO:0005524)			kidney(2)|large_intestine(3)|lung(1)|ovary(3)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	14		Lung NSC(122;8.3e-05)|all_lung(180;0.000547)|Melanoma(134;0.0417)		all cancers(107;7.31e-17)|GBM - Glioblastoma multiforme(94;6.28e-07)		CTGCAGGGTTCCCGGCCTGGG	0.761													C|||	50	0.00998403	0.0023	0.0202	5008	,	,		12129	0.0		0.0298	False		,,,				2504	0.0031				p.S273C		.											.	SPATA5L1-94	0			c.C818G						.	C	CYS/SER	17,3375		0,17,1679	3.0	4.0	4.0		818	4.9	0.3	15	dbSNP_134	4	149,7059		1,147,3456	no	missense	SPATA5L1	NM_024063.2	112	1,164,5135	GG,GC,CC		2.0671,0.5012,1.566	possibly-damaging	273/754	45695445	166,10434	1696	3604	5300	SO:0001583	missense	79029	exon1			AGGGTTCCCGGCC	AK023232	CCDS10123.1	15q15.1	2010-04-21			ENSG00000171763	ENSG00000171763		"""ATPases / AAA-type"""	28762	protein-coding gene	gene with protein product						12477932	Standard	NM_024063		Approved	MGC5347, FLJ12286	uc001zve.3	Q9BVQ7	OTTHUMG00000131425	ENST00000305560.6:c.818C>G	15.37:g.45695445C>G	ENSP00000305494:p.Ser273Cys	Somatic	2	0		WXS	Illumina GAIIx	Phase_I	15	14	NM_024063	0	0	0	3	3	C9JHR5|Q9H8W7|Q9HA41	Missense_Mutation	SNP	ENST00000305560.6	37	CCDS10123.1	40	0.018315018315018316	8	0.016260162601626018	9	0.024861878453038673	0	0.0	23	0.030343007915567283	C	20.5	3.999282	0.74818	0.005012	0.020671	ENSG00000171763	ENST00000305560	D	0.93426	-3.22	4.9	4.9	0.64082	ATPase, AAA-type, core (1);ATPase, AAA+ type, core (1);	0.367137	0.28560	N	0.014910	D	0.89111	0.6622	M	0.68728	2.09	0.20307	N	0.999919	D	0.56035	0.974	P	0.57057	0.812	D	0.85330	0.1089	10	0.87932	D	0	-22.4119	16.8259	0.85931	0.0:1.0:0.0:0.0	.	273	Q9BVQ7	SPA5L_HUMAN	C	273	ENSP00000305494:S273C	ENSP00000305494:S273C	S	+	2	0	SPATA5L1	43482737	0.758000	0.28405	0.314000	0.25224	0.281000	0.26958	7.247000	0.78257	2.536000	0.85505	0.585000	0.79938	TCC	C|0.982;G|0.018		0.761	SPATA5L1-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000254218.1	NM_024063	
WDR72	256764	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	15	53908071	53908071	+	Frame_Shift_Del	DEL	T	T	-			TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr15:53908071delT	ENST00000396328.1	-	15	2571	c.2332delA	c.(2332-2334)atgfs	p.M778fs	WDR72_ENST00000360509.5_Frame_Shift_Del_p.M778fs|WDR72_ENST00000557913.1_Frame_Shift_Del_p.M775fs|WDR72_ENST00000559418.1_Frame_Shift_Del_p.M788fs	NM_001277176.1|NM_182758.2	NP_001264105.1|NP_877435.3	Q3MJ13	WDR72_HUMAN	WD repeat domain 72	778										NS(1)|breast(1)|endometrium(4)|kidney(4)|large_intestine(18)|lung(29)|prostate(3)|skin(6)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	71				all cancers(107;0.0511)		TTAGGCTGCATTTTTTTGGAG	0.393																																					p.M778fs		.											.	WDR72-92	0			c.2332delA						.						184.0	175.0	178.0					15																	53908071		2194	4293	6487	SO:0001589	frameshift_variant	256764	exon15			GCTGCATTTTTTT	BX537884	CCDS10151.1, CCDS73730.1	15q21.3	2013-01-09			ENSG00000166415	ENSG00000166415		"""WD repeat domain containing"""	26790	protein-coding gene	gene with protein product		613214					Standard	NM_182758		Approved	FLJ38736	uc002acj.2	Q3MJ13	OTTHUMG00000131939	ENST00000396328.1:c.2332delA	15.37:g.53908071delT	ENSP00000379619:p.Met778fs	Somatic	69	0		WXS	Illumina GAIIx	Phase_I	130	23	NM_182758	0	0	0	0	0	Q7Z3I3|Q8N8X2	Frame_Shift_Del	DEL	ENST00000396328.1	37	CCDS10151.1																																																																																			.		0.393	WDR72-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000254893.2	NM_182758	
MNS1	55329	hgsc.bcm.edu	37	15	56736723	56736723	+	Frame_Shift_Del	DEL	T	T	-	rs549395315	byFrequency	TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr15:56736723delT	ENST00000260453.3	-	5	769	c.605delA	c.(604-606)aagfs	p.K202fs	TEX9_ENST00000537232.1_Intron|TEX9_ENST00000352903.2_Intron	NM_018365.2	NP_060835.1	Q8NEH6	MNS1_HUMAN	meiosis-specific nuclear structural 1	202	Glu-rich.				cilium organization (GO:0044782)|left/right axis specification (GO:0070986)|meiotic nuclear division (GO:0007126)	axoneme (GO:0005930)|intermediate filament (GO:0005882)|nuclear envelope (GO:0005635)|sperm flagellum (GO:0036126)	identical protein binding (GO:0042802)	p.?(1)		breast(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(4)|ovary(2)|pancreas(2)|skin(1)|upper_aerodigestive_tract(1)	20				all cancers(107;0.0196)|GBM - Glioblastoma multiforme(80;0.101)		AGCTTCCTGCTTTTTTTTTTC	0.338													|||unknown(HR)	17	0.00339457	0.0076	0.0029	5008	,	,		18408	0.0		0.002	False		,,,				2504	0.0031				p.K202fs		.											.	MNS1-91	1	Unknown(1)	skin(1)	c.605delA						.						147.0	141.0	143.0					15																	56736723		2192	4292	6484	SO:0001589	frameshift_variant	55329	exon5			TCCTGCTTTTTTT	AK002084	CCDS10158.1	15q21.3	2013-01-16			ENSG00000138587	ENSG00000138587			29636	protein-coding gene	gene with protein product	"""spermatogenesis associated 40"""	610766				7625268, 8032679	Standard	NM_018365		Approved	FLJ11222, SPATA40	uc002adr.2	Q8NEH6	OTTHUMG00000132034	ENST00000260453.3:c.605delA	15.37:g.56736723delT	ENSP00000260453:p.Lys202fs	Somatic	36	0		WXS	Illumina GAIIx	Phase_I	94	42	NM_018365	0	0	0	0	0	Q8IYT6|Q9NUP4	Frame_Shift_Del	DEL	ENST00000260453.3	37	CCDS10158.1																																																																																			.		0.338	MNS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255047.2	NM_018365	
SLTM	79811	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	15	59182525	59182526	+	Frame_Shift_Del	DEL	TC	TC	-			TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10	TC	TC	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr15:59182525_59182526delTC	ENST00000380516.2	-	15	2120_2121	c.2033_2034delGA	c.(2032-2034)agafs	p.R678fs	SLTM_ENST00000536328.1_Frame_Shift_Del_p.R247fs|AC025918.2_ENST00000452467.1_RNA	NM_001013843.1|NM_024755.2	NP_001013865.1|NP_079031.2	Q9NWH9	SLTM_HUMAN	SAFB-like, transcription modulator	678	Arg/Glu-rich.				apoptotic process (GO:0006915)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(3)|kidney(1)|large_intestine(9)|lung(10)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	28						CGCGTTCCATTCTCTCTCTCTC	0.431																																					p.678_678del		.											.	SLTM-91	0			c.2033_2034del						.																																			SO:0001589	frameshift_variant	79811	exon15			TTCCATTCTCTCT	BC046119	CCDS10168.2	15q21.3	2013-02-12			ENSG00000137776	ENSG00000137776		"""RNA binding motif (RRM) containing"""	20709	protein-coding gene	gene with protein product							Standard	XR_243128		Approved	Met, FLJ13213	uc002afp.3	Q9NWH9	OTTHUMG00000074033	ENST00000380516.2:c.2033_2034delGA	15.37:g.59182535_59182536delTC	ENSP00000369887:p.Arg678fs	Somatic	83	0		WXS	Illumina GAIIx	Phase_I	136	27	NM_024755	0	0	0	0	0	A8K5V8|B2RTX3|Q2VPK7|Q52MB3|Q658J7|Q6ZNF2|Q86TK6|Q9H7C3|Q9H8U9	Frame_Shift_Del	DEL	ENST00000380516.2	37	CCDS10168.2																																																																																			.		0.431	SLTM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000157124.1	NM_024755	
NR2E3	10002	hgsc.bcm.edu;bcgsc.ca;mdanderson.org	37	15	72105935	72105935	+	RNA	SNP	C	C	T			TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr15:72105935C>T	ENST00000398840.2	+	0	1143							Q9Y5X4	NR2E3_HUMAN	nuclear receptor subfamily 2, group E, member 3						eye photoreceptor cell development (GO:0042462)|gene expression (GO:0010467)|intracellular receptor signaling pathway (GO:0030522)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|phototransduction (GO:0007602)|positive regulation of rhodopsin gene expression (GO:0045872)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|retina development in camera-type eye (GO:0060041)|signal transduction (GO:0007165)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|visual perception (GO:0007601)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|sequence-specific DNA binding (GO:0043565)|steroid hormone receptor activity (GO:0003707)|zinc ion binding (GO:0008270)			breast(1)|endometrium(1)|lung(1)	3						TGGACCCCCACGGAGTTTGCC	0.607																																					p.T318M		.											.	NR2E3-22	0			c.C953T						.						57.0	61.0	60.0					15																	72105935		2019	4168	6187			10002	exon7			CCCCCACGGAGTT		CCDS73750.1, CCDS73751.1	15q23	2013-01-16			ENSG00000031544	ENSG00000278570		"""Nuclear hormone receptors"""	7974	protein-coding gene	gene with protein product		604485				10220376	Standard	NM_016346		Approved	PNR, rd7, RP37	uc002ath.1	Q9Y5X4	OTTHUMG00000172841		15.37:g.72105935C>T		Somatic	31	0		WXS	Illumina GAIIx	Phase_I	131	46	NM_016346	0	0	0	0	0	B6ZGU0|Q9UHM4	Missense_Mutation	SNP	ENST00000398840.2	37		.	.	.	.	.	.	.	.	.	.	C	15.19	2.758665	0.49468	.	.	ENSG00000031544	ENST00000326995;ENST00000398840	.	.	.	5.47	4.55	0.56014	Nuclear hormone receptor, ligand-binding (2);Nuclear hormone receptor, ligand-binding, core (2);	.	.	.	.	T	0.79902	0.4526	.	.	.	.	.	.	D	0.89917	1.0	D	0.75484	0.986	D	0.84279	0.0493	6	0.87932	D	0	.	15.7441	0.77926	0.1374:0.8626:0.0:0.0	.	318	Q9Y5X4	NR2E3_HUMAN	M	230;318	.	ENSP00000317199:T230M	T	+	2	0	NR2E3	69892989	1.000000	0.71417	0.955000	0.39395	0.975000	0.68041	5.993000	0.70616	1.274000	0.44362	0.561000	0.74099	ACG	.		0.607	NR2E3-202	KNOWN	basic	processed_transcript	processed_transcript		NM_014249	
PML	5371	broad.mit.edu;bcgsc.ca	37	15	74315257	74315257	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr15:74315257G>A	ENST00000268058.3	+	3	787	c.691G>A	c.(691-693)Gca>Aca	p.A231T	PML_ENST00000569477.1_Missense_Mutation_p.A231T|PML_ENST00000435786.2_Missense_Mutation_p.A231T|PML_ENST00000569161.1_3'UTR|PML_ENST00000567543.1_Missense_Mutation_p.A231T|PML_ENST00000395135.3_Missense_Mutation_p.A231T|PML_ENST00000395132.2_Missense_Mutation_p.A231T|PML_ENST00000354026.6_Missense_Mutation_p.A231T|PML_ENST00000268059.6_Missense_Mutation_p.A231T|PML_ENST00000563500.1_Missense_Mutation_p.A231T|PML_ENST00000359928.4_Missense_Mutation_p.A231T|PML_ENST00000564428.1_Missense_Mutation_p.A231T|PML_ENST00000565898.1_Missense_Mutation_p.A231T|PML_ENST00000436891.3_Missense_Mutation_p.A231T|PML_ENST00000569965.1_Missense_Mutation_p.A231T	NM_033238.2	NP_150241.2	P29590	PML_HUMAN	promyelocytic leukemia	231					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|apoptotic process (GO:0006915)|branching involved in mammary gland duct morphogenesis (GO:0060444)|cell cycle arrest (GO:0007050)|cell fate commitment (GO:0045165)|cellular response to interleukin-4 (GO:0071353)|cellular senescence (GO:0090398)|circadian regulation of gene expression (GO:0032922)|common-partner SMAD protein phosphorylation (GO:0007182)|cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|endoplasmic reticulum calcium ion homeostasis (GO:0032469)|entrainment of circadian clock by photoperiod (GO:0043153)|extrinsic apoptotic signaling pathway (GO:0097191)|innate immune response (GO:0045087)|interferon-gamma-mediated signaling pathway (GO:0060333)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|intrinsic apoptotic signaling pathway in response to endoplasmic reticulum stress (GO:0070059)|intrinsic apoptotic signaling pathway in response to oxidative stress (GO:0008631)|maintenance of protein location in nucleus (GO:0051457)|myeloid cell differentiation (GO:0030099)|negative regulation of angiogenesis (GO:0016525)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of mitotic cell cycle (GO:0045930)|negative regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000059)|negative regulation of telomerase activity (GO:0051974)|negative regulation of telomere maintenance via telomerase (GO:0032211)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of translation in response to oxidative stress (GO:0032938)|negative regulation of viral release from host cell (GO:1902187)|PML body organization (GO:0030578)|positive regulation of apoptotic process involved in mammary gland involution (GO:0060058)|positive regulation of defense response to virus by host (GO:0002230)|positive regulation of extrinsic apoptotic signaling pathway (GO:2001238)|positive regulation of histone deacetylation (GO:0031065)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein complex assembly (GO:0006461)|protein stabilization (GO:0050821)|protein targeting (GO:0006605)|regulation of calcium ion transport into cytosol (GO:0010522)|regulation of circadian rhythm (GO:0042752)|regulation of double-strand break repair (GO:2000779)|regulation of MHC class I biosynthetic process (GO:0045343)|regulation of protein phosphorylation (GO:0001932)|regulation of transcription, DNA-templated (GO:0006355)|response to cytokine (GO:0034097)|response to gamma radiation (GO:0010332)|response to hypoxia (GO:0001666)|response to UV (GO:0009411)|retinoic acid receptor signaling pathway (GO:0048384)|SMAD protein import into nucleus (GO:0007184)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endosome (GO:0005768)|extrinsic component of endoplasmic reticulum membrane (GO:0042406)|nuclear matrix (GO:0016363)|nuclear membrane (GO:0031965)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)	cobalt ion binding (GO:0050897)|DNA binding (GO:0003677)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|SUMO binding (GO:0032183)|transcription coactivator activity (GO:0003713)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(2)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(6)|lung(8)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	31						CGACATCAGCGCAGAGATCCA	0.632			T	"""RARA, PAX5"""	"""APL, ALL"""																																p.A231T		.		Dom	yes		15	15q22	5371	promyelocytic leukemia		L	.	PML-1083	0			c.G691A						.						38.0	33.0	35.0					15																	74315257		2198	4297	6495	SO:0001583	missense	5371	exon3			ATCAGCGCAGAGA	AB208950	CCDS10255.1, CCDS10256.1, CCDS10257.1, CCDS10258.1, CCDS45297.1, CCDS45298.1, CCDS45299.1, CCDS45300.1, CCDS58386.1	15q24.1	2011-04-21			ENSG00000140464	ENSG00000140464		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	9113	protein-coding gene	gene with protein product		102578					Standard	NM_033244		Approved	MYL, TRIM19, RNF71	uc002awv.3	P29590	OTTHUMG00000137607	ENST00000268058.3:c.691G>A	15.37:g.74315257G>A	ENSP00000268058:p.Ala231Thr	Somatic	71	0		WXS	Illumina GAIIx	Phase_I	193	7	NM_033250	0	0	12	13	1	E9PBR7|P29591|P29592|P29593|Q00755|Q15959|Q59FP9|Q8WUA0|Q96S41|Q9BPW2|Q9BWP7|Q9BZX6|Q9BZX7|Q9BZX8|Q9BZX9|Q9BZY0|Q9BZY2|Q9BZY3	Missense_Mutation	SNP	ENST00000268058.3	37	CCDS10255.1	.	.	.	.	.	.	.	.	.	.	G	9.557	1.117528	0.20877	.	.	ENSG00000140464	ENST00000395135;ENST00000435786;ENST00000359928;ENST00000436891;ENST00000268058;ENST00000395132;ENST00000268059;ENST00000354026;ENST00000418568	T;T;T;T	0.57107	0.42;0.42;0.93;0.42	4.82	-5.46	0.02608	.	1.885520	0.02640	N	0.105231	T	0.18800	0.0451	N	0.02539	-0.55	0.09310	N	1	B;B;B;B;B;B;B;B;B;B;B;B	0.31485	0.0;0.003;0.007;0.009;0.01;0.002;0.325;0.04;0.04;0.002;0.04;0.008	B;B;B;B;B;B;B;B;B;B;B;B	0.13407	0.001;0.002;0.002;0.005;0.005;0.001;0.009;0.007;0.007;0.001;0.008;0.002	T	0.10870	-1.0611	10	0.11485	T	0.65	-0.0203	5.54	0.17033	0.4895:0.0:0.2819:0.2286	.	181;231;231;231;231;231;231;231;231;231;231;234	Q59GQ8;P29590;P29590-11;P29590-12;P29590-5;E9PBR7;P29590-13;P29590-4;P29590-2;P29590-14;P29590-8;Q59H09	.;PML_HUMAN;.;.;.;.;.;.;.;.;.;.	T	231	ENSP00000353004:A231T;ENSP00000394642:A231T;ENSP00000268058:A231T;ENSP00000378564:A231T	ENSP00000268058:A231T	A	+	1	0	PML	72102310	0.000000	0.05858	0.000000	0.03702	0.761000	0.43186	-3.299000	0.00521	-0.810000	0.04375	0.313000	0.20887	GCA	.		0.632	PML-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269021.3	NM_002675	
PML	5371	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	15	74315308	74315308	+	Nonsense_Mutation	SNP	C	C	T			TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr15:74315308C>T	ENST00000268058.3	+	3	838	c.742C>T	c.(742-744)Cag>Tag	p.Q248*	PML_ENST00000569477.1_Nonsense_Mutation_p.Q248*|PML_ENST00000435786.2_Nonsense_Mutation_p.Q248*|PML_ENST00000569161.1_3'UTR|PML_ENST00000567543.1_Nonsense_Mutation_p.Q248*|PML_ENST00000395135.3_Nonsense_Mutation_p.Q248*|PML_ENST00000395132.2_Nonsense_Mutation_p.Q248*|PML_ENST00000354026.6_Nonsense_Mutation_p.Q248*|PML_ENST00000268059.6_Nonsense_Mutation_p.Q248*|PML_ENST00000563500.1_Nonsense_Mutation_p.Q248*|PML_ENST00000359928.4_Nonsense_Mutation_p.Q248*|PML_ENST00000564428.1_Nonsense_Mutation_p.Q248*|PML_ENST00000565898.1_Nonsense_Mutation_p.Q248*|PML_ENST00000436891.3_Nonsense_Mutation_p.Q248*|PML_ENST00000569965.1_Nonsense_Mutation_p.Q248*	NM_033238.2	NP_150241.2	P29590	PML_HUMAN	promyelocytic leukemia	248					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|apoptotic process (GO:0006915)|branching involved in mammary gland duct morphogenesis (GO:0060444)|cell cycle arrest (GO:0007050)|cell fate commitment (GO:0045165)|cellular response to interleukin-4 (GO:0071353)|cellular senescence (GO:0090398)|circadian regulation of gene expression (GO:0032922)|common-partner SMAD protein phosphorylation (GO:0007182)|cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|endoplasmic reticulum calcium ion homeostasis (GO:0032469)|entrainment of circadian clock by photoperiod (GO:0043153)|extrinsic apoptotic signaling pathway (GO:0097191)|innate immune response (GO:0045087)|interferon-gamma-mediated signaling pathway (GO:0060333)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|intrinsic apoptotic signaling pathway in response to endoplasmic reticulum stress (GO:0070059)|intrinsic apoptotic signaling pathway in response to oxidative stress (GO:0008631)|maintenance of protein location in nucleus (GO:0051457)|myeloid cell differentiation (GO:0030099)|negative regulation of angiogenesis (GO:0016525)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of mitotic cell cycle (GO:0045930)|negative regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000059)|negative regulation of telomerase activity (GO:0051974)|negative regulation of telomere maintenance via telomerase (GO:0032211)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of translation in response to oxidative stress (GO:0032938)|negative regulation of viral release from host cell (GO:1902187)|PML body organization (GO:0030578)|positive regulation of apoptotic process involved in mammary gland involution (GO:0060058)|positive regulation of defense response to virus by host (GO:0002230)|positive regulation of extrinsic apoptotic signaling pathway (GO:2001238)|positive regulation of histone deacetylation (GO:0031065)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein complex assembly (GO:0006461)|protein stabilization (GO:0050821)|protein targeting (GO:0006605)|regulation of calcium ion transport into cytosol (GO:0010522)|regulation of circadian rhythm (GO:0042752)|regulation of double-strand break repair (GO:2000779)|regulation of MHC class I biosynthetic process (GO:0045343)|regulation of protein phosphorylation (GO:0001932)|regulation of transcription, DNA-templated (GO:0006355)|response to cytokine (GO:0034097)|response to gamma radiation (GO:0010332)|response to hypoxia (GO:0001666)|response to UV (GO:0009411)|retinoic acid receptor signaling pathway (GO:0048384)|SMAD protein import into nucleus (GO:0007184)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endosome (GO:0005768)|extrinsic component of endoplasmic reticulum membrane (GO:0042406)|nuclear matrix (GO:0016363)|nuclear membrane (GO:0031965)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)	cobalt ion binding (GO:0050897)|DNA binding (GO:0003677)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|SUMO binding (GO:0032183)|transcription coactivator activity (GO:0003713)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(2)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(6)|lung(8)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	31						GCAGGCGCTGCAGGAGCAGGA	0.677			T	"""RARA, PAX5"""	"""APL, ALL"""																																p.Q248X		.		Dom	yes		15	15q22	5371	promyelocytic leukemia		L	.	PML-1083	0			c.C742T						.						27.0	23.0	24.0					15																	74315308		2198	4297	6495	SO:0001587	stop_gained	5371	exon3			GCGCTGCAGGAGC	AB208950	CCDS10255.1, CCDS10256.1, CCDS10257.1, CCDS10258.1, CCDS45297.1, CCDS45298.1, CCDS45299.1, CCDS45300.1, CCDS58386.1	15q24.1	2011-04-21			ENSG00000140464	ENSG00000140464		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	9113	protein-coding gene	gene with protein product		102578					Standard	NM_033244		Approved	MYL, TRIM19, RNF71	uc002awv.3	P29590	OTTHUMG00000137607	ENST00000268058.3:c.742C>T	15.37:g.74315308C>T	ENSP00000268058:p.Gln248*	Somatic	37	0		WXS	Illumina GAIIx	Phase_I	133	57	NM_033250	0	0	2	2	0	E9PBR7|P29591|P29592|P29593|Q00755|Q15959|Q59FP9|Q8WUA0|Q96S41|Q9BPW2|Q9BWP7|Q9BZX6|Q9BZX7|Q9BZX8|Q9BZX9|Q9BZY0|Q9BZY2|Q9BZY3	Nonsense_Mutation	SNP	ENST00000268058.3	37	CCDS10255.1	.	.	.	.	.	.	.	.	.	.	C	35	5.423985	0.96111	.	.	ENSG00000140464	ENST00000395135;ENST00000435786;ENST00000359928;ENST00000436891;ENST00000268058;ENST00000395132;ENST00000268059;ENST00000354026;ENST00000418568	.	.	.	4.82	1.38	0.22167	.	1.218590	0.05768	N	0.606204	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.17369	T	0.5	-13.2282	6.2759	0.20981	0.3918:0.3155:0.2927:0.0	.	.	.	.	X	248	.	ENSP00000268058:Q248X	Q	+	1	0	PML	72102361	0.997000	0.39634	0.959000	0.39883	0.601000	0.36947	0.544000	0.23253	0.409000	0.25649	0.313000	0.20887	CAG	.		0.677	PML-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269021.3	NM_002675	
ST20	400410	hgsc.bcm.edu;broad.mit.edu	37	15	80215495	80215495	+	Intron	DEL	C	C	-	rs183370362	byFrequency	TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr15:80215495delC	ENST00000485386.1	-	1	251				C15ORF37_ENST00000542003.1_5'Flank|ST20-MTHFS_ENST00000494999.1_Intron|ST20-MTHFS_ENST00000479961.1_Intron|C15orf37_ENST00000560255.1_Frame_Shift_Del_p.S127fs			Q9HBF5	ST20_HUMAN	suppressor of tumorigenicity 20						extrinsic apoptotic signaling pathway in absence of ligand (GO:0097192)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|negative regulation of apoptotic process (GO:0043066)|negative regulation of intrinsic apoptotic signaling pathway (GO:2001243)	mitochondrial outer membrane (GO:0005741)	protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)			kidney(1)|large_intestine(1)|lung(1)|urinary_tract(1)	4						CAGCTCTCCTCCCCCTCCTCC	0.721																																					.		.											.	.	0			.						.						3.0	3.0	3.0					15																	80215495		1541	3478	5019	SO:0001627	intron_variant	283687	.			TCTCCTCCCCCTC	AF249277	CCDS42067.1	15q25.1	2007-07-16				ENSG00000180953			33520	protein-coding gene	gene with protein product							Standard	NM_001100879		Approved	HCCS-1		Q9HBF5		ENST00000485386.1:c.10+298G>-	15.37:g.80215495delC		Somatic	16	0		WXS	Illumina GAIIx	Phase_I	37	16	.	0	0	0	0	0		RNA	DEL	ENST00000485386.1	37	CCDS42067.1																																																																																			.		0.721	ST20-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000416729.1		
CEMIP	57214	broad.mit.edu	37	15	81201549	81201549	+	Missense_Mutation	SNP	G	G	A	rs200544972		TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr15:81201549G>A	ENST00000394685.3	+	14	2118	c.1699G>A	c.(1699-1701)Gaa>Aaa	p.E567K	RP11-351M8.1_ENST00000560560.1_Intron|KIAA1199_ENST00000220244.3_Missense_Mutation_p.E567K|KIAA1199_ENST00000356249.5_Missense_Mutation_p.E567K|RP11-351M8.2_ENST00000560873.1_RNA			Q8WUJ3	CEMIP_HUMAN		567	Necessary for its endoplasmic reticulum (ER) retention and interaction with HSPA5.				hyaluronan catabolic process (GO:0030214)|positive regulation of cell migration (GO:0030335)|positive regulation of peptidyl-threonine phosphorylation (GO:0010800)|positive regulation of protein kinase C activity (GO:1900020)|positive regulation of protein targeting to membrane (GO:0090314)|positive regulation of release of sequestered calcium ion into cytosol (GO:0051281)|sensory perception of sound (GO:0007605)	clathrin-coated vesicle membrane (GO:0030665)|coated pit (GO:0005905)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	clathrin heavy chain binding (GO:0032050)|ER retention sequence binding (GO:0046923)|hyaluronic acid binding (GO:0005540)|hyalurononglucosaminidase activity (GO:0004415)			breast(4)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(10)|lung(14)|ovary(1)|prostate(3)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	49						TGATGTAGACGAAAGGGGAGG	0.542																																					p.E567K		.											.	KIAA1199-93	0			c.G1699A						.						172.0	124.0	140.0					15																	81201549		2203	4300	6503	SO:0001583	missense	57214	exon13			GTAGACGAAAGGG																												ENST00000394685.3:c.1699G>A	15.37:g.81201549G>A	ENSP00000378177:p.Glu567Lys	Somatic	167	0		WXS	Illumina GAIIx	Phase_I	338	8	NM_018689	0	0	0	0	0	Q6L9J5|Q9H1K5|Q9NPN9|Q9ULM1	Missense_Mutation	SNP	ENST00000394685.3	37	CCDS10315.1	.	.	.	.	.	.	.	.	.	.	G	8.606	0.887984	0.17540	.	.	ENSG00000103888	ENST00000220244;ENST00000394685;ENST00000356249;ENST00000394683	T;T;T	0.43294	0.95;0.95;0.95	4.57	3.65	0.41850	Pectin lyase fold/virulence factor (1);	0.261941	0.35207	N	0.003368	T	0.44307	0.1287	M	0.83774	2.66	0.09310	N	1	B	0.11235	0.004	B	0.08055	0.003	T	0.37753	-0.9692	10	0.19590	T	0.45	-7.41	12.4512	0.55679	0.0814:0.0:0.9186:0.0	.	567	Q8WUJ3	K1199_HUMAN	K	567	ENSP00000220244:E567K;ENSP00000378177:E567K;ENSP00000348583:E567K	ENSP00000220244:E567K	E	+	1	0	KIAA1199	78988604	0.996000	0.38824	0.005000	0.12908	0.084000	0.17831	2.580000	0.46068	1.145000	0.42336	0.467000	0.42956	GAA	G|0.999;A|0.001		0.542	KIAA1199-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000291389.1		
CEMIP	57214	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	15	81218052	81218052	+	Silent	SNP	C	C	T	rs372531428		TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr15:81218052C>T	ENST00000394685.3	+	19	2795	c.2376C>T	c.(2374-2376)caC>caT	p.H792H	KIAA1199_ENST00000220244.3_Silent_p.H792H|KIAA1199_ENST00000356249.5_Silent_p.H792H|RP11-351M8.2_ENST00000560873.1_RNA			Q8WUJ3	CEMIP_HUMAN		792					hyaluronan catabolic process (GO:0030214)|positive regulation of cell migration (GO:0030335)|positive regulation of peptidyl-threonine phosphorylation (GO:0010800)|positive regulation of protein kinase C activity (GO:1900020)|positive regulation of protein targeting to membrane (GO:0090314)|positive regulation of release of sequestered calcium ion into cytosol (GO:0051281)|sensory perception of sound (GO:0007605)	clathrin-coated vesicle membrane (GO:0030665)|coated pit (GO:0005905)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	clathrin heavy chain binding (GO:0032050)|ER retention sequence binding (GO:0046923)|hyaluronic acid binding (GO:0005540)|hyalurononglucosaminidase activity (GO:0004415)			breast(4)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(10)|lung(14)|ovary(1)|prostate(3)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	49						ACCAGGACCACGGGGCCTGGC	0.657																																					p.H792H		.											.	KIAA1199-93	0			c.C2376T						.	C		1,4403	2.1+/-5.4	0,1,2201	30.0	34.0	33.0		2376	-5.4	0.9	15		33	0,8600		0,0,4300	no	coding-synonymous	KIAA1199	NM_018689.1		0,1,6501	TT,TC,CC		0.0,0.0227,0.0077		792/1362	81218052	1,13003	2202	4300	6502	SO:0001819	synonymous_variant	57214	exon18			GGACCACGGGGCC																												ENST00000394685.3:c.2376C>T	15.37:g.81218052C>T		Somatic	64	0		WXS	Illumina GAIIx	Phase_I	170	159	NM_018689	0	0	0	0	0	Q6L9J5|Q9H1K5|Q9NPN9|Q9ULM1	Silent	SNP	ENST00000394685.3	37	CCDS10315.1																																																																																			.		0.657	KIAA1199-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000291389.1		
KIF7	374654	hgsc.bcm.edu	37	15	90171910	90171910	+	Frame_Shift_Del	DEL	C	C	-			TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr15:90171910delC	ENST00000394412.3	-	19	3848	c.3772delG	c.(3772-3774)gccfs	p.A1258fs	KIF7_ENST00000558928.1_5'UTR	NM_198525.2	NP_940927.2	Q2M1P5	KIF7_HUMAN	kinesin family member 7	1258					ATP catabolic process (GO:0006200)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|negative regulation of smoothened signaling pathway (GO:0045879)|positive regulation of smoothened signaling pathway (GO:0045880)|smoothened signaling pathway (GO:0007224)|ventricular system development (GO:0021591)	cilium (GO:0005929)|kinesin complex (GO:0005871)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			central_nervous_system(2)|cervix(1)|endometrium(2)|large_intestine(5)|lung(11)|ovary(2)|stomach(1)|urinary_tract(1)	25	Lung NSC(78;0.0237)|all_lung(78;0.0478)		BRCA - Breast invasive adenocarcinoma(143;0.128)			GTGCGGGGGGCCCCCTCAGTG	0.662																																					p.A1258fs		.											.	KIF7-523	0			c.3772delG						.						20.0	26.0	24.0					15																	90171910		2189	4287	6476	SO:0001589	frameshift_variant	374654	exon19			GGGGGGCCCCCTC	AY358384	CCDS32325.2	15q26.1	2011-06-02			ENSG00000166813	ENSG00000166813		"""Kinesins"""	30497	protein-coding gene	gene with protein product		611254				11416179, 15547730	Standard	NM_198525		Approved	JBTS12	uc002bof.2	Q2M1P5	OTTHUMG00000157177	ENST00000394412.3:c.3772delG	15.37:g.90171910delC	ENSP00000377934:p.Ala1258fs	Somatic	49	2		WXS	Illumina GAIIx	Phase_I	113	19	NM_198525	0	0	0	0	0	Q3SXY0|Q6UXE9|Q8IW72	Frame_Shift_Del	DEL	ENST00000394412.3	37	CCDS32325.2																																																																																			.		0.662	KIF7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347782.1	NM_198525	
KIF7	374654	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	15	90192528	90192528	+	Silent	SNP	G	G	A			TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr15:90192528G>A	ENST00000394412.3	-	4	676	c.600C>T	c.(598-600)aaC>aaT	p.N200N		NM_198525.2	NP_940927.2	Q2M1P5	KIF7_HUMAN	kinesin family member 7	200	Kinesin motor. {ECO:0000255|PROSITE- ProRule:PRU00283}.				ATP catabolic process (GO:0006200)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|negative regulation of smoothened signaling pathway (GO:0045879)|positive regulation of smoothened signaling pathway (GO:0045880)|smoothened signaling pathway (GO:0007224)|ventricular system development (GO:0021591)	cilium (GO:0005929)|kinesin complex (GO:0005871)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			central_nervous_system(2)|cervix(1)|endometrium(2)|large_intestine(5)|lung(11)|ovary(2)|stomach(1)|urinary_tract(1)	25	Lung NSC(78;0.0237)|all_lung(78;0.0478)		BRCA - Breast invasive adenocarcinoma(143;0.128)			GCCGCGCCGCGTTGCCCATCT	0.701																																					p.N200N		.											.	KIF7-523	0			c.C600T						.						1.0	2.0	2.0					15																	90192528		474	1207	1681	SO:0001819	synonymous_variant	374654	exon4			CGCCGCGTTGCCC	AY358384	CCDS32325.2	15q26.1	2011-06-02			ENSG00000166813	ENSG00000166813		"""Kinesins"""	30497	protein-coding gene	gene with protein product		611254				11416179, 15547730	Standard	NM_198525		Approved	JBTS12	uc002bof.2	Q2M1P5	OTTHUMG00000157177	ENST00000394412.3:c.600C>T	15.37:g.90192528G>A		Somatic	33	0		WXS	Illumina GAIIx	Phase_I	152	80	NM_198525	0	0	0	0	0	Q3SXY0|Q6UXE9|Q8IW72	Silent	SNP	ENST00000394412.3	37	CCDS32325.2																																																																																			.		0.701	KIF7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347782.1	NM_198525	
TPSAB1	7177	broad.mit.edu	37	16	1291287	1291287	+	Silent	SNP	C	C	T			TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr16:1291287C>T	ENST00000338844.3	+	3	228	c.195C>T	c.(193-195)caC>caT	p.H65H	TPSAB1_ENST00000461509.2_Silent_p.H72H	NM_003294.3	NP_003285.2	Q15661	TRYB1_HUMAN	tryptase alpha/beta 1	65	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				defense response (GO:0006952)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)			NS(2)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|lung(4)|skin(1)	10		Hepatocellular(780;0.00369)				CCCTCATCCACCCCCAGTGGG	0.701																																					p.H65H		.											.	TPSAB1-22	0			c.C195T						.						48.0	47.0	47.0					16																	1291287		2198	4298	6496	SO:0001819	synonymous_variant	7177	exon3			CATCCACCCCCAG	M33494	CCDS10431.1	16p13.3	2009-11-13	2004-10-14	2004-10-15	ENSG00000172236	ENSG00000172236			12019	protein-coding gene	gene with protein product	"""tryptase alpha II"", ""tryptase beta I"", ""tryptase-I"", ""tryptase-II"", ""tryptase-III"""	191080	"""tryptase beta 1"""	TPSB1, TPS1, TPS2		2203827, 9920877	Standard	NM_003294		Approved		uc002ckz.3	Q15661	OTTHUMG00000090467	ENST00000338844.3:c.195C>T	16.37:g.1291287C>T		Somatic	120	0		WXS	Illumina GAIIx	Phase_I	214	7	NM_003294	0	0	0	0	0	D2E6R9|D2E6S1|P15157|Q15663|Q6B052|Q9H2Y4|Q9H2Y5|Q9UQI1	Silent	SNP	ENST00000338844.3	37	CCDS10431.1																																																																																			.		0.701	TPSAB1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000206914.1	NM_003294	
TELO2	9894	hgsc.bcm.edu	37	16	1544462	1544462	+	Silent	SNP	G	G	T			TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr16:1544462G>T	ENST00000262319.6	+	2	459	c.180G>T	c.(178-180)tcG>tcT	p.S60S		NM_016111.3	NP_057195.2	Q9Y4R8	TELO2_HUMAN	telomere maintenance 2	60					regulation of TOR signaling (GO:0032006)	chromosome, telomeric region (GO:0000781)|cytoplasm (GO:0005737)|intracellular (GO:0005622)|membrane (GO:0016020)|nucleus (GO:0005634)|TORC1 complex (GO:0031931)|TORC2 complex (GO:0031932)	protein complex binding (GO:0032403)			NS(1)|endometrium(1)|kidney(5)|lung(9)|ovary(1)|skin(1)|urinary_tract(1)	19		Hepatocellular(780;0.219)				CCCACTTCTCGCCTGTCCTCA	0.642											OREG0023547	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.S60S		.											.	TELO2-90	0			c.G180T						.																																			SO:0001819	synonymous_variant	9894	exon2			CTTCTCGCCTGTC	AL080126	CCDS32363.1	16p13.3	2013-08-06	2013-08-06		ENSG00000100726	ENSG00000100726			29099	protein-coding gene	gene with protein product		611140	"""TEL2, telomere maintenance 2, homolog (S. cerevisiae)"""			9734811, 11230166, 12670948	Standard	NM_016111		Approved	KIAA0683, hCLK2, TEL2	uc002cly.3	Q9Y4R8	OTTHUMG00000044471	ENST00000262319.6:c.180G>T	16.37:g.1544462G>T		Somatic	96	0	596	WXS	Illumina GAIIx	Phase_I	107	6	NM_016111	0	0	18	18	0	D3DU73|O75168|Q7LDV4|Q9BR21	Silent	SNP	ENST00000262319.6	37	CCDS32363.1																																																																																			G|1.000;C|0.000		0.642	TELO2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000103602.2	NM_016111	
IFT140	9742	broad.mit.edu;bcgsc.ca	37	16	1608017	1608017	+	Missense_Mutation	SNP	C	C	A	rs140458893		TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr16:1608017C>A	ENST00000426508.2	-	19	2681	c.2318G>T	c.(2317-2319)cGg>cTg	p.R773L	IFT140_ENST00000439987.2_5'UTR	NM_014714.3	NP_055529.2	Q96RY7	IF140_HUMAN	intraflagellar transport 140	773					cilium assembly (GO:0042384)|intraciliary retrograde transport (GO:0035721)|protein localization to cilium (GO:0061512)|regulation of cilium assembly (GO:1902017)|renal system development (GO:0072001)|retina development in camera-type eye (GO:0060041)|skeletal system morphogenesis (GO:0048705)	axoneme (GO:0005930)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|intraciliary transport particle A (GO:0030991)|photoreceptor connecting cilium (GO:0032391)				breast(1)|central_nervous_system(2)|endometrium(7)|kidney(4)|large_intestine(12)|lung(10)|ovary(5)|pancreas(1)|prostate(4)|skin(4)|stomach(2)|urinary_tract(1)	53		Hepatocellular(780;0.219)				CATGGCGTCCCGGGTGGCCTT	0.577																																					p.R773L		.											.	IFT140-95	0			c.G2318T						.						180.0	170.0	174.0					16																	1608017		2199	4300	6499	SO:0001583	missense	9742	exon19			GCGTCCCGGGTGG	AB011162	CCDS10439.1	16p13.3	2014-07-03	2014-07-03	2005-11-02	ENSG00000187535	ENSG00000187535		"""Intraflagellar transport homologs"", ""WD repeat domain containing"""	29077	protein-coding gene	gene with protein product		614620	"""WD and tetratricopeptide repeats 2"", ""intraflagellar transport 140 homolog (Chlamydomonas)"""	WDTC2		9628581	Standard	NM_014714		Approved	gs114, KIAA0590	uc002cmb.3	Q96RY7	OTTHUMG00000128585	ENST00000426508.2:c.2318G>T	16.37:g.1608017C>A	ENSP00000406012:p.Arg773Leu	Somatic	125	2		WXS	Illumina GAIIx	Phase_I	157	8	NM_014714	0	0	1	1	0	A2A2A8|D3DU75|O60332|Q9UG52	Missense_Mutation	SNP	ENST00000426508.2	37	CCDS10439.1	.	.	.	.	.	.	.	.	.	.	C	17.39	3.377313	0.61735	.	.	ENSG00000187535	ENST00000397417;ENST00000426508;ENST00000439987	T	0.60040	0.22	5.33	0.00553	0.14063	.	0.269957	0.37669	N	0.001981	T	0.60340	0.2261	M	0.76002	2.32	0.54753	D	0.999988	P;P	0.45715	0.667;0.865	B;P	0.50378	0.343;0.639	T	0.56727	-0.7931	10	0.52906	T	0.07	.	6.3561	0.21402	0.1114:0.4926:0.0:0.396	.	773;498	Q96RY7;B4DR58	IF140_HUMAN;.	L	773	ENSP00000406012:R773L	ENSP00000380562:R773L	R	-	2	0	IFT140	1548018	0.021000	0.18746	0.673000	0.29887	0.942000	0.58702	0.318000	0.19504	-0.205000	0.10219	-0.140000	0.14226	CGG	C|1.000;T|0.000		0.577	IFT140-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250438.2	NM_014714	
DNAJA3	9093	ucsc.edu;bcgsc.ca	37	16	4496977	4496977	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr16:4496977G>A	ENST00000262375.6	+	8	1164	c.1087G>A	c.(1087-1089)Gcc>Acc	p.A363T	DNAJA3_ENST00000355296.4_Missense_Mutation_p.A363T|DNAJA3_ENST00000431375.2_Missense_Mutation_p.A210T	NM_005147.5	NP_005138.3	Q96EY1	DNJA3_HUMAN	DnaJ (Hsp40) homolog, subfamily A, member 3	363					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|activation-induced cell death of T cells (GO:0006924)|cell aging (GO:0007569)|mitochondrial DNA replication (GO:0006264)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of interferon-gamma-mediated signaling pathway (GO:0060336)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of programmed cell death (GO:0043069)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuromuscular junction development (GO:0007528)|positive regulation of apoptotic process (GO:0043065)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of T cell proliferation (GO:0042102)|protein folding (GO:0006457)|protein stabilization (GO:0050821)|response to heat (GO:0009408)|response to interferon-gamma (GO:0034341)|skeletal muscle acetylcholine-gated channel clustering (GO:0071340)|small GTPase mediated signal transduction (GO:0007264)|T cell differentiation in thymus (GO:0033077)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extrinsic component of plasma membrane (GO:0019897)|intracellular membrane-bounded organelle (GO:0043231)|mitochondrial matrix (GO:0005759)|mitochondrial nucleoid (GO:0042645)|mitochondrion (GO:0005739)|neuromuscular junction (GO:0031594)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)	ATP binding (GO:0005524)|interferon-gamma receptor binding (GO:0005133)|metal ion binding (GO:0046872)|NF-kappaB binding (GO:0051059)|protein kinase binding (GO:0019901)|small GTPase regulator activity (GO:0005083)|transcription factor binding (GO:0008134)			NS(1)|breast(3)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|ovary(2)|upper_aerodigestive_tract(2)	15						TGGGGGTACAGCCAGAGCCCA	0.522																																					p.A363T		.											.	DNAJA3-291	0			c.G1087A						.						68.0	70.0	70.0					16																	4496977		2197	4300	6497	SO:0001583	missense	9093	exon8			GGTACAGCCAGAG	AF061749	CCDS10515.1, CCDS45400.1, CCDS66930.1	16p13.3	2011-09-02			ENSG00000103423	ENSG00000103423		"""Heat shock proteins / DNAJ (HSP40)"""	11808	protein-coding gene	gene with protein product		608382		TID1		9683573	Standard	NM_005147		Approved	hTid-1	uc002cwk.3	Q96EY1	OTTHUMG00000129470	ENST00000262375.6:c.1087G>A	16.37:g.4496977G>A	ENSP00000262375:p.Ala363Thr	Somatic	166	3		WXS	Illumina GAIIx	Phase_I	149	137	NM_001135110	0	0	0	0	0	B2RAJ5|B4DI33|E7ES32|O75472|Q8WUJ6|Q8WXJ3|Q96D76|Q96IV1|Q9NYH8	Missense_Mutation	SNP	ENST00000262375.6	37	CCDS10515.1	.	.	.	.	.	.	.	.	.	.	G	18.84	3.709728	0.68730	.	.	ENSG00000103423	ENST00000262375;ENST00000355296;ENST00000431375	T;T;T	0.42131	0.98;0.98;0.98	5.47	5.47	0.80525	Chaperone DnaJ, C-terminal (1);HSP40/DnaJ peptide-binding (1);	0.110120	0.64402	D	0.000006	T	0.42832	0.1220	L	0.43554	1.36	0.52099	D	0.999942	P;B;P	0.42337	0.743;0.171;0.776	B;B;B	0.43052	0.248;0.059;0.406	T	0.20638	-1.0269	10	0.36615	T	0.2	-19.7758	18.3202	0.90236	0.0:0.0:1.0:0.0	.	210;363;363	E7ES32;Q96EY1-2;Q96EY1	.;.;DNJA3_HUMAN	T	363;363;210	ENSP00000262375:A363T;ENSP00000347445:A363T;ENSP00000393970:A210T	ENSP00000262375:A363T	A	+	1	0	DNAJA3	4436978	1.000000	0.71417	0.994000	0.49952	0.947000	0.59692	7.984000	0.88150	2.583000	0.87209	0.561000	0.74099	GCC	.		0.522	DNAJA3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000251633.1		
SMG1	23049	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	16	18864971	18864974	+	Frame_Shift_Del	DEL	GAGT	GAGT	-			TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10	GAGT	GAGT	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr16:18864971_18864974delGAGT	ENST00000446231.2	-	31	5111_5114	c.4699_4702delACTC	c.(4699-4704)actctafs	p.TL1567fs	SMG1_ENST00000389467.3_Frame_Shift_Del_p.TL1567fs			Q96Q15	SMG1_HUMAN	SMG1 phosphatidylinositol 3-kinase-related kinase	1567	FAT. {ECO:0000255|PROSITE- ProRule:PRU00534}.|Interaction with SMG8 and SMG9.				DNA repair (GO:0006281)|gene expression (GO:0010467)|mRNA export from nucleus (GO:0006406)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|peptidyl-serine phosphorylation (GO:0018105)|phosphatidylinositol phosphorylation (GO:0046854)|protein autophosphorylation (GO:0046777)|response to stress (GO:0006950)|RNA metabolic process (GO:0016070)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			NS(2)|breast(8)|cervix(2)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(16)|lung(37)|ovary(1)|skin(1)|stomach(4)|urinary_tract(1)	92						AGTTCTATTAGAGTGAGTATGTTT	0.387																																					p.1567_1568del		.											.	SMG1-1160	0			c.4699_4702del						.																																			SO:0001589	frameshift_variant	23049	exon31			CTATTAGAGTGAG	AB061371	CCDS45430.1	16p12.3	2013-07-02	2013-07-02		ENSG00000157106	ENSG00000157106			30045	protein-coding gene	gene with protein product	"""phosphatidylinositol 3-kinase-related kinase"""	607032	"""smg-1 homolog, phosphatidylinositol 3-kinase-related kinase (C. elegans)"""			9455477, 11331269, 17229728	Standard	NM_015092		Approved	LIP, KIAA0421, ATX	uc002dfm.3	Q96Q15	OTTHUMG00000166900	ENST00000446231.2:c.4699_4702delACTC	16.37:g.18864975_18864978delGAGT	ENSP00000402515:p.Thr1567fs	Somatic	123	0		WXS	Illumina GAIIx	Phase_I	222	87	NM_015092	0	0	0	0	0	O43305|Q13284|Q8NFX2|Q96QV0|Q96RW3	Frame_Shift_Del	DEL	ENST00000446231.2	37	CCDS45430.1																																																																																			.		0.387	SMG1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000391817.1	NM_015092	
GPR139	124274	broad.mit.edu	37	16	20043749	20043749	+	Missense_Mutation	SNP	T	T	C			TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr16:20043749T>C	ENST00000570682.1	-	2	670	c.370A>G	c.(370-372)Att>Gtt	p.I124V		NM_001002911.2	NP_001002911.1	Q6DWJ6	GP139_HUMAN	G protein-coupled receptor 139	124					G-protein coupled receptor signaling pathway (GO:0007186)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	neuropeptide receptor activity (GO:0008188)			autonomic_ganglia(1)|central_nervous_system(1)|kidney(1)|large_intestine(4)|lung(17)|ovary(2)|prostate(3)|upper_aerodigestive_tract(1)	30						TACCTGTCAATGGTTAACGGT	0.493																																					p.I124V		.											.	GPR139-92	0			c.A370G						.						155.0	125.0	135.0					16																	20043749		2203	4300	6503	SO:0001583	missense	124274	exon2			TGTCAATGGTTAA	AY255545	CCDS32398.1	16p13.11	2012-08-21						"""GPCR / Class A : Orphans"""	19995	protein-coding gene	gene with protein product						12679517	Standard	XM_005255114		Approved	PGR3	uc002dgu.1	Q6DWJ6		ENST00000570682.1:c.370A>G	16.37:g.20043749T>C	ENSP00000458791:p.Ile124Val	Somatic	215	0		WXS	Illumina GAIIx	Phase_I	417	11	NM_001002911	0	0	0	0	0	A8K5R9|Q86SP2|Q8TDU8	Missense_Mutation	SNP	ENST00000570682.1	37	CCDS32398.1	.	.	.	.	.	.	.	.	.	.	T	0.094	-1.162077	0.01673	.	.	ENSG00000180269	ENST00000326571	.	.	.	5.73	3.49	0.39957	GPCR, rhodopsin-like superfamily (1);	0.108332	0.64402	N	0.000007	T	0.25195	0.0612	N	0.05487	-0.04	0.42200	D	0.991768	B	0.02656	0.0	B	0.04013	0.001	T	0.17440	-1.0369	9	0.02654	T	1	-16.8107	8.8448	0.35164	0.0:0.1541:0.0:0.8459	.	124	Q6DWJ6	GP139_HUMAN	V	124	.	ENSP00000370779:I124V	I	-	1	0	GPR139	19951250	0.987000	0.35691	0.059000	0.19551	0.709000	0.40893	2.148000	0.42235	0.459000	0.27016	0.533000	0.62120	ATT	.		0.493	GPR139-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000438522.1	NM_001002911	
VWA3A	146177	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	16	22128481	22128481	+	Missense_Mutation	SNP	A	A	T			TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr16:22128481A>T	ENST00000389398.5	+	11	1070	c.974A>T	c.(973-975)tAc>tTc	p.Y325F	VWA3A_ENST00000389397.4_5'UTR	NM_173615.3	NP_775886.3	A6NCI4	VWA3A_HUMAN	von Willebrand factor A domain containing 3A	325						extracellular region (GO:0005576)				haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(1)|skin(1)	7				GBM - Glioblastoma multiforme(48;0.0439)		TACCACTGCTACAGCCCAAAG	0.562																																					p.Y325F		.											.	VWA3A-1	0			c.A974T						.						135.0	128.0	130.0					16																	22128481		1961	4157	6118	SO:0001583	missense	146177	exon11			ACTGCTACAGCCC	AK128606, AK098260	CCDS45441.1	16p12.1	2008-02-05				ENSG00000175267			27088	protein-coding gene	gene with protein product						12477932	Standard	XM_006721021		Approved	FLJ46765, FLJ40941	uc010vbq.2	A6NCI4		ENST00000389398.5:c.974A>T	16.37:g.22128481A>T	ENSP00000374049:p.Tyr325Phe	Somatic	151	0		WXS	Illumina GAIIx	Phase_I	357	161	NM_173615	0	0	0	0	0	A4QMU8|A6NNC0|Q6UTX4|Q6ZQZ9|Q8IUY6|Q8N9W1	Missense_Mutation	SNP	ENST00000389398.5	37	CCDS45441.1	.	.	.	.	.	.	.	.	.	.	A	20.9	4.060269	0.76074	.	.	ENSG00000175267	ENST00000310694;ENST00000389398	T	0.13420	2.59	5.49	5.49	0.81192	.	0.239385	0.29722	N	0.011374	T	0.36054	0.0953	M	0.72479	2.2	0.80722	D	1	D	0.89917	1.0	D	0.77004	0.989	T	0.10800	-1.0614	10	0.87932	D	0	.	12.9759	0.58537	1.0:0.0:0.0:0.0	.	325	A6NCI4	VWA3A_HUMAN	F	225;325	ENSP00000374049:Y325F	ENSP00000308827:Y225F	Y	+	2	0	VWA3A	22035982	1.000000	0.71417	1.000000	0.80357	0.919000	0.55068	4.339000	0.59322	2.085000	0.62840	0.533000	0.62120	TAC	.		0.562	VWA3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000430052.1		
GTF3C1	2975	broad.mit.edu	37	16	27512657	27512657	+	Missense_Mutation	SNP	T	T	G			TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr16:27512657T>G	ENST00000356183.4	-	12	1931	c.1916A>C	c.(1915-1917)aAg>aCg	p.K639T	GTF3C1_ENST00000561623.1_Missense_Mutation_p.K639T	NM_001520.3	NP_001511.2	Q12789	TF3C1_HUMAN	general transcription factor IIIC, polypeptide 1, alpha 220kDa	639					5S class rRNA transcription from RNA polymerase III type 1 promoter (GO:0042791)|gene expression (GO:0010467)|rRNA transcription (GO:0009303)|transcription from RNA polymerase III promoter (GO:0006383)|transcription, DNA-templated (GO:0006351)|tRNA transcription (GO:0009304)|tRNA transcription from RNA polymerase III promoter (GO:0042797)	membrane (GO:0016020)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)|transcription factor TFIIIC complex (GO:0000127)	DNA binding (GO:0003677)			breast(2)|central_nervous_system(4)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(14)|liver(3)|lung(28)|ovary(2)|pancreas(1)|prostate(2)|skin(5)|upper_aerodigestive_tract(2)	80						CATGATCATCTTCTGAATCCT	0.517																																					p.K639T		.											.	GTF3C1-94	0			c.A1916C						.						133.0	123.0	127.0					16																	27512657		2197	4300	6497	SO:0001583	missense	2975	exon12			ATCATCTTCTGAA	U06485	CCDS32414.1, CCDS66988.1	16p12	2010-03-23	2002-08-29			ENSG00000077235		"""General transcription factors"""	4664	protein-coding gene	gene with protein product		603246	"""general transcription factor IIIC, polypeptide 1 (alpha subunit, 220kD )"""			8164661, 8127861	Standard	NM_001520		Approved	TFIIIC220	uc002dov.2	Q12789		ENST00000356183.4:c.1916A>C	16.37:g.27512657T>G	ENSP00000348510:p.Lys639Thr	Somatic	183	0		WXS	Illumina GAIIx	Phase_I	312	7	NM_001520	0	0	0	0	0	B2RP21|Q12838|Q6DKN9|Q9Y4W9	Missense_Mutation	SNP	ENST00000356183.4	37	CCDS32414.1	.	.	.	.	.	.	.	.	.	.	T	17.25	3.340987	0.60963	.	.	ENSG00000077235	ENST00000356183;ENST00000388971	T	0.42131	0.98	5.37	5.37	0.77165	.	0.000000	0.85682	D	0.000000	T	0.67439	0.2893	M	0.82630	2.6	0.48511	D	0.999667	D;D	0.89917	1.0;1.0	D;D	0.78314	0.991;0.989	T	0.73294	-0.4028	10	0.87932	D	0	-32.7371	15.3486	0.74363	0.0:0.0:0.0:1.0	.	639;639	Q12789;Q12789-3	TF3C1_HUMAN;.	T	639;637	ENSP00000348510:K639T	ENSP00000348510:K639T	K	-	2	0	GTF3C1	27420158	1.000000	0.71417	1.000000	0.80357	0.966000	0.64601	7.460000	0.80816	2.155000	0.67459	0.460000	0.39030	AAG	.		0.517	GTF3C1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000433856.1	NM_001520	
APOBR	55911	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	16	28509449	28509449	+	Silent	SNP	C	C	T	rs186642005		TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr16:28509449C>T	ENST00000431282.1	+	4	2986	c.2976C>T	c.(2974-2976)cgC>cgT	p.R992R	CLN3_ENST00000567160.1_5'Flank|APOBR_ENST00000564831.1_Silent_p.R1001R|CLN3_ENST00000569430.1_5'Flank|APOBR_ENST00000328423.5_Silent_p.R992R			Q0VD83	APOBR_HUMAN	apolipoprotein B receptor	992					cholesterol metabolic process (GO:0008203)|lipid transport (GO:0006869)|triglyceride metabolic process (GO:0006641)	chylomicron (GO:0042627)|low-density lipoprotein particle (GO:0034362)|membrane (GO:0016020)|plasma membrane (GO:0005886)|very-low-density lipoprotein particle (GO:0034361)	very-low-density lipoprotein particle receptor activity (GO:0030229)			breast(1)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(11)|prostate(1)|skin(2)|stomach(1)	29						CAAGGAGTCGCGTGCACCTCT	0.687													C|||	1	0.000199681	0.0008	0.0	5008	,	,		15711	0.0		0.0	False		,,,				2504	0.0				p.R1001R		.											.	APOBR-90	0			c.C3003T						.	C		1,4313		0,1,2156	18.0	22.0	20.0		2976	-9.3	0.0	16		20	0,8522		0,0,4261	no	coding-synonymous	APOBR	NM_018690.3		0,1,6417	TT,TC,CC		0.0,0.0232,0.0078		992/1089	28509449	1,12835	2157	4261	6418	SO:0001819	synonymous_variant	55911	exon3			GAGTCGCGTGCAC	AK025123	CCDS58442.1	16p11.2	2011-02-14			ENSG00000184730	ENSG00000184730			24087	protein-coding gene	gene with protein product	"""apolipoprotein B48 receptor"", ""apolipoprotein B100 receptor"""	605220				10852956	Standard	NM_018690		Approved	APOB48R, APOB100R	uc002dqb.2	Q0VD83		ENST00000431282.1:c.2976C>T	16.37:g.28509449C>T		Somatic	13	0		WXS	Illumina GAIIx	Phase_I	34	15	NM_018690	0	0	1	1	0	H3BU97|Q0VD81|Q8NC15|Q9NPJ9	Silent	SNP	ENST00000431282.1	37																																																																																				C|0.999;T|0.000		0.687	APOBR-202	KNOWN	basic|appris_candidate	protein_coding	protein_coding		NM_182804	
ATP2A1	487	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	16	28909569	28909569	+	Missense_Mutation	SNP	G	G	A	rs200092983		TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr16:28909569G>A	ENST00000357084.3	+	14	1828	c.1561G>A	c.(1561-1563)Gtc>Atc	p.V521I	ATP2A1_ENST00000536376.1_Missense_Mutation_p.V396I|ATP2A1_ENST00000395503.4_Missense_Mutation_p.V521I	NM_173201.3	NP_775293.1	O14983	AT2A1_HUMAN	ATPase, Ca++ transporting, cardiac muscle, fast twitch 1	521					apoptotic mitochondrial changes (GO:0008637)|ATP catabolic process (GO:0006200)|blood coagulation (GO:0007596)|calcium ion import (GO:0070509)|calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|intrinsic apoptotic signaling pathway in response to endoplasmic reticulum stress (GO:0070059)|ion transmembrane transport (GO:0034220)|maintenance of mitochondrion location (GO:0051659)|negative regulation of endoplasmic reticulum calcium ion concentration (GO:0032471)|negative regulation of striated muscle contraction (GO:0045988)|positive regulation of endoplasmic reticulum calcium ion concentration (GO:0032470)|positive regulation of fast-twitch skeletal muscle fiber contraction (GO:0031448)|positive regulation of mitochondrial calcium ion concentration (GO:0051561)|regulation of striated muscle contraction (GO:0006942)|relaxation of skeletal muscle (GO:0090076)|response to endoplasmic reticulum stress (GO:0034976)|transmembrane transport (GO:0055085)	calcium channel complex (GO:0034704)|endoplasmic reticulum membrane (GO:0005789)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|H zone (GO:0031673)|I band (GO:0031674)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)|platelet dense tubular network membrane (GO:0031095)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calcium-transporting ATPase activity (GO:0005388)|protein homodimerization activity (GO:0042803)			breast(1)|central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(7)|lung(10)|ovary(4)|pancreas(1)|prostate(2)|skin(3)|urinary_tract(2)	38						CCCTGAGGGCGTCATCGACCG	0.597																																					p.V521I		.											.	ATP2A1-93	0			c.G1561A						.						82.0	86.0	85.0					16																	28909569		2197	4300	6497	SO:0001583	missense	487	exon14			GAGGGCGTCATCG		CCDS10643.1, CCDS42139.1, CCDS66997.1	16p12.1	2012-10-22			ENSG00000196296	ENSG00000196296	3.6.3.8	"""ATPases / P-type"""	811	protein-coding gene	gene with protein product	"""sarcoplasmic/endoplasmic reticulum calcium ATPase 1"", ""calcium pump 1"""	108730		ATP2A			Standard	NM_004320		Approved	SERCA1	uc002dro.1	O14983	OTTHUMG00000131760	ENST00000357084.3:c.1561G>A	16.37:g.28909569G>A	ENSP00000349595:p.Val521Ile	Somatic	71	0		WXS	Illumina GAIIx	Phase_I	120	50	NM_004320	0	0	2	2	0	A8K5J9|B3KY17|O14984	Missense_Mutation	SNP	ENST00000357084.3	37	CCDS10643.1	.	.	.	.	.	.	.	.	.	.	G	13.83	2.353869	0.41700	.	.	ENSG00000196296	ENST00000357084;ENST00000395503;ENST00000395498;ENST00000536376	D;D;D	0.82619	-1.63;-1.63;-1.63	5.46	5.46	0.80206	ATPase, cation-transporting, domain N (1);ATPase, P-type, cytoplasmic domain N (1);	0.000000	0.85682	D	0.000000	T	0.67458	0.2895	N	0.05280	-0.08	0.58432	D	0.999999	B;B;B	0.24963	0.115;0.001;0.008	B;B;B	0.20577	0.03;0.02;0.012	T	0.64364	-0.6425	10	0.15499	T	0.54	.	18.0542	0.89358	0.0:0.0:1.0:0.0	.	396;521;521	B3KY17;O14983;O14983-2	.;AT2A1_HUMAN;.	I	521;521;558;396	ENSP00000349595:V521I;ENSP00000378879:V521I;ENSP00000443101:V396I	ENSP00000349595:V521I	V	+	1	0	ATP2A1	28817070	1.000000	0.71417	0.972000	0.41901	0.624000	0.37722	9.791000	0.99081	2.554000	0.86153	0.655000	0.94253	GTC	G|0.999;A|0.001		0.597	ATP2A1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000254686.2	NM_004320	
INO80E	283899	hgsc.bcm.edu	37	16	30007665	30007665	+	Frame_Shift_Del	DEL	A	A	-			TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr16:30007665delA	ENST00000563197.1	+	1	1051	c.34delA	c.(34-36)aaafs	p.K14fs	INO80E_ENST00000567705.1_Frame_Shift_Del_p.K14fs|HIRIP3_ENST00000279392.3_5'UTR|HIRIP3_ENST00000564026.1_5'Flank|HIRIP3_ENST00000566471.1_5'Flank|INO80E_ENST00000304516.7_Frame_Shift_Del_p.K14fs|INO80E_ENST00000567254.1_Frame_Shift_Del_p.K14fs|INO80E_ENST00000563040.1_3'UTR	NM_173618.1	NP_775889.1	Q8NBZ0	IN80E_HUMAN	INO80 complex subunit E	14					DNA recombination (GO:0006310)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	Ino80 complex (GO:0031011)|nucleolus (GO:0005730)|nucleus (GO:0005634)				endometrium(1)|large_intestine(2)|lung(1)|skin(1)|urinary_tract(1)	6						AGTGGACTACAAAAAAAAATA	0.632																																					p.K12fs		.											.	INO80E-91	0			c.34delA						.			60,46,4144		0,1,59,0,45,2020	28.0	31.0	30.0			5.2	1.0	16	dbSNP_126	30	90,92,8032		0,0,90,2,88,3927	no	codingComplex	INO80E	NM_173618.1		0,1,149,2,133,5947	A1A1,A1A2,A1R,A2A2,A2R,RR		2.2157,2.4941,2.3107			30007665	150,138,12176	2193	4283	6476	SO:0001589	frameshift_variant	283899	exon1			GACTACAAAAAAA	AK075133	CCDS10665.1	16p11.2	2011-07-06	2008-08-07	2008-08-07	ENSG00000169592	ENSG00000169592		"""INO80 complex subunits"""	26905	protein-coding gene	gene with protein product			"""coiled-coil domain containing 95"""	CCDC95		16230350	Standard	NM_173618		Approved	FLJ90652	uc002dvg.1	Q8NBZ0	OTTHUMG00000132114	ENST00000563197.1:c.34delA	16.37:g.30007665delA	ENSP00000457016:p.Lys14fs	Somatic	180	2		WXS	Illumina GAIIx	Phase_I	455	12	NM_173618	0	0	0	0	0	Q6Y2K3	Frame_Shift_Del	DEL	ENST00000563197.1	37	CCDS10665.1																																																																																			.		0.632	INO80E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255156.2	NM_173618	
SRCAP	10847	hgsc.bcm.edu;bcgsc.ca	37	16	30736371	30736371	+	Frame_Shift_Del	DEL	C	C	-			TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr16:30736371delC	ENST00000262518.4	+	25	6011	c.5626delC	c.(5626-5628)cccfs	p.P1880fs	SRCAP_ENST00000344771.4_Frame_Shift_Del_p.P1722fs|SRCAP_ENST00000395059.2_Frame_Shift_Del_p.P1818fs	NM_006662.2	NP_006653.2	Q6ZRS2	SRCAP_HUMAN	Snf2-related CREBBP activator protein	1880	Pro-rich.				histone acetylation (GO:0016573)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|protein complex (GO:0043234)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|histone acetyltransferase activity (GO:0004402)|transcription coactivator activity (GO:0003713)			NS(1)|breast(3)|cervix(3)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(22)|liver(3)|lung(62)|ovary(6)|pancreas(1)|prostate(4)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(5)	136			Colorectal(24;0.198)			TCGACGCCAGCCCCCCCCACC	0.567																																					p.P1876fs		.											.	SRCAP-94	0			c.5626delC						.						55.0	67.0	63.0					16																	30736371		2197	4295	6492	SO:0001589	frameshift_variant	10847	exon25			CGCCAGCCCCCCC	AB002307	CCDS10689.2	16p11.2	2009-08-06			ENSG00000080603	ENSG00000080603			16974	protein-coding gene	gene with protein product	"""Swi2/Snf2-related ATPase homolog (S. cerevisiae)"", ""domino homolog 1 (Drosophila)"""	611421				10347196, 9205841	Standard	NM_006662		Approved	KIAA0309, EAF1, SWR1, DOMO1	uc002dze.1	Q6ZRS2	OTTHUMG00000132393	ENST00000262518.4:c.5626delC	16.37:g.30736371delC	ENSP00000262518:p.Pro1880fs	Somatic	48	1		WXS	Illumina GAIIx	Phase_I	93	44	NM_006662	0	0	0	0	0	B0JZA6|O15026|Q7Z744|Q9Y5L9	Frame_Shift_Del	DEL	ENST00000262518.4	37	CCDS10689.2																																																																																			.		0.567	SRCAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255523.1	NM_006662	
BCL7C	9274	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	16	30904237	30904238	+	Frame_Shift_Del	DEL	TC	TC	-			TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10	TC	TC	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr16:30904237_30904238delTC	ENST00000215115.4	-	3	1218_1219	c.203_204delGA	c.(202-204)agafs	p.R68fs	MIR762_ENST00000390236.1_RNA|AC106782.20_ENST00000572471.1_RNA|MIR4519_ENST00000565573.1_RNA|BCL7C_ENST00000380317.4_Frame_Shift_Del_p.R68fs|MIR4519_ENST00000570025.1_RNA|MIR4519_ENST00000564901.1_RNA	NM_004765.2	NP_004756.2	Q8WUZ0	BCL7C_HUMAN	B-cell CLL/lymphoma 7C	68					apoptotic process (GO:0006915)					large_intestine(1)|lung(3)|prostate(1)|skin(1)	6			Colorectal(24;0.198)			GGCCACGGGATCTCTCTGCCCC	0.634																																					p.68_68del		.											.	BCL7C-227	0			c.203_204del						.																																			SO:0001589	frameshift_variant	9274	exon3			ACGGGATCTCTCT	AJ223980	CCDS10693.1, CCDS67012.1	16p11	2012-11-19			ENSG00000099385	ENSG00000099385			1006	protein-coding gene	gene with protein product		605847				9931421	Standard	NM_004765		Approved		uc002dzv.3	Q8WUZ0	OTTHUMG00000177719	ENST00000215115.4:c.203_204delGA	16.37:g.30904241_30904242delTC	ENSP00000215115:p.Arg68fs	Somatic	24	0		WXS	Illumina GAIIx	Phase_I	47	22	NM_004765	0	0	0	0	0	O43770|Q6PD89	Frame_Shift_Del	DEL	ENST00000215115.4	37	CCDS10693.1																																																																																			.		0.634	BCL7C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255547.3	NM_004765	
WDR59	79726	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	16	74937919	74937919	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr16:74937919G>A	ENST00000262144.6	-	18	1922	c.1792C>T	c.(1792-1794)Cgt>Tgt	p.R598C		NM_030581.3	NP_085058.3	Q6PJI9	WDR59_HUMAN	WD repeat domain 59	598										breast(3)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(13)|ovary(1)|prostate(1)	27						CTGTATAAACGAAGGTTCCCA	0.522																																					p.R598C		.											.	WDR59-92	0			c.C1792T						.						56.0	53.0	54.0					16																	74937919		2198	4300	6498	SO:0001583	missense	79726	exon18			ATAAACGAAGGTT	AB067510	CCDS32488.1	16q22.3	2013-01-09				ENSG00000103091		"""WD repeat domain containing"""	25706	protein-coding gene	gene with protein product						11572484	Standard	XM_005256146		Approved	FLJ12270	uc002fdh.1	Q6PJI9		ENST00000262144.6:c.1792C>T	16.37:g.74937919G>A	ENSP00000262144:p.Arg598Cys	Somatic	100	1		WXS	Illumina GAIIx	Phase_I	73	60	NM_030581	0	0	1	6	5	B3KRC3|Q71RE7|Q96PW5|Q9BSW6|Q9HA43	Missense_Mutation	SNP	ENST00000262144.6	37	CCDS32488.1	.	.	.	.	.	.	.	.	.	.	G	17.88	3.497286	0.64186	.	.	ENSG00000103091	ENST00000262144	T	0.69306	-0.39	5.64	5.64	0.86602	.	0.050405	0.85682	D	0.000000	T	0.79724	0.4495	L	0.54323	1.7	0.80722	D	1	D;D	0.89917	0.999;1.0	P;D	0.72338	0.719;0.977	T	0.79732	-0.1680	10	0.59425	D	0.04	-16.9312	19.7097	0.96089	0.0:0.0:1.0:0.0	.	598;43	Q6PJI9;Q6PJI9-4	WDR59_HUMAN;.	C	598	ENSP00000262144:R598C	ENSP00000262144:R598C	R	-	1	0	WDR59	73495420	1.000000	0.71417	0.751000	0.31187	0.688000	0.40055	4.871000	0.63042	2.664000	0.90586	0.460000	0.39030	CGT	.		0.522	WDR59-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000410601.3	NM_030581	
PKD1L2	114780	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	16	81164209	81164209	+	RNA	SNP	G	G	A	rs531025677		TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr16:81164209G>A	ENST00000534142.1	-	0	286				PKD1L2_ENST00000533478.1_RNA|PKD1L2_ENST00000525539.1_RNA			Q7Z442	PK1L2_HUMAN	polycystic kidney disease 1-like 2						ion transport (GO:0006811)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)	calcium ion binding (GO:0005509)|carbohydrate binding (GO:0030246)			breast(2)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(9)|lung(20)|ovary(2)|pancreas(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	44						CCCTCTGCCCGTAGGCCACGA	0.607													a|||	1	0.000199681	0.0	0.0	5008	,	,		18067	0.001		0.0	False		,,,				2504	0.0				.		.											.	PKD1L2-92	0			.						.						36.0	41.0	39.0					16																	81164209		2060	4198	6258			114780	.			CTGCCCGTAGGCC	AY164483	CCDS61998.1, CCDS61999.1	16q23.2	2014-09-11			ENSG00000166473	ENSG00000166473			21715	protein-coding gene	gene with protein product		607894				12782129	Standard	NM_052892		Approved	KIAA1879	uc002fgf.1	Q7Z442	OTTHUMG00000166126		16.37:g.81164209G>A		Somatic	116	0		WXS	Illumina GAIIx	Phase_I	123	50	.	0	0	0	0	0	Q6UEE1|Q6ZN46|Q6ZSP2|Q8N1H9|Q96CL2|Q96Q08	RNA	SNP	ENST00000534142.1	37																																																																																				.		0.607	PKD1L2-009	PUTATIVE	basic|exp_conf	processed_transcript	polymorphic_pseudogene	OTTHUMT00000387969.1		
ZZEF1	23140	bcgsc.ca	37	17	3926110	3926110	+	Missense_Mutation	SNP	C	C	G	rs711177	byFrequency	TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr17:3926110C>G	ENST00000381638.2	-	44	7229	c.7105G>C	c.(7105-7107)Gag>Cag	p.E2369Q		NM_015113.3	NP_055928.3	O43149	ZZEF1_HUMAN	zinc finger, ZZ-type with EF-hand domain 1	2369			E -> Q (in dbSNP:rs711177). {ECO:0000269|PubMed:15489334, ECO:0000269|PubMed:9455477}.				calcium ion binding (GO:0005509)|zinc ion binding (GO:0008270)			central_nervous_system(1)|cervix(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(17)|lung(19)|ovary(3)|pancreas(1)|prostate(3)|skin(8)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(3)	84						CGGATCTCCTCAAAACCGTGA	0.478													C|||	718	0.143371	0.2504	0.1311	5008	,	,		21530	0.0724		0.0706	False		,,,				2504	0.1554				p.E2369Q		.											.	ZZEF1-93	0			c.G7105C						.	C	GLN/GLU	1179,3227	413.3+/-336.4	161,857,1185	80.0	72.0	75.0		7105	5.0	1.0	17	dbSNP_86	75	497,8103	143.0+/-199.1	15,467,3818	yes	missense	ZZEF1	NM_015113.3	29	176,1324,5003	GG,GC,CC		5.7791,26.759,12.8864	benign	2369/2962	3926110	1676,11330	2203	4300	6503	SO:0001583	missense	23140	exon44			TCTCCTCAAAACC	BC035319	CCDS11043.1	17p13.3	2013-01-10	2004-11-03		ENSG00000074755	ENSG00000074755		"""Zinc fingers, ZZ-type"", ""EF-hand domain containing"""	29027	protein-coding gene	gene with protein product			"""zinc finger, ZZ-type with EF hand domain 1"""			9455477	Standard	XM_005256560		Approved	KIAA0399, ZZZ4, FLJ10821	uc002fxe.3	O43149	OTTHUMG00000090741	ENST00000381638.2:c.7105G>C	17.37:g.3926110C>G	ENSP00000371051:p.Glu2369Gln	Somatic	141	0		WXS	Illumina GAIIx	Phase_I	136	5	NM_015113	0	0	0	0	0	A7MBM5|Q6NXG0|Q6ZRA1|Q6ZSF4|Q9NVB9	Missense_Mutation	SNP	ENST00000381638.2	37	CCDS11043.1	264	0.12087912087912088	121	0.2459349593495935	45	0.12430939226519337	38	0.06643356643356643	60	0.079155672823219	C	19.67	3.871784	0.72180	0.26759	0.057791	ENSG00000074755	ENST00000381638	T	0.26810	1.71	5.96	4.97	0.65823	.	0.163737	0.52532	N	0.000067	T	0.00012	0.0000	N	0.19112	0.55	0.21499	P	0.999669417	B	0.27498	0.18	B	0.23150	0.044	T	0.37842	-0.9688	9	0.42905	T	0.14	-13.283	11.0647	0.47968	0.0:0.6898:0.2439:0.0664	rs711177;rs3816483;rs17763614;rs711177	2369	O43149	ZZEF1_HUMAN	Q	2369	ENSP00000371051:E2369Q	ENSP00000371051:E2369Q	E	-	1	0	ZZEF1	3872859	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	3.495000	0.53280	1.472000	0.48140	0.655000	0.94253	GAG	C|0.870;G|0.130		0.478	ZZEF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207480.1	NM_015113	
SMTNL2	342527	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	17	4497117	4497119	+	Splice_Site	DEL	AGA	AGA	-			TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10	AGA	AGA	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr17:4497117_4497119delAGA	ENST00000389313.4	+	4	798_800	c.731_733delAGA	c.(730-735)gagaag>gag	p.K245del	SMTNL2_ENST00000338859.4_Splice_Site_p.K101del	NM_001114974.1	NP_001108446.1	Q2TAL5	SMTL2_HUMAN	smoothelin-like 2	245										breast(1)|endometrium(9)|kidney(1)|lung(1)|skin(1)	13				READ - Rectum adenocarcinoma(115;0.0325)		TCTTCCACAGAGAAGAATTCCTC	0.576																																					p.244_245del		.											.	SMTNL2-90	0			c.731_733del						.																																			SO:0001630	splice_region_variant	342527	exon4			CCACAGAGAAGAA	AK124452	CCDS11048.1, CCDS45583.1	17p13.2	2006-04-26			ENSG00000188176	ENSG00000188176			24764	protein-coding gene	gene with protein product							Standard	NM_001114974		Approved	FLJ42461	uc002fyf.1	Q2TAL5	OTTHUMG00000132938	ENST00000389313.4:c.731-1AGA>-	17.37:g.4497120_4497122delAGA		Somatic	79	0		WXS	Illumina GAIIx	Phase_I	69	16	NM_001114974	0	0	0	0	0	Q6ZVK6	In_Frame_Del	DEL	ENST00000389313.4	37	CCDS45583.1																																																																																			.		0.576	SMTNL2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000439129.1	NM_198501	In_Frame_Del
ACAP1	9744	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	7251702	7251702	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr17:7251702G>A	ENST00000158762.3	+	17	1792	c.1586G>A	c.(1585-1587)cGa>cAa	p.R529Q	ACAP1_ENST00000575415.1_5'Flank|ACAP1_ENST00000570504.1_5'Flank|ACAP1_ENST00000574499.1_5'Flank|ACAP1_ENST00000571471.1_5'Flank	NM_014716.3	NP_055531.1	Q15027	ACAP1_HUMAN	ArfGAP with coiled-coil, ankyrin repeat and PH domains 1	529	Prevents interaction with ITGB1 when S- 554 is not phosphorylated.|Required for interaction with GULP1.				protein transport (GO:0015031)|regulation of ARF GTPase activity (GO:0032312)	endosome (GO:0005768)|membrane (GO:0016020)	ARF GTPase activator activity (GO:0008060)|zinc ion binding (GO:0008270)			NS(1)|breast(5)|cervix(3)|endometrium(4)|kidney(1)|large_intestine(7)|liver(1)|lung(6)|prostate(3)|skin(1)|urinary_tract(1)	33						ATTCGAGGGCGAAGAGGTGGC	0.627																																					p.R529Q		.											.	ACAP1-153	0			c.G1586A						.						30.0	21.0	24.0					17																	7251702		2203	4299	6502	SO:0001583	missense	9744	exon17			GAGGGCGAAGAGG	D30758	CCDS11101.1	17p13.1	2013-01-11	2008-09-22	2008-09-22	ENSG00000072818	ENSG00000072818		"""ADP-ribosylation factor GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"", ""Ankyrin repeat domain containing"""	16467	protein-coding gene	gene with protein product		607763	"""centaurin, beta 1"""	CENTB1		11050434, 11062263	Standard	NM_014716		Approved	KIAA0050	uc002ggd.2	Q15027	OTTHUMG00000102199	ENST00000158762.3:c.1586G>A	17.37:g.7251702G>A	ENSP00000158762:p.Arg529Gln	Somatic	72	0		WXS	Illumina GAIIx	Phase_I	88	77	NM_014716	0	0	0	0	0	Q53XN9	Missense_Mutation	SNP	ENST00000158762.3	37	CCDS11101.1	.	.	.	.	.	.	.	.	.	.	G	25.3	4.626579	0.87560	.	.	ENSG00000072818	ENST00000158762	T	0.73258	-0.73	5.22	5.22	0.72569	.	1.584270	0.03264	N	0.183727	T	0.66287	0.2774	N	0.22421	0.69	0.80722	D	1	D	0.56746	0.977	P	0.47102	0.537	T	0.56896	-0.7903	10	0.12430	T	0.62	.	14.1553	0.65413	0.0:0.0:1.0:0.0	.	529	Q15027	ACAP1_HUMAN	Q	529	ENSP00000158762:R529Q	ENSP00000158762:R529Q	R	+	2	0	ACAP1	7192426	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	2.452000	0.44961	2.720000	0.93068	0.655000	0.94253	CGA	.		0.627	ACAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000220049.4	NM_014716	
NLGN2	57555	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	17	7318830	7318830	+	Splice_Site	SNP	C	C	T			TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr17:7318830C>T	ENST00000302926.2	+	6	1111	c.1038C>T	c.(1036-1038)cgC>cgT	p.R346R	NLGN2_ENST00000575301.1_Splice_Site_p.R346R	NM_020795.2	NP_065846.1	Q8NFZ4	NLGN2_HUMAN	neuroligin 2	346					cell-cell junction maintenance (GO:0045217)|gephyrin clustering (GO:0097116)|locomotory exploration behavior (GO:0035641)|neuromuscular process controlling balance (GO:0050885)|neuron cell-cell adhesion (GO:0007158)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of inhibitory postsynaptic membrane potential (GO:0097151)|positive regulation of synapse assembly (GO:0051965)|positive regulation of synaptic transmission, GABAergic (GO:0032230)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|postsynaptic density protein 95 clustering (GO:0097119)|postsynaptic membrane assembly (GO:0097104)|presynaptic membrane assembly (GO:0097105)|protein localization to synapse (GO:0035418)|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000311)|regulation of respiratory gaseous exchange by neurological system process (GO:0002087)|regulation of synaptic transmission (GO:0050804)|sensory perception of pain (GO:0019233)|single organismal cell-cell adhesion (GO:0016337)|synapse assembly (GO:0007416)|synapse organization (GO:0050808)|terminal button organization (GO:0072553)	cell junction (GO:0030054)|cell surface (GO:0009986)|inhibitory synapse (GO:0060077)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|postsynaptic membrane (GO:0045211)|synapse (GO:0045202)	cell adhesion molecule binding (GO:0050839)|neurexin family protein binding (GO:0042043)|receptor activity (GO:0004872)			central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(3)|lung(7)|prostate(2)|skin(3)	22		Prostate(122;0.157)				TTCTCCCCAGCTACCACATCG	0.602																																					p.R346R		.											.	NLGN2-90	0			c.C1038T						.						74.0	55.0	61.0					17																	7318830		2203	4300	6503	SO:0001630	splice_region_variant	57555	exon6			CCCCAGCTACCAC	AB037787	CCDS11103.1	17p13.2	2008-07-18			ENSG00000169992	ENSG00000169992			14290	protein-coding gene	gene with protein product		606479				10767552, 10819331	Standard	NM_020795		Approved	KIAA1366	uc002ggt.1	Q8NFZ4	OTTHUMG00000108138	ENST00000302926.2:c.1038-1C>T	17.37:g.7318830C>T		Somatic	160	0		WXS	Illumina GAIIx	Phase_I	224	12	NM_020795	0	0	0	0	0	Q9P2I1	Silent	SNP	ENST00000302926.2	37	CCDS11103.1																																																																																			.		0.602	NLGN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000226941.2	NM_020795	Silent
SHISA6	388336	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	11461177	11461177	+	Silent	SNP	G	G	A			TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr17:11461177G>A	ENST00000409168.3	+	4	1059	c.1059G>A	c.(1057-1059)ccG>ccA	p.P353P	SHISA6_ENST00000441885.3_Silent_p.P404P|SHISA6_ENST00000432116.3_Silent_p.P385P	NM_001173461.1	NP_001166932.1	Q6ZSJ9	SHSA6_HUMAN	shisa family member 6	353						alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)				breast(1)|endometrium(4)	5						AACAGAAGCCGTTGCCAAGGG	0.657																																					p.P404P		.											.	SHISA6-67	0			c.G1212A						.						13.0	17.0	15.0					17																	11461177		692	1589	2281	SO:0001819	synonymous_variant	388336	exon6			GAAGCCGTTGCCA	AK127379, AK128003	CCDS45615.1, CCDS54089.1, CCDS54090.1	17p13.1-p12	2013-07-31	2013-07-31		ENSG00000188803	ENSG00000188803		"""Shisa homologs"""	34491	protein-coding gene	gene with protein product			"""shisa homolog 6 (Xenopus laevis)"""				Standard	NM_207386		Approved	FLJ45455	uc002gnc.2	Q6ZSJ9	OTTHUMG00000154121	ENST00000409168.3:c.1059G>A	17.37:g.11461177G>A		Somatic	107	0		WXS	Illumina GAIIx	Phase_I	128	113	NM_207386	0	0	0	0	0	B3KXV5|Q4PL63	Silent	SNP	ENST00000409168.3	37	CCDS54090.1																																																																																			.		0.657	SHISA6-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000333970.2	NM_207386	
MYOCD	93649	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	12649333	12649333	+	Missense_Mutation	SNP	A	A	G			TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr17:12649333A>G	ENST00000343344.4	+	9	1069	c.1069A>G	c.(1069-1071)Act>Gct	p.T357A	MYOCD_ENST00000425538.1_Missense_Mutation_p.T357A|MYOCD_ENST00000395988.1_3'UTR|AC005358.1_ENST00000609971.1_Missense_Mutation_p.T261A			Q8IZQ8	MYCD_HUMAN	myocardin	357					cardiac muscle cell differentiation (GO:0055007)|cardiac ventricle development (GO:0003231)|cardiocyte differentiation (GO:0035051)|cell growth involved in cardiac muscle cell development (GO:0061049)|cellular component maintenance (GO:0043954)|cellular response to growth factor stimulus (GO:0071363)|cellular response to hypoxia (GO:0071456)|digestive tract development (GO:0048565)|ductus arteriosus closure (GO:0097070)|hepatic stellate cell activation (GO:0035733)|lung alveolus development (GO:0048286)|negative regulation of beta-amyloid clearance (GO:1900222)|negative regulation of cardiac muscle cell apoptotic process (GO:0010667)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of myotube differentiation (GO:0010832)|negative regulation of skeletal muscle cell differentiation (GO:2001015)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of cardiac muscle cell differentiation (GO:2000727)|positive regulation of cardiac vascular smooth muscle cell differentiation (GO:2000724)|positive regulation of cell proliferation (GO:0008284)|positive regulation of DNA binding (GO:0043388)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of smooth muscle cell differentiation (GO:0051152)|positive regulation of smooth muscle contraction (GO:0045987)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase II promoter involved in myocardial precursor cell differentiation (GO:0003257)|positive regulation of transcription from RNA polymerase II promoter involved in smooth muscle cell differentiation (GO:2000721)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|regulation of cell growth by extracellular stimulus (GO:0001560)|regulation of histone acetylation (GO:0035065)|regulation of myoblast differentiation (GO:0045661)|regulation of smooth muscle cell differentiation (GO:0051150)|response to hypoxia (GO:0001666)|smooth muscle cell differentiation (GO:0051145)|urinary bladder development (GO:0060157)|uterus development (GO:0060065)|vasculogenesis (GO:0001570)|ventricular cardiac muscle cell differentiation (GO:0055012)	nucleus (GO:0005634)	core promoter sequence-specific DNA binding (GO:0001046)|protein domain specific binding (GO:0019904)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II transcription factor binding transcription factor activity (GO:0001076)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)			breast(2)|central_nervous_system(2)|endometrium(5)|kidney(2)|large_intestine(11)|liver(2)|lung(33)|ovary(1)|prostate(4)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	70				UCEC - Uterine corpus endometrioid carcinoma (92;0.0969)		TTCTGGACAAACTGGTGTCTC	0.413																																					p.T357A		.											.	MYOCD-93	0			c.A1069G						.						137.0	131.0	133.0					17																	12649333		2203	4300	6503	SO:0001583	missense	93649	exon9			GGACAAACTGGTG	AF532596	CCDS11163.1, CCDS54091.1	17p11.2	2004-03-01			ENSG00000141052	ENSG00000141052			16067	protein-coding gene	gene with protein product		606127				11439182, 12397177	Standard	XM_005256863		Approved	MYCD	uc002gno.2	Q8IZQ8	OTTHUMG00000058767	ENST00000343344.4:c.1069A>G	17.37:g.12649333A>G	ENSP00000341835:p.Thr357Ala	Somatic	75	0		WXS	Illumina GAIIx	Phase_I	98	94	NM_001146312	0	0	0	0	0	Q5UBU5|Q8N7Q1	Missense_Mutation	SNP	ENST00000343344.4	37	CCDS11163.1	.	.	.	.	.	.	.	.	.	.	A	13.92	2.381026	0.42207	.	.	ENSG00000141052	ENST00000395982;ENST00000425538;ENST00000343344;ENST00000395988;ENST00000443061	T;T	0.45276	0.91;0.9	5.71	5.71	0.89125	.	0.193389	0.56097	D	0.000034	T	0.23410	0.0566	N	0.17082	0.46	0.39750	D	0.971876	B;B;B;B	0.30870	0.298;0.292;0.162;0.101	B;B;B;B	0.27380	0.036;0.079;0.058;0.026	T	0.15464	-1.0436	10	0.41790	T	0.15	-9.3687	5.3408	0.15982	0.7626:0.0:0.0813:0.1561	.	76;261;357;357	E9PEP9;Q8IZQ8-2;Q8IZQ8-3;Q8IZQ8	.;.;.;MYCD_HUMAN	A	76;357;357;261;62	ENSP00000341835:T357A;ENSP00000400148:T62A	ENSP00000341835:T357A	T	+	1	0	MYOCD	12590058	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	3.805000	0.55575	2.184000	0.69523	0.459000	0.35465	ACT	.		0.413	MYOCD-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000129950.1	NM_153604	
TMEM97	27346	hgsc.bcm.edu;broad.mit.edu	37	17	26653807	26653807	+	Frame_Shift_Del	DEL	A	A	-			TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr17:26653807delA	ENST00000226230.6	+	3	664	c.519delA	c.(517-519)agafs	p.R173fs	TMEM97_ENST00000336687.6_Frame_Shift_Del_p.R66fs|TMEM97_ENST00000583381.1_Frame_Shift_Del_p.R66fs	NM_014573.2	NP_055388.2	Q5BJF2	TMM97_HUMAN	transmembrane protein 97	173					cholesterol homeostasis (GO:0042632)|regulation of cell growth (GO:0001558)	integral component of membrane (GO:0016021)|lysosome (GO:0005764)|nuclear membrane (GO:0031965)|plasma membrane (GO:0005886)|rough endoplasmic reticulum (GO:0005791)		p.K176fs?(1)		endometrium(1)|lung(3)|ovary(1)|upper_aerodigestive_tract(1)	6	all_lung(13;0.000238)|Lung NSC(42;0.000789)			UCEC - Uterine corpus endometrioid carcinoma (53;0.153)		AAGAGAAAAGAAAAAAAAAAT	0.438																																					p.R173fs		.											.	TMEM97-90	1	Deletion - Frameshift(1)	lung(1)	c.519delA						.			25,25,4214		0,0,25,0,25,2082	59.0	56.0	57.0			2.6	1.0	17		58	45,41,8168		0,0,45,0,41,4041	no	codingComplex	TMEM97	NM_014573.2		0,0,70,0,66,6123	A1A1,A1A2,A1R,A2A2,A2R,RR		1.0419,1.1726,1.0864			26653807	70,66,12382	2203	4300	6503	SO:0001589	frameshift_variant	27346	exon3			GAAAAGAAAAAAA	BC091504	CCDS11226.2	17q11.2	2014-01-28			ENSG00000109084	ENSG00000109084			28106	protein-coding gene	gene with protein product		612912				7694637, 15375745	Standard	NM_014573		Approved	MAC30	uc002hat.3	Q5BJF2	OTTHUMG00000132497	ENST00000226230.6:c.519delA	17.37:g.26653807delA	ENSP00000226230:p.Arg173fs	Somatic	19	0		WXS	Illumina GAIIx	Phase_I	30	23	NM_014573	0	0	0	0	0	B4DS02|Q07823	Frame_Shift_Del	DEL	ENST00000226230.6	37	CCDS11226.2																																																																																			.		0.438	TMEM97-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255675.2	NM_014573	
SLFN12	55106	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	33747391	33747391	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr17:33747391C>T	ENST00000394562.1	-	5	1572	c.1049G>A	c.(1048-1050)aGt>aAt	p.S350N	SLFN12_ENST00000452764.3_Missense_Mutation_p.S350N|SLFN12_ENST00000460530.1_5'UTR|SLFN12_ENST00000304905.5_Missense_Mutation_p.S350N			Q8IYM2	SLN12_HUMAN	schlafen family member 12	350							ATP binding (GO:0005524)			breast(1)|kidney(2)|large_intestine(3)|lung(8)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	18		Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.0182)		TTCATATGAACTGGAAAATTC	0.373																																					p.S350N		.											.	SLFN12-91	0			c.G1049A						.						87.0	84.0	85.0					17																	33747391		2203	4300	6503	SO:0001583	missense	55106	exon3			TATGAACTGGAAA	AK001122	CCDS11295.1	17q12	2006-04-05			ENSG00000172123	ENSG00000172123			25500	protein-coding gene	gene with protein product		614955				12477932	Standard	NM_018042		Approved	FLJ10260	uc002hji.4	Q8IYM2	OTTHUMG00000132952	ENST00000394562.1:c.1049G>A	17.37:g.33747391C>T	ENSP00000378063:p.Ser350Asn	Somatic	87	0		WXS	Illumina GAIIx	Phase_I	73	59	NM_018042	0	0	0	1	1	A8K711|Q9NP47	Missense_Mutation	SNP	ENST00000394562.1	37	CCDS11295.1	.	.	.	.	.	.	.	.	.	.	C	0.322	-0.961459	0.02249	.	.	ENSG00000172123	ENST00000394562;ENST00000304905;ENST00000452764	T;T;T	0.03801	3.8;3.8;3.8	1.67	-0.621	0.11564	.	.	.	.	.	T	0.02571	0.0078	N	0.19112	0.55	0.09310	N	1	B	0.12013	0.005	B	0.06405	0.002	T	0.48514	-0.9029	9	0.16896	T	0.51	.	2.7881	0.05379	0.0:0.4894:0.3054:0.2052	.	350	Q8IYM2	SLN12_HUMAN	N	350	ENSP00000378063:S350N;ENSP00000302077:S350N;ENSP00000394903:S350N	ENSP00000302077:S350N	S	-	2	0	SLFN12	30771504	0.001000	0.12720	0.017000	0.16124	0.004000	0.04260	0.565000	0.23578	-0.129000	0.11620	-0.324000	0.08512	AGT	.		0.373	SLFN12-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256491.1	NM_018042	
HEATR9	256957	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	34191866	34191866	+	Missense_Mutation	SNP	T	T	A			TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr17:34191866T>A	ENST00000311880.2	-	4	497	c.349A>T	c.(349-351)Atc>Ttc	p.I117F	C17orf66_ENST00000592980.1_Intron|C17orf66_ENST00000587585.1_5'UTR	NM_152781.2	NP_689994.2	A2RTY3	HEAT9_HUMAN		117					hematopoietic progenitor cell differentiation (GO:0002244)					breast(3)|central_nervous_system(1)|cervix(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(6)|lung(11)|skin(2)|stomach(4)	38		Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.0184)		AACATTTTGATGTGGGTTTGA	0.478																																					p.I117F		.											.	C17orf66-155	0			c.A349T						.						291.0	262.0	272.0					17																	34191866		2203	4300	6503	SO:0001583	missense	256957	exon4			TTTTGATGTGGGT																												ENST00000311880.2:c.349A>T	17.37:g.34191866T>A	ENSP00000309560:p.Ile117Phe	Somatic	233	0		WXS	Illumina GAIIx	Phase_I	241	215	NM_152781	0	0	0	0	0	B4DX21|B4DXA4|B4DXF0|Q8N4R4|Q96M46	Missense_Mutation	SNP	ENST00000311880.2	37	CCDS11299.1	.	.	.	.	.	.	.	.	.	.	T	11.98	1.800749	0.31869	.	.	ENSG00000172653	ENST00000311880	T	0.52295	0.67	4.69	-7.12	0.01537	.	1.806760	0.02716	N	0.113512	T	0.29093	0.0723	L	0.29908	0.895	0.09310	N	1	B;B	0.16396	0.017;0.01	B;B	0.12837	0.008;0.004	T	0.11941	-1.0567	10	0.56958	D	0.05	.	1.1016	0.01685	0.2228:0.1567:0.3564:0.2641	.	83;117	A2RTY3-4;A2RTY3	.;CQ066_HUMAN	F	117	ENSP00000309560:I117F	ENSP00000309560:I117F	I	-	1	0	C17orf66	31215979	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	-0.363000	0.07593	-1.541000	0.01727	-0.256000	0.11100	ATC	.		0.478	C17orf66-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256487.1		
KRTAP4-6	81871	broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	39296288	39296288	+	Missense_Mutation	SNP	C	C	T	rs555705282	byFrequency	TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr17:39296288C>T	ENST00000345847.4	-	1	451	c.452G>A	c.(451-453)cGc>cAc	p.R151H		NM_030976.1	NP_112238.1	Q9BYQ5	KRA46_HUMAN	keratin associated protein 4-6	151	30 X 5 AA repeats of C-C-[IRQVEL]-[SPTR]- [STVQRCP].					keratin filament (GO:0045095)				endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|lung(1)|prostate(1)|urinary_tract(1)	9						gcaagaggggcggcagcagct	0.667													C|||	8	0.00159744	0.0053	0.0	5008	,	,		25217	0.0		0.001	False		,,,				2504	0.0				p.R151H		.											.	.	0			c.G452A						.																																			SO:0001583	missense	81871	exon1			GAGGGGCGGCAGC	AJ406938	CCDS54125.1	17q21.2	2013-06-25			ENSG00000198090	ENSG00000198090		"""Keratin associated proteins"""	18909	protein-coding gene	gene with protein product			"""keratin associated protein 4-15"""	KRTAP4-15			Standard	NM_030976		Approved	KAP4.6, KAP4.15	uc010cxk.2	Q9BYQ5	OTTHUMG00000133634	ENST00000345847.4:c.452G>A	17.37:g.39296288C>T	ENSP00000328270:p.Arg151His	Somatic	69	2		WXS	Illumina GAIIx	Phase_I	197	81	NM_030976	0	0	0	0	0	Q9BYR1	Missense_Mutation	SNP	ENST00000345847.4	37	CCDS54125.1	.	.	.	.	.	.	.	.	.	.	.	13.54	2.266687	0.40095	.	.	ENSG00000198090	ENST00000345847	T	0.01548	4.78	4.72	-1.31	0.09230	.	.	.	.	.	T	0.03053	0.0090	L	0.47016	1.485	0.09310	N	1	.	.	.	.	.	.	T	0.40794	-0.9544	7	0.72032	D	0.01	.	8.8235	0.35041	0.0:0.5384:0.0:0.4616	.	.	.	.	H	151	ENSP00000328270:R151H	ENSP00000328270:R151H	R	-	2	0	KRTAP4-6	36549814	0.000000	0.05858	0.000000	0.03702	0.017000	0.09413	-2.235000	0.01202	-0.218000	0.10018	-0.220000	0.12472	CGC	.		0.667	KRTAP4-6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257779.1		
KRTAP16-1	100505753	hgsc.bcm.edu;bcgsc.ca;mdanderson.org	37	17	39463994	39463994	+	Silent	SNP	G	G	A			TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr17:39463994G>A	ENST00000391352.1	-	1	1511	c.1512C>T	c.(1510-1512)gcC>gcT	p.A504A		NM_001146182.1	NP_001139654.1	A8MUX0	KR161_HUMAN	keratin associated protein 16-1	504	Poly-Ala.					keratin filament (GO:0045095)				haematopoietic_and_lymphoid_tissue(1)	1						GAGCTGCTGCGGCCTCACGGG	0.572																																					p.A504A		.											.	.	0			c.C1512T						.																																			SO:0001819	synonymous_variant	100505753	exon1			TGCTGCGGCCTCA	AP001708	CCDS56032.1	17q21.2	2012-07-04			ENSG00000212657	ENSG00000212657		"""Keratin associated proteins"""	18916	protein-coding gene	gene with protein product							Standard	NM_001146182		Approved	KAP16.1	uc021txi.1	A8MUX0	OTTHUMG00000133640	ENST00000391352.1:c.1512C>T	17.37:g.39463994G>A		Somatic	33	0		WXS	Illumina GAIIx	Phase_I	34	29	NM_001146182	0	0	0	0	0		Silent	SNP	ENST00000391352.1	37	CCDS56032.1																																																																																			.		0.572	KRTAP16-1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257785.1	NM_001146182	
MPP3	4356	broad.mit.edu;bcgsc.ca;mdanderson.org	37	17	41879215	41879215	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr17:41879215C>T	ENST00000398389.4	-	20	1777	c.1612G>A	c.(1612-1614)Gcc>Acc	p.A538T	MPP3_ENST00000398393.1_Missense_Mutation_p.A563T	NM_001932.4	NP_001923.2	Q13368	MPP3_HUMAN	membrane protein, palmitoylated 3 (MAGUK p55 subfamily member 3)	538	Guanylate kinase-like. {ECO:0000255|PROSITE-ProRule:PRU00100}.				nucleotide phosphorylation (GO:0046939)|signal transduction (GO:0007165)	integral component of plasma membrane (GO:0005887)	guanylate kinase activity (GO:0004385)			endometrium(2)|kidney(2)|large_intestine(5)|lung(11)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)	26		Breast(137;0.00394)		BRCA - Breast invasive adenocarcinoma(366;0.119)		ATGAAGGCGGCAGAAGCGGCC	0.527																																					p.A538T		.											.	MPP3-91	0			c.G1612A						.						75.0	72.0	73.0					17																	41879215		1935	4146	6081	SO:0001583	missense	4356	exon20			AGGCGGCAGAAGC		CCDS42344.1	17q12-q21	2008-07-18			ENSG00000161647	ENSG00000161647			7221	protein-coding gene	gene with protein product	"""MAGUK p55 subfamily member 3"", ""discs, large (Drosophila) homolog 3"", ""membrane protein palmitoylated 3"""	601114		DLG3		8824795	Standard	NR_003562		Approved		uc002iei.4	Q13368	OTTHUMG00000133838	ENST00000398389.4:c.1612G>A	17.37:g.41879215C>T	ENSP00000381425:p.Ala538Thr	Somatic	46	1		WXS	Illumina GAIIx	Phase_I	50	44	NM_001932	0	0	0	0	0	B2R7N0|D3DX47|Q4GX05|Q6PGR3|Q86SV1	Missense_Mutation	SNP	ENST00000398389.4	37	CCDS42344.1	.	.	.	.	.	.	.	.	.	.	C	24.9	4.578192	0.86645	.	.	ENSG00000161647	ENST00000398393;ENST00000398389	T;T	0.44482	0.92;0.92	5.42	5.42	0.78866	Guanylate kinase/L-type calcium channel (1);Guanylate kinase (2);	0.000000	0.85682	D	0.000000	T	0.65954	0.2741	M	0.77820	2.39	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.78314	0.991;0.991	T	0.68096	-0.5499	10	0.66056	D	0.02	.	16.2504	0.82481	0.0:1.0:0.0:0.0	.	538;563	Q13368;D3DX46	MPP3_HUMAN;.	T	563;538	ENSP00000381430:A563T;ENSP00000381425:A538T	ENSP00000381425:A538T	A	-	1	0	MPP3	39234741	1.000000	0.71417	0.995000	0.50966	0.328000	0.28507	6.708000	0.74660	2.826000	0.97356	0.563000	0.77884	GCC	.		0.527	MPP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000258371.1	NM_001932	
MAP3K14-AS1	100133991	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	43347830	43347830	+	RNA	SNP	C	C	T			TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr17:43347830C>T	ENST00000585780.1	+	0	4950				MAP3K14_ENST00000344686.2_RNA|MAP3K14-AS1_ENST00000590100.1_RNA|MAP3K14-AS1_ENST00000592422.1_RNA|MAP3K14-AS1_ENST00000591263.1_RNA|MAP3K14-AS1_ENST00000585351.1_RNA|MAP3K14-AS1_ENST00000588160.1_RNA|MAP3K14-AS1_ENST00000588504.1_RNA|MAP3K14-AS1_ENST00000588698.1_RNA|MAP3K14-AS1_ENST00000585346.1_RNA|MAP3K14-AS1_ENST00000586450.1_RNA					MAP3K14 antisense RNA 1																		TGCAGACACGCGGTGGATGGG	0.662																																					.		.											.	MAP3K14-1453	0			.						.						38.0	43.0	41.0					17																	43347830		2003	4154	6157			9020	.			GACACGCGGTGGA	AK311429, BC031942		17q21.31	2014-06-16			ENSG00000267278	ENSG00000267278		"""Long non-coding RNAs"""	44359	non-coding RNA	RNA, long non-coding							Standard	NR_024435		Approved		uc002iit.4		OTTHUMG00000180362		17.37:g.43347830C>T		Somatic	66	0		WXS	Illumina GAIIx	Phase_I	143	70	.	0	0	0	7	7		RNA	SNP	ENST00000585780.1	37		.	.	.	.	.	.	.	.	.	.	C	34	5.310799	0.95629	.	.	ENSG00000006062	ENST00000344686	.	.	.	5.53	5.53	0.82687	Serine/threonine-protein kinase-like domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	D	0.90280	0.6960	H	0.97214	3.96	0.44417	D	0.997332	D;D	0.89917	1.0;1.0	D;D	0.97110	0.999;1.0	D	0.93472	0.6820	8	0.87932	D	0	.	18.4439	0.90677	0.0:1.0:0.0:0.0	.	641;171	Q99558;Q6ZMZ1	M3K14_HUMAN;.	H	640	.	ENSP00000342059:R640H	R	-	2	0	MAP3K14	40703613	0.994000	0.37717	0.884000	0.34674	0.010000	0.07245	7.453000	0.80700	2.587000	0.87381	0.561000	0.74099	CGC	.		0.662	MAP3K14-AS1-008	KNOWN	basic	antisense	antisense	OTTHUMT00000450941.1	NR_024434	
HOXB13	10481	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	17	46805884	46805884	+	Frame_Shift_Del	DEL	C	C	-			TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr17:46805884delC	ENST00000290295.7	-	1	656	c.72delG	c.(70-72)gggfs	p.G24fs		NM_006361.5	NP_006352.2	Q92826	HXB13_HUMAN	homeobox B13	24					angiogenesis (GO:0001525)|epidermis development (GO:0008544)|epithelial cell maturation involved in prostate gland development (GO:0060743)|prostate epithelial cord arborization involved in prostate glandular acinus morphogenesis (GO:0060527)|regulation of growth (GO:0040008)|regulation of transcription, DNA-templated (GO:0006355)|response to testosterone (GO:0033574)|response to wounding (GO:0009611)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	sequence-specific DNA binding (GO:0043565)	p.G24G(1)		endometrium(2)|kidney(2)|lung(6)|prostate(1)	11						CCAGATTCCGCCCCCCTCCCG	0.657																																					p.G24fs		.											.	HOXB13-514	1	Substitution - coding silent(1)	kidney(1)	c.72delG						.						20.0	23.0	22.0					17																	46805884		2203	4296	6499	SO:0001589	frameshift_variant	10481	exon1			ATTCCGCCCCCCT	U57052	CCDS11536.1	17q21.32	2014-09-17	2005-12-22		ENSG00000159184	ENSG00000159184		"""Homeoboxes / ANTP class : HOXL subclass"""	5112	protein-coding gene	gene with protein product		604607	"""homeo box B13"""			8756292, 9665387	Standard	NM_006361		Approved		uc002ioa.3	Q92826	OTTHUMG00000159900	ENST00000290295.7:c.72delG	17.37:g.46805884delC	ENSP00000290295:p.Gly24fs	Somatic	122	0		WXS	Illumina GAIIx	Phase_I	133	111	NM_006361	0	0	0	0	0	B2R878|Q96QM4|Q99810	Frame_Shift_Del	DEL	ENST00000290295.7	37	CCDS11536.1																																																																																			.		0.657	HOXB13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000358087.3	NM_006361	
NGFR	4804	hgsc.bcm.edu	37	17	47583762	47583762	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr17:47583762G>A	ENST00000172229.3	+	3	435	c.310G>A	c.(310-312)Gac>Aac	p.D104N	NGFR_ENST00000504201.1_Missense_Mutation_p.D10N|RP5-1029K10.2_ENST00000514506.1_RNA	NM_002507.3	NP_002498.1	P08138	TNR16_HUMAN	nerve growth factor receptor	104					apoptotic signaling pathway (GO:0097190)|axon guidance (GO:0007411)|central nervous system development (GO:0007417)|circadian regulation of gene expression (GO:0032922)|detection of temperature stimulus (GO:0016048)|glucose homeostasis (GO:0042593)|hair follicle morphogenesis (GO:0031069)|intracellular protein transport (GO:0006886)|membrane protein intracellular domain proteolysis (GO:0031293)|negative regulation of apoptotic process (GO:0043066)|negative regulation of axonogenesis (GO:0050771)|negative regulation of cell cycle (GO:0045786)|negative regulation of fibroblast growth factor receptor signaling pathway (GO:0040037)|negative regulation of hair follicle development (GO:0051799)|nerve development (GO:0021675)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of axonogenesis (GO:0050772)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of odontogenesis of dentin-containing tooth (GO:0042488)|regulation of axonogenesis (GO:0050770)|regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043281)|regulation of glucose import in response to insulin stimulus (GO:2001273)	cell surface (GO:0009986)|cytosol (GO:0005829)|endosome (GO:0005768)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|neuronal postsynaptic density (GO:0097481)|nucleoplasm (GO:0005654)|plasma membrane (GO:0005886)	death receptor activity (GO:0005035)|Rab GTPase binding (GO:0017137)|receptor activity (GO:0004872)|signal transducer activity (GO:0004871)|transmembrane signaling receptor activity (GO:0004888)|ubiquitin protein ligase binding (GO:0031625)			central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(4)|liver(1)|lung(7)|ovary(1)	17	all_cancers(4;1.45e-13)|Breast(4;6.34e-28)|all_epithelial(4;4.95e-17)					GGAGGCCGACGACGCCGTGTG	0.711																																					p.D104N		.											.	NGFR-947	0			c.G310A						.						16.0	17.0	17.0					17																	47583762		2187	4249	6436	SO:0001583	missense	4804	exon3			GCCGACGACGCCG	M14764	CCDS11549.1	17q21-q22	2013-05-22	2010-04-28		ENSG00000064300	ENSG00000064300		"""Tumor necrosis factor receptor superfamily"", ""CD molecules"""	7809	protein-coding gene	gene with protein product	"""low affinity nerve growth factor receptor"", ""TNFR superfamily, member 16"""	162010	"""nerve growth factor receptor (TNFR superfamily, member 16)"""			3022937, 3006050	Standard	NM_002507		Approved	TNFRSF16, CD271, p75NTR	uc002ioz.4	P08138	OTTHUMG00000161495	ENST00000172229.3:c.310G>A	17.37:g.47583762G>A	ENSP00000172229:p.Asp104Asn	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	13	11	NM_002507	0	0	0	0	0	B2R961|B4E096	Missense_Mutation	SNP	ENST00000172229.3	37	CCDS11549.1	.	.	.	.	.	.	.	.	.	.	G	36	5.650863	0.96714	.	.	ENSG00000064300	ENST00000172229;ENST00000504201	D;D	0.91631	-2.72;-2.88	5.55	5.55	0.83447	TNFR/CD27/30/40/95 cysteine-rich region (4);	0.042276	0.85682	D	0.000000	D	0.93556	0.7943	M	0.75264	2.295	0.52501	D	0.999953	D	0.67145	0.996	P	0.54431	0.752	D	0.91747	0.5409	10	0.25106	T	0.35	-36.33	13.426	0.61026	0.0763:0.0:0.9237:0.0	.	104	P08138	TNR16_HUMAN	N	104;10	ENSP00000172229:D104N;ENSP00000421731:D10N	ENSP00000172229:D104N	D	+	1	0	NGFR	44938761	1.000000	0.71417	0.999000	0.59377	0.939000	0.58152	7.684000	0.84104	2.590000	0.87494	0.561000	0.74099	GAC	.		0.711	NGFR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365150.1		
PCTP	58488	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	53851112	53851112	+	Missense_Mutation	SNP	C	C	G			TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr17:53851112C>G	ENST00000268896.5	+	4	492	c.367C>G	c.(367-369)Ctg>Gtg	p.L123V	PCTP_ENST00000576183.1_Missense_Mutation_p.L123V|PCTP_ENST00000325214.6_Missense_Mutation_p.L51V|PCTP_ENST00000573500.1_Missense_Mutation_p.L123V|PCTP_ENST00000576221.1_3'UTR	NM_021213.3	NP_067036.2	Q9UKL6	PPCT_HUMAN	phosphatidylcholine transfer protein	123	START. {ECO:0000255|PROSITE- ProRule:PRU00197}.				cholesterol metabolic process (GO:0008203)|lipid transport (GO:0006869)|phospholipid transport (GO:0015914)	cytosol (GO:0005829)	phosphatidylcholine binding (GO:0031210)|phosphatidylcholine transporter activity (GO:0008525)			endometrium(1)|kidney(1)|large_intestine(2)|lung(5)|skin(1)	10			BRCA - Breast invasive adenocarcinoma(1;0.00207)			GCGGCGAGACCTGGACATGGA	0.562																																					p.L123V		.											.	PCTP-91	0			c.C367G						.						87.0	59.0	68.0					17																	53851112		2203	4300	6503	SO:0001583	missense	58488	exon4			CGAGACCTGGACA	AK024667	CCDS11588.1, CCDS45741.1	17q21-q24	2011-09-13				ENSG00000141179		"""StAR-related lipid transfer (START) domain containing"""	8752	protein-coding gene	gene with protein product	"""StAR-related lipid transfer (START) domain containing 2"""	606055					Standard	NM_021213		Approved	STARD2	uc002iul.4	Q9UKL6		ENST00000268896.5:c.367C>G	17.37:g.53851112C>G	ENSP00000268896:p.Leu123Val	Somatic	137	0		WXS	Illumina GAIIx	Phase_I	158	143	NM_021213	0	0	0	4	4	Q9BSC9|Q9UIT3|Q9UKW7	Missense_Mutation	SNP	ENST00000268896.5	37	CCDS11588.1	.	.	.	.	.	.	.	.	.	.	C	15.00	2.701925	0.48307	.	.	ENSG00000141179	ENST00000268896;ENST00000417982;ENST00000325214	T	0.49139	0.79	5.93	2.72	0.32119	Lipid-binding START (3);START-like domain (1);	0.184307	0.38058	N	0.001832	T	0.30916	0.0780	L	0.35414	1.06	0.47308	D	0.999381	B	0.21452	0.056	B	0.24269	0.052	T	0.05053	-1.0909	10	0.15499	T	0.54	-0.0172	6.8663	0.24094	0.3094:0.6096:0.0:0.0809	.	123	Q9UKL6	PPCT_HUMAN	V	123;51;102	ENSP00000268896:L123V	ENSP00000268896:L123V	L	+	1	2	PCTP	51206111	0.572000	0.26668	0.719000	0.30619	0.230000	0.25150	1.095000	0.30964	0.829000	0.34733	0.655000	0.94253	CTG	.		0.562	PCTP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000439271.2	NM_021213	
ANKFN1	162282	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	17	54543810	54543810	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr17:54543810G>A	ENST00000318698.2	+	14	1695	c.1660G>A	c.(1660-1662)Gag>Aag	p.E554K	ANKFN1_ENST00000566473.2_Missense_Mutation_p.E554K	NM_153228.2	NP_694960.2	Q8N957	ANKF1_HUMAN	ankyrin-repeat and fibronectin type III domain containing 1	554										NS(1)|breast(1)|cervix(2)|endometrium(4)|kidney(4)|large_intestine(11)|lung(27)|ovary(1)|prostate(1)|skin(1)	53						CAGGGAGGTGGAGATGCTTTA	0.413																																					p.E554K		.											.	ANKFN1-136	0			c.G1660A						.						124.0	110.0	115.0					17																	54543810		2203	4300	6503	SO:0001583	missense	162282	exon14			GAGGTGGAGATGC	AK095654	CCDS32686.1	17q23.2	2014-02-12	2005-11-15		ENSG00000153930	ENSG00000153930		"""Ankyrin repeat domain containing"", ""Fibronectin type III domain containing"""	26766	protein-coding gene	gene with protein product							Standard	NM_153228		Approved	FLJ38335	uc002iun.1	Q8N957	OTTHUMG00000155010	ENST00000318698.2:c.1660G>A	17.37:g.54543810G>A	ENSP00000321627:p.Glu554Lys	Somatic	168	0		WXS	Illumina GAIIx	Phase_I	191	10	NM_153228	0	0	0	0	0		Missense_Mutation	SNP	ENST00000318698.2	37	CCDS32686.1	.	.	.	.	.	.	.	.	.	.	G	12.05	1.820286	0.32145	.	.	ENSG00000153930	ENST00000318698	T	0.21031	2.03	5.69	5.69	0.88448	.	0.093215	0.64402	D	0.000001	T	0.16428	0.0395	L	0.29908	0.895	0.80722	D	1	B	0.14438	0.01	B	0.10450	0.005	T	0.08827	-1.0703	10	0.02654	T	1	-12.5869	19.8199	0.96589	0.0:0.0:1.0:0.0	.	554	Q8N957	ANKF1_HUMAN	K	554	ENSP00000321627:E554K	ENSP00000321627:E554K	E	+	1	0	ANKFN1	51898809	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	9.476000	0.97823	2.677000	0.91161	0.655000	0.94253	GAG	.		0.413	ANKFN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000338043.1	NM_153228	
PRKCA	5578	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	17	64731690	64731690	+	Silent	SNP	C	C	T	rs541892161		TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr17:64731690C>T	ENST00000413366.3	+	10	1166	c.1140C>T	c.(1138-1140)gaC>gaT	p.D380D		NM_002737.2	NP_002728	P17252	KPCA_HUMAN	protein kinase C, alpha	380	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of adenylate cyclase activity (GO:0007190)|activation of phospholipase C activity (GO:0007202)|angiogenesis (GO:0001525)|apoptotic signaling pathway (GO:0097190)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cellular calcium ion homeostasis (GO:0006874)|cellular response to carbohydrate stimulus (GO:0071322)|chondrocyte differentiation (GO:0002062)|desmosome assembly (GO:0002159)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|extracellular matrix organization (GO:0030198)|fibroblast growth factor receptor signaling pathway (GO:0008543)|gene expression (GO:0010467)|histone H3-T6 phosphorylation (GO:0035408)|inactivation of MAPK activity (GO:0000188)|induction of positive chemotaxis (GO:0050930)|innate immune response (GO:0045087)|intrinsic apoptotic signaling pathway (GO:0097193)|mRNA metabolic process (GO:0016071)|negative regulation of adenylate cyclase activity (GO:0007194)|negative regulation of cell proliferation (GO:0008285)|negative regulation of glial cell apoptotic process (GO:0034351)|negative regulation of glucose import (GO:0046325)|negative regulation of insulin receptor signaling pathway (GO:0046627)|neurotrophin TRK receptor signaling pathway (GO:0048011)|neutrophil chemotaxis (GO:0030593)|peptidyl-serine autophosphorylation (GO:0036289)|phototransduction, visible light (GO:0007603)|platelet activation (GO:0030168)|positive regulation of angiogenesis (GO:0045766)|positive regulation of blood vessel endothelial cell migration (GO:0043536)|positive regulation of cardiac muscle hypertrophy (GO:0010613)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell migration (GO:0030335)|positive regulation of dense core granule biogenesis (GO:2000707)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of inflammatory response (GO:0050729)|positive regulation of lipopolysaccharide-mediated signaling pathway (GO:0031666)|positive regulation of macrophage differentiation (GO:0045651)|positive regulation of mitotic cell cycle (GO:0045931)|positive regulation of protein phosphorylation (GO:0001934)|protein phosphorylation (GO:0006468)|regulation of insulin secretion (GO:0050796)|regulation of muscle contraction (GO:0006937)|regulation of peptidyl-tyrosine phosphorylation (GO:0050730)|regulation of platelet aggregation (GO:0090330)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|regulation of the force of heart contraction (GO:0002026)|response to interleukin-1 (GO:0070555)|rhodopsin mediated signaling pathway (GO:0016056)|RNA metabolic process (GO:0016070)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)	apical part of cell (GO:0045177)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|neuronal cell body (GO:0043025)|nucleoplasm (GO:0005654)|perinuclear region of cytoplasm (GO:0048471)|photoreceptor outer segment (GO:0001750)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium-dependent protein kinase C activity (GO:0004698)|enzyme binding (GO:0019899)|histone kinase activity (H3-T6 specific) (GO:0035403)|protein kinase activity (GO:0004672)|protein kinase C activity (GO:0004697)|zinc ion binding (GO:0008270)			breast(3)|central_nervous_system(4)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(6)|lung(17)|ovary(1)|pancreas(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	38			BRCA - Breast invasive adenocarcinoma(6;4.68e-09)		Ingenol Mebutate(DB05013)|Phosphatidylserine(DB00144)|Tamoxifen(DB00675)|Vitamin E(DB00163)	AGGATGATGACGTGGAGTGCA	0.517													C|||	1	0.000199681	0.0	0.0	5008	,	,		21641	0.0		0.0	False		,,,				2504	0.001				p.D380D		.											.	PRKCA-1404	0			c.C1140T						.						238.0	193.0	208.0					17																	64731690		2203	4300	6503	SO:0001819	synonymous_variant	5578	exon10			TGATGACGTGGAG		CCDS11664.1	17q22-q24	2009-07-10				ENSG00000154229	2.7.11.1		9393	protein-coding gene	gene with protein product		176960		PKCA			Standard	NM_002737		Approved		uc002jfp.1	P17252		ENST00000413366.3:c.1140C>T	17.37:g.64731690C>T		Somatic	276	2		WXS	Illumina GAIIx	Phase_I	249	228	NM_002737	0	0	0	4	4	B5BU22|Q15137|Q32M72|Q96RE4	Silent	SNP	ENST00000413366.3	37	CCDS11664.1																																																																																			.		0.517	PRKCA-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000446976.1		
DNAH17	8632	bcgsc.ca	37	17	76497920	76497920	+	Missense_Mutation	SNP	C	C	A	rs690844	byFrequency	TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr17:76497920C>A	ENST00000585328.1	-	34	5341	c.5217G>T	c.(5215-5217)atG>atT	p.M1739I	DNAH17-AS1_ENST00000598378.1_3'UTR|DNAH17_ENST00000389840.5_Missense_Mutation_p.M1731I|RP11-559N14.5_ENST00000591373.1_RNA	NM_173628.3	NP_775899.3	Q9UFH2	DYH17_HUMAN	dynein, axonemal, heavy chain 17	1731	Stem. {ECO:0000250}.				cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(2)|breast(7)|central_nervous_system(5)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(13)|large_intestine(8)|lung(37)|ovary(8)|prostate(7)|skin(4)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(3)	116			BRCA - Breast invasive adenocarcinoma(99;0.00294)|OV - Ovarian serous cystadenocarcinoma(97;0.0656)			TGAGGTTCCCCATGAGCAGCG	0.587													A|||	3700	0.738818	0.6823	0.7608	5008	,	,		21036	0.9435		0.6213	False		,,,				2504	0.7096				p.M1742I		.											.	DNAH17-142	0			c.G5226T						.	A	ILE/MET	3042,1334		1083,876,229	145.0	151.0	149.0		5226	-2.5	0.9	17	dbSNP_83	149	5283,3289		1662,1959,665	yes	missense	DNAH17	NM_173628.3	10	2745,2835,894	AA,AC,CC		38.3691,30.4845,35.7044		1742/4463	76497920	8325,4623	2188	4286	6474	SO:0001583	missense	8632	exon34			GTTCCCCATGAGC	AJ000522		17q25.3	2012-04-19	2006-09-04		ENSG00000187775	ENSG00000187775		"""Axonemal dyneins"""	2946	protein-coding gene	gene with protein product		610063	"""dynein, axonemal, heavy polypeptide 17"", ""dynein, axonemal, heavy chain like 1"", ""dynein, axonemal, heavy like 1"""	DNAHL1		9545504	Standard	NM_173628		Approved	DNEL2, FLJ40457	uc010dhp.2	Q9UFH2		ENST00000585328.1:c.5217G>T	17.37:g.76497920C>A	ENSP00000465516:p.Met1739Ile	Somatic	122	1		WXS	Illumina GAIIx	Phase_I	120	5	NM_173628	0	0	0	0	0	O00431|O15206|Q2M2Y1|Q6ZRQ2|Q8N7Q7	Missense_Mutation	SNP	ENST00000585328.1	37		1608	0.7362637362637363	333	0.676829268292683	256	0.7071823204419889	539	0.9423076923076923	480	0.633245382585752	A	4.531	0.098492	0.08681	0.695155	0.616309	ENSG00000187775	ENST00000300671;ENST00000389840	T	0.22336	1.96	4.65	-2.49	0.06403	.	.	.	.	.	T	0.00012	0.0000	.	.	.	0.41536	P	0.011517	.	.	.	.	.	.	T	0.21415	-1.0246	5	0.13853	T	0.58	.	6.3629	0.21439	0.4839:0.2284:0.2877:0.0	rs690844;rs690844	.	.	.	I	1739;1731	ENSP00000374490:M1731I	ENSP00000300671:M1739I	M	-	3	0	DNAH17	74009515	0.001000	0.12720	0.940000	0.37924	0.410000	0.31052	-1.454000	0.02381	-0.505000	0.06568	-2.049000	0.00408	ATG	C|0.273;A|0.727		0.587	DNAH17-001	PUTATIVE	not_organism_supported|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000318962.2	NM_173628	
RPTOR	57521	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	78933974	78933974	+	Missense_Mutation	SNP	G	G	A	rs375708825		TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr17:78933974G>A	ENST00000306801.3	+	30	3936	c.3574G>A	c.(3574-3576)Gtc>Atc	p.V1192I	RPTOR_ENST00000544334.2_Missense_Mutation_p.V1034I|CTD-2561B21.3_ENST00000571591.1_RNA|RPTOR_ENST00000575542.1_3'UTR	NM_020761.2	NP_065812.1	Q8N122	RPTOR_HUMAN	regulatory associated protein of MTOR, complex 1	1192					cell cycle arrest (GO:0007050)|cell growth (GO:0016049)|cellular response to amino acid stimulus (GO:0071230)|cellular response to nutrient levels (GO:0031669)|insulin receptor signaling pathway (GO:0008286)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of protein serine/threonine kinase activity (GO:0071902)|positive regulation of TOR signaling (GO:0032008)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|regulation of cell size (GO:0008361)|TOR signaling (GO:0031929)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|TORC1 complex (GO:0031931)	14-3-3 protein binding (GO:0071889)|protein complex binding (GO:0032403)|protein kinase binding (GO:0019901)|RNA polymerase III type 1 promoter DNA binding (GO:0001030)|RNA polymerase III type 2 promoter DNA binding (GO:0001031)|RNA polymerase III type 3 promoter DNA binding (GO:0001032)|TFIIIC-class transcription factor binding (GO:0001156)			breast(1)|endometrium(4)|kidney(1)|large_intestine(12)|lung(17)|ovary(3)|prostate(1)|skin(1)|stomach(1)|urinary_tract(3)	44						CTCCATCCGCGTCTACGACAG	0.617																																					p.V1192I		.											.	RPTOR-847	0			c.G3574A						.						116.0	81.0	93.0					17																	78933974		2203	4300	6503	SO:0001583	missense	57521	exon30			ATCCGCGTCTACG		CCDS11773.1, CCDS54175.1	17q25.3	2013-01-10				ENSG00000141564		"""WD repeat domain containing"""	30287	protein-coding gene	gene with protein product	"""regulatory associated protein of mTOR"""	607130				10718198, 12150926	Standard	NM_001163034		Approved	KOG1, Mip1, KIAA1303, raptor	uc002jyt.1	Q8N122		ENST00000306801.3:c.3574G>A	17.37:g.78933974G>A	ENSP00000307272:p.Val1192Ile	Somatic	203	0		WXS	Illumina GAIIx	Phase_I	211	44	NM_020761	0	0	9	13	4	B2RN36|C6KEF2|F5H7J5|Q8N4V9|Q8TB32|Q9P2P3	Missense_Mutation	SNP	ENST00000306801.3	37	CCDS11773.1	.	.	.	.	.	.	.	.	.	.	G	33	5.271602	0.95429	.	.	ENSG00000141564	ENST00000306801;ENST00000544334	T;T	0.28454	1.61;1.61	5.18	5.18	0.71444	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.47377	0.1442	L	0.47716	1.5	0.80722	D	1	D;P	0.57899	0.981;0.931	D;P	0.65010	0.931;0.483	T	0.18777	-1.0326	10	0.23891	T	0.37	.	18.6796	0.91541	0.0:0.0:1.0:0.0	.	1034;1192	F5H7J5;Q8N122	.;RPTOR_HUMAN	I	1192;1034	ENSP00000307272:V1192I;ENSP00000442479:V1034I	ENSP00000307272:V1192I	V	+	1	0	RPTOR	76548569	1.000000	0.71417	0.956000	0.39512	0.892000	0.51952	7.388000	0.79795	2.418000	0.82041	0.462000	0.41574	GTC	.		0.617	RPTOR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000438125.1	NM_020761	
RAB40B	10966	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	80616520	80616520	+	Missense_Mutation	SNP	T	T	C			TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr17:80616520T>C	ENST00000571995.1	-	5	543	c.412A>G	c.(412-414)Acg>Gcg	p.T138A	RAB40B_ENST00000269347.6_5'UTR|RAB40B_ENST00000571880.1_5'Flank|RAB40B_ENST00000538809.2_Intron	NM_006822.2	NP_006813.1	Q12829	RB40B_HUMAN	RAB40B, member RAS oncogene family	138					protein transport (GO:0015031)|protein ubiquitination (GO:0016567)|small GTPase mediated signal transduction (GO:0007264)	plasma membrane (GO:0005886)	GTP binding (GO:0005525)			central_nervous_system(1)|kidney(1)|large_intestine(1)|lung(4)|ovary(1)|urinary_tract(2)	10	Breast(20;0.00132)|all_neural(118;0.0952)	all_cancers(8;0.072)|all_epithelial(8;0.139)	BRCA - Breast invasive adenocarcinoma(99;0.0262)|OV - Ovarian serous cystadenocarcinoma(97;0.061)			GCCTGCTCCGTGGGCACCTGC	0.647																																					p.T138A		.											.	RAB40B-227	0			c.A412G						.						28.0	31.0	30.0					17																	80616520		2203	4299	6502	SO:0001583	missense	10966	exon5			GCTCCGTGGGCAC	U05227	CCDS11816.1	17q25.3	2014-08-12			ENSG00000141542	ENSG00000141542		"""RAB, member RAS oncogene"""	18284	protein-coding gene	gene with protein product						11697911	Standard	NM_006822		Approved	SEC4L, RAR	uc002kft.3	Q12829	OTTHUMG00000177806	ENST00000571995.1:c.412A>G	17.37:g.80616520T>C	ENSP00000461785:p.Thr138Ala	Somatic	63	1		WXS	Illumina GAIIx	Phase_I	80	56	NM_006822	0	0	0	6	6	Q8WVG3	Missense_Mutation	SNP	ENST00000571995.1	37	CCDS11816.1	.	.	.	.	.	.	.	.	.	.	T	17.02	3.282559	0.59867	.	.	ENSG00000141542	ENST00000269347;ENST00000538809	.	.	.	3.84	3.84	0.44239	Small GTP-binding protein domain (1);	0.000000	0.64402	D	0.000005	T	0.44286	0.1286	L	0.37850	1.14	0.80722	D	1	B	0.09022	0.002	B	0.15870	0.014	T	0.30446	-0.9978	9	0.12103	T	0.63	.	12.9779	0.58547	0.0:0.0:0.0:1.0	.	138	Q12829	RB40B_HUMAN	A	138;172	.	ENSP00000269347:T138A	T	-	1	0	RAB40B	78209809	1.000000	0.71417	0.997000	0.53966	0.885000	0.51271	7.788000	0.85771	1.692000	0.51112	0.482000	0.46254	ACG	.		0.647	RAB40B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000439007.1		
MPPE1	65258	broad.mit.edu	37	18	11889445	11889445	+	Missense_Mutation	SNP	G	G	T			TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr18:11889445G>T	ENST00000588072.1	-	5	1656	c.435C>A	c.(433-435)caC>caA	p.H145Q	MPPE1_ENST00000317235.7_Missense_Mutation_p.H145Q|MPPE1_ENST00000344987.7_Missense_Mutation_p.H145Q|MPPE1_ENST00000309976.9_Missense_Mutation_p.H145Q|MPPE1_ENST00000399978.2_Missense_Mutation_p.H145Q	NM_023075.5	NP_075563.3	Q53F39	MPPE1_HUMAN	metallophosphoesterase 1	145					ER to Golgi vesicle-mediated transport (GO:0006888)|GPI anchor biosynthetic process (GO:0006506)	cis-Golgi network (GO:0005801)|endoplasmic reticulum exit site (GO:0070971)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	GPI anchor binding (GO:0034235)|manganese ion binding (GO:0030145)|phosphoric diester hydrolase activity (GO:0008081)			endometrium(1)|large_intestine(1)|lung(1)|ovary(1)|skin(1)	5						CATGACTTGGGTGTCTGAACA	0.493																																					p.H145Q		.											.	MPPE1-90	0			c.C435A						.						126.0	107.0	113.0					18																	11889445		2203	4300	6503	SO:0001583	missense	65258	exon4			ACTTGGGTGTCTG	BC002877	CCDS11853.1, CCDS56054.1	18p11.21	2004-04-30			ENSG00000154889	ENSG00000154889			15988	protein-coding gene	gene with protein product		611900				11978971	Standard	NM_001242904		Approved		uc002kqf.3	Q53F39	OTTHUMG00000131661	ENST00000588072.1:c.435C>A	18.37:g.11889445G>T	ENSP00000465894:p.His145Gln	Somatic	91	0		WXS	Illumina GAIIx	Phase_I	83	4	NM_001242904	0	0	18	18	0	B0YJ39|B0YJ40|B0YJ41|B5ME53|B7WNJ3|D3DUI5|D3DUI7|Q6GMP1|Q8TAD6|Q8TE26|Q8WZ32|Q9BU58|Q9H958|Q9HAI4	Missense_Mutation	SNP	ENST00000588072.1	37	CCDS11853.1	.	.	.	.	.	.	.	.	.	.	G	13.54	2.268894	0.40095	.	.	ENSG00000154889	ENST00000317235;ENST00000309976;ENST00000317251;ENST00000344987;ENST00000399978	T;T;T;T;T	0.15834	2.39;2.39;2.39;2.39;2.39	5.77	1.4	0.22301	Calcineurin-like phosphoesterase superfamily domain (1);	0.084454	0.85682	D	0.000000	T	0.28134	0.0694	L	0.59436	1.845	0.44771	D	0.99777	D;D;D;D;D;P	0.89917	1.0;0.999;0.998;0.998;0.999;0.772	D;D;D;D;D;P	0.75484	0.986;0.952;0.977;0.969;0.977;0.526	T	0.15009	-1.0452	10	0.15952	T	0.53	-8.7791	6.7945	0.23717	0.5718:0.0:0.4282:0.0	.	145;145;48;145;145;145	Q53F39-3;Q53F39-4;B3KNP1;Q53F39-5;Q53F39-2;Q53F39	.;.;.;.;.;MPPE1_HUMAN	Q	145;145;48;145;145	ENSP00000327257:H145Q;ENSP00000311200:H145Q;ENSP00000312935:H48Q;ENSP00000339423:H145Q;ENSP00000382860:H145Q	ENSP00000311200:H145Q	H	-	3	2	MPPE1	11879445	1.000000	0.71417	0.968000	0.41197	0.620000	0.37586	1.422000	0.34826	0.447000	0.26695	-0.768000	0.03414	CAC	.		0.493	MPPE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254562.2	NM_023075	
ABHD3	171586	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	18	19244151	19244151	+	Missense_Mutation	SNP	T	T	G			TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr18:19244151T>G	ENST00000289119.2	-	5	735	c.596A>C	c.(595-597)gAg>gCg	p.E199A	ABHD3_ENST00000579875.1_5'UTR|RP11-13N13.5_ENST00000584148.1_RNA|ABHD3_ENST00000578270.1_5'UTR|ABHD3_ENST00000580981.1_Intron	NM_138340.4	NP_612213.2	Q8WU67	ABHD3_HUMAN	abhydrolase domain containing 3	199						integral component of membrane (GO:0016021)	carboxylic ester hydrolase activity (GO:0052689)			central_nervous_system(1)|endometrium(1)|large_intestine(4)|lung(2)|prostate(2)	10						AATAACTGTCTCCAAGTCTTC	0.408																																					p.E199A		.											.	ABHD3-90	0			c.A596C						.						91.0	81.0	85.0					18																	19244151		2203	4300	6503	SO:0001583	missense	171586	exon5			ACTGTCTCCAAGT	AK024880	CCDS32802.1	18q11.1	2011-02-16			ENSG00000158201	ENSG00000158201		"""Abhydrolase domain containing"""	18718	protein-coding gene	gene with protein product		612197					Standard	NM_138340		Approved	LABH3	uc002ktl.2	Q8WU67		ENST00000289119.2:c.596A>C	18.37:g.19244151T>G	ENSP00000289119:p.Glu199Ala	Somatic	89	0		WXS	Illumina GAIIx	Phase_I	79	68	NM_138340	0	0	0	2	2	B0YIV0|B7Z5C2|O43411	Missense_Mutation	SNP	ENST00000289119.2	37	CCDS32802.1	.	.	.	.	.	.	.	.	.	.	T	20.2	3.942331	0.73672	.	.	ENSG00000158201	ENST00000289119	T	0.10477	2.87	6.01	6.01	0.97437	.	0.000000	0.85682	D	0.000000	T	0.10508	0.0257	L	0.33624	1.015	0.80722	D	1	P	0.37370	0.592	B	0.37091	0.241	T	0.28138	-1.0053	10	0.18710	T	0.47	-16.63	16.5285	0.84344	0.0:0.0:0.0:1.0	.	199	Q8WU67	ABHD3_HUMAN	A	199	ENSP00000289119:E199A	ENSP00000289119:E199A	E	-	2	0	ABHD3	17498149	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.426000	0.80270	2.307000	0.77673	0.528000	0.53228	GAG	.		0.408	ABHD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000444757.1		
ZNF521	25925	broad.mit.edu;bcgsc.ca	37	18	22806811	22806811	+	Silent	SNP	C	C	T			TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr18:22806811C>T	ENST00000361524.3	-	4	1219	c.1071G>A	c.(1069-1071)acG>acA	p.T357T	ZNF521_ENST00000584787.1_Silent_p.T137T|ZNF521_ENST00000538137.2_Silent_p.T357T|ZNF521_ENST00000579111.1_5'Flank	NM_015461.2	NP_056276.1	Q96K83	ZN521_HUMAN	zinc finger protein 521	357					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|protein domain specific binding (GO:0019904)			NS(1)|breast(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(21)|lung(97)|ovary(5)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	149	all_cancers(21;0.0025)|all_epithelial(16;3.62e-05)|Ovarian(20;0.0991)					AATCTGGAGTCGTACTGGACA	0.572			T	PAX5	ALL																																p.T357T		.		Dom	yes		18	18q11.2	25925	zinc finger protein 521		L	.	ZNF521-275	0			c.G1071A						.						81.0	77.0	78.0					18																	22806811		2203	4300	6503	SO:0001819	synonymous_variant	25925	exon4			TGGAGTCGTACTG	AK027354	CCDS32806.1	18q11.2	2013-01-08				ENSG00000198795		"""Zinc fingers, C2H2-type"""	24605	protein-coding gene	gene with protein product	"""early hematopoietic zinc finger"""	610974				11984006, 14630787	Standard	NM_015461		Approved	EHZF, Evi3	uc002kvk.2	Q96K83		ENST00000361524.3:c.1071G>A	18.37:g.22806811C>T		Somatic	68	1		WXS	Illumina GAIIx	Phase_I	73	5	NM_015461	0	0	13	13	0	A3QVP7|B0YJB7|Q8IXI0|Q8TES6|Q9C065|Q9HAL5|Q9UFK4	Silent	SNP	ENST00000361524.3	37	CCDS32806.1																																																																																			.		0.572	ZNF521-001	KNOWN	overlapping_uORF|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000446781.2	NM_015461	
SLC39A6	25800	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	18	33706547	33706547	+	Nonsense_Mutation	SNP	G	G	A			TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr18:33706547G>A	ENST00000590986.1	-	2	713	c.424C>T	c.(424-426)Cga>Tga	p.R142*	SLC39A6_ENST00000269187.5_Nonsense_Mutation_p.R142*|SLC39A6_ENST00000440549.2_Intron			Q13433	S39A6_HUMAN	solute carrier family 39 (zinc transporter), member 6	142					cellular zinc ion homeostasis (GO:0006882)|transmembrane transport (GO:0055085)|zinc ion transmembrane import (GO:0071578)|zinc ion transmembrane transport (GO:0071577)	cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|integral component of plasma membrane (GO:0005887)|lamellipodium membrane (GO:0031258)|plasma membrane (GO:0005886)	zinc ion transmembrane transporter activity (GO:0005385)			breast(2)|central_nervous_system(1)|endometrium(5)|kidney(6)|large_intestine(4)|liver(1)|lung(18)|ovary(1)|pancreas(1)|prostate(1)|skin(1)	41						AGAGCTTTTCGCTTATTTTTA	0.483																																					p.R142X		.											.	SLC39A6-92	0			c.C424T						.						114.0	102.0	106.0					18																	33706547		2029	4196	6225	SO:0001587	stop_gained	25800	exon2			CTTTTCGCTTATT	U41060	CCDS42428.1, CCDS45854.1	18q12.2	2013-05-22				ENSG00000141424		"""Solute carriers"""	18607	protein-coding gene	gene with protein product		608731	"""solute carrier family 39 (metal ion transporter), member 6"""			12659941, 12839489	Standard	NM_012319		Approved	LIV-1	uc010dmy.3	Q13433		ENST00000590986.1:c.424C>T	18.37:g.33706547G>A	ENSP00000465915:p.Arg142*	Somatic	221	1		WXS	Illumina GAIIx	Phase_I	234	203	NM_012319	0	0	0	3	3	B4DR49|B4E224|Q8IXR3|Q96HP5	Nonsense_Mutation	SNP	ENST00000590986.1	37	CCDS42428.1	.	.	.	.	.	.	.	.	.	.	G	37	6.338123	0.97485	.	.	ENSG00000141424	ENST00000269187	.	.	.	5.7	2.65	0.31530	.	0.476492	0.20353	N	0.094012	.	.	.	.	.	.	0.18873	N	0.999987	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-0.4407	6.278	0.20991	0.1736:0.0:0.6684:0.158	.	.	.	.	X	142	.	ENSP00000269187:R142X	R	-	1	2	SLC39A6	31960545	0.512000	0.26186	0.894000	0.35097	0.757000	0.42996	1.558000	0.36309	0.774000	0.33427	0.555000	0.69702	CGA	.		0.483	SLC39A6-004	NOVEL	alternative_5_UTR|not_organism_supported|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000444136.1		
FHOD3	80206	broad.mit.edu;ucsc.edu;bcgsc.ca	37	18	34289245	34289245	+	Silent	SNP	C	C	T	rs141915411		TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr18:34289245C>T	ENST00000359247.4	+	14	1848	c.1848C>T	c.(1846-1848)aaC>aaT	p.N616N	FHOD3_ENST00000445677.1_Silent_p.N595N|FHOD3_ENST00000591635.1_Intron|FHOD3_ENST00000257209.4_Silent_p.N633N|FHOD3_ENST00000587493.1_3'UTR|FHOD3_ENST00000590592.1_Silent_p.N808N	NM_001281739.1	NP_001268668.1	Q2V2M9	FHOD3_HUMAN	formin homology 2 domain containing 3	616					actin filament network formation (GO:0051639)|cardiac myofibril assembly (GO:0055003)|negative regulation of actin filament polymerization (GO:0030837)|sarcomere organization (GO:0045214)	striated muscle thin filament (GO:0005865)				NS(1)|breast(5)|central_nervous_system(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(25)|liver(2)|lung(29)|ovary(3)|prostate(4)|skin(5)|upper_aerodigestive_tract(1)	90		all_epithelial(2;0.0181)|Colorectal(2;0.0195)				AGAGGCAGAACGAGGGGGTGA	0.587													C|||	1	0.000199681	0.0	0.0	5008	,	,		20005	0.0		0.001	False		,,,				2504	0.0				p.N633N		.											.	FHOD3-139	0			c.C1899T						.						62.0	60.0	61.0					18																	34289245		2203	4300	6503	SO:0001819	synonymous_variant	80206	exon15			GCAGAACGAGGGG	AK091899	CCDS32816.1, CCDS62418.1, CCDS62419.1	18q12	2007-08-02				ENSG00000134775			26178	protein-coding gene	gene with protein product		609691				11214970	Standard	NM_025135		Approved	FHOS2, KIAA1695, FLJ22297, FLJ22717	uc021uiv.1	Q2V2M9		ENST00000359247.4:c.1848C>T	18.37:g.34289245C>T		Somatic	209	2		WXS	Illumina GAIIx	Phase_I	226	196	NM_025135	0	0	0	13	13	A8MQT4|E5F5Q0|Q642I2|Q6ZRQ7|Q86TF9|Q8N3A5|Q9C0G8|Q9H604|Q9H6G7	Silent	SNP	ENST00000359247.4	37																																																																																				C|0.999;T|0.000		0.587	FHOD3-001	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460884.1	XM_371114	
PIAS2	9063	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	18	44470593	44470593	+	Frame_Shift_Del	DEL	T	T	-			TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr18:44470593delT	ENST00000585916.1	-	2	448	c.449delA	c.(448-450)aatfs	p.N150fs	PIAS2_ENST00000545673.1_Intron|PIAS2_ENST00000324794.7_Frame_Shift_Del_p.N150fs	NM_004671.3	NP_004662.2	O75928	PIAS2_HUMAN	protein inhibitor of activated STAT, 2	150	PINIT. {ECO:0000255|PROSITE- ProRule:PRU00799}.				androgen receptor signaling pathway (GO:0030521)|negative regulation of androgen receptor signaling pathway (GO:0060766)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein sumoylation (GO:0016925)|regulation of osteoblast differentiation (GO:0045667)|transcription, DNA-templated (GO:0006351)	nuclear body (GO:0016604)|nucleus (GO:0005634)	androgen receptor binding (GO:0050681)|DNA binding (GO:0003677)|SUMO ligase activity (GO:0019789)|transcription coactivator activity (GO:0003713)|zinc ion binding (GO:0008270)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(8)|ovary(2)|skin(3)|upper_aerodigestive_tract(1)	22						AAAGGGCAGATTTTTTAACTG	0.423																																					p.N150fs		.											.	PIAS2-662	0			c.449delA						.						85.0	75.0	78.0					18																	44470593		2203	4300	6503	SO:0001589	frameshift_variant	9063	exon2			GGCAGATTTTTTA	AF077953	CCDS32824.1, CCDS32825.1	18q12.1-q12.3	2011-10-11				ENSG00000078043		"""Zinc fingers, MIZ-type"""	17311	protein-coding gene	gene with protein product	"""zinc finger, MIZ-type containing 4"""	603567				9724754, 9256341	Standard	NM_004671		Approved	PIASX-BETA, miz, PIASX-ALPHA, ZMIZ4	uc002lck.3	O75928		ENST00000585916.1:c.449delA	18.37:g.44470593delT	ENSP00000465676:p.Asn150fs	Somatic	260	0		WXS	Illumina GAIIx	Phase_I	277	241	NM_173206	0	0	0	0	0	O75927|Q96BT5|Q96KE3	Frame_Shift_Del	DEL	ENST00000585916.1	37	CCDS32824.1																																																																																			.		0.423	PIAS2-008	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000445656.2	NM_004671	
ADNP2	22850	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	18	77893731	77893732	+	Frame_Shift_Del	DEL	TA	TA	-			TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10	TA	TA	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr18:77893731_77893732delTA	ENST00000262198.4	+	4	890_891	c.435_436delTA	c.(433-438)actaaafs	p.K146fs		NM_014913.3	NP_055728.1	Q6IQ32	ADNP2_HUMAN	ADNP homeobox 2	146					cellular response to oxidative stress (GO:0034599)|cellular response to retinoic acid (GO:0071300)|negative regulation of cell death (GO:0060548)|neuron differentiation (GO:0030182)|positive regulation of cell growth (GO:0030307)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(4)|central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(3)|large_intestine(9)|liver(1)|lung(15)|ovary(5)|prostate(2)	42		all_cancers(4;1.06e-15)|all_epithelial(4;2.36e-10)|all_lung(4;0.000302)|Lung NSC(4;0.000518)|Esophageal squamous(42;0.0212)|Ovarian(4;0.0256)|all_hematologic(56;0.15)|Melanoma(33;0.2)		Epithelial(2;1.1e-11)|OV - Ovarian serous cystadenocarcinoma(15;7.54e-09)|BRCA - Breast invasive adenocarcinoma(31;0.00247)|STAD - Stomach adenocarcinoma(84;0.164)		TAGGTGAAACTAAATCATCTAG	0.401																																					p.145_146del		.											.	ADNP2-140	0			c.435_436del						.																																			SO:0001589	frameshift_variant	22850	exon4			TGAAACTAAATCA	AB020670	CCDS32853.1	18q23	2013-01-07	2007-07-17	2007-07-17	ENSG00000101544	ENSG00000101544		"""Homeoboxes / ZF class"", ""Zinc fingers, C2H2-type"""	23803	protein-coding gene	gene with protein product			"""zinc finger protein 508"""	ZNF508			Standard	NM_014913		Approved	KIAA0863	uc002lnw.3	Q6IQ32	OTTHUMG00000172535	ENST00000262198.4:c.435_436delTA	18.37:g.77893731_77893732delTA	ENSP00000262198:p.Lys146fs	Somatic	110	0		WXS	Illumina GAIIx	Phase_I	103	94	NM_014913	0	0	0	0	0	A8K951|O94943|Q9H9P3	Frame_Shift_Del	DEL	ENST00000262198.4	37	CCDS32853.1																																																																																			.		0.401	ADNP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000418979.1	NM_014913	
LMNB2	84823	ucsc.edu;bcgsc.ca	37	19	2438488	2438488	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr19:2438488C>T	ENST00000582871.1	-	3	469	c.383G>A	c.(382-384)cGt>cAt	p.R128H	LMNB2_ENST00000325327.3_Missense_Mutation_p.R148H	NM_032737.3	NP_116126.3	Q03252	LMNB2_HUMAN	lamin B2	128	Coil 1B.|Rod.					lamin filament (GO:0005638)|nuclear inner membrane (GO:0005637)	structural molecule activity (GO:0005198)			NS(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(8)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	18		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		GTCCTTCACACGGCCCTGGGC	0.667																																					p.R148H		.											.	LMNB2-290	0			c.G443A						.						30.0	26.0	27.0					19																	2438488		2203	4300	6503	SO:0001583	missense	84823	exon3			TTCACACGGCCCT	M94362	CCDS12090.1, CCDS12090.2	19p13.3	2013-01-16			ENSG00000176619	ENSG00000176619		"""Intermediate filaments type V, lamins"""	6638	protein-coding gene	gene with protein product		150341		LMN2		1630457	Standard	NM_032737		Approved		uc002lvy.4	Q03252	OTTHUMG00000150626	ENST00000582871.1:c.383G>A	19.37:g.2438488C>T	ENSP00000462730:p.Arg128His	Somatic	320	2		WXS	Illumina GAIIx	Phase_I	806	359	NM_032737	0	0	1	3	2	O75292|Q14734|Q96DF6	Missense_Mutation	SNP	ENST00000582871.1	37		.	.	.	.	.	.	.	.	.	.	C	18.82	3.705188	0.68615	.	.	ENSG00000176619	ENST00000325327	.	.	.	4.38	4.38	0.52667	Filament (1);	0.000000	0.85682	D	0.000000	T	0.65133	0.2662	M	0.71871	2.18	0.80722	D	1	P	0.47910	0.902	P	0.48425	0.577	T	0.71286	-0.4638	9	0.59425	D	0.04	.	15.5124	0.75793	0.0:1.0:0.0:0.0	.	128	Q03252	LMNB2_HUMAN	H	128	.	ENSP00000327054:R128H	R	-	2	0	LMNB2	2389488	1.000000	0.71417	0.912000	0.35992	0.120000	0.20174	6.049000	0.71053	1.983000	0.57843	0.561000	0.74099	CGT	.		0.667	LMNB2-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_032737	
MFSD12	126321	broad.mit.edu	37	19	3547501	3547501	+	Silent	SNP	G	G	T			TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr19:3547501G>T	ENST00000355415.2	-	5	1051	c.882C>A	c.(880-882)tcC>tcA	p.S294S	MFSD12_ENST00000398558.4_Silent_p.S294S|MFSD12_ENST00000389395.3_Silent_p.S294S|AC005786.7_ENST00000589360.1_RNA|MFSD12_ENST00000591878.1_5'Flank	NM_174983.3	NP_778148.2	Q6NUT3	MFS12_HUMAN	major facilitator superfamily domain containing 12	294					transport (GO:0006810)	integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)				cervix(1)|endometrium(2)|lung(4)|urinary_tract(2)	9						TGTAGGTCTGGGACAGGTTCA	0.642																																					p.S294S		.											.	.	0			c.C882A						.						48.0	54.0	52.0					19																	3547501		2104	4221	6325	SO:0001819	synonymous_variant	126321	exon5			GGTCTGGGACAGG	AF218008	CCDS42465.1, CCDS74256.1	19p13.3	2012-03-09	2011-11-24	2011-11-24	ENSG00000161091	ENSG00000161091			28299	protein-coding gene	gene with protein product			"""chromosome 19 open reading frame 28"""	C19orf28		12477932	Standard	NM_174983		Approved	MGC20700, PP3501	uc002lxw.3	Q6NUT3		ENST00000355415.2:c.882C>A	19.37:g.3547501G>T		Somatic	308	0		WXS	Illumina GAIIx	Phase_I	610	10	NM_001042680	0	0	48	48	0	A8MXP7|D6W615|E9PAJ8|Q8N459	Silent	SNP	ENST00000355415.2	37	CCDS42465.1																																																																																			.		0.642	MFSD12-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000452949.2	NM_174983	
MFSD12	126321	hgsc.bcm.edu	37	19	3547981	3547981	+	Silent	SNP	T	T	G			TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr19:3547981T>G	ENST00000355415.2	-	4	871	c.702A>C	c.(700-702)ctA>ctC	p.L234L	MFSD12_ENST00000398558.4_Silent_p.L234L|MFSD12_ENST00000389395.3_Silent_p.L234L|AC005786.7_ENST00000589360.1_RNA|MFSD12_ENST00000591878.1_5'UTR	NM_174983.3	NP_778148.2	Q6NUT3	MFS12_HUMAN	major facilitator superfamily domain containing 12	234					transport (GO:0006810)	integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)				cervix(1)|endometrium(2)|lung(4)|urinary_tract(2)	9						CCAGGTGGAATAGCAGTGAGA	0.716																																					p.L234L		.											.	.	0			c.A702C						.						17.0	22.0	20.0					19																	3547981		1984	4124	6108	SO:0001819	synonymous_variant	126321	exon4			GTGGAATAGCAGT	AF218008	CCDS42465.1, CCDS74256.1	19p13.3	2012-03-09	2011-11-24	2011-11-24	ENSG00000161091	ENSG00000161091			28299	protein-coding gene	gene with protein product			"""chromosome 19 open reading frame 28"""	C19orf28		12477932	Standard	NM_174983		Approved	MGC20700, PP3501	uc002lxw.3	Q6NUT3		ENST00000355415.2:c.702A>C	19.37:g.3547981T>G		Somatic	2	0		WXS	Illumina GAIIx	Phase_I	11	9	NM_001042680	0	0	29	47	18	A8MXP7|D6W615|E9PAJ8|Q8N459	Silent	SNP	ENST00000355415.2	37	CCDS42465.1																																																																																			.		0.716	MFSD12-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000452949.2	NM_174983	
CHAF1A	10036	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	4409751	4409751	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr19:4409751C>T	ENST00000301280.5	+	3	1056	c.955C>T	c.(955-957)Cgc>Tgc	p.R319C		NM_005483.2	NP_005474	Q13111	CAF1A_HUMAN	chromatin assembly factor 1, subunit A (p150)	319					cell cycle (GO:0007049)|chromatin assembly (GO:0031497)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|DNA replication-dependent nucleosome assembly (GO:0006335)|protein complex assembly (GO:0006461)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	CAF-1 complex (GO:0033186)|nuclear chromatin (GO:0000790)|protein complex (GO:0043234)	chromatin binding (GO:0003682)|chromo shadow domain binding (GO:0070087)|identical protein binding (GO:0042802)|unfolded protein binding (GO:0051082)			breast(1)|endometrium(4)|kidney(3)|large_intestine(5)|lung(6)|ovary(1)|pancreas(1)|prostate(2)|skin(3)|urinary_tract(1)	27		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0148)|STAD - Stomach adenocarcinoma(1328;0.18)		CACGCCCCTCCGCAGAGTGAG	0.632								Chromatin Structure																													p.R319C		.											.	CHAF1A-92	0			c.C955T						.						54.0	52.0	52.0					19																	4409751		2203	4300	6503	SO:0001583	missense	10036	exon3			CCCCTCCGCAGAG	U20979	CCDS32875.1	19p13.3	2008-07-16				ENSG00000167670			1910	protein-coding gene	gene with protein product	"""chromatin assembly factor I (150 kDa)"""	601246				7600578	Standard	NM_005483		Approved	CAF1P150, CAF1B, CAF-1, CAF1, P150, MGC71229	uc002mal.3	Q13111		ENST00000301280.5:c.955C>T	19.37:g.4409751C>T	ENSP00000301280:p.Arg319Cys	Somatic	79	0		WXS	Illumina GAIIx	Phase_I	117	49	NM_005483	0	0	0	0	0	Q6NXG5|Q7Z7K3|Q9UJY8	Missense_Mutation	SNP	ENST00000301280.5	37	CCDS32875.1	.	.	.	.	.	.	.	.	.	.	C	13.43	2.235826	0.39498	.	.	ENSG00000167670	ENST00000344143;ENST00000535117;ENST00000301280	T	0.05786	3.39	5.78	-5.38	0.02673	.	.	.	.	.	T	0.02571	0.0078	N	0.11560	0.145	0.09310	N	1	B	0.15719	0.014	B	0.06405	0.002	T	0.44065	-0.9352	9	0.87932	D	0	-1.1276	0.6845	0.00880	0.2308:0.2082:0.311:0.25	.	319	Q13111	CAF1A_HUMAN	C	319	ENSP00000301280:R319C	ENSP00000301280:R319C	R	+	1	0	CHAF1A	4360751	0.000000	0.05858	0.000000	0.03702	0.034000	0.12701	-0.148000	0.10219	-1.138000	0.02884	0.591000	0.81541	CGC	.		0.632	CHAF1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458310.2	NM_005483	
KDM4B	23030	hgsc.bcm.edu	37	19	5151503	5151503	+	Missense_Mutation	SNP	G	G	T			TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr19:5151503G>T	ENST00000159111.4	+	23	3490	c.3272G>T	c.(3271-3273)cGg>cTg	p.R1091L	KDM4B_ENST00000536461.1_Missense_Mutation_p.R1125L	NM_015015.2	NP_055830	O94953	KDM4B_HUMAN	lysine (K)-specific demethylase 4B	1091					chromatin modification (GO:0016568)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cell junction (GO:0030054)|focal adhesion (GO:0005925)|nucleus (GO:0005634)	dioxygenase activity (GO:0051213)|zinc ion binding (GO:0008270)			breast(2)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(1)|liver(1)|lung(14)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)	32						GTGCAGGGCCGGCCCGGAGCC	0.721																																					p.R1091L		.											.	KDM4B-226	0			c.G3272T						.						4.0	6.0	5.0					19																	5151503		2063	4116	6179	SO:0001583	missense	23030	exon23			AGGGCCGGCCCGG	AB020683	CCDS12138.1	19p13.3	2013-01-23	2009-04-06	2009-04-06		ENSG00000127663		"""Chromatin-modifying enzymes / K-demethylases"", ""Tudor domain containing"""	29136	protein-coding gene	gene with protein product	"""tudor domain containing 14B"""	609765	"""jumonji domain containing 2B"""	JMJD2B		10048485, 15138608	Standard	NM_015015		Approved	KIAA0876, TDRD14B	uc002mbq.4	O94953		ENST00000159111.4:c.3272G>T	19.37:g.5151503G>T	ENSP00000159111:p.Arg1091Leu	Somatic	9	0		WXS	Illumina GAIIx	Phase_I	43	5	NM_015015	0	0	27	27	0	B9EGN8|D6W631|O75274|Q6P3R5|Q9P1V1|Q9UF40	Missense_Mutation	SNP	ENST00000159111.4	37	CCDS12138.1	.	.	.	.	.	.	.	.	.	.	G	15.79	2.936901	0.52972	.	.	ENSG00000127663	ENST00000159111;ENST00000536461	T;T	0.19938	2.13;2.11	4.66	0.881	0.19166	.	0.351996	0.25400	N	0.030952	T	0.13329	0.0323	L	0.36672	1.1	0.29092	N	0.88206	B;B	0.31485	0.325;0.116	B;B	0.26202	0.067;0.044	T	0.10683	-1.0619	10	0.56958	D	0.05	-20.7107	6.8207	0.23855	0.4651:0.0:0.5349:0.0	.	1125;1091	F5GX28;O94953	.;KDM4B_HUMAN	L	1091;1125	ENSP00000159111:R1091L;ENSP00000440495:R1125L	ENSP00000159111:R1091L	R	+	2	0	KDM4B	5102503	1.000000	0.71417	0.998000	0.56505	0.920000	0.55202	1.741000	0.38238	0.367000	0.24454	0.448000	0.29417	CGG	.		0.721	KDM4B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000450558.1	NM_015015	
FUT6	2528	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	5831871	5831871	+	Silent	SNP	C	C	T	rs141754965		TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr19:5831871C>T	ENST00000318336.4	-	3	1902	c.708G>A	c.(706-708)acG>acA	p.T236T	FUT6_ENST00000527106.1_Silent_p.T236T|FUT6_ENST00000524754.1_Silent_p.T236T|FUT6_ENST00000592563.1_Silent_p.T236T|FUT6_ENST00000286955.5_Silent_p.T236T	NM_000150.2	NP_000141.1	P51993	FUT6_HUMAN	fucosyltransferase 6 (alpha (1,3) fucosyltransferase)	236					fucosylation (GO:0036065)|L-fucose catabolic process (GO:0042355)|protein glycosylation (GO:0006486)	extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	3-galactosyl-N-acetylglucosaminide 4-alpha-L-fucosyltransferase activity (GO:0017060)|alpha-(1->3)-fucosyltransferase activity (GO:0046920)|fucosyltransferase activity (GO:0008417)			endometrium(2)|kidney(1)|large_intestine(1)|lung(2)	6						ACCGGGACAGCGTCTCCATCA	0.632																																					p.T236T		.											.	FUT6-90	0			c.G708A						.	C	,	0,4406		0,0,2203	120.0	116.0	117.0		708,708	-4.2	0.0	19	dbSNP_134	117	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous,coding-synonymous	FUT6	NM_000150.2,NM_001040701.1	,	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	,	236/360,236/360	5831871	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	2528	exon3			GGACAGCGTCTCC		CCDS12152.1	19p13.3	2013-02-26			ENSG00000156413	ENSG00000156413	2.4.1.65	"""Fucosyltransferases"""	4017	protein-coding gene	gene with protein product	"""alpha-(1,3)-fucosyltransferase"", ""galactoside 3-L-fucosyltransferase"""	136836				1520296, 7782074	Standard	NM_001040701		Approved	FT1A, FCT3A, FucT-VI, FLJ40754	uc002mdh.1	P51993	OTTHUMG00000167335	ENST00000318336.4:c.708G>A	19.37:g.5831871C>T		Somatic	325	1		WXS	Illumina GAIIx	Phase_I	663	282	NM_000150	0	0	0	0	0	A6NEX0|D6W637|Q9UND8	Silent	SNP	ENST00000318336.4	37	CCDS12152.1																																																																																			C|1.000;T|0.000		0.632	FUT6-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394218.2	NM_000150	
PSPN	5623	bcgsc.ca	37	19	6375624	6375624	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr19:6375624G>A	ENST00000245810.1	-	2	151	c.152C>T	c.(151-153)aCc>aTc	p.T51I	PSPN_ENST00000597721.1_Silent_p.H79H	NM_004158.2	NP_004149.1	O60542	PSPN_HUMAN	persephin	51					axon guidance (GO:0007411)|branching involved in ureteric bud morphogenesis (GO:0001658)|central nervous system development (GO:0007417)|nervous system development (GO:0007399)	extracellular space (GO:0005615)	receptor binding (GO:0005102)			lung(1)|ovary(1)|skin(1)	3						GGGGCGGTGGGTGCCTGTGGG	0.672																																					p.T51I		.											.	PSPN-91	0			c.C152T						.						25.0	22.0	23.0					19																	6375624		2193	4290	6483	SO:0001583	missense	5623	exon2			CGGTGGGTGCCTG	AF040962	CCDS12164.1	19p13.3	2014-01-30				ENSG00000125650		"""Endogenous ligands"""	9579	protein-coding gene	gene with protein product		602921				10072588	Standard	NM_004158		Approved	PSP	uc010xja.2	O60542		ENST00000245810.1:c.152C>T	19.37:g.6375624G>A	ENSP00000245810:p.Thr51Ile	Somatic	132	4		WXS	Illumina GAIIx	Phase_I	407	200	NM_004158	0	0	4	6	2		Missense_Mutation	SNP	ENST00000245810.1	37	CCDS12164.1	.	.	.	.	.	.	.	.	.	.	G	10.26	1.299861	0.23650	.	.	ENSG00000125650	ENST00000245810	D	0.88586	-2.4	2.27	2.27	0.28462	.	.	.	.	.	T	0.74222	0.3688	N	0.08118	0	0.25324	N	0.98909	B	0.34147	0.438	B	0.28638	0.092	T	0.64879	-0.6303	9	0.36615	T	0.2	-19.1332	8.54	0.33386	0.0:0.0:1.0:0.0	.	51	O60542	PSPN_HUMAN	I	51	ENSP00000245810:T51I	ENSP00000245810:T51I	T	-	2	0	PSPN	6326624	0.002000	0.14202	0.045000	0.18777	0.054000	0.15201	0.087000	0.14958	1.189000	0.43028	0.313000	0.20887	ACC	.		0.672	PSPN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398032.1	NM_004158	
VAV1	7409	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	6822269	6822269	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr19:6822269G>A	ENST00000602142.1	+	5	569	c.487G>A	c.(487-489)Gtg>Atg	p.V163M	VAV1_ENST00000596764.1_Missense_Mutation_p.V163M|VAV1_ENST00000304076.2_Missense_Mutation_p.V163M|VAV1_ENST00000599806.1_Missense_Mutation_p.V108M|VAV1_ENST00000539284.1_Missense_Mutation_p.V98M	NM_005428.3	NP_005419.2	P15498	VAV_HUMAN	vav 1 guanine nucleotide exchange factor	163					apoptotic signaling pathway (GO:0097190)|blood coagulation (GO:0007596)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|G-protein coupled receptor signaling pathway (GO:0007186)|innate immune response (GO:0045087)|integrin-mediated signaling pathway (GO:0007229)|neurotrophin TRK receptor signaling pathway (GO:0048011)|neutrophil chemotaxis (GO:0030593)|phosphatidylinositol-mediated signaling (GO:0048015)|platelet activation (GO:0030168)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell adhesion (GO:0045785)|reactive oxygen species metabolic process (GO:0072593)|regulation of Rac GTPase activity (GO:0032314)|regulation of small GTPase mediated signal transduction (GO:0051056)|regulation of transcription, DNA-templated (GO:0006355)|small GTPase mediated signal transduction (GO:0007264)|T cell activation (GO:0042110)|T cell costimulation (GO:0031295)	cell-cell junction (GO:0005911)|cytosol (GO:0005829)|plasma membrane (GO:0005886)	guanyl-nucleotide exchange factor activity (GO:0005085)|metal ion binding (GO:0046872)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)|sequence-specific DNA binding transcription factor activity (GO:0003700)			biliary_tract(1)|breast(3)|central_nervous_system(2)|endometrium(3)|kidney(5)|large_intestine(16)|lung(18)|ovary(5)|prostate(2)|skin(5)|upper_aerodigestive_tract(2)	62						GTATGACTGCGTGGAGAATGA	0.637																																					p.V163M		.											.	VAV1-1276	0			c.G487A						.						107.0	78.0	88.0					19																	6822269		2202	4298	6500	SO:0001583	missense	7409	exon5			GACTGCGTGGAGA		CCDS12174.1, CCDS59341.1, CCDS59342.1	19p13.2	2013-02-14	2007-07-25			ENSG00000141968		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"", ""SH2 domain containing"""	12657	protein-coding gene	gene with protein product		164875	"""vav 1 oncogene"""	VAV		9438848	Standard	NM_005428		Approved		uc010xjh.2	P15498		ENST00000602142.1:c.487G>A	19.37:g.6822269G>A	ENSP00000472929:p.Val163Met	Somatic	148	1		WXS	Illumina GAIIx	Phase_I	411	54	NM_005428	0	0	0	0	0	B4DVK9|M0QXX6|Q15860	Missense_Mutation	SNP	ENST00000602142.1	37	CCDS12174.1	.	.	.	.	.	.	.	.	.	.	G	24.9	4.586731	0.86851	.	.	ENSG00000141968	ENST00000304076;ENST00000539284	T;T	0.56275	0.47;0.47	4.17	4.17	0.49024	Calponin homology domain (1);	0.173491	0.37012	N	0.002297	T	0.70745	0.3259	M	0.76170	2.325	0.58432	D	0.999999	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.91635	0.999;0.998;0.996;0.999	T	0.73084	-0.4094	10	0.49607	T	0.09	.	14.3548	0.66730	0.0:0.0:1.0:0.0	.	98;163;108;163	F5H5P4;B2R8B5;Q96D37;P15498	.;.;.;VAV_HUMAN	M	163;98	ENSP00000302269:V163M;ENSP00000443242:V98M	ENSP00000302269:V163M	V	+	1	0	VAV1	6773269	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	8.000000	0.88501	2.323000	0.78572	0.563000	0.77884	GTG	.		0.637	VAV1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458475.1		
PNPLA6	10908	hgsc.bcm.edu;broad.mit.edu	37	19	7605851	7605851	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr19:7605851C>T	ENST00000221249.6	+	10	1152	c.721C>T	c.(721-723)Cgg>Tgg	p.R241W	PNPLA6_ENST00000545201.2_Missense_Mutation_p.R241W|PNPLA6_ENST00000450331.3_Missense_Mutation_p.R241W|PNPLA6_ENST00000414982.3_Missense_Mutation_p.R289W|PNPLA6_ENST00000600737.1_Missense_Mutation_p.R280W	NM_006702.4	NP_006693.3	Q8IY17	PLPL6_HUMAN	patatin-like phospholipase domain containing 6	280					angiogenesis (GO:0001525)|cell death (GO:0008219)|lipid catabolic process (GO:0016042)|organ morphogenesis (GO:0009887)|phosphatidylcholine metabolic process (GO:0046470)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	lysophospholipase activity (GO:0004622)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(6)|lung(14)|ovary(3)|stomach(1)|upper_aerodigestive_tract(1)	35						CCGGGCGGCCCGGGACTCCAC	0.692																																					p.R289W		.											.	PNPLA6-47	0			c.C865T						.						12.0	14.0	13.0					19																	7605851		2200	4288	6488	SO:0001583	missense	10908	exon9			GCGGCCCGGGACT	AJ004832	CCDS32891.1, CCDS54206.1, CCDS54207.1, CCDS59343.1	19p13.2	2013-09-11						"""Patatin-like phospholipase domain containing"""	16268	protein-coding gene	gene with protein product	"""neuropathy target esterase"""	603197				9576844, 16799181, 19029121	Standard	NM_006702		Approved	NTE, sws, iPLA2delta, SPG39	uc010xjq.2	Q8IY17		ENST00000221249.6:c.721C>T	19.37:g.7605851C>T	ENSP00000221249:p.Arg241Trp	Somatic	40	0		WXS	Illumina GAIIx	Phase_I	203	14	NM_001166111	0	0	10	10	0	A6NGQ0|B4DFB9|B7Z7T2|F5H5K9|J3KQS3|O60859|Q86W58|Q9UG58	Missense_Mutation	SNP	ENST00000221249.6	37	CCDS32891.1	.	.	.	.	.	.	.	.	.	.	C	18.81	3.703911	0.68501	.	.	ENSG00000032444	ENST00000221249;ENST00000545201;ENST00000414982;ENST00000544207;ENST00000450331	T;T;T;T	0.43688	0.94;0.94;0.94;0.94	5.28	4.23	0.50019	Cyclic nucleotide-binding-like (1);RmlC-like jelly roll fold (1);Cyclic nucleotide-binding domain (3);	0.207947	0.39834	N	0.001252	T	0.51873	0.1700	L	0.49126	1.545	0.30101	N	0.807419	D;D;D;D	0.57899	0.981;0.958;0.976;0.958	P;P;P;P	0.58970	0.849;0.764;0.764;0.764	T	0.55354	-0.8154	10	0.72032	D	0.01	.	11.1086	0.48218	0.334:0.666:0.0:0.0	.	280;241;280;241	Q8IY17;F5H5K9;Q8IY17-3;Q8IY17-2	PLPL6_HUMAN;.;.;.	W	241;241;289;178;241	ENSP00000221249:R241W;ENSP00000443323:R241W;ENSP00000407509:R289W;ENSP00000394348:R241W	ENSP00000221249:R241W	R	+	1	2	PNPLA6	7511851	0.022000	0.18835	0.867000	0.34043	0.469000	0.32828	1.979000	0.40608	1.203000	0.43233	0.491000	0.48974	CGG	.		0.692	PNPLA6-001	KNOWN	NAGNAG_splice_site|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000459275.1	NM_006702	
TIMM44	10469	broad.mit.edu	37	19	7998852	7998852	+	Missense_Mutation	SNP	C	C	T	rs147925283		TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr19:7998852C>T	ENST00000270538.3	-	6	848	c.580G>A	c.(580-582)Gtc>Atc	p.V194I	TIMM44_ENST00000598968.1_5'Flank	NM_006351.3	NP_006342.2	O43615	TIM44_HUMAN	translocase of inner mitochondrial membrane 44 homolog (yeast)	194					cellular protein metabolic process (GO:0044267)|protein targeting to mitochondrion (GO:0006626)	mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|P-P-bond-hydrolysis-driven protein transmembrane transporter activity (GO:0015450)			NS(1)|endometrium(3)|kidney(3)|large_intestine(2)|liver(2)|lung(2)|ovary(2)|skin(1)|urinary_tract(1)	17						TGTCCCAGGACGCTGTCGTCA	0.632													C|||	1	0.000199681	0.0	0.0	5008	,	,		16777	0.001		0.0	False		,,,				2504	0.0				p.V194I		.											.	TIMM44-91	0			c.G580A						.	C	ILE/VAL	3,4403	8.1+/-20.4	0,3,2200	64.0	76.0	72.0		580	4.2	0.4	19	dbSNP_134	72	1,8599	1.2+/-3.3	0,1,4299	yes	missense	TIMM44	NM_006351.3	29	0,4,6499	TT,TC,CC		0.0116,0.0681,0.0308	benign	194/453	7998852	4,13002	2203	4300	6503	SO:0001583	missense	10469	exon6			CCAGGACGCTGTC	AF026030	CCDS12192.1	19p13.3-p13.2	2008-07-04				ENSG00000104980			17316	protein-coding gene	gene with protein product		605058				10848612, 10339406	Standard	NM_006351		Approved	TIM44	uc002miz.3	O43615		ENST00000270538.3:c.580G>A	19.37:g.7998852C>T	ENSP00000270538:p.Val194Ile	Somatic	56	0		WXS	Illumina GAIIx	Phase_I	109	4	NM_006351	0	0	83	84	1	A8K0R9|D6W664|Q8N193	Missense_Mutation	SNP	ENST00000270538.3	37	CCDS12192.1	.	.	.	.	.	.	.	.	.	.	C	11.95	1.792464	0.31685	6.81E-4	1.16E-4	ENSG00000104980	ENST00000270538	T	0.76968	-1.06	5.22	4.17	0.49024	.	0.000000	0.64402	D	0.000003	T	0.73552	0.3601	M	0.65975	2.015	0.31204	N	0.699429	B	0.17038	0.02	B	0.09377	0.004	T	0.72257	-0.4346	10	0.37606	T	0.19	-32.3405	12.0525	0.53515	0.0:0.9126:0.0:0.0874	.	194	O43615	TIM44_HUMAN	I	194	ENSP00000270538:V194I	ENSP00000270538:V194I	V	-	1	0	TIMM44	7904852	0.009000	0.17119	0.354000	0.25760	0.513000	0.34164	1.726000	0.38085	2.454000	0.82982	0.561000	0.74099	GTC	C|0.999;T|0.001		0.632	TIMM44-001	KNOWN	upstream_uORF|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000461596.3		
FBN3	84467	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	8206917	8206917	+	Missense_Mutation	SNP	G	G	A	rs370751618		TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr19:8206917G>A	ENST00000600128.1	-	7	1060	c.646C>T	c.(646-648)Cgt>Tgt	p.R216C	FBN3_ENST00000601739.1_Missense_Mutation_p.R216C|FBN3_ENST00000270509.2_Missense_Mutation_p.R216C			Q75N90	FBN3_HUMAN	fibrillin 3	216	TB 1.					proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|extracellular matrix structural constituent (GO:0005201)			NS(1)|breast(9)|central_nervous_system(2)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(15)|lung(53)|ovary(7)|pancreas(2)|prostate(3)|skin(10)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	132						CCCCAGGCACGGCCCACAGTG	0.652																																					p.R216C		.											.	FBN3-100	0			c.C646T						.	G	CYS/ARG	1,4405	2.1+/-5.4	0,1,2202	32.0	35.0	34.0		646	4.0	0.5	19		34	0,8600		0,0,4300	no	missense	FBN3	NM_032447.3	180	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	benign	216/2810	8206917	1,13005	2203	4300	6503	SO:0001583	missense	84467	exon6			AGGCACGGCCCAC		CCDS12196.1	19p13	2008-02-05							18794	protein-coding gene	gene with protein product		608529					Standard	NM_032447		Approved		uc002mjf.3	Q75N90		ENST00000600128.1:c.646C>T	19.37:g.8206917G>A	ENSP00000470498:p.Arg216Cys	Somatic	99	0		WXS	Illumina GAIIx	Phase_I	163	50	NM_032447	0	0	0	0	0	Q75N91|Q75N92|Q75N93|Q86SJ5|Q96JP8	Missense_Mutation	SNP	ENST00000600128.1	37	CCDS12196.1	.	.	.	.	.	.	.	.	.	.	g	24.9	4.581381	0.86748	2.27E-4	0.0	ENSG00000142449	ENST00000270509	D	0.93763	-3.28	3.95	3.95	0.45737	Matrix fibril-associated (3);TGF-beta binding (1);	0.079903	0.51477	U	0.000091	D	0.94076	0.8101	L	0.44542	1.39	0.58432	D	0.99999	D	0.76494	0.999	P	0.60609	0.877	D	0.94610	0.7803	10	0.62326	D	0.03	.	15.1368	0.72572	0.0:0.0:1.0:0.0	.	216	Q75N90	FBN3_HUMAN	C	216	ENSP00000270509:R216C	ENSP00000270509:R216C	R	-	1	0	FBN3	8112917	0.996000	0.38824	0.462000	0.27118	0.992000	0.81027	3.679000	0.54634	2.028000	0.59812	0.491000	0.48974	CGT	.		0.652	FBN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000461428.2	NM_032447	
MYO1F	4542	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	19	8587291	8587291	+	Missense_Mutation	SNP	C	C	T	rs376380813		TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr19:8587291C>T	ENST00000338257.8	-	27	3457	c.3190G>A	c.(3190-3192)Gtg>Atg	p.V1064M		NM_012335.3	NP_036467.2	O00160	MYO1F_HUMAN	myosin IF	1064	SH3. {ECO:0000255|PROSITE- ProRule:PRU00192}.				defense response to Gram-positive bacterium (GO:0050830)|negative regulation of cell adhesion (GO:0007162)|neutrophil degranulation (GO:0043312)|positive regulation of cell migration (GO:0030335)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of innate immune response (GO:0045088)	cortical actin cytoskeleton (GO:0030864)|filamentous actin (GO:0031941)|unconventional myosin complex (GO:0016461)	actin binding (GO:0003779)|ATP binding (GO:0005524)|motor activity (GO:0003774)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|kidney(6)|large_intestine(7)|lung(13)|ovary(3)|prostate(3)|skin(3)|urinary_tract(1)	42						ACCTCGTTCACGTTGAAGCTC	0.622																																					p.V1064M		.											.	MYO1F-93	0			c.G3190A						.	C	MET/VAL	0,4246		0,0,2123	70.0	73.0	72.0		3190	5.5	0.9	19		72	1,8459		0,1,4229	no	missense	MYO1F	NM_012335.3	21	0,1,6352	TT,TC,CC		0.0118,0.0,0.0079	possibly-damaging	1064/1099	8587291	1,12705	2123	4230	6353	SO:0001583	missense	4542	exon27			CGTTCACGTTGAA	X98411	CCDS42494.1	19p13.3-p13.2	2011-09-27			ENSG00000142347	ENSG00000142347		"""Myosins / Myosin superfamily : Class I"""	7600	protein-coding gene	gene with protein product		601480				9119401, 8884266	Standard	NM_012335		Approved		uc002mkg.3	O00160	OTTHUMG00000156005	ENST00000338257.8:c.3190G>A	19.37:g.8587291C>T	ENSP00000344871:p.Val1064Met	Somatic	91	0		WXS	Illumina GAIIx	Phase_I	259	13	NM_012335	0	0	4	4	0	Q8WWN7	Missense_Mutation	SNP	ENST00000338257.8	37	CCDS42494.1	.	.	.	.	.	.	.	.	.	.	C	18.55	3.647973	0.67358	0.0	1.18E-4	ENSG00000142347	ENST00000338257	T	0.31247	1.5	5.5	5.5	0.81552	Src homology-3 domain (5);	.	.	.	.	T	0.41811	0.1175	M	0.61703	1.905	0.53688	D	0.999975	P	0.42123	0.771	P	0.45474	0.482	T	0.24225	-1.0166	9	0.48119	T	0.1	.	18.3775	0.90440	0.0:1.0:0.0:0.0	.	1064	O00160	MYO1F_HUMAN	M	1064	ENSP00000344871:V1064M	ENSP00000344871:V1064M	V	-	1	0	MYO1F	8493291	0.993000	0.37304	0.945000	0.38365	0.699000	0.40488	3.317000	0.51968	2.572000	0.86782	0.650000	0.86243	GTG	.		0.622	MYO1F-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000342716.2		
ICAM1	3383	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	10394443	10394443	+	Silent	SNP	C	C	A			TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr19:10394443C>A	ENST00000264832.3	+	3	943	c.618C>A	c.(616-618)ccC>ccA	p.P206P	CTD-2369P2.5_ENST00000592893.1_RNA|ICAM1_ENST00000423829.2_Intron|CTD-2369P2.8_ENST00000589379.1_RNA	NM_000201.2	NP_000192.2	P05362	ICAM1_HUMAN	intercellular adhesion molecule 1	206					adhesion of symbiont to host (GO:0044406)|cell adhesion (GO:0007155)|cell adhesion mediated by integrin (GO:0033627)|cell aging (GO:0007569)|cellular response to alkaloid (GO:0071312)|cellular response to glucose stimulus (GO:0071333)|cellular response to hypoxia (GO:0071456)|cellular response to interleukin-1 (GO:0071347)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to nutrient levels (GO:0031669)|cellular response to tumor necrosis factor (GO:0071356)|cytokine-mediated signaling pathway (GO:0019221)|establishment of endothelial barrier (GO:0061028)|extracellular matrix organization (GO:0030198)|heterophilic cell-cell adhesion (GO:0007157)|interferon-gamma-mediated signaling pathway (GO:0060333)|leukocyte cell-cell adhesion (GO:0007159)|leukocyte migration (GO:0050900)|membrane to membrane docking (GO:0022614)|negative regulation of calcium ion transport (GO:0051926)|negative regulation of endothelial cell apoptotic process (GO:2000352)|negative regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902042)|ovarian follicle development (GO:0001541)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of cellular extravasation (GO:0002693)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of Rho GTPase activity (GO:0032321)|positive regulation of vasoconstriction (GO:0045907)|receptor-mediated virion attachment to host cell (GO:0046813)|regulation of cell adhesion (GO:0030155)|regulation of cell shape (GO:0008360)|regulation of immune response (GO:0050776)|regulation of leukocyte mediated cytotoxicity (GO:0001910)|regulation of ruffle assembly (GO:1900027)|response to amino acid (GO:0043200)|response to amphetamine (GO:0001975)|response to copper ion (GO:0046688)|response to drug (GO:0042493)|response to ethanol (GO:0045471)|response to gonadotropin (GO:0034698)|response to ionizing radiation (GO:0010212)|response to organic cyclic compound (GO:0014070)|response to sulfur dioxide (GO:0010477)|T cell activation via T cell receptor contact with antigen bound to MHC molecule on antigen presenting cell (GO:0002291)|T cell antigen processing and presentation (GO:0002457)	cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|immunological synapse (GO:0001772)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	integrin binding (GO:0005178)|receptor activity (GO:0004872)|transmembrane signaling receptor activity (GO:0004888)|virus receptor activity (GO:0001618)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(4)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	14			OV - Ovarian serous cystadenocarcinoma(20;1.39e-09)|Epithelial(33;2.81e-06)|all cancers(31;6.56e-06)		Hyaluronan(DB08818)|Natalizumab(DB00108)	CCTCGGCCCCCTACCAGCTCC	0.592																																					p.P206P		.											.	ICAM1-91	0			c.C618A						.						17.0	17.0	17.0					19																	10394443		2203	4300	6503	SO:0001819	synonymous_variant	3383	exon3			GGCCCCCTACCAG		CCDS12231.1	19p13.3-p13.2	2014-01-30	2008-07-18			ENSG00000090339		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Endogenous ligands"""	5344	protein-coding gene	gene with protein product	"""human rhinovirus receptor"""	147840				2453850, 3871395	Standard	NM_000201		Approved	BB2, CD54	uc002mnq.2	P05362		ENST00000264832.3:c.618C>A	19.37:g.10394443C>A		Somatic	57	0		WXS	Illumina GAIIx	Phase_I	100	39	NM_000201	0	0	2	2	0	B2R6M3|Q5NKV7|Q96B50	Silent	SNP	ENST00000264832.3	37	CCDS12231.1																																																																																			.		0.592	ICAM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451207.1		
S1PR5	53637	broad.mit.edu;bcgsc.ca	37	19	10624719	10624719	+	Nonsense_Mutation	SNP	G	G	T			TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr19:10624719G>T	ENST00000439028.3	-	2	1094	c.969C>A	c.(967-969)tgC>tgA	p.C323*	S1PR5_ENST00000333430.4_Nonsense_Mutation_p.C323*	NM_001166215.1	NP_001159687.1	Q9H228	S1PR5_HUMAN	sphingosine-1-phosphate receptor 5	323					regulation of neuron differentiation (GO:0045664)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	sphingosine-1-phosphate receptor activity (GO:0038036)			central_nervous_system(1)|endometrium(2)|large_intestine(1)|lung(5)|ovary(1)|pancreas(1)|prostate(1)	12					Fingolimod(DB08868)	AGTGGCGTCCGCAGCAGACCA	0.706																																					p.C323X		.											.	S1PR5-523	0			c.C969A						.						22.0	24.0	23.0					19																	10624719		2199	4297	6496	SO:0001587	stop_gained	53637	exon2			GCGTCCGCAGCAG	AK074661	CCDS12240.1	19p13.2	2012-08-08	2008-04-30	2008-04-30		ENSG00000180739		"""GPCR / Class A : Lysophospholipid receptors : Sphingosine 1-phosphate"""	14299	protein-coding gene	gene with protein product		605146	"""endothelial differentiation, sphingolipid G-protein-coupled receptor, 8"""	EDG8		10799507	Standard	NM_030760		Approved	Edg-8	uc002mou.2	Q9H228		ENST00000439028.3:c.969C>A	19.37:g.10624719G>T	ENSP00000416915:p.Cys323*	Somatic	44	0		WXS	Illumina GAIIx	Phase_I	193	6	NM_030760	0	0	0	0	0	Q6NW11	Nonsense_Mutation	SNP	ENST00000439028.3	37	CCDS12240.1	.	.	.	.	.	.	.	.	.	.	G	18.97	3.736103	0.69189	.	.	ENSG00000180739	ENST00000439028;ENST00000333430	.	.	.	5.11	-4.22	0.03800	.	0.299750	0.30879	U	0.008689	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	12.5494	0.56218	0.6384:0.0:0.3616:0.0	.	.	.	.	X	323	.	ENSP00000328472:C323X	C	-	3	2	S1PR5	10485719	1.000000	0.71417	0.138000	0.22173	0.035000	0.12851	0.573000	0.23699	-0.589000	0.05874	-0.658000	0.03865	TGC	.		0.706	S1PR5-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452015.1	NM_030760	
TMED1	11018	broad.mit.edu	37	19	10946806	10946806	+	Missense_Mutation	SNP	A	A	C			TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr19:10946806A>C	ENST00000214869.2	-	1	160	c.62T>G	c.(61-63)gTg>gGg	p.V21G	TMED1_ENST00000588289.1_5'Flank|C19orf38_ENST00000592854.1_5'Flank|TMED1_ENST00000591695.1_Missense_Mutation_p.V21G	NM_006858.2	NP_006849.1	Q13445	TMED1_HUMAN	transmembrane emp24 protein transport domain containing 1	21					cell-cell signaling (GO:0007267)|protein transport (GO:0015031)|signal transduction (GO:0007165)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	receptor binding (GO:0005102)			breast(1)|central_nervous_system(2)|lung(2)|ovary(3)|prostate(1)|skin(1)	10						CGCCCCTCCCACCTCCACTGG	0.682																																					p.V21G		.											.	TMED1-155	0			c.T62G						.						7.0	8.0	7.0					19																	10946806		2142	4189	6331	SO:0001583	missense	11018	exon1			CCTCCCACCTCCA	U41804	CCDS12249.1	19p13.2	2008-02-05	2005-08-26			ENSG00000099203			17291	protein-coding gene	gene with protein product		605395	"""transmembrane emp24 domain containing 1"""			11466339, 8621446	Standard	NM_006858		Approved	ST2L, MGC1270, IL1RL1LG, Il1rl1l	uc002mpy.3	Q13445		ENST00000214869.2:c.62T>G	19.37:g.10946806A>C	ENSP00000214869:p.Val21Gly	Somatic	55	5		WXS	Illumina GAIIx	Phase_I	155	30	NM_006858	0	0	10	10	0		Missense_Mutation	SNP	ENST00000214869.2	37	CCDS12249.1	.	.	.	.	.	.	.	.	.	.	A	5.417	0.262161	0.10239	.	.	ENSG00000099203	ENST00000214869	T	0.32023	1.47	4.73	2.55	0.30701	.	0.428864	0.20045	N	0.100436	T	0.11965	0.0291	N	0.08118	0	0.09310	N	0.999992	B	0.02656	0.0	B	0.04013	0.001	T	0.12192	-1.0557	10	0.24483	T	0.36	-7.5505	3.3292	0.07077	0.6091:0.2245:0.1663:0.0	.	21	Q13445	TMED1_HUMAN	G	21	ENSP00000214869:V21G	ENSP00000214869:V21G	V	-	2	0	TMED1	10807806	0.000000	0.05858	0.012000	0.15200	0.016000	0.09150	0.496000	0.22499	1.996000	0.58369	0.533000	0.62120	GTG	.		0.682	TMED1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452614.1	NM_006858	
LPHN1	22859	hgsc.bcm.edu;bcgsc.ca	37	19	14272167	14272167	+	Silent	SNP	C	C	T			TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr19:14272167C>T	ENST00000340736.6	-	7	1779	c.1482G>A	c.(1480-1482)caG>caA	p.Q494Q	CTB-55O6.12_ENST00000588387.1_RNA|CTB-55O6.12_ENST00000592086.1_RNA|LPHN1_ENST00000591528.1_5'Flank|LPHN1_ENST00000361434.3_Silent_p.Q489Q	NM_001008701.2	NP_001008701.1	O94910	LPHN1_HUMAN	latrophilin 1	494					calcium-mediated signaling using intracellular calcium source (GO:0035584)|G-protein coupled receptor signaling pathway (GO:0007186)|heterophilic cell-cell adhesion (GO:0007157)|neuropeptide signaling pathway (GO:0007218)|positive regulation of synapse maturation (GO:0090129)	axon (GO:0030424)|cell junction (GO:0030054)|growth cone (GO:0030426)|integral component of membrane (GO:0016021)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)|presynaptic membrane (GO:0042734)|synapse (GO:0045202)	carbohydrate binding (GO:0030246)|cell adhesion molecule binding (GO:0050839)|G-protein coupled receptor activity (GO:0004930)|latrotoxin receptor activity (GO:0016524)			central_nervous_system(1)|cervix(2)|endometrium(6)|kidney(1)|large_intestine(3)|liver(1)|lung(10)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	32						GCATGCCCTGCTGGGTGGCCG	0.701																																					p.Q494Q		.											.	LPHN1-523	0			c.G1482A						.						10.0	12.0	11.0					19																	14272167		2170	4251	6421	SO:0001819	synonymous_variant	22859	exon7			GCCCTGCTGGGTG	AB020628	CCDS12307.1, CCDS32928.1	19p13.2	2014-08-08				ENSG00000072071		"""-"", ""GPCR / Class B : Orphans"""	20973	protein-coding gene	gene with protein product						10994649	Standard	NM_014921		Approved	KIAA0821, CIRL1, LEC2	uc010xnn.2	O94910		ENST00000340736.6:c.1482G>A	19.37:g.14272167C>T		Somatic	34	0		WXS	Illumina GAIIx	Phase_I	142	64	NM_001008701	0	0	1	4	3	Q96IE7|Q9BU07|Q9HAR3	Silent	SNP	ENST00000340736.6	37	CCDS32928.1																																																																																			.		0.701	LPHN1-001	KNOWN	overlapping_uORF|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000459696.1	NM_014921	
CD97	976	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	14515325	14515325	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr19:14515325G>A	ENST00000242786.5	+	13	1660	c.1580G>A	c.(1579-1581)tGc>tAc	p.C527Y	CTC-548K16.5_ENST00000590626.1_RNA|CD97_ENST00000357355.3_Missense_Mutation_p.C478Y|CD97_ENST00000358600.3_Missense_Mutation_p.C434Y	NM_078481.3	NP_510966.1	P48960	CD97_HUMAN	CD97 molecule	527	GPS. {ECO:0000255|PROSITE- ProRule:PRU00098}.				cell adhesion (GO:0007155)|cell surface receptor signaling pathway (GO:0007166)|cell-cell signaling (GO:0007267)|cellular component movement (GO:0006928)|G-protein coupled receptor signaling pathway (GO:0007186)|immune response (GO:0006955)|inflammatory response (GO:0006954)|neuropeptide signaling pathway (GO:0007218)	extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)|transmembrane signaling receptor activity (GO:0004888)			breast(2)|endometrium(3)|kidney(1)|large_intestine(6)|liver(1)|lung(9)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	30						ACCTGCCAATGCAGCCACCTG	0.597																																					p.C527Y		.											.	CD97-570	0			c.G1580A						.						74.0	63.0	67.0					19																	14515325		2203	4300	6503	SO:0001583	missense	976	exon13			GCCAATGCAGCCA		CCDS32929.1, CCDS32930.1, CCDS32931.1	19p13	2014-08-08	2006-03-28			ENSG00000123146		"""CD molecules"", ""-"", ""GPCR / Class B : Orphans"""	1711	protein-coding gene	gene with protein product	"""leukocyte antigen CD97"", ""seven-span transmembrane protein"", ""seven-transmembrane, heterodimeric receptor associated with inflammation"", ""seven transmembrane helix receptor"""	601211	"""CD97 antigen"""			7636245, 8786105	Standard	NM_078481		Approved	TM7LN1	uc002myl.3	P48960		ENST00000242786.5:c.1580G>A	19.37:g.14515325G>A	ENSP00000242786:p.Cys527Tyr	Somatic	101	0		WXS	Illumina GAIIx	Phase_I	261	54	NM_078481	0	0	1	1	0	A8K7Z4|B2RBJ9|O00718|O76101|Q8NG72|Q8TBQ7	Missense_Mutation	SNP	ENST00000242786.5	37	CCDS32929.1	.	.	.	.	.	.	.	.	.	.	G	28.9	4.962429	0.92791	.	.	ENSG00000123146	ENST00000242786;ENST00000357355;ENST00000358600;ENST00000393059	D;D;D	0.90788	-2.73;-2.73;-2.73	4.85	4.85	0.62838	GPS domain (3);	.	.	.	.	D	0.97155	0.9070	H	0.98178	4.165	0.58432	D	0.999997	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.994;0.996;0.999	D	0.98372	1.0554	9	0.87932	D	0	.	15.4798	0.75517	0.0:0.0:1.0:0.0	.	434;478;527	P48960-2;P48960-3;P48960	.;.;CD97_HUMAN	Y	527;478;434;477	ENSP00000242786:C527Y;ENSP00000349918:C478Y;ENSP00000351413:C434Y	ENSP00000242786:C527Y	C	+	2	0	CD97	14376325	1.000000	0.71417	0.084000	0.20598	0.604000	0.37047	9.054000	0.93866	2.532000	0.85374	0.561000	0.74099	TGC	.		0.597	CD97-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000459821.2	NM_078481	
EMR2	30817	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	14854448	14854448	+	Missense_Mutation	SNP	A	A	G			TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr19:14854448A>G	ENST00000315576.3	-	19	2783	c.2332T>C	c.(2332-2334)Tac>Cac	p.Y778H	EMR2_ENST00000353005.1_Missense_Mutation_p.Y636H|EMR2_ENST00000595839.1_Missense_Mutation_p.Y636H|EMR2_ENST00000392967.2_Missense_Mutation_p.Y767H|EMR2_ENST00000594294.1_Missense_Mutation_p.Y729H|EMR2_ENST00000353876.1_Missense_Mutation_p.Y685H|EMR2_ENST00000392965.3_Missense_Mutation_p.Y720H|EMR2_ENST00000601345.1_Missense_Mutation_p.Y767H|EMR2_ENST00000346057.1_Missense_Mutation_p.Y729H|EMR2_ENST00000594076.1_Missense_Mutation_p.Y685H|EMR2_ENST00000596991.2_Missense_Mutation_p.Y767H	NM_013447.3	NP_038475.2	Q9UHX3	EMR2_HUMAN	egf-like module containing, mucin-like, hormone receptor-like 2	778					cell adhesion (GO:0007155)|cell migration (GO:0016477)|G-protein coupled receptor signaling pathway (GO:0007186)|granulocyte chemotaxis (GO:0071621)|inflammatory response (GO:0006954)|neuropeptide signaling pathway (GO:0007218)	cell projection (GO:0042995)|integral component of membrane (GO:0016021)|leading edge membrane (GO:0031256)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|chondroitin sulfate binding (GO:0035374)|G-protein coupled receptor activity (GO:0004930)			breast(1)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(8)|lung(19)|ovary(1)|prostate(2)|skin(6)|upper_aerodigestive_tract(1)	48						AGGAGGCAGTACACCAGGAAG	0.597																																					p.Y778H		.											.	EMR2-524	0			c.T2332C						.						169.0	153.0	158.0					19																	14854448		2203	4300	6503	SO:0001583	missense	30817	exon19			GGCAGTACACCAG	AF114491	CCDS32935.1, CCDS59361.1	19p13.1	2014-08-08	2003-11-26			ENSG00000127507		"""CD molecules"", ""-"", ""GPCR / Class B : Orphans"""	3337	protein-coding gene	gene with protein product		606100	"""egf-like module containing, mucin-like, hormone receptor-like sequence 2"""				Standard	NM_013447		Approved	CD312	uc002mzp.2	Q9UHX3		ENST00000315576.3:c.2332T>C	19.37:g.14854448A>G	ENSP00000319883:p.Tyr778His	Somatic	245	0		WXS	Illumina GAIIx	Phase_I	454	87	NM_013447	0	0	0	0	0	B4DQ96|E7ESD7|E9PBR1|E9PEL6|E9PFQ5|E9PG91|Q8NG96|Q9Y4B1	Missense_Mutation	SNP	ENST00000315576.3	37	CCDS32935.1	.	.	.	.	.	.	.	.	.	.	A	8.012	0.757820	0.15846	.	.	ENSG00000127507	ENST00000315576;ENST00000392967;ENST00000346057;ENST00000353876;ENST00000353005;ENST00000392965	T;T;T;T;T;T	0.61859	0.07;0.07;0.07;0.07;0.07;0.07	5.21	4.19	0.49359	GPCR, family 2-like (1);GPCR, family 2, secretin-like, conserved site (1);	.	.	.	.	T	0.33030	0.0849	N	0.16602	0.42	0.80722	D	1	B;B;P;B;B;B;B;B	0.42078	0.09;0.002;0.77;0.006;0.033;0.001;0.019;0.012	B;B;B;B;B;B;B;B	0.40134	0.047;0.016;0.32;0.02;0.048;0.009;0.047;0.065	T	0.38757	-0.9646	9	0.02654	T	1	.	6.5892	0.22638	0.8123:0.0:0.1877:0.0	.	720;685;778;636;729;778;778;767	E7ESD7;Q9UHX3-4;A0JNV7;Q9UHX3-5;Q9UHX3-3;A8K6W1;Q9UHX3;Q9UHX3-2	.;.;.;.;.;.;EMR2_HUMAN;.	H	778;767;729;685;636;720	ENSP00000319883:Y778H;ENSP00000376694:Y767H;ENSP00000263380:Y729H;ENSP00000319454:Y685H;ENSP00000319838:Y636H;ENSP00000376692:Y720H	ENSP00000319883:Y778H	Y	-	1	0	EMR2	14715448	1.000000	0.71417	0.961000	0.40146	0.959000	0.62525	2.493000	0.45320	0.835000	0.34877	0.491000	0.48974	TAC	.		0.597	EMR2-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000466502.2		
AKAP8	10270	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	19	15484604	15484604	+	Missense_Mutation	SNP	G	G	A	rs140271912		TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr19:15484604G>A	ENST00000269701.2	-	4	424	c.364C>T	c.(364-366)Cgg>Tgg	p.R122W		NM_005858.3	NP_005849.1	O43823	AKAP8_HUMAN	A kinase (PRKA) anchor protein 8	122					mitotic chromosome condensation (GO:0007076)|mitotic nuclear division (GO:0007067)|signal transduction (GO:0007165)	condensed chromosome (GO:0000793)|female pronucleus (GO:0001939)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nuclear matrix (GO:0016363)|nucleus (GO:0005634)	double-stranded DNA binding (GO:0003690)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			breast(2)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|kidney(1)|large_intestine(5)|lung(6)|ovary(2)	26						CACCTCTCCCGGTCCTGTATG	0.637																																					p.R122W	GBM(190;1671 2163 3274 27186 30476)	.											.	AKAP8-290	0			c.C364T						.		TRP/ARG	0,4404		0,0,2202	25.0	23.0	24.0		364	4.8	1.0	19	dbSNP_134	24	2,8598	2.2+/-6.3	0,2,4298	yes	missense	AKAP8	NM_005858.3	101	0,2,6500	AA,AG,GG		0.0233,0.0,0.0154	probably-damaging	122/693	15484604	2,13002	2202	4300	6502	SO:0001583	missense	10270	exon4			TCTCCCGGTCCTG	Y11997	CCDS12329.1	19p13.12	2012-05-16			ENSG00000105127	ENSG00000105127		"""A-kinase anchor proteins"""	378	protein-coding gene	gene with protein product	"""A-kinase anchor protein, 95kDa"""	604692				9473338	Standard	NM_005858		Approved	AKAP95, DKFZp586B1222	uc002nav.3	O43823		ENST00000269701.2:c.364C>T	19.37:g.15484604G>A	ENSP00000269701:p.Arg122Trp	Somatic	37	0		WXS	Illumina GAIIx	Phase_I	78	35	NM_005858	0	0	0	0	0		Missense_Mutation	SNP	ENST00000269701.2	37	CCDS12329.1	.	.	.	.	.	.	.	.	.	.	g	22.8	4.342897	0.82022	0.0	2.33E-4	ENSG00000105127	ENST00000269701	T	0.48836	0.8	4.82	4.82	0.62117	.	0.150595	0.31450	N	0.007637	T	0.59376	0.2189	L	0.51422	1.61	0.80722	D	1	D	0.89917	1.0	P	0.60415	0.874	T	0.62905	-0.6755	10	0.72032	D	0.01	-13.1424	15.1765	0.72916	0.0:0.0:1.0:0.0	.	122	O43823	AKAP8_HUMAN	W	122	ENSP00000269701:R122W	ENSP00000269701:R122W	R	-	1	2	AKAP8	15345604	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	5.577000	0.67444	2.392000	0.81423	0.651000	0.88453	CGG	G|1.000;A|0.000		0.637	AKAP8-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000461293.3	NM_005858	
OR10H5	284433	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	15905080	15905080	+	Silent	SNP	C	C	T	rs201176627		TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr19:15905080C>T	ENST00000308940.8	+	1	320	c.222C>T	c.(220-222)acC>acT	p.T74T		NM_001004466.1	NP_001004466.1	Q8NGA6	O10H5_HUMAN	olfactory receptor, family 10, subfamily H, member 5	74						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(3)|liver(1)|lung(9)|ovary(1)	20						TCCTCTACACCGTGGCCATCA	0.612																																					p.T74T		.											.	OR10H5-69	0			c.C222T						.	C		0,4406		0,0,2203	158.0	129.0	139.0		222	-4.0	0.0	19		139	1,8599		0,1,4299	no	coding-synonymous	OR10H5	NM_001004466.1		0,1,6502	TT,TC,CC		0.0116,0.0,0.0077		74/316	15905080	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	284433	exon1			CTACACCGTGGCC	AC011537	CCDS32940.1	19p13.12	2013-09-24			ENSG00000172519	ENSG00000172519		"""GPCR / Class A : Olfactory receptors"""	15389	protein-coding gene	gene with protein product							Standard	NM_001004466		Approved		uc010xos.2	Q8NGA6	OTTHUMG00000182284	ENST00000308940.8:c.222C>T	19.37:g.15905080C>T		Somatic	338	3		WXS	Illumina GAIIx	Phase_I	766	330	NM_001004466	0	0	0	0	0	Q6IFJ0|Q96R60	Silent	SNP	ENST00000308940.8	37	CCDS32940.1																																																																																			C|0.999;T|0.001		0.612	OR10H5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000460363.1		
SLC5A5	6528	broad.mit.edu;bcgsc.ca	37	19	17994831	17994831	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr19:17994831C>T	ENST00000222248.3	+	12	1849	c.1502C>T	c.(1501-1503)gCt>gTt	p.A501V		NM_000453.2	NP_000444.1	Q92911	SC5A5_HUMAN	solute carrier family 5 (sodium/iodide cotransporter), member 5	501					cellular nitrogen compound metabolic process (GO:0034641)|cellular response to cAMP (GO:0071320)|cellular response to gonadotropin stimulus (GO:0071371)|iodide transport (GO:0015705)|ion transport (GO:0006811)|small molecule metabolic process (GO:0044281)|thyroid hormone generation (GO:0006590)|transmembrane transport (GO:0055085)|transport (GO:0006810)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|vesicle (GO:0031982)	iodide transmembrane transporter activity (GO:0015111)|sodium:iodide symporter activity (GO:0008507)			NS(2)|biliary_tract(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|large_intestine(6)|lung(13)|ovary(1)|prostate(1)|skin(3)	31						CTCCTCCCTGCTAACGACTCC	0.642																																					p.A501V	Melanoma(65;1008 1708 7910 46650)	.											.	SLC5A5-93	0			c.C1502T						.						8.0	7.0	8.0					19																	17994831		2184	4266	6450	SO:0001583	missense	6528	exon12			TCCCTGCTAACGA		CCDS12368.1	19p13.11	2013-07-19	2013-07-19		ENSG00000105641	ENSG00000105641		"""Solute carriers"""	11040	protein-coding gene	gene with protein product		601843	"""solute carrier family 5 (sodium iodide symporter), member 5"""			9231811	Standard	NM_000453		Approved	NIS	uc002nhr.4	Q92911		ENST00000222248.3:c.1502C>T	19.37:g.17994831C>T	ENSP00000222248:p.Ala501Val	Somatic	68	2		WXS	Illumina GAIIx	Phase_I	162	76	NM_000453	0	0	0	0	0	O43702|Q2M335|Q9NYB6	Missense_Mutation	SNP	ENST00000222248.3	37	CCDS12368.1	.	.	.	.	.	.	.	.	.	.	C	7.683	0.689512	0.14973	.	.	ENSG00000105641	ENST00000222248	D	0.85171	-1.95	4.43	0.741	0.18336	.	4.969260	0.01041	N	0.004309	T	0.75199	0.3817	L	0.29908	0.895	0.09310	N	1	B	0.02656	0.0	B	0.06405	0.002	T	0.55982	-0.8054	10	0.20519	T	0.43	.	2.7012	0.05149	0.1895:0.5217:0.1841:0.1048	.	501	Q92911	SC5A5_HUMAN	V	501	ENSP00000222248:A501V	ENSP00000222248:A501V	A	+	2	0	SLC5A5	17855831	0.000000	0.05858	0.019000	0.16419	0.008000	0.06430	-1.102000	0.03332	0.420000	0.25954	0.555000	0.69702	GCT	.		0.642	SLC5A5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466690.1		
ARRDC2	27106	broad.mit.edu	37	19	18119374	18119374	+	Silent	SNP	C	C	T			TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr19:18119374C>T	ENST00000222250.4	+	1	398	c.255C>T	c.(253-255)cgC>cgT	p.R85R	ARRDC2_ENST00000608009.1_3'UTR|ARRDC2_ENST00000379656.3_Intron	NM_015683.1	NP_056498.1	Q8TBH0	ARRD2_HUMAN	arrestin domain containing 2	85					signal transduction (GO:0007165)	cytoplasmic vesicle (GO:0031410)|plasma membrane (GO:0005886)				endometrium(1)|large_intestine(2)|lung(7)|pancreas(1)|prostate(1)	12						TGAGCCACCGCGCCACGCTCC	0.697																																					p.R85R		.											.	ARRDC2-91	0			c.C255T						.						12.0	14.0	13.0					19																	18119374		2191	4279	6470	SO:0001819	synonymous_variant	27106	exon1			CCACCGCGCCACG		CCDS12370.1, CCDS32956.1	19p13.12	2008-02-05				ENSG00000105643			25225	protein-coding gene	gene with protein product						8619474, 9110174	Standard	NM_015683		Approved	CLONE24945, PP2703	uc002nhv.3	Q8TBH0		ENST00000222250.4:c.255C>T	19.37:g.18119374C>T		Somatic	16	0		WXS	Illumina GAIIx	Phase_I	30	4	NM_015683	0	0	10	12	2	B2RBG9|O95895|Q6ZRV9|Q8WYG6	Silent	SNP	ENST00000222250.4	37	CCDS12370.1																																																																																			.		0.697	ARRDC2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466845.1	NM_015683	
TMEM161A	54929	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	19243492	19243492	+	Missense_Mutation	SNP	C	C	A			TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr19:19243492C>A	ENST00000162044.9	-	4	324	c.260G>T	c.(259-261)tGc>tTc	p.C87F	TMEM161A_ENST00000587583.2_Missense_Mutation_p.C87F|TMEM161A_ENST00000450333.2_Missense_Mutation_p.C87F|TMEM161A_ENST00000592147.1_5'UTR	NM_017814.2	NP_060284.1	Q9NX61	T161A_HUMAN	transmembrane protein 161A	87					cellular response to oxidative stress (GO:0034599)|cellular response to UV (GO:0034644)|negative regulation of intrinsic apoptotic signaling pathway in response to DNA damage (GO:1902230)|positive regulation of DNA repair (GO:0045739)|response to retinoic acid (GO:0032526)	integral component of membrane (GO:0016021)				breast(2)|central_nervous_system(1)|endometrium(1)|large_intestine(3)|lung(4)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	15			OV - Ovarian serous cystadenocarcinoma(5;1.19e-05)|Epithelial(12;0.0011)			CGTGAGGGGGCAGGTCTCCAG	0.617																																					p.C87F		.											.	TMEM161A-154	0			c.G260T						.						81.0	60.0	68.0					19																	19243492		2203	4300	6503	SO:0001583	missense	54929	exon4			AGGGGGCAGGTCT	BC005210	CCDS12393.1, CCDS58656.1	19p13.11	2008-02-05				ENSG00000064545			26020	protein-coding gene	gene with protein product						12975309	Standard	NM_017814		Approved	FLJ39645, FLJ20422	uc002nlg.4	Q9NX61		ENST00000162044.9:c.260G>T	19.37:g.19243492C>A	ENSP00000162044:p.Cys87Phe	Somatic	59	0		WXS	Illumina GAIIx	Phase_I	119	20	NM_001256766	0	0	122	152	30	B3KUE0|G5E9M6|Q7L2Y1	Missense_Mutation	SNP	ENST00000162044.9	37	CCDS12393.1	.	.	.	.	.	.	.	.	.	.	C	10.62	1.401835	0.25291	.	.	ENSG00000064545	ENST00000450333;ENST00000162044	.	.	.	4.31	3.25	0.37280	.	0.325571	0.34603	N	0.003836	T	0.37839	0.1018	N	0.22421	0.69	0.32043	N	0.598034	P;P;D	0.55385	0.924;0.938;0.971	P;P;P	0.55161	0.461;0.477;0.77	T	0.46978	-0.9152	9	0.62326	D	0.03	-4.6908	6.3317	0.21274	0.0:0.7075:0.1897:0.1028	.	87;87;87	G5E9M6;B3KUE0;Q9NX61	.;.;T161A_HUMAN	F	87	.	ENSP00000162044:C87F	C	-	2	0	TMEM161A	19104492	0.487000	0.25988	0.998000	0.56505	0.045000	0.14185	1.000000	0.29770	0.920000	0.36970	-0.304000	0.09214	TGC	.		0.617	TMEM161A-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000460089.2	NM_017814	
SLC7A10	56301	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	33706703	33706703	+	Missense_Mutation	SNP	C	C	T	rs551036567		TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr19:33706703C>T	ENST00000253188.4	-	2	474	c.328G>A	c.(328-330)Gtc>Atc	p.V110I	CTD-2540B15.6_ENST00000590492.1_RNA	NM_019849.2	NP_062823.1	Q9NS82	AAA1_HUMAN	solute carrier family 7 (neutral amino acid transporter light chain, asc system), member 10	110					amino acid transport (GO:0006865)|blood coagulation (GO:0007596)|D-alanine transport (GO:0042941)|D-serine transport (GO:0042942)|ion transport (GO:0006811)|L-serine transport (GO:0015825)|leukocyte migration (GO:0050900)|neutral amino acid transport (GO:0015804)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	L-serine transmembrane transporter activity (GO:0015194)|neutral amino acid transmembrane transporter activity (GO:0015175)			central_nervous_system(1)|kidney(1)|large_intestine(4)|lung(8)|ovary(2)|skin(1)|stomach(1)	18	Esophageal squamous(110;0.137)					ATCTCTGTGACGTAGGCGTAG	0.657																																					p.V110I		.											.	SLC7A10-91	0			c.G328A						.						37.0	32.0	34.0					19																	33706703		2178	4281	6459	SO:0001583	missense	56301	exon2			CTGTGACGTAGGC	AB037670	CCDS12431.1	19q13.11	2013-05-28	2011-07-12		ENSG00000130876	ENSG00000130876		"""Solute carriers"""	11058	protein-coding gene	gene with protein product		607959				10734121, 10863037	Standard	NM_019849		Approved	asc-1	uc002num.2	Q9NS82	OTTHUMG00000180344	ENST00000253188.4:c.328G>A	19.37:g.33706703C>T	ENSP00000253188:p.Val110Ile	Somatic	85	0		WXS	Illumina GAIIx	Phase_I	158	36	NM_019849	0	0	0	0	0	B2RE84	Missense_Mutation	SNP	ENST00000253188.4	37	CCDS12431.1	.	.	.	.	.	.	.	.	.	.	C	12.53	1.965812	0.34659	.	.	ENSG00000130876	ENST00000253188	D	0.90069	-2.61	4.79	4.79	0.61399	Amino acid permease domain (1);	0.062472	0.64402	D	0.000005	T	0.81791	0.4897	N	0.16233	0.39	0.80722	D	1	P	0.49696	0.927	P	0.46796	0.527	T	0.80195	-0.1483	10	0.02654	T	1	.	16.8665	0.86030	0.0:1.0:0.0:0.0	.	110	Q9NS82	AAA1_HUMAN	I	110	ENSP00000253188:V110I	ENSP00000253188:V110I	V	-	1	0	SLC7A10	38398543	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	6.089000	0.71384	2.240000	0.73641	0.456000	0.33151	GTC	.		0.657	SLC7A10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000450846.2	NM_019849	
COX6B1	1340	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	36145482	36145482	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr19:36145482G>A	ENST00000592141.1	+	3	381	c.116G>A	c.(115-117)cGc>cAc	p.R39H	COX6B1_ENST00000246554.3_Missense_Mutation_p.R39H|COX6B1_ENST00000392201.1_Missense_Mutation_p.R39H			P14854	CX6B1_HUMAN	cytochrome c oxidase subunit VIb polypeptide 1 (ubiquitous)	39					cellular metabolic process (GO:0044237)|hydrogen ion transmembrane transport (GO:1902600)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)|substantia nigra development (GO:0021762)	mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	cytochrome-c oxidase activity (GO:0004129)			lung(6)|prostate(1)|stomach(1)	8	all_lung(56;2.22e-07)|Lung NSC(56;3.47e-07)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0515)			GACTTCCACCGCTGTCAGAAG	0.498																																					p.R39H		.											.	COX6B1-226	0			c.G116A						.						179.0	148.0	159.0					19																	36145482		2203	4300	6503	SO:0001583	missense	1340	exon3			TCCACCGCTGTCA	BC001015	CCDS12469.1	19q13.1	2011-07-04	2010-01-07	2004-08-12	ENSG00000126267	ENSG00000126267	1.9.3.1	"""Mitochondrial respiratory chain complex / Complex IV"""	2280	protein-coding gene	gene with protein product		124089	"""cytochrome c oxidase subunit Vib"", ""cytochrome c oxidase subunit Vib polypeptide 1 (ubiquitous)"""	COX6B		1650756	Standard	NM_001863		Approved	COXG	uc002oav.3	P14854	OTTHUMG00000048112	ENST00000592141.1:c.116G>A	19.37:g.36145482G>A	ENSP00000466818:p.Arg39His	Somatic	167	0		WXS	Illumina GAIIx	Phase_I	301	57	NM_001863	0	0	0	0	0	B2R5C9|Q6IBL4	Missense_Mutation	SNP	ENST00000592141.1	37	CCDS12469.1	.	.	.	.	.	.	.	.	.	.	G	17.35	3.368042	0.61513	.	.	ENSG00000126267	ENST00000246554;ENST00000392201	D	0.84370	-1.84	5.94	5.94	0.96194	.	0.000000	0.85682	D	0.000000	T	0.81711	0.4880	.	.	.	0.80722	D	1	B	0.16166	0.016	B	0.20955	0.032	T	0.76247	-0.3029	9	0.48119	T	0.1	-11.8118	15.8518	0.78937	0.0:0.0:1.0:0.0	.	39	P14854	CX6B1_HUMAN	H	39;56	ENSP00000246554:R39H	ENSP00000246554:R39H	R	+	2	0	COX6B1	40837322	1.000000	0.71417	1.000000	0.80357	0.587000	0.36485	8.061000	0.89467	2.818000	0.97014	0.650000	0.86243	CGC	.		0.498	COX6B1-004	KNOWN	alternative_5_UTR|upstream_ATG|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000459068.3	NM_001863	
KMT2B	9757	hgsc.bcm.edu;broad.mit.edu	37	19	36223002	36223002	+	Frame_Shift_Del	DEL	G	G	-			TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr19:36223002delG	ENST00000222270.7	+	27	5631	c.5631delG	c.(5629-5631)ttgfs	p.L1877fs	KMT2B_ENST00000420124.1_Frame_Shift_Del_p.L1877fs|KMT2B_ENST00000607650.1_RNA	NM_014727.1	NP_055542.1	Q9UMN6	KMT2B_HUMAN	lysine (K)-specific methyltransferase 2B	1877					chromatin-mediated maintenance of transcription (GO:0048096)|gene silencing (GO:0016458)|histone H3-K4 methylation (GO:0051568)|histone H3-K4 trimethylation (GO:0080182)|oocyte differentiation (GO:0009994)|ovarian follicle development (GO:0001541)|ovulation (GO:0030728)|regulation of histone H3-K4 methylation (GO:0051569)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)	p.G1881fs*16(1)									GGAGGCCCTTGGGGGGTGTCT	0.672																																					p.L1877fs		.											.	MLL4-697	1	Deletion - Frameshift(1)	large_intestine(1)	c.5631delG						.						11.0	12.0	12.0					19																	36223002		1860	4086	5946	SO:0001589	frameshift_variant	8085	exon27			GCCCTTGGGGGGT	AJ007041	CCDS46055.1	19q13.1	2014-02-18			ENSG00000105663	ENSG00000272333		"""Chromatin-modifying enzymes / K-methyltransferases"""	15840	protein-coding gene	gene with protein product	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila) 4"""	606834				10409430, 10637508	Standard	XM_006723513		Approved	KIAA0304, MLL2, TRX2, HRX2, WBP7, MLL1B, MLL4		Q9UMN6	OTTHUMG00000048119	ENST00000222270.7:c.5631delG	19.37:g.36223002delG	ENSP00000222270:p.Leu1877fs	Somatic	33	0		WXS	Illumina GAIIx	Phase_I	40	10	NM_014727	0	0	0	0	0	O15022|O95836|Q96GP2|Q96IP3|Q9UK25|Q9Y668|Q9Y669	Frame_Shift_Del	DEL	ENST00000222270.7	37	CCDS46055.1																																																																																			.		0.672	KMT2B-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_014727	
LRFN3	79414	hgsc.bcm.edu	37	19	36431134	36431134	+	Silent	SNP	C	C	T			TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr19:36431134C>T	ENST00000588831.1	+	3	1861	c.807C>T	c.(805-807)ctC>ctT	p.L269L	LRFN3_ENST00000246529.3_Silent_p.L269L			Q9BTN0	LRFN3_HUMAN	leucine rich repeat and fibronectin type III domain containing 3	269	LRRCT.				cell adhesion (GO:0007155)	cell junction (GO:0030054)|cell projection (GO:0042995)|integral component of membrane (GO:0016021)|postsynaptic membrane (GO:0045211)				cervix(1)|kidney(1)|large_intestine(1)|lung(6)|prostate(2)|upper_aerodigestive_tract(1)	12	all_lung(56;7.14e-07)|Lung NSC(56;1.12e-06)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.06)			AGGACGACCTCGAGGCCTGCG	0.716																																					p.L269L		.											.	LRFN3-90	0			c.C807T						.						12.0	14.0	14.0					19																	36431134		2127	4179	6306	SO:0001819	synonymous_variant	79414	exon2			CGACCTCGAGGCC	BC003578	CCDS12483.1	19q13.13	2013-02-11				ENSG00000126243		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	28370	protein-coding gene	gene with protein product	"""fibronectin type III, immunoglobulin and leucine rich repeat domains 1"""	612809				12975309, 16495444, 16828986	Standard	NM_024509		Approved	MGC2656, SALM4, FIGLER1	uc002oco.3	Q9BTN0		ENST00000588831.1:c.807C>T	19.37:g.36431134C>T		Somatic	4	0		WXS	Illumina GAIIx	Phase_I	18	5	NM_024509	0	0	12	12	0	Q6UY10	Silent	SNP	ENST00000588831.1	37	CCDS12483.1																																																																																			.		0.716	LRFN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000457403.2	NM_024509	
ZNF529	57711	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	37038306	37038306	+	Missense_Mutation	SNP	T	T	G			TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr19:37038306T>G	ENST00000591340.1	-	5	1312	c.1154A>C	c.(1153-1155)cAg>cCg	p.Q385P	ZNF529_ENST00000334116.7_Missense_Mutation_p.Q280P	NM_020951.4	NP_066002.3	Q6P280	ZN529_HUMAN	zinc finger protein 529	385					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.Q385R(1)|p.Q384R(1)		breast(1)	1	Esophageal squamous(110;0.198)					ATGAATTCTCTGATGACGAGC	0.408																																					p.Q385P		.											.	ZNF529-67	2	Substitution - Missense(2)	endometrium(2)	c.A1154C						.						94.0	106.0	102.0					19																	37038306		2181	4294	6475	SO:0001583	missense	57711	exon6			ATTCTCTGATGAC	AK025110	CCDS54256.1	19q13.13	2014-08-22			ENSG00000186020	ENSG00000186020		"""Zinc fingers, C2H2-type"", ""-"""	29328	protein-coding gene	gene with protein product						10997877	Standard	NM_020951		Approved	KIAA1615	uc002oeh.4	Q6P280	OTTHUMG00000180714	ENST00000591340.1:c.1154A>C	19.37:g.37038306T>G	ENSP00000465578:p.Gln385Pro	Somatic	49	0		WXS	Illumina GAIIx	Phase_I	102	57	NM_001145649	0	0	1	1	0	K7EKE1|Q9H731|Q9HCF7	Missense_Mutation	SNP	ENST00000591340.1	37	CCDS54256.1	.	.	.	.	.	.	.	.	.	.	T	11.66	1.704994	0.30232	.	.	ENSG00000186020	ENST00000334116	.	.	.	3.19	3.19	0.36642	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.42268	0.1195	L	0.55017	1.72	0.24060	N	0.996014	B;B	0.22480	0.057;0.07	B;B	0.23852	0.029;0.049	T	0.42275	-0.9461	8	0.87932	D	0	.	7.3629	0.26756	0.0:0.0:0.2231:0.7769	.	280;352	Q6P280-2;Q6P280	.;ZN529_HUMAN	P	385	.	ENSP00000334695:Q385P	Q	-	2	0	ZNF529	41730146	0.013000	0.17824	0.997000	0.53966	0.968000	0.65278	0.693000	0.25497	1.312000	0.45043	0.482000	0.46254	CAG	.		0.408	ZNF529-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452730.1	NM_020951	
RYR1	6261	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	19	38939333	38939333	+	Frame_Shift_Del	DEL	C	C	-			TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr19:38939333delC	ENST00000359596.3	+	11	1002	c.1002delC	c.(1000-1002)ggcfs	p.G334fs	RYR1_ENST00000355481.4_Frame_Shift_Del_p.G334fs|RYR1_ENST00000360985.3_Frame_Shift_Del_p.G334fs			P21817	RYR1_HUMAN	ryanodine receptor 1 (skeletal)	334					calcium ion transport (GO:0006816)|cellular response to caffeine (GO:0071313)|cytosolic calcium ion homeostasis (GO:0051480)|ion transmembrane transport (GO:0034220)|muscle contraction (GO:0006936)|ossification involved in bone maturation (GO:0043931)|outflow tract morphogenesis (GO:0003151)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|skeletal muscle fiber development (GO:0048741)|skin development (GO:0043588)|transmembrane transport (GO:0055085)	cell cortex (GO:0005938)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|I band (GO:0031674)|integral component of plasma membrane (GO:0005887)|junctional membrane complex (GO:0030314)|junctional sarcoplasmic reticulum membrane (GO:0014701)|plasma membrane (GO:0005886)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|T-tubule (GO:0030315)|terminal cisterna (GO:0014802)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|voltage-gated calcium channel activity (GO:0005245)			NS(4)|autonomic_ganglia(2)|breast(3)|central_nervous_system(5)|endometrium(26)|haematopoietic_and_lymphoid_tissue(3)|kidney(34)|large_intestine(42)|liver(1)|lung(106)|ovary(11)|pancreas(5)|prostate(9)|skin(12)|stomach(11)|upper_aerodigestive_tract(4)|urinary_tract(7)	285	all_cancers(60;7.91e-06)		Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)		Caffeine(DB00201)|Dantrolene(DB01219)|Suramin(DB04786)	AGGGCATGGGCCCCCCTGAGA	0.637																																					p.G334fs		.											.	RYR1-100	0			c.1002delC						.						84.0	83.0	84.0					19																	38939333		2203	4300	6503	SO:0001589	frameshift_variant	6261	exon11			CATGGGCCCCCCT	J05200	CCDS33011.1, CCDS42563.1	19q13.1	2014-09-17				ENSG00000196218		"""Ion channels / Ryanodine receptors"""	10483	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 137"""	180901	"""central core disease of muscle"""	MHS, MHS1, CCO		1862346, 16621918	Standard	NM_000540		Approved	RYR, PPP1R137	uc002oit.3	P21817		ENST00000359596.3:c.1002delC	19.37:g.38939333delC	ENSP00000352608:p.Gly334fs	Somatic	166	0		WXS	Illumina GAIIx	Phase_I	344	136	NM_001042723	0	0	0	0	0	Q16314|Q16368|Q9NPK1|Q9P1U4	Frame_Shift_Del	DEL	ENST00000359596.3	37	CCDS33011.1																																																																																			.		0.637	RYR1-010	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000462137.1		
RYR1	6261	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	39018334	39018334	+	Silent	SNP	C	C	T			TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr19:39018334C>T	ENST00000359596.3	+	73	10734	c.10734C>T	c.(10732-10734)ggC>ggT	p.G3578G	RYR1_ENST00000355481.4_Silent_p.G3573G|RYR1_ENST00000360985.3_Silent_p.G3578G|AC067969.1_ENST00000597015.1_RNA			P21817	RYR1_HUMAN	ryanodine receptor 1 (skeletal)	3578					calcium ion transport (GO:0006816)|cellular response to caffeine (GO:0071313)|cytosolic calcium ion homeostasis (GO:0051480)|ion transmembrane transport (GO:0034220)|muscle contraction (GO:0006936)|ossification involved in bone maturation (GO:0043931)|outflow tract morphogenesis (GO:0003151)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|skeletal muscle fiber development (GO:0048741)|skin development (GO:0043588)|transmembrane transport (GO:0055085)	cell cortex (GO:0005938)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|I band (GO:0031674)|integral component of plasma membrane (GO:0005887)|junctional membrane complex (GO:0030314)|junctional sarcoplasmic reticulum membrane (GO:0014701)|plasma membrane (GO:0005886)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|T-tubule (GO:0030315)|terminal cisterna (GO:0014802)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|voltage-gated calcium channel activity (GO:0005245)			NS(4)|autonomic_ganglia(2)|breast(3)|central_nervous_system(5)|endometrium(26)|haematopoietic_and_lymphoid_tissue(3)|kidney(34)|large_intestine(42)|liver(1)|lung(106)|ovary(11)|pancreas(5)|prostate(9)|skin(12)|stomach(11)|upper_aerodigestive_tract(4)|urinary_tract(7)	285	all_cancers(60;7.91e-06)		Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)		Caffeine(DB00201)|Dantrolene(DB01219)|Suramin(DB04786)	TGTACCGGGGCGTCCCGGGTC	0.657																																					p.G3578G		.											.	RYR1-100	0			c.C10734T						.						39.0	41.0	40.0					19																	39018334		2203	4300	6503	SO:0001819	synonymous_variant	6261	exon73			CCGGGGCGTCCCG	J05200	CCDS33011.1, CCDS42563.1	19q13.1	2014-09-17				ENSG00000196218		"""Ion channels / Ryanodine receptors"""	10483	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 137"""	180901	"""central core disease of muscle"""	MHS, MHS1, CCO		1862346, 16621918	Standard	NM_000540		Approved	RYR, PPP1R137	uc002oit.3	P21817		ENST00000359596.3:c.10734C>T	19.37:g.39018334C>T		Somatic	161	1		WXS	Illumina GAIIx	Phase_I	374	195	NM_000540	0	0	0	0	0	Q16314|Q16368|Q9NPK1|Q9P1U4	Silent	SNP	ENST00000359596.3	37	CCDS33011.1																																																																																			.		0.657	RYR1-010	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000462137.1		
FBXO27	126433	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	39521937	39521937	+	Nonsense_Mutation	SNP	G	G	A			TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr19:39521937G>A	ENST00000292853.4	-	3	507	c.388C>T	c.(388-390)Caa>Taa	p.Q130*	FBXO27_ENST00000600828.1_Nonsense_Mutation_p.Q129*|CTB-189B5.3_ENST00000597303.1_RNA|FBXO27_ENST00000509137.2_Nonsense_Mutation_p.Q130*	NM_178820.3	NP_849142.1	Q8NI29	FBX27_HUMAN	F-box protein 27	130	FBA. {ECO:0000255|PROSITE- ProRule:PRU00482}.					SCF ubiquitin ligase complex (GO:0019005)	glycoprotein binding (GO:0001948)			cervix(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(5)|ovary(1)|urinary_tract(2)	17	all_cancers(60;3.79e-07)|all_lung(34;1.26e-07)|Lung NSC(34;1.46e-07)|all_epithelial(25;4.69e-07)|Ovarian(47;0.0454)		Lung(45;0.000419)|LUSC - Lung squamous cell carcinoma(53;0.000554)			CCACCGTGTTGCACCATCCAC	0.587																																					p.Q130X		.											.	FBXO27-227	0			c.C388T						.						78.0	73.0	75.0					19																	39521937		2203	4300	6503	SO:0001587	stop_gained	126433	exon3			CGTGTTGCACCAT	AF436061	CCDS12527.1	19q13.2	2008-02-05	2004-06-15			ENSG00000161243		"""F-boxes /  ""other"""""	18753	protein-coding gene	gene with protein product		609099	"""F-box only protein 27"""			126433	Standard	NM_178820		Approved	Fbg5, Fbx27	uc002okh.3	Q8NI29		ENST00000292853.4:c.388C>T	19.37:g.39521937G>A	ENSP00000292853:p.Gln130*	Somatic	142	0		WXS	Illumina GAIIx	Phase_I	269	50	NM_178820	0	0	0	0	0	Q96C87	Nonsense_Mutation	SNP	ENST00000292853.4	37	CCDS12527.1	.	.	.	.	.	.	.	.	.	.	G	25.8	4.673046	0.88445	.	.	ENSG00000161243	ENST00000292853;ENST00000509137	.	.	.	3.66	-6.55	0.01854	.	2.361880	0.01889	N	0.038431	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.07990	T	0.79	-18.5204	8.9226	0.35621	0.0:0.4812:0.1868:0.3321	.	.	.	.	X	130	.	ENSP00000292853:Q130X	Q	-	1	0	FBXO27	44213777	0.000000	0.05858	0.000000	0.03702	0.526000	0.34562	-0.080000	0.11339	-0.660000	0.05352	0.479000	0.44913	CAA	.		0.587	FBXO27-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000463281.1		
FCGBP	8857	ucsc.edu;bcgsc.ca	37	19	40362754	40362754	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr19:40362754C>T	ENST00000221347.6	-	32	15323	c.15316G>A	c.(15316-15318)Gtg>Atg	p.V5106M		NM_003890.2	NP_003881.2	Q9Y6R7	FCGBP_HUMAN	Fc fragment of IgG binding protein	5106						extracellular vesicular exosome (GO:0070062)				NS(3)|autonomic_ganglia(1)|breast(7)|central_nervous_system(5)|endometrium(13)|kidney(9)|large_intestine(27)|lung(49)|ovary(8)|pancreas(3)|prostate(13)|skin(9)|stomach(9)|upper_aerodigestive_tract(6)|urinary_tract(3)	165	all_cancers(60;6.03e-06)|all_lung(34;5.58e-08)|Lung NSC(34;6.62e-08)|Ovarian(47;0.06)		Epithelial(26;6.25e-23)|all cancers(26;1.13e-20)			TTCACGGCCACGCCAGCTGCC	0.647																																					p.V5106M		.											.	FCGBP-98	0			c.G15316A						.						48.0	50.0	50.0					19																	40362754		2202	4300	6502	SO:0001583	missense	8857	exon32			CGGCCACGCCAGC	D84239		19q13.2	2013-09-20			ENSG00000090920	ENSG00000275395			13572	protein-coding gene	gene with protein product	"""IgG Fc binding protein"", ""Human Fc gamma BP"""					9182547	Standard	NM_003890		Approved	FC(GAMMA)BP	uc002omp.4	Q9Y6R7	OTTHUMG00000182580	ENST00000221347.6:c.15316G>A	19.37:g.40362754C>T	ENSP00000221347:p.Val5106Met	Somatic	172	3		WXS	Illumina GAIIx	Phase_I	509	241	NM_003890	0	0	1	2	1	O95784	Missense_Mutation	SNP	ENST00000221347.6	37	CCDS12546.1	.	.	.	.	.	.	.	.	.	.	C	11.36	1.615121	0.28712	.	.	ENSG00000090920	ENST00000221347	T	0.80123	-1.34	4.74	-1.54	0.08584	Uncharacterised domain, cysteine-rich (2);	30.927500	0.01214	N	0.007904	D	0.85630	0.5741	M	0.91196	3.185	0.09310	N	1	P	0.43231	0.801	P	0.45610	0.487	T	0.68150	-0.5485	10	0.59425	D	0.04	.	4.2294	0.10596	0.1493:0.4815:0.0:0.3692	.	5106	Q9Y6R7	FCGBP_HUMAN	M	5106	ENSP00000221347:V5106M	ENSP00000221347:V5106M	V	-	1	0	FCGBP	45054594	0.000000	0.05858	0.000000	0.03702	0.019000	0.09904	-0.450000	0.06803	-0.308000	0.08792	-0.380000	0.06706	GTG	.		0.647	FCGBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000462507.1	NM_003890	
PRX	57716	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	40900691	40900691	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr19:40900691C>T	ENST00000324001.7	-	7	3838	c.3568G>A	c.(3568-3570)Gtg>Atg	p.V1190M	PRX_ENST00000291825.7_3'UTR	NM_181882.2	NP_870998.2	Q9BXM0	PRAX_HUMAN	periaxin	1190	Glu-rich (acidic).				axon ensheathment (GO:0008366)|cell death (GO:0008219)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				breast(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(7)|lung(12)|ovary(2)|prostate(3)|skin(1)|urinary_tract(9)	47			Lung(22;6.24e-05)|LUSC - Lung squamous cell carcinoma(20;0.000384)			GACAGGGTCACCTGGGGCACC	0.632																																					p.V1190M		.											.	PRX-92	0			c.G3568A						.						105.0	98.0	100.0					19																	40900691		2203	4300	6503	SO:0001583	missense	57716	exon7			GGGTCACCTGGGG	AB046840	CCDS12556.1, CCDS33028.1	19q13.2	2014-09-17				ENSG00000105227			13797	protein-coding gene	gene with protein product		605725				10839370, 9143514	Standard	NM_181882		Approved	KIAA1620	uc002onr.3	Q9BXM0		ENST00000324001.7:c.3568G>A	19.37:g.40900691C>T	ENSP00000326018:p.Val1190Met	Somatic	87	1		WXS	Illumina GAIIx	Phase_I	225	107	NM_181882	0	0	6	12	6	Q9BXL9|Q9HCF2	Missense_Mutation	SNP	ENST00000324001.7	37	CCDS33028.1	.	.	.	.	.	.	.	.	.	.	C	15.05	2.718169	0.48622	.	.	ENSG00000105227	ENST00000324001;ENST00000341562	T	0.01379	4.96	4.45	4.45	0.53987	.	0.162161	0.29002	N	0.013454	T	0.06554	0.0168	L	0.60455	1.87	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	T	0.14035	-1.0487	10	0.66056	D	0.02	-18.5263	14.0984	0.65039	0.0:1.0:0.0:0.0	.	1190	Q9BXM0	PRAX_HUMAN	M	1190;1125	ENSP00000326018:V1190M	ENSP00000326018:V1190M	V	-	1	0	PRX	45592531	0.000000	0.05858	0.992000	0.48379	0.696000	0.40369	0.150000	0.16263	2.301000	0.77427	0.561000	0.74099	GTG	.		0.632	PRX-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000462582.1	NM_020956	
LIPE	3991	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	19	42914911	42914913	+	In_Frame_Del	DEL	AGA	AGA	-			TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10	AGA	AGA	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr19:42914911_42914913delAGA	ENST00000244289.4	-	2	1241_1243	c.965_967delTCT	c.(964-969)ttctcg>tcg	p.F322del	LIPE_ENST00000602000.1_Intron|LIPE-AS1_ENST00000593491.2_RNA|LIPE-AS1_ENST00000599276.1_RNA|LIPE-AS1_ENST00000597203.1_RNA|LIPE-AS1_ENST00000594624.2_RNA	NM_005357.2	NP_005348.2	Q05469	LIPS_HUMAN	lipase, hormone-sensitive	322					cholesterol metabolic process (GO:0008203)|diacylglycerol catabolic process (GO:0046340)|lipid catabolic process (GO:0016042)|long-chain fatty acid catabolic process (GO:0042758)|protein phosphorylation (GO:0006468)|small molecule metabolic process (GO:0044281)|triglyceride catabolic process (GO:0019433)	cytosol (GO:0005829)|lipid particle (GO:0005811)|plasma membrane (GO:0005886)	hormone-sensitive lipase activity (GO:0033878)|triglyceride lipase activity (GO:0004806)			breast(2)|endometrium(4)|kidney(7)|large_intestine(6)|lung(8)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	32		Prostate(69;0.00682)				CCCTGGCTCGAGAAGAAGGCTAT	0.655																																					p.322_323del		.											.	LIPE-154	0			c.965_967del						.																																			SO:0001651	inframe_deletion	3991	exon2			GGCTCGAGAAGAA	L11706	CCDS12607.1	19q13.1-q13.2	2014-03-14			ENSG00000079435	ENSG00000079435	3.1.1.3		6621	protein-coding gene	gene with protein product		151750				8506334	Standard	NM_005357		Approved	HSL	uc002otr.3	Q05469	OTTHUMG00000182814	ENST00000244289.4:c.965_967delTCT	19.37:g.42914914_42914916delAGA	ENSP00000244289:p.Phe322del	Somatic	51	0		WXS	Illumina GAIIx	Phase_I	82	70	NM_005357	0	0	0	0	0	Q3LRT2|Q6NSL7	In_Frame_Del	DEL	ENST00000244289.4	37	CCDS12607.1																																																																																			.		0.655	LIPE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463861.1	NM_005357	
PSG6	5675	hgsc.bcm.edu	37	19	43421937	43421937	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr19:43421937G>A	ENST00000292125.2	-	1	52	c.8C>T	c.(7-9)cCc>cTc	p.P3L	PSG6_ENST00000402603.4_Missense_Mutation_p.P3L|PSG6_ENST00000601833.1_Intron|PSG6_ENST00000187910.2_Missense_Mutation_p.P3L	NM_002782.4	NP_002773.1	Q00889	PSG6_HUMAN	pregnancy specific beta-1-glycoprotein 6	3					female pregnancy (GO:0007565)	extracellular region (GO:0005576)				central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(3)|lung(19)|ovary(1)|prostate(2)|skin(6)|stomach(1)|upper_aerodigestive_tract(2)	44		Prostate(69;0.00899)				GGCTGAGAGGGGTCCCATGGT	0.602																																					p.P3L		.											.	PSG6-92	0			c.C8T						.						139.0	118.0	125.0					19																	43421937		2201	4300	6501	SO:0001583	missense	5675	exon1			GAGAGGGGTCCCA		CCDS12613.1, CCDS33038.1	19q13.2	2013-01-29			ENSG00000170848	ENSG00000170848		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	9523	protein-coding gene	gene with protein product		176395				1690992	Standard	NM_002782		Approved			Q00889	OTTHUMG00000151127	ENST00000292125.2:c.8C>T	19.37:g.43421937G>A	ENSP00000292125:p.Pro3Leu	Somatic	27	0		WXS	Illumina GAIIx	Phase_I	65	5	NM_001031850	0	0	0	0	0	O75244|Q15224|Q15235|Q549K1	Missense_Mutation	SNP	ENST00000292125.2	37	CCDS12613.1	.	.	.	.	.	.	.	.	.	.	g	5.961	0.361349	0.11296	.	.	ENSG00000170848	ENST00000187910;ENST00000402603;ENST00000292125;ENST00000402456	T;T;T	0.29142	1.58;1.92;1.61	1.47	0.359	0.16088	.	.	.	.	.	T	0.24198	0.0586	L	0.59912	1.85	0.09310	N	1	B;B;B	0.15719	0.006;0.005;0.014	B;B;B	0.19946	0.009;0.018;0.027	T	0.30995	-0.9959	9	0.22109	T	0.4	.	3.3746	0.07233	0.3027:0.0:0.6973:0.0	.	3;3;3	Q00889;Q00889-2;B5MCE1	PSG6_HUMAN;.;.	L	3	ENSP00000187910:P3L;ENSP00000385736:P3L;ENSP00000292125:P3L	ENSP00000187910:P3L	P	-	2	0	PSG6	48113777	0.002000	0.14202	0.058000	0.19502	0.028000	0.11728	0.042000	0.13949	0.157000	0.19338	0.194000	0.17425	CCC	.		0.602	PSG6-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000321436.1	NM_002782	
NKPD1	284353	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	19	45655516	45655516	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr19:45655516C>T	ENST00000438936.2	-	3	1724	c.1513G>A	c.(1513-1515)Gcc>Acc	p.A505T	NKPD1_ENST00000589776.1_Missense_Mutation_p.A505T|NKPD1_ENST00000317951.4_Missense_Mutation_p.A727T|NKPD1_ENST00000429338.1_Intron|AC005757.7_ENST00000589594.1_lincRNA			Q17RQ9	NKPD1_HUMAN	NTPase, KAP family P-loop domain containing 1	505						integral component of membrane (GO:0016021)				endometrium(1)|lung(4)|prostate(2)|urinary_tract(1)	8		Ovarian(192;0.0728)|all_neural(266;0.112)		OV - Ovarian serous cystadenocarcinoma(262;0.00863)|GBM - Glioblastoma multiforme(486;0.231)		GGGAAGTCGGCGCCCAGGAAG	0.672																																					p.A727T		.											.	NKPD1-68	0			c.G2179A						.						11.0	14.0	13.0					19																	45655516		1973	4122	6095	SO:0001583	missense	284353	exon4			AGTCGGCGCCCAG	AK090919		19q13.32	2012-07-02		2012-07-02	ENSG00000179846	ENSG00000179846			24739	protein-coding gene	gene with protein product						14702039	Standard	NM_198478		Approved	FLJ33600	uc010xxi.2	Q17RQ9	OTTHUMG00000160521	ENST00000438936.2:c.1513G>A	19.37:g.45655516C>T	ENSP00000401739:p.Ala505Thr	Somatic	34	0		WXS	Illumina GAIIx	Phase_I	165	27	NM_198478	0	0	0	0	0	B7ZLG6|D6RH15|Q8N2A2	Missense_Mutation	SNP	ENST00000438936.2	37		.	.	.	.	.	.	.	.	.	.	C	10.27	1.303158	0.23736	.	.	ENSG00000179846	ENST00000317951;ENST00000438936	T;T	0.42900	0.97;0.96	5.43	-6.28	0.02020	.	.	.	.	.	T	0.09686	0.0238	N	0.01352	-0.895	0.09310	N	0.999998	B	0.13594	0.008	B	0.06405	0.002	T	0.21075	-1.0256	9	0.07644	T	0.81	-3.9475	2.3648	0.04316	0.5186:0.1697:0.1023:0.2094	.	505	Q17RQ9	NKPD1_HUMAN	T	727;505	ENSP00000321976:A727T;ENSP00000401739:A505T	ENSP00000321976:A727T	A	-	1	0	NKPD1	50347356	0.000000	0.05858	0.002000	0.10522	0.931000	0.56810	-0.614000	0.05604	-1.438000	0.01965	0.561000	0.74099	GCC	.		0.672	NKPD1-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000360950.2	NM_198478	
ERCC1	2067	broad.mit.edu;bcgsc.ca;mdanderson.org	37	19	45922382	45922382	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr19:45922382G>A	ENST00000300853.3	-	5	1090	c.499C>T	c.(499-501)Cgg>Tgg	p.R167W	ERCC1_ENST00000591636.1_Missense_Mutation_p.R167W|ERCC1_ENST00000013807.5_Missense_Mutation_p.R167W|ERCC1_ENST00000340192.7_Missense_Mutation_p.R167W|ERCC1_ENST00000589165.1_Missense_Mutation_p.R167W|ERCC1_ENST00000423698.2_Missense_Mutation_p.R95W	NM_001983.3	NP_001974.1	P07992	ERCC1_HUMAN	excision repair cross-complementation group 1	167					cell proliferation (GO:0008283)|chromosome organization (GO:0051276)|DNA catabolic process, endonucleolytic (GO:0000737)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|interstrand cross-link repair (GO:0036297)|isotype switching (GO:0045190)|male gonad development (GO:0008584)|mitotic recombination (GO:0006312)|multicellular organism growth (GO:0035264)|multicellular organismal aging (GO:0010259)|negative regulation of telomere maintenance (GO:0032205)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA damage removal (GO:0000718)|nucleotide-excision repair, DNA incision, 3'-to lesion (GO:0006295)|nucleotide-excision repair, DNA incision, 5'-to lesion (GO:0006296)|oogenesis (GO:0048477)|post-embryonic hemopoiesis (GO:0035166)|pyrimidine dimer repair by nucleotide-excision repair (GO:0000720)|replicative cell aging (GO:0001302)|response to nutrient (GO:0007584)|response to oxidative stress (GO:0006979)|response to sucrose (GO:0009744)|response to X-ray (GO:0010165)|spermatogenesis (GO:0007283)|syncytium formation (GO:0006949)|transcription-coupled nucleotide-excision repair (GO:0006283)|UV protection (GO:0009650)	cytoplasm (GO:0005737)|nuclear chromosome, telomeric region (GO:0000784)|nucleoplasm (GO:0005654)|nucleotide-excision repair complex (GO:0000109)|nucleus (GO:0005634)|transcription factor TFIID complex (GO:0005669)	damaged DNA binding (GO:0003684)|endonuclease activity (GO:0004519)|protein C-terminus binding (GO:0008022)|protein domain specific binding (GO:0019904)|single-stranded DNA binding (GO:0003697)			central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(4)|lung(2)|ovary(2)|skin(1)	15		Ovarian(192;0.051)|all_neural(266;0.112)		OV - Ovarian serous cystadenocarcinoma(262;0.0247)		AGCAGGACCCGCAAGGCGAAG	0.622								Nucleotide excision repair (NER)																													p.R167W		.											.	ERCC1-659	0			c.C499T						.						66.0	53.0	58.0					19																	45922382		2200	4299	6499	SO:0001583	missense	2067	exon5			GGACCCGCAAGGC		CCDS12662.1, CCDS12663.1, CCDS54279.1	19q13.32	2014-03-07	2014-03-07			ENSG00000012061			3433	protein-coding gene	gene with protein product		126380	"""excision repair cross-complementing rodent repair deficiency, complementation group 1 (includes overlapping antisense sequence)"""			6462228	Standard	NM_001983		Approved	RAD10	uc002pbs.2	P07992		ENST00000300853.3:c.499C>T	19.37:g.45922382G>A	ENSP00000300853:p.Arg167Trp	Somatic	40	1		WXS	Illumina GAIIx	Phase_I	73	25	NM_001983	0	0	59	81	22	B2RC01|B3KRR0|Q7Z7F5|Q96S40	Missense_Mutation	SNP	ENST00000300853.3	37	CCDS12662.1	.	.	.	.	.	.	.	.	.	.	G	21.5	4.162700	0.78226	.	.	ENSG00000012061	ENST00000300853;ENST00000340192;ENST00000423698;ENST00000013807	T;T;T;T	0.56444	0.5;0.47;0.6;0.46	4.71	3.65	0.41850	Restriction endonuclease, type II-like (1);	0.000000	0.85682	D	0.000000	T	0.76948	0.4059	M	0.93197	3.39	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.91635	0.999;0.997;0.998;0.998	T	0.80683	-0.1273	10	0.87932	D	0	-28.4027	10.3876	0.44150	0.0:0.0:0.8052:0.1948	.	167;95;167;167	Q7Z7F5;B3KRR0;Q96S40;P07992	.;.;.;ERCC1_HUMAN	W	167;167;95;167	ENSP00000300853:R167W;ENSP00000345203:R167W;ENSP00000394875:R95W;ENSP00000013807:R167W	ENSP00000013807:R167W	R	-	1	2	ERCC1	50614222	1.000000	0.71417	0.997000	0.53966	0.962000	0.63368	3.420000	0.52735	0.949000	0.37715	0.462000	0.41574	CGG	.		0.622	ERCC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000459542.1	NM_001983	
GRIN2D	2906	hgsc.bcm.edu;bcgsc.ca;mdanderson.org	37	19	48918195	48918195	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr19:48918195C>T	ENST00000263269.3	+	6	1575	c.1487C>T	c.(1486-1488)gCg>gTg	p.A496V		NM_000836.2	NP_000827.2	O15399	NMDE4_HUMAN	glutamate receptor, ionotropic, N-methyl D-aspartate 2D	496					adult locomotory behavior (GO:0008344)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|regulation of sensory perception of pain (GO:0051930)|signal transduction (GO:0007165)|startle response (GO:0001964)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)	cell junction (GO:0030054)|dendrite (GO:0030425)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	extracellular-glutamate-gated ion channel activity (GO:0005234)|N-methyl-D-aspartate selective glutamate receptor activity (GO:0004972)			autonomic_ganglia(1)|breast(6)|endometrium(2)|large_intestine(9)|lung(12)|ovary(5)|pancreas(1)|prostate(1)	37		all_epithelial(76;1.11e-06)|all_lung(116;5.79e-06)|Lung NSC(112;1.18e-05)|all_neural(266;0.0189)|Ovarian(192;0.0261)|Breast(70;0.203)		all cancers(93;0.00014)|OV - Ovarian serous cystadenocarcinoma(262;0.000233)|Epithelial(262;0.0112)|GBM - Glioblastoma multiforme(486;0.0161)	Acamprosate(DB00659)|Acetylcysteine(DB06151)|Atomoxetine(DB00289)|Gabapentin(DB00996)|Ketobemidone(DB06738)|Milnacipran(DB04896)|Orphenadrine(DB01173)|Pentobarbital(DB00312)|Pethidine(DB00454)|Phenobarbital(DB01174)|Secobarbital(DB00418)	AAGCGGCTGGCGCATACCATC	0.617																																					p.A496V		.											.	GRIN2D-156	0			c.C1487T						.						49.0	50.0	49.0					19																	48918195		2203	4300	6503	SO:0001583	missense	2906	exon6			GGCTGGCGCATAC	U77783	CCDS12719.1	19q13.33	2012-08-29			ENSG00000105464	ENSG00000105464		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4588	protein-coding gene	gene with protein product	"""N-methyl-d-aspartate receptor subunit 2D"""	602717		NMDAR2D		9480759, 9418891	Standard	NM_000836		Approved	GluN2D, EB11, NR2D	uc002pjc.4	O15399		ENST00000263269.3:c.1487C>T	19.37:g.48918195C>T	ENSP00000263269:p.Ala496Val	Somatic	160	0		WXS	Illumina GAIIx	Phase_I	335	136	NM_000836	0	0	0	0	0		Missense_Mutation	SNP	ENST00000263269.3	37	CCDS12719.1	.	.	.	.	.	.	.	.	.	.	C	34	5.361090	0.95877	.	.	ENSG00000105464	ENST00000263269	T	0.39997	1.05	4.88	4.88	0.63580	Extracellular solute-binding protein, family 3 (1);Glutamate receptor, L-glutamate/glycine-binding (1);Ionotropic glutamate receptor (1);	0.066103	0.64402	D	0.000016	T	0.72835	0.3510	M	0.93150	3.385	0.58432	D	0.999992	D	0.89917	1.0	D	0.68483	0.958	T	0.81551	-0.0881	10	0.87932	D	0	.	17.1833	0.86860	0.0:1.0:0.0:0.0	.	496	O15399	NMDE4_HUMAN	V	496	ENSP00000263269:A496V	ENSP00000263269:A496V	A	+	2	0	GRIN2D	53610007	1.000000	0.71417	1.000000	0.80357	0.893000	0.52053	7.636000	0.83301	2.445000	0.82738	0.655000	0.94253	GCG	.		0.617	GRIN2D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466121.1		
SCAF1	58506	hgsc.bcm.edu	37	19	50156709	50156711	+	In_Frame_Del	DEL	GGA	GGA	-	rs199563438	byFrequency	TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10	GGA	GGA	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr19:50156709_50156711delGGA	ENST00000360565.3	+	7	3187_3189	c.3063_3065delGGA	c.(3061-3066)gcggag>gcg	p.E1039del		NM_021228.2	NP_067051.2	Q9H7N4	SFR19_HUMAN	SR-related CTD-associated factor 1	1039	Glu-rich.				mRNA processing (GO:0006397)|RNA splicing (GO:0008380)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	RNA binding (GO:0003723)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(2)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	20		all_lung(116;1.05e-05)|Lung NSC(112;3.77e-05)|all_neural(266;0.196)|Ovarian(192;0.231)		OV - Ovarian serous cystadenocarcinoma(262;0.00113)|GBM - Glioblastoma multiforme(134;0.0204)		GAGGTGGGGCggaggaggaggag	0.655																																					p.1021_1022del		.											.	SCAF1-68	0			c.3063_3065del						.																																			SO:0001651	inframe_deletion	58506	exon7			TGGGGCGGAGGAG	AK024444	CCDS33074.1	19q13.3-q13.4	2011-01-10			ENSG00000126461	ENSG00000126461			30403	protein-coding gene	gene with protein product						11461075	Standard	NM_021228		Approved	SR-A1, FLJ00034	uc002poq.3	Q9H7N4		ENST00000360565.3:c.3063_3065delGGA	19.37:g.50156718_50156720delGGA	ENSP00000353769:p.Glu1039del	Somatic	33	1		WXS	Illumina GAIIx	Phase_I	86	37	NM_021228	0	0	0	0	0	Q7Z5V7|Q8WVA1|Q9NR59	In_Frame_Del	DEL	ENST00000360565.3	37	CCDS33074.1																																																																																			.		0.655	SCAF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465764.1	NM_021228	
MED25	81857	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	19	50333113	50333113	+	Frame_Shift_Del	DEL	C	C	-			TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr19:50333113delC	ENST00000312865.6	+	6	649	c.596delC	c.(595-597)gccfs	p.A199fs	MED25_ENST00000538643.1_Intron	NM_030973.3	NP_112235.2	Q71SY5	MED25_HUMAN	mediator complex subunit 25	199	Interaction with the Mediator complex.				cell death (GO:0008219)|gene expression (GO:0010467)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of chromatin binding (GO:0035563)|positive regulation of mediator complex assembly (GO:2001178)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription initiation from RNA polymerase II promoter (GO:0006367)	nucleoplasm (GO:0005654)	retinoic acid receptor binding (GO:0042974)|retinoid X receptor binding (GO:0046965)|transcription factor binding (GO:0008134)			NS(1)|central_nervous_system(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(1)|lung(6)|ovary(1)|stomach(1)|urinary_tract(1)	17		all_lung(116;3.24e-07)|Lung NSC(112;1.6e-06)|all_neural(266;0.0459)|Ovarian(192;0.0728)		OV - Ovarian serous cystadenocarcinoma(262;0.00822)|GBM - Glioblastoma multiforme(134;0.0122)		GAGAAGGCAGCCCCCCCGGCC	0.657																																					p.A199fs	GBM(51;894 1657 37868)	.											.	MED25-91	0			c.596delC						.			26,24,4204		0,0,26,2,20,2079	16.0	17.0	17.0			5.5	0.4	19		17	31,33,8184		0,0,31,4,25,4064	no	codingComplex	MED25	NM_030973.3		0,0,57,6,45,6143	A1A1,A1A2,A1R,A2A2,A2R,RR		0.7759,1.1754,0.9119			50333113	57,57,12388	2203	4299	6502	SO:0001589	frameshift_variant	81857	exon6			AGGCAGCCCCCCC	AL136746	CCDS33075.1	19q13.3	2014-09-17	2007-07-30			ENSG00000104973			28845	protein-coding gene	gene with protein product		610197	"""mediator of RNA polymerase II transcription, subunit 25 homolog (S. cerevisiae)"""			9110174, 11230166	Standard	NM_030973		Approved	ARC92, ACID1, TCBAP0758, DKFZp434K0512	uc002ppw.2	Q71SY5		ENST00000312865.6:c.596delC	19.37:g.50333113delC	ENSP00000326767:p.Ala199fs	Somatic	122	0		WXS	Illumina GAIIx	Phase_I	240	29	NM_030973	0	0	0	0	0	A8K095|B9TX30|O95783|Q6P143|Q6QMH5|Q707U4|Q8TB55|Q9H0L5|Q9HB34	Frame_Shift_Del	DEL	ENST00000312865.6	37	CCDS33075.1																																																																																			.		0.657	MED25-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465316.1	NM_030973	
PTOV1	53635	hgsc.bcm.edu;bcgsc.ca	37	19	50360301	50360303	+	In_Frame_Del	DEL	AAG	AAG	-			TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10	AAG	AAG	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr19:50360301_50360303delAAG	ENST00000601675.1	+	6	732_734	c.628_630delAAG	c.(628-630)aagdel	p.K212del	AC018766.5_ENST00000599259.1_RNA|MIR4749_ENST00000578197.1_RNA|PTOV1_ENST00000599732.1_In_Frame_Del_p.K212del|AC018766.4_ENST00000596624.1_RNA|PTOV1_ENST00000600603.1_In_Frame_Del_p.K180del|AC018766.5_ENST00000601893.1_RNA|AC018766.6_ENST00000601211.1_RNA|PTOV1_ENST00000221557.9_In_Frame_Del_p.K180del|PTOV1_ENST00000598325.1_3'UTR|AC018766.5_ENST00000593654.1_RNA|PTOV1_ENST00000391842.1_In_Frame_Del_p.K212del|PTOV1_ENST00000601638.1_In_Frame_Del_p.K180del			Q86YD1	PTOV1_HUMAN	prostate tumor overexpressed 1	212	Interaction with FLOT1.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				endometrium(5)|kidney(3)|large_intestine(2)|lung(5)|ovary(1)	16		all_lung(116;1.05e-05)|Lung NSC(112;3.77e-05)|all_neural(266;0.107)|Ovarian(192;0.231)		GBM - Glioblastoma multiforme(134;0.0116)|OV - Ovarian serous cystadenocarcinoma(262;0.0132)		GTACTCGTCCAAGAAGAAGATCT	0.64																																					p.210_210del		.											.	PTOV1-226	0			c.628_630del						.																																			SO:0001651	inframe_deletion	53635	exon6			TCGTCCAAGAAGA	AF238381	CCDS12782.1	19q13.33	2014-08-28	2008-09-12		ENSG00000104960	ENSG00000104960			9632	protein-coding gene	gene with protein product		610195				12598323, 15713644	Standard	XM_005258998		Approved		uc002pqf.1	Q86YD1	OTTHUMG00000183162	ENST00000601675.1:c.628_630delAAG	19.37:g.50360307_50360309delAAG	ENSP00000472816:p.Lys212del	Somatic	163	1		WXS	Illumina GAIIx	Phase_I	337	144	NM_017432	0	0	0	0	0	Q6UXX7|Q96BU3|Q9HBN4|Q9NYL1	In_Frame_Del	DEL	ENST00000601675.1	37	CCDS12782.1																																																																																			.		0.640	PTOV1-007	KNOWN	alternative_3_UTR|NMD_exception|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465347.1	NM_017432	
LRRC4B	94030	hgsc.bcm.edu	37	19	51051969	51051969	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr19:51051969C>T	ENST00000599957.1	-	2	324	c.127G>A	c.(127-129)Gtg>Atg	p.V43M	LRRC4B_ENST00000389201.3_Missense_Mutation_p.V43M			Q9NT99	LRC4B_HUMAN	leucine rich repeat containing 4B	43					positive regulation of synapse assembly (GO:0051965)	cell junction (GO:0030054)|cerebellar mossy fiber (GO:0044300)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|synapse (GO:0045202)				breast(1)|central_nervous_system(1)|endometrium(4)|large_intestine(6)|liver(1)|lung(11)|prostate(4)|skin(1)|urinary_tract(1)	30		all_neural(266;0.131)		OV - Ovarian serous cystadenocarcinoma(262;0.00284)|GBM - Glioblastoma multiforme(134;0.0188)		GCAGACGTCACGGCCACTCCA	0.731																																					p.V43M		.											.	LRRC4B-205	0			c.G127A						.																																			SO:0001583	missense	94030	exon2			ACGTCACGGCCAC	BC032460	CCDS42595.1	19q13.33	2014-01-30	2004-06-14	2004-06-16	ENSG00000131409	ENSG00000131409		"""Immunoglobulin superfamily / I-set domain containing"", ""Endogenous ligands"""	25042	protein-coding gene	gene with protein product	"""netrin-G3 ligand"""		"""leucine-rich repeats and immunoglobulin-like domains 4"""	LRIG4		11441184	Standard	NM_001080457		Approved	DKFZp761A179, HSM	uc002pss.3	Q9NT99		ENST00000599957.1:c.127G>A	19.37:g.51051969C>T	ENSP00000471502:p.Val43Met	Somatic	1	0		WXS	Illumina GAIIx	Phase_I	14	7	NM_001080457	0	0	0	1	1	Q3ZCQ4|Q58F20	Missense_Mutation	SNP	ENST00000599957.1	37	CCDS42595.1	.	.	.	.	.	.	.	.	.	.	C	11.91	1.779972	0.31502	.	.	ENSG00000131409	ENST00000389201;ENST00000535879	T	0.59772	0.24	3.67	-4.41	0.03590	.	0.286883	0.20990	N	0.082060	T	0.24431	0.0592	N	0.08118	0	0.20489	N	0.999899	B	0.19200	0.034	B	0.10450	0.005	T	0.04961	-1.0915	10	0.37606	T	0.19	.	1.4986	0.02471	0.1528:0.2416:0.386:0.2197	.	43	Q9NT99	LRC4B_HUMAN	M	43	ENSP00000373853:V43M	ENSP00000373853:V43M	V	-	1	0	LRRC4B	55743781	0.133000	0.22466	0.382000	0.26119	0.914000	0.54420	0.763000	0.26517	-0.335000	0.08451	0.442000	0.29010	GTG	.		0.731	LRRC4B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464907.1	NM_001080457	
ZNF841	284371	broad.mit.edu;bcgsc.ca	37	19	52568564	52568564	+	Silent	SNP	C	C	T	rs374222381		TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr19:52568564C>T	ENST00000426391.2	-	5	2774	c.2223G>A	c.(2221-2223)gcG>gcA	p.A741A	ZNF841_ENST00000389534.4_Silent_p.A857A|ZNF841_ENST00000359973.2_Silent_p.A433A|CTC-471J1.2_ENST00000569091.1_RNA|ZNF432_ENST00000598446.1_Intron|ZNF841_ENST00000594295.1_Silent_p.A857A			Q6ZN19	ZN841_HUMAN	zinc finger protein 841	741					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(4)|kidney(3)|lung(3)	11						GCCGCCCAAACGCCTTGCCAC	0.408																																					p.A857A		.											.	.	0			c.G2571A						.	C		0,1384		0,0,692	154.0	131.0	138.0		2571	-3.3	0.0	19		138	1,3181		0,1,1590	no	coding-synonymous	ZNF841	NM_001136499.1		0,1,2282	TT,TC,CC		0.0314,0.0,0.0219		857/925	52568564	1,4565	692	1591	2283	SO:0001819	synonymous_variant	284371	exon7			CCCAAACGCCTTG	AK131409	CCDS46161.1	19q13.41	2013-01-08			ENSG00000197608	ENSG00000197608		"""Zinc fingers, C2H2-type"", ""-"""	27611	protein-coding gene	gene with protein product							Standard	NM_001136499		Approved	LOC284371	uc010ydh.1	Q6ZN19		ENST00000426391.2:c.2223G>A	19.37:g.52568564C>T		Somatic	145	0		WXS	Illumina GAIIx	Phase_I	320	10	NM_001136499	0	0	2	2	0	B9EG58|Q6ZN82|Q6ZP71|Q8N9U7	Silent	SNP	ENST00000426391.2	37																																																																																				.		0.408	ZNF841-001	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000462435.1	XM_209155	
ZNF160	90338	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	53577421	53577421	+	Silent	SNP	C	C	T	rs374134545		TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr19:53577421C>T	ENST00000429604.1	-	6	658	c.243G>A	c.(241-243)acG>acA	p.T81T	ZNF160_ENST00000355147.5_Silent_p.T81T|ZNF160_ENST00000599056.1_Silent_p.T81T|ZNF160_ENST00000601421.1_Silent_p.T45T|ZNF160_ENST00000418871.1_Silent_p.T81T|ZNF160_ENST00000599729.1_5'Flank	NM_001102603.1|NM_198893.2	NP_001096073.1|NP_942596.1	Q9HCG1	ZN160_HUMAN	zinc finger protein 160	81					hemopoiesis (GO:0030097)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(8)|lung(10)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	35				GBM - Glioblastoma multiforme(134;0.02)		CACATTCCGGCGTTCTTGGTT	0.488																																					p.T81T		.											.	ZNF160-90	0			c.G243A						.	C	,,	0,4406		0,0,2203	201.0	172.0	182.0		243,243,243	0.8	0.0	19		182	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous,coding-synonymous,coding-synonymous	ZNF160	NM_001102603.1,NM_033288.3,NM_198893.2	,,	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	,,	81/819,81/819,81/819	53577421	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	90338	exon6			TTCCGGCGTTCTT	X78928	CCDS12859.1	19q13.42	2013-01-08				ENSG00000170949		"""Zinc fingers, C2H2-type"", ""-"""	12948	protein-coding gene	gene with protein product		600398				7774943, 7865130	Standard	NM_198893		Approved	HZF5, F11, KR18, HKr18, FLJ00032, KIAA1611	uc002qar.4	Q9HCG1		ENST00000429604.1:c.243G>A	19.37:g.53577421C>T		Somatic	85	0		WXS	Illumina GAIIx	Phase_I	175	83	NM_001102603	0	0	0	0	0	Q14589|Q504Q8|Q96JC5|Q9BVY9|Q9H7N6	Silent	SNP	ENST00000429604.1	37	CCDS12859.1																																																																																			.		0.488	ZNF160-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463994.2	NM_033288	
SSC5D	284297	hgsc.bcm.edu	37	19	56029616	56029616	+	Missense_Mutation	SNP	C	C	A	rs35104581|rs150781976	byFrequency	TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr19:56029616C>A	ENST00000389623.6	+	14	3996	c.3973C>A	c.(3973-3975)Ccc>Acc	p.P1325T		NM_001144950.1	NP_001138422.1	A1L4H1	SRCRL_HUMAN	scavenger receptor cysteine rich family, 5 domains	1325	Pro-rich.|Thr-rich.				defense response to Gram-negative bacterium (GO:0050829)|defense response to Gram-positive bacterium (GO:0050830)|detection of bacterial lipoprotein (GO:0042494)|innate immune response (GO:0045087)|multicellular organismal development (GO:0007275)|negative regulation of interleukin-8 secretion (GO:2000483)|receptor-mediated endocytosis (GO:0006898)	cytoplasm (GO:0005737)|extracellular matrix (GO:0031012)|extracellular space (GO:0005615)|intracellular (GO:0005622)|membrane (GO:0016020)	extracellular matrix binding (GO:0050840)|fibronectin binding (GO:0001968)|laminin binding (GO:0043236)|scavenger receptor activity (GO:0005044)			NS(1)|breast(1)|skin(2)	4						gacccctcaccccACAACTCC	0.597																																					p.P1325T		.											.	.	0			c.C3973A						.						343.0	327.0	332.0					19																	56029616		692	1591	2283	SO:0001583	missense	284297	exon14			CCTCACCCCACAA		CCDS46196.1, CCDS59424.1	19q13.42	2014-07-09	2014-07-09		ENSG00000179954	ENSG00000179954			26641	protein-coding gene	gene with protein product	"""soluble scavenger with 5 domains"""		"""scavenger receptor cysteine rich domain containing (5 domains)"""			19535143	Standard	NM_001144950		Approved	FLJ35258	uc002qlg.4	A1L4H1		ENST00000389623.6:c.3973C>A	19.37:g.56029616C>A	ENSP00000374274:p.Pro1325Thr	Somatic	43	0		WXS	Illumina GAIIx	Phase_I	92	3	NM_001144950	0	0	0	0	0	B5MDQ5|C7S7T9|C7S7U0|K7EP70	Missense_Mutation	SNP	ENST00000389623.6	37	CCDS46196.1	.	.	.	.	.	.	.	.	.	.	-	10.40	1.340729	0.24339	.	.	ENSG00000179954	ENST00000389623	T	0.01902	4.57	2.21	2.21	0.28008	.	.	.	.	.	T	0.02119	0.0066	L	0.27053	0.805	0.09310	N	1	B	0.23854	0.092	B	0.14023	0.01	T	0.42361	-0.9456	9	0.72032	D	0.01	.	8.4195	0.32692	0.0:1.0:0.0:0.0	.	1325	A1L4H1	SRCRL_HUMAN	T	1325	ENSP00000374274:P1325T	ENSP00000374274:P1325T	P	+	1	0	SSC5D	60721428	0.006000	0.16342	0.012000	0.15200	0.113000	0.19764	0.520000	0.22878	1.174000	0.42811	0.165000	0.16767	CCC	.		0.597	SSC5D-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000453345.2	XM_001718392	
ZNF444	55311	hgsc.bcm.edu	37	19	56658405	56658405	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr19:56658405G>A	ENST00000337080.3	+	3	492	c.125G>A	c.(124-126)cGc>cAc	p.R42H	ZNF444_ENST00000592949.1_Missense_Mutation_p.R42H	NM_001253792.1|NM_018337.3	NP_001240721.1|NP_060807.2	Q8N0Y2	ZN444_HUMAN	zinc finger protein 444	42	SCAN box. {ECO:0000255|PROSITE- ProRule:PRU00187}.				regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)			NS(1)|endometrium(1)|lung(5)	7		Colorectal(82;3.46e-05)|Ovarian(87;0.0822)|Renal(1328;0.157)		GBM - Glioblastoma multiforme(193;0.0531)		GGGCTGCTCCGCGCCCTGTGC	0.746																																					p.R42H		.											.	ZNF444-90	0			c.G125A						.						6.0	7.0	7.0					19																	56658405		1979	3941	5920	SO:0001583	missense	55311	exon3			TGCTCCGCGCCCT	AB052954	CCDS12939.1, CCDS59426.1	19q13.43	2013-01-09			ENSG00000167685	ENSG00000167685		"""-"", ""Zinc fingers, C2H2-type"""	16052	protein-coding gene	gene with protein product		607874				11978792, 19760602	Standard	NM_001253792		Approved	ZSCAN17, FLJ11137, EZF2	uc002qmm.3	Q8N0Y2		ENST00000337080.3:c.125G>A	19.37:g.56658405G>A	ENSP00000338860:p.Arg42His	Somatic	2	0		WXS	Illumina GAIIx	Phase_I	9	8	NM_001253792	0	0	9	15	6	Q8TEQ9|Q8WU35|Q9NUU1	Missense_Mutation	SNP	ENST00000337080.3	37	CCDS12939.1	.	.	.	.	.	.	.	.	.	.	G	21.0	4.074791	0.76415	.	.	ENSG00000167685	ENST00000337080	T	0.05649	3.41	3.7	3.7	0.42460	Retrovirus capsid, C-terminal (1);Transcription regulator SCAN (3);	.	.	.	.	T	0.22666	0.0547	M	0.79475	2.455	0.33192	D	0.551046	D;D	0.76494	0.999;0.999	D;D	0.78314	0.984;0.991	T	0.16958	-1.0385	9	0.37606	T	0.19	.	11.6447	0.51255	0.0:0.0:1.0:0.0	.	42;42	Q8N0Y2-2;Q8N0Y2	.;ZN444_HUMAN	H	42	ENSP00000338860:R42H	ENSP00000338860:R42H	R	+	2	0	ZNF444	61350217	0.009000	0.17119	0.750000	0.31169	0.874000	0.50279	1.142000	0.31540	2.002000	0.58637	0.484000	0.47621	CGC	.		0.746	ZNF444-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000457503.1	NM_018337	
ZNF211	10520	hgsc.bcm.edu;bcgsc.ca	37	19	58153343	58153345	+	In_Frame_Del	DEL	ATT	ATT	-			TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10	ATT	ATT	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr19:58153343_58153345delATT	ENST00000347302.3	+	3	1668_1670	c.1489_1491delATT	c.(1489-1491)attdel	p.I497del	ZNF211_ENST00000544273.1_In_Frame_Del_p.I509del|ZNF211_ENST00000391703.3_In_Frame_Del_p.I436del|ZNF211_ENST00000254182.7_In_Frame_Del_p.I488del|ZNF211_ENST00000541801.1_In_Frame_Del_p.I488del|ZNF211_ENST00000420680.1_In_Frame_Del_p.I501del|ZNF211_ENST00000240731.4_In_Frame_Del_p.I510del|ZNF211_ENST00000299871.5_In_Frame_Del_p.I562del	NM_198855.2	NP_942152.1	Q13398	ZN211_HUMAN	zinc finger protein 211	497					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(8)|ovary(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	26		Colorectal(82;5.46e-05)|all_neural(62;0.0218)|Breast(46;0.0389)|Ovarian(87;0.0443)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.026)		ATCTAACCTCATTAAACACCTGA	0.443																																					p.562_562del		.											.	ZNF211-92	0			c.1684_1686del						.																																			SO:0001651	inframe_deletion	10520	exon5			AACCTCATTAAAC	U38904	CCDS12956.1, CCDS12957.1, CCDS58686.1, CCDS58687.1, CCDS58688.1, CCDS74468.1	19q13.4	2013-01-08			ENSG00000121417	ENSG00000121417		"""Zinc fingers, C2H2-type"", ""-"""	13003	protein-coding gene	gene with protein product		601856				7633419, 9096115	Standard	NM_006385		Approved	ZNF-25, CH2H2-25	uc031rng.1	Q13398	OTTHUMG00000168012	ENST00000347302.3:c.1489_1491delATT	19.37:g.58153343_58153345delATT	ENSP00000339562:p.Ile497del	Somatic	99	0		WXS	Illumina GAIIx	Phase_I	213	104	NM_001265597	0	0	0	0	0	B4DH10|B4DLC9|B4E3C9|B9ZVS7|B9ZVW1|F8WDV2|Q05BQ7|Q2TAL7|Q59EG4|Q59G36|Q5EBL6	In_Frame_Del	DEL	ENST00000347302.3	37	CCDS12957.1																																																																																			.		0.443	ZNF211-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000397502.1		
TAF1B	9014	hgsc.bcm.edu;bcgsc.ca	37	2	10059788	10059788	+	Frame_Shift_Del	DEL	A	A	-			TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr2:10059788delA	ENST00000263663.5	+	14	1592	c.1404delA	c.(1402-1404)ggafs	p.G468fs	TAF1B_ENST00000396242.3_Frame_Shift_Del_p.G213fs	NM_005680.2	NP_005671	Q53T94	TAF1B_HUMAN	TATA box binding protein (TBP)-associated factor, RNA polymerase I, B, 63kDa	468					gene expression (GO:0010467)|RNA polymerase I transcriptional preinitiation complex assembly at the promoter for the nuclear large rRNA transcript (GO:0001189)|termination of RNA polymerase I transcription (GO:0006363)|transcription elongation from RNA polymerase I promoter (GO:0006362)|transcription from RNA polymerase I promoter (GO:0006360)|transcription initiation from RNA polymerase I promoter (GO:0006361)|transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|RNA polymerase I core factor complex (GO:0070860)	metal ion binding (GO:0046872)|RNA polymerase I CORE element sequence-specific DNA binding (GO:0001164)|RNA polymerase I CORE element sequence-specific DNA binding transcription factor recruiting transcription factor activity (GO:0001187)|sequence-specific DNA binding transcription factor activity (GO:0003700)|TBP-class protein binding (GO:0017025)			breast(2)|central_nervous_system(1)|endometrium(1)|kidney(1)|lung(4)|ovary(2)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	14	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)					CAACTGCTGGAAAAAAAAGCC	0.418																																					p.G468fs		.											.	TAF1B-92	0			c.1404delA						.						76.0	73.0	74.0					2																	10059788		2203	4300	6503	SO:0001589	frameshift_variant	9014	exon14			TGCTGGAAAAAAA	L39061	CCDS33143.1	2p25	2008-06-02	2002-08-29		ENSG00000115750	ENSG00000115750			11533	protein-coding gene	gene with protein product		604904	"""TATA box binding protein (TBP)-associated factor, RNA polymerase I, B, 63kD"""			7801123	Standard	NM_005680		Approved	TAFI63, SL1, RAF1B, RAFI63	uc002qzz.3	Q53T94	OTTHUMG00000151673	ENST00000263663.5:c.1404delA	2.37:g.10059788delA	ENSP00000263663:p.Gly468fs	Somatic	141	1		WXS	Illumina GAIIx	Phase_I	164	33	NM_005680	0	0	0	0	0	B4DI42|F8WD72|Q15574|Q8WVC3	Frame_Shift_Del	DEL	ENST00000263663.5	37	CCDS33143.1																																																																																			.		0.418	TAF1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323426.2	NM_005680	
GRHL1	29841	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	10105471	10105471	+	Silent	SNP	C	C	T			TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr2:10105471C>T	ENST00000324907.9	+	8	1207	c.1071C>T	c.(1069-1071)aaC>aaT	p.N357N	GRHL1_ENST00000405379.2_Silent_p.N357N|GRHL1_ENST00000324883.5_Silent_p.N168N	NM_198182.2	NP_937825.2	Q9NZI5	GRHL1_HUMAN	grainyhead-like 1 (Drosophila)	357					cellular lipid metabolic process (GO:0044255)|multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)			cervix(1)|endometrium(1)|large_intestine(2)|lung(8)|ovary(1)|pancreas(1)|skin(1)|stomach(1)|urinary_tract(1)	17	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)			Epithelial(75;0.172)|OV - Ovarian serous cystadenocarcinoma(76;0.246)		TTGCGTATAACGCCATTTCCT	0.448																																					p.N357N		.											.	GRHL1-92	0			c.C1071T						.						145.0	138.0	141.0					2																	10105471		2203	4300	6503	SO:0001819	synonymous_variant	29841	exon8			GTATAACGCCATT	AF198489	CCDS33144.1, CCDS33144.2	2p25.2	2008-02-05	2005-07-11	2005-07-11	ENSG00000134317	ENSG00000134317			17923	protein-coding gene	gene with protein product		609786	"""transcription factor CP2-like 2"""	TFCP2L2		10644752, 12393799	Standard	NM_198182		Approved	LBP-32, MGR	uc002raa.3	Q9NZI5	OTTHUMG00000151704	ENST00000324907.9:c.1071C>T	2.37:g.10105471C>T		Somatic	74	0		WXS	Illumina GAIIx	Phase_I	73	67	NM_198182	0	0	0	0	0	A6NLA4|B2R7E4|B5MEC2|Q53T93|Q6NWN7|Q6NWN8|Q6NWN9|Q8NI33	Silent	SNP	ENST00000324907.9	37	CCDS33144.2																																																																																			.		0.448	GRHL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323543.2	NM_014552	
LOXL3	84695	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	74779681	74779681	+	Silent	SNP	C	C	T	rs376297326		TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr2:74779681C>T	ENST00000264094.3	-	2	152	c.81G>A	c.(79-81)ccG>ccA	p.P27P	LOXL3_ENST00000393937.2_Silent_p.P27P|LOXL3_ENST00000409549.1_Silent_p.P27P|LOXL3_ENST00000409986.1_Silent_p.P27P|DOK1_ENST00000409429.1_Intron|DOK1_ENST00000233668.5_5'Flank|LOXL3_ENST00000484369.1_5'UTR|LOXL3_ENST00000409249.1_Silent_p.P27P|DOK1_ENST00000340004.6_5'Flank	NM_032603.2	NP_115992.1	P58215	LOXL3_HUMAN	lysyl oxidase-like 3	27					epithelial to mesenchymal transition (GO:0001837)|negative regulation of transcription, DNA-templated (GO:0045892)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|membrane (GO:0016020)|nucleus (GO:0005634)	copper ion binding (GO:0005507)|protein-lysine 6-oxidase activity (GO:0004720)|scavenger receptor activity (GO:0005044)			endometrium(7)|kidney(2)|large_intestine(9)|lung(9)|ovary(1)|prostate(1)|urinary_tract(1)	30						TGGAAGGGGACGGAGACCCCA	0.682																																					p.P27P		.											.	LOXL3-226	0			c.G81A						.	C	,	0,4398		0,0,2199	13.0	14.0	14.0		,81	-9.2	0.1	2		14	1,8591		0,1,4295	no	intron,coding-synonymous	DOK1,LOXL3	NM_001197260.1,NM_032603.2	,	0,1,6494	TT,TC,CC		0.0116,0.0,0.0077	,	,27/754	74779681	1,12989	2199	4296	6495	SO:0001819	synonymous_variant	84695	exon2			AGGGGACGGAGAC	AF282619	CCDS1953.1, CCDS74527.1	2p13	2008-05-23			ENSG00000115318	ENSG00000115318			13869	protein-coding gene	gene with protein product		607163				11386757	Standard	NM_032603		Approved		uc002smp.1	P58215	OTTHUMG00000129953	ENST00000264094.3:c.81G>A	2.37:g.74779681C>T		Somatic	142	0		WXS	Illumina GAIIx	Phase_I	175	16	NM_032603	0	0	0	0	0	D6W5J1|Q2EHP2|Q6IPL7|Q96RS1	Silent	SNP	ENST00000264094.3	37	CCDS1953.1																																																																																			.		0.682	LOXL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252215.1	NM_032603	
HK2	3099	ucsc.edu;bcgsc.ca	37	2	75105940	75105940	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr2:75105940G>A	ENST00000290573.2	+	9	1757	c.1157G>A	c.(1156-1158)tGc>tAc	p.C386Y	HK2_ENST00000409174.1_Missense_Mutation_p.C358Y	NM_000189.4	NP_000180.2	P52789	HXK2_HUMAN	hexokinase 2	386	Hexokinase type-2 1.|Regulatory.				apoptotic mitochondrial changes (GO:0008637)|carbohydrate metabolic process (GO:0005975)|cellular glucose homeostasis (GO:0001678)|glucose 6-phosphate metabolic process (GO:0051156)|glucose metabolic process (GO:0006006)|glucose transport (GO:0015758)|glycolytic process (GO:0006096)|hexose transport (GO:0008645)|lactation (GO:0007595)|regulation of glucose import (GO:0046324)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)	cytosol (GO:0005829)|membrane (GO:0016020)|mitochondrial outer membrane (GO:0005741)	ATP binding (GO:0005524)|fructokinase activity (GO:0008865)|glucokinase activity (GO:0004340)|glucose binding (GO:0005536)|hexokinase activity (GO:0004396)|mannokinase activity (GO:0019158)			breast(2)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(5)|lung(22)|ovary(2)|prostate(1)|skin(2)|stomach(1)|urinary_tract(1)	43						GCCAGCCTGTGCGCAGCCACC	0.642																																					p.C386Y		.											.	HK2-252	0			c.G1157A						.						16.0	13.0	14.0					2																	75105940		2176	4250	6426	SO:0001583	missense	3099	exon9			GCCTGTGCGCAGC		CCDS1956.1	2p13	2010-03-19			ENSG00000159399	ENSG00000159399	2.7.1.1		4923	protein-coding gene	gene with protein product		601125					Standard	NM_000189		Approved		uc002snd.3	P52789	OTTHUMG00000129972	ENST00000290573.2:c.1157G>A	2.37:g.75105940G>A	ENSP00000290573:p.Cys386Tyr	Somatic	142	2		WXS	Illumina GAIIx	Phase_I	346	133	NM_000189	0	0	0	0	0	D6W5J2|Q8WU87|Q9UN82	Missense_Mutation	SNP	ENST00000290573.2	37	CCDS1956.1	.	.	.	.	.	.	.	.	.	.	G	19.49	3.836638	0.71373	.	.	ENSG00000159399	ENST00000290573;ENST00000535740;ENST00000409174	D;D	0.96774	-4.12;-4.12	4.65	4.65	0.58169	Hexokinase, C-terminal (1);	0.000000	0.85682	D	0.000000	D	0.97185	0.9080	L	0.60957	1.885	0.80722	D	1	D	0.76494	0.999	D	0.66497	0.944	D	0.97580	1.0110	10	0.87932	D	0	-15.9228	15.404	0.74863	0.0:0.0:1.0:0.0	.	386	P52789	HXK2_HUMAN	Y	386;386;358	ENSP00000290573:C386Y;ENSP00000387140:C358Y	ENSP00000290573:C386Y	C	+	2	0	HK2	74959448	0.996000	0.38824	0.986000	0.45419	0.912000	0.54170	2.320000	0.43797	2.567000	0.86603	0.655000	0.94253	TGC	.		0.642	HK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252238.2	NM_000189	
CAPG	822	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	85628351	85628351	+	Silent	SNP	G	G	A			TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr2:85628351G>A	ENST00000409921.1	-	5	519	c.453C>T	c.(451-453)acC>acT	p.T151T	CAPG_ENST00000483659.1_5'UTR|CAPG_ENST00000263867.4_Silent_p.T151T|CAPG_ENST00000409670.1_Silent_p.T151T|CAPG_ENST00000409724.1_Silent_p.T151T			Q9BPX3	CND3_HUMAN	capping protein (actin filament), gelsolin-like	887					mitotic cell cycle (GO:0000278)|mitotic chromosome condensation (GO:0007076)	actin cytoskeleton (GO:0015629)|centrosome (GO:0005813)|condensin complex (GO:0000796)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)				endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(6)	11						GTGCCCGCTCGGTGGCACGGA	0.582																																					p.T151T		.											.	CAPG-204	0			c.C453T						.						179.0	170.0	173.0					2																	85628351		2203	4300	6503	SO:0001819	synonymous_variant	822	exon5			CCGCTCGGTGGCA	M94345	CCDS1974.1, CCDS58715.1	2p11.2	2008-06-04			ENSG00000042493	ENSG00000042493			1474	protein-coding gene	gene with protein product	"""macrophage capping protein"""	153615		AFCP		1322908, 12754261	Standard	NM_001747		Approved	MCP	uc010fgi.2	P40121	OTTHUMG00000130183	ENST00000409921.1:c.453C>T	2.37:g.85628351G>A		Somatic	195	0		WXS	Illumina GAIIx	Phase_I	183	161	NM_001256140	0	0	5	5	0	Q3MJE0|Q96SV9|Q9BUR3|Q9BVY1|Q9H914|Q9H9Z6|Q9HBI9	Silent	SNP	ENST00000409921.1	37	CCDS58715.1																																																																																			.		0.582	CAPG-004	NOVEL	basic|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000329383.1	NM_001747	
CAPG	822	ucsc.edu;bcgsc.ca	37	2	85628769	85628769	+	Silent	SNP	G	G	A			TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr2:85628769G>A	ENST00000409921.1	-	4	300	c.234C>T	c.(232-234)gcC>gcT	p.A78A	CAPG_ENST00000483659.1_5'UTR|CAPG_ENST00000263867.4_Silent_p.A78A|CAPG_ENST00000409670.1_Silent_p.A78A|CAPG_ENST00000409724.1_Silent_p.A78A			Q9BPX3	CND3_HUMAN	capping protein (actin filament), gelsolin-like	0					mitotic cell cycle (GO:0000278)|mitotic chromosome condensation (GO:0007076)	actin cytoskeleton (GO:0015629)|centrosome (GO:0005813)|condensin complex (GO:0000796)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)		p.A78A(1)		endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(6)	11						CAGCCAGCACGGCACAGGCCC	0.652																																					p.A78A		.											.	CAPG-204	1	Substitution - coding silent(1)	lung(1)	c.C234T						.						41.0	42.0	42.0					2																	85628769		2203	4300	6503	SO:0001819	synonymous_variant	822	exon4			CAGCACGGCACAG	M94345	CCDS1974.1, CCDS58715.1	2p11.2	2008-06-04			ENSG00000042493	ENSG00000042493			1474	protein-coding gene	gene with protein product	"""macrophage capping protein"""	153615		AFCP		1322908, 12754261	Standard	NM_001747		Approved	MCP	uc010fgi.2	P40121	OTTHUMG00000130183	ENST00000409921.1:c.234C>T	2.37:g.85628769G>A		Somatic	113	2		WXS	Illumina GAIIx	Phase_I	141	123	NM_001256140	0	0	5	5	0	Q3MJE0|Q96SV9|Q9BUR3|Q9BVY1|Q9H914|Q9H9Z6|Q9HBI9	Silent	SNP	ENST00000409921.1	37	CCDS58715.1																																																																																			.		0.652	CAPG-004	NOVEL	basic|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000329383.1	NM_001747	
ZAP70	7535	broad.mit.edu	37	2	98354472	98354472	+	Silent	SNP	G	G	A	rs115143372	byFrequency	TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr2:98354472G>A	ENST00000264972.5	+	13	1853	c.1638G>A	c.(1636-1638)ccG>ccA	p.P546P	ZAP70_ENST00000442208.1_Silent_p.P420P|ZAP70_ENST00000463643.1_3'UTR|ZAP70_ENST00000451498.2_Silent_p.P239P	NM_001079.3	NP_001070.2	P43403	ZAP70_HUMAN	zeta-chain (TCR) associated protein kinase 70kDa	546	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				adaptive immune response (GO:0002250)|B cell activation (GO:0042113)|beta selection (GO:0043366)|immune response (GO:0006955)|intracellular signal transduction (GO:0035556)|negative thymic T cell selection (GO:0045060)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of alpha-beta T cell differentiation (GO:0046638)|positive regulation of alpha-beta T cell proliferation (GO:0046641)|positive regulation of calcium-mediated signaling (GO:0050850)|positive regulation of T cell differentiation (GO:0045582)|positive thymic T cell selection (GO:0045059)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|T cell activation (GO:0042110)|T cell aggregation (GO:0070489)|T cell differentiation (GO:0030217)|T cell migration (GO:0072678)|T cell receptor signaling pathway (GO:0050852)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|immunological synapse (GO:0001772)|plasma membrane (GO:0005886)|T cell receptor complex (GO:0042101)	ATP binding (GO:0005524)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein tyrosine kinase activity (GO:0004713)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(4)|lung(15)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	29						TGAAAGGGCCGGAGGTCATGG	0.607													G|||	4	0.000798722	0.0023	0.0014	5008	,	,		17959	0.0		0.0	False		,,,				2504	0.0				p.P546P		.											.	ZAP70-955	0			c.G1638A						.	G	,	12,4394	19.1+/-41.9	0,12,2191	68.0	69.0	69.0		1638,717	-9.9	0.7	2	dbSNP_133	69	0,8598		0,0,4299	no	coding-synonymous,coding-synonymous	ZAP70	NM_001079.3,NM_207519.1	,	0,12,6490	AA,AG,GG		0.0,0.2724,0.0923	,	546/620,239/313	98354472	12,12992	2203	4299	6502	SO:0001819	synonymous_variant	7535	exon13			AGGGCCGGAGGTC	L05148	CCDS33254.1, CCDS33255.1	2q11-q13	2014-09-17	2002-08-29		ENSG00000115085	ENSG00000115085		"""SH2 domain containing"""	12858	protein-coding gene	gene with protein product		176947	"""zeta-chain (TCR) associated protein kinase (70 kD)"""	SRK		1423621	Standard	NM_001079		Approved	ZAP-70, STD	uc002syd.1	P43403	OTTHUMG00000153060	ENST00000264972.5:c.1638G>A	2.37:g.98354472G>A		Somatic	223	0		WXS	Illumina GAIIx	Phase_I	194	4	NM_001079	0	0	0	0	0	A6NFP4|Q6PIA4|Q8IXD6|Q9UBS6	Silent	SNP	ENST00000264972.5	37	CCDS33254.1																																																																																			G|0.999;A|0.001		0.607	ZAP70-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000329278.1		
NPHP1	4867	broad.mit.edu;bcgsc.ca	37	2	110962528	110962528	+	Silent	SNP	C	C	T			TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr2:110962528C>T	ENST00000393272.3	-	1	115	c.18G>A	c.(16-18)caG>caA	p.Q6Q	NPHP1_ENST00000316534.4_Silent_p.Q6Q|NPHP1_ENST00000445609.2_Silent_p.Q6Q|NPHP1_ENST00000418527.1_Silent_p.Q6Q|NPHP1_ENST00000355301.4_Silent_p.Q6Q|NPHP1_ENST00000417665.1_Silent_p.Q6Q	NM_000272.3|NM_207181.2	NP_000263.2|NP_997064.2	O15259	NPHP1_HUMAN	nephronophthisis 1 (juvenile)	6					actin cytoskeleton organization (GO:0030036)|cell projection organization (GO:0030030)|cellular protein localization (GO:0034613)|excretion (GO:0007588)|photoreceptor cell outer segment organization (GO:0035845)|retina development in camera-type eye (GO:0060041)|signal transduction (GO:0007165)|single organismal cell-cell adhesion (GO:0016337)|spermatid differentiation (GO:0048515)|visual behavior (GO:0007632)	cell-cell junction (GO:0005911)|ciliary transition zone (GO:0035869)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|membrane (GO:0016020)|motile cilium (GO:0031514)|photoreceptor connecting cilium (GO:0032391)|tight junction (GO:0005923)	structural molecule activity (GO:0005198)			autonomic_ganglia(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(6)|lung(10)|ovary(2)	24						GAGGATCTCGCTGTCGTCTCG	0.667																																					p.Q6Q		.											.	NPHP1-92	0			c.G18A						.						43.0	43.0	43.0					2																	110962528		2203	4300	6503	SO:0001819	synonymous_variant	4867	exon1			ATCTCGCTGTCGT	AF023674	CCDS2086.1, CCDS46384.1, CCDS46385.1, CCDS46386.1	2q13	2014-01-28			ENSG00000144061	ENSG00000144061			7905	protein-coding gene	gene with protein product	"""nephrocystin-1"""	607100		NPH1			Standard	NM_000272		Approved	JBTS4, SLSN1	uc002tfm.4	O15259	OTTHUMG00000131195	ENST00000393272.3:c.18G>A	2.37:g.110962528C>T		Somatic	89	2		WXS	Illumina GAIIx	Phase_I	183	62	NM_207181	0	0	5	8	3	O14837	Silent	SNP	ENST00000393272.3	37	CCDS46385.1																																																																																			.		0.667	NPHP1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000253919.3	NM_000272	
MAP3K19	80122	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	135738728	135738728	+	Missense_Mutation	SNP	T	T	C			TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr2:135738728T>C	ENST00000375845.3	-	9	3613	c.3583A>G	c.(3583-3585)Atg>Gtg	p.M1195V	MAP3K19_ENST00000375844.3_Missense_Mutation_p.M377V|MAP3K19_ENST00000392917.3_Missense_Mutation_p.M327V|MAP3K19_ENST00000358371.4_Missense_Mutation_p.M1082V|MAP3K19_ENST00000392915.1_3'UTR|MAP3K19_ENST00000392918.3_Missense_Mutation_p.M329V|MAP3K19_ENST00000315513.3_Missense_Mutation_p.M56V	NM_001018044.2|NM_025052.3	NP_001018054.1|NP_079328.3	Q56UN5	M3K19_HUMAN	mitogen-activated protein kinase kinase kinase 19	1195	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.						ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)										CCAGTTGGCATGAGCATAACA	0.428																																					p.M1195V		.											.	.	0			c.A3583G						.						134.0	131.0	132.0					2																	135738728		2203	4300	6503	SO:0001583	missense	80122	exon9			TTGGCATGAGCAT	AK026727	CCDS2176.2, CCDS33293.1, CCDS63021.1, CCDS63020.1, CCDS63022.1	2q21.3	2012-10-16	2012-10-16	2012-10-16	ENSG00000176601	ENSG00000176601		"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	26249	protein-coding gene	gene with protein product			"""Yeast Sps1/Ste20-related kinase 4 (S. cerevisiae)"", ""yeast Sps1/Ste20-related kinase 4 (S. cerevisiae)"", ""YSK4 Sps1/Ste20-related kinase homolog (S. cerevisiae)"""	YSK4		12477932	Standard	NM_001282883		Approved	FLJ23074	uc002tue.1	Q56UN5	OTTHUMG00000074083	ENST00000375845.3:c.3583A>G	2.37:g.135738728T>C	ENSP00000365005:p.Met1195Val	Somatic	48	0		WXS	Illumina GAIIx	Phase_I	56	51	NM_025052	0	0	0	0	0	B2RP57|B7ZMH9|E2QRE3|Q56UN1|Q56UN2|Q56UN3|Q56UN4|Q8N4E9|Q9H5T2	Missense_Mutation	SNP	ENST00000375845.3	37	CCDS2176.2	.	.	.	.	.	.	.	.	.	.	T	14.54	2.566360	0.45694	.	.	ENSG00000176601	ENST00000375845;ENST00000358371;ENST00000375844;ENST00000392918;ENST00000392917;ENST00000437365;ENST00000315513	T;T;T;T;T;T;T	0.24151	1.87;1.87;1.87;1.87;1.87;1.87;1.87	5.88	4.74	0.60224	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.56097	D	0.000027	T	0.23926	0.0579	N	0.10645	0.015	0.41287	D	0.986955	B;P;B;B;P	0.44380	0.145;0.811;0.274;0.274;0.834	B;P;B;B;P	0.54544	0.069;0.554;0.122;0.122;0.755	T	0.12268	-1.0554	10	0.87932	D	0	.	10.6739	0.45774	0.0:0.0739:0.0:0.9261	.	327;1082;329;377;1195	B7ZMH9;Q56UN5-3;Q56UN5-4;Q56UN5-5;Q56UN5	.;.;.;.;YSK4_HUMAN	V	1195;1082;377;329;327;585;56	ENSP00000365005:M1195V;ENSP00000351140:M1082V;ENSP00000365004:M377V;ENSP00000376650:M329V;ENSP00000376649:M327V;ENSP00000392827:M585V;ENSP00000321160:M56V	ENSP00000321160:M56V	M	-	1	0	YSK4	135455198	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	6.091000	0.71406	2.246000	0.74042	0.533000	0.62120	ATG	.		0.428	MAP3K19-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000158244.1	NM_025052	
PLA2R1	22925	bcgsc.ca	37	2	160869814	160869814	+	Missense_Mutation	SNP	C	C	T	rs530179642		TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr2:160869814C>T	ENST00000283243.7	-	10	1830	c.1624G>A	c.(1624-1626)Ggt>Agt	p.G542S	PLA2R1_ENST00000392771.1_Missense_Mutation_p.G542S	NM_001195641.1|NM_007366.4	NP_001182570.1|NP_031392.3	Q13018	PLA2R_HUMAN	phospholipase A2 receptor 1, 180kDa	542	C-type lectin 3. {ECO:0000255|PROSITE- ProRule:PRU00040}.				cytokine production (GO:0001816)|negative regulation of arachidonic acid secretion (GO:1900139)|negative regulation of phospholipase A2 activity (GO:1900138)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of arachidonic acid secretion (GO:0090238)|positive regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043517)|reactive oxygen species metabolic process (GO:0072593)|receptor-mediated endocytosis (GO:0006898)|replicative senescence (GO:0090399)	cell surface (GO:0009986)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	carbohydrate binding (GO:0030246)|phospholipase binding (GO:0043274)|receptor activity (GO:0004872)	p.G542S(1)	PLA2R1/RBMS1(2)	central_nervous_system(1)|endometrium(8)|kidney(2)|large_intestine(17)|lung(20)|ovary(1)|pancreas(1)|prostate(1)|skin(7)|stomach(1)|upper_aerodigestive_tract(1)	60						CAGTAATAACCGCTGGAAGCT	0.388																																					p.G542S		.											.	PLA2R1-93	1	Substitution - Missense(1)	large_intestine(1)	c.G1624A						.						123.0	121.0	121.0					2																	160869814		2203	4300	6503	SO:0001583	missense	22925	exon10			AATAACCGCTGGA	U17033	CCDS33309.1, CCDS42767.1	2q23-q24	2011-08-30	2002-08-29		ENSG00000153246	ENSG00000153246		"""C-type lectin domain containing"""	9042	protein-coding gene	gene with protein product		604939	"""phospholipase A2 receptor 1, 180kD"""			7721806, 7925459	Standard	NM_007366		Approved	PLA2G1R, PLA2IR, PLA2-R, CLEC13C	uc002ube.2	Q13018	OTTHUMG00000154087	ENST00000283243.7:c.1624G>A	2.37:g.160869814C>T	ENSP00000283243:p.Gly542Ser	Somatic	53	0		WXS	Illumina GAIIx	Phase_I	70	4	NM_001195641	0	0	3	3	0	B2RTU9|D3DPB1|Q13019|Q15095|Q53R45|Q53RR7	Missense_Mutation	SNP	ENST00000283243.7	37	CCDS33309.1	.	.	.	.	.	.	.	.	.	.	C	33	5.203806	0.95033	.	.	ENSG00000153246	ENST00000283243;ENST00000392771	T;T	0.06768	3.3;3.26	5.26	5.26	0.73747	C-type lectin fold (1);C-type lectin-like (1);C-type lectin (2);	0.000000	0.85682	D	0.000000	T	0.28665	0.0710	M	0.71036	2.16	0.58432	D	0.999998	P;D;D	0.89917	0.635;1.0;1.0	B;D;D	0.97110	0.36;1.0;1.0	T	0.01397	-1.1365	10	0.22109	T	0.4	.	19.2342	0.93851	0.0:1.0:0.0:0.0	.	542;542;542	B7ZML4;Q13018-2;Q13018	.;.;PLA2R_HUMAN	S	542	ENSP00000283243:G542S;ENSP00000376524:G542S	ENSP00000283243:G542S	G	-	1	0	PLA2R1	160578060	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	5.274000	0.65569	2.608000	0.88229	0.650000	0.86243	GGT	.		0.388	PLA2R1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000333820.1		
SLC40A1	30061	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	190430180	190430180	+	Silent	SNP	G	G	A	rs368843037		TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr2:190430180G>A	ENST00000261024.2	-	6	1086	c.660C>T	c.(658-660)taC>taT	p.Y220Y		NM_014585.5	NP_055400.1	Q9NP59	S40A1_HUMAN	solute carrier family 40 (iron-regulated transporter), member 1	220					anatomical structure morphogenesis (GO:0009653)|cellular iron ion homeostasis (GO:0006879)|endothelium development (GO:0003158)|iron ion transmembrane transport (GO:0034755)|lymphocyte homeostasis (GO:0002260)|multicellular organismal iron ion homeostasis (GO:0060586)|negative regulation of apoptotic process (GO:0043066)|regulation of transcription from RNA polymerase II promoter in response to iron (GO:0034395)|spleen trabecula formation (GO:0060345)|transmembrane transport (GO:0055085)	basolateral plasma membrane (GO:0016323)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)|multivesicular body (GO:0005771)|plasma membrane (GO:0005886)|synaptic vesicle (GO:0008021)	iron ion transmembrane transporter activity (GO:0005381)			endometrium(3)|large_intestine(1)|lung(6)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	14			OV - Ovarian serous cystadenocarcinoma(117;0.000917)|Epithelial(96;0.014)|all cancers(119;0.0491)			AGAGCAGAACGTACTCCACGC	0.473													G|||	1	0.000199681	0.0	0.0014	5008	,	,		19656	0.0		0.0	False		,,,				2504	0.0				p.Y220Y		.											.	SLC40A1-91	0			c.C660T						.						90.0	87.0	88.0					2																	190430180		2203	4300	6503	SO:0001819	synonymous_variant	30061	exon6			CAGAACGTACTCC	AF215636	CCDS2299.1	2q32	2014-09-17	2003-06-04	2003-06-05	ENSG00000138449	ENSG00000138449		"""Solute carriers"""	10909	protein-coding gene	gene with protein product	"""ferroportin 1"""	604653	"""solute carrier family 11 (proton-coupled divalent metal ion transporters), member 3"""	SLC11A3		10828623	Standard	NM_014585		Approved	MTP1, IREG1, FPN1, HFE4	uc002uqp.4	Q9NP59	OTTHUMG00000132662	ENST00000261024.2:c.660C>T	2.37:g.190430180G>A		Somatic	114	0		WXS	Illumina GAIIx	Phase_I	130	106	NM_014585	0	0	0	0	0	Q6FI62|Q7Z4F8|Q8IVB2|Q9NRL0	Silent	SNP	ENST00000261024.2	37	CCDS2299.1																																																																																			.		0.473	SLC40A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255916.2		
ORMDL1	94101	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	190640321	190640321	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr2:190640321C>T	ENST00000325795.3	-	2	1082	c.296G>A	c.(295-297)cGg>cAg	p.R99Q	ORMDL1_ENST00000409519.1_Missense_Mutation_p.R99Q|ORMDL1_ENST00000496543.1_5'Flank|ORMDL1_ENST00000392350.3_Missense_Mutation_p.R99Q|ORMDL1_ENST00000392349.4_Missense_Mutation_p.R99Q			Q9P0S3	ORML1_HUMAN	ORMDL sphingolipid biosynthesis regulator 1	99					ceramide metabolic process (GO:0006672)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)				breast(1)|urinary_tract(1)	2			OV - Ovarian serous cystadenocarcinoma(117;0.00177)|Epithelial(96;0.0317)|all cancers(119;0.0889)			GAAAAACTTCCGTGAAGATGT	0.393																																					p.R99Q		.											.	ORMDL1-68	0			c.G296A						.						90.0	88.0	88.0					2																	190640321		2203	4300	6503	SO:0001583	missense	94101	exon4			AACTTCCGTGAAG		CCDS2301.1	2q32	2014-06-16	2014-06-16		ENSG00000128699	ENSG00000128699			16036	protein-coding gene	gene with protein product		610073	"""ORM1 (S. cerevisiae)-like 1"", ""ORM1-like 1 (S. cerevisiae)"""			12093374, 23066021	Standard	NM_016467		Approved		uc002ure.4	Q9P0S3	OTTHUMG00000132661	ENST00000325795.3:c.296G>A	2.37:g.190640321C>T	ENSP00000326869:p.Arg99Gln	Somatic	64	1		WXS	Illumina GAIIx	Phase_I	69	20	NM_016467	0	0	26	37	11	B2R8W3|D3DPH9	Missense_Mutation	SNP	ENST00000325795.3	37	CCDS2301.1	.	.	.	.	.	.	.	.	.	.	C	21.7	4.186303	0.78789	.	.	ENSG00000128699	ENST00000392350;ENST00000325795;ENST00000392349;ENST00000409519;ENST00000442547;ENST00000458355	.	.	.	4.84	4.84	0.62591	.	0.057350	0.64402	D	0.000002	T	0.70002	0.3174	M	0.91038	3.17	0.58432	D	0.999996	P	0.36944	0.574	B	0.31869	0.137	T	0.78904	-0.2020	9	0.72032	D	0.01	-3.6348	18.1158	0.89555	0.0:1.0:0.0:0.0	.	99	Q9P0S3	ORML1_HUMAN	Q	99	.	ENSP00000326869:R99Q	R	-	2	0	ORMDL1	190348566	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.849000	0.69465	2.498000	0.84270	0.655000	0.94253	CGG	.		0.393	ORMDL1-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335275.1	NM_016467	
EEF1B2	1933	broad.mit.edu	37	2	207025358	207025358	+	Missense_Mutation	SNP	A	A	G			TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr2:207025358A>G	ENST00000392222.2	+	2	502	c.127A>G	c.(127-129)Agc>Ggc	p.S43G	EEF1B2_ENST00000236957.5_Missense_Mutation_p.S43G|NDUFS1_ENST00000457011.1_5'Flank|SNORA41_ENST00000384675.1_RNA|SNORD51_ENST00000384320.2_RNA|NDUFS1_ENST00000432169.1_5'Flank|NDUFS1_ENST00000455934.2_5'Flank|NDUFS1_ENST00000233190.6_5'Flank|NDUFS1_ENST00000423725.1_5'Flank|NDUFS1_ENST00000449699.1_5'Flank|NDUFS1_ENST00000440274.1_5'Flank|EEF1B2_ENST00000392221.1_Missense_Mutation_p.S43G	NM_001959.3	NP_001950.1	P24534	EF1B_HUMAN	eukaryotic translation elongation factor 1 beta 2	43	GST C-terminal.				cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|translation (GO:0006412)|translational elongation (GO:0006414)	cytosol (GO:0005829)|eukaryotic translation elongation factor 1 complex (GO:0005853)	translation elongation factor activity (GO:0003746)	p.S43G(4)		breast(1)|endometrium(5)|kidney(3)|large_intestine(1)|lung(6)	16						AGCCGTGTCCAGCCCACCGCC	0.468																																					p.S43G		.											.	EEF1B2-227	4	Substitution - Missense(4)	endometrium(2)|lung(1)|kidney(1)	c.A127G						.						109.0	99.0	102.0					2																	207025358		2203	4300	6503	SO:0001583	missense	1933	exon3			GTGTCCAGCCCAC	X60489	CCDS2367.1	2q33.3	2011-04-28			ENSG00000114942	ENSG00000114942			3208	protein-coding gene	gene with protein product		600655				8250921	Standard	NM_001959		Approved		uc002vbf.1	P24534	OTTHUMG00000132891	ENST00000392222.2:c.127A>G	2.37:g.207025358A>G	ENSP00000376056:p.Ser43Gly	Somatic	174	1		WXS	Illumina GAIIx	Phase_I	160	4	NM_021121	1	0	436	438	1	A8K795|Q6IBH9	Missense_Mutation	SNP	ENST00000392222.2	37	CCDS2367.1	.	.	.	.	.	.	.	.	.	.	A	0.014	-1.585588	0.00872	.	.	ENSG00000114942	ENST00000236957;ENST00000392221;ENST00000392222;ENST00000445505	T;T;T;T	0.44482	0.92;0.92;0.92;0.92	5.47	0.911	0.19343	Glutathione S-transferase, C-terminal-like (2);	0.442134	0.26800	N	0.022437	T	0.19846	0.0477	N	0.16098	0.37	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.18745	-1.0327	10	0.17832	T	0.49	-2.1703	6.3337	0.21285	0.2348:0.0:0.6384:0.1268	.	43	P24534	EF1B_HUMAN	G	43	ENSP00000236957:S43G;ENSP00000376055:S43G;ENSP00000376056:S43G;ENSP00000407730:S43G	ENSP00000236957:S43G	S	+	1	0	EEF1B2	206733603	0.049000	0.20398	0.145000	0.22337	0.051000	0.14879	0.879000	0.28146	-0.027000	0.13873	-0.252000	0.11476	AGC	.		0.468	EEF1B2-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336436.1	NM_001037663	
EEF1B2	1933	broad.mit.edu	37	2	207025366	207025366	+	Silent	SNP	G	G	A			TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr2:207025366G>A	ENST00000392222.2	+	2	510	c.135G>A	c.(133-135)ccG>ccA	p.P45P	EEF1B2_ENST00000236957.5_Silent_p.P45P|NDUFS1_ENST00000457011.1_5'Flank|SNORA41_ENST00000384675.1_RNA|SNORD51_ENST00000384320.2_RNA|NDUFS1_ENST00000432169.1_5'Flank|NDUFS1_ENST00000455934.2_5'Flank|NDUFS1_ENST00000233190.6_5'Flank|NDUFS1_ENST00000423725.1_5'Flank|NDUFS1_ENST00000449699.1_5'Flank|NDUFS1_ENST00000440274.1_5'Flank|EEF1B2_ENST00000392221.1_Silent_p.P45P	NM_001959.3	NP_001950.1	P24534	EF1B_HUMAN	eukaryotic translation elongation factor 1 beta 2	45	GST C-terminal.				cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|translation (GO:0006412)|translational elongation (GO:0006414)	cytosol (GO:0005829)|eukaryotic translation elongation factor 1 complex (GO:0005853)	translation elongation factor activity (GO:0003746)	p.P45P(5)		breast(1)|endometrium(5)|kidney(3)|large_intestine(1)|lung(6)	16						CCAGCCCACCGCCTGCCGACT	0.448																																					p.P45P		.											.	EEF1B2-227	5	Substitution - coding silent(5)	kidney(2)|endometrium(2)|lung(1)	c.G135A						.						109.0	99.0	102.0					2																	207025366		2203	4300	6503	SO:0001819	synonymous_variant	1933	exon3			CCCACCGCCTGCC	X60489	CCDS2367.1	2q33.3	2011-04-28			ENSG00000114942	ENSG00000114942			3208	protein-coding gene	gene with protein product		600655				8250921	Standard	NM_001959		Approved		uc002vbf.1	P24534	OTTHUMG00000132891	ENST00000392222.2:c.135G>A	2.37:g.207025366G>A		Somatic	168	1		WXS	Illumina GAIIx	Phase_I	168	4	NM_021121	0	0	364	364	0	A8K795|Q6IBH9	Silent	SNP	ENST00000392222.2	37	CCDS2367.1																																																																																			.		0.448	EEF1B2-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336436.1	NM_001037663	
SPEG	10290	broad.mit.edu	37	2	220354177	220354177	+	Missense_Mutation	SNP	A	A	C			TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr2:220354177A>C	ENST00000312358.7	+	36	8569	c.8437A>C	c.(8437-8439)Aca>Cca	p.T2813P	AC053503.11_ENST00000429882.1_RNA|SPEG_ENST00000485813.1_3'UTR	NM_005876.4	NP_005867.3	Q15772	SPEG_HUMAN	SPEG complex locus	2813	Pro-rich.				cardiac muscle cell development (GO:0055013)|in utero embryonic development (GO:0001701)|muscle organ development (GO:0007517)|negative regulation of cell proliferation (GO:0008285)|respiratory system development (GO:0060541)	nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			breast(2)|central_nervous_system(3)|endometrium(10)|kidney(2)|large_intestine(9)|lung(42)|ovary(5)|pancreas(1)|prostate(8)|skin(1)|stomach(9)|upper_aerodigestive_tract(4)|urinary_tract(4)	100		Renal(207;0.0183)		Epithelial(149;4.5e-10)|all cancers(144;7.93e-08)|Lung(261;0.00639)|LUSC - Lung squamous cell carcinoma(224;0.00829)|READ - Rectum adenocarcinoma(5;0.163)		TGCTGCCCCCACACCCCCGTC	0.677																																					p.T2813P		.											.	SPEG-383	0			c.A8437C						.						29.0	31.0	30.0					2																	220354177		1883	4090	5973	SO:0001583	missense	10290	exon36			GCCCCCACACCCC	BC006346	CCDS42824.1, CCDS54432.1	2q35	2013-01-11	2006-04-27	2006-04-27	ENSG00000072195	ENSG00000072195		"""Immunoglobulin superfamily / I-set domain containing"""	16901	protein-coding gene	gene with protein product		615950	"""aortic preferentially expressed gene 1"""	APEG1		8663449, 10973969	Standard	NM_005876		Approved	MGC12676, KIAA1297, SPEGalpha, SPEGbeta, BPEG	uc010fwg.3	Q15772	OTTHUMG00000058925	ENST00000312358.7:c.8437A>C	2.37:g.220354177A>C	ENSP00000311684:p.Thr2813Pro	Somatic	26	2		WXS	Illumina GAIIx	Phase_I	28	3	NM_005876	0	0	0	0	0	A8K0G6|A8MRU0|Q27J74|Q695L1|Q6FGA6|Q6ZQW1|Q6ZTL8|Q9P2P9	Missense_Mutation	SNP	ENST00000312358.7	37	CCDS42824.1	.	.	.	.	.	.	.	.	.	.	A	0.019	-1.463061	0.01062	.	.	ENSG00000072195	ENST00000312358;ENST00000265327	T	0.63255	-0.03	4.51	3.62	0.41486	.	2.709530	0.01798	N	0.032721	T	0.44030	0.1274	N	0.08118	0	0.09310	N	0.999999	B	0.02656	0.0	B	0.01281	0.0	T	0.32428	-0.9907	10	0.22706	T	0.39	.	7.5344	0.27702	0.2568:0.0:0.7432:0.0	.	2813	Q15772	SPEG_HUMAN	P	2813	ENSP00000311684:T2813P	ENSP00000265327:T2813P	T	+	1	0	SPEG	220062421	0.000000	0.05858	0.045000	0.18777	0.027000	0.11550	0.254000	0.18314	1.108000	0.41662	-0.474000	0.04947	ACA	.		0.677	SPEG-004	NOVEL	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000130252.2	NM_005876	
UGT1A6	54578	hgsc.bcm.edu;bcgsc.ca	37	2	234652188	234652188	+	Intron	DEL	C	C	-			TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr2:234652188delC	ENST00000305139.6	+	2	1000				UGT1A9_ENST00000354728.4_Intron|UGT1A1_ENST00000373450.4_Intron|UGT1A10_ENST00000373445.1_Intron|UGT1A3_ENST00000482026.1_Intron|UGT1A7_ENST00000373426.3_Intron|UGT1A10_ENST00000344644.5_Intron|UGT1A6_ENST00000406651.1_Intron|UGT1A5_ENST00000373414.3_Intron|UGT1A4_ENST00000373409.3_Intron|DNAJB3_ENST00000449667.1_RNA|UGT1A1_ENST00000609637.1_Intron|UGT1A6_ENST00000480628.1_Intron|UGT1A1_ENST00000608381.1_Intron|UGT1A6_ENST00000373424.1_Intron|UGT1A1_ENST00000609767.1_Intron	NM_001072.3	NP_001063.2	P19224	UD16_HUMAN	UDP glucuronosyltransferase 1 family, polypeptide A6						cellular glucuronidation (GO:0052695)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	enzyme binding (GO:0019899)|glucuronosyltransferase activity (GO:0015020)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)			central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(4)|lung(10)|skin(1)|upper_aerodigestive_tract(1)	22		Breast(86;0.000765)|all_lung(227;0.00267)|Renal(207;0.00339)|all_hematologic(139;0.0116)|Acute lymphoblastic leukemia(138;0.0328)|Lung NSC(271;0.0457)|Lung SC(224;0.128)		Epithelial(121;5.86e-18)|BRCA - Breast invasive adenocarcinoma(100;0.000384)|Lung(119;0.00306)|LUSC - Lung squamous cell carcinoma(224;0.00702)	Acetaminophen(DB00316)|Deferiprone(DB08826)|Mycophenolate mofetil(DB00688)|Mycophenolic acid(DB01024)|Propofol(DB00818)|Valproic Acid(DB00313)	GTTCCTCTGACCCCCCCAAAA	0.542																																					p.G125fs		.											.	.	0			c.375delG						.		,,,,,,,,,	69,2,3419		3,0,63,0,2,1677	28.0	33.0	32.0		,,,,,,,,,	-2.0	0.0	2		32	8,5,7789		0,0,8,0,5,3888	no	intron,intron,intron,intron,intron,intron,intron,intron,intron,codingComplex	UGT1A10,UGT1A8,UGT1A7,UGT1A6,UGT1A5,UGT1A9,UGT1A4,UGT1A3,DNAJB3	NM_205862.1,NM_021027.2,NM_019093.2,NM_019078.1,NM_019077.2,NM_019076.4,NM_019075.2,NM_007120.2,NM_001072.3,NM_001001394.3	,,,,,,,,,	3,0,71,0,7,5565	A1A1,A1A2,A1R,A2A2,A2R,RR		0.1666,2.0344,0.7439	,,,,,,,,,	,,,,,,,,,	234652188	77,7,11208	1815	4071	5886	SO:0001627	intron_variant	414061	exon1			CTCTGACCCCCCC	M84130	CCDS2507.1, CCDS2508.1	2q37	2010-03-05	2005-07-20		ENSG00000167165	ENSG00000167165		"""UDP glucuronosyltransferases"""	12538	other	complex locus constituent		606431	"""UDP glycosyltransferase 1 family, polypeptide A6"""			9295054, 1339448	Standard	NM_001072		Approved	HLUGP, GNT1, UGT1F		P19224	OTTHUMG00000059122	ENST00000305139.6:c.862-23492C>-	2.37:g.234652188delC		Somatic	117	0		WXS	Illumina GAIIx	Phase_I	74	61	NM_001001394	0	0	0	0	0	A6NKK6|B8K289|Q96TE7	Frame_Shift_Del	DEL	ENST00000305139.6	37	CCDS2507.1																																																																																			.		0.542	UGT1A6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000130988.1	NM_205862	
SH3BP4	23677	broad.mit.edu	37	2	235949696	235949696	+	Missense_Mutation	SNP	G	G	A	rs199774203	byFrequency	TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr2:235949696G>A	ENST00000409212.1	+	4	790	c.283G>A	c.(283-285)Gca>Aca	p.A95T	SH3BP4_ENST00000392011.2_Missense_Mutation_p.A95T|SH3BP4_ENST00000344528.4_Missense_Mutation_p.A95T			Q9P0V3	SH3B4_HUMAN	SH3-domain binding protein 4	95	SH3. {ECO:0000255|PROSITE- ProRule:PRU00192}.				cellular response to amino acid stimulus (GO:0071230)|endocytosis (GO:0006897)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of GTPase activity (GO:0034260)|negative regulation of TOR signaling (GO:0032007)|positive regulation of autophagy (GO:0010508)|protein localization to lysosome (GO:0061462)|regulation of catalytic activity (GO:0050790)	coated pit (GO:0005905)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	GDP-dissociation inhibitor activity (GO:0005092)|identical protein binding (GO:0042802)|Ras GTPase binding (GO:0017016)			central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(6)|lung(13)|ovary(4)|prostate(2)|skin(6)|stomach(3)|urinary_tract(2)	44		Breast(86;0.000332)|Renal(207;0.00339)|all_lung(227;0.00458)|all_hematologic(139;0.0296)|Lung NSC(271;0.0419)		Epithelial(121;7.66e-20)|BRCA - Breast invasive adenocarcinoma(100;0.000402)|Lung(119;0.00299)|LUSC - Lung squamous cell carcinoma(224;0.00645)|GBM - Glioblastoma multiforme(43;0.237)		GTGGTGGTACGCACACAACAC	0.522													G|||	2	0.000399361	0.0008	0.0	5008	,	,		19078	0.0		0.0	False		,,,				2504	0.001				p.A95T		.											.	SH3BP4-94	0			c.G283A						.						173.0	143.0	153.0					2																	235949696		2203	4300	6503	SO:0001583	missense	23677	exon4			TGGTACGCACACA	AF147747	CCDS2513.1	2q37.1-q37.2	2008-05-15			ENSG00000130147	ENSG00000130147			10826	protein-coding gene	gene with protein product		605611				10644451	Standard	NM_014521		Approved		uc002vvp.3	Q9P0V3	OTTHUMG00000133292	ENST00000409212.1:c.283G>A	2.37:g.235949696G>A	ENSP00000386862:p.Ala95Thr	Somatic	277	1		WXS	Illumina GAIIx	Phase_I	305	10	NM_014521	0	0	11	11	0	O95082|Q309A3|Q53QD0|Q53TD1	Missense_Mutation	SNP	ENST00000409212.1	37	CCDS2513.1	1	4.578754578754579E-4	1	0.0020325203252032522	0	0.0	0	0.0	0	0.0	G	35	5.426166	0.96131	.	.	ENSG00000130147	ENST00000392011;ENST00000420127;ENST00000416021;ENST00000409212;ENST00000344528;ENST00000446904	T;T;T;T;T	0.51817	0.69;0.69;0.69;0.69;0.69	5.44	5.44	0.79542	Src homology-3 domain (4);	0.000000	0.85682	D	0.000000	T	0.76898	0.4052	M	0.92738	3.34	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	T	0.82886	-0.0235	10	0.87932	D	0	-6.9209	17.8307	0.88682	0.0:0.0:1.0:0.0	.	95;95	A8K594;Q9P0V3	.;SH3B4_HUMAN	T	95	ENSP00000375867:A95T;ENSP00000403251:A95T;ENSP00000386862:A95T;ENSP00000340237:A95T;ENSP00000415391:A95T	ENSP00000340237:A95T	A	+	1	0	SH3BP4	235614435	1.000000	0.71417	0.660000	0.29694	0.778000	0.44026	9.549000	0.98106	2.549000	0.85964	0.655000	0.94253	GCA	G|0.999;A|0.000		0.522	SH3BP4-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000329763.1		
ANO7	50636	bcgsc.ca	37	2	242148703	242148703	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr2:242148703G>A	ENST00000274979.8	+	12	1346	c.1243G>A	c.(1243-1245)Ggc>Agc	p.G415S	ANO7_ENST00000402430.3_Missense_Mutation_p.G414S	NM_001001891.3	NP_001001891.2	Q6IWH7	ANO7_HUMAN	anoctamin 7	415					calcium activated galactosylceramide scrambling (GO:0061591)|calcium activated phosphatidylcholine scrambling (GO:0061590)|calcium activated phosphatidylserine scrambling (GO:0061589)|chloride transport (GO:0006821)|ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	cell junction (GO:0030054)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|intracellular (GO:0005622)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	intracellular calcium activated chloride channel activity (GO:0005229)|phospholipid scramblase activity (GO:0017128)			NS(1)|central_nervous_system(1)|endometrium(3)|large_intestine(5)|lung(14)|pancreas(2)|prostate(1)|skin(3)|urinary_tract(2)	32						GCCACAGGCCGGCCGGCTGTT	0.637																																					p.G415S		.											.	ANO7-92	0			c.G1243A						.						12.0	12.0	12.0					2																	242148703		2162	4236	6398	SO:0001583	missense	50636	exon12			CAGGCCGGCCGGC	AY617079	CCDS33423.1, CCDS46563.1	2q37.3	2014-04-09	2008-08-28	2008-08-28	ENSG00000146205	ENSG00000146205		"""Ion channels / Chloride channels : Calcium activated : Anoctamins"""	31677	protein-coding gene	gene with protein product		605096	"""transmembrane protein 16G"""	PCANAP5, TMEM16G		14981236, 15375614, 24692353	Standard	NM_001001891		Approved	NGEP, PCANAP5L, IPCA-5	uc002wax.2	Q6IWH7	OTTHUMG00000151702	ENST00000274979.8:c.1243G>A	2.37:g.242148703G>A	ENSP00000274979:p.Gly415Ser	Somatic	62	0		WXS	Illumina GAIIx	Phase_I	63	4	NM_001001891	0	0	0	0	0	Q6IWH6	Missense_Mutation	SNP	ENST00000274979.8	37	CCDS33423.1	.	.	.	.	.	.	.	.	.	.	G	3.066	-0.192204	0.06259	.	.	ENSG00000146205	ENST00000274979;ENST00000402430	T;T	0.61392	0.11;0.11	3.33	2.43	0.29744	.	0.913380	0.09231	N	0.830557	T	0.38639	0.1048	N	0.12502	0.225	0.46185	D	0.998911	P	0.49696	0.927	P	0.46076	0.503	T	0.31166	-0.9953	10	0.02654	T	1	.	9.6434	0.39853	0.1117:0.0:0.8883:0.0	.	415	Q6IWH7	ANO7_HUMAN	S	415;414	ENSP00000274979:G415S;ENSP00000385418:G414S	ENSP00000274979:G415S	G	+	1	0	ANO7	241797376	0.998000	0.40836	0.964000	0.40570	0.386000	0.30323	2.656000	0.46716	0.367000	0.24454	0.313000	0.20887	GGC	.		0.637	ANO7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323509.1	NM_001001891	
NOP56	10528	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	20	2637510	2637510	+	Missense_Mutation	SNP	A	A	T			TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr20:2637510A>T	ENST00000329276.5	+	10	1766	c.1250A>T	c.(1249-1251)aAt>aTt	p.N417I	NOP56_ENST00000492135.1_3'UTR|SNORD110_ENST00000408189.1_RNA|SNORD86_ENST00000391196.1_RNA|SNORD56_ENST00000413522.1_RNA|SNORA51_ENST00000606420.1_RNA|IDH3B_ENST00000488299.1_5'Flank|SNORD57_ENST00000448188.1_RNA	NM_006392.3	NP_006383.2	O00567	NOP56_HUMAN	NOP56 ribonucleoprotein	417					cell death (GO:0008219)|rRNA processing (GO:0006364)	box C/D snoRNP complex (GO:0031428)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleolus (GO:0005730)|pre-snoRNP complex (GO:0070761)|small nucleolar ribonucleoprotein complex (GO:0005732)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|snoRNA binding (GO:0030515)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(5)|lung(6)|ovary(2)|pancreas(1)|skin(2)|urinary_tract(1)	25						CCACGAAAGAATCTGGATGTC	0.507																																					p.N417I		.											.	NOP56-92	0			c.A1250T						.						177.0	145.0	156.0					20																	2637510		2203	4300	6503	SO:0001583	missense	10528	exon10			GAAAGAATCTGGA	Y12065	CCDS13030.1	20p13	2012-12-10	2012-12-10	2009-01-13	ENSG00000101361	ENSG00000101361			15911	protein-coding gene	gene with protein product	"""spinocerebellar ataxia 36"""	614154	"""nucleolar protein 5A (56kD with KKE/D repeat)"", ""nucleolar protein 5A (56kDa with KKE/D repeat)"", ""NOP56 ribonucleoprotein homolog (yeast)"""	NOL5A		9372940, 21683323	Standard	NR_027700		Approved	SCA36	uc002wgh.3	O00567	OTTHUMG00000031703	ENST00000329276.5:c.1250A>T	20.37:g.2637510A>T	ENSP00000370589:p.Asn417Ile	Somatic	128	0		WXS	Illumina GAIIx	Phase_I	304	138	NM_006392	0	0	56	101	45	Q2M3T6|Q9NQ05	Missense_Mutation	SNP	ENST00000329276.5	37	CCDS13030.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	21.1|21.1	4.097350|4.097350	0.76870|0.76870	.|.	.|.	ENSG00000101361|ENSG00000101361	ENST00000415272|ENST00000329276;ENST00000381169	.|T	.|0.40476	.|1.03	5.75|5.75	5.75|5.75	0.90469|0.90469	.|.	.|0.042518	.|0.85682	.|D	.|0.000000	T|T	0.53899|0.53899	0.1825|0.1825	L|L	0.32530|0.32530	0.975|0.975	0.80722|0.80722	D|D	1|1	.|D;D	.|0.89917	.|0.998;1.0	.|D;D	.|0.83275	.|0.947;0.996	T|T	0.57277|0.57277	-0.7839|-0.7839	5|10	.|0.87932	.|D	.|0	-27.4111|-27.4111	14.0228|14.0228	0.64568|0.64568	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	.|164;417	.|E9PDI8;O00567	.|.;NOP56_HUMAN	F|I	158|417;164	.|ENSP00000370589:N417I	.|ENSP00000370589:N417I	I|N	+|+	1|2	0|0	NOP56|NOP56	2585510|2585510	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.996000|0.996000	0.88848|0.88848	8.969000|8.969000	0.93411|0.93411	2.194000|2.194000	0.70268|0.70268	0.533000|0.533000	0.62120|0.62120	ATC|AAT	.		0.507	NOP56-009	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077631.2	NM_006392	
VSX1	30813	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	20	25052585	25052585	+	Missense_Mutation	SNP	G	G	T	rs149938697	byFrequency	TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr20:25052585G>T	ENST00000429762.3	-	5	912	c.878C>A	c.(877-879)cCg>cAg	p.P293Q	VSX1_ENST00000444511.2_Missense_Mutation_p.R233S	NM_001256272.1	NP_001243201.1	Q9NZR4	VSX1_HUMAN	visual system homeobox 1	0					neuron maturation (GO:0042551)|response to stimulus (GO:0050896)|retinal bipolar neuron differentiation (GO:0060040)|transcription, DNA-templated (GO:0006351)|visual perception (GO:0007601)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|large_intestine(3)|lung(2)	6						GCACCACCACGGGGTCTGGGG	0.537																																					p.P293Q		.											.	VSX1-90	0			c.C878A						.																																			SO:0001583	missense	30813	exon5			CACCACGGGGTCT	AF176797	CCDS13168.1, CCDS13169.1, CCDS58766.1, CCDS58767.1	20p11.21	2014-02-14	2007-07-12		ENSG00000100987	ENSG00000100987		"""Homeoboxes / PRD class"""	12723	protein-coding gene	gene with protein product		605020	"""posterior polymorphous corneal dystrophy"", ""visual system homeobox 1 homolog, CHX10-like (zebrafish)"""	PPCD		10673340	Standard	NM_001256272		Approved	PPD, PPCD1	uc002wuf.4	Q9NZR4	OTTHUMG00000032111	ENST00000429762.3:c.878C>A	20.37:g.25052585G>T	ENSP00000401690:p.Pro293Gln	Somatic	79	0		WXS	Illumina GAIIx	Phase_I	166	86	NM_001256272	0	0	0	0	0	B9EGJ4|D1MF28|Q0GM60|Q0GM61|Q0GM62|Q0GM63|Q0GM64|Q0GM65|Q5TF40|Q5TF41|Q9HCU3|Q9NU27	Missense_Mutation	SNP	ENST00000429762.3	37	CCDS58767.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	6.586|6.586	0.476553|0.476553	0.12521|0.12521	.|.	.|.	ENSG00000100987|ENSG00000100987	ENST00000429762|ENST00000444511	D|D	0.91068|0.92397	-2.78|-3.03	1.78|1.78	-2.51|-2.51	0.06365|0.06365	.|.	.|.	.|.	.|.	.|.	D|D	0.84902|0.84902	0.5575|0.5575	.|.	.|.	.|.	0.09310|0.09310	N|N	0.999995|0.999995	B|B	0.24483|0.17667	0.104|0.023	B|B	0.16289|0.13407	0.015|0.009	T|T	0.71248|0.71248	-0.4649|-0.4649	8|8	0.72032|0.51188	D|T	0.01|0.08	.|.	5.9595|5.9595	0.19291|0.19291	0.4398:0.0:0.5602:0.0|0.4398:0.0:0.5602:0.0	.|.	293|233	Q9NZR4-8|Q9NZR4-7	.|.	Q|S	293|233	ENSP00000401690:P293Q|ENSP00000387720:R233S	ENSP00000401690:P293Q|ENSP00000387720:R233S	P|R	-|-	2|1	0|0	VSX1|VSX1	25000585|25000585	0.000000|0.000000	0.05858|0.05858	0.002000|0.002000	0.10522|0.10522	0.003000|0.003000	0.03518|0.03518	-1.075000|-1.075000	0.03423|0.03423	-0.619000|-0.619000	0.05648|0.05648	-0.628000|-0.628000	0.03992|0.03992	CCG|CGT	G|0.998;A|0.002		0.537	VSX1-003	KNOWN	basic|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000334157.2		
ID1	3397	hgsc.bcm.edu	37	20	30193226	30193226	+	Silent	SNP	C	C	G	rs11545368	byFrequency	TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr20:30193226C>G	ENST00000376112.3	+	1	141	c.36C>G	c.(34-36)gcC>gcG	p.A12A	MIR3193_ENST00000578262.1_RNA|ID1_ENST00000376105.3_Silent_p.A12A	NM_002165.3	NP_002156.2	P41134	ID1_HUMAN	inhibitor of DNA binding 1, dominant negative helix-loop-helix protein	12					angiogenesis (GO:0001525)|blood vessel endothelial cell migration (GO:0043534)|blood vessel morphogenesis (GO:0048514)|BMP signaling pathway (GO:0030509)|collagen metabolic process (GO:0032963)|endothelial cell morphogenesis (GO:0001886)|heart development (GO:0007507)|lung morphogenesis (GO:0060425)|lung vasculature development (GO:0060426)|negative regulation of apoptotic process (GO:0043066)|negative regulation of DNA binding (GO:0043392)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription by transcription factor localization (GO:0010621)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|protein destabilization (GO:0031648)|regulation of angiogenesis (GO:0045765)|regulation of MAPK cascade (GO:0043408)|response to antibiotic (GO:0046677)|rhythmic process (GO:0048511)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	Golgi apparatus (GO:0005794)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(2)|ovary(1)|pancreas(1)	4	all_cancers(5;7.12e-06)|Lung NSC(7;3.95e-06)|all_epithelial(3;4.36e-06)|all_lung(7;6.68e-06)|all_hematologic(12;0.158)|Ovarian(7;0.198)		Epithelial(4;1.99e-05)|all cancers(5;0.000169)|Colorectal(19;0.00202)|COAD - Colon adenocarcinoma(19;0.0264)			CCACCGCCGCCGCGGGCCCCA	0.647													C|||	8	0.00159744	0.0	0.0014	5008	,	,		14076	0.0		0.007	False		,,,				2504	0.0				p.A12A	NSCLC(123;1618 1779 21803 28680 33854)	.											.	ID1-651	0			c.C36G						.	C	,	3,3435		0,3,1716	16.0	20.0	19.0		36,36	1.6	1.0	20	dbSNP_120	19	45,7333		0,45,3644	no	coding-synonymous,coding-synonymous	ID1	NM_002165.3,NM_181353.2	,	0,48,5360	GG,GC,CC		0.6099,0.0873,0.4438	,	12/156,12/150	30193226	48,10768	1719	3689	5408	SO:0001819	synonymous_variant	3397	exon1			CGCCGCCGCGGGC		CCDS13185.1, CCDS13186.1	20q11	2013-05-21			ENSG00000125968	ENSG00000125968		"""Basic helix-loop-helix proteins"""	5360	protein-coding gene	gene with protein product	"""DNA-binding protein inhibitor ID-1"""	600349				8294468	Standard	NM_002165		Approved	dJ857M17.1.2, bHLHb24	uc002wwg.2	P41134	OTTHUMG00000032181	ENST00000376112.3:c.36C>G	20.37:g.30193226C>G		Somatic	1	0		WXS	Illumina GAIIx	Phase_I	8	5	NM_002165	0	0	0	1	1	A8K537|E1P5L4|O00651|O00652|Q16371|Q16377|Q5TE66|Q5TE67|Q969Z7|Q9H0Z5|Q9H109	Silent	SNP	ENST00000376112.3	37	CCDS13185.1																																																																																			C|0.993;G|0.007		0.647	ID1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078550.1	NM_002165	
E2F1	1869	broad.mit.edu;bcgsc.ca	37	20	32266084	32266084	+	Silent	SNP	G	G	A			TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr20:32266084G>A	ENST00000343380.5	-	4	787	c.648C>T	c.(646-648)agC>agT	p.S216S	RP1-63M2.5_ENST00000606866.1_RNA	NM_005225.2	NP_005216.1	Q01094	E2F1_HUMAN	E2F transcription factor 1	216	Dimerization. {ECO:0000255}.|Required for interaction with TRIM28.				anoikis (GO:0043276)|apoptotic process (GO:0006915)|cellular response to fatty acid (GO:0071398)|cellular response to hypoxia (GO:0071456)|DNA damage checkpoint (GO:0000077)|forebrain development (GO:0030900)|G1/S transition of mitotic cell cycle (GO:0000082)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|lens fiber cell apoptotic process (GO:1990086)|mitotic cell cycle (GO:0000278)|mRNA stabilization (GO:0048255)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0071930)|negative regulation of transcription, DNA-templated (GO:0045892)|Notch signaling pathway (GO:0007219)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of gene expression (GO:0010628)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of G1/S transition of mitotic cell cycle (GO:2000045)|regulation of transcription, DNA-templated (GO:0006355)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|Rb-E2F complex (GO:0035189)	core promoter binding (GO:0001047)|DNA binding (GO:0003677)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)			NS(2)|breast(1)|endometrium(3)|lung(8)|prostate(1)|upper_aerodigestive_tract(1)	16						GCTGCTGCTCGCTCTCCTGCA	0.637																																					p.S216S		.											.	E2F1-838	0			c.C648T						.						50.0	43.0	46.0					20																	32266084		2203	4300	6503	SO:0001819	synonymous_variant	1869	exon4			CTGCTCGCTCTCC		CCDS13224.1	20q11	2008-05-14			ENSG00000101412	ENSG00000101412			3113	protein-coding gene	gene with protein product		189971		RBBP3		8964493	Standard	NM_005225		Approved	RBP3	uc002wzu.4	Q01094	OTTHUMG00000032265	ENST00000343380.5:c.648C>T	20.37:g.32266084G>A		Somatic	168	0		WXS	Illumina GAIIx	Phase_I	369	10	NM_005225	0	0	22	22	0	Q13143|Q92768	Silent	SNP	ENST00000343380.5	37	CCDS13224.1																																																																																			.		0.637	E2F1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078731.2		
GSS	2937	hgsc.bcm.edu	37	20	33519853	33519855	+	In_Frame_Del	DEL	CTT	CTT	-			TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10	CTT	CTT	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr20:33519853_33519855delCTT	ENST00000216951.2	-	10	1014_1016	c.916_918delAAG	c.(916-918)aagdel	p.K306del	GSS_ENST00000451957.2_In_Frame_Del_p.K195del|GSS_ENST00000541098.1_In_Frame_Del_p.K178del	NM_000178.2	NP_000169.1	P48637	GSHB_HUMAN	glutathione synthetase	306					aging (GO:0007568)|cellular amino acid metabolic process (GO:0006520)|glutathione biosynthetic process (GO:0006750)|glutathione derivative biosynthetic process (GO:1901687)|nervous system development (GO:0007399)|response to amino acid (GO:0043200)|response to cadmium ion (GO:0046686)|response to nutrient levels (GO:0031667)|response to oxidative stress (GO:0006979)|response to tumor necrosis factor (GO:0034612)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)|glutathione binding (GO:0043295)|glutathione synthase activity (GO:0004363)|glycine binding (GO:0016594)|magnesium ion binding (GO:0000287)|protein homodimerization activity (GO:0042803)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(6)|ovary(3)|upper_aerodigestive_tract(1)	17			BRCA - Breast invasive adenocarcinoma(18;0.035)		Acetylcysteine(DB06151)|Glutathione(DB00143)|Glycine(DB00145)|L-Cysteine(DB00151)	CCTGCTGCACCTTCTTAGTCCCA	0.611																																					p.306_306del		.											.	GSS-93	0			c.916_918del						.																																			SO:0001651	inframe_deletion	2937	exon10			CTGCACCTTCTTA		CCDS13245.1	20q11.2	1996-06-18			ENSG00000100983	ENSG00000100983	6.3.2.3		4624	protein-coding gene	gene with protein product		601002				8825653	Standard	NM_000178		Approved		uc002xbg.3	P48637	OTTHUMG00000032315	ENST00000216951.2:c.916_918delAAG	20.37:g.33519856_33519858delCTT	ENSP00000216951:p.Lys306del	Somatic	247	4		WXS	Illumina GAIIx	Phase_I	550	257	NM_000178	0	0	0	0	0	B2R697|B6F210|E1P5P9|Q4TTD9	In_Frame_Del	DEL	ENST00000216951.2	37	CCDS13245.1																																																																																			.		0.611	GSS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078821.2		
GNAS-AS1	149775	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	20	57393302	57393302	+	RNA	SNP	G	G	T			TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr20:57393302G>T	ENST00000424094.2	-	0	2312				MIR298_ENST00000401212.1_RNA|MIR296_ENST00000385215.1_lincRNA	NR_002785.2				GNAS antisense RNA 1																		GAGCAAAGCAGCAGGCTAGTT	0.587																																					.		.											.	.	0			.						.						38.0	42.0	41.0					20																	57393302		1568	3582	5150			100126296	.			AAAGCAGCAGGCT	AJ251759		20q13.32	2012-10-19	2012-08-15	2010-11-25	ENSG00000235590	ENSG00000235590		"""Long non-coding RNAs"", ""-"""	24872	non-coding RNA	RNA, long non-coding	"""GNAS antisense"", ""non-protein coding RNA 75"""	610540	"""GNAS antisense RNA (non-protein coding)"", ""GNAS antisense RNA 1 (non-protein coding)"""	GNASAS, GNAS-AS		10749992	Standard	NR_002785		Approved	SANG, NESP-AS, NESPAS, GNAS1AS, NCRNA00075	uc002xzs.2		OTTHUMG00000060481		20.37:g.57393302G>T		Somatic	202	1		WXS	Illumina GAIIx	Phase_I	350	160	.	0	0	0	0	0		RNA	SNP	ENST00000424094.2	37																																																																																				.		0.587	GNAS-AS1-001	KNOWN	basic	antisense	antisense	OTTHUMT00000133891.2	NR_002785	
NELFCD	51497	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	20	57568155	57568155	+	Silent	SNP	G	G	A	rs141996345		TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr20:57568155G>A	ENST00000344018.3	+	11	1386	c.1359G>A	c.(1357-1359)gcG>gcA	p.A453A	NELFCD_ENST00000602795.1_Silent_p.A462A|NELFCD_ENST00000479207.1_3'UTR			Q8IXH7	NELFD_HUMAN	negative elongation factor complex member C/D	453					gene expression (GO:0010467)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of viral transcription (GO:0050434)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|viral process (GO:0016032)	membrane (GO:0016020)|NELF complex (GO:0032021)|nucleoplasm (GO:0005654)											TCCACCTGGCGTTGCTGGATG	0.502													G|||	1	0.000199681	0.0	0.0	5008	,	,		17745	0.001		0.0	False		,,,				2504	0.0				p.A462A		.											.	.	0			c.G1386A						.	G		5,4401	9.9+/-24.2	0,5,2198	133.0	104.0	113.0		1359	-10.6	0.0	20	dbSNP_134	113	0,8600		0,0,4300	no	coding-synonymous	TH1L	NM_198976.1		0,5,6498	AA,AG,GG		0.0,0.1135,0.0384		453/591	57568155	5,13001	2203	4300	6503	SO:0001819	synonymous_variant	51497	exon11			CCTGGCGTTGCTG	AF161479	CCDS13473.1, CCDS13473.2	20q13	2013-01-31	2013-01-31	2013-01-31	ENSG00000101158	ENSG00000101158			15934	protein-coding gene	gene with protein product	"""trihydrophobin 1"""	605297	"""TH1-like (Drosophila homolog)"", ""TH1-like (Drosophila)"""	TH1L		11030415, 11042152	Standard	NM_198976		Approved	HSPC130, TH1, NELF-C, NELF-D	uc002yag.4	Q8IXH7	OTTHUMG00000032861	ENST00000344018.3:c.1359G>A	20.37:g.57568155G>A		Somatic	315	0		WXS	Illumina GAIIx	Phase_I	639	152	NM_198976	0	0	6	6	0	B4DE06|Q9BYL2|Q9H405|Q9H888|Q9H8T3|Q9NVX5|Q9P029|Q9UGN1|Q9UGN2|Q9UGN3	Silent	SNP	ENST00000344018.3	37																																																																																				G|0.999;A|0.001		0.502	NELFCD-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_198976	
ZNF831	128611	broad.mit.edu;ucsc.edu;bcgsc.ca	37	20	57769225	57769225	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr20:57769225G>A	ENST00000371030.2	+	1	3151	c.3151G>A	c.(3151-3153)Gct>Act	p.A1051T		NM_178457.1	NP_848552.1	Q5JPB2	ZN831_HUMAN	zinc finger protein 831	1051							metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)			NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(15)|lung(71)|ovary(2)|pancreas(1)|prostate(4)|skin(16)|upper_aerodigestive_tract(2)|urinary_tract(3)	125	all_lung(29;0.0085)					TCCCAGGGAGGCTACCTCCTC	0.627																																					p.A1051T		.											.	ZNF831-126	0			c.G3151A						.						22.0	27.0	25.0					20																	57769225		2066	4220	6286	SO:0001583	missense	128611	exon1			AGGGAGGCTACCT	AL121919	CCDS42894.1	20q13.32	2008-10-20	2008-03-25	2008-03-25	ENSG00000124203	ENSG00000124203			16167	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 174"""	C20orf174			Standard	NM_178457		Approved	dJ492J12.1	uc002yan.3	Q5JPB2	OTTHUMG00000032864	ENST00000371030.2:c.3151G>A	20.37:g.57769225G>A	ENSP00000360069:p.Ala1051Thr	Somatic	73	1		WXS	Illumina GAIIx	Phase_I	139	67	NM_178457	0	0	0	0	0	Q5TDR4|Q8TCP0	Missense_Mutation	SNP	ENST00000371030.2	37	CCDS42894.1	.	.	.	.	.	.	.	.	.	.	G	2.621	-0.288473	0.05605	.	.	ENSG00000124203	ENST00000371030	T	0.04119	3.7	4.55	-2.6	0.06190	.	1.161610	0.06363	N	0.712095	T	0.01353	0.0044	N	0.01874	-0.695	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.41752	-0.9491	10	0.02654	T	1	2.3096	1.2349	0.01951	0.3824:0.3086:0.1726:0.1364	.	1051	Q5JPB2	ZN831_HUMAN	T	1051	ENSP00000360069:A1051T	ENSP00000360069:A1051T	A	+	1	0	ZNF831	57202620	0.000000	0.05858	0.000000	0.03702	0.258000	0.26162	0.357000	0.20199	-0.736000	0.04831	-0.320000	0.08662	GCT	.		0.627	ZNF831-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000079916.2	NM_178457	
PHACTR3	116154	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	20	58342325	58342325	+	Missense_Mutation	SNP	C	C	A			TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr20:58342325C>A	ENST00000371015.1	+	5	1093	c.626C>A	c.(625-627)gCt>gAt	p.A209D	PHACTR3_ENST00000395636.2_Missense_Mutation_p.A168D|PHACTR3_ENST00000541461.1_Missense_Mutation_p.A168D|PHACTR3_ENST00000395639.4_Intron|PHACTR3_ENST00000355648.4_Missense_Mutation_p.A168D|PHACTR3_ENST00000361300.4_Intron|PHACTR3_ENST00000359926.3_Missense_Mutation_p.A206D	NM_001281507.1|NM_080672.3	NP_001268436.1|NP_542403.1	Q96KR7	PHAR3_HUMAN	phosphatase and actin regulator 3	209						nucleus (GO:0005634)	protein phosphatase inhibitor activity (GO:0004864)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(13)|liver(2)|lung(32)|ovary(3)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	59	all_lung(29;0.00344)		BRCA - Breast invasive adenocarcinoma(7;2.76e-09)			CAAGCCTTAGCTGGGGCTGAC	0.627																																					p.A209D		.											.	PHACTR3-93	0			c.C626A						.						50.0	47.0	48.0					20																	58342325		2203	4300	6503	SO:0001583	missense	116154	exon5			CCTTAGCTGGGGC	AJ311122	CCDS13480.1, CCDS13481.1, CCDS42895.1, CCDS56202.1	20q13.32-q13.33	2014-06-13	2004-05-20	2004-05-20	ENSG00000087495	ENSG00000087495		"""Phosphatase and actin regulators"""	15833	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 123"""	608725	"""chromosome 20 open reading frame 101"""	C20orf101		15107502	Standard	NM_001199505		Approved	PPP1R123	uc002yau.3	Q96KR7	OTTHUMG00000032869	ENST00000371015.1:c.626C>A	20.37:g.58342325C>A	ENSP00000360054:p.Ala209Asp	Somatic	170	0		WXS	Illumina GAIIx	Phase_I	357	23	NM_080672	0	0	0	0	0	B1AKX0|B1AN68|B1AN69|B2RB46|Q32P33|Q707P6|Q9H4T4	Missense_Mutation	SNP	ENST00000371015.1	37	CCDS13480.1	.	.	.	.	.	.	.	.	.	.	C	9.431	1.085436	0.20390	.	.	ENSG00000087495	ENST00000359926;ENST00000371015;ENST00000541461;ENST00000355648;ENST00000395636	T;T;T;T;T	0.23552	1.91;1.93;1.9;1.9;1.9	4.7	3.75	0.43078	.	0.952451	0.08812	N	0.890151	T	0.15435	0.0372	N	0.25647	0.755	0.28336	N	0.921546	B;B	0.10296	0.003;0.003	B;B	0.08055	0.003;0.003	T	0.28902	-1.0029	10	0.12766	T	0.61	-2.1945	5.0112	0.14313	0.0:0.7099:0.0:0.2901	.	209;206	Q96KR7;B1AKX0	PHAR3_HUMAN;.	D	206;209;168;168;168	ENSP00000353002:A206D;ENSP00000360054:A209D;ENSP00000442483:A168D;ENSP00000347866:A168D;ENSP00000378998:A168D	ENSP00000347866:A168D	A	+	2	0	PHACTR3	57775720	1.000000	0.71417	1.000000	0.80357	0.972000	0.66771	3.274000	0.51631	2.166000	0.68216	0.460000	0.39030	GCT	.		0.627	PHACTR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079923.3	NM_080672	
CABLES2	81928	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	20	60966048	60966048	+	Missense_Mutation	SNP	C	C	A			TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr20:60966048C>A	ENST00000279101.5	-	10	1424	c.1416G>T	c.(1414-1416)agG>agT	p.R472S		NM_031215.2	NP_112492.2	Q9BTV7	CABL2_HUMAN	Cdk5 and Abl enzyme substrate 2	472					cell cycle (GO:0007049)|cell division (GO:0051301)|regulation of cell cycle (GO:0051726)|regulation of cell division (GO:0051302)		cyclin-dependent protein serine/threonine kinase regulator activity (GO:0016538)			endometrium(2)|kidney(1)|lung(6)|pancreas(1)|skin(1)	11	Breast(26;2.05e-08)		BRCA - Breast invasive adenocarcinoma(19;4.36e-06)			GGGTGAGGCGCCTGTAATGAG	0.612																																					p.R472S		.											.	CABLES2-91	0			c.G1416T						.						101.0	98.0	99.0					20																	60966048		2203	4300	6503	SO:0001583	missense	81928	exon10			GAGGCGCCTGTAA	BC003122	CCDS33503.1	20q13.33	2004-01-09	2004-01-09	2004-01-09	ENSG00000149679	ENSG00000149679			16143	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 150"""	C20orf150		12477932	Standard	NM_031215		Approved	dJ908M14.2, ik3-2	uc002ycv.2	Q9BTV7	OTTHUMG00000032912	ENST00000279101.5:c.1416G>T	20.37:g.60966048C>A	ENSP00000279101:p.Arg472Ser	Somatic	112	1		WXS	Illumina GAIIx	Phase_I	239	125	NM_031215	0	0	0	1	1	Q5JWL0|Q9BYK0	Missense_Mutation	SNP	ENST00000279101.5	37	CCDS33503.1	.	.	.	.	.	.	.	.	.	.	C	16.23	3.064030	0.55432	.	.	ENSG00000149679	ENST00000370560;ENST00000279101	T	0.44881	0.91	5.43	0.289	0.15723	.	0.000000	0.85682	D	0.000000	T	0.35970	0.0950	M	0.65975	2.015	0.58432	D	0.999999	B	0.32245	0.361	B	0.33690	0.168	T	0.06110	-1.0845	10	0.42905	T	0.14	-16.5176	6.0431	0.19746	0.0:0.1501:0.4134:0.4365	.	472	Q9BTV7	CABL2_HUMAN	S	260;472	ENSP00000279101:R472S	ENSP00000279101:R472S	R	-	3	2	CABLES2	60399443	1.000000	0.71417	0.955000	0.39395	0.982000	0.71751	0.782000	0.26788	-0.217000	0.10033	-0.302000	0.09304	AGG	.		0.612	CABLES2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080027.2	XM_037265	
COL20A1	57642	broad.mit.edu	37	20	61938844	61938844	+	Missense_Mutation	SNP	G	G	A	rs201827276		TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr20:61938844G>A	ENST00000358894.6	+	6	599	c.499G>A	c.(499-501)Ggc>Agc	p.G167S	COL20A1_ENST00000326996.6_Missense_Mutation_p.G167S|COL20A1_ENST00000422202.1_Missense_Mutation_p.G174S|COL20A1_ENST00000435874.1_Missense_Mutation_p.G174S	NM_020882.2	NP_065933.2	Q9P218	COKA1_HUMAN	collagen, type XX, alpha 1	167					extracellular matrix organization (GO:0030198)	collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)				NS(3)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(1)|lung(21)|ovary(1)|prostate(3)|urinary_tract(2)	36	all_cancers(38;1.39e-10)					CGCCCCAGCCGGCCCCCAGTT	0.677													G|||	1	0.000199681	0.0008	0.0	5008	,	,		13521	0.0		0.0	False		,,,				2504	0.0				p.G167S		.											.	COL20A1-90	0			c.G499A						.	G	SER/GLY	1,3905		0,1,1952	22.0	26.0	24.0		499	0.3	0.0	20		24	5,8243		0,5,4119	yes	missense	COL20A1	NM_020882.2	56	0,6,6071	AA,AG,GG		0.0606,0.0256,0.0494	benign	167/1285	61938844	6,12148	1953	4124	6077	SO:0001583	missense	57642	exon6			CCAGCCGGCCCCC	BC043183	CCDS46628.1	20q13.33	2014-02-12			ENSG00000101203	ENSG00000101203		"""Collagens"", ""Fibronectin type III domain containing"""	14670	protein-coding gene	gene with protein product						10819331	Standard	NM_020882		Approved	KIAA1510	uc011aau.2	Q9P218	OTTHUMG00000032964	ENST00000358894.6:c.499G>A	20.37:g.61938844G>A	ENSP00000351767:p.Gly167Ser	Somatic	36	0		WXS	Illumina GAIIx	Phase_I	129	4	NM_020882	0	0	0	0	0	Q4VXQ4|Q6PI59|Q8WUT2|Q96CY9|Q9BQU6|Q9BQU7	Missense_Mutation	SNP	ENST00000358894.6	37	CCDS46628.1	.	.	.	.	.	.	.	.	.	.	G	7.509	0.654191	0.14580	2.56E-4	6.06E-4	ENSG00000101203	ENST00000358894;ENST00000326996;ENST00000435874;ENST00000422202	T;T;T;T	0.78246	-1.16;-1.16;-1.16;-1.16	3.59	0.283	0.15696	.	0.949413	0.08703	U	0.906200	T	0.59445	0.2194	N	0.24115	0.695	0.09310	N	1	B	0.16166	0.016	B	0.06405	0.002	T	0.35176	-0.9799	10	0.10111	T	0.7	.	7.2734	0.26271	0.186:0.14:0.6741:0.0	.	167	Q9P218	COKA1_HUMAN	S	167;167;174;174	ENSP00000351767:G167S;ENSP00000323077:G167S;ENSP00000408690:G174S;ENSP00000414753:G174S	ENSP00000323077:G167S	G	+	1	0	COL20A1	61409289	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	0.023000	0.13533	-0.465000	0.06953	-1.786000	0.00637	GGC	.		0.677	COL20A1-006	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000144595.2	NM_020882	
COL20A1	57642	broad.mit.edu;ucsc.edu;bcgsc.ca	37	20	61944185	61944185	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr20:61944185C>T	ENST00000358894.6	+	16	2075	c.1975C>T	c.(1975-1977)Cca>Tca	p.P659S	COL20A1_ENST00000326996.6_Missense_Mutation_p.P659S|COL20A1_ENST00000422202.1_Missense_Mutation_p.P666S|COL20A1_ENST00000435874.1_Missense_Mutation_p.P666S	NM_020882.2	NP_065933.2	Q9P218	COKA1_HUMAN	collagen, type XX, alpha 1	659	Fibronectin type-III 5. {ECO:0000255|PROSITE-ProRule:PRU00316}.				extracellular matrix organization (GO:0030198)	collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)				NS(3)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(1)|lung(21)|ovary(1)|prostate(3)|urinary_tract(2)	36	all_cancers(38;1.39e-10)					GACGGAGCTGCCAGGGGATGC	0.657																																					p.P659S		.											.	COL20A1-90	0			c.C1975T						.						17.0	23.0	21.0					20																	61944185		1936	4115	6051	SO:0001583	missense	57642	exon16			GAGCTGCCAGGGG	BC043183	CCDS46628.1	20q13.33	2014-02-12			ENSG00000101203	ENSG00000101203		"""Collagens"", ""Fibronectin type III domain containing"""	14670	protein-coding gene	gene with protein product						10819331	Standard	NM_020882		Approved	KIAA1510	uc011aau.2	Q9P218	OTTHUMG00000032964	ENST00000358894.6:c.1975C>T	20.37:g.61944185C>T	ENSP00000351767:p.Pro659Ser	Somatic	137	1		WXS	Illumina GAIIx	Phase_I	276	121	NM_020882	0	0	0	0	0	Q4VXQ4|Q6PI59|Q8WUT2|Q96CY9|Q9BQU6|Q9BQU7	Missense_Mutation	SNP	ENST00000358894.6	37	CCDS46628.1	.	.	.	.	.	.	.	.	.	.	C	0.429	-0.904539	0.02453	.	.	ENSG00000101203	ENST00000358894;ENST00000326996;ENST00000435874;ENST00000422202	T;T;T;T	0.52754	0.65;0.65;0.65;0.65	4.29	3.34	0.38264	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.163489	0.43919	D	0.000510	T	0.29093	0.0723	N	0.19112	0.55	0.09310	N	1	P;P	0.39883	0.644;0.693	B;B	0.40659	0.227;0.336	T	0.13176	-1.0519	10	0.11485	T	0.65	.	8.1074	0.30894	0.0:0.8849:0.0:0.1151	.	666;659	Q9P218-2;Q9P218	.;COKA1_HUMAN	S	659;659;666;666	ENSP00000351767:P659S;ENSP00000323077:P659S;ENSP00000408690:P666S;ENSP00000414753:P666S	ENSP00000323077:P659S	P	+	1	0	COL20A1	61414630	0.000000	0.05858	0.011000	0.14972	0.069000	0.16628	-0.085000	0.11250	0.804000	0.34136	0.313000	0.20887	CCA	.		0.657	COL20A1-006	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000144595.2	NM_020882	
BACH1	571	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	21	30701923	30701925	+	In_Frame_Del	DEL	GAA	GAA	-			TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10	GAA	GAA	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr21:30701923_30701925delGAA	ENST00000399921.1	+	4	1928_1930	c.1685_1687delGAA	c.(1684-1689)cgaaga>cga	p.562_563RR>R	BACH1_ENST00000286800.3_In_Frame_Del_p.562_563RR>R	NM_206866.1	NP_996749.1	Q9BX63	FANCJ_HUMAN	BTB and CNC homology 1, basic leucine zipper transcription factor 1	0					DNA damage checkpoint (GO:0000077)|DNA duplex unwinding (GO:0032508)|double-strand break repair (GO:0006302)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)	4 iron, 4 sulfur cluster binding (GO:0051539)|ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(5)|kidney(2)|large_intestine(8)|liver(1)|lung(7)|ovary(1)|urinary_tract(2)	27						CATGATATTCGAAGAAGAAGTAA	0.379																																					p.562_563del		.											.	BACH1-92	0			c.1685_1687del						.																																			SO:0001651	inframe_deletion	571	exon4			ATATTCGAAGAAG	AF026200	CCDS13585.1	21q22.1	2013-01-10			ENSG00000156273	ENSG00000156273		"""BTB/POZ domain containing"", ""basic leucine zipper proteins"""	935	protein-coding gene	gene with protein product		602751				9544839, 9479503	Standard	NR_027655		Approved	BACH-1, BTBD24	uc002ynj.3	O14867	OTTHUMG00000078878	ENST00000399921.1:c.1685_1687delGAA	21.37:g.30701929_30701931delGAA	ENSP00000382805:p.Arg564del	Somatic	100	0		WXS	Illumina GAIIx	Phase_I	232	107	NM_206866	0	0	0	0	0	Q3MJE2|Q8NCI5	In_Frame_Del	DEL	ENST00000399921.1	37	CCDS13585.1																																																																																			.		0.379	BACH1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000171974.1	NM_206866	
TIAM1	7074	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	21	32638636	32638636	+	Missense_Mutation	SNP	G	G	A	rs202148756		TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr21:32638636G>A	ENST00000286827.3	-	5	1124	c.653C>T	c.(652-654)gCg>gTg	p.A218V	TIAM1_ENST00000541036.1_Missense_Mutation_p.A218V|TIAM1_ENST00000469412.1_Intron	NM_003253.2	NP_003244.2	Q13009	TIAM1_HUMAN	T-cell lymphoma invasion and metastasis 1	218					apoptotic signaling pathway (GO:0097190)|cell migration (GO:0016477)|cell-matrix adhesion (GO:0007160)|ephrin receptor signaling pathway (GO:0048013)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of axonogenesis (GO:0050772)|positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of Rho GTPase activity (GO:0032321)|Rac protein signal transduction (GO:0016601)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cell-cell contact zone (GO:0044291)|cell-cell junction (GO:0005911)|cytosol (GO:0005829)|extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)	phospholipid binding (GO:0005543)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)|receptor signaling protein activity (GO:0005057)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			autonomic_ganglia(3)|breast(7)|central_nervous_system(2)|endometrium(13)|kidney(4)|large_intestine(33)|lung(44)|ovary(2)|prostate(3)|skin(2)|urinary_tract(2)	115						CCGCGGACTCGCCCGCGTTTC	0.567																																					p.A218V		.											.	TIAM1-724	0			c.C653T						.	G	VAL/ALA	0,4406		0,0,2203	66.0	68.0	68.0		653	-2.5	0.5	21		68	1,8599	1.2+/-3.3	0,1,4299	no	missense	TIAM1	NM_003253.2	64	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	benign	218/1592	32638636	1,13005	2203	4300	6503	SO:0001583	missense	7074	exon5			GGACTCGCCCGCG		CCDS13609.1	21q22.1	2013-01-10			ENSG00000156299	ENSG00000156299		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	11805	protein-coding gene	gene with protein product		600687				8595894, 15340013	Standard	NM_003253		Approved		uc002yow.1	Q13009	OTTHUMG00000084869	ENST00000286827.3:c.653C>T	21.37:g.32638636G>A	ENSP00000286827:p.Ala218Val	Somatic	70	0		WXS	Illumina GAIIx	Phase_I	145	72	NM_003253	0	0	0	0	0	B7ZLR6|F5GZ53|Q17RT7	Missense_Mutation	SNP	ENST00000286827.3	37	CCDS13609.1	.	.	.	.	.	.	.	.	.	.	G	10.41	1.341786	0.24339	0.0	1.16E-4	ENSG00000156299	ENST00000286827;ENST00000399841;ENST00000541036;ENST00000455508	T;T	0.40476	1.03;1.03	5.22	-2.47	0.06442	.	0.906660	0.09667	N	0.771714	T	0.14356	0.0347	N	0.08118	0	0.09310	N	1	B;B;B	0.28933	0.228;0.146;0.0	B;B;B	0.19148	0.024;0.011;0.0	T	0.18840	-1.0324	10	0.18276	T	0.48	.	1.0628	0.01604	0.3718:0.268:0.2038:0.1564	.	218;218;218	F5GZ53;B7ZLR6;Q13009	.;.;TIAM1_HUMAN	V	218;59;218;218	ENSP00000286827:A218V;ENSP00000441570:A218V	ENSP00000286827:A218V	A	-	2	0	TIAM1	31560507	0.277000	0.24220	0.540000	0.28089	0.623000	0.37688	0.478000	0.22212	-0.242000	0.09667	-0.194000	0.12790	GCG	G|0.999;A|0.001		0.567	TIAM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000192552.1	NM_003253	
UMODL1	89766	broad.mit.edu	37	21	43531700	43531700	+	Missense_Mutation	SNP	C	C	A			TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr21:43531700C>A	ENST00000408910.2	+	12	1984	c.1984C>A	c.(1984-1986)Cgt>Agt	p.R662S	UMODL1_ENST00000400424.2_Missense_Mutation_p.R590S|UMODL1_ENST00000400427.1_Missense_Mutation_p.R718S|UMODL1_ENST00000408989.2_Missense_Mutation_p.R790S	NM_001004416.2	NP_001004416	Q5DID0	UROL1_HUMAN	uromodulin-like 1	662					adipose tissue development (GO:0060612)|cellular response to gonadotropin-releasing hormone (GO:0097211)|multicellular organismal reproductive process (GO:0048609)|regulation of apoptotic process (GO:0042981)|regulation of gene expression (GO:0010468)|regulation of ovarian follicle development (GO:2000354)|single fertilization (GO:0007338)	cytoplasm (GO:0005737)|external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)	calcium ion binding (GO:0005509)|peptidase inhibitor activity (GO:0030414)	p.R790S(1)|p.R590S(1)		breast(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(5)|lung(22)|ovary(2)|prostate(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	47						GCATGCCACCCGTTCCACCCG	0.617																																					p.R790S	Pancreas(122;680 807 13940 14411 22888 25505 31742 36028 36332 38435)	.											.	UMODL1-93	2	Substitution - Missense(2)	kidney(2)	c.C2368A						.						49.0	58.0	55.0					21																	43531700		1990	4161	6151	SO:0001583	missense	89766	exon11			GCCACCCGTTCCA		CCDS42935.1, CCDS42936.1, CCDS56214.1, CCDS56215.1	21q22.3	2008-07-04			ENSG00000177398	ENSG00000177398			12560	protein-coding gene	gene with protein product	"""olfactorin"""	613859				16026467	Standard	NM_173568		Approved		uc002zag.1	Q5DID0	OTTHUMG00000086788	ENST00000408910.2:c.1984C>A	21.37:g.43531700C>A	ENSP00000386147:p.Arg662Ser	Somatic	134	0		WXS	Illumina GAIIx	Phase_I	225	5	NM_173568	0	0	0	0	0	C9JCE6|Q5DIC9|Q6LA40|Q6LA41|Q8N216	Missense_Mutation	SNP	ENST00000408910.2	37	CCDS42936.1	.	.	.	.	.	.	.	.	.	.	C	1.090	-0.664425	0.03428	.	.	ENSG00000177398	ENST00000400427;ENST00000400424;ENST00000408989;ENST00000408910	T;T;T;T	0.72615	-0.63;-0.67;-0.63;-0.67	4.18	2.29	0.28610	.	0.870854	0.09510	N	0.792493	T	0.47322	0.1439	N	0.19112	0.55	0.09310	N	1	B;P	0.34724	0.005;0.465	B;B	0.26416	0.003;0.069	T	0.20009	-1.0288	10	0.09084	T	0.74	-5.3927	7.6448	0.28315	0.0:0.734:0.1678:0.0982	.	790;662	Q5DID0-2;Q5DID0	.;UROL1_HUMAN	S	718;590;790;662	ENSP00000383279:R718S;ENSP00000383276:R590S;ENSP00000386126:R790S;ENSP00000386147:R662S	ENSP00000383276:R590S	R	+	1	0	UMODL1	42404769	0.000000	0.05858	0.001000	0.08648	0.011000	0.07611	-0.523000	0.06230	0.452000	0.26830	0.655000	0.94253	CGT	.		0.617	UMODL1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000195292.2		
CCT8L2	150160	ucsc.edu;bcgsc.ca	37	22	17072883	17072883	+	Silent	SNP	G	G	A			TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr22:17072883G>A	ENST00000359963.3	-	1	817	c.558C>T	c.(556-558)caC>caT	p.H186H		NM_014406.4	NP_055221.1	Q96SF2	TCPQM_HUMAN	chaperonin containing TCP1, subunit 8 (theta)-like 2	186					anion transport (GO:0006820)|cellular protein metabolic process (GO:0044267)|potassium ion transmembrane transport (GO:0071805)|transport (GO:0006810)	cytoplasm (GO:0005737)	anion channel activity (GO:0005253)|ATP binding (GO:0005524)|calcium-activated potassium channel activity (GO:0015269)			breast(3)|endometrium(7)|kidney(1)|large_intestine(8)|liver(2)|lung(37)|ovary(3)|prostate(3)|skin(2)|stomach(1)	67	all_hematologic(4;0.00567)|Acute lymphoblastic leukemia(84;0.0977)	all_epithelial(15;0.0157)|Lung NSC(13;0.147)|all_lung(157;0.175)				CCCAGCAGGCGTGGGCCACCA	0.612																																					p.H186H		.											.	CCT8L2-69	0			c.C558T						.						66.0	64.0	65.0					22																	17072883		2203	4300	6503	SO:0001819	synonymous_variant	150160	exon1			GCAGGCGTGGGCC	AP003553	CCDS13738.1	22q11.1	2011-09-01			ENSG00000198445	ENSG00000198445			15553	protein-coding gene	gene with protein product							Standard	NM_014406		Approved	CESK1	uc002zlp.1	Q96SF2	OTTHUMG00000141302	ENST00000359963.3:c.558C>T	22.37:g.17072883G>A		Somatic	146	2		WXS	Illumina GAIIx	Phase_I	180	166	NM_014406	0	0	0	0	0	A4QPH3|Q9UJS3	Silent	SNP	ENST00000359963.3	37	CCDS13738.1																																																																																			.		0.612	CCT8L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000280580.1		
LZTR1	8216	broad.mit.edu	37	22	21343966	21344002	+	Splice_Site	DEL	GAGGAGGTGAGGGGCGTGGGGAGCCAGGGCGCAGGTA	GAGGAGGTGAGGGGCGTGGGGAGCCAGGGCGCAGGTA	-	rs138025454|rs4822786|rs372705680|rs544346603|rs7410444|rs398036571|rs541944601|rs550797478|rs59718704	byFrequency	TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr22:21343966_21344002delGAGGAGGTGAGGGGCGTGGGGAGCCAGGGCGCAGGTA	ENST00000215739.8	+	7	1005_1010	c.646_651delGAGGAGGTGAGGGGCGTGGGGAGCCAGGGCGCAGGTA	c.(646-651)gaggagdel	p.EE216fs	LZTR1_ENST00000479606.1_3'UTR|LZTR1_ENST00000389355.3_Splice_Site_p.EE197fs	NM_006767.3	NP_006758.2	Q8N653	LZTR1_HUMAN	leucine-zipper-like transcription regulator 1	216					anatomical structure morphogenesis (GO:0009653)|regulation of transcription, DNA-templated (GO:0006355)		sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(6)|lung(13)|ovary(3)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(3)	42	all_cancers(11;1.83e-25)|all_epithelial(7;9.19e-23)|Lung NSC(8;3.06e-15)|all_lung(8;5.05e-14)|Melanoma(16;0.000465)|Ovarian(15;0.0028)|Colorectal(54;0.0332)|all_neural(72;0.142)	Lung SC(17;0.0262)	LUSC - Lung squamous cell carcinoma(15;0.000204)|Lung(15;0.00494)|Epithelial(17;0.195)			CACCTGCTgggaggaggtgaggggcgtggggagccagggcgcaggtagaggaggtga	0.662														897	0.179113	0.1354	0.1859	5008	,	,		20879	0.2907		0.166	False		,,,				2504	0.1319				p.216_217del		.											.	LZTR1-280	0			c.646_651del						.																																			SO:0001630	splice_region_variant	8216	exon7			TGCTGGGAGGAGG	D38496	CCDS33606.1	22q11.21	2013-01-09	2004-12-10		ENSG00000099949	ENSG00000099949		"""BTB/POZ domain containing"""	6742	protein-coding gene	gene with protein product		600574	"""leucine-zipper-like transcriptional regulator 1"""			7633402, 16356934	Standard	NM_006767		Approved	LZTR-1, BTBD29	uc002zto.3	Q8N653	OTTHUMG00000150878	ENST00000215739.8:c.651+1GAGGAGGTGAGGGGCGTGGGGAGCCAGGGCGCAGGTA>-	22.37:g.21343966_21344002delGAGGAGGTGAGGGGCGTGGGGAGCCAGGGCGCAGGTA		Somatic	61	0		WXS	Illumina GAIIx	Phase_I	62	14	NM_006767	0	0	0	0	0	Q14776|Q20WK0	In_Frame_Del	DEL	ENST00000215739.8	37	CCDS33606.1																																																																																			.		0.662	LZTR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320387.1	NM_006767	Frame_Shift_Del
RAB36	9609	bcgsc.ca	37	22	23503121	23503121	+	Silent	SNP	G	G	A	rs5759611	byFrequency	TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr22:23503121G>A	ENST00000263116.2	+	10	913	c.873G>A	c.(871-873)tcG>tcA	p.S291S	RAB36_ENST00000341989.4_Silent_p.S269S	NM_004914.2	NP_004905.2	O95755	RAB36_HUMAN	RAB36, member RAS oncogene family	291					protein transport (GO:0015031)|small GTPase mediated signal transduction (GO:0007264)	Golgi apparatus (GO:0005794)|membrane (GO:0016020)	GTP binding (GO:0005525)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(2)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	15	all_hematologic(9;0.0197)|Acute lymphoblastic leukemia(84;0.181)			READ - Rectum adenocarcinoma(21;0.155)		TCGAGCAGTCGGTGCTGCAGG	0.607													G|||	1138	0.227236	0.0976	0.3501	5008	,	,		20790	0.3413		0.2396	False		,,,				2504	0.1851				p.S291S		.											.	RAB36-228	0			c.G873A						.	G		535,3871	242.5+/-252.5	36,463,1704	80.0	69.0	73.0		873	-11.3	0.3	22	dbSNP_114	73	2217,6383	377.2+/-338.5	288,1641,2371	no	coding-synonymous	RAB36	NM_004914.2		324,2104,4075	AA,AG,GG		25.7791,12.1425,21.1595		291/334	23503121	2752,10254	2203	4300	6503	SO:0001819	synonymous_variant	9609	exon10			GCAGTCGGTGCTG	AB023061	CCDS13805.1	22q11.22	2008-06-11			ENSG00000100228	ENSG00000100228		"""RAB, member RAS oncogene"""	9775	protein-coding gene	gene with protein product		605662				9920784, 10591208	Standard	NM_004914		Approved		uc002zwv.1	O95755	OTTHUMG00000150601	ENST00000263116.2:c.873G>A	22.37:g.23503121G>A		Somatic	245	1		WXS	Illumina GAIIx	Phase_I	301	8	NM_004914	0	0	5	5	0	Q2M390|Q7Z4A9|Q9UHP5	Silent	SNP	ENST00000263116.2	37	CCDS13805.1																																																																																			G|0.776;A|0.224		0.607	RAB36-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319046.1	NM_004914	
MIF	4282	hgsc.bcm.edu	37	22	24237074	24237074	+	Missense_Mutation	SNP	C	C	T	rs182012324	byFrequency	TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr22:24237074C>T	ENST00000215754.7	+	2	695	c.224C>T	c.(223-225)tCc>tTc	p.S75F	AP000350.4_ENST00000406213.1_3'UTR|AP000350.10_ENST00000433835.3_Missense_Mutation_p.P183S	NM_002415.1	NP_002406.1	P03971	MIS_HUMAN	macrophage migration inhibitory factor (glycosylation-inhibiting factor)	0					aging (GO:0007568)|cell-cell signaling (GO:0007267)|gonadal mesoderm development (GO:0007506)|Mullerian duct regression (GO:0001880)|positive regulation of gene expression (GO:0010628)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|preantral ovarian follicle growth (GO:0001546)|response to drug (GO:0042493)|response to organic cyclic compound (GO:0014070)|sex determination (GO:0007530)|sex differentiation (GO:0007548)|urogenital system development (GO:0001655)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)	hormone activity (GO:0005179)|receptor binding (GO:0005102)			urinary_tract(1)	1						CAGAACCGCTCCTACAGCAAG	0.741													c|||	2	0.000399361	0.0	0.0	5008	,	,		9651	0.0		0.001	False		,,,				2504	0.001				p.S75F		.											.	MIF-514	0			c.C224T						.		PHE/SER	0,3942		0,0,1971	3.0	4.0	4.0		224	2.8	0.8	22		4	7,7811		0,7,3902	yes	missense	MIF	NM_002415.1	155	0,7,5873	TT,TC,CC		0.0895,0.0,0.0595	benign	75/116	24237074	7,11753	1971	3909	5880	SO:0001583	missense	4282	exon2			ACCGCTCCTACAG	M25639	CCDS13819.1	22q11.23	2007-04-26			ENSG00000240972	ENSG00000240972			7097	protein-coding gene	gene with protein product		153620		GLIF		7558020, 2552447	Standard	NM_002415		Approved	GIF	uc002zyr.1	P14174	OTTHUMG00000150773	ENST00000215754.7:c.224C>T	22.37:g.24237074C>T	ENSP00000215754:p.Ser75Phe	Somatic	4	0		WXS	Illumina GAIIx	Phase_I	5	5	NM_002415	0	1	9	837	827	O75246|Q6GTN3	Missense_Mutation	SNP	ENST00000215754.7	37	CCDS13819.1	1	4.578754578754579E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	N	14.96	2.691564	0.48097	0.0	8.95E-4	ENSG00000240972	ENST00000215754	.	.	.	4.96	2.76	0.32466	Tautomerase (2);	0.780131	0.12276	N	0.483326	T	0.34629	0.0904	L	0.52905	1.665	0.09310	N	0.999996	B	0.30973	0.302	B	0.28553	0.091	T	0.33752	-0.9856	9	0.66056	D	0.02	-14.5498	5.3544	0.16053	0.1511:0.6297:0.1378:0.0814	.	75	P14174	MIF_HUMAN	F	75	.	ENSP00000215754:S75F	S	+	2	0	MIF	22567074	0.023000	0.18921	0.847000	0.33407	0.658000	0.38924	0.867000	0.27968	1.175000	0.42826	0.448000	0.29417	TCC	C|0.999;T|0.000		0.741	MIF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320009.1	NM_002415	
TTC28	23331	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	22	28501523	28501523	+	Silent	SNP	C	C	T			TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr22:28501523C>T	ENST00000397906.2	-	8	3192	c.3051G>A	c.(3049-3051)ctG>ctA	p.L1017L		NM_001145418.1	NP_001138890.1	Q96AY4	TTC28_HUMAN	tetratricopeptide repeat domain 28	1017					mitotic nuclear division (GO:0007067)|regulation of mitotic cell cycle (GO:0007346)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|midbody (GO:0030496)				endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)	12						GGTGGTACTGCAGGGCTGTGT	0.567																																					p.L1017L		.											.	.	0			c.G3051A						.						118.0	107.0	111.0					22																	28501523		692	1591	2283	SO:0001819	synonymous_variant	23331	exon8			GTACTGCAGGGCT	AB028966	CCDS46678.1	22q12.1	2013-01-10			ENSG00000100154	ENSG00000100154		"""Tetratricopeptide (TTC) repeat domain containing"""	29179	protein-coding gene	gene with protein product		615098				10470851	Standard	NM_001145418		Approved	KIAA1043	uc003adp.4	Q96AY4	OTTHUMG00000151006	ENST00000397906.2:c.3051G>A	22.37:g.28501523C>T		Somatic	172	1		WXS	Illumina GAIIx	Phase_I	185	174	NM_001145418	0	0	1	1	0	K7ZRV2|O95928|O95929|Q5W189|Q9NTE4|Q9UG31|Q9UGG5|Q9UPV8|Q9Y3S5	Silent	SNP	ENST00000397906.2	37	CCDS46678.1																																																																																			.		0.567	TTC28-001	NOVEL	not_organism_supported|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000320930.2	XM_929318	
CHEK2	11200	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	22	29130427	29130427	+	Nonsense_Mutation	SNP	G	G	A	rs587781269		TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr22:29130427G>A	ENST00000405598.1	-	3	474	c.283C>T	c.(283-285)Cga>Tga	p.R95*	CHEK2_ENST00000382566.1_Nonsense_Mutation_p.R95*|CHEK2_ENST00000328354.6_Nonsense_Mutation_p.R95*|CHEK2_ENST00000382580.2_Nonsense_Mutation_p.R95*|CHEK2_ENST00000382565.1_Nonsense_Mutation_p.R95*|CHEK2_ENST00000402731.1_Nonsense_Mutation_p.R95*|CHEK2_ENST00000382578.1_Nonsense_Mutation_p.R95*|CHEK2_ENST00000544772.1_5'UTR|CHEK2_ENST00000348295.3_Nonsense_Mutation_p.R95*|CHEK2_ENST00000403642.1_Nonsense_Mutation_p.R95*|CHEK2_ENST00000404276.1_Nonsense_Mutation_p.R95*			O96017	CHK2_HUMAN	checkpoint kinase 2	95					cellular protein catabolic process (GO:0044257)|cellular response to DNA damage stimulus (GO:0006974)|DNA damage checkpoint (GO:0000077)|DNA damage induced protein phosphorylation (GO:0006975)|double-strand break repair (GO:0006302)|G2/M transition of mitotic cell cycle (GO:0000086)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|positive regulation of transcription, DNA-templated (GO:0045893)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|protein stabilization (GO:0050821)|regulation of protein catabolic process (GO:0042176)|regulation of transcription, DNA-templated (GO:0006355)|replicative senescence (GO:0090399)|response to gamma radiation (GO:0010332)|signal transduction in response to DNA damage (GO:0042770)|signal transduction involved in intra-S DNA damage checkpoint (GO:0072428)|spindle assembly involved in mitosis (GO:0090307)|transcription, DNA-templated (GO:0006351)	nucleoplasm (GO:0005654)|PML body (GO:0016605)	ATP binding (GO:0005524)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|protein kinase binding (GO:0019901)|protein serine/threonine kinase activity (GO:0004674)|ubiquitin protein ligase binding (GO:0031625)			central_nervous_system(17)|endometrium(2)|kidney(11)|large_intestine(2)|lung(11)|ovary(1)|prostate(4)|stomach(2)	50						GCCCATAATCGAGCCCAGGGG	0.463			F			breast		Direct reversal of damage;Other conserved DNA damage response genes																													p.R95X		.	yes	Rec		familial breast cancer	22	22q12.1	11200	CHK2 checkpoint homolog (S. pombe)		E	.	CHEK2-1515	0			c.C283T						.						46.0	51.0	49.0					22																	29130427		2203	4300	6503	SO:0001587	stop_gained	11200	exon2			ATAATCGAGCCCA	AF086904	CCDS13843.1, CCDS13844.1, CCDS33629.1	22q12.1	2014-09-17	2011-11-11	2001-09-27	ENSG00000183765	ENSG00000183765			16627	protein-coding gene	gene with protein product		604373	"""CHK2 (checkpoint, S.pombe) homolog"", ""CHK2 checkpoint homolog (S. pombe)"""	RAD53		9836640, 10097108	Standard	NM_001257387		Approved	CDS1, CHK2, HuCds1, PP1425, bA444G7	uc003adt.1	O96017	OTTHUMG00000151023	ENST00000405598.1:c.283C>T	22.37:g.29130427G>A	ENSP00000386087:p.Arg95*	Somatic	61	0		WXS	Illumina GAIIx	Phase_I	49	47	NM_145862	0	0	0	0	0	A8K3Y9|B7ZBF3|B7ZBF4|B7ZBF5|Q6QA03|Q6QA04|Q6QA05|Q6QA06|Q6QA07|Q6QA08|Q6QA10|Q6QA11|Q6QA12|Q6QA13|Q9HBS5|Q9HCQ8|Q9UGF0|Q9UGF1	Nonsense_Mutation	SNP	ENST00000405598.1	37	CCDS13843.1	.	.	.	.	.	.	.	.	.	.	G	37	5.981356	0.97168	.	.	ENSG00000183765	ENST00000348295;ENST00000382578;ENST00000382565;ENST00000382566;ENST00000328354;ENST00000404276;ENST00000405598;ENST00000382580;ENST00000403642;ENST00000402731;ENST00000447421;ENST00000439200;ENST00000398017	.	.	.	5.42	5.42	0.78866	.	0.052729	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-0.3402	18.5716	0.91137	0.0:0.0:1.0:0.0	.	.	.	.	X	95;95;95;95;95;95;95;95;95;95;95;95;105	.	ENSP00000329178:R95X	R	-	1	2	CHEK2	27460427	1.000000	0.71417	1.000000	0.80357	0.963000	0.63663	4.658000	0.61497	2.704000	0.92352	0.655000	0.94253	CGA	.		0.463	CHEK2-005	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000321150.1	NM_001005735	
XBP1	7494	broad.mit.edu	37	22	29191569	29191569	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr22:29191569G>A	ENST00000216037.6	-	5	823	c.751C>T	c.(751-753)Cgt>Tgt	p.R251C	XBP1_ENST00000344347.5_Missense_Mutation_p.T242M|XBP1_ENST00000405219.3_Missense_Mutation_p.R201C|XBP1_ENST00000403532.3_Missense_Mutation_p.R256C	NM_001079539.1|NM_005080.3	NP_001073007.1|NP_005071.2	P17861	XBP1_HUMAN	X-box binding protein 1	251					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|cellular response to antibiotic (GO:0071236)|endoplasmic reticulum unfolded protein response (GO:0030968)|epithelial cell maturation involved in salivary gland development (GO:0060691)|exocrine pancreas development (GO:0031017)|glucose homeostasis (GO:0042593)|immune response (GO:0006955)|positive regulation of endoplasmic reticulum unfolded protein response (GO:1900103)|positive regulation of proteasomal protein catabolic process (GO:1901800)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|response to drug (GO:0042493)|response to electrical stimulus (GO:0051602)|serotonin secretion, neurotransmission (GO:0060096)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(2)|endometrium(1)|large_intestine(1)|lung(1)	5						GGCTGATGACGTCCCCACTGA	0.522																																					p.R251C		.											.	XBP1-290	0			c.C751T						.						79.0	81.0	80.0					22																	29191569		2203	4300	6503	SO:0001583	missense	7494	exon5			GATGACGTCCCCA	M31627	CCDS13847.1	22q12.1	2013-01-10			ENSG00000100219	ENSG00000100219		"""basic leucine zipper proteins"""	12801	protein-coding gene	gene with protein product		194355		XBP2		1718857, 2196176	Standard	NM_001079539		Approved		uc003aec.3	P17861	OTTHUMG00000151094	ENST00000216037.6:c.751C>T	22.37:g.29191569G>A	ENSP00000216037:p.Arg251Cys	Somatic	90	1		WXS	Illumina GAIIx	Phase_I	114	4	NM_005080	0	0	71	71	0	Q8WYK6|Q969P1|Q96BD7	Missense_Mutation	SNP	ENST00000216037.6	37	CCDS13847.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	19.43|19.43	3.826173|3.826173	0.71143|0.71143	.|.	.|.	ENSG00000100219|ENSG00000100219	ENST00000216037;ENST00000403532;ENST00000405219|ENST00000344347	.|.	.|.	.|.	5.77|5.77	5.77|5.77	0.91146|0.91146	.|.	.|0.400278	.|0.27782	.|N	.|0.017873	T|T	0.62816|0.62816	0.2459|0.2459	.|.	.|.	.|.	0.45704|0.45704	D|D	0.998614|0.998614	D|D	0.76494|0.63046	0.999|0.992	P|P	0.53689|0.47015	0.732|0.534	T|T	0.66118|0.66118	-0.6003|-0.6003	7|8	0.87932|0.59425	D|D	0|0.04	.|.	18.9768|18.9768	0.92740|0.92740	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	201|242	B1AHH1|P17861-2	.|.	C|M	251;256;201|242	.|.	ENSP00000216037:R251C|ENSP00000343155:T242M	R|T	-|-	1|2	0|0	XBP1|XBP1	27521569|27521569	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.999000|0.999000	0.98932|0.98932	9.176000|9.176000	0.94839|0.94839	2.735000|2.735000	0.93741|0.93741	0.655000|0.655000	0.94253|0.94253	CGT|ACG	.		0.522	XBP1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000321274.1	NM_005080	
ZNRF3	84133	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	22	29445345	29445345	+	Frame_Shift_Del	DEL	C	C	-			TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr22:29445345delC	ENST00000544604.2	+	8	1351	c.1176delC	c.(1174-1176)aacfs	p.N392fs	ZNRF3_ENST00000406323.3_Frame_Shift_Del_p.N292fs|ZNRF3_ENST00000402174.1_Frame_Shift_Del_p.N292fs|ZNRF3_ENST00000332811.4_Frame_Shift_Del_p.N292fs	NM_001206998.1	NP_001193927.1	Q9ULT6	ZNRF3_HUMAN	zinc and ring finger 3	392					canonical Wnt signaling pathway (GO:0060070)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of non-canonical Wnt signaling pathway (GO:2000051)|protein ubiquitination (GO:0016567)|stem cell proliferation (GO:0072089)|ubiquitin-dependent protein catabolic process (GO:0006511)|Wnt receptor catabolic process (GO:0038018)|Wnt signaling pathway, planar cell polarity pathway (GO:0060071)	integral component of plasma membrane (GO:0005887)	frizzled binding (GO:0005109)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|liver(4)|lung(9)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)	28						CCCACGGCAACCCCGTCACCT	0.667																																					p.N392fs		.											.	ZNRF3-69	0			c.1176delC						.						56.0	65.0	62.0					22																	29445345		2181	4281	6462	SO:0001589	frameshift_variant	84133	exon8			CGGCAACCCCGTC	AB051436	CCDS42999.1, CCDS56225.1	22q12.1	2013-01-09			ENSG00000183579	ENSG00000183579		"""RING-type (C3HC4) zinc fingers"""	18126	protein-coding gene	gene with protein product		612062				10574461	Standard	NM_032173		Approved	KIAA1133, BK747E2.3, FLJ22057, RNF203	uc003aeg.3	Q9ULT6	OTTHUMG00000151009	ENST00000544604.2:c.1176delC	22.37:g.29445345delC	ENSP00000443824:p.Asn392fs	Somatic	117	0		WXS	Illumina GAIIx	Phase_I	165	146	NM_001206998	0	0	0	0	0	B3KU18|Q6ICH1|Q6NTF8|Q8WU18	Frame_Shift_Del	DEL	ENST00000544604.2	37	CCDS56225.1																																																																																			.		0.667	ZNRF3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000320943.2	XM_290972	
CRELD2	79174	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	22	50319196	50319196	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr22:50319196G>A	ENST00000328268.4	+	9	1074	c.1000G>A	c.(1000-1002)Gca>Aca	p.A334T	CRELD2_ENST00000404488.3_Missense_Mutation_p.A383T|CRELD2_ENST00000403427.3_Missense_Mutation_p.A306T|CRELD2_ENST00000407217.3_Missense_Mutation_p.A302T	NM_024324.3	NP_077300.3	Q6UXH1	CREL2_HUMAN	cysteine-rich with EGF-like domains 2	334						endoplasmic reticulum (GO:0005783)|extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)	calcium ion binding (GO:0005509)			endometrium(1)|large_intestine(1)|lung(3)|ovary(1)|stomach(3)	9		all_cancers(38;5.53e-07)|all_epithelial(38;3.84e-06)|all_lung(38;0.00208)|Breast(42;0.0104)|Lung NSC(38;0.0199)|Ovarian(80;0.0907)|Lung SC(80;0.236)		BRCA - Breast invasive adenocarcinoma(115;0.198)|LUAD - Lung adenocarcinoma(64;0.247)		TGTGCCGCCGGCAGAGGCTGG	0.592																																					p.A383T		.											.	CRELD2-90	0			c.G1147A						.						87.0	81.0	83.0					22																	50319196		2203	4300	6503	SO:0001583	missense	79174	exon10			CCGCCGGCAGAGG	BC050675	CCDS14082.1, CCDS46730.1, CCDS63515.1, CCDS63516.1	22q13.33	2005-12-08			ENSG00000184164	ENSG00000184164			28150	protein-coding gene	gene with protein product		607171				12137942	Standard	XM_005261737		Approved	MGC11256	uc010hal.2	Q6UXH1	OTTHUMG00000150292	ENST00000328268.4:c.1000G>A	22.37:g.50319196G>A	ENSP00000332223:p.Ala334Thr	Somatic	68	0		WXS	Illumina GAIIx	Phase_I	94	88	NM_001135101	0	0	0	0	0	A5GZA2|A5GZA3|A5GZA4|A5GZA5|A5GZA6|Q4W0V0|Q86UC0|Q9BU47	Missense_Mutation	SNP	ENST00000328268.4	37	CCDS14082.1	.	.	.	.	.	.	.	.	.	.	G	6.921	0.539590	0.13250	.	.	ENSG00000184164	ENST00000404488;ENST00000328268;ENST00000407217;ENST00000403427	T;T;T;T	0.57595	0.6;0.42;0.62;0.39	4.29	1.99	0.26369	.	62.780300	0.01754	U	0.030117	T	0.43389	0.1245	L	0.34521	1.04	0.09310	N	1	B;P;B;P;B	0.48089	0.257;0.905;0.43;0.651;0.304	B;B;B;B;B	0.42827	0.098;0.399;0.196;0.15;0.105	T	0.34875	-0.9811	10	0.14252	T	0.57	.	7.3531	0.26703	0.0915:0.3272:0.5813:0.0	.	302;383;306;334;334	Q6UXH1-2;Q6UXH1-5;Q6UXH1-4;A5GZA6;Q6UXH1	.;.;.;.;CREL2_HUMAN	T	383;334;302;306	ENSP00000383938:A383T;ENSP00000332223:A334T;ENSP00000386034:A302T;ENSP00000384111:A306T	ENSP00000332223:A334T	A	+	1	0	CRELD2	48705200	0.000000	0.05858	0.006000	0.13384	0.004000	0.04260	0.631000	0.24568	0.797000	0.33971	0.532000	0.56150	GCA	.		0.592	CRELD2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000317409.1	NM_024324	
PLXNB2	23654	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	22	50722344	50722344	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr22:50722344G>A	ENST00000449103.1	-	14	2479	c.2339C>T	c.(2338-2340)gCg>gTg	p.A780V	PLXNB2_ENST00000359337.4_Missense_Mutation_p.A780V|PLXNB2_ENST00000496720.1_5'UTR			O15031	PLXB2_HUMAN	plexin B2	780					brain development (GO:0007420)|neural tube closure (GO:0001843)|neuroblast proliferation (GO:0007405)|positive regulation of axonogenesis (GO:0050772)|regulation of cell shape (GO:0008360)|regulation of neuron migration (GO:2001222)|regulation of protein phosphorylation (GO:0001932)|regulation of Rho GTPase activity (GO:0032319)|semaphorin-plexin signaling pathway (GO:0071526)	cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)	GTPase activator activity (GO:0005096)|semaphorin receptor activity (GO:0017154)			breast(2)|central_nervous_system(4)|cervix(2)|endometrium(11)|kidney(4)|large_intestine(3)|liver(1)|lung(20)|ovary(5)|prostate(6)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(2)	66		all_cancers(38;5.78e-13)|all_epithelial(38;1.71e-11)|all_lung(38;3.89e-05)|Breast(42;0.000523)|Lung NSC(38;0.000992)|Ovarian(80;0.0221)|Hepatocellular(38;0.0691)|Lung SC(80;0.113)		BRCA - Breast invasive adenocarcinoma(115;0.205)|LUAD - Lung adenocarcinoma(64;0.247)		CCCGCACCACGCACACCTGTA	0.677																																					p.A780V		.											.	PLXNB2-211	0			c.C2339T						.						18.0	24.0	22.0					22																	50722344		2035	4169	6204	SO:0001583	missense	23654	exon14			CACCACGCACACC		CCDS43035.1	22q13.33	2008-06-12			ENSG00000196576	ENSG00000196576		"""Plexins"""	9104	protein-coding gene	gene with protein product		604293				10520995, 12183458	Standard	NM_012401		Approved	MM1, KIAA0315, PLEXB2	uc003bkv.4	O15031	OTTHUMG00000150219	ENST00000449103.1:c.2339C>T	22.37:g.50722344G>A	ENSP00000409171:p.Ala780Val	Somatic	34	0		WXS	Illumina GAIIx	Phase_I	88	75	NM_012401	0	0	0	24	24	A6QRH0|Q7KZU3|Q9BSU7	Missense_Mutation	SNP	ENST00000449103.1	37	CCDS43035.1	.	.	.	.	.	.	.	.	.	.	g	0.239	-1.015113	0.02078	.	.	ENSG00000196576	ENST00000449103;ENST00000359337	T;T	0.03094	4.05;4.05	4.52	0.975	0.19721	.	0.248739	0.28006	N	0.016964	T	0.00754	0.0025	N	0.00197	-1.87	0.23221	N	0.998095	B	0.02656	0.0	B	0.01281	0.0	T	0.45818	-0.9235	10	0.08381	T	0.77	.	3.8273	0.08859	0.6471:0.0:0.1951:0.1578	.	780	O15031	PLXB2_HUMAN	V	780	ENSP00000409171:A780V;ENSP00000352288:A780V	ENSP00000352288:A780V	A	-	2	0	PLXNB2	49064471	0.678000	0.27586	0.935000	0.37517	0.047000	0.14425	0.421000	0.21280	0.275000	0.22094	-0.348000	0.07805	GCG	.		0.677	PLXNB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316874.3	NM_012401	
PLXNB2	23654	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	22	50722601	50722601	+	Silent	SNP	G	G	A			TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr22:50722601G>A	ENST00000449103.1	-	13	2363	c.2223C>T	c.(2221-2223)taC>taT	p.Y741Y	PLXNB2_ENST00000359337.4_Silent_p.Y741Y|PLXNB2_ENST00000496720.1_5'UTR			O15031	PLXB2_HUMAN	plexin B2	741					brain development (GO:0007420)|neural tube closure (GO:0001843)|neuroblast proliferation (GO:0007405)|positive regulation of axonogenesis (GO:0050772)|regulation of cell shape (GO:0008360)|regulation of neuron migration (GO:2001222)|regulation of protein phosphorylation (GO:0001932)|regulation of Rho GTPase activity (GO:0032319)|semaphorin-plexin signaling pathway (GO:0071526)	cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)	GTPase activator activity (GO:0005096)|semaphorin receptor activity (GO:0017154)			breast(2)|central_nervous_system(4)|cervix(2)|endometrium(11)|kidney(4)|large_intestine(3)|liver(1)|lung(20)|ovary(5)|prostate(6)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(2)	66		all_cancers(38;5.78e-13)|all_epithelial(38;1.71e-11)|all_lung(38;3.89e-05)|Breast(42;0.000523)|Lung NSC(38;0.000992)|Ovarian(80;0.0221)|Hepatocellular(38;0.0691)|Lung SC(80;0.113)		BRCA - Breast invasive adenocarcinoma(115;0.205)|LUAD - Lung adenocarcinoma(64;0.247)		AAGACTTGACGTAGAGGTGCA	0.687																																					p.Y741Y		.											.	PLXNB2-211	0			c.C2223T						.						54.0	59.0	57.0					22																	50722601		2106	4218	6324	SO:0001819	synonymous_variant	23654	exon13			CTTGACGTAGAGG		CCDS43035.1	22q13.33	2008-06-12			ENSG00000196576	ENSG00000196576		"""Plexins"""	9104	protein-coding gene	gene with protein product		604293				10520995, 12183458	Standard	NM_012401		Approved	MM1, KIAA0315, PLEXB2	uc003bkv.4	O15031	OTTHUMG00000150219	ENST00000449103.1:c.2223C>T	22.37:g.50722601G>A		Somatic	48	0		WXS	Illumina GAIIx	Phase_I	71	65	NM_012401	0	0	1	32	31	A6QRH0|Q7KZU3|Q9BSU7	Silent	SNP	ENST00000449103.1	37	CCDS43035.1	.	.	.	.	.	.	.	.	.	.	g	1.393	-0.580304	0.03854	.	.	ENSG00000196576	ENST00000434732	.	.	.	4.39	-3.4	0.04853	.	.	.	.	.	T	0.53012	0.1770	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.50056	-0.8872	4	.	.	.	.	9.0421	0.36325	0.5674:0.0:0.4326:0.0	.	.	.	.	M	83	.	.	T	-	2	0	PLXNB2	49064728	0.275000	0.24201	0.899000	0.35326	0.051000	0.14879	-0.876000	0.04201	-0.769000	0.04620	-0.696000	0.03686	ACG	.		0.687	PLXNB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316874.3	NM_012401	
SCO2	9997	bcgsc.ca	37	22	50962208	50962208	+	Silent	SNP	T	T	G	rs12148	byFrequency	TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10	T	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr22:50962208T>G	ENST00000543927.1	-	2	839	c.633A>C	c.(631-633)gcA>gcC	p.A211A	CTA-384D8.36_ENST00000608319.1_RNA|SCO2_ENST00000535425.1_Silent_p.A211A|SCO2_ENST00000395693.3_Silent_p.A211A|SCO2_ENST00000252785.3_Silent_p.A211A	NM_001169109.1	NP_001162580.1	O43819	SCO2_HUMAN	SCO2 cytochrome c oxidase assembly protein	211	Thioredoxin. {ECO:0000255|PROSITE- ProRule:PRU00691}.				cellular copper ion homeostasis (GO:0006878)|copper ion transport (GO:0006825)|eye development (GO:0001654)|in utero embryonic development (GO:0001701)|muscle system process (GO:0003012)|oxidation-reduction process (GO:0055114)|respiratory chain complex IV assembly (GO:0008535)|respiratory electron transport chain (GO:0022904)|response to activity (GO:0014823)	mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)|myofibril (GO:0030016)|nucleus (GO:0005634)	copper ion binding (GO:0005507)			endometrium(1)|lung(1)	2		all_cancers(38;4.58e-14)|all_epithelial(38;1.12e-12)|all_lung(38;3.07e-05)|Breast(42;6.27e-05)|Lung NSC(38;0.000813)|Ovarian(80;0.0221)|Hepatocellular(38;0.0691)|Lung SC(80;0.113)		BRCA - Breast invasive adenocarcinoma(115;0.205)|LUAD - Lung adenocarcinoma(64;0.247)		CCTTGGGGCCTGCATTGTAGT	0.582													G|||	3283	0.655551	0.6694	0.6196	5008	,	,		19911	0.6677		0.6183	False		,,,				2504	0.6881				p.A211A		.											.	SCO2-226	0			c.A633C						.	G	,,,,,	2955,1451	469.8+/-355.6	982,991,230	190.0	160.0	170.0		633,633,633,,633,	-9.9	0.0	22	dbSNP_52	170	5305,3295	492.8+/-373.4	1611,2083,606	no	coding-synonymous,coding-synonymous,coding-synonymous,utr-3,coding-synonymous,utr-3	SCO2,NCAPH2	NM_001169109.1,NM_001169110.1,NM_001169111.1,NM_001185011.1,NM_005138.2,NM_152299.3	,,,,,	2593,3074,836	GG,GT,TT		38.314,32.9324,36.4909	,,,,,	211/267,211/267,211/267,,211/267,	50962208	8260,4746	2203	4300	6503	SO:0001819	synonymous_variant	9997	exon2			GGGGCCTGCATTG	AL021683	CCDS14095.1	22q13.33	2014-01-30	2012-10-15		ENSG00000130489	ENSG00000130489		"""Mitochondrial respiratory chain complex assembly factors"""	10604	protein-coding gene	gene with protein product		604272	"""SCO (cytochrome oxidase deficient, yeast) homolog 2"", ""SCO cytochrome oxidase deficient homolog 2 (yeast)"", ""myopia 6"""	MYP6		10218584, 16091356, 23643385	Standard	NM_005138		Approved	SCO1L	uc003bma.3	O43819	OTTHUMG00000150251	ENST00000543927.1:c.633A>C	22.37:g.50962208T>G		Somatic	230	2		WXS	Illumina GAIIx	Phase_I	225	7	NM_001169111	0	0	93	93	0	Q3T1B5|Q9UK87	Silent	SNP	ENST00000543927.1	37	CCDS14095.1																																																																																			T|0.349;G|0.651		0.582	SCO2-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317091.1	NM_005138	
SETD5	55209	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	9516182	9516182	+	Nonsense_Mutation	SNP	A	A	T			TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr3:9516182A>T	ENST00000406341.1	+	20	3737	c.3547A>T	c.(3547-3549)Aag>Tag	p.K1183*	SETD5_ENST00000402198.1_Nonsense_Mutation_p.K1183*|SETD5_ENST00000407969.1_Nonsense_Mutation_p.K1202*|SETD5_ENST00000302463.6_Nonsense_Mutation_p.K1085*|SETD5_ENST00000402466.1_Nonsense_Mutation_p.K1085*			Q9C0A6	SETD5_HUMAN	SET domain containing 5	1183	Ser-rich.									NS(2)|breast(3)|central_nervous_system(1)|endometrium(6)|kidney(2)|large_intestine(10)|lung(11)|ovary(3)|prostate(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	47	Medulloblastoma(99;0.227)			OV - Ovarian serous cystadenocarcinoma(96;0.112)		GAGCATCCCCAAGGTCCTCCG	0.542																																					p.K1183X		.											.	SETD5-70	0			c.A3547T						.						104.0	102.0	102.0					3																	9516182		2062	4206	6268	SO:0001587	stop_gained	55209	exon21			ATCCCCAAGGTCC	BC020956	CCDS46741.1, CCDS74892.1	3p25.3	2011-12-13			ENSG00000168137	ENSG00000168137			25566	protein-coding gene	gene with protein product		615743				11214970	Standard	XM_005265299		Approved	FLJ10707	uc003brt.3	Q9C0A6	OTTHUMG00000150491	ENST00000406341.1:c.3547A>T	3.37:g.9516182A>T	ENSP00000383939:p.Lys1183*	Somatic	70	0		WXS	Illumina GAIIx	Phase_I	105	86	NM_001080517	0	0	4	31	27	Q6AI17|Q8WUB6|Q9H3X4|Q9H6V7|Q9H7S3|Q9NVI9	Nonsense_Mutation	SNP	ENST00000406341.1	37	CCDS46741.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	47|47	13.401307|13.401307	0.99740|0.99740	.|.	.|.	ENSG00000168137|ENSG00000168137	ENST00000402198;ENST00000402466;ENST00000406341;ENST00000407969;ENST00000302463|ENST00000399686	.|.	.|.	.|.	5.61|5.61	5.61|5.61	0.85477|0.85477	.|.	0.066998|.	0.64402|.	D|.	0.000008|.	.|T	.|0.55305	.|0.1912	.|.	.|.	.|.	0.80722|0.80722	A|A	1|1	.|.	.|.	.|.	.|.	.|.	.|.	.|T	.|0.65553	.|-0.6140	.|3	0.02654|.	T|.	1|.	-18.0164|-18.0164	10.4568|10.4568	0.44555|0.44555	0.9273:0.0:0.0727:0.0|0.9273:0.0:0.0727:0.0	.|.	.|.	.|.	.|.	X|L	1183;1085;1183;1202;1085|850	.|.	ENSP00000302028:K1085X|.	K|Q	+|+	1|2	0|0	SETD5|SETD5	9491182|9491182	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.701000|0.701000	0.40568|0.40568	3.429000|3.429000	0.52800|0.52800	2.259000|2.259000	0.74868|0.74868	0.528000|0.528000	0.53228|0.53228	AAG|CAA	.		0.542	SETD5-001	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318425.1	XM_371614	
SLC6A11	6538	broad.mit.edu;bcgsc.ca	37	3	10858122	10858122	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr3:10858122G>A	ENST00000254488.2	+	1	238	c.172G>A	c.(172-174)Gag>Aag	p.E58K	SLC6A11_ENST00000454147.1_Missense_Mutation_p.E58K	NM_014229.1	NP_055044.1	P48066	S6A11_HUMAN	solute carrier family 6 (neurotransmitter transporter), member 11	58					brain development (GO:0007420)|neurotransmitter secretion (GO:0007269)|response to drug (GO:0042493)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	gamma-aminobutyric acid:sodium symporter activity (GO:0005332)|neurotransmitter binding (GO:0042165)|neurotransmitter:sodium symporter activity (GO:0005328)			breast(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(13)|lung(13)|ovary(1)|skin(4)	35				OV - Ovarian serous cystadenocarcinoma(96;0.229)	Clobazam(DB00349)	CAACAAGGTGGAGTTCGTGCT	0.687																																					p.E58K		.											.	SLC6A11-132	0			c.G172A						.						51.0	32.0	38.0					3																	10858122		2203	4300	6503	SO:0001583	missense	6538	exon1			AAGGTGGAGTTCG	S75989	CCDS2602.1	3p25.3	2013-07-19	2013-07-19		ENSG00000132164	ENSG00000132164		"""Solute carriers"""	11044	protein-coding gene	gene with protein product	"""GABA transporter 3"""	607952	"""solute carrier family 6 (neurotransmitter transporter, GABA), member 11"""			7874447	Standard	NM_014229		Approved	GAT3	uc003bvz.3	P48066	OTTHUMG00000129718	ENST00000254488.2:c.172G>A	3.37:g.10858122G>A	ENSP00000254488:p.Glu58Lys	Somatic	172	0		WXS	Illumina GAIIx	Phase_I	291	10	NM_014229	0	0	0	0	0	B2R6U6|Q8IYC9	Missense_Mutation	SNP	ENST00000254488.2	37	CCDS2602.1	.	.	.	.	.	.	.	.	.	.	G	25.8	4.673711	0.88445	.	.	ENSG00000132164	ENST00000254488;ENST00000454147	T;T	0.75704	-0.96;-0.96	3.48	3.48	0.39840	.	0.000000	0.85682	D	0.000000	D	0.90480	0.7018	H	0.98559	4.265	0.80722	D	1	D	0.59357	0.985	D	0.63381	0.914	D	0.94389	0.7612	10	0.87932	D	0	.	15.1481	0.72674	0.0:0.0:1.0:0.0	.	58	P48066	S6A11_HUMAN	K	58	ENSP00000254488:E58K;ENSP00000404120:E58K	ENSP00000254488:E58K	E	+	1	0	SLC6A11	10833122	1.000000	0.71417	1.000000	0.80357	0.543000	0.35085	9.213000	0.95133	1.774000	0.52232	0.313000	0.20887	GAG	.		0.687	SLC6A11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251927.1	NM_014229	
STAC	6769	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	3	36570404	36570406	+	In_Frame_Del	DEL	AGA	AGA	-			TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10	AGA	AGA	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr3:36570404_36570406delAGA	ENST00000273183.3	+	10	1337_1339	c.1037_1039delAGA	c.(1036-1041)gagaag>gag	p.K347del	STAC_ENST00000457375.2_In_Frame_Del_p.K286del	NM_003149.1	NP_003140.1	Q99469	STAC_HUMAN	SH3 and cysteine rich domain	347					cellular response to heat (GO:0034605)|intracellular signal transduction (GO:0035556)|signal transduction (GO:0007165)	cytosol (GO:0005829)	metal ion binding (GO:0046872)			endometrium(5)|large_intestine(9)|lung(10)|ovary(1)|pancreas(1)|prostate(1)|skin(5)	32						CAACAAAATGAGAAGATTTTTAG	0.399																																					p.346_347del		.											.	STAC-94	0			c.1037_1039del						.																																			SO:0001651	inframe_deletion	6769	exon10			AAAATGAGAAGAT	D86640	CCDS2662.1	3p22.3	2007-06-08			ENSG00000144681	ENSG00000144681			11353	protein-coding gene	gene with protein product		602317	"""src homology three (SH3) and cysteine rich domain"""			8954993, 10393425	Standard	XM_006713308		Approved	STAC1	uc003cgh.1	Q99469	OTTHUMG00000130798	ENST00000273183.3:c.1037_1039delAGA	3.37:g.36570407_36570409delAGA	ENSP00000273183:p.Lys347del	Somatic	85	0		WXS	Illumina GAIIx	Phase_I	80	75	NM_003149	0	0	0	0	0	B2R8S8	In_Frame_Del	DEL	ENST00000273183.3	37	CCDS2662.1																																																																																			.		0.399	STAC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253338.2	NM_003149	
MLH1	4292	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	3	37042447	37042449	+	Splice_Site	DEL	AAG	AAG	-	rs63751642|rs267607724|rs63749829|rs267607721|rs63751191|rs267607723		TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10	AAG	AAG	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr3:37042447_37042449delAAG	ENST00000231790.2	+	3	425_427	c.209_211delAAG	c.(208-213)aaagaa>aaa	p.E71del	MLH1_ENST00000536378.1_5'UTR|MLH1_ENST00000492474.1_3'UTR|MLH1_ENST00000539477.1_5'UTR|MLH1_ENST00000435176.1_5'UTR|MLH1_ENST00000458205.2_5'UTR|MLH1_ENST00000455445.2_5'UTR	NM_000249.3|NM_001258273.1	NP_000240.1|NP_001245202.1	P40692	MLH1_HUMAN	mutL homolog 1	71			Missing (in HNPCC2). {ECO:0000269|PubMed:16083711}.		ATP catabolic process (GO:0006200)|double-strand break repair via nonhomologous end joining (GO:0006303)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|isotype switching (GO:0045190)|male meiosis chromosome segregation (GO:0007060)|meiotic metaphase I plate congression (GO:0043060)|mismatch repair (GO:0006298)|negative regulation of mitotic recombination (GO:0045950)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|oogenesis (GO:0048477)|resolution of meiotic recombination intermediates (GO:0000712)|somatic hypermutation of immunoglobulin genes (GO:0016446)|spermatogenesis (GO:0007283)|spindle midzone assembly involved in meiosis (GO:0051257)|synapsis (GO:0007129)	chiasma (GO:0005712)|male germ cell nucleus (GO:0001673)|membrane (GO:0016020)|MutLalpha complex (GO:0032389)|nucleus (GO:0005634)|synaptonemal complex (GO:0000795)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|guanine/thymine mispair binding (GO:0032137)			NS(1)|breast(4)|central_nervous_system(3)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(12)|kidney(2)|large_intestine(54)|lung(13)|oesophagus(7)|ovary(6)|pancreas(5)|prostate(5)|skin(2)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	127						ATCTAACAGAAAGAAGATCTGGA	0.335		1	"""D, Mis, N, F, S"""		"""colorectal, endometrial, ovarian, CNS"""	"""colorectal, endometrial, ovarian, CNS"""		Mismatch excision repair (MMR)	Turcot syndrome;Muir-Torre syndrome;Lynch syndrome;Constitutional Mismatch Repair Deficiency Syndrome																												p.70_71del		.	yes	Rec	yes	"""Hereditary non-polyposis colorectal cancer, Turcot syndrome"""	3	3p21.3	4292	E.coli MutL homolog gene		"""E, O"""	.	MLH1-2559	0			c.209_211del	GRCh37	CD010631|CM055986	MLH1	D|M		.																																			SO:0001630	splice_region_variant	4292	exon3	Familial Cancer Database	Brain tumor-colorectal polyp(osis) syndrome; ;Hereditary Non-Polyposis Colorectal Cancer, HNPCC, Lynch syndromes 1 and 2 (= Cancer Family Syndrome), Hereditary Mismatch Repair Deficiency syndrome, HMRDS;Mismatch Repair Cancer syndrome, MMRCS, Childhood Cancer Syndrome, CCS, Biallelic Mismatch Repair Gene Mutations Associated Early Onset Cancer, Lynch syndrome type III	AACAGAAAGAAGA	U07418	CCDS2663.1, CCDS54562.1, CCDS54563.1	3p22.3	2014-09-17	2013-09-12		ENSG00000076242	ENSG00000076242			7127	protein-coding gene	gene with protein product		120436	"""mutL (E. coli) homolog 1 (colon cancer, nonpolyposis type 2)"", ""mutL homolog 1, colon cancer, nonpolyposis type 2 (E. coli)"""	COCA2		7903889	Standard	NM_000249		Approved	HNPCC, FCC2, HNPCC2	uc003cgl.3	P40692	OTTHUMG00000130797	ENST00000231790.2:c.208-1AAG>-	3.37:g.37042450_37042452delAAG		Somatic	65	0		WXS	Illumina GAIIx	Phase_I	61	51	NM_000249	0	0	0	0	0	B4DI13|B4DQ11|E9PCU2	In_Frame_Del	DEL	ENST00000231790.2	37	CCDS2663.1																																																																																			.		0.335	MLH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253337.2	NM_000249	In_Frame_Del
XIRP1	165904	hgsc.bcm.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	39230192	39230192	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr3:39230192C>T	ENST00000340369.3	-	2	973	c.745G>A	c.(745-747)Gcc>Acc	p.A249T	XIRP1_ENST00000421646.1_Intron|XIRP1_ENST00000396251.1_Missense_Mutation_p.A249T	NM_194293.2	NP_919269.2	Q702N8	XIRP1_HUMAN	xin actin-binding repeat containing 1	249					cardiac muscle cell development (GO:0055013)|negative regulation of cell proliferation (GO:0008285)|regulation of membrane potential (GO:0042391)|sarcomere organization (GO:0045214)	fascia adherens (GO:0005916)	poly(A) RNA binding (GO:0044822)			breast(4)|central_nervous_system(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(14)|lung(22)|ovary(4)|pancreas(1)|prostate(2)|skin(6)	71				KIRC - Kidney renal clear cell carcinoma(284;0.0517)|Kidney(284;0.065)		TCATGGATGGCGCCCTCTGCA	0.597																																					p.A249T		.											.	XIRP1-158	0			c.G745A						.						93.0	88.0	90.0					3																	39230192		2203	4300	6503	SO:0001583	missense	165904	exon2			GGATGGCGCCCTC	AW755250	CCDS2683.1, CCDS56245.1	3p21.33	2008-02-05	2007-06-27	2007-06-27	ENSG00000168334	ENSG00000168334			14301	protein-coding gene	gene with protein product		609777	"""cardiomyopathy associated 1"""	CMYA1		12203715, 15454575	Standard	NM_001198621		Approved	DKFZp451D042, Xin	uc003cjk.2	Q702N8	OTTHUMG00000131297	ENST00000340369.3:c.745G>A	3.37:g.39230192C>T	ENSP00000343140:p.Ala249Thr	Somatic	47	0		WXS	Illumina GAIIx	Phase_I	57	45	NM_001198621	0	0	0	0	0	A0JP25|A4QPE2|Q68DF2|Q6ZTR3|Q702N9|Q8IVN7|Q8N1N3|Q8N904|Q8TCG7	Missense_Mutation	SNP	ENST00000340369.3	37	CCDS2683.1	.	.	.	.	.	.	.	.	.	.	C	5.696	0.312999	0.10789	.	.	ENSG00000168334	ENST00000396251;ENST00000340369	T;T	0.04809	3.55;3.95	4.84	0.645	0.17782	.	0.522001	0.20522	N	0.090683	T	0.01905	0.0060	N	0.08118	0	0.40014	D	0.975324	B;B	0.25312	0.123;0.031	B;B	0.14578	0.008;0.011	T	0.52064	-0.8625	10	0.13470	T	0.59	.	4.466	0.11689	0.0:0.4786:0.1575:0.3638	.	249;249	Q702N8;Q702N8-2	XIRP1_HUMAN;.	T	249	ENSP00000379550:A249T;ENSP00000343140:A249T	ENSP00000343140:A249T	A	-	1	0	XIRP1	39205196	0.163000	0.22920	0.807000	0.32361	0.896000	0.52359	0.574000	0.23714	0.194000	0.20326	-0.229000	0.12294	GCC	.		0.597	XIRP1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000254065.1	XM_093522	
SEMA3G	56920	broad.mit.edu	37	3	52476810	52476810	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr3:52476810C>T	ENST00000231721.2	-	2	228	c.229G>A	c.(229-231)Gcc>Acc	p.A77T		NM_020163.1	NP_064548.1	Q9NS98	SEM3G_HUMAN	sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3G	77	Sema. {ECO:0000255|PROSITE- ProRule:PRU00352}.				multicellular organismal development (GO:0007275)	extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	receptor activity (GO:0004872)			kidney(1)|large_intestine(5)|lung(8)|ovary(2)|prostate(1)|skin(1)	18				BRCA - Breast invasive adenocarcinoma(193;1.69e-05)|Kidney(197;0.00173)|KIRC - Kidney renal clear cell carcinoma(197;0.00196)|OV - Ovarian serous cystadenocarcinoma(275;0.0333)		GAGTAGAGGGCGTCCAGGCCA	0.627																																					p.A77T		.											.	SEMA3G-70	0			c.G229A						.						58.0	62.0	61.0					3																	52476810		2203	4300	6503	SO:0001583	missense	56920	exon2			AGAGGGCGTCCAG		CCDS2856.1	3p21.1	2013-01-11			ENSG00000010319	ENSG00000010319		"""Semaphorins"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	30400	protein-coding gene	gene with protein product						11214971	Standard	XM_005265327		Approved	FLJ00014, sem2	uc003dea.1	Q9NS98	OTTHUMG00000158570	ENST00000231721.2:c.229G>A	3.37:g.52476810C>T	ENSP00000231721:p.Ala77Thr	Somatic	172	0		WXS	Illumina GAIIx	Phase_I	211	4	NM_020163	0	0	1	1	0	Q7L9D9|Q9H7Q3	Missense_Mutation	SNP	ENST00000231721.2	37	CCDS2856.1	.	.	.	.	.	.	.	.	.	.	C	5.440	0.266314	0.10294	.	.	ENSG00000010319	ENST00000231721;ENST00000475739	T;T	0.10960	2.82;2.82	4.82	1.51	0.23008	WD40/YVTN repeat-like-containing domain (1);Semaphorin/CD100 antigen (4);	0.428883	0.24576	N	0.037355	T	0.06371	0.0164	L	0.27053	0.805	0.09310	N	1	B	0.20550	0.046	B	0.21708	0.036	T	0.36939	-0.9727	10	0.23891	T	0.37	.	5.431	0.16454	0.1407:0.5266:0.0:0.3327	.	77	Q9NS98	SEM3G_HUMAN	T	77;95	ENSP00000231721:A77T;ENSP00000419181:A95T	ENSP00000231721:A77T	A	-	1	0	SEMA3G	52451850	0.000000	0.05858	0.285000	0.24819	0.021000	0.10359	0.289000	0.18957	0.459000	0.27016	-0.291000	0.09656	GCC	.		0.627	SEMA3G-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351354.1	NM_020163	
PDZRN3	23024	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	3	73432786	73432788	+	In_Frame_Del	DEL	CTC	CTC	-			TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10	CTC	CTC	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr3:73432786_73432788delCTC	ENST00000263666.4	-	10	3043_3045	c.2929_2931delGAG	c.(2929-2931)gagdel	p.E977del	PDZRN3_ENST00000535920.1_In_Frame_Del_p.E699del|PDZRN3_ENST00000466348.1_5'Flank|PDZRN3_ENST00000479530.1_In_Frame_Del_p.E694del|PDZRN3_ENST00000466780.1_In_Frame_Del_p.E634del|PDZRN3_ENST00000462146.2_In_Frame_Del_p.E634del	NM_015009.1	NP_055824.1	Q9UPQ7	PZRN3_HUMAN	PDZ domain containing ring finger 3	977					neuromuscular junction development (GO:0007528)|protein ubiquitination (GO:0016567)	neuromuscular junction (GO:0031594)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(13)|lung(31)|ovary(4)|pancreas(2)|prostate(2)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	69		Prostate(10;0.114)|Lung NSC(201;0.187)|Lung SC(41;0.236)		BRCA - Breast invasive adenocarcinoma(55;0.00041)|Epithelial(33;0.0023)|LUSC - Lung squamous cell carcinoma(21;0.0048)|Lung(16;0.0105)|KIRC - Kidney renal clear cell carcinoma(39;0.111)|Kidney(39;0.134)		GCTGCTTCCTCTCCTCCTTGCTC	0.64																																					p.977_977del		.											.	PDZRN3-232	0			c.2929_2931del						.																																			SO:0001651	inframe_deletion	23024	exon10			CTTCCTCTCCTCC	AB029018	CCDS33789.1	3p14.1	2013-01-09	2008-08-14		ENSG00000121440	ENSG00000121440		"""RING-type (C3HC4) zinc fingers"""	17704	protein-coding gene	gene with protein product	"""likely ortholog of mouse semaF cytoplasmic domain associated protein 3"""	609729				10470851	Standard	XM_005264718		Approved	KIAA1095, SEMACAP3, LNX3	uc003dpl.1	Q9UPQ7	OTTHUMG00000158865	ENST00000263666.4:c.2929_2931delGAG	3.37:g.73432789_73432791delCTC	ENSP00000263666:p.Glu977del	Somatic	85	0		WXS	Illumina GAIIx	Phase_I	94	82	NM_015009	0	0	0	0	0	A7MCZ6|Q8N2N7|Q96CC2|Q9NSQ2	In_Frame_Del	DEL	ENST00000263666.4	37	CCDS33789.1																																																																																			.		0.640	PDZRN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352460.1	XM_041363	
ITGB5	3693	broad.mit.edu;bcgsc.ca	37	3	124515279	124515279	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr3:124515279C>T	ENST00000296181.4	-	10	1945	c.1649G>A	c.(1648-1650)tGc>tAc	p.C550Y		NM_002213.3	NP_002204.2	P18084	ITB5_HUMAN	integrin, beta 5	550	Cysteine-rich tandem repeats.				antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cell-matrix adhesion (GO:0007160)|endodermal cell differentiation (GO:0035987)|epithelial cell-cell adhesion (GO:0090136)|extracellular matrix organization (GO:0030198)|integrin-mediated signaling pathway (GO:0007229)|muscle contraction (GO:0006936)|stress fiber assembly (GO:0043149)|transforming growth factor beta receptor signaling pathway (GO:0007179)	cell leading edge (GO:0031252)|cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integrin alphav-beta5 complex (GO:0034684)|phagocytic vesicle (GO:0045335)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	receptor activity (GO:0004872)			breast(1)|endometrium(3)|kidney(2)|large_intestine(8)|lung(10)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)	30				GBM - Glioblastoma multiforme(114;0.163)		GAAGTTGTCGCACTCACAGAA	0.582																																					p.C550Y		.											.	ITGB5-227	0			c.G1649A						.						143.0	131.0	135.0					3																	124515279		2203	4300	6503	SO:0001583	missense	3693	exon10			TTGTCGCACTCAC	J05633	CCDS3030.1	3q21.2	2010-03-23			ENSG00000082781	ENSG00000082781		"""Integrins"""	6160	protein-coding gene	gene with protein product		147561				2211615	Standard	NM_002213		Approved		uc003eho.3	P18084	OTTHUMG00000159432	ENST00000296181.4:c.1649G>A	3.37:g.124515279C>T	ENSP00000296181:p.Cys550Tyr	Somatic	113	0		WXS	Illumina GAIIx	Phase_I	147	7	NM_002213	0	0	54	55	1	B0LPF8|B2RD70	Missense_Mutation	SNP	ENST00000296181.4	37	CCDS3030.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	26.7|26.7	4.761885|4.761885	0.89932|0.89932	.|.	.|.	ENSG00000082781|ENSG00000082781	ENST00000481591|ENST00000296181	.|D	.|0.98249	.|-4.82	5.26|5.26	5.26|5.26	0.73747|0.73747	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	D|D	0.99039|0.99039	0.9671|0.9671	M|M	0.85041|0.85041	2.73|2.73	0.80722|0.80722	D|D	1|1	.|D	.|0.89917	.|1.0	.|D	.|0.97110	.|1.0	D|D	0.99755|0.99755	1.1019|1.1019	5|10	.|0.87932	.|D	.|0	.|.	19.0716|19.0716	0.93140|0.93140	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|550	.|P18084	.|ITB5_HUMAN	T|Y	240|550	.|ENSP00000296181:C550Y	.|ENSP00000296181:C550Y	A|C	-|-	1|2	0|0	ITGB5|ITGB5	125997969|125997969	1.000000|1.000000	0.71417|0.71417	0.988000|0.988000	0.46212|0.46212	0.971000|0.971000	0.66376|0.66376	7.578000|7.578000	0.82498|0.82498	2.735000|2.735000	0.93741|0.93741	0.563000|0.563000	0.77884|0.77884	GCG|TGC	.		0.582	ITGB5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355286.3	NM_002213	
COL6A5	256076	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	3	130159651	130159651	+	Frame_Shift_Del	DEL	T	T	-			TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr3:130159651delT	ENST00000432398.2	+	35	6963	c.6469delT	c.(6469-6471)tttfs	p.F2157fs	COL6A5_ENST00000265379.6_Frame_Shift_Del_p.F2157fs	NM_153264.5	NP_694996.5	A8TX70	CO6A5_HUMAN	collagen, type VI, alpha 5	2157	Nonhelical region.				cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)	collagen trimer (GO:0005581)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)				endometrium(6)|kidney(4)|large_intestine(8)|lung(19)|pancreas(2)|prostate(3)|stomach(1)|urinary_tract(1)	44						CTTAAAGCCATTTTTATACTC	0.338																																					p.F2157fs		.											.	.	0			c.6469delT						.						55.0	51.0	52.0					3																	130159651		1832	4081	5913	SO:0001589	frameshift_variant	256076	exon35			AAGCCATTTTTAT	AK093199		3q21.3	2013-01-16	2010-05-24	2010-05-24	ENSG00000172752	ENSG00000172752		"""Collagens"""	26674	protein-coding gene	gene with protein product	"""von Willebrand factor A domain containing 4"""	611916	"""collagen, type XXIX, alpha 1"""	COL29A1		17850181	Standard	NM_153264		Approved	FLJ35880, VWA4	uc010htk.2	A8TX70	OTTHUMG00000159712	ENST00000432398.2:c.6469delT	3.37:g.130159651delT	ENSP00000390895:p.Phe2157fs	Somatic	54	0		WXS	Illumina GAIIx	Phase_I	77	33	NM_153264	0	0	0	0	0	A9J6L2|A9J6L4|A9J6L6|A9J6L7|A9J6M0|A9J6M1|A9J6M2|B5MEA7|Q6ZW26|Q8NA36	Frame_Shift_Del	DEL	ENST00000432398.2	37																																																																																				.		0.338	COL6A5-202	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_153264	
SLC35G2	80723	hgsc.bcm.edu;broad.mit.edu	37	3	136573486	136573486	+	Frame_Shift_Del	DEL	A	A	-			TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr3:136573486delA	ENST00000446465.2	+	2	812	c.184delA	c.(184-186)aaafs	p.K64fs	RP11-85F14.5_ENST00000461864.1_RNA|RP11-85F14.5_ENST00000474250.1_RNA|RP11-85F14.5_ENST00000470236.1_RNA|SLC35G2_ENST00000393079.3_Frame_Shift_Del_p.K64fs	NM_025246.2	NP_079522.2			solute carrier family 35, member G2																		GAGTGAAATGAAAAAAAAAGG	0.413																																					p.K62fs		.											.	.	0			c.184delA						.						88.0	99.0	95.0					3																	136573486		2203	4300	6503	SO:0001589	frameshift_variant	80723	exon2			GAAATGAAAAAAA	BC022557	CCDS3091.1	3q22.3	2013-05-22	2012-03-09	2012-03-09	ENSG00000168917	ENSG00000168917		"""Solute carriers"""	28480	protein-coding gene	gene with protein product			"""transmembrane protein 22"""	TMEM22		11230166	Standard	NM_001097600		Approved	MGC3295, DKFZp564K2464	uc003erf.4	Q8TBE7	OTTHUMG00000159787	ENST00000446465.2:c.184delA	3.37:g.136573486delA	ENSP00000400839:p.Lys64fs	Somatic	48	0		WXS	Illumina GAIIx	Phase_I	52	45	NM_025246	0	0	0	0	0		Frame_Shift_Del	DEL	ENST00000446465.2	37	CCDS3091.1																																																																																			.		0.413	SLC35G2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357317.1	NM_025246	
FXR1	8087	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	3	180666228	180666228	+	Frame_Shift_Del	DEL	A	A	-			TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr3:180666228delA	ENST00000357559.4	+	5	748	c.364delA	c.(364-366)aaafs	p.K123fs	FXR1_ENST00000445140.2_Frame_Shift_Del_p.K123fs|FXR1_ENST00000480918.1_Frame_Shift_Del_p.K110fs|FXR1_ENST00000305586.7_Frame_Shift_Del_p.K38fs|FXR1_ENST00000468861.1_Frame_Shift_Del_p.K38fs|FXR1_ENST00000491062.1_Frame_Shift_Del_p.K74fs	NM_001013438.2|NM_005087.3	NP_001013456.1|NP_005078.2	P51114	FXR1_HUMAN	fragile X mental retardation, autosomal homolog 1	123					apoptotic process (GO:0006915)|cell differentiation (GO:0030154)|muscle organ development (GO:0007517)|negative regulation of translation (GO:0017148)	costamere (GO:0043034)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleolus (GO:0005730)|polysome (GO:0005844)	G-quadruplex RNA binding (GO:0002151)|mRNA 3'-UTR binding (GO:0003730)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)	p.N124fs*14(1)		breast(3)|endometrium(4)|large_intestine(5)|lung(12)|skin(2)	26	all_cancers(143;6.07e-14)|Ovarian(172;0.0212)		Epithelial(37;3.05e-35)|OV - Ovarian serous cystadenocarcinoma(80;2.4e-22)			TAAAACTGTCAAAAAAAATAC	0.333																																					p.K122fs		.											.	FXR1-153	1	Deletion - Frameshift(1)	large_intestine(1)	c.364delA						.						55.0	58.0	57.0					3																	180666228		2202	4298	6500	SO:0001589	frameshift_variant	8087	exon5			ACTGTCAAAAAAA	M67468	CCDS3238.1, CCDS33894.1, CCDS46965.1	3q28	2014-01-28			ENSG00000114416	ENSG00000114416			4023	protein-coding gene	gene with protein product		600819				7781595, 9642279	Standard	NM_005087		Approved		uc003fkq.3	P51114	OTTHUMG00000158138	ENST00000357559.4:c.364delA	3.37:g.180666228delA	ENSP00000350170:p.Lys123fs	Somatic	54	0		WXS	Illumina GAIIx	Phase_I	75	60	NM_001013438	0	0	0	0	0	A8K9B8|Q7Z450|Q8N6R8	Frame_Shift_Del	DEL	ENST00000357559.4	37	CCDS3238.1																																																																																			.		0.333	FXR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350265.5		
EPHB3	2049	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	184299402	184299402	+	Missense_Mutation	SNP	C	C	A			TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr3:184299402C>A	ENST00000330394.2	+	16	3441	c.2989C>A	c.(2989-2991)Cag>Aag	p.Q997K	EIF2B5_ENST00000444495.1_Intron	NM_004443.3	NP_004434.2	P54753	EPHB3_HUMAN	EPH receptor B3	997					angiogenesis (GO:0001525)|axon guidance (GO:0007411)|axonal fasciculation (GO:0007413)|cell migration (GO:0016477)|central nervous system projection neuron axonogenesis (GO:0021952)|corpus callosum development (GO:0022038)|dendritic spine development (GO:0060996)|dendritic spine morphogenesis (GO:0060997)|digestive tract morphogenesis (GO:0048546)|ephrin receptor signaling pathway (GO:0048013)|palate development (GO:0060021)|positive regulation of synapse assembly (GO:0051965)|protein autophosphorylation (GO:0046777)|regulation of axonogenesis (GO:0050770)|regulation of Cdc42 GTPase activity (GO:0043088)|regulation of cell-cell adhesion (GO:0022407)|regulation of Rac GTPase activity (GO:0032314)|retinal ganglion cell axon guidance (GO:0031290)|substrate adhesion-dependent cell spreading (GO:0034446)|thymus development (GO:0048538)|urogenital system development (GO:0001655)	cell projection (GO:0042995)|integral component of plasma membrane (GO:0005887)	ATP binding (GO:0005524)|axon guidance receptor activity (GO:0008046)|ephrin receptor activity (GO:0005003)			breast(5)|central_nervous_system(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(22)|ovary(5)|prostate(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	51	all_cancers(143;1.89e-10)|Ovarian(172;0.0339)		Epithelial(37;1.27e-34)|OV - Ovarian serous cystadenocarcinoma(80;3.8e-22)			GCTGCCTGTGCAGGTCTGACA	0.617																																					p.Q997K		.											.	EPHB3-1455	0			c.C2989A						.						35.0	34.0	34.0					3																	184299402		2202	4300	6502	SO:0001583	missense	2049	exon16			CCTGTGCAGGTCT	X75208	CCDS3268.1	3q27.1	2013-09-19	2004-10-28		ENSG00000182580	ENSG00000182580		"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3394	protein-coding gene	gene with protein product		601839	"""EphB3"""	ETK2		8397371	Standard	NM_004443		Approved	Hek2, Tyro6	uc003foz.3	P54753	OTTHUMG00000156710	ENST00000330394.2:c.2989C>A	3.37:g.184299402C>A	ENSP00000332118:p.Gln997Lys	Somatic	130	0		WXS	Illumina GAIIx	Phase_I	124	107	NM_004443	0	0	1	2	1	Q7Z740	Missense_Mutation	SNP	ENST00000330394.2	37	CCDS3268.1	.	.	.	.	.	.	.	.	.	.	C	16.05	3.012350	0.54468	.	.	ENSG00000182580	ENST00000330394	T	0.72167	-0.63	4.36	4.36	0.52297	.	0.061504	0.64402	D	0.000003	T	0.60741	0.2292	L	0.34521	1.04	0.80722	D	1	B	0.30406	0.278	B	0.27887	0.084	T	0.61806	-0.6987	10	0.40728	T	0.16	.	16.7884	0.85580	0.0:1.0:0.0:0.0	.	997	P54753	EPHB3_HUMAN	K	997	ENSP00000332118:Q997K	ENSP00000332118:Q997K	Q	+	1	0	EPHB3	185782096	1.000000	0.71417	1.000000	0.80357	0.970000	0.65996	4.881000	0.63114	2.378000	0.81104	0.643000	0.83706	CAG	.		0.617	EPHB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000345413.1	NM_004443	
FAM43A	131583	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	194407766	194407766	+	Missense_Mutation	SNP	A	A	G			TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr3:194407766A>G	ENST00000329759.4	+	1	1145	c.211A>G	c.(211-213)Acc>Gcc	p.T71A		NM_153690.4	NP_710157.2	Q8N2R8	FA43A_HUMAN	family with sequence similarity 43, member A	71										breast(2)|central_nervous_system(1)|lung(6)|skin(1)	10	all_cancers(143;2.04e-08)|Ovarian(172;0.0634)	Lung NSC(153;0.147)	OV - Ovarian serous cystadenocarcinoma(49;8.37e-18)|LUSC - Lung squamous cell carcinoma(58;3.55e-06)|Lung(62;4.19e-06)	GBM - Glioblastoma multiforme(46;1.78e-05)		CCCAACTTACACCGTGCTCTA	0.672																																					p.T71A		.											.	FAM43A-90	0			c.A211G						.						76.0	68.0	71.0					3																	194407766		2203	4300	6503	SO:0001583	missense	131583	exon1			ACTTACACCGTGC	AK074503	CCDS33923.1	3q29	2004-07-28			ENSG00000185112	ENSG00000185112			26888	protein-coding gene	gene with protein product						12477932	Standard	NM_153690		Approved	FLJ90022	uc003fuj.3	Q8N2R8	OTTHUMG00000156016	ENST00000329759.4:c.211A>G	3.37:g.194407766A>G	ENSP00000371397:p.Thr71Ala	Somatic	279	1		WXS	Illumina GAIIx	Phase_I	351	310	NM_153690	0	0	4	4	0	A3KME2|Q8IXP4|Q8WZ07	Missense_Mutation	SNP	ENST00000329759.4	37	CCDS33923.1	.	.	.	.	.	.	.	.	.	.	A	18.53	3.643116	0.67244	.	.	ENSG00000185112	ENST00000329759	T	0.62639	0.01	5.16	5.16	0.70880	Pleckstrin homology-type (1);	0.052449	0.85682	D	0.000000	T	0.57695	0.2071	L	0.55481	1.735	0.58432	D	0.999999	P	0.40909	0.732	B	0.41988	0.372	T	0.54748	-0.8247	10	0.12766	T	0.61	-16.2763	13.8367	0.63413	1.0:0.0:0.0:0.0	.	71	Q8N2R8	FA43A_HUMAN	A	71	ENSP00000371397:T71A	ENSP00000371397:T71A	T	+	1	0	FAM43A	195889055	1.000000	0.71417	0.997000	0.53966	0.965000	0.64279	8.586000	0.90806	1.948000	0.56530	0.374000	0.22700	ACC	.		0.672	FAM43A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000342734.1	NM_153690	
MUC4	4585	bcgsc.ca	37	3	195505791	195505791	+	Silent	SNP	A	A	T			TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10	A	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr3:195505791A>T	ENST00000463781.3	-	2	13119	c.12660T>A	c.(12658-12660)ggT>ggA	p.G4220G	MUC4_ENST00000346145.4_Intron|MUC4_ENST00000475231.1_Silent_p.G4220G|MUC4_ENST00000349607.4_Intron	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)	p.G4220G(1)		NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		GGGTGGCGTGACCTGTGGATG	0.587																																					p.G4220G		.											.	MUC4-90	1	Substitution - coding silent(1)	kidney(1)	c.T12660A						.						24.0	25.0	24.0					3																	195505791		2078	4168	6246	SO:0001819	synonymous_variant	4585	exon2			GGCGTGACCTGTG	AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.12660T>A	3.37:g.195505791A>T		Somatic	283	4		WXS	Illumina GAIIx	Phase_I	326	34	NM_018406	0	0	0	0	0	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Silent	SNP	ENST00000463781.3	37	CCDS54700.1																																																																																			.		0.587	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324081.6	NM_018406	
MUC4	4585	bcgsc.ca	37	3	195505870	195505870	+	Missense_Mutation	SNP	G	G	A	rs201928034		TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr3:195505870G>A	ENST00000463781.3	-	2	13040	c.12581C>T	c.(12580-12582)cCt>cTt	p.P4194L	MUC4_ENST00000346145.4_Intron|MUC4_ENST00000475231.1_Missense_Mutation_p.P4194L|MUC4_ENST00000349607.4_Intron	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		GTCGGTGACAGGAAGAGGGGT	0.602																																					p.P4194L		.											.	MUC4-90	0			c.C12581T						.						21.0	15.0	17.0					3																	195505870		689	1578	2267	SO:0001583	missense	4585	exon2			GTGACAGGAAGAG	AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.12581C>T	3.37:g.195505870G>A	ENSP00000417498:p.Pro4194Leu	Somatic	251	6		WXS	Illumina GAIIx	Phase_I	316	21	NM_018406	0	0	0	0	0	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	ENST00000463781.3	37	CCDS54700.1	.	.	.	.	.	.	.	.	.	.	g	1.704	-0.500860	0.04261	.	.	ENSG00000145113	ENST00000463781;ENST00000475231	T;T	0.33654	1.46;1.4	.	.	.	.	.	.	.	.	T	0.35913	0.0948	N	0.19112	0.55	0.20196	N	0.999925	D	0.59357	0.985	D	0.64042	0.921	T	0.17319	-1.0373	7	.	.	.	.	6.6097	0.22745	2.0E-4:0.0:0.9998:0.0	.	4066	E7ESK3	.	L	4194	ENSP00000417498:P4194L;ENSP00000420243:P4194L	.	P	-	2	0	MUC4	196990649	0.001000	0.12720	0.080000	0.20451	0.057000	0.15508	0.823000	0.27366	0.452000	0.26830	0.074000	0.15403	CCT	.		0.602	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324081.6	NM_018406	
MUC4	4585	bcgsc.ca	37	3	195510020	195510020	+	Missense_Mutation	SNP	T	T	A			TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10	T	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr3:195510020T>A	ENST00000463781.3	-	2	8890	c.8431A>T	c.(8431-8433)Aca>Tca	p.T2811S	MUC4_ENST00000346145.4_Intron|MUC4_ENST00000475231.1_Missense_Mutation_p.T2811S|MUC4_ENST00000349607.4_Intron	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		GCGTGACCTGTGGACACTGAC	0.587																																					p.T2811S		.											.	MUC4-90	0			c.A8431T						.						70.0	43.0	52.0					3																	195510020		685	1501	2186	SO:0001583	missense	4585	exon2			GACCTGTGGACAC	AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.8431A>T	3.37:g.195510020T>A	ENSP00000417498:p.Thr2811Ser	Somatic	276	5		WXS	Illumina GAIIx	Phase_I	96	27	NM_018406	0	0	0	0	0	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	ENST00000463781.3	37	CCDS54700.1	.	.	.	.	.	.	.	.	.	.	-	6.759	0.508816	0.12883	.	.	ENSG00000145113	ENST00000463781;ENST00000475231	T;T	0.31769	1.54;1.48	.	.	.	.	.	.	.	.	T	0.13329	0.0323	N	0.19112	0.55	0.09310	N	1	P	0.38110	0.618	B	0.25759	0.063	T	0.14952	-1.0454	7	.	.	.	.	5.7459	0.18120	0.0:0.0:0.0:1.0	.	2683	E7ESK3	.	S	2811	ENSP00000417498:T2811S;ENSP00000420243:T2811S	.	T	-	1	0	MUC4	196994799	0.005000	0.15991	0.059000	0.19551	0.063000	0.16089	-0.513000	0.06305	0.357000	0.24183	0.000000	0.15137	ACA	.		0.587	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324081.6	NM_018406	
NELFA	7469	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	1991593	1991593	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr4:1991593C>T	ENST00000411638.2	-	3	401	c.386G>A	c.(385-387)gGt>gAt	p.G129D	NELFA_ENST00000542778.1_De_novo_Start_OutOfFrame|NELFA_ENST00000382882.3_Missense_Mutation_p.G140D	NM_005663.4	NP_005654.3	Q9H3P2	NELFA_HUMAN	negative elongation factor complex member A	129					gene expression (GO:0010467)|multicellular organismal development (GO:0007275)|negative regulation of transcription elongation from RNA polymerase II promoter (GO:0034244)|positive regulation of viral transcription (GO:0050434)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|viral process (GO:0016032)	cytoplasm (GO:0005737)|NELF complex (GO:0032021)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)										TTCACACTCACCCACTGCCGG	0.637																																					p.G140D		.											.	.	0			c.G419A						.						72.0	79.0	76.0					4																	1991593		2203	4300	6503	SO:0001583	missense	7469	exon3			CACTCACCCACTG	AF101434	CCDS3358.2	4p16.3	2013-01-31	2013-01-31	2013-01-31	ENSG00000185049	ENSG00000185049			12768	protein-coding gene	gene with protein product		606026	"""Wolf-Hirschhorn syndrome candidate 2"""	WHSC2		10409432	Standard	NM_005663		Approved	NELF-A	uc003gem.3	Q9H3P2	OTTHUMG00000089967	ENST00000411638.2:c.386G>A	4.37:g.1991593C>T	ENSP00000399165:p.Gly129Asp	Somatic	109	0		WXS	Illumina GAIIx	Phase_I	237	107	NM_005663	0	0	0	0	0	A2A2T1|O95392	Missense_Mutation	SNP	ENST00000411638.2	37		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	2.850|2.850	-0.238591|-0.238591	0.05944|0.05944	.|.	.|.	ENSG00000185049|ENSG00000185049	ENST00000382882;ENST00000416258;ENST00000411638;ENST00000431323;ENST00000455762|ENST00000453740;ENST00000411649	T;T;T;T|.	0.42131|.	1.62;0.98;1.62;1.62|.	4.96|4.96	1.92|1.92	0.25849|0.25849	.|.	0.275863|.	0.45126|.	D|.	0.000386|.	T|T	0.33556|0.33556	0.0867|0.0867	N|N	0.03608|0.03608	-0.345|-0.345	0.58432|0.58432	D|D	0.999997|0.999997	B|.	0.17038|.	0.02|.	B|.	0.21360|.	0.034|.	T|T	0.26744|0.26744	-1.0094|-1.0094	10|6	0.15499|0.66056	T|D	0.54|0.02	-7.3525|-7.3525	10.6578|10.6578	0.45686|0.45686	0.0:0.7843:0.1313:0.0844|0.0:0.7843:0.1313:0.0844	.|.	129|.	Q9H3P2|.	NELFA_HUMAN|.	D|M	140;133;129;145;59|30;113	ENSP00000372335:G140D;ENSP00000387647:G133D;ENSP00000399165:G129D;ENSP00000395761:G145D|.	ENSP00000372335:G140D|ENSP00000330311:V72M	G|V	-|-	2|1	0|0	WHSC2|WHSC2	1961391|1961391	0.922000|0.922000	0.31269|0.31269	0.025000|0.025000	0.17156|0.17156	0.033000|0.033000	0.12548|0.12548	1.949000|1.949000	0.40313|0.40313	0.029000|0.029000	0.15352|0.15352	0.609000|0.609000	0.83330|0.83330	GGT|GTG	.		0.637	NELFA-015	NOVEL	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000473007.1	NM_005663	
TRMT44	152992	hgsc.bcm.edu;bcgsc.ca	37	4	8470030	8470032	+	In_Frame_Del	DEL	AAG	AAG	-			TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10	AAG	AAG	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr4:8470030_8470032delAAG	ENST00000389737.4	+	9	1884_1886	c.1884_1886delAAG	c.(1882-1887)acaaga>aca	p.R629del	TRMT44_ENST00000513449.2_In_Frame_Del_p.R388del	NM_152544.2	NP_689757.2	Q8IYL2	TRM44_HUMAN	tRNA methyltransferase 44 homolog (S. cerevisiae)	629					tRNA processing (GO:0008033)	cytoplasm (GO:0005737)	metal ion binding (GO:0046872)|methyltransferase activity (GO:0008168)										AATTAAACACAAGAAGTTCTCGA	0.502																																					p.628_629del		.											.	.	0			c.1884_1886del						.																																			SO:0001651	inframe_deletion	152992	exon9			AAACACAAGAAGT	AK093044	CCDS3402.1, CCDS3402.2	4p16.1	2012-06-12	2012-06-12	2012-06-12	ENSG00000155275	ENSG00000155275			26653	protein-coding gene	gene with protein product	"""tRNA methyltransferase 44 homolog (S. cerevisiae)"""	614309	"""chromosome 4 open reading frame 23"", ""methyltransferase like 19"""	C4orf23, METTL19		21658913	Standard	NM_152544		Approved	FLJ35725, TRM44	uc003glg.2	Q8IYL2	OTTHUMG00000160935	ENST00000389737.4:c.1884_1886delAAG	4.37:g.8470033_8470035delAAG	ENSP00000374387:p.Arg629del	Somatic	135	1		WXS	Illumina GAIIx	Phase_I	236	105	NM_152544	0	0	0	0	0	Q8NA95	In_Frame_Del	DEL	ENST00000389737.4	37	CCDS3402.2																																																																																			.		0.502	TRMT44-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000359197.2	NM_152544	
CPEB2	132864	hgsc.bcm.edu;broad.mit.edu	37	4	15067858	15067858	+	Frame_Shift_Del	DEL	T	T	-			TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr4:15067858delT	ENST00000507071.1	+	11	1711	c.1624delT	c.(1624-1626)tttfs	p.F543fs	CPEB2_ENST00000538197.1_Frame_Shift_Del_p.F988fs|CPEB2_ENST00000382395.3_Frame_Shift_Del_p.F521fs|CPEB2_ENST00000382401.3_Frame_Shift_Del_p.F516fs|CPEB2_ENST00000442003.2_Frame_Shift_Del_p.F961fs|CPEB2_ENST00000541112.1_Frame_Shift_Del_p.F980fs|RP11-665G4.1_ENST00000513384.1_RNA|CPEB2_ENST00000345451.3_Frame_Shift_Del_p.F513fs|CPEB2_ENST00000259997.5_Frame_Shift_Del_p.F551fs|RP11-665G4.1_ENST00000502344.1_RNA			Q7Z5Q1	CPEB2_HUMAN	cytoplasmic polyadenylation element binding protein 2	543					cellular response to arsenic-containing substance (GO:0071243)|cellular response to hypoxia (GO:0071456)|cellular response to insulin stimulus (GO:0032869)|cellular response to oxidative stress (GO:0034599)|negative regulation of cytoplasmic translation (GO:2000766)|negative regulation of cytoplasmic translational elongation (GO:1900248)|negative regulation of GTPase activity (GO:0034260)	cytoplasm (GO:0005737)|messenger ribonucleoprotein complex (GO:1990124)|nucleus (GO:0005634)	GTPase inhibitor activity (GO:0005095)|mRNA 3'-UTR AU-rich region binding (GO:0035925)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|ribosomal large subunit binding (GO:0043023)|ribosomal small subunit binding (GO:0043024)|ribosome binding (GO:0043022)|translation repressor activity, nucleic acid binding (GO:0000900)			autonomic_ganglia(1)|breast(1)|cervix(1)|endometrium(1)|large_intestine(2)|lung(4)|prostate(1)|skin(3)	14						ATTTGCTCCCTTTTTTTGTGC	0.443																																					p.F987fs		.											.	CPEB2-91	0			c.2959delT						.						272.0	250.0	257.0					4																	15067858		2203	4300	6503	SO:0001589	frameshift_variant	132864	exon12			GCTCCCTTTTTTT	AY247744	CCDS56325.1, CCDS56326.1	4p15.33	2013-02-12			ENSG00000137449	ENSG00000137449		"""RNA binding motif (RRM) containing"""	21745	protein-coding gene	gene with protein product		610605				12672660	Standard	NM_182485		Approved		uc003gnk.2	Q7Z5Q1	OTTHUMG00000090669	ENST00000507071.1:c.1624delT	4.37:g.15067858delT	ENSP00000424084:p.Phe543fs	Somatic	170	0		WXS	Illumina GAIIx	Phase_I	446	15	NM_001177382	0	0	0	0	0	E7EPM3|F5H160|Q3B8N6|Q3MI89|Q3MI90|Q3MI92|Q7Z5Q0	Frame_Shift_Del	DEL	ENST00000507071.1	37																																																																																				.		0.443	CPEB2-001	KNOWN	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000207349.2	XM_059607	
FAM200B	285550	broad.mit.edu	37	4	15689832	15689832	+	Frame_Shift_Del	DEL	A	A	-			TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr4:15689832delA	ENST00000422728.2	+	2	2070	c.1232delA	c.(1231-1233)gaafs	p.E411fs	FAM200B_ENST00000504137.1_Intron	NM_001145191.1	NP_001138663.1	P0CF97	F200B_HUMAN	family with sequence similarity 200, member B	411							nucleic acid binding (GO:0003676)			endometrium(1)|kidney(1)	2						tttctcattgaaaaaaaatct	0.313																																					p.E411fs		.											.	.	0			c.1232delA						.						29.0	24.0	25.0					4																	15689832		692	1587	2279	SO:0001589	frameshift_variant	285550	exon2			TCATTGAAAAAAA	BC048993	CCDS47028.1	4p15.32	2014-04-02			ENSG00000237765	ENSG00000237765			27740	protein-coding gene	gene with protein product	"""chromosome 4 open reading frame 53"""						Standard	NM_001145191		Approved	C4orf53	uc003gof.4	P0CF97	OTTHUMG00000160279	ENST00000422728.2:c.1232delA	4.37:g.15689832delA	ENSP00000393017:p.Glu411fs	Somatic	65	0		WXS	Illumina GAIIx	Phase_I	135	8	NM_001145191	0	0	0	0	0		Frame_Shift_Del	DEL	ENST00000422728.2	37	CCDS47028.1																																																																																			.		0.313	FAM200B-005	PUTATIVE	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000360100.1	NM_001145191	
STIM2	57620	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	27000929	27000929	+	Silent	SNP	G	G	A			TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr4:27000929G>A	ENST00000467011.1	+	5	1010	c.585G>A	c.(583-585)caG>caA	p.Q195Q	STIM2_ENST00000465503.1_Silent_p.Q195Q|STIM2_ENST00000467087.1_Silent_p.Q195Q|STIM2_ENST00000412829.2_Silent_p.Q282Q|STIM2_ENST00000237364.5_Silent_p.Q282Q|STIM2_ENST00000382009.3_Silent_p.Q282Q	NM_001169117.1	NP_001162588	Q9P246	STIM2_HUMAN	stromal interaction molecule 2	195	SAM. {ECO:0000255|PROSITE- ProRule:PRU00184}.				activation of store-operated calcium channel activity (GO:0032237)|calcium ion transmembrane transport (GO:0070588)|cellular calcium ion homeostasis (GO:0006874)|positive regulation of calcium ion transport (GO:0051928)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium channel regulator activity (GO:0005246)|calcium ion binding (GO:0005509)|store-operated calcium channel activity (GO:0015279)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(9)|lung(7)|prostate(1)|skin(2)|urinary_tract(1)	25		Breast(46;0.0503)				AAAAACTTCAGCTCAAGGCAT	0.403																																					p.Q195Q		.											.	STIM2-91	0			c.G585A						.						129.0	112.0	118.0					4																	27000929		2203	4300	6503	SO:0001819	synonymous_variant	57620	exon5			ACTTCAGCTCAAG	AB040915	CCDS3440.1, CCDS3440.2, CCDS54751.1, CCDS54752.1	4p15.2	2013-01-10			ENSG00000109689	ENSG00000109689		"""Sterile alpha motif (SAM) domain containing"""	19205	protein-coding gene	gene with protein product		610841				11463338	Standard	NM_020860		Approved		uc003gsh.4	Q9P246	OTTHUMG00000097805	ENST00000467011.1:c.585G>A	4.37:g.27000929G>A		Somatic	59	0		WXS	Illumina GAIIx	Phase_I	144	62	NM_001169118	0	0	7	9	2	A6H8L7|B7ZVY0|Q96BF1|Q9BQH2|Q9H8R1	Silent	SNP	ENST00000467011.1	37	CCDS54752.1																																																																																			.		0.403	STIM2-003	NOVEL	basic|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000356861.1	NM_020860	
TLR6	10333	hgsc.bcm.edu;bcgsc.ca	37	4	38830935	38830935	+	Frame_Shift_Del	DEL	T	T	-			TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr4:38830935delT	ENST00000381950.1	-	1	225	c.160delA	c.(160-162)accfs	p.T54fs	TLR6_ENST00000436693.2_Frame_Shift_Del_p.T54fs			Q9Y2C9	TLR6_HUMAN	toll-like receptor 6	54					activation of NF-kappaB-inducing kinase activity (GO:0007250)|cellular response to diacyl bacterial lipopeptide (GO:0071726)|defense response to bacterium (GO:0042742)|detection of diacyl bacterial lipopeptide (GO:0042496)|immune response (GO:0006955)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|microglial cell activation involved in immune response (GO:0002282)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|nitric oxide metabolic process (GO:0046209)|pathogen-associated molecular pattern dependent induction by symbiont of host innate immune response (GO:0052033)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interleukin-6 biosynthetic process (GO:0045410)|positive regulation of JUN kinase activity (GO:0043507)|regulation of cytokine secretion (GO:0050707)|signal transduction (GO:0007165)|T-helper 1 type immune response (GO:0042088)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 6 signaling pathway (GO:0034150)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)	cytoplasmic vesicle (GO:0031410)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|Toll-like receptor 2-Toll-like receptor 6 protein complex (GO:0035355)	diacyl lipopeptide binding (GO:0042498)|lipopeptide binding (GO:0071723)|receptor activity (GO:0004872)|transmembrane signaling receptor activity (GO:0004888)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(7)|ovary(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	22						AAGACTTTGGTTTTCAGCGGT	0.408																																					p.T54fs		.											.	TLR6-524	0			c.160delA						.						88.0	81.0	84.0					4																	38830935		2203	4300	6503	SO:0001589	frameshift_variant	10333	exon2			CTTTGGTTTTCAG		CCDS3446.1	4p16.1	2009-11-23			ENSG00000174130	ENSG00000174130		"""CD molecules"""	16711	protein-coding gene	gene with protein product		605403				10231569	Standard	NM_006068		Approved	CD286	uc010ifg.2	Q9Y2C9	OTTHUMG00000128579	ENST00000381950.1:c.160delA	4.37:g.38830935delT	ENSP00000371376:p.Thr54fs	Somatic	79	1		WXS	Illumina GAIIx	Phase_I	171	83	NM_006068	0	0	0	0	0	B3Y640|B6CH35|B6RFS4|B6RFS5|Q2NKL3	Frame_Shift_Del	DEL	ENST00000381950.1	37	CCDS3446.1																																																																																			.		0.408	TLR6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250431.1		
FRYL	285527	bcgsc.ca	37	4	48592687	48592687	+	Missense_Mutation	SNP	G	G	T			TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr4:48592687G>T	ENST00000503238.1	-	14	1495	c.1496C>A	c.(1495-1497)gCa>gAa	p.A499E	FRYL_ENST00000506685.1_Missense_Mutation_p.A205E|FRYL_ENST00000507711.1_Missense_Mutation_p.A499E|FRYL_ENST00000358350.4_Missense_Mutation_p.A499E|FRYL_ENST00000537810.1_Missense_Mutation_p.A499E|FRYL_ENST00000264319.7_5'UTR			O94915	FRYL_HUMAN	FRY-like	499					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)					breast(2)|central_nervous_system(2)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(21)|lung(38)|ovary(1)|pancreas(1)|prostate(3)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	91						TATGACTTTTGCTTCTTCATC	0.294																																					p.A499E		.											.	FRYL-69	0			c.C1496A						.						78.0	73.0	75.0					4																	48592687		1796	4076	5872	SO:0001583	missense	285527	exon17			ACTTTTGCTTCTT	AL833170	CCDS43227.1	4p12	2011-08-03	2006-11-17	2005-11-24	ENSG00000075539	ENSG00000075539			29127	protein-coding gene	gene with protein product			"""KIAA0826"", ""furry homolog-like (Drosophila)"""	KIAA0826		10048485	Standard	NM_015030		Approved	DKFZp686E205	uc003gyh.1	O94915	OTTHUMG00000160608	ENST00000503238.1:c.1496C>A	4.37:g.48592687G>T	ENSP00000426064:p.Ala499Glu	Somatic	34	0		WXS	Illumina GAIIx	Phase_I	58	4	NM_015030	0	0	0	0	0	O95640|Q8WTZ5|Q9NT40	Missense_Mutation	SNP	ENST00000503238.1	37	CCDS43227.1	.	.	.	.	.	.	.	.	.	.	G	31	5.059567	0.93846	.	.	ENSG00000075539	ENST00000503238;ENST00000358350;ENST00000537810;ENST00000507711;ENST00000506685	T;T;T;T	0.51071	1.69;1.69;1.69;0.72	5.6	5.6	0.85130	Armadillo-type fold (1);	0.000000	0.64402	U	0.000001	T	0.72526	0.3471	M	0.82323	2.585	0.80722	D	1	D;D	0.76494	0.997;0.999	D;D	0.79784	0.992;0.993	T	0.72944	-0.4138	10	0.44086	T	0.13	.	19.6103	0.95602	0.0:0.0:1.0:0.0	.	499;499	F2Z2S2;O94915	.;FRYL_HUMAN	E	499;499;499;499;205	ENSP00000426064:A499E;ENSP00000351113:A499E;ENSP00000441114:A499E;ENSP00000421584:A499E	ENSP00000351113:A499E	A	-	2	0	FRYL	48287444	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.786000	0.99046	2.629000	0.89072	0.655000	0.94253	GCA	.		0.294	FRYL-011	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000369265.2		
UGT2B15	7366	hgsc.bcm.edu	37	4	69536320	69536320	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr4:69536320G>A	ENST00000338206.5	-	1	26	c.17C>T	c.(16-18)aCg>aTg	p.T6M		NM_001076.3	NP_001067.2	P54855	UDB15_HUMAN	UDP glucuronosyltransferase 2 family, polypeptide B15	6					cellular glucuronidation (GO:0052695)|steroid metabolic process (GO:0008202)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	glucuronosyltransferase activity (GO:0015020)									Acetaminophen(DB00316)|Dabigatran etexilate(DB06695)|Ezetimibe(DB00973)|Lorazepam(DB00186)|Morphine(DB00295)|Oxazepam(DB00842)|Valproic Acid(DB00313)	AAAGACTGACGTCCATTTCAG	0.403																																					p.T6M		.											.	UGT2B15-46	0			c.C17T						.						222.0	232.0	229.0					4																	69536320		2203	4297	6500	SO:0001583	missense	7366	exon1			ACTGACGTCCATT	AF180322	CCDS3524.1	4q13	2008-02-05	2005-07-20		ENSG00000196620	ENSG00000196620		"""UDP glucuronosyltransferases"""	12546	protein-coding gene	gene with protein product		600069	"""UDP glycosyltransferase 2 family, polypeptide B15"""			7835904	Standard	NM_001076		Approved	UGT2B8	uc021xow.1	P54855	OTTHUMG00000161507	ENST00000338206.5:c.17C>T	4.37:g.69536320G>A	ENSP00000341045:p.Thr6Met	Somatic	60	0		WXS	Illumina GAIIx	Phase_I	133	8	NM_001076	0	0	0	0	0	A6NDX0|A6NNJ4|A8K054|P23765|Q9UK63	Missense_Mutation	SNP	ENST00000338206.5	37	CCDS3524.1	.	.	.	.	.	.	.	.	.	.	g	4.807	0.149959	0.09185	.	.	ENSG00000196620	ENST00000338206	T	0.60299	0.2	2.56	-2.34	0.06704	.	1.919090	0.03725	N	0.252530	T	0.48040	0.1478	L	0.47716	1.5	0.09310	N	1	B	0.15473	0.013	B	0.17433	0.018	T	0.22347	-1.0219	10	0.32370	T	0.25	.	5.9844	0.19426	0.5394:0.0:0.4606:0.0	.	6	P54855	UDB15_HUMAN	M	6	ENSP00000341045:T6M	ENSP00000341045:T6M	T	-	2	0	UGT2B15	69218915	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	-0.193000	0.09573	-0.573000	0.05998	-0.480000	0.04831	ACG	.		0.403	UGT2B15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365172.1	NM_001076	
SHROOM3	57619	hgsc.bcm.edu	37	4	77662309	77662309	+	Silent	SNP	C	C	T	rs344143	byFrequency	TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr4:77662309C>T	ENST00000296043.6	+	5	3936	c.2983C>T	c.(2983-2985)Ctg>Ttg	p.L995L		NM_020859.3	NP_065910.3	Q8TF72	SHRM3_HUMAN	shroom family member 3	995	ASD1. {ECO:0000255|PROSITE- ProRule:PRU00637}.				actin cytoskeleton organization (GO:0030036)|apical protein localization (GO:0045176)|cell morphogenesis (GO:0000902)|cellular pigment accumulation (GO:0043482)|columnar/cuboidal epithelial cell development (GO:0002066)|neural tube closure (GO:0001843)|pattern specification process (GO:0007389)|regulation of cell shape (GO:0008360)	adherens junction (GO:0005912)|apical junction complex (GO:0043296)|apical plasma membrane (GO:0016324)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|microtubule (GO:0005874)				NS(3)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(10)|kidney(2)|large_intestine(6)|lung(29)|ovary(1)|skin(5)|upper_aerodigestive_tract(1)	60			Lung(101;0.0903)			TGAGGGCGACCTGGCCAGGCC	0.741													C|||	1906	0.380591	0.4115	0.4078	5008	,	,		9710	0.2669		0.4245	False		,,,				2504	0.3916				p.L995L		.											.	SHROOM3-93	0			c.C2983T						.	C		1365,2227		322,721,753	3.0	4.0	4.0		2983	-0.1	0.0	4	dbSNP_79	4	3066,4302		771,1524,1389	no	coding-synonymous	SHROOM3	NM_020859.3		1093,2245,2142	TT,TC,CC		41.6124,38.0011,40.4288		995/1997	77662309	4431,6529	1796	3684	5480	SO:0001819	synonymous_variant	57619	exon5			GGCGACCTGGCCA	AB055660	CCDS3579.2	4q21.1	2009-11-25			ENSG00000138771	ENSG00000138771			30422	protein-coding gene	gene with protein product		604570				10589677, 16615870	Standard	NM_020859		Approved	ShrmL, SHRM, KIAA1481, APXL3	uc011cbx.2	Q8TF72	OTTHUMG00000157075	ENST00000296043.6:c.2983C>T	4.37:g.77662309C>T		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	10	10	NM_020859	0	0	0	3	3	Q5QTQ3|Q6ZRW3|Q96IR9|Q9P247	Silent	SNP	ENST00000296043.6	37	CCDS3579.2																																																																																			C|0.604;T|0.396		0.741	SHROOM3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252408.2	NM_020859	
PRKG2	5593	broad.mit.edu;ucsc.edu;bcgsc.ca	37	4	82126123	82126123	+	Missense_Mutation	SNP	G	G	A	rs187350442		TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr4:82126123G>A	ENST00000395578.1	-	2	195	c.79C>T	c.(79-81)Cgg>Tgg	p.R27W	PRKG2_ENST00000418486.2_Missense_Mutation_p.R27W|PRKG2_ENST00000264399.1_Missense_Mutation_p.R27W			Q13237	KGP2_HUMAN	protein kinase, cGMP-dependent, type II	27					blood coagulation (GO:0007596)|circadian regulation of gene expression (GO:0032922)|nitric oxide metabolic process (GO:0046209)|protein phosphorylation (GO:0006468)|regulation of nitric-oxide synthase activity (GO:0050999)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cGMP binding (GO:0030553)|cGMP-dependent protein kinase activity (GO:0004692)|protein kinase activity (GO:0004672)	p.R27W(2)		NS(1)|breast(4)|central_nervous_system(2)|endometrium(3)|kidney(3)|large_intestine(7)|lung(14)|ovary(1)|skin(2)	37						ACCTTGTTCCGCAGAGCATCA	0.527													G|||	1	0.000199681	0.0	0.0014	5008	,	,		19454	0.0		0.0	False		,,,				2504	0.0				p.R27W		.											.	PRKG2-524	2	Substitution - Missense(2)	kidney(2)	c.C79T						.	G	TRP/ARG	1,4405	2.1+/-5.4	0,1,2202	86.0	80.0	82.0		79	4.2	1.0	4		82	2,8598	2.2+/-6.3	0,2,4298	yes	missense	PRKG2	NM_006259.1	101	0,3,6500	AA,AG,GG		0.0233,0.0227,0.0231	probably-damaging	27/763	82126123	3,13003	2203	4300	6503	SO:0001583	missense	5593	exon1			TGTTCCGCAGAGC	X94612	CCDS3589.1, CCDS75150.1	4q13.1-q21.1	2009-07-10			ENSG00000138669	ENSG00000138669	2.7.11.1		9416	protein-coding gene	gene with protein product		601591				7498513	Standard	XM_005263126		Approved	cGKII, PRKGR2	uc003hmh.2	Q13237	OTTHUMG00000130296	ENST00000395578.1:c.79C>T	4.37:g.82126123G>A	ENSP00000378945:p.Arg27Trp	Somatic	137	2		WXS	Illumina GAIIx	Phase_I	295	139	NM_006259	0	0	0	0	0	B4DMX3|E7EPE6|O00125|O60916	Missense_Mutation	SNP	ENST00000395578.1	37	CCDS3589.1	1	4.578754578754579E-4	0	0.0	1	0.0027624309392265192	0	0.0	0	0.0	G	11.71	1.720797	0.30503	2.27E-4	2.33E-4	ENSG00000138669	ENST00000395578;ENST00000264399;ENST00000418486	T;T;T	0.70869	-0.4;-0.4;-0.52	5.1	4.25	0.50352	.	0.218260	0.45361	D	0.000375	T	0.55752	0.1940	N	0.24115	0.695	0.80722	D	1	D;D	0.65815	0.995;0.988	B;B	0.44315	0.446;0.353	T	0.59595	-0.7425	10	0.72032	D	0.01	-10.0862	6.7167	0.23308	0.0809:0.0:0.4711:0.448	.	27;27	E7EPE6;Q13237	.;KGP2_HUMAN	W	27	ENSP00000378945:R27W;ENSP00000264399:R27W;ENSP00000389038:R27W	ENSP00000264399:R27W	R	-	1	2	PRKG2	82345147	0.972000	0.33761	1.000000	0.80357	0.561000	0.35649	0.506000	0.22658	1.366000	0.46076	0.585000	0.79938	CGG	G|0.999;A|0.001		0.527	PRKG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252639.1	NM_006259	
UNC5C	8633	hgsc.bcm.edu;bcgsc.ca	37	4	96140294	96140294	+	Frame_Shift_Del	DEL	G	G	-			TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr4:96140294delG	ENST00000453304.1	-	9	1819	c.1471delC	c.(1471-1473)caafs	p.Q491fs	UNC5C_ENST00000506749.1_Frame_Shift_Del_p.Q510fs	NM_003728.3	NP_003719.3	O95185	UNC5C_HUMAN	unc-5 homolog C (C. elegans)	491					anterior/posterior axon guidance (GO:0033564)|apoptotic process (GO:0006915)|axon guidance (GO:0007411)|brain development (GO:0007420)|positive regulation of apoptotic process (GO:0043065)|regulation of cell migration (GO:0030334)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	netrin receptor activity (GO:0005042)			NS(1)|breast(2)|endometrium(2)|kidney(1)|large_intestine(14)|lung(25)|ovary(3)|pancreas(1)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	55		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;8.72e-10)		AGGTCATCTTGGGGGGTGACA	0.502																																					p.Q491fs		.											.	UNC5C-94	0			c.1471delC						.						220.0	200.0	207.0					4																	96140294		2203	4300	6503	SO:0001589	frameshift_variant	8633	exon9			CATCTTGGGGGGT	AF055634	CCDS3643.1	4q21-q23	2013-01-11	2001-11-28		ENSG00000182168	ENSG00000182168		"""Immunoglobulin superfamily / I-set domain containing"""	12569	protein-coding gene	gene with protein product		603610	"""unc5 (C.elegans homolog) c"""			9126742, 9782087	Standard	NM_003728		Approved		uc003hto.3	O95185	OTTHUMG00000130989	ENST00000453304.1:c.1471delC	4.37:g.96140294delG	ENSP00000406022:p.Gln491fs	Somatic	149	0		WXS	Illumina GAIIx	Phase_I	450	214	NM_003728	0	0	0	0	0	Q8IUT0	Frame_Shift_Del	DEL	ENST00000453304.1	37	CCDS3643.1																																																																																			.		0.502	UNC5C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253607.1	NM_003728	
AP1AR	55435	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	113189441	113189441	+	Missense_Mutation	SNP	A	A	G			TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr4:113189441A>G	ENST00000274000.5	+	10	1140	c.785A>G	c.(784-786)aAt>aGt	p.N262S	AP1AR_ENST00000309703.6_Missense_Mutation_p.N229S	NM_018569.4	NP_061039.3	Q63HQ0	AP1AR_HUMAN	adaptor-related protein complex 1 associated regulatory protein	262					cellular protein localization (GO:0034613)|negative regulation of cell motility (GO:2000146)|negative regulation of receptor recycling (GO:0001920)|negative regulation of substrate adhesion-dependent cell spreading (GO:1900025)|protein transport (GO:0015031)|regulation of Arp2/3 complex-mediated actin nucleation (GO:0034315)|vesicle targeting, trans-Golgi to endosome (GO:0048203)	cytoplasm (GO:0005737)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|nucleolus (GO:0005730)|transport vesicle (GO:0030133)	AP-1 adaptor complex binding (GO:0035650)|kinesin binding (GO:0019894)			NS(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(2)	9						GAGTGGGAAAATGATTTTGTT	0.408																																					p.N262S		.											.	AP1AR-90	0			c.A785G						.						122.0	111.0	115.0					4																	113189441		2203	4300	6503	SO:0001583	missense	55435	exon10			GGGAAAATGATTT	AL136628	CCDS3696.1, CCDS47125.1	4q25	2009-09-28	2009-09-25	2009-09-25	ENSG00000138660	ENSG00000138660			28808	protein-coding gene	gene with protein product	"""gamma1-adaptin brefeldin A resistance"""	610851	"""chromosome 4 open reading frame 16"""	C4orf16		15775984	Standard	NM_018569		Approved	PRO0971, 2C18, gamma-BAR	uc003iaj.4	Q63HQ0	OTTHUMG00000132849	ENST00000274000.5:c.785A>G	4.37:g.113189441A>G	ENSP00000274000:p.Asn262Ser	Somatic	133	0		WXS	Illumina GAIIx	Phase_I	213	92	NM_018569	0	1	32	49	16	B2RCV7|Q96GG6|Q9H0V0|Q9P1L4	Missense_Mutation	SNP	ENST00000274000.5	37	CCDS3696.1	.	.	.	.	.	.	.	.	.	.	A	16.81	3.224539	0.58668	.	.	ENSG00000138660	ENST00000274000;ENST00000309703	T;T	0.56941	0.46;0.43	5.57	3.1	0.35709	.	0.049569	0.85682	N	0.000000	T	0.63686	0.2532	L	0.60455	1.87	0.42403	D	0.992571	D;B	0.71674	0.998;0.141	D;B	0.76071	0.987;0.041	T	0.62291	-0.6885	10	0.72032	D	0.01	-9.4229	7.1095	0.25382	0.7774:0.148:0.0746:0.0	.	229;262	Q63HQ0-2;Q63HQ0	.;AP1AR_HUMAN	S	262;229	ENSP00000274000:N262S;ENSP00000309023:N229S	ENSP00000274000:N262S	N	+	2	0	AP1AR	113408890	1.000000	0.71417	0.991000	0.47740	0.994000	0.84299	4.636000	0.61339	0.384000	0.24942	0.528000	0.53228	AAT	.		0.408	AP1AR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256323.2	NM_018569	
ANK2	287	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	114276759	114276759	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr4:114276759G>A	ENST00000357077.4	+	38	7038	c.6985G>A	c.(6985-6987)Ggc>Agc	p.G2329S	ANK2_ENST00000394537.3_Intron|ANK2_ENST00000264366.6_Missense_Mutation_p.G2296S|ANK2_ENST00000510275.2_Intron|ANK2_ENST00000506722.1_Intron|ANK2_ENST00000509550.1_Intron	NM_001148.4	NP_001139.3	Q01484	ANK2_HUMAN	ankyrin 2, neuronal	2329					atrial cardiac muscle cell action potential (GO:0086014)|atrial cardiac muscle cell to AV node cell communication (GO:0086066)|atrial septum development (GO:0003283)|axon guidance (GO:0007411)|cardiac muscle contraction (GO:0060048)|cellular calcium ion homeostasis (GO:0006874)|cellular protein localization (GO:0034613)|membrane depolarization during SA node cell action potential (GO:0086046)|paranodal junction assembly (GO:0030913)|positive regulation of calcium ion transmembrane transporter activity (GO:1901021)|positive regulation of calcium ion transport (GO:0051928)|positive regulation of cation channel activity (GO:2001259)|positive regulation of gene expression (GO:0010628)|positive regulation of potassium ion transmembrane transporter activity (GO:1901018)|positive regulation of potassium ion transport (GO:0043268)|protein localization to cell surface (GO:0034394)|protein localization to endoplasmic reticulum (GO:0070972)|protein localization to M-band (GO:0036309)|protein localization to organelle (GO:0033365)|protein localization to plasma membrane (GO:0072659)|protein localization to T-tubule (GO:0036371)|protein stabilization (GO:0050821)|protein targeting to plasma membrane (GO:0072661)|regulation of calcium ion transmembrane transporter activity (GO:1901019)|regulation of calcium ion transport (GO:0051924)|regulation of cardiac muscle cell contraction (GO:0086004)|regulation of cardiac muscle cell membrane potential (GO:0086036)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by calcium ion signaling (GO:0010882)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of protein stability (GO:0031647)|regulation of release of sequestered calcium ion into cytosol (GO:0051279)|regulation of ventricular cardiac muscle cell membrane repolarization (GO:0060307)|response to methylmercury (GO:0051597)|SA node cell action potential (GO:0086015)|SA node cell to atrial cardiac muscle cell communication (GO:0086070)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|T-tubule organization (GO:0033292)|ventricular cardiac muscle cell action potential (GO:0086005)	A band (GO:0031672)|basolateral plasma membrane (GO:0016323)|costamere (GO:0043034)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|integral component of plasma membrane (GO:0005887)|intercalated disc (GO:0014704)|intracellular (GO:0005622)|M band (GO:0031430)|membrane raft (GO:0045121)|neuron projection (GO:0043005)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)	ATPase binding (GO:0051117)|enzyme binding (GO:0019899)|ion channel binding (GO:0044325)|potassium channel regulator activity (GO:0015459)|protein binding, bridging (GO:0030674)|protein kinase binding (GO:0019901)|spectrin binding (GO:0030507)|structural constituent of cytoskeleton (GO:0005200)			NS(1)|biliary_tract(1)|breast(9)|central_nervous_system(10)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(54)|liver(2)|lung(112)|ovary(8)|pancreas(1)|prostate(7)|skin(11)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(10)	248		Ovarian(17;0.0448)|Hepatocellular(203;0.218)		OV - Ovarian serous cystadenocarcinoma(123;4.92e-05)		TGATTGCACAGGCAGCTGTAG	0.488																																					p.G2329S		.											.	ANK2-583	0			c.G6985A						.						60.0	58.0	59.0					4																	114276759		2203	4300	6503	SO:0001583	missense	287	exon38			TGCACAGGCAGCT	M37123	CCDS3702.1, CCDS43261.1, CCDS54796.1	4q25-q26	2014-09-17	2003-03-12		ENSG00000145362	ENSG00000145362		"""Ankyrin repeat domain containing"""	493	protein-coding gene	gene with protein product		106410	"""long (electrocardiographic) QT syndrome 4"""	LQT4		7485162, 12571597	Standard	NM_001148		Approved		uc003ibe.4	Q01484	OTTHUMG00000132912	ENST00000357077.4:c.6985G>A	4.37:g.114276759G>A	ENSP00000349588:p.Gly2329Ser	Somatic	82	0		WXS	Illumina GAIIx	Phase_I	154	70	NM_001148	0	0	0	0	0	Q01485|Q08AC7|Q08AC8|Q7Z3L5	Missense_Mutation	SNP	ENST00000357077.4	37	CCDS3702.1	.	.	.	.	.	.	.	.	.	.	G	1.768	-0.485182	0.04352	.	.	ENSG00000145362	ENST00000357077;ENST00000264366	T;T	0.65178	-0.13;-0.14	5.53	2.68	0.31781	.	0.644708	0.14201	N	0.334672	T	0.50411	0.1614	L	0.44542	1.39	0.09310	N	0.999998	B;B	0.09022	0.001;0.002	B;B	0.09377	0.001;0.004	T	0.34800	-0.9814	9	.	.	.	.	9.6352	0.39804	0.0791:0.2706:0.6503:0.0	.	2296;2329	Q01484;Q01484-4	ANK2_HUMAN;.	S	2329;2296	ENSP00000349588:G2329S;ENSP00000264366:G2296S	.	G	+	1	0	ANK2	114496208	0.019000	0.18553	0.002000	0.10522	0.151000	0.21798	1.172000	0.31908	1.287000	0.44583	0.655000	0.94253	GGC	.		0.488	ANK2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000256422.2	NM_001148	
FAT4	79633	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	4	126369791	126369791	+	Frame_Shift_Del	DEL	A	A	-			TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr4:126369791delA	ENST00000394329.3	+	9	7633	c.7620delA	c.(7618-7620)gtafs	p.V2540fs	FAT4_ENST00000335110.5_Frame_Shift_Del_p.V838fs	NM_024582.4	NP_078858.4	Q6V0I7	FAT4_HUMAN	FAT atypical cadherin 4	2540	Cadherin 24. {ECO:0000255|PROSITE- ProRule:PRU00043}.				branching involved in ureteric bud morphogenesis (GO:0001658)|cerebral cortex development (GO:0021987)|digestive tract development (GO:0048565)|heart morphogenesis (GO:0003007)|heterophilic cell-cell adhesion (GO:0007157)|hippo signaling (GO:0035329)|homophilic cell adhesion (GO:0007156)|inner ear receptor stereocilium organization (GO:0060122)|neurogenesis (GO:0022008)|ossification involved in bone maturation (GO:0043931)|plasma membrane organization (GO:0007009)|regulation of metanephric nephron tubule epithelial cell differentiation (GO:0072307)	apical part of cell (GO:0045177)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(6)|autonomic_ganglia(1)|breast(4)|central_nervous_system(3)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(3)|kidney(10)|large_intestine(93)|liver(3)|lung(120)|ovary(9)|pancreas(2)|prostate(21)|skin(31)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(6)	355						CTGTGCATGTAAAAGATGGTG	0.433																																					p.V2540fs		.											.	FAT4-108	0			c.7620delA						.						81.0	79.0	80.0					4																	126369791		2203	4299	6502	SO:0001589	frameshift_variant	79633	exon9			GCATGTAAAAGAT	AY356402	CCDS3732.3	4q28.1	2013-05-31	2013-05-31		ENSG00000196159	ENSG00000196159		"""Cadherins / Cadherin-related"""	23109	protein-coding gene	gene with protein product	"""cadherin-related family member 11"""	612411	"""FAT tumor suppressor homolog 4 (Drosophila)"""			15003449	Standard	NM_024582		Approved	CDHF14, FAT-J, CDHR11	uc003ifj.4	Q6V0I7	OTTHUMG00000133100	ENST00000394329.3:c.7620delA	4.37:g.126369791delA	ENSP00000377862:p.Val2540fs	Somatic	105	0		WXS	Illumina GAIIx	Phase_I	259	115	NM_024582	0	0	0	0	0	A8K5Z6|B5MDG4|Q3LIA6|Q8TCK7|Q9H5T6	Frame_Shift_Del	DEL	ENST00000394329.3	37	CCDS3732.3																																																																																			.		0.433	FAT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256765.2	NM_024582	
NAA15	80155	hgsc.bcm.edu;bcgsc.ca	37	4	140291458	140291459	+	Frame_Shift_Del	DEL	AA	AA	-			TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10	AA	AA	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr4:140291458_140291459delAA	ENST00000296543.5	+	15	2170_2171	c.1847_1848delAA	c.(1846-1848)gaafs	p.E616fs	NAA15_ENST00000398947.1_Frame_Shift_Del_p.E616fs	NM_057175.3	NP_476516.1	Q9BXJ9	NAA15_HUMAN	N(alpha)-acetyltransferase 15, NatA auxiliary subunit	616	Interaction with HYPK.				angiogenesis (GO:0001525)|cell differentiation (GO:0030154)|N-terminal protein amino acid acetylation (GO:0006474)|negative regulation of apoptotic process (GO:0043066)|positive regulation of transcription, DNA-templated (GO:0045893)|protein stabilization (GO:0050821)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|membrane (GO:0016020)|NatA complex (GO:0031415)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	N-acetyltransferase activity (GO:0008080)|poly(A) RNA binding (GO:0044822)|ribosome binding (GO:0043022)			NS(1)|endometrium(3)|large_intestine(7)|liver(2)|lung(8)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	29						aaaaatgcagaaaaagaaaagc	0.386																																					p.616_616del		.											.	NAA15-92	0			c.1847_1848del						.																																			SO:0001589	frameshift_variant	80155	exon15			ATGCAGAAAAAGA	AY039242	CCDS43270.1	4q31.1	2010-01-14	2010-01-14	2010-01-14	ENSG00000164134	ENSG00000164134		"""N(alpha)-acetyltransferase subunits"""	30782	protein-coding gene	gene with protein product		608000	"""NMDA receptor regulated 1"""	NARG1		12140756, 11478804, 19660095	Standard	XM_005263236		Approved	TBDN100, NATH, FLJ13340	uc003ihu.1	Q9BXJ9	OTTHUMG00000137363	ENST00000296543.5:c.1847_1848delAA	4.37:g.140291460_140291461delAA	ENSP00000296543:p.Glu616fs	Somatic	123	2		WXS	Illumina GAIIx	Phase_I	214	109	NM_057175	0	0	0	0	0	D3DNY6|Q52LG9|Q8IWH4|Q8NEV2|Q9H8P6	Frame_Shift_Del	DEL	ENST00000296543.5	37	CCDS43270.1																																																																																			.		0.386	NAA15-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000267839.2	NM_057175	
ZNF330	27309	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	142143548	142143548	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr4:142143548C>T	ENST00000262990.4	+	2	251	c.23C>T	c.(22-24)gCg>gTg	p.A8V	ZNF330_ENST00000421169.2_5'UTR	NM_014487.4	NP_055302.1	Q9Y3S2	ZN330_HUMAN	zinc finger protein 330	8						chromosome, centromeric region (GO:0000775)|midbody (GO:0030496)|nucleolus (GO:0005730)	metal ion binding (GO:0046872)|zinc ion binding (GO:0008270)			kidney(1)|large_intestine(4)|lung(6)|upper_aerodigestive_tract(1)|urinary_tract(2)	14	all_hematologic(180;0.162)					AAGACTGGTGCGAGGAAGAAG	0.358																																					p.A8V		.											.	ZNF330-90	0			c.C23T						.						86.0	87.0	87.0					4																	142143548		2203	4300	6503	SO:0001583	missense	27309	exon2			CTGGTGCGAGGAA	AJ006591	CCDS3754.1	4q31.21	2008-05-15			ENSG00000109445	ENSG00000109445		"""Zinc fingers, C2H2-type"""	15462	protein-coding gene	gene with protein product		609550				11528117, 10593942	Standard	NM_001292002		Approved	NOA36, HSA6591	uc003iiq.4	Q9Y3S2	OTTHUMG00000133413	ENST00000262990.4:c.23C>T	4.37:g.142143548C>T	ENSP00000262990:p.Ala8Val	Somatic	164	0		WXS	Illumina GAIIx	Phase_I	333	160	NM_014487	0	0	23	52	29	B2RDA3	Missense_Mutation	SNP	ENST00000262990.4	37	CCDS3754.1	.	.	.	.	.	.	.	.	.	.	C	34	5.298763	0.95574	.	.	ENSG00000109445	ENST00000262990;ENST00000512809;ENST00000503649;ENST00000512738	T;T;T;T	0.32272	1.46;1.46;1.46;1.46	5.75	5.75	0.90469	.	0.000000	0.85682	D	0.000000	T	0.53981	0.1830	L	0.54323	1.7	0.80722	D	1	D	0.76494	0.999	D	0.79108	0.992	T	0.51028	-0.8757	10	0.62326	D	0.03	-13.4092	19.9462	0.97183	0.0:1.0:0.0:0.0	.	8	Q9Y3S2	ZN330_HUMAN	V	8	ENSP00000262990:A8V;ENSP00000422599:A8V;ENSP00000422966:A8V;ENSP00000422251:A8V	ENSP00000262990:A8V	A	+	2	0	ZNF330	142362998	1.000000	0.71417	0.364000	0.25888	0.998000	0.95712	7.227000	0.78070	2.717000	0.92951	0.585000	0.79938	GCG	.		0.358	ZNF330-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257271.2	NM_014487	
DCLK2	166614	bcgsc.ca	37	4	151000382	151000384	+	In_Frame_Del	DEL	AGA	AGA	-			TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10	AGA	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr4:151000382_151000384delAGA	ENST00000296550.7	+	1	957_959	c.203_205delAGA	c.(202-207)gagaag>gag	p.K70del	DCLK2_ENST00000506325.1_In_Frame_Del_p.K70del|DCLK2_ENST00000302176.8_In_Frame_Del_p.K70del	NM_001040260.3	NP_001035350.2	Q8N568	DCLK2_HUMAN	doublecortin-like kinase 2	70					intracellular signal transduction (GO:0035556)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|endometrium(4)|kidney(1)|large_intestine(7)|lung(7)|ovary(3)|pancreas(1)|prostate(1)|skin(1)	26	all_hematologic(180;0.151)					CTCAGCTCGGAGAAGAAGGCCAA	0.66																																					p.68_69del	GBM(195;186 2215 13375 16801 37459)	.											.	DCLK2-300	0			c.203_205del						.																																			SO:0001651	inframe_deletion	166614	exon1			GCTCGGAGAAGAA	BC032726	CCDS34076.1, CCDS47142.1, CCDS47142.2	4q31.3	2008-02-05	2007-04-02	2007-04-02	ENSG00000170390	ENSG00000170390			19002	protein-coding gene	gene with protein product		613166	"""doublecortin and CaM kinase-like 2"""	DCAMKL2		12477932	Standard	NM_001040260		Approved	MGC45428, DCDC3, DCDC3B, DCK2	uc003ilo.4	Q8N568	OTTHUMG00000161444	ENST00000296550.7:c.203_205delAGA	4.37:g.151000385_151000387delAGA	ENSP00000296550:p.Lys70del	Somatic	297	4		WXS	Illumina GAIIx	Phase_I	665	0	NM_001040260	0	0	0	0	0	C9J5Q9|Q59GC8|Q8N399	In_Frame_Del	DEL	ENST00000296550.7	37	CCDS34076.1																																																																																			.		0.660	DCLK2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000364952.1	NM_001040260	
TENM3	55714	hgsc.bcm.edu	37	4	183721231	183721231	+	Silent	SNP	C	C	T			TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr4:183721231C>T	ENST00000511685.1	+	28	7950	c.7827C>T	c.(7825-7827)taC>taT	p.Y2609Y	TENM3_ENST00000406950.2_Silent_p.Y2609Y			Q9P273	TEN3_HUMAN	teneurin transmembrane protein 3	2609					camera-type eye morphogenesis (GO:0048593)|homophilic cell adhesion (GO:0007156)|positive regulation of neuron projection development (GO:0010976)|self proteolysis (GO:0097264)|signal transduction (GO:0007165)	cell projection (GO:0042995)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)										ACGTGCGCTACGGCATGACCC	0.731																																					p.Y2609Y		.											.	.	0			c.C7827T						.						14.0	17.0	16.0					4																	183721231		2162	4253	6415	SO:0001819	synonymous_variant	55714	exon27			GCGCTACGGCATG	AF195420	CCDS47165.1	4q35	2012-10-02	2012-10-02	2012-10-02	ENSG00000218336	ENSG00000218336			29944	protein-coding gene	gene with protein product		610083	"""odz, odd Oz/ten-m homolog 3 (Drosophila)"""	ODZ3		10331952, 10625539	Standard	NM_001080477		Approved	Ten-M3, KIAA1455	uc003ivd.1	Q9P273	OTTHUMG00000160682	ENST00000511685.1:c.7827C>T	4.37:g.183721231C>T		Somatic	3	0		WXS	Illumina GAIIx	Phase_I	13	5	NM_001080477	0	0	0	1	1	Q5XUL9|Q96SY2|Q9NV77|Q9NVW1|Q9NZJ2	Silent	SNP	ENST00000511685.1	37	CCDS47165.1																																																																																			.		0.731	TENM3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000361734.1		
ACSL1	2180	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	185684335	185684335	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr4:185684335C>T	ENST00000515030.1	-	16	1832	c.1507G>A	c.(1507-1509)Gag>Aag	p.E503K	ACSL1_ENST00000504342.1_Missense_Mutation_p.E503K|ACSL1_ENST00000281455.2_Missense_Mutation_p.E503K|ACSL1_ENST00000454703.2_Missense_Mutation_p.E332K|ACSL1_ENST00000507295.1_Missense_Mutation_p.E469K|ACSL1_ENST00000437665.3_Missense_Mutation_p.E332K|ACSL1_ENST00000513317.1_Missense_Mutation_p.E503K			P33121	ACSL1_HUMAN	acyl-CoA synthetase long-chain family member 1	503					adiponectin-activated signaling pathway (GO:0033211)|alpha-linolenic acid metabolic process (GO:0036109)|cellular lipid metabolic process (GO:0044255)|linoleic acid metabolic process (GO:0043651)|lipid biosynthetic process (GO:0008610)|long-chain fatty acid import (GO:0044539)|long-chain fatty acid metabolic process (GO:0001676)|long-chain fatty-acyl-CoA biosynthetic process (GO:0035338)|positive regulation of protein serine/threonine kinase activity (GO:0071902)|response to drug (GO:0042493)|response to nutrient (GO:0007584)|response to oleic acid (GO:0034201)|response to organic cyclic compound (GO:0014070)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)|unsaturated fatty acid metabolic process (GO:0033559)|xenobiotic catabolic process (GO:0042178)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)|peroxisomal membrane (GO:0005778)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|long-chain fatty acid-CoA ligase activity (GO:0004467)			NS(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(6)|liver(1)|lung(17)|ovary(2)|prostate(1)|skin(2)	38		all_lung(41;7.57e-14)|Lung NSC(41;1.81e-13)|Colorectal(36;0.00172)|Hepatocellular(41;0.00826)|Renal(120;0.00988)|Prostate(90;0.0235)|all_hematologic(60;0.0315)|all_neural(102;0.107)|Medulloblastoma(177;0.146)		all cancers(43;1.33e-28)|Epithelial(43;5.3e-25)|OV - Ovarian serous cystadenocarcinoma(60;4.88e-11)|Colorectal(24;3.59e-06)|STAD - Stomach adenocarcinoma(60;2.72e-05)|GBM - Glioblastoma multiforme(59;2.83e-05)|BRCA - Breast invasive adenocarcinoma(30;7.66e-05)|COAD - Colon adenocarcinoma(29;0.000538)|LUSC - Lung squamous cell carcinoma(40;0.008)|READ - Rectum adenocarcinoma(43;0.0419)	Adenosine monophosphate(DB00131)|Adenosine triphosphate(DB00171)	CCCTCGCCCTCGGCAGCCATG	0.488																																					p.E503K		.											.	ACSL1-92	0			c.G1507A						.						67.0	65.0	65.0					4																	185684335		2203	4300	6503	SO:0001583	missense	2180	exon16			CGCCCTCGGCAGC	BC026290	CCDS3839.1, CCDS68825.1, CCDS68826.1, CCDS75213.1	4q35.1	2014-08-08	2004-02-19	2004-02-20	ENSG00000151726	ENSG00000151726	6.2.1.3	"""Acyl-CoA synthetase family"""	3569	protein-coding gene	gene with protein product	"""lignoceroyl-CoA synthase"", ""long-chain fatty-acid-coenzyme A ligase 1"""	152425	"""fatty-acid-Coenzyme A ligase, long-chain 2"""	FACL2		2341402, 1531127	Standard	XM_005262828		Approved	LACS2, LACS, ACS1, LACS1, FACL1	uc003iwu.1	P33121	OTTHUMG00000160547	ENST00000515030.1:c.1507G>A	4.37:g.185684335C>T	ENSP00000422607:p.Glu503Lys	Somatic	72	0		WXS	Illumina GAIIx	Phase_I	72	66	NM_001995	0	0	0	13	13	B7Z452|D3DP57|P41215|Q8N8V7|Q8TA99	Missense_Mutation	SNP	ENST00000515030.1	37	CCDS3839.1	.	.	.	.	.	.	.	.	.	.	C	8.620	0.891225	0.17613	.	.	ENSG00000151726	ENST00000454703;ENST00000515030;ENST00000503407;ENST00000281455;ENST00000507295;ENST00000437665;ENST00000504342;ENST00000513317	T;T;T;T;T;T;T;T	0.10573	2.86;2.86;2.86;2.86;2.86;2.86;2.86;2.86	5.6	-0.0918	0.13659	AMP-dependent synthetase/ligase (1);	0.275894	0.45867	N	0.000336	T	0.02807	0.0084	N	0.01257	-0.925	0.26851	N	0.968176	B;B;B;B	0.02656	0.0;0.0;0.0;0.0	B;B;B;B	0.12837	0.008;0.001;0.001;0.001	T	0.42464	-0.9450	10	0.22706	T	0.39	-5.745	6.3524	0.21383	0.0:0.133:0.2424:0.6245	.	469;503;503;503	E7EPM6;B7Z452;P33121;P33121-2	.;.;ACSL1_HUMAN;.	K	332;503;109;503;469;332;503;503	ENSP00000407165:E332K;ENSP00000422607:E503K;ENSP00000425098:E109K;ENSP00000281455:E503K;ENSP00000426244:E469K;ENSP00000405687:E332K;ENSP00000425006:E503K;ENSP00000426150:E503K	ENSP00000281455:E503K	E	-	1	0	ACSL1	185921329	1.000000	0.71417	0.576000	0.28549	0.595000	0.36748	4.158000	0.58150	-0.164000	0.10927	-0.290000	0.09829	GAG	.		0.488	ACSL1-011	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000361112.2	NM_001995	
DNAH5	1767	bcgsc.ca	37	5	13766210	13766210	+	Missense_Mutation	SNP	C	C	T	rs149452082		TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr5:13766210C>T	ENST00000265104.4	-	59	10080	c.9976G>A	c.(9976-9978)Gta>Ata	p.V3326I	DNAH5_ENST00000504001.3_Intron	NM_001369.2	NP_001360.1	Q8TE73	DYH5_HUMAN	dynein, axonemal, heavy chain 5	3326	Stalk. {ECO:0000250}.				cilium movement (GO:0003341)|lateral ventricle development (GO:0021670)|left/right axis specification (GO:0070986)	axonemal dynein complex (GO:0005858)|axoneme (GO:0005930)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(6)|breast(14)|central_nervous_system(4)|cervix(2)|endometrium(23)|haematopoietic_and_lymphoid_tissue(8)|kidney(11)|large_intestine(85)|liver(1)|lung(129)|ovary(16)|pancreas(2)|prostate(5)|skin(48)|stomach(5)|upper_aerodigestive_tract(11)|urinary_tract(8)	378	Lung NSC(4;0.00476)					AGCAGCAGTACGCAATCCATG	0.522									Kartagener syndrome																												p.V3326I		.											.	DNAH5-182	0			c.G9976A						.						115.0	112.0	113.0					5																	13766210		2203	4300	6503	SO:0001583	missense	1767	exon59	Familial Cancer Database	Ciliary Dyskinesia, Primary (CILD1 - CILD13), Immotile Cilia Syndrome	GCAGTACGCAATC	AJ132090	CCDS3882.1	5p15.2	2008-07-18	2006-09-04		ENSG00000039139	ENSG00000039139		"""Axonemal dyneins"""	2950	protein-coding gene	gene with protein product	"""dynein heavy chain 5"""	603335	"""dynein, axonemal, heavy polypeptide 5"""			9256245, 11788826	Standard	NM_001369		Approved	Dnahc5, HL1, PCD, CILD3, KTGNR	uc003jfd.2	Q8TE73	OTTHUMG00000090533	ENST00000265104.4:c.9976G>A	5.37:g.13766210C>T	ENSP00000265104:p.Val3326Ile	Somatic	97	2		WXS	Illumina GAIIx	Phase_I	192	114	NM_001369	0	0	0	0	0	Q92860|Q96L74|Q9H5S7|Q9HCG9	Missense_Mutation	SNP	ENST00000265104.4	37	CCDS3882.1	.	.	.	.	.	.	.	.	.	.	C	34	5.368022	0.95900	.	.	ENSG00000039139	ENST00000265104	T	0.79141	-1.24	5.63	5.63	0.86233	Dynein heavy chain, coiled coil stalk (1);	0.000000	0.85682	D	0.000000	D	0.85331	0.5672	L	0.55743	1.74	0.80722	D	1	D	0.71674	0.998	D	0.63793	0.918	D	0.84606	0.0675	10	0.48119	T	0.1	.	19.7357	0.96202	0.0:1.0:0.0:0.0	.	3326	Q8TE73	DYH5_HUMAN	I	3326	ENSP00000265104:V3326I	ENSP00000265104:V3326I	V	-	1	0	DNAH5	13819210	1.000000	0.71417	0.994000	0.49952	0.881000	0.50899	5.966000	0.70395	2.660000	0.90430	0.558000	0.71614	GTA	C|1.000;A|0.000		0.522	DNAH5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207057.2	NM_001369	
AGXT2	64902	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	34998917	34998917	+	Silent	SNP	C	C	T	rs372814383		TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr5:34998917C>T	ENST00000231420.6	-	14	1652	c.1452G>A	c.(1450-1452)gcG>gcA	p.A484A		NM_031900.3	NP_114106.1	Q9BYV1	AGT2_HUMAN	alanine--glyoxylate aminotransferase 2	484					cellular nitrogen compound metabolic process (GO:0034641)|glycine biosynthetic process, by transamination of glyoxylate (GO:0019265)|glyoxylate catabolic process (GO:0009436)|glyoxylate metabolic process (GO:0046487)|L-alanine catabolic process, by transamination (GO:0019481)|nucleobase-containing small molecule metabolic process (GO:0055086)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|pyrimidine nucleobase metabolic process (GO:0006206)|pyrimidine nucleoside catabolic process (GO:0046135)|small molecule metabolic process (GO:0044281)	mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	(R)-3-amino-2-methylpropionate-pyruvate transaminase activity (GO:0047305)|alanine-glyoxylate transaminase activity (GO:0008453)|beta-alanine-pyruvate transaminase activity (GO:0016223)|pyridoxal phosphate binding (GO:0030170)	p.A484A(1)		NS(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(8)|lung(18)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	41	all_lung(31;4.52e-05)		COAD - Colon adenocarcinoma(61;0.174)|Colorectal(62;0.229)	GBM - Glioblastoma multiforme(108;0.181)	Glycine(DB00145)|L-Alanine(DB00160)|Pyruvic acid(DB00119)	ACATTGAGGGCGCAATGCGAA	0.363													C|||	1	0.000199681	0.0	0.0	5008	,	,		22057	0.0		0.0	False		,,,				2504	0.001				p.A484A		.											.	AGXT2-94	1	Substitution - coding silent(1)	upper_aerodigestive_tract(1)	c.G1452A						.	C		3,4403	6.2+/-15.9	0,3,2200	154.0	135.0	142.0		1452	-11.1	0.2	5		142	0,8600		0,0,4300	no	coding-synonymous	AGXT2	NM_031900.3		0,3,6500	TT,TC,CC		0.0,0.0681,0.0231		484/515	34998917	3,13003	2203	4300	6503	SO:0001819	synonymous_variant	64902	exon14			TGAGGGCGCAATG	AJ292204	CCDS3908.1	5p13	2010-05-07	2010-05-07		ENSG00000113492	ENSG00000113492	2.6.1.44		14412	protein-coding gene	gene with protein product	"""beta-alanine-pyruvate aminotransferase"", ""beta-ALAAT II"""	612471	"""alanine-glyoxylate aminotransferase 2"""			15240345	Standard	NM_031900		Approved	AGT2	uc003jjf.3	Q9BYV1	OTTHUMG00000090788	ENST00000231420.6:c.1452G>A	5.37:g.34998917C>T		Somatic	65	0		WXS	Illumina GAIIx	Phase_I	100	40	NM_031900	0	0	0	0	0	B7ZM47|E9PDL7|Q53FB4|Q53FY7|Q53G03|Q5W7Q1	Silent	SNP	ENST00000231420.6	37	CCDS3908.1																																																																																			.		0.363	AGXT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207574.2	NM_031900	
NUP155	9631	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	5	37348627	37348628	+	Frame_Shift_Del	DEL	AG	AG	-			TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10	AG	AG	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr5:37348627_37348628delAG	ENST00000231498.3	-	9	1177_1178	c.974_975delCT	c.(973-975)tctfs	p.S325fs	NUP155_ENST00000513532.1_Frame_Shift_Del_p.S325fs|NUP155_ENST00000381843.2_Frame_Shift_Del_p.S266fs	NM_153485.1	NP_705618.1	O75694	NU155_HUMAN	nucleoporin 155kDa	325					atrial cardiac muscle cell action potential (GO:0086014)|carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA export from nucleus (GO:0006406)|nuclear envelope organization (GO:0006998)|protein import into nucleus (GO:0006606)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	membrane (GO:0016020)|nuclear envelope (GO:0005635)|nuclear pore (GO:0005643)	structural constituent of nuclear pore (GO:0017056)|transporter activity (GO:0005215)			endometrium(1)|kidney(16)|large_intestine(5)|lung(29)|ovary(2)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	62	all_lung(31;0.000137)		COAD - Colon adenocarcinoma(61;0.14)|Colorectal(62;0.202)			TACCAGCAGCAGAGACAATGGC	0.356																																					p.325_325del		.											.	NUP155-205	0			c.974_975del						.																																			SO:0001589	frameshift_variant	9631	exon9			AGCAGCAGAGACA	AJ007558	CCDS3921.1, CCDS43310.1, CCDS64142.1	5p13.1	2008-02-05	2002-08-29		ENSG00000113569	ENSG00000113569			8063	protein-coding gene	gene with protein product		606694	"""nucleoporin 155kD"""			10191094	Standard	NM_153485		Approved	KIAA0791, N155	uc003jku.1	O75694	OTTHUMG00000090803	ENST00000231498.3:c.974_975delCT	5.37:g.37348629_37348630delAG	ENSP00000231498:p.Ser325fs	Somatic	384	0		WXS	Illumina GAIIx	Phase_I	683	313	NM_153485	0	0	0	0	0	Q9UBE9|Q9UFL5	Frame_Shift_Del	DEL	ENST00000231498.3	37	CCDS3921.1																																																																																			.		0.356	NUP155-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207593.2	NM_153485, NM_004298	
OSMR	9180	hgsc.bcm.edu;broad.mit.edu	37	5	38923329	38923329	+	Frame_Shift_Del	DEL	A	A	-			TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr5:38923329delA	ENST00000274276.3	+	13	2245	c.1843delA	c.(1843-1845)aaafs	p.K616fs		NM_003999.2	NP_003990.1	Q99650	OSMR_HUMAN	oncostatin M receptor	616	Fibronectin type-III 3. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell proliferation (GO:0008283)|cell surface receptor signaling pathway (GO:0007166)|oncostatin-M-mediated signaling pathway (GO:0038165)|positive regulation of acute inflammatory response (GO:0002675)|positive regulation of cell proliferation (GO:0008284)|response to cytokine (GO:0034097)	oncostatin-M receptor complex (GO:0005900)	growth factor binding (GO:0019838)|oncostatin-M receptor activity (GO:0004924)			NS(1)|breast(3)|central_nervous_system(2)|endometrium(1)|kidney(1)|large_intestine(8)|lung(20)|ovary(2)|pancreas(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	46	all_lung(31;0.000365)					TTTATTAGAGAAAAAAACAGG	0.368																																					p.K615fs		.											.	OSMR-496	0			c.1843delA						.						70.0	74.0	73.0					5																	38923329		2203	4300	6503	SO:0001589	frameshift_variant	9180	exon13			TTAGAGAAAAAAA	U60805	CCDS3928.1, CCDS54847.1	5p13.2	2013-02-11			ENSG00000145623	ENSG00000145623		"""Fibronectin type III domain containing"""	8507	protein-coding gene	gene with protein product		601743				8999038	Standard	NM_001168355		Approved	OSMRB	uc003jln.2	Q99650	OTTHUMG00000090811	ENST00000274276.3:c.1843delA	5.37:g.38923329delA	ENSP00000274276:p.Lys616fs	Somatic	37	0		WXS	Illumina GAIIx	Phase_I	62	11	NM_003999	0	0	0	0	0	Q6P4E8|Q96QJ6	Frame_Shift_Del	DEL	ENST00000274276.3	37	CCDS3928.1																																																																																			.		0.368	OSMR-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000207609.2	NM_003999	
ANXA2R	389289	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	43039623	43039623	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr5:43039623C>T	ENST00000314890.3	-	2	1945	c.526G>A	c.(526-528)Gcg>Acg	p.A176T	AC025171.1_ENST00000505541.1_RNA|AC025171.1_ENST00000451894.2_RNA	NM_001014279.2	NP_001014301.1	Q3ZCQ2	AX2R_HUMAN	annexin A2 receptor	176																	ACAGAGAACGCGGCAAAACCA	0.562											OREG0016598	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.A176T		.											.	.	0			c.G526A						.						82.0	84.0	83.0					5																	43039623		2203	4300	6503	SO:0001583	missense	389289	exon1			AGAACGCGGCAAA	BC067873	CCDS34153.1	5p12	2013-08-14	2012-03-09	2012-03-09	ENSG00000177721	ENSG00000177721			33463	protein-coding gene	gene with protein product		611296	"""chromosome 5 open reading frame 39"""	C5orf39		16895901, 18636554	Standard	NM_001014279		Approved	AXIIR	uc003jnf.3	Q3ZCQ2	OTTHUMG00000162232	ENST00000314890.3:c.526G>A	5.37:g.43039623C>T	ENSP00000315915:p.Ala176Thr	Somatic	112	0	913	WXS	Illumina GAIIx	Phase_I	219	119	NM_001014279	1	0	3	5	1	Q8NHX5	Missense_Mutation	SNP	ENST00000314890.3	37	CCDS34153.1	.	.	.	.	.	.	.	.	.	.	C	12.37	1.919026	0.33908	.	.	ENSG00000177721	ENST00000314890	T	0.39592	1.07	2.46	-4.92	0.03075	.	.	.	.	.	T	0.20373	0.0490	N	0.24115	0.695	0.09310	N	1	P	0.34826	0.471	B	0.24541	0.054	T	0.07195	-1.0785	9	0.87932	D	0	.	5.4736	0.16684	0.134:0.1752:0.5818:0.1091	.	176	Q3ZCQ2	AX2R_HUMAN	T	176	ENSP00000315915:A176T	ENSP00000315915:A176T	A	-	1	0	C5orf39	43075380	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.881000	0.04179	-1.671000	0.01466	-0.910000	0.02820	GCG	.		0.562	ANXA2R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000368030.1	NM_001014279	
SPATA9	83890	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	94994526	94994526	+	Missense_Mutation	SNP	C	C	A			TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr5:94994526C>A	ENST00000274432.8	-	5	707	c.566G>T	c.(565-567)tGt>tTt	p.C189F	RFESD_ENST00000508206.1_Intron|SPATA9_ENST00000477047.2_5'UTR	NM_031952.3	NP_114158.2	Q9BWV2	SPAT9_HUMAN	spermatogenesis associated 9	189					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)				large_intestine(3)|lung(4)	7		all_cancers(142;1.28e-06)|all_epithelial(76;1.55e-09)|all_lung(232;0.00307)|Lung NSC(167;0.00452)|Ovarian(225;0.00473)|Colorectal(57;0.0846)|Breast(839;0.198)		all cancers(79;8.91e-16)		GGCTTTTCTACAATTTTCACT	0.418																																					p.C189F		.											.	SPATA9-90	0			c.G566T						.						128.0	118.0	122.0					5																	94994526		2203	4299	6502	SO:0001583	missense	83890	exon5			TTTCTACAATTTT	AK093225	CCDS4076.1	5q15	2008-02-05			ENSG00000145757	ENSG00000145757			22988	protein-coding gene	gene with protein product		608039				12493713	Standard	NM_031952		Approved	NYD-SP16, FLJ35906	uc003klj.1	Q9BWV2	OTTHUMG00000121169	ENST00000274432.8:c.566G>T	5.37:g.94994526C>A	ENSP00000274432:p.Cys189Phe	Somatic	44	0		WXS	Illumina GAIIx	Phase_I	62	29	NM_031952	0	0	0	1	1	A8K8H3|Q4G122|Q86X33|Q8NA28	Missense_Mutation	SNP	ENST00000274432.8	37	CCDS4076.1	.	.	.	.	.	.	.	.	.	.	C	0.067	-1.211196	0.01555	.	.	ENSG00000145757	ENST00000274432	T	0.27720	1.65	5.35	-2.74	0.05932	.	1.210010	0.05721	N	0.597837	T	0.10508	0.0257	N	0.02539	-0.55	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.27226	-1.0080	10	0.13470	T	0.59	0.0316	5.6577	0.17652	0.3111:0.3154:0.3735:0.0	.	189	Q9BWV2	SPAT9_HUMAN	F	189	ENSP00000274432:C189F	ENSP00000274432:C189F	C	-	2	0	SPATA9	95020282	0.012000	0.17670	0.000000	0.03702	0.005000	0.04900	0.399000	0.20916	-0.645000	0.05458	-0.291000	0.09656	TGT	.		0.418	SPATA9-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000304036.1	NM_031952	
MCC	4163	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	112720886	112720886	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr5:112720886C>T	ENST00000408903.3	-	2	609	c.194G>A	c.(193-195)cGc>cAc	p.R65H	CTD-2201G3.1_ENST00000416046.2_RNA	NM_001085377.1	NP_001078846	P23508	CRCM_HUMAN	mutated in colorectal cancers	0					negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of epithelial cell migration (GO:0010633)|negative regulation of epithelial cell proliferation (GO:0050680)|signal transduction (GO:0007165)|Wnt signaling pathway (GO:0016055)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)			endometrium(4)|kidney(3)|large_intestine(15)|liver(2)|lung(8)|ovary(2)|pancreas(1)|prostate(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	42		all_cancers(142;5.89e-08)|all_epithelial(76;3.57e-11)|all_lung(232;0.000605)|Lung NSC(810;0.000697)|Colorectal(10;0.00146)|Prostate(80;0.00174)|Ovarian(225;0.0175)|Breast(839;0.198)		OV - Ovarian serous cystadenocarcinoma(64;2.04e-54)|Epithelial(69;9.69e-49)|all cancers(49;6.25e-44)|COAD - Colon adenocarcinoma(37;0.0432)|Colorectal(14;0.0766)		ATTCAGCTGGCGACAGACCAT	0.408																																					p.R65H		.											.	MCC-69	0			c.G194A						.						116.0	105.0	109.0					5																	112720886		1902	4122	6024	SO:0001583	missense	4163	exon2			AGCTGGCGACAGA		CCDS4111.1, CCDS43351.1	5q21-q22	2013-01-10			ENSG00000171444	ENSG00000171444		"""EF-hand domain containing"""	6935	protein-coding gene	gene with protein product		159350				1848370	Standard	NM_002387		Approved		uc003kql.4	P23508	OTTHUMG00000128804	ENST00000408903.3:c.194G>A	5.37:g.112720886C>T	ENSP00000386227:p.Arg65His	Somatic	144	0		WXS	Illumina GAIIx	Phase_I	260	108	NM_001085377	0	0	0	0	0	D3DT05|Q6ZR04	Missense_Mutation	SNP	ENST00000408903.3	37	CCDS43351.1	.	.	.	.	.	.	.	.	.	.	C	21.6	4.171644	0.78452	.	.	ENSG00000171444	ENST00000408903	T	0.71934	-0.61	4.45	3.58	0.41010	.	0.000000	0.51477	D	0.000095	T	0.59445	0.2194	.	.	.	0.32587	N	0.527659	B	0.15719	0.014	B	0.06405	0.002	T	0.64504	-0.6392	9	0.46703	T	0.11	-12.7526	11.7507	0.51847	0.0:0.9115:0.0:0.0885	.	65	P23508-2	.	H	65	ENSP00000386227:R65H	ENSP00000386227:R65H	R	-	2	0	MCC	112748785	1.000000	0.71417	0.956000	0.39512	0.912000	0.54170	5.417000	0.66423	1.191000	0.43056	0.650000	0.86243	CGC	.		0.408	MCC-003	PUTATIVE	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000370839.1	NM_001085377	
LVRN	206338	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	5	115335468	115335468	+	Frame_Shift_Del	DEL	T	T	-			TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr5:115335468delT	ENST00000357872.4	+	7	1508	c.1384delT	c.(1384-1386)tttfs	p.F463fs	AQPEP_ENST00000395528.2_5'UTR	NM_173800.4	NP_776161.3	Q6Q4G3	AMPQ_HUMAN		463						integral component of membrane (GO:0016021)	metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)										GAATGAGATCTTTTTTTCTAA	0.363																																					p.F462fs		.											.	.	0			c.1384delT						.						53.0	56.0	55.0					5																	115335468		2201	4300	6501	SO:0001589	frameshift_variant	0	exon7			GAGATCTTTTTTT																												ENST00000357872.4:c.1384delT	5.37:g.115335468delT	ENSP00000350541:p.Phe463fs	Somatic	102	0		WXS	Illumina GAIIx	Phase_I	200	92	NM_173800	0	0	0	0	0	A8K6J0|C9JGD2|Q32MR1|Q4G0I9|Q4G0V2|Q86XA3|Q8NBZ2	Frame_Shift_Del	DEL	ENST00000357872.4	37	CCDS4124.1																																																																																			.		0.363	AQPEP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250852.1		
FBN2	2201	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	127728872	127728872	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr5:127728872G>A	ENST00000508053.1	-	16	2395	c.1421C>T	c.(1420-1422)gCc>gTc	p.A474V	FBN2_ENST00000262464.4_Missense_Mutation_p.A474V|FBN2_ENST00000508989.1_Missense_Mutation_p.A441V			P35556	FBN2_HUMAN	fibrillin 2	474					anatomical structure morphogenesis (GO:0009653)|bone trabecula formation (GO:0060346)|embryonic limb morphogenesis (GO:0030326)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|positive regulation of bone mineralization (GO:0030501)|positive regulation of osteoblast differentiation (GO:0045669)|sequestering of TGFbeta in extracellular matrix (GO:0035583)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|microfibril (GO:0001527)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|extracellular matrix structural constituent (GO:0005201)			NS(1)|autonomic_ganglia(1)|biliary_tract(1)|breast(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(37)|liver(1)|lung(89)|ovary(9)|pancreas(2)|prostate(6)|skin(10)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	197		all_cancers(142;0.0216)|Prostate(80;0.0551)	KIRC - Kidney renal clear cell carcinoma(527;0.0268)|Kidney(363;0.0488)	OV - Ovarian serous cystadenocarcinoma(64;0.0821)|Epithelial(69;0.146)		CCCCACACCGGCTCCCCCAAC	0.562																																					p.A474V		.											.	FBN2-146	0			c.C1421T						.						77.0	86.0	83.0					5																	127728872		2203	4300	6503	SO:0001583	missense	2201	exon10			ACACCGGCTCCCC	U03272	CCDS34222.1	5q23-q31	2008-08-01	2008-08-01			ENSG00000138829			3604	protein-coding gene	gene with protein product	"""fibrillin 5"""	612570	"""congenital contractural arachnodactyly"""	CCA		1852206, 8120105	Standard	NM_001999		Approved	DA9	uc003kuu.3	P35556		ENST00000508053.1:c.1421C>T	5.37:g.127728872G>A	ENSP00000424571:p.Ala474Val	Somatic	61	0		WXS	Illumina GAIIx	Phase_I	126	61	NM_001999	0	0	0	0	0	B4DU01|Q59ES6	Missense_Mutation	SNP	ENST00000508053.1	37	CCDS34222.1	.	.	.	.	.	.	.	.	.	.	G	3.987	-0.005257	0.07773	.	.	ENSG00000138829	ENST00000262464;ENST00000508053;ENST00000508989	D;D;D	0.85773	-1.84;-1.84;-2.03	4.02	4.02	0.46733	.	0.087898	0.46442	D	0.000282	T	0.70211	0.3198	N	0.08118	0	0.35137	D	0.768509	B;B	0.26935	0.164;0.164	B;B	0.19946	0.027;0.027	T	0.70378	-0.4888	10	0.14656	T	0.56	.	17.4572	0.87610	0.0:0.0:1.0:0.0	.	441;474	D6RJI3;P35556	.;FBN2_HUMAN	V	474;474;441	ENSP00000262464:A474V;ENSP00000424571:A474V;ENSP00000425596:A441V	ENSP00000262464:A474V	A	-	2	0	FBN2	127756771	1.000000	0.71417	0.964000	0.40570	0.045000	0.14185	4.097000	0.57741	2.516000	0.84829	0.563000	0.77884	GCC	.		0.562	FBN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000371618.2	NM_001999	
RAD50	10111	hgsc.bcm.edu	37	5	131931452	131931452	+	Frame_Shift_Del	DEL	A	A	-			TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr5:131931452delA	ENST00000265335.6	+	13	2544	c.2157delA	c.(2155-2157)ctafs	p.L719fs	RAD50_ENST00000378823.3_Frame_Shift_Del_p.L580fs			Q92878	RAD50_HUMAN	RAD50 homolog (S. cerevisiae)	719	Zinc-hook. {ECO:0000255|PROSITE- ProRule:PRU00471}.				cellular response to DNA damage stimulus (GO:0006974)|DNA catabolic process, endonucleolytic (GO:0000737)|DNA duplex unwinding (GO:0032508)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|positive regulation of kinase activity (GO:0033674)|positive regulation of protein autophosphorylation (GO:0031954)|reciprocal meiotic recombination (GO:0007131)|regulation of mitotic recombination (GO:0000019)|telomere maintenance (GO:0000723)|telomere maintenance via telomerase (GO:0007004)	membrane (GO:0016020)|Mre11 complex (GO:0030870)|nuclear chromosome, telomeric region (GO:0000784)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|pronucleus (GO:0045120)|site of double-strand break (GO:0035861)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|nuclease activity (GO:0004518)|protein binding, bridging (GO:0030674)|zinc ion binding (GO:0008270)	p.L580L(1)		breast(3)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(10)|liver(1)|lung(8)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	36		all_cancers(142;0.0368)|Breast(839;0.198)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)			AATCAGAGCTAAAAAAAAAGG	0.418								Homologous recombination																													p.L719fs		.											.	RAD50-229	1	Substitution - coding silent(1)	breast(1)	c.2157delA						.						67.0	66.0	66.0					5																	131931452		2203	4300	6503	SO:0001589	frameshift_variant	10111	exon13			AGAGCTAAAAAAA	Z75311	CCDS34233.1	5q23-q31	2008-05-30	2001-11-28		ENSG00000113522	ENSG00000113522			9816	protein-coding gene	gene with protein product		604040	"""RAD50 (S. cerevisiae) homolog"""			8756642, 9705271	Standard	NM_005732		Approved	hRad50, RAD50-2	uc003kxi.3	Q92878	OTTHUMG00000059613	ENST00000265335.6:c.2157delA	5.37:g.131931452delA	ENSP00000265335:p.Leu719fs	Somatic	40	1		WXS	Illumina GAIIx	Phase_I	74	24	NM_005732	0	0	0	0	0	B9EGF5|O43254|Q6GMT7|Q6P5X3|Q9UP86	Frame_Shift_Del	DEL	ENST00000265335.6	37	CCDS34233.1																																																																																			.		0.418	RAD50-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000132566.5	NM_005732	
PCDHA10	56139	bcgsc.ca	37	5	140237079	140237079	+	Silent	SNP	C	C	T	rs189056024		TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr5:140237079C>T	ENST00000307360.5	+	1	1446	c.1446C>T	c.(1444-1446)gaC>gaT	p.D482D	PCDHA6_ENST00000529310.1_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA7_ENST00000525929.1_Intron|PCDHA5_ENST00000529619.1_Intron|PCDHA9_ENST00000532602.1_Intron|PCDHA8_ENST00000531613.1_Intron|PCDHA3_ENST00000522353.2_Intron|PCDHA4_ENST00000530339.1_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA10_ENST00000506939.2_Silent_p.D482D|PCDHA2_ENST00000526136.1_Intron|PCDHA4_ENST00000512229.2_Intron|PCDHA6_ENST00000527624.1_Intron|PCDHA5_ENST00000529859.1_Intron	NM_018901.2	NP_061724.1	Q9Y5I2	PCDAA_HUMAN	protocadherin alpha 10	482	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			NS(1)|breast(11)|cervix(1)|endometrium(11)|kidney(5)|large_intestine(13)|liver(2)|lung(20)|ovary(3)|pancreas(1)|prostate(3)|skin(6)|upper_aerodigestive_tract(2)	79			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GGGACGCGGACGCGCAGGAGA	0.662																																					p.D482D		.											.	PCDHA10-99	0			c.C1446T						.						85.0	84.0	85.0					5																	140237079		2196	4273	6469	SO:0001819	synonymous_variant	56139	exon1			CGCGGACGCGCAG	AF152475	CCDS34255.1, CCDS54921.1, CCDS75325.1	5q31	2010-11-26			ENSG00000250120	ENSG00000250120		"""Cadherins / Protocadherins : Clustered"""	8664	other	complex locus constituent	"""KIAA0345-like 4"", ""ortholog to mouse CNR8"""	606316		CNRS8		10380929	Standard	NM_018901		Approved	CNR8, CRNR8, CNRN8, PCDH-ALPHA10		Q9Y5I2	OTTHUMG00000163372	ENST00000307360.5:c.1446C>T	5.37:g.140237079C>T		Somatic	247	4		WXS	Illumina GAIIx	Phase_I	987	432	NM_031859	0	0	0	2	2	A1L493|O75280|Q9NRU2	Silent	SNP	ENST00000307360.5	37	CCDS54921.1																																																																																			C|0.999;A|0.000		0.662	PCDHA10-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372895.2	NM_018901	
TENM2	57451	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	167674716	167674716	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr5:167674716G>A	ENST00000518659.1	+	27	6811	c.6772G>A	c.(6772-6774)Ggg>Agg	p.G2258R	TENM2_ENST00000520394.1_Missense_Mutation_p.G2019R|TENM2_ENST00000519204.1_Missense_Mutation_p.G2137R|TENM2_ENST00000403607.2_Missense_Mutation_p.G2082R|TENM2_ENST00000545108.1_Missense_Mutation_p.G2257R	NM_001122679.1	NP_001116151.1	Q9NT68	TEN2_HUMAN	teneurin transmembrane protein 2	2258					axon guidance (GO:0007411)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|heterophilic cell-cell adhesion (GO:0007157)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of filopodium assembly (GO:0051491)|self proteolysis (GO:0097264)|signal transduction (GO:0007165)|single organismal cell-cell adhesion (GO:0016337)|transcription, DNA-templated (GO:0006351)	cell junction (GO:0030054)|cell-cell junction (GO:0005911)|dendrite (GO:0030425)|dendritic spine (GO:0043197)|endoplasmic reticulum (GO:0005783)|filopodium (GO:0030175)|Golgi apparatus (GO:0005794)|growth cone (GO:0030426)|integral component of plasma membrane (GO:0005887)|neuron projection (GO:0043005)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|PML body (GO:0016605)|postsynaptic membrane (GO:0045211)|synapse (GO:0045202)	cell adhesion molecule binding (GO:0050839)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|receptor binding (GO:0005102)										AACCAGACTCGGGGATGTGCA	0.512																																					p.G2249R		.											.	.	0			c.G6745A						.						55.0	57.0	56.0					5																	167674716		2116	4235	6351	SO:0001583	missense	57451	exon27			AGACTCGGGGATG	AB032953		5q35	2012-10-02	2012-10-02	2012-10-02	ENSG00000145934	ENSG00000145934			29943	protein-coding gene	gene with protein product		610119	"""odz, odd Oz/ten-m homolog 2 (Drosophila)"""	ODZ2		10625539	Standard	NM_001122679		Approved	KIAA1127, Ten-M2	uc010jjd.3	Q9NT68	OTTHUMG00000162928	ENST00000518659.1:c.6772G>A	5.37:g.167674716G>A	ENSP00000429430:p.Gly2258Arg	Somatic	102	0		WXS	Illumina GAIIx	Phase_I	190	36	NM_001122679	0	0	0	0	0	Q9ULU2	Missense_Mutation	SNP	ENST00000518659.1	37		.	.	.	.	.	.	.	.	.	.	G	19.62	3.862656	0.71949	.	.	ENSG00000145934	ENST00000518659;ENST00000545108;ENST00000519204;ENST00000520394;ENST00000403607	D;D;D;D;D	0.93547	-2.77;-2.76;-2.96;-3.19;-3.24	5.59	5.59	0.84812	.	0.000000	0.85682	D	0.000000	D	0.97037	0.9032	M	0.82716	2.605	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;0.999	D	0.97237	0.9888	10	0.72032	D	0.01	.	19.5848	0.95486	0.0:0.0:1.0:0.0	.	2257;2258;2019	F5H2D1;Q9NT68;F8VNQ3	.;TEN2_HUMAN;.	R	2258;2257;2137;2019;2082	ENSP00000429430:G2258R;ENSP00000438635:G2257R;ENSP00000428964:G2137R;ENSP00000427874:G2019R;ENSP00000384905:G2082R	ENSP00000384905:G2082R	G	+	1	0	ODZ2	167607294	1.000000	0.71417	0.145000	0.22337	0.796000	0.44982	9.869000	0.99810	2.636000	0.89361	0.561000	0.74099	GGG	.		0.512	TENM2-001	KNOWN	not_organism_supported|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000376096.1	NM_001122679	
ERGIC1	57222	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	172315747	172315747	+	Silent	SNP	G	G	A			TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr5:172315747G>A	ENST00000393784.3	+	2	205	c.66G>A	c.(64-66)acG>acA	p.T22T	ERGIC1_ENST00000523291.1_Silent_p.T22T|ERGIC1_ENST00000519860.1_3'UTR	NM_001031711.2	NP_001026881.1	Q969X5	ERGI1_HUMAN	endoplasmic reticulum-golgi intermediate compartment (ERGIC) 1	22					ER to Golgi vesicle-mediated transport (GO:0006888)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)				endometrium(1)|large_intestine(3)|lung(2)|ovary(1)|skin(2)	9	Renal(175;0.000159)|Lung NSC(126;0.00344)|all_lung(126;0.00594)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;7.24e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000516)			CGCAGCCAACGTACACCGGGG	0.582																																					p.T22T		.											.	ERGIC1-93	0			c.G66A						.						193.0	140.0	158.0					5																	172315747		2203	4300	6503	SO:0001819	synonymous_variant	57222	exon2			GCCAACGTACACC	AF267855	CCDS34292.1	5q35.1	2009-11-06			ENSG00000113719	ENSG00000113719			29205	protein-coding gene	gene with protein product						10574461, 15308636	Standard	NM_001031711		Approved	ERGIC32, ERGIC-32, KIAA1181, NET24	uc003mbw.4	Q969X5	OTTHUMG00000130520	ENST00000393784.3:c.66G>A	5.37:g.172315747G>A		Somatic	165	1		WXS	Illumina GAIIx	Phase_I	346	133	NM_001031711	0	0	34	62	28	Q9H0L0|Q9H2J2|Q9ULN9	Silent	SNP	ENST00000393784.3	37	CCDS34292.1																																																																																			.		0.582	ERGIC1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252938.3	NM_020462	
CLTB	1212	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	175824972	175824972	+	Missense_Mutation	SNP	C	C	T	rs372564708		TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr5:175824972C>T	ENST00000310418.4	-	3	516	c.311G>A	c.(310-312)cGc>cAc	p.R104H	CLTB_ENST00000345807.2_Missense_Mutation_p.R104H	NM_007097.3	NP_009028.1	P09497	CLCB_HUMAN	clathrin, light chain B	104	Involved in binding clathrin heavy chain.				intracellular protein transport (GO:0006886)|vesicle-mediated transport (GO:0016192)	ciliary membrane (GO:0060170)|clathrin coat (GO:0030118)|clathrin coat of coated pit (GO:0030132)|clathrin coat of trans-Golgi network vesicle (GO:0030130)|trans-Golgi network (GO:0005802)	peptide binding (GO:0042277)|structural molecule activity (GO:0005198)			lung(1)	1	all_cancers(89;0.00522)|Renal(175;0.000269)|Lung NSC(126;0.0105)|all_lung(126;0.0168)	Medulloblastoma(196;0.0208)|all_neural(177;0.0416)|all_hematologic(541;0.214)	Kidney(164;3.85e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	Kidney(146;0.098)		TCGCCACTTGCGGATGCTCTC	0.647																																					p.R104H		.											.	CLTB-90	0			c.G311A						.	C	HIS/ARG,HIS/ARG	1,4405	2.1+/-5.4	0,1,2202	92.0	99.0	96.0		311,311	4.3	1.0	5		96	0,8600		0,0,4300	no	missense,missense	CLTB	NM_001834.2,NM_007097.2	29,29	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	probably-damaging,probably-damaging	104/212,104/230	175824972	1,13005	2203	4300	6503	SO:0001583	missense	1212	exon3			CACTTGCGGATGC	M20470	CCDS4402.1, CCDS4403.1	5q35.2	2010-05-11	2010-05-11		ENSG00000175416	ENSG00000175416			2091	protein-coding gene	gene with protein product		118970	"""clathrin, light polypeptide (Lcb)"""			7713494	Standard	NM_007097		Approved	Lcb	uc003meh.4	P09497	OTTHUMG00000130662	ENST00000310418.4:c.311G>A	5.37:g.175824972C>T	ENSP00000309415:p.Arg104His	Somatic	122	0		WXS	Illumina GAIIx	Phase_I	239	39	NM_001834	0	0	315	386	71	Q53Y37|Q6FHW1	Missense_Mutation	SNP	ENST00000310418.4	37	CCDS4403.1	.	.	.	.	.	.	.	.	.	.	C	32	5.147808	0.94603	2.27E-4	0.0	ENSG00000175416	ENST00000310418;ENST00000345807;ENST00000508425	.	.	.	4.33	4.33	0.51752	.	0.000000	0.85682	D	0.000000	D	0.85682	0.5753	M	0.92122	3.275	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.76071	0.987;0.984	D	0.90079	0.4169	9	0.87932	D	0	.	16.8322	0.85947	0.0:1.0:0.0:0.0	.	104;104	P09497-2;P09497	.;CLCB_HUMAN	H	104;104;70	.	ENSP00000309415:R104H	R	-	2	0	CLTB	175757578	1.000000	0.71417	0.997000	0.53966	0.970000	0.65996	7.402000	0.79972	1.950000	0.56595	0.455000	0.32223	CGC	.		0.647	CLTB-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000253153.1		
NSD1	64324	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	176687121	176687121	+	Nonsense_Mutation	SNP	C	C	T			TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr5:176687121C>T	ENST00000439151.2	+	14	5143	c.5098C>T	c.(5098-5100)Cga>Tga	p.R1700*	NSD1_ENST00000361032.4_Nonsense_Mutation_p.R1597*|NSD1_ENST00000347982.4_Nonsense_Mutation_p.R1431*|NSD1_ENST00000354179.4_Nonsense_Mutation_p.R1431*	NM_022455.4	NP_071900.2	Q96L73	NSD1_HUMAN	nuclear receptor binding SET domain protein 1	1700					gastrulation with mouth forming second (GO:0001702)|histone H3-K36 methylation (GO:0010452)|histone H4-K20 methylation (GO:0034770)|histone methylation (GO:0016571)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	chromosome (GO:0005694)|nucleus (GO:0005634)	androgen receptor binding (GO:0050681)|chromatin binding (GO:0003682)|estrogen receptor binding (GO:0030331)|histone methyltransferase activity (H3-K36 specific) (GO:0046975)|histone methyltransferase activity (H4-K20 specific) (GO:0042799)|retinoic acid receptor binding (GO:0042974)|retinoid X receptor binding (GO:0046965)|thyroid hormone receptor binding (GO:0046966)|transcription cofactor activity (GO:0003712)|transcription corepressor activity (GO:0003714)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(13)|large_intestine(18)|lung(24)|ovary(2)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(7)|urinary_tract(3)	96	all_cancers(89;1.57e-05)|Renal(175;0.000269)|Lung NSC(126;0.00111)|all_lung(126;0.002)	all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)|Epithelial(233;0.198)	Kidney(146;0.235)		GCGGGGCTGCCGAAATCATGA	0.433			T	NUP98	AML		Sotos Syndrome		Weaver syndrome;Sotos syndrome;Beckwith-Wiedemann syndrome	HNSCC(47;0.14)																											p.R1700X		.		Dom	yes		5	5q35	64324	nuclear receptor binding SET domain protein 1	yes	L	.	NSD1-188	0			c.C5098T	GRCh37	CM074953	NSD1	M		.						77.0	72.0	74.0					5																	176687121		2203	4300	6503	SO:0001587	stop_gained	64324	exon14	Familial Cancer Database	Weaver-Smith syndrome;Cerebral Gigantism;BWS, Exomphalos-Macroglossia-Gigantism (EMG) syndrome, Wiedemann-Beckwith syndrome, WBS	GGCTGCCGAAATC	AK026066	CCDS4412.1, CCDS4413.1	5q35	2014-09-17	2003-03-12		ENSG00000165671	ENSG00000165671		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	14234	protein-coding gene	gene with protein product		606681	"""Sotos syndrome"""	STO		9628876, 11896389	Standard	NM_022455		Approved	ARA267, FLJ22263, KMT3B	uc003mfr.4	Q96L73	OTTHUMG00000130846	ENST00000439151.2:c.5098C>T	5.37:g.176687121C>T	ENSP00000395929:p.Arg1700*	Somatic	97	0		WXS	Illumina GAIIx	Phase_I	205	28	NM_022455	0	0	3	4	1	Q96PD8|Q96RN7	Nonsense_Mutation	SNP	ENST00000439151.2	37	CCDS4412.1	.	.	.	.	.	.	.	.	.	.	C	44	10.672971	0.99447	.	.	ENSG00000165671	ENST00000354179;ENST00000439151;ENST00000347982;ENST00000361032	.	.	.	5.51	4.6	0.57074	.	0.000000	0.52532	D	0.000076	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	14.2749	0.66173	0.2826:0.7174:0.0:0.0	.	.	.	.	X	1431;1700;1431;1597	.	ENSP00000343209:R1431X	R	+	1	2	NSD1	176619727	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	1.842000	0.39250	2.752000	0.94435	0.467000	0.42956	CGA	.		0.433	NSD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253412.2	NM_172349	
RASGEF1C	255426	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	179564923	179564923	+	Nonsense_Mutation	SNP	C	C	A			TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr5:179564923C>A	ENST00000393371.2	-	1	426	c.130G>T	c.(130-132)Gaa>Taa	p.E44*	RASGEF1C_ENST00000519883.1_5'Flank|RASGEF1C_ENST00000361132.4_Nonsense_Mutation_p.E44*|RASGEF1C_ENST00000522500.1_5'Flank			Q8N431	RGF1C_HUMAN	RasGEF domain family, member 1C	44	N-terminal Ras-GEF. {ECO:0000255|PROSITE- ProRule:PRU00135}.				regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	intracellular (GO:0005622)	guanyl-nucleotide exchange factor activity (GO:0005085)			breast(1)|kidney(2)|large_intestine(3)|lung(3)|ovary(1)|prostate(1)|stomach(1)	12	all_cancers(89;3.44e-05)|all_epithelial(37;1.22e-05)|Renal(175;0.000269)|Lung NSC(126;0.00199)|all_lung(126;0.00351)|Breast(19;0.137)	all_cancers(40;0.0242)|Medulloblastoma(196;0.00498)|all_neural(177;0.0137)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			ATCAGTGTTTCCAGGGAGGCT	0.682																																					p.E44X		.											.	RASGEF1C-228	0			c.G130T						.						57.0	52.0	54.0					5																	179564923		2202	4300	6502	SO:0001587	stop_gained	255426	exon2			GTGTTTCCAGGGA	AK093160	CCDS4452.1	5q35.3	2005-08-16			ENSG00000146090	ENSG00000146090			27400	protein-coding gene	gene with protein product						12477932	Standard	XM_006714839		Approved	FLJ35841	uc003mlr.3	Q8N431	OTTHUMG00000130914	ENST00000393371.2:c.130G>T	5.37:g.179564923C>A	ENSP00000377037:p.Glu44*	Somatic	170	0		WXS	Illumina GAIIx	Phase_I	388	66	NM_175062	0	0	0	0	0	D3DWQ7|Q7Z4T0|Q8NA49	Nonsense_Mutation	SNP	ENST00000393371.2	37	CCDS4452.1	.	.	.	.	.	.	.	.	.	.	C	39	7.341534	0.98224	.	.	ENSG00000146090	ENST00000361132;ENST00000393371	.	.	.	4.44	4.44	0.53790	.	0.111023	0.64402	D	0.000013	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.51188	T	0.08	.	16.0269	0.80550	0.0:1.0:0.0:0.0	.	.	.	.	X	44	.	ENSP00000354963:E44X	E	-	1	0	RASGEF1C	179497529	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	7.031000	0.76491	2.193000	0.70182	0.511000	0.50034	GAA	.		0.682	RASGEF1C-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253506.2	NM_175062	
EHMT2	10919	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	6	31857309	31857311	+	In_Frame_Del	DEL	TCT	TCT	-	rs138941874		TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10	TCT	TCT	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr6:31857309_31857311delTCT	ENST00000375537.4	-	8	939_941	c.933_935delAGA	c.(931-936)gaagag>gag	p.311_312EE>E	EHMT2_ENST00000375530.4_In_Frame_Del_p.311_312EE>E|EHMT2_ENST00000395728.3_In_Frame_Del_p.368_369EE>E|EHMT2_ENST00000480912.1_5'UTR|EHMT2_ENST00000375528.4_In_Frame_Del_p.368_369EE>E	NM_006709.3	NP_006700.3	Q96KQ7	EHMT2_HUMAN	euchromatic histone-lysine N-methyltransferase 2	311	Poly-Glu.				DNA methylation (GO:0006306)|DNA methylation on cytosine within a CG sequence (GO:0010424)|fertilization (GO:0009566)|histone methylation (GO:0016571)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|organ growth (GO:0035265)|peptidyl-lysine dimethylation (GO:0018027)|regulation of DNA replication (GO:0006275)|spermatid development (GO:0007286)|synaptonemal complex assembly (GO:0007130)	chromosome (GO:0005694)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	C2H2 zinc finger domain binding (GO:0070742)|histone methyltransferase activity (H3-K27 specific) (GO:0046976)|histone methyltransferase activity (H3-K9 specific) (GO:0046974)|histone-lysine N-methyltransferase activity (GO:0018024)|p53 binding (GO:0002039)|protein-lysine N-methyltransferase activity (GO:0016279)|zinc ion binding (GO:0008270)			central_nervous_system(1)|cervix(2)|kidney(2)|large_intestine(3)|lung(6)|ovary(2)|prostate(4)|upper_aerodigestive_tract(1)	21						ctcctcttcctcttcttcttctt	0.493																																					p.311_312del		.											.	EHMT2-91	0			c.933_935del						.																																			SO:0001651	inframe_deletion	10919	exon8			TCTTCCTCTTCTT	AF134726	CCDS4725.1, CCDS4726.1, CCDS75425.1	6p21.3	2013-01-10	2004-03-22	2005-06-09	ENSG00000204371	ENSG00000204371	2.1.1.43	"""Chromatin-modifying enzymes / K-methyltransferases"", ""Ankyrin repeat domain containing"""	14129	protein-coding gene	gene with protein product		604599	"""chromosome 6 open reading frame 30"", ""HLA-B associated transcript 8"""	C6orf30, BAT8		8457211, 11316813	Standard	XM_005274833		Approved	G9A, Em:AF134726.3, NG36/G9a, KMT1C	uc003nxz.1	Q96KQ7	OTTHUMG00000031180	ENST00000375537.4:c.933_935delAGA	6.37:g.31857318_31857320delTCT	ENSP00000364687:p.Glu323del	Somatic	74	0		WXS	Illumina GAIIx	Phase_I	52	10	NM_025256	0	0	0	0	0	B0UZY2|Q14349|Q5JP83|Q5JQ92|Q5JQA1|Q5JQG3|Q6PK06|Q96MH5|Q96QD0|Q9UQL8|Q9Y331	In_Frame_Del	DEL	ENST00000375537.4	37	CCDS4725.1																																																																																			.		0.493	EHMT2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000076355.5	NM_006709	
TNXB	7148	hgsc.bcm.edu	37	6	32063513	32063514	+	Frame_Shift_Del	DEL	AC	AC	-	rs144556766		TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10	AC	AC	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr6:32063513_32063514delAC	ENST00000479795.1	-	3	2256_2257	c.2116_2117delGT	c.(2116-2118)gtafs	p.V706fs	TNXB_ENST00000375244.3_Frame_Shift_Del_p.V706fs|TNXB_ENST00000375247.2_Frame_Shift_Del_p.V706fs			P22105	TENX_HUMAN	tenascin XB	706	EGF-like 18. {ECO:0000255|PROSITE- ProRule:PRU00076}.				actin cytoskeleton organization (GO:0030036)|cell adhesion (GO:0007155)|cell-matrix adhesion (GO:0007160)|collagen fibril organization (GO:0030199)|collagen metabolic process (GO:0032963)|elastic fiber assembly (GO:0048251)|extracellular fibril organization (GO:0043206)|fatty acid metabolic process (GO:0006631)|regulation of JUN kinase activity (GO:0043506)|single organismal cell-cell adhesion (GO:0016337)|triglyceride metabolic process (GO:0006641)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|proteinaceous extracellular matrix (GO:0005578)	heparin binding (GO:0008201)|integrin binding (GO:0005178)			endometrium(1)|kidney(1)|large_intestine(1)|lung(4)|prostate(1)	8						GAAGCCCTCTACACACACACAC	0.668																																					p.706_706del		.											.	TNXB-90	0			c.2116_2117del						.																																			SO:0001589	frameshift_variant	7148	exon3			CCCTCTACACACA	X71923	CCDS4736.1	6p21.3	2013-02-11			ENSG00000168477	ENSG00000168477		"""Fibrinogen C domain containing"", ""Fibronectin type III domain containing"""	11976	protein-coding gene	gene with protein product		600985		TNXB1, TNXB2		8530023	Standard	NM_019105		Approved	TNXBS, XBS, XB	uc021yvf.2	P22105	OTTHUMG00000031088	ENST00000479795.1:c.2116_2117delGT	6.37:g.32063523_32063524delAC	ENSP00000418248:p.Val706fs	Somatic	284	2		WXS	Illumina GAIIx	Phase_I	424	14	NM_019105	0	0	0	0	0	P78530|P78531|Q08424|Q08AM0|Q08AM1|Q59GU7|Q5SQD3|Q5ST74|Q7L8Q4|Q8N4R1|Q9NPK9|Q9UC10|Q9UC11|Q9UC12|Q9UC13|Q9UMG7	Frame_Shift_Del	DEL	ENST00000479795.1	37																																																																																				.		0.668	TNXB-007	PUTATIVE	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000357059.1	NM_019105	
BTNL2	56244	broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	32370751	32370751	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr6:32370751C>T	ENST00000374993.1	-	3	669	c.670G>A	c.(670-672)Gtc>Atc	p.V224I	BTNL2_ENST00000540315.1_Intron|BTNL2_ENST00000374995.3_Intron|BTNL2_ENST00000454136.3_Missense_Mutation_p.V224I|BTNL2_ENST00000414363.1_Intron|BTNL2_ENST00000544175.1_Intron|BTNL2_ENST00000429232.2_Intron	NM_019602.1	NP_062548.1	Q9UIR0	BTNL2_HUMAN	butyrophilin-like 2 (MHC class II associated)	224	Ig-like V-type 2.					integral component of membrane (GO:0016021)		p.V224I(1)		central_nervous_system(3)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(5)|prostate(1)|urinary_tract(1)	19						TCAGTGAGGACGGGGTTGTGG	0.592																																					p.V224I		.											.	BTNL2-90	1	Substitution - Missense(1)	large_intestine(1)	c.G670A						.						73.0	61.0	65.0					6																	32370751		1511	2708	4219	SO:0001583	missense	56244	exon3			TGAGGACGGGGTT	AF186588		6p21.3	2014-01-14			ENSG00000204290	ENSG00000204290		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Butyrophilins"""	1142	protein-coding gene	gene with protein product		606000				10803852, 15735647	Standard	XM_006726138		Approved	HSBLMHC1, BTL-II, BTN7	uc003obg.1	Q9UIR0	OTTHUMG00000031102	ENST00000374993.1:c.670G>A	6.37:g.32370751C>T	ENSP00000364132:p.Val224Ile	Somatic	178	2		WXS	Illumina GAIIx	Phase_I	182	159	NM_019602	0	0	0	0	0	A0PJV5|B0UYW9|B0V0N6|O98261|Q08E96|Q58R22|Q58R23|Q5JYF9|Q5MP42|Q5MP43|Q5RIF8|Q5SP08|Q5SP09|Q5SRW3|Q5SRW4|Q5SU36|Q95HK0	Missense_Mutation	SNP	ENST00000374993.1	37		.	.	.	.	.	.	.	.	.	.	C	1.530	-0.544595	0.04024	.	.	ENSG00000204290	ENST00000468270;ENST00000374993	T	0.75589	-0.95	4.71	-5.73	0.02398	CD80-like, immunoglobulin C2-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	1.451450	0.04328	N	0.351912	T	0.18718	0.0449	N	0.05487	-0.04	0.09310	N	1	B	0.13145	0.007	B	0.06405	0.002	T	0.06570	-1.0819	10	0.07482	T	0.82	.	1.9694	0.03402	0.1228:0.378:0.2442:0.255	.	224	Q9UIR0	BTNL2_HUMAN	I	224	ENSP00000364132:V224I	ENSP00000364132:V224I	V	-	1	0	BTNL2	32478729	0.000000	0.05858	0.000000	0.03702	0.081000	0.17604	-2.170000	0.01268	-0.689000	0.05149	-0.172000	0.13284	GTC	.		0.592	BTNL2-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_019602	
HLA-DQB1	3119	bcgsc.ca	37	6	32628022	32628022	+	Silent	SNP	A	A	G	rs1140347	byFrequency	TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10	A	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr6:32628022A>G	ENST00000399082.3	-	3	440	c.396T>C	c.(394-396)ctT>ctC	p.L132L	HLA-DQB1_ENST00000399079.3_Silent_p.L222L|HLA-DQB1_ENST00000434651.2_Silent_p.L259L|HLA-DQB1-AS1_ENST00000419852.1_RNA|HLA-DQB1_ENST00000399084.1_Silent_p.L259L|XXbac-BPG254F23.6_ENST00000443574.1_RNA|HLA-DQB1_ENST00000460185.1_5'UTR|HLA-DQB1_ENST00000374943.4_Silent_p.L267L			P01920	DQB1_HUMAN	major histocompatibility complex, class II, DQ beta 1	0	Beta-2.|Ig-like C1-type.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|cytokine-mediated signaling pathway (GO:0019221)|humoral immune response mediated by circulating immunoglobulin (GO:0002455)|immune response (GO:0006955)|immunoglobulin production involved in immunoglobulin mediated immune response (GO:0002381)|interferon-gamma-mediated signaling pathway (GO:0060333)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)	clathrin-coated endocytic vesicle membrane (GO:0030669)|endocytic vesicle membrane (GO:0030666)|endosome (GO:0005768)|ER to Golgi transport vesicle membrane (GO:0012507)|Golgi membrane (GO:0000139)|integral component of lumenal side of endoplasmic reticulum membrane (GO:0071556)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|MHC class II protein complex (GO:0042613)|plasma membrane (GO:0005886)|trans-Golgi network membrane (GO:0032588)|transport vesicle membrane (GO:0030658)	MHC class II receptor activity (GO:0032395)|peptide antigen binding (GO:0042605)			breast(1)|large_intestine(1)|lung(1)|pancreas(1)	4					"""""""Insulin(DB00071)"""	GTCAGTGCAGAAGCCCTGGAG	0.542									T-cell Lymphoma, (Cutaneous) , Familial Clustering of;Sjgren syndrome;Melanoma, Familial Clustering of;ACTH-independent macronodular adrenal hyperplasia																												p.L267L	Esophageal Squamous(151;720 1825 15000 40336 43415)	.											.	HLA-DQB1-22	0			c.T801C						.						67.0	62.0	64.0					6																	32628022		1986	4056	6042	SO:0001819	synonymous_variant	3119	exon6	Familial Cancer Database	incl.: Mycosis Fungoides, Sezary syndrome, Adult T-cell Lymphoma;Sjogren syndrome; ;AIMAH, Cushing disease, Adrenal, Familial	GTGCAGAAGCCCT		CCDS43451.1, CCDS59006.1	6p21.3	2013-01-11			ENSG00000179344	ENSG00000179344		"""Histocompatibility complex"", ""Immunoglobulin superfamily / C1-set domain containing"""	4944	protein-coding gene	gene with protein product		604305		HLA-DQB			Standard	NM_001243962		Approved	IDDM1, CELIAC1	uc031snw.1	P01920	OTTHUMG00000031124	ENST00000399082.3:c.396T>C	6.37:g.32628022A>G		Somatic	81	1		WXS	Illumina GAIIx	Phase_I	14	5	NM_001243961	0	0	0	0	0	A1KR27|A2RPH3|A4Q9R4|A4USG2|A4USG5|A6N8I7|A9YQA0|B0S7Y7|B1A0K6|B1GXI3|B3VLT3|B5BLN7|B7VU69|C0MQ34|C0MQ35|C8ZL52|C8ZLJ8|C8ZLJ9|C9DRQ3|O19708|O19713|O19724|O62861|O78046|O78221|O78223|O98034|O98201|P01917|P01918|P01919|P03992|P05537|P79482|P79526|P79544|P79551|Q08GC8|Q09035|Q0E4V9|Q1M312|Q29731|Q29877|Q29884|Q29915|Q29966|Q2P9N3|Q2QK85|Q30061|Q30075|Q30076|Q30080|Q30081|Q30082|Q30083|Q30084|Q30089|Q30095|Q31633|Q38I47|Q45UE3|Q4QZB5|Q53I44|Q564J6|Q5G841|Q5ISH1|Q5ISH3|Q5W1E1|Q5Y7G8|Q643R4|Q6B9X1|Q70VH8|Q7YP69|Q8HWH0|Q8MH58|Q8SNB4|Q8SND1|Q8SP70|Q8WMA3|Q9BD17|Q9MYH2|Q9TPA9|Q9XRY6|Q9XRY7|Q9XRZ2	Silent	SNP	ENST00000399082.3	37																																																																																				A|0.440;G|0.560		0.542	HLA-DQB1-007	NOVEL	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000276131.1	NM_002123	
B3GALT4	8705	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	33245779	33245779	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr6:33245779C>T	ENST00000451237.1	+	1	863	c.583C>T	c.(583-585)Cgt>Tgt	p.R195C		NM_003782.3	NP_003773.1	O96024	B3GT4_HUMAN	UDP-Gal:betaGlcNAc beta 1,3-galactosyltransferase, polypeptide 4	195					protein glycosylation (GO:0006486)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	ganglioside galactosyltransferase activity (GO:0047915)|UDP-galactose:beta-N-acetylglucosamine beta-1,3-galactosyltransferase activity (GO:0008499)			breast(2)|endometrium(1)|kidney(1)|large_intestine(1)|lung(1)|ovary(2)|pancreas(1)|prostate(1)|soft_tissue(1)|urinary_tract(2)	13						GCGAGGGGGCCGTTGGGGGCA	0.577																																					p.R195C		.											.	B3GALT4-68	0			c.C583T						.						66.0	72.0	70.0					6																	33245779		2203	4300	6503	SO:0001583	missense	8705	exon1			GGGGGCCGTTGGG	Y15061	CCDS34425.1	6p21.3	2013-02-19			ENSG00000235863	ENSG00000235863		"""Beta 3-glycosyltransferases"""	919	protein-coding gene	gene with protein product		603095				9582303	Standard	NM_003782		Approved	beta3Gal-T4, GalT4	uc003odr.3	O96024	OTTHUMG00000031100	ENST00000451237.1:c.583C>T	6.37:g.33245779C>T	ENSP00000390784:p.Arg195Cys	Somatic	101	1		WXS	Illumina GAIIx	Phase_I	125	111	NM_003782	0	0	2	15	13		Missense_Mutation	SNP	ENST00000451237.1	37	CCDS34425.1	.	.	.	.	.	.	.	.	.	.	C	17.73	3.462134	0.63513	.	.	ENSG00000235863	ENST00000451237	T	0.46819	0.86	4.5	3.58	0.41010	.	.	.	.	.	T	0.30696	0.0773	L	0.43152	1.355	0.37223	D	0.905342	D	0.58620	0.983	P	0.44394	0.448	T	0.24333	-1.0163	9	0.56958	D	0.05	.	12.3514	0.55151	0.0:0.8296:0.1704:0.0	.	195	O96024	B3GT4_HUMAN	C	195	ENSP00000390784:R195C	ENSP00000390784:R195C	R	+	1	0	B3GALT4	33353757	0.036000	0.19791	0.933000	0.37362	0.899000	0.52679	1.574000	0.36482	2.338000	0.79540	0.643000	0.83706	CGT	.		0.577	B3GALT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076162.2		
DAXX	1616	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	6	33288228	33288232	+	Frame_Shift_Del	DEL	TCTTT	TCTTT	-			TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10	TCTTT	TCTTT	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr6:33288228_33288232delTCTTT	ENST00000374542.5	-	4	1380_1384	c.1176_1180delAAAGA	c.(1174-1182)aaaaagagafs	p.KR393fs	DAXX_ENST00000414083.2_Frame_Shift_Del_p.KR318fs|DAXX_ENST00000477162.1_5'UTR|DAXX_ENST00000266000.6_Frame_Shift_Del_p.KR393fs|ZBTB22_ENST00000418724.1_5'Flank|ZBTB22_ENST00000431845.2_5'Flank	NM_001141969.1|NM_001141970.1|NM_001350.4	NP_001135441.1|NP_001135442.1|NP_001341.1	Q9UER7	DAXX_HUMAN	death-domain associated protein	393	Interaction with histone H3.3.|Necessary for interaction with USP7.				activation of JUN kinase activity (GO:0007257)|androgen receptor signaling pathway (GO:0030521)|apoptotic process (GO:0006915)|chromatin remodeling (GO:0006338)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|mitotic cytokinesis (GO:0000281)|negative regulation of transcription, DNA-templated (GO:0045892)|nucleosome assembly (GO:0006334)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of neuron death (GO:1901216)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of protein phosphorylation (GO:0001934)|regulation of protein ubiquitination (GO:0031396)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	chromosome, centromeric region (GO:0000775)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|heterochromatin (GO:0000792)|nucleus (GO:0005634)|PML body (GO:0016605)|SWI/SNF superfamily-type complex (GO:0070603)	androgen receptor binding (GO:0050681)|enzyme binding (GO:0019899)|heat shock protein binding (GO:0031072)|histone binding (GO:0042393)|p53 binding (GO:0002039)|protein homodimerization activity (GO:0042803)|protein kinase activator activity (GO:0030295)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|receptor signaling protein activity (GO:0005057)|transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)|ubiquitin protein ligase binding (GO:0031625)			breast(1)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|kidney(5)|large_intestine(2)|lung(7)|ovary(3)|pancreas(18)|prostate(3)|skin(4)|upper_aerodigestive_tract(4)|urinary_tract(1)	55						CGAGCTCTTCTCTTTTTTCTCTCGC	0.546			"""Mis, F, N"""		Pancreatic neuroendocrine tumors. Paediatric GBM																																p.404_406del		.		Rec	yes		6	6p21.3	1616	death-domain associated protein		E	.	DAXX-731	0			c.1212_1216del						.																																			SO:0001589	frameshift_variant	1616	exon4			CTCTTCTCTTTTT	AF006041	CCDS4776.1, CCDS59008.1	6p21.3	2008-08-29	2008-08-29			ENSG00000204209			2681	protein-coding gene	gene with protein product		603186	"""death-associated protein 6"""			9407001, 9215629	Standard	NM_001141970		Approved	DAP6	uc011dre.2	Q9UER7		ENST00000374542.5:c.1176_1180delAAAGA	6.37:g.33288228_33288232delTCTTT	ENSP00000363668:p.Lys393fs	Somatic	62	0		WXS	Illumina GAIIx	Phase_I	48	41	NM_001141970	0	0	0	0	0	B4E1I3|F5H082|O14747|O15141|O15208|Q5STK9|Q9BWI3	Frame_Shift_Del	DEL	ENST00000374542.5	37	CCDS4776.1																																																																																			.		0.546	DAXX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076403.1		
KLHL31	401265	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	53519456	53519456	+	Silent	SNP	C	C	A	rs114605120	byFrequency	TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr6:53519456C>A	ENST00000407079.1	-	1	614	c.615G>T	c.(613-615)tcG>tcT	p.S205S	KLHL31_ENST00000370905.3_Silent_p.S205S			Q9H511	KLH31_HUMAN	kelch-like family member 31	205	BACK.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)					autonomic_ganglia(1)|endometrium(3)|kidney(3)|large_intestine(2)|lung(7)|ovary(1)|prostate(3)	20	Lung NSC(77;0.0158)					TAAACTGATCCGATTCTGCAA	0.343																																					p.S205S		.											.	KLHL31-23	0			c.G615T						.						80.0	81.0	81.0					6																	53519456		2203	4300	6503	SO:0001819	synonymous_variant	401265	exon2			CTGATCCGATTCT		CCDS34478.1	6p12.1	2013-09-27	2013-02-22	2007-01-09	ENSG00000124743	ENSG00000124743		"""Kelch-like"", ""BTB/POZ domain containing"""	21353	protein-coding gene	gene with protein product		610749	"""kelch repeat and BTB (POZ) domain containing 1"", ""kelch-like 31 (Drosophila)"""	KBTBD1			Standard	NM_001003760		Approved	bA345L23.2, BKLHD6	uc003pcb.4	Q9H511	OTTHUMG00000014882	ENST00000407079.1:c.615G>T	6.37:g.53519456C>A		Somatic	71	0		WXS	Illumina GAIIx	Phase_I	56	48	NM_001003760	0	0	0	0	0	A6N9J2|B2RP49	Silent	SNP	ENST00000407079.1	37	CCDS34478.1																																																																																			C|0.999;T|0.001		0.343	KLHL31-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040965.1	NM_001003760	
FAXC	84553	broad.mit.edu;bcgsc.ca	37	6	99771340	99771340	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr6:99771340C>T	ENST00000389677.5	-	4	1085	c.803G>A	c.(802-804)cGg>cAg	p.R268Q	FAXC_ENST00000538471.1_Intron	NM_032511.2	NP_115900.1	Q5TGI0	FAXC_HUMAN	failed axon connections homolog (Drosophila)	268						integral component of membrane (GO:0016021)											TGCTAAAGACCGCATGTCCTT	0.438																																					p.R268Q		.											.	.	0			c.G803A						.						62.0	47.0	53.0					6																	99771340		2203	4300	6503	SO:0001583	missense	84553	exon4			AAAGACCGCATGT	BC011583	CCDS34500.1	6q16.3	2012-02-07	2012-02-07	2012-02-07	ENSG00000146267	ENSG00000146267			20742	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 168"""	C6orf168		12477932	Standard	NM_032511		Approved	MGC2817, dJ273F20	uc003ppj.4	Q5TGI0	OTTHUMG00000015261	ENST00000389677.5:c.803G>A	6.37:g.99771340C>T	ENSP00000374328:p.Arg268Gln	Somatic	110	2		WXS	Illumina GAIIx	Phase_I	88	81	NM_032511	0	0	0	0	0	B3KU39|Q96F61|Q96LU3|Q9BR58|Q9BSS2	Missense_Mutation	SNP	ENST00000389677.5	37	CCDS34500.1	.	.	.	.	.	.	.	.	.	.	C	25.6	4.656083	0.88056	.	.	ENSG00000146267	ENST00000389677	T	0.46451	0.87	5.6	5.6	0.85130	Glutathione S-transferase, C-terminal-like (1);	0.000000	0.85682	D	0.000000	T	0.30479	0.0766	M	0.63843	1.955	0.80722	D	1	P	0.47841	0.901	B	0.36959	0.237	T	0.20273	-1.0280	10	0.38643	T	0.18	-1.9264	19.6104	0.95604	0.0:1.0:0.0:0.0	.	268	Q5TGI0	CF168_HUMAN	Q	268	ENSP00000374328:R268Q	ENSP00000374328:R268Q	R	-	2	0	C6orf168	99878061	1.000000	0.71417	1.000000	0.80357	0.942000	0.58702	7.288000	0.78691	2.634000	0.89283	0.650000	0.86243	CGG	.		0.438	FAXC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041589.4	NM_032511	
MARCKS	4082	broad.mit.edu	37	6	114181210	114181210	+	Frame_Shift_Del	DEL	A	A	-			TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr6:114181210delA	ENST00000368635.4	+	2	835	c.454delA	c.(454-456)aaafs	p.K156fs		NM_002356.5	NP_002347.5	P29966	MARCS_HUMAN	myristoylated alanine-rich protein kinase C substrate	156	Calmodulin-binding (PSD).				energy reserve metabolic process (GO:0006112)|regulation of insulin secretion (GO:0050796)|small molecule metabolic process (GO:0044281)	actin cytoskeleton (GO:0015629)|cell cortex (GO:0005938)|centrosome (GO:0005813)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|germinal vesicle (GO:0042585)|plasma membrane (GO:0005886)	actin filament binding (GO:0051015)|calmodulin binding (GO:0005516)	p.K155fs*12(1)		breast(1)|kidney(1)|large_intestine(1)|lung(1)	4		all_cancers(87;7.65e-05)|all_epithelial(87;0.000296)|all_hematologic(75;0.0172)|Colorectal(196;0.0317)|all_lung(197;0.198)		Epithelial(106;1.59e-07)|all cancers(137;9.85e-07)|OV - Ovarian serous cystadenocarcinoma(136;0.000322)		CGAGACCCCGAAAAAAAAAAA	0.612																																					p.K152fs		.											.	MARCKS-90	1	Deletion - Frameshift(1)	large_intestine(1)	c.454delA						.						9.0	11.0	10.0					6																	114181210		1892	3986	5878	SO:0001589	frameshift_variant	4082	exon2			ACCCCGAAAAAAA	M68956	CCDS5101.1	6q21	2014-04-10	2001-12-17	2001-12-20	ENSG00000155130	ENSG00000277443			6759	protein-coding gene	gene with protein product		177061	"""myristoylated alanine-rich protein kinase C substrate (MARCKS, 80K-L)"""	MACS		1560845, 8420923	Standard	NM_002356		Approved	PKCSL, 80K-L	uc003pvy.4	P29966	OTTHUMG00000188327	ENST00000368635.4:c.454delA	6.37:g.114181210delA	ENSP00000357624:p.Lys156fs	Somatic	6	0		WXS	Illumina GAIIx	Phase_I	7	6	NM_002356	0	0	0	0	0	E1P560|Q2LA83|Q5TDB7	Frame_Shift_Del	DEL	ENST00000368635.4	37	CCDS5101.1																																																																																			.		0.612	MARCKS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041903.1	NM_002356	
SYNE1	23345	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	152751308	152751308	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr6:152751308G>A	ENST00000367255.5	-	36	5328	c.4727C>T	c.(4726-4728)gCt>gTt	p.A1576V	SYNE1_ENST00000448038.1_Missense_Mutation_p.A1583V|SYNE1_ENST00000341594.5_Missense_Mutation_p.A1646V|SYNE1_ENST00000367253.4_Missense_Mutation_p.A1576V|SYNE1_ENST00000265368.4_Missense_Mutation_p.A1576V|SYNE1_ENST00000423061.1_Missense_Mutation_p.A1583V	NM_182961.3	NP_892006.3	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1	1576					cell death (GO:0008219)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment of nucleus localization (GO:0040023)|Golgi organization (GO:0007030)|muscle cell differentiation (GO:0042692)|nuclear matrix anchoring at nuclear membrane (GO:0090292)|nucleus organization (GO:0006997)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)|sarcomere (GO:0030017)|SUN-KASH complex (GO:0034993)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|lamin binding (GO:0005521)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)			NS(3)|biliary_tract(1)|breast(17)|central_nervous_system(21)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(4)|kidney(16)|large_intestine(138)|liver(1)|lung(190)|ovary(11)|pancreas(5)|prostate(12)|skin(20)|stomach(3)|upper_aerodigestive_tract(33)|urinary_tract(19)	524		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		AATTGGAACAGCAAGTTTATC	0.303										HNSCC(10;0.0054)																											p.A1583V		.											.	SYNE1-607	0			c.C4748T						.						56.0	53.0	54.0					6																	152751308		2201	4291	6492	SO:0001583	missense	23345	exon36			GGAACAGCAAGTT	AB018339	CCDS5235.1, CCDS5236.1, CCDS5236.2	6q24.2-q25.3	2014-09-17			ENSG00000131018	ENSG00000131018			17089	protein-coding gene	gene with protein product	"""myocyte nuclear envelope protein 1"", ""nuclear envelope spectrin repeat-1"""	608441	"""chromosome 6 open reading frame 98"""	C6orf98		9872452, 10878022	Standard	NM_182961		Approved	SYNE-1B, KIAA0796, 8B, Nesprin-1, enaptin, MYNE1, CPG2, dJ45H2.2, SCAR8, ARCA1, Nesp1	uc003qou.4	Q8NF91	OTTHUMG00000015841	ENST00000367255.5:c.4727C>T	6.37:g.152751308G>A	ENSP00000356224:p.Ala1576Val	Somatic	137	0		WXS	Illumina GAIIx	Phase_I	119	109	NM_033071	0	0	0	0	0	E7EQI5|O94890|Q5JV19|Q5JV22|Q8N9P7|Q8TCP1|Q8WWW6|Q8WWW7|Q8WXF6|Q96N17|Q9C0A7|Q9H525|Q9H526|Q9NS36|Q9NU50|Q9UJ06|Q9UJ07|Q9ULF8	Missense_Mutation	SNP	ENST00000367255.5	37	CCDS5236.2	.	.	.	.	.	.	.	.	.	.	G	13.28	2.189210	0.38707	.	.	ENSG00000131018	ENST00000367255;ENST00000423061;ENST00000265368;ENST00000448038;ENST00000341594;ENST00000367253	T;T;T;T;T;T	0.53857	0.6;0.6;0.6;0.6;0.6;0.6	5.97	2.87	0.33458	.	0.638247	0.14715	N	0.302686	T	0.24774	0.0601	L	0.43152	1.355	0.80722	D	1	P;B;P;B;B	0.45827	0.791;0.222;0.867;0.222;0.33	B;B;B;B;B	0.35971	0.154;0.058;0.215;0.058;0.124	T	0.04360	-1.0957	10	0.30854	T	0.27	.	12.563	0.56293	0.0:0.0995:0.633:0.2675	.	1559;1576;1576;1576;1583	B3W695;Q8NF91;Q8NF91-6;E7EQI5;Q8NF91-4	.;SYNE1_HUMAN;.;.;.	V	1576;1583;1576;1583;1646;1576	ENSP00000356224:A1576V;ENSP00000396024:A1583V;ENSP00000265368:A1576V;ENSP00000390975:A1583V;ENSP00000341887:A1646V;ENSP00000356222:A1576V	ENSP00000265368:A1576V	A	-	2	0	SYNE1	152793001	0.767000	0.28508	1.000000	0.80357	0.997000	0.91878	0.475000	0.22164	0.811000	0.34303	0.650000	0.86243	GCT	.		0.303	SYNE1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000334755.2	NM_182961	
PMS2	5395	broad.mit.edu;bcgsc.ca	37	7	6026767	6026767	+	Silent	SNP	G	G	A	rs111673299		TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr7:6026767G>A	ENST00000265849.7	-	11	1734	c.1629C>T	c.(1627-1629)gaC>gaT	p.D543D	PMS2_ENST00000441476.2_Silent_p.D437D|PMS2_ENST00000382321.4_Intron|PMS2_ENST00000469652.1_Intron|PMS2_ENST00000406569.3_Silent_p.D543D	NM_000535.5	NP_000526	P54278	PMS2_HUMAN	PMS2 postmeiotic segregation increased 2 (S. cerevisiae)	543					ATP catabolic process (GO:0006200)|mismatch repair (GO:0006298)|response to drug (GO:0042493)|somatic hypermutation of immunoglobulin genes (GO:0016446)|somatic recombination of immunoglobulin gene segments (GO:0016447)	cytoplasm (GO:0005737)|microtubule cytoskeleton (GO:0015630)|MutLalpha complex (GO:0032389)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|DNA binding (GO:0003677)|endonuclease activity (GO:0004519)|single base insertion or deletion binding (GO:0032138)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(6)|kidney(2)|large_intestine(11)|lung(13)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	46		Ovarian(82;0.0694)		UCEC - Uterine corpus endometrioid carcinoma (126;0.101)|OV - Ovarian serous cystadenocarcinoma(56;4.39e-15)		AAAAAGAGTCGTCAGTTTTAG	0.527			"""Mis, N, F"""			"""colorectal, endometrial, ovarian, medulloblastoma, glioma"""		Direct reversal of damage;Mismatch excision repair (MMR)	Turcot syndrome;Lynch syndrome;Constitutional Mismatch Repair Deficiency Syndrome																												p.D543D		.	yes	Rec		"""Hereditary non-polyposis colorectal cancer, Turcot syndrome"""	7	7p22	5395	PMS2 postmeiotic segregation increased 2 (S. cerevisiae)		E	.	PMS2-1083	0			c.C1629T						.						94.0	101.0	99.0					7																	6026767		2203	4299	6502	SO:0001819	synonymous_variant	5395	exon11	Familial Cancer Database	Brain tumor-colorectal polyp(osis) syndrome;Hereditary Non-Polyposis Colorectal Cancer, HNPCC, Lynch syndromes 1 and 2 (= Cancer Family Syndrome), Hereditary Mismatch Repair Deficiency syndrome, HMRDS;Mismatch Repair Cancer syndrome, MMRCS, Childhood Cancer Syndrome, CCS, Biallelic Mismatch Repair Gene Mutations Associated Early Onset Cancer, Lynch syndrome type III	AGAGTCGTCAGTT		CCDS5343.1	7p22.1	2014-09-17	2001-11-28		ENSG00000122512	ENSG00000122512			9122	protein-coding gene	gene with protein product		600259	"""postmeiotic segregation increased (S. cerevisiae) 2"""	PMSL2		8072530	Standard	NM_000535		Approved	H_DJ0042M02.9, HNPCC4	uc003spl.3	P54278	OTTHUMG00000023135	ENST00000265849.7:c.1629C>T	7.37:g.6026767G>A		Somatic	69	2		WXS	Illumina GAIIx	Phase_I	161	74	NM_000535	0	0	0	3	3	B2R610|Q52LH6|Q5FBW9|Q5FBX1|Q5FBX2|Q75MR2	Silent	SNP	ENST00000265849.7	37	CCDS5343.1																																																																																			A|1.000;|0.000		0.527	PMS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207353.3	NM_000535	
TMEM196	256130	hgsc.bcm.edu;broad.mit.edu	37	7	19769017	19769017	+	Frame_Shift_Del	DEL	T	T	-			TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr7:19769017delT	ENST00000405764.3	-	2	888	c.192delA	c.(190-192)aaafs	p.K64fs	TMEM196_ENST00000493519.1_5'UTR|TMEM196_ENST00000422233.1_5'UTR|TMEM196_ENST00000433641.1_5'UTR|TMEM196_ENST00000405844.1_Frame_Shift_Del_p.K64fs	NM_152774.3	NP_689987.3	Q5HYL7	TM196_HUMAN	transmembrane protein 196	70						integral component of membrane (GO:0016021)				breast(1)|large_intestine(1)|lung(4)	6						CAAGTCCTGATTTTTTTTTGG	0.353																																					p.K64fs		.											.	TMEM196-22	0			c.192delA						.			11,11,1946		3,0,5,4,3,969	161.0	137.0	144.0			5.4	1.0	7		148	5,6,4003		0,0,5,0,6,1996	no	codingComplex	TMEM196	NM_152774.3		3,0,10,4,9,2965	A1A1,A1A2,A1R,A2A2,A2R,RR		0.274,1.1179,0.5517			19769017	16,17,5949	692	1591	2283	SO:0001589	frameshift_variant	256130	exon2			TCCTGATTTTTTT		CCDS34607.2	7p15.3	2007-11-21			ENSG00000173452	ENSG00000173452			22431	protein-coding gene	gene with protein product							Standard	NM_152774		Approved	MGC42090	uc011jyg.2	Q5HYL7	OTTHUMG00000152504	ENST00000405764.3:c.192delA	7.37:g.19769017delT	ENSP00000384234:p.Lys64fs	Somatic	42	0		WXS	Illumina GAIIx	Phase_I	94	40	NM_152774	0	0	0	0	0	Q8N6I6	Frame_Shift_Del	DEL	ENST00000405764.3	37	CCDS34607.2																																																																																			.		0.353	TMEM196-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000326499.1	NM_152774	
TNS3	64759	hgsc.bcm.edu;bcgsc.ca	37	7	47385878	47385878	+	Frame_Shift_Del	DEL	C	C	-			TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr7:47385878delC	ENST00000398879.1	-	18	2724	c.2358delG	c.(2356-2358)gggfs	p.G786fs	TNS3_ENST00000355730.3_Frame_Shift_Del_p.G546fs|TNS3_ENST00000311160.9_Frame_Shift_Del_p.G786fs			Q68CZ2	TENS3_HUMAN	tensin 3	786					cell migration (GO:0016477)|lung alveolus development (GO:0048286)|positive regulation of cell proliferation (GO:0008284)	cytoplasm (GO:0005737)|focal adhesion (GO:0005925)				NS(1)|autonomic_ganglia(1)|breast(17)|endometrium(5)|kidney(4)|large_intestine(7)|liver(1)|lung(16)|ovary(4)|prostate(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	64						AGGGCAGCTGCCCCCCAGCAT	0.602																																					p.G786fs		.											.	TNS3-94	0			c.2358delG						.						69.0	73.0	71.0					7																	47385878		1996	4159	6155	SO:0001589	frameshift_variant	64759	exon18			CAGCTGCCCCCCA	AF378756	CCDS5506.2	7p12.3	2013-02-14	2005-05-13	2005-05-13	ENSG00000136205	ENSG00000136205		"""SH2 domain containing"""	21616	protein-coding gene	gene with protein product	"""tumor endothelial marker 6"""	606825	"""tensin-like SH2 domain-containing 1"""	TENS1		11559528	Standard	NM_022748		Approved	TEM6, H_NH0549I23.2, FLJ13732	uc003tnw.3	Q68CZ2	OTTHUMG00000074075	ENST00000398879.1:c.2358delG	7.37:g.47385878delC	ENSP00000381854:p.Gly786fs	Somatic	72	1		WXS	Illumina GAIIx	Phase_I	169	82	NM_022748	0	0	0	0	0	B2RNV1|Q6IPQ2|Q8IZW7|Q8NAD0|Q96PE0|Q96S48	Frame_Shift_Del	DEL	ENST00000398879.1	37	CCDS5506.2																																																																																			.		0.602	TNS3-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000157253.1	NM_022748	
ABCA13	154664	bcgsc.ca;mdanderson.org	37	7	48311657	48311657	+	Silent	SNP	C	C	T			TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr7:48311657C>T	ENST00000435803.1	+	17	2418	c.2394C>T	c.(2392-2394)aaC>aaT	p.N798N		NM_152701.3	NP_689914.2	Q86UQ4	ABCAD_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 13	798					transport (GO:0006810)	integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)	p.N798N(1)|p.N743N(1)		breast(13)|central_nervous_system(8)|endometrium(25)|haematopoietic_and_lymphoid_tissue(4)|kidney(20)|large_intestine(51)|lung(100)|ovary(5)|pancreas(2)|prostate(22)|skin(10)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(4)	270						AATTTGGCAACGAAGTGATTT	0.343																																					p.N798N		.											.	ABCA13-521	2	Substitution - coding silent(2)	kidney(2)	c.C2394T						.						42.0	41.0	41.0					7																	48311657		1841	4100	5941	SO:0001819	synonymous_variant	154664	exon17			TGGCAACGAAGTG	AY204751	CCDS47584.1	7p12.3	2012-03-14			ENSG00000179869	ENSG00000179869		"""ATP binding cassette transporters / subfamily A"""	14638	protein-coding gene	gene with protein product		607807				12697998	Standard	NM_152701		Approved	FLJ33876, FLJ33951	uc003toq.2	Q86UQ4	OTTHUMG00000155840	ENST00000435803.1:c.2394C>T	7.37:g.48311657C>T		Somatic	27	1		WXS	Illumina GAIIx	Phase_I	103	43	NM_152701	0	0	0	0	0	K9LC76|K9LC79|K9LCX7|K9LDK8|K9LDY4|Q6ZTT7|Q86WI2|Q8N248	Silent	SNP	ENST00000435803.1	37	CCDS47584.1																																																																																			.		0.343	ABCA13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341964.2	NM_152701	
ZPBP	11055	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	50129273	50129273	+	Missense_Mutation	SNP	G	G	A	rs200921057		TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr7:50129273G>A	ENST00000046087.2	-	2	229	c.160C>T	c.(160-162)Cgc>Tgc	p.R54C	ZPBP_ENST00000419417.1_Missense_Mutation_p.R54C	NM_001159878.1|NM_007009.2	NP_001153350.1|NP_008940.2	Q9BS86	ZPBP1_HUMAN	zona pellucida binding protein	54					acrosome assembly (GO:0001675)|binding of sperm to zona pellucida (GO:0007339)	acrosomal vesicle (GO:0001669)|cell body (GO:0044297)|extracellular region (GO:0005576)|nucleus (GO:0005634)|zona pellucida receptor complex (GO:0002199)		p.R54C(1)		NS(1)|breast(1)|endometrium(3)|kidney(1)|large_intestine(3)|lung(17)|prostate(3)	29	Glioma(55;0.08)|all_neural(89;0.245)					TTGGTCAAGCGAAAAGCTCTT	0.274																																					p.R54C		.											.	ZPBP-90	1	Substitution - Missense(1)	NS(1)	c.C160T						.						34.0	35.0	35.0					7																	50129273		2203	4298	6501	SO:0001583	missense	11055	exon2			TCAAGCGAAAAGC	D17570	CCDS5509.1, CCDS55110.1	7p14.3	2013-01-11			ENSG00000042813	ENSG00000042813		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	15662	protein-coding gene	gene with protein product		608498				9378618	Standard	NM_007009		Approved	SP38, ZPBP1	uc003tou.3	Q9BS86	OTTHUMG00000023528	ENST00000046087.2:c.160C>T	7.37:g.50129273G>A	ENSP00000046087:p.Arg54Cys	Somatic	122	0		WXS	Illumina GAIIx	Phase_I	202	86	NM_007009	0	0	0	0	0	A4D253|C9JPU1|Q15941|Q75KX9|Q75MI3	Missense_Mutation	SNP	ENST00000046087.2	37	CCDS5509.1	.	.	.	.	.	.	.	.	.	.	G	14.48	2.547047	0.45383	.	.	ENSG00000042813	ENST00000046087;ENST00000419417;ENST00000450231	T;T;T	0.53206	0.63;0.63;1.42	5.23	-0.0983	0.13629	Immunoglobulin-like (1);	1.292310	0.05140	N	0.494132	T	0.39279	0.1072	L	0.47716	1.5	0.09310	N	1	D;D	0.67145	0.996;0.996	B;B	0.43575	0.424;0.424	T	0.34750	-0.9816	9	.	.	.	-0.0431	3.1129	0.06365	0.0878:0.1448:0.3225:0.4449	.	54;54	C9JPU1;Q9BS86	.;ZPBP1_HUMAN	C	54;54;15	ENSP00000046087:R54C;ENSP00000402071:R54C;ENSP00000390054:R15C	.	R	-	1	0	ZPBP	50099819	0.000000	0.05858	0.003000	0.11579	0.878000	0.50629	0.297000	0.19101	0.284000	0.22305	0.557000	0.71058	CGC	G|0.999;T|0.001		0.274	ZPBP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000251374.1	NM_007009	
GTF2IRD1	9569	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	7	73944069	73944069	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr7:73944069G>A	ENST00000265755.3	+	9	1489	c.1096G>A	c.(1096-1098)Gcc>Acc	p.A366T	GTF2IRD1_ENST00000424337.2_Missense_Mutation_p.A366T|GTF2IRD1_ENST00000476977.1_Missense_Mutation_p.A366T|GTF2IRD1_ENST00000489094.1_3'UTR|GTF2IRD1_ENST00000455841.2_Missense_Mutation_p.A398T	NM_005685.3|NM_016328.2	NP_005676.3|NP_057412.1	Q9UHL9	GT2D1_HUMAN	GTF2I repeat domain containing 1	366					multicellular organismal development (GO:0007275)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)|transition between slow and fast fiber (GO:0014886)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(9)|lung(19)|ovary(6)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	49						TCCAGCGGAAGCCCTGGGCCT	0.627																																					p.A398T		.											.	GTF2IRD1-94	0			c.G1192A						.						67.0	55.0	59.0					7																	73944069		2203	4300	6503	SO:0001583	missense	9569	exon9			GCGGAAGCCCTGG	AF151354	CCDS5571.1, CCDS47613.1, CCDS56492.1	7q11.23	2008-04-18	2002-01-14		ENSG00000006704	ENSG00000006704			4661	protein-coding gene	gene with protein product	"""binding factor for early enhancer"""	604318	"""GTF2I repeat domain-containing 1"""	WBSCR11		9774679, 10198167	Standard	NM_016328		Approved	MusTRD1, RBAP2, GTF3, WBSCR12, BEN, Cream1	uc010lbq.3	Q9UHL9	OTTHUMG00000023782	ENST00000265755.3:c.1096G>A	7.37:g.73944069G>A	ENSP00000265755:p.Ala366Thr	Somatic	50	0		WXS	Illumina GAIIx	Phase_I	112	24	NM_001199207	0	0	0	0	0	O95444|Q6DSU6|Q75MX7|Q86UM3|Q8WVC4|Q9UHK8|Q9UI91	Missense_Mutation	SNP	ENST00000265755.3	37	CCDS5571.1	.	.	.	.	.	.	.	.	.	.	g	33	5.240314	0.95240	.	.	ENSG00000006704	ENST00000265755;ENST00000455841;ENST00000424337;ENST00000476977	T;T;T;T	0.69040	-0.37;-0.37;-0.37;-0.37	4.46	4.46	0.54185	.	0.000000	0.85682	D	0.000000	D	0.82403	0.5029	M	0.81802	2.56	0.80722	D	1	D;P;D;D	0.89917	1.0;0.944;0.993;0.989	D;P;D;P	0.91635	0.999;0.724;0.954;0.849	D	0.85698	0.1311	10	0.87932	D	0	-25.1016	16.4644	0.84074	0.0:0.0:1.0:0.0	.	398;366;366;366	Q6DSU6;E9PFE2;Q9UHL9;Q9UHL9-2	.;.;GT2D1_HUMAN;.	T	366;398;366;366	ENSP00000265755:A366T;ENSP00000397566:A398T;ENSP00000408477:A366T;ENSP00000418383:A366T	ENSP00000265755:A366T	A	+	1	0	GTF2IRD1	73582005	1.000000	0.71417	1.000000	0.80357	0.967000	0.64934	9.080000	0.94040	2.214000	0.71695	0.457000	0.33378	GCC	.		0.627	GTF2IRD1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000252654.2	NM_016328	
DTX2	113878	broad.mit.edu	37	7	76112242	76112242	+	Frame_Shift_Del	DEL	A	A	-			TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr7:76112242delA	ENST00000324432.5	+	5	1196	c.686delA	c.(685-687)cacfs	p.H229fs	DTX2_ENST00000446600.1_Frame_Shift_Del_p.H138fs|DTX2_ENST00000446820.2_Frame_Shift_Del_p.H229fs|DTX2_ENST00000413936.2_Frame_Shift_Del_p.H229fs|DTX2_ENST00000430490.2_Frame_Shift_Del_p.H229fs|DTX2_ENST00000307569.8_Frame_Shift_Del_p.H229fs	NM_020892.2	NP_065943.2	Q86UW9	DTX2_HUMAN	deltex 2, E3 ubiquitin ligase	229					Notch signaling pathway (GO:0007219)|protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)	ligase activity (GO:0016874)|zinc ion binding (GO:0008270)			NS(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(14)|ovary(1)|skin(1)|stomach(2)	27						GTCCCCCAGCACCCCCCACAC	0.652																																					p.H229fs		.											.	DTX2-524	0			c.686delA						.						127.0	131.0	129.0					7																	76112242		2203	4300	6503	SO:0001589	frameshift_variant	113878	exon2			CCCAGCACCCCCC		CCDS5587.1, CCDS43605.1	7q11.23	2014-01-28	2014-01-28		ENSG00000091073	ENSG00000091073		"""RING-type (C3HC4) zinc fingers"""	15973	protein-coding gene	gene with protein product		613141	"""deltex (Drosophila) homolog 2"", ""deltex homolog 2 (Drosophila)"""			12670957	Standard	NM_020892		Approved	RNF58, KIAA1528	uc003ufh.4	Q86UW9	OTTHUMG00000162594	ENST00000324432.5:c.686delA	7.37:g.76112242delA	ENSP00000322885:p.His229fs	Somatic	496	0		WXS	Illumina GAIIx	Phase_I	1156	9	NM_001102596	0	0	0	0	0	Q6XM87|Q6XM88|Q96H69|Q9H890|Q9P200	Frame_Shift_Del	DEL	ENST00000324432.5	37	CCDS5587.1																																																																																			.		0.652	DTX2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000253104.2		
DTX2	113878	hgsc.bcm.edu	37	7	76112249	76112249	+	Frame_Shift_Del	DEL	A	A	-	rs147779783	byFrequency	TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr7:76112249delA	ENST00000324432.5	+	5	1203	c.693delA	c.(691-693)ccafs	p.P231fs	DTX2_ENST00000446600.1_Frame_Shift_Del_p.P140fs|DTX2_ENST00000446820.2_Frame_Shift_Del_p.P231fs|DTX2_ENST00000413936.2_Frame_Shift_Del_p.P231fs|DTX2_ENST00000430490.2_Frame_Shift_Del_p.P231fs|DTX2_ENST00000307569.8_Frame_Shift_Del_p.P231fs	NM_020892.2	NP_065943.2	Q86UW9	DTX2_HUMAN	deltex 2, E3 ubiquitin ligase	231					Notch signaling pathway (GO:0007219)|protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)	ligase activity (GO:0016874)|zinc ion binding (GO:0008270)			NS(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(14)|ovary(1)|skin(1)|stomach(2)	27						AGCACCCCCCACACAGGACCG	0.657																																					p.P231fs		.											.	DTX2-524	0			c.693delA						.						125.0	130.0	128.0					7																	76112249		2203	4300	6503	SO:0001589	frameshift_variant	113878	exon2			CCCCCCACACAGG		CCDS5587.1, CCDS43605.1	7q11.23	2014-01-28	2014-01-28		ENSG00000091073	ENSG00000091073		"""RING-type (C3HC4) zinc fingers"""	15973	protein-coding gene	gene with protein product		613141	"""deltex (Drosophila) homolog 2"", ""deltex homolog 2 (Drosophila)"""			12670957	Standard	NM_020892		Approved	RNF58, KIAA1528	uc003ufh.4	Q86UW9	OTTHUMG00000162594	ENST00000324432.5:c.693delA	7.37:g.76112249delA	ENSP00000322885:p.Pro231fs	Somatic	501	2		WXS	Illumina GAIIx	Phase_I	1177	243	NM_001102596	0	0	0	0	0	Q6XM87|Q6XM88|Q96H69|Q9H890|Q9P200	Frame_Shift_Del	DEL	ENST00000324432.5	37	CCDS5587.1																																																																																			.		0.657	DTX2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000253104.2		
TMEM60	85025	hgsc.bcm.edu;broad.mit.edu	37	7	77423460	77423460	+	Frame_Shift_Del	DEL	T	T	-			TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr7:77423460delT	ENST00000257663.3	-	2	607	c.231delA	c.(229-231)aaafs	p.K77fs		NM_032936.3	NP_116325.1	Q9H2L4	TMM60_HUMAN	transmembrane protein 60	77						integral component of membrane (GO:0016021)				endometrium(1)|large_intestine(1)|lung(2)	4						GGTACCAGGCTTTTTTTTTAA	0.408																																					p.K77fs		.											.	TMEM60-90	0			c.231delA						.						142.0	141.0	141.0					7																	77423460		2203	4300	6503	SO:0001589	frameshift_variant	85025	exon2			CCAGGCTTTTTTT	AF260336	CCDS5593.1	7q11.23	2005-07-25	2005-07-25	2005-07-25	ENSG00000135211	ENSG00000135211			21754	protein-coding gene	gene with protein product			"""chromosome 7 open reading frame 35"""	C7orf35			Standard	NM_032936		Approved	DC32	uc003ugn.3	Q9H2L4	OTTHUMG00000130689	ENST00000257663.3:c.231delA	7.37:g.77423460delT	ENSP00000257663:p.Lys77fs	Somatic	61	0		WXS	Illumina GAIIx	Phase_I	127	51	NM_032936	0	0	0	0	0	A4D1C3|Q86UM0	Frame_Shift_Del	DEL	ENST00000257663.3	37	CCDS5593.1																																																																																			.		0.408	TMEM60-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253185.2	NM_032936	
ACHE	43	hgsc.bcm.edu	37	7	100491127	100491127	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr7:100491127G>A	ENST00000412389.1	-	1	882	c.727C>T	c.(727-729)Cac>Tac	p.H243Y	ACHE_ENST00000302913.4_Missense_Mutation_p.H243Y|ACHE_ENST00000497647.1_5'Flank|ACHE_ENST00000411582.1_Missense_Mutation_p.H243Y|ACHE_ENST00000419336.2_Missense_Mutation_p.H243Y|ACHE_ENST00000428317.1_Missense_Mutation_p.H243Y|ACHE_ENST00000241069.5_Missense_Mutation_p.H243Y			P22303	ACES_HUMAN	acetylcholinesterase (Yt blood group)	243					acetylcholine catabolic process (GO:0006581)|acetylcholine catabolic process in synaptic cleft (GO:0001507)|amyloid precursor protein metabolic process (GO:0042982)|cell adhesion (GO:0007155)|cell proliferation (GO:0008283)|choline metabolic process (GO:0019695)|DNA replication (GO:0006260)|glycerophospholipid biosynthetic process (GO:0046474)|muscle organ development (GO:0007517)|negative regulation of synaptic transmission, cholinergic (GO:0032223)|nervous system development (GO:0007399)|neurotransmitter biosynthetic process (GO:0042136)|neurotransmitter receptor biosynthetic process (GO:0045212)|osteoblast development (GO:0002076)|phosphatidylcholine biosynthetic process (GO:0006656)|phospholipid metabolic process (GO:0006644)|positive regulation of protein secretion (GO:0050714)|protein tetramerization (GO:0051262)|receptor internalization (GO:0031623)|regulation of axonogenesis (GO:0050770)|regulation of dendrite morphogenesis (GO:0048814)|regulation of receptor recycling (GO:0001919)|response to wounding (GO:0009611)|retina development in camera-type eye (GO:0060041)|small molecule metabolic process (GO:0044281)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)|synaptic transmission, cholinergic (GO:0007271)	anchored component of membrane (GO:0031225)|axon (GO:0030424)|basal lamina (GO:0005605)|cell junction (GO:0030054)|cell surface (GO:0009986)|dendrite (GO:0030425)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|neuromuscular junction (GO:0031594)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)|synapse (GO:0045202)	acetylcholine binding (GO:0042166)|acetylcholinesterase activity (GO:0003990)|beta-amyloid binding (GO:0001540)|cholinesterase activity (GO:0004104)|collagen binding (GO:0005518)|hydrolase activity (GO:0016787)|laminin binding (GO:0043236)|protein homodimerization activity (GO:0042803)|serine hydrolase activity (GO:0017171)			large_intestine(3)|lung(7)|skin(3)|urinary_tract(3)	16	Lung NSC(181;0.041)|all_lung(186;0.0581)				Ambenonium(DB01122)|Choline(DB00122)|Decamethonium(DB01245)|Demecarium(DB00944)|Dipivefrin(DB00449)|Donepezil(DB00843)|Edrophonium(DB01010)|Ephedrine(DB01364)|Galantamine(DB00674)|Gallamine Triethiodide(DB00483)|Isoflurophate(DB00677)|Mefloquine(DB00358)|Minaprine(DB00805)|Neostigmine(DB01400)|Physostigmine(DB00981)|Pralidoxime(DB00733)|Pyridostigmine(DB00545)|Rivastigmine(DB00989)|Tubocurarine(DB01199)	GACAGCAGGTGCATGCCCACC	0.716																																					p.H243Y		.											.	ACHE-92	0			c.C727T						.						27.0	30.0	29.0					7																	100491127		2200	4292	6492	SO:0001583	missense	43	exon2			GCAGGTGCATGCC		CCDS5709.1, CCDS5710.1, CCDS64736.1	7q22	2014-07-19	2014-01-02		ENSG00000087085	ENSG00000087085	3.1.1.7	"""Blood group antigens"""	108	protein-coding gene	gene with protein product	"""Yt blood group"""	100740	"""acetylcholinesterase (YT blood group)"", ""acetylcholinesterase (Yt blood group)"", ""acetylcholinesterase"""	YT		1380483	Standard	XM_005250357		Approved		uc003uxe.3	P22303	OTTHUMG00000157033	ENST00000412389.1:c.727C>T	7.37:g.100491127G>A	ENSP00000394976:p.His243Tyr	Somatic	6	0		WXS	Illumina GAIIx	Phase_I	46	26	NM_000665	0	0	2	2	0	A4D2E2|B7ZKZ0|D6W5X7|Q16169|Q29S23|Q2M324|Q504V3|Q53F46|Q86TM9|Q86YX9|Q9BXP7	Missense_Mutation	SNP	ENST00000412389.1	37	CCDS5709.1	.	.	.	.	.	.	.	.	.	.	G	13.92	2.380239	0.42207	.	.	ENSG00000087085	ENST00000419336;ENST00000241069;ENST00000428317;ENST00000302913;ENST00000412389;ENST00000426415;ENST00000430554;ENST00000411582;ENST00000422451	T;T;T;T;T;T;T;T	0.70986	-0.53;-0.53;-0.53;-0.53;-0.53;-0.53;-0.53;-0.53	5.26	4.37	0.52481	Carboxylesterase, type B (1);	0.000000	0.85682	D	0.000000	D	0.87212	0.6121	H	0.94306	3.52	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	0.999;0.998;0.999;1.0	D	0.89343	0.3655	10	0.87932	D	0	.	11.2625	0.49091	0.0903:0.0:0.9097:0.0	.	243;243;243;243	B7WPI6;P22303-3;P22303-2;P22303	.;.;.;ACES_HUMAN	Y	243	ENSP00000403474:H243Y;ENSP00000241069:H243Y;ENSP00000414858:H243Y;ENSP00000303211:H243Y;ENSP00000394976:H243Y;ENSP00000397143:H243Y;ENSP00000399725:H243Y;ENSP00000404865:H243Y	ENSP00000241069:H243Y	H	-	1	0	ACHE	100329063	1.000000	0.71417	1.000000	0.80357	0.075000	0.17131	9.492000	0.97957	1.198000	0.43158	0.491000	0.48974	CAC	.		0.716	ACHE-013	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347201.1	NM_015831	
THAP5	168451	hgsc.bcm.edu;broad.mit.edu	37	7	108205526	108205526	+	Frame_Shift_Del	DEL	T	T	-			TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr7:108205526delT	ENST00000415914.3	-	3	450	c.297delA	c.(295-297)aaafs	p.K99fs	THAP5_ENST00000438865.1_3'UTR|THAP5_ENST00000493722.1_5'UTR|THAP5_ENST00000313516.5_Frame_Shift_Del_p.K57fs	NM_001130475.1	NP_001123947.1	Q7Z6K1	THAP5_HUMAN	THAP domain containing 5	99					cell cycle (GO:0007049)|negative regulation of cell cycle (GO:0045786)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|protease binding (GO:0002020)			central_nervous_system(1)|kidney(1)|large_intestine(3)|lung(2)|skin(1)	8						TCTTCTGGGATTTTTTTTTAG	0.279																																					p.K99fs		.											.	THAP5-68	0			c.297delA						.		,	5,32,2509		0,1,4,3,25,1240	109.0	79.0	88.0		,	0.9	0.6	7		90	2,97,5339		0,0,2,17,63,2637	no	codingComplex,codingComplex	THAP5	NM_182529.2,NM_001130475.1	,	0,1,6,20,88,3877	A1A1,A1A2,A1R,A2A2,A2R,RR		1.8205,1.4533,1.7034	,	,	108205526	7,129,7848	692	1589	2281	SO:0001589	frameshift_variant	168451	exon3			CTGGGATTTTTTT	AL833137	CCDS34734.2, CCDS47687.1	7q22.3	2013-01-25			ENSG00000177683	ENSG00000177683		"""THAP (C2CH-type zinc finger) domain containing"""	23188	protein-coding gene	gene with protein product		612534				12575992	Standard	NM_001287598		Approved	DKFZp313O1132	uc003vfm.3	Q7Z6K1	OTTHUMG00000154951	ENST00000415914.3:c.297delA	7.37:g.108205526delT	ENSP00000400500:p.Lys99fs	Somatic	39	0		WXS	Illumina GAIIx	Phase_I	71	25	NM_001130475	0	0	0	0	0		Frame_Shift_Del	DEL	ENST00000415914.3	37	CCDS47687.1																																																																																			.		0.279	THAP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337777.2	NM_182529	
PPP1R3A	5506	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	113519565	113519565	+	Nonsense_Mutation	SNP	C	C	A			TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr7:113519565C>A	ENST00000284601.3	-	4	1650	c.1582G>T	c.(1582-1584)Gaa>Taa	p.E528*		NM_002711.3	NP_002702.2	Q16821	PPR3A_HUMAN	protein phosphatase 1, regulatory subunit 3A	528					glycogen metabolic process (GO:0005977)	integral component of membrane (GO:0016021)				NS(2)|breast(8)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(14)|liver(1)|lung(43)|ovary(10)|pancreas(7)|prostate(3)|skin(15)|stomach(1)|upper_aerodigestive_tract(2)	121						CTTTGTTTTTCATTAACACCT	0.348																																					p.E528X		.											.	PPP1R3A-832	0			c.G1582T						.						75.0	69.0	71.0					7																	113519565		2203	4299	6502	SO:0001587	stop_gained	5506	exon4			GTTTTTCATTAAC	AF024578	CCDS5759.1	7q31.1	2012-04-17	2011-10-04	2001-07-02	ENSG00000154415	ENSG00000154415	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	9291	protein-coding gene	gene with protein product	"""glycogen-associated regulatory subunit of protein phosphatase-1"", ""protein phosphatase 1 regulatory subunit GM"""	600917	"""protein phosphatase 1, regulatory (inhibitor) subunit 3A (glycogen and sarcoplasmic reticulum binding subunit, skeletal muscle)"", ""protein phosphatase 1, regulatory (inhibitor) subunit 3A"""	PPP1R3		7926294	Standard	NM_002711		Approved	GM	uc010ljy.1	Q16821	OTTHUMG00000156944	ENST00000284601.3:c.1582G>T	7.37:g.113519565C>A	ENSP00000284601:p.Glu528*	Somatic	53	0		WXS	Illumina GAIIx	Phase_I	61	10	NM_002711	0	0	0	0	0	A0AVQ2|A4D0T6|O43476|Q75LN8|Q7KYM8|Q86UI6	Nonsense_Mutation	SNP	ENST00000284601.3	37	CCDS5759.1	.	.	.	.	.	.	.	.	.	.	C	15.79	2.937465	0.52972	.	.	ENSG00000154415	ENST00000284601	.	.	.	6.02	5.14	0.70334	.	0.173070	0.41097	D	0.000947	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.62326	D	0.03	-0.3817	7.8016	0.29178	0.0:0.7859:0.0:0.2141	.	.	.	.	X	528	.	ENSP00000284601:E528X	E	-	1	0	PPP1R3A	113306801	0.965000	0.33210	0.680000	0.29994	0.192000	0.23643	1.132000	0.31418	1.566000	0.49654	0.655000	0.94253	GAA	.		0.348	PPP1R3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346724.1	NM_002711	
KCP	375616	broad.mit.edu	37	7	128517759	128517759	+	RNA	SNP	C	C	T			TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr7:128517759C>T	ENST00000476647.2	-	0	4439							Q6ZWJ8	KCP_HUMAN	kielin/chordin-like protein							extracellular region (GO:0005576)				central_nervous_system(1)|endometrium(3)	4						ATTGGCCTCACGCCTGGCACG	0.667																																					.		.											.	KCP-68	0			.						.						78.0	96.0	91.0					7																	128517759		692	1591	2283			375616	.			GCCTCACGCCTGG	AK122706		7q32.3	2009-11-06	2009-02-18	2009-02-18	ENSG00000135253	ENSG00000135253			17585	protein-coding gene	gene with protein product	"""kielin"""	609344	"""cysteine rich BMP regulator 2 (chordin-like)"""	CRIM2		15793581	Standard	NM_001135914		Approved	FLJ33365, NET67	uc011kor.2	Q6ZWJ8	OTTHUMG00000158363		7.37:g.128517759C>T		Somatic	268	0		WXS	Illumina GAIIx	Phase_I	682	18	.	0	0	0	0	0	Q8NBE0	RNA	SNP	ENST00000476647.2	37																																																																																				.		0.667	KCP-006	KNOWN	basic	processed_transcript	processed_transcript	OTTHUMT00000403051.1	NM_199349	
CPA1	1357	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	130020366	130020366	+	Missense_Mutation	SNP	G	G	A	rs145988366	byFrequency	TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr7:130020366G>A	ENST00000011292.3	+	1	155	c.5G>A	c.(4-6)cGg>cAg	p.R2Q	CPA1_ENST00000484324.1_5'Flank	NM_001868.2	NP_001859.1	P15085	CBPA1_HUMAN	carboxypeptidase A1 (pancreatic)	2					proteolysis (GO:0006508)	extracellular space (GO:0005615)	metallocarboxypeptidase activity (GO:0004181)|zinc ion binding (GO:0008270)			endometrium(3)|kidney(1)|large_intestine(5)|lung(11)|ovary(1)	21	Melanoma(18;0.0435)					AGCAGCATGCGGGGGTTGCTG	0.627																																					p.R2Q		.											.	CPA1-91	0			c.G5A						.	G	GLN/ARG	0,4406		0,0,2203	75.0	73.0	73.0		5	-4.6	0.0	7	dbSNP_134	73	3,8597	3.0+/-9.4	0,3,4297	yes	missense	CPA1	NM_001868.2	43	0,3,6500	AA,AG,GG		0.0349,0.0,0.0231	benign	2/420	130020366	3,13003	2203	4300	6503	SO:0001583	missense	1357	exon1			GCATGCGGGGGTT		CCDS5820.1	7q32	2012-02-10			ENSG00000091704	ENSG00000091704	3.4.17.1		2296	protein-coding gene	gene with protein product	"""pancreatic carboxypeptidase A"""	114850		CPA			Standard	NM_001868		Approved		uc003vpx.3	P15085	OTTHUMG00000157826	ENST00000011292.3:c.5G>A	7.37:g.130020366G>A	ENSP00000011292:p.Arg2Gln	Somatic	31	0		WXS	Illumina GAIIx	Phase_I	53	34	NM_001868	0	0	0	0	0	A4D1M1|Q53XU0|Q9BS67|Q9UCF2	Missense_Mutation	SNP	ENST00000011292.3	37	CCDS5820.1	.	.	.	.	.	.	.	.	.	.	G	12.60	1.986966	0.35036	0.0	3.49E-4	ENSG00000091704	ENST00000011292	T	0.12147	2.71	5.14	-4.57	0.03421	.	0.379591	0.31673	N	0.007259	T	0.08891	0.0220	L	0.43757	1.38	0.09310	N	0.999993	B	0.10296	0.003	B	0.04013	0.001	T	0.15809	-1.0424	10	0.52906	T	0.07	.	6.8333	0.23923	0.5871:0.0:0.2927:0.1202	.	2	P15085	CBPA1_HUMAN	Q	2	ENSP00000011292:R2Q	ENSP00000011292:R2Q	R	+	2	0	CPA1	129807602	0.000000	0.05858	0.048000	0.18961	0.312000	0.27988	-0.962000	0.03841	-0.739000	0.04809	0.462000	0.41574	CGG	G|1.000;A|0.000		0.627	CPA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349736.2	NM_001868	
CPA1	1357	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	130021521	130021521	+	Silent	SNP	A	A	G			TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr7:130021521A>G	ENST00000011292.3	+	3	348	c.198A>G	c.(196-198)cgA>cgG	p.R66R	CPA1_ENST00000484324.1_5'UTR	NM_001868.2	NP_001859.1	P15085	CBPA1_HUMAN	carboxypeptidase A1 (pancreatic)	66					proteolysis (GO:0006508)	extracellular space (GO:0005615)	metallocarboxypeptidase activity (GO:0004181)|zinc ion binding (GO:0008270)			endometrium(3)|kidney(1)|large_intestine(5)|lung(11)|ovary(1)	21	Melanoma(18;0.0435)					TCGACGTCCGAGTGCCCTTCC	0.667																																					p.R66R		.											.	CPA1-91	0			c.A198G						.						57.0	45.0	49.0					7																	130021521		2203	4300	6503	SO:0001819	synonymous_variant	1357	exon3			CGTCCGAGTGCCC		CCDS5820.1	7q32	2012-02-10			ENSG00000091704	ENSG00000091704	3.4.17.1		2296	protein-coding gene	gene with protein product	"""pancreatic carboxypeptidase A"""	114850		CPA			Standard	NM_001868		Approved		uc003vpx.3	P15085	OTTHUMG00000157826	ENST00000011292.3:c.198A>G	7.37:g.130021521A>G		Somatic	99	1		WXS	Illumina GAIIx	Phase_I	288	127	NM_001868	0	0	0	0	0	A4D1M1|Q53XU0|Q9BS67|Q9UCF2	Silent	SNP	ENST00000011292.3	37	CCDS5820.1																																																																																			.		0.667	CPA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349736.2	NM_001868	
EXOC4	60412	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	132959896	132959896	+	Silent	SNP	C	C	T			TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr7:132959896C>T	ENST00000253861.4	+	2	275	c.246C>T	c.(244-246)cgC>cgT	p.R82R	EXOC4_ENST00000393161.2_Silent_p.R82R|EXOC4_ENST00000539845.1_5'UTR	NM_021807.3	NP_068579.3	Q96A65	EXOC4_HUMAN	exocyst complex component 4	82					cellular protein metabolic process (GO:0044267)|membrane organization (GO:0061024)|protein transport (GO:0015031)|vesicle docking involved in exocytosis (GO:0006904)	cytoplasm (GO:0005737)|exocyst (GO:0000145)|growth cone membrane (GO:0032584)|membrane (GO:0016020)|myelin sheath abaxonal region (GO:0035748)|plasma membrane (GO:0005886)	protein N-terminus binding (GO:0047485)			NS(1)|breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(10)|lung(16)|ovary(4)|prostate(1)|skin(5)|upper_aerodigestive_tract(2)	50		Esophageal squamous(399;0.129)				TCACAGAGCGCATCACTAACT	0.473																																					p.R82R		.											.	EXOC4-159	0			c.C246T						.						112.0	101.0	105.0					7																	132959896		2203	4300	6503	SO:0001819	synonymous_variant	60412	exon2			AGAGCGCATCACT	AL831989	CCDS5829.1, CCDS43648.1	7q31	2013-01-22	2005-11-01	2005-11-01	ENSG00000131558	ENSG00000131558			30389	protein-coding gene	gene with protein product		608185	"""SEC8-like 1 (S. cerevisiae)"""	SEC8L1		11214970, 12687004	Standard	XM_005250523		Approved	KIAA1699, MGC27170, SEC8, Sec8p	uc003vrk.3	Q96A65	OTTHUMG00000155259	ENST00000253861.4:c.246C>T	7.37:g.132959896C>T		Somatic	159	0		WXS	Illumina GAIIx	Phase_I	362	148	NM_021807	0	0	5	9	4	E9PED2|Q541U8|Q9C0G4|Q9H9K0|Q9P102	Silent	SNP	ENST00000253861.4	37	CCDS5829.1																																																																																			.		0.473	EXOC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000339182.1	NM_021807	
PARP12	64761	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	139726084	139726084	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr7:139726084C>T	ENST00000263549.3	-	11	2566	c.1693G>A	c.(1693-1695)Ggc>Agc	p.G565S		NM_022750.2	NP_073587.1	Q9H0J9	PAR12_HUMAN	poly (ADP-ribose) polymerase family, member 12	565	PARP catalytic. {ECO:0000255|PROSITE- ProRule:PRU00397}.					nucleus (GO:0005634)	metal ion binding (GO:0046872)|NAD+ ADP-ribosyltransferase activity (GO:0003950)|poly(A) RNA binding (GO:0044822)			endometrium(3)|kidney(2)|large_intestine(4)|lung(5)|ovary(3)|prostate(1)|skin(1)	19	Melanoma(164;0.0142)					GCGCTGGTGCCGTGGAACAGC	0.562																																					p.G565S		.											.	PARP12-525	0			c.G1693A						.						89.0	83.0	85.0					7																	139726084		2203	4300	6503	SO:0001583	missense	64761	exon11			TGGTGCCGTGGAA	AL136766	CCDS5857.1	7q34	2014-01-28	2005-06-02	2005-06-02	ENSG00000059378	ENSG00000059378		"""Zinc fingers, CCCH-type domain containing"", ""Poly (ADP-ribose) polymerases"""	21919	protein-coding gene	gene with protein product		612481	"""zinc finger CCCH-type domain containing 1"""	ZC3HDC1		11230166, 12851707	Standard	NM_022750		Approved	FLJ22693, PARP-12, ZC3H1	uc003vvl.1	Q9H0J9	OTTHUMG00000157315	ENST00000263549.3:c.1693G>A	7.37:g.139726084C>T	ENSP00000263549:p.Gly565Ser	Somatic	86	0		WXS	Illumina GAIIx	Phase_I	167	90	NM_022750	0	0	18	32	14	Q9H610|Q9NP36|Q9NTI3	Missense_Mutation	SNP	ENST00000263549.3	37	CCDS5857.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	c|c	15.62|15.62	2.886533|2.886533	0.51908|0.51908	.|.	.|.	ENSG00000059378|ENSG00000059378	ENST00000263549|ENST00000489809	T|T	0.73789|0.50813	-0.78|0.73	4.77|4.77	4.77|4.77	0.60923|0.60923	Poly(ADP-ribose) polymerase, catalytic domain (2);|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.80265|0.80265	0.4591|0.4591	H|H	0.97758|0.97758	4.07|4.07	0.80722|0.80722	D|D	1|1	D|.	0.89917|.	1.0|.	D|.	0.97110|.	1.0|.	D|D	0.87437|0.87437	0.2392|0.2392	10|7	0.87932|0.54805	D|T	0|0.06	.|.	17.7742|17.7742	0.88502|0.88502	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	565|.	Q9H0J9|.	PAR12_HUMAN|.	S|Q	565|159	ENSP00000263549:G565S|ENSP00000417606:R159Q	ENSP00000263549:G565S|ENSP00000417606:R159Q	G|R	-|-	1|2	0|0	PARP12|PARP12	139372553|139372553	1.000000|1.000000	0.71417|0.71417	0.975000|0.975000	0.42487|0.42487	0.450000|0.450000	0.32258|0.32258	7.792000|7.792000	0.85828|0.85828	2.204000|2.204000	0.70986|0.70986	0.461000|0.461000	0.40582|0.40582	GGC|CGG	.		0.562	PARP12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348413.1	NM_022750	
KMT2C	58508	broad.mit.edu;bcgsc.ca	37	7	151878058	151878058	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr7:151878058C>T	ENST00000262189.6	-	36	7105	c.6887G>A	c.(6886-6888)cGt>cAt	p.R2296H	KMT2C_ENST00000355193.2_Missense_Mutation_p.R2296H	NM_170606.2	NP_733751.2	Q8NEZ4	KMT2C_HUMAN	lysine (K)-specific methyltransferase 2C	2296					histone H3-K4 methylation (GO:0051568)|intracellular signal transduction (GO:0035556)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)										ATAGGGATCACGGGCAGCAGA	0.527																																					p.R2296H		.											.	MLL3-1398	0			c.G6887A						.						105.0	101.0	102.0					7																	151878058		2203	4300	6503	SO:0001583	missense	58508	exon36			GGATCACGGGCAG	AF264750	CCDS5931.1	7q36	2013-05-09	2013-05-09	2013-05-09	ENSG00000055609	ENSG00000055609		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	13726	protein-coding gene	gene with protein product		606833	"""myeloid/lymphoid or mixed-lineage leukemia 3"""	MLL3		10819331	Standard	XM_005250026		Approved	KIAA1506, HALR		Q8NEZ4	OTTHUMG00000150553	ENST00000262189.6:c.6887G>A	7.37:g.151878058C>T	ENSP00000262189:p.Arg2296His	Somatic	174	0		WXS	Illumina GAIIx	Phase_I	424	11	NM_170606	0	0	3	3	0	Q8NC02|Q8NDF6|Q9H9P4|Q9NR13|Q9P222|Q9UDR7	Missense_Mutation	SNP	ENST00000262189.6	37	CCDS5931.1	.	.	.	.	.	.	.	.	.	.	C	6.610	0.481022	0.12581	.	.	ENSG00000055609	ENST00000262189;ENST00000355193	D;D	0.82803	-1.65;-1.65	5.17	3.31	0.37934	.	0.292176	0.24285	N	0.039874	T	0.70351	0.3214	L	0.31294	0.92	0.54753	D	0.999988	B;B	0.10296	0.002;0.003	B;B	0.06405	0.001;0.002	T	0.63427	-0.6640	10	0.30854	T	0.27	.	7.6067	0.28105	0.0:0.6778:0.1332:0.1891	.	2296;1357	Q8NEZ4;Q8NEZ4-2	MLL3_HUMAN;.	H	2296	ENSP00000262189:R2296H;ENSP00000347325:R2296H	ENSP00000262189:R2296H	R	-	2	0	MLL3	151508991	0.001000	0.12720	0.115000	0.21578	0.877000	0.50540	-0.067000	0.11579	1.300000	0.44818	0.655000	0.94253	CGT	.		0.527	KMT2C-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000318887.3		
KMT2C	58508	broad.mit.edu	37	7	151879078	151879078	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr7:151879078G>A	ENST00000262189.6	-	36	6085	c.5867C>T	c.(5866-5868)tCc>tTc	p.S1956F	KMT2C_ENST00000355193.2_Missense_Mutation_p.S1956F	NM_170606.2	NP_733751.2	Q8NEZ4	KMT2C_HUMAN	lysine (K)-specific methyltransferase 2C	1956	Pro-rich.				histone H3-K4 methylation (GO:0051568)|intracellular signal transduction (GO:0035556)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)										ATTTGTCGTGGAAGAAGAACA	0.458																																					p.S1956F		.											.	MLL3-1398	0			c.C5867T						.						157.0	166.0	163.0					7																	151879078		2203	4300	6503	SO:0001583	missense	58508	exon36			GTCGTGGAAGAAG	AF264750	CCDS5931.1	7q36	2013-05-09	2013-05-09	2013-05-09	ENSG00000055609	ENSG00000055609		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	13726	protein-coding gene	gene with protein product		606833	"""myeloid/lymphoid or mixed-lineage leukemia 3"""	MLL3		10819331	Standard	XM_005250026		Approved	KIAA1506, HALR		Q8NEZ4	OTTHUMG00000150553	ENST00000262189.6:c.5867C>T	7.37:g.151879078G>A	ENSP00000262189:p.Ser1956Phe	Somatic	103	0		WXS	Illumina GAIIx	Phase_I	241	6	NM_170606	0	0	3	3	0	Q8NC02|Q8NDF6|Q9H9P4|Q9NR13|Q9P222|Q9UDR7	Missense_Mutation	SNP	ENST00000262189.6	37	CCDS5931.1	.	.	.	.	.	.	.	.	.	.	G	15.81	2.943012	0.53079	.	.	ENSG00000055609	ENST00000262189;ENST00000355193	T;T	0.43688	0.94;0.94	5.41	5.41	0.78517	.	0.000000	0.44285	U	0.000467	T	0.52468	0.1736	L	0.29908	0.895	0.80722	D	1	P;D	0.71674	0.895;0.998	P;D	0.63381	0.548;0.914	T	0.52094	-0.8621	10	0.49607	T	0.09	.	19.1888	0.93654	0.0:0.0:1.0:0.0	.	1956;1017	Q8NEZ4;Q8NEZ4-2	MLL3_HUMAN;.	F	1956	ENSP00000262189:S1956F;ENSP00000347325:S1956F	ENSP00000262189:S1956F	S	-	2	0	MLL3	151510011	1.000000	0.71417	0.916000	0.36221	0.721000	0.41392	6.314000	0.72848	2.540000	0.85666	0.563000	0.77884	TCC	.		0.458	KMT2C-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000318887.3		
WDR60	55112	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	158738347	158738347	+	Silent	SNP	G	G	A	rs374045806		TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr7:158738347G>A	ENST00000407559.3	+	25	3236	c.3078G>A	c.(3076-3078)gcG>gcA	p.A1026A		NM_018051.4	NP_060521.4	Q8WVS4	WDR60_HUMAN	WD repeat domain 60	1026					cell projection organization (GO:0030030)	cilium (GO:0005929)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)				NS(3)|breast(1)|central_nervous_system(1)|cervix(2)|endometrium(3)|kidney(1)|large_intestine(2)|liver(4)|lung(16)|ovary(2)	35	Ovarian(565;0.152)	all_cancers(7;1.25e-09)|all_epithelial(9;0.000894)|all_hematologic(28;0.00603)	OV - Ovarian serous cystadenocarcinoma(82;0.00174)	UCEC - Uterine corpus endometrioid carcinoma (81;0.19)|STAD - Stomach adenocarcinoma(7;0.18)		TGGCCAGGGCGTCTGGCTCCA	0.672																																					p.A1026A		.											.	WDR60-92	0			c.G3078A						.			0,4054		0,0,2027	17.0	22.0	21.0		3078	0.6	0.5	7		21	2,8342		0,2,4170	no	coding-synonymous	WDR60	NM_018051.4		0,2,6197	AA,AG,GG		0.024,0.0,0.0161		1026/1067	158738347	2,12396	2027	4172	6199	SO:0001819	synonymous_variant	55112	exon25			CAGGGCGTCTGGC		CCDS47757.1	7q36.3	2013-11-15			ENSG00000126870	ENSG00000126870		"""WD repeat domain containing"""	21862	protein-coding gene	gene with protein product		615462				23910462	Standard	NM_018051		Approved	FLJ10300, FAP163	uc003woe.4	Q8WVS4	OTTHUMG00000151443	ENST00000407559.3:c.3078G>A	7.37:g.158738347G>A		Somatic	64	0		WXS	Illumina GAIIx	Phase_I	213	91	NM_018051	0	0	9	19	10	Q9NW58	Silent	SNP	ENST00000407559.3	37	CCDS47757.1																																																																																			.		0.672	WDR60-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000322668.1	NM_018051	
MYOM2	9172	bcgsc.ca	37	8	2021421	2021421	+	Missense_Mutation	SNP	G	G	T	rs2272720	byFrequency	TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr8:2021421G>T	ENST00000262113.4	+	10	1102	c.961G>T	c.(961-963)Gtg>Ttg	p.V321L	MYOM2_ENST00000523438.1_Intron	NM_003970.2	NP_003961.2	P54296	MYOM2_HUMAN	myomesin 2	321	Ig-like C2-type 2.		V -> L (in dbSNP:rs2272720). {ECO:0000269|PubMed:7505783}.		muscle contraction (GO:0006936)	M band (GO:0031430)|mitochondrion (GO:0005739)|myosin filament (GO:0032982)	structural constituent of muscle (GO:0008307)			autonomic_ganglia(2)|breast(4)|central_nervous_system(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(11)|kidney(2)|large_intestine(17)|lung(39)|ovary(5)|prostate(1)|skin(10)|upper_aerodigestive_tract(3)	104		Ovarian(12;0.0572)|Colorectal(14;0.0844)|Hepatocellular(245;0.217)		BRCA - Breast invasive adenocarcinoma(11;1.85e-05)|Colorectal(4;0.0101)|READ - Rectum adenocarcinoma(4;0.148)|COAD - Colon adenocarcinoma(4;0.179)		TCTTTCAGACGTGCTGTTGAA	0.562													G|||	1402	0.279952	0.0257	0.379	5008	,	,		19795	0.3601		0.4046	False		,,,				2504	0.3425				p.V321L		.											.	MYOM2-95	0			c.G961T						.	G	LEU/VAL	419,3987	205.2+/-227.1	16,387,1800	94.0	84.0	87.0		961	4.6	0.7	8	dbSNP_100	87	3691,4909	528.5+/-381.4	816,2059,1425	yes	missense	MYOM2	NM_003970.2	32	832,2446,3225	TT,TG,GG		42.9186,9.5098,31.6008	benign	321/1466	2021421	4110,8896	2203	4300	6503	SO:0001583	missense	9172	exon10			TCAGACGTGCTGT		CCDS5957.1	8p23.3	2014-06-06	2012-10-17		ENSG00000036448	ENSG00000036448		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	7614	protein-coding gene	gene with protein product		603509	"""myomesin (M-protein) 2 (165kD)"", ""myomesin (M-protein) 2, 165kDa"""				Standard	XM_006716237		Approved		uc003wpx.4	P54296	OTTHUMG00000129175	ENST00000262113.4:c.961G>T	8.37:g.2021421G>T	ENSP00000262113:p.Val321Leu	Somatic	100	0		WXS	Illumina GAIIx	Phase_I	154	5	NM_003970	0	0	0	0	0	Q7Z3Y2	Missense_Mutation	SNP	ENST00000262113.4	37	CCDS5957.1	676	0.30952380952380953	13	0.026422764227642278	148	0.4088397790055249	207	0.3618881118881119	308	0.40633245382585753	G	8.677	0.904279	0.17760	0.095098	0.429186	ENSG00000036448	ENST00000262113	T	0.66815	-0.23	4.63	4.63	0.57726	Immunoglobulin subtype (1);Immunoglobulin I-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.323580	0.29342	N	0.012422	T	0.00012	0.0000	L	0.42686	1.345	0.09310	P	1.0	B	0.12013	0.005	B	0.17098	0.017	T	0.33828	-0.9853	9	0.20519	T	0.43	.	17.4931	0.87710	0.0:0.0:1.0:0.0	rs2272720;rs59193087;rs2272720	321	P54296	MYOM2_HUMAN	L	321	ENSP00000262113:V321L	ENSP00000262113:V321L	V	+	1	0	MYOM2	2008828	1.000000	0.71417	0.666000	0.29783	0.015000	0.08874	5.607000	0.67648	2.093000	0.63338	0.655000	0.94253	GTG	G|0.687;T|0.313		0.562	MYOM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251249.1	NM_003970	
DEFB135	613209	broad.mit.edu;bcgsc.ca	37	8	11839860	11839860	+	Missense_Mutation	SNP	G	G	A	rs141141605		TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr8:11839860G>A	ENST00000382208.2	+	1	31	c.31G>A	c.(31-33)Gtg>Atg	p.V11M		NM_001033017.2	NP_001028189.2	Q30KP9	DB135_HUMAN	defensin, beta 135	11					defense response to bacterium (GO:0042742)	extracellular region (GO:0005576)				endometrium(1)|large_intestine(2)|prostate(1)	4						CTTGGCCCTCGTGGTCCTTAA	0.483													G|||	1	0.000199681	0.0008	0.0	5008	,	,		22087	0.0		0.0	False		,,,				2504	0.0				p.V11M		.											.	DEFB135-68	0			c.G31A						.	G	MET/VAL	8,3922		0,8,1957	132.0	133.0	133.0		31	2.3	0.6	8	dbSNP_134	133	0,8300		0,0,4150	yes	missense	DEFB135	NM_001033017.2	21	0,8,6107	AA,AG,GG		0.0,0.2036,0.0654	possibly-damaging	11/78	11839860	8,12222	1965	4150	6115	SO:0001583	missense	613209	exon1			GCCCTCGTGGTCC	DQ012025	CCDS43710.1	8p23.1	2009-05-27			ENSG00000205883	ENSG00000205883		"""Defensins, beta"""	32400	protein-coding gene	gene with protein product						16033865	Standard	NM_001033017		Approved		uc003wuw.1	Q30KP9	OTTHUMG00000158719	ENST00000382208.2:c.31G>A	8.37:g.11839860G>A	ENSP00000371643:p.Val11Met	Somatic	88	2		WXS	Illumina GAIIx	Phase_I	83	75	NM_001033017	0	0	0	0	0	Q4QY37	Missense_Mutation	SNP	ENST00000382208.2	37	CCDS43710.1	2	9.157509157509158E-4	2	0.0040650406504065045	0	0.0	0	0.0	0	0.0	G	2.440	-0.328793	0.05314	0.002036	0.0	ENSG00000205883	ENST00000382208	.	.	.	3.2	2.29	0.28610	.	.	.	.	.	T	0.52645	0.1747	.	.	.	0.09310	N	0.999992	D	0.76494	0.999	P	0.58331	0.837	T	0.36672	-0.9738	7	0.66056	D	0.02	-6.3339	8.2558	0.31756	0.0:0.2453:0.7547:0.0	.	11	Q30KP9	DB135_HUMAN	M	11	.	ENSP00000371643:V11M	V	+	1	0	DEFB135	11877269	0.238000	0.23825	0.556000	0.28293	0.024000	0.10985	1.006000	0.29847	0.873000	0.35799	0.655000	0.94253	GTG	G|0.999;A|0.001		0.483	DEFB135-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351888.1	NM_001033017	
HOOK3	84376	ucsc.edu	37	8	42819577	42819577	+	Missense_Mutation	SNP	C	C	A			TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr8:42819577C>A	ENST00000307602.4	+	9	939	c.739C>A	c.(739-741)Ctc>Atc	p.L247I		NM_032410.3	NP_115786.1	Q86VS8	HOOK3_HUMAN	hook microtubule-tethering protein 3	247					cytoplasmic microtubule organization (GO:0031122)|early endosome to late endosome transport (GO:0045022)|endosome organization (GO:0007032)|endosome to lysosome transport (GO:0008333)|Golgi localization (GO:0051645)|interkinetic nuclear migration (GO:0022027)|lysosome organization (GO:0007040)|microtubule anchoring at centrosome (GO:0034454)|negative regulation of neurogenesis (GO:0050768)|neuronal stem cell maintenance (GO:0097150)|protein localization to centrosome (GO:0071539)|protein transport (GO:0015031)	centriolar satellite (GO:0034451)|centrosome (GO:0005813)|cis-Golgi network (GO:0005801)|cytoplasm (GO:0005737)|FHF complex (GO:0070695)|Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|microtubule organizing center (GO:0005815)|pericentriolar material (GO:0000242)	identical protein binding (GO:0042802)|microtubule binding (GO:0008017)			NS(1)|breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(10)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	31	Ovarian(28;0.01)|Prostate(17;0.0119)|Lung SC(25;0.184)	all_lung(54;0.000105)|Lung NSC(58;0.000419)|Hepatocellular(245;0.0524)|Renal(179;0.0822)|Esophageal squamous(32;0.129)	Lung(22;0.048)|LUSC - Lung squamous cell carcinoma(45;0.114)			GCATTTGCAGCTCCAGACTCA	0.348			T	RET	papillary thyroid																																p.L247I		.		Dom	yes		8	8p11.21	84376	hook homolog 3		E	.	HOOK3-154	0			c.C739A						.						88.0	86.0	87.0					8																	42819577		2203	4300	6503	SO:0001583	missense	84376	exon9			TTGCAGCTCCAGA	AK090540	CCDS6139.1	8p11.21	2013-08-21	2013-08-21		ENSG00000168172	ENSG00000168172			23576	protein-coding gene	gene with protein product		607825	"""hook homolog 3 (Drosophila)"""			9927460	Standard	NM_032410		Approved	HK3	uc003xpr.3	Q86VS8	OTTHUMG00000165278	ENST00000307602.4:c.739C>A	8.37:g.42819577C>A	ENSP00000305699:p.Leu247Ile	Somatic	47	0		WXS	Illumina GAIIx	Phase_I	45	4	NM_032410	0	0	2	2	0	D3DSY8|Q8NBH0|Q9BY13	Missense_Mutation	SNP	ENST00000307602.4	37	CCDS6139.1	.	.	.	.	.	.	.	.	.	.	C	31	5.064031	0.93898	.	.	ENSG00000168172	ENST00000307602	T	0.25085	1.82	5.85	5.85	0.93711	.	0.000000	0.85682	D	0.000000	T	0.52370	0.1730	M	0.73430	2.235	0.80722	D	1	P;P	0.48350	0.909;0.9	P;P	0.61477	0.889;0.447	T	0.44205	-0.9343	10	0.49607	T	0.09	-0.4757	20.1572	0.98116	0.0:1.0:0.0:0.0	.	247;247	Q2VJ45;Q86VS8	.;HOOK3_HUMAN	I	247	ENSP00000305699:L247I	ENSP00000305699:L247I	L	+	1	0	HOOK3	42938734	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.605000	0.61119	2.762000	0.94881	0.650000	0.86243	CTC	.		0.348	HOOK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383172.2	NM_032410	
ST18	9705	hgsc.bcm.edu;bcgsc.ca	37	8	53062482	53062482	+	Frame_Shift_Del	DEL	T	T	-			TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr8:53062482delT	ENST00000276480.7	-	16	2545	c.1862delA	c.(1861-1863)aatfs	p.N621fs	RP11-26M5.3_ENST00000520496.1_RNA	NM_014682.2	NP_055497.1	O60284	ST18_HUMAN	suppression of tumorigenicity 18, zinc finger	621					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(14)|lung(38)|ovary(4)|prostate(2)|skin(11)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	85		Lung NSC(129;0.131)|all_epithelial(80;0.217)|all_lung(136;0.229)				CAGGATTCGATTTTTTTTCAT	0.408																																					p.N621fs		.											.	ST18-95	0			c.1862delA						.						231.0	216.0	221.0					8																	53062482		2203	4300	6503	SO:0001589	frameshift_variant	9705	exon16			ATTCGATTTTTTT	AB011107	CCDS6149.1	8q11.23	2014-03-24	2014-03-24	2002-12-13	ENSG00000147488	ENSG00000147488		"""Zinc fingers, C2HC-type containing"""	18695	protein-coding gene	gene with protein product	"""neural zinc finger transcription factor 3"""		"""zinc finger protein 387"", ""suppression of tumorigenicity 18 (breast carcinoma) (zinc finger protein)"""	ZNF387		15489893	Standard	NM_014682		Approved	KIAA0535, ZC2HC10, NZF3	uc003xra.2	O60284	OTTHUMG00000164233	ENST00000276480.7:c.1862delA	8.37:g.53062482delT	ENSP00000276480:p.Asn621fs	Somatic	140	1		WXS	Illumina GAIIx	Phase_I	175	148	NM_014682	0	0	0	0	0	Q17RY1	Frame_Shift_Del	DEL	ENST00000276480.7	37	CCDS6149.1																																																																																			.		0.408	ST18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377867.1		
MYBL1	4603	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	8	67511292	67511294	+	In_Frame_Del	DEL	TCT	TCT	-			TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10	TCT	TCT	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr8:67511292_67511294delTCT	ENST00000522677.3	-	4	692_694	c.282_284delAGA	c.(280-285)gaagat>gat	p.E94del	MYBL1_ENST00000524176.2_In_Frame_Del_p.E94del|MYBL1_ENST00000517885.1_In_Frame_Del_p.E94del	NM_001080416.2|NM_001144755.1	NP_001073885.1|NP_001138227.1	P10243	MYBA_HUMAN	v-myb avian myeloblastosis viral oncogene homolog-like 1	94	HTH myb-type 2. {ECO:0000255|PROSITE- ProRule:PRU00625}.				positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			breast(1)|endometrium(1)|kidney(3)|large_intestine(7)|lung(9)|ovary(2)|pancreas(1)|skin(1)	25			Epithelial(68;0.00211)|all cancers(69;0.00726)|OV - Ovarian serous cystadenocarcinoma(28;0.00989)|BRCA - Breast invasive adenocarcinoma(89;0.0938)			TACCCTCTGATCTTCTTCTTTAG	0.33																																					p.94_95del		.											.	MYBL1-395	0			c.282_284del						.																																			SO:0001651	inframe_deletion	4603	exon4			CTCTGATCTTCTT	X13294	CCDS47867.1, CCDS55241.1	8q22	2013-07-09	2013-07-09		ENSG00000185697	ENSG00000185697			7547	protein-coding gene	gene with protein product		159405					Standard	XM_005251251		Approved	AMYB, A-myb	uc003xwj.3	P10243	OTTHUMG00000164559	ENST00000522677.3:c.282_284delAGA	8.37:g.67511298_67511300delTCT	ENSP00000429633:p.Glu94del	Somatic	38	0		WXS	Illumina GAIIx	Phase_I	46	34	NM_001080416	0	0	0	0	0	E7EW29|Q495F9	In_Frame_Del	DEL	ENST00000522677.3	37	CCDS47867.1																																																																																			.		0.330	MYBL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379221.3	XM_034274	
PABPC1	26986	broad.mit.edu	37	8	101724606	101724606	+	Missense_Mutation	SNP	G	G	A	rs202060459		TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr8:101724606G>A	ENST00000318607.5	-	7	2084	c.956C>T	c.(955-957)aCa>aTa	p.T319I	PABPC1_ENST00000519596.1_5'UTR|PABPC1_ENST00000519004.1_Missense_Mutation_p.T274I|PABPC1_ENST00000522387.1_Missense_Mutation_p.T287I	NM_002568.3	NP_002559.2	P11940	PABP1_HUMAN	poly(A) binding protein, cytoplasmic 1	319	RRM 4. {ECO:0000255|PROSITE- ProRule:PRU00176}.				cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|gene silencing by RNA (GO:0031047)|mRNA metabolic process (GO:0016071)|mRNA polyadenylation (GO:0006378)|mRNA splicing, via spliceosome (GO:0000398)|mRNA stabilization (GO:0048255)|negative regulation of nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:2000623)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|positive regulation of nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:1900153)|positive regulation of nuclear-transcribed mRNA poly(A) tail shortening (GO:0060213)|positive regulation of translation (GO:0045727)|RNA metabolic process (GO:0016070)|translation (GO:0006412)|translational initiation (GO:0006413)	catalytic step 2 spliceosome (GO:0071013)|cytoplasm (GO:0005737)|cytoplasmic ribonucleoprotein granule (GO:0036464)|cytoplasmic stress granule (GO:0010494)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	nucleotide binding (GO:0000166)|poly(A) binding (GO:0008143)|poly(A) RNA binding (GO:0044822)|poly(U) RNA binding (GO:0008266)|protein C-terminus binding (GO:0008022)|translation activator activity (GO:0008494)	p.T319I(2)		breast(2)|endometrium(4)|kidney(15)|large_intestine(4)|lung(13)|prostate(1)|skin(1)	40	all_cancers(14;6.8e-05)|all_epithelial(15;3.16e-07)|Lung NSC(17;0.000453)|all_lung(17;0.00125)		Epithelial(11;6.37e-11)|all cancers(13;1.11e-08)|OV - Ovarian serous cystadenocarcinoma(57;3.91e-05)|STAD - Stomach adenocarcinoma(118;0.206)			ACTAGTGATTGTACCAAATGG	0.284																																					p.T319I		.											.	PABPC1-68	2	Substitution - Missense(2)	kidney(1)|endometrium(1)	c.C956T						.						154.0	166.0	162.0					8																	101724606		2203	4298	6501	SO:0001583	missense	26986	exon7			GTGATTGTACCAA	Y00345	CCDS6289.1	8q22.2-q23	2013-02-12	2004-04-20		ENSG00000070756	ENSG00000070756		"""RNA binding motif (RRM) containing"""	8554	protein-coding gene	gene with protein product		604679	"""poly(A)-binding protein, cytoplasmic 2"""	PAB1, PABPC2		2885805	Standard	XM_005250861		Approved	PABP1, PABPL1	uc003yjs.1	P11940	OTTHUMG00000164779	ENST00000318607.5:c.956C>T	8.37:g.101724606G>A	ENSP00000313007:p.Thr319Ile	Somatic	117	1		WXS	Illumina GAIIx	Phase_I	116	3	NM_002568	1	0	351	352	0	Q15097|Q93004	Missense_Mutation	SNP	ENST00000318607.5	37	CCDS6289.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	26.8|26.8	4.768189|4.768189	0.90020|0.90020	.|.	.|.	ENSG00000070756|ENSG00000070756	ENST00000519100|ENST00000318607;ENST00000347137;ENST00000519004;ENST00000522387	.|T;T;T	.|0.16196	.|2.36;2.36;2.36	5.65|5.65	5.65|5.65	0.86999|0.86999	.|Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (3);	.|0.000000	.|0.64402	.|D	.|0.000009	.|T	.|0.37652	.|0.1011	M|M	0.62154|0.62154	1.92|1.92	0.80722|0.80722	D|D	1|1	.|P;P;D	.|0.54964	.|0.917;0.784;0.969	.|P;B;P	.|0.56916	.|0.747;0.442;0.809	.|T	.|0.03784	.|-1.1004	.|10	.|0.87932	.|D	.|0	.|.	20.0919|20.0919	0.97823|0.97823	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|287;319;319	.|E7ERJ7;B3KT93;P11940	.|.;.;PABP1_HUMAN	X|I	188|319;319;274;287	.|ENSP00000313007:T319I;ENSP00000429594:T274I;ENSP00000429395:T287I	.|ENSP00000313007:T319I	Q|T	-|-	1|2	0|0	PABPC1|PABPC1	101793782|101793782	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.999000|0.999000	0.98932|0.98932	9.776000|9.776000	0.99001|0.99001	2.824000|2.824000	0.97209|0.97209	0.655000|0.655000	0.94253|0.94253	CAA|ACA	.		0.284	PABPC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380217.1	NM_002568	
UBR5	51366	broad.mit.edu;ucsc.edu;bcgsc.ca	37	8	103297940	103297940	+	Missense_Mutation	SNP	G	G	T			TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr8:103297940G>T	ENST00000520539.1	-	39	5891	c.5285C>A	c.(5284-5286)gCt>gAt	p.A1762D	UBR5_ENST00000521922.1_Missense_Mutation_p.A1756D|UBR5_ENST00000519528.1_5'Flank|UBR5_ENST00000220959.4_Missense_Mutation_p.A1762D	NM_001282873.1|NM_015902.5	NP_001269802.1|NP_056986.2	O95071	UBR5_HUMAN	ubiquitin protein ligase E3 component n-recognin 5	1762	Poly-Ala.				cell proliferation (GO:0008283)|cellular response to DNA damage stimulus (GO:0006974)|DNA repair (GO:0006281)|negative regulation of double-strand break repair (GO:2000780)|negative regulation of histone H2A K63-linked ubiquitination (GO:1901315)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of catenin import into nucleus (GO:0035413)|positive regulation of protein import into nucleus, translocation (GO:0033160)|progesterone receptor signaling pathway (GO:0050847)|protein polyubiquitination (GO:0000209)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	ligase activity (GO:0016874)|RNA binding (GO:0003723)|ubiquitin-protein transferase activity (GO:0004842)|ubiquitin-ubiquitin ligase activity (GO:0034450)|zinc ion binding (GO:0008270)			NS(1)|breast(13)|central_nervous_system(1)|cervix(1)|endometrium(7)|kidney(8)|large_intestine(19)|liver(1)|lung(51)|ovary(6)|pancreas(1)|prostate(5)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(2)	124	all_cancers(14;8e-07)|all_epithelial(15;2.18e-08)|Lung NSC(17;2.55e-05)|all_lung(17;8.85e-05)		OV - Ovarian serous cystadenocarcinoma(57;0.000442)			TGCAGCTGCAGCACTTGTACT	0.458																																					p.A1762D	Ovarian(131;96 1741 5634 7352 27489)	.											.	UBR5-761	0			c.C5285A						.						66.0	64.0	65.0					8																	103297940		2203	4300	6503	SO:0001583	missense	51366	exon39			GCTGCAGCACTTG	AF006010	CCDS34933.1, CCDS64946.1	8q22	2008-06-23	2007-06-19	2007-06-19	ENSG00000104517	ENSG00000104517		"""Ubiquitin protein ligase E3 component n-recognins"""	16806	protein-coding gene	gene with protein product		608413	"""E3 ubiquitin protein ligase, HECT domain containing, 1"""	EDD1		10030672, 16055722	Standard	NM_015902		Approved	DD5, HYD, EDD, KIAA0896	uc003ykr.2	O95071	OTTHUMG00000164755	ENST00000520539.1:c.5285C>A	8.37:g.103297940G>T	ENSP00000429084:p.Ala1762Asp	Somatic	103	1		WXS	Illumina GAIIx	Phase_I	137	123	NM_015902	0	0	0	1	1	B2RP24|J3KMW7|O94970|Q9NPL3	Missense_Mutation	SNP	ENST00000520539.1	37	CCDS34933.1	.	.	.	.	.	.	.	.	.	.	G	33	5.208728	0.95069	.	.	ENSG00000104517	ENST00000520539;ENST00000220959;ENST00000521922	T;T;T	0.51325	0.71;0.71;0.71	5.7	5.7	0.88788	.	0.000000	0.85682	D	0.000000	T	0.65112	0.2660	L	0.46157	1.445	0.80722	D	1	D;D	0.71674	0.998;0.998	D;D	0.76071	0.987;0.987	T	0.65516	-0.6149	10	0.72032	D	0.01	.	19.8316	0.96638	0.0:0.0:1.0:0.0	.	1756;1762	E7EMW7;O95071	.;UBR5_HUMAN	D	1762;1762;1756	ENSP00000429084:A1762D;ENSP00000220959:A1762D;ENSP00000427819:A1756D	ENSP00000220959:A1762D	A	-	2	0	UBR5	103367116	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.582000	0.98214	2.687000	0.91594	0.563000	0.77884	GCT	.		0.458	UBR5-001	KNOWN	NAGNAG_splice_site|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000380075.2	NM_015902	
TYRP1	7306	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	12704553	12704553	+	Missense_Mutation	SNP	A	A	G			TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr9:12704553A>G	ENST00000388918.5	+	6	1238	c.1109A>G	c.(1108-1110)gAc>gGc	p.D370G	RP11-3L8.3_ENST00000417638.1_RNA|TYRP1_ENST00000381137.2_Missense_Mutation_p.D79G|TYRP1_ENST00000381136.2_Missense_Mutation_p.D80G	NM_000550.2	NP_000541.1	P17643	TYRP1_HUMAN	tyrosinase-related protein 1	370					acetoacetic acid metabolic process (GO:0043438)|melanin biosynthetic process (GO:0042438)|melanocyte differentiation (GO:0030318)|melanosome organization (GO:0032438)	clathrin-coated endocytic vesicle membrane (GO:0030669)|endosome membrane (GO:0010008)|integral component of membrane (GO:0016021)|melanosome (GO:0042470)|melanosome membrane (GO:0033162)	copper ion binding (GO:0005507)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, another compound as one donor, and incorporation of one atom of oxygen (GO:0016716)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)			NS(1)|endometrium(4)|kidney(2)|large_intestine(4)|lung(10)|stomach(1)	22		all_cancers(3;3.1e-05)|all_lung(3;1.7e-06)|Lung NSC(3;2.09e-06)|all_epithelial(3;0.000695)|all_hematologic(3;0.0033)|Acute lymphoblastic leukemia(23;0.0744)		GBM - Glioblastoma multiforme(50;9.85e-06)		GGAAAGTATGACCCTGCTGTT	0.413									Oculocutaneous Albinism																												p.D370G		.											.	TYRP1-226	0			c.A1109G						.						88.0	73.0	78.0					9																	12704553		2203	4300	6503	SO:0001583	missense	7306	exon6	Familial Cancer Database		AGTATGACCCTGC	L33830	CCDS34990.1	9p23	2013-01-08			ENSG00000107165	ENSG00000107165			12450	protein-coding gene	gene with protein product		115501		TYRP, CAS2		9434945	Standard	NM_000550		Approved	GP75, CATB, TRP, b-PROTEIN, OCA3	uc003zkv.4	P17643	OTTHUMG00000021034	ENST00000388918.5:c.1109A>G	9.37:g.12704553A>G	ENSP00000373570:p.Asp370Gly	Somatic	46	1		WXS	Illumina GAIIx	Phase_I	46	45	NM_000550	0	0	0	0	0	P78468|P78469|Q13721|Q15679	Missense_Mutation	SNP	ENST00000388918.5	37	CCDS34990.1	.	.	.	.	.	.	.	.	.	.	A	25.7	4.665950	0.88251	.	.	ENSG00000107165	ENST00000381137;ENST00000388918;ENST00000381136	D;D;D	0.98512	-4.97;-4.97;-4.97	5.53	5.53	0.82687	Tyrosinase (1);Uncharacterised domain, di-copper centre (2);	0.043209	0.85682	D	0.000000	D	0.98947	0.9642	M	0.88241	2.94	0.80722	D	1	D	0.55800	0.973	P	0.62649	0.905	D	0.99572	1.0971	10	0.72032	D	0.01	-30.5265	15.6677	0.77242	1.0:0.0:0.0:0.0	.	370	P17643	TYRP1_HUMAN	G	79;370;80	ENSP00000370529:D79G;ENSP00000373570:D370G;ENSP00000370528:D80G	ENSP00000370528:D80G	D	+	2	0	TYRP1	12694553	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	8.870000	0.92336	2.092000	0.63282	0.482000	0.46254	GAC	.		0.413	TYRP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055502.3	NM_000550	
NUDT2	318	hgsc.bcm.edu	37	9	34339072	34339072	+	Missense_Mutation	SNP	G	G	T			TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr9:34339072G>T	ENST00000379158.2	+	4	393	c.35G>T	c.(34-36)cGa>cTa	p.R12L	NUDT2_ENST00000379155.5_Missense_Mutation_p.R12L|NUDT2_ENST00000346365.4_Missense_Mutation_p.R12L	NM_001161.4	NP_001152.1	P50583	AP4A_HUMAN	nudix (nucleoside diphosphate linked moiety X)-type motif 2	12	Nudix hydrolase. {ECO:0000255|PROSITE- ProRule:PRU00794}.				apoptotic process (GO:0006915)|nucleobase-containing compound metabolic process (GO:0006139)	mitochondrion (GO:0005739)	bis(5'-nucleosyl)-tetraphosphatase (asymmetrical) activity (GO:0004081)|bis(5'-nucleosyl)-tetraphosphatase (symmetrical) activity (GO:0008803)|GTP binding (GO:0005525)			lung(3)	3			LUSC - Lung squamous cell carcinoma(29;0.0107)	GBM - Glioblastoma multiforme(74;0.126)		ATCATCTTCCGAAGATGCCTC	0.438																																					p.R12L	Melanoma(95;1683 1957 4276 39813)	.											.	NUDT2-90	0			c.G35T						.						160.0	142.0	148.0					9																	34339072		2203	4300	6503	SO:0001583	missense	318	exon3			TCTTCCGAAGATG	U30313	CCDS6552.1	9p13	2008-07-21			ENSG00000164978	ENSG00000164978		"""Nudix motif containing"""	8049	protein-coding gene	gene with protein product	"""Ap4A hydrolase 1"", ""Ap4Aase"", ""bis(5'-nucleosyl)-tetraphosphatase (asymmetrical)"", ""diadenosine tetraphosphatase"", ""diadenosine 5',5''-P1,P4-tetraphosphate pyrophosphohydrolase"""	602852		APAH1		7487923, 9479504	Standard	NM_001161		Approved		uc022bga.1	P50583	OTTHUMG00000019817	ENST00000379158.2:c.35G>T	9.37:g.34339072G>T	ENSP00000368455:p.Arg12Leu	Somatic	82	0		WXS	Illumina GAIIx	Phase_I	100	6	NM_147173	0	0	37	37	0	D3DRM0|Q5T589	Missense_Mutation	SNP	ENST00000379158.2	37	CCDS6552.1	.	.	.	.	.	.	.	.	.	.	G	29.6	5.023048	0.93462	.	.	ENSG00000164978	ENST00000337747;ENST00000379154;ENST00000379155;ENST00000346365;ENST00000379158	.	.	.	5.7	4.8	0.61643	NUDIX hydrolase domain (2);NUDIX hydrolase domain-like (1);	0.000000	0.85682	D	0.000000	D	0.86108	0.5854	H	0.94698	3.57	0.80722	D	1	D	0.89917	1.0	D	0.77004	0.989	D	0.89593	0.3829	9	0.87932	D	0	-6.3625	15.0811	0.72117	0.0692:0.0:0.9308:0.0	.	12	P50583	AP4A_HUMAN	L	12	.	ENSP00000338397:R12L	R	+	2	0	NUDT2	34329072	1.000000	0.71417	1.000000	0.80357	0.973000	0.67179	7.583000	0.82559	2.692000	0.91855	0.655000	0.94253	CGA	.		0.438	NUDT2-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052160.2	NM_001161	
CCIN	881	hgsc.bcm.edu;broad.mit.edu	37	9	36170452	36170452	+	Missense_Mutation	SNP	C	C	A			TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr9:36170452C>A	ENST00000335119.2	+	1	1064	c.953C>A	c.(952-954)gCa>gAa	p.A318E		NM_005893.2	NP_005884.2	Q13939	CALI_HUMAN	calicin	318					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)				breast(3)|endometrium(2)|large_intestine(4)|liver(2)|lung(5)|ovary(1)|skin(4)	21			STAD - Stomach adenocarcinoma(86;0.228)			TATCGGGCAGCAGCACTTAGT	0.542																																					p.A318E		.											.	CCIN-92	0			c.C953A						.						78.0	74.0	75.0					9																	36170452		2203	4300	6503	SO:0001583	missense	881	exon1			GGGCAGCAGCACT	Z46967	CCDS6599.1	9p13.1	2013-10-02			ENSG00000185972	ENSG00000185972		"""BTB/POZ domain containing"""	1568	protein-coding gene	gene with protein product		603960				7641791	Standard	NM_005893		Approved	KBTBD14, BTBD20	uc003zzb.4	Q13939	OTTHUMG00000019901	ENST00000335119.2:c.953C>A	9.37:g.36170452C>A	ENSP00000334996:p.Ala318Glu	Somatic	66	0		WXS	Illumina GAIIx	Phase_I	74	4	NM_005893	0	0	0	0	0	Q9BXG7	Missense_Mutation	SNP	ENST00000335119.2	37	CCDS6599.1	.	.	.	.	.	.	.	.	.	.	C	15.52	2.858763	0.51376	.	.	ENSG00000185972	ENST00000335119	T	0.67345	-0.26	5.97	5.97	0.96955	Kelch-type beta propeller (1);	0.000000	0.56097	D	0.000024	T	0.74535	0.3729	L	0.44542	1.39	0.40702	D	0.982499	D	0.69078	0.997	D	0.81914	0.995	T	0.68183	-0.5476	10	0.18276	T	0.48	.	15.9243	0.79603	0.0:1.0:0.0:0.0	.	318	Q13939	CALI_HUMAN	E	318	ENSP00000334996:A318E	ENSP00000334996:A318E	A	+	2	0	CCIN	36160452	0.964000	0.33143	0.915000	0.36163	0.979000	0.70002	4.483000	0.60264	2.839000	0.97877	0.655000	0.94253	GCA	.		0.542	CCIN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052418.1	NM_005893	
C9orf41	138199	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	77613553	77613553	+	Missense_Mutation	SNP	T	T	C			TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr9:77613553T>C	ENST00000376834.3	-	5	1023	c.871A>G	c.(871-873)Atg>Gtg	p.M291V	RP11-197P3.4_ENST00000455609.1_RNA|C9orf41_ENST00000376837.3_3'UTR	NM_152420.1	NP_689633.1	Q8N4J0	CI041_HUMAN	chromosome 9 open reading frame 41	291										endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(5)|ovary(1)|skin(1)|urinary_tract(2)	17						CCTGCTGTCATAGAAAAGTTA	0.388																																					p.M291V		.											.	C9orf41-92	0			c.A871G						.						62.0	66.0	65.0					9																	77613553		2203	4300	6503	SO:0001583	missense	138199	exon5			CTGTCATAGAAAA	AK098661	CCDS6649.1	9q21.31	2012-03-15			ENSG00000156017	ENSG00000156017			23435	protein-coding gene	gene with protein product						12477932	Standard	NM_152420		Approved	FLJ25795	uc004ajq.3	Q8N4J0	OTTHUMG00000020032	ENST00000376834.3:c.871A>G	9.37:g.77613553T>C	ENSP00000366030:p.Met291Val	Somatic	138	0		WXS	Illumina GAIIx	Phase_I	240	108	NM_152420	0	0	5	7	2	Q7Z383|Q8N7C5	Missense_Mutation	SNP	ENST00000376834.3	37	CCDS6649.1	.	.	.	.	.	.	.	.	.	.	T	24.6	4.554477	0.86231	.	.	ENSG00000156017	ENST00000376834;ENST00000451153	T	0.03242	4.0	5.98	5.98	0.97165	N2227-like (1);	0.000000	0.85682	D	0.000000	T	0.24353	0.0590	M	0.90252	3.1	0.80722	D	1	D	0.59357	0.985	D	0.72338	0.977	T	0.02098	-1.1214	10	0.56958	D	0.05	-17.265	16.4696	0.84102	0.0:0.0:0.0:1.0	.	291	Q8N4J0	CI041_HUMAN	V	291;230	ENSP00000366030:M291V	ENSP00000366030:M291V	M	-	1	0	C9orf41	76803373	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.601000	0.82783	2.289000	0.77006	0.482000	0.46254	ATG	.		0.388	C9orf41-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052703.1	NM_152420	
SECISBP2	79048	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	91949587	91949587	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr9:91949587C>T	ENST00000375807.3	+	7	1102	c.1031C>T	c.(1030-1032)gCt>gTt	p.A344V	SECISBP2_ENST00000339901.4_Missense_Mutation_p.A271V|SECISBP2_ENST00000534113.2_Missense_Mutation_p.A276V	NM_001282688.1|NM_001282690.1|NM_024077.3	NP_001269617.1|NP_001269619.1|NP_076982.3	Q96T21	SEBP2_HUMAN	SECIS binding protein 2	344					translation (GO:0006412)	mitochondrion (GO:0005739)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	mRNA 3'-UTR binding (GO:0003730)|poly(A) RNA binding (GO:0044822)|ribonucleoprotein complex binding (GO:0043021)|selenocysteine insertion sequence binding (GO:0035368)			breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|liver(2)|lung(11)|ovary(3)|skin(2)	32						TCTTCTGAAGCTTTATCTTCG	0.388																																					p.A344V		.											.	SECISBP2-93	0			c.C1031T						.						115.0	111.0	113.0					9																	91949587		2202	4300	6502	SO:0001583	missense	79048	exon7			CTGAAGCTTTATC	AF380995	CCDS6683.1, CCDS65076.1, CCDS65077.1	9q22	2008-02-05			ENSG00000187742	ENSG00000187742			30972	protein-coding gene	gene with protein product		607693				11230166	Standard	XM_005252193		Approved		uc004aqj.1	Q96T21	OTTHUMG00000020182	ENST00000375807.3:c.1031C>T	9.37:g.91949587C>T	ENSP00000364965:p.Ala344Val	Somatic	81	0		WXS	Illumina GAIIx	Phase_I	117	43	NM_024077	0	0	13	37	24	F8W892|Q5HYY1|Q8IYC0|Q9H0A1	Missense_Mutation	SNP	ENST00000375807.3	37	CCDS6683.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	1.974|1.974	-0.435903|-0.435903	0.04636|0.04636	.|.	.|.	ENSG00000187742|ENSG00000187742	ENST00000375807;ENST00000395669;ENST00000339901;ENST00000534113;ENST00000425851|ENST00000440898	T;T;T;T|.	0.71222|.	-0.54;-0.55;-0.53;1.0|.	5.53|5.53	0.574|0.574	0.17368|0.17368	.|.	1.108830|.	0.06693|.	N|.	0.770051|.	T|T	0.15565|0.15565	0.0375|0.0375	N|N	0.02539|0.02539	-0.55|-0.55	0.25122|0.25122	N|N	0.990638|0.990638	B;B;B;B;B|.	0.02656|.	0.0;0.0;0.0;0.0;0.0|.	B;B;B;B;B|.	0.06405|.	0.0;0.0;0.002;0.0;0.001|.	T|T	0.22871|0.22871	-1.0204|-1.0204	10|6	0.07813|0.87932	T|D	0.8|0	-3.1974|-3.1974	7.4209|7.4209	0.27071|0.27071	0.0:0.3638:0.0:0.6362|0.0:0.3638:0.0:0.6362	.|.	351;343;271;344;276|.	Q59H19;B4DZC7;Q96T21-2;Q96T21;F8W892|.	.;.;.;SEBP2_HUMAN;.|.	V|F	344;350;271;276;141|24	ENSP00000364965:A344V;ENSP00000364959:A271V;ENSP00000436650:A276V;ENSP00000414288:A141V|.	ENSP00000364959:A271V|ENSP00000411573:L24F	A|L	+|+	2|1	0|0	SECISBP2|SECISBP2	91139407|91139407	0.917000|0.917000	0.31117|0.31117	0.970000|0.970000	0.41538|0.41538	0.938000|0.938000	0.57974|0.57974	0.458000|0.458000	0.21892|0.21892	-0.027000|-0.027000	0.13873|0.13873	-0.982000|-0.982000	0.02568|0.02568	GCT|CTT	.		0.388	SECISBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052990.3	NM_024077	
CDK5RAP2	55755	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	9	123290085	123290085	+	Splice_Site	DEL	T	T	-			TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr9:123290085delT	ENST00000349780.4	-	10	1177	c.998delA	c.(997-999)aag>ag	p.K333fs	CDK5RAP2_ENST00000360190.4_Splice_Site_p.K333fs|CDK5RAP2_ENST00000360822.3_Splice_Site_p.K333fs|CDK5RAP2_ENST00000359309.3_Splice_Site_p.K333fs	NM_018249.4	NP_060719.4	Q96SN8	CK5P2_HUMAN	CDK5 regulatory subunit associated protein 2	333					brain development (GO:0007420)|centrosome organization (GO:0051297)|chromosome segregation (GO:0007059)|establishment of mitotic spindle orientation (GO:0000132)|G2/M transition of mitotic cell cycle (GO:0000086)|microtubule bundle formation (GO:0001578)|microtubule cytoskeleton organization (GO:0000226)|mitotic cell cycle (GO:0000278)|negative regulation of centriole replication (GO:0046600)|negative regulation of neuron differentiation (GO:0045665)|neurogenesis (GO:0022008)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of neuron differentiation (GO:0045664)|regulation of spindle checkpoint (GO:0090231)	cell junction (GO:0030054)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|pericentriolar material (GO:0000242)|perinuclear region of cytoplasm (GO:0048471)|spindle pole (GO:0000922)	calmodulin binding (GO:0005516)|microtubule binding (GO:0008017)|protein kinase binding (GO:0019901)|transcription regulatory region DNA binding (GO:0044212)|tubulin binding (GO:0015631)			breast(6)|central_nervous_system(1)|endometrium(3)|kidney(4)|large_intestine(12)|lung(21)|ovary(2)|prostate(2)|skin(6)|urinary_tract(1)	58						CAGACATACCTTTTTTTCCTT	0.333																																					p.K333fs		.											.	CDK5RAP2-229	0			c.998delA						.						133.0	123.0	126.0					9																	123290085		2202	4300	6502	SO:0001630	splice_region_variant	55755	exon10			CATACCTTTTTTT	BK005504	CCDS6823.1, CCDS43871.1, CCDS75888.1	9q33.3	2014-02-21			ENSG00000136861	ENSG00000136861			18672	protein-coding gene	gene with protein product	"""centrosomin"""	608201	"""microcephaly, primary autosomal recessive 3"""	MCPH3		10721722, 17764569, 24466316	Standard	NM_018249		Approved	C48, FLJ10867, CEP215	uc004bkf.4	Q96SN8	OTTHUMG00000021043	ENST00000349780.4:c.999+1A>-	9.37:g.123290085delT		Somatic	28	0		WXS	Illumina GAIIx	Phase_I	53	26	NM_018249	0	0	0	0	0	Q5JV18|Q7Z3L4|Q7Z3U1|Q7Z7I6|Q9BSW0|Q9H6J6|Q9HCD9|Q9NV90|Q9UIW9	Frame_Shift_Del	DEL	ENST00000349780.4	37	CCDS6823.1																																																																																			.		0.333	CDK5RAP2-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000055535.1	NM_018249	Frame_Shift_Del
NR5A1	2516	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	9	127253373	127253375	+	In_Frame_Del	DEL	GAT	GAT	-			TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10	GAT	GAT	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr9:127253373_127253375delGAT	ENST00000373588.4	-	6	1319_1321	c.1123_1125delATC	c.(1123-1125)atcdel	p.I375del		NM_004959.4	NP_004950.2	Q13285	STF1_HUMAN	nuclear receptor subfamily 5, group A, member 1	375	Important for dimerization.				adrenal gland development (GO:0030325)|cell differentiation (GO:0030154)|cell-cell signaling (GO:0007267)|gene expression (GO:0010467)|hormone metabolic process (GO:0042445)|intracellular receptor signaling pathway (GO:0030522)|luteinization (GO:0001553)|maintenance of protein location in nucleus (GO:0051457)|male gonad development (GO:0008584)|multicellular organismal aging (GO:0010259)|negative regulation of female gonad development (GO:2000195)|positive regulation of male gonad development (GO:2000020)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|primary sex determination (GO:0007538)|regulation of steroid biosynthetic process (GO:0050810)|tissue development (GO:0009888)|transcription initiation from RNA polymerase II promoter (GO:0006367)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|double-stranded DNA binding (GO:0003690)|enzyme binding (GO:0019899)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|phospholipid binding (GO:0005543)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding (GO:0043565)|steroid hormone receptor activity (GO:0003707)|transcription coactivator activity (GO:0003713)|zinc ion binding (GO:0008270)			lung(1)|upper_aerodigestive_tract(1)	2						GGCTGAAGAGGATGATGAACTTG	0.64																																					p.375_375del		.											.	NR5A1-186	0			c.1123_1125del						.																																			SO:0001651	inframe_deletion	2516	exon6			GAAGAGGATGATG	D88155	CCDS6856.1	9q33	2013-01-16			ENSG00000136931	ENSG00000136931		"""Nuclear hormone receptors"""	7983	protein-coding gene	gene with protein product		184757		FTZF1		7789992	Standard	NM_004959		Approved	FTZ1, SF-1, ELP, AD4BP	uc004boo.1	Q13285	OTTHUMG00000020655	ENST00000373588.4:c.1123_1125delATC	9.37:g.127253376_127253378delGAT	ENSP00000362690:p.Ile375del	Somatic	98	0		WXS	Illumina GAIIx	Phase_I	240	106	NM_004959	0	0	0	0	0	O15196|Q5T6F5	In_Frame_Del	DEL	ENST00000373588.4	37	CCDS6856.1																																																																																			.		0.640	NR5A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054029.1	NM_004959	
GOLGA1	2800	ucsc.edu;bcgsc.ca	37	9	127674275	127674275	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr9:127674275C>T	ENST00000373555.4	-	11	1207	c.874G>A	c.(874-876)Gtt>Att	p.V292I		NM_002077.3	NP_002068	Q92805	GOGA1_HUMAN	golgin A1	292					protein targeting to Golgi (GO:0000042)	Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)|trans-Golgi network (GO:0005802)		p.V292I(1)		NS(1)|endometrium(5)|kidney(2)|large_intestine(3)|lung(7)|ovary(1)|stomach(1)	20						TGTGTGATAACGTCTTCTTTC	0.443																																					p.V292I		.											.	GOLGA1-91	1	Substitution - Missense(1)	large_intestine(1)	c.G874A						.						205.0	184.0	191.0					9																	127674275		2203	4300	6503	SO:0001583	missense	2800	exon11			TGATAACGTCTTC	U51587	CCDS6860.1	9q34.11	2010-02-12	2010-02-12		ENSG00000136935	ENSG00000136935			4424	protein-coding gene	gene with protein product		602502	"""golgi autoantigen, golgin subfamily a, 1"""			9324025	Standard	NM_002077		Approved	golgin-97, MGC33154	uc004bpc.3	Q92805	OTTHUMG00000020665	ENST00000373555.4:c.874G>A	9.37:g.127674275C>T	ENSP00000362656:p.Val292Ile	Somatic	106	2		WXS	Illumina GAIIx	Phase_I	214	117	NM_002077	0	0	7	11	4	Q5T164|Q8IYZ9	Missense_Mutation	SNP	ENST00000373555.4	37	CCDS6860.1	.	.	.	.	.	.	.	.	.	.	C	0.011	-1.706135	0.00719	.	.	ENSG00000136935	ENST00000373555	T	0.76839	-1.05	5.84	-0.601	0.11638	.	0.187899	0.25503	U	0.030222	T	0.56543	0.1992	N	0.19112	0.55	0.09310	N	1	B;B	0.10296	0.003;0.002	B;B	0.08055	0.003;0.0	T	0.35400	-0.9790	10	0.33940	T	0.23	1.5149	5.6101	0.17400	0.1359:0.4923:0.2678:0.104	.	191;292	Q59HA1;Q92805	.;GOGA1_HUMAN	I	292	ENSP00000362656:V292I	ENSP00000362656:V292I	V	-	1	0	GOLGA1	126714096	0.968000	0.33430	0.000000	0.03702	0.005000	0.04900	-0.118000	0.10692	-0.688000	0.05155	-0.829000	0.03081	GTT	.		0.443	GOLGA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054049.1	NM_002077	
GAPVD1	26130	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	9	128069806	128069806	+	Missense_Mutation	SNP	T	T	C			TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr9:128069806T>C	ENST00000495955.1	+	7	1521	c.1231T>C	c.(1231-1233)Tac>Cac	p.Y411H	GAPVD1_ENST00000297933.6_Missense_Mutation_p.Y411H|GAPVD1_ENST00000312123.9_Missense_Mutation_p.Y411H|GAPVD1_ENST00000394083.2_Missense_Mutation_p.Y411H|GAPVD1_ENST00000394084.1_Missense_Mutation_p.Y411H|GAPVD1_ENST00000265956.4_Missense_Mutation_p.Y411H|GAPVD1_ENST00000394105.2_Missense_Mutation_p.Y411H|GAPVD1_ENST00000394104.2_Missense_Mutation_p.Y411H|GAPVD1_ENST00000470056.1_Missense_Mutation_p.Y411H			Q14C86	GAPD1_HUMAN	GTPase activating protein and VPS9 domains 1	411					endocytosis (GO:0006897)|positive regulation of GTPase activity (GO:0043547)|regulation of protein transport (GO:0051223)|regulation of small GTPase mediated signal transduction (GO:0051056)|signal transduction (GO:0007165)	cytosol (GO:0005829)|endosome (GO:0005768)|membrane (GO:0016020)	GTPase activating protein binding (GO:0032794)|GTPase activator activity (GO:0005096)|guanyl-nucleotide exchange factor activity (GO:0005085)			central_nervous_system(2)|endometrium(7)|kidney(4)|large_intestine(10)|lung(11)|ovary(2)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	44						TTATATAACCTACAGTCAGCT	0.418																																					p.Y411H		.											.	GAPVD1-93	0			c.T1231C						.						55.0	54.0	55.0					9																	128069806		2203	4300	6503	SO:0001583	missense	26130	exon5			ATAACCTACAGTC		CCDS65130.1, CCDS65131.1, CCDS65132.1	9q34.11	2008-02-05			ENSG00000165219	ENSG00000165219			23375	protein-coding gene	gene with protein product		611714					Standard	XM_005251901		Approved	DKFZP434C212, KIAA1521	uc004bpr.3	Q14C86	OTTHUMG00000020678	ENST00000495955.1:c.1231T>C	9.37:g.128069806T>C	ENSP00000419063:p.Tyr411His	Somatic	59	0		WXS	Illumina GAIIx	Phase_I	82	6	NM_015635	0	0	4	4	0	A8MYK3|B0QZ62|B0QZ63|B0QZ64|Q14C76|Q2Q1W1|Q8ND92|Q8WU86|Q96CZ4|Q9NXQ1|Q9P207|Q9Y4N0	Missense_Mutation	SNP	ENST00000495955.1	37		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	10.17|10.17	1.276655|1.276655	0.23307|0.23307	.|.	.|.	ENSG00000165219|ENSG00000165219	ENST00000436712|ENST00000394084;ENST00000470056;ENST00000394105;ENST00000394104;ENST00000265956;ENST00000394083;ENST00000495955;ENST00000467750;ENST00000297933;ENST00000312123	.|D;D;D;D;D;D;D;D;D;D	.|0.82255	.|-1.59;-1.59;-1.59;-1.59;-1.59;-1.59;-1.59;-1.59;-1.59;-1.59	5.32|5.32	4.15|4.15	0.48705|0.48705	.|Rho GTPase activation protein (1);	.|0.107759	.|0.64402	.|N	.|0.000004	T|T	0.65709|0.65709	0.2717|0.2717	N|N	0.08118|0.08118	0|0	0.43874|0.43874	D|D	0.996488|0.996488	.|B;B;B;B;B;B;B	.|0.17268	.|0.004;0.003;0.004;0.004;0.001;0.021;0.001	.|B;B;B;B;B;B;B	.|0.13407	.|0.006;0.003;0.004;0.004;0.003;0.009;0.001	T|T	0.57359|0.57359	-0.7825|-0.7825	5|10	.|0.26408	.|T	.|0.33	.|.	10.7942|10.7942	0.46451|0.46451	0.0:0.0758:0.0:0.9242|0.0:0.0758:0.0:0.9242	.|.	.|411;411;411;411;411;411;411	.|Q14C86-5;Q14C86;Q14C86-3;Q14C86-4;Q14C86-2;Q14C86-6;B0QZ65	.|.;GAPD1_HUMAN;.;.;.;.;.	P|H	241|411	.|ENSP00000377646:Y411H;ENSP00000419767:Y411H;ENSP00000377665:Y411H;ENSP00000377664:Y411H;ENSP00000265956:Y411H;ENSP00000377645:Y411H;ENSP00000419063:Y411H;ENSP00000418747:Y411H;ENSP00000297933:Y411H;ENSP00000309582:Y411H	.|ENSP00000265956:Y411H	L|Y	+|+	2|1	0|0	GAPVD1|GAPVD1	127109627|127109627	0.997000|0.997000	0.39634|0.39634	1.000000|1.000000	0.80357|0.80357	0.953000|0.953000	0.61014|0.61014	2.868000|2.868000	0.48436|0.48436	0.927000|0.927000	0.37143|0.37143	0.460000|0.460000	0.39030|0.39030	CTA|TAC	.		0.418	GAPVD1-014	KNOWN	alternative_5_UTR|basic	protein_coding	protein_coding	OTTHUMT00000355644.1		
GOLGA2	2801	hgsc.bcm.edu;broad.mit.edu	37	9	131022875	131022875	+	Frame_Shift_Del	DEL	C	C	-	rs369777097		TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr9:131022875delC	ENST00000421699.2	-	17	1558	c.1546delG	c.(1546-1548)gagfs	p.E516fs	GOLGA2_ENST00000609374.1_Frame_Shift_Del_p.E504fs|AL590708.1_ENST00000408370.1_RNA	NM_004486.4	NP_004477.3	Q08379	GOGA2_HUMAN	golgin A2	516					mitotic cell cycle (GO:0000278)	cis-Golgi network (GO:0005801)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)				NS(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(10)|lung(13)|ovary(2)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	34						TCCGCCTGCTCCCCCCAGAGC	0.657																																					p.E516fs		.											.	GOLGA2-91	0			c.1546delG						.						74.0	86.0	82.0					9																	131022875		2203	4299	6502	SO:0001589	frameshift_variant	2801	exon17			CCTGCTCCCCCCA	L06147	CCDS6896.2	9q34.13	2010-06-28	2010-02-12		ENSG00000167110	ENSG00000167110			4425	protein-coding gene	gene with protein product	"""Golgi matrix protein GM130"", ""SY11 protein"""	602580	"""golgi autoantigen, golgin subfamily a, 2"""			8315394	Standard	NM_004486		Approved	GM130, golgin-95	uc011maw.2	Q08379	OTTHUMG00000020732	ENST00000421699.2:c.1546delG	9.37:g.131022875delC	ENSP00000416097:p.Glu516fs	Somatic	31	0		WXS	Illumina GAIIx	Phase_I	127	19	NM_004486	0	0	0	0	0	Q6GRM9|Q9BRB0|Q9NYF9	Frame_Shift_Del	DEL	ENST00000421699.2	37	CCDS6896.2																																																																																			.		0.657	GOLGA2-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054358.2	NM_004486	
STKLD1	169436	hgsc.bcm.edu;bcgsc.ca	37	9	136262309	136262311	+	In_Frame_Del	DEL	CTT	CTT	-			TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10	CTT	CTT	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr9:136262309_136262311delCTT	ENST00000371957.3	+	10	992_994	c.885_887delCTT	c.(883-888)accttc>acc	p.F296del	C9orf96_ENST00000371955.1_5'UTR	NM_153710.3	NP_714921.4	Q8NE28	STKL1_HUMAN		296	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.						ATP binding (GO:0005524)|protein kinase activity (GO:0004672)			autonomic_ganglia(1)|central_nervous_system(3)|endometrium(1)|kidney(1)|large_intestine(5)|lung(10)|ovary(2)|stomach(2)	25				OV - Ovarian serous cystadenocarcinoma(145;1.06e-07)|Epithelial(140;1.28e-06)|all cancers(34;1.46e-05)		TGCACATCACCTTCTTGAGAGGC	0.631																																					p.295_296del		.											.	C9orf96-334	0			c.885_887del						.																																			SO:0001651	inframe_deletion	169436	exon10			CATCACCTTCTTG																												ENST00000371957.3:c.885_887delCTT	9.37:g.136262312_136262314delCTT	ENSP00000361025:p.Phe296del	Somatic	116	1		WXS	Illumina GAIIx	Phase_I	252	103	NM_153710	0	0	0	0	0	Q5T8U8|Q6ZMP6|Q6ZMQ5	In_Frame_Del	DEL	ENST00000371957.3	37	CCDS35169.1																																																																																			.		0.631	C9orf96-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054855.1		
ADAMTS13	11093	broad.mit.edu;bcgsc.ca	37	9	136303424	136303424	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr9:136303424G>A	ENST00000371929.3	+	14	2087	c.1643G>A	c.(1642-1644)tGt>tAt	p.C548Y	ADAMTS13_ENST00000371916.1_3'UTR|ADAMTS13_ENST00000356589.2_Missense_Mutation_p.C517Y|ADAMTS13_ENST00000355699.2_Missense_Mutation_p.C548Y|ADAMTS13_ENST00000536611.1_Missense_Mutation_p.C220Y|ADAMTS13_ENST00000485925.1_Intron	NM_139025.3|NM_139027.3	NP_620594.1|NP_620596.2	Q76LX8	ATS13_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 13	548	Cysteine-rich.				cell-matrix adhesion (GO:0007160)|glycoprotein metabolic process (GO:0009100)|integrin-mediated signaling pathway (GO:0007229)|peptide catabolic process (GO:0043171)|platelet activation (GO:0030168)|protein processing (GO:0016485)|proteolysis (GO:0006508)|response to interferon-gamma (GO:0034341)|response to interleukin-4 (GO:0070670)|response to tumor necrosis factor (GO:0034612)	cell surface (GO:0009986)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|integrin binding (GO:0005178)|metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(3)|lung(13)|ovary(2)|prostate(3)|skin(4)	36				OV - Ovarian serous cystadenocarcinoma(145;1.06e-07)|Epithelial(140;1.28e-06)|all cancers(34;1.46e-05)		TGCCAGGTGTGTGGTGGGGAC	0.627																																					p.C548Y		.											.	ADAMTS13-229	0			c.G1643A						.						140.0	117.0	124.0					9																	136303424		2203	4300	6503	SO:0001583	missense	11093	exon14			AGGTGTGTGGTGG	AJ011374	CCDS6970.1, CCDS6971.1, CCDS6972.1	9q34	2008-07-21	2005-08-19	2001-09-21	ENSG00000160323	ENSG00000160323		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	1366	protein-coding gene	gene with protein product		604134	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 13"""	C9orf8		11557746, 11535495	Standard	NM_139025		Approved	VWFCP, TTP, vWF-CP, FLJ42993, MGC118899, MGC118900, DKFZp434C2322	uc004cdv.4	Q76LX8	OTTHUMG00000020876	ENST00000371929.3:c.1643G>A	9.37:g.136303424G>A	ENSP00000360997:p.Cys548Tyr	Somatic	160	0		WXS	Illumina GAIIx	Phase_I	314	12	NM_139027	0	0	3	3	0	Q6UY16|Q710F6|Q711T8|Q96L37|Q9H0G3|Q9UGQ1	Missense_Mutation	SNP	ENST00000371929.3	37	CCDS6970.1	.	.	.	.	.	.	.	.	.	.	G	17.35	3.366454	0.61513	.	.	ENSG00000160323	ENST00000371929;ENST00000355699;ENST00000356589;ENST00000536611	T;T;T;T	0.72835	-0.69;-0.69;-0.69;-0.69	4.8	4.8	0.61643	.	.	.	.	.	D	0.89125	0.6626	H	0.96175	3.78	0.52099	D	0.999947	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.999;0.999	D	0.92827	0.6277	9	0.87932	D	0	.	16.4597	0.84032	0.0:0.0:1.0:0.0	.	548;517;548	Q76LX8;Q76LX8-3;Q76LX8-2	ATS13_HUMAN;.;.	Y	548;548;517;220	ENSP00000360997:C548Y;ENSP00000347927:C548Y;ENSP00000348997:C517Y;ENSP00000444504:C220Y	ENSP00000347927:C548Y	C	+	2	0	ADAMTS13	135293245	1.000000	0.71417	0.957000	0.39632	0.446000	0.32137	8.094000	0.89533	2.181000	0.69327	0.561000	0.74099	TGT	.		0.627	ADAMTS13-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000054920.1	NM_139025	
BRD3	8019	broad.mit.edu;bcgsc.ca	37	9	136918407	136918407	+	Missense_Mutation	SNP	C	C	T	rs200965087		TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr9:136918407C>T	ENST00000303407.7	-	2	378	c.193G>A	c.(193-195)Gca>Aca	p.A65T	BRD3_ENST00000357885.2_Missense_Mutation_p.A65T|RP11-374P20.4_ENST00000412181.1_RNA|BRD3_ENST00000371834.2_Missense_Mutation_p.A65T	NM_007371.3	NP_031397.1	Q15059	BRD3_HUMAN	bromodomain containing 3	65	Bromo 1. {ECO:0000255|PROSITE- ProRule:PRU00035}.				chromatin modification (GO:0016568)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|lysine-acetylated histone binding (GO:0070577)		BRD3/C15orf55(3)	kidney(1)|skin(1)|stomach(4)	6				OV - Ovarian serous cystadenocarcinoma(145;1.43e-08)|Epithelial(140;8.41e-08)|all cancers(34;5.21e-07)		AATTTGATTGCGTCCACGGGC	0.617			T	C15orf55	lethal midline carcinoma of young people								C|||	1	0.000199681	0.0	0.0014	5008	,	,		15150	0.0		0.0	False		,,,				2504	0.0				p.A65T		.		Dom	yes		9	9q34	8019	bromodomain containing 3		E	.	BRD3-377	0			c.G193A						.						71.0	70.0	70.0					9																	136918407		2203	4300	6503	SO:0001583	missense	8019	exon2			TGATTGCGTCCAC		CCDS6980.1	9q34	2010-12-23	2002-01-14		ENSG00000169925	ENSG00000169925			1104	protein-coding gene	gene with protein product	"""RING3-like"""	601541	"""bromodomain-containing 3"""			7584044, 8781126	Standard	NM_007371		Approved	RING3L, ORFX, KIAA0043	uc004cew.3	Q15059	OTTHUMG00000021004	ENST00000303407.7:c.193G>A	9.37:g.136918407C>T	ENSP00000305918:p.Ala65Thr	Somatic	65	3		WXS	Illumina GAIIx	Phase_I	125	59	NM_007371	0	0	2	8	6	B1APD9|Q4G5Y3|Q5T1R7|Q8N5M3|Q92645	Missense_Mutation	SNP	ENST00000303407.7	37	CCDS6980.1	1	4.578754578754579E-4	0	0.0	1	0.0027624309392265192	0	0.0	0	0.0	C	19.50	3.840034	0.71488	.	.	ENSG00000169925	ENST00000303407;ENST00000371834;ENST00000357885;ENST00000371842	T;T;T;T	0.19105	2.17;2.17;2.17;2.17	5.28	5.28	0.74379	Bromodomain (6);Bromodomain, conserved site (1);	0.000000	0.64402	D	0.000001	T	0.30978	0.0782	L	0.55103	1.725	0.80722	D	1	P;D	0.58268	0.768;0.982	B;P	0.51701	0.293;0.677	T	0.01648	-1.1304	10	0.51188	T	0.08	-24.3143	12.9258	0.58260	0.1622:0.8378:0.0:0.0	.	65;65	Q15059-2;Q15059	.;BRD3_HUMAN	T	65	ENSP00000305918:A65T;ENSP00000360900:A65T;ENSP00000350557:A65T;ENSP00000360908:A65T	ENSP00000305918:A65T	A	-	1	0	BRD3	135908228	1.000000	0.71417	0.958000	0.39756	0.042000	0.13812	5.706000	0.68362	2.452000	0.82932	0.563000	0.77884	GCA	C|0.999;T|0.000		0.617	BRD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055390.4	NM_007371	
FCN2	2220	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	137777089	137777089	+	Silent	SNP	G	G	A	rs369807019		TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr9:137777089G>A	ENST00000291744.6	+	5	316	c.306G>A	c.(304-306)ccG>ccA	p.P102P	FCN2_ENST00000350339.2_Silent_p.P64P	NM_004108.2	NP_004099.2	Q15485	FCN2_HUMAN	ficolin (collagen/fibrinogen domain containing lectin) 2	102	Fibrinogen C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00739}.				complement activation (GO:0006956)|complement activation, lectin pathway (GO:0001867)|innate immune response (GO:0045087)|opsonization (GO:0008228)	blood microparticle (GO:0072562)|collagen trimer (GO:0005581)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	antigen binding (GO:0003823)|calcium ion binding (GO:0005509)|calcium-dependent protein binding (GO:0048306)|carbohydrate binding (GO:0030246)			breast(2)|central_nervous_system(1)|large_intestine(4)|lung(8)|ovary(1)|prostate(2)|urinary_tract(2)	20		Myeloproliferative disorder(178;0.0333)		OV - Ovarian serous cystadenocarcinoma(145;3.58e-08)|Epithelial(140;6.41e-08)|all cancers(34;3.96e-07)		TCCCAGGCCCGCGTACCTGCA	0.662													G|||	1	0.000199681	0.0	0.0	5008	,	,		16065	0.0		0.0	False		,,,				2504	0.001				p.P102P		.											.	FCN2-153	0			c.G306A						.						56.0	54.0	55.0					9																	137777089		2203	4300	6503	SO:0001819	synonymous_variant	2220	exon5			AGGCCCGCGTACC	D49353	CCDS6983.1	9q34	2013-09-12	2013-09-12		ENSG00000160339	ENSG00000160339		"""Fibrinogen C domain containing"""	3624	protein-coding gene	gene with protein product	"""hucolin"", ""collagen/fibrinogen domain-containing protein 2"", ""ficolin B"", ""serum lectin p35"", ""L-ficolin"""	601624	"""ficolin (collagen/fibrinogen domain-containing lectin) 2 (hucolin)"""			8884275	Standard	XM_006717015		Approved	P35, FCNL, EBP-37, ficolin-2	uc004cfg.1	Q15485	OTTHUMG00000020892	ENST00000291744.6:c.306G>A	9.37:g.137777089G>A		Somatic	94	1		WXS	Illumina GAIIx	Phase_I	181	98	NM_004108	0	0	0	0	0	A6NFG7|A8K478|Q6IS69|Q7M4P4|Q9UC57	Silent	SNP	ENST00000291744.6	37	CCDS6983.1																																																																																			.		0.662	FCN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054960.1	NM_004108	
PPP1R26	9858	broad.mit.edu;ucsc.edu;bcgsc.ca	37	9	138377451	138377451	+	Silent	SNP	C	C	T	rs138779417		TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr9:138377451C>T	ENST00000356818.2	+	4	1644	c.1095C>T	c.(1093-1095)gaC>gaT	p.D365D	PPP1R26_ENST00000605660.1_Silent_p.D365D|PPP1R26_ENST00000401470.3_Silent_p.D365D|PPP1R26_ENST00000605286.1_Silent_p.D365D|PPP1R26_ENST00000604351.1_Silent_p.D365D|PPP1R26_ENST00000602993.1_Intron	NM_014811.3	NP_055626.3	Q5T8A7	PPR26_HUMAN	protein phosphatase 1, regulatory subunit 26	365					negative regulation of phosphatase activity (GO:0010923)	nucleus (GO:0005634)	phosphatase binding (GO:0019902)|protein phosphatase inhibitor activity (GO:0004864)										CCAGCAGCGACGATGGCATTG	0.617													C|||	1	0.000199681	0.0008	0.0	5008	,	,		18814	0.0		0.0	False		,,,				2504	0.0				p.D365D		.											.	.	0			c.C1095T						.	C		1,4405	4.2+/-10.8	0,1,2202	49.0	56.0	53.0		1095	-4.7	0.2	9	dbSNP_134	53	0,8600		0,0,4300	yes	coding-synonymous	KIAA0649	NM_014811.3		0,1,6502	TT,TC,CC		0.0,0.0227,0.0077		365/1210	138377451	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	9858	exon4			CAGCGACGATGGC	AB014549	CCDS6988.1	9q34.3	2012-04-17	2011-10-11	2011-10-11	ENSG00000196422	ENSG00000196422		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	29089	protein-coding gene	gene with protein product	"""DRIM/UTP20 interacting protein"", ""1A6/DRIM (down-regulated in metastasis) interacting protein"""	614056	"""KIAA0649"""	KIAA0649		9734811, 16053918	Standard	NM_014811		Approved		uc004cfr.1	Q5T8A7	OTTHUMG00000020904	ENST00000356818.2:c.1095C>T	9.37:g.138377451C>T		Somatic	171	1		WXS	Illumina GAIIx	Phase_I	331	159	NM_014811	0	0	8	10	2	Q86WU0|Q8WVV0|Q9Y4D3	Silent	SNP	ENST00000356818.2	37	CCDS6988.1																																																																																			C|1.000;T|0.000		0.617	PPP1R26-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054987.1	NM_014811	
KCNT1	57582	broad.mit.edu;ucsc.edu;bcgsc.ca	37	9	138662903	138662903	+	Missense_Mutation	SNP	C	C	T	rs566157365		TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr9:138662903C>T	ENST00000263604.3	+	18	1913	c.1913C>T	c.(1912-1914)cCg>cTg	p.P638L	KCNT1_ENST00000491806.2_Missense_Mutation_p.P624L|KCNT1_ENST00000487664.1_Missense_Mutation_p.P612L|KCNT1_ENST00000298480.5_Missense_Mutation_p.P657L|KCNT1_ENST00000371757.2_Missense_Mutation_p.P657L|KCNT1_ENST00000486577.2_Missense_Mutation_p.P618L|KCNT1_ENST00000490355.2_Missense_Mutation_p.P638L|KCNT1_ENST00000488444.2_Missense_Mutation_p.P638L			Q5JUK3	KCNT1_HUMAN	potassium channel, subfamily T, member 1	638					potassium ion transmembrane transport (GO:0071805)	voltage-gated potassium channel complex (GO:0008076)	calcium-activated potassium channel activity (GO:0015269)|voltage-gated potassium channel activity (GO:0005249)			breast(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(18)|ovary(1)|pancreas(3)|prostate(5)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	50		Myeloproliferative disorder(178;0.0821)		OV - Ovarian serous cystadenocarcinoma(145;2.11e-07)|Epithelial(140;1.57e-06)|all cancers(34;9.22e-05)		CACGAGGGTCCGGCCCGCCTG	0.662													C|||	1	0.000199681	0.0	0.0	5008	,	,		14231	0.001		0.0	False		,,,				2504	0.0				p.P657L		.											.	KCNT1-137	0			c.C1970T						.						35.0	32.0	33.0					9																	138662903		2202	4300	6502	SO:0001583	missense	57582	exon18			AGGGTCCGGCCCG	AB037843	CCDS35175.1, CCDS35175.2, CCDS65188.1	9q34.3	2012-07-05			ENSG00000107147	ENSG00000107147		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, calcium-activated"""	18865	protein-coding gene	gene with protein product		608167				10718198, 16382103	Standard	NM_020822		Approved	KCa4.1, KIAA1422	uc011mdq.2	Q5JUK3	OTTHUMG00000020917	ENST00000263604.3:c.1913C>T	9.37:g.138662903C>T	ENSP00000263604:p.Pro638Leu	Somatic	94	1		WXS	Illumina GAIIx	Phase_I	258	139	NM_020822	0	0	0	1	1	B3KXF7|B7ZVY4|B9EGP2|G5E9V0|Q9P2C5	Missense_Mutation	SNP	ENST00000263604.3	37		.	.	.	.	.	.	.	.	.	.	C	8.646	0.897161	0.17686	.	.	ENSG00000107147	ENST00000487664;ENST00000298480;ENST00000371757;ENST00000486577;ENST00000491806;ENST00000488444;ENST00000490355;ENST00000263604	T;T;T;T	0.21361	2.02;2.02;2.02;2.01	3.39	3.39	0.38822	.	0.070966	0.56097	U	0.000024	T	0.16642	0.0400	L	0.33485	1.01	0.80722	D	1	B;B;B;B	0.16166	0.016;0.002;0.011;0.016	B;B;B;B	0.12156	0.007;0.002;0.005;0.003	T	0.05699	-1.0869	10	0.24483	T	0.36	-18.7713	14.9668	0.71201	0.0:1.0:0.0:0.0	.	624;657;612;638	C9JYL2;B9EGP2;G5E9V0;Q5JUK3	.;.;.;KCNT1_HUMAN	L	612;657;657;618;624;638;638;638	ENSP00000417851:P612L;ENSP00000298480:P657L;ENSP00000360822:P657L;ENSP00000263604:P638L	ENSP00000263604:P638L	P	+	2	0	KCNT1	137802724	0.976000	0.34144	0.007000	0.13788	0.146000	0.21551	4.164000	0.58190	1.723000	0.51488	0.467000	0.42956	CCG	.		0.662	KCNT1-201	KNOWN	basic|appris_candidate	protein_coding	protein_coding		NM_020822	
KCNT1	57582	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	9	138669186	138669186	+	Silent	SNP	C	C	T			TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr9:138669186C>T	ENST00000263604.3	+	21	2295	c.2295C>T	c.(2293-2295)ggC>ggT	p.G765G	KCNT1_ENST00000491806.2_Silent_p.G751G|KCNT1_ENST00000487664.1_Silent_p.G739G|KCNT1_ENST00000298480.5_Silent_p.G784G|KCNT1_ENST00000371757.2_Silent_p.G784G|KCNT1_ENST00000486577.2_Silent_p.G743G|KCNT1_ENST00000490355.2_Silent_p.G763G|KCNT1_ENST00000488444.2_Silent_p.G765G			Q5JUK3	KCNT1_HUMAN	potassium channel, subfamily T, member 1	765					potassium ion transmembrane transport (GO:0071805)	voltage-gated potassium channel complex (GO:0008076)	calcium-activated potassium channel activity (GO:0015269)|voltage-gated potassium channel activity (GO:0005249)			breast(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(18)|ovary(1)|pancreas(3)|prostate(5)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	50		Myeloproliferative disorder(178;0.0821)		OV - Ovarian serous cystadenocarcinoma(145;2.11e-07)|Epithelial(140;1.57e-06)|all cancers(34;9.22e-05)		GCCCCCAGGGCTGCAAGCACA	0.602																																					p.G784G		.											.	KCNT1-137	0			c.C2352T						.						81.0	77.0	78.0					9																	138669186		2203	4300	6503	SO:0001819	synonymous_variant	57582	exon21			CCAGGGCTGCAAG	AB037843	CCDS35175.1, CCDS35175.2, CCDS65188.1	9q34.3	2012-07-05			ENSG00000107147	ENSG00000107147		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, calcium-activated"""	18865	protein-coding gene	gene with protein product		608167				10718198, 16382103	Standard	NM_020822		Approved	KCa4.1, KIAA1422	uc011mdq.2	Q5JUK3	OTTHUMG00000020917	ENST00000263604.3:c.2295C>T	9.37:g.138669186C>T		Somatic	230	0		WXS	Illumina GAIIx	Phase_I	464	42	NM_020822	0	0	0	0	0	B3KXF7|B7ZVY4|B9EGP2|G5E9V0|Q9P2C5	Silent	SNP	ENST00000263604.3	37																																																																																				.		0.602	KCNT1-201	KNOWN	basic|appris_candidate	protein_coding	protein_coding		NM_020822	
GRIN1	2902	broad.mit.edu;bcgsc.ca;mdanderson.org	37	9	140055846	140055846	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr9:140055846G>A	ENST00000371561.3	+	10	2542	c.1445G>A	c.(1444-1446)gGc>gAc	p.G482D	GRIN1_ENST00000371550.4_Missense_Mutation_p.G482D|GRIN1_ENST00000371546.4_Missense_Mutation_p.G503D|GRIN1_ENST00000371553.3_Missense_Mutation_p.G503D|GRIN1_ENST00000315048.3_Missense_Mutation_p.G482D|GRIN1_ENST00000371560.3_Missense_Mutation_p.G503D|GRIN1_ENST00000371555.4_Missense_Mutation_p.G503D|GRIN1_ENST00000350902.5_Missense_Mutation_p.G482D|GRIN1_ENST00000371559.4_Missense_Mutation_p.G482D|GRIN1_ENST00000471122.1_3'UTR	NM_007327.3	NP_015566.1	Q05586	NMDZ1_HUMAN	glutamate receptor, ionotropic, N-methyl D-aspartate 1	482					adult locomotory behavior (GO:0008344)|calcium ion homeostasis (GO:0055074)|calcium ion transmembrane transport (GO:0070588)|cation transport (GO:0006812)|cellular calcium ion homeostasis (GO:0006874)|cellular response to manganese ion (GO:0071287)|cerebral cortex development (GO:0021987)|conditioned taste aversion (GO:0001661)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|long-term memory (GO:0007616)|male mating behavior (GO:0060179)|negative regulation of neuron apoptotic process (GO:0043524)|olfactory learning (GO:0008355)|pons maturation (GO:0021586)|positive regulation of apoptotic process (GO:0043065)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|prepulse inhibition (GO:0060134)|propylene metabolic process (GO:0018964)|protein tetramerization (GO:0051262)|regulation of axonogenesis (GO:0050770)|regulation of dendrite morphogenesis (GO:0048814)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of membrane potential (GO:0042391)|regulation of respiratory gaseous exchange (GO:0043576)|regulation of synapse assembly (GO:0051963)|respiratory gaseous exchange (GO:0007585)|response to amphetamine (GO:0001975)|response to calcium ion (GO:0051592)|response to ethanol (GO:0045471)|response to fungicide (GO:0060992)|response to morphine (GO:0043278)|rhythmic process (GO:0048511)|sensory perception of pain (GO:0019233)|social behavior (GO:0035176)|suckling behavior (GO:0001967)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|visual learning (GO:0008542)	cell junction (GO:0030054)|cell surface (GO:0009986)|dendrite (GO:0030425)|dendrite membrane (GO:0032590)|dendritic spine (GO:0043197)|endoplasmic reticulum (GO:0005783)|excitatory synapse (GO:0060076)|integral component of plasma membrane (GO:0005887)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|neuron projection (GO:0043005)|neuronal postsynaptic density (GO:0097481)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)|synapse (GO:0045202)|synaptic cleft (GO:0043083)|synaptic vesicle (GO:0008021)|terminal bouton (GO:0043195)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|extracellular-glutamate-gated ion channel activity (GO:0005234)|glutamate binding (GO:0016595)|glycine binding (GO:0016594)|N-methyl-D-aspartate selective glutamate receptor activity (GO:0004972)|neurotransmitter binding (GO:0042165)|voltage-gated cation channel activity (GO:0022843)			NS(1)|breast(1)|endometrium(1)|kidney(1)|lung(7)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	15	all_cancers(76;0.0926)		STAD - Stomach adenocarcinoma(284;0.0878)	OV - Ovarian serous cystadenocarcinoma(145;6.87e-05)|Epithelial(140;0.00095)	Acamprosate(DB00659)|Acetylcysteine(DB06151)|Atomoxetine(DB00289)|Gabapentin(DB00996)|Ketobemidone(DB06738)|Memantine(DB01043)|Milnacipran(DB04896)|Orphenadrine(DB01173)|Pentobarbital(DB00312)|Pethidine(DB00454)|Phenobarbital(DB01174)|Secobarbital(DB00418)	GTGGCAGATGGCAAGTTCGGC	0.642																																					p.G503D	NSCLC(113;717 1653 2089 20474 37618)	.											.	GRIN1-187	0			c.G1508A						.						58.0	46.0	50.0					9																	140055846		2201	4297	6498	SO:0001583	missense	2902	exon11			CAGATGGCAAGTT		CCDS7031.1, CCDS7032.1, CCDS43910.1, CCDS55354.1, CCDS55355.1	9q34.3	2013-01-11			ENSG00000176884	ENSG00000176884		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4584	protein-coding gene	gene with protein product		138249	"""N-methyl-D-aspartate receptor subunit NR1"""	NMDAR1		1350383	Standard	NM_000832		Approved	GluN1	uc004cln.3	Q05586	OTTHUMG00000020976	ENST00000371561.3:c.1445G>A	9.37:g.140055846G>A	ENSP00000360616:p.Gly482Asp	Somatic	269	1		WXS	Illumina GAIIx	Phase_I	674	100	NM_001185091	0	0	0	0	0	A6NLK7|A6NLR1|C9K0X1|P35437|Q12867|Q12868|Q5VSF3|Q5VSF4|Q5VSF5|Q5VSF6|Q5VSF7|Q5VSF8|Q9UPF8|Q9UPF9	Missense_Mutation	SNP	ENST00000371561.3	37	CCDS7031.1	.	.	.	.	.	.	.	.	.	.	-	24.2	4.505500	0.85282	.	.	ENSG00000176884	ENST00000371561;ENST00000315048;ENST00000350902;ENST00000371550;ENST00000371546;ENST00000371555;ENST00000371553;ENST00000371559;ENST00000371560	T;T;T;T;T;T;T;T;T	0.56611	0.45;0.45;0.45;0.45;0.45;0.45;0.45;0.45;0.45	4.13	4.13	0.48395	Extracellular solute-binding protein, family 3 (1);Glutamate receptor, L-glutamate/glycine-binding (1);Ionotropic glutamate receptor (1);	0.000000	0.85682	D	0.000000	T	0.74207	0.3686	M	0.85630	2.765	0.80722	D	1	D;D;D;D;D;D	0.76494	0.999;0.999;0.999;0.999;0.999;0.999	D;D;P;D;D;D	0.74348	0.931;0.983;0.886;0.928;0.957;0.967	T	0.80367	-0.1412	10	0.87932	D	0	.	14.976	0.71273	0.0:0.0:1.0:0.0	.	503;503;482;482;482;482	Q5VSF4;Q5VSF5;Q05586-2;Q05586-3;Q05586;A2AVK2	.;.;.;.;NMDZ1_HUMAN;.	D	482;482;482;482;503;503;503;482;503	ENSP00000360616:G482D;ENSP00000316696:G482D;ENSP00000316915:G482D;ENSP00000360605:G482D;ENSP00000360601:G503D;ENSP00000360610:G503D;ENSP00000360608:G503D;ENSP00000360614:G482D;ENSP00000360615:G503D	ENSP00000316696:G482D	G	+	2	0	GRIN1	139175667	1.000000	0.71417	0.990000	0.47175	0.842000	0.47809	8.937000	0.92936	1.849000	0.53698	0.298000	0.19748	GGC	.		0.642	GRIN1-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000055267.3	NM_007327	
TMEM203	94107	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	9	140099815	140099815	+	Nonsense_Mutation	SNP	C	C	A			TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr9:140099815C>A	ENST00000343666.5	-	1	275	c.52G>T	c.(52-54)Gag>Tag	p.E18*	NDOR1_ENST00000344894.5_5'Flank|TMEM203_ENST00000537254.1_Nonsense_Mutation_p.E18*|NDOR1_ENST00000458322.2_5'Flank|TPRN_ENST00000541945.1_5'Flank|NDOR1_ENST00000371521.4_5'Flank|NDOR1_ENST00000427047.2_5'Flank	NM_053045.1	NP_444273.1	Q969S6	TM203_HUMAN	transmembrane protein 203	18						integral component of membrane (GO:0016021)				central_nervous_system(1)|kidney(1)	2	all_cancers(76;0.0926)		STAD - Stomach adenocarcinoma(284;0.0698)	OV - Ovarian serous cystadenocarcinoma(145;6.37e-05)|Epithelial(140;0.00057)		ACGAAGATCTCGAAGGTGGCG	0.687																																					p.E18X		.											.	TMEM203-22	0			c.G52T						.						33.0	33.0	33.0					9																	140099815		2184	4281	6465	SO:0001587	stop_gained	94107	exon1			AGATCTCGAAGGT	BC009283	CCDS35185.1	9q34.3	2007-12-18			ENSG00000187713	ENSG00000187713			28217	protein-coding gene	gene with protein product	"""HBeAg-binding protein 1"""					12477932	Standard	NM_053045		Approved	MGC14327, HBEBP1	uc004clv.3	Q969S6	OTTHUMG00000020985	ENST00000343666.5:c.52G>T	9.37:g.140099815C>A	ENSP00000375053:p.Glu18*	Somatic	172	0		WXS	Illumina GAIIx	Phase_I	604	184	NM_053045	0	0	63	85	22	Q6NW08	Nonsense_Mutation	SNP	ENST00000343666.5	37	CCDS35185.1	.	.	.	.	.	.	.	.	.	.	C	37	5.984457	0.97173	.	.	ENSG00000187713	ENST00000343666;ENST00000537254	.	.	.	4.13	3.23	0.37069	.	0.000000	0.64402	U	0.000002	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	8.9449	0.35753	0.0:0.8937:0.0:0.1063	.	.	.	.	X	18	.	ENSP00000375053:E18X	E	-	1	0	TMEM203	139219636	1.000000	0.71417	0.997000	0.53966	0.964000	0.63967	7.319000	0.79040	0.943000	0.37553	0.655000	0.94253	GAG	.		0.687	TMEM203-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055325.2	NM_053045	
CACNA1B	774	broad.mit.edu;bcgsc.ca	37	9	141015261	141015261	+	Silent	SNP	G	G	A			TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr9:141015261G>A	ENST00000371372.1	+	46	6562	c.6417G>A	c.(6415-6417)ccG>ccA	p.P2139P	CACNA1B_ENST00000277551.2_Silent_p.P2139P|CACNA1B_ENST00000371355.4_Silent_p.P2140P|CACNA1B_ENST00000277549.5_Silent_p.P1333P|CACNA1B_ENST00000371357.1_Silent_p.P2138P|CACNA1B_ENST00000371363.1_Silent_p.P2137P	NM_000718.3|NM_001243812.1	NP_000709.1|NP_001230741.1	Q00975	CAC1B_HUMAN	calcium channel, voltage-dependent, N type, alpha 1B subunit	2139					calcium ion import (GO:0070509)|locomotory behavior (GO:0007626)|membrane depolarization (GO:0051899)|membrane depolarization during action potential (GO:0086010)|neurotransmitter secretion (GO:0007269)|regulation of blood pressure (GO:0008217)|regulation of calcium ion transport (GO:0051924)|regulation of heart contraction (GO:0008016)|response to pain (GO:0048265)|synaptic transmission (GO:0007268)|transport (GO:0006810)	dendrite (GO:0030425)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|high voltage-gated calcium channel activity (GO:0008331)|protein C-terminus binding (GO:0008022)|voltage-gated calcium channel activity (GO:0005245)			NS(3)|autonomic_ganglia(1)|breast(7)|central_nervous_system(1)|endometrium(10)|kidney(2)|large_intestine(17)|lung(31)|ovary(1)|prostate(1)|skin(2)|stomach(2)|urinary_tract(2)	80	all_cancers(76;0.166)			OV - Ovarian serous cystadenocarcinoma(145;1.16e-05)|Epithelial(140;0.000476)	Amlodipine(DB00381)|Gabapentin(DB00996)|Levetiracetam(DB01202)|Spironolactone(DB00421)|Verapamil(DB00661)	GTGAGCCCCCGAAGCCCAAGC	0.682																																					p.P2139P		.											.	CACNA1B-138	0			c.G6417A						.						10.0	16.0	14.0					9																	141015261		1915	4062	5977	SO:0001819	synonymous_variant	774	exon45			GCCCCCGAAGCCC	AB209467	CCDS59522.1, CCDS59523.1	9q34	2013-01-10	2007-02-16		ENSG00000148408	ENSG00000148408		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"", ""EF-hand domain containing"""	1389	protein-coding gene	gene with protein product		601012		CACNL1A5		8825650, 16382099	Standard	NM_000718		Approved	Cav2.2, CACNN	uc004cog.3	Q00975	OTTHUMG00000021002	ENST00000371372.1:c.6417G>A	9.37:g.141015261G>A		Somatic	70	2		WXS	Illumina GAIIx	Phase_I	219	84	NM_001243812	0	0	1	2	1	B1AQK5	Silent	SNP	ENST00000371372.1	37	CCDS59522.1																																																																																			.		0.682	CACNA1B-001	KNOWN	non_canonical_conserved|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000055380.1	NM_000718	
YY2	404281	broad.mit.edu	37	X	21875129	21875129	+	Missense_Mutation	SNP	T	T	G			TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chrX:21875129T>G	ENST00000429584.2	+	1	1025	c.527T>G	c.(526-528)gTc>gGc	p.V176G	MBTPS2_ENST00000465888.1_3'UTR|MBTPS2_ENST00000365779.2_Intron|MBTPS2_ENST00000379484.5_Intron	NM_206923.3	NP_996806.2	O15391	TYY2_HUMAN	YY2 transcription factor	176					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(2)|endometrium(5)|kidney(1)|large_intestine(3)|lung(5)|prostate(1)|skin(2)	19						CAAATGCAGGTCAAAACGCTG	0.577																																					p.V176G		.											.	YY2-193	0			c.T527G						.						113.0	112.0	113.0					X																	21875129		2203	4300	6503	SO:0001583	missense	404281	exon1			TGCAGGTCAAAAC	AK091850	CCDS14202.1	Xp22.2-p22.1	2011-02-11			ENSG00000230797	ENSG00000230797		"""Zinc fingers, C2H2-type"""	31684	protein-coding gene	gene with protein product	"""transcription factor yin yang 2"""	300570				14702039	Standard	NM_206923		Approved	ZNF631	uc011mjp.2	O15391	OTTHUMG00000021236	ENST00000429584.2:c.527T>G	X.37:g.21875129T>G	ENSP00000389381:p.Val176Gly	Somatic	67	1		WXS	Illumina GAIIx	Phase_I	104	3	NM_206923	0	0	0	0	0	B2RP10|Q6Q1S4	Missense_Mutation	SNP	ENST00000429584.2	37	CCDS14202.1	.	.	.	.	.	.	.	.	.	.	T	15.30	2.793420	0.50102	.	.	ENSG00000230797	ENST00000429584	T	0.10382	2.88	4.35	3.14	0.36123	.	0.058961	0.64402	U	0.000004	T	0.05640	0.0148	N	0.08118	0	0.39328	D	0.965366	B	0.23735	0.09	B	0.21360	0.034	T	0.31194	-0.9952	10	0.87932	D	0	.	8.4325	0.32766	0.0:0.0:0.1955:0.8045	.	176	O15391	TYY2_HUMAN	G	176	ENSP00000389381:V176G	ENSP00000389381:V176G	V	+	2	0	YY2	21785050	0.993000	0.37304	0.003000	0.11579	0.446000	0.32137	1.890000	0.39728	0.613000	0.30089	0.486000	0.48141	GTC	.		0.577	YY2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056025.1	NM_206923	
SMC1A	8243	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	X	53438821	53438823	+	In_Frame_Del	DEL	CTT	CTT	-			TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10	CTT	CTT	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chrX:53438821_53438823delCTT	ENST00000322213.4	-	7	1269_1271	c.1142_1144delAAG	c.(1141-1146)gaagcc>gcc	p.E381del	SMC1A_ENST00000375340.6_In_Frame_Del_p.E147del	NM_006306.2	NP_006297.2	Q14683	SMC1A_HUMAN	structural maintenance of chromosomes 1A	381					DNA repair (GO:0006281)|gene expression (GO:0010467)|meiotic nuclear division (GO:0007126)|mitotic cell cycle (GO:0000278)|mitotic cell cycle checkpoint (GO:0007093)|mitotic sister chromatid cohesion (GO:0007064)|mitotic sister chromatid segregation (GO:0000070)|mitotic spindle organization (GO:0007052)|mRNA splicing, via spliceosome (GO:0000398)|negative regulation of DNA endoreduplication (GO:0032876)|response to radiation (GO:0009314)|RNA splicing (GO:0008380)|signal transduction in response to DNA damage (GO:0042770)|sister chromatid cohesion (GO:0007062)|stem cell maintenance (GO:0019827)	chromosome (GO:0005694)|chromosome, centromeric region (GO:0000775)|cohesin core heterodimer (GO:0008280)|condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinetochore (GO:0000776)|meiotic cohesin complex (GO:0030893)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|microtubule motor activity (GO:0003777)|poly(A) RNA binding (GO:0044822)|protein heterodimerization activity (GO:0046982)			NS(1)|breast(3)|central_nervous_system(3)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|lung(8)|ovary(5)|upper_aerodigestive_tract(2)	49						CTCTTGCTGGCTTCTTCTTTCAA	0.532																																					p.381_382del		.											.	SMC1A-232	0			c.1142_1144del						.																																			SO:0001651	inframe_deletion	8243	exon7			TGCTGGCTTCTTC	S78271	CCDS14352.1, CCDS75985.1	Xp11.22-p11.21	2014-09-17	2006-07-06	2006-07-06	ENSG00000072501	ENSG00000072501		"""Structural maintenance of chromosomes proteins"""	11111	protein-coding gene	gene with protein product		300040	"""SMC1 (structural maintenance of chromosomes 1, yeast)-like 1"", ""SMC1 structural maintenance of chromosomes 1-like 1 (yeast)"""	SMC1L1		7757074	Standard	NM_006306		Approved	DXS423E, KIAA0178, SB1.8, Smcb	uc004dsg.3	Q14683	OTTHUMG00000021614	ENST00000322213.4:c.1142_1144delAAG	X.37:g.53438827_53438829delCTT	ENSP00000323421:p.Glu381del	Somatic	63	0		WXS	Illumina GAIIx	Phase_I	123	109	NM_006306	0	0	0	0	0	O14995|Q16351|Q2M228	In_Frame_Del	DEL	ENST00000322213.4	37	CCDS14352.1																																																																																			.		0.532	SMC1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056756.2	NM_006306	
FGD1	2245	broad.mit.edu	37	X	54497148	54497148	+	Frame_Shift_Del	DEL	G	G	-	rs201843295		TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chrX:54497148delG	ENST00000375135.3	-	3	1260	c.527delC	c.(526-528)ccafs	p.P176fs		NM_004463.2	NP_004454.2	P98174	FGD1_HUMAN	FYVE, RhoGEF and PH domain containing 1	176	Pro-rich.				actin cytoskeleton organization (GO:0030036)|apoptotic signaling pathway (GO:0097190)|cytoskeleton organization (GO:0007010)|filopodium assembly (GO:0046847)|multicellular organismal development (GO:0007275)|neurotrophin TRK receptor signaling pathway (GO:0048011)|organ morphogenesis (GO:0009887)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|regulation of Cdc42 GTPase activity (GO:0043088)|regulation of cell shape (GO:0008360)|regulation of small GTPase mediated signal transduction (GO:0051056)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|lamellipodium (GO:0030027)|ruffle (GO:0001726)	guanyl-nucleotide exchange factor activity (GO:0005085)|metal ion binding (GO:0046872)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|small GTPase binding (GO:0031267)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(10)|lung(8)|ovary(3)|pancreas(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	39						GGGCTCCAGTGGGGGGGGCAT	0.662																																					p.P176fs		.											.	FGD1-231	0			c.527delC						.			45,42,3159		2,0,25,16,2,30,8,1347,410	4.0	5.0	5.0			-0.4	0.5	X		5	69,69,5588		0,0,43,26,1,40,27,2055,1395	no	codingComplex	FGD1	NM_004463.2		2,0,68,42,3,70,35,3402,1805	A1A1,A1A2,A1R,A1,A2A2,A2R,A2,RR,R		2.4101,2.6802,2.5078			54497148	114,111,8747	2052	3958	6010	SO:0001589	frameshift_variant	2245	exon3			TCCAGTGGGGGGG	U11690	CCDS14359.1	Xp11.21	2013-01-10	2008-08-01		ENSG00000102302	ENSG00000102302		"""Zinc fingers, FYVE domain containing"", ""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	3663	protein-coding gene	gene with protein product		300546	"""faciogenital dysplasia (Aarskog-Scott syndrome)"""	FGDY			Standard	NM_004463		Approved	ZFYVE3	uc004dtg.3	P98174	OTTHUMG00000021627	ENST00000375135.3:c.527delC	X.37:g.54497148delG	ENSP00000364277:p.Pro176fs	Somatic	8	0		WXS	Illumina GAIIx	Phase_I	27	7	NM_004463	0	0	0	0	0	Q5H999|Q8N4D9	Frame_Shift_Del	DEL	ENST00000375135.3	37	CCDS14359.1																																																																																			.		0.662	FGD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056801.1	NM_004463	
CDX4	1046	broad.mit.edu;bcgsc.ca	37	X	72667191	72667191	+	Silent	SNP	C	C	T			TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chrX:72667191C>T	ENST00000373514.2	+	1	102	c.102C>T	c.(100-102)ggC>ggT	p.G34G		NM_005193.1	NP_005184.1	O14627	CDX4_HUMAN	caudal type homeobox 4	34					anterior/posterior pattern specification (GO:0009952)|blood vessel development (GO:0001568)|labyrinthine layer development (GO:0060711)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			endometrium(4)|kidney(1)|large_intestine(1)|lung(11)|skin(1)	18	Renal(35;0.156)					GCACAGGGGGCGGTGGGAGTC	0.612																																					p.G34G		.											.	CDX4-130	0			c.C102T						.						31.0	31.0	31.0					X																	72667191		2203	4300	6503	SO:0001819	synonymous_variant	1046	exon1			AGGGGGCGGTGGG	AF029879	CCDS14424.1	Xq13.2	2012-03-09	2007-07-09		ENSG00000131264	ENSG00000131264		"""Homeoboxes / ANTP class : HOXL subclass"""	1808	protein-coding gene	gene with protein product		300025	"""caudal type homeo box transcription factor 4"""			7655457	Standard	NM_005193		Approved		uc011mqk.2	O14627	OTTHUMG00000021831	ENST00000373514.2:c.102C>T	X.37:g.72667191C>T		Somatic	42	2		WXS	Illumina GAIIx	Phase_I	107	95	NM_005193	0	0	0	0	0	A1A513|Q5JS20	Silent	SNP	ENST00000373514.2	37	CCDS14424.1																																																																																			.		0.612	CDX4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057229.2	NM_005193	
RPA4	29935	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	96139817	96139817	+	Missense_Mutation	SNP	A	A	G			TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chrX:96139817A>G	ENST00000373040.3	+	1	911	c.508A>G	c.(508-510)Aaa>Gaa	p.K170E	DIAPH2_ENST00000373054.4_Intron|DIAPH2_ENST00000373061.3_Intron|DIAPH2_ENST00000373049.4_Intron|DIAPH2_ENST00000355827.4_Intron|DIAPH2_ENST00000324765.8_Intron	NM_013347.4	NP_037479.1	Q13156	RFA4_HUMAN	replication protein A4, 30kDa	170					DNA damage checkpoint (GO:0000077)|DNA recombination (GO:0006310)|DNA replication initiation (GO:0006270)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)|nucleotide-excision repair (GO:0006289)	DNA replication factor A complex (GO:0005662)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	single-stranded DNA binding (GO:0003697)	p.K170*(1)		endometrium(1)|kidney(1)|large_intestine(3)|lung(7)|ovary(1)	13						GATGCTGGATAAAGCCCGTCG	0.458								Other identified genes with known or suspected DNA repair function																													p.K170E		.											.	RPA4-227	1	Substitution - Nonsense(1)	kidney(1)	c.A508G						.						142.0	112.0	122.0					X																	96139817		2203	4300	6503	SO:0001583	missense	29935	exon1			CTGGATAAAGCCC	U24186	CCDS35345.1	Xq21	2010-04-09	2010-04-09		ENSG00000204086	ENSG00000204086			30305	protein-coding gene	gene with protein product		300767	"""replication protein A4, 34kDa"""			7760808	Standard	NM_013347		Approved	HSU24186	uc004efv.4	Q13156	OTTHUMG00000021987	ENST00000373040.3:c.508A>G	X.37:g.96139817A>G	ENSP00000362131:p.Lys170Glu	Somatic	83	0		WXS	Illumina GAIIx	Phase_I	179	69	NM_013347	0	0	0	0	0	Q3SY03	Missense_Mutation	SNP	ENST00000373040.3	37	CCDS35345.1	.	.	.	.	.	.	.	.	.	.	A	12.32	1.902833	0.33628	.	.	ENSG00000204086	ENST00000373040	T	0.50001	0.76	3.66	2.42	0.29668	Nucleic acid-binding, OB-fold-like (1);Nucleic acid-binding, OB-fold (1);Replication protein A, C-terminal (1);	.	.	.	.	T	0.37100	0.0991	L	0.47190	1.495	0.09310	N	1	P	0.40578	0.722	B	0.36885	0.235	T	0.24190	-1.0167	9	0.72032	D	0.01	-23.5884	6.4038	0.21652	0.6468:0.3532:0.0:0.0	.	170	Q13156	RFA4_HUMAN	E	170	ENSP00000362131:K170E	ENSP00000362131:K170E	K	+	1	0	RPA4	96026473	0.264000	0.24093	0.003000	0.11579	0.231000	0.25187	2.139000	0.42149	0.530000	0.28619	0.486000	0.48141	AAA	.		0.458	RPA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057464.1	NM_013347	
HNRNPH2	3188	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	100667308	100667308	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chrX:100667308G>A	ENST00000316594.5	+	2	410	c.332G>A	c.(331-333)gGc>gAc	p.G111D		NM_001032393.2|NM_001199973.1|NM_001199974.1|NM_019597.4	NP_001027565.1|NP_001186902.1|NP_001186903.1|NP_062543.1	P55795	HNRH2_HUMAN	heterogeneous nuclear ribonucleoprotein H2 (H')	111	RRM 2. {ECO:0000255|PROSITE- ProRule:PRU00176}.				gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)	membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			breast(3)|large_intestine(2)|lung(6)|skin(1)	12						GCCAACGATGGCTTCGTCCGG	0.463																																					p.G111D		.											.	HNRNPH2-130	0			c.G332A						.						120.0	105.0	110.0					X																	100667308		2203	4300	6503	SO:0001583	missense	3188	exon2			ACGATGGCTTCGT	U01923	CCDS14485.1	Xq22	2013-02-12		2008-04-18	ENSG00000126945	ENSG00000126945		"""RNA binding motif (RRM) containing"""	5042	protein-coding gene	gene with protein product		300610		HNRPH2		7499401	Standard	NM_019597		Approved	hnRNPH', FTP3, HNRPH'	uc004ehn.3	P55795	OTTHUMG00000022029	ENST00000316594.5:c.332G>A	X.37:g.100667308G>A	ENSP00000361927:p.Gly111Asp	Somatic	184	0		WXS	Illumina GAIIx	Phase_I	357	328	NM_001032393	0	0	6	94	88	A1L400|Q9HHA7	Missense_Mutation	SNP	ENST00000316594.5	37	CCDS14485.1	.	.	.	.	.	.	.	.	.	.	G	16.49	3.136872	0.56936	.	.	ENSG00000126945	ENST00000316594	T	0.11930	2.73	4.73	3.86	0.44501	RNA recognition motif domain (1);	0.000000	0.85682	D	0.000000	T	0.31482	0.0798	M	0.71871	2.18	0.80722	D	1	P	0.49447	0.924	P	0.62298	0.9	T	0.01829	-1.1265	9	.	.	.	-6.2302	11.277	0.49172	0.0:0.0:0.8167:0.1833	.	111	P55795	HNRH2_HUMAN	D	111	ENSP00000361927:G111D	.	G	+	2	0	HNRNPH2	100553964	1.000000	0.71417	0.999000	0.59377	0.947000	0.59692	7.716000	0.84723	1.110000	0.41699	0.513000	0.50165	GGC	.		0.463	HNRNPH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057556.1	NM_019597	
RNF128	79589	hgsc.bcm.edu;broad.mit.edu	37	X	105937256	105937256	+	Frame_Shift_Del	DEL	T	T	-			TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chrX:105937256delT	ENST00000324342.3	+	1	189	c.24delT	c.(22-24)agtfs	p.S8fs		NM_024539.3	NP_078815.3	Q8TEB7	RN128_HUMAN	ring finger protein 128, E3 ubiquitin protein ligase	0					negative regulation of cytokine biosynthetic process (GO:0042036)	cytoskeleton (GO:0005856)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|late endosome (GO:0005770)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(2)|large_intestine(1)|lung(6)|ovary(1)	11						ATAGGTCCAGTTTTTTTTGGC	0.343																																					p.S8fs		.											.	RNF128-227	0			c.24delT						.						70.0	74.0	72.0					X																	105937256		2203	4297	6500	SO:0001589	frameshift_variant	79589	exon1			GTCCAGTTTTTTT	AK027169	CCDS14520.1, CCDS14521.1	Xq22.3	2013-01-09	2012-02-23		ENSG00000133135	ENSG00000133135		"""RING-type (C3HC4) zinc fingers"""	21153	protein-coding gene	gene with protein product		300439	"""ring finger protein 128"""				Standard	NM_024539		Approved	FLJ23516, GRAIL	uc004eml.3	Q8TEB7	OTTHUMG00000022151	ENST00000324342.3:c.24delT	X.37:g.105937256delT	ENSP00000316127:p.Ser8fs	Somatic	86	0		WXS	Illumina GAIIx	Phase_I	142	13	NM_024539	0	0	0	0	0	A0PJI4|Q6PH80|Q6ZTJ8|Q96RF3|Q9H5E4	Frame_Shift_Del	DEL	ENST00000324342.3	37	CCDS14520.1																																																																																			.		0.343	RNF128-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000057805.1	NM_024539	
CAPN6	827	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	X	110497633	110497633	+	Splice_Site	SNP	T	T	C			TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chrX:110497633T>C	ENST00000324068.1	-	3	333		c.e3-2		CAPN6_ENST00000541758.1_Splice_Site	NM_014289.3	NP_055104.2	Q9Y6Q1	CAN6_HUMAN	calpain 6						microtubule bundle formation (GO:0001578)|proteolysis (GO:0006508)|regulation of cytoskeleton organization (GO:0051493)	perinuclear region of cytoplasm (GO:0048471)|spindle microtubule (GO:0005876)	calcium-dependent cysteine-type endopeptidase activity (GO:0004198)|microtubule binding (GO:0008017)			cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(25)|ovary(3)|skin(3)|upper_aerodigestive_tract(1)	47						ACAGATGTCCTATGAATACAA	0.468																																					.		.											.	CAPN6-195	0			c.166-2A>G						.						93.0	82.0	86.0					X																	110497633		2203	4300	6503	SO:0001630	splice_region_variant	827	exon4			ATGTCCTATGAAT	AF029232	CCDS14555.1	Xq23	2008-07-29			ENSG00000077274	ENSG00000077274			1483	protein-coding gene	gene with protein product		300146				9503024, 9339374	Standard	NM_014289		Approved	CAPNX, CalpM, CANPX	uc004epc.2	Q9Y6Q1	OTTHUMG00000022203	ENST00000324068.1:c.166-2A>G	X.37:g.110497633T>C		Somatic	62	0		WXS	Illumina GAIIx	Phase_I	142	80	NM_014289	0	0	0	0	0	D3DUY7|Q9UEQ1|Q9UJA8	Splice_Site	SNP	ENST00000324068.1	37	CCDS14555.1	.	.	.	.	.	.	.	.	.	.	T	16.16	3.043760	0.55003	.	.	ENSG00000077274	ENST00000324068	.	.	.	5.16	5.16	0.70880	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.346	0.66665	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	-	.	.	CAPN6	110384289	1.000000	0.71417	0.960000	0.40013	0.607000	0.37147	7.230000	0.78097	1.835000	0.53391	0.483000	0.47432	.	.		0.468	CAPN6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057922.1		Intron
KIAA1210	57481	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	118215302	118215302	+	Missense_Mutation	SNP	A	A	T			TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chrX:118215302A>T	ENST00000402510.2	-	14	5119	c.5120T>A	c.(5119-5121)aTc>aAc	p.I1707N		NM_020721.1	NP_065772.1	Q9ULL0	K1210_HUMAN	KIAA1210	1707										breast(3)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|lung(31)|ovary(4)|prostate(2)|skin(3)|stomach(1)|urinary_tract(1)	64						TTATTGCGTGATTTCTGCCAT	0.428																																					p.I1707N		.											.	KIAA1210-67	0			c.T5120A						.						152.0	134.0	140.0					X																	118215302		1896	4097	5993	SO:0001583	missense	57481	exon14			TGCGTGATTTCTG	AB033036	CCDS48156.1	Xq24	2012-10-04			ENSG00000250423	ENSG00000250423			29218	protein-coding gene	gene with protein product						10574462	Standard	NM_020721		Approved		uc004era.4	Q9ULL0	OTTHUMG00000162980	ENST00000402510.2:c.5120T>A	X.37:g.118215302A>T	ENSP00000384670:p.Ile1707Asn	Somatic	34	0		WXS	Illumina GAIIx	Phase_I	81	78	NM_020721	0	0	0	0	0	B7ZCI8|Q5JPN4	Missense_Mutation	SNP	ENST00000402510.2	37	CCDS48156.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	12.11|12.11	1.840356|1.840356	0.32513|0.32513	.|.	.|.	ENSG00000250423|ENSG00000248857	ENST00000402510|ENST00000440399	T|.	0.19806|.	2.12|.	5.25|5.25	-3.91|-3.91	0.04168|0.04168	.|.	.|.	.|.	.|.	.|.	T|T	0.47801|0.47801	0.1465|0.1465	M|M	0.73217|0.73217	2.22|2.22	0.09310|0.09310	N|N	1|1	B|.	0.18741|.	0.03|.	B|.	0.17979|.	0.02|.	T|T	0.50162|0.50162	-0.8860|-0.8860	9|5	0.87932|.	D|.	0|.	.|.	6.2251|6.2251	0.20703|0.20703	0.404:0.0:0.458:0.138|0.404:0.0:0.458:0.138	.|.	1707|.	Q9ULL0|.	K1210_HUMAN|.	N|K	1707|1113	ENSP00000384670:I1707N|.	ENSP00000384670:I1707N|.	I|N	-|-	2|3	0|2	RP13-347D8.6|KIAA1210	118099330|118099330	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.001000|0.001000	0.01503|0.01503	-0.403000|-0.403000	0.07214|0.07214	-0.994000|-0.994000	0.03463|0.03463	-0.343000|-0.343000	0.07986|0.07986	ATC|AAT	.		0.428	KIAA1210-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000371251.2	NM_020721	
GPC4	2239	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	132437297	132437297	+	Silent	SNP	G	G	A			TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chrX:132437297G>A	ENST00000370828.3	-	8	1889	c.1365C>T	c.(1363-1365)agC>agT	p.S455S	GPC4_ENST00000535467.1_Silent_p.S385S	NM_001448.2	NP_001439.2	O75487	GPC4_HUMAN	glypican 4	455					anatomical structure morphogenesis (GO:0009653)|carbohydrate metabolic process (GO:0005975)|cell proliferation (GO:0008283)|chondroitin sulfate metabolic process (GO:0030204)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|phototransduction, visible light (GO:0007603)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)	anchored component of membrane (GO:0031225)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|lysosomal lumen (GO:0043202)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)				breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(16)|skin(1)|upper_aerodigestive_tract(1)	28	Acute lymphoblastic leukemia(192;0.000127)					TGTCTGGTTTGCTGGTGTCAA	0.463																																					p.S455S		.											.	GPC4-226	0			c.C1365T						.						213.0	160.0	178.0					X																	132437297		2203	4300	6503	SO:0001819	synonymous_variant	2239	exon8			TGGTTTGCTGGTG	AF030186	CCDS14637.1	Xq26.1	2008-02-05			ENSG00000076716	ENSG00000076716		"""Proteoglycans / Cell Surface : Glypicans"""	4452	protein-coding gene	gene with protein product	"""glypican proteoglycan 4"""	300168				9787072	Standard	NM_001448		Approved	K-glypican	uc004exc.1	O75487	OTTHUMG00000022434	ENST00000370828.3:c.1365C>T	X.37:g.132437297G>A		Somatic	71	0		WXS	Illumina GAIIx	Phase_I	140	126	NM_001448	0	0	0	22	22	B2R6J7|B4E2C0|Q6ZMA6|Q96L43|Q9NU08|Q9UJN1|Q9UPD9	Silent	SNP	ENST00000370828.3	37	CCDS14637.1																																																																																			.		0.463	GPC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058338.1	NM_001448	
SPANXB2	100133171	hgsc.bcm.edu	37	X	140085641	140085641	+	Frame_Shift_Del	DEL	A	A	-			TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chrX:140085641delA	ENST00000449283.1	+	2	239	c.136delA	c.(136-138)aaafs	p.K47fs		NM_145664.1	NP_663697.1	Q9NS25	SPNXB_HUMAN	SPANX family, member B2	47					spermatid development (GO:0007286)	cytoplasm (GO:0005737)|nucleus (GO:0005634)						Acute lymphoblastic leukemia(192;7.65e-05)					ACCTGCTCCTAAAAAAATGAA	0.502																																					p.K46fs		.											.	.	0			c.136delA						.																																			SO:0001589	frameshift_variant	100133171	exon2			GCTCCTAAAAAAA			Xq27.1	2008-04-30			ENSG00000227234	ENSG00000227234			14330	protein-coding gene	gene with protein product							Standard			Approved			Q9NS25	OTTHUMG00000022554	ENST00000449283.1:c.136delA	X.37:g.140085641delA	ENSP00000405202:p.Lys47fs	Somatic	227	0		WXS	Illumina GAIIx	Phase_I	397	232	NM_145664	0	0	0	0	0	B2RPP2|Q32WQ7|Q5JYZ7|Q8TAD5	Frame_Shift_Del	DEL	ENST00000449283.1	37	CCDS48177.1																																																																																			.		0.502	SPANXB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058588.1	NM_145664	
SPANXC	64663	broad.mit.edu;bcgsc.ca	37	X	140336572	140336572	+	Missense_Mutation	SNP	C	C	A			TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chrX:140336572C>A	ENST00000358993.2	-	1	57	c.19G>T	c.(19-21)Gcc>Tcc	p.A7S		NM_022661.2	NP_073152.1	Q9NY87	SPNXC_HUMAN	SPANX family, member C	7						cytoplasm (GO:0005737)|nucleus (GO:0005634)				large_intestine(2)|lung(3)|pancreas(1)	6	Acute lymphoblastic leukemia(192;7.65e-05)					ACCCCGCCGGCACTGGATTGT	0.502																																					p.A7S		.											.	SPANXC-62	0			c.G19T						.						91.0	121.0	111.0					X																	140336572		2198	4291	6489	SO:0001583	missense	64663	exon1			CGCCGGCACTGGA	AJ238277	CCDS14673.1	Xq27.2	2009-03-25			ENSG00000198573	ENSG00000198573			14331	protein-coding gene	gene with protein product	"""cancer/testis antigen family 11, member 3"""	300330				10626816	Standard	NM_022661		Approved	CTp11, CT11.3	uc004fbk.3	Q9NY87	OTTHUMG00000022556	ENST00000358993.2:c.19G>T	X.37:g.140336572C>A	ENSP00000351884:p.Ala7Ser	Somatic	262	1		WXS	Illumina GAIIx	Phase_I	466	12	NM_022661	0	0	0	0	0	Q32WL9|Q5JX88	Missense_Mutation	SNP	ENST00000358993.2	37	CCDS14673.1	.	.	.	.	.	.	.	.	.	.	c	4.953	0.176990	0.09443	.	.	ENSG00000198573	ENST00000358993	T	0.08807	3.05	.	.	.	.	.	.	.	.	T	0.07954	0.0199	L	0.51422	1.61	0.09310	N	1	B	0.14805	0.011	B	0.24269	0.052	T	0.38779	-0.9645	7	0.72032	D	0.01	.	.	.	.	.	7	Q9NY87	SPNXC_HUMAN	S	7	ENSP00000351884:A7S	ENSP00000351884:A7S	A	-	1	0	SPANXC	140164238	0.644000	0.27277	0.001000	0.08648	0.001000	0.01503	-1.340000	0.02650	-0.728000	0.04882	-0.715000	0.03620	GCC	.		0.502	SPANXC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058590.1	NM_022661	
MAGEC1	9947	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	X	140994548	140994548	+	Missense_Mutation	SNP	A	A	G	rs58117541		TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chrX:140994548A>G	ENST00000285879.4	+	4	1644	c.1358A>G	c.(1357-1359)tAc>tGc	p.Y453C	MAGEC1_ENST00000406005.2_Intron	NM_005462.4	NP_005453.2	O60732	MAGC1_HUMAN	melanoma antigen family C, 1	453										breast(3)|central_nervous_system(1)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(22)|lung(60)|ovary(1)|pancreas(1)|prostate(1)|skin(7)|stomach(5)|upper_aerodigestive_tract(7)|urinary_tract(1)	127	Acute lymphoblastic leukemia(192;6.56e-05)					TCTTTCTCCTACACTTTATTG	0.468										HNSCC(15;0.026)																											p.Y453C		.											.	MAGEC1-133	0			c.A1358G						.																																			SO:0001583	missense	9947	exon4			TCTCCTACACTTT	AF064589	CCDS35417.1	Xq26	2009-03-18			ENSG00000155495	ENSG00000155495			6812	protein-coding gene	gene with protein product	"""cancer/testis antigen family 7, member 1"""	300223				9485030, 9618514	Standard	NM_005462		Approved	MAGE-C1, CT7, MGC39366, CT7.1	uc004fbt.3	O60732	OTTHUMG00000022569	ENST00000285879.4:c.1358A>G	X.37:g.140994548A>G	ENSP00000285879:p.Tyr453Cys	Somatic	39	0		WXS	Illumina GAIIx	Phase_I	87	82	NM_005462	0	0	0	0	0	A0PK03|O75451|Q8TCV4	Missense_Mutation	SNP	ENST00000285879.4	37	CCDS35417.1	.	.	.	.	.	.	.	.	.	.	c	5.599	0.295229	0.10622	.	.	ENSG00000155495	ENST00000285879	T	0.02395	4.31	0.131	0.131	0.14755	.	.	.	.	.	T	0.01627	0.0052	N	0.08118	0	0.09310	N	1	B	0.22909	0.077	B	0.04013	0.001	T	0.46965	-0.9153	9	0.66056	D	0.02	.	4.7569	0.13088	0.3555:0.6445:0.0:0.0	.	453	O60732	MAGC1_HUMAN	C	453	ENSP00000285879:Y453C	ENSP00000285879:Y453C	Y	+	2	0	MAGEC1	140822214	0.000000	0.05858	0.006000	0.13384	0.006000	0.05464	-5.594000	0.00111	-1.534000	0.01743	-1.562000	0.00884	TAC	A|0.500;C|0.500		0.468	MAGEC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000058604.1	NM_005462	
PLXNB3	5365	hgsc.bcm.edu;bcgsc.ca	37	X	153042691	153042691	+	Frame_Shift_Del	DEL	G	G	-			TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chrX:153042691delG	ENST00000361971.5	+	30	5070	c.4956delG	c.(4954-4956)gagfs	p.E1652fs	PLXNB3_ENST00000538966.1_Frame_Shift_Del_p.E1675fs|PLXNB3_ENST00000538776.1_Frame_Shift_Del_p.E1305fs|SRPK3_ENST00000489426.1_5'UTR	NM_005393.2	NP_005384.2	Q9ULL4	PLXB3_HUMAN	plexin B3	1652					axon guidance (GO:0007411)|cell chemotaxis (GO:0060326)|negative regulation of cell adhesion (GO:0007162)|negative regulation of cell migration (GO:0030336)|negative regulation of GTPase activity (GO:0034260)|negative regulation of lamellipodium assembly (GO:0010593)|positive chemotaxis (GO:0050918)|positive regulation of endothelial cell proliferation (GO:0001938)|semaphorin-plexin signaling pathway (GO:0071526)	integral component of membrane (GO:0016021)|intracellular (GO:0005622)|plasma membrane (GO:0005886)	protein domain specific binding (GO:0019904)|semaphorin receptor activity (GO:0017154)			central_nervous_system(1)|endometrium(7)|large_intestine(2)|lung(15)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	32	all_hematologic(71;4.25e-06)|all_lung(58;3.83e-05)|Lung NSC(58;5.54e-05)|Acute lymphoblastic leukemia(192;6.56e-05)					ATGGCGAGGAGGGGGGGGTGT	0.692																																					p.E1675fs		.											.	PLXNB3-130	0			c.5025delG						.		,	72,3562		7,40,18,1526,470	12.0	10.0	10.0		,	3.9	0.0	X		10	114,6270		4,55,51,2279,1657	no	frameshift,frameshift	PLXNB3	NM_005393.2,NM_001163257.1	,	11,95,69,3805,2127	A1A1,A1R,A1,RR,R		1.7857,1.9813,1.8567	,	,	153042691	186,9832	2159	4243	6402	SO:0001589	frameshift_variant	5365	exon31			CGAGGAGGGGGGG	AF149019	CCDS14729.1, CCDS55536.1	Xq28	2008-02-05			ENSG00000198753	ENSG00000198753		"""Plexins"""	9105	protein-coding gene	gene with protein product		300214		PLXN6		10520995	Standard	NM_005393		Approved	PLEXR, PLEXB3	uc010nuk.2	Q9ULL4	OTTHUMG00000024217	ENST00000361971.5:c.4956delG	X.37:g.153042691delG	ENSP00000355378:p.Glu1652fs	Somatic	44	1		WXS	Illumina GAIIx	Phase_I	106	90	NM_001163257	0	0	0	0	0	B7Z3E6|F5H773|Q9HDA4	Frame_Shift_Del	DEL	ENST00000361971.5	37	CCDS14729.1																																																																																			.		0.692	PLXNB3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000061063.1		
HCFC1	3054	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	153225825	153225825	+	Missense_Mutation	SNP	C	C	A			TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chrX:153225825C>A	ENST00000310441.7	-	7	1911	c.945G>T	c.(943-945)gaG>gaT	p.E315D	HCFC1_ENST00000369984.4_Missense_Mutation_p.E315D|HCFC1_ENST00000354233.3_Missense_Mutation_p.E315D|HCFC1_ENST00000461098.1_5'UTR	NM_005334.2	NP_005325.2	P51610	HCFC1_HUMAN	host cell factor C1	315					cell cycle (GO:0007049)|chromatin organization (GO:0006325)|histone H4-K16 acetylation (GO:0043984)|histone H4-K5 acetylation (GO:0043981)|histone H4-K8 acetylation (GO:0043982)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of cell cycle (GO:0045787)|positive regulation of gene expression (GO:0010628)|protein stabilization (GO:0050821)|regulation of protein complex assembly (GO:0043254)|regulation of transcription, DNA-templated (GO:0006355)|release from viral latency (GO:0019046)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|histone acetyltransferase complex (GO:0000123)|membrane (GO:0016020)|mitochondrion (GO:0005739)|MLL1 complex (GO:0071339)|MLL5-L complex (GO:0070688)|neuronal cell body (GO:0043025)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|Set1C/COMPASS complex (GO:0048188)	chromatin binding (GO:0003682)|identical protein binding (GO:0042802)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001205)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)			NS(1)|breast(2)|central_nervous_system(2)|endometrium(12)|kidney(3)|large_intestine(3)|lung(18)|ovary(2)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	47	all_cancers(53;6.23e-16)|all_epithelial(53;5.61e-10)|all_lung(58;3.99e-07)|Lung NSC(58;5.02e-07)|all_hematologic(71;4.25e-06)|Acute lymphoblastic leukemia(192;6.56e-05)					GGATGTTGTCCTCCAGTGTAT	0.627																																					p.E315D		.											.	HCFC1-132	0			c.G945T						.						29.0	32.0	31.0					X																	153225825		2102	4184	6286	SO:0001583	missense	3054	exon7			GTTGTCCTCCAGT		CCDS44020.1	Xq28	2014-06-12	2014-06-09		ENSG00000172534	ENSG00000172534			4839	protein-coding gene	gene with protein product	"""VP16-accessory protein"", ""protein phosphatase 1, regulatory subunit 89"""	300019	"""mental retardation, X-linked 3"", ""host cell factor C1 (VP16-accessory protein)"""	HFC1, MRX3		8392914, 23000143	Standard	XM_005274664		Approved	HCF-1, HCF1, CFF, VCAF, MGC70925, PPP1R89	uc004fjp.3	P51610	OTTHUMG00000024222	ENST00000310441.7:c.945G>T	X.37:g.153225825C>A	ENSP00000309555:p.Glu315Asp	Somatic	78	0		WXS	Illumina GAIIx	Phase_I	169	154	NM_005334	0	0	0	8	8	Q6P4G5	Missense_Mutation	SNP	ENST00000310441.7	37	CCDS44020.1	.	.	.	.	.	.	.	.	.	.	C	22.3	4.275882	0.80580	.	.	ENSG00000172534	ENST00000310441;ENST00000369984;ENST00000354233	T;T;T	0.03745	3.83;3.82;3.92	5.39	4.53	0.55603	Kelch-type beta propeller (1);	0.000000	0.85682	D	0.000000	T	0.09992	0.0245	L	0.36672	1.1	0.54753	D	0.999981	P	0.36683	0.565	P	0.55161	0.77	T	0.09729	-1.0661	10	0.59425	D	0.04	.	12.2538	0.54613	0.0:0.9141:0.0:0.0859	.	315	P51610	HCFC1_HUMAN	D	315	ENSP00000309555:E315D;ENSP00000359001:E315D;ENSP00000346174:E315D	ENSP00000309555:E315D	E	-	3	2	HCFC1	152879019	0.974000	0.33945	1.000000	0.80357	0.978000	0.69477	0.230000	0.17852	1.045000	0.40225	0.600000	0.82982	GAG	.		0.627	HCFC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000061099.4	NM_005334	
DKC1	1736	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	154004462	154004462	+	Splice_Site	SNP	C	C	T			TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chrX:154004462C>T	ENST00000369550.5	+	14	1549	c.1339C>T	c.(1339-1341)Cgg>Tgg	p.R447W	DKC1_ENST00000475966.1_3'UTR|SNORA56_ENST00000383966.1_RNA	NM_001142463.1|NM_001363.3	NP_001135935.1|NP_001354.1	O60832	DKC1_HUMAN	dyskeratosis congenita 1, dyskerin	447	Nuclear and nucleolar localization.				cell proliferation (GO:0008283)|pseudouridine synthesis (GO:0001522)|RNA processing (GO:0006396)|rRNA processing (GO:0006364)|telomere maintenance (GO:0000723)|telomere maintenance via telomerase (GO:0007004)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|telomerase holoenzyme complex (GO:0005697)	poly(A) RNA binding (GO:0044822)|pseudouridine synthase activity (GO:0009982)|RNA binding (GO:0003723)|telomerase activity (GO:0003720)			breast(2)|central_nervous_system(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(3)|prostate(1)	15	all_cancers(53;8.15e-17)|all_epithelial(53;1.1e-10)|all_lung(58;6.63e-07)|Lung NSC(58;2.08e-06)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)|Renal(33;0.214)					TTCATCTCAGCGGAAGCGAGA	0.448									Congenital Dyskeratosis																												p.R447W		.											.	DKC1-227	0			c.C1339T						.						67.0	63.0	64.0					X																	154004462		2203	4300	6503	SO:0001630	splice_region_variant	1736	exon14	Familial Cancer Database	Zinsser-Engman-Cole syndrome, Dyskeratosis Congenita	TCTCAGCGGAAGC	AJ224481	CCDS14761.1, CCDS76062.1	Xq28	2014-09-17			ENSG00000130826	ENSG00000130826			2890	protein-coding gene	gene with protein product		300126		DKC		9590285, 9888995	Standard	NM_001142463		Approved	XAP101, dyskerin, NAP57, NOLA4	uc004fmm.3	O60832	OTTHUMG00000024242	ENST00000369550.5:c.1339-1C>T	X.37:g.154004462C>T		Somatic	80	1		WXS	Illumina GAIIx	Phase_I	131	49	NM_001363	0	0	0	1	1	F5BSB3|O43845|Q96G67|Q9Y505	Missense_Mutation	SNP	ENST00000369550.5	37	CCDS14761.1	.	.	.	.	.	.	.	.	.	.	C	16.56	3.158188	0.57368	.	.	ENSG00000130826	ENST00000369550	D	0.97553	-4.43	5.1	1.97	0.26223	.	1.333460	0.04741	N	0.422775	D	0.96673	0.8914	L	0.48642	1.525	0.58432	D	0.999995	D;D	0.76494	0.999;0.999	P;P	0.53146	0.719;0.719	D	0.90423	0.4418	9	.	.	.	-13.7508	10.4652	0.44602	0.6263:0.3737:0.0:0.0	.	447;447	A8MUT5;O60832	.;DKC1_HUMAN	W	447	ENSP00000358563:R447W	.	R	+	1	2	DKC1	153657656	1.000000	0.71417	0.994000	0.49952	0.704000	0.40688	0.818000	0.27295	0.556000	0.29098	0.600000	0.82982	CGG	.		0.448	DKC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000061180.5	NM_001363	Missense_Mutation
MIA3	375056	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	1	222803533	222803534	+	Frame_Shift_Ins	INS	-	-	A			TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr1:222803533_222803534insA	ENST00000344922.5	+	4	2996_2997	c.2971_2972insA	c.(2971-2973)gaafs	p.E991fs	MIA3_ENST00000470521.1_3'UTR|MIA3_ENST00000344507.1_Intron|MIA3_ENST00000344441.6_Frame_Shift_Ins_p.E991fs	NM_198551.2	NP_940953.2	Q5JRA6	MIA3_HUMAN	melanoma inhibitory activity family, member 3	991					chondrocyte development (GO:0002063)|collagen fibril organization (GO:0030199)|exocytosis (GO:0006887)|negative regulation of cell adhesion (GO:0007162)|negative regulation of cell migration (GO:0030336)|positive regulation of bone mineralization (GO:0030501)|positive regulation of leukocyte migration (GO:0002687)|protein transport (GO:0015031)|wound healing (GO:0042060)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)				breast(5)|central_nervous_system(2)|endometrium(3)|kidney(2)|large_intestine(15)|lung(37)|ovary(5)|pancreas(2)|prostate(2)|skin(2)|stomach(4)|urinary_tract(1)	80				GBM - Glioblastoma multiforme(131;0.0199)		GAGCATAGCAGAAAAAATGCTT	0.421																																					p.E991fs		.											.	MIA3-98	0			c.2971_2972insA						.																																			SO:0001589	frameshift_variant	375056	exon4			ATAGCAGAAAAAA		CCDS41470.1, CCDS73035.1	1p36.33	2012-12-13		2006-07-25	ENSG00000154305	ENSG00000154305			24008	protein-coding gene	gene with protein product	"""C219 reactive peptide"", ""transport and golgi organization"""	613455				15183315	Standard	XM_005273121		Approved	UNQ6077, FLJ39207, KIAA0268, TANGO	uc001hnl.3	Q5JRA6	OTTHUMG00000037543	ENST00000344922.5:c.2977dupA	1.37:g.222803539_222803539dupA	ENSP00000340900:p.Glu991fs	Somatic	141	0		WXS	Illumina GAIIx	Phase_I	119	96	NM_198551	0	0	0	0	0	A8K2S0|A8MT05|A8MT13|B7Z430|Q14083|Q3S4X3|Q5JRA5|Q5JRB0|Q5JRB1|Q5JRB2|Q6UVY8|Q86Y60|Q8N8M5|Q92580	Frame_Shift_Ins	INS	ENST00000344922.5	37	CCDS41470.1																																																																																			.		0.421	MIA3-001	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000091489.4	NM_198551	
TRIM21	6737	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	11	4409704	4409705	+	Frame_Shift_Ins	INS	-	-	T			TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr11:4409704_4409705insT	ENST00000254436.7	-	4	672_673	c.560_561insA	c.(559-561)aacfs	p.N187fs	TRIM21_ENST00000543625.1_Frame_Shift_Ins_p.N187fs	NM_003141.3	NP_003132.2	P19474	RO52_HUMAN	tripartite motif containing 21	187					cell cycle (GO:0007049)|innate immune response (GO:0045087)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of protein deubiquitination (GO:0090086)|negative regulation of viral release from host cell (GO:1902187)|negative regulation of viral transcription (GO:0032897)|positive regulation of cell cycle (GO:0045787)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of type I interferon production (GO:0032481)|positive regulation of viral entry into host cell (GO:0046598)|protein autoubiquitination (GO:0051865)|protein destabilization (GO:0031648)|protein monoubiquitination (GO:0006513)|protein polyubiquitination (GO:0000209)|protein trimerization (GO:0070206)|protein ubiquitination (GO:0016567)|regulation of type I interferon production (GO:0032479)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	DNA binding (GO:0003677)|ligase activity (GO:0016874)|RNA binding (GO:0003723)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			cervix(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(8)|ovary(3)	16		Medulloblastoma(188;0.0025)|Breast(177;0.0101)|all_neural(188;0.0227)		Epithelial(150;2.08e-11)|BRCA - Breast invasive adenocarcinoma(625;0.0851)|LUSC - Lung squamous cell carcinoma(625;0.194)		CAACCAGGAAGTTTTTTTGCTG	0.485																																					p.N187fs		.											.	TRIM21-229	0			c.561_562insA						.																																			SO:0001589	frameshift_variant	6737	exon4			CAGGAAGTTTTTT	AF391283	CCDS44525.1	11p15.5-p15.3	2014-02-14	2011-01-25	2004-11-26		ENSG00000132109		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	11312	protein-coding gene	gene with protein product		109092	"""Sjogren syndrome antigen A1 (52kDa, ribonucleoprotein autoantigen SS-A/Ro)"", ""tripartite motif-containing 21"""	SSA1		8094596	Standard	NM_003141		Approved	RNF81, RO52, Ro/SSA	uc001lyy.1	P19474		ENST00000254436.7:c.561dupA	11.37:g.4409711_4409711dupT	ENSP00000254436:p.Asn187fs	Somatic	50	0		WXS	Illumina GAIIx	Phase_I	32	21	NM_003141	0	0	0	0	0	Q5XPV5|Q96RF8	Frame_Shift_Ins	INS	ENST00000254436.7	37	CCDS44525.1																																																																																			.		0.485	TRIM21-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000385842.1	NM_003141	
EXPH5	23086	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	11	108383875	108383876	+	Frame_Shift_Ins	INS	-	-	TG			TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr11:108383875_108383876insTG	ENST00000265843.4	-	6	2468_2469	c.2358_2359insCA	c.(2356-2361)acagatfs	p.D787fs	EXPH5_ENST00000443411.1_Frame_Shift_Ins_p.D599fs|EXPH5_ENST00000524840.1_5'Flank|EXPH5_ENST00000525344.1_Frame_Shift_Ins_p.D780fs|EXPH5_ENST00000428840.1_Frame_Shift_Ins_p.D711fs	NM_015065.2	NP_055880	Q8NEV8	EXPH5_HUMAN	exophilin 5	787					intracellular protein transport (GO:0006886)|keratinocyte development (GO:0003334)|multivesicular body sorting pathway (GO:0071985)|positive regulation of exocytosis (GO:0045921)|positive regulation of protein secretion (GO:0050714)	endosome (GO:0005768)	Rab GTPase binding (GO:0017137)			breast(3)|central_nervous_system(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(13)|liver(1)|lung(34)|ovary(3)|pancreas(2)|prostate(2)|skin(11)|stomach(3)|upper_aerodigestive_tract(1)	91		all_cancers(61;3.99e-08)|Acute lymphoblastic leukemia(157;3.97e-05)|Melanoma(852;4.04e-05)|all_epithelial(67;0.000116)|all_hematologic(158;0.000315)|Breast(348;0.104)|all_neural(303;0.16)		Epithelial(105;8.1e-06)|BRCA - Breast invasive adenocarcinoma(274;1.22e-05)|all cancers(92;0.000129)|OV - Ovarian serous cystadenocarcinoma(223;0.11)|Colorectal(284;0.184)		TTGGATTTATCTGTGTGCGGTA	0.386																																					p.D787fs		.											.	EXPH5-95	0			c.2359_2360insCA						.																																			SO:0001589	frameshift_variant	23086	exon6			ATTTATCTGTGTG		CCDS8341.1	11q22.3	2008-02-05			ENSG00000110723	ENSG00000110723			30578	protein-coding gene	gene with protein product	"""synaptotagmin-like homologue lacking C2 domains b"""	612878				9734811, 11773082	Standard	NM_015065		Approved	SLAC2-B	uc001pkk.3	Q8NEV8	OTTHUMG00000166536	ENST00000265843.4:c.2357_2358dupCA	11.37:g.108383880_108383881dupTG	ENSP00000265843:p.Asp787fs	Somatic	73	0		WXS	Illumina GAIIx	Phase_I	75	57	NM_015065	0	0	0	0	0	Q2KHM1|Q9Y4D6	Frame_Shift_Ins	INS	ENST00000265843.4	37	CCDS8341.1																																																																																			.		0.386	EXPH5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390279.1	NM_015065	
DDX47	51202	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	12	12974637	12974638	+	Frame_Shift_Ins	INS	-	-	A			TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr12:12974637_12974638insA	ENST00000358007.3	+	4	441_442	c.419_420insA	c.(418-423)gcaaaafs	p.AK140fs	DDX47_ENST00000352940.4_Frame_Shift_Ins_p.AK140fs	NM_016355.3	NP_057439.2	Q9H0S4	DDX47_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 47	140	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.				extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|mRNA processing (GO:0006397)|RNA splicing (GO:0008380)|rRNA processing (GO:0006364)	membrane (GO:0016020)|nucleolus (GO:0005730)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(5)|kidney(1)|large_intestine(3)|lung(3)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	16		Prostate(47;0.0526)		BRCA - Breast invasive adenocarcinoma(232;0.0354)		TTGGCCCTTGCAAAAAAACCAC	0.361																																					p.A140fs		.											.	DDX47-226	0			c.419_420insA						.																																			SO:0001589	frameshift_variant	51202	exon4			CCCTTGCAAAAAA	AK127712	CCDS8655.1, CCDS8656.1	12p13.2	2010-07-06			ENSG00000213782	ENSG00000213782		"""DEAD-boxes"""	18682	protein-coding gene	gene with protein product		615428					Standard	NM_016355		Approved	DKFZp564O176, FLJ30012, HQ0256, RRP3	uc001rax.3	Q9H0S4	OTTHUMG00000168709	ENST00000358007.3:c.426dupA	12.37:g.12974644_12974644dupA	ENSP00000350698:p.Ala140fs	Somatic	34	0		WXS	Illumina GAIIx	Phase_I	64	23	NM_016355	0	0	0	0	0	B3KXP4|G5E955|Q96GM0|Q96NV8|Q9UI98	Frame_Shift_Ins	INS	ENST00000358007.3	37	CCDS8655.1																																																																																			.		0.361	DDX47-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400674.1	NM_016355	
MPHOSPH9	10198	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	12	123645709	123645710	+	Frame_Shift_Ins	INS	-	-	A			TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr12:123645709_123645710insA	ENST00000606320.1	-	22	3560_3561	c.3354_3355insT	c.(3352-3357)tttgatfs	p.D1119fs	MPHOSPH9_ENST00000541076.2_Frame_Shift_Ins_p.D1089fs|MPHOSPH9_ENST00000392425.3_Frame_Shift_Ins_p.D967fs|MPHOSPH9_ENST00000302349.5_Frame_Shift_Ins_p.D967fs			Q99550	MPP9_HUMAN	M-phase phosphoprotein 9	1119						centriole (GO:0005814)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|plasma membrane (GO:0005886)				NS(1)|breast(1)|endometrium(4)|kidney(1)|large_intestine(5)|lung(18)|prostate(2)|skin(1)	33	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000182)|Epithelial(86;0.00046)|BRCA - Breast invasive adenocarcinoma(302;0.169)		GTAAGTTCATCAAAAAATCGTT	0.342																																					p.D967_E968delinsX		.											.	MPHOSPH9-514	0			c.2899_2900insT						.																																			SO:0001589	frameshift_variant	10198	exon18			GTTCATCAAAAAA	X98258	CCDS9243.1, CCDS9243.2	12q24	2008-03-03			ENSG00000051825	ENSG00000051825			7215	protein-coding gene	gene with protein product		605501				8885239	Standard	NM_022782		Approved	MPP9	uc001uel.3	Q99550	OTTHUMG00000168849	ENST00000606320.1:c.3355dupT	12.37:g.123645715_123645715dupA	ENSP00000475489:p.Asp1119fs	Somatic	35	0		WXS	Illumina GAIIx	Phase_I	67	32	NM_022782	0	0	0	0	0	A1L486|A6NEE2|B3KR87|Q9H976|U3KQ28	Nonsense_Mutation	INS	ENST00000606320.1	37																																																																																				.		0.342	MPHOSPH9-030	NOVEL	basic	protein_coding	protein_coding	OTTHUMT00000471390.2		
ATP7B	540	hgsc.bcm.edu;bcgsc.ca	37	13	52548260	52548261	+	Frame_Shift_Ins	INS	-	-	AA			TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr13:52548260_52548261insAA	ENST00000242839.4	-	2	1251_1252	c.1095_1096insTT	c.(1093-1098)attgccfs	p.A366fs	ATP7B_ENST00000542656.1_Frame_Shift_Ins_p.A334fs|ATP7B_ENST00000448424.2_Frame_Shift_Ins_p.A366fs|ATP7B_ENST00000400366.3_Intron|ATP7B_ENST00000418097.2_Frame_Shift_Ins_p.A366fs|ATP7B_ENST00000400370.3_Frame_Shift_Ins_p.A366fs|ATP7B_ENST00000344297.5_Frame_Shift_Ins_p.A366fs|ATP7B_ENST00000482841.1_5'UTR	NM_000053.3	NP_000044.2	P35670	ATP7B_HUMAN	ATPase, Cu++ transporting, beta polypeptide	366	HMA 4. {ECO:0000255|PROSITE- ProRule:PRU00280}.				cellular copper ion homeostasis (GO:0006878)|cellular zinc ion homeostasis (GO:0006882)|copper ion import (GO:0015677)|copper ion transport (GO:0006825)|intracellular copper ion transport (GO:0015680)|ion transmembrane transport (GO:0034220)|lactation (GO:0007595)|response to copper ion (GO:0046688)|sequestering of calcium ion (GO:0051208)|transmembrane transport (GO:0055085)	Golgi membrane (GO:0000139)|integral component of plasma membrane (GO:0005887)|late endosome (GO:0005770)|membrane (GO:0016020)|mitochondrion (GO:0005739)|trans-Golgi network (GO:0005802)	ATP binding (GO:0005524)|copper ion binding (GO:0005507)|copper-exporting ATPase activity (GO:0004008)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(5)|kidney(4)|large_intestine(7)|lung(23)|ovary(1)|prostate(3)|skin(4)|stomach(2)	55		Breast(56;0.000207)|Lung NSC(96;0.000845)|Prostate(109;0.0235)|Hepatocellular(98;0.065)|all_neural(104;0.19)		GBM - Glioblastoma multiforme(99;5.25e-08)	Carboplatin(DB00958)|Cisplatin(DB00515)|Oxaliplatin(DB00526)	GTCATGCCGGCAATGGCAATCA	0.554									Wilson disease																												p.A366fs		.											.	ATP7B-92	0			c.1096_1097insTT						.																																			SO:0001589	frameshift_variant	540	exon2	Familial Cancer Database		TGCCGGCAATGGC	U11700	CCDS41892.1, CCDS45049.1, CCDS58293.1	13q14.3	2012-10-22	2005-11-29		ENSG00000123191	ENSG00000123191	3.6.3.4	"""ATPases / P-type"""	870	protein-coding gene	gene with protein product	"""Wilson disease"", ""copper pump 2"", ""copper-transporting ATPase 2"""	606882	"""ATPase, Cu++ transporting, beta polypeptide (Wilson disease)"""	WND		8298641, 8298639	Standard	NM_000053		Approved		uc001vfw.2	P35670	OTTHUMG00000017406	ENST00000242839.4:c.1094_1095dupTT	13.37:g.52548261_52548262dupAA	ENSP00000242839:p.Ala366fs	Somatic	136	1		WXS	Illumina GAIIx	Phase_I	131	116	NM_000053	0	0	0	0	0	Q16318|Q16319|Q4U3V3|Q59FJ9|Q5T7X7	Frame_Shift_Ins	INS	ENST00000242839.4	37	CCDS41892.1																																																																																			.		0.554	ATP7B-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045981.1	NM_000053	
BRF1	2972	hgsc.bcm.edu;broad.mit.edu	37	14	105693009	105693010	+	Frame_Shift_Ins	INS	-	-	G	rs369618475		TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr14:105693009_105693010insG	ENST00000546474.1	-	8	15835_15836	c.876_877insC	c.(874-879)ccctcgfs	p.S293fs	BRF1_ENST00000379932.4_Frame_Shift_Ins_p.S89fs|BRF1_ENST00000446501.2_Frame_Shift_Ins_p.S55fs|BRF1_ENST00000440513.3_Frame_Shift_Ins_p.S178fs|BRF1_ENST00000327359.3_Frame_Shift_Ins_p.S178fs|BRF1_ENST00000379937.2_Frame_Shift_Ins_p.S266fs|BRF1_ENST00000392557.4_Frame_Shift_Ins_p.S89fs|BRF1_ENST00000551787.1_Frame_Shift_Ins_p.S89fs	NM_001242787.1|NM_001519.3	NP_001229716.1|NP_001510.2	Q92994	TF3B_HUMAN	BRF1, RNA polymerase III transcription initiation factor 90 kDa subunit	293					gene expression (GO:0010467)|regulation of mRNA stability (GO:0043488)|regulation of transcription, DNA-templated (GO:0006355)|rRNA transcription (GO:0009303)|transcription from RNA polymerase III promoter (GO:0006383)|transcription initiation from RNA polymerase III promoter (GO:0006384)|tRNA transcription (GO:0009304)	nucleoplasm (GO:0005654)|transcription factor TFIIIB complex (GO:0000126)	zinc ion binding (GO:0008270)	p.S293fs*11(1)		NS(1)|central_nervous_system(1)|endometrium(5)|large_intestine(4)|lung(5)|ovary(3)|prostate(1)|skin(2)|urinary_tract(2)	24		all_cancers(154;0.0231)|all_epithelial(191;0.0694)|Melanoma(154;0.155)	OV - Ovarian serous cystadenocarcinoma(23;0.00753)|all cancers(16;0.00925)|Epithelial(46;0.0221)	Epithelial(152;0.14)		GCTGTGTACGAGGGGGGGTCGC	0.584																																					p.S293fs		.											.	BRF1-155	1	Deletion - Frameshift(1)	large_intestine(1)	c.877_878insC						.																																			SO:0001589	frameshift_variant	2972	exon8			TGTACGAGGGGGG	U28838	CCDS10001.1, CCDS42001.1, CCDS55949.1, CCDS55950.1, CCDS55951.1, CCDS55952.1, CCDS55953.1	14q32.33	2014-04-02	2013-05-29	2001-12-07	ENSG00000185024	ENSG00000185024		"""General transcription factors"""	11551	protein-coding gene	gene with protein product		604902	"""TATA box binding protein (TBP)-associated factor, RNA polymerase III, GTF3B subunit 2"", ""BRF1 homolog, subunit of RNA polymerase III transcription initiation factor IIIB (S. cerevisiae)"""	TAF3B2, TAF3C, GTF3B		7624363, 8943358	Standard	NM_145685		Approved	TFIIIB90, BRF, hBRF	uc001yqp.2	Q92994	OTTHUMG00000029884	ENST00000546474.1:c.877dupC	14.37:g.105693016_105693016dupG	ENSP00000448323:p.Ser293fs	Somatic	45	0		WXS	Illumina GAIIx	Phase_I	75	12	NM_001519	0	0	0	0	0	B3KU36|B4DIG5|B7Z2N3|F5H5Z7|F8WA46|Q13223|Q3SYD9|Q5PR24|Q6IQ02|Q96KX3|Q9HCW6|Q9HCW7|Q9HCW8	Frame_Shift_Ins	INS	ENST00000546474.1	37	CCDS10001.1																																																																																			.		0.584	BRF1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000074548.4	NM_001519	
KIF7	374654	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	15	90190208	90190209	+	Frame_Shift_Ins	INS	-	-	C			TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr15:90190208_90190209insC	ENST00000394412.3	-	7	1716_1717	c.1640_1641insG	c.(1639-1641)ggcfs	p.G547fs		NM_198525.2	NP_940927.2	Q2M1P5	KIF7_HUMAN	kinesin family member 7	547	Sufficient for interaction with NPHP1.				ATP catabolic process (GO:0006200)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|negative regulation of smoothened signaling pathway (GO:0045879)|positive regulation of smoothened signaling pathway (GO:0045880)|smoothened signaling pathway (GO:0007224)|ventricular system development (GO:0021591)	cilium (GO:0005929)|kinesin complex (GO:0005871)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			central_nervous_system(2)|cervix(1)|endometrium(2)|large_intestine(5)|lung(11)|ovary(2)|stomach(1)|urinary_tract(1)	25	Lung NSC(78;0.0237)|all_lung(78;0.0478)		BRCA - Breast invasive adenocarcinoma(143;0.128)			GGAGCCGCGGGCCCCCCCAGCC	0.693											OREG0023460	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.G547fs		.											.	KIF7-523	0			c.1641_1642insG						.																																			SO:0001589	frameshift_variant	374654	exon7			CCGCGGGCCCCCC	AY358384	CCDS32325.2	15q26.1	2011-06-02			ENSG00000166813	ENSG00000166813		"""Kinesins"""	30497	protein-coding gene	gene with protein product		611254				11416179, 15547730	Standard	NM_198525		Approved	JBTS12	uc002bof.2	Q2M1P5	OTTHUMG00000157177	ENST00000394412.3:c.1641dupG	15.37:g.90190215_90190215dupC	ENSP00000377934:p.Gly547fs	Somatic	29	0	1273	WXS	Illumina GAIIx	Phase_I	156	63	NM_198525	0	0	0	0	0	Q3SXY0|Q6UXE9|Q8IW72	Frame_Shift_Ins	INS	ENST00000394412.3	37	CCDS32325.2																																																																																			.		0.693	KIF7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347782.1	NM_198525	
MYH11	4629	hgsc.bcm.edu	37	16	15802686	15802687	+	Intron	INS	-	-	G	rs111588143	byFrequency	TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr16:15802686_15802687insG	ENST00000300036.5	-	41	5896				MYH11_ENST00000573908.1_Intron|MYH11_ENST00000576790.2_Frame_Shift_Ins_p.P1933fs|MYH11_ENST00000396324.3_Intron|NDE1_ENST00000396355.1_Intron|NDE1_ENST00000342673.5_Intron|NDE1_ENST00000396354.1_Intron|MYH11_ENST00000452625.2_Frame_Shift_Ins_p.P1940fs	NM_002474.2	NP_002465.1	P35749	MYH11_HUMAN	myosin, heavy chain 11, smooth muscle						axon guidance (GO:0007411)|cardiac muscle fiber development (GO:0048739)|elastic fiber assembly (GO:0048251)|muscle contraction (GO:0006936)|skeletal muscle myosin thick filament assembly (GO:0030241)|smooth muscle contraction (GO:0006939)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|muscle myosin complex (GO:0005859)|myosin filament (GO:0032982)|smooth muscle contractile fiber (GO:0030485)|stress fiber (GO:0001725)	ATP binding (GO:0005524)|motor activity (GO:0003774)|structural constituent of muscle (GO:0008307)			NS(2)|breast(7)|central_nervous_system(1)|endometrium(11)|kidney(5)|large_intestine(34)|liver(1)|lung(37)|ovary(9)|pancreas(1)|prostate(7)|skin(7)|upper_aerodigestive_tract(1)	123						AAGTTTCCTGTGGGGGGGGCCC	0.495			T	CBFB	AML																																p.P1940fs		.		Dom	yes		16	16p13.13-p13.12	4629	"""myosin, heavy polypeptide 11, smooth muscle"""		L	.	MYH11-666	0			c.5820_5821insC						.		,,,,,	37,4227		0,37,2095					,,,,,	1.7	1.0			33	57,8197		0,57,4070	no	frameshift,intron,intron,intron,intron,frameshift	MYH11,NDE1	NM_022844.2,NM_017668.2,NM_002474.2,NM_001143979.1,NM_001040114.1,NM_001040113.1	,,,,,	0,94,6165	A1A1,A1R,RR		0.6906,0.8677,0.7509	,,,,,	,,,,,		94,12424				SO:0001627	intron_variant	4629	exon42			TTCCTGTGGGGGG	X69292	CCDS10565.1, CCDS10566.1, CCDS45423.1, CCDS45424.1	16p13.11	2011-09-27	2006-09-29		ENSG00000133392	ENSG00000133392		"""Myosins / Myosin superfamily : Class II"""	7569	protein-coding gene	gene with protein product		160745	"""myosin, heavy polypeptide 11, smooth muscle"""			7684189	Standard	NM_001040113		Approved	SMMHC, SMHC	uc002ddx.3	P35749	OTTHUMG00000129935	ENST00000300036.5:c.5787-4706->C	16.37:g.15802694_15802694dupG		Somatic	69	0		WXS	Illumina GAIIx	Phase_I	158	20	NM_001040113	0	0	0	0	0	D2JYH7|O00396|O94944|P78422|Q3MIV8|Q3MNF0|Q3MNF1	Frame_Shift_Ins	INS	ENST00000300036.5	37	CCDS10565.1																																																																																			.		0.495	MYH11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252192.2	NM_001040113	
ATP2A1	487	hgsc.bcm.edu;bcgsc.ca	37	16	28913639	28913640	+	Frame_Shift_Ins	INS	-	-	C			TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr16:28913639_28913640insC	ENST00000357084.3	+	17	2723_2724	c.2456_2457insC	c.(2455-2460)cgccccfs	p.RP819fs	ATP2A1_ENST00000536376.1_Frame_Shift_Ins_p.RP694fs|ATP2A1_ENST00000395503.4_Frame_Shift_Ins_p.RP819fs	NM_173201.3	NP_775293.1	O14983	AT2A1_HUMAN	ATPase, Ca++ transporting, cardiac muscle, fast twitch 1	819					apoptotic mitochondrial changes (GO:0008637)|ATP catabolic process (GO:0006200)|blood coagulation (GO:0007596)|calcium ion import (GO:0070509)|calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|intrinsic apoptotic signaling pathway in response to endoplasmic reticulum stress (GO:0070059)|ion transmembrane transport (GO:0034220)|maintenance of mitochondrion location (GO:0051659)|negative regulation of endoplasmic reticulum calcium ion concentration (GO:0032471)|negative regulation of striated muscle contraction (GO:0045988)|positive regulation of endoplasmic reticulum calcium ion concentration (GO:0032470)|positive regulation of fast-twitch skeletal muscle fiber contraction (GO:0031448)|positive regulation of mitochondrial calcium ion concentration (GO:0051561)|regulation of striated muscle contraction (GO:0006942)|relaxation of skeletal muscle (GO:0090076)|response to endoplasmic reticulum stress (GO:0034976)|transmembrane transport (GO:0055085)	calcium channel complex (GO:0034704)|endoplasmic reticulum membrane (GO:0005789)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|H zone (GO:0031673)|I band (GO:0031674)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)|platelet dense tubular network membrane (GO:0031095)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calcium-transporting ATPase activity (GO:0005388)|protein homodimerization activity (GO:0042803)			breast(1)|central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(7)|lung(10)|ovary(4)|pancreas(1)|prostate(2)|skin(3)|urinary_tract(2)	38						ATCATGGACCGCCCCCCCCGGA	0.658																																					p.R819fs		.											.	ATP2A1-93	0			c.2456_2457insC						.																																			SO:0001589	frameshift_variant	487	exon17			TGGACCGCCCCCC		CCDS10643.1, CCDS42139.1, CCDS66997.1	16p12.1	2012-10-22			ENSG00000196296	ENSG00000196296	3.6.3.8	"""ATPases / P-type"""	811	protein-coding gene	gene with protein product	"""sarcoplasmic/endoplasmic reticulum calcium ATPase 1"", ""calcium pump 1"""	108730		ATP2A			Standard	NM_004320		Approved	SERCA1	uc002dro.1	O14983	OTTHUMG00000131760	ENST00000357084.3:c.2464dupC	16.37:g.28913647_28913647dupC	ENSP00000349595:p.Arg819fs	Somatic	103	1		WXS	Illumina GAIIx	Phase_I	191	54	NM_004320	0	0	0	0	0	A8K5J9|B3KY17|O14984	Frame_Shift_Ins	INS	ENST00000357084.3	37	CCDS10643.1																																																																																			.		0.658	ATP2A1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000254686.2	NM_004320	
LAT	27040	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	16	28996226	28996227	+	5'Flank	INS	-	-	G			TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr16:28996226_28996227insG	ENST00000360872.5	+	0	0				LAT_ENST00000395461.3_Frame_Shift_Ins_p.LG15fs|RP11-264B17.3_ENST00000569969.1_RNA|LAT_ENST00000454369.2_5'Flank|LAT_ENST00000395456.2_5'Flank|LAT_ENST00000564277.1_5'Flank|LAT_ENST00000354453.4_5'Flank|LAT_ENST00000566177.1_5'Flank			O43561	LAT_HUMAN	linker for activation of T cells						blood coagulation (GO:0007596)|calcium-mediated signaling (GO:0019722)|Fc-epsilon receptor signaling pathway (GO:0038095)|gene expression (GO:0010467)|immune response (GO:0006955)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|integrin-mediated signaling pathway (GO:0007229)|intracellular signal transduction (GO:0035556)|lymphocyte homeostasis (GO:0002260)|mast cell degranulation (GO:0043303)|platelet activation (GO:0030168)|positive regulation of signal transduction (GO:0009967)|Ras protein signal transduction (GO:0007265)|regulation of T cell activation (GO:0050863)|T cell activation (GO:0042110)|T cell receptor signaling pathway (GO:0050852)	cell-cell junction (GO:0005911)|COP9 signalosome (GO:0008180)|immunological synapse (GO:0001772)|integral component of membrane (GO:0016021)|mast cell granule (GO:0042629)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)	protein kinase binding (GO:0019901)|SH3/SH2 adaptor activity (GO:0005070)			large_intestine(2)|lung(3)|urinary_tract(1)	6		Hepatocellular(780;0.244)				GTCCCCGTCTTGGGGGGGGCCA	0.723																																					p.L15fs		.											.	LAT-44	0			c.44_45insG						.																																			SO:0001631	upstream_gene_variant	27040	exon1			CCGTCTTGGGGGG	AF036905	CCDS10647.1, CCDS32425.1, CCDS45455.1, CCDS53999.1	16q13	2011-11-01			ENSG00000213658	ENSG00000213658			18874	protein-coding gene	gene with protein product	"""linker for activation of T cells, transmembrane adaptor"""	602354				9489702	Standard	NM_014387		Approved	LAT1	uc010vdj.2	O43561	OTTHUMG00000131761		16.37:g.28996234_28996234dupG	Exception_encountered	Somatic	35	0		WXS	Illumina GAIIx	Phase_I	58	24	NM_001014989	0	0	0	0	0	B7WPI0|C7C5T6|G5E9K3|O43919	Frame_Shift_Ins	INS	ENST00000360872.5	37	CCDS10647.1																																																																																			.		0.723	LAT-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000254688.2		
ZNF486	90649	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	19	20308051	20308052	+	Frame_Shift_Ins	INS	-	-	A	rs558552453	byFrequency	TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr19:20308051_20308052insA	ENST00000335117.8	+	4	589_590	c.532_533insA	c.(532-534)gaafs	p.E178fs	CTC-260E6.6_ENST00000586657.1_RNA|CTC-260E6.6_ENST00000585498.1_RNA|CTC-260E6.6_ENST00000593655.1_RNA	NM_052852.3	NP_443084.2	Q96H40	ZN486_HUMAN	zinc finger protein 486	178					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.K171fs*3(1)|p.K180fs*3(1)		endometrium(3)|large_intestine(3)|lung(3)|ovary(1)|upper_aerodigestive_tract(1)	11						AAGACATACTGAAAAAAAACCT	0.302													AAAAAAAA|AAAAAAAA|AAAAAAAAA|insertion	6	0.00119808	0.0045	0.0	5008	,	,		18392	0.0		0.0	False		,,,				2504	0.0				p.E178fs		.											.	ZNF486-47	2	Deletion - Frameshift(2)	large_intestine(2)	c.532_533insA						.			21,3889		2,17,1936						-1.7	0.0			44	9,8053		0,9,4022	no	frameshift	ZNF486	NM_052852.2		2,26,5958	A1A1,A1R,RR		0.1116,0.5371,0.2506				30,11942				SO:0001589	frameshift_variant	90649	exon4			CATACTGAAAAAA	BC008936	CCDS46029.1	19p12	2014-02-13	2003-12-16	2003-12-17	ENSG00000256229	ENSG00000256229		"""Zinc fingers, C2H2-type"", ""-"""	20807	protein-coding gene	gene with protein product			"""KRAB domain only 2"""	KRBO2			Standard	NM_052852		Approved	MGC2396	uc002nou.3	Q96H40	OTTHUMG00000179731	ENST00000335117.8:c.540dupA	19.37:g.20308059_20308059dupA	ENSP00000335042:p.Glu178fs	Somatic	87	0		WXS	Illumina GAIIx	Phase_I	98	44	NM_052852	0	0	0	0	0	Q0VG00	Frame_Shift_Ins	INS	ENST00000335117.8	37	CCDS46029.1																																																																																			.		0.302	ZNF486-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000447843.2	NM_052852	
RTN2	6253	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	19	45996512	45996513	+	Frame_Shift_Ins	INS	-	-	G			TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr19:45996512_45996513insG	ENST00000245923.4	-	5	1173_1174	c.938_939insC	c.(937-939)cctfs	p.P313fs	PPM1N_ENST00000401705.1_Intron|RTN2_ENST00000430715.2_5'UTR|RTN2_ENST00000590526.1_Frame_Shift_Ins_p.P39fs|RTN2_ENST00000344680.4_Intron|RTN2_ENST00000589384.1_5'Flank	NM_005619.4	NP_005610.1	O75298	RTN2_HUMAN	reticulon 2	313					cell death (GO:0008219)|intracellular protein transmembrane transport (GO:0065002)|regulation of glucose import (GO:0046324)	endoplasmic reticulum (GO:0005783)|integral component of endoplasmic reticulum membrane (GO:0030176)|T-tubule (GO:0030315)|terminal cisterna (GO:0014802)				cervix(1)|endometrium(2)|kidney(3)|large_intestine(2)|lung(6)|ovary(4)|skin(1)|urinary_tract(1)	20		Ovarian(192;0.051)|all_neural(266;0.112)		OV - Ovarian serous cystadenocarcinoma(262;0.00829)|Epithelial(262;0.184)|GBM - Glioblastoma multiforme(486;0.246)		GGACAGGAGTAGGGGGGGTGGG	0.569																																					p.P313fs		.											.	RTN2-93	0			c.939_940insC						.		,	3,4259		0,3,2128					,	-1.2	0.0			65	17,8235		0,17,4109	no	intron,frameshift	RTN2	NM_206900.1,NM_005619.3	,	0,20,6237	A1A1,A1R,RR		0.206,0.0704,0.1598	,	,		20,12494				SO:0001589	frameshift_variant	6253	exon5			AGGAGTAGGGGGG	AF038540	CCDS12665.1, CCDS12666.1, CCDS46114.1	19q13.2-q13.3	2012-03-30				ENSG00000125744			10468	protein-coding gene	gene with protein product	"""NSP-like protein 1"", ""Neuroendocrine-specific protein-like 1"""	603183	"""spastic paraplegia 12 (autosomal dominant)"""	SPG12		8812484, 9530622, 22232211	Standard	NM_005619		Approved	NSP2, NSPL1	uc002pcb.4	O75298		ENST00000245923.4:c.939dupC	19.37:g.45996519_45996519dupG	ENSP00000245923:p.Pro313fs	Somatic	44	0		WXS	Illumina GAIIx	Phase_I	82	39	NM_005619	0	0	0	0	0	O60509|Q7RTM6|Q7RTN1|Q7RTN2	Frame_Shift_Ins	INS	ENST00000245923.4	37	CCDS12665.1																																																																																			.		0.569	RTN2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000459574.1	NM_005619	
C1D	10438	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	2	68270087	68270088	+	Frame_Shift_Ins	INS	-	-	T			TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr2:68270087_68270088insT	ENST00000355848.3	-	5	406_407	c.359_360insA	c.(358-360)aatfs	p.N120fs	C1D_ENST00000409302.1_Frame_Shift_Ins_p.N120fs|C1D_ENST00000410067.3_Frame_Shift_Ins_p.N120fs|C1D_ENST00000407324.1_Frame_Shift_Ins_p.N159fs			Q13901	C1D_HUMAN	C1D nuclear receptor corepressor	120	Interaction with NCOR1 and NCOR2. {ECO:0000250}.				apoptotic process (GO:0006915)|maturation of 5.8S rRNA (GO:0000460)|negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nuclear exosome (RNase complex) (GO:0000176)|nucleolus (GO:0005730)|nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	DNA binding (GO:0003677)|RNA binding (GO:0003723)|transcription corepressor activity (GO:0003714)			lung(2)|urinary_tract(1)	3						CCCAGAGGGCATTTTTTACAAA	0.347																																					p.N120fs		.											.	C1D-186	0			c.360_361insA						.																																			SO:0001589	frameshift_variant	10438	exon6			GAGGGCATTTTTT		CCDS1883.1	2p13-p12	2010-06-10	2010-06-10		ENSG00000197223	ENSG00000197223			29911	protein-coding gene	gene with protein product	"""small unique nuclear receptor co-repressor"""	606997	"""C1D nuclear receptor co-repressor"""			9469821, 17599775, 17412707, 11801738, 9405624	Standard	NM_006333		Approved	SUNCOR, SUN-CoR, LRP1	uc002seb.3	Q13901	OTTHUMG00000129564	ENST00000355848.3:c.360dupA	2.37:g.68270093_68270093dupT	ENSP00000348107:p.Asn120fs	Somatic	111	0		WXS	Illumina GAIIx	Phase_I	104	35	NM_001190263	0	0	0	0	0	A8K336|D6W5F8|Q05D64	Frame_Shift_Ins	INS	ENST00000355848.3	37	CCDS1883.1																																																																																			.		0.347	C1D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251757.3	NM_006333	
SMYD5	10322	broad.mit.edu	37	2	73441441	73441442	+	Frame_Shift_Ins	INS	-	-	GG			TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr2:73441441_73441442insGG	ENST00000389501.4	+	1	92_93	c.47_48insGG	c.(46-51)gcgggcfs	p.AG16fs		NM_006062.2	NP_006053.2	Q6GMV2	SMYD5_HUMAN	SMYD family member 5	16							metal ion binding (GO:0046872)|methyltransferase activity (GO:0008168)			NS(1)|breast(1)|endometrium(1)|large_intestine(3)|lung(5)|pancreas(1)|upper_aerodigestive_tract(1)	13						GTGGGCGTGGCGGGCCGCGCGC	0.698																																					p.A16fs		.											.	SMYD5-226	0			c.47_48insGG						.																																			SO:0001589	frameshift_variant	10322	exon1			GCGTGGCGGGCCG	U50383	CCDS33221.2	2p12	2007-02-09	2003-05-14	2003-05-16	ENSG00000135632	ENSG00000135632		"""Zinc fingers, MYND-type"""	16258	protein-coding gene	gene with protein product			"""retinoic acid induced 15"""	RAI15		8754834	Standard	NM_006062		Approved	RRG1, NN8-4AG, ZMYND23	uc002siw.2	Q6GMV2	OTTHUMG00000150482	ENST00000389501.4:c.48_49dupGG	2.37:g.73441442_73441443dupGG	ENSP00000374152:p.Ala16fs	Somatic	62	0		WXS	Illumina GAIIx	Phase_I	152	11	NM_006062	0	0	0	0	0	D6W5H3|Q13558	Frame_Shift_Ins	INS	ENST00000389501.4	37	CCDS33221.2																																																																																			.		0.698	SMYD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318301.1	NM_006062	
ERCC3	2071	hgsc.bcm.edu;bcgsc.ca	37	2	128046943	128046944	+	In_Frame_Ins	INS	-	-	TCT			TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr2:128046943_128046944insTCT	ENST00000285398.2	-	6	885_886	c.791_792insAGA	c.(790-792)gag>gaAGAg	p.264_264E>EE	ERCC3_ENST00000493187.2_In_Frame_Ins_p.200_200E>EE	NM_000122.1	NP_000113.1	P19447	ERCC3_HUMAN	excision repair cross-complementation group 3	264	Asp/Glu-rich (acidic).				7-methylguanosine mRNA capping (GO:0006370)|apoptotic process (GO:0006915)|DNA repair (GO:0006281)|DNA topological change (GO:0006265)|gene expression (GO:0010467)|hair cell differentiation (GO:0035315)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA damage removal (GO:0000718)|nucleotide-excision repair, DNA duplex unwinding (GO:0000717)|nucleotide-excision repair, DNA incision (GO:0033683)|positive regulation of apoptotic process (GO:0043065)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of viral transcription (GO:0050434)|protein localization (GO:0008104)|regulation of mitotic cell cycle phase transition (GO:1901990)|response to hypoxia (GO:0001666)|response to oxidative stress (GO:0006979)|response to UV (GO:0009411)|termination of RNA polymerase I transcription (GO:0006363)|transcription elongation from RNA polymerase I promoter (GO:0006362)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase I promoter (GO:0006360)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase I promoter (GO:0006361)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription-coupled nucleotide-excision repair (GO:0006283)|UV protection (GO:0009650)|viral process (GO:0016032)	holo TFIIH complex (GO:0005675)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	3'-5' DNA helicase activity (GO:0043138)|ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|ATPase activity (GO:0016887)|damaged DNA binding (GO:0003684)|dATP binding (GO:0032564)|DNA binding (GO:0003677)|GTP binding (GO:0005525)|peptide binding (GO:0042277)|protein C-terminus binding (GO:0008022)|protein N-terminus binding (GO:0047485)|RNA polymerase II carboxy-terminal domain kinase activity (GO:0008353)|transcription factor binding (GO:0008134)			breast(2)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(6)|lung(12)|ovary(2)|pancreas(1)|prostate(1)|skin(1)|urinary_tract(1)	31	Colorectal(110;0.1)			BRCA - Breast invasive adenocarcinoma(221;0.073)		CTGTCTGTGTCTCTTCTTCTTC	0.47			"""Mis, S"""			"""skin basal cell, skin squamous cell, melanoma"""		Nucleotide excision repair (NER)	Xeroderma Pigmentosum																												p.E264delinsEE		.	yes	Rec		Xeroderma pigmentosum (B)	2	2q21	2071	"""excision repair cross-complementing rodent repair deficiency, complementation group 3 (xeroderma pigmentosum group B complementing)"""		E	.	ERCC3-723	0			c.792_793insAGA						.																																			SO:0001652	inframe_insertion	2071	exon6	Familial Cancer Database	incl. XPA, XPB, XPC, XPD, XPE, XPF, XPG, XP Variant, XPV	CTGTGTCTCTTCT	M31899	CCDS2144.1	2q21	2014-09-17	2014-03-07		ENSG00000163161	ENSG00000163161		"""General transcription factors"", ""General transcription factor IIH complex subunits"""	3435	protein-coding gene	gene with protein product	"""xeroderma pigmentosum group B complementing"""	133510	"""excision repair cross-complementing rodent repair deficiency, complementation group 3"""			8202161	Standard	NM_000122		Approved	XPB, BTF2, RAD25, TFIIH, GTF2H	uc002toh.1	P19447	OTTHUMG00000131530	ENST00000285398.2:c.792_794dupAGA	2.37:g.128046950_128046952dupTCT	ENSP00000285398:p.Glu264dup	Somatic	248	0		WXS	Illumina GAIIx	Phase_I	305	196	NM_000122	0	0	0	0	0	Q53QM0	In_Frame_Ins	INS	ENST00000285398.2	37	CCDS2144.1																																																																																			.		0.470	ERCC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000331028.1	NM_000122	
KIF3B	9371	hgsc.bcm.edu;broad.mit.edu	37	20	30914608	30914609	+	Frame_Shift_Ins	INS	-	-	A			TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr20:30914608_30914609insA	ENST00000375712.3	+	6	1950_1951	c.1783_1784insA	c.(1783-1785)gaafs	p.E595fs	KIF3B_ENST00000418717.2_Frame_Shift_Ins_p.E221fs	NM_004798.3	NP_004789.1	O15066	KIF3B_HUMAN	kinesin family member 3B	595	Globular.				anterograde axon cargo transport (GO:0008089)|antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|ATP catabolic process (GO:0006200)|blood coagulation (GO:0007596)|cytoskeleton-dependent intracellular transport (GO:0030705)|determination of left/right symmetry (GO:0007368)|membrane organization (GO:0061024)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|mitotic centrosome separation (GO:0007100)|mitotic spindle organization (GO:0007052)|plus-end-directed vesicle transport along microtubule (GO:0072383)|spindle assembly involved in mitosis (GO:0090307)	centrosome (GO:0005813)|cilium (GO:0005929)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|intraciliary transport particle (GO:0030990)|kinesin II complex (GO:0016939)|membrane (GO:0016020)|microtubule (GO:0005874)|microtubule cytoskeleton (GO:0015630)|midbody (GO:0030496)|plus-end kinesin complex (GO:0005873)|spindle (GO:0005819)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|plus-end-directed microtubule motor activity (GO:0008574)|Rho GTPase binding (GO:0017048)			NS(2)|breast(2)|central_nervous_system(3)|cervix(2)|endometrium(2)|kidney(4)|large_intestine(5)|lung(9)|ovary(2)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	36			UCEC - Uterine corpus endometrioid carcinoma (5;0.0241)			CCCTCTGGAAGAAAAAAGTAAA	0.351																																					p.E595fs		.											.	KIF3B-517	0			c.1783_1784insA						.																																			SO:0001589	frameshift_variant	9371	exon6			CTGGAAGAAAAAA	AB002357	CCDS13200.1	20q11.21	2012-08-01			ENSG00000101350	ENSG00000101350		"""Kinesins"""	6320	protein-coding gene	gene with protein product		603754				9205841	Standard	NM_004798		Approved	KIAA0359, FLA8, KLP-11	uc002wxq.3	O15066	OTTHUMG00000032214	ENST00000375712.3:c.1789dupA	20.37:g.30914614_30914614dupA	ENSP00000364864:p.Glu595fs	Somatic	22	0		WXS	Illumina GAIIx	Phase_I	49	14	NM_004798	0	0	0	0	0	B2RMP4|B4DSR5|E1P5M5	Frame_Shift_Ins	INS	ENST00000375712.3	37	CCDS13200.1																																																																																			.		0.351	KIF3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078619.1	NM_004798	
TOP1	7150	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	20	39713140	39713141	+	Frame_Shift_Ins	INS	-	-	A			TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr20:39713140_39713141insA	ENST00000361337.2	+	8	796_797	c.546_547insA	c.(547-549)aaafs	p.K183fs		NM_003286.2	NP_003277.1	P11387	TOP1_HUMAN	topoisomerase (DNA) I	183	Lys-rich.				chromatin remodeling (GO:0006338)|chromosome segregation (GO:0007059)|DNA replication (GO:0006260)|DNA topological change (GO:0006265)|embryonic cleavage (GO:0040016)|phosphorylation (GO:0016310)|programmed cell death (GO:0012501)|response to drug (GO:0042493)|viral process (GO:0016032)	cytoplasmic mRNA processing body (GO:0000932)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|perikaryon (GO:0043204)|replication fork protection complex (GO:0031298)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|DNA topoisomerase type I activity (GO:0003917)|DNA topoisomerase type II (ATP-hydrolyzing) activity (GO:0003918)|poly(A) RNA binding (GO:0044822)			breast(5)|central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(8)|lung(11)|ovary(3)|prostate(1)|skin(2)|urinary_tract(1)	37		Myeloproliferative disorder(115;0.00878)			Irinotecan(DB00762)|Lucanthone(DB04967)|Sodium stibogluconate(DB05630)|Topotecan(DB01030)	AAGATAAAGATAAAAAAGTTCC	0.371			T	NUP98	AML*																																p.D182fs		.		Dom	yes		20	20q12-q13.1	7150	topoisomerase (DNA) I		L	.	TOP1-1148	0			c.546_547insA						.																																			SO:0001589	frameshift_variant	7150	exon8			TAAAGATAAAAAA		CCDS13312.1	20q12-q13.1	1990-06-22			ENSG00000198900	ENSG00000198900	5.99.1.2		11986	protein-coding gene	gene with protein product		126420					Standard	NM_003286		Approved		uc010ggd.1	P11387	OTTHUMG00000033057	ENST00000361337.2:c.552dupA	20.37:g.39713146_39713146dupA	ENSP00000354522:p.Lys183fs	Somatic	68	0		WXS	Illumina GAIIx	Phase_I	76	24	NM_003286	0	0	0	0	0	A8KA78|E1P5W3|O43256|Q12855|Q12856|Q15610|Q5TFY3|Q9UJN0	Frame_Shift_Ins	INS	ENST00000361337.2	37	CCDS13312.1																																																																																			.		0.371	TOP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080397.2		
RBM5	10181	hgsc.bcm.edu	37	3	50155887	50155888	+	Stop_Codon_Ins	INS	-	-	GA	rs112672304		TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr3:50155887_50155888insGA	ENST00000347869.3	+	0	2621_2622				RP11-493K19.3_ENST00000437204.1_RNA|RP11-493K19.3_ENST00000425674.1_RNA	NM_005778.3	NP_005769.1	P52756	RBM5_HUMAN	RNA binding motif protein 5						apoptotic process (GO:0006915)|gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|negative regulation of cell proliferation (GO:0008285)|positive regulation of apoptotic process (GO:0043065)|regulation of alternative mRNA splicing, via spliceosome (GO:0000381)|RNA processing (GO:0006396)|RNA splicing (GO:0008380)|spliceosomal complex assembly (GO:0000245)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)	DNA binding (GO:0003677)|mRNA binding (GO:0003729)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|zinc ion binding (GO:0008270)	p.*816fs?(1)		breast(2)|cervix(2)|endometrium(3)|large_intestine(4)|lung(6)|prostate(2)	19				BRCA - Breast invasive adenocarcinoma(193;0.000121)|KIRC - Kidney renal clear cell carcinoma(197;0.00558)|Kidney(197;0.00632)		TGAGATGgagtgagagagagag	0.535																																					p.X816delinsX		.											.	RBM5-278	1	Deletion - Frameshift(1)	breast(1)	c.2446_2447insGA						.																																			SO:0001567	stop_retained_variant	10181	exon25			ATGGAGTGAGAGA	U23946	CCDS2810.1	3p21.3	2013-08-15			ENSG00000003756	ENSG00000003756		"""G patch domain containing"", ""RNA binding motif (RRM) containing"""	9902	protein-coding gene	gene with protein product		606884				10352938, 23935508	Standard	NM_005778		Approved	LUCA15, H37	uc003cyg.3	P52756	OTTHUMG00000156785	ENST00000347869.3:c.2466_2467dupGA	3.37:g.50155896_50155897dupGA		Somatic	72	0		WXS	Illumina GAIIx	Phase_I	59	21	NM_005778	0	0	0	0	0	B2RA45|B4DM16|B4DMF9|B4DZ63|Q93021|Q9BU14|Q9HDA6|Q9UKY8|Q9UL24	Frame_Shift_Ins	INS	ENST00000347869.3	37	CCDS2810.1																																																																																			-|0.500;GA|0.500		0.535	RBM5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000345797.3	NM_005778	
HERC6	55008	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	4	89311864	89311865	+	Frame_Shift_Ins	INS	-	-	C			TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr4:89311864_89311865insC	ENST00000264346.7	+	4	556_557	c.497_498insC	c.(496-501)ttccccfs	p.FP166fs	HERC6_ENST00000273960.3_Frame_Shift_Ins_p.FP166fs|HERC6_ENST00000380265.5_Frame_Shift_Ins_p.FP166fs	NM_017912.3	NP_060382.3	Q8IVU3	HERC6_HUMAN	HECT and RLD domain containing E3 ubiquitin protein ligase family member 6	166					hematopoietic progenitor cell differentiation (GO:0002244)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)			endometrium(1)|kidney(1)|large_intestine(2)|lung(6)|ovary(1)	11		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;0.000222)		GGGAAGGAGTTCCCCTCCCAAG	0.559																																					p.F166fs		.											.	HERC6-658	0			c.497_498insC						.																																			SO:0001589	frameshift_variant	55008	exon4			AGGAGTTCCCCTC	AF336798	CCDS47098.1, CCDS54777.1	4q22	2012-02-23	2012-02-23		ENSG00000138642	ENSG00000138642			26072	protein-coding gene	gene with protein product		609249	"""hect domain and RLD 6"""				Standard	NM_001165136		Approved	FLJ20637	uc011cdi.2	Q8IVU3	OTTHUMG00000160983	ENST00000264346.7:c.501dupC	4.37:g.89311868_89311868dupC	ENSP00000264346:p.Phe166fs	Somatic	80	0		WXS	Illumina GAIIx	Phase_I	165	76	NM_017912	0	0	0	0	0	B4DIY5|Q5GC90|Q5GRH3|Q5HYM6|Q5JPB6|Q6PIF4|Q8NAN3|Q9NWS4	Frame_Shift_Ins	INS	ENST00000264346.7	37	CCDS47098.1																																																																																			.		0.559	HERC6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000363259.2		
CWC27	10283	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	5	64100133	64100134	+	Frame_Shift_Ins	INS	-	-	A			TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr5:64100133_64100134insA	ENST00000381070.3	+	10	1075_1076	c.858_859insA	c.(859-861)aaafs	p.K287fs	CWC27_ENST00000508024.1_Frame_Shift_Ins_p.K287fs	NM_005869.2	NP_005860.2	Q6UX04	CWC27_HUMAN	CWC27 spliceosome-associated protein homolog (S. cerevisiae)	287					mRNA splicing, via spliceosome (GO:0000398)|protein folding (GO:0006457)	catalytic step 2 spliceosome (GO:0071013)	peptidyl-prolyl cis-trans isomerase activity (GO:0003755)	p.K288fs*2(1)		breast(1)|endometrium(4)|kidney(1)|large_intestine(9)|lung(5)|prostate(1)	21						AAAGAATTGCCAAAAAATTAAA	0.391																																					p.A286fs		.											.	CWC27-90	1	Deletion - Frameshift(1)	large_intestine(1)	c.858_859insA						.																																			SO:0001589	frameshift_variant	10283	exon10			AATTGCCAAAAAA	AF039692	CCDS3982.2, CCDS75252.1	5q12.3	2010-01-26	2010-01-26	2010-01-26	ENSG00000153015	ENSG00000153015			10664	protein-coding gene	gene with protein product			"""serologically defined colon cancer antigen 10"""	SDCCAG10		9610721, 19941820	Standard	XM_005248399		Approved	NY-CO-10	uc003jtn.1	Q6UX04	OTTHUMG00000074069	ENST00000381070.3:c.864dupA	5.37:g.64100139_64100139dupA	ENSP00000370460:p.Lys287fs	Somatic	28	0		WXS	Illumina GAIIx	Phase_I	68	33	NM_005869	0	0	0	0	0	O60529|O60530|Q96EM3	Frame_Shift_Ins	INS	ENST00000381070.3	37	CCDS3982.2																																																																																			.		0.391	CWC27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000157247.4	NM_005869	
PHACTR2	9749	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	6	144086413	144086414	+	Frame_Shift_Ins	INS	-	-	A			TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr6:144086413_144086414insA	ENST00000427704.2	+	6	807_808	c.677_678insA	c.(676-681)tcaaaafs	p.SK226fs	PHACTR2_ENST00000440869.2_Frame_Shift_Ins_p.SK237fs|PHACTR2_ENST00000367582.3_Frame_Shift_Ins_p.SK157fs|PHACTR2_ENST00000305766.6_Frame_Shift_Ins_p.SK146fs|PHACTR2_ENST00000367584.4_Frame_Shift_Ins_p.SK214fs	NM_001100166.1|NM_014721.2	NP_001093636.1|NP_055536.2	O75167	PHAR2_HUMAN	phosphatase and actin regulator 2	226							protein phosphatase inhibitor activity (GO:0004864)			NS(3)|breast(1)|cervix(1)|endometrium(3)|large_intestine(4)|lung(13)|ovary(2)|prostate(1)|upper_aerodigestive_tract(2)	30				OV - Ovarian serous cystadenocarcinoma(155;1.58e-05)|GBM - Glioblastoma multiforme(68;0.0386)		TCCTCTCATTCAAAAAAAACAA	0.396																																					p.S237fs	Pancreas(12;292 433 7358 48260 52635)|Ovarian(20;501 618 3485 36581 49208)	.											.	PHACTR2-92	0			c.710_711insA						.																																			SO:0001589	frameshift_variant	9749	exon6			CTCATTCAAAAAA	AB014580	CCDS43512.1, CCDS47492.1, CCDS47493.1, CCDS47494.1	6q24.1	2013-01-24	2004-05-20	2004-05-20	ENSG00000112419	ENSG00000112419		"""Phosphatase and actin regulators"""	20956	protein-coding gene	gene with protein product		608724	"""chromosome 6 open reading frame 56"""	C6orf56		9734811, 15107502	Standard	NM_001100164		Approved	KIAA0680	uc010khi.3	O75167	OTTHUMG00000015732	ENST00000427704.2:c.685dupA	6.37:g.144086421_144086421dupA	ENSP00000391763:p.Ser226fs	Somatic	24	0		WXS	Illumina GAIIx	Phase_I	25	20	NM_001100164	0	0	0	0	0	A6NKP5|A7MCZ5|A8MZC0|B2RWP7|B4DN76|B4DPB5|B4DTH7|Q5TFA0|Q68DM2	Frame_Shift_Ins	INS	ENST00000427704.2	37	CCDS47492.1																																																																																			.		0.396	PHACTR2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000042528.2	NM_014721	
ICA1	3382	hgsc.bcm.edu	37	7	8198250	8198251	+	Frame_Shift_Ins	INS	-	-	T			TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr7:8198250_8198251insT	ENST00000402384.3	-	7	877_878	c.611_612insA	c.(610-612)aacfs	p.N204fs	ICA1_ENST00000401396.1_Frame_Shift_Ins_p.N192fs|ICA1_ENST00000422063.2_Frame_Shift_Ins_p.N204fs|ICA1_ENST00000407906.1_Frame_Shift_Ins_p.N204fs|ICA1_ENST00000406470.2_Frame_Shift_Ins_p.N204fs|ICA1_ENST00000396675.3_Frame_Shift_Ins_p.N204fs|ICA1_ENST00000265577.7_Frame_Shift_Ins_p.N203fs			Q05084	ICA69_HUMAN	islet cell autoantigen 1, 69kDa	204	AH. {ECO:0000255|PROSITE- ProRule:PRU00294}.				neurotransmitter transport (GO:0006836)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi membrane (GO:0000139)|secretory granule membrane (GO:0030667)|synaptic vesicle membrane (GO:0030672)		p.N204fs*5(3)		breast(1)|central_nervous_system(2)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(8)|urinary_tract(1)	23		Ovarian(82;0.0612)		UCEC - Uterine corpus endometrioid carcinoma (126;0.246)		ATTTGTCAAAGTTTTTTTTTGC	0.376																																					p.N204fs		.											.	ICA1-515	3	Deletion - Frameshift(3)	large_intestine(3)	c.612_613insA						.																																			SO:0001589	frameshift_variant	3382	exon7			GTCAAAGTTTTTT		CCDS34602.1, CCDS64595.1	7p22	2006-12-13	2002-08-29		ENSG00000003147	ENSG00000003147			5343	protein-coding gene	gene with protein product		147625	"""islet cell autoantigen 1 (69kD)"""			7918678, 8777998	Standard	NM_001276478		Approved	ICAp69	uc003srm.3	Q05084	OTTHUMG00000152008	ENST00000402384.3:c.612dupA	7.37:g.8198259_8198259dupT	ENSP00000385570:p.Asn204fs	Somatic	63	0		WXS	Illumina GAIIx	Phase_I	134	25	NM_022307	0	0	0	0	0	A8K7U1|B3FTQ2|P78506|Q13824|Q96HG3	Frame_Shift_Ins	INS	ENST00000402384.3	37	CCDS34602.1																																																																																			.		0.376	ICA1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000324793.1	NM_004968	
TMEM130	222865	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	7	98452922	98452923	+	Frame_Shift_Ins	INS	-	-	A			TCGA-OR-A5LB-01A-11D-A29I-10	TCGA-OR-A5LB-10A-01D-A29L-10	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1859d4f0-1cb2-48c4-8c28-f41da397e24d	1486299d-8e03-4ae8-8a7f-90c4d57168c2	g.chr7:98452922_98452923insA	ENST00000416379.2	-	5	747_748	c.743_744insT	c.(742-744)ttgfs	p.L248fs	TMEM130_ENST00000339375.4_Frame_Shift_Ins_p.L248fs|TMEM130_ENST00000450876.1_Frame_Shift_Ins_p.L164fs|TMEM130_ENST00000345589.4_Frame_Shift_Ins_p.L146fs|TMEM130_ENST00000546258.1_Frame_Shift_Ins_p.L229fs			Q8N3G9	TM130_HUMAN	transmembrane protein 130	248						Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)				breast(1)|central_nervous_system(1)|kidney(2)|large_intestine(7)|lung(6)|ovary(2)|prostate(2)|skin(3)|urinary_tract(1)	25	all_cancers(62;4.05e-09)|all_epithelial(64;2.62e-09)|Lung NSC(181;0.01)|all_lung(186;0.0115)|Esophageal squamous(72;0.0274)		STAD - Stomach adenocarcinoma(171;0.215)			GGGTGGGCCCCAACACTTGGAT	0.589																																					p.L248fs		.											.	TMEM130-91	0			c.744_745insT						.																																			SO:0001589	frameshift_variant	222865	exon5			GGGCCCCAACACT		CCDS5658.1, CCDS47649.1, CCDS47650.1	7q22.1	2006-03-09			ENSG00000166448	ENSG00000166448			25429	protein-coding gene	gene with protein product						12975309	Standard	NM_152913		Approved	DKFZp761L1417, FLJ42643	uc003upo.3	Q8N3G9	OTTHUMG00000154419	ENST00000416379.2:c.744dupT	7.37:g.98452924_98452924dupA	ENSP00000413163:p.Leu248fs	Somatic	145	0		WXS	Illumina GAIIx	Phase_I	256	41	NM_152913	0	0	0	0	0	A4D266|B7Z364|Q8IY46|Q8N0W9|Q8N3R2	Frame_Shift_Ins	INS	ENST00000416379.2	37	CCDS47650.1																																																																																			.		0.589	TMEM130-008	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000380713.1	NM_152913	
