#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_TTotCov	i_TVarCov	i_Transcript_Id	i_Trna_alt1	i_Trna_alt2	i_Trna_ref	i_Trna_tot	i_Trna_var	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
PERM1	84808	bcgsc.ca	37	1	915360	915360	+	Silent	SNP	A	A	G			TCGA-OR-A5LD-01A-11D-A29I-10	TCGA-OR-A5LD-10A-01D-A29L-10	A	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d84ce93-4c12-49da-87b3-c36d44672d59	afc22b50-442d-4fde-93ce-df0c281205c9	g.chr1:915360A>G	ENST00000341290.2	-	3	743	c.708T>C	c.(706-708)tcT>tcC	p.S236S	C1orf170_ENST00000433179.2_Silent_p.S256S			Q5SV97	PERM1_HUMAN		350					regulation of transcription, DNA-templated (GO:0006355)|response to muscle activity (GO:0014850)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)											GTTGCGGCTCAGAGGCAGGTG	0.592																																					.		.											.	C1orf170-68	0			.						.																																			SO:0001819	synonymous_variant	84808	.			CGGCTCAGAGGCA																												ENST00000341290.2:c.708T>C	1.37:g.915360A>G		Somatic	394	5		WXS	Illumina GAIIx	Phase_I	304	23	.	0	0	0	0	0	Q6ZVZ7|Q9BRF2|S5G239	RNA	SNP	ENST00000341290.2	37																																																																																				.		0.592	C1orf170-001	PUTATIVE	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000097943.2		
SRM	6723	hgsc.bcm.edu	37	1	11119899	11119899	+	Silent	SNP	T	T	C	rs7545802		TCGA-OR-A5LD-01A-11D-A29I-10	TCGA-OR-A5LD-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d84ce93-4c12-49da-87b3-c36d44672d59	afc22b50-442d-4fde-93ce-df0c281205c9	g.chr1:11119899T>C	ENST00000376957.2	-	1	182	c.102A>G	c.(100-102)tcA>tcG	p.S34S		NM_003132.2	NP_003123.2	P19623	SPEE_HUMAN	spermidine synthase	34	PABS.				cellular nitrogen compound metabolic process (GO:0034641)|polyamine metabolic process (GO:0006595)|small molecule metabolic process (GO:0044281)|spermidine biosynthetic process (GO:0008295)	cytosol (GO:0005829)	protein homodimerization activity (GO:0042803)|spermidine synthase activity (GO:0004766)			large_intestine(1)|lung(1)|urinary_tract(1)	3	Ovarian(185;0.249)	Lung NSC(185;1.74e-05)|all_lung(284;2.05e-05)|Renal(390;0.000147)|Colorectal(325;0.00205)|Breast(348;0.00262)|Hepatocellular(190;0.00913)|Ovarian(437;0.00965)|Myeloproliferative disorder(586;0.0255)	STAD - Stomach adenocarcinoma(5;0.228)	UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;3.14e-07)|COAD - Colon adenocarcinoma(227;7.11e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000294)|Kidney(185;0.000728)|KIRC - Kidney renal clear cell carcinoma(229;0.00258)|READ - Rectum adenocarcinoma(331;0.0487)|STAD - Stomach adenocarcinoma(313;0.192)	S-Adenosylmethionine(DB00118)	CCACCTGCAGTGACAGGGCCT	0.761													C|||	5008	1.0	1.0	1.0	5008	,	,		7294	1.0		1.0	False		,,,				2504	1.0				p.S34S		.											.	SRM-90	0			c.A102G						.						8.0	10.0	10.0					1																	11119899		1613	3461	5074	SO:0001819	synonymous_variant	6723	exon1			CTGCAGTGACAGG	BC033106	CCDS125.1	1p36-p22	2010-11-08			ENSG00000116649	ENSG00000116649	2.5.1.16		11296	protein-coding gene	gene with protein product		182891		SRML1		2344393	Standard	NM_003132		Approved	SPS1	uc001arz.1	P19623	OTTHUMG00000002119	ENST00000376957.2:c.102A>G	1.37:g.11119899T>C		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	4	4	NM_003132	0	0	0	1	1	B1AKP9|Q15511	Silent	SNP	ENST00000376957.2	37	CCDS125.1																																																																																			T|0.001;C|0.999		0.761	SRM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000006056.1	NM_003132	
SLC9A1	6548	broad.mit.edu;bcgsc.ca	37	1	27436203	27436203	+	Silent	SNP	G	G	A			TCGA-OR-A5LD-01A-11D-A29I-10	TCGA-OR-A5LD-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d84ce93-4c12-49da-87b3-c36d44672d59	afc22b50-442d-4fde-93ce-df0c281205c9	g.chr1:27436203G>A	ENST00000263980.3	-	3	1454	c.879C>T	c.(877-879)ctC>ctT	p.L293L	SLC9A1_ENST00000545949.1_5'UTR|SLC9A1_ENST00000374086.3_Silent_p.L293L	NM_003047.4	NP_003038.2	P19634	SL9A1_HUMAN	solute carrier family 9, subfamily A (NHE1, cation proton antiporter 1), member 1	293					carbohydrate metabolic process (GO:0005975)|cardiac muscle cell differentiation (GO:0055007)|cell growth (GO:0016049)|cellular response to acidic pH (GO:0071468)|glycosaminoglycan metabolic process (GO:0030203)|hyaluronan catabolic process (GO:0030214)|hyaluronan metabolic process (GO:0030212)|hydrogen ion transmembrane transport (GO:1902600)|ion transport (GO:0006811)|negative regulation of apoptotic process (GO:0043066)|neuron death (GO:0070997)|positive regulation of action potential (GO:0045760)|positive regulation of cell growth (GO:0030307)|positive regulation of mitochondrial membrane permeability (GO:0035794)|protein oligomerization (GO:0051259)|regulation of intracellular pH (GO:0051453)|regulation of pH (GO:0006885)|regulation of sensory perception of pain (GO:0051930)|regulation of the force of heart contraction (GO:0002026)|response to acidic pH (GO:0010447)|response to drug (GO:0042493)|response to organic cyclic compound (GO:0014070)|small molecule metabolic process (GO:0044281)|sodium ion export (GO:0071436)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|membrane raft (GO:0045121)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium-dependent protein binding (GO:0048306)|sodium:proton antiporter activity (GO:0015385)|solute:proton antiporter activity (GO:0015299)			central_nervous_system(1)|cervix(3)|endometrium(3)|kidney(2)|large_intestine(4)|liver(1)|lung(7)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	27				UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|Epithelial(14;2.19e-50)|OV - Ovarian serous cystadenocarcinoma(117;1.8e-29)|Colorectal(126;7.61e-09)|COAD - Colon adenocarcinoma(152;9.32e-07)|BRCA - Breast invasive adenocarcinoma(304;0.000521)|KIRC - Kidney renal clear cell carcinoma(1967;0.00079)|STAD - Stomach adenocarcinoma(196;0.00125)|READ - Rectum adenocarcinoma(331;0.046)	Amiloride(DB00594)	TCAGGAAGCCGAGGAAGATGT	0.612																																					p.L293L		.											.	SLC9A1-91	0			c.C879T						.						146.0	144.0	145.0					1																	27436203		2203	4300	6503	SO:0001819	synonymous_variant	6548	exon3			GAAGCCGAGGAAG	M81768	CCDS295.1	1p36.1-p35	2014-06-13	2012-03-22		ENSG00000090020	ENSG00000090020		"""Solute carriers"""	11071	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 143"""	107310	"""solute carrier family 9 (sodium/hydrogen exchanger), isoform 1 (antiporter, Na+/H+, amiloride sensitive)"", ""solute carrier family 9 (sodium/hydrogen exchanger), member 1"""	APNH, NHE1		8283968	Standard	NM_003047		Approved	PPP1R143	uc001bnm.4	P19634	OTTHUMG00000004271	ENST00000263980.3:c.879C>T	1.37:g.27436203G>A		Somatic	220	1		WXS	Illumina GAIIx	Phase_I	206	19	NM_003047	0	0	0	0	0	B1ALD6|D3DPL4|Q96EM2	Silent	SNP	ENST00000263980.3	37	CCDS295.1																																																																																			.		0.612	SLC9A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000012336.2	NM_003047	
KANK4	163782	broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	62713267	62713267	+	Silent	SNP	T	T	A			TCGA-OR-A5LD-01A-11D-A29I-10	TCGA-OR-A5LD-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d84ce93-4c12-49da-87b3-c36d44672d59	afc22b50-442d-4fde-93ce-df0c281205c9	g.chr1:62713267T>A	ENST00000371153.4	-	9	3138	c.2760A>T	c.(2758-2760)gcA>gcT	p.A920A	KANK4_ENST00000317477.4_Silent_p.A58A|KANK4_ENST00000354381.3_Silent_p.A292A|KANK4_ENST00000371150.1_Silent_p.A276A	NM_181712.4	NP_859063.3	Q5T7N3	KANK4_HUMAN	KN motif and ankyrin repeat domains 4	920						cytoplasm (GO:0005737)				NS(1)|breast(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(49)|ovary(3)|prostate(4)|skin(9)|stomach(1)|upper_aerodigestive_tract(2)	81						GATTGACATCTGCCTGGCAGC	0.627																																					p.A920A		.											.	KANK4-74	0			c.A2760T						.						101.0	84.0	90.0					1																	62713267		2203	4300	6503	SO:0001819	synonymous_variant	163782	exon9			GACATCTGCCTGG	AK096259	CCDS620.1	1p31.3	2013-10-11	2008-01-29	2008-01-29	ENSG00000132854	ENSG00000132854		"""KN motif and ankyrin repeat domain containing"", ""Ankyrin repeat domain containing"""	27263	protein-coding gene	gene with protein product		614612	"""ankyrin repeat domain 38"""	ANKRD38		17996375, 19554261	Standard	NM_181712		Approved	KIAA0172	uc001dah.4	Q5T7N3	OTTHUMG00000008971	ENST00000371153.4:c.2760A>T	1.37:g.62713267T>A		Somatic	178	3		WXS	Illumina GAIIx	Phase_I	140	44	NM_181712	0	0	0	0	0	B1ALP7|Q6P9A0|Q86T71|Q86VE6|Q8NAX3	Silent	SNP	ENST00000371153.4	37	CCDS620.1																																																																																			.		0.627	KANK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000024877.1	NM_181712	
CLCA4	22802	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	87033202	87033202	+	Silent	SNP	T	T	C			TCGA-OR-A5LD-01A-11D-A29I-10	TCGA-OR-A5LD-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d84ce93-4c12-49da-87b3-c36d44672d59	afc22b50-442d-4fde-93ce-df0c281205c9	g.chr1:87033202T>C	ENST00000370563.3	+	7	1092	c.1050T>C	c.(1048-1050)gaT>gaC	p.D350D	CLCA4_ENST00000263723.5_Silent_p.D63D	NM_012128.3	NP_036260.2	Q14CN2	CLCA4_HUMAN	chloride channel accessory 4	350	VWFA. {ECO:0000255|PROSITE- ProRule:PRU00219}.				chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|transport (GO:0006810)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	chloride channel activity (GO:0005254)			breast(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(7)|liver(2)|lung(21)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	44		Lung NSC(277;0.238)		all cancers(265;0.0202)|Epithelial(280;0.0404)		TTCACTTTGATAGTACTGCCA	0.418																																					p.D350D		.											.	CLCA4-92	0			c.T1050C						.						100.0	101.0	100.0					1																	87033202		1946	4177	6123	SO:0001819	synonymous_variant	22802	exon7			CTTTGATAGTACT	AF127035	CCDS41355.1	1p31-p22	2012-02-26	2009-01-29		ENSG00000016602	ENSG00000016602			2018	protein-coding gene	gene with protein product			"""chloride channel, calcium activated, family member 4"", ""chloride channel regulator 4"""			10437792	Standard	NM_012128		Approved	CaCC2	uc009wcs.3	Q14CN2	OTTHUMG00000010260	ENST00000370563.3:c.1050T>C	1.37:g.87033202T>C		Somatic	147	0		WXS	Illumina GAIIx	Phase_I	142	49	NM_012128	0	0	0	0	0	A8MQC9|B7Z1Q5|Q6UX81|Q9UNF7	Silent	SNP	ENST00000370563.3	37	CCDS41355.1																																																																																			.		0.418	CLCA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000028292.1	NM_012128	
SLC25A24	29957	bcgsc.ca	37	1	108728484	108728484	+	Silent	SNP	T	T	C	rs862493	byFrequency	TCGA-OR-A5LD-01A-11D-A29I-10	TCGA-OR-A5LD-10A-01D-A29L-10	T	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d84ce93-4c12-49da-87b3-c36d44672d59	afc22b50-442d-4fde-93ce-df0c281205c9	g.chr1:108728484T>C	ENST00000565488.1	-	2	495	c.276A>G	c.(274-276)aaA>aaG	p.K92K	SLC25A24_ENST00000370041.4_Silent_p.K73K	NM_013386.4	NP_037518.3	Q6NUK1	SCMC1_HUMAN	solute carrier family 25 (mitochondrial carrier; phosphate carrier), member 24	92	EF-hand 3. {ECO:0000255|PROSITE- ProRule:PRU00448}.				ATP transport (GO:0015867)|cellular response to calcium ion (GO:0071277)|cellular response to oxidative stress (GO:0034599)|mitochondrial transport (GO:0006839)|regulation of cell death (GO:0010941)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	ATP transmembrane transporter activity (GO:0005347)|calcium ion binding (GO:0005509)			endometrium(1)|kidney(1)|large_intestine(7)|lung(5)|ovary(1)|upper_aerodigestive_tract(1)	16		all_epithelial(167;3.72e-05)|all_lung(203;0.000567)|Lung NSC(277;0.0011)|Melanoma(281;0.211)		Colorectal(144;0.0345)|Lung(183;0.0971)|COAD - Colon adenocarcinoma(174;0.127)|Epithelial(280;0.134)		TAAATGCCAATTTCATTTTCT	0.303													T|||	825	0.164736	0.1815	0.1657	5008	,	,		14544	0.0794		0.2157	False		,,,				2504	0.1769				p.K92K		.											.	SLC25A24-91	0			c.A276G						.	T	,	815,3581	315.2+/-294.0	86,643,1469	96.0	91.0	93.0		276,219	0.8	0.9	1	dbSNP_86	93	1794,6794	310.8+/-310.0	193,1408,2693	no	coding-synonymous,coding-synonymous	SLC25A24	NM_013386.3,NM_213651.1	,	279,2051,4162	CC,CT,TT		20.8896,18.5396,20.094	,	92/478,73/459	108728484	2609,10375	2198	4294	6492	SO:0001819	synonymous_variant	29957	exon2			TGCCAATTTCATT	AJ619961	CCDS786.1, CCDS41361.1	1p13.2	2013-05-22			ENSG00000085491	ENSG00000085491		"""Solute carriers"", ""EF-hand domain containing"""	20662	protein-coding gene	gene with protein product		608744				15123600	Standard	NM_013386		Approved	DKFZp586G0123, APC1	uc001dvn.5	Q6NUK1	OTTHUMG00000011013	ENST00000565488.1:c.276A>G	1.37:g.108728484T>C		Somatic	74	0		WXS	Illumina GAIIx	Phase_I	90	6	NM_013386	0	0	2	2	0	B7ZAI9|Q5T331|Q5T485|Q6PJJ9|Q705K4|Q9P129	Silent	SNP	ENST00000565488.1	37	CCDS41361.1																																																																																			C|0.183;N|0.000		0.303	SLC25A24-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000030280.2	NM_013386	
POGZ	23126	hgsc.bcm.edu;broad.mit.edu	37	1	151397436	151397437	+	Frame_Shift_Del	DEL	TG	TG	-			TCGA-OR-A5LD-01A-11D-A29I-10	TCGA-OR-A5LD-10A-01D-A29L-10	TG	TG	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d84ce93-4c12-49da-87b3-c36d44672d59	afc22b50-442d-4fde-93ce-df0c281205c9	g.chr1:151397436_151397437delTG	ENST00000271715.2	-	8	1493_1494	c.1179_1180delCA	c.(1177-1182)cacatgfs	p.M394fs	POGZ_ENST00000540984.1_Intron|POGZ_ENST00000531094.1_Frame_Shift_Del_p.M332fs|POGZ_ENST00000491586.1_Frame_Shift_Del_p.M341fs|POGZ_ENST00000361398.3_Frame_Shift_Del_p.M341fs|POGZ_ENST00000392723.1_Frame_Shift_Del_p.M341fs|POGZ_ENST00000368863.2_Frame_Shift_Del_p.M299fs|POGZ_ENST00000409503.1_Frame_Shift_Del_p.M385fs	NM_001194937.1|NM_015100.3	NP_001181866.1|NP_055915.2	Q7Z3K3	POGZ_HUMAN	pogo transposable element with ZNF domain	394					kinetochore assembly (GO:0051382)|mitotic sister chromatid cohesion (GO:0007064)	cytoplasm (GO:0005737)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(1)|endometrium(10)|kidney(3)|large_intestine(10)|liver(2)|lung(11)|ovary(3)|prostate(2)|skin(3)|urinary_tract(1)	47	Lung SC(34;0.00471)|Ovarian(49;0.00672)|Hepatocellular(266;0.0997)|all_hematologic(923;0.127)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.112)|LUSC - Lung squamous cell carcinoma(543;0.181)			CTTACACACATGTGACCTCTCA	0.431																																					p.393_394del		.											.	POGZ-93	0			c.1179_1180del						.																																			SO:0001589	frameshift_variant	23126	exon8			CACACATGTGACC	AB007930	CCDS997.1, CCDS998.1, CCDS44222.1, CCDS44222.2, CCDS53365.1, CCDS53366.1	1q21.1	2013-07-22			ENSG00000143442	ENSG00000143442			18801	protein-coding gene	gene with protein product	"""zinc finger protein 280E"", ""putative protein product of Nbla00003"""	614787				10976766	Standard	NM_015100		Approved	KIAA0461, ZNF635m, ZNF280E	uc001eyd.2	Q7Z3K3	OTTHUMG00000012499	ENST00000271715.2:c.1179_1180delCA	1.37:g.151397438_151397439delTG	ENSP00000271715:p.Met394fs	Somatic	295	0		WXS	Illumina GAIIx	Phase_I	259	23	NM_015100	0	0	0	0	0	B4DTP8|B4DYL9|B7ZBY5|E9PM80|O75049|Q3LIC4|Q5SZS1|Q5SZS2|Q5SZS3|Q5SZS4|Q8TDZ7|Q9Y4X7	Frame_Shift_Del	DEL	ENST00000271715.2	37	CCDS997.1																																																																																			.		0.431	POGZ-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000034915.2	NM_207171	
TNR	7143	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	175293508	175293508	+	Missense_Mutation	SNP	T	T	A			TCGA-OR-A5LD-01A-11D-A29I-10	TCGA-OR-A5LD-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d84ce93-4c12-49da-87b3-c36d44672d59	afc22b50-442d-4fde-93ce-df0c281205c9	g.chr1:175293508T>A	ENST00000367674.2	-	22	4649	c.3941A>T	c.(3940-3942)gAg>gTg	p.E1314V	RP3-518E13.2_ENST00000569593.1_RNA|TNR_ENST00000263525.2_Missense_Mutation_p.E1314V			Q92752	TENR_HUMAN	tenascin R	1314	Fibrinogen C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00739}.				associative learning (GO:0008306)|axon guidance (GO:0007411)|cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|locomotory exploration behavior (GO:0035641)|long-term synaptic potentiation (GO:0060291)|negative regulation of axon extension involved in regeneration (GO:0048692)|negative regulation of cell-cell adhesion (GO:0022408)|negative regulation of synaptic transmission (GO:0050805)|neuromuscular process controlling balance (GO:0050885)|neuron cell-cell adhesion (GO:0007158)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|positive regulation of transmission of nerve impulse (GO:0051971)|synapse organization (GO:0050808)|telencephalon cell migration (GO:0022029)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|membrane raft (GO:0045121)|nucleus (GO:0005634)|perineuronal net (GO:0072534)|proteinaceous extracellular matrix (GO:0005578)				NS(3)|breast(7)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(29)|lung(98)|ovary(4)|pancreas(5)|prostate(4)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	177	Renal(580;0.146)					GTGCCTGGACTCCCCGTACTT	0.493																																					p.E1314V		.											.	TNR-324	0			c.A3941T						.						190.0	138.0	156.0					1																	175293508		2203	4300	6503	SO:0001583	missense	7143	exon22			CTGGACTCCCCGT	X98085	CCDS1318.1	1q24	2013-02-11	2012-07-12		ENSG00000116147	ENSG00000116147		"""Fibrinogen C domain containing"", ""Fibronectin type III domain containing"""	11953	protein-coding gene	gene with protein product	"""restrictin"", ""janusin"""	601995				8626505, 8940128	Standard	NM_003285		Approved		uc009wwu.1	Q92752	OTTHUMG00000034876	ENST00000367674.2:c.3941A>T	1.37:g.175293508T>A	ENSP00000356646:p.Glu1314Val	Somatic	294	0		WXS	Illumina GAIIx	Phase_I	257	67	NM_003285	0	0	0	0	0	C9J563|Q15568|Q5R3G0	Missense_Mutation	SNP	ENST00000367674.2	37	CCDS1318.1	.	.	.	.	.	.	.	.	.	.	T	28.9	4.959588	0.92791	.	.	ENSG00000116147	ENST00000367674;ENST00000263525;ENST00000367673	T;T	0.22336	1.96;1.96	5.66	5.66	0.87406	Fibrinogen, alpha/beta/gamma chain, C-terminal globular (4);Fibrinogen, alpha/beta/gamma chain, C-terminal globular, subdomain 2 (1);	0.000000	0.85682	D	0.000000	T	0.41396	0.1157	L	0.49126	1.545	0.80722	D	1	D	0.89917	1.0	D	0.79784	0.993	T	0.15407	-1.0438	10	0.52906	T	0.07	.	15.5673	0.76303	0.0:0.0:0.0:1.0	.	1314	Q92752	TENR_HUMAN	V	1314;1314;1224	ENSP00000356646:E1314V;ENSP00000263525:E1314V	ENSP00000263525:E1314V	E	-	2	0	TNR	173560131	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.930000	0.87610	2.154000	0.67381	0.533000	0.62120	GAG	.		0.493	TNR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084414.4	NM_003285	
HMCN1	83872	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	186092320	186092320	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5LD-01A-11D-A29I-10	TCGA-OR-A5LD-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d84ce93-4c12-49da-87b3-c36d44672d59	afc22b50-442d-4fde-93ce-df0c281205c9	g.chr1:186092320C>T	ENST00000271588.4	+	81	12696	c.12467C>T	c.(12466-12468)tCa>tTa	p.S4156L	HMCN1_ENST00000367492.2_Missense_Mutation_p.S4156L	NM_031935.2	NP_114141.2	Q96RW7	HMCN1_HUMAN	hemicentin 1	4156	Ig-like C2-type 40.				response to stimulus (GO:0050896)|visual perception (GO:0007601)	basement membrane (GO:0005604)|cell cortex (GO:0005938)|cell junction (GO:0030054)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)			NS(2)|autonomic_ganglia(1)|breast(10)|central_nervous_system(2)|cervix(1)|endometrium(28)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(58)|liver(3)|lung(101)|ovary(23)|pancreas(4)|prostate(20)|skin(8)|stomach(1)|upper_aerodigestive_tract(11)|urinary_tract(18)	308						GTAGCAGGATCAAGCAGCACA	0.502																																					p.S4156L		.											.	HMCN1-113	0			c.C12467T						.						57.0	42.0	47.0					1																	186092320		2203	4300	6503	SO:0001583	missense	83872	exon81			CAGGATCAAGCAG	AF156100	CCDS30956.1	1q25.3-q31.1	2013-01-11			ENSG00000143341	ENSG00000143341		"""Fibulins"", ""Immunoglobulin superfamily / I-set domain containing"""	19194	protein-coding gene	gene with protein product	"""fibulin 6"""	608548	"""age-related macular degeneration 1 (senile macular degeneration)"""	ARMD1		11222143	Standard	NM_031935		Approved	FBLN6, FIBL6, FIBL-6	uc001grq.1	Q96RW7	OTTHUMG00000059337	ENST00000271588.4:c.12467C>T	1.37:g.186092320C>T	ENSP00000271588:p.Ser4156Leu	Somatic	132	0		WXS	Illumina GAIIx	Phase_I	103	32	NM_031935	0	0	0	0	0	A6NGE3|Q5TYR7|Q96DN3|Q96DN8|Q96SC3	Missense_Mutation	SNP	ENST00000271588.4	37	CCDS30956.1	.	.	.	.	.	.	.	.	.	.	C	15.87	2.960547	0.53400	.	.	ENSG00000143341	ENST00000271588;ENST00000367492	T;T	0.68765	-0.35;-0.35	5.85	4.94	0.65067	Immunoglobulin I-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.181260	0.48767	D	0.000178	T	0.78201	0.4246	L	0.55103	1.725	0.49051	D	0.999741	D	0.71674	0.998	D	0.79784	0.993	T	0.78163	-0.2311	10	0.42905	T	0.14	.	16.467	0.84081	0.1321:0.8678:0.0:0.0	.	4156	Q96RW7	HMCN1_HUMAN	L	4156	ENSP00000271588:S4156L;ENSP00000356462:S4156L	ENSP00000271588:S4156L	S	+	2	0	HMCN1	184358943	1.000000	0.71417	0.471000	0.27229	0.051000	0.14879	5.372000	0.66156	1.466000	0.48025	0.655000	0.94253	TCA	.		0.502	HMCN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000131848.1	NM_031935	
NFASC	23114	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	204923329	204923329	+	Nonsense_Mutation	SNP	C	C	T			TCGA-OR-A5LD-01A-11D-A29I-10	TCGA-OR-A5LD-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d84ce93-4c12-49da-87b3-c36d44672d59	afc22b50-442d-4fde-93ce-df0c281205c9	g.chr1:204923329C>T	ENST00000401399.1	+	5	428	c.229C>T	c.(229-231)Cga>Tga	p.R77*	NFASC_ENST00000338586.6_Nonsense_Mutation_p.R77*|NFASC_ENST00000404076.1_Nonsense_Mutation_p.R71*|NFASC_ENST00000513543.1_Nonsense_Mutation_p.R71*|NFASC_ENST00000338515.6_Nonsense_Mutation_p.R77*|NFASC_ENST00000367169.4_Nonsense_Mutation_p.R77*|NFASC_ENST00000367170.4_Nonsense_Mutation_p.R77*|NFASC_ENST00000539706.1_Nonsense_Mutation_p.R71*|NFASC_ENST00000360049.4_Nonsense_Mutation_p.R71*|NFASC_ENST00000339876.6_Nonsense_Mutation_p.R77*|NFASC_ENST00000367172.4_Nonsense_Mutation_p.R77*|NFASC_ENST00000367171.4_Nonsense_Mutation_p.R77*|NFASC_ENST00000403080.1_Nonsense_Mutation_p.R77*|NFASC_ENST00000404907.1_Nonsense_Mutation_p.R71*			O94856	NFASC_HUMAN	neurofascin	77	Ig-like C2-type 1.				axon guidance (GO:0007411)|clustering of voltage-gated sodium channels (GO:0045162)|heterotypic cell-cell adhesion (GO:0034113)|myelination (GO:0042552)|paranodal junction assembly (GO:0030913)|peripheral nervous system development (GO:0007422)|protein localization to juxtaparanode region of axon (GO:0071205)|protein localization to paranode region of axon (GO:0002175)|synapse organization (GO:0050808)|transmission of nerve impulse (GO:0019226)	axon initial segment (GO:0043194)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|intracellular (GO:0005622)|node of Ranvier (GO:0033268)|paranodal junction (GO:0033010)|paranode region of axon (GO:0033270)|plasma membrane (GO:0005886)				NS(1)|breast(4)|central_nervous_system(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(22)|liver(1)|lung(24)|ovary(3)|pancreas(1)|prostate(3)|skin(5)|upper_aerodigestive_tract(1)	81	all_cancers(21;0.0375)|Breast(84;0.0437)|all_epithelial(62;0.171)|Prostate(682;0.19)		KIRC - Kidney renal clear cell carcinoma(13;0.0584)|Kidney(21;0.0934)|BRCA - Breast invasive adenocarcinoma(75;0.158)			CCACTGGACACGAAACAGCAG	0.617																																					p.R77X		.											.	NFASC-139	0			c.C229T						.						52.0	48.0	49.0					1																	204923329		2203	4300	6503	SO:0001587	stop_gained	23114	exon6			TGGACACGAAACA	AK027553	CCDS30982.1, CCDS53460.1, CCDS53461.1, CCDS53462.1	1q32.1	2013-02-11	2010-06-24		ENSG00000163531	ENSG00000163531		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	29866	protein-coding gene	gene with protein product		609145	"""neurofascin homolog (chicken)"""			1377696, 8672144	Standard	NM_015090		Approved	NRCAML, KIAA0756, FLJ46866, NF	uc001hbj.3	O94856	OTTHUMG00000151697	ENST00000401399.1:c.229C>T	1.37:g.204923329C>T	ENSP00000385637:p.Arg77*	Somatic	144	0		WXS	Illumina GAIIx	Phase_I	120	12	NM_001005388	0	0	0	0	0	B2RNN8|B3KQZ1|B5MDP6|B5MDR6|B7ZMD8|Q149P5|Q5T2F0|Q5T2F1|Q5T2F2|Q5T2F3|Q5T2F4|Q5T2F5|Q5T2F6|Q5T2F7|Q5T2F9|Q5T2G0|Q5W9F8|Q68DH3|Q6ZQV6|Q7Z3K1|Q96HT1|Q96K50	Nonsense_Mutation	SNP	ENST00000401399.1	37	CCDS53460.1	.	.	.	.	.	.	.	.	.	.	C	38	6.758924	0.97817	.	.	ENSG00000163531	ENST00000367172;ENST00000367171;ENST00000367170;ENST00000338515;ENST00000339876;ENST00000338586;ENST00000295776;ENST00000539706;ENST00000360049;ENST00000367169;ENST00000446412;ENST00000403080;ENST00000404076;ENST00000401399;ENST00000505079;ENST00000404907;ENST00000513543;ENST00000430393	.	.	.	5.37	3.38	0.38709	.	0.000000	0.47852	D	0.000213	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	13.1434	0.59448	0.4451:0.5549:0.0:0.0	.	.	.	.	X	77;77;77;77;77;77;71;71;71;77;77;77;71;77;77;71;71;47	.	ENSP00000295776:R71X	R	+	1	2	NFASC	203189952	0.974000	0.33945	0.675000	0.29917	0.804000	0.45430	2.457000	0.45005	1.216000	0.43427	-0.274000	0.10170	CGA	.		0.617	NFASC-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000131237.1	NM_001005388	
CR2	1380	broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	207643213	207643213	+	Nonsense_Mutation	SNP	A	A	T			TCGA-OR-A5LD-01A-11D-A29I-10	TCGA-OR-A5LD-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d84ce93-4c12-49da-87b3-c36d44672d59	afc22b50-442d-4fde-93ce-df0c281205c9	g.chr1:207643213A>T	ENST00000367058.3	+	6	1180	c.991A>T	c.(991-993)Aag>Tag	p.K331*	CR2_ENST00000367059.3_Nonsense_Mutation_p.K331*|CR2_ENST00000367057.3_Nonsense_Mutation_p.K331*|CR2_ENST00000485707.1_3'UTR|CR2_ENST00000458541.2_Nonsense_Mutation_p.K331*	NM_001877.4	NP_001868.2	P20023	CR2_HUMAN	complement component (3d/Epstein Barr virus) receptor 2	331	Sushi 5. {ECO:0000255|PROSITE- ProRule:PRU00302}.				B cell differentiation (GO:0030183)|B cell proliferation (GO:0042100)|complement activation, classical pathway (GO:0006958)|immune response (GO:0006955)|innate immune response (GO:0045087)	external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	complement binding (GO:0001848)|complement receptor activity (GO:0004875)|DNA binding (GO:0003677)|protein homodimerization activity (GO:0042803)|transmembrane signaling receptor activity (GO:0004888)			NS(2)|breast(3)|endometrium(4)|kidney(3)|large_intestine(12)|lung(26)|ovary(1)|pancreas(1)|prostate(1)|skin(12)|upper_aerodigestive_tract(3)|urinary_tract(1)	69						TGATAGTCAGAAGACTGGGAC	0.522																																					p.K331X		.											.	CR2-232	0			c.A991T						.						117.0	101.0	106.0					1																	207643213		2203	4300	6503	SO:0001587	stop_gained	1380	exon6			AGTCAGAAGACTG	M26004	CCDS1478.1, CCDS31007.1	1q32	2014-09-17			ENSG00000117322	ENSG00000117322		"""CD molecules"", ""Complement system"""	2336	protein-coding gene	gene with protein product		120650					Standard	NM_001006658		Approved	CD21	uc001hfv.3	P20023	OTTHUMG00000036307	ENST00000367058.3:c.991A>T	1.37:g.207643213A>T	ENSP00000356025:p.Lys331*	Somatic	163	2		WXS	Illumina GAIIx	Phase_I	156	22	NM_001006658	0	0	0	0	0	C9JHD2|Q13866|Q14212|Q53EL2|Q5BKT9|Q5SR46|Q5SR48	Nonsense_Mutation	SNP	ENST00000367058.3	37	CCDS1478.1	.	.	.	.	.	.	.	.	.	.	A	21.7	4.194930	0.78902	.	.	ENSG00000117322	ENST00000367058;ENST00000367057;ENST00000367059;ENST00000458541	.	.	.	5.09	-1.3	0.09259	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	4.0476	0.09779	0.4476:0.0:0.3818:0.1706	.	.	.	.	X	331	.	ENSP00000356024:K331X	K	+	1	0	CR2	205709836	0.000000	0.05858	0.004000	0.12327	0.767000	0.43475	-0.128000	0.10531	-0.118000	0.11851	0.459000	0.35465	AAG	.		0.522	CR2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000088274.1	NM_001877	
TACC2	10579	broad.mit.edu;bcgsc.ca	37	10	123842918	123842918	+	Silent	SNP	A	A	T			TCGA-OR-A5LD-01A-11D-A29I-10	TCGA-OR-A5LD-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d84ce93-4c12-49da-87b3-c36d44672d59	afc22b50-442d-4fde-93ce-df0c281205c9	g.chr10:123842918A>T	ENST00000369005.1	+	4	1243	c.903A>T	c.(901-903)acA>acT	p.T301T	TACC2_ENST00000513429.1_Intron|TACC2_ENST00000358010.1_Intron|TACC2_ENST00000515273.1_Silent_p.T301T|TACC2_ENST00000334433.3_Silent_p.T301T|TACC2_ENST00000453444.2_Silent_p.T301T|TACC2_ENST00000515603.1_Silent_p.T301T	NM_206862.2	NP_996744.2	O95359	TACC2_HUMAN	transforming, acidic coiled-coil containing protein 2	301					astral microtubule organization (GO:0030953)|cerebral cortex development (GO:0021987)|interkinetic nuclear migration (GO:0022027)|neurogenesis (GO:0022008)|regulation of microtubule-based process (GO:0032886)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|nucleolus (GO:0005730)|nucleus (GO:0005634)	nuclear hormone receptor binding (GO:0035257)			NS(1)|breast(5)|central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(15)|lung(27)|ovary(6)|prostate(3)|skin(8)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(3)	83		all_neural(114;0.0656)|Lung NSC(174;0.136)|all_lung(145;0.17)|Breast(234;0.197)				AGTATTTAACAGATGACTTGG	0.587																																					p.T301T		.											.	TACC2-296	0			c.A903T						.						48.0	58.0	55.0					10																	123842918		2203	4300	6503	SO:0001819	synonymous_variant	10579	exon4			TTTAACAGATGAC	AF095791	CCDS7625.1, CCDS7626.1, CCDS7627.1, CCDS7628.1	10q26	2008-07-29			ENSG00000138162	ENSG00000138162			11523	protein-coding gene	gene with protein product		605302				14767476	Standard	XM_005269388		Approved	AZU-1	uc001lfv.3	O95359	OTTHUMG00000019181	ENST00000369005.1:c.903A>T	10.37:g.123842918A>T		Somatic	135	1		WXS	Illumina GAIIx	Phase_I	184	11	NM_206862	0	0	0	0	0	Q4VXL0|Q4VXL3|Q4VXL6|Q4VXL7|Q5U5T7|Q86WG6|Q86WG7|Q8TCK9|Q9BVQ1|Q9NZ41|Q9NZR5	Silent	SNP	ENST00000369005.1	37	CCDS7626.1																																																																																			.		0.587	TACC2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000090004.1		
CFAP46	54777	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	134736085	134736085	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5LD-01A-11D-A29I-10	TCGA-OR-A5LD-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d84ce93-4c12-49da-87b3-c36d44672d59	afc22b50-442d-4fde-93ce-df0c281205c9	g.chr10:134736085G>A	ENST00000368586.5	-	12	1484	c.1384C>T	c.(1384-1386)Cgg>Tgg	p.R462W	TTC40_ENST00000368582.2_Missense_Mutation_p.R462W	NM_001200049.2	NP_001186978.2														breast(1)|endometrium(5)|lung(19)|urinary_tract(3)	28						ATCCTGTCCCGGTAGAGGCCC	0.677																																					p.R462W		.											.	.	0			c.C1384T						.																																			SO:0001583	missense	54777	exon12			TGTCCCGGTAGAG																												ENST00000368586.5:c.1384C>T	10.37:g.134736085G>A	ENSP00000357575:p.Arg462Trp	Somatic	124	0		WXS	Illumina GAIIx	Phase_I	155	46	NM_001200049	0	0	0	0	0		Missense_Mutation	SNP	ENST00000368586.5	37	CCDS58101.1	.	.	.	.	.	.	.	.	.	.	G	11.00	1.510319	0.27036	.	.	ENSG00000171811	ENST00000368586;ENST00000368582	T;T	0.48836	2.79;0.8	3.28	-0.308	0.12773	.	0.496191	0.17521	N	0.171259	T	0.43500	0.1250	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.40040	-0.9584	7	0.72032	D	0.01	-12.2785	6.0503	0.19783	0.0:0.1669:0.2891:0.544	.	.	.	.	W	462	ENSP00000357575:R462W;ENSP00000357571:R462W	ENSP00000357571:R462W	R	-	1	2	C10orf93	134586075	0.000000	0.05858	0.962000	0.40283	0.153000	0.21895	0.063000	0.14410	0.173000	0.19788	-0.521000	0.04368	CGG	.		0.677	TTC40-001	PUTATIVE	basic|appris_candidate_longest|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000051095.3		
KNDC1	85442	hgsc.bcm.edu;broad.mit.edu	37	10	135015372	135015372	+	Silent	SNP	G	G	T			TCGA-OR-A5LD-01A-11D-A29I-10	TCGA-OR-A5LD-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d84ce93-4c12-49da-87b3-c36d44672d59	afc22b50-442d-4fde-93ce-df0c281205c9	g.chr10:135015372G>T	ENST00000304613.3	+	17	3378	c.3357G>T	c.(3355-3357)gcG>gcT	p.A1119A	KNDC1_ENST00000368572.2_Silent_p.A1121A|KNDC1_ENST00000368571.2_Silent_p.A1054A			Q76NI1	VKIND_HUMAN	kinase non-catalytic C-lobe domain (KIND) containing 1	1119					cerebellar granule cell differentiation (GO:0021707)|positive regulation of protein phosphorylation (GO:0001934)|regulation of dendrite morphogenesis (GO:0048814)|small GTPase mediated signal transduction (GO:0007264)	dendrite (GO:0030425)|guanyl-nucleotide exchange factor complex (GO:0032045)|neuronal cell body (GO:0043025)	protein serine/threonine kinase activity (GO:0004674)|Ras guanyl-nucleotide exchange factor activity (GO:0005088)			NS(4)|breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(27)|ovary(1)|prostate(5)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	60		all_cancers(35;4.16e-10)|all_epithelial(44;2.07e-08)|Lung NSC(174;0.000845)|all_lung(145;0.00145)|all_neural(114;0.0299)|Melanoma(40;0.123)|Colorectal(31;0.173)|Glioma(114;0.203)		OV - Ovarian serous cystadenocarcinoma(35;8.77e-06)|Epithelial(32;1.13e-05)|all cancers(32;1.51e-05)		GGCAGCAGGCGGACGGGGCCC	0.706																																					p.A1119A		.											.	KNDC1-229	0			c.G3357T						.																																			SO:0001819	synonymous_variant	85442	exon17			GCAGGCGGACGGG	AK074179	CCDS7674.1	10q26.3	2004-09-14	2004-04-07		ENSG00000171798	ENSG00000171798			29374	protein-coding gene	gene with protein product			"""RasGEF domain family, member 2"""	RASGEF2, C10orf23		11214970	Standard	NM_152643		Approved	KIAA1768, bB439H18.3, FLJ25027	uc001llz.1	Q76NI1	OTTHUMG00000019303	ENST00000304613.3:c.3357G>T	10.37:g.135015372G>T		Somatic	23	0		WXS	Illumina GAIIx	Phase_I	69	5	NM_152643	0	0	0	0	0	B0QZC5|Q5T233|Q6ZNH8|Q8TEE5|Q96LV7|Q9C095	Silent	SNP	ENST00000304613.3	37	CCDS7674.1																																																																																			.		0.706	KNDC1-006	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000277044.3	NM_152643	
OR52I2	143502	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	11	4608887	4608887	+	Missense_Mutation	SNP	A	A	C			TCGA-OR-A5LD-01A-11D-A29I-10	TCGA-OR-A5LD-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d84ce93-4c12-49da-87b3-c36d44672d59	afc22b50-442d-4fde-93ce-df0c281205c9	g.chr11:4608887A>C	ENST00000312614.4	+	1	867	c.845A>C	c.(844-846)tAt>tCt	p.Y282S		NM_001005170.2	NP_001005170.1	Q8NH67	O52I2_HUMAN	olfactory receptor, family 52, subfamily I, member 2	282						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(3)|kidney(1)|large_intestine(2)|lung(11)|pancreas(1)|skin(1)	19		Medulloblastoma(188;0.0075)|Breast(177;0.0461)|all_neural(188;0.0577)		Epithelial(150;8.45e-12)|BRCA - Breast invasive adenocarcinoma(625;0.0285)|LUSC - Lung squamous cell carcinoma(625;0.19)		GCTTTGTACTATCTACCTGGG	0.502																																					p.Y282S		.											.	OR52I2-91	0			c.A845C						.						157.0	150.0	152.0					11																	4608887		2201	4296	6497	SO:0001583	missense	143502	exon1			TGTACTATCTACC	BK004264	CCDS31355.1	11p15.4	2012-08-09			ENSG00000226288	ENSG00000226288		"""GPCR / Class A : Olfactory receptors"""	15221	protein-coding gene	gene with protein product							Standard	NM_001005170		Approved		uc010qyh.2	Q8NH67	OTTHUMG00000165721	ENST00000312614.4:c.845A>C	11.37:g.4608887A>C	ENSP00000308764:p.Tyr282Ser	Somatic	179	0		WXS	Illumina GAIIx	Phase_I	222	50	NM_001005170	0	0	0	0	0	B2RNJ5|B9EKV8|Q6IFJ8	Missense_Mutation	SNP	ENST00000312614.4	37	CCDS31355.1	.	.	.	.	.	.	.	.	.	.	A	14.99	2.700362	0.48307	.	.	ENSG00000226288	ENST00000312614	T	0.71817	-0.6	4.18	4.18	0.49190	GPCR, rhodopsin-like superfamily (1);	0.000000	0.40554	N	0.001062	D	0.84911	0.5577	M	0.89414	3.03	0.41401	D	0.987673	D	0.76494	0.999	D	0.74674	0.984	D	0.87946	0.2720	10	0.87932	D	0	-8.1829	12.307	0.54908	1.0:0.0:0.0:0.0	.	282	Q8NH67	O52I2_HUMAN	S	282	ENSP00000308764:Y282S	ENSP00000308764:Y282S	Y	+	2	0	OR52I2	4565463	0.077000	0.21312	0.927000	0.36925	0.925000	0.55904	1.083000	0.30815	1.773000	0.52216	0.524000	0.50904	TAT	.		0.502	OR52I2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385946.1	NM_001005170	
NLRP10	338322	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	7982583	7982583	+	Silent	SNP	G	G	A	rs138681119	byFrequency	TCGA-OR-A5LD-01A-11D-A29I-10	TCGA-OR-A5LD-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d84ce93-4c12-49da-87b3-c36d44672d59	afc22b50-442d-4fde-93ce-df0c281205c9	g.chr11:7982583G>A	ENST00000328600.2	-	2	737	c.576C>T	c.(574-576)acC>acT	p.T192T		NM_176821.3	NP_789791.1	Q86W26	NAL10_HUMAN	NLR family, pyrin domain containing 10	192	NACHT. {ECO:0000255|PROSITE- ProRule:PRU00136}.				defense response to fungus (GO:0050832)|defense response to Gram-negative bacterium (GO:0050829)|dendritic cell migration (GO:0036336)|helper T cell enhancement of adaptive immune response (GO:0035397)|innate immune response (GO:0045087)|positive regulation of interleukin-6 secretion (GO:2000778)|positive regulation of interleukin-8 secretion (GO:2000484)|positive regulation of T-helper 1 type immune response (GO:0002827)|positive regulation of T-helper 17 type immune response (GO:2000318)	cytoplasm (GO:0005737)|extrinsic component of plasma membrane (GO:0019897)	ATP binding (GO:0005524)			breast(1)|endometrium(2)|kidney(2)|large_intestine(8)|liver(1)|lung(28)|ovary(2)|pancreas(1)|prostate(2)|skin(8)|upper_aerodigestive_tract(1)|urinary_tract(2)	58				Epithelial(150;1.47e-07)|BRCA - Breast invasive adenocarcinoma(625;0.189)		ACAGAGTACCGGTGGCCCAGT	0.532																																					p.T192T		.											.	NLRP10-209	0			c.C576T						.	G		1,4401	2.1+/-5.4	0,1,2200	54.0	57.0	56.0		576	-10.5	0.0	11	dbSNP_134	56	1,8591	1.2+/-3.3	0,1,4295	no	coding-synonymous	NLRP10	NM_176821.3		0,2,6495	AA,AG,GG		0.0116,0.0227,0.0154		192/656	7982583	2,12992	2201	4296	6497	SO:0001819	synonymous_variant	338322	exon2			AGTACCGGTGGCC	AY154465	CCDS7784.1	11p15.4	2006-12-08	2006-12-08	2006-12-08		ENSG00000182261		"""Nucleotide-binding domain and leucine rich repeat containing"""	21464	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 10"""	609662	"""NACHT, leucine rich repeat and PYD containing 10"""	NALP10		12563287	Standard	NM_176821		Approved	NOD8, PAN5, Pynod, CLR11.1	uc001mfv.1	Q86W26		ENST00000328600.2:c.576C>T	11.37:g.7982583G>A		Somatic	75	0		WXS	Illumina GAIIx	Phase_I	140	25	NM_176821	0	0	0	0	0	Q2M3C4|Q6JGT0	Silent	SNP	ENST00000328600.2	37	CCDS7784.1																																																																																			G|1.000;A|0.000		0.532	NLRP10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385705.1	NM_176821	
CAPRIN1	4076	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	11	34097794	34097795	+	Frame_Shift_Del	DEL	AA	AA	-			TCGA-OR-A5LD-01A-11D-A29I-10	TCGA-OR-A5LD-10A-01D-A29L-10	AA	AA	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d84ce93-4c12-49da-87b3-c36d44672d59	afc22b50-442d-4fde-93ce-df0c281205c9	g.chr11:34097794_34097795delAA	ENST00000341394.4	+	5	567_568	c.378_379delAA	c.(376-381)acaatafs	p.I127fs	CAPRIN1_ENST00000532820.1_Frame_Shift_Del_p.I127fs|CAPRIN1_ENST00000529307.1_Frame_Shift_Del_p.I46fs|CAPRIN1_ENST00000389645.3_Frame_Shift_Del_p.I127fs|CAPRIN1_ENST00000530820.1_Frame_Shift_Del_p.I127fs	NM_005898.4	NP_005889.3	Q14444	CAPR1_HUMAN	cell cycle associated protein 1	127					negative regulation of translation (GO:0017148)|positive regulation of dendrite morphogenesis (GO:0050775)|positive regulation of dendritic spine morphogenesis (GO:0061003)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoplasmic mRNA processing body (GO:0000932)|cytoplasmic stress granule (GO:0010494)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			breast(2)|endometrium(2)|kidney(1)|large_intestine(6)|lung(5)|ovary(1)|prostate(1)	18		Acute lymphoblastic leukemia(5;0.00045)|all_hematologic(20;0.0016)				TTCAGAAAACAATAAAGAAGAC	0.332																																					p.126_127del		.											.	CAPRIN1-91	0			c.378_379del						.																																			SO:0001589	frameshift_variant	4076	exon5			GAAAACAATAAAG	BC001731	CCDS31453.1, CCDS31454.1	11p13	2010-08-03	2007-03-27	2007-03-27	ENSG00000135387	ENSG00000135387			6743	protein-coding gene	gene with protein product	"""cytoplasmic activation/proliferation-associated protein-1"""	601178	"""membrane component, chromosome 11, surface marker 1"", ""GPI-anchored membrane protein 1"""	M11S1, GPIAP1		7657653, 16177067, 17210633, 14764709, 15471883	Standard	NM_005898		Approved	caprin-1, RNG105	uc001mvh.1	Q14444	OTTHUMG00000166248	ENST00000341394.4:c.378_379delAA	11.37:g.34097794_34097795delAA	ENSP00000340329:p.Ile127fs	Somatic	70	0		WXS	Illumina GAIIx	Phase_I	50	13	NM_203364	0	0	0	0	0	A6NMY7|D3DR06|Q15074|Q6IMN4|Q6IMN7|Q9BV09	Frame_Shift_Del	DEL	ENST00000341394.4	37	CCDS31453.1																																																																																			.		0.332	CAPRIN1-001	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000388680.2	NM_005898	
DGKZ	8525	broad.mit.edu;bcgsc.ca	37	11	46389253	46389253	+	Missense_Mutation	SNP	G	G	C			TCGA-OR-A5LD-01A-11D-A29I-10	TCGA-OR-A5LD-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d84ce93-4c12-49da-87b3-c36d44672d59	afc22b50-442d-4fde-93ce-df0c281205c9	g.chr11:46389253G>C	ENST00000454345.1	+	4	1014	c.889G>C	c.(889-891)Gac>Cac	p.D297H	DGKZ_ENST00000421244.2_Missense_Mutation_p.D108H|DGKZ_ENST00000456247.2_Missense_Mutation_p.D108H|DGKZ_ENST00000527911.1_Missense_Mutation_p.D108H|DGKZ_ENST00000343674.6_Missense_Mutation_p.D125H|DGKZ_ENST00000532868.2_Missense_Mutation_p.D112H|DGKZ_ENST00000395574.3_Missense_Mutation_p.D74H|DGKZ_ENST00000528615.1_Intron|DGKZ_ENST00000318201.8_Missense_Mutation_p.D108H|DGKZ_ENST00000543978.1_Intron	NM_001105540.1	NP_001099010.1	Q13574	DGKZ_HUMAN	diacylglycerol kinase, zeta	297					blood coagulation (GO:0007596)|cell migration (GO:0016477)|intracellular signal transduction (GO:0035556)|lipid phosphorylation (GO:0046834)|mitotic G1 DNA damage checkpoint (GO:0031571)|negative regulation of mitotic cell cycle (GO:0045930)|negative regulation of Ras protein signal transduction (GO:0046580)|phosphorylation (GO:0016310)|platelet activation (GO:0030168)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)	cytoplasm (GO:0005737)|lamellipodium (GO:0030027)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|diacylglycerol kinase activity (GO:0004143)|enzyme inhibitor activity (GO:0004857)|lipid kinase activity (GO:0001727)|metal ion binding (GO:0046872)|NAD+ kinase activity (GO:0003951)|protein C-terminus binding (GO:0008022)			central_nervous_system(2)|endometrium(1)|kidney(2)|large_intestine(5)|lung(12)|pancreas(1)|prostate(1)|skin(1)	25				GBM - Glioblastoma multiforme(35;0.0259)|Lung(87;0.141)		CGTGTCCGGGGACTTCTGCTA	0.652											OREG0020942	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.D297H		.											.	DGKZ-676	0			c.G889C						.						126.0	102.0	110.0					11																	46389253		2202	4297	6499	SO:0001583	missense	8525	exon4			TCCGGGGACTTCT	U51477	CCDS7918.1, CCDS41640.1, CCDS44579.1, CCDS44580.1, CCDS55757.1, CCDS55758.1, CCDS55759.1, CCDS44579.2	11p11.2	2010-11-24	2010-11-24		ENSG00000149091	ENSG00000149091	2.7.1.107		2857	protein-coding gene	gene with protein product		601441	"""diacylglycerol kinase, zeta 104kDa"""			8626588	Standard	NM_003646		Approved	DAGK5, hDGKzeta, DGK-ZETA, DAGK6	uc001ncn.1	Q13574	OTTHUMG00000166437	ENST00000454345.1:c.889G>C	11.37:g.46389253G>C	ENSP00000412178:p.Asp297His	Somatic	118	2	938	WXS	Illumina GAIIx	Phase_I	143	8	NM_001105540	0	0	0	0	0	B7Z2M9|B7Z6M3|E9PPW4|F6UCU9|G3V0F6|J3KNJ6|O00542|Q6ZVG7|Q8IVW9	Missense_Mutation	SNP	ENST00000454345.1	37	CCDS41640.1	.	.	.	.	.	.	.	.	.	.	G	33	5.247900	0.95305	.	.	ENSG00000149091	ENST00000343674;ENST00000395574;ENST00000532868;ENST00000527911;ENST00000456247;ENST00000421244;ENST00000318201;ENST00000454345;ENST00000524448	D;T;T;T;D;T;T;T;T	0.83992	-1.79;2.47;2.51;3.47;-1.79;2.36;2.47;1.7;2.63	5.16	5.16	0.70880	Protein kinase C-like, phorbol ester/diacylglycerol binding (1);	0.101272	0.64402	D	0.000001	D	0.91168	0.7218	M	0.74467	2.265	0.80722	D	1	D;D;D;D;D;D;D;D;D;D	0.89917	0.996;1.0;1.0;0.99;1.0;0.994;0.994;1.0;1.0;0.996	P;D;D;D;D;D;D;D;D;D	0.97110	0.895;0.982;0.987;0.921;0.99;0.951;0.964;0.982;1.0;0.928	D	0.91954	0.5573	10	0.87932	D	0	.	19.0817	0.93185	0.0:0.0:1.0:0.0	.	108;73;74;108;297;108;108;74;74;125	B7Z2M9;B7Z6M3;B7Z8F6;E9PPW4;Q13574;Q13574-2;G3V0F6;A8MVN1;Q6ZWA5;Q6ZVG7	.;.;.;.;DGKZ_HUMAN;.;.;.;.;.	H	125;74;73;108;108;108;108;297;18	ENSP00000343065:D125H;ENSP00000378941:D74H;ENSP00000436273:D73H;ENSP00000436291:D108H;ENSP00000395684:D108H;ENSP00000391021:D108H;ENSP00000320340:D108H;ENSP00000412178:D297H;ENSP00000435763:D18H	ENSP00000320340:D108H	D	+	1	0	DGKZ	46345829	1.000000	0.71417	1.000000	0.80357	0.907000	0.53573	9.713000	0.98740	2.588000	0.87417	0.555000	0.69702	GAC	.		0.652	DGKZ-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000389772.1	NM_001105540	
CDC42BPG	55561	bcgsc.ca	37	11	64601933	64601933	+	Silent	SNP	T	T	C	rs7933683	byFrequency	TCGA-OR-A5LD-01A-11D-A29I-10	TCGA-OR-A5LD-10A-01D-A29L-10	T	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d84ce93-4c12-49da-87b3-c36d44672d59	afc22b50-442d-4fde-93ce-df0c281205c9	g.chr11:64601933T>C	ENST00000342711.5	-	19	2291	c.2292A>G	c.(2290-2292)acA>acG	p.T764T	CDC42BPG_ENST00000491280.1_5'Flank	NM_017525.2	NP_059995.2			CDC42 binding protein kinase gamma (DMPK-like)											central_nervous_system(1)|lung(3)	4						CCTGCACCTGTGTCAGCCGCT	0.706													C|||	1376	0.27476	0.0424	0.2147	5008	,	,		15170	0.4921		0.2575	False		,,,				2504	0.4254				p.T764T		.											.	CDC42BPG-528	0			c.A2292G						.	C		284,3850		12,260,1795	6.0	7.0	6.0		2292	-6.1	0.8	11	dbSNP_116	6	1681,6531		171,1339,2596	no	coding-synonymous	CDC42BPG	NM_017525.2		183,1599,4391	CC,CT,TT		20.47,6.8699,15.9161		764/1552	64601933	1965,10381	2067	4106	6173	SO:0001819	synonymous_variant	55561	exon19			CACCTGTGTCAGC	AY648038	CCDS31601.1	11q13	2013-01-10			ENSG00000171219	ENSG00000171219		"""Pleckstrin homology (PH) domain containing"""	29829	protein-coding gene	gene with protein product		613991				9341881, 15194684	Standard	NM_017525		Approved	HSMDPKIN, MRCKgamma, DMPK2, kappa-200	uc001obs.4	Q6DT37	OTTHUMG00000045365	ENST00000342711.5:c.2292A>G	11.37:g.64601933T>C		Somatic	42	0		WXS	Illumina GAIIx	Phase_I	67	4	NM_017525	0	0	0	0	0		Silent	SNP	ENST00000342711.5	37	CCDS31601.1																																																																																			T|0.722;C|0.278		0.706	CDC42BPG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000105352.4	XM_290516	
TM7SF2	7108	hgsc.bcm.edu	37	11	64880090	64880090	+	Silent	SNP	G	G	C	rs4930284	byFrequency	TCGA-OR-A5LD-01A-11D-A29I-10	TCGA-OR-A5LD-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d84ce93-4c12-49da-87b3-c36d44672d59	afc22b50-442d-4fde-93ce-df0c281205c9	g.chr11:64880090G>C	ENST00000279263.7	+	2	318	c.156G>C	c.(154-156)ccG>ccC	p.P52P	TM7SF2_ENST00000540748.1_5'UTR|TM7SF2_ENST00000345348.5_Silent_p.P52P|AP003068.9_ENST00000528887.1_RNA	NM_003273.2	NP_003264.2	O76062	ERG24_HUMAN	transmembrane 7 superfamily member 2	52					cholesterol biosynthetic process (GO:0006695)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of plasma membrane (GO:0005887)|receptor complex (GO:0043235)	delta14-sterol reductase activity (GO:0050613)			lung(14)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	18						CGTCCCTGCCGGGGCTGGAGG	0.756													C|||	4990	0.996406	0.9879	0.9986	5008	,	,		10438	1.0		0.999	False		,,,				2504	1.0				p.P52P		.											.	TM7SF2-91	0			c.G156C						.	C		2924,8		1458,8,0	2.0	2.0	2.0		156	-9.8	0.0	11	dbSNP_111	2	6426,0		3213,0,0	no	coding-synonymous	TM7SF2	NM_003273.2		4671,8,0	CC,CG,GG		0.0,0.2729,0.0855		52/419	64880090	9350,8	1466	3213	4679	SO:0001819	synonymous_variant	7108	exon2			CCTGCCGGGGCTG	BC012857	CCDS41669.1, CCDS60846.1	11q13.1	2013-05-23			ENSG00000149809	ENSG00000149809	1.3.1.70		11863	protein-coding gene	gene with protein product	"""delta(14)-sterol reductase"""	603414				9615229, 9286704	Standard	NM_003273		Approved	ANG1, DHCR14A, NET47	uc001oct.4	O76062	OTTHUMG00000165603	ENST00000279263.7:c.156G>C	11.37:g.64880090G>C		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	8	8	NM_003273	0	0	0	0	0	A8K4H0|O95982|Q8IY06|Q96E64|Q96GZ1	Silent	SNP	ENST00000279263.7	37	CCDS41669.1																																																																																			G|0.005;C|0.995		0.756	TM7SF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385234.1	NM_003273	
FRMD8	83786	broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	65167232	65167232	+	Missense_Mutation	SNP	G	G	A	rs139960411	byFrequency	TCGA-OR-A5LD-01A-11D-A29I-10	TCGA-OR-A5LD-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d84ce93-4c12-49da-87b3-c36d44672d59	afc22b50-442d-4fde-93ce-df0c281205c9	g.chr11:65167232G>A	ENST00000317568.5	+	8	992	c.829G>A	c.(829-831)Gac>Aac	p.D277N	FRMD8_ENST00000416776.2_Missense_Mutation_p.D243N|FRMD8_ENST00000355991.5_Missense_Mutation_p.D221N	NM_031904.3	NP_114110.1	Q9BZ67	FRMD8_HUMAN	FERM domain containing 8	277	FERM. {ECO:0000255|PROSITE- ProRule:PRU00084}.					cytoskeleton (GO:0005856)				NS(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(1)|lung(9)|pancreas(1)|urinary_tract(1)	17						CGGTGAGGTTGACAAGCCGGC	0.627																																					p.D277N		.											.	FRMD8-227	0			c.G829A						.						62.0	62.0	62.0					11																	65167232		2201	4297	6498	SO:0001583	missense	83786	exon8			GAGGTTGACAAGC	AK074850	CCDS8102.1, CCDS73320.1	11q13.1	2007-08-14			ENSG00000126391	ENSG00000126391			25462	protein-coding gene	gene with protein product						12477932	Standard	NM_031904		Approved	FLJ90369, FKSG44	uc001odu.4	Q9BZ67	OTTHUMG00000166275	ENST00000317568.5:c.829G>A	11.37:g.65167232G>A	ENSP00000319726:p.Asp277Asn	Somatic	87	3		WXS	Illumina GAIIx	Phase_I	323	42	NM_031904	0	0	3	3	0	B4E2P1|Q86V56|Q8NCB5	Missense_Mutation	SNP	ENST00000317568.5	37	CCDS8102.1	.	.	.	.	.	.	.	.	.	.	G	34	5.324367	0.95708	.	.	ENSG00000126391	ENST00000317568;ENST00000355991;ENST00000416776	D;T;D	0.83250	-1.69;-1.11;-1.7	4.57	4.57	0.56435	FERM domain (1);	0.000000	0.85682	D	0.000000	D	0.89928	0.6857	M	0.72479	2.2	0.58432	D	0.999999	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.991;0.994	D	0.90533	0.4497	10	0.54805	T	0.06	-6.255	15.1924	0.73057	0.0:0.0:1.0:0.0	.	243;221;277	B4E2P1;Q9BZ67-2;Q9BZ67	.;.;FRMD8_HUMAN	N	277;221;243	ENSP00000319726:D277N;ENSP00000348270:D221N;ENSP00000392111:D243N	ENSP00000319726:D277N	D	+	1	0	FRMD8	64923808	1.000000	0.71417	0.976000	0.42696	0.972000	0.66771	8.572000	0.90756	2.262000	0.75019	0.561000	0.74099	GAC	G|0.999;C|0.001		0.627	FRMD8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000388833.1	NM_031904	
FRMD8	83786	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	65167323	65167323	+	Missense_Mutation	SNP	G	G	C			TCGA-OR-A5LD-01A-11D-A29I-10	TCGA-OR-A5LD-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d84ce93-4c12-49da-87b3-c36d44672d59	afc22b50-442d-4fde-93ce-df0c281205c9	g.chr11:65167323G>C	ENST00000317568.5	+	8	1083	c.920G>C	c.(919-921)aGa>aCa	p.R307T	FRMD8_ENST00000416776.2_Missense_Mutation_p.R273T|FRMD8_ENST00000355991.5_Missense_Mutation_p.R251T	NM_031904.3	NP_114110.1	Q9BZ67	FRMD8_HUMAN	FERM domain containing 8	307	FERM. {ECO:0000255|PROSITE- ProRule:PRU00084}.					cytoskeleton (GO:0005856)				NS(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(1)|lung(9)|pancreas(1)|urinary_tract(1)	17						ATCGATAGCAGAGAGAAGGTA	0.637																																					p.R307T		.											.	FRMD8-227	0			c.G920C						.						88.0	90.0	89.0					11																	65167323		2201	4297	6498	SO:0001583	missense	83786	exon8			ATAGCAGAGAGAA	AK074850	CCDS8102.1, CCDS73320.1	11q13.1	2007-08-14			ENSG00000126391	ENSG00000126391			25462	protein-coding gene	gene with protein product						12477932	Standard	NM_031904		Approved	FLJ90369, FKSG44	uc001odu.4	Q9BZ67	OTTHUMG00000166275	ENST00000317568.5:c.920G>C	11.37:g.65167323G>C	ENSP00000319726:p.Arg307Thr	Somatic	54	0		WXS	Illumina GAIIx	Phase_I	247	40	NM_031904	0	0	0	0	0	B4E2P1|Q86V56|Q8NCB5	Missense_Mutation	SNP	ENST00000317568.5	37	CCDS8102.1	.	.	.	.	.	.	.	.	.	.	G	13.72	2.322302	0.41096	.	.	ENSG00000126391	ENST00000317568;ENST00000355991;ENST00000416776	D;T;D	0.82526	-1.61;-1.03;-1.62	4.57	3.38	0.38709	FERM domain (1);	0.170421	0.49305	D	0.000158	T	0.63710	0.2534	N	0.24115	0.695	0.37506	D	0.916955	P;B;B	0.38922	0.651;0.43;0.421	B;B;B	0.35114	0.15;0.196;0.107	T	0.61973	-0.6952	10	0.12103	T	0.63	-23.6714	4.6596	0.12636	0.2818:0.0:0.7182:0.0	.	273;251;307	B4E2P1;Q9BZ67-2;Q9BZ67	.;.;FRMD8_HUMAN	T	307;251;273	ENSP00000319726:R307T;ENSP00000348270:R251T;ENSP00000392111:R273T	ENSP00000319726:R307T	R	+	2	0	FRMD8	64923899	1.000000	0.71417	0.998000	0.56505	0.914000	0.54420	5.283000	0.65621	2.262000	0.75019	0.561000	0.74099	AGA	.		0.637	FRMD8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000388833.1	NM_031904	
TRPC6	7225	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	101375498	101375498	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5LD-01A-11D-A29I-10	TCGA-OR-A5LD-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d84ce93-4c12-49da-87b3-c36d44672d59	afc22b50-442d-4fde-93ce-df0c281205c9	g.chr11:101375498G>A	ENST00000344327.3	-	2	626	c.202C>T	c.(202-204)Cgg>Tgg	p.R68W	TRPC6_ENST00000348423.4_Missense_Mutation_p.R68W|TRPC6_ENST00000526713.1_5'UTR|TRPC6_ENST00000532133.1_Missense_Mutation_p.R68W|TRPC6_ENST00000360497.4_Missense_Mutation_p.R68W	NM_004621.5	NP_004612.2	Q9Y210	TRPC6_HUMAN	transient receptor potential cation channel, subfamily C, member 6	68					aging (GO:0007568)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|calcium ion transmembrane transport (GO:0070588)|cation transport (GO:0006812)|cellular response to hydrogen peroxide (GO:0070301)|cellular response to hypoxia (GO:0071456)|ion transmembrane transport (GO:0034220)|platelet activation (GO:0030168)|positive regulation of calcium ion transport (GO:0051928)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of ion transmembrane transporter activity (GO:0032414)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|slit diaphragm (GO:0036057)	inositol 1,4,5 trisphosphate binding (GO:0070679)|store-operated calcium channel activity (GO:0015279)			autonomic_ganglia(1)|breast(3)|central_nervous_system(2)|endometrium(3)|kidney(3)|large_intestine(14)|lung(17)|ovary(2)|pancreas(1)|prostate(1)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	55		Acute lymphoblastic leukemia(157;0.000918)|all_hematologic(158;0.0162)		BRCA - Breast invasive adenocarcinoma(274;0.0442)		ACTGTCTGCCGCCGGTGAGCC	0.468																																					p.R68W	Colon(166;1315 1927 11094 12848 34731)	.											.	TRPC6-93	0			c.C202T						.						68.0	75.0	72.0					11																	101375498		2203	4299	6502	SO:0001583	missense	7225	exon2			TCTGCCGCCGGTG	AJ006276	CCDS8311.1	11q22.1	2014-02-04				ENSG00000137672		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	12338	protein-coding gene	gene with protein product		603652	"""focal segmental glomerulosclerosis 2"""	FSGS2		9925922, 16382100, 15879175	Standard	NM_004621		Approved	TRP6	uc001pgk.4	Q9Y210		ENST00000344327.3:c.202C>T	11.37:g.101375498G>A	ENSP00000340913:p.Arg68Trp	Somatic	151	1		WXS	Illumina GAIIx	Phase_I	150	25	NM_004621	0	0	0	0	0	Q52M59|Q9HCW3|Q9NQA8|Q9NQA9	Missense_Mutation	SNP	ENST00000344327.3	37	CCDS8311.1	.	.	.	.	.	.	.	.	.	.	G	21.7	4.182572	0.78677	.	.	ENSG00000137672	ENST00000344327;ENST00000532133;ENST00000348423;ENST00000360497	T;T;T;T	0.80653	-1.22;-1.28;-1.14;-1.4	5.6	5.6	0.85130	.	0.328713	0.32901	N	0.005513	D	0.87489	0.6190	L	0.47190	1.495	0.58432	D	0.999991	D;D;D	0.89917	1.0;1.0;0.999	D;D;P	0.79784	0.96;0.993;0.87	D	0.88101	0.2819	10	0.87932	D	0	-12.0751	19.6251	0.95674	0.0:0.0:1.0:0.0	.	68;68;68	Q9Y210-3;Q9Y210-2;Q9Y210	.;.;TRPC6_HUMAN	W	68	ENSP00000340913:R68W;ENSP00000435574:R68W;ENSP00000343672:R68W;ENSP00000353687:R68W	ENSP00000340913:R68W	R	-	1	2	TRPC6	100880708	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.437000	0.52863	2.636000	0.89361	0.655000	0.94253	CGG	.		0.468	TRPC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394770.1	NM_004621	
ESAM	90952	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	124631990	124631990	+	Missense_Mutation	SNP	T	T	C			TCGA-OR-A5LD-01A-11D-A29I-10	TCGA-OR-A5LD-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d84ce93-4c12-49da-87b3-c36d44672d59	afc22b50-442d-4fde-93ce-df0c281205c9	g.chr11:124631990T>C	ENST00000278927.5	-	1	190	c.61A>G	c.(61-63)Agt>Ggt	p.S21G	ESAM_ENST00000442070.2_Missense_Mutation_p.S21G|RP11-677M14.3_ENST00000532579.1_RNA|RP11-677M14.3_ENST00000504932.2_RNA	NM_138961.2	NP_620411.2	Q96AP7	ESAM_HUMAN	endothelial cell adhesion molecule	21					blood coagulation (GO:0007596)|homophilic cell adhesion (GO:0007156)|leukocyte migration (GO:0050900)|single organismal cell-cell adhesion (GO:0016337)	adherens junction (GO:0005912)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|tight junction (GO:0005923)				endometrium(2)|kidney(1)|large_intestine(6)|lung(4)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)	16	all_hematologic(175;0.215)	Breast(109;0.00109)|Lung NSC(97;0.0177)|all_lung(97;0.0179)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;1.49e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.022)		CCGAGGGCACTCAGCCCCAGG	0.657																																					p.S21G		.											.	ESAM-90	0			c.A61G						.						38.0	40.0	40.0					11																	124631990		2201	4299	6500	SO:0001583	missense	90952	exon1			GGGCACTCAGCCC	AK075396	CCDS8453.1	11q24.2	2013-01-29			ENSG00000149564	ENSG00000149564		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	17474	protein-coding gene	gene with protein product		614281				11279107, 11906820	Standard	NM_138961		Approved	W117m	uc001qav.4	Q96AP7	OTTHUMG00000151986	ENST00000278927.5:c.61A>G	11.37:g.124631990T>C	ENSP00000278927:p.Ser21Gly	Somatic	155	1		WXS	Illumina GAIIx	Phase_I	166	49	NM_138961	0	0	0	0	0	B4DVN8|Q96T50	Missense_Mutation	SNP	ENST00000278927.5	37	CCDS8453.1	.	.	.	.	.	.	.	.	.	.	T	14.17	2.454463	0.43634	.	.	ENSG00000149564	ENST00000442070;ENST00000444566;ENST00000278927;ENST00000435477	T;T;T;T	0.72282	1.12;1.12;1.47;-0.64	4.41	3.27	0.37495	.	0.920038	0.09495	N	0.794455	T	0.59142	0.2172	L	0.39898	1.24	0.19300	N	0.999971	B;B;B	0.15930	0.015;0.015;0.005	B;B;B	0.14578	0.011;0.011;0.003	T	0.45338	-0.9268	10	0.25751	T	0.34	.	6.6513	0.22963	0.0:0.1089:0.0:0.8911	.	21;21;21	B4DVN8;F8WDW9;Q96AP7	.;.;ESAM_HUMAN	G	21	ENSP00000410351:S21G;ENSP00000406689:S21G;ENSP00000278927:S21G;ENSP00000415893:S21G	ENSP00000278927:S21G	S	-	1	0	ESAM	124137200	0.990000	0.36364	0.948000	0.38648	0.679000	0.39708	2.048000	0.41278	0.833000	0.34828	0.459000	0.35465	AGT	.		0.657	ESAM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000324686.1	NM_138961	
GLB1L2	89944	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	134240910	134240910	+	Missense_Mutation	SNP	G	G	C			TCGA-OR-A5LD-01A-11D-A29I-10	TCGA-OR-A5LD-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d84ce93-4c12-49da-87b3-c36d44672d59	afc22b50-442d-4fde-93ce-df0c281205c9	g.chr11:134240910G>C	ENST00000535456.2	+	13	1412	c.1224G>C	c.(1222-1224)aaG>aaC	p.K408N	GLB1L2_ENST00000389881.3_Missense_Mutation_p.K408N|GLB1L2_ENST00000529077.1_3'UTR|GLB1L2_ENST00000339772.7_Missense_Mutation_p.K408N	NM_138342.3	NP_612351.2	Q8IW92	GLBL2_HUMAN	galactosidase, beta 1-like 2	408					carbohydrate metabolic process (GO:0005975)	extracellular region (GO:0005576)	beta-galactosidase activity (GO:0004565)			central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(6)|liver(1)|lung(20)|ovary(1)|pancreas(1)|prostate(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	41	all_hematologic(175;0.127)	all_cancers(12;2.85e-18)|all_epithelial(12;1.21e-12)|all_lung(97;0.000276)|Lung NSC(97;0.000518)|Breast(109;0.00122)|Medulloblastoma(222;0.0399)|all_neural(223;0.0412)|Esophageal squamous(93;0.0844)		Epithelial(10;1.37e-11)|all cancers(11;2.2e-10)|BRCA - Breast invasive adenocarcinoma(10;3.09e-10)|OV - Ovarian serous cystadenocarcinoma(99;0.000885)|Lung(977;0.223)		AGCCAATCAAGTCTGAAAAGC	0.567																																					p.K408N		.											.	GLB1L2-25	0			c.G1224C						.						127.0	129.0	128.0					11																	134240910		2201	4297	6498	SO:0001583	missense	89944	exon13			AATCAAGTCTGAA		CCDS31724.1	11q25	2008-01-29			ENSG00000149328	ENSG00000149328			25129	protein-coding gene	gene with protein product						12975309	Standard	NM_138342		Approved		uc001qhp.3	Q8IW92	OTTHUMG00000167179	ENST00000535456.2:c.1224G>C	11.37:g.134240910G>C	ENSP00000444628:p.Lys408Asn	Somatic	91	0		WXS	Illumina GAIIx	Phase_I	97	18	NM_138342	0	0	0	0	0	A6NCE6|Q6UX60|Q8NC62|Q8NCB3|Q8NCJ1|Q96HP3	Missense_Mutation	SNP	ENST00000535456.2	37	CCDS31724.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	10.41|10.41	1.343297|1.343297	0.24339|0.24339	.|.	.|.	ENSG00000149328|ENSG00000149328	ENST00000339772;ENST00000535456;ENST00000389881|ENST00000525089	D;D;D|.	0.93811|.	-3.29;-3.29;-3.29|.	5.77|5.77	-3.62|-3.62	0.04543|0.04543	.|.	0.765819|.	0.12913|.	N|.	0.428836|.	T|T	0.36054|0.36054	0.0953|0.0953	L|L	0.61036|0.61036	1.89|1.89	0.21105|0.21105	N|N	0.999782|0.999782	B|.	0.09022|.	0.002|.	B|.	0.08055|.	0.003|.	T|T	0.40308|0.40308	-0.9570|-0.9570	10|5	0.25106|.	T|.	0.35|.	-2.112|-2.112	1.2858|1.2858	0.02050|0.02050	0.3504:0.2927:0.2302:0.1268|0.3504:0.2927:0.2302:0.1268	.|.	408|.	Q8IW92|.	GLBL2_HUMAN|.	N|L	408|347	ENSP00000344659:K408N;ENSP00000444628:K408N;ENSP00000374531:K408N|.	ENSP00000344659:K408N|.	K|V	+|+	3|1	2|0	GLB1L2|GLB1L2	133746120|133746120	0.007000|0.007000	0.16637|0.16637	0.000000|0.000000	0.03702|0.03702	0.046000|0.046000	0.14306|0.14306	0.019000|0.019000	0.13444|0.13444	-0.661000|-0.661000	0.05345|0.05345	-0.137000|-0.137000	0.14449|0.14449	AAG|GTC	.		0.567	GLB1L2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393629.2	NM_138342	
SLC2A13	114134	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	40441854	40441854	+	Splice_Site	SNP	T	T	A			TCGA-OR-A5LD-01A-11D-A29I-10	TCGA-OR-A5LD-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d84ce93-4c12-49da-87b3-c36d44672d59	afc22b50-442d-4fde-93ce-df0c281205c9	g.chr12:40441854T>A	ENST00000280871.4	-	2	765	c.715A>T	c.(715-717)Agg>Tgg	p.R239W	SLC2A13_ENST00000380858.1_Splice_Site_p.R239W	NM_052885.3	NP_443117.3	Q96QE2	MYCT_HUMAN	solute carrier family 2 (facilitated glucose transporter), member 13	239					transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	substrate-specific transmembrane transporter activity (GO:0022891)			central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(12)|ovary(1)|prostate(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	29		Lung NSC(34;0.105)|all_lung(34;0.123)				TTTACAAACCTCCATCCATCC	0.373										HNSCC(50;0.14)																											p.R239W		.											.	SLC2A13-515	0			c.A715T						.						108.0	107.0	108.0					12																	40441854		2203	4300	6503	SO:0001630	splice_region_variant	114134	exon2			CAAACCTCCATCC	AJ315644	CCDS8736.2	12q12	2013-05-22			ENSG00000151229	ENSG00000151229		"""Solute carriers"""	15956	protein-coding gene	gene with protein product	"""H(+)-myo-inositol symporter"""	611036				11500374	Standard	NM_052885		Approved	HMIT	uc010skm.2	Q96QE2	OTTHUMG00000059743	ENST00000280871.4:c.716+1A>T	12.37:g.40441854T>A		Somatic	47	0		WXS	Illumina GAIIx	Phase_I	62	9	NM_052885	0	0	0	0	0	Q17S07	Missense_Mutation	SNP	ENST00000280871.4	37	CCDS8736.2	.	.	.	.	.	.	.	.	.	.	T	27.9	4.874687	0.91664	.	.	ENSG00000151229	ENST00000280871;ENST00000380858	T;T	0.67698	-0.28;-0.28	5.65	5.65	0.86999	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.093926	0.85682	D	0.000000	D	0.89403	0.6705	H	0.98818	4.34	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.93655	0.6976	10	0.87932	D	0	-24.6783	15.8848	0.79238	0.0:0.0:0.0:1.0	.	239;239	Q96QE2;E9PE47	MYCT_HUMAN;.	W	239	ENSP00000280871:R239W;ENSP00000370239:R239W	ENSP00000280871:R239W	R	-	1	2	SLC2A13	38728121	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	7.538000	0.82048	2.156000	0.67533	0.533000	0.62120	AGG	.		0.373	SLC2A13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000132849.2		Missense_Mutation
MCRS1	10445	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	49957272	49957272	+	Silent	SNP	G	G	A			TCGA-OR-A5LD-01A-11D-A29I-10	TCGA-OR-A5LD-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d84ce93-4c12-49da-87b3-c36d44672d59	afc22b50-442d-4fde-93ce-df0c281205c9	g.chr12:49957272G>A	ENST00000550165.1	-	8	881	c.615C>T	c.(613-615)agC>agT	p.S205S	MCRS1_ENST00000357123.4_Silent_p.S218S|MCRS1_ENST00000343810.4_Silent_p.S205S|MCRS1_ENST00000546244.1_Silent_p.S14S|MCRS1_ENST00000547182.1_5'Flank			Q96EZ8	MCRS1_HUMAN	microspherule protein 1	205					cellular protein modification process (GO:0006464)|chromatin organization (GO:0006325)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|histone H4-K16 acetylation (GO:0043984)|histone H4-K5 acetylation (GO:0043981)|histone H4-K8 acetylation (GO:0043982)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|histone acetyltransferase complex (GO:0000123)|Ino80 complex (GO:0031011)|MLL1 complex (GO:0071339)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)				breast(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(4)|lung(11)	23						ACAGGGCCTTGCTCTGGATGG	0.602																																					p.S218S		.											.	MCRS1-289	0			c.C654T						.						81.0	65.0	70.0					12																	49957272		2203	4300	6503	SO:0001819	synonymous_variant	10445	exon6			GGCCTTGCTCTGG	BC011794	CCDS8787.1, CCDS31795.1, CCDS61118.1	12q13.12	2011-07-06				ENSG00000187778		"""INO80 complex subunits"""	6960	protein-coding gene	gene with protein product	"""INO80 complex subunit Q"""	609504				9765390, 9654073	Standard	NM_006337		Approved	ICP22BP, MSP58, P78, MCRS2, INO80Q	uc001rui.1	Q96EZ8		ENST00000550165.1:c.615C>T	12.37:g.49957272G>A		Somatic	56	0		WXS	Illumina GAIIx	Phase_I	46	14	NM_001012300	0	0	2	3	1	O14742|O75497|Q6VN53|Q7Z372	Silent	SNP	ENST00000550165.1	37	CCDS8787.1																																																																																			.		0.602	MCRS1-006	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405102.1	NM_006337	
ALX1	8092	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	85677521	85677521	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5LD-01A-11D-A29I-10	TCGA-OR-A5LD-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d84ce93-4c12-49da-87b3-c36d44672d59	afc22b50-442d-4fde-93ce-df0c281205c9	g.chr12:85677521G>A	ENST00000316824.3	+	2	553	c.398G>A	c.(397-399)cGg>cAg	p.R133Q		NM_006982.2	NP_008913.2	Q15699	ALX1_HUMAN	ALX homeobox 1	133					anterior/posterior pattern specification (GO:0009952)|brain development (GO:0007420)|cartilage condensation (GO:0001502)|embryonic limb morphogenesis (GO:0030326)|embryonic skeletal system morphogenesis (GO:0048704)|mesenchymal cell development (GO:0014031)|multicellular organismal development (GO:0007275)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neural tube closure (GO:0001843)|palate development (GO:0060021)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)			breast(1)|central_nervous_system(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|liver(1)|lung(16)|ovary(1)	26				GBM - Glioblastoma multiforme(134;0.134)		AGTAAGAAACGGAGGCACCGA	0.478																																					p.R133Q		.											.	ALX1-24	0			c.G398A						.						134.0	128.0	130.0					12																	85677521		2203	4300	6503	SO:0001583	missense	8092	exon2			AGAAACGGAGGCA	U31986	CCDS9028.1	12q21.31	2011-06-20	2007-07-26	2007-07-26		ENSG00000180318		"""Homeoboxes / PRD class"""	1494	protein-coding gene	gene with protein product		601527	"""cartilage paired-class homeoprotein 1"""	CART1		8756334, 7592751	Standard	NM_006982		Approved		uc001tae.4	Q15699	OTTHUMG00000169820	ENST00000316824.3:c.398G>A	12.37:g.85677521G>A	ENSP00000315417:p.Arg133Gln	Somatic	176	0		WXS	Illumina GAIIx	Phase_I	210	41	NM_006982	0	0	0	0	0	Q546C8|Q96FH4	Missense_Mutation	SNP	ENST00000316824.3	37	CCDS9028.1	.	.	.	.	.	.	.	.	.	.	G	33	5.262640	0.95399	.	.	ENSG00000180318	ENST00000316824	D	0.97209	-4.29	5.59	5.59	0.84812	Homeodomain-related (1);Homeobox (3);Homeodomain-like (1);	0.000000	0.85682	D	0.000000	D	0.98991	0.9656	H	0.94462	3.54	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	D	0.99282	1.0896	10	0.87932	D	0	.	20.0204	0.97499	0.0:0.0:1.0:0.0	.	133	Q15699	ALX1_HUMAN	Q	133	ENSP00000315417:R133Q	ENSP00000315417:R133Q	R	+	2	0	ALX1	84201652	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	9.813000	0.99286	2.801000	0.96364	0.650000	0.86243	CGG	.		0.478	ALX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406072.1	NM_006982	
AACS	65985	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	125561105	125561105	+	Silent	SNP	A	A	C			TCGA-OR-A5LD-01A-11D-A29I-10	TCGA-OR-A5LD-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d84ce93-4c12-49da-87b3-c36d44672d59	afc22b50-442d-4fde-93ce-df0c281205c9	g.chr12:125561105A>C	ENST00000316519.6	+	3	512	c.306A>C	c.(304-306)gcA>gcC	p.A102A	AACS_ENST00000261686.6_Silent_p.A102A	NM_023928.3	NP_076417.2	Q86V21	AACS_HUMAN	acetoacetyl-CoA synthetase	102					adipose tissue development (GO:0060612)|cellular response to cholesterol (GO:0071397)|cellular response to glucose stimulus (GO:0071333)|cellular response to testosterone stimulus (GO:0071394)|fatty acid metabolic process (GO:0006631)|liver development (GO:0001889)|positive regulation of insulin secretion (GO:0032024)|response to drug (GO:0042493)|response to ethanol (GO:0045471)|response to nutrient (GO:0007584)|response to oleic acid (GO:0034201)|response to purine-containing compound (GO:0014074)|response to starvation (GO:0042594)|white fat cell differentiation (GO:0050872)	cytoplasm (GO:0005737)	acetoacetate-CoA ligase activity (GO:0030729)|ATP binding (GO:0005524)|butyrate-CoA ligase activity (GO:0047760)			breast(1)|central_nervous_system(1)|cervix(1)|large_intestine(4)|liver(1)|lung(16)|ovary(1)|stomach(1)	26	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;9.82e-05)|Epithelial(86;0.000642)|all cancers(50;0.00843)		TCAACTATGCAGAAAACCTCC	0.488																																					p.A102A		.											.	AACS-92	0			c.A306C						.						157.0	145.0	149.0					12																	125561105		2203	4300	6503	SO:0001819	synonymous_variant	65985	exon3			CTATGCAGAAAAC	AK022451	CCDS9263.1	12q24.31	2010-09-29			ENSG00000081760	ENSG00000081760	6.2.1.16	"""Acyl-CoA synthetase family"""	21298	protein-coding gene	gene with protein product	"""acyl-CoA synthetase family member 1"""	614364				12623130, 17762044	Standard	NM_023928		Approved	FLJ12389, SUR-5, ACSF1	uc001uhc.3	Q86V21	OTTHUMG00000168550	ENST00000316519.6:c.306A>C	12.37:g.125561105A>C		Somatic	135	0		WXS	Illumina GAIIx	Phase_I	158	36	NM_023928	0	0	0	0	0	Q49AB9|Q49AC3|Q658Q8|Q8IWD2|Q8NEW5|Q9BSJ9|Q9H829|Q9HA19	Silent	SNP	ENST00000316519.6	37	CCDS9263.1																																																																																			.		0.488	AACS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400202.1	NM_023928	
NOC4L	79050	broad.mit.edu;bcgsc.ca;mdanderson.org	37	12	132633391	132633391	+	Silent	SNP	G	G	C			TCGA-OR-A5LD-01A-11D-A29I-10	TCGA-OR-A5LD-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d84ce93-4c12-49da-87b3-c36d44672d59	afc22b50-442d-4fde-93ce-df0c281205c9	g.chr12:132633391G>C	ENST00000330579.1	+	9	893	c.852G>C	c.(850-852)ctG>ctC	p.L284L	NOC4L_ENST00000538784.1_5'Flank|NOC4L_ENST00000535343.1_3'UTR	NM_024078.1	NP_076983.1	Q9BVI4	NOC4L_HUMAN	nucleolar complex associated 4 homolog (S. cerevisiae)	284					rRNA processing (GO:0006364)	integral component of membrane (GO:0016021)|nucleolus (GO:0005730)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			endometrium(2)|kidney(2)|large_intestine(1)|lung(7)|skin(2)	14	all_neural(191;0.0982)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;7.2e-08)|Epithelial(86;3.34e-07)|all cancers(50;1.97e-05)		TGCCGCAGCTGGCGCAGCCCA	0.687																																					p.L284L		.											.	NOC4L-90	0			c.G852C						.						29.0	25.0	26.0					12																	132633391		2190	4291	6481	SO:0001819	synonymous_variant	79050	exon9			GCAGCTGGCGCAG		CCDS9277.1	12q24.33	2011-08-12			ENSG00000184967	ENSG00000184967			28461	protein-coding gene	gene with protein product		612819				12446671	Standard	NM_024078		Approved	MGC3162, NET49, UTP19	uc001ujz.1	Q9BVI4	OTTHUMG00000168260	ENST00000330579.1:c.852G>C	12.37:g.132633391G>C		Somatic	101	1		WXS	Illumina GAIIx	Phase_I	87	19	NM_024078	0	0	4	4	0	Q8N2S5|Q96I14	Silent	SNP	ENST00000330579.1	37	CCDS9277.1																																																																																			.		0.687	NOC4L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398999.1	NM_024078	
TPTE2	93492	bcgsc.ca	37	13	20006685	20006685	+	Missense_Mutation	SNP	G	G	T	rs192298083	byFrequency	TCGA-OR-A5LD-01A-11D-A29I-10	TCGA-OR-A5LD-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d84ce93-4c12-49da-87b3-c36d44672d59	afc22b50-442d-4fde-93ce-df0c281205c9	g.chr13:20006685G>T	ENST00000400230.2	-	16	1194	c.1150C>A	c.(1150-1152)Cat>Aat	p.H384N	TPTE2_ENST00000382977.4_Missense_Mutation_p.H384N|TPTE2_ENST00000382978.1_Missense_Mutation_p.H344N|TPTE2_ENST00000382975.4_Missense_Mutation_p.H344N|TPTE2_ENST00000457266.2_Missense_Mutation_p.H273N|TPTE2_ENST00000390680.2_Missense_Mutation_p.H307N|TPTE2_ENST00000400103.2_Missense_Mutation_p.H273N|TPTE2_ENST00000255310.6_Missense_Mutation_p.H307N			Q6XPS3	TPTE2_HUMAN	transmembrane phosphoinositide 3-phosphatase and tensin homolog 2	384	Phosphatase tensin-type. {ECO:0000255|PROSITE-ProRule:PRU00590}.				phosphatidylinositol biosynthetic process (GO:0006661)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum (GO:0005783)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	ion channel activity (GO:0005216)|phosphatidylinositol-3,4,5-trisphosphate 3-phosphatase activity (GO:0016314)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)			NS(2)|breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(7)|large_intestine(8)|lung(21)|pancreas(1)|prostate(8)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	65		all_cancers(29;1.23e-20)|all_lung(29;1.97e-20)|all_epithelial(30;5.86e-20)|Lung NSC(5;3.36e-17)|Lung SC(185;0.0262)|Ovarian(182;0.162)		all cancers(112;1.73e-05)|Epithelial(112;7.42e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.000785)|Lung(94;0.0176)|LUSC - Lung squamous cell carcinoma(192;0.089)		TTGTAGAGATGTTTCACTTGT	0.323																																					p.H384N		.											.	TPTE2-92	0			c.C1150A						.						33.0	32.0	33.0					13																	20006685		2201	4291	6492	SO:0001583	missense	93492	exon17			AGAGATGTTTCAC	AJ421032	CCDS9285.1, CCDS45013.1, CCDS45014.1	13q12.11	2012-12-10			ENSG00000132958	ENSG00000132958		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : PTENs"""	17299	protein-coding gene	gene with protein product		606791				11716755, 12717346, 15057823	Standard	NM_130785		Approved	TPIP	uc001umd.3	Q6XPS3	OTTHUMG00000016493	ENST00000400230.2:c.1150C>A	13.37:g.20006685G>T	ENSP00000383089:p.His384Asn	Somatic	228	0		WXS	Illumina GAIIx	Phase_I	153	7	NM_199254	0	0	0	0	0	A1A4X0|A1A4X1|A8MX64|B1AQ16|B4DWZ2|Q5VUH2|Q8WWL4|Q8WWL5	Missense_Mutation	SNP	ENST00000400230.2	37	CCDS45014.1	.	.	.	.	.	.	.	.	.	.	g	0.008	-1.878406	0.00537	.	.	ENSG00000132958	ENST00000382978;ENST00000400103;ENST00000400230;ENST00000255310;ENST00000390680;ENST00000382977;ENST00000382975;ENST00000457266;ENST00000343548;ENST00000419256	D;D;D;D;D;D;D;D	0.94537	-3.45;-3.45;-3.32;-3.44;-3.44;-3.32;-3.45;-3.45	2.61	-1.48	0.08745	Phosphatase tensin type (1);	0.319355	0.35838	N	0.002942	T	0.63117	0.2484	N	0.00020	-2.77	0.09310	N	1	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.04013	0.001;0.001;0.001	T	0.74343	-0.3696	9	.	.	.	-3.8914	4.9076	0.13806	0.1623:0.0:0.3944:0.4433	.	273;307;384	A8MX64;Q6XPS3-3;Q6XPS3	.;.;TPTE2_HUMAN	N	344;273;384;307;307;384;344;273;384;253	ENSP00000372438:H344N;ENSP00000382974:H273N;ENSP00000383089:H384N;ENSP00000255310:H307N;ENSP00000375098:H307N;ENSP00000372437:H384N;ENSP00000372435:H344N;ENSP00000442218:H273N	.	H	-	1	0	TPTE2	18904685	0.015000	0.18098	0.000000	0.03702	0.065000	0.16274	0.109000	0.15417	-0.280000	0.09154	-0.683000	0.03753	CAT	G|0.999;A|0.001		0.323	TPTE2-205	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_199254	
ARL11	115761	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	13	50204849	50204849	+	Missense_Mutation	SNP	A	A	G			TCGA-OR-A5LD-01A-11D-A29I-10	TCGA-OR-A5LD-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d84ce93-4c12-49da-87b3-c36d44672d59	afc22b50-442d-4fde-93ce-df0c281205c9	g.chr13:50204849A>G	ENST00000282026.1	+	2	601	c.266A>G	c.(265-267)gAc>gGc	p.D89G	ARL11_ENST00000490932.1_Intron	NM_138450.5	NP_612459.1	Q969Q4	ARL11_HUMAN	ADP-ribosylation factor-like 11	89					hematopoietic progenitor cell differentiation (GO:0002244)|small GTPase mediated signal transduction (GO:0007264)	intracellular (GO:0005622)	GTP binding (GO:0005525)			kidney(1)|large_intestine(4)|ovary(1)	6		Lung NSC(96;2.1e-05)|Breast(56;0.00015)|Prostate(109;0.00174)|Hepatocellular(98;0.0207)|Myeloproliferative disorder(33;0.163)|Lung SC(185;0.187)|all_neural(104;0.19)	KIRC - Kidney renal clear cell carcinoma(9;0.119)|Kidney(9;0.169)	GBM - Glioblastoma multiforme(99;1.67e-09)		TACGTGCTGGACAGCACAGAT	0.612																																					p.D89G		.											.	ARL11-90	0			c.A266G						.						85.0	84.0	85.0					13																	50204849		2203	4300	6503	SO:0001583	missense	115761	exon2			TGCTGGACAGCAC	AF441378	CCDS9419.1	13q14.12	2014-05-09			ENSG00000152213	ENSG00000152213		"""ADP-ribosylation factors-like"", ""ADP-ribosylation factors"""	24046	protein-coding gene	gene with protein product		609351				12477932	Standard	NM_138450		Approved	ARLTS1, FLJ33930	uc001vdf.2	Q969Q4	OTTHUMG00000016919	ENST00000282026.1:c.266A>G	13.37:g.50204849A>G	ENSP00000282026:p.Asp89Gly	Somatic	144	0		WXS	Illumina GAIIx	Phase_I	98	11	NM_138450	0	0	0	0	0		Missense_Mutation	SNP	ENST00000282026.1	37	CCDS9419.1	.	.	.	.	.	.	.	.	.	.	A	18.81	3.703075	0.68501	.	.	ENSG00000152213	ENST00000282026	T	0.79845	-1.31	5.42	5.42	0.78866	Small GTP-binding protein domain (1);	0.000000	0.85682	D	0.000000	D	0.93271	0.7856	H	0.97758	4.07	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.95436	0.8521	10	0.87932	D	0	-10.5375	14.6494	0.68786	1.0:0.0:0.0:0.0	.	89	Q969Q4	ARL11_HUMAN	G	89	ENSP00000282026:D89G	ENSP00000282026:D89G	D	+	2	0	ARL11	49102850	1.000000	0.71417	1.000000	0.80357	0.247000	0.25773	8.918000	0.92759	2.053000	0.61076	0.533000	0.62120	GAC	.		0.612	ARL11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044929.2	NM_138450	
ARL11	115761	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	13	50204863	50204863	+	Missense_Mutation	SNP	G	G	T			TCGA-OR-A5LD-01A-11D-A29I-10	TCGA-OR-A5LD-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d84ce93-4c12-49da-87b3-c36d44672d59	afc22b50-442d-4fde-93ce-df0c281205c9	g.chr13:50204863G>T	ENST00000282026.1	+	2	615	c.280G>T	c.(280-282)Gcc>Tcc	p.A94S	ARL11_ENST00000490932.1_Intron	NM_138450.5	NP_612459.1	Q969Q4	ARL11_HUMAN	ADP-ribosylation factor-like 11	94					hematopoietic progenitor cell differentiation (GO:0002244)|small GTPase mediated signal transduction (GO:0007264)	intracellular (GO:0005622)	GTP binding (GO:0005525)			kidney(1)|large_intestine(4)|ovary(1)	6		Lung NSC(96;2.1e-05)|Breast(56;0.00015)|Prostate(109;0.00174)|Hepatocellular(98;0.0207)|Myeloproliferative disorder(33;0.163)|Lung SC(185;0.187)|all_neural(104;0.19)	KIRC - Kidney renal clear cell carcinoma(9;0.119)|Kidney(9;0.169)	GBM - Glioblastoma multiforme(99;1.67e-09)		CACAGATGAAGCCCGCTTACC	0.617																																					p.A94S		.											.	ARL11-90	0			c.G280T						.						86.0	86.0	86.0					13																	50204863		2203	4300	6503	SO:0001583	missense	115761	exon2			GATGAAGCCCGCT	AF441378	CCDS9419.1	13q14.12	2014-05-09			ENSG00000152213	ENSG00000152213		"""ADP-ribosylation factors-like"", ""ADP-ribosylation factors"""	24046	protein-coding gene	gene with protein product		609351				12477932	Standard	NM_138450		Approved	ARLTS1, FLJ33930	uc001vdf.2	Q969Q4	OTTHUMG00000016919	ENST00000282026.1:c.280G>T	13.37:g.50204863G>T	ENSP00000282026:p.Ala94Ser	Somatic	132	0		WXS	Illumina GAIIx	Phase_I	92	11	NM_138450	0	0	0	0	0		Missense_Mutation	SNP	ENST00000282026.1	37	CCDS9419.1	.	.	.	.	.	.	.	.	.	.	G	16.08	3.021246	0.54576	.	.	ENSG00000152213	ENST00000282026	D	0.81739	-1.53	5.42	4.56	0.56223	Small GTP-binding protein domain (1);	0.229741	0.43579	D	0.000554	T	0.70482	0.3229	L	0.31207	0.915	0.50171	D	0.999857	B	0.34103	0.437	B	0.29862	0.108	T	0.71108	-0.4688	10	0.54805	T	0.06	-15.8613	14.4521	0.67392	0.0:0.0:0.8519:0.1481	.	94	Q969Q4	ARL11_HUMAN	S	94	ENSP00000282026:A94S	ENSP00000282026:A94S	A	+	1	0	ARL11	49102864	0.094000	0.21725	0.609000	0.28983	0.207000	0.24258	2.190000	0.42630	1.241000	0.43820	0.655000	0.94253	GCC	.		0.617	ARL11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044929.2	NM_138450	
GZMB	3002	bcgsc.ca	37	14	25101618	25101618	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5LD-01A-11D-A29I-10	TCGA-OR-A5LD-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d84ce93-4c12-49da-87b3-c36d44672d59	afc22b50-442d-4fde-93ce-df0c281205c9	g.chr14:25101618G>A	ENST00000216341.4	-	3	357	c.251C>T	c.(250-252)cCg>cTg	p.P84L	GZMB_ENST00000382540.1_Intron|GZMB_ENST00000382542.1_Missense_Mutation_p.P118L|GZMB_ENST00000526004.1_Intron|RP11-104E19.1_ENST00000557736.1_RNA|RP11-104E19.1_ENST00000555300.1_RNA|GZMB_ENST00000415355.3_Missense_Mutation_p.P72L			P10144	GRAB_HUMAN	granzyme B (granzyme 2, cytotoxic T-lymphocyte-associated serine esterase 1)	84	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				apoptotic process (GO:0006915)|cytolysis (GO:0019835)|intrinsic apoptotic signaling pathway (GO:0097193)|Notch signaling pathway (GO:0007219)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|immunological synapse (GO:0001772)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nucleus (GO:0005634)	serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)			endometrium(2)|large_intestine(1)|lung(4)|stomach(4)|urinary_tract(2)	13				GBM - Glioblastoma multiforme(265;0.028)		CTGCTGGGTCGGCTCCTGTTC	0.522																																					p.P84L		.											.	GZMB-514	0			c.C251T						.						111.0	123.0	119.0					14																	25101618		2203	4300	6503	SO:0001583	missense	3002	exon3			TGGGTCGGCTCCT	BC030195	CCDS9633.1	14q11.2	2008-08-13			ENSG00000100453	ENSG00000100453			4709	protein-coding gene	gene with protein product	"""fragmentin 2"", ""cytotoxic serine protease B"", ""cathepsin G-like 1"", ""T-cell serine protease 1-3E"""	123910		CTLA1, CSPB		2323780	Standard	NM_004131		Approved	CCPI, CGL-1, CSP-B, CGL1, CTSGL1, HLP, SECT	uc001wps.2	P10144	OTTHUMG00000029369	ENST00000216341.4:c.251C>T	14.37:g.25101618G>A	ENSP00000216341:p.Pro84Leu	Somatic	141	2		WXS	Illumina GAIIx	Phase_I	166	16	NM_004131	0	0	0	0	0	Q8N1D2|Q9UCC1	Missense_Mutation	SNP	ENST00000216341.4	37	CCDS9633.1	.	.	.	.	.	.	.	.	.	.	g	10.34	1.322578	0.23994	.	.	ENSG00000100453	ENST00000415355;ENST00000216341;ENST00000382542	D;D;D	0.88741	-2.42;-2.42;-2.42	5.4	-4.52	0.03472	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	1.793260	0.03473	N	0.213946	T	0.80839	0.4700	L	0.33245	0.995	0.09310	N	1	B;B	0.15930	0.015;0.009	B;B	0.09377	0.004;0.002	T	0.64428	-0.6410	10	0.32370	T	0.25	.	6.234	0.20752	0.0:0.3182:0.2322:0.4495	.	72;84	Q6XGZ4;P10144	.;GRAB_HUMAN	L	72;84;118	ENSP00000387385:P72L;ENSP00000216341:P84L;ENSP00000371982:P118L	ENSP00000216341:P84L	P	-	2	0	GZMB	24171458	0.000000	0.05858	0.005000	0.12908	0.003000	0.03518	-3.679000	0.00395	-0.666000	0.05310	-2.213000	0.00299	CCG	.		0.522	GZMB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276540.3	NM_004131	
SLC24A4	123041	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	14	92920319	92920319	+	Missense_Mutation	SNP	T	T	A			TCGA-OR-A5LD-01A-11D-A29I-10	TCGA-OR-A5LD-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d84ce93-4c12-49da-87b3-c36d44672d59	afc22b50-442d-4fde-93ce-df0c281205c9	g.chr14:92920319T>A	ENST00000532405.1	+	11	1182	c.956T>A	c.(955-957)tTc>tAc	p.F319Y	SLC24A4_ENST00000393265.2_Missense_Mutation_p.F255Y|SLC24A4_ENST00000556739.1_3'UTR|SLC24A4_ENST00000298877.1_Missense_Mutation_p.F302Y|SLC24A4_ENST00000351924.5_Missense_Mutation_p.F283Y|SLC24A4_ENST00000531433.1_Missense_Mutation_p.F300Y			Q8NFF2	NCKX4_HUMAN	solute carrier family 24 (sodium/potassium/calcium exchanger), member 4	319					amelogenesis (GO:0097186)|cellular calcium ion homeostasis (GO:0006874)|ion transport (GO:0006811)|response to stimulus (GO:0050896)|sensory perception of smell (GO:0007608)|transmembrane transport (GO:0055085)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium, potassium:sodium antiporter activity (GO:0008273)|symporter activity (GO:0015293)			breast(3)|endometrium(2)|kidney(2)|large_intestine(6)|lung(20)|ovary(2)|skin(1)	36		all_cancers(154;0.0347)|all_epithelial(191;0.163)		Colorectal(1;0.00242)|COAD - Colon adenocarcinoma(157;0.047)|Epithelial(152;0.0781)|READ - Rectum adenocarcinoma(1;0.176)|all cancers(159;0.182)		CCTCCCAAGTTCACCTTCCCT	0.517																																					p.F319Y	NSCLC(10;315 435 10383 28450 38798)	.											.	SLC24A4-93	0			c.T956A						.						192.0	143.0	159.0					14																	92920319		2203	4300	6503	SO:0001583	missense	123041	exon11			CCAAGTTCACCTT	AF520704	CCDS9903.1, CCDS45155.1, CCDS45156.1, CCDS9903.2, CCDS45155.2	14q32.12	2013-05-22			ENSG00000140090	ENSG00000140090		"""Solute carriers"""	10978	protein-coding gene	gene with protein product		609840					Standard	NM_153646		Approved	NCKX4	uc001yak.3	Q8NFF2	OTTHUMG00000167589	ENST00000532405.1:c.956T>A	14.37:g.92920319T>A	ENSP00000431840:p.Phe319Tyr	Somatic	395	0		WXS	Illumina GAIIx	Phase_I	302	80	NM_153646	0	0	0	0	0	B4DHE7|B9ZVY2|Q8N8U6|Q8NCX1|Q8NFF0|Q8NFF1	Missense_Mutation	SNP	ENST00000532405.1	37	CCDS9903.2	.	.	.	.	.	.	.	.	.	.	T	9.426	1.084370	0.20309	.	.	ENSG00000140090	ENST00000393265;ENST00000531433;ENST00000532405;ENST00000298877;ENST00000351924;ENST00000318079	T;T;T;T;T	0.67698	-0.26;0.14;0.15;-0.26;-0.28	5.39	5.39	0.77823	.	0.158873	0.64402	D	0.000018	T	0.50446	0.1616	L	0.41632	1.29	0.32778	N	0.502921	B;B;B	0.10296	0.003;0.003;0.002	B;B;B	0.14578	0.011;0.008;0.003	T	0.50600	-0.8809	10	0.02654	T	1	.	9.1598	0.37016	0.2781:0.0:0.0:0.7219	.	300;255;319	Q8NFF2-3;Q8NFF2-2;Q8NFF2	.;.;NCKX4_HUMAN	Y	255;300;319;302;283;171	ENSP00000376948:F255Y;ENSP00000433302:F300Y;ENSP00000431840:F319Y;ENSP00000298877:F302Y;ENSP00000337789:F283Y	ENSP00000298877:F302Y	F	+	2	0	SLC24A4	91990072	1.000000	0.71417	1.000000	0.80357	0.189000	0.23516	2.316000	0.43761	2.043000	0.60533	0.482000	0.46254	TTC	.		0.517	SLC24A4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000395240.1	NM_153646	
AHNAK2	113146	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	14	105404743	105404743	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5LD-01A-11D-A29I-10	TCGA-OR-A5LD-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d84ce93-4c12-49da-87b3-c36d44672d59	afc22b50-442d-4fde-93ce-df0c281205c9	g.chr14:105404743C>T	ENST00000333244.5	-	7	17164	c.17045G>A	c.(17044-17046)cGa>cAa	p.R5682Q	AHNAK2_ENST00000557457.1_Missense_Mutation_p.R680Q	NM_138420.2	NP_612429.2	Q8IVF2	AHNK2_HUMAN	AHNAK nucleoprotein 2	5682						costamere (GO:0043034)|cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)				cervix(4)|endometrium(4)|large_intestine(3)|lung(14)|ovary(2)|prostate(2)|skin(1)|stomach(3)	33		all_cancers(154;0.115)|Melanoma(154;0.155)|all_epithelial(191;0.183)	all cancers(16;0.000479)|OV - Ovarian serous cystadenocarcinoma(23;0.00659)|Epithelial(46;0.0151)|GBM - Glioblastoma multiforme(11;0.116)			TGCCTCTGGTCGTGCCTCAGG	0.473																																					p.R5682Q		.											.	AHNAK2-47	0			c.G17045A						.						58.0	54.0	55.0					14																	105404743		1911	4128	6039	SO:0001583	missense	113146	exon7			TCTGGTCGTGCCT	AB095939	CCDS45177.1	14q32.33	2010-04-01	2007-03-26	2007-03-26	ENSG00000185567	ENSG00000185567			20125	protein-coding gene	gene with protein product		608570	"""chromosome 14 open reading frame 78"""	C14orf78		15007166	Standard	NM_138420		Approved		uc010axc.1	Q8IVF2		ENST00000333244.5:c.17045G>A	14.37:g.105404743C>T	ENSP00000353114:p.Arg5682Gln	Somatic	145	1		WXS	Illumina GAIIx	Phase_I	153	42	NM_138420	0	0	0	0	0	Q5BKX7|Q7Z343|Q7Z358|Q7Z394|Q7Z3G0|Q86WQ6|Q8IYY1|Q8N3G4|Q96EX9	Missense_Mutation	SNP	ENST00000333244.5	37	CCDS45177.1	.	.	.	.	.	.	.	.	.	.	C	12.25	1.882354	0.33255	.	.	ENSG00000185567	ENST00000557457;ENST00000333244	T;T	0.03065	4.06;4.2	3.41	0.161	0.14977	.	0.875959	0.09277	N	0.824271	T	0.02156	0.0067	L	0.32530	0.975	0.09310	N	1	P	0.42649	0.786	B	0.30495	0.116	T	0.45308	-0.9270	10	0.21014	T	0.42	.	3.4302	0.07425	0.139:0.3693:0.3859:0.1058	.	5682	Q8IVF2	AHNK2_HUMAN	Q	680;5682	ENSP00000450998:R680Q;ENSP00000353114:R5682Q	ENSP00000353114:R5682Q	R	-	2	0	AHNAK2	104475788	0.000000	0.05858	0.000000	0.03702	0.086000	0.17979	-0.806000	0.04525	0.144000	0.18951	0.655000	0.94253	CGA	.		0.473	AHNAK2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000410300.1	NM_138420	
RYR3	6263	ucsc.edu;bcgsc.ca;mdanderson.org	37	15	34030716	34030716	+	Silent	SNP	C	C	T	rs112521485	byFrequency	TCGA-OR-A5LD-01A-11D-A29I-10	TCGA-OR-A5LD-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d84ce93-4c12-49da-87b3-c36d44672d59	afc22b50-442d-4fde-93ce-df0c281205c9	g.chr15:34030716C>T	ENST00000389232.4	+	50	7651	c.7581C>T	c.(7579-7581)taC>taT	p.Y2527Y	RYR3_ENST00000415757.3_Silent_p.Y2527Y	NM_001036.3	NP_001027.3	Q15413	RYR3_HUMAN	ryanodine receptor 3	2527	4 X approximate repeats.				calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|cellular response to ATP (GO:0071318)|cellular response to caffeine (GO:0071313)|cellular response to calcium ion (GO:0071277)|cellular response to magnesium ion (GO:0071286)|ion transmembrane transport (GO:0034220)|negative regulation of cytosolic calcium ion concentration (GO:0051481)|protein homotetramerization (GO:0051289)|striated muscle contraction (GO:0006941)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|junctional membrane complex (GO:0030314)|perinuclear region of cytoplasm (GO:0048471)|sarcoplasmic reticulum membrane (GO:0033017)	calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|ryanodine-sensitive calcium-release channel activity (GO:0005219)			NS(3)|breast(9)|central_nervous_system(8)|cervix(2)|endometrium(29)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(55)|lung(148)|ovary(7)|pancreas(1)|prostate(13)|skin(4)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(3)	311		all_lung(180;7.18e-09)		all cancers(64;8.95e-12)|GBM - Glioblastoma multiforme(186;0.00109)|BRCA - Breast invasive adenocarcinoma(123;0.0363)		GGGGGAGCTACGGGCTAGCTG	0.507											OREG0023032	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	C|||	28	0.00559105	0.0204	0.0014	5008	,	,		19210	0.0		0.0	False		,,,				2504	0.0				p.Y2527Y		.											.	RYR3-520	0			c.C7581T						.	C		33,3865		0,33,1916	95.0	102.0	100.0		7581	-7.6	0.3	15	dbSNP_132	100	0,8262		0,0,4131	no	coding-synonymous	RYR3	NM_001036.3		0,33,6047	TT,TC,CC		0.0,0.8466,0.2714		2527/4871	34030716	33,12127	1949	4131	6080	SO:0001819	synonymous_variant	6263	exon50			GAGCTACGGGCTA		CCDS45210.1, CCDS58351.1	15q14-q15	2013-01-10				ENSG00000198838		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10485	protein-coding gene	gene with protein product		180903				8276408	Standard	NM_001036		Approved		uc001zhi.3	Q15413		ENST00000389232.4:c.7581C>T	15.37:g.34030716C>T		Somatic	110	1	844	WXS	Illumina GAIIx	Phase_I	57	25	NM_001243996	0	0	0	0	0	O15175|Q15412	Silent	SNP	ENST00000389232.4	37	CCDS45210.1																																																																																			C|0.995;T|0.005		0.507	RYR3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000417514.1		
SCG3	29106	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	15	51981440	51981440	+	Missense_Mutation	SNP	C	C	G			TCGA-OR-A5LD-01A-11D-A29I-10	TCGA-OR-A5LD-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d84ce93-4c12-49da-87b3-c36d44672d59	afc22b50-442d-4fde-93ce-df0c281205c9	g.chr15:51981440C>G	ENST00000220478.3	+	6	968	c.565C>G	c.(565-567)Ctg>Gtg	p.L189V	SCG3_ENST00000542355.2_5'UTR	NM_013243.3	NP_037375.2	Q8WXD2	SCG3_HUMAN	secretogranin III	189					blood coagulation (GO:0007596)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)	extracellular region (GO:0005576)|membrane (GO:0016020)|secretory granule lumen (GO:0034774)	poly(A) RNA binding (GO:0044822)			breast(1)|large_intestine(3)|lung(12)|ovary(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	21				all cancers(107;0.00488)		AGCACATACACTGGAAGATGA	0.358																																					p.L189V		.											.	SCG3-91	0			c.C565G						.						90.0	91.0	91.0					15																	51981440		2195	4293	6488	SO:0001583	missense	29106	exon6			CATACACTGGAAG	AF078851	CCDS10142.1, CCDS53947.1	15q21.2	2013-09-23			ENSG00000104112	ENSG00000104112			13707	protein-coding gene	gene with protein product		611796				2053134, 8825061	Standard	NM_013243		Approved	SGIII, FLJ90833	uc002abh.3	Q8WXD2	OTTHUMG00000131748	ENST00000220478.3:c.565C>G	15.37:g.51981440C>G	ENSP00000220478:p.Leu189Val	Somatic	159	0		WXS	Illumina GAIIx	Phase_I	86	8	NM_013243	0	0	0	0	0	A8K2B0|B3KQP6|B4DK99|F5H3R8|Q96C83|Q96GE8|Q9Y6G7	Missense_Mutation	SNP	ENST00000220478.3	37	CCDS10142.1	.	.	.	.	.	.	.	.	.	.	C	16.57	3.160916	0.57368	.	.	ENSG00000104112	ENST00000220478	T	0.37411	1.2	5.76	1.77	0.24775	.	0.000000	0.64402	D	0.000001	T	0.44808	0.1311	L	0.34521	1.04	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	T	0.33624	-0.9861	10	0.72032	D	0.01	-16.6346	10.161	0.42851	0.0:0.6107:0.0:0.3893	.	189	Q8WXD2	SCG3_HUMAN	V	189	ENSP00000220478:L189V	ENSP00000220478:L189V	L	+	1	2	SCG3	49768732	0.137000	0.22531	0.807000	0.32361	0.930000	0.56654	0.647000	0.24812	0.373000	0.24621	0.462000	0.41574	CTG	.		0.358	SCG3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254670.2	NM_013243	
ICE2	79664	bcgsc.ca	37	15	60734697	60734697	+	Silent	SNP	A	A	G	rs1063100	byFrequency	TCGA-OR-A5LD-01A-11D-A29I-10	TCGA-OR-A5LD-10A-01D-A29L-10	A	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d84ce93-4c12-49da-87b3-c36d44672d59	afc22b50-442d-4fde-93ce-df0c281205c9	g.chr15:60734697A>G	ENST00000261520.4	-	12	2577	c.2343T>C	c.(2341-2343)taT>taC	p.Y781Y	NARG2_ENST00000439632.1_Silent_p.Y644Y	NM_024611.4	NP_078887.2														breast(1)|central_nervous_system(1)|endometrium(7)|kidney(3)|large_intestine(2)|lung(10)|ovary(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(2)	32						CTTCAACTCCATAACAAGCTT	0.323													A|||	2978	0.594649	0.2534	0.6513	5008	,	,		18942	0.8244		0.5726	False		,,,				2504	0.8016				p.Y781Y		.											.	NARG2-227	0			c.T2343C						.	A	,	1267,3139	430.4+/-342.5	187,893,1123	89.0	79.0	82.0		1932,2343	-7.4	0.9	15	dbSNP_86	82	4931,3667	621.5+/-397.2	1431,2069,799	no	coding-synonymous,coding-synonymous	NARG2	NM_001018089.1,NM_024611.4	,	1618,2962,1922	GG,GA,AA		42.6495,28.7562,47.6623	,	644/846,781/983	60734697	6198,6806	2203	4299	6502	SO:0001819	synonymous_variant	79664	exon12			AACTCCATAACAA																												ENST00000261520.4:c.2343T>C	15.37:g.60734697A>G		Somatic	393	4		WXS	Illumina GAIIx	Phase_I	316	12	NM_024611	0	0	2	2	0		Silent	SNP	ENST00000261520.4	37	CCDS10176.1																																																																																			.		0.323	NARG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256136.1		
ZNF598	90850	hgsc.bcm.edu	37	16	2059674	2059674	+	Missense_Mutation	SNP	T	T	C	rs71384660		TCGA-OR-A5LD-01A-11D-A29I-10	TCGA-OR-A5LD-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d84ce93-4c12-49da-87b3-c36d44672d59	afc22b50-442d-4fde-93ce-df0c281205c9	g.chr16:2059674T>C	ENST00000431526.1	-	2	88	c.74A>G	c.(73-75)gAa>gGa	p.E25G	ZNF598_ENST00000563630.1_5'UTR|ZNF598_ENST00000562103.1_5'UTR	NM_178167.2	NP_835461.2	Q86UK7	ZN598_HUMAN	zinc finger protein 598	25							poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|lung(7)|skin(1)|urinary_tract(1)	16						GCTCCCGCCTTCCCGCTCAGG	0.766													C|||	5008	1.0	1.0	1.0	5008	,	,		5162	1.0		1.0	False		,,,				2504	1.0				p.E25G		.											.	ZNF598-432	0			c.A74G						.						1.0	2.0	2.0					16																	2059674		1089	2314	3403	SO:0001583	missense	90850	exon2			CCGCCTTCCCGCT	BC029270		16p13.3	2008-05-02				ENSG00000167962		"""Zinc fingers, C2H2-type"""	28079	protein-coding gene	gene with protein product							Standard	NM_178167		Approved	FLJ00086	uc002cof.2	Q86UK7		ENST00000431526.1:c.74A>G	16.37:g.2059674T>C	ENSP00000411409:p.Glu25Gly	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	8	8	NM_178167	0	0	0	0	0	Q8IW49|Q8N3D9|Q96FG3|Q9H7J3	Missense_Mutation	SNP	ENST00000431526.1	37		2168	0.9926739926739927	487	0.9898373983739838	361	0.9972375690607734	568	0.993006993006993	752	0.9920844327176781	N	1.560	-0.537056	0.04082	.	.	ENSG00000167962	ENST00000431526	T	0.77098	-1.07	3.3	3.3	0.37823	.	0.415485	0.23105	N	0.051871	T	0.00012	0.0000	.	.	.	0.48696	P	3.1000000000003247E-4	.	.	.	.	.	.	T	0.34650	-0.9820	6	0.22706	T	0.39	-7.8624	8.393	0.32540	0.0:0.8796:0.0:0.1204	.	.	.	.	G	25	ENSP00000411409:E25G	ENSP00000411409:E25G	E	-	2	0	ZNF598	1999675	1.000000	0.71417	1.000000	0.80357	0.107000	0.19398	0.911000	0.28584	0.691000	0.31592	-0.642000	0.03964	GAA	T|0.007;C|0.993		0.766	ZNF598-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_178167	
C16orf45	89927	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	16	15596190	15596190	+	Intron	SNP	C	C	A			TCGA-OR-A5LD-01A-11D-A29I-10	TCGA-OR-A5LD-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d84ce93-4c12-49da-87b3-c36d44672d59	afc22b50-442d-4fde-93ce-df0c281205c9	g.chr16:15596190C>A	ENST00000300006.4	+	2	465				C16orf45_ENST00000452191.2_Missense_Mutation_p.D4E|RP11-1021N1.1_ENST00000568222.1_Intron|C16orf45_ENST00000566490.1_Intron	NM_033201.2	NP_149978.1	Q96MC5	CP045_HUMAN	chromosome 16 open reading frame 45											endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(3)|ovary(1)	11						TGTGGGGCGACCTCACAGAGA	0.527																																					p.D4E		.											.	C16orf45-91	0			c.C12A						.						136.0	128.0	130.0					16																	15596190		692	1591	2283	SO:0001627	intron_variant	89927	exon1			GGGCGACCTCACA	AK057180	CCDS10561.1, CCDS45422.1	16p13.2	2012-10-09			ENSG00000166780	ENSG00000166780			19213	protein-coding gene	gene with protein product							Standard	NM_033201		Approved	FLJ32618	uc002ddo.3	Q96MC5	OTTHUMG00000129883	ENST00000300006.4:c.107-12972C>A	16.37:g.15596190C>A		Somatic	127	0		WXS	Illumina GAIIx	Phase_I	185	22	NM_001142469	0	0	0	0	0	O00223|O75769|Q8IZ36|Q96H25	Missense_Mutation	SNP	ENST00000300006.4	37	CCDS10561.1	.	.	.	.	.	.	.	.	.	.	C	10.85	1.467622	0.26335	.	.	ENSG00000166780	ENST00000452191	.	.	.	3.36	-6.72	0.01755	.	.	.	.	.	T	0.23965	0.0580	.	.	.	0.09310	N	0.999996	.	.	.	.	.	.	T	0.32561	-0.9902	5	0.72032	D	0.01	.	0.4152	0.00447	0.2098:0.2403:0.3246:0.2253	.	.	.	.	E	4	.	ENSP00000408976:D4E	D	+	3	2	C16orf45	15503691	0.000000	0.05858	0.000000	0.03702	0.027000	0.11550	-0.470000	0.06639	-2.136000	0.00810	0.411000	0.27672	GAC	.		0.527	C16orf45-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252130.2	NM_033201	
GTF3C1	2975	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	16	27503663	27503663	+	Silent	SNP	T	T	C			TCGA-OR-A5LD-01A-11D-A29I-10	TCGA-OR-A5LD-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d84ce93-4c12-49da-87b3-c36d44672d59	afc22b50-442d-4fde-93ce-df0c281205c9	g.chr16:27503663T>C	ENST00000356183.4	-	19	3162	c.3147A>G	c.(3145-3147)ccA>ccG	p.P1049P	GTF3C1_ENST00000561623.1_Silent_p.P1049P	NM_001520.3	NP_001511.2	Q12789	TF3C1_HUMAN	general transcription factor IIIC, polypeptide 1, alpha 220kDa	1049					5S class rRNA transcription from RNA polymerase III type 1 promoter (GO:0042791)|gene expression (GO:0010467)|rRNA transcription (GO:0009303)|transcription from RNA polymerase III promoter (GO:0006383)|transcription, DNA-templated (GO:0006351)|tRNA transcription (GO:0009304)|tRNA transcription from RNA polymerase III promoter (GO:0042797)	membrane (GO:0016020)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)|transcription factor TFIIIC complex (GO:0000127)	DNA binding (GO:0003677)			breast(2)|central_nervous_system(4)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(14)|liver(3)|lung(28)|ovary(2)|pancreas(1)|prostate(2)|skin(5)|upper_aerodigestive_tract(2)	80						ACCCACCTAGTGGGGTGTTGA	0.552																																					p.P1049P		.											.	GTF3C1-94	0			c.A3147G						.						57.0	59.0	58.0					16																	27503663		2197	4300	6497	SO:0001819	synonymous_variant	2975	exon19			ACCTAGTGGGGTG	U06485	CCDS32414.1, CCDS66988.1	16p12	2010-03-23	2002-08-29			ENSG00000077235		"""General transcription factors"""	4664	protein-coding gene	gene with protein product		603246	"""general transcription factor IIIC, polypeptide 1 (alpha subunit, 220kD )"""			8164661, 8127861	Standard	NM_001520		Approved	TFIIIC220	uc002dov.2	Q12789		ENST00000356183.4:c.3147A>G	16.37:g.27503663T>C		Somatic	94	0		WXS	Illumina GAIIx	Phase_I	137	24	NM_001520	0	0	0	0	0	B2RP21|Q12838|Q6DKN9|Q9Y4W9	Silent	SNP	ENST00000356183.4	37	CCDS32414.1																																																																																			.		0.552	GTF3C1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000433856.1	NM_001520	
CDIPT	10423	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	16	29870513	29870515	+	In_Frame_Del	DEL	CTT	CTT	-			TCGA-OR-A5LD-01A-11D-A29I-10	TCGA-OR-A5LD-10A-01D-A29L-10	CTT	CTT	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d84ce93-4c12-49da-87b3-c36d44672d59	afc22b50-442d-4fde-93ce-df0c281205c9	g.chr16:29870513_29870515delCTT	ENST00000219789.6	-	6	1515_1517	c.637_639delAAG	c.(637-639)aagdel	p.K213del	CDIPT_ENST00000566113.1_In_Frame_Del_p.K168del|CDIPT_ENST00000561555.1_In_Frame_Del_p.K237del|CDIPT_ENST00000563415.1_3'UTR|CDIPT_ENST00000570016.1_In_Frame_Del_p.K213del|CDIPT_ENST00000569956.1_In_Frame_Del_p.K213del|CDIPT_ENST00000567459.1_5'UTR	NM_006319.3	NP_006310.1	O14735	CDIPT_HUMAN	CDP-diacylglycerol--inositol 3-phosphatidyltransferase	213					CDP-diacylglycerol metabolic process (GO:0046341)|glycerophospholipid biosynthetic process (GO:0046474)|phosphatidylinositol biosynthetic process (GO:0006661)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum membrane (GO:0005789)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	alcohol binding (GO:0043178)|carbohydrate binding (GO:0030246)|CDP-diacylglycerol-inositol 3-phosphatidyltransferase activity (GO:0003881)|diacylglycerol binding (GO:0019992)|manganese ion binding (GO:0030145)			endometrium(1)|lung(3)	4						TCCAGCGTCACTTCTTCTTGGCG	0.665																																					p.213_213del		.											.	CDIPT-90	0			c.637_639del						.																																			SO:0001651	inframe_deletion	10423	exon6			GCGTCACTTCTTC	AF014807	CCDS10657.1, CCDS67002.1	16p11.2	2012-11-19	2010-04-29		ENSG00000103502	ENSG00000103502	2.7.8.11		1769	protein-coding gene	gene with protein product	"""phosphatidylinositol synthase"""	605893	"""CDP-diacylglycerol--inositol 3-phosphatidyltransferase (phosphatidylinositol synthase)"""			9407135	Standard	NM_006319		Approved	PIS1, PIS	uc002dum.3	O14735	OTTHUMG00000177144	ENST00000219789.6:c.637_639delAAG	16.37:g.29870519_29870521delCTT	ENSP00000219789:p.Lys213del	Somatic	108	0		WXS	Illumina GAIIx	Phase_I	149	34	NM_006319	0	0	0	0	0	B4DUV0|H3BTV1|Q6FGU1|Q6ZN70	In_Frame_Del	DEL	ENST00000219789.6	37	CCDS10657.1																																																																																			.		0.665	CDIPT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255147.3	NM_006319	
ABCC11	85320	broad.mit.edu	37	16	48245093	48245093	+	Silent	SNP	C	C	T			TCGA-OR-A5LD-01A-11D-A29I-10	TCGA-OR-A5LD-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d84ce93-4c12-49da-87b3-c36d44672d59	afc22b50-442d-4fde-93ce-df0c281205c9	g.chr16:48245093C>T	ENST00000394747.1	-	10	1723	c.1374G>A	c.(1372-1374)gaG>gaA	p.E458E	ABCC11_ENST00000356608.2_Silent_p.E458E|ABCC11_ENST00000353782.5_Silent_p.E458E|ABCC11_ENST00000537808.1_Silent_p.E458E|ABCC11_ENST00000394748.1_Silent_p.E458E	NM_033151.3	NP_149163.2	Q96J66	ABCCB_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP), member 11	458					organic anion transport (GO:0015711)|purine nucleotide transport (GO:0015865)|transmembrane transport (GO:0055085)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|organic anion transmembrane transporter activity (GO:0008514)|purine nucleotide transmembrane transporter activity (GO:0015216)			breast(3)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(12)|lung(42)|ovary(3)|prostate(2)|skin(5)|urinary_tract(2)	83		all_cancers(37;0.127)|all_lung(18;0.132)|Breast(268;0.166)			Conjugated Estrogens(DB00286)|Folic Acid(DB00158)|Indomethacin(DB00328)|Methotrexate(DB00563)|Probenecid(DB01032)	AAACAGGGCTCTCCTGGAGGA	0.468																																					p.E458E		.											.	ABCC11-95	0			c.G1374A						.						82.0	89.0	87.0					16																	48245093		2201	4300	6501	SO:0001819	synonymous_variant	85320	exon10			AGGGCTCTCCTGG	AF367202	CCDS10732.1, CCDS10733.1	16q12	2012-03-14			ENSG00000121270	ENSG00000121270		"""ATP binding cassette transporters / subfamily C"""	14639	protein-coding gene	gene with protein product		607040				11483364, 11435397	Standard	NM_033151		Approved	MRP8	uc002efg.1	Q96J66	OTTHUMG00000133146	ENST00000394747.1:c.1374G>A	16.37:g.48245093C>T		Somatic	35	0		WXS	Illumina GAIIx	Phase_I	25	3	NM_033151	0	0	0	0	0	Q8TDJ0|Q96JA6|Q9BX80	Silent	SNP	ENST00000394747.1	37	CCDS10732.1																																																																																			.		0.468	ABCC11-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000429984.1	NM_032583	
N4BP1	9683	broad.mit.edu;bcgsc.ca	37	16	48595678	48595678	+	Missense_Mutation	SNP	T	T	G			TCGA-OR-A5LD-01A-11D-A29I-10	TCGA-OR-A5LD-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d84ce93-4c12-49da-87b3-c36d44672d59	afc22b50-442d-4fde-93ce-df0c281205c9	g.chr16:48595678T>G	ENST00000262384.3	-	2	1112	c.876A>C	c.(874-876)gaA>gaC	p.E292D	RP11-44I10.3_ENST00000563994.1_RNA	NM_153029.3	NP_694574.3	O75113	N4BP1_HUMAN	NEDD4 binding protein 1	292					cellular response to UV (GO:0034644)|negative regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032435)|negative regulation of protein ubiquitination (GO:0031397)	nucleolus (GO:0005730)|PML body (GO:0016605)				breast(3)|kidney(2)|lung(11)|urinary_tract(1)	17		all_cancers(37;0.179)|all_lung(18;0.11)				TCGTATGCCTTTCTTCAGAAT	0.398																																					p.E292D		.											.	N4BP1-22	0			c.A876C						.						86.0	83.0	84.0					16																	48595678		1831	4084	5915	SO:0001583	missense	9683	exon2			ATGCCTTTCTTCA	AK026937	CCDS45479.1	16q12.1	2008-01-18				ENSG00000102921			29850	protein-coding gene	gene with protein product						9734811, 11717310	Standard	NM_153029		Approved		uc002efp.3	O75113		ENST00000262384.3:c.876A>C	16.37:g.48595678T>G	ENSP00000262384:p.Glu292Asp	Somatic	37	0		WXS	Illumina GAIIx	Phase_I	15	4	NM_153029	0	0	0	0	0	A7MD49|Q2YDX1	Missense_Mutation	SNP	ENST00000262384.3	37	CCDS45479.1	.	.	.	.	.	.	.	.	.	.	T	17.68	3.449516	0.63178	.	.	ENSG00000102921	ENST00000262384	T	0.50813	0.73	5.75	4.61	0.57282	.	0.265873	0.36519	N	0.002554	T	0.53530	0.1802	L	0.32530	0.975	0.34235	D	0.676994	D	0.76494	0.999	D	0.69307	0.963	T	0.65664	-0.6113	10	0.72032	D	0.01	-22.1891	8.9758	0.35935	0.0:0.1604:0.0:0.8396	.	292	O75113	N4BP1_HUMAN	D	292	ENSP00000262384:E292D	ENSP00000262384:E292D	E	-	3	2	N4BP1	47153179	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	2.100000	0.41777	0.949000	0.37715	0.533000	0.62120	GAA	.		0.398	N4BP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000429920.1	NM_014664	
E2F4	1874	broad.mit.edu	37	16	67234630	67234630	+	IGR	SNP	G	G	A			TCGA-OR-A5LD-01A-11D-A29I-10	TCGA-OR-A5LD-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d84ce93-4c12-49da-87b3-c36d44672d59	afc22b50-442d-4fde-93ce-df0c281205c9	g.chr16:67234630G>A	ENST00000379378.3	+	0	2096				ELMO3_ENST00000360833.1_Missense_Mutation_p.S231N|ELMO3_ENST00000393997.2_Missense_Mutation_p.S248N|MIR328_ENST00000385213.1_RNA|ELMO3_ENST00000477898.1_Missense_Mutation_p.S82N|ELMO3_ENST00000571638.1_3'UTR	NM_001950.3	NP_001941.2	Q16254	E2F4_HUMAN	E2F transcription factor 4, p107/p130-binding						blood circulation (GO:0008015)|cell volume homeostasis (GO:0006884)|cilium assembly (GO:0042384)|epithelial cell development (GO:0002064)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|organ morphogenesis (GO:0009887)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of cell proliferation (GO:0042127)|regulation of cell size (GO:0008361)|regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0000083)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|protein domain specific binding (GO:0019904)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)			breast(4)|central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(2)	11		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.000697)|Epithelial(162;0.00303)|all cancers(182;0.0325)		CTGCTGGAGAGTGTGACCTTG	0.642																																					p.S248N		.											.	ELMO3-90	0			c.G743A						.						42.0	46.0	45.0					16																	67234630		2041	4181	6222	SO:0001628	intergenic_variant	79767	exon7			TGGAGAGTGTGAC	BC021050	CCDS32464.1	16q22.1	2014-05-06			ENSG00000205250	ENSG00000205250			3118	protein-coding gene	gene with protein product		600659				7958924, 7892279	Standard	NM_001950		Approved	E2F-4	uc002erz.3	Q16254	OTTHUMG00000172975		16.37:g.67234630G>A		Somatic	100	2		WXS	Illumina GAIIx	Phase_I	294	32	NM_024712	0	0	1	3	2	A6NGR8|B5BU56|Q12991|Q15328	Missense_Mutation	SNP	ENST00000379378.3	37	CCDS32464.1	.	.	.	.	.	.	.	.	.	.	G	12.21	1.870066	0.33069	.	.	ENSG00000102890	ENST00000360833;ENST00000393997	T;T	0.37915	1.17;1.17	4.62	3.67	0.42095	Armadillo-like helical (1);Armadillo-type fold (1);	0.274240	0.47852	N	0.000212	T	0.23014	0.0556	L	0.27053	0.805	0.51767	D	0.999934	B;B;B	0.12013	0.002;0.005;0.005	B;B;B	0.15484	0.011;0.009;0.013	T	0.05209	-1.0899	10	0.24483	T	0.36	-3.7439	8.9277	0.35650	0.1797:0.0:0.8203:0.0	.	195;231;248	Q96BJ8;F8W9E7;Q96BJ8-3	ELMO3_HUMAN;.;.	N	231;248	ENSP00000354077:S231N;ENSP00000377566:S248N	ENSP00000354077:S231N	S	+	2	0	ELMO3	65792131	1.000000	0.71417	1.000000	0.80357	0.923000	0.55619	4.157000	0.58144	1.181000	0.42912	0.561000	0.74099	AGT	.		0.642	E2F4-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000421565.1	NM_001950	
PKD1L2	114780	bcgsc.ca	37	16	81185478	81185478	+	RNA	SNP	G	G	A	rs374254873		TCGA-OR-A5LD-01A-11D-A29I-10	TCGA-OR-A5LD-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d84ce93-4c12-49da-87b3-c36d44672d59	afc22b50-442d-4fde-93ce-df0c281205c9	g.chr16:81185478G>A	ENST00000525539.1	-	0	4446				PKD1L2_ENST00000533478.1_RNA	NM_052892.3	NP_443124.3	Q7Z442	PK1L2_HUMAN	polycystic kidney disease 1-like 2						ion transport (GO:0006811)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)	calcium ion binding (GO:0005509)|carbohydrate binding (GO:0030246)			breast(2)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(9)|lung(20)|ovary(2)|pancreas(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	44						TACCACTTCCGGTCCATCACC	0.532													G|||	1	0.000199681	0.0	0.0014	5008	,	,		18087	0.0		0.0	False		,,,				2504	0.0				.		.											.	PKD1L2-92	0			.						.						60.0	56.0	58.0					16																	81185478		1954	4148	6102			114780	.			ACTTCCGGTCCAT	AY164483	CCDS61998.1, CCDS61999.1	16q23.2	2014-09-11			ENSG00000166473	ENSG00000166473			21715	protein-coding gene	gene with protein product		607894				12782129	Standard	NM_052892		Approved	KIAA1879	uc002fgf.1	Q7Z442	OTTHUMG00000166126		16.37:g.81185478G>A		Somatic	326	2		WXS	Illumina GAIIx	Phase_I	168	7	.	0	0	0	0	0	Q6UEE1|Q6ZN46|Q6ZSP2|Q8N1H9|Q96CL2|Q96Q08	RNA	SNP	ENST00000525539.1	37																																																																																				.		0.532	PKD1L2-001	KNOWN	non_canonical_polymorphism|basic	polymorphic_pseudogene	polymorphic_pseudogene	OTTHUMT00000387972.2		
ACAP1	9744	hgsc.bcm.edu	37	17	7251272	7251273	+	Frame_Shift_Del	DEL	TC	TC	-			TCGA-OR-A5LD-01A-11D-A29I-10	TCGA-OR-A5LD-10A-01D-A29L-10	TC	TC	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d84ce93-4c12-49da-87b3-c36d44672d59	afc22b50-442d-4fde-93ce-df0c281205c9	g.chr17:7251272_7251273delTC	ENST00000158762.3	+	15	1581_1582	c.1375_1376delTC	c.(1375-1377)tctfs	p.S459fs	ACAP1_ENST00000575415.1_5'Flank|ACAP1_ENST00000571471.1_5'Flank|ACAP1_ENST00000574499.1_5'Flank|ACAP1_ENST00000570504.1_5'Flank	NM_014716.3	NP_055531.1	Q15027	ACAP1_HUMAN	ArfGAP with coiled-coil, ankyrin repeat and PH domains 1	459	Arf-GAP. {ECO:0000255|PROSITE- ProRule:PRU00288}.|Required for interaction with GULP1.				protein transport (GO:0015031)|regulation of ARF GTPase activity (GO:0032312)	endosome (GO:0005768)|membrane (GO:0016020)	ARF GTPase activator activity (GO:0008060)|zinc ion binding (GO:0008270)			NS(1)|breast(5)|cervix(3)|endometrium(4)|kidney(1)|large_intestine(7)|liver(1)|lung(6)|prostate(3)|skin(1)|urinary_tract(1)	33						CAAAGTCCGGTCTCTGACCCTT	0.604																																					p.459_459del		.											.	ACAP1-153	0			c.1375_1376del						.																																			SO:0001589	frameshift_variant	9744	exon15			GTCCGGTCTCTGA	D30758	CCDS11101.1	17p13.1	2013-01-11	2008-09-22	2008-09-22	ENSG00000072818	ENSG00000072818		"""ADP-ribosylation factor GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"", ""Ankyrin repeat domain containing"""	16467	protein-coding gene	gene with protein product		607763	"""centaurin, beta 1"""	CENTB1		11050434, 11062263	Standard	NM_014716		Approved	KIAA0050	uc002ggd.2	Q15027	OTTHUMG00000102199	ENST00000158762.3:c.1375_1376delTC	17.37:g.7251274_7251275delTC	ENSP00000158762:p.Ser459fs	Somatic	94	1		WXS	Illumina GAIIx	Phase_I	87	14	NM_014716	0	0	0	0	0	Q53XN9	Frame_Shift_Del	DEL	ENST00000158762.3	37	CCDS11101.1																																																																																			.		0.604	ACAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000220049.4	NM_014716	
IGFBP4	3487	hgsc.bcm.edu	37	17	38600092	38600092	+	Silent	SNP	G	G	A	rs598892	byFrequency	TCGA-OR-A5LD-01A-11D-A29I-10	TCGA-OR-A5LD-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d84ce93-4c12-49da-87b3-c36d44672d59	afc22b50-442d-4fde-93ce-df0c281205c9	g.chr17:38600092G>A	ENST00000269593.4	+	1	380	c.105G>A	c.(103-105)ctG>ctA	p.L35L	IGFBP4_ENST00000542955.1_Intron	NM_001552.2	NP_001543.2	P22692	IBP4_HUMAN	insulin-like growth factor binding protein 4	35	IGFBP N-terminal. {ECO:0000255|PROSITE- ProRule:PRU00653}.				cell proliferation (GO:0008283)|cellular protein metabolic process (GO:0044267)|DNA metabolic process (GO:0006259)|inflammatory response (GO:0006954)|positive regulation of insulin-like growth factor receptor signaling pathway (GO:0043568)|positive regulation of MAPK cascade (GO:0043410)|regulation of cell growth (GO:0001558)|regulation of glucose metabolic process (GO:0010906)|signal transduction (GO:0007165)|skeletal system development (GO:0001501)|type B pancreatic cell proliferation (GO:0044342)	extracellular region (GO:0005576)|extracellular space (GO:0005615)				NS(1)|endometrium(1)|kidney(1)|large_intestine(2)	5		Breast(137;0.000496)	STAD - Stomach adenocarcinoma(5;5.91e-05)			AGGAGAAGCTGGCGCGCTGCC	0.771													G|||	1792	0.357827	0.0386	0.5	5008	,	,		9796	0.4752		0.3946	False		,,,				2504	0.5297				p.L35L	GBM(160;940 3581 26177)	.											.	IGFBP4-522	0			c.G105A						.	G		266,3270		24,218,1526	3.0	3.0	3.0		105	4.0	1.0	17	dbSNP_83	3	2267,4893		352,1563,1665	no	coding-synonymous	IGFBP4	NM_001552.2		376,1781,3191	AA,AG,GG		31.662,7.5226,23.6818		35/259	38600092	2533,8163	1768	3580	5348	SO:0001819	synonymous_variant	3487	exon1			GAAGCTGGCGCGC	M38177	CCDS11367.1	17q21.2	2014-09-16	2001-11-28		ENSG00000141753	ENSG00000141753			5473	protein-coding gene	gene with protein product	"""IGF-binding protein 4"""	146733	"""insulin-like growth factor-binding protein 4"""			1707125, 1704481	Standard	NM_001552		Approved	IBP4, BP-4, HT29-IGFBP, IGFBP-4	uc002hus.3	P22692	OTTHUMG00000133326	ENST00000269593.4:c.105G>A	17.37:g.38600092G>A		Somatic	1	0		WXS	Illumina GAIIx	Phase_I	7	6	NM_001552	0	0	0	0	0	A0N9W2|B4E351|Q5U012|Q9UCL6	Silent	SNP	ENST00000269593.4	37	CCDS11367.1																																																																																			G|0.645;A|0.355		0.771	IGFBP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257134.1	NM_001552	
QRICH2	84074	bcgsc.ca	37	17	74288508	74288508	+	Missense_Mutation	SNP	T	T	A			TCGA-OR-A5LD-01A-11D-A29I-10	TCGA-OR-A5LD-10A-01D-A29L-10	T	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d84ce93-4c12-49da-87b3-c36d44672d59	afc22b50-442d-4fde-93ce-df0c281205c9	g.chr17:74288508T>A	ENST00000262765.5	-	4	1981	c.1802A>T	c.(1801-1803)gAt>gTt	p.D601V		NM_032134.1	NP_115510.1	Q9H0J4	QRIC2_HUMAN	glutamine rich 2	601	Gln-rich.									breast(3)|central_nervous_system(1)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(6)|lung(17)|ovary(4)|pancreas(2)|prostate(3)|skin(2)|stomach(4)	62						ACCATGCTGATCTGCACCAGG	0.537																																					p.D601V		.											.	QRICH2-94	0			c.A1802T						.						168.0	134.0	145.0					17																	74288508		2203	4300	6503	SO:0001583	missense	84074	exon4			TGCTGATCTGCAC	AK058102	CCDS32741.1	17q25.1	2009-03-19			ENSG00000129646	ENSG00000129646			25326	protein-coding gene	gene with protein product							Standard	NM_032134		Approved	DKFZP434P0316	uc002jrd.1	Q9H0J4	OTTHUMG00000167578	ENST00000262765.5:c.1802A>T	17.37:g.74288508T>A	ENSP00000262765:p.Asp601Val	Somatic	297	3		WXS	Illumina GAIIx	Phase_I	288	13	NM_032134	0	0	0	0	0	A2RRE1|Q96LM3	Missense_Mutation	SNP	ENST00000262765.5	37	CCDS32741.1	.	.	.	.	.	.	.	.	.	.	T	8.120	0.780708	0.16120	.	.	ENSG00000129646	ENST00000262765;ENST00000301613	T	0.21734	1.99	4.82	-9.63	0.00544	.	.	.	.	.	T	0.06735	0.0172	N	0.16478	0.41	0.09310	N	1	P;B	0.37276	0.589;0.138	B;B	0.33454	0.164;0.033	T	0.14200	-1.0481	9	0.18710	T	0.47	0.7097	1.6345	0.02739	0.4588:0.2138:0.0952:0.2322	.	601;601	B5MD94;Q9H0J4	.;QRIC2_HUMAN	V	601	ENSP00000262765:D601V	ENSP00000262765:D601V	D	-	2	0	QRICH2	71800103	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-6.623000	0.00059	-2.309000	0.00651	-0.444000	0.05651	GAT	.		0.537	QRICH2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000395140.1	NM_032134	
FLJ45079	400624	ucsc.edu;bcgsc.ca	37	17	75878204	75878204	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5LD-01A-11D-A29I-10	TCGA-OR-A5LD-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d84ce93-4c12-49da-87b3-c36d44672d59	afc22b50-442d-4fde-93ce-df0c281205c9	g.chr17:75878204G>A	ENST00000374983.2	-	1	455	c.269C>T	c.(268-270)aCa>aTa	p.T90I																					BRCA - Breast invasive adenocarcinoma(99;0.00524)|Lung(188;0.154)			aaacggatatgtgtcagtgta	0.473																																					.		.											.	.	0			.						.						601.0	638.0	624.0					17																	75878204		1310	2289	3599	SO:0001583	missense	0	.			GGATATGTGTCAG																												ENST00000374983.2:c.269C>T	17.37:g.75878204G>A	ENSP00000364122:p.Thr90Ile	Somatic	289	2		WXS	Illumina GAIIx	Phase_I	266	83	.	0	0	0	0	0		RNA	SNP	ENST00000374983.2	37		.	.	.	.	.	.	.	.	.	.	G	7.673	0.687476	0.14973	.	.	ENSG00000204283	ENST00000374983	.	.	.	0.694	0.694	0.18062	.	.	.	.	.	T	0.32133	0.0819	.	.	.	.	.	.	P	0.48694	0.914	B	0.40199	0.322	T	0.46884	-0.9159	5	0.87932	D	0	.	.	.	.	.	90	Q6ZRC4	.	I	90	.	ENSP00000364122:T90I	T	-	2	0	AC015804.1	73389799	0.654000	0.27367	0.007000	0.13788	0.008000	0.06430	2.368000	0.44222	0.647000	0.30713	0.655000	0.94253	ACA	.		0.473	FLJ45079-201	KNOWN	basic|appris_principal	protein_coding	protein_coding			
ENGASE	64772	hgsc.bcm.edu	37	17	77071040	77071040	+	Missense_Mutation	SNP	C	C	A	rs56107536	byFrequency	TCGA-OR-A5LD-01A-11D-A29I-10	TCGA-OR-A5LD-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d84ce93-4c12-49da-87b3-c36d44672d59	afc22b50-442d-4fde-93ce-df0c281205c9	g.chr17:77071040C>A	ENST00000579016.1	+	1	14	c.14C>A	c.(13-15)gCg>gAg	p.A5E	ENGASE_ENST00000539857.2_5'UTR	NM_001042573.2	NP_001036038.1	Q8NFI3	ENASE_HUMAN	endo-beta-N-acetylglucosaminidase	5						cytoplasm (GO:0005737)	mannosyl-glycoprotein endo-beta-N-acetylglucosaminidase activity (GO:0033925)			breast(2)|endometrium(4)|large_intestine(1)|lung(15)|prostate(2)|skin(1)	25						gaggccgcggcggtgacggtc	0.766													C|||	823	0.164337	0.0159	0.2925	5008	,	,		7125	0.2917		0.1143	False		,,,				2504	0.1943				p.A5E		.											.	ENGASE-91	0			c.C14A						.	C	GLU/ALA	98,2574		1,96,1239	3.0	4.0	4.0		14	2.5	0.0	17	dbSNP_129	4	659,5613		26,607,2503	no	missense	ENGASE	NM_001042573.1	107	27,703,3742	AA,AC,CC		10.507,3.6677,8.4638	possibly-damaging	5/744	77071040	757,8187	1336	3136	4472	SO:0001583	missense	64772	exon1			CCGCGGCGGTGAC	AF512564	CCDS42394.1	17q25.3	2009-03-03			ENSG00000167280	ENSG00000167280	3.2.1.96		24622	protein-coding gene	gene with protein product	"""Mannosyl-glycoprotein endo-beta-N-acetylglucosaminidase"", ""Di-N-acetylchitobiosyl beta-N-acetylglucosaminidase"""	611898				12114544, 18586680	Standard	NM_001042573		Approved	FLJ21865	uc002jwv.4	Q8NFI3	OTTHUMG00000167714	ENST00000579016.1:c.14C>A	17.37:g.77071040C>A	ENSP00000462333:p.Ala5Glu	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	7	5	NM_001042573	0	0	0	0	0	Q659F0|Q8TB86|Q9H6U4	Missense_Mutation	SNP	ENST00000579016.1	37	CCDS42394.1	358	0.16391941391941392	12	0.024390243902439025	89	0.24585635359116023	166	0.2902097902097902	91	0.12005277044854881	C	14.26	2.483801	0.44147	0.036677	0.10507	ENSG00000167280	ENST00000311595;ENST00000545583	.	.	.	2.54	2.54	0.30619	.	.	.	.	.	T	0.00012	0.0000	N	0.22421	0.69	0.31931	P	0.612136	P;P	0.40000	0.572;0.698	B;P	0.45377	0.22;0.478	T	0.25363	-1.0134	7	0.49607	T	0.09	-17.5832	8.7108	0.34382	0.0:1.0:0.0:0.0	rs56107536	5;5	Q8NFI3;Q8NFI3-3	ENASE_HUMAN;.	E	5	.	ENSP00000308158:A5E	A	+	2	0	ENGASE	74582635	0.000000	0.05858	0.003000	0.11579	0.019000	0.09904	-0.338000	0.07842	1.723000	0.51488	0.563000	0.77884	GCG	C|0.836;A|0.164		0.766	ENGASE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395807.1	NM_022759	
THOC1	9984	broad.mit.edu;bcgsc.ca	37	18	268019	268021	+	Start_Codon_Del	DEL	TCT	TCT	-	rs186687400		TCGA-OR-A5LD-01A-11D-A29I-10	TCGA-OR-A5LD-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d84ce93-4c12-49da-87b3-c36d44672d59	afc22b50-442d-4fde-93ce-df0c281205c9	g.chr18:268019_268021delTCT	ENST00000261600.6	-	0	6_8				THOC1_ENST00000582313.1_5'UTR|RP11-705O1.8_ENST00000581677.1_lincRNA	NM_005131.2	NP_005122.2	Q96FV9	THOC1_HUMAN	THO complex 1						apoptotic process (GO:0006915)|mRNA export from nucleus (GO:0006406)|mRNA processing (GO:0006397)|negative regulation of DNA damage checkpoint (GO:2000002)|negative regulation of isotype switching to IgA isotypes (GO:0048297)|positive regulation of DNA-templated transcription, elongation (GO:0032786)|regulation of DNA recombination (GO:0000018)|regulation of DNA-templated transcription, elongation (GO:0032784)|replication fork processing (GO:0031297)|RNA processing (GO:0006396)|RNA splicing (GO:0008380)|signal transduction (GO:0007165)|transcription, DNA-templated (GO:0006351)|viral mRNA export from host cell nucleus (GO:0046784)	cytoplasm (GO:0005737)|intercellular bridge (GO:0045171)|nucleus (GO:0005634)|THO complex (GO:0000347)|THO complex part of transcription export complex (GO:0000445)|transcription export complex (GO:0000346)	DNA binding (GO:0003677)|RNA binding (GO:0003723)			breast(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(5)|ovary(1)|skin(1)|stomach(1)|urinary_tract(1)	20		all_cancers(4;0.0896)|Myeloproliferative disorder(11;0.0412)				GTCGGAGACATCTTCTCGGCTGC	0.67																																							.											.	THOC1-91	0									.																																			SO:0001582	initiator_codon_variant	9984	wholegene			GAGACATCTTCTC	AK055354	CCDS45820.1	18p11.32	2013-02-11			ENSG00000079134	ENSG00000079134		"""THO complex subunits"""	19070	protein-coding gene	gene with protein product		606930				11979277	Standard	NM_005131		Approved	P84, HPR1	uc002kkj.4	Q96FV9			18.37:g.268022_268024delTCT		Somatic	102	0		WXS	Illumina GAIIx	Phase_I	69	0	NM_005131	0	0	0	0	0	B2RBP6|Q15219|Q64I72|Q64I73	Frame_Shift_Del	DEL	ENST00000261600.6	37	CCDS45820.1																																																																																			.		0.670	THOC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000440348.5	NM_005131	
RNF165	494470	broad.mit.edu;ucsc.edu;bcgsc.ca	37	18	44013156	44013156	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5LD-01A-11D-A29I-10	TCGA-OR-A5LD-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d84ce93-4c12-49da-87b3-c36d44672d59	afc22b50-442d-4fde-93ce-df0c281205c9	g.chr18:44013156C>T	ENST00000269439.7	+	2	116	c.65C>T	c.(64-66)gCc>gTc	p.A22V	RNF165_ENST00000543885.1_Intron	NM_152470.2	NP_689683.2	Q6ZSG1	RN165_HUMAN	ring finger protein 165	22							zinc ion binding (GO:0008270)			NS(1)|large_intestine(4)|lung(6)	11				READ - Rectum adenocarcinoma(1;0.0873)		CTTCCAGGTGCCCCCTTTCAA	0.677																																					p.A22V		.											.	RNF165-90	0			c.C65T						.						49.0	36.0	41.0					18																	44013156		2203	4299	6502	SO:0001583	missense	494470	exon2			CAGGTGCCCCCTT	BC012190	CCDS32823.1, CCDS58621.1	18q21.1	2014-01-03			ENSG00000141622	ENSG00000141622		"""RING-type (C3HC4) zinc fingers"""	31696	protein-coding gene	gene with protein product							Standard	NR_046357		Approved	ARKL2, RNF111L2	uc002lcb.1	Q6ZSG1		ENST00000269439.7:c.65C>T	18.37:g.44013156C>T	ENSP00000269439:p.Ala22Val	Somatic	78	1		WXS	Illumina GAIIx	Phase_I	126	28	NM_152470	0	0	0	0	0	B3KVD1	Missense_Mutation	SNP	ENST00000269439.7	37	CCDS32823.1	.	.	.	.	.	.	.	.	.	.	C	20.7	4.034657	0.75617	.	.	ENSG00000141622	ENST00000269439	T	0.19806	2.12	5.36	5.36	0.76844	.	0.070233	0.56097	D	0.000036	T	0.27489	0.0675	L	0.56769	1.78	0.80722	D	1	B	0.09022	0.002	B	0.10450	0.005	T	0.04885	-1.0920	10	0.72032	D	0.01	-5.9537	19.0744	0.93154	0.0:1.0:0.0:0.0	.	22	Q6ZSG1	RN165_HUMAN	V	22	ENSP00000269439:A22V	ENSP00000269439:A22V	A	+	2	0	RNF165	42267154	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	4.217000	0.58547	2.515000	0.84797	0.462000	0.41574	GCC	.		0.677	RNF165-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000445358.1	NM_152470	
MUC16	94025	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	9045734	9045734	+	Missense_Mutation	SNP	G	G	C			TCGA-OR-A5LD-01A-11D-A29I-10	TCGA-OR-A5LD-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d84ce93-4c12-49da-87b3-c36d44672d59	afc22b50-442d-4fde-93ce-df0c281205c9	g.chr19:9045734G>C	ENST00000397910.4	-	5	36100	c.35897C>G	c.(35896-35898)aCt>aGt	p.T11966S		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	11968	Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						TCTCAAGATAGTGGTTGGACT	0.473																																					p.T11966S		.											.	MUC16-566	0			c.C35897G						.						203.0	199.0	200.0					19																	9045734		1992	4158	6150	SO:0001583	missense	94025	exon5			AAGATAGTGGTTG	AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.35897C>G	19.37:g.9045734G>C	ENSP00000381008:p.Thr11966Ser	Somatic	297	0		WXS	Illumina GAIIx	Phase_I	306	100	NM_024690	0	0	0	0	0	Q6ZQW5|Q96RK2	Missense_Mutation	SNP	ENST00000397910.4	37	CCDS54212.1	.	.	.	.	.	.	.	.	.	.	G	8.782	0.928395	0.18131	.	.	ENSG00000181143	ENST00000397910	T	0.02158	4.42	3.42	3.42	0.39159	.	.	.	.	.	T	0.04497	0.0123	N	0.24115	0.695	.	.	.	D	0.64830	0.994	P	0.58970	0.849	T	0.38950	-0.9637	8	0.87932	D	0	.	10.6434	0.45606	0.0:0.0:1.0:0.0	.	11966	B5ME49	.	S	11966	ENSP00000381008:T11966S	ENSP00000381008:T11966S	T	-	2	0	MUC16	8906734	0.020000	0.18652	0.006000	0.13384	0.031000	0.12232	1.701000	0.37825	2.217000	0.71921	0.555000	0.69702	ACT	.		0.473	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402806.1	NM_024690	
DNMT1	1786	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	10259655	10259655	+	Silent	SNP	G	G	A	rs200928585		TCGA-OR-A5LD-01A-11D-A29I-10	TCGA-OR-A5LD-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d84ce93-4c12-49da-87b3-c36d44672d59	afc22b50-442d-4fde-93ce-df0c281205c9	g.chr19:10259655G>A	ENST00000340748.4	-	26	2812	c.2577C>T	c.(2575-2577)gaC>gaT	p.D859D	DNMT1_ENST00000359526.4_Silent_p.D875D|DNMT1_ENST00000540357.1_Silent_p.D859D			P26358	DNMT1_HUMAN	DNA (cytosine-5-)-methyltransferase 1	859	BAH 1. {ECO:0000255|PROSITE- ProRule:PRU00370}.				cellular response to amino acid stimulus (GO:0071230)|chromatin modification (GO:0016568)|DNA methylation (GO:0006306)|gene silencing (GO:0016458)|maintenance of DNA methylation (GO:0010216)|negative regulation of histone H3-K9 methylation (GO:0051573)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of gene expression (GO:0010628)|positive regulation of histone H3-K4 methylation (GO:0051571)|regulation of cell proliferation (GO:0042127)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|pericentric heterochromatin (GO:0005721)|replication fork (GO:0005657)	chromatin binding (GO:0003682)|DNA (cytosine-5-)-methyltransferase activity (GO:0003886)|DNA binding (GO:0003677)|DNA-methyltransferase activity (GO:0009008)|methyl-CpG binding (GO:0008327)|RNA binding (GO:0003723)|zinc ion binding (GO:0008270)			breast(5)|endometrium(8)|kidney(5)|large_intestine(21)|lung(11)|ovary(2)|pancreas(1)|prostate(10)|skin(5)|stomach(1)|urinary_tract(1)	70			OV - Ovarian serous cystadenocarcinoma(20;1.59e-09)|Epithelial(33;2.86e-06)|all cancers(31;6.68e-06)		Azacitidine(DB00928)|Decitabine(DB01262)|Flucytosine(DB01099)|Procainamide(DB01035)	AGGTCTTCCCGTCGTCCCCCT	0.557													G|||	1	0.000199681	0.0008	0.0	5008	,	,		19451	0.0		0.0	False		,,,				2504	0.0				p.D875D		.											.	DNMT1-660	0			c.C2625T						.	G	,	1,4405	2.1+/-5.4	0,1,2202	140.0	105.0	117.0		2625,2577	-10.0	0.0	19		117	0,8600		0,0,4300	no	coding-synonymous,coding-synonymous	DNMT1	NM_001130823.1,NM_001379.2	,	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	,	875/1633,859/1617	10259655	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	1786	exon27			CTTCCCGTCGTCC	X63692	CCDS12228.1, CCDS45958.1	19p13.2	2014-09-17				ENSG00000130816	2.1.1.37		2976	protein-coding gene	gene with protein product		126375		DNMT		1594447	Standard	NM_001379		Approved	MCMT, CXXC9	uc010xlc.2	P26358		ENST00000340748.4:c.2577C>T	19.37:g.10259655G>A		Somatic	112	0		WXS	Illumina GAIIx	Phase_I	170	36	NM_001130823	0	0	0	0	0	A0AV63|B7ZLW6|Q9UHG5|Q9ULA2|Q9UMZ6	Silent	SNP	ENST00000340748.4	37	CCDS12228.1																																																																																			G|0.999;A|0.000		0.557	DNMT1-001	KNOWN	upstream_ATG|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451166.1	NM_001379	
OR7C1	26664	hgsc.bcm.edu	37	19	14910638	14910638	+	Frame_Shift_Del	DEL	A	A	-	rs534928853	byFrequency	TCGA-OR-A5LD-01A-11D-A29I-10	TCGA-OR-A5LD-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d84ce93-4c12-49da-87b3-c36d44672d59	afc22b50-442d-4fde-93ce-df0c281205c9	g.chr19:14910638delA	ENST00000248073.2	-	1	385	c.311delT	c.(310-312)ttcfs	p.F104fs	OR7A5_ENST00000601611.1_Intron	NM_198944.1	NP_945182.1	O76099	OR7C1_HUMAN	olfactory receptor, family 7, subfamily C, member 1	104					spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(2)|central_nervous_system(1)|endometrium(2)|large_intestine(8)|lung(2)|ovary(2)|prostate(1)	18						AAATGAAGTGAAAAAAAAAAT	0.443													|||unknown(HR)	63	0.0125799	0.0076	0.0043	5008	,	,		21296	0.0109		0.002	False		,,,				2504	0.0378				p.F104fs		.											.	OR7C1-70	0			c.311delT						.			3,45,4216		0,0,3,0,45,2084	59.0	60.0	60.0			2.6	0.1	19		61	16,32,8204		0,0,16,2,28,4080	no	codingComplex	OR7C1	NM_198944.1		0,0,19,2,73,6164	A1A1,A1A2,A1R,A2A2,A2R,RR		0.5817,1.1257,0.767			14910638	19,77,12420	2203	4300	6503	SO:0001589	frameshift_variant	26664	exon1			GAAGTGAAAAAAA	X89676	CCDS12317.1	19p13.1	2012-08-09						"""GPCR / Class A : Olfactory receptors"""	8373	protein-coding gene	gene with protein product				OR7C4			Standard	NM_198944		Approved	OR19-5	uc010xnz.2	O76099		ENST00000248073.2:c.311delT	19.37:g.14910638delA	ENSP00000248073:p.Phe104fs	Somatic	131	1		WXS	Illumina GAIIx	Phase_I	483	11	NM_198944	0	0	0	0	0	Q15621|Q6IFP2|Q96R94	Frame_Shift_Del	DEL	ENST00000248073.2	37	CCDS12317.1																																																																																			.		0.443	OR7C1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466519.1		
UQCRFS1	7386	hgsc.bcm.edu	37	19	29704002	29704002	+	Silent	SNP	T	T	C	rs11666764	byFrequency	TCGA-OR-A5LD-01A-11D-A29I-10	TCGA-OR-A5LD-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d84ce93-4c12-49da-87b3-c36d44672d59	afc22b50-442d-4fde-93ce-df0c281205c9	g.chr19:29704002T>C	ENST00000304863.4	-	1	446	c.24A>G	c.(22-24)tcA>tcG	p.S8S	CTB-32O4.2_ENST00000587859.1_lincRNA	NM_006003.2	NP_005994.2	P47985	UCRI_HUMAN	ubiquinol-cytochrome c reductase, Rieske iron-sulfur polypeptide 1	8					cellular metabolic process (GO:0044237)|respiratory electron transport chain (GO:0022904)|response to antibiotic (GO:0046677)|response to drug (GO:0042493)|response to hormone (GO:0009725)|small molecule metabolic process (GO:0044281)	mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex III (GO:0005750)|mitochondrion (GO:0005739)	2 iron, 2 sulfur cluster binding (GO:0051537)|metal ion binding (GO:0046872)|ubiquinol-cytochrome-c reductase activity (GO:0008121)			endometrium(4)|kidney(2)|large_intestine(2)|lung(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	14	Breast(6;0.0545)|Esophageal squamous(110;0.239)		Lung(7;0.092)			CGAACGGGCCTGAGCGGGATG	0.751													C|||	4781	0.954673	0.9433	0.9294	5008	,	,		9645	0.999		0.9195	False		,,,				2504	0.9785				p.S8S		.											.	UQCRFS1-226	0			c.A24G						.						1.0	2.0	2.0					19																	29704002		760	1811	2571	SO:0001819	synonymous_variant	7386	exon1			CGGGCCTGAGCGG	BC010035	CCDS12415.1	19q12	2011-07-04			ENSG00000169021	ENSG00000169021	1.10.2.2	"""Mitochondrial respiratory chain complex / Complex III"""	12587	protein-coding gene	gene with protein product	"""cytochrome b-c1 complex subunit 5"""	191327				8088805	Standard	NM_006003		Approved	RIS1, RIP1, UQCR5, RISP	uc002nsd.2	P47985		ENST00000304863.4:c.24A>G	19.37:g.29704002T>C		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	7	6	NM_006003	0	0	0	0	0	A8K519|Q6NVX5|Q9UPH2	Silent	SNP	ENST00000304863.4	37	CCDS12415.1																																																																																			T|0.072;C|0.928		0.751	UQCRFS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458563.1	NM_006003	
UQCRFS1	7386	hgsc.bcm.edu	37	19	29704010	29704010	+	Missense_Mutation	SNP	A	A	C	rs8100724	byFrequency	TCGA-OR-A5LD-01A-11D-A29I-10	TCGA-OR-A5LD-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d84ce93-4c12-49da-87b3-c36d44672d59	afc22b50-442d-4fde-93ce-df0c281205c9	g.chr19:29704010A>C	ENST00000304863.4	-	1	438	c.16T>G	c.(16-18)Tcc>Gcc	p.S6A	CTB-32O4.2_ENST00000587859.1_lincRNA	NM_006003.2	NP_005994.2	P47985	UCRI_HUMAN	ubiquinol-cytochrome c reductase, Rieske iron-sulfur polypeptide 1	6			S -> A (in dbSNP:rs8100724). {ECO:0000269|PubMed:14702039, ECO:0000269|PubMed:15489334, ECO:0000269|PubMed:2158323, ECO:0000269|PubMed:7721092}.		cellular metabolic process (GO:0044237)|respiratory electron transport chain (GO:0022904)|response to antibiotic (GO:0046677)|response to drug (GO:0042493)|response to hormone (GO:0009725)|small molecule metabolic process (GO:0044281)	mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex III (GO:0005750)|mitochondrion (GO:0005739)	2 iron, 2 sulfur cluster binding (GO:0051537)|metal ion binding (GO:0046872)|ubiquinol-cytochrome-c reductase activity (GO:0008121)			endometrium(4)|kidney(2)|large_intestine(2)|lung(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	14	Breast(6;0.0545)|Esophageal squamous(110;0.239)		Lung(7;0.092)			CCTGAGCGGGATGCTACCGAC	0.746													C|||	4777	0.953874	0.944	0.9265	5008	,	,		9603	0.999		0.9165	False		,,,				2504	0.9785				p.S6A		.											.	UQCRFS1-226	0			c.T16G						.						1.0	2.0	2.0					19																	29704010		816	1888	2704	SO:0001583	missense	7386	exon1			AGCGGGATGCTAC	BC010035	CCDS12415.1	19q12	2011-07-04			ENSG00000169021	ENSG00000169021	1.10.2.2	"""Mitochondrial respiratory chain complex / Complex III"""	12587	protein-coding gene	gene with protein product	"""cytochrome b-c1 complex subunit 5"""	191327				8088805	Standard	NM_006003		Approved	RIS1, RIP1, UQCR5, RISP	uc002nsd.2	P47985		ENST00000304863.4:c.16T>G	19.37:g.29704010A>C	ENSP00000306397:p.Ser6Ala	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	8	8	NM_006003	0	0	0	0	0	A8K519|Q6NVX5|Q9UPH2	Missense_Mutation	SNP	ENST00000304863.4	37	CCDS12415.1	2044	0.9358974358974359	461	0.9369918699186992	326	0.9005524861878453	569	0.9947552447552448	688	0.9076517150395779	C	0.037	-1.301919	0.01353	.	.	ENSG00000169021	ENST00000304863	T	0.36520	1.25	4.42	-0.0799	0.13708	Ubiquinol-cytochrome c reductase 8kDa, N-terminal (1);Globular protein, non-globular alpha/beta subunit (1);	0.198900	0.43579	N	0.000544	T	0.00012	0.0000	N	0.00707	-1.245	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.31696	-0.9934	9	0.02654	T	1	.	4.4059	0.11409	0.1479:0.436:0.0:0.4161	rs8100724;rs17856012;rs17856322;rs60176823;rs8100724	6	P47985	UCRI_HUMAN	A	6	ENSP00000306397:S6A	ENSP00000306397:S6A	S	-	1	0	UQCRFS1	34395850	0.363000	0.24989	0.510000	0.27712	0.005000	0.04900	0.594000	0.24014	-0.304000	0.08843	-1.900000	0.00529	TCC	A|0.065;C|0.935		0.746	UQCRFS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458563.1	NM_006003	
ZNF420	147923	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	37619839	37619839	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5LD-01A-11D-A29I-10	TCGA-OR-A5LD-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d84ce93-4c12-49da-87b3-c36d44672d59	afc22b50-442d-4fde-93ce-df0c281205c9	g.chr19:37619839G>A	ENST00000337995.3	+	5	2161	c.1946G>A	c.(1945-1947)gGg>gAg	p.G649E	ZNF420_ENST00000304239.7_Intron|ZNF585A_ENST00000588723.1_Intron|CTC-454I21.4_ENST00000587645.1_RNA|ZNF420_ENST00000586540.1_Intron	NM_144689.3	NP_653290.2	Q8TAQ5	ZN420_HUMAN	zinc finger protein 420	649					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(2)|endometrium(2)|large_intestine(9)|lung(10)|prostate(1)|skin(3)	27			COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)			AAGGAATGTGGGAAGGCCTTT	0.388																																					p.G649E		.											.	ZNF420-90	0			c.G1946A						.						84.0	82.0	83.0					19																	37619839		2203	4299	6502	SO:0001583	missense	147923	exon5			AATGTGGGAAGGC	AK056695	CCDS12498.1	19q13.12	2013-01-08			ENSG00000197050	ENSG00000197050		"""Zinc fingers, C2H2-type"", ""-"""	20649	protein-coding gene	gene with protein product							Standard	NM_144689		Approved	FLJ32191	uc002ofl.3	Q8TAQ5	OTTHUMG00000048168	ENST00000337995.3:c.1946G>A	19.37:g.37619839G>A	ENSP00000338770:p.Gly649Glu	Somatic	60	0		WXS	Illumina GAIIx	Phase_I	88	22	NM_144689	0	0	1	1	0	B2RDY6|Q96ML5	Missense_Mutation	SNP	ENST00000337995.3	37	CCDS12498.1	.	.	.	.	.	.	.	.	.	.	G	12.07	1.827427	0.32329	.	.	ENSG00000197050	ENST00000337995	T	0.07114	3.22	4.46	3.43	0.39272	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.09862	0.0242	L	0.60012	1.86	0.80722	D	1	B	0.16396	0.017	B	0.17433	0.018	T	0.08249	-1.0731	8	.	.	.	.	11.0362	0.47802	0.0932:0.0:0.9068:0.0	.	649	Q8TAQ5	ZN420_HUMAN	E	649	ENSP00000338770:G649E	.	G	+	2	0	ZNF420	42311679	0.000000	0.05858	1.000000	0.80357	0.998000	0.95712	0.365000	0.20348	1.095000	0.41419	0.655000	0.94253	GGG	.		0.388	ZNF420-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109587.3	NM_144689	
ADCK4	79934	hgsc.bcm.edu;broad.mit.edu	37	19	41220217	41220217	+	Missense_Mutation	SNP	C	C	G	rs548830266		TCGA-OR-A5LD-01A-11D-A29I-10	TCGA-OR-A5LD-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d84ce93-4c12-49da-87b3-c36d44672d59	afc22b50-442d-4fde-93ce-df0c281205c9	g.chr19:41220217C>G	ENST00000324464.3	-	3	489	c.188G>C	c.(187-189)cGg>cCg	p.R63P	ADCK4_ENST00000450541.1_Missense_Mutation_p.R63P|ITPKC_ENST00000263370.2_5'Flank|ADCK4_ENST00000243583.6_Missense_Mutation_p.R63P	NM_024876.3	NP_079152.3	Q96D53	ADCK4_HUMAN	aarF domain containing kinase 4	63						integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	protein serine/threonine kinase activity (GO:0004674)			NS(1)|breast(1)|endometrium(3)|large_intestine(3)|lung(6)|stomach(2)|urinary_tract(1)	17			Lung(22;9.49e-05)|LUSC - Lung squamous cell carcinoma(20;0.000219)			ACGGGCCTCCCGTGCCCTGCG	0.617																																					p.R63P		.											.	ADCK4-319	0			c.G188C						.						54.0	57.0	56.0					19																	41220217		2203	4300	6503	SO:0001583	missense	79934	exon3			GCCTCCCGTGCCC	AK022291	CCDS12562.1, CCDS46081.1	19q13.2	2008-02-05				ENSG00000123815			19041	protein-coding gene	gene with protein product		615567					Standard	NM_024876		Approved	FLJ12229, COQ8	uc002oor.2	Q96D53		ENST00000324464.3:c.188G>C	19.37:g.41220217C>G	ENSP00000315118:p.Arg63Pro	Somatic	28	0		WXS	Illumina GAIIx	Phase_I	35	8	NM_001142555	0	0	0	0	0	Q8TAJ1|Q9HA52	Missense_Mutation	SNP	ENST00000324464.3	37	CCDS12562.1	.	.	.	.	.	.	.	.	.	.	c	19.19	3.778841	0.70107	.	.	ENSG00000123815	ENST00000324464;ENST00000450541;ENST00000243583	T;T;T	0.77877	-1.13;-1.07;-1.07	5.16	5.16	0.70880	.	0.000000	0.85682	D	0.000000	D	0.86435	0.5932	M	0.68317	2.08	0.42313	D	0.992228	D;D	0.89917	1.0;0.999	D;D	0.76071	0.979;0.987	D	0.86805	0.1994	10	0.51188	T	0.08	-10.9034	15.9215	0.79580	0.0:1.0:0.0:0.0	.	63;63	Q96D53;Q96D53-2	ADCK4_HUMAN;.	P	63	ENSP00000315118:R63P;ENSP00000412839:R63P;ENSP00000243583:R63P	ENSP00000243583:R63P	R	-	2	0	ADCK4	45912057	1.000000	0.71417	0.997000	0.53966	0.575000	0.36095	4.023000	0.57211	2.567000	0.86603	0.556000	0.70494	CGG	.		0.617	ADCK4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000462731.1	NM_024876	
ERF	2077	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	42753866	42753866	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5LD-01A-11D-A29I-10	TCGA-OR-A5LD-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d84ce93-4c12-49da-87b3-c36d44672d59	afc22b50-442d-4fde-93ce-df0c281205c9	g.chr19:42753866G>A	ENST00000222329.4	-	4	555	c.398C>T	c.(397-399)cCg>cTg	p.P133L	ERF_ENST00000595941.1_5'Flank|ERF_ENST00000440177.2_Missense_Mutation_p.P58L|AC006486.9_ENST00000594664.1_Intron	NM_006494.2	NP_006485.2	P50548	ERF_HUMAN	Ets2 repressor factor	133					cell cycle (GO:0007049)|cell differentiation (GO:0030154)|chorio-allantoic fusion (GO:0060710)|ectodermal cell differentiation (GO:0010668)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription from RNA polymerase II promoter (GO:0006366)|trophoblast giant cell differentiation (GO:0060707)	cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|transcription corepressor activity (GO:0003714)			central_nervous_system(1)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(7)|skin(1)	17		Prostate(69;0.00682)				CGGCACTGGCGGGGCACTCTG	0.672																																					p.P133L		.											.	ERF-658	0			c.C398T						.						45.0	44.0	45.0					19																	42753866		2203	4300	6503	SO:0001583	missense	2077	exon4			ACTGGCGGGGCAC	U58535	CCDS12600.1	19q13	2008-07-16				ENSG00000105722			3444	protein-coding gene	gene with protein product	"""Ets2 repressor factor"""	611888				7588608, 9192842	Standard	XM_005258644		Approved	PE-2, PE2	uc002ote.4	P50548		ENST00000222329.4:c.398C>T	19.37:g.42753866G>A	ENSP00000222329:p.Pro133Leu	Somatic	96	0		WXS	Illumina GAIIx	Phase_I	103	23	NM_006494	0	0	2	4	2	B2RAP1|B7Z4R0|Q59G38|Q9UPI7	Missense_Mutation	SNP	ENST00000222329.4	37	CCDS12600.1	.	.	.	.	.	.	.	.	.	.	G	19.78	3.890356	0.72524	.	.	ENSG00000105722	ENST00000222329;ENST00000440177	T;T	0.52526	0.66;0.66	4.72	4.72	0.59763	.	0.059694	0.64402	D	0.000002	T	0.40448	0.1117	L	0.54323	1.7	0.80722	D	1	P	0.35551	0.509	B	0.18561	0.022	T	0.50355	-0.8838	10	0.87932	D	0	.	15.565	0.76284	0.0:0.0:1.0:0.0	.	133	P50548	ERF_HUMAN	L	133;58	ENSP00000222329:P133L;ENSP00000388173:P58L	ENSP00000222329:P133L	P	-	2	0	ERF	47445706	1.000000	0.71417	0.976000	0.42696	0.971000	0.66376	9.186000	0.94906	2.627000	0.88993	0.561000	0.74099	CCG	.		0.672	ERF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463684.1	NM_006494	
ZNF226	7769	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	19	44680835	44680837	+	In_Frame_Del	DEL	TCA	TCA	-	rs61742482		TCGA-OR-A5LD-01A-11D-A29I-10	TCGA-OR-A5LD-10A-01D-A29L-10	TCA	TCA	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d84ce93-4c12-49da-87b3-c36d44672d59	afc22b50-442d-4fde-93ce-df0c281205c9	g.chr19:44680835_44680837delTCA	ENST00000590089.1	+	7	1787_1789	c.1420_1422delTCA	c.(1420-1422)tcadel	p.S474del	ZNF226_ENST00000454662.2_In_Frame_Del_p.S474del|ZNF226_ENST00000588883.1_3'UTR|ZNF226_ENST00000337433.5_In_Frame_Del_p.S474del			Q9NYT6	ZN226_HUMAN	zinc finger protein 226	474					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)						Prostate(69;0.0352)|all_neural(266;0.202)				TGGAGAGAAGTCATACATATGTA	0.448																																					p.474_474del	Pancreas(115;581 1665 13228 19278 50070)	.											.	.	0			c.1420_1422del						.																																			SO:0001651	inframe_deletion	7769	exon6			GAGAAGTCATACA	AF024707	CCDS46102.1, CCDS46103.1	19q13.31	2013-01-08	2012-09-11	2012-09-11	ENSG00000167380	ENSG00000167380		"""Zinc fingers, C2H2-type"", ""-"""	13019	protein-coding gene	gene with protein product							Standard	NM_001146220		Approved		uc002oyp.3	Q9NYT6		ENST00000590089.1:c.1420_1422delTCA	19.37:g.44680835_44680837delTCA	ENSP00000465121:p.Ser474del	Somatic	131	0		WXS	Illumina GAIIx	Phase_I	141	20	NM_001032372	0	0	0	0	0	Q8WWE6|Q96TE6|Q9NS44	In_Frame_Del	DEL	ENST00000590089.1	37	CCDS46102.1																																																																																			.		0.448	ZNF226-005	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000460712.1		
SYMPK	8189	broad.mit.edu	37	19	46321272	46321272	+	Missense_Mutation	SNP	T	T	G			TCGA-OR-A5LD-01A-11D-A29I-10	TCGA-OR-A5LD-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d84ce93-4c12-49da-87b3-c36d44672d59	afc22b50-442d-4fde-93ce-df0c281205c9	g.chr19:46321272T>G	ENST00000245934.7	-	23	3270	c.3026A>C	c.(3025-3027)tAc>tCc	p.Y1009S	RSPH6A_ENST00000221538.3_5'Flank|RSPH6A_ENST00000597055.1_5'Flank|SYMPK_ENST00000598155.1_5'UTR	NM_004819.2	NP_004810.2	Q92797	SYMPK_HUMAN	symplekin	1009					cell adhesion (GO:0007155)|mRNA polyadenylation (GO:0006378)|positive regulation of protein dephosphorylation (GO:0035307)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|tight junction (GO:0005923)				breast(3)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(7)|liver(1)|lung(25)|ovary(1)|urinary_tract(1)	45		all_neural(266;0.0299)|Ovarian(192;0.0308)		OV - Ovarian serous cystadenocarcinoma(262;0.00509)|GBM - Glioblastoma multiforme(486;0.0593)		CAGGCGGGGGTACATGGTCAG	0.637																																					p.Y1009S		.											.	SYMPK-91	0			c.A3026C						.						46.0	38.0	41.0					19																	46321272		2196	4295	6491	SO:0001583	missense	8189	exon23			CGGGGGTACATGG	U49240	CCDS12676.2	19q13.3	2008-02-05			ENSG00000125755	ENSG00000125755			22935	protein-coding gene	gene with protein product		602388				9330635	Standard	NM_004819		Approved	SYM, SPK	uc002pdn.3	Q92797	OTTHUMG00000150151	ENST00000245934.7:c.3026A>C	19.37:g.46321272T>G	ENSP00000245934:p.Tyr1009Ser	Somatic	74	7		WXS	Illumina GAIIx	Phase_I	100	18	NM_004819	1	0	29	31	1	O00521|O00689|O00733|Q59GT5|Q8N2U5	Missense_Mutation	SNP	ENST00000245934.7	37	CCDS12676.2	.	.	.	.	.	.	.	.	.	.	T	25.9	4.683927	0.88639	.	.	ENSG00000125755	ENST00000245934	T	0.65916	-0.18	5.33	5.33	0.75918	.	0.000000	0.85682	D	0.000000	T	0.80325	0.4602	M	0.85041	2.73	0.80722	D	1	D	0.76494	0.999	D	0.77557	0.99	D	0.83582	0.0118	10	0.72032	D	0.01	.	13.295	0.60292	0.0:0.0:0.0:1.0	.	1009	Q92797	SYMPK_HUMAN	S	1009	ENSP00000245934:Y1009S	ENSP00000245934:Y1009S	Y	-	2	0	SYMPK	51013112	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.467000	0.80930	2.039000	0.60335	0.454000	0.30748	TAC	.		0.637	SYMPK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316581.1	NM_004819	
MIR512-2	574459	broad.mit.edu;bcgsc.ca;mdanderson.org	37	19	54172505	54172505	+	RNA	SNP	C	C	T			TCGA-OR-A5LD-01A-11D-A29I-10	TCGA-OR-A5LD-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d84ce93-4c12-49da-87b3-c36d44672d59	afc22b50-442d-4fde-93ce-df0c281205c9	g.chr19:54172505C>T	ENST00000384912.1	+	0	95				MIR1323_ENST00000408090.1_RNA|MIR512-1_ENST00000384913.1_RNA	NR_030180.1|NR_030181.1				microRNA 512-2																		CTGAGGCGAGCACCGAAAAAA	0.572																																					.		.											.	.	0			.						.						47.0	44.0	45.0					19																	54172505		1555	3571	5126			574459	.			GGCGAGCACCGAA			19q13.42	2011-09-12		2008-12-18	ENSG00000207644	ENSG00000207644		"""ncRNAs / Micro RNAs"""	32091	non-coding RNA	RNA, micro				MIRN512-2			Standard	NR_030181		Approved	hsa-mir-512-2	uc021uzj.1				19.37:g.54172505C>T		Somatic	169	0		WXS	Illumina GAIIx	Phase_I	205	35	.	0	0	0	0	0		RNA	SNP	ENST00000384912.1	37																																																																																				.		0.572	MIR512-2-201	KNOWN	basic	miRNA	miRNA		NR_030181	
LILRB2	10288	broad.mit.edu;bcgsc.ca	37	19	54783810	54783810	+	Missense_Mutation	SNP	T	T	C			TCGA-OR-A5LD-01A-11D-A29I-10	TCGA-OR-A5LD-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d84ce93-4c12-49da-87b3-c36d44672d59	afc22b50-442d-4fde-93ce-df0c281205c9	g.chr19:54783810T>C	ENST00000391749.4	-	4	462	c.191A>G	c.(190-192)aAa>aGa	p.K64R	LILRB2_ENST00000391748.1_Missense_Mutation_p.K64R|LILRB2_ENST00000391746.1_Missense_Mutation_p.K64R|LILRB2_ENST00000434421.1_5'UTR|LILRB2_ENST00000314446.5_Missense_Mutation_p.K64R|MIR4752_ENST00000579672.1_RNA|LILRB2_ENST00000471216.1_5'UTR	NM_001278406.1	NP_001265335.1	Q8N423	LIRB2_HUMAN	leukocyte immunoglobulin-like receptor, subfamily B (with TM and ITIM domains), member 2	64	Ig-like C2-type 1.				cell surface receptor signaling pathway (GO:0007166)|cell-cell signaling (GO:0007267)|cellular defense response (GO:0006968)|cellular response to lipopolysaccharide (GO:0071222)|Fc receptor mediated inhibitory signaling pathway (GO:0002774)|heterotypic cell-cell adhesion (GO:0034113)|immune response (GO:0006955)|immune response-inhibiting cell surface receptor signaling pathway (GO:0002767)|negative regulation of antigen processing and presentation (GO:0002578)|negative regulation of calcium ion transport (GO:0051926)|negative regulation of T cell proliferation (GO:0042130)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of regulatory T cell differentiation (GO:0045591)|positive regulation of T cell proliferation (GO:0042102)|positive regulation of T cell tolerance induction (GO:0002666)|regulation of dendritic cell differentiation (GO:2001198)|regulation of immune response (GO:0050776)|signal transduction (GO:0007165)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	cell adhesion molecule binding (GO:0050839)|inhibitory MHC class I receptor activity (GO:0032396)|MHC class I protein binding (GO:0042288)|MHC class Ib protein binding (GO:0023029)|protein phosphatase 1 binding (GO:0008157)|receptor activity (GO:0004872)			breast(2)|endometrium(3)|kidney(1)|large_intestine(4)|lung(30)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	44	Ovarian(34;0.19)			GBM - Glioblastoma multiforme(193;0.105)		TGCTGATTTTTTCTCCCTATA	0.547																																					p.K64R		.											.	LILRB2-91	0			c.A191G						.						209.0	202.0	205.0					19																	54783810		2203	4300	6503	SO:0001583	missense	10288	exon4			GATTTTTTCTCCC	AF000574	CCDS12886.1, CCDS42612.1, CCDS62791.1, CCDS62792.1	19q13.4	2013-01-11			ENSG00000131042	ENSG00000131042		"""Leukocyte immunoglobulin-like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6606	protein-coding gene	gene with protein product		604815				9151699, 9079806	Standard	XM_006722966		Approved	LIR-2, ILT4, MIR-10, LIR2, CD85d, MIR10	uc002qfb.3	Q8N423	OTTHUMG00000064896	ENST00000391749.4:c.191A>G	19.37:g.54783810T>C	ENSP00000375629:p.Lys64Arg	Somatic	212	0		WXS	Illumina GAIIx	Phase_I	209	6	NM_005874	0	0	0	0	0	A8MU67|C9JF29|O75017|Q8NHJ7|Q8NHJ8	Missense_Mutation	SNP	ENST00000391749.4	37	CCDS12886.1	.	.	.	.	.	.	.	.	.	.	T	6.581	0.475549	0.12521	.	.	ENSG00000131042	ENST00000391748;ENST00000314446;ENST00000391749;ENST00000391746	T;T;T;T	0.09445	2.98;2.98;2.98;2.98	2.48	-1.63	0.08345	Immunoglobulin subtype (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	1.358570	0.04987	N	0.466614	T	0.08492	0.0211	L	0.31065	0.9	0.80722	D	1	B;B;B	0.06786	0.001;0.001;0.0	B;B;B	0.14023	0.01;0.007;0.007	T	0.14227	-1.0480	10	0.38643	T	0.18	.	6.127	0.20184	0.0:0.5979:0.0:0.4021	.	64;81;64	A8MU67;E7EVY1;Q8N423	.;.;LIRB2_HUMAN	R	64	ENSP00000375628:K64R;ENSP00000319960:K64R;ENSP00000375629:K64R;ENSP00000375626:K64R	ENSP00000319960:K64R	K	-	2	0	LILRB2	59475622	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-0.977000	0.03782	-0.393000	0.07739	-1.473000	0.01005	AAA	.		0.547	LILRB2-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000139510.1		
FAM71E2	284418	broad.mit.edu	37	19	55869916	55869916	+	Missense_Mutation	SNP	C	C	T	rs370183321		TCGA-OR-A5LD-01A-11D-A29I-10	TCGA-OR-A5LD-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d84ce93-4c12-49da-87b3-c36d44672d59	afc22b50-442d-4fde-93ce-df0c281205c9	g.chr19:55869916C>T	ENST00000424985.3	-	9	2513	c.2320G>A	c.(2320-2322)Gag>Aag	p.E774K	CTD-2105E13.6_ENST00000591954.3_Silent_p.A323A	NM_001145402.1	NP_001138874.1	Q8N5Q1	F71E2_HUMAN	family with sequence similarity 71, member E2	774										NS(1)|breast(3)|endometrium(2)|kidney(1)|skin(1)	8						TCCTTCATCTCGCCCCATGGC	0.662																																					p.E774K		.											.	.	0			c.G2320A						.						20.0	21.0	20.0					19																	55869916		692	1591	2283	SO:0001583	missense	284418	exon9			TCATCTCGCCCCA	AL834316		19q13.42	2014-04-02	2007-11-20	2007-11-20	ENSG00000180043	ENSG00000180043			25278	protein-coding gene	gene with protein product			"""chromosome 19 open reading frame 16"""	C19orf16			Standard	NM_001145402		Approved	DKFZp434G1729	uc002qkr.2	Q8N5Q1	OTTHUMG00000170357	ENST00000424985.3:c.2320G>A	19.37:g.55869916C>T	ENSP00000398617:p.Glu774Lys	Somatic	48	0		WXS	Illumina GAIIx	Phase_I	77	3	NM_001145402	0	0	0	0	0	Q8ND99	Missense_Mutation	SNP	ENST00000424985.3	37		.	.	.	.	.	.	.	.	.	.	-	0.970	-0.700366	0.03279	.	.	ENSG00000180043	ENST00000424985	T	0.12774	2.65	3.4	-1.81	0.07882	.	.	.	.	.	T	0.04048	0.0113	N	0.08118	0	0.09310	N	1	P	0.35011	0.48	B	0.21917	0.037	T	0.32375	-0.9909	9	0.38643	T	0.18	.	0.7897	0.01055	0.1795:0.3836:0.1906:0.2462	.	774	Q8N5Q1	F71E2_HUMAN	K	774	ENSP00000398617:E774K	ENSP00000398617:E774K	E	-	1	0	FAM71E2	60561728	0.004000	0.15560	0.000000	0.03702	0.004000	0.04260	0.593000	0.23999	-0.356000	0.08187	0.306000	0.20318	GAG	.		0.662	FAM71E2-010	NOVEL	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000409063.4	NM_001145402	
ZNF787	126208	hgsc.bcm.edu	37	19	56599438	56599440	+	In_Frame_Del	DEL	TCG	TCG	-	rs5828672|rs71696054	byFrequency	TCGA-OR-A5LD-01A-11D-A29I-10	TCGA-OR-A5LD-10A-01D-A29L-10	TCG	TCG	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d84ce93-4c12-49da-87b3-c36d44672d59	afc22b50-442d-4fde-93ce-df0c281205c9	g.chr19:56599438_56599440delTCG	ENST00000270459.3	-	3	1219_1221	c.1101_1103delCGA	c.(1099-1104)gacgag>gag	p.D367del		NM_001002836.2	NP_001002836	Q6DD87	ZN787_HUMAN	zinc finger protein 787	367					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(1)|lung(2)|pancreas(1)	5		Colorectal(82;3.46e-05)|Ovarian(87;0.0822)|Renal(1328;0.157)		GBM - Glioblastoma multiforme(193;0.0559)		GCCCGCGGCCTCGTCGTCGTCGT	0.778														4509	0.900359	0.9939	0.732	5008	,	,		3238	0.7252		0.9821	False		,,,				2504	0.9898				p.367_368del		.											.	ZNF787-69	0			c.1101_1103del						.																																			SO:0001651	inframe_deletion	126208	exon3			GCGGCCTCGTCGT	BC077728, AF000560	CCDS42634.1	19q13.42	2013-01-08				ENSG00000142409		"""Zinc fingers, C2H2-type"""	26998	protein-coding gene	gene with protein product							Standard	NM_001002836		Approved		uc010eth.1	Q6DD87		ENST00000270459.3:c.1101_1103delCGA	19.37:g.56599447_56599449delTCG	ENSP00000270459:p.Asp367del	Somatic	3	3		WXS	Illumina GAIIx	Phase_I	28	27	NM_001002836	0	0	0	0	0	O00455	In_Frame_Del	DEL	ENST00000270459.3	37	CCDS42634.1																																																																																			.		0.778	ZNF787-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000457498.1	NM_001002836	
TPO	7173	hgsc.bcm.edu	37	2	1481231	1481231	+	Missense_Mutation	SNP	G	G	C	rs2175977	byFrequency	TCGA-OR-A5LD-01A-11D-A29I-10	TCGA-OR-A5LD-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d84ce93-4c12-49da-87b3-c36d44672d59	afc22b50-442d-4fde-93ce-df0c281205c9	g.chr2:1481231G>C	ENST00000345913.4	+	8	1284	c.1193G>C	c.(1192-1194)aGc>aCc	p.S398T	TPO_ENST00000497517.2_Intron|TPO_ENST00000337415.3_Missense_Mutation_p.S398T|TPO_ENST00000382198.1_Intron|TPO_ENST00000349624.3_Intron|TPO_ENST00000346956.3_Missense_Mutation_p.S398T|TPO_ENST00000329066.4_Missense_Mutation_p.S398T|TPO_ENST00000382201.3_Missense_Mutation_p.S398T	NM_000547.5	NP_000538.3	P07202	PERT_HUMAN	thyroid peroxidase	398			S -> T (in dbSNP:rs2175977). {ECO:0000269|PubMed:7550241}.		cellular nitrogen compound metabolic process (GO:0034641)|embryonic hemopoiesis (GO:0035162)|hormone biosynthetic process (GO:0042446)|hydrogen peroxide catabolic process (GO:0042744)|small molecule metabolic process (GO:0044281)|thyroid hormone generation (GO:0006590)	extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|heme binding (GO:0020037)|iodide peroxidase activity (GO:0004447)|peroxidase activity (GO:0004601)			breast(1)|central_nervous_system(3)|endometrium(8)|kidney(4)|large_intestine(14)|liver(2)|lung(33)|ovary(8)|pancreas(6)|prostate(4)|skin(7)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	95	all_hematologic(175;0.0487)|Acute lymphoblastic leukemia(172;0.0627)	all_cancers(51;0.0338)		all cancers(51;0.0356)|OV - Ovarian serous cystadenocarcinoma(76;0.0748)|Epithelial(75;0.12)	Carbimazole(DB00389)|Dextrothyroxine(DB00509)|Methimazole(DB00763)|Propylthiouracil(DB00550)	GGCCGCGCCAGCGAGGTCCCC	0.761													G|||	3557	0.710264	0.8185	0.6571	5008	,	,		9157	0.7758		0.6034	False		,,,				2504	0.6442				p.S398T		.											.	TPO-332	0			c.G1193C						.	G	THR/SER,THR/SER,THR/SER,THR/SER,THR/SER,	2498,394		1072,354,20	2.0	2.0	2.0		1193,1193,1193,1193,1193,	4.1	1.0	2	dbSNP_96	2	4199,1477		1511,1177,150	no	missense,missense,missense,missense,missense,intron	TPO	NM_000547.5,NM_001206744.1,NM_001206745.1,NM_175719.3,NM_175721.3,NM_175722.3	58,58,58,58,58,	2583,1531,170	CC,CG,GG		26.0218,13.6238,21.8371	probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging,	398/934,398/934,398/877,398/877,398/890,	1481231	6697,1871	1446	2838	4284	SO:0001583	missense	7173	exon8			GCGCCAGCGAGGT		CCDS1643.1, CCDS1644.1, CCDS1646.1	2p25	2008-02-05			ENSG00000115705	ENSG00000115705	1.11.1.7		12015	protein-coding gene	gene with protein product		606765					Standard	NM_175722		Approved	TPX	uc002qww.3	P07202	OTTHUMG00000090271	ENST00000345913.4:c.1193G>C	2.37:g.1481231G>C	ENSP00000318820:p.Ser398Thr	Somatic	2	0		WXS	Illumina GAIIx	Phase_I	11	9	NM_175719	0	0	0	0	0	P09934|P09935|Q8IUL0|Q8NF94|Q8NF95|Q8NF96|Q8NF97|Q8TCI9	Missense_Mutation	SNP	ENST00000345913.4	37	CCDS1643.1	1512|1512	0.6923076923076923|0.6923076923076923	388|388	0.7886178861788617|0.7886178861788617	227|227	0.6270718232044199|0.6270718232044199	438|438	0.7657342657342657|0.7657342657342657	459|459	0.6055408970976254|0.6055408970976254	G|G	18.72|18.72	3.683431|3.683431	0.68157|0.68157	0.863762|0.863762	0.739782|0.739782	ENSG00000115705|ENSG00000115705	ENST00000536482|ENST00000337415;ENST00000345913;ENST00000346956;ENST00000329066;ENST00000382201;ENST00000422464	.|T;T;T;T;T;T	.|0.73897	.|-0.79;-0.79;-0.79;-0.79;-0.79;-0.79	4.99|4.99	4.08|4.08	0.47627|0.47627	.|.	.|0.142496	.|0.64402	.|N	.|0.000004	T|T	0.00012|0.00012	0.0000|0.0000	M|M	0.62723|0.62723	1.935|1.935	0.09310|0.09310	P|P	1.0|1.0	.|D;D;D	.|0.76494	.|0.998;0.998;0.999	.|D;D;D	.|0.69654	.|0.956;0.94;0.965	T|T	0.30060|0.30060	-0.9991|-0.9991	5|9	0.48119|0.56958	T|D	0.1|0.05	-48.0867|-48.0867	8.6411|8.6411	0.33978|0.33978	0.08:0.1541:0.7659:0.0|0.08:0.1541:0.7659:0.0	rs2175977|rs2175977	.|398;398;398	.|P07202-4;P07202-2;P07202	.|.;.;PERT_HUMAN	H|T	81|398;398;398;398;398;327	.|ENSP00000337263:S398T;ENSP00000318820:S398T;ENSP00000263886:S398T;ENSP00000329869:S398T;ENSP00000371636:S398T;ENSP00000405788:S327T	ENSP00000439133:Q81H|ENSP00000329869:S398T	Q|S	+|+	3|2	2|0	TPO|TPO	1460238|1460238	0.956000|0.956000	0.32656|0.32656	1.000000|1.000000	0.80357|0.80357	0.986000|0.986000	0.74619|0.74619	1.297000|1.297000	0.33400|0.33400	1.031000|1.031000	0.39867|0.39867	0.460000|0.460000	0.39030|0.39030	CAG|AGC	G|0.301;C|0.699		0.761	TPO-202	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000206594.2	NM_000547	
C2orf71	388939	broad.mit.edu;bcgsc.ca	37	2	29296512	29296512	+	Missense_Mutation	SNP	G	G	C			TCGA-OR-A5LD-01A-11D-A29I-10	TCGA-OR-A5LD-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d84ce93-4c12-49da-87b3-c36d44672d59	afc22b50-442d-4fde-93ce-df0c281205c9	g.chr2:29296512G>C	ENST00000331664.5	-	1	615	c.616C>G	c.(616-618)Cat>Gat	p.H206D		NM_001029883.2	NP_001025054.1	A6NGG8	CB071_HUMAN	chromosome 2 open reading frame 71	206					response to stimulus (GO:0050896)|visual perception (GO:0007601)	primary cilium (GO:0072372)				NS(2)|breast(5)|central_nervous_system(3)|endometrium(4)|kidney(3)|large_intestine(11)|lung(20)|ovary(2)|prostate(6)|skin(3)|stomach(1)	60						GTGGCCTGATGGATGATGCAC	0.557																																					p.H206D		.											.	C2orf71-91	0			c.C616G						.						83.0	87.0	86.0					2																	29296512		2040	4201	6241	SO:0001583	missense	388939	exon1			CCTGATGGATGAT		CCDS42669.1	2p23.2	2014-01-28			ENSG00000179270	ENSG00000179270			34383	protein-coding gene	gene with protein product		613425				20398886	Standard	NM_001029883		Approved	FLJ34931, RP54	uc002rmt.2	A6NGG8	OTTHUMG00000152024	ENST00000331664.5:c.616C>G	2.37:g.29296512G>C	ENSP00000332809:p.His206Asp	Somatic	144	0		WXS	Illumina GAIIx	Phase_I	164	8	NM_001029883	0	0	0	0	0		Missense_Mutation	SNP	ENST00000331664.5	37	CCDS42669.1	.	.	.	.	.	.	.	.	.	.	G	10.42	1.346075	0.24426	.	.	ENSG00000179270	ENST00000331664	T	0.18016	2.24	5.52	4.59	0.56863	.	0.410754	0.25817	N	0.028116	T	0.12561	0.0305	L	0.39898	1.24	0.23440	N	0.997676	B	0.13594	0.008	B	0.17722	0.019	T	0.22626	-1.0211	10	0.14252	T	0.57	-2.2757	8.5843	0.33649	0.0:0.12:0.5075:0.3726	.	206	A6NGG8	CB071_HUMAN	D	206	ENSP00000332809:H206D	ENSP00000332809:H206D	H	-	1	0	C2orf71	29150016	0.986000	0.35501	0.029000	0.17559	0.859000	0.49053	2.735000	0.47377	2.600000	0.87896	0.561000	0.74099	CAT	.		0.557	C2orf71-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000324924.3	NM_001029883	
ARHGEF33	100271715	hgsc.bcm.edu	37	2	39187519	39187519	+	Silent	SNP	A	A	G	rs958412	byFrequency	TCGA-OR-A5LD-01A-11D-A29I-10	TCGA-OR-A5LD-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d84ce93-4c12-49da-87b3-c36d44672d59	afc22b50-442d-4fde-93ce-df0c281205c9	g.chr2:39187519A>G	ENST00000536934.1	+	14	2158	c.2073A>G	c.(2071-2073)aaA>aaG	p.K691K	ARHGEF33_ENST00000409978.1_Silent_p.K691K|ARHGEF33_ENST00000398800.4_Silent_p.K691K|AC019171.1_ENST00000601251.1_5'Flank			A8MVX0	ARG33_HUMAN	Rho guanine nucleotide exchange factor (GEF) 33	691							Rho guanyl-nucleotide exchange factor activity (GO:0005089)			endometrium(3)|pancreas(1)|prostate(1)	5						GCGCCTACAAACTGGAGGCGG	0.746													G|||	4508	0.90016	0.9523	0.9481	5008	,	,		7469	0.8403		0.9354	False		,,,				2504	0.8211				p.K691K		.											.	ARHGEF33-46	0			c.A2073G						.						1.0	1.0	1.0					2																	39187519		286	830	1116	SO:0001819	synonymous_variant	100271715	exon14			CTACAAACTGGAG		CCDS46263.1, CCDS46263.2	2p22.1	2012-07-24			ENSG00000214694	ENSG00000214694		"""Rho guanine nucleotide exchange factors"""	37252	protein-coding gene	gene with protein product							Standard	NM_001145451		Approved		uc021vgd.1	A8MVX0	OTTHUMG00000153540	ENST00000536934.1:c.2073A>G	2.37:g.39187519A>G		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	8	8	NM_001145451	0	0	0	0	0	J3KPX2	Silent	SNP	ENST00000536934.1	37																																																																																				A|0.086;G|0.914		0.746	ARHGEF33-202	KNOWN	basic	protein_coding	protein_coding		NM_001145451	
PEX13	5194	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	61275821	61275821	+	Silent	SNP	C	C	T			TCGA-OR-A5LD-01A-11D-A29I-10	TCGA-OR-A5LD-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d84ce93-4c12-49da-87b3-c36d44672d59	afc22b50-442d-4fde-93ce-df0c281205c9	g.chr2:61275821C>T	ENST00000295030.5	+	4	1166	c.1128C>T	c.(1126-1128)gcC>gcT	p.A376A		NM_002618.3	NP_002609.1	Q92968	PEX13_HUMAN	peroxisomal biogenesis factor 13	376					cerebral cortex cell migration (GO:0021795)|fatty acid alpha-oxidation (GO:0001561)|locomotory behavior (GO:0007626)|microtubule-based peroxisome localization (GO:0060152)|neuron migration (GO:0001764)|protein import into peroxisome matrix, docking (GO:0016560)|suckling behavior (GO:0001967)	integral component of peroxisomal membrane (GO:0005779)|membrane (GO:0016020)|peroxisomal membrane (GO:0005778)|peroxisome (GO:0005777)				endometrium(2)|large_intestine(2)|lung(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	10			LUSC - Lung squamous cell carcinoma(5;2.05e-06)|Lung(5;3.13e-05)|Epithelial(17;0.114)			AGGAAGCTGCCTTTGAATCTG	0.393																																					p.A376A		.											.	PEX13-91	0			c.C1128T						.						117.0	113.0	115.0					2																	61275821		2203	4300	6503	SO:0001819	synonymous_variant	5194	exon4			AGCTGCCTTTGAA	U71374	CCDS1866.1	2p16.1	2008-08-26	2008-08-26		ENSG00000162928	ENSG00000162928			8855	protein-coding gene	gene with protein product		601789	"""peroxisome biogenesis factor 13"""			9878256	Standard	NM_002618		Approved		uc002sau.4	Q92968	OTTHUMG00000129422	ENST00000295030.5:c.1128C>T	2.37:g.61275821C>T		Somatic	126	0		WXS	Illumina GAIIx	Phase_I	169	31	NM_002618	0	0	5	7	2	B2RCS1	Silent	SNP	ENST00000295030.5	37	CCDS1866.1																																																																																			.		0.393	PEX13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251581.3	NM_002618	
SOWAHC	65124	hgsc.bcm.edu	37	2	110372192	110372192	+	Silent	SNP	A	A	G	rs6594048		TCGA-OR-A5LD-01A-11D-A29I-10	TCGA-OR-A5LD-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d84ce93-4c12-49da-87b3-c36d44672d59	afc22b50-442d-4fde-93ce-df0c281205c9	g.chr2:110372192A>G	ENST00000356454.3	+	1	282	c.126A>G	c.(124-126)ctA>ctG	p.L42L	SEPT10_ENST00000356688.4_5'Flank|SEPT10_ENST00000397714.2_5'Flank|SEPT10_ENST00000334001.6_5'Flank|SEPT10_ENST00000545389.1_5'Flank|SEPT10_ENST00000397712.2_5'Flank|SEPT10_ENST00000415095.1_5'Flank|SEPT10_ENST00000437928.1_5'Flank	NM_023016.3	NP_075392.2	Q53LP3	SWAHC_HUMAN	sosondowah ankyrin repeat domain family member C	42																	GGGGCGCCCTAGGCGGCGAAC	0.771													G|||	5008	1.0	1.0	1.0	5008	,	,		6158	1.0		1.0	False		,,,				2504	1.0				p.L42L		.											.	.	0			c.A126G						.						1.0	2.0	2.0					2																	110372192		1239	2477	3716	SO:0001819	synonymous_variant	65124	exon1			CGCCCTAGGCGGC	AK023346	CCDS33270.1	2q13	2013-01-10	2012-01-12	2012-01-12	ENSG00000198142	ENSG00000198142		"""Ankyrin repeat domain containing"""	26149	protein-coding gene	gene with protein product			"""ankyrin repeat domain 57"""	C2orf26, ANKRD57		22234889	Standard	NM_023016		Approved	FLJ21870	uc002tfb.3	Q53LP3	OTTHUMG00000153219	ENST00000356454.3:c.126A>G	2.37:g.110372192A>G		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	20	20	NM_023016	0	0	0	0	0	Q8NE15|Q9H6U1	Silent	SNP	ENST00000356454.3	37	CCDS33270.1																																																																																			A|0.029;G|0.971		0.771	SOWAHC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000330168.1	NM_023016	
GLI2	2736	broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	121747796	121747796	+	Missense_Mutation	SNP	G	G	A	rs376388820		TCGA-OR-A5LD-01A-11D-A29I-10	TCGA-OR-A5LD-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d84ce93-4c12-49da-87b3-c36d44672d59	afc22b50-442d-4fde-93ce-df0c281205c9	g.chr2:121747796G>A	ENST00000452319.1	+	14	4366	c.4306G>A	c.(4306-4308)Gca>Aca	p.A1436T	GLI2_ENST00000314490.11_Intron|GLI2_ENST00000361492.4_Missense_Mutation_p.A1436T					GLI family zinc finger 2											NS(1)|breast(3)|central_nervous_system(4)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(7)|lung(24)|ovary(8)|pancreas(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	64	Renal(3;0.0496)	Prostate(154;0.0623)				TCCGCAGGACGCAGGTGGGGC	0.642																																					p.A1436T		.											.	GLI2-954	0			c.G4306A						.	G	THR/ALA	0,4406		0,0,2203	40.0	45.0	43.0		4306	-7.6	0.0	2		43	1,8599	1.2+/-3.3	0,1,4299	no	missense	GLI2	NM_005270.4	58	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	benign	1436/1587	121747796	1,13005	2203	4300	6503	SO:0001583	missense	2736	exon13			CAGGACGCAGGTG		CCDS33283.1	2q14	2013-01-25	2009-03-05		ENSG00000074047	ENSG00000074047		"""Zinc fingers, C2H2-type"""	4318	protein-coding gene	gene with protein product	"""tax-responsive element-2 holding protein"", ""tax helper protein 1"", ""tax helper protein 2"""	165230	"""GLI-Kruppel family member GLI2"", ""glioma-associated oncogene family zinc finger 2"""			2850480, 9557682	Standard	NM_005270		Approved	THP2, HPE9, THP1	uc010flp.3	P10070	OTTHUMG00000153741	ENST00000452319.1:c.4306G>A	2.37:g.121747796G>A	ENSP00000390436:p.Ala1436Thr	Somatic	256	1		WXS	Illumina GAIIx	Phase_I	312	66	NM_005270	0	0	4	4	0		Missense_Mutation	SNP	ENST00000452319.1	37	CCDS33283.1	.	.	.	.	.	.	.	.	.	.	G	0.004	-2.332070	0.00227	0.0	1.16E-4	ENSG00000074047	ENST00000452319;ENST00000361492	T;T	0.13901	2.55;2.55	4.41	-7.57	0.01318	.	0.666529	0.14198	N	0.334886	T	0.02610	0.0079	N	0.01267	-0.92	0.09310	N	0.999999	B;B	0.02656	0.0;0.0	B;B	0.04013	0.0;0.001	T	0.38866	-0.9641	9	.	.	.	.	5.5669	0.17175	0.2425:0.119:0.5215:0.117	.	1436;1091	P10070;P10070-2	GLI2_HUMAN;.	T	1436	ENSP00000390436:A1436T;ENSP00000354586:A1436T	.	A	+	1	0	GLI2	121464266	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-1.277000	0.02812	-1.234000	0.02548	-2.002000	0.00443	GCA	.		0.642	GLI2-009	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000332293.3	NM_005270	
NXPH2	11249	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	2	139429091	139429091	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5LD-01A-11D-A29I-10	TCGA-OR-A5LD-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d84ce93-4c12-49da-87b3-c36d44672d59	afc22b50-442d-4fde-93ce-df0c281205c9	g.chr2:139429091G>A	ENST00000272641.3	-	2	302	c.196C>T	c.(196-198)Ccc>Tcc	p.P66S		NM_007226.2	NP_009157.1	O95156	NXPH2_HUMAN	neurexophilin 2	66	II.				neuropeptide signaling pathway (GO:0007218)	extracellular region (GO:0005576)				endometrium(1)|large_intestine(3)|lung(6)|ovary(3)|prostate(3)|skin(3)|urinary_tract(3)	22				BRCA - Breast invasive adenocarcinoma(221;0.101)		CCGGGCTTGGGCACCGGAGAC	0.552																																					p.P66S		.											.	NXPH2-72	0			c.C196T						.						115.0	114.0	114.0					2																	139429091		1928	4135	6063	SO:0001583	missense	11249	exon2			GCTTGGGCACCGG	AF043467	CCDS46421.1	2q22.1	2008-05-15			ENSG00000144227	ENSG00000144227			8076	protein-coding gene	gene with protein product		604635				9570794	Standard	NM_007226		Approved	NPH2	uc002tvi.3	O95156	OTTHUMG00000153636	ENST00000272641.3:c.196C>T	2.37:g.139429091G>A	ENSP00000272641:p.Pro66Ser	Somatic	76	0		WXS	Illumina GAIIx	Phase_I	115	8	NM_007226	0	0	0	0	0	B7WP24|Q494R1|Q75QC3	Missense_Mutation	SNP	ENST00000272641.3	37	CCDS46421.1	.	.	.	.	.	.	.	.	.	.	G	7.062	0.566525	0.13560	.	.	ENSG00000144227	ENST00000272641	.	.	.	6.17	2.98	0.34508	.	0.286388	0.39544	N	0.001328	T	0.36138	0.0956	L	0.36672	1.1	0.26682	N	0.971521	B	0.02656	0.0	B	0.08055	0.003	T	0.18241	-1.0343	8	.	.	.	-4.4449	13.429	0.61044	0.1992:0.0:0.8008:0.0	.	66	O95156	NXPH2_HUMAN	S	66	.	.	P	-	1	0	NXPH2	139145561	0.786000	0.28738	0.564000	0.28396	0.962000	0.63368	0.987000	0.29603	0.919000	0.36945	0.655000	0.94253	CCC	.		0.552	NXPH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000331901.1		
MAP2	4133	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	210557459	210557459	+	Missense_Mutation	SNP	G	G	T			TCGA-OR-A5LD-01A-11D-A29I-10	TCGA-OR-A5LD-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d84ce93-4c12-49da-87b3-c36d44672d59	afc22b50-442d-4fde-93ce-df0c281205c9	g.chr2:210557459G>T	ENST00000360351.4	+	7	1071	c.565G>T	c.(565-567)Ggt>Tgt	p.G189C	MAP2_ENST00000392194.1_Intron|MAP2_ENST00000447185.1_Missense_Mutation_p.G185C|MAP2_ENST00000199940.6_Intron|MAP2_ENST00000361559.4_Intron	NM_002374.3	NP_002365.3	P11137	MTAP2_HUMAN	microtubule-associated protein 2	189					axonogenesis (GO:0007409)|cellular response to organic substance (GO:0071310)|central nervous system neuron development (GO:0021954)|dendrite morphogenesis (GO:0048813)|microtubule bundle formation (GO:0001578)|neuron projection development (GO:0031175)	cytoplasm (GO:0005737)|dendritic shaft (GO:0043198)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|neuronal cell body (GO:0043025)|nuclear periphery (GO:0034399)	dystroglycan binding (GO:0002162)|structural molecule activity (GO:0005198)			breast(7)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(36)|liver(2)|lung(42)|ovary(11)|pancreas(2)|prostate(2)|skin(2)|stomach(4)|upper_aerodigestive_tract(4)|urinary_tract(1)	124		Hepatocellular(293;0.137)|Lung NSC(271;0.163)|Renal(323;0.202)		UCEC - Uterine corpus endometrioid carcinoma (47;6.64e-05)|Epithelial(149;3.12e-100)|all cancers(144;6.88e-91)|Lung(261;0.0624)|LUSC - Lung squamous cell carcinoma(261;0.0662)|STAD - Stomach adenocarcinoma(1183;0.18)	Docetaxel(DB01248)|Estramustine(DB01196)|Paclitaxel(DB01229)	AAGTAAGCCTGGTGAAGACCT	0.463																																					p.G189C	Pancreas(27;423 979 28787 29963)	.											.	MAP2-591	0			c.G565T						.						90.0	76.0	81.0					2																	210557459		2203	4300	6503	SO:0001583	missense	4133	exon7			AAGCCTGGTGAAG		CCDS2384.1, CCDS2385.1, CCDS33369.1	2q34-q35	2008-05-27			ENSG00000078018	ENSG00000078018		"""A-kinase anchor proteins"""	6839	protein-coding gene	gene with protein product		157130				3103857, 7479905	Standard	XM_005246554		Approved	MAP2A, MAP2B, MAP2C	uc002vde.1	P11137	OTTHUMG00000132962	ENST00000360351.4:c.565G>T	2.37:g.210557459G>T	ENSP00000353508:p.Gly189Cys	Somatic	121	0		WXS	Illumina GAIIx	Phase_I	162	37	NM_002374	0	0	0	0	0	Q17S04|Q8IUX2|Q99975|Q99976	Missense_Mutation	SNP	ENST00000360351.4	37	CCDS2384.1	.	.	.	.	.	.	.	.	.	.	G	20.9	4.074297	0.76415	.	.	ENSG00000078018	ENST00000360351;ENST00000445941;ENST00000447185	T;T;T	0.20881	2.04;2.04;2.04	5.98	5.1	0.69264	.	0.112697	0.40554	N	0.001079	T	0.31327	0.0793	L	0.57536	1.79	0.31643	N	0.647786	D;D	0.59357	0.985;0.975	P;P	0.54026	0.74;0.554	T	0.37686	-0.9695	10	0.87932	D	0	-20.7424	8.7483	0.34600	0.2095:0.0:0.7905:0.0	.	185;189	P11137-3;P11137	.;MAP2_HUMAN	C	189;271;185	ENSP00000353508:G189C;ENSP00000409969:G271C;ENSP00000392164:G185C	ENSP00000353508:G189C	G	+	1	0	MAP2	210265704	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	2.277000	0.43417	2.838000	0.97847	0.655000	0.94253	GGT	.		0.463	MAP2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256521.2	NM_001039538	
SP140	11262	broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	231102964	231102964	+	Missense_Mutation	SNP	A	A	T			TCGA-OR-A5LD-01A-11D-A29I-10	TCGA-OR-A5LD-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d84ce93-4c12-49da-87b3-c36d44672d59	afc22b50-442d-4fde-93ce-df0c281205c9	g.chr2:231102964A>T	ENST00000392045.3	+	3	388	c.274A>T	c.(274-276)Aca>Tca	p.T92S	SP140_ENST00000350136.5_Missense_Mutation_p.T72S|SP140_ENST00000417495.3_Missense_Mutation_p.T92S|SP140_ENST00000343805.6_Missense_Mutation_p.T92S|SP140_ENST00000373645.3_Missense_Mutation_p.T92S|SP140_ENST00000486687.2_Missense_Mutation_p.T92S|SP140_ENST00000544128.1_3'UTR|SP140_ENST00000420434.3_Missense_Mutation_p.T92S	NM_007237.4	NP_009168.4	Q13342	SP140_HUMAN	SP140 nuclear body protein	92	HSR. {ECO:0000255|PROSITE- ProRule:PRU00747}.				defense response (GO:0006952)|regulation of transcription, DNA-templated (GO:0006355)	cytoplasm (GO:0005737)|nuclear envelope (GO:0005635)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			NS(1)|kidney(1)|large_intestine(3)|lung(5)|ovary(1)|skin(1)	12		Renal(207;0.0112)|all_lung(227;0.0221)|Lung NSC(271;0.0977)|all_hematologic(139;0.103)|Acute lymphoblastic leukemia(138;0.167)		Epithelial(121;1.13e-12)|all cancers(144;2.71e-10)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(119;0.00942)		GGTCCCAGTGACAAGAGTGAT	0.383																																					p.T92S		.											.	SP140-90	0			c.A274T						.						118.0	112.0	114.0					2																	231102964		2203	4300	6503	SO:0001583	missense	11262	exon3			CCAGTGACAAGAG	U63420	CCDS33392.1, CCDS42831.1, CCDS63149.1, CCDS63150.1, CCDS63151.1	2q37.1	2013-01-28			ENSG00000079263	ENSG00000079263		"""Zinc fingers, PHD-type"""	17133	protein-coding gene	gene with protein product		608602				8695863, 8910577, 12368356	Standard	NM_001005176		Approved	LYSP100-B, LYSP100-A	uc002vql.3	Q13342	OTTHUMG00000153670	ENST00000392045.3:c.274A>T	2.37:g.231102964A>T	ENSP00000375899:p.Thr92Ser	Somatic	174	1		WXS	Illumina GAIIx	Phase_I	252	29	NM_007237	0	0	0	0	0	E7ESH9|E7EUR5|E9PFJ6|Q0VGE5|Q13341|Q3KR17|Q4ZG66|Q53TG1|Q6NSG4|Q92881|Q96TG3	Missense_Mutation	SNP	ENST00000392045.3	37	CCDS42831.1	.	.	.	.	.	.	.	.	.	.	A	0.169	-1.073835	0.01918	.	.	ENSG00000079263	ENST00000537563;ENST00000486687;ENST00000392044;ENST00000350136;ENST00000392045;ENST00000417495;ENST00000343805;ENST00000420434;ENST00000373645	D;D;D;D;D;D	0.93712	-3.27;-3.27;-3.27;-3.27;-3.27;-3.27	3.36	-5.8	0.02347	Sp100 (2);	.	.	.	.	T	0.74261	0.3693	N	0.01048	-1.04	0.09310	N	1	B;B;B;B;P;B	0.39216	0.059;0.011;0.009;0.002;0.664;0.004	B;B;B;B;B;B	0.38842	0.041;0.011;0.01;0.029;0.283;0.011	T	0.73701	-0.3900	9	0.14252	T	0.57	-0.1529	6.1431	0.20271	0.2749:0.3679:0.3572:0.0	.	92;92;92;92;92;92	E7EUR5;E7ESH9;E9PFJ6;Q13342;E7EX75;Q6NSG4	.;.;.;LY10_HUMAN;.;.	S	92;92;92;72;92;92;92;92;92	ENSP00000440107:T92S;ENSP00000345846:T72S;ENSP00000375899:T92S;ENSP00000342096:T92S;ENSP00000398210:T92S;ENSP00000362749:T92S	ENSP00000342096:T92S	T	+	1	0	SP140	230811208	0.000000	0.05858	0.000000	0.03702	0.358000	0.29455	-3.197000	0.00562	-1.429000	0.01987	-2.794000	0.00115	ACA	.		0.383	SP140-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000332015.1	NM_007237	
ESPNL	339768	hgsc.bcm.edu	37	2	239009289	239009289	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5LD-01A-11D-A29I-10	TCGA-OR-A5LD-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d84ce93-4c12-49da-87b3-c36d44672d59	afc22b50-442d-4fde-93ce-df0c281205c9	g.chr2:239009289G>A	ENST00000343063.3	+	1	492	c.229G>A	c.(229-231)Gcc>Acc	p.A77T	ESPNL_ENST00000409169.1_Missense_Mutation_p.A77T	NM_194312.2	NP_919288.2	Q6ZVH7	ESPNL_HUMAN	espin-like	77										endometrium(1)|lung(8)|pancreas(2)|skin(2)	13		Breast(86;7.61e-05)|Renal(207;0.00183)|Ovarian(221;0.0481)|all_hematologic(139;0.158)|all_lung(227;0.198)|Melanoma(123;0.203)|Hepatocellular(293;0.244)		Epithelial(121;4.71e-24)|OV - Ovarian serous cystadenocarcinoma(60;3.02e-12)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;5.63e-08)|BRCA - Breast invasive adenocarcinoma(100;0.000109)|Lung(119;0.0108)|LUSC - Lung squamous cell carcinoma(224;0.0253)		AGCGCATGACGCCGCTGCCAC	0.736																																					p.A77T		.											.	ESPNL-69	0			c.G229A						.						2.0	3.0	3.0					2																	239009289		1711	3586	5297	SO:0001583	missense	339768	exon1			CATGACGCCGCTG	AK124559	CCDS2525.1	2q37.3	2013-01-10			ENSG00000144488	ENSG00000144488		"""Ankyrin repeat domain containing"""	27937	protein-coding gene	gene with protein product						12975309	Standard	NM_194312		Approved	FLJ42568	uc002vxq.4	Q6ZVH7	OTTHUMG00000133335	ENST00000343063.3:c.229G>A	2.37:g.239009289G>A	ENSP00000339115:p.Ala77Thr	Somatic	3	0		WXS	Illumina GAIIx	Phase_I	19	6	NM_194312	0	0	0	0	0	Q66K27|Q6ZVG1|Q8IVU2	Missense_Mutation	SNP	ENST00000343063.3	37	CCDS2525.1	.	.	.	.	.	.	.	.	.	.	G	19.62	3.861974	0.71949	.	.	ENSG00000144488	ENST00000343063;ENST00000409169	D;D	0.83075	-1.68;-1.56	4.1	4.1	0.47936	Ankyrin repeat-containing domain (4);	0.000000	0.64402	U	0.000015	D	0.88599	0.6480	M	0.90595	3.13	0.80722	D	1	D	0.61080	0.989	P	0.51806	0.68	D	0.90440	0.4431	10	0.72032	D	0.01	-12.6572	11.0966	0.48147	0.0:0.0:0.814:0.1859	.	77	Q6ZVH7	ESPNL_HUMAN	T	77	ENSP00000339115:A77T;ENSP00000386577:A77T	ENSP00000339115:A77T	A	+	1	0	ESPNL	238674028	1.000000	0.71417	0.068000	0.19968	0.368000	0.29767	6.551000	0.73909	1.838000	0.53458	0.462000	0.41574	GCC	.		0.736	ESPNL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257164.2	NM_194312	
PANK2	80025	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	20	3869889	3869889	+	Missense_Mutation	SNP	C	C	G			TCGA-OR-A5LD-01A-11D-A29I-10	TCGA-OR-A5LD-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d84ce93-4c12-49da-87b3-c36d44672d59	afc22b50-442d-4fde-93ce-df0c281205c9	g.chr20:3869889C>G	ENST00000316562.4	+	1	148	c.142C>G	c.(142-144)Ctc>Gtc	p.L48V	RP11-119B16.2_ENST00000451507.1_RNA|PANK2_ENST00000610179.1_5'Flank|PANK2_ENST00000497424.1_Intron	NM_153638.2	NP_705902.2	Q9BZ23	PANK2_HUMAN	pantothenate kinase 2	48					aerobic respiration (GO:0009060)|cell death (GO:0008219)|coenzyme A biosynthetic process (GO:0015937)|coenzyme biosynthetic process (GO:0009108)|mitochondrion morphogenesis (GO:0070584)|pantothenate metabolic process (GO:0015939)|regulation of mitochondrial membrane potential (GO:0051881)|small molecule metabolic process (GO:0044281)|spermatid development (GO:0007286)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)|mitochondrial intermembrane space (GO:0005758)	ATP binding (GO:0005524)|pantothenate kinase activity (GO:0004594)			breast(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(5)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	15						TCACGATAGCCTCTCATTGGA	0.662																																					p.L48V		.											.	PANK2-115	0			c.C142G						.						33.0	27.0	29.0					20																	3869889		2203	4300	6503	SO:0001583	missense	80025	exon1			GATAGCCTCTCAT	AK021791	CCDS13071.2, CCDS13072.1	20p13	2008-07-31	2008-07-31	2002-09-06	ENSG00000125779	ENSG00000125779	2.7.1.33		15894	protein-coding gene	gene with protein product	"""Hallervorden-Spatz syndrome"""	606157	"""neurodegeneration with brain iron accumulation 1 (Hallervorden-Spatz syndrome)"""	C20orf48, NBIA1		8944032, 11479594	Standard	XM_005260835		Approved	HSS, FLJ11729, PKAN, HARP	uc002wkc.3	Q9BZ23	OTTHUMG00000031768	ENST00000316562.4:c.142C>G	20.37:g.3869889C>G	ENSP00000313377:p.Leu48Val	Somatic	162	0		WXS	Illumina GAIIx	Phase_I	118	46	NM_153638	0	0	0	0	0	B1AK33|B2Z3X0|D3DVZ0|Q5T7I2|Q5T7I4|Q7RTX5|Q8N7Q4|Q8TCR5|Q9BYW5|Q9HAF2	Missense_Mutation	SNP	ENST00000316562.4	37	CCDS13071.2	.	.	.	.	.	.	.	.	.	.	C	13.03	2.115102	0.37339	.	.	ENSG00000125779	ENST00000316562	D	0.97598	-4.45	4.9	-3.18	0.05186	.	1.754440	0.03254	N	0.182278	D	0.90473	0.7016	N	0.08118	0	0.09310	N	1	B	0.15473	0.013	B	0.17979	0.02	D	0.83597	0.0126	10	0.45353	T	0.12	.	3.6642	0.08250	0.2804:0.2981:0.0:0.4215	.	48	Q9BZ23	PANK2_HUMAN	V	48	ENSP00000313377:L48V	ENSP00000313377:L48V	L	+	1	0	PANK2	3817889	0.000000	0.05858	0.004000	0.12327	0.040000	0.13550	-0.524000	0.06222	-0.400000	0.07656	-0.169000	0.13324	CTC	.		0.662	PANK2-007	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000077793.2	NM_024960	
PAK7	57144	broad.mit.edu	37	20	9546653	9546653	+	Nonsense_Mutation	SNP	C	C	A			TCGA-OR-A5LD-01A-11D-A29I-10	TCGA-OR-A5LD-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d84ce93-4c12-49da-87b3-c36d44672d59	afc22b50-442d-4fde-93ce-df0c281205c9	g.chr20:9546653C>A	ENST00000378429.3	-	6	1915	c.1369G>T	c.(1369-1371)Gaa>Taa	p.E457*	PAK7_ENST00000378423.1_Nonsense_Mutation_p.E457*|PAK7_ENST00000353224.5_Nonsense_Mutation_p.E457*	NM_020341.3	NP_065074.1	Q9P286	PAK7_HUMAN	p21 protein (Cdc42/Rac)-activated kinase 7	457	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				apoptotic process (GO:0006915)|cell growth (GO:0016049)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|cytoskeleton organization (GO:0007010)|learning (GO:0007612)|locomotory behavior (GO:0007626)|memory (GO:0007613)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|signal transduction (GO:0007165)	mitochondrion (GO:0005739)|nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|central_nervous_system(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|lung(44)|ovary(2)|skin(13)|stomach(1)|upper_aerodigestive_tract(3)	81			COAD - Colon adenocarcinoma(9;0.194)			GTTGAGCCTTCCCCGATTTTG	0.557																																					p.E457X		.											.	PAK7-1434	0			c.G1369T						.						215.0	201.0	206.0					20																	9546653		2203	4300	6503	SO:0001587	stop_gained	57144	exon5			AGCCTTCCCCGAT	AB033090	CCDS13107.1	20p12	2008-06-17	2008-06-17		ENSG00000101349	ENSG00000101349			15916	protein-coding gene	gene with protein product		608038	"""p21(CDKN1A)-activated kinase 7"""			11756552, 10574462	Standard	NM_020341		Approved	KIAA1264, PAK5	uc002wnk.2	Q9P286	OTTHUMG00000031857	ENST00000378429.3:c.1369G>T	20.37:g.9546653C>A	ENSP00000367686:p.Glu457*	Somatic	192	0		WXS	Illumina GAIIx	Phase_I	191	6	NM_177990	0	0	0	0	0	A8K5T6|D3DW14|Q5W115|Q9BX09|Q9ULF6	Nonsense_Mutation	SNP	ENST00000378429.3	37	CCDS13107.1	.	.	.	.	.	.	.	.	.	.	C	42	9.387067	0.99156	.	.	ENSG00000101349	ENST00000378429;ENST00000353224;ENST00000378423;ENST00000439520	.	.	.	5.66	5.66	0.87406	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.7589	0.96306	0.0:1.0:0.0:0.0	.	.	.	.	X	457;457;457;405	.	.	E	-	1	0	PAK7	9494653	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	7.818000	0.86416	2.654000	0.90174	0.585000	0.79938	GAA	.		0.557	PAK7-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077962.1		
NINL	22981	bcgsc.ca	37	20	25439036	25439036	+	Missense_Mutation	SNP	G	G	A	rs41310175	byFrequency	TCGA-OR-A5LD-01A-11D-A29I-10	TCGA-OR-A5LD-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d84ce93-4c12-49da-87b3-c36d44672d59	afc22b50-442d-4fde-93ce-df0c281205c9	g.chr20:25439036G>A	ENST00000278886.6	-	22	3899	c.3826C>T	c.(3826-3828)Cgc>Tgc	p.R1276C	NINL_ENST00000422516.1_Missense_Mutation_p.R927C|NINL_ENST00000464285.1_5'UTR	NM_025176.4	NP_079452.3	Q9Y2I6	NINL_HUMAN	ninein-like	1276			R -> C (in dbSNP:rs41310175).		G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)	cytosol (GO:0005829)|microtubule (GO:0005874)	calcium ion binding (GO:0005509)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(13)|lung(25)|ovary(2)|pancreas(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	57						GCATCCAGGCGCCTCCTGGCC	0.677													g|||	77	0.0153754	0.0038	0.0216	5008	,	,		17279	0.001		0.0487	False		,,,				2504	0.0072				p.R1276C		.											.	NINL-94	0			c.C3826T						.	A	CYS/ARG	42,4364	46.0+/-80.4	0,42,2161	66.0	58.0	61.0		3826	-4.8	0.0	20	dbSNP_127	61	350,8250	119.0+/-178.4	8,334,3958	yes	missense	NINL	NM_025176.4	180	8,376,6119	AA,AG,GG		4.0698,0.9532,3.014	probably-damaging	1276/1383	25439036	392,12614	2203	4300	6503	SO:0001583	missense	22981	exon22			CCAGGCGCCTCCT		CCDS33452.1	20p11.22-p11.1	2013-01-10			ENSG00000101004	ENSG00000101004		"""EF-hand domain containing"""	29163	protein-coding gene	gene with protein product	"""ninein-like protein"""	609580				10231032	Standard	XM_005260678		Approved	KIAA0980, NLP	uc002wux.1	Q9Y2I6	OTTHUMG00000032127	ENST00000278886.6:c.3826C>T	20.37:g.25439036G>A	ENSP00000278886:p.Arg1276Cys	Somatic	101	1		WXS	Illumina GAIIx	Phase_I	115	6	NM_025176	0	0	9	9	0	A6NJN0|B3V9H6|B7Z1V8|Q5JYP0|Q8NE38|Q9NQE3	Missense_Mutation	SNP	ENST00000278886.6	37	CCDS33452.1	52	0.023809523809523808	4	0.008130081300813009	9	0.024861878453038673	1	0.0017482517482517483	38	0.05013192612137203	g	8.701	0.909849	0.17833	0.009532	0.040698	ENSG00000101004	ENST00000278886;ENST00000422516	T;T	0.34859	1.34;1.34	2.4	-4.81	0.03180	.	0.935097	0.08759	N	0.897966	T	0.07863	0.0197	L	0.51422	1.61	0.09310	N	1	D;D;D	0.69078	0.975;0.97;0.997	B;B;P	0.54270	0.162;0.27;0.747	T	0.12066	-1.0562	10	0.59425	D	0.04	-0.6612	4.7227	0.12926	0.3007:0.2906:0.4087:0.0	rs41310175;rs61737614	927;1276;67	Q9Y2I6-2;Q9Y2I6;Q9HAD5	.;NINL_HUMAN;.	C	1276;927	ENSP00000278886:R1276C;ENSP00000410431:R927C	ENSP00000278886:R1276C	R	-	1	0	NINL	25387036	0.007000	0.16637	0.000000	0.03702	0.059000	0.15707	1.664000	0.37439	-1.568000	0.01670	-0.970000	0.02610	CGC	G|0.973;A|0.027		0.677	NINL-007	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000078445.3	NM_025176	
RTFDC1	51507	hgsc.bcm.edu	37	20	55059239	55059239	+	Silent	SNP	C	C	T			TCGA-OR-A5LD-01A-11D-A29I-10	TCGA-OR-A5LD-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d84ce93-4c12-49da-87b3-c36d44672d59	afc22b50-442d-4fde-93ce-df0c281205c9	g.chr20:55059239C>T	ENST00000023939.4	+	5	578	c.471C>T	c.(469-471)tgC>tgT	p.C157C	RTFDC1_ENST00000395881.3_Silent_p.C157C|RTFDC1_ENST00000357348.5_Silent_p.C187C	NM_001283035.1|NM_001283036.1|NM_016407.3	NP_001269964.1|NP_001269965.1|NP_057491.2	Q9BY42	RTF2_HUMAN	replication termination factor 2 domain containing 1	157																	CGGAAGTTTGCCACACGGTGA	0.478																																					p.C157C		.											.	.	0			c.C471T						.						166.0	162.0	163.0					20																	55059239		2203	4300	6503	SO:0001819	synonymous_variant	51507	exon5			AGTTTGCCACACG	AF161513	CCDS13453.1, CCDS63316.1, CCDS63317.1	20q13	2012-10-29	2012-10-29	2012-10-29	ENSG00000022277	ENSG00000022277			15890	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 43"""	C20orf43			Standard	NM_001283035		Approved	HSPC164, CDAO5	uc002xxt.2	Q9BY42	OTTHUMG00000032801	ENST00000023939.4:c.471C>T	20.37:g.55059239C>T		Somatic	103	0		WXS	Illumina GAIIx	Phase_I	76	4	NM_016407	0	0	0	0	0	E1P5Z9|Q9BYL7|Q9HCV9|Q9NX29|Q9NZZ8|Q9P002|Q9UHW3	Silent	SNP	ENST00000023939.4	37	CCDS13453.1																																																																																			.		0.478	RTFDC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079817.2	NM_016407	
KRTAP21-3	100288323	hgsc.bcm.edu;bcgsc.ca;mdanderson.org	37	21	32090951	32090951	+	Missense_Mutation	SNP	A	A	C			TCGA-OR-A5LD-01A-11D-A29I-10	TCGA-OR-A5LD-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d84ce93-4c12-49da-87b3-c36d44672d59	afc22b50-442d-4fde-93ce-df0c281205c9	g.chr21:32090951A>C	ENST00000444335.1	-	1	144	c.127T>G	c.(127-129)Tat>Gat	p.Y43D		NM_001164435.1	NP_001157907.1	Q3LHN1	KR213_HUMAN	keratin associated protein 21-3	43						intermediate filament (GO:0005882)											ATAACAGAATATTTATTTTCA	0.368																																					p.Y43D		.											.	.	0			c.T127G						.						57.0	53.0	54.0					21																	32090951		692	1591	2283	SO:0001583	missense	100288323	exon1			CAGAATATTTATT	AB180042	CCDS54481.1	21q22.11	2011-02-24			ENSG00000231068	ENSG00000231068		"""Keratin associated proteins"""	34216	protein-coding gene	gene with protein product							Standard	NM_001164435		Approved		uc021wii.1	Q3LHN1	OTTHUMG00000125533	ENST00000444335.1:c.127T>G	21.37:g.32090951A>C	ENSP00000404517:p.Tyr43Asp	Somatic	233	0		WXS	Illumina GAIIx	Phase_I	249	42	NM_001164435	0	0	0	0	0		Missense_Mutation	SNP	ENST00000444335.1	37	CCDS54481.1	.	.	.	.	.	.	.	.	.	.	A	8.411	0.844128	0.16963	.	.	ENSG00000231068	ENST00000444335	.	.	.	2.85	-1.08	0.09936	.	.	.	.	.	T	0.34366	0.0895	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.38779	-0.9645	5	0.87932	D	0	.	3.0076	0.06033	0.4776:0.2347:0.2877:0.0	.	.	.	.	D	43	.	ENSP00000404517:Y43D	Y	-	1	0	KRTAP21-3	31012822	0.001000	0.12720	0.000000	0.03702	0.064000	0.16182	0.472000	0.22116	-0.191000	0.10448	0.524000	0.50904	TAT	.		0.368	KRTAP21-3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000246864.1	XM_002343741	
TIAM1	7074	broad.mit.edu	37	21	32624321	32624321	+	Missense_Mutation	SNP	A	A	C			TCGA-OR-A5LD-01A-11D-A29I-10	TCGA-OR-A5LD-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d84ce93-4c12-49da-87b3-c36d44672d59	afc22b50-442d-4fde-93ce-df0c281205c9	g.chr21:32624321A>C	ENST00000286827.3	-	6	1619	c.1148T>G	c.(1147-1149)gTg>gGg	p.V383G	TIAM1_ENST00000469412.1_5'UTR|TIAM1_ENST00000541036.1_Missense_Mutation_p.V383G	NM_003253.2	NP_003244.2	Q13009	TIAM1_HUMAN	T-cell lymphoma invasion and metastasis 1	383					apoptotic signaling pathway (GO:0097190)|cell migration (GO:0016477)|cell-matrix adhesion (GO:0007160)|ephrin receptor signaling pathway (GO:0048013)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of axonogenesis (GO:0050772)|positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of Rho GTPase activity (GO:0032321)|Rac protein signal transduction (GO:0016601)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cell-cell contact zone (GO:0044291)|cell-cell junction (GO:0005911)|cytosol (GO:0005829)|extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)	phospholipid binding (GO:0005543)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)|receptor signaling protein activity (GO:0005057)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			autonomic_ganglia(3)|breast(7)|central_nervous_system(2)|endometrium(13)|kidney(4)|large_intestine(33)|lung(44)|ovary(2)|prostate(3)|skin(2)|urinary_tract(2)	115						GTTCTCGTACACCCCCTGACG	0.667																																					p.V383G		.											.	TIAM1-724	0			c.T1148G						.						52.0	59.0	57.0					21																	32624321		2203	4299	6502	SO:0001583	missense	7074	exon6			TCGTACACCCCCT		CCDS13609.1	21q22.1	2013-01-10			ENSG00000156299	ENSG00000156299		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	11805	protein-coding gene	gene with protein product		600687				8595894, 15340013	Standard	NM_003253		Approved		uc002yow.1	Q13009	OTTHUMG00000084869	ENST00000286827.3:c.1148T>G	21.37:g.32624321A>C	ENSP00000286827:p.Val383Gly	Somatic	66	11		WXS	Illumina GAIIx	Phase_I	84	17	NM_003253	0	0	0	0	0	B7ZLR6|F5GZ53|Q17RT7	Missense_Mutation	SNP	ENST00000286827.3	37	CCDS13609.1	.	.	.	.	.	.	.	.	.	.	A	24.1	4.497945	0.85069	.	.	ENSG00000156299	ENST00000286827;ENST00000399841;ENST00000541036	T;T	0.50813	0.79;0.73	4.86	4.86	0.63082	.	0.000000	0.85682	D	0.000000	T	0.63977	0.2557	L	0.55481	1.735	0.80722	D	1	D;D;D	0.89917	1.0;0.999;0.999	D;D;D	0.87578	0.998;0.996;0.996	T	0.67612	-0.5626	10	0.87932	D	0	.	14.6199	0.68576	1.0:0.0:0.0:0.0	.	383;383;383	F5GZ53;B7ZLR6;Q13009	.;.;TIAM1_HUMAN	G	383;224;383	ENSP00000286827:V383G;ENSP00000441570:V383G	ENSP00000286827:V383G	V	-	2	0	TIAM1	31546192	1.000000	0.71417	0.996000	0.52242	0.947000	0.59692	8.596000	0.90844	2.021000	0.59480	0.533000	0.62120	GTG	.		0.667	TIAM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000192552.1	NM_003253	
GCAT	23464	broad.mit.edu	37	22	38205989	38205989	+	Intron	SNP	T	T	C	rs2285178	byFrequency	TCGA-OR-A5LD-01A-11D-A29I-10	TCGA-OR-A5LD-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d84ce93-4c12-49da-87b3-c36d44672d59	afc22b50-442d-4fde-93ce-df0c281205c9	g.chr22:38205989T>C	ENST00000248924.6	+	2	252				GCAT_ENST00000415371.1_Intron|GCAT_ENST00000323205.6_Missense_Mutation_p.L77S	NM_014291.3	NP_055106.1	O75600	KBL_HUMAN	glycine C-acetyltransferase						biosynthetic process (GO:0009058)|cellular amino acid metabolic process (GO:0006520)|L-threonine catabolic process to glycine (GO:0019518)	mitochondrion (GO:0005739)|nucleus (GO:0005634)	glycine C-acetyltransferase activity (GO:0008890)|pyridoxal phosphate binding (GO:0030170)			haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(8)|skin(1)	12	Melanoma(58;0.045)				Glycine(DB00145)	GGCCTGCCCTTGCCCCACCTG	0.557													.|||	1380	0.275559	0.1014	0.3098	5008	,	,		18233	0.3135		0.332	False		,,,				2504	0.3896				p.L77S		.											.	GCAT-90	0			c.T230C						.	T	SER/LEU,	618,3788	253.4+/-259.3	47,524,1632	66.0	43.0	51.0		230,	0.0	0.0	22	dbSNP_100	51	2672,5926	399.5+/-346.5	383,1906,2010	yes	missense,intron	GCAT	NM_001171690.1,NM_014291.3	145,	430,2430,3642	CC,CT,TT		31.077,14.0263,25.2999	,	77/446,	38205989	3290,9714	2203	4299	6502	SO:0001627	intron_variant	23464	exon2			TGCCCTTGCCCCA	AF077740	CCDS13957.1, CCDS54527.1	22q13.1	2010-01-19	2010-01-19		ENSG00000100116	ENSG00000100116	2.3.1.29		4188	protein-coding gene	gene with protein product	"""2-amino-3-ketobutyrate coenzyme A ligase"""	607422	"""glycine C-acetyltransferase (2-amino-3-ketobutyrate coenzyme A ligase)"""				Standard	NM_014291		Approved	KBL	uc003aua.2	O75600	OTTHUMG00000150664	ENST00000248924.6:c.197-45T>C	22.37:g.38205989T>C		Somatic	145	1		WXS	Illumina GAIIx	Phase_I	95	5	NM_001171690	0	0	0	0	0	E2QC23|Q6ZWF1|Q96CA9	Missense_Mutation	SNP	ENST00000248924.6	37	CCDS13957.1	614	0.28113553113553114	54	0.10975609756097561	114	0.3149171270718232	195	0.3409090909090909	251	0.3311345646437995	t	5.786	0.329321	0.10956	0.140263	0.31077	ENSG00000100116	ENST00000323205;ENST00000445195;ENST00000394944	D;D	0.94793	-3.52;-1.86	3.68	0.00572	0.14064	.	.	.	.	.	T	0.00012	0.0000	.	.	.	0.58432	P	1.999999999946489E-6	B	0.19583	0.037	B	0.13407	0.009	T	0.09378	-1.0677	7	0.87932	D	0	.	4.1025	0.10020	0.3637:0.0:0.1877:0.4486	rs2285178;rs59294489;rs2285178	77	E2QC23	.	S	77	ENSP00000371110:L77S;ENSP00000406719:L77S	ENSP00000371110:L77S	L	+	2	0	GCAT	36535935	0.001000	0.12720	0.000000	0.03702	0.039000	0.13416	0.213000	0.17521	-0.072000	0.12864	0.402000	0.26972	TTG	T|0.722;C|0.278		0.557	GCAT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319506.1	NM_014291.2	
PRR34	55267	hgsc.bcm.edu	37	22	46449891	46449891	+	Missense_Mutation	SNP	G	G	A	rs12159707	byFrequency	TCGA-OR-A5LD-01A-11D-A29I-10	TCGA-OR-A5LD-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d84ce93-4c12-49da-87b3-c36d44672d59	afc22b50-442d-4fde-93ce-df0c281205c9	g.chr22:46449891G>A	ENST00000396008.2	-	1	133	c.83C>T	c.(82-84)cCc>cTc	p.P28L	C22orf26_ENST00000333761.1_Missense_Mutation_p.P28L|RP6-109B7.3_ENST00000451166.1_RNA|RP6-109B7.3_ENST00000416202.1_RNA|FLJ27365_ENST00000381051.2_Intron|RP6-109B7.5_ENST00000608644.1_RNA|RP6-109B7.3_ENST00000445441.1_RNA|RP6-109B7.2_ENST00000439423.1_lincRNA			Q9NV39	PRR34_HUMAN		28	Pro-rich.		P -> L (in dbSNP:rs12159707).										Ovarian(80;0.00965)|all_neural(38;0.0416)		UCEC - Uterine corpus endometrioid carcinoma (28;0.0178)|BRCA - Breast invasive adenocarcinoma(115;0.0784)|LUAD - Lung adenocarcinoma(64;0.247)		TGCGGGGTTGGGGGGGGAGGT	0.746													G|||	1079	0.215455	0.2723	0.2723	5008	,	,		6433	0.0278		0.33	False		,,,				2504	0.1738				p.P28L		.											.	C22orf26-90	0			c.C83T						.	G	LEU/PRO	1414,2432		349,716,858	5.0	5.0	5.0		83	0.7	0.0	22	dbSNP_120	5	2591,5181		546,1499,1841	no	missense	C22orf26	NM_018280.2	98	895,2215,2699	AA,AG,GG		33.3376,36.7655,34.4724	probably-damaging	28/139	46449891	4005,7613	1923	3886	5809	SO:0001583	missense	55267	exon1			GGGTTGGGGGGGG																												ENST00000396008.2:c.83C>T	22.37:g.46449891G>A	ENSP00000379329:p.Pro28Leu	Somatic	3	0		WXS	Illumina GAIIx	Phase_I	5	4	NM_018280	0	0	0	0	0	B0QZ24	Missense_Mutation	SNP	ENST00000396008.2	37	CCDS14071.1	542	0.24816849816849818	155	0.3150406504065041	117	0.32320441988950277	22	0.038461538461538464	248	0.32717678100263853	G	5.153	0.213778	0.09810	0.367655	0.333376	ENSG00000182257	ENST00000396008;ENST00000333761	T;T	0.41400	1.0;1.0	0.666	0.666	0.17901	.	.	.	.	.	T	0.00012	0.0000	N	0.08118	0	0.80722	P	0.0	D	0.69078	0.997	D	0.68483	0.958	T	0.42189	-0.9466	7	0.87932	D	0	.	.	.	.	rs12159707;rs59880898	28	Q9NV39	CV026_HUMAN	L	28	ENSP00000379329:P28L;ENSP00000327764:P28L	ENSP00000327764:P28L	P	-	2	0	C22orf26	44828555	0.742000	0.28228	0.008000	0.14137	0.010000	0.07245	0.672000	0.25187	0.636000	0.30508	0.645000	0.84053	CCC	A|0.248;C|0.000;G|0.752		0.746	C22orf26-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317994.1		
IQSEC1	9922	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	12977227	12977227	+	Missense_Mutation	SNP	G	G	C			TCGA-OR-A5LD-01A-11D-A29I-10	TCGA-OR-A5LD-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d84ce93-4c12-49da-87b3-c36d44672d59	afc22b50-442d-4fde-93ce-df0c281205c9	g.chr3:12977227G>C	ENST00000273221.4	-	3	1547	c.1331C>G	c.(1330-1332)cCc>cGc	p.P444R	IQSEC1_ENST00000473088.1_5'Flank	NM_014869.5	NP_055684.3	Q6DN90	IQEC1_HUMAN	IQ motif and Sec7 domain 1	444					actin cytoskeleton organization (GO:0030036)|positive regulation of GTPase activity (GO:0043547)|regulation of ARF protein signal transduction (GO:0032012)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nucleolus (GO:0005730)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)			breast(2)|endometrium(5)|kidney(1)|large_intestine(5)|lung(6)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	24						GCTGTCCAGGGGCCTGGGGGG	0.667																																					p.P444R		.											.	IQSEC1-91	0			c.C1331G						.						35.0	38.0	37.0					3																	12977227		2202	4300	6502	SO:0001583	missense	9922	exon3			TCCAGGGGCCTGG	BC010267	CCDS33703.1, CCDS74902.1	3p25.2	2011-09-23			ENSG00000144711	ENSG00000144711			29112	protein-coding gene	gene with protein product	"""brefeldin A-resistant ARF-GEF2"""	610166				9872452, 8619474	Standard	NM_001134382		Approved	KIAA0763, GEP100, BRAG2, ARF-GEP100	uc011auw.2	Q6DN90	OTTHUMG00000155398	ENST00000273221.4:c.1331C>G	3.37:g.12977227G>C	ENSP00000273221:p.Pro444Arg	Somatic	56	0		WXS	Illumina GAIIx	Phase_I	54	12	NM_014869	0	0	0	0	0	O94863|Q96D85	Missense_Mutation	SNP	ENST00000273221.4	37	CCDS33703.1	.	.	.	.	.	.	.	.	.	.	G	15.81	2.942589	0.53079	.	.	ENSG00000144711	ENST00000273221;ENST00000435445;ENST00000429247	T;T	0.41758	0.99;0.99	5.38	4.51	0.55191	.	0.338170	0.32687	N	0.005761	T	0.40719	0.1128	.	.	.	0.44547	D	0.997501	P;P;P	0.51933	0.941;0.941;0.949	P;P;P	0.47864	0.559;0.536;0.548	T	0.12863	-1.0531	9	0.17369	T	0.5	.	14.0251	0.64582	0.073:0.0:0.927:0.0	.	430;430;444	E9PG60;C9JMG9;Q6DN90	.;.;IQEC1_HUMAN	R	444;430;430	ENSP00000273221:P444R;ENSP00000402299:P430R	ENSP00000273221:P444R	P	-	2	0	IQSEC1	12952227	1.000000	0.71417	0.972000	0.41901	0.809000	0.45718	5.566000	0.67372	1.272000	0.44329	0.655000	0.94253	CCC	.		0.667	IQSEC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000339865.2	NM_014869	
LSM3	27258	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	14220380	14220380	+	Splice_Site	SNP	A	A	C	rs200658802		TCGA-OR-A5LD-01A-11D-A29I-10	TCGA-OR-A5LD-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d84ce93-4c12-49da-87b3-c36d44672d59	afc22b50-442d-4fde-93ce-df0c281205c9	g.chr3:14220380A>C	ENST00000306024.3	+	1	523	c.20A>C	c.(19-21)cAg>cCg	p.Q7P	XPC_ENST00000449060.2_5'Flank|XPC_ENST00000285021.7_5'Flank	NM_014463.2	NP_055278.1	P62310	LSM3_HUMAN	LSM3 homolog, U6 small nuclear RNA associated (S. cerevisiae)	7					exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay (GO:0043928)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|mRNA processing (GO:0006397)|mRNA splicing, via spliceosome (GO:0000398)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|RNA metabolic process (GO:0016070)	catalytic step 2 spliceosome (GO:0071013)|cytosol (GO:0005829)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			central_nervous_system(1)|large_intestine(2)|ovary(1)	4						GACGTAGACCAGGTAAGTGTA	0.517																																					p.Q7P		.											.	LSM3-91	0			c.A20C						.						111.0	105.0	107.0					3																	14220380		2203	4300	6503	SO:0001630	splice_region_variant	27258	exon1			TAGACCAGGTAAG	AF182289	CCDS2619.1	3p25.1	2012-08-15			ENSG00000170860	ENSG00000170860			17874	protein-coding gene	gene with protein product		607283				10369684	Standard	NM_014463		Approved	YLR438C, SMX4, USS2	uc003byn.3	P62310	OTTHUMG00000129838	ENST00000306024.3:c.21+1A>C	3.37:g.14220380A>C		Somatic	152	9		WXS	Illumina GAIIx	Phase_I	138	42	NM_014463	0	0	0	0	0	Q6IAH0|Q9Y4Z1	Missense_Mutation	SNP	ENST00000306024.3	37	CCDS2619.1	.	.	.	.	.	.	.	.	.	.	A	16.40	3.113312	0.56398	.	.	ENSG00000170860	ENST00000306024	.	.	.	5.5	5.5	0.81552	.	0.000000	0.85682	D	0.000000	T	0.44498	0.1296	N	0.22421	0.69	0.80722	D	1	B	0.02656	0.0	B	0.04013	0.001	T	0.30208	-0.9986	9	0.34782	T	0.22	-10.1698	14.4451	0.67345	1.0:0.0:0.0:0.0	.	7	P62310	LSM3_HUMAN	P	7	.	ENSP00000302160:Q7P	Q	+	2	0	LSM3	14195384	1.000000	0.71417	1.000000	0.80357	0.846000	0.48090	6.735000	0.74806	2.085000	0.62840	0.482000	0.46254	CAG	A|0.999;C|0.001		0.517	LSM3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252078.3	NM_014463	Missense_Mutation
LZTFL1	54585	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	45879475	45879475	+	Missense_Mutation	SNP	C	C	G			TCGA-OR-A5LD-01A-11D-A29I-10	TCGA-OR-A5LD-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d84ce93-4c12-49da-87b3-c36d44672d59	afc22b50-442d-4fde-93ce-df0c281205c9	g.chr3:45879475C>G	ENST00000296135.6	-	2	246	c.72G>C	c.(70-72)aaG>aaC	p.K24N	LZTFL1_ENST00000539217.1_Intron|LZTFL1_ENST00000536047.1_Missense_Mutation_p.K7N|LZTFL1_ENST00000490463.1_5'UTR	NM_001276378.1|NM_020347.2	NP_001263307.1|NP_065080.1	Q9NQ48	LZTL1_HUMAN	leucine zipper transcription factor-like 1	24					establishment of protein localization to organelle (GO:0072594)	BBSome (GO:0034464)|cytoplasm (GO:0005737)	identical protein binding (GO:0042802)			endometrium(1)|large_intestine(2)|lung(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(2)	8				BRCA - Breast invasive adenocarcinoma(193;0.00867)|KIRC - Kidney renal clear cell carcinoma(197;0.0177)|Kidney(197;0.0208)		TCAAGCCTCTCTTTGAACGAG	0.393																																					p.K24N		.											.	LZTFL1-90	0			c.G72C						.						76.0	77.0	76.0					3																	45879475		2203	4300	6503	SO:0001583	missense	54585	exon2			GCCTCTCTTTGAA	AJ297351	CCDS2731.1, CCDS63608.1, CCDS63609.1	3p21.3	2014-01-28			ENSG00000163818	ENSG00000163818			6741	protein-coding gene	gene with protein product		606568				11352561, 22510444	Standard	NM_020347		Approved	BBS17	uc003cox.2	Q9NQ48	OTTHUMG00000133452	ENST00000296135.6:c.72G>C	3.37:g.45879475C>G	ENSP00000296135:p.Lys24Asn	Somatic	59	0		WXS	Illumina GAIIx	Phase_I	60	16	NM_020347	0	0	0	0	0	B3KSI9|B4E0K7|Q8TC61|Q9NQ56	Missense_Mutation	SNP	ENST00000296135.6	37	CCDS2731.1	.	.	.	.	.	.	.	.	.	.	C	16.64	3.179833	0.57800	.	.	ENSG00000163818	ENST00000296135;ENST00000536047;ENST00000445698	T;T;T	0.26067	1.76;1.76;1.76	5.49	-0.54	0.11861	.	0.086995	0.85682	D	0.000000	T	0.27832	0.0685	M	0.70595	2.14	0.80722	D	1	P	0.42785	0.79	B	0.42138	0.377	T	0.12400	-1.0549	10	0.54805	T	0.06	-25.5899	10.4369	0.44441	0.0:0.5432:0.0:0.4568	.	24	Q9NQ48	LZTL1_HUMAN	N	24;7;7	ENSP00000296135:K24N;ENSP00000439522:K7N;ENSP00000412240:K7N	ENSP00000296135:K24N	K	-	3	2	LZTFL1	45854479	1.000000	0.71417	0.993000	0.49108	0.990000	0.78478	0.681000	0.25320	-0.105000	0.12132	0.655000	0.94253	AAG	.		0.393	LZTFL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257326.3	NM_020347	
PTH1R	5745	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	46943321	46943321	+	Silent	SNP	C	C	A	rs151330461	byFrequency	TCGA-OR-A5LD-01A-11D-A29I-10	TCGA-OR-A5LD-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d84ce93-4c12-49da-87b3-c36d44672d59	afc22b50-442d-4fde-93ce-df0c281205c9	g.chr3:46943321C>A	ENST00000313049.5	+	11	1385	c.1182C>A	c.(1180-1182)gcC>gcA	p.A394A	PTH1R_ENST00000418619.1_Silent_p.A394A|PTH1R_ENST00000449590.1_Silent_p.A394A|PTH1R_ENST00000430002.2_Silent_p.A394A			Q03431	PTH1R_HUMAN	parathyroid hormone 1 receptor	394					adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|aging (GO:0007568)|bone mineralization (GO:0030282)|bone resorption (GO:0045453)|cell maturation (GO:0048469)|chondrocyte differentiation (GO:0002062)|G-protein coupled receptor signaling pathway (GO:0007186)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|negative regulation of cell proliferation (GO:0008285)|osteoblast development (GO:0002076)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of inositol phosphate biosynthetic process (GO:0060732)|skeletal system development (GO:0001501)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|brush border membrane (GO:0031526)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	parathyroid hormone receptor activity (GO:0004991)|peptide hormone binding (GO:0017046)|protein self-association (GO:0043621)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(3)|liver(1)|lung(5)|skin(2)|stomach(1)|urinary_tract(2)	19					Preotact(DB05829)|Teriparatide(DB06285)	AGACCAACGCCGGCCGGTGTG	0.637																																					p.A394A		.											.	PTH1R-522	0			c.C1182A						.						54.0	55.0	55.0					3																	46943321		2203	4300	6503	SO:0001819	synonymous_variant	5745	exon12			CAACGCCGGCCGG		CCDS2747.1	3p22-p21.1	2012-08-10	2008-11-18	2008-11-18	ENSG00000160801	ENSG00000160801		"""GPCR / Class B : Parathyroid hormone receptors"""	9608	protein-coding gene	gene with protein product		168468	"""parathyroid hormone receptor 1"""	PTHR, PTHR1		8020952	Standard	NM_001184744		Approved		uc021wxg.1	Q03431	OTTHUMG00000133515	ENST00000313049.5:c.1182C>A	3.37:g.46943321C>A		Somatic	236	0		WXS	Illumina GAIIx	Phase_I	201	52	NM_001184744	0	0	0	0	0	Q2M1U3	Silent	SNP	ENST00000313049.5	37	CCDS2747.1																																																																																			C|1.000;T|0.000		0.637	PTH1R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257481.1	NM_000316	
SEMA5B	54437	hgsc.bcm.edu	37	3	122631896	122631896	+	Missense_Mutation	SNP	A	A	T	rs2276782	byFrequency	TCGA-OR-A5LD-01A-11D-A29I-10	TCGA-OR-A5LD-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d84ce93-4c12-49da-87b3-c36d44672d59	afc22b50-442d-4fde-93ce-df0c281205c9	g.chr3:122631896A>T	ENST00000357599.3	-	18	2905	c.2519T>A	c.(2518-2520)gTc>gAc	p.V840D	SEMA5B_ENST00000195173.4_Missense_Mutation_p.V839D|SEMA5B_ENST00000451055.2_Missense_Mutation_p.V894D	NM_001031702.3|NM_001256348.1	NP_001026872.2|NP_001243277.1	Q9P283	SEM5B_HUMAN	sema domain, seven thrombospondin repeats (type 1 and type 1-like), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 5B	840			V -> D (in dbSNP:rs2276782). {ECO:0000269|PubMed:10819331, ECO:0000269|PubMed:14702039, ECO:0000269|PubMed:15489334}.		cell differentiation (GO:0030154)|nervous system development (GO:0007399)	integral component of membrane (GO:0016021)	receptor activity (GO:0004872)			breast(2)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(13)|lung(26)|ovary(2)|pancreas(3)|skin(2)|upper_aerodigestive_tract(3)	55				GBM - Glioblastoma multiforme(114;0.0367)		GCGCAGGAGGACCTCCACCAG	0.791													T|||	3010	0.601038	0.5348	0.621	5008	,	,		11243	0.3522		0.8082	False		,,,				2504	0.7198				p.V894D		.											.	SEMA5B-157	0			c.T2681A						.	T	ASP/VAL	2573,1477		827,919,279	4.0	5.0	5.0		2519	5.0	1.0	3	dbSNP_100	5	6625,1195		2828,969,113	no	missense	SEMA5B	NM_001031702.2	152	3655,1888,392	TT,TA,AA		15.2813,36.4691,22.5105	benign	840/1152	122631896	9198,2672	2025	3910	5935	SO:0001583	missense	54437	exon18			AGGAGGACCTCCA	AB040878	CCDS35491.1, CCDS58848.1, CCDS74995.1	3q21.1	2008-07-18			ENSG00000082684	ENSG00000082684		"""Semaphorins"""	10737	protein-coding gene	gene with protein product		609298		SEMAG		8817451	Standard	NM_001256346		Approved	SemG, KIAA1445, FLJ10372	uc031sbm.1	Q9P283	OTTHUMG00000140392	ENST00000357599.3:c.2519T>A	3.37:g.122631896A>T	ENSP00000350215:p.Val840Asp	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	4	4	NM_001256347	0	0	0	0	0	A8K5U2|B7Z393|F8W9U8|Q6DD89|Q6UY12|Q9NW17	Missense_Mutation	SNP	ENST00000357599.3	37	CCDS35491.1	1286	0.5888278388278388	247	0.5020325203252033	243	0.6712707182320442	193	0.3374125874125874	603	0.7955145118733509	T	5.344	0.248763	0.10130	0.635309	0.847187	ENSG00000082684	ENST00000357599;ENST00000195173;ENST00000418793;ENST00000451055;ENST00000393583	T;T;T;T	0.34072	1.43;1.38;1.48;1.5	5.01	5.01	0.66863	.	0.161766	0.52532	N	0.000069	T	0.00012	0.0000	N	0.00246	-1.78	0.30182	P	0.8002819999999999	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.39354	-0.9618	9	0.02654	T	1	.	10.6514	0.45651	0.1435:0.0:0.0:0.8565	rs2276782	782;840	D3YTI7;Q9P283	.;SEM5B_HUMAN	D	840;839;782;894;840	ENSP00000350215:V840D;ENSP00000195173:V839D;ENSP00000389588:V894D;ENSP00000377208:V840D	ENSP00000195173:V839D	V	-	2	0	SEMA5B	124114586	1.000000	0.71417	0.990000	0.47175	0.785000	0.44390	4.886000	0.63149	0.945000	0.37605	-0.257000	0.10917	GTC	T|0.412;A|0.588		0.791	SEMA5B-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000277165.1	NM_001031702	
MME	4311	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	154884739	154884739	+	Missense_Mutation	SNP	C	C	A			TCGA-OR-A5LD-01A-11D-A29I-10	TCGA-OR-A5LD-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d84ce93-4c12-49da-87b3-c36d44672d59	afc22b50-442d-4fde-93ce-df0c281205c9	g.chr3:154884739C>A	ENST00000460393.1	+	18	1829	c.1709C>A	c.(1708-1710)tCc>tAc	p.S570Y	MME_ENST00000492661.1_Missense_Mutation_p.S570Y|MME_ENST00000493237.1_Missense_Mutation_p.S570Y|MME_ENST00000360490.2_Missense_Mutation_p.S570Y|MME-AS1_ENST00000484721.1_RNA|MME_ENST00000462745.1_Missense_Mutation_p.S570Y	NM_000902.3|NM_007287.2	NP_000893.2|NP_009218.2	P08473	NEP_HUMAN	membrane metallo-endopeptidase	570					angiotensin maturation (GO:0002003)|beta-amyloid metabolic process (GO:0050435)|cellular protein metabolic process (GO:0044267)|cellular response to cytokine stimulus (GO:0071345)|cellular response to UV-A (GO:0071492)|cellular response to UV-B (GO:0071493)|creatinine metabolic process (GO:0046449)|kidney development (GO:0001822)|peptide metabolic process (GO:0006518)|proteolysis (GO:0006508)|replicative senescence (GO:0090399)|sensory perception of pain (GO:0019233)	axon (GO:0030424)|brush border (GO:0005903)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|neuron projection terminus (GO:0044306)|plasma membrane (GO:0005886)|synapse (GO:0045202)|synaptic vesicle (GO:0008021)	endopeptidase activity (GO:0004175)|metalloendopeptidase activity (GO:0004222)|peptide binding (GO:0042277)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|lung(31)|ovary(3)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)	64		all_neural(597;0.00391)|Myeloproliferative disorder(1037;0.0122)	LUSC - Lung squamous cell carcinoma(72;0.114)|Lung(72;0.135)		Candoxatril(DB00616)|Liraglutide(DB06655)	GCCCAGCAGTCCAACTCATTG	0.458																																					p.S570Y		.											.	MME-516	0			c.C1709A						.						142.0	136.0	138.0					3																	154884739		2203	4300	6503	SO:0001583	missense	4311	exon18			AGCAGTCCAACTC		CCDS3172.1	3q25.2	2012-01-31	2007-02-21		ENSG00000196549	ENSG00000196549	3.4.24.11	"""CD molecules"""	7154	protein-coding gene	gene with protein product	"""neutral endopeptidase"", ""enkephalinase"", ""neprilysin"""	120520					Standard	NM_007287		Approved	CALLA, CD10, NEP	uc003fad.1	P08473	OTTHUMG00000158455	ENST00000460393.1:c.1709C>A	3.37:g.154884739C>A	ENSP00000418525:p.Ser570Tyr	Somatic	111	0		WXS	Illumina GAIIx	Phase_I	103	30	NM_007287	0	0	0	0	0	A8K6U6|D3DNJ9|Q3MIX4	Missense_Mutation	SNP	ENST00000460393.1	37	CCDS3172.1	.	.	.	.	.	.	.	.	.	.	C	24.4	4.522789	0.85600	.	.	ENSG00000196549	ENST00000492661;ENST00000460393;ENST00000462745;ENST00000493237;ENST00000360490	D;D;D;D;D	0.83250	-1.7;-1.7;-1.7;-1.7;-1.7	5.9	5.9	0.94986	Peptidase M13, neprilysin, C-terminal (1);Metallopeptidase, catalytic domain (1);	0.254103	0.40818	N	0.001009	D	0.89729	0.6799	M	0.71296	2.17	0.42799	D	0.993922	D	0.53619	0.961	P	0.57620	0.824	D	0.90107	0.4189	10	0.87932	D	0	-1.8467	20.2789	0.98501	0.0:1.0:0.0:0.0	.	570	P08473	NEP_HUMAN	Y	570	ENSP00000420389:S570Y;ENSP00000418525:S570Y;ENSP00000419653:S570Y;ENSP00000417079:S570Y;ENSP00000353679:S570Y	ENSP00000353679:S570Y	S	+	2	0	MME	156367433	0.909000	0.30893	0.998000	0.56505	0.999000	0.98932	3.901000	0.56303	2.788000	0.95919	0.650000	0.86243	TCC	.		0.458	MME-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351076.1	NM_000902	
AHSG	197	bcgsc.ca	37	3	186338564	186338564	+	Missense_Mutation	SNP	C	C	T	rs35457250	byFrequency	TCGA-OR-A5LD-01A-11D-A29I-10	TCGA-OR-A5LD-10A-01D-A29L-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d84ce93-4c12-49da-87b3-c36d44672d59	afc22b50-442d-4fde-93ce-df0c281205c9	g.chr3:186338564C>T	ENST00000273784.5	+	7	1028	c.952C>T	c.(952-954)Cgc>Tgc	p.R318C	AHSG_ENST00000411641.2_Missense_Mutation_p.R317C	NM_001622.2	NP_001613.2	P02765	FETUA_HUMAN	alpha-2-HS-glycoprotein	317					acute-phase response (GO:0006953)|negative regulation of bone mineralization (GO:0030502)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of phosphorylation (GO:0042326)|ossification (GO:0001503)|pinocytosis (GO:0006907)|positive regulation of phagocytosis (GO:0050766)|regulation of bone mineralization (GO:0030500)|regulation of inflammatory response (GO:0050727)|skeletal system development (GO:0001501)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	cysteine-type endopeptidase inhibitor activity (GO:0004869)|kinase inhibitor activity (GO:0019210)			central_nervous_system(1)|kidney(1)|large_intestine(2)|lung(15)|prostate(2)|stomach(1)	22	all_cancers(143;3.64e-12)|Ovarian(172;0.0339)		OV - Ovarian serous cystadenocarcinoma(80;3.27e-20)	GBM - Glioblastoma multiforme(93;0.0463)		CTACGACCTGCGCCACACCTT	0.627													.|||	18	0.00359425	0.0008	0.0086	5008	,	,		19690	0.0		0.0099	False		,,,				2504	0.001				p.R317C		.											.	AHSG-90	0			c.C949T						.	C	CYS/ARG	3,4403	6.2+/-15.9	0,3,2200	97.0	97.0	97.0		949	3.4	0.9	3	dbSNP_126	97	67,8533	39.8+/-96.3	0,67,4233	yes	missense	AHSG	NM_001622.2	180	0,70,6433	TT,TC,CC		0.7791,0.0681,0.5382	probably-damaging	317/368	186338564	70,12936	2203	4300	6503	SO:0001583	missense	197	exon7			GACCTGCGCCACA	D67013, M16961	CCDS3278.1	3q27.3	2006-02-22			ENSG00000145192	ENSG00000145192			349	protein-coding gene	gene with protein product		138680				9322749, 7736783	Standard	NM_001622		Approved	FETUA, A2HS, HSGA	uc003fqk.4	P02765	OTTHUMG00000156605	ENST00000273784.5:c.952C>T	3.37:g.186338564C>T	ENSP00000273784:p.Arg318Cys	Somatic	172	2		WXS	Illumina GAIIx	Phase_I	168	6	NM_001622	0	0	0	0	0	A8K9N6|B2R7G1|O14961|O14962|Q9P152	Missense_Mutation	SNP	ENST00000273784.5	37		16	0.007326007326007326	0	0.0	5	0.013812154696132596	0	0.0	11	0.014511873350923483	c	13.99	2.402541	0.42613	6.81E-4	0.007791	ENSG00000145192	ENST00000411641;ENST00000541510;ENST00000273784	T;T	0.08807	3.06;3.05	5.47	3.43	0.39272	.	0.476987	0.18976	N	0.126003	T	0.17916	0.0430	M	0.78456	2.415	0.39824	D	0.972881	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.87578	0.997;0.998;0.998	T	0.01401	-1.1364	10	0.87932	D	0	-16.2674	5.7642	0.18217	0.2338:0.6695:0.0:0.0967	rs35457250	383;317;318	F5H0Q5;P02765;C9JV77	.;FETUA_HUMAN;.	C	317;383;318	ENSP00000393887:R317C;ENSP00000273784:R318C	ENSP00000273784:R318C	R	+	1	0	AHSG	187821258	0.437000	0.25593	0.850000	0.33497	0.046000	0.14306	1.353000	0.34045	1.452000	0.47756	0.563000	0.77884	CGC	C|0.993;T|0.007		0.627	AHSG-002	NOVEL	basic|appris_candidate_longest|exp_conf	protein_coding	protein_coding	OTTHUMT00000344762.1	NM_001622	
CRIPAK	285464	hgsc.bcm.edu	37	4	1388755	1388755	+	Silent	SNP	C	C	G	rs373946226	byFrequency	TCGA-OR-A5LD-01A-11D-A29I-10	TCGA-OR-A5LD-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d84ce93-4c12-49da-87b3-c36d44672d59	afc22b50-442d-4fde-93ce-df0c281205c9	g.chr4:1388755C>G	ENST00000324803.4	+	1	3416	c.456C>G	c.(454-456)ccC>ccG	p.P152P		NM_175918.3	NP_787114.2	Q8N1N5	CRPAK_HUMAN	cysteine-rich PAK1 inhibitor	152					negative regulation of intracellular estrogen receptor signaling pathway (GO:0033147)|negative regulation of protein kinase activity (GO:0006469)|regulation of cytoskeleton organization (GO:0051493)|response to estrogen (GO:0043627)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				NS(3)|breast(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(11)|ovary(1)|pancreas(2)|prostate(6)|skin(4)|urinary_tract(1)	35			OV - Ovarian serous cystadenocarcinoma(23;0.0106)			CACACGTGCCCATGCGGAGTG	0.697													N|||	566	0.113019	0.0772	0.1657	5008	,	,		16075	0.0139		0.1441	False		,,,				2504	0.1943				p.P152P		.											.	CRIPAK-90	0			c.C456G						.						75.0	67.0	69.0					4																	1388755		2201	4282	6483	SO:0001819	synonymous_variant	285464	exon1			CGTGCCCATGCGG	AK096209	CCDS3349.1	4p16.3	2011-02-10	2006-09-04		ENSG00000179979	ENSG00000179979			26619	protein-coding gene	gene with protein product		610203	"""cysteine-rich PAK1inhibitor"""			16278681	Standard	NM_175918		Approved	FLJ34443	uc003gdf.2	Q8N1N5	OTTHUMG00000121131	ENST00000324803.4:c.456C>G	4.37:g.1388755C>G		Somatic	19	0		WXS	Illumina GAIIx	Phase_I	62	10	NM_175918	0	0	3	6	3	Q8NB03	Silent	SNP	ENST00000324803.4	37	CCDS3349.1	.	.	.	.	.	.	.	.	.	.	-	3.606	-0.080629	0.07141	.	.	ENSG00000179979	ENST00000382944	.	.	.	0.948	-1.9	0.07665	.	.	.	.	.	T	0.13713	0.0332	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.26643	-1.0097	5	0.12430	T	0.62	.	2.6602	0.05024	0.0:0.3324:0.2607:0.407	.	.	.	.	D	136	.	ENSP00000372402:H136D	H	+	1	0	CRIPAK	1378755	0.000000	0.05858	0.001000	0.08648	0.018000	0.09664	-4.277000	0.00261	-0.599000	0.05798	-1.737000	0.00689	CAT	C|0.960;G|0.040		0.697	CRIPAK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000241607.2	NM_175918	
CRIPAK	285464	bcgsc.ca	37	4	1388790	1388790	+	Missense_Mutation	SNP	T	T	C	rs79415192		TCGA-OR-A5LD-01A-11D-A29I-10	TCGA-OR-A5LD-10A-01D-A29L-10	T	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d84ce93-4c12-49da-87b3-c36d44672d59	afc22b50-442d-4fde-93ce-df0c281205c9	g.chr4:1388790T>C	ENST00000324803.4	+	1	3451	c.491T>C	c.(490-492)gTg>gCg	p.V164A		NM_175918.3	NP_787114.2	Q8N1N5	CRPAK_HUMAN	cysteine-rich PAK1 inhibitor	164					negative regulation of intracellular estrogen receptor signaling pathway (GO:0033147)|negative regulation of protein kinase activity (GO:0006469)|regulation of cytoskeleton organization (GO:0051493)|response to estrogen (GO:0043627)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|nucleus (GO:0005634)|plasma membrane (GO:0005886)		p.V164A(1)		NS(3)|breast(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(11)|ovary(1)|pancreas(2)|prostate(6)|skin(4)|urinary_tract(1)	35			OV - Ovarian serous cystadenocarcinoma(23;0.0106)			CGTGCCGACGTGGAGTGCCCG	0.692																																					p.V164A		.											.	CRIPAK-90	1	Substitution - Missense(1)	lung(1)	c.T491C						.						180.0	124.0	143.0					4																	1388790		2201	4281	6482	SO:0001583	missense	285464	exon1			CCGACGTGGAGTG	AK096209	CCDS3349.1	4p16.3	2011-02-10	2006-09-04		ENSG00000179979	ENSG00000179979			26619	protein-coding gene	gene with protein product		610203	"""cysteine-rich PAK1inhibitor"""			16278681	Standard	NM_175918		Approved	FLJ34443	uc003gdf.2	Q8N1N5	OTTHUMG00000121131	ENST00000324803.4:c.491T>C	4.37:g.1388790T>C	ENSP00000323978:p.Val164Ala	Somatic	26	1		WXS	Illumina GAIIx	Phase_I	42	15	NM_175918	0	0	5	6	1	Q8NB03	Missense_Mutation	SNP	ENST00000324803.4	37	CCDS3349.1	.	.	.	.	.	.	.	.	.	.	t	1.148	-0.647432	0.03506	.	.	ENSG00000179979	ENST00000324803	T	0.24350	1.86	1.25	-2.49	0.06403	.	.	.	.	.	T	0.08714	0.0216	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.20174	-1.0283	9	0.14252	T	0.57	.	0.8761	0.01224	0.1598:0.3215:0.2492:0.2695	.	164	Q8N1N5	CRPAK_HUMAN	A	164	ENSP00000323978:V164A	ENSP00000323978:V164A	V	+	2	0	CRIPAK	1378790	0.000000	0.05858	0.000000	0.03702	0.005000	0.04900	-0.847000	0.04331	-2.974000	0.00285	-1.550000	0.00899	GTG	C|1.000;|0.000		0.692	CRIPAK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000241607.2	NM_175918	
STIM2	57620	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	26997088	26997088	+	Missense_Mutation	SNP	A	A	G			TCGA-OR-A5LD-01A-11D-A29I-10	TCGA-OR-A5LD-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d84ce93-4c12-49da-87b3-c36d44672d59	afc22b50-442d-4fde-93ce-df0c281205c9	g.chr4:26997088A>G	ENST00000467011.1	+	4	910	c.485A>G	c.(484-486)aAt>aGt	p.N162S	STIM2_ENST00000382009.3_Missense_Mutation_p.N249S|STIM2_ENST00000465503.1_Missense_Mutation_p.N162S|STIM2_ENST00000237364.5_Missense_Mutation_p.N249S|STIM2_ENST00000467087.1_Missense_Mutation_p.N162S|STIM2_ENST00000412829.2_Missense_Mutation_p.N249S	NM_001169117.1	NP_001162588	Q9P246	STIM2_HUMAN	stromal interaction molecule 2	162	SAM. {ECO:0000255|PROSITE- ProRule:PRU00184}.				activation of store-operated calcium channel activity (GO:0032237)|calcium ion transmembrane transport (GO:0070588)|cellular calcium ion homeostasis (GO:0006874)|positive regulation of calcium ion transport (GO:0051928)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium channel regulator activity (GO:0005246)|calcium ion binding (GO:0005509)|store-operated calcium channel activity (GO:0015279)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(9)|lung(7)|prostate(1)|skin(2)|urinary_tract(1)	25		Breast(46;0.0503)				AGAGACAACAATGTCAAAGGA	0.388																																					p.N162S		.											.	STIM2-91	0			c.A485G						.						118.0	124.0	122.0					4																	26997088		2203	4300	6503	SO:0001583	missense	57620	exon4			ACAACAATGTCAA	AB040915	CCDS3440.1, CCDS3440.2, CCDS54751.1, CCDS54752.1	4p15.2	2013-01-10			ENSG00000109689	ENSG00000109689		"""Sterile alpha motif (SAM) domain containing"""	19205	protein-coding gene	gene with protein product		610841				11463338	Standard	NM_020860		Approved		uc003gsh.4	Q9P246	OTTHUMG00000097805	ENST00000467011.1:c.485A>G	4.37:g.26997088A>G	ENSP00000419383:p.Asn162Ser	Somatic	95	0		WXS	Illumina GAIIx	Phase_I	67	16	NM_001169118	0	0	3	3	0	A6H8L7|B7ZVY0|Q96BF1|Q9BQH2|Q9H8R1	Missense_Mutation	SNP	ENST00000467011.1	37	CCDS54752.1	.	.	.	.	.	.	.	.	.	.	A	9.876	1.200334	0.22121	.	.	ENSG00000109689	ENST00000467087;ENST00000382009;ENST00000237364;ENST00000467011;ENST00000412829;ENST00000465503	D;D;D;D;D;D	0.85258	-1.96;-1.96;-1.96;-1.96;-1.96;-1.96	4.64	4.64	0.57946	.	0.247628	0.41823	D	0.000810	T	0.75072	0.3800	N	0.25647	0.755	0.29458	N	0.857949	B;B;B	0.15473	0.013;0.013;0.011	B;B;B	0.18263	0.021;0.021;0.012	T	0.66015	-0.6028	10	0.27785	T	0.31	.	10.5285	0.44963	0.8377:0.1623:0.0:0.0	.	249;249;249	A6H8L7;E9PGD0;F5GXJ4	.;.;.	S	162;249;249;162;249;162	ENSP00000419073:N162S;ENSP00000371439:N249S;ENSP00000237364:N249S;ENSP00000419383:N162S;ENSP00000404812:N249S;ENSP00000417569:N162S	ENSP00000237364:N249S	N	+	2	0	STIM2	26606186	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	2.148000	0.42235	1.851000	0.53745	0.482000	0.46254	AAT	.		0.388	STIM2-003	NOVEL	basic|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000356861.1	NM_020860	
DSPP	1834	bcgsc.ca	37	4	88536550	88536550	+	Silent	SNP	T	T	C	rs111215872|rs111456637	byFrequency	TCGA-OR-A5LD-01A-11D-A29I-10	TCGA-OR-A5LD-10A-01D-A29L-10	T	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d84ce93-4c12-49da-87b3-c36d44672d59	afc22b50-442d-4fde-93ce-df0c281205c9	g.chr4:88536550T>C	ENST00000282478.7	+	4	2769	c.2736T>C	c.(2734-2736)agT>agC	p.S912S	RP11-742B18.1_ENST00000506480.1_RNA|DSPP_ENST00000399271.1_Silent_p.S912S			Q9NZW4	DSPP_HUMAN	dentin sialophosphoprotein	912	Asp/Ser-rich.				biomineral tissue development (GO:0031214)|cellular response to cell-matrix adhesion (GO:0071460)|extracellular matrix organization (GO:0030198)|multicellular organismal development (GO:0007275)|ossification (GO:0001503)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|collagen binding (GO:0005518)|extracellular matrix structural constituent (GO:0005201)	p.S912S(1)		breast(2)|central_nervous_system(1)|endometrium(9)|kidney(4)|large_intestine(8)|lung(13)|ovary(1)|skin(3)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	47		Hepatocellular(203;0.114)|all_hematologic(202;0.236)		OV - Ovarian serous cystadenocarcinoma(123;0.000508)		gcaacagcagtgacagcagtg	0.488													T|||	1014	0.202476	0.1982	0.2637	5008	,	,		33910	0.1111		0.2972	False		,,,				2504	0.1616				p.S912S		.											.	DSPP-90	1	Substitution - coding silent(1)	stomach(1)	c.T2736C						.			276,2946		18,240,1353	65.0	93.0	83.0		2736	0.4	0.9	4	dbSNP_134	83	1274,4674		128,1018,1828	no	coding-synonymous	DSPP	NM_014208.3		146,1258,3181	CC,CT,TT		21.419,8.5661,16.9029		912/1302	88536550	1550,7620	1611	2974	4585	SO:0001819	synonymous_variant	1834	exon5			CAGCAGTGACAGC	AF163151	CCDS43248.1	4q21.3	2008-02-05			ENSG00000152591	ENSG00000152591			3054	protein-coding gene	gene with protein product		125485		DFNA39, DGI1		8995371, 9533027	Standard	NM_014208		Approved	DMP3	uc003hqu.3	Q9NZW4	OTTHUMG00000161061	ENST00000282478.7:c.2736T>C	4.37:g.88536550T>C		Somatic	560	5		WXS	Illumina GAIIx	Phase_I	564	17	NM_014208	0	0	0	0	0	A8MUI0|O95815	Silent	SNP	ENST00000282478.7	37	CCDS43248.1																																																																																			.		0.488	DSPP-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000363616.3	NM_014208	
FRG1	2483	bcgsc.ca	37	4	190874269	190874269	+	Missense_Mutation	SNP	A	A	T			TCGA-OR-A5LD-01A-11D-A29I-10	TCGA-OR-A5LD-10A-01D-A29L-10	A	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d84ce93-4c12-49da-87b3-c36d44672d59	afc22b50-442d-4fde-93ce-df0c281205c9	g.chr4:190874269A>T	ENST00000226798.4	+	4	528	c.306A>T	c.(304-306)ttA>ttT	p.L102F	FRG1_ENST00000514482.1_3'UTR	NM_004477.2	NP_004468.1	Q14331	FRG1_HUMAN	FSHD region gene 1	102					mRNA splicing, via spliceosome (GO:0000398)|muscle organ development (GO:0007517)|rRNA processing (GO:0006364)	catalytic step 2 spliceosome (GO:0071013)|cytoplasm (GO:0005737)	poly(A) RNA binding (GO:0044822)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(2)|lung(11)|ovary(1)|pancreas(1)|prostate(5)|skin(7)|urinary_tract(1)	32		all_cancers(14;1.44e-58)|all_epithelial(14;6.32e-41)|all_lung(41;8.13e-17)|Lung NSC(41;2.13e-16)|Breast(6;2.54e-06)|Melanoma(20;0.000263)|Hepatocellular(41;0.00213)|Renal(120;0.0183)|all_hematologic(60;0.0358)|Prostate(90;0.0421)|all_neural(102;0.147)		all cancers(3;1.73e-30)|Epithelial(3;5.85e-30)|OV - Ovarian serous cystadenocarcinoma(60;5.56e-15)|BRCA - Breast invasive adenocarcinoma(30;9.14e-06)|Lung(3;3.54e-05)|STAD - Stomach adenocarcinoma(60;8.83e-05)|LUSC - Lung squamous cell carcinoma(40;0.000198)|GBM - Glioblastoma multiforme(59;0.00892)|READ - Rectum adenocarcinoma(43;0.161)		CTGTCAAATTATCTGATTCCA	0.294																																					p.L102F		.											.	FRG1-90	0			c.A306T						.																																			SO:0001583	missense	2483	exon4			CAAATTATCTGAT	L76159	CCDS34121.1	4q35	2008-02-05			ENSG00000109536	ENSG00000109536			3954	protein-coding gene	gene with protein product		601278				8733123	Standard	XM_005262880		Approved	FSG1, FRG1A	uc003izs.3	Q14331	OTTHUMG00000160202	ENST00000226798.4:c.306A>T	4.37:g.190874269A>T	ENSP00000226798:p.Leu102Phe	Somatic	463	6		WXS	Illumina GAIIx	Phase_I	337	13	NM_004477	0	0	0	0	0	A8K775	Missense_Mutation	SNP	ENST00000226798.4	37	CCDS34121.1	.	.	.	.	.	.	.	.	.	.	.	15.26	2.781529	0.49891	.	.	ENSG00000109536	ENST00000226798;ENST00000531991	T;T	0.47869	1.92;0.83	3.71	-2.26	0.06867	Actin cross-linking (1);	0.140469	0.45361	D	0.000367	T	0.58793	0.2147	M	0.78916	2.43	0.52501	D	0.999953	D	0.63046	0.992	D	0.70487	0.969	T	0.56805	-0.7918	10	0.72032	D	0.01	-23.2027	4.8679	0.13618	0.3579:0.0:0.5038:0.1383	.	102	Q14331	FRG1_HUMAN	F	102;39	ENSP00000226798:L102F;ENSP00000435943:L39F	ENSP00000226798:L102F	L	+	3	2	FRG1	191111263	1.000000	0.71417	0.969000	0.41365	0.937000	0.57800	0.757000	0.26433	-0.634000	0.05538	-0.959000	0.02639	TTA	.		0.294	FRG1-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000359622.4	NM_004477	
SMN2	6607	broad.mit.edu	37	5	69372372	69372372	+	Missense_Mutation	SNP	G	G	C	rs121909192	byFrequency	TCGA-OR-A5LD-01A-11D-A29I-10	TCGA-OR-A5LD-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d84ce93-4c12-49da-87b3-c36d44672d59	afc22b50-442d-4fde-93ce-df0c281205c9	g.chr5:69372372G>C	ENST00000380743.4	+	8	933	c.859G>C	c.(859-861)Gga>Cga	p.G287R	RN7SL9P_ENST00000584813.1_RNA|SMN2_ENST00000511812.1_Missense_Mutation_p.G220R|SMN2_ENST00000380741.4_Intron|SMN2_ENST00000380742.4_Missense_Mutation_p.G255R	NM_017411.3	NP_059107.1	Q16637	SMN_HUMAN	survival of motor neuron 2, centromeric	287	Required for interaction with SYNCRIP.				cell death (GO:0008219)|gene expression (GO:0010467)|ncRNA metabolic process (GO:0034660)|nervous system development (GO:0007399)|positive regulation of protein import into nucleus (GO:0042307)|RNA metabolic process (GO:0016070)|spliceosomal complex assembly (GO:0000245)|spliceosomal snRNP assembly (GO:0000387)	Cajal body (GO:0015030)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|Gemini of coiled bodies (GO:0097504)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|SMN complex (GO:0032797)|SMN-Sm protein complex (GO:0034719)	identical protein binding (GO:0042802)|RNA binding (GO:0003723)						Lung NSC(167;4.15e-05)|Prostate(74;0.00996)|Ovarian(174;0.0448)|Breast(144;0.198)		OV - Ovarian serous cystadenocarcinoma(47;3.04e-60)|Epithelial(20;7.09e-58)|all cancers(19;1.13e-53)|Lung(70;0.0174)		TCAAAAAGAAGGAAGGTGCTC	0.289													G|||	5	0.000998403	0.0	0.0	5008	,	,		11194	0.0		0.003	False		,,,				2504	0.002				p.G287R		.											.	SMN1-22	0			c.G859C						.	G	ARG/GLY,,ARG/GLY,	3,3627		1,1,1813	34.0	42.0	39.0	http://www.ncbi.nlm.nih.gov/sites/varvu?gene	859,,763,	2.5	1.0	5	dbSNP_133	39	38,7916		9,20,3948	no	missense,intron,missense,intron	SMN2	NM_017411.3,NM_022875.2,NM_022876.2,NM_022877.2	125,,125,	10,21,5761	CC,CG,GG		0.4777,0.0826,0.3539	probably-damaging,,probably-damaging,	287/295,,255/263,	69372372	41,11543	1815	3977	5792	SO:0001583	missense	6606	exon8			AAAGAAGGAAGGT		CCDS4007.1, CCDS4008.1	5q13.2	2014-09-17			ENSG00000205571	ENSG00000205571		"""Tudor domain containing"""	11118	protein-coding gene	gene with protein product	"""tudor domain containing 16B"""	601627				7813012	Standard	NM_022875		Approved	BCD541, SMNC, GEMIN1, TDRD16B	uc003jyd.3	Q16637	OTTHUMG00000099389	ENST00000380743.4:c.859G>C	5.37:g.69372372G>C	ENSP00000370119:p.Gly287Arg	Somatic	93	2		WXS	Illumina GAIIx	Phase_I	70	5	NM_000344	0	0	34	34	0	A8K0V4|Q13119|Q549U5|Q96J51	Missense_Mutation	SNP	ENST00000380743.4	37	CCDS4007.1	.	.	.	.	.	.	.	.	.	.	G	11.37	1.618199	0.28801	8.26E-4	0.004777	ENSG00000205571	ENST00000380743;ENST00000511812;ENST00000380742	D;D;D	0.98968	-4.94;-4.94;-5.28	2.5	2.5	0.30297	Survival motor neuron (1);	0.131439	0.49305	U	0.000145	D	0.98585	0.9527	M	0.73962	2.25	0.80722	A	1	D;D;D	0.76494	0.999;0.999;0.999	D;D;D	0.81914	0.995;0.991;0.995	D	0.99383	1.0923	9	0.40728	T	0.16	-2.2273	8.5419	0.33397	0.0:0.0:1.0:0.0	.	220;255;287	B4DP61;Q16637-2;Q16637	.;.;SMN_HUMAN	R	287;220;255	ENSP00000370119:G287R;ENSP00000424282:G220R;ENSP00000370118:G255R	ENSP00000370118:G255R	G	+	1	0	SMN2	69408128	1.000000	0.71417	1.000000	0.80357	0.464000	0.32679	2.276000	0.43408	1.389000	0.46526	0.184000	0.17185	GGA	G|0.996;C|0.004		0.289	SMN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000216845.2	NM_017411	
SLCO6A1	133482	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	101748695	101748695	+	Splice_Site	SNP	T	T	G			TCGA-OR-A5LD-01A-11D-A29I-10	TCGA-OR-A5LD-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d84ce93-4c12-49da-87b3-c36d44672d59	afc22b50-442d-4fde-93ce-df0c281205c9	g.chr5:101748695T>G	ENST00000506729.1	-	9	1796	c.1625A>C	c.(1624-1626)aAg>aCg	p.K542T	SLCO6A1_ENST00000379810.1_Splice_Site_p.K289T|SLCO6A1_ENST00000513675.1_Splice_Site_p.K289T|SLCO6A1_ENST00000379807.3_Splice_Site_p.K542T|SLCO6A1_ENST00000389019.3_Splice_Site_p.K480T			Q86UG4	SO6A1_HUMAN	solute carrier organic anion transporter family, member 6A1	542	Kazal-like. {ECO:0000255|PROSITE- ProRule:PRU00798}.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	transporter activity (GO:0005215)	p.K542fs*13(1)		breast(1)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(17)|lung(22)|ovary(3)|prostate(4)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	60		all_cancers(142;8e-09)|all_epithelial(76;2.83e-12)|Prostate(80;0.00125)|Colorectal(57;0.00342)|Ovarian(225;0.024)|Lung NSC(167;0.0259)|all_lung(232;0.0323)		Epithelial(69;1.47e-15)|COAD - Colon adenocarcinoma(37;0.0113)		aataatTACCTTTTTTTGGTT	0.234																																					p.K542T		.											.	SLCO6A1-96	1	Deletion - Frameshift(1)	large_intestine(1)	c.A1625C						.						10.0	10.0	10.0					5																	101748695		2105	4221	6326	SO:0001630	splice_region_variant	133482	exon9			ATTACCTTTTTTT	AF505657	CCDS34206.1, CCDS75282.1	5q21.2	2013-05-22			ENSG00000205359	ENSG00000205359		"""Solute carriers"""	23613	protein-coding gene	gene with protein product	"""cancer/testis antigen 48"""	613365					Standard	XM_005271874		Approved	OATP6A1, OATPY, MGC26949, CT48	uc003knp.3	Q86UG4	OTTHUMG00000162759	ENST00000506729.1:c.1626+1A>C	5.37:g.101748695T>G		Somatic	51	0		WXS	Illumina GAIIx	Phase_I	39	18	NM_173488	0	0	0	0	0	A6NHC1|Q6ZMY5|Q86UV2|Q8IYU5	Missense_Mutation	SNP	ENST00000506729.1	37	CCDS34206.1	.	.	.	.	.	.	.	.	.	.	T	12.15	1.851418	0.32699	.	.	ENSG00000205359	ENST00000506729;ENST00000379807;ENST00000389019;ENST00000513675;ENST00000379810	T;T;T;T;T	0.04360	3.64;3.64;3.64;3.64;3.64	5.17	4.0	0.46444	Major facilitator superfamily domain, general substrate transporter (1);Protease inhibitor, Kazal-type (1);	0.284988	0.28712	N	0.014390	T	0.14485	0.0350	L	0.58510	1.815	0.38754	D	0.954185	D;P;D	0.89917	0.999;0.94;1.0	D;P;D	0.79784	0.982;0.897;0.993	T	0.02424	-1.1161	10	0.39692	T	0.17	.	8.682	0.34214	0.0:0.0886:0.0:0.9114	.	480;289;542	Q86UG4-2;C9J020;Q86UG4	.;.;SO6A1_HUMAN	T	542;542;480;289;289	ENSP00000421339:K542T;ENSP00000369135:K542T;ENSP00000373671:K480T;ENSP00000421990:K289T;ENSP00000369138:K289T	ENSP00000369135:K542T	K	-	2	0	SLCO6A1	101776594	0.991000	0.36638	0.787000	0.31911	0.098000	0.18820	1.321000	0.33678	0.975000	0.38392	0.533000	0.62120	AAG	.		0.234	SLCO6A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000370335.1	NM_173488	Missense_Mutation
SOWAHA	134548	hgsc.bcm.edu	37	5	132149684	132149684	+	Missense_Mutation	SNP	G	G	C	rs40274	byFrequency	TCGA-OR-A5LD-01A-11D-A29I-10	TCGA-OR-A5LD-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d84ce93-4c12-49da-87b3-c36d44672d59	afc22b50-442d-4fde-93ce-df0c281205c9	g.chr5:132149684G>C	ENST00000378693.2	+	1	652	c.371G>C	c.(370-372)cGg>cCg	p.R124P		NM_175873.4	NP_787069.3	Q2M3V2	SWAHA_HUMAN	sosondowah ankyrin repeat domain family member A	124	Pro-rich.		R -> P (in dbSNP:rs40274).														CCCTTGGTCCGGGTGCCGCGG	0.776																																					p.R124P		.											.	.	0			c.G371C						.	C	PRO/ARG	2599,13		1293,13,0	2.0	3.0	3.0		371	-0.3	0.0	5	dbSNP_76	3	6177,193		2993,191,1	no	missense	ANKRD43	NM_175873.4	103	4286,204,1	CC,CG,GG		3.0298,0.4977,2.2935	benign	124/550	132149684	8776,206	1306	3185	4491	SO:0001583	missense	134548	exon1			TGGTCCGGGTGCC	AK090823	CCDS43361.1	5q23.3	2013-01-10	2012-01-12	2012-01-12	ENSG00000198944	ENSG00000198944		"""Ankyrin repeat domain containing"""	27033	protein-coding gene	gene with protein product			"""ankyrin repeat domain 43"""	ANKRD43		22234889	Standard	NM_175873		Approved		uc003kxw.3	Q2M3V2	OTTHUMG00000059844	ENST00000378693.2:c.371G>C	5.37:g.132149684G>C	ENSP00000367965:p.Arg124Pro	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	7	7	NM_175873	0	0	0	0	0	Q8NAE7	Missense_Mutation	SNP	ENST00000378693.2	37	CCDS43361.1	2142	0.9807692307692307	482	0.9796747967479674	357	0.9861878453038674	562	0.9825174825174825	741	0.9775725593667546	c	9.833	1.188835	0.21954	0.995023	0.969702	ENSG00000198944	ENST00000378693	T	0.38077	1.16	4.27	-0.265	0.12946	.	2.345400	0.02245	N	0.066177	T	0.00012	0.0000	N	0.08118	0	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.36261	-0.9755	9	0.30078	T	0.28	-5.2019	3.6102	0.08057	0.2245:0.4439:0.2467:0.085	rs40274	124	Q2M3V2	ANR43_HUMAN	P	124	ENSP00000367965:R124P	ENSP00000367965:R124P	R	+	2	0	ANKRD43	132177583	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-1.768000	0.01794	-0.003000	0.14444	-3.153000	0.00058	CGG	G|0.980;C|0.020		0.776	SOWAHA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000133062.1	NM_175873	
DOK3	79930	bcgsc.ca	37	5	176936590	176936590	+	Silent	SNP	T	T	C	rs2112181	byFrequency	TCGA-OR-A5LD-01A-11D-A29I-10	TCGA-OR-A5LD-10A-01D-A29L-10	T	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d84ce93-4c12-49da-87b3-c36d44672d59	afc22b50-442d-4fde-93ce-df0c281205c9	g.chr5:176936590T>C	ENST00000357198.4	-	2	124	c.120A>G	c.(118-120)tcA>tcG	p.S40S	DOK3_ENST00000501403.2_5'UTR|DOK3_ENST00000377112.4_5'UTR|DOK3_ENST00000312943.6_Intron	NM_024872.2	NP_079148.2	Q7L591	DOK3_HUMAN	docking protein 3	40					Ras protein signal transduction (GO:0007265)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)				NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|lung(7)	13	all_cancers(89;0.00033)|Renal(175;0.000269)|Lung NSC(126;0.00161)|all_lung(126;0.00286)	all_neural(177;0.00802)|Medulloblastoma(196;0.0145)|all_hematologic(541;0.248)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)|Epithelial(233;0.191)			GGGAGACTGATGACAGGCTGG	0.632													T|||	734	0.146565	0.2466	0.098	5008	,	,		16457	0.1677		0.0517	False		,,,				2504	0.1217				p.S40S		.											.	DOK3-226	0			c.A120G						.	T	,,	793,3613	318.0+/-295.4	75,643,1485	69.0	74.0	72.0		,,120	0.7	0.6	5	dbSNP_96	72	465,8135	138.1+/-194.9	6,453,3841	no	intron,utr-5,coding-synonymous	DOK3	NM_001144875.1,NM_001144876.1,NM_024872.2	,,	81,1096,5326	CC,CT,TT		5.407,17.9982,9.6725	,,	,,40/497	176936590	1258,11748	2203	4300	6503	SO:0001819	synonymous_variant	79930	exon2			GACTGATGACAGG	AK026223	CCDS4426.1, CCDS47349.1, CCDS47350.1	5q35	2008-02-05			ENSG00000146094	ENSG00000146094			24583	protein-coding gene	gene with protein product		611435				10733577, 12595900	Standard	NM_024872		Approved	FLJ22570	uc003mhk.3	Q7L591	OTTHUMG00000130850	ENST00000357198.4:c.120A>G	5.37:g.176936590T>C		Somatic	94	0		WXS	Illumina GAIIx	Phase_I	101	5	NM_024872	0	0	0	0	0	E9PAT0|H7BXS0|Q8N864|Q9BQB3|Q9H666	Silent	SNP	ENST00000357198.4	37	CCDS4426.1																																																																																			T|0.892;C|0.108		0.632	DOK3-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000253420.4	NM_024872	
BPHL	670	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	6	3118992	3118992	+	Silent	SNP	C	C	T			TCGA-OR-A5LD-01A-11D-A29I-10	TCGA-OR-A5LD-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d84ce93-4c12-49da-87b3-c36d44672d59	afc22b50-442d-4fde-93ce-df0c281205c9	g.chr6:3118992C>T	ENST00000380379.5	+	1	67	c.18C>T	c.(16-18)ggC>ggT	p.G6G	BPHL_ENST00000434640.1_Intron|BPHL_ENST00000380368.2_5'UTR|BPHL_ENST00000380375.3_5'UTR	NM_004332.2	NP_004323.2	Q86WA6	BPHL_HUMAN	biphenyl hydrolase-like (serine hydrolase)	6					cellular amino acid metabolic process (GO:0006520)|response to toxic substance (GO:0009636)	extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)	hydrolase activity (GO:0016787)			endometrium(4)|kidney(1)|large_intestine(2)|lung(6)	13	Ovarian(93;0.0386)	all_hematologic(90;0.108)				CTGTGCTGGGCGGCCGGGGCG	0.721																																					p.G6G		.											.	BPHL-90	0			c.C18T						.						6.0	14.0	12.0					6																	3118992		642	1490	2132	SO:0001819	synonymous_variant	670	exon1			GCTGGGCGGCCGG	X81372	CCDS4483.2	6p25	2008-08-29	2008-08-29		ENSG00000137274	ENSG00000137274			1094	protein-coding gene	gene with protein product	"""breast epithelial mucin-associated antigen"""	603156		MCNAA		7759552, 9721218, 15832508	Standard	NM_004332		Approved	Bph-rp	uc003mva.3	Q86WA6	OTTHUMG00000014140	ENST00000380379.5:c.18C>T	6.37:g.3118992C>T		Somatic	30	0		WXS	Illumina GAIIx	Phase_I	57	11	NM_004332	0	0	0	0	0	Q00306|Q13855|Q3KP51	Silent	SNP	ENST00000380379.5	37	CCDS4483.2																																																																																			.		0.721	BPHL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039670.5		
EYS	346007	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	65655687	65655687	+	Splice_Site	SNP	G	G	A	rs371032798		TCGA-OR-A5LD-01A-11D-A29I-10	TCGA-OR-A5LD-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d84ce93-4c12-49da-87b3-c36d44672d59	afc22b50-442d-4fde-93ce-df0c281205c9	g.chr6:65655687G>A	ENST00000370621.3	-	15	2906	c.2380C>T	c.(2380-2382)Cga>Tga	p.R794*	EYS_ENST00000503581.1_Splice_Site_p.R794*|EYS_ENST00000370616.2_Splice_Site_p.R794*			Q5T1H1	EYS_HUMAN	eyes shut homolog (Drosophila)	794	EGF-like 10; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				detection of light stimulus involved in visual perception (GO:0050908)|skeletal muscle tissue regeneration (GO:0043403)	extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)			breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(12)|lung(42)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)	69						GTTACTCACCGATAGCTTTTG	0.343																																					p.R794X		.											.	EYS-660	0			c.C2380T						.	G	stop/ARG	0,1384		0,0,692	260.0	230.0	239.0		2380	3.8	0.3	6		239	1,3181		0,1,1590	no	stop-gained-near-splice	EYS	NM_001142800.1		0,1,2282	AA,AG,GG		0.0314,0.0,0.0219		794/3145	65655687	1,4565	692	1591	2283	SO:0001630	splice_region_variant	346007	exon15			CTCACCGATAGCT		CCDS4967.1, CCDS47445.1, CCDS47446.1	6q12	2014-01-28	2008-10-20	2008-10-20	ENSG00000188107	ENSG00000188107			21555	protein-coding gene	gene with protein product		612424	"""chromosome 6 open reading frame 180"", ""EGF-like-domain, multiple 11"", ""retinitis pigmentosa 25 (autosomal recessive)"", ""EGF-like-domain, multiple 10"", ""chromosome 6 open reading frame 178"", ""chromosome 6 open reading frame 179"""	C6orf180, EGFL11, RP25, EGFL10, C6orf178, C6orf179		18836446, 18976725	Standard	NM_001142800		Approved	dJ1018A4.2, bA166P24.2, SPAM, bA307F22.3, dJ303F19.1, bA74E24.1	uc011dxu.1	Q5T1H1	OTTHUMG00000014971	ENST00000370621.3:c.2381+1C>T	6.37:g.65655687G>A		Somatic	90	0		WXS	Illumina GAIIx	Phase_I	91	24	NM_001142800	0	0	0	0	0	A2RUR2|A8MVE7|B7TYK8|B7UUQ3|B7ZBE7|B7ZBE8|B7ZBR3|B9ZVD2|Q5SZM4|Q5T3C8|Q5T669|Q5TEL3|Q5TEL4|Q5VVG4|Q6UY05|Q9H557|Q9NQ15	Nonsense_Mutation	SNP	ENST00000370621.3	37		.	.	.	.	.	.	.	.	.	.	G	37	6.103255	0.97286	0.0	3.14E-4	ENSG00000188107	ENST00000503581;ENST00000370621;ENST00000370616	.	.	.	4.7	3.83	0.44106	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	10.0343	0.42120	0.0963:0.0:0.9037:0.0	.	.	.	.	X	794	.	ENSP00000359650:R794X	R	-	1	2	EYS	65712408	0.003000	0.15002	0.324000	0.25361	0.172000	0.22775	0.475000	0.22164	0.980000	0.38523	0.561000	0.74099	CGA	.		0.343	EYS-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000351351.3	XM_294050	Nonsense_Mutation
SNX14	57231	broad.mit.edu	37	6	86227557	86227557	+	Missense_Mutation	SNP	T	T	C			TCGA-OR-A5LD-01A-11D-A29I-10	TCGA-OR-A5LD-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d84ce93-4c12-49da-87b3-c36d44672d59	afc22b50-442d-4fde-93ce-df0c281205c9	g.chr6:86227557T>C	ENST00000314673.3	-	23	2361	c.2185A>G	c.(2185-2187)Att>Gtt	p.I729V	SNX14_ENST00000346348.3_Missense_Mutation_p.I676V|SNX14_ENST00000505648.1_Missense_Mutation_p.I677V|SNX14_ENST00000369627.2_Missense_Mutation_p.I720V|SNX14_ENST00000513865.1_Missense_Mutation_p.I448V|SNX14_ENST00000508980.1_5'UTR	NM_153816.3	NP_722523.1	Q9Y5W7	SNX14_HUMAN	sorting nexin 14	729					protein transport (GO:0015031)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	integral component of membrane (GO:0016021)	phosphatidylinositol binding (GO:0035091)			NS(1)|endometrium(1)|kidney(2)|large_intestine(6)|lung(11)|skin(1)	22		all_cancers(76;4.83e-07)|Acute lymphoblastic leukemia(125;3.3e-08)|Prostate(29;2.55e-07)|all_hematologic(105;3.66e-05)|all_epithelial(107;0.000695)|Lung NSC(302;0.197)|all_lung(197;0.24)		BRCA - Breast invasive adenocarcinoma(108;0.0423)		CAAGAATTAATGAAATTCATG	0.343																																					p.I729V		.											.	SNX14-226	0			c.A2185G						.						123.0	120.0	121.0					6																	86227557		2203	4300	6503	SO:0001583	missense	57231	exon23			AATTAATGAAATT	AF121863	CCDS5003.1, CCDS5004.1, CCDS75490.1	6q15	2008-10-22			ENSG00000135317	ENSG00000135317		"""Sorting nexins"""	14977	protein-coding gene	gene with protein product						11485546, 11736640	Standard	XM_005248738		Approved	RGS-PX2	uc003pkr.3	Q9Y5W7	OTTHUMG00000015140	ENST00000314673.3:c.2185A>G	6.37:g.86227557T>C	ENSP00000313121:p.Ile729Val	Somatic	80	0		WXS	Illumina GAIIx	Phase_I	54	3	NM_153816	0	0	3	3	0	B4DI55|Q4VBR3|Q5TCF9|Q5TCG0|Q6NUI7|Q6PI37|Q9BSD1	Missense_Mutation	SNP	ENST00000314673.3	37	CCDS5004.1	.	.	.	.	.	.	.	.	.	.	T	14.27	2.486542	0.44249	.	.	ENSG00000135317	ENST00000346348;ENST00000369628;ENST00000314673;ENST00000513865;ENST00000505648;ENST00000369627;ENST00000515216;ENST00000418862	T;T;T;T;T;T	0.29142	2.0;1.99;1.58;1.99;1.99;1.99	4.97	4.97	0.65823	.	0.047656	0.85682	D	0.000000	T	0.12390	0.0301	L	0.29908	0.895	0.45634	D	0.998567	B;B;B;B	0.15141	0.007;0.012;0.004;0.007	B;B;B;B	0.16289	0.005;0.01;0.002;0.015	T	0.04229	-1.0967	10	0.31617	T	0.26	-16.6511	14.9504	0.71067	0.0:0.0:0.0:1.0	.	720;676;729;677	Q9Y5W7-4;Q9Y5W7-2;Q9Y5W7;Q9Y5W7-3	.;.;SNX14_HUMAN;.	V	676;186;729;448;677;720;647;94	ENSP00000257769:I676V;ENSP00000313121:I729V;ENSP00000420938:I448V;ENSP00000427380:I677V;ENSP00000358641:I720V;ENSP00000425630:I647V	ENSP00000313121:I729V	I	-	1	0	SNX14	86284276	1.000000	0.71417	1.000000	0.80357	0.896000	0.52359	4.748000	0.62148	1.999000	0.58509	0.454000	0.30748	ATT	.		0.343	SNX14-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041393.2	NM_153816	
C6orf58	352999	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	127899852	127899852	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5LD-01A-11D-A29I-10	TCGA-OR-A5LD-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d84ce93-4c12-49da-87b3-c36d44672d59	afc22b50-442d-4fde-93ce-df0c281205c9	g.chr6:127899852G>A	ENST00000329722.7	+	2	335	c.323G>A	c.(322-324)cGa>cAa	p.R108Q	C6orf58_ENST00000498112.1_3'UTR	NM_001010905.1	NP_001010905.1	Q6P5S2	CF058_HUMAN	chromosome 6 open reading frame 58	108						extracellular vesicular exosome (GO:0070062)				kidney(3)|large_intestine(3)|liver(1)|lung(7)|pancreas(1)	15				GBM - Glioblastoma multiforme(226;0.0405)|all cancers(137;0.156)		GATCCAACCCGAAGGACAAAC	0.423																																					p.R108Q		.											.	C6orf58-90	0			c.G323A						.						212.0	196.0	202.0					6																	127899852		2203	4299	6502	SO:0001583	missense	352999	exon2			CAACCCGAAGGAC	BC062712	CCDS34533.1	6q22.33	2011-12-13			ENSG00000184530	ENSG00000184530			20960	protein-coding gene	gene with protein product							Standard	NM_001010905		Approved		uc003qbh.4	Q6P5S2	OTTHUMG00000015530	ENST00000329722.7:c.323G>A	6.37:g.127899852G>A	ENSP00000328069:p.Arg108Gln	Somatic	133	1		WXS	Illumina GAIIx	Phase_I	153	51	NM_001010905	0	0	0	0	0	B4E1I0|Q5VUP2	Missense_Mutation	SNP	ENST00000329722.7	37	CCDS34533.1	.	.	.	.	.	.	.	.	.	.	G	1.160	-0.644016	0.03531	.	.	ENSG00000184530	ENST00000329722	T	0.44083	0.93	4.95	-1.57	0.08506	.	1.008770	0.07958	N	0.981926	T	0.04407	0.0121	N	0.02412	-0.56	0.09310	N	1	B	0.28233	0.204	B	0.19148	0.024	T	0.36286	-0.9754	10	0.11182	T	0.66	1.5261	9.1675	0.37060	0.6842:0.0:0.3158:0.0	.	108	Q6P5S2	CF058_HUMAN	Q	108	ENSP00000328069:R108Q	ENSP00000328069:R108Q	R	+	2	0	C6orf58	127941545	0.000000	0.05858	0.000000	0.03702	0.136000	0.21042	0.141000	0.16076	-0.364000	0.08088	0.591000	0.81541	CGA	.		0.423	C6orf58-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042152.1	NM_001010905	
FGFR1OP	11116	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	167436000	167436000	+	Missense_Mutation	SNP	C	C	G	rs558048540	byFrequency	TCGA-OR-A5LD-01A-11D-A29I-10	TCGA-OR-A5LD-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d84ce93-4c12-49da-87b3-c36d44672d59	afc22b50-442d-4fde-93ce-df0c281205c9	g.chr6:167436000C>G	ENST00000366847.4	+	8	914	c.683C>G	c.(682-684)tCt>tGt	p.S228C	FGFR1OP_ENST00000349556.4_Missense_Mutation_p.S208C|RP11-517H2.6_ENST00000609590.1_RNA	NM_007045.2	NP_008976.1	O95684	FR1OP_HUMAN	FGFR1 oncogene partner	228					G2/M transition of mitotic cell cycle (GO:0000086)|microtubule anchoring (GO:0034453)|mitotic cell cycle (GO:0000278)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of protein tyrosine kinase activity (GO:0061099)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of cell growth (GO:0030307)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)	centrosome (GO:0005813)|cytosol (GO:0005829)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	protein homodimerization activity (GO:0042803)|protein kinase binding (GO:0019901)|protein tyrosine kinase activity (GO:0004713)|protein tyrosine kinase inhibitor activity (GO:0030292)			large_intestine(2)|ovary(1)|stomach(1)	4		Breast(66;1.48e-05)|Ovarian(120;0.0607)		OV - Ovarian serous cystadenocarcinoma(33;1.73e-19)|BRCA - Breast invasive adenocarcinoma(81;5.1e-06)|GBM - Glioblastoma multiforme(31;0.00231)		AAAATTGGATCTTTTCTAAGC	0.418			T	FGFR1	"""MPD, NHL"""																																p.S228C		.		Dom	yes		6	6q27	11116	FGFR1 oncogene partner (FOP)		L	.	FGFR1OP-683	0			c.C683G						.						94.0	90.0	92.0					6																	167436000		2203	4300	6503	SO:0001583	missense	11116	exon8			TTGGATCTTTTCT	Y18046	CCDS5296.1, CCDS5297.1, CCDS75550.1	6q27	2008-02-05			ENSG00000213066	ENSG00000213066			17012	protein-coding gene	gene with protein product		605392				9949182, 10373756	Standard	NM_007045		Approved	FOP	uc003qvj.3	O95684	OTTHUMG00000016011	ENST00000366847.4:c.683C>G	6.37:g.167436000C>G	ENSP00000355812:p.Ser228Cys	Somatic	87	0		WXS	Illumina GAIIx	Phase_I	79	18	NM_007045	0	0	8	8	0	A8K1D1|B2R705|Q49AI0|Q5R3F6|Q96EW1	Missense_Mutation	SNP	ENST00000366847.4	37	CCDS5296.1	.	.	.	.	.	.	.	.	.	.	C	15.07	2.724296	0.48728	.	.	ENSG00000213066	ENST00000366847;ENST00000420493;ENST00000349556	T;T	0.35789	1.29;1.32	5.29	5.29	0.74685	.	0.507764	0.21392	N	0.075298	T	0.36496	0.0969	M	0.65975	2.015	0.09310	N	1	D;D;D	0.62365	0.989;0.991;0.984	P;P;P	0.55965	0.701;0.788;0.711	T	0.29731	-1.0002	10	0.62326	D	0.03	-5.3618	9.6836	0.40085	0.0:0.8421:0.0:0.1579	.	181;208;228	E7ET71;O95684-2;O95684	.;.;FR1OP_HUMAN	C	228;181;208	ENSP00000355812:S228C;ENSP00000230248:S208C	ENSP00000230248:S208C	S	+	2	0	FGFR1OP	167355990	0.584000	0.26766	0.008000	0.14137	0.901000	0.52897	1.503000	0.35715	2.467000	0.83353	0.544000	0.68410	TCT	.		0.418	FGFR1OP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000043099.2	NM_007045	
TNRC18	84629	hgsc.bcm.edu	37	7	5372406	5372406	+	Silent	SNP	G	G	T	rs13238738	byFrequency	TCGA-OR-A5LD-01A-11D-A29I-10	TCGA-OR-A5LD-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d84ce93-4c12-49da-87b3-c36d44672d59	afc22b50-442d-4fde-93ce-df0c281205c9	g.chr7:5372406G>T	ENST00000430969.1	-	19	6342	c.5994C>A	c.(5992-5994)cgC>cgA	p.R1998R	TNRC18_ENST00000399537.4_Silent_p.R1998R	NM_001080495.2	NP_001073964.2	O15417	TNC18_HUMAN	trinucleotide repeat containing 18	1998							chromatin binding (GO:0003682)			central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(8)	11		Ovarian(82;0.142)		UCEC - Uterine corpus endometrioid carcinoma (126;0.195)|OV - Ovarian serous cystadenocarcinoma(56;5.32e-15)		TGCGCTCGCTGCGGCGCCGCG	0.756													G|||	2646	0.528355	0.3601	0.4352	5008	,	,		9503	0.7063		0.673	False		,,,				2504	0.4898				p.R1998R		.											.	TNRC18-46	0			c.C5994A						.	G		1260,1040		370,520,260	2.0	3.0	3.0		5994	2.1	1.0	7	dbSNP_121	3	3787,1581		1438,911,335	no	coding-synonymous	TNRC18	NM_001080495.2		1808,1431,595	TT,TG,GG		29.4523,45.2174,34.181		1998/2969	5372406	5047,2621	1150	2684	3834	SO:0001819	synonymous_variant	84629	exon19			CTCGCTGCGGCGC	U80753	CCDS47534.1	7p22.1	2012-04-17			ENSG00000182095	ENSG00000182095		"""Trinucleotide (CAG) repeat containing"""	11962	protein-coding gene	gene with protein product						9225980	Standard	NM_001080495		Approved	CAGL79, TNRC18A, KIAA1856	uc003soi.4	O15417	OTTHUMG00000151831	ENST00000430969.1:c.5994C>A	7.37:g.5372406G>T		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	9	7	NM_001080495	0	0	0	0	0	A8MX41|Q96JH1|Q96K91	Silent	SNP	ENST00000430969.1	37	CCDS47534.1	1284	0.5879120879120879	197	0.40040650406504064	170	0.4696132596685083	415	0.7255244755244755	502	0.662269129287599	.	11.77	1.738038	0.30774	0.547826	0.705477	ENSG00000182095	ENST00000455076	.	.	.	4.14	2.1	0.27182	.	.	.	.	.	T	0.00012	0.0000	.	.	.	0.09310	P	0.9999999999999956	.	.	.	.	.	.	T	0.35425	-0.9789	3	.	.	.	.	12.3787	0.55295	0.0:0.4664:0.5335:0.0	rs13238738	.	.	.	E	35	.	.	A	-	2	0	TNRC18	5338932	0.998000	0.40836	0.997000	0.53966	0.996000	0.88848	0.427000	0.21379	0.648000	0.30732	0.555000	0.69702	GCA	G|0.411;T|0.589		0.756	TNRC18-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding			
USP42	84132	hgsc.bcm.edu	37	7	6193521	6193521	+	Missense_Mutation	SNP	G	G	C	rs61729726	byFrequency	TCGA-OR-A5LD-01A-11D-A29I-10	TCGA-OR-A5LD-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d84ce93-4c12-49da-87b3-c36d44672d59	afc22b50-442d-4fde-93ce-df0c281205c9	g.chr7:6193521G>C	ENST00000306177.5	+	15	2494	c.2336G>C	c.(2335-2337)cGc>cCc	p.R779P		NM_032172.2	NP_115548.1	Q9H9J4	UBP42_HUMAN	ubiquitin specific peptidase 42	779	Pro-rich.				cell differentiation (GO:0030154)|protein deubiquitination (GO:0016579)|spermatogenesis (GO:0007283)|ubiquitin-dependent protein catabolic process (GO:0006511)		ubiquitin-specific protease activity (GO:0004843)			breast(1)|central_nervous_system(1)|endometrium(5)|kidney(4)|large_intestine(2)|lung(14)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|urinary_tract(1)	35		Ovarian(82;0.0423)		UCEC - Uterine corpus endometrioid carcinoma (126;0.108)|OV - Ovarian serous cystadenocarcinoma(56;5.77e-14)		CCGCCGCCCCGCGATCCCGGC	0.756													C|||	2895	0.578075	0.8638	0.4121	5008	,	,		10724	0.7331		0.3082	False		,,,				2504	0.4274				p.R779P		.											.	USP42-659	0			c.G2336C						.	C	PRO/ARG	2157,1125		751,655,235	4.0	6.0	5.0		2336	2.6	0.0	7	dbSNP_129	5	1843,5693		290,1263,2215	no	missense	USP42	NM_032172.2	103	1041,1918,2450	CC,CG,GG		24.4559,34.2779,36.9754	benign	779/1317	6193521	4000,6818	1641	3768	5409	SO:0001583	missense	84132	exon15			CGCCCCGCGATCC	AK022759	CCDS47535.1	7p22.2	2005-08-08	2005-08-08		ENSG00000106346	ENSG00000106346		"""Ubiquitin-specific peptidases"""	20068	protein-coding gene	gene with protein product			"""ubiquitin specific protease 42"""			12838346	Standard	NM_032172		Approved	FLJ12697	uc011jwp.2	Q9H9J4	OTTHUMG00000151888	ENST00000306177.5:c.2336G>C	7.37:g.6193521G>C	ENSP00000301962:p.Arg779Pro	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	23	16	NM_032172	0	0	0	0	0	A2RUE3|B5MDA5|Q0VIN8|Q3C166|Q6P9B4	Missense_Mutation	SNP	ENST00000306177.5	37	CCDS47535.1	1188	0.5439560439560439	401	0.8150406504065041	130	0.35911602209944754	440	0.7692307692307693	217	0.2862796833773087	C	10.95	1.494372	0.26774	0.657221	0.244559	ENSG00000106346	ENST00000306177;ENST00000426246	T;T	0.14266	2.52;2.93	5.46	2.59	0.31030	.	0.841331	0.10600	N	0.655737	T	0.00012	0.0000	N	0.08118	0	0.80722	P	0.0	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.09164	-1.0687	9	0.28530	T	0.3	.	2.8136	0.05448	0.1458:0.5508:0.1414:0.162	rs61729726	779;779	Q9H9J4-2;Q9H9J4	.;UBP42_HUMAN	P	779;625	ENSP00000301962:R779P;ENSP00000408217:R625P	ENSP00000301962:R779P	R	+	2	0	USP42	6160046	0.001000	0.12720	0.000000	0.03702	0.000000	0.00434	0.469000	0.22067	0.265000	0.21872	-0.120000	0.15030	CGC	G|0.456;C|0.544		0.756	USP42-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000324262.3	XM_166526	
HDAC9	9734	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	18705997	18705997	+	Silent	SNP	A	A	G	rs370270521		TCGA-OR-A5LD-01A-11D-A29I-10	TCGA-OR-A5LD-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d84ce93-4c12-49da-87b3-c36d44672d59	afc22b50-442d-4fde-93ce-df0c281205c9	g.chr7:18705997A>G	ENST00000432645.2	+	11	1620	c.1620A>G	c.(1618-1620)ggA>ggG	p.G540G	HDAC9_ENST00000406072.1_Silent_p.G527G|HDAC9_ENST00000456174.2_Silent_p.G512G|HDAC9_ENST00000441542.2_Silent_p.G543G|HDAC9_ENST00000405010.3_Silent_p.G540G|HDAC9_ENST00000417496.2_Silent_p.G538G|HDAC9_ENST00000428307.2_Silent_p.G496G|HDAC9_ENST00000401921.1_Silent_p.G499G|HDAC9_ENST00000406451.4_Silent_p.G540G|HDAC9_ENST00000524023.1_Silent_p.G463G	NM_058176.2	NP_478056.1	Q9UKV0	HDAC9_HUMAN	histone deacetylase 9	540					B cell activation (GO:0042113)|B cell differentiation (GO:0030183)|cellular response to insulin stimulus (GO:0032869)|heart development (GO:0007507)|histone deacetylation (GO:0016575)|histone H3 deacetylation (GO:0070932)|histone H4 deacetylation (GO:0070933)|inflammatory response (GO:0006954)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|Notch signaling pathway (GO:0007219)|peptidyl-lysine deacetylation (GO:0034983)|positive regulation of cell migration involved in sprouting angiogenesis (GO:0090050)|regulation of skeletal muscle fiber development (GO:0048742)|regulation of striated muscle cell differentiation (GO:0051153)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|histone deacetylase complex (GO:0000118)|histone methyltransferase complex (GO:0035097)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	histone deacetylase activity (GO:0004407)|histone deacetylase binding (GO:0042826)|metal ion binding (GO:0046872)|NAD-dependent histone deacetylase activity (H3-K14 specific) (GO:0032041)|NAD-dependent histone deacetylase activity (H3-K18 specific) (GO:0097372)|NAD-dependent histone deacetylase activity (H3-K9 specific) (GO:0046969)|NAD-dependent histone deacetylase activity (H4-K16 specific) (GO:0046970)|protein deacetylase activity (GO:0033558)|protein kinase C binding (GO:0005080)|repressing transcription factor binding (GO:0070491)|transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)			breast(3)|central_nervous_system(4)|cervix(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(18)|liver(2)|lung(37)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	82	all_lung(11;0.187)				Valproic Acid(DB00313)	ACACACTGGGACAAGTTGGGG	0.547											OREG0017877	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.G543G		.											.	HDAC9-227	0			c.A1629G						.	A	,,,,,,,,	1,4113		0,1,2056	81.0	96.0	91.0		1614,1488,1497,1389,1536,1620,1620,1620,1629	4.4	1.0	7		91	0,8384		0,0,4192	no	coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous	HDAC9	NM_001204144.1,NM_001204145.1,NM_001204146.1,NM_001204147.1,NM_001204148.1,NM_014707.1,NM_058176.2,NM_178423.1,NM_178425.2	,,,,,,,,	0,1,6248	GG,GA,AA		0.0,0.0243,0.0080	,,,,,,,,	538/589,496/547,499/550,463/514,512/563,540/591,540/1012,540/1067,543/1070	18705997	1,12497	2057	4192	6249	SO:0001819	synonymous_variant	9734	exon11			ACTGGGACAAGTT	AF124924	CCDS47553.1, CCDS47554.1, CCDS47555.1, CCDS47557.1, CCDS56465.1, CCDS56466.1, CCDS56467.1, CCDS56468.1, CCDS75565.1	7p21.1	2008-05-15			ENSG00000048052	ENSG00000048052			14065	protein-coding gene	gene with protein product		606543				10523670, 10487760	Standard	NM_178425		Approved	KIAA0744, HDAC, MITR, HD7, HDAC7B	uc003sui.3	Q9UKV0	OTTHUMG00000152487	ENST00000432645.2:c.1620A>G	7.37:g.18705997A>G		Somatic	171	0	727	WXS	Illumina GAIIx	Phase_I	185	38	NM_178425	0	0	0	0	0	A7E2F3|B7Z4I4|B7Z917|B7Z928|B7Z940|C9JS87|E7EX34|F8W9E0|O94845|O95028|Q2M2R6|Q86SL1|Q86US3	Silent	SNP	ENST00000432645.2	37	CCDS47555.1																																																																																			.		0.547	HDAC9-023	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000376176.1		
OR2F1	26211	bcgsc.ca	37	7	143657801	143657801	+	Silent	SNP	A	A	G	rs2072166	byFrequency	TCGA-OR-A5LD-01A-11D-A29I-10	TCGA-OR-A5LD-10A-01D-A29L-10	A	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d84ce93-4c12-49da-87b3-c36d44672d59	afc22b50-442d-4fde-93ce-df0c281205c9	g.chr7:143657801A>G	ENST00000392899.1	+	1	775	c.738A>G	c.(736-738)acA>acG	p.T246T	RP4-669B10.3_ENST00000466281.1_lincRNA	NM_012369.2	NP_036501.2	Q13607	OR2F1_HUMAN	olfactory receptor, family 2, subfamily F, member 1 (gene/pseudogene)	246					signal transduction (GO:0007165)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|endometrium(2)|kidney(2)|large_intestine(6)|lung(18)|ovary(1)|skin(4)	34	Melanoma(164;0.0903)					CTCACCTCACAGTGGTTGCCC	0.488													a|||	2291	0.457468	0.6687	0.415	5008	,	,		22020	0.5744		0.3231	False		,,,				2504	0.2198				p.T246T		.											.	OR2F1-71	0			c.A738G						.	G		2672,1734	519.3+/-369.9	816,1040,347	158.0	130.0	140.0		738	-11.1	0.0	7	dbSNP_96	140	2839,5761	675.2+/-403.2	481,1877,1942	no	coding-synonymous	OR2F1	NM_012369.2		1297,2917,2289	GG,GA,AA		33.0116,39.3554,42.3728		246/318	143657801	5511,7495	2203	4300	6503	SO:0001819	synonymous_variant	26211	exon1			CCTCACAGTGGTT	U56421	CCDS5887.1	7q35	2013-06-03	2013-06-03		ENSG00000213215	ENSG00000213215		"""GPCR / Class A : Olfactory receptors"""	8246	protein-coding gene	gene with protein product		608497	"""olfactory receptor, family 2, subfamily F, member 1"""	OR2F4, OR2F5, OR2F3, OR2F3P		9500546	Standard	NM_012369		Approved	OLF3, OR7-140, OR7-139, OR14-60	uc003wds.1	Q13607	OTTHUMG00000157771	ENST00000392899.1:c.738A>G	7.37:g.143657801A>G		Somatic	225	2		WXS	Illumina GAIIx	Phase_I	143	5	NM_012369	0	0	0	0	0	A4D2G1|Q6IFP7|Q96R49|Q9UDX1	Silent	SNP	ENST00000392899.1	37	CCDS5887.1																																																																																			A|0.568;G|0.432		0.488	OR2F1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349581.1		
PCM1	5108	ucsc.edu;bcgsc.ca	37	8	17817553	17817553	+	Missense_Mutation	SNP	G	G	T	rs17635381	byFrequency	TCGA-OR-A5LD-01A-11D-A29I-10	TCGA-OR-A5LD-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d84ce93-4c12-49da-87b3-c36d44672d59	afc22b50-442d-4fde-93ce-df0c281205c9	g.chr8:17817553G>T	ENST00000519253.1	+	14	2322	c.2071G>T	c.(2071-2073)Gcc>Tcc	p.A691S	PCM1_ENST00000325083.8_Missense_Mutation_p.A691S|PCM1_ENST00000524226.1_Missense_Mutation_p.A692S			Q15154	PCM1_HUMAN	pericentriolar material 1	691			A -> S (in dbSNP:rs17635381).		centrosome organization (GO:0051297)|cilium assembly (GO:0042384)|cytoplasmic microtubule organization (GO:0031122)|G2/M transition of mitotic cell cycle (GO:0000086)|interkinetic nuclear migration (GO:0022027)|intraciliary transport involved in cilium morphogenesis (GO:0035735)|microtubule anchoring (GO:0034453)|microtubule anchoring at centrosome (GO:0034454)|mitotic cell cycle (GO:0000278)|negative regulation of neurogenesis (GO:0050768)|neuronal stem cell maintenance (GO:0097150)|positive regulation of intracellular protein transport (GO:0090316)|protein localization to centrosome (GO:0071539)	centriolar satellite (GO:0034451)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nuclear membrane (GO:0031965)|pericentriolar material (GO:0000242)|protein complex (GO:0043234)	identical protein binding (GO:0042802)		PCM1/JAK2(30)	breast(4)|endometrium(8)|kidney(5)|large_intestine(16)|lung(11)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	48				Colorectal(111;0.0789)		AGTTATCTCTGCCAGTGCATC	0.358			T	"""RET, JAK2"""	"""papillary thyroid, CML, MPD"""								G|||	723	0.144369	0.0227	0.1268	5008	,	,		17835	0.3661		0.1272	False		,,,				2504	0.1104				p.A691S		.		Dom	yes		8	8p22-p21.3	5108	pericentriolar material 1  (PTC4)		"""E, L"""	.	PCM1-742	0			c.G2071T						.	G	SER/ALA	128,3638		5,118,1760	73.0	68.0	70.0		2071	5.2	1.0	8	dbSNP_123	70	1192,7040		77,1038,3001	yes	missense	PCM1	NM_006197.3	99	82,1156,4761	TT,TG,GG		14.4801,3.3988,11.0018	probably-damaging	691/2025	17817553	1320,10678	1883	4116	5999	SO:0001583	missense	5108	exon14			ATCTCTGCCAGTG		CCDS47812.1	8p22-p21.3	2008-08-08			ENSG00000078674	ENSG00000078674			8727	protein-coding gene	gene with protein product		600299				8120099, 15659651	Standard	NM_006197		Approved	PTC4	uc003wyi.4	Q15154	OTTHUMG00000163699	ENST00000519253.1:c.2071G>T	8.37:g.17817553G>T	ENSP00000431099:p.Ala691Ser	Somatic	136	0		WXS	Illumina GAIIx	Phase_I	108	25	NM_006197	0	0	1	1	0	Q58F13|Q6P1K7|Q8NB85|Q9BWC1|Q9H4A2	Missense_Mutation	SNP	ENST00000519253.1	37		379	0.17353479853479853	13	0.026422764227642278	48	0.13259668508287292	214	0.3741258741258741	104	0.13720316622691292	G	12.27	1.886862	0.33348	0.033988	0.144801	ENSG00000078674	ENST00000325083;ENST00000517730;ENST00000519253;ENST00000524226	T;T;T;T	0.28454	3.5;2.55;1.61;1.61	5.17	5.17	0.71159	.	0.268940	0.35903	N	0.002912	T	0.00012	0.0000	L	0.44542	1.39	0.09310	P	1.0	B;B;P;B	0.40534	0.144;0.044;0.72;0.031	B;B;B;B	0.43536	0.082;0.082;0.423;0.017	T	0.50591	-0.8810	9	0.25106	T	0.35	-0.1599	16.7078	0.85377	0.0:0.0:1.0:0.0	rs17635381;rs17635381	691;730;692;691	E7ETA6;E7EV93;E7EV56;Q15154	.;.;.;PCM1_HUMAN	S	691;730;691;692	ENSP00000327077:A691S;ENSP00000428131:A730S;ENSP00000431099:A691S;ENSP00000430521:A692S	ENSP00000327077:A691S	A	+	1	0	PCM1	17861833	1.000000	0.71417	0.992000	0.48379	0.161000	0.22273	3.715000	0.54897	2.791000	0.96007	0.637000	0.83480	GCC	G|0.834;N|0.000		0.358	PCM1-003	NOVEL	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000374800.1	NM_006197	
ZFAT	57623	broad.mit.edu;bcgsc.ca	37	8	135615137	135615137	+	Nonsense_Mutation	SNP	G	G	T			TCGA-OR-A5LD-01A-11D-A29I-10	TCGA-OR-A5LD-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d84ce93-4c12-49da-87b3-c36d44672d59	afc22b50-442d-4fde-93ce-df0c281205c9	g.chr8:135615137G>T	ENST00000377838.3	-	6	999	c.825C>A	c.(823-825)taC>taA	p.Y275*	ZFAT-AS1_ENST00000505776.1_RNA|ZFAT_ENST00000429442.2_Nonsense_Mutation_p.Y263*|ZFAT_ENST00000523399.1_Nonsense_Mutation_p.Y213*|ZFAT_ENST00000520214.1_Nonsense_Mutation_p.Y263*|ZFAT_ENST00000520356.1_Nonsense_Mutation_p.Y263*|ZFAT_ENST00000520727.1_Nonsense_Mutation_p.Y263*	NM_001174157.1|NM_020863.3	NP_001167628.1|NP_065914.2	Q9P243	ZFAT_HUMAN	zinc finger and AT hook domain containing	275					hematopoietic progenitor cell differentiation (GO:0002244)|spongiotrophoblast layer development (GO:0060712)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|endometrium(10)|kidney(9)|large_intestine(8)|lung(16)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	54	all_epithelial(106;8.26e-19)|Lung NSC(106;3.47e-07)|all_lung(105;1.39e-06)|Ovarian(258;0.0102)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0432)			CCTTGTTGCAGTATTCACAAG	0.488																																					p.Y275X		.											.	ZFAT-90	0			c.C825A						.						98.0	99.0	98.0					8																	135615137		1989	4166	6155	SO:0001587	stop_gained	57623	exon6			GTTGCAGTATTCA	BC025423	CCDS43768.1, CCDS47924.1, CCDS43768.2, CCDS55275.1, CCDS55276.1	8q24.23	2008-06-05	2008-01-25	2008-01-25	ENSG00000066827	ENSG00000066827		"""Zinc fingers, C2H2-type"""	19899	protein-coding gene	gene with protein product		610931	"""zinc finger protein 406"""	ZNF406, ZFAT1		10819331, 18329245	Standard	NM_020863		Approved	KIAA1485	uc003yup.3	Q9P243	OTTHUMG00000164321	ENST00000377838.3:c.825C>A	8.37:g.135615137G>T	ENSP00000367069:p.Tyr275*	Somatic	198	0		WXS	Illumina GAIIx	Phase_I	311	13	NM_020863	0	0	0	0	0	B7ZL15|E9PER3|Q3MIM5|Q6PJ01|Q75PJ6|Q75PJ7|Q75PJ9|Q86X64	Nonsense_Mutation	SNP	ENST00000377838.3	37	CCDS47924.1	.	.	.	.	.	.	.	.	.	.	G	36	5.660973	0.96734	.	.	ENSG00000066827	ENST00000520356;ENST00000520727;ENST00000429442;ENST00000377838;ENST00000520214;ENST00000318135;ENST00000523399;ENST00000398946	.	.	.	5.83	4.96	0.65561	.	0.068180	0.64402	D	0.000009	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.05436	T	0.98	-34.0497	13.8359	0.63408	0.0727:0.0:0.9273:0.0	.	.	.	.	X	263;263;263;275;263;263;213;263	.	ENSP00000326997:Y263X	Y	-	3	2	ZFAT	135684319	1.000000	0.71417	0.999000	0.59377	0.988000	0.76386	4.163000	0.58183	1.477000	0.48234	0.563000	0.77884	TAC	.		0.488	ZFAT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378272.1	NM_001029939	
PLEC	5339	hgsc.bcm.edu	37	8	145001784	145001784	+	Silent	SNP	A	A	G	rs3135109	byFrequency	TCGA-OR-A5LD-01A-11D-A29I-10	TCGA-OR-A5LD-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d84ce93-4c12-49da-87b3-c36d44672d59	afc22b50-442d-4fde-93ce-df0c281205c9	g.chr8:145001784A>G	ENST00000322810.4	-	27	4130	c.3961T>C	c.(3961-3963)Ttg>Ctg	p.L1321L	PLEC_ENST00000345136.3_Silent_p.L1184L|PLEC_ENST00000398774.2_Silent_p.L1152L|PLEC_ENST00000357649.2_Silent_p.L1188L|PLEC_ENST00000354589.3_Silent_p.L1184L|PLEC_ENST00000356346.3_Silent_p.L1170L|PLEC_ENST00000354958.2_Silent_p.L1162L|PLEC_ENST00000436759.2_Silent_p.L1211L|PLEC_ENST00000527096.1_Silent_p.L1207L	NM_201380.2	NP_958782.1	Q15149	PLEC_HUMAN	plectin	1321	Globular 1.		L -> V (in dbSNP:rs3135109). {ECO:0000269|PubMed:8698233}.		apoptotic process (GO:0006915)|cell junction assembly (GO:0034329)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)	costamere (GO:0043034)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|hemidesmosome (GO:0030056)|intermediate filament cytoskeleton (GO:0045111)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|sarcoplasm (GO:0016528)	ankyrin binding (GO:0030506)|poly(A) RNA binding (GO:0044822)|structural constituent of muscle (GO:0008307)			NS(1)|breast(3)|central_nervous_system(4)|cervix(7)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(8)|lung(57)|ovary(4)|pancreas(2)|prostate(11)|skin(9)|stomach(2)|upper_aerodigestive_tract(10)	137						CGCTCAAGCAACTGGGCGACC	0.716													G|||	1156	0.230831	0.028	0.2954	5008	,	,		12494	0.1429		0.4274	False		,,,				2504	0.3476				p.L1321L		.											.	PLEC-141	0			c.T3961C						.	G	,,,,,,,	296,3620		20,256,1682	5.0	6.0	6.0		3631,3508,3484,3961,3454,3550,3562,3550	4.4	0.9	8	dbSNP_103	6	2835,5065		532,1771,1647	no	coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous	PLEC	NM_000445.3,NM_201378.2,NM_201379.1,NM_201380.2,NM_201381.1,NM_201382.2,NM_201383.1,NM_201384.1	,,,,,,,	552,2027,3329	GG,GA,AA		35.8861,7.5587,26.498	,,,,,,,	1211/4575,1170/4534,1162/4526,1321/4685,1152/4516,1184/4548,1188/4552,1184/4548	145001784	3131,8685	1958	3950	5908	SO:0001819	synonymous_variant	5339	exon27			CAAGCAACTGGGC	U53204	CCDS43769.1, CCDS43770.1, CCDS43771.1, CCDS43772.1, CCDS43773.1, CCDS43774.1, CCDS43775.1, CCDS47936.1	8q24	2010-02-04	2010-02-04	2010-02-04	ENSG00000178209	ENSG00000178209			9069	protein-coding gene	gene with protein product		601282	"""plectin 1, intermediate filament binding protein, 500kD"", ""epidermolysis bullosa simplex 1 (Ogna)"", ""plectin 1, intermediate filament binding protein 500kDa"""	EBS1, PLEC1		8633055, 8696340	Standard	XM_005250976		Approved	PCN, PLTN	uc003zaf.1	Q15149	OTTHUMG00000165291	ENST00000322810.4:c.3961T>C	8.37:g.145001784A>G		Somatic	1	0		WXS	Illumina GAIIx	Phase_I	29	10	NM_201380	0	0	0	0	0	Q15148|Q16640|Q6S376|Q6S377|Q6S378|Q6S379|Q6S380|Q6S381|Q6S382|Q6S383	Silent	SNP	ENST00000322810.4	37	CCDS43772.1																																																																																			G|0.246;A|0.754		0.716	PLEC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383281.1	NM_000445	
BOP1	23246	hgsc.bcm.edu	37	8	145486621	145486623	+	In_Frame_Del	DEL	GTT	GTT	-			TCGA-OR-A5LD-01A-11D-A29I-10	TCGA-OR-A5LD-10A-01D-A29L-10	GTT	GTT	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d84ce93-4c12-49da-87b3-c36d44672d59	afc22b50-442d-4fde-93ce-df0c281205c9	g.chr8:145486621_145486623delGTT	ENST00000307404.5	-	14	1929_1931	c.1900_1902delAAC	c.(1900-1902)aacdel	p.N634del	BOP1_ENST00000525016.1_5'Flank	NM_015201.3	NP_056016.1			block of proliferation 1											lung(1)|urinary_tract(2)	3	all_cancers(97;4.06e-12)|all_epithelial(106;2.89e-10)|Lung NSC(106;5.7e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;3.94e-40)|Epithelial(56;2.61e-39)|all cancers(56;1.37e-34)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.087)			CACAGATGACGTTGTCACCTAGG	0.591																																					p.634_634del		.											.	BOP1-90	0			c.1900_1902del						.																																			SO:0001651	inframe_deletion	23246	exon14			GATGACGTTGTCA	AK024840	CCDS6418.1, CCDS6418.2	8q24.3	2014-05-06			ENSG00000170727	ENSG00000261236		"""WD repeat domain containing"""	15519	protein-coding gene	gene with protein product		610596				8590280	Standard	NM_015201		Approved	KIAA0124	uc003zbm.3	Q14137	OTTHUMG00000174603	ENST00000307404.5:c.1900_1902delAAC	8.37:g.145486621_145486623delGTT	ENSP00000304151:p.Asn634del	Somatic	148	0		WXS	Illumina GAIIx	Phase_I	167	30	NM_015201	0	0	0	0	0		In_Frame_Del	DEL	ENST00000307404.5	37	CCDS6418.1																																																																																			.		0.591	BOP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381902.2	NM_015201	
TTC16	158248	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	130492920	130492920	+	Missense_Mutation	SNP	A	A	G			TCGA-OR-A5LD-01A-11D-A29I-10	TCGA-OR-A5LD-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d84ce93-4c12-49da-87b3-c36d44672d59	afc22b50-442d-4fde-93ce-df0c281205c9	g.chr9:130492920A>G	ENST00000373289.3	+	14	1938	c.1858A>G	c.(1858-1860)Acc>Gcc	p.T620A	TTC16_ENST00000489226.1_3'UTR|TOR2A_ENST00000472723.1_5'Flank	NM_144965.1	NP_659402.1	Q8NEE8	TTC16_HUMAN	tetratricopeptide repeat domain 16	620										central_nervous_system(2)|endometrium(3)|lung(7)|ovary(3)|pancreas(2)|prostate(4)|skin(1)	22						CCTAGTCAGGACCACAGGCAC	0.587																																					p.T620A		.											.	TTC16-90	0			c.A1858G						.						45.0	37.0	39.0					9																	130492920		2203	4300	6503	SO:0001583	missense	158248	exon14			GTCAGGACCACAG	AK057342	CCDS6875.1	9q34.13	2013-01-10			ENSG00000167094	ENSG00000167094		"""Tetratricopeptide (TTC) repeat domain containing"""	26536	protein-coding gene	gene with protein product						12477932	Standard	NM_144965		Approved	FLJ32780	uc004brq.1	Q8NEE8	OTTHUMG00000020711	ENST00000373289.3:c.1858A>G	9.37:g.130492920A>G	ENSP00000362386:p.Thr620Ala	Somatic	62	0		WXS	Illumina GAIIx	Phase_I	67	23	NM_144965	0	0	0	0	0	B4DYG4|B5ME24|Q5JU66|Q96M72	Missense_Mutation	SNP	ENST00000373289.3	37	CCDS6875.1	.	.	.	.	.	.	.	.	.	.	A	12.29	1.894203	0.33442	.	.	ENSG00000167094	ENST00000373289	T	0.19105	2.17	4.37	2.06	0.26882	.	1.020380	0.07839	N	0.962676	T	0.14830	0.0358	L	0.32530	0.975	0.09310	N	1	B;B	0.21071	0.051;0.051	B;B	0.17979	0.01;0.02	T	0.34700	-0.9818	10	0.27082	T	0.32	-13.0131	4.8113	0.13345	0.693:0.0:0.307:0.0	.	607;620	B4DZ42;Q8NEE8	.;TTC16_HUMAN	A	620	ENSP00000362386:T620A	ENSP00000362386:T620A	T	+	1	0	TTC16	129532741	0.059000	0.20769	0.048000	0.18961	0.209000	0.24338	0.875000	0.28079	0.465000	0.27167	0.459000	0.35465	ACC	.		0.587	TTC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054224.1	NM_144965	
TTC16	158248	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	9	130493619	130493619	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5LD-01A-11D-A29I-10	TCGA-OR-A5LD-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d84ce93-4c12-49da-87b3-c36d44672d59	afc22b50-442d-4fde-93ce-df0c281205c9	g.chr9:130493619G>A	ENST00000373289.3	+	14	2637	c.2557G>A	c.(2557-2559)Gga>Aga	p.G853R	TTC16_ENST00000489226.1_3'UTR|TOR2A_ENST00000472723.1_5'Flank	NM_144965.1	NP_659402.1	Q8NEE8	TTC16_HUMAN	tetratricopeptide repeat domain 16	853										central_nervous_system(2)|endometrium(3)|lung(7)|ovary(3)|pancreas(2)|prostate(4)|skin(1)	22						GTCCACCTGGGGACCCAGCCC	0.602																																					p.G853R		.											.	TTC16-90	0			c.G2557A						.						60.0	65.0	63.0					9																	130493619		2203	4300	6503	SO:0001583	missense	158248	exon14			ACCTGGGGACCCA	AK057342	CCDS6875.1	9q34.13	2013-01-10			ENSG00000167094	ENSG00000167094		"""Tetratricopeptide (TTC) repeat domain containing"""	26536	protein-coding gene	gene with protein product						12477932	Standard	NM_144965		Approved	FLJ32780	uc004brq.1	Q8NEE8	OTTHUMG00000020711	ENST00000373289.3:c.2557G>A	9.37:g.130493619G>A	ENSP00000362386:p.Gly853Arg	Somatic	185	0		WXS	Illumina GAIIx	Phase_I	215	19	NM_144965	0	0	0	0	0	B4DYG4|B5ME24|Q5JU66|Q96M72	Missense_Mutation	SNP	ENST00000373289.3	37	CCDS6875.1	.	.	.	.	.	.	.	.	.	.	G	16.32	3.090217	0.55968	.	.	ENSG00000167094	ENST00000373289	T	0.36878	1.23	4.52	0.612	0.17591	.	1.235280	0.05711	N	0.596010	T	0.31702	0.0805	L	0.56769	1.78	0.09310	N	1	B;B	0.30033	0.266;0.266	B;B	0.27170	0.077;0.077	T	0.27706	-1.0066	10	0.42905	T	0.14	-0.5014	3.4904	0.07636	0.286:0.0:0.5376:0.1764	.	840;853	B4DZ42;Q8NEE8	.;TTC16_HUMAN	R	853	ENSP00000362386:G853R	ENSP00000362386:G853R	G	+	1	0	TTC16	129533440	0.003000	0.15002	0.000000	0.03702	0.436000	0.31835	0.144000	0.16135	0.114000	0.18032	0.462000	0.41574	GGA	.		0.602	TTC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054224.1	NM_144965	
WDR34	89891	hgsc.bcm.edu	37	9	131418828	131418828	+	Missense_Mutation	SNP	A	A	C	rs4837292		TCGA-OR-A5LD-01A-11D-A29I-10	TCGA-OR-A5LD-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d84ce93-4c12-49da-87b3-c36d44672d59	afc22b50-442d-4fde-93ce-df0c281205c9	g.chr9:131418828A>C	ENST00000372715.2	-	1	238	c.178T>G	c.(178-180)Tgg>Ggg	p.W60G		NM_052844.3	NP_443076.2	Q96EX3	WDR34_HUMAN	WD repeat domain 34	60				W -> G (in Ref. 2; AAH11874/AAH01614). {ECO:0000305}.		axoneme (GO:0005930)|centriole (GO:0005814)|ciliary basal body (GO:0036064)				central_nervous_system(2)|lung(5)|skin(1)|urinary_tract(1)	9						ACCGTCTCCCAGCGGATGCCC	0.806																																					p.W60G		.											.	WDR34-92	0			c.T178G						.	C	GLY/TRP	1803,9		897,9,0	1.0	1.0	1.0		178	2.1	1.0	9	dbSNP_111	1	3858,0		1929,0,0	no	missense	WDR34	NM_052844.3	184	2826,9,0	CC,CA,AA		0.0,0.4967,0.1587	benign	60/537	131418828	5661,9	906	1929	2835	SO:0001583	missense	89891	exon1			TCTCCCAGCGGAT	BC011874	CCDS6906.2	9q34.11	2013-11-15	2013-02-19	2013-02-19	ENSG00000119333	ENSG00000119333		"""WD repeat domain containing"""	28296	protein-coding gene	gene with protein product		613363				19521662, 21953912, 24183451	Standard	NM_052844		Approved	DIC5, MGC20486, bA216B9.3, FAP133	uc004bvq.1	Q96EX3	OTTHUMG00000020750	ENST00000372715.2:c.178T>G	9.37:g.131418828A>C	ENSP00000361800:p.Trp60Gly	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	6	6	NM_052844	0	0	0	0	0	Q5VXV4|Q9BV46	Missense_Mutation	SNP	ENST00000372715.2	37	CCDS6906.2	2170	0.9935897435897436	486	0.9878048780487805	362	1.0	571	0.9982517482517482	751	0.9907651715039578	C	7.343	0.621247	0.14193	0.995033	1.0	ENSG00000119333	ENST00000372715;ENST00000451652;ENST00000419989	T;T;T	0.74106	-0.81;-0.81;-0.81	4.02	2.12	0.27331	.	0.538297	0.18788	N	0.131154	T	0.00012	0.0000	N	0.00538	-1.39	0.58432	P	1.999999999946489E-6	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.34625	-0.9821	9	0.08381	T	0.77	-3.0135	7.4804	0.27402	0.1755:0.4462:0.3784:0.0	rs4837292;rs56752541	45;60	A2A3F8;Q96EX3	.;WDR34_HUMAN	G	60;51;45	ENSP00000361800:W60G;ENSP00000411370:W51G;ENSP00000415421:W45G	ENSP00000361800:W60G	W	-	1	0	WDR34	130458649	1.000000	0.71417	0.994000	0.49952	0.970000	0.65996	0.709000	0.25734	0.259000	0.21709	-0.126000	0.14955	TGG	A|0.006;C|0.994		0.806	WDR34-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054463.1	NM_052844	
SLC2A6	11182	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	9	136339193	136339193	+	Silent	SNP	T	T	C			TCGA-OR-A5LD-01A-11D-A29I-10	TCGA-OR-A5LD-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d84ce93-4c12-49da-87b3-c36d44672d59	afc22b50-442d-4fde-93ce-df0c281205c9	g.chr9:136339193T>C	ENST00000371899.4	-	7	1022	c.945A>G	c.(943-945)gcA>gcG	p.A315A	SLC2A6_ENST00000371897.4_Silent_p.A315A|SLC2A6_ENST00000485978.1_5'UTR	NM_017585.3	NP_060055.2	Q9UGQ3	GTR6_HUMAN	solute carrier family 2 (facilitated glucose transporter), member 6	315					glucose transport (GO:0015758)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	glucose transmembrane transporter activity (GO:0005355)			cervix(1)|endometrium(1)|large_intestine(1)|lung(3)|prostate(3)|skin(1)	10				OV - Ovarian serous cystadenocarcinoma(145;8.47e-08)|Epithelial(140;9.37e-07)|all cancers(34;1.03e-05)		CAACGATGGCTGCGTCGTCCT	0.677																																					p.A315A		.											.	SLC2A6-90	0			c.A945G						.						24.0	22.0	23.0					9																	136339193		2196	4293	6489	SO:0001819	synonymous_variant	11182	exon7			GATGGCTGCGTCG	AJ011372	CCDS6975.1, CCDS48052.1	9q34	2013-05-22			ENSG00000160326	ENSG00000160326		"""Solute carriers"""	11011	protein-coding gene	gene with protein product		606813				10970791	Standard	NM_001145099		Approved	GLUT9, GLUT6, HSA011372	uc004cee.3	Q9UGQ3	OTTHUMG00000020874	ENST00000371899.4:c.945A>G	9.37:g.136339193T>C		Somatic	102	0		WXS	Illumina GAIIx	Phase_I	112	7	NM_017585	0	0	0	0	0	A6NNU6|Q5SXD7|Q8NCC2	Silent	SNP	ENST00000371899.4	37	CCDS6975.1																																																																																			.		0.677	SLC2A6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054909.1	NM_017585	
TPRN	286262	hgsc.bcm.edu;bcgsc.ca	37	9	140086594	140086594	+	Missense_Mutation	SNP	G	G	T			TCGA-OR-A5LD-01A-11D-A29I-10	TCGA-OR-A5LD-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d84ce93-4c12-49da-87b3-c36d44672d59	afc22b50-442d-4fde-93ce-df0c281205c9	g.chr9:140086594G>T	ENST00000409012.4	-	4	2192	c.2106C>A	c.(2104-2106)gaC>gaA	p.D702E	TPRN_ENST00000541945.1_5'Flank|TPRN_ENST00000321773.2_Missense_Mutation_p.D669E	NM_001128228.2	NP_001121700.2	Q4KMQ1	TPRN_HUMAN	taperin	702					sensory perception of sound (GO:0007605)	stereocilium (GO:0032420)				breast(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(2)|prostate(2)	8						CGCTGCGGAAGTCCGAGAGGT	0.632																																					p.D702E		.											.	TPRN-90	0			c.C2106A						.						55.0	62.0	60.0					9																	140086594		2203	4300	6503	SO:0001583	missense	286262	exon4			GCGGAAGTCCGAG	AK074735	CCDS56594.1	9q34.3	2011-01-06	2010-03-24	2010-03-24	ENSG00000176058	ENSG00000176058			26894	protein-coding gene	gene with protein product		613354	"""chromosome 9 open reading frame 75"", ""deafness, autosomal recessive 79"""	C9orf75, DFNB79		20170898, 20170899	Standard	NM_001128228		Approved	FLJ90254	uc004clu.3	Q4KMQ1	OTTHUMG00000020984	ENST00000409012.4:c.2106C>A	9.37:g.140086594G>T	ENSP00000387100:p.Asp702Glu	Somatic	81	0		WXS	Illumina GAIIx	Phase_I	55	4	NM_001128228	0	0	9	9	0	B7ZKU5|Q5VSG5|Q5VSG6|Q6IPP2|Q8NCH2	Missense_Mutation	SNP	ENST00000409012.4	37	CCDS56594.1	.	.	.	.	.	.	.	.	.	.	G	21.7	4.186144	0.78789	.	.	ENSG00000176058	ENST00000333046;ENST00000409012;ENST00000321773	.	.	.	4.78	4.78	0.61160	.	0.000000	0.85682	D	0.000000	T	0.66567	0.2802	L	0.36672	1.1	0.53688	D	0.999979	D	0.76494	0.999	D	0.83275	0.996	T	0.69851	-0.5033	9	0.87932	D	0	-29.4474	13.2896	0.60264	0.0:0.0:1.0:0.0	.	702	Q4KMQ1	TPRN_HUMAN	E	528;702;669	.	ENSP00000313704:D669E	D	-	3	2	TPRN	139206415	1.000000	0.71417	1.000000	0.80357	0.720000	0.41350	5.091000	0.64505	2.213000	0.71641	0.462000	0.41574	GAC	.		0.632	TPRN-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000055323.3	NM_173691	
AR	367	bcgsc.ca	37	X	66765161	66765161	+	Missense_Mutation	SNP	A	A	T	rs200185441		TCGA-OR-A5LD-01A-11D-A29I-10	TCGA-OR-A5LD-10A-01D-A29L-10	A	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d84ce93-4c12-49da-87b3-c36d44672d59	afc22b50-442d-4fde-93ce-df0c281205c9	g.chrX:66765161A>T	ENST00000374690.3	+	1	697	c.173A>T	c.(172-174)cAg>cTg	p.Q58L	AR_ENST00000513847.1_3'UTR|AR_ENST00000396044.3_Missense_Mutation_p.Q58L|AR_ENST00000504326.1_Missense_Mutation_p.Q58L	NM_000044.3	NP_000035.2	P10275	ANDR_HUMAN	androgen receptor	58	Gln-rich.|Modulating.|Poly-Gln.				androgen receptor signaling pathway (GO:0030521)|cell death (GO:0008219)|cell growth (GO:0016049)|cell proliferation (GO:0008283)|cell-cell signaling (GO:0007267)|gene expression (GO:0010467)|intracellular receptor signaling pathway (GO:0030522)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of integrin biosynthetic process (GO:0045720)|positive regulation of cell proliferation (GO:0008284)|positive regulation of integrin biosynthetic process (GO:0045726)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of phosphorylation (GO:0042327)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|positive regulation of transcription, DNA-templated (GO:0045893)|prostate gland development (GO:0030850)|protein oligomerization (GO:0051259)|regulation of establishment of protein localization to plasma membrane (GO:0090003)|sex differentiation (GO:0007548)|signal transduction (GO:0007165)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transport (GO:0006810)	cytoplasm (GO:0005737)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)	androgen binding (GO:0005497)|androgen receptor activity (GO:0004882)|beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|protein dimerization activity (GO:0046983)|receptor binding (GO:0005102)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II transcription factor binding (GO:0001085)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)	p.Q58L(2)		breast(4)|central_nervous_system(2)|cervix(1)|endometrium(8)|kidney(1)|large_intestine(12)|lung(20)|ovary(3)|prostate(11)|stomach(2)|upper_aerodigestive_tract(3)	67	all_cancers(1;0.173)|Prostate(1;2.27e-16)|all_epithelial(1;0.102)	all_lung(315;1.3e-11)			Bicalutamide(DB01128)|Cyproterone acetate(DB04839)|Danazol(DB01406)|Drospirenone(DB01395)|Drostanolone(DB00858)|Enzalutamide(DB08899)|Fludrocortisone(DB00687)|Fluoxymesterone(DB01185)|Flutamide(DB00499)|Ketoconazole(DB01026)|Levonorgestrel(DB00367)|Methyltestosterone(DB06710)|Nandrolone decanoate(DB08804)|Nandrolone phenpropionate(DB00984)|Nilutamide(DB00665)|Oxandrolone(DB00621)|Spironolactone(DB00421)|Testosterone Propionate(DB01420)|Testosterone(DB00624)	CTGCTGCTgcagcagcagcag	0.667									Androgen Insensitivity Syndrome																												p.Q58L		.											.	AR-661	2	Substitution - Missense(2)	lung(1)|endometrium(1)	c.A173T	GRCh37	CM033749	AR	M	rs5902610	.						8.0	11.0	10.0					X																	66765161		2116	4153	6269	SO:0001583	missense	367	exon1	Familial Cancer Database	CAIS, Testicular Feminisation, AIS, Morris syndrome; incl. Reifenstein Syndrome	TGCTGCAGCAGCA	M20132	CCDS14387.1, CCDS43965.1	Xq12	2013-01-16	2008-08-07		ENSG00000169083	ENSG00000169083		"""Nuclear hormone receptors"""	644	protein-coding gene	gene with protein product	"""testicular feminization"", ""Kennedy disease"""	313700	"""dihydrotestosterone receptor"", ""spinal and bulbar muscular atrophy"""	DHTR, SBMA		3353726, 3377788	Standard	NM_000044		Approved	AIS, NR3C4, SMAX1, HUMARA	uc004dwu.2	P10275	OTTHUMG00000021740	ENST00000374690.3:c.173A>T	X.37:g.66765161A>T	ENSP00000363822:p.Gln58Leu	Somatic	35	0		WXS	Illumina GAIIx	Phase_I	21	4	NM_000044	0	0	0	0	0	A2RUN2|B1AKD7|Q9UD95	Missense_Mutation	SNP	ENST00000374690.3	37	CCDS14387.1	.	.	.	.	.	.	.	.	.	.	a	11.20	1.568808	0.28003	.	.	ENSG00000169083	ENST00000374690;ENST00000504326;ENST00000396044;ENST00000538891	T;T;T	0.69040	-0.37;-0.37;-0.37	.	.	.	.	0.157519	0.30235	N	0.010084	T	0.46541	0.1398	N	0.19112	0.55	0.09310	N	0.999999	B;B	0.34313	0.448;0.448	B;B	0.36534	0.227;0.227	T	0.39800	-0.9596	8	0.62326	D	0.03	.	.	.	.	.	58;58	E7EVX6;D3YPQ2	.;.	L	58	ENSP00000363822:Q58L;ENSP00000421155:Q58L;ENSP00000379359:Q58L	ENSP00000363822:Q58L	Q	+	2	0	AR	66681886	0.997000	0.39634	0.872000	0.34217	0.495000	0.33615	1.386000	0.34419	0.000000	0.14550	0.000000	0.15137	CAG	.		0.667	AR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057007.1	NM_000044	
PASD1	139135	bcgsc.ca	37	X	150840185	150840185	+	Silent	SNP	T	T	C	rs6627174	byFrequency	TCGA-OR-A5LD-01A-11D-A29I-10	TCGA-OR-A5LD-10A-01D-A29L-10	T	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d84ce93-4c12-49da-87b3-c36d44672d59	afc22b50-442d-4fde-93ce-df0c281205c9	g.chrX:150840185T>C	ENST00000370357.4	+	13	1616	c.1371T>C	c.(1369-1371)ggT>ggC	p.G457G		NM_173493.2	NP_775764.2	Q8IV76	PASD1_HUMAN	PAS domain containing 1	457						nucleus (GO:0005634)	signal transducer activity (GO:0004871)			breast(2)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(3)|liver(1)|lung(25)|ovary(3)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	48	Acute lymphoblastic leukemia(192;6.56e-05)					GTTTCTGTGGTTTATCTTTAT	0.478													T|||	1488	0.394172	0.062	0.2939	3775	,	,		15542	0.6448		0.164	False		,,,				2504	0.3957				p.G457G		.											.	PASD1-133	0			c.T1371C						.	T		405,3430		17,316,55,1299,516	122.0	106.0	111.0		1371	-1.9	0.0	X	dbSNP_116	111	1495,5233		113,850,419,1465,1453	no	coding-synonymous	PASD1	NM_173493.2		130,1166,474,2764,1969	CC,CT,C,TT,T		22.2206,10.5606,17.9873		457/774	150840185	1900,8663	2203	4300	6503	SO:0001819	synonymous_variant	139135	exon13			CTGTGGTTTATCT	AY270020	CCDS35431.1	Xq28	2009-08-06			ENSG00000166049	ENSG00000166049			20686	protein-coding gene	gene with protein product	"""cancer/testis antigen 63"""					15122589, 15162151	Standard	NM_173493		Approved	CT63	uc004fev.4	Q8IV76	OTTHUMG00000024169	ENST00000370357.4:c.1371T>C	X.37:g.150840185T>C		Somatic	107	0		WXS	Illumina GAIIx	Phase_I	87	6	NM_173493	0	0	0	0	0	Q3MNE0|Q69HD7|Q8N7X9	Silent	SNP	ENST00000370357.4	37	CCDS35431.1																																																																																			0|0.003;C|0.270		0.478	PASD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060879.2	NM_173493	
ARPC2	10109	broad.mit.edu	37	2	219103504	219103505	+	Frame_Shift_Ins	INS	-	-	C			TCGA-OR-A5LD-01A-11D-A29I-10	TCGA-OR-A5LD-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d84ce93-4c12-49da-87b3-c36d44672d59	afc22b50-442d-4fde-93ce-df0c281205c9	g.chr2:219103504_219103505insC	ENST00000295685.10	+	5	647_648	c.386_387insC	c.(385-390)ttccaafs	p.Q130fs	ARPC2_ENST00000315717.5_Frame_Shift_Ins_p.Q130fs|ARPC2_ENST00000477992.1_3'UTR	NM_005731.2	NP_005722.1	O15144	ARPC2_HUMAN	actin related protein 2/3 complex, subunit 2, 34kDa	130					Arp2/3 complex-mediated actin nucleation (GO:0034314)|cellular component movement (GO:0006928)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|positive regulation of lamellipodium assembly (GO:0010592)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)	actin cytoskeleton (GO:0015629)|Arp2/3 protein complex (GO:0005885)|cell leading edge (GO:0031252)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)|synapse (GO:0045202)	structural constituent of cytoskeleton (GO:0005200)			cervix(1)|kidney(1)|large_intestine(2)|lung(1)|ovary(1)	6		Renal(207;0.0474)		Epithelial(149;1.21e-06)|all cancers(144;0.000212)|LUSC - Lung squamous cell carcinoma(224;0.00829)|Lung(261;0.0103)		GAAAAATACTTCCAATTCCAAG	0.426																																					p.F129fs		.											.	ARPC2-91	0			c.386_387insC						.																																			SO:0001589	frameshift_variant	10109	exon5			AATACTTCCAATT	AF006085	CCDS2410.1	2q36.1	2011-07-06	2002-08-29		ENSG00000163466	ENSG00000163466		"""Actin related protein 2/3 complex subunits"""	705	protein-coding gene	gene with protein product		604224	"""actin related protein 2/3 complex, subunit 2 (34 kD)"""			9359840, 9230079	Standard	NM_005731		Approved	p34-Arc, ARC34	uc002vhd.4	O15144	OTTHUMG00000133618	ENST00000295685.10:c.388dupC	2.37:g.219103506_219103506dupC	ENSP00000295685:p.Gln130fs	Somatic	263	0		WXS	Illumina GAIIx	Phase_I	349	8	NM_005731	0	0	0	0	0	Q92801|Q9P1D4	Frame_Shift_Ins	INS	ENST00000295685.10	37	CCDS2410.1																																																																																			.		0.426	ARPC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256777.2	NM_005731	
TIMP3	7078	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	22	33255323	33255324	+	Frame_Shift_Ins	INS	-	-	C			TCGA-OR-A5LD-01A-11D-A29I-10	TCGA-OR-A5LD-10A-01D-A29L-10	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d84ce93-4c12-49da-87b3-c36d44672d59	afc22b50-442d-4fde-93ce-df0c281205c9	g.chr22:33255323_33255324insC	ENST00000266085.6	+	5	896_897	c.595_596insC	c.(595-597)gccfs	p.A199fs	SYN3_ENST00000332840.5_Intron|SYN3_ENST00000358763.2_Intron	NM_000362.4	NP_000353.1	P35625	TIMP3_HUMAN	TIMP metallopeptidase inhibitor 3	199					cellular response to organic substance (GO:0071310)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of membrane protein ectodomain proteolysis (GO:0051045)|visual perception (GO:0007601)	basement membrane (GO:0005604)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|metalloendopeptidase inhibitor activity (GO:0008191)			endometrium(2)|large_intestine(3)|lung(1)|urinary_tract(1)	7						CCGAGGATGGGCCCCCCCGGAT	0.604																																					p.A199fs		.											.	TIMP3-226	0			c.595_596insC						.																																			SO:0001589	frameshift_variant	7078	exon5			GGATGGGCCCCCC		CCDS13911.1	22q12.3	2013-01-08	2008-07-31		ENSG00000100234	ENSG00000100234			11822	protein-coding gene	gene with protein product		188826	"""tissue inhibitor of metalloproteinase 3 (Sorsby fundus dystrophy, pseudoinflammatory)"""	SFD		8188246, 12652295	Standard	NM_000362		Approved		uc003anb.3	P35625	OTTHUMG00000030784	ENST00000266085.6:c.602dupC	22.37:g.33255330_33255330dupC	ENSP00000266085:p.Ala199fs	Somatic	74	0		WXS	Illumina GAIIx	Phase_I	76	20	NM_000362	0	0	0	0	0	B2RBY9|Q5THV4|Q9UC74|Q9UGS2	Frame_Shift_Ins	INS	ENST00000266085.6	37	CCDS13911.1																																																																																			.		0.604	TIMP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000075672.2	NM_000362	
MAP3K4	4216	hgsc.bcm.edu	37	6	161413044	161413045	+	In_Frame_Ins	INS	-	-	CCG	rs369151355|rs569609736	byFrequency	TCGA-OR-A5LD-01A-11D-A29I-10	TCGA-OR-A5LD-10A-01D-A29L-10	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d84ce93-4c12-49da-87b3-c36d44672d59	afc22b50-442d-4fde-93ce-df0c281205c9	g.chr6:161413044_161413045insCCG	ENST00000392142.4	+	1	229_230	c.81_82insCCG	c.(82-84)ccg>CCGccg	p.28_28P>PP	RP3-428L16.2_ENST00000608721.1_RNA|MAP3K4_ENST00000366919.2_In_Frame_Ins_p.28_28P>PP|MAP3K4_ENST00000366920.2_In_Frame_Ins_p.28_28P>PP|MAP3K4_ENST00000348824.7_In_Frame_Ins_p.28_28P>PP	NM_005922.2	NP_005913	Q9Y6R4	M3K4_HUMAN	mitogen-activated protein kinase kinase kinase 4	28	Poly-Pro.				activation of MAPKK activity (GO:0000186)|chorionic trophoblast cell differentiation (GO:0060718)|intracellular signal transduction (GO:0035556)|male germ-line sex determination (GO:0019100)|MAPK cascade (GO:0000165)|placenta development (GO:0001890)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of p38MAPK cascade (GO:1900745)|regulation of gene expression (GO:0010468)|response to UV-C (GO:0010225)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|MAP kinase kinase kinase activity (GO:0004709)|metal ion binding (GO:0046872)			breast(6)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(20)|lung(28)|ovary(3)|skin(2)|stomach(1)	77		Breast(66;0.000776)|Ovarian(120;0.0367)|Prostate(117;0.0771)		OV - Ovarian serous cystadenocarcinoma(65;1.85e-18)|BRCA - Breast invasive adenocarcinoma(81;3.04e-05)		Agccgccgccaccgccgccgcc	0.738														185	0.0369409	0.0083	0.0303	5008	,	,		9103	0.0288		0.0487	False		,,,				2504	0.0767				p.P27delinsPP		.											.	MAP3K4-548	0			c.81_82insCCG						.																																			SO:0001652	inframe_insertion	4216	exon1			GCCGCCACCGCCG	AF002715	CCDS34565.1, CCDS34566.1, CCDS75544.1	6q26	2012-10-02			ENSG00000085511	ENSG00000085511		"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	6856	protein-coding gene	gene with protein product		602425		MEKK4		9305639	Standard	XM_005266988		Approved	MTK1, MAPKKK4, KIAA0213	uc003qtn.3	Q9Y6R4	OTTHUMG00000015968	ENST00000392142.4:c.91_93dupCCG	6.37:g.161413051_161413053dupCCG	ENSP00000375986:p.Pro36dup	Somatic	5	0		WXS	Illumina GAIIx	Phase_I	16	11	NM_006724	0	0	0	0	0	A6H8W0|B7ZLD3|B9EG75|Q5VTT8|Q5VTT9|Q92612|Q9H408	In_Frame_Ins	INS	ENST00000392142.4	37	CCDS34565.1																																																																																			.		0.738	MAP3K4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000042988.3		
SPATA31C1	441452	hgsc.bcm.edu	37	9	90534192	90534193	+	RNA	INS	-	-	TCTTGTCTCCCAGCGTCA	rs567658963|rs536300617	byFrequency	TCGA-OR-A5LD-01A-11D-A29I-10	TCGA-OR-A5LD-10A-01D-A29L-10	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d84ce93-4c12-49da-87b3-c36d44672d59	afc22b50-442d-4fde-93ce-df0c281205c9	g.chr9:90534192_90534193insTCTTGTCTCCCAGCGTCA	ENST00000602681.1	+	0	938_939							P0DKV0	S31C1_HUMAN	SPATA31 subfamily C, member 1						cell differentiation (GO:0030154)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)											TCCCAGCGTCATCTTGTCTCCC	0.594																																					p.H71delinsHLVSQRH		.											.	.	0			c.212_213insTCTTGTCTCCCAGCGTCA						.																																					441452	exon2			AGCGTCATCTTGT	AK093374		9q22.1	2014-03-18	2012-10-12	2012-10-12	ENSG00000230246	ENSG00000230246			27846	other	unknown			"""family with sequence similarity 75, member C1"""	FAM75C1			Standard	NM_001145124		Approved	FLJ36055	uc010mqi.3	P0DKV0	OTTHUMG00000020160		9.37:g.90534192_90534193insTCTTGTCTCCCAGCGTCA		Somatic	400	0		WXS	Illumina GAIIx	Phase_I	357	0	NM_001145124	0	0	0	0	0		In_Frame_Ins	INS	ENST00000602681.1	37																																																																																				.		0.594	SPATA31C1-002	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000467313.1	NM_001145124	
