#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_TTotCov	i_TVarCov	i_Transcript_Id	i_Trna_alt1	i_Trna_alt2	i_Trna_ref	i_Trna_tot	i_Trna_var	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
ACAP3	116983	broad.mit.edu;bcgsc.ca	37	1	1230833	1230833	+	Missense_Mutation	SNP	G	G	T	rs144585204		TCGA-OR-A5LF-01A-11D-A30A-10	TCGA-OR-A5LF-10A-01D-A30A-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2cf21c74-97c0-46f3-8e1a-197f9737b5b5	bcf5a948-3260-455b-b930-5cec0d656728	g.chr1:1230833G>T	ENST00000354700.5	-	19	2009	c.1807C>A	c.(1807-1809)Cct>Act	p.P603T	ACAP3_ENST00000379037.2_5'Flank|ACAP3_ENST00000353662.3_Missense_Mutation_p.P561T	NM_030649.2	NP_085152.2	Q96P50	ACAP3_HUMAN	ArfGAP with coiled-coil, ankyrin repeat and PH domains 3	603					regulation of ARF GTPase activity (GO:0032312)		ARF GTPase activator activity (GO:0008060)|zinc ion binding (GO:0008270)			endometrium(3)|lung(9)|skin(1)|upper_aerodigestive_tract(1)	14						TTACTGCGAGGGCCAGCCCCT	0.667																																					p.P603T		.											.	ACAP3-90	0			c.C1807A						.	G	THR/PRO	0,4392		0,0,2196	33.0	33.0	33.0		1807	4.7	1.0	1	dbSNP_134	33	3,8585	3.0+/-9.4	0,3,4291	yes	missense	ACAP3	NM_030649.2	38	0,3,6487	TT,TG,GG		0.0349,0.0,0.0231	probably-damaging	603/835	1230833	3,12977	2196	4294	6490	SO:0001583	missense	116983	exon19			TGCGAGGGCCAGC	AF411981	CCDS19.2	1p36	2013-01-10	2008-09-22	2008-09-22	ENSG00000131584	ENSG00000131584		"""ADP-ribosylation factor GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"", ""Ankyrin repeat domain containing"""	16754	protein-coding gene	gene with protein product			"""centaurin, beta 5"""	CENTB5			Standard	NM_030649		Approved	KIAA1716	uc001aeb.2	Q96P50	OTTHUMG00000002235	ENST00000354700.5:c.1807C>A	1.37:g.1230833G>T	ENSP00000346733:p.Pro603Thr	Somatic	227	2		WXS	Illumina GAIIx	Phase_I	170	12	NM_030649	0	0	0	0	0	B1AMF5|Q5TA42|Q5TA43|Q86UT3|Q9BSR9|Q9C0E7	Missense_Mutation	SNP	ENST00000354700.5	37	CCDS19.2	.	.	.	.	.	.	.	.	.	.	G	14.61	2.586480	0.46110	0.0	3.49E-4	ENSG00000131584	ENST00000354700;ENST00000353662	T;T	0.26660	1.72;1.84	4.66	4.66	0.58398	.	0.456811	0.19758	N	0.106728	T	0.43299	0.1241	L	0.47716	1.5	0.46279	D	0.998965	D;D	0.89917	0.996;1.0	P;D	0.87578	0.906;0.998	T	0.12016	-1.0564	10	0.15066	T	0.55	.	17.8971	0.88892	0.0:0.0:1.0:0.0	.	603;561	Q96P50;Q96P50-1	ACAP3_HUMAN;.	T	603;561	ENSP00000346733:P603T;ENSP00000321139:P561T	ENSP00000321139:P561T	P	-	1	0	ACAP3	1220696	1.000000	0.71417	0.999000	0.59377	0.049000	0.14656	6.359000	0.73060	2.294000	0.77228	0.491000	0.48974	CCT	G|1.000;T|0.000		0.667	ACAP3-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000006366.2	NM_030649	
NOL9	79707	hgsc.bcm.edu	37	1	6614391	6614391	+	Missense_Mutation	SNP	A	A	C	rs6693391	byFrequency	TCGA-OR-A5LF-01A-11D-A30A-10	TCGA-OR-A5LF-10A-01D-A30A-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2cf21c74-97c0-46f3-8e1a-197f9737b5b5	bcf5a948-3260-455b-b930-5cec0d656728	g.chr1:6614391A>C	ENST00000377705.5	-	1	204	c.172T>G	c.(172-174)Tcc>Gcc	p.S58A	TAS1R1_ENST00000351136.3_5'Flank|TAS1R1_ENST00000333172.6_5'Flank|TAS1R1_ENST00000328191.4_5'Flank	NM_024654.4	NP_078930	Q5SY16	NOL9_HUMAN	nucleolar protein 9	58			S -> A (in dbSNP:rs6693391). {ECO:0000269|PubMed:14702039, ECO:0000269|PubMed:15489334}.		maturation of 5.8S rRNA (GO:0000460)	membrane (GO:0016020)|nucleolus (GO:0005730)	ATP binding (GO:0005524)|polynucleotide 5'-hydroxyl-kinase activity (GO:0051731)|RNA binding (GO:0003723)			central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(2)|lung(9)|skin(2)|urinary_tract(1)	19	Ovarian(185;0.0212)|all_lung(157;0.154)	all_cancers(23;2.46e-35)|all_epithelial(116;1.41e-22)|all_lung(118;7.59e-07)|Lung NSC(185;4.28e-06)|Colorectal(325;4.52e-05)|Breast(487;0.000353)|Renal(390;0.0007)|Hepatocellular(190;0.00308)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0443)		Colorectal(212;1.47e-07)|COAD - Colon adenocarcinoma(227;1.47e-05)|Kidney(185;5.27e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.000971)|BRCA - Breast invasive adenocarcinoma(365;0.00113)|STAD - Stomach adenocarcinoma(132;0.0017)|READ - Rectum adenocarcinoma(331;0.0649)		TCCACGCCGGACGCCTGGGCT	0.781													C|||	4789	0.95627	0.8722	0.9841	5008	,	,		9026	0.9692		0.995	False		,,,				2504	0.9969				p.S58A		.											.	NOL9-515	0			c.T172G						.	C	ALA/SER	2196,260		975,246,7	2.0	3.0	3.0		172	3.0	0.2	1	dbSNP_116	3	4875,25		2425,25,0	no	missense	NOL9	NM_024654.4	99	3400,271,7	CC,CA,AA		0.5102,10.5863,3.8744	benign	58/703	6614391	7071,285	1228	2450	3678	SO:0001583	missense	79707	exon1			CGCCGGACGCCTG	AK091284	CCDS80.1	1p36.31	2012-05-02			ENSG00000162408	ENSG00000162408			26265	protein-coding gene	gene with protein product	"""polynucleotide 5'-kinase"""					21063389	Standard	NM_024654		Approved	FLJ23323, NET6, Grc3	uc001ans.3	Q5SY16	OTTHUMG00000000904	ENST00000377705.5:c.172T>G	1.37:g.6614391A>C	ENSP00000366934:p.Ser58Ala	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	17	17	NM_024654	0	0	0	0	0	Q2NL84|Q4VBY3|Q6P472|Q7L4D6|Q96EE0|Q9H5L4	Missense_Mutation	SNP	ENST00000377705.5	37	CCDS80.1	2092	0.9578754578754579	421	0.8556910569105691	355	0.9806629834254144	562	0.9825174825174825	754	0.9947229551451188	C	0.416	-0.910621	0.02434	0.894137	0.994898	ENSG00000162408	ENST00000377705	T	0.15718	2.4	4.0	3.05	0.35203	.	0.361559	0.20066	N	0.099972	T	0.00012	0.0000	N	0.01576	-0.805	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.37798	-0.9690	9	0.02654	T	1	-12.1681	8.8998	0.35487	0.424:0.576:0.0:0.0	rs6693391;rs56691058	58	Q5SY16	NOL9_HUMAN	A	58	ENSP00000366934:S58A	ENSP00000366934:S58A	S	-	1	0	NOL9	6536978	0.795000	0.28851	0.220000	0.23810	0.044000	0.14063	0.592000	0.23984	0.422000	0.26005	-0.285000	0.09966	TCC	A|0.047;C|0.953		0.781	NOL9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000002625.1	NM_024654	
NOL9	79707	hgsc.bcm.edu	37	1	6614415	6614415	+	Missense_Mutation	SNP	A	A	G	rs6693400	byFrequency	TCGA-OR-A5LF-01A-11D-A30A-10	TCGA-OR-A5LF-10A-01D-A30A-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2cf21c74-97c0-46f3-8e1a-197f9737b5b5	bcf5a948-3260-455b-b930-5cec0d656728	g.chr1:6614415A>G	ENST00000377705.5	-	1	180	c.148T>C	c.(148-150)Tgg>Cgg	p.W50R	TAS1R1_ENST00000351136.3_5'Flank|TAS1R1_ENST00000333172.6_5'Flank|TAS1R1_ENST00000328191.4_5'Flank	NM_024654.4	NP_078930	Q5SY16	NOL9_HUMAN	nucleolar protein 9	50			W -> R (in dbSNP:rs6693400). {ECO:0000269|PubMed:14702039, ECO:0000269|PubMed:15489334}.		maturation of 5.8S rRNA (GO:0000460)	membrane (GO:0016020)|nucleolus (GO:0005730)	ATP binding (GO:0005524)|polynucleotide 5'-hydroxyl-kinase activity (GO:0051731)|RNA binding (GO:0003723)			central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(2)|lung(9)|skin(2)|urinary_tract(1)	19	Ovarian(185;0.0212)|all_lung(157;0.154)	all_cancers(23;2.46e-35)|all_epithelial(116;1.41e-22)|all_lung(118;7.59e-07)|Lung NSC(185;4.28e-06)|Colorectal(325;4.52e-05)|Breast(487;0.000353)|Renal(390;0.0007)|Hepatocellular(190;0.00308)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0443)		Colorectal(212;1.47e-07)|COAD - Colon adenocarcinoma(227;1.47e-05)|Kidney(185;5.27e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.000971)|BRCA - Breast invasive adenocarcinoma(365;0.00113)|STAD - Stomach adenocarcinoma(132;0.0017)|READ - Rectum adenocarcinoma(331;0.0649)		AGTAACCGCCACCGTAGGCGC	0.781													G|||	4907	0.979832	0.9281	0.9914	5008	,	,		8643	1.0		1.0	False		,,,				2504	1.0				p.W50R		.											.	NOL9-515	0			c.T148C						.	G	ARG/TRP	1625,149		742,141,4	2.0	3.0	3.0		148	4.0	0.8	1	dbSNP_116	3	3888,4		1942,4,0	no	missense	NOL9	NM_024654.4	101	2684,145,4	GG,GA,AA		0.1028,8.3991,2.7003	benign	50/703	6614415	5513,153	887	1946	2833	SO:0001583	missense	79707	exon1			ACCGCCACCGTAG	AK091284	CCDS80.1	1p36.31	2012-05-02			ENSG00000162408	ENSG00000162408			26265	protein-coding gene	gene with protein product	"""polynucleotide 5'-kinase"""					21063389	Standard	NM_024654		Approved	FLJ23323, NET6, Grc3	uc001ans.3	Q5SY16	OTTHUMG00000000904	ENST00000377705.5:c.148T>C	1.37:g.6614415A>G	ENSP00000366934:p.Trp50Arg	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	6	6	NM_024654	0	0	0	0	0	Q2NL84|Q4VBY3|Q6P472|Q7L4D6|Q96EE0|Q9H5L4	Missense_Mutation	SNP	ENST00000377705.5	37	CCDS80.1	2140	0.9798534798534798	452	0.9186991869918699	358	0.988950276243094	572	1.0	758	1.0	G	0.460	-0.889729	0.02511	0.916009	0.998972	ENSG00000162408	ENST00000377705	T	0.14516	2.5	4.0	4.0	0.46444	.	0.198450	0.25411	N	0.030874	T	0.00012	0.0000	N	0.01576	-0.805	0.58432	P	1.999999999946489E-6	B	0.02656	0.0	B	0.01281	0.0	T	0.38972	-0.9636	9	0.02654	T	1	-21.655	7.9426	0.29967	0.1142:0.0:0.8858:0.0	rs6693400;rs57411617	50	Q5SY16	NOL9_HUMAN	R	50	ENSP00000366934:W50R	ENSP00000366934:W50R	W	-	1	0	NOL9	6537002	0.793000	0.28825	0.806000	0.32338	0.033000	0.12548	0.756000	0.26419	1.042000	0.40150	-0.282000	0.10007	TGG	A|0.020;G|0.980		0.781	NOL9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000002625.1	NM_024654	
SRM	6723	hgsc.bcm.edu	37	1	11119899	11119899	+	Silent	SNP	T	T	C	rs7545802		TCGA-OR-A5LF-01A-11D-A30A-10	TCGA-OR-A5LF-10A-01D-A30A-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2cf21c74-97c0-46f3-8e1a-197f9737b5b5	bcf5a948-3260-455b-b930-5cec0d656728	g.chr1:11119899T>C	ENST00000376957.2	-	1	182	c.102A>G	c.(100-102)tcA>tcG	p.S34S		NM_003132.2	NP_003123.2	P19623	SPEE_HUMAN	spermidine synthase	34	PABS.				cellular nitrogen compound metabolic process (GO:0034641)|polyamine metabolic process (GO:0006595)|small molecule metabolic process (GO:0044281)|spermidine biosynthetic process (GO:0008295)	cytosol (GO:0005829)	protein homodimerization activity (GO:0042803)|spermidine synthase activity (GO:0004766)			large_intestine(1)|lung(1)|urinary_tract(1)	3	Ovarian(185;0.249)	Lung NSC(185;1.74e-05)|all_lung(284;2.05e-05)|Renal(390;0.000147)|Colorectal(325;0.00205)|Breast(348;0.00262)|Hepatocellular(190;0.00913)|Ovarian(437;0.00965)|Myeloproliferative disorder(586;0.0255)	STAD - Stomach adenocarcinoma(5;0.228)	UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;3.14e-07)|COAD - Colon adenocarcinoma(227;7.11e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000294)|Kidney(185;0.000728)|KIRC - Kidney renal clear cell carcinoma(229;0.00258)|READ - Rectum adenocarcinoma(331;0.0487)|STAD - Stomach adenocarcinoma(313;0.192)	S-Adenosylmethionine(DB00118)	CCACCTGCAGTGACAGGGCCT	0.761													C|||	5008	1.0	1.0	1.0	5008	,	,		7294	1.0		1.0	False		,,,				2504	1.0				p.S34S		.											.	SRM-90	0			c.A102G						.						8.0	10.0	10.0					1																	11119899		1613	3461	5074	SO:0001819	synonymous_variant	6723	exon1			CTGCAGTGACAGG	BC033106	CCDS125.1	1p36-p22	2010-11-08			ENSG00000116649	ENSG00000116649	2.5.1.16		11296	protein-coding gene	gene with protein product		182891		SRML1		2344393	Standard	NM_003132		Approved	SPS1	uc001arz.1	P19623	OTTHUMG00000002119	ENST00000376957.2:c.102A>G	1.37:g.11119899T>C		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	5	5	NM_003132	0	0	0	0	0	B1AKP9|Q15511	Silent	SNP	ENST00000376957.2	37	CCDS125.1																																																																																			T|0.001;C|0.999		0.761	SRM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000006056.1	NM_003132	
DHRS3	9249	bcgsc.ca	37	1	12640650	12640650	+	Silent	SNP	C	C	T	rs11540058	byFrequency	TCGA-OR-A5LF-01A-11D-A30A-10	TCGA-OR-A5LF-10A-01D-A30A-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2cf21c74-97c0-46f3-8e1a-197f9737b5b5	bcf5a948-3260-455b-b930-5cec0d656728	g.chr1:12640650C>T	ENST00000376223.2	-	2	623	c.240G>A	c.(238-240)acG>acA	p.T80T	DHRS3_ENST00000482265.1_5'UTR	NM_004753.4	NP_004744.2	O75911	DHRS3_HUMAN	dehydrogenase/reductase (SDR family) member 3	80					bone morphogenesis (GO:0060349)|cardiac septum morphogenesis (GO:0060411)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|outflow tract morphogenesis (GO:0003151)|palate development (GO:0060021)|phototransduction, visible light (GO:0007603)|regulation of ossification (GO:0030278)|retinoid metabolic process (GO:0001523)|retinol metabolic process (GO:0042572)|visual perception (GO:0007601)	integral component of membrane (GO:0016021)|photoreceptor outer segment membrane (GO:0042622)	electron carrier activity (GO:0009055)|NADP-retinol dehydrogenase activity (GO:0052650)|nucleotide binding (GO:0000166)|retinol dehydrogenase activity (GO:0004745)			cervix(1)|large_intestine(4)|lung(2)|prostate(1)|skin(1)	9	Ovarian(185;0.249)	Lung NSC(185;4.11e-05)|all_lung(284;4.58e-05)|Renal(390;0.000147)|Colorectal(325;0.000585)|Breast(348;0.000596)|Ovarian(437;0.00965)|Hepatocellular(190;0.0202)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.023)|Colorectal(212;9.25e-07)|COAD - Colon adenocarcinoma(227;0.000326)|BRCA - Breast invasive adenocarcinoma(304;0.000344)|Kidney(185;0.00235)|KIRC - Kidney renal clear cell carcinoma(229;0.00656)|STAD - Stomach adenocarcinoma(313;0.00798)|READ - Rectum adenocarcinoma(331;0.0419)	Vitamin A(DB00162)	GGATCTCCTCCGTCGTCTCCT	0.537													C|||	399	0.0796725	0.0446	0.0764	5008	,	,		17584	0.002		0.1918	False		,,,				2504	0.0941				p.T80T		.											.	DHRS3-91	0			c.G240A						.	C		294,4112	161.1+/-193.3	10,274,1919	74.0	71.0	72.0		240	-4.2	0.4	1	dbSNP_120	72	1781,6819	321.8+/-315.3	194,1393,2713	no	coding-synonymous	DHRS3	NM_004753.4		204,1667,4632	TT,TC,CC		20.7093,6.6727,15.9542		80/303	12640650	2075,10931	2203	4300	6503	SO:0001819	synonymous_variant	9249	exon2			CTCCTCCGTCGTC	AF061741	CCDS146.1	1p36.1	2011-09-20			ENSG00000162496	ENSG00000162496	1.1.-.-	"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 3"""	17693	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 16C, member 1"""	612830				9705317, 12226107, 19027726	Standard	XM_005263533		Approved	retSDR1, Rsdr1, SDR1, RDH17, SDR16C1	uc001auc.3	O75911	OTTHUMG00000001885	ENST00000376223.2:c.240G>A	1.37:g.12640650C>T		Somatic	154	0		WXS	Illumina GAIIx	Phase_I	166	6	NM_004753	0	0	0	0	0	B2R7F3|Q5VUY3|Q6UY38|Q9BUC8	Silent	SNP	ENST00000376223.2	37	CCDS146.1																																																																																			C|0.868;T|0.132		0.537	DHRS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000005318.1	NM_004753	
OPRD1	4985	hgsc.bcm.edu	37	1	29138975	29138975	+	Missense_Mutation	SNP	G	G	T	rs1042114	byFrequency	TCGA-OR-A5LF-01A-11D-A30A-10	TCGA-OR-A5LF-10A-01D-A30A-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2cf21c74-97c0-46f3-8e1a-197f9737b5b5	bcf5a948-3260-455b-b930-5cec0d656728	g.chr1:29138975G>T	ENST00000234961.2	+	1	322	c.80G>T	c.(79-81)tGc>tTc	p.C27F		NM_000911.3	NP_000902.3	P41143	OPRD_HUMAN	opioid receptor, delta 1	27			C -> F (improved maturation and increased expression at the cell surface; dbSNP:rs1042114). {ECO:0000269|PubMed:10982041, ECO:0000269|PubMed:8201839, ECO:0000269|Ref.4}.		adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|adult locomotory behavior (GO:0008344)|cellular response to growth factor stimulus (GO:0071363)|cellular response to hypoxia (GO:0071456)|cellular response to toxic substance (GO:0097237)|G-protein coupled receptor signaling pathway (GO:0007186)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|immune response (GO:0006955)|negative regulation of gene expression (GO:0010629)|negative regulation of protein oligomerization (GO:0032460)|neuropeptide signaling pathway (GO:0007218)|opioid receptor signaling pathway (GO:0038003)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|positive regulation of CREB transcription factor activity (GO:0032793)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|protein import into nucleus, translocation (GO:0000060)|regulation of calcium ion transport (GO:0051924)|regulation of mitochondrial membrane potential (GO:0051881)|regulation of sensory perception of pain (GO:0051930)	axon terminus (GO:0043679)|cytoplasm (GO:0005737)|dendrite membrane (GO:0032590)|integral component of plasma membrane (GO:0005887)|intrinsic component of plasma membrane (GO:0031226)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|vesicle (GO:0031982)	enkephalin receptor activity (GO:0038046)|opioid receptor activity (GO:0004985)			breast(1)|central_nervous_system(1)|kidney(3)|large_intestine(1)|lung(2)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	15		Colorectal(325;3.46e-05)|Lung NSC(340;0.000947)|all_lung(284;0.00131)|Renal(390;0.00758)|Breast(348;0.00765)|all_neural(195;0.0199)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0563)|Medulloblastoma(700;0.123)		Colorectal(126;1.29e-07)|COAD - Colon adenocarcinoma(152;7.51e-06)|STAD - Stomach adenocarcinoma(196;0.00306)|BRCA - Breast invasive adenocarcinoma(304;0.0241)|READ - Rectum adenocarcinoma(331;0.0649)|KIRC - Kidney renal clear cell carcinoma(1967;0.147)	Alvimopan(DB06274)|Amitriptyline(DB00321)|Buprenorphine(DB00921)|Butorphanol(DB00611)|Codeine(DB00318)|Dextromethorphan(DB00514)|Dextropropoxyphene(DB00647)|Diphenoxylate(DB01081)|Fentanyl(DB00813)|Heroin(DB01452)|Hydrocodone(DB00956)|Hydromorphone(DB00327)|Ketamine(DB01221)|Ketobemidone(DB06738)|Levorphanol(DB00854)|Loperamide(DB00836)|Methadone(DB00333)|Morphine(DB00295)|Nalbuphine(DB00844)|Naloxone(DB01183)|Naltrexone(DB00704)|Oxycodone(DB00497)|Oxymorphone(DB01192)|Remifentanil(DB00899)|Sufentanil(DB00708)|Tapentadol(DB06204)|Tramadol(DB00193)	CCTAGCGCCTGCCCCAGCGCT	0.771													T|||	4730	0.944489	0.9796	0.9193	5008	,	,		9147	1.0		0.8678	False		,,,				2504	0.9366				p.C27F		.											.	OPRD1-69	0			c.G80T						.	T	PHE/CYS	3689,115		1788,113,1	4.0	6.0	5.0	http://www.ncbi.nlm.nih.gov/omim/103780,165195|http://omim.org/entry/165195|http://omim.org/entry/103780	80	2.9	1.0	1	dbSNP_86	5	6762,846		2982,798,24	no	missense	OPRD1	NM_000911.3	205	4770,911,25	TT,TG,GG		11.1199,3.0231,8.421	benign	27/373	29138975	10451,961	1902	3804	5706	SO:0001583	missense	4985	exon1			GCGCCTGCCCCAG	U10504	CCDS329.1	1p36.1-p34.3	2012-08-08			ENSG00000116329	ENSG00000116329		"""GPCR / Class A : Opioid receptors"""	8153	protein-coding gene	gene with protein product		165195				8415697	Standard	NM_000911		Approved		uc001brf.1	P41143	OTTHUMG00000003646	ENST00000234961.2:c.80G>T	1.37:g.29138975G>T	ENSP00000234961:p.Cys27Phe	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	19	18	NM_000911	0	0	0	0	0	B5B0B8	Missense_Mutation	SNP	ENST00000234961.2	37	CCDS329.1	2035	0.9317765567765568	474	0.9634146341463414	331	0.914364640883978	572	1.0	658	0.8680738786279684	T	0.016	-1.513433	0.00975	0.969769	0.888801	ENSG00000116329	ENST00000234961;ENST00000536280	T	0.67698	-0.28	4.0	2.89	0.33648	.	1.802200	0.02327	N	0.073605	T	0.00012	0.0000	N	0.01874	-0.695	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.41342	-0.9514	9	0.09338	T	0.73	.	3.8109	0.08796	0.0:0.1144:0.2238:0.6618	rs1042114;rs59349662;rs1042114	27	P41143	OPRD_HUMAN	F	27	ENSP00000234961:C27F	ENSP00000234961:C27F	C	+	2	0	OPRD1	29011562	0.002000	0.14202	0.992000	0.48379	0.116000	0.19942	0.521000	0.22893	0.713000	0.32060	-0.694000	0.03704	TGC	G|0.061;T|0.939		0.771	OPRD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000010330.1	NM_000911	
ZCCHC17	51538	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	1	31819587	31819587	+	Splice_Site	SNP	G	G	T			TCGA-OR-A5LF-01A-11D-A30A-10	TCGA-OR-A5LF-10A-01D-A30A-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2cf21c74-97c0-46f3-8e1a-197f9737b5b5	bcf5a948-3260-455b-b930-5cec0d656728	g.chr1:31819587G>T	ENST00000373714.1	+	6	679	c.418G>T	c.(418-420)Ggc>Tgc	p.G140C	ZCCHC17_ENST00000344147.5_Splice_Site_p.G140C|RP11-266K22.2_ENST00000430143.1_RNA|ZCCHC17_ENST00000422613.2_Missense_Mutation_p.G116C|ZCCHC17_ENST00000546109.1_Splice_Site_p.G132C|ZCCHC17_ENST00000479629.1_3'UTR	NM_001282568.1|NM_001282570.1	NP_001269497.1|NP_001269499.1	Q9NP64	NO40_HUMAN	zinc finger, CCHC domain containing 17	140						cytosolic large ribosomal subunit (GO:0022625)|nucleolus (GO:0005730)	poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			breast(1)|kidney(1)|large_intestine(2)|ovary(1)|skin(1)	6		Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.127)|all_neural(195;0.146)|Medulloblastoma(700;0.151)|Breast(348;0.222)		STAD - Stomach adenocarcinoma(196;0.0215)|READ - Rectum adenocarcinoma(331;0.168)		TGGCTGTAAAGGTAGGGTGAA	0.517																																					p.G140C		.											.	ZCCHC17-91	0			c.G418T						.						94.0	72.0	80.0					1																	31819587		2203	4300	6503	SO:0001630	splice_region_variant	51538	exon6			TGTAAAGGTAGGG	AF151085	CCDS341.1, CCDS60061.1, CCDS72741.1, CCDS72742.1, CCDS72743.1, CCDS72744.1	1p35.2	2008-05-02			ENSG00000121766	ENSG00000121766		"""Zinc fingers, CCHC domain containing"""	30246	protein-coding gene	gene with protein product						12202495, 12893261	Standard	NM_001282572		Approved	PS1D, HSPC251, pNO40	uc001bsp.1	Q9NP64	OTTHUMG00000003791	ENST00000373714.1:c.418+1G>T	1.37:g.31819587G>T		Somatic	105	0		WXS	Illumina GAIIx	Phase_I	106	36	NM_016505	0	0	0	0	0	B4DY38|D3DPN4|Q6PKH4|Q9NYG4|Q9P0M8	Missense_Mutation	SNP	ENST00000373714.1	37	CCDS341.1	.	.	.	.	.	.	.	.	.	.	G	20.5	4.002448	0.74932	.	.	ENSG00000121766	ENST00000344147;ENST00000373714;ENST00000546109;ENST00000422613	D;D;D	0.96522	-4.04;-4.04;-4.04	5.5	5.5	0.81552	Zinc finger, CCHC-type (2);	0.000000	0.85682	D	0.000000	D	0.98058	0.9360	M	0.79011	2.435	0.44908	D	0.997923	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	D	0.98705	1.0702	10	0.87932	D	0	.	18.523	0.90960	0.0:0.0:1.0:0.0	.	116;132;140	E7EPF0;B4DY38;Q9NP64	.;.;NO40_HUMAN	C	140;140;132;116	ENSP00000343557:G140C;ENSP00000362819:G140C;ENSP00000444742:G132C	ENSP00000343557:G140C	G	+	1	0	ZCCHC17	31592174	1.000000	0.71417	1.000000	0.80357	0.594000	0.36715	8.208000	0.89748	2.745000	0.94114	0.491000	0.48974	GGC;GGC;GGC;GGT	.		0.517	ZCCHC17-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000010665.1	NM_016505	Missense_Mutation
LEPR	3953	ucsc.edu;bcgsc.ca	37	1	66087142	66087142	+	Splice_Site	SNP	G	G	T			TCGA-OR-A5LF-01A-11D-A30A-10	TCGA-OR-A5LF-10A-01D-A30A-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2cf21c74-97c0-46f3-8e1a-197f9737b5b5	bcf5a948-3260-455b-b930-5cec0d656728	g.chr1:66087142G>T	ENST00000349533.6	+	18	2782		c.e18+1		LEPR_ENST00000371059.3_Splice_Site|LEPR_ENST00000344610.8_Splice_Site|LEPR_ENST00000406510.3_Intron|LEPR_ENST00000371060.3_Splice_Site|LEPR_ENST00000371058.1_Splice_Site	NM_002303.5	NP_002294.2	O15243	OBRG_HUMAN	leptin receptor						negative regulation of growth hormone receptor signaling pathway (GO:0060400)|negative regulation of JAK-STAT cascade (GO:0046426)|negative regulation of protein localization to cell surface (GO:2000009)	endosome (GO:0005768)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	receptor binding (GO:0005102)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(7)|lung(22)|skin(2)	36				OV - Ovarian serous cystadenocarcinoma(397;0.00722)|KIRC - Kidney renal clear cell carcinoma(1967;0.094)		CACACCAAAGGTATTGTACTT	0.328																																					.		.											.	LEPR-91	0			c.2597+1G>T	GRCh37	CS982253	LEPR	S		.						136.0	126.0	130.0					1																	66087142		2203	4296	6499	SO:0001630	splice_region_variant	3953	exon18			CCAAAGGTATTGT	U43168	CCDS631.1, CCDS30740.1, CCDS30741.1, CCDS55604.1	1p31	2014-09-17			ENSG00000116678	ENSG00000116678		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6554	protein-coding gene	gene with protein product		601007				8548812, 8812446	Standard	NM_001003680		Approved	OBR, CD295	uc001dci.3	P48357	OTTHUMG00000009115	ENST00000349533.6:c.2597+1G>T	1.37:g.66087142G>T		Somatic	39	0		WXS	Illumina GAIIx	Phase_I	37	4	NM_001003679	0	0	0	0	0	Q6FHL5	Splice_Site	SNP	ENST00000349533.6	37	CCDS631.1	.	.	.	.	.	.	.	.	.	.	G	11.19	1.564305	0.27915	.	.	ENSG00000116678	ENST00000344610;ENST00000349533;ENST00000371060;ENST00000371059;ENST00000371058	.	.	.	5.13	5.13	0.70059	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	17.4917	0.87705	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	LEPR	65859730	1.000000	0.71417	1.000000	0.80357	0.128000	0.20619	6.593000	0.74100	2.542000	0.85734	0.591000	0.81541	.	.		0.328	LEPR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000025275.1	NM_002303	Intron
LOR	4014	hgsc.bcm.edu	37	1	153233578	153233578	+	Silent	SNP	C	C	T	rs1143389	byFrequency	TCGA-OR-A5LF-01A-11D-A30A-10	TCGA-OR-A5LF-10A-01D-A30A-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2cf21c74-97c0-46f3-8e1a-197f9737b5b5	bcf5a948-3260-455b-b930-5cec0d656728	g.chr1:153233578C>T	ENST00000368742.3	+	2	210	c.153C>T	c.(151-153)tgC>tgT	p.C51C		NM_000427.2	NP_000418.2	P23490	LORI_HUMAN	loricrin	51					keratinization (GO:0031424)|keratinocyte differentiation (GO:0030216)|peptide cross-linking (GO:0018149)	cornified envelope (GO:0001533)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	protein binding, bridging (GO:0030674)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)			lung(2)	2	all_lung(78;3.35e-32)|Lung NSC(65;1.22e-30)|Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.171)			gttctggctgcggctactccg	0.796													C|||	1003	0.20028	0.034	0.147	5008	,	,		4886	0.3194		0.1412	False		,,,				2504	0.4008				p.C51C		.											.	LOR-90	0			c.C153T						.	C		83,2085		3,77,1004	2.0	2.0	2.0		153	-7.2	0.0	1	dbSNP_86	2	743,3969		44,655,1657	no	coding-synonymous	LOR	NM_000427.2		47,732,2661	TT,TC,CC		15.7683,3.8284,12.0058		51/313	153233578	826,6054	1084	2356	3440	SO:0001819	synonymous_variant	4014	exon2			TGGCTGCGGCTAC	M61120	CCDS30870.1	1q21	2008-02-05			ENSG00000203782	ENSG00000203782			6663	protein-coding gene	gene with protein product		152445				2007607, 1355480	Standard	NM_000427		Approved		uc001fbm.3	P23490	OTTHUMG00000013938	ENST00000368742.3:c.153C>T	1.37:g.153233578C>T		Somatic	2	0		WXS	Illumina GAIIx	Phase_I	13	13	NM_000427	0	0	0	0	0	Q5T869|Q5XKF8	Silent	SNP	ENST00000368742.3	37	CCDS30870.1																																																																																			C|0.818;T|0.182		0.796	LOR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039107.1	NM_000427	
LOR	4014	hgsc.bcm.edu	37	1	153233701	153233701	+	Silent	SNP	A	A	C	rs1143390	byFrequency	TCGA-OR-A5LF-01A-11D-A30A-10	TCGA-OR-A5LF-10A-01D-A30A-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2cf21c74-97c0-46f3-8e1a-197f9737b5b5	bcf5a948-3260-455b-b930-5cec0d656728	g.chr1:153233701A>C	ENST00000368742.3	+	2	333	c.276A>C	c.(274-276)ggA>ggC	p.G92G		NM_000427.2	NP_000418.2	P23490	LORI_HUMAN	loricrin	92					keratinization (GO:0031424)|keratinocyte differentiation (GO:0030216)|peptide cross-linking (GO:0018149)	cornified envelope (GO:0001533)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	protein binding, bridging (GO:0030674)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)			lung(2)	2	all_lung(78;3.35e-32)|Lung NSC(65;1.22e-30)|Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.171)			AGTACTCcggaggcggcggct	0.786													a|||	1994	0.398163	0.416	0.3703	5008	,	,		4732	0.3562		0.3797	False		,,,				2504	0.456				p.G92G		.											.	LOR-90	0			c.A276C						.						1.0	1.0	1.0					1																	153233701		392	1110	1502	SO:0001819	synonymous_variant	4014	exon2			CTCCGGAGGCGGC	M61120	CCDS30870.1	1q21	2008-02-05			ENSG00000203782	ENSG00000203782			6663	protein-coding gene	gene with protein product		152445				2007607, 1355480	Standard	NM_000427		Approved		uc001fbm.3	P23490	OTTHUMG00000013938	ENST00000368742.3:c.276A>C	1.37:g.153233701A>C		Somatic	1	0		WXS	Illumina GAIIx	Phase_I	9	8	NM_000427	0	0	0	0	0	Q5T869|Q5XKF8	Silent	SNP	ENST00000368742.3	37	CCDS30870.1																																																																																			A|0.594;C|0.406		0.786	LOR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039107.1	NM_000427	
FMO3	2328	bcgsc.ca	37	1	171083226	171083226	+	Missense_Mutation	SNP	G	G	T	rs371057073		TCGA-OR-A5LF-01A-11D-A30A-10	TCGA-OR-A5LF-10A-01D-A30A-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2cf21c74-97c0-46f3-8e1a-197f9737b5b5	bcf5a948-3260-455b-b930-5cec0d656728	g.chr1:171083226G>T	ENST00000367755.4	+	7	1018	c.907G>T	c.(907-909)Gtg>Ttg	p.V303L	FMO3_ENST00000392085.2_Missense_Mutation_p.V303L|FMO3_ENST00000538429.1_Missense_Mutation_p.V240L|FMO3_ENST00000542847.1_Missense_Mutation_p.V283L	NM_001002294.2	NP_001002294.1	P31513	FMO3_HUMAN	flavin containing monooxygenase 3	303					drug metabolic process (GO:0017144)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)	amino acid binding (GO:0016597)|flavin adenine dinucleotide binding (GO:0050660)|N,N-dimethylaniline monooxygenase activity (GO:0004499)|NADP binding (GO:0050661)|trimethylamine monooxygenase activity (GO:0034899)			endometrium(1)|kidney(1)|large_intestine(12)|lung(12)|skin(1)|stomach(2)|urinary_tract(2)	31	all_hematologic(923;0.0922)|Acute lymphoblastic leukemia(37;0.181)				Almotriptan(DB00918)|Cimetidine(DB00501)|Clozapine(DB00363)|Dapsone(DB00250)|Dasatinib(DB01254)|Olanzapine(DB00334)|Tamoxifen(DB00675)|Vandetanib(DB05294)|Voriconazole(DB00582)	AAAGCCTAACGTGAAGGAATT	0.458																																					p.V303L		.											.	FMO3-187	0			c.G907T						.						141.0	124.0	130.0					1																	171083226		2203	4300	6503	SO:0001583	missense	2328	exon7			CCTAACGTGAAGG	BC032016	CCDS1292.1	1q24.3	2013-10-01			ENSG00000007933	ENSG00000007933	2.6.1.16		3771	protein-coding gene	gene with protein product		136132				8486388, 9417913	Standard	NM_001002294		Approved		uc001ghh.3	P31513	OTTHUMG00000035505	ENST00000367755.4:c.907G>T	1.37:g.171083226G>T	ENSP00000356729:p.Val303Leu	Somatic	106	0		WXS	Illumina GAIIx	Phase_I	89	4	NM_001002294	0	0	0	0	0	B2R816|Q14854|Q8N5N5	Missense_Mutation	SNP	ENST00000367755.4	37	CCDS1292.1	.	.	.	.	.	.	.	.	.	.	G	16.28	3.077868	0.55753	.	.	ENSG00000007933	ENST00000367755;ENST00000392085;ENST00000542847;ENST00000538429	T;T;T;T	0.59083	0.29;0.29;0.29;0.29	4.73	4.73	0.59995	.	0.195253	0.43919	D	0.000510	T	0.61274	0.2334	M	0.63843	1.955	0.42266	D	0.992035	D;D;D	0.71674	0.997;0.998;0.998	P;D;D	0.70016	0.903;0.945;0.967	T	0.64127	-0.6480	10	0.48119	T	0.1	-12.0722	8.8013	0.34909	0.1705:0.0:0.8295:0.0	.	240;283;303	F5H261;F5GZZ8;P31513	.;.;FMO3_HUMAN	L	303;303;283;240	ENSP00000356729:V303L;ENSP00000375935:V303L;ENSP00000444073:V283L;ENSP00000439500:V240L	ENSP00000356729:V303L	V	+	1	0	FMO3	169349850	1.000000	0.71417	0.941000	0.38009	0.354000	0.29330	3.205000	0.51090	2.305000	0.77605	0.650000	0.86243	GTG	.		0.458	FMO3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086219.1	NM_006894	
CAPN9	10753	bcgsc.ca	37	1	230903350	230903350	+	Silent	SNP	T	T	C	rs3828126	byFrequency	TCGA-OR-A5LF-01A-11D-A30A-10	TCGA-OR-A5LF-10A-01D-A30A-10	T	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2cf21c74-97c0-46f3-8e1a-197f9737b5b5	bcf5a948-3260-455b-b930-5cec0d656728	g.chr1:230903350T>C	ENST00000271971.2	+	5	713	c.600T>C	c.(598-600)acT>acC	p.T200T	CAPN9_ENST00000366666.2_Silent_p.T137T|CAPN9_ENST00000354537.1_Silent_p.T200T|RP11-99J16__A.2_ENST00000412344.1_RNA	NM_006615.2	NP_006606.1	O14815	CAN9_HUMAN	calpain 9	200	Calpain catalytic. {ECO:0000255|PROSITE- ProRule:PRU00239}.				digestion (GO:0007586)|proteolysis (GO:0006508)	cytoplasm (GO:0005737)	calcium ion binding (GO:0005509)|calcium-dependent cysteine-type endopeptidase activity (GO:0004198)			autonomic_ganglia(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(12)|ovary(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	25	Breast(184;0.0871)|Ovarian(103;0.183)	Prostate(94;0.167)				AAGACTTCACTGGGGGTGTGG	0.552													C|||	1125	0.224641	0.1959	0.2939	5008	,	,		16928	0.1984		0.337	False		,,,				2504	0.1258				p.T200T		.											.	CAPN9-91	0			c.T600C						.	C	,	855,3551	745.1+/-411.6	81,693,1429	89.0	92.0	91.0		600,600	-10.6	0.0	1	dbSNP_107	91	2820,5780	676.6+/-403.3	479,1862,1959	yes	coding-synonymous,coding-synonymous	CAPN9	NM_006615.2,NM_016452.1	,	560,2555,3388	CC,CT,TT		32.7907,19.4054,28.2562	,	200/691,200/665	230903350	3675,9331	2203	4300	6503	SO:0001819	synonymous_variant	10753	exon5			CTTCACTGGGGGT	AF022799	CCDS1586.1, CCDS31053.1	1q42.11-q42.3	2013-01-10	2004-11-11		ENSG00000135773	ENSG00000135773		"""EF-hand domain containing"""	1486	protein-coding gene	gene with protein product	"""novel calpain large subunit-4"""	606401	"""calpain 9 (nCL-4)"""			9524069, 10835488	Standard	XM_005273010		Approved	nCL-4, GC36	uc001htz.1	O14815	OTTHUMG00000037779	ENST00000271971.2:c.600T>C	1.37:g.230903350T>C		Somatic	98	0		WXS	Illumina GAIIx	Phase_I	83	4	NM_006615	0	0	0	0	0	B1APS1|B1AQI0|Q9NS74	Silent	SNP	ENST00000271971.2	37	CCDS1586.1																																																																																			T|0.736;C|0.264		0.552	CAPN9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000092179.1	NM_006615	
ANKRD26	22852	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	27322227	27322227	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5LF-01A-11D-A30A-10	TCGA-OR-A5LF-10A-01D-A30A-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2cf21c74-97c0-46f3-8e1a-197f9737b5b5	bcf5a948-3260-455b-b930-5cec0d656728	g.chr10:27322227G>A	ENST00000376087.4	-	25	3899	c.3734C>T	c.(3733-3735)aCg>aTg	p.T1245M	ANKRD26_ENST00000376070.3_Missense_Mutation_p.T802M|ANKRD26_ENST00000436985.2_Missense_Mutation_p.T1261M	NM_001256053.1|NM_014915.2	NP_001242982.1|NP_055730.2	Q9UPS8	ANR26_HUMAN	ankyrin repeat domain 26	1244					glucose homeostasis (GO:0042593)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of multicellular organism growth (GO:0040015)|negative regulation of organ growth (GO:0046621)|regulation of fatty acid metabolic process (GO:0019217)|regulation of feeding behavior (GO:0060259)	actin filament (GO:0005884)|centrosome (GO:0005813)				breast(4)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(14)|lung(30)|ovary(1)|pancreas(1)|prostate(3)|skin(2)|urinary_tract(2)	70						ATAACGTGACGTAACCTCCAG	0.333																																					p.T1245M		.											.	ANKRD26-138	0			c.C3734T						.						145.0	132.0	136.0					10																	27322227		1840	4103	5943	SO:0001583	missense	22852	exon25			CGTGACGTAACCT	AB028997	CCDS41499.1	10p12.1	2014-09-17			ENSG00000107890	ENSG00000107890		"""Ankyrin repeat domain containing"""	29186	protein-coding gene	gene with protein product		610855	"""thrombocytopenia 2 (autosomal dominant)"""	THC2		10470851, 21211618	Standard	NM_014915		Approved	KIAA1074	uc009xku.1	Q9UPS8	OTTHUMG00000017851	ENST00000376087.4:c.3734C>T	10.37:g.27322227G>A	ENSP00000365255:p.Thr1245Met	Somatic	109	0		WXS	Illumina GAIIx	Phase_I	63	46	NM_014915	0	0	0	0	0	A6NH29|Q2TAZ3|Q6ZR14|Q9H1Q1|Q9NSK9|Q9NTD5|Q9NW69	Missense_Mutation	SNP	ENST00000376087.4	37	CCDS41499.1	.	.	.	.	.	.	.	.	.	.	G	11.23	1.577930	0.28180	.	.	ENSG00000107890	ENST00000376070;ENST00000376087;ENST00000436985	T;T;T	0.78707	-1.2;-1.2;-1.2	5.55	-3.32	0.04973	.	0.688639	0.12559	N	0.458353	T	0.60625	0.2283	L	0.28400	0.85	0.09310	N	1	D;P;D	0.55385	0.957;0.928;0.971	B;B;B	0.42882	0.401;0.226;0.302	T	0.56571	-0.7957	10	0.48119	T	0.1	.	5.149	0.15000	0.5218:0.0:0.2307:0.2475	.	1245;1244;1261	Q9UPS8-3;Q9UPS8;A1L497	.;ANR26_HUMAN;.	M	802;1245;1261	ENSP00000365238:T802M;ENSP00000365255:T1245M;ENSP00000405112:T1261M	ENSP00000365238:T802M	T	-	2	0	ANKRD26	27362233	0.683000	0.27633	0.000000	0.03702	0.954000	0.61252	1.278000	0.33179	-1.078000	0.03117	0.586000	0.80456	ACG	.		0.333	ANKRD26-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047296.1		
CNNM1	26507	hgsc.bcm.edu	37	10	101089772	101089772	+	Silent	SNP	C	C	A	rs112168939	byFrequency	TCGA-OR-A5LF-01A-11D-A30A-10	TCGA-OR-A5LF-10A-01D-A30A-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2cf21c74-97c0-46f3-8e1a-197f9737b5b5	bcf5a948-3260-455b-b930-5cec0d656728	g.chr10:101089772C>A	ENST00000356713.4	+	1	917	c.628C>A	c.(628-630)Cgg>Agg	p.R210R	CNNM1_ENST00000370528.3_Silent_p.R139R|CNNM1_ENST00000370534.4_5'UTR|CNNM1_ENST00000446890.1_Silent_p.R139R	NM_020348.2	NP_065081.2	Q9NRU3	CNNM1_HUMAN	cyclin and CBS domain divalent metal cation transport mediator 1	210					ion transport (GO:0006811)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	adenyl nucleotide binding (GO:0030554)			NS(1)|breast(2)|endometrium(3)|kidney(1)|large_intestine(10)|lung(5)|ovary(1)|prostate(1)|skin(1)	25		Colorectal(252;0.234)		Epithelial(162;6.82e-10)|all cancers(201;5.62e-08)		CGTTCGCCCGCGGTTGTACGG	0.756													C|||	46	0.0091853	0.0015	0.0159	5008	,	,		12949	0.0		0.0288	False		,,,				2504	0.0041				p.R210R		.											.	CNNM1-68	0			c.C628A						.						2.0	2.0	2.0					10																	101089772		1195	2837	4032	SO:0001819	synonymous_variant	26507	exon1			CGCCCGCGGTTGT	AF169226	CCDS7478.2	10q24.2	2014-08-08	2014-08-07		ENSG00000119946	ENSG00000119946			102	protein-coding gene	gene with protein product		607802	"""cyclin M1"""	ACDP1		21393841	Standard	NM_020348		Approved		uc001kpp.4	Q9NRU3	OTTHUMG00000018881	ENST00000356713.4:c.628C>A	10.37:g.101089772C>A		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	8	8	NM_020348	0	0	0	0	0	Q4QQG7|Q4QQH8|Q4QQP9|Q9NT45	Silent	SNP	ENST00000356713.4	37	CCDS7478.2																																																																																			C|0.983;A|0.017		0.756	CNNM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049792.2	NM_020348	
EMX2	2018	bcgsc.ca	37	10	119305202	119305202	+	Silent	SNP	C	C	A	rs8192642	byFrequency	TCGA-OR-A5LF-01A-11D-A30A-10	TCGA-OR-A5LF-10A-01D-A30A-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2cf21c74-97c0-46f3-8e1a-197f9737b5b5	bcf5a948-3260-455b-b930-5cec0d656728	g.chr10:119305202C>A	ENST00000553456.3	+	2	1290	c.466C>A	c.(466-468)Cgg>Agg	p.R156R	EMX2_ENST00000546446.1_3'UTR|EMX2OS_ENST00000551288.1_RNA|EMX2_ENST00000442245.4_Intron	NM_004098.3	NP_004089.1	Q04743	EMX2_HUMAN	empty spiracles homeobox 2	156					anterior/posterior pattern specification (GO:0009952)|cell proliferation in forebrain (GO:0021846)|cerebral cortex regionalization (GO:0021796)|dentate gyrus development (GO:0021542)|forebrain cell migration (GO:0021885)|neuron differentiation (GO:0030182)|regulation of transcription, DNA-templated (GO:0006355)|renal system development (GO:0072001)|response to drug (GO:0042493)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)			endometrium(2)|large_intestine(5)|lung(2)|ovary(1)|prostate(2)	12		Colorectal(252;0.109)|Lung NSC(174;0.179)|all_lung(145;0.22)		all cancers(201;0.0133)		AAAGCCCAAGCGGATCCGAAC	0.602													C|||	32	0.00638978	0.0008	0.0115	5008	,	,		16854	0.0		0.0179	False		,,,				2504	0.0051				p.R156R		.											.	EMX2-90	0			c.C466A						.	C	,	15,4391	22.3+/-47.3	1,13,2189	65.0	55.0	58.0		,466	5.0	1.0	10	dbSNP_117	58	149,8451	73.2+/-135.9	1,147,4152	no	intron,coding-synonymous	EMX2	NM_001165924.1,NM_004098.3	,	2,160,6341	AA,AC,CC		1.7326,0.3404,1.261	,	,156/253	119305202	164,12842	2203	4300	6503	SO:0001819	synonymous_variant	2018	exon2			CCCAAGCGGATCC	AF301598	CCDS7601.1, CCDS53583.1	10q26.11	2011-06-20	2007-02-15		ENSG00000170370	ENSG00000170370		"""Homeoboxes / ANTP class : NKL subclass"""	3341	protein-coding gene	gene with protein product		600035	"""empty spiracles homolog 2 (Drosophila)"""			7959790	Standard	NM_004098		Approved		uc001ldh.4	Q04743	OTTHUMG00000019123	ENST00000553456.3:c.466C>A	10.37:g.119305202C>A		Somatic	379	6		WXS	Illumina GAIIx	Phase_I	304	10	NM_004098	0	0	0	0	0	G3V305|Q96NN8|Q9BQF4	Silent	SNP	ENST00000553456.3	37	CCDS7601.1																																																																																			C|0.988;A|0.012		0.602	EMX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050569.4	NM_004098	
PRKCDBP	112464	hgsc.bcm.edu	37	11	6341365	6341365	+	Silent	SNP	C	C	T	rs11544764	byFrequency	TCGA-OR-A5LF-01A-11D-A30A-10	TCGA-OR-A5LF-10A-01D-A30A-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2cf21c74-97c0-46f3-8e1a-197f9737b5b5	bcf5a948-3260-455b-b930-5cec0d656728	g.chr11:6341365C>T	ENST00000303927.3	-	1	512	c.342G>A	c.(340-342)ggG>ggA	p.G114G	PRKCDBP_ENST00000530979.1_Silent_p.G114G	NM_145040.2	NP_659477.2	Q969G5	PRDBP_HUMAN	protein kinase C, delta binding protein	114					cortical actin cytoskeleton organization (GO:0030866)|negative regulation of fermentation (GO:1901003)|negative regulation of protein kinase B signaling (GO:0051898)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)	caveola (GO:0005901)|protein complex (GO:0043234)				large_intestine(3)|lung(4)|prostate(1)|upper_aerodigestive_tract(1)	9		Medulloblastoma(188;0.00263)|all_neural(188;0.026)|Breast(177;0.029)		Epithelial(150;4.9e-08)|BRCA - Breast invasive adenocarcinoma(625;0.189)		CCACCAGCAGCCCGTGGTTGG	0.706													C|||	433	0.0864617	0.0416	0.0951	5008	,	,		13993	0.1438		0.1064	False		,,,				2504	0.0613				p.G114G		.											.	PRKCDBP-115	0			c.G342A						.	C		206,4012		7,192,1910	8.0	8.0	8.0		342	2.4	1.0	11	dbSNP_120	8	902,7436		53,796,3320	no	coding-synonymous	PRKCDBP	NM_145040.2		60,988,5230	TT,TC,CC		10.8179,4.8838,8.8245		114/262	6341365	1108,11448	2109	4169	6278	SO:0001819	synonymous_variant	112464	exon1			CAGCAGCCCGTGG	AF339881	CCDS7762.1	11p15.4	2011-04-20			ENSG00000170955	ENSG00000170955			9400	protein-coding gene	gene with protein product	"""sdr-related gene product that binds to c-kinase"""					9054438	Standard	NM_145040		Approved	SRBC, HSRBC, MGC20400, cavin-3, CAVIN3	uc001mcu.1	Q969G5	OTTHUMG00000133378	ENST00000303927.3:c.342G>A	11.37:g.6341365C>T		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	14	13	NM_145040	0	0	0	0	0		Silent	SNP	ENST00000303927.3	37	CCDS7762.1																																																																																			C|0.902;T|0.098		0.706	PRKCDBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257228.2	NM_145040	
PRKCDBP	112464	hgsc.bcm.edu	37	11	6341397	6341397	+	Missense_Mutation	SNP	C	C	T	rs10839551	byFrequency	TCGA-OR-A5LF-01A-11D-A30A-10	TCGA-OR-A5LF-10A-01D-A30A-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2cf21c74-97c0-46f3-8e1a-197f9737b5b5	bcf5a948-3260-455b-b930-5cec0d656728	g.chr11:6341397C>T	ENST00000303927.3	-	1	480	c.310G>A	c.(310-312)Gcc>Acc	p.A104T	PRKCDBP_ENST00000530979.1_Missense_Mutation_p.A104T	NM_145040.2	NP_659477.2	Q969G5	PRDBP_HUMAN	protein kinase C, delta binding protein	104			A -> T (in dbSNP:rs10839551).		cortical actin cytoskeleton organization (GO:0030866)|negative regulation of fermentation (GO:1901003)|negative regulation of protein kinase B signaling (GO:0051898)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)	caveola (GO:0005901)|protein complex (GO:0043234)				large_intestine(3)|lung(4)|prostate(1)|upper_aerodigestive_tract(1)	9		Medulloblastoma(188;0.00263)|all_neural(188;0.026)|Breast(177;0.029)		Epithelial(150;4.9e-08)|BRCA - Breast invasive adenocarcinoma(625;0.189)		TGCACCTGGGCTGCGCGGCGC	0.692													C|||	28	0.00559105	0.0	0.0115	5008	,	,		14865	0.0		0.0179	False		,,,				2504	0.002				p.A104T		.											.	PRKCDBP-115	0			c.G310A						.	C	THR/ALA	22,4208		0,22,2093	6.0	7.0	7.0		310	3.8	1.0	11	dbSNP_120	7	180,8078		1,178,3950	no	missense	PRKCDBP	NM_145040.2	58	1,200,6043	TT,TC,CC		2.1797,0.5201,1.6176	possibly-damaging	104/262	6341397	202,12286	2115	4129	6244	SO:0001583	missense	112464	exon1			CCTGGGCTGCGCG	AF339881	CCDS7762.1	11p15.4	2011-04-20			ENSG00000170955	ENSG00000170955			9400	protein-coding gene	gene with protein product	"""sdr-related gene product that binds to c-kinase"""					9054438	Standard	NM_145040		Approved	SRBC, HSRBC, MGC20400, cavin-3, CAVIN3	uc001mcu.1	Q969G5	OTTHUMG00000133378	ENST00000303927.3:c.310G>A	11.37:g.6341397C>T	ENSP00000307292:p.Ala104Thr	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	20	17	NM_145040	0	0	0	0	0		Missense_Mutation	SNP	ENST00000303927.3	37	CCDS7762.1	22	0.010073260073260074	0	0.0	7	0.019337016574585635	0	0.0	15	0.01978891820580475	C	22.8	4.340378	0.81911	0.005201	0.021797	ENSG00000170955	ENST00000303927;ENST00000530979	T;T	0.60171	0.21;0.21	4.71	3.76	0.43208	.	0.237121	0.35349	N	0.003280	T	0.30792	0.0776	L	0.55481	1.735	0.29445	N	0.858862	P	0.40476	0.718	B	0.35971	0.215	T	0.44406	-0.9330	10	0.35671	T	0.21	-12.8243	9.9364	0.41554	0.0:0.7749:0.2251:0.0	rs10839551;rs10839551	104	Q969G5	PRDBP_HUMAN	T	104	ENSP00000307292:A104T;ENSP00000432047:A104T	ENSP00000307292:A104T	A	-	1	0	PRKCDBP	6297973	0.655000	0.27376	1.000000	0.80357	0.877000	0.50540	2.038000	0.41184	2.442000	0.82660	0.563000	0.77884	GCC	C|0.990;T|0.010		0.692	PRKCDBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257228.2	NM_145040	
NAALADL1	10004	bcgsc.ca	37	11	64813685	64813685	+	Missense_Mutation	SNP	G	G	C	rs36053340	byFrequency	TCGA-OR-A5LF-01A-11D-A30A-10	TCGA-OR-A5LF-10A-01D-A30A-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2cf21c74-97c0-46f3-8e1a-197f9737b5b5	bcf5a948-3260-455b-b930-5cec0d656728	g.chr11:64813685G>C	ENST00000358658.3	-	15	1858	c.1831C>G	c.(1831-1833)Ctg>Gtg	p.L611V	NAALADL1_ENST00000339885.2_3'UTR|NAALADL1_ENST00000340252.4_Missense_Mutation_p.L662V|NAALADL1_ENST00000355721.3_Missense_Mutation_p.L570V|NAALADL1_ENST00000355369.2_3'UTR|NAALADL1_ENST00000356632.3_Missense_Mutation_p.L576V|NAALADL1_ENST00000526799.1_5'UTR|NAALADL1_ENST00000528884.1_5'UTR	NM_005468.2	NP_005459.2	Q9UQQ1	NALDL_HUMAN	N-acetylated alpha-linked acidic dipeptidase-like 1	611			L -> V (in dbSNP:rs36053340).			integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	carboxypeptidase activity (GO:0004180)|dipeptidase activity (GO:0016805)|metal ion binding (GO:0046872)|metallopeptidase activity (GO:0008237)|peptidase activity (GO:0008233)			autonomic_ganglia(1)|breast(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(15)|ovary(1)|prostate(1)|upper_aerodigestive_tract(2)	29						TGCTGCTCCAGCAGGGCCCCA	0.612													G|||	112	0.0223642	0.0	0.036	5008	,	,		21048	0.0		0.0417	False		,,,				2504	0.046				p.L611V		.											.	NAALADL1-90	0			c.C1831G						.	G	VAL/LEU	36,4366	42.3+/-75.8	0,36,2165	65.0	64.0	64.0		1831	-1.2	0.0	11	dbSNP_126	64	431,8163	132.5+/-190.1	11,409,3877	yes	missense	NAALADL1	NM_005468.2	32	11,445,6042	CC,CG,GG		5.0151,0.8178,3.5934	benign	611/741	64813685	467,12529	2201	4297	6498	SO:0001583	missense	10004	exon15			GCTCCAGCAGGGC	AF010141	CCDS31604.1	11q12	2011-08-16			ENSG00000168060	ENSG00000168060			23536	protein-coding gene	gene with protein product	"""ileal peptidase I100"""	602640				10085079	Standard	NM_005468		Approved		uc001ocn.3	Q9UQQ1	OTTHUMG00000165595	ENST00000358658.3:c.1831C>G	11.37:g.64813685G>C	ENSP00000351484:p.Leu611Val	Somatic	103	0		WXS	Illumina GAIIx	Phase_I	84	4	NM_005468	0	0	0	0	0	C9J8A1|C9J964|C9JL35|C9JSN0|O43176	Missense_Mutation	SNP	ENST00000358658.3	37	CCDS31604.1	45	0.020604395604395604	0	0.0	14	0.03867403314917127	0	0.0	31	0.040897097625329816	G	12.83	2.054279	0.36277	0.008178	0.050151	ENSG00000168060	ENST00000533753;ENST00000358658;ENST00000453486;ENST00000340252;ENST00000355721;ENST00000356632	T;T;T;T;T	0.61510	0.1;0.1;0.1;0.1;0.1	4.98	-1.2	0.09554	Transferrin receptor-like, dimerisation domain (2);	0.000000	0.64402	D	0.000002	T	0.18635	0.0447	L	0.58583	1.82	0.09310	N	0.999999	P	0.43314	0.803	P	0.48952	0.596	T	0.43458	-0.9390	10	0.51188	T	0.08	-18.9194	10.8916	0.46998	0.2753:0.0:0.7247:0.0	rs36053340	611	Q9UQQ1	NALDL_HUMAN	V	18;611;611;662;570;576	ENSP00000434225:L18V;ENSP00000351484:L611V;ENSP00000344244:L662V;ENSP00000347955:L570V;ENSP00000349045:L576V	ENSP00000344244:L662V	L	-	1	2	NAALADL1	64570261	0.000000	0.05858	0.004000	0.12327	0.505000	0.33919	-0.834000	0.04391	-0.308000	0.08792	0.561000	0.74099	CTG	G|0.964;C|0.036		0.612	NAALADL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385162.1	NM_005468	
NADSYN1	55191	bcgsc.ca	37	11	71169547	71169547	+	Missense_Mutation	SNP	G	G	C	rs2276360	byFrequency	TCGA-OR-A5LF-01A-11D-A30A-10	TCGA-OR-A5LF-10A-01D-A30A-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2cf21c74-97c0-46f3-8e1a-197f9737b5b5	bcf5a948-3260-455b-b930-5cec0d656728	g.chr11:71169547G>C	ENST00000319023.2	+	3	408	c.220G>C	c.(220-222)Gtg>Ctg	p.V74L		NM_018161.4	NP_060631.2	Q6IA69	NADE_HUMAN	NAD synthetase 1	74	CN hydrolase. {ECO:0000255|PROSITE- ProRule:PRU00054}.		V -> L (in dbSNP:rs2276360). {ECO:0000269|PubMed:14702039, ECO:0000269|PubMed:15489334, ECO:0000269|Ref.3}.		NAD biosynthetic process (GO:0009435)|NAD metabolic process (GO:0019674)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytoplasm (GO:0005737)|cytosol (GO:0005829)	ATP binding (GO:0005524)|hydrolase activity, acting on carbon-nitrogen (but not peptide) bonds (GO:0016810)|NAD+ synthase (glutamine-hydrolyzing) activity (GO:0003952)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(11)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)	25					L-Glutamine(DB00130)	AGCGGCCCTTGTGGAGTCTCC	0.557													C|||	2023	0.403954	0.3472	0.4697	5008	,	,		19193	0.381		0.7018	False		,,,				2504	0.1513				p.V74L	Ovarian(79;763 1781 6490 50276)	.											.	NADSYN1-92	0			c.G220C						.	C	LEU/VAL	1874,2526	631.0+/-395.6	384,1106,710	146.0	124.0	131.0		220	-2.3	0.0	11	dbSNP_100	131	6393,2195	373.8+/-337.2	2379,1635,280	yes	missense	NADSYN1	NM_018161.4	32	2763,2741,990	CC,CG,GG		25.5589,42.5909,36.3489	benign	74/707	71169547	8267,4721	2200	4294	6494	SO:0001583	missense	55191	exon3			GCCCTTGTGGAGT	AB091316	CCDS8201.1	11q13.4	2008-02-05				ENSG00000172890			29832	protein-coding gene	gene with protein product		608285				12547821	Standard	NM_018161		Approved	FLJ10631	uc001oqn.3	Q6IA69		ENST00000319023.2:c.220G>C	11.37:g.71169547G>C	ENSP00000326424:p.Val74Leu	Somatic	158	0		WXS	Illumina GAIIx	Phase_I	175	9	NM_018161	0	0	0	0	0	B3KUU4|Q86SN2|Q9HA25|Q9NVM8	Missense_Mutation	SNP	ENST00000319023.2	37	CCDS8201.1	1122	0.5137362637362637	167	0.3394308943089431	175	0.48342541436464087	243	0.42482517482517484	537	0.7084432717678101	C	1.356	-0.590150	0.03799	0.425909	0.744411	ENSG00000172890	ENST00000319023	D	0.87179	-2.22	4.35	-2.34	0.06704	Nitrilase/cyanide hydratase and apolipoprotein N-acyltransferase (4);	0.000000	0.64402	N	0.000005	T	0.00012	0.0000	N	0.00193	-1.875	0.09310	P	0.99999780136	B	0.02656	0.0	B	0.04013	0.001	T	0.32214	-0.9915	9	0.02654	T	1	-13.0225	6.6657	0.23039	0.0:0.4165:0.1199:0.4636	rs2276360;rs17677196;rs17856092;rs17856094;rs57438242;rs2276360	74	Q6IA69	NADE_HUMAN	L	74	ENSP00000326424:V74L	ENSP00000326424:V74L	V	+	1	0	NADSYN1	70847195	0.043000	0.20138	0.037000	0.18230	0.749000	0.42624	0.274000	0.18680	-0.823000	0.04301	-0.216000	0.12614	GTG	G|0.448;C|0.552		0.557	NADSYN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394356.1	NM_018161	
GLB1L3	112937	broad.mit.edu	37	11	134147265	134147265	+	Silent	SNP	A	A	C			TCGA-OR-A5LF-01A-11D-A30A-10	TCGA-OR-A5LF-10A-01D-A30A-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2cf21c74-97c0-46f3-8e1a-197f9737b5b5	bcf5a948-3260-455b-b930-5cec0d656728	g.chr11:134147265A>C	ENST00000431683.2	+	2	69	c.69A>C	c.(67-69)ccA>ccC	p.P23P	GLB1L3_ENST00000389887.5_Silent_p.P23P	NM_001080407.2	NP_001073876.2	Q8NCI6	GLBL3_HUMAN	galactosidase, beta 1-like 3	23					carbohydrate metabolic process (GO:0005975)		beta-galactosidase activity (GO:0004565)			endometrium(4)|kidney(1)|large_intestine(3)|lung(4)|pancreas(1)	13	all_hematologic(175;0.127)	all_cancers(12;5.52e-23)|all_epithelial(12;2.15e-16)|all_lung(97;1.19e-05)|Lung NSC(97;2.76e-05)|Breast(109;0.000162)|all_neural(223;0.0182)|Medulloblastoma(222;0.0208)|Esophageal squamous(93;0.0559)		Epithelial(10;1.3e-11)|all cancers(11;2.07e-10)|BRCA - Breast invasive adenocarcinoma(10;3.09e-10)|OV - Ovarian serous cystadenocarcinoma(99;0.000873)|Lung(977;0.222)		TTTTCCTGCCATTTATCTCAT	0.532																																					p.P23P		.											.	GLB1L3-69	0			c.A69C						.						70.0	75.0	74.0					11																	134147265		1886	4105	5991	SO:0001819	synonymous_variant	112937	exon2			CCTGCCATTTATC		CCDS44780.1	11q25	2008-11-06	2008-01-29		ENSG00000166105	ENSG00000166105			25147	protein-coding gene	gene with protein product						12477932	Standard	NM_001080407		Approved	FLJ90231	uc009zdf.3	Q8NCI6	OTTHUMG00000133524	ENST00000431683.2:c.69A>C	11.37:g.134147265A>C		Somatic	120	5		WXS	Illumina GAIIx	Phase_I	78	10	NM_001080407	0	0	0	0	0	A6NEM0|A6NN15|Q6P3S3|Q96FF8	Silent	SNP	ENST00000431683.2	37	CCDS44780.1																																																																																			.		0.532	GLB1L3-007	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393625.1	NM_138416	
WNK1	65125	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	966392	966392	+	Nonsense_Mutation	SNP	C	C	A			TCGA-OR-A5LF-01A-11D-A30A-10	TCGA-OR-A5LF-10A-01D-A30A-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2cf21c74-97c0-46f3-8e1a-197f9737b5b5	bcf5a948-3260-455b-b930-5cec0d656728	g.chr12:966392C>A	ENST00000315939.6	+	5	2020	c.1377C>A	c.(1375-1377)tgC>tgA	p.C459*	WNK1_ENST00000537687.1_Nonsense_Mutation_p.C459*|WNK1_ENST00000530271.2_Nonsense_Mutation_p.C459*|WNK1_ENST00000535572.1_Nonsense_Mutation_p.C459*|WNK1_ENST00000540360.1_3'UTR|WNK1_ENST00000340908.4_Nonsense_Mutation_p.C52*	NM_018979.3	NP_061852.3	Q9H4A3	WNK1_HUMAN	WNK lysine deficient protein kinase 1	459	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				intracellular signal transduction (GO:0035556)|ion transport (GO:0006811)|negative regulation of pancreatic juice secretion (GO:0090188)|negative regulation of phosphatase activity (GO:0010923)|neuron development (GO:0048666)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of systemic arterial blood pressure (GO:0003084)|protein phosphorylation (GO:0006468)|regulation of cellular process (GO:0050794)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|chloride channel inhibitor activity (GO:0019869)|phosphatase binding (GO:0019902)|protein kinase inhibitor activity (GO:0004860)|protein serine/threonine kinase activity (GO:0004674)			breast(7)|central_nervous_system(1)|endometrium(3)|kidney(6)|large_intestine(15)|lung(43)|ovary(6)|prostate(3)|skin(7)|stomach(8)|upper_aerodigestive_tract(3)|urinary_tract(2)	104	all_cancers(10;0.00611)|all_epithelial(11;0.00825)|all_lung(10;0.0331)|Ovarian(42;0.0512)|Lung NSC(10;0.0632)		Epithelial(1;1.74e-08)|all cancers(1;7.04e-08)|OV - Ovarian serous cystadenocarcinoma(31;0.000423)|BRCA - Breast invasive adenocarcinoma(9;0.0149)|Colorectal(1;0.0197)			TTGAAGGATGCATACGACAAA	0.363																																					p.C459X	Colon(19;451 567 6672 12618 28860)	.											.	WNK1-916	0			c.C1377A						.						98.0	94.0	95.0					12																	966392		2203	4300	6503	SO:0001587	stop_gained	65125	exon5			AGGATGCATACGA	AJ296290	CCDS8506.1, CCDS53731.1, CCDS73419.1	12p13.3	2014-09-17	2005-01-19	2005-01-21	ENSG00000060237	ENSG00000060237			14540	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 167"""	605232	"""protein kinase, lysine deficient 1"", ""hereditary sensory neuropathy, type II"""	PRKWNK1, HSN2			Standard	NM_001184985		Approved	HSAN2, PPP1R167	uc031qfk.1	Q9H4A3	OTTHUMG00000090321	ENST00000315939.6:c.1377C>A	12.37:g.966392C>A	ENSP00000313059:p.Cys459*	Somatic	231	1		WXS	Illumina GAIIx	Phase_I	336	64	NM_001184985	0	0	0	0	0	A1L4B0|C5HTZ5|C5HTZ6|C5HTZ7|H6WZW3|O15052|P54963|Q4VBX9|Q6IFS5|Q86WL5|Q8N673|Q96CZ6|Q9P1S9	Nonsense_Mutation	SNP	ENST00000315939.6	37	CCDS8506.1	.	.	.	.	.	.	.	.	.	.	C	44	10.641225	0.99442	.	.	ENSG00000060237	ENST00000535572;ENST00000315939;ENST00000537687;ENST00000530271;ENST00000340908	.	.	.	5.84	4.01	0.46588	.	0.000000	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-8.5126	11.1061	0.48203	0.0:0.7997:0.0:0.2003	.	.	.	.	X	459;459;459;459;52	.	ENSP00000313059:C459X	C	+	3	2	WNK1	836653	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	2.366000	0.44204	0.807000	0.34208	0.591000	0.81541	TGC	.		0.363	WNK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206683.1	NM_018979	
ATF7IP	55729	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	14578126	14578126	+	Missense_Mutation	SNP	A	A	G			TCGA-OR-A5LF-01A-11D-A30A-10	TCGA-OR-A5LF-10A-01D-A30A-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2cf21c74-97c0-46f3-8e1a-197f9737b5b5	bcf5a948-3260-455b-b930-5cec0d656728	g.chr12:14578126A>G	ENST00000540793.1	+	1	1432	c.1277A>G	c.(1276-1278)aAt>aGt	p.N426S	ATF7IP_ENST00000261168.4_Missense_Mutation_p.N426S|ATF7IP_ENST00000543189.1_Missense_Mutation_p.N426S|ATF7IP_ENST00000541654.1_3'UTR|ATF7IP_ENST00000544627.1_Missense_Mutation_p.N434S|ATF7IP_ENST00000536444.1_Missense_Mutation_p.N426S			Q6VMQ6	MCAF1_HUMAN	activating transcription factor 7 interacting protein	426	Glu-rich.				DNA methylation (GO:0006306)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of RNA polymerase II transcriptional preinitiation complex assembly (GO:0045898)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	nucleus (GO:0005634)				cervix(1)|endometrium(7)|kidney(5)|large_intestine(10)|liver(2)|lung(22)|ovary(1)|prostate(4)|skin(1)|urinary_tract(1)	54						ATCTTAGAAAATACAGACTCT	0.338																																					p.N426S		.											.	ATF7IP-252	0			c.A1277G						.						57.0	59.0	58.0					12																	14578126		2203	4300	6503	SO:0001583	missense	55729	exon2			TAGAAAATACAGA	AJ242978	CCDS8663.1, CCDS66326.1, CCDS66327.1, CCDS73449.1	12p13.1	2005-11-18				ENSG00000171681			20092	protein-coding gene	gene with protein product		613644				10976766, 10777215	Standard	XM_005253424		Approved	FLJ10688, p621	uc001rbw.3	Q6VMQ6		ENST00000540793.1:c.1277A>G	12.37:g.14578126A>G	ENSP00000444589:p.Asn426Ser	Somatic	57	0		WXS	Illumina GAIIx	Phase_I	71	30	NM_018179	0	0	0	0	0	F5GX74|G3V1U0|Q4G0T9|Q6P3T3|Q86XW5|Q9NVJ9|Q9NWC2|Q9Y4X8	Missense_Mutation	SNP	ENST00000540793.1	37	CCDS8663.1	.	.	.	.	.	.	.	.	.	.	A	10.98	1.505770	0.26949	.	.	ENSG00000171681	ENST00000261168;ENST00000543189;ENST00000536444;ENST00000544627;ENST00000396279;ENST00000540793	T;T;T;T;T;T	0.28069	2.02;2.01;2.02;2.01;1.63;2.02	5.36	1.76	0.24704	.	0.192301	0.35378	N	0.003248	T	0.22859	0.0552	L	0.45581	1.43	0.21719	N	0.999573	B;B;B;B;B;B;B	0.33022	0.394;0.084;0.011;0.009;0.009;0.084;0.084	B;B;B;B;B;B;B	0.30782	0.12;0.022;0.01;0.007;0.007;0.022;0.022	T	0.11251	-1.0595	10	0.39692	T	0.17	-10.0702	8.118	0.30955	0.7004:0.0:0.2996:0.0	.	434;426;434;426;426;426;37	B4E2A2;B4DRL6;F5GX74;G3V1U0;Q6VMQ6;Q6VMQ6-2;B3KQF8	.;.;.;.;MCAF1_HUMAN;.;.	S	426;426;426;434;426;426	ENSP00000261168:N426S;ENSP00000443179:N426S;ENSP00000445955:N426S;ENSP00000440440:N434S;ENSP00000379575:N426S;ENSP00000444589:N426S	ENSP00000261168:N426S	N	+	2	0	ATF7IP	14469393	0.392000	0.25229	0.991000	0.47740	0.993000	0.82548	0.973000	0.29422	0.430000	0.26230	0.482000	0.46254	AAT	.		0.338	ATF7IP-024	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000401400.1	NM_018179	
PLBD1	79887	hgsc.bcm.edu	37	12	14720583	14720583	+	Silent	SNP	T	T	C	rs7954623	byFrequency	TCGA-OR-A5LF-01A-11D-A30A-10	TCGA-OR-A5LF-10A-01D-A30A-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2cf21c74-97c0-46f3-8e1a-197f9737b5b5	bcf5a948-3260-455b-b930-5cec0d656728	g.chr12:14720583T>C	ENST00000240617.5	-	1	700	c.48A>G	c.(46-48)ccA>ccG	p.P16P	RP11-695J4.2_ENST00000542401.1_RNA|RP11-695J4.2_ENST00000545424.1_RNA	NM_024829.5	NP_079105.4	Q6P4A8	PLBL1_HUMAN	phospholipase B domain containing 1	16					glycerophospholipid biosynthetic process (GO:0046474)|lipid catabolic process (GO:0016042)|phosphatidylcholine acyl-chain remodeling (GO:0036151)|phosphatidylethanolamine acyl-chain remodeling (GO:0036152)|phosphatidylinositol acyl-chain remodeling (GO:0036149)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|lysosome (GO:0005764)	hydrolase activity (GO:0016787)			central_nervous_system(1)|cervix(2)|endometrium(3)|kidney(3)|large_intestine(2)|lung(3)|prostate(1)|upper_aerodigestive_tract(1)	16						gcagaagcggtggcggctgtg	0.766													C|||	4627	0.923922	0.7663	0.9741	5008	,	,		9999	0.9861		0.9871	False		,,,				2504	0.9724				p.P16P		.											.	PLBD1-90	0			c.A48G						.						1.0	1.0	1.0					12																	14720583		540	1082	1622	SO:0001819	synonymous_variant	79887	exon1			AAGCGGTGGCGGC	BC000909	CCDS31751.1	12p13.1	2013-10-11			ENSG00000121316	ENSG00000121316			26215	protein-coding gene	gene with protein product	"""PLB homolog 1 (Dictyostelium)"""					15193148, 19019078	Standard	NM_024829		Approved	FLJ22662	uc001rcc.1	Q6P4A8	OTTHUMG00000168821	ENST00000240617.5:c.48A>G	12.37:g.14720583T>C		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	7	7	NM_024829	0	0	0	0	0	A8K4E9|Q9BVV3|Q9H625	Silent	SNP	ENST00000240617.5	37	CCDS31751.1																																																																																			T|0.056;C|0.944		0.766	PLBD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401203.1	NM_024829	
RECQL	5965	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	21624011	21624011	+	Silent	SNP	A	A	C			TCGA-OR-A5LF-01A-11D-A30A-10	TCGA-OR-A5LF-10A-01D-A30A-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2cf21c74-97c0-46f3-8e1a-197f9737b5b5	bcf5a948-3260-455b-b930-5cec0d656728	g.chr12:21624011A>C	ENST00000444129.2	-	14	2157	c.1689T>G	c.(1687-1689)gcT>gcG	p.A563A	RECQL_ENST00000421138.2_Silent_p.A563A	NM_002907.3|NM_032941.2	NP_002898.2|NP_116559.1	P46063	RECQ1_HUMAN	RecQ helicase-like	563					DNA duplex unwinding (GO:0032508)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|DNA strand renaturation (GO:0000733)	membrane (GO:0016020)|nucleus (GO:0005634)	annealing helicase activity (GO:0036310)|ATP binding (GO:0005524)|ATP-dependent 3'-5' DNA helicase activity (GO:0043140)|ATP-dependent DNA helicase activity (GO:0004003)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)			endometrium(2)|kidney(1)|large_intestine(4)|lung(5)|ovary(2)|prostate(1)|skin(1)|urinary_tract(1)	17						TGGTAGCATAAGCTGTAAAAC	0.338								Other identified genes with known or suspected DNA repair function																													p.A563A		.											.	RECQL-228	0			c.T1689G						.						77.0	73.0	75.0					12																	21624011		2202	4299	6501	SO:0001819	synonymous_variant	5965	exon15			AGCATAAGCTGTA	D37984	CCDS31756.1	12p12.1	2014-03-07	2014-03-07	2014-03-07	ENSG00000004700	ENSG00000004700			9948	protein-coding gene	gene with protein product	"""DNA helicase Q1-like"""	600537	"""RecQ protein-like (DNA helicase Q1-like)"""			7527136, 7961977	Standard	NM_002907		Approved	RecQ1, RecQL1	uc001rex.3	P46063	OTTHUMG00000169131	ENST00000444129.2:c.1689T>G	12.37:g.21624011A>C		Somatic	97	0		WXS	Illumina GAIIx	Phase_I	141	60	NM_032941	0	0	0	0	0	A8K6G2	Silent	SNP	ENST00000444129.2	37	CCDS31756.1																																																																																			.		0.338	RECQL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402371.1	NM_002907	
KRT7	3855	hgsc.bcm.edu	37	12	52627215	52627215	+	Silent	SNP	A	A	G	rs7308888	byFrequency	TCGA-OR-A5LF-01A-11D-A30A-10	TCGA-OR-A5LF-10A-01D-A30A-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2cf21c74-97c0-46f3-8e1a-197f9737b5b5	bcf5a948-3260-455b-b930-5cec0d656728	g.chr12:52627215A>G	ENST00000331817.5	+	1	318	c.135A>G	c.(133-135)tcA>tcG	p.S45S		NM_005556.3	NP_005547.3	P08729	K2C7_HUMAN	keratin 7	45	Head.				viral process (GO:0016032)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)|keratin filament (GO:0045095)|nucleus (GO:0005634)	structural molecule activity (GO:0005198)			endometrium(1)|kidney(1)|large_intestine(3)|lung(5)|prostate(2)|stomach(1)|urinary_tract(1)	14				BRCA - Breast invasive adenocarcinoma(357;0.105)	Primaquine(DB01087)	TCGGCGCCTCACGGCCGCGCG	0.771													g|||	4451	0.888778	0.9781	0.8473	5008	,	,		10346	0.9048		0.8191	False		,,,				2504	0.8528				p.S45S		.											.	KRT7-90	0			c.A135G						.			3161,173		1496,169,2	4.0	6.0	5.0		135	-5.3	0.0	12	dbSNP_116	5	5763,1251		2369,1025,113	no	coding-synonymous	KRT7	NM_005556.3		3865,1194,115	GG,GA,AA		17.8358,5.189,13.7611		45/470	52627215	8924,1424	1667	3507	5174	SO:0001819	synonymous_variant	3855	exon1			CGCCTCACGGCCG		CCDS8822.1	12q13.13	2013-01-16			ENSG00000135480	ENSG00000135480		"""-"", ""Intermediate filaments type II, keratins (basic)"""	6445	protein-coding gene	gene with protein product	"""keratin, type II cytoskeletal 7"", ""cytokeratin 7"", ""sarcolectin"", ""keratin, 55K type II cytoskeletal"""	148059				1713141, 16831889	Standard	XR_245927		Approved	K7, CK7, K2C7, SCL	uc001saa.1	P08729	OTTHUMG00000169580	ENST00000331817.5:c.135A>G	12.37:g.52627215A>G		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	25	24	NM_005556	0	0	0	0	0	Q92676|Q9BUD8|Q9Y3R7	Silent	SNP	ENST00000331817.5	37	CCDS8822.1																																																																																			A|0.133;G|0.867		0.771	KRT7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404897.1	NM_005556	
CTDSP2	10106	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	58217464	58217464	+	Missense_Mutation	SNP	A	A	G			TCGA-OR-A5LF-01A-11D-A30A-10	TCGA-OR-A5LF-10A-01D-A30A-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2cf21c74-97c0-46f3-8e1a-197f9737b5b5	bcf5a948-3260-455b-b930-5cec0d656728	g.chr12:58217464A>G	ENST00000398073.2	-	8	1040	c.737T>C	c.(736-738)cTg>cCg	p.L246P	MIR26A2_ENST00000385054.1_RNA|CTDSP2_ENST00000548823.1_Missense_Mutation_p.L73P|CTDSP2_ENST00000547701.1_Missense_Mutation_p.L94P	NM_005730.3	NP_005721.3	O14595	CTDS2_HUMAN	CTD (carboxy-terminal domain, RNA polymerase II, polypeptide A) small phosphatase 2	246	FCP1 homology. {ECO:0000255|PROSITE- ProRule:PRU00336}.				activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|protein dephosphorylation (GO:0006470)	nucleoplasm (GO:0005654)	CTD phosphatase activity (GO:0008420)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|lung(1)|prostate(2)	7	all_neural(12;0.00559)|Glioma(12;0.0143)|Melanoma(17;0.122)					GATCAGGTTCAGCAACTCAGT	0.602																																					p.L246P		.											.	CTDSP2-514	0			c.T737C						.						45.0	50.0	48.0					12																	58217464		2177	4293	6470	SO:0001583	missense	10106	exon8			AGGTTCAGCAACT	AF000152	CCDS41801.1	12q14.1	2012-06-14			ENSG00000175215	ENSG00000175215		"""Serine/threonine phosphatases / CTD aspartate-based phosphatases"""	17077	protein-coding gene	gene with protein product	"""conserved gene amplified in osteosarcoma"", ""nuclear LIM interactor-interacting factor 2"", ""NLI-interacting factor 2"", ""small CTD phosphatase 2"""	608711				9315096, 12721286	Standard	XM_005268556		Approved	OS4, SCP2, PSR2	uc001sqm.3	O14595	OTTHUMG00000170483	ENST00000398073.2:c.737T>C	12.37:g.58217464A>G	ENSP00000381148:p.Leu246Pro	Somatic	126	0		WXS	Illumina GAIIx	Phase_I	184	73	NM_005730	0	0	0	0	0	A8K5H4|Q53ZR2|Q6NZY3|Q9UEX1	Missense_Mutation	SNP	ENST00000398073.2	37	CCDS41801.1	.	.	.	.	.	.	.	.	.	.	A	24.5	4.538211	0.85917	.	.	ENSG00000175215	ENST00000398073;ENST00000548823;ENST00000549039;ENST00000547701	T;T;T;T	0.20738	2.05;2.05;2.05;2.05	5.26	5.26	0.73747	NLI interacting factor (2);Dullard phosphatase domain, eukaryotic (1);HAD-like domain (2);	0.000000	0.85682	D	0.000000	T	0.56819	0.2011	M	0.93978	3.48	0.80722	D	1	D;D;D	0.89917	0.968;0.998;1.0	D;D;D	0.85130	0.967;0.986;0.997	T	0.68750	-0.5326	10	0.72032	D	0.01	-18.5521	14.2626	0.66094	1.0:0.0:0.0:0.0	.	120;73;246	B4DH48;F8W1I1;O14595	.;.;CTDS2_HUMAN	P	246;73;100;94	ENSP00000381148:L246P;ENSP00000447046:L73P;ENSP00000448386:L100P;ENSP00000446705:L94P	ENSP00000381148:L246P	L	-	2	0	CTDSP2	56503731	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	7.077000	0.76814	2.202000	0.70862	0.460000	0.39030	CTG	.		0.602	CTDSP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000409353.1	NM_005730	
GAS2L3	283431	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	101005850	101005850	+	Missense_Mutation	SNP	G	G	C	rs143611209	byFrequency	TCGA-OR-A5LF-01A-11D-A30A-10	TCGA-OR-A5LF-10A-01D-A30A-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2cf21c74-97c0-46f3-8e1a-197f9737b5b5	bcf5a948-3260-455b-b930-5cec0d656728	g.chr12:101005850G>C	ENST00000539410.1	+	5	762	c.376G>C	c.(376-378)Gca>Cca	p.A126P	GAS2L3_ENST00000547754.1_Missense_Mutation_p.A126P|GAS2L3_ENST00000266754.5_Missense_Mutation_p.A126P|GAS2L3_ENST00000537247.1_Missense_Mutation_p.A22P			Q86XJ1	GA2L3_HUMAN	growth arrest-specific 2 like 3	126	CH. {ECO:0000255|PROSITE- ProRule:PRU00044}.				actin cytoskeleton organization (GO:0030036)|cell cycle arrest (GO:0007050)|microtubule cytoskeleton organization (GO:0000226)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|microtubule (GO:0005874)|microtubule cytoskeleton (GO:0015630)	actin binding (GO:0003779)|microtubule binding (GO:0008017)			endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(15)|pancreas(1)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	35						GGACAATACCGCAAACTTCCT	0.378																																					p.A126P		.											.	GAS2L3-227	0			c.G376C						.						204.0	193.0	197.0					12																	101005850		2203	4300	6503	SO:0001583	missense	283431	exon6			AATACCGCAAACT	AK095594	CCDS9079.1	12q23.1	2014-09-11			ENSG00000139354	ENSG00000139354			27475	protein-coding gene	gene with protein product							Standard	NM_174942		Approved		uc001thu.3	Q86XJ1	OTTHUMG00000170439	ENST00000539410.1:c.376G>C	12.37:g.101005850G>C	ENSP00000439672:p.Ala126Pro	Somatic	126	0		WXS	Illumina GAIIx	Phase_I	207	32	NM_174942	0	0	0	0	0	B2RCN2	Missense_Mutation	SNP	ENST00000539410.1	37	CCDS9079.1	.	.	.	.	.	.	.	.	.	.	G	33	5.230295	0.95207	.	.	ENSG00000139354	ENST00000266754;ENST00000547754;ENST00000537247;ENST00000539410	T;T;T;T	0.44881	0.91;0.91;0.91;0.91	5.81	5.81	0.92471	Calponin homology domain (5);	0.054165	0.85682	D	0.000000	T	0.71367	0.3331	M	0.88775	2.98	0.58432	D	0.99999	D	0.54601	0.967	D	0.65874	0.939	T	0.75563	-0.3274	10	0.72032	D	0.01	-10.3724	20.1345	0.98019	0.0:0.0:1.0:0.0	.	126	Q86XJ1	GA2L3_HUMAN	P	126;126;22;126	ENSP00000266754:A126P;ENSP00000448955:A126P;ENSP00000442406:A22P;ENSP00000439672:A126P	ENSP00000266754:A126P	A	+	1	0	GAS2L3	99529981	1.000000	0.71417	0.994000	0.49952	0.980000	0.70556	9.437000	0.97535	2.763000	0.94921	0.558000	0.71614	GCA	G|1.000;T|0.000		0.378	GAS2L3-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000409143.1	NM_174942	
RIMBP2	23504	hgsc.bcm.edu	37	12	130921471	130921471	+	Silent	SNP	T	T	C	rs2292663	byFrequency	TCGA-OR-A5LF-01A-11D-A30A-10	TCGA-OR-A5LF-10A-01D-A30A-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2cf21c74-97c0-46f3-8e1a-197f9737b5b5	bcf5a948-3260-455b-b930-5cec0d656728	g.chr12:130921471T>C	ENST00000261655.4	-	10	2134	c.1971A>G	c.(1969-1971)ccA>ccG	p.P657P	RIMBP2_ENST00000535703.1_Silent_p.P565P|RIMBP2_ENST00000536002.1_Silent_p.P565P	NM_015347.4	NP_056162.4	O15034	RIMB2_HUMAN	RIMS binding protein 2	657	Pro-rich.				negative regulation of phosphatase activity (GO:0010923)	cell junction (GO:0030054)|plasma membrane (GO:0005886)|synapse (GO:0045202)				NS(2)|breast(1)|central_nervous_system(5)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(23)|lung(33)|ovary(3)|pancreas(1)|prostate(3)|skin(6)|upper_aerodigestive_tract(5)|urinary_tract(1)	96	all_neural(191;0.101)|Medulloblastoma(191;0.163)	all_epithelial(31;0.213)		OV - Ovarian serous cystadenocarcinoma(86;4.29e-06)|all cancers(50;4.56e-05)|Epithelial(86;5.41e-05)		CCTGTGGCTGTGGCAGGATGC	0.736													C|||	734	0.146565	0.1657	0.1599	5008	,	,		11830	0.256		0.1054	False		,,,				2504	0.0409				p.P657P		.											.	RIMBP2-142	0			c.A1971G						.	C		577,3799		41,495,1652	12.0	18.0	16.0		1971	-0.1	1.0	12	dbSNP_100	16	861,7691		48,765,3463	no	coding-synonymous	RIMBP2	NM_015347.4		89,1260,5115	CC,CT,TT		10.0678,13.1856,11.1231		657/1053	130921471	1438,11490	2188	4276	6464	SO:0001819	synonymous_variant	23504	exon10			TGGCTGTGGCAGG	AB002316	CCDS31925.1	12q24.33	2014-06-13				ENSG00000060709			30339	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 133"""	611602				10748113	Standard	NM_015347		Approved	KIAA0318, RBP2, MGC15831, RIM-BP2, PPP1R133	uc001uil.2	O15034		ENST00000261655.4:c.1971A>G	12.37:g.130921471T>C		Somatic	6	0		WXS	Illumina GAIIx	Phase_I	89	48	NM_015347	0	0	0	0	0	Q96ID2	Silent	SNP	ENST00000261655.4	37	CCDS31925.1																																																																																			T|0.868;C|0.132		0.736	RIMBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399520.1	NM_015347	
MEDAG	84935	hgsc.bcm.edu	37	13	31480827	31480827	+	Missense_Mutation	SNP	A	A	G	rs9531945	byFrequency	TCGA-OR-A5LF-01A-11D-A30A-10	TCGA-OR-A5LF-10A-01D-A30A-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2cf21c74-97c0-46f3-8e1a-197f9737b5b5	bcf5a948-3260-455b-b930-5cec0d656728	g.chr13:31480827A>G	ENST00000380482.4	+	1	500	c.175A>G	c.(175-177)Agg>Ggg	p.R59G	TEX26-AS1_ENST00000593246.1_RNA|TEX26-AS1_ENST00000590721.1_RNA|TEX26-AS1_ENST00000588726.1_RNA|TEX26-AS1_ENST00000592950.1_RNA|TEX26-AS1_ENST00000585870.1_RNA|TEX26-AS1_ENST00000590344.1_RNA	NM_032849.3	NP_116238	Q5VYS4	MEDAG_HUMAN	mesenteric estrogen-dependent adipogenesis	59			R -> G (in dbSNP:rs9531945). {ECO:0000269|PubMed:14702039, ECO:0000269|PubMed:15489334}.		positive regulation of fat cell differentiation (GO:0045600)	cytoplasm (GO:0005737)											CGTGGTGGCCAggcccgggga	0.726													G|||	4890	0.976438	0.913	0.9957	5008	,	,		11722	1.0		1.0	False		,,,				2504	1.0				p.R59G		.											.	.	0			c.A175G						.	G	GLY/ARG	2883,187		1349,185,1	3.0	4.0	4.0		175	3.2	0.0	13	dbSNP_119	4	6648,4		3322,4,0	no	missense	C13orf33	NM_032849.3	125	4671,189,1	GG,GA,AA		0.0601,6.0912,1.9646	benign	59/304	31480827	9531,191	1535	3326	4861	SO:0001583	missense	84935	exon1			GTGGCCAGGCCCG	AB055407	CCDS9338.1	13q12.3	2013-10-11	2012-09-26	2012-09-26	ENSG00000102802	ENSG00000102802			25926	protein-coding gene	gene with protein product	"""mesenteric estrogen-dependent adipose 4"", ""activated in W/Wv mouse stomach 3 homolog"""		"""chromosome 13 open reading frame 33"""	C13orf33		22510272	Standard	NM_032849		Approved	FLJ14834, AWMS3, MEDA-4	uc001uth.4	Q5VYS4	OTTHUMG00000016679	ENST00000380482.4:c.175A>G	13.37:g.31480827A>G	ENSP00000369849:p.Arg59Gly	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	17	17	NM_032849	0	0	0	0	0	Q8IXF1|Q96K26|Q96NC8	Missense_Mutation	SNP	ENST00000380482.4	37	CCDS9338.1	2123	0.9720695970695971	437	0.8882113821138211	361	0.9972375690607734	567	0.9912587412587412	758	1.0	G	0.006	-2.044123	0.00398	0.939088	0.999399	ENSG00000102802	ENST00000380482	T	0.40225	1.04	4.92	3.15	0.36227	.	0.260438	0.31495	N	0.007559	T	0.00012	0.0000	N	0.02539	-0.55	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.42616	-0.9441	9	0.02654	T	1	-3.5214	6.5331	0.22338	0.1691:0.1474:0.6836:0.0	rs9531945;rs17857210;rs57016010;rs9531945	59	Q5VYS4	CM033_HUMAN	G	59	ENSP00000369849:R59G	ENSP00000369849:R59G	R	+	1	2	C13orf33	30378827	0.386000	0.25180	0.001000	0.08648	0.005000	0.04900	2.086000	0.41643	0.132000	0.18615	-1.032000	0.02404	AGG	A|0.219;G|0.781		0.726	MEDAG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044375.1	NM_032849	
ING1	3621	hgsc.bcm.edu	37	13	111368316	111368316	+	Silent	SNP	C	C	T	rs9555726	byFrequency	TCGA-OR-A5LF-01A-11D-A30A-10	TCGA-OR-A5LF-10A-01D-A30A-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2cf21c74-97c0-46f3-8e1a-197f9737b5b5	bcf5a948-3260-455b-b930-5cec0d656728	g.chr13:111368316C>T	ENST00000375774.3	+	1	988	c.526C>T	c.(526-528)Ctg>Ttg	p.L176L	CARS2_ENST00000535398.1_5'Flank|ING1_ENST00000464141.1_Intron|ING1_ENST00000375775.3_Intron|ING1_ENST00000333219.7_Intron|ING1_ENST00000338450.7_Intron	NM_005537.4	NP_005528.3	Q9UK53	ING1_HUMAN	inhibitor of growth family, member 1	176					cell cycle (GO:0007049)|chromatin modification (GO:0016568)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|positive regulation of transcription, DNA-templated (GO:0045893)|protein import into nucleus (GO:0006606)|regulation of cell death (GO:0010941)	nucleus (GO:0005634)	methylated histone binding (GO:0035064)|zinc ion binding (GO:0008270)			endometrium(4)|large_intestine(6)|lung(1)|ovary(1)	12	all_lung(23;3.61e-05)|Lung NSC(43;0.00144)|Lung SC(71;0.0753)|all_neural(89;0.077)|Medulloblastoma(90;0.148)		BRCA - Breast invasive adenocarcinoma(86;0.188)			GGCCGCATCTCTGCTGACCCG	0.706													C|||	2912	0.58147	0.23	0.6816	5008	,	,		11066	0.7252		0.6909	False		,,,				2504	0.7249				p.L176L		.											.	ING1-515	0			c.C526T						.	C	,,,	1347,2085		295,757,664	14.0	24.0	21.0		526,,,	-5.6	0.0	13	dbSNP_119	21	5238,1736		2020,1198,269	no	coding-synonymous,intron,intron,intron	ING1	NM_005537.3,NM_198217.1,NM_198218.1,NM_198219.1	,,,	2315,1955,933	TT,TC,CC		24.8925,39.2483,36.7192	,,,	176/423,,,	111368316	6585,3821	1716	3487	5203	SO:0001819	synonymous_variant	3621	exon1			GCATCTCTGCTGA		CCDS9515.1, CCDS9516.1, CCDS9517.1, CCDS9518.1	13q34	2013-01-28			ENSG00000153487	ENSG00000153487		"""Zinc fingers, PHD-type"""	6062	protein-coding gene	gene with protein product	"""inhibitor of growth 1"", ""tumor suppressor ING1"", ""growth inhibitor ING1"", ""growth inhibitory protein ING1"""	601566				8944021, 9186514	Standard	NM_198219		Approved	p33ING1, p33ING1b, p24ING1c, p33, p47, p47ING1a	uc001vri.3	Q9UK53	OTTHUMG00000017346	ENST00000375774.3:c.526C>T	13.37:g.111368316C>T		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	13	13	NM_005537	0	0	0	0	0	O00532|O43658|Q53ZR3|Q5T9G8|Q5T9G9|Q5T9H0|Q5T9H1|Q9H007|Q9HD98|Q9HD99|Q9NS83|Q9P0U6|Q9UBC6|Q9UIJ1|Q9UIJ2|Q9UIJ3|Q9UIJ4|Q9UK52	Silent	SNP	ENST00000375774.3	37	CCDS9517.1																																																																																			C|0.372;T|0.628		0.706	ING1-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000045770.2	NM_005537	
DNAAF2	55172	hgsc.bcm.edu	37	14	50100683	50100683	+	Silent	SNP	C	C	G	rs2985686	byFrequency	TCGA-OR-A5LF-01A-11D-A30A-10	TCGA-OR-A5LF-10A-01D-A30A-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2cf21c74-97c0-46f3-8e1a-197f9737b5b5	bcf5a948-3260-455b-b930-5cec0d656728	g.chr14:50100683C>G	ENST00000298292.8	-	1	1265	c.1185G>C	c.(1183-1185)gcG>gcC	p.A395A	DNAAF2_ENST00000406043.3_Silent_p.A395A	NM_018139.2	NP_060609.2	Q9NVR5	KTU_HUMAN	dynein, axonemal, assembly factor 2	395					axonemal dynein complex assembly (GO:0070286)|bacterial-type flagellum-dependent cell motility (GO:0071973)|cilium-dependent cell motility (GO:0060285)|response to retinoic acid (GO:0032526)	cytoplasm (GO:0005737)				kidney(1)|lung(4)	5						CTCCGTCCTCCGCGCGACTCC	0.781													G|||	2800	0.559105	0.6702	0.6715	5008	,	,		11594	0.1736		0.7604	False		,,,				2504	0.5194				p.A395A		.											.	.	0			c.G1185C						.						1.0	1.0	1.0					14																	50100683		917	2082	2999	SO:0001819	synonymous_variant	55172	exon1			GTCCTCCGCGCGA	AK001425	CCDS9691.2, CCDS45100.1	14q21.3	2012-05-03	2011-06-09	2011-06-09	ENSG00000165506	ENSG00000165506			20188	protein-coding gene	gene with protein product	"""kintoun"""	612517	"""chromosome 14 open reading frame 104"""	C14orf104			Standard	NM_001083908		Approved	FLJ10563, KTU, PF13, CILD10	uc001wws.4	Q9NVR5	OTTHUMG00000152331	ENST00000298292.8:c.1185G>C	14.37:g.50100683C>G		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	7	7	NM_018139	0	0	0	0	0	B9WS54|C0JAP7|Q86TR1|Q86TY8|Q969Z5	Silent	SNP	ENST00000298292.8	37	CCDS9691.2																																																																																			C|0.569;G|0.431		0.781	DNAAF2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000276813.1		
PLEKHH1	57475	broad.mit.edu	37	14	68045912	68045912	+	Missense_Mutation	SNP	G	G	A	rs201225859		TCGA-OR-A5LF-01A-11D-A30A-10	TCGA-OR-A5LF-10A-01D-A30A-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2cf21c74-97c0-46f3-8e1a-197f9737b5b5	bcf5a948-3260-455b-b930-5cec0d656728	g.chr14:68045912G>A	ENST00000329153.5	+	21	3043	c.2911G>A	c.(2911-2913)Ggg>Agg	p.G971R	PLEKHH1_ENST00000417684.2_5'UTR	NM_020715.2	NP_065766.1	Q9ULM0	PKHH1_HUMAN	pleckstrin homology domain containing, family H (with MyTH4 domain) member 1	971	MyTH4. {ECO:0000255|PROSITE- ProRule:PRU00359}.					cytoskeleton (GO:0005856)				endometrium(2)|kidney(4)|lung(12)|urinary_tract(1)	19				all cancers(60;0.000771)|OV - Ovarian serous cystadenocarcinoma(108;0.00502)|BRCA - Breast invasive adenocarcinoma(234;0.011)		CCTGCGGACCGGGGAGCGGGA	0.602													G|||	1	0.000199681	0.0	0.0	5008	,	,		19033	0.0		0.001	False		,,,				2504	0.0				p.G971R		.											.	PLEKHH1-22	0			c.G2911A						.	G	ARG/GLY	1,4105		0,1,2052	52.0	59.0	56.0		2911	5.3	1.0	14		56	3,8377		0,3,4187	yes	missense	PLEKHH1	NM_020715.2	125	0,4,6239	AA,AG,GG		0.0358,0.0244,0.032	probably-damaging	971/1365	68045912	4,12482	2053	4190	6243	SO:0001583	missense	57475	exon21			CGGACCGGGGAGC	AB033026	CCDS45128.1	14q24.1	2013-01-10				ENSG00000054690		"""Pleckstrin homology (PH) domain containing"""	17733	protein-coding gene	gene with protein product						10574462	Standard	NM_020715		Approved	KIAA1200	uc001xjl.1	Q9ULM0		ENST00000329153.5:c.2911G>A	14.37:g.68045912G>A	ENSP00000330278:p.Gly971Arg	Somatic	101	0		WXS	Illumina GAIIx	Phase_I	82	4	NM_020715	0	0	0	0	0	A6H8X6|Q6PJL4|Q6ZWC7	Missense_Mutation	SNP	ENST00000329153.5	37	CCDS45128.1	1	4.578754578754579E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	G	28.0	4.885118	0.91814	2.44E-4	3.58E-4	ENSG00000054690	ENST00000329153	D	0.93076	-3.16	5.27	5.27	0.74061	MyTH4 domain (3);	0.000000	0.85682	D	0.000000	D	0.96676	0.8915	M	0.83603	2.65	0.80722	D	1	D	0.69078	0.997	D	0.65140	0.932	D	0.96502	0.9372	10	0.54805	T	0.06	.	19.0819	0.93186	0.0:0.0:1.0:0.0	.	971	Q9ULM0	PKHH1_HUMAN	R	971	ENSP00000330278:G971R	ENSP00000330278:G971R	G	+	1	0	PLEKHH1	67115665	1.000000	0.71417	0.967000	0.41034	0.753000	0.42808	6.250000	0.72435	2.731000	0.93534	0.655000	0.94253	GGG	G|0.999;A|0.000		0.602	PLEKHH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412730.3	XM_031054	
CKB	1152	hgsc.bcm.edu	37	14	103988180	103988180	+	Silent	SNP	G	G	T	rs1136165	byFrequency	TCGA-OR-A5LF-01A-11D-A30A-10	TCGA-OR-A5LF-10A-01D-A30A-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2cf21c74-97c0-46f3-8e1a-197f9737b5b5	bcf5a948-3260-455b-b930-5cec0d656728	g.chr14:103988180G>T	ENST00000348956.2	-	4	813	c.456C>A	c.(454-456)cgC>cgA	p.R152R		NM_001823.4	NP_001814.2	P12277	KCRB_HUMAN	creatine kinase, brain	152	Phosphagen kinase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00843}.				cellular chloride ion homeostasis (GO:0030644)|cellular nitrogen compound metabolic process (GO:0034641)|creatine metabolic process (GO:0006600)|small molecule metabolic process (GO:0044281)|substantia nigra development (GO:0021762)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|creatine kinase activity (GO:0004111)			lung(2)|prostate(1)	3		Melanoma(154;0.155)	Epithelial(46;0.14)		Creatine(DB00148)	TCTCGATGGCGCGGCGCTCCC	0.756													G|||	3294	0.657748	0.5416	0.7349	5008	,	,		7060	0.8264		0.6233	False		,,,				2504	0.6217				p.R152R	Esophageal Squamous(186;2492 2823 49929 50127)	.											.	CKB-115	0			c.C456A						.	G		1738,1164		574,590,287	3.0	4.0	3.0		456	-0.0	1.0	14	dbSNP_86	3	4002,2154		1387,1228,463	no	coding-synonymous	CKB	NM_001823.3		1961,1818,750	TT,TG,GG		34.9903,40.1103,36.6306		152/382	103988180	5740,3318	1451	3078	4529	SO:0001819	synonymous_variant	1152	exon4			GATGGCGCGGCGC		CCDS9981.1	14q32.32	2012-10-02			ENSG00000166165	ENSG00000166165	2.7.3.2		1991	protein-coding gene	gene with protein product		123280		CKBB			Standard	NM_001823		Approved		uc001ynf.2	P12277	OTTHUMG00000171786	ENST00000348956.2:c.456C>A	14.37:g.103988180G>T		Somatic	1	0		WXS	Illumina GAIIx	Phase_I	7	5	NM_001823	0	0	0	0	0	A8K236|B2R5R4|Q2LE07|Q6FG40|Q9UC66	Silent	SNP	ENST00000348956.2	37	CCDS9981.1	1462	0.6694139194139194	285	0.5792682926829268	250	0.6906077348066298	460	0.8041958041958042	467	0.6160949868073878	G	13.11	2.138272	0.37728	0.598897	0.650097	ENSG00000166165	ENST00000428256	.	.	.	4.64	-0.0349	0.13894	.	0.000000	0.85682	D	0.000000	T	0.00012	0.0000	.	.	.	0.09310	P	0.9999999999999624	.	.	.	.	.	.	T	0.17592	-1.0364	5	0.41790	T	0.15	-18.9304	4.9837	0.14180	0.3841:0.2745:0.3414:0.0	rs1136165;rs2227867;rs2765044;rs3179077;rs3199393;rs17366340;rs17423634;rs17849441;rs17850309;rs17850603;rs17851735;rs17851741;rs17857802	.	.	.	S	118	.	ENSP00000395515:R118S	R	-	1	0	CKB	103057933	0.001000	0.12720	0.999000	0.59377	0.996000	0.88848	-2.081000	0.01367	0.066000	0.16515	0.449000	0.29647	CGC	G|0.327;T|0.673		0.756	CKB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000415111.1		
TLE3	7090	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	15	70349954	70349954	+	Silent	SNP	C	C	T			TCGA-OR-A5LF-01A-11D-A30A-10	TCGA-OR-A5LF-10A-01D-A30A-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2cf21c74-97c0-46f3-8e1a-197f9737b5b5	bcf5a948-3260-455b-b930-5cec0d656728	g.chr15:70349954C>T	ENST00000558939.1	-	13	2481	c.1104G>A	c.(1102-1104)gcG>gcA	p.A368A	TLE3_ENST00000451782.2_Silent_p.A365A|TLE3_ENST00000560589.1_Silent_p.A312A|TLE3_ENST00000442299.2_Silent_p.A365A|TLE3_ENST00000559929.1_Silent_p.A378A|TLE3_ENST00000558201.1_Silent_p.A374A|TLE3_ENST00000559191.1_Intron|TLE3_ENST00000560939.1_Silent_p.A370A|TLE3_ENST00000557907.1_Silent_p.A365A|TLE3_ENST00000559048.1_Silent_p.A373A|TLE3_ENST00000557997.1_Silent_p.A365A|TLE3_ENST00000558379.1_Silent_p.A368A|TLE3_ENST00000539550.1_Silent_p.A300A|TLE3_ENST00000317509.8_Silent_p.A356A|TLE3_ENST00000440567.3_Silent_p.A358A	NM_001282979.1|NM_001282980.1|NM_001282981.1	NP_001269908.1|NP_001269909.1|NP_001269910.1	Q04726	TLE3_HUMAN	transducin-like enhancer of split 3	368	Pro/Ser-rich.				Notch signaling pathway (GO:0007219)|organ morphogenesis (GO:0009887)|regulation of transcription, DNA-templated (GO:0006355)|signal transduction (GO:0007165)|transcription, DNA-templated (GO:0006351)|Wnt signaling pathway (GO:0016055)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)				breast(1)|endometrium(4)|kidney(2)|large_intestine(4)|lung(16)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	31						CGAAGGGCGCCGCATAGGAGC	0.662																																					p.A368A		.											.	TLE3-522	0			c.G1104A						.						26.0	35.0	32.0					15																	70349954		2121	4238	6359	SO:0001819	synonymous_variant	7090	exon13			GGGCGCCGCATAG	M99438	CCDS45293.1, CCDS45294.1, CCDS58375.1, CCDS61689.1, CCDS61691.1, CCDS61692.1, CCDS73747.1	15q22	2014-03-07	2014-03-07			ENSG00000140332		"""WD repeat domain containing"""	11839	protein-coding gene	gene with protein product		600190	"""transducin-like enhancer of split 3, homolog of Drosophila E(sp1)"", ""transducin-like enhancer of split 3 (E(sp1) homolog, Drosophila)"""			8365415	Standard	XM_005254623		Approved	ESG, ESG3, KIAA1547, HsT18976, GRG3	uc002asm.2	Q04726		ENST00000558939.1:c.1104G>A	15.37:g.70349954C>T		Somatic	50	0		WXS	Illumina GAIIx	Phase_I	49	37	NM_005078	0	0	0	0	0	B4DPT0|E9PD64|F8W964|Q6PI57|Q8IVV6|Q8WVR2|Q9HCM5	Silent	SNP	ENST00000558939.1	37	CCDS45293.1																																																																																			.		0.662	TLE3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000416913.1	NM_005078	
MESDC1	59274	hgsc.bcm.edu	37	15	81295416	81295416	+	Silent	SNP	G	G	T			TCGA-OR-A5LF-01A-11D-A30A-10	TCGA-OR-A5LF-10A-01D-A30A-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2cf21c74-97c0-46f3-8e1a-197f9737b5b5	bcf5a948-3260-455b-b930-5cec0d656728	g.chr15:81295416G>T	ENST00000267984.2	+	1	2122	c.804G>T	c.(802-804)ccG>ccT	p.P268P		NM_022566.2	NP_072088.1	Q9H1K6	MESD1_HUMAN	mesoderm development candidate 1	268										endometrium(1)|lung(2)	3						CCACCGAGCCGCAGTTCCTGG	0.726																																					p.P268P		.											.	MESDC1-90	0			c.G804T						.						5.0	6.0	6.0					15																	81295416		2080	4024	6104	SO:0001819	synonymous_variant	59274	exon1			CGAGCCGCAGTTC	AY007810	CCDS10316.1	15q13	2008-07-18			ENSG00000140406	ENSG00000140406			13519	protein-coding gene	gene with protein product		615466				11247670	Standard	NM_022566		Approved	MGC99595	uc002bfz.3	Q9H1K6	OTTHUMG00000144185	ENST00000267984.2:c.804G>T	15.37:g.81295416G>T		Somatic	1	0		WXS	Illumina GAIIx	Phase_I	41	4	NM_022566	0	0	0	0	0		Silent	SNP	ENST00000267984.2	37	CCDS10316.1																																																																																			.		0.726	MESDC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000291390.1	NM_022566	
MESP2	145873	hgsc.bcm.edu	37	15	90320146	90320146	+	Silent	SNP	G	G	A	rs56192595|rs199821487|rs28546919		TCGA-OR-A5LF-01A-11D-A30A-10	TCGA-OR-A5LF-10A-01D-A30A-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2cf21c74-97c0-46f3-8e1a-197f9737b5b5	bcf5a948-3260-455b-b930-5cec0d656728	g.chr15:90320146G>A	ENST00000341735.3	+	1	558	c.558G>A	c.(556-558)caG>caA	p.Q186Q	MESP2_ENST00000560219.1_Intron|MESP2_ENST00000558723.1_Intron	NM_001039958.1	NP_001035047.1	Q0VG99	MESP2_HUMAN	mesoderm posterior basic helix-loop-helix transcription factor 2	186	13 X 2 AA tandem repeats of G-Q.				mesodermal cell migration (GO:0008078)|Notch signaling pathway (GO:0007219)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|signal transduction involved in regulation of gene expression (GO:0023019)|somite rostral/caudal axis specification (GO:0032525)|transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			kidney(1)|large_intestine(2)|lung(1)|skin(1)|upper_aerodigestive_tract(1)	6	Lung NSC(78;0.0221)|all_lung(78;0.0448)		BRCA - Breast invasive adenocarcinoma(143;0.0146)|KIRC - Kidney renal clear cell carcinoma(17;0.0286)|Kidney(142;0.0514)			ggcaggggcaggggcaggggc	0.781																																					p.Q186Q		.											.	MESP2-68	0			c.G558A						.						2.0	2.0	2.0					15																	90320146		1056	2363	3419	SO:0001819	synonymous_variant	145873	exon1			GGGGCAGGGGCAG		CCDS42078.1	15q26.1	2014-06-30	2014-06-30			ENSG00000188095		"""Basic helix-loop-helix proteins"""	29659	protein-coding gene	gene with protein product		605195	"""mesoderm posterior 2 homolog (mouse)"""			11578861	Standard	NM_001039958		Approved	SCDO2, bHLHc6	uc002bon.3	Q0VG99		ENST00000341735.3:c.558G>A	15.37:g.90320146G>A		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	5	4	NM_001039958	0	0	0	0	0	Q7RTU2	Silent	SNP	ENST00000341735.3	37	CCDS42078.1																																																																																			A|1.000;|0.000		0.781	MESP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000416421.1	XM_085261	
MESP2	145873	hgsc.bcm.edu	37	15	90320149	90320149	+	Silent	SNP	G	G	A			TCGA-OR-A5LF-01A-11D-A30A-10	TCGA-OR-A5LF-10A-01D-A30A-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2cf21c74-97c0-46f3-8e1a-197f9737b5b5	bcf5a948-3260-455b-b930-5cec0d656728	g.chr15:90320149G>A	ENST00000341735.3	+	1	561	c.561G>A	c.(559-561)ggG>ggA	p.G187G	MESP2_ENST00000560219.1_Intron|MESP2_ENST00000558723.1_Intron	NM_001039958.1	NP_001035047.1	Q0VG99	MESP2_HUMAN	mesoderm posterior basic helix-loop-helix transcription factor 2	187	13 X 2 AA tandem repeats of G-Q.				mesodermal cell migration (GO:0008078)|Notch signaling pathway (GO:0007219)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|signal transduction involved in regulation of gene expression (GO:0023019)|somite rostral/caudal axis specification (GO:0032525)|transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			kidney(1)|large_intestine(2)|lung(1)|skin(1)|upper_aerodigestive_tract(1)	6	Lung NSC(78;0.0221)|all_lung(78;0.0448)		BRCA - Breast invasive adenocarcinoma(143;0.0146)|KIRC - Kidney renal clear cell carcinoma(17;0.0286)|Kidney(142;0.0514)			aggggcaggggcaggggcaag	0.781																																					p.G187G		.											.	MESP2-68	0			c.G561A						.						2.0	3.0	3.0					15																	90320149		1334	3199	4533	SO:0001819	synonymous_variant	145873	exon1			GCAGGGGCAGGGG		CCDS42078.1	15q26.1	2014-06-30	2014-06-30			ENSG00000188095		"""Basic helix-loop-helix proteins"""	29659	protein-coding gene	gene with protein product		605195	"""mesoderm posterior 2 homolog (mouse)"""			11578861	Standard	NM_001039958		Approved	SCDO2, bHLHc6	uc002bon.3	Q0VG99		ENST00000341735.3:c.561G>A	15.37:g.90320149G>A		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	5	4	NM_001039958	0	0	0	0	0	Q7RTU2	Silent	SNP	ENST00000341735.3	37	CCDS42078.1																																																																																			.		0.781	MESP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000416421.1	XM_085261	
RCCD1	91433	hgsc.bcm.edu	37	15	91499986	91499986	+	Missense_Mutation	SNP	G	G	T	rs4932380	byFrequency	TCGA-OR-A5LF-01A-11D-A30A-10	TCGA-OR-A5LF-10A-01D-A30A-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2cf21c74-97c0-46f3-8e1a-197f9737b5b5	bcf5a948-3260-455b-b930-5cec0d656728	g.chr15:91499986G>T	ENST00000394258.2	+	2	224	c.22G>T	c.(22-24)Gcc>Tcc	p.A8S	RCCD1_ENST00000556618.1_Missense_Mutation_p.A8S|RCCD1_ENST00000555155.1_Missense_Mutation_p.A8S|RCCD1_ENST00000556774.1_Intron|AC068831.6_ENST00000553321.1_RNA	NM_001017919.1|NM_033544.2	NP_001017919.1|NP_291022.2	A6NED2	RCCD1_HUMAN	RCC1 domain containing 1	8			A -> S (in dbSNP:rs4932380).			cytoplasm (GO:0005737)|plasma membrane (GO:0005886)				breast(1)|kidney(1)|large_intestine(2)	4	Lung NSC(78;0.0987)|all_lung(78;0.175)		Lung(145;0.189)			GCGGCCGGGGGCCTGGTTCGG	0.761											OREG0023477	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	G|||	951	0.189896	0.0469	0.2954	5008	,	,		8275	0.3819		0.0835	False		,,,				2504	0.2198				p.A8S		.											.	RCCD1-90	0			c.G22T						.	G	SER/ALA,SER/ALA	202,3844		4,194,1825	5.0	9.0	7.0		22,22	-4.2	0.0	15	dbSNP_111	7	594,7378		19,556,3411	yes	missense,missense	RCCD1	NM_001017919.1,NM_033544.2	99,99	23,750,5236	TT,TG,GG		7.4511,4.9926,6.6234	benign,benign	8/377,8/377	91499986	796,11222	2023	3986	6009	SO:0001583	missense	91433	exon2			CCGGGGGCCTGGT		CCDS32333.1	15q26.1	2005-10-21	2005-10-21			ENSG00000166965			30457	protein-coding gene	gene with protein product						12477932	Standard	XM_006720763		Approved	MGC14386	uc002bqk.3	A6NED2		ENST00000394258.2:c.22G>T	15.37:g.91499986G>T	ENSP00000377801:p.Ala8Ser	Somatic	1	0	1283	WXS	Illumina GAIIx	Phase_I	44	8	NM_001017919	0	0	0	0	0	B2RTP9|Q29RX6	Missense_Mutation	SNP	ENST00000394258.2	37	CCDS32333.1	390	0.17857142857142858	22	0.044715447154471545	89	0.24585635359116023	223	0.38986013986013984	56	0.07387862796833773	G	3.046	-0.196425	0.06259	0.049926	0.074511	ENSG00000166965	ENST00000394258;ENST00000555155;ENST00000556618	T;T;T	0.79653	-1.29;-1.29;-1.29	3.71	-4.18	0.03846	Regulator of chromosome condensation/beta-lactamase-inhibitor protein II (2);	0.620743	0.15175	N	0.276447	T	0.00012	0.0000	L	0.27053	0.805	0.58432	P	5.000000000032756E-6	B;B	0.16802	0.019;0.011	B;B	0.14578	0.011;0.005	T	0.30208	-0.9986	9	0.16420	T	0.52	.	0.4602	0.00515	0.2924:0.2652:0.2603:0.1821	rs4932380	8;8	G3V2I3;A6NED2	.;RCCD1_HUMAN	S	8	ENSP00000377801:A8S;ENSP00000450678:A8S;ENSP00000451963:A8S	ENSP00000377801:A8S	A	+	1	0	RCCD1	89300990	0.000000	0.05858	0.021000	0.16686	0.107000	0.19398	-1.567000	0.02146	-0.916000	0.03818	-0.225000	0.12378	GCC	G|0.822;T|0.178		0.761	RCCD1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000414748.1	NM_033544	
FBXL16	146330	bcgsc.ca	37	16	746914	746914	+	Silent	SNP	G	G	A	rs4984915	byFrequency	TCGA-OR-A5LF-01A-11D-A30A-10	TCGA-OR-A5LF-10A-01D-A30A-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2cf21c74-97c0-46f3-8e1a-197f9737b5b5	bcf5a948-3260-455b-b930-5cec0d656728	g.chr16:746914G>A	ENST00000397621.1	-	2	823	c.492C>T	c.(490-492)gcC>gcT	p.A164A	FBXL16_ENST00000562563.1_5'Flank|FBXL16_ENST00000562585.1_5'Flank|FBXL16_ENST00000324361.5_Silent_p.A164A	NM_153350.3	NP_699181.2	Q8N461	FXL16_HUMAN	F-box and leucine-rich repeat protein 16	164										endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|lung(3)|ovary(1)	10		Hepatocellular(780;0.0218)				AGCCTCTGGCGGCAAAACCCT	0.587													G|||	1919	0.383187	0.208	0.3833	5008	,	,		8377	0.7123		0.2535	False		,,,				2504	0.4141				p.A164A		.											.	FBXL16-226	0			c.C492T						.	G		837,3563	328.0+/-300.3	86,665,1449	80.0	71.0	74.0		492	-8.3	0.0	16	dbSNP_111	74	1906,6692	337.4+/-322.3	205,1496,2598	no	coding-synonymous	FBXL16	NM_153350.3		291,2161,4047	AA,AG,GG		22.1679,19.0227,21.1032		164/480	746914	2743,10255	2200	4299	6499	SO:0001819	synonymous_variant	146330	exon2			TCTGGCGGCAAAA	BC036680	CCDS10421.1	16p13.3	2011-06-09	2004-06-15	2004-06-16	ENSG00000127585	ENSG00000127585		"""F-boxes / Leucine-rich repeats"""	14150	protein-coding gene	gene with protein product		609082	"""chromosome 16 open reading frame 22"""	C16orf22		11157797	Standard	NM_153350		Approved	MGC33974, Fbl16	uc021taa.1	Q8N461	OTTHUMG00000090420	ENST00000397621.1:c.492C>T	16.37:g.746914G>A		Somatic	168	0		WXS	Illumina GAIIx	Phase_I	201	7	NM_153350	0	0	0	0	0	B3KR59|D3DU60|Q2MHR2|Q96S14|Q9UJI0	Silent	SNP	ENST00000397621.1	37	CCDS10421.1																																																																																			G|0.718;A|0.282		0.587	FBXL16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206851.2	NM_153350	
C16orf90	646174	bcgsc.ca	37	16	3544745	3544745	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5LF-01A-11D-A30A-10	TCGA-OR-A5LF-10A-01D-A30A-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2cf21c74-97c0-46f3-8e1a-197f9737b5b5	bcf5a948-3260-455b-b930-5cec0d656728	g.chr16:3544745C>T	ENST00000437192.3	-	2	181	c.179G>A	c.(178-180)cGc>cAc	p.R60H	LA16c-306E5.3_ENST00000574423.2_RNA	NM_001080524.1	NP_001073993.1	A8MZG2	CP090_HUMAN	chromosome 16 open reading frame 90	50										large_intestine(1)	1						CCGGAGGTGGCGCAGCCGGAA	0.711																																					p.R60H		.											.	.	0			c.G179A						.																																			SO:0001583	missense	646174	exon2			AGGTGGCGCAGCC		CCDS45397.1	16p13.3	2009-01-29			ENSG00000215131	ENSG00000215131			34455	protein-coding gene	gene with protein product							Standard	NM_001080524		Approved	LOC646174	uc002cvi.3	A8MZG2	OTTHUMG00000154627	ENST00000437192.3:c.179G>A	16.37:g.3544745C>T	ENSP00000401335:p.Arg60His	Somatic	32	1		WXS	Illumina GAIIx	Phase_I	108	47	NM_001080524	0	0	0	0	0		Missense_Mutation	SNP	ENST00000437192.3	37	CCDS45397.1	.	.	.	.	.	.	.	.	.	.	C	15.34	2.804752	0.50315	.	.	ENSG00000215131	ENST00000437192	.	.	.	5.7	4.74	0.60224	.	0.000000	0.31323	U	0.007842	T	0.52125	0.1715	L	0.36672	1.1	0.24371	N	0.994834	D	0.76494	0.999	D	0.80764	0.994	T	0.45071	-0.9286	9	0.72032	D	0.01	-6.7932	11.0194	0.47709	0.0:0.9129:0.0:0.0871	.	60	A8MZG2-2	.	H	60	.	ENSP00000401335:R60H	R	-	2	0	C16orf90	3484746	1.000000	0.71417	1.000000	0.80357	0.729000	0.41735	1.537000	0.36083	1.403000	0.46800	0.591000	0.81541	CGC	.		0.711	C16orf90-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346319.2	NM_001080524	
GTF3C1	2975	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	16	27523174	27523190	+	Frame_Shift_Del	DEL	CGTTTAAATTCCTTCAG	CGTTTAAATTCCTTCAG	-			TCGA-OR-A5LF-01A-11D-A30A-10	TCGA-OR-A5LF-10A-01D-A30A-10	CGTTTAAATTCCTTCAG	CGTTTAAATTCCTTCAG	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2cf21c74-97c0-46f3-8e1a-197f9737b5b5	bcf5a948-3260-455b-b930-5cec0d656728	g.chr16:27523174_27523190delCGTTTAAATTCCTTCAG	ENST00000356183.4	-	7	1021_1037	c.1006_1022delCTGAAGGAATTTAAACG	c.(1006-1023)ctgaaggaatttaaacggfs	p.LKEFKR336fs	GTF3C1_ENST00000561623.1_Frame_Shift_Del_p.LKEFKR336fs	NM_001520.3	NP_001511.2	Q12789	TF3C1_HUMAN	general transcription factor IIIC, polypeptide 1, alpha 220kDa	336					5S class rRNA transcription from RNA polymerase III type 1 promoter (GO:0042791)|gene expression (GO:0010467)|rRNA transcription (GO:0009303)|transcription from RNA polymerase III promoter (GO:0006383)|transcription, DNA-templated (GO:0006351)|tRNA transcription (GO:0009304)|tRNA transcription from RNA polymerase III promoter (GO:0042797)	membrane (GO:0016020)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)|transcription factor TFIIIC complex (GO:0000127)	DNA binding (GO:0003677)			breast(2)|central_nervous_system(4)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(14)|liver(3)|lung(28)|ovary(2)|pancreas(1)|prostate(2)|skin(5)|upper_aerodigestive_tract(2)	80						ATGGTCATTCCGTTTAAATTCCTTCAGCAGCTTGAGG	0.548																																					p.336_341del		.											.	GTF3C1-94	0			c.1006_1022del						.																																			SO:0001589	frameshift_variant	2975	exon7			TCATTCCGTTTAA	U06485	CCDS32414.1, CCDS66988.1	16p12	2010-03-23	2002-08-29			ENSG00000077235		"""General transcription factors"""	4664	protein-coding gene	gene with protein product		603246	"""general transcription factor IIIC, polypeptide 1 (alpha subunit, 220kD )"""			8164661, 8127861	Standard	NM_001520		Approved	TFIIIC220	uc002dov.2	Q12789		ENST00000356183.4:c.1006_1022delCTGAAGGAATTTAAACG	16.37:g.27523174_27523190delCGTTTAAATTCCTTCAG	ENSP00000348510:p.Leu336fs	Somatic	156	0		WXS	Illumina GAIIx	Phase_I	211	18	NM_001520	0	0	0	0	0	B2RP21|Q12838|Q6DKN9|Q9Y4W9	Frame_Shift_Del	DEL	ENST00000356183.4	37	CCDS32414.1																																																																																			.		0.548	GTF3C1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000433856.1	NM_001520	
PYCARD	29108	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	16	31213958	31213958	+	Silent	SNP	C	C	T			TCGA-OR-A5LF-01A-11D-A30A-10	TCGA-OR-A5LF-10A-01D-A30A-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2cf21c74-97c0-46f3-8e1a-197f9737b5b5	bcf5a948-3260-455b-b930-5cec0d656728	g.chr16:31213958C>T	ENST00000247470.9	-	1	355	c.54G>A	c.(52-54)gaG>gaA	p.E18E	PYCARD_ENST00000350605.4_Silent_p.E18E|C16orf98_ENST00000561916.2_Missense_Mutation_p.L62F	NM_013258.4	NP_037390.2	Q9ULZ3	ASC_HUMAN	PYD and CARD domain containing	18	DAPIN. {ECO:0000255|PROSITE- ProRule:PRU00061}.				activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|activation of innate immune response (GO:0002218)|apoptotic process (GO:0006915)|cellular response to interleukin-1 (GO:0071347)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to tumor necrosis factor (GO:0071356)|defense response to Gram-negative bacterium (GO:0050829)|defense response to virus (GO:0051607)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|macropinocytosis (GO:0044351)|myeloid dendritic cell activation (GO:0001773)|myeloid dendritic cell activation involved in immune response (GO:0002277)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of interferon-beta production (GO:0032688)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of protein serine/threonine kinase activity (GO:0071901)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of activated T cell proliferation (GO:0042104)|positive regulation of adaptive immune response (GO:0002821)|positive regulation of antigen processing and presentation of peptide antigen via MHC class II (GO:0002588)|positive regulation of apoptotic process (GO:0043065)|positive regulation of chemokine secretion (GO:0090197)|positive regulation of cysteine-type endopeptidase activity (GO:2001056)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of extrinsic apoptotic signaling pathway (GO:2001238)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of interleukin-1 beta secretion (GO:0050718)|positive regulation of interleukin-10 secretion (GO:2001181)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of interleukin-6 secretion (GO:2000778)|positive regulation of interleukin-8 secretion (GO:2000484)|positive regulation of JNK cascade (GO:0046330)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of phagocytosis (GO:0050766)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of T cell activation (GO:0050870)|positive regulation of T cell migration (GO:2000406)|positive regulation of tumor necrosis factor production (GO:0032760)|regulation of intrinsic apoptotic signaling pathway (GO:2001242)|regulation of protein stability (GO:0031647)|regulation of tumor necrosis factor-mediated signaling pathway (GO:0010803)|signal transduction (GO:0007165)|tumor necrosis factor-mediated signaling pathway (GO:0033209)	AIM2 inflammasome complex (GO:0097169)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|IkappaB kinase complex (GO:0008385)|mitochondrion (GO:0005739)|NLRP1 inflammasome complex (GO:0072558)|NLRP3 inflammasome complex (GO:0072559)|nucleolus (GO:0005730)|nucleus (GO:0005634)	cysteine-type endopeptidase activator activity involved in apoptotic process (GO:0008656)|protein homodimerization activity (GO:0042803)|Pyrin domain binding (GO:0032090)			NS(1)|kidney(1)	2						TCTTGAGCTCCTCGGCGGTCA	0.721																																					p.E18E		.											.	PYCARD-651	0			c.G54A						.						41.0	40.0	40.0					16																	31213958		2195	4298	6493	SO:0001819	synonymous_variant	29108	exon1			GAGCTCCTCGGCG	AB023416	CCDS10708.1, CCDS10709.1	16p11.2	2013-01-22			ENSG00000103490	ENSG00000103490			16608	protein-coding gene	gene with protein product		606838					Standard	NM_013258		Approved	TMS-1, CARD5, ASC	uc010cak.3	Q9ULZ3	OTTHUMG00000176753	ENST00000247470.9:c.54G>A	16.37:g.31213958C>T		Somatic	38	0		WXS	Illumina GAIIx	Phase_I	166	35	NM_013258	0	0	0	0	0	Q96D12|Q9BSZ5|Q9HBD0|Q9NXJ8	Silent	SNP	ENST00000247470.9	37	CCDS10708.1																																																																																			.		0.721	PYCARD-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000255539.13	NM_013258	
IRX3	79191	hgsc.bcm.edu	37	16	54318528	54318528	+	Missense_Mutation	SNP	A	A	G	rs1450355	byFrequency	TCGA-OR-A5LF-01A-11D-A30A-10	TCGA-OR-A5LF-10A-01D-A30A-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2cf21c74-97c0-46f3-8e1a-197f9737b5b5	bcf5a948-3260-455b-b930-5cec0d656728	g.chr16:54318528A>G	ENST00000329734.3	-	2	1977	c.1265T>C	c.(1264-1266)cTg>cCg	p.L422P		NM_024336.2	NP_077312.2	P78415	IRX3_HUMAN	iroquois homeobox 3	422	Pro-rich.		L -> P (in dbSNP:rs1450355). {ECO:0000269|PubMed:15489334}.		mesoderm development (GO:0007498)|metanephros development (GO:0001656)|negative regulation of neuron differentiation (GO:0045665)|positive regulation of neuron differentiation (GO:0045666)|regulation of transcription, DNA-templated (GO:0006355)|specification of loop of Henle identity (GO:0072086)|transcription, DNA-templated (GO:0006351)	axon (GO:0030424)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)			endometrium(2)|kidney(1)|large_intestine(5)|lung(3)|ovary(1)|soft_tissue(1)|urinary_tract(1)	14						GAGCGGGTGCAGGCGGGGGCC	0.776													g|||	4851	0.96865	0.888	0.987	5008	,	,		8017	1.0		1.0	False		,,,				2504	1.0				p.L422P	GBM(143;1830 1866 4487 4646 37383)	.											.	IRX3-90	0			c.T1265C						.	T	PRO/LEU	1678,102		788,102,0	1.0	2.0	2.0		1265	2.5	1.0	16	dbSNP_88	2	4195,3		2096,3,0	no	missense	IRX3	NM_024336.2	98	2884,105,0	GG,GA,AA		0.0715,5.7303,1.7564	benign	422/502	54318528	5873,105	890	2099	2989	SO:0001583	missense	79191	exon2			GGGTGCAGGCGGG	U90308	CCDS10750.1	16q12.2	2011-06-20	2007-07-13		ENSG00000177508	ENSG00000177508		"""Homeoboxes / TALE class"""	14360	protein-coding gene	gene with protein product		612985					Standard	NM_024336		Approved	IRX-1	uc002eht.1	P78415	OTTHUMG00000133200	ENST00000329734.3:c.1265T>C	16.37:g.54318528A>G	ENSP00000331608:p.Leu422Pro	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	15	15	NM_024336	0	0	0	0	0	Q7Z4A4|Q7Z4A5|Q8IVC6	Missense_Mutation	SNP	ENST00000329734.3	37	CCDS10750.1	2108	0.9652014652014652	433	0.8800813008130082	354	0.9779005524861878	567	0.9912587412587412	754	0.9947229551451188	g	5.642	0.303067	0.10678	0.942697	0.999285	ENSG00000177508	ENST00000329734	T	0.54279	0.58	4.4	2.45	0.29901	.	0.652897	0.14990	N	0.286760	T	0.00012	0.0000	N	0.01352	-0.895	0.29914	P	0.82336	B	0.02656	0.0	B	0.01281	0.0	T	0.21861	-1.0233	9	0.33940	T	0.23	-4.0049	5.143	0.14969	0.1733:0.0:0.6627:0.164	rs1450355;rs17852160;rs60836119	422	P78415	IRX3_HUMAN	P	422	ENSP00000331608:L422P	ENSP00000331608:L422P	L	-	2	0	IRX3	52876029	1.000000	0.71417	0.984000	0.44739	0.000000	0.00434	1.455000	0.35190	0.155000	0.19261	-1.528000	0.00924	CTG	T|0.035;G|0.004		0.776	IRX3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256910.2		
ZFPM1	161882	hgsc.bcm.edu	37	16	88599696	88599697	+	Frame_Shift_Del	DEL	GA	GA	-	rs368520732|rs67712719	byFrequency	TCGA-OR-A5LF-01A-11D-A30A-10	TCGA-OR-A5LF-10A-01D-A30A-10	GA	GA	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2cf21c74-97c0-46f3-8e1a-197f9737b5b5	bcf5a948-3260-455b-b930-5cec0d656728	g.chr16:88599696_88599697delGA	ENST00000319555.3	+	10	1652_1653	c.1330_1331delGA	c.(1330-1332)gagfs	p.E444fs	RP11-21B21.4_ENST00000563243.1_RNA	NM_153813.2	NP_722520.2	Q8IX07	FOG1_HUMAN	zinc finger protein, FOG family member 1	444				EPLA -> AP (in Ref. 1; AAN45858). {ECO:0000305}.	atrial septum morphogenesis (GO:0060413)|atrioventricular valve morphogenesis (GO:0003181)|blood coagulation (GO:0007596)|cardiac muscle tissue morphogenesis (GO:0055008)|definitive erythrocyte differentiation (GO:0060318)|embryonic hemopoiesis (GO:0035162)|erythrocyte differentiation (GO:0030218)|granulocyte differentiation (GO:0030851)|megakaryocyte development (GO:0035855)|megakaryocyte differentiation (GO:0030219)|mitral valve formation (GO:0003192)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of interleukin-4 biosynthetic process (GO:0045403)|negative regulation of mast cell differentiation (GO:0060377)|negative regulation of protein binding (GO:0032091)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|outflow tract morphogenesis (GO:0003151)|platelet formation (GO:0030220)|positive regulation of interferon-gamma biosynthetic process (GO:0045078)|primitive erythrocyte differentiation (GO:0060319)|regulation of chemokine production (GO:0032642)|regulation of definitive erythrocyte differentiation (GO:0010724)|T-helper cell lineage commitment (GO:0002295)|transcriptional activation by promoter-enhancer looping (GO:0071733)|tricuspid valve formation (GO:0003195)|ventricular septum morphogenesis (GO:0060412)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|transcription factor complex (GO:0005667)|transcriptional repressor complex (GO:0017053)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II transcription factor binding (GO:0001085)|transcription factor binding (GO:0008134)			central_nervous_system(1)|ovary(2)|urinary_tract(1)	4				BRCA - Breast invasive adenocarcinoma(80;0.0478)		GGCCAGAGCGGAGCCTCTGGCC	0.743														4881	0.974641	0.9138	0.9914	5008	,	,		7261	0.996		1.0	False		,,,				2504	0.9969				p.444_444del	Pancreas(49;850 1106 29641 32847 38344)	.											.	ZFPM1-90	0			c.1330_1331del						.			2219,383		1063,93,145						-6.5	0.0		dbSNP_130	3	4709,133		2339,31,51	no	frameshift	ZFPM1	NM_153813.2		3402,124,196	A1A1,A1R,RR		2.7468,14.7194,6.9318				6928,516				SO:0001589	frameshift_variant	161882	exon10			AGAGCGGAGCCTC	AF488691	CCDS32502.1	16q24.2	2013-01-10	2012-11-27		ENSG00000179588	ENSG00000179588		"""Zinc fingers, C2H2-type"", ""Zinc fingers, C2HC-type containing"""	19762	protein-coding gene	gene with protein product		601950	"""zinc finger protein, multitype 1"""				Standard	NM_153813		Approved	FOG1, FOG, ZNF89A, ZC2HC11A	uc002fkv.3	Q8IX07	OTTHUMG00000173152	ENST00000319555.3:c.1330_1331delGA	16.37:g.88599696_88599697delGA	ENSP00000326630:p.Glu444fs	Somatic	1	0		WXS	Illumina GAIIx	Phase_I	29	17	NM_153813	0	0	0	0	0		Frame_Shift_Del	DEL	ENST00000319555.3	37	CCDS32502.1																																																																																			.		0.743	ZFPM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000422270.2		
ZFPM1	161882	hgsc.bcm.edu	37	16	88599697	88599705	+	In_Frame_Del	DEL	AGCCTCTGG	AGCCTCTGG	-	rs67873604|rs149145771|rs368520732|rs67322929|rs201915453|rs67712719	byFrequency	TCGA-OR-A5LF-01A-11D-A30A-10	TCGA-OR-A5LF-10A-01D-A30A-10	AGCCTCTGG	AGCCTCTGG	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2cf21c74-97c0-46f3-8e1a-197f9737b5b5	bcf5a948-3260-455b-b930-5cec0d656728	g.chr16:88599697_88599705delAGCCTCTGG	ENST00000319555.3	+	10	1653_1661	c.1331_1339delAGCCTCTGG	c.(1330-1341)gagcctctggcc>gcc	p.EPL444del	RP11-21B21.4_ENST00000563243.1_RNA	NM_153813.2	NP_722520.2	Q8IX07	FOG1_HUMAN	zinc finger protein, FOG family member 1	444				EPLA -> AP (in Ref. 1; AAN45858). {ECO:0000305}.	atrial septum morphogenesis (GO:0060413)|atrioventricular valve morphogenesis (GO:0003181)|blood coagulation (GO:0007596)|cardiac muscle tissue morphogenesis (GO:0055008)|definitive erythrocyte differentiation (GO:0060318)|embryonic hemopoiesis (GO:0035162)|erythrocyte differentiation (GO:0030218)|granulocyte differentiation (GO:0030851)|megakaryocyte development (GO:0035855)|megakaryocyte differentiation (GO:0030219)|mitral valve formation (GO:0003192)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of interleukin-4 biosynthetic process (GO:0045403)|negative regulation of mast cell differentiation (GO:0060377)|negative regulation of protein binding (GO:0032091)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|outflow tract morphogenesis (GO:0003151)|platelet formation (GO:0030220)|positive regulation of interferon-gamma biosynthetic process (GO:0045078)|primitive erythrocyte differentiation (GO:0060319)|regulation of chemokine production (GO:0032642)|regulation of definitive erythrocyte differentiation (GO:0010724)|T-helper cell lineage commitment (GO:0002295)|transcriptional activation by promoter-enhancer looping (GO:0071733)|tricuspid valve formation (GO:0003195)|ventricular septum morphogenesis (GO:0060412)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|transcription factor complex (GO:0005667)|transcriptional repressor complex (GO:0017053)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II transcription factor binding (GO:0001085)|transcription factor binding (GO:0008134)			central_nervous_system(1)|ovary(2)|urinary_tract(1)	4				BRCA - Breast invasive adenocarcinoma(80;0.0478)		GCCAGAGCGGAGCCTCTGGCCCAGAATGG	0.746																																					p.444_447del	Pancreas(49;850 1106 29641 32847 38344)	.											.	ZFPM1-90	0			c.1331_1339del						.																																			SO:0001651	inframe_deletion	161882	exon10			GAGCGGAGCCTCT	AF488691	CCDS32502.1	16q24.2	2013-01-10	2012-11-27		ENSG00000179588	ENSG00000179588		"""Zinc fingers, C2H2-type"", ""Zinc fingers, C2HC-type containing"""	19762	protein-coding gene	gene with protein product		601950	"""zinc finger protein, multitype 1"""				Standard	NM_153813		Approved	FOG1, FOG, ZNF89A, ZC2HC11A	uc002fkv.3	Q8IX07	OTTHUMG00000173152	ENST00000319555.3:c.1331_1339delAGCCTCTGG	16.37:g.88599697_88599705delAGCCTCTGG	ENSP00000326630:p.Glu444_Leu446del	Somatic	1	0		WXS	Illumina GAIIx	Phase_I	27	0	NM_153813	0	0	0	0	0		In_Frame_Del	DEL	ENST00000319555.3	37	CCDS32502.1																																																																																			.		0.746	ZFPM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000422270.2		
ZFPM1	161882	hgsc.bcm.edu	37	16	88599701	88599701	+	Frame_Shift_Del	DEL	T	T	-	rs67322929|rs149145771	byFrequency	TCGA-OR-A5LF-01A-11D-A30A-10	TCGA-OR-A5LF-10A-01D-A30A-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2cf21c74-97c0-46f3-8e1a-197f9737b5b5	bcf5a948-3260-455b-b930-5cec0d656728	g.chr16:88599701delT	ENST00000319555.3	+	10	1657	c.1335delT	c.(1333-1335)cctfs	p.P445fs	RP11-21B21.4_ENST00000563243.1_RNA	NM_153813.2	NP_722520.2	Q8IX07	FOG1_HUMAN	zinc finger protein, FOG family member 1	445				EPLA -> AP (in Ref. 1; AAN45858). {ECO:0000305}.	atrial septum morphogenesis (GO:0060413)|atrioventricular valve morphogenesis (GO:0003181)|blood coagulation (GO:0007596)|cardiac muscle tissue morphogenesis (GO:0055008)|definitive erythrocyte differentiation (GO:0060318)|embryonic hemopoiesis (GO:0035162)|erythrocyte differentiation (GO:0030218)|granulocyte differentiation (GO:0030851)|megakaryocyte development (GO:0035855)|megakaryocyte differentiation (GO:0030219)|mitral valve formation (GO:0003192)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of interleukin-4 biosynthetic process (GO:0045403)|negative regulation of mast cell differentiation (GO:0060377)|negative regulation of protein binding (GO:0032091)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|outflow tract morphogenesis (GO:0003151)|platelet formation (GO:0030220)|positive regulation of interferon-gamma biosynthetic process (GO:0045078)|primitive erythrocyte differentiation (GO:0060319)|regulation of chemokine production (GO:0032642)|regulation of definitive erythrocyte differentiation (GO:0010724)|T-helper cell lineage commitment (GO:0002295)|transcriptional activation by promoter-enhancer looping (GO:0071733)|tricuspid valve formation (GO:0003195)|ventricular septum morphogenesis (GO:0060412)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|transcription factor complex (GO:0005667)|transcriptional repressor complex (GO:0017053)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II transcription factor binding (GO:0001085)|transcription factor binding (GO:0008134)			central_nervous_system(1)|ovary(2)|urinary_tract(1)	4				BRCA - Breast invasive adenocarcinoma(80;0.0478)		GAGCGGAGCCTCTGGCCCAGA	0.746													-|T|-|insertion	4871	0.972644	0.9145	0.9899	5008	,	,		7405	0.995		0.994	False		,,,				2504	0.9939				p.P445fs	Pancreas(49;850 1106 29641 32847 38344)	.											.	ZFPM1-90	0			c.1335delT						.						1.0	1.0	1.0					16																	88599701		392	657	1049	SO:0001589	frameshift_variant	161882	exon10			GGAGCCTCTGGCC	AF488691	CCDS32502.1	16q24.2	2013-01-10	2012-11-27		ENSG00000179588	ENSG00000179588		"""Zinc fingers, C2H2-type"", ""Zinc fingers, C2HC-type containing"""	19762	protein-coding gene	gene with protein product		601950	"""zinc finger protein, multitype 1"""				Standard	NM_153813		Approved	FOG1, FOG, ZNF89A, ZC2HC11A	uc002fkv.3	Q8IX07	OTTHUMG00000173152	ENST00000319555.3:c.1335delT	16.37:g.88599701delT	ENSP00000326630:p.Pro445fs	Somatic	1	0		WXS	Illumina GAIIx	Phase_I	20	18	NM_153813	0	0	0	0	0		Frame_Shift_Del	DEL	ENST00000319555.3	37	CCDS32502.1																																																																																			.		0.746	ZFPM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000422270.2		
ZFPM1	161882	hgsc.bcm.edu	37	16	88599703	88599705	+	In_Frame_Del	DEL	TGG	TGG	-	rs149145771|rs67873604	byFrequency	TCGA-OR-A5LF-01A-11D-A30A-10	TCGA-OR-A5LF-10A-01D-A30A-10	TGG	TGG	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2cf21c74-97c0-46f3-8e1a-197f9737b5b5	bcf5a948-3260-455b-b930-5cec0d656728	g.chr16:88599703_88599705delTGG	ENST00000319555.3	+	10	1659_1661	c.1337_1339delTGG	c.(1336-1341)ctggcc>ccc	p.446_447LA>P	RP11-21B21.4_ENST00000563243.1_RNA	NM_153813.2	NP_722520.2	Q8IX07	FOG1_HUMAN	zinc finger protein, FOG family member 1	446				EPLA -> AP (in Ref. 1; AAN45858). {ECO:0000305}.	atrial septum morphogenesis (GO:0060413)|atrioventricular valve morphogenesis (GO:0003181)|blood coagulation (GO:0007596)|cardiac muscle tissue morphogenesis (GO:0055008)|definitive erythrocyte differentiation (GO:0060318)|embryonic hemopoiesis (GO:0035162)|erythrocyte differentiation (GO:0030218)|granulocyte differentiation (GO:0030851)|megakaryocyte development (GO:0035855)|megakaryocyte differentiation (GO:0030219)|mitral valve formation (GO:0003192)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of interleukin-4 biosynthetic process (GO:0045403)|negative regulation of mast cell differentiation (GO:0060377)|negative regulation of protein binding (GO:0032091)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|outflow tract morphogenesis (GO:0003151)|platelet formation (GO:0030220)|positive regulation of interferon-gamma biosynthetic process (GO:0045078)|primitive erythrocyte differentiation (GO:0060319)|regulation of chemokine production (GO:0032642)|regulation of definitive erythrocyte differentiation (GO:0010724)|T-helper cell lineage commitment (GO:0002295)|transcriptional activation by promoter-enhancer looping (GO:0071733)|tricuspid valve formation (GO:0003195)|ventricular septum morphogenesis (GO:0060412)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|transcription factor complex (GO:0005667)|transcriptional repressor complex (GO:0017053)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II transcription factor binding (GO:0001085)|transcription factor binding (GO:0008134)			central_nervous_system(1)|ovary(2)|urinary_tract(1)	4				BRCA - Breast invasive adenocarcinoma(80;0.0478)		GCGGAGCCTCTGGCCCAGAATGG	0.739														4871	0.972644	0.9145	0.9899	5008	,	,		7191	0.995		0.994	False		,,,				2504	0.9939				p.446_447del	Pancreas(49;850 1106 29641 32847 38344)	.											.	ZFPM1-90	0			c.1337_1339del						.																																			SO:0001651	inframe_deletion	161882	exon10			AGCCTCTGGCCCA	AF488691	CCDS32502.1	16q24.2	2013-01-10	2012-11-27		ENSG00000179588	ENSG00000179588		"""Zinc fingers, C2H2-type"", ""Zinc fingers, C2HC-type containing"""	19762	protein-coding gene	gene with protein product		601950	"""zinc finger protein, multitype 1"""				Standard	NM_153813		Approved	FOG1, FOG, ZNF89A, ZC2HC11A	uc002fkv.3	Q8IX07	OTTHUMG00000173152	ENST00000319555.3:c.1337_1339delTGG	16.37:g.88599703_88599705delTGG	ENSP00000326630:p.Leu446_Ala447delinsPro	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	20	20	NM_153813	0	0	0	0	0		In_Frame_Del	DEL	ENST00000319555.3	37	CCDS32502.1																																																																																			.		0.739	ZFPM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000422270.2		
NCOR1	9611	hgsc.bcm.edu	37	17	16097787	16097787	+	Missense_Mutation	SNP	G	G	T			TCGA-OR-A5LF-01A-11D-A30A-10	TCGA-OR-A5LF-10A-01D-A30A-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2cf21c74-97c0-46f3-8e1a-197f9737b5b5	bcf5a948-3260-455b-b930-5cec0d656728	g.chr17:16097787G>T	ENST00000268712.3	-	2	354	c.97C>A	c.(97-99)Cgc>Agc	p.R33S	NCOR1_ENST00000395851.1_Missense_Mutation_p.R33S|NCOR1_ENST00000395848.1_Missense_Mutation_p.R33S|RN7SL442P_ENST00000473804.2_RNA	NM_006311.3	NP_006302.2	O75376	NCOR1_HUMAN	nuclear receptor corepressor 1	33	Interaction with ZBTB33 and HEXIM1.			R -> H (in Ref. 2; AAO32942). {ECO:0000305}.	CD4-positive, CD25-positive, alpha-beta regulatory T cell differentiation (GO:0002361)|cellular lipid metabolic process (GO:0044255)|cholesterol homeostasis (GO:0042632)|chromatin modification (GO:0016568)|circadian regulation of gene expression (GO:0032922)|definitive erythrocyte differentiation (GO:0060318)|gene expression (GO:0010467)|negative regulation of JNK cascade (GO:0046329)|negative regulation of phosphatidylinositol 3-kinase signaling (GO:0014067)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|Notch signaling pathway (GO:0007219)|positive regulation of histone deacetylation (GO:0031065)|regulation of fatty acid transport (GO:2000191)|regulation of glycolytic process by negative regulation of transcription from RNA polymerase II promoter (GO:0072362)|regulation of lipid transport by negative regulation of transcription from RNA polymerase II promoter (GO:0072368)|regulation of multicellular organism growth (GO:0040014)|small molecule metabolic process (GO:0044281)|spindle assembly (GO:0051225)|thalamus development (GO:0021794)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle microtubule (GO:0005876)|transcription factor complex (GO:0005667)|transcriptional repressor complex (GO:0017053)	chromatin binding (GO:0003682)|histone deacetylase binding (GO:0042826)|histone deacetylase regulator activity (GO:0035033)|nuclear hormone receptor binding (GO:0035257)|RNA polymerase II activating transcription factor binding (GO:0001102)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)|transcription regulatory region DNA binding (GO:0044212)			NS(2)|breast(13)|central_nervous_system(2)|cervix(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(17)|lung(26)|ovary(1)|prostate(7)|skin(2)|upper_aerodigestive_tract(6)|urinary_tract(10)	107				UCEC - Uterine corpus endometrioid carcinoma (92;0.101)		TGCTGGTGGCGGGTGTTGGGA	0.418																																					p.R33S		.											.	NCOR1-229	0			c.C97A						.						142.0	97.0	112.0					17																	16097787		2203	4299	6502	SO:0001583	missense	9611	exon1			GGTGGCGGGTGTT	AF044209	CCDS11175.1, CCDS54094.1, CCDS54095.1	17p11.2	2014-06-12	2010-06-10		ENSG00000141027	ENSG00000141027			7672	protein-coding gene	gene with protein product	"""thyroid hormone- and retinoic acid receptor-associated corepressor 1"", ""protein phosphatase 1, regulatory subunit 109"""	600849	"""nuclear receptor co-repressor 1"""			7566114, 9724795	Standard	NM_006311		Approved	N-CoR, hCIT529I10, TRAC1, hN-CoR, KIAA1047, MGC104216, PPP1R109	uc002gpo.3	O75376	OTTHUMG00000059309	ENST00000268712.3:c.97C>A	17.37:g.16097787G>T	ENSP00000268712:p.Arg33Ser	Somatic	86	0		WXS	Illumina GAIIx	Phase_I	80	4	NM_001190438	0	0	0	0	0	B3DLF8|E9PGV6|Q86YY0|Q9UPV5|Q9UQ18	Missense_Mutation	SNP	ENST00000268712.3	37	CCDS11175.1	.	.	.	.	.	.	.	.	.	.	G	14.92	2.680175	0.47886	.	.	ENSG00000141027	ENST00000268712;ENST00000395851;ENST00000395849;ENST00000458113;ENST00000395848;ENST00000411510;ENST00000436828;ENST00000430577	T;T;T	0.55760	0.5;1.04;0.65	4.75	4.75	0.60458	.	0.000000	0.85682	D	0.000000	T	0.71970	0.3403	M	0.72118	2.19	0.80722	D	1	D;D;D;D;P;D;P	0.76494	0.994;0.998;0.999;0.998;0.68;0.997;0.673	D;D;D;D;B;D;B	0.83275	0.916;0.946;0.996;0.946;0.189;0.951;0.261	T	0.76391	-0.2976	10	0.87932	D	0	.	16.7361	0.85447	0.0:0.0:1.0:0.0	.	33;33;33;33;33;33;33	E7EU93;E7EV02;Q3B773;E7EW50;E9PGV6;O75376;O75376-2	.;.;.;.;.;NCOR1_HUMAN;.	S	33	ENSP00000268712:R33S;ENSP00000379192:R33S;ENSP00000379189:R33S	ENSP00000268712:R33S	R	-	1	0	NCOR1	16038512	1.000000	0.71417	0.997000	0.53966	0.990000	0.78478	6.533000	0.73829	2.171000	0.68590	0.460000	0.39030	CGC	.		0.418	NCOR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000131751.5	NM_006311	
NF1	4763	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	17	29661949	29661949	+	Frame_Shift_Del	DEL	A	A	-	rs143502927		TCGA-OR-A5LF-01A-11D-A30A-10	TCGA-OR-A5LF-10A-01D-A30A-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2cf21c74-97c0-46f3-8e1a-197f9737b5b5	bcf5a948-3260-455b-b930-5cec0d656728	g.chr17:29661949delA	ENST00000358273.4	+	40	6289	c.5906delA	c.(5905-5907)caafs	p.Q1969fs	NF1_ENST00000356175.3_Frame_Shift_Del_p.Q1948fs|NF1_ENST00000444181.2_5'Flank|NF1_ENST00000417592.2_5'Flank|NF1_ENST00000581113.2_3'UTR	NM_001042492.2	NP_001035957.1	P21359	NF1_HUMAN	neurofibromin 1	1969					actin cytoskeleton organization (GO:0030036)|adrenal gland development (GO:0030325)|artery morphogenesis (GO:0048844)|brain development (GO:0007420)|camera-type eye morphogenesis (GO:0048593)|cell communication (GO:0007154)|cerebral cortex development (GO:0021987)|cognition (GO:0050890)|collagen fibril organization (GO:0030199)|extracellular matrix organization (GO:0030198)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|forebrain astrocyte development (GO:0021897)|forebrain morphogenesis (GO:0048853)|heart development (GO:0007507)|liver development (GO:0001889)|MAPK cascade (GO:0000165)|metanephros development (GO:0001656)|myelination in peripheral nervous system (GO:0022011)|negative regulation of angiogenesis (GO:0016525)|negative regulation of astrocyte differentiation (GO:0048712)|negative regulation of cell migration (GO:0030336)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of endothelial cell proliferation (GO:0001937)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of neurotransmitter secretion (GO:0046929)|negative regulation of oligodendrocyte differentiation (GO:0048715)|negative regulation of osteoclast differentiation (GO:0045671)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of Rac protein signal transduction (GO:0035021)|negative regulation of Ras protein signal transduction (GO:0046580)|negative regulation of transcription factor import into nucleus (GO:0042992)|neural tube development (GO:0021915)|osteoblast differentiation (GO:0001649)|peripheral nervous system development (GO:0007422)|phosphatidylinositol 3-kinase signaling (GO:0014065)|pigmentation (GO:0043473)|positive regulation of adenylate cyclase activity (GO:0045762)|positive regulation of apoptotic process (GO:0043065)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001241)|positive regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902043)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of Ras GTPase activity (GO:0032320)|Ras protein signal transduction (GO:0007265)|regulation of angiogenesis (GO:0045765)|regulation of blood vessel endothelial cell migration (GO:0043535)|regulation of bone resorption (GO:0045124)|regulation of cell-matrix adhesion (GO:0001952)|regulation of glial cell differentiation (GO:0045685)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of Ras GTPase activity (GO:0032318)|regulation of synaptic transmission, GABAergic (GO:0032228)|response to hypoxia (GO:0001666)|Schwann cell development (GO:0014044)|skeletal muscle tissue development (GO:0007519)|smooth muscle tissue development (GO:0048745)|spinal cord development (GO:0021510)|sympathetic nervous system development (GO:0048485)|visual learning (GO:0008542)|wound healing (GO:0042060)	axon (GO:0030424)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|membrane (GO:0016020)|nucleus (GO:0005634)	phosphatidylcholine binding (GO:0031210)|phosphatidylethanolamine binding (GO:0008429)|Ras GTPase activator activity (GO:0005099)	p.0?(8)|p.?(3)	NF1/ACCN1(2)	autonomic_ganglia(12)|breast(11)|central_nervous_system(72)|cervix(6)|endometrium(12)|haematopoietic_and_lymphoid_tissue(59)|kidney(9)|large_intestine(39)|liver(1)|lung(80)|ovary(20)|pancreas(2)|prostate(2)|skin(8)|soft_tissue(249)|stomach(2)|thyroid(1)|upper_aerodigestive_tract(5)|urinary_tract(9)	599		all_cancers(10;1.29e-12)|all_epithelial(10;0.00347)|all_hematologic(16;0.00556)|Acute lymphoblastic leukemia(14;0.00593)|Breast(31;0.014)|Myeloproliferative disorder(56;0.0255)|all_lung(9;0.0321)|Lung NSC(157;0.0659)		UCEC - Uterine corpus endometrioid carcinoma (4;4.38e-05)|all cancers(4;1.64e-26)|Epithelial(4;9.15e-23)|OV - Ovarian serous cystadenocarcinoma(4;3.58e-21)|GBM - Glioblastoma multiforme(4;0.00146)		GCCAAACGACAAAGAGTTACT	0.383			"""D, Mis, N, F, S, O"""		"""neurofibroma, glioma"""	"""neurofibroma, glioma"""			Neurofibromatosis, type 1	TCGA GBM(6;<1E-08)|TSP Lung(7;0.0071)|TCGA Ovarian(3;0.0088)																											p.Q1969fs		.	yes	Rec	yes	Neurofibromatosis type 1	17	17q12	4763	neurofibromatosis type 1 gene		O	.	NF1-3353	11	Whole gene deletion(8)|Unknown(3)	soft_tissue(7)|autonomic_ganglia(2)|lung(1)|central_nervous_system(1)	c.5906delA						.						128.0	116.0	120.0					17																	29661949		2203	4300	6503	SO:0001589	frameshift_variant	4763	exon40	Familial Cancer Database	NF1, von Recklinghausen disease, incl.: Hereditary Spinal Neurofibromatosis, Neurofibromatosis-Noonan syndrome	AACGACAAAGAGT		CCDS11264.1, CCDS42292.1, CCDS45645.1	17q11.2	2014-09-17	2008-07-31		ENSG00000196712	ENSG00000196712			7765	protein-coding gene	gene with protein product	"""neurofibromatosis"", ""von Recklinghausen disease"", ""Watson disease"""	613113				1715669	Standard	NM_000267		Approved		uc002hgg.3	P21359	OTTHUMG00000132871	ENST00000358273.4:c.5906delA	17.37:g.29661949delA	ENSP00000351015:p.Gln1969fs	Somatic	82	0		WXS	Illumina GAIIx	Phase_I	98	62	NM_001042492	0	0	0	0	0	O00662|Q14284|Q14930|Q14931|Q9UMK3	Frame_Shift_Del	DEL	ENST00000358273.4	37	CCDS42292.1																																																																																			.		0.383	NF1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256351.2	NM_000267	
ASB16	92591	hgsc.bcm.edu	37	17	42254417	42254417	+	Missense_Mutation	SNP	A	A	G	rs7212854	byFrequency	TCGA-OR-A5LF-01A-11D-A30A-10	TCGA-OR-A5LF-10A-01D-A30A-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2cf21c74-97c0-46f3-8e1a-197f9737b5b5	bcf5a948-3260-455b-b930-5cec0d656728	g.chr17:42254417A>G	ENST00000293414.1	+	3	965	c.881A>G	c.(880-882)aAc>aGc	p.N294S	ASB16-AS1_ENST00000591166.1_RNA|ASB16-AS1_ENST00000592897.1_RNA|ASB16-AS1_ENST00000588785.1_RNA|ASB16-AS1_ENST00000585457.1_RNA	NM_080863.4	NP_543139.4	Q96NS5	ASB16_HUMAN	ankyrin repeat and SOCS box containing 16	294				N -> S (in Ref. 1; BAB70800/BAG37167, 3; AAH75088 and 4; AAL57353). {ECO:0000305}.	intracellular signal transduction (GO:0035556)|protein ubiquitination (GO:0016567)					central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(2)|liver(2)|lung(2)|prostate(1)	14		Breast(137;0.00765)|Prostate(33;0.0313)		BRCA - Breast invasive adenocarcinoma(366;0.114)		GCTTGTGCCAACGGCTGCGGG	0.751													A|||	2275	0.454273	0.5756	0.379	5008	,	,		8774	0.6925		0.2714	False		,,,				2504	0.2863				p.N294S		.											.	ASB16-227	0			c.A881G						.	A	SER/ASN,	429,1345		24,381,482	1.0	2.0	1.0		881,204	3.8	1.0	17	dbSNP_116	1	576,3936		27,522,1707	no	missense,coding-synonymous	ASB16,C17orf65	NM_080863.4,NM_178542.3	46,	51,903,2189	GG,GA,AA		12.766,24.1826,15.9879	probably-damaging,	294/454,68/194	42254417	1005,5281	887	2256	3143	SO:0001583	missense	92591	exon3			GTGCCAACGGCTG	AK054727	CCDS11478.1	17q21.31	2013-01-10	2011-01-25		ENSG00000161664	ENSG00000161664		"""Ankyrin repeat domain containing"""	19768	protein-coding gene	gene with protein product		615056	"""ankyrin repeat and SOCS box-containing 16"""			12076535	Standard	NM_080863		Approved	FLJ30165	uc002ifl.1	Q96NS5	OTTHUMG00000181809	ENST00000293414.1:c.881A>G	17.37:g.42254417A>G	ENSP00000293414:p.Asn294Ser	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	14	11	NM_080863	0	0	0	0	0	B2RBC0|Q8WXK0	Missense_Mutation	SNP	ENST00000293414.1	37	CCDS11478.1	1014	0.4642857142857143	292	0.5934959349593496	125	0.3453038674033149	385	0.6730769230769231	212	0.2796833773087071	A	18.19	3.568823	0.65765	0.241826	0.12766	ENSG00000161664	ENST00000293414	D	0.82984	-1.67	4.86	3.78	0.43462	Ankyrin repeat-containing domain (4);	0.044733	0.85682	D	0.000000	T	0.00012	0.0000	L	0.28458	0.855	0.23010	P	0.99843442	B	0.25441	0.126	B	0.27170	0.077	T	0.48514	-0.9029	9	0.39692	T	0.17	-14.5205	9.4601	0.38778	0.9148:0.0:0.0852:0.0	rs7212854	294	Q96NS5	ASB16_HUMAN	S	294	ENSP00000293414:N294S	ENSP00000293414:N294S	N	+	2	0	ASB16	39609943	0.987000	0.35691	0.978000	0.43139	0.956000	0.61745	3.125000	0.50469	0.883000	0.36040	0.454000	0.30748	AAC	A|0.590;G|0.410		0.751	ASB16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000457703.1		
EFCAB13	124989	bcgsc.ca	37	17	45452257	45452257	+	Nonsense_Mutation	SNP	A	A	T	rs74969489	byFrequency	TCGA-OR-A5LF-01A-11D-A30A-10	TCGA-OR-A5LF-10A-01D-A30A-10	A	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2cf21c74-97c0-46f3-8e1a-197f9737b5b5	bcf5a948-3260-455b-b930-5cec0d656728	g.chr17:45452257A>T	ENST00000331493.2	+	12	1708	c.1297A>T	c.(1297-1299)Aag>Tag	p.K433*	EFCAB13_ENST00000517484.1_Nonsense_Mutation_p.K337*	NM_152347.4	NP_689560.3	Q8IY85	EFC13_HUMAN	EF-hand calcium binding domain 13	433						cytoplasm (GO:0005737)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)										AAAACTTCAGAAGCCAGCTGT	0.378													A|||	24	0.00479233	0.0008	0.0029	5008	,	,		16296	0.0		0.0179	False		,,,				2504	0.0031				p.K433X		.											.	.	0			c.A1297T						.	A	stop/LYS,stop/LYS	10,4396	16.8+/-37.8	0,10,2193	55.0	56.0	56.0		1009,1297	2.5	0.1	17	dbSNP_131	56	146,8454	70.7+/-133.2	2,142,4156	yes	stop-gained,stop-gained	C17orf57	NM_001195192.1,NM_152347.4	,	2,152,6349	TT,TA,AA		1.6977,0.227,1.1994	,	337/785,433/974	45452257	156,12850	2203	4300	6503	SO:0001587	stop_gained	124989	exon12			CTTCAGAAGCCAG	BC036407	CCDS11512.1, CCDS56034.1	17q21.32	2013-01-11	2012-07-20	2012-07-20	ENSG00000178852	ENSG00000178852		"""EF-hand domain containing"""	26864	protein-coding gene	gene with protein product			"""chromosome 17 open reading frame 57"""	C17orf57			Standard	NM_152347		Approved	FLJ40342	uc002iln.3	Q8IY85	OTTHUMG00000164767	ENST00000331493.2:c.1297A>T	17.37:g.45452257A>T	ENSP00000332111:p.Lys433*	Somatic	129	0		WXS	Illumina GAIIx	Phase_I	106	5	NM_152347	0	0	0	0	0	G3V128|Q49AG9	Nonsense_Mutation	SNP	ENST00000331493.2	37	CCDS11512.1	14	0.00641025641025641	1	0.0020325203252032522	2	0.0055248618784530384	0	0.0	11	0.014511873350923483	A	28.4	4.915961	0.92178	0.00227	0.016977	ENSG00000178852	ENST00000331493;ENST00000517484;ENST00000344176	.	.	.	3.65	2.53	0.30540	.	0.465305	0.19308	N	0.117479	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-5.2883	7.0023	0.24817	0.7665:0.2335:0.0:0.0	.	.	.	.	X	433;337;385	.	.	K	+	1	0	C17orf57	42807256	0.887000	0.30362	0.084000	0.20598	0.004000	0.04260	0.696000	0.25541	0.724000	0.32296	0.477000	0.44152	AAG	A|0.989;T|0.011		0.378	EFCAB13-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000380147.4	NM_152347	
VEZF1	7716	bcgsc.ca	37	17	56056604	56056604	+	Silent	SNP	T	T	C	rs57786397|rs138088904|rs369163670	byFrequency	TCGA-OR-A5LF-01A-11D-A30A-10	TCGA-OR-A5LF-10A-01D-A30A-10	T	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2cf21c74-97c0-46f3-8e1a-197f9737b5b5	bcf5a948-3260-455b-b930-5cec0d656728	g.chr17:56056604T>C	ENST00000581208.1	-	5	1087	c.1047A>G	c.(1045-1047)caA>caG	p.Q349Q	VEZF1_ENST00000584396.1_Silent_p.Q340Q	NM_007146.2	NP_009077.2	Q14119	VEZF1_HUMAN	vascular endothelial zinc finger 1	349	Poly-Gln.				angiogenesis (GO:0001525)|cellular defense response (GO:0006968)|endothelial cell development (GO:0001885)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(1)|kidney(2)|lung(5)|ovary(1)	10						gttgttgttgttgctgctgct	0.468													-|||	285	0.0569089	0.0938	0.036	5008	,	,		16688	0.0099		0.0656	False		,,,				2504	0.0613				p.Q349Q		.											.	VEZF1-136	0			c.A1047G						.	-		1,4405		0,1,2202	161.0	149.0	153.0		1047		0.4	17	dbSNP_134	153	2,8598		0,2,4298	no	coding-synonymous	VEZF1	NM_007146.2		0,3,6500	CC,CT,TT		0.0233,0.0227,0.0231		349/522	56056604	3,13003	2203	4300	6503	SO:0001819	synonymous_variant	7716	exon5			TTGTTGTTGCTGC	D28118	CCDS32687.1	17q22	2012-10-05	2006-08-16	2006-08-16	ENSG00000136451	ENSG00000136451		"""Zinc fingers, C2H2-type"""	12949	protein-coding gene	gene with protein product		606747	"""zinc finger protein 161"""	ZNF161		8035792	Standard	XM_005257643		Approved	DB1	uc002ivf.1	Q14119	OTTHUMG00000178777	ENST00000581208.1:c.1047A>G	17.37:g.56056604T>C		Somatic	101	0		WXS	Illumina GAIIx	Phase_I	92	6	NM_007146	0	0	0	0	0		Silent	SNP	ENST00000581208.1	37	CCDS32687.1																																																																																			T|0.999;C|0.001		0.468	VEZF1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000443321.1		
CTDP1	9150	hgsc.bcm.edu	37	18	77440128	77440128	+	Missense_Mutation	SNP	T	T	G	rs17855830	byFrequency	TCGA-OR-A5LF-01A-11D-A30A-10	TCGA-OR-A5LF-10A-01D-A30A-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2cf21c74-97c0-46f3-8e1a-197f9737b5b5	bcf5a948-3260-455b-b930-5cec0d656728	g.chr18:77440128T>G	ENST00000299543.7	+	1	328	c.181T>G	c.(181-183)Tcc>Gcc	p.S61A	RP11-567M16.3_ENST00000317008.4_lincRNA|CTDP1_ENST00000075430.7_Missense_Mutation_p.S61A	NM_001202504.1|NM_004715.4	NP_001189433.1|NP_004706.3	Q9Y5B0	CTDP1_HUMAN	CTD (carboxy-terminal domain, RNA polymerase II, polypeptide A) phosphatase, subunit 1	61				S -> A (in Ref. 1; AAD42088 and 4; AAH63447). {ECO:0000305}.	exit from mitosis (GO:0010458)|gene expression (GO:0010467)|positive regulation of viral transcription (GO:0050434)|protein dephosphorylation (GO:0006470)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|viral process (GO:0016032)	actin cytoskeleton (GO:0015629)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|midbody (GO:0030496)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle (GO:0005819)|spindle midzone (GO:0051233)|spindle pole (GO:0000922)	CTD phosphatase activity (GO:0008420)|DNA-directed RNA polymerase activity (GO:0003899)			autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(14)|ovary(2)|prostate(2)|urinary_tract(1)	35		Esophageal squamous(42;0.0157)|Melanoma(33;0.144)		OV - Ovarian serous cystadenocarcinoma(15;5.2e-06)|BRCA - Breast invasive adenocarcinoma(31;0.0277)		CGCGCAGTCCTCCGGGGCCTC	0.791													G|||	3282	0.655351	0.7005	0.6729	5008	,	,		6558	0.5685		0.5934	False		,,,				2504	0.7352				p.S61A		.											.	CTDP1-90	0			c.T181G						.						1.0	1.0	1.0					18																	77440128		666	1677	2343	SO:0001583	missense	9150	exon1			CAGTCCTCCGGGG	AF081287	CCDS12017.1, CCDS12018.1, CCDS74239.1	18q23	2014-09-17			ENSG00000060069	ENSG00000060069		"""Serine/threonine phosphatases / CTD aspartate-based phosphatases"""	2498	protein-coding gene	gene with protein product		604927				9405607, 9765293	Standard	NM_004715		Approved	FCP1	uc002lnh.2	Q9Y5B0	OTTHUMG00000132920	ENST00000299543.7:c.181T>G	18.37:g.77440128T>G	ENSP00000299543:p.Ser61Ala	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	4	4	NM_004715	0	0	0	0	0	A8MY97|Q7Z644|Q96BZ1|Q9Y6F5	Missense_Mutation	SNP	ENST00000299543.7	37	CCDS12017.1	1309	0.5993589743589743	327	0.6646341463414634	247	0.6823204419889503	300	0.5244755244755245	435	0.5738786279683378	G	0.111	-1.138061	0.01742	.	.	ENSG00000060069	ENST00000299543;ENST00000075430	T;T	0.09445	2.99;2.98	3.86	-7.72	0.01250	.	0.854039	0.09930	N	0.737324	T	0.00012	0.0000	N	0.02539	-0.55	0.80722	P	0.0	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.41556	-0.9502	9	0.06099	T	0.92	-0.2807	1.1956	0.01874	0.1612:0.2663:0.203:0.3696	rs17855830	61;61	Q9Y5B0-4;Q9Y5B0	.;CTDP1_HUMAN	A	61	ENSP00000299543:S61A;ENSP00000075430:S61A	ENSP00000075430:S61A	S	+	1	0	CTDP1	75541116	0.000000	0.05858	0.003000	0.11579	0.029000	0.11900	-1.395000	0.02516	-1.871000	0.01138	-1.521000	0.00933	TCC	T|0.401;G|0.599		0.791	CTDP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256432.1	NM_004715	
KISS1R	84634	hgsc.bcm.edu	37	19	920642	920642	+	Missense_Mutation	SNP	T	T	A	rs350132	byFrequency	TCGA-OR-A5LF-01A-11D-A30A-10	TCGA-OR-A5LF-10A-01D-A30A-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2cf21c74-97c0-46f3-8e1a-197f9737b5b5	bcf5a948-3260-455b-b930-5cec0d656728	g.chr19:920642T>A	ENST00000234371.5	+	5	1244	c.1091T>A	c.(1090-1092)cTc>cAc	p.L364H	KISS1R_ENST00000606939.1_3'UTR	NM_032551.4	NP_115940.2	Q969F8	KISSR_HUMAN	KISS1 receptor	364			L -> H (in dbSNP:rs350132). {ECO:0000269|PubMed:11385580, ECO:0000269|PubMed:11414709, ECO:0000269|PubMed:11457843, ECO:0000269|PubMed:14573733, ECO:0000269|PubMed:15489334, ECO:0000269|PubMed:15598687, ECO:0000269|Ref.8}.		activation of MAPKK activity (GO:0000186)|arachidonic acid secretion (GO:0050482)|calcium-mediated signaling (GO:0019722)|G-protein coupled receptor signaling pathway (GO:0007186)|negative regulation of cell proliferation (GO:0008285)|neuropeptide signaling pathway (GO:0007218)|positive regulation of hormone secretion (GO:0046887)|positive regulation of stress fiber assembly (GO:0051496)|positive regulation of synaptic transmission (GO:0050806)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	neuropeptide binding (GO:0042923)|neuropeptide receptor activity (GO:0008188)			cervix(1)|kidney(1)|ovary(1)|pancreas(1)|skin(1)	5		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;1.04e-05)|all_lung(49;1.53e-05)|Breast(49;9.42e-05)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		GCGGAGCTGCTCCGCCTGGGG	0.816													a|||	3926	0.783946	0.916	0.6988	5008	,	,		7496	0.7589		0.7485	False		,,,				2504	0.728				p.L364H		.											.	KISS1R-91	0			c.T1091A						.						1.0	2.0	1.0					19																	920642		976	2331	3307	SO:0001583	missense	84634	exon5			AGCTGCTCCGCCT	AB051065	CCDS12049.1	19p13.3	2012-08-10	2006-02-15	2006-02-15	ENSG00000116014	ENSG00000116014		"""GPCR / Class A : RF amide peptide receptors"""	4510	protein-coding gene	gene with protein product		604161	"""G protein-coupled receptor 54"""	GPR54		10100623	Standard	NM_032551		Approved	HOT7T175, AXOR12	uc002lqk.4	Q969F8		ENST00000234371.5:c.1091T>A	19.37:g.920642T>A	ENSP00000234371:p.Leu364His	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	5	5	NM_032551	0	0	0	0	0	A5D8U2|B2RTV1|Q96QG0	Missense_Mutation	SNP	ENST00000234371.5	37	CCDS12049.1	1676	0.7673992673992674	432	0.8780487804878049	253	0.6988950276243094	435	0.7604895104895105	556	0.7335092348284961	N	2.523	-0.310400	0.05458	.	.	ENSG00000116014	ENST00000234371	T	0.71579	-0.58	4.36	-0.607	0.11615	.	0.579379	0.14719	N	0.302432	T	0.00012	0.0000	N	0.03608	-0.345	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.31998	-0.9923	9	0.13108	T	0.6	.	0.8843	0.01241	0.3667:0.1686:0.3009:0.1639	rs350132;rs3746148	364	Q969F8	KISSR_HUMAN	H	364	ENSP00000234371:L364H	ENSP00000234371:L364H	L	+	2	0	KISS1R	871642	0.000000	0.05858	0.075000	0.20258	0.190000	0.23558	-1.559000	0.02162	-0.349000	0.08274	-0.385000	0.06624	CTC	T|0.232;A|0.768		0.816	KISS1R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458217.3	NM_032551	
ARID3A	1820	hgsc.bcm.edu	37	19	929678	929678	+	Silent	SNP	G	G	A	rs3826948	byFrequency	TCGA-OR-A5LF-01A-11D-A30A-10	TCGA-OR-A5LF-10A-01D-A30A-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2cf21c74-97c0-46f3-8e1a-197f9737b5b5	bcf5a948-3260-455b-b930-5cec0d656728	g.chr19:929678G>A	ENST00000263620.3	+	2	477	c.150G>A	c.(148-150)gaG>gaA	p.E50E	AC005391.2_ENST00000585647.1_RNA	NM_005224.2	NP_005215.1	Q99856	ARI3A_HUMAN	AT rich interactive domain 3A (BRIGHT-like)	50						cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|membrane raft (GO:0045121)|nucleolus (GO:0005730)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(2)|ovary(1)	10		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;1.04e-05)|all_lung(49;1.53e-05)|Breast(49;9.42e-05)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		GAGAGCCCGAGAGTGCCCGGA	0.766													g|||	2308	0.460863	0.1112	0.487	5008	,	,		7932	0.6756		0.6223	False		,,,				2504	0.5276				p.E50E	Pancreas(29;54 1022 32760 50921)	.											.	ARID3A-90	0			c.G150A						.	G		470,2552		61,348,1102	3.0	4.0	3.0		150	1.1	0.4	19	dbSNP_107	3	3721,3153		1076,1569,792	no	coding-synonymous	ARID3A	NM_005224.2		1137,1917,1894	AA,AG,GG		45.8685,15.5526,42.3504		50/594	929678	4191,5705	1511	3437	4948	SO:0001819	synonymous_variant	1820	exon2			GCCCGAGAGTGCC	U88047	CCDS12050.1	19p13.3	2013-02-07	2006-11-08	2004-01-30		ENSG00000116017		"""-"""	3031	protein-coding gene	gene with protein product		603265	"""dead ringer-like 1 (Drosophila)"", ""AT rich interactive domain 3A (BRIGHT- like)"""	DRIL1		9722953	Standard	NM_005224		Approved	BRIGHT	uc002lql.3	Q99856		ENST00000263620.3:c.150G>A	19.37:g.929678G>A		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	6	5	NM_005224	0	0	0	0	0	Q5I858|Q6P9C6|Q8IZA7|Q8N4Z3	Silent	SNP	ENST00000263620.3	37	CCDS12050.1																																																																																			T|0.495;C|0.504		0.766	ARID3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458219.1	NM_005224	
ARID3A	1820	hgsc.bcm.edu	37	19	929753	929753	+	Silent	SNP	A	A	G	rs1799595	byFrequency	TCGA-OR-A5LF-01A-11D-A30A-10	TCGA-OR-A5LF-10A-01D-A30A-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2cf21c74-97c0-46f3-8e1a-197f9737b5b5	bcf5a948-3260-455b-b930-5cec0d656728	g.chr19:929753A>G	ENST00000263620.3	+	2	552	c.225A>G	c.(223-225)ccA>ccG	p.P75P	AC005391.2_ENST00000585647.1_RNA	NM_005224.2	NP_005215.1	Q99856	ARI3A_HUMAN	AT rich interactive domain 3A (BRIGHT-like)	75						cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|membrane raft (GO:0045121)|nucleolus (GO:0005730)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(2)|ovary(1)	10		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;1.04e-05)|all_lung(49;1.53e-05)|Breast(49;9.42e-05)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		TGGGACACCCAGCCAGCCCCG	0.751													t|||	4428	0.884185	0.9062	0.804	5008	,	,		8534	0.998		0.836	False		,,,				2504	0.8436				p.P75P	Pancreas(29;54 1022 32760 50921)	.											.	ARID3A-90	0			c.A225G						.	G		3389,305		1555,279,13	4.0	5.0	5.0		225	-6.8	0.0	19	dbSNP_89	5	6619,1123		2834,951,86	no	coding-synonymous	ARID3A	NM_005224.2		4389,1230,99	GG,GA,AA		14.5053,8.2566,12.4869		75/594	929753	10008,1428	1847	3871	5718	SO:0001819	synonymous_variant	1820	exon2			ACACCCAGCCAGC	U88047	CCDS12050.1	19p13.3	2013-02-07	2006-11-08	2004-01-30		ENSG00000116017		"""-"""	3031	protein-coding gene	gene with protein product		603265	"""dead ringer-like 1 (Drosophila)"", ""AT rich interactive domain 3A (BRIGHT- like)"""	DRIL1		9722953	Standard	NM_005224		Approved	BRIGHT	uc002lql.3	Q99856		ENST00000263620.3:c.225A>G	19.37:g.929753A>G		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	16	16	NM_005224	0	0	0	0	0	Q5I858|Q6P9C6|Q8IZA7|Q8N4Z3	Silent	SNP	ENST00000263620.3	37	CCDS12050.1																																																																																			A|0.114;G|0.886		0.751	ARID3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458219.1	NM_005224	
APC2	10297	hgsc.bcm.edu	37	19	1467684	1467684	+	Silent	SNP	A	A	C	rs265273	byFrequency	TCGA-OR-A5LF-01A-11D-A30A-10	TCGA-OR-A5LF-10A-01D-A30A-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2cf21c74-97c0-46f3-8e1a-197f9737b5b5	bcf5a948-3260-455b-b930-5cec0d656728	g.chr19:1467684A>C	ENST00000535453.1	+	14	6097	c.4384A>C	c.(4384-4386)Aga>Cga	p.R1462R	APC2_ENST00000238483.4_Silent_p.R1188R|C19orf25_ENST00000588427.1_Intron|APC2_ENST00000233607.2_Silent_p.R1462R			P02655	APOC2_HUMAN	adenomatosis polyposis coli 2	0					cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|chylomicron remnant clearance (GO:0034382)|chylomicron remodeling (GO:0034371)|high-density lipoprotein particle clearance (GO:0034384)|lipid catabolic process (GO:0016042)|lipoprotein metabolic process (GO:0042157)|negative regulation of catalytic activity (GO:0043086)|negative regulation of cholesterol transport (GO:0032375)|negative regulation of lipid metabolic process (GO:0045833)|negative regulation of receptor-mediated endocytosis (GO:0048261)|negative regulation of very-low-density lipoprotein particle clearance (GO:0010916)|phospholipid efflux (GO:0033700)|phototransduction, visible light (GO:0007603)|positive regulation of fatty acid biosynthetic process (GO:0045723)|positive regulation of lipoprotein lipase activity (GO:0051006)|positive regulation of phospholipase activity (GO:0010518)|positive regulation of phospholipid catabolic process (GO:0060697)|positive regulation of triglyceride catabolic process (GO:0010898)|positive regulation of very-low-density lipoprotein particle remodeling (GO:0010902)|retinoid metabolic process (GO:0001523)|reverse cholesterol transport (GO:0043691)|small molecule metabolic process (GO:0044281)|triglyceride homeostasis (GO:0070328)|triglyceride-rich lipoprotein particle remodeling (GO:0034370)|very-low-density lipoprotein particle remodeling (GO:0034372)	chylomicron (GO:0042627)|early endosome (GO:0005769)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|intermediate-density lipoprotein particle (GO:0034363)|low-density lipoprotein particle (GO:0034362)|spherical high-density lipoprotein particle (GO:0034366)|very-low-density lipoprotein particle (GO:0034361)	lipase inhibitor activity (GO:0055102)|lipid binding (GO:0008289)|lipoprotein lipase activator activity (GO:0060230)|phospholipase activator activity (GO:0016004)|phospholipase binding (GO:0043274)|protein homodimerization activity (GO:0042803)			breast(3)|cervix(1)|kidney(4)|large_intestine(2)|lung(5)|pancreas(1)|skin(2)	18		Acute lymphoblastic leukemia(61;3.02e-13)|all_hematologic(61;4.32e-09)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		GGGCAAGAACAGAGCAGGGCT	0.776													C|||	4887	0.975839	0.9977	0.9424	5008	,	,		10431	1.0		0.9374	False		,,,				2504	0.9847				p.R1462R		.											.	APC2-290	0			c.A4384C						.						1.0	1.0	1.0					19																	1467684		925	2103	3028	SO:0001819	synonymous_variant	10297	exon15			AAGAACAGAGCAG		CCDS12068.1	19p13.3	2013-02-14			ENSG00000115266	ENSG00000115266		"""Armadillo repeat containing"""	24036	protein-coding gene	gene with protein product	"""adenomatous polyposis coli like"""	612034				9823329, 10021369	Standard	XM_005259475		Approved	APCL	uc002lsr.1	O95996		ENST00000535453.1:c.4384A>C	19.37:g.1467684A>C		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	5	5	NM_005883	0	0	0	0	0	C0JYY4|Q9BS39|Q9UDE3|Q9UNK3	Silent	SNP	ENST00000535453.1	37	CCDS12068.1																																																																																			A|0.030;C|0.970		0.776	APC2-004	KNOWN	NAGNAG_splice_site|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000449539.2	NM_005883	
ANKRD24	170961	hgsc.bcm.edu	37	19	4217919	4217919	+	Missense_Mutation	SNP	G	G	A	rs142674065	byFrequency	TCGA-OR-A5LF-01A-11D-A30A-10	TCGA-OR-A5LF-10A-01D-A30A-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2cf21c74-97c0-46f3-8e1a-197f9737b5b5	bcf5a948-3260-455b-b930-5cec0d656728	g.chr19:4217919G>A	ENST00000600132.1	+	18	3038	c.2762G>A	c.(2761-2763)cGg>cAg	p.R921Q	ANKRD24_ENST00000262970.5_Missense_Mutation_p.R1011Q|ANKRD24_ENST00000318934.4_Missense_Mutation_p.R921Q	NM_133475.1	NP_597732.1	Q8TF21	ANR24_HUMAN	ankyrin repeat domain 24	921										endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(4)|lung(9)|prostate(1)|skin(1)	21				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0233)|STAD - Stomach adenocarcinoma(1328;0.181)		GAGCACCGCCGGCTGCAGGAG	0.781													G|||	79	0.0157748	0.0023	0.0159	5008	,	,		7657	0.0		0.0169	False		,,,				2504	0.0491				p.R921Q		.											.	ANKRD24-68	0			c.G2762A						.	G	GLN/ARG	19,2469		0,19,1225	2.0	3.0	3.0		2762	3.5	1.0	19	dbSNP_134	3	157,5597		2,153,2722	no	missense	ANKRD24	NM_133475.1	43	2,172,3947	AA,AG,GG		2.7285,0.7637,2.1354	benign	921/1147	4217919	176,8066	1244	2877	4121	SO:0001583	missense	170961	exon18			ACCGCCGGCTGCA	AB075861	CCDS45925.1	19p13.3	2013-01-10				ENSG00000089847		"""Ankyrin repeat domain containing"""	29424	protein-coding gene	gene with protein product						11853319	Standard	NM_133475		Approved	KIAA1981	uc010dtt.1	Q8TF21		ENST00000600132.1:c.2762G>A	19.37:g.4217919G>A	ENSP00000471252:p.Arg921Gln	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	10	10	NM_133475	0	0	0	0	0	O75268|O95781	Missense_Mutation	SNP	ENST00000600132.1	37	CCDS45925.1	44	0.020146520146520148	16	0.032520325203252036	7	0.019337016574585635	1	0.0017482517482517483	20	0.026385224274406333	g	5.888	0.348018	0.11126	0.007637	0.027285	ENSG00000089847	ENST00000318934;ENST00000262970	T;T	0.26518	1.73;1.73	3.53	3.53	0.40419	.	.	.	.	.	T	0.03136	0.0092	N	0.14661	0.345	0.19945	N	0.999948	B;P	0.37997	0.291;0.614	B;B	0.26693	0.033;0.072	T	0.08764	-1.0706	9	0.11485	T	0.65	.	7.641	0.28294	0.1274:0.0:0.8726:0.0	.	921;1011	Q8TF21;Q8TF21-2	ANR24_HUMAN;.	Q	921;1011	ENSP00000321731:R921Q;ENSP00000262970:R1011Q	ENSP00000262970:R1011Q	R	+	2	0	ANKRD24	4168919	0.710000	0.27896	1.000000	0.80357	0.745000	0.42441	0.963000	0.29293	1.928000	0.55862	0.456000	0.33151	CGG	G|0.980;A|0.020		0.781	ANKRD24-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000458188.1	XM_114000	
KANK3	256949	hgsc.bcm.edu	37	19	8399635	8399635	+	Missense_Mutation	SNP	C	C	T	rs890853	byFrequency	TCGA-OR-A5LF-01A-11D-A30A-10	TCGA-OR-A5LF-10A-01D-A30A-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2cf21c74-97c0-46f3-8e1a-197f9737b5b5	bcf5a948-3260-455b-b930-5cec0d656728	g.chr19:8399635C>T	ENST00000593649.1	-	3	1141	c.1076G>A	c.(1075-1077)cGc>cAc	p.R359H	KANK3_ENST00000330915.3_Missense_Mutation_p.R359H			Q6NY19	KANK3_HUMAN	KN motif and ankyrin repeat domains 3	359			R -> H (in dbSNP:rs890853).							breast(1)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(3)|skin(1)|urinary_tract(1)	9						CAGACTGGCGCGCAGCAGCTC	0.761													C|||	962	0.192093	0.093	0.3847	5008	,	,		10548	0.2113		0.2545	False		,,,				2504	0.1053				p.R359H		.											.	KANK3-90	0			c.G1076A						.						1.0	1.0	1.0					19																	8399635		1163	2476	3639	SO:0001583	missense	256949	exon3			CTGGCGCGCAGCA	AK128815	CCDS12199.1	19p13.2	2013-01-10	2008-01-29	2008-01-29		ENSG00000186994		"""KN motif and ankyrin repeat domain containing"", ""Ankyrin repeat domain containing"""	24796	protein-coding gene	gene with protein product		614611	"""ankyrin repeat domain 47"""	ANKRD47		17996375, 19554261	Standard	NM_198471		Approved	FLJ46061	uc010dwa.3	Q6NY19		ENST00000593649.1:c.1076G>A	19.37:g.8399635C>T	ENSP00000470728:p.Arg359His	Somatic	1	0		WXS	Illumina GAIIx	Phase_I	12	10	NM_198471	0	0	0	0	0	Q6NZI1|Q6ZQR3|Q8IUV2	Missense_Mutation	SNP	ENST00000593649.1	37		505	0.23122710622710624	63	0.12804878048780488	131	0.36187845303867405	117	0.20454545454545456	194	0.2559366754617414	C	13.09	2.134512	0.37630	.	.	ENSG00000186994	ENST00000330915	T	0.54071	0.59	4.52	0.959	0.19624	.	.	.	.	.	T	0.00012	0.0000	L	0.29908	0.895	0.53688	P	2.8999999999945736E-5	B	0.16396	0.017	B	0.09377	0.004	T	0.33394	-0.9870	8	0.54805	T	0.06	-23.4019	6.9118	0.24338	0.0:0.5682:0.0:0.4318	rs890853	359	Q6NY19-2	.	H	359	ENSP00000328923:R359H	ENSP00000328923:R359H	R	-	2	0	KANK3	8305635	0.014000	0.17966	0.688000	0.30117	0.060000	0.15804	0.173000	0.16724	0.468000	0.27243	0.297000	0.19635	CGC	C|0.769;T|0.231		0.761	KANK3-002	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000461379.1	NM_198471	
FBXO17	115290	hgsc.bcm.edu	37	19	39440918	39440918	+	Silent	SNP	T	T	C	rs2304117	byFrequency	TCGA-OR-A5LF-01A-11D-A30A-10	TCGA-OR-A5LF-10A-01D-A30A-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2cf21c74-97c0-46f3-8e1a-197f9737b5b5	bcf5a948-3260-455b-b930-5cec0d656728	g.chr19:39440918T>C	ENST00000292852.4	-	2	383	c.42A>G	c.(40-42)ccA>ccG	p.P14P	CTC-360G5.8_ENST00000599996.1_5'Flank|FBXO17_ENST00000595329.1_Silent_p.P14P|SARS2_ENST00000448145.2_5'Flank	NM_024907.5	NP_079183.4	Q96EF6	FBX17_HUMAN	F-box protein 17	14						SCF ubiquitin ligase complex (GO:0019005)	glycoprotein binding (GO:0001948)			breast(1)|endometrium(1)|large_intestine(1)|lung(3)|prostate(1)	7	all_cancers(60;8.37e-07)|all_lung(34;3.71e-07)|Lung NSC(34;4.17e-07)|all_epithelial(25;1.13e-06)|Ovarian(47;0.0454)		Lung(45;0.000419)|LUSC - Lung squamous cell carcinoma(53;0.000554)			GGGCCAGGGATGGGTCCGCCG	0.731													c|||	2378	0.47484	0.3336	0.3746	5008	,	,		11867	0.6796		0.4195	False		,,,				2504	0.5828				p.P23P		.											.	FBXO17-226	0			c.A69G						.		,	1052,2556		213,626,965	3.0	4.0	3.0		42,69	0.5	0.0	19	dbSNP_100	3	2265,4819		496,1273,1773	no	coding-synonymous,coding-synonymous	FBXO17	NM_024907.5,NM_148169.1	,	709,1899,2738	CC,CT,TT		31.9735,29.1574,31.0232	,	14/279,23/288	39440918	3317,7375	1804	3542	5346	SO:0001819	synonymous_variant	115290	exon2			CAGGGATGGGTCC	AF386743	CCDS12526.1	19q13.2	2010-07-02	2004-06-15	2004-06-16		ENSG00000269190		"""F-boxes /  ""other"""""	18754	protein-coding gene	gene with protein product	"""F-box only protein 26"""	609094	"""F-box only protein 17"""	FBXO26			Standard	NM_148169		Approved	FBG4, FLJ25205, MGC9379, FLJ11798, Fbx17		Q96EF6		ENST00000292852.4:c.42A>G	19.37:g.39440918T>C		Somatic	1	0		WXS	Illumina GAIIx	Phase_I	38	32	NM_148169	0	0	0	0	0	Q96LQ4	Silent	SNP	ENST00000292852.4	37	CCDS12526.1																																																																																			T|0.545;C|0.455		0.731	FBXO17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463273.1	NM_024907	
LIPE	3991	hgsc.bcm.edu	37	19	42906024	42906024	+	Silent	SNP	G	G	A	rs36104839	byFrequency	TCGA-OR-A5LF-01A-11D-A30A-10	TCGA-OR-A5LF-10A-01D-A30A-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2cf21c74-97c0-46f3-8e1a-197f9737b5b5	bcf5a948-3260-455b-b930-5cec0d656728	g.chr19:42906024G>A	ENST00000244289.4	-	10	3447	c.3171C>T	c.(3169-3171)gcC>gcT	p.A1057A	LIPE-AS1_ENST00000599276.1_RNA|LIPE-AS1_ENST00000593491.2_RNA|LIPE-AS1_ENST00000594624.2_RNA|LIPE-AS1_ENST00000597203.1_RNA	NM_005357.2	NP_005348.2	Q05469	LIPS_HUMAN	lipase, hormone-sensitive	1057					cholesterol metabolic process (GO:0008203)|diacylglycerol catabolic process (GO:0046340)|lipid catabolic process (GO:0016042)|long-chain fatty acid catabolic process (GO:0042758)|protein phosphorylation (GO:0006468)|small molecule metabolic process (GO:0044281)|triglyceride catabolic process (GO:0019433)	cytosol (GO:0005829)|lipid particle (GO:0005811)|plasma membrane (GO:0005886)	hormone-sensitive lipase activity (GO:0033878)|triglyceride lipase activity (GO:0004806)			breast(2)|endometrium(4)|kidney(7)|large_intestine(6)|lung(8)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	32		Prostate(69;0.00682)				CGCTCGGCCCGGCTCCGGCGG	0.716													G|||	44	0.00878594	0.0023	0.0144	5008	,	,		6804	0.0		0.0258	False		,,,				2504	0.0051				p.A1057A		.											.	LIPE-154	0			c.C3171T						.	G		14,2650		0,14,1318	2.0	3.0	3.0		3171	1.9	0.0	19	dbSNP_126	3	166,5594		0,166,2714	no	coding-synonymous	LIPE	NM_005357.2		0,180,4032	AA,AG,GG		2.8819,0.5255,2.1368		1057/1077	42906024	180,8244	1332	2880	4212	SO:0001819	synonymous_variant	3991	exon10			CGGCCCGGCTCCG	L11706	CCDS12607.1	19q13.1-q13.2	2014-03-14			ENSG00000079435	ENSG00000079435	3.1.1.3		6621	protein-coding gene	gene with protein product		151750				8506334	Standard	NM_005357		Approved	HSL	uc002otr.3	Q05469	OTTHUMG00000182814	ENST00000244289.4:c.3171C>T	19.37:g.42906024G>A		Somatic	1	0		WXS	Illumina GAIIx	Phase_I	6	6	NM_005357	0	0	0	0	0	Q3LRT2|Q6NSL7	Silent	SNP	ENST00000244289.4	37	CCDS12607.1																																																																																			G|0.984;A|0.016		0.716	LIPE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463861.1	NM_005357	
INAFM1	255783	hgsc.bcm.edu	37	19	47778412	47778412	+	Missense_Mutation	SNP	G	G	T	rs1055218	byFrequency	TCGA-OR-A5LF-01A-11D-A30A-10	TCGA-OR-A5LF-10A-01D-A30A-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2cf21c74-97c0-46f3-8e1a-197f9737b5b5	bcf5a948-3260-455b-b930-5cec0d656728	g.chr19:47778412G>T	ENST00000552360.2	+	1	271	c.236G>T	c.(235-237)cGc>cTc	p.R79L		NM_178511.5	NP_848606.3														skin(1)	1						TGTGCTGCCCGCCCGGGCGTG	0.776													G|||	1999	0.399161	0.3162	0.3876	5008	,	,		5503	0.5942		0.331	False		,,,				2504	0.3885				p.R79L		.											.	.	0			c.G236T						.						6.0	6.0	6.0					19																	47778412		676	1545	2221	SO:0001583	missense	255783	exon1			CTGCCCGCCCGGG																												ENST00000552360.2:c.236G>T	19.37:g.47778412G>T	ENSP00000447679:p.Arg79Leu	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	5	5	NM_178511	0	0	0	0	0		Missense_Mutation	SNP	ENST00000552360.2	37	CCDS46131.1	909	0.41620879120879123	179	0.3638211382113821	137	0.3784530386740331	319	0.5576923076923077	274	0.36147757255936674	G	5.764	0.325396	0.10900	.	.	ENSG00000257704;ENSG00000232427	ENST00000552360;ENST00000422073	.	.	.	2.47	-0.147	0.13428	.	.	.	.	.	T	0.00012	0.0000	N	0.22421	0.69	0.80722	P	0.0	P	0.35307	0.494	B	0.20184	0.028	T	0.45862	-0.9232	7	0.35671	T	0.21	.	3.1104	0.06356	0.1831:0.2892:0.5277:0.0	rs1055218;rs3195715;rs17418921;rs57061764	79	C9JVW0	PRR24_HUMAN	L	132;79	.	ENSP00000447679:R132L	R	+	2	0	PRR24;AC008532.1	52470252	0.002000	0.14202	0.007000	0.13788	0.039000	0.13416	-0.171000	0.09883	0.370000	0.24538	0.456000	0.33151	CGC	G|0.585;T|0.415		0.776	PRR24-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407505.2		
TULP2	7288	bcgsc.ca	37	19	49400634	49400634	+	Missense_Mutation	SNP	C	C	T	rs7260579	byFrequency	TCGA-OR-A5LF-01A-11D-A30A-10	TCGA-OR-A5LF-10A-01D-A30A-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2cf21c74-97c0-46f3-8e1a-197f9737b5b5	bcf5a948-3260-455b-b930-5cec0d656728	g.chr19:49400634C>T	ENST00000221399.3	-	3	196	c.52G>A	c.(52-54)Gct>Act	p.A18T	NUCB1_ENST00000407032.1_5'Flank|NUCB1_ENST00000405315.4_5'Flank	NM_003323.2	NP_003314.2	O00295	TULP2_HUMAN	tubby like protein 2	18			A -> T (in dbSNP:rs7260579).		visual perception (GO:0007601)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)	protein complex binding (GO:0032403)			NS(1)|breast(2)|central_nervous_system(2)|kidney(1)|large_intestine(6)|lung(7)|ovary(1)|skin(2)	22		all_epithelial(76;5.29e-07)|all_lung(116;1.7e-06)|Lung NSC(112;3.55e-06)|all_neural(266;0.0189)|Ovarian(192;0.0261)		OV - Ovarian serous cystadenocarcinoma(262;0.000259)|all cancers(93;0.000435)|Epithelial(262;0.0221)|GBM - Glioblastoma multiforme(486;0.0234)		CTCATAGCAGCGAGCTCATGC	0.607													C|||	1024	0.204473	0.3676	0.1974	5008	,	,		18145	0.0704		0.1292	False		,,,				2504	0.2045				p.A18T		.											.	TULP2-93	0			c.G52A						.	C	THR/ALA	1386,3020	453.6+/-350.4	211,964,1028	141.0	99.0	113.0		52	-0.4	0.0	19	dbSNP_116	113	1029,7571	218.1+/-256.6	62,905,3333	yes	missense	TULP2	NM_003323.2	58	273,1869,4361	TT,TC,CC		11.9651,31.4571,18.5684	benign	18/521	49400634	2415,10591	2203	4300	6503	SO:0001583	missense	7288	exon3			TAGCAGCGAGCTC	U82469	CCDS12739.1	19q13.1	2009-08-06			ENSG00000104804	ENSG00000104804			12424	protein-coding gene	gene with protein product	"""cancer/testis antigen 65"""	602309				9096357	Standard	NM_003323		Approved	TUBL2, CT65	uc002pkz.2	O00295	OTTHUMG00000164406	ENST00000221399.3:c.52G>A	19.37:g.49400634C>T	ENSP00000221399:p.Ala18Thr	Somatic	167	0		WXS	Illumina GAIIx	Phase_I	180	6	NM_003323	0	0	0	0	0	Q8TC50	Missense_Mutation	SNP	ENST00000221399.3	37	CCDS12739.1	402	0.18406593406593408	184	0.37398373983739835	72	0.19889502762430938	41	0.07167832167832168	105	0.13852242744063326	C	7.542	0.660812	0.14645	0.314571	0.119651	ENSG00000104804	ENST00000221399;ENST00000518572;ENST00000522945	D;T;T	0.83335	-1.71;2.21;1.31	4.35	-0.411	0.12370	.	0.455494	0.19372	N	0.115897	T	0.00012	0.0000	N	0.22421	0.69	0.80722	P	0.0	B	0.21905	0.062	B	0.14578	0.011	T	0.09818	-1.0657	9	0.08381	T	0.77	-3.4787	3.3478	0.07141	0.1879:0.5029:0.0:0.3092	rs7260579;rs17847561;rs60155229;rs7260579	18	O00295	TULP2_HUMAN	T	18	ENSP00000221399:A18T;ENSP00000428420:A18T;ENSP00000430040:A18T	ENSP00000221399:A18T	A	-	1	0	TULP2	54092446	0.000000	0.05858	0.000000	0.03702	0.171000	0.22731	-0.133000	0.10451	-0.050000	0.13356	0.498000	0.49722	GCT	C|0.803;T|0.197		0.607	TULP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378633.1	NM_003323	
MYH14	79784	hgsc.bcm.edu	37	19	50713713	50713713	+	Missense_Mutation	SNP	C	C	A	rs590722	byFrequency	TCGA-OR-A5LF-01A-11D-A30A-10	TCGA-OR-A5LF-10A-01D-A30A-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2cf21c74-97c0-46f3-8e1a-197f9737b5b5	bcf5a948-3260-455b-b930-5cec0d656728	g.chr19:50713713C>A	ENST00000596571.1	+	1	91	c.91C>A	c.(91-93)Ccc>Acc	p.P31T	MYH14_ENST00000376970.2_Missense_Mutation_p.P31T|MYH14_ENST00000425460.1_Missense_Mutation_p.P31T|MYH14_ENST00000440075.2_Missense_Mutation_p.P31T|MYH14_ENST00000601313.1_Missense_Mutation_p.P31T|MYH14_ENST00000262269.8_Missense_Mutation_p.P31T|MYH14_ENST00000598205.1_Missense_Mutation_p.P31T			Q7Z406	MYH14_HUMAN	myosin, heavy chain 14, non-muscle	31					actin filament-based movement (GO:0030048)|actomyosin structure organization (GO:0031032)|ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|mitochondrion morphogenesis (GO:0070584)|neuronal action potential (GO:0019228)|regulation of cell shape (GO:0008360)|sensory perception of sound (GO:0007605)|skeletal muscle atrophy (GO:0014732)|skeletal muscle contraction (GO:0003009)|skeletal muscle tissue development (GO:0007519)|vocalization behavior (GO:0071625)	actomyosin (GO:0042641)|axon (GO:0030424)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|growth cone (GO:0030426)|membrane (GO:0016020)|myosin II complex (GO:0016460)|myosin II filament (GO:0097513)|stress fiber (GO:0001725)	actin-dependent ATPase activity (GO:0030898)|ATP binding (GO:0005524)|microfilament motor activity (GO:0000146)			central_nervous_system(1)|cervix(2)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(10)|ovary(1)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	46		all_neural(266;0.0571)|Ovarian(192;0.0728)		OV - Ovarian serous cystadenocarcinoma(262;0.00389)|GBM - Glioblastoma multiforme(134;0.0195)		CCTGTTCACGCCCCGCGGGCC	0.766													C|||	941	0.187899	0.1581	0.1527	5008	,	,		8614	0.2579		0.1372	False		,,,				2504	0.2331				p.P31T		.											.	MYH14-23	0			c.C91A						.	C	THR/PRO,THR/PRO,THR/PRO	319,2625		14,291,1167	3.0	4.0	4.0		91,91,91	2.2	0.0	19	dbSNP_83	4	784,5950		48,688,2631	no	missense,missense,missense	MYH14	NM_001077186.1,NM_001145809.1,NM_024729.3	38,38,38	62,979,3798	AA,AC,CC		11.6424,10.8356,11.397	possibly-damaging,possibly-damaging,possibly-damaging	31/2004,31/2037,31/1996	50713713	1103,8575	1472	3367	4839	SO:0001583	missense	79784	exon2			TTCACGCCCCGCG	AY165122	CCDS46151.1, CCDS54295.1, CCDS59411.1	19q13.33	2011-09-27	2009-11-19			ENSG00000105357		"""Myosins / Myosin superfamily : Class II"""	23212	protein-coding gene	gene with protein product		608568	"""myosin, heavy polypeptide 14"", ""myosin, heavy chain 14"""	DFNA4		12909352, 15015131, 17940200	Standard	NM_024729		Approved	FLJ13881, KIAA2034, MHC16, MYH17	uc010enu.1	Q7Z406		ENST00000596571.1:c.91C>A	19.37:g.50713713C>A	ENSP00000472819:p.Pro31Thr	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	10	10	NM_001077186	0	0	0	0	0	B0I1S2|C3TTN4|Q5CZ75|Q6XYE4|Q76B62|Q8WV23|Q96I22|Q9BT27|Q9BW35|Q9H882	Missense_Mutation	SNP	ENST00000596571.1	37	CCDS59411.1	373	0.1707875457875458	76	0.15447154471544716	47	0.1298342541436464	140	0.24475524475524477	110	0.14511873350923482	C	14.02	2.410075	0.42715	0.108356	0.116424	ENSG00000105357	ENST00000301415;ENST00000440075;ENST00000376970;ENST00000425460;ENST00000376965;ENST00000262269	D;D;D;D	0.86097	-2.07;-2.04;-2.02;-2.06	4.46	2.2	0.27929	.	.	.	.	.	T	0.00073	0.0002	N	0.19112	0.55	0.80722	P	0.0	B;B;B	0.26876	0.162;0.038;0.063	B;B;B	0.21917	0.037;0.016;0.037	T	0.09487	-1.0672	8	0.72032	D	0.01	.	12.3488	0.55136	0.0:0.4912:0.5088:0.0	rs590722	31;31;31	Q7Z406-2;Q7Z406;Q7Z406-6	.;MYH14_HUMAN;.	T	31	ENSP00000406273:P31T;ENSP00000366169:P31T;ENSP00000407879:P31T;ENSP00000262269:P31T	ENSP00000262269:P31T	P	+	1	0	MYH14	55405525	0.000000	0.05858	0.026000	0.17262	0.272000	0.26649	0.139000	0.16036	0.565000	0.29255	0.555000	0.69702	CCC	T|0.171;G|0.829		0.766	MYH14-008	NOVEL	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000464710.2	NM_024729	
ASPDH	554235	hgsc.bcm.edu	37	19	51015404	51015404	+	Missense_Mutation	SNP	T	T	C	rs12977172	byFrequency	TCGA-OR-A5LF-01A-11D-A30A-10	TCGA-OR-A5LF-10A-01D-A30A-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2cf21c74-97c0-46f3-8e1a-197f9737b5b5	bcf5a948-3260-455b-b930-5cec0d656728	g.chr19:51015404T>C	ENST00000389208.4	-	6	858	c.797A>G	c.(796-798)cAg>cGg	p.Q266R	JOSD2_ENST00000595669.1_5'Flank|JOSD2_ENST00000598418.1_5'Flank|JOSD2_ENST00000391815.3_5'Flank|JOSD2_ENST00000601423.1_5'Flank|ASPDH_ENST00000376916.3_Missense_Mutation_p.Q161R|ASPDH_ENST00000597030.1_5'Flank	NM_001114598.1	NP_001108070.1	A6ND91	ASPD_HUMAN	aspartate dehydrogenase domain containing	266			Q -> R (in dbSNP:rs12977172). {ECO:0000269|PubMed:15489334, ECO:0000269|Ref.1}.		NAD biosynthetic process (GO:0009435)|NADP catabolic process (GO:0006742)		aspartate dehydrogenase activity (GO:0033735)|NADP binding (GO:0050661)			endometrium(1)|large_intestine(1)|lung(1)	3						CAGGAGGCTCTGCCAGAAGGC	0.706													C|||	3986	0.795927	0.9728	0.7781	5008	,	,		10864	0.7143		0.6849	False		,,,				2504	0.7679				p.Q266R		.											.	ASPDH-90	0			c.A797G						.	C	ARG/GLN,ARG/GLN	3799,331		1771,257,37	6.0	9.0	8.0		482,797	1.9	1.0	19	dbSNP_121	8	5527,2593		1919,1689,452	no	missense,missense	ASPDH	NM_001024656.2,NM_001114598.1	43,43	3690,1946,489	CC,CT,TT		31.9335,8.0145,23.8694	benign,benign	161/179,266/284	51015404	9326,2924	2065	4060	6125	SO:0001583	missense	554235	exon6			AGGCTCTGCCAGA		CCDS33082.1, CCDS46153.1	19q13.33	2012-10-02			ENSG00000204653	ENSG00000204653			33856	protein-coding gene	gene with protein product							Standard	NM_001024656		Approved		uc010enz.3	A6ND91		ENST00000389208.4:c.797A>G	19.37:g.51015404T>C	ENSP00000373860:p.Gln266Arg	Somatic	2	0		WXS	Illumina GAIIx	Phase_I	13	11	NM_001114598	0	0	0	0	0	Q6NZ37	Missense_Mutation	SNP	ENST00000389208.4	37	CCDS46153.1	1681	0.7696886446886447	481	0.9776422764227642	273	0.7541436464088398	412	0.7202797202797203	515	0.679419525065963	C	3.606	-0.080592	0.07141	0.919855	0.680665	ENSG00000204653	ENST00000376916;ENST00000389208	T;T	0.39997	1.05;1.05	2.95	1.88	0.25563	Aspartate dehydrogenase (1);	1.158050	0.06646	N	0.761872	T	0.00012	0.0000	N	0.01705	-0.755	0.80722	P	0.0	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.0	T	0.30794	-0.9966	9	0.06099	T	0.92	-1.7519	4.8935	0.13738	0.0:0.6813:0.0:0.3187	rs12977172	266;161	A6ND91;A6ND91-2	ASPD_HUMAN;.	R	161;266	ENSP00000366114:Q161R;ENSP00000373860:Q266R	ENSP00000366114:Q161R	Q	-	2	0	ASPDH	55707216	0.916000	0.31088	0.989000	0.46669	0.553000	0.35397	0.171000	0.16685	0.125000	0.18397	-0.355000	0.07637	CAG	T|0.228;C|0.772		0.706	ASPDH-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464861.1	NM_001024656	
KLK1	3816	bcgsc.ca	37	19	51323501	51323501	+	Silent	SNP	A	A	G	rs1054713	byFrequency	TCGA-OR-A5LF-01A-11D-A30A-10	TCGA-OR-A5LF-10A-01D-A30A-10	A	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2cf21c74-97c0-46f3-8e1a-197f9737b5b5	bcf5a948-3260-455b-b930-5cec0d656728	g.chr19:51323501A>G	ENST00000301420.2	-	3	440	c.405T>C	c.(403-405)gaT>gaC	p.D135D	CTD-2568A17.5_ENST00000326989.5_lincRNA|KLK1_ENST00000448701.2_Silent_p.D33D	NM_002257.2	NP_002248.1	P06870	KLK1_HUMAN	kallikrein 1	135	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.					extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	serine-type endopeptidase activity (GO:0004252)			breast(1)|large_intestine(4)|lung(7)|urinary_tract(1)	13		all_neural(266;0.0199)		OV - Ovarian serous cystadenocarcinoma(262;0.00224)|GBM - Glioblastoma multiforme(134;0.00399)	Aprotinin(DB06692)	CCTTCACAGCATCTGTGATGG	0.592													g|||	3642	0.727236	0.7466	0.7651	5008	,	,		17336	0.8026		0.672	False		,,,				2504	0.6534				p.D135D		.											.	KLK1-226	0			c.T405C						.	A		3278,1128		1233,812,158	124.0	108.0	114.0		405	-5.8	0.0	19	dbSNP_86	114	5744,2856		1900,1944,456	no	coding-synonymous	KLK1	NM_002257.2		3133,2756,614	GG,GA,AA		33.2093,25.6015,30.632		135/263	51323501	9022,3984	2203	4300	6503	SO:0001819	synonymous_variant	3816	exon3			CACAGCATCTGTG	L10038	CCDS12804.1	19q13.3	2008-02-05	2006-10-27			ENSG00000167748	3.4.21.35	"""Kallikreins"""	6357	protein-coding gene	gene with protein product		147910	"""kallikrein 1, renal/pancreas/salivary"""			1684954, 16800724, 16800723	Standard	NM_002257		Approved	Klk6	uc002ptk.1	P06870		ENST00000301420.2:c.405T>C	19.37:g.51323501A>G		Somatic	170	1		WXS	Illumina GAIIx	Phase_I	118	7	NM_002257	0	0	0	0	0	Q66US9|Q86U61|Q8TCV8|Q9BS53|Q9NQU4|Q9UD19|Q9UMJ1	Silent	SNP	ENST00000301420.2	37	CCDS12804.1																																																																																			A|0.298;G|0.702		0.592	KLK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464135.2	NM_002257	
PRKCG	5582	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	19	54393237	54393237	+	Frame_Shift_Del	DEL	C	C	-			TCGA-OR-A5LF-01A-11D-A30A-10	TCGA-OR-A5LF-10A-01D-A30A-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2cf21c74-97c0-46f3-8e1a-197f9737b5b5	bcf5a948-3260-455b-b930-5cec0d656728	g.chr19:54393237delC	ENST00000263431.3	+	5	777	c.495delC	c.(493-495)atcfs	p.I165fs	PRKCG_ENST00000542049.1_Frame_Shift_Del_p.I52fs|PRKCG_ENST00000540413.1_Frame_Shift_Del_p.I165fs|PRKCG_ENST00000536044.1_Frame_Shift_Del_p.I165fs	NM_002739.3	NP_002730.1	P05129	KPCG_HUMAN	protein kinase C, gamma	165					activation of phospholipase C activity (GO:0007202)|blood coagulation (GO:0007596)|cell death (GO:0008219)|chemosensory behavior (GO:0007635)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|innervation (GO:0060384)|intracellular signal transduction (GO:0035556)|learning or memory (GO:0007611)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of protein catabolic process (GO:0042177)|negative regulation of protein ubiquitination (GO:0031397)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphorylation (GO:0016310)|platelet activation (GO:0030168)|positive regulation of mismatch repair (GO:0032425)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|response to morphine (GO:0043278)|response to pain (GO:0048265)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)	cell-cell junction (GO:0005911)|cytosol (GO:0005829)|dendrite (GO:0030425)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|synaptic membrane (GO:0097060)	ATP binding (GO:0005524)|calcium-dependent protein kinase C activity (GO:0004698)|protein kinase activity (GO:0004672)|protein kinase C activity (GO:0004697)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|zinc ion binding (GO:0008270)			large_intestine(1)|lung(4)|ovary(2)|pancreas(2)|skin(1)	10	all_cancers(19;0.0462)|all_epithelial(19;0.0258)|all_lung(19;0.185)|Ovarian(34;0.19)|Lung NSC(19;0.218)			GBM - Glioblastoma multiforme(134;0.0521)	Tamoxifen(DB00675)	AGCTGGAGATCCGGGCTCCCA	0.711																																					p.I165fs		.											.	PRKCG-1367	0			c.495delC						.						11.0	13.0	12.0					19																	54393237		2182	4254	6436	SO:0001589	frameshift_variant	5582	exon5			GGAGATCCGGGCT	M13977	CCDS12867.1	19q13.4	2014-09-17			ENSG00000126583	ENSG00000126583	2.7.11.1		9402	protein-coding gene	gene with protein product	"""PKC-gamma"""	176980		PKCG, SCA14		8432525, 3755548	Standard	NM_002739		Approved	PKCC, MGC57564	uc002qcq.1	P05129	OTTHUMG00000064846	ENST00000263431.3:c.495delC	19.37:g.54393237delC	ENSP00000263431:p.Ile165fs	Somatic	39	0		WXS	Illumina GAIIx	Phase_I	57	24	NM_002739	0	0	0	0	0	B7Z8Q0	Frame_Shift_Del	DEL	ENST00000263431.3	37	CCDS12867.1																																																																																			.		0.711	PRKCG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000139233.3	NM_002739	
ZNF787	126208	hgsc.bcm.edu	37	19	56599438	56599440	+	In_Frame_Del	DEL	TCG	TCG	-	rs5828672|rs71696054	byFrequency	TCGA-OR-A5LF-01A-11D-A30A-10	TCGA-OR-A5LF-10A-01D-A30A-10	TCG	TCG	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2cf21c74-97c0-46f3-8e1a-197f9737b5b5	bcf5a948-3260-455b-b930-5cec0d656728	g.chr19:56599438_56599440delTCG	ENST00000270459.3	-	3	1219_1221	c.1101_1103delCGA	c.(1099-1104)gacgag>gag	p.D367del		NM_001002836.2	NP_001002836	Q6DD87	ZN787_HUMAN	zinc finger protein 787	367					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(1)|lung(2)|pancreas(1)	5		Colorectal(82;3.46e-05)|Ovarian(87;0.0822)|Renal(1328;0.157)		GBM - Glioblastoma multiforme(193;0.0559)		GCCCGCGGCCTCGTCGTCGTCGT	0.778														4509	0.900359	0.9939	0.732	5008	,	,		3238	0.7252		0.9821	False		,,,				2504	0.9898				p.367_368del		.											.	ZNF787-69	0			c.1101_1103del						.																																			SO:0001651	inframe_deletion	126208	exon3			GCGGCCTCGTCGT	BC077728, AF000560	CCDS42634.1	19q13.42	2013-01-08				ENSG00000142409		"""Zinc fingers, C2H2-type"""	26998	protein-coding gene	gene with protein product							Standard	NM_001002836		Approved		uc010eth.1	Q6DD87		ENST00000270459.3:c.1101_1103delCGA	19.37:g.56599447_56599449delTCG	ENSP00000270459:p.Asp367del	Somatic	4	4		WXS	Illumina GAIIx	Phase_I	26	25	NM_001002836	0	0	0	0	0	O00455	In_Frame_Del	DEL	ENST00000270459.3	37	CCDS42634.1																																																																																			.		0.778	ZNF787-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000457498.1	NM_001002836	
TRAPPC12	51112	hgsc.bcm.edu	37	2	3391826	3391826	+	Silent	SNP	C	C	T	rs11127423	byFrequency	TCGA-OR-A5LF-01A-11D-A30A-10	TCGA-OR-A5LF-10A-01D-A30A-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2cf21c74-97c0-46f3-8e1a-197f9737b5b5	bcf5a948-3260-455b-b930-5cec0d656728	g.chr2:3391826C>T	ENST00000324266.5	+	2	627	c.432C>T	c.(430-432)gcC>gcT	p.A144A	TRAPPC12_ENST00000382110.2_Silent_p.A144A	NM_016030.5	NP_057114.5	Q8WVT3	TPC12_HUMAN	trafficking protein particle complex 12	144					vesicle-mediated transport (GO:0016192)												GCAGCGAAGCCGCGCGCCCGG	0.781													C|||	1528	0.305112	0.2352	0.1628	5008	,	,		6707	0.4048		0.2435	False		,,,				2504	0.4611				p.A144A		.											.	.	0			c.C432T						.						2.0	2.0	2.0					2																	3391826		1308	2977	4285	SO:0001819	synonymous_variant	51112	exon2			CGAAGCCGCGCGC	BC017475	CCDS1652.1	2p25.3	2013-01-10	2011-12-12	2011-12-12	ENSG00000171853	ENSG00000171853		"""Trafficking protein particle complex"", ""Tetratricopeptide (TTC) repeat domain containing"""	24284	protein-coding gene	gene with protein product		614139	"""tetratricopeptide repeat domain 15"""	TTC15		10810093, 21525244, 20562859	Standard	NM_016030		Approved	CGI-87, TTC-15	uc002qxm.1	Q8WVT3	OTTHUMG00000090328	ENST00000324266.5:c.432C>T	2.37:g.3391826C>T		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	9	5	NM_016030	0	0	0	0	0	B3KV01|D6W4Y2|Q8WVW1|Q9Y395	Silent	SNP	ENST00000324266.5	37	CCDS1652.1																																																																																			C|0.719;T|0.281		0.781	TRAPPC12-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206693.2	NM_016030	
XDH	7498	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	31572920	31572920	+	Missense_Mutation	SNP	G	G	T			TCGA-OR-A5LF-01A-11D-A30A-10	TCGA-OR-A5LF-10A-01D-A30A-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2cf21c74-97c0-46f3-8e1a-197f9737b5b5	bcf5a948-3260-455b-b930-5cec0d656728	g.chr2:31572920G>T	ENST00000379416.3	-	25	2849	c.2801C>A	c.(2800-2802)aCc>aAc	p.T934N		NM_000379.3	NP_000370.2	P47989	XDH_HUMAN	xanthine dehydrogenase	934					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|lactation (GO:0007595)|negative regulation of endothelial cell differentiation (GO:0045602)|negative regulation of endothelial cell proliferation (GO:0001937)|negative regulation of gene expression (GO:0010629)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of vascular endothelial growth factor signaling pathway (GO:1900747)|negative regulation of vasculogenesis (GO:2001213)|nucleobase-containing small molecule metabolic process (GO:0055086)|positive regulation of p38MAPK cascade (GO:1900745)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|purine nucleobase metabolic process (GO:0006144)|purine nucleotide catabolic process (GO:0006195)|small molecule metabolic process (GO:0044281)|xanthine catabolic process (GO:0009115)	cytosol (GO:0005829)|extracellular space (GO:0005615)|peroxisome (GO:0005777)	2 iron, 2 sulfur cluster binding (GO:0051537)|electron carrier activity (GO:0009055)|flavin adenine dinucleotide binding (GO:0050660)|iron ion binding (GO:0005506)|molybdopterin cofactor binding (GO:0043546)|protein homodimerization activity (GO:0042803)|UDP-N-acetylmuramate dehydrogenase activity (GO:0008762)|xanthine dehydrogenase activity (GO:0004854)|xanthine oxidase activity (GO:0004855)			breast(3)|central_nervous_system(2)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(13)|lung(31)|ovary(1)|pancreas(1)|prostate(3)|skin(9)|urinary_tract(1)	74	Acute lymphoblastic leukemia(172;0.155)				Aldesleukin(DB00041)|Allopurinol(DB00437)|Azathioprine(DB00993)|Carboplatin(DB00958)|Carvedilol(DB01136)|Chlorphenesin(DB00856)|Cisplatin(DB00515)|Daunorubicin(DB00694)|Deferoxamine(DB00746)|Doxorubicin(DB00997)|Flavin adenine dinucleotide(DB03147)|L-Carnitine(DB00583)|Menadione(DB00170)|Mercaptopurine(DB01033)|Nitrofural(DB00336)|Procarbazine(DB01168)|Pyrazinamide(DB00339)|Spermine(DB00127)|Trifluoperazine(DB00831)	CATCCCACAGGTCACTGCAAC	0.562																																					p.T934N	Colon(66;682 1445 30109 40147)	.											.	XDH-158	0			c.C2801A						.						118.0	130.0	126.0					2																	31572920		2203	4300	6503	SO:0001583	missense	7498	exon25			CCACAGGTCACTG	D11456	CCDS1775.1	2p23.1	2009-07-10	2003-03-20		ENSG00000158125	ENSG00000158125	1.17.1.4		12805	protein-coding gene	gene with protein product		607633	"""xanthene dehydrogenase"""			8224915	Standard	NM_000379		Approved	XOR, XO	uc002rnv.1	P47989	OTTHUMG00000099385	ENST00000379416.3:c.2801C>A	2.37:g.31572920G>T	ENSP00000368727:p.Thr934Asn	Somatic	74	0		WXS	Illumina GAIIx	Phase_I	55	17	NM_000379	0	0	0	0	0	Q16681|Q16712|Q4PJ16	Missense_Mutation	SNP	ENST00000379416.3	37	CCDS1775.1	.	.	.	.	.	.	.	.	.	.	G	11.42	1.634524	0.29068	.	.	ENSG00000158125	ENST00000379416	T	0.42900	0.96	5.91	4.0	0.46444	Aldehyde oxidase/xanthine dehydrogenase, molybdopterin binding (3);	0.206543	0.50627	D	0.000111	T	0.41442	0.1159	L	0.43554	1.36	0.47905	D	0.999542	P	0.38863	0.65	B	0.43701	0.428	T	0.27905	-1.0060	10	0.35671	T	0.21	.	13.957	0.64155	0.0:0.0:0.6271:0.3729	.	934	P47989	XDH_HUMAN	N	934	ENSP00000368727:T934N	ENSP00000368727:T934N	T	-	2	0	XDH	31426424	1.000000	0.71417	0.975000	0.42487	0.001000	0.01503	1.803000	0.38863	1.486000	0.48398	-0.188000	0.12872	ACC	.		0.562	XDH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000216840.1	NM_000379	
ARHGEF33	100271715	hgsc.bcm.edu	37	2	39187519	39187519	+	Silent	SNP	A	A	G	rs958412	byFrequency	TCGA-OR-A5LF-01A-11D-A30A-10	TCGA-OR-A5LF-10A-01D-A30A-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2cf21c74-97c0-46f3-8e1a-197f9737b5b5	bcf5a948-3260-455b-b930-5cec0d656728	g.chr2:39187519A>G	ENST00000536934.1	+	14	2158	c.2073A>G	c.(2071-2073)aaA>aaG	p.K691K	AC019171.1_ENST00000601251.1_5'Flank|ARHGEF33_ENST00000409978.1_Silent_p.K691K|ARHGEF33_ENST00000398800.4_Silent_p.K691K			A8MVX0	ARG33_HUMAN	Rho guanine nucleotide exchange factor (GEF) 33	691							Rho guanyl-nucleotide exchange factor activity (GO:0005089)			endometrium(3)|pancreas(1)|prostate(1)	5						GCGCCTACAAACTGGAGGCGG	0.746													G|||	4508	0.90016	0.9523	0.9481	5008	,	,		7469	0.8403		0.9354	False		,,,				2504	0.8211				p.K691K		.											.	ARHGEF33-46	0			c.A2073G						.						1.0	1.0	1.0					2																	39187519		286	830	1116	SO:0001819	synonymous_variant	100271715	exon14			CTACAAACTGGAG		CCDS46263.1, CCDS46263.2	2p22.1	2012-07-24			ENSG00000214694	ENSG00000214694		"""Rho guanine nucleotide exchange factors"""	37252	protein-coding gene	gene with protein product							Standard	NM_001145451		Approved		uc021vgd.1	A8MVX0	OTTHUMG00000153540	ENST00000536934.1:c.2073A>G	2.37:g.39187519A>G		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	6	6	NM_001145451	0	0	0	0	0	J3KPX2	Silent	SNP	ENST00000536934.1	37																																																																																				A|0.086;G|0.914		0.746	ARHGEF33-202	KNOWN	basic	protein_coding	protein_coding		NM_001145451	
RNF149	284996	hgsc.bcm.edu	37	2	101925026	101925026	+	Missense_Mutation	SNP	T	T	C	rs11123868	byFrequency	TCGA-OR-A5LF-01A-11D-A30A-10	TCGA-OR-A5LF-10A-01D-A30A-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2cf21c74-97c0-46f3-8e1a-197f9737b5b5	bcf5a948-3260-455b-b930-5cec0d656728	g.chr2:101925026T>C	ENST00000295317.3	-	1	132	c.25A>G	c.(25-27)Agc>Ggc	p.S9G	MIR5696_ENST00000578474.1_RNA	NM_173647.3	NP_775918.2	Q8NC42	RN149_HUMAN	ring finger protein 149	9			S -> G (in dbSNP:rs11123868). {ECO:0000269|PubMed:14702039, ECO:0000269|PubMed:15489334}.		cellular response to drug (GO:0035690)|negative regulation of MAPK cascade (GO:0043409)|regulation of protein stability (GO:0031647)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(3)|ovary(1)|prostate(1)	12						GCCCCGACGCTGGCTTCGCGC	0.726													C|||	2397	0.478634	0.7678	0.4582	5008	,	,		13525	0.3175		0.3917	False		,,,				2504	0.3579				p.S9G	Colon(25;331 612 6521 7355 31028)	.											.	RNF149-290	0			c.A25G						.	C	GLY/SER	1794,1350		547,700,325	4.0	6.0	5.0		25	-2.5	0.0	2	dbSNP_120	5	2382,4344		496,1390,1477	no	missense	RNF149	NM_173647.3	56	1043,2090,1802	CC,CT,TT		35.4148,42.9389,42.31	benign	9/401	101925026	4176,5694	1572	3363	4935	SO:0001583	missense	284996	exon1			CGACGCTGGCTTC	AK074985	CCDS2051.1	2q12.1	2013-01-09			ENSG00000163162	ENSG00000163162		"""RING-type (C3HC4) zinc fingers"""	23137	protein-coding gene	gene with protein product							Standard	NM_173647		Approved	FLJ90504	uc002taz.2	Q8NC42	OTTHUMG00000130685	ENST00000295317.3:c.25A>G	2.37:g.101925026T>C	ENSP00000295317:p.Ser9Gly	Somatic	2	0		WXS	Illumina GAIIx	Phase_I	19	13	NM_173647	0	0	0	0	0	Q53S14|Q8N5I8|Q8NBY5|Q8WUU3	Missense_Mutation	SNP	ENST00000295317.3	37	CCDS2051.1	1023	0.4684065934065934	378	0.7682926829268293	162	0.44751381215469616	189	0.3304195804195804	294	0.38786279683377306	C	1.566	-0.535355	0.04082	0.570611	0.354148	ENSG00000163162	ENST00000295317	T	0.08634	3.07	3.96	-2.45	0.06481	.	4.553570	0.01792	N	0.032390	T	0.00012	0.0000	N	0.00926	-1.1	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.30327	-0.9982	9	0.16896	T	0.51	.	7.6769	0.28490	0.0:0.1603:0.4369:0.4028	rs11123868;rs17856944;rs56755384	9	Q8NC42	RN149_HUMAN	G	9	ENSP00000295317:S9G	ENSP00000295317:S9G	S	-	1	0	RNF149	101291458	0.000000	0.05858	0.003000	0.11579	0.044000	0.14063	-0.581000	0.05820	-0.783000	0.04534	-0.374000	0.07098	AGC	T|0.543;C|0.457		0.726	RNF149-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253180.2	NM_173647	
C2orf40	84417	hgsc.bcm.edu	37	2	106682226	106682226	+	Silent	SNP	T	T	C	rs4271786|rs543094154	byFrequency	TCGA-OR-A5LF-01A-11D-A30A-10	TCGA-OR-A5LF-10A-01D-A30A-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2cf21c74-97c0-46f3-8e1a-197f9737b5b5	bcf5a948-3260-455b-b930-5cec0d656728	g.chr2:106682226T>C	ENST00000238044.3	+	1	115	c.6T>C	c.(4-6)gcT>gcC	p.A2A	C2orf40_ENST00000409944.1_Intron|C2orf40_ENST00000489174.1_Intron	NM_032411.2	NP_115787.1	Q9H1Z8	AUGN_HUMAN	chromosome 2 open reading frame 40	2					cellular senescence (GO:0090398)|cyclin catabolic process (GO:0008054)|G1 to G0 transition (GO:0070314)	cytoplasmic vesicle (GO:0031410)|extracellular space (GO:0005615)				lung(7)|urinary_tract(1)	8						CCGCCATGGCTGCCTCCCCCG	0.766													C|||	1272	0.253994	0.2753	0.1369	5008	,	,		11771	0.2411		0.2227	False		,,,				2504	0.3538				p.A2A		.											.	C2orf40-90	0			c.T6C						.	C		520,2666		23,474,1096	2.0	3.0	3.0		6	1.0	0.3	2	dbSNP_111	3	871,5647		54,763,2442	no	coding-synonymous	C2orf40	NM_032411.2		77,1237,3538	CC,CT,TT		13.363,16.3214,14.3343		2/149	106682226	1391,8313	1593	3259	4852	SO:0001819	synonymous_variant	84417	exon1			CATGGCTGCCTCC	BC021742	CCDS2072.1	2q12.2	2014-01-28			ENSG00000119147	ENSG00000119147			24642	protein-coding gene	gene with protein product	"""esophageal cancer related gene 4 protein"""	611752				12800218	Standard	NM_032411		Approved	ECRG4, augurin	uc010fjf.3	Q9H1Z8	OTTHUMG00000130921	ENST00000238044.3:c.6T>C	2.37:g.106682226T>C		Somatic	2	0		WXS	Illumina GAIIx	Phase_I	36	4	NM_032411	0	0	0	0	0	D3DVK2	Silent	SNP	ENST00000238044.3	37	CCDS2072.1																																																																																			T|0.765;C|0.235		0.766	C2orf40-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253515.2	NM_032411	
SOWAHC	65124	hgsc.bcm.edu	37	2	110372192	110372192	+	Silent	SNP	A	A	G	rs6594048		TCGA-OR-A5LF-01A-11D-A30A-10	TCGA-OR-A5LF-10A-01D-A30A-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2cf21c74-97c0-46f3-8e1a-197f9737b5b5	bcf5a948-3260-455b-b930-5cec0d656728	g.chr2:110372192A>G	ENST00000356454.3	+	1	282	c.126A>G	c.(124-126)ctA>ctG	p.L42L	SEPT10_ENST00000545389.1_5'Flank|SEPT10_ENST00000356688.4_5'Flank|SEPT10_ENST00000437928.1_5'Flank|SEPT10_ENST00000334001.6_5'Flank|SEPT10_ENST00000397714.2_5'Flank|SEPT10_ENST00000415095.1_5'Flank|SEPT10_ENST00000397712.2_5'Flank	NM_023016.3	NP_075392.2	Q53LP3	SWAHC_HUMAN	sosondowah ankyrin repeat domain family member C	42																	GGGGCGCCCTAGGCGGCGAAC	0.771													G|||	5008	1.0	1.0	1.0	5008	,	,		6158	1.0		1.0	False		,,,				2504	1.0				p.L42L		.											.	.	0			c.A126G						.						1.0	2.0	2.0					2																	110372192		1239	2477	3716	SO:0001819	synonymous_variant	65124	exon1			CGCCCTAGGCGGC	AK023346	CCDS33270.1	2q13	2013-01-10	2012-01-12	2012-01-12	ENSG00000198142	ENSG00000198142		"""Ankyrin repeat domain containing"""	26149	protein-coding gene	gene with protein product			"""ankyrin repeat domain 57"""	C2orf26, ANKRD57		22234889	Standard	NM_023016		Approved	FLJ21870	uc002tfb.3	Q53LP3	OTTHUMG00000153219	ENST00000356454.3:c.126A>G	2.37:g.110372192A>G		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	16	16	NM_023016	0	0	0	0	0	Q8NE15|Q9H6U1	Silent	SNP	ENST00000356454.3	37	CCDS33270.1																																																																																			A|0.029;G|0.971		0.771	SOWAHC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000330168.1	NM_023016	
GPR39	2863	bcgsc.ca	37	2	133174764	133174764	+	Missense_Mutation	SNP	C	C	T	rs2241764	byFrequency	TCGA-OR-A5LF-01A-11D-A30A-10	TCGA-OR-A5LF-10A-01D-A30A-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2cf21c74-97c0-46f3-8e1a-197f9737b5b5	bcf5a948-3260-455b-b930-5cec0d656728	g.chr2:133174764C>T	ENST00000329321.3	+	1	618	c.149C>T	c.(148-150)gCc>gTc	p.A50V		NM_001508.2	NP_001499.1	O43194	GPR39_HUMAN	G protein-coupled receptor 39	50			A -> V (in dbSNP:rs2241764). {ECO:0000269|PubMed:14702039}.		G-protein coupled receptor signaling pathway (GO:0007186)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|metal ion binding (GO:0046872)			breast(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(8)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	22						GGGAACAGCGCCACCATTCGG	0.532													T|||	1894	0.378195	0.5295	0.3429	5008	,	,		20511	0.2361		0.327	False		,,,				2504	0.3978				p.A50V		.											.	GPR39-226	0			c.C149T						.	T	VAL/ALA	2200,2206	588.0+/-386.8	541,1118,544	150.0	134.0	139.0		149	5.3	1.0	2	dbSNP_98	139	2810,5790	676.5+/-403.3	477,1856,1967	yes	missense	GPR39	NM_001508.2	64	1018,2974,2511	TT,TC,CC		32.6744,49.9319,38.5207	benign	50/454	133174764	5010,7996	2203	4300	6503	SO:0001583	missense	2863	exon1			ACAGCGCCACCAT	AF034633	CCDS2170.1	2q21-q22	2012-08-21			ENSG00000183840	ENSG00000183840		"""GPCR / Class A : Orphans"""	4496	protein-coding gene	gene with protein product		602886				9441746	Standard	NM_001508		Approved		uc002ttl.3	O43194	OTTHUMG00000131679	ENST00000329321.3:c.149C>T	2.37:g.133174764C>T	ENSP00000327417:p.Ala50Val	Somatic	203	2		WXS	Illumina GAIIx	Phase_I	214	10	NM_001508	0	0	0	0	0	B2RC12|B6V9G4|Q08AS2|Q53R01	Missense_Mutation	SNP	ENST00000329321.3	37	CCDS2170.1	786	0.3598901098901099	256	0.5203252032520326	127	0.35082872928176795	151	0.263986013986014	252	0.3324538258575198	T	5.771	0.326541	0.10900	0.499319	0.326744	ENSG00000183840	ENST00000329321	T	0.36157	1.27	5.34	5.34	0.76211	GPCR, rhodopsin-like superfamily (1);	0.264420	0.36628	N	0.002497	T	0.00012	0.0000	N	0.00677	-1.265	0.47123	P	6.789999999999852E-4	B	0.02656	0.0	B	0.04013	0.001	T	0.42999	-0.9418	9	0.06099	T	0.92	.	11.4538	0.50169	0.0:0.0701:0.0:0.9299	rs2241764;rs2241764	50	O43194	GPR39_HUMAN	V	50	ENSP00000327417:A50V	ENSP00000327417:A50V	A	+	2	0	GPR39	132891234	1.000000	0.71417	0.989000	0.46669	0.839000	0.47603	4.958000	0.63660	1.064000	0.40671	-0.391000	0.06502	GCC	C|0.618;T|0.381		0.532	GPR39-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254582.1		
CHPF	79586	bcgsc.ca	37	2	220404648	220404648	+	Silent	SNP	C	C	T	rs1043833	byFrequency	TCGA-OR-A5LF-01A-11D-A30A-10	TCGA-OR-A5LF-10A-01D-A30A-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2cf21c74-97c0-46f3-8e1a-197f9737b5b5	bcf5a948-3260-455b-b930-5cec0d656728	g.chr2:220404648C>T	ENST00000243776.6	-	4	2033	c.1785G>A	c.(1783-1785)ctG>ctA	p.L595L	CHPF_ENST00000535926.1_Silent_p.L433L	NM_024536.5	NP_078812	Q8IZ52	CHSS2_HUMAN	chondroitin polymerizing factor	595					carbohydrate metabolic process (GO:0005975)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate metabolic process (GO:0030204)|glycosaminoglycan metabolic process (GO:0030203)|small molecule metabolic process (GO:0044281)	Golgi cisterna membrane (GO:0032580)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)	glucuronosyl-N-acetylgalactosaminyl-proteoglycan 4-beta-N-acetylgalactosaminyltransferase activity (GO:0047238)|metal ion binding (GO:0046872)|N-acetylgalactosaminyl-proteoglycan 3-beta-glucuronosyltransferase activity (GO:0050510)			central_nervous_system(1)|cervix(1)|endometrium(4)|large_intestine(3)|lung(10)|ovary(1)|prostate(1)	21		Renal(207;0.0183)		Epithelial(149;3.02e-08)|all cancers(144;3.41e-06)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00802)		CCATGAGGCGCAGTGGTGAGG	0.652													C|||	1534	0.30631	0.1884	0.4841	5008	,	,		17935	0.2748		0.4523	False		,,,				2504	0.2219				p.L595L		.											.	CHPF-90	0			c.G1785A						.	C	,	1096,3310		126,844,1233	53.0	59.0	57.0		1299,1785	-0.6	0.8	2	dbSNP_86	57	3967,4625		933,2101,1262	no	coding-synonymous,coding-synonymous	CHPF	NM_001195731.1,NM_024536.5	,	1059,2945,2495	TT,TC,CC		46.1709,24.8752,38.9521	,	433/614,595/776	220404648	5063,7935	2203	4296	6499	SO:0001819	synonymous_variant	79586	exon4			GAGGCGCAGTGGT	BC008878	CCDS2443.1, CCDS56169.1	2q35	2014-02-12			ENSG00000123989	ENSG00000123989	2.4.1.175, 2.4.1.226	"""Beta 3-glycosyltransferases"", ""Beta 4-glycosyltransferases"""	24291	protein-coding gene	gene with protein product	"""chondroitin sulfate synthase 2"""	610405				11230166, 12716890	Standard	NM_024536		Approved	CSS2, CHSY2	uc002vmc.4	Q8IZ52	OTTHUMG00000058929	ENST00000243776.6:c.1785G>A	2.37:g.220404648C>T		Somatic	293	4		WXS	Illumina GAIIx	Phase_I	299	10	NM_024536	0	0	0	0	0	B4DXU0|Q6UXD6|Q7L4G1|Q9H0F8|Q9H618	Silent	SNP	ENST00000243776.6	37	CCDS2443.1																																																																																			C|0.644;T|0.356		0.652	CHPF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000130268.1	NM_024536	
PRR21	643905	bcgsc.ca	37	2	240982228	240982228	+	Missense_Mutation	SNP	C	C	T	rs10439373	byFrequency	TCGA-OR-A5LF-01A-11D-A30A-10	TCGA-OR-A5LF-10A-01D-A30A-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2cf21c74-97c0-46f3-8e1a-197f9737b5b5	bcf5a948-3260-455b-b930-5cec0d656728	g.chr2:240982228C>T	ENST00000408934.1	-	1	171	c.172G>A	c.(172-174)Ggc>Agc	p.G58S		NM_001080835.1	NP_001074304.1	Q8WXC7	PRR21_HUMAN	proline rich 21	58	Pro-rich.		G -> S (in dbSNP:rs10439373).							NS(1)|breast(1)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(3)|lung(7)|ovary(2)|prostate(5)|skin(3)|stomach(2)|upper_aerodigestive_tract(2)	29						GATGAAGGGCCGTGGGTGAAG	0.602													N|||	2614	0.521965	0.6157	0.4481	5008	,	,		17559	0.506		0.502	False		,,,				2504	0.4847				p.G58S		.											.	PRR21-70	0			c.G172A						.	C	SER/GLY	2651,1755		769,1113,321	133.0	117.0	122.0		172	-3.0	0.0	2	dbSNP_119	122	3699,4901		748,2203,1349	no	missense	PRR21	NM_001080835.1	56	1517,3316,1670	TT,TC,CC		43.0116,39.832,48.8236	possibly-damaging	58/390	240982228	6350,6656	2203	4300	6503	SO:0001583	missense	643905	exon1			AAGGGCCGTGGGT	AF453950	CCDS33417.1	2q37.3	2009-04-20			ENSG00000221961	ENSG00000221961			33866	protein-coding gene	gene with protein product							Standard	NM_001080835		Approved		uc010zod.2	Q8WXC7	OTTHUMG00000159174	ENST00000408934.1:c.172G>A	2.37:g.240982228C>T	ENSP00000386166:p.Gly58Ser	Somatic	380	6		WXS	Illumina GAIIx	Phase_I	360	13	NM_001080835	0	0	0	0	0		Missense_Mutation	SNP	ENST00000408934.1	37	CCDS33417.1	.	.	.	.	.	.	.	.	.	.	N	0.155	-1.087546	0.01873	0.60168	0.430116	ENSG00000221961	ENST00000408934;ENST00000486799	T;T	0.37584	1.19;1.19	1.5	-3.0	0.05480	.	.	.	.	.	T	0.00012	0.0000	N	0.08118	0	0.80722	P	0.0	B	0.27679	0.185	B	0.23275	0.045	T	0.41980	-0.9478	8	0.17832	T	0.49	.	4.1525	0.10245	0.1588:0.3931:0.0:0.4481	rs10439373;rs10439373	58	Q8WXC7	PRR21_HUMAN	S	58	ENSP00000386166:G58S;ENSP00000418240:G58S	ENSP00000386166:G58S	G	-	1	0	PRR21	240630901	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-1.681000	0.01937	-2.086000	0.00863	-1.281000	0.01382	GGC	C|0.491;T|0.509		0.602	PRR21-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_001080835	
ANO7	50636	bcgsc.ca	37	2	242129487	242129487	+	Silent	SNP	G	G	T	rs11695874	byFrequency	TCGA-OR-A5LF-01A-11D-A30A-10	TCGA-OR-A5LF-10A-01D-A30A-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2cf21c74-97c0-46f3-8e1a-197f9737b5b5	bcf5a948-3260-455b-b930-5cec0d656728	g.chr2:242129487G>T	ENST00000274979.8	+	2	274	c.171G>T	c.(169-171)cgG>cgT	p.R57R	ANO7_ENST00000402530.3_Silent_p.R57R|ANO7_ENST00000402430.3_Silent_p.R57R	NM_001001891.3	NP_001001891.2	Q6IWH7	ANO7_HUMAN	anoctamin 7	57					calcium activated galactosylceramide scrambling (GO:0061591)|calcium activated phosphatidylcholine scrambling (GO:0061590)|calcium activated phosphatidylserine scrambling (GO:0061589)|chloride transport (GO:0006821)|ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	cell junction (GO:0030054)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|intracellular (GO:0005622)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	intracellular calcium activated chloride channel activity (GO:0005229)|phospholipid scramblase activity (GO:0017128)			NS(1)|central_nervous_system(1)|endometrium(3)|large_intestine(5)|lung(14)|pancreas(2)|prostate(1)|skin(3)|urinary_tract(2)	32						GGATGCTGCGGCGACGGGCCC	0.677													G|||	745	0.148762	0.0968	0.1888	5008	,	,		15980	0.0208		0.3052	False		,,,				2504	0.1616				p.R57R		.											.	ANO7-92	0			c.G171T						.	G	,	571,3819		41,489,1665	29.0	28.0	28.0		171,171	0.4	0.0	2	dbSNP_120	28	2342,6220		335,1672,2274	no	coding-synonymous,coding-synonymous	ANO7	NM_001001666.3,NM_001001891.3	,	376,2161,3939	TT,TG,GG		27.3534,13.0068,22.4907	,	57/180,57/934	242129487	2913,10039	2195	4281	6476	SO:0001819	synonymous_variant	50636	exon2			GCTGCGGCGACGG	AY617079	CCDS33423.1, CCDS46563.1	2q37.3	2014-04-09	2008-08-28	2008-08-28	ENSG00000146205	ENSG00000146205		"""Ion channels / Chloride channels : Calcium activated : Anoctamins"""	31677	protein-coding gene	gene with protein product		605096	"""transmembrane protein 16G"""	PCANAP5, TMEM16G		14981236, 15375614, 24692353	Standard	NM_001001891		Approved	NGEP, PCANAP5L, IPCA-5	uc002wax.2	Q6IWH7	OTTHUMG00000151702	ENST00000274979.8:c.171G>T	2.37:g.242129487G>T		Somatic	323	2		WXS	Illumina GAIIx	Phase_I	266	9	NM_001001666	0	0	0	0	0	Q6IWH6	Silent	SNP	ENST00000274979.8	37	CCDS33423.1																																																																																			G|0.805;T|0.195		0.677	ANO7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323509.1	NM_001001891	
FRG1B	284802	bcgsc.ca	37	20	29632680	29632680	+	Silent	SNP	G	G	A	rs4892355		TCGA-OR-A5LF-01A-11D-A30A-10	TCGA-OR-A5LF-10A-01D-A30A-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2cf21c74-97c0-46f3-8e1a-197f9737b5b5	bcf5a948-3260-455b-b930-5cec0d656728	g.chr20:29632680G>A	ENST00000278882.3	+	8	875	c.495G>A	c.(493-495)aaG>aaA	p.K165K	FRG1B_ENST00000358464.4_Silent_p.K165K			Q9BZ01	FRG1B_HUMAN	FSHD region gene 1 family, member B	165										endometrium(10)|kidney(21)|lung(3)|pancreas(1)|prostate(9)|urinary_tract(9)	53						TTCTTAAAAAGGCTCAGAAAG	0.313																																					.		.											.	FRG1B-22	0			.						.																																			SO:0001819	synonymous_variant	284802	.			TAAAAAGGCTCAG			20q11.1	2013-03-18	2007-10-11	2007-10-11	ENSG00000149531	ENSG00000149531			15792	other	unknown			"""chromosome 20 open reading frame 80"""	C20orf80			Standard	NR_003579		Approved	bA348I14.2	uc010ztl.1	Q9BZ01	OTTHUMG00000032157	ENST00000278882.3:c.495G>A	20.37:g.29632680G>A		Somatic	502	20		WXS	Illumina GAIIx	Phase_I	317	35	.	0	0	0	0	0	C4AME5	RNA	SNP	ENST00000278882.3	37																																																																																				G|0.500;A|0.500		0.313	FRG1B-001	KNOWN	not_best_in_genome_evidence|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000078494.2	NR_003579	
FAM83C	128876	bcgsc.ca	37	20	33875562	33875562	+	Silent	SNP	C	C	T	rs141723001	byFrequency	TCGA-OR-A5LF-01A-11D-A30A-10	TCGA-OR-A5LF-10A-01D-A30A-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2cf21c74-97c0-46f3-8e1a-197f9737b5b5	bcf5a948-3260-455b-b930-5cec0d656728	g.chr20:33875562C>T	ENST00000374408.3	-	4	1116	c.1020G>A	c.(1018-1020)tcG>tcA	p.S340S	EIF6_ENST00000374443.3_5'Flank|EIF6_ENST00000374450.3_5'Flank|FAM83C-AS1_ENST00000429167.1_RNA	NM_178468.5	NP_848563.1	Q9BQN1	FA83C_HUMAN	family with sequence similarity 83, member C	340										central_nervous_system(2)|endometrium(3)|kidney(1)|large_intestine(6)|lung(19)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	40			BRCA - Breast invasive adenocarcinoma(18;0.00252)			AGGGCAGGGACGACGTGGGGC	0.642													C|||	39	0.00778754	0.0272	0.0029	5008	,	,		17522	0.001		0.0	False		,,,				2504	0.0				p.S340S		.											.	FAM83C-92	0			c.G1020A						.	C		111,4295	81.4+/-119.9	2,107,2094	109.0	88.0	95.0		1020	-2.8	0.0	20	dbSNP_134	95	0,8600		0,0,4300	no	coding-synonymous	FAM83C	NM_178468.4		2,107,6394	TT,TC,CC		0.0,2.5193,0.8535		340/748	33875562	111,12895	2203	4300	6503	SO:0001819	synonymous_variant	128876	exon4			CAGGGACGACGTG	AL121753	CCDS13251.1	20q11.22	2011-04-01	2006-03-23	2006-03-23	ENSG00000125998	ENSG00000125998			16121	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 128"""	C20orf128			Standard	NM_178468		Approved	dJ614O4.7	uc021wck.1	Q9BQN1	OTTHUMG00000032332	ENST00000374408.3:c.1020G>A	20.37:g.33875562C>T		Somatic	237	3		WXS	Illumina GAIIx	Phase_I	289	9	NM_178468	0	0	0	0	0	Q14D67|Q5JWN6|Q8N276	Silent	SNP	ENST00000374408.3	37	CCDS13251.1																																																																																			C|0.992;T|0.008		0.642	FAM83C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078854.3		
ACTR5	79913	hgsc.bcm.edu	37	20	37377139	37377139	+	Silent	SNP	C	C	T	rs2254105	byFrequency	TCGA-OR-A5LF-01A-11D-A30A-10	TCGA-OR-A5LF-10A-01D-A30A-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2cf21c74-97c0-46f3-8e1a-197f9737b5b5	bcf5a948-3260-455b-b930-5cec0d656728	g.chr20:37377139C>T	ENST00000243903.4	+	1	55	c.18C>T	c.(16-18)ttC>ttT	p.F6F		NM_024855.3	NP_079131.3	Q9H9F9	ARP5_HUMAN	ARP5 actin-related protein 5 homolog (yeast)	6					DNA recombination (GO:0006310)|double-strand break repair (GO:0006302)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)|UV-damage excision repair (GO:0070914)	cytoplasm (GO:0005737)|Ino80 complex (GO:0031011)|nucleus (GO:0005634)				kidney(2)|large_intestine(2)|liver(1)|lung(5)|skin(2)	12		Myeloproliferative disorder(115;0.00878)				CGAACGTGTTCCCGTTCCGCG	0.756													C|||	1227	0.245008	0.205	0.2334	5008	,	,		10427	0.2679		0.2565	False		,,,				2504	0.272				p.F6F		.											.	ACTR5-90	0			c.C18T						.						3.0	4.0	4.0					20																	37377139		1470	2633	4103	SO:0001819	synonymous_variant	79913	exon1			CGTGTTCCCGTTC	AK022847	CCDS13308.1	20q12	2011-07-06	2001-11-28		ENSG00000101442	ENSG00000101442		"""INO80 complex subunits"""	14671	protein-coding gene	gene with protein product	"""INO80 complex subunit M"""		"""ARP5 (actin-related protein 5, yeast) homolog"""			16230350	Standard	NM_024855		Approved	FLJ12785, Arp5, INO80M	uc002xjd.2	Q9H9F9	OTTHUMG00000032456	ENST00000243903.4:c.18C>T	20.37:g.37377139C>T		Somatic	3	0		WXS	Illumina GAIIx	Phase_I	42	17	NM_024855	0	0	0	0	0	Q86WF7|Q8IUY5|Q8N724|Q9BRN0|Q9BVB7	Silent	SNP	ENST00000243903.4	37	CCDS13308.1																																																																																			C|0.769;T|0.231		0.756	ACTR5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079205.2	NM_024855	
SCARF2	91179	hgsc.bcm.edu	37	22	20780091	20780091	+	Silent	SNP	C	C	G	rs759610		TCGA-OR-A5LF-01A-11D-A30A-10	TCGA-OR-A5LF-10A-01D-A30A-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2cf21c74-97c0-46f3-8e1a-197f9737b5b5	bcf5a948-3260-455b-b930-5cec0d656728	g.chr22:20780091C>G	ENST00000266214.5	-	11	2291	c.2187G>C	c.(2185-2187)ccG>ccC	p.P729P	SCARF2_ENST00000405555.3_Silent_p.P724P	NM_153334.4	NP_699165.2	Q96GP6	SREC2_HUMAN	scavenger receptor class F, member 2	729	Pro-rich.				cell adhesion (GO:0007155)	focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)				breast(1)|central_nervous_system(1)|kidney(1)|large_intestine(1)|lung(3)|prostate(1)|skin(2)	10	Melanoma(16;0.000465)|Ovarian(15;0.00167)|Colorectal(54;0.0221)|all_neural(72;0.219)	Lung SC(17;0.0262)	LUSC - Lung squamous cell carcinoma(15;0.00102)|Lung(15;0.0173)			CGGGCAGCCCCGGGGGGCGCG	0.781																																					p.P729P		.											.	SCARF2-341	0			c.G2187C						.	G	,	3110,60		1525,60,0	4.0	5.0	4.0		2187,2172	-6.8	0.1	22	dbSNP_86	4	5974,118		2928,118,0	no	coding-synonymous,coding-synonymous	SCARF2	NM_153334.4,NM_182895.2	,	4453,178,0	GG,GC,CC		1.937,1.8927,1.9218	,	729/871,724/866	20780091	9084,178	1585	3046	4631	SO:0001819	synonymous_variant	91179	exon11			CAGCCCCGGGGGG	AF522196	CCDS13779.1, CCDS46666.1	22q11.21	2011-10-10			ENSG00000244486	ENSG00000244486			19869	protein-coding gene	gene with protein product		613619				12154095	Standard	XM_006724364		Approved	SREC-II, SREC2, HUMZD58C02	uc002zsk.2	Q96GP6	OTTHUMG00000150779	ENST00000266214.5:c.2187G>C	22.37:g.20780091C>G		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	28	26	NM_153334	0	0	0	0	0	E5RFB8|Q58A83|Q8IXF3|Q9BW74	Silent	SNP	ENST00000266214.5	37	CCDS13779.1																																																																																			C|0.138;G|0.862		0.781	SCARF2-001	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000320047.1		
MED15	51586	broad.mit.edu	37	22	20918916	20918918	+	In_Frame_Del	DEL	CAG	CAG	-	rs374794651		TCGA-OR-A5LF-01A-11D-A30A-10	TCGA-OR-A5LF-10A-01D-A30A-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2cf21c74-97c0-46f3-8e1a-197f9737b5b5	bcf5a948-3260-455b-b930-5cec0d656728	g.chr22:20918916_20918918delCAG	ENST00000263205.7	+	6	700_702	c.631_633delCAG	c.(631-633)cagdel	p.Q218del	MED15_ENST00000541476.1_In_Frame_Del_p.Q192del|MED15_ENST00000425759.2_In_Frame_Del_p.Q107del|MED15_ENST00000382974.2_In_Frame_Del_p.Q147del|MED15_ENST00000406969.1_In_Frame_Del_p.Q192del|MED15_ENST00000542773.1_In_Frame_Del_p.Q23del|MED15_ENST00000292733.7_In_Frame_Del_p.Q218del	NM_001003891.1	NP_001003891.1	Q96RN5	MED15_HUMAN	mediator complex subunit 15	218	Poly-Gln.			Missing (in Ref. 4; CAG30423). {ECO:0000305}.	gene expression (GO:0010467)|stem cell maintenance (GO:0019827)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cytoplasm (GO:0005737)|mediator complex (GO:0016592)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	RNA polymerase II transcription cofactor activity (GO:0001104)			central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(2)|lung(8)|ovary(1)|prostate(1)|skin(3)|urinary_tract(1)	25	all_cancers(11;2.07e-24)|Melanoma(16;0.000465)|Ovarian(15;0.00167)|Colorectal(54;0.0221)|all_neural(72;0.142)	Lung SC(17;0.0262)	LUSC - Lung squamous cell carcinoma(15;0.00102)|Lung(15;0.0173)|Epithelial(17;0.209)			gcagcagctccagcagcagcagc	0.567											OREG0026319	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.211_211del		.											.	MED15-211	0			c.631_633del						.																																			SO:0001651	inframe_deletion	51586	exon6			CAGCTCCAGCAGC	AF056191	CCDS13781.1, CCDS33602.1, CCDS74824.1	22q11.2	2007-07-30	2007-07-30	2007-07-30	ENSG00000099917	ENSG00000099917			14248	protein-coding gene	gene with protein product		607372	"""trinucleotide repeat containing 7"", ""PC2 (positive cofactor 2, multiprotein complex) glutamine/Q-rich-associated protein"""	TNRC7, PCQAP		11024300, 11414760, 15175163	Standard	XM_005261632		Approved	TIG-1, CAG7A, Arc105	uc002zsp.3	Q96RN5	OTTHUMG00000150810	ENST00000263205.7:c.631_633delCAG	22.37:g.20918925_20918927delCAG	ENSP00000263205:p.Gln218del	Somatic	180	0	744	WXS	Illumina GAIIx	Phase_I	156	7	NM_015889	0	0	0	0	0	D3DX31|D3DX32|O15413|Q6IC31|Q8NF16|Q96CT0|Q96IH7|Q9P1T3	In_Frame_Del	DEL	ENST00000263205.7	37	CCDS33602.1																																																																																			.		0.567	MED15-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000320177.2	NM_015889	
IGLV2-8	28817	bcgsc.ca	37	22	23165624	23165624	+	RNA	SNP	C	C	A			TCGA-OR-A5LF-01A-11D-A30A-10	TCGA-OR-A5LF-10A-01D-A30A-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2cf21c74-97c0-46f3-8e1a-197f9737b5b5	bcf5a948-3260-455b-b930-5cec0d656728	g.chr22:23165624C>A	ENST00000390317.2	+	0	357				MIR650_ENST00000385101.1_RNA					immunoglobulin lambda variable 2-8																		GCAAAGCCCCCAAACTCATGA	0.567																																					.		.											.	.	0			.						.						246.0	241.0	243.0					22																	23165624		1895	4100	5995			723778	.			AGCCCCCAAACTC	X97462		22q11.2	2012-02-08			ENSG00000211671	ENSG00000278196		"""Immunoglobulins / IGL locus"""	5895	other	immunoglobulin gene							Standard	NG_000002		Approved				OTTHUMG00000151240		22.37:g.23165624C>A		Somatic	207	2		WXS	Illumina GAIIx	Phase_I	193	48	.	0	0	0	0	0		RNA	SNP	ENST00000390317.2	37																																																																																				.		0.567	IGLV2-8-001	KNOWN	mRNA_end_NF|cds_end_NF|basic|appris_principal	IG_V_gene	IG_V_gene	OTTHUMT00000321845.1	NG_000002	
TMPRSS6	164656	bcgsc.ca	37	22	37485724	37485724	+	Missense_Mutation	SNP	T	T	C	rs2235324	byFrequency	TCGA-OR-A5LF-01A-11D-A30A-10	TCGA-OR-A5LF-10A-01D-A30A-10	T	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2cf21c74-97c0-46f3-8e1a-197f9737b5b5	bcf5a948-3260-455b-b930-5cec0d656728	g.chr22:37485724T>C	ENST00000346753.3	-	7	873	c.757A>G	c.(757-759)Aag>Gag	p.K253E	TMPRSS6_ENST00000406725.1_Missense_Mutation_p.K244E|TMPRSS6_ENST00000381792.2_Missense_Mutation_p.K244E|TMPRSS6_ENST00000442782.2_Missense_Mutation_p.K253E|TMPRSS6_ENST00000406856.1_Missense_Mutation_p.K244E	NM_153609.2	NP_705837.1	Q8IU80	TMPS6_HUMAN	transmembrane protease, serine 6	253	CUB 1. {ECO:0000255|PROSITE- ProRule:PRU00059}.		K -> E (in dbSNP:rs2235324). {ECO:0000269|PubMed:19818657, ECO:0000269|PubMed:21643693}.		angiogenesis (GO:0001525)|extracellular matrix organization (GO:0030198)|fibrinolysis (GO:0042730)|intracellular signal transduction (GO:0035556)|iron ion homeostasis (GO:0055072)|proteolysis (GO:0006508)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	serine-type endopeptidase activity (GO:0004252)			breast(5)|central_nervous_system(4)|endometrium(4)|kidney(4)|large_intestine(3)|lung(13)|ovary(1)|prostate(1)|skin(2)|stomach(3)	40						ATGAGGTCCTTGGGGCCCTGC	0.662													t|||	1955	0.390375	0.4009	0.3329	5008	,	,		15163	0.4008		0.4254	False		,,,				2504	0.3701				p.K253E		.											.	TMPRSS6-292	0			c.A757G						.	T	GLU/LYS	1871,2531		425,1021,755	23.0	23.0	23.0		757	-9.2	0.2	22	dbSNP_98	23	3280,5320		653,1974,1673	yes	missense	TMPRSS6	NM_153609.2	56	1078,2995,2428	CC,CT,TT		38.1395,42.5034,39.617	benign	253/812	37485724	5151,7851	2201	4300	6501	SO:0001583	missense	164656	exon7			GGTCCTTGGGGCC	AY055383	CCDS13941.1, CCDS74856.1, CCDS74857.1	22q13.1	2010-04-13			ENSG00000187045	ENSG00000187045		"""Serine peptidases / Transmembrane"""	16517	protein-coding gene	gene with protein product		609862					Standard	NM_001289000		Approved	FLJ30744	uc003aqs.1	Q8IU80	OTTHUMG00000150541	ENST00000346753.3:c.757A>G	22.37:g.37485724T>C	ENSP00000334962:p.Lys253Glu	Somatic	364	2		WXS	Illumina GAIIx	Phase_I	180	6	NM_153609	0	0	0	0	0	B0QYB4|B0QYB7|B0QYB8|Q5TI06|Q6ICC2|Q6UXD8|Q8IUE2|Q8IXV8	Missense_Mutation	SNP	ENST00000346753.3	37	CCDS13941.1	858	0.39285714285714285	181	0.3678861788617886	123	0.3397790055248619	243	0.42482517482517484	311	0.4102902374670185	t	0.181	-1.062264	0.01950	0.425034	0.381395	ENSG00000187045	ENST00000381792;ENST00000346753;ENST00000406725;ENST00000406856;ENST00000442782	T;T;T;T;T	0.57907	0.37;0.37;0.37;0.37;0.37	4.58	-9.17	0.00691	CUB (1);	1.449440	0.03793	N	0.263158	T	0.00012	0.0000	N	0.03608	-0.345	0.80722	P	0.0	B;B;B	0.06786	0.001;0.0;0.0	B;B;B	0.04013	0.001;0.0;0.0	T	0.21008	-1.0258	9	0.10377	T	0.69	.	9.1985	0.37242	0.0:0.1425:0.4878:0.3697	rs2235324;rs60936257;rs2235324	253;244;253	Q8IU80-2;Q8IU80-5;Q8IU80	.;.;TMPS6_HUMAN	E	244;253;244;244;253	ENSP00000371211:K244E;ENSP00000334962:K253E;ENSP00000385453:K244E;ENSP00000384964:K244E;ENSP00000397691:K253E	ENSP00000334962:K253E	K	-	1	0	TMPRSS6	35815670	0.000000	0.05858	0.167000	0.22817	0.530000	0.34684	-1.869000	0.01643	-1.242000	0.02523	-1.938000	0.00498	AAG	T|0.615;C|0.385		0.662	TMPRSS6-003	NOVEL	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000318822.1	NM_153609	
ATP6V1A	523	broad.mit.edu;bcgsc.ca	37	3	113528258	113528258	+	Missense_Mutation	SNP	G	G	A	rs140346248		TCGA-OR-A5LF-01A-11D-A30A-10	TCGA-OR-A5LF-10A-01D-A30A-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2cf21c74-97c0-46f3-8e1a-197f9737b5b5	bcf5a948-3260-455b-b930-5cec0d656728	g.chr3:113528258G>A	ENST00000273398.3	+	15	1946	c.1838G>A	c.(1837-1839)cGt>cAt	p.R613H	ATP6V1A_ENST00000461496.1_3'UTR|ATP6V1A_ENST00000538620.1_Missense_Mutation_p.R580H	NM_001690.3	NP_001681.2	P38606	VATA_HUMAN	ATPase, H+ transporting, lysosomal 70kDa, V1 subunit A	613					ATP hydrolysis coupled proton transport (GO:0015991)|cellular iron ion homeostasis (GO:0006879)|insulin receptor signaling pathway (GO:0008286)|interaction with host (GO:0051701)|phagosome maturation (GO:0090382)|transferrin transport (GO:0033572)|transmembrane transport (GO:0055085)|transport (GO:0006810)	apical plasma membrane (GO:0016324)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)|microvillus (GO:0005902)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)|proton-transporting two-sector ATPase complex (GO:0016469)|proton-transporting V-type ATPase, V1 domain (GO:0033180)	ATP binding (GO:0005524)|proton-transporting ATPase activity, rotational mechanism (GO:0046961)			breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(17)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	34					Alendronate(DB00630)|Etidronic acid(DB01077)|Tiludronate(DB01133)	AATGCATTCCGTAGCCTTGAA	0.393																																					p.R613H		.											.	ATP6V1A-93	0			c.G1838A						.						101.0	96.0	98.0					3																	113528258		2203	4300	6503	SO:0001583	missense	523	exon15			CATTCCGTAGCCT	L09235	CCDS2976.1	3q13.31	2010-04-21	2002-08-29	2003-04-25	ENSG00000114573	ENSG00000114573	3.6.3.14	"""ATPases / V-type"""	851	protein-coding gene	gene with protein product		607027	"""ATPase, H+ transporting, lysosomal (vacuolar proton pump), alpha polypeptide, 70kD, isoform 1"""	VPP2, ATP6A1, ATP6V1A1		8463241	Standard	NM_001690		Approved	Vma1, VA68	uc003eao.3	P38606	OTTHUMG00000159295	ENST00000273398.3:c.1838G>A	3.37:g.113528258G>A	ENSP00000273398:p.Arg613His	Somatic	285	0		WXS	Illumina GAIIx	Phase_I	271	10	NM_001690	0	0	0	0	0	B2RBR8|B7Z1R5|D3DN75|Q53YD9|Q96DY6|Q9UHY3	Missense_Mutation	SNP	ENST00000273398.3	37	CCDS2976.1	.	.	.	.	.	.	.	.	.	.	G	31	5.070508	0.93950	.	.	ENSG00000114573	ENST00000545842;ENST00000273398;ENST00000538620	T;T	0.78246	-1.16;-1.16	5.51	4.62	0.57501	ATPase, F1/V1/A1 complex, alpha/beta subunit, C-terminal (1);	0.102343	0.64402	D	0.000002	T	0.78616	0.4311	M	0.79614	2.46	0.80722	D	1	B	0.28350	0.208	B	0.30029	0.11	T	0.79654	-0.1713	10	0.59425	D	0.04	-10.803	14.7109	0.69232	0.0709:0.0:0.9291:0.0	.	613	P38606	VATA_HUMAN	H	330;613;580	ENSP00000273398:R613H;ENSP00000439874:R580H	ENSP00000273398:R613H	R	+	2	0	ATP6V1A	115010948	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	8.013000	0.88655	2.588000	0.87417	0.455000	0.32223	CGT	G|1.000;C|0.000		0.393	ATP6V1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354457.1	NM_001690	
ST6GAL1	6480	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	186793513	186793513	+	Silent	SNP	T	T	C			TCGA-OR-A5LF-01A-11D-A30A-10	TCGA-OR-A5LF-10A-01D-A30A-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2cf21c74-97c0-46f3-8e1a-197f9737b5b5	bcf5a948-3260-455b-b930-5cec0d656728	g.chr3:186793513T>C	ENST00000169298.3	+	8	1817	c.1143T>C	c.(1141-1143)caT>caC	p.H381H	ST6GAL1_ENST00000448044.1_Silent_p.H381H|ST6GAL1_ENST00000457772.2_Silent_p.H150H	NM_173216.2	NP_775323.1	P15907	SIAT1_HUMAN	ST6 beta-galactosamide alpha-2,6-sialyltranferase 1	381					cellular protein metabolic process (GO:0044267)|humoral immune response (GO:0006959)|N-acetylneuraminate metabolic process (GO:0006054)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)|sialylation (GO:0097503)	extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|integral component of Golgi membrane (GO:0030173)	beta-galactoside alpha-2,6-sialyltransferase activity (GO:0003835)|sialyltransferase activity (GO:0008373)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(2)|upper_aerodigestive_tract(1)	7	all_cancers(143;2.33e-12)|Ovarian(172;0.0339)		OV - Ovarian serous cystadenocarcinoma(80;8.53e-19)	GBM - Glioblastoma multiforme(93;0.0939)		TGGTGAAGCATCTCAACCAGG	0.527																																					p.H381H		.											.	ST6GAL1-650	0			c.T1143C						.						94.0	89.0	91.0					3																	186793513		2203	4300	6503	SO:0001819	synonymous_variant	6480	exon7			GAAGCATCTCAAC	X62822	CCDS3285.1, CCDS46973.1	3q27-q28	2013-02-26	2003-01-14	2005-02-07	ENSG00000073849	ENSG00000073849	2.4.99.1		10860	protein-coding gene	gene with protein product	"""ST6Gal I"""	109675	"""sialyltransferase 1 (beta-galactoside alpha-2,6-sialytransferase)"""	SIAT1		2408023	Standard	NM_003032		Approved		uc003frd.3	P15907	OTTHUMG00000156500	ENST00000169298.3:c.1143T>C	3.37:g.186793513T>C		Somatic	89	0		WXS	Illumina GAIIx	Phase_I	87	28	NM_003032	0	0	0	0	0	A8KA14|B2R513|D3DNV3	Silent	SNP	ENST00000169298.3	37	CCDS3285.1																																																																																			.		0.527	ST6GAL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344399.1	NM_173216	
CRIPAK	285464	bcgsc.ca	37	4	1388819	1388819	+	Missense_Mutation	SNP	T	T	C	rs144797159	byFrequency	TCGA-OR-A5LF-01A-11D-A30A-10	TCGA-OR-A5LF-10A-01D-A30A-10	T	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2cf21c74-97c0-46f3-8e1a-197f9737b5b5	bcf5a948-3260-455b-b930-5cec0d656728	g.chr4:1388819T>C	ENST00000324803.4	+	1	3480	c.520T>C	c.(520-522)Tgt>Cgt	p.C174R		NM_175918.3	NP_787114.2	Q8N1N5	CRPAK_HUMAN	cysteine-rich PAK1 inhibitor	174					negative regulation of intracellular estrogen receptor signaling pathway (GO:0033147)|negative regulation of protein kinase activity (GO:0006469)|regulation of cytoskeleton organization (GO:0051493)|response to estrogen (GO:0043627)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				NS(3)|breast(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(11)|ovary(1)|pancreas(2)|prostate(6)|skin(4)|urinary_tract(1)	35			OV - Ovarian serous cystadenocarcinoma(23;0.0106)			CACGTGCCCATGTGGAGTGCC	0.677													N|||	940	0.1877	0.3328	0.1398	5008	,	,		17297	0.0992		0.0378	False		,,,				2504	0.271				p.C174R		.											.	CRIPAK-90	0			c.T520C						.						191.0	130.0	151.0					4																	1388819		2194	4196	6390	SO:0001583	missense	285464	exon1			TGCCCATGTGGAG	AK096209	CCDS3349.1	4p16.3	2011-02-10	2006-09-04		ENSG00000179979	ENSG00000179979			26619	protein-coding gene	gene with protein product		610203	"""cysteine-rich PAK1inhibitor"""			16278681	Standard	NM_175918		Approved	FLJ34443	uc003gdf.2	Q8N1N5	OTTHUMG00000121131	ENST00000324803.4:c.520T>C	4.37:g.1388819T>C	ENSP00000323978:p.Cys174Arg	Somatic	30	1		WXS	Illumina GAIIx	Phase_I	271	35	NM_175918	0	0	0	0	0	Q8NB03	Missense_Mutation	SNP	ENST00000324803.4	37	CCDS3349.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	t|t	2.950|2.950	-0.216975|-0.216975	0.06101|0.06101	.|.	.|.	ENSG00000179979|ENSG00000179979	ENST00000324803|ENST00000382944	T|.	0.29142|.	1.58|.	1.25|1.25	-0.146|-0.146	0.13432|0.13432	Post-SET domain (1);|.	.|.	.|.	.|.	.|.	T|T	0.15825|0.15825	0.0381|0.0381	N|N	0.08118|0.08118	0|0	0.09310|0.09310	N|N	1|1	B|.	0.20052|.	0.041|.	B|.	0.11329|.	0.006|.	T|T	0.24977|0.24977	-1.0145|-1.0145	9|6	0.66056|0.27082	D|T	0.02|0.32	.|.	4.6847|4.6847	0.12752|0.12752	0.0:0.2124:0.0:0.7876|0.0:0.2124:0.0:0.7876	.|.	174|.	Q8N1N5|.	CRPAK_HUMAN|.	R|T	174|157	ENSP00000323978:C174R|.	ENSP00000323978:C174R|ENSP00000372402:M157T	C|M	+|+	1|2	0|0	CRIPAK|CRIPAK	1378819|1378819	0.000000|0.000000	0.05858|0.05858	0.003000|0.003000	0.11579|0.11579	0.014000|0.014000	0.08584|0.08584	-0.160000|-0.160000	0.10041|0.10041	-0.013000|-0.013000	0.14199|0.14199	0.102000|0.102000	0.15555|0.15555	TGT|ATG	T|0.950;C|0.050		0.677	CRIPAK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000241607.2	NM_175918	
CRMP1	1400	hgsc.bcm.edu	37	4	5894586	5894586	+	Silent	SNP	G	G	A	rs143304363	byFrequency	TCGA-OR-A5LF-01A-11D-A30A-10	TCGA-OR-A5LF-10A-01D-A30A-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2cf21c74-97c0-46f3-8e1a-197f9737b5b5	bcf5a948-3260-455b-b930-5cec0d656728	g.chr4:5894586G>A	ENST00000324989.7	-	1	199	c.111C>T	c.(109-111)gcC>gcT	p.A37A	CRMP1_ENST00000512574.1_5'Flank	NM_001014809.1	NP_001014809.1	Q14194	DPYL1_HUMAN	collapsin response mediator protein 1	0					axon guidance (GO:0007411)|nervous system development (GO:0007399)|nucleobase-containing compound metabolic process (GO:0006139)|pyrimidine nucleobase catabolic process (GO:0006208)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dendrite (GO:0030425)|neuronal cell body (GO:0043025)	hydrolase activity, acting on carbon-nitrogen (but not peptide) bonds, in cyclic amides (GO:0016812)			NS(1)|cervix(2)|endometrium(4)|large_intestine(10)|lung(11)|ovary(2)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	36				Colorectal(103;0.0721)		CCTCCACCGCGGCGAACATGC	0.756													G|||	277	0.0553115	0.0076	0.0461	5008	,	,		4031	0.0437		0.0805	False		,,,				2504	0.1125				p.A37A		.											.	CRMP1-92	0			c.C111T						.	G		56,3324		2,52,1636	4.0	4.0	4.0		111	0.2	1.0	4	dbSNP_134	4	409,6095		9,391,2852	no	coding-synonymous	CRMP1	NM_001014809.1		11,443,4488	AA,AG,GG		6.2884,1.6568,4.7046		37/687	5894586	465,9419	1690	3252	4942	SO:0001819	synonymous_variant	1400	exon1			CACCGCGGCGAAC	D78012	CCDS33950.1, CCDS43207.1, CCDS75102.1	4p16.1	2008-05-15			ENSG00000072832	ENSG00000072832			2365	protein-coding gene	gene with protein product		602462				8973361	Standard	XM_005247940		Approved	DRP-1, DPYSL1	uc003gis.3	Q14194	OTTHUMG00000125489	ENST00000324989.7:c.111C>T	4.37:g.5894586G>A		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	35	12	NM_001014809	0	0	0	0	0	A0EJG6|Q13024|Q4W5F1|Q96TC8	Silent	SNP	ENST00000324989.7	37	CCDS33950.1																																																																																			G|0.946;A|0.054		0.756	CRMP1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000246814.2	NM_001313	
RBM47	54502	hgsc.bcm.edu	37	4	40440854	40440854	+	Silent	SNP	G	G	C	rs1052153	byFrequency	TCGA-OR-A5LF-01A-11D-A30A-10	TCGA-OR-A5LF-10A-01D-A30A-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2cf21c74-97c0-46f3-8e1a-197f9737b5b5	bcf5a948-3260-455b-b930-5cec0d656728	g.chr4:40440854G>C	ENST00000381793.2	-	3	453	c.57C>G	c.(55-57)tcC>tcG	p.S19S	RBM47_ENST00000515809.1_Intron|RBM47_ENST00000514014.1_Intron|RBM47_ENST00000319592.4_Silent_p.S19S|RBM47_ENST00000381795.6_Silent_p.S19S|RBM47_ENST00000295971.7_Silent_p.S19S			A0AV96	RBM47_HUMAN	RNA binding motif protein 47	19					hematopoietic progenitor cell differentiation (GO:0002244)	nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			breast(5)|endometrium(1)|kidney(3)|large_intestine(2)|lung(9)|ovary(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(1)	29						GCACCTTGGCGGAGGACCCGG	0.662													C|||	4016	0.801917	0.6808	0.8588	5008	,	,		14653	0.7679		0.8837	False		,,,				2504	0.8763				p.S19S		.											.	RBM47-25	0			c.C57G						.	C	,	3111,1133		1151,809,162	8.0	9.0	9.0		57,57	-7.6	0.0	4	dbSNP_86	9	7487,919		3358,771,74	no	coding-synonymous,coding-synonymous	RBM47	NM_001098634.1,NM_019027.3	,	4509,1580,236	CC,CG,GG		10.9327,26.6965,16.2213	,	19/594,19/525	40440854	10598,2052	2122	4203	6325	SO:0001819	synonymous_variant	54502	exon4			CTTGGCGGAGGAC	AK000280	CCDS3460.1, CCDS43223.1	4p14	2013-02-12			ENSG00000163694	ENSG00000163694		"""RNA binding motif (RRM) containing"""	30358	protein-coding gene	gene with protein product							Standard	NM_019027		Approved	FLJ20273, NET18	uc003gvc.2	A0AV96	OTTHUMG00000128598	ENST00000381793.2:c.57C>G	4.37:g.40440854G>C		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	11	11	NM_001098634	0	0	0	0	0	A0PJK2|B5MED4|Q8NI52|Q8NI53|Q9NXG3	Silent	SNP	ENST00000381793.2	37	CCDS43223.1																																																																																			G|0.794;C|0.206		0.662	RBM47-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250456.2	NM_019027	
TMPRSS11F	389208	bcgsc.ca;mdanderson.org	37	4	68928345	68928345	+	Intron	SNP	C	C	T			TCGA-OR-A5LF-01A-11D-A30A-10	TCGA-OR-A5LF-10A-01D-A30A-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2cf21c74-97c0-46f3-8e1a-197f9737b5b5	bcf5a948-3260-455b-b930-5cec0d656728	g.chr4:68928345C>T	ENST00000356291.2	-	8	1075				UBA6-AS1_ENST00000500538.2_RNA|UBA6-AS1_ENST00000511571.1_RNA|RP11-35D5.1_ENST00000600441.1_RNA|UBA6-AS1_ENST00000499180.2_RNA	NM_207407.2	NP_997290.2	Q6ZWK6	TM11F_HUMAN	transmembrane protease, serine 11F							extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	serine-type endopeptidase activity (GO:0004252)			NS(1)|breast(1)|endometrium(2)|kidney(2)|large_intestine(7)|liver(1)|lung(18)|ovary(1)|pancreas(1)|prostate(1)|urinary_tract(4)	39						GAGTTCTTCTCCAGAGCTGTT	0.418																																					.		.											.	.	0			.						.						165.0	160.0	162.0					4																	68928345		2203	4300	6503	SO:0001627	intron_variant	0	.			TCTTCTCCAGAGC	AK122625	CCDS3520.1	4q13.2	2010-04-13			ENSG00000198092	ENSG00000198092		"""Serine peptidases / Transmembrane"""	29994	protein-coding gene	gene with protein product							Standard	NM_207407		Approved	FLJ16046	uc003hdt.1	Q6ZWK6	OTTHUMG00000129307	ENST00000356291.2:c.1015+2057G>A	4.37:g.68928345C>T		Somatic	113	0		WXS	Illumina GAIIx	Phase_I	146	59	.	0	0	0	0	0	A8MXX2	RNA	SNP	ENST00000356291.2	37	CCDS3520.1																																																																																			.		0.418	TMPRSS11F-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251439.1	NM_207407	
SHROOM3	57619	hgsc.bcm.edu	37	4	77662248	77662248	+	Silent	SNP	G	G	A	rs344142	byFrequency	TCGA-OR-A5LF-01A-11D-A30A-10	TCGA-OR-A5LF-10A-01D-A30A-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2cf21c74-97c0-46f3-8e1a-197f9737b5b5	bcf5a948-3260-455b-b930-5cec0d656728	g.chr4:77662248G>A	ENST00000296043.6	+	5	3875	c.2922G>A	c.(2920-2922)tcG>tcA	p.S974S		NM_020859.3	NP_065910.3	Q8TF72	SHRM3_HUMAN	shroom family member 3	974	ASD1. {ECO:0000255|PROSITE- ProRule:PRU00637}.				actin cytoskeleton organization (GO:0030036)|apical protein localization (GO:0045176)|cell morphogenesis (GO:0000902)|cellular pigment accumulation (GO:0043482)|columnar/cuboidal epithelial cell development (GO:0002066)|neural tube closure (GO:0001843)|pattern specification process (GO:0007389)|regulation of cell shape (GO:0008360)	adherens junction (GO:0005912)|apical junction complex (GO:0043296)|apical plasma membrane (GO:0016324)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|microtubule (GO:0005874)				NS(3)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(10)|kidney(2)|large_intestine(6)|lung(29)|ovary(1)|skin(5)|upper_aerodigestive_tract(1)	60			Lung(101;0.0903)			CCGAGGCGTCGGCCTCCGCCT	0.776													G|||	2165	0.432308	0.4054	0.4827	5008	,	,		9965	0.2669		0.6044	False		,,,				2504	0.4264				p.S974S		.											.	SHROOM3-93	0			c.G2922A						.	G		1740,1410		550,640,385	2.0	3.0	3.0		2922	0.4	0.0	4	dbSNP_129	3	4503,2047		1663,1177,435	no	coding-synonymous	SHROOM3	NM_020859.3		2213,1817,820	AA,AG,GG		31.2519,44.7619,35.6392		974/1997	77662248	6243,3457	1575	3275	4850	SO:0001819	synonymous_variant	57619	exon5			GGCGTCGGCCTCC	AB055660	CCDS3579.2	4q21.1	2009-11-25			ENSG00000138771	ENSG00000138771			30422	protein-coding gene	gene with protein product		604570				10589677, 16615870	Standard	NM_020859		Approved	ShrmL, SHRM, KIAA1481, APXL3	uc011cbx.2	Q8TF72	OTTHUMG00000157075	ENST00000296043.6:c.2922G>A	4.37:g.77662248G>A		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	25	25	NM_020859	0	0	0	0	0	Q5QTQ3|Q6ZRW3|Q96IR9|Q9P247	Silent	SNP	ENST00000296043.6	37	CCDS3579.2																																																																																			G|0.531;A|0.469		0.776	SHROOM3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252408.2	NM_020859	
C4orf32	132720	hgsc.bcm.edu	37	4	113066831	113066831	+	Missense_Mutation	SNP	G	G	A	rs10002700	byFrequency	TCGA-OR-A5LF-01A-11D-A30A-10	TCGA-OR-A5LF-10A-01D-A30A-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2cf21c74-97c0-46f3-8e1a-197f9737b5b5	bcf5a948-3260-455b-b930-5cec0d656728	g.chr4:113066831G>A	ENST00000309733.5	+	1	279	c.95G>A	c.(94-96)gGg>gAg	p.G32E		NM_152400.2	NP_689613.1	Q8N8J7	CD032_HUMAN	chromosome 4 open reading frame 32	32				G -> E (in Ref. 1; BAC04841 and 3; AAH22534). {ECO:0000305}.		integral component of membrane (GO:0016021)							Ovarian(17;0.156)		OV - Ovarian serous cystadenocarcinoma(123;0.00198)		gcagggaccgggtgggatccc	0.806													A|||	5004	0.999201	1.0	1.0	5008	,	,		5782	1.0		0.996	False		,,,				2504	1.0				p.G32E		.											.	C4orf32-90	0			c.G95A						.	A	GLU/GLY	2990,0		1495,0,0	3.0	5.0	4.0		95	2.0	0.1	4	dbSNP_119	4	6170,26		3072,26,0	no	missense	C4orf32	NM_152400.2	98	4567,26,0	AA,AG,GG		0.4196,0.0,0.283	benign	32/133	113066831	9160,26	1495	3098	4593	SO:0001583	missense	132720	exon1			GGACCGGGTGGGA	AK096689	CCDS3695.1	4q25	2008-02-05			ENSG00000174749	ENSG00000174749			26813	protein-coding gene	gene with protein product						12477932	Standard	NM_152400		Approved	FLJ39370	uc003iah.2	Q8N8J7	OTTHUMG00000132851	ENST00000309733.5:c.95G>A	4.37:g.113066831G>A	ENSP00000310182:p.Gly32Glu	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	11	11	NM_152400	0	0	0	0	0	Q49A91|Q4W5C7|Q8TBF9	Missense_Mutation	SNP	ENST00000309733.5	37	CCDS3695.1	2136	0.978021978021978	469	0.9532520325203252	355	0.9806629834254144	563	0.9842657342657343	749	0.9881266490765171	A	0.015	-1.569980	0.00895	1.0	0.995804	ENSG00000174749	ENST00000309733	T	0.42513	0.97	3.18	2.02	0.26589	.	0.619595	0.14277	N	0.329768	T	0.00012	0.0000	N	0.00538	-1.39	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.32561	-0.9902	9	0.02654	T	1	-1.079	4.6216	0.12455	0.712:0.0:0.288:0.0	rs10002700;rs17845705;rs17858649	32	Q8N8J7	CD032_HUMAN	E	32	ENSP00000310182:G32E	ENSP00000310182:G32E	G	+	2	0	C4orf32	113286280	0.547000	0.26465	0.070000	0.20053	0.008000	0.06430	0.688000	0.25422	0.414000	0.25790	-0.893000	0.02921	GGG	G|0.022;A|0.978		0.806	C4orf32-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256325.2	NM_152400	
LRRC14B	389257	hgsc.bcm.edu	37	5	191992	191992	+	Silent	SNP	G	G	A	rs34710524	byFrequency	TCGA-OR-A5LF-01A-11D-A30A-10	TCGA-OR-A5LF-10A-01D-A30A-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2cf21c74-97c0-46f3-8e1a-197f9737b5b5	bcf5a948-3260-455b-b930-5cec0d656728	g.chr5:191992G>A	ENST00000328278.3	+	1	367	c.339G>A	c.(337-339)acG>acA	p.T113T		NM_001080478.1	NP_001073947.1	A6NHZ5	LR14B_HUMAN	leucine rich repeat containing 14B	113										endometrium(1)|kidney(1)|large_intestine(1)|lung(4)|skin(1)|upper_aerodigestive_tract(2)	10						CTGACCTCACGGGCATCCGAG	0.741													G|||	110	0.0219649	0.0023	0.0346	5008	,	,		13465	0.0		0.0746	False		,,,				2504	0.0082				p.T113T		.											.	LRRC14B-69	0			c.G339A						.	G		35,2869		0,35,1417	2.0	3.0	2.0		339	-10.1	0.0	5	dbSNP_126	2	366,5908		2,362,2773	no	coding-synonymous	LRRC14B	NM_001080478.1		2,397,4190	AA,AG,GG		5.8336,1.2052,4.3691		113/515	191992	401,8777	1452	3137	4589	SO:0001819	synonymous_variant	389257	exon1			CCTCACGGGCATC		CCDS47184.1	5p15.33	2010-02-17			ENSG00000185028	ENSG00000185028			37268	protein-coding gene	gene with protein product							Standard	NM_001080478		Approved		uc003jal.1	A6NHZ5	OTTHUMG00000161578	ENST00000328278.3:c.339G>A	5.37:g.191992G>A		Somatic	1	0		WXS	Illumina GAIIx	Phase_I	18	17	NM_001080478	0	0	0	0	0		Silent	SNP	ENST00000328278.3	37	CCDS47184.1																																																																																			G|0.975;A|0.025		0.741	LRRC14B-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000365393.2	NM_001080478	
IRX4	50805	hgsc.bcm.edu	37	5	1882129	1882129	+	Silent	SNP	T	T	G	rs2232374	byFrequency	TCGA-OR-A5LF-01A-11D-A30A-10	TCGA-OR-A5LF-10A-01D-A30A-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2cf21c74-97c0-46f3-8e1a-197f9737b5b5	bcf5a948-3260-455b-b930-5cec0d656728	g.chr5:1882129T>G	ENST00000505790.1	-	3	546	c.90A>C	c.(88-90)ggA>ggC	p.G30G	IRX4_ENST00000505938.1_5'Flank|IRX4_ENST00000231357.2_Silent_p.G30G|CTD-2194D22.3_ENST00000506335.1_RNA|IRX4_ENST00000513692.1_Silent_p.G30G	NM_001278634.1	NP_001265563.1	P78413	IRX4_HUMAN	iroquois homeobox 4	30					establishment of organ orientation (GO:0048561)|heart development (GO:0007507)|regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)			endometrium(1)|lung(7)|ovary(1)|prostate(1)	10				GBM - Glioblastoma multiforme(108;0.242)		GCGTGCGGCCTCCGGACTCGC	0.741													N|||	1389	0.277356	0.2821	0.3141	5008	,	,		10764	0.3313		0.2177	False		,,,				2504	0.2505				p.G30G		.											.	IRX4-226	0			c.A90C						.			440,2456		29,382,1037	2.0	2.0	2.0		90	-2.3	0.0	5	dbSNP_98	2	967,5425		81,805,2310	no	coding-synonymous	IRX4	NM_016358.2		110,1187,3347	GG,GT,TT		15.1283,15.1934,15.1486		30/520	1882129	1407,7881	1448	3196	4644	SO:0001819	synonymous_variant	50805	exon2			GCGGCCTCCGGAC	AF124733	CCDS3867.1, CCDS75225.1	5p15.33	2011-06-20	2007-07-13		ENSG00000113430	ENSG00000113430		"""Homeoboxes / TALE class"""	6129	protein-coding gene	gene with protein product		606199	"""iroquois homeobox protein 4"""			10625552	Standard	NM_016358		Approved		uc003jcz.2	P78413	OTTHUMG00000090411	ENST00000505790.1:c.90A>C	5.37:g.1882129T>G		Somatic	2	0		WXS	Illumina GAIIx	Phase_I	19	8	NM_016358	0	0	0	0	0	B2RMW5|D3DTC5|H1AFL0|H1AFL1|Q2NL64|Q9UHR2	Silent	SNP	ENST00000505790.1	37	CCDS3867.1																																																																																			T|0.735;G|0.265		0.741	IRX4-004	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365500.1	NM_016358	
NSUN2	54888	hgsc.bcm.edu	37	5	6633042	6633042	+	Silent	SNP	C	C	T	rs10062086	byFrequency	TCGA-OR-A5LF-01A-11D-A30A-10	TCGA-OR-A5LF-10A-01D-A30A-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2cf21c74-97c0-46f3-8e1a-197f9737b5b5	bcf5a948-3260-455b-b930-5cec0d656728	g.chr5:6633042C>T	ENST00000264670.6	-	1	362	c.51G>A	c.(49-51)gaG>gaA	p.E17E	SRD5A1_ENST00000537411.1_5'Flank|SRD5A1_ENST00000274192.5_5'Flank|SRD5A1_ENST00000538824.1_5'Flank|NSUN2_ENST00000539938.1_5'UTR|NSUN2_ENST00000506139.1_Silent_p.E17E	NM_017755.5	NP_060225.4	Q08J23	NSUN2_HUMAN	NOP2/Sun RNA methyltransferase family, member 2	17					mitotic nuclear division (GO:0007067)|tRNA methylation (GO:0030488)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleolus (GO:0005730)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|tRNA (cytosine-5-)-methyltransferase activity (GO:0016428)|tRNA binding (GO:0000049)			breast(1)|endometrium(6)|kidney(2)|large_intestine(5)|lung(23)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	41						CCTCCGCGTCCTCCGGCCGCT	0.781													C|||	1385	0.276558	0.2829	0.3905	5008	,	,		9693	0.1587		0.3917	False		,,,				2504	0.1902				p.E17E		.											.	NSUN2-91	0			c.G51A						.						2.0	3.0	2.0					5																	6633042		1293	2804	4097	SO:0001819	synonymous_variant	54888	exon1			CGCGTCCTCCGGC	AK000310	CCDS3869.1, CCDS54832.1	5p15.32	2014-01-31	2012-06-12		ENSG00000037474	ENSG00000037474		"""NOP2/Sun domain containing"""	25994	protein-coding gene	gene with protein product	"""tRNA methyltransferase 4 homolog (S. cerevisiae)"", ""Myc-induced SUN-domain-containing protein"""	610916	"""NOL1/NOP2/Sun domain family, member 2"", ""NOP2/Sun domain family, member 2"", ""mental retardation, non-syndromic, autosomal recessive, 5"""	MRT5		17071714, 22541559	Standard	NM_017755		Approved	FLJ20303, TRM4, Misu	uc003jdu.3	Q08J23	OTTHUMG00000090455	ENST00000264670.6:c.51G>A	5.37:g.6633042C>T		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	10	10	NM_017755	0	0	0	0	0	A8K529|B2RNR4|B3KP09|B4DQW2|G3V1R4|Q9BVN4|Q9H858|Q9NXD9	Silent	SNP	ENST00000264670.6	37	CCDS3869.1																																																																																			C|0.687;T|0.313		0.781	NSUN2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000206902.1	NM_017755	
PROB1	389333	hgsc.bcm.edu	37	5	138730037	138730037	+	Missense_Mutation	SNP	T	T	C	rs11748963	byFrequency	TCGA-OR-A5LF-01A-11D-A30A-10	TCGA-OR-A5LF-10A-01D-A30A-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2cf21c74-97c0-46f3-8e1a-197f9737b5b5	bcf5a948-3260-455b-b930-5cec0d656728	g.chr5:138730037T>C	ENST00000434752.2	-	1	848	c.734A>G	c.(733-735)cAg>cGg	p.Q245R		NM_001161546.1	NP_001155018.1	E7EW31	PROB1_HUMAN	proline-rich basic protein 1	245																	CGCGGCGGCCTGCAGGGGGCC	0.781													T|||	1773	0.354034	0.146	0.2839	5008	,	,		10752	0.6151		0.3042	False		,,,				2504	0.4673				p.Q245R		.											.	.	0			c.A734G						.						5.0	7.0	6.0					5																	138730037		671	1537	2208	SO:0001583	missense	389333	exon1			GCGGCCTGCAGGG	AK316483	CCDS54909.1	5q31.2	2012-10-01	2012-10-01	2012-10-01	ENSG00000228672	ENSG00000228672			41906	protein-coding gene	gene with protein product			"""chromosome 5 open reading frame 65"""	C5orf65			Standard	NM_001161546		Approved		uc011czc.1	E7EW31		ENST00000434752.2:c.734A>G	5.37:g.138730037T>C	ENSP00000416033:p.Gln245Arg	Somatic	1	0		WXS	Illumina GAIIx	Phase_I	22	9	NM_001161546	0	0	0	0	0	B4E007	Missense_Mutation	SNP	ENST00000434752.2	37	CCDS54909.1	803	0.3676739926739927	105	0.21341463414634146	108	0.2983425414364641	366	0.6398601398601399	224	0.2955145118733509	T	21.8	4.205823	0.79127	.	.	ENSG00000228672	ENST00000434752	.	.	.	4.26	4.26	0.50523	.	.	.	.	.	T	0.00012	0.0000	L	0.36672	1.1	0.33628	P	0.39427599999999996	D	0.76494	0.999	D	0.83275	0.996	T	0.45483	-0.9258	7	0.52906	T	0.07	.	11.6588	0.51334	0.0:0.0:0.0:1.0	rs11748963	245	E7EW31	CE065_HUMAN	R	245	.	ENSP00000416033:Q245R	Q	-	2	0	AC135457.1	138757936	0.990000	0.36364	0.998000	0.56505	0.770000	0.43624	2.116000	0.41930	1.919000	0.55581	0.459000	0.35465	CAG	T|0.632;C|0.368		0.781	PROB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000470735.1	NM_001161546	
GABRA6	2559	broad.mit.edu	37	5	161128694	161128694	+	Missense_Mutation	SNP	C	C	G	rs150186322		TCGA-OR-A5LF-01A-11D-A30A-10	TCGA-OR-A5LF-10A-01D-A30A-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2cf21c74-97c0-46f3-8e1a-197f9737b5b5	bcf5a948-3260-455b-b930-5cec0d656728	g.chr5:161128694C>G	ENST00000274545.5	+	9	1710	c.1277C>G	c.(1276-1278)cCa>cGa	p.P426R	GABRA6_ENST00000523217.1_Missense_Mutation_p.P416R			Q16445	GBRA6_HUMAN	gamma-aminobutyric acid (GABA) A receptor, alpha 6	426					gamma-aminobutyric acid signaling pathway (GO:0007214)|ion transmembrane transport (GO:0034220)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|transport (GO:0006810)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	benzodiazepine receptor activity (GO:0008503)|chloride channel activity (GO:0005254)|extracellular ligand-gated ion channel activity (GO:0005230)|GABA-A receptor activity (GO:0004890)			breast(1)|central_nervous_system(2)|endometrium(6)|large_intestine(9)|liver(2)|lung(22)|ovary(7)|skin(6)|urinary_tract(2)	57	Renal(175;0.00259)	Medulloblastoma(196;0.0208)|all_neural(177;0.0672)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)		Acamprosate(DB00659)|Alprazolam(DB00404)|Amobarbital(DB01351)|Amoxapine(DB00543)|Aprobarbital(DB01352)|Bromazepam(DB01558)|Butabarbital(DB00237)|Butalbital(DB00241)|Butethal(DB01353)|Chlordiazepoxide(DB00475)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ergoloid mesylate(DB01049)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Flumazenil(DB01205)|Flunitrazepam(DB01544)|Flurazepam(DB00690)|Glutethimide(DB01437)|Halazepam(DB00801)|Halothane(DB01159)|Heptabarbital(DB01354)|Hexobarbital(DB01355)|Isoflurane(DB00753)|Lorazepam(DB00186)|Meprobamate(DB00371)|Methoxyflurane(DB01028)|Methylphenobarbital(DB00849)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Olanzapine(DB00334)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Prazepam(DB01588)|Primidone(DB00794)|Propofol(DB00818)|Quazepam(DB01589)|Secobarbital(DB00418)|Sevoflurane(DB01236)|Talbutal(DB00306)|Temazepam(DB00231)|Thiopental(DB00599)|Topiramate(DB00273)|Triazolam(DB00897)	ATTCTCTTCCCAGTTGCATTT	0.473										TCGA Ovarian(5;0.080)																											p.P426R		.											.	GABRA6-163	0			c.C1277G						.	C	ARG/PRO	0,4406		0,0,2203	132.0	119.0	123.0		1277	5.2	1.0	5	dbSNP_134	123	2,8598	2.2+/-6.3	0,2,4298	yes	missense	GABRA6	NM_000811.2	103	0,2,6501	GG,GC,CC		0.0233,0.0,0.0154	probably-damaging	426/454	161128694	2,13004	2203	4300	6503	SO:0001583	missense	2559	exon9			TCTTCCCAGTTGC		CCDS4356.1	5q34	2012-06-22			ENSG00000145863	ENSG00000145863		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	4080	protein-coding gene	gene with protein product	"""GABA(A) receptor, alpha 6"""	137143				8020978	Standard	NM_000811		Approved		uc003lyu.2	Q16445	OTTHUMG00000130351	ENST00000274545.5:c.1277C>G	5.37:g.161128694C>G	ENSP00000274545:p.Pro426Arg	Somatic	169	1		WXS	Illumina GAIIx	Phase_I	228	6	NM_000811	0	0	0	0	0	A8K096|Q4VAV2	Missense_Mutation	SNP	ENST00000274545.5	37	CCDS4356.1	.	.	.	.	.	.	.	.	.	.	C	24.7	4.558399	0.86231	0.0	2.33E-4	ENSG00000145863	ENST00000274545;ENST00000523217	D;D	0.86366	-2.11;-2.11	5.16	5.16	0.70880	Neurotransmitter-gated ion-channel transmembrane domain (1);	0.000000	0.85682	D	0.000000	D	0.95443	0.8520	M	0.93638	3.44	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.96400	0.9296	10	0.87932	D	0	.	19.013	0.92881	0.0:1.0:0.0:0.0	.	426	Q16445	GBRA6_HUMAN	R	426;416	ENSP00000274545:P426R;ENSP00000430527:P416R	ENSP00000274545:P426R	P	+	2	0	GABRA6	161061272	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.684000	0.84104	2.571000	0.86741	0.655000	0.94253	CCA	C|1.000;G|0.000		0.473	GABRA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252707.2		
PPP1R3G	648791	hgsc.bcm.edu	37	6	5086211	5086211	+	Silent	SNP	G	G	C	rs584962		TCGA-OR-A5LF-01A-11D-A30A-10	TCGA-OR-A5LF-10A-01D-A30A-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2cf21c74-97c0-46f3-8e1a-197f9737b5b5	bcf5a948-3260-455b-b930-5cec0d656728	g.chr6:5086211G>C	ENST00000405617.2	+	1	492	c.492G>C	c.(490-492)ctG>ctC	p.L164L		NM_001145115.1	NP_001138587.1	B7ZBB8	PP13G_HUMAN	protein phosphatase 1, regulatory subunit 3G	164					glucose homeostasis (GO:0042593)|positive regulation of glycogen (starch) synthase activity (GO:2000467)|positive regulation of glycogen biosynthetic process (GO:0045725)	cytoplasm (GO:0005737)	glycogen binding (GO:2001069)			kidney(2)	2						TCTCGCGCCTGCGAAGCTTCC	0.736													C|||	5008	1.0	1.0	1.0	5008	,	,		12118	1.0		1.0	False		,,,				2504	1.0				p.L164L		.											.	PPP1R3G-136	0			c.G492C						.						1.0	2.0	1.0					6																	5086211		271	872	1143	SO:0001819	synonymous_variant	648791	exon1			GCGCCTGCGAAGC		CCDS47366.1	6p25.1	2012-04-17	2011-10-04		ENSG00000219607	ENSG00000219607		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	14945	protein-coding gene	gene with protein product			"""protein phosphatase 1, regulatory (inhibitor) subunit 3G"""			11948623	Standard	NM_001145115		Approved		uc011dia.1	B7ZBB8	OTTHUMG00000014172	ENST00000405617.2:c.492G>C	6.37:g.5086211G>C		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	8	8	NM_001145115	0	0	0	0	0		Silent	SNP	ENST00000405617.2	37	CCDS47366.1																																																																																			G|0.000;C|1.000		0.736	PPP1R3G-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039740.3	NM_001145115	
HIST1H4E	8367	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	26204877	26204877	+	Missense_Mutation	SNP	C	C	T	rs201304438		TCGA-OR-A5LF-01A-11D-A30A-10	TCGA-OR-A5LF-10A-01D-A30A-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2cf21c74-97c0-46f3-8e1a-197f9737b5b5	bcf5a948-3260-455b-b930-5cec0d656728	g.chr6:26204877C>T	ENST00000360441.4	+	1	20	c.5C>T	c.(4-6)tCt>tTt	p.S2F		NM_003545.3	NP_003536.1	P62805	H4_HUMAN	histone cluster 1, H4e	2					CENP-A containing nucleosome assembly (GO:0034080)|chromatin organization (GO:0006325)|DNA replication-dependent nucleosome assembly (GO:0006335)|DNA replication-independent nucleosome assembly (GO:0006336)|histone H4-K20 demethylation (GO:0035574)|mitotic cell cycle (GO:0000278)|negative regulation of megakaryocyte differentiation (GO:0045653)|nucleosome assembly (GO:0006334)|telomere maintenance (GO:0000723)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nuclear chromosome (GO:0000228)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)|protein complex (GO:0043234)	DNA binding (GO:0003677)|histone demethylase activity (H4-K20 specific) (GO:0035575)|poly(A) RNA binding (GO:0044822)			breast(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(5)|ovary(2)|upper_aerodigestive_tract(2)	18		all_hematologic(11;0.196)				TTGGTCATGTCTGGTCGCGGC	0.498																																					p.S2F		.											.	HIST1H4E-69	0			c.C5T						.						68.0	72.0	71.0					6																	26204877		2203	4300	6503	SO:0001583	missense	8367	exon1			TCATGTCTGGTCG	Z80787	CCDS4593.1	6p22.1	2011-01-27	2006-10-11	2003-02-14	ENSG00000198518	ENSG00000276966		"""Histones / Replication-dependent"""	4790	protein-coding gene	gene with protein product		602830	"""H4 histone family, member J"", ""histone 1, H4e"""	H4FJ		9119399, 12408966	Standard	NM_003545		Approved	H4/j	uc003ngy.3	P62805	OTTHUMG00000014441	ENST00000360441.4:c.5C>T	6.37:g.26204877C>T	ENSP00000353624:p.Ser2Phe	Somatic	75	0		WXS	Illumina GAIIx	Phase_I	74	30	NM_003545	0	0	0	0	0	A2VCL0|P02304|P02305|Q6DRA9|Q6FGB8|Q6NWP7	Missense_Mutation	SNP	ENST00000360441.4	37	CCDS4593.1	.	.	.	.	.	.	.	.	.	.	.	9.336	1.061706	0.19987	.	.	ENSG00000198518	ENST00000360441	.	.	.	2.08	2.08	0.27032	.	0.143957	0.47852	U	0.000212	T	0.63745	0.2537	.	.	.	0.47949	D	0.999553	.	.	.	.	.	.	T	0.70400	-0.4882	6	0.87932	D	0	.	12.1184	0.53878	0.0:1.0:0.0:0.0	.	.	.	.	F	2	.	ENSP00000353624:S2F	S	+	2	0	HIST1H4E	26312856	1.000000	0.71417	0.942000	0.38095	0.051000	0.14879	5.842000	0.69417	1.448000	0.47680	0.563000	0.77884	TCT	C|0.999;G|0.000		0.498	HIST1H4E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040104.1	NM_003545	
HLA-C	3107	bcgsc.ca	37	6	31239449	31239449	+	Missense_Mutation	SNP	C	C	G	rs28626310	byFrequency	TCGA-OR-A5LF-01A-11D-A30A-10	TCGA-OR-A5LF-10A-01D-A30A-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2cf21c74-97c0-46f3-8e1a-197f9737b5b5	bcf5a948-3260-455b-b930-5cec0d656728	g.chr6:31239449C>G	ENST00000376228.5	-	2	284	c.270G>C	c.(268-270)aaG>aaC	p.K90N	HLA-C_ENST00000383329.3_Missense_Mutation_p.K90N	NM_002117.5	NP_002108.4	Q95604	1C17_HUMAN	major histocompatibility complex, class I, C	90	Alpha-1.		K -> N (in dbSNP:rs28626310).		antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-independent (GO:0002480)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cytokine-mediated signaling pathway (GO:0019221)|interferon-gamma-mediated signaling pathway (GO:0060333)|positive regulation of T cell mediated cytotoxicity (GO:0001916)|regulation of immune response (GO:0050776)|type I interferon signaling pathway (GO:0060337)|viral process (GO:0016032)	cell surface (GO:0009986)|early endosome membrane (GO:0031901)|endoplasmic reticulum (GO:0005783)|ER to Golgi transport vesicle membrane (GO:0012507)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of lumenal side of endoplasmic reticulum membrane (GO:0071556)|MHC class I protein complex (GO:0042612)|phagocytic vesicle membrane (GO:0030670)|plasma membrane (GO:0005886)	peptide antigen binding (GO:0042605)			central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(2)|lung(4)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)	17						GGCGCTTGTACTTCTGTGTCT	0.701													c|||	710	0.141773	0.1452	0.1282	5008	,	,		12148	0.0516		0.168	False		,,,				2504	0.2127				p.K90N		.											.	HLA-C-90	0			c.G270C						.	C	ASN/LYS	438,2584		26,386,1099	48.0	49.0	48.0		270	-5.5	0.0	6	dbSNP_125	48	999,4419		91,817,1801	no	missense	HLA-C	NM_002117.5	94	117,1203,2900	GG,GC,CC		18.4385,14.4937,17.0261	benign	90/367	31239449	1437,7003	1511	2709	4220	SO:0001583	missense	3107	exon2			CTTGTACTTCTGT	M11886	CCDS34393.1	6p21.3	2014-01-30			ENSG00000204525	ENSG00000204525		"""Histocompatibility complex"", ""Immunoglobulin superfamily / C1-set domain containing"""	4933	protein-coding gene	gene with protein product		142840	"""psoriasis susceptibility 1"""	HLA-JY3, D6S204, PSORS1		3863816, 16642438	Standard	NM_001243042		Approved		uc003nsy.3	P04222	OTTHUMG00000031154	ENST00000376228.5:c.270G>C	6.37:g.31239449C>G	ENSP00000365402:p.Lys90Asn	Somatic	166	2		WXS	Illumina GAIIx	Phase_I	253	8	NM_002117	0	0	0	0	0	O02864|O02958|Q29643|Q9MY30	Missense_Mutation	SNP	ENST00000376228.5	37	CCDS34393.1	260|260	0.11904761904761904|0.11904761904761904	60|60	0.12195121951219512|0.12195121951219512	47|47	0.1298342541436464|0.1298342541436464	26|26	0.045454545454545456|0.045454545454545456	127|127	0.16754617414248021|0.16754617414248021	-|-	0.008|0.008	-1.894729|-1.894729	0.00522|0.00522	0.144937|0.144937	0.184385|0.184385	ENSG00000204525|ENSG00000204525	ENST00000376228;ENST00000383329;ENST00000396254;ENST00000539307|ENST00000415537	T;T|.	0.00009|.	9.48;9.48|.	2.75|2.75	-5.49|-5.49	0.02584|0.02584	MHC class I, alpha chain, alpha1/alpha2 (2);MHC classes I/II-like antigen recognition protein (1);MHC class I-like antigen recognition (1);|.	2211.810000|.	0.00541|.	N|.	0.000226|.	T|T	0.01489|0.01489	0.0048|0.0048	N|N	0.01751|0.01751	-0.74|-0.74	0.80722|0.80722	P|P	0.0|0.0	B;B;B;B|.	0.10296|.	0.003;0.003;0.001;0.003|.	B;B;B;B|.	0.21151|.	0.033;0.033;0.033;0.022|.	T|T	0.22941|0.22941	-1.0202|-1.0202	9|4	0.36615|.	T|.	0.2|.	.|.	3.7958|3.7958	0.08738|0.08738	0.0845:0.197:0.1701:0.5485|0.0845:0.197:0.1701:0.5485	rs28626310;rs41555912|rs28626310;rs41555912	90;90;90;90|.	A2AEA4;A6H578;A2AEA2;P10321|.	.;.;.;1C07_HUMAN|.	N|L	90;90;90;127|90	ENSP00000365402:K90N;ENSP00000372819:K90N|.	ENSP00000365402:K90N|.	K|V	-|-	3|1	2|0	HLA-C|HLA-C	31347428|31347428	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.000000|0.000000	0.00434|0.00434	-9.984000|-9.984000	0.00008|0.00008	-6.044000|-6.044000	0.00007|0.00007	-3.594000|-3.594000	0.00028|0.00028	AAG|GTA	C|0.840;G|0.160		0.701	HLA-C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076281.3	NM_002117	
CAPN11	11131	broad.mit.edu;bcgsc.ca	37	6	44137262	44137262	+	Silent	SNP	G	G	T			TCGA-OR-A5LF-01A-11D-A30A-10	TCGA-OR-A5LF-10A-01D-A30A-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2cf21c74-97c0-46f3-8e1a-197f9737b5b5	bcf5a948-3260-455b-b930-5cec0d656728	g.chr6:44137262G>T	ENST00000398776.1	+	3	371	c.333G>T	c.(331-333)cgG>cgT	p.R111R	CAPN11_ENST00000542245.1_Silent_p.R111R	NM_007058.3	NP_008989.2	Q9UMQ6	CAN11_HUMAN	calpain 11	111	Calpain catalytic. {ECO:0000255|PROSITE- ProRule:PRU00239}.				proteolysis (GO:0006508)	acrosomal vesicle (GO:0001669)|cytoplasm (GO:0005737)	calcium ion binding (GO:0005509)|calcium-dependent cysteine-type endopeptidase activity (GO:0004198)|peptidase activity (GO:0008233)			breast(3)|endometrium(5)|kidney(1)|large_intestine(5)|lung(17)|ovary(1)|pancreas(1)|prostate(2)|stomach(1)	36	all_cancers(18;3.19e-06)|Lung NSC(15;0.00108)|all_lung(25;0.00278)|Hepatocellular(11;0.00908)|Ovarian(13;0.0273)		Colorectal(64;0.00337)|COAD - Colon adenocarcinoma(64;0.00536)			CCTGGCAGCGGCCCAAGGTGG	0.542																																					p.R111R		.											.	CAPN11-136	0			c.G333T						.						15.0	16.0	16.0					6																	44137262		1893	4127	6020	SO:0001819	synonymous_variant	11131	exon3			GCAGCGGCCCAAG	AJ242832	CCDS47436.1	6p12	2013-01-10			ENSG00000137225	ENSG00000137225		"""EF-hand domain containing"""	1478	protein-coding gene	gene with protein product		604822				10409436	Standard	NM_007058		Approved		uc003owt.1	Q9UMQ6	OTTHUMG00000014758	ENST00000398776.1:c.333G>T	6.37:g.44137262G>T		Somatic	191	2		WXS	Illumina GAIIx	Phase_I	88	5	NM_007058	0	0	0	0	0	B2RA64|Q5T3G1|Q8N4R5	Silent	SNP	ENST00000398776.1	37	CCDS47436.1																																																																																			.		0.542	CAPN11-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000040714.3		
RIMS1	22999	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	72945399	72945399	+	Missense_Mutation	SNP	C	C	G			TCGA-OR-A5LF-01A-11D-A30A-10	TCGA-OR-A5LF-10A-01D-A30A-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2cf21c74-97c0-46f3-8e1a-197f9737b5b5	bcf5a948-3260-455b-b930-5cec0d656728	g.chr6:72945399C>G	ENST00000521978.1	+	8	1825	c.1825C>G	c.(1825-1827)Ccc>Gcc	p.P609A	RIMS1_ENST00000517827.1_Missense_Mutation_p.P68A|RIMS1_ENST00000401910.3_Missense_Mutation_p.P83A|RIMS1_ENST00000425662.2_Missense_Mutation_p.P2A|RIMS1_ENST00000491071.2_Missense_Mutation_p.P609A|RIMS1_ENST00000522291.1_Missense_Mutation_p.P609A|RIMS1_ENST00000523963.1_Missense_Mutation_p.P83A|RIMS1_ENST00000348717.5_Missense_Mutation_p.P609A|RIMS1_ENST00000520567.1_Missense_Mutation_p.P609A|RIMS1_ENST00000264839.7_Missense_Mutation_p.P609A|RIMS1_ENST00000517960.1_Missense_Mutation_p.P609A|RIMS1_ENST00000518273.1_Missense_Mutation_p.P609A	NM_014989.5	NP_055804.2	Q86UR5	RIMS1_HUMAN	regulating synaptic membrane exocytosis 1	609	PDZ. {ECO:0000255|PROSITE- ProRule:PRU00143}.				calcium ion-dependent exocytosis (GO:0017156)|calcium ion-dependent exocytosis of neurotransmitter (GO:0048791)|glutamate secretion (GO:0014047)|intracellular protein transport (GO:0006886)|membrane fusion (GO:0061025)|neurotransmitter secretion (GO:0007269)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of gene expression (GO:0010628)|positive regulation of inhibitory postsynaptic membrane potential (GO:0097151)|protein complex assembly (GO:0006461)|regulated secretory pathway (GO:0045055)|regulation of catalytic activity (GO:0050790)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of neurotransmitter secretion (GO:0046928)|response to stimulus (GO:0050896)|secretion (GO:0046903)|synaptic transmission (GO:0007268)|synaptic vesicle exocytosis (GO:0016079)|visual perception (GO:0007601)	cell junction (GO:0030054)|plasma membrane (GO:0005886)|presynaptic active zone (GO:0048786)|presynaptic membrane (GO:0042734)	metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|Rab GTPase binding (GO:0017137)|small GTPase regulator activity (GO:0005083)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(25)|liver(4)|lung(35)|ovary(9)|pancreas(3)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	102		all_epithelial(107;0.179)|all_hematologic(105;0.212)				AACAACCATGCCCAAAGACTC	0.403																																					p.P609A		.											.	RIMS1-144	0			c.C1825G						.						72.0	70.0	71.0					6																	72945399		1880	4114	5994	SO:0001583	missense	22999	exon8			ACCATGCCCAAAG	AB002338	CCDS47449.1, CCDS55029.1, CCDS55030.1, CCDS55031.1, CCDS55032.1, CCDS55033.1	6q12-q13	2008-10-16	2002-06-12	2002-06-14	ENSG00000079841	ENSG00000079841			17282	protein-coding gene	gene with protein product	"""Rab3-interacting molecule"""	606629	"""RAB3 interacting protein 2"""	RAB3IP2, CORD7		9205841, 11438518	Standard	NM_001168407		Approved	RIM, KIAA0340, RIM1	uc003pga.4	Q86UR5	OTTHUMG00000015009	ENST00000521978.1:c.1825C>G	6.37:g.72945399C>G	ENSP00000428417:p.Pro609Ala	Somatic	119	0		WXS	Illumina GAIIx	Phase_I	114	34	NM_014989	0	0	0	0	0	A7MBN6|B7Z2M0|B7Z2Q9|B7Z3S3|B7Z6S2|E7EX08|E9PCB7|E9PCZ1|E9PF48|E9PHF5|E9PHR1|O15048|Q5JY21|Q5JY25|Q5SZK1|Q8TDY9|Q8TDZ5|Q9HBA1|Q9HBA2|Q9HBA3|Q9HBA4|Q9HBA5|Q9HBA6	Missense_Mutation	SNP	ENST00000521978.1	37	CCDS47449.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	28.1|28.1	4.890789|4.890789	0.91889|0.91889	.|.	.|.	ENSG00000079841|ENSG00000079841	ENST00000517433|ENST00000491071;ENST00000350827;ENST00000352008;ENST00000348717;ENST00000349908;ENST00000346609;ENST00000264839;ENST00000517960;ENST00000518273;ENST00000520567;ENST00000522291;ENST00000521978;ENST00000401910;ENST00000523963;ENST00000425662;ENST00000453976;ENST00000517827	.|T;T;T;T;T;T;T;T;T;T;T;T;T	.|0.27104	.|1.69;1.69;1.69;1.69;1.69;1.69;1.69;1.69;1.69;1.69;1.69;1.69;1.69	5.92|5.92	5.92|5.92	0.95590|0.95590	.|PDZ/DHR/GLGF (3);	.|0.000000	.|0.64402	.|D	.|0.000004	T|T	0.45418|0.45418	0.1341|0.1341	L|L	0.61387|0.61387	1.9|1.9	0.80722|0.80722	D|D	1|1	.|B;D;D;D;P;D;D	.|0.71674	.|0.287;0.997;0.983;0.996;0.814;0.998;0.996	.|B;D;D;D;P;D;D	.|0.85130	.|0.391;0.997;0.988;0.996;0.75;0.996;0.996	T|T	0.33343|0.33343	-0.9872|-0.9872	5|10	.|0.72032	.|D	.|0.01	-15.3444|-15.3444	20.3151|20.3151	0.98650|0.98650	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|68;83;609;68;83;609;609	.|B7Z3S3;E9PHF5;E9PHR1;B7Z9Z3;E9PF48;C9JNW6;Q86UR5	.|.;.;.;.;.;.;RIMS1_HUMAN	G|A	182|609;609;609;609;609;609;609;609;609;609;609;609;83;83;2;2;68	.|ENSP00000430101:P609A;ENSP00000275037:P609A;ENSP00000264839:P609A;ENSP00000429959:P609A;ENSP00000430408:P609A;ENSP00000430502:P609A;ENSP00000430932:P609A;ENSP00000428417:P609A;ENSP00000385649:P83A;ENSP00000428328:P83A;ENSP00000411235:P2A;ENSP00000389503:P2A;ENSP00000428367:P68A	.|ENSP00000264839:P609A	A|P	+|+	2|1	0|0	RIMS1|RIMS1	73002120|73002120	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.981000|0.981000	0.71138|0.71138	7.818000|7.818000	0.86416|0.86416	2.809000|2.809000	0.96659|0.96659	0.467000|0.467000	0.42956|0.42956	GCC|CCC	.		0.403	RIMS1-011	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374968.1		
RIMS1	22999	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	72945409	72945409	+	Nonsense_Mutation	SNP	C	C	G			TCGA-OR-A5LF-01A-11D-A30A-10	TCGA-OR-A5LF-10A-01D-A30A-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2cf21c74-97c0-46f3-8e1a-197f9737b5b5	bcf5a948-3260-455b-b930-5cec0d656728	g.chr6:72945409C>G	ENST00000521978.1	+	8	1835	c.1835C>G	c.(1834-1836)tCa>tGa	p.S612*	RIMS1_ENST00000517827.1_Nonsense_Mutation_p.S71*|RIMS1_ENST00000401910.3_Nonsense_Mutation_p.S86*|RIMS1_ENST00000425662.2_Nonsense_Mutation_p.S5*|RIMS1_ENST00000491071.2_Nonsense_Mutation_p.S612*|RIMS1_ENST00000522291.1_Nonsense_Mutation_p.S612*|RIMS1_ENST00000523963.1_Nonsense_Mutation_p.S86*|RIMS1_ENST00000348717.5_Nonsense_Mutation_p.S612*|RIMS1_ENST00000520567.1_Nonsense_Mutation_p.S612*|RIMS1_ENST00000264839.7_Nonsense_Mutation_p.S612*|RIMS1_ENST00000517960.1_Nonsense_Mutation_p.S612*|RIMS1_ENST00000518273.1_Nonsense_Mutation_p.S612*	NM_014989.5	NP_055804.2	Q86UR5	RIMS1_HUMAN	regulating synaptic membrane exocytosis 1	612	PDZ. {ECO:0000255|PROSITE- ProRule:PRU00143}.				calcium ion-dependent exocytosis (GO:0017156)|calcium ion-dependent exocytosis of neurotransmitter (GO:0048791)|glutamate secretion (GO:0014047)|intracellular protein transport (GO:0006886)|membrane fusion (GO:0061025)|neurotransmitter secretion (GO:0007269)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of gene expression (GO:0010628)|positive regulation of inhibitory postsynaptic membrane potential (GO:0097151)|protein complex assembly (GO:0006461)|regulated secretory pathway (GO:0045055)|regulation of catalytic activity (GO:0050790)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of neurotransmitter secretion (GO:0046928)|response to stimulus (GO:0050896)|secretion (GO:0046903)|synaptic transmission (GO:0007268)|synaptic vesicle exocytosis (GO:0016079)|visual perception (GO:0007601)	cell junction (GO:0030054)|plasma membrane (GO:0005886)|presynaptic active zone (GO:0048786)|presynaptic membrane (GO:0042734)	metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|Rab GTPase binding (GO:0017137)|small GTPase regulator activity (GO:0005083)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(25)|liver(4)|lung(35)|ovary(9)|pancreas(3)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	102		all_epithelial(107;0.179)|all_hematologic(105;0.212)				CCCAAAGACTCAGGTGCATTG	0.413																																					p.S612X		.											.	RIMS1-144	0			c.C1835G						.						68.0	66.0	67.0					6																	72945409		1879	4110	5989	SO:0001587	stop_gained	22999	exon8			AAGACTCAGGTGC	AB002338	CCDS47449.1, CCDS55029.1, CCDS55030.1, CCDS55031.1, CCDS55032.1, CCDS55033.1	6q12-q13	2008-10-16	2002-06-12	2002-06-14	ENSG00000079841	ENSG00000079841			17282	protein-coding gene	gene with protein product	"""Rab3-interacting molecule"""	606629	"""RAB3 interacting protein 2"""	RAB3IP2, CORD7		9205841, 11438518	Standard	NM_001168407		Approved	RIM, KIAA0340, RIM1	uc003pga.4	Q86UR5	OTTHUMG00000015009	ENST00000521978.1:c.1835C>G	6.37:g.72945409C>G	ENSP00000428417:p.Ser612*	Somatic	113	0		WXS	Illumina GAIIx	Phase_I	114	34	NM_014989	0	0	0	0	0	A7MBN6|B7Z2M0|B7Z2Q9|B7Z3S3|B7Z6S2|E7EX08|E9PCB7|E9PCZ1|E9PF48|E9PHF5|E9PHR1|O15048|Q5JY21|Q5JY25|Q5SZK1|Q8TDY9|Q8TDZ5|Q9HBA1|Q9HBA2|Q9HBA3|Q9HBA4|Q9HBA5|Q9HBA6	Nonsense_Mutation	SNP	ENST00000521978.1	37	CCDS47449.1	.	.	.	.	.	.	.	.	.	.	C	42	9.491043	0.99186	.	.	ENSG00000079841	ENST00000491071;ENST00000350827;ENST00000352008;ENST00000348717;ENST00000349908;ENST00000346609;ENST00000264839;ENST00000517960;ENST00000518273;ENST00000520567;ENST00000522291;ENST00000521978;ENST00000401910;ENST00000523963;ENST00000425662;ENST00000453976;ENST00000517827	.	.	.	5.92	5.05	0.67936	.	0.374178	0.22495	N	0.059316	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-12.8881	14.8418	0.70230	0.0:0.9315:0.0:0.0685	.	.	.	.	X	612;612;612;612;612;612;612;612;612;612;612;612;86;86;5;5;71	.	ENSP00000264839:S612X	S	+	2	0	RIMS1	73002130	1.000000	0.71417	0.998000	0.56505	0.897000	0.52465	7.818000	0.86416	1.517000	0.48917	0.467000	0.42956	TCA	.		0.413	RIMS1-011	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374968.1		
KCNQ5	56479	hgsc.bcm.edu	37	6	73332040	73332040	+	Silent	SNP	C	C	G	rs3734212	byFrequency	TCGA-OR-A5LF-01A-11D-A30A-10	TCGA-OR-A5LF-10A-01D-A30A-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2cf21c74-97c0-46f3-8e1a-197f9737b5b5	bcf5a948-3260-455b-b930-5cec0d656728	g.chr6:73332040C>G	ENST00000370398.1	+	1	232	c.123C>G	c.(121-123)tcC>tcG	p.S41S	KCNQ5_ENST00000414165.2_Silent_p.S41S|KCNQ5_ENST00000342056.2_Silent_p.S41S|KCNQ5_ENST00000370392.1_Silent_p.S41S|KCNQ5_ENST00000403813.2_Silent_p.S41S|KCNQ5_ENST00000355194.4_Silent_p.S41S|KCNQ5_ENST00000402622.2_Silent_p.S41S|KCNQ5_ENST00000355635.3_Silent_p.S41S	NM_019842.3	NP_062816.2	Q9NR82	KCNQ5_HUMAN	potassium voltage-gated channel, KQT-like subfamily, member 5	41					protein complex assembly (GO:0006461)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|inward rectifier potassium channel activity (GO:0005242)			breast(1)|cervix(1)|endometrium(6)|kidney(7)|large_intestine(13)|lung(15)|ovary(4)|pancreas(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	57		all_epithelial(107;0.116)|Lung NSC(302;0.219)		COAD - Colon adenocarcinoma(1;0.0107)|Colorectal(1;0.0583)	Ezogabine(DB04953)	ATGTGGAGTCCGGCCGGGGCA	0.791													G|||	2294	0.458067	0.2625	0.4337	5008	,	,		8962	0.4524		0.7097	False		,,,				2504	0.4867				p.S41S	GBM(142;1375 1859 14391 23261 44706)	.											.	KCNQ5-158	0			c.C123G						.	G	,,,,	1342,1750		314,714,518	2.0	3.0	3.0		123,123,123,123,123	-2.2	1.0	6	dbSNP_107	3	4892,1744		1918,1056,344	no	coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous	KCNQ5	NM_001160130.1,NM_001160132.1,NM_001160133.1,NM_001160134.1,NM_019842.3	,,,,	2232,1770,862	GG,GC,CC		26.2809,43.4023,35.9169	,,,,	41/924,41/943,41/952,41/823,41/933	73332040	6234,3494	1546	3318	4864	SO:0001819	synonymous_variant	56479	exon1			GGAGTCCGGCCGG	AF202977	CCDS4976.1, CCDS55034.1	6q14	2012-07-05			ENSG00000185760	ENSG00000185760		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6299	protein-coding gene	gene with protein product		607357				10787416, 10816588, 16382104	Standard	NM_019842		Approved	Kv7.5	uc011dyh.2	Q9NR82	OTTHUMG00000015020	ENST00000370398.1:c.123C>G	6.37:g.73332040C>G		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	12	12	NM_001160132	0	0	0	0	0	A6NKT6|A6PVT6|A8MSQ5|B4DS33|B5MC83|B7ZL37|F5GZV0|Q17RE1|Q5VVP3|Q86W40|Q9NRN0|Q9NYA6	Silent	SNP	ENST00000370398.1	37	CCDS4976.1																																																																																			C|0.505;G|0.495		0.791	KCNQ5-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000041198.3	NM_019842	
FAM26F	441168	hgsc.bcm.edu	37	6	116783390	116783390	+	Missense_Mutation	SNP	A	A	G	rs10784	byFrequency	TCGA-OR-A5LF-01A-11D-A30A-10	TCGA-OR-A5LF-10A-01D-A30A-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2cf21c74-97c0-46f3-8e1a-197f9737b5b5	bcf5a948-3260-455b-b930-5cec0d656728	g.chr6:116783390A>G	ENST00000368605.1	+	2	393	c.298A>G	c.(298-300)Acg>Gcg	p.T100A	RP1-93H18.6_ENST00000476099.1_RNA|FAM26F_ENST00000368606.3_Intron	NM_001010919.1	NP_001010919.1	Q5R3K3	FA26F_HUMAN	family with sequence similarity 26, member F	100			T -> A (in dbSNP:rs10784). {ECO:0000269|PubMed:15489334, ECO:0000269|Ref.2}.		ion transport (GO:0006811)	integral component of membrane (GO:0016021)				large_intestine(2)|lung(1)	3				GBM - Glioblastoma multiforme(226;0.0402)|all cancers(137;0.0627)|OV - Ovarian serous cystadenocarcinoma(136;0.0655)|Epithelial(106;0.231)		CCTGGTGTGCACGCAAATCAG	0.756													G|||	3559	0.710663	0.5008	0.7839	5008	,	,		10258	0.8938		0.7326	False		,,,				2504	0.7311				p.A100A		.											.	FAM26F-68	0			c.G298G						.	G	ALA/THR	1502,914		497,508,203	1.0	2.0	2.0		298	-7.7	0.0	6	dbSNP_52	2	3461,1133		1385,691,221	no	missense	FAM26F	NM_001010919.1	58	1882,1199,424	GG,GA,AA		24.6626,37.8311,29.2011	benign	100/316	116783390	4963,2047	1208	2297	3505	SO:0001583	missense	441168	exon2			GTGTGCACGCAAA	AF086130	CCDS34519.1, CCDS64506.1	6q22.1	2007-06-20			ENSG00000188820	ENSG00000188820			33391	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 187"""	C6orf187			Standard	NM_001010919		Approved	RP1-93H18.5, OTTHUMP00000017061, OTTHUMP00000017062, dJ93H18.5	uc003pwv.4	Q5R3K3	OTTHUMG00000015438	ENST00000368605.1:c.298A>G	6.37:g.116783390A>G	ENSP00000357594:p.Thr100Ala	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	9	9	NM_001010919	0	0	0	0	0	B9EJB0|Q5R3K4	Silent	SNP	ENST00000368605.1	37	CCDS34519.1	1594	0.7298534798534798	254	0.516260162601626	268	0.7403314917127072	528	0.9230769230769231	544	0.7176781002638523	G	6.861	0.528183	0.13127	0.621689	0.753374	ENSG00000188820	ENST00000368605	T	0.15834	2.39	4.09	-7.66	0.01277	.	5.156980	0.00166	N	0.000002	T	0.00552	0.0018	N	0.00099	-2.14	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.36261	-0.9755	9	0.09843	T	0.71	2.6864	2.2461	0.04032	0.3809:0.0793:0.1421:0.3977	rs10784;rs929044	100	Q5R3K3	FA26F_HUMAN	A	100	ENSP00000357594:T100A	ENSP00000357594:T100A	T	+	1	0	FAM26F	116890083	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-5.113000	0.00150	-2.581000	0.00462	-1.288000	0.01363	ACG	A|0.272;G|0.728		0.756	FAM26F-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041946.1	NM_001010919	
EYA4	2070	bcgsc.ca	37	6	133849868	133849868	+	Silent	SNP	C	C	T	rs142721902	byFrequency	TCGA-OR-A5LF-01A-11D-A30A-10	TCGA-OR-A5LF-10A-01D-A30A-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2cf21c74-97c0-46f3-8e1a-197f9737b5b5	bcf5a948-3260-455b-b930-5cec0d656728	g.chr6:133849868C>T	ENST00000367895.5	+	20	2309	c.1845C>T	c.(1843-1845)aaC>aaT	p.N615N	EYA4_ENST00000355167.3_Silent_p.N615N|EYA4_ENST00000430974.2_Intron|EYA4_ENST00000452339.2_Silent_p.N561N|EYA4_ENST00000355286.6_Silent_p.N592N|EYA4_ENST00000525849.1_Silent_p.N592N|EYA4_ENST00000531901.1_Silent_p.N621N|RP3-323P13.2_ENST00000607033.1_RNA|EYA4_ENST00000431403.2_Silent_p.N615N	NM_004100.4	NP_004091.3	O95677	EYA4_HUMAN	EYA transcriptional coactivator and phosphatase 4	615					anatomical structure morphogenesis (GO:0009653)|chromatin modification (GO:0016568)|DNA repair (GO:0006281)|inner ear development (GO:0048839)|middle ear morphogenesis (GO:0042474)|regulation of transcription, DNA-templated (GO:0006355)|sensory perception of sound (GO:0007605)|transcription, DNA-templated (GO:0006351)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|protein tyrosine phosphatase activity (GO:0004725)			breast(1)|central_nervous_system(3)|endometrium(5)|kidney(2)|large_intestine(11)|lung(25)|skin(1)	48	Colorectal(23;0.221)			GBM - Glioblastoma multiforme(68;0.00457)|OV - Ovarian serous cystadenocarcinoma(155;0.0152)		CACAGCACAACATGCCCTTCT	0.498													C|||	41	0.0081869	0.0015	0.0029	5008	,	,		17999	0.0		0.0149	False		,,,				2504	0.0225				p.N615N	Melanoma(57;398 1237 3528 4702 7415)	.											.	EYA4-578	0			c.C1845T						.	C	,,	20,4386	26.2+/-53.5	0,20,2183	305.0	283.0	291.0		1845,1776,1845	5.2	1.0	6	dbSNP_134	291	110,8490	59.5+/-121.1	0,110,4190	no	coding-synonymous,coding-synonymous,coding-synonymous	EYA4	NM_004100.4,NM_172103.3,NM_172105.3	,,	0,130,6373	TT,TC,CC		1.2791,0.4539,0.9995	,,	615/640,592/617,615/640	133849868	130,12876	2203	4300	6503	SO:0001819	synonymous_variant	2070	exon20			GCACAACATGCCC	Y17114	CCDS5165.1, CCDS5166.1, CCDS43506.1, CCDS75521.1, CCDS75523.1	6q23	2014-09-17	2014-06-19		ENSG00000112319	ENSG00000112319		"""Protein tyrosine phosphatases / Asp-based PTPs"""	3522	protein-coding gene	gene with protein product		603550	"""eyes absent (Drosophila) homolog 4"", ""eyes absent homolog 4 (Drosophila)"""	DFNA10, CMD1J		9887327, 11159937	Standard	NM_004100		Approved		uc003qed.4	O95677	OTTHUMG00000015602	ENST00000367895.5:c.1845C>T	6.37:g.133849868C>T		Somatic	133	1		WXS	Illumina GAIIx	Phase_I	114	6	NM_172105	0	0	0	0	0	B7Z7F7|O95464|O95679|Q8IW39|Q9NTR7	Silent	SNP	ENST00000367895.5	37	CCDS5165.1																																																																																			C|0.989;T|0.011		0.498	EYA4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000042282.2	NM_004100	
RAET1G	353091	bcgsc.ca	37	6	150240829	150240829	+	Missense_Mutation	SNP	G	G	C	rs9397449	byFrequency	TCGA-OR-A5LF-01A-11D-A30A-10	TCGA-OR-A5LF-10A-01D-A30A-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2cf21c74-97c0-46f3-8e1a-197f9737b5b5	bcf5a948-3260-455b-b930-5cec0d656728	g.chr6:150240829G>C	ENST00000367360.2	-	2	276	c.209C>G	c.(208-210)aCa>aGa	p.T70R	RAET1G_ENST00000479265.1_Missense_Mutation_p.T70R|RAET1E-AS1_ENST00000605899.1_RNA|RP11-244K5.8_ENST00000606915.1_RNA|RAET1E-AS1_ENST00000446954.2_RNA	NM_001001788.2	NP_001001788.2			retinoic acid early transcript 1G											NS(1)|endometrium(2)|kidney(3)|large_intestine(2)|lung(4)|urinary_tract(1)	13		Ovarian(120;0.0907)	BRCA - Breast invasive adenocarcinoma(37;0.193)	OV - Ovarian serous cystadenocarcinoma(155;2.73e-12)		GGGTGTGACTGTCTTGCTGCC	0.517													g|||	1132	0.226038	0.1021	0.111	5008	,	,		20972	0.5317		0.1501	False		,,,				2504	0.2382				p.T70R		.											.	RAET1G-90	0			c.C209G						.	C	ARG/THR	492,3914	780.8+/-414.5	27,438,1738	278.0	261.0	267.0		209	-2.0	0.0	6	dbSNP_119	267	1130,7470	767.0+/-407.6	83,964,3253	no	missense	RAET1G	NM_001001788.2	71	110,1402,4991	CC,CG,GG		13.1395,11.1666,12.4712	benign	70/335	150240829	1622,11384	2203	4300	6503	SO:0001583	missense	353091	exon2			GTGACTGTCTTGC	AY172579	CCDS43514.1	6q24.1-25.1	2009-04-29	2004-11-22		ENSG00000203722	ENSG00000203722			16795	protein-coding gene	gene with protein product		609244	"""retinoic acid early transcript 1G pseudogene"""			11827464, 15240696	Standard	NM_001001788		Approved	ULBP5	uc010kii.1	Q6H3X3	OTTHUMG00000015802	ENST00000367360.2:c.209C>G	6.37:g.150240829G>C	ENSP00000356329:p.Thr70Arg	Somatic	599	4		WXS	Illumina GAIIx	Phase_I	570	13	NM_001001788	0	0	0	0	0		Missense_Mutation	SNP	ENST00000367360.2	37	CCDS43514.1	503	0.2303113553113553	47	0.09552845528455285	46	0.1270718232044199	308	0.5384615384615384	102	0.1345646437994723	C	2.358	-0.347240	0.05208	0.111666	0.131395	ENSG00000203722	ENST00000367360;ENST00000479265	T;T	0.00626	6.13;6.13	2.4	-2.05	0.07321	MHC class I, alpha chain, alpha1/alpha2 (1);MHC classes I/II-like antigen recognition protein (1);MHC class I-like antigen recognition (1);	.	.	.	.	T	0.00144	0.0004	L	0.29908	0.895	0.80722	P	0.0	B	0.21688	0.059	B	0.26094	0.066	T	0.43540	-0.9385	8	0.02654	T	1	.	0.992	0.01459	0.1668:0.1581:0.398:0.2771	rs9397449;rs60358512;rs9397449	70	Q6H3X3	RET1G_HUMAN	R	70	ENSP00000356329:T70R;ENSP00000417503:T70R	ENSP00000356329:T70R	T	-	2	0	RAET1G	150282522	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-2.137000	0.01304	-0.955000	0.03636	-3.292000	0.00046	ACA	G|0.807;C|0.193		0.517	RAET1G-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042668.2		
TBP	6908	hgsc.bcm.edu	37	6	170871004	170871004	+	Silent	SNP	G	G	A			TCGA-OR-A5LF-01A-11D-A30A-10	TCGA-OR-A5LF-10A-01D-A30A-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2cf21c74-97c0-46f3-8e1a-197f9737b5b5	bcf5a948-3260-455b-b930-5cec0d656728	g.chr6:170871004G>A	ENST00000392092.2	+	3	459	c.180G>A	c.(178-180)caG>caA	p.Q60Q	TBP_ENST00000230354.6_Silent_p.Q60Q|TBP_ENST00000540980.1_Silent_p.Q40Q	NM_003194.4	NP_003185.1	P20226	TBP_HUMAN	TATA box binding protein	60	Poly-Gln.				cell death (GO:0008219)|gene expression (GO:0010467)|positive regulation of transcription, DNA-templated (GO:0045893)|spermatogenesis (GO:0007283)|termination of RNA polymerase I transcription (GO:0006363)|transcription elongation from RNA polymerase I promoter (GO:0006362)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase I promoter (GO:0006360)|transcription from RNA polymerase II promoter (GO:0006366)|transcription from RNA polymerase III promoter (GO:0006383)|transcription initiation from RNA polymerase I promoter (GO:0006361)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	cytoplasm (GO:0005737)|female pronucleus (GO:0001939)|male pronucleus (GO:0001940)|nuclear euchromatin (GO:0005719)|nucleoplasm (GO:0005654)|transcription factor TFIIA complex (GO:0005672)|transcription factor TFIID complex (GO:0005669)	repressing transcription factor binding (GO:0070491)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)			breast(2)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(2)|lung(9)|ovary(1)|prostate(4)|urinary_tract(1)	26		Breast(66;5.08e-05)|Ovarian(120;0.125)|Esophageal squamous(34;0.246)		OV - Ovarian serous cystadenocarcinoma(33;1.07e-22)|BRCA - Breast invasive adenocarcinoma(81;5.01e-06)|GBM - Glioblastoma multiforme(31;0.00591)		Ggcagcagcagcaacaacaac	0.542																																					p.Q60Q		.											.	TBP-91	0			c.G180A						.						43.0	45.0	44.0					6																	170871004		2203	4300	6503	SO:0001819	synonymous_variant	6908	exon3			GCAGCAGCAACAA	M55654	CCDS5315.1, CCDS55077.1	6q27	2014-04-02			ENSG00000112592	ENSG00000112592		"""General transcription factors"""	11588	protein-coding gene	gene with protein product		600075		GTF2D1, SCA17		2194289, 11448935	Standard	NM_003194		Approved	TFIID	uc003qxu.3	P20226	OTTHUMG00000016084	ENST00000392092.2:c.180G>A	6.37:g.170871004G>A		Somatic	62	0		WXS	Illumina GAIIx	Phase_I	52	10	NM_003194	0	0	0	0	0	B4E3B3|F5H869|Q16845|Q6IBM6|Q9UC02	Silent	SNP	ENST00000392092.2	37	CCDS5315.1																																																																																			.		0.542	TBP-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000043271.2	NM_003194	
TBP	6908	mdanderson.org	37	6	170871013	170871013	+	Silent	SNP	A	A	G	rs201732168|rs113202486|rs574714675|rs71010672	byFrequency	TCGA-OR-A5LF-01A-11D-A30A-10	TCGA-OR-A5LF-10A-01D-A30A-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2cf21c74-97c0-46f3-8e1a-197f9737b5b5	bcf5a948-3260-455b-b930-5cec0d656728	g.chr6:170871013A>G	ENST00000392092.2	+	3	468	c.189A>G	c.(187-189)caA>caG	p.Q63Q	TBP_ENST00000230354.6_Silent_p.Q63Q|TBP_ENST00000540980.1_Silent_p.Q43Q	NM_003194.4	NP_003185.1	P20226	TBP_HUMAN	TATA box binding protein	63	Poly-Gln.				cell death (GO:0008219)|gene expression (GO:0010467)|positive regulation of transcription, DNA-templated (GO:0045893)|spermatogenesis (GO:0007283)|termination of RNA polymerase I transcription (GO:0006363)|transcription elongation from RNA polymerase I promoter (GO:0006362)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase I promoter (GO:0006360)|transcription from RNA polymerase II promoter (GO:0006366)|transcription from RNA polymerase III promoter (GO:0006383)|transcription initiation from RNA polymerase I promoter (GO:0006361)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	cytoplasm (GO:0005737)|female pronucleus (GO:0001939)|male pronucleus (GO:0001940)|nuclear euchromatin (GO:0005719)|nucleoplasm (GO:0005654)|transcription factor TFIIA complex (GO:0005672)|transcription factor TFIID complex (GO:0005669)	repressing transcription factor binding (GO:0070491)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)	p.Q63_Q64insQ(1)|p.Q63Q(1)		breast(2)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(2)|lung(9)|ovary(1)|prostate(4)|urinary_tract(1)	26		Breast(66;5.08e-05)|Ovarian(120;0.125)|Esophageal squamous(34;0.246)		OV - Ovarian serous cystadenocarcinoma(33;1.07e-22)|BRCA - Breast invasive adenocarcinoma(81;5.01e-06)|GBM - Glioblastoma multiforme(31;0.00591)		agcaacaacaacagcagcagc	0.552													a|||	10	0.00199681	0.0038	0.0014	5008	,	,		14818	0.002		0.0	False		,,,				2504	0.002				p.Q63Q		.											.	TBP-91	2	Insertion - In frame(1)|Substitution - coding silent(1)	prostate(1)|breast(1)	c.A189G						.						34.0	37.0	36.0					6																	170871013		2203	4298	6501	SO:0001819	synonymous_variant	6908	exon3			ACAACAACAGCAG	M55654	CCDS5315.1, CCDS55077.1	6q27	2014-04-02			ENSG00000112592	ENSG00000112592		"""General transcription factors"""	11588	protein-coding gene	gene with protein product		600075		GTF2D1, SCA17		2194289, 11448935	Standard	NM_003194		Approved	TFIID	uc003qxu.3	P20226	OTTHUMG00000016084	ENST00000392092.2:c.189A>G	6.37:g.170871013A>G		Somatic	63	0		WXS	Illumina GAIIx	Phase_I	54	13	NM_003194	0	0	0	0	0	B4E3B3|F5H869|Q16845|Q6IBM6|Q9UC02	Silent	SNP	ENST00000392092.2	37	CCDS5315.1																																																																																			.		0.552	TBP-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000043271.2	NM_003194	
TNRC18	84629	hgsc.bcm.edu	37	7	5372406	5372406	+	Silent	SNP	G	G	T	rs13238738	byFrequency	TCGA-OR-A5LF-01A-11D-A30A-10	TCGA-OR-A5LF-10A-01D-A30A-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2cf21c74-97c0-46f3-8e1a-197f9737b5b5	bcf5a948-3260-455b-b930-5cec0d656728	g.chr7:5372406G>T	ENST00000430969.1	-	19	6342	c.5994C>A	c.(5992-5994)cgC>cgA	p.R1998R	TNRC18_ENST00000399537.4_Silent_p.R1998R	NM_001080495.2	NP_001073964.2	O15417	TNC18_HUMAN	trinucleotide repeat containing 18	1998							chromatin binding (GO:0003682)			central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(8)	11		Ovarian(82;0.142)		UCEC - Uterine corpus endometrioid carcinoma (126;0.195)|OV - Ovarian serous cystadenocarcinoma(56;5.32e-15)		TGCGCTCGCTGCGGCGCCGCG	0.756													G|||	2646	0.528355	0.3601	0.4352	5008	,	,		9503	0.7063		0.673	False		,,,				2504	0.4898				p.R1998R		.											.	TNRC18-46	0			c.C5994A						.	G		1260,1040		370,520,260	2.0	3.0	3.0		5994	2.1	1.0	7	dbSNP_121	3	3787,1581		1438,911,335	no	coding-synonymous	TNRC18	NM_001080495.2		1808,1431,595	TT,TG,GG		29.4523,45.2174,34.181		1998/2969	5372406	5047,2621	1150	2684	3834	SO:0001819	synonymous_variant	84629	exon19			CTCGCTGCGGCGC	U80753	CCDS47534.1	7p22.1	2012-04-17			ENSG00000182095	ENSG00000182095		"""Trinucleotide (CAG) repeat containing"""	11962	protein-coding gene	gene with protein product						9225980	Standard	NM_001080495		Approved	CAGL79, TNRC18A, KIAA1856	uc003soi.4	O15417	OTTHUMG00000151831	ENST00000430969.1:c.5994C>A	7.37:g.5372406G>T		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	25	9	NM_001080495	0	0	0	0	0	A8MX41|Q96JH1|Q96K91	Silent	SNP	ENST00000430969.1	37	CCDS47534.1	1284	0.5879120879120879	197	0.40040650406504064	170	0.4696132596685083	415	0.7255244755244755	502	0.662269129287599	.	11.77	1.738038	0.30774	0.547826	0.705477	ENSG00000182095	ENST00000455076	.	.	.	4.14	2.1	0.27182	.	.	.	.	.	T	0.00012	0.0000	.	.	.	0.09310	P	0.9999999999999956	.	.	.	.	.	.	T	0.35425	-0.9789	3	.	.	.	.	12.3787	0.55295	0.0:0.4664:0.5335:0.0	rs13238738	.	.	.	E	35	.	.	A	-	2	0	TNRC18	5338932	0.998000	0.40836	0.997000	0.53966	0.996000	0.88848	0.427000	0.21379	0.648000	0.30732	0.555000	0.69702	GCA	G|0.411;T|0.589		0.756	TNRC18-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding			
CCDC129	223075	bcgsc.ca	37	7	31682453	31682453	+	Missense_Mutation	SNP	C	C	T	rs4141001	byFrequency	TCGA-OR-A5LF-01A-11D-A30A-10	TCGA-OR-A5LF-10A-01D-A30A-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2cf21c74-97c0-46f3-8e1a-197f9737b5b5	bcf5a948-3260-455b-b930-5cec0d656728	g.chr7:31682453C>T	ENST00000407970.3	+	11	1507	c.1469C>T	c.(1468-1470)gCg>gTg	p.A490V	CCDC129_ENST00000319386.3_Missense_Mutation_p.A342V|CCDC129_ENST00000409210.1_Missense_Mutation_p.A398V|CCDC129_ENST00000451887.2_Missense_Mutation_p.A516V	NM_001257967.1|NM_194300.3	NP_001244896.1|NP_919276.2	Q6ZRS4	CC129_HUMAN	coiled-coil domain containing 129	490			A -> V (in dbSNP:rs4141001). {ECO:0000269|PubMed:14702039, ECO:0000269|PubMed:15489334}.							cervix(1)|endometrium(3)|kidney(3)|large_intestine(6)|lung(31)	44						AGCCAAGAAGCGAATGCCTTG	0.522													C|||	3650	0.728834	0.5696	0.7795	5008	,	,		22267	0.8085		0.7475	False		,,,				2504	0.8067				p.A516V		.											.	.	0			c.C1547T						.	C	VAL/ALA	2590,1816	639.2+/-397.1	771,1048,384	111.0	111.0	111.0		1469	2.5	0.2	7	dbSNP_110	111	6676,1924	726.9+/-406.6	2606,1464,230	yes	missense	CCDC129	NM_194300.2	64	3377,2512,614	TT,TC,CC		22.3721,41.2165,28.756	benign	490/1045	31682453	9266,3740	2203	4300	6503	SO:0001583	missense	223075	exon11			AAGAAGCGAATGC	AK128026	CCDS5435.2, CCDS59050.1, CCDS75577.1	7p14.3	2006-08-21			ENSG00000180347	ENSG00000180347			27363	protein-coding gene	gene with protein product						14702039	Standard	NM_001257967		Approved	FLJ38344	uc011kad.1	Q6ZRS4	OTTHUMG00000128611	ENST00000407970.3:c.1469C>T	7.37:g.31682453C>T	ENSP00000384416:p.Ala490Val	Somatic	162	0		WXS	Illumina GAIIx	Phase_I	243	8	NM_001257968	0	0	0	0	0	A2RU17|B3KTI9|B4DHB0|B4E2R1|F5H3V5	Missense_Mutation	SNP	ENST00000407970.3	37	CCDS5435.2	1656	0.7582417582417582	290	0.5894308943089431	289	0.7983425414364641	506	0.8846153846153846	571	0.7532981530343008	C	2.512	-0.312801	0.05422	0.587835	0.776279	ENSG00000180347	ENST00000319386;ENST00000407970;ENST00000451887;ENST00000538406;ENST00000409210	T;T;T;T	0.17691	2.26;2.52;2.52;2.26	5.66	2.49	0.30216	.	0.686063	0.13526	N	0.381326	T	0.00012	0.0000	N	0.22421	0.69	0.80722	P	0.0	P;B;B;B	0.45011	0.848;0.043;0.043;0.104	B;B;B;B	0.31390	0.129;0.016;0.016;0.024	T	0.35151	-0.9800	9	0.15952	T	0.53	0.3842	6.3546	0.21395	0.1034:0.3891:0.5075:0.0	rs4141001;rs60898332;rs4141001	516;500;490;342	F5H3V5;F5H2J8;Q6ZRS4;Q6ZRS4-2	.;.;CC129_HUMAN;.	V	342;490;516;500;398	ENSP00000313062:A342V;ENSP00000384416:A490V;ENSP00000395835:A516V;ENSP00000387214:A398V	ENSP00000313062:A342V	A	+	2	0	CCDC129	31648978	0.915000	0.31059	0.150000	0.22450	0.001000	0.01503	1.281000	0.33214	1.394000	0.46624	-0.353000	0.07706	GCG	C|0.269;T|0.731		0.522	CCDC129-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000318975.1	NM_194300	
POLD2	5425	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	44156093	44156093	+	Missense_Mutation	SNP	T	T	C			TCGA-OR-A5LF-01A-11D-A30A-10	TCGA-OR-A5LF-10A-01D-A30A-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2cf21c74-97c0-46f3-8e1a-197f9737b5b5	bcf5a948-3260-455b-b930-5cec0d656728	g.chr7:44156093T>C	ENST00000406581.2	-	8	1446	c.797A>G	c.(796-798)aAg>aGg	p.K266R	POLD2_ENST00000452185.1_Missense_Mutation_p.K266R|POLD2_ENST00000223361.3_Missense_Mutation_p.K266R	NM_001256879.1	NP_001243808.1	P49005	DPOD2_HUMAN	polymerase (DNA directed), delta 2, accessory subunit	266					base-excision repair (GO:0006284)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|DNA strand elongation involved in DNA replication (GO:0006271)|mitotic cell cycle (GO:0000278)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA gap filling (GO:0006297)|telomere maintenance (GO:0000723)|telomere maintenance via recombination (GO:0000722)|telomere maintenance via semi-conservative replication (GO:0032201)|transcription-coupled nucleotide-excision repair (GO:0006283)	delta DNA polymerase complex (GO:0043625)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|DNA-directed DNA polymerase activity (GO:0003887)			breast(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(4)|ovary(2)|skin(1)|urinary_tract(1)	12						CTGGGTTTTCTTGGTGAGGTA	0.597																																					p.K301R		.											.	POLD2-229	0			c.A902G						.						56.0	45.0	49.0					7																	44156093		2203	4299	6502	SO:0001583	missense	5425	exon7			GTTTTCTTGGTGA		CCDS5477.1, CCDS75586.1	7p13	2012-05-18	2012-05-18		ENSG00000106628	ENSG00000106628		"""DNA polymerases"""	9176	protein-coding gene	gene with protein product	"""Pol delta B subunit (p50)"", ""DNA polymerase delta subunit p50"""	600815	"""polymerase (DNA directed), delta 2, regulatory subunit (50kD)"", ""polymerase (DNA directed), delta 2, regulatory subunit 50kDa"""			8530069	Standard	NM_001127218		Approved		uc003tkf.5	P49005	OTTHUMG00000022909	ENST00000406581.2:c.797A>G	7.37:g.44156093T>C	ENSP00000386105:p.Lys266Arg	Somatic	91	0		WXS	Illumina GAIIx	Phase_I	88	14	NM_006230	0	0	0	0	0	A4D2J4|B2R5S4	Missense_Mutation	SNP	ENST00000406581.2	37	CCDS5477.1	.	.	.	.	.	.	.	.	.	.	T	17.70	3.453413	0.63290	.	.	ENSG00000106628	ENST00000406581;ENST00000223361;ENST00000452185;ENST00000436400;ENST00000436844	T;T;T;T	0.48836	0.81;0.8;0.81;0.81	5.84	5.84	0.93424	DNA polymerase alpha/epsilon, subunit B (1);	0.000000	0.85682	D	0.000000	T	0.38772	0.1053	L	0.35414	1.06	0.80722	D	1	B;B	0.31730	0.143;0.337	B;B	0.33339	0.123;0.162	T	0.17868	-1.0355	10	0.17369	T	0.5	-20.0257	15.897	0.79341	0.0:0.0:0.0:1.0	.	266;266	P49005;F8W8R3	DPOD2_HUMAN;.	R	266;266;266;6;184	ENSP00000386105:K266R;ENSP00000223361:K266R;ENSP00000395231:K266R;ENSP00000416203:K184R	ENSP00000223361:K266R	K	-	2	0	POLD2	44122618	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	5.866000	0.69590	2.241000	0.73720	0.533000	0.62120	AAG	.		0.597	POLD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250994.2	NM_001127218	
VOPP1	81552	hgsc.bcm.edu	37	7	55639970	55639970	+	Silent	SNP	G	G	A	rs200450690	byFrequency	TCGA-OR-A5LF-01A-11D-A30A-10	TCGA-OR-A5LF-10A-01D-A30A-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2cf21c74-97c0-46f3-8e1a-197f9737b5b5	bcf5a948-3260-455b-b930-5cec0d656728	g.chr7:55639970G>A	ENST00000285279.5	-	1	248	c.48C>T	c.(46-48)ctC>ctT	p.L16L	VOPP1_ENST00000428648.1_5'Flank|VOPP1_ENST00000471168.1_Intron|VOPP1_ENST00000427700.1_5'UTR|RP11-310H4.1_ENST00000454777.1_RNA	NM_001284282.1|NM_030796.3	NP_001271211.1|NP_110423.3	Q96AW1	VOPP1_HUMAN	vesicular, overexpressed in cancer, prosurvival protein 1	16					regulation of transcription, DNA-templated (GO:0006355)|signal transduction (GO:0007165)|transcription, DNA-templated (GO:0006351)	cytoplasmic vesicle membrane (GO:0030659)|endosome (GO:0005768)|integral component of organelle membrane (GO:0031301)	signal transducer activity (GO:0004871)			endometrium(1)|lung(4)	5						CTACCTCCAAGAGCAGCCCGA	0.766													G|||	26	0.00519169	0.003	0.0043	5008	,	,		7996	0.0		0.0139	False		,,,				2504	0.0051				p.L16L		.											.	.	0			c.C48T						.	G		3,2939		0,3,1468	3.0	4.0	3.0		48	-3.5	0.1	7		3	50,6732		0,50,3341	no	coding-synonymous	VOPP1	NM_030796.3		0,53,4809	AA,AG,GG		0.7372,0.102,0.545		16/173	55639970	53,9671	1471	3391	4862	SO:0001819	synonymous_variant	81552	exon1			CTCCAAGAGCAGC		CCDS47588.1, CCDS64654.1, CCDS64656.1	7p11.2	2010-06-22			ENSG00000154978	ENSG00000154978			34518	protein-coding gene	gene with protein product	"""Glioblastoma-amplified secreted protein"", ""EGFR-coamplified and overexpressed protein"""	611915				15735698	Standard	NM_030796		Approved	ECop, GASP, FLJ20532, DKFZp564K0822	uc003tqs.3	Q96AW1	OTTHUMG00000156124	ENST00000285279.5:c.48C>T	7.37:g.55639970G>A		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	12	11	NM_030796	0	0	0	0	0	B0AZU1|B2RAT4|B3KS72|C9JWR3|Q6FIE3|Q8NBN8|Q96RE5|Q9H0W4	Silent	SNP	ENST00000285279.5	37	CCDS47588.1																																																																																			G|0.994;A|0.006		0.766	VOPP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000343074.1	NM_030796	
KCP	375616	hgsc.bcm.edu	37	7	128550681	128550681	+	RNA	DEL	C	C	-	rs11335250|rs398006231|rs112748667		TCGA-OR-A5LF-01A-11D-A30A-10	TCGA-OR-A5LF-10A-01D-A30A-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2cf21c74-97c0-46f3-8e1a-197f9737b5b5	bcf5a948-3260-455b-b930-5cec0d656728	g.chr7:128550681delC	ENST00000476647.2	-	0	92							Q6ZWJ8	KCP_HUMAN	kielin/chordin-like protein							extracellular region (GO:0005576)				central_nervous_system(1)|endometrium(3)	4						AGCGCCAGGGCCCCCGAGGTG	0.761													?|CCCCC|CCCC|unsure	5008	1.0	1.0	1.0	5008	,	,		11787	1.0		1.0	False		,,,				2504	1.0				.		.											.	KCP-68	0			c.49+1G>-						.		,	1955,3		977,1,1	1.0	2.0	2.0		,		0.6	7	dbSNP_130	11	3848,2		1924,0,1	no	frameshift,frameshift	KCP	NM_199349.2,NM_001135914.1	,	2901,1,2	A1A1,A1R,RR		0.0519,0.1532,0.0861	,	,	128550681	5803,5	255	884	1139			375616	exon2			CCAGGGCCCCCGA	AK122706		7q32.3	2009-11-06	2009-02-18	2009-02-18	ENSG00000135253	ENSG00000135253			17585	protein-coding gene	gene with protein product	"""kielin"""	609344	"""cysteine rich BMP regulator 2 (chordin-like)"""	CRIM2		15793581	Standard	NM_001135914		Approved	FLJ33365, NET67	uc011kor.2	Q6ZWJ8	OTTHUMG00000158363		7.37:g.128550681delC		Somatic	1	1		WXS	Illumina GAIIx	Phase_I	28	28	NM_001135914	0	0	0	0	0	Q8NBE0	Splice_Site	DEL	ENST00000476647.2	37																																																																																				.		0.761	KCP-006	KNOWN	basic	processed_transcript	processed_transcript	OTTHUMT00000403051.1	NM_199349	
ZNF282	8427	broad.mit.edu	37	7	148892715	148892715	+	Missense_Mutation	SNP	C	C	A			TCGA-OR-A5LF-01A-11D-A30A-10	TCGA-OR-A5LF-10A-01D-A30A-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2cf21c74-97c0-46f3-8e1a-197f9737b5b5	bcf5a948-3260-455b-b930-5cec0d656728	g.chr7:148892715C>A	ENST00000262085.3	+	1	139	c.34C>A	c.(34-36)Cag>Aag	p.Q12K	ZNF282_ENST00000479907.1_Missense_Mutation_p.Q12K	NM_003575.2	NP_003566.1	Q9UDV7	ZN282_HUMAN	zinc finger protein 282	12					negative regulation of transcription, DNA-templated (GO:0045892)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			endometrium(3)|large_intestine(3)|lung(7)|prostate(2)|skin(1)|urinary_tract(1)	17	Melanoma(164;0.15)		OV - Ovarian serous cystadenocarcinoma(82;0.00171)	Lung(243;0.145)		GCAGCCTCAGCAGCTGGGCAT	0.697																																					p.Q12K		.											.	ZNF282-90	0			c.C34A						.						14.0	16.0	15.0					7																	148892715		2199	4291	6490	SO:0001583	missense	8427	exon1			CCTCAGCAGCTGG	D30612	CCDS5895.1	7q36.1	2013-01-08			ENSG00000170265	ENSG00000170265		"""Zinc fingers, C2H2-type"", ""-"""	13076	protein-coding gene	gene with protein product		603397				9396811	Standard	NM_003575		Approved	HUB1	uc003wfm.3	Q9UDV7	OTTHUMG00000158974	ENST00000262085.3:c.34C>A	7.37:g.148892715C>A	ENSP00000262085:p.Gln12Lys	Somatic	41	0		WXS	Illumina GAIIx	Phase_I	124	7	NM_003575	0	0	0	0	0	B4DRI5|O43691|Q6DKK0	Missense_Mutation	SNP	ENST00000262085.3	37	CCDS5895.1	.	.	.	.	.	.	.	.	.	.	C	18.48	3.633659	0.67015	.	.	ENSG00000170265	ENST00000262085;ENST00000479907	T;T	0.06687	3.27;5.03	4.52	4.52	0.55395	.	0.000000	0.39407	N	0.001372	T	0.10551	0.0258	N	0.14661	0.345	0.36407	D	0.863497	P;P	0.42409	0.779;0.713	B;P	0.51742	0.264;0.678	T	0.25433	-1.0132	10	0.87932	D	0	-28.2375	12.7526	0.57316	0.0:1.0:0.0:0.0	.	12;12	B4DRI5;Q9UDV7	.;ZN282_HUMAN	K	12	ENSP00000262085:Q12K;ENSP00000418840:Q12K	ENSP00000262085:Q12K	Q	+	1	0	ZNF282	148523648	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	3.035000	0.49759	2.024000	0.59613	0.313000	0.20887	CAG	.		0.697	ZNF282-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352746.1	NM_003575	
ZNF775	285971	hgsc.bcm.edu	37	7	150094851	150094851	+	Missense_Mutation	SNP	A	A	G	rs13225910	byFrequency	TCGA-OR-A5LF-01A-11D-A30A-10	TCGA-OR-A5LF-10A-01D-A30A-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2cf21c74-97c0-46f3-8e1a-197f9737b5b5	bcf5a948-3260-455b-b930-5cec0d656728	g.chr7:150094851A>G	ENST00000329630.5	+	3	1389	c.1282A>G	c.(1282-1284)Acg>Gcg	p.T428A		NM_173680.3	NP_775951.2	Q96BV0	ZN775_HUMAN	zinc finger protein 775	428			T -> A (in dbSNP:rs13225910).		regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|liver(1)|lung(7)|skin(1)	11	Ovarian(565;0.183)|Melanoma(164;0.226)		OV - Ovarian serous cystadenocarcinoma(82;0.0173)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)		GGCCCGGGACACGCTGTGGGG	0.756													G|||	1894	0.378195	0.2814	0.3228	5008	,	,		7213	0.4702		0.4354	False		,,,				2504	0.3947				p.T428A		.											.	ZNF775-90	0			c.A1282G						.	G	ALA/THR	951,2643		177,597,1023	4.0	5.0	4.0		1282	1.2	0.0	7	dbSNP_121	4	2946,4600		676,1594,1503	no	missense	ZNF775	NM_173680.3	58	853,2191,2526	GG,GA,AA		39.0406,26.4608,34.982	benign	428/538	150094851	3897,7243	1797	3773	5570	SO:0001583	missense	285971	exon3			CGGGACACGCTGT	BC038111	CCDS43678.1	7q36.1	2013-01-08			ENSG00000196456	ENSG00000196456		"""Zinc fingers, C2H2-type"""	28501	protein-coding gene	gene with protein product						12477932	Standard	NM_173680		Approved	MGC33584	uc003whf.1	Q96BV0	OTTHUMG00000158324	ENST00000329630.5:c.1282A>G	7.37:g.150094851A>G	ENSP00000330838:p.Thr428Ala	Somatic	3	0		WXS	Illumina GAIIx	Phase_I	23	15	NM_173680	0	0	0	0	0	Q8IY24	Missense_Mutation	SNP	ENST00000329630.5	37	CCDS43678.1	922	0.42216117216117216	169	0.3434959349593496	128	0.35359116022099446	298	0.5209790209790209	327	0.4313984168865435	G	0.004	-2.282788	0.00251	0.264608	0.390406	ENSG00000196456	ENST00000329630	T	0.08008	3.14	3.27	1.23	0.21249	.	.	.	.	.	T	0.00012	0.0000	N	0.03608	-0.345	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.35325	-0.9793	7	.	.	.	.	3.7266	0.08477	0.2539:0.2047:0.5414:0.0	rs13225910	428	Q96BV0	ZN775_HUMAN	A	428	ENSP00000330838:T428A	.	T	+	1	0	ZNF775	149725784	0.006000	0.16342	0.000000	0.03702	0.003000	0.03518	0.602000	0.24134	0.141000	0.18875	-0.213000	0.12676	ACG	A|0.578;G|0.422		0.756	ZNF775-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350679.1	NM_173680	
XKR5	389610	hgsc.bcm.edu	37	8	6692968	6692968	+	RNA	SNP	C	C	T	rs2977806	byFrequency	TCGA-OR-A5LF-01A-11D-A30A-10	TCGA-OR-A5LF-10A-01D-A30A-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2cf21c74-97c0-46f3-8e1a-197f9737b5b5	bcf5a948-3260-455b-b930-5cec0d656728	g.chr8:6692968C>T	ENST00000518724.1	-	0	198				GS1-24F4.2_ENST00000500823.2_lincRNA			Q6UX68	XKR5_HUMAN	XK, Kell blood group complex subunit-related family, member 5							integral component of membrane (GO:0016021)				endometrium(1)|large_intestine(1)|lung(1)	3			STAD - Stomach adenocarcinoma(24;0.0984)	READ - Rectum adenocarcinoma(644;0.137)|COAD - Colon adenocarcinoma(149;0.166)		GCGCGCTCTGCTCGGCCGCCT	0.771													C|||	2585	0.516174	0.4539	0.4294	5008	,	,		9340	0.5645		0.5308	False		,,,				2504	0.5971				p.E16E		.											.	XKR5-90	0			c.G48A						.	C		1568,974		509,550,212	1.0	3.0	2.0		48	2.0	1.0	8	dbSNP_101	2	3547,2009		1196,1155,427	no	coding-synonymous	XKR5	NM_207411.4		1705,1705,639	TT,TC,CC		36.1591,38.3163,36.8363		16/687	6692968	5115,2983	1271	2778	4049			389610	exon1			GCTCTGCTCGGCC	AY358489		8p23.1	2006-01-12	2006-01-12		ENSG00000186530	ENSG00000275591			20782	protein-coding gene	gene with protein product			"""X Kell blood group precursor-related family, member 5"""				Standard	NM_207411		Approved		uc022aqv.1	Q6UX68	OTTHUMG00000153652		8.37:g.6692968C>T		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	9	8	NM_207411	0	0	0	0	0	Q5GH74	Silent	SNP	ENST00000518724.1	37																																																																																				C|0.487;T|0.513		0.771	XKR5-001	KNOWN	basic	processed_transcript	processed_transcript	OTTHUMT00000331969.2	NM_207411	
ZNF703	80139	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	8	37554967	37554967	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5LF-01A-11D-A30A-10	TCGA-OR-A5LF-10A-01D-A30A-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2cf21c74-97c0-46f3-8e1a-197f9737b5b5	bcf5a948-3260-455b-b930-5cec0d656728	g.chr8:37554967C>T	ENST00000331569.4	+	2	777	c.548C>T	c.(547-549)tCc>tTc	p.S183F		NM_025069.1	NP_079345.1	Q9H7S9	ZN703_HUMAN	zinc finger protein 703	183	Ser-rich.				adherens junction assembly (GO:0034333)|cellular response to estradiol stimulus (GO:0071392)|mammary gland epithelial cell differentiation (GO:0060644)|negative regulation of homotypic cell-cell adhesion (GO:0034111)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of mammary gland epithelial cell proliferation (GO:0033601)|regulation of canonical Wnt signaling pathway (GO:0060828)|regulation of cell cycle (GO:0051726)|regulation of transcription, DNA-templated (GO:0006355)|regulation of transforming growth factor beta receptor signaling pathway (GO:0017015)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nuclear matrix (GO:0016363)|nucleus (GO:0005634)|protein complex (GO:0043234)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)		FGFR1/ZNF703(2)	breast(1)|cervix(1)|kidney(1)|large_intestine(2)|lung(1)|pancreas(1)	7			BRCA - Breast invasive adenocarcinoma(5;7.93e-25)|LUSC - Lung squamous cell carcinoma(8;1.05e-09)			tcctcgtcctcctcgtccccG	0.697																																					p.S183F		.											.	ZNF703-523	0			c.C548T						.						13.0	11.0	12.0					8																	37554967		2113	4173	6286	SO:0001583	missense	80139	exon2			CGTCCTCCTCGTC	AK024361	CCDS6094.1	8p12	2008-05-02				ENSG00000183779			25883	protein-coding gene	gene with protein product						15897872	Standard	NM_025069		Approved	FLJ14299, ZNF503L	uc003xjy.1	Q9H7S9		ENST00000331569.4:c.548C>T	8.37:g.37554967C>T	ENSP00000332325:p.Ser183Phe	Somatic	33	0		WXS	Illumina GAIIx	Phase_I	72	23	NM_025069	0	0	0	0	0	Q5XG76	Missense_Mutation	SNP	ENST00000331569.4	37	CCDS6094.1	.	.	.	.	.	.	.	.	.	.	C	19.40	3.820344	0.71028	.	.	ENSG00000183779	ENST00000331569	T	0.51071	0.72	4.68	4.68	0.58851	.	0.000000	0.34025	N	0.004326	T	0.46268	0.1384	N	0.08118	0	0.42549	D	0.993108	D	0.63880	0.993	D	0.66196	0.942	T	0.56318	-0.7999	10	0.62326	D	0.03	-14.5352	13.0935	0.59178	0.0:1.0:0.0:0.0	.	183	Q9H7S9	ZN703_HUMAN	F	183	ENSP00000332325:S183F	ENSP00000332325:S183F	S	+	2	0	ZNF703	37674125	0.483000	0.25956	0.991000	0.47740	0.902000	0.53008	5.139000	0.64801	2.155000	0.67459	0.462000	0.41574	TCC	.		0.697	ZNF703-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376683.2	NM_025069	
MAL2	114569	hgsc.bcm.edu	37	8	120220776	120220776	+	Splice_Site	DEL	G	G	-	rs398009582|rs71302978		TCGA-OR-A5LF-01A-11D-A30A-10	TCGA-OR-A5LF-10A-01D-A30A-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2cf21c74-97c0-46f3-8e1a-197f9737b5b5	bcf5a948-3260-455b-b930-5cec0d656728	g.chr8:120220776delG	ENST00000276681.6	+	1	167	c.65delG	c.(64-66)cgg>cg	p.R22fs	MAL2_ENST00000521748.1_3'UTR	NM_052886.2	NP_443118.1	Q969L2	MAL2_HUMAN	mal, T-cell differentiation protein 2 (gene/pseudogene)	22						cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)						all_cancers(13;1.91e-26)|Lung NSC(37;8.61e-08)|Ovarian(258;0.018)|Hepatocellular(40;0.161)		STAD - Stomach adenocarcinoma(47;0.000967)			CCGCCGCCCCGGGGTCACCCT	0.771													GGG|GGGG|GGG|insertion	5008	1.0	1.0	1.0	5008	,	,		6681	1.0		1.0	False		,,,				2504	1.0				.		.											.	.	0			c.64+1G>-						.			1571,11		785,1,5	1.0	1.0	1.0			0.7	0.8	8	dbSNP_130	1	4116,22		2057,2,10	no	frameshift	MAL2	NM_052886.2		2842,3,15	A1A1,A1R,RR		0.5317,0.6953,0.5769			120220776	5687,33	184	483	667	SO:0001630	splice_region_variant	114569	exon1			CGCCCCGGGGTCA	AL117612	CCDS75780.1	8q23	2011-01-26	2011-01-26			ENSG00000147676			13634	protein-coding gene	gene with protein product	"""MAL proteolipid protein 2"""	609684				11549320	Standard	NM_052886		Approved		uc003yop.3	Q969L2		ENST00000276681.6:c.66+1G>-	8.37:g.120220776delG		Somatic	4	4		WXS	Illumina GAIIx	Phase_I	41	38	NM_052886	0	0	0	0	0	B2R520|Q6ZMD9	Splice_Site	DEL	ENST00000276681.6	37																																																																																				.		0.771	MAL2-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_052886	Frame_Shift_Del
SCRIB	23513	hgsc.bcm.edu	37	8	144874554	144874554	+	Silent	SNP	T	T	C	rs6991873	byFrequency	TCGA-OR-A5LF-01A-11D-A30A-10	TCGA-OR-A5LF-10A-01D-A30A-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2cf21c74-97c0-46f3-8e1a-197f9737b5b5	bcf5a948-3260-455b-b930-5cec0d656728	g.chr8:144874554T>C	ENST00000320476.3	-	32	4356	c.4350A>G	c.(4348-4350)ccA>ccG	p.P1450P	SCRIB_ENST00000356994.2_Silent_p.P1450P|RP11-429J17.8_ENST00000527139.1_RNA|RP11-429J17.8_ENST00000532625.1_RNA|SCRIB_ENST00000377533.3_Silent_p.P1369P|SCRIB_ENST00000546337.1_5'Flank|RP11-429J17.8_ENST00000534089.1_RNA	NM_015356.4	NP_056171	Q14160	SCRIB_HUMAN	scribbled planar cell polarity protein	1450					activation of Rac GTPase activity (GO:0032863)|apoptotic process involved in morphogenesis (GO:0060561)|astrocyte cell migration (GO:0043615)|asymmetric protein localization (GO:0008105)|auditory receptor cell stereocilium organization (GO:0060088)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|cochlear nucleus development (GO:0021747)|establishment of apical/basal cell polarity (GO:0035089)|mammary gland duct morphogenesis (GO:0060603)|negative regulation of mitotic cell cycle (GO:0045930)|neural tube closure (GO:0001843)|positive chemotaxis (GO:0050918)|positive regulation of apoptotic process (GO:0043065)|positive regulation of receptor recycling (GO:0001921)|protein localization to adherens junction (GO:0071896)|single organismal cell-cell adhesion (GO:0016337)|synaptic vesicle endocytosis (GO:0048488)|synaptic vesicle targeting (GO:0016080)|viral process (GO:0016032)|wound healing (GO:0042060)	basolateral plasma membrane (GO:0016323)|cell projection (GO:0042995)|cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|extracellular vesicular exosome (GO:0070062)|myelin sheath abaxonal region (GO:0035748)|plasma membrane (GO:0005886)|Scrib-APC-beta-catenin complex (GO:0034750)				NS(1)|autonomic_ganglia(1)|central_nervous_system(2)|endometrium(3)|kidney(3)|large_intestine(3)|lung(20)|ovary(2)|pancreas(1)|skin(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	42	all_cancers(97;2.31e-11)|all_epithelial(106;1.58e-09)|Lung NSC(106;0.00013)|all_lung(105;0.000374)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;2.46e-41)|Epithelial(56;1.23e-39)|all cancers(56;1.12e-34)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.18)			CTCCCAGGGGTGGGGGGGACG	0.751													T|||	4958	0.990016	0.9652	0.9971	5008	,	,		8428	1.0		0.998	False		,,,				2504	1.0				p.P1450P	Pancreas(51;966 1133 10533 14576 29674)	.											.	SCRIB-228	0			c.A4350G						.	T	,	3300,62		1619,62,0	3.0	4.0	4.0		4350,4350	-2.9	0.0	8	dbSNP_116	4	7076,4		3536,4,0	no	coding-synonymous,coding-synonymous	SCRIB	NM_015356.3,NM_182706.3	,	5155,66,0	CC,CT,TT		0.0565,1.8441,0.6321	,	1450/1631,1450/1656	144874554	10376,66	1681	3540	5221	SO:0001819	synonymous_variant	23513	exon32			CAGGGGTGGGGGG	AY062238	CCDS6411.1, CCDS6412.1	8q24.3	2013-03-05	2013-03-05		ENSG00000180900	ENSG00000180900			30377	protein-coding gene	gene with protein product		607733	"""scribbled homolog (Drosophila)"""			11027293, 14681682	Standard	NM_182706		Approved	KIAA0147, SCRB1, Vartul	uc003yzo.1	Q14160	OTTHUMG00000165154	ENST00000320476.3:c.4350A>G	8.37:g.144874554T>C		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	15	15	NM_015356	0	0	0	0	0	Q6P496|Q7Z5D1|Q8WWV8|Q96C69|Q96GG1	Silent	SNP	ENST00000320476.3	37	CCDS6411.1	2162	0.98992673992674	472	0.959349593495935	361	0.9972375690607734	572	1.0	757	0.9986807387862797	T	5.986	0.365776	0.11352	0.981559	0.999435	ENSG00000180900	ENST00000526832	.	.	.	4.01	-2.89	0.05665	.	.	.	.	.	T	0.00012	0.0000	.	.	.	0.80722	P	0.0	.	.	.	.	.	.	T	0.20773	-1.0265	3	.	.	.	.	6.6143	0.22769	0.0:0.6476:0.1513:0.201	rs6991873	.	.	.	A	470	.	.	T	-	1	0	SCRIB	144946542	0.000000	0.05858	0.000000	0.03702	0.031000	0.12232	-0.411000	0.07142	-0.857000	0.04115	-0.386000	0.06593	ACC	T|0.010;C|0.990		0.751	SCRIB-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000382215.1	NM_015356	
PLEC	5339	hgsc.bcm.edu	37	8	144998169	144998169	+	Silent	SNP	C	C	T	rs1140522	byFrequency	TCGA-OR-A5LF-01A-11D-A30A-10	TCGA-OR-A5LF-10A-01D-A30A-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2cf21c74-97c0-46f3-8e1a-197f9737b5b5	bcf5a948-3260-455b-b930-5cec0d656728	g.chr8:144998169C>T	ENST00000322810.4	-	31	6508	c.6339G>A	c.(6337-6339)gcG>gcA	p.A2113A	PLEC_ENST00000356346.3_Silent_p.A1962A|PLEC_ENST00000354589.3_Silent_p.A1976A|PLEC_ENST00000354958.2_Silent_p.A1954A|PLEC_ENST00000357649.2_Silent_p.A1980A|PLEC_ENST00000436759.2_Silent_p.A2003A|PLEC_ENST00000345136.3_Silent_p.A1976A|PLEC_ENST00000398774.2_Silent_p.A1944A|PLEC_ENST00000527096.1_Silent_p.A1999A	NM_201380.2	NP_958782.1	Q15149	PLEC_HUMAN	plectin	2113	Central fibrous rod domain.				apoptotic process (GO:0006915)|cell junction assembly (GO:0034329)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)	costamere (GO:0043034)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|hemidesmosome (GO:0030056)|intermediate filament cytoskeleton (GO:0045111)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|sarcoplasm (GO:0016528)	ankyrin binding (GO:0030506)|poly(A) RNA binding (GO:0044822)|structural constituent of muscle (GO:0008307)			NS(1)|breast(3)|central_nervous_system(4)|cervix(7)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(8)|lung(57)|ovary(4)|pancreas(2)|prostate(11)|skin(9)|stomach(2)|upper_aerodigestive_tract(10)	137						CCTCCTCCGCCGCCAGCTGCC	0.741													C|||	1156	0.230831	0.028	0.2968	5008	,	,		12421	0.1429		0.4274	False		,,,				2504	0.3466				p.A2113A		.											.	PLEC-141	0			c.G6339A						.	C	,,,,,,,	297,3657		19,259,1699	5.0	7.0	6.0		6009,5886,5862,6339,5832,5928,5940,5928	-8.9	0.0	8	dbSNP_86	6	2901,4993		551,1799,1597	no	coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous	PLEC	NM_000445.3,NM_201378.2,NM_201379.1,NM_201380.2,NM_201381.1,NM_201382.2,NM_201383.1,NM_201384.1	,,,,,,,	570,2058,3296	TT,TC,CC		36.7494,7.5114,26.9919	,,,,,,,	2003/4575,1962/4534,1954/4526,2113/4685,1944/4516,1976/4548,1980/4552,1976/4548	144998169	3198,8650	1977	3947	5924	SO:0001819	synonymous_variant	5339	exon31			CTCCGCCGCCAGC	U53204	CCDS43769.1, CCDS43770.1, CCDS43771.1, CCDS43772.1, CCDS43773.1, CCDS43774.1, CCDS43775.1, CCDS47936.1	8q24	2010-02-04	2010-02-04	2010-02-04	ENSG00000178209	ENSG00000178209			9069	protein-coding gene	gene with protein product		601282	"""plectin 1, intermediate filament binding protein, 500kD"", ""epidermolysis bullosa simplex 1 (Ogna)"", ""plectin 1, intermediate filament binding protein 500kDa"""	EBS1, PLEC1		8633055, 8696340	Standard	XM_005250976		Approved	PCN, PLTN	uc003zaf.1	Q15149	OTTHUMG00000165291	ENST00000322810.4:c.6339G>A	8.37:g.144998169C>T		Somatic	2	0		WXS	Illumina GAIIx	Phase_I	46	20	NM_201380	0	0	0	0	0	Q15148|Q16640|Q6S376|Q6S377|Q6S378|Q6S379|Q6S380|Q6S381|Q6S382|Q6S383	Silent	SNP	ENST00000322810.4	37	CCDS43772.1																																																																																			C|0.740;T|0.260		0.741	PLEC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383281.1	NM_000445	
ZNF517	340385	hgsc.bcm.edu	37	8	146033347	146033347	+	Missense_Mutation	SNP	T	T	C	rs2976653	byFrequency	TCGA-OR-A5LF-01A-11D-A30A-10	TCGA-OR-A5LF-10A-01D-A30A-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2cf21c74-97c0-46f3-8e1a-197f9737b5b5	bcf5a948-3260-455b-b930-5cec0d656728	g.chr8:146033347T>C	ENST00000531720.1	+	4	1091	c.1046T>C	c.(1045-1047)gTg>gCg	p.V349A	ZNF517_ENST00000525105.1_Intron|ZNF517_ENST00000526178.1_Intron|ZNF517_ENST00000359971.3_Missense_Mutation_p.V349A			Q6ZMY9	ZN517_HUMAN	zinc finger protein 517	349				V -> A (in Ref. 1; BAD18586). {ECO:0000305}.	regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(2)|large_intestine(2)|lung(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	13	all_cancers(97;1.03e-11)|all_epithelial(106;6.69e-11)|Lung NSC(106;4.08e-05)|all_lung(105;0.000125)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		Epithelial(56;5.47e-39)|OV - Ovarian serous cystadenocarcinoma(54;6.38e-39)|all cancers(56;5.47e-34)|BRCA - Breast invasive adenocarcinoma(115;0.0355)|Colorectal(110;0.055)			GACGGCGGCGTGGGGCAGGGC	0.746													C|||	4981	0.994609	1.0	1.0	5008	,	,		12856	1.0		0.994	False		,,,				2504	0.9785				p.V349A		.											.	ZNF517-90	0			c.T1046C						.	C	ALA/VAL	3411,3		1704,3,0	3.0	5.0	4.0		1046	-0.8	0.0	8	dbSNP_101	4	7050,46		3502,46,0	no	missense	ZNF517	NM_213605.2	64	5206,49,0	CC,CT,TT		0.6483,0.0879,0.4662	benign	349/493	146033347	10461,49	1707	3548	5255	SO:0001583	missense	340385	exon5			GCGGCGTGGGGCA	AK096527	CCDS6434.1	8q24.3	2013-01-08				ENSG00000197363		"""Zinc fingers, C2H2-type"", ""-"""	27984	protein-coding gene	gene with protein product							Standard	NM_213605		Approved		uc003zed.1	Q6ZMY9		ENST00000531720.1:c.1046T>C	8.37:g.146033347T>C	ENSP00000436103:p.Val349Ala	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	36	36	NM_213605	0	0	0	0	0		Missense_Mutation	SNP	ENST00000531720.1	37	CCDS6434.1	2179|2179	0.9977106227106227|0.9977106227106227	492|492	1.0|1.0	362|362	1.0|1.0	572|572	1.0|1.0	753|753	0.9934036939313984|0.9934036939313984	C|C	0.021|0.021	-1.418607|-1.418607	0.01136|0.01136	0.999121|0.999121	0.993517|0.993517	ENSG00000197363|ENSG00000197363	ENST00000359971;ENST00000531720|ENST00000529429	T;T|.	0.05319|.	3.46;3.46|.	2.17|2.17	-0.838|-0.838	0.10762|0.10762	.|.	.|.	.|.	.|.	.|.	T|T	0.00012|0.00012	0.0000|0.0000	L|L	0.35644|0.35644	1.08|1.08	0.80722|0.80722	P|P	0.0|0.0	B|.	0.02656|.	0.0|.	B|.	0.01281|.	0.0|.	T|T	0.21449|0.21449	-1.0245|-1.0245	8|4	0.59425|.	D|.	0.04|.	.|.	0.241|0.241	0.00192|0.00192	0.362:0.2246:0.2135:0.1999|0.362:0.2246:0.2135:0.1999	rs2976653;rs59817342|rs2976653;rs59817342	349|.	Q6ZMY9|.	ZN517_HUMAN|.	A|R	349|316	ENSP00000353058:V349A;ENSP00000436103:V349A|.	ENSP00000353058:V349A|.	V|W	+|+	2|1	0|0	ZNF517|ZNF517	146004151|146004151	0.001000|0.001000	0.12720|0.12720	0.002000|0.002000	0.10522|0.10522	0.004000|0.004000	0.04260|0.04260	-0.400000|-0.400000	0.07241|0.07241	-0.612000|-0.612000	0.05701|0.05701	-1.157000|-1.157000	0.01802|0.01802	GTG|TGG	G|0.992;C|0.006		0.746	ZNF517-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382642.1	XM_291261	
C9orf66	157983	hgsc.bcm.edu	37	9	214706	214706	+	Missense_Mutation	SNP	G	G	C	rs540473	byFrequency	TCGA-OR-A5LF-01A-11D-A30A-10	TCGA-OR-A5LF-10A-01D-A30A-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2cf21c74-97c0-46f3-8e1a-197f9737b5b5	bcf5a948-3260-455b-b930-5cec0d656728	g.chr9:214706G>C	ENST00000382387.2	-	1	1187	c.691C>G	c.(691-693)Cga>Gga	p.R231G	DOCK8_ENST00000453981.1_5'Flank|DOCK8_ENST00000432829.2_5'Flank	NM_152569.2	NP_689782.2	Q5T8R8	CI066_HUMAN	chromosome 9 open reading frame 66	231	Arg-rich.		R -> G (in dbSNP:rs540473).							central_nervous_system(1)|cervix(1)|kidney(1)|skin(1)	4	all_lung(41;0.218)	all_cancers(5;2.09e-12)|all_epithelial(5;6.16e-09)|all_lung(10;1.15e-08)|Lung NSC(10;1.91e-08)|Acute lymphoblastic leukemia(5;0.00457)|all_hematologic(5;0.0332)|Breast(48;0.0646)|Prostate(43;0.137)	Kidney(42;0.112)|KIRC - Kidney renal clear cell carcinoma(5;0.157)	all cancers(5;0.000704)|Lung(218;0.00755)|GBM - Glioblastoma multiforme(5;0.0149)|Epithelial(6;0.0154)		CCCCAGTATCGGGAGGCCAGT	0.791													C|||	2724	0.54393	0.4856	0.5504	5008	,	,		9921	0.7401		0.4324	False		,,,				2504	0.5307				p.R231G		.											.	C9orf66-514	0			c.C691G						.	C	GLY/ARG	1470,1990		362,746,622	3.0	4.0	4.0		691	1.7	0.9	9	dbSNP_83	4	2548,4318		590,1368,1475	no	missense	C9orf66	NM_152569.2	125	952,2114,2097	CC,CG,GG		37.1104,42.4855,38.9115	benign	231/296	214706	4018,6308	1730	3433	5163	SO:0001583	missense	157983	exon1			AGTATCGGGAGGC	AK055720	CCDS6439.1	9p24.3	2008-02-05			ENSG00000183784	ENSG00000183784			26436	protein-coding gene	gene with protein product							Standard	NM_152569		Approved	FLJ31158	uc003zge.4	Q5T8R8	OTTHUMG00000021017	ENST00000382387.2:c.691C>G	9.37:g.214706G>C	ENSP00000371824:p.Arg231Gly	Somatic	2	0		WXS	Illumina GAIIx	Phase_I	10	8	NM_152569	0	0	0	0	0	Q96NB0	Missense_Mutation	SNP	ENST00000382387.2	37	CCDS6439.1	1127	0.5160256410256411	240	0.4878048780487805	182	0.5027624309392266	387	0.6765734265734266	318	0.41952506596306066	.	6.200	0.405074	0.11754	0.424855	0.371104	ENSG00000183784	ENST00000382387	T	0.22743	1.94	3.91	1.74	0.24563	.	.	.	.	.	T	0.00012	0.0000	N	0.08118	0	0.54753	P	1.7000000000044757E-5	B	0.02656	0.0	B	0.01281	0.0	T	0.25813	-1.0121	8	0.87932	D	0	.	11.1247	0.48310	0.0:0.4274:0.5726:0.0	rs540473;rs13292950	231	Q5T8R8	CI066_HUMAN	G	231	ENSP00000371824:R231G	ENSP00000371824:R231G	R	-	1	2	C9orf66	204706	0.960000	0.32886	0.885000	0.34714	0.005000	0.04900	0.456000	0.21859	0.370000	0.24538	-0.335000	0.08231	CGA	G|0.516;C|0.484		0.791	C9orf66-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055436.1	NM_152569	
KIAA0020	9933	bcgsc.ca	37	9	2811505	2811505	+	Silent	SNP	G	G	A	rs2270888	byFrequency	TCGA-OR-A5LF-01A-11D-A30A-10	TCGA-OR-A5LF-10A-01D-A30A-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2cf21c74-97c0-46f3-8e1a-197f9737b5b5	bcf5a948-3260-455b-b930-5cec0d656728	g.chr9:2811505G>A	ENST00000397885.2	-	15	1697	c.1491C>T	c.(1489-1491)caC>caT	p.H497H		NM_014878.4	NP_055693.4	Q15397	K0020_HUMAN	KIAA0020	497	PUM-HD. {ECO:0000255|PROSITE- ProRule:PRU00318}.					endoplasmic reticulum (GO:0005783)|nucleolus (GO:0005730)	poly(A) RNA binding (GO:0044822)			NS(1)|breast(2)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(7)|lung(4)|ovary(1)	21				GBM - Glioblastoma multiforme(50;0.0319)		CTTCTTGGGCGTGTTCTTGCA	0.502													G|||	2072	0.413738	0.2035	0.3746	5008	,	,		19076	0.496		0.4742	False		,,,				2504	0.5787				p.H497H		.											.	KIAA0020-91	0			c.C1491T						.	G		1137,3269	406.6+/-333.9	132,873,1198	165.0	149.0	154.0		1491	-8.9	0.0	9	dbSNP_100	154	4300,4300	578.5+/-390.7	1081,2138,1081	no	coding-synonymous	KIAA0020	NM_014878.4		1213,3011,2279	AA,AG,GG		50.0,25.8057,41.8038		497/649	2811505	5437,7569	2203	4300	6503	SO:0001819	synonymous_variant	9933	exon15			TTGGGCGTGTTCT	AL832239	CCDS6448.2	9p24.2	2012-11-29			ENSG00000080608	ENSG00000080608			29676	protein-coding gene	gene with protein product	"""penguin homolog (Drosophila)"", ""minor histocompatibility antigen HA-8"""	609960				7584026, 7584028, 21266351	Standard	NM_014878		Approved	XTP5, PEN, PUF6, hPUF-A, HA-8	uc003zhp.1	Q15397	OTTHUMG00000019450	ENST00000397885.2:c.1491C>T	9.37:g.2811505G>A		Somatic	135	2		WXS	Illumina GAIIx	Phase_I	110	7	NM_014878	0	0	0	0	0	A8K804|Q547G7|Q5SZY9|Q6IB47|Q96B27|Q96L78|Q96L79|Q96L80	Silent	SNP	ENST00000397885.2	37	CCDS6448.2																																																																																			A|0.416;C|0.000;G|0.584;T|0.000		0.502	KIAA0020-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051529.3	NM_014878	
ERMP1	79956	hgsc.bcm.edu	37	9	5832728	5832728	+	Silent	SNP	G	G	C	rs1131727	byFrequency	TCGA-OR-A5LF-01A-11D-A30A-10	TCGA-OR-A5LF-10A-01D-A30A-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2cf21c74-97c0-46f3-8e1a-197f9737b5b5	bcf5a948-3260-455b-b930-5cec0d656728	g.chr9:5832728G>C	ENST00000339450.5	-	1	389	c.300C>G	c.(298-300)gcC>gcG	p.A100A	ERMP1_ENST00000214893.5_5'UTR|ERMP1_ENST00000381506.3_5'Flank	NM_024896.2	NP_079172.2	Q7Z2K6	ERMP1_HUMAN	endoplasmic reticulum metallopeptidase 1	100						endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	metal ion binding (GO:0046872)|metallopeptidase activity (GO:0008237)			endometrium(2)|kidney(1)|large_intestine(9)|lung(4)|ovary(1)|prostate(2)|skin(1)	20		Acute lymphoblastic leukemia(23;0.158)		GBM - Glioblastoma multiforme(50;0.00115)|Lung(218;0.111)		GGTGTCCAGCGGCCCCGCGTA	0.741													G|||	2021	0.403554	0.1309	0.428	5008	,	,		3601	0.7093		0.34	False		,,,				2504	0.5051				p.A100A		.											.	ERMP1-69	0			c.C300G						.						4.0	3.0	3.0					9																	5832728		1620	3326	4946	SO:0001819	synonymous_variant	79956	exon1			TCCAGCGGCCCCG	AB058718	CCDS34983.1	9p24	2008-02-05	2007-07-05	2007-07-05	ENSG00000099219	ENSG00000099219			23703	protein-coding gene	gene with protein product	"""Felix-ina"""	611156	"""KIAA1815"""	KIAA1815		11347906	Standard	XM_005251587		Approved	FLJ23309, FXNA	uc003zjm.1	Q7Z2K6	OTTHUMG00000019508	ENST00000339450.5:c.300C>G	9.37:g.5832728G>C		Somatic	2	0		WXS	Illumina GAIIx	Phase_I	40	36	NM_024896	0	0	0	0	0	B2RNA4|B3KSB1|Q8N5T5|Q9H5M1	Silent	SNP	ENST00000339450.5	37	CCDS34983.1																																																																																			G|0.572;C|0.428		0.741	ERMP1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354877.1	NM_024896	
KIAA2026	158358	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	5969127	5969127	+	Silent	SNP	G	G	C			TCGA-OR-A5LF-01A-11D-A30A-10	TCGA-OR-A5LF-10A-01D-A30A-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2cf21c74-97c0-46f3-8e1a-197f9737b5b5	bcf5a948-3260-455b-b930-5cec0d656728	g.chr9:5969127G>C	ENST00000399933.3	-	3	1103	c.1104C>G	c.(1102-1104)acC>acG	p.T368T	KIAA2026_ENST00000381461.2_Silent_p.T368T	NM_001017969.2	NP_001017969.2	Q5HYC2	K2026_HUMAN	KIAA2026	368										breast(6)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(11)|lung(15)|ovary(2)|prostate(2)|skin(1)	46		Acute lymphoblastic leukemia(23;0.158)		GBM - Glioblastoma multiforme(50;0.00155)|Lung(218;0.124)		CTGCTTCCCAGGTCCTATAAG	0.453																																					p.T368T		.											.	KIAA2026-92	0			c.C1104G						.						75.0	71.0	72.0					9																	5969127		1923	4125	6048	SO:0001819	synonymous_variant	158358	exon3			TTCCCAGGTCCTA	AB095946		9p24.1	2014-01-10			ENSG00000183354	ENSG00000183354			23378	protein-coding gene	gene with protein product							Standard	NM_001017969		Approved	FLJ20375	uc003zjq.4	Q5HYC2	OTTHUMG00000019507	ENST00000399933.3:c.1104C>G	9.37:g.5969127G>C		Somatic	73	0		WXS	Illumina GAIIx	Phase_I	91	28	NM_001017969	0	0	0	0	0	A8MTP2|B9EGW7|Q4VXA2|Q8IVE5	Silent	SNP	ENST00000399933.3	37																																																																																				.		0.453	KIAA2026-002	NOVEL	not_organism_supported|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000051652.2	NM_001017969	
SHB	6461	hgsc.bcm.edu	37	9	38068532	38068532	+	Silent	SNP	A	A	G	rs3750444	byFrequency	TCGA-OR-A5LF-01A-11D-A30A-10	TCGA-OR-A5LF-10A-01D-A30A-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2cf21c74-97c0-46f3-8e1a-197f9737b5b5	bcf5a948-3260-455b-b930-5cec0d656728	g.chr9:38068532A>G	ENST00000377707.3	-	1	676	c.111T>C	c.(109-111)ccT>ccC	p.P37P	RP11-613M10.9_ENST00000540557.1_Silent_p.P37P|SHB_ENST00000377700.4_Silent_p.P37P	NM_003028.2	NP_003019.2	Q15464	SHB_HUMAN	Src homology 2 domain containing adaptor protein B	37	Mediates interaction with LAT, PTK2/FAK1, JAK1 and JAK3.				angiogenesis (GO:0001525)|apoptotic process (GO:0006915)|cell differentiation (GO:0030154)|positive regulation of signal transduction (GO:0009967)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	SH3/SH2 adaptor activity (GO:0005070)			central_nervous_system(2)|endometrium(4)|lung(1)|prostate(1)|skin(1)|soft_tissue(1)|stomach(1)	11		all_epithelial(88;0.122)		GBM - Glioblastoma multiforme(29;3.27e-05)|Lung(182;0.0658)		GGGGCTGCGAAGGCCGCTCGC	0.726													G|||	2976	0.594249	0.6422	0.634	5008	,	,		7777	0.369		0.665	False		,,,				2504	0.6605				p.P37P		.											.	SHB-92	0			c.T111C						.						3.0	3.0	3.0					9																	38068532		1163	2650	3813	SO:0001819	synonymous_variant	6461	exon1			CTGCGAAGGCCGC		CCDS43806.1	9p13.2	2013-09-23	2005-05-24		ENSG00000107338	ENSG00000107338		"""SH2 domain containing"""	10838	protein-coding gene	gene with protein product		600314	"""SHB adaptor protein (a Src homology 2 protein)"", ""SHB (Src homology 2 domain containing) adaptor protein B"""			7713524	Standard	NM_003028		Approved		uc004aax.3	Q15464	OTTHUMG00000019936	ENST00000377707.3:c.111T>C	9.37:g.38068532A>G		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	6	6	NM_003028	0	0	0	0	0	B9EGM0|D3DRQ5|Q504U5|Q5VUM8	Silent	SNP	ENST00000377707.3	37	CCDS43806.1																																																																																			A|0.411;G|0.589		0.726	SHB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052490.1		
FPGS	2356	hgsc.bcm.edu	37	9	130565267	130565267	+	Missense_Mutation	SNP	A	A	G	rs11554717|rs10760502	byFrequency	TCGA-OR-A5LF-01A-11D-A30A-10	TCGA-OR-A5LF-10A-01D-A30A-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2cf21c74-97c0-46f3-8e1a-197f9737b5b5	bcf5a948-3260-455b-b930-5cec0d656728	g.chr9:130565267A>G	ENST00000373247.2	+	1	114	c.64A>G	c.(64-66)Ata>Gta	p.I22V	FPGS_ENST00000373225.3_5'Flank|FPGS_ENST00000460181.1_3'UTR|FPGS_ENST00000393706.2_Missense_Mutation_p.I22V|FPGS_ENST00000373245.1_Missense_Mutation_p.I22V	NM_004957.4	NP_004948.4	Q05932	FOLC_HUMAN	folylpolyglutamate synthase	22			I -> V (in dbSNP:rs10760502). {ECO:0000269|PubMed:14702039, ECO:0000269|PubMed:15489334, ECO:0000269|PubMed:7721888}.		brain development (GO:0007420)|folic acid metabolic process (GO:0046655)|liver development (GO:0001889)|nucleobase-containing compound metabolic process (GO:0006139)|one-carbon metabolic process (GO:0006730)|organ regeneration (GO:0031100)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|tetrahydrofolylpolyglutamate synthase activity (GO:0004326)			endometrium(2)|kidney(1)|lung(3)|ovary(1)	7					Methotrexate(DB00563)|Pralatrexate(DB06813)|Raltitrexed(DB00293)	TGCGCGCGGCATAACGACCCA	0.761													g|||	3912	0.78115	0.8956	0.6153	5008	,	,		6680	0.9583		0.6352	False		,,,				2504	0.7117				p.I22V		.											.	FPGS-90	0			c.A64G						.		VAL/ILE	2249,281		997,255,13	1.0	3.0	2.0		64	1.8	0.0	9	dbSNP_120	2	3848,1396		1394,1060,168	no	missense	FPGS	NM_004957.4	29	2391,1315,181	GG,GA,AA		26.6209,11.1067,21.5719	benign	22/588	130565267	6097,1677	1265	2622	3887	SO:0001583	missense	2356	exon1			CGCGGCATAACGA		CCDS35148.1, CCDS35149.1, CCDS75905.1	9q34.11	2013-09-19			ENSG00000136877	ENSG00000136877	6.3.2.17		3824	protein-coding gene	gene with protein product		136510					Standard	NM_004957		Approved		uc004bsg.1	Q05932	OTTHUMG00000020716	ENST00000373247.2:c.64A>G	9.37:g.130565267A>G	ENSP00000362344:p.Ile22Val	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	10	10	NM_004957	0	0	0	0	0	B3KPW4|B7Z2Z3|F5H0K6|Q5JU19|Q5JU22|Q6P2P6	Missense_Mutation	SNP	ENST00000373247.2	37	CCDS35148.1	1668	0.7637362637362637	432	0.8780487804878049	215	0.5939226519337016	545	0.9527972027972028	476	0.6279683377308707	g	3.002	-0.205821	0.06180	0.888933	0.733791	ENSG00000136877	ENST00000373247;ENST00000373245;ENST00000393706;ENST00000373228	T;T;T;T	0.29655	3.02;1.56;3.03;1.56	4.93	1.83	0.25207	.	0.868559	0.09918	N	0.738853	T	0.00012	0.0000	N	0.08118	0	0.80722	P	0.0	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.37361	-0.9709	9	0.02654	T	1	-12.2003	6.0757	0.19913	0.2469:0.2097:0.5434:0.0	rs10760502;rs17855899;rs56845445	22;22	Q05932-4;Q05932	.;FOLC_HUMAN	V	22	ENSP00000362344:I22V;ENSP00000362342:I22V;ENSP00000377309:I22V;ENSP00000362325:I22V	ENSP00000362325:I22V	I	+	1	0	FPGS	129605088	0.000000	0.05858	0.001000	0.08648	0.021000	0.10359	0.242000	0.18087	0.210000	0.20664	-0.258000	0.10820	ATA	A|0.235;G|0.765		0.761	FPGS-011	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054251.1		
WDR34	89891	hgsc.bcm.edu	37	9	131418828	131418828	+	Missense_Mutation	SNP	A	A	C	rs4837292		TCGA-OR-A5LF-01A-11D-A30A-10	TCGA-OR-A5LF-10A-01D-A30A-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2cf21c74-97c0-46f3-8e1a-197f9737b5b5	bcf5a948-3260-455b-b930-5cec0d656728	g.chr9:131418828A>C	ENST00000372715.2	-	1	238	c.178T>G	c.(178-180)Tgg>Ggg	p.W60G		NM_052844.3	NP_443076.2	Q96EX3	WDR34_HUMAN	WD repeat domain 34	60				W -> G (in Ref. 2; AAH11874/AAH01614). {ECO:0000305}.		axoneme (GO:0005930)|centriole (GO:0005814)|ciliary basal body (GO:0036064)				central_nervous_system(2)|lung(5)|skin(1)|urinary_tract(1)	9						ACCGTCTCCCAGCGGATGCCC	0.806																																					p.W60G		.											.	WDR34-92	0			c.T178G						.	C	GLY/TRP	1803,9		897,9,0	1.0	1.0	1.0		178	2.1	1.0	9	dbSNP_111	1	3858,0		1929,0,0	no	missense	WDR34	NM_052844.3	184	2826,9,0	CC,CA,AA		0.0,0.4967,0.1587	benign	60/537	131418828	5661,9	906	1929	2835	SO:0001583	missense	89891	exon1			TCTCCCAGCGGAT	BC011874	CCDS6906.2	9q34.11	2013-11-15	2013-02-19	2013-02-19	ENSG00000119333	ENSG00000119333		"""WD repeat domain containing"""	28296	protein-coding gene	gene with protein product		613363				19521662, 21953912, 24183451	Standard	NM_052844		Approved	DIC5, MGC20486, bA216B9.3, FAP133	uc004bvq.1	Q96EX3	OTTHUMG00000020750	ENST00000372715.2:c.178T>G	9.37:g.131418828A>C	ENSP00000361800:p.Trp60Gly	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	5	5	NM_052844	0	0	0	0	0	Q5VXV4|Q9BV46	Missense_Mutation	SNP	ENST00000372715.2	37	CCDS6906.2	2170	0.9935897435897436	486	0.9878048780487805	362	1.0	571	0.9982517482517482	751	0.9907651715039578	C	7.343	0.621247	0.14193	0.995033	1.0	ENSG00000119333	ENST00000372715;ENST00000451652;ENST00000419989	T;T;T	0.74106	-0.81;-0.81;-0.81	4.02	2.12	0.27331	.	0.538297	0.18788	N	0.131154	T	0.00012	0.0000	N	0.00538	-1.39	0.58432	P	1.999999999946489E-6	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.34625	-0.9821	9	0.08381	T	0.77	-3.0135	7.4804	0.27402	0.1755:0.4462:0.3784:0.0	rs4837292;rs56752541	45;60	A2A3F8;Q96EX3	.;WDR34_HUMAN	G	60;51;45	ENSP00000361800:W60G;ENSP00000411370:W51G;ENSP00000415421:W45G	ENSP00000361800:W60G	W	-	1	0	WDR34	130458649	1.000000	0.71417	0.994000	0.49952	0.970000	0.65996	0.709000	0.25734	0.259000	0.21709	-0.126000	0.14955	TGG	A|0.006;C|0.994		0.806	WDR34-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054463.1	NM_052844	
SMC1A	8243	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	X	53440047	53440047	+	Silent	SNP	A	A	G			TCGA-OR-A5LF-01A-11D-A30A-10	TCGA-OR-A5LF-10A-01D-A30A-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2cf21c74-97c0-46f3-8e1a-197f9737b5b5	bcf5a948-3260-455b-b930-5cec0d656728	g.chrX:53440047A>G	ENST00000322213.4	-	5	784	c.657T>C	c.(655-657)gcT>gcC	p.A219A	SMC1A_ENST00000375340.6_Intron	NM_006306.2	NP_006297.2	Q14683	SMC1A_HUMAN	structural maintenance of chromosomes 1A	219					DNA repair (GO:0006281)|gene expression (GO:0010467)|meiotic nuclear division (GO:0007126)|mitotic cell cycle (GO:0000278)|mitotic cell cycle checkpoint (GO:0007093)|mitotic sister chromatid cohesion (GO:0007064)|mitotic sister chromatid segregation (GO:0000070)|mitotic spindle organization (GO:0007052)|mRNA splicing, via spliceosome (GO:0000398)|negative regulation of DNA endoreduplication (GO:0032876)|response to radiation (GO:0009314)|RNA splicing (GO:0008380)|signal transduction in response to DNA damage (GO:0042770)|sister chromatid cohesion (GO:0007062)|stem cell maintenance (GO:0019827)	chromosome (GO:0005694)|chromosome, centromeric region (GO:0000775)|cohesin core heterodimer (GO:0008280)|condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinetochore (GO:0000776)|meiotic cohesin complex (GO:0030893)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|microtubule motor activity (GO:0003777)|poly(A) RNA binding (GO:0044822)|protein heterodimerization activity (GO:0046982)			NS(1)|breast(3)|central_nervous_system(3)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|lung(8)|ovary(5)|upper_aerodigestive_tract(2)	49						GCTGTACCTGAGCCCGTACTA	0.522																																					p.A219A		.											.	SMC1A-232	0			c.T657C						.						109.0	85.0	93.0					X																	53440047		2203	4300	6503	SO:0001819	synonymous_variant	8243	exon5			TACCTGAGCCCGT	S78271	CCDS14352.1, CCDS75985.1	Xp11.22-p11.21	2014-09-17	2006-07-06	2006-07-06	ENSG00000072501	ENSG00000072501		"""Structural maintenance of chromosomes proteins"""	11111	protein-coding gene	gene with protein product		300040	"""SMC1 (structural maintenance of chromosomes 1, yeast)-like 1"", ""SMC1 structural maintenance of chromosomes 1-like 1 (yeast)"""	SMC1L1		7757074	Standard	NM_006306		Approved	DXS423E, KIAA0178, SB1.8, Smcb	uc004dsg.3	Q14683	OTTHUMG00000021614	ENST00000322213.4:c.657T>C	X.37:g.53440047A>G		Somatic	103	0		WXS	Illumina GAIIx	Phase_I	139	20	NM_006306	0	0	0	0	0	O14995|Q16351|Q2M228	Silent	SNP	ENST00000322213.4	37	CCDS14352.1	.	.	.	.	.	.	.	.	.	.	A	8.813	0.935799	0.18206	.	.	ENSG00000072501	ENST00000428014	.	.	.	4.52	-1.48	0.08745	.	.	.	.	.	T	0.38453	0.1041	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.30736	-0.9968	4	.	.	.	.	0.1689	0.00111	0.3645:0.2037:0.1895:0.2424	.	.	.	.	P	224	.	.	L	-	2	0	SMC1A	53456772	0.004000	0.15560	0.998000	0.56505	0.987000	0.75469	-0.995000	0.03712	-0.180000	0.10637	0.356000	0.21956	CTC	.		0.522	SMC1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056756.2	NM_006306	
ZXDB	158586	hgsc.bcm.edu	37	X	57618845	57618845	+	Missense_Mutation	SNP	G	G	A	rs199513692		TCGA-OR-A5LF-01A-11D-A30A-10	TCGA-OR-A5LF-10A-01D-A30A-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2cf21c74-97c0-46f3-8e1a-197f9737b5b5	bcf5a948-3260-455b-b930-5cec0d656728	g.chrX:57618845G>A	ENST00000374888.1	+	1	577	c.364G>A	c.(364-366)Gag>Aag	p.E122K		NM_007157.3	NP_009088.1	P98169	ZXDB_HUMAN	zinc finger, X-linked, duplicated B	122					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)	p.E122K(1)		NS(1)|central_nervous_system(2)|endometrium(5)|kidney(1)|large_intestine(1)|lung(7)|ovary(2)|prostate(2)|skin(6)	27						GGAGGAGGCCGAGGAGGGCCC	0.756																																					p.E122K		.											.	ZXDB-130	1	Substitution - Missense(1)	skin(1)	c.G364A						.						3.0	4.0	4.0					X																	57618845		1773	3669	5442	SO:0001583	missense	158586	exon1			GAGGCCGAGGAGG	L14788	CCDS35313.1	Xp11.1	2013-01-08			ENSG00000198455	ENSG00000198455		"""Zinc fingers, C2H2-type"""	13199	protein-coding gene	gene with protein product		300236				8268913	Standard	NM_007157		Approved	ZNF905	uc004dvd.3	P98169	OTTHUMG00000021685	ENST00000374888.1:c.364G>A	X.37:g.57618845G>A	ENSP00000364023:p.Glu122Lys	Somatic	5	0		WXS	Illumina GAIIx	Phase_I	43	7	NM_007157	0	0	0	0	0	A8K151|Q9UBB3	Missense_Mutation	SNP	ENST00000374888.1	37	CCDS35313.1	.	.	.	.	.	.	.	.	.	.	.	8.440	0.850716	0.17034	.	.	ENSG00000198455	ENST00000374888	T	0.33865	1.39	2.93	2.93	0.34026	.	1.203730	0.05881	N	0.626423	T	0.25827	0.0629	L	0.27053	0.805	0.09310	N	0.999999	B	0.32071	0.355	B	0.19946	0.027	T	0.13710	-1.0499	10	0.28530	T	0.3	.	11.3184	0.49405	0.0:0.0:1.0:0.0	.	122	P98169	ZXDB_HUMAN	K	122	ENSP00000364023:E122K	ENSP00000364023:E122K	E	+	1	0	ZXDB	57635570	0.001000	0.12720	0.635000	0.29338	0.079000	0.17450	0.974000	0.29436	1.402000	0.46780	0.556000	0.70494	GAG	.		0.756	ZXDB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056922.1	NM_007157	
ZXDB	158586	hgsc.bcm.edu	37	X	57618870	57618870	+	Missense_Mutation	SNP	G	G	A	rs189164178		TCGA-OR-A5LF-01A-11D-A30A-10	TCGA-OR-A5LF-10A-01D-A30A-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2cf21c74-97c0-46f3-8e1a-197f9737b5b5	bcf5a948-3260-455b-b930-5cec0d656728	g.chrX:57618870G>A	ENST00000374888.1	+	1	602	c.389G>A	c.(388-390)gGc>gAc	p.G130D		NM_007157.3	NP_009088.1	P98169	ZXDB_HUMAN	zinc finger, X-linked, duplicated B	130					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)			NS(1)|central_nervous_system(2)|endometrium(5)|kidney(1)|large_intestine(1)|lung(7)|ovary(2)|prostate(2)|skin(6)	27						CTCCAGGGGGGCGAGAGCGGC	0.786																																					p.G130D		.											.	ZXDB-130	0			c.G389A						.						3.0	4.0	4.0					X																	57618870		1711	3557	5268	SO:0001583	missense	158586	exon1			AGGGGGGCGAGAG	L14788	CCDS35313.1	Xp11.1	2013-01-08			ENSG00000198455	ENSG00000198455		"""Zinc fingers, C2H2-type"""	13199	protein-coding gene	gene with protein product		300236				8268913	Standard	NM_007157		Approved	ZNF905	uc004dvd.3	P98169	OTTHUMG00000021685	ENST00000374888.1:c.389G>A	X.37:g.57618870G>A	ENSP00000364023:p.Gly130Asp	Somatic	2	0		WXS	Illumina GAIIx	Phase_I	34	9	NM_007157	0	0	0	0	0	A8K151|Q9UBB3	Missense_Mutation	SNP	ENST00000374888.1	37	CCDS35313.1	178	0.10729355033152502	26	0.05327868852459016	39	0.11271676300578035	57	0.10326086956521739	56	0.07407407407407407	.	0.726	-0.781881	0.02929	.	.	ENSG00000198455	ENST00000374888	T	0.33865	1.39	2.27	1.38	0.22167	.	1.379900	0.04684	N	0.412819	T	0.00468	0.0015	L	0.29908	0.895	0.80722	P	0.0	B	0.09022	0.002	B	0.06405	0.002	T	0.14420	-1.0473	9	0.18276	T	0.48	.	6.4732	0.22020	0.1715:0.0:0.8284:0.0	.	130	P98169	ZXDB_HUMAN	D	130	ENSP00000364023:G130D	ENSP00000364023:G130D	G	+	2	0	ZXDB	57635595	0.000000	0.05858	0.001000	0.08648	0.027000	0.11550	0.023000	0.13533	0.374000	0.24650	0.556000	0.70494	GGC	G|0.893;A|0.107		0.786	ZXDB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056922.1	NM_007157	
ZXDA	7789	hgsc.bcm.edu	37	X	57936462	57936462	+	Silent	SNP	G	G	A	rs60293829		TCGA-OR-A5LF-01A-11D-A30A-10	TCGA-OR-A5LF-10A-01D-A30A-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2cf21c74-97c0-46f3-8e1a-197f9737b5b5	bcf5a948-3260-455b-b930-5cec0d656728	g.chrX:57936462G>A	ENST00000358697.4	-	1	605	c.393C>T	c.(391-393)aaC>aaT	p.N131N		NM_007156.4	NP_009087.1	P98168	ZXDA_HUMAN	zinc finger, X-linked, duplicated A	131					positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	C2H2 zinc finger domain binding (GO:0070742)|metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(2)|endometrium(9)|kidney(1)|large_intestine(7)|lung(13)|ovary(2)|prostate(2)|skin(1)	37						AGCCCGCGGGGTTCGCGCCGC	0.786													G|||	1022	0.270728	0.0499	0.2622	3775	,	,		5001	0.3095		0.1829	False		,,,				2504	0.2843				p.N131N		.											.	ZXDA-131	0			c.C393T						.						4.0	5.0	4.0					X																	57936462		1821	3391	5212	SO:0001819	synonymous_variant	7789	exon1			CGCGGGGTTCGCG	L14787	CCDS14376.1	Xp11.21	2013-01-08			ENSG00000198205	ENSG00000198205		"""Zinc fingers, C2H2-type"""	13198	protein-coding gene	gene with protein product	"""zinc finger protein 896"""	300235				8268913	Standard	NM_007156		Approved	ZNF896	uc004dve.3	P98168	OTTHUMG00000021688	ENST00000358697.4:c.393C>T	X.37:g.57936462G>A		Somatic	3	0		WXS	Illumina GAIIx	Phase_I	35	6	NM_007156	0	0	0	0	0	Q9UJP7	Silent	SNP	ENST00000358697.4	37	CCDS14376.1																																																																																			G|0.766;A|0.234		0.786	ZXDA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056925.1	NM_007156	
PIN4	5303	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	71417357	71417357	+	Missense_Mutation	SNP	T	T	C			TCGA-OR-A5LF-01A-11D-A30A-10	TCGA-OR-A5LF-10A-01D-A30A-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2cf21c74-97c0-46f3-8e1a-197f9737b5b5	bcf5a948-3260-455b-b930-5cec0d656728	g.chrX:71417357T>C	ENST00000373669.2	+	4	484	c.452T>C	c.(451-453)aTg>aCg	p.M151T	PIN4_ENST00000218432.5_3'UTR|PIN4_ENST00000423432.2_Intron|RN7SL388P_ENST00000498736.2_RNA	NM_006223.3	NP_006214.2	Q9Y237	PIN4_HUMAN	protein (peptidylprolyl cis/trans isomerase) NIMA-interacting, 4 (parvulin)	126					protein folding (GO:0006457)|rRNA processing (GO:0006364)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|nucleus (GO:0005634)|preribosome (GO:0030684)|spindle (GO:0005819)	bent DNA binding (GO:0003681)|DNA binding (GO:0003677)|double-stranded DNA binding (GO:0003690)|peptidyl-prolyl cis-trans isomerase activity (GO:0003755)|poly(A) RNA binding (GO:0044822)			large_intestine(1)|lung(2)	3	Renal(35;0.156)					CATATTATTATGGTCGAAGGA	0.343																																					p.M151T		.											.	PIN4-130	0			c.T452C						.						48.0	44.0	45.0					X																	71417357		2203	4300	6503	SO:0001583	missense	5303	exon4			TTATTATGGTCGA	AB009690	CCDS14417.1, CCDS55447.1	Xq13.1	2008-02-05	2006-01-12		ENSG00000102309	ENSG00000102309			8992	protein-coding gene	gene with protein product		300252	"""protein (peptidyl-prolyl cis/trans isomerase) NIMA-interacting, 4 (parvulin)"""			16522211, 17875217	Standard	NM_006223		Approved	PAR14, PAR17, EPVH	uc004eam.3	Q9Y237	OTTHUMG00000021811	ENST00000373669.2:c.452T>C	X.37:g.71417357T>C	ENSP00000362773:p.Met151Thr	Somatic	240	0		WXS	Illumina GAIIx	Phase_I	259	105	NM_006223	0	0	0	0	0	A8E0G6|B3KXM0|F5H1P5|Q0D2H3|Q3MHV0|Q52M21|Q5HYW6|Q6IRW4	Missense_Mutation	SNP	ENST00000373669.2	37	CCDS14417.1	.	.	.	.	.	.	.	.	.	.	T	18.98	3.737811	0.69304	.	.	ENSG00000102309	ENST00000373669	.	.	.	5.34	5.34	0.76211	.	0.000000	0.85682	D	0.000000	T	0.57272	0.2042	L	0.33293	1	0.80722	D	1	B	0.25904	0.137	B	0.36959	0.237	T	0.59445	-0.7453	9	0.66056	D	0.02	-15.4313	12.1658	0.54129	0.0:0.0:0.0:1.0	.	151	Q9Y237-2	.	T	151	.	ENSP00000362773:M151T	M	+	2	0	PIN4	71334082	1.000000	0.71417	1.000000	0.80357	0.948000	0.59901	7.454000	0.80714	1.776000	0.52262	0.486000	0.48141	ATG	.		0.343	PIN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057175.2	NM_006223	
NSDHL	50814	broad.mit.edu;ucsc.edu;bcgsc.ca	37	X	152031231	152031231	+	Missense_Mutation	SNP	T	T	C			TCGA-OR-A5LF-01A-11D-A30A-10	TCGA-OR-A5LF-10A-01D-A30A-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2cf21c74-97c0-46f3-8e1a-197f9737b5b5	bcf5a948-3260-455b-b930-5cec0d656728	g.chrX:152031231T>C	ENST00000370274.3	+	5	700	c.506T>C	c.(505-507)aTt>aCt	p.I169T	NSDHL_ENST00000440023.1_Missense_Mutation_p.I169T	NM_015922.2	NP_057006.1	Q15738	NSDHL_HUMAN	NAD(P) dependent steroid dehydrogenase-like	169					cholesterol biosynthetic process (GO:0006695)|hair follicle development (GO:0001942)|labyrinthine layer blood vessel development (GO:0060716)|small molecule metabolic process (GO:0044281)|smoothened signaling pathway (GO:0007224)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|lipid particle (GO:0005811)	3-beta-hydroxy-delta5-steroid dehydrogenase activity (GO:0003854)|sterol-4-alpha-carboxylate 3-dehydrogenase (decarboxylating) activity (GO:0047012)			NS(1)|breast(1)|cervix(1)|endometrium(4)|large_intestine(3)|lung(5)	15	Acute lymphoblastic leukemia(192;6.56e-05)					ATGAAACCCATTGACTACTAC	0.433																																					p.I169T		.											.	NSDHL-130	0			c.T506C						.						173.0	152.0	159.0					X																	152031231		2203	4300	6503	SO:0001583	missense	50814	exon5			AACCCATTGACTA	X96621	CCDS14717.1	Xq28	2011-09-14			ENSG00000147383	ENSG00000147383	1.1.1.170	"""Short chain dehydrogenase/reductase superfamily / Extended SDR fold"""	13398	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 31E, member 1"""	300275				10710235, 12837764, 19027726	Standard	NM_015922		Approved	XAP104, H105e3, SDR31E1	uc004fgs.1	Q15738	OTTHUMG00000024185	ENST00000370274.3:c.506T>C	X.37:g.152031231T>C	ENSP00000359297:p.Ile169Thr	Somatic	178	2		WXS	Illumina GAIIx	Phase_I	283	103	NM_015922	0	0	0	0	0	D3DWT6|O00344	Missense_Mutation	SNP	ENST00000370274.3	37	CCDS14717.1	.	.	.	.	.	.	.	.	.	.	T	18.63	3.664615	0.67700	.	.	ENSG00000147383	ENST00000370274;ENST00000440023;ENST00000432467	D;D;D	0.83755	-1.76;-1.76;-1.76	6.17	6.17	0.99709	3-beta hydroxysteroid dehydrogenase/isomerase (1);NAD(P)-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.85137	0.5628	L	0.45470	1.425	0.80722	D	1	D	0.55800	0.973	P	0.54856	0.762	D	0.86215	0.1627	10	0.62326	D	0.03	0.0975	13.4605	0.61225	0.0:0.0:0.0:1.0	.	169	Q15738	NSDHL_HUMAN	T	169	ENSP00000359297:I169T;ENSP00000391854:I169T;ENSP00000396266:I169T	ENSP00000359297:I169T	I	+	2	0	NSDHL	151781887	1.000000	0.71417	0.933000	0.37362	0.727000	0.41649	7.971000	0.88012	2.088000	0.63022	0.486000	0.48141	ATT	.		0.433	NSDHL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060927.1	NM_015922	
PCGF6	84108	hgsc.bcm.edu	37	10	105110740	105110741	+	In_Frame_Ins	INS	-	-	GGAGGC	rs201702163|rs113359610|rs60968810	byFrequency	TCGA-OR-A5LF-01A-11D-A30A-10	TCGA-OR-A5LF-10A-01D-A30A-10	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2cf21c74-97c0-46f3-8e1a-197f9737b5b5	bcf5a948-3260-455b-b930-5cec0d656728	g.chr10:105110740_105110741insGGAGGC	ENST00000369847.3	-	1	150_151	c.83_84insGCCTCC	c.(82-84)cct>ccGCCTCCt	p.28_28P>PPP	PCGF6_ENST00000337211.4_In_Frame_Ins_p.28_28P>PPP|PCGF6_ENST00000490296.1_5'UTR	NM_001011663.1	NP_001011663.1	Q9BYE7	PCGF6_HUMAN	polycomb group ring finger 6	28	Pro-rich.				negative regulation of transcription, DNA-templated (GO:0045892)	nucleus (GO:0005634)|PcG protein complex (GO:0031519)|PRC1 complex (GO:0035102)	DNA binding (GO:0003677)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001227)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|endometrium(1)|kidney(2)|large_intestine(1)|lung(3)	8		Colorectal(252;0.0747)|Breast(234;0.128)		Epithelial(162;2.57e-09)|all cancers(201;7.21e-08)|BRCA - Breast invasive adenocarcinoma(275;0.205)		gcggggagacaggaggcggagg	0.748														2236	0.446486	0.2269	0.4337	5008	,	,		11043	0.4325		0.5149	False		,,,				2504	0.6963				p.P28delinsPPP		.											.	PCGF6-226	0			c.84_85insGCCTCC						.		,	550,2140		138,274,933					,	1.3	0.0		dbSNP_132	6	1951,3319		581,789,1265	no	coding,coding	PCGF6	NM_032154.3,NM_001011663.1	,	719,1063,2198	A1A1,A1R,RR		37.0209,20.4461,31.4196	,	,		2501,5459				SO:0001652	inframe_insertion	84108	exon1			GGAGACAGGAGGC	AB047006	CCDS7546.1, CCDS31275.1	10q24.33	2013-01-09	2005-01-17	2005-01-19	ENSG00000156374	ENSG00000156374		"""RING-type (C3HC4) zinc fingers"", ""Polycomb group ring fingers"""	21156	protein-coding gene	gene with protein product		607816	"""ring finger protein 134"""	RNF134		12167161	Standard	NM_032154		Approved	MBLR	uc001kwt.3	Q9BYE7	OTTHUMG00000018982	ENST00000369847.3:c.78_83dupGCCTCC	10.37:g.105110741_105110746dupGGAGGC	ENSP00000358862:p.ProPro28dup	Somatic	6	2		WXS	Illumina GAIIx	Phase_I	26	11	NM_032154	0	0	0	0	0	A8K3R4|Q5SYD1|Q5SYD6|Q96ID9|Q96SJ1	In_Frame_Ins	INS	ENST00000369847.3	37	CCDS31275.1																																																																																			-|0.590;GGAGGC|0.410		0.748	PCGF6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050132.1	NM_032154	
CHD8	57680	hgsc.bcm.edu;bcgsc.ca	37	14	21863156	21863157	+	Frame_Shift_Ins	INS	-	-	CTCTATCTTCATTTGTTCT			TCGA-OR-A5LF-01A-11D-A30A-10	TCGA-OR-A5LF-10A-01D-A30A-10	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2cf21c74-97c0-46f3-8e1a-197f9737b5b5	bcf5a948-3260-455b-b930-5cec0d656728	g.chr14:21863156_21863157insCTCTATCTTCATTTGTTCT	ENST00000557364.1	-	30	5567_5568	c.5304_5305insAGAACAAATGAAGATAGAG	c.(5302-5307)gaggctfs	p.A1769fs	CHD8_ENST00000555962.1_5'Flank|CHD8_ENST00000430710.3_Frame_Shift_Ins_p.A1490fs|SNORD8_ENST00000363915.1_RNA|CHD8_ENST00000399982.2_Frame_Shift_Ins_p.A1769fs|SNORD9_ENST00000362566.1_RNA			Q9HCK8	CHD8_HUMAN	chromodomain helicase DNA binding protein 8	1769					ATP catabolic process (GO:0006200)|ATP-dependent chromatin remodeling (GO:0043044)|canonical Wnt signaling pathway (GO:0060070)|DNA duplex unwinding (GO:0032508)|in utero embryonic development (GO:0001701)|negative regulation of fibroblast apoptotic process (GO:2000270)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of Wnt signaling pathway (GO:0030178)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	MLL1 complex (GO:0071339)|nucleus (GO:0005634)|protein complex (GO:0043234)	ATP binding (GO:0005524)|beta-catenin binding (GO:0008013)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)|DNA-dependent ATPase activity (GO:0008094)|histone binding (GO:0042393)|methylated histone binding (GO:0035064)|p53 binding (GO:0002039)			NS(2)|breast(1)|central_nervous_system(1)|cervix(4)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(8)|lung(33)|ovary(6)|prostate(7)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	85	all_cancers(95;0.00121)		Epithelial(56;2.55e-06)|all cancers(55;1.73e-05)	GBM - Glioblastoma multiforme(265;0.00424)		CGTTCTGCAGCCTCTATCTTCA	0.53																																					p.A1769fs		.											.	CHD8-277	0			c.5305_5306insAGAACAAATGAAGATAGAG						.																																			SO:0001589	frameshift_variant	57680	exon29			CTGCAGCCTCTAT	AB046784	CCDS45081.1, CCDS53885.1	14q11.2	2008-02-05	2004-06-22	2004-06-23		ENSG00000100888			20153	protein-coding gene	gene with protein product		610528	"""helicase with SNF2 domain 1"""	HELSNF1		10997877	Standard	NM_020920		Approved	KIAA1564, DUPLIN	uc001war.2	Q9HCK8		ENST00000557364.1:c.5286_5304dupAGAACAAATGAAGATAGAG	14.37:g.21863156_21863157insCTCTATCTTCATTTGTTCT	ENSP00000451601:p.Ala1769fs	Somatic	69	0		WXS	Illumina GAIIx	Phase_I	45	4	NM_001170629	0	0	0	0	0	Q4G0D8|Q68DQ0|Q6DKH9|Q6P440|Q6ZNL7|Q8N3Z9|Q8NCY4|Q8TBR9|Q96F26	Frame_Shift_Ins	INS	ENST00000557364.1	37	CCDS53885.1																																																																																			.		0.530	CHD8-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000410436.1	NM_020920	
VTN	7448	hgsc.bcm.edu	37	17	26699367	26699368	+	5'Flank	INS	-	-	C	rs11437594		TCGA-OR-A5LF-01A-11D-A30A-10	TCGA-OR-A5LF-10A-01D-A30A-10	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2cf21c74-97c0-46f3-8e1a-197f9737b5b5	bcf5a948-3260-455b-b930-5cec0d656728	g.chr17:26699367_26699368insC	ENST00000226218.4	-	0	0				SARM1_ENST00000457710.3_Frame_Shift_Ins_p.A72fs|CTB-96E2.3_ENST00000591482.1_RNA|TMEM199_ENST00000509083.1_Intron|SARM1_ENST00000379061.4_Intron|VTN_ENST00000536498.1_5'Flank	NM_000638.3	NP_000629.3	P04004	VTNC_HUMAN	vitronectin						cell adhesion (GO:0007155)|cell adhesion mediated by integrin (GO:0033627)|cell-matrix adhesion (GO:0007160)|endodermal cell differentiation (GO:0035987)|extracellular matrix organization (GO:0030198)|immune response (GO:0006955)|innate immune response (GO:0045087)|negative regulation of blood coagulation (GO:0030195)|negative regulation of endopeptidase activity (GO:0010951)|positive regulation of cell-substrate adhesion (GO:0010811)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein binding (GO:0032092)|positive regulation of receptor-mediated endocytosis (GO:0048260)|positive regulation of smooth muscle cell migration (GO:0014911)|positive regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030949)|positive regulation of wound healing (GO:0090303)|regulation of complement activation (GO:0030449)|smooth muscle cell-matrix adhesion (GO:0061302)	alphav-beta3 integrin-vitronectin complex (GO:0071062)|blood microparticle (GO:0072562)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix binding (GO:0050840)|heparin binding (GO:0008201)|integrin binding (GO:0005178)|polysaccharide binding (GO:0030247)|scavenger receptor activity (GO:0005044)			kidney(2)|large_intestine(7)|lung(2)|ovary(1)|upper_aerodigestive_tract(1)	13	all_lung(13;0.000533)|Lung NSC(42;0.00171)			UCEC - Uterine corpus endometrioid carcinoma (53;0.153)	Abciximab(DB00054)	CCTGGCTGCTGCGGCCGTGGGC	0.743													CC|C|CC|deletion	5008	1.0	1.0	1.0	5008	,	,		10362	1.0		1.0	False		,,,				2504	1.0				p.A105fs		.											.	.	0			c.313_314insC						.			2410,14		1203,4,5						0.8	1.0		dbSNP_120	3	4457,19		2225,7,6	no	frameshift	SARM1	NM_015077.2		3428,11,11	A1A1,A1R,RR		0.4245,0.5776,0.4783				6867,33				SO:0001631	upstream_gene_variant	23098	exon2			GCTGCTGCGGCCG	BC005046	CCDS11229.1	17q11.2	2014-08-08	2006-02-10		ENSG00000109072	ENSG00000109072		"""Endogenous ligands"""	12724	protein-coding gene	gene with protein product	"""serum spreading factor"", ""somatomedin B"", ""complement S-protein"""	193190	"""vitronectin (serum spreading factor, somatomedin B, complement S-protein)"""			2447940	Standard	NM_000638		Approved	VN	uc002hbc.3	P04004	OTTHUMG00000132500		17.37:g.26699368_26699368dupC	Exception_encountered	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	14	14	NM_015077	0	0	0	0	0	B2R7G0|P01141|Q9BSH7	Frame_Shift_Ins	INS	ENST00000226218.4	37	CCDS11229.1																																																																																			-|0.009;C|0.991		0.743	VTN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255680.2	NM_000638	
MCC	4163	broad.mit.edu	37	5	112824048	112824049	+	In_Frame_Ins	INS	-	-	GCC	rs35336557|rs531679771|rs370593160	byFrequency	TCGA-OR-A5LF-01A-11D-A30A-10	TCGA-OR-A5LF-10A-01D-A30A-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2cf21c74-97c0-46f3-8e1a-197f9737b5b5	bcf5a948-3260-455b-b930-5cec0d656728	g.chr5:112824048_112824049insGCC	ENST00000408903.3	-	1	478_479	c.63_64insGGC	c.(61-66)ggcagc>ggcGGCagc	p.21_22insG		NM_001085377.1	NP_001078846	P23508	CRCM_HUMAN	mutated in colorectal cancers	0					negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of epithelial cell migration (GO:0010633)|negative regulation of epithelial cell proliferation (GO:0050680)|signal transduction (GO:0007165)|Wnt signaling pathway (GO:0016055)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)			endometrium(4)|kidney(3)|large_intestine(15)|liver(2)|lung(8)|ovary(2)|pancreas(1)|prostate(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	42		all_cancers(142;5.89e-08)|all_epithelial(76;3.57e-11)|all_lung(232;0.000605)|Lung NSC(810;0.000697)|Colorectal(10;0.00146)|Prostate(80;0.00174)|Ovarian(225;0.0175)|Breast(839;0.198)		OV - Ovarian serous cystadenocarcinoma(64;2.04e-54)|Epithelial(69;9.69e-49)|all cancers(49;6.25e-44)|COAD - Colon adenocarcinoma(37;0.0432)|Colorectal(14;0.0766)		ctgctgccgctgccgccgccgc	0.738														1663	0.332069	0.0227	0.3487	5008	,	,		8489	0.5208		0.3668	False		,,,				2504	0.5082				p.S22delinsGS		.											.	MCC-69	0			c.64_65insGGC						.																																			SO:0001652	inframe_insertion	4163	exon1			TGCCGCTGCCGCC		CCDS4111.1, CCDS43351.1	5q21-q22	2013-01-10			ENSG00000171444	ENSG00000171444		"""EF-hand domain containing"""	6935	protein-coding gene	gene with protein product		159350				1848370	Standard	NM_002387		Approved		uc003kql.4	P23508	OTTHUMG00000128804	ENST00000408903.3:c.61_63dupGGC	5.37:g.112824055_112824057dupGCC	ENSP00000386227:p.Gly22_Gly23dup	Somatic	9	0		WXS	Illumina GAIIx	Phase_I	44	11	NM_001085377	0	0	0	0	0	D3DT05|Q6ZR04	In_Frame_Ins	INS	ENST00000408903.3	37	CCDS43351.1																																																																																			.		0.738	MCC-003	PUTATIVE	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000370839.1	NM_001085377	
FUCA2	2519	hgsc.bcm.edu	37	6	143832707	143832708	+	In_Frame_Ins	INS	-	-	GCAGCA			TCGA-OR-A5LF-01A-11D-A30A-10	TCGA-OR-A5LF-10A-01D-A30A-10	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2cf21c74-97c0-46f3-8e1a-197f9737b5b5	bcf5a948-3260-455b-b930-5cec0d656728	g.chr6:143832707_143832708insGCAGCA	ENST00000002165.6	-	1	119_120	c.64_65insTGCTGC	c.(64-66)ccg>cTGCTGCcg	p.21_22insLL	FUCA2_ENST00000438118.2_In_Frame_Ins_p.21_22insLL|FUCA2_ENST00000367585.1_5'UTR	NM_032020.4	NP_114409.2	Q9BTY2	FUCO2_HUMAN	fucosidase, alpha-L- 2, plasma	21					fucose metabolic process (GO:0006004)|glycoside catabolic process (GO:0016139)|regulation of entry of bacterium into host cell (GO:2000535)|response to bacterium (GO:0009617)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|lysosome (GO:0005764)	alpha-L-fucosidase activity (GO:0004560)|fucose binding (GO:0042806)			endometrium(1)|large_intestine(1)|lung(2)|ovary(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	9				OV - Ovarian serous cystadenocarcinoma(155;7.45e-06)|GBM - Glioblastoma multiforme(68;0.0142)		CGgcggcggcggcagcagcagc	0.723																																					p.P22delinsLLP		.											.	FUCA2-91	0			c.65_66insTGCTGC						.			4,3738		0,4,1867						-7.7	0.0			12	44,7236		5,34,3601	no	coding	FUCA2	NM_032020.4		5,38,5468	A1A1,A1R,RR		0.6044,0.1069,0.4355				48,10974				SO:0001652	inframe_insertion	2519	exon1			GGCGGCGGCAGCA	BC003060	CCDS5200.1	6q24	2012-10-02			ENSG00000001036	ENSG00000001036	3.2.1.51		4008	protein-coding gene	gene with protein product		136820				6590153	Standard	NM_032020		Approved	MGC1314, dJ20N2.5	uc003qjm.3	Q9BTY2	OTTHUMG00000015728	ENST00000002165.6:c.59_64dupTGCTGC	6.37:g.143832708_143832713dupGCAGCA	ENSP00000002165:p.Leu20_Leu21dup	Somatic	6	0		WXS	Illumina GAIIx	Phase_I	64	43	NM_032020	0	0	0	0	0	E9PEB6|Q7Z6V1|Q7Z6Y2|Q8NBK4	In_Frame_Ins	INS	ENST00000002165.6	37	CCDS5200.1																																																																																			.		0.723	FUCA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042521.2	NM_032020	
AVL9	23080	broad.mit.edu	37	7	32535342	32535343	+	Frame_Shift_Ins	INS	-	-	G			TCGA-OR-A5LF-01A-11D-A30A-10	TCGA-OR-A5LF-10A-01D-A30A-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2cf21c74-97c0-46f3-8e1a-197f9737b5b5	bcf5a948-3260-455b-b930-5cec0d656728	g.chr7:32535342_32535343insG	ENST00000318709.4	+	1	242_243	c.21_22insG	c.(22-24)gggfs	p.G8fs	AVL9_ENST00000409301.1_Frame_Shift_Ins_p.G8fs|LSM5_ENST00000409952.3_5'Flank|LSM5_ENST00000409909.3_5'Flank|AVL9_ENST00000404479.1_Frame_Shift_Ins_p.G8fs|AVL9_ENST00000459629.1_3'UTR	NM_015060.1	NP_055875.1	Q8NBF6	AVL9_HUMAN	AVL9 homolog (S. cerevisiase)	8					cell migration (GO:0016477)	integral component of membrane (GO:0016021)|recycling endosome (GO:0055037)				endometrium(3)|kidney(1)|large_intestine(3)|lung(7)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	18						CCAGGAGAGGCGGGGATGGCGT	0.718																																					p.G7fs		.											.	AVL9-90	0			c.21_22insG						.			54,3176		7,40,1568						-1.4	0.0			11	106,6304		12,82,3111	no	frameshift	AVL9	NM_015060.1		19,122,4679	A1A1,A1R,RR		1.6537,1.6718,1.6598				160,9480				SO:0001589	frameshift_variant	23080	exon1			GAGAGGCGGGGAT	D87682	CCDS34613.1	7p14.3	2013-05-01	2008-10-03	2008-10-03	ENSG00000105778	ENSG00000105778			28994	protein-coding gene	gene with protein product		612927	"""KIAA0241"""	KIAA0241		17229886, 22595670	Standard	XM_005249668		Approved		uc003tcv.1	Q8NBF6	OTTHUMG00000152929	ENST00000318709.4:c.25dupG	7.37:g.32535346_32535346dupG	ENSP00000315568:p.Gly8fs	Somatic	79	0		WXS	Illumina GAIIx	Phase_I	281	7	NM_015060	0	0	0	0	0	Q92573	Frame_Shift_Ins	INS	ENST00000318709.4	37	CCDS34613.1																																																																																			.		0.718	AVL9-003	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000328643.1	NM_015060	
PODXL	5420	hgsc.bcm.edu	37	7	131241029	131241030	+	In_Frame_Ins	INS	-	-	GGCGAC	rs11277659|rs547816245|rs532078953|rs79759078|rs571821675	byFrequency	TCGA-OR-A5LF-01A-11D-A30A-10	TCGA-OR-A5LF-10A-01D-A30A-10	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2cf21c74-97c0-46f3-8e1a-197f9737b5b5	bcf5a948-3260-455b-b930-5cec0d656728	g.chr7:131241029_131241030insGGCGAC	ENST00000378555.3	-	1	336_337	c.89_90insGTCGCC	c.(88-90)ccc>ccGTCGCCc	p.30_30P>PSP	PODXL_ENST00000541194.1_In_Frame_Ins_p.30_30P>PSP|PODXL_ENST00000322985.9_In_Frame_Ins_p.30_30P>PSP|PODXL_ENST00000465001.1_Intron|PODXL_ENST00000537928.1_In_Frame_Ins_p.30_30P>PSP			O00592	PODXL_HUMAN	podocalyxin-like	30					cell adhesion (GO:0007155)|cell migration (GO:0016477)|epithelial tube formation (GO:0072175)|glomerular visceral epithelial cell development (GO:0072015)|leukocyte migration (GO:0050900)|negative regulation of cell adhesion (GO:0007162)|negative regulation of cell-cell adhesion (GO:0022408)|positive regulation of cell migration (GO:0030335)|positive regulation of cell-cell adhesion mediated by integrin (GO:0033634)|regulation of microvillus assembly (GO:0032534)	apical plasma membrane (GO:0016324)|cell body (GO:0044297)|cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|integral component of plasma membrane (GO:0005887)|lamellipodium (GO:0030027)|microvillus membrane (GO:0031528)|plasma membrane (GO:0005886)|ruffle (GO:0001726)|slit diaphragm (GO:0036057)		p.P30_S31delPS(2)		NS(1)|breast(3)|endometrium(3)|kidney(3)|large_intestine(4)|lung(4)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	24	Melanoma(18;0.162)					CATTCTGGGAGggcgacggcga	0.752																																					p.P30delinsPSP		.											.	PODXL-136	2	Deletion - In frame(2)	prostate(2)	c.90_91insGTCGCC						.																																			SO:0001652	inframe_insertion	5420	exon1			CTGGGAGGGCGAC		CCDS34755.1, CCDS47714.1	7q32-q33	2008-07-18			ENSG00000128567	ENSG00000128567			9171	protein-coding gene	gene with protein product		602632					Standard	NM_001018111		Approved	PCLP, Gp200, PC	uc003vqx.4	O00592	OTTHUMG00000154918	ENST00000378555.3:c.84_89dupGTCGCC	7.37:g.131241030_131241035dupGGCGAC	ENSP00000367817:p.SerPro30dup	Somatic	5	0		WXS	Illumina GAIIx	Phase_I	86	0	NM_005397	0	0	0	0	0	A6NHX8|Q52LZ7|Q53ER6	In_Frame_Ins	INS	ENST00000378555.3	37	CCDS34755.1																																																																																			.		0.752	PODXL-005	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000337627.2	NM_001018111	
RBMXL3	139804	hgsc.bcm.edu	37	X	114425192	114425193	+	In_Frame_Ins	INS	-	-	CCCAACGCCCACAGCGGAGGCCGCTCG			TCGA-OR-A5LF-01A-11D-A30A-10	TCGA-OR-A5LF-10A-01D-A30A-10	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2cf21c74-97c0-46f3-8e1a-197f9737b5b5	bcf5a948-3260-455b-b930-5cec0d656728	g.chrX:114425192_114425193insCCCAACGCCCACAGCGGAGGCCGCTCG	ENST00000424776.3	+	1	1230_1231	c.1188_1189insCCCAACGCCCACAGCGGAGGCCGCTCG	c.(1189-1191)ccc>CCCAACGCCCACAGCGGAGGCCGCTCGccc	p.397_397P>PNAHSGGRSP	LRCH2_ENST00000538422.1_Intron|LRCH2_ENST00000317135.8_Intron	NM_001145346.1	NP_001138818.1	Q8N7X1	RMXL3_HUMAN	RNA binding motif protein, X-linked-like 3	397	Gly-rich.						nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			endometrium(13)|kidney(2)|skin(1)	16						GAGGCCGCTCGCCCGACGCCCA	0.629																																					p.S396delinsSPNAHSGGRS		.											.	.	0			c.1188_1189insCCCAACGCCCACAGCGGAGGCCGCTCG						.																																			SO:0001652	inframe_insertion	139804	exon1			CCGCTCGCCCGAC	AK097568	CCDS55478.1	Xq23	2013-02-12	2009-03-24	2009-03-24	ENSG00000175718	ENSG00000175718		"""RNA binding motif (RRM) containing"""	26859	protein-coding gene	gene with protein product			"""chromosome X open reading frame 55"""	CXorf55			Standard	NM_001145346		Approved	FLJ40249	uc011mte.1	Q8N7X1	OTTHUMG00000022230	Exception_encountered	X.37:g.114425192_114425193insCCCAACGCCCACAGCGGAGGCCGCTCG	Exception_encountered	Somatic	49	0		WXS	Illumina GAIIx	Phase_I	219	0	NM_001145346	0	0	0	0	0	B4DXC0	In_Frame_Ins	INS	ENST00000424776.3	37	CCDS55478.1																																																																																			.		0.629	RBMXL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057968.3	NM_001145346	
UVRAG	7405	hgsc.bcm.edu	37	11	75526481	75526482	+	Missense_Mutation	DNP	CC	CC	AG	rs7118569|rs386755092|rs7118567	byFrequency	TCGA-OR-A5LF-01A-11D-A30A-10	TCGA-OR-A5LF-10A-01D-A30A-10	CC	CC	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2cf21c74-97c0-46f3-8e1a-197f9737b5b5	bcf5a948-3260-455b-b930-5cec0d656728	g.chr11:75526481_75526482CC>AG	ENST00000356136.3	+	1	270_271	c.29_30CC>AG	c.(28-30)cCC>cAG	p.P10Q	RP11-535A19.2_ENST00000531263.1_RNA|RP11-535A19.2_ENST00000529719.1_RNA|RP11-535A19.2_ENST00000533945.1_RNA|RP11-535A19.2_ENST00000533590.1_RNA|RP11-535A19.2_ENST00000527219.1_RNA	NM_003369.3	NP_003360.2	Q9P2Y5	UVRAG_HUMAN	UV radiation resistance associated	10			P -> H (in dbSNP:rs7118567).		DNA repair (GO:0006281)|positive regulation of autophagy (GO:0010508)|SNARE complex assembly (GO:0035493)|viral entry into host cell (GO:0046718)	cytoplasm (GO:0005737)|early endosome (GO:0005769)|late endosome (GO:0005770)|lysosome (GO:0005764)|phagocytic vesicle (GO:0045335)|protein complex (GO:0043234)				central_nervous_system(1)|cervix(3)|endometrium(3)|kidney(1)|large_intestine(2)|lung(15)|skin(5)|urinary_tract(2)	32						GTCGGGGGCCCCGTCCCCCAGC	0.777																																					p.P10Q		.											.	UVRAG-229	0			c.C30G						.																																			SO:0001583	missense	7405	exon1			GGGCCCCGTCCCC	X99050, AB012958	CCDS8241.1	11q13	2012-11-15	2012-11-15		ENSG00000198382	ENSG00000198382			12640	protein-coding gene	gene with protein product	"""beclin 1 binding protein"""	602493	"""UV radiation resistance associated gene"""			9169138, 16799551, 18843052	Standard	NM_003369		Approved	VPS38	uc001oxc.3	Q9P2Y5	OTTHUMG00000165319	Exception_encountered	11.37:g.75526481_75526482delinsAG	ENSP00000348455:p.Pro10Gln	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	8	0	NM_003369	0	0	0	0	0	B3KTC1|O00392	Missense_Mutation	DNP	ENST00000356136.3	37	CCDS8241.1																																																																																			C|0.821;G|0.179		0.777	UVRAG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383430.1	NM_003369	
