#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_TTotCov	i_TVarCov	i_Transcript_Id	i_Trna_alt1	i_Trna_alt2	i_Trna_ref	i_Trna_tot	i_Trna_var	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
RNF207	388591	ucsc.edu;bcgsc.ca	37	1	6278414	6278414	+	Missense_Mutation	SNP	A	A	G	rs709209	byFrequency	TCGA-OR-A5LG-01A-11D-A29I-10	TCGA-OR-A5LG-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a39e8bc9-757d-4536-b301-458fc7ec992d	6b9e8d41-7044-4151-b4d6-e211b0e7a923	g.chr1:6278414A>G	ENST00000377939.4	+	17	1845	c.1718A>G	c.(1717-1719)aAc>aGc	p.N573S	RNF207_ENST00000483336.1_3'UTR|RNF207_ENST00000377948.2_3'UTR	NM_207396.2	NP_997279.2	Q6ZRF8	RN207_HUMAN	ring finger protein 207	573			N -> S (in dbSNP:rs709209). {ECO:0000269|PubMed:19305409}.			intracellular (GO:0005622)	zinc ion binding (GO:0008270)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(7)|ovary(2)	16	Ovarian(185;0.0634)	all_cancers(23;1.22e-38)|all_epithelial(116;4.25e-22)|all_lung(118;7.95e-08)|Lung NSC(185;1.6e-06)|all_neural(13;3.18e-06)|all_hematologic(16;8.99e-06)|Acute lymphoblastic leukemia(12;0.000365)|Breast(487;0.000496)|Renal(390;0.0007)|Colorectal(325;0.00104)|Glioma(11;0.00203)|Hepatocellular(190;0.00308)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0392)|Medulloblastoma(700;0.211)		Epithelial(90;4.84e-38)|GBM - Glioblastoma multiforme(13;5.77e-32)|OV - Ovarian serous cystadenocarcinoma(86;2.88e-19)|Colorectal(212;6.9e-08)|COAD - Colon adenocarcinoma(227;8.13e-06)|Kidney(185;4.89e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.000896)|BRCA - Breast invasive adenocarcinoma(365;0.00108)|STAD - Stomach adenocarcinoma(132;0.00311)|READ - Rectum adenocarcinoma(331;0.0642)|Lung(427;0.182)		AGCAGGAACAACGCGGCCTCA	0.567													G|||	2189	0.437101	0.7405	0.2939	5008	,	,		19938	0.2639		0.3469	False		,,,				2504	0.3998				p.N573S		.											.	RNF207-514	0			c.A1718G						.	G	SER/ASN	2908,1368		1019,870,249	65.0	77.0	73.0		1718	-1.3	0.0	1	dbSNP_86	73	2857,5645		495,1867,1889	yes	missense	RNF207	NM_207396.2	46	1514,2737,2138	GG,GA,AA		33.6039,31.9925,45.1166	benign	573/635	6278414	5765,7013	2138	4251	6389	SO:0001583	missense	388591	exon17			GGAACAACGCGGC	AK128246	CCDS59.2	1p36.31	2008-11-19			ENSG00000158286	ENSG00000158286		"""RING-type (C3HC4) zinc fingers"""	32947	protein-coding gene	gene with protein product	"""OTTHUMG00000001089"""		"""chromosome 1 open reading frame 188"""	C1orf188			Standard	NM_207396		Approved	FLJ46380, FLJ32096	uc001amg.3	Q6ZRF8	OTTHUMG00000001089	ENST00000377939.4:c.1718A>G	1.37:g.6278414A>G	ENSP00000367173:p.Asn573Ser	Somatic	105	1		WXS	Illumina GAIIx	Phase_I	54	5	NM_207396	0	0	7	7	0	A2VCM8|B4DFR6|Q5TGS6|Q6ZS63|Q96MP2	Missense_Mutation	SNP	ENST00000377939.4	37	CCDS59.2	864	0.3956043956043956	346	0.7032520325203252	116	0.32044198895027626	153	0.2674825174825175	249	0.32849604221635886	G	0.509	-0.867304	0.02590	0.680075	0.336039	ENSG00000158286	ENST00000377939	T	0.16196	2.36	4.71	-1.29	0.09288	.	2.289780	0.03153	N	0.168212	T	0.00012	0.0000	N	0.00707	-1.245	0.58432	P	1.0000000000287557E-6	B	0.02656	0.0	B	0.01281	0.0	T	0.41502	-0.9505	9	0.06625	T	0.88	-28.6057	1.1273	0.01738	0.2717:0.2697:0.3211:0.1375	rs709209;rs9435252;rs56791368;rs709209	573	Q6ZRF8	RN207_HUMAN	S	573	ENSP00000367173:N573S	ENSP00000367173:N573S	N	+	2	0	RNF207	6201001	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.296000	0.08287	-0.582000	0.05929	-0.213000	0.12676	AAC	A|0.587;G|0.413		0.567	RNF207-001	NOVEL	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000003669.2	NM_207396	
NOL9	79707	hgsc.bcm.edu	37	1	6614391	6614391	+	Missense_Mutation	SNP	A	A	C	rs6693391	byFrequency	TCGA-OR-A5LG-01A-11D-A29I-10	TCGA-OR-A5LG-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a39e8bc9-757d-4536-b301-458fc7ec992d	6b9e8d41-7044-4151-b4d6-e211b0e7a923	g.chr1:6614391A>C	ENST00000377705.5	-	1	204	c.172T>G	c.(172-174)Tcc>Gcc	p.S58A	TAS1R1_ENST00000333172.6_5'Flank|TAS1R1_ENST00000328191.4_5'Flank|TAS1R1_ENST00000351136.3_5'Flank	NM_024654.4	NP_078930	Q5SY16	NOL9_HUMAN	nucleolar protein 9	58			S -> A (in dbSNP:rs6693391). {ECO:0000269|PubMed:14702039, ECO:0000269|PubMed:15489334}.		maturation of 5.8S rRNA (GO:0000460)	membrane (GO:0016020)|nucleolus (GO:0005730)	ATP binding (GO:0005524)|polynucleotide 5'-hydroxyl-kinase activity (GO:0051731)|RNA binding (GO:0003723)			central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(2)|lung(9)|skin(2)|urinary_tract(1)	19	Ovarian(185;0.0212)|all_lung(157;0.154)	all_cancers(23;2.46e-35)|all_epithelial(116;1.41e-22)|all_lung(118;7.59e-07)|Lung NSC(185;4.28e-06)|Colorectal(325;4.52e-05)|Breast(487;0.000353)|Renal(390;0.0007)|Hepatocellular(190;0.00308)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0443)		Colorectal(212;1.47e-07)|COAD - Colon adenocarcinoma(227;1.47e-05)|Kidney(185;5.27e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.000971)|BRCA - Breast invasive adenocarcinoma(365;0.00113)|STAD - Stomach adenocarcinoma(132;0.0017)|READ - Rectum adenocarcinoma(331;0.0649)		TCCACGCCGGACGCCTGGGCT	0.781													C|||	4789	0.95627	0.8722	0.9841	5008	,	,		9026	0.9692		0.995	False		,,,				2504	0.9969				p.S58A		.											.	NOL9-515	0			c.T172G						.	C	ALA/SER	2196,260		975,246,7	2.0	3.0	3.0		172	3.0	0.2	1	dbSNP_116	3	4875,25		2425,25,0	no	missense	NOL9	NM_024654.4	99	3400,271,7	CC,CA,AA		0.5102,10.5863,3.8744	benign	58/703	6614391	7071,285	1228	2450	3678	SO:0001583	missense	79707	exon1			CGCCGGACGCCTG	AK091284	CCDS80.1	1p36.31	2012-05-02			ENSG00000162408	ENSG00000162408			26265	protein-coding gene	gene with protein product	"""polynucleotide 5'-kinase"""					21063389	Standard	NM_024654		Approved	FLJ23323, NET6, Grc3	uc001ans.3	Q5SY16	OTTHUMG00000000904	ENST00000377705.5:c.172T>G	1.37:g.6614391A>C	ENSP00000366934:p.Ser58Ala	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	19	19	NM_024654	0	0	0	0	0	Q2NL84|Q4VBY3|Q6P472|Q7L4D6|Q96EE0|Q9H5L4	Missense_Mutation	SNP	ENST00000377705.5	37	CCDS80.1	2092	0.9578754578754579	421	0.8556910569105691	355	0.9806629834254144	562	0.9825174825174825	754	0.9947229551451188	C	0.416	-0.910621	0.02434	0.894137	0.994898	ENSG00000162408	ENST00000377705	T	0.15718	2.4	4.0	3.05	0.35203	.	0.361559	0.20066	N	0.099972	T	0.00012	0.0000	N	0.01576	-0.805	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.37798	-0.9690	9	0.02654	T	1	-12.1681	8.8998	0.35487	0.424:0.576:0.0:0.0	rs6693391;rs56691058	58	Q5SY16	NOL9_HUMAN	A	58	ENSP00000366934:S58A	ENSP00000366934:S58A	S	-	1	0	NOL9	6536978	0.795000	0.28851	0.220000	0.23810	0.044000	0.14063	0.592000	0.23984	0.422000	0.26005	-0.285000	0.09966	TCC	A|0.047;C|0.953		0.781	NOL9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000002625.1	NM_024654	
NBPF1	55672	broad.mit.edu	37	1	16918395	16918395	+	Missense_Mutation	SNP	T	T	C	rs60769486		TCGA-OR-A5LG-01A-11D-A29I-10	TCGA-OR-A5LG-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a39e8bc9-757d-4536-b301-458fc7ec992d	6b9e8d41-7044-4151-b4d6-e211b0e7a923	g.chr1:16918395T>C	ENST00000430580.2	-	7	1009	c.122A>G	c.(121-123)aAa>aGa	p.K41R		NM_017940.3	NP_060410.2	Q3BBV0	NBPF1_HUMAN	neuroblastoma breakpoint family, member 1	41						cytoplasm (GO:0005737)									UCEC - Uterine corpus endometrioid carcinoma (279;0.00459)|BRCA - Breast invasive adenocarcinoma(304;7.52e-06)|COAD - Colon adenocarcinoma(227;1.05e-05)|Kidney(64;0.00016)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.179)		TACAAAACATTTCTCTTTGAG	0.458																																					.		.											.	.	0			.						.						392.0	394.0	394.0					1																	16918395		2203	4300	6503	SO:0001583	missense	55672	.			AAACATTTCTCTT	AB051480		1p36.13	2013-01-30			ENSG00000219481	ENSG00000219481		"""neuroblastoma breakpoint family"""	26088	protein-coding gene	gene with protein product		610501				11214970, 16079250	Standard	NM_017940		Approved	FLJ20719, KIAA1693	uc001ayw.4	Q3BBV0	OTTHUMG00000002487	ENST00000430580.2:c.122A>G	1.37:g.16918395T>C	ENSP00000474456:p.Lys41Arg	Somatic	127	1		WXS	Illumina GAIIx	Phase_I	114	8	.	0	0	9	13	4	Q8N4E8|Q9C0H0	Missense_Mutation	SNP	ENST00000430580.2	37																																																																																				.		0.458	NBPF1-005	NOVEL	upstream_uORF|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000106436.3	NM_017940	
PADI3	51702	bcgsc.ca	37	1	17575645	17575645	+	Silent	SNP	A	A	C	rs3763589	byFrequency	TCGA-OR-A5LG-01A-11D-A29I-10	TCGA-OR-A5LG-10A-01D-A29L-10	A	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a39e8bc9-757d-4536-b301-458fc7ec992d	6b9e8d41-7044-4151-b4d6-e211b0e7a923	g.chr1:17575645A>C	ENST00000375460.3	+	1	53	c.13A>C	c.(13-15)Aga>Cga	p.R5R		NM_016233.2	NP_057317.2	Q9ULW8	PADI3_HUMAN	peptidyl arginine deiminase, type III	5					protein citrullination (GO:0018101)	cytoplasm (GO:0005737)	calcium ion binding (GO:0005509)|protein-arginine deiminase activity (GO:0004668)			breast(1)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(4)|liver(2)|lung(10)|ovary(2)|prostate(1)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	32		Colorectal(325;3.46e-05)|Breast(348;0.000162)|all_lung(284;0.000337)|Lung NSC(340;0.000419)|Renal(390;0.000518)|Ovarian(437;0.00409)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00488)|BRCA - Breast invasive adenocarcinoma(304;1.17e-05)|COAD - Colon adenocarcinoma(227;1.18e-05)|Kidney(64;0.000186)|KIRC - Kidney renal clear cell carcinoma(64;0.00272)|STAD - Stomach adenocarcinoma(196;0.00656)|READ - Rectum adenocarcinoma(331;0.0655)|Lung(427;0.189)	L-Citrulline(DB00155)	GTCGCTGCAGAGAATCGTGCG	0.607													A|||	581	0.116014	0.031	0.1239	5008	,	,		17311	0.1538		0.0746	False		,,,				2504	0.229				p.R5R		.											.	PADI3-132	0			c.A13C						.	A		156,4250	106.9+/-145.3	7,142,2054	145.0	122.0	130.0		13	5.6	1.0	1	dbSNP_107	130	668,7932	168.3+/-219.8	22,624,3654	no	coding-synonymous	PADI3	NM_016233.2		29,766,5708	CC,CA,AA		7.7674,3.5406,6.3355		5/665	17575645	824,12182	2203	4300	6503	SO:0001819	synonymous_variant	51702	exon1			CTGCAGAGAATCG	AB026831	CCDS179.1	1p36.13	2008-02-05			ENSG00000142619	ENSG00000142619	3.5.3.15	"""Peptidyl arginine deiminases"""	18337	protein-coding gene	gene with protein product		606755				11069618	Standard	NM_016233		Approved	PDI3	uc001bai.3	Q9ULW8	OTTHUMG00000002373	ENST00000375460.3:c.13A>C	1.37:g.17575645A>C		Somatic	144	0		WXS	Illumina GAIIx	Phase_I	86	6	NM_016233	0	0	0	0	0	Q58EY7|Q70SX5	Silent	SNP	ENST00000375460.3	37	CCDS179.1																																																																																			A|0.927;C|0.073		0.607	PADI3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000006805.1		
TCTEX1D4	343521	hgsc.bcm.edu	37	1	45271828	45271828	+	Silent	SNP	T	T	C	rs17885815	byFrequency	TCGA-OR-A5LG-01A-11D-A29I-10	TCGA-OR-A5LG-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a39e8bc9-757d-4536-b301-458fc7ec992d	6b9e8d41-7044-4151-b4d6-e211b0e7a923	g.chr1:45271828T>C	ENST00000339355.2	-	1	519	c.513A>G	c.(511-513)gtA>gtG	p.V171V	BTBD19_ENST00000453418.1_5'Flank|TCTEX1D4_ENST00000372200.1_Silent_p.V171V|BTBD19_ENST00000450269.1_5'Flank|BTBD19_ENST00000409335.2_5'Flank			Q5JR98	TC1D4_HUMAN	Tctex1 domain containing 4	171						acrosomal vesicle (GO:0001669)|axoneme (GO:0005930)|microtubule organizing center (GO:0005815)|nucleus (GO:0005634)|sperm flagellum (GO:0036126)	protein phosphatase 1 binding (GO:0008157)			pancreas(1)	1	Acute lymphoblastic leukemia(166;0.155)					CCACACTGCATACCAGCTTGT	0.716													C|||	682	0.136182	0.0764	0.1427	5008	,	,		11465	0.1647		0.1759	False		,,,				2504	0.1421				p.V171V		.											.	TCTEX1D4-91	0			c.A513G						.	C		415,3851		26,363,1744	6.0	9.0	8.0		513	5.5	1.0	1	dbSNP_124	8	1263,7055		105,1053,3001	no	coding-synonymous	TCTEX1D4	NM_001013632.2		131,1416,4745	CC,CT,TT		15.1839,9.7281,13.3344		171/222	45271828	1678,10906	2133	4159	6292	SO:0001819	synonymous_variant	343521	exon2			ACTGCATACCAGC	BC092499	CCDS30699.1	1p34.1	2007-12-17				ENSG00000188396			32315	protein-coding gene	gene with protein product	"""novel Tctex-1 family domain-containing protein"""	611713				12477932	Standard	XM_006710614		Approved		uc001cmp.3	Q5JR98		ENST00000339355.2:c.513A>G	1.37:g.45271828T>C		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	17	17	NM_001013632	0	0	0	0	0		Silent	SNP	ENST00000339355.2	37	CCDS30699.1																																																																																			T|0.859;C|0.141		0.716	TCTEX1D4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000023733.1	NM_001013632	
THEM4	117145	hgsc.bcm.edu	37	1	151881885	151881885	+	Missense_Mutation	SNP	A	A	C	rs3748805	byFrequency	TCGA-OR-A5LG-01A-11D-A29I-10	TCGA-OR-A5LG-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a39e8bc9-757d-4536-b301-458fc7ec992d	6b9e8d41-7044-4151-b4d6-e211b0e7a923	g.chr1:151881885A>C	ENST00000368814.3	-	1	399	c.50T>G	c.(49-51)cTg>cGg	p.L17R	THEM4_ENST00000489410.1_Missense_Mutation_p.L17R	NM_053055.4	NP_444283.2	Q5T1C6	THEM4_HUMAN	thioesterase superfamily member 4	17			L -> R (in dbSNP:rs3748805). {ECO:0000269|PubMed:11598301, ECO:0000269|PubMed:14702039, ECO:0000269|PubMed:15489334, ECO:0000269|PubMed:17013611, ECO:0000269|Ref.4}.		epidermal growth factor receptor signaling pathway (GO:0007173)|fatty acid metabolic process (GO:0006631)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|protein kinase B signaling (GO:0043491)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)	cell projection (GO:0042995)|cytosol (GO:0005829)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	palmitoyl-CoA hydrolase activity (GO:0016290)			endometrium(1)|large_intestine(4)|lung(3)|urinary_tract(1)	9	Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.14)		LUSC - Lung squamous cell carcinoma(543;0.181)			TACTGGCGGCAGGCACAGAGC	0.741													C|||	4622	0.922923	0.8986	0.9092	5008	,	,		8223	0.9494		0.9155	False		,,,				2504	0.9458				p.L17R		.											.	THEM4-522	0			c.T50G						.						1.0	1.0	1.0					1																	151881885		1068	2473	3541	SO:0001583	missense	117145	exon1			GGCGGCAGGCACA	AJ313515	CCDS1006.1	1q21.3	2008-02-05			ENSG00000159445	ENSG00000159445			17947	protein-coding gene	gene with protein product	"""C-terminal modulator protein"""	606388				11598301	Standard	NM_053055		Approved	CTMP	uc001ezj.2	Q5T1C6	OTTHUMG00000013049	ENST00000368814.3:c.50T>G	1.37:g.151881885A>C	ENSP00000357804:p.Leu17Arg	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	9	9	NM_053055	0	0	0	4	4	B2RBX2|Q96KR2	Missense_Mutation	SNP	ENST00000368814.3	37	CCDS1006.1	2023	0.9262820512820513	453	0.9207317073170732	320	0.8839779005524862	545	0.9527972027972028	705	0.9300791556728232	C	0.562	-0.845033	0.02671	.	.	ENSG00000159445	ENST00000368814;ENST00000489410	T;T	0.25579	2.45;1.79	1.92	-0.278	0.12894	.	16.336300	0.02935	N	0.139768	T	0.02455	0.0075	N	0.08118	0	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.21143	-1.0254	9	0.10111	T	0.7	0.3431	0.4569	0.00510	0.2457:0.3181:0.2427:0.1934	rs3748805;rs17855960	17	Q5T1C6	THEM4_HUMAN	R	17	ENSP00000357804:L17R;ENSP00000433304:L17R	ENSP00000357804:L17R	L	-	2	0	THEM4	150148509	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.350000	0.07721	-0.432000	0.07297	-0.358000	0.07595	CTG	T|0.073;G|0.921		0.741	THEM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000036615.1	NM_053055	
TCHH	7062	bcgsc.ca	37	1	152080066	152080066	+	Missense_Mutation	SNP	C	C	T	rs140720320		TCGA-OR-A5LG-01A-11D-A29I-10	TCGA-OR-A5LG-10A-01D-A29L-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a39e8bc9-757d-4536-b301-458fc7ec992d	6b9e8d41-7044-4151-b4d6-e211b0e7a923	g.chr1:152080066C>T	ENST00000368804.1	-	2	5626	c.5627G>A	c.(5626-5628)cGg>cAg	p.R1876Q		NM_007113.2	NP_009044.2	Q07283	TRHY_HUMAN	trichohyalin	1876	23 X 26 AA approximate tandem repeats.				keratinization (GO:0031424)	cytoskeleton (GO:0005856)	calcium ion binding (GO:0005509)	p.R1876L(1)		NS(2)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(20)|kidney(9)|large_intestine(16)|lung(33)|ovary(3)|pancreas(1)|prostate(4)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(4)	105	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			TTTCCTTTCCCGTTCCTGGCG	0.567													C|||	1	0.000199681	0.0	0.0	5008	,	,		20727	0.0		0.001	False		,,,				2504	0.0				p.R1876Q		.											.	TCHH-72	1	Substitution - Missense(1)	lung(1)	c.G5627A						.	C	GLN/ARG	1,4147		0,1,2073	165.0	166.0	166.0		5627	1.4	1.0	1	dbSNP_134	166	17,8367		0,17,4175	yes	missense	TCHH	NM_007113.2	43	0,18,6248	TT,TC,CC		0.2028,0.0241,0.1436	probably-damaging	1876/1944	152080066	18,12514	2074	4192	6266	SO:0001583	missense	7062	exon3			CTTTCCCGTTCCT	L09190	CCDS41396.1	1q21-q23	2013-01-10		2006-01-27	ENSG00000159450	ENSG00000159450		"""EF-hand domain containing"""	11791	protein-coding gene	gene with protein product		190370		THH		1431214	Standard	NM_007113		Approved		uc001ezp.3	Q07283	OTTHUMG00000013066	ENST00000368804.1:c.5627G>A	1.37:g.152080066C>T	ENSP00000357794:p.Arg1876Gln	Somatic	126	0		WXS	Illumina GAIIx	Phase_I	147	5	NM_007113	0	0	0	0	0	Q5VUI3	Missense_Mutation	SNP	ENST00000368804.1	37	CCDS41396.1	1	4.578754578754579E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	C	11.16	1.555567	0.27739	2.41E-4	0.002028	ENSG00000159450	ENST00000368804	T	0.05925	3.37	4.29	1.35	0.21983	.	.	.	.	.	T	0.01592	0.0051	L	0.39898	1.24	0.21290	N	0.999731	B	0.27882	0.192	B	0.20767	0.031	T	0.46219	-0.9207	9	0.34782	T	0.22	-7.3562	6.5666	0.22515	0.0:0.5814:0.0:0.4186	.	1876	Q07283	TRHY_HUMAN	Q	1876	ENSP00000357794:R1876Q	ENSP00000357794:R1876Q	R	-	2	0	TCHH	150346690	0.000000	0.05858	0.962000	0.40283	0.263000	0.26337	0.102000	0.15272	-0.011000	0.14247	0.313000	0.20887	CGG	C|0.999;T|0.001		0.567	TCHH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000036671.2	NM_007113	
LOR	4014	hgsc.bcm.edu	37	1	153233578	153233578	+	Silent	SNP	C	C	T	rs1143389	byFrequency	TCGA-OR-A5LG-01A-11D-A29I-10	TCGA-OR-A5LG-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a39e8bc9-757d-4536-b301-458fc7ec992d	6b9e8d41-7044-4151-b4d6-e211b0e7a923	g.chr1:153233578C>T	ENST00000368742.3	+	2	210	c.153C>T	c.(151-153)tgC>tgT	p.C51C		NM_000427.2	NP_000418.2	P23490	LORI_HUMAN	loricrin	51					keratinization (GO:0031424)|keratinocyte differentiation (GO:0030216)|peptide cross-linking (GO:0018149)	cornified envelope (GO:0001533)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	protein binding, bridging (GO:0030674)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)			lung(2)	2	all_lung(78;3.35e-32)|Lung NSC(65;1.22e-30)|Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.171)			gttctggctgcggctactccg	0.796													C|||	1003	0.20028	0.034	0.147	5008	,	,		4886	0.3194		0.1412	False		,,,				2504	0.4008				p.C51C		.											.	LOR-90	0			c.C153T						.	C		83,2085		3,77,1004	2.0	2.0	2.0		153	-7.2	0.0	1	dbSNP_86	2	743,3969		44,655,1657	no	coding-synonymous	LOR	NM_000427.2		47,732,2661	TT,TC,CC		15.7683,3.8284,12.0058		51/313	153233578	826,6054	1084	2356	3440	SO:0001819	synonymous_variant	4014	exon2			TGGCTGCGGCTAC	M61120	CCDS30870.1	1q21	2008-02-05			ENSG00000203782	ENSG00000203782			6663	protein-coding gene	gene with protein product		152445				2007607, 1355480	Standard	NM_000427		Approved		uc001fbm.3	P23490	OTTHUMG00000013938	ENST00000368742.3:c.153C>T	1.37:g.153233578C>T		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	11	11	NM_000427	0	0	0	0	0	Q5T869|Q5XKF8	Silent	SNP	ENST00000368742.3	37	CCDS30870.1																																																																																			C|0.818;T|0.182		0.796	LOR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039107.1	NM_000427	
SHCBP1L	81626	hgsc.bcm.edu	37	1	182922067	182922067	+	Missense_Mutation	SNP	G	G	T	rs188196867	byFrequency	TCGA-OR-A5LG-01A-11D-A29I-10	TCGA-OR-A5LG-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a39e8bc9-757d-4536-b301-458fc7ec992d	6b9e8d41-7044-4151-b4d6-e211b0e7a923	g.chr1:182922067G>T	ENST00000367547.3	-	1	438	c.202C>A	c.(202-204)Ctg>Atg	p.L68M	SHCBP1L_ENST00000423786.1_5'Flank|SHCBP1L_ENST00000488956.1_5'UTR	NM_030933.2	NP_112195.2	Q9BZQ2	SHP1L_HUMAN	SHC SH2-domain binding protein 1-like	140								p.L68M(1)		breast(1)|endometrium(2)|kidney(2)|large_intestine(3)|liver(1)|lung(2)|pancreas(1)|prostate(1)|skin(2)	15						TGGAGCCGCAGCCTGGCCGTC	0.761													G|||	65	0.0129792	0.0015	0.0447	5008	,	,		12094	0.0		0.0219	False		,,,				2504	0.0102				p.L68M		.											.	SHCBP1L-91	1	Substitution - Missense(1)	breast(1)	c.C202A						.	G	MET/LEU	22,3042		0,22,1510	2.0	3.0	3.0		202	3.0	1.0	1		3	167,6229		1,165,3032	no	missense	SHCBP1L	NM_030933.2	15	1,187,4542	TT,TG,GG		2.611,0.718,1.9979	benign	68/654	182922067	189,9271	1532	3198	4730	SO:0001583	missense	81626	exon1			GCCGCAGCCTGGC	AF288397	CCDS30955.1	1q25	2011-01-24	2011-01-24	2011-01-24	ENSG00000157060	ENSG00000157060			16788	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 14"""	C1orf14		11318611	Standard	NM_030933		Approved		uc001gpu.3	Q9BZQ2	OTTHUMG00000035419	ENST00000367547.3:c.202C>A	1.37:g.182922067G>T	ENSP00000356518:p.Leu68Met	Somatic	2	0		WXS	Illumina GAIIx	Phase_I	56	35	NM_030933	0	0	0	0	0	Q4G195|Q9BZQ3|Q9H2B6	Missense_Mutation	SNP	ENST00000367547.3	37	CCDS30955.1	41	0.018772893772893772	7	0.014227642276422764	14	0.03867403314917127	0	0.0	20	0.026385224274406333	G	8.485	0.860773	0.17178	0.00718	0.02611	ENSG00000157060	ENST00000367547;ENST00000287709	T	0.46063	0.88	3.9	2.98	0.34508	.	0.716137	0.11457	N	0.562144	T	0.05044	0.0135	N	0.08118	0	0.80722	D	1	P	0.37276	0.589	B	0.34779	0.189	T	0.02132	-1.1208	10	0.31617	T	0.26	-4.4958	7.9824	0.30192	0.1203:0.0:0.8797:0.0	.	68	Q9BZQ2-3	.	M	68;137	ENSP00000356518:L68M	ENSP00000287709:L137M	L	-	1	2	SHCBP1L	181188690	0.878000	0.30173	0.996000	0.52242	0.343000	0.28985	0.241000	0.18065	0.752000	0.32923	-0.657000	0.03884	CTG	G|0.981;T|0.019		0.761	SHCBP1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000085956.1	NM_030933	
LAD1	3898	bcgsc.ca	37	1	201355522	201355522	+	Missense_Mutation	SNP	T	T	C	rs4128458	byFrequency	TCGA-OR-A5LG-01A-11D-A29I-10	TCGA-OR-A5LG-10A-01D-A29L-10	T	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a39e8bc9-757d-4536-b301-458fc7ec992d	6b9e8d41-7044-4151-b4d6-e211b0e7a923	g.chr1:201355522T>C	ENST00000391967.2	-	3	1268	c.967A>G	c.(967-969)Aag>Gag	p.K323E	LAD1_ENST00000367313.3_Missense_Mutation_p.K337E|LAD1_ENST00000488842.1_5'Flank	NM_005558.3	NP_005549.2	O00515	LAD1_HUMAN	ladinin 1	323			K -> E (in dbSNP:rs4128458).			basement membrane (GO:0005604)	structural molecule activity (GO:0005198)			breast(2)|central_nervous_system(1)|endometrium(1)|large_intestine(5)|lung(6)|prostate(2)|skin(2)	19						GCCCCCTGCTTTGCCAAAGAG	0.677													C|||	2770	0.553115	0.8775	0.3847	5008	,	,		15336	0.5188		0.4612	False		,,,				2504	0.364				p.K323E		.											.	LAD1-90	0			c.A967G						.	C	GLU/LYS	3531,871		1427,677,97	29.0	28.0	28.0		967	1.6	0.0	1	dbSNP_108	28	4209,4391		1011,2187,1102	yes	missense	LAD1	NM_005558.3	56	2438,2864,1199	CC,CT,TT		48.9419,19.7865,40.4707	benign	323/518	201355522	7740,5262	2201	4300	6501	SO:0001583	missense	3898	exon3			CCTGCTTTGCCAA	U42408	CCDS1410.1	1q25.1-q32.3	2008-02-05			ENSG00000159166	ENSG00000159166			6472	protein-coding gene	gene with protein product		602314				8618013, 9119369	Standard	NM_005558		Approved		uc001gwm.3	O00515	OTTHUMG00000035737	ENST00000391967.2:c.967A>G	1.37:g.201355522T>C	ENSP00000375829:p.Lys323Glu	Somatic	61	0		WXS	Illumina GAIIx	Phase_I	71	4	NM_005558	0	0	0	0	0	O95614|Q96GD8	Missense_Mutation	SNP	ENST00000391967.2	37	CCDS1410.1	1219	0.5581501831501832	437	0.8882113821138211	153	0.42265193370165743	282	0.493006993006993	347	0.4577836411609499	C	1.003	-0.690442	0.03303	0.802135	0.489419	ENSG00000159166	ENST00000391967;ENST00000367313	T;T	0.10477	2.88;2.87	4.6	1.65	0.23941	.	1.051530	0.07467	N	0.901672	T	0.00012	0.0000	N	0.00347	-1.61	0.80722	P	0.0	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.24657	-1.0154	9	0.02654	T	1	-17.1114	6.8142	0.23820	0.0:0.5957:0.0:0.4043	rs4128458;rs4342880;rs59727181;rs4128458	337;323	E9PDI4;O00515	.;LAD1_HUMAN	E	323;337	ENSP00000375829:K323E;ENSP00000356282:K337E	ENSP00000356282:K337E	K	-	1	0	LAD1	199622145	0.267000	0.24122	0.000000	0.03702	0.095000	0.18619	1.124000	0.31320	0.206000	0.20587	-0.166000	0.13349	AAG	T|0.405;C|0.595		0.677	LAD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086946.1	NM_005558	
CAPN2	824	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	223949944	223949944	+	Missense_Mutation	SNP	G	G	C			TCGA-OR-A5LG-01A-11D-A29I-10	TCGA-OR-A5LG-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a39e8bc9-757d-4536-b301-458fc7ec992d	6b9e8d41-7044-4151-b4d6-e211b0e7a923	g.chr1:223949944G>C	ENST00000295006.5	+	14	1932	c.1623G>C	c.(1621-1623)ttG>ttC	p.L541F	CAPN2_ENST00000433674.2_Missense_Mutation_p.L463F|CAPN2_ENST00000474026.1_3'UTR	NM_001748.4	NP_001739	P17655	CAN2_HUMAN	calpain 2, (m/II) large subunit	541	Domain IV.				blastocyst development (GO:0001824)|cellular response to amino acid stimulus (GO:0071230)|myoblast fusion (GO:0007520)|protein autoprocessing (GO:0016540)|proteolysis (GO:0006508)|proteolysis involved in cellular protein catabolic process (GO:0051603)|regulation of cytoskeleton organization (GO:0051493)|response to hypoxia (GO:0001666)	chromatin (GO:0000785)|cortical actin cytoskeleton (GO:0030864)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|membrane raft (GO:0045121)|nucleus (GO:0005634)|perinuclear endoplasmic reticulum (GO:0097038)|plasma membrane (GO:0005886)|pseudopodium (GO:0031143)	calcium ion binding (GO:0005509)|calcium-dependent cysteine-type endopeptidase activity (GO:0004198)|cysteine-type peptidase activity (GO:0008234)|cytoskeletal protein binding (GO:0008092)	p.L541F(1)		breast(3)|endometrium(1)|kidney(1)|large_intestine(9)|lung(10)|prostate(1)|skin(1)|stomach(3)	29				GBM - Glioblastoma multiforme(131;0.109)		TTGCCCAGTTGGCAGGAGAGG	0.483																																					p.L541F		.											.	CAPN2-523	1	Substitution - Missense(1)	lung(1)	c.G1623C						.						181.0	132.0	149.0					1																	223949944		2203	4300	6503	SO:0001583	missense	824	exon14			CCAGTTGGCAGGA	J04700	CCDS31035.1, CCDS53478.1	1q41-q42	2013-01-10			ENSG00000162909	ENSG00000162909	3.4.22.52	"""EF-hand domain containing"""	1479	protein-coding gene	gene with protein product		114230				2852952, 2539381	Standard	NM_001748		Approved	mCANP, CANPml, CANPL2	uc001hob.4	P17655	OTTHUMG00000037376	ENST00000295006.5:c.1623G>C	1.37:g.223949944G>C	ENSP00000295006:p.Leu541Phe	Somatic	131	0		WXS	Illumina GAIIx	Phase_I	161	77	NM_001748	0	0	0	0	0	A6NDG7|B7ZA96|E7ES58|Q16738|Q6PJT3|Q8WU26|Q9HBB1	Missense_Mutation	SNP	ENST00000295006.5	37	CCDS31035.1	.	.	.	.	.	.	.	.	.	.	G	17.22	3.335447	0.60853	.	.	ENSG00000162909	ENST00000433674;ENST00000295006;ENST00000366869	T;T	0.28255	1.62;1.62	5.63	4.7	0.59300	EF-hand-like domain (1);	0.142691	0.48767	D	0.000165	T	0.49864	0.1582	L	0.57536	1.79	0.80722	D	1	B;D;D	0.65815	0.117;0.995;0.992	B;D;D	0.65140	0.021;0.925;0.932	T	0.50939	-0.8768	10	0.54805	T	0.06	.	15.1242	0.72469	0.0:0.1421:0.8579:0.0	.	463;124;541	B7ZA96;B3KUH9;P17655	.;.;CAN2_HUMAN	F	463;541;570	ENSP00000413158:L463F;ENSP00000295006:L541F	ENSP00000295006:L541F	L	+	3	2	CAPN2	222016567	0.998000	0.40836	0.999000	0.59377	0.769000	0.43574	0.392000	0.20801	1.342000	0.45619	0.655000	0.94253	TTG	.		0.483	CAPN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090973.1	NM_001748	
OBSCN	84033	hgsc.bcm.edu	37	1	228399799	228399799	+	Silent	SNP	C	C	T	rs11582369	byFrequency	TCGA-OR-A5LG-01A-11D-A29I-10	TCGA-OR-A5LG-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a39e8bc9-757d-4536-b301-458fc7ec992d	6b9e8d41-7044-4151-b4d6-e211b0e7a923	g.chr1:228399799C>T	ENST00000422127.1	+	2	359	c.315C>T	c.(313-315)tgC>tgT	p.C105C	OBSCN_ENST00000570156.2_Silent_p.C105C|C1orf145_ENST00000295012.5_Intron|OBSCN_ENST00000366709.4_5'UTR|OBSCN_ENST00000284548.11_Silent_p.C105C|OBSCN_ENST00000366707.4_5'UTR	NM_001098623.2	NP_001092093.2	Q5VST9	OBSCN_HUMAN	obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF	105					apoptotic signaling pathway (GO:0097190)|multicellular organismal development (GO:0007275)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|protein localization to M-band (GO:0036309)|regulation of small GTPase mediated signal transduction (GO:0051056)|sarcomere organization (GO:0045214)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|M band (GO:0031430)|myofibril (GO:0030016)|Z disc (GO:0030018)	ankyrin binding (GO:0030506)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|structural constituent of muscle (GO:0008307)|titin binding (GO:0031432)			NS(2)|breast(7)|central_nervous_system(5)|cervix(2)|endometrium(30)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(37)|lung(89)|ovary(8)|pancreas(3)|prostate(13)|skin(6)|stomach(11)|upper_aerodigestive_tract(2)|urinary_tract(3)	223		Prostate(94;0.0405)				AGGCCGCGTGCGCCGAGCAGG	0.736													C|||	254	0.0507188	0.0129	0.0591	5008	,	,		8585	0.121		0.0338	False		,,,				2504	0.0409				p.C105C		.											.	OBSCN-403	0			c.C315T						.	C	,	63,3177		0,63,1557	6.0	7.0	6.0		315,315	-4.9	0.0	1	dbSNP_120	6	259,6741		4,251,3245	no	coding-synonymous,coding-synonymous	OBSCN	NM_001098623.1,NM_052843.2	,	4,314,4802	TT,TC,CC		3.7,1.9444,3.1445	,	105/7969,105/6621	228399799	322,9918	1620	3500	5120	SO:0001819	synonymous_variant	84033	exon2			CGCGTGCGCCGAG	AJ002535	CCDS1570.2, CCDS58065.1, CCDS59204.1	1q42	2014-09-17			ENSG00000154358	ENSG00000154358		"""Rho guanine nucleotide exchange factors"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	15719	protein-coding gene	gene with protein product		608616				11448995, 11814696	Standard	NM_001098623		Approved	KIAA1556, UNC89, KIAA1639, ARHGEF30	uc001hsq.2	Q5VST9	OTTHUMG00000039772	ENST00000422127.1:c.315C>T	1.37:g.228399799C>T		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	35	30	NM_001271223	0	0	0	0	0	Q2A664|Q5T7G8|Q5T7G9|Q5VSU2|Q86YC7|Q8NHN0|Q8NHN1|Q8NHN2|Q8NHN3|Q8NHN4|Q8NHN5|Q8NHN6|Q8NHN7|Q8NHN8|Q8NHN9|Q96AA2|Q9HCD3|Q9HCL6	Silent	SNP	ENST00000422127.1	37	CCDS58065.1																																																																																			C|0.943;T|0.057		0.736	OBSCN-204	KNOWN	basic|CCDS	protein_coding	protein_coding		NM_052843	
NPY4R	5540	broad.mit.edu;bcgsc.ca	37	10	47087160	47087160	+	Missense_Mutation	SNP	C	C	T	rs149694580	byFrequency	TCGA-OR-A5LG-01A-11D-A29I-10	TCGA-OR-A5LG-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a39e8bc9-757d-4536-b301-458fc7ec992d	6b9e8d41-7044-4151-b4d6-e211b0e7a923	g.chr10:47087160C>T	ENST00000395716.1	+	2	462	c.377C>T	c.(376-378)aCg>aTg	p.T126M	NPY4R_ENST00000374312.1_Missense_Mutation_p.T126M			P50391	NPY4R_HUMAN	neuropeptide Y receptor Y4	126					blood circulation (GO:0008015)|digestion (GO:0007586)|feeding behavior (GO:0007631)|G-protein coupled receptor signaling pathway (GO:0007186)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|pancreatic polypeptide receptor activity (GO:0001602)|peptide binding (GO:0042277)|peptide YY receptor activity (GO:0001601)										ATGTCGGTGACGGTCTCCATC	0.597													C|||	2	0.000399361	0.0008	0.0	5008	,	,		42575	0.001		0.0	False		,,,				2504	0.0				p.T126M		.											.	PPYR1-524	0			c.C377T						.	C	MET/THR	3,4403	9.9+/-24.2	0,3,2200	298.0	268.0	278.0		377	4.9	1.0	10	dbSNP_134	278	6,8594	4.3+/-15.6	0,6,4294	yes	missense	PPYR1	NM_005972.4	81	0,9,6494	TT,TC,CC		0.0698,0.0681,0.0692	probably-damaging	126/376	47087160	9,12997	2203	4300	6503	SO:0001583	missense	5540	exon3			CGGTGACGGTCTC		CCDS73100.1	10q11.2	2013-03-26	2013-03-26	2013-03-26	ENSG00000204174	ENSG00000204174		"""GPCR / Class A : Neuropeptide receptors : Y"""	9329	protein-coding gene	gene with protein product		601790	"""pancreatic polypeptide receptor 1"""	PPYR1		9417917	Standard	NM_005972		Approved	Y4, PP1	uc001jee.3	P50391	OTTHUMG00000018108	ENST00000395716.1:c.377C>T	10.37:g.47087160C>T	ENSP00000379066:p.Thr126Met	Somatic	341	1		WXS	Illumina GAIIx	Phase_I	289	60	NM_005972	0	0	0	0	0	Q13456|Q5ISU3|Q5T2X9|Q6FH06	Missense_Mutation	SNP	ENST00000395716.1	37	CCDS31193.1	.	.	.	.	.	.	.	.	.	.	C	14.18	2.457915	0.43634	6.81E-4	6.98E-4	ENSG00000204174	ENST00000374312;ENST00000395716	T;T	0.74421	-0.84;-0.84	4.93	4.93	0.64822	GPCR, rhodopsin-like superfamily (1);	0.054567	0.64402	D	0.000001	D	0.84768	0.5545	M	0.66560	2.04	0.58432	D	0.999999	D	0.89917	1.0	D	0.85130	0.997	D	0.86474	0.1787	10	0.87932	D	0	.	16.0236	0.80522	0.0:1.0:0.0:0.0	.	126	P50391	NPY4R_HUMAN	M	126	ENSP00000363431:T126M;ENSP00000379066:T126M	ENSP00000363431:T126M	T	+	2	0	PPYR1	46507166	0.998000	0.40836	0.960000	0.40013	0.074000	0.17049	3.778000	0.55371	2.464000	0.83262	0.609000	0.83330	ACG	C|1.000;T|0.000		0.597	NPY4R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047837.1		
FAM170B	170370	broad.mit.edu;bcgsc.ca	37	10	50339962	50339962	+	Missense_Mutation	SNP	A	A	T	rs75297145	byFrequency	TCGA-OR-A5LG-01A-11D-A29I-10	TCGA-OR-A5LG-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a39e8bc9-757d-4536-b301-458fc7ec992d	6b9e8d41-7044-4151-b4d6-e211b0e7a923	g.chr10:50339962A>T	ENST00000311787.5	-	2	637	c.548T>A	c.(547-549)cTg>cAg	p.L183Q	FAM170B-AS1_ENST00000442525.1_RNA|FAM170B-AS1_ENST00000435809.1_RNA|FAM170B-AS1_ENST00000443389.1_RNA	NM_001164484.1	NP_001157956.1	A6NMN3	F170B_HUMAN	family with sequence similarity 170, member B	183										central_nervous_system(1)|endometrium(1)|skin(1)	3						GCAGCACTCCAGCAGGTCTAT	0.652													A|||	442	0.0882588	0.0144	0.1095	5008	,	,		16806	0.003		0.1938	False		,,,				2504	0.1524				p.L183Q		.											.	.	0			c.T548A						.	A	GLN/LEU	55,1329		1,53,638	21.0	23.0	23.0		548	1.9	0.8	10	dbSNP_132	23	662,2520		71,520,1000	no	missense	FAM170B	NM_001164484.1	113	72,573,1638	TT,TA,AA		20.8045,3.974,15.703	benign	183/284	50339962	717,3849	692	1591	2283	SO:0001583	missense	170370	exon2			CACTCCAGCAGGT		CCDS53536.1	10q11.23	2008-11-06	2008-06-12	2008-06-12	ENSG00000172538	ENSG00000172538			19736	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 73"""	C10orf73			Standard	NM_001164484		Approved	Em:AC084727.4	uc001jhj.3	A6NMN3	OTTHUMG00000018187	ENST00000311787.5:c.548T>A	10.37:g.50339962A>T	ENSP00000308292:p.Leu183Gln	Somatic	44	0		WXS	Illumina GAIIx	Phase_I	48	5	NM_001164484	0	0	0	0	0	Q86WY6|Q8N6K8	Missense_Mutation	SNP	ENST00000311787.5	37	CCDS53536.1	199	0.09111721611721611	9	0.018292682926829267	35	0.09668508287292818	0	0.0	155	0.20448548812664907	A	8.876	0.950364	0.18431	0.03974	0.208045	ENSG00000172538	ENST00000311787	T	0.32515	1.45	5.73	1.93	0.25924	.	0.862135	0.09814	N	0.752387	T	0.00012	0.0000	L	0.54323	1.7	0.80722	P	0.0	B	0.25955	0.138	B	0.21708	0.036	T	0.22103	-1.0226	9	0.51188	T	0.08	-13.7362	2.8237	0.05479	0.6126:0.0:0.2004:0.1869	.	183	A6NMN3	F170B_HUMAN	Q	183	ENSP00000308292:L183Q	ENSP00000308292:L183Q	L	-	2	0	FAM170B	50009968	0.000000	0.05858	0.768000	0.31515	0.115000	0.19883	-0.175000	0.09825	1.011000	0.39340	0.491000	0.48974	CTG	A|0.908;T|0.092		0.652	FAM170B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047974.1	XM_096317	
TBC1D12	23232	hgsc.bcm.edu	37	10	96163039	96163039	+	Silent	SNP	C	C	G	rs2477534	byFrequency	TCGA-OR-A5LG-01A-11D-A29I-10	TCGA-OR-A5LG-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a39e8bc9-757d-4536-b301-458fc7ec992d	6b9e8d41-7044-4151-b4d6-e211b0e7a923	g.chr10:96163039C>G	ENST00000225235.4	+	1	779	c.669C>G	c.(667-669)ccC>ccG	p.P223P		NM_015188.1	NP_056003.1	O60347	TBC12_HUMAN	TBC1 domain family, member 12	223							Rab GTPase activator activity (GO:0005097)			breast(1)|central_nervous_system(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(5)|upper_aerodigestive_tract(2)	20		Colorectal(252;0.0429)				GGGACAGCCCCGCCAGCAGCT	0.751													G|||	3411	0.68111	0.6165	0.5648	5008	,	,		8936	0.8373		0.6342	False		,,,				2504	0.7382				p.P223P		.											.	TBC1D12-68	0			c.C669G						.	G		1895,863		709,477,193	2.0	3.0	3.0		669	-2.0	0.0	10	dbSNP_100	3	4435,1895		1664,1107,394	yes	coding-synonymous	TBC1D12	NM_015188.1		2373,1584,587	GG,GC,CC		29.9368,31.2908,30.3477		223/776	96163039	6330,2758	1379	3165	4544	SO:0001819	synonymous_variant	23232	exon1			CAGCCCCGCCAGC	AB011180	CCDS41553.1	10q23.33	2013-09-20			ENSG00000108239	ENSG00000108239			29082	protein-coding gene	gene with protein product						9628581	Standard	NM_015188		Approved	KIAA0608	uc001kjr.2	O60347	OTTHUMG00000018794	ENST00000225235.4:c.669C>G	10.37:g.96163039C>G		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	31	19	NM_015188	0	0	0	0	0	Q5VYA6|Q8WX26|Q8WX59|Q9UG83	Silent	SNP	ENST00000225235.4	37	CCDS41553.1																																																																																			C|0.339;G|0.661		0.751	TBC1D12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049482.2		
TAF5	6877	hgsc.bcm.edu	37	10	105128134	105128134	+	Missense_Mutation	SNP	T	T	G	rs10883859	byFrequency	TCGA-OR-A5LG-01A-11D-A29I-10	TCGA-OR-A5LG-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a39e8bc9-757d-4536-b301-458fc7ec992d	6b9e8d41-7044-4151-b4d6-e211b0e7a923	g.chr10:105128134T>G	ENST00000369839.3	+	1	411	c.388T>G	c.(388-390)Tcc>Gcc	p.S130A	TAF5_ENST00000351396.4_Missense_Mutation_p.S130A	NM_006951.3	NP_008882.2	Q15542	TAF5_HUMAN	TAF5 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 100kDa	130			S -> A (in dbSNP:rs10883859). {ECO:0000269|PubMed:15489334, ECO:0000269|PubMed:8758937, ECO:0000269|PubMed:9045704, ECO:0000269|Ref.5}.		chromatin modification (GO:0016568)|DNA-templated transcription, initiation (GO:0006352)|gene expression (GO:0010467)|histone acetylation (GO:0016573)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	actin cytoskeleton (GO:0015629)|intracellular membrane-bounded organelle (GO:0043231)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor TFIID complex (GO:0005669)|transcription factor TFTC complex (GO:0033276)	protein dimerization activity (GO:0046983)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			breast(1)|central_nervous_system(1)|kidney(2)|large_intestine(5)|lung(4)|ovary(2)	15		Colorectal(252;0.0747)|Breast(234;0.128)		Epithelial(162;1.83e-09)|all cancers(201;1.4e-08)|BRCA - Breast invasive adenocarcinoma(275;0.198)		AGTGGCGGGCTCCGGAGCCCC	0.741													T|||	1553	0.310104	0.1952	0.4078	5008	,	,		9029	0.4206		0.329	False		,,,				2504	0.2628				p.S130A		.											.	TAF5-92	0			c.T388G						.	T	ALA/SER	635,2955		63,509,1223	3.0	5.0	4.0		388	1.9	1.0	10	dbSNP_120	4	2122,5176		327,1468,1854	no	missense	TAF5	NM_006951.3	99	390,1977,3077	GG,GT,TT		29.0765,17.688,25.3215	benign	130/801	105128134	2757,8131	1795	3649	5444	SO:0001583	missense	6877	exon1			GCGGGCTCCGGAG	X95525	CCDS7547.1	10q24-q25.2	2013-01-10	2002-08-29	2001-12-07	ENSG00000148835	ENSG00000148835		"""WD repeat domain containing"""	11539	protein-coding gene	gene with protein product		601787	"""TATA box binding protein (TBP)-associated factor, RNA polymerase II, D, 100kD"""	TAF2D		8884287, 8942982	Standard	NM_006951		Approved	TAFII100	uc001kwv.3	Q15542	OTTHUMG00000018985	ENST00000369839.3:c.388T>G	10.37:g.105128134T>G	ENSP00000358854:p.Ser130Ala	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	22	8	NM_006951	0	0	0	0	0	A8K5B4|B2RMR0|B7ZKJ6|Q53EM4|Q5SYD5|Q86UZ7|Q9Y4K5	Missense_Mutation	SNP	ENST00000369839.3	37	CCDS7547.1	821	0.3759157509157509	127	0.258130081300813	150	0.4143646408839779	277	0.48426573426573427	267	0.35224274406332456	T	12.78	2.040311	0.35989	0.17688	0.290765	ENSG00000148835	ENST00000369839;ENST00000351396	T;T	0.55930	0.73;0.49	4.45	1.88	0.25563	.	0.435426	0.24978	N	0.034100	T	0.00012	0.0000	N	0.04508	-0.205	0.41867	P	0.009742999999999946	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.0	T	0.46373	-0.9196	9	0.09338	T	0.73	-0.0936	6.2404	0.20787	0.1492:0.0:0.2595:0.5913	rs10883859	130;130	Q15542-2;Q15542	.;TAF5_HUMAN	A	130	ENSP00000358854:S130A;ENSP00000311024:S130A	ENSP00000311024:S130A	S	+	1	0	TAF5	105118124	0.988000	0.35896	1.000000	0.80357	0.948000	0.59901	0.932000	0.28884	0.814000	0.34374	0.459000	0.35465	TCC	T|0.623;G|0.377		0.741	TAF5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050144.1		
KNDC1	85442	hgsc.bcm.edu	37	10	135000148	135000148	+	Silent	SNP	T	T	C	rs3810965	byFrequency	TCGA-OR-A5LG-01A-11D-A29I-10	TCGA-OR-A5LG-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a39e8bc9-757d-4536-b301-458fc7ec992d	6b9e8d41-7044-4151-b4d6-e211b0e7a923	g.chr10:135000148T>C	ENST00000304613.3	+	6	1317	c.1296T>C	c.(1294-1296)gcT>gcC	p.A432A	KNDC1_ENST00000368572.2_Silent_p.A432A|KNDC1_ENST00000368571.2_Silent_p.A367A			Q76NI1	VKIND_HUMAN	kinase non-catalytic C-lobe domain (KIND) containing 1	432					cerebellar granule cell differentiation (GO:0021707)|positive regulation of protein phosphorylation (GO:0001934)|regulation of dendrite morphogenesis (GO:0048814)|small GTPase mediated signal transduction (GO:0007264)	dendrite (GO:0030425)|guanyl-nucleotide exchange factor complex (GO:0032045)|neuronal cell body (GO:0043025)	protein serine/threonine kinase activity (GO:0004674)|Ras guanyl-nucleotide exchange factor activity (GO:0005088)			NS(4)|breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(27)|ovary(1)|prostate(5)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	60		all_cancers(35;4.16e-10)|all_epithelial(44;2.07e-08)|Lung NSC(174;0.000845)|all_lung(145;0.00145)|all_neural(114;0.0299)|Melanoma(40;0.123)|Colorectal(31;0.173)|Glioma(114;0.203)		OV - Ovarian serous cystadenocarcinoma(35;8.77e-06)|Epithelial(32;1.13e-05)|all cancers(32;1.51e-05)		CAGAAGGAGCTAGGCAGCTGG	0.667													c|||	2087	0.416733	0.118	0.3847	5008	,	,		13870	0.5764		0.4354	False		,,,				2504	0.6595				p.A432A		.											.	KNDC1-229	0			c.T1296C						.			719,3683		63,593,1545	26.0	32.0	30.0		1296	-4.2	0.0	10	dbSNP_107	30	3956,4636		925,2106,1265	no	coding-synonymous	KNDC1	NM_152643.6		988,2699,2810	CC,CT,TT		46.0428,16.3335,35.9781		432/1750	135000148	4675,8319	2201	4296	6497	SO:0001819	synonymous_variant	85442	exon6			AGGAGCTAGGCAG	AK074179	CCDS7674.1	10q26.3	2004-09-14	2004-04-07		ENSG00000171798	ENSG00000171798			29374	protein-coding gene	gene with protein product			"""RasGEF domain family, member 2"""	RASGEF2, C10orf23		11214970	Standard	NM_152643		Approved	KIAA1768, bB439H18.3, FLJ25027	uc001llz.1	Q76NI1	OTTHUMG00000019303	ENST00000304613.3:c.1296T>C	10.37:g.135000148T>C		Somatic	2	0		WXS	Illumina GAIIx	Phase_I	8	5	NM_152643	0	0	8	8	0	B0QZC5|Q5T233|Q6ZNH8|Q8TEE5|Q96LV7|Q9C095	Silent	SNP	ENST00000304613.3	37	CCDS7674.1																																																																																			T|0.607;C|0.393		0.667	KNDC1-006	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000277044.3	NM_152643	
PNPLA2	57104	hgsc.bcm.edu	37	11	824789	824789	+	Missense_Mutation	SNP	T	T	C	rs1138693	byFrequency	TCGA-OR-A5LG-01A-11D-A29I-10	TCGA-OR-A5LG-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a39e8bc9-757d-4536-b301-458fc7ec992d	6b9e8d41-7044-4151-b4d6-e211b0e7a923	g.chr11:824789T>C	ENST00000336615.4	+	10	1644	c.1442T>C	c.(1441-1443)cTg>cCg	p.L481P	EFCAB4A_ENST00000528542.2_5'Flank|EFCAB4A_ENST00000450448.1_5'Flank|AP006621.8_ENST00000528982.1_RNA|AP006621.8_ENST00000532946.1_RNA	NM_020376.3	NP_065109.1	Q96AD5	PLPL2_HUMAN	patatin-like phospholipase domain containing 2	481			L -> P (in dbSNP:rs1138693). {ECO:0000269|PubMed:15489334, ECO:0000269|PubMed:16644682, ECO:0000269|Ref.2}.		acylglycerol acyl-chain remodeling (GO:0036155)|glycerophospholipid biosynthetic process (GO:0046474)|lipid particle organization (GO:0034389)|lipid storage (GO:0019915)|negative regulation of sequestering of triglyceride (GO:0010891)|phospholipid metabolic process (GO:0006644)|positive regulation of triglyceride catabolic process (GO:0010898)|small molecule metabolic process (GO:0044281)|triglyceride catabolic process (GO:0019433)	cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|lipid particle (GO:0005811)|plasma membrane (GO:0005886)	triglyceride lipase activity (GO:0004806)			breast(1)|endometrium(2)|lung(4)|prostate(1)|urinary_tract(1)	9		all_cancers(49;4.75e-06)|all_epithelial(84;0.00204)|Breast(177;0.00234)|Ovarian(85;0.0228)|Medulloblastoma(188;0.0321)|all_neural(188;0.0762)		all cancers(45;1.63e-25)|Epithelial(43;1.28e-24)|OV - Ovarian serous cystadenocarcinoma(40;7.09e-19)|BRCA - Breast invasive adenocarcinoma(625;4.23e-05)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)		CAGCACCAGCTGGCCGGGCCT	0.751													-|||	3277	0.654353	0.7133	0.7709	5008	,	,		10714	0.6002		0.7058	False		,,,				2504	0.4949				p.L481P		.											.	PNPLA2-90	0			c.T1442C						.	-	PRO/LEU	1997,839		756,485,177	2.0	3.0	3.0		1442		0.0	11	dbSNP_86	3	4530,1868		1710,1110,379	no	missense	PNPLA2	NM_020376.3	98	2466,1595,556	CC,CT,TT		29.1966,29.5839,29.3156	possibly-damaging	481/505	824789	6527,2707	1418	3199	4617	SO:0001583	missense	57104	exon10			ACCAGCTGGCCGG	AJ278475	CCDS7718.1	11p15.5	2014-03-14			ENSG00000177666	ENSG00000177666	3.1.1.3	"""Patatin-like phospholipase domain containing"""	30802	protein-coding gene	gene with protein product		609059				8619474, 16799181, 19029121	Standard	NM_020376		Approved	desnutrin, TTS-2.2, ATGL, FP17548, iPLA2zeta	uc001lrt.3	Q96AD5	OTTHUMG00000133309	ENST00000336615.4:c.1442T>C	11.37:g.824789T>C	ENSP00000337701:p.Leu481Pro	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	5	5	NM_020376	0	0	0	98	98	O60643|Q5EFF5|Q6XYE5|Q96ET6|Q9NQ61|Q9NQ62	Missense_Mutation	SNP	ENST00000336615.4	37	CCDS7718.1	1526	0.6987179487179487	356	0.7235772357723578	265	0.7320441988950276	378	0.6608391608391608	527	0.6952506596306068	-	10.58	1.389293	0.25118	0.704161	0.708034	ENSG00000177666	ENST00000336615	T	0.32272	1.46	.	.	.	.	.	.	.	.	T	0.00012	0.0000	N	0.08118	0	0.80722	P	0.0	P	0.51240	0.943	P	0.55011	0.766	T	0.23940	-1.0174	6	0.07175	T	0.84	.	.	.	.	rs1138693;rs3202695;rs17851512;rs57764436	481	Q96AD5	PLPL2_HUMAN	P	481	ENSP00000337701:L481P	ENSP00000337701:L481P	L	+	2	0	PNPLA2	814789	0.003000	0.15002	0.009000	0.14445	0.006000	0.05464	0.000000	0.12993	0.000000	0.14550	0.000000	0.15137	CTG	T|0.300;C|0.700		0.751	PNPLA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257106.1	NM_020376	
WT1	7490	hgsc.bcm.edu	37	11	32456694	32456694	+	Silent	SNP	C	C	A	rs2234582	byFrequency	TCGA-OR-A5LG-01A-11D-A29I-10	TCGA-OR-A5LG-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a39e8bc9-757d-4536-b301-458fc7ec992d	6b9e8d41-7044-4151-b4d6-e211b0e7a923	g.chr11:32456694C>A	ENST00000332351.3	-	1	482	c.198G>T	c.(196-198)ccG>ccT	p.P66P	WT1-AS_ENST00000426618.2_RNA|WT1-AS_ENST00000478367.1_RNA|WT1-AS_ENST00000395900.1_RNA|WT1_ENST00000448076.3_Silent_p.P66P|WT1-AS_ENST00000525436.1_RNA|WT1-AS_ENST00000494911.1_RNA|WT1-AS_ENST00000459866.1_RNA	NM_024424.3|NM_024426.4	NP_077742.2|NP_077744	P19544	WT1_HUMAN	Wilms tumor 1	0	Pro-rich.				adrenal cortex formation (GO:0035802)|adrenal gland development (GO:0030325)|branching involved in ureteric bud morphogenesis (GO:0001658)|camera-type eye development (GO:0043010)|cardiac muscle cell fate commitment (GO:0060923)|cellular response to cAMP (GO:0071320)|cellular response to gonadotropin stimulus (GO:0071371)|diaphragm development (GO:0060539)|epithelial cell differentiation (GO:0030855)|germ cell development (GO:0007281)|glomerular basement membrane development (GO:0032836)|glomerular visceral epithelial cell differentiation (GO:0072112)|glomerulus development (GO:0032835)|gonad development (GO:0008406)|heart development (GO:0007507)|kidney development (GO:0001822)|male genitalia development (GO:0030539)|male gonad development (GO:0008584)|mesenchymal to epithelial transition (GO:0060231)|metanephric epithelium development (GO:0072207)|metanephric mesenchyme development (GO:0072075)|metanephric S-shaped body morphogenesis (GO:0072284)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of female gonad development (GO:2000195)|negative regulation of metanephric glomerular mesangial cell proliferation (GO:0072302)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of translation (GO:0017148)|positive regulation of apoptotic process (GO:0043065)|positive regulation of heart growth (GO:0060421)|positive regulation of male gonad development (GO:2000020)|positive regulation of metanephric ureteric bud development (GO:2001076)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|posterior mesonephric tubule development (GO:0072166)|regulation of organ formation (GO:0003156)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)|RNA splicing (GO:0008380)|sex determination (GO:0007530)|thorax and anterior abdomen determination (GO:0007356)|tissue development (GO:0009888)|ureteric bud development (GO:0001657)|vasculogenesis (GO:0001570)|visceral serous pericardium development (GO:0061032)	cytoplasm (GO:0005737)|nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	C2H2 zinc finger domain binding (GO:0070742)|RNA binding (GO:0003723)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)		EWSR1/WT1(234)	NS(1)|haematopoietic_and_lymphoid_tissue(348)|kidney(149)|large_intestine(9)|lung(20)|peritoneum(1)|pleura(2)|skin(2)|upper_aerodigestive_tract(1)	533	Breast(20;0.247)		OV - Ovarian serous cystadenocarcinoma(30;0.128)			CCATTTGCTGCGGCTCAGACC	0.761			"""D, Mis, N, F, S"""	EWSR1	"""Wilms, desmoplastic small round cell tumor"""	Wilms			Wilms' tumor-Aniridia-ambiguous Genitals-mental Retardation;Frasier syndrome;Familial Wilms' tumor;Denys-Drash syndrome				C|||	1511	0.301717	0.6604	0.1556	5008	,	,		5831	0.0675		0.1839	False		,,,				2504	0.2832				p.P66P		.	yes	Rec	yes	"""Denys-Drash syndrome, Frasier syndrome, Familial Wilms tumor"""	11	11p13	7490	Wilms tumour 1 gene		O	.	WT1-6891	0			c.G198T						.	C	,,	1567,1733		420,727,503	2.0	3.0	3.0		198,198,198	1.2	0.0	11	dbSNP_98	3	1360,5576		235,890,2343	no	coding-synonymous,coding-synonymous,coding-synonymous	WT1	NM_000378.4,NM_024424.3,NM_024426.4	,,	655,1617,2846	AA,AC,CC		19.6078,47.4848,28.5952	,,	66/498,66/515,66/518	32456694	2927,7309	1650	3468	5118	SO:0001819	synonymous_variant	7490	exon1	Familial Cancer Database	WAGR syndrome; ; ;incl.: Early Onset Nephrotic Syndrome-WT1 associated	TTGCTGCGGCTCA		CCDS7878.2, CCDS44561.1, CCDS44562.1, CCDS55750.1, CCDS55751.1	11p13	2014-09-17			ENSG00000184937	ENSG00000184937		"""Zinc fingers, C2H2-type"""	12796	protein-coding gene	gene with protein product		607102		GUD		14681303	Standard	NM_024424		Approved	WAGR, WIT-2, AWT1	uc001mtn.2	P19544	OTTHUMG00000039556	ENST00000332351.3:c.198G>T	11.37:g.32456694C>A		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	10	7	NM_024424	0	0	0	0	0	A8K6S1|B3KSA5|Q15881|Q16256|Q16575|Q4VXV4|Q4VXV5|Q4VXV6|Q8IYZ5	Silent	SNP	ENST00000332351.3	37	CCDS7878.2																																																																																			C|0.748;A|0.252		0.761	WT1-001	KNOWN	non_ATG_start|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000095436.2	NM_000378	
TMEM132A	54972	hgsc.bcm.edu	37	11	60701987	60701987	+	Silent	SNP	G	G	A	rs7715	byFrequency	TCGA-OR-A5LG-01A-11D-A29I-10	TCGA-OR-A5LG-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a39e8bc9-757d-4536-b301-458fc7ec992d	6b9e8d41-7044-4151-b4d6-e211b0e7a923	g.chr11:60701987G>A	ENST00000453848.2	+	9	1745	c.1587G>A	c.(1585-1587)tcG>tcA	p.S529S	TMEM132A_ENST00000005286.4_Silent_p.S530S			Q24JP5	T132A_HUMAN	transmembrane protein 132A	529						endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)				breast(1)|cervix(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(14)|ovary(3)|prostate(1)|skin(3)	32						CAGAGGCGTCGGATGAGGCCG	0.776													A|||	2111	0.421526	0.4713	0.4467	5008	,	,		10338	0.3165		0.4225	False		,,,				2504	0.4438				p.S530S		.											.	TMEM132A-227	0			c.G1590A						.	A	,	942,1508		213,516,496	2.0	2.0	2.0		1590,1587	-7.2	0.0	11	dbSNP_52	2	2096,3524		468,1160,1182	no	coding-synonymous,coding-synonymous	TMEM132A	NM_017870.3,NM_178031.2	,	681,1676,1678	AA,AG,GG		37.2954,38.449,37.6456	,	530/1025,529/1024	60701987	3038,5032	1225	2810	4035	SO:0001819	synonymous_variant	54972	exon9			GGCGTCGGATGAG	AK000546	CCDS7997.1, CCDS44618.1	11q12.2	2006-03-02	2006-03-02	2006-03-02	ENSG00000006118	ENSG00000006118			31092	protein-coding gene	gene with protein product			"""heat shock 70kDa protein 5 (glucose-regulated protein, 78kDa) binding protein 1"""	HSPA5BP1		12514190, 10997877	Standard	NM_017870		Approved	GBP, FLJ20539	uc001nqi.3	Q24JP5	OTTHUMG00000167803	ENST00000453848.2:c.1587G>A	11.37:g.60701987G>A		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	6	4	NM_017870	0	0	0	0	0	Q69YU7|Q86VZ8|Q86W97|Q9H8K3|Q9HCI9|Q9NWY0	Silent	SNP	ENST00000453848.2	37	CCDS44618.1	914	0.4184981684981685	245	0.49796747967479676	164	0.4530386740331492	185	0.32342657342657344	320	0.42216358839050133	A	4.934	0.173621	0.09391	0.38449	0.372954	ENSG00000006118	ENST00000536409	.	.	.	3.58	-7.16	0.01516	.	.	.	.	.	T	0.00012	0.0000	.	.	.	0.09310	P	0.999999999658343	.	.	.	.	.	.	T	0.36792	-0.9733	3	.	.	.	.	2.6854	0.05106	0.499:0.0869:0.2045:0.2096	rs7715;rs1054244;rs3168133;rs17341674;rs17349396;rs60745855	.	.	.	R	121	.	.	G	+	1	0	TMEM132A	60458563	.	.	0.000000	0.03702	0.000000	0.00434	.	.	-2.810000	0.00348	-1.376000	0.01182	GGA	G|0.581;A|0.419		0.776	TMEM132A-001	KNOWN	NAGNAG_splice_site|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000396352.1	NM_017870	
C11orf95	65998	hgsc.bcm.edu	37	11	63531175	63531175	+	lincRNA	SNP	C	C	G	rs2959886	byFrequency	TCGA-OR-A5LG-01A-11D-A29I-10	TCGA-OR-A5LG-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a39e8bc9-757d-4536-b301-458fc7ec992d	6b9e8d41-7044-4151-b4d6-e211b0e7a923	g.chr11:63531175C>G	ENST00000433688.1	-	0	1770							C9JLR9	CK095_HUMAN	chromosome 11 open reading frame 95																		CGCCCCGCCACCGCGGCTGGT	0.751													G|||	946	0.188898	0.4372	0.0937	5008	,	,		7651	0.003		0.1372	False		,,,				2504	0.1656				p.R584R		.											.	.	0			c.G1752C						.						5.0	9.0	8.0					11																	63531175		637	1527	2164			65998	exon5			CCGCCACCGCGGC	BC000572, AK096306		11q13	2011-11-24			ENSG00000188070	ENSG00000188070			28449	protein-coding gene	gene with protein product		615699				20607705	Standard	NM_001144936		Approved	MGC3032	uc010rmv.2	C9JLR9			11.37:g.63531175C>G		Somatic	1	0		WXS	Illumina GAIIx	Phase_I	40	19	NM_001144936	0	0	0	0	0	A6NLS7|Q3C1V4	Silent	SNP	ENST00000433688.1	37																																																																																				C|0.216;G|0.784		0.751	C11orf95-201	KNOWN	basic	lincRNA	lincRNA		NM_001144936	
KRTAP5-10	387273	hgsc.bcm.edu	37	11	71276681	71276681	+	Silent	SNP	T	T	C	rs113879786		TCGA-OR-A5LG-01A-11D-A29I-10	TCGA-OR-A5LG-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a39e8bc9-757d-4536-b301-458fc7ec992d	6b9e8d41-7044-4151-b4d6-e211b0e7a923	g.chr11:71276681T>C	ENST00000398531.1	+	1	73	c.48T>C	c.(46-48)ggT>ggC	p.G16G	KRTAP5-10_ENST00000376536.4_Silent_p.G16G	NM_001012710.1	NP_001012728.1	Q6L8G5	KR510_HUMAN	keratin associated protein 5-10	16						keratin filament (GO:0045095)				endometrium(2)|large_intestine(1)|lung(4)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	12						GCTGTGGGGGTTGTGGCTCCG	0.662																																					p.G16G		.											.	KRTAP5-10-91	0			c.T48C						.						33.0	43.0	40.0					11																	71276681		2175	4274	6449	SO:0001819	synonymous_variant	387273	exon1			TGGGGGTTGTGGC	AB126079	CCDS41684.1	11q13.4	2008-02-05			ENSG00000204572	ENSG00000204572		"""Keratin associated proteins"""	23605	protein-coding gene	gene with protein product						15144888	Standard	NM_001012710		Approved	KRTAP5.10	uc001oqt.1	Q6L8G5	OTTHUMG00000057585	ENST00000398531.1:c.48T>C	11.37:g.71276681T>C		Somatic	89	0		WXS	Illumina GAIIx	Phase_I	174	45	NM_001012710	0	0	0	0	0	B9EHA4	Silent	SNP	ENST00000398531.1	37	CCDS41684.1																																																																																			T|0.717;C|0.283		0.662	KRTAP5-10-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000127968.2		
PHOX2A	401	hgsc.bcm.edu	37	11	71954893	71954893	+	Silent	SNP	G	G	A	rs182932220	byFrequency	TCGA-OR-A5LG-01A-11D-A29I-10	TCGA-OR-A5LG-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a39e8bc9-757d-4536-b301-458fc7ec992d	6b9e8d41-7044-4151-b4d6-e211b0e7a923	g.chr11:71954893G>A	ENST00000298231.5	-	1	327	c.156C>T	c.(154-156)ctC>ctT	p.L52L	PHOX2A_ENST00000544057.1_Intron	NM_005169.3	NP_005160.2	O14813	PHX2A_HUMAN	paired-like homeobox 2a	52					dopaminergic neuron differentiation (GO:0071542)|locus ceruleus development (GO:0021703)|midbrain development (GO:0030901)|noradrenergic neuron differentiation (GO:0003357)|oculomotor nerve formation (GO:0021623)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of respiratory gaseous exchange (GO:0043576)|somatic motor neuron differentiation (GO:0021523)|sympathetic nervous system development (GO:0048485)|transcription, DNA-templated (GO:0006351)|trochlear nerve formation (GO:0021642)	nuclear chromatin (GO:0000790)	RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|lung(2)	5						TGGAGGAGCCGAGCGCGGGGC	0.741													g|||	70	0.0139776	0.0015	0.013	5008	,	,		7842	0.006		0.0378	False		,,,				2504	0.0153				p.L52L		.											.	PHOX2A-90	0			c.C156T						.			15,3377		0,15,1681	2.0	3.0	3.0		156	3.5	1.0	11		3	189,6897		1,187,3355	no	coding-synonymous	PHOX2A	NM_005169.3		1,202,5036	AA,AG,GG		2.6672,0.4422,1.9469		52/285	71954893	204,10274	1696	3543	5239	SO:0001819	synonymous_variant	401	exon1			GGAGCCGAGCGCG	AF022722	CCDS8214.1	11q13.4	2014-09-04	2007-07-12	2003-02-14	ENSG00000165462	ENSG00000165462		"""Homeoboxes / PRD class"""	691	protein-coding gene	gene with protein product		602753	"""aristaless (Drosophila) homeobox, aristaless homeobox (Drosophila), fibrosis of extraocular muscles, congenital, 2, autosomal recessive"", ""paired-like (aristaless) homeobox 2a"""	ARIX, FEOM2		8661014, 11600883	Standard	NM_005169		Approved	PMX2A, CFEOM2	uc001osh.4	O14813	OTTHUMG00000167899	ENST00000298231.5:c.156C>T	11.37:g.71954893G>A		Somatic	2	0		WXS	Illumina GAIIx	Phase_I	28	9	NM_005169	0	0	0	0	0	A8K3N0|Q8IVZ2	Silent	SNP	ENST00000298231.5	37	CCDS8214.1																																																																																			G|0.980;A|0.020		0.741	PHOX2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396885.1	NM_005169	
PDE2A	5138	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	72308628	72308628	+	Missense_Mutation	SNP	T	T	C			TCGA-OR-A5LG-01A-11D-A29I-10	TCGA-OR-A5LG-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a39e8bc9-757d-4536-b301-458fc7ec992d	6b9e8d41-7044-4151-b4d6-e211b0e7a923	g.chr11:72308628T>C	ENST00000334456.5	-	5	604	c.359A>G	c.(358-360)aAt>aGt	p.N120S	PDE2A_ENST00000444035.2_Missense_Mutation_p.N111S|PDE2A_ENST00000376450.3_Intron|PDE2A_ENST00000418754.2_Intron|PDE2A_ENST00000540345.1_Missense_Mutation_p.N111S|PDE2A_ENST00000544570.1_Missense_Mutation_p.N113S|PDE2A_ENST00000540380.1_5'UTR	NM_002599.4	NP_002590.1	O00408	PDE2A_HUMAN	phosphodiesterase 2A, cGMP-stimulated	120					blood coagulation (GO:0007596)|calcium ion transmembrane transport (GO:0070588)|cAMP catabolic process (GO:0006198)|cAMP-mediated signaling (GO:0019933)|cellular response to cGMP (GO:0071321)|cellular response to drug (GO:0035690)|cellular response to granulocyte macrophage colony-stimulating factor stimulus (GO:0097011)|cellular response to macrophage colony-stimulating factor stimulus (GO:0036006)|cellular response to mechanical stimulus (GO:0071260)|cellular response to transforming growth factor beta stimulus (GO:0071560)|cGMP catabolic process (GO:0046069)|cGMP-mediated signaling (GO:0019934)|establishment of endothelial barrier (GO:0061028)|metabolic process (GO:0008152)|monocyte differentiation (GO:0030224)|negative regulation of cAMP biosynthetic process (GO:0030818)|negative regulation of protein import into nucleus, translocation (GO:0033159)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of vascular permeability (GO:0043116)|positive regulation of inflammatory response (GO:0050729)|positive regulation of vascular permeability (GO:0043117)|protein targeting to mitochondrion (GO:0006626)	axon (GO:0030424)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|mitochondrial matrix (GO:0005759)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|presynaptic membrane (GO:0042734)	calcium channel activity (GO:0005262)|cAMP binding (GO:0030552)|cGMP binding (GO:0030553)|cGMP-stimulated cyclic-nucleotide phosphodiesterase activity (GO:0004118)|cyclic-nucleotide phosphodiesterase activity (GO:0004112)|drug binding (GO:0008144)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|TPR domain binding (GO:0030911)			breast(2)|endometrium(1)|kidney(3)|large_intestine(2)|lung(21)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	36			BRCA - Breast invasive adenocarcinoma(5;3.55e-05)		Caffeine(DB00201)|Tofisopam(DB08811)	GCCCAGCCCATTGCAGCCCAG	0.642																																					p.N120S		.											.	PDE2A-156	0			c.A359G						.						39.0	36.0	37.0					11																	72308628		2200	4293	6493	SO:0001583	missense	5138	exon5			AGCCCATTGCAGC	U67733	CCDS8216.1, CCDS44670.1, CCDS53678.1, CCDS73345.1	11q13.1-q14.1	2008-05-14			ENSG00000186642	ENSG00000186642	3.1.4.17	"""Phosphodiesterases"""	8777	protein-coding gene	gene with protein product		602658				9210593	Standard	NM_002599		Approved		uc010rrc.2	O00408	OTTHUMG00000102045	ENST00000334456.5:c.359A>G	11.37:g.72308628T>C	ENSP00000334910:p.Asn120Ser	Somatic	55	0		WXS	Illumina GAIIx	Phase_I	29	11	NM_002599	0	0	2	3	1	B2R646|B3KRV5|E9PGI1|F6W5Z0|Q5J791|Q5J792|Q5J793|Q6ZMR1	Missense_Mutation	SNP	ENST00000334456.5	37	CCDS8216.1	.	.	.	.	.	.	.	.	.	.	T	10.38	1.335162	0.24253	.	.	ENSG00000186642	ENST00000334456;ENST00000444035;ENST00000429363;ENST00000544570;ENST00000540345;ENST00000538749	T;T;T;T;T	0.68903	-0.36;-0.36;-0.36;-0.36;-0.36	5.75	4.42	0.53409	.	0.458294	0.21788	N	0.069106	T	0.41003	0.1140	N	0.04880	-0.145	0.23820	N	0.996751	B;B;B;B	0.02656	0.0;0.0;0.0;0.0	B;B;B;B	0.04013	0.0;0.001;0.001;0.0	T	0.15178	-1.0446	10	0.25106	T	0.35	.	8.2449	0.31682	0.0:0.101:0.0:0.899	.	120;111;113;120	O00408;E9PGI1;F6W5Z0;B2R646	PDE2A_HUMAN;.;.;.	S	120;111;189;113;111;99	ENSP00000334910:N120S;ENSP00000411657:N111S;ENSP00000442256:N113S;ENSP00000446399:N111S;ENSP00000439683:N99S	ENSP00000334910:N120S	N	-	2	0	PDE2A	71986276	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	1.017000	0.29989	2.189000	0.69895	0.533000	0.62120	AAT	.		0.642	PDE2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219839.2	NM_002599	
LIPT2	387787	hgsc.bcm.edu	37	11	74204727	74204727	+	Silent	SNP	A	A	G	rs4944895	byFrequency	TCGA-OR-A5LG-01A-11D-A29I-10	TCGA-OR-A5LG-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a39e8bc9-757d-4536-b301-458fc7ec992d	6b9e8d41-7044-4151-b4d6-e211b0e7a923	g.chr11:74204727A>G	ENST00000310109.4	-	1	51	c.22T>C	c.(22-24)Ttg>Ctg	p.L8L	AP001372.2_ENST00000526036.1_lincRNA	NM_001144869.1	NP_001138341.1	A6NK58	LIPT2_HUMAN	lipoyl(octanoyl) transferase 2 (putative)	8					cellular protein modification process (GO:0006464)|lipoate biosynthetic process (GO:0009107)	mitochondrion (GO:0005739)	ligase activity (GO:0016874)|lipoyl(octanoyl) transferase activity (GO:0033819)|octanoyltransferase activity (GO:0016415)			endometrium(1)|prostate(1)|stomach(1)	3						AGGCGCACCAACCGAACGGCG	0.771													G|||	4671	0.932708	0.7579	0.9769	5008	,	,		11814	1.0		0.999	False		,,,				2504	1.0				p.L8L		.											.	LIPT2-68	0			c.T22C						.						1.0	1.0	1.0					11																	74204727		89	361	450	SO:0001819	synonymous_variant	387787	exon1			GCACCAACCGAAC		CCDS44679.1	11q13.4	2009-09-09			ENSG00000175536	ENSG00000175536			37216	protein-coding gene	gene with protein product							Standard	NM_001144869		Approved		uc010rrk.2	A6NK58	OTTHUMG00000165646	ENST00000310109.4:c.22T>C	11.37:g.74204727A>G		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	5	5	NM_001144869	0	0	0	0	0		Silent	SNP	ENST00000310109.4	37	CCDS44679.1																																																																																			A|0.071;G|0.929		0.771	LIPT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385544.1	NM_001144869	
B3GNT6	192134	hgsc.bcm.edu	37	11	76751585	76751604	+	Frame_Shift_Del	DEL	TGGCCCTTCGGCGTGCAGCT	TGGCCCTTCGGCGTGCAGCT	-	rs200788398|rs34153015|rs11292200|rs201940118|rs11292199	byFrequency	TCGA-OR-A5LG-01A-11D-A29I-10	TCGA-OR-A5LG-10A-01D-A29L-10	TGGCCCTTCGGCGTGCAGCT	TGGCCCTTCGGCGTGCAGCT	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a39e8bc9-757d-4536-b301-458fc7ec992d	6b9e8d41-7044-4151-b4d6-e211b0e7a923	g.chr11:76751585_76751604delTGGCCCTTCGGCGTGCAGCT	ENST00000533140.1	+	2	1128_1147	c.990_1009delTGGCCCTTCGGCGTGCAGCT	c.(988-1011)cctggcccttcggcgtgcagcttgfs	p.GPSACSL331fs	B3GNT6_ENST00000421061.1_Splice_Site_p.IGPSACS209fs|B3GNT6_ENST00000354301.5_Splice_Site_p.WPFGVQL330fs			O43505	B3GN1_HUMAN	UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 6 (core 3 synthase)	0					axon guidance (GO:0007411)|carbohydrate metabolic process (GO:0005975)|glycosaminoglycan metabolic process (GO:0030203)|keratan sulfate biosynthetic process (GO:0018146)|keratan sulfate metabolic process (GO:0042339)|poly-N-acetyllactosamine biosynthetic process (GO:0030311)|protein glycosylation (GO:0006486)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|integral component of Golgi membrane (GO:0030173)	N-acetyllactosaminide beta-1,3-N-acetylglucosaminyltransferase activity (GO:0008532)			central_nervous_system(1)|kidney(2)|lung(4)|prostate(1)	8						GAGGGCATCCTGGCCCTTCGGCGTGCAGCTTGCCTGGCGC	0.686																																					p.330_336del		.											.	.	0			c.989_1006del						.																																			SO:0001589	frameshift_variant	192134	exon4			GCATCCTGGCCCT	AB073740	CCDS53681.1	11q13.4	2013-02-19			ENSG00000198488	ENSG00000198488		"""Beta 3-glycosyltransferases"""	24141	protein-coding gene	gene with protein product		615315				11821425	Standard	NM_138706		Approved	B3Gn-T6	uc021qnp.1	Q6ZMB0		ENST00000533140.1:c.990_1009delTGGCCCTTCGGCGTGCAGCT	11.37:g.76751585_76751604delTGGCCCTTCGGCGTGCAGCT	ENSP00000435352:p.Gly331fs	Somatic	2	0		WXS	Illumina GAIIx	Phase_I	51	0	NM_138706	0	0	0	0	0	Q4TTN0	In_Frame_Del	DEL	ENST00000533140.1	37	CCDS53681.1																																																																																			.		0.686	B3GNT6-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000382740.2	NM_138706	
SLC37A2	219855	bcgsc.ca	37	11	124955032	124955032	+	Silent	SNP	T	T	C	rs948268	byFrequency	TCGA-OR-A5LG-01A-11D-A29I-10	TCGA-OR-A5LG-10A-01D-A29L-10	T	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a39e8bc9-757d-4536-b301-458fc7ec992d	6b9e8d41-7044-4151-b4d6-e211b0e7a923	g.chr11:124955032T>C	ENST00000403796.2	+	14	1546	c.1245T>C	c.(1243-1245)gaT>gaC	p.D415D	SLC37A2_ENST00000525837.1_3'UTR|SLC37A2_ENST00000407458.1_Silent_p.D415D|SLC37A2_ENST00000298280.5_3'UTR|SLC37A2_ENST00000308074.4_Silent_p.D415D	NM_001145290.1	NP_001138762.1	Q8TED4	SPX2_HUMAN	solute carrier family 37 (glucose-6-phosphate transporter), member 2	415					carbohydrate transport (GO:0008643)|transmembrane transport (GO:0055085)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	transporter activity (GO:0005215)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(6)|ovary(2)|prostate(2)|skin(1)|stomach(2)|urinary_tract(1)	27	all_hematologic(175;0.215)	Breast(109;0.012)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.152)|all_lung(97;0.159)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;1.61e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0384)		TCTCTGCTGATCTGGTGAGTG	0.617													C|||	3331	0.665136	0.9478	0.513	5008	,	,		17342	0.4643		0.6213	False		,,,				2504	0.6431				p.D415D	Melanoma(11;373 620 21213 26083 47768)	.											.	SLC37A2-92	0			c.T1245C						.	C	,	3915,487	227.2+/-242.5	1747,421,33	60.0	61.0	61.0		1245,1245	3.0	1.0	11	dbSNP_86	61	5300,3298	492.6+/-373.4	1666,1968,665	no	coding-synonymous,coding-synonymous	SLC37A2	NM_001145290.1,NM_198277.2	,	3413,2389,698	CC,CT,TT		38.3578,11.0632,29.1154	,	415/502,415/506	124955032	9215,3785	2201	4299	6500	SO:0001819	synonymous_variant	219855	exon14			TGCTGATCTGGTG	AK074100	CCDS31714.1, CCDS44757.1	11q24.2	2013-07-17	2013-07-17		ENSG00000134955	ENSG00000134955		"""Solute carriers"""	20644	protein-coding gene	gene with protein product			"""solute carrier family 37 (glycerol-3-phosphate transporter), member 2"""				Standard	NM_198277		Approved	FLJ00171	uc010sau.2	Q8TED4	OTTHUMG00000165879	ENST00000403796.2:c.1245T>C	11.37:g.124955032T>C		Somatic	75	0		WXS	Illumina GAIIx	Phase_I	79	5	NM_001145290	0	0	0	0	0	A8K2P9|Q6P599|Q7Z7P8|Q8TEM2	Silent	SNP	ENST00000403796.2	37	CCDS44757.1																																																																																			T|0.312;C|0.688		0.617	SLC37A2-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000386837.1	XM_166184	
DCP1B	196513	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	2058258	2058258	+	Silent	SNP	G	G	C			TCGA-OR-A5LG-01A-11D-A29I-10	TCGA-OR-A5LG-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a39e8bc9-757d-4536-b301-458fc7ec992d	6b9e8d41-7044-4151-b4d6-e211b0e7a923	g.chr12:2058258G>C	ENST00000280665.6	-	8	1846	c.1767C>G	c.(1765-1767)ctC>ctG	p.L589L	DCP1B_ENST00000397173.4_Silent_p.L487L	NM_152640.3	NP_689853.3	Q8IZD4	DCP1B_HUMAN	decapping mRNA 1B	589					exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay (GO:0043928)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|RNA metabolic process (GO:0016070)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nucleus (GO:0005634)	hydrolase activity (GO:0016787)			NS(1)|breast(1)|endometrium(6)|kidney(2)|large_intestine(3)|lung(10)|skin(1)	24			OV - Ovarian serous cystadenocarcinoma(31;0.00193)			TTACCTGAATGAGGTACAGCA	0.597																																					p.L589L		.											.	DCP1B-91	0			c.C1767G						.						85.0	80.0	81.0					12																	2058258		2203	4300	6503	SO:0001819	synonymous_variant	196513	exon8			CTGAATGAGGTAC	AY146652	CCDS31727.1	12p13.33	2013-05-02	2013-05-02		ENSG00000151065	ENSG00000151065			24451	protein-coding gene	gene with protein product		609843	"""DCP1 decapping enzyme homolog B (S. cerevisiae)"""			12417715, 15067023	Standard	NM_152640		Approved	FLJ31638	uc001qjx.1	Q8IZD4	OTTHUMG00000168113	ENST00000280665.6:c.1767C>G	12.37:g.2058258G>C		Somatic	110	0		WXS	Illumina GAIIx	Phase_I	70	54	NM_152640	0	0	0	0	0	B4DRD1|Q86XH9|Q96BP8|Q96MZ8	Silent	SNP	ENST00000280665.6	37	CCDS31727.1																																																																																			.		0.597	DCP1B-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398244.1	NM_152640	
DENND5B	160518	bcgsc.ca	37	12	31605044	31605044	+	Missense_Mutation	SNP	G	G	T	rs1056320	byFrequency	TCGA-OR-A5LG-01A-11D-A29I-10	TCGA-OR-A5LG-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a39e8bc9-757d-4536-b301-458fc7ec992d	6b9e8d41-7044-4151-b4d6-e211b0e7a923	g.chr12:31605044G>T	ENST00000389082.5	-	5	1723	c.1459C>A	c.(1459-1461)Cat>Aat	p.H487N	DENND5B_ENST00000536562.1_Missense_Mutation_p.H522N|DENND5B_ENST00000354285.4_Missense_Mutation_p.H509N|snoU13_ENST00000458765.1_RNA|DENND5B_ENST00000306833.6_Missense_Mutation_p.H522N	NM_144973.3	NP_659410.3	Q6ZUT9	DEN5B_HUMAN	DENN/MADD domain containing 5B	487			H -> N (in dbSNP:rs1056320). {ECO:0000269|PubMed:14702039, ECO:0000269|Ref.5}.		positive regulation of Rab GTPase activity (GO:0032851)	integral component of membrane (GO:0016021)|membrane (GO:0016020)	Rab guanyl-nucleotide exchange factor activity (GO:0017112)			NS(2)|central_nervous_system(1)|endometrium(1)|kidney(4)|large_intestine(8)|lung(17)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	38						TCTTCACAATGCAGTTTTAAA	0.473													G|||	888	0.177316	0.2284	0.1052	5008	,	,		19727	0.247		0.1233	False		,,,				2504	0.1431				p.H487N		.											.	DENND5B-24	0			c.C1459A						.	G	ASN/HIS	770,3092		77,616,1238	167.0	167.0	167.0		1459	4.7	1.0	12	dbSNP_86	167	867,7403		54,759,3322	yes	missense	DENND5B	NM_144973.3	68	131,1375,4560	TT,TG,GG		10.4837,19.9379,13.4932	benign	487/1275	31605044	1637,10495	1931	4135	6066	SO:0001583	missense	160518	exon5			CACAATGCAGTTT	AF086301	CCDS44857.1	12p11.21	2012-10-03			ENSG00000170456	ENSG00000170456		"""DENN/MADD domain containing"""	28338	protein-coding gene	gene with protein product						12477932	Standard	NM_144973		Approved	MGC24039	uc001rki.1	Q6ZUT9	OTTHUMG00000169034	ENST00000389082.5:c.1459C>A	12.37:g.31605044G>T	ENSP00000373734:p.His487Asn	Somatic	137	1		WXS	Illumina GAIIx	Phase_I	194	6	NM_144973	0	0	6	6	0	B5ME75|Q59FW8|Q68CZ7|Q6NUJ0|Q7Z3F9|Q8N973|Q8WUC8	Missense_Mutation	SNP	ENST00000389082.5	37	CCDS44857.1	394	0.1804029304029304	122	0.24796747967479674	42	0.11602209944751381	139	0.243006993006993	91	0.12005277044854881	G	10.69	1.420867	0.25639	0.199379	0.104837	ENSG00000170456	ENST00000389082;ENST00000306833;ENST00000536562;ENST00000354285;ENST00000546299	T;T;T;T;T	0.39997	1.05;1.05;1.05;1.05;1.05	4.67	4.67	0.58626	.	0.346390	0.26804	N	0.022409	T	0.00012	0.0000	N	0.14661	0.345	0.45239	P	0.0017559999999999798	B;B;B;B	0.12630	0.001;0.006;0.0;0.0	B;B;B;B	0.19666	0.001;0.026;0.0;0.001	T	0.19516	-1.0303	9	0.19147	T	0.46	-18.0088	13.191	0.59711	0.0791:0.0:0.9209:0.0	rs1056320;rs3168408;rs16916263;rs52832424;rs58342800;rs1056320	409;509;487;522	Q6ZUT9-3;Q6ZUT9-4;Q6ZUT9;G3V1S3	.;.;DEN5B_HUMAN;.	N	487;522;522;509;439	ENSP00000373734:H487N;ENSP00000306482:H522N;ENSP00000444889:H522N;ENSP00000346238:H509N;ENSP00000442938:H439N	ENSP00000306482:H522N	H	-	1	0	DENND5B	31496311	1.000000	0.71417	1.000000	0.80357	0.818000	0.46254	5.975000	0.70475	2.421000	0.82119	0.563000	0.77884	CAT	G|0.818;T|0.182		0.473	DENND5B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402040.1	NM_144973	
AVPR1A	552	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	63544384	63544384	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5LG-01A-11D-A29I-10	TCGA-OR-A5LG-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a39e8bc9-757d-4536-b301-458fc7ec992d	6b9e8d41-7044-4151-b4d6-e211b0e7a923	g.chr12:63544384C>T	ENST00000299178.2	-	1	338	c.233G>A	c.(232-234)cGg>cAg	p.R78Q		NM_000706.4	NP_000697.1	P37288	V1AR_HUMAN	arginine vasopressin receptor 1A	78					activation of phospholipase C activity (GO:0007202)|blood circulation (GO:0008015)|calcium-mediated signaling (GO:0019722)|cellular response to water deprivation (GO:0042631)|G-protein coupled receptor signaling pathway (GO:0007186)|generation of precursor metabolites and energy (GO:0006091)|grooming behavior (GO:0007625)|maternal aggressive behavior (GO:0002125)|maternal behavior (GO:0042711)|myotube differentiation (GO:0014902)|negative regulation of female receptivity (GO:0007621)|negative regulation of transmission of nerve impulse (GO:0051970)|penile erection (GO:0043084)|positive regulation of cell growth (GO:0030307)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cellular pH reduction (GO:0032849)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of glutamate secretion (GO:0014049)|positive regulation of heart rate (GO:0010460)|positive regulation of prostaglandin biosynthetic process (GO:0031394)|positive regulation of renal sodium excretion (GO:0035815)|positive regulation of systemic arterial blood pressure (GO:0003084)|positive regulation of vasoconstriction (GO:0045907)|regulation of systemic arterial blood pressure by vasopressin (GO:0001992)|response to corticosterone (GO:0051412)|social behavior (GO:0035176)|sperm ejaculation (GO:0042713)|telencephalon development (GO:0021537)	cytoplasmic vesicle (GO:0031410)|endosome (GO:0005768)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	peptide hormone binding (GO:0017046)|protein kinase C binding (GO:0005080)|vasopressin receptor activity (GO:0005000)			central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(6)|lung(12)|prostate(2)|skin(1)	26			BRCA - Breast invasive adenocarcinoma(9;0.193)	GBM - Glioblastoma multiforme(28;0.0569)	Conivaptan(DB00872)|Desmopressin(DB00035)|Felypressin(DB00093)|Terlipressin(DB02638)|Tolvaptan(DB06212)|Vasopressin(DB00067)	GCGCGGCGTCCGGTGCAGAGC	0.657																																					p.R78Q		.											.	AVPR1A-946	0			c.G233A						.						24.0	26.0	25.0					12																	63544384		2203	4299	6502	SO:0001583	missense	552	exon1			GGCGTCCGGTGCA	L25615	CCDS8965.1	12q14-q15	2012-08-08				ENSG00000166148		"""GPCR / Class A : Vasopressin and oxytocin receptors"""	895	protein-coding gene	gene with protein product		600821		AVPR1		8106369	Standard	NM_000706		Approved		uc001sro.2	P37288		ENST00000299178.2:c.233G>A	12.37:g.63544384C>T	ENSP00000299178:p.Arg78Gln	Somatic	49	0		WXS	Illumina GAIIx	Phase_I	171	91	NM_000706	0	0	0	3	3		Missense_Mutation	SNP	ENST00000299178.2	37	CCDS8965.1	.	.	.	.	.	.	.	.	.	.	C	15.94	2.980019	0.53827	.	.	ENSG00000166148	ENST00000299178	T	0.40756	1.02	5.33	4.44	0.53790	GPCR, rhodopsin-like superfamily (1);	0.153645	0.56097	D	0.000032	T	0.38639	0.1048	M	0.68593	2.085	0.31091	N	0.71085	P	0.39250	0.665	B	0.36766	0.232	T	0.49513	-0.8932	9	.	.	.	-18.5884	9.1471	0.36939	0.0:0.8326:0.0:0.1674	.	78	P37288	V1AR_HUMAN	Q	78	ENSP00000299178:R78Q	.	R	-	2	0	AVPR1A	61830651	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	1.202000	0.32271	1.248000	0.43934	0.561000	0.74099	CGG	.		0.657	AVPR1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406734.1		
FAM109A	144717	hgsc.bcm.edu	37	12	111800827	111800835	+	In_Frame_Del	DEL	GCCACCCCC	GCCACCCCC	-	rs3840795|rs139032867|rs199734407|rs200911236	byFrequency	TCGA-OR-A5LG-01A-11D-A29I-10	TCGA-OR-A5LG-10A-01D-A29L-10	GCCACCCCC	GCCACCCCC	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a39e8bc9-757d-4536-b301-458fc7ec992d	6b9e8d41-7044-4151-b4d6-e211b0e7a923	g.chr12:111800827_111800835delGCCACCCCC	ENST00000547838.2	-	2	494_502	c.397_405delGGGGGTGGC	c.(397-405)gggggtggcdel	p.GGG133del	FAM109A_ENST00000548163.1_In_Frame_Del_p.GGG133del|FAM109A_ENST00000450786.2_In_Frame_Del_p.113_116AGVA>A|FAM109A_ENST00000361483.3_In_Frame_Del_p.GGG146del|FAM109A_ENST00000392658.5_In_Frame_Del_p.GGG133del			Q8N4B1	SESQ1_HUMAN	family with sequence similarity 109, member A	133					endosome organization (GO:0007032)|receptor recycling (GO:0001881)|retrograde transport, endosome to Golgi (GO:0042147)	clathrin-coated vesicle (GO:0030136)|early endosome (GO:0005769)|recycling endosome (GO:0055037)|trans-Golgi network (GO:0005802)	protein homodimerization activity (GO:0042803)	p.G133M(1)|p.G146_G148delGGG(1)|p.G133_G135delGGG(1)		breast(1)|endometrium(1)|lung(1)|ovary(1)	4						gcagggCCATGCCACCCCCGCCACGTACA	0.732														1710	0.341454	0.233	0.3732	5008	,	,		9526	0.6518		0.2078	False		,,,				2504	0.2832				p.146_148del		.											.	FAM109A-90	3	Deletion - In frame(2)|Substitution - Missense(1)	breast(2)|ovary(1)	c.436_444del						.		,,	674,3090		134,406,1342				http://www.ncbi.nlm.nih.gov/sites/varvu?gene	,,	-4.5	0.0		dbSNP_107	6	1126,6432		186,754,2839	no	coding,coding,coding	FAM109A	NM_144671.4,NM_001177997.1,NM_001177996.1	,,	320,1160,4181	A1A1,A1R,RR		14.8981,17.9065,15.8983	,,	,,		1800,9522				SO:0001651	inframe_deletion	144717	exon4			GGCCATGCCACCC	BC034809	CCDS9152.1, CCDS53833.1	12q24.12	2013-01-10			ENSG00000198324	ENSG00000198324		"""Pleckstrin homology (PH) domain containing"""	26509	protein-coding gene	gene with protein product		614239				12477932	Standard	NM_144671		Approved	FLJ32356	uc009zvu.3	Q8N4B1	OTTHUMG00000169547	ENST00000547838.2:c.397_405delGGGGGTGGC	12.37:g.111800827_111800835delGCCACCCCC	ENSP00000447353:p.Gly133_Gly135del	Somatic	2	1		WXS	Illumina GAIIx	Phase_I	34	0	NM_001177996	0	0	0	0	0	J3KP50|Q6PJL9|Q96MH8	In_Frame_Del	DEL	ENST00000547838.2	37	CCDS9152.1																																																																																			.		0.732	FAM109A-007	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404768.2	NM_144671	
RNFT2	84900	hgsc.bcm.edu	37	12	117187907	117187907	+	Silent	SNP	T	T	C	rs111256849	byFrequency	TCGA-OR-A5LG-01A-11D-A29I-10	TCGA-OR-A5LG-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a39e8bc9-757d-4536-b301-458fc7ec992d	6b9e8d41-7044-4151-b4d6-e211b0e7a923	g.chr12:117187907T>C	ENST00000257575.4	+	4	578	c.345T>C	c.(343-345)caT>caC	p.H115H	RNFT2_ENST00000407967.3_Silent_p.H115H|RNFT2_ENST00000319176.7_Silent_p.H115H|RNFT2_ENST00000392549.2_Silent_p.H115H			Q96EX2	RNFT2_HUMAN	ring finger protein, transmembrane 2	115	His-rich.					integral component of membrane (GO:0016021)	zinc ion binding (GO:0008270)			endometrium(1)|large_intestine(3)|lung(1)|urinary_tract(1)	6	all_neural(191;0.117)|Medulloblastoma(191;0.163)			BRCA - Breast invasive adenocarcinoma(302;0.034)		CCCACCACCATTTCCACCATG	0.746													C|||	1284	0.25639	0.4826	0.1326	5008	,	,		12011	0.1786		0.166	False		,,,				2504	0.2117				p.H115H		.											.	.	0			c.T345C						.	C	,	1295,2539		234,827,856	3.0	4.0	4.0		345,345	3.2	1.0	12	dbSNP_132	4	888,6786		67,754,3016	no	coding-synonymous,coding-synonymous	RNFT2	NM_001109903.1,NM_032814.3	,	301,1581,3872	CC,CT,TT		11.5715,33.7767,18.9694	,	115/445,115/421	117187907	2183,9325	1917	3837	5754	SO:0001819	synonymous_variant	84900	exon4			CCACCATTTCCAC	AK027533	CCDS9180.2, CCDS44987.1	12q24.22	2013-01-09	2008-02-26	2008-02-26	ENSG00000135119	ENSG00000135119		"""RING-type (C3HC4) zinc fingers"""	25905	protein-coding gene	gene with protein product			"""transmembrane protein 118"""	TMEM118		12477932	Standard	NM_032814		Approved	FLJ14627	uc009zwn.3	Q96EX2	OTTHUMG00000150882	ENST00000257575.4:c.345T>C	12.37:g.117187907T>C		Somatic	1	0		WXS	Illumina GAIIx	Phase_I	28	13	NM_001109903	0	0	0	0	0	E9PAM7|Q96SU5	Silent	SNP	ENST00000257575.4	37	CCDS44987.1																																																																																			T|0.767;C|0.233		0.746	RNFT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320417.1	NM_032814	
PITPNM2	57605	bcgsc.ca	37	12	123471094	123471094	+	Silent	SNP	G	G	A	rs12811109	byFrequency	TCGA-OR-A5LG-01A-11D-A29I-10	TCGA-OR-A5LG-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a39e8bc9-757d-4536-b301-458fc7ec992d	6b9e8d41-7044-4151-b4d6-e211b0e7a923	g.chr12:123471094G>A	ENST00000542749.1	-	23	3678	c.3615C>T	c.(3613-3615)caC>caT	p.H1205H	PITPNM2_ENST00000320201.4_Silent_p.H1205H|PITPNM2_ENST00000392428.1_Silent_p.H926H|PITPNM2_ENST00000280562.5_Silent_p.H1199H			Q9BZ72	PITM2_HUMAN	phosphatidylinositol transfer protein, membrane-associated 2	1205					metabolic process (GO:0008152)|transport (GO:0006810)	integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)	calcium ion binding (GO:0005509)|lipid binding (GO:0008289)			NS(2)|central_nervous_system(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(8)|lung(10)|ovary(2)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)	39	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;2.55e-05)|Epithelial(86;8.43e-05)|BRCA - Breast invasive adenocarcinoma(302;0.123)		CATAGGCCGCGTGCACGCGCA	0.682													G|||	613	0.122404	0.0431	0.1873	5008	,	,		15693	0.002		0.2157	False		,,,				2504	0.2117				p.H1205H		.											.	PITPNM2-228	0			c.C3615T						.	G		308,4096		7,294,1901	25.0	22.0	23.0		3615	0.1	1.0	12	dbSNP_121	23	1667,6931		136,1395,2768	no	coding-synonymous	PITPNM2	NM_020845.2		143,1689,4669	AA,AG,GG		19.3882,6.9936,15.19		1205/1350	123471094	1975,11027	2202	4299	6501	SO:0001819	synonymous_variant	57605	exon24			GGCCGCGTGCACG	AF334585	CCDS9242.1, CCDS73543.1	12q24.31	2008-02-05				ENSG00000090975			21044	protein-coding gene	gene with protein product		608920				10022914	Standard	XM_005253582		Approved	RDGBA2, RDGB2, NIR3	uc001uej.1	Q9BZ72		ENST00000542749.1:c.3615C>T	12.37:g.123471094G>A		Somatic	120	1		WXS	Illumina GAIIx	Phase_I	185	9	NM_020845	0	0	6	6	0	Q9P271	Silent	SNP	ENST00000542749.1	37	CCDS9242.1																																																																																			G|0.860;A|0.140		0.682	PITPNM2-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401342.1	NM_020845	
MEDAG	84935	hgsc.bcm.edu	37	13	31480827	31480827	+	Missense_Mutation	SNP	A	A	G	rs9531945	byFrequency	TCGA-OR-A5LG-01A-11D-A29I-10	TCGA-OR-A5LG-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a39e8bc9-757d-4536-b301-458fc7ec992d	6b9e8d41-7044-4151-b4d6-e211b0e7a923	g.chr13:31480827A>G	ENST00000380482.4	+	1	500	c.175A>G	c.(175-177)Agg>Ggg	p.R59G	TEX26-AS1_ENST00000590344.1_RNA|TEX26-AS1_ENST00000588726.1_RNA|TEX26-AS1_ENST00000592950.1_RNA|TEX26-AS1_ENST00000585870.1_RNA|TEX26-AS1_ENST00000593246.1_RNA|TEX26-AS1_ENST00000590721.1_RNA	NM_032849.3	NP_116238	Q5VYS4	MEDAG_HUMAN	mesenteric estrogen-dependent adipogenesis	59			R -> G (in dbSNP:rs9531945). {ECO:0000269|PubMed:14702039, ECO:0000269|PubMed:15489334}.		positive regulation of fat cell differentiation (GO:0045600)	cytoplasm (GO:0005737)											CGTGGTGGCCAggcccgggga	0.726													G|||	4890	0.976438	0.913	0.9957	5008	,	,		11722	1.0		1.0	False		,,,				2504	1.0				p.R59G		.											.	.	0			c.A175G						.	G	GLY/ARG	2883,187		1349,185,1	3.0	4.0	4.0		175	3.2	0.0	13	dbSNP_119	4	6648,4		3322,4,0	no	missense	C13orf33	NM_032849.3	125	4671,189,1	GG,GA,AA		0.0601,6.0912,1.9646	benign	59/304	31480827	9531,191	1535	3326	4861	SO:0001583	missense	84935	exon1			GTGGCCAGGCCCG	AB055407	CCDS9338.1	13q12.3	2013-10-11	2012-09-26	2012-09-26	ENSG00000102802	ENSG00000102802			25926	protein-coding gene	gene with protein product	"""mesenteric estrogen-dependent adipose 4"", ""activated in W/Wv mouse stomach 3 homolog"""		"""chromosome 13 open reading frame 33"""	C13orf33		22510272	Standard	NM_032849		Approved	FLJ14834, AWMS3, MEDA-4	uc001uth.4	Q5VYS4	OTTHUMG00000016679	ENST00000380482.4:c.175A>G	13.37:g.31480827A>G	ENSP00000369849:p.Arg59Gly	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	12	12	NM_032849	0	0	0	0	0	Q8IXF1|Q96K26|Q96NC8	Missense_Mutation	SNP	ENST00000380482.4	37	CCDS9338.1	2123	0.9720695970695971	437	0.8882113821138211	361	0.9972375690607734	567	0.9912587412587412	758	1.0	G	0.006	-2.044123	0.00398	0.939088	0.999399	ENSG00000102802	ENST00000380482	T	0.40225	1.04	4.92	3.15	0.36227	.	0.260438	0.31495	N	0.007559	T	0.00012	0.0000	N	0.02539	-0.55	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.42616	-0.9441	9	0.02654	T	1	-3.5214	6.5331	0.22338	0.1691:0.1474:0.6836:0.0	rs9531945;rs17857210;rs57016010;rs9531945	59	Q5VYS4	CM033_HUMAN	G	59	ENSP00000369849:R59G	ENSP00000369849:R59G	R	+	1	2	C13orf33	30378827	0.386000	0.25180	0.001000	0.08648	0.005000	0.04900	2.086000	0.41643	0.132000	0.18615	-1.032000	0.02404	AGG	A|0.219;G|0.781		0.726	MEDAG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044375.1	NM_032849	
UPF3A	65110	broad.mit.edu	37	13	115047559	115047559	+	Silent	SNP	C	C	T			TCGA-OR-A5LG-01A-11D-A29I-10	TCGA-OR-A5LG-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a39e8bc9-757d-4536-b301-458fc7ec992d	6b9e8d41-7044-4151-b4d6-e211b0e7a923	g.chr13:115047559C>T	ENST00000375299.3	+	2	327	c.271C>T	c.(271-273)Ctg>Ttg	p.L91L	UPF3A_ENST00000351487.5_Silent_p.L91L	NM_023011.3	NP_075387.1	Q9H1J1	REN3A_HUMAN	UPF3 regulator of nonsense transcripts homolog A (yeast)	91	Required for interaction with UPF2.				gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|mRNA transport (GO:0051028)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|nucleocytoplasmic transport (GO:0006913)|positive regulation of translation (GO:0045727)|RNA metabolic process (GO:0016070)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	nucleocytoplasmic transporter activity (GO:0005487)|nucleotide binding (GO:0000166)|RNA binding (GO:0003723)	p.L91L(8)		autonomic_ganglia(1)|central_nervous_system(2)|kidney(2)|large_intestine(2)|lung(3)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	16	Lung NSC(43;0.00299)|all_neural(89;0.0337)|Medulloblastoma(90;0.163)|Lung SC(71;0.218)	all_cancers(25;0.0191)|all_epithelial(44;0.00716)|all_lung(25;0.0173)|Lung NSC(25;0.0634)|Breast(118;0.238)	BRCA - Breast invasive adenocarcinoma(86;0.0886)	OV - Ovarian serous cystadenocarcinoma(48;0.195)|Epithelial(10;0.2)		GCTGCGCCCGCTGCCAGCACA	0.731																																					p.L91L		.											.	UPF3A-91	8	Substitution - coding silent(8)	lung(2)|prostate(2)|kidney(2)|central_nervous_system(2)	c.C271T						.						4.0	4.0	4.0					13																	115047559		1902	3804	5706	SO:0001819	synonymous_variant	65110	exon2			CGCCCGCTGCCAG	AF318575	CCDS9543.1, CCDS9544.1	13q34	2010-04-30			ENSG00000169062	ENSG00000169062			20332	protein-coding gene	gene with protein product		605530				11113196, 11163187	Standard	NM_023011		Approved	RENT3A, UPF3, HUPF3A	uc001vup.3	Q9H1J1	OTTHUMG00000017403	ENST00000375299.3:c.271C>T	13.37:g.115047559C>T		Somatic	23	0		WXS	Illumina GAIIx	Phase_I	85	7	NM_080687	0	0	15	15	0	A2A366|Q5T8C3|Q5T8C9|Q7Z6N3|Q86YK1|Q9BZI8	Silent	SNP	ENST00000375299.3	37	CCDS9543.1																																																																																			.		0.731	UPF3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045968.2		
PNN	5411	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	14	39650733	39650733	+	Missense_Mutation	SNP	C	C	A			TCGA-OR-A5LG-01A-11D-A29I-10	TCGA-OR-A5LG-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a39e8bc9-757d-4536-b301-458fc7ec992d	6b9e8d41-7044-4151-b4d6-e211b0e7a923	g.chr14:39650733C>A	ENST00000216832.4	+	9	1887	c.1820C>A	c.(1819-1821)tCc>tAc	p.S607Y	PNN_ENST00000557680.1_Intron	NM_002687.3	NP_002678	Q9H307	PININ_HUMAN	pinin, desmosome associated protein	607	Necessary for interaction with PPIG.|Ser-rich.				cell adhesion (GO:0007155)|mRNA splicing, via spliceosome (GO:0000398)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	catalytic step 2 spliceosome (GO:0071013)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|intermediate filament (GO:0005882)|membrane (GO:0016020)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)|structural molecule activity (GO:0005198)			breast(2)|endometrium(5)|kidney(1)|large_intestine(6)|lung(9)|ovary(1)|skin(2)|stomach(1)	27	Hepatocellular(127;0.213)		LUAD - Lung adenocarcinoma(48;0.000565)|Lung(238;0.000711)	GBM - Glioblastoma multiforme(112;0.0119)		cgcagtagttccagtagcagc	0.507																																					p.S607Y		.											.	PNN-91	0			c.C1820A						.						63.0	55.0	58.0					14																	39650733		2201	4299	6500	SO:0001583	missense	5411	exon9			GTAGTTCCAGTAG	U77718	CCDS9671.1	14q21.1	2010-07-02			ENSG00000100941	ENSG00000100941			9162	protein-coding gene	gene with protein product		603154				8922384	Standard	NM_002687		Approved	memA	uc001wuw.4	Q9H307	OTTHUMG00000028821	ENST00000216832.4:c.1820C>A	14.37:g.39650733C>A	ENSP00000216832:p.Ser607Tyr	Somatic	213	1		WXS	Illumina GAIIx	Phase_I	212	100	NM_002687	0	0	44	89	45	B4DZX8|O60899|Q53EM7|Q6P5X4|Q7KYL1|Q99738|Q9UHZ9|Q9UQR9	Missense_Mutation	SNP	ENST00000216832.4	37	CCDS9671.1	.	.	.	.	.	.	.	.	.	.	C	13.45	2.239519	0.39598	.	.	ENSG00000100941	ENST00000216832	T	0.52057	0.68	6.01	6.01	0.97437	.	0.315634	0.33272	N	0.005081	T	0.74291	0.3697	M	0.84683	2.71	0.80722	D	1	D	0.71674	0.998	D	0.80764	0.994	T	0.76666	-0.2875	10	0.87932	D	0	-2.824	20.1316	0.98000	0.0:1.0:0.0:0.0	.	607	Q9H307	PININ_HUMAN	Y	607	ENSP00000216832:S607Y	ENSP00000216832:S607Y	S	+	2	0	PNN	38720484	1.000000	0.71417	1.000000	0.80357	0.956000	0.61745	4.615000	0.61190	2.861000	0.98227	0.650000	0.86243	TCC	.		0.507	PNN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276776.2	NM_002687	
DNAAF2	55172	hgsc.bcm.edu	37	14	50100683	50100683	+	Silent	SNP	C	C	G	rs2985686	byFrequency	TCGA-OR-A5LG-01A-11D-A29I-10	TCGA-OR-A5LG-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a39e8bc9-757d-4536-b301-458fc7ec992d	6b9e8d41-7044-4151-b4d6-e211b0e7a923	g.chr14:50100683C>G	ENST00000298292.8	-	1	1265	c.1185G>C	c.(1183-1185)gcG>gcC	p.A395A	DNAAF2_ENST00000406043.3_Silent_p.A395A	NM_018139.2	NP_060609.2	Q9NVR5	KTU_HUMAN	dynein, axonemal, assembly factor 2	395					axonemal dynein complex assembly (GO:0070286)|bacterial-type flagellum-dependent cell motility (GO:0071973)|cilium-dependent cell motility (GO:0060285)|response to retinoic acid (GO:0032526)	cytoplasm (GO:0005737)				kidney(1)|lung(4)	5						CTCCGTCCTCCGCGCGACTCC	0.781													G|||	2800	0.559105	0.6702	0.6715	5008	,	,		11594	0.1736		0.7604	False		,,,				2504	0.5194				p.A395A		.											.	.	0			c.G1185C						.						1.0	1.0	1.0					14																	50100683		917	2082	2999	SO:0001819	synonymous_variant	55172	exon1			GTCCTCCGCGCGA	AK001425	CCDS9691.2, CCDS45100.1	14q21.3	2012-05-03	2011-06-09	2011-06-09	ENSG00000165506	ENSG00000165506			20188	protein-coding gene	gene with protein product	"""kintoun"""	612517	"""chromosome 14 open reading frame 104"""	C14orf104			Standard	NM_001083908		Approved	FLJ10563, KTU, PF13, CILD10	uc001wws.4	Q9NVR5	OTTHUMG00000152331	ENST00000298292.8:c.1185G>C	14.37:g.50100683C>G		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	12	12	NM_018139	0	0	0	0	0	B9WS54|C0JAP7|Q86TR1|Q86TY8|Q969Z5	Silent	SNP	ENST00000298292.8	37	CCDS9691.2																																																																																			C|0.569;G|0.431		0.781	DNAAF2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000276813.1		
SPTB	6710	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	14	65241872	65241872	+	Missense_Mutation	SNP	G	G	T			TCGA-OR-A5LG-01A-11D-A29I-10	TCGA-OR-A5LG-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a39e8bc9-757d-4536-b301-458fc7ec992d	6b9e8d41-7044-4151-b4d6-e211b0e7a923	g.chr14:65241872G>T	ENST00000389721.5	-	22	4845	c.4813C>A	c.(4813-4815)Ctc>Atc	p.L1605I	SPTB_ENST00000389722.3_Missense_Mutation_p.L1605I|SPTB_ENST00000542895.1_Missense_Mutation_p.L1605I|SPTB_ENST00000556626.1_Missense_Mutation_p.L1605I|SPTB_ENST00000389720.3_Missense_Mutation_p.L1605I	NM_000347.5	NP_000338.3	P11277	SPTB1_HUMAN	spectrin, beta, erythrocytic	1605					actin filament capping (GO:0051693)|axon guidance (GO:0007411)|hemopoiesis (GO:0030097)|plasma membrane organization (GO:0007009)|porphyrin-containing compound biosynthetic process (GO:0006779)	actin cytoskeleton (GO:0015629)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|protein complex (GO:0043234)|spectrin (GO:0008091)|spectrin-associated cytoskeleton (GO:0014731)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|ankyrin binding (GO:0030506)|structural constituent of cytoskeleton (GO:0005200)			breast(5)|central_nervous_system(4)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(18)|lung(36)|ovary(8)|pancreas(1)|prostate(4)|skin(10)|urinary_tract(3)	106		all_lung(585;4.15e-09)		all cancers(60;4.33e-34)|OV - Ovarian serous cystadenocarcinoma(108;8.32e-20)|BRCA - Breast invasive adenocarcinoma(234;0.0628)		ATGACGTAGAGCTCCTGCTCG	0.632																																					p.L1605I		.											.	SPTB-100	0			c.C4813A						.						137.0	108.0	118.0					14																	65241872		2203	4300	6503	SO:0001583	missense	6710	exon22			CGTAGAGCTCCTG		CCDS32099.1, CCDS32100.1	14q24.1-q24.2	2013-01-10	2008-07-29			ENSG00000070182		"""Pleckstrin homology (PH) domain containing"""	11274	protein-coding gene	gene with protein product	"""spherocytosis, clinical type I"""	182870				2209094	Standard	NM_001024858		Approved		uc001xhr.3	P11277		ENST00000389721.5:c.4813C>A	14.37:g.65241872G>T	ENSP00000374371:p.Leu1605Ile	Somatic	105	0		WXS	Illumina GAIIx	Phase_I	137	10	NM_000347	0	0	2	2	0	Q15510|Q15519	Missense_Mutation	SNP	ENST00000389721.5	37	CCDS32100.1	.	.	.	.	.	.	.	.	.	.	G	16.53	3.150183	0.57151	.	.	ENSG00000070182	ENST00000389723;ENST00000389722;ENST00000335612;ENST00000553938;ENST00000556626;ENST00000389721;ENST00000542895;ENST00000389720	T;T;T;T;T;T	0.50277	0.75;0.75;0.75;0.75;0.75;0.75	5.13	3.21	0.36854	.	0.132879	0.52532	D	0.000078	T	0.68906	0.3052	M	0.84948	2.725	0.58432	D	0.999992	B;P;B	0.34562	0.094;0.457;0.084	B;P;B	0.57371	0.284;0.819;0.215	T	0.69375	-0.5162	10	0.87932	D	0	.	9.4621	0.38792	0.0845:0.155:0.7604:0.0	.	389;1605;1609	E7EV95;P11277;Q59FP5	.;SPTB1_HUMAN;.	I	1609;1605;389;270;1605;1605;1605;1605	ENSP00000374372:L1605I;ENSP00000451324:L270I;ENSP00000451752:L1605I;ENSP00000374371:L1605I;ENSP00000443882:L1605I;ENSP00000374370:L1605I	ENSP00000334218:L389I	L	-	1	0	SPTB	64311625	1.000000	0.71417	0.990000	0.47175	0.268000	0.26511	5.719000	0.68462	0.583000	0.29574	0.561000	0.74099	CTC	.		0.632	SPTB-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000414080.1		
KIF26A	26153	hgsc.bcm.edu	37	14	104644147	104644147	+	Silent	SNP	C	C	T	rs11621644	byFrequency	TCGA-OR-A5LG-01A-11D-A29I-10	TCGA-OR-A5LG-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a39e8bc9-757d-4536-b301-458fc7ec992d	6b9e8d41-7044-4151-b4d6-e211b0e7a923	g.chr14:104644147C>T	ENST00000423312.2	+	12	5022	c.5022C>T	c.(5020-5022)tcC>tcT	p.S1674S	KIF26A_ENST00000315264.7_Silent_p.S1535S	NM_015656.1	NP_056471.1	Q9ULI4	KI26A_HUMAN	kinesin family member 26A	1674					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|blood coagulation (GO:0007596)|enteric nervous system development (GO:0048484)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|negative regulation of signal transduction (GO:0009968)|regulation of cell growth by extracellular stimulus (GO:0001560)	cytosol (GO:0005829)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|microtubule binding (GO:0008017)|microtubule motor activity (GO:0003777)			autonomic_ganglia(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(8)|pancreas(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(2)	21		all_cancers(154;0.109)|Melanoma(154;0.0525)|all_epithelial(191;0.0767)	Epithelial(46;0.152)	Epithelial(152;0.161)		GCAGCGCCTCCTCCGCCCCTG	0.716													C|||	1581	0.315695	0.1112	0.379	5008	,	,		13472	0.4415		0.3549	False		,,,				2504	0.3773				p.S1674S		.											.	KIF26A-24	0			c.C5022T						.	C		442,3276		34,374,1451	4.0	5.0	5.0		5022	2.6	1.0	14	dbSNP_120	5	2372,5338		411,1550,1894	no	coding-synonymous	KIF26A	NM_015656.1		445,1924,3345	TT,TC,CC		30.7652,11.8881,24.6237		1674/1883	104644147	2814,8614	1859	3855	5714	SO:0001819	synonymous_variant	26153	exon12			CGCCTCCTCCGCC	AB033062	CCDS45171.1	14q32.33	2009-03-19			ENSG00000066735	ENSG00000066735		"""Kinesins"""	20226	protein-coding gene	gene with protein product		613231				10574462, 11416179	Standard	NM_015656		Approved	KIAA1236, DKFZP434N178	uc001yos.4	Q9ULI4	OTTHUMG00000154986	ENST00000423312.2:c.5022C>T	14.37:g.104644147C>T		Somatic	2	0		WXS	Illumina GAIIx	Phase_I	10	6	NM_015656	0	0	0	0	0	Q8TAZ7|Q96GK3|Q9UFL3	Silent	SNP	ENST00000423312.2	37	CCDS45171.1																																																																																			C|0.681;T|0.319		0.716	KIF26A-002	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414356.1		
MYO5A	4644	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	15	52689550	52689550	+	Missense_Mutation	SNP	C	C	A			TCGA-OR-A5LG-01A-11D-A29I-10	TCGA-OR-A5LG-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a39e8bc9-757d-4536-b301-458fc7ec992d	6b9e8d41-7044-4151-b4d6-e211b0e7a923	g.chr15:52689550C>A	ENST00000399231.3	-	10	1410	c.1167G>T	c.(1165-1167)aaG>aaT	p.K389N	MYO5A_ENST00000358212.6_Missense_Mutation_p.K389N|MYO5A_ENST00000356338.6_Missense_Mutation_p.K389N|MYO5A_ENST00000399233.2_Missense_Mutation_p.K389N|MYO5A_ENST00000553916.1_Missense_Mutation_p.K389N	NM_000259.3	NP_000250	Q9Y4I1	MYO5A_HUMAN	myosin VA (heavy chain 12, myoxin)	389	Myosin motor.				actin filament-based movement (GO:0030048)|anagen (GO:0042640)|cellular protein metabolic process (GO:0044267)|cellular response to insulin stimulus (GO:0032869)|endoplasmic reticulum localization (GO:0051643)|exocytosis (GO:0006887)|insulin secretion (GO:0030073)|locomotion involved in locomotory behavior (GO:0031987)|long-chain fatty acid biosynthetic process (GO:0042759)|melanin biosynthetic process (GO:0042438)|melanocyte differentiation (GO:0030318)|melanosome transport (GO:0032402)|membrane organization (GO:0061024)|myelination (GO:0042552)|odontogenesis (GO:0042476)|post-Golgi vesicle-mediated transport (GO:0006892)|protein localization to plasma membrane (GO:0072659)|protein transport (GO:0015031)|regulation of inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity (GO:0031585)|secretory granule localization (GO:0032252)|synapse organization (GO:0050808)|synaptic transmission (GO:0007268)|transport (GO:0006810)|vesicle transport along actin filament (GO:0030050)|vesicle-mediated transport (GO:0016192)|visual perception (GO:0007601)	actomyosin (GO:0042641)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|filopodium tip (GO:0032433)|Golgi apparatus (GO:0005794)|growth cone (GO:0030426)|insulin-responsive compartment (GO:0032593)|intermediate filament (GO:0005882)|melanosome (GO:0042470)|membrane (GO:0016020)|microtubule plus-end (GO:0035371)|myosin complex (GO:0016459)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|photoreceptor outer segment (GO:0001750)|ruffle (GO:0001726)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|microfilament motor activity (GO:0000146)|poly(A) RNA binding (GO:0044822)|Rab GTPase binding (GO:0017137)			breast(4)|central_nervous_system(1)|cervix(2)|endometrium(5)|kidney(7)|large_intestine(12)|lung(19)|ovary(3)|skin(3)|stomach(1)	57				all cancers(107;0.0085)|Colorectal(133;0.077)|READ - Rectum adenocarcinoma(133;0.196)		TGGAGATGGGCTTGATGTATG	0.502																																					p.K389N		.											.	MYO5A-93	0			c.G1167T						.						108.0	101.0	103.0					15																	52689550		2054	4196	6250	SO:0001583	missense	4644	exon10			GATGGGCTTGATG		CCDS42037.1, CCDS45262.1	15q21	2014-09-17	2006-09-29		ENSG00000197535	ENSG00000197535		"""Myosins / Myosin superfamily : Class V"""	7602	protein-coding gene	gene with protein product	"""myosin, heavy polypeptide kinase"", ""myosin heavy chain 12"", ""myoxin"", ""myosin V"""	160777	"""myosin VA (heavy polypeptide 12, myoxin)"""	MYH12		8188282, 8022818	Standard	NM_000259		Approved	MYO5, GS1, MYR12	uc002aby.2	Q9Y4I1	OTTHUMG00000137383	ENST00000399231.3:c.1167G>T	15.37:g.52689550C>A	ENSP00000382177:p.Lys389Asn	Somatic	167	0		WXS	Illumina GAIIx	Phase_I	170	64	NM_000259	0	0	1	1	0	A8MZC5|O60653|Q07902|Q16249|Q9UE30|Q9UE31	Missense_Mutation	SNP	ENST00000399231.3	37	CCDS42037.1	.	.	.	.	.	.	.	.	.	.	C	20.5	3.993267	0.74703	.	.	ENSG00000197535	ENST00000399231;ENST00000399233;ENST00000356338;ENST00000358212;ENST00000546028;ENST00000553916	D;D;D;D;D	0.88509	-2.39;-2.39;-2.39;-2.39;-2.39	5.71	2.43	0.29744	Myosin head, motor domain (2);	0.000000	0.85682	D	0.000000	D	0.96225	0.8769	H	0.98664	4.295	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.995;0.998	D	0.95813	0.8843	10	0.72032	D	0.01	.	11.0576	0.47927	0.0:0.7365:0.0:0.2635	.	389;389	Q9Y4I1;Q9Y4I1-2	MYO5A_HUMAN;.	N	389;389;389;389;19;389	ENSP00000382177:K389N;ENSP00000382179:K389N;ENSP00000348693:K389N;ENSP00000350945:K389N;ENSP00000451109:K389N	ENSP00000348693:K389N	K	-	3	2	MYO5A	50476842	0.799000	0.28903	1.000000	0.80357	0.987000	0.75469	0.000000	0.12993	0.745000	0.32763	0.655000	0.94253	AAG	.		0.502	MYO5A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000268102.1	NM_000259	
LACTB	114294	hgsc.bcm.edu	37	15	63414083	63414083	+	Missense_Mutation	SNP	A	A	C	rs34317102	byFrequency	TCGA-OR-A5LG-01A-11D-A29I-10	TCGA-OR-A5LG-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a39e8bc9-757d-4536-b301-458fc7ec992d	6b9e8d41-7044-4151-b4d6-e211b0e7a923	g.chr15:63414083A>C	ENST00000261893.4	+	1	85	c.13A>C	c.(13-15)Atg>Ctg	p.M5L	LACTB_ENST00000413507.2_Missense_Mutation_p.M5L	NM_032857.3	NP_116246.2	P83111	LACTB_HUMAN	lactamase, beta	5				M -> L (in Ref. 1 and 2). {ECO:0000305}.		cytoplasm (GO:0005737)|mitochondrion (GO:0005739)	hydrolase activity (GO:0016787)			NS(1)|breast(1)|kidney(1)|large_intestine(3)|lung(3)|prostate(1)|skin(1)|stomach(1)	12						GTACCGGCTCATGTCAGCAGT	0.751													C|||	3981	0.794928	0.6725	0.8256	5008	,	,		8367	0.997		0.7316	False		,,,				2504	0.7955				p.M5L	Melanoma(85;443 1381 6215 27308 35583)	.											.	LACTB-90	0			c.A13C						.	C	LEU/MET,LEU/MET	1936,668		733,470,99	4.0	4.0	4.0		13,13	3.1	1.0	15	dbSNP_126	4	4375,1183		1737,901,141	yes	missense,missense	LACTB	NM_032857.3,NM_171846.2	15,15	2470,1371,240	CC,CA,AA		21.2846,25.6528,22.6783	benign,benign	5/548,5/374	63414083	6311,1851	1302	2779	4081	SO:0001583	missense	114294	exon1			CGGCTCATGTCAG	AK027808	CCDS10182.1, CCDS45275.1	15q22.1	2012-11-14	2001-12-12	2001-12-14	ENSG00000103642	ENSG00000103642		"""Mitochondrial ribosomal proteins / large subunits"""	16468	protein-coding gene	gene with protein product		608440	"""mitochondrial ribosomal protein L56"""	MRPL56		11707067	Standard	NM_032857		Approved	FLJ14902	uc002alw.3	P83111	OTTHUMG00000132807	ENST00000261893.4:c.13A>C	15.37:g.63414083A>C	ENSP00000261893:p.Met5Leu	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	4	4	NM_171846	0	0	0	0	0	P83096	Missense_Mutation	SNP	ENST00000261893.4	37	CCDS10182.1	1713	0.7843406593406593	304	0.6178861788617886	287	0.7928176795580111	568	0.993006993006993	554	0.7308707124010554	C	0.674	-0.800779	0.02841	0.743472	0.787154	ENSG00000103642	ENST00000261893;ENST00000413507	T	0.33216	1.42	3.1	3.1	0.35709	.	0.592824	0.14749	N	0.300689	T	0.00012	0.0000	N	0.02539	-0.55	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.37842	-0.9688	9	0.02654	T	1	0.0321	7.626	0.28212	0.2541:0.7459:0.0:0.0	rs34317102	5	P83111	LACTB_HUMAN	L	5	ENSP00000261893:M5L	ENSP00000261893:M5L	M	+	1	0	LACTB	61201136	0.994000	0.37717	0.956000	0.39512	0.117000	0.20001	0.346000	0.19997	0.640000	0.30582	-0.677000	0.03784	ATG	A|0.226;C|0.774		0.751	LACTB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256224.1	NM_032857	
ARID3B	10620	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	15	74865529	74865529	+	Silent	SNP	C	C	T			TCGA-OR-A5LG-01A-11D-A29I-10	TCGA-OR-A5LG-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a39e8bc9-757d-4536-b301-458fc7ec992d	6b9e8d41-7044-4151-b4d6-e211b0e7a923	g.chr15:74865529C>T	ENST00000346246.5	+	4	912	c.681C>T	c.(679-681)gtC>gtT	p.V227V		NM_006465.2	NP_006456.1	Q8IVW6	ARI3B_HUMAN	AT rich interactive domain 3B (BRIGHT-like)	227	ARID. {ECO:0000255|PROSITE- ProRule:PRU00355}.|Interaction with RB1.					nucleus (GO:0005634)	DNA binding (GO:0003677)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001205)			NS(1)|breast(1)|endometrium(1)|large_intestine(2)|lung(7)|prostate(2)	14						ACCTCTTCGTCTTTATGCAGA	0.458																																					p.V227V		.											.	ARID3B-90	0			c.C681T						.						168.0	164.0	165.0					15																	74865529		2197	4296	6493	SO:0001819	synonymous_variant	10620	exon4			CTTCGTCTTTATG		CCDS10264.1	15q24	2013-02-07	2006-11-08		ENSG00000179361	ENSG00000179361		"""-"""	14350	protein-coding gene	gene with protein product		612457	"""AT rich interactive domain 3B (BRIGHT- like)"""				Standard	NM_006465		Approved	BDP, DRIL2	uc002ayd.3	Q8IVW6	OTTHUMG00000141321	ENST00000346246.5:c.681C>T	15.37:g.74865529C>T		Somatic	101	0		WXS	Illumina GAIIx	Phase_I	97	43	NM_006465	0	0	1	1	0	O95443|Q59HC9|Q6P9C9	Silent	SNP	ENST00000346246.5	37	CCDS10264.1																																																																																			.		0.458	ARID3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000280688.2	NM_006465	
MESP2	145873	hgsc.bcm.edu	37	15	90320135	90320146	+	In_Frame_Del	DEL	GGGCAGGGGCAG	GGGCAGGGGCAG	-	rs56192595|rs28546919|rs200021459|rs199821487	byFrequency	TCGA-OR-A5LG-01A-11D-A29I-10	TCGA-OR-A5LG-10A-01D-A29L-10	GGGCAGGGGCAG	GGGCAGGGGCAG	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a39e8bc9-757d-4536-b301-458fc7ec992d	6b9e8d41-7044-4151-b4d6-e211b0e7a923	g.chr15:90320135_90320146delGGGCAGGGGCAG	ENST00000341735.3	+	1	547_558	c.547_558delGGGCAGGGGCAG	c.(547-558)gggcaggggcagdel	p.GQGQ199del	MESP2_ENST00000558723.1_Intron|MESP2_ENST00000560219.1_Intron	NM_001039958.1	NP_001035047.1	Q0VG99	MESP2_HUMAN	mesoderm posterior basic helix-loop-helix transcription factor 2	199	13 X 2 AA tandem repeats of G-Q.				mesodermal cell migration (GO:0008078)|Notch signaling pathway (GO:0007219)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|signal transduction involved in regulation of gene expression (GO:0023019)|somite rostral/caudal axis specification (GO:0032525)|transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.Q198_G205delQGQGQGQG(1)		kidney(1)|large_intestine(2)|lung(1)|skin(1)|upper_aerodigestive_tract(1)	6	Lung NSC(78;0.0221)|all_lung(78;0.0448)		BRCA - Breast invasive adenocarcinoma(143;0.0146)|KIRC - Kidney renal clear cell carcinoma(17;0.0286)|Kidney(142;0.0514)			gcaggggcaagggcaggggcaggggcaggggc	0.783																																					p.183_186del		.											.	MESP2-68	1	Deletion - In frame(1)	upper_aerodigestive_tract(1)	c.547_558del						.																																			SO:0001651	inframe_deletion	145873	exon1			GGGCAAGGGCAGG		CCDS42078.1	15q26.1	2014-06-30	2014-06-30			ENSG00000188095		"""Basic helix-loop-helix proteins"""	29659	protein-coding gene	gene with protein product		605195	"""mesoderm posterior 2 homolog (mouse)"""			11578861	Standard	NM_001039958		Approved	SCDO2, bHLHc6	uc002bon.3	Q0VG99		ENST00000341735.3:c.547_558delGGGCAGGGGCAG	15.37:g.90320135_90320146delGGGCAGGGGCAG	ENSP00000342392:p.Gly199_Gln202del	Somatic	1	0		WXS	Illumina GAIIx	Phase_I	11	10	NM_001039958	0	0	0	0	0	Q7RTU2	In_Frame_Del	DEL	ENST00000341735.3	37	CCDS42078.1																																																																																			.		0.783	MESP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000416421.1	XM_085261	
GGA2	23062	hgsc.bcm.edu	37	16	23521643	23521643	+	Splice_Site	SNP	G	G	C	rs17844840|rs1071685	byFrequency	TCGA-OR-A5LG-01A-11D-A29I-10	TCGA-OR-A5LG-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a39e8bc9-757d-4536-b301-458fc7ec992d	6b9e8d41-7044-4151-b4d6-e211b0e7a923	g.chr16:23521643G>C	ENST00000309859.4	-	1	172	c.90C>G	c.(88-90)ctC>ctG	p.L30L	GGA2_ENST00000567468.1_Splice_Site_p.L30L	NM_015044.4	NP_055859.1	Q9UJY4	GGA2_HUMAN	golgi-associated, gamma adaptin ear containing, ARF binding protein 2	30					intracellular protein transport (GO:0006886)|vesicle-mediated transport (GO:0016192)	clathrin adaptor complex (GO:0030131)|clathrin-coated vesicle (GO:0030136)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|trans-Golgi network (GO:0005802)	ADP-ribosylation factor binding (GO:0030306)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(9)|lung(4)|ovary(1)	21				GBM - Glioblastoma multiforme(48;0.0386)		GCTACTCACTGAGCCACAGCT	0.781													G|||	3460	0.690895	0.5756	0.7291	5008	,	,		7234	0.6964		0.8131	False		,,,				2504	0.6881				p.L30L		.											.	GGA2-91	0			c.C90G						.						1.0	1.0	1.0					16																	23521643		725	1470	2195	SO:0001630	splice_region_variant	23062	exon1			CTCACTGAGCCAC	AF190863	CCDS10611.1	16p12	2010-02-12	2010-02-12		ENSG00000103365	ENSG00000103365			16064	protein-coding gene	gene with protein product		606005				10747088, 10749927	Standard	NM_015044		Approved	VEAR, KIAA1080	uc002dlq.3	Q9UJY4	OTTHUMG00000096957	ENST00000309859.4:c.91+1C>G	16.37:g.23521643G>C		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	5	5	NM_015044	0	0	0	0	0	D3DWF0|O14564|Q9NYN2|Q9UPS2	Silent	SNP	ENST00000309859.4	37	CCDS10611.1																																																																																			G|0.500;C|0.500		0.781	GGA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214019.1		Silent
IRX3	79191	hgsc.bcm.edu	37	16	54318528	54318528	+	Missense_Mutation	SNP	A	A	G	rs1450355	byFrequency	TCGA-OR-A5LG-01A-11D-A29I-10	TCGA-OR-A5LG-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a39e8bc9-757d-4536-b301-458fc7ec992d	6b9e8d41-7044-4151-b4d6-e211b0e7a923	g.chr16:54318528A>G	ENST00000329734.3	-	2	1977	c.1265T>C	c.(1264-1266)cTg>cCg	p.L422P		NM_024336.2	NP_077312.2	P78415	IRX3_HUMAN	iroquois homeobox 3	422	Pro-rich.		L -> P (in dbSNP:rs1450355). {ECO:0000269|PubMed:15489334}.		mesoderm development (GO:0007498)|metanephros development (GO:0001656)|negative regulation of neuron differentiation (GO:0045665)|positive regulation of neuron differentiation (GO:0045666)|regulation of transcription, DNA-templated (GO:0006355)|specification of loop of Henle identity (GO:0072086)|transcription, DNA-templated (GO:0006351)	axon (GO:0030424)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)			endometrium(2)|kidney(1)|large_intestine(5)|lung(3)|ovary(1)|soft_tissue(1)|urinary_tract(1)	14						GAGCGGGTGCAGGCGGGGGCC	0.776													g|||	4851	0.96865	0.888	0.987	5008	,	,		8017	1.0		1.0	False		,,,				2504	1.0				p.L422P	GBM(143;1830 1866 4487 4646 37383)	.											.	IRX3-90	0			c.T1265C						.	T	PRO/LEU	1678,102		788,102,0	1.0	2.0	2.0		1265	2.5	1.0	16	dbSNP_88	2	4195,3		2096,3,0	no	missense	IRX3	NM_024336.2	98	2884,105,0	GG,GA,AA		0.0715,5.7303,1.7564	benign	422/502	54318528	5873,105	890	2099	2989	SO:0001583	missense	79191	exon2			GGGTGCAGGCGGG	U90308	CCDS10750.1	16q12.2	2011-06-20	2007-07-13		ENSG00000177508	ENSG00000177508		"""Homeoboxes / TALE class"""	14360	protein-coding gene	gene with protein product		612985					Standard	NM_024336		Approved	IRX-1	uc002eht.1	P78415	OTTHUMG00000133200	ENST00000329734.3:c.1265T>C	16.37:g.54318528A>G	ENSP00000331608:p.Leu422Pro	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	10	10	NM_024336	0	0	0	0	0	Q7Z4A4|Q7Z4A5|Q8IVC6	Missense_Mutation	SNP	ENST00000329734.3	37	CCDS10750.1	2108	0.9652014652014652	433	0.8800813008130082	354	0.9779005524861878	567	0.9912587412587412	754	0.9947229551451188	g	5.642	0.303067	0.10678	0.942697	0.999285	ENSG00000177508	ENST00000329734	T	0.54279	0.58	4.4	2.45	0.29901	.	0.652897	0.14990	N	0.286760	T	0.00012	0.0000	N	0.01352	-0.895	0.29914	P	0.82336	B	0.02656	0.0	B	0.01281	0.0	T	0.21861	-1.0233	9	0.33940	T	0.23	-4.0049	5.143	0.14969	0.1733:0.0:0.6627:0.164	rs1450355;rs17852160;rs60836119	422	P78415	IRX3_HUMAN	P	422	ENSP00000331608:L422P	ENSP00000331608:L422P	L	-	2	0	IRX3	52876029	1.000000	0.71417	0.984000	0.44739	0.000000	0.00434	1.455000	0.35190	0.155000	0.19261	-1.528000	0.00924	CTG	T|0.035;G|0.004		0.776	IRX3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256910.2		
CCDC102A	92922	hgsc.bcm.edu	37	16	57562804	57562804	+	Missense_Mutation	SNP	G	G	A	rs12935069		TCGA-OR-A5LG-01A-11D-A29I-10	TCGA-OR-A5LG-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a39e8bc9-757d-4536-b301-458fc7ec992d	6b9e8d41-7044-4151-b4d6-e211b0e7a923	g.chr16:57562804G>A	ENST00000258214.2	-	2	532	c.286C>T	c.(286-288)Cgg>Tgg	p.R96W		NM_033212.3	NP_149989.2	Q96A19	C102A_HUMAN	coiled-coil domain containing 102A	96				R -> W (in Ref. 2; AAH08285/AAH09941). {ECO:0000305}.						endometrium(1)|large_intestine(1)|lung(4)|ovary(1)|prostate(1)	8						TCCGACCACCGGCGCATGGTC	0.731													A|||	5008	1.0	1.0	1.0	5008	,	,		3757	1.0		1.0	False		,,,				2504	1.0				p.R96W		.											.	CCDC102A-91	0			c.C286T						.						8.0	10.0	9.0					16																	57562804		1834	3717	5551	SO:0001583	missense	92922	exon2			ACCACCGGCGCAT	BC008285	CCDS10784.1	16q13	2008-02-05			ENSG00000135736	ENSG00000135736			28097	protein-coding gene	gene with protein product						12477932	Standard	NM_033212		Approved	MGC10992	uc002elw.3	Q96A19	OTTHUMG00000133472	ENST00000258214.2:c.286C>T	16.37:g.57562804G>A	ENSP00000258214:p.Arg96Trp	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	8	8	NM_033212	0	0	0	0	0	Q9BT74	Missense_Mutation	SNP	ENST00000258214.2	37	CCDS10784.1	2180	0.9981684981684982	492	1.0	360	0.994475138121547	570	0.9965034965034965	758	1.0	A	10.17	1.277909	0.23307	.	.	ENSG00000135736	ENST00000258214	T	0.37752	1.18	4.82	4.82	0.62117	.	0.000000	0.64402	N	0.000001	T	0.00012	0.0000	N	0.00049	-2.415	0.40217	P	0.022302999999999962	B	0.02656	0.0	B	0.01281	0.0	T	0.44787	-0.9305	9	0.33141	T	0.24	-23.2491	9.5348	0.39216	0.9152:0.0:0.0848:0.0	rs12935069;rs12935069	96	Q96A19	C102A_HUMAN	W	96	ENSP00000258214:R96W	ENSP00000258214:R96W	R	-	1	2	CCDC102A	56120305	1.000000	0.71417	1.000000	0.80357	0.971000	0.66376	6.801000	0.75170	0.698000	0.31739	-0.556000	0.04195	CGG	G|0.001;A|0.999		0.731	CCDC102A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257348.1	NM_033212	
HYDIN	54768	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	16	71012910	71012910	+	Silent	SNP	G	G	T			TCGA-OR-A5LG-01A-11D-A29I-10	TCGA-OR-A5LG-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a39e8bc9-757d-4536-b301-458fc7ec992d	6b9e8d41-7044-4151-b4d6-e211b0e7a923	g.chr16:71012910G>T	ENST00000393567.2	-	30	4695	c.4545C>A	c.(4543-4545)gcC>gcA	p.A1515A		NM_001270974.1	NP_001257903.1	Q4G0P3	HYDIN_HUMAN	HYDIN, axonemal central pair apparatus protein	1515					cilium assembly (GO:0042384)|cilium movement (GO:0003341)|epithelial cell development (GO:0002064)|trachea development (GO:0060438)|ventricular system development (GO:0021591)	cell projection (GO:0042995)				breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(17)|lung(12)|ovary(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)	43		Ovarian(137;0.0654)				TGTTTTTCCTGGCTTGATTCA	0.423																																					p.A1515A		.											.	HYDIN-92	0			c.C4545A						.						67.0	64.0	65.0					16																	71012910		1848	4073	5921	SO:0001819	synonymous_variant	54768	exon30			TTTCCTGGCTTGA	AK074472	CCDS10897.1, CCDS56004.1, CCDS56005.1, CCDS59269.1	16q22.2	2014-02-05	2012-01-06		ENSG00000157423	ENSG00000157423		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	19368	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 31"""	610812	"""hydrocephalus inducing"", ""hydrocephalus inducing homolog (mouse)"""			12719380, 23022101	Standard	NM_001198542		Approved	DKFZp434D0513, KIAA1864, PPP1R31, CILD5	uc031qwy.1	Q4G0P3	OTTHUMG00000137584	ENST00000393567.2:c.4545C>A	16.37:g.71012910G>T		Somatic	122	0		WXS	Illumina GAIIx	Phase_I	214	36	NM_001270974	0	0	0	0	0	A6NC70|A6NLZ0|B4DQY4|B4DRN4|F5H6V3|Q8N3H8|Q8N3P6|Q8TC08|Q96JG3|Q96SS4|Q9H5U3|Q9H9B8|Q9NTI0|Q9UBE5	Silent	SNP	ENST00000393567.2	37	CCDS59269.1																																																																																			.		0.423	HYDIN-001	PUTATIVE	not_organism_supported|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000398624.3		
MARVELD3	91862	broad.mit.edu	37	16	71660364	71660365	+	Frame_Shift_Del	DEL	GA	GA	-			TCGA-OR-A5LG-01A-11D-A29I-10	TCGA-OR-A5LG-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a39e8bc9-757d-4536-b301-458fc7ec992d	6b9e8d41-7044-4151-b4d6-e211b0e7a923	g.chr16:71660364_71660365delGA	ENST00000268485.3	+	1	276_277	c.232_233delGA	c.(232-234)gagfs	p.E78fs	MARVELD3_ENST00000567501.1_5'Flank|RP11-432I5.2_ENST00000562763.1_RNA|MARVELD3_ENST00000565261.1_Frame_Shift_Del_p.E78fs|MARVELD3_ENST00000299952.4_Frame_Shift_Del_p.E78fs|MARVELD3_ENST00000567566.1_Frame_Shift_Del_p.E78fs	NM_052858.4	NP_443090.4	Q96A59	MALD3_HUMAN	MARVEL domain containing 3	78	Arg-rich.				cell-cell junction organization (GO:0045216)|tight junction assembly (GO:0070830)	cytoplasmic vesicle (GO:0031410)|integral component of membrane (GO:0016021)|tight junction (GO:0005923)				NS(1)|endometrium(3)|large_intestine(5)|lung(6)|skin(2)	17		Ovarian(137;0.125)				CCgggagagggagagagagagg	0.703																																					p.78_78del		.											.	MARVELD3-91	0			c.232_233del						.																																			SO:0001589	frameshift_variant	91862	exon1			GAGAGGGAGAGAG	BC013376	CCDS10904.1, CCDS32478.1, CCDS59270.1	16q22.2	2008-02-05	2004-07-12	2004-07-14	ENSG00000140832	ENSG00000140832			30525	protein-coding gene	gene with protein product		614094	"""MARVEL (membrane-associating) domain containing 3"""	MRVLDC3			Standard	NM_001017967		Approved		uc002fat.4	Q96A59	OTTHUMG00000137591	ENST00000268485.3:c.232_233delGA	16.37:g.71660372_71660373delGA	ENSP00000268485:p.Glu78fs	Somatic	101	0		WXS	Illumina GAIIx	Phase_I	413	7	NM_001017967	0	0	0	0	0	A8K820|H3BQM5|Q96MJ4	Frame_Shift_Del	DEL	ENST00000268485.3	37	CCDS10904.1																																																																																			.		0.703	MARVELD3-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000268991.2	NM_052858	
ZFPM1	161882	hgsc.bcm.edu	37	16	88599697	88599705	+	In_Frame_Del	DEL	AGCCTCTGG	AGCCTCTGG	-	rs67873604|rs149145771|rs368520732|rs67322929|rs201915453|rs67712719	byFrequency	TCGA-OR-A5LG-01A-11D-A29I-10	TCGA-OR-A5LG-10A-01D-A29L-10	AGCCTCTGG	AGCCTCTGG	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a39e8bc9-757d-4536-b301-458fc7ec992d	6b9e8d41-7044-4151-b4d6-e211b0e7a923	g.chr16:88599697_88599705delAGCCTCTGG	ENST00000319555.3	+	10	1653_1661	c.1331_1339delAGCCTCTGG	c.(1330-1341)gagcctctggcc>gcc	p.EPL444del	RP11-21B21.4_ENST00000563243.1_RNA	NM_153813.2	NP_722520.2	Q8IX07	FOG1_HUMAN	zinc finger protein, FOG family member 1	444				EPLA -> AP (in Ref. 1; AAN45858). {ECO:0000305}.	atrial septum morphogenesis (GO:0060413)|atrioventricular valve morphogenesis (GO:0003181)|blood coagulation (GO:0007596)|cardiac muscle tissue morphogenesis (GO:0055008)|definitive erythrocyte differentiation (GO:0060318)|embryonic hemopoiesis (GO:0035162)|erythrocyte differentiation (GO:0030218)|granulocyte differentiation (GO:0030851)|megakaryocyte development (GO:0035855)|megakaryocyte differentiation (GO:0030219)|mitral valve formation (GO:0003192)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of interleukin-4 biosynthetic process (GO:0045403)|negative regulation of mast cell differentiation (GO:0060377)|negative regulation of protein binding (GO:0032091)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|outflow tract morphogenesis (GO:0003151)|platelet formation (GO:0030220)|positive regulation of interferon-gamma biosynthetic process (GO:0045078)|primitive erythrocyte differentiation (GO:0060319)|regulation of chemokine production (GO:0032642)|regulation of definitive erythrocyte differentiation (GO:0010724)|T-helper cell lineage commitment (GO:0002295)|transcriptional activation by promoter-enhancer looping (GO:0071733)|tricuspid valve formation (GO:0003195)|ventricular septum morphogenesis (GO:0060412)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|transcription factor complex (GO:0005667)|transcriptional repressor complex (GO:0017053)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II transcription factor binding (GO:0001085)|transcription factor binding (GO:0008134)			central_nervous_system(1)|ovary(2)|urinary_tract(1)	4				BRCA - Breast invasive adenocarcinoma(80;0.0478)		GCCAGAGCGGAGCCTCTGGCCCAGAATGG	0.746																																					p.444_447del	Pancreas(49;850 1106 29641 32847 38344)	.											.	ZFPM1-90	0			c.1331_1339del						.																																			SO:0001651	inframe_deletion	161882	exon10			GAGCGGAGCCTCT	AF488691	CCDS32502.1	16q24.2	2013-01-10	2012-11-27		ENSG00000179588	ENSG00000179588		"""Zinc fingers, C2H2-type"", ""Zinc fingers, C2HC-type containing"""	19762	protein-coding gene	gene with protein product		601950	"""zinc finger protein, multitype 1"""				Standard	NM_153813		Approved	FOG1, FOG, ZNF89A, ZC2HC11A	uc002fkv.3	Q8IX07	OTTHUMG00000173152	ENST00000319555.3:c.1331_1339delAGCCTCTGG	16.37:g.88599697_88599705delAGCCTCTGG	ENSP00000326630:p.Glu444_Leu446del	Somatic	3	0		WXS	Illumina GAIIx	Phase_I	15	0	NM_153813	0	0	0	0	0		In_Frame_Del	DEL	ENST00000319555.3	37	CCDS32502.1																																																																																			.		0.746	ZFPM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000422270.2		
RPL13	6137	hgsc.bcm.edu	37	16	89627671	89627671	+	Silent	SNP	C	C	T	rs174035	byFrequency	TCGA-OR-A5LG-01A-11D-A29I-10	TCGA-OR-A5LG-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a39e8bc9-757d-4536-b301-458fc7ec992d	6b9e8d41-7044-4151-b4d6-e211b0e7a923	g.chr16:89627671C>T	ENST00000393099.3	+	2	390	c.141C>T	c.(139-141)gcC>gcT	p.A47A	RPL13_ENST00000311528.5_Silent_p.A47A|RPL13_ENST00000452368.3_Silent_p.A47A|SNORD68_ENST00000363214.1_RNA|RPL13_ENST00000567815.1_Silent_p.A47A	NM_033251.2	NP_150254.1	P26373	RL13_HUMAN	ribosomal protein L13	47					cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|RNA metabolic process (GO:0016070)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)|translational elongation (GO:0006414)|translational initiation (GO:0006413)|translational termination (GO:0006415)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral transcription (GO:0019083)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|cytosolic large ribosomal subunit (GO:0022625)|cytosolic ribosome (GO:0022626)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|structural constituent of ribosome (GO:0003735)			lung(3)|skin(1)|upper_aerodigestive_tract(2)	6		all_hematologic(23;0.0748)		all cancers(4;1.15e-07)|OV - Ovarian serous cystadenocarcinoma(4;7.8e-06)|BRCA - Breast invasive adenocarcinoma(80;0.0139)		GCCGCATCGCCCCGCGCCCCG	0.741													C|||	720	0.14377	0.1256	0.1282	5008	,	,		12083	0.13		0.1839	False		,,,				2504	0.1524				p.A47A		.											.	RPL13-90	0			c.C141T						.	C	,	382,2954		24,334,1310	3.0	4.0	3.0		141,141	0.9	1.0	16	dbSNP_79	3	1125,5851		71,983,2434	no	coding-synonymous,coding-synonymous	RPL13	NM_000977.3,NM_033251.2	,	95,1317,3744	TT,TC,CC		16.1267,11.4508,14.614	,	47/212,47/212	89627671	1507,8805	1668	3488	5156	SO:0001819	synonymous_variant	6137	exon3			CATCGCCCCGCGC	AB007172	CCDS10979.1, CCDS58492.1	16q24.3	2011-04-06			ENSG00000167526	ENSG00000167526		"""L ribosomal proteins"""	10303	protein-coding gene	gene with protein product		113703				9582194	Standard	NM_000977		Approved	D16S444E, BBC1, L13	uc002fnm.2	P26373	OTTHUMG00000133770	ENST00000393099.3:c.141C>T	16.37:g.89627671C>T		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	13	13	NM_001243131	0	0	17	312	295	B4DLX3|F5H1S2|Q3KQT8|Q567Q8|Q9BPX0	Silent	SNP	ENST00000393099.3	37	CCDS10979.1																																																																																			C|0.846;T|0.154		0.741	RPL13-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000258294.2	NM_000977	
GLTPD2	388323	hgsc.bcm.edu	37	17	4693342	4693342	+	Missense_Mutation	SNP	C	C	A	rs35910358	byFrequency	TCGA-OR-A5LG-01A-11D-A29I-10	TCGA-OR-A5LG-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a39e8bc9-757d-4536-b301-458fc7ec992d	6b9e8d41-7044-4151-b4d6-e211b0e7a923	g.chr17:4693342C>A	ENST00000331264.7	+	4	680	c.627C>A	c.(625-627)gaC>gaA	p.D209E		NM_001014985.2	NP_001014985	A6NH11	GLTD2_HUMAN	glycolipid transfer protein domain containing 2	209				D -> E (in Ref. 2; AAI50537). {ECO:0000305}.		cytoplasm (GO:0005737)	glycolipid binding (GO:0051861)|glycolipid transporter activity (GO:0017089)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(1)	4						GAGGCCCGGACGCGGGCGTGC	0.761													C|||	4904	0.979233	0.9228	1.0	5008	,	,		11019	1.0		0.998	False		,,,				2504	1.0				p.D209E		.											.	GLTPD2-68	0			c.C627A						.	C	GLU/ASP	2706,78		1314,78,0	2.0	2.0	2.0		627	0.2	0.1	17	dbSNP_126	2	6028,0		3014,0,0	no	missense	GLTPD2	NM_001014985.2	45	4328,78,0	AA,AC,CC		0.0,2.8017,0.8852	benign	209/292	4693342	8734,78	1392	3014	4406	SO:0001583	missense	388323	exon4			CCCGGACGCGGGC	BC029290	CCDS32534.1	17p13.2	2007-12-19				ENSG00000182327			33756	protein-coding gene	gene with protein product							Standard	NM_001014985		Approved		uc002fza.2	A6NH11		ENST00000331264.7:c.627C>A	17.37:g.4693342C>A	ENSP00000328070:p.Asp209Glu	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	21	21	NM_001014985	0	0	0	0	0	A7E2T2	Missense_Mutation	SNP	ENST00000331264.7	37	CCDS32534.1	2151	0.9848901098901099	466	0.9471544715447154	362	1.0	572	1.0	751	0.9907651715039578	C	9.155	1.017148	0.19355	0.971983	1.0	ENSG00000182327	ENST00000331264	.	.	.	4.58	0.162	0.14981	Glycolipid transfer protein domain (3);	.	.	.	.	T	0.00012	0.0000	L	0.41027	1.25	0.80722	P	0.0	B	0.22080	0.064	B	0.31614	0.133	T	0.34650	-0.9820	7	0.12103	T	0.63	-20.1635	5.889	0.18897	0.0:0.5269:0.298:0.1751	rs35910358	209	A6NH11	GLTD2_HUMAN	E	209	.	ENSP00000328070:D209E	D	+	3	2	GLTPD2	4640082	0.004000	0.15560	0.082000	0.20525	0.081000	0.17604	0.011000	0.13264	-0.068000	0.12953	0.555000	0.69702	GAC	C|0.015;A|0.985		0.761	GLTPD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000439781.1	NM_001014985	
MYO15A	51168	hgsc.bcm.edu	37	17	18024266	18024266	+	Missense_Mutation	SNP	T	T	G	rs2955367	byFrequency	TCGA-OR-A5LG-01A-11D-A29I-10	TCGA-OR-A5LG-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a39e8bc9-757d-4536-b301-458fc7ec992d	6b9e8d41-7044-4151-b4d6-e211b0e7a923	g.chr17:18024266T>G	ENST00000205890.5	+	2	2490	c.2152T>G	c.(2152-2154)Tgg>Ggg	p.W718G		NM_016239.3	NP_057323.3	Q9UKN7	MYO15_HUMAN	myosin XVA	718				W -> G (in Ref. 2; AAF05903/AF051976). {ECO:0000305}.	inner ear morphogenesis (GO:0042472)|locomotory behavior (GO:0007626)|sensory perception of sound (GO:0007605)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|myosin complex (GO:0016459)|stereocilium (GO:0032420)	ATP binding (GO:0005524)|motor activity (GO:0003774)			breast(5)|central_nervous_system(2)|endometrium(17)|kidney(3)|large_intestine(16)|lung(27)|ovary(3)|pancreas(1)|prostate(6)|skin(13)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	99	all_neural(463;0.228)					GCAGGCCAGCTGGTGGGCCTT	0.796													t|||	2484	0.496006	0.2995	0.451	5008	,	,		3987	0.6567		0.3668	False		,,,				2504	0.7607				p.W718G		.											.	MYO15A-97	0			c.T2152G						.						1.0	1.0	1.0					17																	18024266		862	2132	2994	SO:0001583	missense	51168	exon2			GCCAGCTGGTGGG	AF144094	CCDS42271.1	17p11.2	2011-09-27			ENSG00000091536	ENSG00000091536		"""Myosins / Myosin superfamily : Class XV"""	7594	protein-coding gene	gene with protein product		602666		DFNB3, MYO15		9603736	Standard	NM_016239		Approved		uc021trl.1	Q9UKN7	OTTHUMG00000059390	ENST00000205890.5:c.2152T>G	17.37:g.18024266T>G	ENSP00000205890:p.Trp718Gly	Somatic	2	0		WXS	Illumina GAIIx	Phase_I	9	6	NM_016239	0	0	0	0	0	B4DFC7	Missense_Mutation	SNP	ENST00000205890.5	37	CCDS42271.1	961	0.440018315018315	165	0.3353658536585366	150	0.4143646408839779	374	0.6538461538461539	272	0.35883905013192613	t	8.609	0.888709	0.17540	.	.	ENSG00000091536	ENST00000205890	D	0.88509	-2.39	4.17	3.0	0.34707	.	.	.	.	.	T	0.00012	0.0000	L	0.27053	0.805	0.09310	P	0.99999999915476	P	0.43477	0.808	B	0.33295	0.161	T	0.49808	-0.8900	8	0.36615	T	0.2	.	3.0044	0.06024	0.2142:0.1168:0.0:0.6689	rs2955367	718	Q9UKN7	MYO15_HUMAN	G	718	ENSP00000205890:W718G	ENSP00000205890:W718G	W	+	1	0	MYO15A	17964991	0.538000	0.26394	0.967000	0.41034	0.089000	0.18198	0.549000	0.23329	1.516000	0.48900	0.247000	0.18012	TGG	T|0.570;G|0.430		0.796	MYO15A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000132048.1	NM_016239	
C17orf96	100170841	hgsc.bcm.edu	37	17	36830459	36830459	+	Missense_Mutation	SNP	G	G	A	rs111565436	byFrequency	TCGA-OR-A5LG-01A-11D-A29I-10	TCGA-OR-A5LG-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a39e8bc9-757d-4536-b301-458fc7ec992d	6b9e8d41-7044-4151-b4d6-e211b0e7a923	g.chr17:36830459G>A	ENST00000325814.5	-	1	728	c.290C>T	c.(289-291)cCc>cTc	p.P97L		NM_001130677.1	NP_001124149.1	A6NHQ4	CQ096_HUMAN	chromosome 17 open reading frame 96	97	Pro-rich.				neuron fate commitment (GO:0048663)												AGGAACGCCGGGCCGCCCGGT	0.776													G|||	1323	0.264177	0.5272	0.1671	5008	,	,		10122	0.0942		0.1789	False		,,,				2504	0.2403				p.P97L		.											.	.	0			c.C290T						.						2.0	3.0	3.0					17																	36830459		485	1247	1732	SO:0001583	missense	100170841	exon1			ACGCCGGGCCGCC		CCDS45661.1	17q12	2014-04-17			ENSG00000179294	ENSG00000273604			34493	protein-coding gene	gene with protein product	"""proline rich 28"""					24550272	Standard	NM_001130677		Approved	LOC100170841, PRR28	uc010wdq.2	A6NHQ4	OTTHUMG00000188495	ENST00000325814.5:c.290C>T	17.37:g.36830459G>A	ENSP00000317905:p.Pro97Leu	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	5	5	NM_001130677	0	0	0	0	0		Missense_Mutation	SNP	ENST00000325814.5	37	CCDS45661.1	546	0.25	273	0.5548780487804879	71	0.19613259668508287	65	0.11363636363636363	137	0.18073878627968337	G	12.55	1.970645	0.34754	.	.	ENSG00000179294	ENST00000325814	.	.	.	3.57	1.42	0.22433	.	.	.	.	.	T	0.00012	0.0000	N	0.14661	0.345	0.80722	P	0.0	B	0.24426	0.103	B	0.25405	0.06	T	0.43782	-0.9370	7	0.87932	D	0	.	6.42	0.21738	0.0:0.2024:0.589:0.2087	.	97	A6NHQ4	CQ096_HUMAN	L	97	.	ENSP00000317905:P97L	P	-	2	0	C17orf96	34083985	0.001000	0.12720	0.308000	0.25141	0.049000	0.14656	0.571000	0.23669	0.121000	0.18284	0.313000	0.20887	CCC	G|0.750;A|0.250		0.776	C17orf96-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255465.2	NM_001130677	
CDK5RAP3	80279	ucsc.edu;bcgsc.ca	37	17	46053334	46053334	+	Silent	SNP	A	A	G	rs202125432	byFrequency	TCGA-OR-A5LG-01A-11D-A29I-10	TCGA-OR-A5LG-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a39e8bc9-757d-4536-b301-458fc7ec992d	6b9e8d41-7044-4151-b4d6-e211b0e7a923	g.chr17:46053334A>G	ENST00000338399.4	+	8	859	c.753A>G	c.(751-753)gaA>gaG	p.E251E	RP11-6N17.9_ENST00000582262.1_RNA|CDK5RAP3_ENST00000536708.2_Silent_p.E276E	NM_176096.1	NP_788276.1	Q96JB5	CK5P3_HUMAN	CDK5 regulatory subunit associated protein 3	251					brain development (GO:0007420)|protein ufmylation (GO:0071569)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|regulation of neuron differentiation (GO:0045664)	membrane (GO:0016020)	protein kinase binding (GO:0019901)	p.E251E(1)		NS(1)|central_nervous_system(2)|cervix(3)|endometrium(3)|large_intestine(2)|lung(5)|prostate(1)|skin(1)	18						CTGTGGTGGAACGACCCCACC	0.602																																					p.E251E		.											.	CDK5RAP3-226	1	Substitution - coding silent(1)	prostate(1)	c.A753G						.																																			SO:0001819	synonymous_variant	80279	exon8			GGTGGAACGACCC	AF110322	CCDS42356.1, CCDS62232.1	17q21.2	2008-07-18				ENSG00000108465			18673	protein-coding gene	gene with protein product	"""ischemic heart CDK5 activator-binding protein C53"", ""LXXLL/leucine-zipper-containing ARFbinding protein"""	608202				10721722	Standard	NM_176096		Approved	MST016, FLJ13660, C53, IC53, HSF-27, OK/SW-cl.114, LZAP	uc010wlc.3	Q96JB5		ENST00000338399.4:c.753A>G	17.37:g.46053334A>G		Somatic	100	0		WXS	Illumina GAIIx	Phase_I	69	12	NM_176096	0	0	45	45	0	B7Z6N4|D3DTU1|D3DTU2|F5H3I5|Q53FA2|Q9H3F8|Q9H8G0|Q9HBR9	Silent	SNP	ENST00000338399.4	37	CCDS42356.1																																																																																			A|0.949;G|0.051		0.602	CDK5RAP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000442913.1	NM_176096	
C17orf47	284083	broad.mit.edu	37	17	56620273	56620273	+	Silent	SNP	G	G	T			TCGA-OR-A5LG-01A-11D-A29I-10	TCGA-OR-A5LG-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a39e8bc9-757d-4536-b301-458fc7ec992d	6b9e8d41-7044-4151-b4d6-e211b0e7a923	g.chr17:56620273G>T	ENST00000321691.3	-	1	1456	c.1275C>A	c.(1273-1275)tcC>tcA	p.S425S	RP11-112H10.4_ENST00000580769.1_RNA|RP11-112H10.4_ENST00000578022.1_RNA|RP11-112H10.4_ENST00000580589.1_RNA|SEPT4_ENST00000412945.3_5'Flank|SEPT4_ENST00000457347.2_5'Flank	NM_001038704.2	NP_001033793	Q8NEP4	CQ047_HUMAN	chromosome 17 open reading frame 47	425										NS(1)|breast(2)|endometrium(1)|kidney(4)|large_intestine(4)|lung(9)|prostate(1)|skin(1)|urinary_tract(1)	24	Medulloblastoma(34;0.127)|all_neural(34;0.237)					GCCACCATGAGGAGTCAGGTC	0.527																																					p.S425S		.											.	C17orf47-135	0			c.C1275A						.						120.0	125.0	123.0					17																	56620273		2203	4300	6503	SO:0001819	synonymous_variant	284083	exon1			CCATGAGGAGTCA		CCDS32691.1	17q23.2	2012-10-11			ENSG00000181013	ENSG00000181013			26844	protein-coding gene	gene with protein product							Standard	NM_001038704		Approved	FLJ40121	uc002iwq.2	Q8NEP4	OTTHUMG00000179244	ENST00000321691.3:c.1275C>A	17.37:g.56620273G>T		Somatic	151	0		WXS	Illumina GAIIx	Phase_I	82	3	NM_001038704	0	0	0	0	0	Q8N821	Silent	SNP	ENST00000321691.3	37	CCDS32691.1																																																																																			.		0.527	C17orf47-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000445443.1	NM_001038704	
CSHL1	1444	bcgsc.ca	37	17	61987570	61987570	+	Missense_Mutation	SNP	G	G	T	rs2727307	byFrequency	TCGA-OR-A5LG-01A-11D-A29I-10	TCGA-OR-A5LG-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a39e8bc9-757d-4536-b301-458fc7ec992d	6b9e8d41-7044-4151-b4d6-e211b0e7a923	g.chr17:61987570G>T	ENST00000309894.5	-	4	422	c.423C>A	c.(421-423)gaC>gaA	p.D141E	CSHL1_ENST00000450719.3_Missense_Mutation_p.D47E|CSHL1_ENST00000438387.2_Missense_Mutation_p.D58E|CSHL1_ENST00000558099.1_5'UTR|CSHL1_ENST00000561003.1_Missense_Mutation_p.D58E|CSHL1_ENST00000259003.10_Missense_Mutation_p.D79E|CSHL1_ENST00000346606.6_Missense_Mutation_p.D47E|CSHL1_ENST00000392824.4_3'UTR	NM_022579.1	NP_072101.1	Q14406	CSHL_HUMAN	chorionic somatomammotropin hormone-like 1	141			D -> E (in dbSNP:rs2727307). {ECO:0000269|PubMed:15489334}.			extracellular region (GO:0005576)	hormone activity (GO:0005179)|metal ion binding (GO:0046872)			endometrium(3)|lung(6)	9						GGAGGTGATAGTCATCGCTGT	0.592													G|||	1392	0.277955	0.059	0.3256	5008	,	,		19686	0.4196		0.4185	False		,,,				2504	0.2495				p.D141E		.											.	CSHL1-90	0			c.C423A						.	G	GLU/ASP,GLU/ASP,GLU/ASP,GLU/ASP	555,3851	249.3+/-256.8	32,491,1680	90.0	78.0	82.0		141,423,174,354	3.1	0.2	17	dbSNP_100	82	3562,5038	516.7+/-378.9	747,2068,1485	no	missense,missense,missense,missense	CSHL1	NM_001318.2,NM_022579.1,NM_022580.1,NM_022581.1	45,45,45,45	779,2559,3165	TT,TG,GG		41.4186,12.5965,31.6546	benign,benign,benign,benign	47/129,141/223,58/140,118/200	61987570	4117,8889	2203	4300	6503	SO:0001583	missense	1444	exon4			GTGATAGTCATCG	BC029365	CCDS11652.1, CCDS42370.1, CCDS45759.1	17q22-q24	2012-10-02							2442	protein-coding gene	gene with protein product	"""chorionic somatomammotropin CS-5"""	603515		CSHP1		8083227	Standard	NM_001318		Approved	hCS-L, CSL, CS-5, MGC149868	uc002jda.1	Q14406		ENST00000309894.5:c.423C>A	17.37:g.61987570G>T	ENSP00000309524:p.Asp141Glu	Somatic	455	1		WXS	Illumina GAIIx	Phase_I	239	8	NM_022579	0	0	0	0	0	D3DU26|D3DU27|Q0VDB2	Missense_Mutation	SNP	ENST00000309894.5	37	CCDS11652.1	708	0.3241758241758242	38	0.07723577235772358	135	0.3729281767955801	217	0.3793706293706294	318	0.41952506596306066	g	8.404	0.842563	0.16963	0.125965	0.414186	ENSG00000204414	ENST00000309894;ENST00000438387;ENST00000259003;ENST00000346606;ENST00000450719	D;D;D	0.90261	-2.64;-2.64;-2.64	3.07	3.07	0.35406	Four-helical cytokine-like, core (1);Four-helical cytokine, core (1);	0.304551	0.31145	N	0.008174	T	0.00012	0.0000	L	0.29908	0.895	0.09310	P	0.99999999455923	B;B;B;B	0.32893	0.007;0.337;0.389;0.337	B;B;B;B	0.38156	0.007;0.173;0.266;0.253	T	0.08411	-1.0723	9	0.87932	D	0	.	8.2735	0.31857	0.0:0.2465:0.7534:0.0	rs2727307;rs57082825	47;58;141;118	Q14406-4;Q14406-3;Q14406;Q14406-2	.;.;CSHL_HUMAN;.	E	141;58;136;47;136	ENSP00000309524:D141E;ENSP00000402632:D58E;ENSP00000316360:D47E	ENSP00000259003:D136E	D	-	3	2	GH1	59341302	1.000000	0.71417	0.247000	0.24249	0.002000	0.02628	1.431000	0.34925	1.730000	0.51580	0.305000	0.20034	GAC	G|0.670;T|0.330		0.592	CSHL1-009	KNOWN	not_best_in_genome_evidence|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000444557.1	NM_022579	
CSHL1	1444	bcgsc.ca	37	17	61987576	61987576	+	Silent	SNP	G	G	A	rs2246207	byFrequency	TCGA-OR-A5LG-01A-11D-A29I-10	TCGA-OR-A5LG-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a39e8bc9-757d-4536-b301-458fc7ec992d	6b9e8d41-7044-4151-b4d6-e211b0e7a923	g.chr17:61987576G>A	ENST00000309894.5	-	4	416	c.417C>T	c.(415-417)agC>agT	p.S139S	CSHL1_ENST00000450719.3_Silent_p.S45S|CSHL1_ENST00000438387.2_Silent_p.S56S|CSHL1_ENST00000558099.1_5'UTR|CSHL1_ENST00000561003.1_Silent_p.S56S|CSHL1_ENST00000259003.10_Silent_p.S77S|CSHL1_ENST00000346606.6_Silent_p.S45S|CSHL1_ENST00000392824.4_3'UTR	NM_022579.1	NP_072101.1	Q14406	CSHL_HUMAN	chorionic somatomammotropin hormone-like 1	139						extracellular region (GO:0005576)	hormone activity (GO:0005179)|metal ion binding (GO:0046872)			endometrium(3)|lung(6)	9						GATAGTCATCGCTGTCCGAGG	0.587													G|||	1952	0.389776	0.4637	0.3501	5008	,	,		19398	0.4196		0.4225	False		,,,				2504	0.2536				p.S139S		.											.	CSHL1-90	0			c.C417T						.	G	,,,	2165,2241	583.4+/-385.8	538,1089,576	88.0	76.0	80.0		135,417,168,348	-4.3	0.0	17	dbSNP_100	80	3571,5029	517.8+/-379.1	751,2069,1480	no	coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous	CSHL1	NM_001318.2,NM_022579.1,NM_022580.1,NM_022581.1	,,,	1289,3158,2056	AA,AG,GG		41.5233,49.1375,44.1027	,,,	45/129,139/223,56/140,116/200	61987576	5736,7270	2203	4300	6503	SO:0001819	synonymous_variant	1444	exon4			GTCATCGCTGTCC	BC029365	CCDS11652.1, CCDS42370.1, CCDS45759.1	17q22-q24	2012-10-02							2442	protein-coding gene	gene with protein product	"""chorionic somatomammotropin CS-5"""	603515		CSHP1		8083227	Standard	NM_001318		Approved	hCS-L, CSL, CS-5, MGC149868	uc002jda.1	Q14406		ENST00000309894.5:c.417C>T	17.37:g.61987576G>A		Somatic	446	1		WXS	Illumina GAIIx	Phase_I	242	8	NM_022579	0	0	0	0	0	D3DU26|D3DU27|Q0VDB2	Silent	SNP	ENST00000309894.5	37	CCDS11652.1																																																																																			G|0.566;A|0.434		0.587	CSHL1-009	KNOWN	not_best_in_genome_evidence|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000444557.1	NM_022579	
FOXJ1	2302	hgsc.bcm.edu	37	17	74133974	74133974	+	Silent	SNP	C	C	T	rs894542	byFrequency	TCGA-OR-A5LG-01A-11D-A29I-10	TCGA-OR-A5LG-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a39e8bc9-757d-4536-b301-458fc7ec992d	6b9e8d41-7044-4151-b4d6-e211b0e7a923	g.chr17:74133974C>T	ENST00000322957.6	-	3	1080	c.726G>A	c.(724-726)acG>acA	p.T242T	RNF157-AS1_ENST00000585542.1_RNA|RNF157-AS1_ENST00000590137.1_RNA	NM_001454.3	NP_001445.2	Q92949	FOXJ1_HUMAN	forkhead box J1	242					actin cytoskeleton organization (GO:0030036)|activation of Rho GTPase activity (GO:0032862)|brain development (GO:0007420)|central tolerance induction (GO:0002508)|cilium assembly (GO:0042384)|epithelium development (GO:0060429)|establishment of apical/basal cell polarity (GO:0035089)|glomerular parietal epithelial cell development (GO:0072016)|humoral immune response (GO:0006959)|left/right pattern formation (GO:0060972)|leukocyte migration (GO:0050900)|lung epithelium development (GO:0060428)|metanephric part of ureteric bud development (GO:0035502)|negative regulation of B cell activation (GO:0050869)|negative regulation of germinal center formation (GO:0002635)|negative regulation of humoral immune response mediated by circulating immunoglobulin (GO:0002924)|negative regulation of interleukin-6 biosynthetic process (GO:0045409)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of T cell differentiation in thymus (GO:0033085)|negative regulation of T cell proliferation (GO:0042130)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|pattern specification process (GO:0007389)|positive regulation of central B cell tolerance induction (GO:0002897)|positive regulation of lung ciliated cell differentiation (GO:1901248)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region sequence-specific DNA binding (GO:0000976)			large_intestine(1)|liver(1)|pancreas(1)|skin(1)	4			LUSC - Lung squamous cell carcinoma(166;0.187)			CGGTATTCACCGTCAGCGGCC	0.716													C|||	385	0.076877	0.0431	0.134	5008	,	,		12954	0.0347		0.1103	False		,,,				2504	0.091				p.T242T		.											.	FOXJ1-227	0			c.G726A						.	C		156,3988		3,150,1919	4.0	6.0	5.0		726	1.5	1.0	17	dbSNP_86	5	700,7392		28,644,3374	no	coding-synonymous	FOXJ1	NM_001454.3		31,794,5293	TT,TC,CC		8.6505,3.7645,6.9958		242/422	74133974	856,11380	2072	4046	6118	SO:0001819	synonymous_variant	2302	exon3			ATTCACCGTCAGC	X99349	CCDS32739.1	17q25.1	2008-05-14				ENSG00000129654		"""Forkhead boxes"""	3816	protein-coding gene	gene with protein product		602291		FKHL13		9073514, 16518568	Standard	NM_001454		Approved	HFH-4, HFH4	uc002jqx.3	Q92949		ENST00000322957.6:c.726G>A	17.37:g.74133974C>T		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	13	12	NM_001454	0	0	0	0	0	O00630	Silent	SNP	ENST00000322957.6	37	CCDS32739.1																																																																																			C|0.925;T|0.075		0.716	FOXJ1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000449856.1	NM_001454	
MTCL1	23255	broad.mit.edu	37	18	8825271	8825271	+	Missense_Mutation	SNP	C	C	T	rs115783507	byFrequency	TCGA-OR-A5LG-01A-11D-A29I-10	TCGA-OR-A5LG-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a39e8bc9-757d-4536-b301-458fc7ec992d	6b9e8d41-7044-4151-b4d6-e211b0e7a923	g.chr18:8825271C>T	ENST00000306329.11	+	13	4720	c.4720C>T	c.(4720-4722)Cgc>Tgc	p.R1574C	SOGA2_ENST00000518815.1_Missense_Mutation_p.R580C|SOGA2_ENST00000517570.1_Missense_Mutation_p.R1214C|SOGA2_ENST00000400050.3_Missense_Mutation_p.R1214C|SOGA2_ENST00000359865.3_Missense_Mutation_p.R1255C|SOGA2_ENST00000306285.7_Missense_Mutation_p.R580C																							GGGGGCACGGCGCCCCCTTGA	0.637													C|||	16	0.00319489	0.0008	0.0029	5008	,	,		17262	0.0		0.002	False		,,,				2504	0.0112				p.R1255C		.											.	.	0			c.C3763T						.	C	CYS/ARG	14,4392	21.2+/-45.6	0,14,2189	29.0	30.0	30.0		3763	-0.2	0.0	18	dbSNP_132	30	10,8590	7.7+/-29.5	0,10,4290	yes	missense	CCDC165	NM_015210.3	180	0,24,6479	TT,TC,CC		0.1163,0.3177,0.1845	probably-damaging	1255/1587	8825271	24,12982	2203	4300	6503	SO:0001583	missense	23255	exon15			GCACGGCGCCCCC																												ENST00000306329.11:c.4720C>T	18.37:g.8825271C>T	ENSP00000305027:p.Arg1574Cys	Somatic	82	0		WXS	Illumina GAIIx	Phase_I	71	4	NM_015210	0	0	0	0	0		Missense_Mutation	SNP	ENST00000306329.11	37		2	9.157509157509158E-4	1	0.0020325203252032522	1	0.0027624309392265192	0	0.0	0	0.0	C	2.166	-0.391027	0.04932	0.003177	0.001163	ENSG00000168502	ENST00000306329;ENST00000517570;ENST00000359865;ENST00000400050;ENST00000306285	T;T;T;T	0.32272	2.46;2.46;2.46;1.46	5.04	-0.226	0.13106	.	0.896444	0.09389	N	0.808809	T	0.23886	0.0578	L	0.50333	1.59	0.09310	N	1	B;B	0.19935	0.018;0.04	B;B	0.11329	0.002;0.006	T	0.32188	-0.9916	10	0.56958	D	0.05	-1.6916	3.2619	0.06851	0.1211:0.5581:0.1173:0.2035	.	1565;1255	Q9Y4B5;Q9Y4B5-3	CC165_HUMAN;.	C	1276;1214;1255;1214;580	ENSP00000429556:R1214C;ENSP00000352927:R1255C;ENSP00000382924:R1214C;ENSP00000303670:R580C	ENSP00000303670:R580C	R	+	1	0	CCDC165	8815271	0.994000	0.37717	0.000000	0.03702	0.045000	0.14185	2.449000	0.44935	-0.067000	0.12976	0.655000	0.94253	CGC	C|0.998;T|0.002		0.637	SOGA2-015	PUTATIVE	basic|appris_candidate_longest|exp_conf	protein_coding	protein_coding	OTTHUMT00000444141.1		
APC2	10297	hgsc.bcm.edu	37	19	1457002	1457002	+	Missense_Mutation	SNP	G	G	C	rs143870588	byFrequency	TCGA-OR-A5LG-01A-11D-A29I-10	TCGA-OR-A5LG-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a39e8bc9-757d-4536-b301-458fc7ec992d	6b9e8d41-7044-4151-b4d6-e211b0e7a923	g.chr19:1457002G>C	ENST00000535453.1	+	8	2680	c.967G>C	c.(967-969)Ggc>Cgc	p.G323R	APC2_ENST00000238483.4_Intron|CTB-25B13.12_ENST00000588225.1_RNA|APC2_ENST00000233607.2_Missense_Mutation_p.G323R			P02655	APOC2_HUMAN	adenomatosis polyposis coli 2	0					cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|chylomicron remnant clearance (GO:0034382)|chylomicron remodeling (GO:0034371)|high-density lipoprotein particle clearance (GO:0034384)|lipid catabolic process (GO:0016042)|lipoprotein metabolic process (GO:0042157)|negative regulation of catalytic activity (GO:0043086)|negative regulation of cholesterol transport (GO:0032375)|negative regulation of lipid metabolic process (GO:0045833)|negative regulation of receptor-mediated endocytosis (GO:0048261)|negative regulation of very-low-density lipoprotein particle clearance (GO:0010916)|phospholipid efflux (GO:0033700)|phototransduction, visible light (GO:0007603)|positive regulation of fatty acid biosynthetic process (GO:0045723)|positive regulation of lipoprotein lipase activity (GO:0051006)|positive regulation of phospholipase activity (GO:0010518)|positive regulation of phospholipid catabolic process (GO:0060697)|positive regulation of triglyceride catabolic process (GO:0010898)|positive regulation of very-low-density lipoprotein particle remodeling (GO:0010902)|retinoid metabolic process (GO:0001523)|reverse cholesterol transport (GO:0043691)|small molecule metabolic process (GO:0044281)|triglyceride homeostasis (GO:0070328)|triglyceride-rich lipoprotein particle remodeling (GO:0034370)|very-low-density lipoprotein particle remodeling (GO:0034372)	chylomicron (GO:0042627)|early endosome (GO:0005769)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|intermediate-density lipoprotein particle (GO:0034363)|low-density lipoprotein particle (GO:0034362)|spherical high-density lipoprotein particle (GO:0034366)|very-low-density lipoprotein particle (GO:0034361)	lipase inhibitor activity (GO:0055102)|lipid binding (GO:0008289)|lipoprotein lipase activator activity (GO:0060230)|phospholipase activator activity (GO:0016004)|phospholipase binding (GO:0043274)|protein homodimerization activity (GO:0042803)			breast(3)|cervix(1)|kidney(4)|large_intestine(2)|lung(5)|pancreas(1)|skin(2)	18		Acute lymphoblastic leukemia(61;3.02e-13)|all_hematologic(61;4.32e-09)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		AATCCTCCACGGCACCGAggc	0.731													G|||	30	0.00599042	0.0008	0.0072	5008	,	,		13028	0.0		0.0199	False		,,,				2504	0.0041				p.G323R		.											.	APC2-290	0			c.G967C						.	G	ARG/GLY	10,3420		0,10,1705	2.0	3.0	2.0		967	4.6	1.0	19	dbSNP_134	2	73,6753		0,73,3340	yes	missense	APC2	NM_005883.2	125	0,83,5045	CC,CG,GG		1.0694,0.2915,0.8093	probably-damaging	323/2304	1457002	83,10173	1715	3413	5128	SO:0001583	missense	10297	exon9			CTCCACGGCACCG		CCDS12068.1	19p13.3	2013-02-14			ENSG00000115266	ENSG00000115266		"""Armadillo repeat containing"""	24036	protein-coding gene	gene with protein product	"""adenomatous polyposis coli like"""	612034				9823329, 10021369	Standard	XM_005259475		Approved	APCL	uc002lsr.1	O95996		ENST00000535453.1:c.967G>C	19.37:g.1457002G>C	ENSP00000442954:p.Gly323Arg	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	10	5	NM_005883	0	0	0	0	0	C0JYY4|Q9BS39|Q9UDE3|Q9UNK3	Missense_Mutation	SNP	ENST00000535453.1	37	CCDS12068.1	26	0.011904761904761904	4	0.008130081300813009	7	0.019337016574585635	0	0.0	15	0.01978891820580475	G	26.5	4.740587	0.89573	0.002915	0.010694	ENSG00000115266	ENST00000233607;ENST00000535453	T;T	0.64803	-0.12;-0.12	4.58	4.58	0.56647	Armadillo-type fold (1);	0.302208	0.30676	N	0.009114	T	0.54013	0.1832	L	0.34521	1.04	0.80722	D	1	D;D	0.89917	1.0;0.999	D;D	0.70935	0.971;0.935	T	0.67726	-0.5596	10	0.66056	D	0.02	-35.7747	14.8998	0.70670	0.0:0.0:1.0:0.0	.	322;323	O95996-3;O95996	.;APC2_HUMAN	R	323	ENSP00000233607:G323R;ENSP00000442954:G323R	ENSP00000233607:G323R	G	+	1	0	APC2	1408002	1.000000	0.71417	0.966000	0.40874	0.744000	0.42396	9.476000	0.97823	2.375000	0.81037	0.561000	0.74099	GGC	G|0.988;C|0.012		0.731	APC2-004	KNOWN	NAGNAG_splice_site|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000449539.2	NM_005883	
ABHD17A	81926	broad.mit.edu	37	19	1881527	1881527	+	Frame_Shift_Del	DEL	G	G	-	rs377128884		TCGA-OR-A5LG-01A-11D-A29I-10	TCGA-OR-A5LG-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a39e8bc9-757d-4536-b301-458fc7ec992d	6b9e8d41-7044-4151-b4d6-e211b0e7a923	g.chr19:1881527delG	ENST00000292577.7	-	2	472	c.39delC	c.(37-39)ttcfs	p.F13fs	ABHD17A_ENST00000590661.1_Frame_Shift_Del_p.F13fs|ABHD17A_ENST00000250974.9_Frame_Shift_Del_p.F13fs	NM_001130111.1	NP_001123583.1	Q96GS6	AB17A_HUMAN	abhydrolase domain containing 17A	13						extracellular region (GO:0005576)|membrane (GO:0016020)	hydrolase activity (GO:0016787)	p.F13delF(1)									GCGGGCAGCAGAAGAGGCAGC	0.756																																					p.F13fs		.											.	FAM108A1-90	1	Deletion - In frame(1)	upper_aerodigestive_tract(1)	c.39delC						.						9.0	13.0	11.0					19																	1881527		2041	4133	6174	SO:0001589	frameshift_variant	81926	exon2			GCAGCAGAAGAGG	BC020512	CCDS32867.1, CCDS45902.1	19p13.3	2013-03-15	2013-03-15	2013-03-15	ENSG00000129968	ENSG00000129968		"""Abhydrolase domain containing"""	28756	protein-coding gene	gene with protein product			"""chromosome 19 open reading frame 27"", ""family with sequence similarity 108, member A1"""	C19orf27, FAM108A1		14702039	Standard	NM_031213		Approved	MGC5244	uc002lug.3	Q96GS6	OTTHUMG00000171872	ENST00000292577.7:c.39delC	19.37:g.1881527delG	ENSP00000292577:p.Phe13fs	Somatic	6	0		WXS	Illumina GAIIx	Phase_I	78	10	NM_031213	0	0	0	0	0	A8K0G8|D6W5Z9|Q6PJU2|Q8WUH9|Q9BWL0|Q9H7Q9	Frame_Shift_Del	DEL	ENST00000292577.7	37	CCDS45902.1																																																																																			.		0.756	ABHD17A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000415556.2	NM_031213	
ABHD17A	81926	broad.mit.edu	37	19	1881529	1881530	+	Frame_Shift_Del	DEL	AG	AG	-			TCGA-OR-A5LG-01A-11D-A29I-10	TCGA-OR-A5LG-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a39e8bc9-757d-4536-b301-458fc7ec992d	6b9e8d41-7044-4151-b4d6-e211b0e7a923	g.chr19:1881529_1881530delAG	ENST00000292577.7	-	2	469_470	c.36_37delCT	c.(34-39)ctcttcfs	p.F13fs	ABHD17A_ENST00000590661.1_Frame_Shift_Del_p.F13fs|ABHD17A_ENST00000250974.9_Frame_Shift_Del_p.F13fs	NM_001130111.1	NP_001123583.1	Q96GS6	AB17A_HUMAN	abhydrolase domain containing 17A	13						extracellular region (GO:0005576)|membrane (GO:0016020)	hydrolase activity (GO:0016787)										GGGCAGCAGAAGAGGCAGCAGA	0.762																																					p.12_13del		.											.	FAM108A1-90	0			c.36_37del						.																																			SO:0001589	frameshift_variant	81926	exon2			AGCAGAAGAGGCA	BC020512	CCDS32867.1, CCDS45902.1	19p13.3	2013-03-15	2013-03-15	2013-03-15	ENSG00000129968	ENSG00000129968		"""Abhydrolase domain containing"""	28756	protein-coding gene	gene with protein product			"""chromosome 19 open reading frame 27"", ""family with sequence similarity 108, member A1"""	C19orf27, FAM108A1		14702039	Standard	NM_031213		Approved	MGC5244	uc002lug.3	Q96GS6	OTTHUMG00000171872	ENST00000292577.7:c.36_37delCT	19.37:g.1881531_1881532delAG	ENSP00000292577:p.Phe13fs	Somatic	6	0		WXS	Illumina GAIIx	Phase_I	78	10	NM_031213	0	0	0	0	0	A8K0G8|D6W5Z9|Q6PJU2|Q8WUH9|Q9BWL0|Q9H7Q9	Frame_Shift_Del	DEL	ENST00000292577.7	37	CCDS45902.1																																																																																			.		0.762	ABHD17A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000415556.2	NM_031213	
EEF2	1938	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	3976662	3976662	+	Missense_Mutation	SNP	C	C	G			TCGA-OR-A5LG-01A-11D-A29I-10	TCGA-OR-A5LG-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a39e8bc9-757d-4536-b301-458fc7ec992d	6b9e8d41-7044-4151-b4d6-e211b0e7a923	g.chr19:3976662C>G	ENST00000309311.6	-	15	2555	c.2467G>C	c.(2467-2469)Gac>Cac	p.D823H		NM_001961.3	NP_001952.1	P13639	EF2_HUMAN	eukaryotic translation elongation factor 2	823					cell death (GO:0008219)|cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|hematopoietic progenitor cell differentiation (GO:0002244)|positive regulation of gene expression (GO:0010628)|positive regulation of translation (GO:0045727)|translation (GO:0006412)|translational elongation (GO:0006414)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)|polysome (GO:0005844)|ribonucleoprotein complex (GO:0030529)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|poly(A) RNA binding (GO:0044822)|protein kinase binding (GO:0019901)|translation activator activity (GO:0008494)|translation elongation factor activity (GO:0003746)			endometrium(4)|large_intestine(4)|lung(6)|ovary(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	21		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.00461)|GBM - Glioblastoma multiforme(1328;0.0223)|STAD - Stomach adenocarcinoma(1328;0.18)		TCGAAGGGGTCTCCGGGCAGG	0.652																																					p.D823H	Colon(165;1804 1908 4071 6587 18799)	.											.	EEF2-90	0			c.G2467C						.						32.0	28.0	29.0					19																	3976662		2203	4298	6501	SO:0001583	missense	1938	exon15			AGGGGTCTCCGGG	Z11692	CCDS12117.1	19p13.3	2012-09-20			ENSG00000167658	ENSG00000167658			3214	protein-coding gene	gene with protein product	"""polypeptidyl-tRNA translocase"""	130610		EF2		2610926, 6427766	Standard	NM_001961		Approved	EEF-2	uc002lze.3	P13639		ENST00000309311.6:c.2467G>C	19.37:g.3976662C>G	ENSP00000307940:p.Asp823His	Somatic	71	0		WXS	Illumina GAIIx	Phase_I	56	25	NM_001961	0	2	1140	1945	803	B2RMP5|D6W618|Q58J86	Missense_Mutation	SNP	ENST00000309311.6	37	CCDS12117.1	.	.	.	.	.	.	.	.	.	.	C	20.8	4.045728	0.75846	.	.	ENSG00000167658	ENST00000309311	T	0.64618	-0.11	5.5	4.47	0.54385	Elongation factor G/III/V (1);Translation elongation factor EFG/EF2, C-terminal (3);	0.155671	0.56097	D	0.000039	T	0.76321	0.3971	M	0.85777	2.775	0.80722	D	1	D	0.53885	0.963	P	0.55713	0.782	T	0.81048	-0.1109	10	0.87932	D	0	-53.0711	13.4789	0.61324	0.0:0.9251:0.0:0.0749	.	823	P13639	EF2_HUMAN	H	823	ENSP00000307940:D823H	ENSP00000307940:D823H	D	-	1	0	EEF2	3927662	0.998000	0.40836	0.767000	0.31495	0.878000	0.50629	3.795000	0.55499	1.331000	0.45412	0.651000	0.88453	GAC	.		0.652	EEF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000457615.2	NM_001961	
ECSIT	51295	ucsc.edu	37	19	11617126	11617126	+	Missense_Mutation	SNP	A	A	C			TCGA-OR-A5LG-01A-11D-A29I-10	TCGA-OR-A5LG-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a39e8bc9-757d-4536-b301-458fc7ec992d	6b9e8d41-7044-4151-b4d6-e211b0e7a923	g.chr19:11617126A>C	ENST00000270517.7	-	8	1304	c.1169T>G	c.(1168-1170)gTc>gGc	p.V390G	ECSIT_ENST00000591104.1_3'UTR|CTC-398G3.6_ENST00000585656.1_5'Flank|ECSIT_ENST00000592312.1_3'UTR|ZNF653_ENST00000293771.5_5'Flank|ECSIT_ENST00000417981.2_Missense_Mutation_p.V176G|ECSIT_ENST00000252440.7_3'UTR|ZNF653_ENST00000593191.1_5'Flank|ECSIT_ENST00000591352.1_5'Flank|ECSIT_ENST00000588998.1_3'UTR	NM_016581.4	NP_057665.2	Q9BQ95	ECSIT_HUMAN	ECSIT signalling integrator	390					BMP signaling pathway (GO:0030509)|innate immune response (GO:0045087)|mesoderm formation (GO:0001707)|oxidation-reduction process (GO:0055114)|regulation of oxidoreductase activity (GO:0051341)	cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	oxidoreductase activity, acting on NAD(P)H (GO:0016651)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)			kidney(2)|large_intestine(3)|lung(1)|ovary(1)|prostate(2)|skin(1)|urinary_tract(1)	11						GAGGCGGAAGACCACGGGGAT	0.662																																					p.V390G		.											.	ECSIT-91	0			c.T1169G						.						34.0	36.0	36.0					19																	11617126		2203	4300	6503	SO:0001583	missense	51295	exon8			CGGAAGACCACGG	BC005119	CCDS12262.1, CCDS45979.1, CCDS45980.1, CCDS59353.1	19p13.2	2013-05-24	2013-05-24			ENSG00000130159		"""Mitochondrial respiratory chain complex assembly factors"""	29548	protein-coding gene	gene with protein product	"""signaling intermediate in Toll pathway evolutionarily conserved ortholog (mouse)"""	608388	"""ECSIT homolog (Drosophila)"""			10465784, 22982022	Standard	NM_001142464		Approved	SITPEC	uc002msb.3	Q9BQ95		ENST00000270517.7:c.1169T>G	19.37:g.11617126A>C	ENSP00000270517:p.Val390Gly	Somatic	62	0		WXS	Illumina GAIIx	Phase_I	57	2	NM_016581	0	0	129	157	28	E9PAN9|K7EMM0|Q96HQ7|Q9NYI1	Missense_Mutation	SNP	ENST00000270517.7	37	CCDS12262.1	.	.	.	.	.	.	.	.	.	.	A	19.26	3.793488	0.70452	.	.	ENSG00000130159	ENST00000270517;ENST00000417981	T;T	0.49432	0.78;0.78	5.43	5.43	0.79202	.	0.358813	0.27961	N	0.017144	T	0.65719	0.2718	M	0.72894	2.215	0.80722	D	1	D;D	0.71674	0.996;0.998	D;P	0.63877	0.919;0.844	T	0.69967	-0.5001	10	0.87932	D	0	-25.6063	14.4627	0.67462	1.0:0.0:0.0:0.0	.	176;390	E9PAN9;Q9BQ95	.;ECSIT_HUMAN	G	390;176	ENSP00000270517:V390G;ENSP00000412712:V176G	ENSP00000270517:V390G	V	-	2	0	ECSIT	11478126	1.000000	0.71417	0.998000	0.56505	0.090000	0.18270	8.410000	0.90225	2.075000	0.62263	0.477000	0.44152	GTC	.		0.662	ECSIT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000442603.2	NM_016581	
CCDC105	126402	hgsc.bcm.edu	37	19	15133926	15133926	+	Missense_Mutation	SNP	C	C	A	rs8112667	byFrequency	TCGA-OR-A5LG-01A-11D-A29I-10	TCGA-OR-A5LG-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a39e8bc9-757d-4536-b301-458fc7ec992d	6b9e8d41-7044-4151-b4d6-e211b0e7a923	g.chr19:15133926C>A	ENST00000292574.3	+	7	1577	c.1495C>A	c.(1495-1497)Ccc>Acc	p.P499T		NM_173482.2	NP_775753.2	Q8IYK2	CC105_HUMAN	coiled-coil domain containing 105	499			P -> T (in dbSNP:rs8112667).			extracellular vesicular exosome (GO:0070062)				NS(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(10)|ovary(1)|prostate(4)|skin(2)	23						CAGCGCGGACCCCTAGTGACC	0.716													c|||	1705	0.340455	0.1929	0.438	5008	,	,		11943	0.5208		0.2326	False		,,,				2504	0.3957				p.P499T		.											.	CCDC105-91	0			c.C1495A						.		THR/PRO	868,3356		95,678,1339	7.0	9.0	8.0		1495	-6.6	0.0	19	dbSNP_116	8	1799,6519		206,1387,2566	yes	missense	CCDC105	NM_173482.2	38	301,2065,3905	AA,AC,CC		21.6278,20.5492,21.2646	benign	499/500	15133926	2667,9875	2112	4159	6271	SO:0001583	missense	126402	exon7			GCGGACCCCTAGT	AK097684	CCDS12322.1	19p13.12	2008-02-05				ENSG00000160994			26866	protein-coding gene	gene with protein product						12477932	Standard	NM_173482		Approved	FLJ40365	uc002nae.2	Q8IYK2		ENST00000292574.3:c.1495C>A	19.37:g.15133926C>A	ENSP00000292574:p.Pro499Thr	Somatic	2	0		WXS	Illumina GAIIx	Phase_I	60	34	NM_173482	0	0	0	0	0	Q8N7T5|Q8NDL5	Missense_Mutation	SNP	ENST00000292574.3	37	CCDS12322.1	718	0.32875457875457875	102	0.2073170731707317	139	0.3839779005524862	297	0.5192307692307693	180	0.23746701846965698	c	12.70	2.017064	0.35606	0.205492	0.216278	ENSG00000160994	ENST00000292574	T	0.15139	2.45	3.29	-6.58	0.01836	.	1.321340	0.05609	N	0.577760	T	0.00012	0.0000	N	0.08118	0	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.44528	-0.9322	9	0.87932	D	0	.	0.9387	0.01351	0.3527:0.1586:0.3022:0.1865	rs8112667;rs59368867;rs8112667	499	Q8IYK2	CC105_HUMAN	T	499	ENSP00000292574:P499T	ENSP00000292574:P499T	P	+	1	0	CCDC105	14994926	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-3.281000	0.00528	-1.857000	0.01159	-1.528000	0.00924	CCC	C|0.671;A|0.329		0.716	CCDC105-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466293.1	NM_173482	
PGLS	25796	hgsc.bcm.edu	37	19	17622614	17622614	+	Silent	SNP	C	C	T	rs11086075	byFrequency	TCGA-OR-A5LG-01A-11D-A29I-10	TCGA-OR-A5LG-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a39e8bc9-757d-4536-b301-458fc7ec992d	6b9e8d41-7044-4151-b4d6-e211b0e7a923	g.chr19:17622614C>T	ENST00000252603.2	+	1	177	c.133C>T	c.(133-135)Ctg>Ttg	p.L45L	CTD-3131K8.2_ENST00000596643.1_lincRNA	NM_012088.2	NP_036220.1	O95336	6PGL_HUMAN	6-phosphogluconolactonase	45					carbohydrate metabolic process (GO:0005975)|pentose-phosphate shunt (GO:0006098)|pentose-phosphate shunt, oxidative branch (GO:0009051)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	6-phosphogluconolactonase activity (GO:0017057)|monosaccharide binding (GO:0048029)			endometrium(1)|lung(1)	2						CGCGCTCGGCCTGTCGGGCGG	0.736													C|||	1862	0.371805	0.2496	0.4207	5008	,	,		10575	0.377		0.4851	False		,,,				2504	0.3804				p.L45L		.											.	PGLS-90	0			c.C133T						.	C		662,2504		107,448,1028	2.0	2.0	2.0		133	2.6	1.0	19	dbSNP_120	2	2200,4094		507,1186,1454	no	coding-synonymous	PGLS	NM_012088.2		614,1634,2482	TT,TC,CC		34.9539,20.9097,30.2537		45/259	17622614	2862,6598	1583	3147	4730	SO:0001819	synonymous_variant	25796	exon1			CTCGGCCTGTCGG	AJ243972	CCDS12361.1	19p13.2	2008-02-05				ENSG00000130313	3.1.1.31		8903	protein-coding gene	gene with protein product		604951				10518023	Standard	NM_012088		Approved	6PGL	uc002ngw.3	O95336		ENST00000252603.2:c.133C>T	19.37:g.17622614C>T		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	27	11	NM_012088	0	0	0	0	0		Silent	SNP	ENST00000252603.2	37	CCDS12361.1																																																																																			C|0.617;T|0.383		0.736	PGLS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464154.1		
MAP1S	55201	hgsc.bcm.edu	37	19	17837425	17837425	+	Missense_Mutation	SNP	C	C	G	rs17710707	byFrequency	TCGA-OR-A5LG-01A-11D-A29I-10	TCGA-OR-A5LG-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a39e8bc9-757d-4536-b301-458fc7ec992d	6b9e8d41-7044-4151-b4d6-e211b0e7a923	g.chr19:17837425C>G	ENST00000324096.4	+	5	1383	c.1232C>G	c.(1231-1233)tCt>tGt	p.S411C	MAP1S_ENST00000597681.1_Intron|MAP1S_ENST00000544059.2_Missense_Mutation_p.S385C|CTD-3149D2.4_ENST00000595363.1_RNA	NM_018174.4	NP_060644.4	Q66K74	MAP1S_HUMAN	microtubule-associated protein 1S	411	Necessary for the microtubule-organizing center localization.		S -> C (in dbSNP:rs17710707). {ECO:0000269|PubMed:15489334}.		apoptotic DNA fragmentation (GO:0006309)|brain development (GO:0007420)|execution phase of apoptosis (GO:0097194)|microtubule bundle formation (GO:0001578)|mitochondrion transport along microtubule (GO:0047497)|nervous system development (GO:0007399)|neuron projection morphogenesis (GO:0048812)	cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendrite (GO:0030425)|microtubule (GO:0005874)|neuronal cell body (GO:0043025)|nucleolus (GO:0005730)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|synapse (GO:0045202)	actin filament binding (GO:0051015)|beta-tubulin binding (GO:0048487)|DNA binding (GO:0003677)|microtubule binding (GO:0008017)|tubulin binding (GO:0015631)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(4)|lung(5)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	25						ACGCTGGCCTCTGTGTGCGCC	0.731													C|||	574	0.114617	0.0832	0.1772	5008	,	,		12607	0.0169		0.2068	False		,,,				2504	0.1186				p.S411C		.											.	MAP1S-90	0			c.C1232G						.	C	CYS/SER	344,3714		17,310,1702	5.0	5.0	5.0		1232	2.6	0.2	19	dbSNP_123	5	1234,6710		91,1052,2829	no	missense	MAP1S	NM_018174.4	112	108,1362,4531	GG,GC,CC		15.5337,8.4771,13.1478	probably-damaging	411/1060	17837425	1578,10424	2029	3972	6001	SO:0001583	missense	55201	exon5			TGGCCTCTGTGTG	BC067115	CCDS32954.1	19p13.12	2008-02-05	2006-07-04	2006-07-04		ENSG00000130479			15715	protein-coding gene	gene with protein product		607573	"""chromosome 19 open reading frame 5"", ""VCY2 interacting protein 1"", ""BPY2 interacting protein 1"""	C19orf5, VCY2IP1, BPY2IP1		11827465, 15528209, 16297881, 14627543	Standard	NM_018174		Approved	FLJ10669, MAP8	uc002nhe.1	Q66K74		ENST00000324096.4:c.1232C>G	19.37:g.17837425C>G	ENSP00000325313:p.Ser411Cys	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	39	20	NM_018174	0	0	1	2	1	B4DH53|Q27QB1|Q6NXF1|Q8N3L8|Q8N3W5|Q8NI88|Q96H94|Q96IT4|Q96SP8|Q9BRC6|Q9H928|Q9NVK7	Missense_Mutation	SNP	ENST00000324096.4	37	CCDS32954.1	257	0.11767399267399267	34	0.06910569105691057	66	0.18232044198895028	7	0.012237762237762238	150	0.19788918205804748	C	15.12	2.738952	0.49045	0.084771	0.155337	ENSG00000130479	ENST00000324096;ENST00000544059	T;T	0.03801	3.8;3.8	3.67	2.61	0.31194	.	0.155772	0.30277	N	0.009981	T	0.00012	0.0000	M	0.79614	2.46	0.09310	P	0.99999454915	D;D	0.89917	1.0;1.0	D;D	0.80764	0.977;0.994	T	0.06006	-1.0851	9	0.87932	D	0	-16.5051	8.9574	0.35827	0.0:0.8847:0.0:0.1153	rs17710707	385;411	B4DH53;Q66K74	.;MAP1S_HUMAN	C	411;385	ENSP00000325313:S411C;ENSP00000439243:S385C	ENSP00000325313:S411C	S	+	2	0	MAP1S	17698425	0.998000	0.40836	0.209000	0.23619	0.382000	0.30200	7.628000	0.83189	0.516000	0.28340	-0.291000	0.09656	TCT	C|0.883;G|0.117		0.731	MAP1S-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466027.1	NM_018174	
RGS9BP	388531	hgsc.bcm.edu	37	19	33167455	33167455	+	Missense_Mutation	SNP	G	G	T	rs259290	byFrequency	TCGA-OR-A5LG-01A-11D-A29I-10	TCGA-OR-A5LG-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a39e8bc9-757d-4536-b301-458fc7ec992d	6b9e8d41-7044-4151-b4d6-e211b0e7a923	g.chr19:33167455G>T	ENST00000334176.3	+	1	1143	c.286G>T	c.(286-288)Gcg>Tcg	p.A96S	ANKRD27_ENST00000306065.4_5'Flank|ANKRD27_ENST00000587352.1_5'Flank	NM_207391.2	NP_997274.2	Q6ZS82	R9BP_HUMAN	regulator of G protein signaling 9 binding protein	96			A -> S (in dbSNP:rs259290). {ECO:0000269|PubMed:14702039}.		detection of light stimulus involved in visual perception (GO:0050908)|negative regulation of signal transduction (GO:0009968)|phototransduction, visible light (GO:0007603)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|rhodopsin mediated signaling pathway (GO:0016056)	integral component of membrane (GO:0016021)				central_nervous_system(1)|lung(2)	3	Esophageal squamous(110;0.137)					CATGCGACGCGCGCTGGAGCT	0.786													G|||	2178	0.434904	0.3805	0.4856	5008	,	,		10415	0.2579		0.6233	False		,,,				2504	0.4611				p.A96S		.											.	RGS9BP-90	0			c.G286T						.	G	SER/ALA	1584,1384		459,666,359	2.0	2.0	2.0		286	3.5	1.0	19	dbSNP_79	2	4397,1763		1670,1057,353	yes	missense	RGS9BP	NM_207391.2	99	2129,1723,712	TT,TG,GG		28.6201,46.6307,34.4763	possibly-damaging	96/236	33167455	5981,3147	1484	3080	4564	SO:0001583	missense	388531	exon1			CGACGCGCGCTGG	AW302149	CCDS12424.1	19q13.11	2008-02-05	2007-08-14			ENSG00000186326			30304	protein-coding gene	gene with protein product		607814	"""regulator of G protein signalling 9 binding protein"""			12119397, 8889548	Standard	NM_207391		Approved	FLJ45744, PERRS, R9AP, RGS9	uc002ntp.1	Q6ZS82		ENST00000334176.3:c.286G>T	19.37:g.33167455G>T	ENSP00000334134:p.Ala96Ser	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	13	13	NM_207391	0	0	0	0	0	Q6ZVJ6	Missense_Mutation	SNP	ENST00000334176.3	37	CCDS12424.1	1007	0.4610805860805861	184	0.37398373983739835	188	0.5193370165745856	161	0.28146853146853146	474	0.6253298153034301	G	15.38	2.815844	0.50527	0.533693	0.713799	ENSG00000186326	ENST00000334176	T	0.33654	1.4	4.57	3.5	0.40072	.	0.065802	0.64402	U	0.000009	T	0.00012	0.0000	L	0.28115	0.83	0.20873	P	0.999831543	P	0.52170	0.951	P	0.50352	0.638	T	0.12528	-1.0544	9	0.35671	T	0.21	-21.6697	13.7833	0.63094	0.0:0.0:0.8453:0.1547	rs259290	96	Q6ZS82	R9BP_HUMAN	S	96	ENSP00000334134:A96S	ENSP00000334134:A96S	A	+	1	0	RGS9BP	37859295	1.000000	0.71417	1.000000	0.80357	0.125000	0.20455	4.816000	0.62642	1.092000	0.41356	0.313000	0.20887	GCG	G|0.540;T|0.460		0.786	RGS9BP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000450337.1	NM_207391	
RINL	126432	hgsc.bcm.edu	37	19	39360720	39360720	+	Missense_Mutation	SNP	G	G	A	rs8110393	byFrequency	TCGA-OR-A5LG-01A-11D-A29I-10	TCGA-OR-A5LG-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a39e8bc9-757d-4536-b301-458fc7ec992d	6b9e8d41-7044-4151-b4d6-e211b0e7a923	g.chr19:39360720G>A	ENST00000591812.1	-	9	1291	c.1205C>T	c.(1204-1206)cCc>cTc	p.P402L	RINL_ENST00000598904.1_Missense_Mutation_p.P288L|RINL_ENST00000340740.3_Missense_Mutation_p.P288L|CTC-360G5.6_ENST00000593830.1_RNA|RINL_ENST00000602238.1_5'Flank			Q6ZS11	RINL_HUMAN	Ras and Rab interactor-like	402	VPS9. {ECO:0000255|PROSITE- ProRule:PRU00550}.		P -> L (in dbSNP:rs8110393).		endocytosis (GO:0006897)|positive regulation of GTPase activity (GO:0043547)|protein transport (GO:0015031)	actin cytoskeleton (GO:0015629)|cytoplasmic vesicle (GO:0031410)|ruffle (GO:0001726)	GTPase activator activity (GO:0005096)|guanyl-nucleotide exchange factor activity (GO:0005085)			endometrium(3)|kidney(4)|large_intestine(2)|lung(4)|pancreas(1)|skin(1)|urinary_tract(2)	17						GGCGGGGGCGGGGCTCTGCCC	0.781													G|||	3477	0.694289	0.9289	0.6153	5008	,	,		10275	0.7619		0.4642	False		,,,				2504	0.6002				p.P402L		.											.	RINL-91	0			c.C1205T						.	G	LEU/PRO,LEU/PRO	3328,464		1489,350,57	4.0	4.0	4.0		1205,863	3.5	1.0	19	dbSNP_116	4	4059,3433		1245,1569,932	no	missense,missense	RINL	NM_001195833.1,NM_198445.3	98,98	2734,1919,989	AA,AG,GG		45.8222,12.2363,34.5356	probably-damaging,probably-damaging	402/567,288/453	39360720	7387,3897	1896	3746	5642	SO:0001583	missense	126432	exon9			GGGGCGGGGCTCT	AK127808	CCDS12522.1, CCDS59386.1	19q13.2	2010-07-13			ENSG00000187994	ENSG00000187994			24795	protein-coding gene	gene with protein product							Standard	NM_001195833		Approved	FLJ45909	uc010xuo.2	Q6ZS11		ENST00000591812.1:c.1205C>T	19.37:g.39360720G>A	ENSP00000467107:p.Pro402Leu	Somatic	1	0		WXS	Illumina GAIIx	Phase_I	31	31	NM_001195833	0	0	0	0	0	B4DPG5	Missense_Mutation	SNP	ENST00000591812.1	37	CCDS59386.1	1421	0.6506410256410257	458	0.9308943089430894	225	0.6215469613259669	401	0.701048951048951	337	0.4445910290237467	G	17.17	3.320891	0.60634	0.877637	0.541778	ENSG00000187994	ENST00000340740;ENST00000536520	T	0.28454	1.61	4.57	3.53	0.40419	Vacuolar sorting protein 9 (1);	0.269737	0.35235	N	0.003350	T	0.00012	0.0000	M	0.67700	2.07	0.21553	P	0.999649277	B;B	0.21225	0.053;0.053	B;B	0.22152	0.038;0.038	T	0.17776	-1.0358	9	0.72032	D	0.01	-26.0247	8.5759	0.33598	0.1063:0.0:0.8937:0.0	rs8110393;rs61482706	402;288	B4DPG5;Q6ZS11	.;RINL_HUMAN	L	288	ENSP00000340369:P288L	ENSP00000340369:P288L	P	-	2	0	RINL	44052560	1.000000	0.71417	0.987000	0.45799	0.313000	0.28021	4.771000	0.62318	1.273000	0.44346	0.407000	0.27541	CCC	G|0.349;A|0.651		0.781	RINL-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000460433.1	NM_198445	
FBXO17	115290	hgsc.bcm.edu	37	19	39440918	39440918	+	Silent	SNP	T	T	C	rs2304117	byFrequency	TCGA-OR-A5LG-01A-11D-A29I-10	TCGA-OR-A5LG-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a39e8bc9-757d-4536-b301-458fc7ec992d	6b9e8d41-7044-4151-b4d6-e211b0e7a923	g.chr19:39440918T>C	ENST00000292852.4	-	2	383	c.42A>G	c.(40-42)ccA>ccG	p.P14P	SARS2_ENST00000448145.2_5'Flank|CTC-360G5.8_ENST00000599996.1_5'Flank|FBXO17_ENST00000595329.1_Silent_p.P14P	NM_024907.5	NP_079183.4	Q96EF6	FBX17_HUMAN	F-box protein 17	14						SCF ubiquitin ligase complex (GO:0019005)	glycoprotein binding (GO:0001948)			breast(1)|endometrium(1)|large_intestine(1)|lung(3)|prostate(1)	7	all_cancers(60;8.37e-07)|all_lung(34;3.71e-07)|Lung NSC(34;4.17e-07)|all_epithelial(25;1.13e-06)|Ovarian(47;0.0454)		Lung(45;0.000419)|LUSC - Lung squamous cell carcinoma(53;0.000554)			GGGCCAGGGATGGGTCCGCCG	0.731													c|||	2378	0.47484	0.3336	0.3746	5008	,	,		11867	0.6796		0.4195	False		,,,				2504	0.5828				p.P23P		.											.	FBXO17-226	0			c.A69G						.		,	1052,2556		213,626,965	3.0	4.0	3.0		42,69	0.5	0.0	19	dbSNP_100	3	2265,4819		496,1273,1773	no	coding-synonymous,coding-synonymous	FBXO17	NM_024907.5,NM_148169.1	,	709,1899,2738	CC,CT,TT		31.9735,29.1574,31.0232	,	14/279,23/288	39440918	3317,7375	1804	3542	5346	SO:0001819	synonymous_variant	115290	exon2			CAGGGATGGGTCC	AF386743	CCDS12526.1	19q13.2	2010-07-02	2004-06-15	2004-06-16		ENSG00000269190		"""F-boxes /  ""other"""""	18754	protein-coding gene	gene with protein product	"""F-box only protein 26"""	609094	"""F-box only protein 17"""	FBXO26			Standard	NM_148169		Approved	FBG4, FLJ25205, MGC9379, FLJ11798, Fbx17		Q96EF6		ENST00000292852.4:c.42A>G	19.37:g.39440918T>C		Somatic	1	0		WXS	Illumina GAIIx	Phase_I	43	14	NM_148169	0	0	1	1	0	Q96LQ4	Silent	SNP	ENST00000292852.4	37	CCDS12526.1																																																																																			T|0.545;C|0.455		0.731	FBXO17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463273.1	NM_024907	
PTGIR	5739	hgsc.bcm.edu	37	19	47127324	47127324	+	Silent	SNP	C	C	G	rs2229128	byFrequency	TCGA-OR-A5LG-01A-11D-A29I-10	TCGA-OR-A5LG-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a39e8bc9-757d-4536-b301-458fc7ec992d	6b9e8d41-7044-4151-b4d6-e211b0e7a923	g.chr19:47127324C>G	ENST00000291294.2	-	2	292	c.159G>C	c.(157-159)gtG>gtC	p.V53V	PTGIR_ENST00000594275.1_Intron|PTGIR_ENST00000596260.1_Silent_p.V53V|PTGIR_ENST00000597185.1_Intron|PTGIR_ENST00000598865.1_Intron	NM_000960.3	NP_000951.1	P43119	PI2R_HUMAN	prostaglandin I2 (prostacyclin) receptor (IP)	53					adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|blood coagulation (GO:0007596)|cell-cell signaling (GO:0007267)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|negative regulation of platelet-derived growth factor receptor signaling pathway (GO:0010642)|negative regulation of smooth muscle cell proliferation (GO:0048662)|positive regulation of cAMP biosynthetic process (GO:0030819)|positive regulation of cAMP-mediated signaling (GO:0043950)|positive regulation of GTPase activity (GO:0043547)|response to lipopolysaccharide (GO:0032496)	cytosol (GO:0005829)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|guanyl-nucleotide exchange factor activity (GO:0005085)			endometrium(1)|kidney(1)|large_intestine(1)|lung(5)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	13		Ovarian(192;0.0129)|all_neural(266;0.0459)|Breast(70;0.212)		OV - Ovarian serous cystadenocarcinoma(262;0.000327)|all cancers(93;0.000641)|Epithelial(262;0.0174)|GBM - Glioblastoma multiforme(486;0.0331)	Dinoprost Tromethamine(DB01160)|Epoprostenol(DB01240)|Iloprost(DB01088)|Treprostinil(DB00374)	CCAGTCCGGTCACCAGCACCG	0.731													G|||	1139	0.227436	0.1362	0.2133	5008	,	,		13968	0.3313		0.2465	False		,,,				2504	0.2342				p.V53V		.											.	PTGIR-522	0			c.G159C						.	G		523,3103		62,399,1352	3.0	5.0	5.0		159	2.2	1.0	19	dbSNP_98	5	1678,5498		231,1216,2141	no	coding-synonymous	PTGIR	NM_000960.3		293,1615,3493	GG,GC,CC		23.3835,14.4236,20.3759		53/387	47127324	2201,8601	1813	3588	5401	SO:0001819	synonymous_variant	5739	exon2			TCCGGTCACCAGC		CCDS12686.1	19q13.3	2012-08-08				ENSG00000160013		"""GPCR / Class A : Prostanoid receptors"""	9602	protein-coding gene	gene with protein product		600022				7759114	Standard	NM_000960		Approved	IP	uc002pex.3	P43119		ENST00000291294.2:c.159G>C	19.37:g.47127324C>G		Somatic	2	0		WXS	Illumina GAIIx	Phase_I	26	16	NM_000960	0	0	0	0	0		Silent	SNP	ENST00000291294.2	37	CCDS12686.1																																																																																			C|0.254;G|0.746		0.731	PTGIR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466581.1		
INAFM1	255783	hgsc.bcm.edu	37	19	47778412	47778412	+	Missense_Mutation	SNP	G	G	T	rs1055218	byFrequency	TCGA-OR-A5LG-01A-11D-A29I-10	TCGA-OR-A5LG-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a39e8bc9-757d-4536-b301-458fc7ec992d	6b9e8d41-7044-4151-b4d6-e211b0e7a923	g.chr19:47778412G>T	ENST00000552360.2	+	1	271	c.236G>T	c.(235-237)cGc>cTc	p.R79L		NM_178511.5	NP_848606.3														skin(1)	1						TGTGCTGCCCGCCCGGGCGTG	0.776													G|||	1999	0.399161	0.3162	0.3876	5008	,	,		5503	0.5942		0.331	False		,,,				2504	0.3885				p.R79L		.											.	.	0			c.G236T						.						6.0	6.0	6.0					19																	47778412		676	1545	2221	SO:0001583	missense	255783	exon1			CTGCCCGCCCGGG																												ENST00000552360.2:c.236G>T	19.37:g.47778412G>T	ENSP00000447679:p.Arg79Leu	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	14	14	NM_178511	0	0	0	1	1		Missense_Mutation	SNP	ENST00000552360.2	37	CCDS46131.1	909	0.41620879120879123	179	0.3638211382113821	137	0.3784530386740331	319	0.5576923076923077	274	0.36147757255936674	G	5.764	0.325396	0.10900	.	.	ENSG00000257704;ENSG00000232427	ENST00000552360;ENST00000422073	.	.	.	2.47	-0.147	0.13428	.	.	.	.	.	T	0.00012	0.0000	N	0.22421	0.69	0.80722	P	0.0	P	0.35307	0.494	B	0.20184	0.028	T	0.45862	-0.9232	7	0.35671	T	0.21	.	3.1104	0.06356	0.1831:0.2892:0.5277:0.0	rs1055218;rs3195715;rs17418921;rs57061764	79	C9JVW0	PRR24_HUMAN	L	132;79	.	ENSP00000447679:R132L	R	+	2	0	PRR24;AC008532.1	52470252	0.002000	0.14202	0.007000	0.13788	0.039000	0.13416	-0.171000	0.09883	0.370000	0.24538	0.456000	0.33151	CGC	G|0.585;T|0.415		0.776	PRR24-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407505.2		
KCNA7	3743	hgsc.bcm.edu	37	19	49575618	49575618	+	Silent	SNP	A	A	G	rs71352730	byFrequency	TCGA-OR-A5LG-01A-11D-A29I-10	TCGA-OR-A5LG-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a39e8bc9-757d-4536-b301-458fc7ec992d	6b9e8d41-7044-4151-b4d6-e211b0e7a923	g.chr19:49575618A>G	ENST00000221444.1	-	1	580	c.225T>C	c.(223-225)ggT>ggC	p.G75G		NM_031886.2	NP_114092.2	Q96RP8	KCNA7_HUMAN	potassium voltage-gated channel, shaker-related subfamily, member 7	75					protein homooligomerization (GO:0051260)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)			central_nervous_system(1)|endometrium(2)|large_intestine(2)|lung(4)|skin(2)	11		all_lung(116;1.7e-06)|Lung NSC(112;3.55e-06)|all_epithelial(76;3.83e-06)|all_neural(266;0.0189)|Ovarian(192;0.0261)		all cancers(93;0.000397)|OV - Ovarian serous cystadenocarcinoma(262;0.000519)|GBM - Glioblastoma multiforme(486;0.00541)|Epithelial(262;0.0441)	Dalfampridine(DB06637)	GCAGCCGCCCACCGGACTGGT	0.731													a|||	708	0.141374	0.2837	0.1398	5008	,	,		7174	0.0486		0.0875	False		,,,				2504	0.1012				p.G75G	Colon(74;686 1235 3793 23366 48562)	.											.	KCNA7-90	0			c.T225C						.			790,3356		66,658,1349	9.0	12.0	11.0		225	-0.4	1.0	19	dbSNP_130	11	613,7491		29,555,3468	no	coding-synonymous	KCNA7	NM_031886.2		95,1213,4817	GG,GA,AA		7.5642,19.0545,11.4531		75/457	49575618	1403,10847	2073	4052	6125	SO:0001819	synonymous_variant	3743	exon1			CCGCCCACCGGAC	AF315818	CCDS12755.1	19q13.3	2012-07-05				ENSG00000104848		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6226	protein-coding gene	gene with protein product		176268				16382104	Standard	NM_031886		Approved	Kv1.7, HAK6	uc002pmg.3	Q96RP8		ENST00000221444.1:c.225T>C	19.37:g.49575618A>G		Somatic	2	0		WXS	Illumina GAIIx	Phase_I	23	10	NM_031886	0	0	0	0	0	A1KYX7|Q9BYS4	Silent	SNP	ENST00000221444.1	37	CCDS12755.1																																																																																			A|0.868;G|0.132		0.731	KCNA7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466263.1	NM_031886	
ASPDH	554235	hgsc.bcm.edu	37	19	51015404	51015404	+	Missense_Mutation	SNP	T	T	C	rs12977172	byFrequency	TCGA-OR-A5LG-01A-11D-A29I-10	TCGA-OR-A5LG-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a39e8bc9-757d-4536-b301-458fc7ec992d	6b9e8d41-7044-4151-b4d6-e211b0e7a923	g.chr19:51015404T>C	ENST00000389208.4	-	6	858	c.797A>G	c.(796-798)cAg>cGg	p.Q266R	JOSD2_ENST00000601423.1_5'Flank|ASPDH_ENST00000597030.1_5'Flank|JOSD2_ENST00000598418.1_5'Flank|JOSD2_ENST00000391815.3_5'Flank|JOSD2_ENST00000595669.1_5'Flank|ASPDH_ENST00000376916.3_Missense_Mutation_p.Q161R	NM_001114598.1	NP_001108070.1	A6ND91	ASPD_HUMAN	aspartate dehydrogenase domain containing	266			Q -> R (in dbSNP:rs12977172). {ECO:0000269|PubMed:15489334, ECO:0000269|Ref.1}.		NAD biosynthetic process (GO:0009435)|NADP catabolic process (GO:0006742)		aspartate dehydrogenase activity (GO:0033735)|NADP binding (GO:0050661)			endometrium(1)|large_intestine(1)|lung(1)	3						CAGGAGGCTCTGCCAGAAGGC	0.706													C|||	3986	0.795927	0.9728	0.7781	5008	,	,		10864	0.7143		0.6849	False		,,,				2504	0.7679				p.Q266R		.											.	ASPDH-90	0			c.A797G						.	C	ARG/GLN,ARG/GLN	3799,331		1771,257,37	6.0	9.0	8.0		482,797	1.9	1.0	19	dbSNP_121	8	5527,2593		1919,1689,452	no	missense,missense	ASPDH	NM_001024656.2,NM_001114598.1	43,43	3690,1946,489	CC,CT,TT		31.9335,8.0145,23.8694	benign,benign	161/179,266/284	51015404	9326,2924	2065	4060	6125	SO:0001583	missense	554235	exon6			AGGCTCTGCCAGA		CCDS33082.1, CCDS46153.1	19q13.33	2012-10-02			ENSG00000204653	ENSG00000204653			33856	protein-coding gene	gene with protein product							Standard	NM_001024656		Approved		uc010enz.3	A6ND91		ENST00000389208.4:c.797A>G	19.37:g.51015404T>C	ENSP00000373860:p.Gln266Arg	Somatic	1	0		WXS	Illumina GAIIx	Phase_I	16	7	NM_001114598	0	0	0	0	0	Q6NZ37	Missense_Mutation	SNP	ENST00000389208.4	37	CCDS46153.1	1681	0.7696886446886447	481	0.9776422764227642	273	0.7541436464088398	412	0.7202797202797203	515	0.679419525065963	C	3.606	-0.080592	0.07141	0.919855	0.680665	ENSG00000204653	ENST00000376916;ENST00000389208	T;T	0.39997	1.05;1.05	2.95	1.88	0.25563	Aspartate dehydrogenase (1);	1.158050	0.06646	N	0.761872	T	0.00012	0.0000	N	0.01705	-0.755	0.80722	P	0.0	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.0	T	0.30794	-0.9966	9	0.06099	T	0.92	-1.7519	4.8935	0.13738	0.0:0.6813:0.0:0.3187	rs12977172	266;161	A6ND91;A6ND91-2	ASPD_HUMAN;.	R	161;266	ENSP00000366114:Q161R;ENSP00000373860:Q266R	ENSP00000366114:Q161R	Q	-	2	0	ASPDH	55707216	0.916000	0.31088	0.989000	0.46669	0.553000	0.35397	0.171000	0.16685	0.125000	0.18397	-0.355000	0.07637	CAG	T|0.228;C|0.772		0.706	ASPDH-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464861.1	NM_001024656	
ZNF628	89887	hgsc.bcm.edu	37	19	55993260	55993260	+	Missense_Mutation	SNP	A	A	G	rs34864744	byFrequency	TCGA-OR-A5LG-01A-11D-A29I-10	TCGA-OR-A5LG-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a39e8bc9-757d-4536-b301-458fc7ec992d	6b9e8d41-7044-4151-b4d6-e211b0e7a923	g.chr19:55993260A>G	ENST00000598519.1	+	3	1253	c.700A>G	c.(700-702)Acc>Gcc	p.T234A	ZNF628_ENST00000391718.2_Missense_Mutation_p.T230A			Q5EBL2	ZN628_HUMAN	zinc finger protein 628	234	Pro-rich.			T -> A (in Ref. 2; AAH89449). {ECO:0000305}.	transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(4)|kidney(1)|lung(2)	7	Breast(117;0.155)		BRCA - Breast invasive adenocarcinoma(297;0.18)|LUSC - Lung squamous cell carcinoma(43;0.193)	GBM - Glioblastoma multiforme(193;0.0531)		cgccccgggtaccgcctccgc	0.766													N|||	3815	0.761781	0.9387	0.732	5008	,	,		4719	0.4395		0.837	False		,,,				2504	0.7986				p.T234A		.											.	ZNF628-22	0			c.A700G						.						3.0	4.0	4.0					19																	55993260		1771	3509	5280	SO:0001583	missense	89887	exon3			CCGGGTACCGCCT	AF367249	CCDS33116.3	19q13.43	2013-01-08			ENSG00000197483	ENSG00000197483		"""Zinc fingers, C2H2-type"""	28054	protein-coding gene	gene with protein product	"""Zinc finger expressed in Embryonal cells and Certain adult organs"""	610671					Standard	NM_033113		Approved	ZEC, Zfp628	uc002qld.3	Q5EBL2	OTTHUMG00000150396	ENST00000598519.1:c.700A>G	19.37:g.55993260A>G	ENSP00000469591:p.Thr234Ala	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	25	25	NM_033113	0	0	0	0	0	Q86X34	Missense_Mutation	SNP	ENST00000598519.1	37	CCDS33116.3	1594	0.7298534798534798	448	0.9105691056910569	272	0.7513812154696132	259	0.4527972027972028	615	0.8113456464379947	.	0.001	-2.964343	0.00049	.	.	ENSG00000197483	ENST00000391718	T	0.08193	3.12	3.0	-0.723	0.11181	.	.	.	.	.	T	0.00012	0.0000	N	0.08118	0	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.05852	-1.0860	8	0.25106	T	0.35	0.0335	6.0751	0.19911	0.3452:0.3167:0.3381:0.0	rs34864744	230	Q5EBL2	ZN628_HUMAN	A	230	ENSP00000375598:T230A	ENSP00000375598:T230A	T	+	1	0	ZNF628	60685072	0.324000	0.24652	0.001000	0.08648	0.007000	0.05969	-0.265000	0.08644	-0.261000	0.09405	-2.335000	0.00248	ACC	A|0.270;G|0.730		0.766	ZNF628-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000317934.2	XM_058964	
ZSCAN18	65982	hgsc.bcm.edu	37	19	58596109	58596109	+	Silent	SNP	A	A	T	rs146022713	byFrequency	TCGA-OR-A5LG-01A-11D-A29I-10	TCGA-OR-A5LG-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a39e8bc9-757d-4536-b301-458fc7ec992d	6b9e8d41-7044-4151-b4d6-e211b0e7a923	g.chr19:58596109A>T	ENST00000240727.6	-	7	1875	c.1476T>A	c.(1474-1476)ggT>ggA	p.G492G	ZSCAN18_ENST00000600404.1_Silent_p.G548G|ZSCAN18_ENST00000601144.1_Silent_p.G492G|ZSCAN18_ENST00000421612.2_Silent_p.G356G	NM_023926.4	NP_076415.3	Q8TBC5	ZSC18_HUMAN	zinc finger and SCAN domain containing 18	492					regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)			NS(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(8)|skin(3)	19		Colorectal(82;0.000256)|all_neural(62;0.0412)|Breast(46;0.114)|Ovarian(87;0.156)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0152)		TCTCTGGGGGACCGCCCGCCC	0.746													A|||	78	0.0155751	0.0008	0.013	5008	,	,		12718	0.003		0.0268	False		,,,				2504	0.0389				p.G548G		.											.	ZSCAN18-90	0			c.T1644A						.	A	,,,	9,4065		0,9,2028	6.0	7.0	7.0		1644,1476,1068,1476	0.6	0.0	19	dbSNP_134	7	125,7919		0,125,3897	no	coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous	ZSCAN18	NM_001145542.1,NM_001145543.1,NM_001145544.1,NM_023926.4	,,,	0,134,5925	TT,TA,AA		1.554,0.2209,1.1058	,,,	548/567,492/511,356/375,492/511	58596109	134,11984	2037	4022	6059	SO:0001819	synonymous_variant	65982	exon7			TGGGGGACCGCCC	AY280799, AY279352	CCDS12971.1, CCDS46214.1, CCDS46215.1	19q13.43	2013-01-09	2007-02-20	2007-02-20		ENSG00000121413		"""-"", ""Zinc fingers, C2H2-type"""	21037	protein-coding gene	gene with protein product			"""zinc finger protein 447"""	ZNF447			Standard	NM_001145542		Approved	FLJ12895	uc010yht.1	Q8TBC5		ENST00000240727.6:c.1476T>A	19.37:g.58596109A>T		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	7	6	NM_001145542	0	0	21	29	8	B4DG23|E9PBI0|Q9BRK7|Q9H9A0	Silent	SNP	ENST00000240727.6	37	CCDS12971.1																																																																																			A|0.990;T|0.010		0.746	ZSCAN18-003	KNOWN	alternative_5_UTR|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000466706.1	NM_023926	
FAM110C	642273	hgsc.bcm.edu	37	2	45895	45895	+	Missense_Mutation	SNP	A	A	G	rs4241318	byFrequency	TCGA-OR-A5LG-01A-11D-A29I-10	TCGA-OR-A5LG-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a39e8bc9-757d-4536-b301-458fc7ec992d	6b9e8d41-7044-4151-b4d6-e211b0e7a923	g.chr2:45895A>G	ENST00000327669.4	-	1	490	c.491T>C	c.(490-492)aTc>aCc	p.I164T	FAM110C_ENST00000460464.1_5'Flank	NM_001077710.2	NP_001071178.2	Q1W6H9	F110C_HUMAN	family with sequence similarity 110, member C	164				I -> T (in Ref. 1; ABD92775). {ECO:0000305}.	positive regulation of cell migration (GO:0030335)|positive regulation of protein kinase B signaling (GO:0051897)|regulation of cell projection assembly (GO:0060491)	cell cortex (GO:0005938)|microtubule (GO:0005874)|nucleus (GO:0005634)	alpha-tubulin binding (GO:0043014)			central_nervous_system(1)|kidney(1)|lung(2)	4	all_hematologic(175;0.0429)|Acute lymphoblastic leukemia(172;0.0627)	all_cancers(51;0.00221)		all cancers(51;0.000815)|Epithelial(75;0.00379)|OV - Ovarian serous cystadenocarcinoma(76;0.0127)|GBM - Glioblastoma multiforme(21;0.232)		GGTCTCGGGGATTGCGGGGTC	0.786													G|||	5004	0.999201	1.0	1.0	5008	,	,		7869	1.0		0.996	False		,,,				2504	1.0				p.I164T		.											.	FAM110C-68	0			c.T491C						.	G	THR/ILE	2781,1		1390,1,0	2.0	3.0	3.0		491	2.7	0.0	2	dbSNP_111	3	6567,21		3273,21,0	no	missense	FAM110C	NM_001077710.2	89	4663,22,0	GG,GA,AA		0.3188,0.0359,0.2348	benign	164/322	45895	9348,22	1391	3294	4685	SO:0001583	missense	642273	exon1			TCGGGGATTGCGG	DQ431183	CCDS42645.1	2p25.3	2011-12-01			ENSG00000184731	ENSG00000184731			33340	protein-coding gene	gene with protein product		611395				17499476, 19698782	Standard	NM_001077710		Approved		uc010yim.2	Q1W6H9	OTTHUMG00000151321	ENST00000327669.4:c.491T>C	2.37:g.45895A>G	ENSP00000328347:p.Ile164Thr	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	11	11	NM_001077710	0	0	0	0	0		Missense_Mutation	SNP	ENST00000327669.4	37	CCDS42645.1	2159	0.9885531135531136	492	1.0	362	1.0	549	0.9597902097902098	756	0.9973614775725593	G	4.848	0.157575	0.09236	0.999641	0.996812	ENSG00000184731	ENST00000327669	T	0.30182	1.54	3.58	2.7	0.31948	.	41.233100	0.00166	N	0.000000	T	0.00012	0.0000	N	0.08118	0	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.35076	-0.9803	9	0.09084	T	0.74	-11.2368	6.0655	0.19862	0.2481:0.0:0.7519:0.0	rs4241318	164	Q1W6H9	F110C_HUMAN	T	164	ENSP00000328347:I164T	ENSP00000328347:I164T	I	-	2	0	FAM110C	35895	0.000000	0.05858	0.001000	0.08648	0.000000	0.00434	-0.401000	0.07232	0.330000	0.23485	-0.222000	0.12452	ATC	A|0.011;G|0.989		0.786	FAM110C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000322220.1	NM_001077710	
TPO	7173	hgsc.bcm.edu	37	2	1481231	1481231	+	Missense_Mutation	SNP	G	G	C	rs2175977	byFrequency	TCGA-OR-A5LG-01A-11D-A29I-10	TCGA-OR-A5LG-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a39e8bc9-757d-4536-b301-458fc7ec992d	6b9e8d41-7044-4151-b4d6-e211b0e7a923	g.chr2:1481231G>C	ENST00000345913.4	+	8	1284	c.1193G>C	c.(1192-1194)aGc>aCc	p.S398T	TPO_ENST00000346956.3_Missense_Mutation_p.S398T|TPO_ENST00000329066.4_Missense_Mutation_p.S398T|TPO_ENST00000382201.3_Missense_Mutation_p.S398T|TPO_ENST00000497517.2_Intron|TPO_ENST00000382198.1_Intron|TPO_ENST00000337415.3_Missense_Mutation_p.S398T|TPO_ENST00000349624.3_Intron	NM_000547.5	NP_000538.3	P07202	PERT_HUMAN	thyroid peroxidase	398			S -> T (in dbSNP:rs2175977). {ECO:0000269|PubMed:7550241}.		cellular nitrogen compound metabolic process (GO:0034641)|embryonic hemopoiesis (GO:0035162)|hormone biosynthetic process (GO:0042446)|hydrogen peroxide catabolic process (GO:0042744)|small molecule metabolic process (GO:0044281)|thyroid hormone generation (GO:0006590)	extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|heme binding (GO:0020037)|iodide peroxidase activity (GO:0004447)|peroxidase activity (GO:0004601)			breast(1)|central_nervous_system(3)|endometrium(8)|kidney(4)|large_intestine(14)|liver(2)|lung(33)|ovary(8)|pancreas(6)|prostate(4)|skin(7)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	95	all_hematologic(175;0.0487)|Acute lymphoblastic leukemia(172;0.0627)	all_cancers(51;0.0338)		all cancers(51;0.0356)|OV - Ovarian serous cystadenocarcinoma(76;0.0748)|Epithelial(75;0.12)	Carbimazole(DB00389)|Dextrothyroxine(DB00509)|Methimazole(DB00763)|Propylthiouracil(DB00550)	GGCCGCGCCAGCGAGGTCCCC	0.761													G|||	3557	0.710264	0.8185	0.6571	5008	,	,		9157	0.7758		0.6034	False		,,,				2504	0.6442				p.S398T		.											.	TPO-332	0			c.G1193C						.	G	THR/SER,THR/SER,THR/SER,THR/SER,THR/SER,	2498,394		1072,354,20	2.0	2.0	2.0		1193,1193,1193,1193,1193,	4.1	1.0	2	dbSNP_96	2	4199,1477		1511,1177,150	no	missense,missense,missense,missense,missense,intron	TPO	NM_000547.5,NM_001206744.1,NM_001206745.1,NM_175719.3,NM_175721.3,NM_175722.3	58,58,58,58,58,	2583,1531,170	CC,CG,GG		26.0218,13.6238,21.8371	probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging,	398/934,398/934,398/877,398/877,398/890,	1481231	6697,1871	1446	2838	4284	SO:0001583	missense	7173	exon8			GCGCCAGCGAGGT		CCDS1643.1, CCDS1644.1, CCDS1646.1	2p25	2008-02-05			ENSG00000115705	ENSG00000115705	1.11.1.7		12015	protein-coding gene	gene with protein product		606765					Standard	NM_175722		Approved	TPX	uc002qww.3	P07202	OTTHUMG00000090271	ENST00000345913.4:c.1193G>C	2.37:g.1481231G>C	ENSP00000318820:p.Ser398Thr	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	16	10	NM_175719	0	0	0	0	0	P09934|P09935|Q8IUL0|Q8NF94|Q8NF95|Q8NF96|Q8NF97|Q8TCI9	Missense_Mutation	SNP	ENST00000345913.4	37	CCDS1643.1	1512|1512	0.6923076923076923|0.6923076923076923	388|388	0.7886178861788617|0.7886178861788617	227|227	0.6270718232044199|0.6270718232044199	438|438	0.7657342657342657|0.7657342657342657	459|459	0.6055408970976254|0.6055408970976254	G|G	18.72|18.72	3.683431|3.683431	0.68157|0.68157	0.863762|0.863762	0.739782|0.739782	ENSG00000115705|ENSG00000115705	ENST00000536482|ENST00000337415;ENST00000345913;ENST00000346956;ENST00000329066;ENST00000382201;ENST00000422464	.|T;T;T;T;T;T	.|0.73897	.|-0.79;-0.79;-0.79;-0.79;-0.79;-0.79	4.99|4.99	4.08|4.08	0.47627|0.47627	.|.	.|0.142496	.|0.64402	.|N	.|0.000004	T|T	0.00012|0.00012	0.0000|0.0000	M|M	0.62723|0.62723	1.935|1.935	0.09310|0.09310	P|P	1.0|1.0	.|D;D;D	.|0.76494	.|0.998;0.998;0.999	.|D;D;D	.|0.69654	.|0.956;0.94;0.965	T|T	0.30060|0.30060	-0.9991|-0.9991	5|9	0.48119|0.56958	T|D	0.1|0.05	-48.0867|-48.0867	8.6411|8.6411	0.33978|0.33978	0.08:0.1541:0.7659:0.0|0.08:0.1541:0.7659:0.0	rs2175977|rs2175977	.|398;398;398	.|P07202-4;P07202-2;P07202	.|.;.;PERT_HUMAN	H|T	81|398;398;398;398;398;327	.|ENSP00000337263:S398T;ENSP00000318820:S398T;ENSP00000263886:S398T;ENSP00000329869:S398T;ENSP00000371636:S398T;ENSP00000405788:S327T	ENSP00000439133:Q81H|ENSP00000329869:S398T	Q|S	+|+	3|2	2|0	TPO|TPO	1460238|1460238	0.956000|0.956000	0.32656|0.32656	1.000000|1.000000	0.80357|0.80357	0.986000|0.986000	0.74619|0.74619	1.297000|1.297000	0.33400|0.33400	1.031000|1.031000	0.39867|0.39867	0.460000|0.460000	0.39030|0.39030	CAG|AGC	G|0.301;C|0.699		0.761	TPO-202	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000206594.2	NM_000547	
PXDN	7837	hgsc.bcm.edu	37	2	1748117	1748117	+	Silent	SNP	C	C	G	rs140134102	byFrequency	TCGA-OR-A5LG-01A-11D-A29I-10	TCGA-OR-A5LG-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a39e8bc9-757d-4536-b301-458fc7ec992d	6b9e8d41-7044-4151-b4d6-e211b0e7a923	g.chr2:1748117C>G	ENST00000252804.4	-	1	161	c.111G>C	c.(109-111)ccG>ccC	p.P37P		NM_012293.1	NP_036425.1	Q92626	PXDN_HUMAN	peroxidasin homolog (Drosophila)	37	LRRNT.				extracellular matrix organization (GO:0030198)|hydrogen peroxide catabolic process (GO:0042744)|immune response (GO:0006955)|negative regulation of cytokine-mediated signaling pathway (GO:0001960)|oxidation-reduction process (GO:0055114)	endoplasmic reticulum (GO:0005783)|extracellular matrix (GO:0031012)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent (GO:0005201)|heme binding (GO:0020037)|interleukin-1 receptor antagonist activity (GO:0005152)|metal ion binding (GO:0046872)|peroxidase activity (GO:0004601)			breast(1)|cervix(3)|endometrium(10)|haematopoietic_and_lymphoid_tissue(3)|kidney(6)|large_intestine(24)|lung(48)|ovary(3)|pancreas(8)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	112	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.0797)	all_cancers(51;0.0845)|Lung NSC(108;0.00641)|all_epithelial(98;0.00716)		all cancers(51;0.0492)|OV - Ovarian serous cystadenocarcinoma(76;0.0973)|Epithelial(75;0.17)|GBM - Glioblastoma multiforme(21;0.228)		GGCAGCGGCTCGGACACCCTG	0.741													C|||	40	0.00798722	0.0008	0.0029	5008	,	,		5766	0.0		0.0169	False		,,,				2504	0.0204				p.P37P		.											.	PXDN-166	0			c.G111C						.	C		3,2193		0,3,1095	2.0	3.0	3.0		111	0.2	0.9	2	dbSNP_134	3	44,4352		0,44,2154	no	coding-synonymous	PXDN	NM_012293.1		0,47,3249	GG,GC,CC		1.0009,0.1366,0.713		37/1480	1748117	47,6545	1098	2198	3296	SO:0001819	synonymous_variant	7837	exon1			GCGGCTCGGACAC	AF200348	CCDS46221.1	2p25.3	2013-01-11			ENSG00000130508	ENSG00000130508		"""Immunoglobulin superfamily / I-set domain containing"""	14966	protein-coding gene	gene with protein product		605158				10441517, 9039502	Standard	XM_005264707		Approved	KIAA0230, PRG2, MG50, D2S448, D2S448E, PXN	uc002qxa.3	Q92626	OTTHUMG00000059697	ENST00000252804.4:c.111G>C	2.37:g.1748117C>G		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	11	7	NM_012293	0	0	0	0	0	A8QM65|D6W4Y0|Q4KMG2	Silent	SNP	ENST00000252804.4	37	CCDS46221.1	73	0.033424908424908424	38	0.07723577235772358	5	0.013812154696132596	8	0.013986013986013986	22	0.029023746701846966	C	7.645	0.681689	0.14907	0.001366	0.010009	ENSG00000130508	ENST00000433670	.	.	.	3.27	0.21	0.15231	.	.	.	.	.	T	0.05181	0.0138	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.02263	-1.1186	4	.	.	.	-15.6545	6.8475	0.23996	0.0:0.3866:0.3554:0.2579	.	.	.	.	P	33	.	.	R	-	2	0	PXDN	1727124	0.988000	0.35896	0.940000	0.37924	0.474000	0.32979	0.122000	0.15687	-0.317000	0.08677	-0.450000	0.05554	CGA	C|0.967;G|0.033		0.741	PXDN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000322505.1	XM_056455	
HEATR5B	54497	bcgsc.ca	37	2	37280711	37280711	+	Silent	SNP	T	T	C	rs10202107	byFrequency	TCGA-OR-A5LG-01A-11D-A29I-10	TCGA-OR-A5LG-10A-01D-A29L-10	T	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a39e8bc9-757d-4536-b301-458fc7ec992d	6b9e8d41-7044-4151-b4d6-e211b0e7a923	g.chr2:37280711T>C	ENST00000233099.5	-	17	2534	c.2439A>G	c.(2437-2439)caA>caG	p.Q813Q	HEATR5B_ENST00000354531.2_Silent_p.Q813Q	NM_019024.1	NP_061897.1	Q9P2D3	HTR5B_HUMAN	HEAT repeat containing 5B	813						extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)				breast(3)|cervix(3)|endometrium(3)|kidney(3)|large_intestine(11)|lung(31)|ovary(5)|pancreas(1)|prostate(1)|skin(10)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	77		all_hematologic(82;0.21)				CACCTTTAGCTTGTTTAACAC	0.313													T|||	56	0.0111821	0.0416	0.0014	5008	,	,		17495	0.0		0.0	False		,,,				2504	0.0				p.Q813Q		.											.	HEATR5B-142	0			c.A2439G						.	T		121,4285	91.1+/-129.8	2,117,2084	56.0	57.0	57.0		2439	2.3	1.0	2	dbSNP_119	57	0,8600		0,0,4300	no	coding-synonymous	HEATR5B	NM_019024.1		2,117,6384	CC,CT,TT		0.0,2.7463,0.9303		813/2072	37280711	121,12885	2203	4300	6503	SO:0001819	synonymous_variant	54497	exon17			TTTAGCTTGTTTA	AB037835	CCDS33181.1	2p22.2	2007-01-02			ENSG00000008869	ENSG00000008869			29273	protein-coding gene	gene with protein product						10718198	Standard	XM_005264379		Approved	KIAA1414, DKFZp686P15184	uc002rpp.1	Q9P2D3	OTTHUMG00000152158	ENST00000233099.5:c.2439A>G	2.37:g.37280711T>C		Somatic	249	0		WXS	Illumina GAIIx	Phase_I	162	7	NM_019024	0	0	1	1	0	B5MDU8|Q7Z3B2|Q9NVL7	Silent	SNP	ENST00000233099.5	37	CCDS33181.1																																																																																			T|0.989;C|0.011		0.313	HEATR5B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000325492.1	NM_019024	
SOS1	6654	bcgsc.ca	37	2	39294787	39294787	+	Silent	SNP	T	T	G	rs7609455	byFrequency	TCGA-OR-A5LG-01A-11D-A29I-10	TCGA-OR-A5LG-10A-01D-A29L-10	T	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a39e8bc9-757d-4536-b301-458fc7ec992d	6b9e8d41-7044-4151-b4d6-e211b0e7a923	g.chr2:39294787T>G	ENST00000426016.1	-	3	281	c.195A>C	c.(193-195)cgA>cgC	p.R65R	SOS1_ENST00000395038.2_Silent_p.R65R|SOS1_ENST00000428721.2_Silent_p.R8R|SOS1_ENST00000402219.2_Silent_p.R65R			Q07889	SOS1_HUMAN	son of sevenless homolog 1 (Drosophila)	65					apoptotic signaling pathway (GO:0097190)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|leukocyte migration (GO:0050900)|neurotrophin TRK receptor signaling pathway (GO:0048011)|platelet activation (GO:0030168)|positive regulation of apoptotic process (GO:0043065)|positive regulation of epidermal growth factor receptor signaling pathway (GO:0045742)|positive regulation of Ras GTPase activity (GO:0032320)|positive regulation of Rho GTPase activity (GO:0032321)|positive regulation of small GTPase mediated signal transduction (GO:0051057)|Ras protein signal transduction (GO:0007265)|regulation of small GTPase mediated signal transduction (GO:0051056)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)	DNA binding (GO:0003677)|Ras guanyl-nucleotide exchange factor activity (GO:0005088)|Rho GTPase activator activity (GO:0005100)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			autonomic_ganglia(1)|breast(6)|central_nervous_system(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(9)|liver(1)|lung(29)|ovary(4)|prostate(1)|skin(4)|stomach(1)|urinary_tract(2)	75		all_hematologic(82;0.21)				CTGAAGCACTTCGGGGCTGAG	0.363									Noonan syndrome				t|||	249	0.0497204	0.1286	0.0576	5008	,	,		16835	0.0288		0.001	False		,,,				2504	0.0092				p.R65R		.											.	SOS1-851	0			c.A195C						.	T		512,3894	233.3+/-246.5	27,458,1718	135.0	151.0	146.0		195	3.1	1.0	2	dbSNP_116	146	5,8595	2.2+/-6.3	0,5,4295	no	coding-synonymous	SOS1	NM_005633.3		27,463,6013	GG,GT,TT		0.0581,11.6205,3.9751		65/1334	39294787	517,12489	2203	4300	6503	SO:0001819	synonymous_variant	6654	exon2	Familial Cancer Database	Male Turner syndrome, Pterygium Colli syndrome, incl. Noonan-like/Multiple Giant Cell Lesion syndrome; Noonan s. with multiple lentigines/LEOPARD syndrome	AGCACTTCGGGGC	L13857	CCDS1802.1	2p21	2014-09-17	2002-11-05		ENSG00000115904	ENSG00000115904		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	11187	protein-coding gene	gene with protein product		182530	"""gingival fibromatosis, hereditary, 1"""	GINGF		8276400, 10995566	Standard	NM_005633		Approved	HGF, GF1	uc002rrk.4	Q07889	OTTHUMG00000102109	ENST00000426016.1:c.195A>C	2.37:g.39294787T>G		Somatic	140	1		WXS	Illumina GAIIx	Phase_I	117	5	NM_005633	0	0	0	0	0	A8K2G3|B4DXG2	Silent	SNP	ENST00000426016.1	37	CCDS1802.1																																																																																			T|0.953;G|0.047		0.363	SOS1-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219948.3	NM_005633	
CEP68	23177	broad.mit.edu	37	2	65296662	65296662	+	Missense_Mutation	SNP	G	G	T			TCGA-OR-A5LG-01A-11D-A29I-10	TCGA-OR-A5LG-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a39e8bc9-757d-4536-b301-458fc7ec992d	6b9e8d41-7044-4151-b4d6-e211b0e7a923	g.chr2:65296662G>T	ENST00000377990.2	+	2	287	c.84G>T	c.(82-84)gaG>gaT	p.E28D	CEP68_ENST00000537589.1_Intron|RAB1A_ENST00000494188.1_5'Flank|CEP68_ENST00000546106.1_Missense_Mutation_p.E28D|CEP68_ENST00000260569.4_Missense_Mutation_p.E28D	NM_015147.2	NP_055962.2	Q76N32	CEP68_HUMAN	centrosomal protein 68kDa	28					centriole-centriole cohesion (GO:0010457)|centrosome organization (GO:0051297)|protein localization to organelle (GO:0033365)	centrosome (GO:0005813)|cytoplasm (GO:0005737)	protein domain specific binding (GO:0019904)|protein kinase binding (GO:0019901)			breast(1)|endometrium(6)|kidney(8)|large_intestine(5)|lung(8)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	32						GCTGCAGGGAGCGGGAGCTGG	0.617																																					p.E28D		.											.	CEP68-91	0			c.G84T						.						41.0	49.0	46.0					2																	65296662		2203	4300	6503	SO:0001583	missense	23177	exon2			CAGGGAGCGGGAG	BC004873	CCDS1880.2	2p14	2014-02-20	2005-12-01	2005-12-01	ENSG00000011523	ENSG00000011523			29076	protein-coding gene	gene with protein product			"""KIAA0582"""	KIAA0582		9628581, 9847074, 14654843	Standard	NM_015147		Approved		uc002sdl.4	Q76N32	OTTHUMG00000129538	ENST00000377990.2:c.84G>T	2.37:g.65296662G>T	ENSP00000367229:p.Glu28Asp	Somatic	142	0		WXS	Illumina GAIIx	Phase_I	92	5	NM_015147	0	0	5	5	0	B4DRQ1|D6W5F1|D6W5F2|O60326|Q9BQ18|Q9UDM9	Missense_Mutation	SNP	ENST00000377990.2	37	CCDS1880.2	.	.	.	.	.	.	.	.	.	.	G	11.00	1.509376	0.27036	.	.	ENSG00000011523	ENST00000377990;ENST00000546106;ENST00000260569	T;T;T	0.24908	1.83;1.83;1.83	3.91	2.1	0.27182	.	0.788107	0.11253	N	0.583438	T	0.18467	0.0443	L	0.32530	0.975	0.22581	N	0.998964	B;B;B;B;B	0.02656	0.0;0.0;0.0;0.0;0.0	B;B;B;B;B	0.12156	0.003;0.003;0.003;0.003;0.007	T	0.22800	-1.0206	10	0.34782	T	0.22	-3.3686	7.6079	0.28113	0.0:0.3469:0.4743:0.1788	.	28;28;28;28;28	F5H3N9;F5H2Y2;Q76N32;Q76N32-2;Q05C09	.;.;CEP68_HUMAN;.;.	D	28	ENSP00000367229:E28D;ENSP00000438306:E28D;ENSP00000260569:E28D	ENSP00000260569:E28D	E	+	3	2	CEP68	65150166	0.254000	0.23992	0.287000	0.24848	0.007000	0.05969	0.087000	0.14958	0.633000	0.30452	-0.122000	0.15005	GAG	.		0.617	CEP68-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251727.2	NM_015147	
NOTO	344022	hgsc.bcm.edu	37	2	73429808	73429808	+	Missense_Mutation	SNP	G	G	C	rs1864492	byFrequency	TCGA-OR-A5LG-01A-11D-A29I-10	TCGA-OR-A5LG-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a39e8bc9-757d-4536-b301-458fc7ec992d	6b9e8d41-7044-4151-b4d6-e211b0e7a923	g.chr2:73429808G>C	ENST00000398468.3	+	1	423	c.14G>C	c.(13-15)aGg>aCg	p.R5T		NM_001134462.1	NP_001127934.1	A8MTQ0	NOTO_HUMAN	notochord homeobox	5	Pro-rich.		R -> T (in dbSNP:rs1864492).		cilium morphogenesis (GO:0060271)|determination of left/right symmetry (GO:0007368)|dorsal/ventral pattern formation (GO:0009953)|embryonic pattern specification (GO:0009880)|notochord development (GO:0030903)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)			endometrium(2)	2						CCTAGCCCCAGGCCGCGAGGC	0.701													G|||	1106	0.220847	0.1051	0.2536	5008	,	,		11647	0.373		0.2336	False		,,,				2504	0.184				p.R5T		.											.	.	0			c.G14C						.						1.0	2.0	2.0					2																	73429808		396	1121	1517	SO:0001583	missense	344022	exon1			GCCCCAGGCCGCG		CCDS46335.1	2p13.2	2011-06-20	2007-02-15		ENSG00000214513	ENSG00000214513		"""Homeoboxes / ANTP class : NKL subclass"""	31839	protein-coding gene	gene with protein product			"""notochord homolog (Xenopus laevis)"""			15231714	Standard	NM_001134462		Approved		uc010yrd.2	A8MTQ0	OTTHUMG00000164128	ENST00000398468.3:c.14G>C	2.37:g.73429808G>C	ENSP00000381486:p.Arg5Thr	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	11	10	NM_001134462	0	0	0	0	0	B4DJ59|B7ZAU5	Missense_Mutation	SNP	ENST00000398468.3	37	CCDS46335.1	556	0.25457875457875456	57	0.11585365853658537	105	0.2900552486187845	227	0.3968531468531469	167	0.22031662269129287	G	8.560	0.877489	0.17395	.	.	ENSG00000214513	ENST00000398468	D	0.91894	-2.93	2.33	-2.63	0.06133	.	.	.	.	.	T	0.00012	0.0000	N	0.14661	0.345	0.80722	P	0.0	B	0.12013	0.005	B	0.13407	0.009	T	0.16188	-1.0411	8	0.11182	T	0.66	.	0.8927	0.01257	0.1438:0.1955:0.2657:0.395	rs1864492	5	A8MTQ0	NOTO_HUMAN	T	5	ENSP00000381486:R5T	ENSP00000381486:R5T	R	+	2	0	NOTO	73283316	0.001000	0.12720	0.000000	0.03702	0.047000	0.14425	-0.508000	0.06344	-0.728000	0.04882	0.491000	0.48974	AGG	G|0.286;C|0.714		0.701	NOTO-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377385.2	XM_292889	
CD8B	926	hgsc.bcm.edu	37	2	87088964	87088964	+	Silent	SNP	A	A	G	rs62146888	byFrequency	TCGA-OR-A5LG-01A-11D-A29I-10	TCGA-OR-A5LG-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a39e8bc9-757d-4536-b301-458fc7ec992d	6b9e8d41-7044-4151-b4d6-e211b0e7a923	g.chr2:87088964A>G	ENST00000390655.6	-	1	83	c.25T>C	c.(25-27)Ttg>Ctg	p.L9L	CD8B_ENST00000393761.2_Silent_p.L9L|CD8B_ENST00000331469.2_Silent_p.L9L|AC111200.1_ENST00000441646.1_5'Flank|CD8B_ENST00000349455.3_Silent_p.L9L|CD8B_ENST00000393759.2_Silent_p.L9L|CD8B_ENST00000431506.2_Silent_p.L9L	NM_004931.4	NP_004922.1	P10966	CD8B_HUMAN	CD8b molecule	9					immune response (GO:0006955)|regulation of defense response to virus by virus (GO:0050690)|regulation of immune response (GO:0050776)|T cell activation (GO:0042110)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|viral process (GO:0016032)	early endosome membrane (GO:0031901)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|T cell receptor complex (GO:0042101)	coreceptor activity (GO:0015026)|MHC class I protein binding (GO:0042288)			NS(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(6)|skin(1)|upper_aerodigestive_tract(1)	13						TGCGCGGCCAAGAGGAGCCAC	0.756													G|||	2559	0.510982	0.6626	0.3862	5008	,	,		7474	0.5427		0.4672	False		,,,				2504	0.407				p.L9L		.											.	CD8B-92	0			c.T25C						.						1.0	1.0	1.0					2																	87088964		543	1520	2063	SO:0001819	synonymous_variant	926	exon1			CGGCCAAGAGGAG		CCDS1994.1, CCDS1995.1, CCDS42708.1, CCDS1997.1, CCDS54376.1	2p12	2013-01-11	2006-03-28	2006-03-09	ENSG00000172116	ENSG00000172116		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"""	1707	protein-coding gene	gene with protein product		186730	"""CD8 antigen, beta polypeptide 1 (p37)"""	CD8B1		1541829	Standard	NM_172213		Approved		uc002srw.3	P10966	OTTHUMG00000130264	ENST00000390655.6:c.25T>C	2.37:g.87088964A>G		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	7	7	NM_004931	0	0	0	0	0	P14860|P14861|Q15980|Q496E0|Q496E1|Q496E2|Q9UDB4|Q9UDB5|Q9UDB6|Q9UDB7|Q9UDB8|Q9UDB9|Q9UDC0|Q9UQ55	Silent	SNP	ENST00000390655.6	37	CCDS1997.1																																																																																			A|0.476;G|0.524		0.756	CD8B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000330402.1	NM_172099	
SH3RF3	344558	hgsc.bcm.edu	37	2	109746039	109746039	+	Missense_Mutation	SNP	G	G	A	rs34609468	byFrequency	TCGA-OR-A5LG-01A-11D-A29I-10	TCGA-OR-A5LG-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a39e8bc9-757d-4536-b301-458fc7ec992d	6b9e8d41-7044-4151-b4d6-e211b0e7a923	g.chr2:109746039G>A	ENST00000309415.6	+	1	43	c.43G>A	c.(43-45)Gcc>Acc	p.A15T	SH3RF3-AS1_ENST00000567491.1_lincRNA	NM_001099289.1	NP_001092759.1	Q8TEJ3	SH3R3_HUMAN	SH3 domain containing ring finger 3	15							zinc ion binding (GO:0008270)			endometrium(2)|kidney(1)|large_intestine(6)|liver(2)|lung(5)|ovary(2)	18						CAAGGCGGCCGCCGCTGCTGC	0.786													G|||	623	0.124401	0.028	0.1427	5008	,	,		9489	0.1022		0.2435	False		,,,				2504	0.1421				p.A15T		.											.	SH3RF3-24	0			c.G43A						.						2.0	2.0	2.0					2																	109746039		698	1564	2262	SO:0001583	missense	344558	exon1			GCGGCCGCCGCTG	AK074131	CCDS74557.1	2q13	2013-01-11	2008-05-14	2008-05-14	ENSG00000172985	ENSG00000172985		"""RING-type (C3HC4) zinc fingers"""	24699	protein-coding gene	gene with protein product			"""SH3 multiple domains 4"""	SH3MD4		16374509	Standard	XM_006712493		Approved	FLJ00204, POSH2	uc010ywt.1	Q8TEJ3	OTTHUMG00000153439	ENST00000309415.6:c.43G>A	2.37:g.109746039G>A	ENSP00000309186:p.Ala15Thr	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	6	6	NM_001099289	0	0	0	0	0	A0SDZ7|A8MPR1|Q8NDU1	Missense_Mutation	SNP	ENST00000309415.6	37		344	0.1575091575091575	30	0.06097560975609756	57	0.1574585635359116	59	0.10314685314685315	198	0.2612137203166227	g	34	5.331010	0.95733	.	.	ENSG00000172985	ENST00000418513;ENST00000309415	T;T	0.57107	0.42;2.16	3.65	3.65	0.41850	.	.	.	.	.	T	0.00012	0.0000	.	.	.	0.37164	P	0.09728800000000004	D	0.71674	0.998	P	0.54629	0.757	T	0.04191	-1.0970	7	0.66056	D	0.02	.	14.1116	0.65123	0.0:0.0:1.0:0.0	rs34609468	15	Q8TEJ3	SH3R3_HUMAN	T	15	ENSP00000414997:A15T;ENSP00000309186:A15T	ENSP00000309186:A15T	A	+	1	0	SH3RF3	109112471	0.976000	0.34144	0.997000	0.53966	0.923000	0.55619	3.218000	0.51192	1.579000	0.49836	0.298000	0.19748	GCC	G|0.842;A|0.158		0.786	SH3RF3-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_001099289	
SOWAHC	65124	hgsc.bcm.edu	37	2	110372192	110372192	+	Silent	SNP	A	A	G	rs6594048		TCGA-OR-A5LG-01A-11D-A29I-10	TCGA-OR-A5LG-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a39e8bc9-757d-4536-b301-458fc7ec992d	6b9e8d41-7044-4151-b4d6-e211b0e7a923	g.chr2:110372192A>G	ENST00000356454.3	+	1	282	c.126A>G	c.(124-126)ctA>ctG	p.L42L	SEPT10_ENST00000397714.2_5'Flank|SEPT10_ENST00000334001.6_5'Flank|SEPT10_ENST00000397712.2_5'Flank|SEPT10_ENST00000437928.1_5'Flank|SEPT10_ENST00000356688.4_5'Flank|SEPT10_ENST00000545389.1_5'Flank|SEPT10_ENST00000415095.1_5'Flank	NM_023016.3	NP_075392.2	Q53LP3	SWAHC_HUMAN	sosondowah ankyrin repeat domain family member C	42																	GGGGCGCCCTAGGCGGCGAAC	0.771													G|||	5008	1.0	1.0	1.0	5008	,	,		6158	1.0		1.0	False		,,,				2504	1.0				p.L42L		.											.	.	0			c.A126G						.						1.0	2.0	2.0					2																	110372192		1239	2477	3716	SO:0001819	synonymous_variant	65124	exon1			CGCCCTAGGCGGC	AK023346	CCDS33270.1	2q13	2013-01-10	2012-01-12	2012-01-12	ENSG00000198142	ENSG00000198142		"""Ankyrin repeat domain containing"""	26149	protein-coding gene	gene with protein product			"""ankyrin repeat domain 57"""	C2orf26, ANKRD57		22234889	Standard	NM_023016		Approved	FLJ21870	uc002tfb.3	Q53LP3	OTTHUMG00000153219	ENST00000356454.3:c.126A>G	2.37:g.110372192A>G		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	21	21	NM_023016	0	0	0	0	0	Q8NE15|Q9H6U1	Silent	SNP	ENST00000356454.3	37	CCDS33270.1																																																																																			A|0.029;G|0.971		0.771	SOWAHC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000330168.1	NM_023016	
C1QL2	165257	hgsc.bcm.edu	37	2	119915509	119915509	+	Silent	SNP	G	G	T	rs1317848	byFrequency	TCGA-OR-A5LG-01A-11D-A29I-10	TCGA-OR-A5LG-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a39e8bc9-757d-4536-b301-458fc7ec992d	6b9e8d41-7044-4151-b4d6-e211b0e7a923	g.chr2:119915509G>T	ENST00000272520.3	-	1	956	c.337C>A	c.(337-339)Cgg>Agg	p.R113R		NM_182528.3	NP_872334.2	Q7Z5L3	C1QL2_HUMAN	complement component 1, q subcomponent-like 2	113	Collagen-like.				protein oligomerization (GO:0051259)	collagen trimer (GO:0005581)|extracellular region (GO:0005576)				NS(1)|endometrium(1)|large_intestine(3)|pancreas(1)|prostate(1)	7						AGCCCGGGCCGCCCCGAGTCG	0.796										HNSCC(49;0.14)			G|||	1430	0.285543	0.0938	0.1859	5008	,	,		8271	0.5982		0.2565	False		,,,				2504	0.3231				p.R113R		.											.	C1QL2-91	0			c.C337A						.	G		209,1941		13,183,879	2.0	2.0	2.0		337	-3.2	0.6	2	dbSNP_88	2	955,4379		99,757,1811	no	coding-synonymous	C1QL2	NM_182528.3		112,940,2690	TT,TG,GG		17.904,9.7209,15.5532		113/288	119915509	1164,6320	1075	2667	3742	SO:0001819	synonymous_variant	165257	exon1			CGGGCCGCCCCGA	AF525315	CCDS42737.1	2q14.2	2009-05-20			ENSG00000144119	ENSG00000144119			24181	protein-coding gene	gene with protein product	"""C1q and tumor necrosis factor related protein 10"""	614330				18783346	Standard	NM_182528		Approved	CTRP10, C1QTNF10	uc002tlo.2	Q7Z5L3	OTTHUMG00000153271	ENST00000272520.3:c.337C>A	2.37:g.119915509G>T		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	20	15	NM_182528	0	0	0	0	0		Silent	SNP	ENST00000272520.3	37	CCDS42737.1																																																																																			G|0.681;T|0.319		0.796	C1QL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000330527.2	NM_182528	
MYO7B	4648	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	2	128394466	128394466	+	Missense_Mutation	SNP	G	G	T			TCGA-OR-A5LG-01A-11D-A29I-10	TCGA-OR-A5LG-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a39e8bc9-757d-4536-b301-458fc7ec992d	6b9e8d41-7044-4151-b4d6-e211b0e7a923	g.chr2:128394466G>T	ENST00000409816.2	+	45	6259	c.6227G>T	c.(6226-6228)cGc>cTc	p.R2076L	MYO7B_ENST00000428314.1_Missense_Mutation_p.R2076L|MYO7B_ENST00000409090.1_Missense_Mutation_p.R929L|LIMS2_ENST00000494613.1_5'Flank|MYO7B_ENST00000389524.4_Missense_Mutation_p.R2077L			Q6PIF6	MYO7B_HUMAN	myosin VIIB	2076	FERM 2. {ECO:0000255|PROSITE- ProRule:PRU00084}.					extracellular vesicular exosome (GO:0070062)|myosin complex (GO:0016459)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|motor activity (GO:0003774)			breast(2)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(3)|lung(46)|ovary(3)|pancreas(1)|prostate(3)|urinary_tract(1)	75	Colorectal(110;0.1)			BRCA - Breast invasive adenocarcinoma(221;0.0753)		CGTGGCAGCCGCCTGCTGTGC	0.622																																					p.R2076L		.											.	MYO7B-47	0			c.G6227T						.						50.0	61.0	57.0					2																	128394466		2110	4234	6344	SO:0001583	missense	4648	exon46			GCAGCCGCCTGCT		CCDS46405.1	2q21.1	2011-09-27			ENSG00000169994	ENSG00000169994		"""Myosins / Myosin superfamily : Class VII"""	7607	protein-coding gene	gene with protein product		606541				8022818, 8884266	Standard	NM_001080527		Approved		uc002top.3	Q6PIF6	OTTHUMG00000153419	ENST00000409816.2:c.6227G>T	2.37:g.128394466G>T	ENSP00000386461:p.Arg2076Leu	Somatic	59	0		WXS	Illumina GAIIx	Phase_I	63	4	NM_001080527	0	0	2	2	0	Q14786|Q8TEE1	Missense_Mutation	SNP	ENST00000409816.2	37	CCDS46405.1	.	.	.	.	.	.	.	.	.	.	g	20.5	4.003146	0.74932	.	.	ENSG00000169994	ENST00000389524;ENST00000428314;ENST00000409816;ENST00000409090	T;T;T;T	0.71698	-0.59;-0.59;-0.59;-0.59	5.21	5.21	0.72293	FERM domain (1);Pleckstrin homology-type (1);	0.061993	0.64402	D	0.000004	T	0.73385	0.3580	M	0.69823	2.125	0.42430	D	0.992678	P;P	0.52842	0.956;0.875	P;B	0.47346	0.544;0.44	T	0.77993	-0.2378	10	0.72032	D	0.01	.	12.4889	0.55889	0.0773:0.0:0.9227:0.0	.	991;2076	B0I1T4;Q6PIF6	.;MYO7B_HUMAN	L	2077;2076;2076;929	ENSP00000374175:R2077L;ENSP00000415090:R2076L;ENSP00000386461:R2076L;ENSP00000386850:R929L	ENSP00000374175:R2077L	R	+	2	0	MYO7B	128110936	1.000000	0.71417	0.996000	0.52242	0.952000	0.60782	5.855000	0.69510	2.597000	0.87782	0.585000	0.79938	CGC	.		0.622	MYO7B-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000331124.3	XM_291001	
SCN7A	6332	broad.mit.edu;bcgsc.ca	37	2	167263141	167263141	+	Missense_Mutation	SNP	A	A	G			TCGA-OR-A5LG-01A-11D-A29I-10	TCGA-OR-A5LG-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a39e8bc9-757d-4536-b301-458fc7ec992d	6b9e8d41-7044-4151-b4d6-e211b0e7a923	g.chr2:167263141A>G	ENST00000409855.1	-	25	4124	c.3998T>C	c.(3997-3999)aTg>aCg	p.M1333T		NM_002976.3	NP_002967.2	Q01118	SCN7A_HUMAN	sodium channel, voltage-gated, type VII, alpha subunit	1333					membrane depolarization during action potential (GO:0086010)|muscle contraction (GO:0006936)|neuronal action potential (GO:0019228)|sodium ion homeostasis (GO:0055078)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	glial cell projection (GO:0097386)|plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(1)|lung(30)|prostate(4)|soft_tissue(1)|urinary_tract(1)	44					Valproic Acid(DB00313)	TCCTACTGTCATAGGCAGACA	0.403																																					p.M1333T		.											.	SCN7A-67	0			c.T3998C						.						92.0	87.0	88.0					2																	167263141		1932	4127	6059	SO:0001583	missense	6332	exon25			ACTGTCATAGGCA	M91556	CCDS46442.1	2q21-q23	2012-03-05	2012-02-28	2002-06-14	ENSG00000136546	ENSG00000136546		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10594	protein-coding gene	gene with protein product		182392	"""sodium channel, voltage-gated, type VI, alpha"", ""sodium channel, voltage-gated, type VII, alpha"""	SCN6A		10198179	Standard	NM_002976		Approved	Nav2.1, Nav2.2, NaG	uc002udu.2	Q01118	OTTHUMG00000154078	ENST00000409855.1:c.3998T>C	2.37:g.167263141A>G	ENSP00000386796:p.Met1333Thr	Somatic	208	0		WXS	Illumina GAIIx	Phase_I	243	9	NM_002976	0	0	0	0	0		Missense_Mutation	SNP	ENST00000409855.1	37	CCDS46442.1	.	.	.	.	.	.	.	.	.	.	A	11.82	1.753733	0.31046	.	.	ENSG00000136546	ENST00000409855;ENST00000259060	D	0.98296	-4.85	4.53	0.371	0.16168	Ion transport (1);	1.480890	0.03898	N	0.279783	D	0.94535	0.8240	N	0.22421	0.69	0.09310	N	1	B	0.25048	0.117	B	0.24701	0.055	D	0.88841	0.3312	10	0.39692	T	0.17	.	2.9758	0.05937	0.4253:0.0:0.2078:0.3669	.	1333	Q01118	SCN7A_HUMAN	T	1333	ENSP00000386796:M1333T	ENSP00000259060:M1333T	M	-	2	0	SCN7A	166971387	0.001000	0.12720	0.003000	0.11579	0.728000	0.41692	1.463000	0.35277	0.044000	0.15775	0.533000	0.62120	ATG	.		0.403	SCN7A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000333745.1		
SCN7A	6332	broad.mit.edu	37	2	167273276	167273276	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5LG-01A-11D-A29I-10	TCGA-OR-A5LG-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a39e8bc9-757d-4536-b301-458fc7ec992d	6b9e8d41-7044-4151-b4d6-e211b0e7a923	g.chr2:167273276C>T	ENST00000409855.1	-	20	3481	c.3355G>A	c.(3355-3357)Gaa>Aaa	p.E1119K		NM_002976.3	NP_002967.2	Q01118	SCN7A_HUMAN	sodium channel, voltage-gated, type VII, alpha subunit	1119					membrane depolarization during action potential (GO:0086010)|muscle contraction (GO:0006936)|neuronal action potential (GO:0019228)|sodium ion homeostasis (GO:0055078)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	glial cell projection (GO:0097386)|plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(1)|lung(30)|prostate(4)|soft_tissue(1)|urinary_tract(1)	44					Valproic Acid(DB00313)	TTTGCATTTTCCCATAGCATG	0.348																																					p.E1119K		.											.	SCN7A-67	0			c.G3355A						.						87.0	78.0	81.0					2																	167273276		1854	4098	5952	SO:0001583	missense	6332	exon20			CATTTTCCCATAG	M91556	CCDS46442.1	2q21-q23	2012-03-05	2012-02-28	2002-06-14	ENSG00000136546	ENSG00000136546		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10594	protein-coding gene	gene with protein product		182392	"""sodium channel, voltage-gated, type VI, alpha"", ""sodium channel, voltage-gated, type VII, alpha"""	SCN6A		10198179	Standard	NM_002976		Approved	Nav2.1, Nav2.2, NaG	uc002udu.2	Q01118	OTTHUMG00000154078	ENST00000409855.1:c.3355G>A	2.37:g.167273276C>T	ENSP00000386796:p.Glu1119Lys	Somatic	264	0		WXS	Illumina GAIIx	Phase_I	284	8	NM_002976	0	0	0	0	0		Missense_Mutation	SNP	ENST00000409855.1	37	CCDS46442.1	.	.	.	.	.	.	.	.	.	.	C	1.673	-0.508541	0.04231	.	.	ENSG00000136546	ENST00000409855;ENST00000259060	D	0.98493	-4.96	4.87	0.52	0.17040	Ion transport (1);	0.391809	0.21612	N	0.071766	D	0.92469	0.7609	N	0.17764	0.52	0.32823	D	0.502974	B	0.13594	0.008	B	0.18263	0.021	D	0.85655	0.1285	10	0.02654	T	1	.	7.8041	0.29191	0.0:0.4703:0.0:0.5297	.	1119	Q01118	SCN7A_HUMAN	K	1119	ENSP00000386796:E1119K	ENSP00000259060:E1119K	E	-	1	0	SCN7A	166981522	0.000000	0.05858	1.000000	0.80357	0.647000	0.38526	-0.342000	0.07801	0.148000	0.19059	-0.145000	0.13849	GAA	.		0.348	SCN7A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000333745.1		
SIRPD	128646	broad.mit.edu;mdanderson.org	37	20	1515083	1515083	+	Missense_Mutation	SNP	C	C	A			TCGA-OR-A5LG-01A-11D-A29I-10	TCGA-OR-A5LG-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a39e8bc9-757d-4536-b301-458fc7ec992d	6b9e8d41-7044-4151-b4d6-e211b0e7a923	g.chr20:1515083C>A	ENST00000381623.3	-	4	1771	c.582G>T	c.(580-582)ttG>ttT	p.L194F	SIRPD_ENST00000381621.1_Missense_Mutation_p.L195F			Q9H106	SIRPD_HUMAN	signal-regulatory protein delta	194						extracellular region (GO:0005576)				breast(1)|kidney(2)|large_intestine(3)|lung(6)|ovary(2)|skin(1)	15						ATTTTGACAGCAAGCCTGAAA	0.353																																					p.L194F		.											.	SIRPD-227	0			c.G582T						.						136.0	130.0	132.0					20																	1515083		2203	4300	6503	SO:0001583	missense	128646	exon4			TGACAGCAAGCCT	AL049634	CCDS13018.1	20p13	2013-01-11	2006-02-03	2006-02-03	ENSG00000125900	ENSG00000125900		"""Signal-regulatory proteins"", ""Immunoglobulin superfamily / V-set domain containing"""	16248	protein-coding gene	gene with protein product			"""protein tyrosine phosphatase, non-receptor type substrate 1-like 2"""	PTPNS1L2		16339511	Standard	NM_178460		Approved	dJ576H24.4	uc002wfi.3	Q9H106	OTTHUMG00000031674	ENST00000381623.3:c.582G>T	20.37:g.1515083C>A	ENSP00000371036:p.Leu194Phe	Somatic	21	0		WXS	Illumina GAIIx	Phase_I	20	7	NM_178460	0	0	0	0	0	B3KS88|Q5TFQ6	Missense_Mutation	SNP	ENST00000381623.3	37	CCDS13018.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	1.533|1.533	-0.543912|-0.543912	0.04053|0.04053	.|.	.|.	ENSG00000125900|ENSG00000125900	ENST00000429387|ENST00000381623;ENST00000381621	.|T;T	.|0.02498	.|4.27;4.32	1.93|1.93	0.93|0.93	0.19454|0.19454	.|.	.|0.945467	.|0.08533	.|N	.|0.931747	T|T	0.01905|0.01905	0.0060|0.0060	N|N	0.08118|0.08118	0|0	0.09310|0.09310	N|N	1|1	.|B	.|0.12013	.|0.005	.|B	.|0.12156	.|0.007	T|T	0.46596|0.46596	-0.9180|-0.9180	5|10	.|0.87932	.|D	.|0	.|.	6.1925|6.1925	0.20532|0.20532	0.0:0.6796:0.3204:0.0|0.0:0.6796:0.3204:0.0	.|.	.|194	.|Q9H106	.|SIRPD_HUMAN	F|F	77|194;195	.|ENSP00000371036:L194F;ENSP00000371034:L195F	.|ENSP00000371034:L195F	C|L	-|-	2|3	0|2	SIRPD|SIRPD	1463083|1463083	0.001000|0.001000	0.12720|0.12720	0.001000|0.001000	0.08648|0.08648	0.075000|0.075000	0.17131|0.17131	0.344000|0.344000	0.19962|0.19962	0.350000|0.350000	0.24002|0.24002	-0.693000|-0.693000	0.03709|0.03709	TGC|TTG	.		0.353	SIRPD-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000077552.1	NM_178460	
CFAP61	26074	ucsc.edu;bcgsc.ca	37	20	20123574	20123574	+	Silent	SNP	T	T	C			TCGA-OR-A5LG-01A-11D-A29I-10	TCGA-OR-A5LG-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a39e8bc9-757d-4536-b301-458fc7ec992d	6b9e8d41-7044-4151-b4d6-e211b0e7a923	g.chr20:20123574T>C	ENST00000245957.5	+	9	1009	c.933T>C	c.(931-933)gaT>gaC	p.D311D	C20orf26_ENST00000377306.1_Silent_p.D311D|C20orf26_ENST00000389656.3_5'UTR|C20orf26_ENST00000451767.2_Silent_p.D311D|C20orf26_ENST00000377309.2_5'UTR	NM_015585.3	NP_056400.3	Q8NHU2	CT026_HUMAN		311										NS(2)|breast(3)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(11)|lung(42)|ovary(3)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	77				READ - Rectum adenocarcinoma(2;0.171)		TCTCTCCAGATACCATGGAAA	0.527																																					p.D311D		.											.	C20orf26-94	0			c.T933C						.						45.0	37.0	40.0					20																	20123574		2203	4299	6502	SO:0001819	synonymous_variant	26074	exon9			TCCAGATACCATG																												ENST00000245957.5:c.933T>C	20.37:g.20123574T>C		Somatic	317	2		WXS	Illumina GAIIx	Phase_I	326	130	NM_015585	0	0	0	0	0	A6NHA1|Q5JXV4|Q5TE18|Q8N5R9|Q96M59|Q9BQL2|Q9H127|Q9H128|Q9NQH4|Q9UFV8|Q9Y4V7	Silent	SNP	ENST00000245957.5	37	CCDS33447.1																																																																																			.		0.527	C20orf26-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078228.3		
ENTPD6	955	bcgsc.ca	37	20	25193949	25193949	+	Silent	SNP	G	G	A	rs2076561	byFrequency	TCGA-OR-A5LG-01A-11D-A29I-10	TCGA-OR-A5LG-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a39e8bc9-757d-4536-b301-458fc7ec992d	6b9e8d41-7044-4151-b4d6-e211b0e7a923	g.chr20:25193949G>A	ENST00000376652.4	+	5	667	c.504G>A	c.(502-504)ccG>ccA	p.P168P	ENTPD6_ENST00000360031.2_Silent_p.P167P|ENTPD6_ENST00000354989.5_Silent_p.P151P|Y_RNA_ENST00000365544.1_RNA|ENTPD6_ENST00000433259.2_Silent_p.P168P			O75354	ENTP6_HUMAN	ectonucleoside triphosphate diphosphohydrolase 6 (putative)	168					response to calcium ion (GO:0051592)|response to magnesium ion (GO:0032026)	cell surface (GO:0009986)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	guanosine-5'-triphosphate,3'-diphosphate diphosphatase activity (GO:0008894)|nucleoside-triphosphatase activity (GO:0017111)|uridine-diphosphatase activity (GO:0045134)			breast(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(16)|prostate(1)|skin(1)	27						AGGACATTCCGTTCGACTTCT	0.547													G|||	1553	0.310104	0.0983	0.2262	5008	,	,		20740	0.5913		0.3459	False		,,,				2504	0.3292				p.P168P		.											.	ENTPD6-90	0			c.G504A						.	G	,	619,3787	269.2+/-268.9	42,535,1626	169.0	127.0	141.0		453,504	-11.6	0.0	20	dbSNP_96	141	2765,5835	439.7+/-359.3	431,1903,1966	no	coding-synonymous,coding-synonymous	ENTPD6	NM_001114089.1,NM_001247.2	,	473,2438,3592	AA,AG,GG		32.1512,14.049,26.0188	,	151/468,168/485	25193949	3384,9622	2203	4300	6503	SO:0001819	synonymous_variant	955	exon5			CATTCCGTTCGAC	AF039916	CCDS13170.1, CCDS46586.1	20p11.21	2010-06-24	2010-06-24		ENSG00000197586	ENSG00000197586			3368	protein-coding gene	gene with protein product		603160	"""interleukin 6 signal transducer-2"""	CD39L2, IL6ST2		9676430	Standard	NM_001247		Approved	NTPDase-6, dJ738P15.3	uc002wuj.2	O75354	OTTHUMG00000032116	ENST00000376652.4:c.504G>A	20.37:g.25193949G>A		Somatic	128	0		WXS	Illumina GAIIx	Phase_I	159	6	NM_001247	0	0	31	31	0	A6NCX6|D3DW49|Q5QPJ2|Q5QPJ5|Q7Z5B5|Q8N3H3|Q8TAS7|Q9UJD1	Silent	SNP	ENST00000376652.4	37	CCDS13170.1	755	0.3456959706959707	59	0.11991869918699187	92	0.2541436464088398	346	0.6048951048951049	258	0.3403693931398417	G	0.470	-0.885057	0.02511	0.14049	0.321512	ENSG00000197586	ENST00000433417;ENST00000447877	.	.	.	5.79	-11.6	0.00059	.	.	.	.	.	T	0.00012	0.0000	.	.	.	0.09310	P	0.99999999861442	.	.	.	.	.	.	T	0.26608	-1.0098	3	.	.	.	-1.1705	1.9584	0.03381	0.1245:0.3117:0.2786:0.2853	rs2076561;rs17250460;rs58880188;rs2076561	.	.	.	H	89;61	.	.	R	+	2	0	ENTPD6	25141949	0.000000	0.05858	0.008000	0.14137	0.056000	0.15407	-2.000000	0.01466	-3.712000	0.00117	-2.589000	0.00165	CGT	G|0.708;A|0.292		0.547	ENTPD6-020	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000078414.2		
NINL	22981	bcgsc.ca	37	20	25456888	25456888	+	Silent	SNP	A	A	G	rs437635	byFrequency	TCGA-OR-A5LG-01A-11D-A29I-10	TCGA-OR-A5LG-10A-01D-A29L-10	A	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a39e8bc9-757d-4536-b301-458fc7ec992d	6b9e8d41-7044-4151-b4d6-e211b0e7a923	g.chr20:25456888A>G	ENST00000278886.6	-	17	3112	c.3039T>C	c.(3037-3039)agT>agC	p.S1013S	NINL_ENST00000422516.1_Intron	NM_025176.4	NP_079452.3	Q9Y2I6	NINL_HUMAN	ninein-like	1013					G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)	cytosol (GO:0005829)|microtubule (GO:0005874)	calcium ion binding (GO:0005509)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(13)|lung(25)|ovary(2)|pancreas(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	57						CAACCTCCACACTGTGCTTGT	0.682													G|||	2795	0.558107	0.5356	0.3559	5008	,	,		14219	0.9067		0.4304	False		,,,				2504	0.5041				p.S1013S		.											.	NINL-94	0			c.T3039C						.	G		2241,2165	583.5+/-385.8	552,1137,514	58.0	62.0	60.0		3039	0.2	0.0	20	dbSNP_80	60	3727,4873	615.9+/-396.4	794,2139,1367	no	coding-synonymous	NINL	NM_025176.4		1346,3276,1881	GG,GA,AA		43.3372,49.1375,45.8865		1013/1383	25456888	5968,7038	2203	4300	6503	SO:0001819	synonymous_variant	22981	exon17			CTCCACACTGTGC		CCDS33452.1	20p11.22-p11.1	2013-01-10			ENSG00000101004	ENSG00000101004		"""EF-hand domain containing"""	29163	protein-coding gene	gene with protein product	"""ninein-like protein"""	609580				10231032	Standard	XM_005260678		Approved	KIAA0980, NLP	uc002wux.1	Q9Y2I6	OTTHUMG00000032127	ENST00000278886.6:c.3039T>C	20.37:g.25456888A>G		Somatic	87	0		WXS	Illumina GAIIx	Phase_I	112	5	NM_025176	0	0	3	3	0	A6NJN0|B3V9H6|B7Z1V8|Q5JYP0|Q8NE38|Q9NQE3	Silent	SNP	ENST00000278886.6	37	CCDS33452.1																																																																																			A|0.506;G|0.494		0.682	NINL-007	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000078445.3	NM_025176	
TMEM189-UBE2V1	387522	hgsc.bcm.edu	37	20	48770159	48770159	+	Missense_Mutation	SNP	T	T	C	rs232733		TCGA-OR-A5LG-01A-11D-A29I-10	TCGA-OR-A5LG-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a39e8bc9-757d-4536-b301-458fc7ec992d	6b9e8d41-7044-4151-b4d6-e211b0e7a923	g.chr20:48770159T>C	ENST00000341698.2	-	1	15	c.16A>G	c.(16-18)Aac>Gac	p.N6D	TMEM189_ENST00000371652.4_Missense_Mutation_p.N6D|TMEM189_ENST00000371650.5_Missense_Mutation_p.N6D|TMEM189_ENST00000557021.1_Missense_Mutation_p.N6D	NM_001257399.1	NP_001244328.1			TMEM189-UBE2V1 readthrough											breast(1)|endometrium(4)|large_intestine(6)|lung(6)	17			BRCA - Breast invasive adenocarcinoma(9;8.29e-07)			CCCGGCCAGTTCTCGGCGCCC	0.766													C|||	5008	1.0	1.0	1.0	5008	,	,		6103	1.0		1.0	False		,,,				2504	1.0				p.N6D		.											.	TMEM189-22	0			c.A16G						.						2.0	2.0	2.0					20																	48770159		1101	2248	3349	SO:0001583	missense	387521	exon1			GCCAGTTCTCGGC	U39361	CCDS13424.1	20q13.13	2011-05-31			ENSG00000124208	ENSG00000124208			33521	other	readthrough						11076860	Standard	NM_199203		Approved	Kua-UEV, CROC-1B	uc002xvf.3		OTTHUMG00000033085	ENST00000341698.2:c.16A>G	20.37:g.48770159T>C	ENSP00000344166:p.Asn6Asp	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	11	11	NM_199129	0	0	0	0	0		Missense_Mutation	SNP	ENST00000341698.2	37	CCDS13424.1	2182	0.9990842490842491	492	1.0	360	0.994475138121547	572	1.0	758	1.0	C	0.054	-1.242740	0.01481	.	.	ENSG00000124208;ENSG00000240849;ENSG00000240849;ENSG00000240849	ENST00000341698;ENST00000557021;ENST00000371650;ENST00000371652	T;T;T;T	0.46819	0.86;0.86;1.11;1.11	3.81	0.707	0.18139	.	.	.	.	.	T	0.00012	0.0000	N	0.08118	0	0.80722	P	0.0	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.01281	0.0;0.0;0.0	T	0.40757	-0.9546	8	0.02654	T	1	.	3.4688	0.07559	0.1731:0.5239:0.0:0.303	rs232733;rs674252;rs56654084	6;6;6	Q5TGE1;A5PLL7;G3V2F7	.;TM189_HUMAN;.	D	6	ENSP00000344166:N6D;ENSP00000450635:N6D;ENSP00000360713:N6D;ENSP00000360715:N6D	ENSP00000360713:N6D	N	-	1	0	TMEM189-UBE2V1;TMEM189	48203566	1.000000	0.71417	0.503000	0.27626	0.073000	0.16967	0.497000	0.22514	-0.274000	0.09232	-2.268000	0.00277	AAC	C|0.999;T|0.001		0.766	TMEM189-UBE2V1-001	KNOWN	basic|appris_principal|readthrough_transcript|CCDS	protein_coding	protein_coding	OTTHUMT00000080532.5		
CASS4	57091	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	20	55012236	55012236	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5LG-01A-11D-A29I-10	TCGA-OR-A5LG-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a39e8bc9-757d-4536-b301-458fc7ec992d	6b9e8d41-7044-4151-b4d6-e211b0e7a923	g.chr20:55012236C>T	ENST00000360314.3	+	3	278	c.53C>T	c.(52-54)gCa>gTa	p.A18V	CASS4_ENST00000434344.1_Missense_Mutation_p.A18V|CASS4_ENST00000371336.3_Missense_Mutation_p.A18V	NM_001164116.1	NP_001157588.1	Q9NQ75	CASS4_HUMAN	Cas scaffolding protein family member 4	18	SH3. {ECO:0000255|PROSITE- ProRule:PRU00192}.				cell adhesion (GO:0007155)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|membrane (GO:0016020)	phosphorelay sensor kinase activity (GO:0000155)	p.A18E(1)		breast(1)|endometrium(5)|kidney(1)|large_intestine(7)|lung(26)|ovary(4)|prostate(3)|skin(5)|stomach(1)|urinary_tract(1)	54						CTGGCCAGGGCACTTTATGAC	0.557																																					p.A18V		.											.	CASS4-25	1	Substitution - Missense(1)	lung(1)	c.C53T						.						75.0	66.0	69.0					20																	55012236		2203	4300	6503	SO:0001583	missense	57091	exon2			CCAGGGCACTTTA	AJ276678	CCDS33492.1, CCDS54475.1	20q13.31	2011-04-13	2008-04-14	2008-04-15	ENSG00000087589	ENSG00000087589		"""Cas scaffolding proteins"""	15878	protein-coding gene	gene with protein product	"""HEF-like protein"", ""HEF1-Efs-p130Cas-like"""		"""chromosome 20 open reading frame 32"""	C20orf32			Standard	NM_020356		Approved	HEFL, HEPL	uc002xxr.2	Q9NQ75	OTTHUMG00000032788	ENST00000360314.3:c.53C>T	20.37:g.55012236C>T	ENSP00000353462:p.Ala18Val	Somatic	123	0		WXS	Illumina GAIIx	Phase_I	138	59	NM_020356	0	0	0	0	0	E1P5Z8|Q5QPD6|Q96K09|Q9BYL5	Missense_Mutation	SNP	ENST00000360314.3	37	CCDS33492.1	.	.	.	.	.	.	.	.	.	.	C	35	5.534155	0.96460	.	.	ENSG00000087589	ENST00000360314;ENST00000371336;ENST00000434344	T;T;T	0.61980	0.06;0.06;0.06	5.71	5.71	0.89125	Src homology-3 domain (4);	0.051982	0.85682	D	0.000000	T	0.78329	0.4266	M	0.62088	1.915	0.80722	D	1	D;D;D;D	0.76494	0.996;0.998;0.998;0.999	D;D;D;D	0.77557	0.99;0.933;0.981;0.989	T	0.77568	-0.2539	10	0.52906	T	0.07	-18.8106	19.8625	0.96789	0.0:1.0:0.0:0.0	.	18;18;18;18	B4DII4;Q9NQ75-3;Q9NQ75-2;Q9NQ75	.;.;.;CASS4_HUMAN	V	18	ENSP00000353462:A18V;ENSP00000360387:A18V;ENSP00000410027:A18V	ENSP00000353462:A18V	A	+	2	0	CASS4	54445643	1.000000	0.71417	0.723000	0.30687	0.984000	0.73092	7.290000	0.78711	2.689000	0.91719	0.655000	0.94253	GCA	.		0.557	CASS4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079789.2	NM_020356	
ZNF831	128611	bcgsc.ca	37	20	57782004	57782004	+	Missense_Mutation	SNP	G	G	T			TCGA-OR-A5LG-01A-11D-A29I-10	TCGA-OR-A5LG-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a39e8bc9-757d-4536-b301-458fc7ec992d	6b9e8d41-7044-4151-b4d6-e211b0e7a923	g.chr20:57782004G>T	ENST00000371030.2	+	3	3920	c.3920G>T	c.(3919-3921)aGt>aTt	p.S1307I		NM_178457.1	NP_848552.1	Q5JPB2	ZN831_HUMAN	zinc finger protein 831	1307							metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)			NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(15)|lung(71)|ovary(2)|pancreas(1)|prostate(4)|skin(16)|upper_aerodigestive_tract(2)|urinary_tract(3)	125	all_lung(29;0.0085)					CTGAGAGCCAGTAGACTTCGC	0.552																																					p.S1307I		.											.	ZNF831-126	0			c.G3920T						.						117.0	119.0	118.0					20																	57782004		1949	4134	6083	SO:0001583	missense	128611	exon3			GAGCCAGTAGACT	AL121919	CCDS42894.1	20q13.32	2008-10-20	2008-03-25	2008-03-25	ENSG00000124203	ENSG00000124203			16167	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 174"""	C20orf174			Standard	NM_178457		Approved	dJ492J12.1	uc002yan.3	Q5JPB2	OTTHUMG00000032864	ENST00000371030.2:c.3920G>T	20.37:g.57782004G>T	ENSP00000360069:p.Ser1307Ile	Somatic	115	0		WXS	Illumina GAIIx	Phase_I	138	6	NM_178457	0	0	0	0	0	Q5TDR4|Q8TCP0	Missense_Mutation	SNP	ENST00000371030.2	37	CCDS42894.1	.	.	.	.	.	.	.	.	.	.	G	15.43	2.832065	0.50845	.	.	ENSG00000124203	ENST00000371030	T	0.05855	3.38	5.43	3.45	0.39498	.	0.832715	0.10865	N	0.625640	T	0.07413	0.0187	L	0.27053	0.805	0.09310	N	1	P	0.40476	0.718	P	0.45037	0.467	T	0.35724	-0.9777	10	0.72032	D	0.01	-1.3828	6.9092	0.24325	0.0966:0.1771:0.7263:0.0	.	1307	Q5JPB2	ZN831_HUMAN	I	1307	ENSP00000360069:S1307I	ENSP00000360069:S1307I	S	+	2	0	ZNF831	57215399	0.007000	0.16637	0.001000	0.08648	0.693000	0.40251	1.775000	0.38584	0.624000	0.30286	0.650000	0.86243	AGT	.		0.552	ZNF831-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000079916.2	NM_178457	
KRTAP10-4	386672	ucsc.edu	37	21	45993851	45993851	+	Silent	SNP	C	C	T	rs201895065		TCGA-OR-A5LG-01A-11D-A29I-10	TCGA-OR-A5LG-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a39e8bc9-757d-4536-b301-458fc7ec992d	6b9e8d41-7044-4151-b4d6-e211b0e7a923	g.chr21:45993851C>T	ENST00000400374.3	+	1	246	c.216C>T	c.(214-216)tgC>tgT	p.C72C	TSPEAR_ENST00000397916.1_5'Flank|TSPEAR_ENST00000323084.4_Intron	NM_198687.1	NP_941960.1	P60372	KR104_HUMAN	keratin associated protein 10-4	72	36 X 5 AA repeats of C-C-X(3).					keratin filament (GO:0045095)				NS(1)|endometrium(4)|kidney(1)|large_intestine(1)|lung(9)|pancreas(1)|prostate(1)	18						CAGTGACCTGCGAGCCCAGCC	0.721																																					p.C72C		.											.	KRTAP10-4-90	0			c.C216T						.						20.0	38.0	32.0					21																	45993851		1993	4191	6184	SO:0001819	synonymous_variant	386672	exon1			GACCTGCGAGCCC	AB076351	CCDS42957.1	21q22.3	2006-03-13	2004-07-12	2004-07-14	ENSG00000215454	ENSG00000215454		"""Keratin associated proteins"""	20521	protein-coding gene	gene with protein product			"""keratin associated protein 18-4"""	KRTAP18-4			Standard	NM_198687		Approved	KRTAP18.4, KAP10.4	uc002zfk.1	P60372	OTTHUMG00000057641	ENST00000400374.3:c.216C>T	21.37:g.45993851C>T		Somatic	23	3		WXS	Illumina GAIIx	Phase_I	23	19	NM_198687	0	0	0	0	0	Q08AS0	Silent	SNP	ENST00000400374.3	37	CCDS42957.1																																																																																			C|1.000;|0.000		0.721	KRTAP10-4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128045.1	NM_198687	
SCARF2	91179	hgsc.bcm.edu	37	22	20780097	20780097	+	Silent	SNP	G	G	C	rs759609		TCGA-OR-A5LG-01A-11D-A29I-10	TCGA-OR-A5LG-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a39e8bc9-757d-4536-b301-458fc7ec992d	6b9e8d41-7044-4151-b4d6-e211b0e7a923	g.chr22:20780097G>C	ENST00000266214.5	-	11	2285	c.2181C>G	c.(2179-2181)cgC>cgG	p.R727R	SCARF2_ENST00000405555.3_Silent_p.R722R	NM_153334.4	NP_699165.2	Q96GP6	SREC2_HUMAN	scavenger receptor class F, member 2	727	Pro-rich.				cell adhesion (GO:0007155)	focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)				breast(1)|central_nervous_system(1)|kidney(1)|large_intestine(1)|lung(3)|prostate(1)|skin(2)	10	Melanoma(16;0.000465)|Ovarian(15;0.00167)|Colorectal(54;0.0221)|all_neural(72;0.219)	Lung SC(17;0.0262)	LUSC - Lung squamous cell carcinoma(15;0.00102)|Lung(15;0.0173)			GCCCCGGGGGGCGCGGCGTTG	0.781																																					p.R727R		.											.	SCARF2-341	0			c.C2181G						.	C	,	3271,119		1585,101,9	5.0	5.0	5.0		2181,2166	-5.3	0.0	22	dbSNP_86	5	6306,190		3060,186,2	no	coding-synonymous,coding-synonymous	SCARF2	NM_153334.4,NM_182895.2	,	4645,287,11	CC,CG,GG		2.9249,3.5103,3.1256	,	727/871,722/866	20780097	9577,309	1695	3248	4943	SO:0001819	synonymous_variant	91179	exon11			CGGGGGGCGCGGC	AF522196	CCDS13779.1, CCDS46666.1	22q11.21	2011-10-10			ENSG00000244486	ENSG00000244486			19869	protein-coding gene	gene with protein product		613619				12154095	Standard	XM_006724364		Approved	SREC-II, SREC2, HUMZD58C02	uc002zsk.2	Q96GP6	OTTHUMG00000150779	ENST00000266214.5:c.2181C>G	22.37:g.20780097G>C		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	10	10	NM_153334	0	0	0	0	0	E5RFB8|Q58A83|Q8IXF3|Q9BW74	Silent	SNP	ENST00000266214.5	37	CCDS13779.1																																																																																			G|0.826;C|0.174		0.781	SCARF2-001	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000320047.1		
BCR	613	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	22	23627302	23627302	+	Missense_Mutation	SNP	C	C	G			TCGA-OR-A5LG-01A-11D-A29I-10	TCGA-OR-A5LG-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a39e8bc9-757d-4536-b301-458fc7ec992d	6b9e8d41-7044-4151-b4d6-e211b0e7a923	g.chr22:23627302C>G	ENST00000305877.8	+	10	3071	c.2320C>G	c.(2320-2322)Ccc>Gcc	p.P774A	BCR_ENST00000359540.3_Missense_Mutation_p.P774A	NM_004327.3	NP_004318.3	P11274	BCR_HUMAN	breakpoint cluster region	774	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				actin cytoskeleton organization (GO:0030036)|brain development (GO:0007420)|inner ear morphogenesis (GO:0042472)|negative regulation of cell migration (GO:0030336)|negative regulation of inflammatory response (GO:0050728)|negative regulation of neutrophil degranulation (GO:0043314)|neuromuscular process controlling balance (GO:0050885)|peptidyl-tyrosine phosphorylation (GO:0018108)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive regulation of phagocytosis (GO:0050766)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of cell cycle (GO:0051726)|regulation of small GTPase mediated signal transduction (GO:0051056)|response to lipopolysaccharide (GO:0032496)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	ATP binding (GO:0005524)|GTPase activator activity (GO:0005096)|kinase activity (GO:0016301)|protein serine/threonine kinase activity (GO:0004674)|protein tyrosine kinase activity (GO:0004713)|Rac GTPase activator activity (GO:0030675)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)		BCR/JAK2(6)	central_nervous_system(3)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(9)|ovary(1)|prostate(1)|skin(4)|stomach(1)|urinary_tract(1)	35					Bosutinib(DB06616)|Ponatinib(DB08901)	GGAGGCAGTGCCCAACATCCC	0.542			T	"""ABL1,  FGFR1, JAK2 """	"""CML, ALL, AML"""																																p.P774A		.		Dom	yes		22	22q11.21	613	breakpoint cluster region		L	.	BCR-1349	0			c.C2320G						.						111.0	87.0	95.0					22																	23627302		2203	4300	6503	SO:0001583	missense	613	exon10			GCAGTGCCCAACA		CCDS13806.1, CCDS13807.1	22q11	2013-01-10			ENSG00000186716	ENSG00000186716		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	1014	protein-coding gene	gene with protein product		151410		D22S11, BCR1		1657398, 18070886	Standard	NM_004327		Approved	D22S662, CML, PHL, ALL	uc002zww.3	P11274	OTTHUMG00000150655	ENST00000305877.8:c.2320C>G	22.37:g.23627302C>G	ENSP00000303507:p.Pro774Ala	Somatic	207	1		WXS	Illumina GAIIx	Phase_I	224	109	NM_021574	0	0	8	14	6	P78501|Q12842|Q4LE80|Q6NZI3	Missense_Mutation	SNP	ENST00000305877.8	37	CCDS13806.1	.	.	.	.	.	.	.	.	.	.	C	17.25	3.341691	0.61073	.	.	ENSG00000186716	ENST00000305877;ENST00000359540;ENST00000334149	T;T	0.30448	1.53;1.53	5.06	4.05	0.47172	Pleckstrin homology-type (1);Pleckstrin homology domain (3);	0.188259	0.47093	D	0.000244	T	0.32763	0.0840	L	0.40543	1.245	0.80722	D	1	P;P;P;P;P	0.42692	0.675;0.763;0.787;0.516;0.763	P;P;P;B;P	0.49421	0.595;0.61;0.595;0.281;0.507	T	0.04386	-1.0955	10	0.44086	T	0.13	.	9.171	0.37081	0.0:0.8345:0.0:0.1655	.	363;439;392;774;774	B4E065;Q12843;Q12844;P11274-2;P11274	.;.;.;.;BCR_HUMAN	A	774;774;439	ENSP00000303507:P774A;ENSP00000352535:P774A	ENSP00000303507:P774A	P	+	1	0	BCR	21957302	0.902000	0.30710	0.855000	0.33649	0.528000	0.34623	1.830000	0.39131	1.287000	0.44583	0.655000	0.94253	CCC	.		0.542	BCR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000075819.1	NM_004327	
CHEK2	11200	broad.mit.edu	37	22	29091841	29091841	+	Silent	SNP	G	G	A	rs146546850	byFrequency	TCGA-OR-A5LG-01A-11D-A29I-10	TCGA-OR-A5LG-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a39e8bc9-757d-4536-b301-458fc7ec992d	6b9e8d41-7044-4151-b4d6-e211b0e7a923	g.chr22:29091841G>A	ENST00000405598.1	-	12	1307	c.1116C>T	c.(1114-1116)tcC>tcT	p.S372S	CHEK2_ENST00000403642.1_Silent_p.S281S|CHEK2_ENST00000402731.1_Silent_p.S343S|CHEK2_ENST00000328354.6_Silent_p.S372S|CHEK2_ENST00000348295.3_Silent_p.S343S|CHEK2_ENST00000382580.2_Silent_p.S415S|CHEK2_ENST00000404276.1_Silent_p.S372S|CHEK2_ENST00000382565.1_Intron|CHEK2_ENST00000382566.1_3'UTR|CHEK2_ENST00000382578.1_Silent_p.S281S|CHEK2_ENST00000544772.1_Silent_p.S151S|CHEK2_ENST00000464581.1_5'Flank			O96017	CHK2_HUMAN	checkpoint kinase 2	372	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.|T-loop/activation segment.				cellular protein catabolic process (GO:0044257)|cellular response to DNA damage stimulus (GO:0006974)|DNA damage checkpoint (GO:0000077)|DNA damage induced protein phosphorylation (GO:0006975)|double-strand break repair (GO:0006302)|G2/M transition of mitotic cell cycle (GO:0000086)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|positive regulation of transcription, DNA-templated (GO:0045893)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|protein stabilization (GO:0050821)|regulation of protein catabolic process (GO:0042176)|regulation of transcription, DNA-templated (GO:0006355)|replicative senescence (GO:0090399)|response to gamma radiation (GO:0010332)|signal transduction in response to DNA damage (GO:0042770)|signal transduction involved in intra-S DNA damage checkpoint (GO:0072428)|spindle assembly involved in mitosis (GO:0090307)|transcription, DNA-templated (GO:0006351)	nucleoplasm (GO:0005654)|PML body (GO:0016605)	ATP binding (GO:0005524)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|protein kinase binding (GO:0019901)|protein serine/threonine kinase activity (GO:0004674)|ubiquitin protein ligase binding (GO:0031625)	p.S372S(8)		central_nervous_system(17)|endometrium(2)|kidney(11)|large_intestine(2)|lung(11)|ovary(1)|prostate(4)|stomach(2)	50						CCAAAATCTTGGAGTGCCCAA	0.413			F			breast		Direct reversal of damage;Other conserved DNA damage response genes																													p.S415S		.	yes	Rec		familial breast cancer	22	22q12.1	11200	CHK2 checkpoint homolog (S. pombe)		E	.	CHEK2-1515	8	Substitution - coding silent(8)	kidney(4)|prostate(2)|endometrium(1)|central_nervous_system(1)	c.C1245T						.						43.0	44.0	44.0					22																	29091841		2203	4300	6503	SO:0001819	synonymous_variant	11200	exon12			AATCTTGGAGTGC	AF086904	CCDS13843.1, CCDS13844.1, CCDS33629.1	22q12.1	2014-09-17	2011-11-11	2001-09-27	ENSG00000183765	ENSG00000183765			16627	protein-coding gene	gene with protein product		604373	"""CHK2 (checkpoint, S.pombe) homolog"", ""CHK2 checkpoint homolog (S. pombe)"""	RAD53		9836640, 10097108	Standard	NM_001257387		Approved	CDS1, CHK2, HuCds1, PP1425, bA444G7	uc003adt.1	O96017	OTTHUMG00000151023	ENST00000405598.1:c.1116C>T	22.37:g.29091841G>A		Somatic	190	2		WXS	Illumina GAIIx	Phase_I	130	15	NM_001005735	0	0	1	1	0	A8K3Y9|B7ZBF3|B7ZBF4|B7ZBF5|Q6QA03|Q6QA04|Q6QA05|Q6QA06|Q6QA07|Q6QA08|Q6QA10|Q6QA11|Q6QA12|Q6QA13|Q9HBS5|Q9HCQ8|Q9UGF0|Q9UGF1	Silent	SNP	ENST00000405598.1	37	CCDS13843.1	.	.	.	.	.	.	.	.	.	.	G	5.792	0.330417	0.10956	.	.	ENSG00000183765	ENST00000434810	.	.	.	5.89	-2.11	0.07187	.	.	.	.	.	T	0.42154	0.1190	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.33854	-0.9852	4	.	.	.	-7.6356	3.2532	0.06822	0.327:0.1103:0.4613:0.1014	.	.	.	.	L	116	.	.	P	-	2	0	CHEK2	27421841	0.997000	0.39634	0.996000	0.52242	0.470000	0.32858	0.318000	0.19504	-0.075000	0.12798	-0.907000	0.02831	CCA	.		0.413	CHEK2-005	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000321150.1	NM_001005735	
TMPRSS6	164656	bcgsc.ca	37	22	37462936	37462936	+	Missense_Mutation	SNP	A	A	G	rs855791	byFrequency	TCGA-OR-A5LG-01A-11D-A29I-10	TCGA-OR-A5LG-10A-01D-A29L-10	A	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a39e8bc9-757d-4536-b301-458fc7ec992d	6b9e8d41-7044-4151-b4d6-e211b0e7a923	g.chr22:37462936A>G	ENST00000346753.3	-	17	2323	c.2207T>C	c.(2206-2208)gTc>gCc	p.V736A	TMPRSS6_ENST00000406856.1_Missense_Mutation_p.V749A|TMPRSS6_ENST00000406725.1_Missense_Mutation_p.V727A|TMPRSS6_ENST00000381792.2_Missense_Mutation_p.V749A	NM_153609.2	NP_705837.1	Q8IU80	TMPS6_HUMAN	transmembrane protease, serine 6	736	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.		V -> A (in dbSNP:rs855791). {ECO:0000269|PubMed:12975309, ECO:0000269|PubMed:19818657}.		angiogenesis (GO:0001525)|extracellular matrix organization (GO:0030198)|fibrinolysis (GO:0042730)|intracellular signal transduction (GO:0035556)|iron ion homeostasis (GO:0055072)|proteolysis (GO:0006508)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	serine-type endopeptidase activity (GO:0004252)	p.V736A(1)		breast(5)|central_nervous_system(4)|endometrium(4)|kidney(4)|large_intestine(3)|lung(13)|ovary(1)|prostate(1)|skin(2)|stomach(3)	40						GTAGCGATAGACCTCGCTGCA	0.607													G|||	3028	0.604633	0.8994	0.487	5008	,	,		19711	0.4345		0.6123	False		,,,				2504	0.4571				p.V736A		.											.	TMPRSS6-292	1	Substitution - Missense(1)	stomach(1)	c.T2207C						.	G	ALA/VAL	3708,698	292.1+/-281.9	1560,588,55	135.0	99.0	111.0	http://www.ncbi.nlm.nih.gov/sites/varvu?gene	2207	4.7	1.0	22	dbSNP_86	111	4858,3742	531.3+/-382.0	1399,2060,841	yes	missense	TMPRSS6	NM_153609.2	64	2959,2648,896	GG,GA,AA	http://www.ncbi.nlm.nih.gov/pubmed?term	43.5116,15.842,34.1381	benign	736/812	37462936	8566,4440	2203	4300	6503	SO:0001583	missense	164656	exon17			CGATAGACCTCGC	AY055383	CCDS13941.1, CCDS74856.1, CCDS74857.1	22q13.1	2010-04-13			ENSG00000187045	ENSG00000187045		"""Serine peptidases / Transmembrane"""	16517	protein-coding gene	gene with protein product		609862					Standard	NM_001289000		Approved	FLJ30744	uc003aqs.1	Q8IU80	OTTHUMG00000150541	ENST00000346753.3:c.2207T>C	22.37:g.37462936A>G	ENSP00000334962:p.Val736Ala	Somatic	172	2		WXS	Illumina GAIIx	Phase_I	94	7	NM_153609	0	0	0	0	0	B0QYB4|B0QYB7|B0QYB8|Q5TI06|Q6ICC2|Q6UXD8|Q8IUE2|Q8IXV8	Missense_Mutation	SNP	ENST00000346753.3	37	CCDS13941.1	1314	0.6016483516483516	430	0.8739837398373984	179	0.494475138121547	250	0.4370629370629371	455	0.600263852242744	G	13.30	2.197511	0.38806	0.84158	0.564884	ENSG00000187045	ENST00000381792;ENST00000346753;ENST00000406725;ENST00000406856	D;D;D;D	0.87571	-2.27;-2.27;-2.27;-2.27	4.72	4.72	0.59763	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	0.150864	0.44902	N	0.000412	T	0.00012	0.0000	N	0.03177	-0.4	0.48395	P	3.5200000000001896E-4	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.42515	-0.9447	9	0.22706	T	0.39	.	9.4664	0.38816	0.1631:0.0:0.8369:0.0	rs855791;rs17749938;rs59898578;rs855791	749;736	Q8IU80-5;Q8IU80	.;TMPS6_HUMAN	A	749;736;727;749	ENSP00000371211:V749A;ENSP00000334962:V736A;ENSP00000385453:V727A;ENSP00000384964:V749A	ENSP00000334962:V736A	V	-	2	0	TMPRSS6	35792882	1.000000	0.71417	1.000000	0.80357	0.955000	0.61496	4.736000	0.62059	0.980000	0.38523	-0.186000	0.12905	GTC	G|0.638;N|0.000		0.607	TMPRSS6-003	NOVEL	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000318822.1	NM_153609	
SUN2	25777	bcgsc.ca	37	22	39134715	39134715	+	Silent	SNP	T	T	C	rs1062687	byFrequency	TCGA-OR-A5LG-01A-11D-A29I-10	TCGA-OR-A5LG-10A-01D-A29L-10	T	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a39e8bc9-757d-4536-b301-458fc7ec992d	6b9e8d41-7044-4151-b4d6-e211b0e7a923	g.chr22:39134715T>C	ENST00000405510.1	-	17	2182	c.1824A>G	c.(1822-1824)caA>caG	p.Q608Q	SUN2_ENST00000216064.4_Silent_p.Q608Q|SUN2_ENST00000411587.2_Silent_p.Q597Q|SUN2_ENST00000405018.1_Silent_p.Q629Q|SUN2_ENST00000406622.1_Silent_p.Q608Q|RP3-508I15.14_ENST00000416406.1_RNA|RP3-508I15.19_ENST00000418803.1_RNA|RP3-508I15.20_ENST00000609428.1_RNA|RP3-508I15.18_ENST00000420118.1_RNA	NM_001199580.1	NP_001186509.1	Q9UH99	SUN2_HUMAN	Sad1 and UNC84 domain containing 2	608	SUN. {ECO:0000255|PROSITE- ProRule:PRU00802}.				centrosome localization (GO:0051642)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|mitotic spindle organization (GO:0007052)|nuclear envelope organization (GO:0006998)|nuclear matrix anchoring at nuclear membrane (GO:0090292)|nuclear migration (GO:0007097)|nuclear migration along microfilament (GO:0031022)|positive regulation of cell migration (GO:0030335)	condensed nuclear chromosome (GO:0000794)|endosome (GO:0005768)|integral component of membrane (GO:0016021)|nuclear chromosome, telomeric region (GO:0000784)|nuclear envelope (GO:0005635)|nuclear inner membrane (GO:0005637)|nuclear membrane (GO:0031965)|SUN-KASH complex (GO:0034993)	identical protein binding (GO:0042802)|lamin binding (GO:0005521)|microtubule binding (GO:0008017)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(3)|ovary(1)|skin(2)|stomach(1)	15						CGGCGAAGCCTTGTGGCCCCT	0.622													C|||	1923	0.383986	0.556	0.2046	5008	,	,		17697	0.4603		0.2982	False		,,,				2504	0.2883				p.Q629Q		.											.	SUN2-154	0			c.A1887G						.	C	,,	2258,2148	573.8+/-383.6	577,1104,522	66.0	70.0	69.0		1887,1824,1824	2.4	1.0	22	dbSNP_86	69	2565,6035	685.2+/-404.0	375,1815,2110	no	coding-synonymous,coding-synonymous,coding-synonymous	SUN2	NM_001199579.1,NM_001199580.1,NM_015374.2	,,	952,2919,2632	CC,CT,TT		29.8256,48.7517,37.0829	,,	629/739,608/718,608/718	39134715	4823,8183	2203	4300	6503	SO:0001819	synonymous_variant	25777	exon16			GAAGCCTTGTGGC	AF202723	CCDS13978.1, CCDS56231.1	22q12-q13	2010-05-18	2010-05-18	2010-01-27	ENSG00000100242	ENSG00000100242			14210	protein-coding gene	gene with protein product		613569	"""unc-84 homolog B (C. elegans)"""	UNC84B		10508607, 10375507	Standard	NM_015374		Approved		uc010gxq.2	Q9UH99	OTTHUMG00000151031	ENST00000405510.1:c.1824A>G	22.37:g.39134715T>C		Somatic	74	0		WXS	Illumina GAIIx	Phase_I	69	5	NM_001199579	0	0	65	65	0	B0QY62|O75156|Q2NKN8|Q2T9F7|Q504T5|Q6B4H1|Q7Z3E3	Silent	SNP	ENST00000405510.1	37	CCDS13978.1																																																																																			T|0.441;G|0.116;C|0.264;A|0.179		0.622	SUN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321057.1	XM_039332	
MGAT3	4248	broad.mit.edu	37	22	39883963	39883963	+	Missense_Mutation	SNP	T	T	G			TCGA-OR-A5LG-01A-11D-A29I-10	TCGA-OR-A5LG-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a39e8bc9-757d-4536-b301-458fc7ec992d	6b9e8d41-7044-4151-b4d6-e211b0e7a923	g.chr22:39883963T>G	ENST00000341184.6	+	2	826	c.611T>G	c.(610-612)gTg>gGg	p.V204G		NM_001098270.1|NM_002409.4	NP_001091740.1|NP_002400.3	Q09327	MGAT3_HUMAN	mannosyl (beta-1,4-)-glycoprotein beta-1,4-N-acetylglucosaminyltransferase	204					cellular protein metabolic process (GO:0044267)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	beta-1,4-mannosylglycoprotein 4-beta-N-acetylglucosaminyltransferase activity (GO:0003830)			endometrium(4)|kidney(1)|large_intestine(5)|lung(12)|prostate(1)|skin(1)	24	Melanoma(58;0.04)					CCCAGGGAGGTGCCGCGCCGC	0.677																																					p.V204G		.											.	MGAT3-90	0			c.T611G						.						27.0	23.0	25.0					22																	39883963		2198	4298	6496	SO:0001583	missense	4248	exon2			GGGAGGTGCCGCG	D13789	CCDS13994.2	22q13.1	2013-02-25			ENSG00000128268	ENSG00000128268	2.4.1.144	"""Mannosyl-glycoprotein beta N-acetylglucosaminyltransferases"""	7046	protein-coding gene	gene with protein product		604621				8370666	Standard	NM_002409		Approved	GNT-III	uc010gxy.3	Q09327	OTTHUMG00000030185	ENST00000341184.6:c.611T>G	22.37:g.39883963T>G	ENSP00000345270:p.Val204Gly	Somatic	47	8		WXS	Illumina GAIIx	Phase_I	114	24	NM_002409	0	0	0	0	0	A6NGD0|Q14CK5|Q6IC49|Q9UH32	Missense_Mutation	SNP	ENST00000341184.6	37	CCDS13994.2	.	.	.	.	.	.	.	.	.	.	T	13.42	2.231471	0.39399	.	.	ENSG00000128268	ENST00000341184	.	.	.	5.67	3.33	0.38152	.	0.281600	0.31279	N	0.007921	T	0.31389	0.0795	N	0.22421	0.69	0.53688	D	0.999979	B	0.27625	0.183	B	0.28011	0.085	T	0.13522	-1.0506	9	0.26408	T	0.33	.	3.665	0.08253	0.1319:0.0785:0.1368:0.6527	.	204	Q09327	MGAT3_HUMAN	G	204	.	ENSP00000345270:V204G	V	+	2	0	MGAT3	38213909	0.039000	0.19947	1.000000	0.80357	0.976000	0.68499	0.186000	0.16978	2.178000	0.69098	0.533000	0.62120	GTG	.		0.677	MGAT3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000075039.2	NM_002409	
GPR62	118442	hgsc.bcm.edu	37	3	51990315	51990315	+	Missense_Mutation	SNP	A	A	G	rs28651222	byFrequency	TCGA-OR-A5LG-01A-11D-A29I-10	TCGA-OR-A5LG-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a39e8bc9-757d-4536-b301-458fc7ec992d	6b9e8d41-7044-4151-b4d6-e211b0e7a923	g.chr3:51990315A>G	ENST00000322241.4	+	1	986	c.647A>G	c.(646-648)cAc>cGc	p.H216R		NM_080865.3	NP_543141.3	Q9BZJ7	GPR62_HUMAN	G protein-coupled receptor 62	216			H -> R (in dbSNP:rs28651222). {ECO:0000269|PubMed:11165367, ECO:0000269|Ref.2, ECO:0000269|Ref.3, ECO:0000269|Ref.6}.			integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	G-protein coupled receptor activity (GO:0004930)			endometrium(1)|kidney(1)|large_intestine(1)|ovary(1)|upper_aerodigestive_tract(1)	5				BRCA - Breast invasive adenocarcinoma(193;8.01e-05)|Kidney(197;0.000534)|KIRC - Kidney renal clear cell carcinoma(197;0.000716)		TCCCGACTCCACTCGGACTCT	0.761													G|||	4997	0.997804	1.0	0.9986	5008	,	,		8932	1.0		0.992	False		,,,				2504	0.998				p.H216R		.											.	GPR62-91	0			c.A647G						.	G	ARG/HIS	2557,1		1278,1,0	5.0	6.0	6.0		647	4.6	0.9	3	dbSNP_125	6	5606,40		2783,40,0	yes	missense	GPR62	NM_080865.3	29	4061,41,0	GG,GA,AA		0.7085,0.0391,0.4998	benign	216/369	51990315	8163,41	1279	2823	4102	SO:0001583	missense	118442	exon1			GACTCCACTCGGA	AF317653	CCDS2838.1	3p21.1	2012-08-21			ENSG00000180929	ENSG00000180929		"""GPCR / Class A : Orphans"""	13301	protein-coding gene	gene with protein product		606917				11165367	Standard	NM_080865		Approved		uc003dca.4	Q9BZJ7	OTTHUMG00000157367	ENST00000322241.4:c.647A>G	3.37:g.51990315A>G	ENSP00000319250:p.His216Arg	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	4	4	NM_080865	0	0	0	0	0	F1DAM4|Q5KU27	Missense_Mutation	SNP	ENST00000322241.4	37	CCDS2838.1	2178	0.9972527472527473	492	1.0	361	0.9972375690607734	572	1.0	753	0.9934036939313984	G	2.895	-0.228893	0.06022	0.999609	0.992915	ENSG00000180929	ENST00000322241	T	0.02837	4.14	4.59	4.59	0.56863	GPCR, rhodopsin-like superfamily (1);	0.000000	0.32640	N	0.005833	T	0.00012	0.0000	N	0.00135	-2.02	0.41549	P	0.011438999999999977	B	0.02656	0.0	B	0.01281	0.0	T	0.30149	-0.9988	9	0.02654	T	1	-10.1837	10.1102	0.42557	0.0975:0.0:0.9025:0.0	rs28651222;rs59586449	216	Q9BZJ7	GPR62_HUMAN	R	216	ENSP00000319250:H216R	ENSP00000319250:H216R	H	+	2	0	GPR62	51965355	1.000000	0.71417	0.936000	0.37596	0.331000	0.28603	5.475000	0.66787	0.910000	0.36722	-0.355000	0.07637	CAC	A|0.003;G|0.997		0.761	GPR62-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348611.1		
CHDH	55349	hgsc.bcm.edu	37	3	53857917	53857917	+	Missense_Mutation	SNP	T	T	G	rs9001	byFrequency	TCGA-OR-A5LG-01A-11D-A29I-10	TCGA-OR-A5LG-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a39e8bc9-757d-4536-b301-458fc7ec992d	6b9e8d41-7044-4151-b4d6-e211b0e7a923	g.chr3:53857917T>G	ENST00000315251.6	-	3	556	c.119A>C	c.(118-120)gAg>gCg	p.E40A		NM_018397.4	NP_060867.2	Q8NE62	CHDH_HUMAN	choline dehydrogenase	40			E -> A (in dbSNP:rs9001).		glycine betaine biosynthetic process from choline (GO:0019285)	mitochondrial inner membrane (GO:0005743)	choline dehydrogenase activity (GO:0008812)|flavin adenine dinucleotide binding (GO:0050660)			NS(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(4)|ovary(2)|prostate(1)	17		Hepatocellular(537;0.152)		BRCA - Breast invasive adenocarcinoma(193;0.000158)|KIRC - Kidney renal clear cell carcinoma(284;0.00588)|Kidney(284;0.00673)|OV - Ovarian serous cystadenocarcinoma(275;0.118)	Choline(DB00122)	ATAGCTGTACTCGTCCCGGCT	0.761													T|||	1221	0.24381	0.3238	0.2781	5008	,	,		12724	0.3651		0.1004	False		,,,				2504	0.1339				p.E40A		.											.	CHDH-91	0			c.A119C						.	T	ALA/GLU	816,2768		76,664,1052	6.0	6.0	6.0		119	3.8	1.0	3	dbSNP_52	6	469,6875		12,445,3215	no	missense	CHDH	NM_018397.4	107	88,1109,4267	GG,GT,TT		6.3862,22.7679,11.7588	possibly-damaging	40/595	53857917	1285,9643	1792	3672	5464	SO:0001583	missense	55349	exon3			CTGTACTCGTCCC	AJ272267	CCDS2873.1	3p21	2004-11-24			ENSG00000016391	ENSG00000016391	1.1.99.1		24288	protein-coding gene	gene with protein product							Standard	NM_018397		Approved		uc003dgz.3	Q8NE62	OTTHUMG00000158281	ENST00000315251.6:c.119A>C	3.37:g.53857917T>G	ENSP00000319851:p.Glu40Ala	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	19	13	NM_018397	0	0	0	1	1	Q9NY17	Missense_Mutation	SNP	ENST00000315251.6	37	CCDS2873.1	536	0.2454212454212454	164	0.3333333333333333	82	0.2265193370165746	201	0.3513986013986014	89	0.11741424802110818	T	14.21	2.467073	0.43839	0.227679	0.063862	ENSG00000016391	ENST00000315251;ENST00000481668;ENST00000467802	T;T;T	0.68479	-0.33;1.42;-0.33	5.03	3.8	0.43715	.	0.330341	0.32134	N	0.006528	T	0.00012	0.0000	N	0.08118	0	0.37702	P	0.07576799999999995	B	0.17465	0.022	B	0.12156	0.007	T	0.12372	-1.0550	9	0.56958	D	0.05	-41.8442	8.4332	0.32771	0.0:0.0:0.1978:0.8022	rs9001;rs3172489;rs58735855;rs9001	40	Q8NE62	CHDH_HUMAN	A	40	ENSP00000319851:E40A;ENSP00000418273:E40A;ENSP00000419863:E40A	ENSP00000319851:E40A	E	-	2	0	CHDH	53832957	0.187000	0.23238	0.988000	0.46212	0.816000	0.46133	1.016000	0.29976	2.240000	0.73641	0.533000	0.62120	GAG	T|0.749;G|0.251		0.761	CHDH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350567.2	NM_018397	
LRIG1	26018	hgsc.bcm.edu	37	3	66550756	66550756	+	Missense_Mutation	SNP	G	G	C	rs1403625	byFrequency	TCGA-OR-A5LG-01A-11D-A29I-10	TCGA-OR-A5LG-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a39e8bc9-757d-4536-b301-458fc7ec992d	6b9e8d41-7044-4151-b4d6-e211b0e7a923	g.chr3:66550756G>C	ENST00000273261.3	-	1	600	c.76C>G	c.(76-78)Ctt>Gtt	p.L26V	LRIG1_ENST00000383703.3_Missense_Mutation_p.L26V	NM_015541.2	NP_056356.2	Q96JA1	LRIG1_HUMAN	leucine-rich repeats and immunoglobulin-like domains 1	26				LLL -> VLV (in Ref. 1; AAK62357 and 3; AAH71561). {ECO:0000305}.	innervation (GO:0060384)|otolith morphogenesis (GO:0032474)|sensory perception of sound (GO:0007605)	integral component of membrane (GO:0016021)				NS(2)|breast(2)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(7)|lung(12)|ovary(3)|prostate(1)|skin(4)|stomach(4)|urinary_tract(1)	42		Lung NSC(201;0.0101)		BRCA - Breast invasive adenocarcinoma(55;0.00047)		TCCAGCCGAAGCAAAAGCAGC	0.761													g|||	3605	0.719848	0.1808	0.8833	5008	,	,		8093	0.8284		0.9732	False		,,,				2504	0.9601				p.L26V		.											.	LRIG1-230	0			c.C76G						.		VAL/LEU	1298,1386		255,788,299	3.0	4.0	4.0		76	2.9	0.5	3	dbSNP_88	4	5191,89		2555,81,4	yes	missense	LRIG1	NM_015541.2	32	2810,869,303	CC,CG,GG		1.6856,48.3607,18.5208	benign	26/1094	66550756	6489,1475	1342	2640	3982	SO:0001583	missense	26018	exon1			GCCGAAGCAAAAG	AB050468	CCDS33783.1	3p14	2013-01-14			ENSG00000144749	ENSG00000144749		"""Immunoglobulin superfamily / I-set domain containing"""	17360	protein-coding gene	gene with protein product	"""ortholog of mouse integral membrane glycoprotein LIG-1"", ""leucine-rich repeat protein LRIG1"""	608868				11414704, 12234026	Standard	NM_015541		Approved	LIG-1, DKFZP586O1624, LIG1	uc003dmx.3	Q96JA1	OTTHUMG00000158727	ENST00000273261.3:c.76C>G	3.37:g.66550756G>C	ENSP00000273261:p.Leu26Val	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	15	15	NM_015541	0	0	0	0	0	Q6IQ51|Q96CF9|Q9BYB8|Q9UFI4	Missense_Mutation	SNP	ENST00000273261.3	37	CCDS33783.1	1666	0.7628205128205128	118	0.23983739837398374	325	0.8977900552486188	489	0.8548951048951049	734	0.9683377308707124	g	6.572	0.473779	0.12521	0.483607	0.983144	ENSG00000144749	ENST00000273261;ENST00000383703	T;T	0.67345	-0.26;-0.13	3.84	2.93	0.34026	.	0.847359	0.09512	U	0.792175	T	0.00012	0.0000	N	0.19112	0.55	0.80722	P	0.0	P;P	0.44139	0.827;0.484	B;B	0.37731	0.257;0.096	T	0.48854	-0.8998	9	0.23302	T	0.38	.	8.6883	0.34251	0.1185:0.0:0.8815:0.0	rs1403625;rs13083628	26;26	Q96JA1-2;Q96JA1	.;LRIG1_HUMAN	V	26	ENSP00000273261:L26V;ENSP00000373208:L26V	ENSP00000273261:L26V	L	-	1	0	LRIG1	66633446	.	.	0.520000	0.27837	0.020000	0.10135	.	.	1.845000	0.53610	0.472000	0.43445	CTT	G|0.237;C|0.763		0.761	LRIG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351930.1	NM_015541	
LRIG1	26018	hgsc.bcm.edu	37	3	66550762	66550762	+	Missense_Mutation	SNP	G	G	C	rs1403626	byFrequency	TCGA-OR-A5LG-01A-11D-A29I-10	TCGA-OR-A5LG-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a39e8bc9-757d-4536-b301-458fc7ec992d	6b9e8d41-7044-4151-b4d6-e211b0e7a923	g.chr3:66550762G>C	ENST00000273261.3	-	1	594	c.70C>G	c.(70-72)Ctt>Gtt	p.L24V	LRIG1_ENST00000383703.3_Missense_Mutation_p.L24V	NM_015541.2	NP_056356.2	Q96JA1	LRIG1_HUMAN	leucine-rich repeats and immunoglobulin-like domains 1	24			L -> V (in dbSNP:rs1403626).	LLL -> VLV (in Ref. 1; AAK62357 and 3; AAH71561). {ECO:0000305}.	innervation (GO:0060384)|otolith morphogenesis (GO:0032474)|sensory perception of sound (GO:0007605)	integral component of membrane (GO:0016021)				NS(2)|breast(2)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(7)|lung(12)|ovary(3)|prostate(1)|skin(4)|stomach(4)|urinary_tract(1)	42		Lung NSC(201;0.0101)		BRCA - Breast invasive adenocarcinoma(55;0.00047)		CGAAGCAAAAGCAGCCAGAGA	0.766													g|||	3605	0.719848	0.1808	0.8833	5008	,	,		8368	0.8284		0.9732	False		,,,				2504	0.9601				p.L24V		.											.	LRIG1-230	0			c.C70G						.		VAL/LEU	1309,1447		265,779,334	3.0	4.0	4.0		70	3.1	0.5	3	dbSNP_88	4	5325,93		2620,85,4	no	missense	LRIG1	NM_015541.2	32	2885,864,338	CC,CG,GG		1.7165,47.4964,18.8402	benign	24/1094	66550762	6634,1540	1378	2709	4087	SO:0001583	missense	26018	exon1			GCAAAAGCAGCCA	AB050468	CCDS33783.1	3p14	2013-01-14			ENSG00000144749	ENSG00000144749		"""Immunoglobulin superfamily / I-set domain containing"""	17360	protein-coding gene	gene with protein product	"""ortholog of mouse integral membrane glycoprotein LIG-1"", ""leucine-rich repeat protein LRIG1"""	608868				11414704, 12234026	Standard	NM_015541		Approved	LIG-1, DKFZP586O1624, LIG1	uc003dmx.3	Q96JA1	OTTHUMG00000158727	ENST00000273261.3:c.70C>G	3.37:g.66550762G>C	ENSP00000273261:p.Leu24Val	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	18	18	NM_015541	0	0	0	0	0	Q6IQ51|Q96CF9|Q9BYB8|Q9UFI4	Missense_Mutation	SNP	ENST00000273261.3	37	CCDS33783.1	1670	0.7646520146520146	119	0.241869918699187	326	0.9005524861878453	488	0.8531468531468531	737	0.9722955145118733	g	9.592	1.126319	0.20959	0.474964	0.982835	ENSG00000144749	ENST00000273261;ENST00000383703	T;T	0.68765	-0.35;-0.2	3.11	3.11	0.35812	.	0.429988	0.15146	U	0.278020	T	0.00012	0.0000	N	0.19112	0.55	0.39998	P	0.024872000000000005	P;B	0.36282	0.546;0.282	B;B	0.32465	0.146;0.069	T	0.40572	-0.9556	9	0.23891	T	0.37	.	12.0321	0.53403	0.0:0.0:1.0:0.0	rs1403626;rs13083630;rs1403626	24;24	Q96JA1-2;Q96JA1	.;LRIG1_HUMAN	V	24	ENSP00000273261:L24V;ENSP00000373208:L24V	ENSP00000273261:L24V	L	-	1	0	LRIG1	66633452	.	.	0.546000	0.28166	0.017000	0.09413	.	.	1.734000	0.51633	0.472000	0.43445	CTT	G|0.252;C|0.748		0.766	LRIG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351930.1	NM_015541	
CASR	846	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	122003707	122003707	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5LG-01A-11D-A29I-10	TCGA-OR-A5LG-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a39e8bc9-757d-4536-b301-458fc7ec992d	6b9e8d41-7044-4151-b4d6-e211b0e7a923	g.chr3:122003707G>A	ENST00000490131.1	+	7	3278	c.2906G>A	c.(2905-2907)gGc>gAc	p.G969D	CASR_ENST00000296154.5_Missense_Mutation_p.G969D|AC068754.1_ENST00000408547.1_RNA|CASR_ENST00000498619.1_Missense_Mutation_p.G979D	NM_000388.3	NP_000379	P41180	CASR_HUMAN	calcium-sensing receptor	969					anatomical structure morphogenesis (GO:0009653)|calcium ion import (GO:0070509)|cellular calcium ion homeostasis (GO:0006874)|chemosensory behavior (GO:0007635)|detection of calcium ion (GO:0005513)|G-protein coupled receptor signaling pathway (GO:0007186)|metabolic process (GO:0008152)|ossification (GO:0001503)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|phosphatidylinositol phospholipase C activity (GO:0004435)			NS(1)|breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(13)|lung(45)|ovary(4)|prostate(3)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	84				GBM - Glioblastoma multiforme(114;0.226)	Cinacalcet(DB01012)	GTCATCTTTGGCAGCGGCACG	0.587																																					p.G979D		.											.	CASR-97	0			c.G2936A						.						77.0	73.0	74.0					3																	122003707		2203	4300	6503	SO:0001583	missense	846	exon7			TCTTTGGCAGCGG	U20760	CCDS3010.1, CCDS54632.1	3q21.1	2012-08-29	2008-08-01		ENSG00000036828	ENSG00000036828		"""GPCR / Class C : Calcium-sensing receptors"""	1514	protein-coding gene	gene with protein product	"""severe neonatal hyperparathyroidism"""	601199	"""hypocalciuric hypercalcemia 1"""	HHC, HHC1		7677761	Standard	NM_000388		Approved	FHH, NSHPT, GPRC2A	uc003eew.4	P41180	OTTHUMG00000159491	ENST00000490131.1:c.2906G>A	3.37:g.122003707G>A	ENSP00000418685:p.Gly969Asp	Somatic	366	0		WXS	Illumina GAIIx	Phase_I	376	158	NM_001178065	0	0	0	0	0	Q13912|Q16108|Q16109|Q16110|Q16379|Q2M1T0|Q4PJ19	Missense_Mutation	SNP	ENST00000490131.1	37	CCDS3010.1	.	.	.	.	.	.	.	.	.	.	G	21.6	4.167486	0.78339	.	.	ENSG00000036828	ENST00000490131;ENST00000498619;ENST00000296154	D;D;D	0.91351	-2.83;-2.81;-2.83	5.79	5.79	0.91817	.	0.000000	0.85682	D	0.000000	D	0.93054	0.7789	L	0.34521	1.04	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	D	0.93638	0.6962	10	0.87932	D	0	.	19.0289	0.92946	0.0:0.0:1.0:0.0	.	979;969	E7ENE0;P41180	.;CASR_HUMAN	D	969;979;969	ENSP00000418685:G969D;ENSP00000420194:G979D;ENSP00000296154:G969D	ENSP00000296154:G969D	G	+	2	0	CASR	123486397	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	7.300000	0.78841	2.746000	0.94184	0.561000	0.74099	GGC	.		0.587	CASR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355761.1	NM_000388	
EFCC1	79825	hgsc.bcm.edu	37	3	128720487	128720487	+	Missense_Mutation	SNP	A	A	G	rs1871951	byFrequency	TCGA-OR-A5LG-01A-11D-A29I-10	TCGA-OR-A5LG-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a39e8bc9-757d-4536-b301-458fc7ec992d	6b9e8d41-7044-4151-b4d6-e211b0e7a923	g.chr3:128720487A>G	ENST00000480450.1	+	1	16	c.16A>G	c.(16-18)Acg>Gcg	p.T6A	EFCC1_ENST00000436022.2_5'UTR|KIAA1257_ENST00000510149.1_Intron			Q9HA90	EFCC1_HUMAN	EF-hand and coiled-coil domain containing 1	6							calcium ion binding (GO:0005509)										GCCGGTCAGCACGGGCGCGGA	0.756													G|||	3483	0.695487	0.9592	0.6052	5008	,	,		11644	0.6677		0.5915	False		,,,				2504	0.5389				p.T6A		.											.	.	0			c.A16G						.						2.0	4.0	3.0					3																	128720487		494	1283	1777	SO:0001583	missense	79825	exon1			GTCAGCACGGGCG	AK022119	CCDS3054.1, CCDS3054.2	3q21.3	2013-01-11	2013-01-11	2013-01-11	ENSG00000114654	ENSG00000114654		"""EF-hand domain containing"""	25692	protein-coding gene	gene with protein product			"""chromosome 3 open reading frame 73"", ""coiled-coil domain containing 48"""	C3orf73, CCDC48			Standard	NM_024768		Approved	FLJ12057	uc011bkt.2	Q9HA90	OTTHUMG00000158996	ENST00000480450.1:c.16A>G	3.37:g.128720487A>G	ENSP00000420075:p.Thr6Ala	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	12	12	NM_024768	0	0	0	0	0	A8MYE2	Missense_Mutation	SNP	ENST00000480450.1	37	CCDS3054.2	1498	0.6858974358974359	465	0.9451219512195121	229	0.6325966850828729	362	0.6328671328671329	442	0.58311345646438	g	0.361	-0.939497	0.02322	.	.	ENSG00000114654	ENST00000480450	T	0.41400	1.0	2.78	-3.05	0.05396	.	.	.	.	.	T	0.00012	0.0000	N	0.08118	0	0.58432	P	6.999999999979245E-6	B	0.02656	0.0	B	0.01281	0.0	T	0.37407	-0.9707	8	0.02654	T	1	.	3.5784	0.07943	0.1405:0.2998:0.4439:0.1159	rs1871951	6	Q9HA90	CCD48_HUMAN	A	6	ENSP00000420075:T6A	ENSP00000420075:T6A	T	+	1	0	CCDC48	130203177	0.000000	0.05858	0.000000	0.03702	0.007000	0.05969	-1.263000	0.02850	-0.802000	0.04421	-0.701000	0.03672	ACG	A|0.315;G|0.685		0.756	EFCC1-001	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000352832.1	NM_024768	
CRIPAK	285464	hgsc.bcm.edu	37	4	1388726	1388726	+	Missense_Mutation	SNP	T	T	C	rs199689156	byFrequency	TCGA-OR-A5LG-01A-11D-A29I-10	TCGA-OR-A5LG-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a39e8bc9-757d-4536-b301-458fc7ec992d	6b9e8d41-7044-4151-b4d6-e211b0e7a923	g.chr4:1388726T>C	ENST00000324803.4	+	1	3387	c.427T>C	c.(427-429)Tgc>Cgc	p.C143R		NM_175918.3	NP_787114.2	Q8N1N5	CRPAK_HUMAN	cysteine-rich PAK1 inhibitor	143					negative regulation of intracellular estrogen receptor signaling pathway (GO:0033147)|negative regulation of protein kinase activity (GO:0006469)|regulation of cytoskeleton organization (GO:0051493)|response to estrogen (GO:0043627)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				NS(3)|breast(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(11)|ovary(1)|pancreas(2)|prostate(6)|skin(4)|urinary_tract(1)	35			OV - Ovarian serous cystadenocarcinoma(23;0.0106)			CACGTGCCCATGCGGAGTGCC	0.697																																					p.C143R		.											.	CRIPAK-90	0			c.T427C						.						38.0	37.0	37.0					4																	1388726		1908	3685	5593	SO:0001583	missense	285464	exon1			TGCCCATGCGGAG	AK096209	CCDS3349.1	4p16.3	2011-02-10	2006-09-04		ENSG00000179979	ENSG00000179979			26619	protein-coding gene	gene with protein product		610203	"""cysteine-rich PAK1inhibitor"""			16278681	Standard	NM_175918		Approved	FLJ34443	uc003gdf.2	Q8N1N5	OTTHUMG00000121131	ENST00000324803.4:c.427T>C	4.37:g.1388726T>C	ENSP00000323978:p.Cys143Arg	Somatic	23	0		WXS	Illumina GAIIx	Phase_I	152	22	NM_175918	0	0	9	9	0	Q8NB03	Missense_Mutation	SNP	ENST00000324803.4	37	CCDS3349.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	-|-	8.608|8.608	0.888529|0.888529	0.17540|0.17540	.|.	.|.	ENSG00000179979|ENSG00000179979	ENST00000324803|ENST00000382944	T|.	0.29142|.	1.58|.	0.948|0.948	-0.668|-0.668	0.11392|0.11392	Post-SET domain (1);|.	.|.	.|.	.|.	.|.	T|T	0.12860|0.12860	0.0312|0.0312	N|N	0.08118|0.08118	0|0	0.09310|0.09310	N|N	1|1	B|.	0.27594|.	0.182|.	B|.	0.13407|.	0.009|.	T|T	0.30621|0.30621	-0.9972|-0.9972	9|6	0.51188|0.06365	T|T	0.08|0.9	.|.	4.4755|4.4755	0.11733|0.11733	0.0:0.2357:0.0:0.7643|0.0:0.2357:0.0:0.7643	.|.	143|.	Q8N1N5|.	CRPAK_HUMAN|.	R|T	143|126	ENSP00000323978:C143R|.	ENSP00000323978:C143R|ENSP00000372402:M126T	C|M	+|+	1|2	0|0	CRIPAK|CRIPAK	1378726|1378726	0.000000|0.000000	0.05858|0.05858	0.001000|0.001000	0.08648|0.08648	0.008000|0.008000	0.06430|0.06430	-0.703000|-0.703000	0.05063|0.05063	-0.155000|-0.155000	0.11098|0.11098	0.102000|0.102000	0.15555|0.15555	TGC|ATG	T|0.980;C|0.020		0.697	CRIPAK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000241607.2	NM_175918	
CRIPAK	285464	bcgsc.ca	37	4	1388817	1388817	+	Missense_Mutation	SNP	C	C	G	rs200606324	byFrequency	TCGA-OR-A5LG-01A-11D-A29I-10	TCGA-OR-A5LG-10A-01D-A29L-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a39e8bc9-757d-4536-b301-458fc7ec992d	6b9e8d41-7044-4151-b4d6-e211b0e7a923	g.chr4:1388817C>G	ENST00000324803.4	+	1	3478	c.518C>G	c.(517-519)cCa>cGa	p.P173R		NM_175918.3	NP_787114.2	Q8N1N5	CRPAK_HUMAN	cysteine-rich PAK1 inhibitor	173					negative regulation of intracellular estrogen receptor signaling pathway (GO:0033147)|negative regulation of protein kinase activity (GO:0006469)|regulation of cytoskeleton organization (GO:0051493)|response to estrogen (GO:0043627)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				NS(3)|breast(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(11)|ovary(1)|pancreas(2)|prostate(6)|skin(4)|urinary_tract(1)	35			OV - Ovarian serous cystadenocarcinoma(23;0.0106)			CACACGTGCCCATGTGGAGTG	0.677													N|||	940	0.1877	0.3328	0.1398	5008	,	,		18475	0.0992		0.0378	False		,,,				2504	0.271				p.P173R		.											.	CRIPAK-90	0			c.C518G						.						192.0	130.0	151.0					4																	1388817		2194	4201	6395	SO:0001583	missense	285464	exon1			CGTGCCCATGTGG	AK096209	CCDS3349.1	4p16.3	2011-02-10	2006-09-04		ENSG00000179979	ENSG00000179979			26619	protein-coding gene	gene with protein product		610203	"""cysteine-rich PAK1inhibitor"""			16278681	Standard	NM_175918		Approved	FLJ34443	uc003gdf.2	Q8N1N5	OTTHUMG00000121131	ENST00000324803.4:c.518C>G	4.37:g.1388817C>G	ENSP00000323978:p.Pro173Arg	Somatic	29	1		WXS	Illumina GAIIx	Phase_I	193	51	NM_175918	0	0	122	122	0	Q8NB03	Missense_Mutation	SNP	ENST00000324803.4	37	CCDS3349.1	.	.	.	.	.	.	.	.	.	.	c	1.909	-0.451230	0.04572	.	.	ENSG00000179979	ENST00000324803	T	0.19250	2.16	1.25	0.276	0.15663	Post-SET domain (1);	.	.	.	.	T	0.08358	0.0208	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.40079	-0.9582	9	0.17369	T	0.5	.	4.4738	0.11726	0.0:0.5796:0.2425:0.1779	.	173	Q8N1N5	CRPAK_HUMAN	R	173	ENSP00000323978:P173R	ENSP00000323978:P173R	P	+	2	0	CRIPAK	1378817	0.000000	0.05858	0.000000	0.03702	0.011000	0.07611	-0.368000	0.07543	-0.338000	0.08413	-1.976000	0.00459	CCA	CATGT|0.500;GACGC|0.500		0.677	CRIPAK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000241607.2	NM_175918	
CRIPAK	285464	bcgsc.ca	37	4	1388819	1388819	+	Missense_Mutation	SNP	T	T	C	rs144797159	byFrequency	TCGA-OR-A5LG-01A-11D-A29I-10	TCGA-OR-A5LG-10A-01D-A29L-10	T	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a39e8bc9-757d-4536-b301-458fc7ec992d	6b9e8d41-7044-4151-b4d6-e211b0e7a923	g.chr4:1388819T>C	ENST00000324803.4	+	1	3480	c.520T>C	c.(520-522)Tgt>Cgt	p.C174R		NM_175918.3	NP_787114.2	Q8N1N5	CRPAK_HUMAN	cysteine-rich PAK1 inhibitor	174					negative regulation of intracellular estrogen receptor signaling pathway (GO:0033147)|negative regulation of protein kinase activity (GO:0006469)|regulation of cytoskeleton organization (GO:0051493)|response to estrogen (GO:0043627)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				NS(3)|breast(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(11)|ovary(1)|pancreas(2)|prostate(6)|skin(4)|urinary_tract(1)	35			OV - Ovarian serous cystadenocarcinoma(23;0.0106)			CACGTGCCCATGTGGAGTGCC	0.677													N|||	940	0.1877	0.3328	0.1398	5008	,	,		17297	0.0992		0.0378	False		,,,				2504	0.271				p.C174R		.											.	CRIPAK-90	0			c.T520C						.						191.0	130.0	151.0					4																	1388819		2194	4196	6390	SO:0001583	missense	285464	exon1			TGCCCATGTGGAG	AK096209	CCDS3349.1	4p16.3	2011-02-10	2006-09-04		ENSG00000179979	ENSG00000179979			26619	protein-coding gene	gene with protein product		610203	"""cysteine-rich PAK1inhibitor"""			16278681	Standard	NM_175918		Approved	FLJ34443	uc003gdf.2	Q8N1N5	OTTHUMG00000121131	ENST00000324803.4:c.520T>C	4.37:g.1388819T>C	ENSP00000323978:p.Cys174Arg	Somatic	30	1		WXS	Illumina GAIIx	Phase_I	190	43	NM_175918	0	0	103	103	0	Q8NB03	Missense_Mutation	SNP	ENST00000324803.4	37	CCDS3349.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	t|t	2.950|2.950	-0.216975|-0.216975	0.06101|0.06101	.|.	.|.	ENSG00000179979|ENSG00000179979	ENST00000324803|ENST00000382944	T|.	0.29142|.	1.58|.	1.25|1.25	-0.146|-0.146	0.13432|0.13432	Post-SET domain (1);|.	.|.	.|.	.|.	.|.	T|T	0.15825|0.15825	0.0381|0.0381	N|N	0.08118|0.08118	0|0	0.09310|0.09310	N|N	1|1	B|.	0.20052|.	0.041|.	B|.	0.11329|.	0.006|.	T|T	0.24977|0.24977	-1.0145|-1.0145	9|6	0.66056|0.27082	D|T	0.02|0.32	.|.	4.6847|4.6847	0.12752|0.12752	0.0:0.2124:0.0:0.7876|0.0:0.2124:0.0:0.7876	.|.	174|.	Q8N1N5|.	CRPAK_HUMAN|.	R|T	174|157	ENSP00000323978:C174R|.	ENSP00000323978:C174R|ENSP00000372402:M157T	C|M	+|+	1|2	0|0	CRIPAK|CRIPAK	1378819|1378819	0.000000|0.000000	0.05858|0.05858	0.003000|0.003000	0.11579|0.11579	0.014000|0.014000	0.08584|0.08584	-0.160000|-0.160000	0.10041|0.10041	-0.013000|-0.013000	0.14199|0.14199	0.102000|0.102000	0.15555|0.15555	TGT|ATG	T|0.950;C|0.050		0.677	CRIPAK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000241607.2	NM_175918	
MSX1	4487	hgsc.bcm.edu	37	4	4861745	4861745	+	Missense_Mutation	SNP	C	C	G	rs36059701	byFrequency	TCGA-OR-A5LG-01A-11D-A29I-10	TCGA-OR-A5LG-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a39e8bc9-757d-4536-b301-458fc7ec992d	6b9e8d41-7044-4151-b4d6-e211b0e7a923	g.chr4:4861745C>G	ENST00000382723.4	+	1	353	c.119C>G	c.(118-120)gCa>gGa	p.A40G		NM_002448.3	NP_002439.2	P28360	MSX1_HUMAN	msh homeobox 1	40	Poly-Ala.				activation of meiosis (GO:0090427)|anterior/posterior pattern specification (GO:0009952)|BMP signaling pathway involved in heart development (GO:0061312)|bone morphogenesis (GO:0060349)|cartilage morphogenesis (GO:0060536)|cell morphogenesis (GO:0000902)|cellular response to nicotine (GO:0071316)|embryonic forelimb morphogenesis (GO:0035115)|embryonic hindlimb morphogenesis (GO:0035116)|embryonic nail plate morphogenesis (GO:0035880)|epithelial to mesenchymal transition involved in endocardial cushion formation (GO:0003198)|face morphogenesis (GO:0060325)|in utero embryonic development (GO:0001701)|mammary gland epithelium development (GO:0061180)|mesenchymal cell proliferation (GO:0010463)|midbrain development (GO:0030901)|middle ear morphogenesis (GO:0042474)|muscle organ development (GO:0007517)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of striated muscle cell differentiation (GO:0051154)|negative regulation of transcription regulatory region DNA binding (GO:2000678)|odontogenesis of dentin-containing tooth (GO:0042475)|palate development (GO:0060021)|pituitary gland development (GO:0021983)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043517)|positive regulation of intrinsic apoptotic signaling pathway by p53 class mediator (GO:1902255)|positive regulation of mesenchymal cell apoptotic process (GO:2001055)|protein localization to nucleus (GO:0034504)|protein stabilization (GO:0050821)|regulation of odontogenesis (GO:0042481)|signal transduction involved in regulation of gene expression (GO:0023019)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	p53 binding (GO:0002039)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity (GO:0000982)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001227)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)			endometrium(3)|lung(5)|ovary(1)|prostate(1)|urinary_tract(1)	11				UCEC - Uterine corpus endometrioid carcinoma (64;0.163)		gcggccACGGCAGCCGCCATG	0.716													C|||	519	0.103634	0.0893	0.1037	5008	,	,		6085	0.0565		0.165	False		,,,				2504	0.1084				p.A40G		.											.	MSX1-90	0			c.C119G	GRCh37	CM045070	MSX1	M	rs36059701	.	C	GLY/ALA	241,2261		15,211,1025	3.0	4.0	4.0		119	2.9	0.4	4	dbSNP_126	4	677,4129		58,561,1784	no	missense	MSX1	NM_002448.3	60	73,772,2809	GG,GC,CC		14.0866,9.6323,12.5616	benign	40/304	4861745	918,6390	1251	2403	3654	SO:0001583	missense	4487	exon1			CCACGGCAGCCGC	M97676	CCDS3378.2	4p16.2	2011-06-20	2006-11-21		ENSG00000163132	ENSG00000163132		"""Homeoboxes / ANTP class : NKL subclass"""	7391	protein-coding gene	gene with protein product		142983	"""msh (Drosophila) homeo box homolog 1 (formerly homeo box 7)"", ""msh homeobox homolog 1 (Drosophila)"""	HOX7		1685479, 1973146	Standard	NM_002448		Approved	HYD1, OFC5	uc003gif.3	P28360	OTTHUMG00000090335	ENST00000382723.4:c.119C>G	4.37:g.4861745C>G	ENSP00000372170:p.Ala40Gly	Somatic	1	0		WXS	Illumina GAIIx	Phase_I	9	5	NM_002448	0	0	1	1	0	A0SZU5|A8K3M1|Q96NY4	Missense_Mutation	SNP	ENST00000382723.4	37	CCDS3378.2	290	0.13278388278388278	53	0.10772357723577236	45	0.12430939226519337	44	0.07692307692307693	148	0.19525065963060687	C	6.955	0.546124	0.13312	0.096323	0.140866	ENSG00000163132	ENST00000382723	D	0.95885	-3.84	4.66	2.92	0.33932	.	0.650131	0.15386	N	0.265060	T	0.00552	0.0018	N	0.24115	0.695	0.51767	P	6.20000000000065E-5	B	0.16166	0.016	B	0.15870	0.014	T	0.44003	-0.9356	9	0.11182	T	0.66	-4.3518	5.025	0.14379	0.1663:0.6515:0.0:0.1822	rs36059701	34	P28360	MSX1_HUMAN	G	40	ENSP00000372170:A40G	ENSP00000372170:A40G	A	+	2	0	MSX1	4912646	0.996000	0.38824	0.367000	0.25926	0.047000	0.14425	0.572000	0.23684	0.390000	0.25115	0.491000	0.48974	GCA	C|0.867;G|0.133		0.716	MSX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206700.3		
SOD3	6649	hgsc.bcm.edu	37	4	24801354	24801354	+	Silent	SNP	C	C	T	rs8192291	byFrequency	TCGA-OR-A5LG-01A-11D-A29I-10	TCGA-OR-A5LG-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a39e8bc9-757d-4536-b301-458fc7ec992d	6b9e8d41-7044-4151-b4d6-e211b0e7a923	g.chr4:24801354C>T	ENST00000382120.3	+	2	416	c.211C>T	c.(211-213)Ctg>Ttg	p.L71L		NM_003102.2	NP_003093.2	P08294	SODE_HUMAN	superoxide dismutase 3, extracellular	71					removal of superoxide radicals (GO:0019430)|response to copper ion (GO:0046688)|response to hypoxia (GO:0001666)	cytoplasm (GO:0005737)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|nucleus (GO:0005634)|trans-Golgi network (GO:0005802)	copper ion binding (GO:0005507)|heparin binding (GO:0008201)|superoxide dismutase activity (GO:0004784)|zinc ion binding (GO:0008270)			prostate(1)|urinary_tract(1)	2		Breast(46;0.0503)				GTCGGCCACGCTGGACGCCGC	0.726													C|||	994	0.198482	0.0968	0.1585	5008	,	,		11823	0.3512		0.2028	False		,,,				2504	0.2025				p.L71L		.											.	SOD3-90	0			c.C211T						.	C		341,3293		12,317,1488	4.0	5.0	5.0		211	0.7	0.0	4	dbSNP_117	5	1103,6325		63,977,2674	no	coding-synonymous	SOD3	NM_003102.2		75,1294,4162	TT,TC,CC		14.8492,9.3836,13.0537		71/241	24801354	1444,9618	1817	3714	5531	SO:0001819	synonymous_variant	6649	exon2			GCCACGCTGGACG		CCDS3430.1	4p15.2	2012-09-20			ENSG00000109610	ENSG00000109610	1.15.1.1		11181	protein-coding gene	gene with protein product		185490					Standard	NM_003102		Approved	EC-SOD	uc003gqz.3	P08294	OTTHUMG00000128565	ENST00000382120.3:c.211C>T	4.37:g.24801354C>T		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	37	21	NM_003102	0	0	0	1	1	Q5U781|Q6FHA2	Silent	SNP	ENST00000382120.3	37	CCDS3430.1																																																																																			C|0.777;T|0.223		0.726	SOD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250416.1		
ZAR1	326340	hgsc.bcm.edu	37	4	48492434	48492434	+	Missense_Mutation	SNP	G	G	C	rs10008444	byFrequency	TCGA-OR-A5LG-01A-11D-A29I-10	TCGA-OR-A5LG-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a39e8bc9-757d-4536-b301-458fc7ec992d	6b9e8d41-7044-4151-b4d6-e211b0e7a923	g.chr4:48492434G>C	ENST00000327939.4	+	1	166	c.126G>C	c.(124-126)caG>caC	p.Q42H		NM_175619.1	NP_783318.1	Q86SH2	ZAR1_HUMAN	zygote arrest 1	42					multicellular organismal development (GO:0007275)	cytoplasm (GO:0005737)				endometrium(1)|large_intestine(4)	5						GCTGGCAGCAGCGCGGCAGGG	0.756													C|||	4938	0.986022	0.9493	0.9957	5008	,	,		9261	1.0		1.0	False		,,,				2504	1.0				p.Q42H		.											.	ZAR1-90	0			c.G126C						.	C	HIS/GLN	2851,89		1381,89,0	2.0	3.0	3.0		126	-0.2	0.0	4	dbSNP_119	3	6474,0		3237,0,0	no	missense	ZAR1	NM_175619.1	24	4618,89,0	CC,CG,GG		0.0,3.0272,0.9454	benign	42/425	48492434	9325,89	1470	3237	4707	SO:0001583	missense	326340	exon1			GCAGCAGCGCGGC	AY193890	CCDS3483.1	4p11	2014-02-20			ENSG00000182223	ENSG00000182223			20436	protein-coding gene	gene with protein product	"""zinc finger, 3CxxC-type 6"""	607520				12539046	Standard	NM_175619		Approved	Z3CXXC6	uc003gyd.3	Q86SH2	OTTHUMG00000102093	ENST00000327939.4:c.126G>C	4.37:g.48492434G>C	ENSP00000329803:p.Gln42His	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	16	16	NM_175619	0	0	0	0	0		Missense_Mutation	SNP	ENST00000327939.4	37	CCDS3483.1	2130	0.9752747252747253	449	0.9126016260162602	359	0.9917127071823204	565	0.9877622377622378	757	0.9986807387862797	C	0.021	-1.426522	0.01117	0.969728	1.0	ENSG00000182223	ENST00000327939	.	.	.	4.09	-0.185	0.13276	.	0.811302	0.10779	N	0.635071	T	0.00012	0.0000	N	0.03608	-0.345	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.22103	-1.0226	8	0.14252	T	0.57	-31.571	6.2995	0.21105	0.0:0.2927:0.4307:0.2766	rs10008444;rs58304706	42	Q86SH2	ZAR1_HUMAN	H	42	.	ENSP00000329803:Q42H	Q	+	3	2	ZAR1	48187191	0.000000	0.05858	0.000000	0.03702	0.070000	0.16714	0.053000	0.14184	-0.405000	0.07599	-0.676000	0.03789	CAG	G|0.025;C|0.975		0.756	ZAR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219927.3		
SHROOM3	57619	hgsc.bcm.edu	37	4	77662248	77662248	+	Silent	SNP	G	G	A	rs344142	byFrequency	TCGA-OR-A5LG-01A-11D-A29I-10	TCGA-OR-A5LG-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a39e8bc9-757d-4536-b301-458fc7ec992d	6b9e8d41-7044-4151-b4d6-e211b0e7a923	g.chr4:77662248G>A	ENST00000296043.6	+	5	3875	c.2922G>A	c.(2920-2922)tcG>tcA	p.S974S		NM_020859.3	NP_065910.3	Q8TF72	SHRM3_HUMAN	shroom family member 3	974	ASD1. {ECO:0000255|PROSITE- ProRule:PRU00637}.				actin cytoskeleton organization (GO:0030036)|apical protein localization (GO:0045176)|cell morphogenesis (GO:0000902)|cellular pigment accumulation (GO:0043482)|columnar/cuboidal epithelial cell development (GO:0002066)|neural tube closure (GO:0001843)|pattern specification process (GO:0007389)|regulation of cell shape (GO:0008360)	adherens junction (GO:0005912)|apical junction complex (GO:0043296)|apical plasma membrane (GO:0016324)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|microtubule (GO:0005874)				NS(3)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(10)|kidney(2)|large_intestine(6)|lung(29)|ovary(1)|skin(5)|upper_aerodigestive_tract(1)	60			Lung(101;0.0903)			CCGAGGCGTCGGCCTCCGCCT	0.776													G|||	2165	0.432308	0.4054	0.4827	5008	,	,		9965	0.2669		0.6044	False		,,,				2504	0.4264				p.S974S		.											.	SHROOM3-93	0			c.G2922A						.	G		1740,1410		550,640,385	2.0	3.0	3.0		2922	0.4	0.0	4	dbSNP_129	3	4503,2047		1663,1177,435	no	coding-synonymous	SHROOM3	NM_020859.3		2213,1817,820	AA,AG,GG		31.2519,44.7619,35.6392		974/1997	77662248	6243,3457	1575	3275	4850	SO:0001819	synonymous_variant	57619	exon5			GGCGTCGGCCTCC	AB055660	CCDS3579.2	4q21.1	2009-11-25			ENSG00000138771	ENSG00000138771			30422	protein-coding gene	gene with protein product		604570				10589677, 16615870	Standard	NM_020859		Approved	ShrmL, SHRM, KIAA1481, APXL3	uc011cbx.2	Q8TF72	OTTHUMG00000157075	ENST00000296043.6:c.2922G>A	4.37:g.77662248G>A		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	10	10	NM_020859	0	0	0	0	0	Q5QTQ3|Q6ZRW3|Q96IR9|Q9P247	Silent	SNP	ENST00000296043.6	37	CCDS3579.2																																																																																			G|0.531;A|0.469		0.776	SHROOM3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252408.2	NM_020859	
RAB3C	115827	ucsc.edu;bcgsc.ca	37	5	57913553	57913553	+	Silent	SNP	C	C	T			TCGA-OR-A5LG-01A-11D-A29I-10	TCGA-OR-A5LG-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a39e8bc9-757d-4536-b301-458fc7ec992d	6b9e8d41-7044-4151-b4d6-e211b0e7a923	g.chr5:57913553C>T	ENST00000282878.4	+	2	277	c.108C>T	c.(106-108)atC>atT	p.I36I		NM_138453.2	NP_612462.1	Q96E17	RAB3C_HUMAN	RAB3C, member RAS oncogene family	36					antigen processing and presentation (GO:0019882)|GTP catabolic process (GO:0006184)|protein transport (GO:0015031)|regulation of exocytosis (GO:0017157)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|synaptic vesicle (GO:0008021)|vesicle (GO:0031982)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|myosin V binding (GO:0031489)	p.I36M(1)		breast(1)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(7)|lung(6)|ovary(1)	21		all_cancers(5;9.93e-10)|all_epithelial(5;1.49e-10)|all_lung(5;8.97e-05)|Lung NSC(5;0.000139)|Prostate(74;0.0664)		OV - Ovarian serous cystadenocarcinoma(10;1.8e-34)		TACTCATCATCGGCAATAGCA	0.423																																					p.I36I		.											.	RAB3C-228	1	Substitution - Missense(1)	breast(1)	c.C108T						.						97.0	89.0	92.0					5																	57913553		2203	4300	6503	SO:0001819	synonymous_variant	115827	exon2			CATCATCGGCAAT	AY026936	CCDS3976.1	5q13	2008-02-05			ENSG00000152932	ENSG00000152932		"""RAB, member RAS oncogene"""	30269	protein-coding gene	gene with protein product		612829				12296628	Standard	NM_138453		Approved		uc003jrp.3	Q96E17	OTTHUMG00000097053	ENST00000282878.4:c.108C>T	5.37:g.57913553C>T		Somatic	236	3		WXS	Illumina GAIIx	Phase_I	239	98	NM_138453	0	0	0	0	0		Silent	SNP	ENST00000282878.4	37	CCDS3976.1																																																																																			.		0.423	RAB3C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214156.2	NM_138453	
TMEM171	134285	bcgsc.ca	37	5	72419456	72419456	+	Missense_Mutation	SNP	C	C	G	rs637450	byFrequency	TCGA-OR-A5LG-01A-11D-A29I-10	TCGA-OR-A5LG-10A-01D-A29L-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a39e8bc9-757d-4536-b301-458fc7ec992d	6b9e8d41-7044-4151-b4d6-e211b0e7a923	g.chr5:72419456C>G	ENST00000454765.2	+	2	729	c.256C>G	c.(256-258)Cgt>Ggt	p.R86G	TMEM171_ENST00000287773.5_Missense_Mutation_p.R86G			Q8WVE6	TM171_HUMAN	transmembrane protein 171	86			R -> G (in dbSNP:rs637450). {ECO:0000269|PubMed:12044878}.			integral component of membrane (GO:0016021)				endometrium(5)|kidney(2)|large_intestine(2)|lung(4)|prostate(1)|stomach(1)	15		Lung NSC(167;0.0378)|Ovarian(174;0.0908)|Prostate(461;0.165)		OV - Ovarian serous cystadenocarcinoma(47;1.87e-54)|Lung(70;0.115)		ACTTCAGCTCCGTGCAGGGCT	0.632													C|||	2195	0.438299	0.5325	0.3285	5008	,	,		15716	0.5933		0.2654	False		,,,				2504	0.407				p.R86G	NSCLC(112;638 2280 27369 30736)	.											.	TMEM171-68	0			c.C256G						.	C	GLY/ARG,GLY/ARG	2186,2220	586.0+/-386.4	539,1108,556	53.0	55.0	55.0		256,256	-0.8	0.0	5	dbSNP_83	55	2125,6475	364.1+/-333.4	284,1557,2459	yes	missense,missense	TMEM171	NM_001161342.1,NM_173490.6	125,125	823,2665,3015	GG,GC,CC		24.7093,49.6142,33.1462	benign,benign	86/324,86/325	72419456	4311,8695	2203	4300	6503	SO:0001583	missense	134285	exon2			CAGCTCCGTGCAG	BC018083	CCDS4017.1, CCDS54869.1	5q13.2	2008-02-05			ENSG00000157111	ENSG00000157111			27031	protein-coding gene	gene with protein product						12477932	Standard	NM_173490		Approved	PRP2	uc003kcm.2	Q8WVE6	OTTHUMG00000131269	ENST00000454765.2:c.256C>G	5.37:g.72419456C>G	ENSP00000415030:p.Arg86Gly	Somatic	77	0		WXS	Illumina GAIIx	Phase_I	86	5	NM_173490	0	0	0	0	0	Q8N0S1|Q8TDT7	Missense_Mutation	SNP	ENST00000454765.2	37	CCDS4017.1	901	0.4125457875457875	250	0.508130081300813	127	0.35082872928176795	328	0.5734265734265734	196	0.25857519788918204	C	8.646	0.897133	0.17686	0.496142	0.247093	ENSG00000157111	ENST00000454765;ENST00000287773	T;T	0.24908	1.83;1.83	5.2	-0.798	0.10905	.	0.836303	0.10116	N	0.714050	T	0.00012	0.0000	L	0.32530	0.975	0.80722	P	0.0	P;P	0.34662	0.462;0.462	B;B	0.32724	0.151;0.151	T	0.44528	-0.9322	9	0.51188	T	0.08	-0.0497	8.079	0.30733	0.4258:0.428:0.0:0.1461	rs637450;rs58426328;rs637450	86;86	Q8WVE6-2;Q8WVE6	.;TM171_HUMAN	G	86	ENSP00000415030:R86G;ENSP00000287773:R86G	ENSP00000287773:R86G	R	+	1	0	TMEM171	72455212	0.000000	0.05858	0.000000	0.03702	0.430000	0.31655	0.482000	0.22276	-0.053000	0.13289	0.462000	0.41574	CGT	C|0.636;G|0.364		0.632	TMEM171-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000254037.2	NM_173490	
SOWAHA	134548	hgsc.bcm.edu	37	5	132149684	132149684	+	Missense_Mutation	SNP	G	G	C	rs40274	byFrequency	TCGA-OR-A5LG-01A-11D-A29I-10	TCGA-OR-A5LG-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a39e8bc9-757d-4536-b301-458fc7ec992d	6b9e8d41-7044-4151-b4d6-e211b0e7a923	g.chr5:132149684G>C	ENST00000378693.2	+	1	652	c.371G>C	c.(370-372)cGg>cCg	p.R124P		NM_175873.4	NP_787069.3	Q2M3V2	SWAHA_HUMAN	sosondowah ankyrin repeat domain family member A	124	Pro-rich.		R -> P (in dbSNP:rs40274).														CCCTTGGTCCGGGTGCCGCGG	0.776																																					p.R124P		.											.	.	0			c.G371C						.	C	PRO/ARG	2599,13		1293,13,0	2.0	3.0	3.0		371	-0.3	0.0	5	dbSNP_76	3	6177,193		2993,191,1	no	missense	ANKRD43	NM_175873.4	103	4286,204,1	CC,CG,GG		3.0298,0.4977,2.2935	benign	124/550	132149684	8776,206	1306	3185	4491	SO:0001583	missense	134548	exon1			TGGTCCGGGTGCC	AK090823	CCDS43361.1	5q23.3	2013-01-10	2012-01-12	2012-01-12	ENSG00000198944	ENSG00000198944		"""Ankyrin repeat domain containing"""	27033	protein-coding gene	gene with protein product			"""ankyrin repeat domain 43"""	ANKRD43		22234889	Standard	NM_175873		Approved		uc003kxw.3	Q2M3V2	OTTHUMG00000059844	ENST00000378693.2:c.371G>C	5.37:g.132149684G>C	ENSP00000367965:p.Arg124Pro	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	25	25	NM_175873	0	0	0	0	0	Q8NAE7	Missense_Mutation	SNP	ENST00000378693.2	37	CCDS43361.1	2142	0.9807692307692307	482	0.9796747967479674	357	0.9861878453038674	562	0.9825174825174825	741	0.9775725593667546	c	9.833	1.188835	0.21954	0.995023	0.969702	ENSG00000198944	ENST00000378693	T	0.38077	1.16	4.27	-0.265	0.12946	.	2.345400	0.02245	N	0.066177	T	0.00012	0.0000	N	0.08118	0	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.36261	-0.9755	9	0.30078	T	0.28	-5.2019	3.6102	0.08057	0.2245:0.4439:0.2467:0.085	rs40274	124	Q2M3V2	ANR43_HUMAN	P	124	ENSP00000367965:R124P	ENSP00000367965:R124P	R	+	2	0	ANKRD43	132177583	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-1.768000	0.01794	-0.003000	0.14444	-3.153000	0.00058	CGG	G|0.980;C|0.020		0.776	SOWAHA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000133062.1	NM_175873	
PCDHB13	56123	hgsc.bcm.edu	37	5	140595625	140595625	+	Missense_Mutation	SNP	G	G	A	rs2910005	byFrequency	TCGA-OR-A5LG-01A-11D-A29I-10	TCGA-OR-A5LG-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a39e8bc9-757d-4536-b301-458fc7ec992d	6b9e8d41-7044-4151-b4d6-e211b0e7a923	g.chr5:140595625G>A	ENST00000341948.4	+	1	2117	c.1930G>A	c.(1930-1932)Gtc>Atc	p.V644I		NM_018933.2	NP_061756.1	Q9Y5F0	PCDBD_HUMAN	protocadherin beta 13	644	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|homophilic cell adhesion (GO:0007156)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(14)|liver(4)|lung(24)|ovary(5)|pancreas(1)|skin(4)|upper_aerodigestive_tract(1)	66			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			GGTGGTGCTGGTCAAGGACAA	0.711													G|||	602	0.120208	0.1036	0.0937	5008	,	,		15211	0.0933		0.1421	False		,,,				2504	0.1667				p.V644I		.											.	PCDHB13-93	0			c.G1930A						.						13.0	15.0	14.0					5																	140595625		1563	3249	4812	SO:0001583	missense	56123	exon1			GTGCTGGTCAAGG	AF152492	CCDS4255.1	5q31	2010-01-26			ENSG00000187372	ENSG00000187372		"""Cadherins / Protocadherins : Clustered"""	8684	other	protocadherin		606339				10380929	Standard	NM_018933		Approved	PCDH-BETA13	uc003lja.1	Q9Y5F0	OTTHUMG00000129615	ENST00000341948.4:c.1930G>A	5.37:g.140595625G>A	ENSP00000345491:p.Val644Ile	Somatic	14	0		WXS	Illumina GAIIx	Phase_I	170	68	NM_018933	0	0	3	5	2	A8K9V6	Missense_Mutation	SNP	ENST00000341948.4	37	CCDS4255.1	263	0.12042124542124542	52	0.10569105691056911	43	0.11878453038674033	53	0.09265734265734266	115	0.1517150395778364	-	23.4	4.405720	0.83230	.	.	ENSG00000187372	ENST00000341948;ENST00000430318;ENST00000419217	T	0.23552	1.9	3.3	3.3	0.37823	Cadherin (4);Cadherin-like (1);	.	.	.	.	T	0.00300	0.0009	M	0.63843	1.955	0.27033	P	0.9641952	D	0.71674	0.998	D	0.63283	0.913	T	0.09314	-1.0680	8	0.72032	D	0.01	.	14.5914	0.68368	0.0:0.0:1.0:0.0	rs2910005	644	Q9Y5F0	PCDBD_HUMAN	I	644;644;590	ENSP00000345491:V644I	ENSP00000345491:V644I	V	+	1	0	PCDHB13	140575809	1.000000	0.71417	0.701000	0.30321	0.791000	0.44710	9.501000	0.97979	1.576000	0.49790	0.298000	0.19748	GTC	G|0.500;A|0.500		0.711	PCDHB13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251810.1	NM_018933	
PWWP2A	114825	hgsc.bcm.edu	37	5	159546013	159546013	+	Missense_Mutation	SNP	T	T	C	rs56806495	byFrequency	TCGA-OR-A5LG-01A-11D-A29I-10	TCGA-OR-A5LG-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a39e8bc9-757d-4536-b301-458fc7ec992d	6b9e8d41-7044-4151-b4d6-e211b0e7a923	g.chr5:159546013T>C	ENST00000307063.7	-	1	417	c.383A>G	c.(382-384)gAg>gGg	p.E128G	PWWP2A_ENST00000456329.3_Missense_Mutation_p.E128G|PWWP2A_ENST00000523662.1_Missense_Mutation_p.E128G	NM_001130864.1	NP_001124336.1	Q96N64	PWP2A_HUMAN	PWWP domain containing 2A	128	Pro-rich.									kidney(1)|large_intestine(1)|lung(2)|upper_aerodigestive_tract(1)	5	Renal(175;0.00196)	Medulloblastoma(196;0.0354)|all_neural(177;0.138)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			CTCGCGCTCCTCGGGAGCCGG	0.761													T|||	290	0.0579073	0.0212	0.0403	5008	,	,		9537	0.1101		0.0398	False		,,,				2504	0.0849				p.E128G		.											.	PWWP2A-68	0			c.A383G						.	T	GLY/GLU,GLY/GLU	73,3487		1,71,1708	9.0	12.0	11.0		383,383	3.9	1.0	5	dbSNP_129	11	251,7547		4,243,3652	no	missense,missense	PWWP2A	NM_001130864.1,NM_052927.2	98,98	5,314,5360	CC,CT,TT		3.2188,2.0506,2.8526	benign,benign	128/756,128/561	159546013	324,11034	1780	3899	5679	SO:0001583	missense	114825	exon1			CGCTCCTCGGGAG		CCDS47331.1, CCDS47332.1, CCDS58990.1	5q33.3	2011-03-23			ENSG00000170234	ENSG00000170234			29406	protein-coding gene	gene with protein product							Standard	NM_052927		Approved	KIAA1935	uc011ded.2	Q96N64	OTTHUMG00000163546	ENST00000307063.7:c.383A>G	5.37:g.159546013T>C	ENSP00000305151:p.Glu128Gly	Somatic	2	0		WXS	Illumina GAIIx	Phase_I	13	6	NM_052927	0	0	0	0	0	G5EA07|Q2HJJ2|Q8IYR3|Q96PV3	Missense_Mutation	SNP	ENST00000307063.7	37	CCDS47332.1	130	0.05952380952380952	13	0.026422764227642278	16	0.04419889502762431	66	0.11538461538461539	35	0.04617414248021108	t	12.29	1.894481	0.33442	0.020506	0.032188	ENSG00000170234	ENST00000456329;ENST00000523662;ENST00000307063	T;T;T	0.58797	1.27;1.28;0.31	3.91	3.91	0.45181	.	0.844365	0.10167	N	0.707655	T	0.00875	0.0029	L	0.40543	1.245	0.31235	N	0.695827	B;B;B	0.15930	0.001;0.006;0.015	B;B;B	0.11329	0.002;0.006;0.006	T	0.04216	-1.0968	10	0.33141	T	0.24	-6.1269	10.374	0.44071	0.0:0.0:0.0:1.0	rs56806495	128;128;128	Q96N64;G5EA07;Q96N64-2	PWP2A_HUMAN;.;.	G	128	ENSP00000390462:E128G;ENSP00000428143:E128G;ENSP00000305151:E128G	ENSP00000305151:E128G	E	-	2	0	PWWP2A	159478591	1.000000	0.71417	0.966000	0.40874	0.384000	0.30261	3.710000	0.54860	1.628000	0.50416	0.454000	0.30748	GAG	T|0.943;C|0.057		0.761	PWWP2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374092.1		
PPP1R3G	648791	hgsc.bcm.edu	37	6	5086211	5086211	+	Silent	SNP	G	G	C	rs584962		TCGA-OR-A5LG-01A-11D-A29I-10	TCGA-OR-A5LG-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a39e8bc9-757d-4536-b301-458fc7ec992d	6b9e8d41-7044-4151-b4d6-e211b0e7a923	g.chr6:5086211G>C	ENST00000405617.2	+	1	492	c.492G>C	c.(490-492)ctG>ctC	p.L164L		NM_001145115.1	NP_001138587.1	B7ZBB8	PP13G_HUMAN	protein phosphatase 1, regulatory subunit 3G	164					glucose homeostasis (GO:0042593)|positive regulation of glycogen (starch) synthase activity (GO:2000467)|positive regulation of glycogen biosynthetic process (GO:0045725)	cytoplasm (GO:0005737)	glycogen binding (GO:2001069)			kidney(2)	2						TCTCGCGCCTGCGAAGCTTCC	0.736													C|||	5008	1.0	1.0	1.0	5008	,	,		12118	1.0		1.0	False		,,,				2504	1.0				p.L164L		.											.	PPP1R3G-136	0			c.G492C						.						1.0	2.0	1.0					6																	5086211		271	872	1143	SO:0001819	synonymous_variant	648791	exon1			GCGCCTGCGAAGC		CCDS47366.1	6p25.1	2012-04-17	2011-10-04		ENSG00000219607	ENSG00000219607		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	14945	protein-coding gene	gene with protein product			"""protein phosphatase 1, regulatory (inhibitor) subunit 3G"""			11948623	Standard	NM_001145115		Approved		uc011dia.1	B7ZBB8	OTTHUMG00000014172	ENST00000405617.2:c.492G>C	6.37:g.5086211G>C		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	12	12	NM_001145115	0	0	0	1	1		Silent	SNP	ENST00000405617.2	37	CCDS47366.1																																																																																			G|0.000;C|1.000		0.736	PPP1R3G-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039740.3	NM_001145115	
RREB1	6239	hgsc.bcm.edu	37	6	7230680	7230680	+	Missense_Mutation	SNP	G	G	T	rs9502564	byFrequency	TCGA-OR-A5LG-01A-11D-A29I-10	TCGA-OR-A5LG-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a39e8bc9-757d-4536-b301-458fc7ec992d	6b9e8d41-7044-4151-b4d6-e211b0e7a923	g.chr6:7230680G>T	ENST00000349384.6	+	10	2662	c.2348G>T	c.(2347-2349)gGc>gTc	p.G783V	RREB1_ENST00000379938.2_Missense_Mutation_p.G783V|RREB1_ENST00000334984.6_Missense_Mutation_p.G783V|RREB1_ENST00000379933.3_Missense_Mutation_p.G783V	NM_001003698.3	NP_001003698.1	Q92766	RREB1_HUMAN	ras responsive element binding protein 1	783			G -> V (in dbSNP:rs9502564). {ECO:0000269|PubMed:15067362, ECO:0000269|PubMed:21703425}.		multicellular organismal development (GO:0007275)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription, DNA-templated (GO:0045893)|Ras protein signal transduction (GO:0007265)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nuclear body (GO:0016604)|nucleolus (GO:0005730)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(5)|lung(18)|ovary(5)|pancreas(2)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	58	Ovarian(93;0.0398)	all_hematologic(90;0.0384)|Prostate(151;0.191)				CTGGGCGGGGGCCACAAGGGC	0.697													G|||	2678	0.534744	0.5333	0.4063	5008	,	,		15583	0.7411		0.2893	False		,,,				2504	0.6677				p.G783V		.											.	RREB1-144	0			c.G2348T						.	G	VAL/GLY,VAL/GLY,VAL/GLY,VAL/GLY	2083,2197		552,979,609	9.0	9.0	9.0		2348,2348,2348,2348	5.3	1.0	6	dbSNP_119	9	2599,5719		488,1623,2048	yes	missense,missense,missense,missense	RREB1	NM_001003698.3,NM_001003699.3,NM_001003700.1,NM_001168344.1	109,109,109,109	1040,2602,2657	TT,TG,GG		31.2455,48.6682,37.1646	benign,benign,benign,benign	783/1688,783/1743,783/1477,783/1688	7230680	4682,7916	2140	4159	6299	SO:0001583	missense	6239	exon10			GCGGGGGCCACAA	U26914	CCDS34335.1, CCDS34336.1, CCDS54963.1	6p25	2013-01-08			ENSG00000124782	ENSG00000124782		"""Zinc fingers, C2H2-type"""	10449	protein-coding gene	gene with protein product	"""hindsight homolog (drosophila)"""	602209				9367691, 18394891	Standard	NM_001003698		Approved	HNT	uc003mxb.3	Q92766	OTTHUMG00000014201	ENST00000349384.6:c.2348G>T	6.37:g.7230680G>T	ENSP00000305560:p.Gly783Val	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	35	18	NM_001003700	0	0	0	0	0	A2RRF5|E2GM80|E2GM81|O75567|O75568|Q5VYB2|Q6BEP5|Q6BEP6|Q6BEP8|Q86SU2|Q9Y474	Missense_Mutation	SNP	ENST00000349384.6	37	CCDS34336.1	1014	0.4642857142857143	249	0.5060975609756098	148	0.4088397790055249	412	0.7202797202797203	205	0.2704485488126649	G	11.15	1.553554	0.27739	0.486682	0.312455	ENSG00000124782	ENST00000379933;ENST00000379938;ENST00000349384;ENST00000334984	T;T;T;T	0.09163	3.07;3.07;3.07;3.01	5.32	5.32	0.75619	.	0.278837	0.31370	N	0.007766	T	0.02533	0.0077	N	0.14661	0.345	0.21915	P	0.999474401	B;B;B	0.32653	0.161;0.379;0.328	B;B;B	0.35182	0.079;0.197;0.178	T	0.45512	-0.9256	9	0.13108	T	0.6	-17.3998	11.4207	0.49980	0.0:0.0:0.8202:0.1797	rs9502564	783;783;783	Q92766-3;Q92766;Q92766-2	.;RREB1_HUMAN;.	V	783	ENSP00000369265:G783V;ENSP00000369270:G783V;ENSP00000305560:G783V;ENSP00000335574:G783V	ENSP00000335574:G783V	G	+	2	0	RREB1	7175679	1.000000	0.71417	0.996000	0.52242	0.833000	0.47200	5.477000	0.66799	2.760000	0.94817	0.655000	0.94253	GGC	G|0.546;T|0.454		0.697	RREB1-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000352985.1		
ATXN1	6310	broad.mit.edu	37	6	16327913	16327915	+	In_Frame_Del	DEL	TGA	TGA	-	rs11969612|rs369629396	byFrequency	TCGA-OR-A5LG-01A-11D-A29I-10	TCGA-OR-A5LG-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a39e8bc9-757d-4536-b301-458fc7ec992d	6b9e8d41-7044-4151-b4d6-e211b0e7a923	g.chr6:16327913_16327915delTGA	ENST00000244769.4	-	8	1563_1565	c.627_629delTCA	c.(625-630)catcag>cag	p.H209del	ATXN1_ENST00000436367.1_In_Frame_Del_p.H209del	NM_000332.3	NP_000323.2	P54253	ATX1_HUMAN	ataxin 1	209	Poly-Gln.		H -> Q (in dbSNP:rs11969612).		adult locomotory behavior (GO:0008344)|cell death (GO:0008219)|negative regulation of insulin-like growth factor receptor signaling pathway (GO:0043569)|negative regulation of phosphorylation (GO:0042326)|negative regulation of transcription, DNA-templated (GO:0045892)|nuclear export (GO:0051168)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|RNA processing (GO:0006396)|transcription, DNA-templated (GO:0006351)|visual learning (GO:0008542)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nuclear inclusion body (GO:0042405)|nuclear matrix (GO:0016363)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|identical protein binding (GO:0042802)|poly(G) binding (GO:0034046)|poly(U) RNA binding (GO:0008266)|protein C-terminus binding (GO:0008022)|protein self-association (GO:0043621)	p.H209delH(2)|p.H209_H211delHQH(1)		NS(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(11)|lung(12)|prostate(2)|skin(7)|upper_aerodigestive_tract(2)	44	Breast(50;0.063)|Ovarian(93;0.0733)	all_hematologic(90;0.000682)|Ovarian(999;0.00973)				ctgctgatgctgatgctgctgct	0.665																																					p.209_210del		.											.	ATXN1-93	3	Deletion - In frame(3)	upper_aerodigestive_tract(1)|large_intestine(1)|prostate(1)	c.627_629del						.		,|,	615,313,2022|637,2259		169,39,238,43,188,798|112,413,923					,|,		0.0|0.0		dbSNP_130	7|7	1006,693,4879|752,5866		252,19,483,15,644,1876|24,704,2581	no|no	codingComplex,codingComplex|coding,coding	ATXN1|ATXN1	NM_001128164.1,NM_000332.3|NM_001128164.1,NM_000332.3	,|,	421,58,721,58,832,2674|136,1117,3504	A1A1,A1A2,A1R,A2A2,A2R,RR|A1A1,A1R,RR		25.8285,31.4576,27.5714|11.3629,21.9959,14.5995	,|,	,|,		1621,1006,6901|1389,8125				SO:0001651	inframe_deletion	6310	exon7			TGATGCTGATGCT	X79204	CCDS34342.1	6p23	2014-09-17	2004-08-12	2004-08-13	ENSG00000124788	ENSG00000124788		"""Ataxins"""	10548	protein-coding gene	gene with protein product		601556	"""spinocerebellar ataxia 1 (olivopontocerebellar ataxia 1, autosomal dominant, ataxin 1)"""	SCA1		1582256	Standard	NM_000332		Approved	D6S504E, ATX1	uc010jpi.3	P54253	OTTHUMG00000014303	ENST00000244769.4:c.627_629delTCA	6.37:g.16327913_16327915delTGA	ENSP00000244769:p.His209del	Somatic	31	0		WXS	Illumina GAIIx	Phase_I	53	10	NM_001128164	0	0	0	0	0	Q17S02|Q9UJG2|Q9Y4J1	In_Frame_Del	DEL	ENST00000244769.4	37	CCDS34342.1																																																																																			.		0.665	ATXN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039943.3	NM_000332	
POU3F2	5454	hgsc.bcm.edu	37	6	99283376	99283376	+	Silent	SNP	T	T	G	rs195860	byFrequency	TCGA-OR-A5LG-01A-11D-A29I-10	TCGA-OR-A5LG-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a39e8bc9-757d-4536-b301-458fc7ec992d	6b9e8d41-7044-4151-b4d6-e211b0e7a923	g.chr6:99283376T>G	ENST00000328345.5	+	1	797	c.627T>G	c.(625-627)ggT>ggG	p.G209G		NM_005604.3	NP_005595.2	P20265	PO3F2_HUMAN	POU class 3 homeobox 2	209					astrocyte development (GO:0014002)|cellular response to organic substance (GO:0071310)|cerebral cortex radially oriented cell migration (GO:0021799)|epidermis development (GO:0008544)|forebrain ventricular zone progenitor cell division (GO:0021869)|hypothalamus cell differentiation (GO:0021979)|myelination in peripheral nervous system (GO:0022011)|neurohypophysis development (GO:0021985)|neuron differentiation (GO:0030182)|positive regulation of cell proliferation (GO:0008284)|positive regulation of multicellular organism growth (GO:0040018)|regulation of axonogenesis (GO:0050770)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	identical protein binding (GO:0042802)|RNA polymerase II transcription coactivator activity (GO:0001105)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(2)|large_intestine(3)|lung(5)	10		all_cancers(76;1.56e-06)|Acute lymphoblastic leukemia(125;4.93e-10)|all_hematologic(75;3.55e-07)|all_epithelial(107;0.00893)|Colorectal(196;0.069)|Lung NSC(302;0.197)		BRCA - Breast invasive adenocarcinoma(108;0.0355)		AGCCGGCCGGTCTGCACCACC	0.736													G|||	4460	0.890575	0.8994	0.9121	5008	,	,		6412	0.9544		0.8598	False		,,,				2504	0.8292				p.G209G		.											.	POU3F2-90	0			c.T627G						.	G		3186,306		1453,280,13	4.0	4.0	4.0		627	3.1	1.0	6	dbSNP_79	4	6282,930		2738,806,62	no	coding-synonymous	POU3F2	NM_005604.2		4191,1086,75	GG,GT,TT		12.8952,8.7629,11.5471		209/444	99283376	9468,1236	1746	3606	5352	SO:0001819	synonymous_variant	5454	exon1			GGCCGGTCTGCAC	Z11933	CCDS5040.1	6q16.2	2011-06-20	2007-07-13		ENSG00000184486	ENSG00000184486		"""Homeoboxes / POU class"""	9215	protein-coding gene	gene with protein product		600494	"""POU domain class 3, transcription factor 2"""	OTF7		8441633	Standard	NM_005604		Approved	POUF3, BRN2, OCT7	uc003ppe.3	P20265	OTTHUMG00000015258	ENST00000328345.5:c.627T>G	6.37:g.99283376T>G		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	20	20	NM_005604	0	0	0	0	0	Q14960|Q86V54|Q9UJL0	Silent	SNP	ENST00000328345.5	37	CCDS5040.1																																																																																			T|0.089;G|0.911		0.736	POU3F2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041586.2		
PREP	5550	bcgsc.ca	37	6	105726036	105726036	+	Missense_Mutation	SNP	C	C	T	rs1051484	byFrequency	TCGA-OR-A5LG-01A-11D-A29I-10	TCGA-OR-A5LG-10A-01D-A29L-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a39e8bc9-757d-4536-b301-458fc7ec992d	6b9e8d41-7044-4151-b4d6-e211b0e7a923	g.chr6:105726036C>T	ENST00000369110.3	-	15	2308	c.2116G>A	c.(2116-2118)Gtc>Atc	p.V706I	RP3-355L5.4_ENST00000452363.1_RNA	NM_002726.4	NP_002717.3	P48147	PPCE_HUMAN	prolyl endopeptidase	706			V -> I (in dbSNP:rs1051484). {ECO:0000269|PubMed:8089089}.		proteolysis (GO:0006508)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	serine-type endopeptidase activity (GO:0004252)|serine-type exopeptidase activity (GO:0070008)|serine-type peptidase activity (GO:0008236)			breast(1)|endometrium(2)|large_intestine(7)|lung(12)|ovary(3)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	29		all_cancers(87;0.000128)|Acute lymphoblastic leukemia(125;1.9e-08)|all_hematologic(75;9.25e-07)|all_epithelial(87;0.0344)|Lung NSC(302;0.191)|Colorectal(196;0.202)			Oxytocin(DB00107)	ATCCAGTCGACGTTCAGGCAC	0.552													T|||	1714	0.342252	0.7254	0.2133	5008	,	,		17536	0.1964		0.165	False		,,,				2504	0.2485				p.V706I		.											.	PREP-93	0			c.G2116A						.	T	ILE/VAL	2769,1637	501.5+/-365.0	879,1011,313	187.0	179.0	182.0		2116	4.5	1.0	6	dbSNP_86	182	1332,7268	757.2+/-407.5	93,1146,3061	yes	missense	PREP	NM_002726.4	29	972,2157,3374	TT,TC,CC		15.4884,37.1539,31.5316	benign	706/711	105726036	4101,8905	2203	4300	6503	SO:0001583	missense	5550	exon15			AGTCGACGTTCAG		CCDS5053.1	6q22	2008-02-05			ENSG00000085377	ENSG00000085377	3.4.21.26		9358	protein-coding gene	gene with protein product		600400				7959018	Standard	NM_002726		Approved		uc003prc.3	P48147	OTTHUMG00000015297	ENST00000369110.3:c.2116G>A	6.37:g.105726036C>T	ENSP00000358106:p.Val706Ile	Somatic	110	0		WXS	Illumina GAIIx	Phase_I	75	5	NM_002726	0	0	26	26	0	Q8N6D4	Missense_Mutation	SNP	ENST00000369110.3	37	CCDS5053.1	675	0.3090659340659341	345	0.7012195121951219	92	0.2541436464088398	119	0.20804195804195805	119	0.15699208443271767	T	6.451	0.451407	0.12223	0.628461	0.154884	ENSG00000085377	ENST00000369110	T	0.28666	1.6	5.77	4.53	0.55603	Peptidase S9, prolyl oligopeptidase, catalytic domain (1);	0.235854	0.44097	N	0.000496	T	0.03608	0.0103	N	0.04373	-0.215	0.54753	P	1.7000000000044757E-5	B	0.02656	0.0	B	0.04013	0.001	T	0.38156	-0.9674	9	0.07644	T	0.81	-12.6298	7.6525	0.28356	0.0:0.0805:0.2879:0.6316	rs1051484;rs3191870;rs3734722;rs56566104;rs58772009;rs1051484	706	P48147	PPCE_HUMAN	I	706	ENSP00000358106:V706I	ENSP00000358106:V706I	V	-	1	0	PREP	105832729	1.000000	0.71417	1.000000	0.80357	0.842000	0.47809	2.614000	0.46359	1.120000	0.41904	-0.269000	0.10298	GTC	C|0.673;T|0.327		0.552	PREP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041658.1		
INHBA	3624	ucsc.edu	37	7	41729744	41729744	+	Missense_Mutation	SNP	T	T	A			TCGA-OR-A5LG-01A-11D-A29I-10	TCGA-OR-A5LG-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a39e8bc9-757d-4536-b301-458fc7ec992d	6b9e8d41-7044-4151-b4d6-e211b0e7a923	g.chr7:41729744T>A	ENST00000242208.4	-	3	1031	c.785A>T	c.(784-786)aAg>aTg	p.K262M	INHBA_ENST00000442711.1_Missense_Mutation_p.K262M|INHBA_ENST00000464515.1_5'UTR|AC005027.3_ENST00000416150.1_RNA	NM_002192.2	NP_002183.1	P08476	INHBA_HUMAN	inhibin, beta A	262					activin receptor signaling pathway (GO:0032924)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell surface receptor signaling pathway (GO:0007166)|cell-cell signaling (GO:0007267)|cellular response to cholesterol (GO:0071397)|cellular response to follicle-stimulating hormone stimulus (GO:0071372)|defense response (GO:0006952)|endodermal cell differentiation (GO:0035987)|erythrocyte differentiation (GO:0030218)|extrinsic apoptotic signaling pathway (GO:0097191)|eyelid development in camera-type eye (GO:0061029)|G1/S transition of mitotic cell cycle (GO:0000082)|growth (GO:0040007)|hair follicle development (GO:0001942)|hematopoietic progenitor cell differentiation (GO:0002244)|hemoglobin biosynthetic process (GO:0042541)|male gonad development (GO:0008584)|mesodermal cell differentiation (GO:0048333)|negative regulation of B cell differentiation (GO:0045578)|negative regulation of cell cycle (GO:0045786)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of follicle-stimulating hormone secretion (GO:0046882)|negative regulation of interferon-gamma biosynthetic process (GO:0045077)|negative regulation of macrophage differentiation (GO:0045650)|negative regulation of phosphorylation (GO:0042326)|nervous system development (GO:0007399)|odontogenesis (GO:0042476)|ovarian follicle development (GO:0001541)|palate development (GO:0060021)|positive regulation of cellular protein metabolic process (GO:0032270)|positive regulation of erythrocyte differentiation (GO:0045648)|positive regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001241)|positive regulation of follicle-stimulating hormone secretion (GO:0046881)|positive regulation of ovulation (GO:0060279)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|progesterone secretion (GO:0042701)|regulation of follicle-stimulating hormone secretion (GO:0046880)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to drug (GO:0042493)	activin A complex (GO:0043509)|extracellular region (GO:0005576)|inhibin A complex (GO:0043512)	cytokine activity (GO:0005125)|growth factor activity (GO:0008083)|hormone activity (GO:0005179)|identical protein binding (GO:0042802)|peptide hormone binding (GO:0017046)|type II activin receptor binding (GO:0070699)			biliary_tract(1)|breast(2)|endometrium(2)|kidney(1)|large_intestine(15)|lung(26)|ovary(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	55						ctcttctttcttcttcttctT	0.582										TSP Lung(11;0.080)																											p.K262M		.											.	INHBA-703	0			c.A785T						.						35.0	36.0	35.0					7																	41729744		2203	4300	6503	SO:0001583	missense	3624	exon3			TCTTTCTTCTTCT		CCDS5464.1	7p15-p13	2014-01-30	2007-07-30		ENSG00000122641	ENSG00000122641		"""Endogenous ligands"""	6066	protein-coding gene	gene with protein product		147290	"""inhibin, beta A (activin A, activin AB alpha polypeptide)"""			3345731	Standard	NM_002192		Approved		uc003thr.3	P08476	OTTHUMG00000023574	ENST00000242208.4:c.785A>T	7.37:g.41729744T>A	ENSP00000242208:p.Lys262Met	Somatic	40	0		WXS	Illumina GAIIx	Phase_I	42	4	NM_002192	0	0	0	0	0	Q14599	Missense_Mutation	SNP	ENST00000242208.4	37	CCDS5464.1	.	.	.	.	.	.	.	.	.	.	.	19.76	3.886604	0.72410	.	.	ENSG00000122641	ENST00000242208;ENST00000442711	T;T	0.66280	-0.2;-0.2	6.05	6.05	0.98169	Transforming growth factor-beta, N-terminal (1);	0.515898	0.21145	N	0.079417	T	0.74084	0.3670	L	0.44542	1.39	0.44261	D	0.997112	D	0.89917	1.0	D	0.83275	0.996	T	0.75328	-0.3356	10	0.66056	D	0.02	-26.6365	16.2666	0.82588	0.0:0.0:0.0:1.0	.	262	P08476	INHBA_HUMAN	M	262	ENSP00000242208:K262M;ENSP00000397197:K262M	ENSP00000242208:K262M	K	-	2	0	INHBA	41696269	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.737000	0.47393	2.320000	0.78422	0.528000	0.53228	AAG	.		0.582	INHBA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250793.1		
RAMP3	10268	hgsc.bcm.edu	37	7	45197433	45197433	+	Silent	SNP	G	G	A	rs67477213	byFrequency	TCGA-OR-A5LG-01A-11D-A29I-10	TCGA-OR-A5LG-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a39e8bc9-757d-4536-b301-458fc7ec992d	6b9e8d41-7044-4151-b4d6-e211b0e7a923	g.chr7:45197433G>A	ENST00000242249.4	+	1	44	c.6G>A	c.(4-6)gaG>gaA	p.E2E	RAMP3_ENST00000481345.1_Silent_p.E2E|RAMP3_ENST00000496212.1_Silent_p.E2E	NM_005856.2	NP_005847.1	O60896	RAMP3_HUMAN	receptor (G protein-coupled) activity modifying protein 3	2					calcium ion transport (GO:0006816)|cellular response to estradiol stimulus (GO:0071392)|G-protein coupled receptor signaling pathway involved in heart process (GO:0086103)|intracellular protein transport (GO:0006886)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|positive regulation of receptor recycling (GO:0001921)|protein localization to plasma membrane (GO:0072659)|protein transport (GO:0015031)|receptor internalization (GO:0031623)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)	cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)|lysosome (GO:0005764)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	coreceptor activity (GO:0015026)|protein transporter activity (GO:0008565)|receptor activity (GO:0004872)			breast(1)|endometrium(1)|large_intestine(4)|lung(4)|stomach(1)	11					Pramlintide(DB01278)	CAGCCATGGAGACTGGAGCGC	0.771													G|||	1244	0.248403	0.4947	0.1657	5008	,	,		7876	0.0159		0.2276	False		,,,				2504	0.2352				p.E2E		.											.	RAMP3-90	0			c.G6A						.	G		1194,2386		196,802,792	3.0	3.0	3.0		6	2.0	0.0	7	dbSNP_130	3	1312,6004		141,1030,2487	no	coding-synonymous	RAMP3	NM_005856.2		337,1832,3279	AA,AG,GG		17.9333,33.352,22.9993		2/149	45197433	2506,8390	1790	3658	5448	SO:0001819	synonymous_variant	10268	exon1			CATGGAGACTGGA	AJ001016	CCDS5503.1	7p13-p12	2006-11-21	2006-11-21		ENSG00000122679	ENSG00000122679		"""Receptor (G protein-coupled) activity modifying proteins"""	9845	protein-coding gene	gene with protein product		605155	"""receptor activity modifying protein 3"", ""receptor (calcitonin) activity modifying protein 3"""				Standard	NM_005856		Approved		uc003tnb.3	O60896	OTTHUMG00000023729	ENST00000242249.4:c.6G>A	7.37:g.45197433G>A		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	9	6	NM_005856	0	0	2	7	5	Q7Z2Y1	Silent	SNP	ENST00000242249.4	37	CCDS5503.1																																																																																			G|0.760;A|0.240		0.771	RAMP3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000251343.1	NM_005856	
KCP	375616	hgsc.bcm.edu	37	7	128550681	128550681	+	RNA	DEL	C	C	-	rs11335250|rs398006231|rs112748667		TCGA-OR-A5LG-01A-11D-A29I-10	TCGA-OR-A5LG-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a39e8bc9-757d-4536-b301-458fc7ec992d	6b9e8d41-7044-4151-b4d6-e211b0e7a923	g.chr7:128550681delC	ENST00000476647.2	-	0	92							Q6ZWJ8	KCP_HUMAN	kielin/chordin-like protein							extracellular region (GO:0005576)				central_nervous_system(1)|endometrium(3)	4						AGCGCCAGGGCCCCCGAGGTG	0.761													?|CCCCC|CCCC|unsure	5008	1.0	1.0	1.0	5008	,	,		11787	1.0		1.0	False		,,,				2504	1.0				.		.											.	KCP-68	0			c.49+1G>-						.		,	1955,3		977,1,1	1.0	2.0	2.0		,		0.6	7	dbSNP_130	11	3848,2		1924,0,1	no	frameshift,frameshift	KCP	NM_199349.2,NM_001135914.1	,	2901,1,2	A1A1,A1R,RR		0.0519,0.1532,0.0861	,	,	128550681	5803,5	255	884	1139			375616	exon2			CCAGGGCCCCCGA	AK122706		7q32.3	2009-11-06	2009-02-18	2009-02-18	ENSG00000135253	ENSG00000135253			17585	protein-coding gene	gene with protein product	"""kielin"""	609344	"""cysteine rich BMP regulator 2 (chordin-like)"""	CRIM2		15793581	Standard	NM_001135914		Approved	FLJ33365, NET67	uc011kor.2	Q6ZWJ8	OTTHUMG00000158363		7.37:g.128550681delC		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	10	10	NM_001135914	0	0	0	0	0	Q8NBE0	Splice_Site	DEL	ENST00000476647.2	37																																																																																				.		0.761	KCP-006	KNOWN	basic	processed_transcript	processed_transcript	OTTHUMT00000403051.1	NM_199349	
ZNF467	168544	hgsc.bcm.edu	37	7	149462337	149462337	+	Silent	SNP	G	G	A	rs855667	byFrequency	TCGA-OR-A5LG-01A-11D-A29I-10	TCGA-OR-A5LG-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a39e8bc9-757d-4536-b301-458fc7ec992d	6b9e8d41-7044-4151-b4d6-e211b0e7a923	g.chr7:149462337G>A	ENST00000302017.3	-	5	1667	c.1254C>T	c.(1252-1254)ccC>ccT	p.P418P	ZNF467_ENST00000484747.1_Intron	NM_207336.1	NP_997219.1	Q7Z7K2	ZN467_HUMAN	zinc finger protein 467	418					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			central_nervous_system(1)|kidney(1)|large_intestine(2)|liver(1)|lung(7)|urinary_tract(1)	13	Melanoma(164;0.165)|Ovarian(565;0.177)		OV - Ovarian serous cystadenocarcinoma(82;0.00625)			GGGGCACCACGGGATCGGATC	0.776													A|||	1297	0.258986	0.6051	0.1513	5008	,	,		9829	0.0774		0.1779	False		,,,				2504	0.138				p.P418P		.											.	ZNF467-90	0			c.C1254T						.	A		1016,1770		158,700,535	2.0	2.0	2.0		1254	-5.3	0.0	7	dbSNP_86	2	781,5233		68,645,2294	no	coding-synonymous	ZNF467	NM_207336.1		226,1345,2829	AA,AG,GG		12.9864,36.4681,20.4205		418/596	149462337	1797,7003	1393	3007	4400	SO:0001819	synonymous_variant	168544	exon5			CACCACGGGATCG	BC029296	CCDS5899.1	7q36.1	2013-01-08			ENSG00000181444	ENSG00000181444		"""Zinc fingers, C2H2-type"""	23154	protein-coding gene	gene with protein product		614040				12426389	Standard	NM_207336		Approved	EZI, Zfp467	uc003wgd.2	Q7Z7K2	OTTHUMG00000157883	ENST00000302017.3:c.1254C>T	7.37:g.149462337G>A		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	16	5	NM_207336	0	0	0	0	0		Silent	SNP	ENST00000302017.3	37	CCDS5899.1																																																																																			G|0.763;A|0.237		0.776	ZNF467-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349833.1	NM_207336	
ZNF775	285971	hgsc.bcm.edu	37	7	150094972	150094972	+	Missense_Mutation	SNP	A	A	G			TCGA-OR-A5LG-01A-11D-A29I-10	TCGA-OR-A5LG-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a39e8bc9-757d-4536-b301-458fc7ec992d	6b9e8d41-7044-4151-b4d6-e211b0e7a923	g.chr7:150094972A>G	ENST00000329630.5	+	3	1510	c.1403A>G	c.(1402-1404)cAc>cGc	p.H468R		NM_173680.3	NP_775951.2	Q96BV0	ZN775_HUMAN	zinc finger protein 775	468					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|liver(1)|lung(7)|skin(1)	11	Ovarian(565;0.183)|Melanoma(164;0.226)		OV - Ovarian serous cystadenocarcinoma(82;0.0173)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)		CAGCGCATCCACACGGGTGAG	0.716																																					p.H468R		.											.	ZNF775-90	0			c.A1403G						.						15.0	18.0	17.0					7																	150094972		2189	4286	6475	SO:0001583	missense	285971	exon3			GCATCCACACGGG	BC038111	CCDS43678.1	7q36.1	2013-01-08			ENSG00000196456	ENSG00000196456		"""Zinc fingers, C2H2-type"""	28501	protein-coding gene	gene with protein product						12477932	Standard	NM_173680		Approved	MGC33584	uc003whf.1	Q96BV0	OTTHUMG00000158324	ENST00000329630.5:c.1403A>G	7.37:g.150094972A>G	ENSP00000330838:p.His468Arg	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	70	20	NM_173680	0	0	1	1	0	Q8IY24	Missense_Mutation	SNP	ENST00000329630.5	37	CCDS43678.1	.	.	.	.	.	.	.	.	.	.	A	19.54	3.846238	0.71603	.	.	ENSG00000196456	ENST00000329630	T	0.67523	-0.27	3.82	3.82	0.43975	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	D	0.82458	0.5041	M	0.89414	3.03	0.35898	D	0.830198	D	0.89917	1.0	D	0.97110	1.0	D	0.87726	0.2576	8	.	.	.	.	10.5989	0.45354	1.0:0.0:0.0:0.0	.	468	Q96BV0	ZN775_HUMAN	R	468	ENSP00000330838:H468R	.	H	+	2	0	ZNF775	149725905	1.000000	0.71417	1.000000	0.80357	0.932000	0.56968	3.145000	0.50623	1.591000	0.50007	0.460000	0.39030	CAC	.		0.716	ZNF775-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350679.1	NM_173680	
EN2	2020	hgsc.bcm.edu	37	7	155251183	155251183	+	Silent	SNP	G	G	A	rs77846527	byFrequency	TCGA-OR-A5LG-01A-11D-A29I-10	TCGA-OR-A5LG-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a39e8bc9-757d-4536-b301-458fc7ec992d	6b9e8d41-7044-4151-b4d6-e211b0e7a923	g.chr7:155251183G>A	ENST00000297375.4	+	1	360	c.111G>A	c.(109-111)ccG>ccA	p.P37P	AC008060.8_ENST00000419225.1_lincRNA	NM_001427.3	NP_001418.2	P19622	HME2_HUMAN	engrailed homeobox 2	37					hindbrain development (GO:0030902)|midbrain development (GO:0030901)|multicellular organismal development (GO:0007275)|neuron development (GO:0048666)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	membrane (GO:0016020)|nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)			central_nervous_system(1)|large_intestine(1)|lung(2)	4	all_neural(206;0.119)	all_hematologic(28;0.0592)	OV - Ovarian serous cystadenocarcinoma(82;0.011)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)		gtagcagcCCGGGCGAAGCGG	0.751													g|||	520	0.103834	0.1407	0.0663	5008	,	,		6800	0.0208		0.1113	False		,,,				2504	0.1585				p.P37P		.											.	EN2-90	0			c.G111A						.						2.0	3.0	2.0					7																	155251183		1497	3024	4521	SO:0001819	synonymous_variant	2020	exon1			CAGCCCGGGCGAA		CCDS5940.1	7q36.2	2011-06-20	2007-02-15		ENSG00000164778	ENSG00000164778		"""Homeoboxes / ANTP class : NKL subclass"""	3343	protein-coding gene	gene with protein product		131310					Standard	NM_001427		Approved		uc003wmb.3	P19622	OTTHUMG00000151354	ENST00000297375.4:c.111G>A	7.37:g.155251183G>A		Somatic	1	0		WXS	Illumina GAIIx	Phase_I	27	15	NM_001427	0	0	0	0	0	A4D252|Q549U3|Q9UD58	Silent	SNP	ENST00000297375.4	37	CCDS5940.1																																																																																			G|0.911;A|0.089		0.751	EN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000322337.1	NM_001427	
GPR124	25960	hgsc.bcm.edu	37	8	37699516	37699516	+	Silent	SNP	C	C	T	rs7010546	byFrequency	TCGA-OR-A5LG-01A-11D-A29I-10	TCGA-OR-A5LG-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a39e8bc9-757d-4536-b301-458fc7ec992d	6b9e8d41-7044-4151-b4d6-e211b0e7a923	g.chr8:37699516C>T	ENST00000412232.2	+	19	3673	c.3660C>T	c.(3658-3660)ggC>ggT	p.G1220G	GPR124_ENST00000315215.7_Silent_p.G1003G	NM_032777.9	NP_116166.9	Q96PE1	GP124_HUMAN	G protein-coupled receptor 124	1220					central nervous system development (GO:0007417)|endothelial cell migration (GO:0043542)|G-protein coupled receptor signaling pathway (GO:0007186)|negative regulation of vascular endothelial growth factor signaling pathway (GO:1900747)|neuropeptide signaling pathway (GO:0007218)|positive regulation of endothelial cell migration (GO:0010595)|regulation of angiogenesis (GO:0045765)|regulation of chemotaxis (GO:0050920)|regulation of establishment of blood-brain barrier (GO:0090210)|sprouting angiogenesis (GO:0002040)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(4)|lung(16)|ovary(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	37			BRCA - Breast invasive adenocarcinoma(5;2.75e-24)|LUSC - Lung squamous cell carcinoma(8;3.5e-10)			GCGAGAGCGGCAGTCTGCACA	0.746													C|||	2324	0.464058	0.3048	0.5144	5008	,	,		7503	0.6716		0.4165	False		,,,				2504	0.4785				p.G1220G		.											.	GPR124-157	0			c.C3660T						.	C		594,1854		106,382,736	2.0	3.0	2.0		3660	3.1	1.0	8	dbSNP_116	2	1524,3502		291,942,1280	no	coding-synonymous	GPR124	NM_032777.9		397,1324,2016	TT,TC,CC		30.3223,24.2647,28.3382		1220/1339	37699516	2118,5356	1224	2513	3737	SO:0001819	synonymous_variant	25960	exon19			GAGCGGCAGTCTG	AB040964	CCDS6097.2	8p11.22	2014-08-08			ENSG00000020181	ENSG00000020181		"""-"", ""GPCR / Class B : Orphans"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	17849	protein-coding gene	gene with protein product	"""tumor endothelial marker 5"""	606823				11559528, 12565841	Standard	NM_032777		Approved	TEM5, DKFZp434C211, DKFZp434J0911, KIAA1531, FLJ14390	uc003xkj.3	Q96PE1	OTTHUMG00000156182	ENST00000412232.2:c.3660C>T	8.37:g.37699516C>T		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	6	6	NM_032777	0	0	0	1	1	A6H8W3|D3DSW4|Q8N3R1|Q8TEM3|Q96KB2|Q9P1Z7|Q9UFY4	Silent	SNP	ENST00000412232.2	37	CCDS6097.2	1050	0.4807692307692308	166	0.33739837398373984	169	0.46685082872928174	397	0.6940559440559441	318	0.41952506596306066	C	4.050	0.006880	0.07866	0.242647	0.303223	ENSG00000020181	ENST00000416514	.	.	.	3.95	3.07	0.35406	.	.	.	.	.	.	.	.	.	.	.	0.09310	P	0.9999999999997394	.	.	.	.	.	.	.	.	.	.	0.10111	T	0.7	-18.0593	4.3087	0.10960	0.1378:0.5532:0.2174:0.0916	rs7010546;rs59434562;rs7010546	.	.	.	X	1213	.	ENSP00000405145:Q1213X	Q	+	1	0	GPR124	37818674	0.843000	0.29541	1.000000	0.80357	0.388000	0.30384	-0.114000	0.10757	0.874000	0.35823	0.313000	0.20887	CAG	C|0.479;G|0.000;T|0.520		0.746	GPR124-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000343331.2		
KAT6A	7994	bcgsc.ca;mdanderson.org	37	8	41790884	41790884	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5LG-01A-11D-A29I-10	TCGA-OR-A5LG-10A-01D-A29L-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a39e8bc9-757d-4536-b301-458fc7ec992d	6b9e8d41-7044-4151-b4d6-e211b0e7a923	g.chr8:41790884C>T	ENST00000396930.3	-	18	5397	c.4854G>A	c.(4852-4854)atG>atA	p.M1618I	KAT6A_ENST00000406337.1_Missense_Mutation_p.M1618I|KAT6A_ENST00000265713.2_Missense_Mutation_p.M1618I	NM_001099412.1	NP_001092882.1	Q92794	KAT6A_HUMAN	K(lysine) acetyltransferase 6A	1618	Interaction with PML.|Interaction with RUNX1-2.				aorta morphogenesis (GO:0035909)|cellular senescence (GO:0090398)|chromatin organization (GO:0006325)|DNA packaging (GO:0006323)|embryonic hemopoiesis (GO:0035162)|face morphogenesis (GO:0060325)|heart morphogenesis (GO:0003007)|histone acetylation (GO:0016573)|histone H3 acetylation (GO:0043966)|myeloid cell differentiation (GO:0030099)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription, DNA-templated (GO:0045892)|nucleosome assembly (GO:0006334)|positive regulation of transcription, DNA-templated (GO:0045893)|protein acetylation (GO:0006473)|somatic stem cell maintenance (GO:0035019)|transcription, DNA-templated (GO:0006351)	Golgi apparatus (GO:0005794)|MOZ/MORF histone acetyltransferase complex (GO:0070776)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)|PML body (GO:0016605)	acetyltransferase activity (GO:0016407)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|histone acetyltransferase activity (GO:0004402)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)										TCTGCTGCATCATGCTGCAGC	0.637																																					p.M1618I		.											.	.	0			c.G4854A						.						33.0	30.0	31.0					8																	41790884		2203	4300	6503	SO:0001583	missense	7994	exon18			CTGCATCATGCTG	U47742	CCDS6124.1	8p11	2013-01-28	2011-07-21	2011-07-21	ENSG00000083168	ENSG00000083168		"""Chromatin-modifying enzymes / K-acetyltransferases"", ""Zinc fingers, C2HC-type containing"", ""Zinc fingers, PHD-type"""	13013	protein-coding gene	gene with protein product	"""Monocytic leukemia zinc finger protein"""	601408	"""runt-related transcription factor binding protein 2"", ""MYST histone acetyltransferase (monocytic leukemia) 3"""	ZNF220, RUNXBP2, MYST3		8849440, 8782817	Standard	NM_001099412		Approved	MOZ, ZC2HC6A	uc003xon.4	Q92794	OTTHUMG00000150453	ENST00000396930.3:c.4854G>A	8.37:g.41790884C>T	ENSP00000380136:p.Met1618Ile	Somatic	54	0		WXS	Illumina GAIIx	Phase_I	45	15	NM_001099412	0	0	1	1	0	Q76L81	Missense_Mutation	SNP	ENST00000396930.3	37	CCDS6124.1	.	.	.	.	.	.	.	.	.	.	C	8.692	0.907766	0.17833	.	.	ENSG00000083168	ENST00000265713;ENST00000406337;ENST00000396930	T;T;T	0.61742	0.08;0.08;0.08	5.91	5.91	0.95273	.	0.264153	0.39407	N	0.001373	T	0.63390	0.2507	L	0.32530	0.975	0.38044	D	0.935554	P	0.45715	0.865	P	0.54210	0.745	T	0.61623	-0.7025	10	0.38643	T	0.18	-5.7662	19.9122	0.97029	0.0:1.0:0.0:0.0	.	1618	Q92794	KAT6A_HUMAN	I	1618	ENSP00000265713:M1618I;ENSP00000385888:M1618I;ENSP00000380136:M1618I	ENSP00000265713:M1618I	M	-	3	0	KAT6A	41910041	1.000000	0.71417	1.000000	0.80357	0.971000	0.66376	2.398000	0.44486	2.799000	0.96334	0.650000	0.86243	ATG	.		0.637	KAT6A-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000318163.1	NM_006766	
CRH	1392	hgsc.bcm.edu	37	8	67089425	67089425	+	Silent	SNP	T	T	G	rs6159	byFrequency	TCGA-OR-A5LG-01A-11D-A29I-10	TCGA-OR-A5LG-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a39e8bc9-757d-4536-b301-458fc7ec992d	6b9e8d41-7044-4151-b4d6-e211b0e7a923	g.chr8:67089425T>G	ENST00000276571.3	-	2	734	c.288A>C	c.(286-288)ggA>ggC	p.G96G		NM_000756.2	NP_000747.1	P06850	CRF_HUMAN	corticotropin releasing hormone	96					adrenal gland development (GO:0030325)|associative learning (GO:0008306)|cellular response to cocaine (GO:0071314)|cellular response to dexamethasone stimulus (GO:0071549)|diterpenoid metabolic process (GO:0016101)|feeding behavior (GO:0007631)|female pregnancy (GO:0007565)|ferulate metabolic process (GO:0033494)|glucocorticoid biosynthetic process (GO:0006704)|hormone-mediated apoptotic signaling pathway (GO:0008628)|hypothalamus development (GO:0021854)|inflammatory response (GO:0006954)|ion homeostasis (GO:0050801)|learning or memory (GO:0007611)|locomotory exploration behavior (GO:0035641)|long-term memory (GO:0007616)|long-term synaptic potentiation (GO:0060291)|lung development (GO:0030324)|negative regulation of blood pressure (GO:0045776)|negative regulation of cell death (GO:0060548)|negative regulation of circadian sleep/wake cycle, REM sleep (GO:0042322)|negative regulation of epinephrine secretion (GO:0032811)|negative regulation of gene expression (GO:0010629)|negative regulation of glucagon secretion (GO:0070093)|negative regulation of luteinizing hormone secretion (GO:0033685)|negative regulation of norepinephrine secretion (GO:0010700)|parturition (GO:0007567)|positive regulation of behavioral fear response (GO:2000987)|positive regulation of calcium ion import (GO:0090280)|positive regulation of cAMP biosynthetic process (GO:0030819)|positive regulation of cell death (GO:0010942)|positive regulation of cell proliferation (GO:0008284)|positive regulation of circadian sleep/wake cycle, wakefulness (GO:0010841)|positive regulation of corticosterone secretion (GO:2000854)|positive regulation of corticotropin secretion (GO:0051461)|positive regulation of cortisol secretion (GO:0051464)|positive regulation of digestive system process (GO:0060456)|positive regulation of gene expression (GO:0010628)|positive regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0035774)|positive regulation of protein phosphorylation (GO:0001934)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|regulation of serotonin secretion (GO:0014062)|response to corticosterone (GO:0051412)|response to drug (GO:0042493)|response to estrogen (GO:0043627)|response to ethanol (GO:0045471)|response to ether (GO:0045472)|response to immobilization stress (GO:0035902)|response to pain (GO:0048265)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|synaptic transmission, dopaminergic (GO:0001963)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|perikaryon (GO:0043204)|varicosity (GO:0043196)	hormone activity (GO:0005179)|neuropeptide hormone activity (GO:0005184)|receptor binding (GO:0005102)			breast(1)|endometrium(1)|lung(2)|urinary_tract(1)	5		all_cancers(86;2.58e-06)|all_epithelial(80;6.27e-09)|all_lung(136;0.000414)|Lung NSC(129;0.0011)	Epithelial(68;0.0136)|all cancers(69;0.0507)|BRCA - Breast invasive adenocarcinoma(89;0.0628)|OV - Ovarian serous cystadenocarcinoma(28;0.0904)		Corticotropin(DB01285)	TGCCGCTGCCTCCGGCGAGGA	0.701											OREG0018805	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	G|||	1938	0.386981	0.7557	0.3646	5008	,	,		12753	0.3433		0.1392	False		,,,				2504	0.2045				p.G96G		.											.	CRH-90	0			c.A288C						.	G		1011,1897		182,647,625	2.0	3.0	3.0		288	-2.7	0.0	8	dbSNP_52	3	578,6556		47,484,3036	no	coding-synonymous	CRH	NM_000756.2		229,1131,3661	GG,GT,TT		8.102,34.7662,15.8235		96/197	67089425	1589,8453	1454	3567	5021	SO:0001819	synonymous_variant	1392	exon2			GCTGCCTCCGGCG		CCDS6188.1	8q13	2013-02-25				ENSG00000147571		"""Endogenous ligands"""	2355	protein-coding gene	gene with protein product	"""corticotropin-releasing factor"", ""corticoliberin"""	122560					Standard	NM_000756		Approved	CRF	uc003xvy.2	P06850		ENST00000276571.3:c.288A>C	8.37:g.67089425T>G		Somatic	3	0	1096	WXS	Illumina GAIIx	Phase_I	32	11	NM_000756	0	0	0	0	0	B3KQS4	Silent	SNP	ENST00000276571.3	37	CCDS6188.1																																																																																			T|0.642;G|0.358		0.701	CRH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378926.1	NM_000756	
KIAA1429	25962	ucsc.edu	37	8	95547119	95547119	+	Silent	SNP	T	T	G	rs2304764	byFrequency	TCGA-OR-A5LG-01A-11D-A29I-10	TCGA-OR-A5LG-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a39e8bc9-757d-4536-b301-458fc7ec992d	6b9e8d41-7044-4151-b4d6-e211b0e7a923	g.chr8:95547119T>G	ENST00000297591.5	-	5	507	c.432A>C	c.(430-432)ccA>ccC	p.P144P	KIAA1429_ENST00000437199.1_Silent_p.P144P|KIAA1429_ENST00000421249.2_Silent_p.P144P|RP11-267M23.3_ENST00000521010.1_RNA	NM_015496.4	NP_056311.2	Q69YN4	VIR_HUMAN	KIAA1429	144	Pro-rich.				mRNA processing (GO:0006397)|RNA splicing (GO:0008380)	nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(4)|kidney(5)|large_intestine(16)|lung(28)|ovary(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	66	Breast(36;3.29e-05)		BRCA - Breast invasive adenocarcinoma(8;0.00185)			gtggtggcggtggaggtggtg	0.448													T|||	1720	0.34345	0.1906	0.4452	5008	,	,		10138	0.5089		0.334	False		,,,				2504	0.317				p.P144P		.											.	KIAA1429-92	0			c.A432C						.	T	,	802,3604	306.6+/-289.6	89,624,1490	77.0	71.0	73.0		432,432	-0.5	1.0	8	dbSNP_100	73	2091,6509	344.5+/-325.3	271,1549,2480	no	coding-synonymous,coding-synonymous	KIAA1429	NM_015496.4,NM_183009.2	,	360,2173,3970	GG,GT,TT		24.314,18.2025,22.2436	,	144/1813,144/1148	95547119	2893,10113	2203	4300	6503	SO:0001819	synonymous_variant	25962	exon5			TGGCGGTGGAGGT	AB037850	CCDS34923.1, CCDS47894.1	8q22.1	2008-11-25			ENSG00000164944	ENSG00000164944			24500	protein-coding gene	gene with protein product	"""functional spliceosome-associated protein 121"""					10718198	Standard	NM_015496		Approved	DKFZP434I116, fSAP121	uc003ygo.2	Q69YN4	OTTHUMG00000164426	ENST00000297591.5:c.432A>C	8.37:g.95547119T>G		Somatic	26	2		WXS	Illumina GAIIx	Phase_I	40	10	NM_015496	0	0	0	0	0	Q2M1N0|Q6AHX9|Q6NT78|Q7Z6C7|Q8IXH4|Q9BTH4|Q9H9C9|Q9NWR3|Q9P2B8|Q9UFW1	Silent	SNP	ENST00000297591.5	37	CCDS34923.1																																																																																			T|0.627;G|0.373		0.448	KIAA1429-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378720.2	NM_015496	
MTDH	92140	hgsc.bcm.edu	37	8	98656966	98656966	+	Missense_Mutation	SNP	G	G	T	rs17854373	byFrequency	TCGA-OR-A5LG-01A-11D-A29I-10	TCGA-OR-A5LG-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a39e8bc9-757d-4536-b301-458fc7ec992d	6b9e8d41-7044-4151-b4d6-e211b0e7a923	g.chr8:98656966G>T	ENST00000336273.3	+	1	560	c.232G>T	c.(232-234)Gcc>Tcc	p.A78S	MTDH_ENST00000519934.1_Missense_Mutation_p.A55S	NM_178812.3	NP_848927.2	Q86UE4	LYRIC_HUMAN	metadherin	78	Interaction with BCCIP.			A -> S (in Ref. 5; AAH09324/AAH45642). {ECO:0000305}.	lipopolysaccharide-mediated signaling pathway (GO:0031663)|negative regulation of apoptotic process (GO:0043066)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of angiogenesis (GO:0045766)|positive regulation of autophagy (GO:0010508)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of protein kinase B signaling (GO:0051897)|tight junction assembly (GO:0070830)	apical plasma membrane (GO:0016324)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|intercellular canaliculus (GO:0046581)|nuclear body (GO:0016604)|nucleolus (GO:0005730)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|tight junction (GO:0005923)	double-stranded RNA binding (GO:0003725)|NF-kappaB binding (GO:0051059)|poly(A) RNA binding (GO:0044822)|RNA polymerase II transcription factor binding (GO:0001085)|transcription coactivator activity (GO:0003713)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(6)|large_intestine(5)|liver(1)|lung(8)|ovary(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	32	Breast(36;2.56e-06)		OV - Ovarian serous cystadenocarcinoma(57;0.178)			TTGCGCCGGCGCCCGCAAAAA	0.736													G|||	124	0.0247604	0.0008	0.0274	5008	,	,		8475	0.0		0.0547	False		,,,				2504	0.0501				p.A78S		.											.	MTDH-91	0			c.G232T						.	G	SER/ALA	42,4076		0,42,2017	6.0	9.0	8.0		232	5.5	1.0	8	dbSNP_123	8	401,7773		7,387,3693	no	missense	MTDH	NM_178812.3	99	7,429,5710	TT,TG,GG		4.9058,1.0199,3.604	probably-damaging	78/583	98656966	443,11849	2059	4087	6146	SO:0001583	missense	92140	exon1			GCCGGCGCCCGCA	AF411226	CCDS6274.1	8q22.1	2014-07-14			ENSG00000147649	ENSG00000147649			29608	protein-coding gene	gene with protein product	"""astrocyte elevated gene 1"""	610323				15093543	Standard	NM_178812		Approved	LYRIC, 3D3, AEG-1	uc003yhz.3	Q86UE4	OTTHUMG00000164692	ENST00000336273.3:c.232G>T	8.37:g.98656966G>T	ENSP00000338235:p.Ala78Ser	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	45	19	NM_178812	0	0	0	1	1	Q05DH2|Q52QU9|Q6PK07|Q8TCX3	Missense_Mutation	SNP	ENST00000336273.3	37	CCDS6274.1	55	0.025183150183150184	0	0.0	13	0.03591160220994475	0	0.0	42	0.055408970976253295	G	25.7	4.660641	0.88154	0.010199	0.049058	ENSG00000147649	ENST00000336273;ENST00000519934	T;T	0.10382	2.88;2.88	5.48	5.48	0.80851	.	0.401308	0.24100	N	0.041542	T	0.02193	0.0068	L	0.34521	1.04	0.41950	D	0.990659	D	0.65815	0.995	P	0.61397	0.888	T	0.00621	-1.1640	10	0.39692	T	0.17	-4.8235	17.1332	0.86732	0.0:0.0:1.0:0.0	rs17854373	78	Q86UE4	LYRIC_HUMAN	S	78;55	ENSP00000338235:A78S;ENSP00000428168:A55S	ENSP00000338235:A78S	A	+	1	0	MTDH	98726142	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	3.476000	0.53143	2.567000	0.86603	0.591000	0.81541	GCC	G|0.973;T|0.027		0.736	MTDH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379772.2		
MAL2	114569	hgsc.bcm.edu	37	8	120220776	120220776	+	Splice_Site	DEL	G	G	-	rs398009582|rs71302978		TCGA-OR-A5LG-01A-11D-A29I-10	TCGA-OR-A5LG-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a39e8bc9-757d-4536-b301-458fc7ec992d	6b9e8d41-7044-4151-b4d6-e211b0e7a923	g.chr8:120220776delG	ENST00000276681.6	+	1	167	c.65delG	c.(64-66)cgg>cg	p.R22fs	MAL2_ENST00000521748.1_3'UTR	NM_052886.2	NP_443118.1	Q969L2	MAL2_HUMAN	mal, T-cell differentiation protein 2 (gene/pseudogene)	22						cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)						all_cancers(13;1.91e-26)|Lung NSC(37;8.61e-08)|Ovarian(258;0.018)|Hepatocellular(40;0.161)		STAD - Stomach adenocarcinoma(47;0.000967)			CCGCCGCCCCGGGGTCACCCT	0.771													GGG|GGGG|GGG|insertion	5008	1.0	1.0	1.0	5008	,	,		6681	1.0		1.0	False		,,,				2504	1.0				.		.											.	.	0			c.64+1G>-						.			1571,11		785,1,5	1.0	1.0	1.0			0.7	0.8	8	dbSNP_130	1	4116,22		2057,2,10	no	frameshift	MAL2	NM_052886.2		2842,3,15	A1A1,A1R,RR		0.5317,0.6953,0.5769			120220776	5687,33	184	483	667	SO:0001630	splice_region_variant	114569	exon1			CGCCCCGGGGTCA	AL117612	CCDS75780.1	8q23	2011-01-26	2011-01-26			ENSG00000147676			13634	protein-coding gene	gene with protein product	"""MAL proteolipid protein 2"""	609684				11549320	Standard	NM_052886		Approved		uc003yop.3	Q969L2		ENST00000276681.6:c.66+1G>-	8.37:g.120220776delG		Somatic	2	2		WXS	Illumina GAIIx	Phase_I	12	12	NM_052886	0	0	0	0	0	B2R520|Q6ZMD9	Splice_Site	DEL	ENST00000276681.6	37																																																																																				.		0.771	MAL2-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_052886	Frame_Shift_Del
TRIB1	10221	hgsc.bcm.edu	37	8	126443348	126443348	+	Silent	SNP	C	C	T	rs2385113	byFrequency	TCGA-OR-A5LG-01A-11D-A29I-10	TCGA-OR-A5LG-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a39e8bc9-757d-4536-b301-458fc7ec992d	6b9e8d41-7044-4151-b4d6-e211b0e7a923	g.chr8:126443348C>T	ENST00000311922.3	+	1	786	c.204C>T	c.(202-204)agC>agT	p.S68S	TRIB1_ENST00000520847.1_5'Flank|TRIB1_ENST00000519576.1_5'Flank	NM_001282985.1|NM_025195.2	NP_001269914.1|NP_079471.1			tribbles pseudokinase 1											NS(1)|large_intestine(2)|lung(2)|prostate(2)|urinary_tract(1)	8	all_hematologic(1;4.97e-05)|Ovarian(258;0.00167)|all_neural(195;0.00294)|Hepatocellular(40;0.108)		STAD - Stomach adenocarcinoma(47;0.000918)			CGCCCTGCAGCCCGCAGCCCC	0.796													C|||	2128	0.42492	0.2466	0.4597	5008	,	,		8166	0.3036		0.4632	False		,,,				2504	0.727				p.S68S		.											.	TRIB1-358	0			c.C204T						.						1.0	1.0	1.0					8																	126443348		434	1113	1547	SO:0001819	synonymous_variant	10221	exon1			CTGCAGCCCGCAG	AF205437	CCDS6357.1, CCDS64971.1	8q24.13	2013-10-03	2013-10-03			ENSG00000173334			16891	protein-coding gene	gene with protein product		609461	"""tribbles homolog 1 (Drosophila)"""			9342215, 16715410	Standard	NM_001282985		Approved	C8FW, GIG2, TRB1	uc003yrx.3	Q96RU8		ENST00000311922.3:c.204C>T	8.37:g.126443348C>T		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	6	6	NM_025195	0	0	0	0	0		Silent	SNP	ENST00000311922.3	37	CCDS6357.1																																																																																			C|0.640;T|0.360		0.796	TRIB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381430.1	NM_025195	
FAM83H	286077	hgsc.bcm.edu	37	8	144810138	144810138	+	Missense_Mutation	SNP	G	G	A	rs1137806	byFrequency	TCGA-OR-A5LG-01A-11D-A29I-10	TCGA-OR-A5LG-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a39e8bc9-757d-4536-b301-458fc7ec992d	6b9e8d41-7044-4151-b4d6-e211b0e7a923	g.chr8:144810138G>A	ENST00000388913.3	-	5	1618	c.1493C>T	c.(1492-1494)cCg>cTg	p.P498L		NM_198488.3	NP_940890	Q6ZRV2	FA83H_HUMAN	family with sequence similarity 83, member H	498					biomineral tissue development (GO:0031214)					central_nervous_system(2)|endometrium(1)|large_intestine(1)|lung(12)|pancreas(1)|prostate(3)|urinary_tract(1)	21	all_cancers(97;3.74e-11)|all_epithelial(106;2.62e-09)|Lung NSC(106;0.00013)|all_lung(105;0.000374)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;3.38e-41)|Epithelial(56;6.8e-40)|all cancers(56;6.43e-35)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.146)			TCCGAGCTCCGGGAAGCGGGG	0.771													G|||	831	0.165935	0.0083	0.147	5008	,	,		6578	0.247		0.1451	False		,,,				2504	0.3303				p.P498L		.											.	FAM83H-92	0			c.C1493T						.	G	LEU/PRO	64,3096		3,58,1519	4.0	7.0	6.0		1493	4.4	0.3	8	dbSNP_86	6	767,6345		32,703,2821	no	missense	FAM83H	NM_198488.3	98	35,761,4340	AA,AG,GG		10.7846,2.0253,8.09	benign	498/1180	144810138	831,9441	1580	3556	5136	SO:0001583	missense	286077	exon5			AGCTCCGGGAAGC	AK127960	CCDS6410.2	8q24.3	2014-03-13			ENSG00000180921	ENSG00000180921			24797	protein-coding gene	gene with protein product		611927				18252228	Standard	NM_198488		Approved	FLJ46072	uc003yzk.3	Q6ZRV2	OTTHUMG00000133559	ENST00000388913.3:c.1493C>T	8.37:g.144810138G>A	ENSP00000373565:p.Pro498Leu	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	17	7	NM_198488	0	0	0	1	1	A0JLS2|Q8N4W0	Missense_Mutation	SNP	ENST00000388913.3	37	CCDS6410.2	321	0.14697802197802198	19	0.03861788617886179	46	0.1270718232044199	147	0.256993006993007	109	0.1437994722955145	N	15.31	2.796089	0.50208	0.020253	0.107846	ENSG00000180921	ENST00000388913	T	0.15256	2.44	4.45	4.45	0.53987	.	425.438000	0.00924	U	0.002638	T	0.00012	0.0000	L	0.32530	0.975	0.49299	P	2.2400000000000198E-4	D	0.76494	0.999	P	0.61275	0.886	T	0.14090	-1.0485	9	0.56958	D	0.05	.	12.8618	0.57918	0.0:0.0:0.8368:0.1632	rs1137806;rs3201609	498	Q6ZRV2	FA83H_HUMAN	L	498	ENSP00000373565:P498L	ENSP00000373565:P498L	P	-	2	0	FAM83H	144882126	1.000000	0.71417	0.283000	0.24790	0.537000	0.34900	4.979000	0.63806	2.010000	0.58986	0.455000	0.32223	CCG	G|0.853;A|0.147		0.771	FAM83H-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257632.2	NM_198488	
ZNF517	340385	hgsc.bcm.edu	37	8	146033347	146033347	+	Missense_Mutation	SNP	T	T	C	rs2976653	byFrequency	TCGA-OR-A5LG-01A-11D-A29I-10	TCGA-OR-A5LG-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a39e8bc9-757d-4536-b301-458fc7ec992d	6b9e8d41-7044-4151-b4d6-e211b0e7a923	g.chr8:146033347T>C	ENST00000531720.1	+	4	1091	c.1046T>C	c.(1045-1047)gTg>gCg	p.V349A	ZNF517_ENST00000526178.1_Intron|ZNF517_ENST00000525105.1_Intron|ZNF517_ENST00000359971.3_Missense_Mutation_p.V349A			Q6ZMY9	ZN517_HUMAN	zinc finger protein 517	349				V -> A (in Ref. 1; BAD18586). {ECO:0000305}.	regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(2)|large_intestine(2)|lung(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	13	all_cancers(97;1.03e-11)|all_epithelial(106;6.69e-11)|Lung NSC(106;4.08e-05)|all_lung(105;0.000125)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		Epithelial(56;5.47e-39)|OV - Ovarian serous cystadenocarcinoma(54;6.38e-39)|all cancers(56;5.47e-34)|BRCA - Breast invasive adenocarcinoma(115;0.0355)|Colorectal(110;0.055)			GACGGCGGCGTGGGGCAGGGC	0.746													C|||	4981	0.994609	1.0	1.0	5008	,	,		12856	1.0		0.994	False		,,,				2504	0.9785				p.V349A		.											.	ZNF517-90	0			c.T1046C						.	C	ALA/VAL	3411,3		1704,3,0	3.0	5.0	4.0		1046	-0.8	0.0	8	dbSNP_101	4	7050,46		3502,46,0	no	missense	ZNF517	NM_213605.2	64	5206,49,0	CC,CT,TT		0.6483,0.0879,0.4662	benign	349/493	146033347	10461,49	1707	3548	5255	SO:0001583	missense	340385	exon5			GCGGCGTGGGGCA	AK096527	CCDS6434.1	8q24.3	2013-01-08				ENSG00000197363		"""Zinc fingers, C2H2-type"", ""-"""	27984	protein-coding gene	gene with protein product							Standard	NM_213605		Approved		uc003zed.1	Q6ZMY9		ENST00000531720.1:c.1046T>C	8.37:g.146033347T>C	ENSP00000436103:p.Val349Ala	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	20	20	NM_213605	0	0	0	0	0		Missense_Mutation	SNP	ENST00000531720.1	37	CCDS6434.1	2179|2179	0.9977106227106227|0.9977106227106227	492|492	1.0|1.0	362|362	1.0|1.0	572|572	1.0|1.0	753|753	0.9934036939313984|0.9934036939313984	C|C	0.021|0.021	-1.418607|-1.418607	0.01136|0.01136	0.999121|0.999121	0.993517|0.993517	ENSG00000197363|ENSG00000197363	ENST00000359971;ENST00000531720|ENST00000529429	T;T|.	0.05319|.	3.46;3.46|.	2.17|2.17	-0.838|-0.838	0.10762|0.10762	.|.	.|.	.|.	.|.	.|.	T|T	0.00012|0.00012	0.0000|0.0000	L|L	0.35644|0.35644	1.08|1.08	0.80722|0.80722	P|P	0.0|0.0	B|.	0.02656|.	0.0|.	B|.	0.01281|.	0.0|.	T|T	0.21449|0.21449	-1.0245|-1.0245	8|4	0.59425|.	D|.	0.04|.	.|.	0.241|0.241	0.00192|0.00192	0.362:0.2246:0.2135:0.1999|0.362:0.2246:0.2135:0.1999	rs2976653;rs59817342|rs2976653;rs59817342	349|.	Q6ZMY9|.	ZN517_HUMAN|.	A|R	349|316	ENSP00000353058:V349A;ENSP00000436103:V349A|.	ENSP00000353058:V349A|.	V|W	+|+	2|1	0|0	ZNF517|ZNF517	146004151|146004151	0.001000|0.001000	0.12720|0.12720	0.002000|0.002000	0.10522|0.10522	0.004000|0.004000	0.04260|0.04260	-0.400000|-0.400000	0.07241|0.07241	-0.612000|-0.612000	0.05701|0.05701	-1.157000|-1.157000	0.01802|0.01802	GTG|TGG	G|0.992;C|0.006		0.746	ZNF517-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382642.1	XM_291261	
ERMP1	79956	hgsc.bcm.edu	37	9	5832728	5832728	+	Silent	SNP	G	G	C	rs1131727	byFrequency	TCGA-OR-A5LG-01A-11D-A29I-10	TCGA-OR-A5LG-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a39e8bc9-757d-4536-b301-458fc7ec992d	6b9e8d41-7044-4151-b4d6-e211b0e7a923	g.chr9:5832728G>C	ENST00000339450.5	-	1	389	c.300C>G	c.(298-300)gcC>gcG	p.A100A	ERMP1_ENST00000214893.5_5'UTR|ERMP1_ENST00000381506.3_5'Flank	NM_024896.2	NP_079172.2	Q7Z2K6	ERMP1_HUMAN	endoplasmic reticulum metallopeptidase 1	100						endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	metal ion binding (GO:0046872)|metallopeptidase activity (GO:0008237)			endometrium(2)|kidney(1)|large_intestine(9)|lung(4)|ovary(1)|prostate(2)|skin(1)	20		Acute lymphoblastic leukemia(23;0.158)		GBM - Glioblastoma multiforme(50;0.00115)|Lung(218;0.111)		GGTGTCCAGCGGCCCCGCGTA	0.741													G|||	2021	0.403554	0.1309	0.428	5008	,	,		3601	0.7093		0.34	False		,,,				2504	0.5051				p.A100A		.											.	ERMP1-69	0			c.C300G						.						4.0	3.0	3.0					9																	5832728		1620	3326	4946	SO:0001819	synonymous_variant	79956	exon1			TCCAGCGGCCCCG	AB058718	CCDS34983.1	9p24	2008-02-05	2007-07-05	2007-07-05	ENSG00000099219	ENSG00000099219			23703	protein-coding gene	gene with protein product	"""Felix-ina"""	611156	"""KIAA1815"""	KIAA1815		11347906	Standard	XM_005251587		Approved	FLJ23309, FXNA	uc003zjm.1	Q7Z2K6	OTTHUMG00000019508	ENST00000339450.5:c.300C>G	9.37:g.5832728G>C		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	21	20	NM_024896	0	0	0	0	0	B2RNA4|B3KSB1|Q8N5T5|Q9H5M1	Silent	SNP	ENST00000339450.5	37	CCDS34983.1																																																																																			G|0.572;C|0.428		0.741	ERMP1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354877.1	NM_024896	
TAF1L	138474	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	32630736	32630736	+	Silent	SNP	C	C	T	rs374766892		TCGA-OR-A5LG-01A-11D-A29I-10	TCGA-OR-A5LG-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a39e8bc9-757d-4536-b301-458fc7ec992d	6b9e8d41-7044-4151-b4d6-e211b0e7a923	g.chr9:32630736C>T	ENST00000242310.4	-	1	4931	c.4842G>A	c.(4840-4842)gaG>gaA	p.E1614E	RP11-555J4.4_ENST00000430787.1_RNA	NM_153809.2	NP_722516.1	Q8IZX4	TAF1L_HUMAN	TAF1 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 210kDa-like	1614					DNA-templated transcription, initiation (GO:0006352)|histone acetylation (GO:0016573)|male meiosis (GO:0007140)|positive regulation of transcription, DNA-templated (GO:0045893)|protein phosphorylation (GO:0006468)|regulation of transcription from RNA polymerase II promoter (GO:0006357)	transcription factor TFIID complex (GO:0005669)	DNA binding (GO:0003677)|histone acetyltransferase activity (GO:0004402)|lysine-acetylated histone binding (GO:0070577)|protein serine/threonine kinase activity (GO:0004674)|TBP-class protein binding (GO:0017025)			breast(6)|central_nervous_system(4)|endometrium(14)|kidney(11)|large_intestine(32)|liver(2)|lung(68)|ovary(2)|pancreas(2)|prostate(7)|skin(9)|stomach(1)|upper_aerodigestive_tract(1)	159			LUSC - Lung squamous cell carcinoma(29;0.0181)	GBM - Glioblastoma multiforme(74;0.00301)		TGTTCACAATCTCCTGAGCAG	0.398																																					p.E1614E		.											.	TAF1L-870	0			c.G4842A						.						130.0	121.0	124.0					9																	32630736		2203	4300	6503	SO:0001819	synonymous_variant	138474	exon1			CACAATCTCCTGA	AF390562	CCDS35003.1	9p12	2007-07-27	2007-07-27		ENSG00000122728	ENSG00000122728			18056	protein-coding gene	gene with protein product		607798	"""TAF1-like RNA polymerase II, TATA box binding protein (TBP)-associated factor, 210kDa"""			12217962	Standard	NM_153809		Approved		uc003zrg.1	Q8IZX4	OTTHUMG00000019747	ENST00000242310.4:c.4842G>A	9.37:g.32630736C>T		Somatic	240	0		WXS	Illumina GAIIx	Phase_I	235	101	NM_153809	0	0	0	0	0	Q0VG57	Silent	SNP	ENST00000242310.4	37	CCDS35003.1																																																																																			.		0.398	TAF1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052012.2		
SPATA31A3	727830	bcgsc.ca	37	9	40705751	40705751	+	Silent	SNP	C	C	T			TCGA-OR-A5LG-01A-11D-A29I-10	TCGA-OR-A5LG-10A-01D-A29L-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a39e8bc9-757d-4536-b301-458fc7ec992d	6b9e8d41-7044-4151-b4d6-e211b0e7a923	g.chr9:40705751C>T	ENST00000356699.5	+	4	3437	c.3408C>T	c.(3406-3408)gtC>gtT	p.V1136V	RP11-395E19.5_ENST00000432614.1_lincRNA	NM_001083124.1	NP_001076593.1	Q5VYP0	S31A3_HUMAN	SPATA31 subfamily A, member 3	1136					cell differentiation (GO:0030154)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)											TTACCCCAGTCAGGAAAACAG	0.453																																					p.V1136V		.											.	.	0			c.C3408T						.						14.0	12.0	12.0					9																	40705751		888	2018	2906	SO:0001819	synonymous_variant	727830	exon4			CCCAGTCAGGAAA			9p12	2012-10-15	2012-10-12	2012-10-12	ENSG00000147926				32003	protein-coding gene	gene with protein product			"""family with sequence similarity 75, member A3"""	FAM75A3		20850414	Standard	NM_001083124		Approved	OTTHUMG00000013164, DKFZp434B204	uc010mmj.3	Q5VYP0	OTTHUMG00000013164	ENST00000356699.5:c.3408C>T	9.37:g.40705751C>T		Somatic	318	2		WXS	Illumina GAIIx	Phase_I	302	162	NM_001083124	0	0	0	0	0		Silent	SNP	ENST00000356699.5	37	CCDS47969.1																																																																																			.		0.453	SPATA31A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000036919.1	NM_001083124	
FXN	2395	hgsc.bcm.edu	37	9	71650752	71650752	+	Silent	SNP	A	A	G	rs2481598	byFrequency	TCGA-OR-A5LG-01A-11D-A29I-10	TCGA-OR-A5LG-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a39e8bc9-757d-4536-b301-458fc7ec992d	6b9e8d41-7044-4151-b4d6-e211b0e7a923	g.chr9:71650752A>G	ENST00000377270.3	+	1	578	c.54A>G	c.(52-54)ccA>ccG	p.P18P	FXN_ENST00000396366.2_Silent_p.P18P|FXN_ENST00000396364.3_Silent_p.P18P|FXN_ENST00000498653.1_5'Flank	NM_000144.4	NP_000135.2	Q16595	FRDA_HUMAN	frataxin	18					adult walking behavior (GO:0007628)|aerobic respiration (GO:0009060)|cellular iron ion homeostasis (GO:0006879)|cellular response to hydrogen peroxide (GO:0070301)|embryo development ending in birth or egg hatching (GO:0009792)|heme biosynthetic process (GO:0006783)|ion transport (GO:0006811)|iron incorporation into metallo-sulfur cluster (GO:0018283)|mitochondrion organization (GO:0007005)|negative regulation of apoptotic process (GO:0043066)|negative regulation of multicellular organism growth (GO:0040015)|negative regulation of organ growth (GO:0046621)|negative regulation of release of cytochrome c from mitochondria (GO:0090201)|oxidative phosphorylation (GO:0006119)|positive regulation of cell growth (GO:0030307)|positive regulation of cell proliferation (GO:0008284)|positive regulation of lyase activity (GO:0051349)|positive regulation of metalloenzyme activity (GO:0048554)|positive regulation of oxidoreductase activity (GO:0051353)|positive regulation of transferase activity (GO:0051347)|proprioception (GO:0019230)|protein autoprocessing (GO:0016540)|regulation of ferrochelatase activity (GO:0010722)|response to iron ion (GO:0010039)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	2 iron, 2 sulfur cluster binding (GO:0051537)|ferric iron binding (GO:0008199)|ferrous iron binding (GO:0008198)|ferroxidase activity (GO:0004322)|iron chaperone activity (GO:0034986)|iron-sulfur cluster binding (GO:0051536)			large_intestine(1)|lung(1)	2						CACCCAGCCCAGCCCAGGCCC	0.756													G|||	4932	0.984824	0.9433	0.9986	5008	,	,		9396	1.0		1.0	False		,,,				2504	1.0				p.P18P		.											.	FXN-251	0			c.A54G						.						1.0	2.0	2.0					9																	71650752		971	2168	3139	SO:0001819	synonymous_variant	2395	exon1			CAGCCCAGCCCAG	U43752	CCDS6626.1, CCDS43834.1, CCDS55313.1	9q21.11	2014-09-17	2004-08-16	2004-08-19	ENSG00000165060	ENSG00000165060			3951	protein-coding gene	gene with protein product		606829	"""Friedreich ataxia"""	FRDA		8596916, 8841185	Standard	NM_000144		Approved	FA, FARR, X25, CyaY	uc004aha.2	Q16595	OTTHUMG00000019977	ENST00000377270.3:c.54A>G	9.37:g.71650752A>G		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	5	5	NM_000144	0	0	0	0	0	A8MXJ6|C9JJ89|O15545|O95656|Q15294|Q5VZ01	Silent	SNP	ENST00000377270.3	37	CCDS6626.1																																																																																			A|0.038;G|0.962		0.756	FXN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052568.2	NM_000144	
SVEP1	79987	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	113192698	113192698	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5LG-01A-11D-A29I-10	TCGA-OR-A5LG-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a39e8bc9-757d-4536-b301-458fc7ec992d	6b9e8d41-7044-4151-b4d6-e211b0e7a923	g.chr9:113192698C>T	ENST00000401783.2	-	33	5722	c.5386G>A	c.(5386-5388)Gaa>Aaa	p.E1796K	SVEP1_ENST00000374469.1_Missense_Mutation_p.E1773K|SVEP1_ENST00000297826.5_5'Flank	NM_153366.3	NP_699197.3	Q4LDE5	SVEP1_HUMAN	sushi, von Willebrand factor type A, EGF and pentraxin domain containing 1	1796	Sushi 7. {ECO:0000255|PROSITE- ProRule:PRU00302}.				cell adhesion (GO:0007155)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|membrane (GO:0016020)	calcium ion binding (GO:0005509)|chromatin binding (GO:0003682)			NS(1)|autonomic_ganglia(1)|breast(5)|central_nervous_system(1)|cervix(2)|endometrium(19)|kidney(8)|large_intestine(24)|lung(58)|ovary(7)|prostate(7)|skin(1)|stomach(4)|upper_aerodigestive_tract(5)|urinary_tract(4)	147						TGGCCATTTTCCGGATTTCCT	0.423																																					p.E1796K		.											.	SVEP1-75	0			c.G5386A						.						49.0	45.0	46.0					9																	113192698		1836	4089	5925	SO:0001583	missense	79987	exon33			CATTTTCCGGATT	AK027870		9q31-q32	2008-02-05	2005-03-15	2005-03-17	ENSG00000165124	ENSG00000165124			15985	protein-coding gene	gene with protein product		611691	"""chromosome 9 open reading frame 13"""	C9orf13			Standard	NM_153366		Approved	bA427L11.3, POLYDOM, FLJ13529	uc010mtz.3	Q4LDE5	OTTHUMG00000020482	ENST00000401783.2:c.5386G>A	9.37:g.113192698C>T	ENSP00000384917:p.Glu1796Lys	Somatic	94	0		WXS	Illumina GAIIx	Phase_I	133	55	NM_153366	0	0	0	0	0	Q0P675|Q5D213|Q5T938|Q5VTE4|Q5VTE5|Q7Z387|Q7Z3G3|Q8NBT9|Q96JU7|Q9H284|Q9H8J9	Missense_Mutation	SNP	ENST00000401783.2	37	CCDS48004.1	.	.	.	.	.	.	.	.	.	.	C	20.6	4.020849	0.75275	.	.	ENSG00000165124	ENST00000401783;ENST00000374469	T;T	0.63913	-0.07;-0.07	5.18	5.18	0.71444	Complement control module (2);Sushi/SCR/CCP (3);	0.194431	0.53938	D	0.000059	T	0.62060	0.2397	L	0.41079	1.255	0.80722	D	1	P	0.50819	0.939	P	0.51453	0.67	T	0.55042	-0.8202	10	0.07990	T	0.79	.	18.8778	0.92345	0.0:1.0:0.0:0.0	.	1796	Q4LDE5	SVEP1_HUMAN	K	1796;1773	ENSP00000384917:E1796K;ENSP00000363593:E1773K	ENSP00000363593:E1773K	E	-	1	0	SVEP1	112232519	1.000000	0.71417	1.000000	0.80357	0.901000	0.52897	4.610000	0.61155	2.679000	0.91253	0.655000	0.94253	GAA	.		0.423	SVEP1-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding			
WDR34	89891	hgsc.bcm.edu	37	9	131418828	131418828	+	Missense_Mutation	SNP	A	A	C	rs4837292		TCGA-OR-A5LG-01A-11D-A29I-10	TCGA-OR-A5LG-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a39e8bc9-757d-4536-b301-458fc7ec992d	6b9e8d41-7044-4151-b4d6-e211b0e7a923	g.chr9:131418828A>C	ENST00000372715.2	-	1	238	c.178T>G	c.(178-180)Tgg>Ggg	p.W60G		NM_052844.3	NP_443076.2	Q96EX3	WDR34_HUMAN	WD repeat domain 34	60				W -> G (in Ref. 2; AAH11874/AAH01614). {ECO:0000305}.		axoneme (GO:0005930)|centriole (GO:0005814)|ciliary basal body (GO:0036064)				central_nervous_system(2)|lung(5)|skin(1)|urinary_tract(1)	9						ACCGTCTCCCAGCGGATGCCC	0.806																																					p.W60G		.											.	WDR34-92	0			c.T178G						.	C	GLY/TRP	1803,9		897,9,0	1.0	1.0	1.0		178	2.1	1.0	9	dbSNP_111	1	3858,0		1929,0,0	no	missense	WDR34	NM_052844.3	184	2826,9,0	CC,CA,AA		0.0,0.4967,0.1587	benign	60/537	131418828	5661,9	906	1929	2835	SO:0001583	missense	89891	exon1			TCTCCCAGCGGAT	BC011874	CCDS6906.2	9q34.11	2013-11-15	2013-02-19	2013-02-19	ENSG00000119333	ENSG00000119333		"""WD repeat domain containing"""	28296	protein-coding gene	gene with protein product		613363				19521662, 21953912, 24183451	Standard	NM_052844		Approved	DIC5, MGC20486, bA216B9.3, FAP133	uc004bvq.1	Q96EX3	OTTHUMG00000020750	ENST00000372715.2:c.178T>G	9.37:g.131418828A>C	ENSP00000361800:p.Trp60Gly	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	5	5	NM_052844	0	0	0	0	0	Q5VXV4|Q9BV46	Missense_Mutation	SNP	ENST00000372715.2	37	CCDS6906.2	2170	0.9935897435897436	486	0.9878048780487805	362	1.0	571	0.9982517482517482	751	0.9907651715039578	C	7.343	0.621247	0.14193	0.995033	1.0	ENSG00000119333	ENST00000372715;ENST00000451652;ENST00000419989	T;T;T	0.74106	-0.81;-0.81;-0.81	4.02	2.12	0.27331	.	0.538297	0.18788	N	0.131154	T	0.00012	0.0000	N	0.00538	-1.39	0.58432	P	1.999999999946489E-6	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.34625	-0.9821	9	0.08381	T	0.77	-3.0135	7.4804	0.27402	0.1755:0.4462:0.3784:0.0	rs4837292;rs56752541	45;60	A2A3F8;Q96EX3	.;WDR34_HUMAN	G	60;51;45	ENSP00000361800:W60G;ENSP00000411370:W51G;ENSP00000415421:W45G	ENSP00000361800:W60G	W	-	1	0	WDR34	130458649	1.000000	0.71417	0.994000	0.49952	0.970000	0.65996	0.709000	0.25734	0.259000	0.21709	-0.126000	0.14955	TGG	A|0.006;C|0.994		0.806	WDR34-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054463.1	NM_052844	
PRRC2B	84726	bcgsc.ca	37	9	134351500	134351500	+	Silent	SNP	C	C	T	rs113338693	byFrequency	TCGA-OR-A5LG-01A-11D-A29I-10	TCGA-OR-A5LG-10A-01D-A29L-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a39e8bc9-757d-4536-b301-458fc7ec992d	6b9e8d41-7044-4151-b4d6-e211b0e7a923	g.chr9:134351500C>T	ENST00000357304.4	+	15	4039	c.3984C>T	c.(3982-3984)ccC>ccT	p.P1328P	PRRC2B_ENST00000405995.1_Intron|PRRC2B_ENST00000372249.1_5'UTR|PRRC2B_ENST00000458550.1_Intron	NM_013318.3	NP_037450.2	Q5JSZ5	PRC2B_HUMAN	proline-rich coiled-coil 2B	1328							poly(A) RNA binding (GO:0044822)			cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(7)|lung(20)|ovary(2)	44						TGTGGGGACCCGAGGAGGAGC	0.682											OREG0019561	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	C|||	243	0.0485224	0.0091	0.1383	5008	,	,		14582	0.0546		0.0577	False		,,,				2504	0.0225				p.P1328P		.											.	PRRC2B-24	0			c.C3984T						.	C		73,3701		1,71,1815	27.0	34.0	32.0		3984	-11.3	0.0	9	dbSNP_132	32	372,7844		12,348,3748	no	coding-synonymous	PRRC2B	NM_013318.3		13,419,5563	TT,TC,CC		4.5278,1.9343,3.7114		1328/2230	134351500	445,11545	1887	4108	5995	SO:0001819	synonymous_variant	84726	exon15			GGGACCCGAGGAG	AB011087	CCDS48044.1	9q34.13	2010-12-09	2010-12-09	2010-12-09	ENSG00000130723	ENSG00000130723			28121	protein-coding gene	gene with protein product			"""KIAA0515"", ""HLA-B associated transcript 2-like"", ""HLA-B associated transcript 2-like 1"""	KIAA0515, BAT2L, BAT2L1		9628581	Standard	NM_013318		Approved	MGC10526, LQFBS-1	uc004can.4	Q5JSZ5	OTTHUMG00000020827	ENST00000357304.4:c.3984C>T	9.37:g.134351500C>T		Somatic	56	0	1610	WXS	Illumina GAIIx	Phase_I	74	4	NM_013318	0	0	2	2	0	O60270|Q5JSZ7|Q66VZ2|Q68CR0|Q96EI9|Q9H683	Silent	SNP	ENST00000357304.4	37	CCDS48044.1	123	0.05631868131868132	6	0.012195121951219513	40	0.11049723756906077	34	0.05944055944055944	43	0.05672823218997362	C	2.521	-0.310833	0.05458	0.019343	0.045278	ENSG00000130723	ENST00000451855	.	.	.	5.66	-11.3	0.00108	.	.	.	.	.	.	.	.	.	.	.	0.54753	D	0.999988	.	.	.	.	.	.	.	.	.	.	.	.	.	.	2.364	0.04314	0.1886:0.254:0.0846:0.4729	.	.	.	.	X	62	.	.	R	+	1	2	PRRC2B	133341321	0.000000	0.05858	0.009000	0.14445	0.639000	0.38242	-5.361000	0.00128	-3.751000	0.00111	-0.857000	0.03018	CGA	C|0.943;T|0.057		0.682	PRRC2B-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding			
SEC16A	9919	broad.mit.edu	37	9	139369408	139369408	+	Missense_Mutation	SNP	C	C	T	rs200238338	byFrequency	TCGA-OR-A5LG-01A-11D-A29I-10	TCGA-OR-A5LG-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a39e8bc9-757d-4536-b301-458fc7ec992d	6b9e8d41-7044-4151-b4d6-e211b0e7a923	g.chr9:139369408C>T	ENST00000371706.3	-	1	2159	c.2126G>A	c.(2125-2127)gGg>gAg	p.G709E	SEC16A_ENST00000313050.7_Missense_Mutation_p.G887E|SEC16A_ENST00000290037.6_Missense_Mutation_p.G709E|SEC16A_ENST00000431893.2_Missense_Mutation_p.G709E			O15027	SC16A_HUMAN	SEC16 homolog A (S. cerevisiae)	709					COPII vesicle coating (GO:0048208)|endoplasmic reticulum organization (GO:0007029)|protein transport (GO:0015031)|substantia nigra development (GO:0021762)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)				breast(1)|central_nervous_system(3)|endometrium(7)|kidney(5)|large_intestine(15)|lung(14)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51		Myeloproliferative disorder(178;0.0511)		Epithelial(140;2.9e-06)|OV - Ovarian serous cystadenocarcinoma(145;5.88e-06)		GGTTGGAATCCCAGACAAAGA	0.502																																					p.G887E		.											.	.	0			c.G2660A						.	C	GLU/GLY	0,4000		0,0,2000	41.0	43.0	42.0		2660	4.8	0.0	9		42	8,8324		0,8,4158	yes	missense	SEC16A	NM_014866.1	98	0,8,6158	TT,TC,CC		0.096,0.0,0.0649	probably-damaging	887/2358	139369408	8,12324	2000	4166	6166	SO:0001583	missense	9919	exon3			GGAATCCCAGACA	AK074565	CCDS55351.1, CCDS75936.1	9q34.3	2007-06-20	2007-06-20	2007-06-20	ENSG00000148396	ENSG00000148396			29006	protein-coding gene	gene with protein product		612854	"""KIAA0310"""	KIAA0310		9205841	Standard	NM_014866		Approved	p250	uc004chx.3	O15027	OTTHUMG00000020932	ENST00000371706.3:c.2126G>A	9.37:g.139369408C>T	ENSP00000360771:p.Gly709Glu	Somatic	60	0		WXS	Illumina GAIIx	Phase_I	76	4	NM_014866	0	0	2	2	0	A1YCA4|Q4G0D7|Q5SXP0|Q5SXP1|Q8N347|Q96HP1	Missense_Mutation	SNP	ENST00000371706.3	37		.	.	.	.	.	.	.	.	.	.	C	16.08	3.021765	0.54576	0.0	9.6E-4	ENSG00000148396	ENST00000313050;ENST00000371706;ENST00000290037;ENST00000431893	T;T;T;T	0.22134	1.98;1.97;1.98;1.98	5.65	4.75	0.60458	.	0.546992	0.19495	N	0.112866	T	0.28466	0.0704	M	0.65975	2.015	0.20926	N	0.999827	D;D;D	0.56746	0.961;0.977;0.977	P;P;P	0.53593	0.541;0.73;0.73	T	0.12837	-1.0532	10	0.02654	T	1	-18.6431	9.6945	0.40150	0.25:0.6255:0.1245:0.0	.	887;709;709	F1T0I1;O15027-5;O15027-4	.;.;.	E	887;709;709;709	ENSP00000325827:G887E;ENSP00000360771:G709E;ENSP00000290037:G709E;ENSP00000387583:G709E	ENSP00000290037:G709E	G	-	2	0	SEC16A	138489229	0.000000	0.05858	0.012000	0.15200	0.104000	0.19210	0.560000	0.23500	1.496000	0.48567	0.655000	0.94253	GGG	C|0.991;T|0.008		0.502	SEC16A-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000055077.1	XM_088459	
TIMP1	7076	bcgsc.ca	37	X	47444985	47444985	+	Silent	SNP	T	T	C	rs4898	byFrequency	TCGA-OR-A5LG-01A-11D-A29I-10	TCGA-OR-A5LG-10A-01D-A29L-10	T	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a39e8bc9-757d-4536-b301-458fc7ec992d	6b9e8d41-7044-4151-b4d6-e211b0e7a923	g.chrX:47444985T>C	ENST00000218388.4	+	5	542	c.372T>C	c.(370-372)ttT>ttC	p.F124F	SYN1_ENST00000340666.4_Intron|TIMP1_ENST00000377018.2_Silent_p.F118F|SYN1_ENST00000295987.7_Intron|TIMP1_ENST00000456754.2_3'UTR|TIMP1_ENST00000377017.1_Silent_p.F60F|MIR4769_ENST00000584126.1_RNA	NM_003254.2	NP_003245.1	P01033	TIMP1_HUMAN	TIMP metallopeptidase inhibitor 1	124	NTR. {ECO:0000255|PROSITE- ProRule:PRU00295}.				aging (GO:0007568)|blood coagulation (GO:0007596)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|negative regulation of apoptotic process (GO:0043066)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of membrane protein ectodomain proteolysis (GO:0051045)|negative regulation of metalloenzyme activity (GO:0048553)|negative regulation of trophoblast cell migration (GO:1901164)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of cell proliferation (GO:0008284)|regulation of integrin-mediated signaling pathway (GO:2001044)|response to cytokine (GO:0034097)|response to peptide hormone (GO:0043434)	basement membrane (GO:0005604)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|platelet alpha granule lumen (GO:0031093)	cytokine activity (GO:0005125)|metal ion binding (GO:0046872)|metalloendopeptidase inhibitor activity (GO:0008191)			endometrium(1)|large_intestine(2)	3						CCTGCAGTTTTGTGGCTCCCT	0.572													c|||	1772	0.469404	0.3676	0.3184	3775	,	,		10671	0.3472		0.3539	False		,,,				2504	0.3671				p.F124F		.											.	TIMP1-650	0			c.T372C	GRCh37	CM991177	TIMP1	M	rs4898	.		,,	1814,2021		368,820,258,444,313	44.0	36.0	39.0		372,,	0.4	0.3	X	dbSNP_52	39	3078,3650		522,1211,823,695,1049	no	coding-synonymous,intron,intron	SYN1,TIMP1	NM_003254.2,NM_006950.3,NM_133499.2	,,	890,2031,1081,1139,1362	CC,CT,C,TT,T		45.7491,47.3012,46.3126	,,	124/208,,	47444985	4892,5671	2203	4300	6503	SO:0001819	synonymous_variant	7076	exon5			CAGTTTTGTGGCT		CCDS14281.1	Xp11.3-p11.23	2008-07-29	2005-08-08		ENSG00000102265	ENSG00000102265			11820	protein-coding gene	gene with protein product		305370	"""tissue inhibitor of metalloproteinase 1 (erythroid potentiating activity, collagenase inhibitor)"""	TIMP, CLGI			Standard	XM_005272645		Approved	EPO	uc004dif.3	P01033	OTTHUMG00000021447	ENST00000218388.4:c.372T>C	X.37:g.47444985T>C		Somatic	79	0		WXS	Illumina GAIIx	Phase_I	89	5	NM_003254	0	0	1870	1873	3	Q14252|Q9UCU1	Silent	SNP	ENST00000218388.4	37	CCDS14281.1	748	0.45087402049427366	101	0.27595628415300544	79	0.2762237762237762	124	0.2818181818181818	199	0.33166666666666667	c	3.324	-0.138159	0.06669	0.473012	0.457491	ENSG00000102265	ENST00000445623	.	.	.	5.29	0.454	0.16644	.	.	.	.	.	T	0.00012	0.0000	.	.	.	0.39430	P	0.03293199999999996	.	.	.	.	.	.	T	0.47381	-0.9122	3	.	.	.	.	9.163	0.37035	0.0:0.4676:0.0:0.5324	rs4898;rs1043945;rs6520277;rs17849372;rs57987733;rs4898	.	.	.	S	82	.	.	L	+	2	0	TIMP1	47329929	0.052000	0.20516	0.290000	0.24890	0.402000	0.30811	-1.200000	0.03029	-0.352000	0.08237	-1.181000	0.01715	TTG	T|0.536;C|0.464		0.572	TIMP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056423.1	NM_003254	
GPRASP2	114928	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	101971586	101971586	+	Nonsense_Mutation	SNP	G	G	T			TCGA-OR-A5LG-01A-11D-A29I-10	TCGA-OR-A5LG-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a39e8bc9-757d-4536-b301-458fc7ec992d	6b9e8d41-7044-4151-b4d6-e211b0e7a923	g.chrX:101971586G>T	ENST00000535209.1	+	4	2620	c.1789G>T	c.(1789-1791)Gag>Tag	p.E597*	GPRASP2_ENST00000543253.1_Nonsense_Mutation_p.E597*|GPRASP2_ENST00000332262.5_Nonsense_Mutation_p.E597*			Q96D09	GASP2_HUMAN	G protein-coupled receptor associated sorting protein 2	597						cytoplasm (GO:0005737)	beta-amyloid binding (GO:0001540)			breast(3)|endometrium(5)|kidney(2)|large_intestine(6)|lung(12)|ovary(1)|upper_aerodigestive_tract(1)	30						TGGTTCTGAAGAGTTTGAAGA	0.403																																					p.E597X		.											.	GPRASP2-131	0			c.G1789T						.						79.0	77.0	77.0					X																	101971586		2203	4300	6503	SO:0001587	stop_gained	114928	exon4			TCTGAAGAGTTTG	AK094646	CCDS14501.1	Xq22.1	2014-03-21			ENSG00000158301	ENSG00000158301		"""Armadillo repeat containing"""	25169	protein-coding gene	gene with protein product						15086532, 16221301	Standard	NM_138437		Approved	GASP2, FLJ37327		Q96D09	OTTHUMG00000022059	ENST00000535209.1:c.1789G>T	X.37:g.101971586G>T	ENSP00000437394:p.Glu597*	Somatic	142	0		WXS	Illumina GAIIx	Phase_I	170	155	NM_138437	0	0	0	12	12	D3DXA0|Q8NAB4	Nonsense_Mutation	SNP	ENST00000535209.1	37	CCDS14501.1	.	.	.	.	.	.	.	.	.	.	G	40	8.277779	0.98740	.	.	ENSG00000158301	ENST00000543253;ENST00000535209;ENST00000332262	.	.	.	4.33	4.33	0.51752	.	0.000000	0.47455	D	0.000223	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.56958	D	0.05	.	11.2029	0.48751	0.0:0.0:1.0:0.0	.	.	.	.	X	597	.	ENSP00000339057:E597X	E	+	1	0	GPRASP2	101858242	0.998000	0.40836	0.942000	0.38095	0.624000	0.37722	3.660000	0.54496	2.413000	0.81919	0.600000	0.82982	GAG	.		0.403	GPRASP2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057626.2	NM_138437	
SOWAHD	347454	hgsc.bcm.edu	37	X	118892888	118892888	+	Silent	SNP	G	G	C	rs2782222	byFrequency	TCGA-OR-A5LG-01A-11D-A29I-10	TCGA-OR-A5LG-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a39e8bc9-757d-4536-b301-458fc7ec992d	6b9e8d41-7044-4151-b4d6-e211b0e7a923	g.chrX:118892888G>C	ENST00000343905.3	+	1	313	c.258G>C	c.(256-258)gcG>gcC	p.A86A		NM_001105576.2	NP_001099046.1	A6NJG2	SWAHD_HUMAN	sosondowah ankyrin repeat domain family member D	86																	CGGCTCCTGCGGGGTGGCTGT	0.751													c|||	2295	0.607947	0.4735	0.4841	3775	,	,		7549	0.372		0.495	False		,,,				2504	0.4703				p.A86A		.											.	.	0			c.G258C						.			1145,466		378,253,136,67,79	1.0	2.0	2.0		258	2.3	0.0	X	dbSNP_100	2	2545,1233		737,547,524,198,290	no	coding-synonymous	ANKRD58	NM_001105576.2		1115,800,660,265,369	CC,CG,C,GG,G		32.6363,28.9261,31.5272		86/316	118892888	3690,1699	913	2296	3209	SO:0001819	synonymous_variant	347454	exon1			TCCTGCGGGGTGG		CCDS43984.1	Xq24	2013-01-10	2012-01-12	2012-01-12	ENSG00000187808	ENSG00000187808		"""Ankyrin repeat domain containing"""	32960	protein-coding gene	gene with protein product			"""ankyrin repeat domain 58"""	ANKRD58		22234889	Standard	NM_001105576		Approved		uc010nql.3	A6NJG2	OTTHUMG00000159606	ENST00000343905.3:c.258G>C	X.37:g.118892888G>C		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	7	7	NM_001105576	0	0	0	0	0		Silent	SNP	ENST00000343905.3	37	CCDS43984.1																																																																																			G|0.401;C|0.599		0.751	SOWAHD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356469.1	NM_001105576	
ENOX2	10495	bcgsc.ca	37	X	129790662	129790662	+	Missense_Mutation	SNP	C	C	T	rs200580901		TCGA-OR-A5LG-01A-11D-A29I-10	TCGA-OR-A5LG-10A-01D-A29L-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a39e8bc9-757d-4536-b301-458fc7ec992d	6b9e8d41-7044-4151-b4d6-e211b0e7a923	g.chrX:129790662C>T	ENST00000370927.1	-	8	1130	c.1109G>A	c.(1108-1110)cGc>cAc	p.R370H	ENOX2_ENST00000370935.1_Missense_Mutation_p.R341H|ENOX2_ENST00000394363.1_Missense_Mutation_p.R341H|ENOX2_ENST00000338144.3_Missense_Mutation_p.R370H			Q16206	ENOX2_HUMAN	ecto-NOX disulfide-thiol exchanger 2	370					cell growth (GO:0016049)|oxidation-reduction process (GO:0055114)|regulation of growth (GO:0040008)|ultradian rhythm (GO:0007624)	cytosol (GO:0005829)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)	nucleic acid binding (GO:0003676)|nucleotide binding (GO:0000166)|protein disulfide oxidoreductase activity (GO:0015035)			breast(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(17)|ovary(1)|prostate(3)	33						ATGAATGTTGCGAATTTCCTA	0.323													C|||	1	0.000264901	0.0	0.0	3775	,	,		14623	0.0		0.001	False		,,,				2504	0.0				p.R370H	Ovarian(101;828 1506 2951 9500 35258)	.											.	ENOX2-131	0			c.G1109A						.						108.0	94.0	99.0					X																	129790662		2203	4296	6499	SO:0001583	missense	10495	exon11			ATGTTGCGAATTT	AF207881	CCDS14626.1, CCDS14627.1	Xq25	2013-02-12	2007-03-23	2007-03-23	ENSG00000165675	ENSG00000165675		"""RNA binding motif (RRM) containing"""	2259	protein-coding gene	gene with protein product		300282	"""cytosolic ovarian carcinoma antigen 1"""	COVA1		8150545, 11888291	Standard	NM_006375		Approved	APK1, tNOX	uc004evw.3	Q16206	OTTHUMG00000022401	ENST00000370927.1:c.1109G>A	X.37:g.129790662C>T	ENSP00000359965:p.Arg370His	Somatic	30	0		WXS	Illumina GAIIx	Phase_I	45	4	NM_182314	0	0	0	0	0	A8K197|A8K1C2|Q5VTJ1|Q5VTJ2|Q8WUX0|Q9NTP6|Q9UH82	Missense_Mutation	SNP	ENST00000370927.1	37	CCDS14626.1	0	0.0	0	0.0	0	0.0	0	0.0	0	0.0	C	21.7	4.191439	0.78902	.	.	ENSG00000165675	ENST00000538435;ENST00000370935;ENST00000338144;ENST00000394363;ENST00000350369;ENST00000370927;ENST00000432489	T;T	0.29397	1.57;1.57	4.96	4.1	0.47936	.	0.000000	0.85682	D	0.000000	T	0.50684	0.1630	M	0.69823	2.125	0.50313	D	0.999862	D;D	0.89917	1.0;1.0	D;D	0.78314	0.991;0.991	T	0.48647	-0.9017	9	.	.	.	-3.922	9.9925	0.41879	0.0:0.8995:0.0:0.1005	.	370;398	Q16206;A4QPE1	ENOX2_HUMAN;.	H	341;341;370;341;398;370;341	ENSP00000337146:R370H;ENSP00000359965:R370H	.	R	-	2	0	ENOX2	129618343	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	5.300000	0.65721	1.081000	0.41110	0.600000	0.82982	CGC	C|1.000;T|0.000		0.323	ENOX2-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000058277.1	NM_182314	
MCF2	4168	bcgsc.ca	37	X	138686878	138686878	+	Missense_Mutation	SNP	G	G	A	rs61751333	byFrequency	TCGA-OR-A5LG-01A-11D-A29I-10	TCGA-OR-A5LG-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a39e8bc9-757d-4536-b301-458fc7ec992d	6b9e8d41-7044-4151-b4d6-e211b0e7a923	g.chrX:138686878G>A	ENST00000370576.4	-	15	1914	c.1705C>T	c.(1705-1707)Cat>Tat	p.H569Y	MCF2_ENST00000370578.4_Missense_Mutation_p.H714Y|MCF2_ENST00000338585.6_Missense_Mutation_p.H585Y|MCF2_ENST00000414978.1_Missense_Mutation_p.H629Y|MCF2_ENST00000520602.1_Missense_Mutation_p.H629Y|MCF2_ENST00000519895.1_Missense_Mutation_p.H645Y|MCF2_ENST00000483690.1_5'Flank|MCF2_ENST00000536274.1_Missense_Mutation_p.H530Y|MCF2_ENST00000370573.4_Missense_Mutation_p.H569Y	NM_001171879.1|NM_005369.4	NP_001165350.1|NP_005360.3	P10911	MCF2_HUMAN	MCF.2 cell line derived transforming sequence	569	DH. {ECO:0000255|PROSITE- ProRule:PRU00062}.				apoptotic signaling pathway (GO:0097190)|dendrite development (GO:0016358)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)			NS(2)|cervix(2)|endometrium(4)|kidney(2)|large_intestine(15)|lung(34)|pancreas(1)|pleura(1)|prostate(1)	62	Acute lymphoblastic leukemia(192;0.000127)					TCTGGAGCATGAGCACAATTT	0.318													G|||	25	0.00662252	0.0	0.0086	3775	,	,		10068	0.0		0.0189	False		,,,				2504	0.0				p.H645Y		.											.	MCF2-227	0			c.C1933T						.	G	TYR/HIS,TYR/HIS,TYR/HIS,TYR/HIS,TYR/HIS,TYR/HIS	7,3825		0,7,0,1624,570	28.0	28.0	28.0		1885,1933,1588,1705,1753,1705	-2.6	0.0	X	dbSNP_129	28	139,6581		1,91,46,2335,1820	yes	missense,missense,missense,missense,missense,missense	MCF2	NM_001099855.1,NM_001171876.1,NM_001171877.1,NM_001171878.1,NM_001171879.1,NM_005369.4	83,83,83,83,83,83	1,98,46,3959,2390	AA,AG,A,GG,G		2.0685,0.1827,1.3836	benign,benign,benign,benign,benign,benign	629/986,645/1002,530/822,569/861,585/942,569/926	138686878	146,10406	2201	4293	6494	SO:0001583	missense	4168	exon19			GAGCATGAGCACA		CCDS14667.1, CCDS48175.1, CCDS55514.1, CCDS55515.1, CCDS55516.1, CCDS55517.1	Xq26.3-q27.1	2012-07-24			ENSG00000101977	ENSG00000101977		"""Rho guanine nucleotide exchange factors"""	6940	protein-coding gene	gene with protein product	"""Oncogene MCF2 (oncogene DBL)"""	311030				2577874, 1611909	Standard	NM_001099855		Approved	DBL, ARHGEF21	uc011mwo.1	P10911	OTTHUMG00000022537	ENST00000370576.4:c.1705C>T	X.37:g.138686878G>A	ENSP00000359608:p.His569Tyr	Somatic	43	0		WXS	Illumina GAIIx	Phase_I	43	4	NM_001171876	0	0	25	25	0	B7Z3Y5|B7Z869|B7ZAV1|E9PH77|F5H091|P14919|Q5JYJ2|Q5JYJ3|Q5JYJ4|Q8IUF3|Q8IUF4|Q9UJB3	Missense_Mutation	SNP	ENST00000370576.4	37	CCDS14667.1	19|19	0.011452682338758288|0.011452682338758288	0|0	0.0|0.0	2|2	0.00558659217877095|0.00558659217877095	0|0	0.0|0.0	11|11	0.014666666666666666|0.014666666666666666	G|G	4.066|4.066	0.009961|0.009961	0.07912|0.07912	0.001827|0.001827	0.020685|0.020685	ENSG00000101977|ENSG00000101977	ENST00000520602;ENST00000370576;ENST00000536274;ENST00000370578;ENST00000414978;ENST00000446225;ENST00000519895;ENST00000370573;ENST00000338585|ENST00000437564	T;T;T;T;T;T;T;T;T|.	0.63096|.	-0.02;-0.02;-0.02;-0.02;-0.02;-0.02;-0.02;-0.02;-0.02|.	5.56|5.56	-2.6|-2.6	0.06190|0.06190	Dbl homology (DH) domain (5);|.	0.497156|.	0.23375|.	N|.	0.048880|.	T|T	0.15522|0.15522	0.0374|0.0374	N|N	0.24115|0.24115	0.695|0.695	0.09310|0.09310	N|N	1|1	B;B;B;B;B;B;B;B|.	0.02656|.	0.0;0.0;0.0;0.0;0.0;0.0;0.0;0.0|.	B;B;B;B;B;B;B;B|.	0.06405|.	0.0;0.002;0.0;0.0;0.0;0.001;0.001;0.0|.	T|T	0.25882|0.25882	-1.0119|-1.0119	10|5	0.56958|.	D|.	0.05|.	.|.	10.8961|10.8961	0.47023|0.47023	0.0:0.3138:0.5514:0.1348|0.0:0.3138:0.5514:0.1348	rs61751333|rs61751333	645;714;530;569;569;714;585;569|.	E9PH77;B7Z3Z2;F5H091;B2R9S6;P10911-2;Q5JYJ7;P10911-4;P10911|.	.;.;.;.;.;.;.;MCF2_HUMAN|.	Y|L	629;569;530;714;629;172;645;569;585|72	ENSP00000427745:H629Y;ENSP00000359608:H569Y;ENSP00000438155:H530Y;ENSP00000359610:H714Y;ENSP00000397055:H629Y;ENSP00000405848:H172Y;ENSP00000430276:H645Y;ENSP00000359605:H569Y;ENSP00000342204:H585Y|.	ENSP00000342204:H585Y|.	H|S	-|-	1|2	0|0	MCF2|MCF2	138514544|138514544	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.027000|0.027000	0.11550|0.11550	0.054000|0.054000	0.14205|0.14205	-0.707000|-0.707000	0.05022|0.05022	-0.368000|-0.368000	0.07277|0.07277	CAT|TCA	G|0.988;A|0.012		0.318	MCF2-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000058560.1	NM_005369	
MECP2	4204	broad.mit.edu	37	X	153357653	153357653	+	Missense_Mutation	SNP	C	C	A	rs267608407		TCGA-OR-A5LG-01A-11D-A29I-10	TCGA-OR-A5LG-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a39e8bc9-757d-4536-b301-458fc7ec992d	6b9e8d41-7044-4151-b4d6-e211b0e7a923	g.chrX:153357653C>A	ENST00000303391.6	-	2	264	c.15G>T	c.(13-15)atG>atT	p.M5I	MECP2_ENST00000453960.2_Intron|MECP2_ENST00000407218.1_Missense_Mutation_p.M5I	NM_004992.3	NP_004983.1	P51608	MECP2_HUMAN	methyl CpG binding protein 2	5					adult locomotory behavior (GO:0008344)|behavioral fear response (GO:0001662)|cardiolipin metabolic process (GO:0032048)|catecholamine secretion (GO:0050432)|cerebellum development (GO:0021549)|chromatin silencing (GO:0006342)|dendrite development (GO:0016358)|glucocorticoid metabolic process (GO:0008211)|glutamine metabolic process (GO:0006541)|histone acetylation (GO:0016573)|histone methylation (GO:0016571)|inositol metabolic process (GO:0006020)|long-term memory (GO:0007616)|long-term synaptic potentiation (GO:0060291)|mitochondrial electron transport, ubiquinol to cytochrome c (GO:0006122)|negative regulation of histone acetylation (GO:0035067)|negative regulation of histone methylation (GO:0031061)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|neurological system process involved in regulation of systemic arterial blood pressure (GO:0001976)|neuron maturation (GO:0042551)|pathogenesis (GO:0009405)|phosphatidylcholine metabolic process (GO:0046470)|positive regulation of cell proliferation (GO:0008284)|positive regulation of synapse assembly (GO:0051965)|positive regulation of transcription, DNA-templated (GO:0045893)|post-embryonic development (GO:0009791)|proprioception (GO:0019230)|protein localization (GO:0008104)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of gene expression by genetic imprinting (GO:0006349)|regulation of respiratory gaseous exchange by neurological system process (GO:0002087)|respiratory gaseous exchange (GO:0007585)|response to hypoxia (GO:0001666)|sensory perception of pain (GO:0019233)|social behavior (GO:0035176)|startle response (GO:0001964)|synapse assembly (GO:0007416)|transcription, DNA-templated (GO:0006351)|ventricular system development (GO:0021591)|visual learning (GO:0008542)	cytosol (GO:0005829)|extracellular space (GO:0005615)|heterochromatin (GO:0000792)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|double-stranded methylated DNA binding (GO:0010385)|methyl-CpG binding (GO:0008327)|mRNA binding (GO:0003729)|poly(A) RNA binding (GO:0044822)|protein domain specific binding (GO:0019904)|protein N-terminus binding (GO:0047485)|sequence-specific DNA binding transcription factor activity (GO:0003700)|siRNA binding (GO:0035197)|transcription corepressor activity (GO:0003714)			breast(2)|cervix(2)|endometrium(2)|kidney(3)|large_intestine(3)|lung(8)|prostate(2)|urinary_tract(1)	23	all_cancers(53;3.7e-16)|all_epithelial(53;3.44e-10)|all_lung(58;2.06e-07)|Lung NSC(58;2.72e-07)|all_hematologic(71;4.25e-06)|Acute lymphoblastic leukemia(192;6.56e-05)					TGAGCCCTAACATCCCAGCTA	0.378																																					p.M5I		.											.	MECP2-226	0			c.G15T						.						70.0	57.0	61.0					X																	153357653		2203	4300	6503	SO:0001583	missense	4204	exon2			CCCTAACATCCCA	AF158180	CCDS14741.1, CCDS48193.1	Xq28	2014-09-17	2014-06-18		ENSG00000169057	ENSG00000169057			6990	protein-coding gene	gene with protein product		300005	"""mental retardation, X-linked 16"", ""mental retardation, X-linked 79"", ""Rett syndrome"", ""methyl CpG binding protein 2 (Rett syndrome)"""	RTT, MRX16, MRX79		1606614, 10508514	Standard	NM_004992		Approved		uc004fjw.2	P51608	OTTHUMG00000024229	ENST00000303391.6:c.15G>T	X.37:g.153357653C>A	ENSP00000301948:p.Met5Ile	Somatic	26	2		WXS	Illumina GAIIx	Phase_I	45	7	NM_004992	0	0	0	0	0	O15233|Q6QHH9|Q7Z384	Missense_Mutation	SNP	ENST00000303391.6	37	CCDS14741.1	.	.	.	.	.	.	.	.	.	.	C	12.90	2.077684	0.36662	.	.	ENSG00000169057	ENST00000303391;ENST00000545451;ENST00000369964;ENST00000407218;ENST00000415944	D;D;T	0.97529	-2.46;-4.42;-1.2	4.98	4.98	0.66077	.	.	.	.	.	D	0.91310	0.7260	N	0.08118	0	0.24833	N	0.992517	B	0.30211	0.273	B	0.29785	0.107	T	0.83214	-0.0072	9	0.19590	T	0.45	.	12.3021	0.54880	0.0:1.0:0.0:0.0	.	5	P51608	MECP2_HUMAN	I	5	ENSP00000301948:M5I;ENSP00000384865:M5I;ENSP00000416267:M5I	ENSP00000301948:M5I	M	-	3	0	MECP2	153010847	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.284000	0.51708	2.294000	0.77228	0.594000	0.82650	ATG	.		0.378	MECP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000061144.1	NM_004992	
CYP17A1	1586	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	10	104590691	104590692	+	Frame_Shift_Ins	INS	-	-	AGCTTACTGACGGTGAG			TCGA-OR-A5LG-01A-11D-A29I-10	TCGA-OR-A5LG-10A-01D-A29L-10	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a39e8bc9-757d-4536-b301-458fc7ec992d	6b9e8d41-7044-4151-b4d6-e211b0e7a923	g.chr10:104590691_104590692insAGCTTACTGACGGTGAG	ENST00000369887.3	-	8	1465_1466	c.1294_1295insCTCACCGTCAGTAAGCT	c.(1294-1296)tatfs	p.Y432fs	CYP17A1_ENST00000489268.1_5'Flank|CYP17A1-AS1_ENST00000369884.4_RNA	NM_000102.3	NP_000093.1	P05093	CP17A_HUMAN	cytochrome P450, family 17, subfamily A, polypeptide 1	432					adrenal gland development (GO:0030325)|androgen biosynthetic process (GO:0006702)|biphenyl metabolic process (GO:0018879)|cellular response to antibiotic (GO:0071236)|cellular response to gonadotropin stimulus (GO:0071371)|cellular response to lipopolysaccharide (GO:0071222)|dibenzo-p-dioxin metabolic process (GO:0018894)|glucocorticoid biosynthetic process (GO:0006704)|hippocampus development (GO:0021766)|hormone biosynthetic process (GO:0042446)|Leydig cell differentiation (GO:0033327)|ovulation (GO:0030728)|phenol-containing compound metabolic process (GO:0018958)|phthalate metabolic process (GO:0018963)|positive regulation of steroid hormone biosynthetic process (GO:0090031)|progesterone metabolic process (GO:0042448)|response to acetate (GO:0010034)|response to cAMP (GO:0051591)|response to cytokine (GO:0034097)|response to drug (GO:0042493)|response to fungicide (GO:0060992)|response to herbicide (GO:0009635)|response to insecticide (GO:0017085)|response to ionizing radiation (GO:0010212)|response to methylmercury (GO:0051597)|response to nutrient levels (GO:0031667)|response to retinoic acid (GO:0032526)|response to steroid hormone (GO:0048545)|sex differentiation (GO:0007548)|small molecule metabolic process (GO:0044281)|steroid biosynthetic process (GO:0006694)|steroid metabolic process (GO:0008202)|sterol metabolic process (GO:0016125)|xenobiotic metabolic process (GO:0006805)	axon (GO:0030424)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|mitochondrion (GO:0005739)|neuronal cell body (GO:0043025)	17-alpha-hydroxyprogesterone aldolase activity (GO:0047442)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|oxygen binding (GO:0019825)|steroid 17-alpha-monooxygenase activity (GO:0004508)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(2)|lung(8)|ovary(1)|upper_aerodigestive_tract(2)	18		Colorectal(252;0.122)|all_hematologic(284;0.152)		Epithelial(162;3.93e-09)|all cancers(201;1.02e-07)|BRCA - Breast invasive adenocarcinoma(275;0.215)	Abiraterone(DB05812)|Aminophenazone(DB01424)|Dexamethasone(DB01234)|Metoclopramide(DB01233)|Progesterone(DB00396)	GAAGGGCAAATAGCTTACTGAC	0.599																																					p.Y432_L433delinsSHRQX		.											.	CYP17A1-90	0			c.1295_1296insCTCACCGTCAGTAAGCT						.																																			SO:0001589	frameshift_variant	1586	exon8			GGCAAATAGCTTA	M19489	CCDS7541.1	10q24.3	2010-05-04	2003-02-14	2003-02-28	ENSG00000148795	ENSG00000148795	1.14.99.9	"""Cytochrome P450s"""	2593	protein-coding gene	gene with protein product	"""Steroid 17-alpha-monooxygenase"""	609300	"""cytochrome P450, subfamily XVII (steroid 17-alpha-hydroxylase), adrenal hyperplasia"""	CYP17		1347802	Standard	NM_000102		Approved	P450C17, CPT7, S17AH	uc001kwg.3	P05093	OTTHUMG00000018969	ENST00000369887.3:c.1278_1294dupCTCACCGTCAGTAAGCT	10.37:g.104590691_104590692insAGCTTACTGACGGTGAG	ENSP00000358903:p.Tyr432fs	Somatic	182	0		WXS	Illumina GAIIx	Phase_I	156	16	NM_000102	0	0	0	0	0	Q5TZV7	Nonsense_Mutation	INS	ENST00000369887.3	37	CCDS7541.1																																																																																			.		0.599	CYP17A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050101.1	NM_000102	
C11orf80	79703	hgsc.bcm.edu	37	11	66512290	66512291	+	In_Frame_Ins	INS	-	-	GGC	rs567536854|rs71045961|rs377555566		TCGA-OR-A5LG-01A-11D-A29I-10	TCGA-OR-A5LG-10A-01D-A29L-10	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a39e8bc9-757d-4536-b301-458fc7ec992d	6b9e8d41-7044-4151-b4d6-e211b0e7a923	g.chr11:66512290_66512291insGGC	ENST00000360962.4	+	1	84_85	c.77_78insGGC	c.(76-81)ggggcg>ggGGCggcg	p.34_35insA	C11orf80_ENST00000527368.1_3'UTR|C11orf80_ENST00000532565.2_5'Flank|C11orf80_ENST00000527634.1_5'UTR|C11orf80_ENST00000346672.4_5'UTR|C11orf80_ENST00000540737.1_5'UTR	NM_024650.3	NP_078926.3	Q8N6T0	CK080_HUMAN	chromosome 11 open reading frame 80	34										autonomic_ganglia(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(4)|ovary(1)|skin(1)|urinary_tract(1)	14						GCTGAGGAGGGggcggcggcgg	0.787																																					p.G26delinsGA		.											.	.	0			c.77_78insGGC						.			20,74		9,2,36						-5.0	0.0		dbSNP_130	1	203,337		98,7,165	no	coding	C11orf80	NM_024650.3		107,9,201	A1A1,A1R,RR		37.5926,21.2766,35.1735				223,411				SO:0001652	inframe_insertion	79703	exon1			AGGAGGGGGCGGC			11q13.2	2012-05-30			ENSG00000173715	ENSG00000173715			26197	protein-coding gene	gene with protein product						18160775	Standard	NM_024650		Approved	FLJ22531	uc021qmd.1	Q8N6T0	OTTHUMG00000167164	ENST00000360962.4:c.99_101dupGGC	11.37:g.66512297_66512299dupGGC	ENSP00000354227:p.Ala34_Ala34dup	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	12	11	NM_024650	0	0	0	0	0	Q9H677	In_Frame_Ins	INS	ENST00000360962.4	37	CCDS53664.1																																																																																			.		0.787	C11orf80-202	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		NM_024650	
NCOR2	9612	broad.mit.edu	37	12	124824721	124824722	+	In_Frame_Ins	INS	-	-	GCCGCTGCT	rs61519723|rs112797765|rs143952466	byFrequency	TCGA-OR-A5LG-01A-11D-A29I-10	TCGA-OR-A5LG-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a39e8bc9-757d-4536-b301-458fc7ec992d	6b9e8d41-7044-4151-b4d6-e211b0e7a923	g.chr12:124824721_124824722insGCCGCTGCT	ENST00000405201.1	-	37	5517_5518	c.5517_5518insAGCAGCGGC	c.(5515-5520)ggcggg>ggcAGCAGCGGCggg	p.1838_1839insGSS	NCOR2_ENST00000404621.1_In_Frame_Ins_p.1828_1829insGSS|NCOR2_ENST00000429285.2_In_Frame_Ins_p.1828_1829insGSS|NCOR2_ENST00000356219.3_In_Frame_Ins_p.1845_1846insGSS|NCOR2_ENST00000404121.2_In_Frame_Ins_p.1399_1400insGSS|NCOR2_ENST00000397355.1_In_Frame_Ins_p.1829_1830insGSS			Q9Y618	NCOR2_HUMAN	nuclear receptor corepressor 2	1849					cellular lipid metabolic process (GO:0044255)|gene expression (GO:0010467)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|Notch signaling pathway (GO:0007219)|regulation of cellular ketone metabolic process by negative regulation of transcription from RNA polymerase II promoter (GO:0072365)|small molecule metabolic process (GO:0044281)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	membrane (GO:0016020)|nuclear body (GO:0016604)|nuclear matrix (GO:0016363)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|histone deacetylase binding (GO:0042826)|Notch binding (GO:0005112)|protein N-terminus binding (GO:0047485)|transcription corepressor activity (GO:0003714)			breast(5)|central_nervous_system(2)|endometrium(7)|kidney(5)|large_intestine(7)|lung(28)|ovary(3)|pancreas(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	69	all_neural(191;0.0804)|Medulloblastoma(191;0.163)			Epithelial(86;3.99e-05)|OV - Ovarian serous cystadenocarcinoma(86;9.14e-05)|all cancers(50;0.000402)|BRCA - Breast invasive adenocarcinoma(302;0.0764)		cccccacccccgccgctgctgc	0.713														4762	0.950879	0.8979	0.9496	5008	,	,		14227	0.9633		0.9672	False		,,,				2504	0.9939				p.G1840delinsSSGG		.											.	NCOR2-229	0			c.5518_5519insAGCAGCGGC						.																																			SO:0001652	inframe_insertion	9612	exon39			CACCCCCGCCGCT	U37146	CCDS41857.1, CCDS41858.1, CCDS41857.2, CCDS41858.2, CCDS55892.1	12q24	2010-06-10	2010-06-10		ENSG00000196498	ENSG00000196498			7673	protein-coding gene	gene with protein product		600848	"""nuclear receptor co-repressor 2"""			7566127, 8813722	Standard	NM_001077261		Approved	SMRT, SMRTE, TRAC-1, CTG26, TNRC14	uc010tbb.2	Q9Y618	OTTHUMG00000150455	ENST00000405201.1:c.5509_5517dupAGCAGCGGC	12.37:g.124824722_124824730dupGCCGCTGCT	ENSP00000384018:p.Gly1836_Ser1838dup	Somatic	10	0		WXS	Illumina GAIIx	Phase_I	42	12	NM_006312	0	0	0	0	0	O00613|O15416|O15421|Q13354|Q56D06|Q59GM0|Q9Y5U0	In_Frame_Ins	INS	ENST00000405201.1	37	CCDS41858.2																																																																																			.		0.713	NCOR2-005	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000318173.2	NM_006312	
JPH4	84502	broad.mit.edu	37	14	24044983	24044984	+	Frame_Shift_Ins	INS	-	-	C			TCGA-OR-A5LG-01A-11D-A29I-10	TCGA-OR-A5LG-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a39e8bc9-757d-4536-b301-458fc7ec992d	6b9e8d41-7044-4151-b4d6-e211b0e7a923	g.chr14:24044983_24044984insC	ENST00000397118.3	-	4	1963_1964	c.1061_1062insG	c.(1060-1062)ggcfs	p.G354fs	JPH4_ENST00000356300.4_Frame_Shift_Ins_p.G354fs|JPH4_ENST00000544177.1_5'Flank	NM_032452.2	NP_115828.2	Q96JJ6	JPH4_HUMAN	junctophilin 4	354					calcium ion transport into cytosol (GO:0060402)|learning (GO:0007612)|neuromuscular process controlling balance (GO:0050885)|regulation of ryanodine-sensitive calcium-release channel activity (GO:0060314)|regulation of synaptic plasticity (GO:0048167)	dendritic shaft (GO:0043198)|integral component of membrane (GO:0016021)|junctional sarcoplasmic reticulum membrane (GO:0014701)|plasma membrane (GO:0005886)|smooth endoplasmic reticulum (GO:0005790)				endometrium(1)|large_intestine(2)|lung(13)|ovary(2)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	22	all_cancers(95;0.000251)			GBM - Glioblastoma multiforme(265;0.00654)		CCTTAACCTTGCCCCGCCGAAG	0.718																																					p.G354fs		.											.	JPH4-92	0			c.1062_1063insG						.																																			SO:0001589	frameshift_variant	84502	exon3			AACCTTGCCCCGC	AB058734	CCDS9603.1	14q11	2004-05-28	2004-05-28	2004-05-28	ENSG00000092051	ENSG00000092051			20156	protein-coding gene	gene with protein product			"""junctophilin like 1"""	JPHL1		11347906	Standard	NM_032452		Approved	KIAA1831	uc001wkr.2	Q96JJ6	OTTHUMG00000028769	ENST00000397118.3:c.1062dupG	14.37:g.24044987_24044987dupC	ENSP00000380307:p.Gly354fs	Somatic	29	0		WXS	Illumina GAIIx	Phase_I	220	2	NM_001146028	0	0	0	0	0	D3DS53|Q8ND44|Q96DQ0	Frame_Shift_Ins	INS	ENST00000397118.3	37	CCDS9603.1																																																																																			.		0.718	JPH4-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000413853.1	NM_032452	
CLEC11A	6320	hgsc.bcm.edu	37	19	51228371	51228372	+	Frame_Shift_Ins	INS	-	-	G	rs562569155	byFrequency	TCGA-OR-A5LG-01A-11D-A29I-10	TCGA-OR-A5LG-10A-01D-A29L-10	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a39e8bc9-757d-4536-b301-458fc7ec992d	6b9e8d41-7044-4151-b4d6-e211b0e7a923	g.chr19:51228371_51228372insG	ENST00000250340.4	+	4	816_817	c.619_620insG	c.(619-621)cggfs	p.R207fs	CLEC11A_ENST00000599973.1_Frame_Shift_Ins_p.AG223fs	NM_002975.2	NP_002966.1	Q9Y240	CLC11_HUMAN	C-type lectin domain family 11, member A	207	C-type lectin. {ECO:0000255|PROSITE- ProRule:PRU00040}.				positive regulation of cell proliferation (GO:0008284)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)	carbohydrate binding (GO:0030246)|growth factor activity (GO:0008083)			kidney(1)|lung(4)|ovary(1)|upper_aerodigestive_tract(1)	7		all_neural(266;0.057)		OV - Ovarian serous cystadenocarcinoma(262;0.00641)|GBM - Glioblastoma multiforme(134;0.028)		GTGCACGGCGCGGGGCGGGAGC	0.738													GGGG|GGGG|GGGGG|insertion	7	0.00139776	0.0	0.0014	5008	,	,		10727	0.0		0.004	False		,,,				2504	0.002				p.R207fs		.											.	CLEC11A-91	0			c.619_620insG						.			3,2917		0,3,1457						3.5	1.0			3	24,5960		4,16,2972	no	frameshift	CLEC11A	NM_002975.2		4,19,4429	A1A1,A1R,RR		0.4011,0.1027,0.3032				27,8877				SO:0001589	frameshift_variant	6320	exon4			ACGGCGCGGGGCG	AF087658	CCDS12800.1	19q13.3	2010-04-27	2005-02-09	2005-02-11		ENSG00000105472		"""C-type lectin domain containing"""	10576	protein-coding gene	gene with protein product		604713	"""stem cell growth factor; lymphocyte secreted C-type lectin"""	SCGF		9207134, 9442024	Standard	NM_002975		Approved	P47, LSLCL, CLECSF3	uc002psy.3	Q9Y240		ENST00000250340.4:c.623dupG	19.37:g.51228375_51228375dupG	ENSP00000250340:p.Arg207fs	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	19	8	NM_002975	0	0	0	0	0	B2RAD4	Frame_Shift_Ins	INS	ENST00000250340.4	37	CCDS12800.1																																																																																			.		0.738	CLEC11A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464062.1	NM_002975	
LURAP1L	286343	broad.mit.edu	37	9	12775861	12775862	+	In_Frame_Ins	INS	-	-	GGCGGCGGC	rs3833707|rs139315731		TCGA-OR-A5LG-01A-11D-A29I-10	TCGA-OR-A5LG-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a39e8bc9-757d-4536-b301-458fc7ec992d	6b9e8d41-7044-4151-b4d6-e211b0e7a923	g.chr9:12775861_12775862insGGCGGCGGC	ENST00000319264.3	+	1	842_843	c.147_148insGGCGGCGGC	c.(148-150)ggc>GGCGGCGGCggc	p.50_50G>GGGG	RP11-3L8.3_ENST00000417638.1_RNA|LURAP1L_ENST00000489107.1_3'UTR	NM_203403.1	NP_981948.1	Q8IV03	LUR1L_HUMAN	leucine rich adaptor protein 1-like	53	Gly-rich.							p.G49_G50insGGG(2)|p.G50_G52delGGG(1)									gcggtggtggtggcggcggcgg	0.688																																					p.G49delinsGGGG		.											.	.	3	Insertion - In frame(2)|Deletion - In frame(1)	large_intestine(1)|prostate(1)|central_nervous_system(1)	c.147_148insGGCGGCGGC						.																																			SO:0001652	inframe_insertion	286343	exon1			TGGTGGTGGCGGC	AK095824	CCDS6473.1	9p22.3	2012-02-01	2012-02-01	2012-02-01	ENSG00000153714	ENSG00000153714			31452	protein-coding gene	gene with protein product	"""similar to DNA segment, Chr 4, Brigham & Womens Genetics 0951 expressed"""		"""chromosome 9 open reading frame 150"""	C9orf150		12766061	Standard	NM_203403		Approved	MGC46502, FLJ38505, bA3L8.2	uc003zkw.3	Q8IV03	OTTHUMG00000019557	ENST00000319264.3:c.157_165dupGGCGGCGGC	9.37:g.12775862_12775870dupGGCGGCGGC	ENSP00000321026:p.GlyGlyGly53dup	Somatic	59	0		WXS	Illumina GAIIx	Phase_I	45	18	NM_203403	0	0	0	0	0	Q5VZX7|Q8N923|Q8NCG2	In_Frame_Ins	INS	ENST00000319264.3	37	CCDS6473.1																																																																																			.		0.688	LURAP1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051730.1	NM_203403	
TTLL11	158135	hgsc.bcm.edu	37	9	124855330	124855331	+	In_Frame_Ins	INS	-	-	TGGCCT	rs3833704|rs201653732	byFrequency	TCGA-OR-A5LG-01A-11D-A29I-10	TCGA-OR-A5LG-10A-01D-A29L-10	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a39e8bc9-757d-4536-b301-458fc7ec992d	6b9e8d41-7044-4151-b4d6-e211b0e7a923	g.chr9:124855330_124855331insTGGCCT	ENST00000373776.3	-	1	554_555	c.367_368insAGGCCA	c.(367-369)aca>aAGGCCAca	p.122_123insKA	TTLL11_ENST00000321582.5_In_Frame_Ins_p.122_123insKA|TTLL11_ENST00000474723.1_5'UTR	NM_194252.2	NP_919228.2	Q8NHH1	TTL11_HUMAN	tubulin tyrosine ligase-like family, member 11	122					cellular protein modification process (GO:0006464)	cilium (GO:0005929)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)	ligase activity (GO:0016874)			breast(1)|endometrium(1)|kidney(1)|large_intestine(6)|lung(5)|prostate(3)|skin(1)	18						cgtctccgctgtggcctcggcc	0.762														678	0.135383	0.1044	0.1254	5008	,	,		10384	0.0367		0.2773	False		,,,				2504	0.1401				p.T123delinsKAT		.											.	TTLL11-112	0			c.368_369insAGGCCA						.		,	363,1875		124,115,880					,	-4.8	0.0		dbSNP_107	2	1330,3776		463,404,1686	no	coding,coding	TTLL11	NM_194252.2,NM_001139442.1	,	587,519,2566	A1A1,A1R,RR		26.0478,16.2198,23.0528	,	,		1693,5651				SO:0001652	inframe_insertion	158135	exon1			TCCGCTGTGGCCT	AF521886	CCDS6834.2, CCDS48012.1	9q34.11	2013-02-14	2005-07-28	2005-07-28	ENSG00000175764	ENSG00000175764		"""Tubulin tyrosine ligase-like family"""	18113	protein-coding gene	gene with protein product			"""chromosome 9 open reading frame 20"""	C9orf20		15890843	Standard	NM_001139442		Approved	bA244O19.1	uc011lyl.2	Q8NHH1	OTTHUMG00000020597	ENST00000373776.3:c.362_367dupAGGCCA	9.37:g.124855331_124855336dupTGGCCT	ENSP00000362881:p.Ala122_Thr123insLysAla	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	21	10	NM_001139442	0	0	0	0	0		In_Frame_Ins	INS	ENST00000373776.3	37	CCDS6834.2																																																																																			-|0.843;TGGCCT|0.157		0.762	TTLL11-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000053907.1	XM_088486	
TRIM73	375593	bcgsc.ca	37	7	75028240	75028241	+	Missense_Mutation	DNP	TG	TG	CA	rs73702637|rs73702636		TCGA-OR-A5LG-01A-11D-A29I-10	TCGA-OR-A5LG-10A-01D-A29L-10	TG	TG	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a39e8bc9-757d-4536-b301-458fc7ec992d	6b9e8d41-7044-4151-b4d6-e211b0e7a923	g.chr7:75028240_75028241TG>CA	ENST00000437796.1	+	1	42_43	c.23_24TG>CA	c.(22-24)cTG>cCA	p.L8P	TRIM73_ENST00000463766.1_3'UTR|TRIM73_ENST00000450434.1_Intron|TRIM73_ENST00000430211.1_Missense_Mutation_p.L8P|TRIM73_ENST00000323819.3_Missense_Mutation_p.L8P|TRIM73_ENST00000447409.2_Missense_Mutation_p.L8P			Q86UV7	TRI73_HUMAN	tripartite motif containing 73	8						intracellular (GO:0005622)	zinc ion binding (GO:0008270)			endometrium(1)|large_intestine(1)|lung(1)|pancreas(1)	4						GTGAGCCTGCTGGAGCTGGAGG	0.614																																					p.L8P		.											.	TRIM74-40	0			c.G24A						.																																			SO:0001583	missense	378108	exon2			CCTGCTGGAGCTG	AF498998	CCDS34665.1	7q11.23	2013-01-09	2011-01-25	2006-03-31		ENSG00000178809		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	18162	protein-coding gene	gene with protein product		612549	"""tripartite motif-containing 50B"", ""tripartite motif-containing 73"""	TRIM50B			Standard	NM_198924		Approved		uc003udc.1	Q86UV7		Exception_encountered	7.37:g.75028240_75028241delinsCA	ENSP00000417040:p.Leu8Pro	Somatic	864	0		WXS	Illumina GAIIx	Phase_I	842	0	NM_198853	0	0	0	0	0	Q8N0S3	Missense_Mutation	DNP	ENST00000437796.1	37	CCDS34665.1																																																																																			G|0.500;A|0.500		0.614	TRIM73-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000342950.1		
