#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_TTotCov	i_TVarCov	i_Transcript_Id	i_Trna_alt1	i_Trna_alt2	i_Trna_ref	i_Trna_tot	i_Trna_var	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
PRAMEF4	400735	broad.mit.edu;bcgsc.ca	37	1	12939507	12939507	+	Missense_Mutation	SNP	C	C	G	rs543370672		TCGA-OR-A5LL-01A-11D-A29I-10	TCGA-OR-A5LL-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9bfd4b2e-0577-4c94-8d6c-dafa9104b502	2d4f1606-9261-4ba8-96a9-ee307989af11	g.chr1:12939507C>G	ENST00000235349.5	-	4	1365	c.1295G>C	c.(1294-1296)aGa>aCa	p.R432T		NM_001009611.2	NP_001009611.1	O60810	PRAM4_HUMAN	PRAME family member 4	432					negative regulation of apoptotic process (GO:0043066)|negative regulation of cell differentiation (GO:0045596)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cell proliferation (GO:0008284)					breast(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(10)|ovary(2)|prostate(3)|skin(1)	24	Ovarian(185;0.249)	Lung NSC(185;3.67e-05)|all_lung(284;4.03e-05)|Renal(390;0.000147)|Breast(348;0.000278)|Colorectal(325;0.00058)|Ovarian(437;0.00965)|Hepatocellular(190;0.0245)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00812)|Colorectal(212;4.88e-06)|Kidney(185;4.89e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.000194)|COAD - Colon adenocarcinoma(227;0.000241)|BRCA - Breast invasive adenocarcinoma(304;0.000293)|STAD - Stomach adenocarcinoma(313;0.0072)|READ - Rectum adenocarcinoma(331;0.0649)		TTGAGCAAATCTGCTCCAGCA	0.507													c|||	1	0.000199681	0.0	0.0	5008	,	,		23226	0.0		0.0	False		,,,				2504	0.001				p.R432T		.											.	PRAMEF4-45	0			c.G1295C						.						68.0	79.0	75.0					1																	12939507		1489	2646	4135	SO:0001583	missense	400735	exon4			GCAAATCTGCTCC		CCDS30592.1	1p36.21	2013-01-17			ENSG00000243073	ENSG00000243073		"""-"""	31971	protein-coding gene	gene with protein product							Standard	NM_001009611		Approved	RP5-845O24.6	uc001aun.2	O60810	OTTHUMG00000001987	ENST00000235349.5:c.1295G>C	1.37:g.12939507C>G	ENSP00000235349:p.Arg432Thr	Somatic	244	2		WXS	Illumina GAIIx	Phase_I	217	55	NM_001009611	0	0	0	0	0	Q5LJB5	Missense_Mutation	SNP	ENST00000235349.5	37	CCDS30592.1	.	.	.	.	.	.	.	.	.	.	C	7.227	0.598573	0.13939	.	.	ENSG00000243073	ENST00000235349	T	0.52295	0.67	1.48	0.46	0.16684	.	0.822734	0.10980	N	0.612781	T	0.62258	0.2413	M	0.76328	2.33	0.09310	N	1	D	0.69078	0.997	D	0.72625	0.978	T	0.48502	-0.9030	10	0.66056	D	0.02	.	5.4413	0.16511	0.0:0.6403:0.3597:0.0	.	432	O60810	PRAM4_HUMAN	T	432	ENSP00000235349:R432T	ENSP00000235349:R432T	R	-	2	0	PRAMEF4	12862094	0.000000	0.05858	0.001000	0.08648	0.007000	0.05969	-0.374000	0.07484	0.165000	0.19558	0.400000	0.26472	AGA	C|1.000;G|0.000		0.507	PRAMEF4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000005518.1	NM_001009611	
PRAMEF10	343071	ucsc.edu	37	1	12952796	12952796	+	Missense_Mutation	SNP	T	T	G	rs199584852		TCGA-OR-A5LL-01A-11D-A29I-10	TCGA-OR-A5LL-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9bfd4b2e-0577-4c94-8d6c-dafa9104b502	2d4f1606-9261-4ba8-96a9-ee307989af11	g.chr1:12952796T>G	ENST00000235347.4	-	4	1455	c.1376A>C	c.(1375-1377)aAc>aCc	p.N459T		NM_001039361.3	NP_001034450.2	O60809	PRA10_HUMAN	PRAME family member 10	459					negative regulation of apoptotic process (GO:0043066)|negative regulation of cell differentiation (GO:0045596)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cell proliferation (GO:0008284)					NS(2)|breast(1)|large_intestine(2)|lung(5)|ovary(1)|upper_aerodigestive_tract(1)	12	Ovarian(185;0.249)	Renal(390;0.000469)|Lung NSC(185;0.00143)|all_lung(284;0.00181)|Colorectal(325;0.00215)|Breast(348;0.00224)|Myeloproliferative disorder(586;0.0393)|Hepatocellular(190;0.0623)|Ovarian(437;0.0731)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00812)|Colorectal(212;4.88e-06)|Kidney(185;4.89e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.000194)|COAD - Colon adenocarcinoma(227;0.000241)|BRCA - Breast invasive adenocarcinoma(304;0.000293)|STAD - Stomach adenocarcinoma(313;0.0072)|READ - Rectum adenocarcinoma(331;0.0649)		TGAGCCACAGTTAGGGCAAGG	0.537																																					p.N459T		.											.	PRAMEF10-90	0			c.A1376C						.																																			SO:0001583	missense	343071	exon4			CCACAGTTAGGGC	AL049682	CCDS41255.1	1p36.21	2013-01-17			ENSG00000187545	ENSG00000187545		"""-"""	27997	protein-coding gene	gene with protein product							Standard	NM_001039361		Approved		uc001auo.3	O60809	OTTHUMG00000001981	ENST00000235347.4:c.1376A>C	1.37:g.12952796T>G	ENSP00000235347:p.Asn459Thr	Somatic	170	12		WXS	Illumina GAIIx	Phase_I	41	17	NM_001039361	0	0	0	0	0	Q2M1V2	Missense_Mutation	SNP	ENST00000235347.4	37	CCDS41255.1	.	.	.	.	.	.	.	.	.	.	N	0.993	-0.693518	0.03303	.	.	ENSG00000187545	ENST00000235347	T	0.44881	0.91	1.02	-0.309	0.12769	.	3.436970	0.01056	N	0.004550	T	0.21186	0.0510	N	0.05124	-0.11	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.11591	-1.0581	10	0.12766	T	0.61	.	5.3537	0.16050	0.0:0.0:0.2898:0.7102	.	459	O60809	PRA10_HUMAN	T	459	ENSP00000235347:N459T	ENSP00000235347:N459T	N	-	2	0	PRAMEF10	12875383	0.000000	0.05858	0.000000	0.03702	0.005000	0.04900	-0.748000	0.04818	-0.706000	0.05028	-1.044000	0.02363	AAC	T|0.667;G|0.333		0.537	PRAMEF10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000005512.2	XM_496342	
TMEM50A	23585	bcgsc.ca	37	1	25678142	25678142	+	Missense_Mutation	SNP	G	G	T			TCGA-OR-A5LL-01A-11D-A29I-10	TCGA-OR-A5LL-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9bfd4b2e-0577-4c94-8d6c-dafa9104b502	2d4f1606-9261-4ba8-96a9-ee307989af11	g.chr1:25678142G>T	ENST00000374358.4	+	4	785	c.232G>T	c.(232-234)Gtc>Ttc	p.V78F	TMEM50A_ENST00000480937.1_3'UTR	NM_014313.3	NP_055128.1	O95807	TM50A_HUMAN	transmembrane protein 50A	78						endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)				endometrium(1)|kidney(1)|large_intestine(3)|lung(1)	6		Colorectal(325;3.46e-05)|Lung NSC(340;0.000245)|all_lung(284;0.000335)|Renal(390;0.0007)|Ovarian(437;0.00473)|Breast(348;0.0101)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0936)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0422)|OV - Ovarian serous cystadenocarcinoma(117;3.47e-27)|Colorectal(126;1.1e-08)|COAD - Colon adenocarcinoma(152;7.48e-07)|STAD - Stomach adenocarcinoma(196;0.00035)|BRCA - Breast invasive adenocarcinoma(304;0.00047)|KIRC - Kidney renal clear cell carcinoma(1967;0.000755)|GBM - Glioblastoma multiforme(114;0.00106)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.204)		GAATGGACAAGTCCGAGGTGA	0.358																																					p.V78F		.											.	TMEM50A-90	0			c.G232T						.						174.0	162.0	166.0					1																	25678142		2203	4300	6503	SO:0001583	missense	23585	exon4			GGACAAGTCCGAG	AY071927	CCDS264.1	1p36.11	2008-02-05			ENSG00000183726	ENSG00000183726			30590	protein-coding gene	gene with protein product	"""small membrane protein 1"""	605348				10938938, 10845894	Standard	NM_014313		Approved	SMP1	uc001bke.3	O95807	OTTHUMG00000007651	ENST00000374358.4:c.232G>T	1.37:g.25678142G>T	ENSP00000363478:p.Val78Phe	Somatic	80	0		WXS	Illumina GAIIx	Phase_I	54	4	NM_014313	0	0	58	58	0		Missense_Mutation	SNP	ENST00000374358.4	37	CCDS264.1	.	.	.	.	.	.	.	.	.	.	G	34	5.386027	0.95967	.	.	ENSG00000183726	ENST00000374358	T	0.33865	1.39	5.64	5.64	0.86602	.	0.000000	0.85682	D	0.000000	T	0.60431	0.2268	M	0.72576	2.205	0.80722	D	1	D;D	0.63880	0.981;0.993	P;D	0.69142	0.901;0.962	T	0.60347	-0.7281	10	0.54805	T	0.06	.	18.291	0.90130	0.0:0.0:1.0:0.0	.	78;78	B7Z5M7;O95807	.;TM50A_HUMAN	F	78	ENSP00000363478:V78F	ENSP00000363478:V78F	V	+	1	0	TMEM50A	25550729	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	8.873000	0.92357	2.663000	0.90544	0.645000	0.84053	GTC	.		0.358	TMEM50A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000020313.1		
CSMD2	114784	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	34276428	34276428	+	Silent	SNP	G	G	A			TCGA-OR-A5LL-01A-11D-A29I-10	TCGA-OR-A5LL-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9bfd4b2e-0577-4c94-8d6c-dafa9104b502	2d4f1606-9261-4ba8-96a9-ee307989af11	g.chr1:34276428G>A	ENST00000338325.1	-	3	445	c.33C>T	c.(31-33)ggC>ggT	p.G11G	CSMD2_ENST00000373381.4_Silent_p.G454G			Q7Z408	CSMD2_HUMAN	CUB and Sushi multiple domains 2	414						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(5)|breast(5)|central_nervous_system(3)|cervix(2)|endometrium(20)|haematopoietic_and_lymphoid_tissue(4)|kidney(9)|large_intestine(43)|lung(114)|ovary(8)|pancreas(1)|prostate(6)|skin(20)|upper_aerodigestive_tract(5)|urinary_tract(1)	246		Myeloproliferative disorder(586;0.0294)|all_neural(195;0.249)				AGGTGATGATGCCCGAGGGGC	0.532																																					p.G414G		.											.	CSMD2-103	0			c.C1242T						.						115.0	113.0	114.0					1																	34276428		2203	4300	6503	SO:0001819	synonymous_variant	114784	exon10			GATGATGCCCGAG	AY210418	CCDS380.1, CCDS60082.1	1p34.3	2014-01-28			ENSG00000121904	ENSG00000121904			19290	protein-coding gene	gene with protein product		608398				11472063, 11572484	Standard	NM_001281956		Approved	KIAA1884	uc001bxn.1	Q7Z408	OTTHUMG00000011135	ENST00000338325.1:c.33C>T	1.37:g.34276428G>A		Somatic	46	0		WXS	Illumina GAIIx	Phase_I	16	6	NM_052896	0	0	0	0	0	B1AM50|E7EUA6|Q53TY4|Q5VT59|Q8N963|Q96Q03|Q9H4V7|Q9H4V8|Q9H4V9|Q9H4W0|Q9H4W1|Q9H4W2|Q9H4W3|Q9H4W4|Q9HCY5|Q9HCY6|Q9HCY7	Silent	SNP	ENST00000338325.1	37																																																																																				.		0.532	CSMD2-004	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000036404.2	NM_052896	
DNAJC6	9829	bcgsc.ca	37	1	65858145	65858145	+	Silent	SNP	G	G	A	rs4325172	byFrequency	TCGA-OR-A5LL-01A-11D-A29I-10	TCGA-OR-A5LL-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9bfd4b2e-0577-4c94-8d6c-dafa9104b502	2d4f1606-9261-4ba8-96a9-ee307989af11	g.chr1:65858145G>A	ENST00000395325.3	+	12	1486	c.1329G>A	c.(1327-1329)gaG>gaA	p.E443E	DNAJC6_ENST00000263441.7_Silent_p.E430E|DNAJC6_ENST00000371069.4_Silent_p.E500E	NM_014787.3	NP_055602.1	O75061	AUXI_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 6	443					cell death (GO:0008219)|clathrin coat disassembly (GO:0072318)|membrane organization (GO:0061024)|post-Golgi vesicle-mediated transport (GO:0006892)|regulation of clathrin-mediated endocytosis (GO:2000369)	cytosol (GO:0005829)|synapse (GO:0045202)	protein tyrosine phosphatase activity (GO:0004725)			NS(1)|breast(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(22)|ovary(1)|prostate(2)|skin(1)	39						TCTGTGAGGAGGACCACGCTG	0.448													G|||	1773	0.354034	0.2784	0.4323	5008	,	,		21332	0.1885		0.5338	False		,,,				2504	0.3865				p.E500E		.											.	DNAJC6-272	0			c.G1500A						.	G		1412,2994	462.4+/-353.2	217,978,1008	57.0	53.0	55.0		1329	2.5	1.0	1	dbSNP_111	55	4592,4008	596.6+/-393.6	1213,2166,921	no	coding-synonymous	DNAJC6	NM_014787.2		1430,3144,1929	AA,AG,GG		46.6047,32.0472,46.1633		443/914	65858145	6004,7002	2203	4300	6503	SO:0001819	synonymous_variant	9829	exon12			TGAGGAGGACCAC	AB007942	CCDS30739.1, CCDS58004.1, CCDS58005.1	1p31.3	2011-09-02			ENSG00000116675	ENSG00000116675		"""Heat shock proteins / DNAJ (HSP40)"""	15469	protein-coding gene	gene with protein product	"""auxilin"""	608375				9455484, 11147971	Standard	NM_001256864		Approved	KIAA0473	uc001dce.2	O75061	OTTHUMG00000009066	ENST00000395325.3:c.1329G>A	1.37:g.65858145G>A		Somatic	226	1		WXS	Illumina GAIIx	Phase_I	77	5	NM_001256864	0	0	2	2	0	B7Z3V8|D3DQ65|D3DQ66|Q32M66|Q4G0K1|Q5T614|Q5T615	Silent	SNP	ENST00000395325.3	37	CCDS30739.1																																																																																			G|0.576;A|0.424		0.448	DNAJC6-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000025134.1		
SV2A	9900	bcgsc.ca	37	1	149876665	149876665	+	Silent	SNP	G	G	A	rs13067	byFrequency	TCGA-OR-A5LL-01A-11D-A29I-10	TCGA-OR-A5LL-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9bfd4b2e-0577-4c94-8d6c-dafa9104b502	2d4f1606-9261-4ba8-96a9-ee307989af11	g.chr1:149876665G>A	ENST00000369146.3	-	13	2620	c.2130C>T	c.(2128-2130)atC>atT	p.I710I		NM_001278719.1|NM_014849.3	NP_001265648.1|NP_055664.3	Q7L0J3	SV2A_HUMAN	synaptic vesicle glycoprotein 2A	710					cellular calcium ion homeostasis (GO:0006874)|neurotransmitter transport (GO:0006836)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|neuromuscular junction (GO:0031594)|neuron projection (GO:0043005)|presynaptic active zone (GO:0048786)|synaptic vesicle (GO:0008021)|synaptic vesicle membrane (GO:0030672)	protein kinase binding (GO:0019901)|receptor activity (GO:0004872)|transmembrane transporter activity (GO:0022857)			breast(2)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(8)|lung(16)|ovary(6)|pancreas(1)|prostate(8)|skin(2)|urinary_tract(2)	55	Breast(34;0.00769)|all_hematologic(923;0.127)|Colorectal(459;0.171)		LUSC - Lung squamous cell carcinoma(543;0.221)|STAD - Stomach adenocarcinoma(528;0.247)		Levetiracetam(DB01202)	CAGCCTTGGTGATTCCCACGA	0.602													G|||	107	0.0213658	0.0008	0.0115	5008	,	,		19445	0.001		0.0308	False		,,,				2504	0.0675				p.I710I		.											.	SV2A-97	0			c.C2130T						.	G		21,4385	29.0+/-57.7	0,21,2182	59.0	49.0	52.0		2130	4.2	1.0	1	dbSNP_52	52	255,8345	98.6+/-160.1	1,253,4046	no	coding-synonymous	SV2A	NM_014849.3		1,274,6228	AA,AG,GG		2.9651,0.4766,2.1221		710/743	149876665	276,12730	2203	4300	6503	SO:0001819	synonymous_variant	9900	exon13			CTTGGTGATTCCC	AB018279	CCDS940.1	1q21.2	2008-02-05			ENSG00000159164	ENSG00000159164			20566	protein-coding gene	gene with protein product		185860				7681585, 10611374	Standard	NM_014849		Approved	SV2, KIAA0736	uc001etg.3	Q7L0J3	OTTHUMG00000012209	ENST00000369146.3:c.2130C>T	1.37:g.149876665G>A		Somatic	352	1		WXS	Illumina GAIIx	Phase_I	480	40	NM_014849	0	0	2	2	0	D3DUZ7|O94841|Q5QNX8|Q7Z3L6|Q8NBJ6|Q9BVZ9	Silent	SNP	ENST00000369146.3	37	CCDS940.1																																																																																			G|0.984;A|0.016		0.602	SV2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033754.1		
SPTA1	6708	broad.mit.edu	37	1	158641186	158641186	+	Nonsense_Mutation	SNP	G	G	A			TCGA-OR-A5LL-01A-11D-A29I-10	TCGA-OR-A5LL-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9bfd4b2e-0577-4c94-8d6c-dafa9104b502	2d4f1606-9261-4ba8-96a9-ee307989af11	g.chr1:158641186G>A	ENST00000368147.4	-	12	1726	c.1546C>T	c.(1546-1548)Cag>Tag	p.Q516*		NM_003126.2	NP_003117.2	P02549	SPTA1_HUMAN	spectrin, alpha, erythrocytic 1	516					actin filament capping (GO:0051693)|actin filament organization (GO:0007015)|axon guidance (GO:0007411)|hemopoiesis (GO:0030097)|lymphocyte homeostasis (GO:0002260)|plasma membrane organization (GO:0007009)|porphyrin-containing compound biosynthetic process (GO:0006779)|positive regulation of protein binding (GO:0032092)|positive regulation of T cell proliferation (GO:0042102)|regulation of cell shape (GO:0008360)	actin cytoskeleton (GO:0015629)|cuticular plate (GO:0032437)|cytosol (GO:0005829)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|spectrin (GO:0008091)|spectrin-associated cytoskeleton (GO:0014731)	actin filament binding (GO:0051015)|calcium ion binding (GO:0005509)|structural constituent of cytoskeleton (GO:0005200)	p.Q516K(1)		NS(3)|breast(7)|cervix(1)|endometrium(22)|kidney(9)|large_intestine(29)|liver(2)|lung(183)|ovary(5)|prostate(18)|skin(11)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(9)|urinary_tract(6)	307	all_hematologic(112;0.0378)					TCATGCTTCTGAAGAAGGGCT	0.488																																					p.Q516X		.											.	SPTA1-142	1	Substitution - Missense(1)	lung(1)	c.C1546T						.						113.0	108.0	109.0					1																	158641186		1873	4091	5964	SO:0001587	stop_gained	6708	exon12			GCTTCTGAAGAAG	M61877	CCDS41423.1	1q21	2014-06-23	2014-06-23		ENSG00000163554	ENSG00000163554		"""EF-hand domain containing"""	11272	protein-coding gene	gene with protein product	"""elliptocytosis 2"""	182860	"""spectrin, alpha, erythrocytic 1 (elliptocytosis 2)"""				Standard	NM_003126		Approved	EL2	uc001fst.1	P02549	OTTHUMG00000019636	ENST00000368147.4:c.1546C>T	1.37:g.158641186G>A	ENSP00000357129:p.Gln516*	Somatic	70	0		WXS	Illumina GAIIx	Phase_I	161	6	NM_003126	0	0	0	0	0	Q15514|Q5VYL1|Q5VYL2|Q6LDY5	Nonsense_Mutation	SNP	ENST00000368147.4	37	CCDS41423.1	.	.	.	.	.	.	.	.	.	.	G	39	7.893551	0.98548	.	.	ENSG00000163554	ENST00000368148;ENST00000368147	.	.	.	5.17	4.25	0.50352	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	8.4201	0.32694	0.0:0.1452:0.5845:0.2703	.	.	.	.	X	516	.	ENSP00000357129:Q516X	Q	-	1	0	SPTA1	156907810	1.000000	0.71417	0.994000	0.49952	0.958000	0.62258	3.271000	0.51608	1.398000	0.46701	0.655000	0.94253	CAG	.		0.488	SPTA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051851.3	NM_003126	
SPTA1	6708	broad.mit.edu;bcgsc.ca	37	1	158644356	158644356	+	Silent	SNP	G	G	A			TCGA-OR-A5LL-01A-11D-A29I-10	TCGA-OR-A5LL-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9bfd4b2e-0577-4c94-8d6c-dafa9104b502	2d4f1606-9261-4ba8-96a9-ee307989af11	g.chr1:158644356G>A	ENST00000368147.4	-	9	1402	c.1222C>T	c.(1222-1224)Ctg>Ttg	p.L408L		NM_003126.2	NP_003117.2	P02549	SPTA1_HUMAN	spectrin, alpha, erythrocytic 1	408					actin filament capping (GO:0051693)|actin filament organization (GO:0007015)|axon guidance (GO:0007411)|hemopoiesis (GO:0030097)|lymphocyte homeostasis (GO:0002260)|plasma membrane organization (GO:0007009)|porphyrin-containing compound biosynthetic process (GO:0006779)|positive regulation of protein binding (GO:0032092)|positive regulation of T cell proliferation (GO:0042102)|regulation of cell shape (GO:0008360)	actin cytoskeleton (GO:0015629)|cuticular plate (GO:0032437)|cytosol (GO:0005829)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|spectrin (GO:0008091)|spectrin-associated cytoskeleton (GO:0014731)	actin filament binding (GO:0051015)|calcium ion binding (GO:0005509)|structural constituent of cytoskeleton (GO:0005200)			NS(3)|breast(7)|cervix(1)|endometrium(22)|kidney(9)|large_intestine(29)|liver(2)|lung(183)|ovary(5)|prostate(18)|skin(11)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(9)|urinary_tract(6)	307	all_hematologic(112;0.0378)					CTGTCCAGCAGAACTTCTCCA	0.498																																					p.L408L		.											.	SPTA1-142	0			c.C1222T						.						127.0	125.0	126.0					1																	158644356		1996	4177	6173	SO:0001819	synonymous_variant	6708	exon9			CCAGCAGAACTTC	M61877	CCDS41423.1	1q21	2014-06-23	2014-06-23		ENSG00000163554	ENSG00000163554		"""EF-hand domain containing"""	11272	protein-coding gene	gene with protein product	"""elliptocytosis 2"""	182860	"""spectrin, alpha, erythrocytic 1 (elliptocytosis 2)"""				Standard	NM_003126		Approved	EL2	uc001fst.1	P02549	OTTHUMG00000019636	ENST00000368147.4:c.1222C>T	1.37:g.158644356G>A		Somatic	96	1		WXS	Illumina GAIIx	Phase_I	183	12	NM_003126	0	0	0	0	0	Q15514|Q5VYL1|Q5VYL2|Q6LDY5	Silent	SNP	ENST00000368147.4	37	CCDS41423.1																																																																																			.		0.498	SPTA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051851.3	NM_003126	
OR10J1	26476	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	159410014	159410014	+	Missense_Mutation	SNP	G	G	T			TCGA-OR-A5LL-01A-11D-A29I-10	TCGA-OR-A5LL-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9bfd4b2e-0577-4c94-8d6c-dafa9104b502	2d4f1606-9261-4ba8-96a9-ee307989af11	g.chr1:159410014G>T	ENST00000423932.3	+	1	503	c.466G>T	c.(466-468)Gtc>Ttc	p.V156F	RP11-550P17.5_ENST00000431862.1_RNA	NM_012351.2	NP_036483.2	P30954	O10J1_HUMAN	olfactory receptor, family 10, subfamily J, member 1	156					G-protein coupled receptor signaling pathway (GO:0007186)|sensory perception of chemical stimulus (GO:0007606)|single fertilization (GO:0007338)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(2)|kidney(1)|large_intestine(5)|lung(13)|ovary(1)|skin(2)|stomach(1)	25	all_hematologic(112;0.0429)					TATCCAACTTGTCCTGGGGGC	0.502																																					p.V156F		.											.	OR10J1-69	0			c.G466T						.						136.0	129.0	131.0					1																	159410014		2203	4300	6503	SO:0001583	missense	26476	exon1			CAACTTGTCCTGG	X64995	CCDS1185.1	1q23.2	2012-08-09			ENSG00000196184	ENSG00000196184		"""GPCR / Class A : Olfactory receptors"""	8175	protein-coding gene	gene with protein product						1370859	Standard	NM_012351		Approved	HGMP07J, HSHGMP07J	uc010piv.2	P30954	OTTHUMG00000022737	ENST00000423932.3:c.466G>T	1.37:g.159410014G>T	ENSP00000399078:p.Val156Phe	Somatic	239	0		WXS	Illumina GAIIx	Phase_I	800	83	NM_012351	0	0	0	0	0	Q2M1M8|Q5VSV1|Q6IET5|Q96R56	Missense_Mutation	SNP	ENST00000423932.3	37	CCDS1185.1	.	.	.	.	.	.	.	.	.	.	G	9.858	1.195392	0.22037	.	.	ENSG00000196184	ENST00000423932	T	0.39997	1.05	4.58	3.67	0.42095	GPCR, rhodopsin-like superfamily (1);	0.447166	0.16499	N	0.211768	T	0.46521	0.1397	M	0.91090	3.175	0.09310	N	1	D	0.53151	0.958	P	0.52710	0.707	T	0.48875	-0.8996	10	0.87932	D	0	.	6.9948	0.24777	0.2013:0.0:0.7987:0.0	.	156	P30954	O10J1_HUMAN	F	156	ENSP00000399078:V156F	ENSP00000399078:V156F	V	+	1	0	OR10J1	157676638	0.000000	0.05858	0.032000	0.17829	0.006000	0.05464	0.082000	0.14847	1.258000	0.44101	0.655000	0.94253	GTC	.		0.502	OR10J1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059020.1	NM_012351	
OLFML2B	25903	bcgsc.ca	37	1	161967692	161967692	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5LL-01A-11D-A29I-10	TCGA-OR-A5LL-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9bfd4b2e-0577-4c94-8d6c-dafa9104b502	2d4f1606-9261-4ba8-96a9-ee307989af11	g.chr1:161967692G>A	ENST00000294794.3	-	6	1820	c.1397C>T	c.(1396-1398)gCt>gTt	p.A466V	OLFML2B_ENST00000367940.2_Missense_Mutation_p.A467V	NM_015441.1	NP_056256.1	Q68BL8	OLM2B_HUMAN	olfactomedin-like 2B	466					extracellular matrix organization (GO:0030198)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)	extracellular matrix binding (GO:0050840)			breast(1)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(11)|lung(22)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	48	all_hematologic(112;0.156)		BRCA - Breast invasive adenocarcinoma(70;0.0172)			CCCAGCAGGAGCATCTTTCCC	0.577																																					p.A466V		.											.	OLFML2B-69	0			c.C1397T						.						110.0	107.0	108.0					1																	161967692		2203	4300	6503	SO:0001583	missense	25903	exon6			GCAGGAGCATCTT	BX648975	CCDS1236.1, CCDS72966.1	1q23.1	2008-02-05			ENSG00000162745	ENSG00000162745			24558	protein-coding gene	gene with protein product							Standard	XM_005245075		Approved	DKFZP586L151	uc001gbu.3	Q68BL8	OTTHUMG00000024047	ENST00000294794.3:c.1397C>T	1.37:g.161967692G>A	ENSP00000294794:p.Ala466Val	Somatic	96	0		WXS	Illumina GAIIx	Phase_I	280	8	NM_015441	0	0	10	10	0	B7ZA39|Q5VU96|Q6NX46|Q86X11|Q9Y3X6	Missense_Mutation	SNP	ENST00000294794.3	37	CCDS1236.1	.	.	.	.	.	.	.	.	.	.	G	9.543	1.114015	0.20795	.	.	ENSG00000162745	ENST00000294794;ENST00000367940	D;D	0.86865	-2.18;-2.18	4.29	-1.09	0.09904	.	.	.	.	.	T	0.49064	0.1535	N	0.12182	0.205	0.19300	N	0.999973	B;B	0.11235	0.004;0.004	B;B	0.06405	0.002;0.002	T	0.04191	-1.0970	8	0.17832	T	0.49	.	4.4761	0.11745	0.3929:0.2986:0.3085:0.0	.	467;466	F2Z3N3;Q68BL8	.;OLM2B_HUMAN	V	466;467	ENSP00000294794:A466V;ENSP00000356917:A467V	ENSP00000294794:A466V	A	-	2	0	OLFML2B	160234316	0.000000	0.05858	0.000000	0.03702	0.041000	0.13682	-1.454000	0.02381	-0.428000	0.07339	0.462000	0.41574	GCT	.		0.577	OLFML2B-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000060552.2	NM_015441	
FMO1	2326	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	171254505	171254505	+	Missense_Mutation	SNP	G	G	A	rs28360433	byFrequency	TCGA-OR-A5LL-01A-11D-A29I-10	TCGA-OR-A5LL-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9bfd4b2e-0577-4c94-8d6c-dafa9104b502	2d4f1606-9261-4ba8-96a9-ee307989af11	g.chr1:171254505G>A	ENST00000354841.4	+	8	1552	c.1421G>A	c.(1420-1422)cGc>cAc	p.R474H	FMO1_ENST00000367750.3_Missense_Mutation_p.R474H|FMO1_ENST00000402921.2_Missense_Mutation_p.R411H|FMO1_ENST00000469112.1_3'UTR	NM_001282692.1	NP_001269621.1	Q01740	FMO1_HUMAN	flavin containing monooxygenase 1	474			R -> H (in dbSNP:rs28360433). {ECO:0000269|Ref.2}.		NADPH oxidation (GO:0070995)|organic acid metabolic process (GO:0006082)|small molecule metabolic process (GO:0044281)|toxin metabolic process (GO:0009404)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum lumen (GO:0005788)|integral component of membrane (GO:0016021)	flavin adenine dinucleotide binding (GO:0050660)|monooxygenase activity (GO:0004497)|N,N-dimethylaniline monooxygenase activity (GO:0004499)|NADP binding (GO:0050661)			NS(1)|breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(13)|prostate(2)|skin(2)	27	all_hematologic(923;0.0922)|Acute lymphoblastic leukemia(37;0.181)				Cevimeline(DB00185)|Cimetidine(DB00501)|Lorcaserin(DB04871)|Tamoxifen(DB00675)|Vandetanib(DB05294)|Voriconazole(DB00582)	TACCAGTTCCGCTTGACTGGC	0.498																																					p.R474H		.											.	FMO1-515	0			c.G1421A						.						115.0	103.0	107.0					1																	171254505		2203	4300	6503	SO:0001583	missense	2326	exon9			AGTTCCGCTTGAC	M64082	CCDS1294.1, CCDS60351.1	1q24.3	2011-08-04			ENSG00000010932	ENSG00000010932	1.14.13.8		3769	protein-coding gene	gene with protein product		136130					Standard	XM_005245037		Approved		uc001ghl.3	Q01740	OTTHUMG00000035502	ENST00000354841.4:c.1421G>A	1.37:g.171254505G>A	ENSP00000346901:p.Arg474His	Somatic	109	0		WXS	Illumina GAIIx	Phase_I	99	14	NM_002021	0	0	0	0	0	A8K248|B7Z3P4|Q5QPT2|Q9UJC2	Missense_Mutation	SNP	ENST00000354841.4	37	CCDS1294.1	.	.	.	.	.	.	.	.	.	.	G	24.4	4.532165	0.85812	.	.	ENSG00000010932	ENST00000367750;ENST00000402921;ENST00000354841	T;T;T	0.63580	-0.05;-0.05;-0.05	5.7	4.79	0.61399	.	0.000000	0.85682	D	0.000000	T	0.82116	0.4967	H	0.96365	3.81	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.78314	0.991;0.984	D	0.88258	0.2921	10	0.87932	D	0	-0.2348	14.3145	0.66440	0.0719:0.0:0.9281:0.0	rs28360433;rs28360433	411;474	B7Z3P4;Q01740	.;FMO1_HUMAN	H	474;411;474	ENSP00000356724:R474H;ENSP00000385543:R411H;ENSP00000346901:R474H	ENSP00000346901:R474H	R	+	2	0	FMO1	169521129	1.000000	0.71417	0.988000	0.46212	0.789000	0.44602	9.851000	0.99511	1.412000	0.46977	-0.259000	0.10710	CGC	G|0.994;A|0.006		0.498	FMO1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086212.1	NM_002021	
HMCN1	83872	broad.mit.edu	37	1	185956605	185956605	+	Missense_Mutation	SNP	A	A	G			TCGA-OR-A5LL-01A-11D-A29I-10	TCGA-OR-A5LL-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9bfd4b2e-0577-4c94-8d6c-dafa9104b502	2d4f1606-9261-4ba8-96a9-ee307989af11	g.chr1:185956605A>G	ENST00000271588.4	+	20	3206	c.2977A>G	c.(2977-2979)Att>Gtt	p.I993V	HMCN1_ENST00000485744.1_3'UTR|HMCN1_ENST00000367492.2_Missense_Mutation_p.I993V	NM_031935.2	NP_114141.2	Q96RW7	HMCN1_HUMAN	hemicentin 1	993	Ig-like C2-type 7.				response to stimulus (GO:0050896)|visual perception (GO:0007601)	basement membrane (GO:0005604)|cell cortex (GO:0005938)|cell junction (GO:0030054)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)			NS(2)|autonomic_ganglia(1)|breast(10)|central_nervous_system(2)|cervix(1)|endometrium(28)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(58)|liver(3)|lung(101)|ovary(23)|pancreas(4)|prostate(20)|skin(8)|stomach(1)|upper_aerodigestive_tract(11)|urinary_tract(18)	308						ACTCAGTACAATTGAAGGCAT	0.403																																					p.I993V		.											.	HMCN1-113	0			c.A2977G						.						166.0	163.0	164.0					1																	185956605		2203	4300	6503	SO:0001583	missense	83872	exon20			AGTACAATTGAAG	AF156100	CCDS30956.1	1q25.3-q31.1	2013-01-11			ENSG00000143341	ENSG00000143341		"""Fibulins"", ""Immunoglobulin superfamily / I-set domain containing"""	19194	protein-coding gene	gene with protein product	"""fibulin 6"""	608548	"""age-related macular degeneration 1 (senile macular degeneration)"""	ARMD1		11222143	Standard	NM_031935		Approved	FBLN6, FIBL6, FIBL-6	uc001grq.1	Q96RW7	OTTHUMG00000059337	ENST00000271588.4:c.2977A>G	1.37:g.185956605A>G	ENSP00000271588:p.Ile993Val	Somatic	88	0		WXS	Illumina GAIIx	Phase_I	63	3	NM_031935	0	0	0	0	0	A6NGE3|Q5TYR7|Q96DN3|Q96DN8|Q96SC3	Missense_Mutation	SNP	ENST00000271588.4	37	CCDS30956.1	.	.	.	.	.	.	.	.	.	.	A	8.793	0.931086	0.18131	.	.	ENSG00000143341	ENST00000271588;ENST00000367492	T;T	0.66638	-0.22;-0.22	5.32	5.32	0.75619	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.052033	0.85682	D	0.000000	T	0.60932	0.2307	N	0.04260	-0.245	0.58432	D	0.999998	B;P	0.51653	0.083;0.947	B;D	0.66716	0.247;0.946	T	0.60105	-0.7328	10	0.11485	T	0.65	.	15.2902	0.73859	1.0:0.0:0.0:0.0	.	377;993	Q96RW7-3;Q96RW7	.;HMCN1_HUMAN	V	993	ENSP00000271588:I993V;ENSP00000356462:I993V	ENSP00000271588:I993V	I	+	1	0	HMCN1	184223228	1.000000	0.71417	0.969000	0.41365	0.984000	0.73092	5.747000	0.68689	2.021000	0.59480	0.528000	0.53228	ATT	.		0.403	HMCN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000131848.1	NM_031935	
PM20D1	148811	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	205797785	205797785	+	Missense_Mutation	SNP	G	G	C			TCGA-OR-A5LL-01A-11D-A29I-10	TCGA-OR-A5LL-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9bfd4b2e-0577-4c94-8d6c-dafa9104b502	2d4f1606-9261-4ba8-96a9-ee307989af11	g.chr1:205797785G>C	ENST00000367136.4	-	13	1516	c.1472C>G	c.(1471-1473)aCa>aGa	p.T491R	PM20D1_ENST00000460624.1_5'UTR	NM_152491.4	NP_689704.4	Q6GTS8	P20D1_HUMAN	peptidase M20 domain containing 1	491					negative regulation of neuron death (GO:1901215)|regulation of defense response to virus by host (GO:0050691)|regulation of viral process (GO:0050792)	extracellular vesicular exosome (GO:0070062)	metal ion binding (GO:0046872)|peptidase activity (GO:0008233)			breast(2)|endometrium(2)|kidney(1)|large_intestine(6)|lung(9)|ovary(1)|pancreas(1)|prostate(1)|skin(4)|stomach(1)	28	Breast(84;0.201)		BRCA - Breast invasive adenocarcinoma(75;0.0252)			CTCCTGGTCTGTGTCAGCATT	0.512																																					p.T491R		.											.	PM20D1-69	0			c.C1472G						.						153.0	138.0	143.0					1																	205797785		2203	4300	6503	SO:0001583	missense	148811	exon13			TGGTCTGTGTCAG		CCDS1460.1	1q32.1	2008-02-05			ENSG00000162877	ENSG00000162877			26518	protein-coding gene	gene with protein product							Standard	NM_152491		Approved	FLJ32569, Cps1	uc001hdj.3	Q6GTS8	OTTHUMG00000035999	ENST00000367136.4:c.1472C>G	1.37:g.205797785G>C	ENSP00000356104:p.Thr491Arg	Somatic	67	0		WXS	Illumina GAIIx	Phase_I	54	9	NM_152491	0	0	0	0	0	Q6P4E3|Q96DM4	Missense_Mutation	SNP	ENST00000367136.4	37	CCDS1460.1	.	.	.	.	.	.	.	.	.	.	g	15.33	2.801107	0.50315	.	.	ENSG00000162877	ENST00000367136	T	0.06687	3.27	6.06	-4.15	0.03881	.	0.777216	0.12788	N	0.439065	T	0.05547	0.0146	L	0.43152	1.355	0.09310	N	1	B	0.11235	0.004	B	0.09377	0.004	T	0.42344	-0.9457	10	0.19147	T	0.46	.	6.1532	0.20322	0.42:0.3674:0.2126:0.0	.	491	Q6GTS8	P20D1_HUMAN	R	491	ENSP00000356104:T491R	ENSP00000356104:T491R	T	-	2	0	PM20D1	204064408	0.000000	0.05858	0.001000	0.08648	0.639000	0.38242	-0.171000	0.09883	-0.290000	0.09025	0.655000	0.94253	ACA	.		0.512	PM20D1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087736.1	NM_152491	
NLRP3	114548	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	247587746	247587746	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5LL-01A-11D-A29I-10	TCGA-OR-A5LL-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9bfd4b2e-0577-4c94-8d6c-dafa9104b502	2d4f1606-9261-4ba8-96a9-ee307989af11	g.chr1:247587746G>A	ENST00000336119.3	+	3	1747	c.1001G>A	c.(1000-1002)aGc>aAc	p.S334N	NLRP3_ENST00000366496.2_Missense_Mutation_p.S334N|NLRP3_ENST00000348069.2_Missense_Mutation_p.S334N|NLRP3_ENST00000474792.1_3'UTR|NLRP3_ENST00000391827.2_Missense_Mutation_p.S334N|NLRP3_ENST00000391828.3_Missense_Mutation_p.S334N|NLRP3_ENST00000366497.2_Missense_Mutation_p.S334N	NM_001127462.2|NM_001243133.1|NM_004895.4	NP_001120934.1|NP_001230062.1|NP_004886.3	Q96P20	NALP3_HUMAN	NLR family, pyrin domain containing 3	334	NACHT. {ECO:0000255|PROSITE- ProRule:PRU00136}.				activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|apoptotic process (GO:0006915)|cellular response to lipopolysaccharide (GO:0071222)|defense response (GO:0006952)|defense response to virus (GO:0051607)|detection of biotic stimulus (GO:0009595)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|interleukin-1 beta production (GO:0032611)|interleukin-1 secretion (GO:0050701)|interleukin-18 production (GO:0032621)|negative regulation of acute inflammatory response (GO:0002674)|negative regulation of inflammatory response (GO:0050728)|negative regulation of interleukin-1 beta secretion (GO:0050713)|negative regulation of NF-kappaB import into nucleus (GO:0042347)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|NLRP3 inflammasome complex assembly (GO:0044546)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of interleukin-1 beta secretion (GO:0050718)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|protein oligomerization (GO:0051259)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|NLRP3 inflammasome complex (GO:0072559)	ATP binding (GO:0005524)|peptidoglycan binding (GO:0042834)			NS(1)|breast(3)|endometrium(6)|kidney(1)|large_intestine(19)|lung(85)|ovary(9)|pancreas(2)|prostate(4)|skin(8)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	142	all_cancers(71;9.66e-05)|all_epithelial(71;1.85e-05)|Breast(184;0.0226)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)	all_cancers(173;0.0172)	OV - Ovarian serous cystadenocarcinoma(106;0.0141)			CTCCTGAGCAGCCTCATCAGA	0.587																																					p.S334N		.											.	NLRP3-674	0			c.G1001A						.						57.0	59.0	59.0					1																	247587746		2203	4300	6503	SO:0001583	missense	114548	exon3			TGAGCAGCCTCAT	AF054176	CCDS1632.1, CCDS1633.1, CCDS44346.1, CCDS44347.1	1q44	2014-09-17	2006-12-08	2006-12-08	ENSG00000162711	ENSG00000162711		"""Nucleotide-binding domain and leucine rich repeat containing"""	16400	protein-coding gene	gene with protein product	"""Cryopyrin"", ""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 3"""	606416	"""cold autoinflammatory syndrome 1"""	C1orf7, CIAS1		10741953	Standard	NM_183395		Approved	AGTAVPRL, AII, AVP, FCAS, FCU, NALP3, PYPAF1, MWS, CLR1.1	uc001icr.3	Q96P20	OTTHUMG00000040647	ENST00000336119.3:c.1001G>A	1.37:g.247587746G>A	ENSP00000337383:p.Ser334Asn	Somatic	110	0		WXS	Illumina GAIIx	Phase_I	84	28	NM_183395	0	0	0	0	0	B2RC97|B7ZKS9|B7ZKT2|B7ZKT3|O75434|Q17RS2|Q59H68|Q5JQS8|Q5JQS9|Q6TG35|Q8TCW0|Q8TEU9|Q8WXH9	Missense_Mutation	SNP	ENST00000336119.3	37	CCDS1632.1	.	.	.	.	.	.	.	.	.	.	G	17.94	3.511495	0.64522	.	.	ENSG00000162711	ENST00000391828;ENST00000366497;ENST00000336119;ENST00000348069;ENST00000366496;ENST00000391827	T;T;T;T;T;T	0.78595	-1.19;-1.19;-1.19;-1.19;-1.19;-1.19	4.04	4.04	0.47022	NACHT nucleoside triphosphatase (1);	0.000000	0.64402	D	0.000007	T	0.81475	0.4830	L	0.41415	1.275	0.35497	D	0.799477	D;D;D;D;D	0.89917	1.0;1.0;0.999;0.999;0.999	D;D;D;D;D	0.85130	0.997;0.993;0.979;0.986;0.996	D	0.83490	0.0069	10	0.39692	T	0.17	.	11.9927	0.53184	0.0:0.0:1.0:0.0	.	334;334;334;334;334	B7ZKS9;Q96P20-4;Q96P20-2;Q96P20-5;Q96P20	.;.;.;.;NALP3_HUMAN	N	334	ENSP00000375704:S334N;ENSP00000355453:S334N;ENSP00000337383:S334N;ENSP00000294752:S334N;ENSP00000355452:S334N;ENSP00000375703:S334N	ENSP00000337383:S334N	S	+	2	0	NLRP3	245654369	1.000000	0.71417	1.000000	0.80357	0.841000	0.47740	4.875000	0.63072	2.543000	0.85770	0.563000	0.77884	AGC	.		0.587	NLRP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097740.1	NM_004895	
ECHDC3	79746	hgsc.bcm.edu;bcgsc.ca	37	10	11805375	11805375	+	Silent	SNP	G	G	A			TCGA-OR-A5LL-01A-11D-A29I-10	TCGA-OR-A5LL-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9bfd4b2e-0577-4c94-8d6c-dafa9104b502	2d4f1606-9261-4ba8-96a9-ee307989af11	g.chr10:11805375G>A	ENST00000379215.4	+	5	955	c.744G>A	c.(742-744)gtG>gtA	p.V248V	ECHDC3_ENST00000496136.1_3'UTR	NM_024693.4	NP_078969	Q96DC8	ECHD3_HUMAN	enoyl CoA hydratase domain containing 3	248						mitochondrion (GO:0005739)	catalytic activity (GO:0003824)			breast(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)	4						GTCCGGTGGTGTCCCTGGGCA	0.647																																					p.V248V		.											.	ECHDC3-90	0			c.G744A						.						74.0	61.0	66.0					10																	11805375		2203	4300	6503	SO:0001819	synonymous_variant	79746	exon5			GGTGGTGTCCCTG	AF275677	CCDS7084.1	10p14	2010-04-30	2010-04-30		ENSG00000134463	ENSG00000134463			23489	protein-coding gene	gene with protein product			"""enoyl Coenzyme A hydratase domain containing 3"""			12477932	Standard	NM_024693		Approved	FLJ20909	uc001ikw.4	Q96DC8	OTTHUMG00000017675	ENST00000379215.4:c.744G>A	10.37:g.11805375G>A		Somatic	33	0		WXS	Illumina GAIIx	Phase_I	41	7	NM_024693	0	0	3	3	0	Q53HR9|Q5W0J7|Q8WYY8|Q9BVL8|Q9H7G4	Silent	SNP	ENST00000379215.4	37	CCDS7084.1																																																																																			.		0.647	ECHDC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046771.1	NM_024693	
C10orf131	100127889	bcgsc.ca;mdanderson.org	37	10	97698599	97698599	+	IGR	SNP	A	A	G			TCGA-OR-A5LL-01A-11D-A29I-10	TCGA-OR-A5LL-10A-01D-A29L-10	A	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9bfd4b2e-0577-4c94-8d6c-dafa9104b502	2d4f1606-9261-4ba8-96a9-ee307989af11	g.chr10:97698599A>G	ENST00000423344.2	+	0	1241				ENTPD1-AS1_ENST00000454638.1_RNA|ENTPD1-AS1_ENST00000416301.1_RNA|ENTPD1-AS1_ENST00000451364.1_RNA|ENTPD1-AS1_ENST00000452728.1_RNA	NM_001130446.2	NP_001123918.2	A6NCD4	CJ131_HUMAN	chromosome 10 open reading frame 131											endometrium(1)|kidney(1)	2						GTCATTACCTACACCTATTAA	0.294																																					.		.											.	.	0			.						.																																			SO:0001628	intergenic_variant	0	.			TTACCTACACCTA		CCDS58090.1	10q24.1	2012-05-30			ENSG00000173088	ENSG00000173088			31667	protein-coding gene	gene with protein product							Standard	NM_001130446		Approved	bA690P14.3	uc010qoo.2	A6NCD4	OTTHUMG00000018824		10.37:g.97698599A>G		Somatic	202	0		WXS	Illumina GAIIx	Phase_I	171	37	.	0	0	1	1	0	B1AMZ2|B4DG41	RNA	SNP	ENST00000423344.2	37	CCDS58090.1	.	.	.	.	.	.	.	.	.	.	A	14.40	2.524855	0.44969	.	.	ENSG00000173088	ENST00000371202	.	.	.	6.08	4.94	0.65067	.	0.280024	0.30611	N	0.009242	T	0.67040	0.2851	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.68911	-0.5284	6	0.72032	D	0.01	.	9.8802	0.41229	0.1716:0.0:0.0:0.8284	.	.	.	.	A	228	.	ENSP00000360245:T228A	T	+	1	0	C10orf131	97688589	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	2.005000	0.40864	1.114000	0.41781	0.533000	0.62120	ACA	.		0.294	C10orf131-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000468148.1	NM_001098847	
SLIT1	6585	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	98799839	98799839	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5LL-01A-11D-A29I-10	TCGA-OR-A5LL-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9bfd4b2e-0577-4c94-8d6c-dafa9104b502	2d4f1606-9261-4ba8-96a9-ee307989af11	g.chr10:98799839G>A	ENST00000266058.4	-	21	2448	c.2203C>T	c.(2203-2205)Cca>Tca	p.P735S	SLIT1_ENST00000371070.4_Missense_Mutation_p.P735S|ARHGAP19-SLIT1_ENST00000453547.2_3'UTR	NM_003061.2	NP_003052.2	O75093	SLIT1_HUMAN	slit homolog 1 (Drosophila)	735	LRRNT 4.				axon extension involved in axon guidance (GO:0048846)|axon guidance (GO:0007411)|dorsal/ventral axon guidance (GO:0033563)|establishment of nucleus localization (GO:0040023)|forebrain morphogenesis (GO:0048853)|motor neuron axon guidance (GO:0008045)|negative chemotaxis (GO:0050919)|negative regulation of axon extension involved in axon guidance (GO:0048843)|negative regulation of synapse assembly (GO:0051964)|retinal ganglion cell axon guidance (GO:0031290)|spinal cord development (GO:0021510)|tangential migration from the subventricular zone to the olfactory bulb (GO:0022028)	extracellular space (GO:0005615)	calcium ion binding (GO:0005509)|Roundabout binding (GO:0048495)			breast(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(16)|lung(37)|ovary(5)|prostate(4)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	78		Colorectal(252;0.162)		Epithelial(162;2.02e-08)|all cancers(201;1.5e-06)		CACTCCTGTGGGCACTGTGGG	0.662																																					p.P735S		.											.	SLIT1-94	0			c.C2203T						.						33.0	31.0	32.0					10																	98799839		2203	4300	6503	SO:0001583	missense	6585	exon21			CCTGTGGGCACTG	AB011537	CCDS7453.1	10q23.3-q24	2008-08-01	2001-11-28		ENSG00000187122	ENSG00000187122			11085	protein-coding gene	gene with protein product		603742	"""slit (Drosophila) homolog 1"""	SLIL1		9693030, 9813312	Standard	NM_003061		Approved	slit1, MEGF4, Slit-1, SLIT3	uc001kmw.2	O75093	OTTHUMG00000018843	ENST00000266058.4:c.2203C>T	10.37:g.98799839G>A	ENSP00000266058:p.Pro735Ser	Somatic	222	0		WXS	Illumina GAIIx	Phase_I	203	39	NM_003061	0	0	1	1	0	Q5T0V1|Q8WWZ2|Q9UIL7	Missense_Mutation	SNP	ENST00000266058.4	37	CCDS7453.1	.	.	.	.	.	.	.	.	.	.	G	29.2	4.987470	0.93106	.	.	ENSG00000187122	ENST00000266058;ENST00000371057;ENST00000371070;ENST00000314867	D;D;D	0.98075	-4.7;-4.7;-4.7	5.11	5.11	0.69529	Leucine-rich repeat-containing N-terminal (2);	0.000000	0.85682	D	0.000000	D	0.98953	0.9644	M	0.90759	3.145	0.80722	D	1	D;D	0.89917	0.999;1.0	D;D	0.87578	0.989;0.998	D	0.99457	1.0942	10	0.62326	D	0.03	.	18.7361	0.91755	0.0:0.0:1.0:0.0	.	745;735	E7EWQ8;O75093	.;SLIT1_HUMAN	S	735;745;735;728	ENSP00000266058:P735S;ENSP00000360109:P735S;ENSP00000315005:P728S	ENSP00000266058:P735S	P	-	1	0	SLIT1	98789829	1.000000	0.71417	1.000000	0.80357	0.927000	0.56198	9.263000	0.95617	2.657000	0.90304	0.655000	0.94253	CCA	.		0.662	SLIT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049636.1	NM_003061	
PTPMT1	114971	broad.mit.edu	37	11	47587390	47587390	+	Intron	SNP	C	C	T	rs193125282	byFrequency	TCGA-OR-A5LL-01A-11D-A29I-10	TCGA-OR-A5LL-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9bfd4b2e-0577-4c94-8d6c-dafa9104b502	2d4f1606-9261-4ba8-96a9-ee307989af11	g.chr11:47587390C>T	ENST00000326674.9	+	1	196				PTPMT1_ENST00000326656.8_Intron|PTPMT1_ENST00000426530.2_Silent_p.R72R|PTPMT1_ENST00000534775.1_Silent_p.R72R|NDUFS3_ENST00000533507.1_Intron	NM_175732.2	NP_783859.1	Q8WUK0	PTPM1_HUMAN	protein tyrosine phosphatase, mitochondrial 1						cardiolipin biosynthetic process (GO:0032049)|glycerophospholipid biosynthetic process (GO:0046474)|inositol phosphate dephosphorylation (GO:0046855)|phosphatidylglycerol biosynthetic process (GO:0006655)|phospholipid metabolic process (GO:0006644)|protein dephosphorylation (GO:0006470)|small molecule metabolic process (GO:0044281)	mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	phosphatidylglycerophosphatase activity (GO:0008962)|phosphatidylinositol-4,5-bisphosphate 5-phosphatase activity (GO:0004439)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)			breast(1)|kidney(1)|large_intestine(2)|lung(1)|skin(1)	6						CCCGTCCCCGCCGCTCCGTCC	0.731													C|||	4	0.000798722	0.0	0.0	5008	,	,		10718	0.0		0.004	False		,,,				2504	0.0				p.R72R		.											.	PTPMT1-23	0			c.C216T						.	C	,	1,3739		0,1,1869	7.0	8.0	8.0		216,	0.8	0.0	11		8	20,8132		0,20,4056	no	coding-synonymous,intron	PTPMT1	NM_001143984.1,NM_175732.2	,	0,21,5925	TT,TC,CC		0.2453,0.0267,0.1766	,	72/152,	47587390	21,11871	1870	4076	5946	SO:0001627	intron_variant	114971	exon1			TCCCCGCCGCTCC	BC014048	CCDS41643.1, CCDS44593.1	11p11.2	2011-06-09			ENSG00000110536	ENSG00000110536	3.1.3.36	"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Atypical dual specificity phosphatases"""	26965	protein-coding gene	gene with protein product		609538				12477932	Standard	NM_175732		Approved	PLIP, DUSP23, MOSP	uc001nfs.4	Q8WUK0	OTTHUMG00000166892	ENST00000326674.9:c.174+42C>T	11.37:g.47587390C>T		Somatic	34	1		WXS	Illumina GAIIx	Phase_I	45	8	NM_001143984	0	0	5	6	1	E9PAT8|Q7Z557|Q96CR2|Q9BXV8	Silent	SNP	ENST00000326674.9	37	CCDS41643.1																																																																																			C|0.998;T|0.002		0.731	PTPMT1-002	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391746.1	XM_374879	
PC	5091	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	11	66636324	66636324	+	Missense_Mutation	SNP	T	T	C			TCGA-OR-A5LL-01A-11D-A29I-10	TCGA-OR-A5LL-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9bfd4b2e-0577-4c94-8d6c-dafa9104b502	2d4f1606-9261-4ba8-96a9-ee307989af11	g.chr11:66636324T>C	ENST00000393958.2	-	9	1108	c.1015A>G	c.(1015-1017)Atc>Gtc	p.I339V	PC_ENST00000393960.1_Missense_Mutation_p.I339V|PC_ENST00000355677.3_Missense_Mutation_p.I339V|PC_ENST00000393955.2_Missense_Mutation_p.I339V|PC_ENST00000524491.1_Missense_Mutation_p.I299V	NM_000920.3	NP_000911.2	P11498	PYC_HUMAN	pyruvate carboxylase	339	ATP-grasp. {ECO:0000255|PROSITE- ProRule:PRU00409}.|Biotin carboxylation.				biotin metabolic process (GO:0006768)|carbohydrate metabolic process (GO:0005975)|gluconeogenesis (GO:0006094)|glucose metabolic process (GO:0006006)|lipid metabolic process (GO:0006629)|oxaloacetate metabolic process (GO:0006107)|pyruvate metabolic process (GO:0006090)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)|mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|biotin binding (GO:0009374)|biotin carboxylase activity (GO:0004075)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)|pyruvate carboxylase activity (GO:0004736)			cervix(1)|endometrium(3)|kidney(3)|large_intestine(9)|lung(12)|ovary(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	32		Melanoma(852;0.0525)		Lung(977;0.153)|LUSC - Lung squamous cell carcinoma(976;0.227)	Biotin(DB00121)|Pyruvic acid(DB00119)	CACTCGGTGATCTCCTCTGTG	0.642																																					p.I339V		.											.	PC-228	0			c.A1015G						.						57.0	53.0	55.0					11																	66636324		2200	4295	6495	SO:0001583	missense	5091	exon9			CGGTGATCTCCTC	U04641	CCDS8152.1	11q13.4-q13.5	2012-07-11			ENSG00000173599	ENSG00000173599	6.4.1.1		8636	protein-coding gene	gene with protein product		608786				6548474	Standard	NM_022172		Approved	PCB	uc001ojn.1	P11498	OTTHUMG00000167099	ENST00000393958.2:c.1015A>G	11.37:g.66636324T>C	ENSP00000377530:p.Ile339Val	Somatic	100	0		WXS	Illumina GAIIx	Phase_I	79	7	NM_000920	0	0	0	0	0	B4DN00|Q16705	Missense_Mutation	SNP	ENST00000393958.2	37	CCDS8152.1	.	.	.	.	.	.	.	.	.	.	T	12.33	1.906912	0.33628	.	.	ENSG00000173599	ENST00000393955;ENST00000393958;ENST00000393960;ENST00000524491;ENST00000355677	D;D;D;D;D	0.97041	-4.22;-4.22;-4.22;-4.22;-4.22	4.65	3.51	0.40186	ATP-grasp fold (1);ATP-grasp fold, subdomain 2 (1);Carbamoyl-phosphate synthetase, large subunit, ATP-binding (1);Biotin carboxylation domain (1);	0.067688	0.56097	N	0.000029	D	0.92061	0.7484	N	0.16708	0.43	0.53005	D	0.999967	B	0.26445	0.149	B	0.33960	0.173	D	0.85296	0.1070	10	0.18710	T	0.47	-21.4714	8.3459	0.32272	0.0:0.0964:0.0:0.9036	.	339	P11498	PYC_HUMAN	V	339;339;339;299;339	ENSP00000377527:I339V;ENSP00000377530:I339V;ENSP00000377532:I339V;ENSP00000434192:I299V;ENSP00000347900:I339V	ENSP00000347900:I339V	I	-	1	0	PC	66392900	1.000000	0.71417	1.000000	0.80357	0.494000	0.33585	3.737000	0.55060	0.638000	0.30545	-0.379000	0.06801	ATC	.		0.642	PC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393115.1	NM_001040716	
MRPS35	60488	bcgsc.ca	37	12	27867727	27867727	+	Missense_Mutation	SNP	G	G	A	rs1127787	byFrequency	TCGA-OR-A5LL-01A-11D-A29I-10	TCGA-OR-A5LL-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9bfd4b2e-0577-4c94-8d6c-dafa9104b502	2d4f1606-9261-4ba8-96a9-ee307989af11	g.chr12:27867727G>A	ENST00000081029.3	+	2	198	c.127G>A	c.(127-129)Gga>Aga	p.G43R	MRPS35_ENST00000538315.1_Missense_Mutation_p.G43R	NM_021821.3	NP_068593.2	Q9Y2Q9	RT28_HUMAN	mitochondrial ribosomal protein S35	0						mitochondrial small ribosomal subunit (GO:0005763)|mitochondrion (GO:0005739)	poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(1)|kidney(1)|lung(2)|urinary_tract(1)	6	Lung SC(9;0.0873)					AAGAACACCCGGAAATGAAAG	0.348													G|||	598	0.119409	0.0068	0.1009	5008	,	,		18221	0.1944		0.173	False		,,,				2504	0.1524				p.G43R		.											.	MRPS35-90	0			c.G127A						.	G	ARG/GLY,ARG/GLY	148,4258	103.4+/-141.9	1,146,2056	101.0	104.0	103.0		127,127	2.0	0.0	12	dbSNP_86	103	1372,7228	266.9+/-287.0	108,1156,3036	yes	missense,missense	MRPS35	NM_001190864.1,NM_021821.3	125,125	109,1302,5092	AA,AG,GG		15.9535,3.3591,11.6869	benign,benign	43/195,43/324	27867727	1520,11486	2203	4300	6503	SO:0001583	missense	60488	exon2			ACACCCGGAAATG	AF182422	CCDS8714.1, CCDS53769.1	12p11	2012-09-13			ENSG00000061794	ENSG00000061794		"""Mitochondrial ribosomal proteins / small subunits"""	16635	protein-coding gene	gene with protein product		611995				11279123	Standard	NM_021821		Approved	MRPS28, MDS023	uc001rih.3	P82673	OTTHUMG00000169215	ENST00000081029.3:c.127G>A	12.37:g.27867727G>A	ENSP00000081029:p.Gly43Arg	Somatic	103	1		WXS	Illumina GAIIx	Phase_I	97	6	NM_001190864	0	0	0	0	0	B2RDZ7|Q96Q21	Missense_Mutation	SNP	ENST00000081029.3	37	CCDS8714.1	282	0.12912087912087913	7	0.014227642276422764	37	0.10220994475138122	106	0.1853146853146853	132	0.1741424802110818	G	0.077	-1.191671	0.01607	0.033591	0.159535	ENSG00000061794	ENST00000081029;ENST00000321446;ENST00000538315	T;T	0.41758	1.0;0.99	4.42	1.99	0.26369	.	0.456688	0.23123	N	0.051666	T	0.00012	0.0000	N	0.00152	-1.975	0.80722	P	0.0	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.26608	-1.0098	9	0.08599	T	0.76	-4.1139	4.4065	0.11411	0.6957:0.2013:0.103:0.0	rs1127787;rs1801373;rs3177168;rs3184093;rs11545242;rs17404577;rs52803578;rs3177168	43;43	P82673-2;P82673	.;RT35_HUMAN	R	43	ENSP00000081029:G43R;ENSP00000445390:G43R	ENSP00000081029:G43R	G	+	1	0	MRPS35	27758994	0.008000	0.16893	0.007000	0.13788	0.008000	0.06430	1.190000	0.32126	0.438000	0.26450	-0.238000	0.12139	GGA	G|0.873;A|0.127		0.348	MRPS35-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402897.1	NM_021821	
KRT1	3848	hgsc.bcm.edu	37	12	53069243	53069243	+	Missense_Mutation	SNP	T	T	C	rs77846840|rs540699806|rs267607656	byFrequency	TCGA-OR-A5LL-01A-11D-A29I-10	TCGA-OR-A5LL-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9bfd4b2e-0577-4c94-8d6c-dafa9104b502	2d4f1606-9261-4ba8-96a9-ee307989af11	g.chr12:53069243T>C	ENST00000252244.3	-	9	1727	c.1669A>G	c.(1669-1671)Agc>Ggc	p.S557G		NM_006121.3	NP_006112.3	P04264	K2C1_HUMAN	keratin 1	557	Gly/Ser-rich.|Tail.				complement activation, lectin pathway (GO:0001867)|establishment of skin barrier (GO:0061436)|fibrinolysis (GO:0042730)|negative regulation of inflammatory response (GO:0050728)|regulation of angiogenesis (GO:0045765)|response to oxidative stress (GO:0006979)|retina homeostasis (GO:0001895)	blood microparticle (GO:0072562)|cytoskeleton (GO:0005856)|extracellular matrix (GO:0031012)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|keratin filament (GO:0045095)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)|receptor activity (GO:0004872)|structural molecule activity (GO:0005198)	p.S557_G563delSSYGSGG(3)		breast(2)|central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(7)|lung(11)|ovary(1)|prostate(7)|skin(3)	39						ccgtagctgctacctccggag	0.682																																					p.S557G		.											.	KRT1-92	3	Deletion - In frame(3)	prostate(2)|central_nervous_system(1)	c.A1669G						.						4.0	4.0	4.0					12																	53069243		1805	3566	5371	SO:0001583	missense	3848	exon9			AGCTGCTACCTCC	X69725	CCDS8836.1	12q13.13	2014-06-05	2008-08-01		ENSG00000167768	ENSG00000167768		"""-"", ""Intermediate filaments type II, keratins (basic)"""	6412	protein-coding gene	gene with protein product		139350	"""epidermolytic hyperkeratosis 1"""	EHK1		2461420, 2470667, 16831889	Standard	NM_006121		Approved	KRT1A	uc001sau.1	P04264	OTTHUMG00000169749	ENST00000252244.3:c.1669A>G	12.37:g.53069243T>C	ENSP00000252244:p.Ser557Gly	Somatic	19	0		WXS	Illumina GAIIx	Phase_I	17	4	NM_006121	0	0	0	0	0	B2RA01|P85925|P86104|Q14720|Q6GSJ0|Q9H298	Missense_Mutation	SNP	ENST00000252244.3	37	CCDS8836.1	.	.	.	.	.	.	.	.	.	.	t	12.77	2.037794	0.35989	.	.	ENSG00000167768	ENST00000252244	T	0.81247	-1.47	3.63	0.628	0.17681	.	.	.	.	.	T	0.54711	0.1875	N	0.08118	0	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.48490	-0.9031	8	0.07644	T	0.81	.	5.639	0.17552	0.0:0.6406:0.1602:0.1993	.	557	P04264	K2C1_HUMAN	G	557	ENSP00000252244:S557G	ENSP00000252244:S557G	S	-	1	0	KRT1	51355510	0.000000	0.05858	0.034000	0.17996	0.201000	0.24016	-0.192000	0.09587	-0.104000	0.12154	-1.598000	0.00824	AGC	T|0.500;C|0.500		0.682	KRT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405706.1	NM_006121	
DNAJC14	85406	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	12	56215846	56215846	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5LL-01A-11D-A29I-10	TCGA-OR-A5LL-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9bfd4b2e-0577-4c94-8d6c-dafa9104b502	2d4f1606-9261-4ba8-96a9-ee307989af11	g.chr12:56215846G>A	ENST00000357606.3	-	8	2313	c.2024C>T	c.(2023-2025)gCa>gTa	p.A675V	RP11-762I7.5_ENST00000546837.1_Silent_p.C304C|RP11-762I7.5_ENST00000552719.1_5'UTR|DNAJC14_ENST00000317269.3_Missense_Mutation_p.A675V|DNAJC14_ENST00000317287.5_Missense_Mutation_p.A675V			Q6Y2X3	DJC14_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 14	675	Poly-Ala.				protein transport (GO:0015031)	endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)				breast(2)|kidney(1)|large_intestine(8)|lung(7)|ovary(3)|prostate(1)|skin(1)	23						CTTAGAGGCTGCAGCGGCTCC	0.557																																					p.A675V		.											.	DNAJC14-229	0			c.C2024T						.						103.0	97.0	99.0					12																	56215846		2203	4300	6503	SO:0001583	missense	85406	exon7			GAGGCTGCAGCGG	AF141342	CCDS8894.1	12q12	2011-09-02				ENSG00000135392		"""Heat shock proteins / DNAJ (HSP40)"""	24581	protein-coding gene	gene with protein product		606092				11331877, 11984006	Standard	NM_032364		Approved	DNAJ, DRIP78, HDJ3, LIP6, FLJ32792	uc001shu.2	Q6Y2X3		ENST00000357606.3:c.2024C>T	12.37:g.56215846G>A	ENSP00000350223:p.Ala675Val	Somatic	85	0		WXS	Illumina GAIIx	Phase_I	66	31	NM_032364	0	0	8	16	8	A5YM67|Q17RY2|Q66K17|Q96N59|Q96T63	Missense_Mutation	SNP	ENST00000357606.3	37	CCDS8894.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	11.88|11.88	1.771156|1.771156	0.31320|0.31320	.|.	.|.	ENSG00000135392|ENSG00000135392	ENST00000357606;ENST00000317269;ENST00000537962;ENST00000317287|ENST00000540330	T;T;T|.	0.37584|.	1.19;1.19;1.19|.	5.11|5.11	4.21|4.21	0.49690|0.49690	.|.	0.451250|.	0.21765|.	N|.	0.069457|.	T|.	0.30448|.	0.0765|.	N|N	0.08118|0.08118	0|0	0.24477|0.24477	N|N	0.994368|0.994368	B;B|.	0.24258|.	0.1;0.047|.	B;B|.	0.21708|.	0.036;0.024|.	T|.	0.31916|.	-0.9926|.	10|.	0.56958|0.59425	D|D	0.05|0.04	-0.0012|-0.0012	13.683|13.683	0.62499|0.62499	0.0:0.1561:0.8439:0.0|0.0:0.1561:0.8439:0.0	.|.	675;675|.	Q6Y2X3;A8K5A7|.	DJC14_HUMAN;.|.	V|X	675;675;385;675|171	ENSP00000350223:A675V;ENSP00000316240:A675V;ENSP00000317500:A675V|.	ENSP00000316240:A675V|ENSP00000441495:Q171X	A|Q	-|-	2|1	0|0	DNAJC14|DNAJC14	54502113|54502113	0.092000|0.092000	0.21681|0.21681	0.703000|0.703000	0.30354|0.30354	0.233000|0.233000	0.25261|0.25261	2.061000|2.061000	0.41403|0.41403	1.506000|1.506000	0.48736|0.48736	0.591000|0.591000	0.81541|0.81541	GCA|CAG	.		0.557	DNAJC14-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000409095.1	NM_032364	
MMP19	4327	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	56231788	56231788	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5LL-01A-11D-A29I-10	TCGA-OR-A5LL-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9bfd4b2e-0577-4c94-8d6c-dafa9104b502	2d4f1606-9261-4ba8-96a9-ee307989af11	g.chr12:56231788G>A	ENST00000322569.4	-	7	990	c.899C>T	c.(898-900)cCc>cTc	p.P300L	TMEM198B_ENST00000478241.1_RNA|MMP19_ENST00000394182.1_Missense_Mutation_p.P14L|MMP19_ENST00000548629.1_Missense_Mutation_p.P277L|MMP19_ENST00000409200.3_Silent_p.A253A	NM_002429.4	NP_002420.1	Q99542	MMP19_HUMAN	matrix metallopeptidase 19	300					angiogenesis (GO:0001525)|cell differentiation (GO:0030154)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|luteolysis (GO:0001554)|ovarian follicle development (GO:0001541)|ovulation from ovarian follicle (GO:0001542)|proteolysis (GO:0006508)|response to cAMP (GO:0051591)|response to hormone (GO:0009725)	extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			endometrium(1)|kidney(2)|large_intestine(7)|lung(12)|ovary(2)|skin(2)	26					Marimastat(DB00786)	CTTCCCACGGGGCCCTGAGCG	0.532																																					p.P300L		.											.	MMP19-227	0			c.C899T						.						48.0	47.0	48.0					12																	56231788		2203	4300	6503	SO:0001583	missense	4327	exon7			CCACGGGGCCCTG	X92521	CCDS8895.1, CCDS61146.1	12q14	2005-08-08	2005-08-08			ENSG00000123342			7165	protein-coding gene	gene with protein product		601807	"""matrix metalloproteinase 19"""	MMP18		9232430	Standard	NM_002429		Approved	RASI-1	uc001sib.4	Q99542	OTTHUMG00000170216	ENST00000322569.4:c.899C>T	12.37:g.56231788G>A	ENSP00000313437:p.Pro300Leu	Somatic	87	0		WXS	Illumina GAIIx	Phase_I	56	15	NM_002429	0	0	0	0	0	B4E030|O15278|O95606|Q99580	Missense_Mutation	SNP	ENST00000322569.4	37	CCDS8895.1	.	.	.	.	.	.	.	.	.	.	G	15.41	2.825252	0.50739	.	.	ENSG00000123342	ENST00000394182;ENST00000322569;ENST00000548629	T;T;T	0.15372	4.57;2.58;2.43	5.7	5.7	0.88788	Hemopexin/matrixin (2);	0.108661	0.64402	D	0.000004	T	0.27765	0.0683	L	0.50333	1.59	0.80722	D	1	B;D	0.57899	0.429;0.981	B;P	0.57776	0.102;0.827	T	0.02026	-1.1227	10	0.02654	T	1	.	17.3316	0.87265	0.0:0.0:1.0:0.0	.	300;14	Q99542;Q99542-3	MMP19_HUMAN;.	L	14;300;277	ENSP00000377736:P14L;ENSP00000313437:P300L;ENSP00000446979:P277L	ENSP00000313437:P300L	P	-	2	0	MMP19	54518055	1.000000	0.71417	0.978000	0.43139	0.221000	0.24807	9.056000	0.93881	2.711000	0.92665	0.561000	0.74099	CCC	.		0.532	MMP19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408023.1	NM_002429	
MBD6	114785	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	12	57922471	57922471	+	Missense_Mutation	SNP	A	A	C			TCGA-OR-A5LL-01A-11D-A29I-10	TCGA-OR-A5LL-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9bfd4b2e-0577-4c94-8d6c-dafa9104b502	2d4f1606-9261-4ba8-96a9-ee307989af11	g.chr12:57922471A>C	ENST00000355673.3	+	11	3199	c.2843A>C	c.(2842-2844)aAg>aCg	p.K948T	MBD6_ENST00000431731.2_Missense_Mutation_p.K948T	NM_052897.3	NP_443129.3	Q96DN6	MBD6_HUMAN	methyl-CpG binding domain protein 6	948						chromocenter (GO:0010369)|nucleus (GO:0005634)	chromatin binding (GO:0003682)			breast(1)|central_nervous_system(3)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(8)|lung(8)|ovary(1)|urinary_tract(1)	31						GTAGTCAGAAAGTCTCGTCGT	0.493																																					p.K948T		.											.	MBD6-516	0			c.A2843C						.						113.0	116.0	115.0					12																	57922471		2203	4300	6503	SO:0001583	missense	114785	exon11			TCAGAAAGTCTCG	AB067474	CCDS8944.1	12q13.2	2008-02-05				ENSG00000166987			20445	protein-coding gene	gene with protein product						12529184	Standard	NM_052897		Approved	KIAA1887	uc001soj.1	Q96DN6		ENST00000355673.3:c.2843A>C	12.37:g.57922471A>C	ENSP00000347896:p.Lys948Thr	Somatic	116	0		WXS	Illumina GAIIx	Phase_I	88	8	NM_052897	0	0	26	31	5	Q8N3M0|Q8NA81|Q96Q00	Missense_Mutation	SNP	ENST00000355673.3	37	CCDS8944.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	a|a	21.8|21.8	4.197271|4.197271	0.79015|0.79015	.|.	.|.	ENSG00000166987|ENSG00000166987	ENST00000300263;ENST00000552163|ENST00000355673;ENST00000431731	.|.	.|.	.|.	4.96|4.96	4.96|4.96	0.65561|0.65561	.|.	0.110360|0.110360	0.39210|0.39210	N|N	0.001423|0.001423	T|T	0.50684|0.50684	0.1630|0.1630	N|N	0.08118|0.08118	0|0	0.36615|0.36615	D|D	0.875431|0.875431	.|D;D	.|0.61080	.|0.989;0.989	.|D;D	.|0.70487	.|0.969;0.969	T|T	0.64097|0.64097	-0.6487|-0.6487	7|9	0.87932|0.87932	D|D	0|0	-5.1585|-5.1585	11.2115|11.2115	0.48802|0.48802	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	.|948;948	.|Q6P0P0;Q96DN6	.|.;MBD6_HUMAN	N|T	409;182|948	.|.	ENSP00000300263:K409N|ENSP00000347896:K948T	K|K	+|+	3|2	2|0	MBD6|MBD6	56208738|56208738	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	2.702000|2.702000	0.47102|0.47102	2.225000|2.225000	0.72522|0.72522	0.529000|0.529000	0.55759|0.55759	AAA|AAG	.		0.493	MBD6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407250.1		
WIF1	11197	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	12	65448919	65448919	+	Missense_Mutation	SNP	G	G	T			TCGA-OR-A5LL-01A-11D-A29I-10	TCGA-OR-A5LL-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9bfd4b2e-0577-4c94-8d6c-dafa9104b502	2d4f1606-9261-4ba8-96a9-ee307989af11	g.chr12:65448919G>T	ENST00000286574.4	-	9	1371	c.997C>A	c.(997-999)Cat>Aat	p.H333N		NM_007191.4	NP_009122.2	Q9Y5W5	WIF1_HUMAN	WNT inhibitory factor 1	333	EGF-like 5. {ECO:0000255|PROSITE- ProRule:PRU00076}.				multicellular organismal development (GO:0007275)|positive regulation of fat cell differentiation (GO:0045600)|signal transduction (GO:0007165)|Wnt signaling pathway (GO:0016055)	extracellular region (GO:0005576)				cervix(1)|large_intestine(4)|lung(10)|ovary(3)|skin(1)|stomach(1)|urinary_tract(1)	21			LUAD - Lung adenocarcinoma(6;0.0234)|LUSC - Lung squamous cell carcinoma(43;0.0975)	GBM - Glioblastoma multiforme(28;0.0231)		TGTCTTCCATGCCAACCTTCT	0.413			T	HMGA2	pleomorphic salivary gland adenoma																																p.H333N	Esophageal Squamous(148;1595 1816 48559 49439 49664)	.		Dom	yes		12	12q14.3	11197	WNT inhibitory factor 1		E	.	WIF1-1110	0			c.C997A						.						94.0	88.0	90.0					12																	65448919		2203	4300	6503	SO:0001583	missense	11197	exon9			TTCCATGCCAACC	AF122922	CCDS8971.1	12q14.2	2008-04-11			ENSG00000156076	ENSG00000156076			18081	protein-coding gene	gene with protein product		605186				10201374	Standard	NM_007191		Approved		uc001ssk.3	Q9Y5W5	OTTHUMG00000168832	ENST00000286574.4:c.997C>A	12.37:g.65448919G>T	ENSP00000286574:p.His333Asn	Somatic	58	0		WXS	Illumina GAIIx	Phase_I	68	6	NM_007191	0	0	0	0	0	Q6UXI1|Q8WVG4	Missense_Mutation	SNP	ENST00000286574.4	37	CCDS8971.1	.	.	.	.	.	.	.	.	.	.	G	11.16	1.557952	0.27827	.	.	ENSG00000156076	ENST00000286574;ENST00000543094	T;T	0.55052	1.01;0.54	5.71	4.82	0.62117	EGF, extracellular (1);Epidermal growth factor-like (1);EGF-like region, conserved site (2);Epidermal growth factor-like, type 3 (1);	0.058488	0.64402	D	0.000003	T	0.36663	0.0975	L	0.28115	0.83	0.51767	D	0.999931	B	0.10296	0.003	B	0.10450	0.005	T	0.15492	-1.0435	9	.	.	.	.	9.8659	0.41142	0.0697:0.0:0.792:0.1383	.	333	Q9Y5W5	WIF1_HUMAN	N	333;82	ENSP00000286574:H333N;ENSP00000439024:H82N	.	H	-	1	0	WIF1	63735186	1.000000	0.71417	1.000000	0.80357	0.895000	0.52256	5.036000	0.64164	1.557000	0.49525	0.655000	0.94253	CAT	.		0.413	WIF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401258.2		
EP400	57634	broad.mit.edu	37	12	132547087	132547087	+	Silent	SNP	G	G	A	rs12366766	byFrequency	TCGA-OR-A5LL-01A-11D-A29I-10	TCGA-OR-A5LL-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9bfd4b2e-0577-4c94-8d6c-dafa9104b502	2d4f1606-9261-4ba8-96a9-ee307989af11	g.chr12:132547087G>A	ENST00000333577.4	+	48	8392	c.8283G>A	c.(8281-8283)caG>caA	p.Q2761Q	EP400_ENST00000330386.6_Silent_p.Q2644Q|EP400_ENST00000332482.4_Silent_p.Q2688Q|EP400_ENST00000389561.2_Silent_p.Q2725Q|EP400_ENST00000389562.2_Silent_p.Q2724Q			Q96L91	EP400_HUMAN	E1A binding protein p400	2761	Interaction with ZNF42. {ECO:0000250}.|Poly-Gln.				chromatin organization (GO:0006325)|histone H2A acetylation (GO:0043968)|histone H4 acetylation (GO:0043967)	NuA4 histone acetyltransferase complex (GO:0035267)|nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|Swr1 complex (GO:0000812)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|helicase activity (GO:0004386)	p.Q2724Q(16)|p.Q2725Q(1)		NS(1)|breast(6)|central_nervous_system(10)|cervix(1)|endometrium(21)|kidney(13)|large_intestine(25)|lung(56)|ovary(5)|prostate(8)|skin(6)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(3)	161	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.198)		OV - Ovarian serous cystadenocarcinoma(86;3.01e-08)|Epithelial(86;3.43e-07)|all cancers(50;2.01e-06)		agcagcagcagcaacaacagc	0.562													G|||	37	0.00738818	0.0038	0.0072	5008	,	,		15585	0.002		0.0149	False		,,,				2504	0.0102				p.Q2725Q		.											.	EP400-520	17	Substitution - coding silent(17)	prostate(4)|kidney(4)|central_nervous_system(3)|lung(3)|endometrium(2)|urinary_tract(1)	c.G8175A						.						28.0	31.0	30.0					12																	132547087		2199	4282	6481	SO:0001819	synonymous_variant	57634	exon47			GCAGCAGCAACAA	U80743	CCDS31929.1, CCDS31929.2	12q24.33	2008-02-01	2002-02-05	2002-02-08		ENSG00000183495			11958	protein-coding gene	gene with protein product		606265	"""trinucleotide repeat containing 12"""	TNRC12		9225980, 11509179	Standard	NM_015409		Approved	CAGH32, KIAA1498, P400, KIAA1818, DKFZP434I225	uc001ujn.3	Q96L91		ENST00000333577.4:c.8283G>A	12.37:g.132547087G>A		Somatic	101	0		WXS	Illumina GAIIx	Phase_I	59	8	NM_015409	0	0	1	1	0	O15411|Q6P2F5|Q8N8Q7|Q8NE05|Q96JK7|Q9P230	Silent	SNP	ENST00000333577.4	37																																																																																				.		0.562	EP400-203	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding		NM_015409	
LINC00283	100874057	bcgsc.ca	37	13	103398682	103398682	+	RNA	SNP	G	G	T			TCGA-OR-A5LL-01A-11D-A29I-10	TCGA-OR-A5LL-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9bfd4b2e-0577-4c94-8d6c-dafa9104b502	2d4f1606-9261-4ba8-96a9-ee307989af11	g.chr13:103398682G>T	ENST00000430111.1	+	0	3894									long intergenic non-protein coding RNA 283																		TTTCCTCTCTGTCATGGGATA	0.453																																					p.D1455E		.											.	.	0			c.C4365A						.						94.0	71.0	77.0					13																	103398682		692	1590	2282			643677	exon4			CTCTCTGTCATGG			13q33.1	2012-10-12	2011-08-10	2011-08-10	ENSG00000231633	ENSG00000231633		"""Long non-coding RNAs"""	38809	non-coding RNA	RNA, long non-coding			"""non-protein coding RNA 283"""	NCRNA00283			Standard			Approved				OTTHUMG00000017311		13.37:g.103398682G>T		Somatic	70	0		WXS	Illumina GAIIx	Phase_I	52	4	NM_001146197	0	0	0	0	0		Missense_Mutation	SNP	ENST00000430111.1	37																																																																																				.		0.453	LINC00283-001	KNOWN	not_organism_supported|basic	antisense	antisense	OTTHUMT00000045714.1		
ERCC5	2073	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	13	103498624	103498624	+	Missense_Mutation	SNP	T	T	A			TCGA-OR-A5LL-01A-11D-A29I-10	TCGA-OR-A5LL-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9bfd4b2e-0577-4c94-8d6c-dafa9104b502	2d4f1606-9261-4ba8-96a9-ee307989af11	g.chr13:103498624T>A	ENST00000355739.4	+	1	1431	c.8T>A	c.(7-9)gTc>gAc	p.V3D	ERCC5_ENST00000535557.1_Missense_Mutation_p.V3D|BIVM-ERCC5_ENST00000602836.1_Intron	NM_000123.3	NP_000114	P28715	ERCC5_HUMAN	excision repair cross-complementation group 5	3	N-domain.				DNA catabolic process, endonucleolytic (GO:0000737)|DNA repair (GO:0006281)|negative regulation of apoptotic process (GO:0043066)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA damage removal (GO:0000718)|nucleotide-excision repair, DNA incision, 3'-to lesion (GO:0006295)|response to UV (GO:0009411)|response to UV-C (GO:0010225)|transcription-coupled nucleotide-excision repair (GO:0006283)|UV protection (GO:0009650)	intermediate filament cytoskeleton (GO:0045111)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	bubble DNA binding (GO:0000405)|double-stranded DNA binding (GO:0003690)|endodeoxyribonuclease activity (GO:0004520)|endonuclease activity (GO:0004519)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|protein N-terminus binding (GO:0047485)|single-stranded DNA binding (GO:0003697)			breast(3)|central_nervous_system(1)|cervix(2)|endometrium(2)|kidney(4)|large_intestine(8)|lung(18)|ovary(5)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	51	all_neural(89;0.0438)|Medulloblastoma(90;0.163)|Lung SC(71;0.211)					CTCATGGGGGTCCAGGGGCTC	0.637			"""Mis, N, F"""			"""skin basal cell, skin squamous cell, melanoma"""		Nucleotide excision repair (NER)	Xeroderma Pigmentosum																												p.V3D		.	yes	Rec		Xeroderma pigmentosum (G)	13	13q33	2073	"""excision repair cross-complementing rodent repair deficiency, complementation group 5 (xeroderma pigmentosum, complementation group G (Cockayne syndrome))"""		E	.	ERCC5-689	0			c.T8A						.						28.0	30.0	30.0					13																	103498624		2203	4300	6503	SO:0001583	missense	2073	exon1	Familial Cancer Database	incl. XPA, XPB, XPC, XPD, XPE, XPF, XPG, XP Variant, XPV	TGGGGGTCCAGGG	X71342	CCDS32004.1	13q22-q34	2014-09-17	2014-03-07		ENSG00000134899	ENSG00000134899			3437	protein-coding gene	gene with protein product	"""Cockayne syndrome"""	133530	"""xeroderma pigmentosum, complementation group G"", ""excision repair cross-complementing rodent repair deficiency, complementation group 5"""	ERCM2, XPGC		8088806	Standard	NM_000123		Approved			P28715	OTTHUMG00000017310	ENST00000355739.4:c.8T>A	13.37:g.103498624T>A	ENSP00000347978:p.Val3Asp	Somatic	32	0		WXS	Illumina GAIIx	Phase_I	22	14	NM_000123	0	0	3	8	5	A6NGT4|Q5JUS4|Q5JUS5|Q7Z2V3|Q8IZL6|Q8N1B7|Q9HD59|Q9HD60	Missense_Mutation	SNP	ENST00000355739.4	37	CCDS32004.1	.	.	.	.	.	.	.	.	.	.	T	31	5.078337	0.94000	.	.	ENSG00000134899	ENST00000355739;ENST00000535557	T;T	0.71698	-0.59;-0.59	5.18	5.18	0.71444	XPG N-terminal (2);	0.184413	0.46758	D	0.000273	D	0.84456	0.5476	.	.	.	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.86886	0.2045	9	0.87932	D	0	-14.3441	15.2046	0.73169	0.0:0.0:0.0:1.0	.	3;3	B4DSI5;P28715	.;ERCC5_HUMAN	D	3	ENSP00000347978:V3D;ENSP00000442117:V3D	ENSP00000347978:V3D	V	+	2	0	ERCC5	102296625	1.000000	0.71417	0.992000	0.48379	0.944000	0.59088	7.410000	0.80065	2.171000	0.68590	0.533000	0.62120	GTC	.		0.637	ERCC5-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045708.1		
LRP10	26020	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	14	23345363	23345363	+	Silent	SNP	C	C	T			TCGA-OR-A5LL-01A-11D-A29I-10	TCGA-OR-A5LL-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9bfd4b2e-0577-4c94-8d6c-dafa9104b502	2d4f1606-9261-4ba8-96a9-ee307989af11	g.chr14:23345363C>T	ENST00000359591.4	+	5	1897	c.1206C>T	c.(1204-1206)ggC>ggT	p.G402G	LRP10_ENST00000546834.1_Silent_p.G402G	NM_014045.3	NP_054764.2	Q7Z4F1	LRP10_HUMAN	low density lipoprotein receptor-related protein 10	402	LDL-receptor class A 4. {ECO:0000255|PROSITE-ProRule:PRU00124}.				endocytosis (GO:0006897)	coated pit (GO:0005905)|integral component of membrane (GO:0016021)|membrane (GO:0016020)				central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|liver(2)|lung(7)|ovary(2)|prostate(2)|skin(5)|stomach(1)|urinary_tract(2)	32	all_cancers(95;4.69e-05)			GBM - Glioblastoma multiforme(265;0.00549)		GCCAGCCTGGCAATTTCCGAT	0.597																																					p.G402G		.											.	LRP10-90	0			c.C1206T						.						146.0	134.0	138.0					14																	23345363		2203	4300	6503	SO:0001819	synonymous_variant	26020	exon5			GCCTGGCAATTTC	AF131760	CCDS9578.1	14q11.2	2013-05-29			ENSG00000197324	ENSG00000197324		"""Low density lipoprotein receptors"""	14553	protein-coding gene	gene with protein product		609921				11123907	Standard	XM_005267510		Approved	DKFZP564C1940, MGC8675, LRP9, MST087, MSTP087	uc001whd.3	Q7Z4F1	OTTHUMG00000028705	ENST00000359591.4:c.1206C>T	14.37:g.23345363C>T		Somatic	68	0		WXS	Illumina GAIIx	Phase_I	71	9	NM_014045	0	0	68	77	9	A8K4R5|D3DS31|O95882|Q14CK7|Q86T02|Q8NCZ4|Q9HC42|Q9UG33	Silent	SNP	ENST00000359591.4	37	CCDS9578.1	.	.	.	.	.	.	.	.	.	.	C	8.305	0.820702	0.16678	.	.	ENSG00000197324	ENST00000551466	.	.	.	5.97	5.97	0.96955	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-27.8755	14.0852	0.64951	0.1507:0.8493:0.0:0.0	.	.	.	.	X	304	.	.	Q	+	1	0	LRP10	22415203	0.916000	0.31088	1.000000	0.80357	0.991000	0.79684	0.032000	0.13732	2.837000	0.97791	0.655000	0.94253	CAA	.		0.597	LRP10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000071663.3		
EXOC5	10640	bcgsc.ca	37	14	57714427	57714427	+	Missense_Mutation	SNP	G	G	T			TCGA-OR-A5LL-01A-11D-A29I-10	TCGA-OR-A5LL-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9bfd4b2e-0577-4c94-8d6c-dafa9104b502	2d4f1606-9261-4ba8-96a9-ee307989af11	g.chr14:57714427G>T	ENST00000413566.2	-	2	390	c.31C>A	c.(31-33)Cct>Act	p.P11T	EXOC5_ENST00000340918.7_Missense_Mutation_p.P11T|EXOC5_ENST00000556911.1_5'Flank	NM_006544.3	NP_006535.1	O00471	EXOC5_HUMAN	exocyst complex component 5	11					cellular protein metabolic process (GO:0044267)|exocytosis (GO:0006887)|membrane organization (GO:0061024)|post-Golgi vesicle-mediated transport (GO:0006892)|protein transport (GO:0015031)|vesicle docking (GO:0048278)	cytoplasm (GO:0005737)|cytosol (GO:0005829)				breast(3)|endometrium(1)|large_intestine(3)|lung(10)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)	22						GCCACAAAAGGCTCCTAGTTT	0.333																																					p.P11T		.											.	EXOC5-137	0			c.C31A						.						23.0	21.0	21.0					14																	57714427		1782	4053	5835	SO:0001583	missense	10640	exon2			CAAAAGGCTCCTA	U85946	CCDS45111.1	14q22.3	2013-01-22	2005-11-01	2005-11-01	ENSG00000070367	ENSG00000070367			10696	protein-coding gene	gene with protein product		604469	"""SEC10 (S. cerevisiae)-like 1"", ""SEC10-like 1 (S. cerevisiae)"""	SEC10L1		9119050	Standard	XM_005267272		Approved	SEC10, SEC10P	uc001xct.3	O00471	OTTHUMG00000171309	ENST00000413566.2:c.31C>A	14.37:g.57714427G>T	ENSP00000389934:p.Pro11Thr	Somatic	131	0		WXS	Illumina GAIIx	Phase_I	135	5	NM_006544	0	0	0	0	0	B2R6C5	Missense_Mutation	SNP	ENST00000413566.2	37	CCDS45111.1	.	.	.	.	.	.	.	.	.	.	G	18.84	3.708609	0.68615	.	.	ENSG00000070367	ENST00000413566;ENST00000340918	T;T	0.64085	-0.08;-0.08	5.26	5.26	0.73747	.	0.000000	0.85682	D	0.000000	T	0.66848	0.2831	M	0.64404	1.975	0.80722	D	1	P;P	0.37330	0.59;0.455	B;B	0.41036	0.346;0.188	T	0.70791	-0.4776	10	0.72032	D	0.01	-12.1402	19.2566	0.93948	0.0:0.0:1.0:0.0	.	11;11	F8W9B8;O00471	.;EXOC5_HUMAN	T	11	ENSP00000389934:P11T;ENSP00000342100:P11T	ENSP00000342100:P11T	P	-	1	0	EXOC5	56784180	1.000000	0.71417	1.000000	0.80357	0.956000	0.61745	9.100000	0.94213	2.628000	0.89032	0.585000	0.79938	CCT	.		0.333	EXOC5-001	KNOWN	upstream_uORF|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412905.1	NM_006544	
MTHFD1	4522	broad.mit.edu	37	14	64884686	64884686	+	Missense_Mutation	SNP	T	T	G			TCGA-OR-A5LL-01A-11D-A29I-10	TCGA-OR-A5LL-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9bfd4b2e-0577-4c94-8d6c-dafa9104b502	2d4f1606-9261-4ba8-96a9-ee307989af11	g.chr14:64884686T>G	ENST00000545908.1	+	7	956	c.727T>G	c.(727-729)Tgg>Ggg	p.W243G	MTHFD1_ENST00000216605.8_Missense_Mutation_p.W187G			P11586	C1TC_HUMAN	methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 1, methenyltetrahydrofolate cyclohydrolase, formyltetrahydrofolate synthetase	187	Methylenetetrahydrofolate dehydrogenase and cyclohydrolase.				folic acid metabolic process (GO:0046655)|folic acid-containing compound biosynthetic process (GO:0009396)|histidine biosynthetic process (GO:0000105)|methionine biosynthetic process (GO:0009086)|one-carbon metabolic process (GO:0006730)|purine nucleotide biosynthetic process (GO:0006164)|small molecule metabolic process (GO:0044281)|tetrahydrofolate interconversion (GO:0035999)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|formate-tetrahydrofolate ligase activity (GO:0004329)|methenyltetrahydrofolate cyclohydrolase activity (GO:0004477)|methylenetetrahydrofolate dehydrogenase (NADP+) activity (GO:0004488)|methylenetetrahydrofolate dehydrogenase [NAD(P)+] activity (GO:0004486)			endometrium(3)|kidney(2)|large_intestine(8)|lung(10)|ovary(2)|pancreas(1)|prostate(2)|skin(2)	30				OV - Ovarian serous cystadenocarcinoma(108;8.7e-12)|all cancers(60;3.29e-11)|BRCA - Breast invasive adenocarcinoma(234;0.0488)	Tetrahydrofolic acid(DB00116)	CTTGCTTCTGTGGAACAATGC	0.572																																					p.W187G	Colon(18;220 581 13419 18191 31512)|GBM(126;343 1658 28700 44425 52519)	.											.	MTHFD1-92	0			c.T559G						.						94.0	77.0	83.0					14																	64884686		2203	4300	6503	SO:0001583	missense	4522	exon7			CTTCTGTGGAACA	J04031	CCDS9763.1	14q24	2004-12-13			ENSG00000100714	ENSG00000100714	1.5.1.15, 3.5.4.-		7432	protein-coding gene	gene with protein product		172460		MTHFC, MTHFD		3053686, 2786332	Standard	NM_005956		Approved		uc001xhb.3	P11586	OTTHUMG00000141309	ENST00000545908.1:c.727T>G	14.37:g.64884686T>G	ENSP00000438588:p.Trp243Gly	Somatic	86	1		WXS	Illumina GAIIx	Phase_I	69	6	NM_005956	0	0	42	42	0	B2R5Y2|G3V2B8|Q86VC9|Q9BVP5	Missense_Mutation	SNP	ENST00000545908.1	37		.	.	.	.	.	.	.	.	.	.	T	12.24	1.877840	0.33162	.	.	ENSG00000100714	ENST00000545908;ENST00000555709;ENST00000216605;ENST00000555252	T;T;T;T	0.54675	0.56;0.56;0.56;0.56	5.17	5.17	0.71159	Tetrahydrofolate dehydrogenase/cyclohydrolase, NAD(P)-binding domain (1);NAD(P)-binding domain (1);	0.000000	0.85682	D	0.000000	T	0.48519	0.1504	L	0.58925	1.835	0.80722	D	1	B;B;P	0.45634	0.08;0.202;0.863	B;B;B	0.41088	0.015;0.065;0.347	T	0.46247	-0.9205	10	0.13108	T	0.6	-7.6928	15.0289	0.71691	0.0:0.0:0.0:1.0	.	243;187;187	F5H2F4;P11586;G3V2B8	.;C1TC_HUMAN;.	G	243;187;243;167	ENSP00000438588:W243G;ENSP00000450560:W187G;ENSP00000216605:W243G;ENSP00000451309:W167G	ENSP00000216605:W187G	W	+	1	0	MTHFD1	63954439	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	7.452000	0.80683	1.955000	0.56771	0.459000	0.35465	TGG	.		0.572	MTHFD1-002	NOVEL	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000412167.1		
ADAM21	8747	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	14	70926008	70926008	+	Silent	SNP	A	A	C			TCGA-OR-A5LL-01A-11D-A29I-10	TCGA-OR-A5LL-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9bfd4b2e-0577-4c94-8d6c-dafa9104b502	2d4f1606-9261-4ba8-96a9-ee307989af11	g.chr14:70926008A>C	ENST00000603540.1	+	2	2050	c.1792A>C	c.(1792-1794)Agg>Cgg	p.R598R	RP11-486O13.4_ENST00000556646.1_lincRNA|ADAM21_ENST00000267499.3_Silent_p.R598R	NM_003813.3	NP_003804.2	Q9UKJ8	ADA21_HUMAN	ADAM metallopeptidase domain 21	598	Cys-rich.				binding of sperm to zona pellucida (GO:0007339)|multicellular organism reproduction (GO:0032504)|single fertilization (GO:0007338)	axon (GO:0030424)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(1)|kidney(4)|large_intestine(10)|lung(10)|pancreas(1)|prostate(1)|skin(2)|stomach(1)	31				all cancers(60;0.00326)|BRCA - Breast invasive adenocarcinoma(234;0.00646)|OV - Ovarian serous cystadenocarcinoma(108;0.0401)		CTATCATTTAAGGATGAACAT	0.423																																					p.R598R		.											.	ADAM21-92	0			c.A1792C						.						151.0	138.0	143.0					14																	70926008		2203	4300	6503	SO:0001819	synonymous_variant	8747	exon2			CATTTAAGGATGA	AF029900	CCDS9804.1	14q24.1	2008-09-05	2005-08-18		ENSG00000139985	ENSG00000139985		"""ADAM metallopeptidase domain containing"""	200	protein-coding gene	gene with protein product		603713	"""a disintegrin and metalloproteinase domain 21"""			9469942	Standard	NM_003813		Approved	ADAM31	uc001xmd.3	Q9UKJ8		ENST00000603540.1:c.1792A>C	14.37:g.70926008A>C		Somatic	363	1		WXS	Illumina GAIIx	Phase_I	313	146	NM_003813	0	0	0	0	0	O43507|Q2VPC6|Q32MR0	Silent	SNP	ENST00000603540.1	37	CCDS9804.1																																																																																			.		0.423	ADAM21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000413008.3		
FAM161B	145483	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	14	74411292	74411292	+	Missense_Mutation	SNP	T	T	A			TCGA-OR-A5LL-01A-11D-A29I-10	TCGA-OR-A5LL-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9bfd4b2e-0577-4c94-8d6c-dafa9104b502	2d4f1606-9261-4ba8-96a9-ee307989af11	g.chr14:74411292T>A	ENST00000534936.1	-	3	776	c.671A>T	c.(670-672)cAt>cTt	p.H224L	FAM161B_ENST00000286544.3_Missense_Mutation_p.H287L			Q96MY7	F161B_HUMAN	family with sequence similarity 161, member B	224										breast(3)|central_nervous_system(2)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(5)|ovary(1)|prostate(2)|skin(2)	21						CAGGTAGACATGTGCAGGCAC	0.617																																					p.H287L		.											.	FAM161B-91	0			c.A860T						.						48.0	49.0	48.0					14																	74411292		2203	4300	6503	SO:0001583	missense	145483	exon3			TAGACATGTGCAG	AA356453	CCDS9822.1, CCDS9822.2	14q24.2	2008-06-05	2008-06-05	2008-06-05		ENSG00000156050			19854	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 44"""	C14orf44			Standard	NM_152445		Approved	FLJ31697	uc001xpd.3	Q96MY7		ENST00000534936.1:c.671A>T	14.37:g.74411292T>A	ENSP00000445326:p.His224Leu	Somatic	79	0		WXS	Illumina GAIIx	Phase_I	65	27	NM_152445	0	0	1	3	2	B7Z882|J3KNA2	Missense_Mutation	SNP	ENST00000534936.1	37		.	.	.	.	.	.	.	.	.	.	T	26.1	4.708333	0.89018	.	.	ENSG00000156050	ENST00000286544;ENST00000534936	T;T	0.21932	1.98;1.98	5.26	5.26	0.73747	.	0.155316	0.44902	D	0.000407	T	0.48822	0.1521	M	0.80616	2.505	0.58432	D	0.999995	D	0.89917	1.0	D	0.77557	0.99	T	0.51387	-0.8712	10	0.51188	T	0.08	-16.7414	15.3487	0.74363	0.0:0.0:0.0:1.0	.	224	Q96MY7	F161B_HUMAN	L	287;224	ENSP00000286544:H287L;ENSP00000445326:H224L	ENSP00000286544:H287L	H	-	2	0	FAM161B	73481045	1.000000	0.71417	0.561000	0.28357	0.995000	0.86356	7.513000	0.81739	2.208000	0.71279	0.460000	0.39030	CAT	.		0.617	FAM161B-201	KNOWN	basic|appris_candidate	protein_coding	protein_coding		NM_152445	
CEP152	22995	hgsc.bcm.edu	37	15	49034286	49034286	+	Missense_Mutation	SNP	G	G	T			TCGA-OR-A5LL-01A-11D-A29I-10	TCGA-OR-A5LL-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9bfd4b2e-0577-4c94-8d6c-dafa9104b502	2d4f1606-9261-4ba8-96a9-ee307989af11	g.chr15:49034286G>T	ENST00000380950.2	-	25	4034	c.3847C>A	c.(3847-3849)Cgt>Agt	p.R1283S	CEP152_ENST00000325747.5_Missense_Mutation_p.R1190S|CEP152_ENST00000399334.3_Missense_Mutation_p.R1227S	NM_001194998.1|NM_014985.3	NP_001181927.1|NP_055800.2	O94986	CE152_HUMAN	centrosomal protein 152kDa	1283					cell projection organization (GO:0030030)|centriole replication (GO:0007099)|centrosome duplication (GO:0051298)|de novo centriole assembly (GO:0098535)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)	centrosome (GO:0005813)|cytosol (GO:0005829)|deuterosome (GO:0098536)|nucleus (GO:0005634)	protein kinase binding (GO:0019901)	p.R1227C(1)		breast(3)|cervix(3)|endometrium(3)|kidney(3)|large_intestine(16)|lung(30)|ovary(1)|prostate(2)|skin(2)	63		all_lung(180;0.0428)		all cancers(107;1.08e-07)|GBM - Glioblastoma multiforme(94;2.32e-06)		TGAATATAACGAAGCATGTCA	0.418																																					p.R1283S		.											.	CEP152-70	1	Substitution - Missense(1)	large_intestine(1)	c.C3847A						.						130.0	114.0	119.0					15																	49034286		1873	4112	5985	SO:0001583	missense	22995	exon25			TATAACGAAGCAT	AB020719	CCDS42033.1, CCDS58361.1	15q21.1	2014-02-20							29298	protein-coding gene	gene with protein product	"""asterless"""	613529	"""microcephaly, primary autosomal recessive 4"""	MCPH4		14654843, 21131973	Standard	NM_014985		Approved	KIAA0912, SCKL5	uc001zwz.3	O94986		ENST00000380950.2:c.3847C>A	15.37:g.49034286G>T	ENSP00000370337:p.Arg1283Ser	Somatic	66	0		WXS	Illumina GAIIx	Phase_I	75	4	NM_001194998	0	0	0	0	0	E7ER66|Q17RV1|Q6NTA0	Missense_Mutation	SNP	ENST00000380950.2	37	CCDS58361.1	.	.	.	.	.	.	.	.	.	.	G	21.6	4.171878	0.78452	.	.	ENSG00000103995	ENST00000380950;ENST00000325747;ENST00000399334	T;T;T	0.56611	0.46;0.53;0.45	6.03	5.1	0.69264	.	0.137636	0.48767	D	0.000162	T	0.67392	0.2888	M	0.65498	2.005	0.50632	D	0.999886	D;D;D	0.76494	0.999;0.999;0.999	D;D;D	0.68353	0.957;0.957;0.957	T	0.69049	-0.5248	10	0.52906	T	0.07	-6.8434	11.0386	0.47816	0.0737:0.1314:0.795:0.0	.	1190;1283;1227	O94986-1;E7ER66;O94986	.;.;CE152_HUMAN	S	1283;1190;1227	ENSP00000370337:R1283S;ENSP00000321000:R1190S;ENSP00000382271:R1227S	ENSP00000321000:R1190S	R	-	1	0	CEP152	46821578	1.000000	0.71417	0.997000	0.53966	0.988000	0.76386	3.784000	0.55416	1.536000	0.49237	0.655000	0.94253	CGT	.		0.418	CEP152-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000417365.1	NM_014985	
PML	5371	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	15	74335395	74335395	+	Silent	SNP	C	C	T			TCGA-OR-A5LL-01A-11D-A29I-10	TCGA-OR-A5LL-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9bfd4b2e-0577-4c94-8d6c-dafa9104b502	2d4f1606-9261-4ba8-96a9-ee307989af11	g.chr15:74335395C>T	ENST00000268058.3	+	8	1872	c.1776C>T	c.(1774-1776)acC>acT	p.T592T	PML_ENST00000565898.1_Silent_p.T544T|PML_ENST00000569965.1_3'UTR|PML_ENST00000395135.3_Silent_p.T592T|PML_ENST00000359928.4_3'UTR|PML_ENST00000564428.1_Silent_p.T544T	NM_033238.2	NP_150241.2	P29590	PML_HUMAN	promyelocytic leukemia	592					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|apoptotic process (GO:0006915)|branching involved in mammary gland duct morphogenesis (GO:0060444)|cell cycle arrest (GO:0007050)|cell fate commitment (GO:0045165)|cellular response to interleukin-4 (GO:0071353)|cellular senescence (GO:0090398)|circadian regulation of gene expression (GO:0032922)|common-partner SMAD protein phosphorylation (GO:0007182)|cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|endoplasmic reticulum calcium ion homeostasis (GO:0032469)|entrainment of circadian clock by photoperiod (GO:0043153)|extrinsic apoptotic signaling pathway (GO:0097191)|innate immune response (GO:0045087)|interferon-gamma-mediated signaling pathway (GO:0060333)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|intrinsic apoptotic signaling pathway in response to endoplasmic reticulum stress (GO:0070059)|intrinsic apoptotic signaling pathway in response to oxidative stress (GO:0008631)|maintenance of protein location in nucleus (GO:0051457)|myeloid cell differentiation (GO:0030099)|negative regulation of angiogenesis (GO:0016525)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of mitotic cell cycle (GO:0045930)|negative regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000059)|negative regulation of telomerase activity (GO:0051974)|negative regulation of telomere maintenance via telomerase (GO:0032211)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of translation in response to oxidative stress (GO:0032938)|negative regulation of viral release from host cell (GO:1902187)|PML body organization (GO:0030578)|positive regulation of apoptotic process involved in mammary gland involution (GO:0060058)|positive regulation of defense response to virus by host (GO:0002230)|positive regulation of extrinsic apoptotic signaling pathway (GO:2001238)|positive regulation of histone deacetylation (GO:0031065)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein complex assembly (GO:0006461)|protein stabilization (GO:0050821)|protein targeting (GO:0006605)|regulation of calcium ion transport into cytosol (GO:0010522)|regulation of circadian rhythm (GO:0042752)|regulation of double-strand break repair (GO:2000779)|regulation of MHC class I biosynthetic process (GO:0045343)|regulation of protein phosphorylation (GO:0001932)|regulation of transcription, DNA-templated (GO:0006355)|response to cytokine (GO:0034097)|response to gamma radiation (GO:0010332)|response to hypoxia (GO:0001666)|response to UV (GO:0009411)|retinoic acid receptor signaling pathway (GO:0048384)|SMAD protein import into nucleus (GO:0007184)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endosome (GO:0005768)|extrinsic component of endoplasmic reticulum membrane (GO:0042406)|nuclear matrix (GO:0016363)|nuclear membrane (GO:0031965)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)	cobalt ion binding (GO:0050897)|DNA binding (GO:0003677)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|SUMO binding (GO:0032183)|transcription coactivator activity (GO:0003713)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(2)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(6)|lung(8)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	31						GCCCCAGCACCCTCAGGGTCC	0.552			T	"""RARA, PAX5"""	"""APL, ALL"""																																p.T592T		.		Dom	yes		15	15q22	5371	promyelocytic leukemia		L	.	PML-1083	0			c.C1776T						.						101.0	99.0	99.0					15																	74335395		2198	4297	6495	SO:0001819	synonymous_variant	5371	exon8			CAGCACCCTCAGG	AB208950	CCDS10255.1, CCDS10256.1, CCDS10257.1, CCDS10258.1, CCDS45297.1, CCDS45298.1, CCDS45299.1, CCDS45300.1, CCDS58386.1	15q24.1	2011-04-21			ENSG00000140464	ENSG00000140464		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	9113	protein-coding gene	gene with protein product		102578					Standard	NM_033244		Approved	MYL, TRIM19, RNF71	uc002awv.3	P29590	OTTHUMG00000137607	ENST00000268058.3:c.1776C>T	15.37:g.74335395C>T		Somatic	94	0		WXS	Illumina GAIIx	Phase_I	75	9	NM_002675	0	0	0	1	1	E9PBR7|P29591|P29592|P29593|Q00755|Q15959|Q59FP9|Q8WUA0|Q96S41|Q9BPW2|Q9BWP7|Q9BZX6|Q9BZX7|Q9BZX8|Q9BZX9|Q9BZY0|Q9BZY2|Q9BZY3	Silent	SNP	ENST00000268058.3	37	CCDS10255.1																																																																																			.		0.552	PML-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269021.3	NM_002675	
LRRK1	79705	broad.mit.edu	37	15	101528910	101528910	+	Missense_Mutation	SNP	G	G	T			TCGA-OR-A5LL-01A-11D-A29I-10	TCGA-OR-A5LL-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9bfd4b2e-0577-4c94-8d6c-dafa9104b502	2d4f1606-9261-4ba8-96a9-ee307989af11	g.chr15:101528910G>T	ENST00000388948.3	+	5	864	c.505G>T	c.(505-507)Gtg>Ttg	p.V169L	LRRK1_ENST00000532029.2_Missense_Mutation_p.V169L|LRRK1_ENST00000284395.5_Missense_Mutation_p.V166L	NM_024652.3	NP_078928.3			leucine-rich repeat kinase 1											breast(2)|central_nervous_system(6)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(14)|lung(25)|ovary(4)|prostate(1)|skin(1)	72	Melanoma(26;0.00505)|Lung NSC(78;0.00793)|all_lung(78;0.0094)		OV - Ovarian serous cystadenocarcinoma(32;0.000932)|LUSC - Lung squamous cell carcinoma(107;0.187)|Lung(145;0.23)			CCTGGGGGTTGTGAAGCTCCT	0.622																																					p.V169L		.											.	LRRK1-602	0			c.G505T						.						67.0	72.0	71.0					15																	101528910		2036	4174	6210	SO:0001583	missense	79705	exon5			GGGGTTGTGAAGC	AB058693	CCDS42086.1	15q26.3	2007-01-29			ENSG00000154237	ENSG00000154237			18608	protein-coding gene	gene with protein product		610986				11347906, 14654223	Standard	XM_005254979		Approved	FLJ23119, KIAA1790, Roco1, RIPK6	uc002bwr.3	Q38SD2	OTTHUMG00000165514	ENST00000388948.3:c.505G>T	15.37:g.101528910G>T	ENSP00000373600:p.Val169Leu	Somatic	82	0		WXS	Illumina GAIIx	Phase_I	52	3	NM_024652	0	0	0	0	0		Missense_Mutation	SNP	ENST00000388948.3	37	CCDS42086.1	.	.	.	.	.	.	.	.	.	.	G	23.0	4.365025	0.82463	.	.	ENSG00000154237	ENST00000388948;ENST00000284395;ENST00000532029	T;T;T	0.71579	-0.58;0.27;-0.58	5.5	5.5	0.81552	Ankyrin repeat-containing domain (4);	0.000000	0.64402	D	0.000002	D	0.82981	0.5155	M	0.62266	1.93	0.58432	D	0.99999	P;D	0.89917	0.794;1.0	B;D	0.83275	0.372;0.996	D	0.83966	0.0324	10	0.66056	D	0.02	.	18.3807	0.90449	0.0:0.0:1.0:0.0	.	169;169	Q38SD2;Q38SD2-2	LRRK1_HUMAN;.	L	169;166;169	ENSP00000373600:V169L;ENSP00000284395:V166L;ENSP00000433268:V169L	ENSP00000284395:V166L	V	+	1	0	LRRK1	99346433	1.000000	0.71417	0.968000	0.41197	0.378000	0.30076	8.284000	0.89912	2.591000	0.87537	0.650000	0.86243	GTG	.		0.622	LRRK1-003	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000384567.2	NM_024652	
CCNF	899	broad.mit.edu;ucsc.edu;bcgsc.ca	37	16	2506732	2506732	+	Missense_Mutation	SNP	G	G	A	rs148419125	byFrequency	TCGA-OR-A5LL-01A-11D-A29I-10	TCGA-OR-A5LL-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9bfd4b2e-0577-4c94-8d6c-dafa9104b502	2d4f1606-9261-4ba8-96a9-ee307989af11	g.chr16:2506732G>A	ENST00000397066.4	+	17	2160	c.2072G>A	c.(2071-2073)cGg>cAg	p.R691Q	RP11-715J22.4_ENST00000566085.1_lincRNA	NM_001761.2	NP_001752.2	P41002	CCNF_HUMAN	cyclin F	691	PEST.				mitotic nuclear division (GO:0007067)|negative regulation of centrosome duplication (GO:0010826)|placenta development (GO:0001890)|protein ubiquitination (GO:0016567)|re-entry into mitotic cell cycle (GO:0000320)|SCF-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031146)	centriole (GO:0005814)|nucleus (GO:0005634)|SCF ubiquitin ligase complex (GO:0019005)				breast(3)|central_nervous_system(1)|kidney(4)|large_intestine(2)|lung(5)|prostate(4)|skin(1)	20		Ovarian(90;0.17)				CGCACCAGCCGGGAGCCAGGG	0.672													G|||	2	0.000399361	0.0	0.0	5008	,	,		20909	0.001		0.001	False		,,,				2504	0.0				p.R691Q		.											.	CCNF-658	0			c.G2072A						.	G	GLN/ARG	0,4396		0,0,2198	67.0	60.0	63.0		2072	-1.8	0.0	16	dbSNP_134	63	4,8596	3.7+/-12.6	0,4,4296	yes	missense	CCNF	NM_001761.2	43	0,4,6494	AA,AG,GG		0.0465,0.0,0.0308	benign	691/787	2506732	4,12992	2198	4300	6498	SO:0001583	missense	899	exon17			CCAGCCGGGAGCC	Z36714	CCDS10467.1	16p13.3	2008-02-05			ENSG00000162063	ENSG00000162063		"""F-boxes /  ""other"""""	1591	protein-coding gene	gene with protein product		600227				7896286	Standard	NM_001761		Approved	FBX1, FBXO1	uc002cqd.1	P41002	OTTHUMG00000128858	ENST00000397066.4:c.2072G>A	16.37:g.2506732G>A	ENSP00000380256:p.Arg691Gln	Somatic	127	1		WXS	Illumina GAIIx	Phase_I	145	31	NM_001761	0	0	2	2	0	B2R8H3|Q96EG9	Missense_Mutation	SNP	ENST00000397066.4	37	CCDS10467.1	1	4.578754578754579E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	G	7.872	0.728457	0.15507	0.0	4.65E-4	ENSG00000162063	ENST00000397066;ENST00000293968	T	0.25749	1.78	5.43	-1.84	0.07809	.	1.194080	0.05811	N	0.613964	T	0.16938	0.0407	L	0.34521	1.04	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.32981	-0.9886	10	0.13470	T	0.59	-3.2634	7.2658	0.26229	0.2316:0.3572:0.4112:0.0	.	691	P41002	CCNF_HUMAN	Q	691;606	ENSP00000380256:R691Q	ENSP00000293968:R606Q	R	+	2	0	CCNF	2446733	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-0.128000	0.10531	-0.929000	0.03757	-2.481000	0.00198	CGG	G|1.000;A|0.000		0.672	CCNF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250801.1	NM_001761	
DNAH3	55567	broad.mit.edu	37	16	20966303	20966303	+	Missense_Mutation	SNP	G	G	T	rs148915896	byFrequency	TCGA-OR-A5LL-01A-11D-A29I-10	TCGA-OR-A5LL-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9bfd4b2e-0577-4c94-8d6c-dafa9104b502	2d4f1606-9261-4ba8-96a9-ee307989af11	g.chr16:20966303G>T	ENST00000261383.3	-	55	10902	c.10903C>A	c.(10903-10905)Ccc>Acc	p.P3635T	DNAH3_ENST00000415178.1_3'UTR	NM_017539.1	NP_060009.1	Q8TD57	DYH3_HUMAN	dynein, axonemal, heavy chain 3	3635	AAA 6. {ECO:0000250}.				cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|microtubule motor activity (GO:0003777)			NS(3)|autonomic_ganglia(1)|breast(12)|central_nervous_system(3)|cervix(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(4)|kidney(10)|large_intestine(42)|liver(2)|lung(57)|ovary(14)|pancreas(1)|prostate(7)|skin(11)|stomach(5)|upper_aerodigestive_tract(7)|urinary_tract(6)	202				GBM - Glioblastoma multiforme(48;0.207)		CCTTTGGGGGGCTCATTGGTC	0.517																																					p.P3635T		.											.	DNAH3-167	0			c.C10903A						.						104.0	103.0	103.0					16																	20966303		2201	4300	6501	SO:0001583	missense	55567	exon55			TGGGGGGCTCATT	U83574	CCDS10594.1	16p12.2	2008-08-01	2006-09-04		ENSG00000158486	ENSG00000158486		"""Axonemal dyneins"""	2949	protein-coding gene	gene with protein product		603334	"""dynein, axonemal, heavy polypeptide 3"""			9256245, 9373155	Standard	NM_017539		Approved	Dnahc3b, DLP3, Hsadhc3, DKFZp434N074	uc010vbe.2	Q8TD57	OTTHUMG00000090677	ENST00000261383.3:c.10903C>A	16.37:g.20966303G>T	ENSP00000261383:p.Pro3635Thr	Somatic	60	0		WXS	Illumina GAIIx	Phase_I	70	3	NM_017539	0	0	0	0	0	O00437|O15437|O43326|Q3C0H2|Q8WUP9|Q9UEM3|Q9UEM5|Q9UG35	Missense_Mutation	SNP	ENST00000261383.3	37	CCDS10594.1	.	.	.	.	.	.	.	.	.	.	G	27.4	4.830347	0.91036	.	.	ENSG00000158486	ENST00000261383	T	0.15139	2.45	5.43	5.43	0.79202	Dynein heavy chain (1);	0.000000	0.85682	D	0.000000	T	0.62122	0.2402	H	0.98314	4.2	0.80722	D	1	D	0.89917	1.0	D	0.78314	0.991	T	0.78811	-0.2057	10	0.87932	D	0	.	19.2436	0.93893	0.0:0.0:1.0:0.0	.	3635	Q8TD57	DYH3_HUMAN	T	3635	ENSP00000261383:P3635T	ENSP00000261383:P3635T	P	-	1	0	DNAH3	20873804	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.817000	0.99352	2.543000	0.85770	0.655000	0.94253	CCC	G|1.000;A|0.000		0.517	DNAH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207361.1	NM_017539	
ZFPM1	161882	broad.mit.edu	37	16	88599696	88599697	+	Frame_Shift_Del	DEL	GA	GA	-	rs368520732|rs67712719	byFrequency	TCGA-OR-A5LL-01A-11D-A29I-10	TCGA-OR-A5LL-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9bfd4b2e-0577-4c94-8d6c-dafa9104b502	2d4f1606-9261-4ba8-96a9-ee307989af11	g.chr16:88599696_88599697delGA	ENST00000319555.3	+	10	1652_1653	c.1330_1331delGA	c.(1330-1332)gagfs	p.E444fs	RP11-21B21.4_ENST00000563243.1_RNA	NM_153813.2	NP_722520.2	Q8IX07	FOG1_HUMAN	zinc finger protein, FOG family member 1	444				EPLA -> AP (in Ref. 1; AAN45858). {ECO:0000305}.	atrial septum morphogenesis (GO:0060413)|atrioventricular valve morphogenesis (GO:0003181)|blood coagulation (GO:0007596)|cardiac muscle tissue morphogenesis (GO:0055008)|definitive erythrocyte differentiation (GO:0060318)|embryonic hemopoiesis (GO:0035162)|erythrocyte differentiation (GO:0030218)|granulocyte differentiation (GO:0030851)|megakaryocyte development (GO:0035855)|megakaryocyte differentiation (GO:0030219)|mitral valve formation (GO:0003192)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of interleukin-4 biosynthetic process (GO:0045403)|negative regulation of mast cell differentiation (GO:0060377)|negative regulation of protein binding (GO:0032091)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|outflow tract morphogenesis (GO:0003151)|platelet formation (GO:0030220)|positive regulation of interferon-gamma biosynthetic process (GO:0045078)|primitive erythrocyte differentiation (GO:0060319)|regulation of chemokine production (GO:0032642)|regulation of definitive erythrocyte differentiation (GO:0010724)|T-helper cell lineage commitment (GO:0002295)|transcriptional activation by promoter-enhancer looping (GO:0071733)|tricuspid valve formation (GO:0003195)|ventricular septum morphogenesis (GO:0060412)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|transcription factor complex (GO:0005667)|transcriptional repressor complex (GO:0017053)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II transcription factor binding (GO:0001085)|transcription factor binding (GO:0008134)			central_nervous_system(1)|ovary(2)|urinary_tract(1)	4				BRCA - Breast invasive adenocarcinoma(80;0.0478)		GGCCAGAGCGGAGCCTCTGGCC	0.743														4881	0.974641	0.9138	0.9914	5008	,	,		7261	0.996		1.0	False		,,,				2504	0.9969				p.444_444del	Pancreas(49;850 1106 29641 32847 38344)	.											.	ZFPM1-90	0			c.1330_1331del						.			2219,383		1063,93,145						-6.5	0.0		dbSNP_130	3	4709,133		2339,31,51	no	frameshift	ZFPM1	NM_153813.2		3402,124,196	A1A1,A1R,RR		2.7468,14.7194,6.9318				6928,516				SO:0001589	frameshift_variant	161882	exon10			AGAGCGGAGCCTC	AF488691	CCDS32502.1	16q24.2	2013-01-10	2012-11-27		ENSG00000179588	ENSG00000179588		"""Zinc fingers, C2H2-type"", ""Zinc fingers, C2HC-type containing"""	19762	protein-coding gene	gene with protein product		601950	"""zinc finger protein, multitype 1"""				Standard	NM_153813		Approved	FOG1, FOG, ZNF89A, ZC2HC11A	uc002fkv.3	Q8IX07	OTTHUMG00000173152	ENST00000319555.3:c.1330_1331delGA	16.37:g.88599696_88599697delGA	ENSP00000326630:p.Glu444fs	Somatic	5	0		WXS	Illumina GAIIx	Phase_I	15	9	NM_153813	0	0	0	0	0		Frame_Shift_Del	DEL	ENST00000319555.3	37	CCDS32502.1																																																																																			.		0.743	ZFPM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000422270.2		
NLRP1	22861	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	5424256	5424256	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5LL-01A-11D-A29I-10	TCGA-OR-A5LL-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9bfd4b2e-0577-4c94-8d6c-dafa9104b502	2d4f1606-9261-4ba8-96a9-ee307989af11	g.chr17:5424256C>T	ENST00000572272.1	-	14	3859	c.3860G>A	c.(3859-3861)gGc>gAc	p.G1287D	NLRP1_ENST00000262467.5_Missense_Mutation_p.G1291D|NLRP1_ENST00000269280.4_Intron|NLRP1_ENST00000345221.3_Intron|NLRP1_ENST00000354411.3_Missense_Mutation_p.G1257D|NLRP1_ENST00000577119.1_Intron			Q9C000	NALP1_HUMAN	NLR family, pyrin domain containing 1	1287					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|apoptotic process (GO:0006915)|defense response to bacterium (GO:0042742)|innate immune response (GO:0045087)|neuron apoptotic process (GO:0051402)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|positive regulation of interleukin-1 beta secretion (GO:0050718)|regulation of inflammatory response (GO:0050727)|response to muramyl dipeptide (GO:0032495)	cytosol (GO:0005829)|intracellular (GO:0005622)|NLRP1 inflammasome complex (GO:0072558)|nucleus (GO:0005634)	ATP binding (GO:0005524)|cysteine-type endopeptidase activator activity involved in apoptotic process (GO:0008656)|enzyme binding (GO:0019899)|protein domain specific binding (GO:0019904)	p.G1287D(2)|p.G1291D(1)		breast(4)|central_nervous_system(1)|cervix(1)|endometrium(7)|kidney(2)|large_intestine(17)|liver(5)|lung(17)|ovary(1)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	65		Colorectal(1115;3.48e-05)				GTAACGACAGCCCATATAAAG	0.498																																					p.G1291D		.											.	NLRP1-274	3	Substitution - Missense(3)	lung(3)	c.G3872A						.						84.0	72.0	76.0					17																	5424256		2203	4300	6503	SO:0001583	missense	22861	exon14			CGACAGCCCATAT	AB023143	CCDS32537.1, CCDS42244.1, CCDS42245.1, CCDS42246.1, CCDS58508.1	17p13	2014-01-29	2006-12-08	2006-12-08	ENSG00000091592	ENSG00000091592		"""Nucleotide-binding domain and leucine rich repeat containing"""	14374	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 1"""	606636	"""NACHT, leucine rich repeat and PYD (pyrin domain) containing 1"", ""systemic lupus erythematosus, vitiligo-related 1"""	NALP1, SLEV1		8781126, 12563287, 17377159	Standard	NM_033006		Approved	KIAA0926, DKFZp586O1822, CARD7, NAC, CLR17.1, DEFCAP, VAMAS1	uc002gci.3	Q9C000		ENST00000572272.1:c.3860G>A	17.37:g.5424256C>T	ENSP00000460475:p.Gly1287Asp	Somatic	46	0		WXS	Illumina GAIIx	Phase_I	24	21	NM_001033053	0	0	0	0	0	E9PE50|I6L9D9|Q9BZZ8|Q9BZZ9|Q9H5Z7|Q9H5Z8|Q9HAV8|Q9UFT4|Q9Y2E0	Missense_Mutation	SNP	ENST00000572272.1	37	CCDS42246.1	.	.	.	.	.	.	.	.	.	.	C	16.27	3.075573	0.55646	.	.	ENSG00000091592	ENST00000544378;ENST00000262467;ENST00000269280;ENST00000354411	T;T;T;T	0.42900	0.96;0.96;2.27;0.96	4.59	3.62	0.41486	.	0.000000	0.39544	N	0.001337	T	0.60314	0.2259	M	0.73598	2.24	0.23449	N	0.997657	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	T	0.51419	-0.8708	10	0.87932	D	0	.	8.7769	0.34767	0.0:0.8965:0.0:0.1035	.	1257;1287;1291	Q9C000-4;Q9C000;E9PE50	.;NALP1_HUMAN;.	D	1291;1291;1287;1257	ENSP00000442029:G1291D;ENSP00000262467:G1291D;ENSP00000269280:G1287D;ENSP00000346390:G1257D	ENSP00000262467:G1291D	G	-	2	0	NLRP1	5364980	0.999000	0.42202	0.026000	0.17262	0.011000	0.07611	3.327000	0.52045	1.303000	0.44873	0.644000	0.83932	GGC	.		0.498	NLRP1-011	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000439517.1	NM_033004	
MFSD6L	162387	hgsc.bcm.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	8702218	8702218	+	Missense_Mutation	SNP	C	C	T	rs111726322	byFrequency	TCGA-OR-A5LL-01A-11D-A29I-10	TCGA-OR-A5LL-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9bfd4b2e-0577-4c94-8d6c-dafa9104b502	2d4f1606-9261-4ba8-96a9-ee307989af11	g.chr17:8702218C>T	ENST00000329805.4	-	1	449	c.221G>A	c.(220-222)cGg>cAg	p.R74Q		NM_152599.3	NP_689812.3	Q8IWD5	MFS6L_HUMAN	major facilitator superfamily domain containing 6-like	74						integral component of membrane (GO:0016021)				central_nervous_system(1)|endometrium(1)|kidney(3)|large_intestine(1)|lung(7)|skin(4)	17						TCTCCTTTTCCGGTAGCTTTT	0.632													C|||	3	0.000599042	0.0023	0.0	5008	,	,		15531	0.0		0.0	False		,,,				2504	0.0				p.R74Q		.											.	MFSD6L-90	0			c.G221A						.						56.0	63.0	60.0					17																	8702218		2203	4300	6503	SO:0001583	missense	162387	exon1			CTTTTCCGGTAGC	AK093092	CCDS11146.1	17p13.1	2014-05-30			ENSG00000185156	ENSG00000185156			26656	protein-coding gene	gene with protein product							Standard	NM_152599		Approved	FLJ35773	uc002glp.2	Q8IWD5	OTTHUMG00000178584	ENST00000329805.4:c.221G>A	17.37:g.8702218C>T	ENSP00000330051:p.Arg74Gln	Somatic	83	0		WXS	Illumina GAIIx	Phase_I	67	20	NM_152599	0	0	0	0	0	Q6YL34|Q8NA76	Missense_Mutation	SNP	ENST00000329805.4	37	CCDS11146.1	.	.	.	.	.	.	.	.	.	.	C	5.972	0.363228	0.11296	.	.	ENSG00000185156	ENST00000329805	T	0.80824	-1.42	4.71	2.28	0.28536	Major facilitator superfamily domain, general substrate transporter (1);	0.524413	0.18914	N	0.127676	T	0.51550	0.1681	N	0.02721	-0.515	0.25505	N	0.987519	B	0.14805	0.011	B	0.09377	0.004	T	0.38757	-0.9646	10	0.08179	T	0.78	-7.178	6.9943	0.24774	0.0:0.3233:0.0:0.6767	.	74	Q8IWD5	MFS6L_HUMAN	Q	74	ENSP00000330051:R74Q	ENSP00000330051:R74Q	R	-	2	0	MFSD6L	8642943	1.000000	0.71417	0.998000	0.56505	0.707000	0.40811	0.638000	0.24674	0.238000	0.21222	-0.345000	0.07892	CGG	C|0.986;A|0.014		0.632	MFSD6L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000442554.1	NM_152599	
MYH3	4621	ucsc.edu;bcgsc.ca	37	17	10551910	10551910	+	Silent	SNP	G	G	A	rs16943604	byFrequency	TCGA-OR-A5LL-01A-11D-A29I-10	TCGA-OR-A5LL-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9bfd4b2e-0577-4c94-8d6c-dafa9104b502	2d4f1606-9261-4ba8-96a9-ee307989af11	g.chr17:10551910G>A	ENST00000583535.1	-	8	786	c.699C>T	c.(697-699)aaC>aaT	p.N233N	MYH3_ENST00000226209.7_Silent_p.N233N	NM_002470.3	NP_002461.2	P11055	MYH3_HUMAN	myosin, heavy chain 3, skeletal muscle, embryonic	233	Myosin motor.				actin filament-based movement (GO:0030048)|ATP catabolic process (GO:0006200)|embryonic limb morphogenesis (GO:0030326)|face morphogenesis (GO:0060325)|muscle filament sliding (GO:0030049)|muscle organ development (GO:0007517)|sarcomere organization (GO:0045214)|skeletal muscle contraction (GO:0003009)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|muscle myosin complex (GO:0005859)|myosin filament (GO:0032982)|sarcomere (GO:0030017)	actin filament binding (GO:0051015)|ATP binding (GO:0005524)|ATPase activity, coupled (GO:0042623)|calmodulin binding (GO:0005516)|microfilament motor activity (GO:0000146)			breast(2)|central_nervous_system(2)|cervix(1)|endometrium(8)|kidney(5)|large_intestine(18)|lung(30)|ovary(4)|pancreas(1)|prostate(4)|skin(2)|upper_aerodigestive_tract(5)|urinary_tract(1)	83						CAGTCTTGGCGTTCCCAAAGG	0.453													G|||	62	0.0123802	0.0333	0.0115	5008	,	,		19056	0.0		0.003	False		,,,				2504	0.0072				p.N233N		.											.	MYH3-95	0			c.C699T						.	G		127,4279	93.4+/-132.2	4,119,2080	128.0	124.0	125.0		699	-6.8	0.8	17	dbSNP_123	125	43,8557	28.5+/-78.6	0,43,4257	no	coding-synonymous	MYH3	NM_002470.3		4,162,6337	AA,AG,GG		0.5,2.8824,1.3071		233/1941	10551910	170,12836	2203	4300	6503	SO:0001819	synonymous_variant	4621	exon8			CTTGGCGTTCCCA		CCDS11157.1	17p13.1	2013-09-19	2006-09-29		ENSG00000109063	ENSG00000109063		"""Myosins / Myosin superfamily : Class II"""	7573	protein-coding gene	gene with protein product	"""myosin, skeletal, heavy chain, embryonic 1"", ""muscle embryonic myosin heavy chain 3"""	160720	"""myosin, heavy polypeptide 3, skeletal muscle, embryonic"""			2726495	Standard	NM_002470		Approved	MYHC-EMB, MYHSE1, HEMHC, SMHCE	uc002gmq.2	P11055	OTTHUMG00000130367	ENST00000583535.1:c.699C>T	17.37:g.10551910G>A		Somatic	213	3		WXS	Illumina GAIIx	Phase_I	212	45	NM_002470	0	0	0	0	0	Q15492	Silent	SNP	ENST00000583535.1	37	CCDS11157.1																																																																																			G|0.987;A|0.013		0.453	MYH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252734.2	NM_002470	
RAI1	10743	broad.mit.edu	37	17	17700826	17700826	+	Missense_Mutation	SNP	G	G	T			TCGA-OR-A5LL-01A-11D-A29I-10	TCGA-OR-A5LL-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9bfd4b2e-0577-4c94-8d6c-dafa9104b502	2d4f1606-9261-4ba8-96a9-ee307989af11	g.chr17:17700826G>T	ENST00000353383.1	+	3	5033	c.4564G>T	c.(4564-4566)Gca>Tca	p.A1522S	RAI1_ENST00000261641.6_Missense_Mutation_p.A1522S	NM_030665.3	NP_109590.3	Q7Z5J4	RAI1_HUMAN	retinoic acid induced 1	1522					circadian regulation of gene expression (GO:0032922)|negative regulation of multicellular organism growth (GO:0040015)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	enhancer binding (GO:0035326)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|lung(14)|ovary(1)|prostate(1)|skin(5)|urinary_tract(7)	48				READ - Rectum adenocarcinoma(1115;0.0276)		CCAGACAAGGGCACAGAAACA	0.637																																					p.A1522S		.											.	RAI1-91	0			c.G4564T						.						50.0	60.0	57.0					17																	17700826		2203	4300	6503	SO:0001583	missense	10743	exon3			ACAAGGGCACAGA	AJ230819	CCDS11188.1	17p11.2	2011-02-08			ENSG00000108557	ENSG00000108557			9834	protein-coding gene	gene with protein product		607642	"""Smith-Magenis syndrome chromosome region"""	SMCR		10036180	Standard	NM_030665		Approved	DKFZP434A139, SMS, KIAA1820, MGC12824	uc002grm.3	Q7Z5J4	OTTHUMG00000059314	ENST00000353383.1:c.4564G>T	17.37:g.17700826G>T	ENSP00000323074:p.Ala1522Ser	Somatic	132	0		WXS	Illumina GAIIx	Phase_I	99	3	NM_030665	0	0	16	16	0	Q8N3B4|Q8ND08|Q8WU64|Q96JK5|Q9H1C1|Q9H1C2|Q9UF69	Missense_Mutation	SNP	ENST00000353383.1	37	CCDS11188.1	.	.	.	.	.	.	.	.	.	.	G	11.73	1.726751	0.30593	.	.	ENSG00000108557	ENST00000353383;ENST00000395776;ENST00000261641;ENST00000315321	T;T	0.66995	-0.24;0.32	5.03	5.03	0.67393	.	0.078008	0.52532	D	0.000065	T	0.53753	0.1816	L	0.32530	0.975	0.27825	N	0.941667	B	0.20368	0.044	B	0.19148	0.024	T	0.44682	-0.9312	10	0.32370	T	0.25	.	11.6202	0.51113	0.0824:0.0:0.9176:0.0	.	1522	Q7Z5J4	RAI1_HUMAN	S	1522;1522;1522;1410	ENSP00000323074:A1522S;ENSP00000261641:A1522S	ENSP00000261641:A1522S	A	+	1	0	RAI1	17641551	0.988000	0.35896	0.995000	0.50966	0.993000	0.82548	2.108000	0.41854	2.621000	0.88768	0.561000	0.74099	GCA	.		0.637	RAI1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000131775.1	NM_030665	
KRTAP4-5	85289	ucsc.edu	37	17	39305785	39305785	+	Missense_Mutation	SNP	A	A	T	rs411367		TCGA-OR-A5LL-01A-11D-A29I-10	TCGA-OR-A5LL-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9bfd4b2e-0577-4c94-8d6c-dafa9104b502	2d4f1606-9261-4ba8-96a9-ee307989af11	g.chr17:39305785A>T	ENST00000343246.4	-	1	269	c.235T>A	c.(235-237)Tgc>Agc	p.C79S		NM_033188.3	NP_149445.3	Q9BYR2	KRA45_HUMAN	keratin associated protein 4-5	79	26 X 5 AA repeats of C-C-[GRQVCHIEK]- [SPTR]-[VSTQYC].				aging (GO:0007568)|hair cycle (GO:0042633)	keratin filament (GO:0045095)				central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|lung(4)	6		Breast(137;0.000496)	STAD - Stomach adenocarcinoma(17;0.000371)			tggcagcagcaggggcggcag	0.657																																					p.C79S		.											.	KRTAP4-5-90	0			c.T235A						.						12.0	18.0	16.0					17																	39305785		2089	4172	6261	SO:0001583	missense	85289	exon1			AGCAGCAGGGGCG	AJ406937	CCDS32650.1	17q21.2	2013-06-25			ENSG00000198271	ENSG00000198271		"""Keratin associated proteins"""	18899	protein-coding gene	gene with protein product						11279113	Standard	NM_033188		Approved	KAP4.5	uc002hwb.3	Q9BYR2	OTTHUMG00000133638	ENST00000343246.4:c.235T>A	17.37:g.39305785A>T	ENSP00000340546:p.Cys79Ser	Somatic	44	2		WXS	Illumina GAIIx	Phase_I	54	16	NM_033188	0	0	0	0	0		Missense_Mutation	SNP	ENST00000343246.4	37	CCDS32650.1	773	0.35393772893772896	210	0.4268292682926829	126	0.34806629834254144	175	0.30594405594405594	262	0.34564643799472294	.	0.010	-1.763522	0.00651	.	.	ENSG00000198271	ENST00000343246	T	0.00534	6.74	2.78	-5.56	0.02529	.	0.768893	0.10092	N	0.717076	T	0.00012	0.0000	N	0.01431	-0.87	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.23297	-1.0192	9	0.02654	T	1	.	5.4481	0.16548	0.6146:0.0:0.1542:0.2312	rs411367;rs6503604	79	Q9BYR2	KRA45_HUMAN	S	79	ENSP00000340546:C79S	ENSP00000340546:C79S	C	-	1	0	KRTAP4-5	36559311	0.977000	0.34250	0.000000	0.03702	0.000000	0.00434	-0.260000	0.08708	-1.272000	0.02427	-2.057000	0.00402	TGC	A|0.354;T|0.646		0.657	KRTAP4-5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257783.1		
CD300A	11314	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	72470793	72470793	+	Missense_Mutation	SNP	C	C	A			TCGA-OR-A5LL-01A-11D-A29I-10	TCGA-OR-A5LL-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9bfd4b2e-0577-4c94-8d6c-dafa9104b502	2d4f1606-9261-4ba8-96a9-ee307989af11	g.chr17:72470793C>A	ENST00000360141.3	+	3	790	c.502C>A	c.(502-504)Cag>Aag	p.Q168K	CD300A_ENST00000361933.3_Intron|CD300A_ENST00000310828.5_Missense_Mutation_p.Q55K|CD300A_ENST00000392625.3_Missense_Mutation_p.Q55K|CD300A_ENST00000577511.1_Missense_Mutation_p.Q38K	NM_001256841.1|NM_007261.3	NP_001243770.1|NP_009192.2	Q9UGN4	CLM8_HUMAN	CD300a molecule	168					cell adhesion (GO:0007155)|immune system process (GO:0002376)|negative regulation of activation of JAK2 kinase activity (GO:1902569)|negative regulation of B cell proliferation (GO:0030889)|negative regulation of B cell receptor signaling pathway (GO:0050859)|negative regulation of eosinophil activation (GO:1902567)|negative regulation of eosinophil migration (GO:2000417)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of mast cell activation involved in immune response (GO:0033007)|negative regulation of mast cell degranulation (GO:0043305)|negative regulation of neutrophil activation (GO:1902564)|negative regulation of NK T cell activation (GO:0051134)|negative regulation of phagocytosis, engulfment (GO:0060101)|positive regulation of phosphoprotein phosphatase activity (GO:0032516)|regulation of T cell receptor signaling pathway (GO:0050856)|signal transduction (GO:0007165)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	phosphatidylethanolamine binding (GO:0008429)|phosphatidylserine binding (GO:0001786)|signaling receptor activity (GO:0038023)			breast(1)|endometrium(1)|large_intestine(3)|lung(5)|ovary(1)|skin(4)|urinary_tract(1)	16						TGCCAGCATCCAGGAGGAAAC	0.572																																					p.Q168K		.											.	CD300A-92	0			c.C502A						.						131.0	98.0	109.0					17																	72470793		2203	4300	6503	SO:0001583	missense	11314	exon3			AGCATCCAGGAGG	BC032352	CCDS32720.1, CCDS58590.1	17q25.2	2013-01-11	2006-03-28		ENSG00000167851	ENSG00000167851		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"""	19319	protein-coding gene	gene with protein product		606790	"""CD300a antigen"""			9701027, 10746781	Standard	NM_007261		Approved	Irp60, CMRF35H, CMRF-35-H9, IRC1, IRC2, IGSF12	uc002jkv.4	Q9UGN4	OTTHUMG00000067612	ENST00000360141.3:c.502C>A	17.37:g.72470793C>A	ENSP00000353259:p.Gln168Lys	Somatic	170	0		WXS	Illumina GAIIx	Phase_I	135	25	NM_007261	0	0	0	0	0	A8MW96|O95100|Q9HD97|Q9P0F3|Q9UBK4|Q9UMS9|Q9UMT0	Missense_Mutation	SNP	ENST00000360141.3	37	CCDS32720.1	.	.	.	.	.	.	.	.	.	.	C	7.958	0.746362	0.15710	.	.	ENSG00000167851	ENST00000360141;ENST00000392625;ENST00000310828	T;T	0.41758	4.24;0.99	2.9	0.852	0.18995	.	3.203550	0.01149	N	0.006364	T	0.32164	0.0820	L	0.38175	1.15	0.09310	N	1	B;B;P	0.37466	0.137;0.288;0.596	B;B;B	0.32465	0.046;0.046;0.146	T	0.26503	-1.0101	10	0.62326	D	0.03	.	4.4422	0.11579	0.0:0.6369:0.2302:0.1329	.	55;55;168	Q9UGN4-4;Q9UGN4-2;Q9UGN4	.;.;CLM8_HUMAN	K	168;55;55	ENSP00000353259:Q168K;ENSP00000308188:Q55K	ENSP00000308188:Q55K	Q	+	1	0	CD300A	69982388	0.002000	0.14202	0.006000	0.13384	0.001000	0.01503	0.029000	0.13666	0.271000	0.22005	-0.219000	0.12488	CAG	.		0.572	CD300A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000145091.1	NM_007261	
LONP1	9361	broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	5707755	5707755	+	Missense_Mutation	SNP	T	T	G			TCGA-OR-A5LL-01A-11D-A29I-10	TCGA-OR-A5LL-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9bfd4b2e-0577-4c94-8d6c-dafa9104b502	2d4f1606-9261-4ba8-96a9-ee307989af11	g.chr19:5707755T>G	ENST00000360614.3	-	6	1172	c.1015A>C	c.(1015-1017)Acc>Ccc	p.T339P	LONP1_ENST00000585374.1_Missense_Mutation_p.T225P|LONP1_ENST00000590729.1_Missense_Mutation_p.T209P|LONP1_ENST00000593119.1_Missense_Mutation_p.T275P|LONP1_ENST00000540670.2_Missense_Mutation_p.T143P	NM_004793.2	NP_004784.2			lon peptidase 1, mitochondrial											breast(1)|endometrium(3)|kidney(2)|large_intestine(4)|lung(12)|upper_aerodigestive_tract(1)|urinary_tract(1)	24						TCGGCCCCGGTGAGCGCGGCG	0.662																																					p.F339L		.											.	LONP1-91	0			c.T1015C						.						58.0	59.0	59.0					19																	5707755		2203	4299	6502	SO:0001583	missense	9361	exon6			CCCCGGTGAGCGC	U02389	CCDS12148.1, CCDS62507.1, CCDS62508.1	19p13.2	2014-01-28	2006-10-20	2006-10-20	ENSG00000196365	ENSG00000196365		"""ATPases / AAA-type"", ""Serine peptidases / Serine peptidases"""	9479	protein-coding gene	gene with protein product		605490	"""protease, serine, 15"""	PRSS15		8248235, 8119403	Standard	NM_004793		Approved	LonHS, hLON, PIM1	uc002mcx.4	P36776		ENST00000360614.3:c.1015A>C	19.37:g.5707755T>G	ENSP00000353826:p.Thr339Pro	Somatic	203	1		WXS	Illumina GAIIx	Phase_I	158	26	NM_004793	0	0	85	117	32		Missense_Mutation	SNP	ENST00000360614.3	37	CCDS12148.1	.	.	.	.	.	.	.	.	.	.	T	13.18	2.159243	0.38119	.	.	ENSG00000196365	ENST00000360614;ENST00000358403;ENST00000540670	T;T	0.45668	0.89;0.89	4.63	4.63	0.57726	Peptidase S16, lon N-terminal (2);	0.051589	0.85682	D	0.000000	T	0.51753	0.1693	M	0.85945	2.785	0.53688	D	0.999978	B;B;B	0.24092	0.097;0.054;0.097	B;B;B	0.33254	0.16;0.16;0.16	T	0.57613	-0.7781	10	0.66056	D	0.02	-39.3211	11.9998	0.53224	0.0:0.0:0.0:1.0	.	339;275;339	E5KMH8;Q8N8K8;P36776	.;.;LONM_HUMAN	P	339;303;143	ENSP00000353826:T339P;ENSP00000441523:T143P	ENSP00000351177:T303P	T	-	1	0	LONP1	5658755	1.000000	0.71417	0.892000	0.35008	0.043000	0.13939	7.577000	0.82486	1.716000	0.51395	0.454000	0.30748	ACC	.		0.662	LONP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451662.1	NM_004793	
KANK3	256949	broad.mit.edu	37	19	8398950	8398961	+	In_Frame_Del	DEL	TCGCTGTCGCCA	TCGCTGTCGCCA	-	rs111751275|rs199822445|rs201862465|rs6146458|rs200669927	byFrequency	TCGA-OR-A5LL-01A-11D-A29I-10	TCGA-OR-A5LL-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9bfd4b2e-0577-4c94-8d6c-dafa9104b502	2d4f1606-9261-4ba8-96a9-ee307989af11	g.chr19:8398950_8398961delTCGCTGTCGCCA	ENST00000593649.1	-	5	1532_1543	c.1467_1478delTGGCGACAGCGA	c.(1465-1479)gatggcgacagcgag>gag	p.DGDS489del	KANK3_ENST00000330915.3_In_Frame_Del_p.DGDS489del			Q6NY19	KANK3_HUMAN	KN motif and ankyrin repeat domains 3	489								p.D489_S492delDGDS(2)		breast(1)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(3)|skin(1)|urinary_tract(1)	9						GCCACCGTTCTCGCTGTCGCCATCGCTGTCGC	0.717														1760	0.351438	0.4085	0.428	5008	,	,		15278	0.2927		0.2962	False		,,,				2504	0.3374				p.489_493del		.											.	KANK3-90	2	Deletion - In frame(2)	large_intestine(1)|breast(1)	c.1467_1478del						.			958,2544		287,384,1080						-7.5	0.0		dbSNP_114	6	1402,5766		338,726,2520	no	coding	KANK3	NM_198471.2		625,1110,3600	A1A1,A1R,RR		19.5592,27.3558,22.1181				2360,8310				SO:0001651	inframe_deletion	256949	exon5			CCGTTCTCGCTGT	AK128815	CCDS12199.1	19p13.2	2013-01-10	2008-01-29	2008-01-29		ENSG00000186994		"""KN motif and ankyrin repeat domain containing"", ""Ankyrin repeat domain containing"""	24796	protein-coding gene	gene with protein product		614611	"""ankyrin repeat domain 47"""	ANKRD47		17996375, 19554261	Standard	NM_198471		Approved	FLJ46061	uc010dwa.3	Q6NY19		ENST00000593649.1:c.1467_1478delTGGCGACAGCGA	19.37:g.8398950_8398961delTCGCTGTCGCCA	ENSP00000470728:p.Asp489_Ser492del	Somatic	10	0		WXS	Illumina GAIIx	Phase_I	15	5	NM_198471	0	0	0	0	0	Q6NZI1|Q6ZQR3|Q8IUV2	In_Frame_Del	DEL	ENST00000593649.1	37																																																																																				.		0.717	KANK3-002	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000461379.1	NM_198471	
QTRT1	81890	hgsc.bcm.edu;broad.mit.edu	37	19	10823651	10823651	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5LL-01A-11D-A29I-10	TCGA-OR-A5LL-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9bfd4b2e-0577-4c94-8d6c-dafa9104b502	2d4f1606-9261-4ba8-96a9-ee307989af11	g.chr19:10823651G>A	ENST00000250237.5	+	9	1004	c.994G>A	c.(994-996)Gca>Aca	p.A332T		NM_031209.2	NP_112486.1	Q9BXR0	TGT_HUMAN	queuine tRNA-ribosyltransferase 1	332					queuosine biosynthetic process (GO:0008616)|tRNA modification (GO:0006400)	mitochondrion (GO:0005739)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|queuine tRNA-ribosyltransferase activity (GO:0008479)			large_intestine(2)|lung(7)|prostate(1)|skin(1)|urinary_tract(1)	12			Epithelial(33;1.55e-05)|all cancers(31;3.42e-05)			CTTCCTGCACGCACTGCTGCA	0.697																																					p.A332T		.											.	QTRT1-91	0			c.G994A						.						40.0	34.0	36.0					19																	10823651		2203	4296	6499	SO:0001583	missense	81890	exon9			CTGCACGCACTGC	AF302783	CCDS12248.1	19p13.3	2014-06-11	2008-07-31		ENSG00000213339	ENSG00000213339	2.4.2.29		23797	protein-coding gene	gene with protein product	"""tRNA-guanine transglycosylase"""	609615				20354154	Standard	NM_031209		Approved	TGT	uc002mpr.3	Q9BXR0		ENST00000250237.5:c.994G>A	19.37:g.10823651G>A	ENSP00000250237:p.Ala332Thr	Somatic	87	0		WXS	Illumina GAIIx	Phase_I	58	4	NM_031209	0	0	51	53	2	B4DFM7|Q96BQ4|Q9BXQ9	Missense_Mutation	SNP	ENST00000250237.5	37	CCDS12248.1	.	.	.	.	.	.	.	.	.	.	G	5.889	0.348182	0.11126	.	.	ENSG00000213339	ENST00000250237	.	.	.	4.33	-0.501	0.12008	.	0.147971	0.43416	N	0.000562	T	0.39200	0.1069	N	0.25380	0.74	0.47037	D	0.999296	B	0.02656	0.0	B	0.09377	0.004	T	0.09707	-1.0662	9	0.56958	D	0.05	-7.3286	8.8853	0.35400	0.3313:0.0:0.6687:0.0	.	332	Q9BXR0	TGT_HUMAN	T	332	.	ENSP00000250237:A332T	A	+	1	0	QTRT1	10684651	0.844000	0.29557	0.588000	0.28705	0.025000	0.11179	1.754000	0.38369	-0.274000	0.09232	-0.424000	0.05967	GCA	.		0.697	QTRT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452086.1	NM_031209	
CCDC105	126402	hgsc.bcm.edu	37	19	15133926	15133926	+	Missense_Mutation	SNP	C	C	A	rs8112667	byFrequency	TCGA-OR-A5LL-01A-11D-A29I-10	TCGA-OR-A5LL-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9bfd4b2e-0577-4c94-8d6c-dafa9104b502	2d4f1606-9261-4ba8-96a9-ee307989af11	g.chr19:15133926C>A	ENST00000292574.3	+	7	1577	c.1495C>A	c.(1495-1497)Ccc>Acc	p.P499T		NM_173482.2	NP_775753.2	Q8IYK2	CC105_HUMAN	coiled-coil domain containing 105	499			P -> T (in dbSNP:rs8112667).			extracellular vesicular exosome (GO:0070062)				NS(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(10)|ovary(1)|prostate(4)|skin(2)	23						CAGCGCGGACCCCTAGTGACC	0.716													c|||	1705	0.340455	0.1929	0.438	5008	,	,		11943	0.5208		0.2326	False		,,,				2504	0.3957				p.P499T		.											.	CCDC105-91	0			c.C1495A						.		THR/PRO	868,3356		95,678,1339	7.0	9.0	8.0		1495	-6.6	0.0	19	dbSNP_116	8	1799,6519		206,1387,2566	yes	missense	CCDC105	NM_173482.2	38	301,2065,3905	AA,AC,CC		21.6278,20.5492,21.2646	benign	499/500	15133926	2667,9875	2112	4159	6271	SO:0001583	missense	126402	exon7			GCGGACCCCTAGT	AK097684	CCDS12322.1	19p13.12	2008-02-05				ENSG00000160994			26866	protein-coding gene	gene with protein product						12477932	Standard	NM_173482		Approved	FLJ40365	uc002nae.2	Q8IYK2		ENST00000292574.3:c.1495C>A	19.37:g.15133926C>A	ENSP00000292574:p.Pro499Thr	Somatic	1	0		WXS	Illumina GAIIx	Phase_I	10	5	NM_173482	0	0	0	0	0	Q8N7T5|Q8NDL5	Missense_Mutation	SNP	ENST00000292574.3	37	CCDS12322.1	718	0.32875457875457875	102	0.2073170731707317	139	0.3839779005524862	297	0.5192307692307693	180	0.23746701846965698	c	12.70	2.017064	0.35606	0.205492	0.216278	ENSG00000160994	ENST00000292574	T	0.15139	2.45	3.29	-6.58	0.01836	.	1.321340	0.05609	N	0.577760	T	0.00012	0.0000	N	0.08118	0	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.44528	-0.9322	9	0.87932	D	0	.	0.9387	0.01351	0.3527:0.1586:0.3022:0.1865	rs8112667;rs59368867;rs8112667	499	Q8IYK2	CC105_HUMAN	T	499	ENSP00000292574:P499T	ENSP00000292574:P499T	P	+	1	0	CCDC105	14994926	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-3.281000	0.00528	-1.857000	0.01159	-1.528000	0.00924	CCC	C|0.671;A|0.329		0.716	CCDC105-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466293.1	NM_173482	
UPF1	5976	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	18966869	18966869	+	Silent	SNP	C	C	G			TCGA-OR-A5LL-01A-11D-A29I-10	TCGA-OR-A5LL-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9bfd4b2e-0577-4c94-8d6c-dafa9104b502	2d4f1606-9261-4ba8-96a9-ee307989af11	g.chr19:18966869C>G	ENST00000599848.1	+	12	1922	c.1713C>G	c.(1711-1713)gcC>gcG	p.A571A	UPF1_ENST00000262803.5_Silent_p.A560A			Q92900	RENT1_HUMAN	UPF1 regulator of nonsense transcripts homolog (yeast)	571					ATP catabolic process (GO:0006200)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|dosage compensation by inactivation of X chromosome (GO:0009048)|gene expression (GO:0010467)|histone mRNA catabolic process (GO:0071044)|mRNA export from nucleus (GO:0006406)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process (GO:0000956)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|regulation of translational termination (GO:0006449)|RNA metabolic process (GO:0016070)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|exon-exon junction complex (GO:0035145)|nucleus (GO:0005634)|supraspliceosomal complex (GO:0044530)	ATP binding (GO:0005524)|ATP-dependent RNA helicase activity (GO:0004004)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(11)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	40						CTTTTCTGGCCCTGCACAACC	0.592																																					p.A560A		.											.	UPF1-91	0			c.C1680G						.						69.0	58.0	62.0					19																	18966869		2203	4300	6503	SO:0001819	synonymous_variant	5976	exon12			TCTGGCCCTGCAC	AF074016	CCDS12386.1, CCDS74315.1	19p13.2-p13.11	2012-02-29	2006-02-07	2006-02-07	ENSG00000005007	ENSG00000005007			9962	protein-coding gene	gene with protein product	"""UP Frameshift 1"", ""smg-2 homolog, nonsense mediated mRNA decay factor (C. elegans)"""	601430	"""regulator of nonsense transcripts 1"""	RENT1		8855285, 9064659	Standard	XM_005260015		Approved	HUPF1, KIAA0221, NORF1, pNORF1, smg-2	uc002nkf.3	Q92900		ENST00000599848.1:c.1713C>G	19.37:g.18966869C>G		Somatic	127	0		WXS	Illumina GAIIx	Phase_I	119	24	NM_002911	0	0	26	34	8	O00239|O43343|Q86Z25|Q92842	Silent	SNP	ENST00000599848.1	37																																																																																				.		0.592	UPF1-002	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000464684.1	NM_002911	
URI1	8725	broad.mit.edu	37	19	30500035	30500035	+	Missense_Mutation	SNP	G	G	C			TCGA-OR-A5LL-01A-11D-A29I-10	TCGA-OR-A5LL-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9bfd4b2e-0577-4c94-8d6c-dafa9104b502	2d4f1606-9261-4ba8-96a9-ee307989af11	g.chr19:30500035G>C	ENST00000542441.2	+	8	1107	c.810G>C	c.(808-810)aaG>aaC	p.K270N	URI1_ENST00000392271.1_Missense_Mutation_p.K194N|URI1_ENST00000360605.4_Missense_Mutation_p.K252N|URI1_ENST00000312051.6_Missense_Mutation_p.K230N			O94763	RMP_HUMAN	URI1, prefoldin-like chaperone	270					cellular response to growth factor stimulus (GO:0071363)|cellular response to steroid hormone stimulus (GO:0071383)|negative regulation of intrinsic apoptotic signaling pathway (GO:2001243)|negative regulation of phosphatase activity (GO:0010923)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|protein folding (GO:0006457)|regulation of cell growth (GO:0001558)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to virus (GO:0009615)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|DNA-directed RNA polymerase II, core complex (GO:0005665)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|prefoldin complex (GO:0016272)	chromatin binding (GO:0003682)|protein phosphatase inhibitor activity (GO:0004864)|RNA polymerase II transcription corepressor activity (GO:0001106)										CTTGTCATAAGGATGTTGCAA	0.403																																					p.K270N		.											.	.	0			c.G810C						.						147.0	118.0	128.0					19																	30500035		2203	4299	6502	SO:0001583	missense	8725	exon8			TCATAAGGATGTT	AF091095	CCDS12420.1, CCDS58658.1	19q12	2012-04-17	2011-11-21	2011-11-21	ENSG00000105176	ENSG00000105176		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	13236	protein-coding gene	gene with protein product	"""unconventional prefoldin RPB5 interactor"", ""RPB5-mediating protein"", ""protein phosphatase 1, regulatory subunit 19"""	603494	"""chromosome 19 open reading frame 2"""	C19orf2		9878255, 9819440	Standard	NM_003796		Approved	RMP, NNX3, FLJ10575, URI, PPP1R19	uc002nsr.3	O94763		ENST00000542441.2:c.810G>C	19.37:g.30500035G>C	ENSP00000442436:p.Lys270Asn	Somatic	119	0		WXS	Illumina GAIIx	Phase_I	78	4	NM_003796	0	0	43	46	3	A8K805|H7BY42|Q8TC23|Q9UNU3	Missense_Mutation	SNP	ENST00000542441.2	37	CCDS12420.1	.	.	.	.	.	.	.	.	.	.	G	10.79	1.450483	0.26074	.	.	ENSG00000105176	ENST00000360605;ENST00000392271;ENST00000542441;ENST00000312051	T;T;T	0.08102	3.13;3.13;3.13	5.57	-0.861	0.10676	.	0.869927	0.10572	N	0.659032	T	0.02342	0.0072	N	0.02539	-0.55	0.09310	N	1	B;B;B	0.06786	0.001;0.001;0.001	B;B;B	0.06405	0.002;0.001;0.001	T	0.45614	-0.9249	10	0.18276	T	0.48	5.096	0.9877	0.01450	0.2964:0.2768:0.286:0.1408	.	230;270;268	F8W9T0;O94763;Q8TC23	.;RMP_HUMAN;.	N	268;194;270;230	ENSP00000376097:K194N;ENSP00000442436:K270N;ENSP00000312530:K230N	ENSP00000312530:K230N	K	+	3	2	C19orf2	35191875	0.000000	0.05858	0.000000	0.03702	0.228000	0.25075	0.087000	0.14958	-0.268000	0.09312	0.313000	0.20887	AAG	.		0.403	URI1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000439756.1	NM_134447	
STRN	6801	ucsc.edu	37	2	37152329	37152329	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5LL-01A-11D-A29I-10	TCGA-OR-A5LL-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9bfd4b2e-0577-4c94-8d6c-dafa9104b502	2d4f1606-9261-4ba8-96a9-ee307989af11	g.chr2:37152329C>T	ENST00000263918.4	-	2	265	c.257G>A	c.(256-258)gGa>gAa	p.G86E	STRN_ENST00000379213.2_Missense_Mutation_p.G74E	NM_003162.3	NP_003153.2	O43815	STRN_HUMAN	striatin, calmodulin binding protein	86					dendrite development (GO:0016358)|locomotory behavior (GO:0007626)|negative regulation of cell proliferation (GO:0008285)|tight junction assembly (GO:0070830)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|dendritic spine (GO:0043197)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)|tight junction (GO:0005923)	armadillo repeat domain binding (GO:0070016)|calmodulin binding (GO:0005516)|estrogen receptor binding (GO:0030331)|protein complex binding (GO:0032403)|protein phosphatase 2A binding (GO:0051721)	p.G86E(1)		breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(16)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	33		Ovarian(717;0.0129)|all_hematologic(82;0.21)				CTTCCTTTCTCCCTGCAGGAA	0.373																																					p.G86E		.											.	STRN-91	1	Substitution - Missense(1)	prostate(1)	c.G257A						.						51.0	54.0	53.0					2																	37152329		2203	4300	6503	SO:0001583	missense	6801	exon2			CTTTCTCCCTGCA	AJ223814	CCDS1784.1	2p22.2	2013-01-10	2001-11-28		ENSG00000115808	ENSG00000115808		"""WD repeat domain containing"""	11424	protein-coding gene	gene with protein product		614765	"""striatin, calmodulin-binding protein"""			9693043, 8769426	Standard	NM_003162		Approved	SG2NA	uc002rpn.3	O43815	OTTHUMG00000100959	ENST00000263918.4:c.257G>A	2.37:g.37152329C>T	ENSP00000263918:p.Gly86Glu	Somatic	115	2		WXS	Illumina GAIIx	Phase_I	101	18	NM_003162	0	0	2	2	0	Q3KP65|Q53TQ8|Q9NP38	Missense_Mutation	SNP	ENST00000263918.4	37	CCDS1784.1	.	.	.	.	.	.	.	.	.	.	C	26.6	4.755771	0.89843	.	.	ENSG00000115808	ENST00000263918;ENST00000538092;ENST00000379213	D;T	0.81821	-1.54;-1.43	5.16	5.16	0.70880	Striatin, N-terminal (1);	0.000000	0.85682	D	0.000000	D	0.91888	0.7432	M	0.91872	3.25	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.93679	0.6997	10	0.87932	D	0	-13.4425	17.4167	0.87503	0.0:1.0:0.0:0.0	.	74;86	O43815-2;O43815	.;STRN_HUMAN	E	86;61;74	ENSP00000263918:G86E;ENSP00000368513:G74E	ENSP00000263918:G86E	G	-	2	0	STRN	37005833	1.000000	0.71417	0.999000	0.59377	0.894000	0.52154	7.468000	0.80943	2.376000	0.81061	0.650000	0.86243	GGA	.		0.373	STRN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000218568.1		
DCTN1	1639	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	2	74588719	74588719	+	Silent	SNP	C	C	T			TCGA-OR-A5LL-01A-11D-A29I-10	TCGA-OR-A5LL-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9bfd4b2e-0577-4c94-8d6c-dafa9104b502	2d4f1606-9261-4ba8-96a9-ee307989af11	g.chr2:74588719C>T	ENST00000361874.3	-	32	4061	c.3744G>A	c.(3742-3744)gtG>gtA	p.V1248V	DCTN1_ENST00000409567.3_Silent_p.V1223V|DCTN1_ENST00000409868.1_Silent_p.V1226V|RP11-287D1.3_ENST00000451608.2_Silent_p.V161V|DCTN1_ENST00000409438.1_Silent_p.V1109V|DCTN1_ENST00000394003.3_Silent_p.V1241V|DCTN1_ENST00000409240.1_Silent_p.V1206V|DCTN1_ENST00000407639.2_Silent_p.V1114V	NM_004082.4	NP_004073.2	Q14203	DCTN1_HUMAN	dynactin 1	1248					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|cell death (GO:0008219)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|G2/M transition of mitotic cell cycle (GO:0000086)|melanosome transport (GO:0032402)|microtubule-based transport (GO:0010970)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|nervous system development (GO:0007399)	cell leading edge (GO:0031252)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dynactin complex (GO:0005869)|dynein complex (GO:0030286)|kinetochore (GO:0000776)|membrane (GO:0016020)|microtubule (GO:0005874)|spindle pole (GO:0000922)	motor activity (GO:0003774)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(20)|ovary(4)|prostate(1)|skin(3)	45						ATGAGAAGGTCACTTTGCCCA	0.577																																					p.V1248V		.											.	DCTN1-95	0			c.G3744A						.						147.0	119.0	128.0					2																	74588719		2203	4300	6503	SO:0001819	synonymous_variant	1639	exon32			GAAGGTCACTTTG		CCDS1939.1, CCDS46341.1, CCDS46342.1, CCDS54368.1, CCDS54369.1	2p13	2014-09-17	2010-06-24		ENSG00000204843	ENSG00000204843			2711	protein-coding gene	gene with protein product	"""p150 glued homolog (Drosophila)"""	601143	"""dynactin 1 (p150, Glued (Drosophila) homolog)"""			1828535	Standard	NM_001190836		Approved		uc002skx.3	Q14203	OTTHUMG00000129963	ENST00000361874.3:c.3744G>A	2.37:g.74588719C>T		Somatic	87	0		WXS	Illumina GAIIx	Phase_I	34	6	NM_004082	1	0	24	54	29	A8MY36|B4DM45|E9PFS5|E9PGE1|G5E9H4|O95296|Q6IQ37|Q9BRM9|Q9UIU1|Q9UIU2	Silent	SNP	ENST00000361874.3	37	CCDS1939.1																																																																																			.		0.577	DCTN1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000252227.3	NM_004082	
DNAH6	1768	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	84924798	84924798	+	Missense_Mutation	SNP	G	G	T			TCGA-OR-A5LL-01A-11D-A29I-10	TCGA-OR-A5LL-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9bfd4b2e-0577-4c94-8d6c-dafa9104b502	2d4f1606-9261-4ba8-96a9-ee307989af11	g.chr2:84924798G>T	ENST00000237449.6	+	46	7632	c.7624G>T	c.(7624-7626)Gcc>Tcc	p.A2542S	DNAH6_ENST00000602588.1_Missense_Mutation_p.A514S|DNAH6_ENST00000398278.2_Missense_Mutation_p.A2493S|DNAH6_ENST00000389394.3_Missense_Mutation_p.A2542S			Q9C0G6	DYH6_HUMAN	dynein, axonemal, heavy chain 6	2542	AAA 4. {ECO:0000250}.				cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(2)|breast(9)|central_nervous_system(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(3)|lung(14)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	57						GGTTTTAGCGGCCACCAGACC	0.423																																					p.A2542S		.											.	DNAH6-69	0			c.G7624T						.						123.0	117.0	119.0					2																	84924798		692	1591	2283	SO:0001583	missense	1768	exon47			TTAGCGGCCACCA	U61736	CCDS46348.1	2p11.2	2011-05-24	2006-09-04		ENSG00000115423	ENSG00000115423		"""Axonemal dyneins"""	2951	protein-coding gene	gene with protein product		603336	"""dynein, axonemal, heavy polypeptide 6"", ""dynein heavy chain-like 1"""	DNHL1		8812413	Standard	NM_001370		Approved	Dnahc6, HL-2, FLJ37357	uc010fgb.3	Q9C0G6	OTTHUMG00000128957	ENST00000237449.6:c.7624G>T	2.37:g.84924798G>T	ENSP00000237449:p.Ala2542Ser	Somatic	96	0		WXS	Illumina GAIIx	Phase_I	388	44	NM_001370	0	0	1	1	0	A0PJN9|B5MEE0|B7ZL99|O95493|Q53QZ1|Q53TE5|Q8N1W6|Q92861|Q96BL6|Q9H030|Q9H5E1	Missense_Mutation	SNP	ENST00000237449.6	37	CCDS46348.1	.	.	.	.	.	.	.	.	.	.	G	22.0	4.225015	0.79576	.	.	ENSG00000115423	ENST00000389394;ENST00000398278;ENST00000237449	T;T;T	0.39592	1.13;1.07;1.13	5.67	5.67	0.87782	Dynein heavy chain, P-loop containing D4 domain (1);ATPase, AAA+ type, core (1);	.	.	.	.	T	0.42291	0.1196	L	0.33339	1.005	0.51012	D	0.999904	P;P	0.47191	0.891;0.778	P;P	0.49999	0.628;0.596	T	0.07654	-1.0761	9	0.09338	T	0.73	.	18.5426	0.91035	0.0:0.0:1.0:0.0	.	2542;2493	Q9C0G6;Q9C0G6-4	DYH6_HUMAN;.	S	2542;2493;2542	ENSP00000374045:A2542S;ENSP00000381326:A2493S;ENSP00000237449:A2542S	ENSP00000237449:A2542S	A	+	1	0	DNAH6	84778309	1.000000	0.71417	1.000000	0.80357	0.856000	0.48823	6.607000	0.74163	2.682000	0.91365	0.484000	0.47621	GCC	.		0.423	DNAH6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000328537.2	NM_001370	
EN1	2019	broad.mit.edu	37	2	119600586	119600586	+	Silent	SNP	C	C	A			TCGA-OR-A5LL-01A-11D-A29I-10	TCGA-OR-A5LL-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9bfd4b2e-0577-4c94-8d6c-dafa9104b502	2d4f1606-9261-4ba8-96a9-ee307989af11	g.chr2:119600586C>A	ENST00000295206.6	-	2	1617	c.1107G>T	c.(1105-1107)gcG>gcT	p.A369A	EN1_ENST00000546667.1_5'Flank	NM_001426.3	NP_001417.3	Q05925	HME1_HUMAN	engrailed homeobox 1	369					anatomical structure morphogenesis (GO:0009653)|dorsal/ventral pattern formation (GO:0009953)|embryonic forelimb morphogenesis (GO:0035115)|hindbrain development (GO:0030902)|midbrain development (GO:0030901)|midbrain-hindbrain boundary development (GO:0030917)|multicellular organism growth (GO:0035264)|neuron development (GO:0048666)|pigmentation (GO:0043473)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|proximal/distal pattern formation (GO:0009954)|response to cocaine (GO:0042220)|skeletal system development (GO:0001501)	membrane (GO:0016020)|nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)			endometrium(1)|large_intestine(2)|lung(4)|skin(1)|upper_aerodigestive_tract(1)	9						TGAGGTGCAGCGCCAGGCCGT	0.627																																					p.A369A		.											.	EN1-154	0			c.G1107T						.						74.0	66.0	69.0					2																	119600586		2203	4300	6503	SO:0001819	synonymous_variant	2019	exon2			GTGCAGCGCCAGG	L12699	CCDS2123.1	2q14.2	2011-06-20	2007-02-15		ENSG00000163064	ENSG00000163064		"""Homeoboxes / ANTP class : NKL subclass"""	3342	protein-coding gene	gene with protein product		131290				8094370	Standard	NM_001426		Approved		uc002tlm.3	Q05925	OTTHUMG00000131401	ENST00000295206.6:c.1107G>T	2.37:g.119600586C>A		Somatic	91	5		WXS	Illumina GAIIx	Phase_I	69	7	NM_001426	0	0	0	0	0	Q4ZG44	Silent	SNP	ENST00000295206.6	37	CCDS2123.1																																																																																			.		0.627	EN1-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254191.3		
ZRANB3	84083	broad.mit.edu;bcgsc.ca	37	2	135965341	135965341	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5LL-01A-11D-A29I-10	TCGA-OR-A5LL-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9bfd4b2e-0577-4c94-8d6c-dafa9104b502	2d4f1606-9261-4ba8-96a9-ee307989af11	g.chr2:135965341G>A	ENST00000264159.6	-	19	2788	c.2672C>T	c.(2671-2673)aCt>aTt	p.T891I	ZRANB3_ENST00000412849.1_5'UTR|ZRANB3_ENST00000401392.1_Missense_Mutation_p.T889I|ZRANB3_ENST00000536680.1_Missense_Mutation_p.T889I	NM_032143.2	NP_115519.2	Q5FWF4	ZRAB3_HUMAN	zinc finger, RAN-binding domain containing 3	891					cellular response to DNA damage stimulus (GO:0006974)|DNA catabolic process, endonucleolytic (GO:0000737)|DNA repair (GO:0006281)|DNA rewinding (GO:0036292)|DNA strand renaturation (GO:0000733)|negative regulation of DNA recombination (GO:0045910)|replication fork processing (GO:0031297)|replication fork protection (GO:0048478)|response to UV (GO:0009411)	nuclear replication fork (GO:0043596)	annealing helicase activity (GO:0036310)|ATP binding (GO:0005524)|DNA binding (GO:0003677)|endodeoxyribonuclease activity (GO:0004520)|helicase activity (GO:0004386)|K63-linked polyubiquitin binding (GO:0070530)|zinc ion binding (GO:0008270)			NS(2)|endometrium(2)|kidney(2)|large_intestine(3)|lung(10)|upper_aerodigestive_tract(1)	20				BRCA - Breast invasive adenocarcinoma(221;0.135)		GGGCTTCACAGTGAGATCTGC	0.423																																					p.T891I		.											.	ZRANB3-658	0			c.C2672T						.						108.0	102.0	104.0					2																	135965341		1940	4142	6082	SO:0001583	missense	84083	exon19			TTCACAGTGAGAT	AL136824	CCDS46419.1, CCDS67963.1, CCDS74580.1	2q21.3	2013-05-13			ENSG00000121988	ENSG00000121988		"""Zinc fingers, RAN-binding domain containing"""	25249	protein-coding gene	gene with protein product						11230166	Standard	XM_005263809		Approved	DKFZP434B1727	uc002tum.3	Q5FWF4	OTTHUMG00000150475	ENST00000264159.6:c.2672C>T	2.37:g.135965341G>A	ENSP00000264159:p.Thr891Ile	Somatic	69	2		WXS	Illumina GAIIx	Phase_I	66	28	NM_032143	0	0	1	1	0	B3KYA1|B4E375|B5MDI3|D3DP76|E9PBP0|Q53SM1|Q6P2C4|Q8N1P4|Q9H0E8	Missense_Mutation	SNP	ENST00000264159.6	37	CCDS46419.1	.	.	.	.	.	.	.	.	.	.	G	10.51	1.369182	0.24771	.	.	ENSG00000121988	ENST00000538542;ENST00000283060;ENST00000401392;ENST00000264159;ENST00000536680	D;D;D	0.90732	-2.72;-2.72;-2.71	6.03	1.03	0.20045	.	1.335270	0.04218	N	0.333011	D	0.85071	0.5613	L	0.41027	1.25	0.09310	N	1	B;B	0.06786	0.001;0.001	B;B	0.09377	0.002;0.004	T	0.67150	-0.5743	10	0.46703	T	0.11	-20.2985	2.477	0.04578	0.2688:0.1173:0.4932:0.1208	.	891;889	Q5FWF4;Q5FWF4-3	ZRAB3_HUMAN;.	I	354;354;889;891;889	ENSP00000383979:T889I;ENSP00000264159:T891I;ENSP00000441320:T889I	ENSP00000264159:T891I	T	-	2	0	ZRANB3	135681811	0.000000	0.05858	0.000000	0.03702	0.033000	0.12548	0.097000	0.15168	-0.082000	0.12640	0.655000	0.94253	ACT	.		0.423	ZRANB3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000318254.1	NM_032143	
SP5	389058	hgsc.bcm.edu	37	2	171573185	171573185	+	Silent	SNP	G	G	T	rs1134626	byFrequency	TCGA-OR-A5LL-01A-11D-A29I-10	TCGA-OR-A5LL-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9bfd4b2e-0577-4c94-8d6c-dafa9104b502	2d4f1606-9261-4ba8-96a9-ee307989af11	g.chr2:171573185G>T	ENST00000375281.3	+	2	630	c.468G>T	c.(466-468)ccG>ccT	p.P156P	AC007405.2_ENST00000409786.1_5'Flank	NM_001003845.2	NP_001003845.1	Q6BEB4	SP5_HUMAN	Sp5 transcription factor	156					bone morphogenesis (GO:0060349)|post-anal tail morphogenesis (GO:0036342)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)	p.P156P(1)		NS(1)|endometrium(2)|lung(1)|prostate(1)	5						CCGCGCTGCCGCCAGGCTACT	0.751													G|||	1034	0.20647	0.0242	0.2017	5008	,	,		6711	0.1815		0.3579	False		,,,				2504	0.3262				p.P156P		.											.	SP5-90	1	Substitution - coding silent(1)	NS(1)	c.G468T						.	G		219,2535		16,187,1174	5.0	6.0	6.0		468	-7.5	0.4	2	dbSNP_86	6	2090,4520		318,1454,1533	no	coding-synonymous	SP5	NM_001003845.2		334,1641,2707	TT,TG,GG		31.6188,7.9521,24.6583		156/399	171573185	2309,7055	1377	3305	4682	SO:0001819	synonymous_variant	389058	exon2			GCTGCCGCCAGGC		CCDS33322.1	2q31	2013-01-08			ENSG00000204335	ENSG00000204335		"""Specificity protein transcription factors"", ""Zinc fingers, C2H2-type"""	14529	protein-coding gene	gene with protein product		609391					Standard	NM_001003845		Approved		uc002uge.3	Q6BEB4	OTTHUMG00000154053	ENST00000375281.3:c.468G>T	2.37:g.171573185G>T		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	4	4	NM_001003845	0	0	0	1	1		Silent	SNP	ENST00000375281.3	37	CCDS33322.1																																																																																			G|0.766;T|0.234		0.751	SP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000333670.1	XM_371581	
FAM171B	165215	ucsc.edu	37	2	187559050	187559050	+	Silent	SNP	A	A	G	rs2370705	byFrequency	TCGA-OR-A5LL-01A-11D-A29I-10	TCGA-OR-A5LL-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9bfd4b2e-0577-4c94-8d6c-dafa9104b502	2d4f1606-9261-4ba8-96a9-ee307989af11	g.chr2:187559050A>G	ENST00000304698.5	+	1	353	c.150A>G	c.(148-150)caA>caG	p.Q50Q	AC017101.10_ENST00000453665.1_RNA	NM_177454.3	NP_803237.3	Q6P995	F171B_HUMAN	family with sequence similarity 171, member B	50	Gln-rich.					integral component of membrane (GO:0016021)	DNA binding (GO:0003677)			NS(1)|breast(6)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(10)|lung(22)|ovary(6)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	54						agcagcagcaacaacaacaac	0.637																																					p.Q50Q		.											.	FAM171B-141	0			c.A150G						.						25.0	27.0	27.0					2																	187559050		2202	4300	6502	SO:0001819	synonymous_variant	165215	exon1			GCAGCAACAACAA	AF361495	CCDS33347.1	2q32.2	2008-06-16	2008-06-16	2008-06-16	ENSG00000144369	ENSG00000144369			29412	protein-coding gene	gene with protein product			"""KIAA1946"""	KIAA1946		11853319	Standard	NM_177454		Approved	FLJ34104	uc002ups.3	Q6P995	OTTHUMG00000154278	ENST00000304698.5:c.150A>G	2.37:g.187559050A>G		Somatic	100	1		WXS	Illumina GAIIx	Phase_I	83	6	NM_177454	0	0	7	8	1	Q53SK3|Q8N1Y4|Q8N3K1|Q8N970|Q8NB81|Q8TF55|Q8WYR8	Silent	SNP	ENST00000304698.5	37	CCDS33347.1																																																																																			A|0.500;G|0.500		0.637	FAM171B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000334679.1	NM_177454	
CLK1	1195	broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	201719353	201719353	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5LL-01A-11D-A29I-10	TCGA-OR-A5LL-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9bfd4b2e-0577-4c94-8d6c-dafa9104b502	2d4f1606-9261-4ba8-96a9-ee307989af11	g.chr2:201719353C>T	ENST00000321356.4	-	11	1341	c.1206G>A	c.(1204-1206)atG>atA	p.M402I	CLK1_ENST00000434813.2_Missense_Mutation_p.M444I|CLK1_ENST00000409769.2_Missense_Mutation_p.M225I	NM_004071.3	NP_004062.2	P49759	CLK1_HUMAN	CDC-like kinase 1	402	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cell proliferation (GO:0008283)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|protein autophosphorylation (GO:0046777)|regulation of RNA splicing (GO:0043484)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)			NS(1)|endometrium(2)|kidney(4)|large_intestine(6)|lung(12)|ovary(1)|pancreas(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	33						TTTTCTGTATCATATGTTTTG	0.328																																					p.M444I		.											.	CLK1-784	0			c.G1332A						.						195.0	201.0	199.0					2																	201719353		2203	4300	6503	SO:0001583	missense	1195	exon11			CTGTATCATATGT	L29219	CCDS2331.1, CCDS54427.1	2q33	2008-05-02			ENSG00000013441	ENSG00000013441		"""CDC-like kinases"""	2068	protein-coding gene	gene with protein product		601951				9856501	Standard	NM_004071		Approved		uc002uwe.2	P49759	OTTHUMG00000132784	ENST00000321356.4:c.1206G>A	2.37:g.201719353C>T	ENSP00000326830:p.Met402Ile	Somatic	104	0		WXS	Illumina GAIIx	Phase_I	53	6	NM_001162407	0	0	130	169	39	B4DFW7|Q0P694|Q8N5V8	Missense_Mutation	SNP	ENST00000321356.4	37	CCDS2331.1	.	.	.	.	.	.	.	.	.	.	C	21.0	4.078795	0.76528	.	.	ENSG00000013441	ENST00000321356;ENST00000357369;ENST00000409769;ENST00000434813	T;T;T	0.65178	-0.14;-0.14;-0.14	5.53	5.53	0.82687	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.039831	0.85682	D	0.000000	T	0.68165	0.2971	N	0.21240	0.645	0.42599	D	0.993277	P;D;P;B	0.55605	0.742;0.972;0.742;0.181	P;P;P;B	0.62089	0.876;0.898;0.876;0.237	T	0.72090	-0.4395	10	0.87932	D	0	.	19.4145	0.94689	0.0:1.0:0.0:0.0	.	444;372;402;225	B4DFW7;E9PH13;P49759;B8ZZR0	.;.;CLK1_HUMAN;.	I	402;372;225;444	ENSP00000326830:M402I;ENSP00000386358:M225I;ENSP00000394734:M444I	ENSP00000326830:M402I	M	-	3	0	CLK1	201427598	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	3.847000	0.55895	2.757000	0.94681	0.563000	0.77884	ATG	.		0.328	CLK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256192.2		
FAM124B	79843	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	225266236	225266236	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5LL-01A-11D-A29I-10	TCGA-OR-A5LL-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9bfd4b2e-0577-4c94-8d6c-dafa9104b502	2d4f1606-9261-4ba8-96a9-ee307989af11	g.chr2:225266236G>A	ENST00000409685.3	-	1	515	c.250C>T	c.(250-252)Cgc>Tgc	p.R84C	FAM124B_ENST00000389874.3_Missense_Mutation_p.R84C|FAM124B_ENST00000243806.2_Missense_Mutation_p.R84C	NM_001122779.1	NP_001116251.1	Q9H5Z6	F124B_HUMAN	family with sequence similarity 124B	84										endometrium(2)|large_intestine(2)|lung(7)|ovary(2)|skin(1)|upper_aerodigestive_tract(2)	16		Renal(207;0.0112)|all_lung(227;0.0126)|Lung NSC(271;0.0161)|all_hematologic(139;0.138)		Epithelial(121;4.4e-10)|all cancers(144;2.02e-07)|Lung(261;0.00766)|LUSC - Lung squamous cell carcinoma(224;0.00825)		TCCAGGACGCGAAATAGCCTA	0.547																																					p.R84C		.											.	FAM124B-92	0			c.C250T						.						59.0	57.0	58.0					2																	225266236		2203	4300	6503	SO:0001583	missense	79843	exon1			GGACGCGAAATAG	AK075126	CCDS2461.1, CCDS46527.1	2q36.2	2008-02-05			ENSG00000124019	ENSG00000124019			26224	protein-coding gene	gene with protein product						12477932	Standard	NM_001122779		Approved	FLJ22746	uc002vnx.3	Q9H5Z6	OTTHUMG00000133168	ENST00000409685.3:c.250C>T	2.37:g.225266236G>A	ENSP00000386895:p.Arg84Cys	Somatic	110	0		WXS	Illumina GAIIx	Phase_I	93	19	NM_024785	0	0	0	0	0	A6NNC7|Q8NBZ4|Q8TAV7	Missense_Mutation	SNP	ENST00000409685.3	37	CCDS46527.1	.	.	.	.	.	.	.	.	.	.	G	14.32	2.501625	0.44455	.	.	ENSG00000124019	ENST00000389874;ENST00000409685;ENST00000243806	T;T;T	0.47528	0.84;0.84;0.84	5.69	4.81	0.61882	.	0.522618	0.21107	N	0.080042	T	0.55545	0.1927	M	0.62723	1.935	0.19575	N	0.999969	D;P	0.60160	0.987;0.956	P;B	0.50049	0.629;0.401	T	0.54655	-0.8261	10	0.72032	D	0.01	-6.6696	14.7933	0.69860	0.0693:0.0:0.9307:0.0	.	84;84	Q9H5Z6;Q9H5Z6-2	F124B_HUMAN;.	C	84	ENSP00000374524:R84C;ENSP00000386895:R84C;ENSP00000243806:R84C	ENSP00000243806:R84C	R	-	1	0	FAM124B	224974480	0.648000	0.27313	0.002000	0.10522	0.001000	0.01503	4.069000	0.57541	1.400000	0.46741	0.655000	0.94253	CGC	.		0.547	FAM124B-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000330873.1	NM_024785	
KLHL30	377007	broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	239059526	239059526	+	Silent	SNP	C	C	T			TCGA-OR-A5LL-01A-11D-A29I-10	TCGA-OR-A5LL-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9bfd4b2e-0577-4c94-8d6c-dafa9104b502	2d4f1606-9261-4ba8-96a9-ee307989af11	g.chr2:239059526C>T	ENST00000409223.1	+	8	1664	c.1557C>T	c.(1555-1557)ggC>ggT	p.G519G	KLHL30_ENST00000305959.4_Silent_p.G501G			Q0D2K2	KLH30_HUMAN	kelch-like family member 30	519										lung(4)	4		Breast(86;7.61e-05)|Renal(207;0.00183)|Ovarian(221;0.0481)|all_hematologic(139;0.158)|all_lung(227;0.198)|Melanoma(123;0.203)|Hepatocellular(293;0.244)		Epithelial(121;4.71e-24)|OV - Ovarian serous cystadenocarcinoma(60;3.02e-12)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;5.63e-08)|BRCA - Breast invasive adenocarcinoma(100;0.000109)|Lung(119;0.0108)|LUSC - Lung squamous cell carcinoma(224;0.0253)		ACGTGACGGGCGGCCGCTGGC	0.677																																					p.G519G		.											.	KLHL30-22	0			c.C1557T						.						18.0	25.0	23.0					2																	239059526		2175	4258	6433	SO:0001819	synonymous_variant	377007	exon8			GACGGGCGGCCGC		CCDS46555.1, CCDS46555.2	2q37.3	2013-02-22	2013-02-22		ENSG00000168427	ENSG00000168427		"""Kelch-like"", ""BTB/POZ domain containing"""	24770	protein-coding gene	gene with protein product			"""kelch-like 30 (Drosophila)"""				Standard	NM_198582		Approved	FLJ43374	uc002vxr.2	Q0D2K2	OTTHUMG00000152905	ENST00000409223.1:c.1557C>T	2.37:g.239059526C>T		Somatic	236	1		WXS	Illumina GAIIx	Phase_I	155	21	NM_198582	0	0	0	0	0	Q6ZUS1	Silent	SNP	ENST00000409223.1	37	CCDS46555.2																																																																																			.		0.677	KLHL30-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000328518.1	NM_198582	
BPIFB4	149954	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	20	31671359	31671359	+	Missense_Mutation	SNP	G	G	A	rs373461211		TCGA-OR-A5LL-01A-11D-A29I-10	TCGA-OR-A5LL-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9bfd4b2e-0577-4c94-8d6c-dafa9104b502	2d4f1606-9261-4ba8-96a9-ee307989af11	g.chr20:31671359G>A	ENST00000375483.3	+	3	356	c.356G>A	c.(355-357)cGa>cAa	p.R119Q		NM_182519.2	NP_872325.2	P59827	BPIB4_HUMAN	BPI fold containing family B, member 4	119						cytoplasm (GO:0005737)|extracellular region (GO:0005576)	lipid binding (GO:0008289)										AGGGACCTCCGAAACAGTGGC	0.587																																					p.R119Q		.											.	.	0			c.G356A						.	G	GLN/ARG	0,4406		0,0,2203	72.0	66.0	68.0		356	1.2	0.0	20		68	1,8599	1.2+/-3.3	0,1,4299	no	missense	BPIFB4	NM_182519.2	43	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	benign	119/615	31671359	1,13005	2203	4300	6503	SO:0001583	missense	149954	exon3			ACCTCCGAAACAG	AF549190	CCDS13213.2	20q11.21	2011-08-04	2011-07-29	2011-07-29	ENSG00000186191	ENSG00000186191		"""BPI fold containing"""	16179	protein-coding gene	gene with protein product		615718	"""chromosome 20 open reading frame 186"""	C20orf186		11971875, 21787333	Standard	NM_182519		Approved	dJ726C3.5, LPLUNC4	uc010zue.2	P59827	OTTHUMG00000032235	ENST00000375483.3:c.356G>A	20.37:g.31671359G>A	ENSP00000364632:p.Arg119Gln	Somatic	138	0		WXS	Illumina GAIIx	Phase_I	125	8	NM_182519	0	0	0	0	0	Q5TDX6	Missense_Mutation	SNP	ENST00000375483.3	37	CCDS13213.2	.	.	.	.	.	.	.	.	.	.	G	2.522	-0.310518	0.05458	0.0	1.16E-4	ENSG00000186191	ENST00000375483	T	0.01495	4.83	3.28	1.18	0.20946	.	1.013370	0.07936	N	0.978416	T	0.01489	0.0048	N	0.19112	0.55	0.09310	N	1	B	0.12013	0.005	B	0.04013	0.001	T	0.48198	-0.9056	10	0.46703	T	0.11	-0.5271	4.6783	0.12722	0.1301:0.2236:0.6463:0.0	.	119	P59827	BPIB4_HUMAN	Q	119	ENSP00000364632:R119Q	ENSP00000364632:R119Q	R	+	2	0	BPIFB4	31135020	0.569000	0.26643	0.030000	0.17652	0.031000	0.12232	0.806000	0.27126	0.197000	0.20387	-0.362000	0.07510	CGA	.		0.587	BPIFB4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078655.5	NM_182519	
TFAP2C	7022	broad.mit.edu	37	20	55206414	55206414	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5LL-01A-11D-A29I-10	TCGA-OR-A5LL-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9bfd4b2e-0577-4c94-8d6c-dafa9104b502	2d4f1606-9261-4ba8-96a9-ee307989af11	g.chr20:55206414G>A	ENST00000201031.2	+	2	445	c.202G>A	c.(202-204)Gcc>Acc	p.A68T	TFAP2C_ENST00000544508.1_5'UTR	NM_003222.3	NP_003213.1	Q92754	AP2C_HUMAN	transcription factor AP-2 gamma (activating enhancer binding protein 2 gamma)	68	Gln/Pro-rich (transactivation domain).				cell-cell signaling (GO:0007267)|cerebral cortex development (GO:0021987)|dichotomous subdivision of terminal units involved in mammary gland duct morphogenesis (GO:0060598)|epithelial cell proliferation involved in mammary gland duct elongation (GO:0060750)|forebrain neuron fate commitment (GO:0021877)|germ-line stem cell maintenance (GO:0030718)|hair follicle development (GO:0001942)|keratinocyte development (GO:0003334)|male gonad development (GO:0008584)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of epidermis development (GO:0045682)|regulation of gene expression, epigenetic (GO:0040029)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|sebaceous gland development (GO:0048733)|somatic stem cell maintenance (GO:0035019)|trophectodermal cell differentiation (GO:0001829)	nucleus (GO:0005634)	core promoter binding (GO:0001047)|DNA binding (GO:0003677)|protein dimerization activity (GO:0046983)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	13			Colorectal(105;0.229)			CCAGCAGCTGGCCTACTCCCA	0.697																																					p.A68T		.											.	TFAP2C-514	0			c.G202A						.						31.0	31.0	31.0					20																	55206414		2203	4300	6503	SO:0001583	missense	7022	exon2			CAGCTGGCCTACT		CCDS13454.1	20q13.2	2008-07-17	2001-11-28		ENSG00000087510	ENSG00000087510			11744	protein-coding gene	gene with protein product	"""estrogen receptor factor 1"""	601602	"""transcription factor AP-2 gamma (activating enhancer-binding protein 2 gamma)"""			8661133	Standard	NM_003222		Approved	AP2-GAMMA, ERF1, TFAP2G, hAP-2g	uc002xya.3	Q92754	OTTHUMG00000032805	ENST00000201031.2:c.202G>A	20.37:g.55206414G>A	ENSP00000201031:p.Ala68Thr	Somatic	73	0		WXS	Illumina GAIIx	Phase_I	75	4	NM_003222	0	0	1	1	0	B4DWK3|O00685|O00730|Q86V30|Q8IVB6|Q9P1X2	Missense_Mutation	SNP	ENST00000201031.2	37	CCDS13454.1	.	.	.	.	.	.	.	.	.	.	G	8.786	0.929331	0.18131	.	.	ENSG00000087510	ENST00000201031;ENST00000416606	T;T	0.77489	-1.1;-1.1	5.57	2.4	0.29515	.	0.266800	0.43747	N	0.000526	T	0.64394	0.2594	L	0.43152	1.355	0.80722	D	1	B	0.02656	0.0	B	0.01281	0.0	T	0.56318	-0.7999	10	0.23302	T	0.38	-26.8187	6.5046	0.22188	0.1871:0.3132:0.4997:0.0	.	68	Q92754	AP2C_HUMAN	T	68;56	ENSP00000201031:A68T;ENSP00000390857:A56T	ENSP00000201031:A68T	A	+	1	0	TFAP2C	54639821	1.000000	0.71417	0.988000	0.46212	0.868000	0.49771	1.328000	0.33758	1.358000	0.45922	0.561000	0.74099	GCC	.		0.697	TFAP2C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079823.2	NM_003222	
CTCFL	140690	hgsc.bcm.edu;broad.mit.edu	37	20	56090847	56090847	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5LL-01A-11D-A29I-10	TCGA-OR-A5LL-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9bfd4b2e-0577-4c94-8d6c-dafa9104b502	2d4f1606-9261-4ba8-96a9-ee307989af11	g.chr20:56090847C>T	ENST00000608263.1	-	5	1764	c.1103G>A	c.(1102-1104)cGc>cAc	p.R368H	CTCFL_ENST00000422869.2_Missense_Mutation_p.R368H|CTCFL_ENST00000432255.2_Intron|CTCFL_ENST00000608858.1_5'UTR|CTCFL_ENST00000609232.1_Missense_Mutation_p.R368H|CTCFL_ENST00000371196.2_Missense_Mutation_p.R368H|CTCFL_ENST00000608440.1_Missense_Mutation_p.R368H|CTCFL_ENST00000429804.3_Missense_Mutation_p.R368H|CTCFL_ENST00000608425.1_Missense_Mutation_p.R368H|CTCFL_ENST00000243914.3_Missense_Mutation_p.R368H|CTCFL_ENST00000423479.3_Missense_Mutation_p.R368H|CTCFL_ENST00000539382.1_Missense_Mutation_p.R163H|CTCFL_ENST00000608903.1_Missense_Mutation_p.R106H|CTCFL_ENST00000433949.3_Missense_Mutation_p.R163H|CTCFL_ENST00000502686.2_Missense_Mutation_p.R106H	NM_001269041.1	NP_001255970.1	Q8NI51	CTCFL_HUMAN	CCCTC-binding factor (zinc finger protein)-like	368					cell cycle (GO:0007049)|DNA methylation involved in gamete generation (GO:0043046)|histone methylation (GO:0016571)|positive regulation of gene expression (GO:0010628)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of gene expression by genetic imprinting (GO:0006349)|regulation of histone H3-K4 methylation (GO:0051569)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone binding (GO:0042393)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding (GO:0043565)|transcription regulatory region DNA binding (GO:0044212)	p.R368H(1)		NS(1)|breast(1)|cervix(2)|endometrium(6)|kidney(4)|large_intestine(9)|lung(28)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	58	Lung NSC(12;0.00132)|all_lung(29;0.00433)|Melanoma(10;0.242)		BRCA - Breast invasive adenocarcinoma(13;3.95e-12)|Epithelial(14;3.41e-08)|all cancers(14;2.09e-07)			CTGAAAGGGGCGCTCCCCAGT	0.478																																					p.R368H		.											.	CTCFL-292	1	Substitution - Missense(1)	large_intestine(1)	c.G1103A						.						168.0	160.0	162.0					20																	56090847		2203	4300	6503	SO:0001583	missense	140690	exon5			AAGGGGCGCTCCC		CCDS13459.1, CCDS58776.1, CCDS58777.1, CCDS58778.1, CCDS58779.1, CCDS58780.1, CCDS58781.1, CCDS58782.1, CCDS68161.1, CCDS68162.1, CCDS68163.1, CCDS68164.1	20q13.31	2013-01-08			ENSG00000124092	ENSG00000124092		"""Zinc fingers, C2H2-type"""	16234	protein-coding gene	gene with protein product	"""cancer/testis antigen 27"""	607022					Standard	NM_001269040		Approved	dJ579F20.2, BORIS, CT27	uc010giw.1	Q8NI51	OTTHUMG00000032829	ENST00000608263.1:c.1103G>A	20.37:g.56090847C>T	ENSP00000476783:p.Arg368His	Somatic	39	0		WXS	Illumina GAIIx	Phase_I	44	5	NM_001269044	0	0	0	0	0	A0S6W1|A1L4C6|A6XGL8|A6XGM2|A6XGM3|A6XGM8|A6XGN0|A6XGN1|A6XGN2|A6XGN3|A6XGN4|E7EQ27|E7EUE3|E9PBA9|Q5JUG4|Q9BZ30|Q9NQJ3	Missense_Mutation	SNP	ENST00000608263.1	37	CCDS13459.1	.	.	.	.	.	.	.	.	.	.	C	34	5.309861	0.95629	.	.	ENSG00000124092	ENST00000423479;ENST00000243914;ENST00000371196;ENST00000429804;ENST00000433949;ENST00000502686;ENST00000422109;ENST00000426658;ENST00000539382;ENST00000422869	T;T;T;T;T;T;T;T;T;T	0.20332	2.08;2.08;2.08;2.08;2.08;2.08;2.08;2.08;2.08;2.08	5.24	5.24	0.73138	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.44902	D	0.000406	T	0.46073	0.1374	M	0.64260	1.97	0.58432	D	0.999999	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.97110	0.999;1.0;1.0;1.0;1.0	T	0.39418	-0.9615	10	0.72032	D	0.01	-44.5807	17.9608	0.89084	0.0:1.0:0.0:0.0	.	368;368;368;368;368	A6XGM9;A6XGM2;E7EUE3;A6XGL8;Q8NI51	.;.;.;.;CTCFL_HUMAN	H	368;368;368;368;368;106;368;368;163;368	ENSP00000415579:R368H;ENSP00000243914:R368H;ENSP00000360239:R368H;ENSP00000415329:R368H;ENSP00000392034:R368H;ENSP00000437999:R106H;ENSP00000413713:R368H;ENSP00000403369:R368H;ENSP00000439998:R163H;ENSP00000399061:R368H	ENSP00000243914:R368H	R	-	2	0	CTCFL	55524253	1.000000	0.71417	0.949000	0.38748	0.796000	0.44982	7.493000	0.81493	2.608000	0.88229	0.650000	0.86243	CGC	.		0.478	CTCFL-019	KNOWN	alternative_5_UTR|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000472040.1	NM_080618	
CDH4	1002	broad.mit.edu	37	20	60348208	60348208	+	Silent	SNP	G	G	A			TCGA-OR-A5LL-01A-11D-A29I-10	TCGA-OR-A5LL-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9bfd4b2e-0577-4c94-8d6c-dafa9104b502	2d4f1606-9261-4ba8-96a9-ee307989af11	g.chr20:60348208G>A	ENST00000360469.5	+	4	634	c.546G>A	c.(544-546)tcG>tcA	p.S182S	CDH4_ENST00000543233.1_Silent_p.S108S	NM_001794.3	NP_001785.2	P55283	CADH4_HUMAN	cadherin 4, type 1, R-cadherin (retinal)	182	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(2)|breast(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(17)|liver(2)|lung(25)|ovary(2)|prostate(1)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	74			BRCA - Breast invasive adenocarcinoma(19;2.36e-08)			CCGAGAACTCGCGCGGGCCCT	0.692																																					p.S182S		.											.	CDH4-282	0			c.G546A						.						18.0	16.0	17.0					20																	60348208		2194	4294	6488	SO:0001819	synonymous_variant	1002	exon4			GAACTCGCGCGGG	L34059	CCDS13488.1, CCDS58784.1	20q13.3	2010-01-26			ENSG00000179242	ENSG00000179242		"""Cadherins / Major cadherins"""	1763	protein-coding gene	gene with protein product	"""R-Cadherin"""	603006				10191097, 10516427	Standard	NM_001794		Approved		uc002ybn.2	P55283	OTTHUMG00000032890	ENST00000360469.5:c.546G>A	20.37:g.60348208G>A		Somatic	76	0		WXS	Illumina GAIIx	Phase_I	104	4	NM_001794	0	0	0	0	0	B3KWB8|G3V1P8|Q2M208|Q5VZ44|Q9BZ05	Silent	SNP	ENST00000360469.5	37	CCDS13488.1																																																																																			.		0.692	CDH4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079965.2	NM_001794	
OLIG2	10215	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	21	34399459	34399459	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5LL-01A-11D-A29I-10	TCGA-OR-A5LL-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9bfd4b2e-0577-4c94-8d6c-dafa9104b502	2d4f1606-9261-4ba8-96a9-ee307989af11	g.chr21:34399459G>A	ENST00000333337.3	+	1	1217	c.289G>A	c.(289-291)Gac>Aac	p.D97N	AP000282.2_ENST00000420356.1_RNA|AP000282.2_ENST00000454622.1_RNA|OLIG2_ENST00000382357.3_Missense_Mutation_p.D97N			Q13516	OLIG2_HUMAN	oligodendrocyte lineage transcription factor 2	97					myelination (GO:0042552)|negative regulation of neuron differentiation (GO:0045665)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuron fate commitment (GO:0048663)|positive regulation of oligodendrocyte differentiation (GO:0048714)|spinal cord motor neuron differentiation (GO:0021522)|spinal cord oligodendrocyte cell fate specification (GO:0021530)|thalamus development (GO:0021794)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)			breast(1)|central_nervous_system(2)	3						CACCAAGAAGGACAAGAAGCA	0.607			T	TRA@	T-ALL																																p.D97N		.		Dom	yes		21	21q22.11	10215	oligodendrocyte lineage transcription factor 2 (BHLHB1)		L	.	OLIG2-629	0			c.G289A						.						24.0	25.0	25.0					21																	34399459		2201	4300	6501	SO:0001583	missense	10215	exon2			AAGAAGGACAAGA	U48250	CCDS13620.1	21q22.11	2013-05-21	2001-12-04	2001-12-07	ENSG00000205927	ENSG00000205927		"""Basic helix-loop-helix proteins"""	9398	protein-coding gene	gene with protein product	"""oligodendrocyte-specific bHLH transcription factor 2"", ""protein kinase C binding protein 2"", ""human protein kinase C-binding protein RACK17"", ""basic domain, helix-loop-helix protein, class B, 1"""	606386	"""protein kinase C binding protein 2"""	PRKCBP2, BHLHB1		11526205	Standard	NM_005806		Approved	RACK17, OLIGO2, bHLHe19	uc002yqx.2	Q13516	OTTHUMG00000065032	ENST00000333337.3:c.289G>A	21.37:g.34399459G>A	ENSP00000331040:p.Asp97Asn	Somatic	155	0		WXS	Illumina GAIIx	Phase_I	132	25	NM_005806	0	0	0	0	0	B3KRF3|Q05BP9|Q49AL3|Q86X04|Q9NZ14	Missense_Mutation	SNP	ENST00000333337.3	37	CCDS13620.1	.	.	.	.	.	.	.	.	.	.	G	18.12	3.553275	0.65425	.	.	ENSG00000205927	ENST00000382357;ENST00000333337	T;T	0.79554	-1.28;-1.28	3.1	3.1	0.35709	.	0.000000	0.64402	U	0.000005	T	0.73481	0.3592	L	0.27053	0.805	0.53005	D	0.999963	D	0.53885	0.963	P	0.49922	0.626	T	0.68941	-0.5276	10	0.15952	T	0.53	.	13.0583	0.58992	0.0:0.0:1.0:0.0	.	97	Q13516	OLIG2_HUMAN	N	97	ENSP00000371794:D97N;ENSP00000331040:D97N	ENSP00000331040:D97N	D	+	1	0	OLIG2	33321329	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	4.499000	0.60380	1.539000	0.49286	0.462000	0.41574	GAC	.		0.607	OLIG2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000139663.1	NM_005806	
NEFH	4744	ucsc.edu	37	22	29885594	29885594	+	Silent	SNP	A	A	T	rs79235463|rs200984527|rs267607533	byFrequency	TCGA-OR-A5LL-01A-11D-A29I-10	TCGA-OR-A5LL-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9bfd4b2e-0577-4c94-8d6c-dafa9104b502	2d4f1606-9261-4ba8-96a9-ee307989af11	g.chr22:29885594A>T	ENST00000310624.6	+	4	1998	c.1965A>T	c.(1963-1965)ccA>ccT	p.P655P		NM_021076.3	NP_066554.2	P12036	NFH_HUMAN	neurofilament, heavy polypeptide	661	30 X 6 AA repeats of K-S-P-[AEPV]-[EAK]- [AEVK].|Tail.				axon development (GO:0061564)|axonogenesis (GO:0007409)|cell death (GO:0008219)|cell projection assembly (GO:0030031)|microtubule cytoskeleton organization (GO:0000226)|neurofilament bundle assembly (GO:0033693)|peripheral nervous system neuron axonogenesis (GO:0048936)|regulation of organelle transport along microtubule (GO:1902513)	axon (GO:0030424)|cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|neurofibrillary tangle (GO:0097418)|neurofilament (GO:0005883)	dynein binding (GO:0045502)|kinesin binding (GO:0019894)|microtubule binding (GO:0008017)|protein binding, bridging (GO:0030674)|protein kinase binding (GO:0019901)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)			cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(12)|ovary(2)|skin(3)	30						CCAAGTCCCCAGAGAAGGAAG	0.552																																					p.P655P		.											.	NEFH-90	0			c.A1965T						.						83.0	92.0	89.0					22																	29885594		2203	4300	6503	SO:0001819	synonymous_variant	4744	exon4			GTCCCCAGAGAAG		CCDS13858.1	22q12.2	2013-01-16	2008-09-19		ENSG00000100285	ENSG00000100285		"""Intermediate filaments type IV"""	7737	protein-coding gene	gene with protein product		162230	"""neurofilament, heavy polypeptide 200kDa"""				Standard	NM_021076		Approved		uc003afo.3	P12036	OTTHUMG00000151155	ENST00000310624.6:c.1965A>T	22.37:g.29885594A>T		Somatic	263	1		WXS	Illumina GAIIx	Phase_I	205	37	NM_021076	0	0	7	7	0	B4DYY4|Q96HF8|Q9UJS7|Q9UQ14	Silent	SNP	ENST00000310624.6	37	CCDS13858.1																																																																																			A|0.500;T|0.500		0.552	NEFH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321553.2	NM_021076	
STAB1	23166	broad.mit.edu	37	3	52546974	52546974	+	Splice_Site	SNP	G	G	T			TCGA-OR-A5LL-01A-11D-A29I-10	TCGA-OR-A5LL-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9bfd4b2e-0577-4c94-8d6c-dafa9104b502	2d4f1606-9261-4ba8-96a9-ee307989af11	g.chr3:52546974G>T	ENST00000321725.6	+	29	3234	c.3158G>T	c.(3157-3159)aGg>aTg	p.R1053M		NM_015136.2	NP_055951.2	Q9NY15	STAB1_HUMAN	stabilin 1	1053	FAS1 3. {ECO:0000255|PROSITE- ProRule:PRU00082, ECO:0000305}.				cell adhesion (GO:0007155)|cell-cell signaling (GO:0007267)|defense response to bacterium (GO:0042742)|inflammatory response (GO:0006954)|negative regulation of angiogenesis (GO:0016525)|oxidation-reduction process (GO:0055114)|receptor-mediated endocytosis (GO:0006898)	endocytic vesicle membrane (GO:0030666)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	hyaluronic acid binding (GO:0005540)|low-density lipoprotein particle binding (GO:0030169)|low-density lipoprotein receptor activity (GO:0005041)|protein disulfide oxidoreductase activity (GO:0015035)|scavenger receptor activity (GO:0005044)			breast(4)|central_nervous_system(3)|endometrium(7)|kidney(2)|large_intestine(13)|liver(1)|lung(27)|ovary(1)|pancreas(1)|prostate(4)|skin(6)|upper_aerodigestive_tract(4)|urinary_tract(3)	76				BRCA - Breast invasive adenocarcinoma(193;1.73e-05)|Kidney(197;0.00182)|KIRC - Kidney renal clear cell carcinoma(197;0.00205)|OV - Ovarian serous cystadenocarcinoma(275;0.0482)		AACCTGGTCAGGTGGGGCCGC	0.687																																					p.R1053M		.											.	STAB1-139	0			c.G3158T						.						12.0	15.0	14.0					3																	52546974		2193	4280	6473	SO:0001630	splice_region_variant	23166	exon29			TGGTCAGGTGGGG	AJ275213	CCDS33768.1	3p21.31	2008-07-18			ENSG00000010327	ENSG00000010327			18628	protein-coding gene	gene with protein product	"""MS-1 antigen"", ""fasciclin egf-like, laminin-type egf-like, and link domain-containing scavenger receptor-1"", ""common lymphatic endothelial and vascular endothelial receptor-1"""	608560				11829752, 12077138	Standard	XM_005264973		Approved	KIAA0246, STAB-1, FEEL-1, CLEVER-1, FELE-1, FEX1	uc003dej.3	Q9NY15	OTTHUMG00000158574	ENST00000321725.6:c.3158+1G>T	3.37:g.52546974G>T		Somatic	95	0		WXS	Illumina GAIIx	Phase_I	86	3	NM_015136	0	0	1	1	0	A7E297|Q8IUH0|Q8IUH1|Q93072	Missense_Mutation	SNP	ENST00000321725.6	37	CCDS33768.1	.	.	.	.	.	.	.	.	.	.	G	18.00	3.524933	0.64747	.	.	ENSG00000010327	ENST00000321725	D	0.90788	-2.73	5.84	5.84	0.93424	FAS1 domain (5);	0.000000	0.85682	D	0.000000	D	0.94437	0.8210	M	0.64567	1.98	0.54753	D	0.999989	D	0.89917	1.0	D	0.81914	0.995	D	0.93526	0.6865	10	0.44086	T	0.13	.	17.9316	0.88999	0.0:0.0:1.0:0.0	.	1053	Q9NY15	STAB1_HUMAN	M	1053	ENSP00000312946:R1053M	ENSP00000312946:R1053M	R	+	2	0	STAB1	52522014	1.000000	0.71417	1.000000	0.80357	0.054000	0.15201	6.914000	0.75764	2.769000	0.95229	0.563000	0.77884	AGG	.		0.687	STAB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351380.2	NM_015136	Missense_Mutation
DZIP3	9666	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	108407467	108407467	+	Missense_Mutation	SNP	A	A	G			TCGA-OR-A5LL-01A-11D-A29I-10	TCGA-OR-A5LL-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9bfd4b2e-0577-4c94-8d6c-dafa9104b502	2d4f1606-9261-4ba8-96a9-ee307989af11	g.chr3:108407467A>G	ENST00000361582.3	+	30	3528	c.3298A>G	c.(3298-3300)Aat>Gat	p.N1100D	DZIP3_ENST00000463306.1_Missense_Mutation_p.N1100D	NM_014648.3	NP_055463.1	Q86Y13	DZIP3_HUMAN	DAZ interacting zinc finger protein 3	1100					protein polyubiquitination (GO:0000209)	cytoplasm (GO:0005737)	ligase activity (GO:0016874)|phosphatase binding (GO:0019902)|poly(A) RNA binding (GO:0044822)|polyubiquitin binding (GO:0031593)|RNA binding (GO:0003723)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(3)|central_nervous_system(1)|endometrium(3)|large_intestine(9)|lung(21)|ovary(1)|pancreas(1)|prostate(5)|skin(1)	45						GTCAAATGTTAATTGTGTTTC	0.418																																					p.N1100D		.											.	DZIP3-91	0			c.A3298G						.						74.0	72.0	73.0					3																	108407467		2203	4300	6503	SO:0001583	missense	9666	exon30			AATGTTAATTGTG	AF279370	CCDS2952.1	3q13.13	2013-05-22	2013-05-22		ENSG00000198919	ENSG00000198919		"""RING-type (C3HC4) zinc fingers"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	30938	protein-coding gene	gene with protein product	"""human RNA-binding ubiquitin ligase of 138 kDa"", ""protein phosphatase 1, regulatory subunit 66"""	608672	"""DAZ interacting protein 3, zinc finger"""			9734811, 12538761	Standard	NM_014648		Approved	hRUL138, PPP1R66	uc003dxd.3	Q86Y13	OTTHUMG00000159232	ENST00000361582.3:c.3298A>G	3.37:g.108407467A>G	ENSP00000355028:p.Asn1100Asp	Somatic	260	0		WXS	Illumina GAIIx	Phase_I	179	95	NM_014648	0	0	3	9	6	B3KN01|O75162|Q6P3R9|Q6PH82|Q86Y14|Q86Y15|Q86Y16|Q8IWI0|Q96RS9	Missense_Mutation	SNP	ENST00000361582.3	37	CCDS2952.1	.	.	.	.	.	.	.	.	.	.	A	5.644	0.303523	0.10678	.	.	ENSG00000198919	ENST00000361582;ENST00000463306	T;T	0.17054	2.3;2.3	5.05	3.91	0.45181	.	0.319079	0.27202	N	0.020451	T	0.07908	0.0198	N	0.12182	0.205	0.09310	N	1	B;B	0.06786	0.001;0.001	B;B	0.06405	0.001;0.002	T	0.31280	-0.9949	10	0.17369	T	0.5	-14.2268	6.919	0.24376	0.9001:0.0:0.0999:0.0	.	718;1100	D3DN61;Q86Y13	.;DZIP3_HUMAN	D	1100	ENSP00000355028:N1100D;ENSP00000419981:N1100D	ENSP00000355028:N1100D	N	+	1	0	DZIP3	109890157	0.003000	0.15002	0.053000	0.19242	0.981000	0.71138	1.147000	0.31602	2.243000	0.73865	0.533000	0.62120	AAT	.		0.418	DZIP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353968.1	NM_014648	
PODXL2	50512	broad.mit.edu;bcgsc.ca	37	3	127379708	127379708	+	Silent	SNP	C	C	T	rs114235935	byFrequency	TCGA-OR-A5LL-01A-11D-A29I-10	TCGA-OR-A5LL-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9bfd4b2e-0577-4c94-8d6c-dafa9104b502	2d4f1606-9261-4ba8-96a9-ee307989af11	g.chr3:127379708C>T	ENST00000342480.6	+	3	876	c.837C>T	c.(835-837)ttC>ttT	p.F279F		NM_015720.2	NP_056535.1	Q9NZ53	PDXL2_HUMAN	podocalyxin-like 2	279					leukocyte tethering or rolling (GO:0050901)	integral component of plasma membrane (GO:0005887)	glycosaminoglycan binding (GO:0005539)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(1)|large_intestine(4)|lung(12)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	26						GGGTAGAGTTCGAGGCTCCTC	0.617													C|||	4	0.000798722	0.0	0.0	5008	,	,		17851	0.001		0.002	False		,,,				2504	0.001				p.F279F		.											.	PODXL2-91	0			c.C837T						.	C		1,4405	2.1+/-5.4	0,1,2202	35.0	38.0	37.0		837	-4.3	0.0	3	dbSNP_132	37	35,8565	23.4+/-69.3	0,35,4265	no	coding-synonymous	PODXL2	NM_015720.2		0,36,6467	TT,TC,CC		0.407,0.0227,0.2768		279/606	127379708	36,12970	2203	4300	6503	SO:0001819	synonymous_variant	50512	exon3			AGAGTTCGAGGCT	AF219137	CCDS3044.1	3q21.3	2005-02-18			ENSG00000114631	ENSG00000114631			17936	protein-coding gene	gene with protein product	"""endoglycan"""					10722749	Standard	NM_015720		Approved	PODLX2, endoglycan	uc003ejq.3	Q9NZ53	OTTHUMG00000159642	ENST00000342480.6:c.837C>T	3.37:g.127379708C>T		Somatic	112	0		WXS	Illumina GAIIx	Phase_I	80	14	NM_015720	0	0	9	12	3	Q6UVY4|Q8WUV6	Silent	SNP	ENST00000342480.6	37	CCDS3044.1																																																																																			C|0.997;T|0.003		0.617	PODXL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356638.1	NM_015720	
CP	1356	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	148896230	148896230	+	Missense_Mutation	SNP	C	C	G			TCGA-OR-A5LL-01A-11D-A29I-10	TCGA-OR-A5LL-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9bfd4b2e-0577-4c94-8d6c-dafa9104b502	2d4f1606-9261-4ba8-96a9-ee307989af11	g.chr3:148896230C>G	ENST00000264613.6	-	16	3112	c.2850G>C	c.(2848-2850)gaG>gaC	p.E950D		NM_000096.3	NP_000087	P00450	CERU_HUMAN	ceruloplasmin (ferroxidase)	950	F5/8 type A 3.|Plastocyanin-like 6.				cellular iron ion homeostasis (GO:0006879)|copper ion transport (GO:0006825)|transmembrane transport (GO:0055085)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|lysosomal membrane (GO:0005765)	chaperone binding (GO:0051087)|copper ion binding (GO:0005507)|ferroxidase activity (GO:0004322)			breast(6)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(9)|lung(14)|ovary(1)|prostate(1)|soft_tissue(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	44		Prostate(884;0.00217)|Hepatocellular(537;0.00826)|Myeloproliferative disorder(1037;0.0122)|all_neural(597;0.0189)|Melanoma(1037;0.152)	LUSC - Lung squamous cell carcinoma(72;0.0473)|Lung(72;0.0607)		Drotrecogin alfa(DB00055)	CTATGAATTCCTCATCATCTT	0.294																																					p.E950D		.											.	CP-515	0			c.G2850C						.						123.0	114.0	117.0					3																	148896230		2201	4300	6501	SO:0001583	missense	1356	exon16			GAATTCCTCATCA	M13536	CCDS3141.1	3q23-q25	2010-07-01			ENSG00000047457	ENSG00000047457	1.16.3.1		2295	protein-coding gene	gene with protein product		117700					Standard	NM_000096		Approved		uc003ewy.4	P00450	OTTHUMG00000159563	ENST00000264613.6:c.2850G>C	3.37:g.148896230C>G	ENSP00000264613:p.Glu950Asp	Somatic	107	0		WXS	Illumina GAIIx	Phase_I	88	15	NM_000096	0	0	4	4	0	Q14063|Q2PP18|Q9UKS4	Missense_Mutation	SNP	ENST00000264613.6	37	CCDS3141.1	.	.	.	.	.	.	.	.	.	.	C	9.364	1.068745	0.20147	.	.	ENSG00000047457	ENST00000479771;ENST00000264613;ENST00000494544	D;D;D	0.99751	-6.63;-6.63;-6.63	5.68	-11.4	0.00090	Cupredoxin (2);	0.208186	0.49305	N	0.000141	D	0.97567	0.9203	L	0.37850	1.14	0.31835	N	0.624248	B;B;B;B	0.02656	0.0;0.0;0.0;0.0	B;B;B;B	0.06405	0.002;0.002;0.001;0.002	D	0.88039	0.2780	10	0.17369	T	0.5	-5.7476	7.8359	0.29369	0.5022:0.1773:0.0:0.3205	.	950;950;950;663	A8K5A4;P00450;Q1L857;B3KTA8	.;CERU_HUMAN;.;.	D	85;950;733	ENSP00000420367:E85D;ENSP00000264613:E950D;ENSP00000420545:E733D	ENSP00000264613:E950D	E	-	3	2	CP	150378920	0.001000	0.12720	0.008000	0.14137	0.903000	0.53119	-1.285000	0.02791	-3.331000	0.00185	-1.036000	0.02392	GAG	.		0.294	CP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317498.1	NM_000096	
SLITRK3	22865	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	164908554	164908554	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5LL-01A-11D-A29I-10	TCGA-OR-A5LL-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9bfd4b2e-0577-4c94-8d6c-dafa9104b502	2d4f1606-9261-4ba8-96a9-ee307989af11	g.chr3:164908554G>A	ENST00000475390.1	-	2	508	c.65C>T	c.(64-66)aCa>aTa	p.T22I	SLITRK3_ENST00000241274.3_Missense_Mutation_p.T22I			O94933	SLIK3_HUMAN	SLIT and NTRK-like family, member 3	22					axonogenesis (GO:0007409)	integral component of membrane (GO:0016021)				NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(14)|lung(66)|ovary(6)|pancreas(1)|prostate(4)|skin(5)|upper_aerodigestive_tract(5)	119						TAGAGCAATTGTGCTTAGAAG	0.418										HNSCC(40;0.11)																											p.T22I		.											.	SLITRK3-100	0			c.C65T						.						98.0	91.0	93.0					3																	164908554		2201	4300	6501	SO:0001583	missense	22865	exon2			GCAATTGTGCTTA	AB020655	CCDS3197.1	3q26.1	2004-07-28			ENSG00000121871	ENSG00000121871			23501	protein-coding gene	gene with protein product		609679				10048485, 14557068	Standard	NM_014926		Approved	KIAA0848	uc003fek.3	O94933	OTTHUMG00000158072	ENST00000475390.1:c.65C>T	3.37:g.164908554G>A	ENSP00000420091:p.Thr22Ile	Somatic	113	0		WXS	Illumina GAIIx	Phase_I	67	15	NM_014926	0	0	0	0	0	Q1RMY6	Missense_Mutation	SNP	ENST00000475390.1	37	CCDS3197.1	.	.	.	.	.	.	.	.	.	.	G	16.09	3.025435	0.54683	.	.	ENSG00000121871	ENST00000475390;ENST00000241274;ENST00000497724	T;T;T	0.69306	0.6;0.6;-0.39	6.01	6.01	0.97437	.	0.000000	0.38897	N	0.001521	T	0.66790	0.2825	N	0.20685	0.6	0.45295	D	0.998299	D	0.64830	0.994	P	0.53266	0.722	T	0.68062	-0.5508	10	0.51188	T	0.08	-3.0494	20.5182	0.99214	0.0:0.0:1.0:0.0	.	22	O94933	SLIK3_HUMAN	I	22	ENSP00000420091:T22I;ENSP00000241274:T22I;ENSP00000419611:T22I	ENSP00000241274:T22I	T	-	2	0	SLITRK3	166391248	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.577000	0.82486	2.860000	0.98153	0.655000	0.94253	ACA	.		0.418	SLITRK3-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350126.1	NM_014926	
CHRNA9	55584	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	4	40337918	40337918	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5LL-01A-11D-A29I-10	TCGA-OR-A5LL-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9bfd4b2e-0577-4c94-8d6c-dafa9104b502	2d4f1606-9261-4ba8-96a9-ee307989af11	g.chr4:40337918C>T	ENST00000310169.2	+	2	278	c.139C>T	c.(139-141)Cgt>Tgt	p.R47C		NM_017581.3	NP_060051.2	Q9UGM1	ACHA9_HUMAN	cholinergic receptor, nicotinic, alpha 9 (neuronal)	47					detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|inner ear morphogenesis (GO:0042472)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|synaptic transmission (GO:0007268)	acetylcholine-gated channel complex (GO:0005892)|cell junction (GO:0030054)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	acetylcholine-activated cation-selective channel activity (GO:0004889)|calcium channel activity (GO:0005262)			breast(4)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(12)|ovary(1)|prostate(3)|skin(4)|stomach(1)	33					Galantamine(DB00674)|Nicotine(DB00184)	TAATGCTCTTCGTCCAGTGGA	0.423																																					p.R47C	Esophageal Squamous(115;1297 1602 22235 25158 43327)	.											.	CHRNA9-96	0			c.C139T						.						176.0	164.0	168.0					4																	40337918		2203	4300	6503	SO:0001583	missense	55584	exon2			GCTCTTCGTCCAG	AF227732	CCDS3459.1	4p14	2012-02-11	2012-02-07		ENSG00000174343	ENSG00000174343		"""Cholinergic receptors"", ""Ligand-gated ion channels / Acetylcholine receptors, nicotinic"""	14079	protein-coding gene	gene with protein product	"""acetylcholine receptor, nicotinic, alpha 9 (neuronal)"""	605116	"""cholinergic receptor, nicotinic, alpha polypeptide 9"""				Standard	NM_017581		Approved	NACHRA9	uc003gva.2	Q9UGM1	OTTHUMG00000099375	ENST00000310169.2:c.139C>T	4.37:g.40337918C>T	ENSP00000312663:p.Arg47Cys	Somatic	133	0		WXS	Illumina GAIIx	Phase_I	144	8	NM_017581	0	0	0	0	0	Q14CY7|Q4W5A2|Q9NYV2	Missense_Mutation	SNP	ENST00000310169.2	37	CCDS3459.1	.	.	.	.	.	.	.	.	.	.	C	18.33	3.599831	0.66332	.	.	ENSG00000174343	ENST00000310169	D	0.83506	-1.73	5.76	4.84	0.62591	Neurotransmitter-gated ion-channel ligand-binding (3);	0.096897	0.64402	D	0.000002	D	0.94374	0.8191	H	0.98577	4.27	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.95640	0.8697	10	0.87932	D	0	.	13.4791	0.61326	0.2345:0.7655:0.0:0.0	.	47	Q9UGM1	ACHA9_HUMAN	C	47	ENSP00000312663:R47C	ENSP00000312663:R47C	R	+	1	0	CHRNA9	40032675	0.998000	0.40836	0.999000	0.59377	0.707000	0.40811	1.996000	0.40776	2.733000	0.93635	0.467000	0.42956	CGT	.		0.423	CHRNA9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000216822.1		
FRAS1	80144	broad.mit.edu;ucsc.edu;bcgsc.ca	37	4	79328954	79328954	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5LL-01A-11D-A29I-10	TCGA-OR-A5LL-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9bfd4b2e-0577-4c94-8d6c-dafa9104b502	2d4f1606-9261-4ba8-96a9-ee307989af11	g.chr4:79328954C>T	ENST00000325942.6	+	31	4707	c.4267C>T	c.(4267-4269)Cac>Tac	p.H1423Y	FRAS1_ENST00000264895.6_Missense_Mutation_p.H1423Y	NM_001166133.1	NP_001159605.1	Q86XX4	FRAS1_HUMAN	Fraser extracellular matrix complex subunit 1	1423					cell communication (GO:0007154)|embryonic limb morphogenesis (GO:0030326)|metanephros morphogenesis (GO:0003338)|morphogenesis of an epithelium (GO:0002009)|palate development (GO:0060021)|protein transport (GO:0015031)|skin development (GO:0043588)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|sublamina densa (GO:0061618)	metal ion binding (GO:0046872)			breast(2)|central_nervous_system(2)|cervix(2)|endometrium(14)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(5)|lung(54)|prostate(7)|skin(2)|urinary_tract(4)	103						ATGGTACAGGCACTCAGGAGC	0.557																																					p.H1423Y		.											.	FRAS1-68	0			c.C4267T						.						71.0	79.0	77.0					4																	79328954		2115	4231	6346	SO:0001583	missense	80144	exon31			TACAGGCACTCAG	AB040933	CCDS54772.1	4q21.21	2014-06-25	2014-06-25		ENSG00000138759	ENSG00000138759			19185	protein-coding gene	gene with protein product		607830	"""Fraser syndrome 1"""			12766769, 3118036	Standard	NM_025074		Approved	FLJ22031, FLJ14927, KIAA1500	uc003hlb.2	Q86XX4	OTTHUMG00000160856	ENST00000325942.6:c.4267C>T	4.37:g.79328954C>T	ENSP00000326330:p.His1423Tyr	Somatic	172	1		WXS	Illumina GAIIx	Phase_I	126	41	NM_001166133	0	0	0	0	0	A2RRR8|Q86UZ4|Q8N3U9|Q8NAU7|Q96JW7|Q9H6N9|Q9P228	Missense_Mutation	SNP	ENST00000325942.6	37	CCDS54772.1	.	.	.	.	.	.	.	.	.	.	C	21.5	4.156834	0.78114	.	.	ENSG00000138759	ENST00000325942;ENST00000264895	T;T	0.42900	0.96;0.96	5.67	5.67	0.87782	.	0.054051	0.64402	D	0.000001	T	0.67458	0.2895	M	0.83223	2.63	0.80722	D	1	D;D	0.76494	0.999;0.998	P;D	0.63597	0.869;0.916	T	0.71882	-0.4458	10	0.87932	D	0	.	18.7528	0.91821	0.0:1.0:0.0:0.0	.	1423;1423	E9PHH6;A2RRR8	.;.	Y	1423	ENSP00000326330:H1423Y;ENSP00000264895:H1423Y	ENSP00000264895:H1423Y	H	+	1	0	FRAS1	79547978	1.000000	0.71417	1.000000	0.80357	0.789000	0.44602	5.397000	0.66302	2.671000	0.90904	0.585000	0.79938	CAC	.		0.557	FRAS1-001	NOVEL	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000362706.2		
DSPP	1834	bcgsc.ca	37	4	88536999	88536999	+	Missense_Mutation	SNP	A	A	G	rs202222170		TCGA-OR-A5LL-01A-11D-A29I-10	TCGA-OR-A5LL-10A-01D-A29L-10	A	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9bfd4b2e-0577-4c94-8d6c-dafa9104b502	2d4f1606-9261-4ba8-96a9-ee307989af11	g.chr4:88536999A>G	ENST00000282478.7	+	4	3218	c.3185A>G	c.(3184-3186)gAc>gGc	p.D1062G	RP11-742B18.1_ENST00000506480.1_RNA|DSPP_ENST00000399271.1_Missense_Mutation_p.D1062G			Q9NZW4	DSPP_HUMAN	dentin sialophosphoprotein	1062	Asp/Ser-rich.			D -> G (in Ref. 1; AAF42472). {ECO:0000305}.	biomineral tissue development (GO:0031214)|cellular response to cell-matrix adhesion (GO:0071460)|extracellular matrix organization (GO:0030198)|multicellular organismal development (GO:0007275)|ossification (GO:0001503)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|collagen binding (GO:0005518)|extracellular matrix structural constituent (GO:0005201)			breast(2)|central_nervous_system(1)|endometrium(9)|kidney(4)|large_intestine(8)|lung(13)|ovary(1)|skin(3)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	47		Hepatocellular(203;0.114)|all_hematologic(202;0.236)		OV - Ovarian serous cystadenocarcinoma(123;0.000508)		gacagcagtgacagcagcgac	0.532																																					p.D1062G		.											.	DSPP-90	0			c.A3185G						.						48.0	61.0	56.0					4																	88536999		1554	2803	4357	SO:0001583	missense	1834	exon5			GCAGTGACAGCAG	AF163151	CCDS43248.1	4q21.3	2008-02-05			ENSG00000152591	ENSG00000152591			3054	protein-coding gene	gene with protein product		125485		DFNA39, DGI1		8995371, 9533027	Standard	NM_014208		Approved	DMP3	uc003hqu.3	Q9NZW4	OTTHUMG00000161061	ENST00000282478.7:c.3185A>G	4.37:g.88536999A>G	ENSP00000282478:p.Asp1062Gly	Somatic	452	0		WXS	Illumina GAIIx	Phase_I	356	17	NM_014208	0	0	0	0	0	A8MUI0|O95815	Missense_Mutation	SNP	ENST00000282478.7	37	CCDS43248.1	.	.	.	.	.	.	.	.	.	.	a	6.732	0.503863	0.12822	.	.	ENSG00000152591	ENST00000399271;ENST00000282478	D;D	0.88975	-2.45;-2.45	1.51	1.51	0.23008	.	.	.	.	.	D	0.87716	0.6247	L	0.29908	0.895	0.21762	N	0.99955	D	0.76494	0.999	D	0.74023	0.982	T	0.76072	-0.3093	9	0.24483	T	0.36	.	5.1866	0.15187	1.0:0.0:0.0:0.0	.	1062	Q9NZW4	DSPP_HUMAN	G	1062	ENSP00000382213:D1062G;ENSP00000282478:D1062G	ENSP00000282478:D1062G	D	+	2	0	DSPP	88756023	0.386000	0.25180	0.936000	0.37596	0.006000	0.05464	2.307000	0.43682	0.963000	0.38082	0.242000	0.17961	GAC	.		0.532	DSPP-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000363616.3	NM_014208	
DSPP	1834	bcgsc.ca	37	4	88537426	88537426	+	Silent	SNP	T	T	C	rs371154871|rs201908627	byFrequency	TCGA-OR-A5LL-01A-11D-A29I-10	TCGA-OR-A5LL-10A-01D-A29L-10	T	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9bfd4b2e-0577-4c94-8d6c-dafa9104b502	2d4f1606-9261-4ba8-96a9-ee307989af11	g.chr4:88537426T>C	ENST00000282478.7	+	4	3645	c.3612T>C	c.(3610-3612)agT>agC	p.S1204S	RP11-742B18.1_ENST00000506480.1_RNA|DSPP_ENST00000399271.1_Silent_p.S1204S			Q9NZW4	DSPP_HUMAN	dentin sialophosphoprotein	1204	Asp/Ser-rich.				biomineral tissue development (GO:0031214)|cellular response to cell-matrix adhesion (GO:0071460)|extracellular matrix organization (GO:0030198)|multicellular organismal development (GO:0007275)|ossification (GO:0001503)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|collagen binding (GO:0005518)|extracellular matrix structural constituent (GO:0005201)	p.S1204S(2)		breast(2)|central_nervous_system(1)|endometrium(9)|kidney(4)|large_intestine(8)|lung(13)|ovary(1)|skin(3)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	47		Hepatocellular(203;0.114)|all_hematologic(202;0.236)		OV - Ovarian serous cystadenocarcinoma(123;0.000508)		gcagcgatagtagtgatagca	0.557													t|||	30	0.00599042	0.0129	0.0	5008	,	,		21309	0.006		0.005	False		,,,				2504	0.002				p.S1204S		.											.	DSPP-90	2	Substitution - coding silent(2)	endometrium(2)	c.T3612C						.	T		6,3220		0,6,1607	48.0	67.0	60.0		3612	-6.5	0.0	4	dbSNP_134	60	6,5832		0,6,2913	no	coding-synonymous	DSPP	NM_014208.3		0,12,4520	CC,CT,TT		0.1028,0.186,0.1324		1204/1302	88537426	12,9052	1613	2919	4532	SO:0001819	synonymous_variant	1834	exon5			CGATAGTAGTGAT	AF163151	CCDS43248.1	4q21.3	2008-02-05			ENSG00000152591	ENSG00000152591			3054	protein-coding gene	gene with protein product		125485		DFNA39, DGI1		8995371, 9533027	Standard	NM_014208		Approved	DMP3	uc003hqu.3	Q9NZW4	OTTHUMG00000161061	ENST00000282478.7:c.3612T>C	4.37:g.88537426T>C		Somatic	516	28		WXS	Illumina GAIIx	Phase_I	451	45	NM_014208	0	0	0	0	0	A8MUI0|O95815	Silent	SNP	ENST00000282478.7	37	CCDS43248.1																																																																																			.		0.557	DSPP-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000363616.3	NM_014208	
FBXL7	23194	bcgsc.ca	37	5	15937010	15937010	+	Silent	SNP	C	C	T	rs61748187	byFrequency	TCGA-OR-A5LL-01A-11D-A29I-10	TCGA-OR-A5LL-10A-01D-A29L-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9bfd4b2e-0577-4c94-8d6c-dafa9104b502	2d4f1606-9261-4ba8-96a9-ee307989af11	g.chr5:15937010C>T	ENST00000504595.1	+	4	1672	c.1191C>T	c.(1189-1191)ctC>ctT	p.L397L	MIR887_ENST00000401258.1_RNA|FBXL7_ENST00000510662.1_Silent_p.L350L|FBXL7_ENST00000329673.7_Silent_p.L385L	NM_001278317.1|NM_012304.3	NP_001265246.1|NP_036436.1	Q9UJT9	FBXL7_HUMAN	F-box and leucine-rich repeat protein 7	397					cell proliferation (GO:0008283)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic nuclear division (GO:0007067)|protein ubiquitination (GO:0016567)|SCF-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031146)|ubiquitin-dependent protein catabolic process (GO:0006511)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|SCF ubiquitin ligase complex (GO:0019005)|ubiquitin ligase complex (GO:0000151)	ubiquitin-protein transferase activity (GO:0004842)			cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(13)|lung(33)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	60						TGGAGTACCTCGCCAAGAACT	0.602													C|||	51	0.0101837	0.0015	0.013	5008	,	,		20130	0.0		0.0318	False		,,,				2504	0.0082				p.L397L		.											.	FBXL7-228	0			c.C1191T						.	C		27,4305		0,27,2139	97.0	104.0	102.0		1191	-7.5	0.9	5	dbSNP_129	102	274,8230		6,262,3984	no	coding-synonymous	FBXL7	NM_012304.3		6,289,6123	TT,TC,CC		3.222,0.6233,2.345		397/492	15937010	301,12535	2166	4252	6418	SO:0001819	synonymous_variant	23194	exon4			GTACCTCGCCAAG	AB020647	CCDS54833.1, CCDS64129.1	5p15.1	2011-06-09				ENSG00000183580		"""F-boxes / Leucine-rich repeats"""	13604	protein-coding gene	gene with protein product		605656				10048485, 10531035	Standard	NM_012304		Approved	KIAA0840, FBL7, FBL6	uc003jfn.1	Q9UJT9		ENST00000504595.1:c.1191C>T	5.37:g.15937010C>T		Somatic	128	1		WXS	Illumina GAIIx	Phase_I	122	5	NM_012304	0	0	7	7	0	B9EGF1|D6RDY7|O94926	Silent	SNP	ENST00000504595.1	37	CCDS54833.1																																																																																			C|0.982;T|0.018		0.602	FBXL7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366117.1	NM_012304	
LOX	4015	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	5	121405754	121405754	+	Missense_Mutation	SNP	A	A	C			TCGA-OR-A5LL-01A-11D-A29I-10	TCGA-OR-A5LL-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9bfd4b2e-0577-4c94-8d6c-dafa9104b502	2d4f1606-9261-4ba8-96a9-ee307989af11	g.chr5:121405754A>C	ENST00000231004.4	-	6	1540	c.1241T>G	c.(1240-1242)aTt>aGt	p.I414S	LOX_ENST00000513319.1_5'UTR|SRFBP1_ENST00000504881.1_Intron	NM_001178102.1|NM_002317.5	NP_001171573.1|NP_002308.2	P28300	LYOX_HUMAN	lysyl oxidase	414	Lysyl-oxidase like.				blood vessel development (GO:0001568)|cellular protein modification process (GO:0006464)|collagen fibril organization (GO:0030199)|elastic fiber assembly (GO:0048251)|extracellular matrix organization (GO:0030198)|lung development (GO:0030324)|response to drug (GO:0042493)|response to steroid hormone (GO:0048545)|wound healing (GO:0042060)	collagen trimer (GO:0005581)|extracellular region (GO:0005576)|nucleus (GO:0005634)|proteinaceous extracellular matrix (GO:0005578)	copper ion binding (GO:0005507)|protein-lysine 6-oxidase activity (GO:0004720)			endometrium(1)|lung(6)|prostate(1)	8		all_cancers(142;0.0124)|Prostate(80;0.0322)|Ovarian(225;0.0814)|Breast(839;0.143)	KIRC - Kidney renal clear cell carcinoma(527;0.206)	Epithelial(69;2.14e-11)|OV - Ovarian serous cystadenocarcinoma(64;7.87e-10)|all cancers(49;2.49e-09)|COAD - Colon adenocarcinoma(49;0.02)		TTACGGTGAAATTGTGCAGCC	0.398																																					p.I414S		.											.	LOX-650	0			c.T1241G						.						112.0	105.0	107.0					5																	121405754		2203	4300	6503	SO:0001583	missense	4015	exon6			GGTGAAATTGTGC		CCDS4129.1	5q23.3-q31.2	2008-02-05			ENSG00000113083	ENSG00000113083	1.4.3.13		6664	protein-coding gene	gene with protein product		153455				1685472	Standard	NM_002317		Approved		uc003ksu.3	P28300	OTTHUMG00000128914	ENST00000231004.4:c.1241T>G	5.37:g.121405754A>C	ENSP00000231004:p.Ile414Ser	Somatic	117	0		WXS	Illumina GAIIx	Phase_I	247	16	NM_002317	0	0	0	0	0	B2R5Q3|Q5FWF0	Missense_Mutation	SNP	ENST00000231004.4	37	CCDS4129.1	.	.	.	.	.	.	.	.	.	.	A	25.5	4.647175	0.87958	.	.	ENSG00000113083	ENST00000231004;ENST00000543620	T	0.36699	1.24	5.33	5.33	0.75918	.	0.100076	0.64402	D	0.000001	T	0.58807	0.2148	M	0.72479	2.2	0.58432	D	0.999992	D	0.60160	0.987	D	0.67231	0.95	T	0.63444	-0.6636	10	0.87932	D	0	.	15.5949	0.76572	1.0:0.0:0.0:0.0	.	414	P28300	LYOX_HUMAN	S	414;374	ENSP00000231004:I414S	ENSP00000231004:I414S	I	-	2	0	LOX	121433653	1.000000	0.71417	0.999000	0.59377	0.967000	0.64934	6.214000	0.72200	2.134000	0.65973	0.460000	0.39030	ATT	.		0.398	LOX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250887.2		
PHAX	51808	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	5	125939673	125939673	+	Missense_Mutation	SNP	G	G	C			TCGA-OR-A5LL-01A-11D-A29I-10	TCGA-OR-A5LL-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9bfd4b2e-0577-4c94-8d6c-dafa9104b502	2d4f1606-9261-4ba8-96a9-ee307989af11	g.chr5:125939673G>C	ENST00000297540.4	+	2	1203	c.508G>C	c.(508-510)Gat>Cat	p.D170H	PHAX_ENST00000514725.1_3'UTR	NM_032177.3	NP_115553.2	Q9H814	PHAX_HUMAN	phosphorylated adaptor for RNA export	170	Necessary for interaction with CBP80. {ECO:0000250}.				gene expression (GO:0010467)|ncRNA metabolic process (GO:0034660)|protein transport (GO:0015031)|RNA metabolic process (GO:0016070)|snRNA export from nucleus (GO:0006408)|spliceosomal snRNP assembly (GO:0000387)	cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)|neuronal cell body (GO:0043025)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	RNA binding (GO:0003723)|toxic substance binding (GO:0015643)			haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(2)|prostate(1)	8						GCATACAAAAGATCTAGACAA	0.413																																					p.D170H		.											.	PHAX-90	0			c.G508C						.						85.0	81.0	82.0					5																	125939673		2203	4300	6503	SO:0001583	missense	51808	exon2			ACAAAAGATCTAG	AK023255	CCDS4138.1	5q23.2	2011-05-24	2008-10-01	2008-10-01	ENSG00000164902	ENSG00000164902			10241	protein-coding gene	gene with protein product		604924	"""RNA U, small nuclear RNA export adaptor (phosphorylation regulated)"""	RNUXA		10786834	Standard	NM_032177		Approved	FLJ13193	uc003kua.2	Q9H814	OTTHUMG00000163273	ENST00000297540.4:c.508G>C	5.37:g.125939673G>C	ENSP00000297540:p.Asp170His	Somatic	96	0		WXS	Illumina GAIIx	Phase_I	268	16	NM_032177	0	0	51	51	0	Q9H8W1	Missense_Mutation	SNP	ENST00000297540.4	37	CCDS4138.1	.	.	.	.	.	.	.	.	.	.	G	13.47	2.246848	0.39697	.	.	ENSG00000164902	ENST00000297540;ENST00000456348	T	0.22134	1.97	5.74	3.49	0.39957	.	0.354823	0.34750	N	0.003706	T	0.09686	0.0238	N	0.14661	0.345	0.25999	N	0.982145	P	0.34837	0.472	B	0.33960	0.173	T	0.10291	-1.0636	10	0.49607	T	0.09	-20.6667	2.7803	0.05359	0.2536:0.2824:0.464:0.0	.	170	Q9H814	PHAX_HUMAN	H	170;135	ENSP00000297540:D170H	ENSP00000297540:D170H	D	+	1	0	PHAX	125967572	1.000000	0.71417	0.967000	0.41034	0.827000	0.46813	3.680000	0.54641	2.715000	0.92844	0.655000	0.94253	GAT	.		0.413	PHAX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250924.1	NM_032177	
PHAX	51808	broad.mit.edu;bcgsc.ca	37	5	125939735	125939735	+	Missense_Mutation	SNP	G	G	C			TCGA-OR-A5LL-01A-11D-A29I-10	TCGA-OR-A5LL-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9bfd4b2e-0577-4c94-8d6c-dafa9104b502	2d4f1606-9261-4ba8-96a9-ee307989af11	g.chr5:125939735G>C	ENST00000297540.4	+	2	1265	c.570G>C	c.(568-570)gaG>gaC	p.E190D	PHAX_ENST00000514725.1_3'UTR	NM_032177.3	NP_115553.2	Q9H814	PHAX_HUMAN	phosphorylated adaptor for RNA export	190	Necessary for interaction with CBP80. {ECO:0000250}.				gene expression (GO:0010467)|ncRNA metabolic process (GO:0034660)|protein transport (GO:0015031)|RNA metabolic process (GO:0016070)|snRNA export from nucleus (GO:0006408)|spliceosomal snRNP assembly (GO:0000387)	cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)|neuronal cell body (GO:0043025)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	RNA binding (GO:0003723)|toxic substance binding (GO:0015643)			haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(2)|prostate(1)	8						CAAAGGAAGAGGAAAATGGGC	0.418																																					p.E190D		.											.	PHAX-90	0			c.G570C						.						70.0	67.0	68.0					5																	125939735		2203	4300	6503	SO:0001583	missense	51808	exon2			GGAAGAGGAAAAT	AK023255	CCDS4138.1	5q23.2	2011-05-24	2008-10-01	2008-10-01	ENSG00000164902	ENSG00000164902			10241	protein-coding gene	gene with protein product		604924	"""RNA U, small nuclear RNA export adaptor (phosphorylation regulated)"""	RNUXA		10786834	Standard	NM_032177		Approved	FLJ13193	uc003kua.2	Q9H814	OTTHUMG00000163273	ENST00000297540.4:c.570G>C	5.37:g.125939735G>C	ENSP00000297540:p.Glu190Asp	Somatic	85	1		WXS	Illumina GAIIx	Phase_I	295	23	NM_032177	0	0	85	85	0	Q9H8W1	Missense_Mutation	SNP	ENST00000297540.4	37	CCDS4138.1	.	.	.	.	.	.	.	.	.	.	G	12.27	1.886931	0.33348	.	.	ENSG00000164902	ENST00000297540;ENST00000456348	T	0.23754	1.89	5.74	2.96	0.34315	.	0.238942	0.48767	N	0.000172	T	0.20129	0.0484	L	0.59436	1.845	0.32318	N	0.56283	B	0.09022	0.002	B	0.12156	0.007	T	0.14727	-1.0462	10	0.21540	T	0.41	-26.1885	4.2251	0.10577	0.1882:0.1089:0.591:0.1119	.	190	Q9H814	PHAX_HUMAN	D	190;155	ENSP00000297540:E190D	ENSP00000297540:E190D	E	+	3	2	PHAX	125967634	0.518000	0.26234	1.000000	0.80357	0.990000	0.78478	-0.292000	0.08332	0.762000	0.33152	0.655000	0.94253	GAG	.		0.418	PHAX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250924.1	NM_032177	
PHAX	51808	broad.mit.edu;bcgsc.ca	37	5	125939799	125939799	+	Missense_Mutation	SNP	G	G	C			TCGA-OR-A5LL-01A-11D-A29I-10	TCGA-OR-A5LL-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9bfd4b2e-0577-4c94-8d6c-dafa9104b502	2d4f1606-9261-4ba8-96a9-ee307989af11	g.chr5:125939799G>C	ENST00000297540.4	+	2	1329	c.634G>C	c.(634-636)Gaa>Caa	p.E212Q		NM_032177.3	NP_115553.2	Q9H814	PHAX_HUMAN	phosphorylated adaptor for RNA export	212	Necessary for interaction with CBP80. {ECO:0000250}.				gene expression (GO:0010467)|ncRNA metabolic process (GO:0034660)|protein transport (GO:0015031)|RNA metabolic process (GO:0016070)|snRNA export from nucleus (GO:0006408)|spliceosomal snRNP assembly (GO:0000387)	cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)|neuronal cell body (GO:0043025)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	RNA binding (GO:0003723)|toxic substance binding (GO:0015643)			haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(2)|prostate(1)	8						GAACAGACCAGAAATGAACTA	0.408																																					p.E212Q		.											.	PHAX-90	0			c.G634C						.						57.0	54.0	55.0					5																	125939799		2203	4300	6503	SO:0001583	missense	51808	exon2			AGACCAGAAATGA	AK023255	CCDS4138.1	5q23.2	2011-05-24	2008-10-01	2008-10-01	ENSG00000164902	ENSG00000164902			10241	protein-coding gene	gene with protein product		604924	"""RNA U, small nuclear RNA export adaptor (phosphorylation regulated)"""	RNUXA		10786834	Standard	NM_032177		Approved	FLJ13193	uc003kua.2	Q9H814	OTTHUMG00000163273	ENST00000297540.4:c.634G>C	5.37:g.125939799G>C	ENSP00000297540:p.Glu212Gln	Somatic	107	1		WXS	Illumina GAIIx	Phase_I	324	18	NM_032177	0	0	79	79	0	Q9H8W1	Missense_Mutation	SNP	ENST00000297540.4	37	CCDS4138.1	.	.	.	.	.	.	.	.	.	.	G	22.9	4.348139	0.82132	.	.	ENSG00000164902	ENST00000297540;ENST00000456348	T	0.46819	0.86	5.74	5.74	0.90152	.	0.094116	0.64402	D	0.000001	T	0.55721	0.1938	M	0.64997	1.995	0.58432	D	0.999997	P	0.40302	0.712	P	0.44394	0.448	T	0.53528	-0.8426	10	0.42905	T	0.14	-8.9414	19.9279	0.97110	0.0:0.0:1.0:0.0	.	212	Q9H814	PHAX_HUMAN	Q	212;177	ENSP00000297540:E212Q	ENSP00000297540:E212Q	E	+	1	0	PHAX	125967698	1.000000	0.71417	0.950000	0.38849	0.846000	0.48090	7.893000	0.87330	2.715000	0.92844	0.655000	0.94253	GAA	.		0.408	PHAX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250924.1	NM_032177	
PHAX	51808	broad.mit.edu;bcgsc.ca	37	5	125939825	125939825	+	Silent	SNP	G	G	A			TCGA-OR-A5LL-01A-11D-A29I-10	TCGA-OR-A5LL-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9bfd4b2e-0577-4c94-8d6c-dafa9104b502	2d4f1606-9261-4ba8-96a9-ee307989af11	g.chr5:125939825G>A	ENST00000297540.4	+	2	1355	c.660G>A	c.(658-660)gaG>gaA	p.E220E		NM_032177.3	NP_115553.2	Q9H814	PHAX_HUMAN	phosphorylated adaptor for RNA export	220	Necessary for interaction with CBP80. {ECO:0000250}.				gene expression (GO:0010467)|ncRNA metabolic process (GO:0034660)|protein transport (GO:0015031)|RNA metabolic process (GO:0016070)|snRNA export from nucleus (GO:0006408)|spliceosomal snRNP assembly (GO:0000387)	cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)|neuronal cell body (GO:0043025)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	RNA binding (GO:0003723)|toxic substance binding (GO:0015643)			haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(2)|prostate(1)	8						GTCGATACGAGATCACAGCGG	0.408																																					p.E220E		.											.	PHAX-90	0			c.G660A						.						57.0	54.0	55.0					5																	125939825		2203	4300	6503	SO:0001819	synonymous_variant	51808	exon2			ATACGAGATCACA	AK023255	CCDS4138.1	5q23.2	2011-05-24	2008-10-01	2008-10-01	ENSG00000164902	ENSG00000164902			10241	protein-coding gene	gene with protein product		604924	"""RNA U, small nuclear RNA export adaptor (phosphorylation regulated)"""	RNUXA		10786834	Standard	NM_032177		Approved	FLJ13193	uc003kua.2	Q9H814	OTTHUMG00000163273	ENST00000297540.4:c.660G>A	5.37:g.125939825G>A		Somatic	125	1		WXS	Illumina GAIIx	Phase_I	318	22	NM_032177	0	0	116	116	0	Q9H8W1	Silent	SNP	ENST00000297540.4	37	CCDS4138.1																																																																																			.		0.408	PHAX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250924.1	NM_032177	
CDKN2AIPNL	91368	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	5	133745680	133745680	+	Missense_Mutation	SNP	G	G	C			TCGA-OR-A5LL-01A-11D-A29I-10	TCGA-OR-A5LL-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9bfd4b2e-0577-4c94-8d6c-dafa9104b502	2d4f1606-9261-4ba8-96a9-ee307989af11	g.chr5:133745680G>C	ENST00000458198.2	-	2	296	c.253C>G	c.(253-255)Ctt>Gtt	p.L85V		NM_080656.2	NP_542387.1	Q96HQ2	C2AIL_HUMAN	CDKN2A interacting protein N-terminal like	85										central_nervous_system(1)|kidney(2)|prostate(1)	4			KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)			TTGTCTAAAAGGTCTTTATTG	0.353																																					p.L85V		.											.	CDKN2AIPNL-68	0			c.C253G						.						91.0	86.0	87.0					5																	133745680		2203	4300	6503	SO:0001583	missense	91368	exon2			CTAAAAGGTCTTT	BC008293	CCDS4175.1	5q31.1	2008-02-05			ENSG00000237190	ENSG00000237190			30545	protein-coding gene	gene with protein product						12477932	Standard	NM_080656		Approved	MGC13017	uc011cxs.2	Q96HQ2	OTTHUMG00000129123	ENST00000458198.2:c.253C>G	5.37:g.133745680G>C	ENSP00000394183:p.Leu85Val	Somatic	65	0		WXS	Illumina GAIIx	Phase_I	103	11	NM_080656	0	0	23	23	0	Q8WVE3	Missense_Mutation	SNP	ENST00000458198.2	37	CCDS4175.1	.	.	.	.	.	.	.	.	.	.	G	12.75	2.031074	0.35797	.	.	ENSG00000237190	ENST00000458198	.	.	.	5.34	4.46	0.54185	.	0.073365	0.56097	D	0.000031	T	0.35480	0.0933	N	0.12569	0.235	0.80722	D	1	D	0.57257	0.979	P	0.53185	0.72	T	0.07829	-1.0752	9	0.06757	T	0.87	-5.7184	12.126	0.53917	0.0867:0.0:0.9133:0.0	.	85	Q96HQ2	C2AIL_HUMAN	V	85	.	ENSP00000394183:L85V	L	-	1	0	CDKN2AIPNL	133773579	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	5.508000	0.67006	2.675000	0.91044	0.462000	0.41574	CTT	.		0.353	CDKN2AIPNL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251171.2	NM_080656	
KLHL3	26249	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	137056267	137056267	+	Silent	SNP	C	C	T			TCGA-OR-A5LL-01A-11D-A29I-10	TCGA-OR-A5LL-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9bfd4b2e-0577-4c94-8d6c-dafa9104b502	2d4f1606-9261-4ba8-96a9-ee307989af11	g.chr5:137056267C>T	ENST00000309755.4	-	2	464	c.21G>A	c.(19-21)aaG>aaA	p.K7K	KLHL3_ENST00000508657.1_5'UTR|KLHL3_ENST00000394937.3_Silent_p.K7K	NM_017415.2	NP_059111.2	Q9UH77	KLHL3_HUMAN	kelch-like family member 3	7					distal tubule morphogenesis (GO:0072156)|ion homeostasis (GO:0050801)|protein K48-linked ubiquitination (GO:0070936)|protein ubiquitination (GO:0016567)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|renal sodium ion absorption (GO:0070294)	Cul3-RING ubiquitin ligase complex (GO:0031463)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)	structural molecule activity (GO:0005198)			breast(2)|endometrium(3)|kidney(2)|large_intestine(4)|lung(8)|stomach(1)|upper_aerodigestive_tract(1)	21		all_hematologic(541;3.67e-07)|Breast(839;7.61e-05)|Prostate(281;0.000825)|Ovarian(839;0.0481)|all_lung(232;0.198)	KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0233)	GBM - Glioblastoma multiforme(465;0.0223)		GGGAGCTCAGCTTGACACTGT	0.498																																					p.K7K		.											.	KLHL3-90	0			c.G21A						.						128.0	114.0	119.0					5																	137056267		2203	4300	6503	SO:0001819	synonymous_variant	26249	exon2			GCTCAGCTTGACA	AB032955	CCDS4192.1, CCDS58969.1, CCDS58970.1	5q31	2013-01-30	2013-01-30		ENSG00000146021	ENSG00000146021		"""Kelch-like"", ""BTB/POZ domain containing"""	6354	protein-coding gene	gene with protein product		605775	"""kelch (Drosophila)-like 3"", ""kelch-like 3 (Drosophila)"""			10843806	Standard	NM_017415		Approved	KIAA1129	uc010jek.3	Q9UH77	OTTHUMG00000129155	ENST00000309755.4:c.21G>A	5.37:g.137056267C>T		Somatic	97	0		WXS	Illumina GAIIx	Phase_I	90	13	NM_017415	0	0	0	0	0	B2RBK7|Q9UH75|Q9UH76|Q9ULU0|Q9Y6V6	Silent	SNP	ENST00000309755.4	37	CCDS4192.1																																																																																			.		0.498	KLHL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251220.2		
PCDHGB1	56104	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	140731780	140731780	+	Silent	SNP	C	C	T			TCGA-OR-A5LL-01A-11D-A29I-10	TCGA-OR-A5LL-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9bfd4b2e-0577-4c94-8d6c-dafa9104b502	2d4f1606-9261-4ba8-96a9-ee307989af11	g.chr5:140731780C>T	ENST00000523390.1	+	1	1953	c.1953C>T	c.(1951-1953)tcC>tcT	p.S651S	PCDHGA1_ENST00000517417.1_Intron|PCDHGA4_ENST00000571252.1_5'Flank|PCDHGA3_ENST00000253812.6_Intron|PCDHGA2_ENST00000394576.2_Intron	NM_018922.2|NM_032095.1	NP_061745.1|NP_115266.1	Q9Y5G3	PCDGD_HUMAN	protocadherin gamma subfamily B, 1	651	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			central_nervous_system(2)|endometrium(1)|kidney(1)|large_intestine(6)|lung(3)|ovary(2)|prostate(1)	16			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CGCCACTCTCCGCCACCGCCA	0.687																																					p.S651S		.											.	PCDHGB1-33	0			c.C1953T						.						47.0	55.0	53.0					5																	140731780		2154	4251	6405	SO:0001819	synonymous_variant	56104	exon1			ACTCTCCGCCACC	AF152517	CCDS54923.1, CCDS75330.1	5q31	2010-01-26				ENSG00000254221		"""Cadherins / Protocadherins : Clustered"""	8708	other	protocadherin	"""protocadherin gamma subfamily B, 1, isoform 2"""	606299				10380929	Standard	NM_018922		Approved	PCDH-GAMMA-B1		Q9Y5G3		ENST00000523390.1:c.1953C>T	5.37:g.140731780C>T		Somatic	72	0		WXS	Illumina GAIIx	Phase_I	57	12	NM_018922	0	0	6	6	0	Q3SY75|Q9Y5C8	Silent	SNP	ENST00000523390.1	37	CCDS54923.1																																																																																			.		0.687	PCDHGB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374740.1	NM_018922	
PCDHGB2	56103	broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	140741378	140741378	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5LL-01A-11D-A29I-10	TCGA-OR-A5LL-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9bfd4b2e-0577-4c94-8d6c-dafa9104b502	2d4f1606-9261-4ba8-96a9-ee307989af11	g.chr5:140741378C>T	ENST00000522605.1	+	1	1676	c.1676C>T	c.(1675-1677)gCg>gTg	p.A559V	PCDHGA5_ENST00000518069.1_5'Flank|PCDHGA1_ENST00000517417.1_Intron|PCDHGA4_ENST00000571252.1_Intron|PCDHGB1_ENST00000523390.1_Intron|PCDHGA3_ENST00000253812.6_Intron|PCDHGA2_ENST00000394576.2_Intron	NM_018923.2|NM_032096.1	NP_061746.1|NP_115267.1	Q9Y5G2	PCDGE_HUMAN	protocadherin gamma subfamily B, 2	559	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			endometrium(1)|kidney(1)|large_intestine(5)|lung(3)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	14			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			AATGACAATGCGCCACGGGTG	0.692																																					p.A559V		.											.	PCDHGB2-33	0			c.C1676T						.						32.0	39.0	37.0					5																	140741378		2091	4229	6320	SO:0001583	missense	56103	exon1			ACAATGCGCCACG	AF152331	CCDS54924.1, CCDS75332.1	5q31	2010-01-26				ENSG00000253910		"""Cadherins / Protocadherins : Clustered"""	8709	other	protocadherin		606300				10380929	Standard	NM_018923		Approved	PCDH-GAMMA-B2		Q9Y5G2		ENST00000522605.1:c.1676C>T	5.37:g.140741378C>T	ENSP00000429018:p.Ala559Val	Somatic	134	1		WXS	Illumina GAIIx	Phase_I	113	17	NM_018923	0	0	1	1	0	Q3MIJ3|Q9UN65	Missense_Mutation	SNP	ENST00000522605.1	37	CCDS54924.1	.	.	.	.	.	.	.	.	.	.	.	12.22	1.872463	0.33069	.	.	ENSG00000253910	ENST00000522605	T	0.02656	4.21	5.11	3.31	0.37934	Cadherin (4);Cadherin conserved site (1);Cadherin-like (1);	.	.	.	.	T	0.10078	0.0247	L	0.57536	1.79	0.22835	N	0.998673	D;D	0.71674	0.998;0.97	P;P	0.62491	0.903;0.604	T	0.09314	-1.0680	9	0.54805	T	0.06	.	11.5341	0.50626	0.0:0.7839:0.0:0.2161	.	559;559	Q9Y5G2-2;Q9Y5G2	.;PCDGE_HUMAN	V	559	ENSP00000429018:A559V	ENSP00000429018:A559V	A	+	2	0	PCDHGB2	140721562	0.035000	0.19736	0.845000	0.33349	0.005000	0.04900	3.123000	0.50453	0.267000	0.21916	-1.641000	0.00772	GCG	.		0.692	PCDHGB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374741.1	NM_018923	
RASGEF1C	255426	bcgsc.ca	37	5	179563435	179563435	+	Silent	SNP	T	T	C	rs11546322	byFrequency	TCGA-OR-A5LL-01A-11D-A29I-10	TCGA-OR-A5LL-10A-01D-A29L-10	T	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9bfd4b2e-0577-4c94-8d6c-dafa9104b502	2d4f1606-9261-4ba8-96a9-ee307989af11	g.chr5:179563435T>C	ENST00000393371.2	-	3	677	c.381A>G	c.(379-381)gaA>gaG	p.E127E	RASGEF1C_ENST00000361132.4_Silent_p.E127E|RASGEF1C_ENST00000522500.1_5'UTR|RASGEF1C_ENST00000519883.1_5'Flank			Q8N431	RGF1C_HUMAN	RasGEF domain family, member 1C	127	N-terminal Ras-GEF. {ECO:0000255|PROSITE- ProRule:PRU00135}.				regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	intracellular (GO:0005622)	guanyl-nucleotide exchange factor activity (GO:0005085)			breast(1)|kidney(2)|large_intestine(3)|lung(3)|ovary(1)|prostate(1)|stomach(1)	12	all_cancers(89;3.44e-05)|all_epithelial(37;1.22e-05)|Renal(175;0.000269)|Lung NSC(126;0.00199)|all_lung(126;0.00351)|Breast(19;0.137)	all_cancers(40;0.0242)|Medulloblastoma(196;0.00498)|all_neural(177;0.0137)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			TAGTCGACTCTTCCTGGAAGT	0.682													C|||	2335	0.466254	0.2595	0.5432	5008	,	,		13834	0.7113		0.3857	False		,,,				2504	0.5215				p.E127E		.											.	RASGEF1C-228	0			c.A381G						.	C		1217,3105		198,821,1142	54.0	44.0	47.0		381	0.2	1.0	5	dbSNP_120	47	3063,5459		613,1837,1811	no	coding-synonymous	RASGEF1C	NM_175062.3		811,2658,2953	CC,CT,TT		35.9423,28.1583,33.323		127/467	179563435	4280,8564	2161	4261	6422	SO:0001819	synonymous_variant	255426	exon4			CGACTCTTCCTGG	AK093160	CCDS4452.1	5q35.3	2005-08-16			ENSG00000146090	ENSG00000146090			27400	protein-coding gene	gene with protein product						12477932	Standard	XM_006714839		Approved	FLJ35841	uc003mlr.3	Q8N431	OTTHUMG00000130914	ENST00000393371.2:c.381A>G	5.37:g.179563435T>C		Somatic	280	1		WXS	Illumina GAIIx	Phase_I	314	11	NM_175062	0	0	0	0	0	D3DWQ7|Q7Z4T0|Q8NA49	Silent	SNP	ENST00000393371.2	37	CCDS4452.1																																																																																			T|0.588;C|0.412		0.682	RASGEF1C-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253506.2	NM_175062	
E2F3	1871	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	20488470	20488470	+	Missense_Mutation	SNP	G	G	A	rs147333935	byFrequency	TCGA-OR-A5LL-01A-11D-A29I-10	TCGA-OR-A5LL-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9bfd4b2e-0577-4c94-8d6c-dafa9104b502	2d4f1606-9261-4ba8-96a9-ee307989af11	g.chr6:20488470G>A	ENST00000346618.3	+	6	1192	c.1126G>A	c.(1126-1128)Gct>Act	p.A376T	E2F3_ENST00000535432.1_Missense_Mutation_p.A245T	NM_001949.4	NP_001940.1	O00716	E2F3_HUMAN	E2F transcription factor 3	376					mitotic cell cycle (GO:0000278)|Notch signaling pathway (GO:0007219)|positive regulation of cell proliferation (GO:0008284)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	core promoter binding (GO:0001047)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.A376T(1)		central_nervous_system(1)|kidney(1)|large_intestine(2)|lung(3)	7	all_cancers(95;0.154)|all_epithelial(95;0.0585)|Breast(50;0.146)|Ovarian(93;0.148)		OV - Ovarian serous cystadenocarcinoma(7;0.0068)|all cancers(50;0.0148)|Epithelial(50;0.0562)			CCCTAAACCCGCTTCCAAAGG	0.408																																					p.A376T		.											.	E2F3-414	1	Substitution - Missense(1)	lung(1)	c.G1126A						.	G	THR/ALA	2,4404	4.2+/-10.8	0,2,2201	97.0	93.0	95.0		1126	-0.8	0.9	6	dbSNP_134	95	1,8599	1.2+/-3.3	0,1,4299	yes	missense	E2F3	NM_001949.4	58	0,3,6500	AA,AG,GG		0.0116,0.0454,0.0231	benign	376/466	20488470	3,13003	2203	4300	6503	SO:0001583	missense	1871	exon6			AAACCCGCTTCCA	Y10479	CCDS4545.1, CCDS58999.1	6p22	2008-08-29			ENSG00000112242	ENSG00000112242			3115	protein-coding gene	gene with protein product		600427				8246996	Standard	NM_001949		Approved		uc003nda.2	O00716	OTTHUMG00000016389	ENST00000346618.3:c.1126G>A	6.37:g.20488470G>A	ENSP00000262904:p.Ala376Thr	Somatic	86	0		WXS	Illumina GAIIx	Phase_I	78	14	NM_001949	0	0	0	0	0	Q15000|Q68DT0|Q9BZ44	Missense_Mutation	SNP	ENST00000346618.3	37	CCDS4545.1	.	.	.	.	.	.	.	.	.	.	G	9.680	1.149027	0.21288	4.54E-4	1.16E-4	ENSG00000112242	ENST00000346618;ENST00000535432	T;T	0.06687	3.27;3.27	5.91	-0.816	0.10839	.	0.764210	0.12639	N	0.451509	T	0.01189	0.0039	L	0.32530	0.975	0.25279	N	0.989452	B	0.09022	0.002	B	0.01281	0.0	T	0.48758	-0.9007	10	0.13108	T	0.6	.	1.1125	0.01707	0.4251:0.2375:0.124:0.2134	.	376	O00716	E2F3_HUMAN	T	376;245	ENSP00000262904:A376T;ENSP00000443418:A245T	ENSP00000262904:A376T	A	+	1	0	E2F3	20596449	0.999000	0.42202	0.950000	0.38849	0.979000	0.70002	1.203000	0.32284	-0.338000	0.08413	-0.351000	0.07748	GCT	G|0.999;A|0.001		0.408	E2F3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000043828.1		
OR2B6	26212	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	27925596	27925596	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5LL-01A-11D-A29I-10	TCGA-OR-A5LL-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9bfd4b2e-0577-4c94-8d6c-dafa9104b502	2d4f1606-9261-4ba8-96a9-ee307989af11	g.chr6:27925596C>T	ENST00000244623.1	+	1	578	c.578C>T	c.(577-579)aCa>aTa	p.T193I		NM_012367.1	NP_036499.1	P58173	OR2B6_HUMAN	olfactory receptor, family 2, subfamily B, member 6	193						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(1)|large_intestine(3)|lung(12)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	19						GTTGAGACAACAGCAAATGAG	0.448																																					p.T193I		.											.	OR2B6-69	0			c.C578T						.						184.0	181.0	182.0					6																	27925596		2203	4300	6503	SO:0001583	missense	26212	exon1			AGACAACAGCAAA	U86275	CCDS4642.1	6p22.1	2012-08-09			ENSG00000124657	ENSG00000124657		"""GPCR / Class A : Olfactory receptors"""	8241	protein-coding gene	gene with protein product				OR2B6P, OR2B1, OR2B1P, OR2B5		9500546	Standard	NM_012367		Approved	OR6-31, dJ408B20.2, OR5-40, OR5-41	uc011dkx.2	P58173	OTTHUMG00000014497	ENST00000244623.1:c.578C>T	6.37:g.27925596C>T	ENSP00000244623:p.Thr193Ile	Somatic	177	0		WXS	Illumina GAIIx	Phase_I	129	54	NM_012367	0	0	0	0	0	O43883|Q6IF89|Q9H5B0	Missense_Mutation	SNP	ENST00000244623.1	37	CCDS4642.1	.	.	.	.	.	.	.	.	.	.	c	6.705	0.498672	0.12762	.	.	ENSG00000124657	ENST00000244623	T	0.00091	8.74	3.55	1.71	0.24356	GPCR, rhodopsin-like superfamily (1);	0.501626	0.14698	U	0.303748	T	0.00039	0.0001	L	0.28400	0.85	0.09310	N	1	B	0.10296	0.003	B	0.15870	0.014	T	0.34601	-0.9822	10	0.39692	T	0.17	.	4.7812	0.13202	0.0:0.6124:0.0:0.3876	.	193	P58173	OR2B6_HUMAN	I	193	ENSP00000244623:T193I	ENSP00000244623:T193I	T	+	2	0	OR2B6	28033575	0.000000	0.05858	0.852000	0.33557	0.697000	0.40408	-0.751000	0.04803	0.761000	0.33130	0.467000	0.42956	ACA	.		0.448	OR2B6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040165.1		
GRIK2	2898	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	102511871	102511871	+	Intron	SNP	C	C	A			TCGA-OR-A5LL-01A-11D-A29I-10	TCGA-OR-A5LL-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9bfd4b2e-0577-4c94-8d6c-dafa9104b502	2d4f1606-9261-4ba8-96a9-ee307989af11	g.chr6:102511871C>A	ENST00000421544.1	+	16	3052				GRIK2_ENST00000369134.4_Intron|GRIK2_ENST00000318991.6_Missense_Mutation_p.P866Q|GRIK2_ENST00000413795.1_Missense_Mutation_p.P866Q|GRIK2_ENST00000369138.1_Intron|GRIK2_ENST00000369137.3_Intron	NM_021956.4	NP_068775.1	Q13002	GRIK2_HUMAN	glutamate receptor, ionotropic, kainate 2						behavioral fear response (GO:0001662)|cellular calcium ion homeostasis (GO:0006874)|glutamate receptor signaling pathway (GO:0007215)|intracellular protein transport (GO:0006886)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of synaptic transmission, glutamatergic (GO:0051967)|neuronal action potential (GO:0019228)|positive regulation of synaptic transmission (GO:0050806)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of inhibitory postsynaptic membrane potential (GO:0060080)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of short-term neuronal synaptic plasticity (GO:0048172)|regulation of synaptic transmission (GO:0050804)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)	cell junction (GO:0030054)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|kainate selective glutamate receptor complex (GO:0032983)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)	extracellular-glutamate-gated ion channel activity (GO:0005234)|kainate selective glutamate receptor activity (GO:0015277)	p.P866L(1)		NS(1)|breast(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(18)|lung(37)|ovary(2)|pancreas(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	83		all_cancers(76;1.19e-07)|Acute lymphoblastic leukemia(125;6.17e-11)|all_hematologic(75;6.01e-08)|all_epithelial(87;0.0121)|Colorectal(196;0.14)		all cancers(137;0.112)|BRCA - Breast invasive adenocarcinoma(108;0.124)|GBM - Glioblastoma multiforme(226;0.206)	Amobarbital(DB01351)|Aprobarbital(DB01352)|Butabarbital(DB00237)|Butalbital(DB00241)|Butethal(DB01353)|Heptabarbital(DB01354)|Hexobarbital(DB01355)|Methylphenobarbital(DB00849)|Pentobarbital(DB00312)|Phenobarbital(DB01174)|Primidone(DB00794)|Secobarbital(DB00418)|Talbutal(DB00306)|Thiopental(DB00599)	CCATACCATCCAGACACTGTT	0.289																																					p.P866Q		.											.	GRIK2-157	1	Substitution - Missense(1)	haematopoietic_and_lymphoid_tissue(1)	c.C2597A						.						72.0	70.0	71.0					6																	102511871		2201	4292	6493	SO:0001627	intron_variant	2898	exon16			ACCATCCAGACAC		CCDS5048.1, CCDS5049.1, CCDS55045.1	6q16.3	2012-08-29			ENSG00000164418	ENSG00000164418		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4580	protein-coding gene	gene with protein product		138244		GLUR6		8034316	Standard	NM_021956		Approved	GluK2, MRT6	uc003pqp.4	Q13002	OTTHUMG00000016328	ENST00000421544.1:c.2563-4351C>A	6.37:g.102511871C>A		Somatic	212	0		WXS	Illumina GAIIx	Phase_I	171	42	NM_175768	0	0	0	0	0	A6NMY9|B5MCV0|D7RWZ3|D7RWZ4|D7RWZ5|D7RWZ6|D7RWZ7|Q8WWS1|Q96KS6|Q96KS7|Q96KS8	Missense_Mutation	SNP	ENST00000421544.1	37	CCDS5048.1	.	.	.	.	.	.	.	.	.	.	C	11.44	1.639308	0.29157	.	.	ENSG00000164418	ENST00000413795;ENST00000318991;ENST00000540076	T;T	0.12672	2.66;2.66	5.05	5.05	0.67936	.	.	.	.	.	T	0.09291	0.0229	N	0.08118	0	0.80722	D	1	D	0.64830	0.994	D	0.73380	0.98	T	0.36114	-0.9761	9	0.24483	T	0.36	.	11.9017	0.52687	0.0:0.8247:0.1753:0.0	.	866	Q13002-2	.	Q	866;866;641	ENSP00000405596:P866Q;ENSP00000313276:P866Q	ENSP00000313276:P866Q	P	+	2	0	GRIK2	102618564	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	0.675000	0.25232	2.785000	0.95823	0.591000	0.81541	CCA	.		0.289	GRIK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043718.1		
ESR1	2099	broad.mit.edu	37	6	152129382	152129382	+	Missense_Mutation	SNP	A	A	C			TCGA-OR-A5LL-01A-11D-A29I-10	TCGA-OR-A5LL-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9bfd4b2e-0577-4c94-8d6c-dafa9104b502	2d4f1606-9261-4ba8-96a9-ee307989af11	g.chr6:152129382A>C	ENST00000206249.3	+	1	697	c.335A>C	c.(334-336)cAc>cCc	p.H112P	ESR1_ENST00000406599.1_Missense_Mutation_p.H112P|ESR1_ENST00000456483.2_Missense_Mutation_p.H112P|ESR1_ENST00000440973.1_Missense_Mutation_p.H112P|ESR1_ENST00000443427.1_Missense_Mutation_p.H112P|ESR1_ENST00000427531.2_5'Flank|ESR1_ENST00000338799.5_Missense_Mutation_p.H112P	NM_000125.3	NP_000116.2	P03372	ESR1_HUMAN	estrogen receptor 1	112	Interaction with DDX5; self-association.|Modulating (transactivation AF-1); mediates interaction with MACROD1.				androgen metabolic process (GO:0008209)|antral ovarian follicle growth (GO:0001547)|cellular response to estradiol stimulus (GO:0071392)|chromatin remodeling (GO:0006338)|epithelial cell development (GO:0002064)|epithelial cell proliferation involved in mammary gland duct elongation (GO:0060750)|gene expression (GO:0010467)|intracellular estrogen receptor signaling pathway (GO:0030520)|intracellular steroid hormone receptor signaling pathway (GO:0030518)|male gonad development (GO:0008584)|mammary gland alveolus development (GO:0060749)|mammary gland branching involved in pregnancy (GO:0060745)|negative regulation of gene expression (GO:0010629)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|positive regulation of nitric-oxide synthase activity (GO:0051000)|positive regulation of phospholipase C activity (GO:0010863)|positive regulation of retinoic acid receptor signaling pathway (GO:0048386)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|prostate epithelial cord arborization involved in prostate glandular acinus morphogenesis (GO:0060527)|prostate epithelial cord elongation (GO:0060523)|regulation of apoptotic process (GO:0042981)|regulation of branching involved in prostate gland morphogenesis (GO:0060687)|regulation of transcription, DNA-templated (GO:0006355)|response to estradiol (GO:0032355)|response to estrogen (GO:0043627)|signal transduction (GO:0007165)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|uterus development (GO:0060065)|vagina development (GO:0060068)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|transcriptionally active chromatin (GO:0035327)	beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|core promoter sequence-specific DNA binding (GO:0001046)|enzyme binding (GO:0019899)|estrogen receptor activity (GO:0030284)|estrogen response element binding (GO:0034056)|estrogen-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0038052)|identical protein binding (GO:0042802)|nitric-oxide synthase regulator activity (GO:0030235)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding transcription factor activity (GO:0003700)|steroid binding (GO:0005496)|steroid hormone receptor activity (GO:0003707)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(9)|kidney(1)|large_intestine(11)|lung(19)|ovary(1)|prostate(2)|skin(1)	49		Ovarian(120;0.0448)	BRCA - Breast invasive adenocarcinoma(37;0.0841)	OV - Ovarian serous cystadenocarcinoma(155;4.55e-10)	Allylestrenol(DB01431)|Clomifene(DB00882)|Conjugated Estrogens(DB00286)|Danazol(DB01406)|Desogestrel(DB00304)|Dienestrol(DB00890)|Diethylstilbestrol(DB00255)|Estradiol(DB00783)|Estramustine(DB01196)|Estriol(DB04573)|Estrone(DB00655)|Estropipate(DB04574)|Ethinyl Estradiol(DB00977)|Ethynodiol(DB00823)|Etonogestrel(DB00294)|Fluoxymesterone(DB01185)|Fulvestrant(DB00947)|Levonorgestrel(DB00367)|Medroxyprogesterone Acetate(DB00603)|Melatonin(DB01065)|Mestranol(DB01357)|Naloxone(DB01183)|Norgestimate(DB00957)|Ospemifene(DB04938)|Progesterone(DB00396)|Quinestrol(DB04575)|Raloxifene(DB00481)|Tamoxifen(DB00675)|Toremifene(DB00539)|Trilostane(DB01108)	ATGCTACTGCACCCGCCGCCG	0.711																																					p.H112P		.											.	ESR1-1042	0			c.A335C						.																																			SO:0001583	missense	2099	exon1			TACTGCACCCGCC	X03635	CCDS5234.1	6q24-q27	2013-01-16			ENSG00000091831	ENSG00000091831		"""Nuclear hormone receptors"""	3467	protein-coding gene	gene with protein product		133430		ESR		3754034	Standard	NM_000125		Approved	NR3A1, Era	uc003qon.4	P03372	OTTHUMG00000016103	ENST00000206249.3:c.335A>C	6.37:g.152129382A>C	ENSP00000206249:p.His112Pro	Somatic	58	7		WXS	Illumina GAIIx	Phase_I	67	14	NM_000125	0	0	0	0	0	Q13511|Q14276|Q5T5H7|Q6MZQ9|Q9NU51|Q9UDZ7|Q9UIS7	Missense_Mutation	SNP	ENST00000206249.3	37	CCDS5234.1	.	.	.	.	.	.	.	.	.	.	A	6.385	0.439069	0.12104	.	.	ENSG00000091831	ENST00000440973;ENST00000338799;ENST00000456483;ENST00000446550;ENST00000443427;ENST00000206249;ENST00000406599;ENST00000431590	T;T;T;T;T;T;T	0.27890	1.64;1.64;1.64;1.64;1.64;1.64;1.64	5.01	2.51	0.30379	.	0.618160	0.18516	N	0.138909	T	0.13030	0.0316	N	0.19112	0.55	0.80722	D	1	D;P;P;P	0.71674	0.998;0.632;0.579;0.632	D;P;B;B	0.63488	0.915;0.545;0.247;0.362	T	0.11665	-1.0578	10	0.02654	T	1	.	7.6419	0.28298	0.7846:0.1409:0.0745:0.0	.	112;112;112;112	Q9H2M1;A8KAF4;G4XH65;P03372	.;.;.;ESR1_HUMAN	P	112;112;112;112;112;112;112;40	ENSP00000405330:H112P;ENSP00000342630:H112P;ENSP00000415934:H112P;ENSP00000411105:H112P;ENSP00000387500:H112P;ENSP00000206249:H112P;ENSP00000384064:H112P	ENSP00000206249:H112P	H	+	2	0	ESR1	152171075	1.000000	0.71417	0.997000	0.53966	0.977000	0.68977	3.076000	0.50081	0.232000	0.21100	0.533000	0.62120	CAC	.		0.711	ESR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043308.1		
STK31	56164	bcgsc.ca	37	7	23811800	23811800	+	Missense_Mutation	SNP	G	G	T	rs10247878	byFrequency	TCGA-OR-A5LL-01A-11D-A29I-10	TCGA-OR-A5LL-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9bfd4b2e-0577-4c94-8d6c-dafa9104b502	2d4f1606-9261-4ba8-96a9-ee307989af11	g.chr7:23811800G>T	ENST00000355870.3	+	15	1987	c.1868G>T	c.(1867-1869)aGt>aTt	p.S623I	STK31_ENST00000405627.3_3'UTR|STK31_ENST00000433467.2_Missense_Mutation_p.S623I|STK31_ENST00000428484.1_Missense_Mutation_p.S600I|STK31_ENST00000354639.3_Missense_Mutation_p.S600I	NM_031414.4	NP_113602.2	Q9BXU1	STK31_HUMAN	serine/threonine kinase 31	623			S -> I (in dbSNP:rs10247878). {ECO:0000269|PubMed:17344846}.	NKS -> KKI (in Ref. 1; AAK31978). {ECO:0000305}.		acrosomal vesicle (GO:0001669)	ATP binding (GO:0005524)|hydrolase activity, acting on ester bonds (GO:0016788)|nucleic acid binding (GO:0003676)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(12)|lung(31)|ovary(2)|prostate(1)|skin(7)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	67						TTAAATAAGAGTCCCAGTGTG	0.299													G|||	373	0.0744808	0.0431	0.0908	5008	,	,		16735	0.0476		0.16	False		,,,				2504	0.045				p.S623I		.											.	STK31-338	0			c.G1868T						.	G	ILE/SER,ILE/SER,ILE/SER	263,4139	141.9+/-177.2	8,247,1946	46.0	48.0	47.0		1799,1868,1799	2.3	1.0	7	dbSNP_119	47	1404,7184	265.6+/-286.2	107,1190,2997	yes	missense,missense,missense	STK31	NM_001122833.1,NM_031414.3,NM_032944.2	142,142,142	115,1437,4943	TT,TG,GG		16.3484,5.9746,12.8329	benign,benign,benign	600/997,623/1020,600/997	23811800	1667,11323	2201	4294	6495	SO:0001583	missense	56164	exon15			ATAAGAGTCCCAG	AF285599	CCDS5386.1, CCDS43556.1, CCDS59049.1	7p15.3	2014-04-23			ENSG00000196335	ENSG00000196335		"""Tudor domain containing"""	11407	protein-coding gene	gene with protein product		605790				11279525	Standard	NM_031414		Approved	TDRD8, SgK396	uc003sws.5	Q9BXU1	OTTHUMG00000023053	ENST00000355870.3:c.1868G>T	7.37:g.23811800G>T	ENSP00000348132:p.Ser623Ile	Somatic	99	0		WXS	Illumina GAIIx	Phase_I	93	5	NM_031414	0	0	0	0	0	B4DZ06|B7WPP5|C9J4F9|Q6PCD3|Q9BXH8	Missense_Mutation	SNP	ENST00000355870.3	37	CCDS5386.1	222	0.10164835164835165	26	0.052845528455284556	47	0.1298342541436464	24	0.04195804195804196	125	0.16490765171503957	G	11.86	1.763990	0.31228	0.059746	0.163484	ENSG00000196335	ENST00000355870;ENST00000433467;ENST00000354639;ENST00000428484	T;T;T;T	0.70869	-0.52;1.21;-0.52;-0.52	5.19	2.34	0.29019	.	0.238536	0.42821	D	0.000653	T	0.00384	0.0012	M	0.62723	1.935	0.42167	P	0.008380000000000054	P;B	0.39216	0.664;0.0	B;B	0.31191	0.125;0.002	T	0.04664	-1.0935	9	0.37606	T	0.19	-0.6498	8.4601	0.32923	0.1231:0.2418:0.6351:0.0	rs10247878;rs10247878	623;623	B4DZ06;Q9BXU1	.;STK31_HUMAN	I	623;623;600;600	ENSP00000348132:S623I;ENSP00000411852:S623I;ENSP00000346660:S600I;ENSP00000406146:S600I	ENSP00000346660:S600I	S	+	2	0	STK31	23778325	0.983000	0.35010	0.987000	0.45799	0.867000	0.49689	1.051000	0.30417	0.188000	0.20168	-0.266000	0.10368	AGT	G|0.876;T|0.124		0.299	STK31-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214036.2	NM_031414	
WNT2	7472	broad.mit.edu;bcgsc.ca	37	7	116937913	116937913	+	Frame_Shift_Del	DEL	C	C	-			TCGA-OR-A5LL-01A-11D-A29I-10	TCGA-OR-A5LL-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9bfd4b2e-0577-4c94-8d6c-dafa9104b502	2d4f1606-9261-4ba8-96a9-ee307989af11	g.chr7:116937913delC	ENST00000265441.3	-	4	905	c.606delG	c.(604-606)ttgfs	p.L202fs		NM_003391.2	NP_003382.1	P09544	WNT2_HUMAN	wingless-type MMTV integration site family member 2	202					atrial cardiac muscle tissue morphogenesis (GO:0055009)|canonical Wnt signaling pathway (GO:0060070)|cardiac epithelial to mesenchymal transition (GO:0060317)|cell fate commitment (GO:0045165)|cell-cell signaling (GO:0007267)|cellular response to retinoic acid (GO:0071300)|cellular response to transforming growth factor beta stimulus (GO:0071560)|iris morphogenesis (GO:0061072)|labyrinthine layer blood vessel development (GO:0060716)|lens development in camera-type eye (GO:0002088)|lung development (GO:0030324)|lung induction (GO:0060492)|mammary gland epithelium development (GO:0061180)|neuron differentiation (GO:0030182)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of cardiac muscle cell proliferation (GO:0060045)|positive regulation of cell proliferation (GO:0008284)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of epithelial cell proliferation involved in lung morphogenesis (GO:0060501)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	cytokine activity (GO:0005125)|frizzled binding (GO:0005109)|receptor agonist activity (GO:0048018)			breast(2)|central_nervous_system(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(2)|liver(1)|lung(13)|ovary(3)|prostate(1)|skin(2)	31	all_epithelial(6;2.24e-06)|Lung NSC(10;0.000936)|all_lung(10;0.00109)		STAD - Stomach adenocarcinoma(10;0.000512)	LUSC - Lung squamous cell carcinoma(290;0.133)		ACTCTTGTTTCAAGAACCGCT	0.547																																					p.L202fs		.											.	WNT2-1011	0			c.606delG						.						86.0	82.0	84.0					7																	116937913		2203	4300	6503	SO:0001589	frameshift_variant	7472	exon4			TTGTTTCAAGAAC	X07876	CCDS5771.1	7q31	2013-02-28			ENSG00000105989	ENSG00000105989		"""Wingless-type MMTV integration sites"", ""Endogenous ligands"""	12780	protein-coding gene	gene with protein product	"""secreted growth factor"""	147870		INT1L1		2971536	Standard	NM_003391		Approved	IRP	uc003viz.3	P09544	OTTHUMG00000023428	ENST00000265441.3:c.606delG	7.37:g.116937913delC	ENSP00000265441:p.Leu202fs	Somatic	33	0		WXS	Illumina GAIIx	Phase_I	28	8	NM_003391	0	0	0	0	0	A4D0V1|Q75N05|Q9UDP9	Frame_Shift_Del	DEL	ENST00000265441.3	37	CCDS5771.1																																																																																			.		0.547	WNT2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059749.3	NM_003391	
WNT2	7472	broad.mit.edu;bcgsc.ca	37	7	116937915	116937916	+	Frame_Shift_Del	DEL	AG	AG	-			TCGA-OR-A5LL-01A-11D-A29I-10	TCGA-OR-A5LL-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9bfd4b2e-0577-4c94-8d6c-dafa9104b502	2d4f1606-9261-4ba8-96a9-ee307989af11	g.chr7:116937915_116937916delAG	ENST00000265441.3	-	4	902_903	c.603_604delCT	c.(601-606)ttcttgfs	p.L202fs	AC002465.2_ENST00000436097.1_RNA	NM_003391.2	NP_003382.1	P09544	WNT2_HUMAN	wingless-type MMTV integration site family member 2	202					atrial cardiac muscle tissue morphogenesis (GO:0055009)|canonical Wnt signaling pathway (GO:0060070)|cardiac epithelial to mesenchymal transition (GO:0060317)|cell fate commitment (GO:0045165)|cell-cell signaling (GO:0007267)|cellular response to retinoic acid (GO:0071300)|cellular response to transforming growth factor beta stimulus (GO:0071560)|iris morphogenesis (GO:0061072)|labyrinthine layer blood vessel development (GO:0060716)|lens development in camera-type eye (GO:0002088)|lung development (GO:0030324)|lung induction (GO:0060492)|mammary gland epithelium development (GO:0061180)|neuron differentiation (GO:0030182)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of cardiac muscle cell proliferation (GO:0060045)|positive regulation of cell proliferation (GO:0008284)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of epithelial cell proliferation involved in lung morphogenesis (GO:0060501)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	cytokine activity (GO:0005125)|frizzled binding (GO:0005109)|receptor agonist activity (GO:0048018)			breast(2)|central_nervous_system(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(2)|liver(1)|lung(13)|ovary(3)|prostate(1)|skin(2)	31	all_epithelial(6;2.24e-06)|Lung NSC(10;0.000936)|all_lung(10;0.00109)		STAD - Stomach adenocarcinoma(10;0.000512)	LUSC - Lung squamous cell carcinoma(290;0.133)		TCTTGTTTCAAGAACCGCTTTA	0.545																																					p.201_202del		.											.	WNT2-1011	0			c.603_604del						.																																			SO:0001589	frameshift_variant	7472	exon4			GTTTCAAGAACCG	X07876	CCDS5771.1	7q31	2013-02-28			ENSG00000105989	ENSG00000105989		"""Wingless-type MMTV integration sites"", ""Endogenous ligands"""	12780	protein-coding gene	gene with protein product	"""secreted growth factor"""	147870		INT1L1		2971536	Standard	NM_003391		Approved	IRP	uc003viz.3	P09544	OTTHUMG00000023428	ENST00000265441.3:c.603_604delCT	7.37:g.116937915_116937916delAG	ENSP00000265441:p.Leu202fs	Somatic	32	0		WXS	Illumina GAIIx	Phase_I	27	8	NM_003391	0	0	0	0	0	A4D0V1|Q75N05|Q9UDP9	Frame_Shift_Del	DEL	ENST00000265441.3	37	CCDS5771.1																																																																																			.		0.545	WNT2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059749.3	NM_003391	
CLDN23	137075	hgsc.bcm.edu	37	8	8560536	8560536	+	Missense_Mutation	SNP	G	G	A	rs12548737	byFrequency	TCGA-OR-A5LL-01A-11D-A29I-10	TCGA-OR-A5LL-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9bfd4b2e-0577-4c94-8d6c-dafa9104b502	2d4f1606-9261-4ba8-96a9-ee307989af11	g.chr8:8560536G>A	ENST00000519106.1	+	1	1089	c.628G>A	c.(628-630)Gtg>Atg	p.V210M		NM_194284.2	NP_919260.2	Q96B33	CLD23_HUMAN	claudin 23	210			V -> M (in dbSNP:rs12548737).		calcium-independent cell-cell adhesion (GO:0016338)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|tight junction assembly (GO:0070830)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|tight junction (GO:0005923)	identical protein binding (GO:0042802)|structural molecule activity (GO:0005198)			endometrium(2)	2		Hepatocellular(245;0.217)		COAD - Colon adenocarcinoma(149;0.071)|READ - Rectum adenocarcinoma(644;0.238)		CACCATCCAAGTGGAGTGGCC	0.731													G|||	569	0.113618	0.0083	0.1916	5008	,	,		12622	0.1488		0.0954	False		,,,				2504	0.183				p.V210M		.											.	.	0			c.G628A						.	G	MET/VAL	84,3832		0,84,1874	5.0	8.0	7.0		628	2.3	0.8	8	dbSNP_120	7	857,7211		50,757,3227	yes	missense	CLDN23	NM_194284.2	21	50,841,5101	AA,AG,GG		10.6222,2.145,7.8521	possibly-damaging	210/293	8560536	941,11043	1958	4034	5992	SO:0001583	missense	137075	exon1			ATCCAAGTGGAGT	AK123547	CCDS55195.1	8p23.1	2006-04-12				ENSG00000253958		"""Claudins"""	17591	protein-coding gene	gene with protein product		609203				12736707	Standard	NM_194284		Approved	CLDNL	uc003wsi.3	Q96B33		ENST00000519106.1:c.628G>A	8.37:g.8560536G>A	ENSP00000428780:p.Val210Met	Somatic	2	0		WXS	Illumina GAIIx	Phase_I	6	6	NM_194284	0	0	0	2	2	Q08AJ3	Missense_Mutation	SNP	ENST00000519106.1	37	CCDS55195.1	199	0.09111721611721611	8	0.016260162601626018	54	0.14917127071823205	69	0.12062937062937062	68	0.08970976253298153	G	12.41	1.930863	0.34096	0.02145	0.106222	ENSG00000253958	ENST00000519106	T	0.61859	0.07	4.12	2.31	0.28768	.	.	.	.	.	T	0.00300	0.0009	L	0.27053	0.805	0.40159	P	0.022958000000000034	P	0.48162	0.906	P	0.46585	0.521	T	0.03524	-1.1028	8	0.33940	T	0.23	.	8.182	0.31315	0.2087:0.0:0.7913:0.0	rs12548737	210	Q96B33	CLD23_HUMAN	M	210	ENSP00000428780:V210M	ENSP00000428780:V210M	V	+	1	0	CLDN23	8597946	0.949000	0.32298	0.846000	0.33378	0.051000	0.14879	3.623000	0.54224	1.090000	0.41315	0.407000	0.27541	GTG	G|0.907;A|0.093		0.731	CLDN23-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374721.1	NM_194284	
DOCK5	80005	bcgsc.ca	37	8	25203011	25203013	+	In_Frame_Del	DEL	CCA	CCA	-	rs148691535		TCGA-OR-A5LL-01A-11D-A29I-10	TCGA-OR-A5LL-10A-01D-A29L-10	CCA	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9bfd4b2e-0577-4c94-8d6c-dafa9104b502	2d4f1606-9261-4ba8-96a9-ee307989af11	g.chr8:25203011_25203013delCCA	ENST00000276440.7	+	26	2682_2684	c.2638_2640delCCA	c.(2638-2640)ccadel	p.P880del		NM_024940.6	NP_079216.4	Q9H7D0	DOCK5_HUMAN	dedicator of cytokinesis 5	880					positive regulation of GTPase activity (GO:0043547)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)	guanyl-nucleotide exchange factor activity (GO:0005085)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(12)|kidney(9)|large_intestine(13)|lung(20)|ovary(3)|prostate(1)|skin(4)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	72		all_cancers(63;0.0361)|Ovarian(32;0.000711)|all_epithelial(46;0.0153)|Hepatocellular(4;0.115)|Prostate(55;0.13)|Breast(100;0.143)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0267)|Epithelial(17;1.07e-11)|Colorectal(74;0.0276)|COAD - Colon adenocarcinoma(73;0.0828)		AGTGCTGCTGCCACTGCTGACAG	0.562																																					p.880_880del	Pancreas(145;34 1887 3271 10937 30165)	.											.	DOCK5-71	0			c.2638_2640del						.																																			SO:0001651	inframe_deletion	80005	exon26			CTGCTGCCACTGC		CCDS6047.1	8p21.2	2009-04-17			ENSG00000147459	ENSG00000147459			23476	protein-coding gene	gene with protein product						12432077	Standard	NM_024940		Approved	FLJ21034	uc003xeg.3	Q9H7D0	OTTHUMG00000131991	ENST00000276440.7:c.2638_2640delCCA	8.37:g.25203011_25203013delCCA	ENSP00000276440:p.Pro880del	Somatic	63	0		WXS	Illumina GAIIx	Phase_I	23	4	NM_024940	0	0	0	0	0	B2RNY0|Q5XKD5|Q6AI11|Q6PJS6|Q6ZTS6	In_Frame_Del	DEL	ENST00000276440.7	37	CCDS6047.1																																																																																			.		0.562	DOCK5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254955.2	NM_024940	
ARMC1	55156	bcgsc.ca	37	8	66525548	66525548	+	Silent	SNP	T	T	C	rs11559265	byFrequency	TCGA-OR-A5LL-01A-11D-A29I-10	TCGA-OR-A5LL-10A-01D-A29L-10	T	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9bfd4b2e-0577-4c94-8d6c-dafa9104b502	2d4f1606-9261-4ba8-96a9-ee307989af11	g.chr8:66525548T>C	ENST00000276569.3	-	4	640	c.396A>G	c.(394-396)caA>caG	p.Q132Q	ARMC1_ENST00000523384.1_5'Flank|ARMC1_ENST00000458464.2_Intron	NM_018120.4	NP_060590.1	Q9NVT9	ARMC1_HUMAN	armadillo repeat containing 1	132					metal ion transport (GO:0030001)	mitochondrion (GO:0005739)	metal ion binding (GO:0046872)			cervix(1)|endometrium(3)|large_intestine(1)|lung(8)|skin(1)	14			Epithelial(68;0.103)|OV - Ovarian serous cystadenocarcinoma(28;0.235)			CCAGAAAAAATTGAGCTTTCC	0.393													C|||	1283	0.25619	0.0877	0.3228	5008	,	,		19145	0.379		0.3002	False		,,,				2504	0.2648				p.Q132Q		.											.	ARMC1-91	0			c.A396G						.	C		542,3864	776.6+/-414.2	34,474,1695	152.0	140.0	144.0		396	5.9	1.0	8	dbSNP_120	144	2698,5902	682.6+/-403.8	398,1902,2000	no	coding-synonymous	ARMC1	NM_018120.4		432,2376,3695	CC,CT,TT		31.3721,12.3014,24.9116		132/283	66525548	3240,9766	2203	4300	6503	SO:0001819	synonymous_variant	55156	exon4			AAAAAATTGAGCT	BC011607	CCDS6181.1, CCDS69490.1	8q12.3	2013-02-14			ENSG00000104442	ENSG00000104442		"""Armadillo repeat containing"""	17684	protein-coding gene	gene with protein product							Standard	XM_005251264		Approved	FLJ10511, Arcp	uc003xvl.3	Q9NVT9	OTTHUMG00000164374	ENST00000276569.3:c.396A>G	8.37:g.66525548T>C		Somatic	106	1		WXS	Illumina GAIIx	Phase_I	79	4	NM_018120	0	0	23	23	0	B4E2W7|Q9H018|Q9H820	Silent	SNP	ENST00000276569.3	37	CCDS6181.1																																																																																			T|0.731;C|0.269		0.393	ARMC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378480.1	NM_018120	
RGS22	26166	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	101016248	101016248	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5LL-01A-11D-A29I-10	TCGA-OR-A5LL-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9bfd4b2e-0577-4c94-8d6c-dafa9104b502	2d4f1606-9261-4ba8-96a9-ee307989af11	g.chr8:101016248G>A	ENST00000360863.6	-	17	2727	c.2533C>T	c.(2533-2535)Cct>Tct	p.P845S	RGS22_ENST00000523437.1_Missense_Mutation_p.P833S|SNORD77_ENST00000391112.1_RNA|RGS22_ENST00000523287.1_Missense_Mutation_p.P664S|RGS22_ENST00000519421.1_5'UTR	NM_015668.3	NP_056483.3	Q8NE09	RGS22_HUMAN	regulator of G-protein signaling 22	845					positive regulation of GTPase activity (GO:0043547)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	GTPase activator activity (GO:0005096)		RGS22/SYCP1(2)	breast(3)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(9)|lung(33)|ovary(3)|prostate(2)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	68			Epithelial(11;6.71e-08)|all cancers(13;4.19e-06)|OV - Ovarian serous cystadenocarcinoma(57;0.000469)|STAD - Stomach adenocarcinoma(118;0.169)			TATTCTGCAGGAACATTATCC	0.373																																					p.P845S		.											.	RGS22-140	0			c.C2533T						.						142.0	130.0	134.0					8																	101016248		1861	4094	5955	SO:0001583	missense	26166	exon17			CTGCAGGAACATT	AY009106	CCDS43758.1, CCDS69521.1, CCDS75775.1	8q22.2	2014-01-21	2007-08-14		ENSG00000132554	ENSG00000132554		"""Regulators of G-protein signaling"""	24499	protein-coding gene	gene with protein product		615650	"""regulator of G-protein signalling 22"""				Standard	XM_005250856		Approved	DKFZP434I092, PRTD-NY2, CT145	uc003yjb.1	Q8NE09	OTTHUMG00000164802	ENST00000360863.6:c.2533C>T	8.37:g.101016248G>A	ENSP00000354109:p.Pro845Ser	Somatic	117	0		WXS	Illumina GAIIx	Phase_I	92	17	NM_015668	0	0	0	0	0	A8K944|Q569L2|Q86Y71|Q9BYZ4|Q9UFN6	Missense_Mutation	SNP	ENST00000360863.6	37	CCDS43758.1	.	.	.	.	.	.	.	.	.	.	G	15.27	2.784358	0.49997	.	.	ENSG00000132554	ENST00000360863;ENST00000427793;ENST00000523287;ENST00000523437;ENST00000517828	T;T;T;T	0.51325	0.77;0.73;0.76;0.71	5.49	5.49	0.81192	Regulator of G protein signalling superfamily (1);	0.000000	0.85682	D	0.000000	T	0.57169	0.2035	M	0.66939	2.045	0.34814	D	0.738049	D;D;D	0.55605	0.959;0.959;0.972	P;P;P	0.53313	0.503;0.503;0.723	T	0.68845	-0.5301	10	0.45353	T	0.12	.	12.367	0.55234	0.0818:0.0:0.9182:0.0	.	833;845;664	A8K944;Q8NE09;G3V112	.;RGS22_HUMAN;.	S	845;833;664;833;160	ENSP00000354109:P845S;ENSP00000429382:P664S;ENSP00000428212:P833S;ENSP00000427754:P160S	ENSP00000354109:P845S	P	-	1	0	RGS22	101085424	1.000000	0.71417	1.000000	0.80357	0.548000	0.35241	4.342000	0.59341	2.571000	0.86741	0.655000	0.94253	CCT	.		0.373	RGS22-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000380365.1	NM_015668	
COL14A1	7373	broad.mit.edu	37	8	121344902	121344902	+	Splice_Site	SNP	G	G	T			TCGA-OR-A5LL-01A-11D-A29I-10	TCGA-OR-A5LL-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9bfd4b2e-0577-4c94-8d6c-dafa9104b502	2d4f1606-9261-4ba8-96a9-ee307989af11	g.chr8:121344902G>T	ENST00000297848.3	+	42	4983		c.e42-1		COL14A1_ENST00000247781.3_Splice_Site|COL14A1_ENST00000309791.4_Splice_Site	NM_021110.1	NP_066933.1			collagen, type XIV, alpha 1											NS(1)|autonomic_ganglia(1)|breast(11)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(9)|large_intestine(31)|lung(42)|ovary(5)|pancreas(1)|prostate(1)|skin(8)|stomach(2)|upper_aerodigestive_tract(2)	119	Lung NSC(37;6.52e-07)|Ovarian(258;0.00769)|Hepatocellular(40;0.161)		OV - Ovarian serous cystadenocarcinoma(1;6.47e-38)|STAD - Stomach adenocarcinoma(47;0.00503)			CTCTCTTCTAGGGCATTCCTG	0.507																																					.		.											.	COL14A1-543	0			c.4714-1G>T						.						154.0	134.0	141.0					8																	121344902		2203	4300	6503	SO:0001630	splice_region_variant	7373	exon42			CTTCTAGGGCATT		CCDS34938.1	8q23	2013-02-11	2008-02-04		ENSG00000187955	ENSG00000187955		"""Collagens"", ""Fibronectin type III domain containing"""	2191	protein-coding gene	gene with protein product		120324	"""undulin"""	UND		1716629, 9427527	Standard	NM_021110		Approved		uc003yox.4	Q05707	OTTHUMG00000149877	ENST00000297848.3:c.4714-1G>T	8.37:g.121344902G>T		Somatic	84	0		WXS	Illumina GAIIx	Phase_I	62	3	NM_021110	0	0	0	0	0		Splice_Site	SNP	ENST00000297848.3	37	CCDS34938.1	.	.	.	.	.	.	.	.	.	.	G	10.47	1.359633	0.24598	.	.	ENSG00000187955	ENST00000309791;ENST00000297848;ENST00000247781	.	.	.	5.52	4.63	0.57726	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	12.0253	0.53367	0.0841:0.0:0.9159:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	COL14A1	121414083	1.000000	0.71417	0.999000	0.59377	0.093000	0.18481	4.263000	0.58853	2.594000	0.87642	0.561000	0.74099	.	.		0.507	COL14A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313657.2	NM_021110	Intron
HHLA1	10086	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	8	133090151	133090151	+	Silent	SNP	G	G	A			TCGA-OR-A5LL-01A-11D-A29I-10	TCGA-OR-A5LL-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9bfd4b2e-0577-4c94-8d6c-dafa9104b502	2d4f1606-9261-4ba8-96a9-ee307989af11	g.chr8:133090151G>A	ENST00000414222.1	-	11	992	c.993C>T	c.(991-993)tcC>tcT	p.S331S	OC90_ENST00000262283.5_Silent_p.S73S|HHLA1_ENST00000434736.2_Silent_p.S367S	NM_001145095.1	NP_001138567.1	C9JL84	HHLA1_HUMAN	HERV-H LTR-associating 1	331						extracellular region (GO:0005576)				endometrium(6)|kidney(1)|lung(2)|skin(1)|stomach(2)	12						CCCAGGGCACGGACGATATGG	0.552																																					p.S331S		.											.	.	0			c.C993T						.						92.0	84.0	86.0					8																	133090151		692	1591	2283	SO:0001819	synonymous_variant	10086	exon11			GGGCACGGACGAT	AF110315		8q24	2011-03-01			ENSG00000132297	ENSG00000132297			4904	protein-coding gene	gene with protein product		604109		PLA2L		10329003	Standard	NM_001145095		Approved		uc011liy.1	C9JL84	OTTHUMG00000140390	ENST00000414222.1:c.993C>T	8.37:g.133090151G>A		Somatic	115	0		WXS	Illumina GAIIx	Phase_I	99	45	NM_001145095	0	0	0	0	0		Silent	SNP	ENST00000414222.1	37																																																																																				.		0.552	HHLA1-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		XR_017860	
RIC1	57589	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	9	5754924	5754924	+	Silent	SNP	A	A	G			TCGA-OR-A5LL-01A-11D-A29I-10	TCGA-OR-A5LL-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9bfd4b2e-0577-4c94-8d6c-dafa9104b502	2d4f1606-9261-4ba8-96a9-ee307989af11	g.chr9:5754924A>G	ENST00000414202.2	+	15	1877	c.1686A>G	c.(1684-1686)caA>caG	p.Q562Q	KIAA1432_ENST00000251879.6_Silent_p.Q562Q|KIAA1432_ENST00000418622.3_Silent_p.Q483Q|KIAA1432_ENST00000449720.2_Silent_p.Q446Q|KIAA1432_ENST00000381532.2_Silent_p.Q483Q	NM_001206557.1|NM_020829.3	NP_001193486.1|NP_065880.2														breast(2)|cervix(2)|endometrium(6)|kidney(4)|large_intestine(6)|lung(23)|prostate(1)|upper_aerodigestive_tract(1)	45		Acute lymphoblastic leukemia(23;0.154)		GBM - Glioblastoma multiforme(50;0.000525)|Lung(218;0.122)		ATGACCGTCAAGAAGAGGTAA	0.294																																					p.Q562Q		.											.	KIAA1432-90	0			c.A1686G						.						80.0	81.0	81.0					9																	5754924		2203	4300	6503	SO:0001819	synonymous_variant	57589	exon15			CCGTCAAGAAGAG																												ENST00000414202.2:c.1686A>G	9.37:g.5754924A>G		Somatic	17	0		WXS	Illumina GAIIx	Phase_I	26	6	NM_001135920	0	0	0	0	0		Silent	SNP	ENST00000414202.2	37	CCDS34982.2	.	.	.	.	.	.	.	.	.	.	A	8.536	0.872115	0.17322	.	.	ENSG00000107036	ENST00000545641	.	.	.	5.14	5.14	0.70334	.	.	.	.	.	T	0.57592	0.2064	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.57069	-0.7874	4	.	.	.	-11.1198	7.4465	0.27213	0.8302:0.0:0.1698:0.0	.	.	.	.	G	454	.	.	R	+	1	2	KIAA1432	5744924	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	3.749000	0.55150	1.927000	0.55829	0.528000	0.53228	AGA	.		0.294	KIAA1432-002	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051636.3		
FRMPD1	22844	bcgsc.ca	37	9	37731007	37731007	+	Silent	SNP	C	C	T	rs2274324	byFrequency	TCGA-OR-A5LL-01A-11D-A29I-10	TCGA-OR-A5LL-10A-01D-A29L-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9bfd4b2e-0577-4c94-8d6c-dafa9104b502	2d4f1606-9261-4ba8-96a9-ee307989af11	g.chr9:37731007C>T	ENST00000539465.1	+	9	1358	c.765C>T	c.(763-765)gaC>gaT	p.D255D	FRMPD1_ENST00000377765.3_Silent_p.D255D|FRMPD1_ENST00000536622.1_Silent_p.D77D|RP11-613M10.9_ENST00000540557.1_Intron|FRMPD1_ENST00000541302.1_Silent_p.D124D			Q5SYB0	FRPD1_HUMAN	FERM and PDZ domain containing 1	255	FERM. {ECO:0000255|PROSITE- ProRule:PRU00084}.					cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)				NS(3)|breast(2)|central_nervous_system(2)|endometrium(5)|kidney(4)|large_intestine(22)|lung(34)|ovary(5)|prostate(3)|skin(8)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	93				GBM - Glioblastoma multiforme(29;0.00655)		AGTCACATGACTACCGCTGCC	0.507													C|||	441	0.0880591	0.0688	0.0821	5008	,	,		19066	0.1885		0.0239	False		,,,				2504	0.0808				p.D255D		.											.	FRMPD1-159	0			c.C765T						.	C		257,4149	149.9+/-184.0	7,243,1953	103.0	96.0	98.0		765	5.6	1.0	9	dbSNP_100	98	217,8383	92.8+/-154.8	1,215,4084	yes	coding-synonymous	FRMPD1	NM_014907.2		8,458,6037	TT,TC,CC		2.5233,5.833,3.6445		255/1579	37731007	474,12532	2203	4300	6503	SO:0001819	synonymous_variant	22844	exon9			ACATGACTACCGC	AB023184	CCDS6612.1	9p13.1	2008-02-05			ENSG00000070601	ENSG00000070601			29159	protein-coding gene	gene with protein product						10231032	Standard	NM_014907		Approved	KIAA0967, FRMD2	uc004aag.1	Q5SYB0	OTTHUMG00000019927	ENST00000539465.1:c.765C>T	9.37:g.37731007C>T		Somatic	59	0		WXS	Illumina GAIIx	Phase_I	52	4	NM_014907	0	0	0	0	0	B4DZC8|B7Z807|D3DRQ3|Q14C73|Q5HY96|Q9Y2H3	Silent	SNP	ENST00000539465.1	37	CCDS6612.1																																																																																			C|0.942;T|0.058		0.507	FRMPD1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402969.1	NM_014907	
PSAT1	29968	broad.mit.edu	37	9	80919786	80919786	+	Silent	SNP	T	T	G			TCGA-OR-A5LL-01A-11D-A29I-10	TCGA-OR-A5LL-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9bfd4b2e-0577-4c94-8d6c-dafa9104b502	2d4f1606-9261-4ba8-96a9-ee307989af11	g.chr9:80919786T>G	ENST00000376588.3	+	4	395	c.327T>G	c.(325-327)gcT>gcG	p.A109A	PSAT1_ENST00000347159.2_Silent_p.A109A	NM_058179.2	NP_478059.1	Q9Y617	SERC_HUMAN	phosphoserine aminotransferase 1	109					cellular amino acid biosynthetic process (GO:0008652)|cellular nitrogen compound metabolic process (GO:0034641)|L-serine biosynthetic process (GO:0006564)|pyridoxine biosynthetic process (GO:0008615)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	O-phospho-L-serine:2-oxoglutarate aminotransferase activity (GO:0004648)|pyridoxal phosphate binding (GO:0030170)			breast(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(9)|ovary(1)|urinary_tract(1)	20						CTTGGTCAGCTAAGGCCGCAG	0.502																																					p.A109A	Colon(34;187 791 10662 18313 37609)	.											.	PSAT1-91	0			c.T327G						.						111.0	102.0	105.0					9																	80919786		2203	4300	6503	SO:0001819	synonymous_variant	29968	exon4			GTCAGCTAAGGCC	BC004863	CCDS6659.1, CCDS6660.1	9q21.2	2008-08-11			ENSG00000135069	ENSG00000135069			19129	protein-coding gene	gene with protein product		610936				12633500, 3651428	Standard	NM_058179		Approved	PSA	uc004ala.3	Q9Y617	OTTHUMG00000020066	ENST00000376588.3:c.327T>G	9.37:g.80919786T>G		Somatic	121	1		WXS	Illumina GAIIx	Phase_I	84	8	NM_021154	0	0	83	84	1	Q5T7G5|Q5T7G6|Q96AW2|Q9BQ12	Silent	SNP	ENST00000376588.3	37	CCDS6660.1																																																																																			.		0.502	PSAT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052777.1	NM_021154	
COL5A1	1289	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	9	137710730	137710730	+	Missense_Mutation	SNP	G	G	A	rs183114696		TCGA-OR-A5LL-01A-11D-A29I-10	TCGA-OR-A5LL-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9bfd4b2e-0577-4c94-8d6c-dafa9104b502	2d4f1606-9261-4ba8-96a9-ee307989af11	g.chr9:137710730G>A	ENST00000371817.3	+	56	4789	c.4375G>A	c.(4375-4377)Ggt>Agt	p.G1459S		NM_000093.3|NM_001278074.1	NP_000084.3|NP_001265003.1	P20908	CO5A1_HUMAN	collagen, type V, alpha 1	1459	Triple-helical region.				axon guidance (GO:0007411)|blood vessel development (GO:0001568)|cell adhesion (GO:0007155)|cell migration (GO:0016477)|collagen biosynthetic process (GO:0032964)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular fibril organization (GO:0043206)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|eye morphogenesis (GO:0048592)|heart morphogenesis (GO:0003007)|integrin biosynthetic process (GO:0045112)|negative regulation of endodermal cell differentiation (GO:1903225)|regulation of cellular component organization (GO:0051128)|skin development (GO:0043588)|tendon development (GO:0035989)|wound healing, spreading of epidermal cells (GO:0035313)	basement membrane (GO:0005604)|collagen type V trimer (GO:0005588)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	extracellular matrix structural constituent (GO:0005201)|heparin binding (GO:0008201)|integrin binding (GO:0005178)|metal ion binding (GO:0046872)|platelet-derived growth factor binding (GO:0048407)|proteoglycan binding (GO:0043394)			NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(26)|liver(2)|lung(36)|ovary(4)|pancreas(4)|prostate(5)|skin(10)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(4)	115		Myeloproliferative disorder(178;0.0341)		all cancers(34;2.28e-08)|OV - Ovarian serous cystadenocarcinoma(145;6.03e-08)|Epithelial(140;6.4e-08)|GBM - Glioblastoma multiforme(294;0.131)		AGGCCCGGACGGTCCCCCCGG	0.627													G|||	1	0.000199681	0.0	0.0014	5008	,	,		15371	0.0		0.0	False		,,,				2504	0.0				p.G1459S		.											.	COL5A1-524	0			c.G4375A						.						51.0	50.0	50.0					9																	137710730		2203	4300	6503	SO:0001583	missense	1289	exon56			CCGGACGGTCCCC	D90279	CCDS6982.1, CCDS75932.1	9q34.2-q34.3	2014-09-17			ENSG00000130635	ENSG00000130635		"""Collagens"""	2209	protein-coding gene	gene with protein product	"""alpha 1 type V collagen"""	120215				1572660	Standard	NM_001278074		Approved		uc031tfl.1	P20908	OTTHUMG00000020891	ENST00000371817.3:c.4375G>A	9.37:g.137710730G>A	ENSP00000360882:p.Gly1459Ser	Somatic	56	0		WXS	Illumina GAIIx	Phase_I	70	8	NM_000093	0	0	1	2	1	Q15094|Q5SUX4	Missense_Mutation	SNP	ENST00000371817.3	37	CCDS6982.1	1	4.578754578754579E-4	0	0.0	1	0.0027624309392265192	0	0.0	0	0.0	G	20.6	4.018713	0.75275	.	.	ENSG00000130635	ENST00000371817	D	0.99329	-5.75	4.69	4.69	0.59074	.	0.000000	0.85682	U	0.000000	D	0.99622	0.9862	H	0.98802	4.335	0.80722	D	1	D	0.71674	0.998	P	0.58210	0.835	D	0.97512	1.0067	10	0.87932	D	0	.	17.6063	0.88039	0.0:0.0:1.0:0.0	.	1459	P20908	CO5A1_HUMAN	S	1459	ENSP00000360882:G1459S	ENSP00000360882:G1459S	G	+	1	0	COL5A1	136850551	1.000000	0.71417	0.151000	0.22473	0.875000	0.50365	9.732000	0.98816	2.150000	0.67090	0.448000	0.29417	GGT	G|0.999;A|0.000		0.627	COL5A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054954.2	NM_000093	
AKAP4	8852	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	X	49957052	49957052	+	Missense_Mutation	SNP	T	T	C	rs61751432		TCGA-OR-A5LL-01A-11D-A29I-10	TCGA-OR-A5LL-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9bfd4b2e-0577-4c94-8d6c-dafa9104b502	2d4f1606-9261-4ba8-96a9-ee307989af11	g.chrX:49957052T>C	ENST00000376056.2	-	5	2435	c.2285A>G	c.(2284-2286)cAg>cGg	p.Q762R	AKAP4_ENST00000376064.3_Missense_Mutation_p.Q762R|AKAP4_ENST00000481402.1_5'UTR|AKAP4_ENST00000376058.2_Missense_Mutation_p.Q388R|AKAP4_ENST00000358526.2_Missense_Mutation_p.Q771R					A kinase (PRKA) anchor protein 4											NS(2)|breast(3)|central_nervous_system(2)|cervix(1)|endometrium(2)|kidney(6)|large_intestine(6)|lung(14)|ovary(1)|skin(4)	41	Ovarian(276;0.236)					GAGCTGCTTCTGCAAGCTATT	0.473																																					p.Q771R		.											.	AKAP4-540	0			c.A2312G						.						77.0	56.0	63.0					X																	49957052		2203	4300	6503	SO:0001583	missense	8852	exon5			TGCTTCTGCAAGC	AF072756	CCDS14329.1, CCDS14330.1	Xp11.2	2009-03-12			ENSG00000147081	ENSG00000147081		"""A-kinase anchor proteins"""	374	protein-coding gene	gene with protein product	"""A-kinase anchor protein 82 kDa"", ""testis-specific gene HI"", ""protein kinase A anchoring protein 4"", ""cancer/testis antigen 99"""	300185				9822690, 9514854	Standard	NM_003886		Approved	p82, hAKAP82, AKAP82, Fsc1, HI, CT99	uc004dow.1	Q5JQC9	OTTHUMG00000021517	ENST00000376056.2:c.2285A>G	X.37:g.49957052T>C	ENSP00000365224:p.Gln762Arg	Somatic	100	0		WXS	Illumina GAIIx	Phase_I	102	14	NM_003886	0	0	0	0	0		Missense_Mutation	SNP	ENST00000376056.2	37	CCDS14330.1	.	.	.	.	.	.	.	.	.	.	T	13.78	2.339701	0.41398	.	.	ENSG00000147081	ENST00000376056;ENST00000376058;ENST00000358526;ENST00000376064	T;T;T;T	0.11712	2.75;2.75;2.75;2.75	4.94	3.74	0.42951	A-kinase anchor 110kDa, C-terminal (1);	0.000000	0.50627	D	0.000107	T	0.27933	0.0688	M	0.77103	2.36	0.26431	N	0.97594	P;D	0.63046	0.872;0.992	P;D	0.64410	0.562;0.925	T	0.07328	-1.0778	9	.	.	.	-5.3588	8.1023	0.30865	0.0:0.0:0.2018:0.7982	.	771;388	Q5JQC9;A6ND82	AKAP4_HUMAN;.	R	762;388;771;762	ENSP00000365224:Q762R;ENSP00000365226:Q388R;ENSP00000351327:Q771R;ENSP00000365232:Q762R	.	Q	-	2	0	AKAP4	49843792	1.000000	0.71417	0.991000	0.47740	0.158000	0.22134	4.411000	0.59781	0.552000	0.29026	0.430000	0.28490	CAG	.		0.473	AKAP4-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056552.1	NM_003886	
SHROOM4	57477	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	X	50377344	50377344	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5LL-01A-11D-A29I-10	TCGA-OR-A5LL-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9bfd4b2e-0577-4c94-8d6c-dafa9104b502	2d4f1606-9261-4ba8-96a9-ee307989af11	g.chrX:50377344G>A	ENST00000289292.7	-	4	2012	c.1729C>T	c.(1729-1731)Cgc>Tgc	p.R577C	SHROOM4_ENST00000376020.2_Missense_Mutation_p.R577C|SHROOM4_ENST00000460112.3_Missense_Mutation_p.R461C			Q9ULL8	SHRM4_HUMAN	shroom family member 4	577					actin cytoskeleton organization (GO:0030036)|actin filament organization (GO:0007015)|brain development (GO:0007420)|cognition (GO:0050890)	apical plasma membrane (GO:0016324)|basal plasma membrane (GO:0009925)|cortical actin cytoskeleton (GO:0030864)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|myosin II complex (GO:0016460)|stress fiber (GO:0001725)	actin filament binding (GO:0051015)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(5)|large_intestine(6)|liver(1)|lung(20)|ovary(1)|prostate(4)|skin(3)|upper_aerodigestive_tract(1)	52	Ovarian(276;0.236)					TGGATCGAGCGGCCCCGGGTC	0.582																																					p.R577C		.											.	SHROOM4-131	0			c.C1729T						.						33.0	32.0	32.0					X																	50377344		2203	4300	6503	SO:0001583	missense	57477	exon4			TCGAGCGGCCCCG	AB033028	CCDS35277.1	Xp11.22	2008-02-05			ENSG00000158352	ENSG00000158352			29215	protein-coding gene	gene with protein product		300579				10574462, 16615870	Standard	NR_027121		Approved	KIAA1202	uc004dpe.2	Q9ULL8	OTTHUMG00000021521	ENST00000289292.7:c.1729C>T	X.37:g.50377344G>A	ENSP00000289292:p.Arg577Cys	Somatic	43	0		WXS	Illumina GAIIx	Phase_I	46	10	NM_020717	0	0	0	0	0	A7E2X9|D6RFW0|Q96LA0	Missense_Mutation	SNP	ENST00000289292.7	37	CCDS35277.1	.	.	.	.	.	.	.	.	.	.	G	13.19	2.163267	0.38217	.	.	ENSG00000158352	ENST00000289292;ENST00000376020;ENST00000460112	T;T;T	0.18657	2.65;2.65;2.2	5.53	5.53	0.82687	.	0.071575	0.56097	D	0.000032	T	0.46444	0.1393	M	0.65975	2.015	0.54753	D	0.999983	D	0.89917	1.0	D	0.76071	0.987	T	0.40627	-0.9553	10	0.72032	D	0.01	.	17.0818	0.86601	0.0:0.0:1.0:0.0	.	577	Q9ULL8	SHRM4_HUMAN	C	577;577;461	ENSP00000289292:R577C;ENSP00000365188:R577C;ENSP00000421450:R461C	ENSP00000289292:R577C	R	-	1	0	SHROOM4	50394084	1.000000	0.71417	1.000000	0.80357	0.832000	0.47134	4.289000	0.59013	2.562000	0.86427	0.600000	0.82982	CGC	.		0.582	SHROOM4-001	KNOWN	NMD_exception|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056564.4	NM_020717	
ITM2A	9452	ucsc.edu;bcgsc.ca	37	X	78616969	78616969	+	Missense_Mutation	SNP	C	C	A			TCGA-OR-A5LL-01A-11D-A29I-10	TCGA-OR-A5LL-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9bfd4b2e-0577-4c94-8d6c-dafa9104b502	2d4f1606-9261-4ba8-96a9-ee307989af11	g.chrX:78616969C>A	ENST00000373298.2	-	5	703	c.560G>T	c.(559-561)aGa>aTa	p.R187I	ITM2A_ENST00000434584.2_Missense_Mutation_p.R143I|ITM2A_ENST00000469541.1_5'UTR	NM_004867.4	NP_004858.1	O43736	ITM2A_HUMAN	integral membrane protein 2A	187	BRICHOS. {ECO:0000255|PROSITE- ProRule:PRU00255}.					integral component of membrane (GO:0016021)				breast(1)|kidney(1)|large_intestine(1)|lung(10)|ovary(1)|skin(3)|upper_aerodigestive_tract(1)	18						AGGCAGATATCTGCCACTCTA	0.343																																					p.R187I		.											.	ITM2A-131	0			c.G560T						.						53.0	47.0	49.0					X																	78616969		2201	4297	6498	SO:0001583	missense	9452	exon5			AGATATCTGCCAC	BC034485	CCDS14444.1, CCDS55455.1	Xq13.3-q21.2	2012-10-10			ENSG00000078596	ENSG00000078596		"""BRICHOS domain containing"""	6173	protein-coding gene	gene with protein product	"""BRICHOS domain containing 2A"""	300222				9892734, 8702637	Standard	NM_004867		Approved	BRICD2A, E25A	uc004edh.3	O43736	OTTHUMG00000021900	ENST00000373298.2:c.560G>T	X.37:g.78616969C>A	ENSP00000362395:p.Arg187Ile	Somatic	285	4		WXS	Illumina GAIIx	Phase_I	317	59	NM_004867	0	0	0	0	0	B2R7X5|B4E062|Q6IBC9	Missense_Mutation	SNP	ENST00000373298.2	37	CCDS14444.1	.	.	.	.	.	.	.	.	.	.	C	6.441	0.449439	0.12223	.	.	ENSG00000078596	ENST00000373298;ENST00000434584	T;T	0.79141	-1.24;-1.24	4.5	-1.78	0.07957	BRICHOS (2);	0.275526	0.35970	N	0.002872	T	0.52125	0.1715	N	0.08118	0	0.28798	N	0.89896	B;B	0.22146	0.0;0.065	B;B	0.27500	0.001;0.08	T	0.41875	-0.9484	10	0.30078	T	0.28	-17.4096	6.552	0.22440	0.0:0.2226:0.5219:0.2554	.	143;187	B4E062;O43736	.;ITM2A_HUMAN	I	187;143	ENSP00000362395:R187I;ENSP00000415533:R143I	ENSP00000362395:R187I	R	-	2	0	ITM2A	78503625	1.000000	0.71417	0.101000	0.21167	0.022000	0.10575	2.459000	0.45023	-0.178000	0.10672	-0.503000	0.04515	AGA	.		0.343	ITM2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057329.1	NM_004867	
COL4A6	1288	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	107457358	107457358	+	Missense_Mutation	SNP	C	C	A			TCGA-OR-A5LL-01A-11D-A29I-10	TCGA-OR-A5LL-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9bfd4b2e-0577-4c94-8d6c-dafa9104b502	2d4f1606-9261-4ba8-96a9-ee307989af11	g.chrX:107457358C>A	ENST00000372216.4	-	6	528	c.428G>T	c.(427-429)gGg>gTg	p.G143V	COL4A6_ENST00000545689.1_Missense_Mutation_p.G142V|COL4A6_ENST00000538570.1_Missense_Mutation_p.G142V|COL4A6_ENST00000334504.7_Missense_Mutation_p.G142V|COL4A6_ENST00000394872.2_Missense_Mutation_p.G141V	NM_001847.2	NP_001838.2	Q14031	CO4A6_HUMAN	collagen, type IV, alpha 6	143	Triple-helical region.				cell adhesion (GO:0007155)|cellular response to amino acid stimulus (GO:0071230)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)	collagen type IV trimer (GO:0005587)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)	extracellular matrix structural constituent (GO:0005201)			breast(2)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(20)|lung(41)|ovary(7)|prostate(1)|skin(1)|stomach(1)|urinary_tract(2)	92						TCCGAGAAGCCCAGGATAGCC	0.537									Alport syndrome with Diffuse Leiomyomatosis																												p.G143V	Melanoma(87;1895 1945 2589 7165)	.											.	COL4A6-199	0			c.G428T						.						91.0	82.0	85.0					X																	107457358		2203	4300	6503	SO:0001583	missense	1288	exon6	Familial Cancer Database		AGAAGCCCAGGAT	U04845	CCDS14541.1, CCDS14542.1, CCDS76008.1, CCDS76009.1, CCDS76010.1	Xq22	2014-09-17			ENSG00000197565	ENSG00000197565		"""Collagens"""	2208	protein-coding gene	gene with protein product		303631				8356449	Standard	NM_033641		Approved		uc004env.4	Q14031	OTTHUMG00000022179	ENST00000372216.4:c.428G>T	X.37:g.107457358C>A	ENSP00000361290:p.Gly143Val	Somatic	68	0		WXS	Illumina GAIIx	Phase_I	64	24	NM_001847	0	0	0	0	0	Q12823|Q14053|Q5JYH6|Q5JYH8|Q9NQM5|Q9NTX3|Q9UJ76|Q9UMG6|Q9Y4L4	Missense_Mutation	SNP	ENST00000372216.4	37	CCDS14541.1	.	.	.	.	.	.	.	.	.	.	C	12.79	2.042466	0.35989	.	.	ENSG00000197565	ENST00000372216;ENST00000334504;ENST00000394872;ENST00000541389;ENST00000545689;ENST00000538570	D;D;D;D;D	0.99637	-5.77;-5.77;-6.29;-5.77;-5.77	4.92	4.92	0.64577	.	0.000000	0.41194	D	0.000927	D	0.99813	0.9918	H	0.98980	4.39	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;1.0;1.0;1.0	D	0.96716	0.9529	10	0.87932	D	0	.	14.6254	0.68616	0.0:1.0:0.0:0.0	.	142;142;143;142	F5H851;F5H3Q5;Q14031;Q14031-2	.;.;CO4A6_HUMAN;.	V	143;142;141;142;142;142	ENSP00000361290:G143V;ENSP00000334733:G142V;ENSP00000378340:G141V;ENSP00000443707:G142V;ENSP00000445236:G142V	ENSP00000334733:G142V	G	-	2	0	COL4A6	107344014	1.000000	0.71417	0.996000	0.52242	0.972000	0.66771	4.988000	0.63863	2.360000	0.80028	0.506000	0.49869	GGG	.		0.537	COL4A6-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000057875.2		
GPR50	9248	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	X	150349287	150349287	+	Missense_Mutation	SNP	C	C	G			TCGA-OR-A5LL-01A-11D-A29I-10	TCGA-OR-A5LL-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9bfd4b2e-0577-4c94-8d6c-dafa9104b502	2d4f1606-9261-4ba8-96a9-ee307989af11	g.chrX:150349287C>G	ENST00000218316.3	+	2	1301	c.1232C>G	c.(1231-1233)tCc>tGc	p.S411C	GPR50-AS1_ENST00000454196.1_RNA|AF003625.3_ENST00000602313.1_lincRNA	NM_004224.3	NP_004215.2	Q13585	MTR1L_HUMAN	G protein-coupled receptor 50	411	Pro-rich.				cell-cell signaling (GO:0007267)|G-protein coupled receptor signaling pathway (GO:0007186)	integral component of plasma membrane (GO:0005887)	G-protein coupled receptor activity (GO:0004930)|identical protein binding (GO:0042802)|melatonin receptor activity (GO:0008502)			breast(4)|central_nervous_system(1)|endometrium(8)|kidney(1)|large_intestine(6)|lung(14)|ovary(1)|pancreas(1)|prostate(1)|stomach(1)	38	Acute lymphoblastic leukemia(192;6.56e-05)					TTTAGCCACTCCAAGGCTGCC	0.597																																					p.S411C		.											.	GPR50-176	0			c.C1232G						.						125.0	139.0	134.0					X																	150349287		2078	4192	6270	SO:0001583	missense	9248	exon2			GCCACTCCAAGGC	U52219	CCDS44012.1	Xq28	2012-08-21			ENSG00000102195	ENSG00000102195		"""GPCR / Class A : Orphans"""	4506	protein-coding gene	gene with protein product		300207				9933574, 18400093	Standard	NM_004224		Approved	H9, Mel1c	uc010ntg.2	Q13585	OTTHUMG00000024166	ENST00000218316.3:c.1232C>G	X.37:g.150349287C>G	ENSP00000218316:p.Ser411Cys	Somatic	92	0		WXS	Illumina GAIIx	Phase_I	92	16	NM_004224	0	0	0	0	0	Q0VGG3|Q3ZAR0	Missense_Mutation	SNP	ENST00000218316.3	37	CCDS44012.1	.	.	.	.	.	.	.	.	.	.	C	6.887	0.533172	0.13188	.	.	ENSG00000102195	ENST00000218316	T	0.73363	-0.74	3.67	1.81	0.25067	.	0.501719	0.15091	N	0.281047	T	0.55893	0.1949	N	0.14661	0.345	0.09310	N	1	D	0.54047	0.964	B	0.43783	0.431	T	0.50931	-0.8769	10	0.87932	D	0	-4.9115	5.61	0.17400	0.0:0.4962:0.3824:0.1215	.	411	Q13585	MTR1L_HUMAN	C	411	ENSP00000218316:S411C	ENSP00000218316:S411C	S	+	2	0	GPR50	150099945	0.000000	0.05858	0.006000	0.13384	0.127000	0.20565	-0.060000	0.11712	0.183000	0.20059	-0.516000	0.04426	TCC	.		0.597	GPR50-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060874.1	NM_004224	
SRPK3	26576	broad.mit.edu	37	X	153047594	153047594	+	Missense_Mutation	SNP	A	A	C			TCGA-OR-A5LL-01A-11D-A29I-10	TCGA-OR-A5LL-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9bfd4b2e-0577-4c94-8d6c-dafa9104b502	2d4f1606-9261-4ba8-96a9-ee307989af11	g.chrX:153047594A>C	ENST00000370101.3	+	5	452	c.406A>C	c.(406-408)Agt>Cgt	p.S136R	SRPK3_ENST00000489426.1_Missense_Mutation_p.S203R|SRPK3_ENST00000370108.3_Missense_Mutation_p.S136R|SRPK3_ENST00000393786.3_Missense_Mutation_p.S136R|SRPK3_ENST00000370100.1_Missense_Mutation_p.S94R|SRPK3_ENST00000370104.1_Missense_Mutation_p.S136R	NM_001170760.1|NM_014370.3	NP_001164231.1|NP_055185.2	Q9UPE1	SRPK3_HUMAN	SRSF protein kinase 3	136	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cell differentiation (GO:0030154)|muscle tissue development (GO:0060537)|skeletal muscle tissue development (GO:0007519)		ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|central_nervous_system(1)|endometrium(2)|lung(4)|ovary(2)|pancreas(2)|urinary_tract(1)	13	all_hematologic(71;4.25e-06)|all_lung(58;3.83e-05)|Lung NSC(58;5.54e-05)|Acute lymphoblastic leukemia(192;6.56e-05)					CAGCGACCCCAGTGACCCCAA	0.557																																					p.S136R	Esophageal Squamous(167;766 3400 32156)	.											.	SRPK3-540	0			c.A406C						.						106.0	100.0	102.0					X																	153047594		2201	4300	6501	SO:0001583	missense	26576	exon5			GACCCCAGTGACC	AF027406	CCDS35441.1, CCDS55537.1, CCDS55538.1	Xq28	2010-06-23	2010-06-23	2006-08-17	ENSG00000184343	ENSG00000184343			11402	protein-coding gene	gene with protein product			"""serine/threonine kinase 23"", ""SFRS protein kinase 3"""	STK23		16140986	Standard	NM_014370		Approved	MSSK1	uc004fil.3	Q9UPE1	OTTHUMG00000024207	ENST00000370101.3:c.406A>C	X.37:g.153047594A>C	ENSP00000359119:p.Ser136Arg	Somatic	220	1		WXS	Illumina GAIIx	Phase_I	179	5	NM_014370	0	0	7	7	0	Q13583|Q4F970|Q562F5|Q9UM62	Missense_Mutation	SNP	ENST00000370101.3	37	CCDS35441.1	.	.	.	.	.	.	.	.	.	.	A	17.47	3.398719	0.62177	.	.	ENSG00000184343	ENST00000489426;ENST00000393786;ENST00000370104;ENST00000370108;ENST00000370101;ENST00000370100	T;T;T;T;T;T	0.31510	1.49;1.49;1.49;1.49;1.49;1.49	5.82	5.82	0.92795	Serine/threonine-protein kinase-like domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.64402	D	0.000004	T	0.27419	0.0673	L	0.38692	1.165	0.50171	D	0.999859	B;D;B;B;B	0.58620	0.004;0.983;0.054;0.28;0.026	B;P;B;B;B	0.44597	0.013;0.454;0.029;0.068;0.102	T	0.02991	-1.1085	10	0.20519	T	0.43	-18.209	14.0717	0.64863	1.0:0.0:0.0:0.0	.	94;136;136;136;203	Q9UPE1-2;Q9UPE1-4;Q9UPE1-3;Q9UPE1;E7ETV6	.;.;.;SRPK3_HUMAN;.	R	203;136;136;136;136;94	ENSP00000420058:S203R;ENSP00000377376:S136R;ENSP00000359122:S136R;ENSP00000359126:S136R;ENSP00000359119:S136R;ENSP00000359118:S94R	ENSP00000359118:S94R	S	+	1	0	SRPK3	152700788	0.998000	0.40836	1.000000	0.80357	0.683000	0.39861	3.883000	0.56168	1.969000	0.57287	0.430000	0.28490	AGT	.		0.557	SRPK3-006	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000354501.1	NM_014370	
RABL2B	11158	hgsc.bcm.edu;bcgsc.ca	37	22	51208398	51208399	+	Frame_Shift_Ins	INS	-	-	A			TCGA-OR-A5LL-01A-11D-A29I-10	TCGA-OR-A5LL-10A-01D-A29L-10	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9bfd4b2e-0577-4c94-8d6c-dafa9104b502	2d4f1606-9261-4ba8-96a9-ee307989af11	g.chr22:51208398_51208399insA	ENST00000395598.3	-	6	554_555	c.343_344insT	c.(343-345)tggfs	p.W115fs	RABL2B_ENST00000354869.3_Frame_Shift_Ins_p.W115fs|RABL2B_ENST00000395591.1_Intron|RABL2B_ENST00000395595.3_Frame_Shift_Ins_p.W115fs|RABL2B_ENST00000465063.1_5'UTR|RABL2B_ENST00000395593.3_Frame_Shift_Ins_p.W115fs|RABL2B_ENST00000435118.1_Frame_Shift_Ins_p.W115fs	NM_001003789.1|NM_001130919.1|NM_001130922.1|NM_007081.2	NP_001003789.1|NP_001124391.1|NP_001124394.1|NP_009012.1	Q9UNT1	RBL2B_HUMAN	RAB, member of RAS oncogene family-like 2B	115					GTP catabolic process (GO:0006184)|small GTPase mediated signal transduction (GO:0007264)		GTP binding (GO:0005525)|GTPase activity (GO:0003924)			lung(1)	1		all_cancers(38;8.8e-15)|all_epithelial(38;1.12e-12)|all_lung(38;3.07e-05)|Breast(42;6.27e-05)|Lung NSC(38;0.000813)|Ovarian(80;0.0221)|Hepatocellular(38;0.0691)|Lung SC(80;0.113)		BRCA - Breast invasive adenocarcinoma(115;0.0539)|LUAD - Lung adenocarcinoma(64;0.247)		CTCTGTATACCAGGTGCTCAGG	0.505																																					p.W115fs	GBM(148;358 1894 4987 13698 40400)	.											.	RABL2B-131	0			c.344_345insT						.																																			SO:0001589	frameshift_variant	11158	exon7			GTATACCAGGTGC		CCDS14102.1, CCDS33683.1, CCDS46738.1	22q13.33	2014-05-09			ENSG00000079974	ENSG00000079974		"""RAB, member RAS oncogene"""	9800	protein-coding gene	gene with protein product		605413				10444334	Standard	NM_001130919		Approved		uc011asg.1	Q9UNT1	OTTHUMG00000150156	ENST00000395598.3:c.344dupT	22.37:g.51208399_51208399dupA	ENSP00000378962:p.Trp115fs	Somatic	185	0		WXS	Illumina GAIIx	Phase_I	116	30	NM_001130920	0	0	0	0	0	Q5TZT8|Q96C33	Frame_Shift_Ins	INS	ENST00000395598.3	37	CCDS14102.1																																																																																			.		0.505	RABL2B-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000316606.1	NM_001003789	
RFC1	5981	broad.mit.edu;bcgsc.ca	37	4	39310527	39310528	+	Frame_Shift_Ins	INS	-	-	A			TCGA-OR-A5LL-01A-11D-A29I-10	TCGA-OR-A5LL-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9bfd4b2e-0577-4c94-8d6c-dafa9104b502	2d4f1606-9261-4ba8-96a9-ee307989af11	g.chr4:39310527_39310528insA	ENST00000381897.1	-	13	1746_1747	c.1613_1614insT	c.(1612-1614)ttgfs	p.L538fs	RFC1_ENST00000349703.2_Frame_Shift_Ins_p.L538fs	NM_001204747.1|NM_002913.4	NP_001191676.1|NP_002904.3	P35251	RFC1_HUMAN	replication factor C (activator 1) 1, 145kDa	538					DNA repair (GO:0006281)|DNA strand elongation involved in DNA replication (GO:0006271)|DNA-dependent DNA replication (GO:0006261)|mitotic cell cycle (GO:0000278)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA gap filling (GO:0006297)|positive regulation of catalytic activity (GO:0043085)|positive regulation of transcription, DNA-templated (GO:0045893)|telomere maintenance (GO:0000723)|telomere maintenance via recombination (GO:0000722)|telomere maintenance via semi-conservative replication (GO:0032201)|telomere maintenance via telomerase (GO:0007004)|transcription, DNA-templated (GO:0006351)|transcription-coupled nucleotide-excision repair (GO:0006283)	cell junction (GO:0030054)|DNA replication factor C complex (GO:0005663)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA clamp loader activity (GO:0003689)|double-stranded DNA binding (GO:0003690)|enzyme activator activity (GO:0008047)|sequence-specific DNA binding (GO:0043565)			haematopoietic_and_lymphoid_tissue(2)|large_intestine(9)|ovary(2)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)	16						TTGTCTTTGCCAAACTGTCCCT	0.406																																					p.L538fs	Colon(109;59 1555 12203 17579 39824)|Esophageal Squamous(18;360 542 16186 28570 51157)	.											.	RFC1-230	0			c.1614_1615insT						.																																			SO:0001589	frameshift_variant	5981	exon13			CTTTGCCAAACTG	L23320	CCDS3450.1, CCDS56329.1	4p14-p13	2010-04-21	2002-08-29		ENSG00000035928	ENSG00000035928		"""ATPases / AAA-type"""	9969	protein-coding gene	gene with protein product		102579	"""replication factor C (activator 1) 1 (145kD)"""			8114700	Standard	NM_002913		Approved	A1, PO-GA, RFC140, MHCBFB	uc003gty.2	P35251	OTTHUMG00000099363	ENST00000381897.1:c.1614dupT	4.37:g.39310530_39310530dupA	ENSP00000371321:p.Leu538fs	Somatic	76	0		WXS	Illumina GAIIx	Phase_I	78	9	NM_002913	0	0	0	0	0	A8K6E7|Q5XKF5|Q6PKU0|Q86V41|Q86V46	Frame_Shift_Ins	INS	ENST00000381897.1	37	CCDS56329.1																																																																																			.		0.406	RFC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000216808.1	NM_002913	
