#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_TTotCov	i_TVarCov	i_Transcript_Id	i_Trna_alt1	i_Trna_alt2	i_Trna_ref	i_Trna_tot	i_Trna_var	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
UBR4	23352	hgsc.bcm.edu	37	1	19518806	19518806	+	Missense_Mutation	SNP	G	G	T			TCGA-OR-A5LN-01A-11D-A29I-10	TCGA-OR-A5LN-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	cf6a87e3-f084-4b4c-a978-314c952310a0	c8e44d71-ecbb-4a1f-86ef-5631d9a7442a	g.chr1:19518806G>T	ENST00000375254.3	-	11	1297	c.1270C>A	c.(1270-1272)Ctc>Atc	p.L424I	UBR4_ENST00000375217.2_Missense_Mutation_p.L424I|UBR4_ENST00000375226.2_Missense_Mutation_p.L424I|UBR4_ENST00000375267.2_Missense_Mutation_p.L424I	NM_020765.2	NP_065816.2	Q5T4S7	UBR4_HUMAN	ubiquitin protein ligase E3 component n-recognin 4	424					protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|viral process (GO:0016032)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(7)|central_nervous_system(1)|cervix(2)|endometrium(23)|kidney(25)|large_intestine(25)|liver(2)|lung(47)|ovary(10)|pancreas(2)|prostate(7)|skin(5)|stomach(5)|upper_aerodigestive_tract(4)|urinary_tract(6)	171		Colorectal(325;3.46e-05)|Renal(390;0.000147)|all_lung(284;0.000328)|Lung NSC(340;0.000406)|Breast(348;0.000814)|Ovarian(437;0.00774)|Myeloproliferative disorder(586;0.0256)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00674)|BRCA - Breast invasive adenocarcinoma(304;5.43e-05)|Kidney(64;0.000337)|KIRC - Kidney renal clear cell carcinoma(64;0.00426)|STAD - Stomach adenocarcinoma(196;0.00715)|READ - Rectum adenocarcinoma(331;0.0816)		GTAGGACTGAGGTTCAGTATG	0.468																																					p.L424I		.											.	UBR4-612	0			c.C1270A						.						85.0	85.0	85.0					1																	19518806		2203	4300	6503	SO:0001583	missense	23352	exon11			GACTGAGGTTCAG	AF348492	CCDS189.1	1p36.13	2008-06-23	2007-06-19	2007-06-19	ENSG00000127481	ENSG00000127481		"""Ubiquitin protein ligase E3 component n-recognins"""	30313	protein-coding gene	gene with protein product		609890	"""zinc finger, UBR1 type 1"""	ZUBR1		14702039, 10718198, 16055722	Standard	XM_005245802		Approved	KIAA1307, KIAA0462, RBAF600	uc001bbi.3	Q5T4S7	OTTHUMG00000002498	ENST00000375254.3:c.1270C>A	1.37:g.19518806G>T	ENSP00000364403:p.Leu424Ile	Somatic	100	0		WXS	Illumina GAIIx	Phase_I	79	4	NM_020765	0	0	0	0	0	A8MPT2|A8MQ33|A8MQB1|O60646|O75050|Q4QRK5|Q5T4S8|Q5T4S9|Q5TBN8|Q5TBP2|Q6DKH8|Q6P4A4|Q7L8P7|Q8IXJ4|Q8TDN5|Q8WV67|Q9HA46|Q9P2N9|Q9UG82	Missense_Mutation	SNP	ENST00000375254.3	37	CCDS189.1	.	.	.	.	.	.	.	.	.	.	G	17.24	3.339534	0.60963	.	.	ENSG00000127481	ENST00000375254;ENST00000375267;ENST00000375217;ENST00000375226	T;T;T;T	0.24538	1.86;1.86;1.85;1.85	5.6	5.6	0.85130	.	0.000000	0.64402	D	0.000002	T	0.39091	0.1065	L	0.36672	1.1	0.80722	D	1	P	0.52842	0.956	P	0.62184	0.899	T	0.01993	-1.1233	10	0.23891	T	0.37	.	18.1764	0.89762	0.0:0.0:1.0:0.0	.	424	Q5T4S7	UBR4_HUMAN	I	424	ENSP00000364403:L424I;ENSP00000364416:L424I;ENSP00000364365:L424I;ENSP00000364374:L424I	ENSP00000364365:L424I	L	-	1	0	UBR4	19391393	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	9.176000	0.94839	2.630000	0.89119	0.591000	0.81541	CTC	.		0.468	UBR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000007085.1	NM_020765	
LRP8	7804	hgsc.bcm.edu	37	1	53793511	53793511	+	Missense_Mutation	SNP	T	T	C	rs4926972	byFrequency	TCGA-OR-A5LN-01A-11D-A29I-10	TCGA-OR-A5LN-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	cf6a87e3-f084-4b4c-a978-314c952310a0	c8e44d71-ecbb-4a1f-86ef-5631d9a7442a	g.chr1:53793511T>C	ENST00000306052.6	-	1	175	c.74A>G	c.(73-75)cAg>cGg	p.Q25R	LRP8_ENST00000354412.3_Missense_Mutation_p.Q25R|LRP8_ENST00000371454.2_Missense_Mutation_p.Q25R|LRP8_ENST00000347547.2_Missense_Mutation_p.Q25R|LRP8_ENST00000465675.1_5'Flank|RP4-784A16.5_ENST00000445039.2_lincRNA	NM_004631.4	NP_004622.2	Q14114	LRP8_HUMAN	low density lipoprotein receptor-related protein 8, apolipoprotein e receptor	25			Q -> R (in dbSNP:rs4926972). {ECO:0000269|PubMed:11152697, ECO:0000269|PubMed:15489334, ECO:0000269|PubMed:8626535, ECO:0000269|PubMed:9079678}.		ammon gyrus development (GO:0021541)|blood coagulation (GO:0007596)|cellular response to cholesterol (GO:0071397)|cellular response to growth factor stimulus (GO:0071363)|cytokine-mediated signaling pathway (GO:0019221)|endocytosis (GO:0006897)|layer formation in cerebral cortex (GO:0021819)|lipid metabolic process (GO:0006629)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|phototransduction, visible light (GO:0007603)|positive regulation of CREB transcription factor activity (GO:0032793)|positive regulation of dendrite development (GO:1900006)|positive regulation of dendritic spine morphogenesis (GO:0061003)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein tyrosine kinase activity (GO:0061098)|proteolysis (GO:0006508)|receptor-mediated endocytosis (GO:0006898)|reelin-mediated signaling pathway (GO:0038026)|regulation of synaptic transmission (GO:0050804)|response to drug (GO:0042493)|retinoid metabolic process (GO:0001523)|signal transduction (GO:0007165)	caveola (GO:0005901)|dendrite (GO:0030425)|extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|microtubule associated complex (GO:0005875)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|receptor complex (GO:0043235)	apolipoprotein binding (GO:0034185)|calcium ion binding (GO:0005509)|high-density lipoprotein particle binding (GO:0008035)|reelin receptor activity (GO:0038025)|transmembrane signaling receptor activity (GO:0004888)|very-low-density lipoprotein particle receptor activity (GO:0030229)			endometrium(2)|kidney(1)|large_intestine(6)|lung(9)|prostate(2)|skin(1)	21						ATGCTGGagctgcagcagcag	0.741													C|||	2756	0.550319	0.9327	0.2997	5008	,	,		7123	0.4841		0.3867	False		,,,				2504	0.4479				p.Q25R		.											.	LRP8-90	0			c.A74G						.						1.0	2.0	2.0					1																	53793511		911	2047	2958	SO:0001583	missense	7804	exon1			TGGAGCTGCAGCA	D50678	CCDS578.1, CCDS579.1, CCDS580.1, CCDS30720.1	1p32.3	2013-05-29			ENSG00000157193	ENSG00000157193		"""Low density lipoprotein receptors"""	6700	protein-coding gene	gene with protein product		602600				8626535, 9079678	Standard	NM_004631		Approved	APOER2, MCI1, LRP-8, HSZ75190	uc001cvi.2	Q14114	OTTHUMG00000008924	ENST00000306052.6:c.74A>G	1.37:g.53793511T>C	ENSP00000303634:p.Gln25Arg	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	6	6	NM_004631	0	0	0	0	0	B1AMT6|B1AMT7|B1AMT8|O14968|Q86V27|Q99876|Q9BR78	Missense_Mutation	SNP	ENST00000306052.6	37	CCDS578.1	1082	0.49542124542124544	405	0.823170731707317	112	0.30939226519337015	268	0.46853146853146854	297	0.391820580474934	c	0.012	-1.664933	0.00765	.	.	ENSG00000157193	ENST00000306052;ENST00000371454;ENST00000354412;ENST00000347547	D;D;D;D	0.90563	-2.67;-2.67;-2.69;-2.64	3.47	-3.85	0.04243	.	.	.	.	.	T	0.00012	0.0000	N	0.08118	0	0.80722	P	0.0	B;B;B;B	0.14805	0.005;0.0;0.01;0.011	B;B;B;B	0.12837	0.004;0.0;0.008;0.003	T	0.30909	-0.9962	8	0.12430	T	0.62	.	11.9	0.52678	0.0:0.3284:0.0:0.6716	rs4926972	25;25;25;25	Q14114-2;Q14114-4;Q14114-3;Q14114	.;.;.;LRP8_HUMAN	R	25	ENSP00000303634:Q25R;ENSP00000360509:Q25R;ENSP00000346391:Q25R;ENSP00000334522:Q25R	ENSP00000303634:Q25R	Q	-	2	0	LRP8	53566099	0.879000	0.30193	0.011000	0.14972	0.018000	0.09664	-1.775000	0.01783	-1.821000	0.01213	-3.002000	0.00076	CAG	T|0.504;C|0.496		0.741	LRP8-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000024699.1	NM_004631	
GSTM5	2949	bcgsc.ca	37	1	110257590	110257590	+	Silent	SNP	T	T	C	rs2229059	byFrequency	TCGA-OR-A5LN-01A-11D-A29I-10	TCGA-OR-A5LN-10A-01D-A29L-10	T	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	cf6a87e3-f084-4b4c-a978-314c952310a0	c8e44d71-ecbb-4a1f-86ef-5631d9a7442a	g.chr1:110257590T>C	ENST00000256593.3	+	6	440	c.382T>C	c.(382-384)Ttg>Ctg	p.L128L	GSTM5_ENST00000492718.1_3'UTR|GSTM5_ENST00000369813.1_Silent_p.L87L|GSTM5_ENST00000369812.5_Silent_p.L147L	NM_000851.3	NP_000842.2	P46439	GSTM5_HUMAN	glutathione S-transferase mu 5	128	GST C-terminal.				glutathione derivative biosynthetic process (GO:1901687)|glutathione metabolic process (GO:0006749)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)	glutathione transferase activity (GO:0004364)			NS(1)|central_nervous_system(6)|large_intestine(1)|lung(7)|ovary(1)|prostate(1)|skin(2)|urinary_tract(2)	21		all_epithelial(167;2.5e-05)|all_lung(203;0.000135)|Lung NSC(277;0.000269)|Breast(1374;0.244)		Colorectal(144;0.0131)|all cancers(265;0.0252)|Epithelial(280;0.0265)|Lung(183;0.0425)|COAD - Colon adenocarcinoma(174;0.0474)|LUSC - Lung squamous cell carcinoma(189;0.228)	Glutathione(DB00143)	GCCAAAATACTTGGAGGAACT	0.522													T|||	143	0.0285543	0.0045	0.0432	5008	,	,		20080	0.0		0.0686	False		,,,				2504	0.0389				p.L128L		.											.	GSTM5-514	0			c.T382C						.	T		73,4333	65.8+/-103.3	2,69,2132	117.0	123.0	121.0		382	-4.5	0.0	1	dbSNP_98	121	674,7926	169.0+/-220.4	34,606,3660	no	coding-synonymous	GSTM5	NM_000851.3		36,675,5792	CC,CT,TT		7.8372,1.6568,5.7435		128/219	110257590	747,12259	2203	4300	6503	SO:0001819	synonymous_variant	2949	exon6			AAATACTTGGAGG	L02321	CCDS811.1	1p13.3	2012-06-21	2008-11-26		ENSG00000134201	ENSG00000134201	2.5.1.18	"""Glutathione S-transferases / Soluble"""	4637	protein-coding gene	gene with protein product		138385	"""glutathione S-transferase M5"""			8473333	Standard	NM_000851		Approved		uc001dyn.3	P46439	OTTHUMG00000011644	ENST00000256593.3:c.382T>C	1.37:g.110257590T>C		Somatic	372	2		WXS	Illumina GAIIx	Phase_I	195	6	NM_000851	0	0	0	0	0	A8K0V8|Q6PD78	Silent	SNP	ENST00000256593.3	37	CCDS811.1																																																																																			T|0.956;C|0.044		0.522	GSTM5-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000032200.1	NM_000851	
PTGFRN	5738	hgsc.bcm.edu	37	1	117452869	117452869	+	Missense_Mutation	SNP	C	C	G	rs77292583	byFrequency	TCGA-OR-A5LN-01A-11D-A29I-10	TCGA-OR-A5LN-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	cf6a87e3-f084-4b4c-a978-314c952310a0	c8e44d71-ecbb-4a1f-86ef-5631d9a7442a	g.chr1:117452869C>G	ENST00000393203.2	+	1	191	c.44C>G	c.(43-45)tCg>tGg	p.S15W	RP4-753F5.1_ENST00000610171.1_lincRNA	NM_020440.2	NP_065173.2	Q9P2B2	FPRP_HUMAN	prostaglandin F2 receptor inhibitor	15					lipid particle organization (GO:0034389)	cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)				NS(1)|breast(1)|endometrium(4)|large_intestine(10)|liver(1)|lung(22)|ovary(1)|prostate(4)|stomach(1)|upper_aerodigestive_tract(1)	46	Lung SC(450;0.225)	all_cancers(81;0.00104)|all_lung(203;8.97e-05)|all_epithelial(167;0.000139)|Lung NSC(69;0.000446)		Lung(183;0.0704)|LUSC - Lung squamous cell carcinoma(189;0.227)|Colorectal(144;0.248)		GCGCTCCTGTCGTTGGGTGAG	0.786													C|||	146	0.0291534	0.1074	0.0058	5008	,	,		7813	0.0		0.0	False		,,,				2504	0.0				p.S15W		.											.	PTGFRN-91	0			c.C44G						.	C	TRP/SER	237,3861		2,233,1814	4.0	6.0	5.0		44	0.3	0.1	1	dbSNP_132	5	3,8095		0,3,4046	no	missense	PTGFRN	NM_020440.2	177	2,236,5860	GG,GC,CC		0.037,5.7833,1.9679	benign	15/880	117452869	240,11956	2049	4049	6098	SO:0001583	missense	5738	exon1			TCCTGTCGTTGGG	AB014734	CCDS890.1	1p13.1	2013-01-29	2013-01-25		ENSG00000134247	ENSG00000134247		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	9601	protein-coding gene	gene with protein product		601204	"""prostaglandin F2 receptor negative regulator"""			8655148	Standard	NM_020440		Approved	FPRP, EWI-F, CD9P-1, FLJ11001, KIAA1436, SMAP-6, CD315	uc001egv.1	Q9P2B2	OTTHUMG00000012028	ENST00000393203.2:c.44C>G	1.37:g.117452869C>G	ENSP00000376899:p.Ser15Trp	Somatic	2	0		WXS	Illumina GAIIx	Phase_I	16	12	NM_020440	0	0	0	0	0	Q5VVU9|Q8N2K6	Missense_Mutation	SNP	ENST00000393203.2	37	CCDS890.1	47	0.02152014652014652	45	0.09146341463414634	2	0.0055248618784530384	0	0.0	0	0.0	C	5.911	0.352168	0.11182	0.057833	3.7E-4	ENSG00000134247	ENST00000393203	T	0.03982	3.74	3.41	0.296	0.15757	Immunoglobulin-like (1);	6.098340	0.00166	N	0.000011	T	0.01156	0.0038	N	0.14661	0.345	0.44214	D	0.997042	B	0.02656	0.0	B	0.01281	0.0	T	0.33394	-0.9870	10	0.66056	D	0.02	0.1948	3.6279	0.08120	0.0:0.498:0.2382:0.2638	.	15	Q9P2B2	FPRP_HUMAN	W	15	ENSP00000376899:S15W	ENSP00000376899:S15W	S	+	2	0	PTGFRN	117254392	0.444000	0.25649	0.089000	0.20774	0.001000	0.01503	-0.612000	0.05616	-0.140000	0.11394	-0.481000	0.04817	TCG	C|0.978;G|0.022		0.786	PTGFRN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033271.1	NM_020440	
THEM4	117145	hgsc.bcm.edu	37	1	151881885	151881885	+	Missense_Mutation	SNP	A	A	C	rs3748805	byFrequency	TCGA-OR-A5LN-01A-11D-A29I-10	TCGA-OR-A5LN-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	cf6a87e3-f084-4b4c-a978-314c952310a0	c8e44d71-ecbb-4a1f-86ef-5631d9a7442a	g.chr1:151881885A>C	ENST00000368814.3	-	1	399	c.50T>G	c.(49-51)cTg>cGg	p.L17R	THEM4_ENST00000489410.1_Missense_Mutation_p.L17R	NM_053055.4	NP_444283.2	Q5T1C6	THEM4_HUMAN	thioesterase superfamily member 4	17			L -> R (in dbSNP:rs3748805). {ECO:0000269|PubMed:11598301, ECO:0000269|PubMed:14702039, ECO:0000269|PubMed:15489334, ECO:0000269|PubMed:17013611, ECO:0000269|Ref.4}.		epidermal growth factor receptor signaling pathway (GO:0007173)|fatty acid metabolic process (GO:0006631)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|protein kinase B signaling (GO:0043491)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)	cell projection (GO:0042995)|cytosol (GO:0005829)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	palmitoyl-CoA hydrolase activity (GO:0016290)			endometrium(1)|large_intestine(4)|lung(3)|urinary_tract(1)	9	Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.14)		LUSC - Lung squamous cell carcinoma(543;0.181)			TACTGGCGGCAGGCACAGAGC	0.741													C|||	4622	0.922923	0.8986	0.9092	5008	,	,		8223	0.9494		0.9155	False		,,,				2504	0.9458				p.L17R		.											.	THEM4-522	0			c.T50G						.						1.0	1.0	1.0					1																	151881885		1068	2473	3541	SO:0001583	missense	117145	exon1			GGCGGCAGGCACA	AJ313515	CCDS1006.1	1q21.3	2008-02-05			ENSG00000159445	ENSG00000159445			17947	protein-coding gene	gene with protein product	"""C-terminal modulator protein"""	606388				11598301	Standard	NM_053055		Approved	CTMP	uc001ezj.2	Q5T1C6	OTTHUMG00000013049	ENST00000368814.3:c.50T>G	1.37:g.151881885A>C	ENSP00000357804:p.Leu17Arg	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	10	10	NM_053055	0	0	0	1	1	B2RBX2|Q96KR2	Missense_Mutation	SNP	ENST00000368814.3	37	CCDS1006.1	2023	0.9262820512820513	453	0.9207317073170732	320	0.8839779005524862	545	0.9527972027972028	705	0.9300791556728232	C	0.562	-0.845033	0.02671	.	.	ENSG00000159445	ENST00000368814;ENST00000489410	T;T	0.25579	2.45;1.79	1.92	-0.278	0.12894	.	16.336300	0.02935	N	0.139768	T	0.02455	0.0075	N	0.08118	0	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.21143	-1.0254	9	0.10111	T	0.7	0.3431	0.4569	0.00510	0.2457:0.3181:0.2427:0.1934	rs3748805;rs17855960	17	Q5T1C6	THEM4_HUMAN	R	17	ENSP00000357804:L17R;ENSP00000433304:L17R	ENSP00000357804:L17R	L	-	2	0	THEM4	150148509	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.350000	0.07721	-0.432000	0.07297	-0.358000	0.07595	CTG	T|0.073;G|0.921		0.741	THEM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000036615.1	NM_053055	
NIT1	4817	bcgsc.ca	37	1	161089175	161089175	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5LN-01A-11D-A29I-10	TCGA-OR-A5LN-10A-01D-A29L-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	cf6a87e3-f084-4b4c-a978-314c952310a0	c8e44d71-ecbb-4a1f-86ef-5631d9a7442a	g.chr1:161089175C>T	ENST00000368009.2	+	3	426	c.350C>T	c.(349-351)gCc>gTc	p.A117V	DEDD_ENST00000489249.1_5'Flank|NIT1_ENST00000392190.5_Missense_Mutation_p.A81V|NIT1_ENST00000368007.4_Missense_Mutation_p.A102V|NIT1_ENST00000368008.1_Missense_Mutation_p.A117V|NIT1_ENST00000496861.1_3'UTR|PFDN2_ENST00000368010.3_5'Flank|PFDN2_ENST00000468311.1_5'Flank	NM_005600.2	NP_005591.1	Q86X76	NIT1_HUMAN	nitrilase 1	117	CN hydrolase. {ECO:0000255|PROSITE- ProRule:PRU00054}.				nitrogen compound metabolic process (GO:0006807)	extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	nitrilase activity (GO:0000257)			NS(1)|breast(2)|endometrium(2)|large_intestine(3)|lung(3)|prostate(1)	12	all_cancers(52;3.39e-19)|Breast(13;0.000577)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.00165)			ACCCAGCTTGCCAGGTATCAG	0.517											OREG0013937	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.A117V		.											.	NIT1-90	0			c.C350T						.						45.0	47.0	47.0					1																	161089175		2203	4300	6503	SO:0001583	missense	4817	exon3			AGCTTGCCAGGTA	AF069984	CCDS1218.1, CCDS53401.1, CCDS53402.1, CCDS53403.1	1q21-q22	2008-05-14			ENSG00000158793	ENSG00000158793			7828	protein-coding gene	gene with protein product		604618				9671749	Standard	NM_005600		Approved		uc001fxv.2	Q86X76	OTTHUMG00000031473	ENST00000368009.2:c.350C>T	1.37:g.161089175C>T	ENSP00000356988:p.Ala117Val	Somatic	78	0	1814	WXS	Illumina GAIIx	Phase_I	61	4	NM_001185092	0	0	7	7	0	B1AQP3|D3DVF4|O76091	Missense_Mutation	SNP	ENST00000368009.2	37	CCDS1218.1	.	.	.	.	.	.	.	.	.	.	C	27.4	4.828138	0.90955	.	.	ENSG00000158793	ENST00000368009;ENST00000368007;ENST00000368008;ENST00000392190	D;D;D;D	0.91464	-2.85;-2.85;-2.85;-2.85	5.11	5.11	0.69529	Nitrilase/cyanide hydratase and apolipoprotein N-acyltransferase (4);	0.000000	0.85682	D	0.000000	D	0.96436	0.8837	H	0.94734	3.575	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.998;1.0;0.999	D	0.97131	0.9818	10	0.87932	D	0	-10.7882	16.0845	0.81031	0.0:1.0:0.0:0.0	.	102;117;117	Q86X76-4;B1AQP4;Q86X76	.;.;NIT1_HUMAN	V	117;102;117;81	ENSP00000356988:A117V;ENSP00000356986:A102V;ENSP00000356987:A117V;ENSP00000376028:A81V	ENSP00000356986:A102V	A	+	2	0	NIT1	159355799	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	6.542000	0.73869	2.657000	0.90304	0.655000	0.94253	GCC	.		0.517	NIT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077060.1		
TOR3A	64222	hgsc.bcm.edu	37	1	179051300	179051300	+	Missense_Mutation	SNP	T	T	C	rs2296377	byFrequency	TCGA-OR-A5LN-01A-11D-A29I-10	TCGA-OR-A5LN-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	cf6a87e3-f084-4b4c-a978-314c952310a0	c8e44d71-ecbb-4a1f-86ef-5631d9a7442a	g.chr1:179051300T>C	ENST00000367627.3	+	1	789	c.37T>C	c.(37-39)Ttc>Ctc	p.F13L	TOR3A_ENST00000352445.6_Missense_Mutation_p.F13L	NM_022371.3	NP_071766.2	Q9H497	TOR3A_HUMAN	torsin family 3, member A	13			F -> L (in dbSNP:rs2296377). {ECO:0000269|PubMed:14702039, ECO:0000269|PubMed:15489334, ECO:0000269|Ref.3}.		ATP catabolic process (GO:0006200)|chaperone mediated protein folding requiring cofactor (GO:0051085)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum lumen (GO:0005788)|extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)			endometrium(1)|kidney(2)|large_intestine(4)|lung(4)|pancreas(1)|urinary_tract(1)	13						TTGGCTCTTTTTCCTGCTGCT	0.751													C|||	3842	0.767173	0.9879	0.6441	5008	,	,		12722	0.6677		0.7117	False		,,,				2504	0.7157				p.F13L		.											.	TOR3A-90	0			c.T37C						.	C	LEU/PHE	3262,174		1547,168,3	2.0	3.0	3.0		37	-0.8	0.0	1	dbSNP_100	3	5365,1739		2051,1263,238	yes	missense	TOR3A	NM_022371.3	22	3598,1431,241	CC,CT,TT		24.4792,5.064,18.1499	benign	13/398	179051300	8627,1913	1718	3552	5270	SO:0001583	missense	64222	exon1			CTCTTTTTCCTGC	BC001085	CCDS1329.1	1q25.2	2008-02-05	2003-04-02		ENSG00000186283	ENSG00000186283			11997	protein-coding gene	gene with protein product		607555	"""ATP-dependant interferon responsive"""	ADIR		10644435	Standard	NM_022371		Approved	FLJ22345, ADIR2	uc001gmd.3	Q9H497	OTTHUMG00000035077	ENST00000367627.3:c.37T>C	1.37:g.179051300T>C	ENSP00000356599:p.Phe13Leu	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	5	5	NM_022371	0	0	0	0	0	B4DSY0|B7ZB65|Q5M7Y7|Q8WVA7|Q8WWM2|Q9H495|Q9H6E7	Missense_Mutation	SNP	ENST00000367627.3	37	CCDS1329.1	1679	0.7687728937728938	484	0.983739837398374	250	0.6906077348066298	393	0.6870629370629371	552	0.7282321899736148	C	0.033	-1.323382	0.01309	0.94936	0.755208	ENSG00000186283	ENST00000367627;ENST00000367625;ENST00000352445	T;T;T	0.35421	1.31;1.4;1.63	0.427	-0.794	0.10918	.	1.274350	0.05916	N	0.632520	T	0.00012	0.0000	N	0.00368	-1.59	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.45906	-0.9229	8	0.02654	T	1	-1.1524	.	.	.	rs2296377;rs17844883;rs17856371;rs17857600;rs17857917;rs17858479;rs59034332;rs2296377	13	Q9H497	TOR3A_HUMAN	L	13	ENSP00000356599:F13L;ENSP00000356597:F13L;ENSP00000335351:F13L	ENSP00000335351:F13L	F	+	1	0	TOR3A	177317923	0.000000	0.05858	0.002000	0.10522	0.004000	0.04260	-1.490000	0.02304	-1.608000	0.01587	-1.610000	0.00802	TTC	T|0.229;C|0.771		0.751	TOR3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084927.1	NM_022371	
PTGS2	5743	bcgsc.ca	37	1	186648197	186648197	+	Silent	SNP	C	C	G	rs5277	byFrequency	TCGA-OR-A5LN-01A-11D-A29I-10	TCGA-OR-A5LN-10A-01D-A29L-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	cf6a87e3-f084-4b4c-a978-314c952310a0	c8e44d71-ecbb-4a1f-86ef-5631d9a7442a	g.chr1:186648197C>G	ENST00000367468.5	-	3	442	c.306G>C	c.(304-306)gtG>gtC	p.V102V	RP5-973M2.2_ENST00000608917.1_lincRNA|PTGS2_ENST00000490885.2_5'UTR	NM_000963.2	NP_000954.1	P35354	PGH2_HUMAN	prostaglandin-endoperoxide synthase 2 (prostaglandin G/H synthase and cyclooxygenase)	102					anagen (GO:0042640)|angiogenesis (GO:0001525)|arachidonic acid metabolic process (GO:0019369)|bone mineralization (GO:0030282)|brown fat cell differentiation (GO:0050873)|cellular component movement (GO:0006928)|cellular response to ATP (GO:0071318)|cellular response to hypoxia (GO:0071456)|cellular response to mechanical stimulus (GO:0071260)|cellular response to UV (GO:0034644)|cyclooxygenase pathway (GO:0019371)|decidualization (GO:0046697)|embryo implantation (GO:0007566)|inflammatory response (GO:0006954)|learning (GO:0007612)|lipoxygenase pathway (GO:0019372)|maintenance of blood-brain barrier (GO:0035633)|memory (GO:0007613)|negative regulation of calcium ion transport (GO:0051926)|negative regulation of cell cycle (GO:0045786)|negative regulation of cell proliferation (GO:0008285)|negative regulation of smooth muscle contraction (GO:0045986)|negative regulation of synaptic transmission, dopaminergic (GO:0032227)|ovulation (GO:0030728)|positive regulation of apoptotic process (GO:0043065)|positive regulation of brown fat cell differentiation (GO:0090336)|positive regulation of cell migration involved in sprouting angiogenesis (GO:0090050)|positive regulation of fever generation (GO:0031622)|positive regulation of fibroblast growth factor production (GO:0090271)|positive regulation of NF-kappaB import into nucleus (GO:0042346)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|positive regulation of platelet-derived growth factor production (GO:0090362)|positive regulation of prostaglandin biosynthetic process (GO:0031394)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of smooth muscle contraction (GO:0045987)|positive regulation of synaptic plasticity (GO:0031915)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|positive regulation of transforming growth factor beta production (GO:0071636)|positive regulation of vasoconstriction (GO:0045907)|positive regulation vascular endothelial growth factor production (GO:0010575)|prostaglandin biosynthetic process (GO:0001516)|prostaglandin metabolic process (GO:0006693)|regulation of blood pressure (GO:0008217)|regulation of inflammatory response (GO:0050727)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|response to fatty acid (GO:0070542)|response to fructose (GO:0009750)|response to glucocorticoid (GO:0051384)|response to lipopolysaccharide (GO:0032496)|response to lithium ion (GO:0010226)|response to manganese ion (GO:0010042)|response to oxidative stress (GO:0006979)|response to tumor necrosis factor (GO:0034612)|response to vitamin D (GO:0033280)|sensory perception of pain (GO:0019233)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|endoplasmic reticulum membrane (GO:0005789)|neuron projection (GO:0043005)|nucleus (GO:0005634)|protein complex (GO:0043234)	arachidonate 15-lipoxygenase activity (GO:0050473)|enzyme binding (GO:0019899)|heme binding (GO:0020037)|lipid binding (GO:0008289)|metal ion binding (GO:0046872)|peroxidase activity (GO:0004601)|prostaglandin-endoperoxide synthase activity (GO:0004666)	p.V102V(1)		breast(1)|central_nervous_system(1)|endometrium(1)|kidney(3)|large_intestine(5)|lung(11)|ovary(1)|skin(2)|upper_aerodigestive_tract(2)	27					Acetaminophen(DB00316)|Acetylsalicylic acid(DB00945)|Aldesleukin(DB00041)|Aminosalicylic Acid(DB00233)|Antipyrine(DB01435)|Antrafenine(DB01419)|Balsalazide(DB01014)|Bromfenac(DB00963)|Bumetanide(DB00887)|Carprofen(DB00821)|Celecoxib(DB00482)|Chlorphenesin(DB00856)|Cisplatin(DB00515)|Clodronate(DB00720)|Dapsone(DB00250)|Desmopressin(DB00035)|Diclofenac(DB00586)|Diflunisal(DB00861)|Dihomo-gamma-linolenic acid(DB00154)|Drospirenone(DB01395)|Etanercept(DB00005)|Etodolac(DB00749)|Etoposide(DB00773)|Etoricoxib(DB01628)|Fenoprofen(DB00573)|Flurbiprofen(DB00712)|Ginseng(DB01404)|Ibuprofen(DB01050)|Icosapent(DB00159)|Indomethacin(DB00328)|Ketoprofen(DB01009)|Ketorolac(DB00465)|Lenalidomide(DB00480)|Lornoxicam(DB06725)|Lumiracoxib(DB01283)|Magnesium salicylate(DB01397)|Meclofenamic acid(DB00939)|Mefenamic acid(DB00784)|Meloxicam(DB00814)|Mesalazine(DB00244)|Nabumetone(DB00461)|Naproxen(DB00788)|Nepafenac(DB06802)|Niflumic Acid(DB04552)|Nonoxynol-9(DB06804)|Oxaprozin(DB00991)|Phenylbutazone(DB00812)|Piroxicam(DB00554)|Pomalidomide(DB08910)|Risedronate(DB00884)|Salicylate-sodium(DB01398)|Salicylic acid(DB00936)|Salsalate(DB01399)|Sulfasalazine(DB00795)|Sulindac(DB00605)|Suprofen(DB00870)|Tafluprost(DB08819)|Tenoxicam(DB00469)|Tetrahydrobiopterin(DB00360)|Thalidomide(DB01041)|Tiaprofenic acid(DB01600)|Tolmetin(DB00500)|Triamcinolone(DB00620)|Trisalicylate-choline(DB01401)	TACATGTCAACACATAACTCA	0.348													C|||	380	0.0758786	0.0129	0.1095	5008	,	,		20438	0.0437		0.1819	False		,,,				2504	0.0613				p.V102V		.											.	PTGS2-227	1	Substitution - coding silent(1)	stomach(1)	c.G306C						.	C		168,4238	111.2+/-149.4	7,154,2042	67.0	66.0	66.0		306	3.0	0.6	1	dbSNP_52	66	1327,7273	259.5+/-282.7	94,1139,3067	no	coding-synonymous	PTGS2	NM_000963.2		101,1293,5109	GG,GC,CC		15.4302,3.813,11.4947		102/605	186648197	1495,11511	2203	4300	6503	SO:0001819	synonymous_variant	5743	exon3			TGTCAACACATAA	D28235	CCDS1371.1	1q25.2-q25.3	2008-02-05			ENSG00000073756	ENSG00000073756	1.14.99.1		9605	protein-coding gene	gene with protein product		600262				1380156	Standard	NM_000963		Approved	COX2	uc001gsb.3	P35354	OTTHUMG00000035473	ENST00000367468.5:c.306G>C	1.37:g.186648197C>G		Somatic	133	0		WXS	Illumina GAIIx	Phase_I	108	5	NM_000963	0	0	0	0	0	A8K802|Q16876	Silent	SNP	ENST00000367468.5	37	CCDS1371.1																																																																																			C|0.719;G|0.281		0.348	PTGS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086157.2	NM_000963	
GLRX2	51022	hgsc.bcm.edu	37	1	193074486	193074486	+	Silent	SNP	C	C	T	rs527549646	byFrequency	TCGA-OR-A5LN-01A-11D-A29I-10	TCGA-OR-A5LN-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	cf6a87e3-f084-4b4c-a978-314c952310a0	c8e44d71-ecbb-4a1f-86ef-5631d9a7442a	g.chr1:193074486C>T	ENST00000367439.3	-	1	75	c.27G>A	c.(25-27)gcG>gcA	p.A9A	GLRX2_ENST00000472197.1_Intron|GLRX2_ENST00000367440.3_Intron	NM_197962.2	NP_932066.1	Q9NS18	GLRX2_HUMAN	glutaredoxin 2	9					apoptotic process (GO:0006915)|cell differentiation (GO:0030154)|cell redox homeostasis (GO:0045454)|DNA protection (GO:0042262)|glutathione metabolic process (GO:0006749)|protein folding (GO:0006457)|regulation of signal transduction (GO:0009966)|regulation of transcription, DNA-templated (GO:0006355)|response to hydrogen peroxide (GO:0042542)|response to organic substance (GO:0010033)|response to redox state (GO:0051775)|response to temperature stimulus (GO:0009266)	mitochondrion (GO:0005739)|nucleus (GO:0005634)	2 iron, 2 sulfur cluster binding (GO:0051537)|arsenate reductase (glutaredoxin) activity (GO:0008794)|electron carrier activity (GO:0009055)|glutathione disulfide oxidoreductase activity (GO:0015038)|metal ion binding (GO:0046872)|protein disulfide isomerase activity (GO:0003756)|protein disulfide oxidoreductase activity (GO:0015035)			breast(1)|large_intestine(1)|lung(3)	5					Glutathione(DB00143)	GCCGCGTCCCCGCCAGCGCCG	0.746													C|||	7	0.00139776	0.0038	0.0014	5008	,	,		10490	0.0		0.001	False		,,,				2504	0.0				p.A9A		.											.	GLRX2-186	0			c.G27A						.						4.0	5.0	4.0					1																	193074486		1577	3493	5070	SO:0001819	synonymous_variant	51022	exon1			CGTCCCCGCCAGC	AF132495	CCDS1380.1, CCDS1381.1	1q31.2	2012-09-20			ENSG00000023572	ENSG00000023572			16065	protein-coding gene	gene with protein product	"""bA101E13.1 (GRX2 glutaredoxin (thioltransferase) 2)"""	606820				11297543	Standard	NM_016066		Approved	GRX2, bA101E13.1	uc001gsz.2	Q9NS18	OTTHUMG00000035677	ENST00000367439.3:c.27G>A	1.37:g.193074486C>T		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	5	4	NM_197962	0	0	0	1	1	Q3LR69|Q7L1N7|Q96JC0|Q9Y3D4	Silent	SNP	ENST00000367439.3	37	CCDS1381.1																																																																																			.		0.746	GLRX2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000086699.1	NM_016066	
OBSCN	84033	hgsc.bcm.edu	37	1	228504669	228504669	+	Silent	SNP	G	G	A	rs61825302	byFrequency	TCGA-OR-A5LN-01A-11D-A29I-10	TCGA-OR-A5LN-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	cf6a87e3-f084-4b4c-a978-314c952310a0	c8e44d71-ecbb-4a1f-86ef-5631d9a7442a	g.chr1:228504669G>A	ENST00000422127.1	+	51	13589	c.13545G>A	c.(13543-13545)gcG>gcA	p.A4515A	OBSCN_ENST00000284548.11_Silent_p.A4515A|OBSCN_ENST00000570156.2_Silent_p.A5472A|OBSCN_ENST00000366709.4_Silent_p.A1634A|OBSCN_ENST00000366707.4_Silent_p.A2149A	NM_001098623.2	NP_001092093.2	Q5VST9	OBSCN_HUMAN	obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF	4515	Ig-like 46.				apoptotic signaling pathway (GO:0097190)|multicellular organismal development (GO:0007275)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|protein localization to M-band (GO:0036309)|regulation of small GTPase mediated signal transduction (GO:0051056)|sarcomere organization (GO:0045214)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|M band (GO:0031430)|myofibril (GO:0030016)|Z disc (GO:0030018)	ankyrin binding (GO:0030506)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|structural constituent of muscle (GO:0008307)|titin binding (GO:0031432)			NS(2)|breast(7)|central_nervous_system(5)|cervix(2)|endometrium(30)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(37)|lung(89)|ovary(8)|pancreas(3)|prostate(13)|skin(6)|stomach(11)|upper_aerodigestive_tract(2)|urinary_tract(3)	223		Prostate(94;0.0405)				TGGCCTCTGCGCGGCTCACCG	0.731													g|||	729	0.145567	0.1218	0.2349	5008	,	,		13931	0.1518		0.159	False		,,,				2504	0.0941				p.A5472A		.											.	OBSCN-403	0			c.G16416A						.		,	507,3253		36,435,1409	5.0	6.0	6.0		13545,13545	-6.2	0.0	1	dbSNP_129	6	1105,6501		71,963,2769	no	coding-synonymous,coding-synonymous	OBSCN	NM_001098623.1,NM_052843.2	,	107,1398,4178	AA,AG,GG		14.528,13.484,14.1827	,	4515/7969,4515/6621	228504669	1612,9754	1880	3803	5683	SO:0001819	synonymous_variant	84033	exon62			CTCTGCGCGGCTC	AJ002535	CCDS1570.2, CCDS58065.1, CCDS59204.1	1q42	2014-09-17			ENSG00000154358	ENSG00000154358		"""Rho guanine nucleotide exchange factors"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	15719	protein-coding gene	gene with protein product		608616				11448995, 11814696	Standard	NM_001098623		Approved	KIAA1556, UNC89, KIAA1639, ARHGEF30	uc001hsq.2	Q5VST9	OTTHUMG00000039772	ENST00000422127.1:c.13545G>A	1.37:g.228504669G>A		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	15	9	NM_001271223	0	0	0	0	0	Q2A664|Q5T7G8|Q5T7G9|Q5VSU2|Q86YC7|Q8NHN0|Q8NHN1|Q8NHN2|Q8NHN3|Q8NHN4|Q8NHN5|Q8NHN6|Q8NHN7|Q8NHN8|Q8NHN9|Q96AA2|Q9HCD3|Q9HCL6	Silent	SNP	ENST00000422127.1	37	CCDS58065.1																																																																																			G|0.841;A|0.159		0.731	OBSCN-204	KNOWN	basic|CCDS	protein_coding	protein_coding		NM_052843	
C1orf229	388759	hgsc.bcm.edu	37	1	247274899	247274899	+	Missense_Mutation	SNP	A	A	G	rs73135916	byFrequency	TCGA-OR-A5LN-01A-11D-A29I-10	TCGA-OR-A5LN-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	cf6a87e3-f084-4b4c-a978-314c952310a0	c8e44d71-ecbb-4a1f-86ef-5631d9a7442a	g.chr1:247274899A>G	ENST00000408893.2	-	1	820	c.628T>C	c.(628-630)Tcg>Ccg	p.S210P		NM_207401.1	NP_997284.1	Q6ZS94	CA229_HUMAN	chromosome 1 open reading frame 229	210																	CAGGTGGCCGAAGTCGGAGGG	0.771													G|||	1989	0.397165	0.6029	0.3487	5008	,	,		5543	0.13		0.3241	False		,,,				2504	0.5041				p.S210P		.											.	C1orf229-90	0			c.T628C						.						2.0	2.0	2.0					1																	247274899		1086	2682	3768	SO:0001583	missense	388759	exon1			TGGCCGAAGTCGG	BC156415	CCDS1630.1	1q44	2012-05-30			ENSG00000221953	ENSG00000221953			33759	protein-coding gene	gene with protein product							Standard	NM_207401		Approved	FLJ45717	uc001icg.1	Q6ZS94	OTTHUMG00000165196	ENST00000408893.2:c.628T>C	1.37:g.247274899A>G	ENSP00000386203:p.Ser210Pro	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	5	5	NM_207401	0	0	0	0	0		Missense_Mutation	SNP	ENST00000408893.2	37	CCDS1630.1	731	0.3347069597069597	275	0.5589430894308943	126	0.34806629834254144	81	0.14160839160839161	249	0.32849604221635886	G	5.248	0.231287	0.09969	.	.	ENSG00000221953	ENST00000408893	.	.	.	0.815	-0.419	0.12340	.	.	.	.	.	T	0.00012	0.0000	N	0.08118	0	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.43798	-0.9369	7	0.87932	D	0	.	3.9894	0.09530	0.651:0.0:0.349:0.0	.	210	Q6ZS94	CA229_HUMAN	P	210	.	ENSP00000386203:S210P	S	-	1	0	C1orf229	245341522	0.000000	0.05858	0.004000	0.12327	0.004000	0.04260	-0.572000	0.05881	-1.095000	0.03050	-1.091000	0.02175	TCG	A|0.665;G|0.335		0.771	C1orf229-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382614.1	NM_207401	
ASB13	79754	broad.mit.edu	37	10	5690971	5690971	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5LN-01A-11D-A29I-10	TCGA-OR-A5LN-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	cf6a87e3-f084-4b4c-a978-314c952310a0	c8e44d71-ecbb-4a1f-86ef-5631d9a7442a	g.chr10:5690971C>T	ENST00000357700.6	-	4	505	c.479G>A	c.(478-480)cGg>cAg	p.R160Q	ASB13_ENST00000479033.1_5'UTR	NM_024701.3	NP_078977.2	Q8WXK3	ASB13_HUMAN	ankyrin repeat and SOCS box containing 13	160					intracellular signal transduction (GO:0035556)|protein ubiquitination (GO:0016567)					NS(1)|endometrium(3)|lung(3)|ovary(1)	8				GBM - Glioblastoma multiforme(2;9.59e-09)		CAGATGCTCCCGGGCACAGGC	0.567																																					p.R160Q		.											.	ASB13-227	0			c.G479A						.						119.0	106.0	110.0					10																	5690971		2203	4300	6503	SO:0001583	missense	79754	exon4			TGCTCCCGGGCAC	AK091935	CCDS7070.1	10p15.1	2013-01-10	2011-01-25		ENSG00000196372	ENSG00000196372		"""Ankyrin repeat domain containing"""	19765	protein-coding gene	gene with protein product		615055	"""ankyrin repeat and SOCS box-containing 13"""			12076535	Standard	NM_024701		Approved	FLJ13134, MGC19879	uc001iig.2	Q8WXK3	OTTHUMG00000017603	ENST00000357700.6:c.479G>A	10.37:g.5690971C>T	ENSP00000350331:p.Arg160Gln	Somatic	94	0		WXS	Illumina GAIIx	Phase_I	98	4	NM_024701	0	0	0	0	0	A8K7Q6|D3DRR2|Q96EP7|Q9H8Z1	Missense_Mutation	SNP	ENST00000357700.6	37	CCDS7070.1	.	.	.	.	.	.	.	.	.	.	C	17.15	3.315275	0.60524	.	.	ENSG00000196372	ENST00000357700	T	0.63744	-0.06	4.8	4.8	0.61643	Ankyrin repeat-containing domain (4);	0.054887	0.64402	D	0.000002	T	0.57036	0.2026	N	0.25647	0.755	0.48040	D	0.999578	D;P	0.56521	0.976;0.565	P;B	0.48552	0.581;0.138	T	0.56384	-0.7988	10	0.30078	T	0.28	-17.3937	17.4626	0.87623	0.0:1.0:0.0:0.0	.	160;160	Q8WXK3-2;Q8WXK3	.;ASB13_HUMAN	Q	160	ENSP00000350331:R160Q	ENSP00000350331:R160Q	R	-	2	0	ASB13	5730977	0.984000	0.35163	0.893000	0.35052	0.788000	0.44548	4.737000	0.62066	2.227000	0.72691	0.313000	0.20887	CGG	.		0.567	ASB13-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046564.1		
AGAP6	414189	broad.mit.edu	37	10	51748584	51748584	+	Missense_Mutation	SNP	A	A	G	rs200504295		TCGA-OR-A5LN-01A-11D-A29I-10	TCGA-OR-A5LN-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	cf6a87e3-f084-4b4c-a978-314c952310a0	c8e44d71-ecbb-4a1f-86ef-5631d9a7442a	g.chr10:51748584A>G	ENST00000374056.4	+	1	507	c.109A>G	c.(109-111)Agg>Ggg	p.R37G	AGAP6_ENST00000412531.3_Missense_Mutation_p.R37G			Q5VW22	AGAP6_HUMAN	ArfGAP with GTPase domain, ankyrin repeat and PH domain 6	37				R -> G (in Ref. 2; BC131545). {ECO:0000305}.	regulation of ARF GTPase activity (GO:0032312)		ARF GTPase activator activity (GO:0008060)|zinc ion binding (GO:0008270)			NS(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|liver(1)|lung(8)|prostate(3)|skin(1)|stomach(2)	29						GGCAGGAGCTAGGGACAGGAT	0.592																																					p.R37G		.											.	AGAP6-1	0			c.A109G						.																																			SO:0001583	missense	414189	exon1			GGAGCTAGGGACA		CCDS44397.1	10q11.23	2013-01-10	2008-09-22	2008-09-22	ENSG00000204149	ENSG00000204149		"""ADP-ribosylation factor GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"", ""Ankyrin repeat domain containing"""	23466	protein-coding gene	gene with protein product			"""centaurin, gamma-like family, member 3"""	CTGLF3			Standard	NM_001077665		Approved	bA324H6.1	uc001jix.4	Q5VW22	OTTHUMG00000018220	ENST00000374056.4:c.109A>G	10.37:g.51748584A>G	ENSP00000363168:p.Arg37Gly	Somatic	9	0		WXS	Illumina GAIIx	Phase_I	13	2	NM_001077665	0	0	7	15	8		Missense_Mutation	SNP	ENST00000374056.4	37		.	.	.	.	.	.	.	.	.	.	G	0	-2.861803	0.00064	.	.	ENSG00000204149	ENST00000374056;ENST00000412531	D;D	0.87966	-2.32;-2.32	1.16	1.16	0.20824	.	0.060847	0.64402	N	0.000005	T	0.65637	0.2710	.	.	.	0.09310	N	0.999999	B	0.02656	0.0	B	0.01281	0.0	T	0.51340	-0.8718	9	0.06236	T	0.91	.	3.7746	0.08654	0.2646:0.0:0.7354:0.0	.	37	C9IYN2	.	G	37	ENSP00000363168:R37G;ENSP00000400972:R37G	ENSP00000363168:R37G	R	+	1	2	AGAP6	51418590	0.944000	0.32072	0.873000	0.34254	0.023000	0.10783	0.542000	0.23222	0.072000	0.16694	-1.352000	0.01234	AGG	G|1.000;|0.000		0.592	AGAP6-201	KNOWN	basic|appris_candidate	protein_coding	protein_coding		NM_001077665	
ASAH2	56624	broad.mit.edu;bcgsc.ca	37	10	51974561	51974561	+	Missense_Mutation	SNP	C	C	T	rs549196716		TCGA-OR-A5LN-01A-11D-A29I-10	TCGA-OR-A5LN-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	cf6a87e3-f084-4b4c-a978-314c952310a0	c8e44d71-ecbb-4a1f-86ef-5631d9a7442a	g.chr10:51974561C>T	ENST00000395526.4	-	8	1081	c.1082G>A	c.(1081-1083)cGt>cAt	p.R361H	ASAH2_ENST00000329428.6_Missense_Mutation_p.R342H|ASAH2_ENST00000443575.1_Missense_Mutation_p.R203H|ASAH2_ENST00000447815.1_Missense_Mutation_p.R361H	NM_019893.2	NP_063946.2	Q9NR71	ASAH2_HUMAN	N-acylsphingosine amidohydrolase (non-lysosomal ceramidase) 2	361					apoptotic process (GO:0006915)|ceramide metabolic process (GO:0006672)|glycosphingolipid metabolic process (GO:0006687)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)	integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	ceramidase activity (GO:0017040)	p.R342H(1)|p.R361H(1)		large_intestine(1)|lung(9)|urinary_tract(1)	11						GTTGATGCAACGTGGTCCAAG	0.448													C|||	1	0.000199681	0.0	0.0	5008	,	,		12025	0.0		0.001	False		,,,				2504	0.0				p.R361H		.											.	ASAH2-90	2	Substitution - Missense(2)	urinary_tract(2)	c.G1082A						.						64.0	40.0	48.0					10																	51974561		2202	4293	6495	SO:0001583	missense	56624	exon8			ATGCAACGTGGTC	AF250847	CCDS7239.2, CCDS44398.1	10q11.23	2008-08-11			ENSG00000188611	ENSG00000188611			18860	protein-coding gene	gene with protein product		611202				10781606	Standard	NM_019893		Approved		uc001jjd.3	Q9NR71	OTTHUMG00000018223	ENST00000395526.4:c.1082G>A	10.37:g.51974561C>T	ENSP00000378897:p.Arg361His	Somatic	286	1		WXS	Illumina GAIIx	Phase_I	284	35	NM_019893	0	0	0	0	0	Q3KNU1|Q5SNT7|Q5SZP6|Q5SZP7|Q5T1D5|Q71ME6	Missense_Mutation	SNP	ENST00000395526.4	37	CCDS7239.2	.	.	.	.	.	.	.	.	.	.	C	6.257	0.415597	0.11870	.	.	ENSG00000188611	ENST00000395526;ENST00000447815;ENST00000443575;ENST00000329428	T;T;T;T	0.41758	0.99;0.99;0.99;0.99	5.26	-2.01	0.07410	.	0.739215	0.13790	N	0.362544	T	0.11922	0.0290	N	0.00879	-1.12	0.09310	N	1	B;B	0.06786	0.001;0.0	B;B	0.04013	0.001;0.0	T	0.36261	-0.9755	10	0.14252	T	0.57	.	9.5371	0.39229	0.0:0.4674:0.0:0.5326	.	361;361	Q9NR71-2;Q9NR71	.;ASAH2_HUMAN	H	361;361;203;342	ENSP00000378897:R361H;ENSP00000388206:R361H;ENSP00000392766:R203H;ENSP00000329886:R342H	ENSP00000329886:R342H	R	-	2	0	ASAH2	51644567	0.000000	0.05858	0.051000	0.19133	0.884000	0.51177	-0.097000	0.11042	-0.315000	0.08703	-1.006000	0.02489	CGT	.		0.448	ASAH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048061.3	NM_019893	
PCDH15	65217	hgsc.bcm.edu	37	10	55587197	55587197	+	Silent	SNP	A	A	C	rs570029304|rs559130985	byFrequency	TCGA-OR-A5LN-01A-11D-A29I-10	TCGA-OR-A5LN-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	cf6a87e3-f084-4b4c-a978-314c952310a0	c8e44d71-ecbb-4a1f-86ef-5631d9a7442a	g.chr10:55587197A>C	ENST00000320301.6	-	32	4717	c.4323T>G	c.(4321-4323)ccT>ccG	p.P1441P	PCDH15_ENST00000373957.3_Intron|PCDH15_ENST00000395442.1_Intron|PCDH15_ENST00000395438.1_Silent_p.P1441P|PCDH15_ENST00000395430.1_Silent_p.P1438P|PCDH15_ENST00000395446.1_Intron|PCDH15_ENST00000395440.1_Intron|PCDH15_ENST00000395445.1_Silent_p.P1448P|PCDH15_ENST00000361849.3_Silent_p.P1441P|PCDH15_ENST00000395432.2_Silent_p.P1401P|PCDH15_ENST00000409834.1_Silent_p.P1052P|PCDH15_ENST00000395433.1_Silent_p.P1416P|PCDH15_ENST00000437009.1_Silent_p.P1370P|PCDH15_ENST00000414778.1_Silent_p.P1443P|PCDH15_ENST00000373965.2_Silent_p.P1448P|PCDH15_ENST00000463095.1_5'UTR	NM_033056.3	NP_149045.3	Q96QU1	PCD15_HUMAN	protocadherin-related 15	1441	Poly-Pro.				equilibrioception (GO:0050957)|homophilic cell adhesion (GO:0007156)|photoreceptor cell maintenance (GO:0045494)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|photoreceptor outer segment (GO:0001750)|plasma membrane (GO:0005886)|stereocilium (GO:0032420)|synapse (GO:0045202)	calcium ion binding (GO:0005509)			NS(3)|breast(6)|central_nervous_system(1)|cervix(3)|endometrium(18)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(39)|lung(108)|ovary(5)|pancreas(6)|prostate(6)|skin(12)|upper_aerodigestive_tract(12)|urinary_tract(1)	237		Melanoma(3;0.117)|Lung SC(717;0.238)				CACCTggcggaggcggcggcg	0.567										HNSCC(58;0.16)			A|||	4	0.000798722	0.0	0.0014	5008	,	,		10822	0.002		0.0	False		,,,				2504	0.001				p.P1446P		.											.	PCDH15-193	0			c.T4338G						.						36.0	44.0	41.0					10																	55587197		2203	4300	6503	SO:0001819	synonymous_variant	65217	exon33			TGGCGGAGGCGGC	AY029205	CCDS7248.1, CCDS44400.1, CCDS44401.1, CCDS44403.1, CCDS44404.1, CCDS73134.1, CCDS73135.1, CCDS73136.1, CCDS73137.1, CCDS73138.1	10q21.1	2013-01-08	2010-01-25		ENSG00000150275	ENSG00000150275		"""Cadherins / Cadherin-related"""	14674	protein-coding gene	gene with protein product	"""cadherin-related family member 15"""	605514	"""deafness, autosomal recessive 23"", ""protocadherin 15"""	USH1F, DFNB23		11398101, 14570705	Standard	NM_033056		Approved	CDHR15	uc010qhy.1	Q96QU1	OTTHUMG00000018259	ENST00000320301.6:c.4323T>G	10.37:g.55587197A>C		Somatic	23	0		WXS	Illumina GAIIx	Phase_I	39	6	NM_001142763	0	0	0	0	0	A6NL19|C6ZEF5|C6ZEF6|C6ZEF7|Q5VY38|Q5VY39|Q6TRH8|Q8NDB9|Q96QT8	Silent	SNP	ENST00000320301.6	37	CCDS7248.1																																																																																			.		0.567	PCDH15-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000048121.2	NM_033056	
DOCK1	1793	broad.mit.edu	37	10	128796494	128796494	+	Missense_Mutation	SNP	G	G	T			TCGA-OR-A5LN-01A-11D-A29I-10	TCGA-OR-A5LN-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	cf6a87e3-f084-4b4c-a978-314c952310a0	c8e44d71-ecbb-4a1f-86ef-5631d9a7442a	g.chr10:128796494G>T	ENST00000280333.6	+	8	857	c.748G>T	c.(748-750)Gtg>Ttg	p.V250L	RP11-223P11.3_ENST00000594614.1_RNA|RP11-223P11.3_ENST00000595456.1_RNA|RP11-223P11.3_ENST00000601242.1_RNA	NM_001380.3	NP_001371.1	Q14185	DOCK1_HUMAN	dedicator of cytokinesis 1	250					apoptotic process (GO:0006915)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell migration (GO:0016477)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|hematopoietic progenitor cell differentiation (GO:0002244)|innate immune response (GO:0045087)|integrin-mediated signaling pathway (GO:0007229)|phagocytosis, engulfment (GO:0006911)|positive regulation of GTPase activity (GO:0043547)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)	GTPase activator activity (GO:0005096)|guanyl-nucleotide exchange factor activity (GO:0005085)			NS(2)|breast(1)|central_nervous_system(7)|endometrium(13)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(10)|lung(15)|ovary(4)|prostate(3)|stomach(2)|upper_aerodigestive_tract(5)|urinary_tract(1)	72		all_epithelial(44;2.3e-07)|all_lung(145;0.00466)|Lung NSC(174;0.00685)|Colorectal(57;0.0107)|Renal(717;0.0113)|Breast(234;0.0492)|all_neural(114;0.108)|all_hematologic(284;0.14)		BRCA - Breast invasive adenocarcinoma(275;0.0221)|Colorectal(40;0.115)		ATATGACCCTGTGGAGTCCAA	0.458																																					p.V250L		.											.	DOCK1-698	0			c.G748T						.						198.0	187.0	190.0					10																	128796494		1889	4117	6006	SO:0001583	missense	1793	exon8			GACCCTGTGGAGT	D50857	CCDS73222.1	10q26.13-q26.3	2009-10-28			ENSG00000150760	ENSG00000150760			2987	protein-coding gene	gene with protein product	"""DOwnstream of CrK"""	601403	"""dedicator of cyto-kinesis 1"""			8657152, 8661160	Standard	XM_006717681		Approved	DOCK180, ced5	uc001ljt.3	Q14185	OTTHUMG00000019249	ENST00000280333.6:c.748G>T	10.37:g.128796494G>T	ENSP00000280333:p.Val250Leu	Somatic	141	0		WXS	Illumina GAIIx	Phase_I	150	5	NM_001380	0	0	0	0	0	A9Z1Z5	Missense_Mutation	SNP	ENST00000280333.6	37		.	.	.	.	.	.	.	.	.	.	G	6.818	0.519957	0.13005	.	.	ENSG00000150760	ENST00000280333	T	0.41400	1.0	5.24	-3.93	0.04143	.	1.388840	0.04213	N	0.332156	T	0.16041	0.0386	N	0.03608	-0.345	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.05699	-1.0869	10	0.34782	T	0.22	.	0.1009	0.00048	0.2916:0.1833:0.188:0.3371	.	250;250	B2RUU3;Q14185	.;DOCK1_HUMAN	L	250	ENSP00000280333:V250L	ENSP00000280333:V250L	V	+	1	0	DOCK1	128686484	0.000000	0.05858	0.001000	0.08648	0.853000	0.48598	-0.128000	0.10531	-1.099000	0.03034	-0.175000	0.13238	GTG	.		0.458	DOCK1-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000050979.2	NM_001380	
GLRX3	10539	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	10	131969900	131969900	+	Splice_Site	SNP	G	G	T			TCGA-OR-A5LN-01A-11D-A29I-10	TCGA-OR-A5LN-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	cf6a87e3-f084-4b4c-a978-314c952310a0	c8e44d71-ecbb-4a1f-86ef-5631d9a7442a	g.chr10:131969900G>T	ENST00000368644.1	+	8	846	c.824G>T	c.(823-825)gGt>gTt	p.G275V	GLRX3_ENST00000331244.5_Splice_Site_p.G275V	NM_001199868.1	NP_001186797.1	O76003	GLRX3_HUMAN	glutaredoxin 3	275	Glutaredoxin 2. {ECO:0000255|PROSITE- ProRule:PRU00686}.				cell redox homeostasis (GO:0045454)|negative regulation of cardiac muscle hypertrophy (GO:0010614)|regulation of the force of heart contraction (GO:0002026)	extracellular vesicular exosome (GO:0070062)|Z disc (GO:0030018)	electron carrier activity (GO:0009055)|iron-sulfur cluster binding (GO:0051536)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|protein disulfide oxidoreductase activity (GO:0015035)			endometrium(1)|large_intestine(5)|lung(7)	13		all_cancers(35;9.59e-07)|all_epithelial(44;1.48e-06)|Lung NSC(174;0.00566)|all_lung(145;0.00949)|Colorectal(57;0.142)|all_neural(114;0.16)|Breast(234;0.173)|Glioma(114;0.222)		OV - Ovarian serous cystadenocarcinoma(35;0.00218)		AATAGTACTGGGTATGTAAAT	0.353																																					p.G275V		.											.	GLRX3-22	0			c.G824T						.						85.0	94.0	91.0					10																	131969900		2203	4300	6503	SO:0001630	splice_region_variant	10539	exon8			GTACTGGGTATGT	AJ010841	CCDS7661.1	10q26	2009-05-29	2007-08-16	2007-08-16	ENSG00000108010	ENSG00000108010			15987	protein-coding gene	gene with protein product	"""glutaredoxin 4"""	612754	"""thioredoxin-like 2"""	TXNL2		10636891, 11124703	Standard	NM_006541		Approved	PICOT, bA500G10.4, GRX3, GLRX4, GRX4	uc001lkm.2	O76003	OTTHUMG00000019267	ENST00000368644.1:c.824+1G>T	10.37:g.131969900G>T		Somatic	81	0		WXS	Illumina GAIIx	Phase_I	43	5	NM_006541	0	0	0	0	0	B3KMP7|B3KMQ5|D3DRG2|Q5JV01|Q96CE0|Q9P1B0|Q9P1B1	Missense_Mutation	SNP	ENST00000368644.1	37	CCDS7661.1	.	.	.	.	.	.	.	.	.	.	G	17.77	3.470636	0.63625	.	.	ENSG00000108010	ENST00000331244;ENST00000368644	T;T	0.41065	1.01;1.01	4.85	2.89	0.33648	Glutaredoxin (2);Thioredoxin-like fold (2);	0.200262	0.41605	D	0.000846	T	0.60431	0.2268	M	0.90425	3.115	0.80722	D	1	P	0.47302	0.893	P	0.52909	0.713	T	0.65405	-0.6176	10	0.72032	D	0.01	-5.0376	10.2101	0.43136	0.1221:0.0:0.8779:0.0	.	275	O76003	GLRX3_HUMAN	V	275	ENSP00000330836:G275V;ENSP00000357633:G275V	ENSP00000330836:G275V	G	+	2	0	GLRX3	131859890	1.000000	0.71417	0.998000	0.56505	0.961000	0.63080	4.974000	0.63771	0.532000	0.28657	0.561000	0.74099	GGT	.		0.353	GLRX3-002	KNOWN	alternative_3_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051021.1	NM_006541	Missense_Mutation
PWWP2B	170394	hgsc.bcm.edu	37	10	134219045	134219045	+	Silent	SNP	C	C	T	rs11146364	byFrequency	TCGA-OR-A5LN-01A-11D-A29I-10	TCGA-OR-A5LN-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	cf6a87e3-f084-4b4c-a978-314c952310a0	c8e44d71-ecbb-4a1f-86ef-5631d9a7442a	g.chr10:134219045C>T	ENST00000305233.5	+	2	1100	c.1041C>T	c.(1039-1041)ccC>ccT	p.P347P	PWWP2B_ENST00000368609.4_Silent_p.P347P	NM_138499.3	NP_612508.3	Q6NUJ5	PWP2B_HUMAN	PWWP domain containing 2B	347										central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(5)|urinary_tract(1)	9		all_cancers(35;6.69e-12)|all_epithelial(44;1.55e-08)|Lung NSC(174;0.000845)|all_lung(145;0.00144)|all_neural(114;0.0299)|Breast(234;0.106)|Colorectal(31;0.109)|Melanoma(40;0.123)|Glioma(114;0.203)|all_hematologic(284;0.224)		OV - Ovarian serous cystadenocarcinoma(35;7.49e-05)|Epithelial(32;0.00016)|all cancers(32;0.000186)		AGCACGAGCCCGTGTACCGGG	0.721													C|||	820	0.163738	0.2027	0.2104	5008	,	,		13504	0.1429		0.1074	False		,,,				2504	0.1575				p.P347P		.											.	PWWP2B-90	0			c.C1041T						.	C	,	636,3612		51,534,1539	16.0	21.0	20.0		1041,1041	-2.7	0.1	10	dbSNP_120	20	704,7662		24,656,3503	yes	coding-synonymous,coding-synonymous	PWWP2B	NM_001098637.1,NM_138499.3	,	75,1190,5042	TT,TC,CC		8.415,14.9718,10.6231	,	347/500,347/591	134219045	1340,11274	2124	4183	6307	SO:0001819	synonymous_variant	170394	exon2			CGAGCCCGTGTAC	AK128663	CCDS7667.2	10q26.3	2009-06-03	2007-10-22	2007-10-22	ENSG00000171813	ENSG00000171813			25150	protein-coding gene	gene with protein product			"""PWWP domain containing 2"""	PWWP2			Standard	NM_001098637		Approved	bA432J24.1, FLJ46823	uc001lll.4	Q6NUJ5	OTTHUMG00000019286	ENST00000305233.5:c.1041C>T	10.37:g.134219045C>T		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	10	8	NM_001098637	0	0	8	12	4	A6NM90|B5MDQ1|H9KV61|Q5SZI0|Q6ZQX5|Q96F43	Silent	SNP	ENST00000305233.5	37	CCDS7667.2																																																																																			C|0.860;T|0.140		0.721	PWWP2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051075.3	NM_138499	
GPR123	84435	hgsc.bcm.edu	37	10	134942340	134942340	+	Silent	SNP	C	C	T	rs10776696	byFrequency	TCGA-OR-A5LN-01A-11D-A29I-10	TCGA-OR-A5LN-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	cf6a87e3-f084-4b4c-a978-314c952310a0	c8e44d71-ecbb-4a1f-86ef-5631d9a7442a	g.chr10:134942340C>T	ENST00000392607.3	+	7	1444	c.1008C>T	c.(1006-1008)gcC>gcT	p.A336A	GPR123_ENST00000392606.2_Silent_p.A239A|GPR123_ENST00000607359.1_Silent_p.A1055A	NM_001083909.1	NP_001077378.1	Q86SQ6	GP123_HUMAN	G protein-coupled receptor 123	336					G-protein coupled receptor signaling pathway (GO:0007186)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			endometrium(2)|kidney(2)|large_intestine(1)|lung(6)|prostate(3)	14		all_cancers(35;1.8e-10)|all_epithelial(44;8.95e-09)|Lung NSC(174;0.000845)|all_lung(145;0.00144)|all_neural(114;0.0299)|Colorectal(31;0.0585)|Melanoma(40;0.123)|Glioma(114;0.203)		OV - Ovarian serous cystadenocarcinoma(35;9.16e-06)|Epithelial(32;1.21e-05)|all cancers(32;1.63e-05)		CCAACGGGGCCGCGCTGGGCC	0.736													C|||	1405	0.280551	0.2791	0.2767	5008	,	,		10349	0.4573		0.1312	False		,,,				2504	0.2566				p.A336A		.											.	GPR123-90	0			c.C1008T						.	C		954,3140		119,716,1212	8.0	9.0	9.0		1008	-2.0	0.2	10	dbSNP_120	9	932,7104		61,810,3147	no	coding-synonymous	GPR123	NM_001083909.1		180,1526,4359	TT,TC,CC		11.5978,23.3024,15.5482		336/561	134942340	1886,10244	2047	4018	6065	SO:0001819	synonymous_variant	84435	exon7			CGGGGCCGCGCTG	AB058731	CCDS41580.1	10q26	2014-08-08			ENSG00000197177	ENSG00000197177		"""-"", ""GPCR / Class B : Orphans"""	13838	protein-coding gene	gene with protein product		612302				12565841	Standard	XM_005252695		Approved	KIAA1828	uc001llw.3	Q86SQ6	OTTHUMG00000019304	ENST00000392607.3:c.1008C>T	10.37:g.134942340C>T		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	28	21	NM_001083909	0	0	0	0	0	A5HL16|A6NG50|Q5T234|Q86SN7|Q96JJ9	Silent	SNP	ENST00000392607.3	37	CCDS41580.1																																																																																			C|0.747;T|0.253		0.736	GPR123-003	NOVEL	basic|appris_candidate|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000051113.2		
KNDC1	85442	hgsc.bcm.edu	37	10	135012430	135012430	+	Silent	SNP	T	T	C	rs386749477|rs3008389	byFrequency	TCGA-OR-A5LN-01A-11D-A29I-10	TCGA-OR-A5LN-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	cf6a87e3-f084-4b4c-a978-314c952310a0	c8e44d71-ecbb-4a1f-86ef-5631d9a7442a	g.chr10:135012430T>C	ENST00000304613.3	+	14	2439	c.2418T>C	c.(2416-2418)gtT>gtC	p.V806V	KNDC1_ENST00000368572.2_Silent_p.V806V|KNDC1_ENST00000368571.2_Silent_p.V741V			Q76NI1	VKIND_HUMAN	kinase non-catalytic C-lobe domain (KIND) containing 1	806	Pro-rich.			V -> D (in Ref. 1; BAD12625). {ECO:0000305}.	cerebellar granule cell differentiation (GO:0021707)|positive regulation of protein phosphorylation (GO:0001934)|regulation of dendrite morphogenesis (GO:0048814)|small GTPase mediated signal transduction (GO:0007264)	dendrite (GO:0030425)|guanyl-nucleotide exchange factor complex (GO:0032045)|neuronal cell body (GO:0043025)	protein serine/threonine kinase activity (GO:0004674)|Ras guanyl-nucleotide exchange factor activity (GO:0005088)			NS(4)|breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(27)|ovary(1)|prostate(5)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	60		all_cancers(35;4.16e-10)|all_epithelial(44;2.07e-08)|Lung NSC(174;0.000845)|all_lung(145;0.00145)|all_neural(114;0.0299)|Melanoma(40;0.123)|Colorectal(31;0.173)|Glioma(114;0.203)		OV - Ovarian serous cystadenocarcinoma(35;8.77e-06)|Epithelial(32;1.13e-05)|all cancers(32;1.51e-05)		CACCTGGAGTTGCTTCCGGGG	0.746													C|||	2730	0.545128	0.5166	0.4942	5008	,	,		10776	0.5486		0.5318	False		,,,				2504	0.6299				p.V806V		.											.	KNDC1-229	0			c.T2418C						.			1858,1296		588,682,307	4.0	5.0	4.0		2418	2.5	0.0	10	dbSNP_101	4	4179,3011		1338,1503,754	no	coding-synonymous	KNDC1	NM_152643.6		1926,2185,1061	CC,CT,TT		41.8776,41.0907,41.6377		806/1750	135012430	6037,4307	1577	3595	5172	SO:0001819	synonymous_variant	85442	exon14			TGGAGTTGCTTCC	AK074179	CCDS7674.1	10q26.3	2004-09-14	2004-04-07		ENSG00000171798	ENSG00000171798			29374	protein-coding gene	gene with protein product			"""RasGEF domain family, member 2"""	RASGEF2, C10orf23		11214970	Standard	NM_152643		Approved	KIAA1768, bB439H18.3, FLJ25027	uc001llz.1	Q76NI1	OTTHUMG00000019303	ENST00000304613.3:c.2418T>C	10.37:g.135012430T>C		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	12	5	NM_152643	0	0	0	1	1	B0QZC5|Q5T233|Q6ZNH8|Q8TEE5|Q96LV7|Q9C095	Silent	SNP	ENST00000304613.3	37	CCDS7674.1																																																																																			T|0.470;C|0.530		0.746	KNDC1-006	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000277044.3	NM_152643	
ZNF511	118472	hgsc.bcm.edu	37	10	135122507	135122507	+	Silent	SNP	G	G	A	rs3008357	byFrequency	TCGA-OR-A5LN-01A-11D-A29I-10	TCGA-OR-A5LN-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	cf6a87e3-f084-4b4c-a978-314c952310a0	c8e44d71-ecbb-4a1f-86ef-5631d9a7442a	g.chr10:135122507G>A	ENST00000359035.3	+	1	63	c.60G>A	c.(58-60)ccG>ccA	p.P20P	ZNF511_ENST00000368554.4_5'Flank|TUBGCP2_ENST00000470829.1_5'UTR|TUBGCP2_ENST00000417178.2_5'Flank|ZNF511_ENST00000361518.5_Silent_p.P20P|TUBGCP2_ENST00000368563.2_5'UTR			Q8NB15	ZN511_HUMAN	zinc finger protein 511	20					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			cervix(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(2)|ovary(1)	8		all_cancers(35;7.01e-07)|all_epithelial(44;1.45e-05)|Lung NSC(174;0.027)|all_lung(145;0.0384)|all_neural(114;0.0726)|Glioma(114;0.172)|Melanoma(40;0.175)		all cancers(32;7.56e-06)|OV - Ovarian serous cystadenocarcinoma(35;8.15e-06)|Epithelial(32;9.99e-06)		CGGCGGAGCCGCTGCCTGTAG	0.781													A|||	1022	0.204073	0.3828	0.2176	5008	,	,		7110	0.0635		0.1511	False		,,,				2504	0.1524				p.P20P		.											.	ZNF511-90	0			c.G60A						.						2.0	2.0	2.0					10																	135122507		1305	2802	4107	SO:0001819	synonymous_variant	118472	exon1			GGAGCCGCTGCCT	AK091711	CCDS7677.1	10q26.3	2010-04-12			ENSG00000198546	ENSG00000198546		"""Zinc fingers, C2H2-type"""	28445	protein-coding gene	gene with protein product						12477932	Standard	NM_145806		Approved	MGC30006	uc001lmj.1	Q8NB15	OTTHUMG00000019317	ENST00000359035.3:c.60G>A	10.37:g.135122507G>A		Somatic	1	0		WXS	Illumina GAIIx	Phase_I	14	7	NM_145806	0	0	0	0	0	A8K8L5|Q8WUP1|Q96BV2	Silent	SNP	ENST00000359035.3	37																																																																																				G|0.816;A|0.184		0.781	ZNF511-002	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000051143.1	NM_145806	
IRF7	3665	hgsc.bcm.edu	37	11	615103	615103	+	Silent	SNP	G	G	A	rs113083699	byFrequency	TCGA-OR-A5LN-01A-11D-A29I-10	TCGA-OR-A5LN-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	cf6a87e3-f084-4b4c-a978-314c952310a0	c8e44d71-ecbb-4a1f-86ef-5631d9a7442a	g.chr11:615103G>A	ENST00000397574.2	-	3	546	c.177C>T	c.(175-177)atC>atT	p.I59I	IRF7_ENST00000397570.1_Silent_p.I59I|IRF7_ENST00000525445.1_5'UTR|IRF7_ENST00000397562.3_5'UTR|IRF7_ENST00000348655.6_Silent_p.I59I|IRF7_ENST00000330243.5_Silent_p.I72I|IRF7_ENST00000397566.1_Silent_p.I72I	NM_001572.3	NP_001563.2	Q92985	IRF7_HUMAN	interferon regulatory factor 7	59					cellular response to DNA damage stimulus (GO:0006974)|cytokine-mediated signaling pathway (GO:0019221)|establishment of viral latency (GO:0019043)|immunoglobulin mediated immune response (GO:0016064)|innate immune response (GO:0045087)|interferon-alpha production (GO:0032607)|interferon-beta production (GO:0032608)|interferon-gamma-mediated signaling pathway (GO:0060333)|MDA-5 signaling pathway (GO:0039530)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of macrophage apoptotic process (GO:2000110)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of interferon-alpha production (GO:0032727)|positive regulation of interferon-beta production (GO:0032728)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of type I interferon production (GO:0032481)|positive regulation of type I interferon-mediated signaling pathway (GO:0060340)|regulation of adaptive immune response (GO:0002819)|regulation of immune response (GO:0050776)|regulation of monocyte differentiation (GO:0045655)|regulation of MyD88-dependent toll-like receptor signaling pathway (GO:0034124)|regulation of MyD88-independent toll-like receptor signaling pathway (GO:0034127)|regulation of type I interferon production (GO:0032479)|response to virus (GO:0009615)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|transcription from RNA polymerase II promoter (GO:0006366)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)|type I interferon biosynthetic process (GO:0045351)|type I interferon signaling pathway (GO:0060337)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endosome membrane (GO:0010008)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity (GO:0000982)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)			endometrium(1)|kidney(1)|large_intestine(1)|lung(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	8		all_cancers(49;1.69e-08)|all_epithelial(84;1.65e-05)|Breast(177;0.000231)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.106)|all_lung(207;0.136)		all cancers(45;7.68e-28)|Epithelial(43;7.44e-27)|OV - Ovarian serous cystadenocarcinoma(40;3.53e-21)|BRCA - Breast invasive adenocarcinoma(625;6.96e-05)|Lung(200;0.0375)|LUSC - Lung squamous cell carcinoma(625;0.0703)		CCACCTTGAAGATGCGCGCGT	0.721													G|||	203	0.0405351	0.0772	0.0375	5008	,	,		12225	0.001		0.0527	False		,,,				2504	0.0215				p.I72I		.											.	IRF7-90	0			c.C216T						.	G	,,	153,3775		1,151,1812	5.0	6.0	6.0		177,177,216	3.6	1.0	11	dbSNP_132	6	310,7558		4,302,3628	no	coding-synonymous,coding-synonymous,coding-synonymous	IRF7	NM_001572.3,NM_004029.2,NM_004031.2	,,	5,453,5440	AA,AG,GG		3.94,3.8951,3.9251	,,	59/504,59/475,72/517	615103	463,11333	1964	3934	5898	SO:0001819	synonymous_variant	3665	exon1			CTTGAAGATGCGC	U53830	CCDS7703.1, CCDS7704.1, CCDS7705.1	11p15.5	2005-10-10			ENSG00000185507	ENSG00000185507			6122	protein-coding gene	gene with protein product		605047					Standard	XM_005252906		Approved		uc001lqh.3	Q92985	OTTHUMG00000132019	ENST00000397574.2:c.177C>T	11.37:g.615103G>A		Somatic	1	0		WXS	Illumina GAIIx	Phase_I	9	9	NM_004031	0	0	0	0	0	B9EGL3|O00331|O00332|O00333|O75924|Q9UE79	Silent	SNP	ENST00000397574.2	37	CCDS7703.1																																																																																			G|0.949;A|0.051		0.721	IRF7-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000255026.1	NM_001572	
MUC5B	727897	hgsc.bcm.edu;bcgsc.ca	37	11	1253980	1253980	+	Missense_Mutation	SNP	A	A	G	rs202127660		TCGA-OR-A5LN-01A-11D-A29I-10	TCGA-OR-A5LN-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	cf6a87e3-f084-4b4c-a978-314c952310a0	c8e44d71-ecbb-4a1f-86ef-5631d9a7442a	g.chr11:1253980A>G	ENST00000529681.1	+	17	2103	c.2045A>G	c.(2044-2046)gAc>gGc	p.D682G	MUC5B_ENST00000447027.1_Missense_Mutation_p.D685G	NM_002458.2	NP_002449.2	Q9HC84	MUC5B_HUMAN	mucin 5B, oligomeric mucus/gel-forming	682					cellular protein metabolic process (GO:0044267)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to glucocorticoid stimulus (GO:0071385)|cellular response to retinoic acid (GO:0071300)|epithelial cell differentiation (GO:0030855)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|response to lipopolysaccharide (GO:0032496)|response to ozone (GO:0010193)|response to sulfur dioxide (GO:0010477)|response to vitamin A (GO:0033189)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)				cervix(2)|endometrium(36)|kidney(9)|lung(89)|urinary_tract(1)	137		all_cancers(49;6.97e-08)|all_epithelial(84;3.45e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00141)|Lung(200;0.0853)|LUSC - Lung squamous cell carcinoma(625;0.1)		CAGCTCAGCGACTGGAGGGAC	0.682																																					p.D682G		.											.	.	0			c.A2045G						.						21.0	24.0	23.0					11																	1253980		2116	4228	6344	SO:0001583	missense	727897	exon17			TCAGCGACTGGAG	U95031, AF086604	CCDS44515.1, CCDS44515.2	11p15.5	2007-01-19	2006-03-14			ENSG00000117983		"""Mucins"""	7516	protein-coding gene	gene with protein product		600770	"""mucin 5, subtype B, tracheobronchial"""	MUC5		9804771	Standard	NM_002458		Approved	MG1	uc001lta.3	Q9HC84		ENST00000529681.1:c.2045A>G	11.37:g.1253980A>G	ENSP00000436812:p.Asp682Gly	Somatic	35	0		WXS	Illumina GAIIx	Phase_I	104	11	NM_002458	0	0	0	0	0	O00447|O00573|O14985|O15494|O95291|O95451|Q14881|Q7M4S5|Q99552|Q9UE28	Missense_Mutation	SNP	ENST00000529681.1	37	CCDS44515.2	.	.	.	.	.	.	.	.	.	.	A	7.541	0.660740	0.14645	.	.	ENSG00000117983	ENST00000529681;ENST00000447027;ENST00000349637;ENST00000406844	T;T	0.76060	-0.99;-0.99	4.6	2.72	0.32119	Uncharacterised domain, cysteine-rich (2);	.	.	.	.	T	0.50103	0.1596	N	0.02960	-0.455	0.24874	N	0.992269	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.01281	0.0;0.0;0.0	T	0.45920	-0.9228	9	0.87932	D	0	.	8.6635	0.34108	0.2416:0.0:0.7584:0.0	.	682;1341;685	Q9HC84;A7Y9J9;E9PBJ0	MUC5B_HUMAN;.;.	G	682;685;683;718	ENSP00000436812:D682G;ENSP00000415793:D685G	ENSP00000343037:D683G	D	+	2	0	MUC5B	1210556	0.999000	0.42202	0.632000	0.29296	0.070000	0.16714	2.607000	0.46300	0.373000	0.24621	-1.983000	0.00453	GAC	.		0.682	MUC5B-002	NOVEL	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000390041.2	XM_001126093	
OR52M1	119772	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	4567166	4567166	+	Missense_Mutation	SNP	G	G	C			TCGA-OR-A5LN-01A-11D-A29I-10	TCGA-OR-A5LN-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	cf6a87e3-f084-4b4c-a978-314c952310a0	c8e44d71-ecbb-4a1f-86ef-5631d9a7442a	g.chr11:4567166G>C	ENST00000360213.1	+	1	746	c.746G>C	c.(745-747)tGt>tCt	p.C249S		NM_001004137.1	NP_001004137.1	Q8NGK5	O52M1_HUMAN	olfactory receptor, family 52, subfamily M, member 1	249						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(2)|large_intestine(2)|lung(9)|pancreas(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	18		Medulloblastoma(188;0.0075)|Breast(177;0.0461)|all_neural(188;0.0577)		Epithelial(150;8.45e-12)|BRCA - Breast invasive adenocarcinoma(625;0.0285)|LUSC - Lung squamous cell carcinoma(625;0.19)		TCTCACCTCTGTGCCATCCTG	0.517																																					p.C249S		.											.	OR52M1-68	0			c.G746C						.						303.0	261.0	276.0					11																	4567166		2201	4298	6499	SO:0001583	missense	119772	exon1			ACCTCTGTGCCAT	AB065789	CCDS31353.1	11p15.4	2012-08-09	2002-11-13	2002-11-15	ENSG00000197790	ENSG00000197790		"""GPCR / Class A : Olfactory receptors"""	15225	protein-coding gene	gene with protein product			"""olfactory receptor, family 52, subfamily M, member 1 pseudogene"""	OR52M1P			Standard	NM_001004137		Approved		uc010qyf.2	Q8NGK5	OTTHUMG00000165706	ENST00000360213.1:c.746G>C	11.37:g.4567166G>C	ENSP00000353343:p.Cys249Ser	Somatic	153	0		WXS	Illumina GAIIx	Phase_I	115	30	NM_001004137	0	0	0	0	0		Missense_Mutation	SNP	ENST00000360213.1	37	CCDS31353.1	.	.	.	.	.	.	.	.	.	.	G	13.07	2.128033	0.37533	.	.	ENSG00000197790	ENST00000360213	T	0.36520	1.25	4.49	3.5	0.40072	GPCR, rhodopsin-like superfamily (1);	0.000000	0.51477	D	0.000086	T	0.50360	0.1611	L	0.60455	1.87	0.26909	N	0.966946	D	0.89917	1.0	D	0.91635	0.999	T	0.28138	-1.0053	10	0.52906	T	0.07	.	7.9893	0.30231	0.0935:0.1654:0.7411:0.0	.	249	Q8NGK5	O52M1_HUMAN	S	249	ENSP00000353343:C249S	ENSP00000353343:C249S	C	+	2	0	OR52M1	4523742	0.046000	0.20272	0.997000	0.53966	0.478000	0.33099	2.059000	0.41384	2.481000	0.83766	0.650000	0.86243	TGT	.		0.517	OR52M1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385847.1	NM_001004137	
DYNC2H1	79659	bcgsc.ca	37	11	103124135	103124135	+	Silent	SNP	T	T	G	rs11225634	byFrequency	TCGA-OR-A5LN-01A-11D-A29I-10	TCGA-OR-A5LN-10A-01D-A29L-10	T	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	cf6a87e3-f084-4b4c-a978-314c952310a0	c8e44d71-ecbb-4a1f-86ef-5631d9a7442a	g.chr11:103124135T>G	ENST00000375735.2	+	66	10308	c.10164T>G	c.(10162-10164)acT>acG	p.T3388T	DYNC2H1_ENST00000398093.3_Silent_p.T3395T|DYNC2H1_ENST00000334267.7_Intron	NM_001080463.1|NM_001377.2	NP_001073932.1|NP_001368.2	Q8NCM8	DYHC2_HUMAN	dynein, cytoplasmic 2, heavy chain 1	3388	AAA 5. {ECO:0000250}.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|asymmetric protein localization (GO:0008105)|cilium assembly (GO:0042384)|determination of left/right symmetry (GO:0007368)|dorsal/ventral pattern formation (GO:0009953)|embryonic limb morphogenesis (GO:0030326)|forebrain development (GO:0030900)|Golgi organization (GO:0007030)|intraciliary retrograde transport (GO:0035721)|positive regulation of smoothened signaling pathway (GO:0045880)|protein processing (GO:0016485)|spinal cord motor neuron differentiation (GO:0021522)	apical part of cell (GO:0045177)|axoneme (GO:0005930)|cytosol (GO:0005829)|dynein complex (GO:0030286)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|motile primary cilium (GO:0031512)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|motor activity (GO:0003774)			NS(1)|endometrium(4)|kidney(5)|large_intestine(9)|lung(9)|ovary(1)|prostate(2)|upper_aerodigestive_tract(2)	33		Acute lymphoblastic leukemia(157;0.000966)|all_hematologic(158;0.00348)		BRCA - Breast invasive adenocarcinoma(274;0.000177)|Epithelial(105;0.0785)		CCATTGTTACTGAGGTTAACT	0.348													T|||	907	0.18111	0.3752	0.1254	5008	,	,		15809	0.0933		0.1252	False		,,,				2504	0.1063				p.T3395T		.											.	DYNC2H1-68	0			c.T10185G						.	T	,	1168,2482		189,790,846	109.0	105.0	106.0		10185,10164	0.5	1.0	11	dbSNP_120	106	955,7229		63,829,3200	no	coding-synonymous,coding-synonymous	DYNC2H1	NM_001080463.1,NM_001377.2	,	252,1619,4046	GG,GT,TT		11.6691,32.0,17.9398	,	3395/4315,3388/4308	103124135	2123,9711	1825	4092	5917	SO:0001819	synonymous_variant	79659	exon67			TGTTACTGAGGTT	AB082528	CCDS44717.1, CCDS53701.1	11q21-q22.1	2011-06-02	2005-11-24	2005-11-24	ENSG00000187240	ENSG00000187240		"""Cytoplasmic dyneins"""	2962	protein-coding gene	gene with protein product		603297	"""dynein, cytoplasmic, heavy polypeptide 2"""	DNCH2		9763680, 9373155	Standard	NM_001080463		Approved	hdhc11, DHC2, DHC1b, DYH1B	uc001phn.1	Q8NCM8	OTTHUMG00000165941	ENST00000375735.2:c.10164T>G	11.37:g.103124135T>G		Somatic	372	2		WXS	Illumina GAIIx	Phase_I	197	7	NM_001080463	0	0	0	0	0	O00432|Q16693|Q3C1U8|Q4AC93|Q6ZMX7|Q6ZUM6|Q7Z363|Q8N977|Q92815|Q9HAE4	Silent	SNP	ENST00000375735.2	37	CCDS53701.1																																																																																			T|0.823;G|0.177		0.348	DYNC2H1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387196.1	XM_370652	
ZNF385A	25946	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	54778302	54778302	+	Silent	SNP	C	C	T			TCGA-OR-A5LN-01A-11D-A29I-10	TCGA-OR-A5LN-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	cf6a87e3-f084-4b4c-a978-314c952310a0	c8e44d71-ecbb-4a1f-86ef-5631d9a7442a	g.chr12:54778302C>T	ENST00000338010.5	-	2	110	c.57G>A	c.(55-57)ccG>ccA	p.P19P	ZNF385A_ENST00000551771.1_5'UTR|ZNF385A_ENST00000546970.1_5'UTR|ZNF385A_ENST00000352268.6_Silent_p.P19P|ZNF385A_ENST00000394313.2_5'UTR|RP11-753H16.5_ENST00000552785.1_RNA|ZNF385A_ENST00000551109.1_5'UTR|RP11-753H16.3_ENST00000550474.1_RNA	NM_001130967.1	NP_001124439.1	Q96PM9	Z385A_HUMAN	zinc finger protein 385A	19					apoptotic process (GO:0006915)|cellular response to DNA damage stimulus (GO:0006974)|hemostasis (GO:0007599)|learning or memory (GO:0007611)|locomotory behavior (GO:0007626)|megakaryocyte development (GO:0035855)|mRNA localization resulting in posttranscriptional regulation of gene expression (GO:0010609)|negative regulation of intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:1902166)|platelet alpha granule organization (GO:0070889)|platelet formation (GO:0030220)|positive regulation of DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:1902164)|positive regulation of fat cell differentiation (GO:0045600)|regulation of cytoplasmic translation (GO:2000765)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)	DNA binding (GO:0003677)|mRNA 3'-UTR binding (GO:0003730)|p53 binding (GO:0002039)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)	p.P19P(1)		breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(3)|ovary(1)|urinary_tract(1)	15						GCTGCATGATCGGGGGCTGCC	0.607																																					p.P19P		.											.	ZNF385A-23	1	Substitution - coding silent(1)	endometrium(1)	c.G57A						.						34.0	31.0	32.0					12																	54778302		2192	4291	6483	SO:0001819	synonymous_variant	25946	exon2			CATGATCGGGGGC	AF304052	CCDS8879.1, CCDS44910.1, CCDS44911.1	12q13.13	2012-10-05	2007-12-06	2007-12-06		ENSG00000161642			17521	protein-coding gene	gene with protein product		609124	"""zinc finger protein 385"""	ZNF385			Standard	XM_005268785		Approved	DKFZp586G1122, Hzf, ZFP385	uc001sfy.3	Q96PM9	OTTHUMG00000169840	ENST00000338010.5:c.57G>A	12.37:g.54778302C>T		Somatic	42	0		WXS	Illumina GAIIx	Phase_I	46	7	NM_001130967	0	0	0	0	0	B2RDN5|B4DKH2|F1T0F1|J3KNS3|Q5VH53|Q9H7R6|Q9UFU3	Silent	SNP	ENST00000338010.5	37	CCDS44911.1																																																																																			.		0.607	ZNF385A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406162.1	NM_015481	
RCBTB1	55213	bcgsc.ca	37	13	50141345	50141345	+	Missense_Mutation	SNP	G	G	A	rs4942848	byFrequency	TCGA-OR-A5LN-01A-11D-A29I-10	TCGA-OR-A5LN-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	cf6a87e3-f084-4b4c-a978-314c952310a0	c8e44d71-ecbb-4a1f-86ef-5631d9a7442a	g.chr13:50141345G>A	ENST00000378302.2	-	3	331	c.71C>T	c.(70-72)gCg>gTg	p.A24V	RCBTB1_ENST00000258646.3_Missense_Mutation_p.A24V|RCBTB1_ENST00000546015.1_Missense_Mutation_p.A24V	NM_018191.3	NP_060661.3	Q8NDN9	RCBT1_HUMAN	regulator of chromosome condensation (RCC1) and BTB (POZ) domain containing protein 1	24			A -> V (in dbSNP:rs4942848). {ECO:0000269|PubMed:11306461, ECO:0000269|PubMed:14565662, ECO:0000269|PubMed:14702039, ECO:0000269|PubMed:15489334}.		cell cycle (GO:0007049)|chromatin modification (GO:0016568)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)				endometrium(1)|kidney(1)|large_intestine(3)|lung(7)|ovary(2)|prostate(1)|urinary_tract(1)	16		Lung NSC(96;2.1e-05)|Breast(56;0.00015)|Prostate(109;0.00314)|Hepatocellular(98;0.0207)|Myeloproliferative disorder(33;0.163)|Lung SC(185;0.187)|all_neural(104;0.19)	KIRC - Kidney renal clear cell carcinoma(9;0.206)	GBM - Glioblastoma multiforme(99;4.7e-09)		GAAGACACACGCCTTCCGAAT	0.468													G|||	2635	0.526158	0.3177	0.7305	5008	,	,		18492	0.6131		0.6561	False		,,,				2504	0.4397				p.A24V		.											.	RCBTB1-91	0			c.C71T						.	G	VAL/ALA	1660,2746	507.4+/-366.7	304,1052,847	124.0	111.0	115.0		71	5.8	1.0	13	dbSNP_111	115	5887,2713	682.2+/-403.8	2041,1805,454	yes	missense	RCBTB1	NM_018191.3	64	2345,2857,1301	AA,AG,GG		31.5465,37.6759,41.9729	benign	24/532	50141345	7547,5459	2203	4300	6503	SO:0001583	missense	55213	exon3			ACACACGCCTTCC	AF334406	CCDS9418.1	13q14	2013-01-08			ENSG00000136144	ENSG00000136144		"""BTB/POZ domain containing"""	18243	protein-coding gene	gene with protein product		607867				11306461	Standard	XM_005266441		Approved	FLJ10716, CLLD7, CLLL7	uc001vde.1	Q8NDN9	OTTHUMG00000016915	ENST00000378302.2:c.71C>T	13.37:g.50141345G>A	ENSP00000367552:p.Ala24Val	Somatic	179	1		WXS	Illumina GAIIx	Phase_I	136	7	NM_018191	0	0	0	0	0	Q8IY29|Q969U9	Missense_Mutation	SNP	ENST00000378302.2	37	CCDS9418.1	1284	0.5879120879120879	162	0.32926829268292684	245	0.6767955801104972	366	0.6398601398601399	511	0.6741424802110818	G	23.9	4.468169	0.84533	0.376759	0.684535	ENSG00000136144	ENST00000258646;ENST00000378302;ENST00000546015	T;T;T	0.77098	1.34;1.34;-1.07	5.84	5.84	0.93424	Regulator of chromosome condensation/beta-lactamase-inhibitor protein II (1);	0.000000	0.85682	D	0.000000	T	0.00012	0.0000	L	0.42744	1.35	0.09310	P	0.999999999232834	D	0.89917	1.0	D	0.91635	0.999	T	0.45338	-0.9268	9	0.02654	T	1	-16.71	20.1466	0.98079	0.0:0.0:1.0:0.0	rs4942848;rs17857155;rs57157356;rs4942848	24	Q8NDN9	RCBT1_HUMAN	V	24	ENSP00000258646:A24V;ENSP00000367552:A24V;ENSP00000443293:A24V	ENSP00000258646:A24V	A	-	2	0	RCBTB1	49039346	1.000000	0.71417	0.989000	0.46669	0.904000	0.53231	9.358000	0.97109	2.779000	0.95612	0.591000	0.81541	GCG	G|0.431;A|0.568		0.468	RCBTB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044912.2	NM_018191	
DNAAF2	55172	hgsc.bcm.edu	37	14	50100683	50100683	+	Silent	SNP	C	C	G	rs2985686	byFrequency	TCGA-OR-A5LN-01A-11D-A29I-10	TCGA-OR-A5LN-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	cf6a87e3-f084-4b4c-a978-314c952310a0	c8e44d71-ecbb-4a1f-86ef-5631d9a7442a	g.chr14:50100683C>G	ENST00000298292.8	-	1	1265	c.1185G>C	c.(1183-1185)gcG>gcC	p.A395A	DNAAF2_ENST00000406043.3_Silent_p.A395A	NM_018139.2	NP_060609.2	Q9NVR5	KTU_HUMAN	dynein, axonemal, assembly factor 2	395					axonemal dynein complex assembly (GO:0070286)|bacterial-type flagellum-dependent cell motility (GO:0071973)|cilium-dependent cell motility (GO:0060285)|response to retinoic acid (GO:0032526)	cytoplasm (GO:0005737)				kidney(1)|lung(4)	5						CTCCGTCCTCCGCGCGACTCC	0.781													G|||	2800	0.559105	0.6702	0.6715	5008	,	,		11594	0.1736		0.7604	False		,,,				2504	0.5194				p.A395A		.											.	.	0			c.G1185C						.						1.0	1.0	1.0					14																	50100683		917	2082	2999	SO:0001819	synonymous_variant	55172	exon1			GTCCTCCGCGCGA	AK001425	CCDS9691.2, CCDS45100.1	14q21.3	2012-05-03	2011-06-09	2011-06-09	ENSG00000165506	ENSG00000165506			20188	protein-coding gene	gene with protein product	"""kintoun"""	612517	"""chromosome 14 open reading frame 104"""	C14orf104			Standard	NM_001083908		Approved	FLJ10563, KTU, PF13, CILD10	uc001wws.4	Q9NVR5	OTTHUMG00000152331	ENST00000298292.8:c.1185G>C	14.37:g.50100683C>G		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	5	5	NM_018139	0	0	0	0	0	B9WS54|C0JAP7|Q86TR1|Q86TY8|Q969Z5	Silent	SNP	ENST00000298292.8	37	CCDS9691.2																																																																																			C|0.569;G|0.431		0.781	DNAAF2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000276813.1		
FRMD6	122786	bcgsc.ca	37	14	52156572	52156572	+	Silent	SNP	T	T	C			TCGA-OR-A5LN-01A-11D-A29I-10	TCGA-OR-A5LN-10A-01D-A29L-10	T	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	cf6a87e3-f084-4b4c-a978-314c952310a0	c8e44d71-ecbb-4a1f-86ef-5631d9a7442a	g.chr14:52156572T>C	ENST00000344768.5	+	2	214	c.18T>C	c.(16-18)ttT>ttC	p.F6F	FRMD6_ENST00000356218.4_Silent_p.F6F|RNA5SP385_ENST00000515947.1_RNA|FRMD6_ENST00000395718.2_Silent_p.F6F			Q96NE9	FRMD6_HUMAN	FERM domain containing 6	6					apical constriction (GO:0003383)|cellular protein localization (GO:0034613)|regulation of actin filament-based process (GO:0032970)	apical junction complex (GO:0043296)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|plasma membrane (GO:0005886)				breast(2)|central_nervous_system(1)|endometrium(7)|large_intestine(7)|lung(11)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	34	all_epithelial(31;0.0163)|Breast(41;0.089)					AATTGAATTTTCATAACAACA	0.463																																					p.F6F		.											.	FRMD6-524	0			c.T18C						.						101.0	83.0	89.0					14																	52156572		2203	4300	6503	SO:0001819	synonymous_variant	122786	exon2			GAATTTTCATAAC	BI465118	CCDS9704.1, CCDS58318.1, CCDS58319.1	14q22.1	2011-06-22	2005-07-20	2005-07-20	ENSG00000139926	ENSG00000139926			19839	protein-coding gene	gene with protein product	"""expanded homolog"""	614555	"""chromosome 14 open reading frame 31"""	C14orf31			Standard	NM_152330		Approved	MGC17921, willin, EX1	uc001wzd.3	Q96NE9	OTTHUMG00000140294	ENST00000344768.5:c.18T>C	14.37:g.52156572T>C		Somatic	260	3		WXS	Illumina GAIIx	Phase_I	185	13	NM_001267046	0	0	0	0	0	D3DSB9|Q5HYF2|Q8N2X1|Q8WUH7	Silent	SNP	ENST00000344768.5	37	CCDS58318.1																																																																																			.		0.463	FRMD6-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000276881.1	NM_152330	
FRMD6	122786	bcgsc.ca	37	14	52156575	52156575	+	Silent	SNP	T	T	C			TCGA-OR-A5LN-01A-11D-A29I-10	TCGA-OR-A5LN-10A-01D-A29L-10	T	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	cf6a87e3-f084-4b4c-a978-314c952310a0	c8e44d71-ecbb-4a1f-86ef-5631d9a7442a	g.chr14:52156575T>C	ENST00000344768.5	+	2	217	c.21T>C	c.(19-21)caT>caC	p.H7H	FRMD6_ENST00000356218.4_Silent_p.H7H|RNA5SP385_ENST00000515947.1_RNA|FRMD6_ENST00000395718.2_Silent_p.H7H			Q96NE9	FRMD6_HUMAN	FERM domain containing 6	7					apical constriction (GO:0003383)|cellular protein localization (GO:0034613)|regulation of actin filament-based process (GO:0032970)	apical junction complex (GO:0043296)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|plasma membrane (GO:0005886)				breast(2)|central_nervous_system(1)|endometrium(7)|large_intestine(7)|lung(11)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	34	all_epithelial(31;0.0163)|Breast(41;0.089)					TGAATTTTCATAACAACAGAG	0.458																																					p.H7H		.											.	FRMD6-524	0			c.T21C						.						103.0	84.0	90.0					14																	52156575		2203	4300	6503	SO:0001819	synonymous_variant	122786	exon2			TTTTCATAACAAC	BI465118	CCDS9704.1, CCDS58318.1, CCDS58319.1	14q22.1	2011-06-22	2005-07-20	2005-07-20	ENSG00000139926	ENSG00000139926			19839	protein-coding gene	gene with protein product	"""expanded homolog"""	614555	"""chromosome 14 open reading frame 31"""	C14orf31			Standard	NM_152330		Approved	MGC17921, willin, EX1	uc001wzd.3	Q96NE9	OTTHUMG00000140294	ENST00000344768.5:c.21T>C	14.37:g.52156575T>C		Somatic	271	3		WXS	Illumina GAIIx	Phase_I	195	13	NM_001267046	0	0	0	0	0	D3DSB9|Q5HYF2|Q8N2X1|Q8WUH7	Silent	SNP	ENST00000344768.5	37	CCDS58318.1																																																																																			.		0.458	FRMD6-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000276881.1	NM_152330	
FRMD6	122786	bcgsc.ca	37	14	52156605	52156605	+	Silent	SNP	T	T	C			TCGA-OR-A5LN-01A-11D-A29I-10	TCGA-OR-A5LN-10A-01D-A29L-10	T	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	cf6a87e3-f084-4b4c-a978-314c952310a0	c8e44d71-ecbb-4a1f-86ef-5631d9a7442a	g.chr14:52156605T>C	ENST00000344768.5	+	2	247	c.51T>C	c.(49-51)agT>agC	p.S17S	FRMD6_ENST00000356218.4_Silent_p.S17S|RNA5SP385_ENST00000515947.1_RNA|FRMD6_ENST00000395718.2_Silent_p.S17S			Q96NE9	FRMD6_HUMAN	FERM domain containing 6	17	FERM. {ECO:0000255|PROSITE- ProRule:PRU00084}.				apical constriction (GO:0003383)|cellular protein localization (GO:0034613)|regulation of actin filament-based process (GO:0032970)	apical junction complex (GO:0043296)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|plasma membrane (GO:0005886)				breast(2)|central_nervous_system(1)|endometrium(7)|large_intestine(7)|lung(11)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	34	all_epithelial(31;0.0163)|Breast(41;0.089)					ACCGCCGCAGTGTGTGCATTT	0.433																																					p.S17S		.											.	FRMD6-524	0			c.T51C						.						107.0	89.0	95.0					14																	52156605		2203	4300	6503	SO:0001819	synonymous_variant	122786	exon2			CCGCAGTGTGTGC	BI465118	CCDS9704.1, CCDS58318.1, CCDS58319.1	14q22.1	2011-06-22	2005-07-20	2005-07-20	ENSG00000139926	ENSG00000139926			19839	protein-coding gene	gene with protein product	"""expanded homolog"""	614555	"""chromosome 14 open reading frame 31"""	C14orf31			Standard	NM_152330		Approved	MGC17921, willin, EX1	uc001wzd.3	Q96NE9	OTTHUMG00000140294	ENST00000344768.5:c.51T>C	14.37:g.52156605T>C		Somatic	323	3		WXS	Illumina GAIIx	Phase_I	245	13	NM_001267046	0	0	0	0	0	D3DSB9|Q5HYF2|Q8N2X1|Q8WUH7	Silent	SNP	ENST00000344768.5	37	CCDS58318.1																																																																																			.		0.433	FRMD6-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000276881.1	NM_152330	
FRMD6	122786	bcgsc.ca	37	14	52156626	52156626	+	Silent	SNP	C	C	T	rs569640110	byFrequency	TCGA-OR-A5LN-01A-11D-A29I-10	TCGA-OR-A5LN-10A-01D-A29L-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	cf6a87e3-f084-4b4c-a978-314c952310a0	c8e44d71-ecbb-4a1f-86ef-5631d9a7442a	g.chr14:52156626C>T	ENST00000344768.5	+	2	268	c.72C>T	c.(70-72)aaC>aaT	p.N24N	FRMD6_ENST00000356218.4_Silent_p.N24N|RNA5SP385_ENST00000515947.1_RNA|FRMD6_ENST00000395718.2_Silent_p.N24N			Q96NE9	FRMD6_HUMAN	FERM domain containing 6	24	FERM. {ECO:0000255|PROSITE- ProRule:PRU00084}.				apical constriction (GO:0003383)|cellular protein localization (GO:0034613)|regulation of actin filament-based process (GO:0032970)	apical junction complex (GO:0043296)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|plasma membrane (GO:0005886)				breast(2)|central_nervous_system(1)|endometrium(7)|large_intestine(7)|lung(11)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	34	all_epithelial(31;0.0163)|Breast(41;0.089)					TCCTTCCCAACGATGAATCTC	0.403													C|||	7	0.00139776	0.0038	0.0	5008	,	,		22472	0.001		0.0	False		,,,				2504	0.001				p.N24N		.											.	FRMD6-524	0			c.C72T						.						101.0	85.0	90.0					14																	52156626		2203	4300	6503	SO:0001819	synonymous_variant	122786	exon2			TCCCAACGATGAA	BI465118	CCDS9704.1, CCDS58318.1, CCDS58319.1	14q22.1	2011-06-22	2005-07-20	2005-07-20	ENSG00000139926	ENSG00000139926			19839	protein-coding gene	gene with protein product	"""expanded homolog"""	614555	"""chromosome 14 open reading frame 31"""	C14orf31			Standard	NM_152330		Approved	MGC17921, willin, EX1	uc001wzd.3	Q96NE9	OTTHUMG00000140294	ENST00000344768.5:c.72C>T	14.37:g.52156626C>T		Somatic	324	3		WXS	Illumina GAIIx	Phase_I	248	13	NM_001267046	0	0	0	0	0	D3DSB9|Q5HYF2|Q8N2X1|Q8WUH7	Silent	SNP	ENST00000344768.5	37	CCDS58318.1																																																																																			.		0.403	FRMD6-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000276881.1	NM_152330	
L3HYPDH	112849	hgsc.bcm.edu	37	14	59950910	59950910	+	Missense_Mutation	SNP	A	A	G	rs17096291	byFrequency	TCGA-OR-A5LN-01A-11D-A29I-10	TCGA-OR-A5LN-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	cf6a87e3-f084-4b4c-a978-314c952310a0	c8e44d71-ecbb-4a1f-86ef-5631d9a7442a	g.chr14:59950910A>G	ENST00000247194.4	-	1	238	c.125T>C	c.(124-126)gTg>gCg	p.V42A	JKAMP_ENST00000556985.1_5'Flank|L3HYPDH_ENST00000487285.1_5'Flank|JKAMP_ENST00000425728.2_5'Flank|JKAMP_ENST00000554271.1_5'Flank|JKAMP_ENST00000356057.5_5'Flank|RP11-701B16.2_ENST00000554253.1_RNA|JKAMP_ENST00000261247.9_5'Flank	NM_144581.1	NP_653182.1	Q96EM0	T3HPD_HUMAN	L-3-hydroxyproline dehydratase (trans-)	42			V -> A (in dbSNP:rs17096291).		metabolic process (GO:0008152)		hydro-lyase activity (GO:0016836)|trans-L-3-hydroxyproline dehydratase activity (GO:0050346)									L-Proline(DB00172)	GGGCCCAGACACCTCCGGACA	0.706											OREG0022712	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	A|||	177	0.0353435	0.1286	0.0101	5008	,	,		14153	0.0		0.0	False		,,,				2504	0.0				p.V42A		.											.	.	0			c.T125C						.	A	ALA/VAL	399,3741		20,359,1691	18.0	16.0	16.0		125	5.0	1.0	14	dbSNP_123	16	3,8265		0,3,4131	yes	missense	C14orf149	NM_144581.1	64	20,362,5822	GG,GA,AA		0.0363,9.6377,3.2398	benign	42/355	59950910	402,12006	2070	4134	6204	SO:0001583	missense	112849	exon1			CCAGACACCTCCG	AI762327	CCDS9739.1	14q23.1	2012-08-15	2012-08-15	2012-08-15	ENSG00000126790	ENSG00000126790	4.2.1.77		20488	protein-coding gene	gene with protein product	"""trans-L-3-hydroxyproline dehydratase"""	614811	"""chromosome 14 open reading frame 149"""	C14orf149		22528483	Standard	NM_144581		Approved	FLJ25436	uc001xee.1	Q96EM0	OTTHUMG00000028941	ENST00000247194.4:c.125T>C	14.37:g.59950910A>G	ENSP00000247194:p.Val42Ala	Somatic	7	0	1042	WXS	Illumina GAIIx	Phase_I	60	20	NM_144581	0	0	2	2	0	Q96LJ5	Missense_Mutation	SNP	ENST00000247194.4	37	CCDS9739.1	61	0.027930402930402932	58	0.11788617886178862	3	0.008287292817679558	0	0.0	0	0.0	A	13.73	2.325298	0.41197	0.096377	3.63E-4	ENSG00000126790	ENST00000247194	T	0.18960	2.18	4.97	4.97	0.65823	.	0.262033	0.37483	N	0.002066	T	0.00241	0.0007	L	0.41124	1.26	0.09310	P	0.9999999999999999	B;B	0.24092	0.097;0.009	B;B	0.27380	0.079;0.026	T	0.07616	-1.0763	9	0.62326	D	0.03	.	4.9438	0.13978	0.7742:0.0:0.2258:0.0	rs17096291;rs52809360;rs17096291	42;42	B4DGY8;Q96EM0	.;PRCM_HUMAN	A	42	ENSP00000247194:V42A	ENSP00000247194:V42A	V	-	2	0	C14orf149	59020663	0.997000	0.39634	0.989000	0.46669	0.417000	0.31264	4.100000	0.57762	2.082000	0.62665	0.374000	0.22700	GTG	A|0.965;G|0.035		0.706	L3HYPDH-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000072254.5	NM_144581	
STON2	85439	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	14	81737202	81737202	+	Missense_Mutation	SNP	G	G	T			TCGA-OR-A5LN-01A-11D-A29I-10	TCGA-OR-A5LN-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	cf6a87e3-f084-4b4c-a978-314c952310a0	c8e44d71-ecbb-4a1f-86ef-5631d9a7442a	g.chr14:81737202G>T	ENST00000267540.2	-	5	2625	c.2425C>A	c.(2425-2427)Cac>Aac	p.H809N	STON2_ENST00000555447.1_Missense_Mutation_p.H809N	NM_033104.3	NP_149095.2	Q8WXE9	STON2_HUMAN	stonin 2	809	MHD. {ECO:0000255|PROSITE- ProRule:PRU00404}.				hematopoietic progenitor cell differentiation (GO:0002244)|intracellular protein transport (GO:0006886)|regulation of endocytosis (GO:0030100)|synaptic vesicle endocytosis (GO:0048488)	cell junction (GO:0030054)|clathrin adaptor complex (GO:0030131)|clathrin-coated vesicle (GO:0030136)|cytoplasm (GO:0005737)|neuron projection (GO:0043005)|nucleolus (GO:0005730)|synaptic vesicle (GO:0008021)				breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(13)|pancreas(2)|prostate(1)|skin(5)	34				BRCA - Breast invasive adenocarcinoma(234;0.0348)		AAGAAACAGTGTGGGTGACCG	0.483																																					p.H809N		.											.	STON2-95	0			c.C2425A						.						72.0	62.0	65.0					14																	81737202		2203	4300	6503	SO:0001583	missense	85439	exon7			AACAGTGTGGGTG	AB208948	CCDS9875.1, CCDS58332.1	14q31.1	2007-08-01				ENSG00000140022			30652	protein-coding gene	gene with protein product	"""stoned B homolog 2 (Drosophila)"""	608467				11381094, 11454741	Standard	NM_033104		Approved	STNB2, STN2	uc001xvk.2	Q8WXE9		ENST00000267540.2:c.2425C>A	14.37:g.81737202G>T	ENSP00000267540:p.His809Asn	Somatic	95	0		WXS	Illumina GAIIx	Phase_I	52	21	NM_001256430	0	0	0	0	0	G3V2T7|Q17R24|Q59H11|Q6NT47|Q96RI7|Q96RU6	Missense_Mutation	SNP	ENST00000267540.2	37	CCDS9875.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	28.0|28.0	4.882675|4.882675	0.91740|0.91740	.|.	.|.	ENSG00000140022|ENSG00000140022	ENST00000555447;ENST00000546306;ENST00000267540|ENST00000553821	T;T|.	0.20069|.	2.1;2.1|.	5.79|5.79	5.79|5.79	0.91817|0.91817	Clathrin adaptor, mu subunit, C-terminal (3);|.	0.116278|0.116278	0.56097|0.56097	D|D	0.000024|0.000024	T|T	0.78923|0.78923	0.4360|0.4360	M|M	0.78456|0.78456	2.415|2.415	0.80722|0.80722	D|D	1|1	D;D|.	0.76494|.	0.999;0.998|.	D;D|.	0.81914|.	0.995;0.991|.	T|T	0.77664|0.77664	-0.2503|-0.2503	10|6	0.87932|.	D|.	0|.	-23.6578|-23.6578	20.0371|20.0371	0.97565|0.97565	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	809;809|.	Q8WXE9;G3V2T7|.	STON2_HUMAN;.|.	N|Q	809;821;809|16	ENSP00000450857:H809N;ENSP00000267540:H809N|.	ENSP00000267540:H809N|.	H|H	-|-	1|3	0|2	STON2|STON2	80806955|80806955	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.991000|0.991000	0.79684|0.79684	9.104000|9.104000	0.94239|0.94239	2.734000|2.734000	0.93682|0.93682	0.655000|0.655000	0.94253|0.94253	CAC|CAC	.		0.483	STON2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000413317.1	NM_033104	
KCNK10	54207	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	14	88652129	88652129	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5LN-01A-11D-A29I-10	TCGA-OR-A5LN-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	cf6a87e3-f084-4b4c-a978-314c952310a0	c8e44d71-ecbb-4a1f-86ef-5631d9a7442a	g.chr14:88652129C>T	ENST00000340700.5	-	7	1818	c.1367G>A	c.(1366-1368)aGg>aAg	p.R456K	KCNK10_ENST00000312350.5_Missense_Mutation_p.R461K|KCNK10_ENST00000319231.5_Missense_Mutation_p.R461K	NM_021161.4	NP_066984.1	P57789	KCNKA_HUMAN	potassium channel, subfamily K, member 10	456					signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|transport (GO:0006810)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	potassium channel activity (GO:0005267)|voltage-gated ion channel activity (GO:0005244)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(5)|lung(25)|ovary(3)|pancreas(2)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)	47						CTTGTTTTTCCTCTTGGTGAG	0.542																																					p.R461K		.											.	KCNK10-95	0			c.G1382A						.						145.0	138.0	140.0					14																	88652129		2203	4300	6503	SO:0001583	missense	54207	exon7			TTTTTCCTCTTGG	AF279890	CCDS9880.1, CCDS9881.1, CCDS9882.1	14q31	2014-06-12						"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Two-P"""	6273	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 97"""	605873				10880510, 16382106	Standard	NM_021161		Approved	K2p10.1, TREK-2, TREK2, PPP1R97	uc001xwn.3	P57789		ENST00000340700.5:c.1367G>A	14.37:g.88652129C>T	ENSP00000343104:p.Arg456Lys	Somatic	338	1		WXS	Illumina GAIIx	Phase_I	250	83	NM_138318	0	0	0	0	0	B2R8T4|B2RCT3|B5TJL4|Q6B014|Q8TDK7|Q8TDK8|Q9HB59	Missense_Mutation	SNP	ENST00000340700.5	37	CCDS9880.1	.	.	.	.	.	.	.	.	.	.	C	19.43	3.825349	0.71143	.	.	ENSG00000100433	ENST00000340700;ENST00000312350;ENST00000319231	D;D;D	0.92647	-3.04;-3.06;-3.08	5.71	5.71	0.89125	.	0.226724	0.39909	N	0.001227	D	0.94515	0.8234	L	0.46157	1.445	0.53688	D	0.999976	P;P;P	0.52842	0.956;0.956;0.956	D;D;D	0.65010	0.931;0.931;0.931	D	0.94747	0.7924	10	0.87932	D	0	.	18.8558	0.92251	0.0:1.0:0.0:0.0	.	456;461;461	P57789;B2R8T4;Q6B014	KCNKA_HUMAN;.;.	K	456;461;461	ENSP00000343104:R456K;ENSP00000310568:R461K;ENSP00000312811:R461K	ENSP00000310568:R461K	R	-	2	0	KCNK10	87721882	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	5.203000	0.65174	2.709000	0.92574	0.655000	0.94253	AGG	.		0.542	KCNK10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000410167.1	NM_021161	
LACTB	114294	hgsc.bcm.edu	37	15	63414083	63414083	+	Missense_Mutation	SNP	A	A	C	rs34317102	byFrequency	TCGA-OR-A5LN-01A-11D-A29I-10	TCGA-OR-A5LN-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	cf6a87e3-f084-4b4c-a978-314c952310a0	c8e44d71-ecbb-4a1f-86ef-5631d9a7442a	g.chr15:63414083A>C	ENST00000261893.4	+	1	85	c.13A>C	c.(13-15)Atg>Ctg	p.M5L	LACTB_ENST00000413507.2_Missense_Mutation_p.M5L	NM_032857.3	NP_116246.2	P83111	LACTB_HUMAN	lactamase, beta	5				M -> L (in Ref. 1 and 2). {ECO:0000305}.		cytoplasm (GO:0005737)|mitochondrion (GO:0005739)	hydrolase activity (GO:0016787)			NS(1)|breast(1)|kidney(1)|large_intestine(3)|lung(3)|prostate(1)|skin(1)|stomach(1)	12						GTACCGGCTCATGTCAGCAGT	0.751													C|||	3981	0.794928	0.6725	0.8256	5008	,	,		8367	0.997		0.7316	False		,,,				2504	0.7955				p.M5L	Melanoma(85;443 1381 6215 27308 35583)	.											.	LACTB-90	0			c.A13C						.	C	LEU/MET,LEU/MET	1936,668		733,470,99	4.0	4.0	4.0		13,13	3.1	1.0	15	dbSNP_126	4	4375,1183		1737,901,141	yes	missense,missense	LACTB	NM_032857.3,NM_171846.2	15,15	2470,1371,240	CC,CA,AA		21.2846,25.6528,22.6783	benign,benign	5/548,5/374	63414083	6311,1851	1302	2779	4081	SO:0001583	missense	114294	exon1			CGGCTCATGTCAG	AK027808	CCDS10182.1, CCDS45275.1	15q22.1	2012-11-14	2001-12-12	2001-12-14	ENSG00000103642	ENSG00000103642		"""Mitochondrial ribosomal proteins / large subunits"""	16468	protein-coding gene	gene with protein product		608440	"""mitochondrial ribosomal protein L56"""	MRPL56		11707067	Standard	NM_032857		Approved	FLJ14902	uc002alw.3	P83111	OTTHUMG00000132807	ENST00000261893.4:c.13A>C	15.37:g.63414083A>C	ENSP00000261893:p.Met5Leu	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	15	15	NM_171846	0	0	0	0	0	P83096	Missense_Mutation	SNP	ENST00000261893.4	37	CCDS10182.1	1713	0.7843406593406593	304	0.6178861788617886	287	0.7928176795580111	568	0.993006993006993	554	0.7308707124010554	C	0.674	-0.800779	0.02841	0.743472	0.787154	ENSG00000103642	ENST00000261893;ENST00000413507	T	0.33216	1.42	3.1	3.1	0.35709	.	0.592824	0.14749	N	0.300689	T	0.00012	0.0000	N	0.02539	-0.55	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.37842	-0.9688	9	0.02654	T	1	0.0321	7.626	0.28212	0.2541:0.7459:0.0:0.0	rs34317102	5	P83111	LACTB_HUMAN	L	5	ENSP00000261893:M5L	ENSP00000261893:M5L	M	+	1	0	LACTB	61201136	0.994000	0.37717	0.956000	0.39512	0.117000	0.20001	0.346000	0.19997	0.640000	0.30582	-0.677000	0.03784	ATG	A|0.226;C|0.774		0.751	LACTB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256224.1	NM_032857	
WFIKKN1	117166	broad.mit.edu	37	16	683832	683832	+	Silent	SNP	C	C	A	rs541743223		TCGA-OR-A5LN-01A-11D-A29I-10	TCGA-OR-A5LN-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	cf6a87e3-f084-4b4c-a978-314c952310a0	c8e44d71-ecbb-4a1f-86ef-5631d9a7442a	g.chr16:683832C>A	ENST00000319070.2	+	2	1744	c.1422C>A	c.(1420-1422)ggC>ggA	p.G474G		NM_053284.2	NP_444514.1	Q96NZ8	WFKN1_HUMAN	WAP, follistatin/kazal, immunoglobulin, kunitz and netrin domain containing 1	474	NTR. {ECO:0000255|PROSITE- ProRule:PRU00295}.				muscle fiber development (GO:0048747)|negative regulation of DNA binding (GO:0043392)|negative regulation of protein binding (GO:0032091)|palate development (GO:0060021)|skeletal system development (GO:0001501)	extracellular region (GO:0005576)	metalloendopeptidase inhibitor activity (GO:0008191)|serine-type endopeptidase inhibitor activity (GO:0004867)			breast(1)|endometrium(1)|prostate(1)|upper_aerodigestive_tract(1)	4		Hepatocellular(780;0.00335)				AGTTCTTGGGCACCAAGTACC	0.677																																					p.G474G		.											.	WFIKKN1-90	0			c.C1422A						.						76.0	42.0	53.0					16																	683832		2178	4291	6469	SO:0001819	synonymous_variant	117166	exon2			CTTGGGCACCAAG	AK075356	CCDS10414.1	16p13	2013-01-21			ENSG00000127578	ENSG00000127578		"""Immunoglobulin superfamily / I-set domain containing"", ""WAP four-disulfide core domain containing"""	30912	protein-coding gene	gene with protein product	"""WAP four-disulfide core domain 20A"""	608021	"""chromosome 16 open reading frame 12"""	C16orf12		11274388, 11928817	Standard	NM_053284		Approved	RJD2, WFIKKN, WFDC20A	uc002cht.1	Q96NZ8	OTTHUMG00000090359	ENST00000319070.2:c.1422C>A	16.37:g.683832C>A		Somatic	80	0		WXS	Illumina GAIIx	Phase_I	269	8	NM_053284	0	0	0	0	0	Q7LDW0|Q8NBQ1|Q96S20	Silent	SNP	ENST00000319070.2	37	CCDS10414.1																																																																																			.		0.677	WFIKKN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206731.2	NM_053284	
ZNF598	90850	hgsc.bcm.edu	37	16	2049882	2049882	+	Missense_Mutation	SNP	G	G	C	rs61746014|rs370831505|rs141374045	byFrequency	TCGA-OR-A5LN-01A-11D-A29I-10	TCGA-OR-A5LN-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	cf6a87e3-f084-4b4c-a978-314c952310a0	c8e44d71-ecbb-4a1f-86ef-5631d9a7442a	g.chr16:2049882G>C	ENST00000563630.1	-	9	1745	c.1503C>G	c.(1501-1503)gaC>gaG	p.D501E	ZNF598_ENST00000431526.1_Missense_Mutation_p.D556E|ZNF598_ENST00000562103.1_Missense_Mutation_p.D501E|AC005606.15_ENST00000567515.1_lincRNA			Q86UK7	ZN598_HUMAN	zinc finger protein 598	556							poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)	p.E555_D556insE(1)		NS(2)|breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|lung(7)|skin(1)|urinary_tract(1)	16						CCGGGCCGCCGTCCTCCTCCT	0.701														108	0.0215655	0.0787	0.0043	5008	,	,		13556	0.0		0.001	False		,,,				2504	0.0				p.D556E		.											.	ZNF598-432	1	Insertion - In frame(1)	kidney(1)	c.C1668G						.						8.0	10.0	10.0					16																	2049882		1948	4090	6038	SO:0001583	missense	90850	exon11			GCCGCCGTCCTCC	BC029270		16p13.3	2008-05-02				ENSG00000167962		"""Zinc fingers, C2H2-type"""	28079	protein-coding gene	gene with protein product							Standard	NM_178167		Approved	FLJ00086	uc002cof.2	Q86UK7		ENST00000563630.1:c.1503C>G	16.37:g.2049882G>C	ENSP00000455882:p.Asp501Glu	Somatic	1	0		WXS	Illumina GAIIx	Phase_I	16	7	NM_178167	0	0	2	3	1	Q8IW49|Q8N3D9|Q96FG3|Q9H7J3	Missense_Mutation	SNP	ENST00000563630.1	37		55	0.025183150183150184	47	0.09552845528455285	4	0.011049723756906077	0	0.0	4	0.005277044854881266	.	0.001	-3.553113	0.00009	.	.	ENSG00000167962	ENST00000431526	T	0.18960	2.18	3.81	-7.62	0.01294	.	0.278175	0.39083	N	0.001461	T	0.00328	0.0010	M	0.68952	2.095	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.53121	-0.8483	10	0.02654	T	1	0.661	4.5193	0.11952	0.2398:0.0778:0.4518:0.2306	rs61746014	556	Q86UK7	ZN598_HUMAN	E	556	ENSP00000411409:D556E	ENSP00000411409:D556E	D	-	3	2	ZNF598	1989883	0.000000	0.05858	0.000000	0.03702	0.008000	0.06430	-0.979000	0.03774	-4.688000	0.00036	-1.526000	0.00926	GAC	G|0.949;C|0.051		0.701	ZNF598-001	NOVEL	basic	protein_coding	protein_coding	OTTHUMT00000434439.1	NM_178167	
RRN3	54700	broad.mit.edu;ucsc.edu;bcgsc.ca	37	16	15168670	15168670	+	Missense_Mutation	SNP	G	G	T			TCGA-OR-A5LN-01A-11D-A29I-10	TCGA-OR-A5LN-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	cf6a87e3-f084-4b4c-a978-314c952310a0	c8e44d71-ecbb-4a1f-86ef-5631d9a7442a	g.chr16:15168670G>T	ENST00000198767.6	-	11	990	c.907C>A	c.(907-909)Ctc>Atc	p.L303I	PDXDC1_ENST00000535621.2_Intron|RRN3_ENST00000429751.2_Missense_Mutation_p.L273I|RRN3_ENST00000327307.7_Missense_Mutation_p.L270I|RRN3_ENST00000563559.1_Missense_Mutation_p.L303I|RRN3_ENST00000540462.1_Missense_Mutation_p.L121I	NM_018427.3	NP_060897.3	Q9NYV6	RRN3_HUMAN	RRN3 RNA polymerase I transcription factor homolog (S. cerevisiae)	303					cell proliferation (GO:0008283)|cytoplasm organization (GO:0007028)|gene expression (GO:0010467)|homeostasis of number of cells (GO:0048872)|in utero embryonic development (GO:0001701)|negative regulation of intrinsic apoptotic signaling pathway by p53 class mediator (GO:1902254)|nucleolus organization (GO:0007000)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of DNA-templated transcription, initiation (GO:2000142)|ribosome biogenesis (GO:0042254)|transcription from RNA polymerase I promoter (GO:0006360)|transcription initiation from RNA polymerase I promoter (GO:0006361)	nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)				NS(2)|central_nervous_system(3)|endometrium(1)|kidney(1)|large_intestine(2)|lung(7)|ovary(2)|prostate(2)	20						ATCTGGTCGAGCCGTTCAGGA	0.413																																					p.L303I		.											.	RRN3-91	0			c.C907A						.						113.0	84.0	94.0					16																	15168670		2197	4300	6497	SO:0001583	missense	54700	exon11			GGTCGAGCCGTTC	AF227156	CCDS10559.1, CCDS73833.1	16p13.11	2009-10-26	2006-04-04		ENSG00000085721	ENSG00000085721			30346	protein-coding gene	gene with protein product		605121	"""RRN3 RNA polymerase I transcription factor homolog (yeast)"""			10758157, 11250903	Standard	XM_005255375		Approved	DKFZp566E104	uc002dde.3	Q9NYV6	OTTHUMG00000129847	ENST00000198767.6:c.907C>A	16.37:g.15168670G>T	ENSP00000198767:p.Leu303Ile	Somatic	98	3		WXS	Illumina GAIIx	Phase_I	96	10	NM_018427	0	0	1	1	0	A2RTY9|B4E0J7|B4E3T2|Q3MHU9|Q6IPL4|Q9H4F0	Missense_Mutation	SNP	ENST00000198767.6	37	CCDS10559.1	.	.	.	.	.	.	.	.	.	.	.	7.146	0.582795	0.13749	.	.	ENSG00000085721	ENST00000198767;ENST00000429751;ENST00000327307;ENST00000540462	T;T;T;T	0.43688	0.94;0.94;0.94;0.94	5.52	4.51	0.55191	.	0.660421	0.13888	N	0.355828	T	0.28433	0.0703	N	0.19112	0.55	0.09310	N	1	B;B;B	0.14012	0.004;0.005;0.009	B;B;B	0.12156	0.003;0.007;0.007	T	0.06935	-1.0799	10	0.36615	T	0.2	.	10.7149	0.46006	0.0:0.0:0.628:0.372	.	273;204;303	F5H148;B4DZL9;Q9NYV6	.;.;RRN3_HUMAN	I	303;273;270;121	ENSP00000198767:L303I;ENSP00000402027:L273I;ENSP00000318484:L270I;ENSP00000437963:L121I	ENSP00000198767:L303I	L	-	1	0	RRN3	15076171	0.000000	0.05858	0.041000	0.18516	0.004000	0.04260	0.777000	0.26718	2.586000	0.87340	0.561000	0.74099	CTC	.		0.413	RRN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252087.2	NM_018427	
ZNF48	197407	hgsc.bcm.edu	37	16	30407177	30407177	+	Missense_Mutation	SNP	A	A	G	rs7200143	byFrequency	TCGA-OR-A5LN-01A-11D-A29I-10	TCGA-OR-A5LN-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	cf6a87e3-f084-4b4c-a978-314c952310a0	c8e44d71-ecbb-4a1f-86ef-5631d9a7442a	g.chr16:30407177A>G	ENST00000320159.2	+	1	438	c.62A>G	c.(61-63)cAg>cGg	p.Q21R	SEPT1_ENST00000570039.1_5'UTR	NM_001214906.1|NM_001214907.1|NM_001214909.1|NM_152652.2	NP_001201835.1|NP_001201836.1|NP_001201838.1|NP_689865.2	Q96MX3	ZNF48_HUMAN	zinc finger protein 48	21			Q -> R (in dbSNP:rs7200143).		regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(3)|kidney(1)|large_intestine(1)|lung(11)|ovary(2)|pancreas(1)|skin(1)	21						AGGGAGCCACAGAGAGGCGCC	0.716													T|||	217	0.0433307	0.1558	0.0159	5008	,	,		11488	0.0		0.0	False		,,,				2504	0.0				p.Q21R		.											.	ZNF48-90	0			c.A62G						.	T	ARG/GLN,,ARG/GLN,ARG/GLN	444,3556		21,402,1577	6.0	6.0	6.0		62,,62,62	1.1	0.0	16	dbSNP_116	6	7,8173		0,7,4083	yes	missense,intron,missense,missense	ZNF48	NM_001214906.1,NM_001214907.1,NM_001214909.1,NM_152652.2	43,,43,43	21,409,5660	GG,GA,AA		0.0856,11.1,3.7028	benign,,benign,benign	21/619,,21/619,21/619	30407177	451,11729	2000	4090	6090	SO:0001583	missense	197407	exon2			AGCCACAGAGAGG	M88358, AK056313	CCDS10679.1, CCDS73868.1	16p11.2	2013-01-08			ENSG00000180035	ENSG00000180035		"""Zinc fingers, C2H2-type"""	13114	protein-coding gene	gene with protein product			"""zinc finger protein 553"""	ZNF553		1505991	Standard	NM_152652		Approved	DKFZp762K013, FLJ31751, MGC43952	uc021tgi.1	Q96MX3	OTTHUMG00000048195	ENST00000320159.2:c.62A>G	16.37:g.30407177A>G	ENSP00000324056:p.Gln21Arg	Somatic	3	0		WXS	Illumina GAIIx	Phase_I	82	29	NM_001214906	0	0	0	0	0	Q15920|Q4G0R3|Q69YP3|Q96IL9	Missense_Mutation	SNP	ENST00000320159.2	37	CCDS10679.1	85	0.03891941391941392	80	0.16260162601626016	5	0.013812154696132596	0	0.0	0	0.0	T	16.34	3.097034	0.56075	0.111	8.56E-4	ENSG00000180035	ENST00000528032;ENST00000524644;ENST00000320159	T;T;T	0.06449	3.58;3.5;3.3	4.64	1.07	0.20283	.	0.000000	0.27866	N	0.017532	T	0.00012	0.0000	N	0.08118	0	0.18873	P	0.9999820394	B	0.02656	0.0	B	0.01281	0.0	T	0.47407	-0.9120	9	0.18710	T	0.47	.	3.549	0.07839	0.1599:0.2665:0.0:0.5736	rs7200143	21	Q96MX3	ZNF48_HUMAN	R	21	ENSP00000435674:Q21R;ENSP00000432548:Q21R;ENSP00000324056:Q21R	ENSP00000324056:Q21R	Q	+	2	0	ZNF48	30314678	0.000000	0.05858	0.016000	0.15963	0.093000	0.18481	-0.863000	0.04259	-0.171000	0.10797	-0.346000	0.07831	CAG	A|0.961;G|0.039		0.716	ZNF48-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255549.2	NM_152652	
IRX3	79191	hgsc.bcm.edu	37	16	54318528	54318528	+	Missense_Mutation	SNP	A	A	G	rs1450355	byFrequency	TCGA-OR-A5LN-01A-11D-A29I-10	TCGA-OR-A5LN-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	cf6a87e3-f084-4b4c-a978-314c952310a0	c8e44d71-ecbb-4a1f-86ef-5631d9a7442a	g.chr16:54318528A>G	ENST00000329734.3	-	2	1977	c.1265T>C	c.(1264-1266)cTg>cCg	p.L422P		NM_024336.2	NP_077312.2	P78415	IRX3_HUMAN	iroquois homeobox 3	422	Pro-rich.		L -> P (in dbSNP:rs1450355). {ECO:0000269|PubMed:15489334}.		mesoderm development (GO:0007498)|metanephros development (GO:0001656)|negative regulation of neuron differentiation (GO:0045665)|positive regulation of neuron differentiation (GO:0045666)|regulation of transcription, DNA-templated (GO:0006355)|specification of loop of Henle identity (GO:0072086)|transcription, DNA-templated (GO:0006351)	axon (GO:0030424)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)			endometrium(2)|kidney(1)|large_intestine(5)|lung(3)|ovary(1)|soft_tissue(1)|urinary_tract(1)	14						GAGCGGGTGCAGGCGGGGGCC	0.776													g|||	4851	0.96865	0.888	0.987	5008	,	,		8017	1.0		1.0	False		,,,				2504	1.0				p.L422P	GBM(143;1830 1866 4487 4646 37383)	.											.	IRX3-90	0			c.T1265C						.	T	PRO/LEU	1678,102		788,102,0	1.0	2.0	2.0		1265	2.5	1.0	16	dbSNP_88	2	4195,3		2096,3,0	no	missense	IRX3	NM_024336.2	98	2884,105,0	GG,GA,AA		0.0715,5.7303,1.7564	benign	422/502	54318528	5873,105	890	2099	2989	SO:0001583	missense	79191	exon2			GGGTGCAGGCGGG	U90308	CCDS10750.1	16q12.2	2011-06-20	2007-07-13		ENSG00000177508	ENSG00000177508		"""Homeoboxes / TALE class"""	14360	protein-coding gene	gene with protein product		612985					Standard	NM_024336		Approved	IRX-1	uc002eht.1	P78415	OTTHUMG00000133200	ENST00000329734.3:c.1265T>C	16.37:g.54318528A>G	ENSP00000331608:p.Leu422Pro	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	8	4	NM_024336	0	0	0	0	0	Q7Z4A4|Q7Z4A5|Q8IVC6	Missense_Mutation	SNP	ENST00000329734.3	37	CCDS10750.1	2108	0.9652014652014652	433	0.8800813008130082	354	0.9779005524861878	567	0.9912587412587412	754	0.9947229551451188	g	5.642	0.303067	0.10678	0.942697	0.999285	ENSG00000177508	ENST00000329734	T	0.54279	0.58	4.4	2.45	0.29901	.	0.652897	0.14990	N	0.286760	T	0.00012	0.0000	N	0.01352	-0.895	0.29914	P	0.82336	B	0.02656	0.0	B	0.01281	0.0	T	0.21861	-1.0233	9	0.33940	T	0.23	-4.0049	5.143	0.14969	0.1733:0.0:0.6627:0.164	rs1450355;rs17852160;rs60836119	422	P78415	IRX3_HUMAN	P	422	ENSP00000331608:L422P	ENSP00000331608:L422P	L	-	2	0	IRX3	52876029	1.000000	0.71417	0.984000	0.44739	0.000000	0.00434	1.455000	0.35190	0.155000	0.19261	-1.528000	0.00924	CTG	T|0.035;G|0.004		0.776	IRX3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256910.2		
CX3CL1	6376	ucsc.edu	37	16	57416276	57416276	+	Nonsense_Mutation	SNP	C	C	T			TCGA-OR-A5LN-01A-11D-A29I-10	TCGA-OR-A5LN-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	cf6a87e3-f084-4b4c-a978-314c952310a0	c8e44d71-ecbb-4a1f-86ef-5631d9a7442a	g.chr16:57416276C>T	ENST00000006053.6	+	3	637	c.526C>T	c.(526-528)Cag>Tag	p.Q176*	CX3CL1_ENST00000565912.1_Nonsense_Mutation_p.Q138*|CX3CL1_ENST00000563383.1_Nonsense_Mutation_p.Q182*|CX3CL1_ENST00000564948.1_3'UTR	NM_002996.3	NP_002987.1	P78423	X3CL1_HUMAN	chemokine (C-X3-C motif) ligand 1	176	Mucin-like stalk.				angiogenesis involved in wound healing (GO:0060055)|cell adhesion (GO:0007155)|chemotaxis (GO:0006935)|cytokine-mediated signaling pathway (GO:0019221)|defense response (GO:0006952)|immune response (GO:0006955)|leukocyte adhesive activation (GO:0050902)|leukocyte chemotaxis (GO:0030595)|lymphocyte chemotaxis (GO:0048247)|macrophage chemotaxis (GO:0048246)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|neutrophil chemotaxis (GO:0030593)|positive regulation of angiogenesis (GO:0045766)|positive regulation of calcium-independent cell-cell adhesion (GO:0051041)|positive regulation of inflammatory response (GO:0050729)|positive regulation of transforming growth factor beta1 production (GO:0032914)	cell surface (GO:0009986)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	chemokine activity (GO:0008009)|receptor binding (GO:0005102)			breast(1)|endometrium(1)|large_intestine(1)|lung(2)	5						GCCAAAGGCTCAGGATGGAGG	0.677																																					p.Q176X		.											.	CX3CL1-226	0			c.C526T						.						32.0	33.0	33.0					16																	57416276		2198	4300	6498	SO:0001587	stop_gained	6376	exon3			AAGGCTCAGGATG	U84487	CCDS10779.1	16q13	2013-02-25	2002-08-22	2002-08-23	ENSG00000006210	ENSG00000006210		"""Endogenous ligands"""	10647	protein-coding gene	gene with protein product		601880	"""small inducible cytokine subfamily D (Cys-X3-Cys), member 1 (fractalkine, neurotactin)"""	SCYD1		9177350, 9024663	Standard	NM_002996		Approved	NTN, C3Xkine, ABCD-3, CXC3C, CXC3, fractalkine, neurotactin	uc002eli.3	P78423	OTTHUMG00000133469	ENST00000006053.6:c.526C>T	16.37:g.57416276C>T	ENSP00000006053:p.Gln176*	Somatic	41	0		WXS	Illumina GAIIx	Phase_I	39	4	NM_002996	0	0	0	0	0	O00672	Nonsense_Mutation	SNP	ENST00000006053.6	37	CCDS10779.1	.	.	.	.	.	.	.	.	.	.	C	16.51	3.143106	0.57044	.	.	ENSG00000006210	ENST00000006053	.	.	.	4.79	1.75	0.24633	.	2.961490	0.01446	N	0.015310	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-12.7115	4.2237	0.10570	0.0:0.5506:0.2312:0.2182	.	.	.	.	X	176	.	ENSP00000006053:Q176X	Q	+	1	0	CX3CL1	55973777	0.006000	0.16342	0.001000	0.08648	0.081000	0.17604	1.219000	0.32479	0.692000	0.31613	0.650000	0.86243	CAG	.		0.677	CX3CL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257345.3	NM_002996	
DHODH	1723	broad.mit.edu	37	16	72056283	72056283	+	Missense_Mutation	SNP	T	T	C			TCGA-OR-A5LN-01A-11D-A29I-10	TCGA-OR-A5LN-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	cf6a87e3-f084-4b4c-a978-314c952310a0	c8e44d71-ecbb-4a1f-86ef-5631d9a7442a	g.chr16:72056283T>C	ENST00000219240.4	+	6	749	c.728T>C	c.(727-729)tTg>tCg	p.L243S	DHODH_ENST00000572887.1_Missense_Mutation_p.L243S|DHODH_ENST00000573922.1_Intron	NM_001361.4	NP_001352.2	Q02127	PYRD_HUMAN	dihydroorotate dehydrogenase (quinone)	243					'de novo' pyrimidine nucleobase biosynthetic process (GO:0006207)|'de novo' UMP biosynthetic process (GO:0044205)|female pregnancy (GO:0007565)|lactation (GO:0007595)|nucleobase-containing small molecule metabolic process (GO:0055086)|positive regulation of apoptotic process (GO:0043065)|pyrimidine nucleobase metabolic process (GO:0006206)|pyrimidine nucleoside biosynthetic process (GO:0046134)|regulation of mitochondrial fission (GO:0090140)|response to caffeine (GO:0031000)|response to drug (GO:0042493)|response to starvation (GO:0042594)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|neuronal cell body (GO:0043025)	dihydroorotate dehydrogenase activity (GO:0004152)|dihydroorotate oxidase activity (GO:0004158)|drug binding (GO:0008144)|FMN binding (GO:0010181)|ubiquinone binding (GO:0048039)			breast(1)|endometrium(2)|large_intestine(4)|ovary(1)|skin(1)|stomach(1)	10		Ovarian(137;0.125)			Atovaquone(DB01117)|Leflunomide(DB01097)|Teriflunomide(DB08880)	AGGGATGGCTTGCGGAGAGTG	0.622																																					p.L243S		.											.	DHODH-227	0			c.T728C						.						27.0	36.0	33.0					16																	72056283		2103	4194	6297	SO:0001583	missense	1723	exon6			ATGGCTTGCGGAG		CCDS42192.1	16q22.2	2012-10-02	2011-09-05		ENSG00000102967	ENSG00000102967	1.3.5.2		2867	protein-coding gene	gene with protein product		126064	"""dihydroorotate dehydrogenase"""			8211381	Standard	NM_001361		Approved		uc002fbp.3	Q02127	OTTHUMG00000178093	ENST00000219240.4:c.728T>C	16.37:g.72056283T>C	ENSP00000219240:p.Leu243Ser	Somatic	54	0		WXS	Illumina GAIIx	Phase_I	99	3	NM_001361	0	0	4	4	0	A8K8C8|Q6P176	Missense_Mutation	SNP	ENST00000219240.4	37	CCDS42192.1	.	.	.	.	.	.	.	.	.	.	T	14.50	2.552510	0.45487	.	.	ENSG00000102967	ENST00000219240	D	0.95103	-3.61	5.82	4.71	0.59529	Aldolase-type TIM barrel (1);	0.062213	0.64402	D	0.000006	D	0.95214	0.8448	M	0.84511	2.7	0.46499	D	0.999071	P	0.44521	0.837	P	0.46208	0.507	D	0.93849	0.7143	10	0.44086	T	0.13	-9.9692	12.4135	0.55480	0.1259:0.0:0.0:0.8741	.	243	Q02127	PYRD_HUMAN	S	243	ENSP00000219240:L243S	ENSP00000219240:L243S	L	+	2	0	DHODH	70613784	1.000000	0.71417	0.007000	0.13788	0.002000	0.02628	7.728000	0.84847	1.012000	0.39366	0.459000	0.35465	TTG	.		0.622	DHODH-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		NM_001361	
C17orf97	400566	hgsc.bcm.edu	37	17	260182	260182	+	Silent	SNP	T	T	C	rs7502594	byFrequency	TCGA-OR-A5LN-01A-11D-A29I-10	TCGA-OR-A5LN-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	cf6a87e3-f084-4b4c-a978-314c952310a0	c8e44d71-ecbb-4a1f-86ef-5631d9a7442a	g.chr17:260182T>C	ENST00000571106.1	+	1	55	c.49T>C	c.(49-51)Tta>Cta	p.L17L	AC108004.3_ENST00000599026.1_RNA|AC108004.3_ENST00000466740.2_RNA|C17orf97_ENST00000360127.6_Silent_p.L17L			Q6ZQX7	CQ097_HUMAN	chromosome 17 open reading frame 97	17										breast(1)|kidney(2)|large_intestine(4)|lung(4)|ovary(1)|prostate(1)|skin(1)	14						GAGTCGCCGATTAGTCGGCAT	0.751													c|||	1929	0.385184	0.6286	0.2666	5008	,	,		13427	0.3125		0.2396	False		,,,				2504	0.365				p.L17L		.											.	C17orf97-91	0			c.T49C						.			1512,2124		272,968,578	3.0	4.0	4.0		49	2.9	0.0	17	dbSNP_116	4	1503,5991		176,1151,2420	no	coding-synonymous	C17orf97	NM_001013672.4		448,2119,2998	CC,CT,TT		20.056,41.5842,27.0889		17/424	260182	3015,8115	1818	3747	5565	SO:0001819	synonymous_variant	400566	exon1			CGCCGATTAGTCG	AK128660, BC057385	CCDS32519.2	17p13.3	2008-08-15			ENSG00000187624	ENSG00000187624			33800	protein-coding gene	gene with protein product						12477932	Standard	NM_001013672		Approved	LOC400566	uc021tna.1	Q6ZQX7	OTTHUMG00000132479	ENST00000571106.1:c.49T>C	17.37:g.260182T>C		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	12	4	NM_001013672	0	0	0	0	0	A5D8T6|Q6NSI2|Q6PFW9	Silent	SNP	ENST00000571106.1	37																																																																																				T|0.657;C|0.343		0.751	C17orf97-003	PUTATIVE	basic|appris_candidate|exp_conf	protein_coding	protein_coding	OTTHUMT00000436874.1	NM_001013672	
GSG2	83903	hgsc.bcm.edu	37	17	3627619	3627619	+	Silent	SNP	C	C	T	rs1185511	byFrequency	TCGA-OR-A5LN-01A-11D-A29I-10	TCGA-OR-A5LN-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	cf6a87e3-f084-4b4c-a978-314c952310a0	c8e44d71-ecbb-4a1f-86ef-5631d9a7442a	g.chr17:3627619C>T	ENST00000325418.4	+	1	409	c.390C>T	c.(388-390)tgC>tgT	p.C130C	ITGAE_ENST00000571185.1_5'UTR|ITGAE_ENST00000263087.4_Intron|CTD-3195I5.3_ENST00000571741.1_RNA	NM_031965.2	NP_114171.2	Q8TF76	HASP_HUMAN	germ cell associated 2 (haspin)	130					histone H3-T3 phosphorylation involved in chromosome passenger complex localization to kinetochore (GO:2000751)|intracellular signal transduction (GO:0035556)|mitotic sister chromatid cohesion (GO:0007064)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|protein localization to chromosome, centromeric region (GO:0071459)|protein phosphorylation (GO:0006468)|regulation of spindle checkpoint (GO:0090231)	centrosome (GO:0005813)|chromosome (GO:0005694)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|spindle (GO:0005819)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|histone kinase activity (H3-T3 specific) (GO:0072354)|protein kinase activity (GO:0004672)										GCACACCCTGCGGCCCGCTCC	0.731													C|||	804	0.160543	0.587	0.0403	5008	,	,		12752	0.0		0.0	False		,,,				2504	0.0				p.C130C		.											.	GSG2-297	0			c.C390T						.	C	,	1822,2460		390,1042,709	6.0	8.0	8.0		,390	4.4	0.7	17	dbSNP_87	8	25,8313		0,25,4144	no	intron,coding-synonymous	ITGAE,GSG2	NM_002208.4,NM_031965.2	,	390,1067,4853	TT,TC,CC		0.2998,42.5502,14.6355	,	,130/799	3627619	1847,10773	2141	4169	6310	SO:0001819	synonymous_variant	83903	exon1			ACCCTGCGGCCCG	AB039834	CCDS11036.1	17p13	2005-01-19			ENSG00000177602	ENSG00000177602			19682	protein-coding gene	gene with protein product		609240					Standard	NM_031965		Approved	haspin	uc002fwp.3	Q8TF76	OTTHUMG00000090703	ENST00000325418.4:c.390C>T	17.37:g.3627619C>T		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	28	4	NM_031965	0	0	0	0	0	Q5U5K3|Q96MN1|Q9BXS7	Silent	SNP	ENST00000325418.4	37	CCDS11036.1																																																																																			C|0.779;T|0.221		0.731	GSG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207391.1	NM_031965	
GLTPD2	388323	hgsc.bcm.edu	37	17	4693342	4693342	+	Missense_Mutation	SNP	C	C	A	rs35910358	byFrequency	TCGA-OR-A5LN-01A-11D-A29I-10	TCGA-OR-A5LN-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	cf6a87e3-f084-4b4c-a978-314c952310a0	c8e44d71-ecbb-4a1f-86ef-5631d9a7442a	g.chr17:4693342C>A	ENST00000331264.7	+	4	680	c.627C>A	c.(625-627)gaC>gaA	p.D209E		NM_001014985.2	NP_001014985	A6NH11	GLTD2_HUMAN	glycolipid transfer protein domain containing 2	209				D -> E (in Ref. 2; AAI50537). {ECO:0000305}.		cytoplasm (GO:0005737)	glycolipid binding (GO:0051861)|glycolipid transporter activity (GO:0017089)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(1)	4						GAGGCCCGGACGCGGGCGTGC	0.761													C|||	4904	0.979233	0.9228	1.0	5008	,	,		11019	1.0		0.998	False		,,,				2504	1.0				p.D209E		.											.	GLTPD2-68	0			c.C627A						.	C	GLU/ASP	2706,78		1314,78,0	2.0	2.0	2.0		627	0.2	0.1	17	dbSNP_126	2	6028,0		3014,0,0	no	missense	GLTPD2	NM_001014985.2	45	4328,78,0	AA,AC,CC		0.0,2.8017,0.8852	benign	209/292	4693342	8734,78	1392	3014	4406	SO:0001583	missense	388323	exon4			CCCGGACGCGGGC	BC029290	CCDS32534.1	17p13.2	2007-12-19				ENSG00000182327			33756	protein-coding gene	gene with protein product							Standard	NM_001014985		Approved		uc002fza.2	A6NH11		ENST00000331264.7:c.627C>A	17.37:g.4693342C>A	ENSP00000328070:p.Asp209Glu	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	4	4	NM_001014985	0	0	0	0	0	A7E2T2	Missense_Mutation	SNP	ENST00000331264.7	37	CCDS32534.1	2151	0.9848901098901099	466	0.9471544715447154	362	1.0	572	1.0	751	0.9907651715039578	C	9.155	1.017148	0.19355	0.971983	1.0	ENSG00000182327	ENST00000331264	.	.	.	4.58	0.162	0.14981	Glycolipid transfer protein domain (3);	.	.	.	.	T	0.00012	0.0000	L	0.41027	1.25	0.80722	P	0.0	B	0.22080	0.064	B	0.31614	0.133	T	0.34650	-0.9820	7	0.12103	T	0.63	-20.1635	5.889	0.18897	0.0:0.5269:0.298:0.1751	rs35910358	209	A6NH11	GLTD2_HUMAN	E	209	.	ENSP00000328070:D209E	D	+	3	2	GLTPD2	4640082	0.004000	0.15560	0.082000	0.20525	0.081000	0.17604	0.011000	0.13264	-0.068000	0.12953	0.555000	0.69702	GAC	C|0.015;A|0.985		0.761	GLTPD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000439781.1	NM_001014985	
VAT1	10493	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	17	41170156	41170156	+	Silent	SNP	G	G	C			TCGA-OR-A5LN-01A-11D-A29I-10	TCGA-OR-A5LN-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	cf6a87e3-f084-4b4c-a978-314c952310a0	c8e44d71-ecbb-4a1f-86ef-5631d9a7442a	g.chr17:41170156G>C	ENST00000420567.3	-	3	406	c.261C>G	c.(259-261)gcC>gcG	p.A87A	VAT1_ENST00000587173.1_Silent_p.A153A|VAT1_ENST00000355653.3_Silent_p.A221A			P54219	VMAT1_HUMAN	vesicle amine transport 1	0					monoamine transport (GO:0015844)|neurotransmitter transport (GO:0006836)|transmembrane transport (GO:0055085)	clathrin-sculpted monoamine transport vesicle membrane (GO:0070083)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	drug transmembrane transporter activity (GO:0015238)|monoamine transmembrane transporter activity (GO:0008504)			endometrium(1)|kidney(2)|large_intestine(3)|lung(2)|upper_aerodigestive_tract(1)	9		Breast(137;0.000717)		BRCA - Breast invasive adenocarcinoma(366;0.156)	Ephedra(DB01363)|Methamphetamine(DB01577)|Norepinephrine(DB00368)|Reserpine(DB00206)	TGCTGGCCGAGGCCGTTCCGA	0.557																																					p.A221A		.											.	VAT1-90	0			c.C663G						.						168.0	139.0	148.0					17																	41170156		2203	4300	6503	SO:0001819	synonymous_variant	10493	exon3			GGCCGAGGCCGTT	U18009	CCDS11451.1	17q21	2013-08-23	2013-08-23			ENSG00000108828			16919	protein-coding gene	gene with protein product		604631	"""vesicle amine transport protein 1 homolog (T. californica)"""			7774926, 8938427	Standard	NM_006373		Approved	VATI, FLJ20230	uc002icm.1	Q99536		ENST00000420567.3:c.261C>G	17.37:g.41170156G>C		Somatic	196	0		WXS	Illumina GAIIx	Phase_I	259	14	NM_006373	0	0	28	28	0	E9PDJ5|Q9BRE4	Silent	SNP	ENST00000420567.3	37		.	.	.	.	.	.	.	.	.	.	G	9.833	1.188868	0.21954	.	.	ENSG00000108828	ENST00000315674	.	.	.	5.24	0.581	0.17407	.	.	.	.	.	T	0.47581	0.1453	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.43845	-0.9366	5	0.44086	T	0.13	-0.767	2.9091	0.05731	0.1446:0.1022:0.4335:0.3197	.	.	.	.	V	221	.	ENSP00000326121:L221V	L	-	1	0	VAT1	38423682	0.874000	0.30092	0.999000	0.59377	0.991000	0.79684	-0.118000	0.10692	0.576000	0.29452	0.462000	0.41574	CTC	.		0.557	VAT1-002	PUTATIVE	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000453104.1	NM_006373	
CDK5RAP3	80279	ucsc.edu;bcgsc.ca	37	17	46053334	46053334	+	Silent	SNP	A	A	G	rs202125432	byFrequency	TCGA-OR-A5LN-01A-11D-A29I-10	TCGA-OR-A5LN-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	cf6a87e3-f084-4b4c-a978-314c952310a0	c8e44d71-ecbb-4a1f-86ef-5631d9a7442a	g.chr17:46053334A>G	ENST00000338399.4	+	8	859	c.753A>G	c.(751-753)gaA>gaG	p.E251E	CDK5RAP3_ENST00000536708.2_Silent_p.E276E|RP11-6N17.9_ENST00000582262.1_RNA	NM_176096.1	NP_788276.1	Q96JB5	CK5P3_HUMAN	CDK5 regulatory subunit associated protein 3	251					brain development (GO:0007420)|protein ufmylation (GO:0071569)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|regulation of neuron differentiation (GO:0045664)	membrane (GO:0016020)	protein kinase binding (GO:0019901)	p.E251E(1)		NS(1)|central_nervous_system(2)|cervix(3)|endometrium(3)|large_intestine(2)|lung(5)|prostate(1)|skin(1)	18						CTGTGGTGGAACGACCCCACC	0.602																																					p.E251E		.											.	CDK5RAP3-226	1	Substitution - coding silent(1)	prostate(1)	c.A753G						.																																			SO:0001819	synonymous_variant	80279	exon8			GGTGGAACGACCC	AF110322	CCDS42356.1, CCDS62232.1	17q21.2	2008-07-18				ENSG00000108465			18673	protein-coding gene	gene with protein product	"""ischemic heart CDK5 activator-binding protein C53"", ""LXXLL/leucine-zipper-containing ARFbinding protein"""	608202				10721722	Standard	NM_176096		Approved	MST016, FLJ13660, C53, IC53, HSF-27, OK/SW-cl.114, LZAP	uc010wlc.3	Q96JB5		ENST00000338399.4:c.753A>G	17.37:g.46053334A>G		Somatic	92	2		WXS	Illumina GAIIx	Phase_I	122	15	NM_176096	0	0	36	36	0	B7Z6N4|D3DTU1|D3DTU2|F5H3I5|Q53FA2|Q9H3F8|Q9H8G0|Q9HBR9	Silent	SNP	ENST00000338399.4	37	CCDS42356.1																																																																																			A|0.949;G|0.051		0.602	CDK5RAP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000442913.1	NM_176096	
UTP18	51096	broad.mit.edu;bcgsc.ca	37	17	49338205	49338205	+	Missense_Mutation	SNP	T	T	C	rs377210451		TCGA-OR-A5LN-01A-11D-A29I-10	TCGA-OR-A5LN-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	cf6a87e3-f084-4b4c-a978-314c952310a0	c8e44d71-ecbb-4a1f-86ef-5631d9a7442a	g.chr17:49338205T>C	ENST00000225298.7	+	1	317	c.260T>C	c.(259-261)gTg>gCg	p.V87A	MBTD1_ENST00000376381.2_5'Flank|MBTD1_ENST00000586178.1_5'Flank	NM_016001.2	NP_057085.2	Q9Y5J1	UTP18_HUMAN	UTP18 small subunit (SSU) processome component homolog (yeast)	87					rRNA processing (GO:0006364)	nucleolus (GO:0005730)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			breast(2)|endometrium(3)|kidney(2)|lung(5)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	16			BRCA - Breast invasive adenocarcinoma(22;2.09e-07)			AAACCGGCCGTGGAGCGGTGC	0.726																																					p.V87A		.											.	UTP18-90	0			c.T260C						.	T	ALA/VAL	1,3757		0,1,1878	10.0	13.0	12.0		260	-5.1	0.0	17		12	0,8108		0,0,4054	no	missense	UTP18	NM_016001.2	64	0,1,5932	CC,CT,TT		0.0,0.0266,0.0084	benign	87/557	49338205	1,11865	1879	4054	5933	SO:0001583	missense	51096	exon1			CGGCCGTGGAGCG	AF151806	CCDS42362.1	17q21.33	2013-05-21	2011-12-09	2006-05-16	ENSG00000011260	ENSG00000011260		"""WD repeat domain containing"""	24274	protein-coding gene	gene with protein product		612816	"""WD repeat domain 50"""	WDR50		10810093, 8619474, 15590835	Standard	NM_016001		Approved	CGI-48	uc002its.3	Q9Y5J1	OTTHUMG00000162370	ENST00000225298.7:c.260T>C	17.37:g.49338205T>C	ENSP00000225298:p.Val87Ala	Somatic	105	1		WXS	Illumina GAIIx	Phase_I	248	12	NM_016001	0	0	1	1	0	Q9H4N6	Missense_Mutation	SNP	ENST00000225298.7	37	CCDS42362.1	.	.	.	.	.	.	.	.	.	.	T	9.538	1.112603	0.20795	2.66E-4	0.0	ENSG00000011260	ENST00000225298;ENST00000508506	T	0.36520	1.25	4.82	-5.09	0.02920	.	0.743246	0.12930	N	0.427478	T	0.12902	0.0313	N	0.10733	0.035	0.25832	N	0.984155	B	0.02656	0.0	B	0.01281	0.0	T	0.37686	-0.9695	10	0.06625	T	0.88	-0.3209	9.7563	0.40504	0.1196:0.5931:0.0:0.2873	.	87	Q9Y5J1	UTP18_HUMAN	A	87;63	ENSP00000225298:V87A	ENSP00000225298:V87A	V	+	2	0	UTP18	46693204	0.508000	0.26154	0.040000	0.18447	0.900000	0.52787	-0.101000	0.10973	-1.038000	0.03279	-0.456000	0.05471	GTG	.		0.726	UTP18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000368654.1	NM_016001	
PGS1	9489	hgsc.bcm.edu	37	17	76374837	76374837	+	Silent	SNP	C	C	T	rs369995098	byFrequency	TCGA-OR-A5LN-01A-11D-A29I-10	TCGA-OR-A5LN-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	cf6a87e3-f084-4b4c-a978-314c952310a0	c8e44d71-ecbb-4a1f-86ef-5631d9a7442a	g.chr17:76374837C>T	ENST00000262764.6	+	1	117	c.91C>T	c.(91-93)Ctg>Ttg	p.L31L	PGS1_ENST00000329897.7_5'UTR	NM_024419.3	NP_077733.3	Q32NB8	PGPS1_HUMAN	phosphatidylglycerophosphate synthase 1	31					cardiolipin biosynthetic process (GO:0032049)|diacylglycerol metabolic process (GO:0046339)|glycerophospholipid biosynthetic process (GO:0046474)|phosphatidylglycerol biosynthetic process (GO:0006655)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum (GO:0005783)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|CDP-diacylglycerol-glycerol-3-phosphate 3-phosphatidyltransferase activity (GO:0008444)			cervix(2)|endometrium(1)|large_intestine(1)|lung(3)|prostate(1)|skin(1)|urinary_tract(1)	10			BRCA - Breast invasive adenocarcinoma(99;0.00144)|OV - Ovarian serous cystadenocarcinoma(97;0.031)			GGCCGCGCTCCTGGGACGCCT	0.761													C|||	37	0.00738818	0.0265	0.0029	5008	,	,		11567	0.0		0.0	False		,,,				2504	0.0				p.L31L	Esophageal Squamous(45;182 1126 10685 43198)	.											.	PGS1-90	0			c.C91T						.	C		27,2691		1,25,1333	2.0	5.0	4.0		91	4.5	1.0	17		4	3,6259		0,3,3128	no	coding-synonymous	PGS1	NM_024419.3		1,28,4461	TT,TC,CC		0.0479,0.9934,0.3341		31/557	76374837	30,8950	1359	3131	4490	SO:0001819	synonymous_variant	9489	exon1			GCGCTCCTGGGAC		CCDS42391.1	17q25.3	2006-02-09							30029	protein-coding gene	gene with protein product		614942				9880566	Standard	XR_243691		Approved	DKFZP762M186	uc002jvm.3	Q32NB8		ENST00000262764.6:c.91C>T	17.37:g.76374837C>T		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	20	15	NM_024419	0	0	0	0	0	B7ZA32|Q8IYK9|Q8TA85|Q96A75|Q9H7G9|Q9NPW7	Silent	SNP	ENST00000262764.6	37	CCDS42391.1																																																																																			.		0.761	PGS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000437301.1	NM_024419	
KCNG2	26251	hgsc.bcm.edu	37	18	77623898	77623898	+	Silent	SNP	C	C	T	rs147089723	byFrequency	TCGA-OR-A5LN-01A-11D-A29I-10	TCGA-OR-A5LN-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	cf6a87e3-f084-4b4c-a978-314c952310a0	c8e44d71-ecbb-4a1f-86ef-5631d9a7442a	g.chr18:77623898C>T	ENST00000316249.3	+	1	231	c.231C>T	c.(229-231)gcC>gcT	p.A77A		NM_012283.1	NP_036415.1	Q9UJ96	KCNG2_HUMAN	potassium voltage-gated channel, subfamily G, member 2	77					energy reserve metabolic process (GO:0006112)|potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|regulation of heart contraction (GO:0008016)|regulation of insulin secretion (GO:0050796)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)	extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)			breast(2)|endometrium(4)|lung(7)|skin(1)|upper_aerodigestive_tract(4)	18		Esophageal squamous(42;0.0157)|Melanoma(33;0.144)		OV - Ovarian serous cystadenocarcinoma(15;6.92e-07)|BRCA - Breast invasive adenocarcinoma(31;0.0244)		GCCCGTGCGCCTTCCGCGCCA	0.716													C|||	64	0.0127796	0.0477	0.0014	5008	,	,		3874	0.0		0.0	False		,,,				2504	0.0				p.A77A		.											.	KCNG2-90	0			c.C231T						.	C		217,4143		4,209,1967	17.0	15.0	16.0		231	0.8	1.0	18	dbSNP_134	16	1,8555		0,1,4277	no	coding-synonymous	KCNG2	NM_012283.1		4,210,6244	TT,TC,CC		0.0117,4.9771,1.6878		77/467	77623898	218,12698	2180	4278	6458	SO:0001819	synonymous_variant	26251	exon1			GTGCGCCTTCCGC	AJ011021	CCDS12019.1	18q23	2011-07-05			ENSG00000178342	ENSG00000178342		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6249	protein-coding gene	gene with protein product		605696				10551266, 16382104	Standard	NM_012283		Approved	Kv6.2, KCNF2	uc010xfl.2	Q9UJ96	OTTHUMG00000044541	ENST00000316249.3:c.231C>T	18.37:g.77623898C>T		Somatic	2	0		WXS	Illumina GAIIx	Phase_I	33	26	NM_012283	0	0	0	0	0		Silent	SNP	ENST00000316249.3	37	CCDS12019.1																																																																																			C|0.982;T|0.018		0.716	KCNG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000103906.1	NM_012283	
ABCA7	10347	ucsc.edu	37	19	1047002	1047002	+	Silent	SNP	A	A	G	rs3752234	byFrequency	TCGA-OR-A5LN-01A-11D-A29I-10	TCGA-OR-A5LN-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	cf6a87e3-f084-4b4c-a978-314c952310a0	c8e44d71-ecbb-4a1f-86ef-5631d9a7442a	g.chr19:1047002A>G	ENST00000263094.6	+	14	2055	c.1824A>G	c.(1822-1824)gcA>gcG	p.A608A	ABCA7_ENST00000433129.1_Silent_p.A608A|ABCA7_ENST00000533574.1_Intron|ABCA7_ENST00000435683.2_Silent_p.A470A	NM_019112.3	NP_061985.2	Q8IZY2	ABCA7_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 7	608					apolipoprotein A-I-mediated signaling pathway (GO:0038027)|ATP catabolic process (GO:0006200)|cholesterol efflux (GO:0033344)|high-density lipoprotein particle assembly (GO:0034380)|memory (GO:0007613)|negative regulation of amyloid precursor protein biosynthetic process (GO:0042985)|negative regulation of ATPase activity (GO:0032780)|negative regulation of beta-amyloid formation (GO:1902430)|peptide cross-linking (GO:0018149)|phagocytosis (GO:0006909)|phospholipid efflux (GO:0033700)|phospholipid scrambling (GO:0017121)|positive regulation of ATPase activity (GO:0032781)|positive regulation of beta-amyloid clearance (GO:1900223)|positive regulation of cholesterol efflux (GO:0010875)|positive regulation of engulfment of apoptotic cell (GO:1901076)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of phagocytosis (GO:0050766)|positive regulation of phospholipid efflux (GO:1902995)|protein localization to nucleus (GO:0034504)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|ATP-binding cassette (ABC) transporter complex (GO:0043190)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|phagocytic cup (GO:0001891)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)	apolipoprotein A-I receptor activity (GO:0034188)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|phospholipid transporter activity (GO:0005548)|transporter activity (GO:0005215)			NS(1)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(7)|lung(22)|ovary(1)|pancreas(7)|prostate(4)|skin(3)|upper_aerodigestive_tract(1)	65		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;1.04e-05)|all_lung(49;1.53e-05)|Breast(49;9.42e-05)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		TCAGCGCCGCACTGCTGGTTC	0.726													G|||	2899	0.578874	0.4637	0.7104	5008	,	,		13766	0.75		0.5199	False		,,,				2504	0.5256				p.A608A		.											.	ABCA7-98	0			c.A1824G						.			2219,2141		606,1007,567	14.0	13.0	13.0		1824	-2.7	0.3	19	dbSNP_107	13	4663,3873		1348,1967,953	no	coding-synonymous	ABCA7	NM_019112.3		1954,2974,1520	GG,GA,AA		45.3725,49.1055,46.6346		608/2147	1047002	6882,6014	2180	4268	6448	SO:0001819	synonymous_variant	10347	exon14			CGCCGCACTGCTG	AF328787	CCDS12055.1	19p13.3	2012-03-14			ENSG00000064687	ENSG00000064687		"""ATP binding cassette transporters / subfamily A"""	37	protein-coding gene	gene with protein product		605414					Standard	NM_019112		Approved	ABCX	uc002lqw.4	Q8IZY2	OTTHUMG00000167547	ENST00000263094.6:c.1824A>G	19.37:g.1047002A>G		Somatic	12	0		WXS	Illumina GAIIx	Phase_I	187	119	NM_019112	0	0	0	2	2	Q96S58|Q9BZC4|Q9NR73|Q9UKP8	Silent	SNP	ENST00000263094.6	37	CCDS12055.1																																																																																			A|0.402;G|0.598		0.726	ABCA7-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000394993.1	NM_019112	
ATP8B3	148229	bcgsc.ca	37	19	1784890	1784890	+	Silent	SNP	A	A	G	rs3764605	byFrequency	TCGA-OR-A5LN-01A-11D-A29I-10	TCGA-OR-A5LN-10A-01D-A29L-10	A	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	cf6a87e3-f084-4b4c-a978-314c952310a0	c8e44d71-ecbb-4a1f-86ef-5631d9a7442a	g.chr19:1784890A>G	ENST00000310127.6	-	28	3826	c.3588T>C	c.(3586-3588)agT>agC	p.S1196S	ATP8B3_ENST00000539485.1_Silent_p.S1206S|ATP8B3_ENST00000525591.1_Silent_p.S1159S	NM_138813.3	NP_620168.1	O60423	AT8B3_HUMAN	ATPase, aminophospholipid transporter, class I, type 8B, member 3	1196					binding of sperm to zona pellucida (GO:0007339)	acrosomal vesicle (GO:0001669)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)			central_nervous_system(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(1)|lung(9)|ovary(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	23		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		TTATGGACACACTCAGCAGGA	0.637													.|||	2150	0.429313	0.5061	0.3934	5008	,	,		17760	0.3155		0.4563	False		,,,				2504	0.4407				p.S1196S		.											.	.	0			c.T3588C						.	G	,	2130,2234		566,998,618	69.0	75.0	73.0		3477,3588	-6.6	0.0	19	dbSNP_107	73	4055,4497		978,2099,1199	no	coding-synonymous,coding-synonymous	ATP8B3	NM_001178002.1,NM_138813.2	,	1544,3097,1817	GG,GA,AA		47.4158,48.8084,47.8863	,	1159/1264,1196/1301	1784890	6185,6731	2182	4276	6458	SO:0001819	synonymous_variant	148229	exon28			GGACACACTCAGC	AA827939	CCDS45901.1, CCDS54196.1	19p13.3	2010-04-28	2010-04-28		ENSG00000130270	ENSG00000130270		"""ATPases / P-type"""	13535	protein-coding gene	gene with protein product	"""aminophospholipid translocase ATP8B3"", ""potential phospholipid-transporting ATPase IK"""	605866	"""ATPase, Class I, type 8B, member 3"", ""ATPase, class I, type 8B, member 3"""			11015572	Standard	NM_138813		Approved	ATPIK	uc002ltw.4	O60423	OTTHUMG00000166189	ENST00000310127.6:c.3588T>C	19.37:g.1784890A>G		Somatic	129	1		WXS	Illumina GAIIx	Phase_I	216	7	NM_138813	0	0	0	0	0	Q7Z485|Q8IVB8|Q8N4Y8|Q96M22	Silent	SNP	ENST00000310127.6	37	CCDS45901.1																																																																																			A|0.582;G|0.418		0.637	ATP8B3-002	KNOWN	alternative_5_UTR|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000388279.1	NM_138813	
KLF16	83855	hgsc.bcm.edu	37	19	1854557	1854557	+	Silent	SNP	A	A	G	rs3746045	byFrequency	TCGA-OR-A5LN-01A-11D-A29I-10	TCGA-OR-A5LN-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	cf6a87e3-f084-4b4c-a978-314c952310a0	c8e44d71-ecbb-4a1f-86ef-5631d9a7442a	g.chr19:1854557A>G	ENST00000250916.4	-	2	730	c.660T>C	c.(658-660)ccT>ccC	p.P220P	KLF16_ENST00000592313.1_5'UTR|CTB-31O20.6_ENST00000592884.1_RNA	NM_031918.3	NP_114124.1	Q9BXK1	KLF16_HUMAN	Kruppel-like factor 16	220	Pro/Ser-rich.				dopamine receptor signaling pathway (GO:0007212)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			lung(1)	1		Ovarian(11;1.78e-06)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		TGCGGGCACCAGGGCGCCGGA	0.756													A|||	2119	0.423123	0.6785	0.4611	5008	,	,		10654	0.3829		0.2177	False		,,,				2504	0.3037				p.P220P		.											.	KLF16-90	0			c.T660C						.	A		2319,1817		694,931,443	10.0	16.0	14.0		660	-6.7	0.2	19	dbSNP_107	14	1682,6356		211,1260,2548	no	coding-synonymous	KLF16	NM_031918.3		905,2191,2991	GG,GA,AA		20.9256,43.9313,32.8651		220/253	1854557	4001,8173	2068	4019	6087	SO:0001819	synonymous_variant	83855	exon2			GGCACCAGGGCGC	AF327440	CCDS12075.1	19p13.3	2013-10-15			ENSG00000129911	ENSG00000129911		"""Kruppel-like transcription factors"", ""Zinc fingers, C2H2-type"""	16857	protein-coding gene	gene with protein product		606139				11438660	Standard	NM_031918		Approved	NSLP2, BTEB4, DRRF	uc002luc.3	Q9BXK1	OTTHUMG00000179994	ENST00000250916.4:c.660T>C	19.37:g.1854557A>G		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	15	4	NM_031918	0	0	1	1	0		Silent	SNP	ENST00000250916.4	37	CCDS12075.1																																																																																			A|0.591;G|0.409		0.756	KLF16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000449214.1		
ADAT3	113179	hgsc.bcm.edu	37	19	1912251	1912251	+	Missense_Mutation	SNP	A	A	G	rs150715312	byFrequency	TCGA-OR-A5LN-01A-11D-A29I-10	TCGA-OR-A5LN-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	cf6a87e3-f084-4b4c-a978-314c952310a0	c8e44d71-ecbb-4a1f-86ef-5631d9a7442a	g.chr19:1912251A>G	ENST00000602400.1	+	2	385	c.157A>G	c.(157-159)Aag>Gag	p.K53E	SCAMP4_ENST00000414057.2_Intron|SCAMP4_ENST00000316097.8_Intron|ADAT3_ENST00000329478.2_Missense_Mutation_p.K69E|SCAMP4_ENST00000409472.1_Intron			Q96EY9	ADAT3_HUMAN	adenosine deaminase, tRNA-specific 3	53					tRNA processing (GO:0008033)		hydrolase activity (GO:0016787)|zinc ion binding (GO:0008270)			breast(1)|kidney(3)|pancreas(1)|skin(2)	7		Ovarian(11;2.11e-07)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		CGTCCTGGACAAGCGCCAGAC	0.731													A|||	14	0.00279553	0.0008	0.0072	5008	,	,		11791	0.0		0.008	False		,,,				2504	0.0				p.K69E		.											.	ADAT3-154	0			c.A205G						.	A	,GLU/LYS	19,4335		0,19,2158	12.0	13.0	13.0		,157	3.8	0.9	19	dbSNP_134	13	144,8388		0,144,4122	yes	intron,missense	SCAMP4,ADAT3	NM_079834.2,NM_138422.1	,56	0,163,6280	GG,GA,AA		1.6878,0.4364,1.2649	,probably-damaging	,53/352	1912251	163,12723	2177	4266	6443	SO:0001583	missense	113179	exon2			CTGGACAAGCGCC	BC011824	CCDS12076.1, CCDS12076.2	19p13.3	2011-05-19	2011-05-19		ENSG00000213638	ENSG00000213638			25151	protein-coding gene	gene with protein product	"""tRNA-specific adenosine deaminase 3 homolog (S. cerevisiae)"""	615302	"""adenosine deaminase, tRNA-specific 3, TAD3 homolog (S. cerevisiae)"""			12457566	Standard	NM_138422		Approved	TAD3	uc002luh.4	Q96EY9	OTTHUMG00000154591	ENST00000602400.1:c.157A>G	19.37:g.1912251A>G	ENSP00000473571:p.Lys53Glu	Somatic	3	0		WXS	Illumina GAIIx	Phase_I	37	25	NM_138422	0	0	0	0	0		Missense_Mutation	SNP	ENST00000602400.1	37		9	0.004120879120879121	1	0.0020325203252032522	2	0.0055248618784530384	0	0.0	6	0.0079155672823219	a	15.08	2.726322	0.48833	0.004364	0.016878	ENSG00000213638	ENST00000329478;ENST00000454697	.	.	.	4.81	3.79	0.43588	.	0.168491	0.50627	D	0.000108	T	0.41119	0.1145	M	0.69185	2.1	0.41829	D	0.990062	P	0.40970	0.734	B	0.42798	0.398	T	0.52034	-0.8629	9	0.56958	D	0.05	-18.1231	9.6141	0.39681	0.797:0.203:0.0:0.0	.	53	Q96EY9	ADAT3_HUMAN	E	53	.	ENSP00000332448:K53E	K	+	1	0	ADAT3	1863251	1.000000	0.71417	0.864000	0.33941	0.072000	0.16883	2.446000	0.44908	0.712000	0.32039	0.523000	0.50628	AAG	A|0.993;G|0.007		0.731	ADAT3-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_138422	
ANKLE1	126549	hgsc.bcm.edu	37	19	17392977	17392977	+	Silent	SNP	C	C	T	rs77247570	byFrequency	TCGA-OR-A5LN-01A-11D-A29I-10	TCGA-OR-A5LN-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	cf6a87e3-f084-4b4c-a978-314c952310a0	c8e44d71-ecbb-4a1f-86ef-5631d9a7442a	g.chr19:17392977C>T	ENST00000394458.3	+	2	450	c.174C>T	c.(172-174)tgC>tgT	p.C58C	CTD-2278I10.6_ENST00000596542.1_3'UTR|ANKLE1_ENST00000404085.1_Silent_p.C80C|ANKLE1_ENST00000594072.1_Silent_p.C47C|ANKLE1_ENST00000433424.2_Silent_p.C112C|ANKLE1_ENST00000598347.1_Silent_p.C58C	NM_152363.4	NP_689576	Q8NAG6	ANKL1_HUMAN	ankyrin repeat and LEM domain containing 1	58										large_intestine(1)|lung(3)|prostate(1)|skin(1)|urinary_tract(1)	7						GCCTGCGTTGCCTCGGGGCCC	0.716													C|||	153	0.0305511	0.1135	0.0043	5008	,	,		9545	0.0		0.0	False		,,,				2504	0.0				p.C58C		.											.	.	0			c.C174T						.	C		171,2731		1,169,1281	3.0	4.0	4.0		174	1.9	1.0	19	dbSNP_132	4	4,5444		0,4,2720	no	coding-synonymous	ANKLE1	NM_152363.4		1,173,4001	TT,TC,CC		0.0734,5.8925,2.0958		58/616	17392977	175,8175	1451	2724	4175	SO:0001819	synonymous_variant	126549	exon2			GCGTTGCCTCGGG	AK096688	CCDS12354.2, CCDS12354.3	19p13.11	2013-01-10	2008-03-25	2008-03-25	ENSG00000160117	ENSG00000160117		"""Ankyrin repeat domain containing"""	26812	protein-coding gene	gene with protein product	"""LEM domain containing 6"""		"""ankyrin repeat domain 41"""	ANKRD41			Standard	NM_152363		Approved	FLJ39369, LEMD6	uc002nga.2	Q8NAG6	OTTHUMG00000150839	ENST00000394458.3:c.174C>T	19.37:g.17392977C>T		Somatic	3	0		WXS	Illumina GAIIx	Phase_I	25	23	NM_152363	0	0	0	0	0	A8VU82|Q8N8J8	Silent	SNP	ENST00000394458.3	37	CCDS12354.2																																																																																			C|0.977;T|0.023		0.716	ANKLE1-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000325392.2	NM_152363	
HAPLN4	404037	hgsc.bcm.edu	37	19	19369489	19369489	+	Silent	SNP	T	T	C	rs80354663	byFrequency	TCGA-OR-A5LN-01A-11D-A29I-10	TCGA-OR-A5LN-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	cf6a87e3-f084-4b4c-a978-314c952310a0	c8e44d71-ecbb-4a1f-86ef-5631d9a7442a	g.chr19:19369489T>C	ENST00000291481.7	-	4	723	c.660A>G	c.(658-660)caA>caG	p.Q220Q	AC138430.4_ENST00000586064.2_RNA	NM_023002.2	NP_075378.1	Q86UW8	HPLN4_HUMAN	hyaluronan and proteoglycan link protein 4	220	Link 1. {ECO:0000255|PROSITE- ProRule:PRU00323, ECO:0000305}.				cell adhesion (GO:0007155)	proteinaceous extracellular matrix (GO:0005578)	hyaluronic acid binding (GO:0005540)			NS(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(7)|pancreas(1)|prostate(1)	16			Epithelial(12;0.00575)		Hyaluronan(DB08818)	TCACGGGGTATTGCACTGAGC	0.726													T|||	29	0.00579073	0.0212	0.0014	5008	,	,		12183	0.0		0.0	False		,,,				2504	0.0				p.Q220Q		.											.	HAPLN4-91	0			c.A660G						.	T		104,4278		2,100,2089	16.0	19.0	18.0		660	2.8	1.0	19	dbSNP_131	18	1,8507		0,1,4253	no	coding-synonymous	HAPLN4	NM_023002.2		2,101,6342	CC,CT,TT		0.0118,2.3733,0.8146		220/403	19369489	105,12785	2191	4254	6445	SO:0001819	synonymous_variant	404037	exon4			GGGGTATTGCACT	AB107883	CCDS12398.1	19p13.1	2013-01-11						"""Immunoglobulin superfamily / V-set domain containing"""	31357	protein-coding gene	gene with protein product	"""brain link protein 2"""					12663660	Standard	NM_023002		Approved	BRAL2, KIAA1926	uc002nmb.3	Q86UW8		ENST00000291481.7:c.660A>G	19.37:g.19369489T>C		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	18	18	NM_023002	0	0	0	0	0	A5PKW5|Q96PW2	Silent	SNP	ENST00000291481.7	37	CCDS12398.1																																																																																			T|0.989;C|0.011		0.726	HAPLN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000460117.2	NM_023002	
GLTSCR1	29998	hgsc.bcm.edu	37	19	48205288	48205288	+	Silent	SNP	G	G	A	rs8100472	byFrequency	TCGA-OR-A5LN-01A-11D-A29I-10	TCGA-OR-A5LN-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	cf6a87e3-f084-4b4c-a978-314c952310a0	c8e44d71-ecbb-4a1f-86ef-5631d9a7442a	g.chr19:48205288G>A	ENST00000396720.3	+	15	4493	c.4299G>A	c.(4297-4299)gcG>gcA	p.A1433A	CTD-2571L23.8_ENST00000599924.1_lincRNA	NM_015711.3	NP_056526.3	Q9NZM4	GSCR1_HUMAN	glioma tumor suppressor candidate region gene 1	1433										breast(2)|endometrium(1)|kidney(1)|large_intestine(4)|lung(3)|pancreas(3)|prostate(4)|skin(2)	20		all_cancers(25;1.8e-07)|all_lung(116;5.73e-06)|Lung NSC(112;9.69e-06)|all_epithelial(76;2.42e-05)|all_neural(266;0.0332)|Ovarian(192;0.086)		all cancers(93;0.000358)|OV - Ovarian serous cystadenocarcinoma(262;0.000576)|Epithelial(262;0.0212)|GBM - Glioblastoma multiforme(486;0.0355)		GCGAGCTGGCGGCCGTGGAGG	0.771													G|||	514	0.102636	0.2519	0.0548	5008	,	,		5835	0.001		0.0577	False		,,,				2504	0.0859				p.A1433A		.											.	GLTSCR1-48	0			c.G4299A						.	G		266,1774		1,264,755	1.0	2.0	2.0		4299	-3.5	1.0	19	dbSNP_116	2	222,4724		0,222,2251	no	coding-synonymous	GLTSCR1	NM_015711.3		1,486,3006	AA,AG,GG		4.4885,13.0392,6.9854		1433/1561	48205288	488,6498	1020	2473	3493	SO:0001819	synonymous_variant	29998	exon15			GCTGGCGGCCGTG	AF182077	CCDS46134.1	19q13.3	2012-11-29			ENSG00000063169	ENSG00000063169			4332	protein-coding gene	gene with protein product		605690				10708517	Standard	NM_015711		Approved		uc002phh.4	Q9NZM4		ENST00000396720.3:c.4299G>A	19.37:g.48205288G>A		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	12	12	NM_015711	0	0	0	0	0	A8MW01	Silent	SNP	ENST00000396720.3	37	CCDS46134.1																																																																																			G|0.917;A|0.083		0.771	GLTSCR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465846.1	NM_015711	
KCNA7	3743	hgsc.bcm.edu	37	19	49575618	49575618	+	Silent	SNP	A	A	G	rs71352730	byFrequency	TCGA-OR-A5LN-01A-11D-A29I-10	TCGA-OR-A5LN-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	cf6a87e3-f084-4b4c-a978-314c952310a0	c8e44d71-ecbb-4a1f-86ef-5631d9a7442a	g.chr19:49575618A>G	ENST00000221444.1	-	1	580	c.225T>C	c.(223-225)ggT>ggC	p.G75G		NM_031886.2	NP_114092.2	Q96RP8	KCNA7_HUMAN	potassium voltage-gated channel, shaker-related subfamily, member 7	75					protein homooligomerization (GO:0051260)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)			central_nervous_system(1)|endometrium(2)|large_intestine(2)|lung(4)|skin(2)	11		all_lung(116;1.7e-06)|Lung NSC(112;3.55e-06)|all_epithelial(76;3.83e-06)|all_neural(266;0.0189)|Ovarian(192;0.0261)		all cancers(93;0.000397)|OV - Ovarian serous cystadenocarcinoma(262;0.000519)|GBM - Glioblastoma multiforme(486;0.00541)|Epithelial(262;0.0441)	Dalfampridine(DB06637)	GCAGCCGCCCACCGGACTGGT	0.731													a|||	708	0.141374	0.2837	0.1398	5008	,	,		7174	0.0486		0.0875	False		,,,				2504	0.1012				p.G75G	Colon(74;686 1235 3793 23366 48562)	.											.	KCNA7-90	0			c.T225C						.			790,3356		66,658,1349	9.0	12.0	11.0		225	-0.4	1.0	19	dbSNP_130	11	613,7491		29,555,3468	no	coding-synonymous	KCNA7	NM_031886.2		95,1213,4817	GG,GA,AA		7.5642,19.0545,11.4531		75/457	49575618	1403,10847	2073	4052	6125	SO:0001819	synonymous_variant	3743	exon1			CCGCCCACCGGAC	AF315818	CCDS12755.1	19q13.3	2012-07-05				ENSG00000104848		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6226	protein-coding gene	gene with protein product		176268				16382104	Standard	NM_031886		Approved	Kv1.7, HAK6	uc002pmg.3	Q96RP8		ENST00000221444.1:c.225T>C	19.37:g.49575618A>G		Somatic	1	0		WXS	Illumina GAIIx	Phase_I	16	11	NM_031886	0	0	0	0	0	A1KYX7|Q9BYS4	Silent	SNP	ENST00000221444.1	37	CCDS12755.1																																																																																			A|0.868;G|0.132		0.731	KCNA7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466263.1	NM_031886	
SIGLEC5	8778	bcgsc.ca	37	19	52132662	52132662	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5LN-01A-11D-A29I-10	TCGA-OR-A5LN-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	cf6a87e3-f084-4b4c-a978-314c952310a0	c8e44d71-ecbb-4a1f-86ef-5631d9a7442a	g.chr19:52132662G>A	ENST00000534261.2	-	4	1048	c.649C>T	c.(649-651)Cgc>Tgc	p.R217C	SIGLEC5_ENST00000570106.2_Missense_Mutation_p.R217C|SIGLEC5_ENST00000222107.4_Missense_Mutation_p.R217C|SIGLEC5_ENST00000599649.1_Missense_Mutation_p.R217C|SIGLEC5_ENST00000429354.3_Missense_Mutation_p.R217C			O15389	SIGL5_HUMAN	sialic acid binding Ig-like lectin 5	217	Ig-like C2-type 1.				cell adhesion (GO:0007155)	integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(3)|large_intestine(4)|lung(9)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)	27		all_neural(266;0.0726)		GBM - Glioblastoma multiforme(134;0.00124)|OV - Ovarian serous cystadenocarcinoma(262;0.0218)		GCTCCTTGGCGTTTCATCTGA	0.632																																					p.R217C		.											.	SIGLEC5-92	0			c.C649T						.						121.0	108.0	112.0					19																	52132662		2203	4300	6503	SO:0001583	missense	8778	exon3			CTTGGCGTTTCAT	U71383	CCDS33088.1	19q13.41	2013-01-29			ENSG00000105501	ENSG00000105501		"""Sialic acid binding Ig-like lectins"", ""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	10874	protein-coding gene	gene with protein product		604200		CD33L2		10343116	Standard	NM_003830		Approved	OB-BP2, SIGLEC-5, CD170	uc002pxe.4	O15389	OTTHUMG00000165510	ENST00000534261.2:c.649C>T	19.37:g.52132662G>A	ENSP00000473238:p.Arg217Cys	Somatic	684	4		WXS	Illumina GAIIx	Phase_I	685	278	NM_003830	0	0	0	0	0		Missense_Mutation	SNP	ENST00000534261.2	37	CCDS33088.1	.	.	.	.	.	.	.	.	.	.	G	14.24	2.477397	0.44044	.	.	ENSG00000105501	ENST00000222107;ENST00000429354	T;T	0.03242	4.0;4.0	3.69	-0.197	0.13228	Immunoglobulin-like (1);Immunoglobulin-like fold (1);	1.984930	0.02595	N	0.100423	T	0.02929	0.0087	N	0.03608	-0.345	0.09310	N	1	D	0.67145	0.996	P	0.48368	0.575	T	0.21999	-1.0229	10	0.72032	D	0.01	.	4.0623	0.09844	0.2385:0.2564:0.505:0.0	.	217	O15389	SIGL5_HUMAN	C	217	ENSP00000222107:R217C;ENSP00000415200:R217C	ENSP00000222107:R217C	R	-	1	0	SIGLEC5	56824474	0.000000	0.05858	0.000000	0.03702	0.008000	0.06430	-0.500000	0.06405	-0.026000	0.13895	0.491000	0.48974	CGC	.		0.632	SIGLEC5-001	PUTATIVE	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466897.2	NM_003830	
LILRA1	11024	broad.mit.edu	37	19	55106239	55106239	+	Silent	SNP	G	G	A			TCGA-OR-A5LN-01A-11D-A29I-10	TCGA-OR-A5LN-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	cf6a87e3-f084-4b4c-a978-314c952310a0	c8e44d71-ecbb-4a1f-86ef-5631d9a7442a	g.chr19:55106239G>A	ENST00000251372.3	+	4	362	c.180G>A	c.(178-180)ctG>ctA	p.L60L	LILRB1_ENST00000448689.1_Intron|LILRA1_ENST00000453777.1_Silent_p.L60L|LILRB1_ENST00000418536.2_Intron|LILRB1_ENST00000396321.2_Intron|LILRA1_ENST00000473156.1_3'UTR	NM_006863.2	NP_006854.1	O75019	LIRA1_HUMAN	leukocyte immunoglobulin-like receptor, subfamily A (with TM domain), member 1	60	Ig-like C2-type 1.				cell surface receptor signaling pathway (GO:0007166)|defense response (GO:0006952)|immune system process (GO:0002376)|regulation of immune response (GO:0050776)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	antigen binding (GO:0003823)|transmembrane signaling receptor activity (GO:0004888)	p.L60L(3)		breast(2)|central_nervous_system(1)|endometrium(1)|kidney(3)|large_intestine(5)|liver(1)|lung(23)|ovary(1)|prostate(3)|skin(6)|upper_aerodigestive_tract(1)	47				GBM - Glioblastoma multiforme(193;0.0348)		AGTACCGTCTGTATAGAGAAA	0.572																																					p.L60L		.											.	LILRA1-93	3	Substitution - coding silent(3)	kidney(3)	c.G180A						.						124.0	119.0	121.0					19																	55106239		2203	4300	6503	SO:0001819	synonymous_variant	11024	exon4			CCGTCTGTATAGA	AF025530	CCDS12901.1, CCDS62802.1	19q13.4	2013-01-11			ENSG00000104974	ENSG00000104974		"""Leukocyte immunoglobulin-like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6602	protein-coding gene	gene with protein product		604810				9548455	Standard	NM_006863		Approved	LIR-6, CD85i, LIR6	uc002qgh.2	O75019	OTTHUMG00000065701	ENST00000251372.3:c.180G>A	19.37:g.55106239G>A		Somatic	322	0		WXS	Illumina GAIIx	Phase_I	285	10	NM_006863	0	0	0	0	0	O75018|Q3MJA6	Silent	SNP	ENST00000251372.3	37	CCDS12901.1																																																																																			.		0.572	LILRA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000140807.2	NM_006863	
CMPK2	129607	hgsc.bcm.edu	37	2	7005369	7005369	+	Silent	SNP	A	A	G	rs11678810	byFrequency	TCGA-OR-A5LN-01A-11D-A29I-10	TCGA-OR-A5LN-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	cf6a87e3-f084-4b4c-a978-314c952310a0	c8e44d71-ecbb-4a1f-86ef-5631d9a7442a	g.chr2:7005369A>G	ENST00000256722.5	-	1	458	c.459T>C	c.(457-459)tgT>tgC	p.C153C	CMPK2_ENST00000458098.1_Silent_p.C153C|CMPK2_ENST00000478738.1_Intron|CMPK2_ENST00000404168.1_Silent_p.C153C	NM_207315.3	NP_997198.2	Q5EBM0	CMPK2_HUMAN	cytidine monophosphate (UMP-CMP) kinase 2, mitochondrial	153					cellular response to lipopolysaccharide (GO:0071222)|dTDP biosynthetic process (GO:0006233)|dUDP biosynthetic process (GO:0006227)|nucleoside diphosphate phosphorylation (GO:0006165)|nucleoside triphosphate biosynthetic process (GO:0009142)	mitochondrion (GO:0005739)|nucleus (GO:0005634)	ATP binding (GO:0005524)|cytidylate kinase activity (GO:0004127)|nucleoside diphosphate kinase activity (GO:0004550)|thymidylate kinase activity (GO:0004798)|UMP kinase activity (GO:0033862)			large_intestine(1)|lung(13)|prostate(1)|upper_aerodigestive_tract(1)	16	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)					GTGCCTCCTGACAGGCGCCCA	0.741													G|||	4998	0.998003	0.9924	1.0	5008	,	,		10694	1.0		1.0	False		,,,				2504	1.0				p.C153C		.											.	CMPK2-68	0			c.T459C						.	G		3605,39		1783,39,0	3.0	4.0	4.0		459	1.6	0.0	2	dbSNP_120	4	7874,0		3937,0,0	no	coding-synonymous	CMPK2	NM_207315.2		5720,39,0	GG,GA,AA		0.0,1.0703,0.3386		153/450	7005369	11479,39	1822	3937	5759	SO:0001819	synonymous_variant	129607	exon1			CTCCTGACAGGCG		CCDS42648.1, CCDS58695.1, CCDS58696.1	2p25.2	2008-01-25			ENSG00000134326	ENSG00000134326	2.7.4.14		27015	protein-coding gene	gene with protein product	"""cytidylate kinase 2"""	611787				17999954	Standard	NM_207315		Approved	TYKi, UMP-CMPK2	uc002qyo.4	Q5EBM0	OTTHUMG00000151629	ENST00000256722.5:c.459T>C	2.37:g.7005369A>G		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	7	7	NM_001256478	0	0	0	0	0	A2RUB0|A5D8T2|B7ZM18|Q6ZRU2|Q96AL8	Silent	SNP	ENST00000256722.5	37	CCDS42648.1																																																																																			A|0.003;G|0.997		0.741	CMPK2-002	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323339.2	NM_207315	
EFR3B	22979	bcgsc.ca	37	2	25354712	25354712	+	Missense_Mutation	SNP	G	G	T	rs200151921		TCGA-OR-A5LN-01A-11D-A29I-10	TCGA-OR-A5LN-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	cf6a87e3-f084-4b4c-a978-314c952310a0	c8e44d71-ecbb-4a1f-86ef-5631d9a7442a	g.chr2:25354712G>T	ENST00000403714.3	+	10	1262	c.1079G>T	c.(1078-1080)aGc>aTc	p.S360I	EFR3B_ENST00000402191.1_Missense_Mutation_p.S325I|EFR3B_ENST00000405108.1_Missense_Mutation_p.S212I|EFR3B_ENST00000401432.3_Missense_Mutation_p.S360I	NM_014971.1	NP_055786.1	Q9Y2G0	EFR3B_HUMAN	EFR3 homolog B (S. cerevisiae)	360										endometrium(1)	1						GGGGCGGTCAGCCTCGGCACC	0.682																																					p.S360I		.											.	.	0			c.G1079T						.						26.0	31.0	30.0					2																	25354712		692	1591	2283	SO:0001583	missense	22979	exon10			CGGTCAGCCTCGG	AB023170	CCDS46231.1	2p24.1	2008-02-05	2007-11-14	2007-11-14	ENSG00000084710	ENSG00000084710			29155	protein-coding gene	gene with protein product			"""KIAA0953"""	KIAA0953		10231032	Standard	NM_014971		Approved	FLJ37871	uc010eyh.3	Q9Y2G0	OTTHUMG00000151988	ENST00000403714.3:c.1079G>T	2.37:g.25354712G>T	ENSP00000384081:p.Ser360Ile	Somatic	170	3		WXS	Illumina GAIIx	Phase_I	227	18	NM_014971	0	0	0	0	0	B7WPL8|Q86XU6	Missense_Mutation	SNP	ENST00000403714.3	37	CCDS46231.1	.	.	.	.	.	.	.	.	.	.	G	15.41	2.826470	0.50739	.	.	ENSG00000084710	ENST00000401432;ENST00000403714;ENST00000402191;ENST00000545169;ENST00000405108;ENST00000264719	T;T;T;T;T	0.67698	1.43;1.43;-0.28;3.47;1.44	4.13	3.2	0.36748	Armadillo-type fold (1);	0.115789	0.64402	D	0.000009	T	0.50086	0.1595	L	0.32530	0.975	0.37953	D	0.932706	B;B	0.22414	0.028;0.069	B;B	0.21151	0.033;0.033	T	0.52975	-0.8503	10	0.39692	T	0.17	-20.5454	6.8116	0.23807	0.0986:0.1799:0.7215:0.0	.	360;360	Q9Y2G0;Q9Y2G0-3	EFR3B_HUMAN;.	I	360;360;325;325;212;239	ENSP00000386082:S360I;ENSP00000384081:S360I;ENSP00000385832:S325I;ENSP00000384454:S212I;ENSP00000264719:S239I	ENSP00000264719:S239I	S	+	2	0	EFR3B	25208216	1.000000	0.71417	0.988000	0.46212	0.836000	0.47400	1.825000	0.39081	2.143000	0.66587	0.655000	0.94253	AGC	.		0.682	EFR3B-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000324808.1	NM_014971	
ANKRD53	79998	hgsc.bcm.edu	37	2	71206267	71206267	+	Missense_Mutation	SNP	G	G	A	rs57527165	byFrequency	TCGA-OR-A5LN-01A-11D-A29I-10	TCGA-OR-A5LN-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	cf6a87e3-f084-4b4c-a978-314c952310a0	c8e44d71-ecbb-4a1f-86ef-5631d9a7442a	g.chr2:71206267G>A	ENST00000360589.3	+	2	245	c.211G>A	c.(211-213)Gcg>Acg	p.A71T	AC007040.11_ENST00000606025.1_Intron|ANKRD53_ENST00000441349.1_Intron|ANKRD53_ENST00000457410.1_Intron|ANKRD53_ENST00000272421.6_Missense_Mutation_p.A71T	NM_001115116.1	NP_001108588.1	Q8N9V6	ANR53_HUMAN	ankyrin repeat domain 53	71										endometrium(2)|large_intestine(3)|lung(4)|skin(1)|upper_aerodigestive_tract(1)	11						CAGTGCGCAGGCGACTGCCCT	0.751													G|||	672	0.134185	0.208	0.2781	5008	,	,		10821	0.0516		0.0497	False		,,,				2504	0.1043				p.A71T		.											.	ANKRD53-90	0			c.G211A						.	G	THR/ALA,THR/ALA	738,3520		65,608,1456	14.0	17.0	16.0		211,211	-1.5	0.0	2	dbSNP_129	16	406,7904		12,382,3761	no	missense,missense	ANKRD53	NM_001115116.1,NM_024933.3	58,58	77,990,5217	AA,AG,GG		4.8857,17.3321,9.1025	possibly-damaging,possibly-damaging	71/531,71/344	71206267	1144,11424	2129	4155	6284	SO:0001583	missense	79998	exon2			GCGCAGGCGACTG	BC035234	CCDS1913.1, CCDS46321.1	2p13.3	2013-01-10			ENSG00000144031	ENSG00000144031		"""Ankyrin repeat domain containing"""	25691	protein-coding gene	gene with protein product							Standard	NM_024933		Approved	FLJ12056, FLJ36160	uc002shl.4	Q8N9V6	OTTHUMG00000129712	ENST00000360589.3:c.211G>A	2.37:g.71206267G>A	ENSP00000353796:p.Ala71Thr	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	15	7	NM_001115116	0	0	0	0	0	Q8IYP8	Missense_Mutation	SNP	ENST00000360589.3	37	CCDS46321.1	259	0.11858974358974358	105	0.21341463414634146	89	0.24585635359116023	27	0.0472027972027972	38	0.05013192612137203	G	12.61	1.989396	0.35131	0.173321	0.048857	ENSG00000144031	ENST00000272421;ENST00000360589	T;T	0.64991	-0.13;-0.09	1.95	-1.51	0.08664	.	.	.	.	.	T	0.00012	0.0000	N	0.19112	0.55	0.80722	P	0.0	B;P	0.36354	0.414;0.549	B;B	0.35353	0.099;0.201	T	0.06041	-1.0849	8	0.46703	T	0.11	0.6536	5.2416	0.15475	0.0:0.3409:0.4939:0.1652	rs57527165	71;71	Q8N9V6;Q8N9V6-2	ANR53_HUMAN;.	T	71	ENSP00000272421:A71T;ENSP00000353796:A71T	ENSP00000272421:A71T	A	+	1	0	ANKRD53	71059775	0.009000	0.17119	0.000000	0.03702	0.013000	0.08279	0.505000	0.22642	-0.454000	0.07066	0.561000	0.74099	GCG	G|0.893;A|0.107		0.751	ANKRD53-004	PUTATIVE	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000330275.2	NM_024933	
MRPS5	64969	hgsc.bcm.edu	37	2	95787483	95787483	+	Silent	SNP	C	C	A	rs114292623	byFrequency	TCGA-OR-A5LN-01A-11D-A29I-10	TCGA-OR-A5LN-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	cf6a87e3-f084-4b4c-a978-314c952310a0	c8e44d71-ecbb-4a1f-86ef-5631d9a7442a	g.chr2:95787483C>A	ENST00000272418.2	-	1	262	c.54G>T	c.(52-54)acG>acT	p.T18T	MRPS5_ENST00000475040.1_Intron	NM_031902.3	NP_114108.1	P82675	RT05_HUMAN	mitochondrial ribosomal protein S5	18					translation (GO:0006412)	mitochondrion (GO:0005739)|ribosome (GO:0005840)	poly(A) RNA binding (GO:0044822)|structural constituent of ribosome (GO:0003735)			central_nervous_system(1)|kidney(2)|large_intestine(4)|lung(9)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	20						TCTCACCTGCCGTCCCGCTAC	0.751													C|||	32	0.00638978	0.0242	0.0	5008	,	,		11328	0.0		0.0	False		,,,				2504	0.0				p.T18T		.											.	MRPS5-92	0			c.G54T						.	C		58,3824		0,58,1883	4.0	5.0	5.0		54	-3.2	0.0	2	dbSNP_132	5	0,7832		0,0,3916	no	coding-synonymous	MRPS5	NM_031902.3		0,58,5799	AA,AC,CC		0.0,1.4941,0.4951		18/431	95787483	58,11656	1941	3916	5857	SO:0001819	synonymous_variant	64969	exon1			ACCTGCCGTCCCG	AB049940	CCDS2010.1	2p11.2-q11.2	2012-09-13			ENSG00000144029	ENSG00000144029		"""Mitochondrial ribosomal proteins / small subunits"""	14498	protein-coding gene	gene with protein product	"""mitochondrial 28S ribosomal protein S5"""	611972					Standard	NM_031902		Approved	MRP-S5, S5mt	uc002sub.3	P82675	OTTHUMG00000130394	ENST00000272418.2:c.54G>T	2.37:g.95787483C>A		Somatic	1	0		WXS	Illumina GAIIx	Phase_I	24	14	NM_031902	0	0	0	0	0	Q4ZFY5|Q96LJ6|Q9BWI4|Q9BYC4	Silent	SNP	ENST00000272418.2	37	CCDS2010.1																																																																																			C|0.990;A|0.010		0.751	MRPS5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252772.1	NM_031902	
SOWAHC	65124	hgsc.bcm.edu	37	2	110372192	110372192	+	Silent	SNP	A	A	G	rs6594048		TCGA-OR-A5LN-01A-11D-A29I-10	TCGA-OR-A5LN-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	cf6a87e3-f084-4b4c-a978-314c952310a0	c8e44d71-ecbb-4a1f-86ef-5631d9a7442a	g.chr2:110372192A>G	ENST00000356454.3	+	1	282	c.126A>G	c.(124-126)ctA>ctG	p.L42L	SEPT10_ENST00000334001.6_5'Flank|SEPT10_ENST00000397714.2_5'Flank|SEPT10_ENST00000415095.1_5'Flank|SEPT10_ENST00000437928.1_5'Flank|SEPT10_ENST00000356688.4_5'Flank|SEPT10_ENST00000545389.1_5'Flank|SEPT10_ENST00000397712.2_5'Flank	NM_023016.3	NP_075392.2	Q53LP3	SWAHC_HUMAN	sosondowah ankyrin repeat domain family member C	42																	GGGGCGCCCTAGGCGGCGAAC	0.771													G|||	5008	1.0	1.0	1.0	5008	,	,		6158	1.0		1.0	False		,,,				2504	1.0				p.L42L		.											.	.	0			c.A126G						.						1.0	2.0	2.0					2																	110372192		1239	2477	3716	SO:0001819	synonymous_variant	65124	exon1			CGCCCTAGGCGGC	AK023346	CCDS33270.1	2q13	2013-01-10	2012-01-12	2012-01-12	ENSG00000198142	ENSG00000198142		"""Ankyrin repeat domain containing"""	26149	protein-coding gene	gene with protein product			"""ankyrin repeat domain 57"""	C2orf26, ANKRD57		22234889	Standard	NM_023016		Approved	FLJ21870	uc002tfb.3	Q53LP3	OTTHUMG00000153219	ENST00000356454.3:c.126A>G	2.37:g.110372192A>G		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	5	5	NM_023016	0	0	0	0	0	Q8NE15|Q9H6U1	Silent	SNP	ENST00000356454.3	37	CCDS33270.1																																																																																			A|0.029;G|0.971		0.771	SOWAHC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000330168.1	NM_023016	
PIKFYVE	200576	bcgsc.ca	37	2	209212707	209212707	+	Silent	SNP	G	G	A	rs2304545	byFrequency	TCGA-OR-A5LN-01A-11D-A29I-10	TCGA-OR-A5LN-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	cf6a87e3-f084-4b4c-a978-314c952310a0	c8e44d71-ecbb-4a1f-86ef-5631d9a7442a	g.chr2:209212707G>A	ENST00000264380.4	+	35	5492	c.5334G>A	c.(5332-5334)acG>acA	p.T1778T		NM_015040.3	NP_055855.2	Q9Y2I7	FYV1_HUMAN	phosphoinositide kinase, FYVE finger containing	1778	PIPK. {ECO:0000255|PROSITE- ProRule:PRU00781}.				cellular protein metabolic process (GO:0044267)|intracellular signal transduction (GO:0035556)|myelin assembly (GO:0032288)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol phosphorylation (GO:0046854)|phosphatidylinositol-3-phosphate biosynthetic process (GO:0036092)|phospholipid metabolic process (GO:0006644)|protein localization to nucleus (GO:0034504)|retrograde transport, endosome to Golgi (GO:0042147)|small molecule metabolic process (GO:0044281)	cell-cell junction (GO:0005911)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|early endosome membrane (GO:0031901)|endosome membrane (GO:0010008)|Golgi membrane (GO:0000139)|late endosome membrane (GO:0031902)|membrane raft (GO:0045121)|perinuclear region of cytoplasm (GO:0048471)|vesicle membrane (GO:0012506)	1-phosphatidylinositol-3-phosphate 5-kinase activity (GO:0000285)|1-phosphatidylinositol-4-phosphate 5-kinase activity (GO:0016308)|ATP binding (GO:0005524)|phosphatidylinositol-3,5-bisphosphate 5-phosphatase activity (GO:0043813)|zinc ion binding (GO:0008270)			NS(1)|autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|endometrium(14)|kidney(6)|large_intestine(25)|lung(40)|ovary(7)|pancreas(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	107						TTGGGCAGACGGGCAAGGAGG	0.473													G|||	3586	0.716054	0.3041	0.8386	5008	,	,		19060	0.9117		0.8658	False		,,,				2504	0.8303				p.T1778T		.											.	PIKFYVE-583	0			c.G5334A						.	G		1656,2750	506.7+/-366.5	297,1062,844	113.0	110.0	111.0		5334	0.6	1.0	2	dbSNP_100	111	7228,1372	754.4+/-407.5	3032,1164,104	no	coding-synonymous	PIKFYVE	NM_015040.3		3329,2226,948	AA,AG,GG		15.9535,37.5851,31.6931		1778/2099	209212707	8884,4122	2203	4300	6503	SO:0001819	synonymous_variant	200576	exon35			GCAGACGGGCAAG	AB023198	CCDS2382.1, CCDS33368.1, CCDS54431.1	2q34	2014-01-15	2009-04-17	2009-04-17	ENSG00000115020	ENSG00000115020		"""Zinc fingers, FYVE domain containing"""	23785	protein-coding gene	gene with protein product	"""zinc finger, FYVE domain containing 29"""	609414	"""phosphatidylinositol-3-phosphate/phosphatidylinositol 5-kinase, type III"""	PIP5K3		9858586, 12270933	Standard	NM_015040		Approved	MGC40423, KIAA0981, PIKfyve, PIP5K, p235, ZFYVE29, FAB1	uc002vcz.3	Q9Y2I7	OTTHUMG00000132945	ENST00000264380.4:c.5334G>A	2.37:g.209212707G>A		Somatic	373	1		WXS	Illumina GAIIx	Phase_I	290	8	NM_015040	0	0	0	0	0	Q08AR7|Q08AR8|Q53ST3|Q53T36|Q8N5H0|Q8NB67	Silent	SNP	ENST00000264380.4	37	CCDS2382.1																																																																																			G|0.296;A|0.704		0.473	PIKFYVE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256477.2	NM_015040	
ERBB4	2066	bcgsc.ca	37	2	212251864	212251864	+	Silent	SNP	T	T	C	rs3748962	byFrequency	TCGA-OR-A5LN-01A-11D-A29I-10	TCGA-OR-A5LN-10A-01D-A29L-10	T	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	cf6a87e3-f084-4b4c-a978-314c952310a0	c8e44d71-ecbb-4a1f-86ef-5631d9a7442a	g.chr2:212251864T>C	ENST00000342788.4	-	27	3505	c.3195A>G	c.(3193-3195)gtA>gtG	p.V1065V	ERBB4_ENST00000436443.1_Silent_p.V1049V|ERBB4_ENST00000402597.1_Silent_p.V1055V	NM_005235.2	NP_005226.1	Q15303	ERBB4_HUMAN	v-erb-b2 avian erythroblastic leukemia viral oncogene homolog 4	1065					cardiac muscle tissue regeneration (GO:0061026)|cell fate commitment (GO:0045165)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|central nervous system morphogenesis (GO:0021551)|embryonic pattern specification (GO:0009880)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|heart development (GO:0007507)|innate immune response (GO:0045087)|lactation (GO:0007595)|mammary gland alveolus development (GO:0060749)|mammary gland epithelial cell differentiation (GO:0060644)|mitochondrial fragmentation involved in apoptotic process (GO:0043653)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|nervous system development (GO:0007399)|neural crest cell migration (GO:0001755)|neurotrophin TRK receptor signaling pathway (GO:0048011)|olfactory bulb interneuron differentiation (GO:0021889)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cardiac muscle cell proliferation (GO:0060045)|positive regulation of cell proliferation (GO:0008284)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of STAT protein import into nucleus (GO:2000366)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of tyrosine phosphorylation of Stat5 protein (GO:0042523)|protein autophosphorylation (GO:0046777)|regulation of cell migration (GO:0030334)|signal transduction (GO:0007165)|transcription, DNA-templated (GO:0006351)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	basolateral plasma membrane (GO:0016323)|cytosol (GO:0005829)|extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|epidermal growth factor receptor binding (GO:0005154)|protein homodimerization activity (GO:0042803)|protein tyrosine kinase activity (GO:0004713)|receptor signaling protein tyrosine kinase activity (GO:0004716)|transcription regulatory region DNA binding (GO:0044212)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)			NS(1)|breast(7)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(31)|lung(71)|pancreas(1)|prostate(3)|skin(39)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	179		Renal(323;0.06)|Lung NSC(271;0.197)		UCEC - Uterine corpus endometrioid carcinoma (47;0.214)|Epithelial(149;5.86e-06)|all cancers(144;2.95e-05)|Lung(261;0.00244)|LUSC - Lung squamous cell carcinoma(224;0.00266)	Afatinib(DB08916)	CATCTCGGTATACAAACTGGT	0.433										TSP Lung(8;0.080)			T|||	1117	0.223043	0.0756	0.2983	5008	,	,		18765	0.2887		0.2992	False		,,,				2504	0.2229				p.V1065V		.											.	ERBB4-1461	0			c.A3195G						.	T	,	444,3962	214.5+/-233.7	29,386,1788	110.0	113.0	112.0		3147,3195	-8.9	0.3	2	dbSNP_107	112	2843,5757	447.9+/-361.7	499,1845,1956	no	coding-synonymous,coding-synonymous	ERBB4	NM_001042599.1,NM_005235.2	,	528,2231,3744	CC,CT,TT		33.0581,10.0772,25.273	,	1049/1293,1065/1309	212251864	3287,9719	2203	4300	6503	SO:0001819	synonymous_variant	2066	exon27			TCGGTATACAAAC	L07868	CCDS2394.1, CCDS42811.1	2q33.3-q34	2013-10-11	2013-07-09		ENSG00000178568	ENSG00000178568			3432	protein-coding gene	gene with protein product		600543	"""v-erb-a avian erythroblastic leukemia viral oncogene homolog-like 4"""			7700649, 17018285	Standard	NM_001042599		Approved	ALS19	uc002veg.1	Q15303	OTTHUMG00000133012	ENST00000342788.4:c.3195A>G	2.37:g.212251864T>C		Somatic	200	1		WXS	Illumina GAIIx	Phase_I	117	6	NM_005235	0	0	0	0	0	B7ZLD7|B7ZLE2|B7ZLE3|Q2M1W1|Q59EW4	Silent	SNP	ENST00000342788.4	37	CCDS2394.1																																																																																			T|0.756;C|0.244		0.433	ERBB4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000256597.1	NM_001042599	
TRIP12	9320	bcgsc.ca	37	2	230668858	230668858	+	Silent	SNP	T	T	C	rs13018957	byFrequency	TCGA-OR-A5LN-01A-11D-A29I-10	TCGA-OR-A5LN-10A-01D-A29L-10	T	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	cf6a87e3-f084-4b4c-a978-314c952310a0	c8e44d71-ecbb-4a1f-86ef-5631d9a7442a	g.chr2:230668858T>C	ENST00000283943.5	-	18	2689	c.2511A>G	c.(2509-2511)acA>acG	p.T837T	TRIP12_ENST00000543084.1_Intron|TRIP12_ENST00000389045.3_Silent_p.T567T|TRIP12_ENST00000389044.4_Silent_p.T885T	NM_001284214.1|NM_004238.1	NP_001271143.1|NP_004229.1	Q14669	TRIPC_HUMAN	thyroid hormone receptor interactor 12	837					cellular response to DNA damage stimulus (GO:0006974)|DNA repair (GO:0006281)|embryo development (GO:0009790)|negative regulation of double-strand break repair (GO:2000780)|negative regulation of histone H2A K63-linked ubiquitination (GO:1901315)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ligase activity (GO:0016874)|thyroid hormone receptor binding (GO:0046966)|ubiquitin-protein transferase activity (GO:0004842)	p.T837T(1)		breast(2)|central_nervous_system(4)|cervix(1)|endometrium(5)|kidney(6)|large_intestine(19)|lung(32)|ovary(5)|prostate(4)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	87		Renal(207;0.025)|all_hematologic(139;0.122)|all_lung(227;0.126)|Acute lymphoblastic leukemia(138;0.164)		Epithelial(121;4.76e-13)|all cancers(144;4.34e-10)|LUSC - Lung squamous cell carcinoma(224;0.00864)|Lung(119;0.0116)		CACCAAATAATGTCTTAATAA	0.383													T|||	1757	0.350839	0.1589	0.438	5008	,	,		16773	0.3581		0.5089	False		,,,				2504	0.3783				p.T837T		.											.	TRIP12-572	1	Substitution - coding silent(1)	stomach(1)	c.A2511G						.	T		940,3466	353.1+/-312.0	109,722,1372	84.0	90.0	88.0		2511	-6.9	0.6	2	dbSNP_121	88	4135,4465	563.9+/-388.2	999,2137,1164	no	coding-synonymous	TRIP12	NM_004238.1		1108,2859,2536	CC,CT,TT		48.0814,21.3345,39.0205		837/1993	230668858	5075,7931	2203	4300	6503	SO:0001819	synonymous_variant	9320	exon18			AAATAATGTCTTA	L40383	CCDS33391.1, CCDS63145.1, CCDS63146.1	2q36.3	2008-05-27			ENSG00000153827	ENSG00000153827			12306	protein-coding gene	gene with protein product		604506				7776974	Standard	XM_005246961		Approved	KIAA0045	uc002vpw.1	Q14669	OTTHUMG00000153623	ENST00000283943.5:c.2511A>G	2.37:g.230668858T>C		Somatic	213	1		WXS	Illumina GAIIx	Phase_I	138	6	NM_004238	0	0	2	2	0	D4HL82|Q14CA3|Q14CF1|Q15644|Q53R87|Q53TE7	Silent	SNP	ENST00000283943.5	37	CCDS33391.1																																																																																			T|0.611;C|0.389		0.383	TRIP12-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000331861.3	NM_004238	
ALPPL2	251	hgsc.bcm.edu	37	2	233274475	233274475	+	Missense_Mutation	SNP	C	C	A	rs56080708	byFrequency	TCGA-OR-A5LN-01A-11D-A29I-10	TCGA-OR-A5LN-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	cf6a87e3-f084-4b4c-a978-314c952310a0	c8e44d71-ecbb-4a1f-86ef-5631d9a7442a	g.chr2:233274475C>A	ENST00000295453.3	+	11	1544	c.1492C>A	c.(1492-1494)Cgc>Agc	p.R498S		NM_031313.2	NP_112603.2	P10696	PPBN_HUMAN	alkaline phosphatase, placental-like 2	498				R -> P (in Ref. 1; AAA98616 and 4; CAA39425). {ECO:0000305}.|R -> S (in Ref. 3; CAA37374). {ECO:0000305}.	dephosphorylation (GO:0016311)	anchored component of membrane (GO:0031225)|plasma membrane (GO:0005886)	alkaline phosphatase activity (GO:0004035)|metal ion binding (GO:0046872)			breast(2)|kidney(1)|large_intestine(1)|liver(2)|lung(6)|skin(1)	13		all_hematologic(139;0.00793)|Renal(207;0.0112)|Acute lymphoblastic leukemia(138;0.0182)|all_lung(227;0.0449)|Lung NSC(271;0.132)		Epithelial(121;4.45e-22)|Kidney(3;4.42e-11)|KIRC - Kidney renal clear cell carcinoma(3;1.9e-09)|BRCA - Breast invasive adenocarcinoma(100;0.000767)|Lung(119;0.00566)|LUSC - Lung squamous cell carcinoma(224;0.00746)|STAD - Stomach adenocarcinoma(3;0.0181)|GBM - Glioblastoma multiforme(43;0.196)	Amifostine(DB01143)	CCTGGCGCCCCGCGCCGGCAC	0.731													c|||	477	0.0952476	0.0514	0.062	5008	,	,		10169	0.2133		0.0785	False		,,,				2504	0.0736				p.R498S		.											.	ALPPL2-91	0			c.C1492A						.	C	SER/ARG	328,4022		17,294,1864	12.0	16.0	15.0		1492	1.2	0.0	2	dbSNP_129	15	716,7764		55,606,3579	no	missense	ALPPL2	NM_031313.2	110	72,900,5443	AA,AC,CC		8.4434,7.5402,8.1372	benign	498/533	233274475	1044,11786	2175	4240	6415	SO:0001583	missense	251	exon11			GCGCCCCGCGCCG	J04948	CCDS2491.1	2q37	2008-05-20			ENSG00000163286	ENSG00000163286			441	protein-coding gene	gene with protein product		171810					Standard	NM_031313		Approved		uc002vss.4	P10696	OTTHUMG00000133257	ENST00000295453.3:c.1492C>A	2.37:g.233274475C>A	ENSP00000295453:p.Arg498Ser	Somatic	1	0		WXS	Illumina GAIIx	Phase_I	14	9	NM_031313	0	0	0	0	0	A8KAF2|Q16727|Q53S81|Q96CM1	Missense_Mutation	SNP	ENST00000295453.3	37	CCDS2491.1	231	0.10576923076923077	28	0.056910569105691054	21	0.058011049723756904	120	0.2097902097902098	62	0.08179419525065963	c	0.762	-0.768825	0.02974	0.075402	0.084434	ENSG00000163286	ENST00000295453	D	0.95412	-3.7	2.17	1.24	0.21308	Alkaline-phosphatase-like, core domain (1);	0.504996	0.18426	N	0.141584	T	0.00271	0.0008	N	0.08118	0	0.80722	P	0.0	B	0.06786	0.001	B	0.06405	0.002	T	0.42327	-0.9458	9	0.06236	T	0.91	.	4.2075	0.10495	0.3616:0.5075:0.0:0.1308	rs56080708;rs61730276	498	P10696	PPBN_HUMAN	S	498	ENSP00000295453:R498S	ENSP00000295453:R498S	R	+	1	0	ALPPL2	232982719	0.000000	0.05858	0.020000	0.16555	0.076000	0.17211	-0.511000	0.06321	0.233000	0.21120	0.205000	0.17691	CGC	C|0.901;A|0.099		0.731	ALPPL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257034.2	NM_031313	
ANO7	50636	hgsc.bcm.edu	37	2	242157776	242157776	+	Silent	SNP	C	C	G	rs201381970	byFrequency	TCGA-OR-A5LN-01A-11D-A29I-10	TCGA-OR-A5LN-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	cf6a87e3-f084-4b4c-a978-314c952310a0	c8e44d71-ecbb-4a1f-86ef-5631d9a7442a	g.chr2:242157776C>G	ENST00000274979.8	+	21	2566	c.2463C>G	c.(2461-2463)gcC>gcG	p.A821A	ANO7_ENST00000402430.3_Silent_p.A820A	NM_001001891.3	NP_001001891.2	Q6IWH7	ANO7_HUMAN	anoctamin 7	821					calcium activated galactosylceramide scrambling (GO:0061591)|calcium activated phosphatidylcholine scrambling (GO:0061590)|calcium activated phosphatidylserine scrambling (GO:0061589)|chloride transport (GO:0006821)|ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	cell junction (GO:0030054)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|intracellular (GO:0005622)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	intracellular calcium activated chloride channel activity (GO:0005229)|phospholipid scramblase activity (GO:0017128)			NS(1)|central_nervous_system(1)|endometrium(3)|large_intestine(5)|lung(14)|pancreas(2)|prostate(1)|skin(3)|urinary_tract(2)	32						CCTTCGCCGCCGCGCACAACC	0.766													C|||	157	0.0313498	0.1006	0.0202	5008	,	,		3288	0.001		0.007	False		,,,				2504	0.002				p.A821A		.											.	ANO7-92	0			c.C2463G						.	C		287,3801		11,265,1768	4.0	5.0	5.0		2463	-5.2	0.1	2		5	76,8050		0,76,3987	no	coding-synonymous	ANO7	NM_001001891.3		11,341,5755	GG,GC,CC		0.9353,7.0205,2.972		821/934	242157776	363,11851	2044	4063	6107	SO:0001819	synonymous_variant	50636	exon21			CGCCGCCGCGCAC	AY617079	CCDS33423.1, CCDS46563.1	2q37.3	2014-04-09	2008-08-28	2008-08-28	ENSG00000146205	ENSG00000146205		"""Ion channels / Chloride channels : Calcium activated : Anoctamins"""	31677	protein-coding gene	gene with protein product		605096	"""transmembrane protein 16G"""	PCANAP5, TMEM16G		14981236, 15375614, 24692353	Standard	NM_001001891		Approved	NGEP, PCANAP5L, IPCA-5	uc002wax.2	Q6IWH7	OTTHUMG00000151702	ENST00000274979.8:c.2463C>G	2.37:g.242157776C>G		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	19	7	NM_001001891	0	0	0	0	0	Q6IWH6	Silent	SNP	ENST00000274979.8	37	CCDS33423.1	65	0.02976190476190476	49	0.09959349593495935	7	0.019337016574585635	1	0.0017482517482517483	8	0.010554089709762533	C	0.809	-0.752645	0.03041	0.070205	0.009353	ENSG00000146205	ENST00000451047	.	.	.	2.62	-5.23	0.02798	.	.	.	.	.	T	0.00724	0.0024	.	.	.	0.20563	N	0.999884	.	.	.	.	.	.	T	0.05733	-1.0867	4	.	.	.	.	7.9967	0.30271	0.3001:0.39:0.31:0.0	.	.	.	.	G	134	.	.	R	+	1	0	ANO7	241806449	0.000000	0.05858	0.056000	0.19401	0.010000	0.07245	-3.568000	0.00428	-3.809000	0.00104	-2.270000	0.00275	CGC	C|0.970;G|0.030		0.766	ANO7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323509.1	NM_001001891	
TCF15	6939	hgsc.bcm.edu	37	20	590456	590456	+	Silent	SNP	A	A	G	rs282164	byFrequency	TCGA-OR-A5LN-01A-11D-A29I-10	TCGA-OR-A5LN-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	cf6a87e3-f084-4b4c-a978-314c952310a0	c8e44d71-ecbb-4a1f-86ef-5631d9a7442a	g.chr20:590456A>G	ENST00000246080.3	-	1	586	c.426T>C	c.(424-426)cgT>cgC	p.R142R		NM_004609.3	NP_004600.2	Q12870	TCF15_HUMAN	transcription factor 15 (basic helix-loop-helix)	142					death (GO:0016265)|ear development (GO:0043583)|eating behavior (GO:0042755)|establishment of epithelial cell apical/basal polarity (GO:0045198)|mesenchymal to epithelial transition (GO:0060231)|mesoderm development (GO:0007498)|muscle organ morphogenesis (GO:0048644)|neuromuscular process controlling posture (GO:0050884)|paraxial mesoderm development (GO:0048339)|post-anal tail morphogenesis (GO:0036342)|regulation of gene expression involved in extracellular matrix organization (GO:1901311)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|respiratory system process (GO:0003016)|skeletal system morphogenesis (GO:0048705)|skin development (GO:0043588)|somitogenesis (GO:0001756)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			autonomic_ganglia(1)|lung(2)|prostate(1)	4		Breast(17;0.231)				TGCCCGCGGCACGGAAGCACG	0.736													g|||	4317	0.862021	0.7413	0.9035	5008	,	,		6474	0.998		0.8072	False		,,,				2504	0.9121				p.R142R		.											.	TCF15-90	0			c.T426C						.			3211,1033		1232,747,143	7.0	8.0	8.0		426	-9.0	0.0	20	dbSNP_79	8	6663,1669		2708,1247,211	no	coding-synonymous	TCF15	NM_004609.3		3940,1994,354	GG,GA,AA		20.0312,24.3402,21.4854		142/200	590456	9874,2702	2122	4166	6288	SO:0001819	synonymous_variant	6939	exon1			CGCGGCACGGAAG		CCDS33432.1	20p13	2013-05-21			ENSG00000125878	ENSG00000125878		"""Basic helix-loop-helix proteins"""	11627	protein-coding gene	gene with protein product		601010				8825648, 8041747	Standard	NM_004609		Approved	EC2, PARAXIS, bHLHa40	uc002wdz.3	Q12870	OTTHUMG00000031640	ENST00000246080.3:c.426T>C	20.37:g.590456A>G		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	8	8	NM_004609	0	0	0	0	0	Q9NQQ1	Silent	SNP	ENST00000246080.3	37	CCDS33432.1																																																																																			A|0.165;G|0.835		0.736	TCF15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077475.2	NM_004609	
CST3	1471	hgsc.bcm.edu	37	20	23618488	23618488	+	Silent	SNP	G	G	A	rs1055084	byFrequency	TCGA-OR-A5LN-01A-11D-A29I-10	TCGA-OR-A5LN-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	cf6a87e3-f084-4b4c-a978-314c952310a0	c8e44d71-ecbb-4a1f-86ef-5631d9a7442a	g.chr20:23618488G>A	ENST00000398411.1	-	1	94	c.12C>T	c.(10-12)ccC>ccT	p.P4P	CST3_ENST00000398409.1_Silent_p.P4P|CST3_ENST00000376925.3_Silent_p.P4P			P01034	CYTC_HUMAN	cystatin C	4					apoptotic process (GO:0006915)|brain development (GO:0007420)|cell activation (GO:0001775)|cellular response to hydrogen peroxide (GO:0070301)|circadian sleep/wake cycle, REM sleep (GO:0042747)|defense response (GO:0006952)|embryo implantation (GO:0007566)|extracellular fibril organization (GO:0043206)|eye development (GO:0001654)|negative regulation of blood vessel remodeling (GO:0060313)|negative regulation of cell death (GO:0060548)|negative regulation of collagen catabolic process (GO:0010711)|negative regulation of elastin catabolic process (GO:0060311)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of extracellular matrix disassembly (GO:0010716)|negative regulation of peptidase activity (GO:0010466)|negative regulation of proteolysis (GO:0045861)|positive regulation of cell proliferation (GO:0008284)|positive regulation of DNA replication (GO:0045740)|regulation of programmed cell death (GO:0043067)|regulation of tissue remodeling (GO:0034103)|response to axon injury (GO:0048678)|response to carbohydrate (GO:0009743)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|response to hypoxia (GO:0001666)|response to nutrient levels (GO:0031667)|response to toxic substance (GO:0009636)|salivary gland development (GO:0007431)|Sertoli cell development (GO:0060009)	basement membrane (GO:0005604)|cell projection (GO:0042995)|contractile fiber (GO:0043292)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|lysosome (GO:0005764)|multivesicular body (GO:0005771)|neuronal cell body (GO:0043025)|nuclear membrane (GO:0031965)|perinuclear region of cytoplasm (GO:0048471)	beta-amyloid binding (GO:0001540)|cysteine-type endopeptidase inhibitor activity (GO:0004869)|endopeptidase inhibitor activity (GO:0004866)|protease binding (GO:0002020)			large_intestine(2)|lung(1)|ovary(1)	4	Lung NSC(19;0.0789)|Colorectal(13;0.0993)|all_lung(19;0.169)					GGGCGCGCAGGGGCCCGGCCA	0.756													g|||	114	0.0227636	0.0015	0.0476	5008	,	,		7697	0.0		0.0696	False		,,,				2504	0.0092				p.P4P		.											.	CST3-91	0			c.C12T						.			35,2527		0,35,1246	2.0	2.0	2.0		12	-3.0	0.0	20	dbSNP_86	2	290,4772		2,286,2243	no	coding-synonymous	CST3	NM_000099.2		2,321,3489	AA,AG,GG		5.729,1.3661,4.2629		4/147	23618488	325,7299	1281	2531	3812	SO:0001819	synonymous_variant	1471	exon1			GCGCAGGGGCCCG		CCDS13158.1	20p11.2	2008-04-15	2008-04-15		ENSG00000101439	ENSG00000101439			2475	protein-coding gene	gene with protein product		604312	"""cystatin C (amyloid angiopathy and cerebral hemorrhage)"""			8486384	Standard	NM_000099		Approved		uc002wtn.1	P01034	OTTHUMG00000032080	ENST00000398411.1:c.12C>T	20.37:g.23618488G>A		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	6	4	NM_000099	0	0	48	119	71	B2R5J9|D3DW42|Q6FGW9	Silent	SNP	ENST00000398411.1	37	CCDS13158.1																																																																																			T|0.037;C|0.962		0.756	CST3-002	KNOWN	alternative_3_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256831.1	NM_000099	
FRG1B	284802	bcgsc.ca	37	20	29628229	29628229	+	Silent	SNP	G	G	T	rs373737774		TCGA-OR-A5LN-01A-11D-A29I-10	TCGA-OR-A5LN-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	cf6a87e3-f084-4b4c-a978-314c952310a0	c8e44d71-ecbb-4a1f-86ef-5631d9a7442a	g.chr20:29628229G>T	ENST00000278882.3	+	6	611	c.231G>T	c.(229-231)ggG>ggT	p.G77G	FRG1B_ENST00000358464.4_Silent_p.G77G|FRG1B_ENST00000439954.2_Silent_p.G82G			Q9BZ01	FRG1B_HUMAN	FSHD region gene 1 family, member B	77										endometrium(10)|kidney(21)|lung(3)|pancreas(1)|prostate(9)|urinary_tract(9)	53						TCACTTAGGGGAAAATGGCTT	0.353																																					.		.											.	FRG1B-22	0			.						.																																			SO:0001819	synonymous_variant	284802	.			TTAGGGGAAAATG			20q11.1	2013-03-18	2007-10-11	2007-10-11	ENSG00000149531	ENSG00000149531			15792	other	unknown			"""chromosome 20 open reading frame 80"""	C20orf80			Standard	NR_003579		Approved	bA348I14.2	uc010ztl.1	Q9BZ01	OTTHUMG00000032157	ENST00000278882.3:c.231G>T	20.37:g.29628229G>T		Somatic	1194	23		WXS	Illumina GAIIx	Phase_I	966	59	.	0	0	0	0	0	C4AME5	RNA	SNP	ENST00000278882.3	37																																																																																				.		0.353	FRG1B-001	KNOWN	not_best_in_genome_evidence|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000078494.2	NR_003579	
FRG1B	284802	bcgsc.ca	37	20	29628299	29628299	+	Missense_Mutation	SNP	A	A	G			TCGA-OR-A5LN-01A-11D-A29I-10	TCGA-OR-A5LN-10A-01D-A29L-10	A	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	cf6a87e3-f084-4b4c-a978-314c952310a0	c8e44d71-ecbb-4a1f-86ef-5631d9a7442a	g.chr20:29628299A>G	ENST00000278882.3	+	6	681	c.301A>G	c.(301-303)Agt>Ggt	p.S101G	FRG1B_ENST00000358464.4_Missense_Mutation_p.S101G|FRG1B_ENST00000439954.2_Missense_Mutation_p.S106G			Q9BZ01	FRG1B_HUMAN	FSHD region gene 1 family, member B	101										endometrium(10)|kidney(21)|lung(3)|pancreas(1)|prostate(9)|urinary_tract(9)	53						AGAAGCAAAAAGTAAAACAGC	0.363																																					.		.											.	FRG1B-22	0			.						.																																			SO:0001583	missense	284802	.			GCAAAAAGTAAAA			20q11.1	2013-03-18	2007-10-11	2007-10-11	ENSG00000149531	ENSG00000149531			15792	other	unknown			"""chromosome 20 open reading frame 80"""	C20orf80			Standard	NR_003579		Approved	bA348I14.2	uc010ztl.1	Q9BZ01	OTTHUMG00000032157	ENST00000278882.3:c.301A>G	20.37:g.29628299A>G	ENSP00000278882:p.Ser101Gly	Somatic	696	16		WXS	Illumina GAIIx	Phase_I	577	37	.	0	0	70	70	0	C4AME5	RNA	SNP	ENST00000278882.3	37		.	.	.	.	.	.	.	.	.	.	a	16.61	3.170807	0.57584	.	.	ENSG00000149531	ENST00000278882;ENST00000439954;ENST00000358464	T	0.50001	0.76	2.08	2.08	0.27032	Actin cross-linking (1);	0.125588	0.64402	D	0.000001	T	0.38719	0.1051	.	.	.	0.42178	D	0.991671	B;P	0.36483	0.147;0.555	B;B	0.37731	0.138;0.257	T	0.38178	-0.9673	9	0.62326	D	0.03	.	8.0833	0.30758	1.0:0.0:0.0:0.0	.	106;101	F5H5R5;Q9BZ01	.;FRG1B_HUMAN	G	101;106;101	ENSP00000408863:S106G	ENSP00000278882:S101G	S	+	1	0	FRG1B	28241960	1.000000	0.71417	1.000000	0.80357	0.947000	0.59692	8.085000	0.89518	1.208000	0.43306	0.347000	0.21830	AGT	.		0.363	FRG1B-001	KNOWN	not_best_in_genome_evidence|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000078494.2	NR_003579	
SOGA1	140710	broad.mit.edu	37	20	35414904	35414904	+	Missense_Mutation	SNP	A	A	G			TCGA-OR-A5LN-01A-11D-A29I-10	TCGA-OR-A5LN-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	cf6a87e3-f084-4b4c-a978-314c952310a0	c8e44d71-ecbb-4a1f-86ef-5631d9a7442a	g.chr20:35414904A>G	ENST00000357779.3	-	15	4582	c.4256T>C	c.(4255-4257)cTc>cCc	p.L1419P	SOGA1_ENST00000279034.6_Intron|SOGA1_ENST00000237536.4_Missense_Mutation_p.L1657P|SOGA1_ENST00000456801.2_Missense_Mutation_p.L1260P			O94964	SOGA1_HUMAN	suppressor of glucose, autophagy associated 1	1419					insulin receptor signaling pathway (GO:0008286)|negative regulation of gluconeogenesis (GO:0045721)|regulation of autophagy (GO:0010506)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)				endometrium(5)|kidney(1)|lung(21)|urinary_tract(1)	28						GCTGGGGGGGAGTGCCCTCTC	0.657																																					p.L1657P		.											.	.	0			c.T4970C						.						37.0	42.0	41.0					20																	35414904		692	1591	2283	SO:0001583	missense	140710	exon15			GGGGGGAGTGCCC	AK126630	CCDS46598.1, CCDS54459.1	20q11.23	2012-03-01	2012-02-27	2012-02-27	ENSG00000149639	ENSG00000149639			16111	protein-coding gene	gene with protein product	"""suppressor of glucose by autophagy"", ""suppressor of glucose from autophagy"""		"""chromosome 20 open reading frame 117"", ""KIAA0889"""	C20orf117, KIAA0889		20813965	Standard	NM_080627		Approved	dJ132F21.1, FLJ44670, SOGA	uc021wcx.1	O94964	OTTHUMG00000032395	ENST00000357779.3:c.4256T>C	20.37:g.35414904A>G	ENSP00000350424:p.Leu1419Pro	Somatic	52	6		WXS	Illumina GAIIx	Phase_I	73	9	NM_080627	0	0	0	0	0	A6NK10|Q14DB2|Q5JW51|Q6ZTG8	Missense_Mutation	SNP	ENST00000357779.3	37		.	.	.	.	.	.	.	.	.	.	A	7.734	0.699775	0.15106	.	.	ENSG00000149639	ENST00000237536;ENST00000456801;ENST00000357779	T;T;T	0.18657	2.2;2.21;2.21	4.72	-1.14	0.09741	.	1.008940	0.07937	N	0.978596	T	0.10035	0.0246	N	0.08118	0	0.09310	N	0.999994	.	.	.	.	.	.	T	0.33904	-0.9850	8	0.48119	T	0.1	-0.4527	4.4522	0.11626	0.3714:0.1585:0.4701:0.0	.	.	.	.	P	1657;1260;1419	ENSP00000237536:L1657P;ENSP00000413886:L1260P;ENSP00000350424:L1419P	ENSP00000237536:L1657P	L	-	2	0	KIAA0889	34848318	0.051000	0.20477	0.001000	0.08648	0.465000	0.32709	0.325000	0.19628	-0.179000	0.10654	-0.624000	0.04008	CTC	.		0.657	SOGA1-201	KNOWN	basic	protein_coding	protein_coding		NM_199181	
DNTTIP1	116092	hgsc.bcm.edu	37	20	44420682	44420682	+	Silent	SNP	T	T	C	rs2664591	byFrequency	TCGA-OR-A5LN-01A-11D-A29I-10	TCGA-OR-A5LN-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	cf6a87e3-f084-4b4c-a978-314c952310a0	c8e44d71-ecbb-4a1f-86ef-5631d9a7442a	g.chr20:44420682T>C	ENST00000372622.3	+	1	107	c.39T>C	c.(37-39)ccT>ccC	p.P13P	WFDC3_ENST00000372630.2_5'Flank|WFDC3_ENST00000372632.2_5'Flank|WFDC3_ENST00000243938.4_5'Flank|WFDC3_ENST00000481847.1_5'Flank	NM_052951.2	NP_443183.1	Q9H147	TDIF1_HUMAN	deoxynucleotidyltransferase, terminal, interacting protein 1	13						nucleolus (GO:0005730)|nucleus (GO:0005634)				breast(1)|central_nervous_system(1)|kidney(1)|large_intestine(2)|lung(1)|ovary(2)|prostate(1)	9		Myeloproliferative disorder(115;0.0122)				CGCGGGGACCTAGCGGGGCCG	0.746													C|||	3358	0.670527	0.6952	0.7968	5008	,	,		12080	0.6458		0.7058	False		,,,				2504	0.5368				p.P13P		.											.	DNTTIP1-91	0			c.T39C						.	C		2483,791		949,585,103	4.0	6.0	5.0		39	1.1	0.9	20	dbSNP_100	5	5222,1736		1983,1256,240	no	coding-synonymous	DNTTIP1	NM_052951.2		2932,1841,343	CC,CT,TT		24.9497,24.16,24.697		13/330	44420682	7705,2527	1637	3479	5116	SO:0001819	synonymous_variant	116092	exon1			GGGACCTAGCGGG	AB035676	CCDS13369.1	20q13.12	2003-09-10	2003-09-10	2003-09-12	ENSG00000101457	ENSG00000101457			16160	protein-coding gene	gene with protein product	"""novel protein similar to synaptotagmin 1 (SYT1, P65) (isoform 1)"", ""TdT binding protein"""	611388	"""chromosome 20 open reading frame 167"""	C20orf167		11473582	Standard	NM_052951		Approved	dJ447F3.4, Tdif1	uc002xpk.3	Q9H147	OTTHUMG00000032610	ENST00000372622.3:c.39T>C	20.37:g.44420682T>C		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	4	4	NM_052951	0	0	0	0	0	B2RA18|Q96DE3|Q9BQP2|Q9H148	Silent	SNP	ENST00000372622.3	37	CCDS13369.1																																																																																			T|0.311;C|0.689		0.746	DNTTIP1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079502.1	NM_052951	
NCOA3	8202	hgsc.bcm.edu	37	20	46279863	46279863	+	Silent	SNP	G	G	A	rs578139784|rs112826888|rs573532891	byFrequency	TCGA-OR-A5LN-01A-11D-A29I-10	TCGA-OR-A5LN-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	cf6a87e3-f084-4b4c-a978-314c952310a0	c8e44d71-ecbb-4a1f-86ef-5631d9a7442a	g.chr20:46279863G>A	ENST00000371998.3	+	20	3980	c.3789G>A	c.(3787-3789)caG>caA	p.Q1263Q	NCOA3_ENST00000371997.3_Silent_p.Q1254Q|NCOA3_ENST00000341724.6_Silent_p.Q1189Q|NCOA3_ENST00000372004.3_Silent_p.Q1259Q			Q9Y6Q9	NCOA3_HUMAN	nuclear receptor coactivator 3	1263	Acetyltransferase.|Poly-Gln.				androgen receptor signaling pathway (GO:0030521)|developmental growth (GO:0048589)|histone acetylation (GO:0016573)|labyrinthine layer morphogenesis (GO:0060713)|mammary gland branching involved in thelarche (GO:0060744)|multicellular organism growth (GO:0035264)|positive regulation of gene expression (GO:0010628)|positive regulation of keratinocyte differentiation (GO:0045618)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|receptor transactivation (GO:0035624)|regulation of RNA biosynthetic process (GO:2001141)|transcription, DNA-templated (GO:0006351)|vagina development (GO:0060068)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	androgen receptor binding (GO:0050681)|chromatin binding (GO:0003682)|histone acetyltransferase activity (GO:0004402)|ligand-dependent nuclear receptor binding (GO:0016922)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|nuclear hormone receptor binding (GO:0035257)|protein N-terminus binding (GO:0047485)|signal transducer activity (GO:0004871)|thyroid hormone receptor binding (GO:0046966)|transcription coactivator activity (GO:0003713)			breast(3)|endometrium(3)|kidney(4)|large_intestine(12)|lung(19)|ovary(4)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	52						agcagcagcagcaacagcaac	0.567													G|||	14	0.00279553	0.0076	0.0014	5008	,	,		14322	0.003		0.0	False		,,,				2504	0.0				p.Q1263Q		.											.	NCOA3-229	0			c.G3789A						.						58.0	62.0	60.0					20																	46279863		2203	4300	6503	SO:0001819	synonymous_variant	8202	exon20			GCAGCAGCAACAG	AF012108	CCDS13406.1, CCDS13407.1, CCDS54472.1	20q12	2011-07-01			ENSG00000124151	ENSG00000124151		"""Chromatin-modifying enzymes / K-acetyltransferases"", ""Basic helix-loop-helix proteins"""	7670	protein-coding gene	gene with protein product	"""receptor-associated coactivator 3"", ""thyroid hormone receptor activator molecule 1"""	601937				9252329, 9346901	Standard	NM_181659		Approved	RAC3, AIB1, ACTR, p/CIP, TRAM-1, CAGH16, TNRC16, KAT13B, bHLHe42, SRC-3, SRC3	uc002xtk.3	Q9Y6Q9	OTTHUMG00000033061	ENST00000371998.3:c.3789G>A	20.37:g.46279863G>A		Somatic	148	0		WXS	Illumina GAIIx	Phase_I	154	8	NM_181659	0	0	4	4	0	A4LAZ5|Q0VF45|Q5JYD9|Q5JYE0|Q9BR49|Q9UPC9|Q9UPG4|Q9UPG7	Silent	SNP	ENST00000371998.3	37	CCDS13407.1																																																																																			G|0.993;A|0.007		0.567	NCOA3-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000080405.1	NM_006534	
GATA5	140628	hgsc.bcm.edu	37	20	61050495	61050495	+	Missense_Mutation	SNP	G	G	A	rs112701160	byFrequency	TCGA-OR-A5LN-01A-11D-A29I-10	TCGA-OR-A5LN-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	cf6a87e3-f084-4b4c-a978-314c952310a0	c8e44d71-ecbb-4a1f-86ef-5631d9a7442a	g.chr20:61050495G>A	ENST00000252997.2	-	2	144	c.83C>T	c.(82-84)gCc>gTc	p.A28V	RP13-379O24.3_ENST00000606283.1_lincRNA	NM_080473.4	NP_536721.1	Q9BWX5	GATA5_HUMAN	GATA binding protein 5	28					blood coagulation (GO:0007596)|cellular response to BMP stimulus (GO:0071773)|intestinal epithelial cell differentiation (GO:0060575)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	enhancer sequence-specific DNA binding (GO:0001158)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)			kidney(1)|lung(3)|ovary(1)|stomach(1)	6	Breast(26;2.05e-08)		BRCA - Breast invasive adenocarcinoma(19;3.08e-06)			CGGAGAGCCGGCGCCCGGAGC	0.741													G|||	3	0.000599042	0.0023	0.0	5008	,	,		9174	0.0		0.0	False		,,,				2504	0.0				p.A28V		.											.	GATA5-90	0			c.C83T						.						2.0	3.0	3.0					20																	61050495		1335	3007	4342	SO:0001583	missense	140628	exon2			GAGCCGGCGCCCG	BC047790, BC117356	CCDS13499.1	20q13.33	2013-07-17	2001-11-28		ENSG00000130700	ENSG00000130700		"""GATA zinc finger domain containing"""	15802	protein-coding gene	gene with protein product		611496	"""GATA-binding protein 5"""			9566909	Standard	NM_080473		Approved	bB379O24.1, GATAS	uc002ycx.1	Q9BWX5	OTTHUMG00000032919	ENST00000252997.2:c.83C>T	20.37:g.61050495G>A	ENSP00000252997:p.Ala28Val	Somatic	1	0		WXS	Illumina GAIIx	Phase_I	24	10	NM_080473	0	0	0	0	0	D9ZGF7|Q17RE2|Q86VU4	Missense_Mutation	SNP	ENST00000252997.2	37	CCDS13499.1	.	.	.	.	.	.	.	.	.	.	G	15.76	2.927870	0.52759	.	.	ENSG00000130700	ENST00000370545;ENST00000540404;ENST00000252997	D	0.98901	-5.22	4.0	4.0	0.46444	GATA-type transcription activator, N-terminal (1);	0.431408	0.23162	N	0.051239	D	0.97002	0.9021	L	0.41492	1.28	0.32417	N	0.54987	P	0.47484	0.896	B	0.43413	0.419	D	0.98789	1.0735	10	0.62326	D	0.03	-0.0043	16.0442	0.80707	0.0:0.0:1.0:0.0	.	28	Q9BWX5	GATA5_HUMAN	V	28;48;28	ENSP00000252997:A28V	ENSP00000252997:A28V	A	-	2	0	GATA5	60483890	0.024000	0.19004	0.012000	0.15200	0.427000	0.31564	2.237000	0.43061	1.930000	0.55929	0.400000	0.26472	GCC	G|0.998;A|0.002		0.741	GATA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080038.2	NM_080473	
OGFR	11054	hgsc.bcm.edu	37	20	61444633	61444633	+	Missense_Mutation	SNP	G	G	A	rs75570150		TCGA-OR-A5LN-01A-11D-A29I-10	TCGA-OR-A5LN-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	cf6a87e3-f084-4b4c-a978-314c952310a0	c8e44d71-ecbb-4a1f-86ef-5631d9a7442a	g.chr20:61444633G>A	ENST00000290291.6	+	7	1691	c.1666G>A	c.(1666-1668)Gag>Aag	p.E556K	OGFR_ENST00000370461.1_Missense_Mutation_p.E504K	NM_007346.2	NP_031372.2	Q9NZT2	OGFR_HUMAN	opioid growth factor receptor	556	7 X 20 AA approximate tandem repeats of [ST]-P-S-E-T-P-G-P-[SR]-P-A-G-P-[AT]- [GR]-D-E-P-A-[EK].				opioid receptor signaling pathway (GO:0038003)|regulation of cell growth (GO:0001558)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	opioid receptor activity (GO:0004985)	p.E556K(1)		endometrium(2)|kidney(1)|lung(4)|prostate(3)|skin(4)|upper_aerodigestive_tract(3)	17	Breast(26;3.65e-08)					CGAGCCAGCCGAGAGCCCATC	0.756																																					p.E556K		.											.	OGFR-68	1	Substitution - Missense(1)	skin(1)	c.G1666A						.						6.0	11.0	9.0					20																	61444633		1936	3778	5714	SO:0001583	missense	11054	exon7			CCAGCCGAGAGCC	AF109134	CCDS13504.1	20q13.3	2008-05-02			ENSG00000060491	ENSG00000060491			15768	protein-coding gene	gene with protein product		606459				10677613	Standard	NM_007346		Approved	7-60	uc002ydj.3	Q9NZT2	OTTHUMG00000032937	ENST00000290291.6:c.1666G>A	20.37:g.61444633G>A	ENSP00000290291:p.Glu556Lys	Somatic	3	0		WXS	Illumina GAIIx	Phase_I	39	5	NM_007346	0	0	101	102	1	O96029|Q4VXW5|Q96CM2|Q9BQW1|Q9H4H0|Q9H7J5|Q9NZT3|Q9NZT4	Missense_Mutation	SNP	ENST00000290291.6	37	CCDS13504.1	.	.	.	.	.	.	.	.	.	.	A	2.693	-0.272793	0.05716	.	.	ENSG00000060491	ENST00000290291;ENST00000357163;ENST00000370469;ENST00000370461	T;T	0.52983	0.64;0.64	0.773	-1.55	0.08558	.	.	.	.	.	T	0.25195	0.0612	N	0.14661	0.345	0.09310	N	1	B;B;B	0.09022	0.002;0.002;0.002	B;B;B	0.04013	0.0;0.001;0.0	T	0.12785	-1.0534	9	0.34782	T	0.22	.	5.1465	0.14987	0.4456:0.0:0.5544:0.0	.	556;539;556	B3KMQ6;Q05BV5;Q9NZT2	.;.;OGFR_HUMAN	K	556;536;391;504	ENSP00000290291:E556K;ENSP00000359491:E504K	ENSP00000290291:E556K	E	+	1	0	OGFR	60915078	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-3.269000	0.00532	-0.808000	0.04387	-1.125000	0.01998	GAG	.		0.756	OGFR-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000080067.1		
OGFR	11054	hgsc.bcm.edu	37	20	61444637	61444637	+	Missense_Mutation	SNP	G	G	C	rs78981100		TCGA-OR-A5LN-01A-11D-A29I-10	TCGA-OR-A5LN-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	cf6a87e3-f084-4b4c-a978-314c952310a0	c8e44d71-ecbb-4a1f-86ef-5631d9a7442a	g.chr20:61444637G>C	ENST00000290291.6	+	7	1695	c.1670G>C	c.(1669-1671)aGc>aCc	p.S557T	OGFR_ENST00000370461.1_Missense_Mutation_p.S505T	NM_007346.2	NP_031372.2	Q9NZT2	OGFR_HUMAN	opioid growth factor receptor	557	7 X 20 AA approximate tandem repeats of [ST]-P-S-E-T-P-G-P-[SR]-P-A-G-P-[AT]- [GR]-D-E-P-A-[EK].				opioid receptor signaling pathway (GO:0038003)|regulation of cell growth (GO:0001558)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	opioid receptor activity (GO:0004985)	p.S557T(3)		endometrium(2)|kidney(1)|lung(4)|prostate(3)|skin(4)|upper_aerodigestive_tract(3)	17	Breast(26;3.65e-08)					CCAGCCGAGAGCCCATCGGAG	0.746																																					p.S557T		.											.	OGFR-68	3	Substitution - Missense(3)	upper_aerodigestive_tract(1)|prostate(1)|skin(1)	c.G1670C						.						5.0	10.0	8.0					20																	61444637		1884	3696	5580	SO:0001583	missense	11054	exon7			CCGAGAGCCCATC	AF109134	CCDS13504.1	20q13.3	2008-05-02			ENSG00000060491	ENSG00000060491			15768	protein-coding gene	gene with protein product		606459				10677613	Standard	NM_007346		Approved	7-60	uc002ydj.3	Q9NZT2	OTTHUMG00000032937	ENST00000290291.6:c.1670G>C	20.37:g.61444637G>C	ENSP00000290291:p.Ser557Thr	Somatic	3	0		WXS	Illumina GAIIx	Phase_I	39	5	NM_007346	0	0	112	113	1	O96029|Q4VXW5|Q96CM2|Q9BQW1|Q9H4H0|Q9H7J5|Q9NZT3|Q9NZT4	Missense_Mutation	SNP	ENST00000290291.6	37	CCDS13504.1	.	.	.	.	.	.	.	.	.	.	G	7.631	0.678796	0.14841	.	.	ENSG00000060491	ENST00000290291;ENST00000357163;ENST00000370469;ENST00000370461	T;T	0.40225	1.04;1.04	0.773	0.773	0.18516	.	.	.	.	.	T	0.20373	0.0490	N	0.24115	0.695	0.09310	N	1	P;B;P	0.45594	0.862;0.386;0.862	B;B;B	0.38655	0.278;0.099;0.278	T	0.08868	-1.0701	9	0.09338	T	0.73	3.6159	4.5226	0.11966	0.2481:0.0:0.7519:0.0	.	557;540;557	B3KMQ6;Q05BV5;Q9NZT2	.;.;OGFR_HUMAN	T	557;537;392;505	ENSP00000290291:S557T;ENSP00000359491:S505T	ENSP00000290291:S557T	S	+	2	0	OGFR	60915082	0.000000	0.05858	0.008000	0.14137	0.008000	0.06430	-1.934000	0.01552	0.687000	0.31509	0.185000	0.17295	AGC	.		0.746	OGFR-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000080067.1		
CLIC6	54102	hgsc.bcm.edu	37	21	36042579	36042579	+	Missense_Mutation	SNP	C	C	G	rs13049028	byFrequency	TCGA-OR-A5LN-01A-11D-A29I-10	TCGA-OR-A5LN-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	cf6a87e3-f084-4b4c-a978-314c952310a0	c8e44d71-ecbb-4a1f-86ef-5631d9a7442a	g.chr21:36042579C>G	ENST00000360731.3	+	1	892	c.892C>G	c.(892-894)Caa>Gaa	p.Q298E	CLIC6_ENST00000349499.2_Missense_Mutation_p.Q298E			Q96NY7	CLIC6_HUMAN	chloride intracellular channel 6	298						chloride channel complex (GO:0034707)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	voltage-gated chloride channel activity (GO:0005247)			breast(1)|central_nervous_system(2)|endometrium(2)|kidney(3)|large_intestine(2)|lung(2)|ovary(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	19						TGAGCCGCAGCAATCGGGGGA	0.756													G|||	1116	0.222843	0.2648	0.1657	5008	,	,		8796	0.1825		0.2137	False		,,,				2504	0.2577				p.Q298E		.											.	CLIC6-91	0			c.C892G						.	G	GLU/GLN	454,2348		41,372,988	2.0	2.0	2.0		892	-0.8	0.0	21	dbSNP_121	2	925,5025		74,777,2124	no	missense	CLIC6	NM_053277.1	29	115,1149,3112	GG,GC,CC		15.5462,16.2027,15.7564	benign	298/687	36042579	1379,7373	1401	2975	4376	SO:0001583	missense	54102	exon1			CCGCAGCAATCGG	AF426169	CCDS13638.1	21q22.12	2012-09-26			ENSG00000159212	ENSG00000159212		"""Ion channels / Chloride channels : Intracellular"""	2065	protein-coding gene	gene with protein product		615321		CLIC1L		10830953	Standard	NM_053277		Approved	CLIC5	uc002yuf.1	Q96NY7	OTTHUMG00000086237	ENST00000360731.3:c.892C>G	21.37:g.36042579C>G	ENSP00000353959:p.Gln298Glu	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	16	13	NM_053277	0	0	0	0	0	A8K0U8|Q8IX31	Missense_Mutation	SNP	ENST00000360731.3	37		434	0.1987179487179487	125	0.2540650406504065	63	0.17403314917127072	81	0.14160839160839161	165	0.21767810026385223	G	0.195	-1.050076	0.01981	0.162027	0.155462	ENSG00000159212	ENST00000360731;ENST00000349499	T;T	0.21361	2.02;2.01	3.75	-0.792	0.10925	.	.	.	.	.	T	0.00012	0.0000	N	0.02539	-0.55	0.80722	P	0.0	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.43861	-0.9365	8	0.02654	T	1	-10.3162	7.3436	0.26650	0.1642:0.3831:0.4527:0.0	rs13049028	298;298	Q96NY7;Q96NY7-2	CLIC6_HUMAN;.	E	298	ENSP00000353959:Q298E;ENSP00000290332:Q298E	ENSP00000290332:Q298E	Q	+	1	0	CLIC6	34964449	0.256000	0.24012	0.012000	0.15200	0.009000	0.06853	0.804000	0.27098	-0.082000	0.12640	-0.676000	0.03789	CAA	C|0.802;G|0.198		0.756	CLIC6-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000194156.1		
CLIC6	54102	hgsc.bcm.edu	37	21	36042584	36042584	+	Silent	SNP	G	G	A	rs13049239	byFrequency	TCGA-OR-A5LN-01A-11D-A29I-10	TCGA-OR-A5LN-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	cf6a87e3-f084-4b4c-a978-314c952310a0	c8e44d71-ecbb-4a1f-86ef-5631d9a7442a	g.chr21:36042584G>A	ENST00000360731.3	+	1	897	c.897G>A	c.(895-897)tcG>tcA	p.S299S	CLIC6_ENST00000349499.2_Silent_p.S299S			Q96NY7	CLIC6_HUMAN	chloride intracellular channel 6	299						chloride channel complex (GO:0034707)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	voltage-gated chloride channel activity (GO:0005247)			breast(1)|central_nervous_system(2)|endometrium(2)|kidney(3)|large_intestine(2)|lung(2)|ovary(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	19						CGCAGCAATCGGGGGACGGCA	0.751													A|||	1101	0.219848	0.2549	0.1628	5008	,	,		9144	0.1825		0.2137	False		,,,				2504	0.2577				p.S299S		.											.	CLIC6-91	0			c.G897A						.	A		412,2410		18,376,1017	2.0	2.0	2.0		897	-0.2	0.0	21	dbSNP_121	2	842,5136		42,758,2189	no	coding-synonymous	CLIC6	NM_053277.1		60,1134,3206	AA,AG,GG		14.085,14.5996,14.25		299/687	36042584	1254,7546	1411	2989	4400	SO:0001819	synonymous_variant	54102	exon1			GCAATCGGGGGAC	AF426169	CCDS13638.1	21q22.12	2012-09-26			ENSG00000159212	ENSG00000159212		"""Ion channels / Chloride channels : Intracellular"""	2065	protein-coding gene	gene with protein product		615321		CLIC1L		10830953	Standard	NM_053277		Approved	CLIC5	uc002yuf.1	Q96NY7	OTTHUMG00000086237	ENST00000360731.3:c.897G>A	21.37:g.36042584G>A		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	15	12	NM_053277	0	0	0	0	0	A8K0U8|Q8IX31	Silent	SNP	ENST00000360731.3	37																																																																																				G|0.803;A|0.197		0.751	CLIC6-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000194156.1		
KRTAP10-5	386680	hgsc.bcm.edu	37	21	45999661	45999661	+	Silent	SNP	C	C	T	rs7510443	byFrequency	TCGA-OR-A5LN-01A-11D-A29I-10	TCGA-OR-A5LN-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	cf6a87e3-f084-4b4c-a978-314c952310a0	c8e44d71-ecbb-4a1f-86ef-5631d9a7442a	g.chr21:45999661C>T	ENST00000400372.1	-	1	820	c.795G>A	c.(793-795)gcG>gcA	p.A265A	TSPEAR_ENST00000323084.4_Intron	NM_198694.2	NP_941967.2	P60370	KR105_HUMAN	keratin associated protein 10-5	265						keratin filament (GO:0045095)				endometrium(2)|kidney(1)|lung(9)|prostate(1)|upper_aerodigestive_tract(1)	14						GGCGGGAGCACGCGGGGCGGC	0.697													.|||	151	0.0301518	0.1089	0.0086	5008	,	,		18330	0.0		0.0	False		,,,				2504	0.001				p.A265A		.											.	KRTAP10-5-90	0			c.G795A						.	C	,	326,4036		3,320,1858	26.0	33.0	30.0		,795	-3.5	0.0	21	dbSNP_116	30	35,8483		0,35,4224	no	intron,coding-synonymous	TSPEAR,KRTAP10-5	NM_144991.2,NM_198694.2	,	3,355,6082	TT,TC,CC		0.4109,7.4736,2.8028	,	,265/272	45999661	361,12519	2181	4259	6440	SO:0001819	synonymous_variant	386680	exon1			GGAGCACGCGGGG	AJ566384	CCDS42958.1	21q22.3	2007-10-05			ENSG00000241123	ENSG00000241123		"""Keratin associated proteins"""	22969	protein-coding gene	gene with protein product				KRTAP18-5			Standard	NM_198694		Approved	KAP10.5, KAP18.5	uc002zfl.1	P60370	OTTHUMG00000057638	ENST00000400372.1:c.795G>A	21.37:g.45999661C>T		Somatic	5	0		WXS	Illumina GAIIx	Phase_I	69	5	NM_198694	0	0	0	0	0	Q0VAR7|Q0VAR8|Q70LJ3	Silent	SNP	ENST00000400372.1	37	CCDS42958.1																																																																																			C|0.979;T|0.021		0.697	KRTAP10-5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128042.1		
MICAL3	57553	hgsc.bcm.edu	37	22	18347738	18347738	+	Silent	SNP	G	G	T			TCGA-OR-A5LN-01A-11D-A29I-10	TCGA-OR-A5LN-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	cf6a87e3-f084-4b4c-a978-314c952310a0	c8e44d71-ecbb-4a1f-86ef-5631d9a7442a	g.chr22:18347738G>T	ENST00000441493.2	-	19	2884	c.2532C>A	c.(2530-2532)ccC>ccA	p.P844P	MICAL3_ENST00000414725.2_Silent_p.P872P|MICAL3_ENST00000400561.2_Silent_p.P844P|MICAL3_ENST00000207726.7_Silent_p.P872P|MICAL3_ENST00000383094.3_Silent_p.P844P|MICAL3_ENST00000429452.1_Silent_p.P968P|MICAL3_ENST00000585038.1_Silent_p.P968P|MICAL3_ENST00000444520.1_Silent_p.P844P	NM_015241.2	NP_056056.2	Q7RTP6	MICA3_HUMAN	microtubule associated monooxygenase, calponin and LIM domain containing 3	844					actin filament depolymerization (GO:0030042)|cytoskeleton organization (GO:0007010)|exocytosis (GO:0006887)|oxidation-reduction process (GO:0055114)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)	actin binding (GO:0003779)|FAD binding (GO:0071949)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, NAD(P)H as one donor, and incorporation of one atom of oxygen (GO:0016709)|zinc ion binding (GO:0008270)			large_intestine(1)|lung(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	4		all_epithelial(15;0.198)		Lung(27;0.0427)		CATCCTGCAGGGGTCCTTTGG	0.547																																					p.P968P		.											.	MICAL3-68	0			c.C2904A						.						71.0	68.0	69.0					22																	18347738		1568	3582	5150	SO:0001819	synonymous_variant	57553	exon23			CTGCAGGGGTCCT	AB037785	CCDS46659.1, CCDS46660.1, CCDS46661.1	22q11.21	2013-03-26	2013-03-26		ENSG00000243156	ENSG00000243156			24694	protein-coding gene	gene with protein product		608882				12110185	Standard	NM_015241		Approved	KIAA0819	uc002zng.4	Q7RTP6	OTTHUMG00000150067	ENST00000441493.2:c.2532C>A	22.37:g.18347738G>T		Somatic	104	0		WXS	Illumina GAIIx	Phase_I	67	4	NM_001136004	0	0	0	0	0	B2RXJ5|E9PEF0|O94909|Q5U4P4|Q6ICK4|Q96DF2|Q9P2I3	Silent	SNP	ENST00000441493.2	37	CCDS46659.1																																																																																			.		0.547	MICAL3-010	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000447351.1		
SCARF2	91179	hgsc.bcm.edu	37	22	20780079	20780079	+	Silent	SNP	C	C	T	rs185252842	byFrequency	TCGA-OR-A5LN-01A-11D-A29I-10	TCGA-OR-A5LN-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	cf6a87e3-f084-4b4c-a978-314c952310a0	c8e44d71-ecbb-4a1f-86ef-5631d9a7442a	g.chr22:20780079C>T	ENST00000266214.5	-	11	2303	c.2199G>A	c.(2197-2199)gaG>gaA	p.E733E	SCARF2_ENST00000405555.3_Silent_p.E728E	NM_153334.4	NP_699165.2	Q96GP6	SREC2_HUMAN	scavenger receptor class F, member 2	733	Pro-rich.				cell adhesion (GO:0007155)	focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)				breast(1)|central_nervous_system(1)|kidney(1)|large_intestine(1)|lung(3)|prostate(1)|skin(2)	10	Melanoma(16;0.000465)|Ovarian(15;0.00167)|Colorectal(54;0.0221)|all_neural(72;0.219)	Lung SC(17;0.0262)	LUSC - Lung squamous cell carcinoma(15;0.00102)|Lung(15;0.0173)			CTGTCGCCTCCTCGGGCAGCC	0.781													C|||	127	0.0253594	0.0915	0.0086	5008	,	,		6317	0.0		0.0	False		,,,				2504	0.0				p.E733E		.											.	SCARF2-341	0			c.G2199A						.						3.0	4.0	4.0					22																	20780079		1400	2679	4079	SO:0001819	synonymous_variant	91179	exon11			CGCCTCCTCGGGC	AF522196	CCDS13779.1, CCDS46666.1	22q11.21	2011-10-10			ENSG00000244486	ENSG00000244486			19869	protein-coding gene	gene with protein product		613619				12154095	Standard	XM_006724364		Approved	SREC-II, SREC2, HUMZD58C02	uc002zsk.2	Q96GP6	OTTHUMG00000150779	ENST00000266214.5:c.2199G>A	22.37:g.20780079C>T		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	4	4	NM_153334	0	0	0	0	0	E5RFB8|Q58A83|Q8IXF3|Q9BW74	Silent	SNP	ENST00000266214.5	37	CCDS13779.1																																																																																			C|0.977;T|0.023		0.781	SCARF2-001	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000320047.1		
SCARF2	91179	hgsc.bcm.edu	37	22	20780091	20780091	+	Silent	SNP	C	C	G	rs759610		TCGA-OR-A5LN-01A-11D-A29I-10	TCGA-OR-A5LN-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	cf6a87e3-f084-4b4c-a978-314c952310a0	c8e44d71-ecbb-4a1f-86ef-5631d9a7442a	g.chr22:20780091C>G	ENST00000266214.5	-	11	2291	c.2187G>C	c.(2185-2187)ccG>ccC	p.P729P	SCARF2_ENST00000405555.3_Silent_p.P724P	NM_153334.4	NP_699165.2	Q96GP6	SREC2_HUMAN	scavenger receptor class F, member 2	729	Pro-rich.				cell adhesion (GO:0007155)	focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)				breast(1)|central_nervous_system(1)|kidney(1)|large_intestine(1)|lung(3)|prostate(1)|skin(2)	10	Melanoma(16;0.000465)|Ovarian(15;0.00167)|Colorectal(54;0.0221)|all_neural(72;0.219)	Lung SC(17;0.0262)	LUSC - Lung squamous cell carcinoma(15;0.00102)|Lung(15;0.0173)			CGGGCAGCCCCGGGGGGCGCG	0.781																																					p.P729P		.											.	SCARF2-341	0			c.G2187C						.	G	,	3110,60		1525,60,0	4.0	5.0	4.0		2187,2172	-6.8	0.1	22	dbSNP_86	4	5974,118		2928,118,0	no	coding-synonymous,coding-synonymous	SCARF2	NM_153334.4,NM_182895.2	,	4453,178,0	GG,GC,CC		1.937,1.8927,1.9218	,	729/871,724/866	20780091	9084,178	1585	3046	4631	SO:0001819	synonymous_variant	91179	exon11			CAGCCCCGGGGGG	AF522196	CCDS13779.1, CCDS46666.1	22q11.21	2011-10-10			ENSG00000244486	ENSG00000244486			19869	protein-coding gene	gene with protein product		613619				12154095	Standard	XM_006724364		Approved	SREC-II, SREC2, HUMZD58C02	uc002zsk.2	Q96GP6	OTTHUMG00000150779	ENST00000266214.5:c.2187G>C	22.37:g.20780091C>G		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	5	5	NM_153334	0	0	0	0	0	E5RFB8|Q58A83|Q8IXF3|Q9BW74	Silent	SNP	ENST00000266214.5	37	CCDS13779.1																																																																																			C|0.138;G|0.862		0.781	SCARF2-001	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000320047.1		
SCARF2	91179	hgsc.bcm.edu	37	22	20780097	20780097	+	Silent	SNP	G	G	C	rs759609		TCGA-OR-A5LN-01A-11D-A29I-10	TCGA-OR-A5LN-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	cf6a87e3-f084-4b4c-a978-314c952310a0	c8e44d71-ecbb-4a1f-86ef-5631d9a7442a	g.chr22:20780097G>C	ENST00000266214.5	-	11	2285	c.2181C>G	c.(2179-2181)cgC>cgG	p.R727R	SCARF2_ENST00000405555.3_Silent_p.R722R	NM_153334.4	NP_699165.2	Q96GP6	SREC2_HUMAN	scavenger receptor class F, member 2	727	Pro-rich.				cell adhesion (GO:0007155)	focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)				breast(1)|central_nervous_system(1)|kidney(1)|large_intestine(1)|lung(3)|prostate(1)|skin(2)	10	Melanoma(16;0.000465)|Ovarian(15;0.00167)|Colorectal(54;0.0221)|all_neural(72;0.219)	Lung SC(17;0.0262)	LUSC - Lung squamous cell carcinoma(15;0.00102)|Lung(15;0.0173)			GCCCCGGGGGGCGCGGCGTTG	0.781																																					p.R727R		.											.	SCARF2-341	0			c.C2181G						.	C	,	3271,119		1585,101,9	5.0	5.0	5.0		2181,2166	-5.3	0.0	22	dbSNP_86	5	6306,190		3060,186,2	no	coding-synonymous,coding-synonymous	SCARF2	NM_153334.4,NM_182895.2	,	4645,287,11	CC,CG,GG		2.9249,3.5103,3.1256	,	727/871,722/866	20780097	9577,309	1695	3248	4943	SO:0001819	synonymous_variant	91179	exon11			CGGGGGGCGCGGC	AF522196	CCDS13779.1, CCDS46666.1	22q11.21	2011-10-10			ENSG00000244486	ENSG00000244486			19869	protein-coding gene	gene with protein product		613619				12154095	Standard	XM_006724364		Approved	SREC-II, SREC2, HUMZD58C02	uc002zsk.2	Q96GP6	OTTHUMG00000150779	ENST00000266214.5:c.2181C>G	22.37:g.20780097G>C		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	6	6	NM_153334	0	0	0	0	0	E5RFB8|Q58A83|Q8IXF3|Q9BW74	Silent	SNP	ENST00000266214.5	37	CCDS13779.1																																																																																			G|0.826;C|0.174		0.781	SCARF2-001	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000320047.1		
MN1	4330	hgsc.bcm.edu	37	22	28194747	28194747	+	Silent	SNP	C	C	T	rs45554336	byFrequency	TCGA-OR-A5LN-01A-11D-A29I-10	TCGA-OR-A5LN-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	cf6a87e3-f084-4b4c-a978-314c952310a0	c8e44d71-ecbb-4a1f-86ef-5631d9a7442a	g.chr22:28194747C>T	ENST00000302326.4	-	1	2739	c.1785G>A	c.(1783-1785)gtG>gtA	p.V595V		NM_002430.2	NP_002421.3	Q10571	MN1_HUMAN	meningioma (disrupted in balanced translocation) 1	595					intramembranous ossification (GO:0001957)					NS(1)|breast(2)|central_nervous_system(3)|endometrium(4)|kidney(3)|large_intestine(6)|lung(15)|ovary(3)|prostate(4)|skin(3)|upper_aerodigestive_tract(1)	45						CCAAGCCGCCCACCGGGCCGC	0.736			T	ETV6	"""AML, meningioma"""								C|||	465	0.0928514	0.3381	0.0259	5008	,	,		10913	0.0		0.0	False		,,,				2504	0.0				p.V595V		.		Dom	yes		22	22q13	4330	meningioma (disrupted in balanced translocation) 1		"""L, O"""	.	MN1-993	0			c.G1785A						.	C		548,2408		6,536,936	2.0	3.0	3.0		1785	4.8	1.0	22	dbSNP_127	3	4,6414		0,4,3205	no	coding-synonymous	MN1	NM_002430.2		6,540,4141	TT,TC,CC		0.0623,18.5386,5.8886		595/1321	28194747	552,8822	1478	3209	4687	SO:0001819	synonymous_variant	4330	exon1			GCCGCCCACCGGG	X82209	CCDS42998.1	22q12.1	2010-09-29			ENSG00000169184	ENSG00000169184			7180	protein-coding gene	gene with protein product	"""probable tumor suppressor protein MN1"""	156100	"""meningioma chromosome region"""	MGCR		7731706, 12569362	Standard	NM_002430		Approved	MGCR1-PEN, MGCR1	uc003adj.3	Q10571	OTTHUMG00000150975	ENST00000302326.4:c.1785G>A	22.37:g.28194747C>T		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	5	5	NM_002430	0	0	0	0	0	A9Z1V9	Silent	SNP	ENST00000302326.4	37	CCDS42998.1																																																																																			C|0.932;T|0.068		0.736	MN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320737.1	NM_002430	
MN1	4330	broad.mit.edu	37	22	28194910	28194912	+	In_Frame_Del	DEL	TGT	TGT	-			TCGA-OR-A5LN-01A-11D-A29I-10	TCGA-OR-A5LN-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	cf6a87e3-f084-4b4c-a978-314c952310a0	c8e44d71-ecbb-4a1f-86ef-5631d9a7442a	g.chr22:28194910_28194912delTGT	ENST00000302326.4	-	1	2574_2576	c.1620_1622delACA	c.(1618-1623)caacag>cag	p.540_541QQ>Q		NM_002430.2	NP_002421.3	Q10571	MN1_HUMAN	meningioma (disrupted in balanced translocation) 1	540	Poly-Gln.				intramembranous ossification (GO:0001957)					NS(1)|breast(2)|central_nervous_system(3)|endometrium(4)|kidney(3)|large_intestine(6)|lung(15)|ovary(3)|prostate(4)|skin(3)|upper_aerodigestive_tract(1)	45						ttgctgttgctgttgctgctgct	0.655			T	ETV6	"""AML, meningioma"""																																p.540_541del		.		Dom	yes		22	22q13	4330	meningioma (disrupted in balanced translocation) 1		"""L, O"""	.	MN1-993	0			c.1620_1622del						.			259,3347		25,209,1569						1.4	1.0		dbSNP_130	5	283,7069		26,231,3419	no	coding	MN1	NM_002430.2		51,440,4988	A1A1,A1R,RR		3.8493,7.1825,4.9462				542,10416				SO:0001651	inframe_deletion	4330	exon1			TGTTGCTGTTGCT	X82209	CCDS42998.1	22q12.1	2010-09-29			ENSG00000169184	ENSG00000169184			7180	protein-coding gene	gene with protein product	"""probable tumor suppressor protein MN1"""	156100	"""meningioma chromosome region"""	MGCR		7731706, 12569362	Standard	NM_002430		Approved	MGCR1-PEN, MGCR1	uc003adj.3	Q10571	OTTHUMG00000150975	ENST00000302326.4:c.1620_1622delACA	22.37:g.28194910_28194912delTGT	ENSP00000304956:p.Gln550del	Somatic	10	0		WXS	Illumina GAIIx	Phase_I	40	7	NM_002430	0	0	0	0	0	A9Z1V9	In_Frame_Del	DEL	ENST00000302326.4	37	CCDS42998.1																																																																																			.		0.655	MN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320737.1	NM_002430	
MN1	4330	hgsc.bcm.edu	37	22	28194933	28194933	+	Silent	SNP	T	T	C	rs572936881|rs373314940|rs71194738	byFrequency	TCGA-OR-A5LN-01A-11D-A29I-10	TCGA-OR-A5LN-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	cf6a87e3-f084-4b4c-a978-314c952310a0	c8e44d71-ecbb-4a1f-86ef-5631d9a7442a	g.chr22:28194933T>C	ENST00000302326.4	-	1	2553	c.1599A>G	c.(1597-1599)caA>caG	p.Q533Q		NM_002430.2	NP_002421.3	Q10571	MN1_HUMAN	meningioma (disrupted in balanced translocation) 1	533	Poly-Gln.				intramembranous ossification (GO:0001957)					NS(1)|breast(2)|central_nervous_system(3)|endometrium(4)|kidney(3)|large_intestine(6)|lung(15)|ovary(3)|prostate(4)|skin(3)|upper_aerodigestive_tract(1)	45						gctgctgctgttgctgctgct	0.652			T	ETV6	"""AML, meningioma"""								T|||	98	0.0195687	0.0613	0.0086	5008	,	,		12327	0.002		0.005	False		,,,				2504	0.0041				p.Q533Q		.		Dom	yes		22	22q13	4330	meningioma (disrupted in balanced translocation) 1		"""L, O"""	.	MN1-993	0			c.A1599G						.	C		9,3561		0,9,1776	4.0	5.0	5.0		1599	-0.4	1.0	22		5	5,7341		0,5,3668	no	coding-synonymous	MN1	NM_002430.2		0,14,5444	CC,CT,TT		0.0681,0.2521,0.1283		533/1321	28194933	14,10902	1785	3673	5458	SO:0001819	synonymous_variant	4330	exon1			CTGCTGTTGCTGC	X82209	CCDS42998.1	22q12.1	2010-09-29			ENSG00000169184	ENSG00000169184			7180	protein-coding gene	gene with protein product	"""probable tumor suppressor protein MN1"""	156100	"""meningioma chromosome region"""	MGCR		7731706, 12569362	Standard	NM_002430		Approved	MGCR1-PEN, MGCR1	uc003adj.3	Q10571	OTTHUMG00000150975	ENST00000302326.4:c.1599A>G	22.37:g.28194933T>C		Somatic	14	0		WXS	Illumina GAIIx	Phase_I	58	13	NM_002430	0	1	19	1680	1660	A9Z1V9	Silent	SNP	ENST00000302326.4	37	CCDS42998.1																																																																																			.		0.652	MN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320737.1	NM_002430	
MN1	4330	hgsc.bcm.edu	37	22	28194936	28194936	+	Silent	SNP	C	C	T	rs45597040	byFrequency	TCGA-OR-A5LN-01A-11D-A29I-10	TCGA-OR-A5LN-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	cf6a87e3-f084-4b4c-a978-314c952310a0	c8e44d71-ecbb-4a1f-86ef-5631d9a7442a	g.chr22:28194936C>T	ENST00000302326.4	-	1	2550	c.1596G>A	c.(1594-1596)caG>caA	p.Q532Q		NM_002430.2	NP_002421.3	Q10571	MN1_HUMAN	meningioma (disrupted in balanced translocation) 1	532	Poly-Gln.				intramembranous ossification (GO:0001957)			p.Q532Q(1)		NS(1)|breast(2)|central_nervous_system(3)|endometrium(4)|kidney(3)|large_intestine(6)|lung(15)|ovary(3)|prostate(4)|skin(3)|upper_aerodigestive_tract(1)	45						gctgctgttgctgctgctgct	0.652			T	ETV6	"""AML, meningioma"""																																p.Q532Q		.		Dom	yes		22	22q13	4330	meningioma (disrupted in balanced translocation) 1		"""L, O"""	.	MN1-993	1	Substitution - coding silent(1)	prostate(1)	c.G1596A						.						4.0	5.0	5.0					22																	28194936		1795	3654	5449	SO:0001819	synonymous_variant	4330	exon1			CTGTTGCTGCTGC	X82209	CCDS42998.1	22q12.1	2010-09-29			ENSG00000169184	ENSG00000169184			7180	protein-coding gene	gene with protein product	"""probable tumor suppressor protein MN1"""	156100	"""meningioma chromosome region"""	MGCR		7731706, 12569362	Standard	NM_002430		Approved	MGCR1-PEN, MGCR1	uc003adj.3	Q10571	OTTHUMG00000150975	ENST00000302326.4:c.1596G>A	22.37:g.28194936C>T		Somatic	15	0		WXS	Illumina GAIIx	Phase_I	59	13	NM_002430	0	0	17	22	5	A9Z1V9	Silent	SNP	ENST00000302326.4	37	CCDS42998.1																																																																																			C|0.963;T|0.037		0.652	MN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320737.1	NM_002430	
CARD10	29775	hgsc.bcm.edu	37	22	37915145	37915145	+	Silent	SNP	C	C	T	rs79861380	byFrequency	TCGA-OR-A5LN-01A-11D-A29I-10	TCGA-OR-A5LN-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	cf6a87e3-f084-4b4c-a978-314c952310a0	c8e44d71-ecbb-4a1f-86ef-5631d9a7442a	g.chr22:37915145C>T	ENST00000403299.1	-	2	279	c.63G>A	c.(61-63)gaG>gaA	p.E21E	CARD10_ENST00000251973.5_Silent_p.E21E			Q9BWT7	CAR10_HUMAN	caspase recruitment domain family, member 10	21					activation of NF-kappaB-inducing kinase activity (GO:0007250)|protein complex assembly (GO:0006461)|regulation of apoptotic process (GO:0042981)	CBM complex (GO:0032449)|cytoplasm (GO:0005737)	receptor signaling complex scaffold activity (GO:0030159)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(5)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	17	Melanoma(58;0.0574)					cctcctccgcctcagaccccg	0.756													C|||	295	0.0589058	0.1573	0.0548	5008	,	,		9486	0.0		0.0398	False		,,,				2504	0.0092				p.E21E		.											.	CARD10-662	0			c.G63A						.	C		625,3669		33,559,1555	8.0	9.0	9.0		63	3.9	1.0	22	dbSNP_131	9	324,8168		4,316,3926	no	coding-synonymous	CARD10	NM_014550.3		37,875,5481	TT,TC,CC		3.8154,14.5552,7.4222		21/1033	37915145	949,11837	2147	4246	6393	SO:0001819	synonymous_variant	29775	exon1			CTCCGCCTCAGAC	AF086324	CCDS13948.1	22q13.1	2008-05-22			ENSG00000100065	ENSG00000100065			16422	protein-coding gene	gene with protein product		607209				11259443, 11356195	Standard	NM_014550		Approved	CARMA3, BIMP1	uc003asu.1	Q9BWT7	OTTHUMG00000150592	ENST00000403299.1:c.63G>A	22.37:g.37915145C>T		Somatic	1	0		WXS	Illumina GAIIx	Phase_I	27	23	NM_014550	0	0	0	0	0	Q14CQ8|Q5TFG6|Q8NC81|Q9UGR5|Q9UGR6|Q9Y3H0	Silent	SNP	ENST00000403299.1	37	CCDS13948.1																																																																																			C|0.935;T|0.065		0.756	CARD10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318997.1	NM_014550	
FBLN2	2199	ucsc.edu	37	3	13612286	13612286	+	Missense_Mutation	SNP	A	A	G	rs28587534	byFrequency	TCGA-OR-A5LN-01A-11D-A29I-10	TCGA-OR-A5LN-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	cf6a87e3-f084-4b4c-a978-314c952310a0	c8e44d71-ecbb-4a1f-86ef-5631d9a7442a	g.chr3:13612286A>G	ENST00000295760.7	+	2	500	c.431A>G	c.(430-432)cAc>cGc	p.H144R	FBLN2_ENST00000404922.3_Missense_Mutation_p.H144R|FBLN2_ENST00000492059.1_Missense_Mutation_p.H144R|FBLN2_ENST00000535798.1_Missense_Mutation_p.H170R	NM_001998.2	NP_001989.2	P98095	FBLN2_HUMAN	fibulin 2	144	N.|Subdomain NA (Cys-rich).		H -> R (in dbSNP:rs28587534).		extracellular matrix organization (GO:0030198)|positive regulation of cell-substrate adhesion (GO:0010811)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	calcium ion binding (GO:0005509)|extracellular matrix binding (GO:0050840)|extracellular matrix structural constituent (GO:0005201)			haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(3)|lung(10)|ovary(3)|prostate(3)|urinary_tract(1)	24			UCEC - Uterine corpus endometrioid carcinoma (1;0.00416)			CACGCGGGCCACAAGTACGCC	0.687													G|||	585	0.116813	0.3759	0.0418	5008	,	,		13252	0.0417		0.0099	False		,,,				2504	0.0072				p.H144R		.											.	FBLN2-91	0			c.A431G						.	G	ARG/HIS,ARG/HIS,ARG/HIS	1306,2958		202,902,1028	10.0	13.0	12.0		431,431,431	-1.0	0.0	3	dbSNP_125	12	78,8346		0,78,4134	no	missense,missense,missense	FBLN2	NM_001004019.1,NM_001165035.1,NM_001998.2	29,29,29	202,980,5162	GG,GA,AA		0.9259,30.6285,10.9079	benign,benign,benign	144/1232,144/1232,144/1185	13612286	1384,11304	2132	4212	6344	SO:0001583	missense	2199	exon2			CGGGCCACAAGTA	X82494	CCDS46761.1, CCDS46762.1	3p25-p24	2010-06-15			ENSG00000163520	ENSG00000163520		"""Fibulins"""	3601	protein-coding gene	gene with protein product		135821				7806230	Standard	NM_001165035		Approved		uc011ava.2	P98095	OTTHUMG00000155437	ENST00000295760.7:c.431A>G	3.37:g.13612286A>G	ENSP00000295760:p.His144Arg	Somatic	18	1		WXS	Illumina GAIIx	Phase_I	77	21	NM_001998	0	0	0	0	0	B7Z9C5|Q8IUI0|Q8IUI1	Missense_Mutation	SNP	ENST00000295760.7	37	CCDS46762.1	200	0.09157509157509157	162	0.32926829268292684	17	0.04696132596685083	14	0.024475524475524476	7	0.009234828496042216	G	0.004	-2.378673	0.00205	0.306285	0.009259	ENSG00000163520	ENST00000535798;ENST00000404922;ENST00000295760;ENST00000465610;ENST00000492059	T;T;T;T;T	0.63417	-0.04;-0.04;-0.04;1.68;-0.04	4.96	-0.976	0.10286	.	0.477068	0.20408	N	0.092905	T	0.00012	0.0000	N	0.01352	-0.895	0.80722	P	0.0	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.01281	0.0;0.0;0.0	T	0.20042	-1.0287	9	0.02654	T	1	.	5.9693	0.19342	0.659:0.0:0.1876:0.1534	rs28587534;rs58091201	144;144;170	P98095;P98095-2;F5H1F3	FBLN2_HUMAN;.;.	R	170;144;144;144;144	ENSP00000445705:H170R;ENSP00000384169:H144R;ENSP00000295760:H144R;ENSP00000420164:H144R;ENSP00000420042:H144R	ENSP00000295760:H144R	H	+	2	0	FBLN2	13587286	1.000000	0.71417	0.009000	0.14445	0.010000	0.07245	3.821000	0.55700	-0.322000	0.08615	-1.335000	0.01260	CAC	A|0.908;G|0.092		0.687	FBLN2-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000340083.3	NM_001004019	
DALRD3	55152	hgsc.bcm.edu	37	3	49055839	49055839	+	Silent	SNP	G	G	A	rs372270652	byFrequency	TCGA-OR-A5LN-01A-11D-A29I-10	TCGA-OR-A5LN-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	cf6a87e3-f084-4b4c-a978-314c952310a0	c8e44d71-ecbb-4a1f-86ef-5631d9a7442a	g.chr3:49055839G>A	ENST00000341949.4	-	1	165	c.159C>T	c.(157-159)gaC>gaT	p.D53D	DALRD3_ENST00000313778.5_Intron|NDUFAF3_ENST00000395458.2_5'Flank|NDUFAF3_ENST00000326925.6_5'Flank|DALRD3_ENST00000440857.1_De_novo_Start_OutOfFrame|MIR425_ENST00000362162.1_RNA|MIR191_ENST00000384873.1_RNA|NDUFAF3_ENST00000326912.4_5'Flank|DALRD3_ENST00000395462.4_De_novo_Start_OutOfFrame|DALRD3_ENST00000496568.1_Intron|DALRD3_ENST00000441576.2_Silent_p.D53D	NM_001009996.1	NP_001009996.1	Q5D0E6	DALD3_HUMAN	DALR anticodon binding domain containing 3	53					arginyl-tRNA aminoacylation (GO:0006420)		arginine-tRNA ligase activity (GO:0004814)|ATP binding (GO:0005524)			breast(2)|endometrium(2)|large_intestine(2)|lung(5)|skin(1)	12				BRCA - Breast invasive adenocarcinoma(193;8.01e-05)|Kidney(197;0.00218)|KIRC - Kidney renal clear cell carcinoma(197;0.00244)		CCACCTGGCCGTCATCGAAGC	0.716													G|||	3	0.000599042	0.0023	0.0	5008	,	,		12694	0.0		0.0	False		,,,				2504	0.0				p.D53D		.											.	DALRD3-90	0			c.C159T						.	G	,	5,4071		0,5,2033	6.0	9.0	8.0		159,	-3.5	0.0	3		8	0,8262		0,0,4131	no	coding-synonymous,intron	DALRD3	NM_001009996.1,NM_018114.4	,	0,5,6164	AA,AG,GG		0.0,0.1227,0.0405	,	53/544,	49055839	5,12333	2038	4131	6169	SO:0001819	synonymous_variant	55152	exon1			CTGGCCGTCATCG	BC014099	CCDS2783.1, CCDS33754.1, CCDS63632.1	3p21.31	2005-01-10			ENSG00000178149	ENSG00000178149			25536	protein-coding gene	gene with protein product						12477932	Standard	NM_001009996		Approved	FLJ10496	uc003cvk.2	Q5D0E6	OTTHUMG00000156748	ENST00000341949.4:c.159C>T	3.37:g.49055839G>A		Somatic	2	0		WXS	Illumina GAIIx	Phase_I	29	15	NM_001009996	0	0	0	0	0	Q7Z5S7|Q86WY1|Q8N105|Q8NA89|Q9NVU8	Silent	SNP	ENST00000341949.4	37	CCDS33754.1																																																																																			.		0.716	DALRD3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000345581.1	NM_018114	
CHDH	55349	hgsc.bcm.edu	37	3	53857917	53857917	+	Missense_Mutation	SNP	T	T	G	rs9001	byFrequency	TCGA-OR-A5LN-01A-11D-A29I-10	TCGA-OR-A5LN-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	cf6a87e3-f084-4b4c-a978-314c952310a0	c8e44d71-ecbb-4a1f-86ef-5631d9a7442a	g.chr3:53857917T>G	ENST00000315251.6	-	3	556	c.119A>C	c.(118-120)gAg>gCg	p.E40A		NM_018397.4	NP_060867.2	Q8NE62	CHDH_HUMAN	choline dehydrogenase	40			E -> A (in dbSNP:rs9001).		glycine betaine biosynthetic process from choline (GO:0019285)	mitochondrial inner membrane (GO:0005743)	choline dehydrogenase activity (GO:0008812)|flavin adenine dinucleotide binding (GO:0050660)			NS(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(4)|ovary(2)|prostate(1)	17		Hepatocellular(537;0.152)		BRCA - Breast invasive adenocarcinoma(193;0.000158)|KIRC - Kidney renal clear cell carcinoma(284;0.00588)|Kidney(284;0.00673)|OV - Ovarian serous cystadenocarcinoma(275;0.118)	Choline(DB00122)	ATAGCTGTACTCGTCCCGGCT	0.761													T|||	1221	0.24381	0.3238	0.2781	5008	,	,		12724	0.3651		0.1004	False		,,,				2504	0.1339				p.E40A		.											.	CHDH-91	0			c.A119C						.	T	ALA/GLU	816,2768		76,664,1052	6.0	6.0	6.0		119	3.8	1.0	3	dbSNP_52	6	469,6875		12,445,3215	no	missense	CHDH	NM_018397.4	107	88,1109,4267	GG,GT,TT		6.3862,22.7679,11.7588	possibly-damaging	40/595	53857917	1285,9643	1792	3672	5464	SO:0001583	missense	55349	exon3			CTGTACTCGTCCC	AJ272267	CCDS2873.1	3p21	2004-11-24			ENSG00000016391	ENSG00000016391	1.1.99.1		24288	protein-coding gene	gene with protein product							Standard	NM_018397		Approved		uc003dgz.3	Q8NE62	OTTHUMG00000158281	ENST00000315251.6:c.119A>C	3.37:g.53857917T>G	ENSP00000319851:p.Glu40Ala	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	9	9	NM_018397	0	0	0	0	0	Q9NY17	Missense_Mutation	SNP	ENST00000315251.6	37	CCDS2873.1	536	0.2454212454212454	164	0.3333333333333333	82	0.2265193370165746	201	0.3513986013986014	89	0.11741424802110818	T	14.21	2.467073	0.43839	0.227679	0.063862	ENSG00000016391	ENST00000315251;ENST00000481668;ENST00000467802	T;T;T	0.68479	-0.33;1.42;-0.33	5.03	3.8	0.43715	.	0.330341	0.32134	N	0.006528	T	0.00012	0.0000	N	0.08118	0	0.37702	P	0.07576799999999995	B	0.17465	0.022	B	0.12156	0.007	T	0.12372	-1.0550	9	0.56958	D	0.05	-41.8442	8.4332	0.32771	0.0:0.0:0.1978:0.8022	rs9001;rs3172489;rs58735855;rs9001	40	Q8NE62	CHDH_HUMAN	A	40	ENSP00000319851:E40A;ENSP00000418273:E40A;ENSP00000419863:E40A	ENSP00000319851:E40A	E	-	2	0	CHDH	53832957	0.187000	0.23238	0.988000	0.46212	0.816000	0.46133	1.016000	0.29976	2.240000	0.73641	0.533000	0.62120	GAG	T|0.749;G|0.251		0.761	CHDH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350567.2	NM_018397	
SNTN	132203	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	3	63649755	63649755	+	Missense_Mutation	SNP	T	T	C			TCGA-OR-A5LN-01A-11D-A29I-10	TCGA-OR-A5LN-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	cf6a87e3-f084-4b4c-a978-314c952310a0	c8e44d71-ecbb-4a1f-86ef-5631d9a7442a	g.chr3:63649755T>C	ENST00000343837.3	+	4	448	c.428T>C	c.(427-429)gTa>gCa	p.V143A	SNTN_ENST00000496807.1_Intron	NM_001080537.1	NP_001074006.1	A6NMZ2	SNTAN_HUMAN	sentan, cilia apical structure protein	143						cilium (GO:0005929)	calcium ion binding (GO:0005509)			endometrium(2)|ovary(1)	3						ATACGGAATGTAAAAATTATG	0.284																																					p.V143A		.											.	SNTN-69	0			c.T428C						.						39.0	37.0	38.0					3																	63649755		2203	4300	6503	SO:0001583	missense	132203	exon4			GGAATGTAAAAAT	AK126350	CCDS33779.1	3p14.2	2009-03-10	2009-03-10		ENSG00000188817	ENSG00000188817			33706	protein-coding gene	gene with protein product	"""S100A-like protein"""					18829862	Standard	NM_001080537		Approved	FLJ44379, S100AL	uc003dlr.3	A6NMZ2	OTTHUMG00000158766	ENST00000343837.3:c.428T>C	3.37:g.63649755T>C	ENSP00000341442:p.Val143Ala	Somatic	164	0		WXS	Illumina GAIIx	Phase_I	130	9	NM_001080537	0	0	0	0	0	B7FF65	Missense_Mutation	SNP	ENST00000343837.3	37	CCDS33779.1	.	.	.	.	.	.	.	.	.	.	T	1.265	-0.614727	0.03663	.	.	ENSG00000188817	ENST00000343837	T	0.44083	0.93	5.51	-4.99	0.03010	.	1.700900	0.03085	N	0.158987	T	0.35189	0.0923	L	0.54323	1.7	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.20472	-1.0274	10	0.25751	T	0.34	.	8.1249	0.30992	0.11:0.4397:0.0:0.4504	.	143	A6NMZ2	SNTAN_HUMAN	A	143	ENSP00000341442:V143A	ENSP00000341442:V143A	V	+	2	0	SNTN	63624795	0.000000	0.05858	0.008000	0.14137	0.041000	0.13682	-0.569000	0.05902	-0.798000	0.04444	0.477000	0.44152	GTA	.		0.284	SNTN-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352094.1	NM_001080537	
DGKQ	1609	hgsc.bcm.edu	37	4	962100	962100	+	Silent	SNP	G	G	A	rs76581432	byFrequency	TCGA-OR-A5LN-01A-11D-A29I-10	TCGA-OR-A5LN-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	cf6a87e3-f084-4b4c-a978-314c952310a0	c8e44d71-ecbb-4a1f-86ef-5631d9a7442a	g.chr4:962100G>A	ENST00000273814.3	-	5	706	c.633C>T	c.(631-633)gcC>gcT	p.A211A	DGKQ_ENST00000502309.1_5'Flank	NM_001347.3	NP_001338.2	P52824	DGKQ_HUMAN	diacylglycerol kinase, theta 110kDa	211					blood coagulation (GO:0007596)|cAMP-mediated signaling (GO:0019933)|G-protein coupled receptor signaling pathway (GO:0007186)|platelet activation (GO:0030168)|protein kinase C signaling (GO:0070528)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to ATP (GO:0033198)|thrombin receptor signaling pathway (GO:0070493)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	activating transcription factor binding (GO:0033613)|ATP binding (GO:0005524)|diacylglycerol kinase activity (GO:0004143)|kinase binding (GO:0019900)|metal ion binding (GO:0046872)|NAD+ kinase activity (GO:0003951)|phospholipase binding (GO:0043274)			breast(1)|endometrium(2)|kidney(2)|lung(2)|prostate(2)	9			OV - Ovarian serous cystadenocarcinoma(23;0.0158)			AGCGCACGCCGGCCAGCACGT	0.721													g|||	107	0.0213658	0.0749	0.0086	5008	,	,		7507	0.0		0.002	False		,,,				2504	0.0				p.A211A	Esophageal Squamous(17;537 645 4447 26373)	.											.	DGKQ-537	0			c.C633T						.			239,3839		5,229,1805	9.0	8.0	8.0		633	-8.9	0.1	4	dbSNP_131	8	9,8119		0,9,4055	no	coding-synonymous	DGKQ	NM_001347.2		5,238,5860	AA,AG,GG		0.1107,5.8607,2.0318		211/943	962100	248,11958	2039	4064	6103	SO:0001819	synonymous_variant	1609	exon5			CACGCCGGCCAGC	L38707	CCDS3342.1	4p16.3	2008-08-29	2002-08-29		ENSG00000145214	ENSG00000145214			2856	protein-coding gene	gene with protein product		601207	"""diacylglycerol kinase, theta (110kD)"""	DAGK4		8617502, 9099683	Standard	NM_001347		Approved	DAGK, DAGK7	uc003gbw.4	P52824	OTTHUMG00000088629	ENST00000273814.3:c.633C>T	4.37:g.962100G>A		Somatic	1	0		WXS	Illumina GAIIx	Phase_I	82	37	NM_001347	0	0	1	1	0	Q6P3W4	Silent	SNP	ENST00000273814.3	37	CCDS3342.1	52	0.023809523809523808	48	0.0975609756097561	3	0.008287292817679558	0	0.0	1	0.0013192612137203166	G	3.725	-0.056784	0.07362	0.058607	0.001107	ENSG00000145214	ENST00000509465	.	.	.	4.47	-8.94	0.00768	.	.	.	.	.	T	0.00875	0.0029	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.31641	-0.9936	4	.	.	.	.	1.2907	0.02060	0.4309:0.095:0.1675:0.3066	.	.	.	.	L	158	.	.	P	-	2	0	DGKQ	952100	0.000000	0.05858	0.056000	0.19401	0.246000	0.25737	-3.667000	0.00398	-1.695000	0.01423	-1.327000	0.01280	CCG	G|0.976;A|0.024		0.721	DGKQ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000200888.1		
SLC26A1	10861	hgsc.bcm.edu	37	4	985372	985372	+	Silent	SNP	C	C	T	rs36084010	byFrequency	TCGA-OR-A5LN-01A-11D-A29I-10	TCGA-OR-A5LN-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	cf6a87e3-f084-4b4c-a978-314c952310a0	c8e44d71-ecbb-4a1f-86ef-5631d9a7442a	g.chr4:985372C>T	ENST00000361661.2	-	3	497	c.120G>A	c.(118-120)tcG>tcA	p.S40S	IDUA_ENST00000247933.4_Intron|SLC26A1_ENST00000398520.2_Silent_p.S40S|SLC26A1_ENST00000513138.1_5'Flank|IDUA_ENST00000453894.1_Intron|SLC26A1_ENST00000398516.2_Silent_p.S40S	NM_213613.2	NP_998778.1	Q9H2B4	S26A1_HUMAN	solute carrier family 26 (anion exchanger), member 1	40					3'-phosphoadenosine 5'-phosphosulfate biosynthetic process (GO:0050428)|3'-phosphoadenosine 5'-phosphosulfate metabolic process (GO:0050427)|carbohydrate metabolic process (GO:0005975)|chloride transport (GO:0006821)|glycosaminoglycan metabolic process (GO:0030203)|ion transport (GO:0006811)|oxalate transport (GO:0019532)|small molecule metabolic process (GO:0044281)|sulfate transmembrane transport (GO:1902358)|sulfate transport (GO:0008272)|transmembrane transport (GO:0055085)|xenobiotic metabolic process (GO:0006805)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	anion:anion antiporter activity (GO:0015301)|chloride transmembrane transporter activity (GO:0015108)|oxalate transmembrane transporter activity (GO:0019531)|secondary active sulfate transmembrane transporter activity (GO:0008271)|sulfate transmembrane transporter activity (GO:0015116)			central_nervous_system(1)|endometrium(4)|pancreas(1)|prostate(1)|skin(1)	8			OV - Ovarian serous cystadenocarcinoma(23;0.0158)			GCACACTGCACGAGCAGCTGC	0.721													C|||	136	0.0271565	0.0961	0.0101	5008	,	,		16221	0.0		0.002	False		,,,				2504	0.0				p.S40S		.											.	SLC26A1-91	0			c.G120A						.	C	,,,	365,4025		15,335,1845	21.0	20.0	20.0		,120,120,120	-10.9	0.0	4	dbSNP_126	20	7,8573		0,7,4283	no	intron,coding-synonymous,coding-synonymous,coding-synonymous	IDUA,SLC26A1	NM_000203.3,NM_022042.2,NM_134425.1,NM_213613.2	,,,	15,342,6128	TT,TC,CC		0.0816,8.3144,2.8682	,,,	,40/702,40/225,40/702	985372	372,12598	2195	4290	6485	SO:0001819	synonymous_variant	10861	exon2			ACTGCACGAGCAG	AF297659	CCDS33933.1, CCDS33934.1	4p16.3	2013-07-18	2013-07-18		ENSG00000145217	ENSG00000145217		"""Solute carriers"""	10993	protein-coding gene	gene with protein product		610130	"""solute carrier family 26 (sulfate transporter), member 1"""				Standard	NM_213613		Approved	SAT-1, EDM4	uc003gcc.3	Q9H2B4	OTTHUMG00000160003	ENST00000361661.2:c.120G>A	4.37:g.985372C>T		Somatic	1	0		WXS	Illumina GAIIx	Phase_I	68	32	NM_022042	0	0	0	1	1	A8K9N2|Q7Z5R3|Q96BK0	Silent	SNP	ENST00000361661.2	37	CCDS33934.1																																																																																			C|0.968;T|0.032		0.721	SLC26A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000358783.1	NM_022042, NM_134425	
CRIPAK	285464	hgsc.bcm.edu	37	4	1388755	1388755	+	Silent	SNP	C	C	G	rs373946226	byFrequency	TCGA-OR-A5LN-01A-11D-A29I-10	TCGA-OR-A5LN-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	cf6a87e3-f084-4b4c-a978-314c952310a0	c8e44d71-ecbb-4a1f-86ef-5631d9a7442a	g.chr4:1388755C>G	ENST00000324803.4	+	1	3416	c.456C>G	c.(454-456)ccC>ccG	p.P152P		NM_175918.3	NP_787114.2	Q8N1N5	CRPAK_HUMAN	cysteine-rich PAK1 inhibitor	152					negative regulation of intracellular estrogen receptor signaling pathway (GO:0033147)|negative regulation of protein kinase activity (GO:0006469)|regulation of cytoskeleton organization (GO:0051493)|response to estrogen (GO:0043627)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				NS(3)|breast(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(11)|ovary(1)|pancreas(2)|prostate(6)|skin(4)|urinary_tract(1)	35			OV - Ovarian serous cystadenocarcinoma(23;0.0106)			CACACGTGCCCATGCGGAGTG	0.697													N|||	566	0.113019	0.0772	0.1657	5008	,	,		16075	0.0139		0.1441	False		,,,				2504	0.1943				p.P152P		.											.	CRIPAK-90	0			c.C456G						.						75.0	67.0	69.0					4																	1388755		2201	4282	6483	SO:0001819	synonymous_variant	285464	exon1			CGTGCCCATGCGG	AK096209	CCDS3349.1	4p16.3	2011-02-10	2006-09-04		ENSG00000179979	ENSG00000179979			26619	protein-coding gene	gene with protein product		610203	"""cysteine-rich PAK1inhibitor"""			16278681	Standard	NM_175918		Approved	FLJ34443	uc003gdf.2	Q8N1N5	OTTHUMG00000121131	ENST00000324803.4:c.456C>G	4.37:g.1388755C>G		Somatic	11	0		WXS	Illumina GAIIx	Phase_I	154	50	NM_175918	0	0	9	25	16	Q8NB03	Silent	SNP	ENST00000324803.4	37	CCDS3349.1	.	.	.	.	.	.	.	.	.	.	-	3.606	-0.080629	0.07141	.	.	ENSG00000179979	ENST00000382944	.	.	.	0.948	-1.9	0.07665	.	.	.	.	.	T	0.13713	0.0332	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.26643	-1.0097	5	0.12430	T	0.62	.	2.6602	0.05024	0.0:0.3324:0.2607:0.407	.	.	.	.	D	136	.	ENSP00000372402:H136D	H	+	1	0	CRIPAK	1378755	0.000000	0.05858	0.001000	0.08648	0.018000	0.09664	-4.277000	0.00261	-0.599000	0.05798	-1.737000	0.00689	CAT	C|0.960;G|0.040		0.697	CRIPAK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000241607.2	NM_175918	
ADRA2C	152	broad.mit.edu	37	4	3769013	3769013	+	Missense_Mutation	SNP	G	G	T	rs530828101		TCGA-OR-A5LN-01A-11D-A29I-10	TCGA-OR-A5LN-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	cf6a87e3-f084-4b4c-a978-314c952310a0	c8e44d71-ecbb-4a1f-86ef-5631d9a7442a	g.chr4:3769013G>T	ENST00000330055.5	+	1	889	c.680G>T	c.(679-681)gGc>gTc	p.G227V	ADRA2C_ENST00000509482.1_Missense_Mutation_p.G227V	NM_000683.3	NP_000674.2	P18825	ADA2C_HUMAN	adrenoceptor alpha 2C	227					activation of MAPK activity by adrenergic receptor signaling pathway (GO:0071883)|activation of protein kinase B activity (GO:0032148)|blood coagulation (GO:0007596)|cell-cell signaling (GO:0007267)|energy reserve metabolic process (GO:0006112)|epidermal growth factor-activated receptor transactivation by G-protein coupled receptor signaling pathway (GO:0035625)|female pregnancy (GO:0007565)|G-protein coupled receptor signaling pathway (GO:0007186)|negative regulation of epinephrine secretion (GO:0032811)|negative regulation of norepinephrine secretion (GO:0010700)|negative regulation of uterine smooth muscle contraction (GO:0070473)|platelet activation (GO:0030168)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of vasoconstriction (GO:0045907)|regulation of insulin secretion (GO:0050796)|regulation of sensory perception of pain (GO:0051930)|small molecule metabolic process (GO:0044281)	axon terminus (GO:0043679)|cytoplasm (GO:0005737)|endosome (GO:0005768)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	alpha-2A adrenergic receptor binding (GO:0031694)|alpha2-adrenergic receptor activity (GO:0004938)|epinephrine binding (GO:0051379)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)			endometrium(2)|kidney(1)|large_intestine(1)|lung(4)	8				UCEC - Uterine corpus endometrioid carcinoma (64;0.163)	Amoxapine(DB00543)|Amphetamine(DB00182)|Apomorphine(DB00714)|Aripiprazole(DB01238)|Asenapine(DB06216)|Bethanidine(DB00217)|Brimonidine(DB00484)|Bromocriptine(DB01200)|Cabergoline(DB00248)|Carvedilol(DB01136)|Chlorpromazine(DB00477)|Clonidine(DB00575)|Clozapine(DB00363)|Desipramine(DB01151)|Doxepin(DB01142)|Dronedarone(DB04855)|Droxidopa(DB06262)|Ephedra(DB01363)|Epinephrine(DB00668)|Ergoloid mesylate(DB01049)|Fenoldopam(DB00800)|Iloperidone(DB04946)|Lisuride(DB00589)|Loxapine(DB00408)|Lurasidone(DB08815)|Maprotiline(DB00934)|Mephentermine(DB01365)|Methamphetamine(DB01577)|Methotrimeprazine(DB01403)|Mianserin(DB06148)|Mirtazapine(DB00370)|Norepinephrine(DB00368)|Nortriptyline(DB00540)|Olanzapine(DB00334)|Oxymetazoline(DB00935)|Paliperidone(DB01267)|Pergolide(DB01186)|Phenoxybenzamine(DB00925)|Pramipexole(DB00413)|Quetiapine(DB01224)|Risperidone(DB00734)|Ropinirole(DB00268)|Tizanidine(DB00697)|Tolazoline(DB00797)|Xylometazoline(DB06694)|Yohimbine(DB01392)|Ziprasidone(DB00246)	CTCATCATGGGCCTGGTCTAC	0.701																																					p.G227V	Esophageal Squamous(12;454 628 4517 14479)	.											.	ADRA2C-522	0			c.G680T						.																																			SO:0001583	missense	152	exon1			TCATGGGCCTGGT	AY455666	CCDS47004.1	4p16.3	2013-10-22	2012-05-09		ENSG00000184160	ENSG00000184160		"""GPCR / Class A : Adrenoceptors : alpha"""	283	protein-coding gene	gene with protein product		104250	"""adrenergic, alpha-2C-, receptor"""	ADRA2L2, ADRA2RL2		1849485	Standard	NM_000683		Approved	ADRARL2	uc003ghm.3	P18825	OTTHUMG00000159830	ENST00000330055.5:c.680G>T	4.37:g.3769013G>T	ENSP00000386069:p.Gly227Val	Somatic	41	0		WXS	Illumina GAIIx	Phase_I	214	9	NM_000683	0	0	0	0	0	P35369|Q9HB49	Missense_Mutation	SNP	ENST00000330055.5	37	CCDS47004.1	.	.	.	.	.	.	.	.	.	.	G	11.72	1.724021	0.30593	.	.	ENSG00000184160	ENST00000509482;ENST00000330055	T;T	0.70164	-0.46;-0.46	3.93	1.77	0.24775	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	T	0.30448	0.0765	N	0.00424	-1.51	0.52501	D	0.999957	B;B	0.16603	0.018;0.009	B;B	0.18871	0.023;0.007	T	0.07271	-1.0781	9	0.30078	T	0.28	.	10.6241	0.45497	0.0:0.0:0.501:0.499	.	227;227	D6RGL0;P18825	.;ADA2C_HUMAN	V	227	ENSP00000426268:G227V;ENSP00000386069:G227V	ENSP00000386069:G227V	G	+	2	0	ADRA2C	3738811	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	3.602000	0.54066	0.588000	0.29660	0.511000	0.50034	GGC	.		0.701	ADRA2C-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357607.1	NM_000683	
OTOP1	133060	broad.mit.edu	37	4	4228274	4228282	+	In_Frame_Del	DEL	CCACAGCAG	CCACAGCAG	-	rs75328065|rs199840382|rs111245977|rs377667898|rs200554408|rs201436152	byFrequency	TCGA-OR-A5LN-01A-11D-A29I-10	TCGA-OR-A5LN-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	cf6a87e3-f084-4b4c-a978-314c952310a0	c8e44d71-ecbb-4a1f-86ef-5631d9a7442a	g.chr4:4228274_4228282delCCACAGCAG	ENST00000296358.4	-	1	334_342	c.310_318delCTGCTGTGG	c.(310-318)ctgctgtggdel	p.LLW104del		NM_177998.1	NP_819056.1	Q7RTM1	OTOP1_HUMAN	otopetrin 1	104					biomineral tissue development (GO:0031214)|detection of gravity (GO:0009590)|inner ear morphogenesis (GO:0042472)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)		p.L104_W106delLLW(1)		NS(1)|breast(1)|central_nervous_system(2)|endometrium(1)|kidney(2)|large_intestine(3)|liver(4)|lung(14)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	34				UCEC - Uterine corpus endometrioid carcinoma (64;0.168)		ACCACAGCATCCACAGCAGCTGCAGCAGC	0.727																																					p.104_106del		.											.	OTOP1-92	1	Deletion - In frame(1)	upper_aerodigestive_tract(1)	c.310_318del						.																																			SO:0001651	inframe_deletion	133060	exon1			CAGCATCCACAGC	BK000653	CCDS3372.1	4p16.2	2008-02-05			ENSG00000163982	ENSG00000163982			19656	protein-coding gene	gene with protein product		607806				12651873	Standard	NM_177998		Approved		uc003ghp.1	Q7RTM1	OTTHUMG00000090301	ENST00000296358.4:c.310_318delCTGCTGTGG	4.37:g.4228274_4228282delCCACAGCAG	ENSP00000296358:p.Leu104_Trp106del	Somatic	10	0		WXS	Illumina GAIIx	Phase_I	78	7	NM_177998	0	0	0	0	0	A1L476	In_Frame_Del	DEL	ENST00000296358.4	37	CCDS3372.1																																																																																			.		0.727	OTOP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206661.2	NM_177998	
OTOP1	133060	hgsc.bcm.edu	37	4	4228456	4228456	+	Silent	SNP	G	G	T	rs73191872		TCGA-OR-A5LN-01A-11D-A29I-10	TCGA-OR-A5LN-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	cf6a87e3-f084-4b4c-a978-314c952310a0	c8e44d71-ecbb-4a1f-86ef-5631d9a7442a	g.chr4:4228456G>T	ENST00000296358.4	-	1	160	c.136C>A	c.(136-138)Cgg>Agg	p.R46R		NM_177998.1	NP_819056.1	Q7RTM1	OTOP1_HUMAN	otopetrin 1	46					biomineral tissue development (GO:0031214)|detection of gravity (GO:0009590)|inner ear morphogenesis (GO:0042472)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)				NS(1)|breast(1)|central_nervous_system(2)|endometrium(1)|kidney(2)|large_intestine(3)|liver(4)|lung(14)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	34				UCEC - Uterine corpus endometrioid carcinoma (64;0.168)		ACAccgccccgccggggggcc	0.736																																					p.R46R		.											.	OTOP1-92	0			c.C136A						.						4.0	4.0	4.0					4																	4228456		1989	3880	5869	SO:0001819	synonymous_variant	133060	exon1			CGCCCCGCCGGGG	BK000653	CCDS3372.1	4p16.2	2008-02-05			ENSG00000163982	ENSG00000163982			19656	protein-coding gene	gene with protein product		607806				12651873	Standard	NM_177998		Approved		uc003ghp.1	Q7RTM1	OTTHUMG00000090301	ENST00000296358.4:c.136C>A	4.37:g.4228456G>T		Somatic	3	0		WXS	Illumina GAIIx	Phase_I	91	14	NM_177998	0	0	0	0	0	A1L476	Silent	SNP	ENST00000296358.4	37	CCDS3372.1																																																																																			.		0.736	OTOP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206661.2	NM_177998	
GPR78	27201	hgsc.bcm.edu	37	4	8583212	8583212	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5LN-01A-11D-A29I-10	TCGA-OR-A5LN-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	cf6a87e3-f084-4b4c-a978-314c952310a0	c8e44d71-ecbb-4a1f-86ef-5631d9a7442a	g.chr4:8583212G>A	ENST00000382487.4	+	1	920	c.503G>A	c.(502-504)cGc>cAc	p.R168H	GPR78_ENST00000509216.1_Intron	NM_080819.4	NP_543009.2	Q96P69	GPR78_HUMAN	G protein-coupled receptor 78	168					adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			central_nervous_system(4)|kidney(4)|large_intestine(1)|lung(8)|ovary(3)|prostate(3)|skin(1)|upper_aerodigestive_tract(2)	26						GAGCGTCCGCGCTTCGCAGCC	0.701																																					p.R168H		.											.	GPR78-516	0			c.G503A						.						10.0	10.0	10.0					4																	8583212		2122	4180	6302	SO:0001583	missense	27201	exon1			GTCCGCGCTTCGC	AF411107	CCDS3403.1	4p16.1	2012-08-21			ENSG00000155269	ENSG00000155269		"""GPCR / Class A : Orphans"""	4528	protein-coding gene	gene with protein product		606921				11574155	Standard	NM_080819		Approved		uc003glk.4	Q96P69	OTTHUMG00000128483	ENST00000382487.4:c.503G>A	4.37:g.8583212G>A	ENSP00000371927:p.Arg168His	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	21	10	NM_080819	0	0	0	0	0	Q8NGV3	Missense_Mutation	SNP	ENST00000382487.4	37	CCDS3403.1	.	.	.	.	.	.	.	.	.	.	G	9.381	1.073045	0.20147	.	.	ENSG00000155269	ENST00000382487	T	0.37058	1.22	2.32	1.44	0.22558	GPCR, rhodopsin-like superfamily (1);	0.248866	0.28659	U	0.014571	T	0.17152	0.0412	L	0.31926	0.97	0.31693	N	0.641702	P	0.42456	0.78	B	0.28849	0.095	T	0.33624	-0.9861	10	0.14252	T	0.57	.	7.6032	0.28087	0.139:0.0:0.861:0.0	.	168	Q96P69	GPR78_HUMAN	H	168	ENSP00000371927:R168H	ENSP00000371927:R168H	R	+	2	0	GPR78	8634112	0.103000	0.21917	0.054000	0.19295	0.209000	0.24338	1.043000	0.30316	-0.039000	0.13602	0.313000	0.20887	CGC	.		0.701	GPR78-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359201.1		
DHX15	1665	bcgsc.ca	37	4	24556528	24556528	+	Missense_Mutation	SNP	G	G	T			TCGA-OR-A5LN-01A-11D-A29I-10	TCGA-OR-A5LN-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	cf6a87e3-f084-4b4c-a978-314c952310a0	c8e44d71-ecbb-4a1f-86ef-5631d9a7442a	g.chr4:24556528G>T	ENST00000336812.4	-	5	1056	c.900C>A	c.(898-900)ttC>ttA	p.F300L		NM_001358.2	NP_001349.2	O43143	DHX15_HUMAN	DEAH (Asp-Glu-Ala-His) box helicase 15	300	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.				mRNA processing (GO:0006397)|RNA splicing (GO:0008380)	nucleus (GO:0005634)|U12-type spliceosomal complex (GO:0005689)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|double-stranded RNA binding (GO:0003725)|poly(A) RNA binding (GO:0044822)|RNA helicase activity (GO:0003724)			breast(4)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(5)|liver(1)|lung(6)|ovary(1)|upper_aerodigestive_tract(1)	30		Breast(46;0.0503)				AGTAAATCTGGAATTTTCCTG	0.378																																					p.F300L		.											.	DHX15-91	0			c.C900A						.						91.0	85.0	87.0					4																	24556528		2203	4300	6503	SO:0001583	missense	1665	exon5			AATCTGGAATTTT	AB001636	CCDS33966.1	4p15.3	2013-05-13	2013-05-13	2003-06-20	ENSG00000109606	ENSG00000109606		"""DEAH-boxes"""	2738	protein-coding gene	gene with protein product		603403	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 15"", ""DEAH (Asp-Glu-Ala-His) box polypeptide 15"""	DDX15		9388478	Standard	NM_001358		Approved	HRH2, DBP1, PRP43, PrPp43p, PRPF43	uc003gqx.3	O43143	OTTHUMG00000160304	ENST00000336812.4:c.900C>A	4.37:g.24556528G>T	ENSP00000336741:p.Phe300Leu	Somatic	46	0		WXS	Illumina GAIIx	Phase_I	57	4	NM_001358	0	0	4	4	0	Q9NQT7	Missense_Mutation	SNP	ENST00000336812.4	37	CCDS33966.1	.	.	.	.	.	.	.	.	.	.	G	24.9	4.582575	0.86748	.	.	ENSG00000109606	ENST00000336812;ENST00000535946	T	0.23348	1.91	6.16	4.15	0.48705	DEAD-like helicase (2);ATPase, AAA+ type, core (1);	0.000000	0.85682	D	0.000000	T	0.50171	0.1600	M	0.82630	2.6	0.80722	D	1	D	0.76494	0.999	D	0.72075	0.976	T	0.55392	-0.8148	10	0.87932	D	0	-27.2782	9.6108	0.39661	0.2402:0.0:0.7598:0.0	.	300	O43143	DHX15_HUMAN	L	300;289	ENSP00000336741:F300L	ENSP00000336741:F300L	F	-	3	2	DHX15	24165626	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	2.214000	0.42853	1.616000	0.50265	0.650000	0.86243	TTC	.		0.378	DHX15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000360143.1	NM_001358	
LPHN3	23284	broad.mit.edu	37	4	62897212	62897212	+	Missense_Mutation	SNP	G	G	T			TCGA-OR-A5LN-01A-11D-A29I-10	TCGA-OR-A5LN-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	cf6a87e3-f084-4b4c-a978-314c952310a0	c8e44d71-ecbb-4a1f-86ef-5631d9a7442a	g.chr4:62897212G>T	ENST00000514591.1	+	22	3600	c.3271G>T	c.(3271-3273)Gcc>Tcc	p.A1091S	LPHN3_ENST00000508693.1_Missense_Mutation_p.A1159S|LPHN3_ENST00000508946.1_Missense_Mutation_p.A1091S|LPHN3_ENST00000512091.2_Missense_Mutation_p.A1091S|LPHN3_ENST00000545650.1_Missense_Mutation_p.A1091S|LPHN3_ENST00000504896.1_Missense_Mutation_p.A1091S|LPHN3_ENST00000506720.1_Missense_Mutation_p.A1159S|LPHN3_ENST00000507625.1_Missense_Mutation_p.A1150S|LPHN3_ENST00000514996.1_Missense_Mutation_p.A1082S|LPHN3_ENST00000509896.1_Missense_Mutation_p.A1159S|LPHN3_ENST00000514157.1_Missense_Mutation_p.A1082S|LPHN3_ENST00000507164.1_Missense_Mutation_p.A1150S|LPHN3_ENST00000506746.1_Missense_Mutation_p.A1150S|LPHN3_ENST00000506700.1_Missense_Mutation_p.A1082S|LPHN3_ENST00000511324.1_Missense_Mutation_p.A1150S			Q9HAR2	LPHN3_HUMAN	latrophilin 3	1069					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)|G-protein coupled receptor activity (GO:0004930)			breast(5)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(5)|kidney(4)|large_intestine(21)|lung(73)|ovary(1)|pancreas(1)|prostate(6)|upper_aerodigestive_tract(1)	125						ATTGACCTGGGCCTTTGGACT	0.353																																					p.A1091S		.											.	LPHN3-508	0			c.G3271T						.						136.0	129.0	131.0					4																	62897212		1849	4093	5942	SO:0001583	missense	23284	exon20			ACCTGGGCCTTTG	AB018311	CCDS54768.1	4q13.1	2014-08-08				ENSG00000150471		"""-"", ""GPCR / Class B : Orphans"""	20974	protein-coding gene	gene with protein product						10994649	Standard	NM_015236		Approved	KIAA0768, LEC3	uc010ihh.3	Q9HAR2		ENST00000514591.1:c.3271G>T	4.37:g.62897212G>T	ENSP00000422533:p.Ala1091Ser	Somatic	73	0		WXS	Illumina GAIIx	Phase_I	99	4	NM_015236	0	0	2	2	0	E9PE04|O94867|Q9NWK5	Missense_Mutation	SNP	ENST00000514591.1	37	CCDS54768.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	15.74|15.74	2.923296|2.923296	0.52653|0.52653	.|.	.|.	ENSG00000150471|ENSG00000150471	ENST00000512091;ENST00000514591;ENST00000509896;ENST00000511324;ENST00000506700;ENST00000545650;ENST00000295349;ENST00000280009;ENST00000507164;ENST00000508693;ENST00000507625;ENST00000514157;ENST00000504896;ENST00000508946;ENST00000506720;ENST00000506746;ENST00000514996|ENST00000502815	T;T;T;T;T;T;T;T;T;T;T;T;T;T;T|.	0.42131|.	0.98;0.98;0.98;0.98;0.98;0.98;0.98;0.98;0.98;0.98;0.98;0.98;0.98;0.98;0.98|.	5.49|5.49	5.49|5.49	0.81192|0.81192	GPCR, family 2-like (1);|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.38108|0.38108	0.1028|0.1028	N|N	0.05351|0.05351	-0.065|-0.065	0.80722|0.80722	D|D	1|1	D;D;D|.	0.76494|.	0.999;0.999;0.998|.	D;D;D|.	0.83275|.	0.996;0.996;0.994|.	T|T	0.28073|0.28073	-1.0055|-1.0055	10|5	0.13853|.	T|.	0.58|.	.|.	14.238|14.238	0.65938|0.65938	0.0:0.0:0.8509:0.1491|0.0:0.0:0.8509:0.1491	.|.	1091;1069;1091|.	E9PE04;Q9HAR2;Q9HAR2-2|.	.;LPHN3_HUMAN;.|.	S|V	1091;1091;1159;1150;1082;1091;1069;1091;1150;1159;1150;1082;1091;1091;1159;1150;1082|539	ENSP00000423388:A1091S;ENSP00000422533:A1091S;ENSP00000423787:A1159S;ENSP00000425033:A1150S;ENSP00000424120:A1082S;ENSP00000439831:A1091S;ENSP00000421476:A1150S;ENSP00000424030:A1159S;ENSP00000421372:A1150S;ENSP00000425201:A1082S;ENSP00000423434:A1091S;ENSP00000421627:A1091S;ENSP00000420931:A1159S;ENSP00000425884:A1150S;ENSP00000424258:A1082S|.	ENSP00000280009:A1091S|.	A|G	+|+	1|2	0|0	LPHN3|LPHN3	62579807|62579807	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.999000|0.999000	0.98932|0.98932	5.502000|5.502000	0.66956|0.66956	2.584000|2.584000	0.87258|0.87258	0.655000|0.655000	0.94253|0.94253	GCC|GGC	.		0.353	LPHN3-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000361765.1		
SOWAHB	345079	hgsc.bcm.edu	37	4	77818202	77818202	+	Silent	SNP	T	T	C	rs2645674	byFrequency	TCGA-OR-A5LN-01A-11D-A29I-10	TCGA-OR-A5LN-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	cf6a87e3-f084-4b4c-a978-314c952310a0	c8e44d71-ecbb-4a1f-86ef-5631d9a7442a	g.chr4:77818202T>C	ENST00000334306.2	-	1	800	c.801A>G	c.(799-801)acA>acG	p.T267T		NM_001029870.1	NP_001025041.1	A6NEL2	SWAHB_HUMAN	sosondowah ankyrin repeat domain family member B	267	Ala-rich.																AAGCCCTGCTTGTCGCAGCCT	0.726													C|||	1670	0.333466	0.4887	0.2392	5008	,	,		13358	0.2292		0.332	False		,,,				2504	0.2996				p.T267T		.											.	.	0			c.A801G						.	C		1258,2610		207,844,883	3.0	5.0	4.0		801	-3.8	0.0	4	dbSNP_100	4	1803,5973		226,1351,2311	no	coding-synonymous	ANKRD56	NM_001029870.1		433,2195,3194	CC,CT,TT		23.1867,32.5233,26.2882		267/794	77818202	3061,8583	1934	3888	5822	SO:0001819	synonymous_variant	345079	exon1			CCTGCTTGTCGCA		CCDS34017.1	4q21.1	2013-01-10	2012-01-12	2012-01-12	ENSG00000186212	ENSG00000186212		"""Ankyrin repeat domain containing"""	32958	protein-coding gene	gene with protein product			"""ankyrin repeat domain 56"""	ANKRD56		22234889	Standard	NM_001029870		Approved		uc003hki.3	A6NEL2	OTTHUMG00000160876	ENST00000334306.2:c.801A>G	4.37:g.77818202T>C		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	11	5	NM_001029870	0	0	0	0	0	B2RP29	Silent	SNP	ENST00000334306.2	37	CCDS34017.1																																																																																			T|0.691;C|0.309		0.726	SOWAHB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000362762.1	NM_001029870	
PRDM8	56978	hgsc.bcm.edu	37	4	81123603	81123603	+	Silent	SNP	G	G	T	rs6831357	byFrequency	TCGA-OR-A5LN-01A-11D-A29I-10	TCGA-OR-A5LN-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	cf6a87e3-f084-4b4c-a978-314c952310a0	c8e44d71-ecbb-4a1f-86ef-5631d9a7442a	g.chr4:81123603G>T	ENST00000504452.1	+	8	1826	c.987G>T	c.(985-987)ctG>ctT	p.L329L	PRDM8_ENST00000339711.4_Silent_p.L329L|PRDM8_ENST00000415738.2_Silent_p.L329L			Q9NQV8	PRDM8_HUMAN	PR domain containing 8	329	Gly-rich.				corpus callosum morphogenesis (GO:0021540)|corticospinal tract morphogenesis (GO:0021957)|negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|histone methyltransferase activity (H3-K9 specific) (GO:0046974)|metal ion binding (GO:0046872)|transcription corepressor activity (GO:0003714)			breast(2)|central_nervous_system(1)|endometrium(1)|large_intestine(2)|lung(2)|skin(2)	10						GCGCTGGTCTGGTAGGGGGCC	0.706													G|||	309	0.0617013	0.2216	0.0231	5008	,	,		9086	0.0		0.0	False		,,,				2504	0.0				p.L329L		.											.	PRDM8-91	0			c.G987T						.	G	,	274,1802		1,272,765	2.0	2.0	2.0		987,987	4.0	0.9	4	dbSNP_116	2	7,5213		0,7,2603	no	coding-synonymous,coding-synonymous	PRDM8	NM_001099403.1,NM_020226.3	,	1,279,3368	TT,TG,GG		0.1341,13.1985,3.8514	,	329/690,329/690	81123603	281,7015	1038	2610	3648	SO:0001819	synonymous_variant	56978	exon4			TGGTCTGGTAGGG	AF275815	CCDS43243.1	4q21	2008-08-21				ENSG00000152784			13993	protein-coding gene	gene with protein product							Standard	NM_020226		Approved		uc003hmc.4	Q9NQV8		ENST00000504452.1:c.987G>T	4.37:g.81123603G>T		Somatic	1	0		WXS	Illumina GAIIx	Phase_I	7	7	NM_001099403	0	0	0	0	0	A8K7X2|Q6IQ36	Silent	SNP	ENST00000504452.1	37	CCDS43243.1																																																																																			G|0.933;T|0.067		0.706	PRDM8-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000362793.1		
DSPP	1834	bcgsc.ca	37	4	88536535	88536535	+	Silent	SNP	T	T	C	rs376565023		TCGA-OR-A5LN-01A-11D-A29I-10	TCGA-OR-A5LN-10A-01D-A29L-10	T	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	cf6a87e3-f084-4b4c-a978-314c952310a0	c8e44d71-ecbb-4a1f-86ef-5631d9a7442a	g.chr4:88536535T>C	ENST00000282478.7	+	4	2754	c.2721T>C	c.(2719-2721)gaT>gaC	p.D907D	RP11-742B18.1_ENST00000506480.1_RNA|DSPP_ENST00000399271.1_Silent_p.D907D			Q9NZW4	DSPP_HUMAN	dentin sialophosphoprotein	907	Asp/Ser-rich.				biomineral tissue development (GO:0031214)|cellular response to cell-matrix adhesion (GO:0071460)|extracellular matrix organization (GO:0030198)|multicellular organismal development (GO:0007275)|ossification (GO:0001503)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|collagen binding (GO:0005518)|extracellular matrix structural constituent (GO:0005201)			breast(2)|central_nervous_system(1)|endometrium(9)|kidney(4)|large_intestine(8)|lung(13)|ovary(1)|skin(3)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	47		Hepatocellular(203;0.114)|all_hematologic(202;0.236)		OV - Ovarian serous cystadenocarcinoma(123;0.000508)		acagcagtgatagcagcaaca	0.483																																					p.D907D		.											.	DSPP-90	0			c.T2721C						.						76.0	96.0	89.0					4																	88536535		1648	2961	4609	SO:0001819	synonymous_variant	1834	exon5			CAGTGATAGCAGC	AF163151	CCDS43248.1	4q21.3	2008-02-05			ENSG00000152591	ENSG00000152591			3054	protein-coding gene	gene with protein product		125485		DFNA39, DGI1		8995371, 9533027	Standard	NM_014208		Approved	DMP3	uc003hqu.3	Q9NZW4	OTTHUMG00000161061	ENST00000282478.7:c.2721T>C	4.37:g.88536535T>C		Somatic	700	0		WXS	Illumina GAIIx	Phase_I	1185	73	NM_014208	0	0	0	0	0	A8MUI0|O95815	Silent	SNP	ENST00000282478.7	37	CCDS43248.1																																																																																			.		0.483	DSPP-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000363616.3	NM_014208	
C4orf27	54969	hgsc.bcm.edu	37	4	170678999	170678999	+	Silent	SNP	G	G	C	rs61997073	byFrequency	TCGA-OR-A5LN-01A-11D-A29I-10	TCGA-OR-A5LN-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	cf6a87e3-f084-4b4c-a978-314c952310a0	c8e44d71-ecbb-4a1f-86ef-5631d9a7442a	g.chr4:170678999G>C	ENST00000393381.2	-	1	105	c.30C>G	c.(28-30)ccC>ccG	p.P10P		NM_017867.2	NP_060337.2	Q9NWY4	CD027_HUMAN	chromosome 4 open reading frame 27	10						nucleus (GO:0005634)				NS(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(4)|ovary(1)|pancreas(1)	12		Prostate(90;0.00601)|Renal(120;0.0183)		GBM - Glioblastoma multiforme(119;0.018)|LUSC - Lung squamous cell carcinoma(193;0.116)		CCTCTCCGCCGGGCCTGCGCT	0.697													G|||	73	0.0145767	0.0484	0.0101	5008	,	,		12661	0.0		0.002	False		,,,				2504	0.0				p.P10P		.											.	C4orf27-92	0			c.C30G						.	G		96,3972		1,94,1939	5.0	5.0	5.0		30	0.7	0.2	4	dbSNP_129	5	7,8045		0,7,4019	no	coding-synonymous	C4orf27	NM_017867.2		1,101,5958	CC,CG,GG		0.0869,2.3599,0.8498		10/347	170678999	103,12017	2034	4026	6060	SO:0001819	synonymous_variant	54969	exon1			TCCGCCGGGCCTG	BC010367	CCDS3813.1	4q33	2011-01-25			ENSG00000056050	ENSG00000056050			26051	protein-coding gene	gene with protein product						11230166	Standard	NM_017867		Approved	FLJ20534	uc003isl.4	Q9NWY4	OTTHUMG00000160960	ENST00000393381.2:c.30C>G	4.37:g.170678999G>C		Somatic	2	0		WXS	Illumina GAIIx	Phase_I	47	19	NM_017867	0	0	0	2	2		Silent	SNP	ENST00000393381.2	37	CCDS3813.1																																																																																			G|0.955;C|0.045		0.697	C4orf27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000363140.1	NM_017867	
SLCO6A1	133482	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	101816044	101816044	+	Silent	SNP	G	G	A	rs143064096	byFrequency	TCGA-OR-A5LN-01A-11D-A29I-10	TCGA-OR-A5LN-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	cf6a87e3-f084-4b4c-a978-314c952310a0	c8e44d71-ecbb-4a1f-86ef-5631d9a7442a	g.chr5:101816044G>A	ENST00000506729.1	-	2	624	c.453C>T	c.(451-453)taC>taT	p.Y151Y	SLCO6A1_ENST00000379810.1_Silent_p.Y151Y|SLCO6A1_ENST00000389019.3_Silent_p.Y151Y|SLCO6A1_ENST00000513675.1_Silent_p.Y151Y|SLCO6A1_ENST00000514551.1_Intron|SLCO6A1_ENST00000379807.3_Silent_p.Y151Y			Q86UG4	SO6A1_HUMAN	solute carrier organic anion transporter family, member 6A1	151						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	transporter activity (GO:0005215)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(17)|lung(22)|ovary(3)|prostate(4)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	60		all_cancers(142;8e-09)|all_epithelial(76;2.83e-12)|Prostate(80;0.00125)|Colorectal(57;0.00342)|Ovarian(225;0.024)|Lung NSC(167;0.0259)|all_lung(232;0.0323)		Epithelial(69;1.47e-15)|COAD - Colon adenocarcinoma(37;0.0113)		ATGAAATATCGTAACTCTTTT	0.358													G|||	5	0.000998403	0.0038	0.0	5008	,	,		17487	0.0		0.0	False		,,,				2504	0.0				p.Y151Y		.											.	SLCO6A1-96	0			c.C453T						.	G		20,4386	27.2+/-55.0	0,20,2183	126.0	127.0	127.0		453	0.8	0.4	5	dbSNP_134	127	1,8599		0,1,4299	no	coding-synonymous	SLCO6A1	NM_173488.3		0,21,6482	AA,AG,GG		0.0116,0.4539,0.1615		151/720	101816044	21,12985	2203	4300	6503	SO:0001819	synonymous_variant	133482	exon2			AATATCGTAACTC	AF505657	CCDS34206.1, CCDS75282.1	5q21.2	2013-05-22			ENSG00000205359	ENSG00000205359		"""Solute carriers"""	23613	protein-coding gene	gene with protein product	"""cancer/testis antigen 48"""	613365					Standard	XM_005271874		Approved	OATP6A1, OATPY, MGC26949, CT48	uc003knp.3	Q86UG4	OTTHUMG00000162759	ENST00000506729.1:c.453C>T	5.37:g.101816044G>A		Somatic	131	0		WXS	Illumina GAIIx	Phase_I	141	35	NM_173488	0	0	0	0	0	A6NHC1|Q6ZMY5|Q86UV2|Q8IYU5	Silent	SNP	ENST00000506729.1	37	CCDS34206.1																																																																																			G|0.998;A|0.002		0.358	SLCO6A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000370335.1	NM_173488	
PCDHB7	56129	broad.mit.edu	37	5	140553994	140553994	+	Silent	SNP	G	G	T	rs374392843		TCGA-OR-A5LN-01A-11D-A29I-10	TCGA-OR-A5LN-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	cf6a87e3-f084-4b4c-a978-314c952310a0	c8e44d71-ecbb-4a1f-86ef-5631d9a7442a	g.chr5:140553994G>T	ENST00000231137.3	+	1	1752	c.1578G>T	c.(1576-1578)gcG>gcT	p.A526A		NM_018940.2	NP_061763.1	Q9Y5E2	PCDB7_HUMAN	protocadherin beta 7	526	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.A526A(1)		NS(2)|breast(2)|central_nervous_system(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(20)|lung(54)|ovary(5)|prostate(7)|skin(7)|upper_aerodigestive_tract(4)|urinary_tract(1)	119			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			CCCTGCAGGCGTTCGAGTTCC	0.706													g|||	1	0.000199681	0.0	0.0	5008	,	,		16269	0.0		0.001	False		,,,				2504	0.0				p.A526A		.											.	PCDHB7-95	1	Substitution - coding silent(1)	lung(1)	c.G1578T						.						62.0	68.0	66.0					5																	140553994		2203	4300	6503	SO:0001819	synonymous_variant	56129	exon1			GCAGGCGTTCGAG	AF152500	CCDS4249.1	5q31	2010-01-26			ENSG00000113212	ENSG00000113212		"""Cadherins / Protocadherins : Clustered"""	8692	other	protocadherin		606333				10380929	Standard	NM_018940		Approved	PCDH-BETA7	uc003lit.3	Q9Y5E2	OTTHUMG00000129608	ENST00000231137.3:c.1578G>T	5.37:g.140553994G>T		Somatic	119	0		WXS	Illumina GAIIx	Phase_I	504	14	NM_018940	0	0	3	6	3	A1L3Y8	Silent	SNP	ENST00000231137.3	37	CCDS4249.1																																																																																			.		0.706	PCDHB7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251803.2	NM_018940	
PCDHB10	56126	hgsc.bcm.edu	37	5	140573834	140573834	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5LN-01A-11D-A29I-10	TCGA-OR-A5LN-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	cf6a87e3-f084-4b4c-a978-314c952310a0	c8e44d71-ecbb-4a1f-86ef-5631d9a7442a	g.chr5:140573834C>T	ENST00000239446.4	+	1	1893	c.1709C>T	c.(1708-1710)gCg>gTg	p.A570V		NM_018930.3	NP_061753.1	Q9UN67	PCDBA_HUMAN	protocadherin beta 10	570	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|homophilic cell adhesion (GO:0007156)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(14)|lung(30)|ovary(4)|prostate(5)|skin(3)|upper_aerodigestive_tract(4)|urinary_tract(2)	76			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			AACGGCTCCGCGCCCTGCACC	0.726																																					p.A570V		.											.	PCDHB10-92	0			c.C1709T						.						7.0	10.0	9.0					5																	140573834		1713	3685	5398	SO:0001583	missense	56126	exon1			GCTCCGCGCCCTG	AF152489	CCDS4252.1	5q31.3	2010-06-15			ENSG00000120324	ENSG00000120324		"""Cadherins / Protocadherins : Clustered"""	8681	other	protocadherin		606336				10380929	Standard	NM_018930		Approved		uc003lix.3	Q9UN67	OTTHUMG00000129626	ENST00000239446.4:c.1709C>T	5.37:g.140573834C>T	ENSP00000239446:p.Ala570Val	Somatic	2	0		WXS	Illumina GAIIx	Phase_I	101	20	NM_018930	0	0	7	7	0	Q96T99	Missense_Mutation	SNP	ENST00000239446.4	37	CCDS4252.1	.	.	.	.	.	.	.	.	.	.	c	12.82	2.051546	0.36181	.	.	ENSG00000120324	ENST00000239446	T	0.60299	0.2	3.53	2.65	0.31530	Cadherin-like (1);	.	.	.	.	T	0.52741	0.1753	M	0.76574	2.34	0.09310	N	1	P	0.40476	0.718	B	0.31614	0.133	T	0.54774	-0.8243	9	0.62326	D	0.03	.	11.3453	0.49556	0.0:0.9017:0.0:0.0983	.	570	Q9UN67	PCDBA_HUMAN	V	570	ENSP00000239446:A570V	ENSP00000239446:A570V	A	+	2	0	PCDHB10	140554018	.	.	0.963000	0.40424	0.739000	0.42172	.	.	1.994000	0.58287	0.549000	0.68633	GCG	.		0.726	PCDHB10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251821.1	NM_018930	
PPP1R3G	648791	hgsc.bcm.edu	37	6	5086211	5086211	+	Silent	SNP	G	G	C	rs584962		TCGA-OR-A5LN-01A-11D-A29I-10	TCGA-OR-A5LN-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	cf6a87e3-f084-4b4c-a978-314c952310a0	c8e44d71-ecbb-4a1f-86ef-5631d9a7442a	g.chr6:5086211G>C	ENST00000405617.2	+	1	492	c.492G>C	c.(490-492)ctG>ctC	p.L164L		NM_001145115.1	NP_001138587.1	B7ZBB8	PP13G_HUMAN	protein phosphatase 1, regulatory subunit 3G	164					glucose homeostasis (GO:0042593)|positive regulation of glycogen (starch) synthase activity (GO:2000467)|positive regulation of glycogen biosynthetic process (GO:0045725)	cytoplasm (GO:0005737)	glycogen binding (GO:2001069)			kidney(2)	2						TCTCGCGCCTGCGAAGCTTCC	0.736													C|||	5008	1.0	1.0	1.0	5008	,	,		12118	1.0		1.0	False		,,,				2504	1.0				p.L164L		.											.	PPP1R3G-136	0			c.G492C						.						1.0	2.0	1.0					6																	5086211		271	872	1143	SO:0001819	synonymous_variant	648791	exon1			GCGCCTGCGAAGC		CCDS47366.1	6p25.1	2012-04-17	2011-10-04		ENSG00000219607	ENSG00000219607		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	14945	protein-coding gene	gene with protein product			"""protein phosphatase 1, regulatory (inhibitor) subunit 3G"""			11948623	Standard	NM_001145115		Approved		uc011dia.1	B7ZBB8	OTTHUMG00000014172	ENST00000405617.2:c.492G>C	6.37:g.5086211G>C		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	7	7	NM_001145115	0	0	0	2	2		Silent	SNP	ENST00000405617.2	37	CCDS47366.1																																																																																			G|0.000;C|1.000		0.736	PPP1R3G-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039740.3	NM_001145115	
RREB1	6239	hgsc.bcm.edu	37	6	7230680	7230680	+	Missense_Mutation	SNP	G	G	T	rs9502564	byFrequency	TCGA-OR-A5LN-01A-11D-A29I-10	TCGA-OR-A5LN-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	cf6a87e3-f084-4b4c-a978-314c952310a0	c8e44d71-ecbb-4a1f-86ef-5631d9a7442a	g.chr6:7230680G>T	ENST00000349384.6	+	10	2662	c.2348G>T	c.(2347-2349)gGc>gTc	p.G783V	RREB1_ENST00000334984.6_Missense_Mutation_p.G783V|RREB1_ENST00000379938.2_Missense_Mutation_p.G783V|RREB1_ENST00000379933.3_Missense_Mutation_p.G783V	NM_001003698.3	NP_001003698.1	Q92766	RREB1_HUMAN	ras responsive element binding protein 1	783			G -> V (in dbSNP:rs9502564). {ECO:0000269|PubMed:15067362, ECO:0000269|PubMed:21703425}.		multicellular organismal development (GO:0007275)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription, DNA-templated (GO:0045893)|Ras protein signal transduction (GO:0007265)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nuclear body (GO:0016604)|nucleolus (GO:0005730)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(5)|lung(18)|ovary(5)|pancreas(2)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	58	Ovarian(93;0.0398)	all_hematologic(90;0.0384)|Prostate(151;0.191)				CTGGGCGGGGGCCACAAGGGC	0.697													G|||	2678	0.534744	0.5333	0.4063	5008	,	,		15583	0.7411		0.2893	False		,,,				2504	0.6677				p.G783V		.											.	RREB1-144	0			c.G2348T						.	G	VAL/GLY,VAL/GLY,VAL/GLY,VAL/GLY	2083,2197		552,979,609	9.0	9.0	9.0		2348,2348,2348,2348	5.3	1.0	6	dbSNP_119	9	2599,5719		488,1623,2048	yes	missense,missense,missense,missense	RREB1	NM_001003698.3,NM_001003699.3,NM_001003700.1,NM_001168344.1	109,109,109,109	1040,2602,2657	TT,TG,GG		31.2455,48.6682,37.1646	benign,benign,benign,benign	783/1688,783/1743,783/1477,783/1688	7230680	4682,7916	2140	4159	6299	SO:0001583	missense	6239	exon10			GCGGGGGCCACAA	U26914	CCDS34335.1, CCDS34336.1, CCDS54963.1	6p25	2013-01-08			ENSG00000124782	ENSG00000124782		"""Zinc fingers, C2H2-type"""	10449	protein-coding gene	gene with protein product	"""hindsight homolog (drosophila)"""	602209				9367691, 18394891	Standard	NM_001003698		Approved	HNT	uc003mxb.3	Q92766	OTTHUMG00000014201	ENST00000349384.6:c.2348G>T	6.37:g.7230680G>T	ENSP00000305560:p.Gly783Val	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	12	11	NM_001003700	0	0	1	1	0	A2RRF5|E2GM80|E2GM81|O75567|O75568|Q5VYB2|Q6BEP5|Q6BEP6|Q6BEP8|Q86SU2|Q9Y474	Missense_Mutation	SNP	ENST00000349384.6	37	CCDS34336.1	1014	0.4642857142857143	249	0.5060975609756098	148	0.4088397790055249	412	0.7202797202797203	205	0.2704485488126649	G	11.15	1.553554	0.27739	0.486682	0.312455	ENSG00000124782	ENST00000379933;ENST00000379938;ENST00000349384;ENST00000334984	T;T;T;T	0.09163	3.07;3.07;3.07;3.01	5.32	5.32	0.75619	.	0.278837	0.31370	N	0.007766	T	0.02533	0.0077	N	0.14661	0.345	0.21915	P	0.999474401	B;B;B	0.32653	0.161;0.379;0.328	B;B;B	0.35182	0.079;0.197;0.178	T	0.45512	-0.9256	9	0.13108	T	0.6	-17.3998	11.4207	0.49980	0.0:0.0:0.8202:0.1797	rs9502564	783;783;783	Q92766-3;Q92766;Q92766-2	.;RREB1_HUMAN;.	V	783	ENSP00000369265:G783V;ENSP00000369270:G783V;ENSP00000305560:G783V;ENSP00000335574:G783V	ENSP00000335574:G783V	G	+	2	0	RREB1	7175679	1.000000	0.71417	0.996000	0.52242	0.833000	0.47200	5.477000	0.66799	2.760000	0.94817	0.655000	0.94253	GGC	G|0.546;T|0.454		0.697	RREB1-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000352985.1		
C6orf136	221545	hgsc.bcm.edu	37	6	30615244	30615244	+	Intron	SNP	G	G	A	rs28360037	byFrequency	TCGA-OR-A5LN-01A-11D-A29I-10	TCGA-OR-A5LN-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	cf6a87e3-f084-4b4c-a978-314c952310a0	c8e44d71-ecbb-4a1f-86ef-5631d9a7442a	g.chr6:30615244G>A	ENST00000376473.5	+	1	231				C6orf136_ENST00000293604.6_Missense_Mutation_p.G79E|C6orf136_ENST00000376471.4_Intron|AL662800.2_ENST00000583820.1_RNA|C6orf136_ENST00000493705.1_Intron|C6orf136_ENST00000528347.2_5'Flank	NM_001109938.2	NP_001103408.1	Q5SQH8	CF136_HUMAN	chromosome 6 open reading frame 136							mitochondrion (GO:0005739)				endometrium(1)|large_intestine(2)|lung(6)|ovary(1)	10						GGGGTCGCGGGAGCGGGAGGG	0.761													G|||	211	0.0421326	0.0968	0.0576	5008	,	,		11076	0.0		0.0427	False		,,,				2504	0.0				p.G79E		.											.	C6orf136-90	0			c.G236A						.						2.0	3.0	3.0					6																	30615244		458	1204	1662	SO:0001627	intron_variant	221545	exon1			TCGCGGGAGCGGG	BC016167	CCDS4684.1, CCDS43443.1, CCDS4684.2, CCDS54979.1	6p21.32	2012-02-06			ENSG00000204564	ENSG00000204564			21301	protein-coding gene	gene with protein product							Standard	NM_001109938		Approved	Em:AB023049.8	uc003nqx.4	Q5SQH8	OTTHUMG00000031221	ENST00000376473.5:c.72+164G>A	6.37:g.30615244G>A		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	30	18	NM_001161376	0	0	0	0	0	A9R9P9|F8VX15|Q5SU01|Q6ZSB7|Q8TB84	Missense_Mutation	SNP	ENST00000376473.5	37	CCDS43443.1	130	0.05952380952380952	67	0.13617886178861788	30	0.08287292817679558	3	0.005244755244755245	30	0.0395778364116095	G	18.04	3.534998	0.64972	.	.	ENSG00000204564	ENST00000293604;ENST00000446773	.	.	.	3.87	-0.288	0.12855	.	.	.	.	.	T	0.15132	0.0365	.	.	.	0.58432	P	5.000000000032756E-6	B	0.14012	0.009	B	0.12156	0.007	T	0.13683	-1.0500	6	0.87932	D	0	.	4.0933	0.09980	0.3211:0.1758:0.5032:0.0	rs28360037	79	F8VX15	.	E	79;16	.	ENSP00000293604:G79E	G	+	2	0	C6orf136	30723223	0.002000	0.14202	0.000000	0.03702	0.031000	0.12232	0.999000	0.29757	-0.194000	0.10399	0.655000	0.94253	GGA	G|0.939;A|0.061		0.761	C6orf136-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076457.4	NM_145029	
DNAH8	1769	hgsc.bcm.edu;bcgsc.ca	37	6	38813530	38813530	+	Missense_Mutation	SNP	G	G	T			TCGA-OR-A5LN-01A-11D-A29I-10	TCGA-OR-A5LN-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	cf6a87e3-f084-4b4c-a978-314c952310a0	c8e44d71-ecbb-4a1f-86ef-5631d9a7442a	g.chr6:38813530G>T	ENST00000359357.3	+	34	4629	c.4375G>T	c.(4375-4377)Ggg>Tgg	p.G1459W	DNAH8_ENST00000441566.1_Missense_Mutation_p.G1459W|DNAH8_ENST00000449981.2_Missense_Mutation_p.G1676W			Q96JB1	DYH8_HUMAN	dynein, axonemal, heavy chain 8	1459					cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(7)|breast(9)|central_nervous_system(4)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(3)|kidney(16)|large_intestine(44)|liver(4)|lung(101)|ovary(7)|pancreas(2)|prostate(8)|skin(28)|stomach(4)|upper_aerodigestive_tract(6)|urinary_tract(4)	260						AATGGTCTTAGGGTCTTTACT	0.353																																					p.G1676W		.											.	DNAH8-615	0			c.G5026T						.						102.0	107.0	105.0					6																	38813530		2203	4299	6502	SO:0001583	missense	1769	exon36			GTCTTAGGGTCTT	Z83806	CCDS75447.1	6p21.2	2012-04-19	2006-09-04		ENSG00000124721	ENSG00000124721		"""Axonemal dyneins"""	2952	protein-coding gene	gene with protein product		603337	"""dynein, axonemal, heavy polypeptide 8"""			9373155	Standard	NM_001206927		Approved	hdhc9	uc021yzh.1	Q96JB1	OTTHUMG00000016253	ENST00000359357.3:c.4375G>T	6.37:g.38813530G>T	ENSP00000352312:p.Gly1459Trp	Somatic	68	0		WXS	Illumina GAIIx	Phase_I	56	4	NM_001206927	0	0	0	0	0	O00438|Q5JYI2|Q5T2M3|Q5T2M4|Q5TG00|Q9UEM4	Missense_Mutation	SNP	ENST00000359357.3	37		.	.	.	.	.	.	.	.	.	.	G	18.56	3.651363	0.67472	.	.	ENSG00000124721	ENST00000449981;ENST00000327475;ENST00000359357;ENST00000441566	T;T;T	0.61392	0.11;0.11;0.11	5.49	2.69	0.31865	Dynein heavy chain, domain-2 (1);	0.241534	0.40818	N	0.001012	T	0.71796	0.3382	M	0.90595	3.13	0.50813	D	0.999893	D	0.89917	1.0	D	0.91635	0.999	T	0.77202	-0.2674	10	0.72032	D	0.01	.	11.2039	0.48758	0.204:0.0:0.796:0.0	.	1459	Q96JB1	DYH8_HUMAN	W	1664;1664;1459;1459	ENSP00000333363:G1664W;ENSP00000352312:G1459W;ENSP00000402294:G1459W	ENSP00000333363:G1664W	G	+	1	0	DNAH8	38921508	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	3.751000	0.55165	0.686000	0.31488	0.644000	0.83932	GGG	.		0.353	DNAH8-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000043574.1	NM_001206927	
KCNK17	89822	hgsc.bcm.edu	37	6	39282036	39282036	+	Missense_Mutation	SNP	T	T	C	rs10947804	byFrequency	TCGA-OR-A5LN-01A-11D-A29I-10	TCGA-OR-A5LN-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	cf6a87e3-f084-4b4c-a978-314c952310a0	c8e44d71-ecbb-4a1f-86ef-5631d9a7442a	g.chr6:39282036T>C	ENST00000373231.4	-	1	293	c.61A>G	c.(61-63)Agc>Ggc	p.S21G	KCNK17_ENST00000453413.2_Missense_Mutation_p.S21G	NM_031460.3	NP_113648.2	Q96T54	KCNKH_HUMAN	potassium channel, subfamily K, member 17	21			S -> G (in dbSNP:rs10947804). {ECO:0000269|PubMed:11248242, ECO:0000269|PubMed:15489334}.		potassium ion transport (GO:0006813)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	potassium channel activity (GO:0005267)|voltage-gated ion channel activity (GO:0005244)			endometrium(1)|kidney(1)|large_intestine(3)|lung(6)|ovary(1)|skin(2)	14						AGCACGGTGCTGGGCACCGCG	0.761													T|||	2917	0.582468	0.8858	0.4553	5008	,	,		12417	0.4673		0.4851	False		,,,				2504	0.4816				p.S21G		.											.	KCNK17-227	0			c.A61G						.	T	GLY/SER,GLY/SER	3100,536		1364,372,82	3.0	4.0	3.0		61,61	2.1	0.0	6	dbSNP_120	3	4061,3263		1251,1559,852	yes	missense,missense	KCNK17	NM_001135111.1,NM_031460.3	56,56	2615,1931,934	CC,CT,TT		44.5522,14.7415,34.6624	benign,benign	21/272,21/333	39282036	7161,3799	1818	3662	5480	SO:0001583	missense	89822	exon1			CGGTGCTGGGCAC	AF358910	CCDS4842.1, CCDS47419.1	6p21	2012-03-07			ENSG00000124780	ENSG00000124780		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Two-P"""	14465	protein-coding gene	gene with protein product		607370				16382106	Standard	NM_031460		Approved	K2p17.1, TALK-2, TALK2, TASK4, TASK-4	uc003ooo.3	Q96T54	OTTHUMG00000014646	ENST00000373231.4:c.61A>G	6.37:g.39282036T>C	ENSP00000362328:p.Ser21Gly	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	24	23	NM_001135111	0	0	0	0	0	E9PB46|Q5TCF4|Q8TAW4|Q9BXD1|Q9H592	Missense_Mutation	SNP	ENST00000373231.4	37	CCDS4842.1	1214	0.5558608058608059	431	0.8760162601626016	173	0.47790055248618785	244	0.42657342657342656	366	0.48284960422163586	T	8.033	0.762256	0.15914	0.852585	0.554478	ENSG00000124780	ENST00000373231;ENST00000453413	T;T	0.56776	0.44;0.44	4.06	2.09	0.27110	.	1.425750	0.04586	N	0.395947	T	0.14184	0.0343	N	0.17082	0.46	0.80722	P	0.0	B;B	0.06786	0.001;0.0	B;B	0.04013	0.001;0.001	T	0.09122	-1.0689	9	0.21014	T	0.42	.	5.3388	0.15973	0.0:0.5516:0.0:0.4484	rs10947804;rs17845776;rs17858736;rs60349641	21;21	E9PB46;Q96T54	.;KCNKH_HUMAN	G	21	ENSP00000362328:S21G;ENSP00000401271:S21G	ENSP00000362328:S21G	S	-	1	0	KCNK17	39390014	0.000000	0.05858	0.003000	0.11579	0.032000	0.12392	-0.229000	0.09098	0.383000	0.24910	0.459000	0.35465	AGC	T|0.441;C|0.559		0.761	KCNK17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040453.2	NM_031460	
EEF1A1	1915	broad.mit.edu	37	6	74228721	74228721	+	Silent	SNP	G	G	A	rs567492289		TCGA-OR-A5LN-01A-11D-A29I-10	TCGA-OR-A5LN-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	cf6a87e3-f084-4b4c-a978-314c952310a0	c8e44d71-ecbb-4a1f-86ef-5631d9a7442a	g.chr6:74228721G>A	ENST00000316292.9	-	3	1546	c.555C>T	c.(553-555)ccC>ccT	p.P185P	EEF1A1_ENST00000309268.6_Silent_p.P185P|EEF1A1_ENST00000491404.1_5'UTR|EEF1A1_ENST00000331523.2_Silent_p.P185P	NM_001402.5	NP_001393.1	P68104	EF1A1_HUMAN	eukaryotic translation elongation factor 1 alpha 1	185	tr-type G.				cellular protein metabolic process (GO:0044267)|cellular response to epidermal growth factor stimulus (GO:0071364)|gene expression (GO:0010467)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)|translation (GO:0006412)|translational elongation (GO:0006414)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|eukaryotic translation elongation factor 1 complex (GO:0005853)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|poly(A) RNA binding (GO:0044822)|protein kinase binding (GO:0019901)|translation elongation factor activity (GO:0003746)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(2)|lung(6)|prostate(2)|skin(3)	18						CTACTGTGTCGGGGTTGTAGC	0.423											OREG0003891	type=REGULATORY REGION|Gene=EEF1A1|Dataset=Stanford ENCODE Dataset|EvidenceSubtype=Transient transfection luciferase assay																									p.P185P		.											.	EEF1A1-226	0			c.C555T						.																																			SO:0001819	synonymous_variant	1915	exon4			TGTGTCGGGGTTG	BC019669	CCDS4980.1	6q14.1	2010-06-30	2004-11-19		ENSG00000156508	ENSG00000156508			3189	protein-coding gene	gene with protein product		130590	"""leukocyte receptor cluster (LRC) member 7"""	EF1A, EEF1A, LENG7		8812466, 10941842	Standard	NM_001402		Approved	EE1A1	uc003phj.3	P68104	OTTHUMG00000015031	ENST00000316292.9:c.555C>T	6.37:g.74228721G>A		Somatic	64	1	1151	WXS	Illumina GAIIx	Phase_I	77	3	NM_001402	2	0	1144	1147	1	P04719|P04720|Q6IQ15	Silent	SNP	ENST00000316292.9	37	CCDS4980.1																																																																																			.		0.423	EEF1A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041210.2	NM_001402	
POU3F2	5454	hgsc.bcm.edu	37	6	99283376	99283376	+	Silent	SNP	T	T	G	rs195860	byFrequency	TCGA-OR-A5LN-01A-11D-A29I-10	TCGA-OR-A5LN-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	cf6a87e3-f084-4b4c-a978-314c952310a0	c8e44d71-ecbb-4a1f-86ef-5631d9a7442a	g.chr6:99283376T>G	ENST00000328345.5	+	1	797	c.627T>G	c.(625-627)ggT>ggG	p.G209G		NM_005604.3	NP_005595.2	P20265	PO3F2_HUMAN	POU class 3 homeobox 2	209					astrocyte development (GO:0014002)|cellular response to organic substance (GO:0071310)|cerebral cortex radially oriented cell migration (GO:0021799)|epidermis development (GO:0008544)|forebrain ventricular zone progenitor cell division (GO:0021869)|hypothalamus cell differentiation (GO:0021979)|myelination in peripheral nervous system (GO:0022011)|neurohypophysis development (GO:0021985)|neuron differentiation (GO:0030182)|positive regulation of cell proliferation (GO:0008284)|positive regulation of multicellular organism growth (GO:0040018)|regulation of axonogenesis (GO:0050770)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	identical protein binding (GO:0042802)|RNA polymerase II transcription coactivator activity (GO:0001105)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(2)|large_intestine(3)|lung(5)	10		all_cancers(76;1.56e-06)|Acute lymphoblastic leukemia(125;4.93e-10)|all_hematologic(75;3.55e-07)|all_epithelial(107;0.00893)|Colorectal(196;0.069)|Lung NSC(302;0.197)		BRCA - Breast invasive adenocarcinoma(108;0.0355)		AGCCGGCCGGTCTGCACCACC	0.736													G|||	4460	0.890575	0.8994	0.9121	5008	,	,		6412	0.9544		0.8598	False		,,,				2504	0.8292				p.G209G		.											.	POU3F2-90	0			c.T627G						.	G		3186,306		1453,280,13	4.0	4.0	4.0		627	3.1	1.0	6	dbSNP_79	4	6282,930		2738,806,62	no	coding-synonymous	POU3F2	NM_005604.2		4191,1086,75	GG,GT,TT		12.8952,8.7629,11.5471		209/444	99283376	9468,1236	1746	3606	5352	SO:0001819	synonymous_variant	5454	exon1			GGCCGGTCTGCAC	Z11933	CCDS5040.1	6q16.2	2011-06-20	2007-07-13		ENSG00000184486	ENSG00000184486		"""Homeoboxes / POU class"""	9215	protein-coding gene	gene with protein product		600494	"""POU domain class 3, transcription factor 2"""	OTF7		8441633	Standard	NM_005604		Approved	POUF3, BRN2, OCT7	uc003ppe.3	P20265	OTTHUMG00000015258	ENST00000328345.5:c.627T>G	6.37:g.99283376T>G		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	18	9	NM_005604	0	0	0	0	0	Q14960|Q86V54|Q9UJL0	Silent	SNP	ENST00000328345.5	37	CCDS5040.1																																																																																			T|0.089;G|0.911		0.736	POU3F2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041586.2		
CTGF	1490	hgsc.bcm.edu	37	6	132271952	132271952	+	Missense_Mutation	SNP	G	G	C	rs7451102		TCGA-OR-A5LN-01A-11D-A29I-10	TCGA-OR-A5LN-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	cf6a87e3-f084-4b4c-a978-314c952310a0	c8e44d71-ecbb-4a1f-86ef-5631d9a7442a	g.chr6:132271952G>C	ENST00000367976.3	-	2	447	c.247C>G	c.(247-249)Cac>Gac	p.H83D	RP11-69I8.3_ENST00000435287.1_RNA	NM_001901.2	NP_001892	P29279	CTGF_HUMAN	connective tissue growth factor	83	IGFBP N-terminal. {ECO:0000255|PROSITE- ProRule:PRU00653}.		H -> D (in dbSNP:rs7451102). {ECO:0000269|PubMed:1293144, ECO:0000269|PubMed:1654338, ECO:0000269|PubMed:9054739, ECO:0000269|Ref.12, ECO:0000269|Ref.4, ECO:0000269|Ref.5, ECO:0000269|Ref.6, ECO:0000269|Ref.7}.		angiogenesis (GO:0001525)|cartilage condensation (GO:0001502)|cell differentiation (GO:0030154)|cell migration (GO:0016477)|cell-matrix adhesion (GO:0007160)|cellular lipid metabolic process (GO:0044255)|chondrocyte proliferation (GO:0035988)|cytosolic calcium ion transport (GO:0060401)|DNA replication (GO:0006260)|epidermis development (GO:0008544)|extracellular matrix constituent secretion (GO:0070278)|fibroblast growth factor receptor signaling pathway (GO:0008543)|gene expression (GO:0010467)|integrin-mediated signaling pathway (GO:0007229)|intracellular signal transduction (GO:0035556)|lung development (GO:0030324)|negative regulation of cell death (GO:0060548)|negative regulation of gene expression (GO:0010629)|organ senescence (GO:0010260)|ossification (GO:0001503)|positive regulation of cardiac muscle contraction (GO:0060452)|positive regulation of cell activation (GO:0050867)|positive regulation of cell death (GO:0010942)|positive regulation of cell differentiation (GO:0045597)|positive regulation of cell proliferation (GO:0008284)|positive regulation of collagen biosynthetic process (GO:0032967)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of G0 to G1 transition (GO:0070318)|positive regulation of gene expression (GO:0010628)|positive regulation of JNK cascade (GO:0046330)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of stress fiber assembly (GO:0051496)|reactive oxygen species metabolic process (GO:0072593)|regulation of cell growth (GO:0001558)|regulation of chondrocyte differentiation (GO:0032330)|response to amino acid (GO:0043200)|response to anoxia (GO:0034059)|response to estradiol (GO:0032355)|response to fatty acid (GO:0070542)|response to glucose (GO:0009749)|response to mineralocorticoid (GO:0051385)|response to peptide hormone (GO:0043434)|response to wounding (GO:0009611)|small molecule metabolic process (GO:0044281)|tissue homeostasis (GO:0001894)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cell cortex (GO:0005938)|cis-Golgi network (GO:0005801)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)	heparin binding (GO:0008201)|insulin-like growth factor binding (GO:0005520)			breast(1)|endometrium(6)|kidney(1)|large_intestine(1)|lung(3)|prostate(1)	13	Breast(56;0.0602)			GBM - Glioblastoma multiforme(226;0.015)|OV - Ovarian serous cystadenocarcinoma(155;0.0169)		GAGCCGAAGTGACAGAATAGG	0.711													C|||	5007	0.9998	1.0	1.0	5008	,	,		8487	1.0		0.999	False		,,,				2504	1.0				p.H83D	Esophageal Squamous(127;510 1660 12817 24400 38449)	.											.	CTGF-90	0			c.C247G						.						7.0	8.0	7.0					6																	132271952		2119	4187	6306	SO:0001583	missense	1490	exon2			CGAAGTGACAGAA	X78947	CCDS5151.1	6q23.2	2008-02-05			ENSG00000118523	ENSG00000118523			2500	protein-coding gene	gene with protein product		121009				1654338	Standard	NM_001901		Approved	IGFBP8, CCN2	uc003qcz.3	P29279	OTTHUMG00000015573	ENST00000367976.3:c.247C>G	6.37:g.132271952G>C	ENSP00000356954:p.His83Asp	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	5	5	NM_001901	0	0	0	0	0	E1P578|Q6LCY0|Q96A79|Q96QX2|Q9UDL6	Missense_Mutation	SNP	ENST00000367976.3	37	CCDS5151.1	2184	1.0	492	1.0	362	1.0	572	1.0	758	1.0	C	8.018	0.758919	0.15846	.	.	ENSG00000118523	ENST00000367976	T	0.62232	0.04	5.28	5.28	0.74379	Insulin-like growth factor-binding protein, IGFBP (2);	0.048665	0.85682	N	0.000000	T	0.06781	0.0173	N	0.00042	-2.475	0.40675	P	0.017750000000000044	B	0.02656	0.0	B	0.01281	0.0	T	0.27739	-1.0065	9	0.02654	T	1	.	15.7931	0.78384	0.0:0.863:0.137:0.0	rs7451102;rs59294435	83	P29279	CTGF_HUMAN	D	83	ENSP00000356954:H83D	ENSP00000356954:H83D	H	-	1	0	CTGF	132313645	1.000000	0.71417	0.923000	0.36655	0.645000	0.38454	4.000000	0.57039	1.236000	0.43740	-0.293000	0.09583	CAC	G|0.000;C|1.000		0.711	CTGF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042239.2	NM_001901	
CTGF	1490	hgsc.bcm.edu	37	6	132271959	132271959	+	Silent	SNP	T	T	G	rs12206231		TCGA-OR-A5LN-01A-11D-A29I-10	TCGA-OR-A5LN-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	cf6a87e3-f084-4b4c-a978-314c952310a0	c8e44d71-ecbb-4a1f-86ef-5631d9a7442a	g.chr6:132271959T>G	ENST00000367976.3	-	2	440	c.240A>C	c.(238-240)ctA>ctC	p.L80L	RP11-69I8.3_ENST00000435287.1_RNA	NM_001901.2	NP_001892	P29279	CTGF_HUMAN	connective tissue growth factor	80	IGFBP N-terminal. {ECO:0000255|PROSITE- ProRule:PRU00653}.				angiogenesis (GO:0001525)|cartilage condensation (GO:0001502)|cell differentiation (GO:0030154)|cell migration (GO:0016477)|cell-matrix adhesion (GO:0007160)|cellular lipid metabolic process (GO:0044255)|chondrocyte proliferation (GO:0035988)|cytosolic calcium ion transport (GO:0060401)|DNA replication (GO:0006260)|epidermis development (GO:0008544)|extracellular matrix constituent secretion (GO:0070278)|fibroblast growth factor receptor signaling pathway (GO:0008543)|gene expression (GO:0010467)|integrin-mediated signaling pathway (GO:0007229)|intracellular signal transduction (GO:0035556)|lung development (GO:0030324)|negative regulation of cell death (GO:0060548)|negative regulation of gene expression (GO:0010629)|organ senescence (GO:0010260)|ossification (GO:0001503)|positive regulation of cardiac muscle contraction (GO:0060452)|positive regulation of cell activation (GO:0050867)|positive regulation of cell death (GO:0010942)|positive regulation of cell differentiation (GO:0045597)|positive regulation of cell proliferation (GO:0008284)|positive regulation of collagen biosynthetic process (GO:0032967)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of G0 to G1 transition (GO:0070318)|positive regulation of gene expression (GO:0010628)|positive regulation of JNK cascade (GO:0046330)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of stress fiber assembly (GO:0051496)|reactive oxygen species metabolic process (GO:0072593)|regulation of cell growth (GO:0001558)|regulation of chondrocyte differentiation (GO:0032330)|response to amino acid (GO:0043200)|response to anoxia (GO:0034059)|response to estradiol (GO:0032355)|response to fatty acid (GO:0070542)|response to glucose (GO:0009749)|response to mineralocorticoid (GO:0051385)|response to peptide hormone (GO:0043434)|response to wounding (GO:0009611)|small molecule metabolic process (GO:0044281)|tissue homeostasis (GO:0001894)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cell cortex (GO:0005938)|cis-Golgi network (GO:0005801)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)	heparin binding (GO:0008201)|insulin-like growth factor binding (GO:0005520)			breast(1)|endometrium(6)|kidney(1)|large_intestine(1)|lung(3)|prostate(1)	13	Breast(56;0.0602)			GBM - Glioblastoma multiforme(226;0.015)|OV - Ovarian serous cystadenocarcinoma(155;0.0169)		AGTGACAGAATAGGCCCTTGT	0.701													G|||	5008	1.0	1.0	1.0	5008	,	,		8368	1.0		1.0	False		,,,				2504	1.0				p.L80L	Esophageal Squamous(127;510 1660 12817 24400 38449)	.											.	CTGF-90	0			c.A240C						.						7.0	8.0	7.0					6																	132271959		2127	4192	6319	SO:0001819	synonymous_variant	1490	exon2			ACAGAATAGGCCC	X78947	CCDS5151.1	6q23.2	2008-02-05			ENSG00000118523	ENSG00000118523			2500	protein-coding gene	gene with protein product		121009				1654338	Standard	NM_001901		Approved	IGFBP8, CCN2	uc003qcz.3	P29279	OTTHUMG00000015573	ENST00000367976.3:c.240A>C	6.37:g.132271959T>G		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	5	5	NM_001901	0	0	0	0	0	E1P578|Q6LCY0|Q96A79|Q96QX2|Q9UDL6	Silent	SNP	ENST00000367976.3	37	CCDS5151.1																																																																																			T|0.000;G|1.000		0.701	CTGF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042239.2	NM_001901	
CTGF	1490	hgsc.bcm.edu	37	6	132271980	132271980	+	Silent	SNP	T	T	G	rs6934749		TCGA-OR-A5LN-01A-11D-A29I-10	TCGA-OR-A5LN-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	cf6a87e3-f084-4b4c-a978-314c952310a0	c8e44d71-ecbb-4a1f-86ef-5631d9a7442a	g.chr6:132271980T>G	ENST00000367976.3	-	2	419	c.219A>C	c.(217-219)ccA>ccC	p.P73P	RP11-69I8.3_ENST00000435287.1_RNA	NM_001901.2	NP_001892	P29279	CTGF_HUMAN	connective tissue growth factor	73	IGFBP N-terminal. {ECO:0000255|PROSITE- ProRule:PRU00653}.				angiogenesis (GO:0001525)|cartilage condensation (GO:0001502)|cell differentiation (GO:0030154)|cell migration (GO:0016477)|cell-matrix adhesion (GO:0007160)|cellular lipid metabolic process (GO:0044255)|chondrocyte proliferation (GO:0035988)|cytosolic calcium ion transport (GO:0060401)|DNA replication (GO:0006260)|epidermis development (GO:0008544)|extracellular matrix constituent secretion (GO:0070278)|fibroblast growth factor receptor signaling pathway (GO:0008543)|gene expression (GO:0010467)|integrin-mediated signaling pathway (GO:0007229)|intracellular signal transduction (GO:0035556)|lung development (GO:0030324)|negative regulation of cell death (GO:0060548)|negative regulation of gene expression (GO:0010629)|organ senescence (GO:0010260)|ossification (GO:0001503)|positive regulation of cardiac muscle contraction (GO:0060452)|positive regulation of cell activation (GO:0050867)|positive regulation of cell death (GO:0010942)|positive regulation of cell differentiation (GO:0045597)|positive regulation of cell proliferation (GO:0008284)|positive regulation of collagen biosynthetic process (GO:0032967)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of G0 to G1 transition (GO:0070318)|positive regulation of gene expression (GO:0010628)|positive regulation of JNK cascade (GO:0046330)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of stress fiber assembly (GO:0051496)|reactive oxygen species metabolic process (GO:0072593)|regulation of cell growth (GO:0001558)|regulation of chondrocyte differentiation (GO:0032330)|response to amino acid (GO:0043200)|response to anoxia (GO:0034059)|response to estradiol (GO:0032355)|response to fatty acid (GO:0070542)|response to glucose (GO:0009749)|response to mineralocorticoid (GO:0051385)|response to peptide hormone (GO:0043434)|response to wounding (GO:0009611)|small molecule metabolic process (GO:0044281)|tissue homeostasis (GO:0001894)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cell cortex (GO:0005938)|cis-Golgi network (GO:0005801)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)	heparin binding (GO:0008201)|insulin-like growth factor binding (GO:0005520)			breast(1)|endometrium(6)|kidney(1)|large_intestine(1)|lung(3)|prostate(1)	13	Breast(56;0.0602)			GBM - Glioblastoma multiforme(226;0.015)|OV - Ovarian serous cystadenocarcinoma(155;0.0169)		GCGGGTCGCATGGGTCGCGCT	0.716													G|||	5008	1.0	1.0	1.0	5008	,	,		7576	1.0		1.0	False		,,,				2504	1.0				p.P73P	Esophageal Squamous(127;510 1660 12817 24400 38449)	.											.	CTGF-90	0			c.A219C						.						6.0	8.0	7.0					6																	132271980		2100	4127	6227	SO:0001819	synonymous_variant	1490	exon2			GTCGCATGGGTCG	X78947	CCDS5151.1	6q23.2	2008-02-05			ENSG00000118523	ENSG00000118523			2500	protein-coding gene	gene with protein product		121009				1654338	Standard	NM_001901		Approved	IGFBP8, CCN2	uc003qcz.3	P29279	OTTHUMG00000015573	ENST00000367976.3:c.219A>C	6.37:g.132271980T>G		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	5	5	NM_001901	0	0	0	0	0	E1P578|Q6LCY0|Q96A79|Q96QX2|Q9UDL6	Silent	SNP	ENST00000367976.3	37	CCDS5151.1																																																																																			T|0.000;G|1.000		0.716	CTGF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042239.2	NM_001901	
MAP7	9053	hgsc.bcm.edu	37	6	136683828	136683828	+	Missense_Mutation	SNP	A	A	G	rs80342066	byFrequency	TCGA-OR-A5LN-01A-11D-A29I-10	TCGA-OR-A5LN-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	cf6a87e3-f084-4b4c-a978-314c952310a0	c8e44d71-ecbb-4a1f-86ef-5631d9a7442a	g.chr6:136683828A>G	ENST00000354570.3	-	11	1696	c.1286T>C	c.(1285-1287)aTg>aCg	p.M429T	MAP7_ENST00000454590.1_Missense_Mutation_p.M451T|MAP7_ENST00000544465.1_Missense_Mutation_p.M414T|RP3-406A7.3_ENST00000571188.1_RNA|MAP7_ENST00000438100.2_Missense_Mutation_p.M414T|MAP7_ENST00000432797.2_Missense_Mutation_p.M283T	NM_001198616.1|NM_001198617.1|NM_001198619.1|NM_003980.4	NP_001185545.1|NP_001185546.1|NP_001185548.1|NP_003971.1	Q14244	MAP7_HUMAN	microtubule-associated protein 7	429	Pro-rich.				cell morphogenesis (GO:0000902)|cell proliferation (GO:0008283)|establishment or maintenance of cell polarity (GO:0007163)|fertilization (GO:0009566)|germ cell development (GO:0007281)|glycosphingolipid metabolic process (GO:0006687)|homeostasis of number of cells (GO:0048872)|Leydig cell differentiation (GO:0033327)|microtubule bundle formation (GO:0001578)|microtubule cytoskeleton organization (GO:0000226)|nucleus organization (GO:0006997)|organ growth (GO:0035265)|protein localization to plasma membrane (GO:0072659)|response to osmotic stress (GO:0006970)|response to retinoic acid (GO:0032526)|Sertoli cell development (GO:0060009)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|microtubule cytoskeleton (GO:0015630)|plasma membrane (GO:0005886)	receptor binding (GO:0005102)|structural molecule activity (GO:0005198)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(10)|lung(11)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	33	Colorectal(23;0.24)			GBM - Glioblastoma multiforme(68;0.00199)|OV - Ovarian serous cystadenocarcinoma(155;0.00643)		agctggggccatggctggagc	0.577													G|||	114	0.0227636	0.034	0.0447	5008	,	,		14186	0.0288		0.0	False		,,,				2504	0.0092				p.M459T		.											.	MAP7-90	0			c.T1376C						.	G	THR/MET,THR/MET,THR/MET,THR/MET,THR/MET,THR/MET,THR/MET,THR/MET,THR/MET,THR/MET	125,4269		0,125,2072	13.0	15.0	15.0		1352,1376,1241,1352,1241,1175,1004,848,848,1286	-1.4	0.0	6	dbSNP_131	15	20,8566		0,20,4273	yes	missense,missense,missense,missense,missense,missense,missense,missense,missense,missense	MAP7	NM_001198608.1,NM_001198609.1,NM_001198611.1,NM_001198614.1,NM_001198615.1,NM_001198616.1,NM_001198617.1,NM_001198618.1,NM_001198619.1,NM_003980.4	81,81,81,81,81,81,81,81,81,81	0,145,6345	GG,GA,AA		0.2329,2.8448,1.1171	benign,benign,benign,benign,benign,benign,benign,benign,benign,benign	451/772,459/780,414/735,451/772,414/735,392/713,335/656,283/604,283/604,429/750	136683828	145,12835	2197	4293	6490	SO:0001583	missense	9053	exon11			GGGGCCATGGCTG	X73882	CCDS5178.1, CCDS56452.1, CCDS56453.1, CCDS56454.1, CCDS56455.1, CCDS75527.1, CCDS75528.1, CCDS75529.1	6q23.2	2008-07-28			ENSG00000135525	ENSG00000135525			6869	protein-coding gene	gene with protein product		604108				8408219	Standard	NM_003980		Approved	E-MAP-115	uc011edg.2	Q14244	OTTHUMG00000015646	ENST00000354570.3:c.1286T>C	6.37:g.136683828A>G	ENSP00000346581:p.Met429Thr	Somatic	1	0		WXS	Illumina GAIIx	Phase_I	13	7	NM_001198609	0	0	0	0	0	B7Z290|B7Z400|B7Z5S7|B7Z9U7|C9JPS0|E9PCP3|F5H1E2|Q7Z6S0|Q8TAU5|Q9NY82|Q9NY83	Missense_Mutation	SNP	ENST00000354570.3	37	CCDS5178.1	56	0.02564102564102564	19	0.03861788617886179	20	0.055248618784530384	17	0.02972027972027972	0	0.0	G	0.663	-0.805118	0.02819	0.028448	0.002329	ENSG00000135525	ENST00000354570;ENST00000454590;ENST00000544465;ENST00000438100;ENST00000432797;ENST00000345567	T;T;T;T;T	0.28069	1.63;1.63;1.63;1.63;1.63	4.39	-1.41	0.08941	.	6.730520	0.00166	N	0.000001	T	0.02304	0.0071	N	0.01352	-0.895	0.09310	N	1	B;B;B;B;B;B;B	0.02656	0.0;0.0;0.0;0.0;0.0;0.0;0.0	B;B;B;B;B;B;B	0.01281	0.0;0.0;0.0;0.0;0.0;0.0;0.0	T	0.18085	-1.0348	10	0.12430	T	0.62	42.5527	4.0735	0.09892	0.4443:0.0:0.296:0.2597	.	414;451;414;451;335;392;429	B7Z290;B7ZB64;F5H1E2;E9PCP3;F8W783;Q14244-2;Q14244	.;.;.;.;.;.;MAP7_HUMAN	T	429;451;414;414;283;335	ENSP00000346581:M429T;ENSP00000414712:M451T;ENSP00000445737:M414T;ENSP00000400790:M414T;ENSP00000414879:M283T	ENSP00000344217:M335T	M	-	2	0	MAP7	136725521	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	0.261000	0.18442	-0.755000	0.04709	-1.204000	0.01649	ATG	A|0.983;G|0.017		0.577	MAP7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042382.2	NM_003980	
GINM1	116254	hgsc.bcm.edu	37	6	149887586	149887586	+	Silent	SNP	G	G	A	rs11547034	byFrequency	TCGA-OR-A5LN-01A-11D-A29I-10	TCGA-OR-A5LN-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	cf6a87e3-f084-4b4c-a978-314c952310a0	c8e44d71-ecbb-4a1f-86ef-5631d9a7442a	g.chr6:149887586G>A	ENST00000367419.5	+	1	157	c.36G>A	c.(34-36)cgG>cgA	p.R12R	RP1-12G14.5_ENST00000446392.1_lincRNA	NM_138785.3	NP_620140.1	Q9NU53	GINM1_HUMAN	glycoprotein integral membrane 1	12						extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)											TCGCCCTCCGGCTCCTGCTGT	0.791													G|||	379	0.0756789	0.2738	0.0231	5008	,	,		8936	0.0		0.001	False		,,,				2504	0.0				p.R12R		.											.	.	0			c.G36A						.	G		634,3122		40,554,1284	4.0	5.0	5.0		36	1.1	0.3	6	dbSNP_120	5	14,7576		0,14,3781	no	coding-synonymous	C6orf72	NM_138785.3		40,568,5065	AA,AG,GG		0.1845,16.8797,5.7113		12/331	149887586	648,10698	1878	3795	5673	SO:0001819	synonymous_variant	116254	exon1			CCTCCGGCTCCTG	BC014320	CCDS5216.1	6q24.3	2012-07-20	2012-07-20	2012-07-20	ENSG00000055211	ENSG00000055211			21074	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 72"""	C6orf72			Standard	NM_138785		Approved	dJ12G14.2	uc003qmq.1	Q9NU53	OTTHUMG00000015789	ENST00000367419.5:c.36G>A	6.37:g.149887586G>A		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	29	16	NM_138785	0	0	0	1	1	B2RDY7|E1P5A2	Silent	SNP	ENST00000367419.5	37	CCDS5216.1																																																																																			G|0.934;A|0.066		0.791	GINM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042644.1	NM_138785	
PRR18	285800	hgsc.bcm.edu	37	6	166720806	166720806	+	Silent	SNP	G	G	C	rs911203	byFrequency	TCGA-OR-A5LN-01A-11D-A29I-10	TCGA-OR-A5LN-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	cf6a87e3-f084-4b4c-a978-314c952310a0	c8e44d71-ecbb-4a1f-86ef-5631d9a7442a	g.chr6:166720806G>C	ENST00000322583.3	-	1	1065	c.825C>G	c.(823-825)tcC>tcG	p.S275S		NM_175922.3	NP_787118.2	Q8N4B5	PRR18_HUMAN	proline rich 18	275										haematopoietic_and_lymphoid_tissue(2)|lung(1)	3		Breast(66;2.35e-05)|Ovarian(120;0.0606)|Prostate(117;0.0959)		OV - Ovarian serous cystadenocarcinoma(33;1.5e-19)|BRCA - Breast invasive adenocarcinoma(81;4.45e-06)|GBM - Glioblastoma multiforme(31;7.96e-05)		cggcagccgcggACTCCACGC	0.741													C|||	3992	0.797125	0.8525	0.6196	5008	,	,		7867	0.9206		0.7465	False		,,,				2504	0.773				p.S275S		.											.	PRR18-514	0			c.C825G						.	C		3541,683		1503,535,74	7.0	7.0	7.0		825	2.4	1.0	6	dbSNP_86	7	6180,2074		2355,1470,302	no	coding-synonymous	PRR18	NM_175922.3		3858,2005,376	CC,CG,GG		25.1272,16.1695,22.0949		275/296	166720806	9721,2757	2112	4127	6239	SO:0001819	synonymous_variant	285800	exon1			AGCCGCGGACTCC	BC034775	CCDS5291.1	6q27	2009-01-27	2009-01-27						28574	protein-coding gene	gene with protein product			"""proline rich region 18"""			12477932	Standard	NM_175922		Approved	MGC35308	uc003quw.1	Q8N4B5		ENST00000322583.3:c.825C>G	6.37:g.166720806G>C		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	7	7	NM_175922	0	0	0	0	0		Silent	SNP	ENST00000322583.3	37	CCDS5291.1																																																																																			G|0.796;C|0.204		0.741	PRR18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000392563.3	NM_175922	
VWDE	221806	hgsc.bcm.edu	37	7	12443312	12443312	+	Missense_Mutation	SNP	C	C	T	rs139879021	byFrequency	TCGA-OR-A5LN-01A-11D-A29I-10	TCGA-OR-A5LN-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	cf6a87e3-f084-4b4c-a978-314c952310a0	c8e44d71-ecbb-4a1f-86ef-5631d9a7442a	g.chr7:12443312C>T	ENST00000275358.3	-	1	219	c.31G>A	c.(31-33)Gcg>Acg	p.A11T		NM_001135924.1	NP_001129396.1	Q8N2E2	VWDE_HUMAN	von Willebrand factor D and EGF domains	11						extracellular region (GO:0005576)				breast(4)|endometrium(2)|kidney(1)|skin(1)	8						AACATCAGCGCGATCACCAGC	0.721													C|||	33	0.00658946	0.0234	0.0029	5008	,	,		14305	0.0		0.0	False		,,,				2504	0.0				p.A11T		.											.	VWDE-68	0			c.G31A						.	C	THR/ALA	33,1351		1,31,660	20.0	27.0	25.0		31	2.4	0.0	7	dbSNP_134	25	1,3181		0,1,1590	yes	missense	VWDE	NM_001135924.1	58	1,32,2250	TT,TC,CC		0.0314,2.3844,0.7446	benign	11/1591	12443312	34,4532	692	1591	2283	SO:0001583	missense	221806	exon1			TCAGCGCGATCAC		CCDS47544.1	7p21.3	2008-09-23			ENSG00000146530	ENSG00000146530			21897	protein-coding gene	gene with protein product						14702039, 16303743	Standard	NM_001135924		Approved	FLJ14712	uc003ssj.2	Q8N2E2	OTTHUMG00000152315	ENST00000275358.3:c.31G>A	7.37:g.12443312C>T	ENSP00000275358:p.Ala11Thr	Somatic	1	0		WXS	Illumina GAIIx	Phase_I	30	11	NM_001135924	0	0	0	0	0	B7ZM77|Q96SQ3	Missense_Mutation	SNP	ENST00000275358.3	37	CCDS47544.1	9	0.004120879120879121	8	0.016260162601626018	1	0.0027624309392265192	0	0.0	0	0.0	C	13.20	2.164755	0.38217	0.023844	3.14E-4	ENSG00000146530	ENST00000275358;ENST00000541006	D	0.82344	-1.6	3.28	2.38	0.29361	.	1.817110	0.02839	N	0.127729	T	0.58293	0.2112	L	0.36672	1.1	0.09310	N	1	P	0.43431	0.807	B	0.29663	0.105	T	0.61431	-0.7064	10	0.37606	T	0.19	.	7.8381	0.29382	0.2478:0.7522:0.0:0.0	.	11	Q8N2E2	VWDE_HUMAN	T	11	ENSP00000275358:A11T	ENSP00000275358:A11T	A	-	1	0	VWDE	12409837	0.001000	0.12720	0.005000	0.12908	0.107000	0.19398	0.623000	0.24447	0.953000	0.37825	0.491000	0.48974	GCG	C|0.996;T|0.004		0.721	VWDE-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000325870.3	XM_371878	
FKBP9	11328	hgsc.bcm.edu	37	7	32997323	32997323	+	Silent	SNP	G	G	A	rs141020449	byFrequency	TCGA-OR-A5LN-01A-11D-A29I-10	TCGA-OR-A5LN-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	cf6a87e3-f084-4b4c-a978-314c952310a0	c8e44d71-ecbb-4a1f-86ef-5631d9a7442a	g.chr7:32997323G>A	ENST00000242209.4	+	1	307	c.138G>A	c.(136-138)gaG>gaA	p.E46E	FKBP9_ENST00000538443.1_5'UTR|FKBP9_ENST00000538336.1_Silent_p.E46E|AVL9_ENST00000404479.1_Intron	NM_001284343.1|NM_007270.3	NP_001271272.1|NP_009201.2	O95302	FKBP9_HUMAN	FK506 binding protein 9, 63 kDa	46					chaperone-mediated protein folding (GO:0061077)|protein folding (GO:0006457)|protein peptidyl-prolyl isomerization (GO:0000413)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)	calcium ion binding (GO:0005509)|FK506 binding (GO:0005528)|peptidyl-prolyl cis-trans isomerase activity (GO:0003755)			central_nervous_system(13)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(6)|lung(9)|ovary(2)|upper_aerodigestive_tract(1)	39			GBM - Glioblastoma multiforme(11;0.0156)			TGCCCGACGAGTGCCCGCGCA	0.721													G|||	13	0.00259585	0.0091	0.0014	5008	,	,		10838	0.0		0.0	False		,,,				2504	0.0				p.E46E		.											.	FKBP9-651	0			c.G138A						.	G		31,4177		0,31,2073	8.0	8.0	8.0		138	3.5	1.0	7	dbSNP_134	8	3,8297		0,3,4147	no	coding-synonymous	FKBP9	NM_007270.3		0,34,6220	AA,AG,GG		0.0361,0.7367,0.2718		46/571	32997323	34,12474	2104	4150	6254	SO:0001819	synonymous_variant	11328	exon1			CGACGAGTGCCCG	AF089745	CCDS5439.1, CCDS64622.1, CCDS64623.1	7p11.1	2013-01-10	2002-08-29		ENSG00000122642	ENSG00000122642		"""EF-hand domain containing"""	3725	protein-coding gene	gene with protein product			"""FK506-binding protein 9 (63 kD)"""			12036304	Standard	NM_007270		Approved	FKBP60, FKBP63	uc003tdh.3	O95302	OTTHUMG00000097847	ENST00000242209.4:c.138G>A	7.37:g.32997323G>A		Somatic	3	0		WXS	Illumina GAIIx	Phase_I	71	42	NM_007270	0	0	0	0	0	B3KY35|B7Z1G9|B7Z6H3|Q2M2A1|Q3MIR7|Q6IN76|Q6P2N1|Q96EX5|Q96IJ9	Silent	SNP	ENST00000242209.4	37	CCDS5439.1																																																																																			G|0.996;A|0.004		0.721	FKBP9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000215137.1	NM_007270	
MEPCE	56257	hgsc.bcm.edu	37	7	100027763	100027763	+	Missense_Mutation	SNP	G	G	A	rs549563315		TCGA-OR-A5LN-01A-11D-A29I-10	TCGA-OR-A5LN-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	cf6a87e3-f084-4b4c-a978-314c952310a0	c8e44d71-ecbb-4a1f-86ef-5631d9a7442a	g.chr7:100027763G>A	ENST00000310512.2	+	1	510	c.122G>A	c.(121-123)gGg>gAg	p.G41E	MEPCE_ENST00000414441.1_Intron|ZCWPW1_ENST00000324725.6_5'Flank|ZCWPW1_ENST00000360951.4_5'Flank|ZCWPW1_ENST00000398027.2_5'Flank	NM_019606.5	NP_062552.2	Q7L2J0	MEPCE_HUMAN	methylphosphate capping enzyme	41	Gly-rich.				negative regulation of chromatin binding (GO:0035562)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of G1/S transition of mitotic cell cycle (GO:1900087)|RNA methylation (GO:0001510)|snRNA metabolic process (GO:0016073)|snRNA modification (GO:0040031)		poly(A) RNA binding (GO:0044822)|RNA methyltransferase activity (GO:0008173)|S-adenosylmethionine-dependent methyltransferase activity (GO:0008757)			breast(1)|endometrium(2)|kidney(1)|large_intestine(3)|liver(2)|lung(9)|prostate(4)|skin(1)|upper_aerodigestive_tract(1)	24	Lung NSC(181;0.0181)|all_lung(186;0.0284)|Esophageal squamous(72;0.0439)					GCCGCCTCTGGGGAGCTCCGC	0.771													G|||	1	0.000199681	0.0008	0.0	5008	,	,		10008	0.0		0.0	False		,,,				2504	0.0				p.G41E		.											.	MEPCE-91	0			c.G122A						.																																			SO:0001583	missense	56257	exon1			CCTCTGGGGAGCT	AF264752	CCDS5693.1, CCDS55136.1	7q22.1	2008-02-04	2007-07-26	2007-07-26	ENSG00000146834	ENSG00000146834			20247	protein-coding gene	gene with protein product		611478	"""bin3, bicoid-interacting 3, homolog (Drosophila)"""	BCDIN3		12358911, 17643375	Standard	NM_019606		Approved	FLJ20257, MePCE	uc003uuw.3	Q7L2J0	OTTHUMG00000155255	ENST00000310512.2:c.122G>A	7.37:g.100027763G>A	ENSP00000308546:p.Gly41Glu	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	14	12	NM_019606	0	0	1	1	0	B3KP86|D6W5V7|Q9NPD4	Missense_Mutation	SNP	ENST00000310512.2	37	CCDS5693.1	.	.	.	.	.	.	.	.	.	.	G	17.57	3.423719	0.62733	.	.	ENSG00000146834	ENST00000310512	.	.	.	5.26	2.19	0.27852	.	0.384744	0.24808	N	0.035438	T	0.16128	0.0388	N	0.08118	0	0.26750	N	0.970219	B	0.24186	0.099	B	0.17098	0.017	T	0.12451	-1.0547	9	0.56958	D	0.05	-19.9395	5.3573	0.16067	0.095:0.0:0.5475:0.3574	.	41	Q7L2J0	MEPCE_HUMAN	E	41	.	ENSP00000308546:G41E	G	+	2	0	MEPCE	99865699	0.998000	0.40836	0.921000	0.36526	0.786000	0.44442	1.328000	0.33758	0.555000	0.29079	0.561000	0.74099	GGG	.		0.771	MEPCE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000339135.1		
NKX2-6	137814	hgsc.bcm.edu	37	8	23560484	23560484	+	Missense_Mutation	SNP	G	G	T	rs143039156	byFrequency	TCGA-OR-A5LN-01A-11D-A29I-10	TCGA-OR-A5LN-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	cf6a87e3-f084-4b4c-a978-314c952310a0	c8e44d71-ecbb-4a1f-86ef-5631d9a7442a	g.chr8:23560484G>T	ENST00000325017.3	-	2	385	c.386C>A	c.(385-387)gCg>gAg	p.A129E	NKX2-6_ENST00000418222.1_Missense_Mutation_p.A47E	NM_001136271.2	NP_001129743.2	A6NCS4	NKX26_HUMAN	NK2 homeobox 6	129					atrial cardiac muscle cell development (GO:0055014)|cell differentiation (GO:0030154)|digestive tract development (GO:0048565)|embryonic heart tube development (GO:0035050)|hypothalamus development (GO:0021854)|negative regulation of apoptotic process (GO:0043066)|pericardium development (GO:0060039)|pharyngeal system development (GO:0060037)|positive regulation of cell proliferation (GO:0008284)|tongue development (GO:0043586)|transcription, DNA-templated (GO:0006351)|ventricular cardiac muscle cell development (GO:0055015)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)										TCGTTGCCGCGCCTTGGGCTG	0.741													G|||	53	0.0105831	0.003	0.0115	5008	,	,		13623	0.0		0.0318	False		,,,				2504	0.0092				p.A129E		.											.	NKX2-6-68	0			c.C386A						.						5.0	6.0	5.0					8																	23560484		679	1539	2218	SO:0001583	missense	137814	exon2			TGCCGCGCCTTGG	CN272646		8p21.2	2012-03-09	2011-06-01			ENSG00000180053		"""Homeoboxes / ANTP class : NKL subclass"""	32940	protein-coding gene	gene with protein product	"""tinman paralog (Drosophila)"""	611770	"""NK2 transcription factor related, locus 6 (Drosophila)"""			15649947	Standard	NM_001136271		Approved	CSX2, NKX4-2	uc011kzy.3	A6NCS4		ENST00000325017.3:c.386C>A	8.37:g.23560484G>T	ENSP00000320089:p.Ala129Glu	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	23	13	NM_001136271	0	0	0	0	0		Missense_Mutation	SNP	ENST00000325017.3	37		27	0.012362637362637362	2	0.0040650406504065045	4	0.011049723756906077	0	0.0	21	0.027704485488126648	G	7.784	0.710042	0.15239	.	.	ENSG00000180053	ENST00000325017;ENST00000418222	D;D	0.95724	-3.79;-3.79	4.5	-2.0	0.07433	Homeodomain-related (1);Homeodomain-like (1);	1.803450	0.03035	N	0.152674	T	0.73916	0.3648	N	0.22421	0.69	0.09310	N	1	B	0.20261	0.043	B	0.16722	0.016	T	0.78204	-0.2295	10	0.02654	T	1	.	1.1583	0.01800	0.16:0.2458:0.219:0.3752	.	129	A6NCS4	NKX26_HUMAN	E	129;47	ENSP00000320089:A129E;ENSP00000402231:A47E	ENSP00000320089:A129E	A	-	2	0	NKX2-6	23616429	0.000000	0.05858	0.000000	0.03702	0.792000	0.44763	-0.253000	0.08794	-0.744000	0.04778	0.462000	0.41574	GCG	G|0.988;T|0.012		0.741	NKX2-6-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000376057.4	NM_001136271	
MAL2	114569	hgsc.bcm.edu	37	8	120220776	120220776	+	Splice_Site	DEL	G	G	-	rs398009582|rs71302978		TCGA-OR-A5LN-01A-11D-A29I-10	TCGA-OR-A5LN-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	cf6a87e3-f084-4b4c-a978-314c952310a0	c8e44d71-ecbb-4a1f-86ef-5631d9a7442a	g.chr8:120220776delG	ENST00000276681.6	+	1	167	c.65delG	c.(64-66)cgg>cg	p.R22fs	MAL2_ENST00000521748.1_3'UTR	NM_052886.2	NP_443118.1	Q969L2	MAL2_HUMAN	mal, T-cell differentiation protein 2 (gene/pseudogene)	22						cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)						all_cancers(13;1.91e-26)|Lung NSC(37;8.61e-08)|Ovarian(258;0.018)|Hepatocellular(40;0.161)		STAD - Stomach adenocarcinoma(47;0.000967)			CCGCCGCCCCGGGGTCACCCT	0.771													GGG|GGGG|GGG|insertion	5008	1.0	1.0	1.0	5008	,	,		6681	1.0		1.0	False		,,,				2504	1.0				.		.											.	.	0			c.64+1G>-						.			1571,11		785,1,5	1.0	1.0	1.0			0.7	0.8	8	dbSNP_130	1	4116,22		2057,2,10	no	frameshift	MAL2	NM_052886.2		2842,3,15	A1A1,A1R,RR		0.5317,0.6953,0.5769			120220776	5687,33	184	483	667	SO:0001630	splice_region_variant	114569	exon1			CGCCCCGGGGTCA	AL117612	CCDS75780.1	8q23	2011-01-26	2011-01-26			ENSG00000147676			13634	protein-coding gene	gene with protein product	"""MAL proteolipid protein 2"""	609684				11549320	Standard	NM_052886		Approved		uc003yop.3	Q969L2		ENST00000276681.6:c.66+1G>-	8.37:g.120220776delG		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	19	19	NM_052886	0	0	0	0	0	B2R520|Q6ZMD9	Splice_Site	DEL	ENST00000276681.6	37																																																																																				.		0.771	MAL2-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_052886	Frame_Shift_Del
KCNK9	51305	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	8	140715144	140715144	+	Missense_Mutation	SNP	G	G	C			TCGA-OR-A5LN-01A-11D-A29I-10	TCGA-OR-A5LN-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	cf6a87e3-f084-4b4c-a978-314c952310a0	c8e44d71-ecbb-4a1f-86ef-5631d9a7442a	g.chr8:140715144G>C	ENST00000520439.1	-	1	155	c.92C>G	c.(91-93)tCg>tGg	p.S31W	KCNK9_ENST00000303015.1_Missense_Mutation_p.S31W	NM_001282534.1	NP_001269463.1	Q9NPC2	KCNK9_HUMAN	potassium channel, subfamily K, member 9	31					cochlea development (GO:0090102)|potassium ion transport (GO:0006813)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|synaptic vesicle (GO:0008021)	potassium channel activity (GO:0005267)|voltage-gated ion channel activity (GO:0005244)	p.S31*(1)		NS(1)|endometrium(9)|kidney(1)|large_intestine(9)|lung(17)|ovary(2)|prostate(3)|skin(1)	43	all_cancers(97;3.94e-14)|all_epithelial(106;4.81e-13)|Lung NSC(106;8.18e-05)|all_lung(105;0.00015)|Ovarian(258;0.00235)|Acute lymphoblastic leukemia(118;0.155)	Ovarian(118;0.134)	BRCA - Breast invasive adenocarcinoma(115;0.0855)		Doxapram(DB00561)|Halothane(DB01159)	CTCGTGGTCCGACTCGAGGGC	0.622																																					p.S31W		.											.	KCNK9-93	1	Substitution - Nonsense(1)	large_intestine(1)	c.C92G						.						78.0	66.0	70.0					8																	140715144		2203	4300	6503	SO:0001583	missense	51305	exon1			TGGTCCGACTCGA	AF212829	CCDS6377.1	8q24.3	2012-03-07			ENSG00000169427	ENSG00000169427		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Two-P"""	6283	protein-coding gene	gene with protein product		605874				10734076, 16382106	Standard	NM_001282534		Approved	K2p9.1, TASK3, TASK-3	uc003yvf.1	Q9NPC2	OTTHUMG00000164186	ENST00000520439.1:c.92C>G	8.37:g.140715144G>C	ENSP00000430676:p.Ser31Trp	Somatic	143	0		WXS	Illumina GAIIx	Phase_I	280	50	NM_016601	0	0	0	0	0	Q2M290|Q540F2	Missense_Mutation	SNP	ENST00000520439.1	37	CCDS6377.1	.	.	.	.	.	.	.	.	.	.	G	22.1	4.248579	0.80024	.	.	ENSG00000169427	ENST00000522317;ENST00000303015;ENST00000520439	T;T;T	0.25250	1.81;1.81;1.81	3.81	3.81	0.43845	.	0.079028	0.52532	D	0.000073	T	0.56731	0.2005	M	0.88979	2.995	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.67818	-0.5572	10	0.66056	D	0.02	.	15.0272	0.71680	0.0:0.0:1.0:0.0	.	31	Q9NPC2	KCNK9_HUMAN	W	31	ENSP00000429847:S31W;ENSP00000302166:S31W;ENSP00000430676:S31W	ENSP00000302166:S31W	S	-	2	0	KCNK9	140784326	1.000000	0.71417	0.992000	0.48379	0.996000	0.88848	6.891000	0.75639	1.811000	0.52892	0.555000	0.69702	TCG	.		0.622	KCNK9-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378473.1	NM_016601	
ZNF696	79943	hgsc.bcm.edu	37	8	144378868	144378868	+	Silent	SNP	A	A	G	rs7386259	byFrequency	TCGA-OR-A5LN-01A-11D-A29I-10	TCGA-OR-A5LN-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	cf6a87e3-f084-4b4c-a978-314c952310a0	c8e44d71-ecbb-4a1f-86ef-5631d9a7442a	g.chr8:144378868A>G	ENST00000330143.3	+	3	1432	c.1023A>G	c.(1021-1023)cgA>cgG	p.R341R		NM_030895.2	NP_112157.2	Q9H7X3	ZN696_HUMAN	zinc finger protein 696	341					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			lung(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	8	all_cancers(97;1.01e-10)|all_epithelial(106;4.86e-09)|Lung NSC(106;0.000167)|all_lung(105;0.000459)|Ovarian(258;0.0212)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.156)|Colorectal(110;0.173)			GGCACCAGCGACTCCACACGG	0.726													G|||	4505	0.899561	0.9425	0.9179	5008	,	,		11520	0.8403		0.8608	False		,,,				2504	0.9294				p.R341R		.											.	ZNF696-90	0			c.A1023G						.	G		3773,275		1771,231,22	5.0	5.0	5.0		1023	-0.3	0.0	8	dbSNP_116	5	6735,1261		2843,1049,106	no	coding-synonymous	ZNF696	NM_030895.2		4614,1280,128	GG,GA,AA		15.7704,6.7935,12.7532		341/375	144378868	10508,1536	2024	3998	6022	SO:0001819	synonymous_variant	79943	exon3			CCAGCGACTCCAC	AK024191	CCDS6399.1	8q24.3	2013-01-08				ENSG00000185730		"""Zinc fingers, C2H2-type"""	25872	protein-coding gene	gene with protein product							Standard	NM_030895		Approved	FLJ14129	uc003yxy.4	Q9H7X3		ENST00000330143.3:c.1023A>G	8.37:g.144378868A>G		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	10	10	NM_030895	0	0	0	1	1	A0AVE2	Silent	SNP	ENST00000330143.3	37	CCDS6399.1																																																																																			A|0.118;G|0.882		0.726	ZNF696-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381164.2	NM_030895	
PLEC	5339	hgsc.bcm.edu	37	8	144996987	144996987	+	Silent	SNP	G	G	A	rs80143277	byFrequency	TCGA-OR-A5LN-01A-11D-A29I-10	TCGA-OR-A5LN-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	cf6a87e3-f084-4b4c-a978-314c952310a0	c8e44d71-ecbb-4a1f-86ef-5631d9a7442a	g.chr8:144996987G>A	ENST00000322810.4	-	31	7690	c.7521C>T	c.(7519-7521)gcC>gcT	p.A2507A	PLEC_ENST00000356346.3_Silent_p.A2356A|PLEC_ENST00000527096.1_Silent_p.A2393A|PLEC_ENST00000354589.3_Silent_p.A2370A|PLEC_ENST00000345136.3_Silent_p.A2370A|PLEC_ENST00000354958.2_Silent_p.A2348A|PLEC_ENST00000398774.2_Silent_p.A2338A|PLEC_ENST00000357649.2_Silent_p.A2374A|PLEC_ENST00000436759.2_Silent_p.A2397A	NM_201380.2	NP_958782.1	Q15149	PLEC_HUMAN	plectin	2507	Central fibrous rod domain.				apoptotic process (GO:0006915)|cell junction assembly (GO:0034329)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)	costamere (GO:0043034)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|hemidesmosome (GO:0030056)|intermediate filament cytoskeleton (GO:0045111)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|sarcoplasm (GO:0016528)	ankyrin binding (GO:0030506)|poly(A) RNA binding (GO:0044822)|structural constituent of muscle (GO:0008307)			NS(1)|breast(3)|central_nervous_system(4)|cervix(7)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(8)|lung(57)|ovary(4)|pancreas(2)|prostate(11)|skin(9)|stomach(2)|upper_aerodigestive_tract(10)	137						GCTGCCGCTCGGCCTCCAGCG	0.716													G|||	55	0.0109824	0.0393	0.0029	5008	,	,		14753	0.001		0.0	False		,,,				2504	0.0				p.A2507A		.											.	PLEC-141	0			c.C7521T						.	G	,,,,,,,	144,3970		0,144,1913	5.0	6.0	6.0		7191,7068,7044,7521,7014,7110,7122,7110	-10.3	0.0	8	dbSNP_131	6	3,8207		0,3,4102	no	coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous	PLEC	NM_000445.3,NM_201378.2,NM_201379.1,NM_201380.2,NM_201381.1,NM_201382.2,NM_201383.1,NM_201384.1	,,,,,,,	0,147,6015	AA,AG,GG		0.0365,3.5002,1.1928	,,,,,,,	2397/4575,2356/4534,2348/4526,2507/4685,2338/4516,2370/4548,2374/4552,2370/4548	144996987	147,12177	2057	4105	6162	SO:0001819	synonymous_variant	5339	exon31			CCGCTCGGCCTCC	U53204	CCDS43769.1, CCDS43770.1, CCDS43771.1, CCDS43772.1, CCDS43773.1, CCDS43774.1, CCDS43775.1, CCDS47936.1	8q24	2010-02-04	2010-02-04	2010-02-04	ENSG00000178209	ENSG00000178209			9069	protein-coding gene	gene with protein product		601282	"""plectin 1, intermediate filament binding protein, 500kD"", ""epidermolysis bullosa simplex 1 (Ogna)"", ""plectin 1, intermediate filament binding protein 500kDa"""	EBS1, PLEC1		8633055, 8696340	Standard	XM_005250976		Approved	PCN, PLTN	uc003zaf.1	Q15149	OTTHUMG00000165291	ENST00000322810.4:c.7521C>T	8.37:g.144996987G>A		Somatic	2	0		WXS	Illumina GAIIx	Phase_I	57	30	NM_201380	0	0	5	9	4	Q15148|Q16640|Q6S376|Q6S377|Q6S378|Q6S379|Q6S380|Q6S381|Q6S382|Q6S383	Silent	SNP	ENST00000322810.4	37	CCDS43772.1																																																																																			G|0.985;A|0.015		0.716	PLEC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383281.1	NM_000445	
C8orf82	414919	hgsc.bcm.edu	37	8	145754272	145754272	+	Missense_Mutation	SNP	G	G	A	rs75220950	byFrequency	TCGA-OR-A5LN-01A-11D-A29I-10	TCGA-OR-A5LN-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	cf6a87e3-f084-4b4c-a978-314c952310a0	c8e44d71-ecbb-4a1f-86ef-5631d9a7442a	g.chr8:145754272G>A	ENST00000524821.1	-	1	244	c.29C>T	c.(28-30)aCc>aTc	p.T10I	LRRC24_ENST00000533758.1_5'Flank|C8orf82_ENST00000313465.5_Missense_Mutation_p.T10I|LRRC24_ENST00000529415.2_5'Flank			Q6P1X6	CH082_HUMAN	chromosome 8 open reading frame 82	10										endometrium(1)|urinary_tract(1)	2						CAAGGCCAGGGTCCGGAGCGT	0.751													G|||	328	0.0654952	0.233	0.0231	5008	,	,		6292	0.0		0.004	False		,,,				2504	0.0				p.T10I		.											.	C8orf82-44	0			c.C29T						.	G	ILE/THR	655,3201		40,575,1313	3.0	4.0	4.0		29	3.2	0.0	8	dbSNP_131	4	26,7578		0,26,3776	no	missense	C8orf82	NM_001001795.1	89	40,601,5089	AA,AG,GG		0.3419,16.9865,5.9424	benign	10/217	145754272	681,10779	1928	3802	5730	SO:0001583	missense	414919	exon1			GCCAGGGTCCGGA		CCDS34970.1	8q24	2012-04-18			ENSG00000213563	ENSG00000213563			33826	protein-coding gene	gene with protein product						12477932	Standard	NM_001001795		Approved	MGC70857	uc003zdp.1	Q6P1X6	OTTHUMG00000165181	ENST00000524821.1:c.29C>T	8.37:g.145754272G>A	ENSP00000436621:p.Thr10Ile	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	41	40	NM_001001795	0	0	0	9	9	Q6GMR2|Q6P2Q7	Missense_Mutation	SNP	ENST00000524821.1	37	CCDS34970.1	149|149	0.06822344322344322|0.06822344322344322	137|137	0.2784552845528455|0.2784552845528455	7|7	0.019337016574585635|0.019337016574585635	0|0	0.0|0.0	5|5	0.006596306068601583|0.006596306068601583	G|G	13.57|13.57	2.276363|2.276363	0.40294|0.40294	0.169865|0.169865	0.003419|0.003419	ENSG00000213563|ENSG00000213563	ENST00000527462|ENST00000524821;ENST00000313465	.|.	.|.	.|.	4.98|4.98	3.17|3.17	0.36434|0.36434	.|.	.|0.735129	.|0.11585	.|U	.|0.549400	T|T	0.00012|0.00012	0.0000|0.0000	N|N	0.08118|0.08118	0|0	0.80722|0.80722	P|P	0.0|0.0	.|B	.|0.06786	.|0.001	.|B	.|0.04013	.|0.001	T|T	0.20505|0.20505	-1.0273|-1.0273	4|8	.|0.66056	.|D	.|0.02	-0.9922|-0.9922	9.4586|9.4586	0.38769|0.38769	0.0881:0.1475:0.7644:0.0|0.0881:0.1475:0.7644:0.0	.|.	.|10	.|Q6P1X6	.|CH082_HUMAN	S|I	59|10	.|.	.|ENSP00000316262:T10I	P|T	-|-	1|2	0|0	C8orf82|C8orf82	145725080|145725080	0.001000|0.001000	0.12720|0.12720	0.000000|0.000000	0.03702|0.03702	0.000000|0.000000	0.00434|0.00434	0.152000|0.152000	0.16302|0.16302	0.146000|0.146000	0.19002|0.19002	-1.268000|-1.268000	0.01426|0.01426	CCC|ACC	G|0.923;A|0.077		0.751	C8orf82-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382503.1	NM_001001795	
CHMP5	51510	hgsc.bcm.edu	37	9	33264540	33264540	+	5'Flank	SNP	C	C	G	rs1071545	byFrequency	TCGA-OR-A5LN-01A-11D-A29I-10	TCGA-OR-A5LN-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	cf6a87e3-f084-4b4c-a978-314c952310a0	c8e44d71-ecbb-4a1f-86ef-5631d9a7442a	g.chr9:33264540C>G	ENST00000223500.8	+	0	0				CHMP5_ENST00000419016.2_5'Flank|BAG1_ENST00000472232.3_Missense_Mutation_p.G45R|BAG1_ENST00000379704.2_5'UTR	NM_016410.5	NP_057494.3	Q9NZZ3	CHMP5_HUMAN	charged multivesicular body protein 5						endosomal transport (GO:0016197)|endosome to lysosome transport (GO:0008333)|lysosome organization (GO:0007040)|membrane organization (GO:0061024)|protein transport (GO:0015031)|regulation of receptor recycling (GO:0001919)|viral life cycle (GO:0019058)|viral process (GO:0016032)	cytosol (GO:0005829)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)				endometrium(1)|kidney(1)|large_intestine(3)|lung(4)|ovary(1)	10			LUSC - Lung squamous cell carcinoma(29;0.00506)			GGTGGACGCCCAGAGGGAGGC	0.771													G|||	4905	0.979433	0.9251	0.9942	5008	,	,		8749	1.0		1.0	False		,,,				2504	1.0				p.G45R		.											.	BAG1-228	0			c.G133C						.		,ARG/GLY	3714,198		1759,196,1	4.0	5.0	4.0		,133	3.6	0.0	9	dbSNP_86	4	7514,4		3755,4,0	no	utr-5,missense	BAG1	NM_001172415.1,NM_004323.5	,125	5514,200,1	GG,GC,CC		0.0532,5.0613,1.7673	,benign	,45/346	33264540	11228,202	1956	3759	5715	SO:0001631	upstream_gene_variant	573	exon1			GACGCCCAGAGGG	AF132968	CCDS6537.1, CCDS56569.1	9p13.3	2011-09-21	2011-09-21	2005-08-09	ENSG00000086065	ENSG00000086065		"""Charged multivesicular body proteins"""	26942	protein-coding gene	gene with protein product		610900	"""chromosome 9 open reading frame 83"", ""chromatin modifying protein 5"""	C9orf83, SNF7DC2		15644320, 11559748	Standard	NM_016410		Approved	HSPC177, CGI-34, Vps60	uc003zsm.4	Q9NZZ3	OTTHUMG00000019765		9.37:g.33264540C>G	Exception_encountered	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	8	8	NM_004323	0	0	0	1	1	B2RD95|B4DIR6|Q5VXW2|Q96AV2|Q9HB68|Q9NYS4|Q9Y323	Missense_Mutation	SNP	ENST00000223500.8	37	CCDS6537.1	2143	0.9812271062271062	452	0.9186991869918699	361	0.9972375690607734	572	1.0	758	1.0	G	5.424	0.263435	0.10294	0.949387	0.999468	ENSG00000107262	ENST00000472232	.	.	.	3.62	3.62	0.41486	.	0.965269	0.08484	N	0.939035	T	0.00012	0.0000	N	0.08118	0	0.47407	P	5.870000000000042E-4	B	0.02656	0.0	B	0.01281	0.0	T	0.39761	-0.9598	8	0.06236	T	0.91	-3.4106	9.2895	0.37778	0.0:0.2201:0.7798:0.0	rs1071545;rs1702659;rs59772010	45	Q99933	BAG1_HUMAN	R	45	.	ENSP00000420514:G45R	G	-	1	0	BAG1	33254540	0.798000	0.28890	0.040000	0.18447	0.006000	0.05464	0.985000	0.29578	1.113000	0.41760	-0.674000	0.03794	GGG	C|0.976;G|0.024		0.771	CHMP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052040.3	NM_016410	
SPATA31E1	286234	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	90499864	90499864	+	Missense_Mutation	SNP	C	C	A			TCGA-OR-A5LN-01A-11D-A29I-10	TCGA-OR-A5LN-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	cf6a87e3-f084-4b4c-a978-314c952310a0	c8e44d71-ecbb-4a1f-86ef-5631d9a7442a	g.chr9:90499864C>A	ENST00000325643.5	+	4	528	c.462C>A	c.(460-462)caC>caA	p.H154Q		NM_178828.4	NP_849150.3	Q6ZUB1	S31E1_HUMAN	SPATA31 subfamily E, member 1	154					cell differentiation (GO:0030154)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)											GCAGCTCCCACCTGCCCTTAG	0.637																																					p.H154Q		.											.	.	0			c.C462A						.						34.0	35.0	35.0					9																	90499864		2203	4299	6502	SO:0001583	missense	286234	exon4			CTCCCACCTGCCC	AK093185	CCDS6676.1	9q22.1-q22.2	2012-10-12	2012-10-12	2012-10-12	ENSG00000177992	ENSG00000177992			26672	protein-coding gene	gene with protein product			"""chromosome 9 open reading frame 79"", ""family with sequence similarity 75, member E1"""	C9orf79, FAM75E1			Standard	NM_178828		Approved	FLJ35866	uc004app.4	Q6ZUB1	OTTHUMG00000020157	ENST00000325643.5:c.462C>A	9.37:g.90499864C>A	ENSP00000322640:p.His154Gln	Somatic	99	0		WXS	Illumina GAIIx	Phase_I	90	17	NM_178828	0	0	0	0	0	B2RPB1|Q5SQC9|Q8NA41|Q8ND27	Missense_Mutation	SNP	ENST00000325643.5	37	CCDS6676.1	.	.	.	.	.	.	.	.	.	.	.	8.484	0.860525	0.17178	.	.	ENSG00000177992	ENST00000325643	T	0.03801	3.8	2.35	-4.69	0.03299	.	1.281740	0.05791	N	0.610368	T	0.10035	0.0246	L	0.48642	1.525	0.09310	N	1	D	0.76494	0.999	D	0.71656	0.974	T	0.07693	-1.0759	10	0.27785	T	0.31	.	2.0908	0.03656	0.2744:0.4278:0.1381:0.1596	.	154	Q6ZUB1	CI079_HUMAN	Q	154	ENSP00000322640:H154Q	ENSP00000322640:H154Q	H	+	3	2	C9orf79	89689684	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.762000	0.04745	-2.874000	0.00322	-1.838000	0.00587	CAC	.		0.637	SPATA31E1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052954.2	NM_178828	
MEGF9	1955	hgsc.bcm.edu	37	9	123476303	123476303	+	Missense_Mutation	SNP	A	A	C	rs7861158	byFrequency	TCGA-OR-A5LN-01A-11D-A29I-10	TCGA-OR-A5LN-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	cf6a87e3-f084-4b4c-a978-314c952310a0	c8e44d71-ecbb-4a1f-86ef-5631d9a7442a	g.chr9:123476303A>C	ENST00000373930.3	-	1	445	c.334T>G	c.(334-336)Tct>Gct	p.S112A	MEGF9_ENST00000426959.1_Missense_Mutation_p.S104A	NM_001080497.2	NP_001073966.2	Q9H1U4	MEGF9_HUMAN	multiple EGF-like-domains 9	112	Pro-rich.					integral component of membrane (GO:0016021)				endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(2)|lung(9)|upper_aerodigestive_tract(1)	16						GTGGTGGAAGAGGGTCCAGCA	0.736													C|||	328	0.0654952	0.2405	0.0144	5008	,	,		8285	0.0		0.0	False		,,,				2504	0.0				p.S112A		.											.	.	0			c.T334G						.	C	ALA/SER	680,3074		70,540,1267	11.0	16.0	14.0		334	-1.0	0.0	9	dbSNP_116	14	19,8119		0,19,4050	yes	missense	MEGF9	NM_001080497.2	99	70,559,5317	CC,CA,AA		0.2335,18.114,5.8779	benign	112/603	123476303	699,11193	1877	4069	5946	SO:0001583	missense	1955	exon1			TGGAAGAGGGTCC	AB011542	CCDS48010.1, CCDS48010.2	9q32-q33.3	2008-07-21	2006-03-31	2006-03-31	ENSG00000106780	ENSG00000106780			3234	protein-coding gene	gene with protein product		604268	"""EGF-like-domain, multiple 5"""	EGFL5		9693030	Standard	NM_001080497		Approved		uc022bms.1	Q9H1U4	OTTHUMG00000021039	ENST00000373930.3:c.334T>G	9.37:g.123476303A>C	ENSP00000363040:p.Ser112Ala	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	49	12	NM_001080497	0	0	0	0	0	B7Z315|O75098	Missense_Mutation	SNP	ENST00000373930.3	37	CCDS48010.2	102	0.046703296703296704	95	0.19308943089430894	7	0.019337016574585635	0	0.0	0	0.0	C	1.650	-0.514320	0.04200	0.18114	0.002335	ENSG00000106780	ENST00000373930;ENST00000426959	T;T	0.15718	2.4;2.43	3.56	-0.98	0.10272	.	1.142670	0.06524	N	0.740166	T	0.00012	0.0000	N	0.01576	-0.805	0.80722	P	0.0	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.34204	-0.9838	9	0.02654	T	1	-0.0939	2.636	0.04958	0.2661:0.4809:0.1313:0.1216	rs7861158;rs7861158	112;104	Q9H1U4;C9J1K8	MEGF9_HUMAN;.	A	112;104	ENSP00000363040:S112A;ENSP00000392666:S104A	ENSP00000363040:S112A	S	-	1	0	MEGF9	122516124	0.001000	0.12720	0.000000	0.03702	0.020000	0.10135	-0.318000	0.08050	-0.234000	0.09782	-0.466000	0.05196	TCT	A|0.951;C|0.049		0.736	MEGF9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055513.1	NM_001080497	
FPGS	2356	hgsc.bcm.edu	37	9	130565267	130565267	+	Missense_Mutation	SNP	A	A	G	rs11554717|rs10760502	byFrequency	TCGA-OR-A5LN-01A-11D-A29I-10	TCGA-OR-A5LN-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	cf6a87e3-f084-4b4c-a978-314c952310a0	c8e44d71-ecbb-4a1f-86ef-5631d9a7442a	g.chr9:130565267A>G	ENST00000373247.2	+	1	114	c.64A>G	c.(64-66)Ata>Gta	p.I22V	FPGS_ENST00000393706.2_Missense_Mutation_p.I22V|FPGS_ENST00000460181.1_3'UTR|FPGS_ENST00000373245.1_Missense_Mutation_p.I22V|FPGS_ENST00000373225.3_5'Flank	NM_004957.4	NP_004948.4	Q05932	FOLC_HUMAN	folylpolyglutamate synthase	22			I -> V (in dbSNP:rs10760502). {ECO:0000269|PubMed:14702039, ECO:0000269|PubMed:15489334, ECO:0000269|PubMed:7721888}.		brain development (GO:0007420)|folic acid metabolic process (GO:0046655)|liver development (GO:0001889)|nucleobase-containing compound metabolic process (GO:0006139)|one-carbon metabolic process (GO:0006730)|organ regeneration (GO:0031100)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|tetrahydrofolylpolyglutamate synthase activity (GO:0004326)			endometrium(2)|kidney(1)|lung(3)|ovary(1)	7					Methotrexate(DB00563)|Pralatrexate(DB06813)|Raltitrexed(DB00293)	TGCGCGCGGCATAACGACCCA	0.761													g|||	3912	0.78115	0.8956	0.6153	5008	,	,		6680	0.9583		0.6352	False		,,,				2504	0.7117				p.I22V		.											.	FPGS-90	0			c.A64G						.		VAL/ILE	2249,281		997,255,13	1.0	3.0	2.0		64	1.8	0.0	9	dbSNP_120	2	3848,1396		1394,1060,168	no	missense	FPGS	NM_004957.4	29	2391,1315,181	GG,GA,AA		26.6209,11.1067,21.5719	benign	22/588	130565267	6097,1677	1265	2622	3887	SO:0001583	missense	2356	exon1			CGCGGCATAACGA		CCDS35148.1, CCDS35149.1, CCDS75905.1	9q34.11	2013-09-19			ENSG00000136877	ENSG00000136877	6.3.2.17		3824	protein-coding gene	gene with protein product		136510					Standard	NM_004957		Approved		uc004bsg.1	Q05932	OTTHUMG00000020716	ENST00000373247.2:c.64A>G	9.37:g.130565267A>G	ENSP00000362344:p.Ile22Val	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	7	7	NM_004957	0	0	0	0	0	B3KPW4|B7Z2Z3|F5H0K6|Q5JU19|Q5JU22|Q6P2P6	Missense_Mutation	SNP	ENST00000373247.2	37	CCDS35148.1	1668	0.7637362637362637	432	0.8780487804878049	215	0.5939226519337016	545	0.9527972027972028	476	0.6279683377308707	g	3.002	-0.205821	0.06180	0.888933	0.733791	ENSG00000136877	ENST00000373247;ENST00000373245;ENST00000393706;ENST00000373228	T;T;T;T	0.29655	3.02;1.56;3.03;1.56	4.93	1.83	0.25207	.	0.868559	0.09918	N	0.738853	T	0.00012	0.0000	N	0.08118	0	0.80722	P	0.0	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.37361	-0.9709	9	0.02654	T	1	-12.2003	6.0757	0.19913	0.2469:0.2097:0.5434:0.0	rs10760502;rs17855899;rs56845445	22;22	Q05932-4;Q05932	.;FOLC_HUMAN	V	22	ENSP00000362344:I22V;ENSP00000362342:I22V;ENSP00000377309:I22V;ENSP00000362325:I22V	ENSP00000362325:I22V	I	+	1	0	FPGS	129605088	0.000000	0.05858	0.001000	0.08648	0.021000	0.10359	0.242000	0.18087	0.210000	0.20664	-0.258000	0.10820	ATA	A|0.235;G|0.765		0.761	FPGS-011	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054251.1		
NOTCH1	4851	hgsc.bcm.edu	37	9	139417333	139417333	+	Silent	SNP	G	G	A	rs61751557	byFrequency	TCGA-OR-A5LN-01A-11D-A29I-10	TCGA-OR-A5LN-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	cf6a87e3-f084-4b4c-a978-314c952310a0	c8e44d71-ecbb-4a1f-86ef-5631d9a7442a	g.chr9:139417333G>A	ENST00000277541.6	-	4	786	c.711C>T	c.(709-711)ggC>ggT	p.G237G	NOTCH1_ENST00000491649.1_5'UTR	NM_017617.3	NP_060087.3	P46531	NOTC1_HUMAN	notch 1	237	EGF-like 6. {ECO:0000255|PROSITE- ProRule:PRU00076}.				anagen (GO:0042640)|aortic valve morphogenesis (GO:0003180)|apoptotic process involved in embryonic digit morphogenesis (GO:1902263)|arterial endothelial cell differentiation (GO:0060842)|atrioventricular node development (GO:0003162)|atrioventricular valve morphogenesis (GO:0003181)|auditory receptor cell fate commitment (GO:0009912)|axonogenesis (GO:0007409)|branching morphogenesis of an epithelial tube (GO:0048754)|cardiac atrium morphogenesis (GO:0003209)|cardiac chamber formation (GO:0003207)|cardiac epithelial to mesenchymal transition (GO:0060317)|cardiac left ventricle morphogenesis (GO:0003214)|cardiac muscle cell proliferation (GO:0060038)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac right atrium morphogenesis (GO:0003213)|cardiac right ventricle formation (GO:0003219)|cardiac septum morphogenesis (GO:0060411)|cardiac vascular smooth muscle cell development (GO:0060948)|cardiac ventricle morphogenesis (GO:0003208)|cell fate specification (GO:0001708)|cell migration involved in endocardial cushion formation (GO:0003273)|cellular response to follicle-stimulating hormone stimulus (GO:0071372)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|cilium morphogenesis (GO:0060271)|collecting duct development (GO:0072044)|compartment pattern specification (GO:0007386)|coronary artery morphogenesis (GO:0060982)|coronary vein morphogenesis (GO:0003169)|determination of left/right symmetry (GO:0007368)|distal tubule development (GO:0072017)|embryonic hindlimb morphogenesis (GO:0035116)|endocardial cell differentiation (GO:0060956)|endocardial cushion morphogenesis (GO:0003203)|endocardium development (GO:0003157)|endocardium morphogenesis (GO:0003160)|endoderm development (GO:0007492)|epithelial to mesenchymal transition (GO:0001837)|epithelial to mesenchymal transition involved in endocardial cushion formation (GO:0003198)|forebrain development (GO:0030900)|foregut morphogenesis (GO:0007440)|gene expression (GO:0010467)|glial cell differentiation (GO:0010001)|glomerular mesangial cell development (GO:0072144)|growth involved in heart morphogenesis (GO:0003241)|hair follicle morphogenesis (GO:0031069)|heart development (GO:0007507)|heart looping (GO:0001947)|heart trabecula morphogenesis (GO:0061384)|humoral immune response (GO:0006959)|immune response (GO:0006955)|in utero embryonic development (GO:0001701)|inflammatory response to antigenic stimulus (GO:0002437)|interleukin-4 secretion (GO:0072602)|keratinocyte differentiation (GO:0030216)|left/right axis specification (GO:0070986)|liver development (GO:0001889)|lung development (GO:0030324)|mesenchymal cell development (GO:0014031)|mitral valve formation (GO:0003192)|negative regulation of anoikis (GO:2000811)|negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of calcium ion-dependent exocytosis (GO:0045955)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of catalytic activity (GO:0043086)|negative regulation of cell migration involved in sprouting angiogenesis (GO:0090051)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell-substrate adhesion (GO:0010812)|negative regulation of endothelial cell chemotaxis (GO:2001027)|negative regulation of glial cell proliferation (GO:0060253)|negative regulation of myoblast differentiation (GO:0045662)|negative regulation of myotube differentiation (GO:0010832)|negative regulation of neurogenesis (GO:0050768)|negative regulation of oligodendrocyte differentiation (GO:0048715)|negative regulation of ossification (GO:0030279)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of photoreceptor cell differentiation (GO:0046533)|negative regulation of pro-B cell differentiation (GO:2000974)|negative regulation of stem cell differentiation (GO:2000737)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|neural tube development (GO:0021915)|neuronal stem cell maintenance (GO:0097150)|Notch receptor processing (GO:0007220)|Notch signaling involved in heart development (GO:0061314)|Notch signaling pathway (GO:0007219)|Notch signaling pathway involved in regulation of secondary heart field cardioblast proliferation (GO:0003270)|pericardium morphogenesis (GO:0003344)|positive regulation of apoptotic process (GO:0043065)|positive regulation of astrocyte differentiation (GO:0048711)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of cardiac muscle cell proliferation (GO:0060045)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of JAK-STAT cascade (GO:0046427)|positive regulation of keratinocyte differentiation (GO:0045618)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061419)|positive regulation of transcription of Notch receptor target (GO:0007221)|positive regulation of transcription, DNA-templated (GO:0045893)|prostate gland epithelium morphogenesis (GO:0060740)|pulmonary valve morphogenesis (GO:0003184)|regulation of epithelial cell proliferation involved in prostate gland development (GO:0060768)|regulation of extracellular matrix assembly (GO:1901201)|regulation of somitogenesis (GO:0014807)|regulation of transcription from RNA polymerase II promoter involved in myocardial precursor cell differentiation (GO:0003256)|regulation of transcription, DNA-templated (GO:0006355)|response to muramyl dipeptide (GO:0032495)|secretory columnal luminar epithelial cell differentiation involved in prostate glandular acinus development (GO:0060528)|skeletal muscle cell differentiation (GO:0035914)|somatic stem cell division (GO:0048103)|sprouting angiogenesis (GO:0002040)|transcription initiation from RNA polymerase II promoter (GO:0006367)|tube formation (GO:0035148)|vasculogenesis involved in coronary vascular morphogenesis (GO:0060979)|venous endothelial cell differentiation (GO:0060843)|ventricular septum morphogenesis (GO:0060412)|ventricular trabecula myocardium morphogenesis (GO:0003222)	cell surface (GO:0009986)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|MAML1-RBP-Jkappa- ICN1 complex (GO:0002193)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|chromatin DNA binding (GO:0031490)|core promoter binding (GO:0001047)|enzyme binding (GO:0019899)|enzyme inhibitor activity (GO:0004857)|receptor activity (GO:0004872)|RNA polymerase II transcription factor binding transcription factor activity involved in positive regulation of transcription (GO:0001190)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(16)|central_nervous_system(17)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1183)|kidney(4)|large_intestine(1)|lung(57)|oesophagus(2)|ovary(3)|pancreas(1)|prostate(3)|skin(21)|upper_aerodigestive_tract(39)|urinary_tract(3)	1359	all_cancers(76;0.223)	Myeloproliferative disorder(178;0.0511)		OV - Ovarian serous cystadenocarcinoma(145;5.34e-06)|Epithelial(140;7.77e-06)		GGGTGACGTCGCCCGTGGGGC	0.761			"""T, Mis, O"""	TRB@	T-ALL					HNSCC(8;0.001)			G|||	102	0.0203674	0.0756	0.0014	5008	,	,		12299	0.0		0.001	False		,,,				2504	0.0				p.G237G		.		Dom	yes		9	9q34.3	4851	"""Notch homolog 1, translocation-associated (Drosophila) (TAN1)"""		L	.	NOTCH1-5459	0			c.C711T						.	G		161,3523		2,157,1683	6.0	9.0	8.0		711	-2.3	0.7	9	dbSNP_129	8	6,7608		0,6,3801	no	coding-synonymous	NOTCH1	NM_017617.3		2,163,5484	AA,AG,GG		0.0788,4.3702,1.4781		237/2556	139417333	167,11131	1842	3807	5649	SO:0001819	synonymous_variant	4851	exon4			GACGTCGCCCGTG	AF308602	CCDS43905.1	9q34.3	2013-01-10	2010-06-24		ENSG00000148400	ENSG00000148400		"""Ankyrin repeat domain containing"""	7881	protein-coding gene	gene with protein product		190198	"""Notch (Drosophila) homolog 1 (translocation-associated)"", ""Notch homolog 1, translocation-associated (Drosophila)"""	TAN1		1831692	Standard	NM_017617		Approved		uc004chz.3	P46531	OTTHUMG00000020935	ENST00000277541.6:c.711C>T	9.37:g.139417333G>A		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	34	27	NM_017617	0	0	0	0	0	Q59ED8|Q5SXM3	Silent	SNP	ENST00000277541.6	37	CCDS43905.1																																																																																			G|0.987;A|0.013		0.761	NOTCH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055087.1	NM_017617	
C9orf172	389813	hgsc.bcm.edu	37	9	139740174	139740174	+	Silent	SNP	C	C	A	rs565217311	byFrequency	TCGA-OR-A5LN-01A-11D-A29I-10	TCGA-OR-A5LN-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	cf6a87e3-f084-4b4c-a978-314c952310a0	c8e44d71-ecbb-4a1f-86ef-5631d9a7442a	g.chr9:139740174C>A	ENST00000436881.1	+	1	1308	c.1308C>A	c.(1306-1308)ccC>ccA	p.P436P		NM_001080482.2	NP_001073951.2	C9J069	CI172_HUMAN	chromosome 9 open reading frame 172	436										endometrium(2)|large_intestine(1)|lung(6)	9						CCAGTCCGCCCCGGCTGGCCA	0.746													c|||	17	0.00339457	0.0129	0.0	5008	,	,		8810	0.0		0.0	False		,,,				2504	0.0				p.P436P		.											.	.	0			c.C1308A						.						3.0	3.0	3.0					9																	139740174		1102	2703	3805	SO:0001819	synonymous_variant	389813	exon1			TCCGCCCCGGCTG		CCDS48059.1	9q34.3	2012-04-03			ENSG00000232434	ENSG00000232434			37284	protein-coding gene	gene with protein product							Standard	NM_001080482		Approved		uc011meh.2	C9J069		ENST00000436881.1:c.1308C>A	9.37:g.139740174C>A		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	8	8	NM_001080482	0	0	0	0	0		Silent	SNP	ENST00000436881.1	37	CCDS48059.1																																																																																			.		0.746	C9orf172-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_001080482	
C9orf172	389813	hgsc.bcm.edu	37	9	139740195	139740195	+	Silent	SNP	C	C	A	rs575731810	byFrequency	TCGA-OR-A5LN-01A-11D-A29I-10	TCGA-OR-A5LN-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	cf6a87e3-f084-4b4c-a978-314c952310a0	c8e44d71-ecbb-4a1f-86ef-5631d9a7442a	g.chr9:139740195C>A	ENST00000436881.1	+	1	1329	c.1329C>A	c.(1327-1329)cgC>cgA	p.R443R	PHPT1_ENST00000371661.1_5'Flank	NM_001080482.2	NP_001073951.2	C9J069	CI172_HUMAN	chromosome 9 open reading frame 172	443										endometrium(2)|large_intestine(1)|lung(6)	9						CCGACAGCCGCCACTACTCGC	0.741													c|||	17	0.00339457	0.0129	0.0	5008	,	,		10227	0.0		0.0	False		,,,				2504	0.0				p.R443R		.											.	.	0			c.C1329A						.						4.0	4.0	4.0					9																	139740195		1216	2958	4174	SO:0001819	synonymous_variant	389813	exon1			CAGCCGCCACTAC		CCDS48059.1	9q34.3	2012-04-03			ENSG00000232434	ENSG00000232434			37284	protein-coding gene	gene with protein product							Standard	NM_001080482		Approved		uc011meh.2	C9J069		ENST00000436881.1:c.1329C>A	9.37:g.139740195C>A		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	10	8	NM_001080482	0	0	0	0	0		Silent	SNP	ENST00000436881.1	37	CCDS48059.1																																																																																			.		0.741	C9orf172-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_001080482	
CACNA1B	774	hgsc.bcm.edu	37	9	140917779	140917779	+	Missense_Mutation	SNP	G	G	T	rs7873074	byFrequency	TCGA-OR-A5LN-01A-11D-A29I-10	TCGA-OR-A5LN-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	cf6a87e3-f084-4b4c-a978-314c952310a0	c8e44d71-ecbb-4a1f-86ef-5631d9a7442a	g.chr9:140917779G>T	ENST00000371372.1	+	19	2729	c.2584G>T	c.(2584-2586)Gcg>Tcg	p.A862S	CACNA1B_ENST00000545473.1_5'Flank|CACNA1B_ENST00000371363.1_Missense_Mutation_p.A862S|CACNA1B_ENST00000277551.2_Missense_Mutation_p.A862S|CACNA1B_ENST00000277549.5_Missense_Mutation_p.A54S|CACNA1B_ENST00000371357.1_Missense_Mutation_p.A863S|CACNA1B_ENST00000371355.4_Missense_Mutation_p.A863S|CACNA1B_ENST00000371367.5_5'Flank	NM_000718.3|NM_001243812.1	NP_000709.1|NP_001230741.1	Q00975	CAC1B_HUMAN	calcium channel, voltage-dependent, N type, alpha 1B subunit	862			A -> S (in dbSNP:rs7873074).		calcium ion import (GO:0070509)|locomotory behavior (GO:0007626)|membrane depolarization (GO:0051899)|membrane depolarization during action potential (GO:0086010)|neurotransmitter secretion (GO:0007269)|regulation of blood pressure (GO:0008217)|regulation of calcium ion transport (GO:0051924)|regulation of heart contraction (GO:0008016)|response to pain (GO:0048265)|synaptic transmission (GO:0007268)|transport (GO:0006810)	dendrite (GO:0030425)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|high voltage-gated calcium channel activity (GO:0008331)|protein C-terminus binding (GO:0008022)|voltage-gated calcium channel activity (GO:0005245)			NS(3)|autonomic_ganglia(1)|breast(7)|central_nervous_system(1)|endometrium(10)|kidney(2)|large_intestine(17)|lung(31)|ovary(1)|prostate(1)|skin(2)|stomach(2)|urinary_tract(2)	80	all_cancers(76;0.166)			OV - Ovarian serous cystadenocarcinoma(145;1.16e-05)|Epithelial(140;0.000476)	Amlodipine(DB00381)|Gabapentin(DB00996)|Levetiracetam(DB01202)|Spironolactone(DB00421)|Verapamil(DB00661)	CAAGACCCCCGCGGCGGGGGA	0.771													G|||	2138	0.426917	0.7292	0.1383	5008	,	,		8593	0.6339		0.1541	False		,,,				2504	0.2904				p.A862S		.											.	CACNA1B-138	0			c.G2584T						.						1.0	1.0	1.0					9																	140917779		1024	2272	3296	SO:0001583	missense	774	exon19			ACCCCCGCGGCGG	AB209467	CCDS59522.1, CCDS59523.1	9q34	2013-01-10	2007-02-16		ENSG00000148408	ENSG00000148408		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"", ""EF-hand domain containing"""	1389	protein-coding gene	gene with protein product		601012		CACNL1A5		8825650, 16382099	Standard	NM_000718		Approved	Cav2.2, CACNN	uc004cog.3	Q00975	OTTHUMG00000021002	ENST00000371372.1:c.2584G>T	9.37:g.140917779G>T	ENSP00000360423:p.Ala862Ser	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	4	4	NM_001243812	0	0	0	0	0	B1AQK5	Missense_Mutation	SNP	ENST00000371372.1	37	CCDS59522.1	871	0.39880952380952384	351	0.7134146341463414	42	0.11602209944751381	361	0.6311188811188811	117	0.15435356200527706	G	2.404	-0.336886	0.05278	.	.	ENSG00000148408	ENST00000371372;ENST00000277551;ENST00000277549;ENST00000371363;ENST00000371357;ENST00000371355	D;D;D;D;D;D	0.96685	-3.87;-3.88;-4.09;-3.88;-3.86;-3.86	2.64	2.64	0.31445	.	607.713000	0.00166	N	0.000000	T	0.00012	0.0000	N	0.08118	0	0.80722	P	0.0	P;P;P	0.41748	0.731;0.761;0.612	B;B;B	0.32149	0.071;0.141;0.081	T	0.48559	-0.9025	9	0.07813	T	0.8	.	8.5047	0.33179	0.0:0.0:1.0:0.0	rs7873074;rs57704776	862;863;862	B1AQK4;B1AQK7;B1AQK6	.;.;.	S	862;862;54;862;863;863	ENSP00000360423:A862S;ENSP00000277551:A862S;ENSP00000277549:A54S;ENSP00000360414:A862S;ENSP00000360408:A863S;ENSP00000360406:A863S	ENSP00000277549:A54S	A	+	1	0	CACNA1B	140037600	0.000000	0.05858	0.012000	0.15200	0.095000	0.18619	-0.158000	0.10070	1.290000	0.44636	0.455000	0.32223	GCG	G|0.601;T|0.399		0.771	CACNA1B-001	KNOWN	non_canonical_conserved|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000055380.1	NM_000718	
DCAF8L1	139425	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	27999220	27999220	+	Missense_Mutation	SNP	C	C	G			TCGA-OR-A5LN-01A-11D-A29I-10	TCGA-OR-A5LN-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	cf6a87e3-f084-4b4c-a978-314c952310a0	c8e44d71-ecbb-4a1f-86ef-5631d9a7442a	g.chrX:27999220C>G	ENST00000441525.1	-	1	346	c.232G>C	c.(232-234)Gac>Cac	p.D78H		NM_001017930.1	NP_001017930.1	A6NGE4	DC8L1_HUMAN	DDB1 and CUL4 associated factor 8-like 1	78	Glu-rich.									NS(1)|breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(10)|lung(24)|ovary(3)|prostate(1)|skin(4)|stomach(1)|urinary_tract(1)	56						AGTTCGACGTCTTCACTTGAA	0.488																																					p.D78H		.											.	DCAF8L1-112	0			c.G232C						.						191.0	141.0	158.0					X																	27999220		2202	4300	6502	SO:0001583	missense	139425	exon1			CGACGTCTTCACT		CCDS35222.1	Xp22.11	2013-01-09	2009-07-17	2009-07-17	ENSG00000226372	ENSG00000226372		"""WD repeat domain containing"""	31810	protein-coding gene	gene with protein product			"""WD repeat domain 42B"""	WDR42B			Standard	NM_001017930		Approved		uc004dbx.1	A6NGE4	OTTHUMG00000021312	ENST00000441525.1:c.232G>C	X.37:g.27999220C>G	ENSP00000405222:p.Asp78His	Somatic	244	0		WXS	Illumina GAIIx	Phase_I	275	49	NM_001017930	0	0	0	0	0	B3KXX1	Missense_Mutation	SNP	ENST00000441525.1	37	CCDS35222.1	.	.	.	.	.	.	.	.	.	.	C	10.20	1.284633	0.23392	.	.	ENSG00000226372	ENST00000441525	T	0.67865	-0.29	0.842	-0.902	0.10537	.	0.687690	0.13454	N	0.386677	T	0.58977	0.2160	M	0.61703	1.905	0.21762	N	0.999554	P	0.47962	0.903	B	0.43052	0.406	T	0.53872	-0.8377	10	0.87932	D	0	-6.0559	4.6587	0.12632	0.0:0.5803:0.0:0.4197	.	78	A6NGE4	DC8L1_HUMAN	H	78	ENSP00000405222:D78H	ENSP00000405222:D78H	D	-	1	0	DCAF8L1	27909141	0.135000	0.22499	0.001000	0.08648	0.034000	0.12701	1.020000	0.30027	-0.382000	0.07870	0.284000	0.19432	GAC	.		0.488	DCAF8L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056150.2	XM_066690	
ANO4	121601	broad.mit.edu	37	12	101368641	101368642	+	Frame_Shift_Ins	INS	-	-	C	rs370605819|rs199907380		TCGA-OR-A5LN-01A-11D-A29I-10	TCGA-OR-A5LN-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	cf6a87e3-f084-4b4c-a978-314c952310a0	c8e44d71-ecbb-4a1f-86ef-5631d9a7442a	g.chr12:101368641_101368642insC	ENST00000392977.3	+	7	786_787	c.576_577insC	c.(577-579)cccfs	p.P193fs	ANO4_ENST00000299222.9_5'UTR|ANO4_ENST00000538618.1_3'UTR|ANO4_ENST00000392979.3_Frame_Shift_Ins_p.P158fs			Q32M45	ANO4_HUMAN	anoctamin 4	193					chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|intracellular (GO:0005622)|plasma membrane (GO:0005886)	intracellular calcium activated chloride channel activity (GO:0005229)			NS(1)|biliary_tract(1)|breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(14)|lung(33)|ovary(4)|prostate(5)|skin(7)|stomach(2)|urinary_tract(1)	78						TCTATTACCTGCCCCGCCGTTA	0.465										HNSCC(74;0.22)																											p.L157fs		.											.	ANO4-96	0			c.471_472insC						.																																			SO:0001589	frameshift_variant	121601	exon6			TTACCTGCCCCGC	AK091540	CCDS31884.1, CCDS66445.1	12q23.3	2014-04-09	2008-08-28	2008-08-28	ENSG00000151572	ENSG00000151572		"""Ion channels / Chloride channels : Calcium activated : Anoctamins"""	23837	protein-coding gene	gene with protein product		610111	"""transmembrane protein 16D"""	TMEM16D		12739008, 15067359, 24692353	Standard	NM_178826		Approved	FLJ34221, FLJ34272, FLJ35277	uc001thw.2	Q32M45		ENST00000392977.3:c.580dupC	12.37:g.101368645_101368645dupC	ENSP00000376703:p.Pro193fs	Somatic	89	0		WXS	Illumina GAIIx	Phase_I	118	7	NM_178826	0	0	0	0	0	Q8NAJ0|Q8NB39|Q8NB53	Frame_Shift_Ins	INS	ENST00000392977.3	37																																																																																				.		0.465	ANO4-002	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000409295.1	NM_178826	
CRIPAK	285464	hgsc.bcm.edu	37	4	1388398	1388399	+	Frame_Shift_Ins	INS	-	-	CCTGCTCATGTGCCCATGTGGAGTGCCCG			TCGA-OR-A5LN-01A-11D-A29I-10	TCGA-OR-A5LN-10A-01D-A29L-10	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	cf6a87e3-f084-4b4c-a978-314c952310a0	c8e44d71-ecbb-4a1f-86ef-5631d9a7442a	g.chr4:1388398_1388399insCCTGCTCATGTGCCCATGTGGAGTGCCCG	ENST00000324803.4	+	1	3059_3060	c.99_100insCCTGCTCATGTGCCCATGTGGAGTGCCCG	c.(100-102)cctfs	p.-34fs		NM_175918.3	NP_787114.2	Q8N1N5	CRPAK_HUMAN	cysteine-rich PAK1 inhibitor						negative regulation of intracellular estrogen receptor signaling pathway (GO:0033147)|negative regulation of protein kinase activity (GO:0006469)|regulation of cytoskeleton organization (GO:0051493)|response to estrogen (GO:0043627)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				NS(3)|breast(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(11)|ovary(1)|pancreas(2)|prostate(6)|skin(4)|urinary_tract(1)	35			OV - Ovarian serous cystadenocarcinoma(23;0.0106)			TGGAGTGCCCGCCTGCTCACAC	0.639																																					p.P33fs		.											.	CRIPAK-90	0			c.99_100insCCTGCTCATGTGCCCATGTGGAGTGCCCG						.																																			SO:0001589	frameshift_variant	285464	exon1			GTGCCCGCCTGCT	AK096209	CCDS3349.1	4p16.3	2011-02-10	2006-09-04		ENSG00000179979	ENSG00000179979			26619	protein-coding gene	gene with protein product		610203	"""cysteine-rich PAK1inhibitor"""			16278681	Standard	NM_175918		Approved	FLJ34443	uc003gdf.2	Q8N1N5	OTTHUMG00000121131	ENST00000324803.4:c.71_99dupCCTGCTCATGTGCCCATGTGGAGTGCCCG	4.37:g.1388398_1388399insCCTGCTCATGTGCCCATGTGGAGTGCCCG	ENSP00000323978:p.Pro34fs	Somatic	196	0		WXS	Illumina GAIIx	Phase_I	450	0	NM_175918	0	0	0	0	0	Q8NB03	Frame_Shift_Ins	INS	ENST00000324803.4	37	CCDS3349.1																																																																																			.		0.639	CRIPAK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000241607.2	NM_175918	
KIAA1211	57482	hgsc.bcm.edu	37	4	57180576	57180577	+	In_Frame_Ins	INS	-	-	GGAGCGGAG	rs71921617|rs138358443|rs11276076	byFrequency	TCGA-OR-A5LN-01A-11D-A29I-10	TCGA-OR-A5LN-10A-01D-A29L-10	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	cf6a87e3-f084-4b4c-a978-314c952310a0	c8e44d71-ecbb-4a1f-86ef-5631d9a7442a	g.chr4:57180576_57180577insGGAGCGGAG	ENST00000504228.1	+	6	1013_1014	c.908_909insGGAGCGGAG	c.(907-912)gcggag>gcGGAGCGGAGggag	p.307_308insRRE	KIAA1211_ENST00000264229.6_In_Frame_Ins_p.307_308insRRE|KIAA1211_ENST00000541073.1_In_Frame_Ins_p.300_301insRRE			Q6ZU35	K1211_HUMAN	KIAA1211	307	Glu-rich.									endometrium(7)|large_intestine(10)|lung(39)|ovary(2)|prostate(3)|skin(3)|stomach(1)	65	Glioma(25;0.08)|all_neural(26;0.101)					TGGGAGGACGCGGAGCGGAGGG	0.733																																					p.A303delinsAERR		.											.	KIAA1211-70	0			c.908_909insGGAGCGGAG						.																																			SO:0001652	inframe_insertion	57482	exon8			AGGACGCGGAGCG	AB033037	CCDS43230.1	4q12	2012-08-03			ENSG00000109265	ENSG00000109265			29219	protein-coding gene	gene with protein product						10574462, 11230166	Standard	NM_020722		Approved		uc003hbk.2	Q6ZU35	OTTHUMG00000160749	ENST00000504228.1:c.909_917dupGGAGCGGAG	4.37:g.57180577_57180585dupGGAGCGGAG	ENSP00000423366:p.Arg305_Glu307dup	Somatic	13	0		WXS	Illumina GAIIx	Phase_I	35	17	NM_020722	0	0	0	0	0	Q9NTE2|Q9NTP8|Q9ULK9	In_Frame_Ins	INS	ENST00000504228.1	37	CCDS43230.1																																																																																			.		0.733	KIAA1211-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000362097.2	NM_020722	
ATXN1	6310	broad.mit.edu	37	6	16327915	16327916	+	In_Frame_Ins	INS	-	-	TGC	rs11969612|rs369629396	byFrequency	TCGA-OR-A5LN-01A-11D-A29I-10	TCGA-OR-A5LN-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	cf6a87e3-f084-4b4c-a978-314c952310a0	c8e44d71-ecbb-4a1f-86ef-5631d9a7442a	g.chr6:16327915_16327916insTGC	ENST00000244769.4	-	8	1562_1563	c.626_627insGCA	c.(625-627)cat>caGCAt	p.208_209insQ	ATXN1_ENST00000436367.1_In_Frame_Ins_p.208_209insQ	NM_000332.3	NP_000323.2	P54253	ATX1_HUMAN	ataxin 1	208	Poly-Gln.		H -> Q (in dbSNP:rs11969612).		adult locomotory behavior (GO:0008344)|cell death (GO:0008219)|negative regulation of insulin-like growth factor receptor signaling pathway (GO:0043569)|negative regulation of phosphorylation (GO:0042326)|negative regulation of transcription, DNA-templated (GO:0045892)|nuclear export (GO:0051168)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|RNA processing (GO:0006396)|transcription, DNA-templated (GO:0006351)|visual learning (GO:0008542)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nuclear inclusion body (GO:0042405)|nuclear matrix (GO:0016363)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|identical protein binding (GO:0042802)|poly(G) binding (GO:0034046)|poly(U) RNA binding (GO:0008266)|protein C-terminus binding (GO:0008022)|protein self-association (GO:0043621)	p.H209delH(2)|p.H209_H211delHQH(1)		NS(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(11)|lung(12)|prostate(2)|skin(7)|upper_aerodigestive_tract(2)	44	Breast(50;0.063)|Ovarian(93;0.0733)	all_hematologic(90;0.000682)|Ovarian(999;0.00973)				gctgatgctgatgctgctgctg	0.668																																					p.H209delinsQH		.											.	ATXN1-93	3	Deletion - In frame(3)	upper_aerodigestive_tract(1)|large_intestine(1)|prostate(1)	c.627_628insGCA						.																																			SO:0001652	inframe_insertion	6310	exon7			ATGCTGATGCTGC	X79204	CCDS34342.1	6p23	2014-09-17	2004-08-12	2004-08-13	ENSG00000124788	ENSG00000124788		"""Ataxins"""	10548	protein-coding gene	gene with protein product		601556	"""spinocerebellar ataxia 1 (olivopontocerebellar ataxia 1, autosomal dominant, ataxin 1)"""	SCA1		1582256	Standard	NM_000332		Approved	D6S504E, ATX1	uc010jpi.3	P54253	OTTHUMG00000014303	ENST00000244769.4:c.624_626dupGCA	6.37:g.16327922_16327924dupTGC	ENSP00000244769:p.Gln209_Gln210dup	Somatic	20	0		WXS	Illumina GAIIx	Phase_I	42	9	NM_001128164	0	0	0	0	0	Q17S02|Q9UJG2|Q9Y4J1	In_Frame_Ins	INS	ENST00000244769.4	37	CCDS34342.1																																																																																			.		0.668	ATXN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039943.3	NM_000332	
AVL9	23080	broad.mit.edu	37	7	32535342	32535343	+	Frame_Shift_Ins	INS	-	-	G			TCGA-OR-A5LN-01A-11D-A29I-10	TCGA-OR-A5LN-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	cf6a87e3-f084-4b4c-a978-314c952310a0	c8e44d71-ecbb-4a1f-86ef-5631d9a7442a	g.chr7:32535342_32535343insG	ENST00000318709.4	+	1	242_243	c.21_22insG	c.(22-24)gggfs	p.G8fs	LSM5_ENST00000409909.3_5'Flank|AVL9_ENST00000459629.1_3'UTR|LSM5_ENST00000409952.3_5'Flank|AVL9_ENST00000409301.1_Frame_Shift_Ins_p.G8fs|AVL9_ENST00000404479.1_Frame_Shift_Ins_p.G8fs	NM_015060.1	NP_055875.1	Q8NBF6	AVL9_HUMAN	AVL9 homolog (S. cerevisiase)	8					cell migration (GO:0016477)	integral component of membrane (GO:0016021)|recycling endosome (GO:0055037)				endometrium(3)|kidney(1)|large_intestine(3)|lung(7)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	18						CCAGGAGAGGCGGGGATGGCGT	0.718																																					p.G7fs		.											.	AVL9-90	0			c.21_22insG						.			54,3176		7,40,1568						-1.4	0.0			11	106,6304		12,82,3111	no	frameshift	AVL9	NM_015060.1		19,122,4679	A1A1,A1R,RR		1.6537,1.6718,1.6598				160,9480				SO:0001589	frameshift_variant	23080	exon1			GAGAGGCGGGGAT	D87682	CCDS34613.1	7p14.3	2013-05-01	2008-10-03	2008-10-03	ENSG00000105778	ENSG00000105778			28994	protein-coding gene	gene with protein product		612927	"""KIAA0241"""	KIAA0241		17229886, 22595670	Standard	XM_005249668		Approved		uc003tcv.1	Q8NBF6	OTTHUMG00000152929	ENST00000318709.4:c.25dupG	7.37:g.32535346_32535346dupG	ENSP00000315568:p.Gly8fs	Somatic	48	0		WXS	Illumina GAIIx	Phase_I	206	7	NM_015060	0	0	0	0	0	Q92573	Frame_Shift_Ins	INS	ENST00000318709.4	37	CCDS34613.1																																																																																			.		0.718	AVL9-003	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000328643.1	NM_015060	
VARS	7407	hgsc.bcm.edu	37	6	31762843	31762844	+	Missense_Mutation	DNP	GG	GG	CT	rs2607015|rs2753960|rs67600122	byFrequency	TCGA-OR-A5LN-01A-11D-A29I-10	TCGA-OR-A5LN-10A-01D-A29L-10	GG	GG	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	cf6a87e3-f084-4b4c-a978-314c952310a0	c8e44d71-ecbb-4a1f-86ef-5631d9a7442a	g.chr6:31762843_31762844GG>CT	ENST00000375663.3	-	2	591_592	c.151_152CC>AG	c.(151-153)CCc>AGc	p.P51S	VARS_ENST00000444930.2_Intron|LSM2_ENST00000491421.1_5'Flank	NM_006295.2	NP_006286.1	P26640	SYVC_HUMAN	valyl-tRNA synthetase	51			P -> R (in dbSNP:rs2607015).|P -> T (in dbSNP:rs2753960).	P -> S (in Ref. 1; CAA41990 and 7; AAH12808). {ECO:0000305}.	gene expression (GO:0010467)|tRNA aminoacylation for protein translation (GO:0006418)|valyl-tRNA aminoacylation (GO:0006438)	cytosol (GO:0005829)|mitochondrion (GO:0005739)	aminoacyl-tRNA editing activity (GO:0002161)|ATP binding (GO:0005524)|valine-tRNA ligase activity (GO:0004832)			central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(18)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	30					L-Valine(DB00161)	TGGGGGAAAGGGAGTCCTGCTA	0.733																																					p.P51S		.											.	VARS-93	0			c.C151A						.																																			SO:0001583	missense	7407	exon2			GAAAGGGAGTCCT	BC012808	CCDS34412.1	6p21.3	2011-07-01		2005-07-05	ENSG00000204394	ENSG00000204394	6.1.1.9	"""Aminoacyl tRNA synthetases / Class I"""	12651	protein-coding gene	gene with protein product	"""valine tRNA ligase 1, cytoplasmic"""	192150	"""valyl-tRNA synthetase 2"""	VARS2		15779907	Standard	XM_005249362		Approved		uc003nxe.3	P26640	OTTHUMG00000031286	ENST00000375663.3:c.151_152delinsCT	6.37:g.31762843_31762844delinsCT	ENSP00000364815:p.Pro51Ser	Somatic	4	0		WXS	Illumina GAIIx	Phase_I	12	0	NM_006295	0	0	0	0	0	B0V1N1|B4DZ61|Q5JQ90|Q96E77|Q9UQM2	Missense_Mutation	DNP	ENST00000375663.3	37	CCDS34412.1																																																																																			G|0.721;T|0.279		0.733	VARS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076619.2	NM_006295	
