#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_TTotCov	i_TVarCov	i_Transcript_Id	i_Trna_alt1	i_Trna_alt2	i_Trna_ref	i_Trna_tot	i_Trna_var	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
AGMAT	79814	hgsc.bcm.edu	37	1	15911349	15911349	+	Silent	SNP	G	G	A	rs3737705	byFrequency	TCGA-OR-A5LO-01A-11D-A29I-10	TCGA-OR-A5LO-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	89d60dde-b03a-4cb7-b32a-5d06fa328603	4a5886aa-889d-4ef2-89a9-be2f7a06bd58	g.chr1:15911349G>A	ENST00000375826.3	-	1	256	c.114C>T	c.(112-114)gaC>gaT	p.D38D	DNAJC16_ENST00000483270.1_Intron|RP4-680D5.2_ENST00000428945.1_RNA	NM_024758.4	NP_079034.3	Q9BSE5	SPEB_HUMAN	agmatine ureohydrolase (agmatinase)	38					agmatine biosynthetic process (GO:0097055)|cellular nitrogen compound metabolic process (GO:0034641)|polyamine metabolic process (GO:0006595)|putrescine biosynthetic process from arginine (GO:0033388)|small molecule metabolic process (GO:0044281)|spermidine biosynthetic process (GO:0008295)	extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)	agmatinase activity (GO:0008783)|metal ion binding (GO:0046872)			endometrium(1)|kidney(2)|large_intestine(6)|lung(2)|skin(1)	12		Breast(348;0.000207)|Colorectal(325;0.000258)|Lung NSC(340;0.000359)|all_lung(284;0.000486)|Renal(390;0.000518)|Ovarian(437;0.0129)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;6.93e-07)|COAD - Colon adenocarcinoma(227;3.91e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000121)|KIRC - Kidney renal clear cell carcinoma(229;0.00257)|STAD - Stomach adenocarcinoma(313;0.00734)|READ - Rectum adenocarcinoma(331;0.0649)		TCCGGGGCGCGTCGGAAGCCT	0.791													G|||	1691	0.33766	0.2685	0.3084	5008	,	,		9254	0.5794		0.2952	False		,,,				2504	0.2464				p.D38D	NSCLC(126;1678 1780 25805 43508 49531)	.											.	AGMAT-91	0			c.C114T						.	G		446,1872		44,358,757	2.0	3.0	3.0		114	-4.1	0.0	1	dbSNP_107	3	1412,4272		187,1038,1617	no	coding-synonymous	AGMAT	NM_024758.4		231,1396,2374	AA,AG,GG		24.8417,19.2407,23.2192		38/353	15911349	1858,6144	1159	2842	4001	SO:0001819	synonymous_variant	79814	exon1			GGGCGCGTCGGAA	AY057097	CCDS160.1	1p36.13	2009-01-05			ENSG00000116771	ENSG00000116771			18407	protein-coding gene	gene with protein product						11804860, 14648699, 11914032	Standard	NM_024758		Approved	FLJ23384	uc001awv.2	Q9BSE5	OTTHUMG00000002357	ENST00000375826.3:c.114C>T	1.37:g.15911349G>A		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	6	6	NM_024758	0	0	0	3	3	Q5TDH1|Q9H5J3	Silent	SNP	ENST00000375826.3	37	CCDS160.1																																																																																			G|0.647;A|0.353		0.791	AGMAT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000006763.1	NM_024758	
KIAA0754	643314	broad.mit.edu;mdanderson.org	37	1	39879083	39879083	+	Missense_Mutation	SNP	C	C	A			TCGA-OR-A5LO-01A-11D-A29I-10	TCGA-OR-A5LO-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	89d60dde-b03a-4cb7-b32a-5d06fa328603	4a5886aa-889d-4ef2-89a9-be2f7a06bd58	g.chr1:39879083C>A	ENST00000530275.1	+	1	2933	c.2738C>A	c.(2737-2739)cCa>cAa	p.P913Q	MACF1_ENST00000545844.1_Intron|MACF1_ENST00000372915.3_Intron|MACF1_ENST00000289893.4_Intron|MACF1_ENST00000564288.1_Intron|MACF1_ENST00000539005.1_Intron|MACF1_ENST00000317713.7_Intron|MACF1_ENST00000567887.1_Intron|MACF1_ENST00000361689.2_Intron	NM_015038.1	NP_055853.1	O94854	K0754_HUMAN	KIAA0754	913	Ala-rich.									central_nervous_system(1)|large_intestine(6)|skin(1)	8	Lung NSC(20;5.57e-06)|Ovarian(52;0.00769)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0393)	OV - Ovarian serous cystadenocarcinoma(33;7.78e-19)|Epithelial(16;1.73e-17)|all cancers(16;2.49e-16)|LUSC - Lung squamous cell carcinoma(16;0.00146)|Lung(16;0.00204)			GTGCCCACCCCAGAGGAGCCC	0.721																																					p.P1049Q		.											.	.	0			c.C3146A						.						2.0	2.0	2.0					1																	39879083		1049	2640	3689	SO:0001583	missense	643314	exon1			CCACCCCAGAGGA			1p34.2	2009-07-09				ENSG00000255103			29111	protein-coding gene	gene with protein product						9872452	Standard	NM_015038		Approved		uc009vvt.1	O94854		ENST00000530275.1:c.2738C>A	1.37:g.39879083C>A	ENSP00000431179:p.Pro913Gln	Somatic	19	0		WXS	Illumina GAIIx	Phase_I	25	11	NM_015038	0	0	0	0	0	E9PMC2|Q6ZSB2	Missense_Mutation	SNP	ENST00000530275.1	37		.	.	.	.	.	.	.	.	.	.	C	14.70	2.613041	0.46631	.	.	ENSG00000255103	ENST00000530275	T	0.23348	1.91	4.42	0.00655	0.14067	.	.	.	.	.	T	0.20700	0.0498	L	0.34521	1.04	0.09310	N	1	B	0.32467	0.372	B	0.39419	0.299	T	0.33163	-0.9879	9	0.66056	D	0.02	.	5.3766	0.16168	0.0:0.5472:0.157:0.2957	.	913	O94854	K0754_HUMAN	Q	913	ENSP00000431179:P913Q	ENSP00000431179:P913Q	P	+	2	0	RP4-562N20.1	39651670	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.548000	0.06048	0.128000	0.18479	0.297000	0.19635	CCA	.		0.721	KIAA0754-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000392100.1	NM_015038	
GBP7	388646	ucsc.edu	37	1	89599070	89599070	+	Silent	SNP	T	T	C	rs151091316		TCGA-OR-A5LO-01A-11D-A29I-10	TCGA-OR-A5LO-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	89d60dde-b03a-4cb7-b32a-5d06fa328603	4a5886aa-889d-4ef2-89a9-be2f7a06bd58	g.chr1:89599070T>C	ENST00000294671.2	-	10	1671	c.1533A>G	c.(1531-1533)gaA>gaG	p.E511E		NM_207398.2	NP_997281.2	Q8N8V2	GBP7_HUMAN	guanylate binding protein 7	511						membrane (GO:0016020)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(2)|large_intestine(9)|lung(5)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	27		Lung NSC(277;0.0908)		all cancers(265;0.00835)|Epithelial(280;0.0322)		TTTGCTGCTGTTCCTTCTGTT	0.438																																					p.E511E		.											.	GBP7-92	0			c.A1533G						.																																			SO:0001819	synonymous_variant	388646	exon10			CTGCTGTTCCTTC	AK096141	CCDS720.1	1p22.2	2008-02-05			ENSG00000213512	ENSG00000213512			29606	protein-coding gene	gene with protein product		612468					Standard	NM_207398		Approved	FLJ38822, GBP4L	uc001dna.2	Q8N8V2	OTTHUMG00000010659	ENST00000294671.2:c.1533A>G	1.37:g.89599070T>C		Somatic	155	10		WXS	Illumina GAIIx	Phase_I	118	24	NM_207398	0	0	0	0	0		Silent	SNP	ENST00000294671.2	37	CCDS720.1																																																																																			T|0.997;C|0.003		0.438	GBP7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000029401.1	NM_207398	
IGSF3	3321	broad.mit.edu	37	1	117142736	117142736	+	Missense_Mutation	SNP	A	A	G	rs138851517	byFrequency	TCGA-OR-A5LO-01A-11D-A29I-10	TCGA-OR-A5LO-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	89d60dde-b03a-4cb7-b32a-5d06fa328603	4a5886aa-889d-4ef2-89a9-be2f7a06bd58	g.chr1:117142736A>G	ENST00000369486.3	-	7	2621	c.1856T>C	c.(1855-1857)aTc>aCc	p.I619T	IGSF3_ENST00000369483.1_Missense_Mutation_p.I639T|IGSF3_ENST00000318837.6_Missense_Mutation_p.I639T	NM_001007237.1	NP_001007238.1	O75054	IGSF3_HUMAN	immunoglobulin superfamily, member 3	619	Ig-like C2-type 5.				lacrimal gland development (GO:0032808)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)				NS(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|liver(1)|lung(31)|ovary(4)|prostate(1)|skin(4)|upper_aerodigestive_tract(2)	62	Lung SC(450;0.225)	all_cancers(81;1.24e-06)|all_epithelial(167;4.85e-07)|all_lung(203;1.66e-06)|Lung NSC(69;1.11e-05)		Lung(183;0.0142)|Colorectal(144;0.0929)|LUSC - Lung squamous cell carcinoma(189;0.108)|COAD - Colon adenocarcinoma(174;0.139)|all cancers(265;0.159)|Epithelial(280;0.166)		AGCCTTCTCGATGGCAGTTCG	0.627													A|||	10	0.00199681	0.0023	0.0029	5008	,	,		16651	0.001		0.001	False		,,,				2504	0.0031				p.I639T		.											.	IGSF3-92	0			c.T1916C						.																																			SO:0001583	missense	3321	exon8			TTCTCGATGGCAG	AF031174	CCDS30813.1, CCDS30814.1	1p13	2013-01-29			ENSG00000143061	ENSG00000143061		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5950	protein-coding gene	gene with protein product		603491				9790749	Standard	NM_001007237		Approved	V8, EWI-3, MGC117164	uc031pnr.1	O75054	OTTHUMG00000022751	ENST00000369486.3:c.1856T>C	1.37:g.117142736A>G	ENSP00000358498:p.Ile619Thr	Somatic	104	1		WXS	Illumina GAIIx	Phase_I	79	9	NM_001542	0	0	11	18	7	A6NJZ6|A6NMC7	Missense_Mutation	SNP	ENST00000369486.3	37	CCDS30813.1	.	.	.	.	.	.	.	.	.	.	A	16.34	3.096884	0.56075	.	.	ENSG00000143061	ENST00000369486;ENST00000369483;ENST00000318837	T;T;T	0.15256	2.44;2.44;2.44	4.8	4.8	0.61643	Immunoglobulin subtype (1);Immunoglobulin-like fold (1);	0.132915	0.52532	D	0.000079	T	0.06096	0.0158	N	0.19112	0.55	0.48571	D	0.999675	B;B;B	0.30914	0.162;0.3;0.195	B;B;B	0.33454	0.069;0.164;0.114	T	0.16837	-1.0389	10	0.51188	T	0.08	-37.2914	12.3358	0.55067	1.0:0.0:0.0:0.0	.	639;619;639	O75054-2;O75054;A6NJZ6	.;IGSF3_HUMAN;.	T	619;639;639	ENSP00000358498:I619T;ENSP00000358495:I639T;ENSP00000321184:I639T	ENSP00000321184:I639T	I	-	2	0	IGSF3	116944259	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	6.960000	0.76036	2.001000	0.58596	0.374000	0.22700	ATC	A|0.500;G|0.500		0.627	IGSF3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000059040.1	NM_001542	
TTF2	8458	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	117618146	117618146	+	Missense_Mutation	SNP	C	C	G			TCGA-OR-A5LO-01A-11D-A29I-10	TCGA-OR-A5LO-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	89d60dde-b03a-4cb7-b32a-5d06fa328603	4a5886aa-889d-4ef2-89a9-be2f7a06bd58	g.chr1:117618146C>G	ENST00000369466.4	+	5	984	c.940C>G	c.(940-942)Caa>Gaa	p.Q314E		NM_003594.3	NP_003585.3	Q9UNY4	TTF2_HUMAN	transcription termination factor, RNA polymerase II	314					ATP catabolic process (GO:0006200)|DNA-templated transcription, termination (GO:0006353)|mRNA processing (GO:0006397)|regulation of transcription, DNA-templated (GO:0006355)|RNA splicing (GO:0008380)|termination of RNA polymerase II transcription (GO:0006369)	cytoplasm (GO:0005737)|spliceosomal complex (GO:0005681)|transcription elongation factor complex (GO:0008023)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|DNA binding (GO:0003677)|DNA-dependent ATPase activity (GO:0008094)|zinc ion binding (GO:0008270)			NS(1)|autonomic_ganglia(1)|breast(1)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|liver(1)|lung(24)|ovary(1)|prostate(2)|skin(2)|urinary_tract(2)	50	Lung SC(450;0.225)	all_cancers(81;4.23e-06)|all_epithelial(167;3.65e-07)|all_lung(203;2.81e-06)|Lung NSC(69;1.98e-05)		Lung(183;0.0553)|Colorectal(144;0.179)|LUSC - Lung squamous cell carcinoma(189;0.19)		GGGGCATTTCCAAGAGCGGCC	0.607																																					p.Q314E		.											.	TTF2-91	0			c.C940G						.						40.0	42.0	42.0					1																	117618146		2203	4300	6503	SO:0001583	missense	8458	exon5			CATTTCCAAGAGC	AF073771	CCDS892.1	1p13.1	2014-02-18			ENSG00000116830	ENSG00000116830			12398	protein-coding gene	gene with protein product	"""zinc finger, GRF-type containing 6"""	604718				9748214	Standard	NM_003594		Approved	HuF2, ZGRF6	uc001egy.3	Q9UNY4	OTTHUMG00000012030	ENST00000369466.4:c.940C>G	1.37:g.117618146C>G	ENSP00000358478:p.Gln314Glu	Somatic	114	0		WXS	Illumina GAIIx	Phase_I	101	48	NM_003594	0	0	0	0	0	A8K4Q2|O75921|Q5T2K7|Q5VVU8|Q8N6I8	Missense_Mutation	SNP	ENST00000369466.4	37	CCDS892.1	.	.	.	.	.	.	.	.	.	.	C	4.762	0.141696	0.09083	.	.	ENSG00000116830	ENST00000369466	D	0.86366	-2.11	4.95	0.831	0.18860	.	0.223491	0.23074	N	0.052238	T	0.48259	0.1490	L	0.27053	0.805	0.09310	N	1	B;B	0.33103	0.063;0.397	B;B	0.28991	0.026;0.097	T	0.51679	-0.8675	10	0.08837	T	0.75	0.5593	1.8643	0.03195	0.165:0.4944:0.1599:0.1807	.	314;314	Q9UNY4;Q9UNY4-2	TTF2_HUMAN;.	E	314	ENSP00000358478:Q314E	ENSP00000358478:Q314E	Q	+	1	0	TTF2	117419669	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	0.593000	0.23999	-0.035000	0.13691	-0.305000	0.09177	CAA	.		0.607	TTF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033277.3		
NBPF7	343505	hgsc.bcm.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	120378701	120378701	+	IGR	SNP	C	C	G			TCGA-OR-A5LO-01A-11D-A29I-10	TCGA-OR-A5LO-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	89d60dde-b03a-4cb7-b32a-5d06fa328603	4a5886aa-889d-4ef2-89a9-be2f7a06bd58	g.chr1:120378701C>G								REG4 (24418 upstream) : ADAM30 (57454 downstream)																							ACTTTCTGTTCAACTAGTGCC	0.493																																					p.E349Q		.											.	NBPF7-24	0			c.G1045C						.						107.0	107.0	107.0					1																	120378701		1966	4169	6135	SO:0001628	intergenic_variant	343505	exon7			TCTGTTCAACTAG																													1.37:g.120378701C>G		Somatic	173	0		WXS	Illumina GAIIx	Phase_I	129	56	NM_001047980	0	0	0	0	0		Missense_Mutation	SNP		37																																																																																				.	0	0.493								
TXNIP	10628	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	1	145441200	145441202	+	In_Frame_Del	DEL	CAA	CAA	-			TCGA-OR-A5LO-01A-11D-A29I-10	TCGA-OR-A5LO-10A-01D-A29L-10	CAA	CAA	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	89d60dde-b03a-4cb7-b32a-5d06fa328603	4a5886aa-889d-4ef2-89a9-be2f7a06bd58	g.chr1:145441200_145441202delCAA	ENST00000369317.4	+	8	1492_1494	c.1158_1160delCAA	c.(1156-1161)ctcaac>ctc	p.N389del	TXNIP_ENST00000475171.1_3'UTR	NM_006472.3	NP_006463.3	Q9H3M7	TXNIP_HUMAN	thioredoxin interacting protein	389					cell cycle (GO:0007049)|cellular response to tumor cell (GO:0071228)|innate immune response (GO:0045087)|keratinocyte differentiation (GO:0030216)|negative regulation of cell division (GO:0051782)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive regulation of apoptotic process (GO:0043065)|protein import into nucleus (GO:0006606)|regulation of cell proliferation (GO:0042127)|response to calcium ion (GO:0051592)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|response to glucose (GO:0009749)|response to hydrogen peroxide (GO:0042542)|response to mechanical stimulus (GO:0009612)|response to progesterone (GO:0032570)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|mitochondrial intermembrane space (GO:0005758)|nucleus (GO:0005634)	enzyme inhibitor activity (GO:0004857)|ubiquitin protein ligase binding (GO:0031625)	p.N389delN(1)		breast(3)|cervix(1)|endometrium(1)|kidney(4)|large_intestine(1)|lung(5)|ovary(2)|prostate(3)|upper_aerodigestive_tract(1)	21	all_hematologic(18;0.0187)|Acute lymphoblastic leukemia(18;0.0786)					CCTGCATCCTCAACAACAATGTG	0.394																																					p.386_387del		.											.	TXNIP-92	1	Deletion - In frame(1)	breast(1)	c.1158_1160del						.																																			SO:0001651	inframe_deletion	10628	exon8			CATCCTCAACAAC	S73591	CCDS72876.1	1q11	2008-07-18			ENSG00000117289	ENSG00000265972			16952	protein-coding gene	gene with protein product	"""upregulated by 1,25-dihydroxyvitamin D-3"", ""thioredoxin binding protein 2"""	606599				8086474	Standard	NM_006472		Approved	VDUP1, EST01027, HHCPA78, THIF	uc001enn.4	Q9H3M7	OTTHUMG00000013755	ENST00000369317.4:c.1158_1160delCAA	1.37:g.145441206_145441208delCAA	ENSP00000358323:p.Asn389del	Somatic	98	0		WXS	Illumina GAIIx	Phase_I	108	25	NM_006472	0	0	0	0	0	B4E3D3|Q16226|Q6PML0|Q9BXG9	In_Frame_Del	DEL	ENST00000369317.4	37	CCDS913.1																																																																																			.		0.394	TXNIP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000038547.1	NM_006472	
DENND4B	9909	broad.mit.edu	37	1	153906135	153906135	+	Missense_Mutation	SNP	T	T	G			TCGA-OR-A5LO-01A-11D-A29I-10	TCGA-OR-A5LO-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	89d60dde-b03a-4cb7-b32a-5d06fa328603	4a5886aa-889d-4ef2-89a9-be2f7a06bd58	g.chr1:153906135T>G	ENST00000361217.4	-	20	3572	c.3154A>C	c.(3154-3156)Acc>Ccc	p.T1052P	DENND4B_ENST00000474386.1_5'Flank	NM_014856.2	NP_055671.2	O75064	DEN4B_HUMAN	DENN/MADD domain containing 4B	1052					positive regulation of Rab GTPase activity (GO:0032851)|regulation of Rab protein signal transduction (GO:0032483)	Golgi apparatus (GO:0005794)|nucleus (GO:0005634)	Rab guanyl-nucleotide exchange factor activity (GO:0017112)			NS(1)|breast(1)|cervix(1)|endometrium(7)|kidney(2)|large_intestine(6)|lung(9)|ovary(1)|prostate(5)|skin(2)|urinary_tract(1)	36	all_lung(78;2.89e-32)|Lung NSC(65;2.27e-30)|Hepatocellular(266;0.0877)|Melanoma(130;0.199)		LUSC - Lung squamous cell carcinoma(543;0.151)			CGTCGGGGGGTGCCTGCCTCA	0.697																																					p.T1052P		.											.	DENND4B-69	0			c.A3154C						.						4.0	6.0	6.0					1																	153906135		1855	3985	5840	SO:0001583	missense	9909	exon20			GGGGGGTGCCTGC	AB007945	CCDS44228.1	1q21.3	2012-10-03	2006-01-27	2006-01-27	ENSG00000198837	ENSG00000198837		"""DENN/MADD domain containing"""	29044	protein-coding gene	gene with protein product			"""KIAA0476"""	KIAA0476		9455484, 12906859	Standard	NM_014856		Approved		uc001fdd.1	O75064	OTTHUMG00000037157	ENST00000361217.4:c.3154A>C	1.37:g.153906135T>G	ENSP00000354597:p.Thr1052Pro	Somatic	20	2		WXS	Illumina GAIIx	Phase_I	38	10	NM_014856	0	0	13	14	1	Q5T4K0	Missense_Mutation	SNP	ENST00000361217.4	37	CCDS44228.1	.	.	.	.	.	.	.	.	.	.	T	14.22	2.469936	0.43839	.	.	ENSG00000198837	ENST00000361217;ENST00000368646	T;T	0.08282	3.19;3.11	5.09	5.09	0.68999	.	0.331958	0.31949	N	0.006804	T	0.02267	0.0070	L	0.27053	0.805	0.32932	D	0.517261	B	0.18310	0.027	B	0.12837	0.008	T	0.39057	-0.9632	10	0.35671	T	0.21	-23.9096	8.5979	0.33727	0.0:0.0872:0.0:0.9128	.	1052	O75064	DEN4B_HUMAN	P	1052;1063	ENSP00000354597:T1052P;ENSP00000357635:T1063P	ENSP00000354597:T1052P	T	-	1	0	DENND4B	152172759	1.000000	0.71417	0.998000	0.56505	0.976000	0.68499	2.953000	0.49105	2.131000	0.65755	0.379000	0.24179	ACC	.		0.697	DENND4B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090278.2	XM_375806	
NUP210L	91181	broad.mit.edu	37	1	154076608	154076608	+	Missense_Mutation	SNP	G	G	T			TCGA-OR-A5LO-01A-11D-A29I-10	TCGA-OR-A5LO-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	89d60dde-b03a-4cb7-b32a-5d06fa328603	4a5886aa-889d-4ef2-89a9-be2f7a06bd58	g.chr1:154076608G>T	ENST00000368559.3	-	13	1770	c.1699C>A	c.(1699-1701)Ccc>Acc	p.P567T	MIR5698_ENST00000577643.1_RNA|NUP210L_ENST00000271854.3_Missense_Mutation_p.P567T	NM_207308.2	NP_997191.2	Q5VU65	P210L_HUMAN	nucleoporin 210kDa-like	567					Sertoli cell development (GO:0060009)|spermatid development (GO:0007286)	integral component of membrane (GO:0016021)				NS(1)|breast(6)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(12)|lung(34)|ovary(4)|pancreas(1)|prostate(2)|skin(6)|urinary_tract(2)	80	all_lung(78;9.35e-31)|Lung NSC(65;1.33e-28)|Hepatocellular(266;0.0877)|Melanoma(130;0.128)		LUSC - Lung squamous cell carcinoma(543;0.151)|Colorectal(543;0.198)			ATTGCAATGGGTATTTCTATA	0.383																																					p.P567T		.											.	NUP210L-77	0			c.C1699A						.						182.0	164.0	169.0					1																	154076608		1870	4114	5984	SO:0001583	missense	91181	exon13			CAATGGGTATTTC	AK125924	CCDS41399.1, CCDS53370.1	1q21.3	2008-02-05			ENSG00000143552	ENSG00000143552			29915	protein-coding gene	gene with protein product							Standard	NM_207308		Approved		uc001fdw.3	Q5VU65	OTTHUMG00000035852	ENST00000368559.3:c.1699C>A	1.37:g.154076608G>T	ENSP00000357547:p.Pro567Thr	Somatic	72	0		WXS	Illumina GAIIx	Phase_I	58	4	NM_001159484	0	0	0	0	0	E7EP56|Q5T4L7|Q6ZRN1|Q6ZRT4|Q6ZU81|Q8NDI6|Q9UF31	Missense_Mutation	SNP	ENST00000368559.3	37	CCDS41399.1	.	.	.	.	.	.	.	.	.	.	G	14.52	2.560769	0.45590	.	.	ENSG00000143552	ENST00000368559;ENST00000271854	T;T	0.05199	3.48;3.48	4.83	3.92	0.45320	.	0.000000	0.64402	D	0.000013	T	0.10337	0.0253	M	0.65975	2.015	0.34633	D	0.719807	D;P	0.76494	0.999;0.747	D;B	0.64144	0.922;0.399	T	0.03555	-1.1025	10	0.42905	T	0.14	-10.8982	11.1265	0.48322	0.0866:0.0:0.9134:0.0	.	567;567	E7EP56;Q5VU65	.;P210L_HUMAN	T	567	ENSP00000357547:P567T;ENSP00000271854:P567T	ENSP00000271854:P567T	P	-	1	0	NUP210L	152343232	1.000000	0.71417	1.000000	0.80357	0.906000	0.53458	5.249000	0.65427	1.267000	0.44247	-0.142000	0.14014	CCC	.		0.383	NUP210L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087270.3	NM_207308	
SCAMP3	10067	ucsc.edu;bcgsc.ca	37	1	155230131	155230131	+	Silent	SNP	C	C	T	rs1142287	byFrequency	TCGA-OR-A5LO-01A-11D-A29I-10	TCGA-OR-A5LO-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	89d60dde-b03a-4cb7-b32a-5d06fa328603	4a5886aa-889d-4ef2-89a9-be2f7a06bd58	g.chr1:155230131C>T	ENST00000302631.3	-	4	485	c.378G>A	c.(376-378)ggG>ggA	p.G126G	SCAMP3_ENST00000472397.1_5'UTR|SCAMP3_ENST00000355379.3_Silent_p.G100G|CLK2_ENST00000497188.1_5'Flank	NM_005698.3	NP_005689.2	O14828	SCAM3_HUMAN	secretory carrier membrane protein 3	126					post-Golgi vesicle-mediated transport (GO:0006892)|protein transport (GO:0015031)|response to retinoic acid (GO:0032526)	extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	ubiquitin protein ligase binding (GO:0031625)			breast(1)|endometrium(3)|large_intestine(3)|lung(7)|ovary(4)|urinary_tract(1)	19	all_lung(78;2.32e-23)|Hepatocellular(266;0.0877)|all_hematologic(923;0.088)		Epithelial(20;3.72e-10)|all cancers(21;1.19e-09)|BRCA - Breast invasive adenocarcinoma(34;0.000752)|LUSC - Lung squamous cell carcinoma(543;0.193)			TAGCTGTGCCCCCCAGGGCAG	0.592													C|||	2263	0.451877	0.5416	0.3199	5008	,	,		20022	0.6944		0.2753	False		,,,				2504	0.3558				p.G126G		.											.	SCAMP3-93	0			c.G378A						.	C	,	2359,2047		635,1089,479	86.0	84.0	85.0	http://www.ncbi.nlm.nih.gov/pubmed?term	378,300	-1.6	0.4	1	dbSNP_86	85	2253,6347		306,1641,2353	yes	coding-synonymous,coding-synonymous	SCAMP3	NM_005698.3,NM_052837.2	,	941,2730,2832	TT,TC,CC	http://www.ncbi.nlm.nih.gov/pubmed?term	26.1977,46.4594,35.4606	,	126/348,100/322	155230131	4612,8394	2203	4300	6503	SO:0001819	synonymous_variant	10067	exon4			TGTGCCCCCCAGG	AF005039	CCDS1105.1, CCDS1106.1	1q21	2013-02-21			ENSG00000116521	ENSG00000116521		"""Secretory carrier membrane proteins"""	10565	protein-coding gene	gene with protein product	"""Propin 1"""	606913		C1orf3		9331372, 9658162	Standard	NM_005698		Approved		uc001fjs.3	O14828	OTTHUMG00000035874	ENST00000302631.3:c.378G>A	1.37:g.155230131C>T		Somatic	35	0		WXS	Illumina GAIIx	Phase_I	26	4	NM_005698	0	0	0	0	0	A9Z1W6|B1AVS6|O15128|Q96FR8|Q9BPY0	Silent	SNP	ENST00000302631.3	37	CCDS1105.1																																																																																			C|0.584;T|0.416		0.592	SCAMP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087399.1	NM_005698	
ATP1B1	481	bcgsc.ca	37	1	169096477	169096477	+	Missense_Mutation	SNP	C	C	T	rs141812161	byFrequency	TCGA-OR-A5LO-01A-11D-A29I-10	TCGA-OR-A5LO-10A-01D-A29L-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	89d60dde-b03a-4cb7-b32a-5d06fa328603	4a5886aa-889d-4ef2-89a9-be2f7a06bd58	g.chr1:169096477C>T	ENST00000367816.1	+	5	927	c.398C>T	c.(397-399)cCg>cTg	p.P133L	ATP1B1_ENST00000367815.4_Missense_Mutation_p.P133L|ATP1B1_ENST00000367813.3_Missense_Mutation_p.P125L|ATP1B1_ENST00000499679.3_Missense_Mutation_p.P77L			P05026	AT1B1_HUMAN	ATPase, Na+/K+ transporting, beta 1 polypeptide	133					blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cell adhesion (GO:0007155)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular calcium ion homeostasis (GO:0006874)|cellular potassium ion homeostasis (GO:0030007)|cellular sodium ion homeostasis (GO:0006883)|ion transmembrane transport (GO:0034220)|leukocyte migration (GO:0050900)|membrane repolarization (GO:0086009)|membrane repolarization during cardiac muscle cell action potential (GO:0086013)|positive regulation of ATP catabolic process (GO:1903291)|positive regulation of ATPase activity (GO:0032781)|positive regulation of calcium:sodium antiporter activity (GO:1903281)|positive regulation of potassium ion import (GO:1903288)|positive regulation of potassium ion transmembrane transporter activity (GO:1901018)|positive regulation of sodium ion export from cell (GO:1903278)|potassium ion import (GO:0010107)|protein localization to plasma membrane (GO:0072659)|protein stabilization (GO:0050821)|protein transport into plasma membrane raft (GO:0044861)|regulation of cardiac muscle contraction by calcium ion signaling (GO:0010882)|regulation of gene expression (GO:0010468)|relaxation of cardiac muscle (GO:0055119)|response to hypoxia (GO:0001666)|sodium ion export from cell (GO:0036376)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|caveola (GO:0005901)|extracellular vesicular exosome (GO:0070062)|intercalated disc (GO:0014704)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|sodium:potassium-exchanging ATPase complex (GO:0005890)|vesicle (GO:0031982)	ATPase activator activity (GO:0001671)|ATPase binding (GO:0051117)|MHC class II protein complex binding (GO:0023026)|sodium:potassium-exchanging ATPase activity (GO:0005391)			breast(1)|endometrium(1)|kidney(3)|large_intestine(3)|lung(4)|ovary(1)|prostate(1)	14	all_hematologic(923;0.208)					CCCAGTGAACCGAAAGAACGA	0.383																																					p.P133L		.											.	ATP1B1-540	0			c.C398T						.	C	LEU/PRO	0,4406		0,0,2203	88.0	85.0	86.0		398	-0.7	0.1	1	dbSNP_134	86	2,8598	2.2+/-6.3	0,2,4298	yes	missense	ATP1B1	NM_001677.3	98	0,2,6501	TT,TC,CC		0.0233,0.0,0.0154	benign	133/304	169096477	2,13004	2203	4300	6503	SO:0001583	missense	481	exon4			GTGAACCGAAAGA	U16799	CCDS1276.1	1q24.2	2012-10-22			ENSG00000143153	ENSG00000143153		"""ATPases / P-type"""	804	protein-coding gene	gene with protein product	"""sodium/potassium-transporting ATPase subunit beta-1"", ""sodium pump subunit beta-1"", ""sodium-potassium ATPase subunit beta 1 (non-catalytic)"""	182330		ATP1B			Standard	NM_001677		Approved		uc001gfr.1	P05026	OTTHUMG00000034590	ENST00000367816.1:c.398C>T	1.37:g.169096477C>T	ENSP00000356790:p.Pro133Leu	Somatic	69	0		WXS	Illumina GAIIx	Phase_I	56	6	NM_001677	0	0	60	60	0	Q5TGZ3	Missense_Mutation	SNP	ENST00000367816.1	37	CCDS1276.1	.	.	.	.	.	.	.	.	.	.	C	0.790	-0.759301	0.03019	0.0	2.33E-4	ENSG00000143153	ENST00000367816;ENST00000367815;ENST00000499679;ENST00000367813	T;T;T;T	0.26810	1.71;1.71;1.71;1.71	6.02	-0.683	0.11335	.	0.669254	0.16844	N	0.197210	T	0.03651	0.0104	N	0.19112	0.55	0.27608	N	0.948748	B	0.02656	0.0	B	0.04013	0.001	T	0.43956	-0.9359	9	0.12103	T	0.63	-27.1059	6.2604	0.20897	0.615:0.2166:0.0:0.1684	.	133	P05026	AT1B1_HUMAN	L	133;133;77;125	ENSP00000356790:P133L;ENSP00000356789:P133L;ENSP00000423450:P77L;ENSP00000356787:P125L	ENSP00000356787:P125L	P	+	2	0	ATP1B1	167363101	0.786000	0.28738	0.050000	0.19076	0.136000	0.21042	1.042000	0.30303	-0.019000	0.14055	0.655000	0.94253	CCG	C|1.000;T|0.000		0.383	ATP1B1-002	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000083696.1		
NME7	29922	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	169292366	169292366	+	Silent	SNP	A	A	G			TCGA-OR-A5LO-01A-11D-A29I-10	TCGA-OR-A5LO-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	89d60dde-b03a-4cb7-b32a-5d06fa328603	4a5886aa-889d-4ef2-89a9-be2f7a06bd58	g.chr1:169292366A>G	ENST00000367811.3	-	3	523	c.267T>C	c.(265-267)agT>agC	p.S89S	NME7_ENST00000472647.1_Silent_p.S53S|NME7_ENST00000469474.1_5'UTR|RP4-800F24.1_ENST00000432081.1_RNA	NM_013330.3	NP_037462.1	Q9Y5B8	NDK7_HUMAN	NME/NM23 family member 7	89	DM10. {ECO:0000255|PROSITE- ProRule:PRU00665}.				brain development (GO:0007420)|ciliary receptor clustering involved in smoothened signaling pathway (GO:0060830)|CTP biosynthetic process (GO:0006241)|determination of left/right symmetry (GO:0007368)|epithelial cilium movement (GO:0003351)|GTP biosynthetic process (GO:0006183)|intraciliary transport (GO:0042073)|left/right pattern formation (GO:0060972)|UTP biosynthetic process (GO:0006228)	centrosome (GO:0005813)|ciliary basal body (GO:0036064)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|nucleoside diphosphate kinase activity (GO:0004550)			central_nervous_system(1)|kidney(1)|large_intestine(5)|lung(8)|skin(1)	16	all_hematologic(923;0.208)					TTTCTTTCCTACTGCCCAGCT	0.353																																					p.S89S		.											.	NME7-514	0			c.T267C						.						84.0	84.0	84.0					1																	169292366		2203	4300	6503	SO:0001819	synonymous_variant	29922	exon3			TTTCCTACTGCCC	AF153191	CCDS1277.1, CCDS44274.1	1q24.2	2014-07-31	2012-05-18		ENSG00000143156	ENSG00000143156			20461	protein-coding gene	gene with protein product	"""cilia and flagella associated protein 67"""	613465	"""non-metastatic cells 7, protein expressed in (nucleoside-diphosphate kinase)"""			19852809	Standard	NM_197972		Approved	FLJ37194, NM23-H7, CFAP67	uc001gfu.3	Q9Y5B8	OTTHUMG00000034586	ENST00000367811.3:c.267T>C	1.37:g.169292366A>G		Somatic	50	0		WXS	Illumina GAIIx	Phase_I	32	13	NM_013330	0	0	1	1	0	A8K3T6|A8MY09|B3KSW9|Q5TGZ4	Silent	SNP	ENST00000367811.3	37	CCDS1277.1																																																																																			.		0.353	NME7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000083688.1	NM_013330	
PAPPA2	60676	broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	176679229	176679229	+	Missense_Mutation	SNP	C	C	G			TCGA-OR-A5LO-01A-11D-A29I-10	TCGA-OR-A5LO-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	89d60dde-b03a-4cb7-b32a-5d06fa328603	4a5886aa-889d-4ef2-89a9-be2f7a06bd58	g.chr1:176679229C>G	ENST00000367662.3	+	11	4732	c.3568C>G	c.(3568-3570)Caa>Gaa	p.Q1190E		NM_020318.2	NP_064714.2	Q9BXP8	PAPP2_HUMAN	pappalysin 2	1190					bone morphogenesis (GO:0060349)|cell differentiation (GO:0030154)|cellular protein metabolic process (GO:0044267)|proteolysis (GO:0006508)|regulation of cell growth (GO:0001558)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|membrane (GO:0016020)	metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			NS(3)|breast(3)|central_nervous_system(7)|cervix(5)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(19)|lung(136)|ovary(7)|pancreas(1)|prostate(4)|skin(10)|upper_aerodigestive_tract(8)|urinary_tract(1)	226						ATACTTGGATCAATGGGCTAC	0.453																																					p.Q1190E		.											.	PAPPA2-548	0			c.C3568G						.						126.0	122.0	124.0					1																	176679229		1896	4126	6022	SO:0001583	missense	60676	exon11			TTGGATCAATGGG	BG354569	CCDS41438.1, CCDS41439.1	1q23-q25	2008-05-23	2004-07-07	2004-07-09	ENSG00000116183	ENSG00000116183			14615	protein-coding gene	gene with protein product			"""placenta-specific 3"""	PLAC3		11018262, 11264294	Standard	NM_021936		Approved	PAPPE, PAPP-A2	uc001gkz.3	Q9BXP8	OTTHUMG00000035025	ENST00000367662.3:c.3568C>G	1.37:g.176679229C>G	ENSP00000356634:p.Gln1190Glu	Somatic	193	1		WXS	Illumina GAIIx	Phase_I	128	52	NM_020318	0	0	0	0	0	A9Z1Y8|Q96PH7|Q96PH8|Q9H4C9	Missense_Mutation	SNP	ENST00000367662.3	37	CCDS41438.1	.	.	.	.	.	.	.	.	.	.	C	18.02	3.529859	0.64860	.	.	ENSG00000116183	ENST00000367662	T	0.56941	0.43	5.76	5.76	0.90799	.	0.113881	0.64402	D	0.000011	T	0.76990	0.4065	M	0.85859	2.78	0.80722	D	1	D	0.76494	0.999	D	0.72075	0.976	T	0.79899	-0.1608	10	0.87932	D	0	-6.6759	19.571	0.95419	0.0:1.0:0.0:0.0	.	1190	Q9BXP8	PAPP2_HUMAN	E	1190	ENSP00000356634:Q1190E	ENSP00000356634:Q1190E	Q	+	1	0	PAPPA2	174945852	1.000000	0.71417	1.000000	0.80357	0.060000	0.15804	7.040000	0.76551	2.713000	0.92767	0.655000	0.94253	CAA	.		0.453	PAPPA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084763.1		
C1orf106	55765	hgsc.bcm.edu	37	1	200880978	200880978	+	Missense_Mutation	SNP	C	C	T	rs296520	byFrequency	TCGA-OR-A5LO-01A-11D-A29I-10	TCGA-OR-A5LO-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	89d60dde-b03a-4cb7-b32a-5d06fa328603	4a5886aa-889d-4ef2-89a9-be2f7a06bd58	g.chr1:200880978C>T	ENST00000367342.4	+	9	1812	c.1612C>T	c.(1612-1614)Cgc>Tgc	p.R538C	C1orf106_ENST00000413687.2_Missense_Mutation_p.R453C	NM_018265.3	NP_060735.3	Q3KP66	CA106_HUMAN	chromosome 1 open reading frame 106	538			R -> C (in dbSNP:rs296520). {ECO:0000269|PubMed:14702039, ECO:0000269|PubMed:15489334}.							endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(6)|ovary(1)|prostate(2)|skin(3)|stomach(1)|urinary_tract(2)	21						GTGGGAGCTGCGCCGCGCAGC	0.736													T|||	3966	0.791933	0.6089	0.8213	5008	,	,		12017	0.997		0.7256	False		,,,				2504	0.8753				p.R552C		.											.	C1orf106-93	0			c.C1654T						.	T	CYS/ARG,CYS/ARG	2547,1503		890,767,368	5.0	7.0	6.0		1357,1612	0.8	0.0	1	dbSNP_79	6	5587,2355		2124,1339,508	no	missense,missense	C1orf106	NM_001142569.2,NM_018265.3	180,180	3014,2106,876	TT,TC,CC		29.6525,37.1111,32.1714	benign,benign	453/579,538/664	200880978	8134,3858	2025	3971	5996	SO:0001583	missense	55765	exon9			GAGCTGCGCCGCG	AK001763	CCDS44292.1	1q32.1	2011-02-15			ENSG00000163362	ENSG00000163362			25599	protein-coding gene	gene with protein product						14702039	Standard	NM_018265		Approved	FLJ10901	uc001gvo.4	Q3KP66	OTTHUMG00000035789	ENST00000367342.4:c.1612C>T	1.37:g.200880978C>T	ENSP00000356311:p.Arg538Cys	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	12	11	NM_018265	0	0	0	1	1	B4E1K9|E9PFY0|Q9NV65|Q9NVI0	Missense_Mutation	SNP	ENST00000367342.4	37		1677	0.7678571428571429	261	0.5304878048780488	285	0.787292817679558	569	0.9947552447552448	562	0.741424802110818	T	0.366	-0.936884	0.02340	0.628889	0.703475	ENSG00000163362	ENST00000367342;ENST00000413687	T;T	0.28454	1.61;1.61	3.39	0.759	0.18438	.	0.912041	0.09365	N	0.812206	T	0.00012	0.0000	N	0.01576	-0.805	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.16188	-1.0411	9	0.29301	T	0.29	-23.0614	3.796	0.08740	0.0:0.2241:0.1856:0.5903	rs296520;rs7519373;rs56757010	538	Q3KP66	CA106_HUMAN	C	538;453	ENSP00000356311:R538C;ENSP00000392105:R453C	ENSP00000356311:R538C	R	+	1	0	C1orf106	199147601	0.004000	0.15560	0.002000	0.10522	0.007000	0.05969	-0.731000	0.04909	-0.124000	0.11724	-0.381000	0.06696	CGC	C|0.242;T|0.758		0.736	C1orf106-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000087057.2	NM_018265	
ELK4	2005	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	205592890	205592890	+	Missense_Mutation	SNP	C	C	A			TCGA-OR-A5LO-01A-11D-A29I-10	TCGA-OR-A5LO-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	89d60dde-b03a-4cb7-b32a-5d06fa328603	4a5886aa-889d-4ef2-89a9-be2f7a06bd58	g.chr1:205592890C>A	ENST00000357992.4	-	2	460	c.121G>T	c.(121-123)Gtg>Ttg	p.V41L	ELK4_ENST00000468523.1_5'UTR|ELK4_ENST00000289703.4_Missense_Mutation_p.V41L	NM_001973.3	NP_001964.2	P28324	ELK4_HUMAN	ELK4, ETS-domain protein (SRF accessory protein 1)	41					cell differentiation (GO:0030154)|histone H3 deacetylation (GO:0070932)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|core promoter binding (GO:0001047)|DNA binding (GO:0003677)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription cofactor activity (GO:0003712)		SLC45A3/ELK4(18)	breast(1)|endometrium(1)|kidney(2)|large_intestine(1)|lung(6)|skin(1)	12	Breast(84;0.07)		BRCA - Breast invasive adenocarcinoma(75;0.0908)			AGACGAGCCACCTCTTCTGCC	0.473			T	SLC45A3	prostate																																p.V41L		.		Dom	yes		1	1q32	2005	"""ELK4, ETS-domain protein (SRF accessory protein 1)"""		E	.	ELK4-658	0			c.G121T						.						160.0	158.0	159.0					1																	205592890		2203	4300	6503	SO:0001583	missense	2005	exon2			GAGCCACCTCTTC	M85165	CCDS1456.1, CCDS1457.1	1q32	2008-02-05			ENSG00000158711	ENSG00000158711			3326	protein-coding gene	gene with protein product		600246				7851904, 8575773	Standard	NM_001973		Approved	SAP1		P28324	OTTHUMG00000037221	ENST00000357992.4:c.121G>T	1.37:g.205592890C>A	ENSP00000350681:p.Val41Leu	Somatic	179	0		WXS	Illumina GAIIx	Phase_I	114	50	NM_021795	0	0	1	4	3	P28323|Q6GSJ2	Missense_Mutation	SNP	ENST00000357992.4	37	CCDS1456.1	.	.	.	.	.	.	.	.	.	.	C	35	5.519149	0.96416	.	.	ENSG00000158711	ENST00000539916;ENST00000357992;ENST00000289703	T;T	0.60672	0.17;0.17	5.58	5.58	0.84498	Winged helix-turn-helix transcription repressor DNA-binding (1);Ets (4);	0.000000	0.85682	D	0.000000	T	0.75488	0.3856	M	0.66439	2.03	0.80722	D	1	P;D	0.76494	0.832;0.999	P;D	0.78314	0.699;0.991	T	0.76881	-0.2795	10	0.87932	D	0	.	18.4943	0.90858	0.0:1.0:0.0:0.0	.	41;41	P28324-2;P28324	.;ELK4_HUMAN	L	131;41;41	ENSP00000350681:V41L;ENSP00000289703:V41L	ENSP00000289703:V41L	V	-	1	0	ELK4	203859513	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.776000	0.85560	2.778000	0.95560	0.655000	0.94253	GTG	.		0.473	ELK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090615.1	NM_021795	
ARID4B	51742	bcgsc.ca	37	1	235383188	235383188	+	Silent	SNP	A	A	G	rs4659654	byFrequency	TCGA-OR-A5LO-01A-11D-A29I-10	TCGA-OR-A5LO-10A-01D-A29L-10	A	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	89d60dde-b03a-4cb7-b32a-5d06fa328603	4a5886aa-889d-4ef2-89a9-be2f7a06bd58	g.chr1:235383188A>G	ENST00000264183.3	-	16	2000	c.1503T>C	c.(1501-1503)gaT>gaC	p.D501D	ARID4B_ENST00000366603.2_Silent_p.D501D|ARID4B_ENST00000349213.3_Silent_p.D501D	NM_016374.5	NP_057458.4	Q4LE39	ARI4B_HUMAN	AT rich interactive domain 4B (RBP1-like)	501	Glu-rich.				histone H3-K9 trimethylation (GO:0036124)|histone H4-K20 trimethylation (GO:0034773)|regulation of gene expression by genetic imprinting (GO:0006349)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)			NS(1)|breast(2)|large_intestine(2)|lung(1)|ovary(2)	8	Ovarian(103;0.0473)|Breast(184;0.23)	all_cancers(173;0.000782)|Prostate(94;0.0132)|all_epithelial(177;0.0808)|Lung SC(1967;0.24)	OV - Ovarian serous cystadenocarcinoma(106;2.86e-05)			CATCTTTGTCATCCAGATTTT	0.328													G|||	2261	0.451478	0.4433	0.5115	5008	,	,		15454	0.251		0.4791	False		,,,				2504	0.5982				p.D501D		.											.	ARID4B-228	0			c.T1503C						.	G	,,	2101,2305	601.5+/-389.7	494,1113,596	209.0	191.0	197.0		1503,1503,1503	-1.5	0.0	1	dbSNP_111	197	3988,4610	599.8+/-394.1	924,2140,1235	no	coding-synonymous,coding-synonymous,coding-synonymous	ARID4B	NM_001206794.1,NM_016374.5,NM_031371.3	,,	1418,3253,1831	GG,GA,AA		46.3829,47.685,46.8241	,,	501/1313,501/1313,501/1227	235383188	6089,6915	2203	4299	6502	SO:0001819	synonymous_variant	51742	exon16			TTTGTCATCCAGA	AF214114	CCDS31060.1, CCDS31061.1	1q42.1-q43	2013-02-07	2006-11-08	2004-01-30	ENSG00000054267	ENSG00000054267		"""-"""	15550	protein-coding gene	gene with protein product		609696	"""retinoblastoma binding protein 1-like 1"", ""AT rich interactive domain 4B (RBP1- like)"""	RBP1L1		11481388	Standard	NM_016374		Approved	BCAA, BRCAA1, SAP180	uc001hwq.3	Q4LE39	OTTHUMG00000039621	ENST00000264183.3:c.1503T>C	1.37:g.235383188A>G		Somatic	62	0		WXS	Illumina GAIIx	Phase_I	45	4	NM_016374	0	0	7	7	0	A1L465|Q3MHV4|Q5HY99|Q5T2C2|Q5T2C3|Q5T2C4|Q5T2C5|Q5T2C6|Q6P600|Q86UX1|Q86WR4|Q9H915|Q9NYU3|Q9NZB6|Q9NZG4|Q9P2W4|Q9UF62|Q9Y6E1	Silent	SNP	ENST00000264183.3	37	CCDS31061.1																																																																																			A|0.549;G|0.451		0.328	ARID4B-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095566.3	NM_016374	
CEP170	9859	broad.mit.edu	37	1	243333027	243333027	+	Silent	SNP	A	A	G	rs200644784		TCGA-OR-A5LO-01A-11D-A29I-10	TCGA-OR-A5LO-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	89d60dde-b03a-4cb7-b32a-5d06fa328603	4a5886aa-889d-4ef2-89a9-be2f7a06bd58	g.chr1:243333027A>G	ENST00000366542.1	-	12	1797	c.1746T>C	c.(1744-1746)cgT>cgC	p.R582R	RP11-261C10.4_ENST00000422938.1_RNA|CEP170_ENST00000366543.1_Silent_p.R484R|RP11-261C10.4_ENST00000437499.1_RNA|CEP170_ENST00000366544.1_Silent_p.R484R	NM_014812.2	NP_055627.2	Q5SW79	CE170_HUMAN	centrosomal protein 170kDa	582						centriole (GO:0005814)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|microtubule (GO:0005874)|nuclear membrane (GO:0031965)		p.R582R(3)		NS(1)|breast(2)|endometrium(18)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(12)|lung(14)|ovary(1)|prostate(2)|skin(3)|stomach(1)|urinary_tract(1)	62	all_neural(11;0.101)	all_cancers(173;0.003)	all cancers(7;5.81e-06)|GBM - Glioblastoma multiforme(7;0.000443)|OV - Ovarian serous cystadenocarcinoma(106;0.0101)			GTGAAACCCAACGTTTGCTTC	0.398																																					p.R582R		.											.	CEP170-93	3	Substitution - coding silent(3)	kidney(3)	c.T1746C						.						103.0	92.0	95.0					1																	243333027		1878	4106	5984	SO:0001819	synonymous_variant	9859	exon12			AACCCAACGTTTG	AB022657	CCDS44337.1, CCDS44338.1, CCDS44339.1	1q44	2014-02-20	2006-01-12	2006-01-12	ENSG00000143702	ENSG00000143702			28920	protein-coding gene	gene with protein product	"""KARP 1 binding protein"", ""XRCC5 binding protein"""	613023	"""KIAA0470"""	KIAA0470		15616186	Standard	NM_014812		Approved	KAB, FAM68A	uc021plo.1	Q5SW79	OTTHUMG00000039862	ENST00000366542.1:c.1746T>C	1.37:g.243333027A>G		Somatic	456	1		WXS	Illumina GAIIx	Phase_I	354	8	NM_014812	0	0	4	4	0	O75058|Q5SW77|Q5SW78|Q7LGA9|Q86W31|Q9UQ08|Q9UQ09	Silent	SNP	ENST00000366542.1	37	CCDS44339.1	.	.	.	.	.	.	.	.	.	.	A	9.754	1.168273	0.21621	.	.	ENSG00000143702	ENST00000336415	.	.	.	4.66	-6.75	0.01738	.	.	.	.	.	T	0.46833	0.1413	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.51576	-0.8688	4	.	.	.	-8.1159	6.5973	0.22681	0.3246:0.0:0.4436:0.2317	.	.	.	.	A	546	.	.	V	-	2	0	CEP170	241399650	0.846000	0.29590	0.974000	0.42286	0.957000	0.61999	-0.087000	0.11215	-0.781000	0.04548	-0.555000	0.04198	GTT	.		0.398	CEP170-003	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096178.2	NM_014812	
PGBD2	267002	broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	249211953	249211953	+	Silent	SNP	G	G	C			TCGA-OR-A5LO-01A-11D-A29I-10	TCGA-OR-A5LO-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	89d60dde-b03a-4cb7-b32a-5d06fa328603	4a5886aa-889d-4ef2-89a9-be2f7a06bd58	g.chr1:249211953G>C	ENST00000329291.5	+	3	1317	c.1170G>C	c.(1168-1170)ctG>ctC	p.L390L	PGBD2_ENST00000539153.1_Silent_p.L387L|PGBD2_ENST00000355360.4_Silent_p.L139L	NM_170725.2	NP_733843.1	Q6P3X8	PGBD2_HUMAN	piggyBac transposable element derived 2	390										NS(1)|endometrium(3)|lung(6)|ovary(1)|skin(3)	14	all_cancers(71;3.33e-06)|all_epithelial(71;2.41e-06)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.0458)|Lung NSC(105;0.0494)|Melanoma(84;0.199)	all_cancers(173;0.012)	OV - Ovarian serous cystadenocarcinoma(106;0.00989)			CCAAAGAACTGAAAAAAATGA	0.463																																					p.L390L		.											.	PGBD2-91	0			c.G1170C						.						59.0	64.0	62.0					1																	249211953		2203	4300	6503	SO:0001819	synonymous_variant	267002	exon3			AGAACTGAAAAAA	AF229602	CCDS31128.1, CCDS31129.1	1q	2008-02-05			ENSG00000185220	ENSG00000185220			19399	protein-coding gene	gene with protein product							Standard	XM_005270333		Approved		uc001ifh.3	Q6P3X8	OTTHUMG00000040424	ENST00000329291.5:c.1170G>C	1.37:g.249211953G>C		Somatic	127	1		WXS	Illumina GAIIx	Phase_I	93	36	NM_170725	0	0	0	2	2	B3KVR8|Q6MZF8	Silent	SNP	ENST00000329291.5	37	CCDS31128.1																																																																																			.		0.463	PGBD2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000097318.1		
FAM208B	54906	hgsc.bcm.edu	37	10	5773063	5773063	+	Silent	SNP	C	C	T			TCGA-OR-A5LO-01A-11D-A29I-10	TCGA-OR-A5LO-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	89d60dde-b03a-4cb7-b32a-5d06fa328603	4a5886aa-889d-4ef2-89a9-be2f7a06bd58	g.chr10:5773063C>T	ENST00000328090.5	+	11	1726	c.1101C>T	c.(1099-1101)tgC>tgT	p.C367C	RP11-336A10.2_ENST00000411512.2_RNA	NM_017782.4	NP_060252	Q5VWN6	F208B_HUMAN	family with sequence similarity 208, member B	367																	TGAACTTGTGCCGCCCCTTTC	0.468																																					p.C367C		.											.	.	0			c.C1101T						.						51.0	52.0	52.0					10																	5773063		2004	4152	6156	SO:0001819	synonymous_variant	54906	exon11			CTTGTGCCGCCCC	BX649177	CCDS41485.1	10p15.1	2011-09-14	2011-09-14	2011-09-14	ENSG00000108021	ENSG00000108021			23484	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 18"""	C10orf18		12477932	Standard	NM_017782		Approved	FLJ20360, bA318E3.2, KIAA2006	uc001iij.3	Q5VWN6	OTTHUMG00000017605	ENST00000328090.5:c.1101C>T	10.37:g.5773063C>T		Somatic	30	0		WXS	Illumina GAIIx	Phase_I	42	4	NM_017782	0	0	7	7	0	Q2YD91|Q5VWN5|Q6ZRQ8|Q8IVG4|Q9BUZ7|Q9H5J9|Q9H7A4|Q9H996|Q9NXA1	Silent	SNP	ENST00000328090.5	37	CCDS41485.1	.	.	.	.	.	.	.	.	.	.	C	4.275	0.050130	0.08243	.	.	ENSG00000108021	ENST00000380270	.	.	.	5.78	4.79	0.61399	.	.	.	.	.	T	0.63908	0.2551	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.62258	-0.6892	4	.	.	.	.	12.4442	0.55641	0.0:0.9156:0.0:0.0844	.	.	.	.	S	147	.	.	P	+	1	0	C10orf18	5813069	0.000000	0.05858	0.935000	0.37517	0.398000	0.30690	0.168000	0.16622	1.291000	0.44653	0.555000	0.69702	CCG	.		0.468	FAM208B-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046571.2	NM_017782	
TAF3	83860	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	8006163	8006163	+	Silent	SNP	A	A	G			TCGA-OR-A5LO-01A-11D-A29I-10	TCGA-OR-A5LO-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	89d60dde-b03a-4cb7-b32a-5d06fa328603	4a5886aa-889d-4ef2-89a9-be2f7a06bd58	g.chr10:8006163A>G	ENST00000344293.5	+	3	896	c.690A>G	c.(688-690)ccA>ccG	p.P230P		NM_031923.3	NP_114129.1	Q5VWG9	TAF3_HUMAN	TAF3 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 140kDa	230					maintenance of protein location in nucleus (GO:0051457)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|transcription factor TFIID complex (GO:0005669)	zinc ion binding (GO:0008270)			NS(2)|breast(4)|endometrium(2)|kidney(1)|large_intestine(6)|lung(16)|ovary(3)|prostate(4)|skin(2)	40						TGCTTTCTCCAGTCCATGTAC	0.468																																					p.P230P		.											.	TAF3-69	0			c.A690G						.						85.0	85.0	85.0					10																	8006163		1948	4143	6091	SO:0001819	synonymous_variant	83860	exon3			TTCTCCAGTCCAT	AJ292190	CCDS41487.1	10p15.1	2013-01-28	2002-08-29		ENSG00000165632	ENSG00000165632		"""Zinc fingers, PHD-type"""	17303	protein-coding gene	gene with protein product		606576	"""TAF3 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 140 kD"""			11438666, 18549481	Standard	NM_031923		Approved	TAF140, TAFII140	uc010qbd.3	Q5VWG9	OTTHUMG00000017643	ENST00000344293.5:c.690A>G	10.37:g.8006163A>G		Somatic	183	0		WXS	Illumina GAIIx	Phase_I	222	44	NM_031923	0	0	10	11	1	Q05DA0|Q6GMS5|Q6P6B5|Q86VY6|Q9BQS9|Q9UFI8	Silent	SNP	ENST00000344293.5	37	CCDS41487.1																																																																																			.		0.468	TAF3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046725.1	NM_031923	
ARHGAP21	57584	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	24909959	24909959	+	Missense_Mutation	SNP	T	T	C			TCGA-OR-A5LO-01A-11D-A29I-10	TCGA-OR-A5LO-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	89d60dde-b03a-4cb7-b32a-5d06fa328603	4a5886aa-889d-4ef2-89a9-be2f7a06bd58	g.chr10:24909959T>C	ENST00000396432.2	-	9	1351	c.865A>G	c.(865-867)Aac>Gac	p.N289D	ARHGAP21_ENST00000320481.6_Missense_Mutation_p.N76D	NM_020824.3	NP_065875.3	Q5T5U3	RHG21_HUMAN	Rho GTPase activating protein 21	288					establishment of Golgi localization (GO:0051683)|Golgi organization (GO:0007030)|maintenance of Golgi location (GO:0051684)|organelle transport along microtubule (GO:0072384)|signal transduction (GO:0007165)	cell junction (GO:0030054)|cytoplasmic vesicle (GO:0031410)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)	GTPase activator activity (GO:0005096)			NS(1)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(11)|kidney(4)|large_intestine(17)|lung(21)|ovary(7)|pancreas(1)|prostate(5)|skin(2)|stomach(2)|urinary_tract(1)	78						GTATGGTTGTTTCTATTGGAT	0.408																																					p.N289D		.											.	ARHGAP21-235	0			c.A865G						.						125.0	112.0	116.0					10																	24909959		2203	4300	6503	SO:0001583	missense	57584	exon9			GGTTGTTTCTATT	AF480466	CCDS7144.2	10p12.31	2013-01-10			ENSG00000107863	ENSG00000107863		"""Rho GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"""	23725	protein-coding gene	gene with protein product		609870				12056806	Standard	NM_020824		Approved	KIAA1424, ARHGAP10	uc001isb.2	Q5T5U3	OTTHUMG00000017825	ENST00000396432.2:c.865A>G	10.37:g.24909959T>C	ENSP00000379709:p.Asn289Asp	Somatic	285	0		WXS	Illumina GAIIx	Phase_I	429	93	NM_020824	0	0	2	3	1	Q0VF98|Q7Z3P7|Q8N3A2|Q8NI19|Q8TBV5|Q9P2C3	Missense_Mutation	SNP	ENST00000396432.2	37	CCDS7144.2	.	.	.	.	.	.	.	.	.	.	T	12.46	1.945911	0.34377	.	.	ENSG00000107863	ENST00000396432;ENST00000447364;ENST00000320481;ENST00000376410;ENST00000446003;ENST00000445703	T;T;T;T	0.45276	2.85;2.96;0.9;0.9	5.35	4.19	0.49359	.	0.548840	0.21758	N	0.069573	T	0.35566	0.0936	L	0.51422	1.61	0.25817	N	0.984328	B;B	0.30511	0.218;0.282	B;B	0.23574	0.047;0.021	T	0.22452	-1.0216	10	0.46703	T	0.11	.	11.5495	0.50713	0.0:0.0712:0.0:0.9288	.	279;288	F8W9U9;Q5T5U3	.;RHG21_HUMAN	D	289;278;76;279;289;124	ENSP00000379709:N289D;ENSP00000365604:N76D;ENSP00000365592:N279D;ENSP00000405018:N289D	ENSP00000365604:N76D	N	-	1	0	ARHGAP21	24949965	1.000000	0.71417	0.996000	0.52242	0.952000	0.60782	2.914000	0.48797	0.953000	0.37825	0.528000	0.53228	AAC	.		0.408	ARHGAP21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047229.4	NM_020824	
ZEB1	6935	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	31810238	31810238	+	Missense_Mutation	SNP	A	A	C			TCGA-OR-A5LO-01A-11D-A29I-10	TCGA-OR-A5LO-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	89d60dde-b03a-4cb7-b32a-5d06fa328603	4a5886aa-889d-4ef2-89a9-be2f7a06bd58	g.chr10:31810238A>C	ENST00000320985.10	+	7	2085	c.1975A>C	c.(1975-1977)Aat>Cat	p.N659H	ZEB1_ENST00000560721.2_Missense_Mutation_p.N639H|ZEB1_ENST00000559858.1_3'UTR|ZEB1_ENST00000361642.5_Missense_Mutation_p.N660H|ZEB1_ENST00000446923.2_Missense_Mutation_p.N643H|ZEB1_ENST00000542815.3_Missense_Mutation_p.N592H			P37275	ZEB1_HUMAN	zinc finger E-box binding homeobox 1	659					cartilage development (GO:0051216)|cell proliferation (GO:0008283)|cellular response to amino acid stimulus (GO:0071230)|cellular response to transforming growth factor beta stimulus (GO:0071560)|cochlea morphogenesis (GO:0090103)|embryonic camera-type eye morphogenesis (GO:0048596)|embryonic skeletal system morphogenesis (GO:0048704)|forebrain development (GO:0030900)|immune response (GO:0006955)|negative regulation of cell proliferation (GO:0008285)|negative regulation of epithelial cell differentiation (GO:0030857)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|pattern specification process (GO:0007389)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of mesenchymal cell proliferation (GO:0010464)|regulation of smooth muscle cell differentiation (GO:0051150)|regulation of T cell differentiation in thymus (GO:0033081)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transforming growth factor beta receptor signaling pathway (GO:0017015)|response to activity (GO:0014823)|response to nutrient levels (GO:0031667)|semicircular canal morphogenesis (GO:0048752)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|double-stranded DNA binding (GO:0003690)|E-box binding (GO:0070888)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)|zinc ion binding (GO:0008270)			NS(2)|breast(4)|central_nervous_system(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(14)|lung(38)|ovary(3)|skin(6)|upper_aerodigestive_tract(4)	77		Prostate(175;0.0156)				TGCCAAGAACAATGATCAGCC	0.428																																					p.N660H	Ovarian(40;423 959 14296 36701 49589)	.											.	ZEB1-518	0			c.A1978C						.						79.0	71.0	74.0					10																	31810238		2203	4300	6503	SO:0001583	missense	6935	exon7			AAGAACAATGATC	AK091478	CCDS7169.1, CCDS44370.1, CCDS53505.1, CCDS53506.1, CCDS53507.1	10p11.22	2014-02-14	2007-02-15	2007-02-15	ENSG00000148516	ENSG00000148516		"""Zinc fingers, C2H2-type"", ""Homeoboxes / ZF class"""	11642	protein-coding gene	gene with protein product		189909	"""transcription factor 8 (represses interleukin 2 expression)"", ""posterior polymorphous corneal dystrophy 3"""	TCF8, PPCD3		1427828, 1840704, 15384081, 16252232	Standard	NM_001128128		Approved	BZP, ZEB, AREB6, NIL-2-A, Zfhep, Zfhx1a, FECD6	uc001ivu.4	P37275	OTTHUMG00000017907	ENST00000320985.10:c.1975A>C	10.37:g.31810238A>C	ENSP00000319248:p.Asn659His	Somatic	87	0		WXS	Illumina GAIIx	Phase_I	145	45	NM_001174096	0	0	5	6	1	B4DJV0|B4DUW9|E9PCM7|F5H4I8|Q12924|Q13800|Q2KJ05|Q5T968|Q5VZ84|Q8NB68	Missense_Mutation	SNP	ENST00000320985.10	37	CCDS7169.1	.	.	.	.	.	.	.	.	.	.	A	4.648	0.120500	0.08881	.	.	ENSG00000148516	ENST00000542879;ENST00000537225;ENST00000361642;ENST00000546250;ENST00000542815;ENST00000320985;ENST00000437844;ENST00000541037;ENST00000543514;ENST00000446923	T;T;T;T;T	0.12569	2.99;2.68;2.72;2.67;2.72	5.34	-0.146	0.13432	.	1.262630	0.05488	N	0.556097	T	0.15955	0.0384	L	0.29908	0.895	0.09310	N	1	B;B;P;B;B;B;P;B	0.35600	0.419;0.249;0.511;0.328;0.291;0.294;0.511;0.328	P;B;B;B;B;B;B;B	0.46110	0.504;0.115;0.135;0.087;0.054;0.308;0.087;0.087	T	0.46512	-0.9186	10	0.19590	T	0.45	-0.0419	9.8506	0.41055	0.4674:0.0:0.5326:0.0	.	592;659;643;659;659;639;660;659	F5H4I8;F5H1R1;E9PCM7;B2RBI8;A0JLS9;Q5VZ84;Q2KJ05;P37275	.;.;.;.;.;.;.;ZEB1_HUMAN	H	441;659;660;659;592;659;639;518;550;643	ENSP00000444282:N441H;ENSP00000354487:N660H;ENSP00000444891:N592H;ENSP00000319248:N659H;ENSP00000391612:N643H	ENSP00000319248:N659H	N	+	1	0	ZEB1	31850244	0.000000	0.05858	0.001000	0.08648	0.746000	0.42486	-0.069000	0.11542	0.016000	0.14998	-0.242000	0.12053	AAT	.		0.428	ZEB1-018	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000419083.2	NM_030751	
WDFY4	57705	broad.mit.edu	37	10	50155016	50155016	+	Splice_Site	SNP	T	T	G			TCGA-OR-A5LO-01A-11D-A29I-10	TCGA-OR-A5LO-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	89d60dde-b03a-4cb7-b32a-5d06fa328603	4a5886aa-889d-4ef2-89a9-be2f7a06bd58	g.chr10:50155016T>G	ENST00000325239.5	+	50	8004		c.e50+2		WDFY4_ENST00000413659.2_Splice_Site|WDFY4_ENST00000465910.1_Splice_Site	NM_020945.1	NP_065996.1	Q6ZS81	WDFY4_HUMAN	WDFY family member 4							integral component of membrane (GO:0016021)				NS(2)|breast(5)|central_nervous_system(4)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|lung(3)|pancreas(2)|prostate(5)|skin(6)|stomach(1)	48						GCTCTGCAGGTGAGCTGCTGC	0.562																																					.		.											.	WDFY4-22	0			c.7977+2T>G						.						38.0	41.0	40.0					10																	50155016		692	1591	2283	SO:0001630	splice_region_variant	57705	exon51			TGCAGGTGAGCTG	AK074085	CCDS44385.1	10q11.23	2013-01-10			ENSG00000128815	ENSG00000128815		"""WD repeat domain containing"""	29323	protein-coding gene	gene with protein product		613316	"""chromosome 10 open reading frame 64"""	C10orf64		10997877	Standard	NM_020945		Approved	KIAA1607, Em:AC060234.3, FLJ45748	uc001jha.4	Q6ZS81	OTTHUMG00000018180	ENST00000325239.5:c.7977+2T>G	10.37:g.50155016T>G		Somatic	71	9		WXS	Illumina GAIIx	Phase_I	134	16	NM_020945	0	0	0	0	0	B9ZVP2|Q86WZ4|Q8N4A3|Q8TEN7|Q96BE1|Q9H7H8|Q9HCG5	Splice_Site	SNP	ENST00000325239.5	37	CCDS44385.1	.	.	.	.	.	.	.	.	.	.	.	20.5	4.005495	0.74932	.	.	ENSG00000128815	ENST00000426033;ENST00000325239;ENST00000312002;ENST00000265453;ENST00000544136	.	.	.	5.46	5.46	0.80206	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.5568	0.61763	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	+	.	.	WDFY4	49825022	1.000000	0.71417	0.996000	0.52242	0.818000	0.46254	5.887000	0.69751	2.196000	0.70406	0.482000	0.46254	.	.		0.562	WDFY4-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		XM_033379	Intron
C10orf95	79946	hgsc.bcm.edu	37	10	104210735	104210735	+	Missense_Mutation	SNP	C	C	A	rs2281878	byFrequency	TCGA-OR-A5LO-01A-11D-A29I-10	TCGA-OR-A5LO-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	89d60dde-b03a-4cb7-b32a-5d06fa328603	4a5886aa-889d-4ef2-89a9-be2f7a06bd58	g.chr10:104210735C>A	ENST00000239125.1	-	2	327	c.253G>T	c.(253-255)Gct>Tct	p.A85S	RP11-18I14.10_ENST00000596366.1_RNA|RP11-18I14.10_ENST00000494270.2_RNA|RP11-18I14.10_ENST00000594818.1_RNA|RP11-18I14.10_ENST00000473970.2_RNA|RP11-18I14.10_ENST00000492465.2_RNA|RP11-18I14.10_ENST00000596045.1_RNA	NM_024886.1	NP_079162.1	Q9H7T3	CJ095_HUMAN	chromosome 10 open reading frame 95	85	Arg/Pro-rich.									liver(1)	1		Colorectal(252;0.207)		Epithelial(162;8.34e-09)|all cancers(201;1.95e-07)|BRCA - Breast invasive adenocarcinoma(275;0.213)		GCTGCGGAAGCTGTGGGCCTG	0.766													C|||	1422	0.283946	0.2481	0.2147	5008	,	,		8527	0.3661		0.2107	False		,,,				2504	0.3722				p.A85S		.											.	C10orf95-91	0			c.G253T						.	C	SER/ALA	686,2688		69,548,1070	4.0	6.0	5.0		253	0.9	1.0	10	dbSNP_100	5	1301,5815		124,1053,2381	yes	missense	C10orf95	NM_024886.1	99	193,1601,3451	AA,AC,CC		18.2827,20.332,18.9418	possibly-damaging	85/258	104210735	1987,8503	1687	3558	5245	SO:0001583	missense	79946	exon2			CGGAAGCTGTGGG	AK024342	CCDS7534.1	10q24.32	2014-02-19	2014-02-19	2014-02-19	ENSG00000120055	ENSG00000120055			25880	protein-coding gene	gene with protein product							Standard	NM_024886		Approved	FLJ14280	uc001kvo.1	Q9H7T3	OTTHUMG00000018959	ENST00000239125.1:c.253G>T	10.37:g.104210735C>A	ENSP00000239125:p.Ala85Ser	Somatic	1	0		WXS	Illumina GAIIx	Phase_I	19	11	NM_024886	0	0	1	2	1	A0AVQ7	Missense_Mutation	SNP	ENST00000239125.1	37	CCDS7534.1	525	0.2403846153846154	101	0.20528455284552846	71	0.19613259668508287	200	0.34965034965034963	153	0.20184696569920843	C	12.47	1.948662	0.34377	0.20332	0.182827	ENSG00000120055	ENST00000239125	.	.	.	4.68	0.951	0.19579	.	0.773948	0.10608	N	0.654824	T	0.00012	0.0000	N	0.08118	0	0.53688	P	2.5000000000052758E-5	B	0.33807	0.426	B	0.32090	0.14	T	0.45891	-0.9230	8	0.33940	T	0.23	-38.6243	6.6233	0.22816	0.0:0.3488:0.0:0.6512	rs2281878	85	Q9H7T3	CJ095_HUMAN	S	85	.	ENSP00000239125:A85S	A	-	1	0	C10orf95	104200725	0.997000	0.39634	0.987000	0.45799	0.038000	0.13279	0.038000	0.13862	0.047000	0.15862	-0.350000	0.07774	GCT	C|0.759;A|0.241		0.766	C10orf95-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050065.1	NM_024886	
NEURL1	9148	broad.mit.edu;ucsc.edu;bcgsc.ca	37	10	105330702	105330702	+	Silent	SNP	G	G	T			TCGA-OR-A5LO-01A-11D-A29I-10	TCGA-OR-A5LO-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	89d60dde-b03a-4cb7-b32a-5d06fa328603	4a5886aa-889d-4ef2-89a9-be2f7a06bd58	g.chr10:105330702G>T	ENST00000369780.4	+	2	568	c.159G>T	c.(157-159)ctG>ctT	p.L53L	NEURL_ENST00000369777.2_Silent_p.L36L	NM_004210.4	NP_004201.3	O76050	NEUL1_HUMAN		53					brain development (GO:0007420)|cellular response to amino acid stimulus (GO:0071230)|lactation (GO:0007595)|negative regulation of cell proliferation (GO:0008285)|negative regulation of Notch signaling pathway (GO:0045746)|nervous system development (GO:0007399)|Notch signaling pathway (GO:0007219)|positive regulation of apoptotic process (GO:0043065)|positive regulation of dendritic spine development (GO:0060999)|positive regulation of epidermal growth factor-activated receptor activity (GO:0045741)|positive regulation of filopodium assembly (GO:0051491)|positive regulation of long-term neuronal synaptic plasticity (GO:0048170)|positive regulation of synapse maturation (GO:0090129)|protein monoubiquitination (GO:0006513)|skeletal muscle tissue development (GO:0007519)|sperm axoneme assembly (GO:0007288)|sperm motility (GO:0030317)	apical dendrite (GO:0097440)|cell junction (GO:0030054)|cytoplasm (GO:0005737)|dendritic spine (GO:0043197)|perikaryon (GO:0043204)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)	ligase activity (GO:0016874)|translation factor activity, non-nucleic acid binding (GO:0045183)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(1)|lung(4)|ovary(2)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	17				Epithelial(162;2.12e-09)|all cancers(201;6.99e-08)|BRCA - Breast invasive adenocarcinoma(275;0.125)		CGGCAGTGCTGCCCAGCGGGG	0.647																																					p.L53L		.											.	NEURL-226	0			c.G159T						.						79.0	93.0	88.0					10																	105330702		2203	4300	6503	SO:0001819	synonymous_variant	9148	exon2			AGTGCTGCCCAGC																												ENST00000369780.4:c.159G>T	10.37:g.105330702G>T		Somatic	221	1		WXS	Illumina GAIIx	Phase_I	210	55	NM_004210	0	0	2	2	0	Q5TDR2|Q5TDR3|Q8TAN0|Q9H463	Silent	SNP	ENST00000369780.4	37	CCDS7551.1																																																																																			.		0.647	NEURL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050170.1		
ADRB1	153	hgsc.bcm.edu	37	10	115804008	115804008	+	Silent	SNP	C	C	T	rs371084372	byFrequency	TCGA-OR-A5LO-01A-11D-A29I-10	TCGA-OR-A5LO-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	89d60dde-b03a-4cb7-b32a-5d06fa328603	4a5886aa-889d-4ef2-89a9-be2f7a06bd58	g.chr10:115804008C>T	ENST00000369295.2	+	1	203	c.117C>T	c.(115-117)ccC>ccT	p.P39P		NM_000684.2	NP_000675.1	P08588	ADRB1_HUMAN	adrenoceptor beta 1	39					activation of adenylate cyclase activity (GO:0007190)|adenylate cyclase-activating adrenergic receptor signaling pathway (GO:0071880)|aging (GO:0007568)|apoptotic process (GO:0006915)|brown fat cell differentiation (GO:0050873)|diet induced thermogenesis (GO:0002024)|fear response (GO:0042596)|glycogen catabolic process (GO:0005980)|heat generation (GO:0031649)|lipid homeostasis (GO:0055088)|memory (GO:0007613)|negative regulation of multicellular organism growth (GO:0040015)|negative regulation of smooth muscle contraction (GO:0045986)|negative regulation of urine volume (GO:0035811)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cAMP biosynthetic process (GO:0030819)|positive regulation of cAMP-mediated signaling (GO:0043950)|positive regulation of cation channel activity (GO:2001259)|positive regulation of cell growth involved in cardiac muscle cell development (GO:0061051)|positive regulation of heart rate by epinephrine-norepinephrine (GO:0001996)|positive regulation of Ras GTPase activity (GO:0032320)|positive regulation of renin secretion into blood stream (GO:1900135)|positive regulation of saliva secretion (GO:0046878)|positive regulation of systemic arterial blood pressure (GO:0003084)|positive regulation of the force of heart contraction by norepinephrine (GO:0003061)|protein localization to organelle (GO:0033365)|regulation of calcium ion transport (GO:0051924)|regulation of cardiac muscle cell contraction (GO:0086004)|regulation of inhibitory postsynaptic membrane potential (GO:0060080)|response to cold (GO:0009409)|Rho protein signal transduction (GO:0007266)|sensory perception of pain (GO:0019233)|vasodilation by norepinephrine-epinephrine involved in regulation of systemic arterial blood pressure (GO:0002025)|wound healing (GO:0042060)	early endosome (GO:0005769)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	alpha-2A adrenergic receptor binding (GO:0031694)|beta-adrenergic receptor activity (GO:0004939)|beta1-adrenergic receptor activity (GO:0004940)|dopamine binding (GO:0035240)|drug binding (GO:0008144)|epinephrine binding (GO:0051379)|norepinephrine binding (GO:0051380)|PDZ domain binding (GO:0030165)|protein heterodimerization activity (GO:0046982)|Ras guanyl-nucleotide exchange factor activity (GO:0005088)|receptor signaling protein activity (GO:0005057)			large_intestine(4)|lung(1)|upper_aerodigestive_tract(1)	6		Colorectal(252;0.172)|Breast(234;0.188)		Epithelial(162;0.0124)|all cancers(201;0.0298)	Acebutolol(DB01193)|Alprenolol(DB00866)|Amiodarone(DB01118)|Amitriptyline(DB00321)|Amphetamine(DB00182)|Arbutamine(DB01102)|Asenapine(DB06216)|Atenolol(DB00335)|Betaxolol(DB00195)|Bethanidine(DB00217)|Bevantolol(DB01295)|Bisoprolol(DB00612)|Bopindolol(DB08807)|Bupranolol(DB08808)|Cabergoline(DB00248)|Carteolol(DB00521)|Carvedilol(DB01136)|Clenbuterol(DB01407)|Desipramine(DB01151)|Dobutamine(DB00841)|Dronedarone(DB04855)|Droxidopa(DB06262)|Ephedra(DB01363)|Epinephrine(DB00668)|Esmolol(DB00187)|Fenoterol(DB01288)|Isoetarine(DB00221)|Isoprenaline(DB01064)|Labetalol(DB00598)|Levobunolol(DB01210)|Loxapine(DB00408)|Mephentermine(DB01365)|Metipranolol(DB01214)|Metoprolol(DB00264)|Mirtazapine(DB00370)|Nadolol(DB01203)|Nebivolol(DB04861)|Norepinephrine(DB00368)|Nortriptyline(DB00540)|Olanzapine(DB00334)|Oxprenolol(DB01580)|Penbutolol(DB01359)|Phenylpropanolamine(DB00397)|Pindolol(DB00960)|Pirbuterol(DB01291)|Practolol(DB01297)|Propranolol(DB00571)|Pseudoephedrine(DB00852)|Salbutamol(DB01001)|Sotalol(DB00489)|Timolol(DB00373)|Trimipramine(DB00726)	CGTCGCCGCCCGCCTCGTTGC	0.741													C|||	2	0.000399361	0.0	0.0029	5008	,	,		8204	0.0		0.0	False		,,,				2504	0.0				p.P39P		.											.	ADRB1-658	0			c.C117T						.	C		0,3832		0,0,1916	4.0	4.0	4.0		117	4.4	0.2	10		4	12,7610		0,12,3799	no	coding-synonymous	ADRB1	NM_000684.2		0,12,5715	TT,TC,CC		0.1574,0.0,0.1048		39/478	115804008	12,11442	1916	3811	5727	SO:0001819	synonymous_variant	153	exon1			GCCGCCCGCCTCG	J03019	CCDS7586.1	10q25.3	2012-08-08	2012-05-09		ENSG00000043591	ENSG00000043591		"""GPCR / Class A : Adrenoceptors : beta"""	285	protein-coding gene	gene with protein product		109630	"""adrenergic, beta-1-, receptor"""	ADRB1R			Standard	NM_000684		Approved		uc001lba.3	P08588	OTTHUMG00000019079	ENST00000369295.2:c.117C>T	10.37:g.115804008C>T		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	10	8	NM_000684	0	0	0	0	0	B0LPE2|Q5T5Y4|Q9UKG7|Q9UKG8	Silent	SNP	ENST00000369295.2	37	CCDS7586.1																																																																																			.		0.741	ADRB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050448.1		
PNLIP	5406	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	118307963	118307963	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5LO-01A-11D-A29I-10	TCGA-OR-A5LO-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	89d60dde-b03a-4cb7-b32a-5d06fa328603	4a5886aa-889d-4ef2-89a9-be2f7a06bd58	g.chr10:118307963G>A	ENST00000369221.2	+	4	321	c.293G>A	c.(292-294)gGa>gAa	p.G98E	PNLIP_ENST00000470562.1_3'UTR	NM_000936.2	NP_000927.1	P16233	LIPP_HUMAN	pancreatic lipase	98					intestinal cholesterol absorption (GO:0030299)|lipid catabolic process (GO:0016042)|lipid digestion (GO:0044241)|phototransduction, visible light (GO:0007603)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)	extracellular region (GO:0005576)	metal ion binding (GO:0046872)|triglyceride lipase activity (GO:0004806)			central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(6)|liver(2)|lung(22)|ovary(2)|skin(4)|upper_aerodigestive_tract(1)	43				all cancers(201;0.0131)	Glycerol Phenylbutyrate(DB08909)|Orlistat(DB01083)	ATAGACAAGGGAGAAGAAAAC	0.413																																					p.G98E		.											.	PNLIP-92	0			c.G293A						.						130.0	126.0	127.0					10																	118307963		2203	4300	6503	SO:0001583	missense	5406	exon4			ACAAGGGAGAAGA	BC014309	CCDS7594.1	10q25.3	2012-07-31			ENSG00000175535	ENSG00000175535	3.1.1.3		9155	protein-coding gene	gene with protein product		246600				1783385	Standard	NM_000936		Approved	PL	uc001lcm.3	P16233	OTTHUMG00000019103	ENST00000369221.2:c.293G>A	10.37:g.118307963G>A	ENSP00000358223:p.Gly98Glu	Somatic	117	0		WXS	Illumina GAIIx	Phase_I	131	31	NM_000936	0	0	0	0	0	Q5VSQ2	Missense_Mutation	SNP	ENST00000369221.2	37	CCDS7594.1	.	.	.	.	.	.	.	.	.	.	G	19.98	3.926702	0.73327	.	.	ENSG00000175535	ENST00000369221	D	0.91068	-2.78	5.39	5.39	0.77823	Lipase, N-terminal (1);	0.000000	0.64402	D	0.000001	D	0.93923	0.8055	M	0.81112	2.525	0.58432	D	0.999997	D	0.65815	0.995	P	0.59221	0.854	D	0.93964	0.7243	10	0.72032	D	0.01	.	12.063	0.53572	0.0818:0.0:0.9182:0.0	.	98	P16233	LIPP_HUMAN	E	98	ENSP00000358223:G98E	ENSP00000358223:G98E	G	+	2	0	PNLIP	118297953	1.000000	0.71417	1.000000	0.80357	0.939000	0.58152	3.537000	0.53590	2.814000	0.96858	0.585000	0.79938	GGA	.		0.413	PNLIP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050524.1	NM_000936	
BTBD16	118663	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	124089066	124089066	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5LO-01A-11D-A29I-10	TCGA-OR-A5LO-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	89d60dde-b03a-4cb7-b32a-5d06fa328603	4a5886aa-889d-4ef2-89a9-be2f7a06bd58	g.chr10:124089066G>A	ENST00000260723.4	+	11	1234	c.983G>A	c.(982-984)cGt>cAt	p.R328H	BTBD16_ENST00000368994.2_Missense_Mutation_p.R329H	NM_144587.2	NP_653188.2	Q32M84	BTBDG_HUMAN	BTB (POZ) domain containing 16	328										breast(1)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(5)|lung(3)|skin(2)|stomach(1)|urinary_tract(1)	15		all_neural(114;0.107)|Lung NSC(174;0.175)|all_lung(145;0.222)|Breast(234;0.238)				CTCTGCTTGCGTCTGCACGGC	0.602																																					p.R328H		.											.	BTBD16-91	0			c.G983A						.						125.0	109.0	115.0					10																	124089066		2203	4300	6503	SO:0001583	missense	118663	exon11			GCTTGCGTCTGCA	AK058088	CCDS31301.1	10q26.13	2013-01-24	2006-07-04	2006-07-04	ENSG00000138152	ENSG00000138152		"""BTB/POZ domain containing"""	26340	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 87"""	C10orf87			Standard	NM_144587		Approved	FLJ25359, Em:AC061711.1	uc001lgc.1	Q32M84	OTTHUMG00000019182	ENST00000260723.4:c.983G>A	10.37:g.124089066G>A	ENSP00000260723:p.Arg328His	Somatic	58	0		WXS	Illumina GAIIx	Phase_I	71	28	NM_144587	0	0	1	1	0	A6NM63|Q4VXL1|Q96LN0	Missense_Mutation	SNP	ENST00000260723.4	37	CCDS31301.1	.	.	.	.	.	.	.	.	.	.	G	14.62	2.590001	0.46214	.	.	ENSG00000138152	ENST00000260723;ENST00000368994	T;T	0.53206	0.63;0.64	5.77	4.83	0.62350	.	0.085303	0.46442	N	0.000295	T	0.64227	0.2579	M	0.67953	2.075	0.46113	D	0.998875	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	T	0.66783	-0.5836	10	0.87932	D	0	-8.884	9.8685	0.41160	0.1:0.0:0.9:0.0	.	329;328	Q32M84-2;Q32M84	.;BTBDG_HUMAN	H	328;329	ENSP00000260723:R328H;ENSP00000357990:R329H	ENSP00000260723:R328H	R	+	2	0	BTBD16	124079056	1.000000	0.71417	0.617000	0.29091	0.002000	0.02628	3.350000	0.52224	1.347000	0.45714	-0.345000	0.07892	CGT	.		0.602	BTBD16-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000050780.3	NM_144587	
EBF3	253738	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	131639127	131639127	+	Silent	SNP	G	G	A	rs369433267		TCGA-OR-A5LO-01A-11D-A29I-10	TCGA-OR-A5LO-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	89d60dde-b03a-4cb7-b32a-5d06fa328603	4a5886aa-889d-4ef2-89a9-be2f7a06bd58	g.chr10:131639127G>A	ENST00000355311.5	-	14	1614	c.1542C>T	c.(1540-1542)tcC>tcT	p.S514S	MIR4297_ENST00000579857.1_RNA|EBF3_ENST00000368648.3_Silent_p.S505S			Q9H4W6	COE3_HUMAN	early B-cell factor 3	514	Pro/Ser/Thr-rich.				multicellular organismal development (GO:0007275)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(8)|lung(23)|ovary(1)|pancreas(1)|prostate(1)|skin(1)	44		all_cancers(35;1.8e-08)|all_epithelial(44;8.26e-08)|Lung NSC(174;0.0091)|all_lung(145;0.0123)|Breast(234;0.039)|all_neural(114;0.0722)|Colorectal(57;0.0764)		OV - Ovarian serous cystadenocarcinoma(35;0.00513)		GAGAGTTAGCGGAGGAGCCAT	0.502																																					p.S505S		.											.	EBF3-91	0			c.C1515T						.	G		1,4405	2.1+/-5.4	0,1,2202	104.0	103.0	104.0		1515	2.9	1.0	10		104	0,8600		0,0,4300	no	coding-synonymous	EBF3	NM_001005463.2		0,1,6502	AA,AG,GG		0.0,0.0227,0.0077		505/552	131639127	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	253738	exon14			GTTAGCGGAGGAG		CCDS31314.1	10q26.3	2007-03-30			ENSG00000108001	ENSG00000108001			19087	protein-coding gene	gene with protein product		607407				12355068	Standard	NM_001005463		Approved	COE3, DKFZp667B0210	uc001lki.2	Q9H4W6	OTTHUMG00000019265	ENST00000355311.5:c.1542C>T	10.37:g.131639127G>A		Somatic	89	0		WXS	Illumina GAIIx	Phase_I	64	15	NM_001005463	0	0	0	0	0	A0AUY1|Q5T6H9|Q9H4W5	Silent	SNP	ENST00000355311.5	37		.	.	.	.	.	.	.	.	.	.	G	7.774	0.708137	0.15239	2.27E-4	0.0	ENSG00000108001	ENST00000440978	.	.	.	4.89	2.88	0.33553	.	.	.	.	.	T	0.45196	0.1330	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.37407	-0.9707	4	.	.	.	-19.6946	2.8604	0.05585	0.0978:0.1284:0.507:0.2668	.	.	.	.	C	76	.	.	R	-	1	0	EBF3	131529117	1.000000	0.71417	1.000000	0.80357	1.000000	0.99986	1.026000	0.30103	1.276000	0.44395	0.655000	0.94253	CGC	.		0.502	EBF3-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000051015.2	NM_001005463	
MUC2	4583	bcgsc.ca	37	11	1092973	1092973	+	Missense_Mutation	SNP	C	C	T	rs55847666		TCGA-OR-A5LO-01A-11D-A29I-10	TCGA-OR-A5LO-10A-01D-A29L-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	89d60dde-b03a-4cb7-b32a-5d06fa328603	4a5886aa-889d-4ef2-89a9-be2f7a06bd58	g.chr11:1092973C>T	ENST00000441003.2	+	30	4819	c.4792C>T	c.(4792-4794)Ccc>Tcc	p.P1598S	MUC2_ENST00000359061.5_Intron|MUC2_ENST00000333592.6_5'Flank|MUC2_ENST00000361558.6_Intron	NM_002457.2	NP_002448.2	Q02817	MUC2_HUMAN	mucin 2, oligomeric mucus/gel-forming	0	Approximate repeats.				cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi lumen (GO:0005796)|inner mucus layer (GO:0070702)|outer mucus layer (GO:0070703)		p.P1598S(1)		NS(3)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(26)|haematopoietic_and_lymphoid_tissue(4)|kidney(11)|large_intestine(5)|lung(22)|ovary(2)|prostate(16)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	102		all_cancers(49;1.08e-07)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.191)		BRCA - Breast invasive adenocarcinoma(625;0.000207)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)	Pranlukast(DB01411)	aaccccaacacccaccggcac	0.637																																					p.P1598S		.											.	MUC2-90	1	Substitution - Missense(1)	endometrium(1)	c.C4792T						.						47.0	83.0	70.0					11																	1092973		1782	3238	5020	SO:0001583	missense	4583	exon30			CCAACACCCACCG	L21998		11p15.5	2011-01-28	2006-03-14		ENSG00000198788	ENSG00000198788		"""Mucins"""	7512	protein-coding gene	gene with protein product		158370	"""mucin 2, intestinal/tracheal"""			15081123	Standard	NM_002457		Approved		uc001lsx.1	Q02817	OTTHUMG00000156800	ENST00000441003.2:c.4792C>T	11.37:g.1092973C>T	ENSP00000415183:p.Pro1598Ser	Somatic	143	0		WXS	Illumina GAIIx	Phase_I	77	6	NM_002457	0	0	0	0	0	Q14878	Missense_Mutation	SNP	ENST00000441003.2	37		.	.	.	.	.	.	.	.	.	.	C	3.622	-0.077443	0.07184	.	.	ENSG00000198788	ENST00000441003	T	0.13778	2.56	1.75	-2.88	0.05682	.	.	.	.	.	T	0.04363	0.0120	.	.	.	0.09310	N	1	B	0.06786	0.001	B	0.01281	0.0	T	0.43686	-0.9376	8	0.07482	T	0.82	.	3.4241	0.07403	0.4105:0.429:0.0:0.1605	rs55847666	1598	E7EUV1	.	S	1598	ENSP00000415183:P1598S	ENSP00000415183:P1598S	P	+	1	0	MUC2	1082973	0.007000	0.16637	0.000000	0.03702	0.120000	0.20174	0.230000	0.17852	-0.314000	0.08716	0.121000	0.15741	CCC	.		0.637	MUC2-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000345894.2	NM_002457	
MUC5B	727897	ucsc.edu	37	11	1253969	1253969	+	Silent	SNP	A	A	G	rs72846370		TCGA-OR-A5LO-01A-11D-A29I-10	TCGA-OR-A5LO-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	89d60dde-b03a-4cb7-b32a-5d06fa328603	4a5886aa-889d-4ef2-89a9-be2f7a06bd58	g.chr11:1253969A>G	ENST00000529681.1	+	17	2092	c.2034A>G	c.(2032-2034)gtA>gtG	p.V678V	MUC5B_ENST00000447027.1_Silent_p.V681V	NM_002458.2	NP_002449.2	Q9HC84	MUC5B_HUMAN	mucin 5B, oligomeric mucus/gel-forming	678					cellular protein metabolic process (GO:0044267)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to glucocorticoid stimulus (GO:0071385)|cellular response to retinoic acid (GO:0071300)|epithelial cell differentiation (GO:0030855)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|response to lipopolysaccharide (GO:0032496)|response to ozone (GO:0010193)|response to sulfur dioxide (GO:0010477)|response to vitamin A (GO:0033189)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)				cervix(2)|endometrium(36)|kidney(9)|lung(89)|urinary_tract(1)	137		all_cancers(49;6.97e-08)|all_epithelial(84;3.45e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00141)|Lung(200;0.0853)|LUSC - Lung squamous cell carcinoma(625;0.1)		CCAAGGGCGTACAGCTCAGCG	0.682																																					p.V678V		.											.	.	0			c.A2034G						.						23.0	26.0	25.0					11																	1253969		2131	4242	6373	SO:0001819	synonymous_variant	727897	exon17			GGGCGTACAGCTC	U95031, AF086604	CCDS44515.1, CCDS44515.2	11p15.5	2007-01-19	2006-03-14			ENSG00000117983		"""Mucins"""	7516	protein-coding gene	gene with protein product		600770	"""mucin 5, subtype B, tracheobronchial"""	MUC5		9804771	Standard	NM_002458		Approved	MG1	uc001lta.3	Q9HC84		ENST00000529681.1:c.2034A>G	11.37:g.1253969A>G		Somatic	37	2		WXS	Illumina GAIIx	Phase_I	93	14	NM_002458	0	0	0	0	0	O00447|O00573|O14985|O15494|O95291|O95451|Q14881|Q7M4S5|Q99552|Q9UE28	Silent	SNP	ENST00000529681.1	37	CCDS44515.2																																																																																			.		0.682	MUC5B-002	NOVEL	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000390041.2	XM_001126093	
MUC5B	727897	bcgsc.ca	37	11	1253980	1253980	+	Missense_Mutation	SNP	A	A	G	rs202127660		TCGA-OR-A5LO-01A-11D-A29I-10	TCGA-OR-A5LO-10A-01D-A29L-10	A	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	89d60dde-b03a-4cb7-b32a-5d06fa328603	4a5886aa-889d-4ef2-89a9-be2f7a06bd58	g.chr11:1253980A>G	ENST00000529681.1	+	17	2103	c.2045A>G	c.(2044-2046)gAc>gGc	p.D682G	MUC5B_ENST00000447027.1_Missense_Mutation_p.D685G	NM_002458.2	NP_002449.2	Q9HC84	MUC5B_HUMAN	mucin 5B, oligomeric mucus/gel-forming	682					cellular protein metabolic process (GO:0044267)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to glucocorticoid stimulus (GO:0071385)|cellular response to retinoic acid (GO:0071300)|epithelial cell differentiation (GO:0030855)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|response to lipopolysaccharide (GO:0032496)|response to ozone (GO:0010193)|response to sulfur dioxide (GO:0010477)|response to vitamin A (GO:0033189)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)				cervix(2)|endometrium(36)|kidney(9)|lung(89)|urinary_tract(1)	137		all_cancers(49;6.97e-08)|all_epithelial(84;3.45e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00141)|Lung(200;0.0853)|LUSC - Lung squamous cell carcinoma(625;0.1)		CAGCTCAGCGACTGGAGGGAC	0.682																																					p.D682G		.											.	.	0			c.A2045G						.						21.0	24.0	23.0					11																	1253980		2116	4228	6344	SO:0001583	missense	727897	exon17			TCAGCGACTGGAG	U95031, AF086604	CCDS44515.1, CCDS44515.2	11p15.5	2007-01-19	2006-03-14			ENSG00000117983		"""Mucins"""	7516	protein-coding gene	gene with protein product		600770	"""mucin 5, subtype B, tracheobronchial"""	MUC5		9804771	Standard	NM_002458		Approved	MG1	uc001lta.3	Q9HC84		ENST00000529681.1:c.2045A>G	11.37:g.1253980A>G	ENSP00000436812:p.Asp682Gly	Somatic	30	1		WXS	Illumina GAIIx	Phase_I	80	11	NM_002458	0	0	0	0	0	O00447|O00573|O14985|O15494|O95291|O95451|Q14881|Q7M4S5|Q99552|Q9UE28	Missense_Mutation	SNP	ENST00000529681.1	37	CCDS44515.2	.	.	.	.	.	.	.	.	.	.	A	7.541	0.660740	0.14645	.	.	ENSG00000117983	ENST00000529681;ENST00000447027;ENST00000349637;ENST00000406844	T;T	0.76060	-0.99;-0.99	4.6	2.72	0.32119	Uncharacterised domain, cysteine-rich (2);	.	.	.	.	T	0.50103	0.1596	N	0.02960	-0.455	0.24874	N	0.992269	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.01281	0.0;0.0;0.0	T	0.45920	-0.9228	9	0.87932	D	0	.	8.6635	0.34108	0.2416:0.0:0.7584:0.0	.	682;1341;685	Q9HC84;A7Y9J9;E9PBJ0	MUC5B_HUMAN;.;.	G	682;685;683;718	ENSP00000436812:D682G;ENSP00000415793:D685G	ENSP00000343037:D683G	D	+	2	0	MUC5B	1210556	0.999000	0.42202	0.632000	0.29296	0.070000	0.16714	2.607000	0.46300	0.373000	0.24621	-1.983000	0.00453	GAC	.		0.682	MUC5B-002	NOVEL	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000390041.2	XM_001126093	
SYT8	90019	hgsc.bcm.edu	37	11	1858572	1858572	+	Missense_Mutation	SNP	C	C	T	rs2292474	byFrequency	TCGA-OR-A5LO-01A-11D-A29I-10	TCGA-OR-A5LO-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	89d60dde-b03a-4cb7-b32a-5d06fa328603	4a5886aa-889d-4ef2-89a9-be2f7a06bd58	g.chr11:1858572C>T	ENST00000381968.3	+	9	1245	c.1117C>T	c.(1117-1119)Cgg>Tgg	p.R373W	TNNI2_ENST00000381911.1_5'Flank|TNNI2_ENST00000252898.7_5'Flank|TNNI2_ENST00000381905.3_5'Flank|SYT8_ENST00000341958.3_Missense_Mutation_p.R359W|TNNI2_ENST00000381906.1_5'Flank|SYT8_ENST00000535046.1_3'UTR	NM_138567.3	NP_612634	Q8NBV8	SYT8_HUMAN	synaptotagmin VIII	373					acrosome reaction (GO:0007340)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|synaptic vesicle (GO:0008021)	transporter activity (GO:0005215)			breast(1)|large_intestine(1)|lung(2)|ovary(1)|skin(1)	6		all_epithelial(84;0.000138)|Breast(177;0.000962)|Ovarian(85;0.0014)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00136)|Lung(200;0.0681)|LUSC - Lung squamous cell carcinoma(625;0.082)		CATTGCCCAGCGGCACCCCCT	0.731													T|||	1928	0.384984	0.1679	0.415	5008	,	,		13483	0.378		0.498	False		,,,				2504	0.5481				p.R373W		.											.	SYT8-91	0			c.C1117T						.	T	TRP/ARG	906,3442		119,668,1387	12.0	14.0	14.0		1117	2.7	1.0	11	dbSNP_100	14	4072,4398		1026,2020,1189	no	missense	SYT8	NM_138567.3	101	1145,2688,2576	TT,TC,CC		48.0756,20.8372,38.836	benign	373/402	1858572	4978,7840	2174	4235	6409	SO:0001583	missense	90019	exon9			GCCCAGCGGCACC	AL137708	CCDS7726.2	11p15.5	2013-01-21			ENSG00000149043	ENSG00000149043		"""Synaptotagmins"""	19264	protein-coding gene	gene with protein product		607719				7791877	Standard	XM_005253216		Approved	DKFZp434K0322	uc001lue.1	Q8NBV8	OTTHUMG00000009026	ENST00000381968.3:c.1117C>T	11.37:g.1858572C>T	ENSP00000371394:p.Arg373Trp	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	15	15	NM_138567	0	0	0	1	1	A6NFJ4|Q9NSV9	Missense_Mutation	SNP	ENST00000381968.3	37	CCDS7726.2	855|855	0.3914835164835165|0.3914835164835165	84|84	0.17073170731707318|0.17073170731707318	163|163	0.45027624309392267|0.45027624309392267	226|226	0.3951048951048951|0.3951048951048951	382|382	0.503957783641161|0.503957783641161	t|t	1.107|1.107	-0.659353|-0.659353	0.03454|0.03454	0.208372|0.208372	0.480756|0.480756	ENSG00000149043|ENSG00000149043	ENST00000381978|ENST00000381968;ENST00000341958	.|T;T	.|0.03951	.|3.77;3.75	3.85|3.85	2.68|2.68	0.31781|0.31781	.|.	.|.	.|.	.|.	.|.	T|T	0.00012|0.00012	0.0000|0.0000	N|N	0.00005|0.00005	-3.275|-3.275	0.09310|0.09310	P|P	1.0|1.0	.|B;B	.|0.02656	.|0.0;0.0	.|B;B	.|0.01281	.|0.0;0.0	T|T	0.41928|0.41928	-0.9481|-0.9481	4|8	.|0.02654	.|T	.|1	.|.	8.5203|8.5203	0.33270|0.33270	0.0:0.1655:0.0:0.8345|0.0:0.1655:0.0:0.8345	rs2292474|rs2292474	.|373;359	.|Q8NBV8;A6NCR4	.|SYT8_HUMAN;.	V|W	371|373;359	.|ENSP00000371394:R373W;ENSP00000343691:R359W	.|ENSP00000343691:R359W	A|R	+|+	2|1	0|2	SYT8|SYT8	1815148|1815148	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.293000|0.293000	0.27360|0.27360	3.304000|3.304000	0.51866|0.51866	0.174000|0.174000	0.19809|0.19809	-0.665000|-0.665000	0.03846|0.03846	GCG|CGG	C|0.602;T|0.398		0.731	SYT8-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000025013.4		
WT1	7490	hgsc.bcm.edu	37	11	32456694	32456694	+	Silent	SNP	C	C	A	rs2234582	byFrequency	TCGA-OR-A5LO-01A-11D-A29I-10	TCGA-OR-A5LO-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	89d60dde-b03a-4cb7-b32a-5d06fa328603	4a5886aa-889d-4ef2-89a9-be2f7a06bd58	g.chr11:32456694C>A	ENST00000332351.3	-	1	482	c.198G>T	c.(196-198)ccG>ccT	p.P66P	WT1_ENST00000448076.3_Silent_p.P66P|WT1-AS_ENST00000494911.1_RNA|WT1-AS_ENST00000478367.1_RNA|WT1-AS_ENST00000525436.1_RNA|WT1-AS_ENST00000459866.1_RNA|WT1-AS_ENST00000426618.2_RNA|WT1-AS_ENST00000395900.1_RNA	NM_024424.3|NM_024426.4	NP_077742.2|NP_077744	P19544	WT1_HUMAN	Wilms tumor 1	0	Pro-rich.				adrenal cortex formation (GO:0035802)|adrenal gland development (GO:0030325)|branching involved in ureteric bud morphogenesis (GO:0001658)|camera-type eye development (GO:0043010)|cardiac muscle cell fate commitment (GO:0060923)|cellular response to cAMP (GO:0071320)|cellular response to gonadotropin stimulus (GO:0071371)|diaphragm development (GO:0060539)|epithelial cell differentiation (GO:0030855)|germ cell development (GO:0007281)|glomerular basement membrane development (GO:0032836)|glomerular visceral epithelial cell differentiation (GO:0072112)|glomerulus development (GO:0032835)|gonad development (GO:0008406)|heart development (GO:0007507)|kidney development (GO:0001822)|male genitalia development (GO:0030539)|male gonad development (GO:0008584)|mesenchymal to epithelial transition (GO:0060231)|metanephric epithelium development (GO:0072207)|metanephric mesenchyme development (GO:0072075)|metanephric S-shaped body morphogenesis (GO:0072284)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of female gonad development (GO:2000195)|negative regulation of metanephric glomerular mesangial cell proliferation (GO:0072302)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of translation (GO:0017148)|positive regulation of apoptotic process (GO:0043065)|positive regulation of heart growth (GO:0060421)|positive regulation of male gonad development (GO:2000020)|positive regulation of metanephric ureteric bud development (GO:2001076)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|posterior mesonephric tubule development (GO:0072166)|regulation of organ formation (GO:0003156)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)|RNA splicing (GO:0008380)|sex determination (GO:0007530)|thorax and anterior abdomen determination (GO:0007356)|tissue development (GO:0009888)|ureteric bud development (GO:0001657)|vasculogenesis (GO:0001570)|visceral serous pericardium development (GO:0061032)	cytoplasm (GO:0005737)|nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	C2H2 zinc finger domain binding (GO:0070742)|RNA binding (GO:0003723)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)		EWSR1/WT1(234)	NS(1)|haematopoietic_and_lymphoid_tissue(348)|kidney(149)|large_intestine(9)|lung(20)|peritoneum(1)|pleura(2)|skin(2)|upper_aerodigestive_tract(1)	533	Breast(20;0.247)		OV - Ovarian serous cystadenocarcinoma(30;0.128)			CCATTTGCTGCGGCTCAGACC	0.761			"""D, Mis, N, F, S"""	EWSR1	"""Wilms, desmoplastic small round cell tumor"""	Wilms			Wilms' tumor-Aniridia-ambiguous Genitals-mental Retardation;Frasier syndrome;Familial Wilms' tumor;Denys-Drash syndrome				C|||	1511	0.301717	0.6604	0.1556	5008	,	,		5831	0.0675		0.1839	False		,,,				2504	0.2832				p.P66P		.	yes	Rec	yes	"""Denys-Drash syndrome, Frasier syndrome, Familial Wilms tumor"""	11	11p13	7490	Wilms tumour 1 gene		O	.	WT1-6891	0			c.G198T						.	C	,,	1567,1733		420,727,503	2.0	3.0	3.0		198,198,198	1.2	0.0	11	dbSNP_98	3	1360,5576		235,890,2343	no	coding-synonymous,coding-synonymous,coding-synonymous	WT1	NM_000378.4,NM_024424.3,NM_024426.4	,,	655,1617,2846	AA,AC,CC		19.6078,47.4848,28.5952	,,	66/498,66/515,66/518	32456694	2927,7309	1650	3468	5118	SO:0001819	synonymous_variant	7490	exon1	Familial Cancer Database	WAGR syndrome; ; ;incl.: Early Onset Nephrotic Syndrome-WT1 associated	TTGCTGCGGCTCA		CCDS7878.2, CCDS44561.1, CCDS44562.1, CCDS55750.1, CCDS55751.1	11p13	2014-09-17			ENSG00000184937	ENSG00000184937		"""Zinc fingers, C2H2-type"""	12796	protein-coding gene	gene with protein product		607102		GUD		14681303	Standard	NM_024424		Approved	WAGR, WIT-2, AWT1	uc001mtn.2	P19544	OTTHUMG00000039556	ENST00000332351.3:c.198G>T	11.37:g.32456694C>A		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	6	5	NM_024424	0	0	0	0	0	A8K6S1|B3KSA5|Q15881|Q16256|Q16575|Q4VXV4|Q4VXV5|Q4VXV6|Q8IYZ5	Silent	SNP	ENST00000332351.3	37	CCDS7878.2																																																																																			C|0.748;A|0.252		0.761	WT1-001	KNOWN	non_ATG_start|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000095436.2	NM_000378	
LRRC4C	57689	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	11	40136210	40136210	+	Missense_Mutation	SNP	C	C	G			TCGA-OR-A5LO-01A-11D-A29I-10	TCGA-OR-A5LO-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	89d60dde-b03a-4cb7-b32a-5d06fa328603	4a5886aa-889d-4ef2-89a9-be2f7a06bd58	g.chr11:40136210C>G	ENST00000278198.2	-	2	3596	c.1633G>C	c.(1633-1635)Gtc>Ctc	p.V545L	LRRC4C_ENST00000528697.1_Missense_Mutation_p.V545L|LRRC4C_ENST00000530763.1_Missense_Mutation_p.V545L|LRRC4C_ENST00000527150.1_Missense_Mutation_p.V545L			Q9HCJ2	LRC4C_HUMAN	leucine rich repeat containing 4C	545					regulation of axonogenesis (GO:0050770)	cell junction (GO:0030054)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|postsynaptic membrane (GO:0045211)				NS(2)|central_nervous_system(3)|endometrium(1)|large_intestine(14)|lung(43)|ovary(5)|prostate(2)|skin(9)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	86		all_lung(304;0.0575)|Lung NSC(402;0.138)				TAGAAAATGACCAGCATCACT	0.443																																					p.V545L		.											.	LRRC4C-521	0			c.G1633C						.						148.0	133.0	138.0					11																	40136210		2203	4300	6503	SO:0001583	missense	57689	exon7			AAATGACCAGCAT	AB046800	CCDS31464.1	11p12	2013-01-14				ENSG00000148948		"""Immunoglobulin superfamily / I-set domain containing"""	29317	protein-coding gene	gene with protein product		608817				14595443	Standard	NM_020929		Approved	KIAA1580, NGL-1	uc031pzu.1	Q9HCJ2		ENST00000278198.2:c.1633G>C	11.37:g.40136210C>G	ENSP00000278198:p.Val545Leu	Somatic	169	0		WXS	Illumina GAIIx	Phase_I	143	11	NM_001258419	0	0	6	6	0	A8K0T1|Q7L0N3	Missense_Mutation	SNP	ENST00000278198.2	37	CCDS31464.1	.	.	.	.	.	.	.	.	.	.	C	12.37	1.916410	0.33815	.	.	ENSG00000148948	ENST00000278198;ENST00000527150;ENST00000528697;ENST00000530763	T;T;T;T	0.32272	1.46;1.46;1.46;1.46	5.99	5.99	0.97316	.	0.056765	0.64402	D	0.000001	T	0.32615	0.0835	L	0.42245	1.32	0.47862	D	0.999531	B	0.12013	0.005	B	0.21360	0.034	T	0.02909	-1.1095	10	0.46703	T	0.11	.	19.4659	0.94939	0.0:1.0:0.0:0.0	.	545	Q9HCJ2	LRC4C_HUMAN	L	545	ENSP00000278198:V545L;ENSP00000436976:V545L;ENSP00000437132:V545L;ENSP00000434761:V545L	ENSP00000278198:V545L	V	-	1	0	LRRC4C	40092786	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	4.742000	0.62103	2.840000	0.97914	0.655000	0.94253	GTC	.		0.443	LRRC4C-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389499.1	NM_020929	
FOLH1	2346	bcgsc.ca	37	11	49204732	49204732	+	Missense_Mutation	SNP	T	T	C	rs199782232		TCGA-OR-A5LO-01A-11D-A29I-10	TCGA-OR-A5LO-10A-01D-A29L-10	T	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	89d60dde-b03a-4cb7-b32a-5d06fa328603	4a5886aa-889d-4ef2-89a9-be2f7a06bd58	g.chr11:49204732T>C	ENST00000256999.2	-	7	1149	c.889A>G	c.(889-891)Att>Gtt	p.I297V	FOLH1_ENST00000340334.7_Missense_Mutation_p.I282V|FOLH1_ENST00000533034.1_Missense_Mutation_p.I282V|FOLH1_ENST00000356696.3_Missense_Mutation_p.I297V|FOLH1_ENST00000343844.4_5'UTR	NM_004476.1	NP_004467.1	Q04609	FOLH1_HUMAN	folate hydrolase (prostate-specific membrane antigen) 1	297	NAALADase.				folic acid-containing compound metabolic process (GO:0006760)|proteolysis (GO:0006508)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)	carboxypeptidase activity (GO:0004180)|dipeptidase activity (GO:0016805)|metal ion binding (GO:0046872)|metallopeptidase activity (GO:0008237)|peptidase activity (GO:0008233)			NS(2)|breast(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(7)|lung(34)|ovary(1)|skin(1)|upper_aerodigestive_tract(4)|urinary_tract(3)	60					Capromab(DB00089)	TAGTATCCAATTGGATGAACA	0.363																																					p.I297V		.											.	FOLH1-579	0			c.A889G						.						78.0	79.0	78.0					11																	49204732		2201	4298	6499	SO:0001583	missense	2346	exon7			ATCCAATTGGATG	M99487	CCDS7946.1, CCDS31493.1, CCDS53626.1, CCDS53627.1, CCDS53628.1	11p11.2	2011-07-22			ENSG00000086205	ENSG00000086205	3.4.17.21		3788	protein-coding gene	gene with protein product	"""glutamate carboxylase II"", ""glutamate carboxypeptidase II"""	600934		FOLH		9838072	Standard	NM_001193472		Approved	PSM, PSMA, NAALAD1, NAALAdase, GCP2, GCPII	uc001ngy.3	Q04609	OTTHUMG00000166625	ENST00000256999.2:c.889A>G	11.37:g.49204732T>C	ENSP00000256999:p.Ile297Val	Somatic	145	1		WXS	Illumina GAIIx	Phase_I	114	6	NM_004476	0	0	5	5	0	A4UU12|A9CB79|B7Z312|B7Z343|D3DQS5|E9PDX8|O43748|Q16305|Q541A4|Q8TAY3|Q9NP15|Q9NYE2|Q9P1P8	Missense_Mutation	SNP	ENST00000256999.2	37	CCDS7946.1	.	.	.	.	.	.	.	.	.	.	T	7.025	0.559465	0.13436	.	.	ENSG00000086205	ENST00000256999;ENST00000356696;ENST00000340334;ENST00000533034;ENST00000389724	T;T;T;T	0.57107	0.42;0.42;0.42;0.42	2.76	1.59	0.23543	.	0.125811	0.35349	N	0.003276	T	0.50582	0.1624	M	0.78344	2.41	0.80722	D	1	B;B;B;B	0.20459	0.007;0.001;0.045;0.02	B;B;B;B	0.28139	0.046;0.018;0.086;0.035	T	0.47355	-0.9124	10	0.54805	T	0.06	.	6.1691	0.20406	0.0:0.1358:0.0:0.8642	.	282;282;297;297	Q04609-9;Q04609-7;Q04609-8;Q04609	.;.;.;FOLH1_HUMAN	V	297;297;282;282;297	ENSP00000256999:I297V;ENSP00000349129:I297V;ENSP00000344131:I282V;ENSP00000431463:I282V	ENSP00000256999:I297V	I	-	1	0	FOLH1	49161308	1.000000	0.71417	0.994000	0.49952	0.146000	0.21551	3.347000	0.52200	0.301000	0.22738	0.163000	0.16589	ATT	.		0.363	FOLH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390896.1	NM_004476	
FOLH1	2346	ucsc.edu	37	11	49204779	49204779	+	Missense_Mutation	SNP	C	C	T	rs116795343	byFrequency	TCGA-OR-A5LO-01A-11D-A29I-10	TCGA-OR-A5LO-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	89d60dde-b03a-4cb7-b32a-5d06fa328603	4a5886aa-889d-4ef2-89a9-be2f7a06bd58	g.chr11:49204779C>T	ENST00000256999.2	-	7	1102	c.842G>A	c.(841-843)cGt>cAt	p.R281H	FOLH1_ENST00000340334.7_Missense_Mutation_p.R266H|FOLH1_ENST00000533034.1_Missense_Mutation_p.R266H|FOLH1_ENST00000356696.3_Missense_Mutation_p.R281H|FOLH1_ENST00000343844.4_De_novo_Start_OutOfFrame	NM_004476.1	NP_004467.1	Q04609	FOLH1_HUMAN	folate hydrolase (prostate-specific membrane antigen) 1	281	NAALADase.				folic acid-containing compound metabolic process (GO:0006760)|proteolysis (GO:0006508)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)	carboxypeptidase activity (GO:0004180)|dipeptidase activity (GO:0016805)|metal ion binding (GO:0046872)|metallopeptidase activity (GO:0008237)|peptidase activity (GO:0008233)	p.R281L(1)		NS(2)|breast(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(7)|lung(34)|ovary(1)|skin(1)|upper_aerodigestive_tract(4)|urinary_tract(3)	60					Capromab(DB00089)	TGCAATTCCACGCCTATAAGC	0.348																																					p.R281H		.											.	FOLH1-579	1	Substitution - Missense(1)	lung(1)	c.G842A						.						72.0	73.0	73.0					11																	49204779		2201	4298	6499	SO:0001583	missense	2346	exon7			ATTCCACGCCTAT	M99487	CCDS7946.1, CCDS31493.1, CCDS53626.1, CCDS53627.1, CCDS53628.1	11p11.2	2011-07-22			ENSG00000086205	ENSG00000086205	3.4.17.21		3788	protein-coding gene	gene with protein product	"""glutamate carboxylase II"", ""glutamate carboxypeptidase II"""	600934		FOLH		9838072	Standard	NM_001193472		Approved	PSM, PSMA, NAALAD1, NAALAdase, GCP2, GCPII	uc001ngy.3	Q04609	OTTHUMG00000166625	ENST00000256999.2:c.842G>A	11.37:g.49204779C>T	ENSP00000256999:p.Arg281His	Somatic	120	4		WXS	Illumina GAIIx	Phase_I	93	14	NM_004476	0	0	5	5	0	A4UU12|A9CB79|B7Z312|B7Z343|D3DQS5|E9PDX8|O43748|Q16305|Q541A4|Q8TAY3|Q9NP15|Q9NYE2|Q9P1P8	Missense_Mutation	SNP	ENST00000256999.2	37	CCDS7946.1	.	.	.	.	.	.	.	.	.	.	C	2.929	-0.221410	0.06061	.	.	ENSG00000086205	ENST00000256999;ENST00000356696;ENST00000340334;ENST00000533034;ENST00000389724	T;T;T;T	0.43294	0.95;0.95;0.95;0.95	2.76	-1.12	0.09808	.	0.978445	0.08346	N	0.960084	T	0.21427	0.0516	N	0.14661	0.345	0.80722	D	1	B;B;B;B	0.06786	0.001;0.001;0.0;0.0	B;B;B;B	0.06405	0.001;0.0;0.002;0.0	T	0.23655	-1.0182	10	0.14656	T	0.56	.	6.6038	0.22714	0.0:0.3193:0.0:0.6807	.	266;266;281;281	Q04609-9;Q04609-7;Q04609-8;Q04609	.;.;.;FOLH1_HUMAN	H	281;281;266;266;281	ENSP00000256999:R281H;ENSP00000349129:R281H;ENSP00000344131:R266H;ENSP00000431463:R266H	ENSP00000256999:R281H	R	-	2	0	FOLH1	49161355	0.002000	0.14202	0.792000	0.32020	0.272000	0.26649	-0.922000	0.04004	-0.085000	0.12573	0.194000	0.17425	CGT	C|0.974;T|0.026		0.348	FOLH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390896.1	NM_004476	
TM7SF2	7108	hgsc.bcm.edu	37	11	64880090	64880090	+	Silent	SNP	G	G	C	rs4930284	byFrequency	TCGA-OR-A5LO-01A-11D-A29I-10	TCGA-OR-A5LO-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	89d60dde-b03a-4cb7-b32a-5d06fa328603	4a5886aa-889d-4ef2-89a9-be2f7a06bd58	g.chr11:64880090G>C	ENST00000279263.7	+	2	318	c.156G>C	c.(154-156)ccG>ccC	p.P52P	AP003068.9_ENST00000528887.1_RNA|TM7SF2_ENST00000345348.5_Silent_p.P52P|TM7SF2_ENST00000540748.1_5'UTR	NM_003273.2	NP_003264.2	O76062	ERG24_HUMAN	transmembrane 7 superfamily member 2	52					cholesterol biosynthetic process (GO:0006695)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of plasma membrane (GO:0005887)|receptor complex (GO:0043235)	delta14-sterol reductase activity (GO:0050613)			lung(14)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	18						CGTCCCTGCCGGGGCTGGAGG	0.756													C|||	4990	0.996406	0.9879	0.9986	5008	,	,		10438	1.0		0.999	False		,,,				2504	1.0				p.P52P		.											.	TM7SF2-91	0			c.G156C						.	C		2924,8		1458,8,0	2.0	2.0	2.0		156	-9.8	0.0	11	dbSNP_111	2	6426,0		3213,0,0	no	coding-synonymous	TM7SF2	NM_003273.2		4671,8,0	CC,CG,GG		0.0,0.2729,0.0855		52/419	64880090	9350,8	1466	3213	4679	SO:0001819	synonymous_variant	7108	exon2			CCTGCCGGGGCTG	BC012857	CCDS41669.1, CCDS60846.1	11q13.1	2013-05-23			ENSG00000149809	ENSG00000149809	1.3.1.70		11863	protein-coding gene	gene with protein product	"""delta(14)-sterol reductase"""	603414				9615229, 9286704	Standard	NM_003273		Approved	ANG1, DHCR14A, NET47	uc001oct.4	O76062	OTTHUMG00000165603	ENST00000279263.7:c.156G>C	11.37:g.64880090G>C		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	7	7	NM_003273	1	0	1	252	250	A8K4H0|O95982|Q8IY06|Q96E64|Q96GZ1	Silent	SNP	ENST00000279263.7	37	CCDS41669.1																																																																																			G|0.005;C|0.995		0.756	TM7SF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385234.1	NM_003273	
PPME1	51400	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	73957234	73957234	+	Silent	SNP	A	A	G			TCGA-OR-A5LO-01A-11D-A29I-10	TCGA-OR-A5LO-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	89d60dde-b03a-4cb7-b32a-5d06fa328603	4a5886aa-889d-4ef2-89a9-be2f7a06bd58	g.chr11:73957234A>G	ENST00000328257.8	+	10	1271	c.948A>G	c.(946-948)aaA>aaG	p.K316K	PPME1_ENST00000398427.4_Silent_p.K330K|P4HA3_ENST00000540363.1_Intron|PPME1_ENST00000543525.1_Silent_p.K129K			Q9Y570	PPME1_HUMAN	protein phosphatase methylesterase 1	316					negative regulation of catalytic activity (GO:0043086)|protein demethylation (GO:0006482)|regulation of catalytic activity (GO:0050790)		protein C-terminal methylesterase activity (GO:0051722)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|protein phosphatase inhibitor activity (GO:0004864)|protein phosphatase type 2A regulator activity (GO:0008601)			endometrium(1)|large_intestine(2)|lung(2)	5	Breast(11;3.29e-05)					CCATTCCTAAATTGCTGCTCT	0.408																																					p.K330K		.											.	.	0			c.A990G						.						74.0	72.0	72.0					11																	73957234		1796	3906	5702	SO:0001819	synonymous_variant	51400	exon10			TCCTAAATTGCTG		CCDS44678.1, CCDS60891.1	11q13.4	2014-03-14			ENSG00000214517	ENSG00000214517	3.1.1.89		30178	protein-coding gene	gene with protein product		611117				10318862	Standard	NM_016147		Approved	PME-1	uc009yty.4	Q9Y570	OTTHUMG00000168115	ENST00000328257.8:c.948A>G	11.37:g.73957234A>G		Somatic	70	0		WXS	Illumina GAIIx	Phase_I	66	63	NM_001271593	0	0	0	22	22	B3KMU6|B5MEE7|J3QT22|Q8WYG8|Q9NVT5|Q9UI18	Silent	SNP	ENST00000328257.8	37	CCDS44678.1																																																																																			.		0.408	PPME1-001	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398254.1	NM_016147	
CD163L1	283316	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	7531782	7531782	+	Missense_Mutation	SNP	C	C	A			TCGA-OR-A5LO-01A-11D-A29I-10	TCGA-OR-A5LO-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	89d60dde-b03a-4cb7-b32a-5d06fa328603	4a5886aa-889d-4ef2-89a9-be2f7a06bd58	g.chr12:7531782C>A	ENST00000313599.3	-	9	2220	c.2163G>T	c.(2161-2163)atG>atT	p.M721I	CD163L1_ENST00000396630.1_Missense_Mutation_p.M721I|CD163L1_ENST00000544331.1_Intron|CD163L1_ENST00000416109.2_Missense_Mutation_p.M731I			Q9NR16	C163B_HUMAN	CD163 molecule-like 1	721	SRCR 7. {ECO:0000255|PROSITE- ProRule:PRU00196}.					extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	scavenger receptor activity (GO:0005044)			breast(5)|central_nervous_system(3)|endometrium(8)|kidney(3)|large_intestine(18)|lung(37)|ovary(8)|prostate(3)|skin(6)|stomach(1)|urinary_tract(4)	96						CAGCAATGTTCATTCCCCAGC	0.488																																					p.M721I		.											.	CD163L1-100	0			c.G2163T						.						130.0	102.0	111.0					12																	7531782		2203	4300	6503	SO:0001583	missense	283316	exon9			AATGTTCATTCCC	AF264014	CCDS8577.1, CCDS73434.1	12p13.31	2006-03-28	2006-03-28			ENSG00000177675			30375	protein-coding gene	gene with protein product		606079	"""CD163 antigen-like 1"""			11124526, 11086079	Standard	XM_005253348		Approved	M160, CD163B	uc001qsy.3	Q9NR16		ENST00000313599.3:c.2163G>T	12.37:g.7531782C>A	ENSP00000315945:p.Met721Ile	Somatic	110	0		WXS	Illumina GAIIx	Phase_I	141	28	NM_174941	0	0	1	1	0	B4E0G7|C9JHR7|E7EVK4|Q2M3B7|Q6UWC2	Missense_Mutation	SNP	ENST00000313599.3	37	CCDS8577.1	.	.	.	.	.	.	.	.	.	.	C	3.499	-0.102274	0.06967	.	.	ENSG00000177675	ENST00000313599;ENST00000416109;ENST00000396630	T;T;T	0.34275	1.37;1.37;1.37	2.69	1.75	0.24633	Speract/scavenger receptor (2);Speract/scavenger receptor-related (2);	1.329040	0.05696	N	0.593129	T	0.23806	0.0576	N	0.12663	0.25	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.09377	0.004;0.001	T	0.29088	-1.0023	10	0.31617	T	0.26	.	10.8589	0.46815	0.0:0.8776:0.0:0.1224	.	731;721	E7EVK4;Q9NR16	.;C163B_HUMAN	I	721;731;721	ENSP00000315945:M721I;ENSP00000393474:M731I;ENSP00000379871:M721I	ENSP00000315945:M721I	M	-	3	0	CD163L1	7423049	0.000000	0.05858	0.001000	0.08648	0.009000	0.06853	-0.170000	0.09897	0.006000	0.14734	-1.644000	0.00765	ATG	.		0.488	CD163L1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000399329.1	NM_174941	
WBP11	51729	broad.mit.edu	37	12	14941906	14941906	+	Missense_Mutation	SNP	G	G	T			TCGA-OR-A5LO-01A-11D-A29I-10	TCGA-OR-A5LO-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	89d60dde-b03a-4cb7-b32a-5d06fa328603	4a5886aa-889d-4ef2-89a9-be2f7a06bd58	g.chr12:14941906G>T	ENST00000261167.2	-	11	1704	c.1471C>A	c.(1471-1473)Cta>Ata	p.L491I		NM_016312.2	NP_057396.1	Q9Y2W2	WBP11_HUMAN	WW domain binding protein 11	491	Pro-rich.				mRNA processing (GO:0006397)|RNA splicing (GO:0008380)|rRNA processing (GO:0006364)	cytoplasm (GO:0005737)|nuclear speck (GO:0016607)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|protein phosphatase type 1 regulator activity (GO:0008599)|single-stranded DNA binding (GO:0003697)|WW domain binding (GO:0050699)			endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(16)|ovary(1)|prostate(1)	30						GGGGGAGGTAGCCTTGGTGGG	0.542																																					p.L491I		.											.	WBP11-92	0			c.C1471A						.						13.0	16.0	15.0					12																	14941906		2203	4295	6498	SO:0001583	missense	51729	exon11			GAGGTAGCCTTGG	AB029309	CCDS8666.1	12p12.3	2014-06-13			ENSG00000084463	ENSG00000084463			16461	protein-coding gene	gene with protein product	"""splicing factor, PQBP1 and PP1 interacting"", ""protein phosphatase 1, regulatory subunit 165"""					10593949	Standard	NM_016312		Approved	NPWBP, SIPP1, PPP1R165	uc001rci.3	Q9Y2W2	OTTHUMG00000168737	ENST00000261167.2:c.1471C>A	12.37:g.14941906G>T	ENSP00000261167:p.Leu491Ile	Somatic	79	0		WXS	Illumina GAIIx	Phase_I	117	4	NM_016312	0	0	90	90	0	Q96AY8	Missense_Mutation	SNP	ENST00000261167.2	37	CCDS8666.1	.	.	.	.	.	.	.	.	.	.	G	13.86	2.363341	0.41902	.	.	ENSG00000084463	ENST00000261167;ENST00000537574	D	0.90004	-2.6	4.68	3.77	0.43336	.	0.000000	0.64402	D	0.000003	D	0.91825	0.7413	M	0.64997	1.995	0.47737	D	0.999509	D	0.63880	0.993	D	0.67548	0.952	D	0.91037	0.4868	10	0.49607	T	0.09	-13.3668	10.9246	0.47184	0.0947:0.0:0.9053:0.0	.	491	Q9Y2W2	WBP11_HUMAN	I	491;457	ENSP00000442868:L457I	ENSP00000261167:L491I	L	-	1	2	WBP11	14833173	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	3.560000	0.53763	2.442000	0.82660	0.585000	0.79938	CTA	.		0.542	WBP11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400850.1	NM_016312	
EPS8	2059	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	15823815	15823815	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5LO-01A-11D-A29I-10	TCGA-OR-A5LO-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	89d60dde-b03a-4cb7-b32a-5d06fa328603	4a5886aa-889d-4ef2-89a9-be2f7a06bd58	g.chr12:15823815G>A	ENST00000281172.5	-	4	615	c.179C>T	c.(178-180)tCa>tTa	p.S60L	EPS8_ENST00000543612.1_Missense_Mutation_p.S60L|RNU6-251P_ENST00000363235.1_RNA|EPS8_ENST00000543523.1_Missense_Mutation_p.S60L	NM_004447.5	NP_004438.3	Q12929	EPS8_HUMAN	epidermal growth factor receptor pathway substrate 8	60					actin crosslink formation (GO:0051764)|actin cytoskeleton reorganization (GO:0031532)|actin filament bundle assembly (GO:0051017)|actin polymerization-dependent cell motility (GO:0070358)|adult locomotory behavior (GO:0008344)|barbed-end actin filament capping (GO:0051016)|behavioral response to ethanol (GO:0048149)|cell proliferation (GO:0008283)|dendritic cell migration (GO:0036336)|epidermal growth factor receptor signaling pathway (GO:0007173)|exit from mitosis (GO:0010458)|positive regulation of signal transduction (GO:0009967)|Rac protein signal transduction (GO:0016601)|regulation of actin filament length (GO:0030832)|regulation of cell shape (GO:0008360)|signal transduction (GO:0007165)	cell cortex (GO:0005938)|cell junction (GO:0030054)|extracellular vesicular exosome (GO:0070062)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|neuron projection (GO:0043005)|postsynaptic density (GO:0014069)|ruffle membrane (GO:0032587)|stereocilium (GO:0032420)|vesicle (GO:0031982)	actin binding (GO:0003779)|Rac GTPase binding (GO:0048365)|SH3/SH2 adaptor activity (GO:0005070)			NS(1)|breast(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(9)|ovary(3)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	33		all_epithelial(100;1.87e-05)|Breast(259;0.000286)|Hepatocellular(102;0.244)		BRCA - Breast invasive adenocarcinoma(232;4.29e-05)|GBM - Glioblastoma multiforme(207;0.0264)		AGATATATCTGACACACTGCT	0.363																																					p.S60L		.											.	EPS8-94	0			c.C179T						.						171.0	154.0	160.0					12																	15823815		2203	4300	6503	SO:0001583	missense	2059	exon4			ATATCTGACACAC	U12535	CCDS31753.1	12p12.3	2008-05-02				ENSG00000151491			3420	protein-coding gene	gene with protein product		600206				8084614	Standard	NM_004447		Approved		uc001rdb.3	Q12929		ENST00000281172.5:c.179C>T	12.37:g.15823815G>A	ENSP00000281172:p.Ser60Leu	Somatic	112	0		WXS	Illumina GAIIx	Phase_I	120	32	NM_004447	0	0	3	3	0	A6NMC3|A8K6W2|A8KA66|B4DX66|Q8N6J0	Missense_Mutation	SNP	ENST00000281172.5	37	CCDS31753.1	.	.	.	.	.	.	.	.	.	.	G	21.8	4.201234	0.79015	.	.	ENSG00000151491	ENST00000543523;ENST00000281172;ENST00000543612;ENST00000543223;ENST00000546311;ENST00000535752;ENST00000543363;ENST00000536793;ENST00000544064	T;T;T;T;T	0.47528	3.28;3.28;3.28;0.85;0.84	5.04	5.04	0.67666	Phosphotyrosine interaction domain (1);	0.064059	0.64402	D	0.000005	T	0.46014	0.1371	L	0.59436	1.845	0.80722	D	1	P	0.37864	0.61	B	0.33521	0.165	T	0.46105	-0.9215	10	0.37606	T	0.19	-16.9535	18.9408	0.92604	0.0:0.0:1.0:0.0	.	60	Q12929	EPS8_HUMAN	L	60	ENSP00000441867:S60L;ENSP00000281172:S60L;ENSP00000442388:S60L;ENSP00000445235:S60L;ENSP00000440591:S60L	ENSP00000281172:S60L	S	-	2	0	EPS8	15715082	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.118000	0.77137	2.785000	0.95823	0.655000	0.94253	TCA	.		0.363	EPS8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401093.1		
KRT72	140807	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	52980754	52980754	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5LO-01A-11D-A29I-10	TCGA-OR-A5LO-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	89d60dde-b03a-4cb7-b32a-5d06fa328603	4a5886aa-889d-4ef2-89a9-be2f7a06bd58	g.chr12:52980754C>T	ENST00000537672.2	-	8	1331	c.1321G>A	c.(1321-1323)Gaa>Aaa	p.E441K	KRT72_ENST00000398066.3_Missense_Mutation_p.E253K|KRT72_ENST00000293745.2_Missense_Mutation_p.E441K|KRT72_ENST00000354310.4_Missense_Mutation_p.E399K	NM_001146225.1	NP_001139697.1	Q14CN4	K2C72_HUMAN	keratin 72	441	Tail.					extracellular vesicular exosome (GO:0070062)|keratin filament (GO:0045095)	structural molecule activity (GO:0005198)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(6)|lung(14)|ovary(5)|pancreas(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(2)	36				BRCA - Breast invasive adenocarcinoma(357;0.195)		TTTGGATATTCGCCAGACATC	0.453																																					p.E441K		.											.	KRT72-96	0			c.G1321A						.						116.0	104.0	108.0					12																	52980754		2203	4300	6503	SO:0001583	missense	140807	exon8			GATATTCGCCAGA	AY033495	CCDS8833.1, CCDS53795.1	12q13.13	2013-06-25			ENSG00000170486	ENSG00000170486		"""-"", ""Intermediate filaments type II, keratins (basic)"""	28932	protein-coding gene	gene with protein product		608246				12648212, 11703281, 16831889	Standard	NM_080747		Approved	K6IRS2, KRT6IRS2, KRT6, K6irs	uc001saq.2	Q14CN4	OTTHUMG00000169744	ENST00000537672.2:c.1321G>A	12.37:g.52980754C>T	ENSP00000441160:p.Glu441Lys	Somatic	185	0		WXS	Illumina GAIIx	Phase_I	242	50	NM_001146225	0	0	0	0	0	B4DEI8|H9KV51|Q8NA87|Q8WWY9|Q8WWZ0	Missense_Mutation	SNP	ENST00000537672.2	37	CCDS8833.1	.	.	.	.	.	.	.	.	.	.	C	19.12	3.766583	0.69878	.	.	ENSG00000170486	ENST00000537672;ENST00000293745;ENST00000354310;ENST00000398066	D;D;D;T	0.83673	-1.69;-1.69;-1.75;-1.36	4.44	4.44	0.53790	.	0.114504	0.38720	N	0.001584	D	0.84174	0.5414	M	0.65975	2.015	0.35204	D	0.774539	D;D	0.59357	0.985;0.972	P;P	0.48901	0.594;0.594	D	0.89563	0.3808	10	0.87932	D	0	.	12.9246	0.58252	0.0:1.0:0.0:0.0	.	399;441	B4DEI8;Q14CN4	.;K2C72_HUMAN	K	441;441;399;253	ENSP00000441160:E441K;ENSP00000293745:E441K;ENSP00000346269:E399K;ENSP00000446151:E253K	ENSP00000293745:E441K	E	-	1	0	KRT72	51267021	0.998000	0.40836	0.900000	0.35374	0.604000	0.37047	2.550000	0.45811	2.774000	0.95407	0.555000	0.69702	GAA	.		0.453	KRT72-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405693.1	NM_080747	
HNRNPA1	3178	broad.mit.edu;ucsc.edu	37	12	54677695	54677695	+	Missense_Mutation	SNP	G	G	C			TCGA-OR-A5LO-01A-11D-A29I-10	TCGA-OR-A5LO-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	89d60dde-b03a-4cb7-b32a-5d06fa328603	4a5886aa-889d-4ef2-89a9-be2f7a06bd58	g.chr12:54677695G>C	ENST00000340913.6	+	9	1060	c.1007G>C	c.(1006-1008)aGa>aCa	p.R336T	HNRNPA1_ENST00000547276.1_Missense_Mutation_p.R231T|HNRNPA1_ENST00000330752.8_Missense_Mutation_p.R271T|HNRNPA1_ENST00000546500.1_Missense_Mutation_p.R284T|RP11-968A15.8_ENST00000553061.1_RNA	NM_002136.2|NM_031157.2	NP_002127.1|NP_112420.1	P09651	ROA1_HUMAN	heterogeneous nuclear ribonucleoprotein A1	336	Gly-rich.|Nuclear targeting sequence (M9).				cell death (GO:0008219)|gene expression (GO:0010467)|mRNA processing (GO:0006397)|mRNA splicing, via spliceosome (GO:0000398)|mRNA transport (GO:0051028)|nuclear export (GO:0051168)|nuclear import (GO:0051170)|RNA export from nucleus (GO:0006405)|RNA splicing (GO:0008380)|viral process (GO:0016032)	catalytic step 2 spliceosome (GO:0071013)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|intermediate filament cytoskeleton (GO:0045111)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)|spliceosomal complex (GO:0005681)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|single-stranded DNA binding (GO:0003697)|single-stranded RNA binding (GO:0003727)			endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(4)|lung(6)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	20						TTTGGAGGCAGAAGCTCTGGC	0.428																																					p.R336T	Colon(83;502 1289 8436 16406 24870)	.											.	HNRNPA1-93	0			c.G1007C						.						70.0	77.0	75.0					12																	54677695		2023	4173	6196	SO:0001583	missense	3178	exon9			GAGGCAGAAGCTC	BC009600	CCDS41793.1, CCDS44909.1	12q13.1	2013-10-11		2007-08-16	ENSG00000135486	ENSG00000135486		"""RNA binding motif (RRM) containing"""	5031	protein-coding gene	gene with protein product		164017		HNRPA1		1733858	Standard	XR_245923		Approved	hnRNPA1, hnRNP-A1	uc001sfl.3	P09651		ENST00000340913.6:c.1007G>C	12.37:g.54677695G>C	ENSP00000341826:p.Arg336Thr	Somatic	15	0		WXS	Illumina GAIIx	Phase_I	23	5	NM_031157	1	1	1960	2572	610	A8K4Z8|Q3MIB7|Q6PJZ7	Missense_Mutation	SNP	ENST00000340913.6	37	CCDS44909.1	.	.	.	.	.	.	.	.	.	.	G	18.96	3.733322	0.69189	.	.	ENSG00000135486	ENST00000546500;ENST00000547617;ENST00000552494;ENST00000340913;ENST00000330752;ENST00000552591;ENST00000551133;ENST00000547276;ENST00000550482	D;D;D;D	0.88124	-2.34;-2.34;-2.34;-2.34	4.06	4.06	0.47325	.	0.000000	0.64402	D	0.000020	D	0.92260	0.7545	M	0.72576	2.205	0.45946	D	0.998778	D;D;D;D;P;D;D	0.62365	0.991;0.989;0.989;0.989;0.851;0.989;0.981	D;D;D;D;P;D;D	0.76071	0.987;0.978;0.978;0.978;0.474;0.978;0.95	D	0.92793	0.6250	10	0.72032	D	0.01	.	14.5535	0.68084	0.0:0.0:1.0:0.0	.	262;271;284;284;231;284;336	Q9BSM5;F8VRQ1;F8W6I7;F8VSB5;P09651-3;P09651-2;P09651	.;.;.;.;.;.;ROA1_HUMAN	T	284;268;284;336;284;284;271;231;155	ENSP00000448617:R284T;ENSP00000341826:R336T;ENSP00000447260:R231T;ENSP00000446486:R155T	ENSP00000333504:R284T	R	+	2	0	HNRNPA1	52963962	1.000000	0.71417	1.000000	0.80357	0.945000	0.59286	7.572000	0.82409	2.573000	0.86826	0.561000	0.74099	AGA	.		0.428	HNRNPA1-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000405480.1	NM_031157	
AMDHD1	144193	hgsc.bcm.edu	37	12	96337183	96337183	+	Missense_Mutation	SNP	A	A	G	rs7955450	byFrequency	TCGA-OR-A5LO-01A-11D-A29I-10	TCGA-OR-A5LO-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	89d60dde-b03a-4cb7-b32a-5d06fa328603	4a5886aa-889d-4ef2-89a9-be2f7a06bd58	g.chr12:96337183A>G	ENST00000266736.2	+	1	113	c.7A>G	c.(7-9)Agc>Ggc	p.S3G	CCDC38_ENST00000546386.1_5'Flank|CCDC38_ENST00000344280.3_5'Flank|CCDC38_ENST00000549752.1_5'Flank	NM_152435.2	NP_689648.2	Q96NU7	HUTI_HUMAN	amidohydrolase domain containing 1	3			S -> G (in dbSNP:rs7955450). {ECO:0000269|PubMed:14702039, ECO:0000269|PubMed:15221005, ECO:0000269|PubMed:15489334, ECO:0000269|PubMed:16541075}.		cellular nitrogen compound metabolic process (GO:0034641)|histidine catabolic process (GO:0006548)|histidine catabolic process to glutamate and formamide (GO:0019556)|histidine catabolic process to glutamate and formate (GO:0019557)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	imidazolonepropionase activity (GO:0050480)|metal ion binding (GO:0046872)			central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(7)|lung(7)|ovary(1)|skin(1)	22						CGACATGGCAAGCGGCCACAG	0.736													G|||	3598	0.71845	0.702	0.6888	5008	,	,		10480	0.9554		0.6004	False		,,,				2504	0.6391				p.S3G		.											.	AMDHD1-90	0			c.A7G						.						2.0	3.0	3.0					12																	96337183		1177	2379	3556	SO:0001583	missense	144193	exon1			ATGGCAAGCGGCC	AB075878	CCDS9057.1	12q23.1	2006-02-02				ENSG00000139344			28577	protein-coding gene	gene with protein product							Standard	NM_152435		Approved	MGC35366	uc001tel.2	Q96NU7	OTTHUMG00000170353	ENST00000266736.2:c.7A>G	12.37:g.96337183A>G	ENSP00000266736:p.Ser3Gly	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	8	8	NM_152435	0	0	0	1	1	A8K463|Q68CI8	Missense_Mutation	SNP	ENST00000266736.2	37	CCDS9057.1	1561	0.7147435897435898	348	0.7073170731707317	233	0.643646408839779	540	0.9440559440559441	440	0.5804749340369393	G	5.553	0.286982	0.10513	.	.	ENSG00000139344	ENST00000266736	T	0.30714	1.52	4.39	-8.69	0.00855	.	0.734274	0.13810	N	0.361153	T	0.00012	0.0000	N	0.01576	-0.805	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.28427	-1.0044	9	0.21540	T	0.41	.	1.8829	0.03231	0.44:0.0902:0.1959:0.2739	rs7955450;rs17856824;rs58541549;rs7955450	3	Q96NU7	HUTI_HUMAN	G	3	ENSP00000266736:S3G	ENSP00000266736:S3G	S	+	1	0	AMDHD1	94861314	0.000000	0.05858	0.000000	0.03702	0.134000	0.20937	-0.592000	0.05747	-2.316000	0.00645	-1.140000	0.01884	AGC	A|0.273;G|0.727		0.736	AMDHD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408640.1	NM_152435	
UNG	7374	hgsc.bcm.edu	37	12	109536257	109536257	+	Silent	SNP	C	C	G			TCGA-OR-A5LO-01A-11D-A29I-10	TCGA-OR-A5LO-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	89d60dde-b03a-4cb7-b32a-5d06fa328603	4a5886aa-889d-4ef2-89a9-be2f7a06bd58	g.chr12:109536257C>G	ENST00000242576.2	+	2	259	c.153C>G	c.(151-153)gcC>gcG	p.A51A	UNG_ENST00000336865.2_Silent_p.A42A	NM_080911.2	NP_550433.1			uracil-DNA glycosylase											central_nervous_system(1)|endometrium(2)|large_intestine(1)|lung(4)|ovary(1)	9						CCAAGAAGGCCCCGGCTGGGC	0.716								Base excision repair (BER), DNA glycosylases	Immune Deficiency with Hyper-IgM																												p.A51A		.											.	UNG-1083	0			c.C153G						.						16.0	20.0	19.0					12																	109536257		2164	4240	6404	SO:0001819	synonymous_variant	7374	exon2	Familial Cancer Database	Hypogammaglobulinemia with Hyper-IgM, HIGM type I-V, XLHIGM	GAAGGCCCCGGCT	A64377	CCDS9124.1, CCDS9125.1	12q23-q24.1	2014-09-17			ENSG00000076248	ENSG00000076248	3.2.2.27		12572	protein-coding gene	gene with protein product	"""uracil-DNA glycosylase 1, uracil-DNA glycosylase 2"""	191525		DGU		1923798, 17101234	Standard	NM_080911		Approved	UDG, UNG1, UNG2, HIGM4	uc001tnz.2	P13051	OTTHUMG00000169247	ENST00000242576.2:c.153C>G	12.37:g.109536257C>G		Somatic	3	0		WXS	Illumina GAIIx	Phase_I	94	30	NM_080911	0	0	71	106	35		Silent	SNP	ENST00000242576.2	37	CCDS9124.1																																																																																			.		0.716	UNG-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000403067.1	NM_080911	
RNFT2	84900	hgsc.bcm.edu	37	12	117187907	117187907	+	Silent	SNP	T	T	C	rs111256849	byFrequency	TCGA-OR-A5LO-01A-11D-A29I-10	TCGA-OR-A5LO-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	89d60dde-b03a-4cb7-b32a-5d06fa328603	4a5886aa-889d-4ef2-89a9-be2f7a06bd58	g.chr12:117187907T>C	ENST00000257575.4	+	4	578	c.345T>C	c.(343-345)caT>caC	p.H115H	RNFT2_ENST00000392549.2_Silent_p.H115H|RNFT2_ENST00000319176.7_Silent_p.H115H|RNFT2_ENST00000407967.3_Silent_p.H115H			Q96EX2	RNFT2_HUMAN	ring finger protein, transmembrane 2	115	His-rich.					integral component of membrane (GO:0016021)	zinc ion binding (GO:0008270)			endometrium(1)|large_intestine(3)|lung(1)|urinary_tract(1)	6	all_neural(191;0.117)|Medulloblastoma(191;0.163)			BRCA - Breast invasive adenocarcinoma(302;0.034)		CCCACCACCATTTCCACCATG	0.746													C|||	1284	0.25639	0.4826	0.1326	5008	,	,		12011	0.1786		0.166	False		,,,				2504	0.2117				p.H115H		.											.	.	0			c.T345C						.	C	,	1295,2539		234,827,856	3.0	4.0	4.0		345,345	3.2	1.0	12	dbSNP_132	4	888,6786		67,754,3016	no	coding-synonymous,coding-synonymous	RNFT2	NM_001109903.1,NM_032814.3	,	301,1581,3872	CC,CT,TT		11.5715,33.7767,18.9694	,	115/445,115/421	117187907	2183,9325	1917	3837	5754	SO:0001819	synonymous_variant	84900	exon4			CCACCATTTCCAC	AK027533	CCDS9180.2, CCDS44987.1	12q24.22	2013-01-09	2008-02-26	2008-02-26	ENSG00000135119	ENSG00000135119		"""RING-type (C3HC4) zinc fingers"""	25905	protein-coding gene	gene with protein product			"""transmembrane protein 118"""	TMEM118		12477932	Standard	NM_032814		Approved	FLJ14627	uc009zwn.3	Q96EX2	OTTHUMG00000150882	ENST00000257575.4:c.345T>C	12.37:g.117187907T>C		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	14	11	NM_001109903	0	0	0	0	0	E9PAM7|Q96SU5	Silent	SNP	ENST00000257575.4	37	CCDS44987.1																																																																																			T|0.767;C|0.233		0.746	RNFT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320417.1	NM_032814	
RNFT2	84900	hgsc.bcm.edu	37	12	117187919	117187919	+	Silent	SNP	C	C	T	rs116754010	byFrequency	TCGA-OR-A5LO-01A-11D-A29I-10	TCGA-OR-A5LO-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	89d60dde-b03a-4cb7-b32a-5d06fa328603	4a5886aa-889d-4ef2-89a9-be2f7a06bd58	g.chr12:117187919C>T	ENST00000257575.4	+	4	590	c.357C>T	c.(355-357)ggC>ggT	p.G119G	RNFT2_ENST00000392549.2_Silent_p.G119G|RNFT2_ENST00000319176.7_Silent_p.G119G|RNFT2_ENST00000407967.3_Silent_p.G119G			Q96EX2	RNFT2_HUMAN	ring finger protein, transmembrane 2	119	His-rich.					integral component of membrane (GO:0016021)	zinc ion binding (GO:0008270)			endometrium(1)|large_intestine(3)|lung(1)|urinary_tract(1)	6	all_neural(191;0.117)|Medulloblastoma(191;0.163)			BRCA - Breast invasive adenocarcinoma(302;0.034)		TCCACCATGGCGGCCACCGCG	0.751													C|||	314	0.0626997	0.1452	0.0144	5008	,	,		11841	0.0208		0.0159	False		,,,				2504	0.0767				p.G119G		.											.	.	0			c.C357T						.	C	,	436,3370		21,394,1488	4.0	4.0	4.0		357,357	-7.2	0.0	12	dbSNP_132	4	155,7571		1,153,3709	no	coding-synonymous,coding-synonymous	RNFT2	NM_001109903.1,NM_032814.3	,	22,547,5197	TT,TC,CC		2.0062,11.4556,5.1249	,	119/445,119/421	117187919	591,10941	1903	3863	5766	SO:0001819	synonymous_variant	84900	exon4			CCATGGCGGCCAC	AK027533	CCDS9180.2, CCDS44987.1	12q24.22	2013-01-09	2008-02-26	2008-02-26	ENSG00000135119	ENSG00000135119		"""RING-type (C3HC4) zinc fingers"""	25905	protein-coding gene	gene with protein product			"""transmembrane protein 118"""	TMEM118		12477932	Standard	NM_032814		Approved	FLJ14627	uc009zwn.3	Q96EX2	OTTHUMG00000150882	ENST00000257575.4:c.357C>T	12.37:g.117187919C>T		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	12	11	NM_001109903	0	0	0	0	0	E9PAM7|Q96SU5	Silent	SNP	ENST00000257575.4	37	CCDS44987.1																																																																																			C|0.954;T|0.046		0.751	RNFT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320417.1	NM_032814	
TMEM132C	92293	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	129100821	129100821	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5LO-01A-11D-A29I-10	TCGA-OR-A5LO-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	89d60dde-b03a-4cb7-b32a-5d06fa328603	4a5886aa-889d-4ef2-89a9-be2f7a06bd58	g.chr12:129100821G>A	ENST00000435159.2	+	4	1246	c.1246G>A	c.(1246-1248)Gcc>Acc	p.A416T	TMEM132C_ENST00000315208.8_Missense_Mutation_p.A32T	NM_001136103.2	NP_001129575.2	Q8N3T6	T132C_HUMAN	transmembrane protein 132C	416						integral component of membrane (GO:0016021)				breast(2)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(4)|lung(2)|prostate(2)|skin(1)	13						CACAGACATCGCCGTGTCCGA	0.552																																					p.A416T		.											.	TMEM132C-68	0			c.G1246A						.						159.0	139.0	145.0					12																	129100821		692	1591	2283	SO:0001583	missense	92293	exon4			GACATCGCCGTGT	AK126715		12q24.32	2014-06-13				ENSG00000181234			25436	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 152"""						Standard	NM_001136103		Approved	DKFZp761O2018, PPP1R152	uc021rgn.1	Q8N3T6		ENST00000435159.2:c.1246G>A	12.37:g.129100821G>A	ENSP00000410852:p.Ala416Thr	Somatic	212	0		WXS	Illumina GAIIx	Phase_I	264	77	NM_001136103	0	0	0	0	0	Q69YX8	Missense_Mutation	SNP	ENST00000435159.2	37		.	.	.	.	.	.	.	.	.	.	G	12.59	1.983264	0.35036	.	.	ENSG00000181234	ENST00000435159;ENST00000315208	T;T	0.21734	1.99;1.99	5.0	4.11	0.48088	.	0.398540	0.21448	N	0.074365	T	0.11707	0.0285	N	0.20807	0.61	0.09310	N	1	B	0.26258	0.145	B	0.16722	0.016	T	0.25813	-1.0121	10	0.20519	T	0.43	.	8.7836	0.34807	0.2375:0.0:0.7625:0.0	.	416	Q8N3T6	T132C_HUMAN	T	416;32	ENSP00000410852:A416T;ENSP00000324458:A32T	ENSP00000324458:A32T	A	+	1	0	TMEM132C	127666774	0.129000	0.22400	0.006000	0.13384	0.808000	0.45660	1.509000	0.35780	1.100000	0.41517	0.555000	0.69702	GCC	.		0.552	TMEM132C-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		XM_044062	
EP400	57634	broad.mit.edu	37	12	132547087	132547087	+	Silent	SNP	G	G	A	rs12366766	byFrequency	TCGA-OR-A5LO-01A-11D-A29I-10	TCGA-OR-A5LO-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	89d60dde-b03a-4cb7-b32a-5d06fa328603	4a5886aa-889d-4ef2-89a9-be2f7a06bd58	g.chr12:132547087G>A	ENST00000333577.4	+	48	8392	c.8283G>A	c.(8281-8283)caG>caA	p.Q2761Q	EP400_ENST00000389561.2_Silent_p.Q2725Q|EP400_ENST00000332482.4_Silent_p.Q2688Q|EP400_ENST00000389562.2_Silent_p.Q2724Q|EP400_ENST00000330386.6_Silent_p.Q2644Q			Q96L91	EP400_HUMAN	E1A binding protein p400	2761	Interaction with ZNF42. {ECO:0000250}.|Poly-Gln.				chromatin organization (GO:0006325)|histone H2A acetylation (GO:0043968)|histone H4 acetylation (GO:0043967)	NuA4 histone acetyltransferase complex (GO:0035267)|nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|Swr1 complex (GO:0000812)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|helicase activity (GO:0004386)	p.Q2724Q(16)|p.Q2725Q(1)		NS(1)|breast(6)|central_nervous_system(10)|cervix(1)|endometrium(21)|kidney(13)|large_intestine(25)|lung(56)|ovary(5)|prostate(8)|skin(6)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(3)	161	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.198)		OV - Ovarian serous cystadenocarcinoma(86;3.01e-08)|Epithelial(86;3.43e-07)|all cancers(50;2.01e-06)		agcagcagcagcaacaacagc	0.562													G|||	37	0.00738818	0.0038	0.0072	5008	,	,		15585	0.002		0.0149	False		,,,				2504	0.0102				p.Q2725Q		.											.	EP400-520	17	Substitution - coding silent(17)	prostate(4)|kidney(4)|central_nervous_system(3)|lung(3)|endometrium(2)|urinary_tract(1)	c.G8175A						.						28.0	31.0	30.0					12																	132547087		2199	4282	6481	SO:0001819	synonymous_variant	57634	exon47			GCAGCAGCAACAA	U80743	CCDS31929.1, CCDS31929.2	12q24.33	2008-02-01	2002-02-05	2002-02-08		ENSG00000183495			11958	protein-coding gene	gene with protein product		606265	"""trinucleotide repeat containing 12"""	TNRC12		9225980, 11509179	Standard	NM_015409		Approved	CAGH32, KIAA1498, P400, KIAA1818, DKFZP434I225	uc001ujn.3	Q96L91		ENST00000333577.4:c.8283G>A	12.37:g.132547087G>A		Somatic	145	0		WXS	Illumina GAIIx	Phase_I	172	17	NM_015409	0	0	0	0	0	O15411|Q6P2F5|Q8N8Q7|Q8NE05|Q96JK7|Q9P230	Silent	SNP	ENST00000333577.4	37																																																																																				.		0.562	EP400-203	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding		NM_015409	
PGAM5	192111	hgsc.bcm.edu	37	12	133294107	133294107	+	Silent	SNP	G	G	T	rs547560937		TCGA-OR-A5LO-01A-11D-A29I-10	TCGA-OR-A5LO-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	89d60dde-b03a-4cb7-b32a-5d06fa328603	4a5886aa-889d-4ef2-89a9-be2f7a06bd58	g.chr12:133294107G>T	ENST00000498926.2	+	3	511	c.453G>T	c.(451-453)acG>acT	p.T151T	PGAM5_ENST00000317555.2_Silent_p.T151T|PXMP2_ENST00000545677.1_3'UTR|PGAM5_ENST00000543955.1_Silent_p.T2T|PGAM5_ENST00000454808.2_Silent_p.T2T	NM_001170543.1|NM_001170544.1	NP_001164014.1|NP_001164015.1	Q96HS1	PGAM5_HUMAN	phosphoglycerate mutase family member 5	151					dephosphorylation (GO:0016311)|necroptotic process (GO:0070266)|positive regulation of GTPase activity (GO:0043547)	integral component of membrane (GO:0016021)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)	GTPase activator activity (GO:0005096)|phosphatase activity (GO:0016791)|phosphoprotein phosphatase activity (GO:0004721)|protein complex binding (GO:0032403)			endometrium(1)|kidney(1)|large_intestine(1)|lung(2)	5	all_neural(191;0.0982)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;1.89e-08)|Epithelial(86;1.14e-07)|all cancers(50;3.57e-06)		CGTCTATGACGCGCGCCATAG	0.612																																					p.T151T		.											.	PGAM5-90	0			c.G453T						.						68.0	73.0	71.0					12																	133294107		2203	4298	6501	SO:0001819	synonymous_variant	192111	exon3			TATGACGCGCGCC	BC008196	CCDS9280.1, CCDS53845.1	12q24.33	2011-07-28			ENSG00000247077	ENSG00000247077			28763	protein-coding gene	gene with protein product		614939				11283018	Standard	NM_001170543		Approved	MGC5352, BXLBv68	uc009zyv.3	Q96HS1	OTTHUMG00000168021	ENST00000498926.2:c.453G>T	12.37:g.133294107G>T		Somatic	107	0		WXS	Illumina GAIIx	Phase_I	77	4	NM_138575	0	0	24	24	0	A9LN06|C9IZY7|Q96JB0	Silent	SNP	ENST00000498926.2	37	CCDS53845.1																																																																																			.		0.612	PGAM5-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000397562.1	NM_138575	
CEP128	145508	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	14	81209477	81209477	+	Silent	SNP	G	G	C	rs201355718		TCGA-OR-A5LO-01A-11D-A29I-10	TCGA-OR-A5LO-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	89d60dde-b03a-4cb7-b32a-5d06fa328603	4a5886aa-889d-4ef2-89a9-be2f7a06bd58	g.chr14:81209477G>C	ENST00000555265.1	-	19	3123	c.2748C>G	c.(2746-2748)ctC>ctG	p.L916L	CEP128_ENST00000281129.3_Silent_p.L916L			Q6ZU80	CE128_HUMAN	centrosomal protein 128kDa	916						centriole (GO:0005814)|cytoplasm (GO:0005737)|microtubule organizing center (GO:0005815)|spindle pole (GO:0000922)				NS(1)|breast(3)|central_nervous_system(2)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(22)|ovary(2)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	51						TCTGTTGAAAGAGACACTGCA	0.393																																					p.L916L		.											.	CEP128-91	0			c.C2748G						.						123.0	111.0	115.0					14																	81209477		2203	4300	6503	SO:0001819	synonymous_variant	145508	exon18			TTGAAAGAGACAC	AK056756	CCDS32130.1	14q31.1	2014-02-20	2011-05-06	2011-05-06	ENSG00000100629	ENSG00000100629			20359	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 61"", ""chromosome 14 open reading frame 145"""	C14orf61, C14orf145		21399614	Standard	NM_152446		Approved		uc001xux.2	Q6ZU80		ENST00000555265.1:c.2748C>G	14.37:g.81209477G>C		Somatic	40	0		WXS	Illumina GAIIx	Phase_I	102	20	NM_152446	0	0	4	4	0	B9EK52|Q86X97|Q96ML4	Silent	SNP	ENST00000555265.1	37	CCDS32130.1																																																																																			G|0.999;C|0.001		0.393	CEP128-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000413415.1	NM_152446	
DIO3	1735	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	14	102028383	102028383	+	Missense_Mutation	SNP	G	G	T			TCGA-OR-A5LO-01A-11D-A29I-10	TCGA-OR-A5LO-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	89d60dde-b03a-4cb7-b32a-5d06fa328603	4a5886aa-889d-4ef2-89a9-be2f7a06bd58	g.chr14:102028383G>T	ENST00000510508.4	+	1	696	c.550G>T	c.(550-552)Gtc>Ttc	p.V184F	DIO3OS_ENST00000408206.1_lincRNA|DIO3_ENST00000359323.3_Missense_Mutation_p.V158F			P55073	IOD3_HUMAN	deiodinase, iodothyronine, type III	184					cellular nitrogen compound metabolic process (GO:0034641)|hormone biosynthetic process (GO:0042446)|positive regulation of multicellular organism growth (GO:0040018)|small molecule metabolic process (GO:0044281)|thyroid hormone catabolic process (GO:0042404)|thyroid hormone generation (GO:0006590)	endosome (GO:0005768)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	thyroxine 5'-deiodinase activity (GO:0004800)|thyroxine 5-deiodinase activity (GO:0033798)			central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(4)|lung(8)|ovary(3)|skin(1)	22		all_neural(303;0.185)				CCAGCGCCTGGTCACTAAGTA	0.617																																					.		.											.	DIO3-494	0			.						.						41.0	47.0	45.0					14																	102028383		2073	4189	6262	SO:0001583	missense	1735	.			CGCCTGGTCACTA	S79854	CCDS41992.1, CCDS41992.2	14q32	2012-10-08			ENSG00000197406	ENSG00000197406			2885	protein-coding gene	gene with protein product		601038		TXDI3		9787088, 7593630	Standard	NM_001362		Approved		uc021sdx.1	P55073	OTTHUMG00000160681	ENST00000510508.4:c.550G>T	14.37:g.102028383G>T	ENSP00000427336:p.Val184Phe	Somatic	57	0		WXS	Illumina GAIIx	Phase_I	100	22	.	0	0	0	0	0	G3XAM0|Q8WVN5	Missense_Mutation	SNP	ENST00000510508.4	37	CCDS41992.2	.	.	.	.	.	.	.	.	.	.	G	24.5	4.536858	0.85812	.	.	ENSG00000197406;ENSG00000258865	ENST00000359323;ENST00000510508	T;T	0.38401	1.14;1.14	3.51	3.51	0.40186	Thioredoxin-like fold (1);	0.231875	0.26096	U	0.026372	T	0.56321	0.1977	M	0.73217	2.22	0.80722	D	1	D	0.76494	0.999	D	0.69654	0.965	T	0.60342	-0.7282	10	0.48119	T	0.1	.	14.2065	0.65737	0.0:0.0:1.0:0.0	.	158	P55073	IOD3_HUMAN	F	158;184	ENSP00000352273:V158F;ENSP00000427336:V184F	ENSP00000352273:V184F	V	+	1	0	DIO3;AL049836.1	101098136	1.000000	0.71417	1.000000	0.80357	0.962000	0.63368	9.515000	0.98015	1.799000	0.52666	0.462000	0.41574	GTC	.		0.617	DIO3-001	KNOWN	upstream_ATG|basic|appris_principal|CCDS|seleno	protein_coding	protein_coding	OTTHUMT00000361712.4	NM_001362	
C2CD4B	388125	hgsc.bcm.edu	37	15	62456358	62456358	+	Missense_Mutation	SNP	A	A	C	rs8040712	byFrequency	TCGA-OR-A5LO-01A-11D-A29I-10	TCGA-OR-A5LO-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	89d60dde-b03a-4cb7-b32a-5d06fa328603	4a5886aa-889d-4ef2-89a9-be2f7a06bd58	g.chr15:62456358A>C	ENST00000380392.3	-	2	954	c.826T>G	c.(826-828)Ttc>Gtc	p.F276V		NM_001007595.2	NP_001007596.2	A6NLJ0	C2C4B_HUMAN	C2 calcium-dependent domain containing 4B	276	C2.		F -> V (in dbSNP:rs8040712).			focal adhesion (GO:0005925)|nucleolus (GO:0005730)				skin(1)	1						gcgccTCCGAACAGGCTCTCC	0.781													C|||	3678	0.734425	0.7935	0.7622	5008	,	,		8907	0.5853		0.837	False		,,,				2504	0.683				p.F276V		.											.	C2CD4B-68	0			c.T826G						.						1.0	2.0	2.0					15																	62456358		946	2340	3286	SO:0001583	missense	388125	exon2			CTCCGAACAGGCT	BM023530	CCDS32259.1	15q22.2	2009-09-28	2009-09-28	2009-09-28					33628	protein-coding gene	gene with protein product	"""nuclear localized factor 2"""	610344	"""family with sequence similarity 148, member B"""	FAM148B			Standard	NM_001007595		Approved	NLF2	uc002ahg.2	A6NLJ0		ENST00000380392.3:c.826T>G	15.37:g.62456358A>C	ENSP00000369755:p.Phe276Val	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	4	4	NM_001007595	0	0	0	0	0		Missense_Mutation	SNP	ENST00000380392.3	37	CCDS32259.1	1621	0.7422161172161172	391	0.7947154471544715	277	0.7651933701657458	338	0.5909090909090909	615	0.8113456464379947	C	7.029	0.560274	0.13498	.	.	ENSG00000205502	ENST00000380392	T	0.77750	-1.12	3.13	-0.587	0.11690	.	0.286793	0.34460	N	0.003953	T	0.00012	0.0000	N	0.14661	0.345	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.38134	-0.9675	9	0.17832	T	0.49	.	7.611	0.28131	0.6497:0.2221:0.1281:0.0	rs8040712	276	A6NLJ0	C2C4B_HUMAN	V	276	ENSP00000369755:F276V	ENSP00000369755:F276V	F	-	1	0	C2CD4B	60243650	0.316000	0.24580	0.000000	0.03702	0.000000	0.00434	-0.369000	0.07533	-0.140000	0.11394	-1.484000	0.00983	TTC	A|0.258;C|0.742		0.781	C2CD4B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000416117.1	NM_001007595	
SMAD6	4091	hgsc.bcm.edu	37	15	66995716	66995716	+	Silent	SNP	C	C	T	rs149612008		TCGA-OR-A5LO-01A-11D-A29I-10	TCGA-OR-A5LO-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	89d60dde-b03a-4cb7-b32a-5d06fa328603	4a5886aa-889d-4ef2-89a9-be2f7a06bd58	g.chr15:66995716C>T	ENST00000288840.5	+	1	1151	c.120C>T	c.(118-120)ggC>ggT	p.G40G	SMAD6_ENST00000457357.2_Silent_p.G40G	NM_005585.4	NP_005576.3	O43541	SMAD6_HUMAN	SMAD family member 6	40					BMP signaling pathway (GO:0030509)|cell-substrate adhesion (GO:0031589)|fat cell differentiation (GO:0045444)|immune response (GO:0006955)|intracellular signal transduction (GO:0035556)|negative regulation of apoptotic process (GO:0043066)|negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of cell proliferation (GO:0008285)|negative regulation of pathway-restricted SMAD protein phosphorylation (GO:0060394)|negative regulation of SMAD protein complex assembly (GO:0010991)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|response to estrogen (GO:0043627)|response to laminar fluid shear stress (GO:0034616)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|ureteric bud development (GO:0001657)|zygotic specification of dorsal/ventral axis (GO:0007352)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|protein complex (GO:0043234)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|co-SMAD binding (GO:0070410)|I-SMAD binding (GO:0070411)|metal ion binding (GO:0046872)|R-SMAD binding (GO:0070412)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)|transforming growth factor beta receptor, inhibitory cytoplasmic mediator activity (GO:0030617)|type I activin receptor binding (GO:0070698)|type I transforming growth factor beta receptor binding (GO:0034713)|ubiquitin protein ligase binding (GO:0031625)			lung(1)|skin(1)	2						GGAGCTTGGGCAGCCGAGCTG	0.776																																					p.G40G	Esophageal Squamous(179;72 2004 22333 39628 47290)	.											.	SMAD6-415	0			c.C120T						.	C		13,2667		0,13,1327	2.0	2.0	2.0		120	2.6	1.0	15	dbSNP_134	2	163,5563		1,161,2701	no	coding-synonymous	SMAD6	NM_005585.4		1,174,4028	TT,TC,CC		2.8467,0.4851,2.0937		40/497	66995716	176,8230	1340	2863	4203	SO:0001819	synonymous_variant	4091	exon1			CTTGGGCAGCCGA	BC012986	CCDS10221.1	15q22.31	2014-09-11	2006-11-06	2004-05-26	ENSG00000137834	ENSG00000137834		"""SMADs"""	6772	protein-coding gene	gene with protein product		602931	"""MAD, mothers against decapentaplegic homolog 6 (Drosophila)"", ""SMAD, mothers against DPP homolog 6 (Drosophila)"""	MADH7, MADH6		9256479	Standard	NR_027654		Approved	HsT17432	uc002aqf.3	O43541	OTTHUMG00000133218	ENST00000288840.5:c.120C>T	15.37:g.66995716C>T		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	57	23	NM_005585	0	0	0	0	0	A9J6M5|O43654|Q15799|Q7Z7L4|Q96E31|Q9UKZ3	Silent	SNP	ENST00000288840.5	37	CCDS10221.1																																																																																			A|0.008;C|0.992		0.776	SMAD6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256953.2	NM_005585	
PTPN9	5780	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	15	75782617	75782617	+	Missense_Mutation	SNP	G	G	C			TCGA-OR-A5LO-01A-11D-A29I-10	TCGA-OR-A5LO-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	89d60dde-b03a-4cb7-b32a-5d06fa328603	4a5886aa-889d-4ef2-89a9-be2f7a06bd58	g.chr15:75782617G>C	ENST00000306726.2	-	8	1506	c.994C>G	c.(994-996)Cgt>Ggt	p.R332G	PTPN9_ENST00000564970.1_5'UTR	NM_002833.2	NP_002824.1	P43378	PTN9_HUMAN	protein tyrosine phosphatase, non-receptor type 9	332	Tyrosine-protein phosphatase. {ECO:0000255|PROSITE-ProRule:PRU00160}.				peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)	cytoplasm (GO:0005737)	non-membrane spanning protein tyrosine phosphatase activity (GO:0004726)|protein tyrosine phosphatase activity (GO:0004725)			central_nervous_system(1)|endometrium(4)|large_intestine(4)|lung(9)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	22						TCCCCATAACGGTTTTTCTCT	0.418																																					p.R332G		.											.	PTPN9-226	0			c.C994G						.						158.0	141.0	147.0					15																	75782617		2197	4294	6491	SO:0001583	missense	5780	exon8			CATAACGGTTTTT		CCDS10280.1	15q23	2011-06-09			ENSG00000169410	ENSG00000169410		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Non-receptor"""	9661	protein-coding gene	gene with protein product		600768				1557404	Standard	NM_002833		Approved	MEG2	uc002bal.3	P43378	OTTHUMG00000142838	ENST00000306726.2:c.994C>G	15.37:g.75782617G>C	ENSP00000303554:p.Arg332Gly	Somatic	121	0		WXS	Illumina GAIIx	Phase_I	110	54	NM_002833	0	0	7	14	7	Q53XR9	Missense_Mutation	SNP	ENST00000306726.2	37	CCDS10280.1	.	.	.	.	.	.	.	.	.	.	g	20.3	3.968450	0.74131	.	.	ENSG00000169410	ENST00000306726;ENST00000544966	D	0.90844	-2.74	5.6	3.55	0.40652	Protein-tyrosine phosphatase, receptor/non-receptor type (3);	0.000000	0.85682	D	0.000000	D	0.96642	0.8904	H	0.97415	4	0.49389	D	0.999785	D	0.89917	1.0	D	0.79784	0.993	D	0.96937	0.9685	10	0.87932	D	0	.	11.4621	0.50217	0.0:0.0:0.6626:0.3374	.	332	P43378	PTN9_HUMAN	G	332;322	ENSP00000303554:R332G	ENSP00000303554:R332G	R	-	1	0	PTPN9	73569672	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	2.744000	0.47450	1.304000	0.44892	0.651000	0.88453	CGT	.		0.418	PTPN9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000286474.1		
PKD1	5310	hgsc.bcm.edu	37	16	2140912	2140912	+	Silent	SNP	G	G	C	rs112387277	byFrequency	TCGA-OR-A5LO-01A-11D-A29I-10	TCGA-OR-A5LO-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	89d60dde-b03a-4cb7-b32a-5d06fa328603	4a5886aa-889d-4ef2-89a9-be2f7a06bd58	g.chr16:2140912G>C	ENST00000262304.4	-	43	12184	c.11976C>G	c.(11974-11976)gcC>gcG	p.A3992A	RP11-304L19.1_ENST00000570072.1_RNA|MIR1225_ENST00000408729.1_RNA|PKD1_ENST00000423118.1_Silent_p.A3991A	NM_001009944.2	NP_001009944	P98161	PKD1_HUMAN	polycystic kidney disease 1 (autosomal dominant)	3992					anatomical structure morphogenesis (GO:0009653)|branching morphogenesis of an epithelial tube (GO:0048754)|calcium ion transmembrane transport (GO:0070588)|calcium-independent cell-matrix adhesion (GO:0007161)|cartilage condensation (GO:0001502)|cartilage development (GO:0051216)|cation transmembrane transport (GO:0098655)|cell cycle arrest (GO:0007050)|cell-matrix adhesion (GO:0007160)|cytoplasmic sequestering of transcription factor (GO:0042994)|detection of mechanical stimulus (GO:0050982)|digestive tract development (GO:0048565)|embryonic placenta development (GO:0001892)|genitalia development (GO:0048806)|heart development (GO:0007507)|homophilic cell adhesion (GO:0007156)|in utero embryonic development (GO:0001701)|JAK-STAT cascade (GO:0007259)|kidney development (GO:0001822)|liver development (GO:0001889)|lung epithelium development (GO:0060428)|mesonephric duct development (GO:0072177)|mesonephric tubule development (GO:0072164)|metanephric ascending thin limb development (GO:0072218)|metanephric collecting duct development (GO:0072205)|metanephric distal tubule morphogenesis (GO:0072287)|metanephric proximal tubule development (GO:0072237)|neural tube development (GO:0021915)|neuropeptide signaling pathway (GO:0007218)|nitrogen compound metabolic process (GO:0006807)|peptidyl-serine phosphorylation (GO:0018105)|placenta blood vessel development (GO:0060674)|positive regulation of cyclin-dependent protein serine/threonine kinase activity involved in G1/S transition of mitotic cell cycle (GO:0031659)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of protein binding (GO:0032092)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein export from nucleus (GO:0006611)|regulation of mitotic spindle organization (GO:0060236)|regulation of proteasomal protein catabolic process (GO:0061136)|response to fluid shear stress (GO:0034405)|skin development (GO:0043588)|spinal cord development (GO:0021510)	basolateral plasma membrane (GO:0016323)|cilium (GO:0005929)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|lateral plasma membrane (GO:0016328)|motile primary cilium (GO:0031512)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|polycystin complex (GO:0002133)	calcium channel activity (GO:0005262)|carbohydrate binding (GO:0030246)|cation channel activity (GO:0005261)|ion channel binding (GO:0044325)|protein domain specific binding (GO:0019904)|protein kinase binding (GO:0019901)			breast(1)|central_nervous_system(3)|cervix(1)|endometrium(7)|kidney(6)|lung(34)|prostate(4)|skin(10)|upper_aerodigestive_tract(3)|urinary_tract(3)	72						AGAGCAGCGAGGCCGCCAGGC	0.706													g|||	4	0.000798722	0.0	0.0014	5008	,	,		10868	0.0		0.003	False		,,,				2504	0.0				p.A3992A		.											.	PKD1-91	0			c.C11976G						.		,	1,4287		0,1,2143	9.0	11.0	10.0		11973,11976	-2.0	0.8	16	dbSNP_132	10	29,8457		0,29,4214	no	coding-synonymous,coding-synonymous	PKD1	NM_000296.3,NM_001009944.2	,	0,30,6357	CC,CG,GG		0.3417,0.0233,0.2349	,	3991/4303,3992/4304	2140912	30,12744	2144	4243	6387	SO:0001819	synonymous_variant	5310	exon43			CAGCGAGGCCGCC	L33243	CCDS32369.1, CCDS45385.1	16p13.3	2014-01-28			ENSG00000008710	ENSG00000008710		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	9008	protein-coding gene	gene with protein product	"""polycystin 1"", ""transient receptor potential cation channel, subfamily P, member 1"""	601313					Standard	NM_001009944		Approved	PBP, Pc-1, TRPP1	uc002cos.1	P98161	OTTHUMG00000155795	ENST00000262304.4:c.11976C>G	16.37:g.2140912G>C		Somatic	2	0		WXS	Illumina GAIIx	Phase_I	23	22	NM_001009944	0	0	0	10	10	Q15140|Q15141	Silent	SNP	ENST00000262304.4	37	CCDS32369.1																																																																																			G|0.999;C|0.001		0.706	PKD1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000341688.1		
FLYWCH2	114984	ucsc.edu;bcgsc.ca	37	16	2946453	2946453	+	Start_Codon_SNP	SNP	G	G	T			TCGA-OR-A5LO-01A-11D-A29I-10	TCGA-OR-A5LO-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	89d60dde-b03a-4cb7-b32a-5d06fa328603	4a5886aa-889d-4ef2-89a9-be2f7a06bd58	g.chr16:2946453G>T	ENST00000396958.3	+	3	383	c.3G>T	c.(1-3)atG>atT	p.M1I	FLYWCH2_ENST00000293981.6_Start_Codon_SNP_p.M1I|FLYWCH2_ENST00000572006.1_Start_Codon_SNP_p.M1I	NM_001142500.1|NM_138439.2	NP_001135972.1|NP_612448.1	Q96CP2	FWCH2_HUMAN	FLYWCH family member 2	1							poly(A) RNA binding (GO:0044822)			central_nervous_system(1)|lung(3)|ovary(1)|skin(1)	6						GTCCCGGGATGCCCCTGCCCG	0.672																																					p.M1I		.											.	FLYWCH2-22	0			c.G3T						.						26.0	33.0	30.0					16																	2946453		2195	4298	6493	SO:0001582	initiator_codon_variant	114984	exon3			CGGGATGCCCCTG	BC014089	CCDS10482.1	16p13.3	2014-02-12	2007-06-21		ENSG00000162076	ENSG00000162076			25178	protein-coding gene	gene with protein product						12477932	Standard	NM_138439		Approved		uc010uwk.2	Q96CP2	OTTHUMG00000128962	ENST00000396958.3:c.3G>T	16.37:g.2946453G>T	ENSP00000380159:p.Met1Ile	Somatic	45	0		WXS	Illumina GAIIx	Phase_I	38	4	NM_001142499	0	0	300	300	0		Missense_Mutation	SNP	ENST00000396958.3	37	CCDS10482.1	.	.	.	.	.	.	.	.	.	.	G	12.82	2.052538	0.36181	.	.	ENSG00000162076	ENST00000396958;ENST00000293981	.	.	.	3.6	2.65	0.31530	.	0.000000	0.42548	D	0.000693	T	0.60117	0.2244	.	.	.	0.80722	D	1	P	0.39044	0.656	P	0.48627	0.584	T	0.62129	-0.6919	8	0.87932	D	0	.	6.8766	0.24151	0.1268:0.0:0.8732:0.0	.	1	Q96CP2	FWCH2_HUMAN	I	1	.	ENSP00000293981:M1I	M	+	3	0	FLYWCH2	2886454	0.999000	0.42202	0.997000	0.53966	0.517000	0.34286	2.628000	0.46477	1.106000	0.41623	0.407000	0.27541	ATG	.		0.672	FLYWCH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250944.1	NM_138439	Missense_Mutation
BFAR	51283	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	16	14761544	14761544	+	Missense_Mutation	SNP	C	C	A			TCGA-OR-A5LO-01A-11D-A29I-10	TCGA-OR-A5LO-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	89d60dde-b03a-4cb7-b32a-5d06fa328603	4a5886aa-889d-4ef2-89a9-be2f7a06bd58	g.chr16:14761544C>A	ENST00000261658.2	+	8	1490	c.1213C>A	c.(1213-1215)Ctt>Att	p.L405I	BFAR_ENST00000426842.2_Missense_Mutation_p.L277I|BFAR_ENST00000563971.1_Missense_Mutation_p.L280I|BFAR_ENST00000563082.1_3'UTR	NM_016561.2	NP_057645.1	Q9NZS9	BFAR_HUMAN	bifunctional apoptosis regulator	405					apoptotic process (GO:0006915)|negative regulation of apoptotic process (GO:0043066)	endoplasmic reticulum (GO:0005783)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)	structural molecule activity (GO:0005198)|zinc ion binding (GO:0008270)			endometrium(4)|kidney(1)|large_intestine(2)|lung(1)|ovary(2)|skin(1)	11						AACGCAGGGGCTTTTTGTGGC	0.473																																					p.L405I		.											.	BFAR-92	0			c.C1213A						.						145.0	141.0	142.0					16																	14761544		2197	4300	6497	SO:0001583	missense	51283	exon8			CAGGGGCTTTTTG	AF173003	CCDS10554.1	16p13.2	2013-01-10			ENSG00000103429	ENSG00000103429		"""RING-type (C3HC4) zinc fingers"", ""Sterile alpha motif (SAM) domain containing"""	17613	protein-coding gene	gene with protein product						10716992	Standard	NM_016561		Approved	BAR, RNF47	uc002dco.3	Q9NZS9	OTTHUMG00000129848	ENST00000261658.2:c.1213C>A	16.37:g.14761544C>A	ENSP00000261658:p.Leu405Ile	Somatic	85	0		WXS	Illumina GAIIx	Phase_I	92	41	NM_016561	0	0	24	37	13	A8K4Z9|B4DUT0|D3DUG8	Missense_Mutation	SNP	ENST00000261658.2	37	CCDS10554.1	.	.	.	.	.	.	.	.	.	.	C	14.32	2.500000	0.44455	.	.	ENSG00000103429	ENST00000261658;ENST00000426842	T;T	0.54071	2.94;0.59	5.69	5.69	0.88448	.	0.123452	0.56097	D	0.000030	T	0.34978	0.0916	N	0.12182	0.205	0.37461	D	0.915217	B;B;B	0.15141	0.002;0.012;0.012	B;B;B	0.11329	0.001;0.006;0.006	T	0.26224	-1.0109	10	0.29301	T	0.29	.	13.7201	0.62720	0.1539:0.8461:0.0:0.0	.	277;405;405	B4DUT0;B2R9R6;Q9NZS9	.;.;BFAR_HUMAN	I	405;277	ENSP00000261658:L405I;ENSP00000400634:L277I	ENSP00000261658:L405I	L	+	1	0	BFAR	14669045	0.993000	0.37304	0.996000	0.52242	0.989000	0.77384	2.864000	0.48404	2.673000	0.90976	0.563000	0.77884	CTT	.		0.473	BFAR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252088.1	NM_016561	
TOX3	27324	broad.mit.edu	37	16	52473370	52473370	+	Missense_Mutation	SNP	G	G	C			TCGA-OR-A5LO-01A-11D-A29I-10	TCGA-OR-A5LO-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	89d60dde-b03a-4cb7-b32a-5d06fa328603	4a5886aa-889d-4ef2-89a9-be2f7a06bd58	g.chr16:52473370G>C	ENST00000219746.9	-	7	1782	c.1498C>G	c.(1498-1500)Caa>Gaa	p.Q500E	TOX3_ENST00000407228.3_Missense_Mutation_p.Q495E	NM_001080430.2	NP_001073899.2	O15405	TOX3_HUMAN	TOX high mobility group box family member 3	500	Gln-rich.				apoptotic process (GO:0006915)|negative regulation of neuron apoptotic process (GO:0043524)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|estrogen response element binding (GO:0034056)|phosphoprotein binding (GO:0051219)|protein homodimerization activity (GO:0042803)			NS(2)|endometrium(6)|kidney(1)|lung(8)|prostate(3)|stomach(3)|upper_aerodigestive_tract(1)	24						tgattaatttgctgctggaga	0.577																																					p.Q500E		.											.	TOX3-68	0			c.C1498G						.						15.0	14.0	14.0					16																	52473370		2095	4151	6246	SO:0001583	missense	27324	exon7			TAATTTGCTGCTG	U80736	CCDS54008.1, CCDS54009.1	16q12.1	2008-02-05	2007-03-20	2007-03-20		ENSG00000103460		"""Trinucleotide (CAG) repeat containing"""	11972	protein-coding gene	gene with protein product		611416	"""trinucleotide repeat containing 9"""	TNRC9		9225980	Standard	NM_001080430		Approved	CAGF9	uc002egw.2	O15405		ENST00000219746.9:c.1498C>G	16.37:g.52473370G>C	ENSP00000219746:p.Gln500Glu	Somatic	23	0		WXS	Illumina GAIIx	Phase_I	17	3	NM_001080430	0	0	0	0	0	B4DRD0|B5MCW4	Missense_Mutation	SNP	ENST00000219746.9	37	CCDS54009.1	.	.	.	.	.	.	.	.	.	.	G	12.33	1.906825	0.33628	.	.	ENSG00000103460	ENST00000219746;ENST00000407228	T;T	0.11495	3.05;2.77	5.66	5.66	0.87406	.	0.246720	0.34046	N	0.004302	T	0.10337	0.0253	N	0.24115	0.695	0.58432	D	0.999998	B;B	0.24483	0.104;0.044	B;B	0.21708	0.036;0.036	T	0.17806	-1.0357	10	0.37606	T	0.19	.	19.3629	0.94448	0.0:0.0:1.0:0.0	.	495;500	B4DRD0;O15405	.;TOX3_HUMAN	E	500;495	ENSP00000219746:Q500E;ENSP00000385705:Q495E	ENSP00000219746:Q500E	Q	-	1	0	TOX3	51030871	1.000000	0.71417	0.997000	0.53966	0.634000	0.38068	9.032000	0.93736	2.666000	0.90696	0.563000	0.77884	CAA	.		0.577	TOX3-003	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000422534.1	XM_049037	
IRX3	79191	hgsc.bcm.edu	37	16	54318528	54318528	+	Missense_Mutation	SNP	A	A	G	rs1450355	byFrequency	TCGA-OR-A5LO-01A-11D-A29I-10	TCGA-OR-A5LO-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	89d60dde-b03a-4cb7-b32a-5d06fa328603	4a5886aa-889d-4ef2-89a9-be2f7a06bd58	g.chr16:54318528A>G	ENST00000329734.3	-	2	1977	c.1265T>C	c.(1264-1266)cTg>cCg	p.L422P		NM_024336.2	NP_077312.2	P78415	IRX3_HUMAN	iroquois homeobox 3	422	Pro-rich.		L -> P (in dbSNP:rs1450355). {ECO:0000269|PubMed:15489334}.		mesoderm development (GO:0007498)|metanephros development (GO:0001656)|negative regulation of neuron differentiation (GO:0045665)|positive regulation of neuron differentiation (GO:0045666)|regulation of transcription, DNA-templated (GO:0006355)|specification of loop of Henle identity (GO:0072086)|transcription, DNA-templated (GO:0006351)	axon (GO:0030424)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)			endometrium(2)|kidney(1)|large_intestine(5)|lung(3)|ovary(1)|soft_tissue(1)|urinary_tract(1)	14						GAGCGGGTGCAGGCGGGGGCC	0.776													g|||	4851	0.96865	0.888	0.987	5008	,	,		8017	1.0		1.0	False		,,,				2504	1.0				p.L422P	GBM(143;1830 1866 4487 4646 37383)	.											.	IRX3-90	0			c.T1265C						.	T	PRO/LEU	1678,102		788,102,0	1.0	2.0	2.0		1265	2.5	1.0	16	dbSNP_88	2	4195,3		2096,3,0	no	missense	IRX3	NM_024336.2	98	2884,105,0	GG,GA,AA		0.0715,5.7303,1.7564	benign	422/502	54318528	5873,105	890	2099	2989	SO:0001583	missense	79191	exon2			GGGTGCAGGCGGG	U90308	CCDS10750.1	16q12.2	2011-06-20	2007-07-13		ENSG00000177508	ENSG00000177508		"""Homeoboxes / TALE class"""	14360	protein-coding gene	gene with protein product		612985					Standard	NM_024336		Approved	IRX-1	uc002eht.1	P78415	OTTHUMG00000133200	ENST00000329734.3:c.1265T>C	16.37:g.54318528A>G	ENSP00000331608:p.Leu422Pro	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	6	6	NM_024336	0	0	0	0	0	Q7Z4A4|Q7Z4A5|Q8IVC6	Missense_Mutation	SNP	ENST00000329734.3	37	CCDS10750.1	2108	0.9652014652014652	433	0.8800813008130082	354	0.9779005524861878	567	0.9912587412587412	754	0.9947229551451188	g	5.642	0.303067	0.10678	0.942697	0.999285	ENSG00000177508	ENST00000329734	T	0.54279	0.58	4.4	2.45	0.29901	.	0.652897	0.14990	N	0.286760	T	0.00012	0.0000	N	0.01352	-0.895	0.29914	P	0.82336	B	0.02656	0.0	B	0.01281	0.0	T	0.21861	-1.0233	9	0.33940	T	0.23	-4.0049	5.143	0.14969	0.1733:0.0:0.6627:0.164	rs1450355;rs17852160;rs60836119	422	P78415	IRX3_HUMAN	P	422	ENSP00000331608:L422P	ENSP00000331608:L422P	L	-	2	0	IRX3	52876029	1.000000	0.71417	0.984000	0.44739	0.000000	0.00434	1.455000	0.35190	0.155000	0.19261	-1.528000	0.00924	CTG	T|0.035;G|0.004		0.776	IRX3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256910.2		
CNOT1	23019	broad.mit.edu	37	16	58577421	58577421	+	Intron	SNP	C	C	T	rs41260	byFrequency	TCGA-OR-A5LO-01A-11D-A29I-10	TCGA-OR-A5LO-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	89d60dde-b03a-4cb7-b32a-5d06fa328603	4a5886aa-889d-4ef2-89a9-be2f7a06bd58	g.chr16:58577421C>T	ENST00000317147.5	-	31	4767				CNOT1_ENST00000245138.4_Intron|CNOT1_ENST00000441024.2_Silent_p.A1508A|CNOT1_ENST00000569240.1_Intron	NM_001265612.1|NM_016284.4	NP_001252541.1|NP_057368.3	A5YKK6	CNOT1_HUMAN	CCR4-NOT transcription complex, subunit 1						gene expression (GO:0010467)|gene silencing by RNA (GO:0031047)|mRNA metabolic process (GO:0016071)|negative regulation of intracellular estrogen receptor signaling pathway (GO:0033147)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|positive regulation of cytoplasmic mRNA processing body assembly (GO:0010606)|positive regulation of nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:1900153)|positive regulation of nuclear-transcribed mRNA poly(A) tail shortening (GO:0060213)|regulation of stem cell maintenance (GO:2000036)|regulation of translation (GO:0006417)|RNA metabolic process (GO:0016070)|RNA phosphodiester bond hydrolysis, exonucleolytic (GO:0090503)|transcription, DNA-templated (GO:0006351)|trophectodermal cell differentiation (GO:0001829)	CCR4-NOT complex (GO:0030014)|cytoplasmic mRNA processing body (GO:0000932)|cytosol (GO:0005829)|extracellular space (GO:0005615)|membrane (GO:0016020)|nucleus (GO:0005634)|peroxisomal membrane (GO:0005778)	estrogen receptor binding (GO:0030331)|poly(A) RNA binding (GO:0044822)|retinoic acid receptor binding (GO:0042974)			breast(1)|central_nervous_system(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(4)|kidney(7)|large_intestine(24)|lung(25)|ovary(4)|prostate(6)|skin(3)|upper_aerodigestive_tract(2)	87				Kidney(780;0.0722)|OV - Ovarian serous cystadenocarcinoma(108;0.173)|Epithelial(162;0.239)		taagtggtaacgcccagtgcc	0.343													T|||	4038	0.80631	0.9062	0.7392	5008	,	,		20105	0.9712		0.5726	False		,,,				2504	0.7894				p.A1508A		.											.	CNOT1-95	0			c.G4524A						.	T	,	2224,396		955,314,41	48.0	54.0	52.0		,4524	-6.4	0.0	16	dbSNP_76	52	2544,2074		737,1070,502	no	intron,coding-synonymous	CNOT1	NM_016284.3,NM_206999.1	,	1692,1384,543	TT,TC,CC		44.9112,15.1145,34.1254	,	,1508/1552	58577421	4768,2470	1310	2309	3619	SO:0001627	intron_variant	23019	exon31			TGGTAACGCCCAG	AL833549	CCDS10799.1, CCDS45501.1, CCDS58468.1	16q21	2008-02-05			ENSG00000125107	ENSG00000125107			7877	protein-coding gene	gene with protein product		604917		NOT1		14702039	Standard	NM_016284		Approved	CDC39, NOT1H, KIAA1007, AD-005	uc002env.4	A5YKK6	OTTHUMG00000133487	ENST00000317147.5:c.4434+89G>A	16.37:g.58577421C>T		Somatic	84	2		WXS	Illumina GAIIx	Phase_I	102	6	NM_206999	0	0	6	6	0	Q68DX7|Q7Z3K2|Q8IWB8|Q8TB53|Q9BVZ6|Q9UFR8|Q9UI27|Q9Y2L0	Silent	SNP	ENST00000317147.5	37	CCDS10799.1																																																																																			C|0.186;T|0.814		0.343	CNOT1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000257385.3	NM_016284	
CTRL	1506	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	16	67963838	67963838	+	Nonstop_Mutation	SNP	C	C	G			TCGA-OR-A5LO-01A-11D-A29I-10	TCGA-OR-A5LO-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	89d60dde-b03a-4cb7-b32a-5d06fa328603	4a5886aa-889d-4ef2-89a9-be2f7a06bd58	g.chr16:67963838C>G	ENST00000574481.1	-	7	1355	c.794G>C	c.(793-795)tGa>tCa	p.*265S	CTRL_ENST00000576408.1_5'Flank	NM_001907.2	NP_001898.1	P40313	CTRL_HUMAN	chymotrypsin-like	0					digestion (GO:0007586)|proteolysis (GO:0006508)	extracellular space (GO:0005615)	serine-type endopeptidase activity (GO:0004252)			kidney(1)|large_intestine(2)|urinary_tract(1)	4		Ovarian(137;0.192)		OV - Ovarian serous cystadenocarcinoma(108;0.00412)|Epithelial(162;0.018)|all cancers(182;0.118)		GTGGTGAGCTCAGTTGTAGGC	0.542																																					p.X265S		.											.	CTRL-90	0			c.G794C						.						142.0	131.0	135.0					16																	67963838		2198	4300	6498	SO:0001578	stop_lost	1506	exon7			TGAGCTCAGTTGT		CCDS10852.1	16q22.1	2008-02-05			ENSG00000141086	ENSG00000141086			2524	protein-coding gene	gene with protein product		118888				8268911	Standard	NM_001907		Approved		uc002euw.3	P40313	OTTHUMG00000137552	ENST00000574481.1:c.794G>C	16.37:g.67963838C>G		Somatic	54	0		WXS	Illumina GAIIx	Phase_I	82	19	NM_001907	0	0	0	2	2		Missense_Mutation	SNP	ENST00000574481.1	37	CCDS10852.1	.	.	.	.	.	.	.	.	.	.	C	14.78	2.638761	0.47153	.	.	ENSG00000141086	ENST00000319955	.	.	.	5.74	-0.425	0.12317	.	.	.	.	.	.	.	.	.	.	.	0.09310	N	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	6.5296	0.22320	0.1162:0.521:0.0:0.3628	.	.	.	.	S	265	.	.	X	-	2	2	CTRL	66521339	0.424000	0.25490	0.208000	0.23602	0.916000	0.54674	-0.037000	0.12164	0.058000	0.16222	0.491000	0.48974	TGA	.		0.542	CTRL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268886.3		
FUK	197258	broad.mit.edu	37	16	70507049	70507049	+	Missense_Mutation	SNP	G	G	T	rs550917987	byFrequency	TCGA-OR-A5LO-01A-11D-A29I-10	TCGA-OR-A5LO-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	89d60dde-b03a-4cb7-b32a-5d06fa328603	4a5886aa-889d-4ef2-89a9-be2f7a06bd58	g.chr16:70507049G>T	ENST00000288078.6	+	15	1802	c.1570G>T	c.(1570-1572)Gcc>Tcc	p.A524S	FUK_ENST00000378912.2_Missense_Mutation_p.A556S|FUK_ENST00000571514.1_Missense_Mutation_p.A17S	NM_145059.2	NP_659496.2	Q8N0W3	FUK_HUMAN	fucokinase	524						cytoplasm (GO:0005737)	ATP binding (GO:0005524)|fucokinase activity (GO:0050201)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(11)|ovary(2)|prostate(2)	23		Ovarian(137;0.0694)				AGCCTGGCGGGCCTCCTGGCG	0.701													G|||	10	0.00199681	0.0008	0.0	5008	,	,		13478	0.001		0.0	False		,,,				2504	0.0082				p.A524S		.											.	FUK-91	0			c.G1570T						.						5.0	7.0	7.0					16																	70507049		1868	4034	5902	SO:0001583	missense	197258	exon15			TGGCGGGCCTCCT		CCDS10891.2	16q22.1	2008-02-05			ENSG00000157353	ENSG00000157353	2.7.1.52		29500	protein-coding gene	gene with protein product	"""L-fucose kinase"""	608675				12056818	Standard	XM_006721161		Approved	FLJ39408	uc002eyy.3	Q8N0W3	OTTHUMG00000074085	ENST00000288078.6:c.1570G>T	16.37:g.70507049G>T	ENSP00000288078:p.Ala524Ser	Somatic	13	1		WXS	Illumina GAIIx	Phase_I	68	5	NM_145059	0	0	3	3	0	Q5PSM3|Q5XKL6|Q6ZRA0|Q96MT9	Missense_Mutation	SNP	ENST00000288078.6	37	CCDS10891.2	.	.	.	.	.	.	.	.	.	.	G	13.58	2.280454	0.40294	.	.	ENSG00000157353	ENST00000288078;ENST00000378912	T;T	0.06068	3.35;3.37	5.84	3.9	0.45041	.	0.430306	0.25642	N	0.029261	T	0.03520	0.0101	N	0.17872	0.535	0.80722	D	1	B;B;B	0.30406	0.016;0.038;0.278	B;B;B	0.24974	0.018;0.006;0.057	T	0.35226	-0.9797	10	0.06757	T	0.87	-9.6279	9.5691	0.39416	0.2717:0.0:0.7283:0.0	.	556;430;524	Q8N0W3-2;B2RDL5;Q8N0W3	.;.;FUK_HUMAN	S	524;556	ENSP00000288078:A524S;ENSP00000368192:A556S	ENSP00000288078:A524S	A	+	1	0	FUK	69064550	0.625000	0.27111	0.557000	0.28306	0.834000	0.47266	2.535000	0.45685	0.836000	0.34901	0.655000	0.94253	GCC	.		0.701	FUK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000157291.2	NM_145059	
MARVELD3	91862	broad.mit.edu	37	16	71660364	71660365	+	Frame_Shift_Del	DEL	GA	GA	-			TCGA-OR-A5LO-01A-11D-A29I-10	TCGA-OR-A5LO-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	89d60dde-b03a-4cb7-b32a-5d06fa328603	4a5886aa-889d-4ef2-89a9-be2f7a06bd58	g.chr16:71660364_71660365delGA	ENST00000268485.3	+	1	276_277	c.232_233delGA	c.(232-234)gagfs	p.E78fs	MARVELD3_ENST00000567501.1_5'Flank|MARVELD3_ENST00000565261.1_Frame_Shift_Del_p.E78fs|MARVELD3_ENST00000299952.4_Frame_Shift_Del_p.E78fs|MARVELD3_ENST00000567566.1_Frame_Shift_Del_p.E78fs|RP11-432I5.2_ENST00000562763.1_RNA	NM_052858.4	NP_443090.4	Q96A59	MALD3_HUMAN	MARVEL domain containing 3	78	Arg-rich.				cell-cell junction organization (GO:0045216)|tight junction assembly (GO:0070830)	cytoplasmic vesicle (GO:0031410)|integral component of membrane (GO:0016021)|tight junction (GO:0005923)				NS(1)|endometrium(3)|large_intestine(5)|lung(6)|skin(2)	17		Ovarian(137;0.125)				CCgggagagggagagagagagg	0.703																																					p.78_78del		.											.	MARVELD3-91	0			c.232_233del						.																																			SO:0001589	frameshift_variant	91862	exon1			GAGAGGGAGAGAG	BC013376	CCDS10904.1, CCDS32478.1, CCDS59270.1	16q22.2	2008-02-05	2004-07-12	2004-07-14	ENSG00000140832	ENSG00000140832			30525	protein-coding gene	gene with protein product		614094	"""MARVEL (membrane-associating) domain containing 3"""	MRVLDC3			Standard	NM_001017967		Approved		uc002fat.4	Q96A59	OTTHUMG00000137591	ENST00000268485.3:c.232_233delGA	16.37:g.71660372_71660373delGA	ENSP00000268485:p.Glu78fs	Somatic	93	0		WXS	Illumina GAIIx	Phase_I	228	9	NM_001017967	0	0	0	0	0	A8K820|H3BQM5|Q96MJ4	Frame_Shift_Del	DEL	ENST00000268485.3	37	CCDS10904.1																																																																																			.		0.703	MARVELD3-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000268991.2	NM_052858	
UNC45B	146862	broad.mit.edu	37	17	33475419	33475419	+	Missense_Mutation	SNP	A	A	T			TCGA-OR-A5LO-01A-11D-A29I-10	TCGA-OR-A5LO-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	89d60dde-b03a-4cb7-b32a-5d06fa328603	4a5886aa-889d-4ef2-89a9-be2f7a06bd58	g.chr17:33475419A>T	ENST00000268876.5	+	2	234	c.137A>T	c.(136-138)tAt>tTt	p.Y46F	UNC45B_ENST00000591048.1_Missense_Mutation_p.Y46F|UNC45B_ENST00000394570.2_Missense_Mutation_p.Y46F|UNC45B_ENST00000433649.1_Missense_Mutation_p.Y46F|UNC45B_ENST00000378449.1_Missense_Mutation_p.Y46F	NM_173167.2	NP_775259.1	Q8IWX7	UN45B_HUMAN	unc-45 homolog B (C. elegans)	46					cell differentiation (GO:0030154)|chaperone-mediated protein folding (GO:0061077)|muscle organ development (GO:0007517)	cytoplasm (GO:0005737)|cytosol (GO:0005829)				breast(1)|central_nervous_system(2)|endometrium(7)|kidney(5)|large_intestine(10)|lung(24)|ovary(3)|prostate(2)|skin(1)|stomach(1)|urinary_tract(3)	59		Ovarian(249;0.17)				GCCACGCTTTATCGGAACCGG	0.632																																					p.Y46F		.											.	UNC45B-157	0			c.A137T						.						59.0	55.0	57.0					17																	33475419		2203	4300	6503	SO:0001583	missense	146862	exon2			CGCTTTATCGGAA	AW755253	CCDS11292.1, CCDS45648.1	17q12	2008-02-05	2005-11-17	2005-11-17	ENSG00000141161	ENSG00000141161			14304	protein-coding gene	gene with protein product		611220	"""cardiomyopathy associated 4"""	CMYA4		12356907	Standard	NM_001267052		Approved	UNC45	uc002hja.3	Q8IWX7	OTTHUMG00000132931	ENST00000268876.5:c.137A>T	17.37:g.33475419A>T	ENSP00000268876:p.Tyr46Phe	Somatic	141	1		WXS	Illumina GAIIx	Phase_I	86	3	NM_001267052	0	0	0	0	0	Q495Q8|Q495Q9	Missense_Mutation	SNP	ENST00000268876.5	37	CCDS11292.1	.	.	.	.	.	.	.	.	.	.	A	23.1	4.373644	0.82573	.	.	ENSG00000141161	ENST00000394570;ENST00000268876;ENST00000433649;ENST00000378449	T;T;T;T	0.64260	-0.09;-0.09;-0.09;-0.09	4.81	4.81	0.61882	Elongated TPR repeat-containing domain (1);Tetratricopeptide repeat-containing (1);	0.414726	0.29266	N	0.012644	T	0.67720	0.2923	L	0.31664	0.95	0.80722	D	1	B;P;D	0.54047	0.383;0.923;0.964	B;P;D	0.65773	0.237;0.718;0.938	T	0.71115	-0.4686	10	0.66056	D	0.02	-12.764	13.7027	0.62620	1.0:0.0:0.0:0.0	.	46;46;46	Q8IWX7-2;Q8IWX7-3;Q8IWX7	.;.;UN45B_HUMAN	F	46	ENSP00000378071:Y46F;ENSP00000268876:Y46F;ENSP00000412840:Y46F;ENSP00000367710:Y46F	ENSP00000268876:Y46F	Y	+	2	0	UNC45B	30499532	1.000000	0.71417	0.952000	0.39060	0.862000	0.49288	5.756000	0.68757	2.026000	0.59711	0.460000	0.39030	TAT	.		0.632	UNC45B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256458.2	NM_173167	
MED1	5469	bcgsc.ca	37	17	37580917	37580917	+	Missense_Mutation	SNP	G	G	T			TCGA-OR-A5LO-01A-11D-A29I-10	TCGA-OR-A5LO-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	89d60dde-b03a-4cb7-b32a-5d06fa328603	4a5886aa-889d-4ef2-89a9-be2f7a06bd58	g.chr17:37580917G>T	ENST00000394287.3	-	11	1019	c.814C>A	c.(814-816)Cca>Aca	p.P272T	MED1_ENST00000300651.6_Missense_Mutation_p.P272T			O95243	MBD4_HUMAN	mediator complex subunit 1	429					base-excision repair (GO:0006284)|base-excision repair, AP site formation (GO:0006285)|depyrimidination (GO:0045008)|DNA catabolic process, endonucleolytic (GO:0000737)|DNA repair (GO:0006281)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|mitotic G2 DNA damage checkpoint (GO:0007095)|response to radiation (GO:0009314)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	endodeoxyribonuclease activity (GO:0004520)|pyrimidine-specific mismatch base pair DNA N-glycosylase activity (GO:0008263)|satellite DNA binding (GO:0003696)			NS(1)|breast(2)|cervix(3)|kidney(3)|large_intestine(7)|lung(25)|ovary(2)|pancreas(1)|prostate(1)|skin(6)|upper_aerodigestive_tract(7)|urinary_tract(1)	59		Ovarian(249;1.78e-06)|Lung SC(565;0.0262)	Lung(15;0.0178)|LUAD - Lung adenocarcinoma(14;0.146)	UCEC - Uterine corpus endometrioid carcinoma (308;6.64e-05)|BRCA - Breast invasive adenocarcinoma(366;0.00136)|READ - Rectum adenocarcinoma(1115;0.0649)		ATAATTAATGGTGCAATTGGG	0.368										HNSCC(31;0.082)																											p.P272T	Pancreas(21;279 768 2492 4877 24026)	.											.	MED1-620	0			c.C814A						.						156.0	147.0	150.0					17																	37580917		2203	4300	6503	SO:0001583	missense	5469	exon11			TTAATGGTGCAAT	L40366	CCDS11336.1	17q12	2007-07-30	2007-07-30	2007-07-30	ENSG00000125686	ENSG00000125686			9234	protein-coding gene	gene with protein product		604311	"""PPAR binding protein"""	TRIP2, PPARGBP, PPARBP		9325263, 10485914	Standard	NM_004774		Approved	PBP, TRAP220, RB18A, DRIP230, CRSP200, CRSP1	uc002hrv.4	Q15648	OTTHUMG00000133216	ENST00000394287.3:c.814C>A	17.37:g.37580917G>T	ENSP00000377828:p.Pro272Thr	Somatic	149	0		WXS	Illumina GAIIx	Phase_I	56	4	NM_004774	0	0	1	1	0	B4DZN2|D3DNC3|D3DNC4|E9PEE4|Q2MD36|Q7Z4T3|Q96F09	Missense_Mutation	SNP	ENST00000394287.3	37		.	.	.	.	.	.	.	.	.	.	G	25.8	4.678439	0.88542	.	.	ENSG00000125686	ENST00000394287;ENST00000300651	T	0.47528	0.84	5.46	5.46	0.80206	Mediator complex, subunit Med1, metazoa/fungi (1);	.	.	.	.	T	0.67804	0.2932	M	0.65498	2.005	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	T	0.64011	-0.6507	9	0.33141	T	0.24	-6.463	18.8995	0.92437	0.0:0.0:1.0:0.0	.	272;272	Q15648;Q15648-3	MED1_HUMAN;.	T	272	ENSP00000300651:P272T	ENSP00000300651:P272T	P	-	1	0	MED1	34834443	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	9.118000	0.94355	2.571000	0.86741	0.561000	0.74099	CCA	.		0.368	MED1-002	PUTATIVE	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000256944.1	NM_004774	
KRTAP4-4	84616	bcgsc.ca	37	17	39316482	39316482	+	Missense_Mutation	SNP	C	C	G	rs366700	byFrequency	TCGA-OR-A5LO-01A-11D-A29I-10	TCGA-OR-A5LO-10A-01D-A29L-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	89d60dde-b03a-4cb7-b32a-5d06fa328603	4a5886aa-889d-4ef2-89a9-be2f7a06bd58	g.chr17:39316482C>G	ENST00000390661.3	-	1	501	c.462G>C	c.(460-462)agG>agC	p.R154S		NM_032524.1	NP_115913.1	Q9BYR3	KRA44_HUMAN	keratin associated protein 4-4	154	26 X 5 AA repeats of C-C-[GRQVCH]-[SPT]- [VSTQR].		R -> S (in dbSNP:rs366700).			keratin filament (GO:0045095)				kidney(1)|large_intestine(1)|lung(5)	7		Breast(137;0.000496)	STAD - Stomach adenocarcinoma(17;0.000449)			GCCTGTAGCACCTGGACACAC	0.617													c|||	523	0.104433	0.379	0.0288	5008	,	,		20637	0.0		0.002	False		,,,				2504	0.0				p.R154S		.											.	KRTAP4-4-44	0			c.G462C						.	G	SER/ARG	1375,3019		224,927,1046	39.0	46.0	44.0		462	1.5	1.0	17	dbSNP_80	44	7,8585		0,7,4289	yes	missense	KRTAP4-4	NM_032524.1	110	224,934,5335	GG,GC,CC		0.0815,31.2927,10.6422	benign	154/167	39316482	1382,11604	2197	4296	6493	SO:0001583	missense	84616	exon1			GTAGCACCTGGAC	AJ406936	CCDS11383.1	17q21.2	2013-06-25			ENSG00000171396	ENSG00000171396		"""Keratin associated proteins"""	16928	protein-coding gene	gene with protein product			"""keratin associated protein 4-13"""	KRTAP4-13		11279113	Standard	NM_032524		Approved	KAP4.4, KAP4.13	uc002hwc.3	Q9BYR3	OTTHUMG00000133428	ENST00000390661.3:c.462G>C	17.37:g.39316482C>G	ENSP00000375076:p.Arg154Ser	Somatic	274	2		WXS	Illumina GAIIx	Phase_I	116	6	NM_032524	0	0	0	0	0	Q9BYU7	Missense_Mutation	SNP	ENST00000390661.3	37	CCDS11383.1	190	0.08699633699633699	179	0.3638211382113821	11	0.03038674033149171	0	0.0	0	0.0	.	2.548	-0.304815	0.05495	0.312927	8.15E-4	ENSG00000171396	ENST00000390661	T	0.00571	6.5	4.79	1.5	0.22942	.	0.286046	0.18063	U	0.152889	T	0.00012	0.0000	N	0.00159	-1.955	0.54753	P	1.8999999999991246E-5	B	0.02656	0.0	B	0.04013	0.001	T	0.03068	-1.1076	9	0.19147	T	0.46	.	4.8968	0.13755	0.2534:0.289:0.4576:0.0	rs366700;rs52806510;rs366700	154	Q9BYR3	KRA44_HUMAN	S	154	ENSP00000375076:R154S	ENSP00000375076:R154S	R	-	3	2	KRTAP4-4	36570008	0.000000	0.05858	0.990000	0.47175	0.502000	0.33828	-0.971000	0.03806	0.113000	0.18004	-0.335000	0.08231	AGG	C|0.485;G|0.515		0.617	KRTAP4-4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257291.1		
KRTAP4-3	85290	ucsc.edu;bcgsc.ca	37	17	39324333	39324333	+	Missense_Mutation	SNP	T	T	A	rs12953139	byFrequency	TCGA-OR-A5LO-01A-11D-A29I-10	TCGA-OR-A5LO-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	89d60dde-b03a-4cb7-b32a-5d06fa328603	4a5886aa-889d-4ef2-89a9-be2f7a06bd58	g.chr17:39324333T>A	ENST00000391356.2	-	1	91	c.92A>T	c.(91-93)cAg>cTg	p.Q31L		NM_033187.1	NP_149443.1	Q9BYR4	KRA43_HUMAN	keratin associated protein 4-3	31					aging (GO:0007568)|hair cycle (GO:0042633)	keratin filament (GO:0045095)				breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(2)|upper_aerodigestive_tract(1)	12		Breast(137;0.000496)	STAD - Stomach adenocarcinoma(17;0.000449)			GCAGGTGGTCTGGCAGCAGCT	0.637																																					p.Q31L		.											.	KRTAP4-3-22	0			c.A92T						.						29.0	32.0	31.0					17																	39324333		2195	4293	6488	SO:0001583	missense	85290	exon1			GTGGTCTGGCAGC	AJ406935	CCDS42331.1	17q21.2	2013-06-25			ENSG00000196156	ENSG00000196156		"""Keratin associated proteins"""	18908	protein-coding gene	gene with protein product							Standard	NM_033187		Approved	KAP4.3	uc010cxl.3	Q9BYR4	OTTHUMG00000133639	ENST00000391356.2:c.92A>T	17.37:g.39324333T>A	ENSP00000375151:p.Gln31Leu	Somatic	159	0		WXS	Illumina GAIIx	Phase_I	109	36	NM_033187	0	0	0	0	0		Missense_Mutation	SNP	ENST00000391356.2	37	CCDS42331.1	.	.	.	.	.	.	.	.	.	.	.	8.661	0.900435	0.17686	.	.	ENSG00000196156	ENST00000391356	T	0.01629	4.72	5.15	0.112	0.14623	.	.	.	.	.	T	0.03608	0.0103	M	0.85373	2.75	0.80722	P	0.0	B	0.34181	0.44	B	0.38378	0.272	T	0.11131	-1.0600	8	0.35671	T	0.21	.	3.821	0.08836	0.1588:0.2591:0.0:0.5822	.	31	Q9BYR4	KRA43_HUMAN	L	31	ENSP00000375151:Q31L	ENSP00000375151:Q31L	Q	-	2	0	KRTAP4-3	36577859	0.006000	0.16342	0.208000	0.23602	0.204000	0.24138	0.129000	0.15830	0.020000	0.15106	0.533000	0.62120	CAG	A|0.046;T|0.954		0.637	KRTAP4-3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257784.1		
ASB16	92591	hgsc.bcm.edu	37	17	42254281	42254281	+	Missense_Mutation	SNP	A	A	G	rs7212573	byFrequency	TCGA-OR-A5LO-01A-11D-A29I-10	TCGA-OR-A5LO-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	89d60dde-b03a-4cb7-b32a-5d06fa328603	4a5886aa-889d-4ef2-89a9-be2f7a06bd58	g.chr17:42254281A>G	ENST00000293414.1	+	3	829	c.745A>G	c.(745-747)Acg>Gcg	p.T249A	ASB16-AS1_ENST00000585457.1_RNA|ASB16-AS1_ENST00000588785.1_RNA|ASB16-AS1_ENST00000592897.1_RNA|ASB16-AS1_ENST00000591166.1_RNA	NM_080863.4	NP_543139.4	Q96NS5	ASB16_HUMAN	ankyrin repeat and SOCS box containing 16	249				T -> A (in Ref. 1; BAB70800/BAG37167, 3; AAH75088 and 4; AAL57353). {ECO:0000305}.	intracellular signal transduction (GO:0035556)|protein ubiquitination (GO:0016567)					central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(2)|liver(2)|lung(2)|prostate(1)	14		Breast(137;0.00765)|Prostate(33;0.0313)		BRCA - Breast invasive adenocarcinoma(366;0.114)		TGCGCTGAACACGGCGTGCGC	0.756													G|||	2594	0.517971	0.702	0.4424	5008	,	,		11135	0.752		0.2932	False		,,,				2504	0.3129				p.T249A		.											.	ASB16-227	0			c.A745G						.	G	ALA/THR,ARG/CYS	2530,1736		801,928,404	7.0	8.0	7.0		745,340	3.1	0.7	17	dbSNP_116	7	2387,5811		422,1543,2134	no	missense,missense	ASB16,C17orf65	NM_080863.4,NM_178542.3	58,180	1223,2471,2538	GG,GA,AA		29.1169,40.6939,39.4496	benign,benign	249/454,114/194	42254281	4917,7547	2133	4099	6232	SO:0001583	missense	92591	exon3			CTGAACACGGCGT	AK054727	CCDS11478.1	17q21.31	2013-01-10	2011-01-25		ENSG00000161664	ENSG00000161664		"""Ankyrin repeat domain containing"""	19768	protein-coding gene	gene with protein product		615056	"""ankyrin repeat and SOCS box-containing 16"""			12076535	Standard	NM_080863		Approved	FLJ30165	uc002ifl.1	Q96NS5	OTTHUMG00000181809	ENST00000293414.1:c.745A>G	17.37:g.42254281A>G	ENSP00000293414:p.Thr249Ala	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	4	4	NM_080863	0	0	0	3	3	B2RBC0|Q8WXK0	Missense_Mutation	SNP	ENST00000293414.1	37	CCDS11478.1	1144|1144	0.5238095238095238|0.5238095238095238	349|349	0.709349593495935|0.709349593495935	142|142	0.39226519337016574|0.39226519337016574	420|420	0.7342657342657343|0.7342657342657343	233|233	0.3073878627968338|0.3073878627968338	G|G	5.919|5.919	0.353578|0.353578	0.11182|0.11182	0.593061|0.593061	0.291169|0.291169	ENSG00000168597|ENSG00000161664	ENST00000303061|ENST00000293414	.|T	.|0.51817	.|0.69	5.22|5.22	3.08|3.08	0.35506|0.35506	.|Ankyrin repeat-containing domain (4);	.|0.157781	.|0.56097	.|N	.|0.000038	T|T	0.00012|0.00012	0.0000|0.0000	N|N	0.04148|0.04148	-0.265|-0.265	0.58432|0.58432	P|P	8.000000000008E-6|8.000000000008E-6	B|B	0.02656|0.02656	0.0|0.0	B|B	0.01281|0.01281	0.0|0.0	T|T	0.41502|0.41502	-0.9505|-0.9505	7|9	0.87932|0.05833	D|T	0|0.94	-9.3151|-9.3151	9.5645|9.5645	0.39389|0.39389	0.0761:0.0:0.6662:0.2577|0.0761:0.0:0.6662:0.2577	rs7212573|rs7212573	114|249	Q495Z4|Q96NS5	CQ065_HUMAN|ASB16_HUMAN	R|A	114|249	.|ENSP00000293414:T249A	ENSP00000366342:C114R|ENSP00000293414:T249A	C|T	-|+	1|1	0|0	C17orf65|ASB16	39609807|39609807	0.002000|0.002000	0.14202|0.14202	0.723000|0.723000	0.30687|0.30687	0.056000|0.056000	0.15407|0.15407	1.059000|1.059000	0.30517|0.30517	0.777000|0.777000	0.33496|0.33496	-0.227000|-0.227000	0.12334|0.12334	TGT|ACG	A|0.476;G|0.524		0.756	ASB16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000457703.1		
GFAP	2670	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	42989105	42989105	+	Nonsense_Mutation	SNP	C	C	A			TCGA-OR-A5LO-01A-11D-A29I-10	TCGA-OR-A5LO-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	89d60dde-b03a-4cb7-b32a-5d06fa328603	4a5886aa-889d-4ef2-89a9-be2f7a06bd58	g.chr17:42989105C>A	ENST00000253408.5	-	5	906	c.841G>T	c.(841-843)Gaa>Taa	p.E281*	GFAP_ENST00000435360.2_Nonsense_Mutation_p.E281*|GFAP_ENST00000586793.1_Nonsense_Mutation_p.E281*|GFAP_ENST00000591327.1_5'Flank|GFAP_ENST00000588735.1_Intron	NM_002055.4	NP_002046.1	P14136	GFAP_HUMAN	glial fibrillary acidic protein	281	Coil 2B.|Rod.				astrocyte development (GO:0014002)|Bergmann glial cell differentiation (GO:0060020)|extracellular matrix organization (GO:0030198)|intermediate filament organization (GO:0045109)|long-term synaptic potentiation (GO:0060291)|negative regulation of neuron projection development (GO:0010977)|neuron projection regeneration (GO:0031102)|positive regulation of Schwann cell proliferation (GO:0010625)|regulation of neurotransmitter uptake (GO:0051580)|response to wounding (GO:0009611)	astrocyte projection (GO:0097449)|cell body (GO:0044297)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|intermediate filament (GO:0005882)|membrane (GO:0016020)	structural constituent of cytoskeleton (GO:0005200)			endometrium(3)|kidney(1)|large_intestine(2)|liver(1)|lung(11)|ovary(1)|pancreas(1)|skin(2)|urinary_tract(1)	23		Prostate(33;0.0959)				TCGTTGGCTTCGTGCTTGGCC	0.682																																					p.E281X		.											.	GFAP-516	0			c.G841T						.						53.0	49.0	50.0					17																	42989105		2203	4300	6503	SO:0001587	stop_gained	2670	exon5			TGGCTTCGTGCTT	S40719	CCDS11491.1, CCDS45708.1, CCDS59296.1	17q21	2013-01-16						"""Intermediate filaments type III"""	4235	protein-coding gene	gene with protein product	"""intermediate filament protein"""	137780				9693047	Standard	NM_002055		Approved	FLJ45472	uc002ihq.3	P14136		ENST00000253408.5:c.841G>T	17.37:g.42989105C>A	ENSP00000253408:p.Glu281*	Somatic	106	0		WXS	Illumina GAIIx	Phase_I	86	70	NM_001131019	0	0	0	0	0	B2RD44|D3DX59|E9PAX3|Q53H98|Q5D055|Q6ZQS3|Q7Z5J6|Q7Z5J7|Q96KS4|Q96P18|Q9UFD0	Nonsense_Mutation	SNP	ENST00000253408.5	37	CCDS11491.1	.	.	.	.	.	.	.	.	.	.	C	23.3	4.402053	0.83120	.	.	ENSG00000131095	ENST00000253408;ENST00000421021;ENST00000435360	.	.	.	4.42	4.42	0.53409	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	17.9208	0.88965	0.0:1.0:0.0:0.0	.	.	.	.	X	281;256;281	.	ENSP00000253408:E281X	E	-	1	0	GFAP	40344631	1.000000	0.71417	0.997000	0.53966	0.442000	0.32017	7.583000	0.82559	2.755000	0.94549	0.655000	0.94253	GAA	.		0.682	GFAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000448701.1	NM_002055	
PRKAR1A	5573	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	66521052	66521052	+	Splice_Site	SNP	G	G	A			TCGA-OR-A5LO-01A-11D-A29I-10	TCGA-OR-A5LO-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	89d60dde-b03a-4cb7-b32a-5d06fa328603	4a5886aa-889d-4ef2-89a9-be2f7a06bd58	g.chr17:66521052G>A	ENST00000589228.1	+	6	630		c.e6-1		PRKAR1A_ENST00000536854.2_Splice_Site|PRKAR1A_ENST00000586397.1_Splice_Site|PRKAR1A_ENST00000392711.1_Splice_Site|PRKAR1A_ENST00000358598.2_Splice_Site|PRKAR1A_ENST00000588188.2_Splice_Site	NM_001276289.1|NM_001278433.1	NP_001263218.1|NP_001265362.1	P10644	KAP0_HUMAN	protein kinase, cAMP-dependent, regulatory, type I, alpha						activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|blood coagulation (GO:0007596)|cardiac muscle cell proliferation (GO:0060038)|cellular response to glucagon stimulus (GO:0071377)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|female meiotic division (GO:0007143)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|mesoderm formation (GO:0001707)|negative regulation of cAMP-dependent protein kinase activity (GO:2000480)|negative regulation of meiosis (GO:0045835)|neurotrophin TRK receptor signaling pathway (GO:0048011)|regulation of insulin secretion (GO:0050796)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|sarcomere organization (GO:0045214)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	AMP-activated protein kinase complex (GO:0031588)|cAMP-dependent protein kinase complex (GO:0005952)|cytosol (GO:0005829)|membrane (GO:0016020)|neuromuscular junction (GO:0031594)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	cAMP binding (GO:0030552)|cAMP-dependent protein kinase inhibitor activity (GO:0004862)|cAMP-dependent protein kinase regulator activity (GO:0008603)|protein kinase A catalytic subunit binding (GO:0034236)|ubiquitin protein ligase binding (GO:0031625)			adrenal_gland(4)|breast(2)|endometrium(1)|kidney(1)|large_intestine(5)|liver(2)|lung(8)|soft_tissue(2)|stomach(2)|testis(1)|thyroid(2)|upper_aerodigestive_tract(1)	31	Breast(10;1.64e-13)					CCCTCTTTTAGGTGATGAAGG	0.289			"""T, Mis, N, F, S"""	RET	papillary thyroid	"""myxoma, endocrine, papillary thyroid"""			Primary Pigmented Nodular Adrenocortical Disease, Familial;Carney Complex;Cardiac Myxomas, Familial Clustering of																												.	Ovarian(167;637 1670 33025 39608 46699 51856)	.	yes	"""Dom, Rec"""	yes	Carney complex	17	17q23-q24	5573	"""protein kinase, cAMP-dependent, regulatory, type I, alpha (tissue specific extinguisher 1)"""		"""E, M"""	.	PRKAR1A-1141	0			c.503-1G>A						.						114.0	121.0	118.0					17																	66521052		2203	4300	6503	SO:0001630	splice_region_variant	5573	exon6	Familial Cancer Database	iPPNAD, PPNAD1, incl. familial micronodular adrenocortical hyperplasia, PPNAD2;Carney syndrome, NAME syndrome, LAMB syndrome, Familial Myxoma syndrome;	CTTTTAGGTGATG		CCDS11678.1, CCDS62307.1	17q24.2	2014-09-17	2012-07-31		ENSG00000108946	ENSG00000108946	2.7.11.1		9388	protein-coding gene	gene with protein product	"""Carney complex type 1"""	188830	"""tissue specific extinguisher 1"""	PRKAR1, TSE1		3479018, 10973256	Standard	NM_212471		Approved	CNC1	uc002jhg.4	P10644	OTTHUMG00000180128	ENST00000589228.1:c.503-1G>A	17.37:g.66521052G>A		Somatic	67	0		WXS	Illumina GAIIx	Phase_I	34	18	NM_212471	0	0	2	2	0	K7ER48|Q567S7	Splice_Site	SNP	ENST00000589228.1	37	CCDS11678.1	.	.	.	.	.	.	.	.	.	.	G	24.7	4.560436	0.86335	.	.	ENSG00000108946	ENST00000358598;ENST00000392711;ENST00000392710;ENST00000536854	.	.	.	5.84	5.84	0.93424	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	20.1221	0.97964	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	PRKAR1A	64032647	1.000000	0.71417	0.998000	0.56505	0.942000	0.58702	9.476000	0.97823	2.754000	0.94517	0.655000	0.94253	.	.		0.289	PRKAR1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000449884.1		Intron
FASN	2194	hgsc.bcm.edu	37	17	80039129	80039129	+	Missense_Mutation	SNP	T	T	A			TCGA-OR-A5LO-01A-11D-A29I-10	TCGA-OR-A5LO-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	89d60dde-b03a-4cb7-b32a-5d06fa328603	4a5886aa-889d-4ef2-89a9-be2f7a06bd58	g.chr17:80039129T>A	ENST00000306749.2	-	38	6724	c.6506A>T	c.(6505-6507)gAg>gTg	p.E2169V	FASN_ENST00000579758.1_Intron	NM_004104.4	NP_004095.4	P49327	FAS_HUMAN	fatty acid synthase	2169	Acyl carrier. {ECO:0000255|PROSITE- ProRule:PRU00258}.				acetyl-CoA metabolic process (GO:0006084)|cellular lipid metabolic process (GO:0044255)|cellular response to interleukin-4 (GO:0071353)|energy reserve metabolic process (GO:0006112)|fatty acid biosynthetic process (GO:0006633)|fatty acid metabolic process (GO:0006631)|long-chain fatty-acyl-CoA biosynthetic process (GO:0035338)|osteoblast differentiation (GO:0001649)|pantothenate metabolic process (GO:0015939)|positive regulation of cellular metabolic process (GO:0031325)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|glycogen granule (GO:0042587)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	3-hydroxyoctanoyl-[acyl-carrier-protein] dehydratase activity (GO:0047451)|3-hydroxypalmitoyl-[acyl-carrier-protein] dehydratase activity (GO:0004317)|3-oxoacyl-[acyl-carrier-protein] reductase (NADPH) activity (GO:0004316)|3-oxoacyl-[acyl-carrier-protein] synthase activity (GO:0004315)|[acyl-carrier-protein] S-acetyltransferase activity (GO:0004313)|[acyl-carrier-protein] S-malonyltransferase activity (GO:0004314)|drug binding (GO:0008144)|enoyl-[acyl-carrier-protein] reductase (NADPH, A-specific) activity (GO:0047117)|enoyl-[acyl-carrier-protein] reductase (NADPH, B-specific) activity (GO:0004319)|fatty acid synthase activity (GO:0004312)|myristoyl-[acyl-carrier-protein] hydrolase activity (GO:0016295)|NADPH binding (GO:0070402)|oleoyl-[acyl-carrier-protein] hydrolase activity (GO:0004320)|palmitoyl-[acyl-carrier-protein] hydrolase activity (GO:0016296)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			central_nervous_system(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(1)|lung(12)|prostate(3)|skin(2)|urinary_tract(1)	34	all_neural(118;0.0878)|Ovarian(332;0.227)|all_lung(278;0.246)		OV - Ovarian serous cystadenocarcinoma(97;0.0211)|BRCA - Breast invasive adenocarcinoma(99;0.0237)		Cerulenin(DB01034)|Orlistat(DB01083)	CAGGTTGAGCTCACGCTCCAG	0.662																																					p.E2169V	Colon(59;314 1043 11189 28578 32273)	.											.	FASN-90	0			c.A6506T						.						29.0	25.0	26.0					17																	80039129		2185	4284	6469	SO:0001583	missense	2194	exon38			TTGAGCTCACGCT	U26644	CCDS11801.1	17q25	2012-01-31			ENSG00000169710	ENSG00000169710	2.3.1.85	"""Short chain dehydrogenase/reductase superfamily / Atypical members"""	3594	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 27X, member 1"""	600212				7835891, 7567999, 19027726	Standard	NM_004104		Approved	FAS, SDR27X1	uc002kdu.3	P49327		ENST00000306749.2:c.6506A>T	17.37:g.80039129T>A	ENSP00000304592:p.Glu2169Val	Somatic	85	0		WXS	Illumina GAIIx	Phase_I	208	14	NM_004104	0	0	62	62	0	Q13479|Q16702|Q4LE83|Q6P4U5|Q6SS02|Q969R1|Q96C68|Q96IT0	Missense_Mutation	SNP	ENST00000306749.2	37	CCDS11801.1	.	.	.	.	.	.	.	.	.	.	T	17.58	3.424698	0.62733	.	.	ENSG00000169710	ENST00000306749	T	0.50277	0.75	4.87	4.87	0.63330	Acyl carrier protein-like (3);Phosphopantetheine-binding (1);	0.259619	0.35838	N	0.002953	T	0.64382	0.2593	M	0.71920	2.185	0.48696	D	0.999696	D	0.59767	0.986	P	0.60886	0.88	T	0.69610	-0.5099	10	0.87932	D	0	-25.7181	14.4292	0.67238	0.0:0.0:0.0:1.0	.	2169	P49327	FAS_HUMAN	V	2169	ENSP00000304592:E2169V	ENSP00000304592:E2169V	E	-	2	0	FASN	77632418	1.000000	0.71417	0.260000	0.24451	0.007000	0.05969	6.185000	0.72013	1.808000	0.52836	0.260000	0.18958	GAG	.		0.662	FASN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000442369.1	NM_004104	
FASN	2194	hgsc.bcm.edu	37	17	80042498	80042498	+	Missense_Mutation	SNP	A	A	C			TCGA-OR-A5LO-01A-11D-A29I-10	TCGA-OR-A5LO-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	89d60dde-b03a-4cb7-b32a-5d06fa328603	4a5886aa-889d-4ef2-89a9-be2f7a06bd58	g.chr17:80042498A>C	ENST00000306749.2	-	27	4877	c.4659T>G	c.(4657-4659)caT>caG	p.H1553Q	FASN_ENST00000579758.1_5'Flank	NM_004104.4	NP_004095.4	P49327	FAS_HUMAN	fatty acid synthase	1553					acetyl-CoA metabolic process (GO:0006084)|cellular lipid metabolic process (GO:0044255)|cellular response to interleukin-4 (GO:0071353)|energy reserve metabolic process (GO:0006112)|fatty acid biosynthetic process (GO:0006633)|fatty acid metabolic process (GO:0006631)|long-chain fatty-acyl-CoA biosynthetic process (GO:0035338)|osteoblast differentiation (GO:0001649)|pantothenate metabolic process (GO:0015939)|positive regulation of cellular metabolic process (GO:0031325)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|glycogen granule (GO:0042587)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	3-hydroxyoctanoyl-[acyl-carrier-protein] dehydratase activity (GO:0047451)|3-hydroxypalmitoyl-[acyl-carrier-protein] dehydratase activity (GO:0004317)|3-oxoacyl-[acyl-carrier-protein] reductase (NADPH) activity (GO:0004316)|3-oxoacyl-[acyl-carrier-protein] synthase activity (GO:0004315)|[acyl-carrier-protein] S-acetyltransferase activity (GO:0004313)|[acyl-carrier-protein] S-malonyltransferase activity (GO:0004314)|drug binding (GO:0008144)|enoyl-[acyl-carrier-protein] reductase (NADPH, A-specific) activity (GO:0047117)|enoyl-[acyl-carrier-protein] reductase (NADPH, B-specific) activity (GO:0004319)|fatty acid synthase activity (GO:0004312)|myristoyl-[acyl-carrier-protein] hydrolase activity (GO:0016295)|NADPH binding (GO:0070402)|oleoyl-[acyl-carrier-protein] hydrolase activity (GO:0004320)|palmitoyl-[acyl-carrier-protein] hydrolase activity (GO:0016296)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			central_nervous_system(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(1)|lung(12)|prostate(3)|skin(2)|urinary_tract(1)	34	all_neural(118;0.0878)|Ovarian(332;0.227)|all_lung(278;0.246)		OV - Ovarian serous cystadenocarcinoma(97;0.0211)|BRCA - Breast invasive adenocarcinoma(99;0.0237)		Cerulenin(DB01034)|Orlistat(DB01083)	TGGGCTGGGCATGGCGCAGCG	0.662																																					p.H1553Q	Colon(59;314 1043 11189 28578 32273)	.											.	FASN-90	0			c.T4659G						.						36.0	35.0	35.0					17																	80042498		2184	4295	6479	SO:0001583	missense	2194	exon27			CTGGGCATGGCGC	U26644	CCDS11801.1	17q25	2012-01-31			ENSG00000169710	ENSG00000169710	2.3.1.85	"""Short chain dehydrogenase/reductase superfamily / Atypical members"""	3594	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 27X, member 1"""	600212				7835891, 7567999, 19027726	Standard	NM_004104		Approved	FAS, SDR27X1	uc002kdu.3	P49327		ENST00000306749.2:c.4659T>G	17.37:g.80042498A>C	ENSP00000304592:p.His1553Gln	Somatic	112	0		WXS	Illumina GAIIx	Phase_I	195	26	NM_004104	0	0	81	81	0	Q13479|Q16702|Q4LE83|Q6P4U5|Q6SS02|Q969R1|Q96C68|Q96IT0	Missense_Mutation	SNP	ENST00000306749.2	37	CCDS11801.1	.	.	.	.	.	.	.	.	.	.	A	7.805	0.714479	0.15306	.	.	ENSG00000169710	ENST00000306749;ENST00000545909	T	0.25250	1.81	4.5	-3.53	0.04667	Polyketide synthase, enoylreductase (1);	0.111909	0.64402	D	0.000013	T	0.07818	0.0196	N	0.01242	-0.935	0.37105	D	0.90005	B	0.25351	0.124	B	0.20767	0.031	T	0.15954	-1.0419	10	0.42905	T	0.14	-27.2261	13.0182	0.58771	0.4491:0.0:0.5509:0.0	.	1553	P49327	FAS_HUMAN	Q	1553;518	ENSP00000304592:H1553Q	ENSP00000304592:H1553Q	H	-	3	2	FASN	77635787	0.005000	0.15991	0.000000	0.03702	0.218000	0.24690	-1.393000	0.02521	-0.538000	0.06281	-0.856000	0.03024	CAT	.		0.662	FASN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000442369.1	NM_004104	
KISS1R	84634	hgsc.bcm.edu	37	19	920642	920642	+	Missense_Mutation	SNP	T	T	A	rs350132	byFrequency	TCGA-OR-A5LO-01A-11D-A29I-10	TCGA-OR-A5LO-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	89d60dde-b03a-4cb7-b32a-5d06fa328603	4a5886aa-889d-4ef2-89a9-be2f7a06bd58	g.chr19:920642T>A	ENST00000234371.5	+	5	1244	c.1091T>A	c.(1090-1092)cTc>cAc	p.L364H	KISS1R_ENST00000606939.1_3'UTR	NM_032551.4	NP_115940.2	Q969F8	KISSR_HUMAN	KISS1 receptor	364			L -> H (in dbSNP:rs350132). {ECO:0000269|PubMed:11385580, ECO:0000269|PubMed:11414709, ECO:0000269|PubMed:11457843, ECO:0000269|PubMed:14573733, ECO:0000269|PubMed:15489334, ECO:0000269|PubMed:15598687, ECO:0000269|Ref.8}.		activation of MAPKK activity (GO:0000186)|arachidonic acid secretion (GO:0050482)|calcium-mediated signaling (GO:0019722)|G-protein coupled receptor signaling pathway (GO:0007186)|negative regulation of cell proliferation (GO:0008285)|neuropeptide signaling pathway (GO:0007218)|positive regulation of hormone secretion (GO:0046887)|positive regulation of stress fiber assembly (GO:0051496)|positive regulation of synaptic transmission (GO:0050806)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	neuropeptide binding (GO:0042923)|neuropeptide receptor activity (GO:0008188)			cervix(1)|kidney(1)|ovary(1)|pancreas(1)|skin(1)	5		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;1.04e-05)|all_lung(49;1.53e-05)|Breast(49;9.42e-05)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		GCGGAGCTGCTCCGCCTGGGG	0.816													a|||	3926	0.783946	0.916	0.6988	5008	,	,		7496	0.7589		0.7485	False		,,,				2504	0.728				p.L364H		.											.	KISS1R-91	0			c.T1091A						.						1.0	2.0	1.0					19																	920642		976	2331	3307	SO:0001583	missense	84634	exon5			AGCTGCTCCGCCT	AB051065	CCDS12049.1	19p13.3	2012-08-10	2006-02-15	2006-02-15	ENSG00000116014	ENSG00000116014		"""GPCR / Class A : RF amide peptide receptors"""	4510	protein-coding gene	gene with protein product		604161	"""G protein-coupled receptor 54"""	GPR54		10100623	Standard	NM_032551		Approved	HOT7T175, AXOR12	uc002lqk.4	Q969F8		ENST00000234371.5:c.1091T>A	19.37:g.920642T>A	ENSP00000234371:p.Leu364His	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	5	5	NM_032551	0	0	0	3	3	A5D8U2|B2RTV1|Q96QG0	Missense_Mutation	SNP	ENST00000234371.5	37	CCDS12049.1	1676	0.7673992673992674	432	0.8780487804878049	253	0.6988950276243094	435	0.7604895104895105	556	0.7335092348284961	N	2.523	-0.310400	0.05458	.	.	ENSG00000116014	ENST00000234371	T	0.71579	-0.58	4.36	-0.607	0.11615	.	0.579379	0.14719	N	0.302432	T	0.00012	0.0000	N	0.03608	-0.345	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.31998	-0.9923	9	0.13108	T	0.6	.	0.8843	0.01241	0.3667:0.1686:0.3009:0.1639	rs350132;rs3746148	364	Q969F8	KISSR_HUMAN	H	364	ENSP00000234371:L364H	ENSP00000234371:L364H	L	+	2	0	KISS1R	871642	0.000000	0.05858	0.075000	0.20258	0.190000	0.23558	-1.559000	0.02162	-0.349000	0.08274	-0.385000	0.06624	CTC	T|0.232;A|0.768		0.816	KISS1R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458217.3	NM_032551	
ABCA7	10347	hgsc.bcm.edu	37	19	1065044	1065044	+	Silent	SNP	C	C	T	rs4147935	byFrequency	TCGA-OR-A5LO-01A-11D-A29I-10	TCGA-OR-A5LO-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	89d60dde-b03a-4cb7-b32a-5d06fa328603	4a5886aa-889d-4ef2-89a9-be2f7a06bd58	g.chr19:1065044C>T	ENST00000263094.6	+	46	6390	c.6159C>T	c.(6157-6159)ggC>ggT	p.G2053G	HMHA1_ENST00000586866.1_5'Flank|HMHA1_ENST00000536472.1_5'Flank|HMHA1_ENST00000313093.2_5'Flank|HMHA1_ENST00000590214.1_5'Flank|ABCA7_ENST00000435683.2_Silent_p.G1915G|HMHA1_ENST00000539243.2_5'Flank|ABCA7_ENST00000433129.1_Silent_p.G2053G	NM_019112.3	NP_061985.2	Q8IZY2	ABCA7_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 7	2053					apolipoprotein A-I-mediated signaling pathway (GO:0038027)|ATP catabolic process (GO:0006200)|cholesterol efflux (GO:0033344)|high-density lipoprotein particle assembly (GO:0034380)|memory (GO:0007613)|negative regulation of amyloid precursor protein biosynthetic process (GO:0042985)|negative regulation of ATPase activity (GO:0032780)|negative regulation of beta-amyloid formation (GO:1902430)|peptide cross-linking (GO:0018149)|phagocytosis (GO:0006909)|phospholipid efflux (GO:0033700)|phospholipid scrambling (GO:0017121)|positive regulation of ATPase activity (GO:0032781)|positive regulation of beta-amyloid clearance (GO:1900223)|positive regulation of cholesterol efflux (GO:0010875)|positive regulation of engulfment of apoptotic cell (GO:1901076)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of phagocytosis (GO:0050766)|positive regulation of phospholipid efflux (GO:1902995)|protein localization to nucleus (GO:0034504)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|ATP-binding cassette (ABC) transporter complex (GO:0043190)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|phagocytic cup (GO:0001891)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)	apolipoprotein A-I receptor activity (GO:0034188)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|phospholipid transporter activity (GO:0005548)|transporter activity (GO:0005215)			NS(1)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(7)|lung(22)|ovary(1)|pancreas(7)|prostate(4)|skin(3)|upper_aerodigestive_tract(1)	65		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;1.04e-05)|all_lung(49;1.53e-05)|Breast(49;9.42e-05)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		CACATGGAGGCCGCCTGCGCT	0.736																																					p.G2053G		.											.	ABCA7-98	0			c.C6159T						.	C		327,3757		20,287,1735	5.0	6.0	6.0		6159	1.5	0.8	19	dbSNP_110	6	2858,5242		553,1752,1745	no	coding-synonymous	ABCA7	NM_019112.3		573,2039,3480	TT,TC,CC		35.284,8.0069,26.1408		2053/2147	1065044	3185,8999	2042	4050	6092	SO:0001819	synonymous_variant	10347	exon46			TGGAGGCCGCCTG	AF328787	CCDS12055.1	19p13.3	2012-03-14			ENSG00000064687	ENSG00000064687		"""ATP binding cassette transporters / subfamily A"""	37	protein-coding gene	gene with protein product		605414					Standard	NM_019112		Approved	ABCX	uc002lqw.4	Q8IZY2	OTTHUMG00000167547	ENST00000263094.6:c.6159C>T	19.37:g.1065044C>T		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	11	8	NM_019112	0	0	4	7	3	Q96S58|Q9BZC4|Q9NR73|Q9UKP8	Silent	SNP	ENST00000263094.6	37	CCDS12055.1																																																																																			C|0.766;T|0.234		0.736	ABCA7-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000394993.1	NM_019112	
C19orf24	55009	hgsc.bcm.edu	37	19	1275820	1275820	+	Missense_Mutation	SNP	G	G	T			TCGA-OR-A5LO-01A-11D-A29I-10	TCGA-OR-A5LO-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	89d60dde-b03a-4cb7-b32a-5d06fa328603	4a5886aa-889d-4ef2-89a9-be2f7a06bd58	g.chr19:1275820G>T	ENST00000409293.4	+	1	795	c.272G>T	c.(271-273)cGg>cTg	p.R91L	C19orf24_ENST00000469144.1_5'Flank	NM_017914.3	NP_060384.3	Q9BVV8	CS024_HUMAN	chromosome 19 open reading frame 24	91						cytoplasm (GO:0005737)|extracellular region (GO:0005576)|integral component of membrane (GO:0016021)							Acute lymphoblastic leukemia(61;4.36e-14)|all_hematologic(61;4.84e-09)|Lung NSC(49;0.000332)|all_lung(49;0.000498)|Breast(49;0.0014)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		TTCCTGATCCGGGCGTTTAGG	0.706																																					p.R91L		.											.	C19orf24-90	0			c.G272T						.						5.0	7.0	6.0					19																	1275820		675	1563	2238	SO:0001583	missense	55009	exon1			TGATCCGGGCGTT	BC000890	CCDS12060.2	19p13.3	2012-10-24			ENSG00000228300	ENSG00000228300			26073	protein-coding gene	gene with protein product						16847563	Standard	NM_017914		Approved	FLJ20640	uc002lrw.4	Q9BVV8	OTTHUMG00000153928	ENST00000409293.4:c.272G>T	19.37:g.1275820G>T	ENSP00000386557:p.Arg91Leu	Somatic	7	0		WXS	Illumina GAIIx	Phase_I	59	4	NM_017914	0	0	0	0	0	Q9NWS2	Missense_Mutation	SNP	ENST00000409293.4	37	CCDS12060.2	.	.	.	.	.	.	.	.	.	.	G	14.95	2.687815	0.48097	.	.	ENSG00000228300	ENST00000409293	T	0.57752	0.38	3.69	3.69	0.42338	.	.	.	.	.	T	0.65439	0.2691	M	0.65975	2.015	.	.	.	D	0.76494	0.999	D	0.71870	0.975	T	0.73569	-0.3941	8	0.72032	D	0.01	-27.7304	7.2582	0.26189	0.124:0.0:0.876:0.0	.	91	Q9BVV8	CS024_HUMAN	L	91	ENSP00000386557:R91L	ENSP00000386557:R91L	R	+	2	0	C19orf24	1226820	1.000000	0.71417	0.999000	0.59377	0.014000	0.08584	4.664000	0.61540	2.057000	0.61298	0.305000	0.20034	CGG	.		0.706	C19orf24-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000333049.2	NM_017914	
SH3GL1	6455	broad.mit.edu	37	19	4361787	4361787	+	Missense_Mutation	SNP	A	A	C			TCGA-OR-A5LO-01A-11D-A29I-10	TCGA-OR-A5LO-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	89d60dde-b03a-4cb7-b32a-5d06fa328603	4a5886aa-889d-4ef2-89a9-be2f7a06bd58	g.chr19:4361787A>C	ENST00000269886.3	-	10	1095	c.917T>G	c.(916-918)cTg>cGg	p.L306R	SH3GL1_ENST00000598564.1_Missense_Mutation_p.L242R|SH3GL1_ENST00000417295.2_Missense_Mutation_p.L258R|AC007292.6_ENST00000594444.1_RNA	NM_003025.3	NP_003016.1	Q99961	SH3G1_HUMAN	SH3-domain GRB2-like 1	306	SH3. {ECO:0000255|PROSITE- ProRule:PRU00192}.				central nervous system development (GO:0007417)|endocytosis (GO:0006897)|signal transduction (GO:0007165)	cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|endosome (GO:0005768)|membrane (GO:0016020)	identical protein binding (GO:0042802)|lipid binding (GO:0008289)			NS(1)|endometrium(2)|kidney(16)|large_intestine(3)|lung(2)|ovary(2)	26				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0152)|STAD - Stomach adenocarcinoma(1328;0.182)		CGGCTGGTCCAGGGGCGCTGG	0.687			T	MLL	AL																																p.L306R	NSCLC(94;1152 2133 30346 33362)	.		Dom	yes		19	19p13.3	6455	SH3-domain GRB2-like 1 (EEN)		L	.	SH3GL1-659	0			c.T917G						.						32.0	30.0	31.0					19																	4361787		2203	4297	6500	SO:0001583	missense	6455	exon10			TGGTCCAGGGGCG		CCDS32874.1, CCDS56076.1, CCDS59335.1	19p13.3	2008-07-22							10830	protein-coding gene	gene with protein product	"""extra 11-19 leukemia fusion"", ""fusion partner of MLL"", ""SH3-containing Grb-2-like 1 protein"", ""SH3-containing protein EEN"", ""SH3 domain GRB2-like 1"""	601768				9169142	Standard	NM_003025		Approved	SH3P8, SH3D2B, CNSA1, EEN, MGC111371	uc002maj.3	Q99961		ENST00000269886.3:c.917T>G	19.37:g.4361787A>C	ENSP00000269886:p.Leu306Arg	Somatic	13	0		WXS	Illumina GAIIx	Phase_I	52	7	NM_003025	0	0	2	4	2	B4DRA1|E7EVZ4|M0QZV5|Q99668	Missense_Mutation	SNP	ENST00000269886.3	37	CCDS32874.1	.	.	.	.	.	.	.	.	.	.	.	11.08	1.532159	0.27387	.	.	ENSG00000141985	ENST00000269886;ENST00000417295	T;T	0.31769	1.48;1.48	3.9	3.9	0.45041	Src homology-3 domain (2);	0.276964	0.29783	N	0.011212	T	0.17323	0.0416	N	0.14661	0.345	0.58432	D	0.999997	B;B;B	0.12013	0.001;0.005;0.005	B;B;B	0.12837	0.008;0.006;0.006	T	0.06232	-1.0838	10	0.17832	T	0.49	-0.3252	12.042	0.53458	1.0:0.0:0.0:0.0	.	258;306;306	E7EVZ4;Q6FGM0;Q99961	.;.;SH3G1_HUMAN	R	306;258	ENSP00000269886:L306R;ENSP00000404568:L258R	ENSP00000269886:L306R	L	-	2	0	SH3GL1	4312787	1.000000	0.71417	1.000000	0.80357	0.538000	0.34931	4.354000	0.59417	1.624000	0.50355	0.418000	0.28097	CTG	.		0.687	SH3GL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458302.1	NM_003025	
CERS4	79603	broad.mit.edu	37	19	8316107	8316107	+	Silent	SNP	C	C	T			TCGA-OR-A5LO-01A-11D-A29I-10	TCGA-OR-A5LO-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	89d60dde-b03a-4cb7-b32a-5d06fa328603	4a5886aa-889d-4ef2-89a9-be2f7a06bd58	g.chr19:8316107C>T	ENST00000251363.5	+	3	447	c.147C>T	c.(145-147)ctC>ctT	p.L49L	CERS4_ENST00000559450.1_Silent_p.L49L|CERS4_ENST00000558331.1_5'UTR|CERS4_ENST00000559336.1_Silent_p.L49L|CERS4_ENST00000595722.1_Intron	NM_024552.2	NP_078828.2	Q9HA82	CERS4_HUMAN	ceramide synthase 4	49					ceramide biosynthetic process (GO:0046513)|small molecule metabolic process (GO:0044281)|sphingolipid biosynthetic process (GO:0030148)|sphingolipid metabolic process (GO:0006665)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sphingosine N-acyltransferase activity (GO:0050291)										CGCTGGTCCTCCTGGCCATGC	0.622																																					p.L49L		.											.	.	0			c.C147T						.						112.0	114.0	113.0					19																	8316107		2203	4300	6503	SO:0001819	synonymous_variant	79603	exon3			GGTCCTCCTGGCC		CCDS12197.1	19p13.2	2014-09-11	2011-07-08	2011-07-08	ENSG00000090661	ENSG00000090661		"""Homeoboxes / CERS class"""	23747	protein-coding gene	gene with protein product		615334	"""LAG1 longevity assurance homolog 4 (S. cerevisiae)"", ""LAG1 homolog, ceramide synthase 4"""	LASS4			Standard	NM_024552		Approved	FLJ12089, Trh1	uc002mjg.3	Q9HA82	OTTHUMG00000172570	ENST00000251363.5:c.147C>T	19.37:g.8316107C>T		Somatic	88	0		WXS	Illumina GAIIx	Phase_I	115	5	NM_024552	0	0	17	18	1	D6W665	Silent	SNP	ENST00000251363.5	37	CCDS12197.1																																																																																			.		0.622	CERS4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000419200.1	NM_024552	
KANK3	256949	broad.mit.edu	37	19	8398950	8398961	+	In_Frame_Del	DEL	TCGCTGTCGCCA	TCGCTGTCGCCA	-	rs111751275|rs199822445|rs201862465|rs6146458|rs200669927	byFrequency	TCGA-OR-A5LO-01A-11D-A29I-10	TCGA-OR-A5LO-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	89d60dde-b03a-4cb7-b32a-5d06fa328603	4a5886aa-889d-4ef2-89a9-be2f7a06bd58	g.chr19:8398950_8398961delTCGCTGTCGCCA	ENST00000593649.1	-	5	1532_1543	c.1467_1478delTGGCGACAGCGA	c.(1465-1479)gatggcgacagcgag>gag	p.DGDS489del	KANK3_ENST00000330915.3_In_Frame_Del_p.DGDS489del			Q6NY19	KANK3_HUMAN	KN motif and ankyrin repeat domains 3	489								p.D489_S492delDGDS(2)		breast(1)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(3)|skin(1)|urinary_tract(1)	9						GCCACCGTTCTCGCTGTCGCCATCGCTGTCGC	0.717														1760	0.351438	0.4085	0.428	5008	,	,		15278	0.2927		0.2962	False		,,,				2504	0.3374				p.489_493del		.											.	KANK3-90	2	Deletion - In frame(2)	large_intestine(1)|breast(1)	c.1467_1478del						.			958,2544		287,384,1080						-7.5	0.0		dbSNP_114	6	1402,5766		338,726,2520	no	coding	KANK3	NM_198471.2		625,1110,3600	A1A1,A1R,RR		19.5592,27.3558,22.1181				2360,8310				SO:0001651	inframe_deletion	256949	exon5			CCGTTCTCGCTGT	AK128815	CCDS12199.1	19p13.2	2013-01-10	2008-01-29	2008-01-29		ENSG00000186994		"""KN motif and ankyrin repeat domain containing"", ""Ankyrin repeat domain containing"""	24796	protein-coding gene	gene with protein product		614611	"""ankyrin repeat domain 47"""	ANKRD47		17996375, 19554261	Standard	NM_198471		Approved	FLJ46061	uc010dwa.3	Q6NY19		ENST00000593649.1:c.1467_1478delTGGCGACAGCGA	19.37:g.8398950_8398961delTCGCTGTCGCCA	ENSP00000470728:p.Asp489_Ser492del	Somatic	6	0		WXS	Illumina GAIIx	Phase_I	43	7	NM_198471	0	0	0	0	0	Q6NZI1|Q6ZQR3|Q8IUV2	In_Frame_Del	DEL	ENST00000593649.1	37																																																																																				.		0.717	KANK3-002	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000461379.1	NM_198471	
MUC16	94025	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	9066010	9066010	+	Missense_Mutation	SNP	C	C	G			TCGA-OR-A5LO-01A-11D-A29I-10	TCGA-OR-A5LO-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	89d60dde-b03a-4cb7-b32a-5d06fa328603	4a5886aa-889d-4ef2-89a9-be2f7a06bd58	g.chr19:9066010C>G	ENST00000397910.4	-	3	21639	c.21436G>C	c.(21436-21438)Gaa>Caa	p.E7146Q		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	7148	Ser-rich.|Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						GTTACAAGTTCTGGGCTTGTG	0.502																																					p.E7146Q		.											.	MUC16-566	0			c.G21436C						.						205.0	187.0	193.0					19																	9066010		2068	4207	6275	SO:0001583	missense	94025	exon3			CAAGTTCTGGGCT	AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.21436G>C	19.37:g.9066010C>G	ENSP00000381008:p.Glu7146Gln	Somatic	326	0		WXS	Illumina GAIIx	Phase_I	489	216	NM_024690	0	0	0	0	0	Q6ZQW5|Q96RK2	Missense_Mutation	SNP	ENST00000397910.4	37	CCDS54212.1	.	.	.	.	.	.	.	.	.	.	c	4.868	0.161352	0.09287	.	.	ENSG00000181143	ENST00000397910	T	0.32515	1.45	2.6	0.392	0.16288	.	.	.	.	.	T	0.30916	0.0780	L	0.47716	1.5	.	.	.	P	0.50710	0.938	P	0.50049	0.629	T	0.38887	-0.9640	8	0.87932	D	0	.	4.758	0.13093	0.0:0.6873:0.0:0.3127	.	7146	B5ME49	.	Q	7146	ENSP00000381008:E7146Q	ENSP00000381008:E7146Q	E	-	1	0	MUC16	8927010	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-0.237000	0.08990	0.168000	0.19655	0.400000	0.26472	GAA	.		0.502	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402806.1	NM_024690	
LDLR	3949	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	11234004	11234004	+	Silent	SNP	G	G	C			TCGA-OR-A5LO-01A-11D-A29I-10	TCGA-OR-A5LO-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	89d60dde-b03a-4cb7-b32a-5d06fa328603	4a5886aa-889d-4ef2-89a9-be2f7a06bd58	g.chr19:11234004G>C	ENST00000558518.1	+	15	2482	c.2295G>C	c.(2293-2295)gtG>gtC	p.V765V	LDLR_ENST00000455727.2_Silent_p.V597V|LDLR_ENST00000545707.1_Silent_p.V587V|LDLR_ENST00000535915.1_Silent_p.V724V|LDLR_ENST00000557933.1_Silent_p.V765V|LDLR_ENST00000558013.1_Silent_p.V765V	NM_000527.4|NM_001195798.1	NP_000518.1|NP_001182727.1	P01130	LDLR_HUMAN	low density lipoprotein receptor	765	Clustered O-linked oligosaccharides.				cholesterol homeostasis (GO:0042632)|cholesterol import (GO:0070508)|cholesterol metabolic process (GO:0008203)|cholesterol transport (GO:0030301)|endocytosis (GO:0006897)|intestinal cholesterol absorption (GO:0030299)|lipid metabolic process (GO:0006629)|lipoprotein catabolic process (GO:0042159)|lipoprotein metabolic process (GO:0042157)|low-density lipoprotein particle clearance (GO:0034383)|phospholipid transport (GO:0015914)|phototransduction, visible light (GO:0007603)|positive regulation of triglyceride biosynthetic process (GO:0010867)|receptor-mediated endocytosis (GO:0006898)|regulation of cholesterol homeostasis (GO:2000188)|regulation of phosphatidylcholine catabolic process (GO:0010899)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|viral process (GO:0016032)	cell surface (GO:0009986)|clathrin-coated endocytic vesicle membrane (GO:0030669)|coated pit (GO:0005905)|early endosome (GO:0005769)|endosome membrane (GO:0010008)|external side of plasma membrane (GO:0009897)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|late endosome (GO:0005770)|low-density lipoprotein particle (GO:0034362)|lysosome (GO:0005764)|membrane (GO:0016020)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|glycoprotein binding (GO:0001948)|low-density lipoprotein particle binding (GO:0030169)|low-density lipoprotein receptor activity (GO:0005041)|very-low-density lipoprotein particle receptor activity (GO:0030229)			breast(2)|endometrium(2)|large_intestine(5)|lung(8)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	26		Lung NSC(9;0.000245)|Renal(1328;0.0007)|Hepatocellular(1079;0.0524)		GBM - Glioblastoma multiforme(1328;1.36e-05)|STAD - Stomach adenocarcinoma(1328;0.000766)|Lung(535;0.197)	Porfimer(DB00707)	TGGAGATAGTGACAATGTCTC	0.612																																					p.V765V	GBM(18;201 575 7820 21545)	.											.	LDLR-94	0			c.G2295C						.						83.0	70.0	74.0					19																	11234004		2203	4300	6503	SO:0001819	synonymous_variant	3949	exon15			GATAGTGACAATG	AY114155	CCDS12254.1, CCDS56083.1, CCDS56084.1, CCDS56085.1, CCDS58651.1	19p13.2	2014-09-17	2008-08-01		ENSG00000130164	ENSG00000130164		"""Low density lipoprotein receptors"""	6547	protein-coding gene	gene with protein product	"""familial hypercholesterolemia"""	606945					Standard	NM_000527		Approved	LDLCQ2	uc002mqk.4	P01130		ENST00000558518.1:c.2295G>C	19.37:g.11234004G>C		Somatic	72	0		WXS	Illumina GAIIx	Phase_I	134	27	NM_001195798	0	0	343	474	131	B4DII3|B4DJZ8|B4DR00|B4DTQ3|C0JYY8|H0YLU8|H0YNT7|Q53ZD9|Q59FQ1|Q9UDH7	Silent	SNP	ENST00000558518.1	37	CCDS12254.1																																																																																			.		0.612	LDLR-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000415973.2		
RNASEH2A	10535	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	12918306	12918306	+	Missense_Mutation	SNP	G	G	T			TCGA-OR-A5LO-01A-11D-A29I-10	TCGA-OR-A5LO-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	89d60dde-b03a-4cb7-b32a-5d06fa328603	4a5886aa-889d-4ef2-89a9-be2f7a06bd58	g.chr19:12918306G>T	ENST00000221486.4	+	4	491	c.397G>T	c.(397-399)Gtg>Ttg	p.V133L		NM_006397.2	NP_006388.2	O75792	RNH2A_HUMAN	ribonuclease H2, subunit A	133					DNA replication (GO:0006260)|mismatch repair (GO:0006298)|RNA catabolic process (GO:0006401)|RNA phosphodiester bond hydrolysis (GO:0090501)|RNA phosphodiester bond hydrolysis, endonucleolytic (GO:0090502)	nucleus (GO:0005634)|ribonuclease H2 complex (GO:0032299)	metal ion binding (GO:0046872)|ribonuclease activity (GO:0004540)|RNA binding (GO:0003723)|RNA-DNA hybrid ribonuclease activity (GO:0004523)	p.V133M(1)		breast(3)|central_nervous_system(1)|endometrium(2)|large_intestine(3)|lung(3)|skin(1)|urinary_tract(1)	14						GGACCAGGGCGTGAACGTCAC	0.493																																					p.V133L		.											.	RNASEH2A-524	1	Substitution - Missense(1)	large_intestine(1)	c.G397T						.						130.0	113.0	119.0					19																	12918306		2203	4300	6503	SO:0001583	missense	10535	exon4			CAGGGCGTGAACG	Z97029	CCDS12282.1	19p13.13	2014-09-17	2006-08-17			ENSG00000104889	3.1.26.-		18518	protein-coding gene	gene with protein product		606034	"""ribonuclease H2, large subunit"", ""Aicardi-Goutieres syndrome 4"""			9789007, 16845400	Standard	NM_006397		Approved	RNASEHI, RNHIA, RNHL, AGS4	uc002mvg.1	O75792		ENST00000221486.4:c.397G>T	19.37:g.12918306G>T	ENSP00000221486:p.Val133Leu	Somatic	188	0		WXS	Illumina GAIIx	Phase_I	296	134	NM_006397	0	0	13	25	12	B2RCY1|Q96F11	Missense_Mutation	SNP	ENST00000221486.4	37	CCDS12282.1	.	.	.	.	.	.	.	.	.	.	G	18.68	3.676821	0.67928	.	.	ENSG00000104889	ENST00000221486	D	0.87334	-2.24	4.8	4.8	0.61643	Ribonuclease HII/HIII domain (1);Ribonuclease H-like (1);	0.067299	0.64402	N	0.000018	D	0.85164	0.5634	L	0.48174	1.505	0.80722	D	1	B	0.18610	0.029	B	0.31016	0.123	T	0.82741	-0.0307	10	0.49607	T	0.09	-15.5002	15.3366	0.74260	0.0:0.0:1.0:0.0	.	133	O75792	RNH2A_HUMAN	L	133	ENSP00000221486:V133L	ENSP00000221486:V133L	V	+	1	0	RNASEH2A	12779306	1.000000	0.71417	0.983000	0.44433	0.927000	0.56198	8.500000	0.90498	2.194000	0.70268	0.505000	0.49811	GTG	.		0.493	RNASEH2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451507.1	NM_006397	
RAD23A	5886	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	13063541	13063541	+	Silent	SNP	G	G	A			TCGA-OR-A5LO-01A-11D-A29I-10	TCGA-OR-A5LO-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	89d60dde-b03a-4cb7-b32a-5d06fa328603	4a5886aa-889d-4ef2-89a9-be2f7a06bd58	g.chr19:13063541G>A	ENST00000586534.1	+	8	913	c.852G>A	c.(850-852)ctG>ctA	p.L284L	RAD23A_ENST00000541222.1_Silent_p.L119L|RAD23A_ENST00000316856.3_Silent_p.L283L|RAD23A_ENST00000592268.1_Intron			P54725	RD23A_HUMAN	RAD23 homolog A (S. cerevisiae)	284					nucleotide-excision repair (GO:0006289)|positive regulation of viral genome replication (GO:0045070)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032434)|viral process (GO:0016032)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|proteasome complex (GO:0000502)	damaged DNA binding (GO:0003684)|polyubiquitin binding (GO:0031593)|single-stranded DNA binding (GO:0003697)|ubiquitin-specific protease binding (GO:1990381)			central_nervous_system(1)|endometrium(2)|large_intestine(3)|lung(2)|ovary(2)|prostate(1)|skin(1)	12						TCCAGATGCTGAACGAGCCCC	0.627								Nucleotide excision repair (NER)																													p.L284L		.											.	RAD23A-227	0			c.G852A						.						36.0	39.0	38.0					19																	13063541		2203	4300	6503	SO:0001819	synonymous_variant	5886	exon8			GATGCTGAACGAG		CCDS12289.1, CCDS59357.1, CCDS59358.1	19p13.2	2008-07-17	2001-11-28			ENSG00000179262			9812	protein-coding gene	gene with protein product	"""RAD23, yeast homolog, A"""	600061	"""RAD23 (S. cerevisiae) homolog A"""			7851894	Standard	NM_005053		Approved	HHR23A, MGC111083	uc002mvw.2	P54725		ENST00000586534.1:c.852G>A	19.37:g.13063541G>A		Somatic	123	0		WXS	Illumina GAIIx	Phase_I	151	36	NM_005053	0	0	122	187	65	K7ESE3|Q59EU8|Q5M7Z1	Silent	SNP	ENST00000586534.1	37	CCDS12289.1																																																																																			.		0.627	RAD23A-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000452752.1	NM_005053	
PGLS	25796	hgsc.bcm.edu	37	19	17622614	17622614	+	Silent	SNP	C	C	T	rs11086075	byFrequency	TCGA-OR-A5LO-01A-11D-A29I-10	TCGA-OR-A5LO-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	89d60dde-b03a-4cb7-b32a-5d06fa328603	4a5886aa-889d-4ef2-89a9-be2f7a06bd58	g.chr19:17622614C>T	ENST00000252603.2	+	1	177	c.133C>T	c.(133-135)Ctg>Ttg	p.L45L	CTD-3131K8.2_ENST00000596643.1_lincRNA	NM_012088.2	NP_036220.1	O95336	6PGL_HUMAN	6-phosphogluconolactonase	45					carbohydrate metabolic process (GO:0005975)|pentose-phosphate shunt (GO:0006098)|pentose-phosphate shunt, oxidative branch (GO:0009051)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	6-phosphogluconolactonase activity (GO:0017057)|monosaccharide binding (GO:0048029)			endometrium(1)|lung(1)	2						CGCGCTCGGCCTGTCGGGCGG	0.736													C|||	1862	0.371805	0.2496	0.4207	5008	,	,		10575	0.377		0.4851	False		,,,				2504	0.3804				p.L45L		.											.	PGLS-90	0			c.C133T						.	C		662,2504		107,448,1028	2.0	2.0	2.0		133	2.6	1.0	19	dbSNP_120	2	2200,4094		507,1186,1454	no	coding-synonymous	PGLS	NM_012088.2		614,1634,2482	TT,TC,CC		34.9539,20.9097,30.2537		45/259	17622614	2862,6598	1583	3147	4730	SO:0001819	synonymous_variant	25796	exon1			CTCGGCCTGTCGG	AJ243972	CCDS12361.1	19p13.2	2008-02-05				ENSG00000130313	3.1.1.31		8903	protein-coding gene	gene with protein product		604951				10518023	Standard	NM_012088		Approved	6PGL	uc002ngw.3	O95336		ENST00000252603.2:c.133C>T	19.37:g.17622614C>T		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	8	8	NM_012088	0	0	0	18	18		Silent	SNP	ENST00000252603.2	37	CCDS12361.1																																																																																			C|0.617;T|0.383		0.736	PGLS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464154.1		
MAU2	23383	hgsc.bcm.edu	37	19	19431690	19431704	+	In_Frame_Del	DEL	GCGGCCCAGGCGGCG	GCGGCCCAGGCGGCG	-	rs553682593|rs375425486|rs550594758	byFrequency	TCGA-OR-A5LO-01A-11D-A29I-10	TCGA-OR-A5LO-10A-01D-A29L-10	GCGGCCCAGGCGGCG	GCGGCCCAGGCGGCG	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	89d60dde-b03a-4cb7-b32a-5d06fa328603	4a5886aa-889d-4ef2-89a9-be2f7a06bd58	g.chr19:19431690_19431704delGCGGCCCAGGCGGCG	ENST00000392313.6	+	1	201_215	c.22_36delGCGGCCCAGGCGGCG	c.(22-36)gcggcccaggcggcgdel	p.AAQAA13del	MAU2_ENST00000262815.8_In_Frame_Del_p.AAQAA13del|SUGP1_ENST00000585763.1_5'Flank|SUGP1_ENST00000247001.5_5'Flank|SUGP1_ENST00000334782.5_5'Flank	NM_015329.3	NP_056144.3	Q9Y6X3	SCC4_HUMAN	MAU2 sister chromatid cohesion factor	13	Ala-rich.|Sufficient for interaction with NIPBL.				maintenance of mitotic sister chromatid cohesion (GO:0034088)|mitotic cell cycle (GO:0000278)	chromatin (GO:0000785)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|SMC loading complex (GO:0032116)	protein N-terminus binding (GO:0047485)			NS(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(5)|skin(1)|upper_aerodigestive_tract(1)	18						ggcggcggcagcggcccaggcggcggcggcccagg	0.735																																					p.8_12del		.											.	MAU2-91	0			c.22_36del						.			89,1901		39,11,945						-8.2	0.6			3	148,4936		53,42,2447	no	coding	MAU2	NM_015329.3		92,53,3392	A1A1,A1R,RR		2.9111,4.4724,3.3503				237,6837				SO:0001651	inframe_deletion	23383	exon1			GCGGCAGCGGCCC	AB020699	CCDS32969.2	19p13.11	2013-08-28	2013-08-28	2013-08-28	ENSG00000129933	ENSG00000129933			29140	protein-coding gene	gene with protein product	"""sister chromatid cohesion 4"""	614560	"""KIAA0892"", ""MAU2 chromatid cohesion factor homolog (C. elegans)"""	KIAA0892		10048485	Standard	NM_015329		Approved	MGC75361, mau-2, MAU2L, SCC4	uc002nmk.4	Q9Y6X3	OTTHUMG00000150188	ENST00000392313.6:c.22_36delGCGGCCCAGGCGGCG	19.37:g.19431690_19431704delGCGGCCCAGGCGGCG	ENSP00000376127:p.Ala13_Ala17del	Somatic	4	3		WXS	Illumina GAIIx	Phase_I	49	35	NM_015329	0	0	0	0	0	Q66PT1|Q6P3S7|Q6ZTT2|Q9UFX8	In_Frame_Del	DEL	ENST00000392313.6	37	CCDS32969.2																																																																																			.		0.735	MAU2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000316748.6	NM_015329	
LTBP4	8425	broad.mit.edu	37	19	41119074	41119074	+	Silent	SNP	G	G	T			TCGA-OR-A5LO-01A-11D-A29I-10	TCGA-OR-A5LO-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	89d60dde-b03a-4cb7-b32a-5d06fa328603	4a5886aa-889d-4ef2-89a9-be2f7a06bd58	g.chr19:41119074G>T	ENST00000308370.7	+	19	2604	c.2604G>T	c.(2602-2604)gcG>gcT	p.A868A	LTBP4_ENST00000602240.1_3'UTR|LTBP4_ENST00000204005.9_Silent_p.A831A|LTBP4_ENST00000243562.9_5'Flank|LTBP4_ENST00000396819.3_Silent_p.A801A|LTBP4_ENST00000545697.1_Silent_p.A321A	NM_001042544.1	NP_001036009.1	Q8N2S1	LTBP4_HUMAN	latent transforming growth factor beta binding protein 4	868	Cys-rich.|EGF-like 9; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				extracellular matrix organization (GO:0030198)|growth hormone secretion (GO:0030252)|multicellular organismal development (GO:0007275)|protein folding (GO:0006457)|regulation of cell differentiation (GO:0045595)|regulation of cell growth (GO:0001558)|regulation of proteolysis (GO:0030162)|regulation of transforming growth factor beta receptor signaling pathway (GO:0017015)|transforming growth factor beta receptor signaling pathway (GO:0007179)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|glycosaminoglycan binding (GO:0005539)|integrin binding (GO:0005178)|transforming growth factor beta binding (GO:0050431)|transforming growth factor beta-activated receptor activity (GO:0005024)	p.A868A(1)		central_nervous_system(1)	1			Lung(22;0.000158)|LUSC - Lung squamous cell carcinoma(20;0.000384)			GCTACCGGGCGCCGTCGGGTC	0.692																																					.		.											.	LTBP4-93	1	Substitution - coding silent(1)	prostate(1)	.						.						14.0	15.0	14.0					19																	41119074		1885	4101	5986	SO:0001819	synonymous_variant	8425	.			CCGGGCGCCGTCG	Y13622	CCDS74368.1, CCDS74369.1, CCDS74370.1	19q13.1-q13.2	2011-10-20				ENSG00000090006		"""Latent transforming growth factor, beta binding proteins"""	6717	protein-coding gene	gene with protein product		604710				9660815, 9271198	Standard	NM_003573		Approved	LTBP-4, LTBP-4L, FLJ46318, FLJ90018	uc002ooh.1	Q8N2S1		ENST00000308370.7:c.2604G>T	19.37:g.41119074G>T		Somatic	14	1		WXS	Illumina GAIIx	Phase_I	55	9	.	0	0	25	25	0	O00508|O75412|O75413	Silent	SNP	ENST00000308370.7	37																																																																																				.		0.692	LTBP4-203	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding		NM_003573	
MEGF8	1954	broad.mit.edu	37	19	42867198	42867198	+	Splice_Site	SNP	A	A	G			TCGA-OR-A5LO-01A-11D-A29I-10	TCGA-OR-A5LO-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	89d60dde-b03a-4cb7-b32a-5d06fa328603	4a5886aa-889d-4ef2-89a9-be2f7a06bd58	g.chr19:42867198A>G	ENST00000251268.6	+	35	6058		c.e35-1		MEGF8_ENST00000334370.4_Splice_Site	NM_001271938.1	NP_001258867.1	Q7Z7M0	MEGF8_HUMAN	multiple EGF-like-domains 8						BMP signaling pathway (GO:0030509)|cell migration involved in gastrulation (GO:0042074)|craniofacial suture morphogenesis (GO:0097094)|determination of digestive tract left/right asymmetry (GO:0071907)|determination of heart left/right asymmetry (GO:0061371)|embryonic heart tube left/right pattern formation (GO:0060971)|embryonic heart tube morphogenesis (GO:0003143)|embryonic limb morphogenesis (GO:0030326)|embryonic skeletal system morphogenesis (GO:0048704)|epiboly involved in gastrulation with mouth forming second (GO:0055113)|fasciculation of sensory neuron axon (GO:0097155)|left/right pattern formation (GO:0060972)|limb morphogenesis (GO:0035108)|positive regulation of axon extension involved in axon guidance (GO:0048842)|regulation of gene expression (GO:0010468)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|receptor activity (GO:0004872)			breast(2)|cervix(1)|endometrium(11)|kidney(2)|large_intestine(9)|lung(20)|ovary(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	50		Prostate(69;0.00682)				CCCCACCCCCAGGGGAGACCC	0.647																																					.		.											.	MEGF8-23	0			c.6059-2A>G						.						48.0	47.0	48.0					19																	42867198		2203	4299	6502	SO:0001630	splice_region_variant	1954	exon35			ACCCCCAGGGGAG	AB011541	CCDS12604.2, CCDS62693.1	19q13.2	2011-11-24	2006-03-31	2006-03-31	ENSG00000105429	ENSG00000105429			3233	protein-coding gene	gene with protein product	"""HBV pre s2 binding protein 1"""	604267	"""EGF-like-domain, multiple 4"", ""chromosome 19 open reading frame 49"""	EGFL4, C19orf49		9693030	Standard	NM_001410		Approved	SBP1, FLJ22365	uc002otm.5	Q7Z7M0	OTTHUMG00000150342	ENST00000251268.6:c.6059-1A>G	19.37:g.42867198A>G		Somatic	105	3		WXS	Illumina GAIIx	Phase_I	145	8	NM_001271938	0	0	0	0	0	A8KAY0|O75097	Splice_Site	SNP	ENST00000251268.6	37		.	.	.	.	.	.	.	.	.	.	A	17.01	3.280451	0.59758	.	.	ENSG00000105429	ENST00000334370;ENST00000251268	.	.	.	5.11	5.11	0.69529	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.2039	0.65721	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	MEGF8	47559038	1.000000	0.71417	0.940000	0.37924	0.497000	0.33675	8.203000	0.89739	2.067000	0.61834	0.416000	0.27883	.	.		0.647	MEGF8-002	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000463854.1	NM_001410	Intron
ZNF112	7771	broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	44832623	44832623	+	Missense_Mutation	SNP	G	G	C			TCGA-OR-A5LO-01A-11D-A29I-10	TCGA-OR-A5LO-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	89d60dde-b03a-4cb7-b32a-5d06fa328603	4a5886aa-889d-4ef2-89a9-be2f7a06bd58	g.chr19:44832623G>C	ENST00000337401.4	-	5	1793	c.1705C>G	c.(1705-1707)Caa>Gaa	p.Q569E	ZNF112_ENST00000354340.4_Missense_Mutation_p.Q563E|ZNF112_ENST00000536500.1_Missense_Mutation_p.Q586E	NM_001083335.1	NP_001076804.1	Q9UJU3	ZN112_HUMAN	zinc finger protein 112	569					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)										TGATGGGCTTGAAGATATGAA	0.428																																					p.Q569E		.											.	ZFP112-95	0			c.C1705G						.						153.0	157.0	156.0					19																	44832623		2203	4300	6503	SO:0001583	missense	7771	exon5			GGGCTTGAAGATA	AF198358		19q13.2	2014-02-06	2012-11-27		ENSG00000062370	ENSG00000062370		"""Zinc fingers, C2H2-type"""	12892	protein-coding gene	gene with protein product		603994	"""zinc finger protein 112 homolog (mouse)"", ""zinc finger protein 228"""	ZFP112, ZNF228			Standard	NM_013380		Approved			Q9UJU3	OTTHUMG00000182357	ENST00000337401.4:c.1705C>G	19.37:g.44832623G>C	ENSP00000337081:p.Gln569Glu	Somatic	74	1		WXS	Illumina GAIIx	Phase_I	108	13	NM_001083335	0	0	11	14	3	A4FU53|Q9HCA7	Missense_Mutation	SNP	ENST00000337401.4	37	CCDS54276.1	.	.	.	.	.	.	.	.	.	.	G	7.753	0.703758	0.15172	.	.	ENSG00000062370	ENST00000337401;ENST00000412927;ENST00000354340;ENST00000536500;ENST00000253426	T;T;T	0.38560	1.13;1.13;1.13	5.1	2.86	0.33363	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.33005	N	0.005388	T	0.27241	0.0668	N	0.20357	0.565	0.09310	N	1	B;P;B	0.35714	0.398;0.517;0.398	B;B;B	0.44085	0.44;0.313;0.44	T	0.09907	-1.0653	10	0.22109	T	0.4	-10.7358	3.334	0.07094	0.0946:0.2467:0.5044:0.1544	.	568;586;569	B4DYT4;F5GWS7;Q9UJU3	.;.;ZF112_HUMAN	E	569;569;563;586;568	ENSP00000337081:Q569E;ENSP00000346305:Q563E;ENSP00000441990:Q586E	ENSP00000253426:Q568E	Q	-	1	0	ZNF285	49524463	0.000000	0.05858	1.000000	0.80357	0.998000	0.95712	-0.431000	0.06965	2.541000	0.85698	0.655000	0.94253	CAA	.		0.428	ZNF112-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000460744.1	NM_013380	
ERCC2	2068	hgsc.bcm.edu	37	19	45867259	45867259	+	Missense_Mutation	SNP	C	C	T	rs1799793	byFrequency	TCGA-OR-A5LO-01A-11D-A29I-10	TCGA-OR-A5LO-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	89d60dde-b03a-4cb7-b32a-5d06fa328603	4a5886aa-889d-4ef2-89a9-be2f7a06bd58	g.chr19:45867259C>T	ENST00000391945.4	-	10	1011	c.934G>A	c.(934-936)Gac>Aac	p.D312N	ERCC2_ENST00000485403.2_Missense_Mutation_p.D288N|ERCC2_ENST00000221481.6_3'UTR|ERCC2_ENST00000391944.3_Missense_Mutation_p.D234N|ERCC2_ENST00000391940.4_Missense_Mutation_p.D288N	NM_000400.3	NP_000391.1	P18074	ERCC2_HUMAN	excision repair cross-complementation group 2	312			D -> N (in dbSNP:rs1799793). {ECO:0000269|PubMed:11245433, ECO:0000269|PubMed:11470747, ECO:0000269|PubMed:11709541, ECO:0000269|Ref.3}.		7-methylguanosine mRNA capping (GO:0006370)|aging (GO:0007568)|apoptotic process (GO:0006915)|ATP catabolic process (GO:0006200)|bone mineralization (GO:0030282)|cell proliferation (GO:0008283)|central nervous system myelin formation (GO:0032289)|chromosome segregation (GO:0007059)|DNA duplex unwinding (GO:0032508)|DNA repair (GO:0006281)|embryonic cleavage (GO:0040016)|erythrocyte maturation (GO:0043249)|extracellular matrix organization (GO:0030198)|gene expression (GO:0010467)|hair cell differentiation (GO:0035315)|hair follicle maturation (GO:0048820)|hematopoietic stem cell differentiation (GO:0060218)|in utero embryonic development (GO:0001701)|multicellular organism growth (GO:0035264)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA damage removal (GO:0000718)|nucleotide-excision repair, DNA incision (GO:0033683)|positive regulation of DNA binding (GO:0043388)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of viral transcription (GO:0050434)|post-embryonic development (GO:0009791)|protein phosphorylation (GO:0006468)|regulation of mitotic cell cycle phase transition (GO:1901990)|response to hypoxia (GO:0001666)|response to oxidative stress (GO:0006979)|small molecule metabolic process (GO:0044281)|spinal cord development (GO:0021510)|termination of RNA polymerase I transcription (GO:0006363)|transcription elongation from RNA polymerase I promoter (GO:0006362)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase I promoter (GO:0006360)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase I promoter (GO:0006361)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription-coupled nucleotide-excision repair (GO:0006283)|UV protection (GO:0009650)|viral process (GO:0016032)	cytoplasm (GO:0005737)|holo TFIIH complex (GO:0005675)|MMXD complex (GO:0071817)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle (GO:0005819)	4 iron, 4 sulfur cluster binding (GO:0051539)|5'-3' DNA helicase activity (GO:0043139)|ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|DNA binding (GO:0003677)|DNA-dependent ATPase activity (GO:0008094)|metal ion binding (GO:0046872)|protein C-terminus binding (GO:0008022)|protein N-terminus binding (GO:0047485)			large_intestine(4)|lung(2)|ovary(1)|pancreas(1)|stomach(1)	9		Ovarian(192;0.0728)|all_neural(266;0.112)		OV - Ovarian serous cystadenocarcinoma(262;0.0226)		AGCACTTCGTCGGGCAGCACG	0.746			"""Mis, N, F, S"""			"""skin basal cell, skin squamous cell, melanoma"""		Nucleotide excision repair (NER)	Xeroderma Pigmentosum				C|||	974	0.194489	0.0734	0.1988	5008	,	,		10423	0.0496		0.3588	False		,,,				2504	0.3354				p.D312N		.	yes	Rec		Xeroderma pigmentosum (D)	19	19q13.2-q13.3	2068	"""excision repair cross-complementing rodent repair deficiency, complementation group 2 (xeroderma pigmentosum D)"""		E	.	ERCC2-848	0			c.G934A	GRCh37	CM015299	ERCC2	M	rs1799793	.	C	ASN/ASP,ASN/ASP	387,3577		30,327,1625	5.0	8.0	7.0		934,862	5.2	0.5	19	dbSNP_89	7	2507,5397		444,1619,1889	no	missense,missense	ERCC2	NM_000400.3,NM_001130867.1	23,23	474,1946,3514	TT,TC,CC		31.7181,9.7629,24.3849	benign,benign	312/761,288/406	45867259	2894,8974	1982	3952	5934	SO:0001583	missense	2068	exon10	Familial Cancer Database	incl. XPA, XPB, XPC, XPD, XPE, XPF, XPG, XP Variant, XPV	CTTCGTCGGGCAG		CCDS33049.1, CCDS46112.1	19q13.3	2014-09-17	2014-03-07		ENSG00000104884	ENSG00000104884	3.6.4.12	"""General transcription factor IIH complex subunits"""	3434	protein-coding gene	gene with protein product	"""excision repair cross-complementing rodent repair deficiency, complementation group 2 protein"", ""TFIIH basal transcription factor complex helicase XPB subunit"""	126340	"""xeroderma pigmentosum complementary group D"", ""excision repair cross-complementing rodent repair deficiency, complementation group 2"""	XPD		8413672, 2184031	Standard	NM_000400		Approved	MAG, EM9, MGC102762, MGC126218, MGC126219, TFIIH	uc002pbj.2	P18074	OTTHUMG00000048190	ENST00000391945.4:c.934G>A	19.37:g.45867259C>T	ENSP00000375809:p.Asp312Asn	Somatic	2	0		WXS	Illumina GAIIx	Phase_I	13	7	NM_000400	0	0	12	23	11	Q2TB78|Q2YDY2|Q7KZU6|Q8N721	Missense_Mutation	SNP	ENST00000391945.4	37	CCDS33049.1	423	0.1936813186813187	34	0.06910569105691057	70	0.19337016574585636	38	0.06643356643356643	281	0.370712401055409	C	20.0	3.930510	0.73327	0.097629	0.317181	ENSG00000104884	ENST00000391941;ENST00000391942;ENST00000391945;ENST00000391944;ENST00000391940	T;T;T	0.64438	-0.1;-0.1;-0.1	5.15	5.15	0.70609	Domain of unknown function DUF1227 (1);	0.000000	0.85682	D	0.000000	T	0.00012	0.0000	L	0.46947	1.48	0.09310	P	1.0	B;P;B	0.34639	0.065;0.461;0.053	B;B;B	0.35353	0.059;0.201;0.051	T	0.28267	-1.0049	9	0.33940	T	0.23	-30.0006	16.1268	0.81402	0.0:1.0:0.0:0.0	rs1799793;rs3916814;rs58989209;rs1799793	234;288;312	E7EVE9;Q7KZU6;P18074	.;.;ERCC2_HUMAN	N	262;288;312;234;288	ENSP00000375809:D312N;ENSP00000375808:D234N;ENSP00000375804:D288N	ENSP00000375804:D288N	D	-	1	0	ERCC2	50559099	1.000000	0.71417	0.523000	0.27875	0.865000	0.49528	7.192000	0.77771	2.388000	0.81334	0.561000	0.74099	GAC	C|0.804;T|0.196		0.746	ERCC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109626.2	NM_000400	
GIPR	2696	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	46176189	46176189	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5LO-01A-11D-A29I-10	TCGA-OR-A5LO-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	89d60dde-b03a-4cb7-b32a-5d06fa328603	4a5886aa-889d-4ef2-89a9-be2f7a06bd58	g.chr19:46176189C>T	ENST00000590918.1	+	5	460	c.361C>T	c.(361-363)Cca>Tca	p.P121S	MIR642A_ENST00000385039.1_RNA|GIPR_ENST00000263281.3_Missense_Mutation_p.P121S|GIPR_ENST00000304207.8_Missense_Mutation_p.P85S	NM_000164.2	NP_000155.1	P48546	GIPR_HUMAN	gastric inhibitory polypeptide receptor	121					activation of adenylate cyclase activity (GO:0007190)|cell surface receptor signaling pathway (GO:0007166)|desensitization of G-protein coupled receptor protein signaling pathway (GO:0002029)|endocrine pancreas development (GO:0031018)|generation of precursor metabolites and energy (GO:0006091)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of insulin secretion (GO:0032024)|response to axon injury (GO:0048678)|response to calcium ion (GO:0051592)|response to fatty acid (GO:0070542)|response to glucose (GO:0009749)|response to nutrient (GO:0007584)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	gastric inhibitory peptide receptor activity (GO:0016519)|peptide hormone binding (GO:0017046)|transmembrane signaling receptor activity (GO:0004888)			endometrium(1)|kidney(2)|lung(5)|prostate(1)|skin(2)|urinary_tract(1)	12		Ovarian(192;0.051)|all_neural(266;0.112)		OV - Ovarian serous cystadenocarcinoma(262;0.0056)|GBM - Glioblastoma multiforme(486;0.0832)|Epithelial(262;0.199)		ATGTGAGAACCCAGAGAAGAA	0.537																																					p.P121S		.											.	GIPR-523	0			c.C361T						.						109.0	94.0	99.0					19																	46176189		2203	4300	6503	SO:0001583	missense	2696	exon5			GAGAACCCAGAGA		CCDS12671.1	19q13.2-q13.3	2012-08-10				ENSG00000010310		"""GPCR / Class B : Glucagon receptors"""	4271	protein-coding gene	gene with protein product		137241				7490109	Standard	NM_000164		Approved		uc002pcu.1	P48546		ENST00000590918.1:c.361C>T	19.37:g.46176189C>T	ENSP00000467494:p.Pro121Ser	Somatic	115	0		WXS	Illumina GAIIx	Phase_I	151	30	NM_000164	0	0	0	0	0	B7WP14|B7ZKQ0|Q14401|Q16400|Q52M04|Q9UPI1	Missense_Mutation	SNP	ENST00000590918.1	37	CCDS12671.1	.	.	.	.	.	.	.	.	.	.	C	5.605	0.296302	0.10622	.	.	ENSG00000010310	ENST00000263281;ENST00000304207	T;T	0.56776	0.44;0.6	4.81	4.81	0.61882	GPCR, family 2, extracellular hormone receptor domain (2);	0.000000	0.49916	D	0.000124	T	0.47838	0.1467	L	0.28274	0.84	0.37216	D	0.905003	B;D;B	0.57257	0.232;0.979;0.057	B;P;B	0.55508	0.113;0.777;0.113	T	0.40646	-0.9552	10	0.06494	T	0.89	.	13.25	0.60045	0.0:1.0:0.0:0.0	.	85;121;121	B7WP14;P48546;P48546-2	.;GIPR_HUMAN;.	S	121;85	ENSP00000263281:P121S;ENSP00000305321:P85S	ENSP00000263281:P121S	P	+	1	0	GIPR	50868029	0.973000	0.33851	1.000000	0.80357	0.929000	0.56500	1.726000	0.38085	2.504000	0.84457	0.561000	0.74099	CCA	.		0.537	GIPR-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000459640.1		
SLC1A5	6510	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	47278856	47278856	+	Missense_Mutation	SNP	G	G	C			TCGA-OR-A5LO-01A-11D-A29I-10	TCGA-OR-A5LO-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	89d60dde-b03a-4cb7-b32a-5d06fa328603	4a5886aa-889d-4ef2-89a9-be2f7a06bd58	g.chr19:47278856G>C	ENST00000542575.2	-	8	2165	c.1537C>G	c.(1537-1539)Ccc>Gcc	p.P513A	SLC1A5_ENST00000412532.2_Missense_Mutation_p.P285A|FKRP_ENST00000600646.1_Intron|SLC1A5_ENST00000434726.2_Missense_Mutation_p.P311A|SLC1A5_ENST00000594991.1_Missense_Mutation_p.P337A	NM_005628.2	NP_005619.1	Q15758	AAAT_HUMAN	solute carrier family 1 (neutral amino acid transporter), member 5	513					amino acid transport (GO:0006865)|extracellular amino acid transport (GO:0006860)|glutamine transport (GO:0006868)|ion transport (GO:0006811)|neutral amino acid transport (GO:0015804)|transmembrane transport (GO:0055085)	extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	L-glutamine transmembrane transporter activity (GO:0015186)|L-serine transmembrane transporter activity (GO:0015194)|neutral amino acid transmembrane transporter activity (GO:0015175)|receptor activity (GO:0004872)|sodium:dicarboxylate symporter activity (GO:0017153)|virus receptor activity (GO:0001618)			cervix(1)|endometrium(3)|kidney(3)|large_intestine(3)|lung(2)|stomach(1)	13		all_epithelial(76;0.00314)|Ovarian(192;0.0798)|all_neural(266;0.107)		OV - Ovarian serous cystadenocarcinoma(262;0.000338)|all cancers(93;0.000882)|Epithelial(262;0.0211)|GBM - Glioblastoma multiforme(486;0.0341)	L-Asparagine(DB00174)|L-Glutamine(DB00130)	TCCTCAGTGGGGACTGGCAGC	0.582																																					p.P513A		.											.	SLC1A5-90	0			c.C1537G						.						144.0	144.0	144.0					19																	47278856		2203	4300	6503	SO:0001583	missense	6510	exon8			CAGTGGGGACTGG	U53347	CCDS12692.1, CCDS46125.1, CCDS46126.1	19q13.32	2013-07-15			ENSG00000105281	ENSG00000105281		"""Solute carriers"""	10943	protein-coding gene	gene with protein product		109190		RDRC, M7V1		8702519, 10051606	Standard	NM_005628		Approved	AAAT, ASCT2	uc002pfs.3	Q15758	OTTHUMG00000183434	ENST00000542575.2:c.1537C>G	19.37:g.47278856G>C	ENSP00000444408:p.Pro513Ala	Somatic	101	0		WXS	Illumina GAIIx	Phase_I	112	17	NM_005628	0	0	0	0	0	A8K9H5|B4DR77|B4DWS4|B7ZB81|D0EYG6|E9PC01|O95720|Q96RL9|Q9BWQ3|Q9UNP2	Missense_Mutation	SNP	ENST00000542575.2	37	CCDS12692.1	.	.	.	.	.	.	.	.	.	.	-	10.14	1.268107	0.23136	.	.	ENSG00000105281	ENST00000542575;ENST00000434726;ENST00000412532;ENST00000306894	T;T;T	0.61859	0.89;0.07;0.08	4.58	-0.278	0.12894	.	0.509628	0.19842	N	0.104825	T	0.23249	0.0562	N	0.04508	-0.205	0.09310	N	1	B;B;B	0.06786	0.001;0.001;0.001	B;B;B	0.04013	0.001;0.001;0.001	T	0.17379	-1.0371	10	0.07644	T	0.81	-15.7083	3.6723	0.08279	0.0811:0.2624:0.4031:0.2534	.	311;513;513	E9PC01;Q15758;Q71UA6	.;AAAT_HUMAN;.	A	513;311;285;520	ENSP00000444408:P513A;ENSP00000406532:P311A;ENSP00000397924:P285A	ENSP00000303623:P520A	P	-	1	0	SLC1A5	51970696	0.000000	0.05858	0.006000	0.13384	0.438000	0.31896	-0.469000	0.06648	0.210000	0.20664	-0.284000	0.09977	CCC	.		0.582	SLC1A5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466630.1		
GLTSCR1	29998	hgsc.bcm.edu	37	19	48184063	48184063	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5LO-01A-11D-A29I-10	TCGA-OR-A5LO-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	89d60dde-b03a-4cb7-b32a-5d06fa328603	4a5886aa-889d-4ef2-89a9-be2f7a06bd58	g.chr19:48184063C>T	ENST00000396720.3	+	6	1830	c.1636C>T	c.(1636-1638)Ccc>Tcc	p.P546S	CTD-2571L23.8_ENST00000599924.1_lincRNA	NM_015711.3	NP_056526.3	Q9NZM4	GSCR1_HUMAN	glioma tumor suppressor candidate region gene 1	546										breast(2)|endometrium(1)|kidney(1)|large_intestine(4)|lung(3)|pancreas(3)|prostate(4)|skin(2)	20		all_cancers(25;1.8e-07)|all_lung(116;5.73e-06)|Lung NSC(112;9.69e-06)|all_epithelial(76;2.42e-05)|all_neural(266;0.0332)|Ovarian(192;0.086)		all cancers(93;0.000358)|OV - Ovarian serous cystadenocarcinoma(262;0.000576)|Epithelial(262;0.0212)|GBM - Glioblastoma multiforme(486;0.0355)		CTCCGCCGCTCCCATCCAGGT	0.751																																					p.P546S		.											.	GLTSCR1-48	0			c.C1636T						.						14.0	17.0	16.0					19																	48184063		1785	3878	5663	SO:0001583	missense	29998	exon6			GCCGCTCCCATCC	AF182077	CCDS46134.1	19q13.3	2012-11-29			ENSG00000063169	ENSG00000063169			4332	protein-coding gene	gene with protein product		605690				10708517	Standard	NM_015711		Approved		uc002phh.4	Q9NZM4		ENST00000396720.3:c.1636C>T	19.37:g.48184063C>T	ENSP00000379946:p.Pro546Ser	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	49	9	NM_015711	0	0	2	2	0	A8MW01	Missense_Mutation	SNP	ENST00000396720.3	37	CCDS46134.1	.	.	.	.	.	.	.	.	.	.	C	10.68	1.419190	0.25552	.	.	ENSG00000063169	ENST00000396720	T	0.76448	-1.02	4.57	4.57	0.56435	.	.	.	.	.	T	0.81230	0.4779	L	0.43152	1.355	0.45837	D	0.998709	D	0.76494	0.999	D	0.63033	0.91	T	0.81095	-0.1088	9	0.46703	T	0.11	.	12.4212	0.55522	0.0:0.8302:0.1698:0.0	.	546	Q9NZM4	GSCR1_HUMAN	S	546	ENSP00000379946:P546S	ENSP00000379946:P546S	P	+	1	0	GLTSCR1	52875875	1.000000	0.71417	0.981000	0.43875	0.935000	0.57460	5.423000	0.66458	2.249000	0.74217	0.462000	0.41574	CCC	.		0.751	GLTSCR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465846.1	NM_015711	
HRC	3270	hgsc.bcm.edu	37	19	49657889	49657889	+	Silent	SNP	T	T	C	rs57199624|rs147238387|rs551367394|rs542091249		TCGA-OR-A5LO-01A-11D-A29I-10	TCGA-OR-A5LO-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	89d60dde-b03a-4cb7-b32a-5d06fa328603	4a5886aa-889d-4ef2-89a9-be2f7a06bd58	g.chr19:49657889T>C	ENST00000252825.4	-	1	792	c.606A>G	c.(604-606)gaA>gaG	p.E202E	HRC_ENST00000595625.1_Silent_p.E202E	NM_002152.2	NP_002143.1	P23327	SRCH_HUMAN	histidine rich calcium binding protein	202	4 X tandem repeats, acidic.|6 X approximate tandem repeats.|Glu-rich (acidic).				cytosolic calcium ion homeostasis (GO:0051480)|muscle contraction (GO:0006936)|positive regulation of heart contraction (GO:0045823)|positive regulation of heart rate (GO:0010460)|positive regulation of relaxation of cardiac muscle (GO:1901899)|regulation of calcium ion transmembrane transport (GO:1903169)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of cell communication by electrical coupling involved in cardiac conduction (GO:1901844)|regulation of heart rate (GO:0002027)|regulation of peptidyl-serine phosphorylation (GO:0033135)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)|regulation of ryanodine-sensitive calcium-release channel activity (GO:0060314)	sarcoplasmic reticulum lumen (GO:0033018)|sarcoplasmic reticulum membrane (GO:0033017)|Z disc (GO:0030018)	ATPase binding (GO:0051117)|calcium ion binding (GO:0005509)|ion channel binding (GO:0044325)			endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(10)|lung(10)|ovary(1)|prostate(3)|urinary_tract(2)	34		all_lung(116;3.16e-06)|Lung NSC(112;6.25e-06)|all_neural(266;0.0189)|Ovarian(192;0.0392)		all cancers(93;2.01e-05)|OV - Ovarian serous cystadenocarcinoma(262;0.00019)|GBM - Glioblastoma multiforme(486;0.00279)|Epithelial(262;0.00622)		AGGcctcctcttcctcctcct	0.567																																					p.E202E	Melanoma(37;75 1097 24567 25669 30645)	.											.	HRC-91	0			c.A606G						.						122.0	91.0	101.0					19																	49657889		2203	4300	6503	SO:0001819	synonymous_variant	3270	exon1			CTCCTCTTCCTCC		CCDS12759.1	19q13.3	2008-07-16	2001-11-28			ENSG00000130528			5178	protein-coding gene	gene with protein product		142705	"""histidine-rich calcium-binding protein"""			2037293	Standard	XR_243928		Approved	MGC133236	uc002pmv.3	P23327		ENST00000252825.4:c.606A>G	19.37:g.49657889T>C		Somatic	73	0		WXS	Illumina GAIIx	Phase_I	110	5	NM_002152	0	0	0	0	0	Q504Y6	Silent	SNP	ENST00000252825.4	37	CCDS12759.1																																																																																			.		0.567	HRC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465649.1	NM_002152	
HRC	3270	hgsc.bcm.edu	37	19	49657916	49657916	+	Silent	SNP	T	T	C	rs7409255		TCGA-OR-A5LO-01A-11D-A29I-10	TCGA-OR-A5LO-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	89d60dde-b03a-4cb7-b32a-5d06fa328603	4a5886aa-889d-4ef2-89a9-be2f7a06bd58	g.chr19:49657916T>C	ENST00000252825.4	-	1	765	c.579A>G	c.(577-579)gaA>gaG	p.E193E	HRC_ENST00000595625.1_Silent_p.E193E	NM_002152.2	NP_002143.1	P23327	SRCH_HUMAN	histidine rich calcium binding protein	193	4 X tandem repeats, acidic.|6 X approximate tandem repeats.|Glu-rich (acidic).				cytosolic calcium ion homeostasis (GO:0051480)|muscle contraction (GO:0006936)|positive regulation of heart contraction (GO:0045823)|positive regulation of heart rate (GO:0010460)|positive regulation of relaxation of cardiac muscle (GO:1901899)|regulation of calcium ion transmembrane transport (GO:1903169)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of cell communication by electrical coupling involved in cardiac conduction (GO:1901844)|regulation of heart rate (GO:0002027)|regulation of peptidyl-serine phosphorylation (GO:0033135)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)|regulation of ryanodine-sensitive calcium-release channel activity (GO:0060314)	sarcoplasmic reticulum lumen (GO:0033018)|sarcoplasmic reticulum membrane (GO:0033017)|Z disc (GO:0030018)	ATPase binding (GO:0051117)|calcium ion binding (GO:0005509)|ion channel binding (GO:0044325)			endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(10)|lung(10)|ovary(1)|prostate(3)|urinary_tract(2)	34		all_lung(116;3.16e-06)|Lung NSC(112;6.25e-06)|all_neural(266;0.0189)|Ovarian(192;0.0392)		all cancers(93;2.01e-05)|OV - Ovarian serous cystadenocarcinoma(262;0.00019)|GBM - Glioblastoma multiforme(486;0.00279)|Epithelial(262;0.00622)		cctcctcctcttcTCCTTCAT	0.557																																					p.E193E	Melanoma(37;75 1097 24567 25669 30645)	.											.	HRC-91	0			c.A579G						.						119.0	95.0	103.0					19																	49657916		2203	4300	6503	SO:0001819	synonymous_variant	3270	exon1			CTCCTCTTCTCCT		CCDS12759.1	19q13.3	2008-07-16	2001-11-28			ENSG00000130528			5178	protein-coding gene	gene with protein product		142705	"""histidine-rich calcium-binding protein"""			2037293	Standard	XR_243928		Approved	MGC133236	uc002pmv.3	P23327		ENST00000252825.4:c.579A>G	19.37:g.49657916T>C		Somatic	82	0		WXS	Illumina GAIIx	Phase_I	100	6	NM_002152	0	0	0	0	0	Q504Y6	Silent	SNP	ENST00000252825.4	37	CCDS12759.1																																																																																			.		0.557	HRC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465649.1	NM_002152	
ZNF83	55769	bcgsc.ca	37	19	53116865	53116865	+	Missense_Mutation	SNP	T	T	C	rs141749555		TCGA-OR-A5LO-01A-11D-A29I-10	TCGA-OR-A5LO-10A-01D-A29L-10	T	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	89d60dde-b03a-4cb7-b32a-5d06fa328603	4a5886aa-889d-4ef2-89a9-be2f7a06bd58	g.chr19:53116865T>C	ENST00000597597.1	-	2	3206	c.953A>G	c.(952-954)aAa>aGa	p.K318R	ZNF83_ENST00000391789.4_Missense_Mutation_p.K290R|ZNF83_ENST00000544146.1_Missense_Mutation_p.K318R|ZNF83_ENST00000601257.1_Intron|ZNF83_ENST00000301096.3_Missense_Mutation_p.K318R|ZNF83_ENST00000536937.1_Missense_Mutation_p.K318R|ZNF83_ENST00000545872.1_Missense_Mutation_p.K318R|ZNF83_ENST00000594682.2_3'UTR|ZNF83_ENST00000541777.2_Missense_Mutation_p.K318R|ZNF83_ENST00000600714.1_Intron			P51522	ZNF83_HUMAN	zinc finger protein 83	318					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(1)|kidney(1)|large_intestine(8)|lung(3)|ovary(1)|prostate(1)|upper_aerodigestive_tract(2)	18				OV - Ovarian serous cystadenocarcinoma(262;0.00841)|GBM - Glioblastoma multiforme(134;0.0244)		CTCATTACATTTGTAAGGTTT	0.413																																					p.K318R		.											.	ZNF83-91	0			c.A953G						.						98.0	104.0	102.0					19																	53116865		2203	4300	6503	SO:0001583	missense	55769	exon3			TTACATTTGTAAG	M27877	CCDS12854.1	19q13.3	2013-01-08	2006-05-12			ENSG00000167766		"""Zinc fingers, C2H2-type"""	13158	protein-coding gene	gene with protein product		194558	"""zinc finger protein 83 (HPF1)"", ""zinc finger protein 816B"""	ZNF816B		8088807	Standard	NM_018300		Approved	FLJ11015, HPF1	uc010epy.3	P51522		ENST00000597597.1:c.953A>G	19.37:g.53116865T>C	ENSP00000472619:p.Lys318Arg	Somatic	121	0		WXS	Illumina GAIIx	Phase_I	187	9	NM_018300	0	0	216	216	0	A8MT75|Q3ZCX0|Q6PI08	Missense_Mutation	SNP	ENST00000597597.1	37	CCDS12854.1	.	.	.	.	.	.	.	.	.	.	N	8.722	0.914503	0.17907	.	.	ENSG00000167766	ENST00000536937;ENST00000301096;ENST00000544146;ENST00000434535;ENST00000545872;ENST00000541777;ENST00000391789	T;T;T;T;T;T	0.19938	2.11;2.11;2.11;2.11;2.11;2.11	2.16	1.09	0.20402	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.22551	0.0544	N	0.16201	0.385	0.09310	N	1	B;D	0.69078	0.017;0.997	B;D	0.81914	0.01;0.995	T	0.10706	-1.0618	9	0.54805	T	0.06	.	3.4318	0.07432	0.0:0.144:0.2323:0.6237	.	290;318	P51522-2;P51522	.;ZNF83_HUMAN	R	318;318;318;290;318;318;290	ENSP00000445993:K318R;ENSP00000301096:K318R;ENSP00000445470:K318R;ENSP00000440713:K318R;ENSP00000439681:K318R;ENSP00000375666:K290R	ENSP00000301096:K318R	K	-	2	0	ZNF83	57808677	0.000000	0.05858	0.706000	0.30403	0.082000	0.17680	-0.250000	0.08830	0.101000	0.17610	-0.540000	0.04249	AAA	T|1.000;C|0.000		0.413	ZNF83-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463700.1	NM_018300	
NLRP12	91662	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	54313435	54313435	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5LO-01A-11D-A29I-10	TCGA-OR-A5LO-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	89d60dde-b03a-4cb7-b32a-5d06fa328603	4a5886aa-889d-4ef2-89a9-be2f7a06bd58	g.chr19:54313435G>A	ENST00000324134.6	-	3	1646	c.1478C>T	c.(1477-1479)gCc>gTc	p.A493V	NLRP12_ENST00000345770.5_Missense_Mutation_p.A493V|NLRP12_ENST00000354278.3_Missense_Mutation_p.A493V|NLRP12_ENST00000391772.1_Missense_Mutation_p.A493V|NLRP12_ENST00000351894.4_Missense_Mutation_p.A493V|NLRP12_ENST00000535162.1_Missense_Mutation_p.A493V|NLRP12_ENST00000391773.1_Missense_Mutation_p.A493V|NLRP12_ENST00000391775.3_Missense_Mutation_p.A493V	NM_001277126.1|NM_144687.2	NP_001264055.1|NP_653288.1	P59046	NAL12_HUMAN	NLR family, pyrin domain containing 12	493	NACHT. {ECO:0000255|PROSITE- ProRule:PRU00136}.				activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|cellular response to cytokine stimulus (GO:0071345)|dendritic cell migration (GO:0036336)|negative regulation of cytokine secretion (GO:0050710)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of inflammatory response (GO:0050728)|negative regulation of interleukin-1 secretion (GO:0050711)|negative regulation of interleukin-6 biosynthetic process (GO:0045409)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of NIK/NF-kappaB signaling (GO:1901223)|negative regulation of protein autophosphorylation (GO:0031953)|negative regulation of signal transduction (GO:0009968)|negative regulation of Toll signaling pathway (GO:0045751)|positive regulation of inflammatory response (GO:0050729)|positive regulation of interleukin-1 beta secretion (GO:0050718)|positive regulation of MHC class I biosynthetic process (GO:0045345)|regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043281)|regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043122)|regulation of interleukin-18 biosynthetic process (GO:0045381)|release of cytoplasmic sequestered NF-kappaB (GO:0008588)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|cysteine-type endopeptidase activator activity involved in apoptotic process (GO:0008656)			NS(1)|breast(4)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(17)|liver(1)|lung(36)|ovary(5)|pancreas(2)|skin(3)|upper_aerodigestive_tract(5)|urinary_tract(1)	80	Ovarian(34;0.19)			GBM - Glioblastoma multiforme(134;0.026)		GTTGAGGAAGGCAGAGACGTC	0.502																																					p.N493I		.											.	NLRP12-211	0			c.A1478T						.						121.0	121.0	121.0					19																	54313435		2203	4300	6503	SO:0001583	missense	91662	exon3			AGGAAGGCAGAGA	AY095146	CCDS12864.1, CCDS62784.1, CCDS62785.1	19q13.42	2014-09-17	2006-12-08	2006-12-08	ENSG00000142405	ENSG00000142405		"""Nucleotide-binding domain and leucine rich repeat containing"""	22938	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 12"""	609648	"""NACHT, leucine rich repeat and PYD containing 12"""	NALP12		12563287, 12019269	Standard	NM_001277129		Approved	RNO2, PYPAF7, Monarch1, PAN6, CLR19.3	uc002qcj.5	P59046	OTTHUMG00000060776	ENST00000324134.6:c.1478C>T	19.37:g.54313435G>A	ENSP00000319377:p.Ala493Val	Somatic	157	0		WXS	Illumina GAIIx	Phase_I	257	41	NM_144687	0	0	0	0	0	A8MTQ2|B3KTE7|Q8NEU4|Q9BY26	Missense_Mutation	SNP	ENST00000324134.6	37	CCDS12864.1	.	.	.	.	.	.	.	.	.	.	G	11.71	1.718411	0.30503	.	.	ENSG00000142405	ENST00000324134;ENST00000535162;ENST00000351894;ENST00000354278;ENST00000391775;ENST00000391773;ENST00000345770;ENST00000391772	T;T;T;T;T;T;T	0.78924	-1.22;-1.22;-1.22;-1.22;-1.22;-1.22;-1.22	4.43	4.43	0.53597	NACHT nucleoside triphosphatase (1);	0.449473	0.16320	N	0.219616	T	0.66025	0.2748	L	0.28344	0.845	0.80722	D	1	P;P;P;P	0.42456	0.78;0.657;0.78;0.709	B;B;B;B	0.40901	0.335;0.255;0.335;0.343	T	0.63721	-0.6573	10	0.30854	T	0.27	.	10.9758	0.47465	0.0:0.19:0.81:0.0	.	493;493;493;493	F2Z321;A8K407;A8MTQ2;P59046	.;.;.;NAL12_HUMAN	V	493	ENSP00000319377:A493V;ENSP00000438030:A493V;ENSP00000340473:A493V;ENSP00000346231:A493V;ENSP00000375655:A493V;ENSP00000375653:A493V;ENSP00000375652:A493V	ENSP00000319377:A493V	A	-	2	0	NLRP12	59005247	0.767000	0.28508	0.892000	0.35008	0.399000	0.30720	1.476000	0.35420	2.185000	0.69588	0.485000	0.47835	GCC	.		0.502	NLRP12-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000134340.1	NM_144687	
NLRP9	338321	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	56226564	56226564	+	Silent	SNP	G	G	C			TCGA-OR-A5LO-01A-11D-A29I-10	TCGA-OR-A5LO-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	89d60dde-b03a-4cb7-b32a-5d06fa328603	4a5886aa-889d-4ef2-89a9-be2f7a06bd58	g.chr19:56226564G>C	ENST00000332836.2	-	6	2385	c.2358C>G	c.(2356-2358)gtC>gtG	p.V786V		NM_176820.2	NP_789790.2	Q7RTR0	NALP9_HUMAN	NLR family, pyrin domain containing 9	786						cytoplasm (GO:0005737)	ATP binding (GO:0005524)			NS(2)|breast(5)|cervix(1)|endometrium(7)|kidney(8)|large_intestine(15)|lung(21)|ovary(2)|prostate(3)|skin(7)|urinary_tract(3)	74		Colorectal(82;0.000133)|Ovarian(87;0.133)		GBM - Glioblastoma multiforme(193;0.123)		AGTCACAGGAGACAGAGGTGA	0.512																																					p.V786V		.											.	NLRP9-294	0			c.C2358G						.						120.0	97.0	105.0					19																	56226564		2201	4293	6494	SO:0001819	synonymous_variant	338321	exon6			ACAGGAGACAGAG	AY154464	CCDS12934.1	19q13.43	2006-12-08	2006-12-08	2006-12-08				"""Nucleotide-binding domain and leucine rich repeat containing"""	22941	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 9"""	609663	"""NACHT, leucine rich repeat and PYD containing 9"""	NALP9		12563287	Standard	NM_176820		Approved	NOD6, PAN12, CLR19.1	uc002qly.3	Q7RTR0		ENST00000332836.2:c.2358C>G	19.37:g.56226564G>C		Somatic	130	0		WXS	Illumina GAIIx	Phase_I	170	30	NM_176820	0	0	0	0	0	B2RN12|Q86W27	Silent	SNP	ENST00000332836.2	37	CCDS12934.1																																																																																			.		0.512	NLRP9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000453653.1	NM_176820	
ZNF135	7694	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	58579299	58579299	+	Missense_Mutation	SNP	C	C	A			TCGA-OR-A5LO-01A-11D-A29I-10	TCGA-OR-A5LO-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	89d60dde-b03a-4cb7-b32a-5d06fa328603	4a5886aa-889d-4ef2-89a9-be2f7a06bd58	g.chr19:58579299C>A	ENST00000313434.5	+	5	1548	c.1447C>A	c.(1447-1449)Caa>Aaa	p.Q483K	ZNF135_ENST00000511556.1_Missense_Mutation_p.Q495K|RN7SL526P_ENST00000469492.2_RNA|ZNF135_ENST00000439855.2_Missense_Mutation_p.Q483K|ZNF135_ENST00000506786.1_Missense_Mutation_p.Q441K|ZNF135_ENST00000359978.6_Intron|ZNF135_ENST00000401053.4_Missense_Mutation_p.Q507K	NM_003436.3	NP_003427.3	P52742	ZN135_HUMAN	zinc finger protein 135	483					cytoskeleton organization (GO:0007010)|regulation of cell morphogenesis (GO:0022604)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(3)|large_intestine(6)|liver(2)|lung(26)|ovary(1)|skin(1)|urinary_tract(1)	41		Colorectal(82;0.000256)|all_neural(62;0.0412)|Breast(46;0.147)|Ovarian(87;0.156)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0161)		ACACCTCACCCAACACCAGCG	0.567																																					p.Q507K		.											.	ZNF135-91	0			c.C1519A						.						95.0	84.0	88.0					19																	58579299		2203	4300	6503	SO:0001583	missense	7694	exon4			CTCACCCAACACC	U09413	CCDS12970.1, CCDS12970.2, CCDS54329.1, CCDS54330.1, CCDS74471.1, CCDS74472.1	19q13.4	2013-01-08	2006-05-12			ENSG00000176293		"""Zinc fingers, C2H2-type"", ""-"""	12919	protein-coding gene	gene with protein product		604077	"""zinc finger protein 61"", ""zinc finger protein 135 (clone pHZ-17)"""	ZNF61, ZNF78L1		7557990, 1505991	Standard	NM_003436		Approved	pHZ-17	uc002qrg.3	P52742		ENST00000313434.5:c.1447C>A	19.37:g.58579299C>A	ENSP00000321406:p.Gln483Lys	Somatic	128	0		WXS	Illumina GAIIx	Phase_I	204	44	NM_007134	0	0	0	0	0	B4DHH9|E9PEV2|F5GYY9|I3L0B3|Q5U5L3|Q8N1I7	Missense_Mutation	SNP	ENST00000313434.5	37		.	.	.	.	.	.	.	.	.	.	C	0.022	-1.412374	0.01145	.	.	ENSG00000176293	ENST00000401053;ENST00000439855;ENST00000313434;ENST00000511556;ENST00000506786	T;T;T;T;T	0.07327	3.2;3.2;3.2;3.2;3.2	2.99	1.81	0.25067	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.04543	0.0124	N	0.02169	-0.655	0.09310	N	1	P;P	0.42078	0.77;0.647	P;P	0.49887	0.625;0.593	T	0.25779	-1.0122	9	0.06494	T	0.89	.	10.2671	0.43462	0.0:0.6677:0.3323:0.0	.	495;483	E9PEV2;P52742	.;ZN135_HUMAN	K	507;483;483;495;441	ENSP00000441410:Q507K;ENSP00000444828:Q483K;ENSP00000321406:Q483K;ENSP00000422074:Q495K;ENSP00000427691:Q441K	ENSP00000321406:Q483K	Q	+	1	0	ZNF135	63271111	0.000000	0.05858	0.497000	0.27552	0.025000	0.11179	-1.088000	0.03379	1.676000	0.50930	0.557000	0.71058	CAA	.		0.567	ZNF135-003	KNOWN	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000361899.2	NM_003436	
TMEM247	388946	ucsc.edu	37	2	46707808	46707808	+	Missense_Mutation	SNP	C	C	G	rs70940616|rs74318890		TCGA-OR-A5LO-01A-11D-A29I-10	TCGA-OR-A5LO-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	89d60dde-b03a-4cb7-b32a-5d06fa328603	4a5886aa-889d-4ef2-89a9-be2f7a06bd58	g.chr2:46707808C>G	ENST00000434431.1	+	2	382	c.382C>G	c.(382-384)Cag>Gag	p.Q128E		NM_001145051.2	NP_001138523.1	A6NEH6	TM247_HUMAN	transmembrane protein 247	128						endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)											GAACCAGCGGCAGCGGCAGCA	0.662																																					p.Q128E		.											.	.	0			c.C382G						.						30.0	40.0	37.0					2																	46707808		692	1591	2283	SO:0001583	missense	388946	exon2			CAGCGGCAGCGGC		CCDS56117.1	2p21	2012-04-11			ENSG00000187600	ENSG00000187600			42967	protein-coding gene	gene with protein product							Standard	NM_001145051		Approved		uc010yod.3	A6NEH6	OTTHUMG00000153137	ENST00000434431.1:c.382C>G	2.37:g.46707808C>G	ENSP00000388684:p.Gln128Glu	Somatic	212	5		WXS	Illumina GAIIx	Phase_I	248	32	NM_001145051	0	0	0	0	0		Missense_Mutation	SNP	ENST00000434431.1	37	CCDS56117.1	.	.	.	.	.	.	.	.	.	.	C	17.67	3.447093	0.63178	.	.	ENSG00000187600	ENST00000434431	.	.	.	4.76	4.76	0.60689	.	0.000000	0.39475	N	0.001353	T	0.65606	0.2707	L	0.34521	1.04	.	.	.	D	0.56035	0.974	D	0.70487	0.969	T	0.71735	-0.4503	8	0.54805	T	0.06	-28.7409	14.7885	0.69821	0.0:1.0:0.0:0.0	.	128	A6NEH6	YB028_HUMAN	E	128	.	ENSP00000388684:Q128E	Q	+	1	0	AC018682.6	46561312	1.000000	0.71417	1.000000	0.80357	0.569000	0.35902	3.910000	0.56371	2.484000	0.83849	0.563000	0.77884	CAG	G|1.000;|0.000		0.662	TMEM247-001	KNOWN	mRNA_end_NF|cds_end_NF|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000329726.1	NM_001145051	
RETSAT	54884	broad.mit.edu	37	2	85577299	85577299	+	Silent	SNP	G	G	A	rs138358940		TCGA-OR-A5LO-01A-11D-A29I-10	TCGA-OR-A5LO-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	89d60dde-b03a-4cb7-b32a-5d06fa328603	4a5886aa-889d-4ef2-89a9-be2f7a06bd58	g.chr2:85577299G>A	ENST00000295802.4	-	4	775	c.663C>T	c.(661-663)ctC>ctT	p.L221L	RETSAT_ENST00000263854.6_Silent_p.L221L|RETSAT_ENST00000457495.2_Silent_p.L160L	NM_017750.3	NP_060220.3	Q6NUM9	RETST_HUMAN	retinol saturase (all-trans-retinol 13,14-reductase)	221					oxidation-reduction process (GO:0055114)|retinol metabolic process (GO:0042572)	endoplasmic reticulum membrane (GO:0005789)|membrane (GO:0016020)|nuclear membrane (GO:0031965)|nuclear outer membrane (GO:0005640)	all-trans-retinol 13,14-reductase activity (GO:0051786)|oxidoreductase activity (GO:0016491)			NS(2)|breast(1)|endometrium(5)|kidney(1)|large_intestine(4)|lung(10)|ovary(2)|prostate(2)|skin(2)|urinary_tract(1)	30					Vitamin A(DB00162)	ACCTGTCGAGGAGCTGAACCA	0.602													G|||	1	0.000199681	0.0008	0.0	5008	,	,		16925	0.0		0.0	False		,,,				2504	0.0				p.L221L		.											.	RETSAT-70	0			c.C663T						.	G		4,4402	8.1+/-20.4	0,4,2199	91.0	88.0	89.0		663	-1.8	0.1	2	dbSNP_134	89	0,8600		0,0,4300	no	coding-synonymous	RETSAT	NM_017750.3		0,4,6499	AA,AG,GG		0.0,0.0908,0.0308		221/611	85577299	4,13002	2203	4300	6503	SO:0001819	synonymous_variant	54884	exon4			GTCGAGGAGCTGA	AK075261	CCDS1972.1	2p11.2	2008-02-05			ENSG00000042445	ENSG00000042445	1.3.99.23		25991	protein-coding gene	gene with protein product						12975309, 15358783	Standard	NM_017750		Approved	FLJ20296	uc002spd.3	Q6NUM9	OTTHUMG00000154611	ENST00000295802.4:c.663C>T	2.37:g.85577299G>A		Somatic	211	0		WXS	Illumina GAIIx	Phase_I	123	3	NM_017750	0	0	51	51	0	A6NIK3|Q53R95|Q53SA9|Q6UX05|Q8N2H5|Q96FA4|Q9NXE5	Silent	SNP	ENST00000295802.4	37	CCDS1972.1	.	.	.	.	.	.	.	.	.	.	G	1.577	-0.532504	0.04112	9.08E-4	0.0	ENSG00000042445	ENST00000409984	.	.	.	5.82	-1.81	0.07882	.	.	.	.	.	T	0.52008	0.1708	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.45862	-0.9232	4	.	.	.	-4.6362	7.8367	0.29374	0.2497:0.3451:0.4052:0.0	.	.	.	.	F	160	.	.	S	-	2	0	RETSAT	85430810	0.824000	0.29247	0.126000	0.21872	0.155000	0.21991	-0.203000	0.09438	-0.231000	0.09825	-0.136000	0.14681	TCC	G|1.000;A|0.000		0.602	RETSAT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252489.1	NM_017750	
C2orf40	84417	hgsc.bcm.edu	37	2	106682235	106682235	+	Silent	SNP	C	C	G	rs4266035	byFrequency	TCGA-OR-A5LO-01A-11D-A29I-10	TCGA-OR-A5LO-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	89d60dde-b03a-4cb7-b32a-5d06fa328603	4a5886aa-889d-4ef2-89a9-be2f7a06bd58	g.chr2:106682235C>G	ENST00000238044.3	+	1	124	c.15C>G	c.(13-15)ccC>ccG	p.P5P	C2orf40_ENST00000409944.1_Intron|C2orf40_ENST00000489174.1_Intron	NM_032411.2	NP_115787.1	Q9H1Z8	AUGN_HUMAN	chromosome 2 open reading frame 40	5					cellular senescence (GO:0090398)|cyclin catabolic process (GO:0008054)|G1 to G0 transition (GO:0070314)	cytoplasmic vesicle (GO:0031410)|extracellular space (GO:0005615)				lung(7)|urinary_tract(1)	8						CTGCCTCCCCCGCGCGGCCTG	0.751													C|||	1156	0.230831	0.18	0.1239	5008	,	,		11837	0.2391		0.2187	False		,,,				2504	0.3793				p.P5P		.											.	C2orf40-90	0			c.C15G						.						2.0	3.0	3.0					2																	106682235		1650	3370	5020	SO:0001819	synonymous_variant	84417	exon1			CTCCCCCGCGCGG	BC021742	CCDS2072.1	2q12.2	2014-01-28			ENSG00000119147	ENSG00000119147			24642	protein-coding gene	gene with protein product	"""esophageal cancer related gene 4 protein"""	611752				12800218	Standard	NM_032411		Approved	ECRG4, augurin	uc010fjf.3	Q9H1Z8	OTTHUMG00000130921	ENST00000238044.3:c.15C>G	2.37:g.106682235C>G		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	5	5	NM_032411	0	0	1	1	0	D3DVK2	Silent	SNP	ENST00000238044.3	37	CCDS2072.1																																																																																			C|0.795;G|0.205		0.751	C2orf40-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253515.2	NM_032411	
SOWAHC	65124	hgsc.bcm.edu	37	2	110372192	110372192	+	Silent	SNP	A	A	G	rs6594048		TCGA-OR-A5LO-01A-11D-A29I-10	TCGA-OR-A5LO-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	89d60dde-b03a-4cb7-b32a-5d06fa328603	4a5886aa-889d-4ef2-89a9-be2f7a06bd58	g.chr2:110372192A>G	ENST00000356454.3	+	1	282	c.126A>G	c.(124-126)ctA>ctG	p.L42L	SEPT10_ENST00000415095.1_5'Flank|SEPT10_ENST00000545389.1_5'Flank|SEPT10_ENST00000437928.1_5'Flank|SEPT10_ENST00000356688.4_5'Flank|SEPT10_ENST00000397712.2_5'Flank|SEPT10_ENST00000334001.6_5'Flank|SEPT10_ENST00000397714.2_5'Flank	NM_023016.3	NP_075392.2	Q53LP3	SWAHC_HUMAN	sosondowah ankyrin repeat domain family member C	42																	GGGGCGCCCTAGGCGGCGAAC	0.771													G|||	5008	1.0	1.0	1.0	5008	,	,		6158	1.0		1.0	False		,,,				2504	1.0				p.L42L		.											.	.	0			c.A126G						.						1.0	2.0	2.0					2																	110372192		1239	2477	3716	SO:0001819	synonymous_variant	65124	exon1			CGCCCTAGGCGGC	AK023346	CCDS33270.1	2q13	2013-01-10	2012-01-12	2012-01-12	ENSG00000198142	ENSG00000198142		"""Ankyrin repeat domain containing"""	26149	protein-coding gene	gene with protein product			"""ankyrin repeat domain 57"""	C2orf26, ANKRD57		22234889	Standard	NM_023016		Approved	FLJ21870	uc002tfb.3	Q53LP3	OTTHUMG00000153219	ENST00000356454.3:c.126A>G	2.37:g.110372192A>G		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	6	6	NM_023016	0	0	0	0	0	Q8NE15|Q9H6U1	Silent	SNP	ENST00000356454.3	37	CCDS33270.1																																																																																			A|0.029;G|0.971		0.771	SOWAHC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000330168.1	NM_023016	
PTPN4	5775	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	120640081	120640081	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5LO-01A-11D-A29I-10	TCGA-OR-A5LO-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	89d60dde-b03a-4cb7-b32a-5d06fa328603	4a5886aa-889d-4ef2-89a9-be2f7a06bd58	g.chr2:120640081G>A	ENST00000263708.2	+	8	1240	c.469G>A	c.(469-471)Gaa>Aaa	p.E157K		NM_002830.3	NP_002821.1	P29074	PTN4_HUMAN	protein tyrosine phosphatase, non-receptor type 4 (megakaryocyte)	157	FERM. {ECO:0000255|PROSITE- ProRule:PRU00084}.				peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)	cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytoskeleton (GO:0005856)	non-membrane spanning protein tyrosine phosphatase activity (GO:0004726)			endometrium(3)|kidney(2)|large_intestine(7)|lung(15)|ovary(2)|urinary_tract(1)	30					Alendronate(DB00630)	ATTATTAGCTGAACTTGGAGA	0.299																																					p.E157K		.											.	PTPN4-228	0			c.G469A						.						23.0	23.0	23.0					2																	120640081		2181	4277	6458	SO:0001583	missense	5775	exon8			TTAGCTGAACTTG		CCDS2129.1	2q14.2	2011-06-09			ENSG00000088179	ENSG00000088179		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Non-receptor"""	9656	protein-coding gene	gene with protein product		176878				1648233	Standard	NM_002830		Approved	PTPMEG	uc002tmf.2	P29074	OTTHUMG00000131436	ENST00000263708.2:c.469G>A	2.37:g.120640081G>A	ENSP00000263708:p.Glu157Lys	Somatic	113	0		WXS	Illumina GAIIx	Phase_I	116	60	NM_002830	0	0	0	0	0	B2RBV8|Q9UDA7	Missense_Mutation	SNP	ENST00000263708.2	37	CCDS2129.1	.	.	.	.	.	.	.	.	.	.	G	34	5.337778	0.95758	.	.	ENSG00000088179	ENST00000263708	T	0.74842	-0.88	5.73	5.73	0.89815	Band 4.1 domain (1);FERM central domain (2);FERM domain (1);FERM/acyl-CoA-binding protein, 3-helical bundle (1);	0.000000	0.85682	D	0.000000	D	0.85652	0.5746	L	0.61387	1.9	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	D	0.86114	0.1564	10	0.87932	D	0	.	19.8954	0.96955	0.0:0.0:1.0:0.0	.	157	P29074	PTN4_HUMAN	K	157	ENSP00000263708:E157K	ENSP00000263708:E157K	E	+	1	0	PTPN4	120356551	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.050000	0.93843	2.708000	0.92522	0.591000	0.81541	GAA	.		0.299	PTPN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254233.2		
ANKRD30BL	554226	bcgsc.ca	37	2	132919192	132919192	+	Silent	SNP	G	G	A	rs111295191		TCGA-OR-A5LO-01A-11D-A29I-10	TCGA-OR-A5LO-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	89d60dde-b03a-4cb7-b32a-5d06fa328603	4a5886aa-889d-4ef2-89a9-be2f7a06bd58	g.chr2:132919192G>A	ENST00000409867.1	-	1	336	c.87C>T	c.(85-87)aaC>aaT	p.N29N	ANKRD30BL_ENST00000470729.1_Intron			A7E2S9	A30BL_HUMAN	ankyrin repeat domain 30B-like	29										endometrium(1)|kidney(3)	4						CGTAAGAGTCGTTGTTGGTGT	0.602																																					.		.											.	.	0			.						.																																			SO:0001819	synonymous_variant	554226	.			AGAGTCGTTGTTG			2q21.2	2013-01-22	2010-06-14	2010-06-14	ENSG00000163046	ENSG00000163046		"""Ankyrin repeat domain containing"""	35167	protein-coding gene	gene with protein product			"""non-protein coding RNA 164"", ""ankyrin repeat domain 30B pseudogene 3"""	NCRNA00164, ANKRD30BP3		17114284	Standard	NR_027019		Approved		uc002tti.3	A7E2S9	OTTHUMG00000153491	ENST00000409867.1:c.87C>T	2.37:g.132919192G>A		Somatic	348	11		WXS	Illumina GAIIx	Phase_I	318	20	.	0	0	0	0	0	B8ZZL7	RNA	SNP	ENST00000409867.1	37																																																																																				.		0.602	ANKRD30BL-001	NOVEL	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000331353.2	NR_027019	
TTN	7273	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	179581920	179581920	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5LO-01A-11D-A29I-10	TCGA-OR-A5LO-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	89d60dde-b03a-4cb7-b32a-5d06fa328603	4a5886aa-889d-4ef2-89a9-be2f7a06bd58	g.chr2:179581920G>A	ENST00000591111.1	-	86	24814	c.24590C>T	c.(24589-24591)aCa>aTa	p.T8197I	TTN_ENST00000589042.1_Missense_Mutation_p.T8514I|TTN_ENST00000342992.6_Missense_Mutation_p.T7270I|TTN-AS1_ENST00000585451.1_RNA|TTN_ENST00000342175.6_Intron|TTN_ENST00000460472.2_Intron|TTN-AS1_ENST00000431752.1_RNA|TTN_ENST00000359218.5_Intron			Q8WZ42	TITIN_HUMAN	titin	12381	Ig-like 64.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TTTGAGAACTGTCAGAGTGGC	0.493																																					p.T8514I		.											.	TTN-636	0			c.C25541T						.						67.0	68.0	68.0					2																	179581920		1920	4127	6047	SO:0001583	missense	7273	exon88			AGAACTGTCAGAG	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.24590C>T	2.37:g.179581920G>A	ENSP00000465570:p.Thr8197Ile	Somatic	114	0		WXS	Illumina GAIIx	Phase_I	67	34	NM_001267550	0	0	0	0	0	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	37		.	.	.	.	.	.	.	.	.	.	G	8.755	0.922143	0.17982	.	.	ENSG00000155657	ENST00000342992	T	0.69040	-0.37	5.52	4.64	0.57946	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.59878	0.2226	L	0.42487	1.325	0.80722	D	1	P	0.41265	0.744	B	0.43123	0.409	T	0.62996	-0.6735	9	0.87932	D	0	.	7.4149	0.27038	0.1426:0.0:0.7217:0.1357	.	8197	Q8WZ42	TITIN_HUMAN	I	7270	ENSP00000343764:T7270I	ENSP00000343764:T7270I	T	-	2	0	TTN	179290165	0.990000	0.36364	0.962000	0.40283	0.981000	0.71138	1.995000	0.40767	1.452000	0.47756	0.655000	0.94253	ACA	.		0.493	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378	
RAPH1	65059	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	204305290	204305290	+	Missense_Mutation	SNP	G	G	C			TCGA-OR-A5LO-01A-11D-A29I-10	TCGA-OR-A5LO-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	89d60dde-b03a-4cb7-b32a-5d06fa328603	4a5886aa-889d-4ef2-89a9-be2f7a06bd58	g.chr2:204305290G>C	ENST00000319170.5	-	14	2922	c.2623C>G	c.(2623-2625)Ccc>Gcc	p.P875A	RAPH1_ENST00000374493.3_Missense_Mutation_p.P927A|ABI2_ENST00000295851.5_3'UTR|RAPH1_ENST00000457812.1_Intron	NM_213589.1	NP_998754.1	Q70E73	RAPH1_HUMAN	Ras association (RalGDS/AF-6) and pleckstrin homology domains 1	875					axon extension (GO:0048675)|cell-matrix adhesion (GO:0007160)|signal transduction (GO:0007165)	cell leading edge (GO:0031252)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|plasma membrane (GO:0005886)				breast(5)|central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(7)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	32						ATGGCAGGGGGAGTTGGAGGG	0.582																																					p.P875A		.											.	RAPH1-1151	0			c.C2623G						.						74.0	89.0	84.0					2																	204305290		2203	4300	6503	SO:0001583	missense	65059	exon14			CAGGGGGAGTTGG	AJ584699	CCDS2359.1, CCDS2360.1	2q33	2013-01-10	2003-11-25	2003-11-26	ENSG00000173166	ENSG00000173166		"""Pleckstrin homology (PH) domain containing"""	14436	protein-coding gene	gene with protein product	"""amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 18"""	609035	"""amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 9"""	ALS2CR9, ALS2CR18			Standard	NM_203365		Approved	KIAA1681	uc002vad.3	Q70E73	OTTHUMG00000132876	ENST00000319170.5:c.2623C>G	2.37:g.204305290G>C	ENSP00000316543:p.Pro875Ala	Somatic	58	1		WXS	Illumina GAIIx	Phase_I	33	22	NM_213589	0	0	0	2	2	Q96Q37|Q9C0I2	Missense_Mutation	SNP	ENST00000319170.5	37	CCDS2359.1	.	.	.	.	.	.	.	.	.	.	G	7.155	0.584608	0.13749	.	.	ENSG00000173166	ENST00000319170;ENST00000374493	T;T	0.47528	0.84;0.86	2.63	2.63	0.31362	.	.	.	.	.	T	0.25901	0.0631	N	0.19112	0.55	0.54753	D	0.999982	P	0.34977	0.478	B	0.28553	0.091	T	0.05209	-1.0899	9	0.25751	T	0.34	.	7.9186	0.29833	0.1189:0.0:0.8811:0.0	.	875	Q70E73	RAPH1_HUMAN	A	875;927	ENSP00000316543:P875A;ENSP00000363617:P927A	ENSP00000316543:P875A	P	-	1	0	RAPH1	204013535	0.923000	0.31300	0.015000	0.15790	0.187000	0.23431	1.762000	0.38451	1.476000	0.48215	0.411000	0.27672	CCC	.		0.582	RAPH1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256363.2	NM_025252	
UNC80	285175	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	2	210705361	210705361	+	Missense_Mutation	SNP	C	C	A			TCGA-OR-A5LO-01A-11D-A29I-10	TCGA-OR-A5LO-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	89d60dde-b03a-4cb7-b32a-5d06fa328603	4a5886aa-889d-4ef2-89a9-be2f7a06bd58	g.chr2:210705361C>A	ENST00000439458.1	+	20	3432	c.3352C>A	c.(3352-3354)Caa>Aaa	p.Q1118K	UNC80_ENST00000272845.6_Missense_Mutation_p.Q1113K	NM_032504.1	NP_115893.1	Q8N2C7	UNC80_HUMAN	unc-80 homolog (C. elegans)	1118					ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.Q1118*(2)		breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(9)|ovary(1)|prostate(1)	20						TTTCATCAGGCAAAGCTCCAA	0.498																																					p.Q1118K		.											.	UNC80-90	2	Substitution - Nonsense(2)	breast(2)	c.C3352A						.						127.0	106.0	112.0					2																	210705361		692	1591	2283	SO:0001583	missense	285175	exon20			ATCAGGCAAAGCT	AK090815	CCDS2387.1, CCDS46504.1, CCDS2387.2	2q35	2009-08-17	2009-08-17	2009-08-17	ENSG00000144406	ENSG00000144406			26582	protein-coding gene	gene with protein product		612636	"""chromosome 2 open reading frame 21"""	C2orf21		19092807	Standard	NM_032504		Approved	FLJ33496, KIAA1843, UNC-80	uc010zjc.1	Q8N2C7	OTTHUMG00000132963	ENST00000439458.1:c.3352C>A	2.37:g.210705361C>A	ENSP00000391088:p.Gln1118Lys	Somatic	127	0		WXS	Illumina GAIIx	Phase_I	94	8	NM_032504	0	0	0	0	0	B2RN50|B4DQY9|B4DZB3|C4IXS8|C9J1U3|Q96JI4|Q96SS0	Missense_Mutation	SNP	ENST00000439458.1	37	CCDS46504.1	.	.	.	.	.	.	.	.	.	.	C	34	5.351597	0.95830	.	.	ENSG00000144406	ENST00000439458;ENST00000272845	T;T	0.29655	1.56;1.56	5.94	5.94	0.96194	.	0.060499	0.64402	D	0.000002	T	0.48642	0.1511	L	0.36672	1.1	0.80722	D	1	P	0.52577	0.954	D	0.67900	0.954	T	0.31420	-0.9944	10	0.54805	T	0.06	-15.3611	20.3731	0.98895	0.0:1.0:0.0:0.0	.	1118	Q8N2C7	UNC80_HUMAN	K	1118;1113	ENSP00000391088:Q1118K;ENSP00000272845:Q1113K	ENSP00000272845:Q1113K	Q	+	1	0	UNC80	210413606	1.000000	0.71417	1.000000	0.80357	0.960000	0.62799	7.798000	0.85924	2.829000	0.97493	0.650000	0.86243	CAA	.		0.498	UNC80-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_182587	
RHBDD1	84236	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	227729481	227729481	+	Silent	SNP	C	C	T			TCGA-OR-A5LO-01A-11D-A29I-10	TCGA-OR-A5LO-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	89d60dde-b03a-4cb7-b32a-5d06fa328603	4a5886aa-889d-4ef2-89a9-be2f7a06bd58	g.chr2:227729481C>T	ENST00000341329.3	+	2	314	c.72C>T	c.(70-72)atC>atT	p.I24I	RHBDD1_ENST00000392062.2_Silent_p.I24I	NM_032276.3	NP_115652.2	Q8TEB9	RHBL4_HUMAN	rhomboid domain containing 1	24					apoptotic process (GO:0006915)|cellular response to unfolded protein (GO:0034620)|cellular response to UV (GO:0034644)|ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|membrane protein intracellular domain proteolysis (GO:0031293)|membrane protein proteolysis (GO:0033619)|negative regulation of apoptotic process (GO:0043066)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of protein processing (GO:0010954)|positive regulation of secretion (GO:0051047)|post-translational protein modification (GO:0043687)|spermatid differentiation (GO:0048515)	endoplasmic reticulum membrane (GO:0005789)|endoplasmic reticulum quality control compartment (GO:0044322)|integral component of endoplasmic reticulum membrane (GO:0030176)|mitochondrion (GO:0005739)	endopeptidase activity (GO:0004175)|serine-type endopeptidase activity (GO:0004252)			breast(1)|large_intestine(5)|lung(8)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	19		Renal(207;0.023)|all_lung(227;0.13)|Esophageal squamous(248;0.23)|all_hematologic(139;0.248)		Epithelial(121;1.47e-11)|all cancers(144;1.52e-08)|Lung(261;0.0128)|LUSC - Lung squamous cell carcinoma(224;0.0175)		ATGTTGGGATCAACAATATTC	0.458																																					p.I24I		.											.	RHBDD1-91	0			c.C72T						.						179.0	165.0	170.0					2																	227729481		2203	4300	6503	SO:0001819	synonymous_variant	84236	exon4			TGGGATCAACAAT	AK074258	CCDS2464.1	2q36.3	2012-07-09			ENSG00000144468	ENSG00000144468			23081	protein-coding gene	gene with protein product						12838346	Standard	NM_032276		Approved	DKFZp547E052	uc002voi.3	Q8TEB9	OTTHUMG00000133178	ENST00000341329.3:c.72C>T	2.37:g.227729481C>T		Somatic	163	0		WXS	Illumina GAIIx	Phase_I	102	42	NM_001167608	0	0	4	5	1	Q495B9|Q53S43|Q5EBM8|Q6P5V8|Q8IV60|Q9H057	Silent	SNP	ENST00000341329.3	37	CCDS2464.1																																																																																			.		0.458	RHBDD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256885.2		
ILKAP	80895	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	239079640	239079640	+	Missense_Mutation	SNP	G	G	T			TCGA-OR-A5LO-01A-11D-A29I-10	TCGA-OR-A5LO-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	89d60dde-b03a-4cb7-b32a-5d06fa328603	4a5886aa-889d-4ef2-89a9-be2f7a06bd58	g.chr2:239079640G>T	ENST00000254654.3	-	11	1157	c.982C>A	c.(982-984)Ctc>Atc	p.L328I		NM_030768.2	NP_110395.1	Q9H0C8	ILKAP_HUMAN	integrin-linked kinase-associated serine/threonine phosphatase	328	PP2C-like.				protein dephosphorylation (GO:0006470)|regulation of nuclear cell cycle DNA replication (GO:0033262)	cytoplasm (GO:0005737)	metal ion binding (GO:0046872)|protein serine/threonine phosphatase activity (GO:0004722)			endometrium(1)|kidney(3)|large_intestine(5)|lung(4)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	19		Breast(86;7.61e-05)|Renal(207;0.00183)|Ovarian(221;0.0481)|all_lung(227;0.152)|all_hematologic(139;0.158)|Melanoma(123;0.203)|Hepatocellular(293;0.244)		Epithelial(121;5.49e-24)|OV - Ovarian serous cystadenocarcinoma(60;3.93e-12)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;6.82e-08)|BRCA - Breast invasive adenocarcinoma(100;0.00012)|Lung(119;0.00942)|LUSC - Lung squamous cell carcinoma(224;0.0163)		ACCTTGAAGAGCCCATCACAG	0.453																																					p.L328I		.											.	ILKAP-118	0			c.C982A						.						107.0	121.0	116.0					2																	239079640		2203	4300	6503	SO:0001583	missense	80895	exon11			TGAAGAGCCCATC	AY024365	CCDS2526.1	2q37.3	2012-04-17	2010-10-25		ENSG00000132323	ENSG00000132323	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatases, Mg2+/Mn2+ dependent"""	15566	protein-coding gene	gene with protein product			"""integrin-linked kinase-associated serine/threonine phosphatase 2C"""				Standard	NM_030768		Approved	DKFZP434J2031, FLJ10181	uc002vxv.3	Q9H0C8	OTTHUMG00000133334	ENST00000254654.3:c.982C>A	2.37:g.239079640G>T	ENSP00000254654:p.Leu328Ile	Somatic	174	0		WXS	Illumina GAIIx	Phase_I	141	67	NM_030768	0	1	26	50	23	B3KM39	Missense_Mutation	SNP	ENST00000254654.3	37	CCDS2526.1	.	.	.	.	.	.	.	.	.	.	G	22.4	4.285561	0.80803	.	.	ENSG00000132323	ENST00000254654;ENST00000450411	T;T	0.16597	2.33;2.33	5.64	5.64	0.86602	Protein phosphatase 2C-like (5);	0.000000	0.85682	D	0.000000	T	0.34337	0.0894	L	0.45422	1.42	0.58432	D	0.999996	P	0.52061	0.95	D	0.66716	0.946	T	0.00531	-1.1686	10	0.29301	T	0.29	-27.4657	18.4752	0.90790	0.0:0.0:1.0:0.0	.	328	Q9H0C8	ILKAP_HUMAN	I	328;145	ENSP00000254654:L328I;ENSP00000406254:L145I	ENSP00000254654:L328I	L	-	1	0	ILKAP	238744379	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	4.603000	0.61105	2.655000	0.90218	0.655000	0.94253	CTC	.		0.453	ILKAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257163.2	NM_030768	
PAK7	57144	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	20	9538346	9538346	+	Nonsense_Mutation	SNP	G	G	T			TCGA-OR-A5LO-01A-11D-A29I-10	TCGA-OR-A5LO-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	89d60dde-b03a-4cb7-b32a-5d06fa328603	4a5886aa-889d-4ef2-89a9-be2f7a06bd58	g.chr20:9538346G>T	ENST00000378429.3	-	8	2198	c.1652C>A	c.(1651-1653)tCa>tAa	p.S551*	PAK7_ENST00000378423.1_Nonsense_Mutation_p.S551*|PAK7_ENST00000353224.5_Nonsense_Mutation_p.S551*	NM_020341.3	NP_065074.1	Q9P286	PAK7_HUMAN	p21 protein (Cdc42/Rac)-activated kinase 7	551	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				apoptotic process (GO:0006915)|cell growth (GO:0016049)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|cytoskeleton organization (GO:0007010)|learning (GO:0007612)|locomotory behavior (GO:0007626)|memory (GO:0007613)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|signal transduction (GO:0007165)	mitochondrion (GO:0005739)|nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|central_nervous_system(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|lung(44)|ovary(2)|skin(13)|stomach(1)|upper_aerodigestive_tract(3)	81			COAD - Colon adenocarcinoma(9;0.194)			TCTCAGAACTGACAGGCAGAC	0.423																																					p.S551X		.											.	PAK7-1434	0			c.C1652A						.						137.0	119.0	125.0					20																	9538346		2203	4300	6503	SO:0001587	stop_gained	57144	exon7			AGAACTGACAGGC	AB033090	CCDS13107.1	20p12	2008-06-17	2008-06-17		ENSG00000101349	ENSG00000101349			15916	protein-coding gene	gene with protein product		608038	"""p21(CDKN1A)-activated kinase 7"""			11756552, 10574462	Standard	NM_020341		Approved	KIAA1264, PAK5	uc002wnk.2	Q9P286	OTTHUMG00000031857	ENST00000378429.3:c.1652C>A	20.37:g.9538346G>T	ENSP00000367686:p.Ser551*	Somatic	82	0		WXS	Illumina GAIIx	Phase_I	73	29	NM_177990	0	0	0	1	1	A8K5T6|D3DW14|Q5W115|Q9BX09|Q9ULF6	Nonsense_Mutation	SNP	ENST00000378429.3	37	CCDS13107.1	.	.	.	.	.	.	.	.	.	.	G	42	9.601142	0.99216	.	.	ENSG00000101349	ENST00000378429;ENST00000353224;ENST00000378423;ENST00000439520	.	.	.	5.69	5.69	0.88448	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.8171	0.96573	0.0:0.0:1.0:0.0	.	.	.	.	X	551;551;551;499	.	.	S	-	2	0	PAK7	9486346	1.000000	0.71417	0.977000	0.42913	0.974000	0.67602	9.869000	0.99810	2.678000	0.91216	0.643000	0.83706	TCA	.		0.423	PAK7-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077962.1		
FRG1B	284802	bcgsc.ca	37	20	29623218	29623218	+	Silent	SNP	A	A	G	rs368763678	byFrequency	TCGA-OR-A5LO-01A-11D-A29I-10	TCGA-OR-A5LO-10A-01D-A29L-10	A	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	89d60dde-b03a-4cb7-b32a-5d06fa328603	4a5886aa-889d-4ef2-89a9-be2f7a06bd58	g.chr20:29623218A>G	ENST00000278882.3	+	3	410	c.30A>G	c.(28-30)acA>acG	p.T10T	FRG1B_ENST00000439954.2_Missense_Mutation_p.N12D|FRG1B_ENST00000358464.4_Silent_p.T10T			Q9BZ01	FRG1B_HUMAN	FSHD region gene 1 family, member B	10								p.T10T(4)		endometrium(10)|kidney(21)|lung(3)|pancreas(1)|prostate(9)|urinary_tract(9)	53						TGCACTCGACAATGGTCTTTT	0.408													.|||	318	0.0634984	0.0212	0.0692	5008	,	,		48514	0.0228		0.1431	False		,,,				2504	0.0767				.		.											.	FRG1B-22	4	Substitution - coding silent(4)	endometrium(2)|kidney(2)	.						.																																			SO:0001819	synonymous_variant	284802	.			CTCGACAATGGTC			20q11.1	2013-03-18	2007-10-11	2007-10-11	ENSG00000149531	ENSG00000149531			15792	other	unknown			"""chromosome 20 open reading frame 80"""	C20orf80			Standard	NR_003579		Approved	bA348I14.2	uc010ztl.1	Q9BZ01	OTTHUMG00000032157	ENST00000278882.3:c.30A>G	20.37:g.29623218A>G		Somatic	690	10		WXS	Illumina GAIIx	Phase_I	778	59	.	0	0	117	117	0	C4AME5	RNA	SNP	ENST00000278882.3	37		.	.	.	.	.	.	.	.	.	.	a	9.656	1.142954	0.21205	.	.	ENSG00000149531	ENST00000439954	T	0.51817	0.69	1.93	1.93	0.25924	.	.	.	.	.	T	0.50803	0.1637	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.50242	-0.8851	6	0.48119	T	0.1	.	7.8149	0.29254	1.0:0.0:0.0:0.0	.	.	.	.	D	12	ENSP00000408863:N12D	ENSP00000408863:N12D	N	+	1	0	FRG1B	28236879	1.000000	0.71417	1.000000	0.80357	0.105000	0.19272	7.836000	0.86788	1.147000	0.42369	0.347000	0.21830	AAT	.		0.408	FRG1B-001	KNOWN	not_best_in_genome_evidence|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000078494.2	NR_003579	
HELZ2	85441	bcgsc.ca	37	20	62198662	62198662	+	Silent	SNP	A	A	G	rs367440	byFrequency	TCGA-OR-A5LO-01A-11D-A29I-10	TCGA-OR-A5LO-10A-01D-A29L-10	A	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	89d60dde-b03a-4cb7-b32a-5d06fa328603	4a5886aa-889d-4ef2-89a9-be2f7a06bd58	g.chr20:62198662A>G	ENST00000467148.1	-	6	2118	c.2049T>C	c.(2047-2049)taT>taC	p.Y683Y	HELZ2_ENST00000427522.2_Silent_p.Y114Y|HELZ2_ENST00000479540.1_5'Flank	NM_001037335.2	NP_001032412.2	Q9BYK8	HELZ2_HUMAN	helicase with zinc finger 2, transcriptional coactivator	683	Interaction with THRAP3.				cellular lipid metabolic process (GO:0044255)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	membrane (GO:0016020)|nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)										CGTGCGAGGCATAGGCCAGCG	0.701													G|||	4686	0.935703	0.9062	0.9092	5008	,	,		14522	0.999		0.8767	False		,,,				2504	0.9898				p.Y683Y		.											.	.	0			c.T2049C						.	G	,	3905,393		1773,359,17	13.0	17.0	15.0		2049,342	-5.0	0.0	20	dbSNP_80	15	7595,809		3439,717,46	no	coding-synonymous,coding-synonymous	PRIC285	NM_001037335.2,NM_033405.3	,	5212,1076,63	GG,GA,AA		9.6264,9.1438,9.4631	,	683/2650,114/2081	62198662	11500,1202	2149	4202	6351	SO:0001819	synonymous_variant	85441	exon7			CGAGGCATAGGCC	AB201715	CCDS13527.1, CCDS33508.1	20q13.33	2012-09-26			ENSG00000130589	ENSG00000130589			30021	protein-coding gene	gene with protein product	"""peroxisomal proliferator activated receptor A interacting complex 285"", ""PPARG-DBD-interacting protein 1"""	611265				11214970, 12189208, 16239304	Standard	NM_001037335		Approved	PDIP1, PRIC285, KIAA1769	uc002yfm.2	Q9BYK8	OTTHUMG00000032969	ENST00000467148.1:c.2049T>C	20.37:g.62198662A>G		Somatic	16	1		WXS	Illumina GAIIx	Phase_I	68	61	NM_001037335	0	0	1	1	0	Q3C2G2|Q4VXQ1|Q8TEF3|Q96ND3|Q9C094	Silent	SNP	ENST00000467148.1	37	CCDS33508.1																																																																																			A|0.084;G|0.916		0.701	HELZ2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354127.1	NM_001037335	
RIPPLY3	53820	broad.mit.edu;ucsc.edu	37	21	38390362	38390362	+	Missense_Mutation	SNP	G	G	T	rs150799198	byFrequency	TCGA-OR-A5LO-01A-11D-A29I-10	TCGA-OR-A5LO-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	89d60dde-b03a-4cb7-b32a-5d06fa328603	4a5886aa-889d-4ef2-89a9-be2f7a06bd58	g.chr21:38390362G>T	ENST00000329553.2	+	4	638	c.428G>T	c.(427-429)cGg>cTg	p.R143L	RIPPLY3_ENST00000485272.1_3'UTR	NM_018962.2	NP_061835.1	P57055	DSCR6_HUMAN	ripply transcriptional repressor 3	143					heart development (GO:0007507)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|pharyngeal system development (GO:0060037)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)											GTGGGAGGTCGGCAGGAAAAT	0.627																																					p.R143L		.											.	DSCR6-153	0			c.G428T						.						38.0	37.0	37.0					21																	38390362		2203	4300	6503	SO:0001583	missense	53820	exon4			GAGGTCGGCAGGA	AB037158	CCDS13648.1	21q22.2	2013-07-23	2013-07-23	2013-06-04	ENSG00000183145	ENSG00000183145			3047	protein-coding gene	gene with protein product		609892	"""Down syndrome critical region gene 6"", ""ripply3 homolog (zebrafish)"""	DSCR6		10814524, 22354841	Standard	NM_018962		Approved			P57055	OTTHUMG00000086639	ENST00000329553.2:c.428G>T	21.37:g.38390362G>T	ENSP00000331734:p.Arg143Leu	Somatic	33	0		WXS	Illumina GAIIx	Phase_I	35	4	NM_018962	0	0	0	0	0		Missense_Mutation	SNP	ENST00000329553.2	37	CCDS13648.1	.	.	.	.	.	.	.	.	.	.	T	8.495	0.862844	0.17178	.	.	ENSG00000183145	ENST00000329553	.	.	.	3.4	-3.2	0.05156	.	2.938470	0.01542	N	0.019279	T	0.18257	0.0438	N	0.14661	0.345	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.04635	-1.0937	9	0.25106	T	0.35	0.0892	0.833	0.01134	0.2755:0.2891:0.2734:0.1621	.	143	P57055	DSCR6_HUMAN	L	143	.	ENSP00000331734:R143L	R	+	2	0	DSCR6	37312232	0.000000	0.05858	0.000000	0.03702	0.007000	0.05969	-2.415000	0.01036	-1.416000	0.02019	-0.363000	0.07495	CGG	G|0.999;A|0.001		0.627	RIPPLY3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000194703.1		
PDE9A	5152	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	21	44185575	44185575	+	Missense_Mutation	SNP	G	G	C			TCGA-OR-A5LO-01A-11D-A29I-10	TCGA-OR-A5LO-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	89d60dde-b03a-4cb7-b32a-5d06fa328603	4a5886aa-889d-4ef2-89a9-be2f7a06bd58	g.chr21:44185575G>C	ENST00000291539.6	+	15	1387	c.1327G>C	c.(1327-1329)Gac>Cac	p.D443H	PDE9A_ENST00000328862.6_Missense_Mutation_p.D417H|PDE9A_ENST00000398224.3_Missense_Mutation_p.D316H|PDE9A_ENST00000470987.1_3'UTR|PDE9A_ENST00000335440.6_Missense_Mutation_p.D341H|PDE9A_ENST00000398236.3_Missense_Mutation_p.D357H|PDE9A_ENST00000335512.4_Missense_Mutation_p.D383H|PDE9A_ENST00000380328.2_Missense_Mutation_p.D390H|PDE9A_ENST00000349112.3_Missense_Mutation_p.D315H|PDE9A_ENST00000398232.3_Missense_Mutation_p.D376H|PDE9A_ENST00000398229.3_Missense_Mutation_p.D309H|PDE9A_ENST00000398225.3_Missense_Mutation_p.D402H|PDE9A_ENST00000398234.3_Missense_Mutation_p.D342H|PDE9A_ENST00000398227.3_Missense_Mutation_p.D283H|PDE9A_ENST00000539837.1_Missense_Mutation_p.D315H	NM_002606.2	NP_002597.1	O76083	PDE9A_HUMAN	phosphodiesterase 9A	443	Catalytic. {ECO:0000250}.				blood coagulation (GO:0007596)|cGMP-mediated signaling (GO:0019934)|metabolic process (GO:0008152)|signal transduction (GO:0007165)	cell projection (GO:0042995)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|perikaryon (GO:0043204)|plasma membrane (GO:0005886)	3',5'-cyclic-GMP phosphodiesterase activity (GO:0047555)|3',5'-cyclic-nucleotide phosphodiesterase activity (GO:0004114)|metal ion binding (GO:0046872)			breast(1)|endometrium(4)|large_intestine(6)|lung(8)|ovary(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	27					Caffeine(DB00201)	GGAGAATTTTGACTACAGCAA	0.488																																					p.D443H		.											.	PDE9A-92	0			c.G1327C						.						95.0	85.0	89.0					21																	44185575		2203	4300	6503	SO:0001583	missense	5152	exon15			AATTTTGACTACA	AF048837	CCDS13690.1, CCDS33567.1, CCDS33568.1, CCDS33569.1, CCDS33570.1, CCDS33571.1, CCDS42941.1, CCDS42942.1, CCDS42943.1, CCDS42944.1, CCDS42945.1, CCDS42946.1, CCDS42947.1	21q22.3	2005-11-29			ENSG00000160191	ENSG00000160191	3.1.4.17	"""Phosphodiesterases"""	8795	protein-coding gene	gene with protein product		602973				9624146	Standard	NM_001001584		Approved		uc002zbm.3	O76083	OTTHUMG00000086825	ENST00000291539.6:c.1327G>C	21.37:g.44185575G>C	ENSP00000291539:p.Asp443His	Somatic	312	1		WXS	Illumina GAIIx	Phase_I	306	77	NM_002606	0	0	31	43	12	B2RBI5|B4DFI5|D3DSJ8|D3DSJ9|O75490|O75491|O95225|Q53Y40|Q5QD39|Q86SF7|Q86SI6|Q86SJ3|Q86WN3|Q86WN4|Q86WN5|Q86WN6|Q86WN7|Q86WN8|Q86WN9|Q86WP0	Missense_Mutation	SNP	ENST00000291539.6	37	CCDS13690.1	.	.	.	.	.	.	.	.	.	.	G	21.9	4.219497	0.79464	.	.	ENSG00000160191	ENST00000335512;ENST00000539837;ENST00000291539;ENST00000380328;ENST00000398232;ENST00000398234;ENST00000398236;ENST00000328862;ENST00000335440;ENST00000398225;ENST00000398229;ENST00000398227;ENST00000349112;ENST00000398224	T;T;T;T;T;T;T;T;T;T;T;T;T;T	0.80393	-1.37;-1.37;-1.37;-1.37;-1.37;-1.37;-1.37;-1.37;-1.37;-1.37;-1.37;-1.37;-1.37;-1.37	3.93	3.93	0.45458	Metal-dependent phosphohydrolase, HD domain (1);5&apos (2);-cyclic nucleotide phosphodiesterase, catalytic domain (2);3&apos (2);	0.097482	0.64402	D	0.000002	D	0.90041	0.6890	M	0.86420	2.815	0.80722	D	1	P;D;D;P;D;D;D;D;D;P;P;D;D;D;P;D	0.71674	0.956;0.993;0.978;0.911;0.993;0.993;0.959;0.978;0.978;0.956;0.911;0.974;0.973;0.993;0.911;0.998	P;P;P;P;P;P;P;P;P;P;P;P;P;P;P;D	0.66084	0.649;0.861;0.753;0.649;0.887;0.857;0.697;0.649;0.753;0.649;0.572;0.687;0.711;0.753;0.649;0.941	D	0.92275	0.5828	10	0.72032	D	0.01	.	16.4974	0.84249	0.0:0.0:1.0:0.0	.	315;376;357;342;417;402;335;383;226;283;309;315;341;390;316;443	F5GWD0;O76083-13;O76083-8;O76083-6;O76083-15;O76083-14;O76083-16;O76083-2;O76083-10;O76083-9;O76083-11;O76083-4;O76083-12;O76083-5;O76083-3;O76083	.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;PDE9A_HUMAN	H	383;315;443;390;376;342;357;417;341;402;309;283;315;316	ENSP00000335242:D383H;ENSP00000441899:D315H;ENSP00000291539:D443H;ENSP00000369685:D390H;ENSP00000381287:D376H;ENSP00000381289:D342H;ENSP00000381291:D357H;ENSP00000328699:D417H;ENSP00000335365:D341H;ENSP00000381281:D402H;ENSP00000381285:D309H;ENSP00000381283:D283H;ENSP00000344730:D315H;ENSP00000381280:D316H	ENSP00000291539:D443H	D	+	1	0	PDE9A	43058644	1.000000	0.71417	1.000000	0.80357	0.853000	0.48598	8.943000	0.92975	2.189000	0.69895	0.514000	0.50259	GAC	.		0.488	PDE9A-016	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000195466.1		
KRTAP10-6	386674	broad.mit.edu	37	21	46011400	46011400	+	Silent	SNP	G	G	A	rs371252868		TCGA-OR-A5LO-01A-11D-A29I-10	TCGA-OR-A5LO-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	89d60dde-b03a-4cb7-b32a-5d06fa328603	4a5886aa-889d-4ef2-89a9-be2f7a06bd58	g.chr21:46011400G>A	ENST00000400368.1	-	1	986	c.966C>T	c.(964-966)tcC>tcT	p.S322S	TSPEAR_ENST00000323084.4_Intron	NM_198688.2	NP_941961.2	P60371	KR106_HUMAN	keratin associated protein 10-6	322	29 X 5 AA repeats of C-C-X(3).					keratin filament (GO:0045095)		p.S322S(5)		endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(3)|lung(6)|prostate(3)|skin(1)|stomach(1)|urinary_tract(1)	23						AGGCACCACAGGAGGGGACGG	0.692																																					p.S322S		.											.	KRTAP10-6-90	5	Substitution - coding silent(5)	endometrium(3)|urinary_tract(1)|prostate(1)	c.C966T						.						66.0	81.0	76.0					21																	46011400		2201	4300	6501	SO:0001819	synonymous_variant	386674	exon1			ACCACAGGAGGGG	AB076353	CCDS42959.1	21q22.3	2006-03-13	2004-07-12	2004-07-14	ENSG00000188155	ENSG00000188155		"""Keratin associated proteins"""	20523	protein-coding gene	gene with protein product			"""keratin associated protein 18-6"""	KRTAP18-6			Standard	NM_198688		Approved	KRTAP18.6, KAP18.6, KAP10.6	uc002zfm.3	P60371	OTTHUMG00000057634	ENST00000400368.1:c.966C>T	21.37:g.46011400G>A		Somatic	277	1		WXS	Illumina GAIIx	Phase_I	346	7	NM_198688	0	0	0	0	0		Silent	SNP	ENST00000400368.1	37	CCDS42959.1																																																																																			.		0.692	KRTAP10-6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128037.1	NM_198688	
KRTAP10-7	386675	broad.mit.edu	37	21	46020656	46020670	+	In_Frame_Del	DEL	CTGCTGCGCCCCCAG	CTGCTGCGCCCCCAG	-	rs36208679|rs60739860|rs373191083		TCGA-OR-A5LO-01A-11D-A29I-10	TCGA-OR-A5LO-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	89d60dde-b03a-4cb7-b32a-5d06fa328603	4a5886aa-889d-4ef2-89a9-be2f7a06bd58	g.chr21:46020656_46020670delCTGCTGCGCCCCCAG	ENST00000380102.2	+	1	160_174	c.135_149delCTGCTGCGCCCCCAG	c.(133-150)ccctgctgcgcccccagc>ccc	p.CCAPS46del	TSPEAR_ENST00000323084.4_Intron	NM_198689.2	NP_941962.1	P60409	KR107_HUMAN	keratin associated protein 10-7	46	30 X 5 AA repeats of C-C-X(3).					keratin filament (GO:0045095)		p.S50_P54delSCCAP(1)		breast(1)|large_intestine(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	8						GCGAGCCCCCCTGCTGCGCCCCCAGCTGCTGCGCC	0.698																																					.		.											.	.	1	Deletion - In frame(1)	upper_aerodigestive_tract(1)	.						.		,	2258,1042		849,560,241					,	-0.7	1.0		dbSNP_126	22	6001,1123		2605,791,166	no	coding,intron	TSPEAR,KRTAP10-7	NM_198689.2,NM_144991.2	,	3454,1351,407	A1A1,A1R,RR		15.7636,31.5758,20.7694	,	,		8259,2165				SO:0001651	inframe_deletion	386675	.			GCCCCCCTGCTGC	AJ566385	CCDS74803.1	21q22.3	2014-04-10			ENSG00000205441	ENSG00000272804		"""Keratin associated proteins"""	22970	protein-coding gene	gene with protein product				KRTAP18-7			Standard	NM_198689		Approved	KAP10.7, KAP18.7	uc002zfn.4	P60409	OTTHUMG00000188307	ENST00000380102.2:c.135_149delCTGCTGCGCCCCCAG	21.37:g.46020656_46020670delCTGCTGCGCCCCCAG	ENSP00000369445:p.Cys46_Ser50del	Somatic	41	1		WXS	Illumina GAIIx	Phase_I	108	14	.	0	0	0	0	0	Q0VDJ8|Q70LJ2	Splice_Site	DEL	ENST00000380102.2	37																																																																																				.		0.698	KRTAP10-7-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000128038.1	NM_198689	
POFUT2	23275	broad.mit.edu;mdanderson.org	37	21	46707762	46707762	+	Silent	SNP	G	G	A			TCGA-OR-A5LO-01A-11D-A29I-10	TCGA-OR-A5LO-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	89d60dde-b03a-4cb7-b32a-5d06fa328603	4a5886aa-889d-4ef2-89a9-be2f7a06bd58	g.chr21:46707762G>A	ENST00000349485.5	-	1	51	c.25C>T	c.(25-27)Ctg>Ttg	p.L9L	POFUT2_ENST00000331343.7_Silent_p.L9L|BX322557.10_ENST00000454115.2_RNA	NM_133635.4	NP_598368.2	Q9Y2G5	OFUT2_HUMAN	protein O-fucosyltransferase 2	9					fucose metabolic process (GO:0006004)|mesoderm formation (GO:0001707)|protein O-linked fucosylation (GO:0036066)|regulation of epithelial to mesenchymal transition (GO:0010717)|regulation of gene expression (GO:0010468)|regulation of secretion (GO:0051046)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)	peptide-O-fucosyltransferase activity (GO:0046922)			breast(1)|endometrium(1)|kidney(2)|large_intestine(2)|liver(1)|lung(9)|skin(2)|upper_aerodigestive_tract(2)	20				Colorectal(79;0.243)		CCCAGCAGCAGGAAGACGAAG	0.726																																					p.L9L		.											.	POFUT2-90	0			c.C25T						.						5.0	7.0	6.0					21																	46707762		2064	4047	6111	SO:0001819	synonymous_variant	23275	exon1			GCAGCAGGAAGAC	AJ203079	CCDS13719.1, CCDS13721.1	21q22.3	2013-03-06	2004-06-07	2004-06-09	ENSG00000186866	ENSG00000186866	2.4.1.221	"""Fucosyltransferases"""	14683	protein-coding gene	gene with protein product	"""peptide-O-fucosyltransferase"", ""GDP-fucose protein O-fucosyltransferase 2"""	610249	"""chromosome 21 open reading frame 80"""	C21orf80			Standard	NM_133635		Approved	KIAA0958, FUT13	uc002zhc.3	Q9Y2G5	OTTHUMG00000084874	ENST00000349485.5:c.25C>T	21.37:g.46707762G>A		Somatic	13	0		WXS	Illumina GAIIx	Phase_I	22	8	NM_015227	0	0	27	44	17	Q6PJV1|Q7Z4N0|Q8WWU6|Q9BQS4|Q9BQS5|Q9UFY3	Silent	SNP	ENST00000349485.5	37	CCDS13719.1																																																																																			.		0.726	POFUT2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000192573.2	NM_015227	
OR11H1	81061	broad.mit.edu;bcgsc.ca;mdanderson.org	37	22	16449102	16449102	+	Missense_Mutation	SNP	G	G	C			TCGA-OR-A5LO-01A-11D-A29I-10	TCGA-OR-A5LO-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	89d60dde-b03a-4cb7-b32a-5d06fa328603	4a5886aa-889d-4ef2-89a9-be2f7a06bd58	g.chr22:16449102G>C	ENST00000252835.4	-	1	703	c.703C>G	c.(703-705)Ctt>Gtt	p.L235V		NM_001005239.1	NP_001005239.1	Q8NG94	O11H1_HUMAN	olfactory receptor, family 11, subfamily H, member 1	235						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			central_nervous_system(1)|endometrium(2)|large_intestine(3)|lung(4)|skin(1)	11	all_hematologic(4;0.00567)|Acute lymphoblastic leukemia(84;0.0977)	all_epithelial(15;0.208)		Kidney(3;0.00216)|KIRC - Kidney renal clear cell carcinoma(3;0.00244)|Lung(27;0.0724)|COAD - Colon adenocarcinoma(3;0.211)		TTCAGGACAAGAGTATAGGAT	0.418																																					p.L235V		.											.	OR11H1-22	0			c.C703G						.						141.0	136.0	138.0					22																	16449102		2201	4297	6498	SO:0001583	missense	81061	exon1			GGACAAGAGTATA	AP000535, AF399611	CCDS74807.1	22q11.1	2012-08-09			ENSG00000130538	ENSG00000130538		"""GPCR / Class A : Olfactory receptors"""	15404	protein-coding gene	gene with protein product						12213199	Standard	NM_001005239		Approved	OR22-1	uc011agd.2	Q8NG94	OTTHUMG00000030069	ENST00000252835.4:c.703C>G	22.37:g.16449102G>C	ENSP00000252835:p.Leu235Val	Somatic	431	0		WXS	Illumina GAIIx	Phase_I	513	147	NM_001005239	0	0	0	0	0	Q6IEX0|Q96R32	Missense_Mutation	SNP	ENST00000252835.4	37	CCDS33594.1	.	.	.	.	.	.	.	.	.	.	g	3.525	-0.096995	0.07010	.	.	ENSG00000130538	ENST00000252835	T	0.00130	8.69	1.73	1.73	0.24493	GPCR, rhodopsin-like superfamily (1);	0.000000	0.37053	N	0.002264	T	0.00178	0.0005	L	0.46614	1.455	0.09310	N	1	P	0.42483	0.781	P	0.47044	0.535	T	0.34329	-0.9833	10	0.42905	T	0.14	.	4.8457	0.13512	0.2164:0.0:0.7836:0.0	.	235	Q8NG94	O11H1_HUMAN	V	235	ENSP00000252835:L235V	ENSP00000252835:L235V	L	-	1	0	OR11H1	14829102	0.000000	0.05858	0.886000	0.34754	0.151000	0.21798	-0.274000	0.08537	0.917000	0.36895	0.368000	0.22195	CTT	T|1.000;|0.000		0.418	OR11H1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000074923.2	NM_001005239	
SI	6476	bcgsc.ca	37	3	164764719	164764719	+	Silent	SNP	C	C	A	rs9838509	byFrequency	TCGA-OR-A5LO-01A-11D-A29I-10	TCGA-OR-A5LO-10A-01D-A29L-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	89d60dde-b03a-4cb7-b32a-5d06fa328603	4a5886aa-889d-4ef2-89a9-be2f7a06bd58	g.chr3:164764719C>A	ENST00000264382.3	-	16	1859	c.1797G>T	c.(1795-1797)gcG>gcT	p.A599A		NM_001041.3	NP_001032.2	P14410	SUIS_HUMAN	sucrase-isomaltase (alpha-glucosidase)	599	Isomaltase.				carbohydrate metabolic process (GO:0005975)|polysaccharide digestion (GO:0044245)|small molecule metabolic process (GO:0044281)	brush border (GO:0005903)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	alpha-1,4-glucosidase activity (GO:0004558)|carbohydrate binding (GO:0030246)|oligo-1,6-glucosidase activity (GO:0004574)|sucrose alpha-glucosidase activity (GO:0004575)	p.A599A(1)		NS(4)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(6)|kidney(10)|large_intestine(18)|lung(124)|ovary(9)|pancreas(1)|prostate(6)|skin(6)|upper_aerodigestive_tract(16)|urinary_tract(1)	218		Prostate(884;0.00314)|Melanoma(1037;0.0153)|all_neural(597;0.0199)			Acarbose(DB00284)|Scopolamine(DB00747)	CTAACCAATGCGCAGCATGTC	0.383										HNSCC(35;0.089)			T|||	3048	0.608626	0.4675	0.6225	5008	,	,		13303	0.8284		0.6282	False		,,,				2504	0.5429				p.A599A		.											.	SI-104	1	Substitution - coding silent(1)	prostate(1)	c.G1797T						.	T		2137,2269		526,1085,592	93.0	89.0	90.0		1797	-5.7	1.0	3	dbSNP_119	90	5139,3461		1533,2073,694	no	coding-synonymous	SI	NM_001041.3		2059,3158,1286	AA,AC,CC		40.2442,48.502,44.0566		599/1828	164764719	7276,5730	2203	4300	6503	SO:0001819	synonymous_variant	6476	exon16			CCAATGCGCAGCA	X63597	CCDS3196.1	3q25.2-q26.2	2004-04-06	2004-04-06		ENSG00000090402	ENSG00000090402	3.2.1.10		10856	protein-coding gene	gene with protein product	"""Oligosaccharide alpha-1,6-glucosidase"""	609845	"""sucrase-isomaltase"""			2962903, 1353958	Standard	NM_001041		Approved		uc003fei.3	P14410	OTTHUMG00000158065	ENST00000264382.3:c.1797G>T	3.37:g.164764719C>A		Somatic	181	0		WXS	Illumina GAIIx	Phase_I	161	5	NM_001041	0	0	0	0	0	A2RUC3|Q1JQ80|Q1RMC2	Silent	SNP	ENST00000264382.3	37	CCDS3196.1																																																																																			C|0.416;A|0.584		0.383	SI-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350116.1	NM_001041	
SPATA16	83893	bcgsc.ca	37	3	172766822	172766822	+	Silent	SNP	G	G	A	rs508508	byFrequency	TCGA-OR-A5LO-01A-11D-A29I-10	TCGA-OR-A5LO-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	89d60dde-b03a-4cb7-b32a-5d06fa328603	4a5886aa-889d-4ef2-89a9-be2f7a06bd58	g.chr3:172766822G>A	ENST00000351008.3	-	3	858	c.675C>T	c.(673-675)agC>agT	p.S225S		NM_031955.5	NP_114161.3	Q9BXB7	SPT16_HUMAN	spermatogenesis associated 16	225					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	Golgi apparatus (GO:0005794)				breast(2)|cervix(1)|large_intestine(8)|lung(20)|ovary(2)|prostate(1)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	43	Ovarian(172;0.00319)|Breast(254;0.197)		LUSC - Lung squamous cell carcinoma(14;1.48e-14)|Lung(28;6.63e-14)			AACTTGCCACGCTTGCTATAT	0.383													G|||	859	0.171526	0.2231	0.1801	5008	,	,		17129	0.1379		0.1511	False		,,,				2504	0.1513				p.S225S		.											.	SPATA16-94	0			c.C675T						.	G		1031,3375	380.2+/-323.6	131,769,1303	104.0	92.0	96.0		675	-2.7	1.0	3	dbSNP_83	96	1243,7357	249.3+/-276.6	92,1059,3149	no	coding-synonymous	SPATA16	NM_031955.5		223,1828,4452	AA,AG,GG		14.4535,23.3999,17.4842		225/570	172766822	2274,10732	2203	4300	6503	SO:0001819	synonymous_variant	83893	exon3			TGCCACGCTTGCT	AF345909	CCDS3221.1	3q26.31	2009-01-05			ENSG00000144962	ENSG00000144962			29935	protein-coding gene	gene with protein product		609856				12529416, 17847006	Standard	NM_031955		Approved	NYD-SP12	uc003fin.4	Q9BXB7	OTTHUMG00000156865	ENST00000351008.3:c.675C>T	3.37:g.172766822G>A		Somatic	137	0		WXS	Illumina GAIIx	Phase_I	79	5	NM_031955	0	0	0	0	0	Q0R0N4|Q0R0S0|Q0R0W2|Q0R129|Q0R131|Q0R140|Q0R1B8|Q0R1G5|Q0R1I2|Q0R1J6|Q0R1S4|Q0R202|Q0R280|Q0R2F8|Q0R2N6|Q0R2N7|Q0R2R0|Q0R2R1|Q0R2S3|Q0R2S4|Q0R2S5|Q0R2T4|Q0R2T7|Q0R2U2|Q0R2U8|Q0R2U9|Q0R2V5|Q0R2V7|Q8NE67	Silent	SNP	ENST00000351008.3	37	CCDS3221.1																																																																																			G|0.824;A|0.176		0.383	SPATA16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346322.1	NM_031955	
MAP6D1	79929	hgsc.bcm.edu	37	3	183543009	183543009	+	Silent	SNP	C	C	A	rs114532244	byFrequency	TCGA-OR-A5LO-01A-11D-A29I-10	TCGA-OR-A5LO-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	89d60dde-b03a-4cb7-b32a-5d06fa328603	4a5886aa-889d-4ef2-89a9-be2f7a06bd58	g.chr3:183543009C>A	ENST00000318631.3	-	1	357	c.327G>T	c.(325-327)gcG>gcT	p.A109A	MAP6D1_ENST00000431348.1_Silent_p.A109A|MAP6D1_ENST00000463801.1_5'UTR	NM_024871.2	NP_079147.1	Q9H9H5	MA6D1_HUMAN	MAP6 domain containing 1	109					dendrite morphogenesis (GO:0048813)|lysosome localization (GO:0032418)|microtubule cytoskeleton organization (GO:0000226)|N-terminal peptidyl-L-cysteine N-palmitoylation (GO:0018009)|negative regulation of microtubule depolymerization (GO:0007026)	cis-Golgi network (GO:0005801)|Golgi-associated vesicle (GO:0005798)|microtubule (GO:0005874)				endometrium(1)|lung(1)	2	all_cancers(143;6.55e-10)|Ovarian(172;0.0303)		all cancers(12;5.15e-42)|Epithelial(37;4.29e-36)|OV - Ovarian serous cystadenocarcinoma(80;6.48e-22)			GGGCGCCGGGCGCAGGTGGCG	0.771													C|||	51	0.0101837	0.0325	0.0072	5008	,	,		9364	0.0		0.003	False		,,,				2504	0.0				p.A109A		.											.	MAP6D1-90	0			c.G327T						.	C		58,3080		0,58,1511	2.0	3.0	3.0		327	-0.3	0.0	3	dbSNP_132	3	7,6561		0,7,3277	no	coding-synonymous	MAP6D1	NM_024871.2		0,65,4788	AA,AC,CC		0.1066,1.8483,0.6697		109/200	183543009	65,9641	1569	3284	4853	SO:0001819	synonymous_variant	79929	exon1			GCCGGGCGCAGGT	BC006434	CCDS3247.1	3q27.1	2005-12-22			ENSG00000180834	ENSG00000180834			25753	protein-coding gene	gene with protein product		610593				12477932	Standard	NM_024871		Approved	FLJ12748	uc003fmc.2	Q9H9H5	OTTHUMG00000156900	ENST00000318631.3:c.327G>T	3.37:g.183543009C>A		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	35	33	NM_024871	0	0	0	0	0		Silent	SNP	ENST00000318631.3	37	CCDS3247.1																																																																																			C|0.982;A|0.018		0.771	MAP6D1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346516.1	NM_024871	
MUC4	4585	bcgsc.ca	37	3	195506187	195506187	+	Silent	SNP	T	T	C	rs199574462		TCGA-OR-A5LO-01A-11D-A29I-10	TCGA-OR-A5LO-10A-01D-A29L-10	T	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	89d60dde-b03a-4cb7-b32a-5d06fa328603	4a5886aa-889d-4ef2-89a9-be2f7a06bd58	g.chr3:195506187T>C	ENST00000463781.3	-	2	12723	c.12264A>G	c.(12262-12264)tcA>tcG	p.S4088S	MUC4_ENST00000349607.4_Intron|MUC4_ENST00000475231.1_Silent_p.S4088S|MUC4_ENST00000346145.4_Intron	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		CGGTGGATGCTGAGGAAGCAT	0.577																																					p.S4088S		.											.	MUC4-90	0			c.A12264G						.						37.0	19.0	24.0					3																	195506187		559	1321	1880	SO:0001819	synonymous_variant	4585	exon2			GGATGCTGAGGAA	AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.12264A>G	3.37:g.195506187T>C		Somatic	253	8		WXS	Illumina GAIIx	Phase_I	65	18	NM_018406	0	0	0	0	0	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Silent	SNP	ENST00000463781.3	37	CCDS54700.1																																																																																			.		0.577	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324081.6	NM_018406	
MUC4	4585	bcgsc.ca	37	3	195510011	195510011	+	Missense_Mutation	SNP	C	C	T	rs28375716		TCGA-OR-A5LO-01A-11D-A29I-10	TCGA-OR-A5LO-10A-01D-A29L-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	89d60dde-b03a-4cb7-b32a-5d06fa328603	4a5886aa-889d-4ef2-89a9-be2f7a06bd58	g.chr3:195510011C>T	ENST00000463781.3	-	2	8899	c.8440G>A	c.(8440-8442)Gcc>Acc	p.A2814T	MUC4_ENST00000349607.4_Intron|MUC4_ENST00000475231.1_Missense_Mutation_p.A2814T|MUC4_ENST00000346145.4_Intron	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		AGAGAGGTGGCGTGACCTGTG	0.587																																					p.A2814T		.											.	MUC4-90	0			c.G8440A						.						70.0	44.0	52.0					3																	195510011		685	1518	2203	SO:0001583	missense	4585	exon2			AGGTGGCGTGACC	AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.8440G>A	3.37:g.195510011C>T	ENSP00000417498:p.Ala2814Thr	Somatic	338	9		WXS	Illumina GAIIx	Phase_I	440	28	NM_018406	0	0	0	0	0	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	ENST00000463781.3	37	CCDS54700.1	.	.	.	.	.	.	.	.	.	.	-	8.082	0.772585	0.16051	.	.	ENSG00000145113	ENST00000463781;ENST00000475231	T;T	0.34472	1.37;1.36	.	.	.	.	.	.	.	.	T	0.23330	0.0564	N	0.19112	0.55	0.09310	N	0.999993	D	0.53312	0.959	P	0.45971	0.499	T	0.13575	-1.0504	7	.	.	.	.	5.8178	0.18506	0.0:0.999:0.0:0.001	.	2686	E7ESK3	.	T	2814	ENSP00000417498:A2814T;ENSP00000420243:A2814T	.	A	-	1	0	MUC4	196994790	0.001000	0.12720	0.022000	0.16811	0.020000	0.10135	-2.830000	0.00744	-0.000000	0.14550	0.000000	0.15137	GCC	.		0.587	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324081.6	NM_018406	
FAM157A	728262	bcgsc.ca	37	3	197880164	197880164	+	lincRNA	SNP	G	G	A			TCGA-OR-A5LO-01A-11D-A29I-10	TCGA-OR-A5LO-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	89d60dde-b03a-4cb7-b32a-5d06fa328603	4a5886aa-889d-4ef2-89a9-be2f7a06bd58	g.chr3:197880164G>A	ENST00000437428.2	+	0	44							C9JC47	F157A_HUMAN	family with sequence similarity 157, member A											NS(1)|skin(1)	2						agcagcagcagcagcagcaAC	0.527																																					p.Q81Q		.											.	.	0			c.G243A						.						3.0	6.0	5.0					3																	197880164		474	1113	1587			728262	exon2			GCAGCAGCAGCAG			3q29	2013-01-30			ENSG00000236438	ENSG00000236438			34079	other	unknown							Standard	NM_001145248		Approved		uc011bup.1	C9JC47			3.37:g.197880164G>A		Somatic	831	9		WXS	Illumina GAIIx	Phase_I	802	30	NM_001145248	0	0	0	0	0		Silent	SNP	ENST00000437428.2	37																																																																																				.		0.527	FAM157A-001	KNOWN	not_best_in_genome_evidence|mRNA_end_NF|basic	lincRNA	lincRNA	OTTHUMT00000340078.2	NM_001145248	
IDUA	3425	broad.mit.edu	37	4	996204	996204	+	Missense_Mutation	SNP	A	A	C			TCGA-OR-A5LO-01A-11D-A29I-10	TCGA-OR-A5LO-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	89d60dde-b03a-4cb7-b32a-5d06fa328603	4a5886aa-889d-4ef2-89a9-be2f7a06bd58	g.chr4:996204A>C	ENST00000247933.4	+	8	1208	c.1120A>C	c.(1120-1122)Acc>Ccc	p.T374P	IDUA_ENST00000514224.1_Missense_Mutation_p.T242P|IDUA_ENST00000453894.1_Missense_Mutation_p.T396P	NM_000203.3	NP_000194.2	P35475	IDUA_HUMAN	iduronidase, alpha-L-	374					carbohydrate metabolic process (GO:0005975)|cell morphogenesis (GO:0000902)|chemical homeostasis (GO:0048878)|chondroitin sulfate catabolic process (GO:0030207)|chondroitin sulfate metabolic process (GO:0030204)|dermatan sulfate catabolic process (GO:0030209)|disaccharide metabolic process (GO:0005984)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|limb morphogenesis (GO:0035108)|lysosome organization (GO:0007040)|skeletal system morphogenesis (GO:0048705)|small molecule metabolic process (GO:0044281)	coated vesicle (GO:0030135)|extracellular vesicular exosome (GO:0070062)|lysosomal lumen (GO:0043202)	L-iduronidase activity (GO:0003940)			breast(1)|endometrium(3)|kidney(1)|large_intestine(1)|lung(5)|upper_aerodigestive_tract(1)	12			OV - Ovarian serous cystadenocarcinoma(23;0.0158)			GGTCAACAACACCCGCCCGCC	0.711																																					p.T374P		.											.	IDUA-91	0			c.A1120C						.						26.0	28.0	27.0					4																	996204		2185	4282	6467	SO:0001583	missense	3425	exon8			AACAACACCCGCC	M74715	CCDS3343.1	4p16.3	2012-10-02			ENSG00000127415	ENSG00000127415	3.2.1.76		5391	protein-coding gene	gene with protein product		252800				1832239	Standard	NM_000203		Approved	MPS1	uc003gby.3	P35475	OTTHUMG00000088901	ENST00000247933.4:c.1120A>C	4.37:g.996204A>C	ENSP00000247933:p.Thr374Pro	Somatic	71	6		WXS	Illumina GAIIx	Phase_I	131	54	NM_000203	0	0	4	5	1	B3KWK6	Missense_Mutation	SNP	ENST00000247933.4	37	CCDS3343.1	.	.	.	.	.	.	.	.	.	.	A	21.2	4.117066	0.77323	.	.	ENSG00000127415	ENST00000247933;ENST00000453894;ENST00000514224	D;D;D	0.94280	-3.39;-3.39;-3.39	5.31	5.31	0.75309	Glycoside hydrolase, subgroup, catalytic domain (1);Glycoside hydrolase, superfamily (1);	0.156849	0.56097	D	0.000026	D	0.96611	0.8894	M	0.86178	2.8	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.995	D	0.96508	0.9376	10	0.46703	T	0.11	-7.29	13.2474	0.60029	1.0:0.0:0.0:0.0	.	396;374	B3KWK6;P35475	.;IDUA_HUMAN	P	374;396;242	ENSP00000247933:T374P;ENSP00000396458:T396P;ENSP00000425081:T242P	ENSP00000247933:T374P	T	+	1	0	IDUA	986204	1.000000	0.71417	0.995000	0.50966	0.426000	0.31534	5.967000	0.70403	2.024000	0.59613	0.454000	0.30748	ACC	.		0.711	IDUA-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000201812.1	NM_000203	
DOK7	285489	hgsc.bcm.edu	37	4	3495064	3495064	+	Missense_Mutation	SNP	C	C	T	rs16844470	byFrequency	TCGA-OR-A5LO-01A-11D-A29I-10	TCGA-OR-A5LO-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	89d60dde-b03a-4cb7-b32a-5d06fa328603	4a5886aa-889d-4ef2-89a9-be2f7a06bd58	g.chr4:3495064C>T	ENST00000340083.5	+	7	1416	c.1351C>T	c.(1351-1353)Cgg>Tgg	p.R451W	DOK7_ENST00000389653.2_Missense_Mutation_p.R451W|DOK7_ENST00000512714.1_3'UTR|DOK7_ENST00000507039.1_3'UTR	NM_173660.4	NP_775931.3	Q18PE1	DOK7_HUMAN	docking protein 7	451			R -> W (in dbSNP:rs16844470). {ECO:0000269|PubMed:22661499}.		neuromuscular junction development (GO:0007528)|positive regulation of protein tyrosine kinase activity (GO:0061098)|receptor clustering (GO:0043113)	cell junction (GO:0030054)|neuromuscular junction (GO:0031594)|plasma membrane (GO:0005886)	phosphatidylinositol binding (GO:0035091)|protein kinase binding (GO:0019901)			kidney(1)|large_intestine(1)|skin(2)|upper_aerodigestive_tract(1)	5				UCEC - Uterine corpus endometrioid carcinoma (64;0.163)		GGGCACGAGACGGCGGGGCCT	0.771													.|||	83	0.0165735	0.0598	0.0043	5008	,	,		12796	0.0		0.0	False		,,,				2504	0.001				p.R451W		.											.	DOK7-91	0			c.C1351T						.	C	,TRP/ARG	173,4055		1,171,1942	6.0	7.0	7.0		,1351	2.5	0.6	4	dbSNP_123	7	11,8329		0,11,4159	no	utr-3,missense	DOK7	NM_001164673.1,NM_173660.4	,101	1,182,6101	TT,TC,CC		0.1319,4.0918,1.464	,probably-damaging	,451/505	3495064	184,12384	2114	4170	6284	SO:0001583	missense	285489	exon7			ACGAGACGGCGGG	AK091037	CCDS3370.2, CCDS54717.1	4p16.2	2014-09-17	2006-08-24	2006-08-24	ENSG00000175920	ENSG00000175920			26594	protein-coding gene	gene with protein product		610285	"""chromosome 4 open reading frame 25"""	C4orf25		16794080	Standard	NM_173660		Approved	FLJ33718, FLJ39137, Dok-7	uc003ghd.3	Q18PE1	OTTHUMG00000122087	ENST00000340083.5:c.1351C>T	4.37:g.3495064C>T	ENSP00000344432:p.Arg451Trp	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	16	16	NM_173660	0	0	0	0	0	A2A499|A2RRD4|E9PB56|Q6P6A6|Q86XG5|Q8N2J3|Q8NBC1	Missense_Mutation	SNP	ENST00000340083.5	37	CCDS3370.2	17	0.007783882783882784	15	0.03048780487804878	2	0.0055248618784530384	0	0.0	0	0.0	C	13.64	2.297697	0.40694	0.040918	0.001319	ENSG00000175920	ENST00000389653;ENST00000340083	T;T	0.66815	-0.23;-0.14	4.29	2.51	0.30379	.	0.374919	0.23426	N	0.048314	T	0.45216	0.1331	M	0.68317	2.08	0.09310	N	1	D;D;B	0.89917	1.0;1.0;0.27	P;D;B	0.67382	0.897;0.951;0.026	T	0.52388	-0.8582	10	0.62326	D	0.03	-7.8434	7.5471	0.27772	0.1653:0.7458:0.0:0.089	rs16844470;rs16844470	451;313;451	Q18PE1-3;Q18PE1-2;Q18PE1	.;.;DOK7_HUMAN	W	451	ENSP00000374304:R451W;ENSP00000344432:R451W	ENSP00000344432:R451W	R	+	1	2	DOK7	3464862	0.000000	0.05858	0.621000	0.29145	0.160000	0.22226	0.169000	0.16641	0.787000	0.33731	0.555000	0.69702	CGG	C|0.990;T|0.010		0.771	DOK7-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000313538.1	NM_173660	
CRMP1	1400	hgsc.bcm.edu	37	4	5894586	5894586	+	Silent	SNP	G	G	A	rs143304363	byFrequency	TCGA-OR-A5LO-01A-11D-A29I-10	TCGA-OR-A5LO-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	89d60dde-b03a-4cb7-b32a-5d06fa328603	4a5886aa-889d-4ef2-89a9-be2f7a06bd58	g.chr4:5894586G>A	ENST00000324989.7	-	1	199	c.111C>T	c.(109-111)gcC>gcT	p.A37A	CRMP1_ENST00000512574.1_5'Flank	NM_001014809.1	NP_001014809.1	Q14194	DPYL1_HUMAN	collapsin response mediator protein 1	0					axon guidance (GO:0007411)|nervous system development (GO:0007399)|nucleobase-containing compound metabolic process (GO:0006139)|pyrimidine nucleobase catabolic process (GO:0006208)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dendrite (GO:0030425)|neuronal cell body (GO:0043025)	hydrolase activity, acting on carbon-nitrogen (but not peptide) bonds, in cyclic amides (GO:0016812)			NS(1)|cervix(2)|endometrium(4)|large_intestine(10)|lung(11)|ovary(2)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	36				Colorectal(103;0.0721)		CCTCCACCGCGGCGAACATGC	0.756													G|||	277	0.0553115	0.0076	0.0461	5008	,	,		4031	0.0437		0.0805	False		,,,				2504	0.1125				p.A37A		.											.	CRMP1-92	0			c.C111T						.	G		56,3324		2,52,1636	4.0	4.0	4.0		111	0.2	1.0	4	dbSNP_134	4	409,6095		9,391,2852	no	coding-synonymous	CRMP1	NM_001014809.1		11,443,4488	AA,AG,GG		6.2884,1.6568,4.7046		37/687	5894586	465,9419	1690	3252	4942	SO:0001819	synonymous_variant	1400	exon1			CACCGCGGCGAAC	D78012	CCDS33950.1, CCDS43207.1, CCDS75102.1	4p16.1	2008-05-15			ENSG00000072832	ENSG00000072832			2365	protein-coding gene	gene with protein product		602462				8973361	Standard	XM_005247940		Approved	DRP-1, DPYSL1	uc003gis.3	Q14194	OTTHUMG00000125489	ENST00000324989.7:c.111C>T	4.37:g.5894586G>A		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	13	11	NM_001014809	0	0	0	1	1	A0EJG6|Q13024|Q4W5F1|Q96TC8	Silent	SNP	ENST00000324989.7	37	CCDS33950.1																																																																																			G|0.946;A|0.054		0.756	CRMP1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000246814.2	NM_001313	
CPZ	8532	broad.mit.edu	37	4	8621339	8621339	+	Missense_Mutation	SNP	T	T	G			TCGA-OR-A5LO-01A-11D-A29I-10	TCGA-OR-A5LO-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	89d60dde-b03a-4cb7-b32a-5d06fa328603	4a5886aa-889d-4ef2-89a9-be2f7a06bd58	g.chr4:8621339T>G	ENST00000360986.4	+	11	2128	c.1954T>G	c.(1954-1956)Tac>Gac	p.Y652D	CPZ_ENST00000315782.6_Missense_Mutation_p.Y641D|CPZ_ENST00000382480.2_Missense_Mutation_p.Y515D|CPZ_ENST00000429646.2_Missense_Mutation_p.Y260D	NM_001014447.2	NP_001014447	Q66K79	CBPZ_HUMAN	carboxypeptidase Z	652					proteolysis (GO:0006508)|Wnt signaling pathway (GO:0016055)	extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	metallocarboxypeptidase activity (GO:0004181)|zinc ion binding (GO:0008270)			cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(23)|ovary(3)|pancreas(1)|skin(1)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	46						GCTGCTCAAGTACTAGCCCCG	0.667																																					p.Y652D		.											.	CPZ-93	0			c.T1954G						.						15.0	15.0	15.0					4																	8621339		2197	4293	6490	SO:0001583	missense	8532	exon11			CTCAAGTACTAGC	U83411	CCDS3404.1, CCDS33953.1, CCDS43212.1	4p16.1	2012-02-10			ENSG00000109625	ENSG00000109625			2333	protein-coding gene	gene with protein product	"""metallocarboxypeptidase Z"""	603105				9099699	Standard	NM_001014447		Approved		uc003glm.3	Q66K79	OTTHUMG00000090513	ENST00000360986.4:c.1954T>G	4.37:g.8621339T>G	ENSP00000354255:p.Tyr652Asp	Somatic	34	0		WXS	Illumina GAIIx	Phase_I	34	4	NM_001014447	0	0	6	6	0	O00520|Q96MX2	Missense_Mutation	SNP	ENST00000360986.4	37	CCDS33953.1	.	.	.	.	.	.	.	.	.	.	T	14.53	2.563445	0.45694	.	.	ENSG00000109625	ENST00000360986;ENST00000382480;ENST00000315782;ENST00000429646	T;T;T;T	0.59638	0.56;1.95;0.25;1.76	4.55	4.55	0.56014	.	0.514451	0.18046	N	0.153444	T	0.65575	0.2704	L	0.60455	1.87	0.27808	N	0.94226	D;D	0.62365	0.991;0.985	P;P	0.59487	0.858;0.724	T	0.60515	-0.7248	10	0.72032	D	0.01	.	7.6329	0.28249	0.0:0.1064:0.0:0.8936	.	641;652	Q66K79-2;Q66K79	.;CBPZ_HUMAN	D	652;515;641;260	ENSP00000354255:Y652D;ENSP00000371920:Y515D;ENSP00000315074:Y641D;ENSP00000403981:Y260D	ENSP00000315074:Y641D	Y	+	1	0	CPZ	8672239	0.994000	0.37717	1.000000	0.80357	0.354000	0.29330	0.838000	0.27572	1.687000	0.51057	0.379000	0.24179	TAC	.		0.667	CPZ-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000207001.4	NM_003652	
FAM184B	27146	hgsc.bcm.edu	37	4	17643848	17643848	+	Missense_Mutation	SNP	G	G	A	rs2286771	byFrequency	TCGA-OR-A5LO-01A-11D-A29I-10	TCGA-OR-A5LO-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	89d60dde-b03a-4cb7-b32a-5d06fa328603	4a5886aa-889d-4ef2-89a9-be2f7a06bd58	g.chr4:17643848G>A	ENST00000265018.3	-	13	2562	c.2350C>T	c.(2350-2352)Cgg>Tgg	p.R784W		NM_015688.1	NP_056503.1	Q9ULE4	F184B_HUMAN	family with sequence similarity 184, member B	784				R -> W (in Ref. 1; BAA86590). {ECO:0000305}.						NS(1)|central_nervous_system(1)|endometrium(1)|prostate(1)	4						GGGCCGCCCCGCTCCTGAGGA	0.701													G|||	2697	0.538538	0.1725	0.6599	5008	,	,		10215	0.8522		0.6233	False		,,,				2504	0.5368				p.R784W		.											.	FAM184B-23	0			c.C2350T						.						1.0	2.0	2.0					4																	17643848		374	1044	1418	SO:0001583	missense	27146	exon13			CGCCCCGCTCCTG		CCDS47033.1	4p16	2009-04-22			ENSG00000047662	ENSG00000047662			29235	protein-coding gene	gene with protein product						10574462	Standard	NM_015688		Approved	KIAA1276	uc003gpm.4	Q9ULE4	OTTHUMG00000160287	ENST00000265018.3:c.2350C>T	4.37:g.17643848G>A	ENSP00000265018:p.Arg784Trp	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	6	6	NM_015688	0	0	0	0	0		Missense_Mutation	SNP	ENST00000265018.3	37	CCDS47033.1	1272	0.5824175824175825	75	0.1524390243902439	232	0.6408839779005525	493	0.8618881118881119	472	0.6226912928759895	G	13.83	2.354233	0.41700	.	.	ENSG00000047662	ENST00000265018	T	0.34072	1.38	3.29	-3.67	0.04476	.	3.541600	0.00901	N	0.002342	T	0.00012	0.0000	N	0.14661	0.345	0.80722	P	0.0	D	0.56968	0.978	B	0.40741	0.339	T	0.48547	-0.9026	9	0.72032	D	0.01	2.0681	6.7491	0.23477	0.107:0.2547:0.5506:0.0877	rs2286771;rs58699512;rs2286771	784	Q9ULE4	F184B_HUMAN	W	784	ENSP00000265018:R784W	ENSP00000265018:R784W	R	-	1	2	FAM184B	17252946	0.000000	0.05858	0.000000	0.03702	0.516000	0.34256	-0.323000	0.07997	-1.014000	0.03379	-0.369000	0.07265	CGG	G|0.440;A|0.560		0.701	FAM184B-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000360137.1	NM_015688	
CSN1S1	1446	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	70802862	70802862	+	Splice_Site	SNP	G	G	T			TCGA-OR-A5LO-01A-11D-A29I-10	TCGA-OR-A5LO-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	89d60dde-b03a-4cb7-b32a-5d06fa328603	4a5886aa-889d-4ef2-89a9-be2f7a06bd58	g.chr4:70802862G>T	ENST00000246891.4	+	8	268	c.219G>T	c.(217-219)caG>caT	p.Q73H	CSN1S1_ENST00000507763.1_Splice_Site_p.Q72H|CSN1S1_ENST00000444405.3_Splice_Site_p.Q72H|CSN1S1_ENST00000507772.1_Splice_Site_p.Q73H|CSN1S1_ENST00000505782.1_Intron	NM_001890.1	NP_001881.1	P47710	CASA1_HUMAN	casein alpha s1	73						extracellular region (GO:0005576)|extracellular space (GO:0005615)	transporter activity (GO:0005215)			lung(5)|prostate(1)|upper_aerodigestive_tract(1)	7						AGTCTACTCAGGTGAGACCCT	0.299																																					p.Q73H		.											.	.	0			c.G219T						.						30.0	30.0	30.0					4																	70802862		1780	3999	5779	SO:0001630	splice_region_variant	1446	exon8			TACTCAGGTGAGA	X78416	CCDS47067.1, CCDS54769.1	4q21.1	2014-02-19	2003-01-24	2003-01-31	ENSG00000126545	ENSG00000126545			2445	protein-coding gene	gene with protein product		115450	"""casein, alpha"""	CASA, CSN1		9050925, 7619062	Standard	NM_001890		Approved		uc003hep.1	P47710	OTTHUMG00000160843	ENST00000246891.4:c.219+1G>T	4.37:g.70802862G>T		Somatic	128	0		WXS	Illumina GAIIx	Phase_I	239	43	NM_001890	0	0	0	0	0	A1A510|A1A511|E9PB60|Q4PNR5	Missense_Mutation	SNP	ENST00000246891.4	37	CCDS47067.1	.	.	.	.	.	.	.	.	.	.	G	8.002	0.755659	0.15846	.	.	ENSG00000126545	ENST00000246891;ENST00000444405;ENST00000507763;ENST00000507772	T;T;T;T	0.46819	0.87;0.86;0.86;0.86	3.25	0.0712	0.14381	.	.	.	.	.	T	0.23727	0.0574	N	0.08118	0	.	.	.	B;B;B	0.22541	0.071;0.071;0.071	B;B;B	0.22601	0.04;0.04;0.04	T	0.19679	-1.0298	8	0.87932	D	0	0.004	3.7241	0.08467	0.1881:0.0:0.577:0.2349	.	73;72;73	E9PDQ1;E9PB60;P47710	.;.;CASA1_HUMAN	H	73;72;72;73	ENSP00000246891:Q73H;ENSP00000413157:Q72H;ENSP00000422611:Q72H;ENSP00000427490:Q73H	ENSP00000246891:Q73H	Q	+	3	2	CSN1S1	70837451	0.044000	0.20184	0.198000	0.23420	0.016000	0.09150	-0.086000	0.11233	0.000000	0.14550	0.478000	0.44815	CAG	.		0.299	CSN1S1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000362629.1		Missense_Mutation
CSN1S1	1446	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	70810573	70810573	+	Missense_Mutation	SNP	C	C	A			TCGA-OR-A5LO-01A-11D-A29I-10	TCGA-OR-A5LO-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	89d60dde-b03a-4cb7-b32a-5d06fa328603	4a5886aa-889d-4ef2-89a9-be2f7a06bd58	g.chr4:70810573C>A	ENST00000246891.4	+	15	457	c.408C>A	c.(406-408)ttC>ttA	p.F136L	CSN1S1_ENST00000507763.1_Missense_Mutation_p.F127L|CSN1S1_ENST00000444405.3_Missense_Mutation_p.F127L|CSN1S1_ENST00000507772.1_Missense_Mutation_p.F128L|CSN1S1_ENST00000505782.1_Missense_Mutation_p.F120L	NM_001890.1	NP_001881.1	P47710	CASA1_HUMAN	casein alpha s1	136						extracellular region (GO:0005576)|extracellular space (GO:0005615)	transporter activity (GO:0005215)			lung(5)|prostate(1)|upper_aerodigestive_tract(1)	7						TCTAGCCTTTCCAGCAGCTCA	0.413																																					p.F136L		.											.	.	0			c.C408A						.						352.0	338.0	343.0					4																	70810573		1945	4136	6081	SO:0001583	missense	1446	exon15			GCCTTTCCAGCAG	X78416	CCDS47067.1, CCDS54769.1	4q21.1	2014-02-19	2003-01-24	2003-01-31	ENSG00000126545	ENSG00000126545			2445	protein-coding gene	gene with protein product		115450	"""casein, alpha"""	CASA, CSN1		9050925, 7619062	Standard	NM_001890		Approved		uc003hep.1	P47710	OTTHUMG00000160843	ENST00000246891.4:c.408C>A	4.37:g.70810573C>A	ENSP00000246891:p.Phe136Leu	Somatic	151	1		WXS	Illumina GAIIx	Phase_I	254	70	NM_001890	0	0	0	0	0	A1A510|A1A511|E9PB60|Q4PNR5	Missense_Mutation	SNP	ENST00000246891.4	37	CCDS47067.1	.	.	.	.	.	.	.	.	.	.	C	9.038	0.989017	0.18966	.	.	ENSG00000126545	ENST00000246891;ENST00000444405;ENST00000354865;ENST00000507763;ENST00000507772;ENST00000505782;ENST00000510936	T;T;T;T;T;T	0.42513	1.0;0.99;0.99;0.99;1.0;0.97	4.08	3.21	0.36854	.	0.976699	0.08353	N	0.958955	T	0.36936	0.0985	L	0.49126	1.545	0.09310	N	1.0	P;P;P	0.37101	0.582;0.582;0.582	B;B;B	0.33392	0.163;0.163;0.163	T	0.42799	-0.9430	9	0.46703	T	0.11	-0.1926	9.6654	0.39981	0.0:0.7878:0.2122:0.0	.	128;127;136	E9PDQ1;E9PB60;P47710	.;.;CASA1_HUMAN	L	136;127;128;127;128;120;27	ENSP00000246891:F136L;ENSP00000413157:F127L;ENSP00000422611:F127L;ENSP00000427490:F128L;ENSP00000426684:F120L;ENSP00000421314:F27L	ENSP00000246891:F136L	F	+	3	2	CSN1S1	70845162	0.003000	0.15002	0.003000	0.11579	0.002000	0.02628	0.699000	0.25586	1.235000	0.43724	0.655000	0.94253	TTC	.		0.413	CSN1S1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000362629.1		
SOWAHB	345079	hgsc.bcm.edu	37	4	77818202	77818202	+	Silent	SNP	T	T	C	rs2645674	byFrequency	TCGA-OR-A5LO-01A-11D-A29I-10	TCGA-OR-A5LO-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	89d60dde-b03a-4cb7-b32a-5d06fa328603	4a5886aa-889d-4ef2-89a9-be2f7a06bd58	g.chr4:77818202T>C	ENST00000334306.2	-	1	800	c.801A>G	c.(799-801)acA>acG	p.T267T		NM_001029870.1	NP_001025041.1	A6NEL2	SWAHB_HUMAN	sosondowah ankyrin repeat domain family member B	267	Ala-rich.																AAGCCCTGCTTGTCGCAGCCT	0.726													C|||	1670	0.333466	0.4887	0.2392	5008	,	,		13358	0.2292		0.332	False		,,,				2504	0.2996				p.T267T		.											.	.	0			c.A801G						.	C		1258,2610		207,844,883	3.0	5.0	4.0		801	-3.8	0.0	4	dbSNP_100	4	1803,5973		226,1351,2311	no	coding-synonymous	ANKRD56	NM_001029870.1		433,2195,3194	CC,CT,TT		23.1867,32.5233,26.2882		267/794	77818202	3061,8583	1934	3888	5822	SO:0001819	synonymous_variant	345079	exon1			CCTGCTTGTCGCA		CCDS34017.1	4q21.1	2013-01-10	2012-01-12	2012-01-12	ENSG00000186212	ENSG00000186212		"""Ankyrin repeat domain containing"""	32958	protein-coding gene	gene with protein product			"""ankyrin repeat domain 56"""	ANKRD56		22234889	Standard	NM_001029870		Approved		uc003hki.3	A6NEL2	OTTHUMG00000160876	ENST00000334306.2:c.801A>G	4.37:g.77818202T>C		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	7	6	NM_001029870	0	0	0	2	2	B2RP29	Silent	SNP	ENST00000334306.2	37	CCDS34017.1																																																																																			T|0.691;C|0.309		0.726	SOWAHB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000362762.1	NM_001029870	
DSPP	1834	bcgsc.ca	37	4	88537051	88537051	+	Silent	SNP	T	T	C	rs371970214		TCGA-OR-A5LO-01A-11D-A29I-10	TCGA-OR-A5LO-10A-01D-A29L-10	T	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	89d60dde-b03a-4cb7-b32a-5d06fa328603	4a5886aa-889d-4ef2-89a9-be2f7a06bd58	g.chr4:88537051T>C	ENST00000282478.7	+	4	3270	c.3237T>C	c.(3235-3237)agT>agC	p.S1079S	RP11-742B18.1_ENST00000506480.1_RNA|DSPP_ENST00000399271.1_Silent_p.S1079S			Q9NZW4	DSPP_HUMAN	dentin sialophosphoprotein	1079	Asp/Ser-rich.				biomineral tissue development (GO:0031214)|cellular response to cell-matrix adhesion (GO:0071460)|extracellular matrix organization (GO:0030198)|multicellular organismal development (GO:0007275)|ossification (GO:0001503)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|collagen binding (GO:0005518)|extracellular matrix structural constituent (GO:0005201)			breast(2)|central_nervous_system(1)|endometrium(9)|kidney(4)|large_intestine(8)|lung(13)|ovary(1)|skin(3)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	47		Hepatocellular(203;0.114)|all_hematologic(202;0.236)		OV - Ovarian serous cystadenocarcinoma(123;0.000508)		gcgacagcagtgatagcagtg	0.552																																					p.S1079S		.											.	DSPP-90	0			c.T3237C						.						42.0	49.0	47.0					4																	88537051		1482	2726	4208	SO:0001819	synonymous_variant	1834	exon5			CAGCAGTGATAGC	AF163151	CCDS43248.1	4q21.3	2008-02-05			ENSG00000152591	ENSG00000152591			3054	protein-coding gene	gene with protein product		125485		DFNA39, DGI1		8995371, 9533027	Standard	NM_014208		Approved	DMP3	uc003hqu.3	Q9NZW4	OTTHUMG00000161061	ENST00000282478.7:c.3237T>C	4.37:g.88537051T>C		Somatic	1025	16		WXS	Illumina GAIIx	Phase_I	752	39	NM_014208	0	0	0	0	0	A8MUI0|O95815	Silent	SNP	ENST00000282478.7	37	CCDS43248.1																																																																																			.		0.552	DSPP-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000363616.3	NM_014208	
DSPP	1834	bcgsc.ca	37	4	88537117	88537117	+	Silent	SNP	C	C	T	rs199799532	byFrequency	TCGA-OR-A5LO-01A-11D-A29I-10	TCGA-OR-A5LO-10A-01D-A29L-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	89d60dde-b03a-4cb7-b32a-5d06fa328603	4a5886aa-889d-4ef2-89a9-be2f7a06bd58	g.chr4:88537117C>T	ENST00000282478.7	+	4	3336	c.3303C>T	c.(3301-3303)gaC>gaT	p.D1101D	RP11-742B18.1_ENST00000506480.1_RNA|DSPP_ENST00000399271.1_Silent_p.D1101D			Q9NZW4	DSPP_HUMAN	dentin sialophosphoprotein	1101	Asp/Ser-rich.			Missing (in Ref. 1; AAF42472 and 3; AAD16120). {ECO:0000305}.	biomineral tissue development (GO:0031214)|cellular response to cell-matrix adhesion (GO:0071460)|extracellular matrix organization (GO:0030198)|multicellular organismal development (GO:0007275)|ossification (GO:0001503)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|collagen binding (GO:0005518)|extracellular matrix structural constituent (GO:0005201)			breast(2)|central_nervous_system(1)|endometrium(9)|kidney(4)|large_intestine(8)|lung(13)|ovary(1)|skin(3)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	47		Hepatocellular(203;0.114)|all_hematologic(202;0.236)		OV - Ovarian serous cystadenocarcinoma(123;0.000508)		atagcagcgacagcagcgaca	0.537													C|||	689	0.13758	0.0968	0.1427	5008	,	,		12804	0.1528		0.1461	False		,,,				2504	0.1646				p.D1101D		.											.	DSPP-90	0			c.C3303T						.						13.0	20.0	18.0					4																	88537117		1053	1995	3048	SO:0001819	synonymous_variant	1834	exon5			CAGCGACAGCAGC	AF163151	CCDS43248.1	4q21.3	2008-02-05			ENSG00000152591	ENSG00000152591			3054	protein-coding gene	gene with protein product		125485		DFNA39, DGI1		8995371, 9533027	Standard	NM_014208		Approved	DMP3	uc003hqu.3	Q9NZW4	OTTHUMG00000161061	ENST00000282478.7:c.3303C>T	4.37:g.88537117C>T		Somatic	643	15		WXS	Illumina GAIIx	Phase_I	329	28	NM_014208	0	0	0	0	0	A8MUI0|O95815	Silent	SNP	ENST00000282478.7	37	CCDS43248.1																																																																																			.		0.537	DSPP-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000363616.3	NM_014208	
METTL14	57721	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	119626935	119626935	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5LO-01A-11D-A29I-10	TCGA-OR-A5LO-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	89d60dde-b03a-4cb7-b32a-5d06fa328603	4a5886aa-889d-4ef2-89a9-be2f7a06bd58	g.chr4:119626935G>A	ENST00000388822.5	+	10	1192	c.1025G>A	c.(1024-1026)aGa>aAa	p.R342K	METTL14_ENST00000506780.1_Missense_Mutation_p.R304K			Q9HCE5	MET14_HUMAN	methyltransferase like 14	342					mRNA destabilization (GO:0061157)|mRNA methylation (GO:0080009)|stem cell maintenance (GO:0019827)	MIS complex (GO:0036396)|nucleus (GO:0005634)	mRNA (2'-O-methyladenosine-N6-)-methyltransferase activity (GO:0016422)|RNA binding (GO:0003723)			endometrium(3)|kidney(1)|large_intestine(3)|lung(5)|ovary(1)|prostate(2)|stomach(1)	16						CTTGGTAGAAGACGCCTTCAT	0.333																																					p.R342K		.											.	METTL14-90	0			c.G1025A						.						79.0	81.0	81.0					4																	119626935		2203	4300	6503	SO:0001583	missense	57721	exon10			GTAGAAGACGCCT	AB046847	CCDS34053.1	4q26	2009-02-24			ENSG00000145388	ENSG00000145388			29330	protein-coding gene	gene with protein product						10997877	Standard	NM_020961		Approved	KIAA1627	uc003icf.3	Q9HCE5	OTTHUMG00000161167	ENST00000388822.5:c.1025G>A	4.37:g.119626935G>A	ENSP00000373474:p.Arg342Lys	Somatic	56	0		WXS	Illumina GAIIx	Phase_I	87	21	NM_020961	0	0	10	10	0	A6NIG1|Q969V2	Missense_Mutation	SNP	ENST00000388822.5	37	CCDS34053.1	.	.	.	.	.	.	.	.	.	.	G	33	5.239670	0.95240	.	.	ENSG00000145388	ENST00000388822;ENST00000506780	T;T	0.38077	1.16;1.16	5.82	5.82	0.92795	.	0.000000	0.85682	D	0.000000	T	0.58032	0.2094	M	0.72894	2.215	0.80722	D	1	D;D	0.58970	0.984;0.972	P;P	0.58577	0.779;0.841	T	0.56153	-0.8026	10	0.51188	T	0.08	-2.8726	20.0938	0.97831	0.0:0.0:1.0:0.0	.	304;342	D6RBL4;Q9HCE5	.;MTL14_HUMAN	K	342;304	ENSP00000373474:R342K;ENSP00000424111:R304K	ENSP00000373474:R342K	R	+	2	0	METTL14	119846383	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.229000	0.95273	2.757000	0.94681	0.585000	0.79938	AGA	.		0.333	METTL14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364034.3	NM_020961	
SMARCA5	8467	bcgsc.ca	37	4	144442735	144442735	+	Silent	SNP	C	C	T	rs11541117	byFrequency	TCGA-OR-A5LO-01A-11D-A29I-10	TCGA-OR-A5LO-10A-01D-A29L-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	89d60dde-b03a-4cb7-b32a-5d06fa328603	4a5886aa-889d-4ef2-89a9-be2f7a06bd58	g.chr4:144442735C>T	ENST00000283131.3	+	3	868	c.406C>T	c.(406-408)Cta>Tta	p.L136L		NM_003601.3	NP_003592.3	O60264	SMCA5_HUMAN	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 5	136					ATP catabolic process (GO:0006200)|ATP-dependent chromatin remodeling (GO:0043044)|CENP-A containing nucleosome assembly (GO:0034080)|chromatin remodeling (GO:0006338)|chromatin silencing at rDNA (GO:0000183)|DNA-templated transcription, initiation (GO:0006352)|double-strand break repair (GO:0006302)|nucleosome assembly (GO:0006334)|nucleosome positioning (GO:0016584)|regulation of transcription from RNA polymerase II promoter (GO:0006357)	chromatin silencing complex (GO:0005677)|condensed chromosome (GO:0000793)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|NURF complex (GO:0016589)|RSF complex (GO:0031213)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|helicase activity (GO:0004386)		EWSR1/SMARCA5(2)	endometrium(2)|kidney(2)|large_intestine(9)|lung(4)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	21	all_hematologic(180;0.158)					GCAGAACTTACTATCCGTTGG	0.378													C|||	2603	0.519768	0.5129	0.4251	5008	,	,		15820	0.744		0.4175	False		,,,				2504	0.4703				p.L136L		.											.	SMARCA5-227	0			c.C406T						.	C		2287,2119	594.5+/-388.2	596,1095,512	42.0	41.0	42.0		406	1.1	0.1	4	dbSNP_120	42	3646,4954	517.0+/-378.9	789,2068,1443	no	coding-synonymous	SMARCA5	NM_003601.3		1385,3163,1955	TT,TC,CC		42.3953,48.0935,45.6174		136/1053	144442735	5933,7073	2203	4300	6503	SO:0001819	synonymous_variant	8467	exon3			AACTTACTATCCG	AB010882	CCDS3761.1	4q31.1-q31.2	2011-04-20			ENSG00000153147	ENSG00000153147			11101	protein-coding gene	gene with protein product		603375				9730600	Standard	NM_003601		Approved	hSNF2H, hISWI, ISWI	uc003ijg.3	O60264	OTTHUMG00000161474	ENST00000283131.3:c.406C>T	4.37:g.144442735C>T		Somatic	115	0		WXS	Illumina GAIIx	Phase_I	154	7	NM_003601	0	0	0	0	0		Silent	SNP	ENST00000283131.3	37	CCDS3761.1																																																																																			C|0.512;T|0.488		0.378	SMARCA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365077.3		
TRIM60	166655	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	165962195	165962195	+	Missense_Mutation	SNP	G	G	A	rs371675727		TCGA-OR-A5LO-01A-11D-A29I-10	TCGA-OR-A5LO-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	89d60dde-b03a-4cb7-b32a-5d06fa328603	4a5886aa-889d-4ef2-89a9-be2f7a06bd58	g.chr4:165962195G>A	ENST00000512596.1	+	3	1187	c.971G>A	c.(970-972)cGa>cAa	p.R324Q	TRIM60_ENST00000341062.5_Missense_Mutation_p.R324Q|TRIM60_ENST00000508504.1_Missense_Mutation_p.R324Q	NM_152620.2	NP_689833.1	Q495X7	TRI60_HUMAN	tripartite motif containing 60	324	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.					intracellular (GO:0005622)	zinc ion binding (GO:0008270)	p.R324Q(1)		NS(1)|breast(2)|endometrium(3)|large_intestine(6)|lung(15)|skin(1)|upper_aerodigestive_tract(1)	29	all_hematologic(180;0.221)	Prostate(90;0.0959)|Melanoma(52;0.18)		GBM - Glioblastoma multiforme(119;0.0844)		AGAAAAAAACGAAACATTTGT	0.418																																					p.R324Q		.											.	TRIM60-226	1	Substitution - Missense(1)	large_intestine(1)	c.G971A						.						104.0	106.0	105.0					4																	165962195		2203	4300	6503	SO:0001583	missense	166655	exon4			AAAAACGAAACAT	AK093201	CCDS3808.1	4q32.3	2013-01-09	2011-01-25	2004-11-17	ENSG00000176979	ENSG00000176979		"""RING-type (C3HC4) zinc fingers"", ""Tripartite motif containing / Tripartite motif containing"""	21162	protein-coding gene	gene with protein product			"""ring finger protein 129"", ""tripartite motif-containing 60"""	RNF129, RNF33			Standard	NM_152620		Approved	FLJ35882	uc003iqy.1	Q495X7	OTTHUMG00000161262	ENST00000512596.1:c.971G>A	4.37:g.165962195G>A	ENSP00000421142:p.Arg324Gln	Somatic	118	0		WXS	Illumina GAIIx	Phase_I	154	33	NM_001258025	0	0	0	0	0	Q8NA35	Missense_Mutation	SNP	ENST00000512596.1	37	CCDS3808.1	.	.	.	.	.	.	.	.	.	.	g	2.421	-0.333126	0.05278	.	.	ENSG00000176979	ENST00000512596;ENST00000508504;ENST00000341062	T;T;T	0.06687	3.27;3.27;3.27	2.49	-4.98	0.03019	Concanavalin A-like lectin/glucanase (1);SPRY-associated (1);Butyrophylin-like (1);B30.2/SPRY domain (1);	0.660443	0.11343	N	0.573786	T	0.01287	0.0042	N	0.00237	-1.79	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.23940	-1.0174	10	0.02654	T	1	.	6.1076	0.20081	0.3102:0.3951:0.2948:0.0	.	324	Q495X7	TRI60_HUMAN	Q	324	ENSP00000421142:R324Q;ENSP00000426496:R324Q;ENSP00000343765:R324Q	ENSP00000343765:R324Q	R	+	2	0	TRIM60	166181645	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.965000	0.03829	-2.237000	0.00712	-2.294000	0.00264	CGA	.		0.418	TRIM60-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364325.1	NM_152620	
ADAMTS16	170690	hgsc.bcm.edu	37	5	5140632	5140632	+	Silent	SNP	T	T	C	rs270208	byFrequency	TCGA-OR-A5LO-01A-11D-A29I-10	TCGA-OR-A5LO-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	89d60dde-b03a-4cb7-b32a-5d06fa328603	4a5886aa-889d-4ef2-89a9-be2f7a06bd58	g.chr5:5140632T>C	ENST00000274181.7	+	1	190	c.52T>C	c.(52-54)Ttg>Ctg	p.L18L	ADAMTS16_ENST00000511368.1_Silent_p.L18L|CTD-2297D10.2_ENST00000512155.1_RNA|CTD-2297D10.1_ENST00000514848.1_RNA	NM_139056.2	NP_620687.2	Q8TE57	ATS16_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 16	18					branching involved in ureteric bud morphogenesis (GO:0001658)	proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(72)|ovary(4)|pancreas(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	107						GTGGATGCTGTTGGCGCAGGT	0.766													C|||	3127	0.624401	0.6747	0.6571	5008	,	,		8861	0.8065		0.501	False		,,,				2504	0.4724				p.L18L		.											.	ADAMTS16-275	0			c.T52C						.	C		2046,874		775,496,189	2.0	5.0	4.0		52	1.2	1.0	5	dbSNP_79	4	3653,3047		1121,1411,818	no	coding-synonymous	ADAMTS16	NM_139056.2		1896,1907,1007	CC,CT,TT		45.4776,29.9315,40.7588		18/1225	5140632	5699,3921	1460	3350	4810	SO:0001819	synonymous_variant	170690	exon1			ATGCTGTTGGCGC	AJ315734	CCDS43299.1	5p15	2008-07-18	2005-08-19		ENSG00000145536	ENSG00000145536		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	17108	protein-coding gene	gene with protein product		607510	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 16"""			11867212	Standard	NM_139056		Approved	ADAMTS16s	uc003jdl.3	Q8TE57	OTTHUMG00000161663	ENST00000274181.7:c.52T>C	5.37:g.5140632T>C		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	7	5	NM_139056	0	0	0	0	0	C6G490|Q8IVE2	Silent	SNP	ENST00000274181.7	37	CCDS43299.1																																																																																			T|0.352;C|0.648		0.766	ADAMTS16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365657.1	NM_139056	
SEMA5A	9037	broad.mit.edu	37	5	9197318	9197318	+	Missense_Mutation	SNP	C	C	A			TCGA-OR-A5LO-01A-11D-A29I-10	TCGA-OR-A5LO-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	89d60dde-b03a-4cb7-b32a-5d06fa328603	4a5886aa-889d-4ef2-89a9-be2f7a06bd58	g.chr5:9197318C>A	ENST00000382496.5	-	10	1695	c.1030G>T	c.(1030-1032)Gcc>Tcc	p.A344S		NM_003966.2	NP_003957.2	Q13591	SEM5A_HUMAN	sema domain, seven thrombospondin repeats (type 1 and type 1-like), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 5A	344	Sema. {ECO:0000255|PROSITE- ProRule:PRU00352}.				axon guidance (GO:0007411)|axonal fasciculation (GO:0007413)|blood vessel endothelial cell proliferation involved in sprouting angiogenesis (GO:0002043)|cell adhesion (GO:0007155)|cell chemotaxis (GO:0060326)|cell-cell signaling (GO:0007267)|diencephalon development (GO:0021536)|negative regulation of axon extension involved in axon guidance (GO:0048843)|negative regulation of cell adhesion (GO:0007162)|negative regulation of endothelial cell apoptotic process (GO:2000352)|nervous system development (GO:0007399)|patterning of blood vessels (GO:0001569)|positive chemotaxis (GO:0050918)|positive regulation of actin filament depolymerization (GO:0030836)|positive regulation of angiogenesis (GO:0045766)|positive regulation of axon extension involved in axon guidance (GO:0048842)|positive regulation of catenin import into nucleus (GO:0035413)|positive regulation of endothelial cell chemotaxis (GO:2001028)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of protein kinase B signaling (GO:0051897)|signal clustering (GO:1990256)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	axon guidance receptor activity (GO:0008046)|chondroitin sulfate proteoglycan binding (GO:0035373)|heparan sulfate proteoglycan binding (GO:0043395)|semaphorin receptor binding (GO:0030215)|syndecan binding (GO:0045545)			biliary_tract(1)|breast(4)|central_nervous_system(2)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(13)|lung(40)|ovary(2)|prostate(5)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	81						GGTAGCCAGGCCGAGCGCGAG	0.582																																					p.A344S		.											.	SEMA5A-91	0			c.G1030T						.						87.0	85.0	86.0					5																	9197318		2203	4300	6503	SO:0001583	missense	9037	exon10			GCCAGGCCGAGCG	U52840	CCDS3875.1	5p15.2	2008-05-15			ENSG00000112902	ENSG00000112902		"""Semaphorins"""	10736	protein-coding gene	gene with protein product		609297		SEMAF		8817451, 9464278	Standard	NM_003966		Approved	semF	uc003jek.2	Q13591	OTTHUMG00000090501	ENST00000382496.5:c.1030G>T	5.37:g.9197318C>A	ENSP00000371936:p.Ala344Ser	Somatic	92	1		WXS	Illumina GAIIx	Phase_I	129	9	NM_003966	0	0	0	0	0	D3DTC6|O60408|Q1RLL9	Missense_Mutation	SNP	ENST00000382496.5	37	CCDS3875.1	.	.	.	.	.	.	.	.	.	.	C	34	5.316962	0.95682	.	.	ENSG00000112902	ENST00000382496	T	0.10763	2.84	5.28	5.28	0.74379	WD40/YVTN repeat-like-containing domain (1);Semaphorin/CD100 antigen (4);	0.000000	0.85682	D	0.000000	T	0.25419	0.0618	L	0.53561	1.675	0.80722	D	1	D	0.55605	0.972	P	0.58266	0.836	T	0.00116	-1.2036	10	0.54805	T	0.06	.	16.7642	0.85520	0.0:1.0:0.0:0.0	.	344	Q13591	SEM5A_HUMAN	S	344	ENSP00000371936:A344S	ENSP00000371936:A344S	A	-	1	0	SEMA5A	9250318	1.000000	0.71417	0.997000	0.53966	0.985000	0.73830	4.749000	0.62155	2.621000	0.88768	0.603000	0.83216	GCC	.		0.582	SEMA5A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206989.2		
FYB	2533	broad.mit.edu	37	5	39135108	39135108	+	Silent	SNP	G	G	T			TCGA-OR-A5LO-01A-11D-A29I-10	TCGA-OR-A5LO-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	89d60dde-b03a-4cb7-b32a-5d06fa328603	4a5886aa-889d-4ef2-89a9-be2f7a06bd58	g.chr5:39135108G>T	ENST00000351578.6	-	8	1714	c.1524C>A	c.(1522-1524)ggC>ggA	p.G508G	FYB_ENST00000540520.1_Silent_p.G518G|FYB_ENST00000512982.1_Silent_p.G508G|FYB_ENST00000515010.1_Silent_p.G508G|FYB_ENST00000505428.1_Silent_p.G508G	NM_199335.3	NP_955367.1	O15117	FYB_HUMAN	FYN binding protein	508					immune response (GO:0006955)|intracellular signal transduction (GO:0035556)|NLS-bearing protein import into nucleus (GO:0006607)|protein phosphorylation (GO:0006468)|signal transduction (GO:0007165)|T cell receptor signaling pathway (GO:0050852)	actin cytoskeleton (GO:0015629)|cytosol (GO:0005829)|nucleus (GO:0005634)	receptor binding (GO:0005102)			endometrium(2)|kidney(4)|large_intestine(6)|liver(1)|lung(29)|ovary(2)|upper_aerodigestive_tract(1)	45	all_lung(31;0.000343)		Epithelial(62;0.235)			CTTGAATAGGGCCTGTTAGCT	0.343																																					p.G518G		.											.	FYB-24	0			c.C1554A						.						143.0	126.0	131.0					5																	39135108		1826	4093	5919	SO:0001819	synonymous_variant	2533	exon8			AATAGGGCCTGTT	U93049	CCDS47200.1, CCDS54848.1	5p13.1	2012-05-04	2010-05-04		ENSG00000082074	ENSG00000082074			4036	protein-coding gene	gene with protein product		602731	"""FYN-binding protein (FYB-120/130)"""			9115214, 9207119	Standard	NM_001465		Approved	SLAP-130, FYB-120/130	uc011cpl.2	O15117	OTTHUMG00000162071	ENST00000351578.6:c.1524C>A	5.37:g.39135108G>T		Somatic	41	0		WXS	Illumina GAIIx	Phase_I	79	3	NM_001243093	0	0	0	0	0	A8K2Y8|B4DLN2|E9PBV9|O00359|Q9NZI9	Silent	SNP	ENST00000351578.6	37	CCDS47200.1																																																																																			.		0.343	FYB-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000367098.1	NM_001465	
MAST4	375449	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	66462103	66462103	+	Missense_Mutation	SNP	G	G	A	rs377512686		TCGA-OR-A5LO-01A-11D-A29I-10	TCGA-OR-A5LO-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	89d60dde-b03a-4cb7-b32a-5d06fa328603	4a5886aa-889d-4ef2-89a9-be2f7a06bd58	g.chr5:66462103G>A	ENST00000403625.2	+	29	7391	c.7096G>A	c.(7096-7098)Gac>Aac	p.D2366N	MAST4_ENST00000403666.1_Missense_Mutation_p.D2177N|MAST4_ENST00000405643.1_Missense_Mutation_p.D2187N|MAST4_ENST00000261569.7_Missense_Mutation_p.D2172N|MAST4_ENST00000404260.3_Missense_Mutation_p.D2369N	NM_001164664.1	NP_001158136.1	O15021	MAST4_HUMAN	microtubule associated serine/threonine kinase family member 4	2369						cytoplasm (GO:0005737)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|protein serine/threonine kinase activity (GO:0004674)			breast(2)|central_nervous_system(1)|kidney(2)|lung(6)|ovary(2)	13		Lung NSC(167;8.56e-06)|Prostate(74;0.00637)|Ovarian(174;0.0563)|Breast(144;0.0586)|Colorectal(97;0.245)		Lung(70;0.011)		CGCCAACACCGACAGAAGGGC	0.567											OREG0016638	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.D2366N		.											.	MAST4-647	0			c.G7096A						.						17.0	28.0	24.0					5																	66462103		2071	4174	6245	SO:0001583	missense	375449	exon29			AACACCGACAGAA	AY830839	CCDS47224.1, CCDS47225.1, CCDS54861.1, CCDS75254.1	5q12.3	2007-06-20			ENSG00000069020	ENSG00000069020			19037	protein-coding gene	gene with protein product						9205841	Standard	NM_198828		Approved	KIAA0303	uc021xzk.1	O15021	OTTHUMG00000152471	ENST00000403625.2:c.7096G>A	5.37:g.66462103G>A	ENSP00000385727:p.Asp2366Asn	Somatic	96	0	1092	WXS	Illumina GAIIx	Phase_I	135	33	NM_001164664	0	0	15	21	6	A6NL49|B5ME48|Q05EE6|Q6ZN07|Q8N4X4|Q96LY3	Missense_Mutation	SNP	ENST00000403625.2	37	CCDS54861.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	13.58|13.58	2.278180|2.278180	0.40294|0.40294	.|.	.|.	ENSG00000069020|ENSG00000069020	ENST00000404260;ENST00000403625;ENST00000403666;ENST00000405643;ENST00000380908;ENST00000261569|ENST00000443808	T;T;T;T;T|.	0.70631|.	-0.48;-0.48;-0.5;-0.5;-0.47|.	4.58|4.58	3.71|3.71	0.42584|0.42584	.|.	1.119980|.	0.06787|.	N|.	0.786361|.	T|T	0.33990|0.33990	0.0882|0.0882	N|N	0.20986|0.20986	0.625|0.625	0.30331|0.30331	N|N	0.786644|0.786644	B;B|.	0.21381|.	0.033;0.055|.	B;B|.	0.15484|.	0.006;0.013|.	T|T	0.27971|0.27971	-1.0058|-1.0058	10|5	0.72032|.	D|.	0.01|.	-19.2472|-19.2472	12.7288|12.7288	0.57187|0.57187	0.0796:0.0:0.9204:0.0|0.0796:0.0:0.9204:0.0	.|.	2369;2177|.	O15021;O15021-3|.	MAST4_HUMAN;.|.	N|Q	2369;2366;2177;2187;2187;2172|1422	ENSP00000385048:D2369N;ENSP00000385727:D2366N;ENSP00000384313:D2177N;ENSP00000384099:D2187N;ENSP00000261569:D2172N|.	ENSP00000261569:D2172N|.	D|R	+|+	1|2	0|0	MAST4|MAST4	66497859|66497859	1.000000|1.000000	0.71417|0.71417	0.560000|0.560000	0.28344|0.28344	0.426000|0.426000	0.31534|0.31534	5.084000|5.084000	0.64462|0.64462	1.149000|1.149000	0.42402|0.42402	0.561000|0.561000	0.74099|0.74099	GAC|CGA	.		0.567	MAST4-001	NOVEL	not_organism_supported|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000326324.2		
CENPH	64946	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	5	68485476	68485476	+	Silent	SNP	C	C	G			TCGA-OR-A5LO-01A-11D-A29I-10	TCGA-OR-A5LO-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	89d60dde-b03a-4cb7-b32a-5d06fa328603	4a5886aa-889d-4ef2-89a9-be2f7a06bd58	g.chr5:68485476C>G	ENST00000283006.2	+	1	102	c.15C>G	c.(13-15)ccC>ccG	p.P5P	CENPH_ENST00000515001.1_Silent_p.P5P	NM_022909.3	NP_075060.1			centromere protein H											kidney(15)|large_intestine(2)|lung(3)	20		Lung NSC(167;5.51e-05)|Prostate(74;0.00634)|Ovarian(174;0.0448)|Breast(144;0.198)		OV - Ovarian serous cystadenocarcinoma(47;1.41e-56)|Epithelial(20;1.29e-52)|all cancers(19;3.15e-48)|Lung(70;0.0178)		AGGAGCAGCCCCAGATGCAAG	0.677																																					p.P5P		.											.	CENPH-153	0			c.C15G						.						14.0	17.0	16.0					5																	68485476		2190	4290	6480	SO:0001819	synonymous_variant	64946	exon1			GCAGCCCCAGATG	AB035124	CCDS3998.1	5p15.2	2013-11-05			ENSG00000153044	ENSG00000153044			17268	protein-coding gene	gene with protein product		605607				11092768, 15502821	Standard	NM_022909		Approved		uc003jvp.3	Q9H3R5	OTTHUMG00000097816	ENST00000283006.2:c.15C>G	5.37:g.68485476C>G		Somatic	32	0		WXS	Illumina GAIIx	Phase_I	51	12	NM_022909	0	0	0	1	1		Silent	SNP	ENST00000283006.2	37	CCDS3998.1																																																																																			.		0.677	CENPH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000215083.1		
VCAN	1462	broad.mit.edu;bcgsc.ca	37	5	82833991	82833991	+	Missense_Mutation	SNP	G	G	T			TCGA-OR-A5LO-01A-11D-A29I-10	TCGA-OR-A5LO-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	89d60dde-b03a-4cb7-b32a-5d06fa328603	4a5886aa-889d-4ef2-89a9-be2f7a06bd58	g.chr5:82833991G>T	ENST00000265077.3	+	8	5734	c.5169G>T	c.(5167-5169)aaG>aaT	p.K1723N	VCAN_ENST00000513016.1_3'UTR|VCAN_ENST00000512590.2_Intron|VCAN_ENST00000343200.5_Missense_Mutation_p.K736N|VCAN_ENST00000342785.4_Intron|VCAN-AS1_ENST00000512090.1_RNA|VCAN_ENST00000502527.2_Intron	NM_004385.4	NP_004376.2	P13611	CSPG2_HUMAN	versican	1723	GAG-beta.				carbohydrate metabolic process (GO:0005975)|cell adhesion (GO:0007155)|cell recognition (GO:0008037)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate catabolic process (GO:0030207)|chondroitin sulfate metabolic process (GO:0030204)|dermatan sulfate biosynthetic process (GO:0030208)|extracellular matrix organization (GO:0030198)|glial cell migration (GO:0008347)|glycosaminoglycan metabolic process (GO:0030203)|heart development (GO:0007507)|multicellular organismal development (GO:0007275)|osteoblast differentiation (GO:0001649)|small molecule metabolic process (GO:0044281)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|Golgi lumen (GO:0005796)|intracellular membrane-bounded organelle (GO:0043231)|lysosomal lumen (GO:0043202)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|carbohydrate binding (GO:0030246)|glycosaminoglycan binding (GO:0005539)|hyaluronic acid binding (GO:0005540)			NS(2)|biliary_tract(1)|breast(3)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(52)|lung(64)|ovary(8)|pancreas(3)|prostate(13)|skin(14)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(5)	190		Lung NSC(167;0.0216)|all_lung(232;0.0251)|Ovarian(174;0.142)		OV - Ovarian serous cystadenocarcinoma(54;2.47e-41)|Epithelial(54;2.51e-34)|all cancers(79;5.19e-29)	Hyaluronan(DB08818)	TTGAGGAAAAGAAAAGGAAGG	0.408																																					p.K1723N		.											.	VCAN-238	0			c.G5169T						.						84.0	87.0	86.0					5																	82833991		2201	4300	6501	SO:0001583	missense	1462	exon8			GGAAAAGAAAAGG	X15998	CCDS4060.1, CCDS47242.1, CCDS54875.1, CCDS54876.1	5q14.2-q14.3	2013-05-07	2007-02-15	2007-02-15	ENSG00000038427	ENSG00000038427		"""Immunoglobulin superfamily / V-set domain containing"", ""Proteoglycans / Extracellular Matrix : Hyalectans"""	2464	protein-coding gene	gene with protein product	"""versican proteoglycan"""	118661	"""chondroitin sulfate proteoglycan 2"""	CSPG2		1478664, 21063030	Standard	NM_004385		Approved	PG-M	uc003kii.3	P13611	OTTHUMG00000131321	ENST00000265077.3:c.5169G>T	5.37:g.82833991G>T	ENSP00000265077:p.Lys1723Asn	Somatic	45	0		WXS	Illumina GAIIx	Phase_I	76	5	NM_004385	0	0	2	2	0	P20754|Q13010|Q13189|Q15123|Q9UCL9|Q9UNW5	Missense_Mutation	SNP	ENST00000265077.3	37	CCDS4060.1	.	.	.	.	.	.	.	.	.	.	G	12.44	1.938563	0.34189	.	.	ENSG00000038427	ENST00000265077;ENST00000343200;ENST00000513960	D;D;T	0.90261	-2.63;-2.64;2.46	5.96	-0.0549	0.13812	.	0.680537	0.14498	N	0.315960	D	0.84772	0.5546	L	0.40543	1.245	0.09310	N	1	B;B	0.26902	0.144;0.163	B;B	0.26094	0.066;0.03	T	0.73591	-0.3934	10	0.48119	T	0.1	.	10.5844	0.45273	0.4559:0.0:0.5441:0.0	.	736;1723	P13611-2;P13611	.;CSPG2_HUMAN	N	1723;736;736	ENSP00000265077:K1723N;ENSP00000340062:K736N;ENSP00000426251:K736N	ENSP00000265077:K1723N	K	+	3	2	VCAN	82869747	0.002000	0.14202	0.000000	0.03702	0.007000	0.05969	0.231000	0.17872	-0.067000	0.12976	-0.136000	0.14681	AAG	.		0.408	VCAN-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000254092.3	NM_004385	
CAMK4	814	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	110819981	110819981	+	Silent	SNP	C	C	A			TCGA-OR-A5LO-01A-11D-A29I-10	TCGA-OR-A5LO-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	89d60dde-b03a-4cb7-b32a-5d06fa328603	4a5886aa-889d-4ef2-89a9-be2f7a06bd58	g.chr5:110819981C>A	ENST00000282356.4	+	11	1637	c.1239C>A	c.(1237-1239)gcC>gcA	p.A413A	CAMK4_ENST00000512453.1_Silent_p.A413A|CAMK4_ENST00000512890.1_3'UTR	NM_001744.4	NP_001735.1	Q16566	KCC4_HUMAN	calcium/calmodulin-dependent protein kinase IV	413					activation of phospholipase C activity (GO:0007202)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|long-term memory (GO:0007616)|myeloid dendritic cell differentiation (GO:0043011)|neuron-neuron synaptic transmission (GO:0007270)|neurotrophin TRK receptor signaling pathway (GO:0048011)|nucleocytoplasmic transport (GO:0006913)|positive regulation of protein export from nucleus (GO:0046827)|positive regulation of transcription, DNA-templated (GO:0045893)|protein phosphorylation (GO:0006468)|regulation of osteoclast differentiation (GO:0045670)|regulation of T cell differentiation in thymus (GO:0033081)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|calmodulin-dependent protein kinase activity (GO:0004683)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(13)|ovary(3)|prostate(2)|skin(1)|urinary_tract(1)	30		all_cancers(142;1.49e-05)|all_epithelial(76;1.82e-07)|Prostate(80;0.00964)|all_lung(232;0.0181)|Lung NSC(167;0.0298)|Ovarian(225;0.0446)|Colorectal(57;0.0478)|Breast(839;0.244)		OV - Ovarian serous cystadenocarcinoma(64;3.79e-08)|Epithelial(69;5.29e-08)|all cancers(49;1.1e-05)|COAD - Colon adenocarcinoma(37;0.109)		CTGAAGAGGCCCCCAAAATGG	0.552																																					p.A413A		.											.	CAMK4-386	0			c.C1239A						.						52.0	55.0	54.0					5																	110819981		2202	4300	6502	SO:0001819	synonymous_variant	814	exon11			AGAGGCCCCCAAA	D30742	CCDS4103.1	5q22.1	2012-09-20			ENSG00000152495	ENSG00000152495	2.7.11.17		1464	protein-coding gene	gene with protein product	"""brain Ca++-calmodulin-dependent protein kinase type IV"", ""calcium/calmodulin-dependent protein kinase type IV catalytic chain"", ""CAM kinase IV"", ""CAM kinase- GR"""	114080				2536634	Standard	NM_001744		Approved	CaMK-GR	uc003kpf.3	Q16566	OTTHUMG00000128792	ENST00000282356.4:c.1239C>A	5.37:g.110819981C>A		Somatic	109	0		WXS	Illumina GAIIx	Phase_I	127	39	NM_001744	0	0	0	0	0	D3DSZ7	Silent	SNP	ENST00000282356.4	37	CCDS4103.1																																																																																			.		0.552	CAMK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250719.2	NM_001744	
LVRN	206338	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	115336915	115336915	+	Missense_Mutation	SNP	A	A	G			TCGA-OR-A5LO-01A-11D-A29I-10	TCGA-OR-A5LO-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	89d60dde-b03a-4cb7-b32a-5d06fa328603	4a5886aa-889d-4ef2-89a9-be2f7a06bd58	g.chr5:115336915A>G	ENST00000357872.4	+	10	1923	c.1799A>G	c.(1798-1800)aAt>aGt	p.N600S	AQPEP_ENST00000395528.2_Missense_Mutation_p.N117S	NM_173800.4	NP_776161.3	Q6Q4G3	AMPQ_HUMAN		600						integral component of membrane (GO:0016021)	metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)										AACATTAAAAATCGGACTCTT	0.448																																					p.N600S		.											.	.	0			c.A1799G						.						106.0	105.0	106.0					5																	115336915		2202	4300	6502	SO:0001583	missense	0	exon10			TTAAAAATCGGAC																												ENST00000357872.4:c.1799A>G	5.37:g.115336915A>G	ENSP00000350541:p.Asn600Ser	Somatic	220	0		WXS	Illumina GAIIx	Phase_I	376	100	NM_173800	0	0	0	0	0	A8K6J0|C9JGD2|Q32MR1|Q4G0I9|Q4G0V2|Q86XA3|Q8NBZ2	Missense_Mutation	SNP	ENST00000357872.4	37	CCDS4124.1	.	.	.	.	.	.	.	.	.	.	A	12.73	2.024415	0.35701	.	.	ENSG00000172901	ENST00000395528;ENST00000357872;ENST00000379578	T;T	0.07216	3.21;5.02	5.48	2.91	0.33838	.	2.309540	0.01451	N	0.015505	T	0.09468	0.0233	L	0.32530	0.975	0.37009	D	0.895627	B	0.31968	0.349	B	0.28638	0.092	T	0.14008	-1.0488	10	0.36615	T	0.2	.	10.7584	0.46251	0.6977:0.3023:0.0:0.0	.	600	Q6Q4G3	AMPQ_HUMAN	S	117;600;589	ENSP00000378899:N117S;ENSP00000350541:N600S	ENSP00000350541:N600S	N	+	2	0	AC010282.1	115364814	1.000000	0.71417	0.990000	0.47175	0.687000	0.40016	2.395000	0.44459	0.879000	0.35944	0.460000	0.39030	AAT	.		0.448	AQPEP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250852.1		
SLC26A2	1836	hgsc.bcm.edu;broad.mit.edu	37	5	149360347	149360348	+	Frame_Shift_Del	DEL	TG	TG	-	rs374310335		TCGA-OR-A5LO-01A-11D-A29I-10	TCGA-OR-A5LO-10A-01D-A29L-10	TG	TG	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	89d60dde-b03a-4cb7-b32a-5d06fa328603	4a5886aa-889d-4ef2-89a9-be2f7a06bd58	g.chr5:149360347_149360348delTG	ENST00000286298.4	+	3	1459_1460	c.1191_1192delTG	c.(1189-1194)actgtafs	p.V398fs		NM_000112.3	NP_000103.2	P50443	S26A2_HUMAN	solute carrier family 26 (anion exchanger), member 2	398					3'-phosphoadenosine 5'-phosphosulfate biosynthetic process (GO:0050428)|3'-phosphoadenosine 5'-phosphosulfate metabolic process (GO:0050427)|carbohydrate metabolic process (GO:0005975)|glycosaminoglycan metabolic process (GO:0030203)|ion transport (GO:0006811)|ossification (GO:0001503)|small molecule metabolic process (GO:0044281)|sulfate transmembrane transport (GO:1902358)|sulfate transport (GO:0008272)|transmembrane transport (GO:0055085)|xenobiotic metabolic process (GO:0006805)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	secondary active sulfate transmembrane transporter activity (GO:0008271)|sulfate transmembrane transporter activity (GO:0015116)			NS(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(9)|lung(1)|prostate(2)|stomach(1)	18			KIRC - Kidney renal clear cell carcinoma(527;0.000962)|Kidney(363;0.00147)			TTGCTATCACTGTATCACTTTC	0.406																																					p.397_398del		.											.	SLC26A2-90	0			c.1191_1192del						.																																			SO:0001589	frameshift_variant	1836	exon3			TATCACTGTATCA	U14528	CCDS4300.1	5q31-q34	2014-09-17	2013-07-18		ENSG00000155850	ENSG00000155850		"""Solute carriers"""	10994	protein-coding gene	gene with protein product		606718	"""solute carrier family 26 (sulfate transporter), member 2"""	DTD		7923357	Standard	NM_000112		Approved	DTDST	uc003lrh.3	P50443	OTTHUMG00000130054	ENST00000286298.4:c.1191_1192delTG	5.37:g.149360347_149360348delTG	ENSP00000286298:p.Val398fs	Somatic	89	0		WXS	Illumina GAIIx	Phase_I	130	12	NM_000112	0	0	0	0	0	A8K2U3|B2R6J1|Q6N051	Frame_Shift_Del	DEL	ENST00000286298.4	37	CCDS4300.1																																																																																			.		0.406	SLC26A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252333.2	NM_000112	
NIPAL4	348938	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	156899852	156899852	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5LO-01A-11D-A29I-10	TCGA-OR-A5LO-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	89d60dde-b03a-4cb7-b32a-5d06fa328603	4a5886aa-889d-4ef2-89a9-be2f7a06bd58	g.chr5:156899852G>A	ENST00000311946.7	+	6	1401	c.1285G>A	c.(1285-1287)Gcc>Acc	p.A429T	ADAM19_ENST00000430702.2_Intron|NIPAL4_ENST00000435489.2_Missense_Mutation_p.A410T	NM_001099287.1	NP_001092757.1	Q0D2K0	NIPA4_HUMAN	NIPA-like domain containing 4	429						integral component of membrane (GO:0016021)	magnesium ion transmembrane transporter activity (GO:0015095)			breast(3)|endometrium(3)|kidney(1)|large_intestine(1)|lung(12)|prostate(1)|skin(1)	22						CCCTTCTCCCGCCCCGGAACC	0.512																																					p.A429T		.											.	NIPAL4-68	0			c.G1285A						.						39.0	38.0	39.0					5																	156899852		1915	4129	6044	SO:0001583	missense	348938	exon6			TCTCCCGCCCCGG	AK026158	CCDS47328.1, CCDS54944.1	5q33.3	2009-03-24	2009-03-24		ENSG00000172548	ENSG00000172548			28018	protein-coding gene	gene with protein product	"""ichthyin"""	609383	"""NIPA-like 4"""			8619474, 9110174, 15317751	Standard	NM_001099287		Approved	ICHYN	uc003lwx.4	Q0D2K0	OTTHUMG00000163497	ENST00000311946.7:c.1285G>A	5.37:g.156899852G>A	ENSP00000311687:p.Ala429Thr	Somatic	45	0		WXS	Illumina GAIIx	Phase_I	95	46	NM_001099287	0	0	0	0	0	A8S6F1|A8S6F5|A8S6F8|B4DLF3|Q0D2J8|Q0D2J9	Missense_Mutation	SNP	ENST00000311946.7	37	CCDS47328.1	.	.	.	.	.	.	.	.	.	.	G	3.535	-0.094927	0.07010	.	.	ENSG00000172548	ENST00000435489;ENST00000311946	D;D	0.90444	-2.63;-2.67	5.93	-2.56	0.06268	.	1.041360	0.07411	N	0.892376	T	0.77498	0.4139	N	0.14661	0.345	0.09310	N	1	B;B	0.14438	0.003;0.01	B;B	0.09377	0.004;0.001	T	0.62006	-0.6945	10	0.12766	T	0.61	-0.8624	5.4735	0.16682	0.4325:0.0:0.3569:0.2106	.	410;429	Q0D2K0-2;Q0D2K0	.;NIPA4_HUMAN	T	410;429	ENSP00000406456:A410T;ENSP00000311687:A429T	ENSP00000311687:A429T	A	+	1	0	NIPAL4	156832430	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	0.092000	0.15066	-0.380000	0.07894	-0.258000	0.10820	GCC	.		0.512	NIPAL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000373789.1	NM_001099287	
DBN1	1627	hgsc.bcm.edu	37	5	176900502	176900502	+	Silent	SNP	G	G	A			TCGA-OR-A5LO-01A-11D-A29I-10	TCGA-OR-A5LO-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	89d60dde-b03a-4cb7-b32a-5d06fa328603	4a5886aa-889d-4ef2-89a9-be2f7a06bd58	g.chr5:176900502G>A	ENST00000309007.5	-	1	240	c.21C>T	c.(19-21)agC>agT	p.S7S	DBN1_ENST00000292385.5_5'Flank|DBN1_ENST00000393565.1_Silent_p.S7S	NM_004395.3	NP_004386	Q16643	DREB_HUMAN	drebrin 1	7	ADF-H. {ECO:0000255|PROSITE- ProRule:PRU00599}.				actin filament organization (GO:0007015)|cell communication by chemical coupling (GO:0010643)|cell communication by electrical coupling (GO:0010644)|maintenance of protein location in cell (GO:0032507)|neural precursor cell proliferation (GO:0061351)|regulation of dendrite development (GO:0050773)|regulation of neuronal synaptic plasticity (GO:0048168)	actin cytoskeleton (GO:0015629)|actomyosin (GO:0042641)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|gap junction (GO:0005921)|plasma membrane (GO:0005886)	actin binding (GO:0003779)|profilin binding (GO:0005522)			breast(3)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(1)|lung(12)|ovary(1)|skin(2)	25	all_cancers(89;2.17e-05)|Renal(175;0.000269)|Lung NSC(126;0.0014)|all_lung(126;0.0025)	all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			GGCGGTGGCCGCTGAAGCTGA	0.736																																					p.S7S		.											.	DBN1-587	0			c.C21T						.						2.0	2.0	2.0					5																	176900502		1495	2999	4494	SO:0001819	synonymous_variant	1627	exon1			GTGGCCGCTGAAG		CCDS4420.1, CCDS4421.1	5q35.3	2008-02-05			ENSG00000113758	ENSG00000113758			2695	protein-coding gene	gene with protein product		126660		D0S117E		8216329	Standard	NM_004395		Approved		uc003mgy.2	Q16643	OTTHUMG00000130856	ENST00000309007.5:c.21C>T	5.37:g.176900502G>A		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	32	4	NM_004395	0	0	7	7	0	A8MV58|B2RBG0|Q9UFZ5	Silent	SNP	ENST00000309007.5	37	CCDS4420.1																																																																																			.		0.736	DBN1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000253429.2	NM_080881	
ADAMTS2	9509	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	178608155	178608155	+	Splice_Site	SNP	A	A	G			TCGA-OR-A5LO-01A-11D-A29I-10	TCGA-OR-A5LO-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	89d60dde-b03a-4cb7-b32a-5d06fa328603	4a5886aa-889d-4ef2-89a9-be2f7a06bd58	g.chr5:178608155A>G	ENST00000251582.7	-	5	994	c.893T>C	c.(892-894)gTc>gCc	p.V298A	ADAMTS2_ENST00000274609.5_Splice_Site_p.V298A	NM_014244.4	NP_055059.2	O95450	ATS2_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 2	298	Peptidase M12B. {ECO:0000255|PROSITE- ProRule:PRU00276}.				collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular matrix organization (GO:0030198)|lung development (GO:0030324)|protein processing (GO:0016485)|skin development (GO:0043588)|spermatogenesis (GO:0007283)	extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			breast(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(15)|lung(31)|ovary(1)|pancreas(3)|prostate(2)|skin(7)	72	all_cancers(89;0.000456)|all_epithelial(37;0.000138)|Renal(175;0.000159)|Lung NSC(126;0.00184)|all_lung(126;0.00326)	all_cancers(40;0.00604)|all_neural(177;0.00411)|Medulloblastoma(196;0.00508)|Lung NSC(249;0.0569)|all_lung(500;0.129)|all_hematologic(541;0.211)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	GBM - Glioblastoma multiforme(465;0.0473)		GATTTCATTGACCTGAAAGAA	0.562																																					p.V298A		.											.	ADAMTS2-228	0			c.T893C						.						119.0	89.0	99.0					5																	178608155		2203	4300	6503	SO:0001630	splice_region_variant	9509	exon5			TCATTGACCTGAA	AJ003125	CCDS4444.1, CCDS34311.1	5q23-q24	2008-07-18	2005-08-19		ENSG00000087116	ENSG00000087116		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	218	protein-coding gene	gene with protein product	"""procollagen I N-proteinase"", ""procollagen N-endopeptidase"""	604539	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 2"""			10094461, 15373769	Standard	NM_014244		Approved	ADAMTS-3, hPCPNI, PCINP, ADAM-TS2, NPI	uc003mjw.3	O95450	OTTHUMG00000130915	ENST00000251582.7:c.892-1T>C	5.37:g.178608155A>G		Somatic	140	0		WXS	Illumina GAIIx	Phase_I	240	69	NM_021599	0	0	0	0	0		Missense_Mutation	SNP	ENST00000251582.7	37	CCDS4444.1	.	.	.	.	.	.	.	.	.	.	A	16.45	3.125869	0.56721	.	.	ENSG00000087116	ENST00000251582;ENST00000274609	D;D	0.89617	-2.54;-2.54	4.33	4.33	0.51752	Metallopeptidase, catalytic domain (1);Peptidase M12B, ADAM/reprolysin (2);	0.350108	0.20141	U	0.098364	D	0.89801	0.6820	L	0.57536	1.79	0.80722	D	1	P;D	0.54047	0.891;0.964	P;P	0.51742	0.543;0.678	D	0.90391	0.4395	10	0.87932	D	0	.	11.5023	0.50446	1.0:0.0:0.0:0.0	.	298;298	O95450-2;O95450	.;ATS2_HUMAN	A	298	ENSP00000251582:V298A;ENSP00000274609:V298A	ENSP00000251582:V298A	V	-	2	0	ADAMTS2	178540761	1.000000	0.71417	1.000000	0.80357	0.736000	0.42039	7.540000	0.82074	1.803000	0.52742	0.459000	0.35465	GTC	.		0.562	ADAMTS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253507.1	NM_014244	Missense_Mutation
CD83	9308	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	14131769	14131769	+	Missense_Mutation	SNP	G	G	C			TCGA-OR-A5LO-01A-11D-A29I-10	TCGA-OR-A5LO-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	89d60dde-b03a-4cb7-b32a-5d06fa328603	4a5886aa-889d-4ef2-89a9-be2f7a06bd58	g.chr6:14131769G>C	ENST00000379153.3	+	3	343	c.172G>C	c.(172-174)Gag>Cag	p.E58Q		NM_001040280.1|NM_001251901.1|NM_004233.3	NP_001035370.1|NP_001238830.1|NP_004224.1	Q01151	CD83_HUMAN	CD83 molecule	58	Ig-like V-type.				defense response (GO:0006952)|humoral immune response (GO:0006959)|negative regulation of interleukin-4 production (GO:0032713)|positive regulation of CD4-positive, alpha-beta T cell differentiation (GO:0043372)|positive regulation of interleukin-10 production (GO:0032733)|positive regulation of interleukin-2 production (GO:0032743)|response to organic cyclic compound (GO:0014070)|signal transduction (GO:0007165)	external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)				breast(2)|endometrium(1)|kidney(1)|large_intestine(3)|lung(4)|ovary(1)	12	Breast(50;0.00245)|Ovarian(93;0.137)	all_hematologic(90;0.117)				GGGTGGTGAAGAGAGGATGGA	0.502																																					p.E58Q		.											.	CD83-90	0			c.G172C						.						76.0	72.0	73.0					6																	14131769		2203	4300	6503	SO:0001583	missense	9308	exon3			GGTGAAGAGAGGA	Z11697	CCDS4532.1, CCDS75403.1	6p23	2013-01-11	2006-03-31		ENSG00000112149	ENSG00000112149		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"""	1703	protein-coding gene	gene with protein product		604534	"""CD83 antigen (activated B lymphocytes, immunoglobulin superfamily)"", ""CD83 molecule """			1378080, 8422464	Standard	NM_001251901		Approved	HB15, BL11	uc003nbi.3	Q01151	OTTHUMG00000014283	ENST00000379153.3:c.172G>C	6.37:g.14131769G>C	ENSP00000368450:p.Glu58Gln	Somatic	132	0		WXS	Illumina GAIIx	Phase_I	127	46	NM_004233	0	0	34	59	25	Q5THX9	Missense_Mutation	SNP	ENST00000379153.3	37	CCDS4532.1	.	.	.	.	.	.	.	.	.	.	G	16.18	3.050582	0.55218	.	.	ENSG00000112149	ENST00000379153	T	0.66460	-0.21	5.39	0.0343	0.14183	Immunoglobulin subtype (1);Immunoglobulin V-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.596334	0.17670	N	0.166010	T	0.43942	0.1270	M	0.65498	2.005	0.09310	N	1	B	0.22746	0.074	B	0.23574	0.047	T	0.50750	-0.8791	10	0.66056	D	0.02	0.2392	10.3167	0.43740	0.0797:0.5462:0.3742:0.0	.	58	Q01151	CD83_HUMAN	Q	58	ENSP00000368450:E58Q	ENSP00000368450:E58Q	E	+	1	0	CD83	14239748	0.291000	0.24352	0.001000	0.08648	0.098000	0.18820	0.223000	0.17719	-0.206000	0.10203	0.655000	0.94253	GAG	.		0.502	CD83-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039916.1		
ATXN1	6310	broad.mit.edu	37	6	16327916	16327918	+	In_Frame_Del	DEL	TGC	TGC	-	rs28555263	byFrequency	TCGA-OR-A5LO-01A-11D-A29I-10	TCGA-OR-A5LO-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	89d60dde-b03a-4cb7-b32a-5d06fa328603	4a5886aa-889d-4ef2-89a9-be2f7a06bd58	g.chr6:16327916_16327918delTGC	ENST00000244769.4	-	8	1560_1562	c.624_626delGCA	c.(622-627)cagcat>cat	p.Q208del	ATXN1_ENST00000436367.1_In_Frame_Del_p.Q208del	NM_000332.3	NP_000323.2	P54253	ATX1_HUMAN	ataxin 1	208	Poly-Gln.				adult locomotory behavior (GO:0008344)|cell death (GO:0008219)|negative regulation of insulin-like growth factor receptor signaling pathway (GO:0043569)|negative regulation of phosphorylation (GO:0042326)|negative regulation of transcription, DNA-templated (GO:0045892)|nuclear export (GO:0051168)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|RNA processing (GO:0006396)|transcription, DNA-templated (GO:0006351)|visual learning (GO:0008542)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nuclear inclusion body (GO:0042405)|nuclear matrix (GO:0016363)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|identical protein binding (GO:0042802)|poly(G) binding (GO:0034046)|poly(U) RNA binding (GO:0008266)|protein C-terminus binding (GO:0008022)|protein self-association (GO:0043621)			NS(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(11)|lung(12)|prostate(2)|skin(7)|upper_aerodigestive_tract(2)	44	Breast(50;0.063)|Ovarian(93;0.0733)	all_hematologic(90;0.000682)|Ovarian(999;0.00973)				ctgatgctgatgctgctgctgct	0.665																																					p.208_209del		.											.	ATXN1-93	0			c.624_626del						.																																			SO:0001651	inframe_deletion	6310	exon7			TGCTGATGCTGCT	X79204	CCDS34342.1	6p23	2014-09-17	2004-08-12	2004-08-13	ENSG00000124788	ENSG00000124788		"""Ataxins"""	10548	protein-coding gene	gene with protein product		601556	"""spinocerebellar ataxia 1 (olivopontocerebellar ataxia 1, autosomal dominant, ataxin 1)"""	SCA1		1582256	Standard	NM_000332		Approved	D6S504E, ATX1	uc010jpi.3	P54253	OTTHUMG00000014303	ENST00000244769.4:c.624_626delGCA	6.37:g.16327925_16327927delTGC	ENSP00000244769:p.Gln208del	Somatic	11	0		WXS	Illumina GAIIx	Phase_I	30	19	NM_001128164	0	0	0	0	0	Q17S02|Q9UJG2|Q9Y4J1	In_Frame_Del	DEL	ENST00000244769.4	37	CCDS34342.1																																																																																			.		0.665	ATXN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039943.3	NM_000332	
HIST1H1E	3008	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	26156922	26156922	+	Missense_Mutation	SNP	T	T	A			TCGA-OR-A5LO-01A-11D-A29I-10	TCGA-OR-A5LO-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	89d60dde-b03a-4cb7-b32a-5d06fa328603	4a5886aa-889d-4ef2-89a9-be2f7a06bd58	g.chr6:26156922T>A	ENST00000304218.3	+	1	364	c.304T>A	c.(304-306)Tcg>Acg	p.S102T	HIST1H2BD_ENST00000289316.2_5'Flank|HIST1H2BD_ENST00000377777.4_5'Flank	NM_005321.2	NP_005312.1	P10412	H14_HUMAN	histone cluster 1, H1e	102	H15. {ECO:0000255|PROSITE- ProRule:PRU00837}.				nucleosome assembly (GO:0006334)|nucleosome positioning (GO:0016584)	extracellular vesicular exosome (GO:0070062)|nuclear heterochromatin (GO:0005720)|nucleosome (GO:0000786)|nucleus (GO:0005634)	chromatin DNA binding (GO:0031490)|poly(A) RNA binding (GO:0044822)			NS(2)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(1)|liver(1)|lung(9)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	26						CACCGGCGCGTCGGGTTCCTT	0.617																																					p.S102T		.											.	HIST1H1E-154	0			c.T304A						.						41.0	47.0	45.0					6																	26156922		2203	4300	6503	SO:0001583	missense	3008	exon1			GGCGCGTCGGGTT	M60748	CCDS4586.1	6p22.1	2012-05-04	2006-10-11	2003-02-21	ENSG00000168298	ENSG00000168298		"""Histones / Replication-dependent"""	4718	protein-coding gene	gene with protein product		142220	"""H1 histone family, member 4"", ""histone 1, H1e"""	H1F4		1916825, 12408966	Standard	NM_005321		Approved	H1.4, H1e, H1s-4	uc003ngq.3	P10412	OTTHUMG00000014422	ENST00000304218.3:c.304T>A	6.37:g.26156922T>A	ENSP00000307705:p.Ser102Thr	Somatic	160	0		WXS	Illumina GAIIx	Phase_I	124	64	NM_005321	0	0	1	3	2	Q4VB25	Missense_Mutation	SNP	ENST00000304218.3	37	CCDS4586.1	.	.	.	.	.	.	.	.	.	.	.	17.61	3.432561	0.62844	.	.	ENSG00000168298	ENST00000304218	T	0.25749	1.78	5.35	5.35	0.76521	Histone H1/H5 (2);Winged helix-turn-helix transcription repressor DNA-binding (1);	0.063724	0.64402	D	0.000004	T	0.46521	0.1397	M	0.82517	2.595	0.54753	D	0.999989	D	0.71674	0.998	D	0.76071	0.987	T	0.54892	-0.8225	10	0.87932	D	0	-5.2304	14.7974	0.69886	0.0:0.0:0.0:1.0	.	102	P10412	H14_HUMAN	T	102	ENSP00000307705:S102T	ENSP00000307705:S102T	S	+	1	0	HIST1H1E	26264901	1.000000	0.71417	0.306000	0.25113	0.521000	0.34408	3.971000	0.56831	2.146000	0.66826	0.459000	0.35465	TCG	.		0.617	HIST1H1E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040084.1	NM_005321	
MUC21	394263	bcgsc.ca	37	6	30954594	30954594	+	Missense_Mutation	SNP	G	G	C			TCGA-OR-A5LO-01A-11D-A29I-10	TCGA-OR-A5LO-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	89d60dde-b03a-4cb7-b32a-5d06fa328603	4a5886aa-889d-4ef2-89a9-be2f7a06bd58	g.chr6:30954594G>C	ENST00000376296.3	+	2	883	c.642G>C	c.(640-642)gaG>gaC	p.E214D	MUC21_ENST00000486149.2_5'UTR	NM_001010909.2	NP_001010909.2	Q5SSG8	MUC21_HUMAN	mucin 21, cell surface associated	214	28 X 15 AA approximate tandem repeats.|Ser-rich.				cellular protein metabolic process (GO:0044267)|negative regulation of cell-cell adhesion (GO:0022408)|negative regulation of cell-substrate adhesion (GO:0010812)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(4)|breast(1)|central_nervous_system(2)|endometrium(1)|kidney(1)|large_intestine(7)|lung(11)|ovary(3)|prostate(4)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	42						CCAACTCTGAGTCCAGAACGA	0.612																																					p.E214D		.											.	MUC21-92	0			c.G642C						.						154.0	152.0	153.0					6																	30954594		2203	4300	6503	SO:0001583	missense	394263	exon2			CTCTGAGTCCAGA	AK056612	CCDS34388.1	6p21.33	2008-05-14	2008-05-14	2008-05-14	ENSG00000204544	ENSG00000204544		"""Mucins"""	21661	protein-coding gene	gene with protein product	"""epiglycanin"""		"""chromosome 6 open reading frame 205"""	C6orf205		17977904	Standard	NM_001010909		Approved	bCX31G15.2	uc003nsh.2	Q5SSG8	OTTHUMG00000031216	ENST00000376296.3:c.642G>C	6.37:g.30954594G>C	ENSP00000365473:p.Glu214Asp	Somatic	276	4		WXS	Illumina GAIIx	Phase_I	237	13	NM_001010909	0	0	0	0	0	B0UZT7|B4DQ55|C9JMK2|D9N007|Q0VGF1|Q3B7T2|Q5SS94|Q6UXC5	Missense_Mutation	SNP	ENST00000376296.3	37	CCDS34388.1	.	.	.	.	.	.	.	.	.	.	G	3.066	-0.192132	0.06299	.	.	ENSG00000204544	ENST00000376296	T	0.01787	4.64	3.54	-7.08	0.01558	.	.	.	.	.	T	0.00384	0.0012	N	0.19112	0.55	0.09310	N	1	B	0.12013	0.005	B	0.08055	0.003	T	0.43196	-0.9406	8	.	.	.	.	10.9515	0.47332	0.1259:0.5078:0.3663:0.0	.	214	Q5SSG8	MUC21_HUMAN	D	214	ENSP00000365473:E214D	.	E	+	3	2	MUC21	31062573	0.000000	0.05858	0.000000	0.03702	0.005000	0.04900	-0.756000	0.04777	-2.750000	0.00375	-0.349000	0.07799	GAG	.		0.612	MUC21-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000128579.3	NM_001010909	
HLA-DQA1	3117	bcgsc.ca	37	6	32609105	32609105	+	Missense_Mutation	SNP	G	G	A	rs1129740	byFrequency	TCGA-OR-A5LO-01A-11D-A29I-10	TCGA-OR-A5LO-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	89d60dde-b03a-4cb7-b32a-5d06fa328603	4a5886aa-889d-4ef2-89a9-be2f7a06bd58	g.chr6:32609105G>A	ENST00000343139.5	+	2	203	c.101G>A	c.(100-102)tGt>tAt	p.C34Y	HLA-DQA1_ENST00000395363.1_Missense_Mutation_p.C34Y|HLA-DQA1_ENST00000374949.2_Missense_Mutation_p.C34Y	NM_002122.3	NP_002113.2	P01909	DQA1_HUMAN	major histocompatibility complex, class II, DQ alpha 1	34	Alpha-1.		Y -> C (in allele DQA1*01:01, allele DQA1*01:02, allele DQA1*01:03, allele DQA1*01:04, allele DQA1*01:05, allele DQA1*01:06 and allele DQA1*01:07; dbSNP:rs1129740).		antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|cytokine-mediated signaling pathway (GO:0019221)|immune response (GO:0006955)|interferon-gamma-mediated signaling pathway (GO:0060333)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)	clathrin-coated endocytic vesicle membrane (GO:0030669)|endocytic vesicle membrane (GO:0030666)|endosome (GO:0005768)|ER to Golgi transport vesicle membrane (GO:0012507)|Golgi membrane (GO:0000139)|integral component of lumenal side of endoplasmic reticulum membrane (GO:0071556)|integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|MHC class II protein complex (GO:0042613)|plasma membrane (GO:0005886)|trans-Golgi network membrane (GO:0032588)|transport vesicle membrane (GO:0030658)	MHC class II receptor activity (GO:0032395)|peptide antigen binding (GO:0042605)			NS(1)|lung(3)|skin(1)|upper_aerodigestive_tract(1)	6						GTTGCCTCTTGTGGTGTAAAC	0.473													.|||	2620	0.523163	0.503	0.6758	5008	,	,		16991	0.4623		0.5547	False		,,,				2504	0.4724				p.C34Y		.											.	HLA-DQA1-90	0			c.G101A						.	A	TYR/CYS	1866,2540		609,648,946	147.0	124.0	131.0		101	-0.3	0.0	6	dbSNP_86	131	3996,4590		1509,978,1806	yes	missense	HLA-DQA1	NM_002122.3	194	2118,1626,2752	AA,AG,GG		46.5409,42.3513,45.1201	benign	34/256	32609105	5862,7130	2203	4293	6496	SO:0001583	missense	3117	exon2			CCTCTTGTGGTGT		CCDS4752.1	6p21.3	2013-01-11			ENSG00000196735	ENSG00000196735		"""Histocompatibility complex"", ""Immunoglobulin superfamily / C1-set domain containing"""	4942	protein-coding gene	gene with protein product		146880		HLA-DQA			Standard	NM_002122		Approved	CELIAC1	uc003obr.3	P01909	OTTHUMG00000031106	ENST00000343139.5:c.101G>A	6.37:g.32609105G>A	ENSP00000339398:p.Cys34Tyr	Somatic	164	0		WXS	Illumina GAIIx	Phase_I	26	16	NM_002122	0	0	0	0	0	O19630|O19706|P01907|P01908|P04225|P04226|P05536|P79553|Q06751|Q29876|Q29994|Q2Q6Y6|Q2Q6Y7|Q2Q6Y8|Q2WCM3|Q30064|Q30067|Q30068|Q30070|Q30071|Q30072|Q30073|Q30086|Q30101|Q5Y7D5|Q5Y7F5|Q6ICU6|Q6PR46|Q6QDB1|Q860W2|Q860W4|Q9BD37|Q9TPM3|Q9UM31	Missense_Mutation	SNP	ENST00000343139.5	37	CCDS4752.1	1155|1155	0.5288461538461539|0.5288461538461539	219|219	0.4451219512195122|0.4451219512195122	236|236	0.6519337016574586|0.6519337016574586	300|300	0.5244755244755245|0.5244755244755245	400|400	0.5277044854881267|0.5277044854881267	.|.	0.005|0.005	-2.227569|-2.227569	0.00280|0.00280	0.423513|0.423513	0.465409|0.465409	ENSG00000196735|ENSG00000196735	ENST00000343139;ENST00000395364;ENST00000395363;ENST00000496318;ENST00000374949|ENST00000486548	T;T;T;T|.	0.00627|.	6.12;6.12;6.12;6.12|.	3.84|3.84	-0.275|-0.275	0.12906|0.12906	.|.	1.206650|.	0.05915|.	N|.	0.632490|.	T|T	0.00784|0.00784	0.0026|0.0026	N|N	0.00067|0.00067	-2.295|-2.295	0.80722|0.80722	P|P	0.0|0.0	B;B|.	0.11235|.	0.004;0.001|.	B;B|.	0.16289|.	0.015;0.002|.	T|T	0.39035|0.39035	-0.9633|-0.9633	9|4	0.02654|.	T|.	1|.	.|.	1.0863|1.0863	0.01654|0.01654	0.4832:0.1399:0.1032:0.2736|0.4832:0.1399:0.1032:0.2736	rs1129740;rs1142321;rs3187980;rs3205982;rs9272689;rs12722045;rs17412265|rs1129740;rs1142321;rs3187980;rs3205982;rs9272689;rs12722045;rs17412265	40;34|.	Q59F33;G4XQK2|.	.;.|.	Y|M	34|7	ENSP00000339398:C34Y;ENSP00000378767:C34Y;ENSP00000437302:C34Y;ENSP00000364087:C34Y|.	ENSP00000339398:C34Y|.	C|V	+|+	2|1	0|0	HLA-DQA1|HLA-DQA1	32717083|32717083	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.000000|0.000000	0.00434|0.00434	0.118000|0.118000	0.15605|0.15605	-0.454000|-0.454000	0.07066|0.07066	-1.852000|-1.852000	0.00566|0.00566	TGT|GTG	G|0.446;A|0.554		0.473	HLA-DQA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076176.3	NM_002122	
KCNK17	89822	hgsc.bcm.edu	37	6	39282036	39282036	+	Missense_Mutation	SNP	T	T	C	rs10947804	byFrequency	TCGA-OR-A5LO-01A-11D-A29I-10	TCGA-OR-A5LO-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	89d60dde-b03a-4cb7-b32a-5d06fa328603	4a5886aa-889d-4ef2-89a9-be2f7a06bd58	g.chr6:39282036T>C	ENST00000373231.4	-	1	293	c.61A>G	c.(61-63)Agc>Ggc	p.S21G	KCNK17_ENST00000453413.2_Missense_Mutation_p.S21G	NM_031460.3	NP_113648.2	Q96T54	KCNKH_HUMAN	potassium channel, subfamily K, member 17	21			S -> G (in dbSNP:rs10947804). {ECO:0000269|PubMed:11248242, ECO:0000269|PubMed:15489334}.		potassium ion transport (GO:0006813)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	potassium channel activity (GO:0005267)|voltage-gated ion channel activity (GO:0005244)			endometrium(1)|kidney(1)|large_intestine(3)|lung(6)|ovary(1)|skin(2)	14						AGCACGGTGCTGGGCACCGCG	0.761													T|||	2917	0.582468	0.8858	0.4553	5008	,	,		12417	0.4673		0.4851	False		,,,				2504	0.4816				p.S21G		.											.	KCNK17-227	0			c.A61G						.	T	GLY/SER,GLY/SER	3100,536		1364,372,82	3.0	4.0	3.0		61,61	2.1	0.0	6	dbSNP_120	3	4061,3263		1251,1559,852	yes	missense,missense	KCNK17	NM_001135111.1,NM_031460.3	56,56	2615,1931,934	CC,CT,TT		44.5522,14.7415,34.6624	benign,benign	21/272,21/333	39282036	7161,3799	1818	3662	5480	SO:0001583	missense	89822	exon1			CGGTGCTGGGCAC	AF358910	CCDS4842.1, CCDS47419.1	6p21	2012-03-07			ENSG00000124780	ENSG00000124780		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Two-P"""	14465	protein-coding gene	gene with protein product		607370				16382106	Standard	NM_031460		Approved	K2p17.1, TALK-2, TALK2, TASK4, TASK-4	uc003ooo.3	Q96T54	OTTHUMG00000014646	ENST00000373231.4:c.61A>G	6.37:g.39282036T>C	ENSP00000362328:p.Ser21Gly	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	12	12	NM_001135111	0	0	0	0	0	E9PB46|Q5TCF4|Q8TAW4|Q9BXD1|Q9H592	Missense_Mutation	SNP	ENST00000373231.4	37	CCDS4842.1	1214	0.5558608058608059	431	0.8760162601626016	173	0.47790055248618785	244	0.42657342657342656	366	0.48284960422163586	T	8.033	0.762256	0.15914	0.852585	0.554478	ENSG00000124780	ENST00000373231;ENST00000453413	T;T	0.56776	0.44;0.44	4.06	2.09	0.27110	.	1.425750	0.04586	N	0.395947	T	0.14184	0.0343	N	0.17082	0.46	0.80722	P	0.0	B;B	0.06786	0.001;0.0	B;B	0.04013	0.001;0.001	T	0.09122	-1.0689	9	0.21014	T	0.42	.	5.3388	0.15973	0.0:0.5516:0.0:0.4484	rs10947804;rs17845776;rs17858736;rs60349641	21;21	E9PB46;Q96T54	.;KCNKH_HUMAN	G	21	ENSP00000362328:S21G;ENSP00000401271:S21G	ENSP00000362328:S21G	S	-	1	0	KCNK17	39390014	0.000000	0.05858	0.003000	0.11579	0.032000	0.12392	-0.229000	0.09098	0.383000	0.24910	0.459000	0.35465	AGC	T|0.441;C|0.559		0.761	KCNK17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040453.2	NM_031460	
ENPP4	22875	broad.mit.edu	37	6	46107907	46107907	+	Missense_Mutation	SNP	G	G	T			TCGA-OR-A5LO-01A-11D-A29I-10	TCGA-OR-A5LO-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	89d60dde-b03a-4cb7-b32a-5d06fa328603	4a5886aa-889d-4ef2-89a9-be2f7a06bd58	g.chr6:46107907G>T	ENST00000321037.4	+	2	817	c.587G>T	c.(586-588)gGa>gTa	p.G196V		NM_014936.4	NP_055751.1	Q9Y6X5	ENPP4_HUMAN	ectonucleotide pyrophosphatase/phosphodiesterase 4 (putative)	196					blood coagulation (GO:0007596)|positive regulation of blood coagulation (GO:0030194)|purine ribonucleoside catabolic process (GO:0046130)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	bis(5'-adenosyl)-triphosphatase activity (GO:0047710)|metal ion binding (GO:0046872)			central_nervous_system(1)|large_intestine(2)|lung(7)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	18						CACAAATACGGACCTGAAGAT	0.383																																					p.G196V		.											.	ENPP4-94	0			c.G587T						.						107.0	105.0	105.0					6																	46107907		2203	4300	6503	SO:0001583	missense	22875	exon2			AATACGGACCTGA	AB020686	CCDS34468.1	6p12.3	2010-06-24	2010-06-24		ENSG00000001561	ENSG00000001561			3359	protein-coding gene	gene with protein product						11027689	Standard	NM_014936		Approved	NPP4, KIAA0879	uc003oxy.3	Q9Y6X5	OTTHUMG00000014779	ENST00000321037.4:c.587G>T	6.37:g.46107907G>T	ENSP00000318066:p.Gly196Val	Somatic	138	0		WXS	Illumina GAIIx	Phase_I	125	4	NM_014936	0	0	15	15	0	A8K5G1|Q7L2N1	Missense_Mutation	SNP	ENST00000321037.4	37	CCDS34468.1	.	.	.	.	.	.	.	.	.	.	G	22.9	4.355688	0.82243	.	.	ENSG00000001561	ENST00000321037;ENST00000371401	D	0.81579	-1.51	5.71	5.71	0.89125	Alkaline phosphatase-like, alpha/beta/alpha (1);Alkaline-phosphatase-like, core domain (1);	0.000000	0.85682	D	0.000000	D	0.93612	0.7960	H	0.97682	4.055	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.95244	0.8354	10	0.87932	D	0	-19.276	19.8579	0.96771	0.0:0.0:1.0:0.0	.	196	Q9Y6X5	ENPP4_HUMAN	V	196	ENSP00000318066:G196V	ENSP00000318066:G196V	G	+	2	0	ENPP4	46215866	1.000000	0.71417	0.852000	0.33557	0.885000	0.51271	9.438000	0.97539	2.687000	0.91594	0.655000	0.94253	GGA	.		0.383	ENPP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040777.2		
POU3F2	5454	hgsc.bcm.edu	37	6	99283376	99283376	+	Silent	SNP	T	T	G	rs195860	byFrequency	TCGA-OR-A5LO-01A-11D-A29I-10	TCGA-OR-A5LO-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	89d60dde-b03a-4cb7-b32a-5d06fa328603	4a5886aa-889d-4ef2-89a9-be2f7a06bd58	g.chr6:99283376T>G	ENST00000328345.5	+	1	797	c.627T>G	c.(625-627)ggT>ggG	p.G209G		NM_005604.3	NP_005595.2	P20265	PO3F2_HUMAN	POU class 3 homeobox 2	209					astrocyte development (GO:0014002)|cellular response to organic substance (GO:0071310)|cerebral cortex radially oriented cell migration (GO:0021799)|epidermis development (GO:0008544)|forebrain ventricular zone progenitor cell division (GO:0021869)|hypothalamus cell differentiation (GO:0021979)|myelination in peripheral nervous system (GO:0022011)|neurohypophysis development (GO:0021985)|neuron differentiation (GO:0030182)|positive regulation of cell proliferation (GO:0008284)|positive regulation of multicellular organism growth (GO:0040018)|regulation of axonogenesis (GO:0050770)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	identical protein binding (GO:0042802)|RNA polymerase II transcription coactivator activity (GO:0001105)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(2)|large_intestine(3)|lung(5)	10		all_cancers(76;1.56e-06)|Acute lymphoblastic leukemia(125;4.93e-10)|all_hematologic(75;3.55e-07)|all_epithelial(107;0.00893)|Colorectal(196;0.069)|Lung NSC(302;0.197)		BRCA - Breast invasive adenocarcinoma(108;0.0355)		AGCCGGCCGGTCTGCACCACC	0.736													G|||	4460	0.890575	0.8994	0.9121	5008	,	,		6412	0.9544		0.8598	False		,,,				2504	0.8292				p.G209G		.											.	POU3F2-90	0			c.T627G						.	G		3186,306		1453,280,13	4.0	4.0	4.0		627	3.1	1.0	6	dbSNP_79	4	6282,930		2738,806,62	no	coding-synonymous	POU3F2	NM_005604.2		4191,1086,75	GG,GT,TT		12.8952,8.7629,11.5471		209/444	99283376	9468,1236	1746	3606	5352	SO:0001819	synonymous_variant	5454	exon1			GGCCGGTCTGCAC	Z11933	CCDS5040.1	6q16.2	2011-06-20	2007-07-13		ENSG00000184486	ENSG00000184486		"""Homeoboxes / POU class"""	9215	protein-coding gene	gene with protein product		600494	"""POU domain class 3, transcription factor 2"""	OTF7		8441633	Standard	NM_005604		Approved	POUF3, BRN2, OCT7	uc003ppe.3	P20265	OTTHUMG00000015258	ENST00000328345.5:c.627T>G	6.37:g.99283376T>G		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	5	5	NM_005604	0	0	0	0	0	Q14960|Q86V54|Q9UJL0	Silent	SNP	ENST00000328345.5	37	CCDS5040.1																																																																																			T|0.089;G|0.911		0.736	POU3F2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041586.2		
BVES	11149	broad.mit.edu	37	6	105585761	105585761	+	5'Flank	SNP	C	C	G			TCGA-OR-A5LO-01A-11D-A29I-10	TCGA-OR-A5LO-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	89d60dde-b03a-4cb7-b32a-5d06fa328603	4a5886aa-889d-4ef2-89a9-be2f7a06bd58	g.chr6:105585761C>G	ENST00000314641.5	-	0	0				BVES-AS1_ENST00000369122.3_RNA|BVES-AS1_ENST00000580511.1_RNA|BVES-AS1_ENST00000580854.1_RNA|BVES_ENST00000336775.5_5'Flank|BVES_ENST00000446408.2_5'Flank|BVES-AS1_ENST00000369120.2_RNA	NM_001199563.1	NP_001186492.1	Q8NE79	POPD1_HUMAN	blood vessel epicardial substance						epithelial cell-cell adhesion (GO:0090136)|hematopoietic progenitor cell differentiation (GO:0002244)|muscle organ development (GO:0007517)|positive regulation of locomotion (GO:0040017)|positive regulation of receptor recycling (GO:0001921)|regulation of Cdc42 GTPase activity (GO:0043088)|regulation of cell shape (GO:0008360)|regulation of heart rate (GO:0002027)|regulation of membrane potential (GO:0042391)|regulation of Rac GTPase activity (GO:0032314)|sinoatrial node cell development (GO:0060931)|substrate adhesion-dependent cell spreading (GO:0034446)|vesicle-mediated transport (GO:0016192)	integral component of membrane (GO:0016021)|lateral plasma membrane (GO:0016328)|plasma membrane (GO:0005886)|tight junction (GO:0005923)	cAMP binding (GO:0030552)|structural molecule activity (GO:0005198)			NS(2)|large_intestine(6)|lung(9)|prostate(2)|skin(1)|urinary_tract(1)	21		all_cancers(87;2.83e-05)|Acute lymphoblastic leukemia(125;1.95e-08)|all_hematologic(75;9.25e-07)|all_epithelial(87;0.0101)|Colorectal(196;0.204)|Lung NSC(302;0.238)				AGAGTATGCTCCGATCAACTT	0.428																																					.		.											.	.	0			.						.																																			SO:0001631	upstream_gene_variant	154442	.			TATGCTCCGATCA	AF124512	CCDS5051.1	6q21	2008-11-25			ENSG00000112276	ENSG00000112276			1152	protein-coding gene	gene with protein product	"""popeye domain containing 1"""	604577				10441744, 10882522	Standard	NM_147147		Approved	HBVES, POP1, POPDC1	uc003pqx.3	Q8NE79	OTTHUMG00000015291		6.37:g.105585761C>G	Exception_encountered	Somatic	333	0		WXS	Illumina GAIIx	Phase_I	198	5	.	0	0	0	0	0	A8K1R4|E1P5D8|Q5T550|Q5T551|Q8IWC6|Q9HBV0|Q9UNG6	RNA	SNP	ENST00000314641.5	37	CCDS5051.1																																																																																			.		0.428	BVES-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406075.1	NM_147147	
ZDHHC14	79683	bcgsc.ca	37	6	158074629	158074629	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5LO-01A-11D-A29I-10	TCGA-OR-A5LO-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	89d60dde-b03a-4cb7-b32a-5d06fa328603	4a5886aa-889d-4ef2-89a9-be2f7a06bd58	g.chr6:158074629G>A	ENST00000359775.5	+	8	1927	c.1038G>A	c.(1036-1038)atG>atA	p.M346I	ZDHHC14_ENST00000414563.2_Missense_Mutation_p.M346I|ZDHHC14_ENST00000341375.8_3'UTR			Q8IZN3	ZDH14_HUMAN	zinc finger, DHHC-type containing 14	346					protein palmitoylation (GO:0018345)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	palmitoyltransferase activity (GO:0016409)|protein-cysteine S-palmitoyltransferase activity (GO:0019706)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(2)|large_intestine(4)|lung(8)|ovary(1)|skin(1)	17		Breast(66;0.00586)|Ovarian(120;0.123)		OV - Ovarian serous cystadenocarcinoma(65;2.9e-17)|BRCA - Breast invasive adenocarcinoma(81;5.8e-05)		GCATCACCATGTACGGGGCCA	0.587																																					p.M346I		.											.	ZDHHC14-227	0			c.G1038A						.						74.0	65.0	68.0					6																	158074629		2203	4300	6503	SO:0001583	missense	79683	exon8			CACCATGTACGGG	AF542388	CCDS5252.1, CCDS47510.1	6q25.3	2008-05-02			ENSG00000175048	ENSG00000175048		"""Zinc fingers, DHHC-type"""	20341	protein-coding gene	gene with protein product							Standard	NM_024630		Approved	FLJ20984, NEW1CP	uc003qqt.3	Q8IZN3	OTTHUMG00000015896	ENST00000359775.5:c.1038G>A	6.37:g.158074629G>A	ENSP00000352821:p.Met346Ile	Somatic	84	2		WXS	Illumina GAIIx	Phase_I	51	45	NM_024630	0	0	2	4	2	A6NDB7|Q5JS07|Q5JS08|Q6PHS4|Q8IZN2|Q9H7F1	Missense_Mutation	SNP	ENST00000359775.5	37	CCDS5252.1	.	.	.	.	.	.	.	.	.	.	G	14.43	2.532229	0.45073	.	.	ENSG00000175048	ENST00000359775;ENST00000414563;ENST00000538483	T;T	0.42513	1.99;0.97	5.38	2.64	0.31445	.	1.200410	0.05931	N	0.635157	T	0.21227	0.0511	L	0.50333	1.59	0.51767	D	0.999931	B;B	0.28178	0.042;0.202	B;B	0.29862	0.015;0.108	T	0.41805	-0.9488	10	0.21014	T	0.42	-4.042	8.0886	0.30786	0.147:0.1309:0.7221:0.0	.	346;346	Q8IZN3;Q8IZN3-2	ZDH14_HUMAN;.	I	346;346;350	ENSP00000352821:M346I;ENSP00000410713:M346I	ENSP00000352821:M346I	M	+	3	0	ZDHHC14	157994617	1.000000	0.71417	0.991000	0.47740	0.937000	0.57800	2.422000	0.44696	2.043000	0.60533	0.460000	0.39030	ATG	.		0.587	ZDHHC14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042841.2	NM_153746	
USP42	84132	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	6175530	6175530	+	Silent	SNP	C	C	G			TCGA-OR-A5LO-01A-11D-A29I-10	TCGA-OR-A5LO-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	89d60dde-b03a-4cb7-b32a-5d06fa328603	4a5886aa-889d-4ef2-89a9-be2f7a06bd58	g.chr7:6175530C>G	ENST00000306177.5	+	4	659	c.501C>G	c.(499-501)ctC>ctG	p.L167L		NM_032172.2	NP_115548.1	Q9H9J4	UBP42_HUMAN	ubiquitin specific peptidase 42	167	USP.				cell differentiation (GO:0030154)|protein deubiquitination (GO:0016579)|spermatogenesis (GO:0007283)|ubiquitin-dependent protein catabolic process (GO:0006511)		ubiquitin-specific protease activity (GO:0004843)			breast(1)|central_nervous_system(1)|endometrium(5)|kidney(4)|large_intestine(2)|lung(14)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|urinary_tract(1)	35		Ovarian(82;0.0423)		UCEC - Uterine corpus endometrioid carcinoma (126;0.108)|OV - Ovarian serous cystadenocarcinoma(56;5.77e-14)		CCCAGGCACTCAGTAATCCTG	0.348																																					p.L167L		.											.	USP42-659	0			c.C501G						.						122.0	111.0	115.0					7																	6175530		1879	4123	6002	SO:0001819	synonymous_variant	84132	exon4			GGCACTCAGTAAT	AK022759	CCDS47535.1	7p22.2	2005-08-08	2005-08-08		ENSG00000106346	ENSG00000106346		"""Ubiquitin-specific peptidases"""	20068	protein-coding gene	gene with protein product			"""ubiquitin specific protease 42"""			12838346	Standard	NM_032172		Approved	FLJ12697	uc011jwp.2	Q9H9J4	OTTHUMG00000151888	ENST00000306177.5:c.501C>G	7.37:g.6175530C>G		Somatic	143	0		WXS	Illumina GAIIx	Phase_I	195	34	NM_032172	0	0	2	2	0	A2RUE3|B5MDA5|Q0VIN8|Q3C166|Q6P9B4	Silent	SNP	ENST00000306177.5	37	CCDS47535.1																																																																																			.		0.348	USP42-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000324262.3	XM_166526	
GARS	2617	hgsc.bcm.edu	37	7	30634630	30634630	+	Silent	SNP	G	G	C	rs2529438	byFrequency	TCGA-OR-A5LO-01A-11D-A29I-10	TCGA-OR-A5LO-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	89d60dde-b03a-4cb7-b32a-5d06fa328603	4a5886aa-889d-4ef2-89a9-be2f7a06bd58	g.chr7:30634630G>C	ENST00000389266.3	+	1	334	c.93G>C	c.(91-93)ctG>ctC	p.L31L	AC005154.6_ENST00000581665.1_RNA|AC005154.6_ENST00000584372.1_RNA|AC005154.6_ENST00000582549.1_RNA|AC005154.6_ENST00000579174.1_RNA|AC005154.6_ENST00000578994.1_RNA|AC005154.6_ENST00000580440.1_RNA|AC005154.6_ENST00000583664.1_RNA|AC005154.6_ENST00000584199.1_RNA	NM_002047.2	NP_002038.2	P41250	SYG_HUMAN	glycyl-tRNA synthetase	31					cell death (GO:0008219)|diadenosine tetraphosphate biosynthetic process (GO:0015966)|gene expression (GO:0010467)|glycyl-tRNA aminoacylation (GO:0006426)|tRNA aminoacylation for protein translation (GO:0006418)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|mitochondrial matrix (GO:0005759)|nucleus (GO:0005634)|secretory granule (GO:0030141)	ATP binding (GO:0005524)|glycine-tRNA ligase activity (GO:0004820)|protein dimerization activity (GO:0046983)			breast(3)|endometrium(2)|kidney(1)|large_intestine(4)|lung(9)|ovary(1)|skin(3)|urinary_tract(1)	24					Glycine(DB00145)	CCTCGCTCCTGCTCCGCCGGT	0.741													G|||	705	0.140775	0.1218	0.0994	5008	,	,		12290	0.1776		0.0726	False		,,,				2504	0.228				p.L31L		.											.	GARS-91	0			c.G93C						.	G		360,3594		14,332,1631	6.0	8.0	7.0		93	2.7	0.0	7	dbSNP_100	7	669,7413		24,621,3396	no	coding-synonymous	GARS	NM_002047.2		38,953,5027	CC,CG,GG		8.2777,9.1047,8.5494		31/740	30634630	1029,11007	1977	4041	6018	SO:0001819	synonymous_variant	2617	exon1			GCTCCTGCTCCGC	AK074524	CCDS43564.1	7p15	2014-09-17	2004-02-13		ENSG00000106105	ENSG00000106105	6.1.1.14	"""Aminoacyl tRNA synthetases / Class II"""	4162	protein-coding gene	gene with protein product	"""glycine tRNA ligase"""	600287	"""Charcot-Marie-Tooth neuropathy 2D"""	CMT2D		8595897, 8872480	Standard	NM_002047		Approved	GlyRS, DSMAV, SMAD1	uc003tbm.3	P41250	OTTHUMG00000152769	ENST00000389266.3:c.93G>C	7.37:g.30634630G>C		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	20	20	NM_002047	0	0	0	48	48	B3KQA2|B4DIA0|Q969Y1	Silent	SNP	ENST00000389266.3	37	CCDS43564.1																																																																																			G|0.889;C|0.111		0.741	GARS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000327735.1	NM_002047	
GARS	2617	hgsc.bcm.edu	37	7	30634661	30634661	+	Missense_Mutation	SNP	C	C	G	rs1049402	byFrequency	TCGA-OR-A5LO-01A-11D-A29I-10	TCGA-OR-A5LO-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	89d60dde-b03a-4cb7-b32a-5d06fa328603	4a5886aa-889d-4ef2-89a9-be2f7a06bd58	g.chr7:30634661C>G	ENST00000389266.3	+	1	365	c.124C>G	c.(124-126)Ccc>Gcc	p.P42A	AC005154.6_ENST00000581665.1_RNA|AC005154.6_ENST00000584372.1_RNA|AC005154.6_ENST00000582549.1_RNA|AC005154.6_ENST00000579174.1_RNA|AC005154.6_ENST00000578994.1_RNA|AC005154.6_ENST00000580440.1_RNA|AC005154.6_ENST00000583664.1_RNA|AC005154.6_ENST00000584199.1_RNA	NM_002047.2	NP_002038.2	P41250	SYG_HUMAN	glycyl-tRNA synthetase	42			P -> A (in dbSNP:rs1049402). {ECO:0000269|PubMed:14702039, ECO:0000269|PubMed:15489334, ECO:0000269|PubMed:7753621, ECO:0000269|PubMed:7961834, ECO:0000269|PubMed:7962006}.		cell death (GO:0008219)|diadenosine tetraphosphate biosynthetic process (GO:0015966)|gene expression (GO:0010467)|glycyl-tRNA aminoacylation (GO:0006426)|tRNA aminoacylation for protein translation (GO:0006418)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|mitochondrial matrix (GO:0005759)|nucleus (GO:0005634)|secretory granule (GO:0030141)	ATP binding (GO:0005524)|glycine-tRNA ligase activity (GO:0004820)|protein dimerization activity (GO:0046983)	p.P42fs*20(1)		breast(3)|endometrium(2)|kidney(1)|large_intestine(4)|lung(9)|ovary(1)|skin(3)|urinary_tract(1)	24					Glycine(DB00145)	GGCCTCCTGCCCCCCGATCTC	0.736													G|||	3252	0.649361	0.5219	0.7147	5008	,	,		13746	0.6677		0.7634	False		,,,				2504	0.6391				p.P42A		.											.	GARS-91	1	Insertion - Frameshift(1)	large_intestine(1)	c.C124G						.	G	ALA/PRO	2445,1427		776,893,267	5.0	8.0	7.0		124	-6.6	0.0	7	dbSNP_86	7	6367,1671		2577,1213,229	no	missense	GARS	NM_002047.2	27	3353,2106,496	GG,GC,CC		20.7888,36.8543,26.0118	benign	42/740	30634661	8812,3098	1936	4019	5955	SO:0001583	missense	2617	exon1			TCCTGCCCCCCGA	AK074524	CCDS43564.1	7p15	2014-09-17	2004-02-13		ENSG00000106105	ENSG00000106105	6.1.1.14	"""Aminoacyl tRNA synthetases / Class II"""	4162	protein-coding gene	gene with protein product	"""glycine tRNA ligase"""	600287	"""Charcot-Marie-Tooth neuropathy 2D"""	CMT2D		8595897, 8872480	Standard	NM_002047		Approved	GlyRS, DSMAV, SMAD1	uc003tbm.3	P41250	OTTHUMG00000152769	ENST00000389266.3:c.124C>G	7.37:g.30634661C>G	ENSP00000373918:p.Pro42Ala	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	15	15	NM_002047	0	0	0	36	36	B3KQA2|B4DIA0|Q969Y1	Missense_Mutation	SNP	ENST00000389266.3	37	CCDS43564.1	1456	0.6666666666666666	278	0.5650406504065041	268	0.7403314917127072	337	0.5891608391608392	573	0.7559366754617414	G	0.005	-2.164835	0.00318	0.631457	0.792112	ENSG00000106105	ENST00000389266	T	0.80393	-1.37	3.31	-6.63	0.01807	.	1.037800	0.07609	N	0.925137	T	0.00012	0.0000	N	0.08118	0	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.13575	-1.0504	9	0.08179	T	0.78	.	5.5596	0.17135	0.0726:0.2689:0.1197:0.5389	rs1049402;rs3189564;rs11553500;rs17856223;rs17856227;rs1049402	42	P41250	SYG_HUMAN	A	42	ENSP00000373918:P42A	ENSP00000373918:P42A	P	+	1	0	GARS	30601186	0.000000	0.05858	0.000000	0.03702	0.037000	0.13140	-0.671000	0.05250	-2.551000	0.00479	-0.744000	0.03518	CCC	C|0.329;G|0.671		0.736	GARS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000327735.1	NM_002047	
ZMIZ2	83637	broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	44802986	44802986	+	Nonsense_Mutation	SNP	C	C	T			TCGA-OR-A5LO-01A-11D-A29I-10	TCGA-OR-A5LO-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	89d60dde-b03a-4cb7-b32a-5d06fa328603	4a5886aa-889d-4ef2-89a9-be2f7a06bd58	g.chr7:44802986C>T	ENST00000309315.4	+	13	1957	c.1834C>T	c.(1834-1836)Cga>Tga	p.R612*	ZMIZ2_ENST00000413916.1_Nonsense_Mutation_p.R554*|ZMIZ2_ENST00000441627.1_Nonsense_Mutation_p.R612*|ZMIZ2_ENST00000433667.1_Nonsense_Mutation_p.R580*|ZMIZ2_ENST00000265346.7_Nonsense_Mutation_p.R586*	NM_031449.3	NP_113637.3	Q8NF64	ZMIZ2_HUMAN	zinc finger, MIZ-type containing 2	612					positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	mitochondrion (GO:0005739)|nuclear replication fork (GO:0043596)|nucleus (GO:0005634)	ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|zinc ion binding (GO:0008270)			breast(3)|endometrium(2)|kidney(3)|large_intestine(6)|lung(10)|ovary(6)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	35						GCTCCCTGCCCGAGGTCATGA	0.557																																					p.R612X	NSCLC(20;604 852 1948 16908 50522)	.											.	ZMIZ2-137	0			c.C1834T						.						95.0	104.0	101.0					7																	44802986		2193	4297	6490	SO:0001587	stop_gained	83637	exon13			CCTGCCCGAGGTC	AK090415	CCDS43576.1, CCDS43577.1, CCDS75591.1	7p13	2009-11-06			ENSG00000122515	ENSG00000122515		"""Zinc fingers, MIZ-type"""	22229	protein-coding gene	gene with protein product		611196					Standard	XM_005249866		Approved	KIAA1886, hZIMP7, ZIMP7, DKFZp761I2123, NET27	uc003tlr.3	Q8NF64	OTTHUMG00000155817	ENST00000309315.4:c.1834C>T	7.37:g.44802986C>T	ENSP00000311778:p.Arg612*	Somatic	140	1		WXS	Illumina GAIIx	Phase_I	299	41	NM_031449	0	0	50	54	4	A4D2K7|D3DVL1|O94790|Q0VGB4|Q659A8|Q6JKL5|Q8WTX8|Q96Q01|Q9BQH7	Nonsense_Mutation	SNP	ENST00000309315.4	37	CCDS43576.1	.	.	.	.	.	.	.	.	.	.	C	38	7.130784	0.98085	.	.	ENSG00000122515	ENST00000413916;ENST00000309315;ENST00000441627;ENST00000433667;ENST00000265346;ENST00000414051	.	.	.	4.82	3.93	0.45458	.	0.224065	0.28618	N	0.014720	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-6.1762	11.4094	0.49917	0.4919:0.5081:0.0:0.0	.	.	.	.	X	554;612;612;580;586;615	.	ENSP00000265346:R586X	R	+	1	2	ZMIZ2	44769511	0.997000	0.39634	0.976000	0.42696	0.949000	0.60115	1.745000	0.38278	1.255000	0.44051	0.555000	0.69702	CGA	.		0.557	ZMIZ2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341790.1	NM_031449	
ELN	2006	broad.mit.edu	37	7	73466109	73466109	+	Missense_Mutation	SNP	G	G	T			TCGA-OR-A5LO-01A-11D-A29I-10	TCGA-OR-A5LO-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	89d60dde-b03a-4cb7-b32a-5d06fa328603	4a5886aa-889d-4ef2-89a9-be2f7a06bd58	g.chr7:73466109G>T	ENST00000252034.7	+	16	1228	c.829G>T	c.(829-831)Gtt>Ttt	p.V277F	ELN_ENST00000380562.4_Missense_Mutation_p.V277F|ELN_ENST00000380576.5_Missense_Mutation_p.V277F|ELN_ENST00000429192.1_Missense_Mutation_p.V282F|ELN_ENST00000320399.6_Missense_Mutation_p.V277F|ELN_ENST00000320492.7_Missense_Mutation_p.V241F|ELN_ENST00000358929.4_Missense_Mutation_p.V277F|ELN_ENST00000458204.1_Missense_Mutation_p.V267F|ELN_ENST00000380553.4_Missense_Mutation_p.V160F|ELN_ENST00000357036.5_Missense_Mutation_p.V282F|ELN_ENST00000380584.4_Missense_Mutation_p.V263F|ELN_ENST00000414324.1_Missense_Mutation_p.V272F|ELN_ENST00000380575.4_Missense_Mutation_p.V267F|ELN_ENST00000445912.1_Missense_Mutation_p.V277F	NM_000501.2|NM_001278915.1	NP_000492.2|NP_001265844.1	P15502	ELN_HUMAN	elastin	277	Ala-rich.				blood circulation (GO:0008015)|blood vessel remodeling (GO:0001974)|cell proliferation (GO:0008283)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|organ morphogenesis (GO:0009887)|regulation of actin filament polymerization (GO:0030833)|respiratory gaseous exchange (GO:0007585)|skeletal muscle tissue development (GO:0007519)|stress fiber assembly (GO:0043149)	elastic fiber (GO:0071953)|extracellular region (GO:0005576)|mitochondrion (GO:0005739)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix binding (GO:0050840)|extracellular matrix constituent conferring elasticity (GO:0030023)|extracellular matrix structural constituent (GO:0005201)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(10)|ovary(4)|pancreas(2)|prostate(1)|skin(2)|stomach(1)	32		Lung NSC(55;0.159)				CCTCCCTGGTGTTGGAGGGGC	0.602			T	PAX5	B-ALL		"""Supravalvular Aortic Stenosis, Cutis laxa , Williams-Beuren Syndrome"""				OREG0018112	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.V282F		.		Dom	yes		7	7q11.23	2006	elastin	yes	L	.	ELN-95	0			c.G844T						.						104.0	79.0	87.0					7																	73466109		2203	4300	6503	SO:0001583	missense	2006	exon16			CCTGGTGTTGGAG		CCDS5562.2, CCDS43598.1, CCDS43599.1, CCDS47611.1, CCDS47612.1, CCDS64673.1, CCDS64674.1, CCDS64675.1, CCDS64676.1, CCDS64677.1, CCDS64678.1, CCDS75616.1, CCDS75617.1	7q11.1-q21.1	2008-08-01	2008-08-01		ENSG00000049540	ENSG00000049540			3327	protein-coding gene	gene with protein product	"""tropoelastin"", ""supravalvular aortic stenosis"", ""Williams-Beuren syndrome"""	130160				8096434	Standard	NM_001278939		Approved	WBS, WS, SVAS	uc003tzn.3	P15502	OTTHUMG00000150229	ENST00000252034.7:c.829G>T	7.37:g.73466109G>T	ENSP00000252034:p.Val277Phe	Somatic	121	0	1145	WXS	Illumina GAIIx	Phase_I	129	3	NM_001081753	0	0	9	9	0	B3KTS6|O15336|O15337|Q14233|Q14234|Q14235|Q14238|Q6P0L4|Q6ZWJ6|Q75MU5|Q7Z316|Q7Z3F5|Q9UMF5	Missense_Mutation	SNP	ENST00000252034.7	37	CCDS5562.2	.	.	.	.	.	.	.	.	.	.	G	5.943	0.358054	0.11239	.	.	ENSG00000049540	ENST00000445912;ENST00000252034;ENST00000358929;ENST00000320492;ENST00000438906;ENST00000438880;ENST00000414324;ENST00000380562;ENST00000380575;ENST00000380584;ENST00000458204;ENST00000357036;ENST00000429192;ENST00000442462;ENST00000380553;ENST00000380576;ENST00000320399	T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T	0.49139	1.28;1.26;1.3;1.06;0.79;0.81;1.37;1.26;1.34;1.34;1.26;1.3;1.32;1.15;1.35;1.26	4.61	1.64	0.23874	.	.	.	.	.	T	0.35885	0.0947	L	0.38175	1.15	0.09310	N	1	P;P;P;P;P;P;P;P;P;P;P;P;P;P	0.48016	0.904;0.815;0.835;0.904;0.904;0.904;0.904;0.904;0.904;0.904;0.904;0.904;0.904;0.904	B;B;B;B;B;B;B;B;B;B;B;B;B;B	0.42625	0.393;0.24;0.305;0.393;0.393;0.393;0.393;0.393;0.393;0.393;0.393;0.393;0.393;0.393	T	0.13656	-1.0501	9	0.48119	T	0.1	-7.4001	6.2858	0.21033	0.3658:0.0:0.6342:0.0	.	277;246;241;272;267;277;267;282;282;277;160;233;263;277	E7ENM0;E9PBM4;G5E950;G3V0G6;E7EN65;P15502-1;P15502-7;P15502-12;P15502-5;P15502-13;P15502-11;B3KRT8;P15502-8;P15502-2	.;.;.;.;.;.;.;.;.;.;.;.;.;.	F	277;277;277;241;255;138;272;277;267;263;267;282;282;246;160;277;277	ENSP00000389857:V277F;ENSP00000252034:V277F;ENSP00000351807:V277F;ENSP00000315607:V241F;ENSP00000406949:V255F;ENSP00000389206:V138F;ENSP00000392575:V272F;ENSP00000369936:V277F;ENSP00000369949:V267F;ENSP00000369958:V263F;ENSP00000403162:V267F;ENSP00000349540:V282F;ENSP00000391129:V282F;ENSP00000369926:V160F;ENSP00000369950:V277F;ENSP00000313565:V277F	ENSP00000252034:V277F	V	+	1	0	ELN	73104045	0.015000	0.18098	0.044000	0.18714	0.074000	0.17049	0.587000	0.23909	0.090000	0.17273	-0.480000	0.04831	GTT	.		0.602	ELN-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000316913.1	NM_000501	
MCM7	4176	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	99697290	99697290	+	Silent	SNP	A	A	T			TCGA-OR-A5LO-01A-11D-A29I-10	TCGA-OR-A5LO-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	89d60dde-b03a-4cb7-b32a-5d06fa328603	4a5886aa-889d-4ef2-89a9-be2f7a06bd58	g.chr7:99697290A>T	ENST00000303887.5	-	3	843	c.198T>A	c.(196-198)atT>atA	p.I66I	AP4M1_ENST00000421755.1_5'Flank|MCM7_ENST00000354230.3_De_novo_Start_OutOfFrame|AP4M1_ENST00000359593.4_5'Flank|MCM7_ENST00000343023.6_Silent_p.I66I|AP4M1_ENST00000422582.1_5'Flank|AP4M1_ENST00000429084.1_5'Flank	NM_005916.3	NP_005907.3	P33993	MCM7_HUMAN	minichromosome maintenance complex component 7	66					cell proliferation (GO:0008283)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to epidermal growth factor stimulus (GO:0071364)|DNA replication (GO:0006260)|DNA replication initiation (GO:0006270)|DNA strand elongation involved in DNA replication (GO:0006271)|DNA unwinding involved in DNA replication (GO:0006268)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)|regulation of phosphorylation (GO:0042325)|response to drug (GO:0042493)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|MCM complex (GO:0042555)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA helicase activity (GO:0003678)|single-stranded DNA binding (GO:0003697)			endometrium(1)|kidney(5)|large_intestine(5)|lung(4)|ovary(1)|stomach(1)	17	Lung NSC(181;0.0181)|all_lung(186;0.0284)|Esophageal squamous(72;0.0439)					CATTCTCACAAATTGAGTCCA	0.557																																					p.I66I		.											.	MCM7-651	0			c.T198A						.						144.0	137.0	140.0					7																	99697290		2203	4300	6503	SO:0001819	synonymous_variant	4176	exon3			CTCACAAATTGAG		CCDS5683.1, CCDS5684.1	7q21.3-q22.1	2014-06-12	2007-04-04		ENSG00000166508	ENSG00000166508			6950	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 104"""	600592	"""minichromosome maintenance deficient (S. cerevisiae) 7"", ""MCM7 minichromosome maintenance deficient 7 (S. cerevisiae)"""	MCM2		7842741	Standard	NM_005916		Approved	CDC47, PPP1R104	uc003usw.1	P33993	OTTHUMG00000154671	ENST00000303887.5:c.198T>A	7.37:g.99697290A>T		Somatic	55	0		WXS	Illumina GAIIx	Phase_I	38	6	NM_005916	0	0	15	23	8	A4D2A1|A4D2A2|E9PGN9|Q15076|Q96D34|Q96GL1	Silent	SNP	ENST00000303887.5	37	CCDS5683.1	.	.	.	.	.	.	.	.	.	.	A	12.20	1.865243	0.32977	.	.	ENSG00000166508	ENST00000542483	.	.	.	4.5	0.838	0.18902	.	.	.	.	.	T	0.54062	0.1835	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.42241	-0.9463	4	.	.	.	-0.6701	7.0721	0.25183	0.5972:0.0:0.4028:0.0	.	.	.	.	Y	9	.	.	F	-	2	0	MCM7	99535226	0.999000	0.42202	0.918000	0.36340	0.984000	0.73092	0.456000	0.21859	-0.011000	0.14247	0.455000	0.32223	TTT	.		0.557	MCM7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336534.3		
MUC17	140453	broad.mit.edu	37	7	100677627	100677627	+	Missense_Mutation	SNP	C	C	G	rs551784528	byFrequency	TCGA-OR-A5LO-01A-11D-A29I-10	TCGA-OR-A5LO-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	89d60dde-b03a-4cb7-b32a-5d06fa328603	4a5886aa-889d-4ef2-89a9-be2f7a06bd58	g.chr7:100677627C>G	ENST00000306151.4	+	3	2994	c.2930C>G	c.(2929-2931)aCt>aGt	p.T977S		NM_001040105.1	NP_001035194.1	Q685J3	MUC17_HUMAN	mucin 17, cell surface associated	977	59 X approximate tandem repeats.|Ser-rich.				cellular homeostasis (GO:0019725)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	apical plasma membrane (GO:0016324)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)	extracellular matrix constituent, lubricant activity (GO:0030197)|PDZ domain binding (GO:0030165)			NS(3)|breast(14)|central_nervous_system(2)|cervix(2)|endometrium(27)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(28)|lung(179)|ovary(19)|pancreas(1)|prostate(13)|skin(26)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(4)	343	Lung NSC(181;0.136)|all_lung(186;0.182)					CCAACCTCGACTCCTAGTGAA	0.512													C|||	4	0.000798722	0.0023	0.0014	5008	,	,		34527	0.0		0.0	False		,,,				2504	0.0				p.T977S		.											.	MUC17-95	0			c.C2930G						.						355.0	331.0	339.0					7																	100677627		2203	4300	6503	SO:0001583	missense	140453	exon3			CCTCGACTCCTAG	AJ606307	CCDS34711.1	7q22	2007-01-17	2006-03-14		ENSG00000169876	ENSG00000169876		"""Mucins"""	16800	protein-coding gene	gene with protein product		608424				11855812	Standard	NM_001040105		Approved		uc003uxp.1	Q685J3	OTTHUMG00000157030	ENST00000306151.4:c.2930C>G	7.37:g.100677627C>G	ENSP00000302716:p.Thr977Ser	Somatic	243	0		WXS	Illumina GAIIx	Phase_I	227	4	NM_001040105	0	0	0	0	0	O14761|Q685J2|Q8TDH7	Missense_Mutation	SNP	ENST00000306151.4	37	CCDS34711.1	.	.	.	.	.	.	.	.	.	.	C	1.126	-0.653807	0.03480	.	.	ENSG00000169876	ENST00000306151	T	0.02323	4.34	0.73	-0.243	0.13035	.	.	.	.	.	T	0.01320	0.0043	N	0.14661	0.345	0.09310	N	1	B	0.30851	0.297	B	0.19148	0.024	T	0.45264	-0.9273	9	0.06365	T	0.9	.	5.173	0.15120	0.0:0.7617:0.0:0.2383	.	977	Q685J3	MUC17_HUMAN	S	977	ENSP00000302716:T977S	ENSP00000302716:T977S	T	+	2	0	MUC17	100464347	0.000000	0.05858	0.003000	0.11579	0.004000	0.04260	-0.869000	0.04232	-0.074000	0.12820	-1.381000	0.01174	ACT	C|1.000;G|0.000		0.512	MUC17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347161.1	NM_001040105	
TAS2R5	54429	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	141490447	141490447	+	Missense_Mutation	SNP	G	G	T	rs142196311		TCGA-OR-A5LO-01A-11D-A29I-10	TCGA-OR-A5LO-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	89d60dde-b03a-4cb7-b32a-5d06fa328603	4a5886aa-889d-4ef2-89a9-be2f7a06bd58	g.chr7:141490447G>T	ENST00000247883.4	+	1	431	c.286G>T	c.(286-288)Gcc>Tcc	p.A96S		NM_018980.2	NP_061853.1	Q9NYW4	TA2R5_HUMAN	taste receptor, type 2, member 5	96					chemosensory behavior (GO:0007635)|detection of chemical stimulus involved in sensory perception of bitter taste (GO:0001580)|sensory perception of taste (GO:0050909)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	bitter taste receptor activity (GO:0033038)|taste receptor activity (GO:0008527)			breast(1)|endometrium(1)|large_intestine(4)|lung(2)|skin(1)	9	Melanoma(164;0.0171)					CTTATGGTTTGCCACCTTCCT	0.507																																					p.A96S		.											.	TAS2R5-90	0			c.G286T						.						87.0	83.0	84.0					7																	141490447		2203	4300	6503	SO:0001583	missense	54429	exon1			TGGTTTGCCACCT	AF227132	CCDS5869.1	7q31.3-q32	2012-08-22			ENSG00000127366	ENSG00000127366		"""Taste receptors / Type 2"", ""GPCR / Unclassified : Taste receptors"""	14912	protein-coding gene	gene with protein product		605062					Standard	NM_018980		Approved	T2R5	uc003vwr.1	Q9NYW4	OTTHUMG00000157632	ENST00000247883.4:c.286G>T	7.37:g.141490447G>T	ENSP00000247883:p.Ala96Ser	Somatic	138	0		WXS	Illumina GAIIx	Phase_I	118	31	NM_018980	0	0	0	0	0	Q645W0|Q75MV7	Missense_Mutation	SNP	ENST00000247883.4	37	CCDS5869.1	.	.	.	.	.	.	.	.	.	.	G	18.79	3.699118	0.68501	.	.	ENSG00000127366	ENST00000247883	T	0.37411	1.2	4.24	2.37	0.29283	.	.	.	.	.	T	0.50137	0.1598	L	0.56199	1.76	0.24214	N	0.995462	D	0.89917	1.0	D	0.83275	0.996	T	0.22906	-1.0203	9	0.72032	D	0.01	.	6.647	0.22941	0.2275:0.0:0.7725:0.0	.	96	Q9NYW4	TA2R5_HUMAN	S	96	ENSP00000247883:A96S	ENSP00000247883:A96S	A	+	1	0	TAS2R5	141136916	0.779000	0.28652	0.997000	0.53966	0.943000	0.58893	0.813000	0.27225	1.005000	0.39183	0.561000	0.74099	GCC	G|1.000;A|0.000		0.507	TAS2R5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349283.1		
NOS3	4846	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	150696313	150696313	+	Missense_Mutation	SNP	A	A	G			TCGA-OR-A5LO-01A-11D-A29I-10	TCGA-OR-A5LO-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	89d60dde-b03a-4cb7-b32a-5d06fa328603	4a5886aa-889d-4ef2-89a9-be2f7a06bd58	g.chr7:150696313A>G	ENST00000484524.1	+	8	992	c.992A>G	c.(991-993)tAc>tGc	p.Y331C	NOS3_ENST00000297494.3_Missense_Mutation_p.Y331C|NOS3_ENST00000461406.1_Missense_Mutation_p.Y125C|NOS3_ENST00000467517.1_Missense_Mutation_p.Y331C	NM_001160111.1	NP_001153583.1	P60323	NANO3_HUMAN	nitric oxide synthase 3 (endothelial cell)	0					germ cell development (GO:0007281)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic signaling pathway (GO:2001234)|oogenesis (GO:0048477)|regulation of cell cycle (GO:0051726)|regulation of translation (GO:0006417)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|cytoplasmic mRNA processing body (GO:0000932)|cytoplasmic stress granule (GO:0010494)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	RNA binding (GO:0003723)|zinc ion binding (GO:0008270)			NS(3)|breast(3)|central_nervous_system(5)|endometrium(1)|kidney(4)|large_intestine(6)|liver(2)|lung(11)|ovary(3)|prostate(3)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	50	all_neural(206;0.219)		OV - Ovarian serous cystadenocarcinoma(82;0.0121)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)		CTGCGCTGGTACGCCCTCCCG	0.647																																					p.Y331C		.											.	NOS3-1011	0			c.A992G						.						60.0	67.0	64.0					7																	150696313		2201	4294	6495	SO:0001583	missense	4846	exon8			GCTGGTACGCCCT		CCDS5912.1, CCDS55182.1, CCDS55183.1	7q36	2007-02-15			ENSG00000164867	ENSG00000164867	1.14.13.39		7876	protein-coding gene	gene with protein product	"""endothelial nitric oxide synthase"""	163729				1379542	Standard	NM_000603		Approved	ECNOS, eNOS	uc003wif.3	P29474	OTTHUMG00000158343	ENST00000484524.1:c.992A>G	7.37:g.150696313A>G	ENSP00000420215:p.Tyr331Cys	Somatic	57	0		WXS	Illumina GAIIx	Phase_I	65	36	NM_001160111	0	0	2	5	3	Q495E5	Missense_Mutation	SNP	ENST00000484524.1	37	CCDS55182.1	.	.	.	.	.	.	.	.	.	.	N	21.3	4.124114	0.77436	.	.	ENSG00000164867	ENST00000297494;ENST00000461406;ENST00000484524;ENST00000467517	T;T;T;T	0.33438	1.41;1.46;1.41;1.41	5.59	5.59	0.84812	Nitric oxide synthase, oxygenase domain (2);	0.000000	0.56097	D	0.000040	T	0.63581	0.2523	M	0.91196	3.185	0.58432	D	0.999997	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.97110	0.986;0.999;1.0;1.0;0.988	T	0.72523	-0.4267	10	0.87932	D	0	-17.7669	13.733	0.62799	1.0:0.0:0.0:0.0	.	331;331;331;125;331	A0S0A6;E9PFR2;A0S0A8;E7ESA7;P29474	.;.;.;.;NOS3_HUMAN	C	331;125;331;331	ENSP00000297494:Y331C;ENSP00000417143:Y125C;ENSP00000420215:Y331C;ENSP00000420551:Y331C	ENSP00000297494:Y331C	Y	+	2	0	NOS3	150327246	1.000000	0.71417	0.976000	0.42696	0.897000	0.52465	9.339000	0.96797	2.119000	0.64992	0.520000	0.50463	TAC	.		0.647	NOS3-004	NOVEL	basic|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000351550.1	NM_000603	
NEFL	4747	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	24811264	24811264	+	RNA	SNP	C	C	T			TCGA-OR-A5LO-01A-11D-A29I-10	TCGA-OR-A5LO-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	89d60dde-b03a-4cb7-b32a-5d06fa328603	4a5886aa-889d-4ef2-89a9-be2f7a06bd58	g.chr8:24811264C>T	ENST00000221169.5	-	0	1809				CTD-2168K21.2_ENST00000607735.1_RNA			P07196	NFL_HUMAN	neurofilament, light polypeptide						anterograde axon cargo transport (GO:0008089)|axon transport of mitochondrion (GO:0019896)|cell death (GO:0008219)|intermediate filament organization (GO:0045109)|locomotion (GO:0040011)|microtubule cytoskeleton organization (GO:0000226)|negative regulation of neuron apoptotic process (GO:0043524)|neurofilament bundle assembly (GO:0033693)|neuromuscular process controlling balance (GO:0050885)|neuron projection morphogenesis (GO:0048812)|peripheral nervous system axon regeneration (GO:0014012)|positive regulation of axonogenesis (GO:0050772)|protein polymerization (GO:0051258)|regulation of axon diameter (GO:0031133)|response to corticosterone (GO:0051412)|response to peptide hormone (GO:0043434)|response to toxic substance (GO:0009636)|retrograde axon cargo transport (GO:0008090)|synaptic transmission (GO:0007268)	axon (GO:0030424)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|growth cone (GO:0030426)|neurofilament (GO:0005883)	identical protein binding (GO:0042802)|protein binding, bridging (GO:0030674)|protein C-terminus binding (GO:0008022)|structural constituent of cytoskeleton (GO:0005200)			central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(5)|ovary(1)|prostate(1)|skin(2)	21		Ovarian(32;0.00965)|Prostate(55;0.157)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0197)|Epithelial(17;2.44e-10)|Colorectal(74;0.0108)|COAD - Colon adenocarcinoma(73;0.0375)		TTATGCTTCCCACGCTGGTGA	0.542																																					p.V405V		.											.	NEFL-24	0			c.G1215A						.						34.0	39.0	37.0					8																	24811264		1966	4171	6137			4747	exon3			GCTTCCCACGCTG		CCDS75712.1	8p21.2	2014-09-17	2008-09-19		ENSG00000104725	ENSG00000277586		"""Intermediate filaments type IV"""	7739	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 110"""	162280	"""neurofilament, light polypeptide 68kDa"""			17620486, 3145240	Standard	NM_006158		Approved	NFL, CMT1F, CMT2E, NF68, PPP1R110	uc003xee.4	P07196	OTTHUMG00000134284		8.37:g.24811264C>T		Somatic	86	0		WXS	Illumina GAIIx	Phase_I	65	52	NM_006158	0	0	0	215	215	B9ZVN2|Q16154|Q8IU72	Silent	SNP	ENST00000221169.5	37																																																																																				.		0.542	NEFL-001	KNOWN	sequence_error|basic	processed_transcript	processed_transcript	OTTHUMT00000258943.4	NM_006158	
GPR124	25960	hgsc.bcm.edu	37	8	37699516	37699516	+	Silent	SNP	C	C	T	rs7010546	byFrequency	TCGA-OR-A5LO-01A-11D-A29I-10	TCGA-OR-A5LO-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	89d60dde-b03a-4cb7-b32a-5d06fa328603	4a5886aa-889d-4ef2-89a9-be2f7a06bd58	g.chr8:37699516C>T	ENST00000412232.2	+	19	3673	c.3660C>T	c.(3658-3660)ggC>ggT	p.G1220G	GPR124_ENST00000315215.7_Silent_p.G1003G	NM_032777.9	NP_116166.9	Q96PE1	GP124_HUMAN	G protein-coupled receptor 124	1220					central nervous system development (GO:0007417)|endothelial cell migration (GO:0043542)|G-protein coupled receptor signaling pathway (GO:0007186)|negative regulation of vascular endothelial growth factor signaling pathway (GO:1900747)|neuropeptide signaling pathway (GO:0007218)|positive regulation of endothelial cell migration (GO:0010595)|regulation of angiogenesis (GO:0045765)|regulation of chemotaxis (GO:0050920)|regulation of establishment of blood-brain barrier (GO:0090210)|sprouting angiogenesis (GO:0002040)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(4)|lung(16)|ovary(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	37			BRCA - Breast invasive adenocarcinoma(5;2.75e-24)|LUSC - Lung squamous cell carcinoma(8;3.5e-10)			GCGAGAGCGGCAGTCTGCACA	0.746													C|||	2324	0.464058	0.3048	0.5144	5008	,	,		7503	0.6716		0.4165	False		,,,				2504	0.4785				p.G1220G		.											.	GPR124-157	0			c.C3660T						.	C		594,1854		106,382,736	2.0	3.0	2.0		3660	3.1	1.0	8	dbSNP_116	2	1524,3502		291,942,1280	no	coding-synonymous	GPR124	NM_032777.9		397,1324,2016	TT,TC,CC		30.3223,24.2647,28.3382		1220/1339	37699516	2118,5356	1224	2513	3737	SO:0001819	synonymous_variant	25960	exon19			GAGCGGCAGTCTG	AB040964	CCDS6097.2	8p11.22	2014-08-08			ENSG00000020181	ENSG00000020181		"""-"", ""GPCR / Class B : Orphans"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	17849	protein-coding gene	gene with protein product	"""tumor endothelial marker 5"""	606823				11559528, 12565841	Standard	NM_032777		Approved	TEM5, DKFZp434C211, DKFZp434J0911, KIAA1531, FLJ14390	uc003xkj.3	Q96PE1	OTTHUMG00000156182	ENST00000412232.2:c.3660C>T	8.37:g.37699516C>T		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	6	6	NM_032777	0	0	0	0	0	A6H8W3|D3DSW4|Q8N3R1|Q8TEM3|Q96KB2|Q9P1Z7|Q9UFY4	Silent	SNP	ENST00000412232.2	37	CCDS6097.2	1050	0.4807692307692308	166	0.33739837398373984	169	0.46685082872928174	397	0.6940559440559441	318	0.41952506596306066	C	4.050	0.006880	0.07866	0.242647	0.303223	ENSG00000020181	ENST00000416514	.	.	.	3.95	3.07	0.35406	.	.	.	.	.	.	.	.	.	.	.	0.09310	P	0.9999999999997394	.	.	.	.	.	.	.	.	.	.	0.10111	T	0.7	-18.0593	4.3087	0.10960	0.1378:0.5532:0.2174:0.0916	rs7010546;rs59434562;rs7010546	.	.	.	X	1213	.	ENSP00000405145:Q1213X	Q	+	1	0	GPR124	37818674	0.843000	0.29541	1.000000	0.80357	0.388000	0.30384	-0.114000	0.10757	0.874000	0.35823	0.313000	0.20887	CAG	C|0.479;G|0.000;T|0.520		0.746	GPR124-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000343331.2		
OPRK1	4986	hgsc.bcm.edu	37	8	54163562	54163562	+	Silent	SNP	C	C	A	rs1051660	byFrequency	TCGA-OR-A5LO-01A-11D-A29I-10	TCGA-OR-A5LO-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	89d60dde-b03a-4cb7-b32a-5d06fa328603	4a5886aa-889d-4ef2-89a9-be2f7a06bd58	g.chr8:54163562C>A	ENST00000265572.3	-	2	333	c.36G>T	c.(34-36)ccG>ccT	p.P12P	OPRK1_ENST00000520287.1_Silent_p.P12P	NM_000912.3	NP_000903.2	P41145	OPRK_HUMAN	opioid receptor, kappa 1	12					adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|adenylate cyclase-inhibiting opioid receptor signaling pathway (GO:0031635)|behavior (GO:0007610)|defense response to virus (GO:0051607)|immune response (GO:0006955)|locomotory behavior (GO:0007626)|opioid receptor signaling pathway (GO:0038003)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|regulation of saliva secretion (GO:0046877)|sensory perception (GO:0007600)|sensory perception of pain (GO:0019233)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	dynorphin receptor activity (GO:0038048)|opioid receptor activity (GO:0004985)			NS(2)|breast(3)|endometrium(3)|kidney(12)|large_intestine(7)|lung(8)|ovary(1)|prostate(1)|skin(5)|urinary_tract(1)	43		all_epithelial(80;0.066)|Lung NSC(129;0.0804)|all_lung(136;0.136)			Alvimopan(DB06274)|Amitriptyline(DB00321)|Buprenorphine(DB00921)|Butorphanol(DB00611)|Codeine(DB00318)|Dextromethorphan(DB00514)|Dextropropoxyphene(DB00647)|Dezocine(DB01209)|Fentanyl(DB00813)|Heroin(DB01452)|Hydromorphone(DB00327)|Ketamine(DB01221)|Ketobemidone(DB06738)|Levorphanol(DB00854)|Loperamide(DB00836)|Menthol(DB00825)|Methylnaltrexone(DB06800)|Mianserin(DB06148)|Mirtazapine(DB00370)|Morphine(DB00295)|Nalbuphine(DB00844)|Naloxone(DB01183)|Naltrexone(DB00704)|Oxycodone(DB00497)|Pentazocine(DB00652)|Pethidine(DB00454)|Progesterone(DB00396)|Remifentanil(DB00899)|Sufentanil(DB00708)|Tapentadol(DB06204)|Tramadol(DB00193)	AGGTAGGGCCCGGCTCCCCGC	0.726													c|||	573	0.114417	0.0968	0.0476	5008	,	,		11885	0.1478		0.0785	False		,,,				2504	0.1881				p.P12P		.											.	OPRK1-70	0			c.G36T	GRCh37	CM074395	OPRK1	M	rs1051660	.			392,3590		20,352,1619	6.0	9.0	8.0		36	-1.5	0.1	8	dbSNP_86	8	701,7415		24,653,3381	no	coding-synonymous	OPRK1	NM_000912.3		44,1005,5000	AA,AC,CC		8.6373,9.8443,9.0346		12/381	54163562	1093,11005	1991	4058	6049	SO:0001819	synonymous_variant	4986	exon2			AGGGCCCGGCTCC		CCDS6152.1, CCDS64895.1	8q11.2	2014-05-21			ENSG00000082556	ENSG00000082556		"""GPCR / Class A : Opioid receptors"""	8154	protein-coding gene	gene with protein product		165196				8188308	Standard	XM_005251252		Approved	KOR, OPRK	uc003xri.1	P41145	OTTHUMG00000164276	ENST00000265572.3:c.36G>T	8.37:g.54163562C>A		Somatic	1	0		WXS	Illumina GAIIx	Phase_I	13	10	NM_000912	0	0	0	0	0	E5RHC9|Q499G4	Silent	SNP	ENST00000265572.3	37	CCDS6152.1																																																																																			C|0.895;A|0.105		0.726	OPRK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378048.1		
PREX2	80243	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	69020559	69020559	+	Silent	SNP	G	G	A	rs570753617		TCGA-OR-A5LO-01A-11D-A29I-10	TCGA-OR-A5LO-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	89d60dde-b03a-4cb7-b32a-5d06fa328603	4a5886aa-889d-4ef2-89a9-be2f7a06bd58	g.chr8:69020559G>A	ENST00000288368.4	+	24	3208	c.2931G>A	c.(2929-2931)tcG>tcA	p.S977S		NM_024870.2|NM_025170.4	NP_079146.2|NP_079446.3	Q70Z35	PREX2_HUMAN	phosphatidylinositol-3,4,5-trisphosphate-dependent Rac exchange factor 2	977					adult locomotory behavior (GO:0008344)|dendrite morphogenesis (GO:0048813)|G-protein coupled receptor signaling pathway (GO:0007186)|intracellular signal transduction (GO:0035556)|positive regulation of Rac GTPase activity (GO:0032855)		Rac GTPase activator activity (GO:0030675)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)			NS(6)|biliary_tract(1)|breast(4)|endometrium(11)|kidney(16)|large_intestine(25)|liver(4)|lung(57)|ovary(2)|pancreas(4)|prostate(3)|skin(42)|upper_aerodigestive_tract(1)|urinary_tract(2)	178						ACAAATCTTCGGAGCAAGGTA	0.363													G|||	1	0.000199681	0.0	0.0014	5008	,	,		20845	0.0		0.0	False		,,,				2504	0.0				p.S977S		.											.	PREX2-390	0			c.G2931A						.						82.0	81.0	81.0					8																	69020559		2203	4300	6503	SO:0001819	synonymous_variant	80243	exon24			ATCTTCGGAGCAA	AK024079	CCDS6201.1	8q13.1	2014-06-13	2008-09-15	2008-09-15	ENSG00000046889	ENSG00000046889		"""Rho guanine nucleotide exchange factors"""	22950	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 129"""	612139	"""DEP domain containing 2"""	DEPDC2		15304342, 15304343	Standard	NM_024870		Approved	DEP.2, FLJ12987, P-REX2, PPP1R129	uc003xxv.1	Q70Z35	OTTHUMG00000164402	ENST00000288368.4:c.2931G>A	8.37:g.69020559G>A		Somatic	74	0		WXS	Illumina GAIIx	Phase_I	63	22	NM_024870	0	0	0	0	0	B4DFX0|Q32KL0|Q32KL1|Q6R7Q3|Q6R7Q4|Q9H805|Q9H961	Silent	SNP	ENST00000288368.4	37	CCDS6201.1																																																																																			.		0.363	PREX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378620.1	NM_025170	
JRK	8629	bcgsc.ca	37	8	143746416	143746416	+	RNA	SNP	A	A	G	rs754957	byFrequency	TCGA-OR-A5LO-01A-11D-A29I-10	TCGA-OR-A5LO-10A-01D-A29L-10	A	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	89d60dde-b03a-4cb7-b32a-5d06fa328603	4a5886aa-889d-4ef2-89a9-be2f7a06bd58	g.chr8:143746416A>G	ENST00000507178.2	-	0	1394							O75564	JERKY_HUMAN	Jrk homolog (mouse)							nucleus (GO:0005634)	DNA binding (GO:0003677)					all_cancers(97;3.96e-12)|all_epithelial(106;1.19e-08)|Lung NSC(106;0.000413)|all_lung(105;0.00106)|Medulloblastoma(13;0.00276)|all_neural(13;0.00559)|Ovarian(258;0.0254)|Acute lymphoblastic leukemia(118;0.155)	Acute lymphoblastic leukemia(644;2.31e-05)				tgtagcgggcatgggggccct	0.612													G|||	2671	0.533347	0.7209	0.3213	5008	,	,		18399	0.5188		0.3917	False		,,,				2504	0.591				p.H354H		.											.	.	0			c.T1062C						.	G	,	2462,1536		789,884,326	8.0	9.0	9.0		1062,1062	-0.7	0.0	8	dbSNP_86	9	3105,5209		657,1791,1709	yes	coding-synonymous,coding-synonymous	JRK	NM_001077527.1,NM_003724.2	,	1446,2675,2035	GG,GA,AA		37.3466,38.4192,45.216	,	354/557,354/569	143746416	5567,6745	1999	4157	6156			8629	exon2			GCGGGCATGGGGG	AF072467	CCDS75796.1, CCDS75797.1	8q24.3	2014-03-28	2014-03-28			ENSG00000234616			6199	protein-coding gene	gene with protein product		603210	"""jerky (mouse) homolog"", ""jerky homolog (mouse)"""			9675132	Standard	NM_003724		Approved	JH8, jerky	uc003ywo.3	O75564			8.37:g.143746416A>G		Somatic	139	0		WXS	Illumina GAIIx	Phase_I	96	5	NM_003724	0	0	1	1	0	O75565	Silent	SNP	ENST00000507178.2	37																																																																																				A|0.477;G|0.523		0.612	JRK-003	KNOWN	basic	processed_transcript	processed_transcript	OTTHUMT00000362914.1	NM_003724	
GNE	10020	broad.mit.edu;ucsc.edu;bcgsc.ca	37	9	36217454	36217454	+	Missense_Mutation	SNP	C	C	G			TCGA-OR-A5LO-01A-11D-A29I-10	TCGA-OR-A5LO-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	89d60dde-b03a-4cb7-b32a-5d06fa328603	4a5886aa-889d-4ef2-89a9-be2f7a06bd58	g.chr9:36217454C>G	ENST00000539815.1	-	11	2117	c.2077G>C	c.(2077-2079)Gac>Cac	p.D693H	GNE_ENST00000396594.3_Missense_Mutation_p.D724H|GNE_ENST00000377902.5_Missense_Mutation_p.D693H|GNE_ENST00000539208.1_Missense_Mutation_p.D583H|GNE_ENST00000447283.2_Missense_Mutation_p.D619H|GNE_ENST00000543356.2_Missense_Mutation_p.D688H			Q9Y223	GLCNE_HUMAN	glucosamine (UDP-N-acetyl)-2-epimerase/N-acetylmannosamine kinase	693	N-acetylmannosamine kinase.				carbohydrate phosphorylation (GO:0046835)|cell adhesion (GO:0007155)|N-acetylglucosamine biosynthetic process (GO:0006045)|N-acetylneuraminate metabolic process (GO:0006054)|UDP-N-acetylglucosamine metabolic process (GO:0006047)	cytoplasm (GO:0005737)|cytosol (GO:0005829)	ATP binding (GO:0005524)|hydrolase activity, hydrolyzing O-glycosyl compounds (GO:0004553)|metal ion binding (GO:0046872)|N-acylmannosamine kinase activity (GO:0009384)|UDP-N-acetylglucosamine 2-epimerase activity (GO:0008761)			endometrium(8)|kidney(1)|large_intestine(3)|lung(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	19			STAD - Stomach adenocarcinoma(86;0.228)			ACATCCACGTCCTGCACGGAG	0.562																																					p.D724H	GBM(184;106 2118 20004 35750 50727)	.											.	GNE-115	0			c.G2170C						.						131.0	95.0	107.0					9																	36217454		2203	4300	6503	SO:0001583	missense	10020	exon12			CCACGTCCTGCAC	AF051852	CCDS6602.1, CCDS47965.1, CCDS55308.1, CCDS55309.1, CCDS55310.1	9p13.1	2008-02-05	2003-12-01		ENSG00000159921	ENSG00000159921			23657	protein-coding gene	gene with protein product		603824	"""UDP-N-acetylglucosamine-2-epimerase/N-acetylmannosamine kinase"""	IBM2		9305887, 9305888	Standard	NM_005476		Approved	Uae1	uc010mli.3	Q9Y223	OTTHUMG00000019899	ENST00000539815.1:c.2077G>C	9.37:g.36217454C>G	ENSP00000439155:p.Asp693His	Somatic	169	1		WXS	Illumina GAIIx	Phase_I	140	50	NM_001128227	0	0	20	31	11	A6PZH2|A6PZH3|A7UNU7|B2R6E1|B7Z372|B7Z428|D3DRP7|F5H499|H0YFA7|Q0VA94	Missense_Mutation	SNP	ENST00000539815.1	37	CCDS6602.1	.	.	.	.	.	.	.	.	.	.	C	15.45	2.836207	0.50951	.	.	ENSG00000159921	ENST00000377902;ENST00000396594;ENST00000339267;ENST00000539815;ENST00000543356;ENST00000539208;ENST00000447283	D;D;D;D;D	0.99578	-4.83;-4.83;-4.83;-4.83;-6.21	5.67	4.67	0.58626	.	0.363482	0.33631	N	0.004709	D	0.97371	0.9140	N	0.21373	0.66	0.31358	N	0.681689	B;B;B;B;B	0.29862	0.002;0.259;0.259;0.053;0.119	B;B;B;B;B	0.28139	0.002;0.086;0.086;0.039;0.07	D	0.95688	0.8738	10	0.56958	D	0.05	-6.8645	5.2737	0.15638	0.0:0.7647:0.0:0.2353	.	583;652;724;693;619	F5H499;Q9Y223-3;Q9Y223-2;Q9Y223;A7UNU7	.;.;.;GLCNE_HUMAN;.	H	693;724;688;693;665;583;619	ENSP00000367134:D693H;ENSP00000379839:D724H;ENSP00000439155:D693H;ENSP00000445117:D583H;ENSP00000414760:D619H	ENSP00000340770:D688H	D	-	1	0	GNE	36207454	1.000000	0.71417	1.000000	0.80357	0.889000	0.51656	2.884000	0.48562	2.681000	0.91329	0.561000	0.74099	GAC	.		0.562	GNE-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052412.4	NM_005476	
KIAA1958	158405	ucsc.edu;bcgsc.ca	37	9	115421992	115421992	+	Silent	SNP	G	G	A			TCGA-OR-A5LO-01A-11D-A29I-10	TCGA-OR-A5LO-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	89d60dde-b03a-4cb7-b32a-5d06fa328603	4a5886aa-889d-4ef2-89a9-be2f7a06bd58	g.chr9:115421992G>A	ENST00000337530.6	+	4	2090	c.1794G>A	c.(1792-1794)acG>acA	p.T598T	KIAA1958_ENST00000536272.1_Silent_p.T626T	NM_133465.2	NP_597722.1	Q8N8K9	K1958_HUMAN	KIAA1958	598										endometrium(1)|large_intestine(9)|lung(10)|prostate(2)|skin(3)	25						TTGCCCGGACGGACAGCGTCA	0.582																																					p.T598T		.											.	KIAA1958-91	0			c.G1794A						.						69.0	67.0	68.0					9																	115421992		2203	4300	6503	SO:0001819	synonymous_variant	158405	exon4			CCGGACGGACAGC	AB075838	CCDS35108.1, CCDS69642.1	9q33.1	2009-09-22			ENSG00000165185	ENSG00000165185			23427	protein-coding gene	gene with protein product							Standard	NM_001287038		Approved	FLJ39294	uc004bgf.1	Q8N8K9	OTTHUMG00000020508	ENST00000337530.6:c.1794G>A	9.37:g.115421992G>A		Somatic	194	2		WXS	Illumina GAIIx	Phase_I	165	75	NM_133465	0	0	3	5	2	B7ZKW6|Q2M336|Q5T252|Q8TF43|Q96N02	Silent	SNP	ENST00000337530.6	37	CCDS35108.1																																																																																			.		0.582	KIAA1958-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000053690.1	NM_133465	
GPSM1	26086	broad.mit.edu	37	9	139244081	139244081	+	Missense_Mutation	SNP	C	C	G			TCGA-OR-A5LO-01A-11D-A29I-10	TCGA-OR-A5LO-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	89d60dde-b03a-4cb7-b32a-5d06fa328603	4a5886aa-889d-4ef2-89a9-be2f7a06bd58	g.chr9:139244081C>G	ENST00000440944.1	+	11	1541	c.1321C>G	c.(1321-1323)Ccc>Gcc	p.P441A		NM_001145638.1	NP_001139110	Q86YR5	GPSM1_HUMAN	G-protein signaling modulator 1	441	Interaction with STK11/LKB1. {ECO:0000250}.|Mediates association with membranes. {ECO:0000250}.				cell differentiation (GO:0030154)|nervous system development (GO:0007399)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)	GDP-dissociation inhibitor activity (GO:0005092)			biliary_tract(1)|endometrium(1)|kidney(2)|lung(4)|upper_aerodigestive_tract(1)	9		Myeloproliferative disorder(178;0.0821)		OV - Ovarian serous cystadenocarcinoma(145;2.39e-06)|Epithelial(140;3.24e-06)		CTGGCGGGGGCCCAGCAGGGA	0.672																																					p.P441A		.											.	GPSM1-90	0			c.C1321G						.						10.0	8.0	9.0					9																	139244081		1912	3854	5766	SO:0001583	missense	26086	exon11			CGGGGGCCCAGCA	AI272212	CCDS6996.2, CCDS48055.1, CCDS48056.1	9q34.3	2013-01-10	2010-06-24		ENSG00000160360	ENSG00000160360		"""Tetratricopeptide (TTC) repeat domain containing"""	17858	protein-coding gene	gene with protein product	"""AGS3 homolog (C. elegans)"""	609491	"""G-protein signalling modulator 1 (AGS3-like, C. elegans)"""			11278352, 10969064	Standard	NM_001145639		Approved	AGS3, DKFZP727I051	uc004chd.2	Q86YR5	OTTHUMG00000020930	ENST00000440944.1:c.1321C>G	9.37:g.139244081C>G	ENSP00000392828:p.Pro441Ala	Somatic	149	10		WXS	Illumina GAIIx	Phase_I	116	16	NM_001145638	0	0	1	1	0	A9Z1X4|B1B0W3|Q86SR5|Q969T1|Q9UFS8	Missense_Mutation	SNP	ENST00000440944.1	37	CCDS48055.1	.	.	.	.	.	.	.	.	.	.	C	4.392	0.072409	0.08436	.	.	ENSG00000160360	ENST00000440944;ENST00000354753	D;D	0.89617	-2.54;-2.54	4.62	1.4	0.22301	.	1.757100	0.02738	N	0.115901	T	0.77928	0.4204	N	0.14661	0.345	0.26310	N	0.977848	B	0.02656	0.0	B	0.01281	0.0	T	0.65286	-0.6205	10	0.24483	T	0.36	-16.6286	2.1338	0.03756	0.3465:0.3824:0.1686:0.1024	.	441	Q86YR5	GPSM1_HUMAN	A	441;418	ENSP00000392828:P441A;ENSP00000346797:P418A	ENSP00000346797:P418A	P	+	1	0	GPSM1	138363902	0.000000	0.05858	0.666000	0.29783	0.999000	0.98932	0.230000	0.17852	0.998000	0.38996	0.655000	0.94253	CCC	.		0.672	GPSM1-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_015597	
NOXA1	10811	hgsc.bcm.edu	37	9	140317999	140317999	+	Missense_Mutation	SNP	C	C	G	rs112864733	byFrequency	TCGA-OR-A5LO-01A-11D-A29I-10	TCGA-OR-A5LO-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	89d60dde-b03a-4cb7-b32a-5d06fa328603	4a5886aa-889d-4ef2-89a9-be2f7a06bd58	g.chr9:140317999C>G	ENST00000341349.2	+	1	198	c.18C>G	c.(16-18)gaC>gaG	p.D6E	EXD3_ENST00000340951.4_5'Flank|EXD3_ENST00000475006.1_5'Flank|snoU13_ENST00000606918.1_RNA|EXD3_ENST00000465160.2_5'Flank|EXD3_ENST00000342129.4_5'Flank|NOXA1_ENST00000392815.2_Missense_Mutation_p.D6E|EXD3_ENST00000479452.1_5'Flank	NM_001256067.1|NM_006647.1	NP_001242996.1|NP_006638.1	Q86UR1	NOXA1_HUMAN	NADPH oxidase activator 1	6	Mediates interaction with RAC1.				positive regulation of catalytic activity (GO:0043085)|regulation of hydrogen peroxide metabolic process (GO:0010310)|regulation of respiratory burst (GO:0060263)|superoxide metabolic process (GO:0006801)	cytoplasm (GO:0005737)|NADPH oxidase complex (GO:0043020)	enzyme binding (GO:0019899)|Rac GTPase binding (GO:0048365)|SH3 domain binding (GO:0017124)|superoxide-generating NADPH oxidase activator activity (GO:0016176)			cervix(1)|large_intestine(2)|lung(2)|skin(3)|upper_aerodigestive_tract(1)	9	all_cancers(76;0.0926)			OV - Ovarian serous cystadenocarcinoma(145;0.000238)|Epithelial(140;0.000982)		CTCTGGGGGACCTGGTGCGCG	0.811													c|||	278	0.0555112	0.0401	0.049	5008	,	,		6061	0.005		0.1213	False		,,,				2504	0.0654				p.D6E		.											.	NOXA1-90	0			c.C18G						.		GLU/ASP	116,3312		1,114,1599	4.0	5.0	5.0		18	-2.8	0.8	9	dbSNP_132	5	595,6781		18,559,3111	no	missense	NOXA1	NM_006647.1	45	19,673,4710	GG,GC,CC		8.0667,3.3839,6.5809	probably-damaging	6/484	140317999	711,10093	1714	3688	5402	SO:0001583	missense	10811	exon1			GGGGGACCTGGTG	AF039697	CCDS7042.1, CCDS59157.1	9q34.3	2013-09-20	2002-12-09	2002-12-13	ENSG00000188747	ENSG00000188747			10668	protein-coding gene	gene with protein product		611255	"""serologically defined colon cancer antigen 31"""	SDCCAG31		9610721	Standard	NM_001256067		Approved	NY-CO-31, FLJ25475	uc004cmu.3	Q86UR1	OTTHUMG00000131781	ENST00000341349.2:c.18C>G	9.37:g.140317999C>G	ENSP00000342848:p.Asp6Glu	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	6	6	NM_006647	0	0	0	0	0	O60533|Q29VU9|Q29VV0|Q2TAM1|Q8IUS3	Missense_Mutation	SNP	ENST00000341349.2	37	CCDS7042.1	143	0.06547619047619048	20	0.04065040650406504	22	0.06077348066298342	4	0.006993006993006993	97	0.1279683377308707	c	14.61	2.587081	0.46110	0.033839	0.080667	ENSG00000188747	ENST00000341349;ENST00000392815	D;D	0.86627	-1.91;-2.15	4.24	-2.81	0.05805	.	0.176261	0.47455	D	0.000234	T	0.02230	0.0069	L	0.27053	0.805	0.58432	P	2.9999999999752447E-6	P;B;B	0.48230	0.907;0.24;0.201	P;B;B	0.48795	0.59;0.05;0.094	T	0.64118	-0.6482	9	0.02654	T	1	.	5.957	0.19279	0.0:0.3375:0.4365:0.2261	.	6;6;6	Q86UR1-3;Q86UR1;Q86UR1-2	.;NOXA1_HUMAN;.	E	6	ENSP00000342848:D6E;ENSP00000376562:D6E	ENSP00000342848:D6E	D	+	3	2	NOXA1	139437820	0.486000	0.25980	0.844000	0.33320	0.587000	0.36485	-0.046000	0.11983	-0.407000	0.07576	0.387000	0.25754	GAC	C|0.934;G|0.066		0.811	NOXA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254713.1		
KLHL15	80311	hgsc.bcm.edu;bcgsc.ca	37	X	24006761	24006763	+	In_Frame_Del	DEL	ATC	ATC	-			TCGA-OR-A5LO-01A-11D-A29I-10	TCGA-OR-A5LO-10A-01D-A29L-10	ATC	ATC	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	89d60dde-b03a-4cb7-b32a-5d06fa328603	4a5886aa-889d-4ef2-89a9-be2f7a06bd58	g.chrX:24006761_24006763delATC	ENST00000328046.8	-	4	1345_1347	c.1090_1092delGAT	c.(1090-1092)gatdel	p.D364del		NM_030624.2	NP_085127.2	Q96M94	KLH15_HUMAN	kelch-like family member 15	364					protein ubiquitination (GO:0016567)					autonomic_ganglia(1)|breast(1)|endometrium(8)|kidney(2)|large_intestine(3)|lung(6)|ovary(1)	22						GTACAGACATATCTGCCATCTGC	0.488																																					p.364_364del		.											.	KLHL15-131	0			c.1090_1092del						.																																			SO:0001651	inframe_deletion	80311	exon4			AGACATATCTGCC	AB051464	CCDS35217.1	Xp22.1-p21	2013-01-30	2013-01-30		ENSG00000174010	ENSG00000174010		"""Kelch-like"", ""BTB/POZ domain containing"""	29347	protein-coding gene	gene with protein product			"""kelch-like 15 (Drosophila)"""			11214970, 14702039	Standard	NM_030624		Approved	KIAA1677	uc004dba.4	Q96M94	OTTHUMG00000021261	ENST00000328046.8:c.1090_1092delGAT	X.37:g.24006761_24006763delATC	ENSP00000332791:p.Asp364del	Somatic	166	1		WXS	Illumina GAIIx	Phase_I	231	103	NM_030624	0	0	0	0	0	Q32MN3|Q8NDA3|Q96BM6|Q9C0I6	In_Frame_Del	DEL	ENST00000328046.8	37	CCDS35217.1																																																																																			.		0.488	KLHL15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056078.1	XM_040383	
CXorf21	80231	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	30577888	30577888	+	Silent	SNP	C	C	T			TCGA-OR-A5LO-01A-11D-A29I-10	TCGA-OR-A5LO-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	89d60dde-b03a-4cb7-b32a-5d06fa328603	4a5886aa-889d-4ef2-89a9-be2f7a06bd58	g.chrX:30577888C>T	ENST00000378962.3	-	3	907	c.585G>A	c.(583-585)gaG>gaA	p.E195E		NM_025159.2	NP_079435.1	Q9HAI6	CX021_HUMAN	chromosome X open reading frame 21	195										kidney(1)|large_intestine(3)|lung(13)|ovary(1)|stomach(1)|urinary_tract(1)	20						AGCTGCTTTTCTCTTTGATGC	0.413																																					p.E195E		.											.	CXorf21-131	0			c.G585A						.						110.0	101.0	104.0					X																	30577888		2202	4300	6502	SO:0001819	synonymous_variant	80231	exon3			GCTTTTCTCTTTG	BC020611	CCDS14224.1	Xp21.3	2006-04-12			ENSG00000120280	ENSG00000120280			25667	protein-coding gene	gene with protein product						12477932	Standard	NM_025159		Approved	FLJ11577	uc004dcg.2	Q9HAI6	OTTHUMG00000021325	ENST00000378962.3:c.585G>A	X.37:g.30577888C>T		Somatic	87	0		WXS	Illumina GAIIx	Phase_I	147	38	NM_025159	0	0	0	0	0		Silent	SNP	ENST00000378962.3	37	CCDS14224.1																																																																																			.		0.413	CXorf21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056164.1	NM_025159	
CXorf21	80231	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	30577890	30577890	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5LO-01A-11D-A29I-10	TCGA-OR-A5LO-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	89d60dde-b03a-4cb7-b32a-5d06fa328603	4a5886aa-889d-4ef2-89a9-be2f7a06bd58	g.chrX:30577890C>T	ENST00000378962.3	-	3	905	c.583G>A	c.(583-585)Gag>Aag	p.E195K		NM_025159.2	NP_079435.1	Q9HAI6	CX021_HUMAN	chromosome X open reading frame 21	195								p.E195*(1)		kidney(1)|large_intestine(3)|lung(13)|ovary(1)|stomach(1)|urinary_tract(1)	20						CTGCTTTTCTCTTTGATGCTT	0.413																																					p.E195K		.											.	CXorf21-131	1	Substitution - Nonsense(1)	lung(1)	c.G583A						.						107.0	98.0	101.0					X																	30577890		2202	4300	6502	SO:0001583	missense	80231	exon3			TTTTCTCTTTGAT	BC020611	CCDS14224.1	Xp21.3	2006-04-12			ENSG00000120280	ENSG00000120280			25667	protein-coding gene	gene with protein product						12477932	Standard	NM_025159		Approved	FLJ11577	uc004dcg.2	Q9HAI6	OTTHUMG00000021325	ENST00000378962.3:c.583G>A	X.37:g.30577890C>T	ENSP00000368245:p.Glu195Lys	Somatic	87	0		WXS	Illumina GAIIx	Phase_I	146	36	NM_025159	0	0	0	0	0		Missense_Mutation	SNP	ENST00000378962.3	37	CCDS14224.1	.	.	.	.	.	.	.	.	.	.	C	16.81	3.225555	0.58668	.	.	ENSG00000120280	ENST00000378962	.	.	.	5.27	4.4	0.53042	.	0.062507	0.64402	D	0.000017	T	0.54159	0.1841	M	0.65498	2.005	0.38248	D	0.941533	P	0.38078	0.617	B	0.37144	0.242	T	0.61486	-0.7053	9	0.62326	D	0.03	-14.5142	9.7712	0.40591	0.1328:0.6628:0.2044:0.0	.	195	Q9HAI6	CX021_HUMAN	K	195	.	ENSP00000368245:E195K	E	-	1	0	CXorf21	30487811	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	4.253000	0.58791	1.169000	0.42739	0.513000	0.50165	GAG	.		0.413	CXorf21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056164.1	NM_025159	
TAF1	6872	ucsc.edu;bcgsc.ca	37	X	70587376	70587376	+	Missense_Mutation	SNP	G	G	T			TCGA-OR-A5LO-01A-11D-A29I-10	TCGA-OR-A5LO-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	89d60dde-b03a-4cb7-b32a-5d06fa328603	4a5886aa-889d-4ef2-89a9-be2f7a06bd58	g.chrX:70587376G>T	ENST00000373790.4	+	2	259	c.208G>T	c.(208-210)Ggg>Tgg	p.G70W	TAF1_ENST00000276072.3_Missense_Mutation_p.G70W|TAF1_ENST00000423759.1_Missense_Mutation_p.G70W|TAF1_ENST00000449580.1_Missense_Mutation_p.G70W	NM_004606.3|NM_138923.2	NP_004597.2|NP_620278.1	P21675	TAF1_HUMAN	TAF1 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 250kDa	70	Protein kinase 1.				cellular response to DNA damage stimulus (GO:0006974)|DNA-templated transcription, initiation (GO:0006352)|gene expression (GO:0010467)|histone acetylation (GO:0016573)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription initiation from RNA polymerase II promoter (GO:0060261)|protein autophosphorylation (GO:0046777)|regulation of transcription involved in G2/M transition of mitotic cell cycle (GO:0000117)|RNA polymerase II transcriptional preinitiation complex assembly (GO:0051123)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	MLL1 complex (GO:0071339)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor TFIID complex (GO:0005669)	ATP binding (GO:0005524)|histone acetyltransferase activity (GO:0004402)|lysine-acetylated histone binding (GO:0070577)|p53 binding (GO:0002039)|protein serine/threonine kinase activity (GO:0004674)|sequence-specific DNA binding (GO:0043565)|TBP-class protein binding (GO:0017025)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)			breast(13)|central_nervous_system(6)|cervix(1)|endometrium(25)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(16)|lung(34)|ovary(9)|prostate(3)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(3)	124	Renal(35;0.156)	all_lung(315;0.000321)				GGCAGGCTTGGGGGCTTTGGG	0.507																																					p.G70W		.											.	TAF1-900	0			c.G208T						.						86.0	70.0	75.0					X																	70587376		2203	4300	6503	SO:0001583	missense	6872	exon2			GGCTTGGGGGCTT		CCDS14412.1, CCDS35325.1, CCDS69783.1	Xq13.1	2011-07-01	2002-08-29	2001-12-07	ENSG00000147133	ENSG00000147133		"""Chromatin-modifying enzymes / K-acetyltransferases"""	11535	protein-coding gene	gene with protein product		313650	"""TATA box binding protein (TBP)-associated factor, RNA polymerase II, A, 250kD"", ""dystonia 3 (with Parkinsonism)"""	TAF2A, BA2R, CCG1, CCGS, DYT3		3556424, 12928496, 17952504	Standard	XM_005262295		Approved	NSCL2, TAFII250, KAT4, DYT3/TAF1	uc004dzt.4	P21675	OTTHUMG00000022723	ENST00000373790.4:c.208G>T	X.37:g.70587376G>T	ENSP00000362895:p.Gly70Trp	Somatic	183	2		WXS	Illumina GAIIx	Phase_I	270	127	NM_004606	0	0	6	6	0	A5CVC8|A5CVC9|A5CVD0|A5CVD1|B1Q2X3|Q59FZ3|Q6IUZ1|Q70Q86|Q70Q87|Q70T00|Q70T01|Q70T02|Q70T03	Missense_Mutation	SNP	ENST00000373790.4	37	CCDS35325.1	.	.	.	.	.	.	.	.	.	.	.	21.6	4.173984	0.78452	.	.	ENSG00000147133	ENST00000373790;ENST00000449580;ENST00000423759;ENST00000276072	T;T;T;T	0.10288	2.89;2.95;2.98;2.92	4.51	3.61	0.41365	TAFII-230 TBP-binding (2);	0.054987	0.64402	D	0.000001	T	0.28101	0.0693	L	0.60455	1.87	0.58432	D	0.999999	D;D	0.89917	1.0;1.0	D;D	0.97110	0.995;1.0	T	0.01508	-1.1337	10	0.72032	D	0.01	.	13.1622	0.59550	0.0:0.0:0.8391:0.1609	.	70;70	P21675;P21675-2	TAF1_HUMAN;.	W	70	ENSP00000362895:G70W;ENSP00000389000:G70W;ENSP00000406549:G70W;ENSP00000276072:G70W	ENSP00000276072:G70W	G	+	1	0	TAF1	70504101	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	8.606000	0.90888	0.987000	0.38709	0.513000	0.50165	GGG	.		0.507	TAF1-009	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000058995.2	NM_004606	
HS6ST2	90161	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	132090979	132090979	+	Missense_Mutation	SNP	G	G	T			TCGA-OR-A5LO-01A-11D-A29I-10	TCGA-OR-A5LO-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	89d60dde-b03a-4cb7-b32a-5d06fa328603	4a5886aa-889d-4ef2-89a9-be2f7a06bd58	g.chrX:132090979G>T	ENST00000370836.2	-	3	1219	c.804C>A	c.(802-804)caC>caA	p.H268Q	HS6ST2_ENST00000370833.2_Missense_Mutation_p.H122Q|HS6ST2_ENST00000521489.1_Missense_Mutation_p.H268Q	NM_147175.3	NP_671704.3	Q96MM7	H6ST2_HUMAN	heparan sulfate 6-O-sulfotransferase 2	268					carbohydrate metabolic process (GO:0005975)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan metabolic process (GO:0030203)|heparan sulfate proteoglycan biosynthetic process, enzymatic modification (GO:0015015)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	heparan sulfate 6-O-sulfotransferase activity (GO:0017095)			central_nervous_system(1)|endometrium(3)|large_intestine(3)|lung(2)	9	Acute lymphoblastic leukemia(192;0.000127)					TACCCGGCCGGTGGCAAGTGC	0.647																																					p.H268Q		.											.	HS6ST2-130	0			c.C804A						.						25.0	29.0	28.0					X																	132090979		2171	4256	6427	SO:0001583	missense	90161	exon3			CGGCCGGTGGCAA	AB067776	CCDS48169.1, CCDS48170.1	Xq26.2	2008-02-05			ENSG00000171004	ENSG00000171004		"""Sulfotransferases, membrane-bound"""	19133	protein-coding gene	gene with protein product		300545				10644753	Standard	NM_147175		Approved		uc011mvd.1	Q96MM7	OTTHUMG00000022430	ENST00000370836.2:c.804C>A	X.37:g.132090979G>T	ENSP00000359873:p.His268Gln	Somatic	256	0		WXS	Illumina GAIIx	Phase_I	519	111	NM_001077188	0	0	0	0	0	B9WRT4|B9WRT5|E9PDY5|Q2TB13|Q4VC07|Q6PIC4|Q86SM9|Q8N3T4|Q8NBN4|Q96SJ4	Missense_Mutation	SNP	ENST00000370836.2	37	CCDS48169.1	.	.	.	.	.	.	.	.	.	.	g	13.15	2.151687	0.38021	.	.	ENSG00000171004	ENST00000370837;ENST00000370836;ENST00000521489;ENST00000370833;ENST00000319809	T;T;T;T	0.73897	-0.79;-0.79;-0.79;-0.79	4.56	2.79	0.32731	.	0.165190	0.53938	D	0.000044	T	0.68137	0.2968	M	0.66939	2.045	0.80722	D	1	B;B	0.33318	0.055;0.408	B;B	0.32149	0.102;0.141	T	0.62144	-0.6916	10	0.38643	T	0.18	-0.7085	8.8794	0.35365	0.1906:0.0:0.8094:0.0	.	268;268	Q96MM7;E9PDY5	H6ST2_HUMAN;.	Q	122;268;268;122;109	ENSP00000359874:H122Q;ENSP00000359873:H268Q;ENSP00000429473:H268Q;ENSP00000359870:H122Q	ENSP00000324617:H109Q	H	-	3	2	HS6ST2	131918661	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.155000	0.64900	0.384000	0.24942	0.525000	0.51046	CAC	.		0.647	HS6ST2-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000058332.3	NM_147174	
L1CAM	3897	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	153133282	153133282	+	Missense_Mutation	SNP	C	C	A			TCGA-OR-A5LO-01A-11D-A29I-10	TCGA-OR-A5LO-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	89d60dde-b03a-4cb7-b32a-5d06fa328603	4a5886aa-889d-4ef2-89a9-be2f7a06bd58	g.chrX:153133282C>A	ENST00000370060.1	-	16	2101	c.1912G>T	c.(1912-1914)Gca>Tca	p.A638S	L1CAM_ENST00000543994.1_Missense_Mutation_p.A640S|L1CAM_ENST00000361981.3_Missense_Mutation_p.A633S|L1CAM_ENST00000538883.1_Missense_Mutation_p.A640S|L1CAM_ENST00000370057.3_Missense_Mutation_p.A638S|L1CAM_ENST00000370055.1_Missense_Mutation_p.A633S|L1CAM_ENST00000361699.4_Missense_Mutation_p.A638S	NM_001278116.1	NP_001265045.1	P32004	L1CAM_HUMAN	L1 cell adhesion molecule	638	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.				axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell death (GO:0008219)|cell surface receptor signaling pathway (GO:0007166)|cell-cell adhesion mediated by integrin (GO:0033631)|chemotaxis (GO:0006935)|heterophilic cell-cell adhesion (GO:0007157)|homophilic cell adhesion (GO:0007156)|homotypic cell-cell adhesion (GO:0034109)|leukocyte cell-cell adhesion (GO:0007159)|leukocyte migration (GO:0050900)|nervous system development (GO:0007399)|positive regulation of calcium-mediated signaling (GO:0050850)|positive regulation of cell-cell adhesion (GO:0022409)	cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|presynaptic membrane (GO:0042734)|terminal bouton (GO:0043195)	sialic acid binding (GO:0033691)			NS(1)|breast(4)|central_nervous_system(3)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(5)|liver(1)|lung(31)|ovary(13)|pancreas(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	81	all_cancers(53;6.72e-15)|all_epithelial(53;3.19e-09)|all_lung(58;3.39e-06)|all_hematologic(71;4.25e-06)|Lung NSC(58;4.7e-06)|Acute lymphoblastic leukemia(192;6.56e-05)					TGGTCTTCTGCAGGACTCCAG	0.672																																					p.A638S		.											.	L1CAM-138	0			c.G1912T						.						55.0	49.0	51.0					X																	153133282		2175	4194	6369	SO:0001583	missense	3897	exon15			CTTCTGCAGGACT	M74387	CCDS14733.1, CCDS14734.1, CCDS48192.1	Xq28	2014-09-17	2003-04-07		ENSG00000198910	ENSG00000198910		"""CD molecules"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	6470	protein-coding gene	gene with protein product		308840	"""antigen identified by monoclonal antibody R1"""	HSAS1, SPG1, HSAS, MASA, MIC5, S10			Standard	NM_001278116		Approved	CD171	uc031tks.1	P32004	OTTHUMG00000024221	ENST00000370060.1:c.1912G>T	X.37:g.153133282C>A	ENSP00000359077:p.Ala638Ser	Somatic	125	0		WXS	Illumina GAIIx	Phase_I	177	34	NM_000425	0	0	14	14	0	A0AV65|A4ZYW4|B2RMU7|G3XAF4|Q8TA87	Missense_Mutation	SNP	ENST00000370060.1	37	CCDS14733.1	.	.	.	.	.	.	.	.	.	.	C	14.04	2.416582	0.42918	.	.	ENSG00000198910	ENST00000370060;ENST00000543994;ENST00000370057;ENST00000538883;ENST00000361981;ENST00000370055;ENST00000361699	T;T;T;T;T;T;T	0.53206	0.63;0.63;0.63;0.63;0.63;0.63;0.63	4.36	4.36	0.52297	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.113123	0.38164	N	0.001789	T	0.35595	0.0937	N	0.21194	0.64	0.09310	N	1	B;B;B	0.34399	0.452;0.372;0.302	B;B;B	0.35413	0.202;0.202;0.163	T	0.38243	-0.9670	10	0.56958	D	0.05	.	13.37	0.60707	0.0:1.0:0.0:0.0	.	633;638;638	G3XAF4;P32004-2;P32004	.;.;L1CAM_HUMAN	S	638;640;638;640;633;633;638	ENSP00000359077:A638S;ENSP00000438430:A640S;ENSP00000359074:A638S;ENSP00000439645:A640S;ENSP00000354712:A633S;ENSP00000359072:A633S;ENSP00000355380:A638S	ENSP00000355380:A638S	A	-	1	0	L1CAM	152786476	0.116000	0.22171	0.068000	0.19968	0.825000	0.46686	1.390000	0.34464	2.013000	0.59113	0.436000	0.28706	GCA	.		0.672	L1CAM-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000061094.2	NM_024003	
SIX6	4990	broad.mit.edu	37	14	60977896	60977897	+	Frame_Shift_Ins	INS	-	-	C	rs372216093		TCGA-OR-A5LO-01A-11D-A29I-10	TCGA-OR-A5LO-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	89d60dde-b03a-4cb7-b32a-5d06fa328603	4a5886aa-889d-4ef2-89a9-be2f7a06bd58	g.chr14:60977896_60977897insC	ENST00000327720.5	+	2	1115_1116	c.667_668insC	c.(667-669)gccfs	p.A223fs		NM_007374.2	NP_031400.2	O95475	SIX6_HUMAN	SIX homeobox 6	223					organ morphogenesis (GO:0009887)|visual perception (GO:0007601)	nucleus (GO:0005634)	DNA binding (GO:0003677)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001205)			NS(1)|autonomic_ganglia(1)|endometrium(3)|kidney(1)|large_intestine(3)|lung(2)	11				OV - Ovarian serous cystadenocarcinoma(108;0.088)		CACCAGCCCGGCCGCCAGTCTA	0.663																																					p.A223fs		.											.	SIX6-90	0			c.667_668insC						.																																			SO:0001589	frameshift_variant	4990	exon2			AGCCCGGCCGCCA	AF141651	CCDS9747.1	14q23.1	2011-06-20	2007-07-13		ENSG00000184302	ENSG00000184302		"""Homeoboxes / SINE class"""	10892	protein-coding gene	gene with protein product		606326	"""sine oculis homeobox (Drosophila) homolog 6"", ""sine oculis homeobox homolog 6 (Drosophila)"""	OPTX2		10512683	Standard	NM_007374		Approved	Six9	uc001xfa.4	O95475	OTTHUMG00000152339	ENST00000327720.5:c.669dupC	14.37:g.60977898_60977898dupC	ENSP00000328596:p.Ala223fs	Somatic	28	0		WXS	Illumina GAIIx	Phase_I	124	6	NM_007374	0	0	0	0	0	Q6NT42|Q9P1X8	Frame_Shift_Ins	INS	ENST00000327720.5	37	CCDS9747.1																																																																																			.		0.663	SIX6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276952.2		
PRR35	146325	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	16	615240	615241	+	In_Frame_Ins	INS	-	-	GACGAGGAGTTCCCA	rs368109839|rs547328716		TCGA-OR-A5LO-01A-11D-A29I-10	TCGA-OR-A5LO-10A-01D-A29L-10	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	89d60dde-b03a-4cb7-b32a-5d06fa328603	4a5886aa-889d-4ef2-89a9-be2f7a06bd58	g.chr16:615240_615241insGACGAGGAGTTCCCA	ENST00000409413.3	+	3	1928_1929	c.1649_1650insGACGAGGAGTTCCCA	c.(1648-1653)gcgacg>gcGACGAGGAGTTCCCAgacg	p.556_557insRSSQT	NHLRC4_ENST00000424439.2_5'Flank|NHLRC4_ENST00000540585.1_5'Flank|PIGQ_ENST00000409527.2_5'Flank	NM_145270.2	NP_660313.1	P0CG20	PRR35_HUMAN		556										central_nervous_system(1)|endometrium(1)|lung(5)|ovary(1)|skin(1)|urinary_tract(1)	10						ACCTGTGTTGCGACGAGGAGTT	0.673																																					p.A550delinsATRSSQ		.											.	C16orf11-23	0			c.1649_1650insGACGAGGAGTTCCCA						.																																			SO:0001652	inframe_insertion	146325	exon3			GTGTTGCGACGAG																												ENST00000409413.3:c.1650_1664dupGACGAGGAGTTCCCA	16.37:g.615240_615241insGACGAGGAGTTCCCA	ENSP00000386499:p.Arg552_Thr556dup	Somatic	151	0		WXS	Illumina GAIIx	Phase_I	265	13	NM_145270	0	0	0	0	0	B8ZZ27|Q8N233|Q96AX3|Q96S23	In_Frame_Ins	INS	ENST00000409413.3	37	CCDS45365.1																																																																																			.		0.673	C16orf11-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000333913.1		
FZD1	8321	hgsc.bcm.edu	37	7	90894459	90894460	+	In_Frame_Ins	INS	-	-	CCG	rs71292991|rs139480179	byFrequency	TCGA-OR-A5LO-01A-11D-A29I-10	TCGA-OR-A5LO-10A-01D-A29L-10	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	89d60dde-b03a-4cb7-b32a-5d06fa328603	4a5886aa-889d-4ef2-89a9-be2f7a06bd58	g.chr7:90894459_90894460insCCG	ENST00000287934.2	+	1	677_678	c.264_265insCCG	c.(265-267)ccg>CCGccg	p.89_89P>PP		NM_003505.1	NP_003496.1	Q9UP38	FZD1_HUMAN	frizzled class receptor 1	89	Poly-Pro.				autocrine signaling (GO:0035425)|axonogenesis (GO:0007409)|brain development (GO:0007420)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in mesenchymal stem cell differentiation (GO:0044338)|canonical Wnt signaling pathway involved in osteoblast differentiation (GO:0044339)|cell-cell signaling (GO:0007267)|epithelial cell differentiation (GO:0030855)|G-protein coupled receptor signaling pathway coupled to cGMP nucleotide second messenger (GO:0007199)|gonad development (GO:0008406)|hard palate development (GO:0060022)|lung alveolus development (GO:0048286)|membranous septum morphogenesis (GO:0003149)|muscular septum morphogenesis (GO:0003150)|negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of catenin import into nucleus (GO:0035414)|negative regulation of transcription, DNA-templated (GO:0045892)|neuron differentiation (GO:0030182)|outflow tract morphogenesis (GO:0003151)|planar cell polarity pathway involved in neural tube closure (GO:0090179)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription, DNA-templated (GO:0045893)|response to drug (GO:0042493)|vasculature development (GO:0001944)|Wnt signaling pathway, calcium modulating pathway (GO:0007223)	apical part of cell (GO:0045177)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|neuron projection membrane (GO:0032589)|plasma membrane (GO:0005886)	frizzled binding (GO:0005109)|G-protein coupled receptor activity (GO:0004930)|PDZ domain binding (GO:0030165)|receptor binding (GO:0005102)|Wnt-activated receptor activity (GO:0042813)|Wnt-protein binding (GO:0017147)	p.Q88_P89insP(2)|p.Q88_P89insA(1)		breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(4)|liver(1)|lung(7)|ovary(1)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	24	all_cancers(62;3.1e-10)|all_epithelial(64;1.66e-08)|Breast(17;0.000635)|Lung NSC(181;0.153)|all_lung(186;0.154)|all_hematologic(106;0.215)		STAD - Stomach adenocarcinoma(171;0.0134)			cggggcAGCAACCGCCGCCGCC	0.743														1874	0.374201	0.4047	0.4625	5008	,	,		10872	0.2986		0.4294	False		,,,				2504	0.2914				p.Q88delinsQP		.											.	FZD1-658	3	Insertion - In frame(3)	breast(2)|liver(1)	c.264_265insCCG						.			1606,5,2563		359,2,886,0,3,837						0.6	1.0		dbSNP_134	11	3182,3,4959		703,0,1776,1,1,1591	no	codingComplex	FZD1	NM_003505.1		1062,2,2662,1,4,2428	A1A1,A1A2,A1R,A2A2,A2R,RR		39.1085,38.5961,38.9349				4788,8,7522				SO:0001652	inframe_insertion	8321	exon1			GCAGCAACCGCCG	AB017363	CCDS5620.1	7q21	2014-01-29	2014-01-29		ENSG00000157240	ENSG00000157240		"""GPCR / Class F : Frizzled receptors"""	4038	protein-coding gene	gene with protein product	"""Wnt receptor"", ""frizzled, Drosophila, homolog of, 1"""	603408	"""frizzled (Drosophila) homolog 1"", ""frizzled homolog 1 (Drosophila)"", ""frizzled 1, seven transmembrane spanning receptor"", ""frizzled family receptor 1"""			9813155	Standard	NM_003505		Approved	DKFZp564G072	uc003ula.3	Q9UP38	OTTHUMG00000023046	ENST00000287934.2:c.274_276dupCCG	7.37:g.90894466_90894468dupCCG	ENSP00000287934:p.Pro93dup	Somatic	5	5		WXS	Illumina GAIIx	Phase_I	25	24	NM_003505	0	0	0	0	0	A4D1E8|O94815|Q549T8	In_Frame_Ins	INS	ENST00000287934.2	37	CCDS5620.1																																																																																			-|0.606;CCG|0.394		0.743	FZD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059367.2	NM_003505	
KNDC1	85442	hgsc.bcm.edu	37	10	135012429	135012430	+	Missense_Mutation	DNP	TT	TT	AC	rs386749477|rs3008390|rs3008389	byFrequency	TCGA-OR-A5LO-01A-11D-A29I-10	TCGA-OR-A5LO-10A-01D-A29L-10	TT	TT	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	89d60dde-b03a-4cb7-b32a-5d06fa328603	4a5886aa-889d-4ef2-89a9-be2f7a06bd58	g.chr10:135012429_135012430TT>AC	ENST00000304613.3	+	14	2438_2439	c.2417_2418TT>AC	c.(2416-2418)gTT>gAC	p.V806D	KNDC1_ENST00000368572.2_Missense_Mutation_p.V806D|KNDC1_ENST00000368571.2_Missense_Mutation_p.V741D			Q76NI1	VKIND_HUMAN	kinase non-catalytic C-lobe domain (KIND) containing 1	806	Pro-rich.			V -> D (in Ref. 1; BAD12625). {ECO:0000305}.	cerebellar granule cell differentiation (GO:0021707)|positive regulation of protein phosphorylation (GO:0001934)|regulation of dendrite morphogenesis (GO:0048814)|small GTPase mediated signal transduction (GO:0007264)	dendrite (GO:0030425)|guanyl-nucleotide exchange factor complex (GO:0032045)|neuronal cell body (GO:0043025)	protein serine/threonine kinase activity (GO:0004674)|Ras guanyl-nucleotide exchange factor activity (GO:0005088)			NS(4)|breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(27)|ovary(1)|prostate(5)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	60		all_cancers(35;4.16e-10)|all_epithelial(44;2.07e-08)|Lung NSC(174;0.000845)|all_lung(145;0.00145)|all_neural(114;0.0299)|Melanoma(40;0.123)|Colorectal(31;0.173)|Glioma(114;0.203)		OV - Ovarian serous cystadenocarcinoma(35;8.77e-06)|Epithelial(32;1.13e-05)|all cancers(32;1.51e-05)		CCACCTGGAGTTGCTTCCGGGG	0.748																																					p.V806D		.											.	KNDC1-229	0			c.T2418C						.																																			SO:0001583	missense	85442	exon14			TGGAGTTGCTTCC	AK074179	CCDS7674.1	10q26.3	2004-09-14	2004-04-07		ENSG00000171798	ENSG00000171798			29374	protein-coding gene	gene with protein product			"""RasGEF domain family, member 2"""	RASGEF2, C10orf23		11214970	Standard	NM_152643		Approved	KIAA1768, bB439H18.3, FLJ25027	uc001llz.1	Q76NI1	OTTHUMG00000019303	Exception_encountered	10.37:g.135012429_135012430delinsAC	ENSP00000304437:p.Val806Asp	Somatic	2	0		WXS	Illumina GAIIx	Phase_I	9	0	NM_152643	0	0	0	0	0	B0QZC5|Q5T233|Q6ZNH8|Q8TEE5|Q96LV7|Q9C095	Missense_Mutation	DNP	ENST00000304613.3	37	CCDS7674.1																																																																																			T|0.470;C|0.530		0.748	KNDC1-006	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000277044.3	NM_152643	
ZNF83	55769	bcgsc.ca	37	19	53116855	53116856	+	Missense_Mutation	DNP	CT	CT	TA	rs199873537|rs7247359		TCGA-OR-A5LO-01A-11D-A29I-10	TCGA-OR-A5LO-10A-01D-A29L-10	CT	CT	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	89d60dde-b03a-4cb7-b32a-5d06fa328603	4a5886aa-889d-4ef2-89a9-be2f7a06bd58	g.chr19:53116855_53116856CT>TA	ENST00000597597.1	-	2	3215_3216	c.962_963AG>TA	c.(961-963)gAG>gTA	p.E321V	ZNF83_ENST00000391789.4_Missense_Mutation_p.E293V|ZNF83_ENST00000544146.1_Missense_Mutation_p.E321V|ZNF83_ENST00000601257.1_Intron|ZNF83_ENST00000301096.3_Missense_Mutation_p.E321V|ZNF83_ENST00000536937.1_Missense_Mutation_p.E321V|ZNF83_ENST00000545872.1_Missense_Mutation_p.E321V|ZNF83_ENST00000594682.2_3'UTR|ZNF83_ENST00000541777.2_Missense_Mutation_p.E321V|ZNF83_ENST00000600714.1_Intron			P51522	ZNF83_HUMAN	zinc finger protein 83	321					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(1)|kidney(1)|large_intestine(8)|lung(3)|ovary(1)|prostate(1)|upper_aerodigestive_tract(2)	18				OV - Ovarian serous cystadenocarcinoma(262;0.00841)|GBM - Glioblastoma multiforme(134;0.0244)		CCTTGCCACACTCATTACATTT	0.411																																					p.E321V		.											.	ZNF83-91	0			c.A962T						.																																			SO:0001583	missense	55769	exon3			CCACACTCATTAC	M27877	CCDS12854.1	19q13.3	2013-01-08	2006-05-12			ENSG00000167766		"""Zinc fingers, C2H2-type"""	13158	protein-coding gene	gene with protein product		194558	"""zinc finger protein 83 (HPF1)"", ""zinc finger protein 816B"""	ZNF816B		8088807	Standard	NM_018300		Approved	FLJ11015, HPF1	uc010epy.3	P51522		ENST00000597597.1:c.962_963delinsTA	19.37:g.53116855_53116856delinsTA	ENSP00000472619:p.Glu321Val	Somatic	126	0		WXS	Illumina GAIIx	Phase_I	192	0	NM_018300	0	0	0	0	0	A8MT75|Q3ZCX0|Q6PI08	Missense_Mutation	DNP	ENST00000597597.1	37	CCDS12854.1																																																																																			.		0.411	ZNF83-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463700.1	NM_018300	
