#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_TTotCov	i_TVarCov	i_Transcript_Id	i_Trna_alt1	i_Trna_alt2	i_Trna_ref	i_Trna_tot	i_Trna_var	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
PADI2	11240	bcgsc.ca	37	1	17405809	17405809	+	Silent	SNP	G	G	A	rs2057096	byFrequency	TCGA-OR-A5LR-01A-11D-A29I-10	TCGA-OR-A5LR-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a4944d75-a6da-45bb-b5b9-3fa3355b0ead	c2a8460f-138e-44eb-a933-a5cd6ca34d8b	g.chr1:17405809G>A	ENST00000375486.4	-	11	1323	c.1260C>T	c.(1258-1260)aaC>aaT	p.N420N	PADI2_ENST00000375481.1_Silent_p.N420N|PADI2_ENST00000444885.2_Silent_p.N304N|PADI2_ENST00000466151.1_5'UTR	NM_007365.2	NP_031391.2	Q9Y2J8	PADI2_HUMAN	peptidyl arginine deiminase, type II	420					chromatin-mediated maintenance of transcription (GO:0048096)|histone H3-R26 citrullination (GO:0036413)|intracellular estrogen receptor signaling pathway (GO:0030520)|negative regulation of chemokine-mediated signaling pathway (GO:0070100)|negative regulation of lymphocyte chemotaxis (GO:1901624)|protein citrullination (GO:0018101)|regulation of chromatin disassembly (GO:0010848)|substantia nigra development (GO:0021762)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|transcriptionally active chromatin (GO:0035327)	calcium ion binding (GO:0005509)|estrogen receptor binding (GO:0030331)|protein-arginine deiminase activity (GO:0004668)			breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(12)|ovary(4)|pancreas(1)|skin(5)|urinary_tract(3)	29		Colorectal(325;3.46e-05)|Breast(348;0.000162)|Lung NSC(340;0.000422)|Renal(390;0.000518)|all_lung(284;0.000546)|Ovarian(437;0.00671)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00583)|BRCA - Breast invasive adenocarcinoma(304;1.49e-05)|COAD - Colon adenocarcinoma(227;1.54e-05)|Kidney(64;0.000258)|KIRC - Kidney renal clear cell carcinoma(64;0.00348)|STAD - Stomach adenocarcinoma(196;0.0072)|READ - Rectum adenocarcinoma(331;0.0698)|Lung(427;0.201)	L-Citrulline(DB00155)	ATGTCTTGCCGTTCACGGTCA	0.592													G|||	2176	0.434505	0.295	0.5259	5008	,	,		14866	0.3879		0.5726	False		,,,				2504	0.4642				p.N420N		.											.	PADI2-208	0			c.C1260T						.	G		1593,2813	495.1+/-363.2	275,1043,885	64.0	65.0	64.0		1260	-5.9	1.0	1	dbSNP_94	64	4972,3628	624.5+/-397.6	1423,2126,751	no	coding-synonymous	PADI2	NM_007365.2		1698,3169,1636	AA,AG,GG		42.186,36.1552,49.5233		420/666	17405809	6565,6441	2203	4300	6503	SO:0001819	synonymous_variant	11240	exon11			CTTGCCGTTCACG	AB030176	CCDS177.1	1p35.2-p35.1	2008-02-05			ENSG00000117115	ENSG00000117115	3.5.3.15	"""Peptidyl arginine deiminases"""	18341	protein-coding gene	gene with protein product		607935				2768262	Standard	NM_007365		Approved	KIAA0994, PDI2	uc001baf.3	Q9Y2J8	OTTHUMG00000002295	ENST00000375486.4:c.1260C>T	1.37:g.17405809G>A		Somatic	113	1		WXS	Illumina GAIIx	Phase_I	105	6	NM_007365	0	0	0	0	0	Q96DA7|Q9UPN2	Silent	SNP	ENST00000375486.4	37	CCDS177.1																																																																																			G|0.520;A|0.480		0.592	PADI2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000006624.1		
OPRD1	4985	hgsc.bcm.edu	37	1	29138975	29138975	+	Missense_Mutation	SNP	G	G	T	rs1042114	byFrequency	TCGA-OR-A5LR-01A-11D-A29I-10	TCGA-OR-A5LR-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a4944d75-a6da-45bb-b5b9-3fa3355b0ead	c2a8460f-138e-44eb-a933-a5cd6ca34d8b	g.chr1:29138975G>T	ENST00000234961.2	+	1	322	c.80G>T	c.(79-81)tGc>tTc	p.C27F		NM_000911.3	NP_000902.3	P41143	OPRD_HUMAN	opioid receptor, delta 1	27			C -> F (improved maturation and increased expression at the cell surface; dbSNP:rs1042114). {ECO:0000269|PubMed:10982041, ECO:0000269|PubMed:8201839, ECO:0000269|Ref.4}.		adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|adult locomotory behavior (GO:0008344)|cellular response to growth factor stimulus (GO:0071363)|cellular response to hypoxia (GO:0071456)|cellular response to toxic substance (GO:0097237)|G-protein coupled receptor signaling pathway (GO:0007186)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|immune response (GO:0006955)|negative regulation of gene expression (GO:0010629)|negative regulation of protein oligomerization (GO:0032460)|neuropeptide signaling pathway (GO:0007218)|opioid receptor signaling pathway (GO:0038003)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|positive regulation of CREB transcription factor activity (GO:0032793)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|protein import into nucleus, translocation (GO:0000060)|regulation of calcium ion transport (GO:0051924)|regulation of mitochondrial membrane potential (GO:0051881)|regulation of sensory perception of pain (GO:0051930)	axon terminus (GO:0043679)|cytoplasm (GO:0005737)|dendrite membrane (GO:0032590)|integral component of plasma membrane (GO:0005887)|intrinsic component of plasma membrane (GO:0031226)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|vesicle (GO:0031982)	enkephalin receptor activity (GO:0038046)|opioid receptor activity (GO:0004985)			breast(1)|central_nervous_system(1)|kidney(3)|large_intestine(1)|lung(2)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	15		Colorectal(325;3.46e-05)|Lung NSC(340;0.000947)|all_lung(284;0.00131)|Renal(390;0.00758)|Breast(348;0.00765)|all_neural(195;0.0199)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0563)|Medulloblastoma(700;0.123)		Colorectal(126;1.29e-07)|COAD - Colon adenocarcinoma(152;7.51e-06)|STAD - Stomach adenocarcinoma(196;0.00306)|BRCA - Breast invasive adenocarcinoma(304;0.0241)|READ - Rectum adenocarcinoma(331;0.0649)|KIRC - Kidney renal clear cell carcinoma(1967;0.147)	Alvimopan(DB06274)|Amitriptyline(DB00321)|Buprenorphine(DB00921)|Butorphanol(DB00611)|Codeine(DB00318)|Dextromethorphan(DB00514)|Dextropropoxyphene(DB00647)|Diphenoxylate(DB01081)|Fentanyl(DB00813)|Heroin(DB01452)|Hydrocodone(DB00956)|Hydromorphone(DB00327)|Ketamine(DB01221)|Ketobemidone(DB06738)|Levorphanol(DB00854)|Loperamide(DB00836)|Methadone(DB00333)|Morphine(DB00295)|Nalbuphine(DB00844)|Naloxone(DB01183)|Naltrexone(DB00704)|Oxycodone(DB00497)|Oxymorphone(DB01192)|Remifentanil(DB00899)|Sufentanil(DB00708)|Tapentadol(DB06204)|Tramadol(DB00193)	CCTAGCGCCTGCCCCAGCGCT	0.771													T|||	4730	0.944489	0.9796	0.9193	5008	,	,		9147	1.0		0.8678	False		,,,				2504	0.9366				p.C27F		.											.	OPRD1-69	0			c.G80T						.	T	PHE/CYS	3689,115		1788,113,1	4.0	6.0	5.0	http://www.ncbi.nlm.nih.gov/omim/103780,165195|http://omim.org/entry/165195|http://omim.org/entry/103780	80	2.9	1.0	1	dbSNP_86	5	6762,846		2982,798,24	no	missense	OPRD1	NM_000911.3	205	4770,911,25	TT,TG,GG		11.1199,3.0231,8.421	benign	27/373	29138975	10451,961	1902	3804	5706	SO:0001583	missense	4985	exon1			GCGCCTGCCCCAG	U10504	CCDS329.1	1p36.1-p34.3	2012-08-08			ENSG00000116329	ENSG00000116329		"""GPCR / Class A : Opioid receptors"""	8153	protein-coding gene	gene with protein product		165195				8415697	Standard	NM_000911		Approved		uc001brf.1	P41143	OTTHUMG00000003646	ENST00000234961.2:c.80G>T	1.37:g.29138975G>T	ENSP00000234961:p.Cys27Phe	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	8	8	NM_000911	0	0	0	0	0	B5B0B8	Missense_Mutation	SNP	ENST00000234961.2	37	CCDS329.1	2035	0.9317765567765568	474	0.9634146341463414	331	0.914364640883978	572	1.0	658	0.8680738786279684	T	0.016	-1.513433	0.00975	0.969769	0.888801	ENSG00000116329	ENST00000234961;ENST00000536280	T	0.67698	-0.28	4.0	2.89	0.33648	.	1.802200	0.02327	N	0.073605	T	0.00012	0.0000	N	0.01874	-0.695	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.41342	-0.9514	9	0.09338	T	0.73	.	3.8109	0.08796	0.0:0.1144:0.2238:0.6618	rs1042114;rs59349662;rs1042114	27	P41143	OPRD_HUMAN	F	27	ENSP00000234961:C27F	ENSP00000234961:C27F	C	+	2	0	OPRD1	29011562	0.002000	0.14202	0.992000	0.48379	0.116000	0.19942	0.521000	0.22893	0.713000	0.32060	-0.694000	0.03704	TGC	G|0.061;T|0.939		0.771	OPRD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000010330.1	NM_000911	
EVA1B	55194	hgsc.bcm.edu	37	1	36788122	36788122	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5LR-01A-11D-A29I-10	TCGA-OR-A5LR-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a4944d75-a6da-45bb-b5b9-3fa3355b0ead	c2a8460f-138e-44eb-a933-a5cd6ca34d8b	g.chr1:36788122G>A	ENST00000270824.1	-	3	563	c.272C>T	c.(271-273)cCc>cTc	p.P91L	RP11-268J15.5_ENST00000373137.2_5'Flank|SH3D21_ENST00000474766.1_3'UTR|EVA1B_ENST00000490466.1_5'UTR	NM_018166.1	NP_060636.1	Q9NVM1	EVA1B_HUMAN	eva-1 homolog B (C. elegans)	91						integral component of membrane (GO:0016021)											CGTGTCGTCGGGGCCCAGCCG	0.761																																					p.P91L		.											.	.	0			c.C272T						.						11.0	12.0	11.0					1																	36788122		2055	4096	6151	SO:0001583	missense	55194	exon3			TCGTCGGGGCCCA	AK001509	CCDS406.1	1p34.3	2012-11-05	2012-11-05	2012-11-05	ENSG00000142694	ENSG00000142694			25558	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 78"", ""family with sequence similarity 176, member B"""	C1orf78, FAM176B		14702039	Standard	XM_005270998		Approved	FLJ10647	uc001caj.1	Q9NVM1	OTTHUMG00000007867	ENST00000270824.1:c.272C>T	1.37:g.36788122G>A	ENSP00000270824:p.Pro91Leu	Somatic	2	0		WXS	Illumina GAIIx	Phase_I	20	20	NM_018166	0	0	1	10	9	D3DPS7	Missense_Mutation	SNP	ENST00000270824.1	37	CCDS406.1	.	.	.	.	.	.	.	.	.	.	G	17.81	3.481029	0.63849	.	.	ENSG00000142694	ENST00000270824	T	0.39592	1.07	4.54	4.54	0.55810	.	0.186285	0.47852	D	0.000206	T	0.30135	0.0755	L	0.27053	0.805	0.50813	D	0.999898	B	0.28760	0.221	B	0.34138	0.176	T	0.10405	-1.0631	10	0.28530	T	0.3	-14.1507	8.7109	0.34382	0.1068:0.0:0.8932:0.0	.	91	Q9NVM1	F176B_HUMAN	L	91	ENSP00000270824:P91L	ENSP00000270824:P91L	P	-	2	0	FAM176B	36560709	0.003000	0.15002	1.000000	0.80357	0.921000	0.55340	1.113000	0.31184	2.053000	0.61076	0.462000	0.41574	CCC	.		0.761	EVA1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000021689.1	NM_018166	
HRNR	388697	bcgsc.ca	37	1	152192555	152192555	+	Missense_Mutation	SNP	T	T	C	rs41266134	byFrequency	TCGA-OR-A5LR-01A-11D-A29I-10	TCGA-OR-A5LR-10A-01D-A29L-10	T	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a4944d75-a6da-45bb-b5b9-3fa3355b0ead	c2a8460f-138e-44eb-a933-a5cd6ca34d8b	g.chr1:152192555T>C	ENST00000368801.2	-	3	1625	c.1550A>G	c.(1549-1551)tAt>tGt	p.Y517C	FLG-AS1_ENST00000593011.1_RNA|FLG-AS1_ENST00000420707.1_RNA	NM_001009931.1	NP_001009931.1	Q86YZ3	HORN_HUMAN	hornerin	517			Y -> C (in dbSNP:rs41266134).		establishment of skin barrier (GO:0061436)|hematopoietic progenitor cell differentiation (GO:0002244)|keratinization (GO:0031424)	cornified envelope (GO:0001533)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)			autonomic_ganglia(1)|breast(6)|central_nervous_system(2)|cervix(2)|endometrium(22)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(19)|liver(1)|lung(84)|ovary(5)|prostate(6)|skin(12)|stomach(9)|upper_aerodigestive_tract(5)|urinary_tract(6)	192	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			ATGCTGACCATAGCTGGAAGA	0.582													T|||	1464	0.292332	0.0242	0.3905	5008	,	,		23145	0.5962		0.1412	False		,,,				2504	0.4274				p.Y517C		.											.	HRNR-93	0			c.A1550G						.	T	CYS/TYR	206,4200	126.6+/-163.6	3,200,2000	260.0	249.0	253.0		1550	-6.0	0.0	1	dbSNP_127	253	1241,7359	249.2+/-276.5	96,1049,3155	yes	missense	HRNR	NM_001009931.1	194	99,1249,5155	CC,CT,TT		14.4302,4.6754,11.1256	benign	517/2851	152192555	1447,11559	2203	4300	6503	SO:0001583	missense	388697	exon3			TGACCATAGCTGG	AB104446	CCDS30859.1	1q21.3	2013-01-10			ENSG00000197915	ENSG00000197915		"""EF-hand domain containing"""	20846	protein-coding gene	gene with protein product	"""filaggrin family member 3"""						Standard	NM_001009931		Approved	S100a18, S100A16, FLG3	uc001ezt.2	Q86YZ3	OTTHUMG00000012243	ENST00000368801.2:c.1550A>G	1.37:g.152192555T>C	ENSP00000357791:p.Tyr517Cys	Somatic	359	3		WXS	Illumina GAIIx	Phase_I	281	12	NM_001009931	0	0	0	0	0	Q5DT20|Q5U1F4	Missense_Mutation	SNP	ENST00000368801.2	37	CCDS30859.1	582	0.2664835164835165	13	0.026422764227642278	119	0.3287292817679558	338	0.5909090909090909	112	0.14775725593667546	T	2.829	-0.243134	0.05906	0.046754	0.144302	ENSG00000197915	ENST00000368801	T	0.01725	4.67	3.01	-6.02	0.02192	.	.	.	.	.	T	0.00300	0.0009	N	0.14661	0.345	0.80722	P	0.0	B	0.10296	0.003	B	0.04013	0.001	T	0.46952	-0.9154	8	0.38643	T	0.18	.	0.3516	0.00350	0.3025:0.2331:0.2662:0.1982	rs41266134	517	Q86YZ3	HORN_HUMAN	C	517	ENSP00000357791:Y517C	ENSP00000357791:Y517C	Y	-	2	0	HRNR	150459179	0.000000	0.05858	0.000000	0.03702	0.005000	0.04900	-6.023000	0.00085	-1.875000	0.01132	-0.515000	0.04445	TAT	T|0.836;C|0.164		0.582	HRNR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000034016.1	XM_373868	
ADAMTS4	9507	bcgsc.ca	37	1	161160928	161160928	+	Silent	SNP	T	T	C			TCGA-OR-A5LR-01A-11D-A29I-10	TCGA-OR-A5LR-10A-01D-A29L-10	T	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a4944d75-a6da-45bb-b5b9-3fa3355b0ead	c2a8460f-138e-44eb-a933-a5cd6ca34d8b	g.chr1:161160928T>C	ENST00000367996.5	-	9	2942	c.2514A>G	c.(2512-2514)taA>taG	p.*838*		NM_005099.4	NP_005090.3	O75173	ATS4_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 4	0					defense response to bacterium (GO:0042742)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|proteolysis (GO:0006508)|skeletal system development (GO:0001501)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|peptidase activity (GO:0008233)|protease binding (GO:0002020)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(20)|ovary(4)|prostate(3)|skin(1)|urinary_tract(1)	43	all_cancers(52;3.73e-19)|Breast(13;0.000577)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.00275)		Tinzaparin(DB06822)	GATAGTGAGGTTATTTCCTGC	0.627																																					p.X838X		.											.	ADAMTS4-230	0			c.A2514G						.						18.0	23.0	22.0					1																	161160928		2172	4255	6427	SO:0001819	synonymous_variant	9507	exon9			GTGAGGTTATTTC	AB014588	CCDS1223.1	1q31-q32	2008-02-05	2005-08-19		ENSG00000158859	ENSG00000158859		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	220	protein-coding gene	gene with protein product		603876	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 4"""			10094461	Standard	NM_005099		Approved	KIAA0688, ADAMTS-2, ADMP-1	uc001fyt.4	O75173	OTTHUMG00000034349	ENST00000367996.5:c.2514A>G	1.37:g.161160928T>C		Somatic	32	0		WXS	Illumina GAIIx	Phase_I	43	4	NM_005099	0	0	0	0	0	Q5VTW2|Q6P4Q8|Q6UWA8|Q9UN83	Silent	SNP	ENST00000367996.5	37	CCDS1223.1																																																																																			.		0.627	ADAMTS4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000083066.2	NM_005099	
LAMC1	3915	bcgsc.ca	37	1	183072590	183072590	+	Silent	SNP	T	T	C	rs2296288	byFrequency	TCGA-OR-A5LR-01A-11D-A29I-10	TCGA-OR-A5LR-10A-01D-A29L-10	T	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a4944d75-a6da-45bb-b5b9-3fa3355b0ead	c2a8460f-138e-44eb-a933-a5cd6ca34d8b	g.chr1:183072590T>C	ENST00000258341.4	+	2	803	c.546T>C	c.(544-546)tgT>tgC	p.C182C		NM_002293.3	NP_002284.3	P11047	LAMC1_HUMAN	laminin, gamma 1 (formerly LAMB2)	182	Laminin N-terminal. {ECO:0000255|PROSITE- ProRule:PRU00466}.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|cell migration (GO:0016477)|endoderm development (GO:0007492)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)|positive regulation of epithelial cell proliferation (GO:0050679)|protein complex assembly (GO:0006461)|substrate adhesion-dependent cell spreading (GO:0034446)	basement membrane (GO:0005604)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|laminin-1 complex (GO:0005606)|laminin-10 complex (GO:0043259)|laminin-11 complex (GO:0043260)	extracellular matrix structural constituent (GO:0005201)|glycosphingolipid binding (GO:0043208)			NS(2)|breast(5)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(17)|lung(27)|ovary(3)|prostate(2)|skin(3)|upper_aerodigestive_tract(3)	76						GTGGTTCCTGTGAGAACACCT	0.552													C|||	2664	0.531949	0.3321	0.6268	5008	,	,		19406	0.628		0.5646	False		,,,				2504	0.6022				p.C182C		.											.	LAMC1-252	0			c.T546C						.	C		1657,2749	658.8+/-400.5	337,983,883	88.0	81.0	83.0		546	-3.3	1.0	1	dbSNP_100	83	4913,3687	528.5+/-381.4	1352,2209,739	no	coding-synonymous	LAMC1	NM_002293.3		1689,3192,1622	CC,CT,TT		42.8721,37.6078,49.4849		182/1610	183072590	6570,6436	2203	4300	6503	SO:0001819	synonymous_variant	3915	exon2			TTCCTGTGAGAAC	J03202	CCDS1351.1	1q31	2013-03-01			ENSG00000135862	ENSG00000135862		"""Laminins"""	6492	protein-coding gene	gene with protein product		150290		LAMB2		3234037	Standard	NM_002293		Approved		uc001gpy.4	P11047	OTTHUMG00000035418	ENST00000258341.4:c.546T>C	1.37:g.183072590T>C		Somatic	355	3		WXS	Illumina GAIIx	Phase_I	267	9	NM_002293	0	0	7	7	0	Q5VYE7	Silent	SNP	ENST00000258341.4	37	CCDS1351.1																																																																																			T|0.486;C|0.514		0.552	LAMC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000085954.2	NM_002293	
CR1	1378	bcgsc.ca	37	1	207787796	207787796	+	Missense_Mutation	SNP	T	T	C	rs61822976		TCGA-OR-A5LR-01A-11D-A29I-10	TCGA-OR-A5LR-10A-01D-A29L-10	T	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a4944d75-a6da-45bb-b5b9-3fa3355b0ead	c2a8460f-138e-44eb-a933-a5cd6ca34d8b	g.chr1:207787796T>C	ENST00000367049.4	+	40	6623	c.6623T>C	c.(6622-6624)aTg>aCg	p.M2208T	CR1_ENST00000400960.2_Missense_Mutation_p.M1758T|CR1_ENST00000367053.1_Missense_Mutation_p.M1758T|CR1_ENST00000367051.1_Missense_Mutation_p.M1758T|CR1_ENST00000367052.1_Missense_Mutation_p.M1758T	NM_000651.4	NP_000642.3	P17927	CR1_HUMAN	complement component (3b/4b) receptor 1 (Knops blood group)	1758					complement activation, classical pathway (GO:0006958)|complement receptor mediated signaling pathway (GO:0002430)|innate immune response (GO:0045087)|negative regulation of complement activation, alternative pathway (GO:0045957)|negative regulation of complement activation, classical pathway (GO:0045959)|negative regulation of serine-type endopeptidase activity (GO:1900004)|positive regulation of serine-type endopeptidase activity (GO:1900005)|regulation of complement activation (GO:0030449)	cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	complement component C3b binding (GO:0001851)|complement component C3b receptor activity (GO:0004877)|complement component C4b binding (GO:0001855)|complement component C4b receptor activity (GO:0001861)	p.M1758T(1)|p.M2208T(1)|p.M1763T(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(9)|kidney(11)|large_intestine(13)|lung(33)|ovary(3)|prostate(6)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	82						TTGGCTGGAATGAAAGCCCTT	0.408																																					p.M2208T		.											.	CR1-93	3	Substitution - Missense(3)	prostate(3)	c.T6623C						.						128.0	121.0	123.0					1																	207787796		1882	4112	5994	SO:0001583	missense	1378	exon40			CTGGAATGAAAGC	Y00816	CCDS44308.1, CCDS44309.1	1q32	2014-07-19	2006-01-12		ENSG00000203710	ENSG00000203710		"""CD molecules"", ""Blood group antigens"", ""Complement system"""	2334	protein-coding gene	gene with protein product		120620	"""complement component (3b/4b) receptor 1, including Knops blood group system"""			1708809	Standard	XM_005273064		Approved	CD35, KN	uc001hfx.3	P17927	OTTHUMG00000036311	ENST00000367049.4:c.6623T>C	1.37:g.207787796T>C	ENSP00000356016:p.Met2208Thr	Somatic	283	2		WXS	Illumina GAIIx	Phase_I	201	12	NM_000651	0	0	0	0	0	Q16744|Q16745|Q5SR43|Q5SR45|Q9UQV2	Missense_Mutation	SNP	ENST00000367049.4	37	CCDS44308.1	.	.	.	.	.	.	.	.	.	.	T	3.803	-0.041226	0.07452	.	.	ENSG00000203710	ENST00000367052;ENST00000367051;ENST00000367053;ENST00000400960;ENST00000367049	T;T;T;T;T	0.22336	1.96;1.96;1.96;1.96;1.96	4.29	-5.87	0.02297	Complement control module (2);Sushi/SCR/CCP (3);	.	.	.	.	T	0.09335	0.0230	N	0.20986	0.625	0.09310	N	1	B;P	0.46457	0.043;0.878	B;B	0.42422	0.009;0.387	T	0.19614	-1.0300	9	0.18276	T	0.48	.	1.2481	0.01977	0.4109:0.0944:0.2677:0.2271	rs61822976	1758;2208	P17927;E9PDY4	CR1_HUMAN;.	T	1758;1758;1758;1758;2208	ENSP00000356019:M1758T;ENSP00000356018:M1758T;ENSP00000356020:M1758T;ENSP00000383744:M1758T;ENSP00000356016:M2208T	ENSP00000356016:M2208T	M	+	2	0	CR1	205854419	0.002000	0.14202	0.000000	0.03702	0.554000	0.35429	-0.327000	0.07955	-0.793000	0.04475	0.358000	0.22013	ATG	.		0.408	CR1-012	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382527.1	NM_000573	
OR2L3	391192	ucsc.edu	37	1	248224578	248224578	+	Missense_Mutation	SNP	T	T	C	rs60743763	byFrequency	TCGA-OR-A5LR-01A-11D-A29I-10	TCGA-OR-A5LR-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a4944d75-a6da-45bb-b5b9-3fa3355b0ead	c2a8460f-138e-44eb-a933-a5cd6ca34d8b	g.chr1:248224578T>C	ENST00000359959.3	+	1	595	c.595T>C	c.(595-597)Ttt>Ctt	p.F199L	OR2L13_ENST00000366478.2_Intron	NM_001004687.1	NP_001004687.1	Q8NG85	OR2L3_HUMAN	olfactory receptor, family 2, subfamily L, member 3	199						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			cervix(1)|endometrium(2)|large_intestine(7)|lung(28)|prostate(1)|skin(1)|urinary_tract(1)	41	all_cancers(71;0.000149)|all_epithelial(71;1.27e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0278)			GGGCACAGTGTTTTTGAGCAC	0.488													t|||	389	0.0776757	0.1324	0.0288	5008	,	,		24690	0.119		0.0626	False		,,,				2504	0.0112				p.F199L		.											.	OR2L3-68	0			c.T595C						.						179.0	198.0	191.0					1																	248224578		2189	4300	6489	SO:0001583	missense	391192	exon1			ACAGTGTTTTTGA	AB065950	CCDS31104.1	1q44	2012-08-09			ENSG00000198128	ENSG00000198128		"""GPCR / Class A : Olfactory receptors"""	15009	protein-coding gene	gene with protein product							Standard	NM_001004687		Approved		uc001idx.1	Q8NG85	OTTHUMG00000040195	ENST00000359959.3:c.595T>C	1.37:g.248224578T>C	ENSP00000353044:p.Phe199Leu	Somatic	235	9		WXS	Illumina GAIIx	Phase_I	107	23	NM_001004687	0	0	0	0	0	B9EH44	Missense_Mutation	SNP	ENST00000359959.3	37	CCDS31104.1	145	0.06639194139194139	38	0.07723577235772358	9	0.024861878453038673	67	0.11713286713286714	31	0.040897097625329816	T	7.648	0.682293	0.14907	.	.	ENSG00000198128	ENST00000359959	T	0.00042	8.84	2.05	0.915	0.19366	GPCR, rhodopsin-like superfamily (1);	0.000000	0.33732	U	0.004607	T	0.00012	0.0000	N	0.13043	0.29	0.09310	N	1	P	0.49447	0.924	P	0.56088	0.791	T	0.44667	-0.9313	10	0.51188	T	0.08	.	0.1554	0.00097	0.2252:0.2557:0.23:0.2891	rs60743763	199	Q8NG85	OR2L3_HUMAN	L	199	ENSP00000353044:F199L	ENSP00000353044:F199L	F	+	1	0	OR2L3	246291201	0.000000	0.05858	0.068000	0.19968	0.037000	0.13140	-2.920000	0.00694	0.928000	0.37168	0.379000	0.24179	TTT	T|0.975;C|0.025		0.488	OR2L3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096852.1	NM_001004687	
CSGALNACT2	55454	broad.mit.edu	37	10	43659419	43659419	+	Missense_Mutation	SNP	G	G	T	rs79064394		TCGA-OR-A5LR-01A-11D-A29I-10	TCGA-OR-A5LR-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a4944d75-a6da-45bb-b5b9-3fa3355b0ead	c2a8460f-138e-44eb-a933-a5cd6ca34d8b	g.chr10:43659419G>T	ENST00000374466.3	+	5	1421	c.1086G>T	c.(1084-1086)ttG>ttT	p.L362F		NM_018590.3	NP_061060.3	Q8N6G5	CGAT2_HUMAN	chondroitin sulfate N-acetylgalactosaminyltransferase 2	362					carbohydrate metabolic process (GO:0005975)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate metabolic process (GO:0030204)|chondroitin sulfate proteoglycan biosynthetic process (GO:0050650)|chondroitin sulfate proteoglycan biosynthetic process, polysaccharide chain biosynthetic process (GO:0050653)|dermatan sulfate proteoglycan biosynthetic process (GO:0050651)|dermatan sulfate proteoglycan biosynthetic process, polysaccharide chain biosynthetic process (GO:0050652)|glycosaminoglycan metabolic process (GO:0030203)|proteoglycan biosynthetic process (GO:0030166)|small molecule metabolic process (GO:0044281)	Golgi cisterna membrane (GO:0032580)|Golgi membrane (GO:0000139)|integral component of Golgi membrane (GO:0030173)|membrane (GO:0016020)	acetylgalactosaminyltransferase activity (GO:0008376)|glucuronylgalactosylproteoglycan 4-beta-N-acetylgalactosaminyltransferase activity (GO:0047237)|metal ion binding (GO:0046872)	p.L362F(5)		endometrium(12)|kidney(3)|large_intestine(5)|lung(16)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	42						GAGAGGTCTTGATGTTTTTCT	0.433																																					p.L362F		.											.	CSGALNACT2-69	5	Substitution - Missense(5)	endometrium(4)|kidney(1)	c.G1086T						.						223.0	221.0	222.0					10																	43659419		2203	4300	6503	SO:0001583	missense	55454	exon5			GGTCTTGATGTTT	AF116646	CCDS7201.1	10q11.21	2013-02-19			ENSG00000169826	ENSG00000169826		"""Beta 4-glycosyltransferases"""	24292	protein-coding gene	gene with protein product	"""chondroitin beta1,4 N-acetylgalactosaminyltransferase 2"""					12446672	Standard	NM_018590		Approved	GALNACT2, MGC40204, PRO0082, GALNACT-2	uc001jan.4	Q8N6G5	OTTHUMG00000018023	ENST00000374466.3:c.1086G>T	10.37:g.43659419G>T	ENSP00000363590:p.Leu362Phe	Somatic	154	1		WXS	Illumina GAIIx	Phase_I	136	5	NM_018590	0	0	3	3	0	B3KWL7|Q6MZJ5|Q6MZP6|Q8TCH4|Q9P1I6	Missense_Mutation	SNP	ENST00000374466.3	37	CCDS7201.1	.	.	.	.	.	.	.	.	.	.	G	24.2	4.499782	0.85176	.	.	ENSG00000169826	ENST00000374466	T	0.27256	1.68	6.08	5.17	0.71159	.	0.064535	0.64402	D	0.000004	T	0.57359	0.2048	M	0.89095	3.005	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.63721	-0.6573	10	0.87932	D	0	-11.7375	14.8306	0.70146	0.0683:0.0:0.9317:0.0	.	362	Q8N6G5	CGAT2_HUMAN	F	362	ENSP00000363590:L362F	ENSP00000363590:L362F	L	+	3	2	CSGALNACT2	42979425	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	1.683000	0.37638	2.894000	0.99253	0.591000	0.81541	TTG	.		0.433	CSGALNACT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047693.1	NM_018590	
TYSND1	219743	bcgsc.ca	37	10	71906150	71906150	+	Missense_Mutation	SNP	T	T	C	rs4746970	byFrequency	TCGA-OR-A5LR-01A-11D-A29I-10	TCGA-OR-A5LR-10A-01D-A29L-10	T	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a4944d75-a6da-45bb-b5b9-3fa3355b0ead	c2a8460f-138e-44eb-a933-a5cd6ca34d8b	g.chr10:71906150T>C	ENST00000287078.6	-	1	192	c.193A>G	c.(193-195)Acc>Gcc	p.T65A	TYSND1_ENST00000335494.5_Missense_Mutation_p.T65A|TYSND1_ENST00000494143.1_5'Flank	NM_173555.2	NP_775826.2	Q2T9J0	TYSD1_HUMAN	trypsin domain containing 1	65			T -> A (in dbSNP:rs4746970). {ECO:0000269|PubMed:15489334}.		protein homooligomerization (GO:0051260)|protein processing (GO:0016485)|proteolysis (GO:0006508)|regulation of fatty acid beta-oxidation (GO:0031998)	membrane (GO:0016020)|peroxisome (GO:0005777)	identical protein binding (GO:0042802)|protease binding (GO:0002020)|serine-type endopeptidase activity (GO:0004252)			endometrium(2)|large_intestine(2)|liver(1)|lung(3)|prostate(1)	9						CCGGCCGCGGTCAGGACTTCG	0.726													T|||	1930	0.385383	0.1679	0.513	5008	,	,		13022	0.5327		0.4115	False		,,,				2504	0.41				p.T65A		.											.	TYSND1-135	0			c.A193G						.	T	ALA/THR,ALA/THR	733,3169		101,531,1319	7.0	8.0	8.0		193,193	2.6	0.0	10	dbSNP_111	8	2989,4601		673,1643,1479	yes	missense,missense	TYSND1	NM_001040273.1,NM_173555.2	58,58	774,2174,2798	CC,CT,TT		39.3808,18.7852,32.3877	benign,benign	65/399,65/567	71906150	3722,7770	1951	3795	5746	SO:0001583	missense	219743	exon1			CCGCGGTCAGGAC	BC016840	CCDS31213.1, CCDS31214.1	10q22.1	2009-11-06		2006-09-21	ENSG00000156521	ENSG00000156521			28531	protein-coding gene	gene with protein product		611017				17255948	Standard	NM_173555		Approved	MGC34695, NET41	uc001jqr.4	Q2T9J0	OTTHUMG00000018397	ENST00000287078.6:c.193A>G	10.37:g.71906150T>C	ENSP00000287078:p.Thr65Ala	Somatic	9	1		WXS	Illumina GAIIx	Phase_I	36	33	NM_173555	0	0	0	2	2	Q5SQT4|Q5SQU1|Q8N6H2|Q96AR5	Missense_Mutation	SNP	ENST00000287078.6	37	CCDS31213.1	903	0.41346153846153844	77	0.1565040650406504	179	0.494475138121547	330	0.5769230769230769	317	0.4182058047493404	T	3.128	-0.179013	0.06380	0.187852	0.393808	ENSG00000156521	ENST00000287078;ENST00000335494	T;T	0.47177	0.85;0.85	4.98	2.59	0.31030	.	0.704604	0.13805	N	0.361502	T	0.00012	0.0000	L	0.47716	1.5	0.80722	P	0.0	B;B	0.09022	0.002;0.0	B;B	0.08055	0.003;0.001	T	0.42068	-0.9473	9	0.44086	T	0.13	-20.2145	2.3036	0.04168	0.2184:0.3024:0.0:0.4792	rs4746970;rs17854223	65;65	Q2T9J0-2;Q2T9J0	.;TYSD1_HUMAN	A	65	ENSP00000287078:T65A;ENSP00000335673:T65A	ENSP00000287078:T65A	T	-	1	0	TYSND1	71576156	0.001000	0.12720	0.030000	0.17652	0.297000	0.27493	0.483000	0.22292	0.905000	0.36596	0.418000	0.28097	ACC	T|0.585;C|0.415		0.726	TYSND1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048483.1	NM_173555	
ADAMTS14	140766	ucsc.edu	37	10	72498690	72498690	+	Nonsense_Mutation	SNP	T	T	A			TCGA-OR-A5LR-01A-11D-A29I-10	TCGA-OR-A5LR-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a4944d75-a6da-45bb-b5b9-3fa3355b0ead	c2a8460f-138e-44eb-a933-a5cd6ca34d8b	g.chr10:72498690T>A	ENST00000373207.1	+	11	1692	c.1692T>A	c.(1690-1692)tgT>tgA	p.C564*	ADAMTS14_ENST00000373208.1_Nonsense_Mutation_p.C567*	NM_080722.3	NP_542453.2	Q8WXS8	ATS14_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 14	564	TSP type-1 1. {ECO:0000255|PROSITE- ProRule:PRU00210}.				collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular matrix organization (GO:0030198)	extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			NS(1)|autonomic_ganglia(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(11)|lung(15)|ovary(7)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	50						TTGGGTCATGTTCGCGGTCAT	0.637																																					p.C567X		.											.	ADAMTS14-232	0			c.T1701A						.						71.0	64.0	67.0					10																	72498690		2203	4300	6503	SO:0001587	stop_gained	140766	exon11			GTCATGTTCGCGG	AF358666	CCDS7306.1, CCDS7307.1	10q21	2008-08-01	2005-08-19		ENSG00000138316	ENSG00000138316		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	14899	protein-coding gene	gene with protein product		607506	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 14"""			11779638	Standard	NM_139155		Approved		uc001jrg.3	Q8WXS8	OTTHUMG00000018414	ENST00000373207.1:c.1692T>A	10.37:g.72498690T>A	ENSP00000362303:p.Cys564*	Somatic	72	1		WXS	Illumina GAIIx	Phase_I	42	4	NM_139155	0	0	0	0	0	Q5T4G0|Q5T4G1|Q8TE55|Q8TEY8	Nonsense_Mutation	SNP	ENST00000373207.1	37	CCDS7306.1	.	.	.	.	.	.	.	.	.	.	T	38	6.828038	0.97869	.	.	ENSG00000138316	ENST00000373208;ENST00000373207	.	.	.	4.89	-0.0368	0.13887	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	8.9927	0.36033	0.0:0.4925:0.0:0.5075	.	.	.	.	X	567;564	.	ENSP00000362303:C564X	C	+	3	2	ADAMTS14	72168696	1.000000	0.71417	0.967000	0.41034	0.969000	0.65631	0.959000	0.29240	0.065000	0.16485	0.374000	0.22700	TGT	.		0.637	ADAMTS14-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000048522.1	NM_080722	
TAF5	6877	hgsc.bcm.edu	37	10	105128134	105128134	+	Missense_Mutation	SNP	T	T	G	rs10883859	byFrequency	TCGA-OR-A5LR-01A-11D-A29I-10	TCGA-OR-A5LR-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a4944d75-a6da-45bb-b5b9-3fa3355b0ead	c2a8460f-138e-44eb-a933-a5cd6ca34d8b	g.chr10:105128134T>G	ENST00000369839.3	+	1	411	c.388T>G	c.(388-390)Tcc>Gcc	p.S130A	TAF5_ENST00000351396.4_Missense_Mutation_p.S130A	NM_006951.3	NP_008882.2	Q15542	TAF5_HUMAN	TAF5 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 100kDa	130			S -> A (in dbSNP:rs10883859). {ECO:0000269|PubMed:15489334, ECO:0000269|PubMed:8758937, ECO:0000269|PubMed:9045704, ECO:0000269|Ref.5}.		chromatin modification (GO:0016568)|DNA-templated transcription, initiation (GO:0006352)|gene expression (GO:0010467)|histone acetylation (GO:0016573)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	actin cytoskeleton (GO:0015629)|intracellular membrane-bounded organelle (GO:0043231)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor TFIID complex (GO:0005669)|transcription factor TFTC complex (GO:0033276)	protein dimerization activity (GO:0046983)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			breast(1)|central_nervous_system(1)|kidney(2)|large_intestine(5)|lung(4)|ovary(2)	15		Colorectal(252;0.0747)|Breast(234;0.128)		Epithelial(162;1.83e-09)|all cancers(201;1.4e-08)|BRCA - Breast invasive adenocarcinoma(275;0.198)		AGTGGCGGGCTCCGGAGCCCC	0.741													T|||	1553	0.310104	0.1952	0.4078	5008	,	,		9029	0.4206		0.329	False		,,,				2504	0.2628				p.S130A		.											.	TAF5-92	0			c.T388G						.	T	ALA/SER	635,2955		63,509,1223	3.0	5.0	4.0		388	1.9	1.0	10	dbSNP_120	4	2122,5176		327,1468,1854	no	missense	TAF5	NM_006951.3	99	390,1977,3077	GG,GT,TT		29.0765,17.688,25.3215	benign	130/801	105128134	2757,8131	1795	3649	5444	SO:0001583	missense	6877	exon1			GCGGGCTCCGGAG	X95525	CCDS7547.1	10q24-q25.2	2013-01-10	2002-08-29	2001-12-07	ENSG00000148835	ENSG00000148835		"""WD repeat domain containing"""	11539	protein-coding gene	gene with protein product		601787	"""TATA box binding protein (TBP)-associated factor, RNA polymerase II, D, 100kD"""	TAF2D		8884287, 8942982	Standard	NM_006951		Approved	TAFII100	uc001kwv.3	Q15542	OTTHUMG00000018985	ENST00000369839.3:c.388T>G	10.37:g.105128134T>G	ENSP00000358854:p.Ser130Ala	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	8	8	NM_006951	0	0	0	1	1	A8K5B4|B2RMR0|B7ZKJ6|Q53EM4|Q5SYD5|Q86UZ7|Q9Y4K5	Missense_Mutation	SNP	ENST00000369839.3	37	CCDS7547.1	821	0.3759157509157509	127	0.258130081300813	150	0.4143646408839779	277	0.48426573426573427	267	0.35224274406332456	T	12.78	2.040311	0.35989	0.17688	0.290765	ENSG00000148835	ENST00000369839;ENST00000351396	T;T	0.55930	0.73;0.49	4.45	1.88	0.25563	.	0.435426	0.24978	N	0.034100	T	0.00012	0.0000	N	0.04508	-0.205	0.41867	P	0.009742999999999946	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.0	T	0.46373	-0.9196	9	0.09338	T	0.73	-0.0936	6.2404	0.20787	0.1492:0.0:0.2595:0.5913	rs10883859	130;130	Q15542-2;Q15542	.;TAF5_HUMAN	A	130	ENSP00000358854:S130A;ENSP00000311024:S130A	ENSP00000311024:S130A	S	+	1	0	TAF5	105118124	0.988000	0.35896	1.000000	0.80357	0.948000	0.59901	0.932000	0.28884	0.814000	0.34374	0.459000	0.35465	TCC	T|0.623;G|0.377		0.741	TAF5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050144.1		
KNDC1	85442	hgsc.bcm.edu	37	10	135015263	135015263	+	Missense_Mutation	SNP	C	C	T	rs199987564	byFrequency	TCGA-OR-A5LR-01A-11D-A29I-10	TCGA-OR-A5LR-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a4944d75-a6da-45bb-b5b9-3fa3355b0ead	c2a8460f-138e-44eb-a933-a5cd6ca34d8b	g.chr10:135015263C>T	ENST00000304613.3	+	17	3269	c.3248C>T	c.(3247-3249)cCa>cTa	p.P1083L	KNDC1_ENST00000368571.2_Missense_Mutation_p.P1018L|KNDC1_ENST00000368572.2_Missense_Mutation_p.P1085L			Q76NI1	VKIND_HUMAN	kinase non-catalytic C-lobe domain (KIND) containing 1	1083					cerebellar granule cell differentiation (GO:0021707)|positive regulation of protein phosphorylation (GO:0001934)|regulation of dendrite morphogenesis (GO:0048814)|small GTPase mediated signal transduction (GO:0007264)	dendrite (GO:0030425)|guanyl-nucleotide exchange factor complex (GO:0032045)|neuronal cell body (GO:0043025)	protein serine/threonine kinase activity (GO:0004674)|Ras guanyl-nucleotide exchange factor activity (GO:0005088)			NS(4)|breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(27)|ovary(1)|prostate(5)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	60		all_cancers(35;4.16e-10)|all_epithelial(44;2.07e-08)|Lung NSC(174;0.000845)|all_lung(145;0.00145)|all_neural(114;0.0299)|Melanoma(40;0.123)|Colorectal(31;0.173)|Glioma(114;0.203)		OV - Ovarian serous cystadenocarcinoma(35;8.77e-06)|Epithelial(32;1.13e-05)|all cancers(32;1.51e-05)		TCCCCCGGCCCAGCCGGATTC	0.706													C|||	2	0.000399361	0.0	0.0	5008	,	,		14257	0.0		0.002	False		,,,				2504	0.0				p.P1083L		.											.	KNDC1-229	0			c.C3248T						.	C	LEU/PRO	1,4369		0,1,2184	10.0	13.0	12.0		3248	3.4	0.0	10		12	9,8525		0,9,4258	no	missense	KNDC1	NM_152643.6	98	0,10,6442	TT,TC,CC		0.1055,0.0229,0.0775	benign	1083/1750	135015263	10,12894	2185	4267	6452	SO:0001583	missense	85442	exon17			CCGGCCCAGCCGG	AK074179	CCDS7674.1	10q26.3	2004-09-14	2004-04-07		ENSG00000171798	ENSG00000171798			29374	protein-coding gene	gene with protein product			"""RasGEF domain family, member 2"""	RASGEF2, C10orf23		11214970	Standard	NM_152643		Approved	KIAA1768, bB439H18.3, FLJ25027	uc001llz.1	Q76NI1	OTTHUMG00000019303	ENST00000304613.3:c.3248C>T	10.37:g.135015263C>T	ENSP00000304437:p.Pro1083Leu	Somatic	6	0		WXS	Illumina GAIIx	Phase_I	66	9	NM_152643	0	0	9	9	0	B0QZC5|Q5T233|Q6ZNH8|Q8TEE5|Q96LV7|Q9C095	Missense_Mutation	SNP	ENST00000304613.3	37	CCDS7674.1	.	.	.	.	.	.	.	.	.	.	C	16.63	3.177605	0.57692	2.29E-4	0.001055	ENSG00000171798	ENST00000304613;ENST00000368572;ENST00000368571	T;T;T	0.11604	2.76;2.76;2.76	4.3	3.39	0.38822	.	0.531595	0.15745	N	0.246723	T	0.11153	0.0272	L	0.53249	1.67	0.18873	N	0.999988	B;B;B	0.33318	0.154;0.408;0.296	B;B;B	0.32980	0.156;0.135;0.041	T	0.19745	-1.0296	10	0.21014	T	0.42	-2.5559	10.3324	0.43831	0.0:0.899:0.0:0.101	.	1083;1018;1083	Q76NI1-4;Q76NI1-2;Q76NI1	.;.;VKIND_HUMAN	L	1083;1085;1018	ENSP00000304437:P1083L;ENSP00000357561:P1085L;ENSP00000357560:P1018L	ENSP00000304437:P1083L	P	+	2	0	KNDC1	134865253	0.000000	0.05858	0.001000	0.08648	0.028000	0.11728	-0.040000	0.12104	0.925000	0.37094	0.313000	0.20887	CCA	.		0.706	KNDC1-006	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000277044.3	NM_152643	
RASSF7	8045	broad.mit.edu;ucsc.edu	37	11	562525	562525	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5LR-01A-11D-A29I-10	TCGA-OR-A5LR-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a4944d75-a6da-45bb-b5b9-3fa3355b0ead	c2a8460f-138e-44eb-a933-a5cd6ca34d8b	g.chr11:562525G>A	ENST00000397583.3	+	3	1004	c.571G>A	c.(571-573)Gca>Aca	p.A191T	RASSF7_ENST00000454668.2_Missense_Mutation_p.A191T|C11orf35_ENST00000329451.3_5'Flank|RP11-496I9.1_ENST00000527620.1_RNA|RP11-496I9.1_ENST00000527113.1_RNA|RASSF7_ENST00000397582.3_Missense_Mutation_p.A191T|RASSF7_ENST00000431809.1_Missense_Mutation_p.A191T|RASSF7_ENST00000344375.4_Missense_Mutation_p.A191T	NM_003475.3	NP_003466.1	Q02833	RASF7_HUMAN	Ras association (RalGDS/AF-6) domain family (N-terminal) member 7	191					apoptotic process (GO:0006915)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)				endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|lung(3)|skin(3)	8		all_cancers(49;2.16e-06)|all_epithelial(84;0.000256)|Breast(177;0.00122)|Ovarian(85;0.0228)|Medulloblastoma(188;0.0321)|all_neural(188;0.0762)		all cancers(45;7.18e-28)|Epithelial(43;6.93e-27)|OV - Ovarian serous cystadenocarcinoma(40;6.97e-21)|BRCA - Breast invasive adenocarcinoma(625;3.56e-05)|Lung(200;0.0375)|LUSC - Lung squamous cell carcinoma(625;0.0703)		AGAGGGACAGGCACGCCTGCA	0.701																																					p.A191T	Pancreas(184;1170 3913 7268)	.											.	RASSF7-91	0			c.G571A						.						13.0	13.0	13.0					11																	562525		1904	3711	5615	SO:0001583	missense	8045	exon3			GGACAGGCACGCC	M91083	CCDS7702.1, CCDS44505.1, CCDS44506.1	11p15.5	2008-02-22	2008-02-22	2005-09-14	ENSG00000099849	ENSG00000099849			1166	protein-coding gene	gene with protein product		143023	"""chromosome 11 open reading frame 13"""	C11orf13		1339391	Standard	NM_001143993		Approved	HRC1, HRAS1	uc001lqc.3	Q02833	OTTHUMG00000132004	ENST00000397583.3:c.571G>A	11.37:g.562525G>A	ENSP00000380713:p.Ala191Thr	Somatic	20	0		WXS	Illumina GAIIx	Phase_I	46	5	NM_001143994	0	0	4	4	0	G5E9N9|Q3KP41|Q3KP42	Missense_Mutation	SNP	ENST00000397583.3	37	CCDS7702.1	.	.	.	.	.	.	.	.	.	.	G	10.27	1.304531	0.23736	.	.	ENSG00000099849	ENST00000431809;ENST00000397582;ENST00000344375;ENST00000397583;ENST00000454668	D;D;D;D;D	0.92805	-3.11;-3.11;-3.11;-3.11;-3.11	4.05	3.12	0.35913	.	0.418236	0.25680	N	0.029007	D	0.85617	0.5738	L	0.51422	1.61	0.09310	N	1	P;P;P	0.43477	0.642;0.808;0.642	B;B;B	0.35278	0.199;0.168;0.199	T	0.76413	-0.2968	10	0.22109	T	0.4	5.9654	9.2634	0.37625	0.0857:0.2218:0.6925:0.0	.	191;191;191	G5E9N9;Q02833;Q02833-2	.;RASF7_HUMAN;.	T	191	ENSP00000403068:A191T;ENSP00000380712:A191T;ENSP00000344226:A191T;ENSP00000380713:A191T;ENSP00000405606:A191T	ENSP00000344226:A191T	A	+	1	0	RASSF7	552525	0.124000	0.22315	0.946000	0.38457	0.133000	0.20885	0.419000	0.21247	1.824000	0.53156	0.462000	0.41574	GCA	.		0.701	RASSF7-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000254972.2	NM_003475	
SYT8	90019	hgsc.bcm.edu	37	11	1858572	1858572	+	Missense_Mutation	SNP	C	C	T	rs2292474	byFrequency	TCGA-OR-A5LR-01A-11D-A29I-10	TCGA-OR-A5LR-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a4944d75-a6da-45bb-b5b9-3fa3355b0ead	c2a8460f-138e-44eb-a933-a5cd6ca34d8b	g.chr11:1858572C>T	ENST00000381968.3	+	9	1245	c.1117C>T	c.(1117-1119)Cgg>Tgg	p.R373W	TNNI2_ENST00000381905.3_5'Flank|TNNI2_ENST00000252898.7_5'Flank|TNNI2_ENST00000381911.1_5'Flank|SYT8_ENST00000535046.1_3'UTR|TNNI2_ENST00000381906.1_5'Flank|SYT8_ENST00000341958.3_Missense_Mutation_p.R359W	NM_138567.3	NP_612634	Q8NBV8	SYT8_HUMAN	synaptotagmin VIII	373					acrosome reaction (GO:0007340)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|synaptic vesicle (GO:0008021)	transporter activity (GO:0005215)			breast(1)|large_intestine(1)|lung(2)|ovary(1)|skin(1)	6		all_epithelial(84;0.000138)|Breast(177;0.000962)|Ovarian(85;0.0014)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00136)|Lung(200;0.0681)|LUSC - Lung squamous cell carcinoma(625;0.082)		CATTGCCCAGCGGCACCCCCT	0.731													T|||	1928	0.384984	0.1679	0.415	5008	,	,		13483	0.378		0.498	False		,,,				2504	0.5481				p.R373W		.											.	SYT8-91	0			c.C1117T						.	T	TRP/ARG	906,3442		119,668,1387	12.0	14.0	14.0		1117	2.7	1.0	11	dbSNP_100	14	4072,4398		1026,2020,1189	no	missense	SYT8	NM_138567.3	101	1145,2688,2576	TT,TC,CC		48.0756,20.8372,38.836	benign	373/402	1858572	4978,7840	2174	4235	6409	SO:0001583	missense	90019	exon9			GCCCAGCGGCACC	AL137708	CCDS7726.2	11p15.5	2013-01-21			ENSG00000149043	ENSG00000149043		"""Synaptotagmins"""	19264	protein-coding gene	gene with protein product		607719				7791877	Standard	XM_005253216		Approved	DKFZp434K0322	uc001lue.1	Q8NBV8	OTTHUMG00000009026	ENST00000381968.3:c.1117C>T	11.37:g.1858572C>T	ENSP00000371394:p.Arg373Trp	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	10	10	NM_138567	0	0	0	0	0	A6NFJ4|Q9NSV9	Missense_Mutation	SNP	ENST00000381968.3	37	CCDS7726.2	855|855	0.3914835164835165|0.3914835164835165	84|84	0.17073170731707318|0.17073170731707318	163|163	0.45027624309392267|0.45027624309392267	226|226	0.3951048951048951|0.3951048951048951	382|382	0.503957783641161|0.503957783641161	t|t	1.107|1.107	-0.659353|-0.659353	0.03454|0.03454	0.208372|0.208372	0.480756|0.480756	ENSG00000149043|ENSG00000149043	ENST00000381978|ENST00000381968;ENST00000341958	.|T;T	.|0.03951	.|3.77;3.75	3.85|3.85	2.68|2.68	0.31781|0.31781	.|.	.|.	.|.	.|.	.|.	T|T	0.00012|0.00012	0.0000|0.0000	N|N	0.00005|0.00005	-3.275|-3.275	0.09310|0.09310	P|P	1.0|1.0	.|B;B	.|0.02656	.|0.0;0.0	.|B;B	.|0.01281	.|0.0;0.0	T|T	0.41928|0.41928	-0.9481|-0.9481	4|8	.|0.02654	.|T	.|1	.|.	8.5203|8.5203	0.33270|0.33270	0.0:0.1655:0.0:0.8345|0.0:0.1655:0.0:0.8345	rs2292474|rs2292474	.|373;359	.|Q8NBV8;A6NCR4	.|SYT8_HUMAN;.	V|W	371|373;359	.|ENSP00000371394:R373W;ENSP00000343691:R359W	.|ENSP00000343691:R359W	A|R	+|+	2|1	0|2	SYT8|SYT8	1815148|1815148	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.293000|0.293000	0.27360|0.27360	3.304000|3.304000	0.51866|0.51866	0.174000|0.174000	0.19809|0.19809	-0.665000|-0.665000	0.03846|0.03846	GCG|CGG	C|0.602;T|0.398		0.731	SYT8-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000025013.4		
OR51D1	390038	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	4661767	4661767	+	Missense_Mutation	SNP	G	G	T			TCGA-OR-A5LR-01A-11D-A29I-10	TCGA-OR-A5LR-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a4944d75-a6da-45bb-b5b9-3fa3355b0ead	c2a8460f-138e-44eb-a933-a5cd6ca34d8b	g.chr11:4661767G>T	ENST00000357605.2	+	1	823	c.747G>T	c.(745-747)aaG>aaT	p.K249N	OR51E1_ENST00000396952.5_5'Flank	NM_001004751.2	NP_001004751.1	Q8NGF3	O51D1_HUMAN	olfactory receptor, family 51, subfamily D, member 1	249						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|liver(2)|lung(14)|prostate(1)|skin(2)|urinary_tract(1)	27		Medulloblastoma(188;0.0075)|Breast(177;0.0461)|all_neural(188;0.0577)		Epithelial(150;2.74e-13)|BRCA - Breast invasive adenocarcinoma(625;0.00435)|GBM - Glioblastoma multiforme(2;0.0841)|LUSC - Lung squamous cell carcinoma(625;0.19)		CAGCACTCAAGGCTTTCAACA	0.552																																					p.K249N		.											.	OR51D1-68	0			c.G747T						.						179.0	162.0	168.0					11																	4661767		2201	4298	6499	SO:0001583	missense	390038	exon1			ACTCAAGGCTTTC	AB065855	CCDS31357.1	11p15.4	2012-08-09			ENSG00000197428	ENSG00000197428		"""GPCR / Class A : Olfactory receptors"""	15193	protein-coding gene	gene with protein product							Standard	NM_001004751		Approved	OR51D1Q	uc010qyk.2	Q8NGF3	OTTHUMG00000165724	ENST00000357605.2:c.747G>T	11.37:g.4661767G>T	ENSP00000350222:p.Lys249Asn	Somatic	99	0		WXS	Illumina GAIIx	Phase_I	80	69	NM_001004751	0	0	0	0	0	B9EIK4	Missense_Mutation	SNP	ENST00000357605.2	37	CCDS31357.1	.	.	.	.	.	.	.	.	.	.	G	11.55	1.671428	0.29693	.	.	ENSG00000197428	ENST00000357605	T	0.00374	7.72	4.58	2.67	0.31697	GPCR, rhodopsin-like superfamily (1);	0.000000	0.47093	D	0.000247	T	0.01421	0.0046	H	0.97131	3.945	0.40612	D	0.981686	D	0.76494	0.999	D	0.79108	0.992	T	0.32188	-0.9916	10	0.87932	D	0	.	8.6498	0.34027	0.2599:0.0:0.7401:0.0	.	249	Q8NGF3	O51D1_HUMAN	N	249	ENSP00000350222:K249N	ENSP00000350222:K249N	K	+	3	2	OR51D1	4618343	0.181000	0.23161	1.000000	0.80357	0.097000	0.18754	-0.442000	0.06871	0.637000	0.30526	0.563000	0.77884	AAG	.		0.552	OR51D1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385956.1	NM_001004751	
PTPMT1	114971	hgsc.bcm.edu	37	11	47587369	47587369	+	Intron	SNP	C	C	T			TCGA-OR-A5LR-01A-11D-A29I-10	TCGA-OR-A5LR-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a4944d75-a6da-45bb-b5b9-3fa3355b0ead	c2a8460f-138e-44eb-a933-a5cd6ca34d8b	g.chr11:47587369C>T	ENST00000326674.9	+	1	196				PTPMT1_ENST00000426530.2_Silent_p.P65P|PTPMT1_ENST00000534775.1_Silent_p.P65P|NDUFS3_ENST00000533507.1_Intron|PTPMT1_ENST00000326656.8_Intron	NM_175732.2	NP_783859.1	Q8WUK0	PTPM1_HUMAN	protein tyrosine phosphatase, mitochondrial 1						cardiolipin biosynthetic process (GO:0032049)|glycerophospholipid biosynthetic process (GO:0046474)|inositol phosphate dephosphorylation (GO:0046855)|phosphatidylglycerol biosynthetic process (GO:0006655)|phospholipid metabolic process (GO:0006644)|protein dephosphorylation (GO:0006470)|small molecule metabolic process (GO:0044281)	mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	phosphatidylglycerophosphatase activity (GO:0008962)|phosphatidylinositol-4,5-bisphosphate 5-phosphatase activity (GO:0004439)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)			breast(1)|kidney(1)|large_intestine(2)|lung(1)|skin(1)	6						CCGGGGAGCCCGGGCCCCTGC	0.741																																					p.P65P		.											.	PTPMT1-23	0			c.C195T						.						5.0	6.0	6.0					11																	47587369		1777	3929	5706	SO:0001627	intron_variant	114971	exon1			GGAGCCCGGGCCC	BC014048	CCDS41643.1, CCDS44593.1	11p11.2	2011-06-09			ENSG00000110536	ENSG00000110536	3.1.3.36	"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Atypical dual specificity phosphatases"""	26965	protein-coding gene	gene with protein product		609538				12477932	Standard	NM_175732		Approved	PLIP, DUSP23, MOSP	uc001nfs.4	Q8WUK0	OTTHUMG00000166892	ENST00000326674.9:c.174+21C>T	11.37:g.47587369C>T		Somatic	1	0		WXS	Illumina GAIIx	Phase_I	35	34	NM_001143984	0	0	1	2	1	E9PAT8|Q7Z557|Q96CR2|Q9BXV8	Silent	SNP	ENST00000326674.9	37	CCDS41643.1																																																																																			.		0.741	PTPMT1-002	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391746.1	XM_374879	
OR5D18	219438	bcgsc.ca	37	11	55587212	55587212	+	Missense_Mutation	SNP	A	A	G	rs7948629	byFrequency	TCGA-OR-A5LR-01A-11D-A29I-10	TCGA-OR-A5LR-10A-01D-A29L-10	A	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a4944d75-a6da-45bb-b5b9-3fa3355b0ead	c2a8460f-138e-44eb-a933-a5cd6ca34d8b	g.chr11:55587212A>G	ENST00000333976.4	+	1	127	c.107A>G	c.(106-108)tAc>tGc	p.Y36C		NM_001001952.1	NP_001001952.1	Q8NGL1	OR5DI_HUMAN	olfactory receptor, family 5, subfamily D, member 18	36			Y -> C (in dbSNP:rs7948629).			integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(2)|breast(1)|endometrium(3)|large_intestine(6)|lung(33)|ovary(1)|prostate(3)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	55		all_epithelial(135;0.208)				CTGGCCATCTACAATGTCACT	0.458													N|||	123	0.0245607	0.003	0.0259	5008	,	,		17251	0.001		0.0616	False		,,,				2504	0.0389				p.Y36C		.											.	OR5D18-71	0			c.A107G						.	A	CYS/TYR	42,4358		0,42,2158	161.0	150.0	154.0		107	3.6	0.2	11	dbSNP_116	154	535,8057		23,489,3784	yes	missense	OR5D18	NM_001001952.1	194	23,531,5942	GG,GA,AA		6.2267,0.9545,4.4412	probably-damaging	36/314	55587212	577,12415	2200	4296	6496	SO:0001583	missense	219438	exon1			CCATCTACAATGT	AB065781	CCDS31510.1	11q11	2012-08-09			ENSG00000186119	ENSG00000186119		"""GPCR / Class A : Olfactory receptors"""	15285	protein-coding gene	gene with protein product							Standard	NM_001001952		Approved		uc010rin.2	Q8NGL1	OTTHUMG00000166811	ENST00000333976.4:c.107A>G	11.37:g.55587212A>G	ENSP00000335025:p.Tyr36Cys	Somatic	153	1		WXS	Illumina GAIIx	Phase_I	147	6	NM_001001952	0	0	0	0	0	Q6IF67|Q6IFD3|Q96RB3	Missense_Mutation	SNP	ENST00000333976.4	37	CCDS31510.1	50	0.022893772893772892	1	0.0020325203252032522	6	0.016574585635359115	0	0.0	43	0.05672823218997362	.	14.11	2.437675	0.43224	0.009545	0.062267	ENSG00000186119	ENST00000333976	T	0.04706	3.57	4.79	3.64	0.41730	.	0.000000	0.35677	N	0.003044	T	0.02888	0.0086	M	0.92649	3.33	0.09310	N	0.999998	D	0.89917	1.0	D	0.91635	0.999	T	0.02263	-1.1186	10	0.87932	D	0	-30.0673	10.1492	0.42782	0.8503:0.0:0.0:0.1497	rs7948629;rs56831774;rs7948629	36	Q8NGL1	OR5DI_HUMAN	C	36	ENSP00000335025:Y36C	ENSP00000335025:Y36C	Y	+	2	0	OR5D18	55343788	0.971000	0.33674	0.157000	0.22605	0.859000	0.49053	2.534000	0.45676	0.801000	0.34066	0.514000	0.50259	TAC	A|0.964;G|0.036		0.458	OR5D18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391515.1	NM_001001952	
TRIM49	57093	ucsc.edu;bcgsc.ca	37	11	89531780	89531780	+	Missense_Mutation	SNP	G	G	C	rs149578071	byFrequency	TCGA-OR-A5LR-01A-11D-A29I-10	TCGA-OR-A5LR-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a4944d75-a6da-45bb-b5b9-3fa3355b0ead	c2a8460f-138e-44eb-a933-a5cd6ca34d8b	g.chr11:89531780G>C	ENST00000329758.1	-	8	1205	c.877C>G	c.(877-879)Cat>Gat	p.H293D	TRIM49_ENST00000532501.2_Missense_Mutation_p.H216D	NM_020358.2	NP_065091.1	P0CI25	TRI49_HUMAN	tripartite motif containing 49	293	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.					intracellular (GO:0005622)	zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|liver(1)|lung(14)|prostate(1)|skin(2)|stomach(1)	27		Acute lymphoblastic leukemia(157;2.31e-05)|all_hematologic(158;0.00556)				GCTTCTTCATGATGCAGAGTA	0.313																																					p.H293D		.											.	TRIM49-84	0			c.C877G						.						27.0	37.0	34.0					11																	89531780		2150	4292	6442	SO:0001583	missense	57093	exon8			CTTCATGATGCAG	AB037682	CCDS8287.1	11p11.12-q12	2012-05-21	2011-01-25	2004-11-17	ENSG00000168930	ENSG00000168930		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	13431	protein-coding gene	gene with protein product		606124	"""ring finger protein 18"", ""tripartite motif-containing 49"""	RNF18		11018261	Standard	NM_020358		Approved	TRIM49A	uc001pdb.3	P0CI25		ENST00000329758.1:c.877C>G	11.37:g.89531780G>C	ENSP00000327604:p.His293Asp	Somatic	61	2		WXS	Illumina GAIIx	Phase_I	31	13	NM_020358	0	0	0	0	0	A0AVR7|A0AVR9|Q6DJV1|Q9NS80	Missense_Mutation	SNP	ENST00000329758.1	37	CCDS8287.1	314	0.14377289377289376	57	0.11585365853658537	86	0.23756906077348067	96	0.16783216783216784	75	0.09894459102902374	G	1.031	-0.681762	0.03353	.	.	ENSG00000168930	ENST00000329758;ENST00000532501	T	0.60672	0.17	0.539	0.539	0.17156	Concanavalin A-like lectin/glucanase (1);Butyrophylin-like (1);B30.2/SPRY domain (1);	.	.	.	.	T	0.00012	0.0000	L	0.40543	1.245	0.80722	P	0.0	B	0.14438	0.01	B	0.13407	0.009	T	0.13818	-1.0495	6	.	.	.	.	.	.	.	.	293	P0CI25	TRI49_HUMAN	D	293;216	ENSP00000327604:H293D	.	H	-	1	0	TRIM49	89171428	0.000000	0.05858	0.001000	0.08648	0.007000	0.05969	-1.486000	0.02312	0.568000	0.29311	0.194000	0.17425	CAT	G|0.500;C|0.500		0.313	TRIM49-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395435.1	NM_020358	
SLC37A2	219855	bcgsc.ca	37	11	124951752	124951752	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5LR-01A-11D-A29I-10	TCGA-OR-A5LR-10A-01D-A29L-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a4944d75-a6da-45bb-b5b9-3fa3355b0ead	c2a8460f-138e-44eb-a933-a5cd6ca34d8b	g.chr11:124951752C>T	ENST00000403796.2	+	9	1136	c.835C>T	c.(835-837)Cca>Tca	p.P279S	SLC37A2_ENST00000407458.1_Missense_Mutation_p.P279S|SLC37A2_ENST00000298280.5_Missense_Mutation_p.P279S|SLC37A2_ENST00000308074.4_Missense_Mutation_p.P279S	NM_001145290.1	NP_001138762.1	Q8TED4	SPX2_HUMAN	solute carrier family 37 (glucose-6-phosphate transporter), member 2	279					carbohydrate transport (GO:0008643)|transmembrane transport (GO:0055085)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	transporter activity (GO:0005215)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(6)|ovary(2)|prostate(2)|skin(1)|stomach(2)|urinary_tract(1)	27	all_hematologic(175;0.215)	Breast(109;0.012)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.152)|all_lung(97;0.159)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;1.61e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0384)		CTCCAAGGGGCCATGCGAAGA	0.562																																					p.P279S	Melanoma(11;373 620 21213 26083 47768)	.											.	SLC37A2-92	0			c.C835T						.						63.0	61.0	62.0					11																	124951752		2201	4299	6500	SO:0001583	missense	219855	exon9			AAGGGGCCATGCG	AK074100	CCDS31714.1, CCDS44757.1	11q24.2	2013-07-17	2013-07-17		ENSG00000134955	ENSG00000134955		"""Solute carriers"""	20644	protein-coding gene	gene with protein product			"""solute carrier family 37 (glycerol-3-phosphate transporter), member 2"""				Standard	NM_198277		Approved	FLJ00171	uc010sau.2	Q8TED4	OTTHUMG00000165879	ENST00000403796.2:c.835C>T	11.37:g.124951752C>T	ENSP00000384407:p.Pro279Ser	Somatic	109	0		WXS	Illumina GAIIx	Phase_I	94	5	NM_001145290	0	0	2	2	0	A8K2P9|Q6P599|Q7Z7P8|Q8TEM2	Missense_Mutation	SNP	ENST00000403796.2	37	CCDS44757.1	.	.	.	.	.	.	.	.	.	.	C	1.692	-0.503725	0.04261	.	.	ENSG00000134955	ENST00000403796;ENST00000407458;ENST00000298280;ENST00000308074	T;T;T;T	0.58210	0.35;0.35;0.35;0.35	4.0	2.1	0.27182	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.748249	0.13178	N	0.407746	T	0.27697	0.0681	N	0.11064	0.09	0.35839	D	0.825915	B;B	0.06786	0.001;0.001	B;B	0.13407	0.002;0.009	T	0.20306	-1.0279	10	0.08599	T	0.76	-0.3753	8.1322	0.31033	0.0:0.7524:0.1587:0.0889	.	279;279	Q8TED4-2;Q8TED4	.;SPX2_HUMAN	S	279	ENSP00000384407:P279S;ENSP00000385126:P279S;ENSP00000298280:P279S;ENSP00000311833:P279S	ENSP00000298280:P279S	P	+	1	0	SLC37A2	124456962	0.014000	0.17966	0.234000	0.24042	0.025000	0.11179	1.099000	0.31013	0.644000	0.30656	-0.150000	0.13652	CCA	.		0.562	SLC37A2-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000386837.1	XM_166184	
KLRB1	3820	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	12	9751229	9751229	+	Missense_Mutation	SNP	A	A	T			TCGA-OR-A5LR-01A-11D-A29I-10	TCGA-OR-A5LR-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a4944d75-a6da-45bb-b5b9-3fa3355b0ead	c2a8460f-138e-44eb-a933-a5cd6ca34d8b	g.chr12:9751229A>T	ENST00000229402.3	-	4	326	c.280T>A	c.(280-282)Tgc>Agc	p.C94S		NM_002258.2	NP_002249.1	Q12918	KLRB1_HUMAN	killer cell lectin-like receptor subfamily B, member 1	94					cell surface receptor signaling pathway (GO:0007166)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)|transmembrane signaling receptor activity (GO:0004888)			endometrium(2)|large_intestine(6)|lung(4)	12						TATATTGGGCAGTTTAAGAGA	0.383																																					p.C94S		.											.	KLRB1-90	0			c.T280A						.						78.0	80.0	79.0					12																	9751229		2203	4300	6503	SO:0001583	missense	3820	exon4			TTGGGCAGTTTAA	U11276	CCDS8601.1	12p13	2014-05-22			ENSG00000111796	ENSG00000111796		"""Killer cell lectin-like receptors"", ""CD molecules"", ""C-type lectin domain containing"""	6373	protein-coding gene	gene with protein product		602890		NKR		8077657	Standard	NM_002258		Approved	CD161, NKR-P1, NKR-P1A, hNKR-P1A, CLEC5B	uc010sgt.2	Q12918	OTTHUMG00000168581	ENST00000229402.3:c.280T>A	12.37:g.9751229A>T	ENSP00000229402:p.Cys94Ser	Somatic	97	0		WXS	Illumina GAIIx	Phase_I	152	11	NM_002258	0	0	5	5	0	Q24K24	Missense_Mutation	SNP	ENST00000229402.3	37	CCDS8601.1	.	.	.	.	.	.	.	.	.	.	A	15.96	2.986388	0.53934	.	.	ENSG00000111796	ENST00000229402	T	0.38887	1.11	3.63	3.63	0.41609	C-type lectin fold (1);C-type lectin-like (1);C-type lectin (1);	0.000000	0.48767	D	0.000168	T	0.57286	0.2043	M	0.67700	2.07	0.28518	N	0.913209	D	0.89917	1.0	D	0.71414	0.973	T	0.52525	-0.8564	10	0.87932	D	0	-8.6217	8.9346	0.35691	1.0:0.0:0.0:0.0	.	94	Q12918	KLRB1_HUMAN	S	94	ENSP00000229402:C94S	ENSP00000229402:C94S	C	-	1	0	KLRB1	9642496	0.872000	0.30054	0.506000	0.27664	0.007000	0.05969	2.786000	0.47790	1.879000	0.54435	0.528000	0.53228	TGC	.		0.383	KLRB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400280.1	NM_002258	
KRT8	3856	broad.mit.edu	37	12	53298675	53298675	+	Missense_Mutation	SNP	A	A	C			TCGA-OR-A5LR-01A-11D-A29I-10	TCGA-OR-A5LR-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a4944d75-a6da-45bb-b5b9-3fa3355b0ead	c2a8460f-138e-44eb-a933-a5cd6ca34d8b	g.chr12:53298675A>C	ENST00000552551.1	-	2	523	c.91T>G	c.(91-93)Tcc>Gcc	p.S31A	KRT8_ENST00000552150.1_Missense_Mutation_p.S59A|KRT8_ENST00000293308.6_Missense_Mutation_p.S31A|KRT8_ENST00000546897.1_Missense_Mutation_p.S31A			P05787	K2C8_HUMAN	keratin 8	31	Head.|Ser-rich.				cell differentiation involved in embryonic placenta development (GO:0060706)|extrinsic apoptotic signaling pathway (GO:0097191)|hepatocyte apoptotic process (GO:0097284)|response to hydrostatic pressure (GO:0051599)|response to other organism (GO:0051707)|sarcomere organization (GO:0045214)|tumor necrosis factor-mediated signaling pathway (GO:0033209)|viral process (GO:0016032)	cell-cell junction (GO:0005911)|costamere (GO:0043034)|cytoplasm (GO:0005737)|dystrophin-associated glycoprotein complex (GO:0016010)|extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)|keratin filament (GO:0045095)|nucleus (GO:0005634)|sarcolemma (GO:0042383)|Z disc (GO:0030018)	scaffold protein binding (GO:0097110)|structural molecule activity (GO:0005198)	p.S31A(4)		endometrium(5)|large_intestine(1)|liver(1)|lung(3)|ovary(1)|prostate(1)|skin(1)	13				BRCA - Breast invasive adenocarcinoma(357;0.108)	Tenecteplase(DB00031)	CTGATGCGGGAACCGGGCCCA	0.662																																					p.S59A		.											.	KRT8-92	4	Substitution - Missense(4)	endometrium(2)|prostate(1)|liver(1)	c.T175G						.						12.0	14.0	13.0					12																	53298675		2120	4158	6278	SO:0001583	missense	3856	exon2			TGCGGGAACCGGG	BC000654	CCDS8841.1, CCDS58234.1	12q13.13	2013-01-16			ENSG00000170421	ENSG00000170421		"""-"", ""Intermediate filaments type II, keratins (basic)"""	6446	protein-coding gene	gene with protein product		148060				2434381, 1705144, 16831889	Standard	NM_002273		Approved	CARD2, K8, CK8, CYK8, K2C8, KO	uc009zmk.1	P05787	OTTHUMG00000169881	ENST00000552551.1:c.91T>G	12.37:g.53298675A>C	ENSP00000447566:p.Ser31Ala	Somatic	48	1		WXS	Illumina GAIIx	Phase_I	132	9	NM_001256282	0	0	251	252	1	A8K4H3|B0AZN5|F8VXB4|Q14099|Q14716|Q14717|Q53GJ0|Q6DHW5|Q6GMY0|Q6P4C7|Q96J60	Missense_Mutation	SNP	ENST00000552551.1	37	CCDS8841.1	.	.	.	.	.	.	.	.	.	.	-	0.012	-1.651707	0.00785	.	.	ENSG00000170421	ENST00000552551;ENST00000293308;ENST00000547916;ENST00000546897;ENST00000552150;ENST00000546826;ENST00000548998;ENST00000547413;ENST00000546542	T;T;T;T;T;T;T;T	0.80393	-1.37;-1.37;-1.37;-1.37;-1.37;-1.37;-1.37;-1.37	4.05	-8.11	0.01082	.	0.706613	0.13676	N	0.370518	T	0.40619	0.1124	N	0.01197	-0.965	0.09310	N	1	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.04013	0.001;0.001;0.0	T	0.43589	-0.9382	10	0.05351	T	0.99	.	6.5956	0.22672	0.4212:0.312:0.0:0.2668	.	59;31;31	F8VXB4;F8VU64;P05787	.;.;K2C8_HUMAN	A	31;31;31;31;59;31;71;31;109	ENSP00000447566:S31A;ENSP00000293308:S31A;ENSP00000447402:S31A;ENSP00000449404:S59A;ENSP00000447881:S31A;ENSP00000447040:S71A;ENSP00000448681:S31A;ENSP00000450228:S109A	ENSP00000293308:S31A	S	-	1	0	KRT8	51584942	0.005000	0.15991	0.000000	0.03702	0.065000	0.16274	-0.018000	0.12568	-3.264000	0.00201	-0.290000	0.09829	TCC	.		0.662	KRT8-001	KNOWN	alternative_5_UTR|overlapping_uORF|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406385.1	NM_002273	
PABPC3	5042	broad.mit.edu	37	13	25671714	25671714	+	Missense_Mutation	SNP	A	A	G	rs61739066	byFrequency	TCGA-OR-A5LR-01A-11D-A29I-10	TCGA-OR-A5LR-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a4944d75-a6da-45bb-b5b9-3fa3355b0ead	c2a8460f-138e-44eb-a933-a5cd6ca34d8b	g.chr13:25671714A>G	ENST00000281589.3	+	1	1415	c.1378A>G	c.(1378-1380)Atg>Gtg	p.M460V		NM_030979.2	NP_112241.2	Q9H361	PABP3_HUMAN	poly(A) binding protein, cytoplasmic 3	460					mRNA metabolic process (GO:0016071)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	nucleotide binding (GO:0000166)|poly(A) binding (GO:0008143)			breast(1)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(10)|lung(21)|ovary(4)|pancreas(1)|skin(3)	47		Lung SC(185;0.0225)|Breast(139;0.0602)		all cancers(112;0.0071)|Epithelial(112;0.0398)|OV - Ovarian serous cystadenocarcinoma(117;0.151)|GBM - Glioblastoma multiforme(144;0.222)|Lung(94;0.241)		ATTTAGTACTATGAGACCAGC	0.537													a|||	11	0.00219649	0.0	0.0029	5008	,	,		23014	0.0		0.007	False		,,,				2504	0.002				p.M460V		.											.	PABPC3-72	0			c.A1378G						.	A	VAL/MET	5,4401	9.9+/-24.2	0,5,2198	114.0	108.0	110.0		1378	-0.7	1.0	13	dbSNP_129	110	75,8525	44.5+/-102.8	0,75,4225	yes	missense	PABPC3	NM_030979.2	21	0,80,6423	GG,GA,AA		0.8721,0.1135,0.6151	benign	460/632	25671714	80,12926	2203	4300	6503	SO:0001583	missense	5042	exon1			AGTACTATGAGAC	AF132026	CCDS9311.1	13q12-q13	2013-02-12	2001-11-28		ENSG00000151846	ENSG00000151846		"""RNA binding motif (RRM) containing"""	8556	protein-coding gene	gene with protein product	"""testis PABP"""	604680	"""poly(A)-binding protein, cytoplasmic 3"""	PABPL3		8432538, 10543404	Standard	NM_030979		Approved	PABP3, tPABP	uc001upy.3	Q9H361	OTTHUMG00000016601	ENST00000281589.3:c.1378A>G	13.37:g.25671714A>G	ENSP00000281589:p.Met460Val	Somatic	141	0		WXS	Illumina GAIIx	Phase_I	117	4	NM_030979	0	0	0	0	0	Q8NHV0|Q9H086	Missense_Mutation	SNP	ENST00000281589.3	37	CCDS9311.1	5	0.0022893772893772895	0	0.0	1	0.0027624309392265192	0	0.0	4	0.005277044854881266	A	0.005	-2.155195	0.00325	0.001135	0.008721	ENSG00000151846	ENST00000281589	T	0.26957	1.7	0.875	-0.745	0.11098	.	0.000000	0.56097	U	0.000023	T	0.06234	0.0161	N	0.10782	0.045	0.33109	D	0.540323	B	0.02656	0.0	B	0.01281	0.0	T	0.28933	-1.0028	10	0.13853	T	0.58	.	4.2065	0.10491	0.5788:0.0:0.4212:0.0	rs61739066	460	Q9H361	PABP3_HUMAN	V	460	ENSP00000281589:M460V	ENSP00000281589:M460V	M	+	1	0	PABPC3	24569714	1.000000	0.71417	0.977000	0.42913	0.068000	0.16541	3.896000	0.56266	-0.276000	0.09206	0.260000	0.18958	ATG	A|0.996;G|0.004		0.537	PABPC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044220.2	NM_030979	
EBPL	84650	broad.mit.edu	37	13	50235160	50235160	+	Missense_Mutation	SNP	G	G	C			TCGA-OR-A5LR-01A-11D-A29I-10	TCGA-OR-A5LR-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a4944d75-a6da-45bb-b5b9-3fa3355b0ead	c2a8460f-138e-44eb-a933-a5cd6ca34d8b	g.chr13:50235160G>C	ENST00000242827.6	-	4	615	c.565C>G	c.(565-567)Cta>Gta	p.L189V	EBPL_ENST00000378270.5_3'UTR|EBPL_ENST00000378284.2_3'UTR|EBPL_ENST00000495963.2_5'UTR|EBPL_ENST00000378272.5_3'UTR	NM_032565.3	NP_115954.1	Q9BY08	EBPL_HUMAN	emopamil binding protein-like	189					sterol metabolic process (GO:0016125)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	cholestenol delta-isomerase activity (GO:0047750)	p.L189V(9)		endometrium(8)|kidney(6)|lung(3)|ovary(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	21		Lung NSC(96;0.000468)|Breast(56;0.0011)|Prostate(109;0.00243)|Hepatocellular(98;0.0556)|Glioma(44;0.236)		GBM - Glioblastoma multiforme(99;2.06e-09)		TTGAGTTCTAGCCATGACTGC	0.418																																					p.L189V	NSCLC(39;857 1083 36109 42364 51411)	.											.	EBPL-90	9	Substitution - Missense(9)	endometrium(6)|kidney(3)	c.C565G						.						67.0	67.0	67.0					13																	50235160		2203	4300	6503	SO:0001583	missense	84650	exon4			GTTCTAGCCATGA	AF243433	CCDS9420.1, CCDS61334.1	13q12-q13	2008-02-05			ENSG00000123179	ENSG00000123179			18061	protein-coding gene	gene with protein product							Standard	NM_032565		Approved	EBRP	uc001vdg.3	Q9BY08	OTTHUMG00000016920	ENST00000242827.6:c.565C>G	13.37:g.50235160G>C	ENSP00000242827:p.Leu189Val	Somatic	127	1		WXS	Illumina GAIIx	Phase_I	116	5	NM_032565	0	0	74	74	0	A6NJ59|Q569H7|Q5JVN2|Q5JVN3|Q5JVN4|Q5JVN5|Q5JVN6	Missense_Mutation	SNP	ENST00000242827.6	37	CCDS9420.1	.	.	.	.	.	.	.	.	.	.	C	3.076	-0.189988	0.06299	.	.	ENSG00000123179	ENST00000242827	D	0.97850	-4.57	5.61	2.84	0.33178	.	0.689671	0.14945	N	0.289287	D	0.88179	0.6367	N	0.00621	-1.32	0.80722	D	1	B	0.09022	0.002	B	0.08055	0.003	T	0.79482	-0.1785	10	0.25751	T	0.34	-0.2032	8.3049	0.32036	0.0:0.4998:0.3595:0.1406	.	189	Q9BY08	EBPL_HUMAN	V	189	ENSP00000242827:L189V	ENSP00000242827:L189V	L	-	1	2	EBPL	49133161	0.000000	0.05858	0.303000	0.25071	0.899000	0.52679	-1.071000	0.03437	0.397000	0.25310	-0.127000	0.14921	CTA	.		0.418	EBPL-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044932.2	NM_032565	
ING1	3621	hgsc.bcm.edu	37	13	111368316	111368316	+	Silent	SNP	C	C	T	rs9555726	byFrequency	TCGA-OR-A5LR-01A-11D-A29I-10	TCGA-OR-A5LR-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a4944d75-a6da-45bb-b5b9-3fa3355b0ead	c2a8460f-138e-44eb-a933-a5cd6ca34d8b	g.chr13:111368316C>T	ENST00000375774.3	+	1	988	c.526C>T	c.(526-528)Ctg>Ttg	p.L176L	ING1_ENST00000338450.7_Intron|ING1_ENST00000333219.7_Intron|ING1_ENST00000464141.1_Intron|CARS2_ENST00000535398.1_5'Flank|ING1_ENST00000375775.3_Intron	NM_005537.4	NP_005528.3	Q9UK53	ING1_HUMAN	inhibitor of growth family, member 1	176					cell cycle (GO:0007049)|chromatin modification (GO:0016568)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|positive regulation of transcription, DNA-templated (GO:0045893)|protein import into nucleus (GO:0006606)|regulation of cell death (GO:0010941)	nucleus (GO:0005634)	methylated histone binding (GO:0035064)|zinc ion binding (GO:0008270)			endometrium(4)|large_intestine(6)|lung(1)|ovary(1)	12	all_lung(23;3.61e-05)|Lung NSC(43;0.00144)|Lung SC(71;0.0753)|all_neural(89;0.077)|Medulloblastoma(90;0.148)		BRCA - Breast invasive adenocarcinoma(86;0.188)			GGCCGCATCTCTGCTGACCCG	0.706													C|||	2912	0.58147	0.23	0.6816	5008	,	,		11066	0.7252		0.6909	False		,,,				2504	0.7249				p.L176L		.											.	ING1-515	0			c.C526T						.	C	,,,	1347,2085		295,757,664	14.0	24.0	21.0		526,,,	-5.6	0.0	13	dbSNP_119	21	5238,1736		2020,1198,269	no	coding-synonymous,intron,intron,intron	ING1	NM_005537.3,NM_198217.1,NM_198218.1,NM_198219.1	,,,	2315,1955,933	TT,TC,CC		24.8925,39.2483,36.7192	,,,	176/423,,,	111368316	6585,3821	1716	3487	5203	SO:0001819	synonymous_variant	3621	exon1			GCATCTCTGCTGA		CCDS9515.1, CCDS9516.1, CCDS9517.1, CCDS9518.1	13q34	2013-01-28			ENSG00000153487	ENSG00000153487		"""Zinc fingers, PHD-type"""	6062	protein-coding gene	gene with protein product	"""inhibitor of growth 1"", ""tumor suppressor ING1"", ""growth inhibitor ING1"", ""growth inhibitory protein ING1"""	601566				8944021, 9186514	Standard	NM_198219		Approved	p33ING1, p33ING1b, p24ING1c, p33, p47, p47ING1a	uc001vri.3	Q9UK53	OTTHUMG00000017346	ENST00000375774.3:c.526C>T	13.37:g.111368316C>T		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	6	6	NM_005537	0	0	0	3	3	O00532|O43658|Q53ZR3|Q5T9G8|Q5T9G9|Q5T9H0|Q5T9H1|Q9H007|Q9HD98|Q9HD99|Q9NS83|Q9P0U6|Q9UBC6|Q9UIJ1|Q9UIJ2|Q9UIJ3|Q9UIJ4|Q9UK52	Silent	SNP	ENST00000375774.3	37	CCDS9517.1																																																																																			C|0.372;T|0.628		0.706	ING1-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000045770.2	NM_005537	
CDH24	64403	bcgsc.ca	37	14	23518918	23518918	+	Silent	SNP	T	T	C	rs11623976	byFrequency	TCGA-OR-A5LR-01A-11D-A29I-10	TCGA-OR-A5LR-10A-01D-A29L-10	T	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a4944d75-a6da-45bb-b5b9-3fa3355b0ead	c2a8460f-138e-44eb-a933-a5cd6ca34d8b	g.chr14:23518918T>C	ENST00000267383.5	-	10	1721	c.1629A>G	c.(1627-1629)agA>agG	p.R543R	CDH24_ENST00000485922.1_5'UTR|CDH24_ENST00000554034.1_Silent_p.R505R|CDH24_ENST00000487137.2_Silent_p.R505R|CDH24_ENST00000397359.3_Silent_p.R543R			Q86UP0	CAD24_HUMAN	cadherin 24, type 2	543	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)|single organismal cell-cell adhesion (GO:0016337)	cell-cell junction (GO:0005911)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	alpha-catenin binding (GO:0045294)|beta-catenin binding (GO:0008013)|calcium ion binding (GO:0005509)|delta-catenin binding (GO:0070097)			breast(1)|central_nervous_system(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(6)|lung(5)|ovary(2)|prostate(1)|skin(1)|urinary_tract(1)	26	all_cancers(95;3.3e-05)			GBM - Glioblastoma multiforme(265;0.00654)		CAACTTCATCTCTGTCCAGGG	0.582													T|||	584	0.116613	0.0204	0.1398	5008	,	,		19997	0.004		0.2604	False		,,,				2504	0.1984				p.R543R		.											.	CDH24-90	0			c.A1629G						.	T	,	249,4157	143.5+/-178.5	6,237,1960	60.0	53.0	56.0		1629,1515	2.3	1.0	14	dbSNP_120	56	2068,6532	357.3+/-330.7	248,1572,2480	no	coding-synonymous,coding-synonymous	CDH24	NM_022478.3,NM_144985.3	,	254,1809,4440	CC,CT,TT		24.0465,5.6514,17.8149	,	543/820,505/782	23518918	2317,10689	2203	4300	6503	SO:0001819	synonymous_variant	64403	exon11			TTCATCTCTGTCC	AL137477	CCDS9585.1, CCDS9586.1	14q11.2	2010-08-20	2009-11-20		ENSG00000139880	ENSG00000139880		"""Cadherins / Major cadherins"""	14265	protein-coding gene	gene with protein product			"""cadherin-like 24"""			12734196	Standard	NM_022478		Approved	CDH11L	uc001wil.3	Q86UP0	OTTHUMG00000028715	ENST00000267383.5:c.1629A>G	14.37:g.23518918T>C		Somatic	75	0		WXS	Illumina GAIIx	Phase_I	83	5	NM_022478	0	0	0	0	0	D3DS44|Q86UP1|Q9NT84	Silent	SNP	ENST00000267383.5	37	CCDS9585.1																																																																																			T|0.841;C|0.159		0.582	CDH24-006	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000257241.2	NM_022478	
UNC79	57578	bcgsc.ca	37	14	94152959	94152959	+	Silent	SNP	C	C	T	rs76973270	byFrequency	TCGA-OR-A5LR-01A-11D-A29I-10	TCGA-OR-A5LR-10A-01D-A29L-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a4944d75-a6da-45bb-b5b9-3fa3355b0ead	c2a8460f-138e-44eb-a933-a5cd6ca34d8b	g.chr14:94152959C>T	ENST00000393151.2	+	44	6978	c.6978C>T	c.(6976-6978)aaC>aaT	p.N2326N	UNC79_ENST00000553484.1_Silent_p.N2348N|UNC79_ENST00000555664.1_Silent_p.N2287N|UNC79_ENST00000256339.4_Silent_p.N2149N			Q9P2D8	UNC79_HUMAN	unc-79 homolog (C. elegans)	2326					behavioral response to ethanol (GO:0048149)|ion transmembrane transport (GO:0034220)|multicellular organism growth (GO:0035264)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(3)|cervix(2)|endometrium(10)|kidney(7)|large_intestine(18)|liver(1)|lung(64)|ovary(1)|prostate(5)|skin(3)|urinary_tract(4)	118						AGTACATCAACGAAGTGCTGG	0.507													C|||	130	0.0259585	0.0015	0.0187	5008	,	,		21966	0.002		0.0497	False		,,,				2504	0.0644				p.N2149N		.											.	.	0			c.C6447T						.	C		37,4369	41.6+/-74.8	0,37,2166	221.0	148.0	173.0		6447	-2.3	0.2	14	dbSNP_131	173	336,8264	115.7+/-175.5	5,326,3969	no	coding-synonymous	UNC79	NM_020818.3		5,363,6135	TT,TC,CC		3.907,0.8398,2.8679		2149/2459	94152959	373,12633	2203	4300	6503	SO:0001819	synonymous_variant	57578	exon44			CATCAACGAAGTG	AB037830	CCDS9911.2	14q32.13	2011-08-18	2011-08-18	2011-08-18	ENSG00000133958	ENSG00000133958			19966	protein-coding gene	gene with protein product			"""KIAA1409"""	KIAA1409		20714347, 21040849	Standard	NM_020818		Approved		uc001ybs.1	Q9P2D8	OTTHUMG00000029783	ENST00000393151.2:c.6978C>T	14.37:g.94152959C>T		Somatic	204	0		WXS	Illumina GAIIx	Phase_I	127	8	NM_020818	0	0	0	0	0	B5MDL6|Q6ZUT7	Silent	SNP	ENST00000393151.2	37																																																																																				C|0.972;T|0.028		0.507	UNC79-006	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000412766.1	XM_028395	
LIPC	3990	bcgsc.ca	37	15	58834741	58834741	+	Silent	SNP	G	G	T	rs690	byFrequency	TCGA-OR-A5LR-01A-11D-A29I-10	TCGA-OR-A5LR-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a4944d75-a6da-45bb-b5b9-3fa3355b0ead	c2a8460f-138e-44eb-a933-a5cd6ca34d8b	g.chr15:58834741G>T	ENST00000356113.6	+	6	1080	c.465G>T	c.(463-465)gtG>gtT	p.V155V	LIPC_ENST00000299022.5_Silent_p.V155V|LIPC_ENST00000414170.3_Silent_p.V155V|LIPC_ENST00000433326.2_Silent_p.V94V			P11150	LIPC_HUMAN	lipase, hepatic	155					cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|chylomicron remnant clearance (GO:0034382)|fatty acid biosynthetic process (GO:0006633)|high-density lipoprotein particle remodeling (GO:0034375)|intermediate-density lipoprotein particle remodeling (GO:0034373)|low-density lipoprotein particle remodeling (GO:0034374)|phosphatidylcholine catabolic process (GO:0034638)|reverse cholesterol transport (GO:0043691)|triglyceride catabolic process (GO:0019433)|triglyceride homeostasis (GO:0070328)|very-low-density lipoprotein particle remodeling (GO:0034372)	extracellular space (GO:0005615)|high-density lipoprotein particle (GO:0034364)	apolipoprotein binding (GO:0034185)|heparin binding (GO:0008201)|low-density lipoprotein particle binding (GO:0030169)|phospholipase activity (GO:0004620)|triglyceride lipase activity (GO:0004806)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(15)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	31		Colorectal(260;0.215)		GBM - Glioblastoma multiforme(80;0.00213)|all cancers(107;0.00548)		AGGAATCTGTGCAACTCTCTC	0.562													T|||	2394	0.478035	0.5484	0.4308	5008	,	,		21003	0.2401		0.5606	False		,,,				2504	0.5767				p.V155V		.											.	LIPC-91	0			c.G465T						.	T		2460,1924	548.5+/-377.6	691,1078,423	177.0	156.0	163.0		465	-7.9	0.0	15	dbSNP_36	163	5047,3537	515.3+/-378.6	1493,2061,738	no	coding-synonymous	LIPC	NM_000236.2		2184,3139,1161	TT,TG,GG		41.2046,43.8869,42.1114		155/500	58834741	7507,5461	2192	4292	6484	SO:0001819	synonymous_variant	3990	exon4			ATCTGTGCAACTC		CCDS10166.1	15q21-q23	2012-10-02			ENSG00000166035	ENSG00000166035	3.1.1.3		6619	protein-coding gene	gene with protein product		151670					Standard	NM_000236		Approved	HL, HTGL	uc002afa.2	P11150	OTTHUMG00000132632	ENST00000356113.6:c.465G>T	15.37:g.58834741G>T		Somatic	232	2		WXS	Illumina GAIIx	Phase_I	187	7	NM_000236	0	0	0	0	0	A2RUB4|A8K9B6|O43571|P78529|Q99465	Silent	SNP	ENST00000356113.6	37	CCDS10166.1																																																																																			G|0.489;T|0.511		0.562	LIPC-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000416209.1		
GLIS2	84662	broad.mit.edu	37	16	4386949	4386949	+	Silent	SNP	A	A	C			TCGA-OR-A5LR-01A-11D-A29I-10	TCGA-OR-A5LR-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a4944d75-a6da-45bb-b5b9-3fa3355b0ead	c2a8460f-138e-44eb-a933-a5cd6ca34d8b	g.chr16:4386949A>C	ENST00000262366.3	+	8	1820	c.999A>C	c.(997-999)ccA>ccC	p.P333P	GLIS2_ENST00000433375.1_Silent_p.P333P|RP11-295D4.1_ENST00000574705.1_RNA|PAM16_ENST00000577031.1_Intron			Q9BZE0	GLIS2_HUMAN	GLIS family zinc finger 2	333					cell differentiation (GO:0030154)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|nervous system development (GO:0007399)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)	cytoplasm (GO:0005737)|nuclear speck (GO:0016607)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|transcription regulatory region DNA binding (GO:0044212)			breast(1)|cervix(4)|endometrium(1)|lung(2)|ovary(1)|prostate(1)|urinary_tract(1)	11						AGCTGCGCCCACCCCCCAAGC	0.677																																					p.P333P		.											.	GLIS2-90	0			c.A999C						.						24.0	23.0	23.0					16																	4386949		2191	4296	6487	SO:0001819	synonymous_variant	84662	exon6			GCGCCCACCCCCC	AF325914	CCDS10511.1	16p13.3	2013-01-08			ENSG00000126603	ENSG00000126603		"""Zinc fingers, C2H2-type"""	29450	protein-coding gene	gene with protein product	"""nephrocystin-7"""	608539				11741991, 14500813, 17618285	Standard	NM_032575		Approved	NPHP7	uc002cwc.1	Q9BZE0	OTTHUMG00000129467	ENST00000262366.3:c.999A>C	16.37:g.4386949A>C		Somatic	31	1		WXS	Illumina GAIIx	Phase_I	119	24	NM_032575	0	0	12	19	7	B3KX84	Silent	SNP	ENST00000262366.3	37	CCDS10511.1																																																																																			.		0.677	GLIS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251630.1	NM_032575	
KRTAP4-11	653240	hgsc.bcm.edu	37	17	39274238	39274238	+	Silent	SNP	A	A	G			TCGA-OR-A5LR-01A-11D-A29I-10	TCGA-OR-A5LR-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a4944d75-a6da-45bb-b5b9-3fa3355b0ead	c2a8460f-138e-44eb-a933-a5cd6ca34d8b	g.chr17:39274238A>G	ENST00000391413.2	-	1	368	c.330T>C	c.(328-330)tgT>tgC	p.C110C		NM_033059.3	NP_149048.2	Q9BYQ6	KR411_HUMAN	keratin associated protein 4-11	110	27 X 5 AA repeats of C-C-[GIKRQVHEL]- [SPTR]-[STVQRMC].					keratin filament (GO:0045095)				endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|lung(8)|prostate(5)|skin(1)	33		Breast(137;0.000496)	STAD - Stomach adenocarcinoma(17;0.000371)			agctggggcgacagcagctgg	0.652																																					p.C110C		.											.	.	0			c.T330C						.						5.0	9.0	8.0					17																	39274238		657	1550	2207	SO:0001819	synonymous_variant	653240	exon1			GGGGCGACAGCAG	AC025904	CCDS45675.1	17q21.2	2013-06-25			ENSG00000212721	ENSG00000212721		"""Keratin associated proteins"""	18911	protein-coding gene	gene with protein product			"""keratin associated protein 4-14"""	KRTAP4-14			Standard	NM_033059		Approved	KAP4.11, KAP4.14	uc002hvz.3	Q9BYQ6	OTTHUMG00000133586	ENST00000391413.2:c.330T>C	17.37:g.39274238A>G		Somatic	31	0		WXS	Illumina GAIIx	Phase_I	104	7	NM_033059	0	0	0	0	0	A0AUY2	Silent	SNP	ENST00000391413.2	37	CCDS45675.1																																																																																			.		0.652	KRTAP4-11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257690.1		
KRTAP4-11	653240	broad.mit.edu;ucsc.edu	37	17	39274291	39274291	+	Missense_Mutation	SNP	T	T	C	rs200214744|rs565505867	byFrequency	TCGA-OR-A5LR-01A-11D-A29I-10	TCGA-OR-A5LR-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a4944d75-a6da-45bb-b5b9-3fa3355b0ead	c2a8460f-138e-44eb-a933-a5cd6ca34d8b	g.chr17:39274291T>C	ENST00000391413.2	-	1	315	c.277A>G	c.(277-279)Atg>Gtg	p.M93V		NM_033059.3	NP_149048.2	Q9BYQ6	KR411_HUMAN	keratin associated protein 4-11	93	27 X 5 AA repeats of C-C-[GIKRQVHEL]- [SPTR]-[STVQRMC].					keratin filament (GO:0045095)		p.M93V(4)		endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|lung(8)|prostate(5)|skin(1)	33		Breast(137;0.000496)	STAD - Stomach adenocarcinoma(17;0.000371)			TGGCAGCACATAGACTGGCAG	0.662																																					p.M93V		.											.	.	4	Substitution - Missense(4)	endometrium(3)|kidney(1)	c.A277G						.						6.0	10.0	8.0					17																	39274291		651	1556	2207	SO:0001583	missense	653240	exon1			AGCACATAGACTG	AC025904	CCDS45675.1	17q21.2	2013-06-25			ENSG00000212721	ENSG00000212721		"""Keratin associated proteins"""	18911	protein-coding gene	gene with protein product			"""keratin associated protein 4-14"""	KRTAP4-14			Standard	NM_033059		Approved	KAP4.11, KAP4.14	uc002hvz.3	Q9BYQ6	OTTHUMG00000133586	ENST00000391413.2:c.277A>G	17.37:g.39274291T>C	ENSP00000375232:p.Met93Val	Somatic	32	1		WXS	Illumina GAIIx	Phase_I	84	12	NM_033059	0	0	0	0	0	A0AUY2	Missense_Mutation	SNP	ENST00000391413.2	37	CCDS45675.1	.	.	.	.	.	.	.	.	.	.	.	0.073	-1.199029	0.01581	.	.	ENSG00000212721	ENST00000391413	T	0.00580	6.43	4.25	-4.9	0.03094	.	.	.	.	.	T	0.00109	0.0003	N	0.00040	-2.49	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.43097	-0.9412	9	0.02654	T	1	.	0.4739	0.00536	0.3479:0.2455:0.1203:0.2863	.	93	Q9BYQ6	KR411_HUMAN	V	93	ENSP00000375232:M93V	ENSP00000375232:M93V	M	-	1	0	KRTAP4-11	36527817	.	.	0.012000	0.15200	0.010000	0.07245	.	.	-1.319000	0.02286	-1.132000	0.01976	ATG	.		0.662	KRTAP4-11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257690.1		
SP6	80320	hgsc.bcm.edu	37	17	45925222	45925222	+	Missense_Mutation	SNP	A	A	C			TCGA-OR-A5LR-01A-11D-A29I-10	TCGA-OR-A5LR-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a4944d75-a6da-45bb-b5b9-3fa3355b0ead	c2a8460f-138e-44eb-a933-a5cd6ca34d8b	g.chr17:45925222A>C	ENST00000536300.1	-	2	905	c.574T>G	c.(574-576)Ttg>Gtg	p.L192V	SP6_ENST00000342234.2_Missense_Mutation_p.L192V	NM_001258248.1	NP_001245177.1	Q3SY56	SP6_HUMAN	Sp6 transcription factor	192					positive regulation of cell proliferation (GO:0008284)|regulation of odontogenesis (GO:0042481)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			large_intestine(1)|lung(5)|prostate(1)|skin(1)	8						GCTACTTCCAAGGCCTTAGCC	0.716																																					p.L192V		.											.	SP6-91	0			c.T574G						.																																			SO:0001583	missense	80320	exon2			CTTCCAAGGCCTT		CCDS11520.1	17q21.32	2013-01-08			ENSG00000189120	ENSG00000189120		"""Specificity protein transcription factors"", ""Zinc fingers, C2H2-type"""	14530	protein-coding gene	gene with protein product	"""epiprofin"""	608613				11087666, 14551215	Standard	NM_001258248		Approved	KLF14, Epfn	uc002img.2	Q3SY56	OTTHUMG00000132067	ENST00000536300.1:c.574T>G	17.37:g.45925222A>C	ENSP00000438209:p.Leu192Val	Somatic	2	0		WXS	Illumina GAIIx	Phase_I	13	9	NM_001258248	0	0	0	2	2	B3KXS4	Missense_Mutation	SNP	ENST00000536300.1	37	CCDS11520.1	.	.	.	.	.	.	.	.	.	.	A	11.56	1.676439	0.29783	.	.	ENSG00000189120	ENST00000342234;ENST00000536300	T;T	0.07688	3.17;3.17	4.5	0.958	0.19619	.	0.000000	0.34853	N	0.003637	T	0.02230	0.0069	N	0.00841	-1.15	0.26753	N	0.970157	P	0.36535	0.557	B	0.39805	0.31	T	0.44982	-0.9292	10	0.09338	T	0.73	.	7.1414	0.25558	0.6236:0.0:0.3764:0.0	.	192	Q3SY56	SP6_HUMAN	V	192	ENSP00000340799:L192V;ENSP00000438209:L192V	ENSP00000340799:L192V	L	-	1	2	SP6	43280221	0.003000	0.15002	0.998000	0.56505	0.960000	0.62799	0.051000	0.14141	0.267000	0.21916	0.379000	0.24179	TTG	.		0.716	SP6-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000441395.1	NM_199262	
SP2	6668	broad.mit.edu	37	17	45994401	45994401	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5LR-01A-11D-A29I-10	TCGA-OR-A5LR-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a4944d75-a6da-45bb-b5b9-3fa3355b0ead	c2a8460f-138e-44eb-a933-a5cd6ca34d8b	g.chr17:45994401C>T	ENST00000376741.4	+	3	1101	c.964C>T	c.(964-966)Cgg>Tgg	p.R322W	AC003665.1_ENST00000585280.1_RNA|AC003665.1_ENST00000411573.2_RNA|AC003665.1_ENST00000451140.2_RNA|AC003665.1_ENST00000433001.1_RNA	NM_003110.5	NP_003101.3	Q02086	SP2_HUMAN	Sp2 transcription factor	322					cardiovascular system development (GO:0072358)|embryonic organ development (GO:0048568)|fibroblast proliferation (GO:0048144)|immune response (GO:0006955)|in utero embryonic development (GO:0001701)|multicellular organism growth (GO:0035264)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|histone deacetylase binding (GO:0042826)|metal ion binding (GO:0046872)			endometrium(1)|large_intestine(1)|lung(7)|prostate(2)|skin(1)|urinary_tract(1)	13						GCAGGCTCTGCGGGTGGTGCA	0.667																																					p.R322W		.											.	SP2-90	0			c.C964T						.						34.0	35.0	35.0					17																	45994401		2202	4296	6498	SO:0001583	missense	6668	exon3			GCTCTGCGGGTGG		CCDS11521.2	17q21.3-q22	2013-01-08			ENSG00000167182	ENSG00000167182		"""Specificity protein transcription factors"", ""Zinc fingers, C2H2-type"""	11207	protein-coding gene	gene with protein product		601801				1341900, 9730617	Standard	NM_003110		Approved	KIAA0048	uc002imk.3	Q02086	OTTHUMG00000150196	ENST00000376741.4:c.964C>T	17.37:g.45994401C>T	ENSP00000365931:p.Arg322Trp	Somatic	56	1		WXS	Illumina GAIIx	Phase_I	66	4	NM_003110	0	0	2	2	0	A6NK74	Missense_Mutation	SNP	ENST00000376741.4	37	CCDS11521.2	.	.	.	.	.	.	.	.	.	.	C	18.14	3.558458	0.65538	.	.	ENSG00000167182	ENST00000376741	T	0.09723	2.95	5.41	4.43	0.53597	.	0.059538	0.64402	D	0.000005	T	0.24509	0.0594	L	0.51422	1.61	0.49798	D	0.999821	D	0.89917	1.0	D	0.65573	0.936	T	0.00780	-1.1569	10	0.72032	D	0.01	.	12.2793	0.54755	0.3376:0.6624:0.0:0.0	.	322	Q02086	SP2_HUMAN	W	322	ENSP00000365931:R322W	ENSP00000365931:R322W	R	+	1	2	SP2	43349400	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	2.362000	0.44169	1.439000	0.47511	0.563000	0.77884	CGG	.		0.667	SP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316777.1	NM_003110	
FADS6	283985	ucsc.edu	37	17	72889685	72889685	+	Silent	SNP	G	G	A	rs2683274	byFrequency	TCGA-OR-A5LR-01A-11D-A29I-10	TCGA-OR-A5LR-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a4944d75-a6da-45bb-b5b9-3fa3355b0ead	c2a8460f-138e-44eb-a933-a5cd6ca34d8b	g.chr17:72889685G>A	ENST00000310226.6	-	1	23	c.9C>T	c.(7-9)ccC>ccT	p.P3P		NM_178128.3	NP_835229.2	Q8N9I5	FADS6_HUMAN	fatty acid desaturase 6	9	3 X 6 AA tandem repeat of M-E-P-T-E-P.				fatty acid biosynthetic process (GO:0006633)	integral component of membrane (GO:0016021)	oxidoreductase activity (GO:0016491)			endometrium(3)|kidney(1)|lung(4)	8	all_lung(278;0.172)|Lung NSC(278;0.207)					TGGGCTCCGTGGGTTCCATGG	0.746																																					p.P3P		.											.	FADS6-22	0			c.C9T						.																																			SO:0001819	synonymous_variant	283985	exon1			CTCCGTGGGTTCC	AK094411	CCDS54163.1	17q25.1	2014-07-17	2013-01-25			ENSG00000172782		"""Fatty acid desaturases"""	30459	protein-coding gene	gene with protein product			"""fatty acid desaturase domain family, member 6"""				Standard	XM_005257224		Approved		uc002jmd.1	Q8N9I5		ENST00000310226.6:c.9C>T	17.37:g.72889685G>A		Somatic	33	3		WXS	Illumina GAIIx	Phase_I	102	31	NM_178128	0	0	0	0	0	Q17RQ7|Q6XYE1	Silent	SNP	ENST00000310226.6	37	CCDS54163.1																																																																																			G|0.500;A|0.500		0.746	FADS6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000445219.1		
AATK	9625	hgsc.bcm.edu	37	17	79096115	79096115	+	Missense_Mutation	SNP	C	C	T	rs61738821	byFrequency	TCGA-OR-A5LR-01A-11D-A29I-10	TCGA-OR-A5LR-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a4944d75-a6da-45bb-b5b9-3fa3355b0ead	c2a8460f-138e-44eb-a933-a5cd6ca34d8b	g.chr17:79096115C>T	ENST00000326724.4	-	11	1645	c.1621G>A	c.(1621-1623)Gcc>Acc	p.A541T	AATK_ENST00000417379.1_Missense_Mutation_p.A438T|AATK_ENST00000572339.1_5'Flank|MIR657_ENST00000385003.1_RNA	NM_001080395.2	NP_001073864.2	Q6ZMQ8	LMTK1_HUMAN	apoptosis-associated tyrosine kinase	541				A -> T (in Ref. 1; BAD18544). {ECO:0000305}.	brain development (GO:0007420)|negative regulation of axon extension (GO:0030517)|neuron apoptotic process (GO:0051402)|peptidyl-tyrosine autophosphorylation (GO:0038083)|Rab protein signal transduction (GO:0032482)	axonal growth cone (GO:0044295)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|perinuclear region of cytoplasm (GO:0048471)|recycling endosome (GO:0055037)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)|protein tyrosine kinase activity (GO:0004713)			endometrium(2)|kidney(2)|lung(8)|ovary(3)|prostate(1)|stomach(4)|upper_aerodigestive_tract(1)	21	all_neural(118;0.101)		BRCA - Breast invasive adenocarcinoma(99;0.0228)|OV - Ovarian serous cystadenocarcinoma(97;0.0524)			TCGTGGCCGGCGGCGGGTGCG	0.756													C|||	710	0.141773	0.2451	0.0836	5008	,	,		7975	0.0337		0.1342	False		,,,				2504	0.1626				p.A541T		.											.	AATK-933	0			c.G1621A						.						2.0	2.0	2.0					17																	79096115		1391	2783	4174	SO:0001583	missense	9625	exon11			GGCCGGCGGCGGG	AB014541	CCDS45807.1, CCDS58607.1	17q25.3	2014-06-12			ENSG00000181409	ENSG00000181409			21	protein-coding gene	gene with protein product	"""lemur tyrosine kinase 1"", ""protein phosphatase 1, regulatory subunit 77"""	605276				9734811, 10083745	Standard	NM_001080395		Approved	AATYK, KIAA0641, LMTK1, LMR1, AATYK1, PPP1R77	uc010dia.3	Q6ZMQ8	OTTHUMG00000132717	ENST00000326724.4:c.1621G>A	17.37:g.79096115C>T	ENSP00000324196:p.Ala541Thr	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	10	10	NM_001080395	0	0	0	0	0	O75136|Q6ZN31|Q86X28	Missense_Mutation	SNP	ENST00000326724.4	37	CCDS45807.1	322	0.14743589743589744	149	0.30284552845528456	49	0.13535911602209943	11	0.019230769230769232	113	0.14907651715039577	C	10.34	1.324257	0.24080	.	.	ENSG00000181409	ENST00000326724;ENST00000374792	T;T	0.77489	-1.1;-1.09	4.26	3.26	0.37387	.	0.388682	0.24547	N	0.037589	T	0.00012	0.0000	L	0.48642	1.525	0.80722	P	0.0	P	0.45986	0.87	B	0.27608	0.081	T	0.05716	-1.0868	9	0.29301	T	0.29	.	11.2582	0.49067	0.1833:0.8167:0.0:0.0	rs61738821	541	Q6ZMQ8	LMTK1_HUMAN	T	541;505	ENSP00000324196:A541T;ENSP00000363924:A505T	ENSP00000324196:A541T	A	-	1	0	AATK	76710710	0.009000	0.17119	0.030000	0.17652	0.032000	0.12392	0.876000	0.28092	0.731000	0.32448	0.561000	0.74099	GCC	C|0.850;T|0.150		0.756	AATK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256055.1	NM_004920	
VAPA	9218	broad.mit.edu;bcgsc.ca	37	18	9914291	9914291	+	Missense_Mutation	SNP	A	A	G			TCGA-OR-A5LR-01A-11D-A29I-10	TCGA-OR-A5LR-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a4944d75-a6da-45bb-b5b9-3fa3355b0ead	c2a8460f-138e-44eb-a933-a5cd6ca34d8b	g.chr18:9914291A>G	ENST00000400000.2	+	1	293	c.38A>G	c.(37-39)cAg>cGg	p.Q13R	RP11-474N24.6_ENST00000609787.1_lincRNA|VAPA_ENST00000340541.4_Missense_Mutation_p.Q13R	NM_003574.5|NM_194434.2	NP_003565.4|NP_919415.2	Q9P0L0	VAPA_HUMAN	VAMP (vesicle-associated membrane protein)-associated protein A, 33kDa	13					cell death (GO:0008219)|membrane fusion (GO:0061025)|neuron projection development (GO:0031175)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|protein localization to endoplasmic reticulum (GO:0070972)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|sphingolipid biosynthetic process (GO:0030148)|sphingolipid metabolic process (GO:0006665)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|microtubule cytoskeleton (GO:0015630)|plasma membrane (GO:0005886)|vesicle (GO:0031982)	protein heterodimerization activity (GO:0046982)|signal transducer activity (GO:0004871)|structural molecule activity (GO:0005198)			breast(1)|lung(2)|prostate(1)	4						AAGCACGAGCAGATCCTGGTC	0.716																																					p.Q13R		.											.	VAPA-90	0			c.A38G						.						20.0	22.0	21.0					18																	9914291		1923	4127	6050	SO:0001583	missense	9218	exon1			ACGAGCAGATCCT		CCDS11847.2, CCDS11848.2	18p11.2	2008-07-28	2002-08-29		ENSG00000101558	ENSG00000101558			12648	protein-coding gene	gene with protein product		605703	"""VAMP (vesicle-associated membrane protein)-associated protein A (33kD)"""			9920726, 9657962	Standard	NM_003574		Approved	hVAP-33, VAP-A	uc002koj.3	Q9P0L0	OTTHUMG00000131603	ENST00000400000.2:c.38A>G	18.37:g.9914291A>G	ENSP00000382880:p.Gln13Arg	Somatic	47	0		WXS	Illumina GAIIx	Phase_I	86	6	NM_003574	0	0	91	92	1	A6NDZ0|D3DUI3|O75453|Q5U0E7|Q9UBZ2	Missense_Mutation	SNP	ENST00000400000.2	37	CCDS11848.2	.	.	.	.	.	.	.	.	.	.	A	13.54	2.266539	0.40095	.	.	ENSG00000101558	ENST00000340541;ENST00000400000	T;T	0.62788	-0.0;-0.0	4.16	4.16	0.48862	PapD-like (2);	0.118979	0.64402	D	0.000019	T	0.61590	0.2359	M	0.78916	2.43	0.44129	D	0.996912	B;B	0.18166	0.005;0.026	B;B	0.23018	0.013;0.043	T	0.59669	-0.7411	9	.	.	.	-8.9302	11.4876	0.50363	1.0:0.0:0.0:0.0	.	13;13	Q9P0L0;Q9P0L0-2	VAPA_HUMAN;.	R	13	ENSP00000345656:Q13R;ENSP00000382880:Q13R	.	Q	+	2	0	VAPA	9904291	1.000000	0.71417	1.000000	0.80357	0.799000	0.45148	4.218000	0.58554	1.532000	0.49169	0.165000	0.16767	CAG	.		0.716	VAPA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254490.1		
GNAL	2774	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	18	11752854	11752854	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5LR-01A-11D-A29I-10	TCGA-OR-A5LR-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a4944d75-a6da-45bb-b5b9-3fa3355b0ead	c2a8460f-138e-44eb-a933-a5cd6ca34d8b	g.chr18:11752854G>A	ENST00000423027.3	+	2	469	c.148G>A	c.(148-150)Gct>Act	p.A50T	GNAL_ENST00000334049.6_Missense_Mutation_p.A127T|GNAL_ENST00000535121.1_Missense_Mutation_p.A50T|GNAL_ENST00000269162.5_Missense_Mutation_p.A50T			P38405	GNAL_HUMAN	guanine nucleotide binding protein (G protein), alpha activating activity polypeptide, olfactory type	50					activation of adenylate cyclase activity (GO:0007190)|adenylate cyclase-activating dopamine receptor signaling pathway (GO:0007191)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|response to amphetamine (GO:0001975)|response to caffeine (GO:0031000)|sensory perception of smell (GO:0007608)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)	extracellular vesicular exosome (GO:0070062)|heterotrimeric G-protein complex (GO:0005834)|plasma membrane (GO:0005886)	G-protein beta/gamma-subunit complex binding (GO:0031683)|G-protein coupled receptor binding (GO:0001664)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|metal ion binding (GO:0046872)|signal transducer activity (GO:0004871)			central_nervous_system(1)|endometrium(1)|large_intestine(4)|liver(1)|lung(4)|ovary(1)	12						GTTTGCAGGGGCTGGTGAGTC	0.517																																					p.A127T		.											.	GNAL-228	0			c.G379A						.						147.0	135.0	139.0					18																	11752854		2203	4300	6503	SO:0001583	missense	2774	exon2			GCAGGGGCTGGTG	AF493893	CCDS11851.1, CCDS11852.1, CCDS58614.1	18p11.22-p11.21	2003-12-17			ENSG00000141404	ENSG00000141404			4388	protein-coding gene	gene with protein product		139312				1302014	Standard	NM_182978		Approved		uc002kqc.3	P38405	OTTHUMG00000131660	ENST00000423027.3:c.148G>A	18.37:g.11752854G>A	ENSP00000408489:p.Ala50Thr	Somatic	94	0		WXS	Illumina GAIIx	Phase_I	112	86	NM_182978	0	0	0	0	0	B7ZA26|Q86XU3	Missense_Mutation	SNP	ENST00000423027.3	37	CCDS11852.1	.	.	.	.	.	.	.	.	.	.	G	34	5.403213	0.96051	.	.	ENSG00000141404	ENST00000334049;ENST00000535121;ENST00000269162;ENST00000423027	D;D;D;D	0.88586	-2.4;-2.4;-2.4;-2.4	5.04	5.04	0.67666	G protein alpha subunit, helical insertion (1);	0.000000	0.85682	D	0.000000	D	0.93504	0.7927	M	0.62266	1.93	0.80722	D	1	D;D	0.89917	1.0;0.984	D;P	0.97110	1.0;0.897	D	0.92867	0.6311	10	0.44086	T	0.13	.	18.5611	0.91100	0.0:0.0:1.0:0.0	.	50;127	P38405;Q86XU3	GNAL_HUMAN;.	T	127;50;50;50	ENSP00000334051:A127T;ENSP00000439023:A50T;ENSP00000269162:A50T;ENSP00000408489:A50T	ENSP00000269162:A50T	A	+	1	0	GNAL	11742854	1.000000	0.71417	1.000000	0.80357	0.888000	0.51559	9.141000	0.94612	2.603000	0.88011	0.462000	0.41574	GCT	.		0.517	GNAL-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254561.2	NM_182978, NM_002071	
MUC16	94025	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	9063253	9063253	+	Missense_Mutation	SNP	T	T	C			TCGA-OR-A5LR-01A-11D-A29I-10	TCGA-OR-A5LR-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a4944d75-a6da-45bb-b5b9-3fa3355b0ead	c2a8460f-138e-44eb-a933-a5cd6ca34d8b	g.chr19:9063253T>C	ENST00000397910.4	-	3	24396	c.24193A>G	c.(24193-24195)Agt>Ggt	p.S8065G		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	8067	Ser-rich.|Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						TGTCCAGAACTGGAGGTCCCC	0.473																																					p.S8065G		.											.	MUC16-566	0			c.A24193G						.						109.0	106.0	107.0					19																	9063253		2078	4210	6288	SO:0001583	missense	94025	exon3			CAGAACTGGAGGT	AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.24193A>G	19.37:g.9063253T>C	ENSP00000381008:p.Ser8065Gly	Somatic	245	0		WXS	Illumina GAIIx	Phase_I	165	113	NM_024690	0	0	0	0	0	Q6ZQW5|Q96RK2	Missense_Mutation	SNP	ENST00000397910.4	37	CCDS54212.1	.	.	.	.	.	.	.	.	.	.	t	6.409	0.443600	0.12164	.	.	ENSG00000181143	ENST00000397910	T	0.25579	1.79	3.15	2.13	0.27403	.	.	.	.	.	T	0.21761	0.0524	L	0.53249	1.67	.	.	.	B	0.23650	0.089	B	0.16289	0.015	T	0.19976	-1.0289	8	0.87932	D	0	.	5.2183	0.15354	0.0:0.1373:0.0:0.8627	.	8065	B5ME49	.	G	8065	ENSP00000381008:S8065G	ENSP00000381008:S8065G	S	-	1	0	MUC16	8924253	0.000000	0.05858	0.000000	0.03702	0.042000	0.13812	-0.046000	0.11983	0.597000	0.29811	0.416000	0.27883	AGT	.		0.473	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402806.1	NM_024690	
ISYNA1	51477	bcgsc.ca	37	19	18546678	18546678	+	Silent	SNP	T	T	C	rs2303697	byFrequency	TCGA-OR-A5LR-01A-11D-A29I-10	TCGA-OR-A5LR-10A-01D-A29L-10	T	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a4944d75-a6da-45bb-b5b9-3fa3355b0ead	c2a8460f-138e-44eb-a933-a5cd6ca34d8b	g.chr19:18546678T>C	ENST00000338128.8	-	8	1246	c.1029A>G	c.(1027-1029)ctA>ctG	p.L343L	ISYNA1_ENST00000578963.1_Silent_p.L215L|ISYNA1_ENST00000457269.4_Silent_p.L289L|ISYNA1_ENST00000317018.6_Silent_p.L141L|ISYNA1_ENST00000545187.1_Silent_p.L193L	NM_001170938.1|NM_016368.4	NP_001164409.1|NP_057452.1	Q9NPH2	INO1_HUMAN	inositol-3-phosphate synthase 1	343					inositol biosynthetic process (GO:0006021)|inositol phosphate metabolic process (GO:0043647)|phospholipid biosynthetic process (GO:0008654)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	inositol-3-phosphate synthase activity (GO:0004512)			breast(1)|endometrium(1)|kidney(2)|lung(4)|ovary(1)|pancreas(1)|upper_aerodigestive_tract(2)	12						ATGGCGCCGATAGGTTCTCCC	0.602													C|||	2366	0.472444	0.8298	0.3732	5008	,	,		15663	0.2163		0.3479	False		,,,				2504	0.4519				p.L343L		.											.	ISYNA1-92	0			c.A1029G	GRCh37	CM044082	ISYNA1	M	rs2303697	.	C	,,	3313,1093	394.0+/-329.1	1253,807,143	163.0	176.0	172.0		867,579,1029	0.8	1.0	19	dbSNP_100	172	2947,5653	668.2+/-402.5	537,1873,1890	no	coding-synonymous,coding-synonymous,coding-synonymous	ISYNA1	NM_001170938.1,NM_001170939.1,NM_016368.4	,,	1790,2680,2033	CC,CT,TT		34.2674,24.8071,48.1316	,,	289/505,193/409,343/559	18546678	6260,6746	2203	4300	6503	SO:0001819	synonymous_variant	51477	exon8			CGCCGATAGGTTC		CCDS12379.1, CCDS54234.1, CCDS62603.1	19p13.11	2014-09-04			ENSG00000105655	ENSG00000105655	5.5.1.4		29821	protein-coding gene	gene with protein product	"""myo-inositol 1-phosphate synthase"""	611670				15024000, 12941308	Standard	NM_016368		Approved	Ino1, INOS, IPS	uc002njd.2	Q9NPH2	OTTHUMG00000179027	ENST00000338128.8:c.1029A>G	19.37:g.18546678T>C		Somatic	164	0		WXS	Illumina GAIIx	Phase_I	183	7	NM_016368	0	0	93	93	0	B3KRT1|G5E9U0|Q6NXT5|Q7Z525|Q9BT65|Q9H2Y2|Q9NSU0|Q9NVW7	Silent	SNP	ENST00000338128.8	37	CCDS12379.1																																																																																			T|0.535;C|0.465		0.602	ISYNA1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000444469.2	NM_016368	
MAG	4099	bcgsc.ca	37	19	35786868	35786868	+	Silent	SNP	C	C	T	rs2301600	byFrequency	TCGA-OR-A5LR-01A-11D-A29I-10	TCGA-OR-A5LR-10A-01D-A29L-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a4944d75-a6da-45bb-b5b9-3fa3355b0ead	c2a8460f-138e-44eb-a933-a5cd6ca34d8b	g.chr19:35786868C>T	ENST00000392213.3	+	4	558	c.399C>T	c.(397-399)agC>agT	p.S133S	MAG_ENST00000597035.1_Intron|MAG_ENST00000361922.4_Silent_p.S133S|MAG_ENST00000537831.2_Silent_p.S108S	NM_002361.3	NP_002352.1	P20916	MAG_HUMAN	myelin associated glycoprotein	133					blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|leukocyte migration (GO:0050900)|negative regulation of axonogenesis (GO:0050771)|neurotrophin TRK receptor signaling pathway (GO:0048011)|regulation of axonogenesis (GO:0050770)|substantia nigra development (GO:0021762)	integral component of membrane (GO:0016021)|paranode region of axon (GO:0033270)|plasma membrane (GO:0005886)|Schmidt-Lanterman incisure (GO:0043220)	carbohydrate binding (GO:0030246)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(3)|large_intestine(10)|lung(11)|skin(2)|upper_aerodigestive_tract(2)	34	all_lung(56;2.37e-08)|Lung NSC(56;3.66e-08)|Esophageal squamous(110;0.162)	Renal(1328;0.242)	Epithelial(14;3.14e-19)|OV - Ovarian serous cystadenocarcinoma(14;1.5e-18)|all cancers(14;1.5e-16)|LUSC - Lung squamous cell carcinoma(66;0.0417)			CAGAGCACAGCGTCCTGGATA	0.662													C|||	1450	0.289537	0.0998	0.3746	5008	,	,		17137	0.4226		0.2416	False		,,,				2504	0.3978				p.S133S		.											.	MAG-947	0			c.C399T						.	C	,,	519,3887		28,463,1712	88.0	86.0	87.0		324,399,399	2.8	1.0	19	dbSNP_100	87	1857,6739		199,1459,2640	no	coding-synonymous,coding-synonymous,coding-synonymous	MAG	NM_001199216.1,NM_002361.3,NM_080600.2	,,	227,1922,4352	TT,TC,CC		21.6031,11.7794,18.2741	,,	108/602,133/627,133/583	35786868	2376,10626	2203	4298	6501	SO:0001819	synonymous_variant	4099	exon4			GCACAGCGTCCTG	M29273	CCDS12455.1, CCDS12456.1, CCDS56090.1	19q13.1	2013-01-29			ENSG00000105695	ENSG00000105695		"""Sialic acid binding Ig-like lectins"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6783	protein-coding gene	gene with protein product	"""sialic acid binding Ig-like lectin 4A"""	159460		GMA		2476987, 8432525	Standard	NM_080600		Approved	SIGLEC4A, SIGLEC-4A, S-MAG	uc002nyy.2	P20916		ENST00000392213.3:c.399C>T	19.37:g.35786868C>T		Somatic	86	0		WXS	Illumina GAIIx	Phase_I	73	5	NM_080600	0	0	0	0	0	B7Z2E5|F5GYC0|Q567S4	Silent	SNP	ENST00000392213.3	37	CCDS12455.1																																																																																			C|0.780;T|0.220		0.662	MAG-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000466071.1	NM_080600	
SOGA1	140710	hgsc.bcm.edu	37	20	35491180	35491180	+	5'Flank	SNP	G	G	A			TCGA-OR-A5LR-01A-11D-A29I-10	TCGA-OR-A5LR-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a4944d75-a6da-45bb-b5b9-3fa3355b0ead	c2a8460f-138e-44eb-a933-a5cd6ca34d8b	g.chr20:35491180G>A	ENST00000357779.3	-	0	0				SOGA1_ENST00000279034.6_5'Flank|SOGA1_ENST00000237536.4_Missense_Mutation_p.R190C			O94964	SOGA1_HUMAN	suppressor of glucose, autophagy associated 1						insulin receptor signaling pathway (GO:0008286)|negative regulation of gluconeogenesis (GO:0045721)|regulation of autophagy (GO:0010506)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)				endometrium(5)|kidney(1)|lung(21)|urinary_tract(1)	28						AGCGGCAAGCGGCTGCTGCCC	0.776																																					p.R190C		.											.	.	0			c.C568T						.						1.0	2.0	1.0					20																	35491180		303	875	1178	SO:0001631	upstream_gene_variant	140710	exon1			GCAAGCGGCTGCT	AK126630	CCDS46598.1, CCDS54459.1	20q11.23	2012-03-01	2012-02-27	2012-02-27	ENSG00000149639	ENSG00000149639			16111	protein-coding gene	gene with protein product	"""suppressor of glucose by autophagy"", ""suppressor of glucose from autophagy"""		"""chromosome 20 open reading frame 117"", ""KIAA0889"""	C20orf117, KIAA0889		20813965	Standard	NM_080627		Approved	dJ132F21.1, FLJ44670, SOGA	uc021wcx.1	O94964	OTTHUMG00000032395		20.37:g.35491180G>A	Exception_encountered	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	20	8	NM_080627	0	0	1	2	1	A6NK10|Q14DB2|Q5JW51|Q6ZTG8	Missense_Mutation	SNP	ENST00000357779.3	37		.	.	.	.	.	.	.	.	.	.	G	23.5	4.425604	0.83667	.	.	ENSG00000149639	ENST00000237536	T	0.19250	2.16	2.95	2.95	0.34219	.	.	.	.	.	T	0.36936	0.0985	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.33828	-0.9853	6	0.66056	D	0.02	-10.9934	13.0885	0.59154	0.0:0.0:1.0:0.0	.	.	.	.	C	190	ENSP00000237536:R190C	ENSP00000237536:R190C	R	-	1	0	KIAA0889	34924594	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	1.766000	0.38491	1.664000	0.50801	0.436000	0.28706	CGC	.		0.776	SOGA1-201	KNOWN	basic	protein_coding	protein_coding		NM_199181	
RUNX1	861	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	21	36259202	36259202	+	Missense_Mutation	SNP	A	A	G			TCGA-OR-A5LR-01A-11D-A29I-10	TCGA-OR-A5LR-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a4944d75-a6da-45bb-b5b9-3fa3355b0ead	c2a8460f-138e-44eb-a933-a5cd6ca34d8b	g.chr21:36259202A>G	ENST00000344691.4	-	1	1785	c.208T>C	c.(208-210)Ttc>Ctc	p.F70L	RUNX1_ENST00000437180.1_Missense_Mutation_p.F97L|RUNX1_ENST00000300305.3_Missense_Mutation_p.F97L|RUNX1_ENST00000486278.2_Missense_Mutation_p.F73L|RUNX1_ENST00000325074.5_Missense_Mutation_p.F85L|RUNX1_ENST00000358356.5_Missense_Mutation_p.F70L|RUNX1_ENST00000399240.1_Missense_Mutation_p.F70L	NM_001001890.2	NP_001001890.1	Q01196	RUNX1_HUMAN	runt-related transcription factor 1	70	Runt. {ECO:0000255|PROSITE- ProRule:PRU00399}.				behavioral response to pain (GO:0048266)|cellular response to transforming growth factor beta stimulus (GO:0071560)|central nervous system development (GO:0007417)|definitive hemopoiesis (GO:0060216)|embryonic hemopoiesis (GO:0035162)|hair follicle morphogenesis (GO:0031069)|hematopoietic stem cell proliferation (GO:0071425)|hemopoiesis (GO:0030097)|in utero embryonic development (GO:0001701)|liver development (GO:0001889)|myeloid cell differentiation (GO:0030099)|myeloid progenitor cell differentiation (GO:0002318)|negative regulation of granulocyte differentiation (GO:0030853)|peripheral nervous system neuron development (GO:0048935)|positive regulation of angiogenesis (GO:0045766)|positive regulation of granulocyte differentiation (GO:0030854)|positive regulation of progesterone secretion (GO:2000872)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of hair follicle cell proliferation (GO:0071336)|regulation of signal transduction (GO:0009966)|skeletal system development (GO:0001501)|transcription, DNA-templated (GO:0006351)	basement membrane (GO:0005604)|nucleus (GO:0005634)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|DNA binding (GO:0003677)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|regulatory region DNA binding (GO:0000975)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)	p.V90_K117del(1)		breast(5)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(428)|large_intestine(3)|lung(6)|oesophagus(4)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	452						GAGCAGAGGAAGTTGGGGCTG	0.697			T	"""RPL22, MDS1, EVI1, CBFA2T3, CBFA2T1, ETV6, LAF4"""	"""AML, preB- ALL, T-ALL"""																																p.F97L		.		Dom	yes		21	21q22.3	861	runt-related transcription factor 1  (AML1)		L	.	RUNX1-5146	1	Deletion - In frame(1)	haematopoietic_and_lymphoid_tissue(1)	c.T289C						.						56.0	53.0	54.0					21																	36259202		2203	4300	6503	SO:0001583	missense	861	exon4			AGAGGAAGTTGGG	X79549	CCDS13639.1, CCDS42922.1, CCDS46646.1	21q22.3	2014-09-17	2008-07-29		ENSG00000159216	ENSG00000159216			10471	protein-coding gene	gene with protein product	"""aml1 oncogene"""	151385	"""acute myeloid leukemia 1"""	AML1, CBFA2		1427868, 7835892	Standard	NM_001001890		Approved	PEBP2A2, AMLCR1	uc010gmv.3	Q01196	OTTHUMG00000086299	ENST00000344691.4:c.208T>C	21.37:g.36259202A>G	ENSP00000340690:p.Phe70Leu	Somatic	76	0		WXS	Illumina GAIIx	Phase_I	104	23	NM_001754	0	0	0	0	0	A8MV94|B2RMS4|D3DSG1|O60472|O60473|O76047|O76089|Q13081|Q13755|Q13756|Q13757|Q13758|Q13759|Q15341|Q15343|Q16122|Q16284|Q16285|Q16286|Q16346|Q16347|Q92479	Missense_Mutation	SNP	ENST00000344691.4	37	CCDS42922.1	.	.	.	.	.	.	.	.	.	.	A	21.1	4.100093	0.76983	.	.	ENSG00000159216	ENST00000344691;ENST00000300305;ENST00000437180;ENST00000325074;ENST00000399240;ENST00000399245;ENST00000358356;ENST00000399237;ENST00000486278;ENST00000455571	D;D;D;D;D;D;D;D;D	0.99382	-5.8;-5.8;-5.8;-5.8;-5.8;-5.8;-5.8;-5.8;-5.8	4.72	4.72	0.59763	Acute myeloid leukemia 1 (AML 1)/Runt (2);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.99137	0.9702	M	0.64630	1.985	0.80722	D	1	D;P;D;P;D	0.76494	0.962;0.948;0.998;0.94;0.999	P;D;D;P;D	0.80764	0.775;0.956;0.992;0.566;0.994	D	0.99282	1.0896	10	0.46703	T	0.11	-27.4112	14.3606	0.66768	1.0:0.0:0.0:0.0	.	97;70;97;85;70	Q2TAM6;Q01196-3;Q01196-8;Q01196-10;Q01196	.;.;.;.;RUNX1_HUMAN	L	70;97;97;85;70;73;70;85;73;84	ENSP00000340690:F70L;ENSP00000300305:F97L;ENSP00000409227:F97L;ENSP00000319459:F85L;ENSP00000382184:F70L;ENSP00000351123:F70L;ENSP00000382182:F85L;ENSP00000438019:F73L;ENSP00000388189:F84L	ENSP00000300305:F97L	F	-	1	0	RUNX1	35181072	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	8.587000	0.90810	1.980000	0.57719	0.460000	0.39030	TTC	.		0.697	RUNX1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000194230.1		
TTC28	23331	bcgsc.ca	37	22	28378472	28378472	+	Silent	SNP	A	A	G	rs5762430	byFrequency	TCGA-OR-A5LR-01A-11D-A29I-10	TCGA-OR-A5LR-10A-01D-A29L-10	A	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a4944d75-a6da-45bb-b5b9-3fa3355b0ead	c2a8460f-138e-44eb-a933-a5cd6ca34d8b	g.chr22:28378472A>G	ENST00000397906.2	-	23	7324	c.7183T>C	c.(7183-7185)Ttg>Ctg	p.L2395L	TTC28-AS1_ENST00000434221.1_RNA|TTC28-AS1_ENST00000430525.1_RNA|TTC28-AS1_ENST00000430853.1_RNA|TTC28-AS1_ENST00000424161.1_RNA|TTC28-AS1_ENST00000435348.1_RNA|TTC28-AS1_ENST00000453632.1_RNA|TTC28-AS1_ENST00000452612.1_RNA|TTC28-AS1_ENST00000417497.1_RNA|TTC28-AS1_ENST00000454996.1_RNA|TTC28-AS1_ENST00000425112.1_RNA|TTC28-AS1_ENST00000454741.1_RNA|TTC28-AS1_ENST00000419253.1_RNA	NM_001145418.1	NP_001138890.1	Q96AY4	TTC28_HUMAN	tetratricopeptide repeat domain 28	2395					mitotic nuclear division (GO:0007067)|regulation of mitotic cell cycle (GO:0007346)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|midbody (GO:0030496)				endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)	12						GACAAATTCAACAGACTGAGG	0.547													A|||	1307	0.260982	0.3086	0.1542	5008	,	,		16213	0.2887		0.1521	False		,,,				2504	0.3558				p.L2395L		.											.	.	0			c.T7183C						.	A		395,989		52,291,349	61.0	55.0	57.0	http://www.ncbi.nlm.nih.gov/pubmed?term	7183	-3.3	0.0	22	dbSNP_114	57	601,2581		54,493,1044	no	coding-synonymous	TTC28	NM_001145418.1		106,784,1393	GG,GA,AA	http://www.ncbi.nlm.nih.gov/pubmed?term	18.8875,28.5405,21.8134		2395/2482	28378472	996,3570	692	1591	2283	SO:0001819	synonymous_variant	23331	exon23			AATTCAACAGACT	AB028966	CCDS46678.1	22q12.1	2013-01-10			ENSG00000100154	ENSG00000100154		"""Tetratricopeptide (TTC) repeat domain containing"""	29179	protein-coding gene	gene with protein product		615098				10470851	Standard	NM_001145418		Approved	KIAA1043	uc003adp.4	Q96AY4	OTTHUMG00000151006	ENST00000397906.2:c.7183T>C	22.37:g.28378472A>G		Somatic	94	0		WXS	Illumina GAIIx	Phase_I	91	5	NM_001145418	0	0	1	1	0	K7ZRV2|O95928|O95929|Q5W189|Q9NTE4|Q9UG31|Q9UGG5|Q9UPV8|Q9Y3S5	Silent	SNP	ENST00000397906.2	37	CCDS46678.1																																																																																			A|0.754;G|0.246		0.547	TTC28-001	NOVEL	not_organism_supported|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000320930.2	XM_929318	
LIMK2	3985	broad.mit.edu	37	22	31674324	31674324	+	Missense_Mutation	SNP	C	C	G	rs149034313	byFrequency	TCGA-OR-A5LR-01A-11D-A29I-10	TCGA-OR-A5LR-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a4944d75-a6da-45bb-b5b9-3fa3355b0ead	c2a8460f-138e-44eb-a933-a5cd6ca34d8b	g.chr22:31674324C>G	ENST00000331728.4	+	16	1928	c.1814C>G	c.(1813-1815)tCc>tGc	p.S605C	LIMK2_ENST00000467301.1_3'UTR|LIMK2_ENST00000333611.4_Missense_Mutation_p.S584C|LIMK2_ENST00000444929.2_Missense_Mutation_p.S359C	NM_005569.3	NP_005560.1	P53671	LIMK2_HUMAN	LIM domain kinase 2	605	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				phosphorylation (GO:0016310)|spermatogenesis (GO:0007283)	cis-Golgi network (GO:0005801)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)|zinc ion binding (GO:0008270)			endometrium(7)|kidney(3)|large_intestine(6)|lung(6)|ovary(2)|prostate(4)|skin(1)	29						GAGGCCCTCTCCCTGTACCTG	0.592													C|||	44	0.00878594	0.0	0.0043	5008	,	,		18334	0.0		0.001	False		,,,				2504	0.0409				p.S605C		.											.	LIMK2-548	0			c.C1814G						.	C	CYS/SER,CYS/SER	1,4405		0,1,2202	189.0	200.0	196.0		1814,1751	5.4	1.0	22	dbSNP_134	196	21,8579		0,21,4279	yes	missense,missense	LIMK2	NM_005569.3,NM_016733.2	112,112	0,22,6481	GG,GC,CC		0.2442,0.0227,0.1692	benign,benign	605/639,584/618	31674324	22,12984	2203	4300	6503	SO:0001583	missense	3985	exon16			CCCTCTCCCTGTA	D45906	CCDS13891.1, CCDS13892.1, CCDS33637.1	22q12	2005-01-21			ENSG00000182541	ENSG00000182541			6614	protein-coding gene	gene with protein product		601988				8537403, 10591208	Standard	NM_005569		Approved		uc003akh.3	P53671	OTTHUMG00000151251	ENST00000331728.4:c.1814C>G	22.37:g.31674324C>G	ENSP00000332687:p.Ser605Cys	Somatic	66	0		WXS	Illumina GAIIx	Phase_I	52	3	NM_005569	0	0	3	3	0	A8K6H5|Q7KZ80|Q7L3H5|Q96E10|Q99464|Q9UFU0	Missense_Mutation	SNP	ENST00000331728.4	37	CCDS13891.1	3	0.0013736263736263737	0	0.0	3	0.008287292817679558	0	0.0	0	0.0	.	15.62	2.887290	0.52014	2.27E-4	0.002442	ENSG00000182541	ENST00000444929;ENST00000331728;ENST00000436394;ENST00000333611	T;T;T	0.74947	-0.89;-0.77;-0.83	5.37	5.37	0.77165	Protein kinase, catalytic domain (1);	.	.	.	.	T	0.58708	0.2141	L	0.31476	0.935	0.54753	D	0.999985	B;B;B	0.24132	0.098;0.036;0.022	B;B;B	0.23852	0.049;0.022;0.013	T	0.59690	-0.7407	9	0.37606	T	0.19	.	18.0911	0.89476	0.0:1.0:0.0:0.0	.	637;359;605	F5GY29;E7EUC1;P53671	.;.;LIMK2_HUMAN	C	359;605;637;584	ENSP00000409522:S359C;ENSP00000332687:S605C;ENSP00000330470:S584C	ENSP00000332687:S605C	S	+	2	0	LIMK2	30004324	1.000000	0.71417	1.000000	0.80357	0.874000	0.50279	4.499000	0.60380	2.501000	0.84356	0.563000	0.77884	TCC	C|0.998;G|0.002		0.592	LIMK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321911.1	NM_016733	
DESI1	27351	bcgsc.ca	37	22	41997128	41997128	+	Silent	SNP	G	G	T			TCGA-OR-A5LR-01A-11D-A29I-10	TCGA-OR-A5LR-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a4944d75-a6da-45bb-b5b9-3fa3355b0ead	c2a8460f-138e-44eb-a933-a5cd6ca34d8b	g.chr22:41997128G>T	ENST00000263256.6	-	6	736	c.480C>A	c.(478-480)tcC>tcA	p.S160S	DESI1_ENST00000463886.1_5'Flank	NM_015704.2	NP_056519.1	Q6ICB0	DESI1_HUMAN	desumoylating isopeptidase 1	160						cytoplasm (GO:0005737)|nucleus (GO:0005634)	peptidase activity (GO:0008233)										GTCTGCCCACGGAGCTCCCTC	0.577																																					p.S160S		.											.	.	0			c.C480A						.						36.0	36.0	36.0					22																	41997128		2203	4300	6503	SO:0001819	synonymous_variant	27351	exon6			GCCCACGGAGCTC	AF038183	CCDS33652.1	22q13.2	2012-05-16	2012-05-16	2012-05-16	ENSG00000100418	ENSG00000100418			24577	protein-coding gene	gene with protein product		614637	"""family with sequence similarity 152, member B"", ""PPPDE peptidase domain containing 2"""	FAM152B, PPPDE2		8619474, 9110174, 22370726	Standard	NM_015704		Approved	D15Wsu75e	uc003bam.2	Q6ICB0	OTTHUMG00000044632	ENST00000263256.6:c.480C>A	22.37:g.41997128G>T		Somatic	160	0		WXS	Illumina GAIIx	Phase_I	111	6	NM_015704	0	0	35	35	0		Silent	SNP	ENST00000263256.6	37	CCDS33652.1																																																																																			.		0.577	DESI1-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000104124.3	NM_015704	
CELSR1	9620	ucsc.edu;bcgsc.ca	37	22	46760481	46760481	+	Missense_Mutation	SNP	C	C	G	rs9615351	byFrequency	TCGA-OR-A5LR-01A-11D-A29I-10	TCGA-OR-A5LR-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a4944d75-a6da-45bb-b5b9-3fa3355b0ead	c2a8460f-138e-44eb-a933-a5cd6ca34d8b	g.chr22:46760481C>G	ENST00000262738.3	-	33	8706	c.8707G>C	c.(8707-8709)Gag>Cag	p.E2903Q		NM_014246.1	NP_055061.1	Q9NYQ6	CELR1_HUMAN	cadherin, EGF LAG seven-pass G-type receptor 1	2903			E -> Q (in dbSNP:rs9615351).		anterior/posterior pattern specification (GO:0009952)|apical protein localization (GO:0045176)|central nervous system development (GO:0007417)|establishment of body hair planar orientation (GO:0048105)|establishment of planar polarity (GO:0001736)|establishment of planar polarity of embryonic epithelium (GO:0042249)|G-protein coupled receptor signaling pathway (GO:0007186)|hair follicle development (GO:0001942)|homophilic cell adhesion (GO:0007156)|inner ear morphogenesis (GO:0042472)|lateral sprouting involved in lung morphogenesis (GO:0060490)|locomotory behavior (GO:0007626)|neural tube closure (GO:0001843)|neuron migration (GO:0001764)|neuropeptide signaling pathway (GO:0007218)|orthogonal dichotomous subdivision of terminal units involved in lung branching morphogenesis (GO:0060488)|planar cell polarity pathway involved in neural tube closure (GO:0090179)|planar dichotomous subdivision of terminal units involved in lung branching morphogenesis (GO:0060489)|protein localization involved in establishment of planar polarity (GO:0090251)|regulation of actin cytoskeleton organization (GO:0032956)|Rho protein signal transduction (GO:0007266)|wound healing (GO:0042060)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)|protein dimerization activity (GO:0046983)|transmembrane signaling receptor activity (GO:0004888)			breast(8)|central_nervous_system(5)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(5)|kidney(4)|large_intestine(13)|lung(27)|ovary(2)|pancreas(2)|prostate(3)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(3)	95		Ovarian(80;0.00142)|Breast(42;0.00296)|all_neural(38;0.0416)|Colorectal(5;0.0766)		UCEC - Uterine corpus endometrioid carcinoma (28;0.00643)|BRCA - Breast invasive adenocarcinoma(115;0.171)		GGGGGGTACTCTCCACGGTGA	0.687													C|||	1203	0.240216	0.5492	0.1816	5008	,	,		16369	0.005		0.2455	False		,,,				2504	0.1012				p.E2903Q		.											.	CELSR1-525	0			c.G8707C						.	C	GLN/GLU	2305,2093	560.8+/-380.6	594,1117,488	31.0	36.0	34.0		8707	-1.8	0.0	22	dbSNP_119	34	2074,6516	337.7+/-322.4	228,1618,2449	yes	missense	CELSR1	NM_014246.1	29	822,2735,2937	GG,GC,CC		24.1444,47.5898,33.7157	possibly-damaging	2903/3015	46760481	4379,8609	2199	4295	6494	SO:0001583	missense	9620	exon33			GGTACTCTCCACG	AF231024	CCDS14076.1	22q13.31	2014-08-08	2013-02-18		ENSG00000075275	ENSG00000075275		"""Cadherins / Major cadherins"", ""-"", ""GPCR / Class B : Orphans"""	1850	protein-coding gene	gene with protein product	"""flamingo homolog 2 (Drosophila)"""	604523	"""cadherin, EGF LAG seven-pass G-type receptor 1, flamingo (Drosophila) homolog"""			9339365	Standard	XM_006724383		Approved	ME2, HFMI2, FMI2, CDHF9	uc003bhw.1	Q9NYQ6	OTTHUMG00000150423	ENST00000262738.3:c.8707G>C	22.37:g.46760481C>G	ENSP00000262738:p.Glu2903Gln	Somatic	12	0		WXS	Illumina GAIIx	Phase_I	52	47	NM_014246	0	0	0	1	1	O95722|Q5TH47|Q9BWQ5|Q9Y506|Q9Y526	Missense_Mutation	SNP	ENST00000262738.3	37	CCDS14076.1	515	0.2358058608058608	265	0.5386178861788617	73	0.20165745856353592	1	0.0017482517482517483	176	0.23218997361477572	C	11.43	1.635840	0.29068	0.524102	0.241444	ENSG00000075275	ENST00000262738	T	0.70516	-0.49	3.64	-1.76	0.08006	.	0.482328	0.14430	U	0.320053	T	0.00012	0.0000	L	0.61218	1.895	0.80722	P	0.0	P	0.39665	0.682	B	0.38428	0.273	T	0.43065	-0.9414	9	0.21540	T	0.41	.	2.3608	0.04307	0.1521:0.5191:0.1482:0.1806	rs9615351;rs60150914	2903	Q9NYQ6	CELR1_HUMAN	Q	2903	ENSP00000262738:E2903Q	ENSP00000262738:E2903Q	E	-	1	0	CELSR1	45139145	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	0.527000	0.22987	-0.226000	0.09899	-0.251000	0.11542	GAG	C|0.700;G|0.300		0.687	CELSR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318037.1	NM_014246	
RBM6	10180	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	50005492	50005492	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5LR-01A-11D-A29I-10	TCGA-OR-A5LR-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a4944d75-a6da-45bb-b5b9-3fa3355b0ead	c2a8460f-138e-44eb-a933-a5cd6ca34d8b	g.chr3:50005492C>T	ENST00000266022.4	+	3	893	c.634C>T	c.(634-636)Cgt>Tgt	p.R212C	RBM6_ENST00000441115.1_Intron|RBM6_ENST00000442092.1_Intron|RBM6_ENST00000443081.1_Missense_Mutation_p.R80C|RBM6_ENST00000539992.1_Intron|RBM6_ENST00000422955.1_Intron	NM_005777.2	NP_005768.1	P78332	RBM6_HUMAN	RNA binding motif protein 6	212					RNA processing (GO:0006396)	nucleus (GO:0005634)	DNA binding (GO:0003677)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(10)|ovary(3)|prostate(1)|skin(4)|urinary_tract(1)	33				BRCA - Breast invasive adenocarcinoma(193;6.81e-05)|KIRC - Kidney renal clear cell carcinoma(197;0.0084)|Kidney(197;0.00977)		AGAACAGTCCCGTTCTGATTT	0.428																																					p.R212C		.											.	RBM6-280	0			c.C634T						.						57.0	58.0	58.0					3																	50005492		2203	4300	6503	SO:0001583	missense	10180	exon3			CAGTCCCGTTCTG	AF069517	CCDS2809.1, CCDS54586.1	3p21.3	2013-01-28			ENSG00000004534	ENSG00000004534		"""RNA binding motif (RRM) containing"", ""G patch domain containing"""	9903	protein-coding gene	gene with protein product		606886				10352938	Standard	NM_001167582		Approved	DEF-3, 3G2, NY-LU-12, g16, DEF3	uc003cyc.3	P78332	OTTHUMG00000156736	ENST00000266022.4:c.634C>T	3.37:g.50005492C>T	ENSP00000266022:p.Arg212Cys	Somatic	123	0		WXS	Illumina GAIIx	Phase_I	77	17	NM_005777	0	0	5	9	4	O60549|O75524|Q86SS3	Missense_Mutation	SNP	ENST00000266022.4	37	CCDS2809.1	.	.	.	.	.	.	.	.	.	.	C	13.13	2.146473	0.37923	.	.	ENSG00000004534	ENST00000266022;ENST00000443081	T;T	0.32988	1.43;1.46	6.04	6.04	0.98038	.	0.293452	0.34700	N	0.003756	T	0.17874	0.0429	N	0.08118	0	0.80722	D	1	D	0.65815	0.995	B	0.44315	0.446	T	0.03051	-1.1078	9	.	.	.	-5.9312	11.4594	0.50202	0.0:0.8932:0.0:0.1068	.	212	P78332	RBM6_HUMAN	C	212;80	ENSP00000266022:R212C;ENSP00000396466:R80C	.	R	+	1	0	RBM6	49980496	1.000000	0.71417	1.000000	0.80357	0.945000	0.59286	2.518000	0.45537	2.873000	0.98535	0.561000	0.74099	CGT	.		0.428	RBM6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000345528.4	NM_005777	
HLTF	6596	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	148763873	148763873	+	Missense_Mutation	SNP	A	A	G			TCGA-OR-A5LR-01A-11D-A29I-10	TCGA-OR-A5LR-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a4944d75-a6da-45bb-b5b9-3fa3355b0ead	c2a8460f-138e-44eb-a933-a5cd6ca34d8b	g.chr3:148763873A>G	ENST00000310053.5	-	18	2259	c.2066T>C	c.(2065-2067)aTt>aCt	p.I689T	HLTF_ENST00000392912.2_Missense_Mutation_p.I689T|HLTF_ENST00000494055.1_Missense_Mutation_p.I689T|HLTF_ENST00000465259.1_Missense_Mutation_p.I688T	NM_003071.3|NM_139048.2	NP_003062.2|NP_620636.1	Q14527	HLTF_HUMAN	helicase-like transcription factor	689					chromatin modification (GO:0016568)|protein ubiquitination (GO:0016567)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|ligase activity (GO:0016874)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			breast(2)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(9)|lung(18)|ovary(1)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	47			LUSC - Lung squamous cell carcinoma(72;0.0473)|Lung(72;0.0607)			ATACCTTCCAATAGTGGCTCT	0.323																																					p.I689T		.											.	HLTF-659	0			c.T2066C						.						97.0	95.0	95.0					3																	148763873		2203	4299	6502	SO:0001583	missense	6596	exon18			CTTCCAATAGTGG	L34673	CCDS33875.1	3q25.1-q26.1	2006-11-09	2006-11-09	2006-11-09	ENSG00000071794	ENSG00000071794		"""RING-type (C3HC4) zinc fingers"""	11099	protein-coding gene	gene with protein product		603257	"""SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 3"""	SNF2L3, SMARCA3		7558014	Standard	NM_139048		Approved	HIP116A, HLTF1, RNF80	uc003ewr.1	Q14527	OTTHUMG00000159534	ENST00000310053.5:c.2066T>C	3.37:g.148763873A>G	ENSP00000308944:p.Ile689Thr	Somatic	122	0		WXS	Illumina GAIIx	Phase_I	92	65	NM_139048	0	0	0	0	0	D3DNH3|Q14536|Q16051|Q7KYJ6|Q86YA5|Q92652|Q96KM9	Missense_Mutation	SNP	ENST00000310053.5	37	CCDS33875.1	.	.	.	.	.	.	.	.	.	.	A	19.99	3.928378	0.73327	.	.	ENSG00000071794	ENST00000465259;ENST00000310053;ENST00000392912;ENST00000494055;ENST00000467858	T;T;T;T;T	0.76316	-1.01;-1.01;-1.01;-1.01;-1.01	5.54	5.54	0.83059	SNF2-related (1);	.	.	.	.	D	0.85873	0.5798	M	0.64997	1.995	0.49687	D	0.999812	D;D;D	0.89917	0.999;1.0;0.999	D;D;D	0.75020	0.976;0.985;0.976	D	0.86976	0.2101	9	0.62326	D	0.03	-23.1717	14.661	0.68870	1.0:0.0:0.0:0.0	.	689;689;689	Q59GQ7;A8K5B6;Q14527	.;.;HLTF_HUMAN	T	688;689;689;689;153	ENSP00000420745:I688T;ENSP00000308944:I689T;ENSP00000376644:I689T;ENSP00000420429:I689T;ENSP00000420106:I153T	ENSP00000308944:I689T	I	-	2	0	HLTF	150246563	1.000000	0.71417	0.998000	0.56505	0.997000	0.91878	6.709000	0.74665	2.090000	0.63153	0.528000	0.53228	ATT	.		0.323	HLTF-003	KNOWN	alternative_3_UTR|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000356064.1		
EIF2B5	8893	broad.mit.edu;bcgsc.ca	37	3	183853220	183853220	+	Missense_Mutation	SNP	C	C	T	rs113994041		TCGA-OR-A5LR-01A-11D-A29I-10	TCGA-OR-A5LR-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a4944d75-a6da-45bb-b5b9-3fa3355b0ead	c2a8460f-138e-44eb-a933-a5cd6ca34d8b	g.chr3:183853220C>T	ENST00000273783.3	+	1	169	c.47C>T	c.(46-48)gCt>gTt	p.A16V	EIF2B5_ENST00000432569.1_Missense_Mutation_p.A16V|RP11-778D9.13_ENST00000609288.1_lincRNA|RP11-778D9.12_ENST00000608232.1_RNA|RP11-778D9.12_ENST00000608135.1_RNA|EIF2B5_ENST00000444495.1_Missense_Mutation_p.A16V	NM_003907.2	NP_003898.2	Q13144	EI2BE_HUMAN	eukaryotic translation initiation factor 2B, subunit 5 epsilon, 82kDa	16					astrocyte development (GO:0014002)|astrocyte differentiation (GO:0048708)|cellular protein metabolic process (GO:0044267)|cellular response to drug (GO:0035690)|gene expression (GO:0010467)|myelination (GO:0042552)|negative regulation of translational initiation in response to stress (GO:0032057)|oligodendrocyte development (GO:0014003)|ovarian follicle development (GO:0001541)|positive regulation of GTPase activity (GO:0043547)|positive regulation of translational initiation (GO:0045948)|response to endoplasmic reticulum stress (GO:0034976)|response to glucose (GO:0009749)|response to heat (GO:0009408)|response to peptide hormone (GO:0043434)|translation (GO:0006412)|translational initiation (GO:0006413)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|eukaryotic translation initiation factor 2B complex (GO:0005851)|nucleus (GO:0005634)	guanyl-nucleotide exchange factor activity (GO:0005085)|translation initiation factor activity (GO:0003743)|translation initiation factor binding (GO:0031369)			cervix(1)|endometrium(3)|kidney(2)|large_intestine(6)|lung(9)|ovary(5)|urinary_tract(1)	27	all_cancers(143;7.59e-11)|Ovarian(172;0.0303)		Epithelial(37;7.06e-36)|OV - Ovarian serous cystadenocarcinoma(80;3.11e-22)			GTTAGTCGGGCTAACAAGCGC	0.697											OREG0015363	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.A16V		.											.	EIF2B5-95	0			c.C47T	GRCh37	CM041311	EIF2B5	M	rs113994041	.						6.0	8.0	7.0					3																	183853220		2156	4225	6381	SO:0001583	missense	8893	exon1			GTCGGGCTAACAA	U23028	CCDS3252.1	3q27.3	2006-07-18	2002-08-29		ENSG00000145191	ENSG00000145191			3261	protein-coding gene	gene with protein product		603945	"""eukaryotic translation initiation factor 2B, subunit 5 (epsilon, 82kD)"""			8688466	Standard	NM_003907		Approved	EIF2Bepsilon, EIF-2B	uc003fmp.3	Q13144	OTTHUMG00000156840	ENST00000273783.3:c.47C>T	3.37:g.183853220C>T	ENSP00000273783:p.Ala16Val	Somatic	50	0	1987	WXS	Illumina GAIIx	Phase_I	95	5	NM_003907	0	0	7	9	2	Q541Z1|Q96D04	Missense_Mutation	SNP	ENST00000273783.3	37	CCDS3252.1	.	.	.	.	.	.	.	.	.	.	c	13.35	2.211828	0.39102	.	.	ENSG00000145191	ENST00000273783;ENST00000432569;ENST00000444495	D;D;D	0.98135	-4.73;-4.17;-4.74	4.93	0.441	0.16577	.	0.600141	0.16984	N	0.191582	D	0.93507	0.7928	L	0.36672	1.1	0.25177	N	0.990238	B	0.02656	0.0	B	0.04013	0.001	D	0.87388	0.2361	10	0.52906	T	0.07	-3.2246	5.2587	0.15561	0.0:0.4724:0.2236:0.304	.	16	Q13144	EI2BE_HUMAN	V	16	ENSP00000273783:A16V;ENSP00000414775:A16V;ENSP00000409142:A16V	ENSP00000273783:A16V	A	+	2	0	EIF2B5	185335914	0.063000	0.20901	0.123000	0.21794	0.252000	0.25951	0.030000	0.13688	0.267000	0.21916	0.650000	0.86243	GCT	.		0.697	EIF2B5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346168.1		
MUC4	4585	bcgsc.ca	37	3	195507226	195507226	+	Missense_Mutation	SNP	A	A	G	rs201269328|rs74187968	byFrequency	TCGA-OR-A5LR-01A-11D-A29I-10	TCGA-OR-A5LR-10A-01D-A29L-10	A	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a4944d75-a6da-45bb-b5b9-3fa3355b0ead	c2a8460f-138e-44eb-a933-a5cd6ca34d8b	g.chr3:195507226A>G	ENST00000463781.3	-	2	11684	c.11225T>C	c.(11224-11226)gTc>gCc	p.V3742A	MUC4_ENST00000475231.1_Missense_Mutation_p.V3742A|MUC4_ENST00000346145.4_Intron|MUC4_ENST00000349607.4_Intron	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		AAGAGGGGTGACGTGACCTGT	0.587													.|||	1722	0.34385	0.4713	0.2594	5008	,	,		9294	0.3819		0.2913	False		,,,				2504	0.2464				p.V3742A		.											.	MUC4-90	0			c.T11225C						.						26.0	26.0	26.0					3																	195507226		670	1583	2253	SO:0001583	missense	4585	exon2			GGGGTGACGTGAC	AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.11225T>C	3.37:g.195507226A>G	ENSP00000417498:p.Val3742Ala	Somatic	286	7		WXS	Illumina GAIIx	Phase_I	240	19	NM_018406	0	0	0	0	0	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	ENST00000463781.3	37	CCDS54700.1	.	.	.	.	.	.	.	.	.	.	N	6.544	0.468647	0.12461	.	.	ENSG00000145113	ENST00000463781;ENST00000475231	T;T	0.47869	1.13;0.83	0.885	-1.77	0.07982	.	0.000000	0.25514	U	0.030158	T	0.17916	0.0430	N	0.08118	0	0.09310	N	1	B	0.19200	0.034	B	0.14023	0.01	T	0.12630	-1.0540	9	.	.	.	.	1.6977	0.02866	0.4856:0.0:0.2321:0.2823	.	3614	E7ESK3	.	A	3742	ENSP00000417498:V3742A;ENSP00000420243:V3742A	.	V	-	2	0	MUC4	196992005	0.000000	0.05858	0.020000	0.16555	0.037000	0.13140	-2.220000	0.01217	-1.811000	0.01229	-2.094000	0.00368	GTC	A|0.001;G|0.999		0.587	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324081.6	NM_018406	
FAM157A	728262	bcgsc.ca	37	3	197880133	197880133	+	lincRNA	SNP	A	A	G	rs56683636		TCGA-OR-A5LR-01A-11D-A29I-10	TCGA-OR-A5LR-10A-01D-A29L-10	A	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a4944d75-a6da-45bb-b5b9-3fa3355b0ead	c2a8460f-138e-44eb-a933-a5cd6ca34d8b	g.chr3:197880133A>G	ENST00000437428.2	+	0	13							C9JC47	F157A_HUMAN	family with sequence similarity 157, member A											NS(1)|skin(1)	2						AAGAACTGgcagcagcagcag	0.537																																					p.Q71R		.											.	.	0			c.A212G						.						24.0	20.0	22.0					3																	197880133		692	1591	2283			728262	exon2			ACTGGCAGCAGCA			3q29	2013-01-30			ENSG00000236438	ENSG00000236438			34079	other	unknown							Standard	NM_001145248		Approved		uc011bup.1	C9JC47			3.37:g.197880133A>G		Somatic	493	9		WXS	Illumina GAIIx	Phase_I	242	26	NM_001145248	0	0	0	0	0		Missense_Mutation	SNP	ENST00000437428.2	37		.	.	.	.	.	.	.	.	.	.	.	0.640	-0.813764	0.02798	.	.	ENSG00000236438	ENST00000431569	.	.	.	.	.	.	.	.	.	.	.	T	0.16727	0.0402	N	0.08118	0	0.09310	N	1	B	0.28667	0.219	B	0.32393	0.145	T	0.32052	-0.9921	5	.	.	.	.	.	.	.	.	71	C9JC47	F157A_HUMAN	R	71	.	.	Q	+	2	0	FAM157A	199364530	0.010000	0.17322	0.112000	0.21494	0.113000	0.19764	0.370000	0.20433	0.103000	0.17682	0.102000	0.15555	CAG	.		0.537	FAM157A-001	KNOWN	not_best_in_genome_evidence|mRNA_end_NF|basic	lincRNA	lincRNA	OTTHUMT00000340078.2	NM_001145248	
CRIPAK	285464	ucsc.edu;bcgsc.ca	37	4	1388324	1388324	+	Missense_Mutation	SNP	A	A	C	rs74377230		TCGA-OR-A5LR-01A-11D-A29I-10	TCGA-OR-A5LR-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a4944d75-a6da-45bb-b5b9-3fa3355b0ead	c2a8460f-138e-44eb-a933-a5cd6ca34d8b	g.chr4:1388324A>C	ENST00000324803.4	+	1	2985	c.25A>C	c.(25-27)Aat>Cat	p.N9H		NM_175918.3	NP_787114.2	Q8N1N5	CRPAK_HUMAN	cysteine-rich PAK1 inhibitor	9					negative regulation of intracellular estrogen receptor signaling pathway (GO:0033147)|negative regulation of protein kinase activity (GO:0006469)|regulation of cytoskeleton organization (GO:0051493)|response to estrogen (GO:0043627)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				NS(3)|breast(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(11)|ovary(1)|pancreas(2)|prostate(6)|skin(4)|urinary_tract(1)	35			OV - Ovarian serous cystadenocarcinoma(23;0.0106)			GCTTTGTGCCAATGTGGAGTG	0.537																																					p.N9H		.											.	CRIPAK-90	0			c.A25C						.						124.0	130.0	128.0					4																	1388324		2203	4300	6503	SO:0001583	missense	285464	exon1			TGTGCCAATGTGG	AK096209	CCDS3349.1	4p16.3	2011-02-10	2006-09-04		ENSG00000179979	ENSG00000179979			26619	protein-coding gene	gene with protein product		610203	"""cysteine-rich PAK1inhibitor"""			16278681	Standard	NM_175918		Approved	FLJ34443	uc003gdf.2	Q8N1N5	OTTHUMG00000121131	ENST00000324803.4:c.25A>C	4.37:g.1388324A>C	ENSP00000323978:p.Asn9His	Somatic	134	3		WXS	Illumina GAIIx	Phase_I	136	23	NM_175918	0	0	1	1	0	Q8NB03	Missense_Mutation	SNP	ENST00000324803.4	37	CCDS3349.1	.	.	.	.	.	.	.	.	.	.	G	0.580	-0.837604	0.02692	.	.	ENSG00000179979	ENST00000324803;ENST00000382944	T	0.23348	1.91	.	.	.	.	.	.	.	.	T	0.09598	0.0236	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.20240	-1.0281	7	0.49607	T	0.09	.	.	.	.	.	9	Q8N1N5	CRPAK_HUMAN	H	9;2	ENSP00000323978:N9H	ENSP00000323978:N9H	N	+	1	0	CRIPAK	1378324	0.752000	0.28338	0.019000	0.16419	0.027000	0.11550	-1.046000	0.03525	-1.644000	0.01517	-1.639000	0.00775	AAT	A|0.939;C|0.061		0.537	CRIPAK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000241607.2	NM_175918	
HGFAC	3083	bcgsc.ca	37	4	3449886	3449886	+	Silent	SNP	G	G	A	rs28468427	byFrequency	TCGA-OR-A5LR-01A-11D-A29I-10	TCGA-OR-A5LR-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a4944d75-a6da-45bb-b5b9-3fa3355b0ead	c2a8460f-138e-44eb-a933-a5cd6ca34d8b	g.chr4:3449886G>A	ENST00000382774.3	+	13	1783	c.1668G>A	c.(1666-1668)gaG>gaA	p.E556E	HGFAC_ENST00000511533.1_Silent_p.E563E	NM_001528.2	NP_001519.1	Q04756	HGFA_HUMAN	HGF activator	556	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				proteolysis (GO:0006508)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|rough endoplasmic reticulum (GO:0005791)	serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)			central_nervous_system(3)|cervix(1)|endometrium(4)|large_intestine(2)|lung(8)|upper_aerodigestive_tract(2)|urinary_tract(2)	22				UCEC - Uterine corpus endometrioid carcinoma (64;0.163)		CCCTGCGGGAGGCCCTGGTCC	0.672													G|||	1393	0.278155	0.2943	0.3285	5008	,	,		15192	0.3581		0.2336	False		,,,				2504	0.184				p.E556E		.											.	HGFAC-514	0			c.G1668A						.	G		1189,3185		196,797,1194	23.0	21.0	22.0		1668	2.1	1.0	4	dbSNP_125	22	1931,6629		246,1439,2595	no	coding-synonymous	HGFAC	NM_001528.2		442,2236,3789	AA,AG,GG		22.5584,27.1834,24.1225		556/656	3449886	3120,9814	2187	4280	6467	SO:0001819	synonymous_variant	3083	exon13			GCGGGAGGCCCTG	D14012	CCDS3369.1, CCDS75098.1	4p16	2008-02-07			ENSG00000109758	ENSG00000109758	3.4.21.-		4894	protein-coding gene	gene with protein product		604552				7683665, 8226803	Standard	XM_005247966		Approved	HGFAP, HGFA	uc003ghc.3	Q04756	OTTHUMG00000090281	ENST00000382774.3:c.1668G>A	4.37:g.3449886G>A		Somatic	49	0		WXS	Illumina GAIIx	Phase_I	167	7	NM_001528	0	0	0	0	0	Q14726|Q2M1W7|Q53X47	Silent	SNP	ENST00000382774.3	37	CCDS3369.1																																																																																			G|0.745;A|0.255		0.672	HGFAC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206607.3		
DSPP	1834	bcgsc.ca	37	4	88537294	88537294	+	Silent	SNP	T	T	C	rs111216206		TCGA-OR-A5LR-01A-11D-A29I-10	TCGA-OR-A5LR-10A-01D-A29L-10	T	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a4944d75-a6da-45bb-b5b9-3fa3355b0ead	c2a8460f-138e-44eb-a933-a5cd6ca34d8b	g.chr4:88537294T>C	ENST00000282478.7	+	4	3513	c.3480T>C	c.(3478-3480)agT>agC	p.S1160S	DSPP_ENST00000399271.1_Silent_p.S1160S|RP11-742B18.1_ENST00000506480.1_RNA			Q9NZW4	DSPP_HUMAN	dentin sialophosphoprotein	1160	Asp/Ser-rich.				biomineral tissue development (GO:0031214)|cellular response to cell-matrix adhesion (GO:0071460)|extracellular matrix organization (GO:0030198)|multicellular organismal development (GO:0007275)|ossification (GO:0001503)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|collagen binding (GO:0005518)|extracellular matrix structural constituent (GO:0005201)			breast(2)|central_nervous_system(1)|endometrium(9)|kidney(4)|large_intestine(8)|lung(13)|ovary(1)|skin(3)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	47		Hepatocellular(203;0.114)|all_hematologic(202;0.236)		OV - Ovarian serous cystadenocarcinoma(123;0.000508)		gcgacagcagtgacagcagcg	0.567																																					p.S1160S		.											.	DSPP-90	0			c.T3480C						.						43.0	58.0	53.0					4																	88537294		1580	2849	4429	SO:0001819	synonymous_variant	1834	exon5			CAGCAGTGACAGC	AF163151	CCDS43248.1	4q21.3	2008-02-05			ENSG00000152591	ENSG00000152591			3054	protein-coding gene	gene with protein product		125485		DFNA39, DGI1		8995371, 9533027	Standard	NM_014208		Approved	DMP3	uc003hqu.3	Q9NZW4	OTTHUMG00000161061	ENST00000282478.7:c.3480T>C	4.37:g.88537294T>C		Somatic	994	8		WXS	Illumina GAIIx	Phase_I	519	120	NM_014208	0	0	0	0	0	A8MUI0|O95815	Silent	SNP	ENST00000282478.7	37	CCDS43248.1																																																																																			.		0.567	DSPP-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000363616.3	NM_014208	
C4orf33	132321	bcgsc.ca	37	4	130032886	130032886	+	Silent	SNP	T	T	A			TCGA-OR-A5LR-01A-11D-A29I-10	TCGA-OR-A5LR-10A-01D-A29L-10	T	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a4944d75-a6da-45bb-b5b9-3fa3355b0ead	c2a8460f-138e-44eb-a933-a5cd6ca34d8b	g.chr4:130032886T>A	ENST00000281146.5	+	6	1261	c.540T>A	c.(538-540)ctT>ctA	p.L180L	C4orf33_ENST00000425929.1_Silent_p.L180L	NM_173487.2	NP_775758.2	Q8N1A6	CD033_HUMAN	chromosome 4 open reading frame 33	180										endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|lung(1)|prostate(1)|upper_aerodigestive_tract(1)	10						ACACACTGCTTGGAGAAGAGT	0.348																																					p.L180L		.											.	C4orf33-69	0			c.T540A						.						108.0	104.0	106.0					4																	130032886		2203	4300	6503	SO:0001819	synonymous_variant	132321	exon6			ACTGCTTGGAGAA	AK091022	CCDS3741.1	4q28.2	2008-02-05			ENSG00000151470	ENSG00000151470			27025	protein-coding gene	gene with protein product						12477932	Standard	NM_001099783		Approved	FLJ33703	uc010iod.3	Q8N1A6	OTTHUMG00000133347	ENST00000281146.5:c.540T>A	4.37:g.130032886T>A		Somatic	161	0		WXS	Illumina GAIIx	Phase_I	154	6	NM_001099783	0	0	15	15	0	D3DNY2|Q6PJF3|Q8NBC5	Silent	SNP	ENST00000281146.5	37	CCDS3741.1																																																																																			.		0.348	C4orf33-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257177.2	NM_173487	
EDNRA	1909	bcgsc.ca	37	4	148461037	148461037	+	Silent	SNP	T	T	C	rs5333	byFrequency	TCGA-OR-A5LR-01A-11D-A29I-10	TCGA-OR-A5LR-10A-01D-A29L-10	T	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a4944d75-a6da-45bb-b5b9-3fa3355b0ead	c2a8460f-138e-44eb-a933-a5cd6ca34d8b	g.chr4:148461037T>C	ENST00000324300.5	+	6	1484	c.969T>C	c.(967-969)caT>caC	p.H323H	EDNRA_ENST00000506066.1_Silent_p.H214H|EDNRA_ENST00000339690.5_3'UTR|EDNRA_ENST00000511804.1_Silent_p.H98H|EDNRA_ENST00000358556.4_Silent_p.H214H|EDNRA_ENST00000503721.1_3'UTR	NM_001957.3	NP_001948.1	P25101	EDNRA_HUMAN	endothelin receptor type A	323					activation of adenylate cyclase activity (GO:0007190)|activation of phospholipase C activity (GO:0007202)|aging (GO:0007568)|artery smooth muscle contraction (GO:0014824)|cell proliferation (GO:0008283)|cellular response to mechanical stimulus (GO:0071260)|endothelin receptor signaling pathway (GO:0086100)|enteric nervous system development (GO:0048484)|fibroblast proliferation (GO:0048144)|G-protein coupled receptor signaling pathway (GO:0007186)|glomerular filtration (GO:0003094)|glucose transport (GO:0015758)|head development (GO:0060322)|heart development (GO:0007507)|histamine secretion (GO:0001821)|in utero embryonic development (GO:0001701)|maternal process involved in parturition (GO:0060137)|metabolic process (GO:0008152)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cAMP biosynthetic process (GO:0030818)|neural crest cell development (GO:0014032)|patterning of blood vessels (GO:0001569)|penile erection (GO:0043084)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of cytosolic calcium ion concentration involved in phospholipase C-activating G-protein coupled signaling pathway (GO:0051482)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of inflammatory response (GO:0050729)|positive regulation of kidney development (GO:0090184)|positive regulation of neutrophil chemotaxis (GO:0090023)|positive regulation of odontogenesis (GO:0042482)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of release of sequestered calcium ion into cytosol (GO:0051281)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|regulation of blood pressure (GO:0008217)|regulation of epithelial cell proliferation (GO:0050678)|respiratory gaseous exchange (GO:0007585)|response to hypoxia (GO:0001666)|response to lipopolysaccharide (GO:0032496)|response to morphine (GO:0043278)|Rho protein signal transduction (GO:0007266)|sensory perception of pain (GO:0019233)|signal transduction (GO:0007165)|smooth muscle cell proliferation (GO:0048659)|smooth muscle contraction (GO:0006939)|vasoconstriction (GO:0042310)	integral component of plasma membrane (GO:0005887)|nuclear membrane (GO:0031965)|plasma membrane (GO:0005886)|T-tubule (GO:0030315)	endothelin receptor activity (GO:0004962)|phosphatidylinositol phospholipase C activity (GO:0004435)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(4)|large_intestine(4)|lung(3)|ovary(1)	17	all_hematologic(180;0.151)			GBM - Glioblastoma multiforme(119;0.154)	Acetylsalicylic acid(DB00945)|Bosentan(DB00559)|MACITENTAN(DB08932)|Sitaxentan(DB06268)	TCCCTCTTCATTTAAGCCGTA	0.378													T|||	1925	0.384385	0.6498	0.3386	5008	,	,		19262	0.2381		0.2237	False		,,,				2504	0.3742				p.H323H		.											.	EDNRA-586	0			c.T969C						.	T	,	2444,1962	621.4+/-393.7	684,1076,443	193.0	193.0	193.0		642,969	-1.1	1.0	4	dbSNP_52	193	2140,6460	367.5+/-334.7	275,1590,2435	no	coding-synonymous,coding-synonymous	EDNRA	NM_001166055.1,NM_001957.3	,	959,2666,2878	CC,CT,TT		24.8837,44.5302,35.2453	,	214/319,323/428	148461037	4584,8422	2203	4300	6503	SO:0001819	synonymous_variant	1909	exon6			TCTTCATTTAAGC	D90348	CCDS3769.1, CCDS54810.1, CCDS58927.1	4q31.22	2013-09-20			ENSG00000151617	ENSG00000151617		"""GPCR / Class A : Endothelin receptors"""	3179	protein-coding gene	gene with protein product		131243				1659806	Standard	NM_001957		Approved		uc003iky.3	P25101	OTTHUMG00000161354	ENST00000324300.5:c.969T>C	4.37:g.148461037T>C		Somatic	82	0		WXS	Illumina GAIIx	Phase_I	78	5	NM_001957	0	0	1	1	0	B2R723|B4E2V6|B7Z9G6|D3DP03|E7ER36|O43441|Q16432|Q16433|Q8TBH2	Silent	SNP	ENST00000324300.5	37	CCDS3769.1																																																																																			T|0.642;C|0.358		0.378	EDNRA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364635.1		
EDNRA	1909	ucsc.edu;bcgsc.ca	37	4	148461073	148461073	+	Silent	SNP	G	G	A	rs5334	byFrequency	TCGA-OR-A5LR-01A-11D-A29I-10	TCGA-OR-A5LR-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a4944d75-a6da-45bb-b5b9-3fa3355b0ead	c2a8460f-138e-44eb-a933-a5cd6ca34d8b	g.chr4:148461073G>A	ENST00000324300.5	+	6	1520	c.1005G>A	c.(1003-1005)gaG>gaA	p.E335E	EDNRA_ENST00000506066.1_Silent_p.E226E|EDNRA_ENST00000339690.5_3'UTR|EDNRA_ENST00000511804.1_Silent_p.E110E|EDNRA_ENST00000358556.4_Silent_p.E226E|EDNRA_ENST00000503721.1_3'UTR	NM_001957.3	NP_001948.1	P25101	EDNRA_HUMAN	endothelin receptor type A	335					activation of adenylate cyclase activity (GO:0007190)|activation of phospholipase C activity (GO:0007202)|aging (GO:0007568)|artery smooth muscle contraction (GO:0014824)|cell proliferation (GO:0008283)|cellular response to mechanical stimulus (GO:0071260)|endothelin receptor signaling pathway (GO:0086100)|enteric nervous system development (GO:0048484)|fibroblast proliferation (GO:0048144)|G-protein coupled receptor signaling pathway (GO:0007186)|glomerular filtration (GO:0003094)|glucose transport (GO:0015758)|head development (GO:0060322)|heart development (GO:0007507)|histamine secretion (GO:0001821)|in utero embryonic development (GO:0001701)|maternal process involved in parturition (GO:0060137)|metabolic process (GO:0008152)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cAMP biosynthetic process (GO:0030818)|neural crest cell development (GO:0014032)|patterning of blood vessels (GO:0001569)|penile erection (GO:0043084)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of cytosolic calcium ion concentration involved in phospholipase C-activating G-protein coupled signaling pathway (GO:0051482)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of inflammatory response (GO:0050729)|positive regulation of kidney development (GO:0090184)|positive regulation of neutrophil chemotaxis (GO:0090023)|positive regulation of odontogenesis (GO:0042482)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of release of sequestered calcium ion into cytosol (GO:0051281)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|regulation of blood pressure (GO:0008217)|regulation of epithelial cell proliferation (GO:0050678)|respiratory gaseous exchange (GO:0007585)|response to hypoxia (GO:0001666)|response to lipopolysaccharide (GO:0032496)|response to morphine (GO:0043278)|Rho protein signal transduction (GO:0007266)|sensory perception of pain (GO:0019233)|signal transduction (GO:0007165)|smooth muscle cell proliferation (GO:0048659)|smooth muscle contraction (GO:0006939)|vasoconstriction (GO:0042310)	integral component of plasma membrane (GO:0005887)|nuclear membrane (GO:0031965)|plasma membrane (GO:0005886)|T-tubule (GO:0030315)	endothelin receptor activity (GO:0004962)|phosphatidylinositol phospholipase C activity (GO:0004435)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(4)|large_intestine(4)|lung(3)|ovary(1)	17	all_hematologic(180;0.151)			GBM - Glioblastoma multiforme(119;0.154)	Acetylsalicylic acid(DB00945)|Bosentan(DB00559)|MACITENTAN(DB08932)|Sitaxentan(DB06268)	TGTATAACGAGATGGACAAGA	0.348													G|||	1924	0.384185	0.6498	0.3372	5008	,	,		18834	0.2381		0.2237	False		,,,				2504	0.3742				p.E335E		.											.	EDNRA-586	0			c.G1005A						.	G	,	2444,1962	621.4+/-393.7	684,1076,443	182.0	182.0	182.0		678,1005	3.6	1.0	4	dbSNP_52	182	2140,6460	367.3+/-334.7	275,1590,2435	no	coding-synonymous,coding-synonymous	EDNRA	NM_001166055.1,NM_001957.3	,	959,2666,2878	AA,AG,GG		24.8837,44.5302,35.2453	,	226/319,335/428	148461073	4584,8422	2203	4300	6503	SO:0001819	synonymous_variant	1909	exon6			TAACGAGATGGAC	D90348	CCDS3769.1, CCDS54810.1, CCDS58927.1	4q31.22	2013-09-20			ENSG00000151617	ENSG00000151617		"""GPCR / Class A : Endothelin receptors"""	3179	protein-coding gene	gene with protein product		131243				1659806	Standard	NM_001957		Approved		uc003iky.3	P25101	OTTHUMG00000161354	ENST00000324300.5:c.1005G>A	4.37:g.148461073G>A		Somatic	55	0		WXS	Illumina GAIIx	Phase_I	61	6	NM_001957	0	0	1	1	0	B2R723|B4E2V6|B7Z9G6|D3DP03|E7ER36|O43441|Q16432|Q16433|Q8TBH2	Silent	SNP	ENST00000324300.5	37	CCDS3769.1																																																																																			G|0.644;A|0.356		0.348	EDNRA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364635.1		
MRPS30	10884	broad.mit.edu	37	5	44809179	44809179	+	Missense_Mutation	SNP	A	A	C			TCGA-OR-A5LR-01A-11D-A29I-10	TCGA-OR-A5LR-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a4944d75-a6da-45bb-b5b9-3fa3355b0ead	c2a8460f-138e-44eb-a933-a5cd6ca34d8b	g.chr5:44809179A>C	ENST00000507110.1	+	1	153	c.115A>C	c.(115-117)Acc>Ccc	p.T39P	RP11-53O19.1_ENST00000508945.1_RNA|RP11-53O19.1_ENST00000505637.1_RNA|RP11-53O19.1_ENST00000505401.1_RNA|RP11-53O19.1_ENST00000505302.1_RNA|RP11-53O19.1_ENST00000508123.1_RNA|RP11-53O19.1_ENST00000503179.1_RNA|RP11-53O19.1_ENST00000503452.1_RNA|RP11-53O19.1_ENST00000514597.1_RNA	NM_016640.3	NP_057724.2	Q9NP92	RT30_HUMAN	mitochondrial ribosomal protein S30	39					apoptotic process (GO:0006915)|translation (GO:0006412)	mitochondrion (GO:0005739)|ribosome (GO:0005840)	poly(A) RNA binding (GO:0044822)|structural constituent of ribosome (GO:0003735)			central_nervous_system(1)|cervix(1)|endometrium(4)|large_intestine(2)|lung(11)|prostate(1)	20	Lung NSC(6;8.08e-07)					CGTCGCGGCGACCCCCGTCGC	0.677																																					p.T39P		.											.	MRPS30-227	0			c.A115C						.						9.0	11.0	11.0					5																	44809179		2159	4249	6408	SO:0001583	missense	10884	exon1			GCGGCGACCCCCG	AF146192	CCDS3951.1	5q11	2012-09-13		2001-11-09	ENSG00000112996	ENSG00000112996		"""Mitochondrial ribosomal proteins / small subunits"""	8769	protein-coding gene	gene with protein product		611991		PDCD9		10640817, 11279123	Standard	NM_016640		Approved	PAP	uc003joh.3	Q9NP92	OTTHUMG00000096967	ENST00000507110.1:c.115A>C	5.37:g.44809179A>C	ENSP00000424328:p.Thr39Pro	Somatic	23	2		WXS	Illumina GAIIx	Phase_I	175	42	NM_016640	0	0	8	9	1	Q96I91|Q96Q19|Q9H0P8|Q9NSF9|Q9NZ76	Missense_Mutation	SNP	ENST00000507110.1	37	CCDS3951.1	.	.	.	.	.	.	.	.	.	.	A	16.97	3.267918	0.59540	.	.	ENSG00000112996	ENST00000507110	T	0.18960	2.18	5.03	1.94	0.25998	.	0.293028	0.30528	N	0.009432	T	0.16685	0.0401	L	0.55481	1.735	0.19775	N	0.999952	B	0.09022	0.002	B	0.12156	0.007	T	0.16808	-1.0390	10	0.32370	T	0.25	-5.4412	5.1907	0.15209	0.2516:0.0:0.5853:0.163	.	39	Q9NP92	RT30_HUMAN	P	39	ENSP00000424328:T39P	ENSP00000424328:T39P	T	+	1	0	MRPS30	44844936	0.001000	0.12720	0.009000	0.14445	0.043000	0.13939	0.701000	0.25616	0.578000	0.29487	-0.250000	0.11733	ACC	.		0.677	MRPS30-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214033.2	NM_016640	
PCDHB10	56126	hgsc.bcm.edu	37	5	140573844	140573844	+	Silent	SNP	C	C	T			TCGA-OR-A5LR-01A-11D-A29I-10	TCGA-OR-A5LR-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a4944d75-a6da-45bb-b5b9-3fa3355b0ead	c2a8460f-138e-44eb-a933-a5cd6ca34d8b	g.chr5:140573844C>T	ENST00000239446.4	+	1	1903	c.1719C>T	c.(1717-1719)acC>acT	p.T573T		NM_018930.3	NP_061753.1	Q9UN67	PCDBA_HUMAN	protocadherin beta 10	573	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|homophilic cell adhesion (GO:0007156)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(14)|lung(30)|ovary(4)|prostate(5)|skin(3)|upper_aerodigestive_tract(4)|urinary_tract(2)	76			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			CGCCCTGCACCGAGCTGGTGC	0.711																																					p.T573T		.											.	PCDHB10-92	0			c.C1719T						.						7.0	10.0	9.0					5																	140573844		1626	3527	5153	SO:0001819	synonymous_variant	56126	exon1			CTGCACCGAGCTG	AF152489	CCDS4252.1	5q31.3	2010-06-15			ENSG00000120324	ENSG00000120324		"""Cadherins / Protocadherins : Clustered"""	8681	other	protocadherin		606336				10380929	Standard	NM_018930		Approved		uc003lix.3	Q9UN67	OTTHUMG00000129626	ENST00000239446.4:c.1719C>T	5.37:g.140573844C>T		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	46	19	NM_018930	0	0	15	15	0	Q96T99	Silent	SNP	ENST00000239446.4	37	CCDS4252.1																																																																																			.		0.711	PCDHB10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251821.1	NM_018930	
HIST1H3D	8351	broad.mit.edu;bcgsc.ca	37	6	26197478	26197478	+	Start_Codon_SNP	SNP	T	T	C			TCGA-OR-A5LR-01A-11D-A29I-10	TCGA-OR-A5LR-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a4944d75-a6da-45bb-b5b9-3fa3355b0ead	c2a8460f-138e-44eb-a933-a5cd6ca34d8b	g.chr6:26197478T>C	ENST00000377831.5	-	2	454	c.1A>G	c.(1-3)Atg>Gtg	p.M1V	HIST1H2BF_ENST00000359985.1_5'Flank|HIST1H3D_ENST00000356476.2_Splice_Site_p.M1V	NM_003530.3	NP_003521.2	P68431	H31_HUMAN	histone cluster 1, H3d	1					blood coagulation (GO:0007596)|chromatin organization (GO:0006325)|DNA replication-dependent nucleosome assembly (GO:0006335)|regulation of gene silencing (GO:0060968)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nuclear chromosome (GO:0000228)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)|protein complex (GO:0043234)	DNA binding (GO:0003677)			NS(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(6)	14		all_hematologic(11;0.196)				GTACGAGCCATTGCGAACTTC	0.542																																					p.M1V	GBM(108;3816 4467)	.											.	HIST1H3D-90	0			c.A1G						.						47.0	52.0	50.0					6																	26197478		2202	4298	6500	SO:0001582	initiator_codon_variant	8351	exon2			GAGCCATTGCGAA	Z80784	CCDS4590.1	6p22.1	2011-01-27	2006-10-11	2003-02-14	ENSG00000197409	ENSG00000197409		"""Histones / Replication-dependent"""	4767	protein-coding gene	gene with protein product		602811	"""H3 histone family, member B"", ""histone 1, H3d"""	H3FB		9119399, 12408966	Standard	NM_003530		Approved	H3/b	uc003ngv.4	P68431	OTTHUMG00000014433	ENST00000377831.5:c.1A>G	6.37:g.26197478T>C	ENSP00000367062:p.Met1Val	Somatic	301	0		WXS	Illumina GAIIx	Phase_I	274	13	NM_003530	0	0	1	1	0	A0PJT7|A5PLR1|P02295|P02296|P16106|Q6ISV8|Q6NWP8|Q6NWP9|Q6NXU4|Q71DJ3|Q93081	Missense_Mutation	SNP	ENST00000377831.5	37	CCDS4590.1	.	.	.	.	.	.	.	.	.	.	.	10.47	1.359085	0.24598	.	.	ENSG00000197409	ENST00000356476;ENST00000377831	T;T	0.56275	0.47;0.47	4.14	4.14	0.48551	.	.	.	.	.	T	0.55577	0.1929	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.62393	-0.6864	6	0.66056	D	0.02	.	12.6401	0.56705	0.0:0.0:0.0:1.0	.	.	.	.	V	1	ENSP00000366999:M1V;ENSP00000367062:M1V	ENSP00000366999:M1V	M	-	1	0	HIST1H3D	26305457	1.000000	0.71417	0.623000	0.29173	0.067000	0.16453	5.925000	0.70062	1.638000	0.50547	0.533000	0.62120	ATG	.		0.542	HIST1H3D-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_003530	Missense_Mutation
PNPLA1	285848	ucsc.edu;bcgsc.ca	37	6	36260858	36260858	+	Silent	SNP	C	C	T	rs2239795	byFrequency	TCGA-OR-A5LR-01A-11D-A29I-10	TCGA-OR-A5LR-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a4944d75-a6da-45bb-b5b9-3fa3355b0ead	c2a8460f-138e-44eb-a933-a5cd6ca34d8b	g.chr6:36260858C>T	ENST00000394571.2	+	3	459	c.459C>T	c.(457-459)ttC>ttT	p.F153F	PNPLA1_ENST00000312917.5_Silent_p.F58F|PNPLA1_ENST00000388715.3_Silent_p.F58F	NM_001145717.1	NP_001139189.2	Q8N8W4	PLPL1_HUMAN	patatin-like phospholipase domain containing 1	153	Patatin.				lipid catabolic process (GO:0016042)	cytoplasm (GO:0005737)	hydrolase activity (GO:0016787)			breast(1)|kidney(1)|large_intestine(4)|lung(9)|pancreas(1)|skin(4)|upper_aerodigestive_tract(2)	22						GCAGCTGCTTCGTCCCGGTGT	0.662													C|||	2095	0.418331	0.5703	0.3213	5008	,	,		17655	0.3472		0.4155	False		,,,				2504	0.3579				p.F153F		.											.	PNPLA1-137	0			c.C459T						.	C	,,	2278,2128	598.9+/-389.2	596,1086,521	116.0	96.0	103.0		174,459,174	-5.1	0.9	6	dbSNP_98	103	3346,5254	497.8+/-374.6	654,2038,1608	no	coding-synonymous,coding-synonymous,coding-synonymous	PNPLA1	NM_001145716.1,NM_001145717.1,NM_173676.2	,,	1250,3124,2129	TT,TC,CC		38.907,48.2978,43.2416	,,	58/447,153/533,58/438	36260858	5624,7382	2203	4300	6503	SO:0001819	synonymous_variant	285848	exon3			CTGCTTCGTCCCG		CCDS34438.1, CCDS47416.1, CCDS54997.1	6p21.31	2009-01-12			ENSG00000180316	ENSG00000180316		"""Patatin-like phospholipase domain containing"""	21246	protein-coding gene	gene with protein product		612121				16799181, 19029121	Standard	NM_001145717		Approved	FLJ38755, dJ50J22.1	uc010jwf.2	Q8N8W4	OTTHUMG00000014590	ENST00000394571.2:c.459C>T	6.37:g.36260858C>T		Somatic	101	1		WXS	Illumina GAIIx	Phase_I	64	6	NM_001145717	0	0	0	0	0	A3RMU3|J3JS20|Q2A6N1|Q3SY95|Q3SY96|Q5R3L2	Silent	SNP	ENST00000394571.2	37	CCDS54997.1																																																																																			C|0.568;T|0.432		0.662	PNPLA1-201	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		NM_173676	
SH3BGRL2	83699	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	80406276	80406276	+	Silent	SNP	A	A	G			TCGA-OR-A5LR-01A-11D-A29I-10	TCGA-OR-A5LR-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a4944d75-a6da-45bb-b5b9-3fa3355b0ead	c2a8460f-138e-44eb-a933-a5cd6ca34d8b	g.chr6:80406276A>G	ENST00000369838.4	+	3	485	c.306A>G	c.(304-306)gcA>gcG	p.A102A		NM_031469.2	NP_113657.1	Q9UJC5	SH3L2_HUMAN	SH3 domain binding glutamate-rich protein like 2	102						extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)				large_intestine(2)|lung(3)	5		all_cancers(76;0.00188)|Acute lymphoblastic leukemia(125;1.24e-05)|all_hematologic(105;0.00223)|all_epithelial(107;0.174)		BRCA - Breast invasive adenocarcinoma(397;0.0278)		CACGGTTGGCATCAAAGGTAG	0.333																																					p.A102A		.											.	SH3BGRL2-226	0			c.A306G						.						125.0	114.0	118.0					6																	80406276		2203	4300	6503	SO:0001819	synonymous_variant	83699	exon3			GTTGGCATCAAAG	AJ297972	CCDS4991.1	6q14.1	2014-02-19	2014-02-19		ENSG00000198478	ENSG00000198478			15567	protein-coding gene	gene with protein product		615678	"""SH3 domain binding glutamic acid-rich protein like 2"""			12095696	Standard	NM_031469		Approved		uc003piz.1	Q9UJC5	OTTHUMG00000015081	ENST00000369838.4:c.306A>G	6.37:g.80406276A>G		Somatic	61	0		WXS	Illumina GAIIx	Phase_I	55	14	NM_031469	0	0	0	0	0	A8MQU2|Q2VPC2|Q5VV96|Q6NSK8|Q6P9E8|Q7Z734|Q8IWD3|Q9BPY5	Silent	SNP	ENST00000369838.4	37	CCDS4991.1																																																																																			.		0.333	SH3BGRL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041309.1		
EIF3B	8662	hgsc.bcm.edu	37	7	2394991	2394991	+	Silent	SNP	C	C	T	rs11551167	byFrequency	TCGA-OR-A5LR-01A-11D-A29I-10	TCGA-OR-A5LR-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a4944d75-a6da-45bb-b5b9-3fa3355b0ead	c2a8460f-138e-44eb-a933-a5cd6ca34d8b	g.chr7:2394991C>T	ENST00000360876.4	+	1	491	c.435C>T	c.(433-435)aaC>aaT	p.N145N	EIF3B_ENST00000397011.2_Silent_p.N145N	NM_001037283.1	NP_001032360.1			eukaryotic translation initiation factor 3, subunit B											breast(2)|endometrium(4)|kidney(2)|large_intestine(3)|lung(11)|ovary(1)|skin(1)	24		Ovarian(82;0.0253)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0833)|OV - Ovarian serous cystadenocarcinoma(56;7.76e-14)		CGCTGGAGAACGGCGACGCGG	0.756													C|||	1173	0.234225	0.0847	0.1513	5008	,	,		9860	0.2808		0.2704	False		,,,				2504	0.41				p.N145N		.											.	EIF3B-68	0			c.C435T						.	C	,	311,3057		24,263,1397	4.0	4.0	4.0		435,435	0.5	1.0	7	dbSNP_120	4	1454,5336		174,1106,2115	no	coding-synonymous,coding-synonymous	EIF3B	NM_001037283.1,NM_003751.3	,	198,1369,3512	TT,TC,CC		21.4138,9.234,17.3755	,	145/815,145/815	2394991	1765,8393	1684	3395	5079	SO:0001819	synonymous_variant	8662	exon1			GGAGAACGGCGAC	U62583	CCDS5332.1	7p22	2013-02-12	2007-07-27	2007-07-27	ENSG00000106263	ENSG00000106263		"""RNA binding motif (RRM) containing"""	3280	protein-coding gene	gene with protein product		603917	"""eukaryotic translation initiation factor 3, subunit 9 eta, 116kDa"""	EIF3S9		8995410	Standard	NM_001037283		Approved	PRT1, eIF3b	uc003sly.3	P55884	OTTHUMG00000022839	ENST00000360876.4:c.435C>T	7.37:g.2394991C>T		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	4	4	NM_001037283	0	0	0	12	12		Silent	SNP	ENST00000360876.4	37	CCDS5332.1																																																																																			C|0.787;T|0.213		0.756	EIF3B-002	KNOWN	alternative_3_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207006.1		
KIAA0087	9808	broad.mit.edu;bcgsc.ca	37	7	26578105	26578105	+	Silent	SNP	A	A	G	rs17153822	byFrequency	TCGA-OR-A5LR-01A-11D-A29I-10	TCGA-OR-A5LR-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a4944d75-a6da-45bb-b5b9-3fa3355b0ead	c2a8460f-138e-44eb-a933-a5cd6ca34d8b	g.chr7:26578105A>G	ENST00000242109.3	-	1	302	c.69T>C	c.(67-69)gaT>gaC	p.D23D				Q14695	K0087_HUMAN	KIAA0087	23																	ATCCGTCCCTATCAGTGCCAG	0.572													A|||	1035	0.206669	0.4758	0.2133	5008	,	,		17376	0.0159		0.168	False		,,,				2504	0.0746				.		.											.	.	0			.						.																																			SO:0001819	synonymous_variant	9808	.			GTCCCTATCAGTG	BC128257		7p15.2	2013-01-16			ENSG00000122548	ENSG00000122548			22191	other	unknown							Standard	NR_022006		Approved		uc003sya.2	Q14695	OTTHUMG00000023321	ENST00000242109.3:c.69T>C	7.37:g.26578105A>G		Somatic	68	0		WXS	Illumina GAIIx	Phase_I	50	4	.	0	0	1	1	0	A1A524|Q75MW1	RNA	SNP	ENST00000242109.3	37																																																																																				A|0.787;G|0.213		0.572	KIAA0087-088	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000328273.1	NR_022006	
CLDN23	137075	hgsc.bcm.edu	37	8	8560536	8560536	+	Missense_Mutation	SNP	G	G	A	rs12548737	byFrequency	TCGA-OR-A5LR-01A-11D-A29I-10	TCGA-OR-A5LR-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a4944d75-a6da-45bb-b5b9-3fa3355b0ead	c2a8460f-138e-44eb-a933-a5cd6ca34d8b	g.chr8:8560536G>A	ENST00000519106.1	+	1	1089	c.628G>A	c.(628-630)Gtg>Atg	p.V210M		NM_194284.2	NP_919260.2	Q96B33	CLD23_HUMAN	claudin 23	210			V -> M (in dbSNP:rs12548737).		calcium-independent cell-cell adhesion (GO:0016338)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|tight junction assembly (GO:0070830)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|tight junction (GO:0005923)	identical protein binding (GO:0042802)|structural molecule activity (GO:0005198)			endometrium(2)	2		Hepatocellular(245;0.217)		COAD - Colon adenocarcinoma(149;0.071)|READ - Rectum adenocarcinoma(644;0.238)		CACCATCCAAGTGGAGTGGCC	0.731													G|||	569	0.113618	0.0083	0.1916	5008	,	,		12622	0.1488		0.0954	False		,,,				2504	0.183				p.V210M		.											.	.	0			c.G628A						.	G	MET/VAL	84,3832		0,84,1874	5.0	8.0	7.0		628	2.3	0.8	8	dbSNP_120	7	857,7211		50,757,3227	yes	missense	CLDN23	NM_194284.2	21	50,841,5101	AA,AG,GG		10.6222,2.145,7.8521	possibly-damaging	210/293	8560536	941,11043	1958	4034	5992	SO:0001583	missense	137075	exon1			ATCCAAGTGGAGT	AK123547	CCDS55195.1	8p23.1	2006-04-12				ENSG00000253958		"""Claudins"""	17591	protein-coding gene	gene with protein product		609203				12736707	Standard	NM_194284		Approved	CLDNL	uc003wsi.3	Q96B33		ENST00000519106.1:c.628G>A	8.37:g.8560536G>A	ENSP00000428780:p.Val210Met	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	10	5	NM_194284	0	0	0	0	0	Q08AJ3	Missense_Mutation	SNP	ENST00000519106.1	37	CCDS55195.1	199	0.09111721611721611	8	0.016260162601626018	54	0.14917127071823205	69	0.12062937062937062	68	0.08970976253298153	G	12.41	1.930863	0.34096	0.02145	0.106222	ENSG00000253958	ENST00000519106	T	0.61859	0.07	4.12	2.31	0.28768	.	.	.	.	.	T	0.00300	0.0009	L	0.27053	0.805	0.40159	P	0.022958000000000034	P	0.48162	0.906	P	0.46585	0.521	T	0.03524	-1.1028	8	0.33940	T	0.23	.	8.182	0.31315	0.2087:0.0:0.7913:0.0	rs12548737	210	Q96B33	CLD23_HUMAN	M	210	ENSP00000428780:V210M	ENSP00000428780:V210M	V	+	1	0	CLDN23	8597946	0.949000	0.32298	0.846000	0.33378	0.051000	0.14879	3.623000	0.54224	1.090000	0.41315	0.407000	0.27541	GTG	G|0.907;A|0.093		0.731	CLDN23-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374721.1	NM_194284	
OPRK1	4986	hgsc.bcm.edu	37	8	54163562	54163562	+	Silent	SNP	C	C	A	rs1051660	byFrequency	TCGA-OR-A5LR-01A-11D-A29I-10	TCGA-OR-A5LR-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a4944d75-a6da-45bb-b5b9-3fa3355b0ead	c2a8460f-138e-44eb-a933-a5cd6ca34d8b	g.chr8:54163562C>A	ENST00000265572.3	-	2	333	c.36G>T	c.(34-36)ccG>ccT	p.P12P	OPRK1_ENST00000520287.1_Silent_p.P12P	NM_000912.3	NP_000903.2	P41145	OPRK_HUMAN	opioid receptor, kappa 1	12					adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|adenylate cyclase-inhibiting opioid receptor signaling pathway (GO:0031635)|behavior (GO:0007610)|defense response to virus (GO:0051607)|immune response (GO:0006955)|locomotory behavior (GO:0007626)|opioid receptor signaling pathway (GO:0038003)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|regulation of saliva secretion (GO:0046877)|sensory perception (GO:0007600)|sensory perception of pain (GO:0019233)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	dynorphin receptor activity (GO:0038048)|opioid receptor activity (GO:0004985)			NS(2)|breast(3)|endometrium(3)|kidney(12)|large_intestine(7)|lung(8)|ovary(1)|prostate(1)|skin(5)|urinary_tract(1)	43		all_epithelial(80;0.066)|Lung NSC(129;0.0804)|all_lung(136;0.136)			Alvimopan(DB06274)|Amitriptyline(DB00321)|Buprenorphine(DB00921)|Butorphanol(DB00611)|Codeine(DB00318)|Dextromethorphan(DB00514)|Dextropropoxyphene(DB00647)|Dezocine(DB01209)|Fentanyl(DB00813)|Heroin(DB01452)|Hydromorphone(DB00327)|Ketamine(DB01221)|Ketobemidone(DB06738)|Levorphanol(DB00854)|Loperamide(DB00836)|Menthol(DB00825)|Methylnaltrexone(DB06800)|Mianserin(DB06148)|Mirtazapine(DB00370)|Morphine(DB00295)|Nalbuphine(DB00844)|Naloxone(DB01183)|Naltrexone(DB00704)|Oxycodone(DB00497)|Pentazocine(DB00652)|Pethidine(DB00454)|Progesterone(DB00396)|Remifentanil(DB00899)|Sufentanil(DB00708)|Tapentadol(DB06204)|Tramadol(DB00193)	AGGTAGGGCCCGGCTCCCCGC	0.726													c|||	573	0.114417	0.0968	0.0476	5008	,	,		11885	0.1478		0.0785	False		,,,				2504	0.1881				p.P12P		.											.	OPRK1-70	0			c.G36T	GRCh37	CM074395	OPRK1	M	rs1051660	.			392,3590		20,352,1619	6.0	9.0	8.0		36	-1.5	0.1	8	dbSNP_86	8	701,7415		24,653,3381	no	coding-synonymous	OPRK1	NM_000912.3		44,1005,5000	AA,AC,CC		8.6373,9.8443,9.0346		12/381	54163562	1093,11005	1991	4058	6049	SO:0001819	synonymous_variant	4986	exon2			AGGGCCCGGCTCC		CCDS6152.1, CCDS64895.1	8q11.2	2014-05-21			ENSG00000082556	ENSG00000082556		"""GPCR / Class A : Opioid receptors"""	8154	protein-coding gene	gene with protein product		165196				8188308	Standard	XM_005251252		Approved	KOR, OPRK	uc003xri.1	P41145	OTTHUMG00000164276	ENST00000265572.3:c.36G>T	8.37:g.54163562C>A		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	14	8	NM_000912	0	0	0	0	0	E5RHC9|Q499G4	Silent	SNP	ENST00000265572.3	37	CCDS6152.1																																																																																			C|0.895;A|0.105		0.726	OPRK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378048.1		
PLEC	5339	hgsc.bcm.edu	37	8	144992388	144992388	+	Silent	SNP	G	G	A	rs75833626	byFrequency	TCGA-OR-A5LR-01A-11D-A29I-10	TCGA-OR-A5LR-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a4944d75-a6da-45bb-b5b9-3fa3355b0ead	c2a8460f-138e-44eb-a933-a5cd6ca34d8b	g.chr8:144992388G>A	ENST00000322810.4	-	32	12181	c.12012C>T	c.(12010-12012)gaC>gaT	p.D4004D	PLEC_ENST00000345136.3_Silent_p.D3867D|PLEC_ENST00000356346.3_Silent_p.D3853D|PLEC_ENST00000398774.2_Silent_p.D3835D|PLEC_ENST00000436759.2_Silent_p.D3894D|PLEC_ENST00000357649.2_Silent_p.D3871D|PLEC_ENST00000527096.1_Silent_p.D3890D|PLEC_ENST00000354958.2_Silent_p.D3845D|PLEC_ENST00000354589.3_Silent_p.D3867D	NM_201380.2	NP_958782.1	Q15149	PLEC_HUMAN	plectin	4004	Globular 2.				apoptotic process (GO:0006915)|cell junction assembly (GO:0034329)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)	costamere (GO:0043034)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|hemidesmosome (GO:0030056)|intermediate filament cytoskeleton (GO:0045111)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|sarcoplasm (GO:0016528)	ankyrin binding (GO:0030506)|poly(A) RNA binding (GO:0044822)|structural constituent of muscle (GO:0008307)			NS(1)|breast(3)|central_nervous_system(4)|cervix(7)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(8)|lung(57)|ovary(4)|pancreas(2)|prostate(11)|skin(9)|stomach(2)|upper_aerodigestive_tract(10)	137						CGGTGCCGTCGTCACGACGGC	0.687													G|||	212	0.0423323	0.152	0.0086	5008	,	,		11105	0.004		0.001	False		,,,				2504	0.0				p.D4004D		.											.	PLEC-141	0			c.C12012T						.	G	,,,,,,,	484,3264		25,434,1415	9.0	12.0	11.0		11682,11559,11535,12012,11505,11601,11613,11601	-5.8	0.0	8	dbSNP_132	11	9,7997		0,9,3994	no	coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous	PLEC	NM_000445.3,NM_201378.2,NM_201379.1,NM_201380.2,NM_201381.1,NM_201382.2,NM_201383.1,NM_201384.1	,,,,,,,	25,443,5409	AA,AG,GG		0.1124,12.9136,4.1943	,,,,,,,	3894/4575,3853/4534,3845/4526,4004/4685,3835/4516,3867/4548,3871/4552,3867/4548	144992388	493,11261	1874	4003	5877	SO:0001819	synonymous_variant	5339	exon32			GCCGTCGTCACGA	U53204	CCDS43769.1, CCDS43770.1, CCDS43771.1, CCDS43772.1, CCDS43773.1, CCDS43774.1, CCDS43775.1, CCDS47936.1	8q24	2010-02-04	2010-02-04	2010-02-04	ENSG00000178209	ENSG00000178209			9069	protein-coding gene	gene with protein product		601282	"""plectin 1, intermediate filament binding protein, 500kD"", ""epidermolysis bullosa simplex 1 (Ogna)"", ""plectin 1, intermediate filament binding protein 500kDa"""	EBS1, PLEC1		8633055, 8696340	Standard	XM_005250976		Approved	PCN, PLTN	uc003zaf.1	Q15149	OTTHUMG00000165291	ENST00000322810.4:c.12012C>T	8.37:g.144992388G>A		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	18	12	NM_201380	1	0	21	49	27	Q15148|Q16640|Q6S376|Q6S377|Q6S378|Q6S379|Q6S380|Q6S381|Q6S382|Q6S383	Silent	SNP	ENST00000322810.4	37	CCDS43772.1																																																																																			G|0.965;A|0.035		0.687	PLEC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383281.1	NM_000445	
HSF1	3297	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	145535011	145535011	+	Missense_Mutation	SNP	T	T	A			TCGA-OR-A5LR-01A-11D-A29I-10	TCGA-OR-A5LR-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a4944d75-a6da-45bb-b5b9-3fa3355b0ead	c2a8460f-138e-44eb-a933-a5cd6ca34d8b	g.chr8:145535011T>A	ENST00000528838.1	+	6	729	c.569T>A	c.(568-570)aTt>aAt	p.I190N	HSF1_ENST00000400780.4_Missense_Mutation_p.I125N	NM_005526.2	NP_005517.1	Q00613	HSF1_HUMAN	heat shock transcription factor 1	190	Hydrophobic repeat HR-A/B.				cellular response to heat (GO:0034605)|defense response (GO:0006952)|embryonic placenta development (GO:0001892)|embryonic process involved in female pregnancy (GO:0060136)|female meiotic division (GO:0007143)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of tumor necrosis factor production (GO:0032720)|positive regulation of multicellular organism growth (GO:0040018)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein phosphorylation (GO:0006468)|regulation of spindle checkpoint (GO:0090231)|response to lipopolysaccharide (GO:0032496)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|pronucleus (GO:0045120)|protein complex (GO:0043234)	chromatin binding (GO:0003682)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II intronic transcription regulatory region sequence-specific DNA binding (GO:0001162)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(1)|large_intestine(1)|lung(3)|prostate(3)|skin(1)|urinary_tract(2)	11	all_cancers(97;6.64e-12)|all_epithelial(106;2.89e-10)|Lung NSC(106;5.7e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;3.94e-40)|Epithelial(56;1.12e-39)|all cancers(56;9.11e-35)|BRCA - Breast invasive adenocarcinoma(115;0.0547)|Colorectal(110;0.055)			CCACAGCTCATTCAGTTCCTG	0.617																																					p.I190N		.											.	HSF1-46	0			c.T569A						.						69.0	72.0	71.0					8																	145535011		2203	4296	6499	SO:0001583	missense	3297	exon6			AGCTCATTCAGTT	M64673	CCDS6419.1	8q24.3	2014-04-10			ENSG00000185122	ENSG00000185122			5224	protein-coding gene	gene with protein product		140580				1871105	Standard	NM_005526		Approved	HSTF1	uc003zbt.4	Q00613	OTTHUMG00000174604	ENST00000528838.1:c.569T>A	8.37:g.145535011T>A	ENSP00000431512:p.Ile190Asn	Somatic	50	0		WXS	Illumina GAIIx	Phase_I	79	27	NM_005526	0	0	1	2	1	A8K4L0|A8MW26|Q53XT4	Missense_Mutation	SNP	ENST00000528838.1	37	CCDS6419.1	.	.	.	.	.	.	.	.	.	.	T	22.7	4.329887	0.81690	.	.	ENSG00000185122	ENST00000528838;ENST00000533240;ENST00000400780	.	.	.	5.5	5.5	0.81552	.	0.000000	0.85682	D	0.000000	T	0.75744	0.3891	M	0.84948	2.725	0.54753	D	0.999988	D	0.54397	0.966	P	0.59288	0.855	T	0.79546	-0.1759	9	0.87932	D	0	-21.2902	8.1715	0.31258	0.0:0.0888:0.0:0.9112	.	190	Q00613	HSF1_HUMAN	N	190;125;125	.	ENSP00000383590:I125N	I	+	2	0	HSF1	145505819	1.000000	0.71417	1.000000	0.80357	0.935000	0.57460	3.115000	0.50391	2.082000	0.62665	0.533000	0.62120	ATT	.		0.617	HSF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382053.1	NM_005526	
TMEM2	23670	broad.mit.edu;ucsc.edu	37	9	74359971	74359971	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5LR-01A-11D-A29I-10	TCGA-OR-A5LR-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a4944d75-a6da-45bb-b5b9-3fa3355b0ead	c2a8460f-138e-44eb-a933-a5cd6ca34d8b	g.chr9:74359971G>A	ENST00000377044.4	-	4	1536	c.997C>T	c.(997-999)Cgg>Tgg	p.R333W	TMEM2_ENST00000377066.5_Missense_Mutation_p.R333W	NM_001135820.1|NM_013390.2	NP_001129292.1|NP_037522.1	Q9UHN6	TMEM2_HUMAN	transmembrane protein 2	333					multicellular organismal development (GO:0007275)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)				central_nervous_system(1)|endometrium(6)|kidney(3)|large_intestine(15)|liver(1)|lung(19)|ovary(2)|prostate(5)|skin(1)|stomach(1)|urinary_tract(2)	56		all_epithelial(88;4.56e-14)|Myeloproliferative disorder(762;0.0255)		GBM - Glioblastoma multiforme(74;7.45e-21)|OV - Ovarian serous cystadenocarcinoma(323;1.02e-16)		CTTCCCAACCGTTCCTGGATC	0.517																																					p.R333W		.											.	TMEM2-92	0			c.C997T						.						149.0	131.0	137.0					9																	74359971		2203	4300	6503	SO:0001583	missense	23670	exon4			CCAACCGTTCCTG		CCDS6638.1, CCDS47979.1	9q21.13	2011-07-19			ENSG00000135048	ENSG00000135048			11869	protein-coding gene	gene with protein product		605835					Standard	NM_013390		Approved		uc011lsa.1	Q9UHN6	OTTHUMG00000020000	ENST00000377044.4:c.997C>T	9.37:g.74359971G>A	ENSP00000366243:p.Arg333Trp	Somatic	72	1		WXS	Illumina GAIIx	Phase_I	60	7	NM_001135820	0	0	0	0	0	A6H8W9|B2RTQ6|Q5T838|Q5T839|Q5T840|Q5T841|Q8NBP6|Q9P2D5	Missense_Mutation	SNP	ENST00000377044.4	37	CCDS6638.1	.	.	.	.	.	.	.	.	.	.	G	20.2	3.951185	0.73787	.	.	ENSG00000135048	ENST00000377044;ENST00000377066	T;T	0.73469	-0.75;-0.7	6.03	5.11	0.69529	.	0.450530	0.24695	N	0.036355	T	0.78310	0.4263	L	0.39898	1.24	0.80722	D	1	D;D	0.76494	0.997;0.999	P;P	0.56474	0.634;0.799	T	0.80555	-0.1330	10	0.66056	D	0.02	.	16.4709	0.84112	0.0:0.0:0.8678:0.1322	.	333;333	Q9UHN6;Q9UHN6-2	TMEM2_HUMAN;.	W	333	ENSP00000366243:R333W;ENSP00000366266:R333W	ENSP00000366243:R333W	R	-	1	2	TMEM2	73549791	1.000000	0.71417	0.831000	0.32960	0.749000	0.42624	3.286000	0.51724	1.514000	0.48869	0.655000	0.94253	CGG	.		0.517	TMEM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052618.2	NM_013390	
PPAPDC3	84814	bcgsc.ca	37	9	134165546	134165546	+	Silent	SNP	C	C	T	rs141024100	byFrequency	TCGA-OR-A5LR-01A-11D-A29I-10	TCGA-OR-A5LR-10A-01D-A29L-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a4944d75-a6da-45bb-b5b9-3fa3355b0ead	c2a8460f-138e-44eb-a933-a5cd6ca34d8b	g.chr9:134165546C>T	ENST00000372264.3	+	1	466	c.162C>T	c.(160-162)gaC>gaT	p.D54D	PPAPDC3_ENST00000372261.1_Silent_p.D54D	NM_032728.3	NP_116117.3	Q8NBV4	PPAC3_HUMAN	phosphatidic acid phosphatase type 2 domain containing 3	54					negative regulation of myotube differentiation (GO:0010832)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|nuclear envelope (GO:0005635)	hydrolase activity (GO:0016787)			breast(2)|central_nervous_system(1)|kidney(1)|large_intestine(2)|lung(9)|skin(1)	16	all_hematologic(7;0.0119)			OV - Ovarian serous cystadenocarcinoma(145;1.22e-05)|Epithelial(140;0.000173)		CTGCTGGTGACGGGGCCAGAG	0.677																																					p.D54D		.											.	PPAPDC3-153	0			c.C162T						.						29.0	28.0	29.0					9																	134165546		2202	4299	6501	SO:0001819	synonymous_variant	84814	exon1			TGGTGACGGGGCC	AK027568	CCDS6942.1	9q34.2-q34.3	2008-02-26	2005-07-15	2005-07-15	ENSG00000160539	ENSG00000160539			28174	protein-coding gene	gene with protein product			"""chromosome 9 open reading frame 67"""	C9orf67		12958361	Standard	NM_032728		Approved	MGC12921, FLJ14662, NET39	uc004cal.2	Q8NBV4	OTTHUMG00000020822	ENST00000372264.3:c.162C>T	9.37:g.134165546C>T		Somatic	40	0		WXS	Illumina GAIIx	Phase_I	80	5	NM_032728	0	0	7	7	0	Q5T6P0|Q96SS7|Q9BRC3	Silent	SNP	ENST00000372264.3	37	CCDS6942.1																																																																																			C|0.999;A|0.001		0.677	PPAPDC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054724.1	NM_032728	
ABCA2	20	broad.mit.edu	37	9	139907251	139907251	+	Missense_Mutation	SNP	A	A	C			TCGA-OR-A5LR-01A-11D-A29I-10	TCGA-OR-A5LR-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a4944d75-a6da-45bb-b5b9-3fa3355b0ead	c2a8460f-138e-44eb-a933-a5cd6ca34d8b	g.chr9:139907251A>C	ENST00000371605.3	-	30	5138	c.4991T>G	c.(4990-4992)gTg>gGg	p.V1664G	ABCA2_ENST00000341511.6_Missense_Mutation_p.V1665G|ABCA2_ENST00000265662.5_Missense_Mutation_p.V1665G			Q9BZC7	ABCA2_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 2	1664					ATP catabolic process (GO:0006200)|cholesterol homeostasis (GO:0042632)|lipid metabolic process (GO:0006629)|regulation of intracellular cholesterol transport (GO:0032383)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to drug (GO:0042493)|response to steroid hormone (GO:0048545)|transmembrane transport (GO:0055085)|transport (GO:0006810)	ATP-binding cassette (ABC) transporter complex (GO:0043190)|cytoplasmic membrane-bounded vesicle (GO:0016023)|endosome (GO:0005768)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|membrane (GO:0016020)|microtubule organizing center (GO:0005815)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|nucleotide binding (GO:0000166)			central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|liver(1)|lung(25)|prostate(2)|skin(1)|stomach(1)|urinary_tract(1)	41	all_cancers(76;0.16)	Myeloproliferative disorder(178;0.0511)	STAD - Stomach adenocarcinoma(284;0.123)	OV - Ovarian serous cystadenocarcinoma(145;2.94e-05)|Epithelial(140;0.00048)		GCCTGTGACCACCCGCATCTG	0.687																																					p.V1695G		.											.	ABCA2-90	0			c.T5084G						.						17.0	22.0	20.0					9																	139907251		2020	4135	6155	SO:0001583	missense	20	exon31			GTGACCACCCGCA	U18235	CCDS43909.1	9q34	2012-03-14			ENSG00000107331	ENSG00000107331		"""ATP binding cassette transporters / subfamily A"""	32	protein-coding gene	gene with protein product		600047		ABC2		8088782	Standard	NM_212533		Approved		uc022bpy.1	Q9BZC7	OTTHUMG00000020958	ENST00000371605.3:c.4991T>G	9.37:g.139907251A>C	ENSP00000360666:p.Val1664Gly	Somatic	93	7		WXS	Illumina GAIIx	Phase_I	174	50	NM_212533	0	0	7	7	0	A6NED5|Q5SPY5|Q5W9G5|Q76MW7|Q9HC28	Missense_Mutation	SNP	ENST00000371605.3	37		.	.	.	.	.	.	.	.	.	.	A	14.80	2.642131	0.47153	.	.	ENSG00000107331	ENST00000265662;ENST00000371605;ENST00000355090;ENST00000341511	D;D;D	0.87966	-2.32;-2.32;-2.32	4.15	4.15	0.48705	.	2.364680	0.02861	U	0.130366	D	0.90079	0.6901	L	0.60455	1.87	0.80722	D	1	D;D	0.60575	0.988;0.988	P;P	0.49502	0.534;0.613	T	0.80915	-0.1169	10	0.87932	D	0	.	13.3138	0.60394	1.0:0.0:0.0:0.0	.	1664;1695	Q9BZC7;E7ETC3	ABCA2_HUMAN;.	G	1665;1664;1695;1665	ENSP00000265662:V1665G;ENSP00000360666:V1664G;ENSP00000344155:V1665G	ENSP00000265662:V1665G	V	-	2	0	ABCA2	139027072	1.000000	0.71417	0.966000	0.40874	0.994000	0.84299	5.356000	0.66052	1.738000	0.51689	0.402000	0.26972	GTG	.		0.687	ABCA2-202	KNOWN	basic	protein_coding	protein_coding		NM_001606	
CDKL5	6792	ucsc.edu;bcgsc.ca	37	X	18622933	18622933	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5LR-01A-11D-A29I-10	TCGA-OR-A5LR-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a4944d75-a6da-45bb-b5b9-3fa3355b0ead	c2a8460f-138e-44eb-a933-a5cd6ca34d8b	g.chrX:18622933G>A	ENST00000379989.3	+	13	2174	c.1889G>A	c.(1888-1890)aGc>aAc	p.S630N	CDKL5_ENST00000463994.1_3'UTR|CDKL5_ENST00000379996.3_Missense_Mutation_p.S630N	NM_001037343.1	NP_001032420.1	O76039	CDKL5_HUMAN	cyclin-dependent kinase-like 5	630					neuron migration (GO:0001764)|positive regulation of axon extension (GO:0045773)|positive regulation of dendrite morphogenesis (GO:0050775)|positive regulation of Rac GTPase activity (GO:0032855)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of dendrite development (GO:0050773)	cytoplasm (GO:0005737)|dendrite cytoplasm (GO:0032839)|dendritic growth cone (GO:0044294)|nucleus (GO:0005634)|ruffle membrane (GO:0032587)	ATP binding (GO:0005524)|cyclin-dependent protein serine/threonine kinase activity (GO:0004693)|kinase activity (GO:0016301)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|Rac GTPase binding (GO:0048365)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(11)|lung(12)|ovary(4)|skin(5)|stomach(1)	44	Hepatocellular(33;0.183)					GGAAGCTTGAGCATAGGGCAA	0.542																																					p.S630N		.											.	CDKL5-838	0			c.G1889A						.						181.0	167.0	172.0					X																	18622933		2203	4300	6503	SO:0001583	missense	6792	exon12			GCTTGAGCATAGG	Y15057	CCDS14186.1	Xp22	2011-11-04	2002-11-26	2002-11-29	ENSG00000008086	ENSG00000008086		"""Cyclin-dependent kinases"""	11411	protein-coding gene	gene with protein product		300203	"""serine/threonine kinase 9"""	STK9		9721213, 16935860	Standard	XM_005274584		Approved	EIEE2	uc004cym.3	O76039	OTTHUMG00000021214	ENST00000379989.3:c.1889G>A	X.37:g.18622933G>A	ENSP00000369325:p.Ser630Asn	Somatic	214	3		WXS	Illumina GAIIx	Phase_I	292	120	NM_003159	0	0	0	0	0	G9B9X4|Q14198|Q5H985|Q8IYC7|Q9UJL6	Missense_Mutation	SNP	ENST00000379989.3	37	CCDS14186.1	.	.	.	.	.	.	.	.	.	.	G	9.889	1.203734	0.22121	.	.	ENSG00000008086	ENST00000379996;ENST00000379989	T;T	0.70749	-0.51;-0.51	5.83	2.71	0.32032	.	0.260249	0.51477	D	0.000092	T	0.48040	0.1478	N	0.08118	0	0.22446	N	0.999097	B	0.06786	0.001	B	0.06405	0.002	T	0.41070	-0.9529	10	0.45353	T	0.12	-9.4695	10.1316	0.42682	0.312:0.0:0.688:0.0	.	630	O76039	CDKL5_HUMAN	N	630	ENSP00000369332:S630N;ENSP00000369325:S630N	ENSP00000369325:S630N	S	+	2	0	CDKL5	18532854	1.000000	0.71417	0.920000	0.36463	0.975000	0.68041	2.022000	0.41030	0.627000	0.30340	-0.191000	0.12829	AGC	.		0.542	CDKL5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055945.2	NM_003159	
MAOA	4128	broad.mit.edu	37	X	43595521	43595523	+	In_Frame_Del	DEL	AAA	AAA	-			TCGA-OR-A5LR-01A-11D-A29I-10	TCGA-OR-A5LR-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a4944d75-a6da-45bb-b5b9-3fa3355b0ead	c2a8460f-138e-44eb-a933-a5cd6ca34d8b	g.chrX:43595521_43595523delAAA	ENST00000338702.3	+	10	1223_1225	c.1100_1102delAAA	c.(1099-1104)gaaata>gta	p.367_368EI>V	MAOA_ENST00000542639.1_In_Frame_Del_p.234_235EI>V	NM_000240.3	NP_000231.1	P21397	AOFA_HUMAN	monoamine oxidase A	367					cellular biogenic amine metabolic process (GO:0006576)|dopamine catabolic process (GO:0042420)|neurotransmitter biosynthetic process (GO:0042136)|neurotransmitter catabolic process (GO:0042135)|neurotransmitter secretion (GO:0007269)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|xenobiotic metabolic process (GO:0006805)	integral component of membrane (GO:0016021)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)	primary amine oxidase activity (GO:0008131)			NS(1)|breast(2)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(3)|liver(1)|lung(2)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	18					Almotriptan(DB00918)|Dopamine(DB00988)|Ephedra(DB01363)|Flavin adenine dinucleotide(DB03147)|Furazolidone(DB00614)|Isocarboxazid(DB01247)|Linezolid(DB00601)|Methamphetamine(DB01577)|Minaprine(DB00805)|Moclobemide(DB01171)|Nandrolone decanoate(DB08804)|Naratriptan(DB00952)|Nicotine(DB00184)|Pargyline(DB01626)|Phenelzine(DB00780)|Phentermine(DB00191)|Phenylephrine(DB00388)|Phenylpropanolamine(DB00397)|Procaine(DB00721)|Pseudoephedrine(DB00852)|Riboflavin(DB00140)|Rizatriptan(DB00953)|Selegiline(DB01037)|Sertraline(DB01104)|Sumatriptan(DB00669)|Testosterone(DB00624)|Tranylcypromine(DB00752)|Zolmitriptan(DB00315)|Zonisamide(DB00909)	CTACATAAGGAAATAAGGTAAGA	0.345																																					p.367_368del		.											.	MAOA-194	0			c.1100_1102del						.																																			SO:0001651	inframe_deletion	4128	exon10			ATAAGGAAATAAG		CCDS14260.1, CCDS59163.1	Xp11.4-p11.3	2008-02-05			ENSG00000189221	ENSG00000189221	1.4.3.4		6833	protein-coding gene	gene with protein product		309850					Standard	NM_000240		Approved		uc004dfy.4	P21397	OTTHUMG00000021387	ENST00000338702.3:c.1100_1102delAAA	X.37:g.43595521_43595523delAAA	ENSP00000340684:p.Glu367_Ile368delinsVal	Somatic	193	0		WXS	Illumina GAIIx	Phase_I	259	7	NM_000240	0	0	0	0	0	B4DF46|Q16426	In_Frame_Del	DEL	ENST00000338702.3	37	CCDS14260.1																																																																																			.		0.345	MAOA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056300.1	NM_000240	
MAOA	4128	hgsc.bcm.edu	37	X	43595521	43595530	+	Splice_Site	DEL	AAATAAGGTA	AAATAAGGTA	-			TCGA-OR-A5LR-01A-11D-A29I-10	TCGA-OR-A5LR-10A-01D-A29L-10	AAATAAGGTA	AAATAAGGTA	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a4944d75-a6da-45bb-b5b9-3fa3355b0ead	c2a8460f-138e-44eb-a933-a5cd6ca34d8b	g.chrX:43595521_43595530delAAATAAGGTA	ENST00000338702.3	+	10	1223_1229	c.1100_1106delAAATAAGGTA	c.(1099-1107)gaaataagg>gg	p.EIR367fs	MAOA_ENST00000542639.1_Splice_Site_p.EIR234fs	NM_000240.3	NP_000231.1	P21397	AOFA_HUMAN	monoamine oxidase A	367					cellular biogenic amine metabolic process (GO:0006576)|dopamine catabolic process (GO:0042420)|neurotransmitter biosynthetic process (GO:0042136)|neurotransmitter catabolic process (GO:0042135)|neurotransmitter secretion (GO:0007269)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|xenobiotic metabolic process (GO:0006805)	integral component of membrane (GO:0016021)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)	primary amine oxidase activity (GO:0008131)			NS(1)|breast(2)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(3)|liver(1)|lung(2)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	18					Almotriptan(DB00918)|Dopamine(DB00988)|Ephedra(DB01363)|Flavin adenine dinucleotide(DB03147)|Furazolidone(DB00614)|Isocarboxazid(DB01247)|Linezolid(DB00601)|Methamphetamine(DB01577)|Minaprine(DB00805)|Moclobemide(DB01171)|Nandrolone decanoate(DB08804)|Naratriptan(DB00952)|Nicotine(DB00184)|Pargyline(DB01626)|Phenelzine(DB00780)|Phentermine(DB00191)|Phenylephrine(DB00388)|Phenylpropanolamine(DB00397)|Procaine(DB00721)|Pseudoephedrine(DB00852)|Riboflavin(DB00140)|Rizatriptan(DB00953)|Selegiline(DB01037)|Sertraline(DB01104)|Sumatriptan(DB00669)|Testosterone(DB00624)|Tranylcypromine(DB00752)|Zolmitriptan(DB00315)|Zonisamide(DB00909)	CTACATAAGGAAATAAGGTAAGAATTTATA	0.343																																					p.367_369del		.											.	MAOA-194	0			c.1100_1106del						.																																			SO:0001630	splice_region_variant	4128	exon10			ATAAGGAAATAAG		CCDS14260.1, CCDS59163.1	Xp11.4-p11.3	2008-02-05			ENSG00000189221	ENSG00000189221	1.4.3.4		6833	protein-coding gene	gene with protein product		309850					Standard	NM_000240		Approved		uc004dfy.4	P21397	OTTHUMG00000021387	ENST00000338702.3:c.1106+1AAATAAGGTA>-	X.37:g.43595521_43595530delAAATAAGGTA		Somatic	193	0		WXS	Illumina GAIIx	Phase_I	259	0	NM_000240	0	0	0	0	0	B4DF46|Q16426	Frame_Shift_Del	DEL	ENST00000338702.3	37	CCDS14260.1																																																																																			.		0.343	MAOA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056300.1	NM_000240	Frame_Shift_Del
MAOA	4128	broad.mit.edu;bcgsc.ca	37	X	43595525	43595530	+	Splice_Site	DEL	AAGGTA	AAGGTA	-			TCGA-OR-A5LR-01A-11D-A29I-10	TCGA-OR-A5LR-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a4944d75-a6da-45bb-b5b9-3fa3355b0ead	c2a8460f-138e-44eb-a933-a5cd6ca34d8b	g.chrX:43595525_43595530delAAGGTA	ENST00000338702.3	+	10	1227_1229	c.1104_1106delAAGGTA	c.(1102-1107)ataagg>atg	p.368_369IR>M	MAOA_ENST00000542639.1_Splice_Site_p.235_236IR>M	NM_000240.3	NP_000231.1	P21397	AOFA_HUMAN	monoamine oxidase A	368					cellular biogenic amine metabolic process (GO:0006576)|dopamine catabolic process (GO:0042420)|neurotransmitter biosynthetic process (GO:0042136)|neurotransmitter catabolic process (GO:0042135)|neurotransmitter secretion (GO:0007269)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|xenobiotic metabolic process (GO:0006805)	integral component of membrane (GO:0016021)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)	primary amine oxidase activity (GO:0008131)			NS(1)|breast(2)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(3)|liver(1)|lung(2)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	18					Almotriptan(DB00918)|Dopamine(DB00988)|Ephedra(DB01363)|Flavin adenine dinucleotide(DB03147)|Furazolidone(DB00614)|Isocarboxazid(DB01247)|Linezolid(DB00601)|Methamphetamine(DB01577)|Minaprine(DB00805)|Moclobemide(DB01171)|Nandrolone decanoate(DB08804)|Naratriptan(DB00952)|Nicotine(DB00184)|Pargyline(DB01626)|Phenelzine(DB00780)|Phentermine(DB00191)|Phenylephrine(DB00388)|Phenylpropanolamine(DB00397)|Procaine(DB00721)|Pseudoephedrine(DB00852)|Riboflavin(DB00140)|Rizatriptan(DB00953)|Selegiline(DB01037)|Sertraline(DB01104)|Sumatriptan(DB00669)|Testosterone(DB00624)|Tranylcypromine(DB00752)|Zolmitriptan(DB00315)|Zonisamide(DB00909)	ATAAGGAAATAAGGTAAGAATTTATA	0.34																																					p.368_369del		.											.	MAOA-194	0			c.1104_1106del						.																																			SO:0001630	splice_region_variant	4128	exon10			GGAAATAAGGTAA		CCDS14260.1, CCDS59163.1	Xp11.4-p11.3	2008-02-05			ENSG00000189221	ENSG00000189221	1.4.3.4		6833	protein-coding gene	gene with protein product		309850					Standard	NM_000240		Approved		uc004dfy.4	P21397	OTTHUMG00000021387	ENST00000338702.3:c.1106+1AAGGTA>-	X.37:g.43595525_43595530delAAGGTA		Somatic	185	0		WXS	Illumina GAIIx	Phase_I	244	7	NM_000240	0	0	0	0	0	B4DF46|Q16426	In_Frame_Del	DEL	ENST00000338702.3	37	CCDS14260.1																																																																																			.		0.340	MAOA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056300.1	NM_000240	In_Frame_Del
MN1	4330	broad.mit.edu	37	22	28194933	28194934	+	In_Frame_Ins	INS	-	-	TGC	rs572936881|rs34890218|rs373314940|rs71194738	byFrequency	TCGA-OR-A5LR-01A-11D-A29I-10	TCGA-OR-A5LR-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a4944d75-a6da-45bb-b5b9-3fa3355b0ead	c2a8460f-138e-44eb-a933-a5cd6ca34d8b	g.chr22:28194933_28194934insTGC	ENST00000302326.4	-	1	2552_2553	c.1598_1599insGCA	c.(1597-1599)caa>caGCAa	p.533_533Q>QQ		NM_002430.2	NP_002421.3	Q10571	MN1_HUMAN	meningioma (disrupted in balanced translocation) 1	533	Poly-Gln.				intramembranous ossification (GO:0001957)					NS(1)|breast(2)|central_nervous_system(3)|endometrium(4)|kidney(3)|large_intestine(6)|lung(15)|ovary(3)|prostate(4)|skin(3)|upper_aerodigestive_tract(1)	45						gctgctgctgttgctgctgctg	0.653			T	ETV6	"""AML, meningioma"""									447	0.0892572	0.0393	0.1196	5008	,	,		12327	0.0774		0.1789	False		,,,				2504	0.0552				p.Q533delinsQQ		.		Dom	yes		22	22q13	4330	meningioma (disrupted in balanced translocation) 1		"""L, O"""	.	MN1-993	0			c.1599_1600insGCA						.																																			SO:0001652	inframe_insertion	4330	exon1			CTGCTGTTGCTGC	X82209	CCDS42998.1	22q12.1	2010-09-29			ENSG00000169184	ENSG00000169184			7180	protein-coding gene	gene with protein product	"""probable tumor suppressor protein MN1"""	156100	"""meningioma chromosome region"""	MGCR		7731706, 12569362	Standard	NM_002430		Approved	MGCR1-PEN, MGCR1	uc003adj.3	Q10571	OTTHUMG00000150975	ENST00000302326.4:c.1596_1598dupGCA	22.37:g.28194940_28194942dupTGC	ENSP00000304956:p.Gln550dup	Somatic	6	0		WXS	Illumina GAIIx	Phase_I	62	41	NM_002430	0	0	0	0	0	A9Z1V9	In_Frame_Ins	INS	ENST00000302326.4	37	CCDS42998.1																																																																																			.		0.653	MN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320737.1	NM_002430	
PRSS48	345062	bcgsc.ca	37	4	152201018	152201019	+	Frame_Shift_Ins	INS	-	-	CAGGT	rs148861921|rs71901196|rs77216366	byFrequency	TCGA-OR-A5LR-01A-11D-A29I-10	TCGA-OR-A5LR-10A-01D-A29L-10	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a4944d75-a6da-45bb-b5b9-3fa3355b0ead	c2a8460f-138e-44eb-a933-a5cd6ca34d8b	g.chr4:152201018_152201019insCAGGT	ENST00000455694.2	+	2	125_126	c.123_124insCAGGT	c.(124-126)cagfs	p.-43fs	PRSS48_ENST00000441586.2_Intron|SH3D19_ENST00000604030.1_Intron	NM_183375.2	NP_899231.2	Q7RTY5	PRS48_HUMAN	protease, serine, 48							extracellular region (GO:0005576)	serine-type endopeptidase activity (GO:0004252)			kidney(1)|large_intestine(2)|lung(2)|prostate(2)|urinary_tract(1)	8						GCTGGCCTTGGCAGGTCAGCCT	0.53														1064	0.21246	0.0787	0.2464	5008	,	,		20396	0.1766		0.4205	False		,,,				2504	0.1922				p.W41fs		.											.	PRSS48-67	0			c.123_124insCAGGT						.			524,3274		60,404,1435						5.0	1.0		dbSNP_130	113	3418,4526		764,1890,1318	no	frameshift	PRSS48	NM_183375.2		824,2294,2753	A1A1,A1R,RR		43.0262,13.7967,33.5718				3942,7800				SO:0001589	frameshift_variant	345062	exon2			GCCTTGGCAGGTC	BN000134	CCDS47145.1	4q31.3	2010-05-07			ENSG00000189099	ENSG00000189099		"""Serine peptidases / Serine peptidases"""	24635	protein-coding gene	gene with protein product						12838346	Standard	NM_183375		Approved	ESSPL	uc011cif.2	Q7RTY5	OTTHUMG00000161673	ENST00000455694.2:c.124_128dupCAGGT	4.37:g.152201019_152201023dupCAGGT	ENSP00000401328:p.Val43fs	Somatic	125	0		WXS	Illumina GAIIx	Phase_I	109	3	NM_183375	0	0	0	0	0	Q08E82|Q0VAD4	Frame_Shift_Ins	INS	ENST00000455694.2	37	CCDS47145.1																																																																																			.		0.530	PRSS48-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365685.3	NM_183375	
GAS8	2622	bcgsc.ca	37	16	90095596	90095597	+	Intron	DNP	AT	AT	GC	rs61118444|rs55742939|rs71137702	byFrequency	TCGA-OR-A5LR-01A-11D-A29I-10	TCGA-OR-A5LR-10A-01D-A29L-10	AT	AT	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a4944d75-a6da-45bb-b5b9-3fa3355b0ead	c2a8460f-138e-44eb-a933-a5cd6ca34d8b	g.chr16:90095596_90095597AT>GC	ENST00000268699.4	+	2	212				C16orf3_ENST00000408886.2_Missense_Mutation_p.I52A|GAS8_ENST00000540721.1_Intron|GAS8_ENST00000536122.1_Intron	NM_001481.2	NP_001472.1	O95995	GAS8_HUMAN	growth arrest-specific 8						cellular protein localization (GO:0034613)|negative regulation of cell proliferation (GO:0008285)|sperm motility (GO:0030317)	Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|motile cilium (GO:0031514)				endometrium(3)|large_intestine(2)|lung(6)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	14		all_cancers(9;4.44e-13)|Lung NSC(15;1.56e-06)|all_lung(18;2.18e-06)|all_neural(9;0.00118)|all_hematologic(23;0.0194)		BRCA - Breast invasive adenocarcinoma(80;0.029)		ggggcaggctatggggcagcct	0.663																																					p.I52A		.											.	C16orf3-90	0			c.A154G						.																																			SO:0001627	intron_variant	750	exon1			AGGCTATGGGGCA	AF050079	CCDS10992.1, CCDS67101.1, CCDS73932.1	16q24.3	2014-07-18	2003-01-16	2003-01-17	ENSG00000141013	ENSG00000141013			4166	protein-coding gene	gene with protein product		605178	"""growth arrest-specific 11"""	GAS11		9790751	Standard	NM_001481		Approved		uc002fqi.1	O95995	OTTHUMG00000138988	Exception_encountered	16.37:g.90095596_90095597delinsGC		Somatic	27	0		WXS	Illumina GAIIx	Phase_I	110	0	NM_001214	0	0	0	0	0	B2RCT1|B7Z4U1|G3V1L5|Q2M234	Missense_Mutation	DNP	ENST00000268699.4	37	CCDS10992.1																																																																																			T|0.361;C|0.639		0.663	GAS8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000272877.2		
