#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_TTotCov	i_TVarCov	i_Transcript_Id	i_Trna_alt1	i_Trna_alt2	i_Trna_ref	i_Trna_tot	i_Trna_var	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
SRRM1	10250	ucsc.edu	37	1	24978030	24978030	+	Missense_Mutation	SNP	G	G	A			TCGA-PA-A5YG-01A-11D-A29I-10	TCGA-PA-A5YG-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bc84db10-201a-4c8c-b43f-6a4557ecd98c	13f7f8b4-77e2-4100-b2fe-c35064ead1ea	g.chr1:24978030G>A	ENST00000323848.9	+	6	967	c.652G>A	c.(652-654)Gaa>Aaa	p.E218K	SRRM1_ENST00000537199.1_Missense_Mutation_p.E87K|SRRM1_ENST00000447431.2_Missense_Mutation_p.E218K|SRRM1_ENST00000479034.1_3'UTR|SRRM1_ENST00000374389.4_Missense_Mutation_p.E218K	NM_005839.3	NP_005830.2	Q8IYB3	SRRM1_HUMAN	serine/arginine repetitive matrix 1	218	Arg-rich.|Pro-rich.				gene expression (GO:0010467)|mRNA 3'-end processing (GO:0031124)|mRNA export from nucleus (GO:0006406)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|RNA splicing, via transesterification reactions (GO:0000375)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	catalytic step 2 spliceosome (GO:0071013)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)			breast(1)|central_nervous_system(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(12)|lung(9)|ovary(2)|prostate(1)|urinary_tract(2)	36		Colorectal(325;3.46e-05)|Renal(390;0.0007)|Lung NSC(340;0.000946)|all_lung(284;0.00125)|Ovarian(437;0.00764)|Breast(348;0.0148)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.19)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0422)|OV - Ovarian serous cystadenocarcinoma(117;1.01e-24)|Colorectal(126;5.95e-08)|COAD - Colon adenocarcinoma(152;3.24e-06)|GBM - Glioblastoma multiforme(114;0.000148)|BRCA - Breast invasive adenocarcinoma(304;0.00177)|KIRC - Kidney renal clear cell carcinoma(1967;0.00348)|STAD - Stomach adenocarcinoma(196;0.00483)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.138)		AGAAAAGAAGGAAAAAACTCC	0.448																																					p.E218K	Ovarian(68;897 1494 3282 17478)	.											.	SRRM1-93	0			c.G652A						.						46.0	54.0	51.0					1																	24978030		2203	4300	6503	SO:0001583	missense	10250	exon6			AAGAAGGAAAAAA	AF048977	CCDS255.1	1p36	2010-04-22			ENSG00000133226	ENSG00000133226			16638	protein-coding gene	gene with protein product	"""Ser/Arg-related nuclear matrix protein"", ""plenty of prolines 101-like"""	605975				9531537	Standard	NM_005839		Approved	SRM160, POP101, MGC39488	uc001bjm.3	Q8IYB3	OTTHUMG00000003320	ENST00000323848.9:c.652G>A	1.37:g.24978030G>A	ENSP00000326261:p.Glu218Lys	Somatic	94	1		WXS	Illumina GAIIx	Phase_I	97	1	NM_005839	0	0	9	9	0	O60585|Q5VVN4	Missense_Mutation	SNP	ENST00000323848.9	37	CCDS255.1	.	.	.	.	.	.	.	.	.	.	G	28.6	4.932311	0.92389	.	.	ENSG00000133226	ENST00000323848;ENST00000447431;ENST00000374389;ENST00000537199	T;T;T;T	0.47528	0.84;0.88;0.88;0.84	5.81	5.81	0.92471	.	0.000000	0.64402	D	0.000009	T	0.67277	0.2876	L	0.56769	1.78	0.80722	D	1	D;D	0.67145	0.996;0.993	D;D	0.73708	0.981;0.956	T	0.65529	-0.6146	10	0.52906	T	0.07	-4.0836	20.0684	0.97708	0.0:0.0:1.0:0.0	.	218;218	E9PCT1;Q8IYB3	.;SRRM1_HUMAN	K	218;218;218;87	ENSP00000326261:E218K;ENSP00000391430:E218K;ENSP00000363510:E218K;ENSP00000441776:E87K	ENSP00000326261:E218K	E	+	1	0	SRRM1	24850617	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.429000	0.66495	2.734000	0.93682	0.650000	0.86243	GAA	.		0.448	SRRM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000009292.2	NM_005839	
MAST2	23139	bcgsc.ca	37	1	46493460	46493460	+	Missense_Mutation	SNP	T	T	G	rs1707336	byFrequency	TCGA-PA-A5YG-01A-11D-A29I-10	TCGA-PA-A5YG-10A-01D-A29L-10	T	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bc84db10-201a-4c8c-b43f-6a4557ecd98c	13f7f8b4-77e2-4100-b2fe-c35064ead1ea	g.chr1:46493460T>G	ENST00000361297.2	+	17	2260	c.1977T>G	c.(1975-1977)atT>atG	p.I659M	MAST2_ENST00000372009.2_Missense_Mutation_p.I589M	NM_015112.2	NP_055927.2			microtubule associated serine/threonine kinase 2											breast(1)|lung(3)|ovary(5)|stomach(2)	11	Acute lymphoblastic leukemia(166;0.155)|Lung SC(450;0.184)					TGTCCAAAATTGGCCTCATGA	0.438													T|||	2430	0.485224	0.4259	0.4827	5008	,	,		21616	0.6607		0.4463	False		,,,				2504	0.4264				p.I659M		.											.	MAST2-581	0			c.T1977G						.	T	MET/ILE	1588,2230		341,906,662	116.0	112.0	113.0		1977	-0.6	1.0	1	dbSNP_89	113	3613,4673		806,2001,1336	yes	missense	MAST2	NM_015112.2	10	1147,2907,1998	GG,GT,TT		43.6037,41.5925,42.9693	benign	659/1799	46493460	5201,6903	1909	4143	6052	SO:0001583	missense	23139	exon17			CAAAATTGGCCTC	AB047005	CCDS41326.1	1p34.1	2008-02-05			ENSG00000086015	ENSG00000086015			19035	protein-coding gene	gene with protein product		612257					Standard	NM_015112		Approved	MAST205, KIAA0807	uc001cov.3	Q6P0Q8	OTTHUMG00000008007	ENST00000361297.2:c.1977T>G	1.37:g.46493460T>G	ENSP00000354671:p.Ile659Met	Somatic	197	0		WXS	Illumina GAIIx	Phase_I	217	6	NM_015112	0	0	10	10	0		Missense_Mutation	SNP	ENST00000361297.2	37	CCDS41326.1	1011	0.46291208791208793	196	0.3983739837398374	170	0.4696132596685083	343	0.5996503496503497	302	0.39841688654353563	T	12.25	1.881032	0.33255	0.415925	0.436037	ENSG00000086015	ENST00000361297;ENST00000372009;ENST00000432341;ENST00000372008	T;T;T	0.65364	-0.15;-0.15;-0.15	5.41	-0.618	0.11576	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.00012	0.0000	N	0.21545	0.675	0.20307	P	0.9999129408	D;B;D;B	0.89917	0.988;0.12;1.0;0.379	D;B;D;P	0.91635	0.977;0.068;0.999;0.45	T	0.39440	-0.9614	9	0.02654	T	1	-11.8172	5.7492	0.18138	0.1423:0.203:0.0:0.6546	rs1707336;rs17402588;rs17845481;rs17858361;rs61064119;rs1707336	589;333;589;659	Q6P0Q8-2;E7EWL1;E7ERL6;Q6P0Q8	.;.;.;MAST2_HUMAN	M	659;589;333;544	ENSP00000354671:I659M;ENSP00000361079:I589M;ENSP00000361078:I544M	ENSP00000354671:I659M	I	+	3	3	MAST2	46266047	0.264000	0.24093	1.000000	0.80357	0.937000	0.57800	-0.392000	0.07314	0.093000	0.17368	0.459000	0.35465	ATT	G|0.475;N|0.000		0.438	MAST2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000021977.1	NM_015112	
HIST2H3D	653604	broad.mit.edu	37	1	149784860	149784861	+	Frame_Shift_Del	DEL	TG	TG	-			TCGA-PA-A5YG-01A-11D-A29I-10	TCGA-PA-A5YG-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bc84db10-201a-4c8c-b43f-6a4557ecd98c	13f7f8b4-77e2-4100-b2fe-c35064ead1ea	g.chr1:149784860_149784861delTG	ENST00000331491.1	-	1	375_376	c.376_377delCA	c.(376-378)cagfs	p.Q126fs	HIST2H2BF_ENST00000545683.1_5'Flank|HIST2H2BF_ENST00000369167.1_5'Flank|HIST2H2BF_ENST00000427880.2_5'Flank|RP11-196G18.21_ENST00000420462.1_RNA|HIST2H2BF_ENST00000469483.1_5'Flank	NM_001123375.2	NP_001116847.1	Q71DI3	H32_HUMAN	histone cluster 2, H3d	126					blood coagulation (GO:0007596)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)	DNA binding (GO:0003677)			biliary_tract(1)|endometrium(1)|large_intestine(1)|liver(1)|lung(3)	7						GCGGGCCAACTGGATGTCCTTG	0.589																																					p.126_126del		.											.	HIST2H3D-22	0			c.376_377del						.																																			SO:0001589	frameshift_variant	653604	exon1			GCCAACTGGATGT	AL591493	CCDS41388.1	1q21.2	2012-03-08	2006-10-11		ENSG00000183598	ENSG00000183598		"""Histones / Replication-dependent"""	25311	protein-coding gene	gene with protein product			"""histone 2, H3d"""				Standard	NM_001123375		Approved		uc010pbl.2	Q71DI3	OTTHUMG00000012092	ENST00000331491.1:c.376_377delCA	1.37:g.149784860_149784861delTG	ENSP00000333277:p.Gln126fs	Somatic	315	0		WXS	Illumina GAIIx	Phase_I	611	11	NM_001123375	0	0	0	0	0	A2BDF6|A6NFS4|Q6B053	Frame_Shift_Del	DEL	ENST00000331491.1	37	CCDS41388.1																																																																																			.		0.589	HIST2H3D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033452.1	NM_001123375	
DENND4B	9909	hgsc.bcm.edu	37	1	153907287	153907287	+	Missense_Mutation	SNP	G	G	C	rs3835302|rs199597671		TCGA-PA-A5YG-01A-11D-A29I-10	TCGA-PA-A5YG-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bc84db10-201a-4c8c-b43f-6a4557ecd98c	13f7f8b4-77e2-4100-b2fe-c35064ead1ea	g.chr1:153907287G>C	ENST00000361217.4	-	18	3140	c.2722C>G	c.(2722-2724)Cag>Gag	p.Q908E	DENND4B_ENST00000474386.1_5'Flank	NM_014856.2	NP_055671.2	O75064	DEN4B_HUMAN	DENN/MADD domain containing 4B	908	Gln-rich.				positive regulation of Rab GTPase activity (GO:0032851)|regulation of Rab protein signal transduction (GO:0032483)	Golgi apparatus (GO:0005794)|nucleus (GO:0005634)	Rab guanyl-nucleotide exchange factor activity (GO:0017112)			NS(1)|breast(1)|cervix(1)|endometrium(7)|kidney(2)|large_intestine(6)|lung(9)|ovary(1)|prostate(5)|skin(2)|urinary_tract(1)	36	all_lung(78;2.89e-32)|Lung NSC(65;2.27e-30)|Hepatocellular(266;0.0877)|Melanoma(130;0.199)		LUSC - Lung squamous cell carcinoma(543;0.151)			tcctgctgctgctgctgctgc	0.632																																					p.Q908E		.											.	DENND4B-69	0			c.C2722G						.						23.0	27.0	26.0					1																	153907287		2184	4281	6465	SO:0001583	missense	9909	exon18			GCTGCTGCTGCTG	AB007945	CCDS44228.1	1q21.3	2012-10-03	2006-01-27	2006-01-27	ENSG00000198837	ENSG00000198837		"""DENN/MADD domain containing"""	29044	protein-coding gene	gene with protein product			"""KIAA0476"""	KIAA0476		9455484, 12906859	Standard	NM_014856		Approved		uc001fdd.1	O75064	OTTHUMG00000037157	ENST00000361217.4:c.2722C>G	1.37:g.153907287G>C	ENSP00000354597:p.Gln908Glu	Somatic	63	0		WXS	Illumina GAIIx	Phase_I	113	6	NM_014856	0	0	5	5	0	Q5T4K0	Missense_Mutation	SNP	ENST00000361217.4	37	CCDS44228.1	.	.	.	.	.	.	.	.	.	.	G	1.785	-0.481073	0.04383	.	.	ENSG00000198837	ENST00000361217;ENST00000368646	T;T	0.06294	3.33;3.32	2.67	0.673	0.17941	.	5.053470	0.00166	N	0.000001	T	0.00815	0.0027	N	0.14661	0.345	0.19300	N	0.999977	B	0.02656	0.0	B	0.04013	0.001	T	0.26573	-1.0099	10	0.02654	T	1	-2.4288	3.3651	0.07201	0.1454:0.0:0.5849:0.2697	.	908	O75064	DEN4B_HUMAN	E	908;919	ENSP00000354597:Q908E;ENSP00000357635:Q919E	ENSP00000354597:Q908E	Q	-	1	0	DENND4B	152173911	0.943000	0.32029	0.986000	0.45419	0.760000	0.43138	0.537000	0.23144	0.194000	0.20326	0.271000	0.19318	CAG	.		0.632	DENND4B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090278.2	XM_375806	
FRMD4A	55691	hgsc.bcm.edu	37	10	13699100	13699100	+	Nonsense_Mutation	SNP	G	G	T			TCGA-PA-A5YG-01A-11D-A29I-10	TCGA-PA-A5YG-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bc84db10-201a-4c8c-b43f-6a4557ecd98c	13f7f8b4-77e2-4100-b2fe-c35064ead1ea	g.chr10:13699100G>T	ENST00000357447.2	-	22	2857	c.2489C>A	c.(2488-2490)tCg>tAg	p.S830*	FRMD4A_ENST00000378503.1_Nonsense_Mutation_p.S830*|FRMD4A_ENST00000358621.4_Nonsense_Mutation_p.S815*	NM_018027.3	NP_060497.3	Q9P2Q2	FRM4A_HUMAN	FERM domain containing 4A	830					establishment of epithelial cell polarity (GO:0090162)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|tight junction (GO:0005923)				breast(4)|endometrium(9)|kidney(2)|large_intestine(11)|lung(9)|ovary(2)|pancreas(1)|prostate(2)|skin(1)	41						GCGGTACTGCGAGCTGGGCTG	0.736																																					p.S830X		.											.	FRMD4A-229	0			c.C2489A						.						15.0	14.0	14.0					10																	13699100		2199	4293	6492	SO:0001587	stop_gained	55691	exon22			TACTGCGAGCTGG	AB037715	CCDS7101.1	10p14	2004-07-15	2004-07-15	2004-07-15	ENSG00000151474	ENSG00000151474			25491	protein-coding gene	gene with protein product			"""FERM domain containing 4"""	FRMD4		10718198	Standard	NM_018027		Approved	FLJ10210, KIAA1294, bA295P9.4	uc001ims.3	Q9P2Q2	OTTHUMG00000017708	ENST00000357447.2:c.2489C>A	10.37:g.13699100G>T	ENSP00000350032:p.Ser830*	Somatic	5	0		WXS	Illumina GAIIx	Phase_I	28	20	NM_018027	0	0	0	0	0	A7E2Y3|Q5T377	Nonsense_Mutation	SNP	ENST00000357447.2	37	CCDS7101.1	.	.	.	.	.	.	.	.	.	.	G	41	8.619892	0.98888	.	.	ENSG00000151474	ENST00000358621;ENST00000357447;ENST00000378503	.	.	.	4.81	4.81	0.61882	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-9.6288	17.8751	0.88823	0.0:0.0:1.0:0.0	.	.	.	.	X	815;830;830	.	ENSP00000350032:S830X	S	-	2	0	FRMD4A	13739106	1.000000	0.71417	1.000000	0.80357	0.760000	0.43138	9.167000	0.94773	2.195000	0.70347	0.174000	0.16983	TCG	.		0.736	FRMD4A-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000046889.1	NM_018027	
STAM	8027	broad.mit.edu	37	10	17730077	17730077	+	Missense_Mutation	SNP	G	G	C	rs568999505		TCGA-PA-A5YG-01A-11D-A29I-10	TCGA-PA-A5YG-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bc84db10-201a-4c8c-b43f-6a4557ecd98c	13f7f8b4-77e2-4100-b2fe-c35064ead1ea	g.chr10:17730077G>C	ENST00000377524.3	+	5	564	c.349G>C	c.(349-351)Gat>Cat	p.D117H	STAM_ENST00000540523.1_Missense_Mutation_p.D6H	NM_003473.3	NP_003464.1	Q92783	STAM1_HUMAN	signal transducing adaptor molecule (SH3 domain and ITAM motif) 1	117	VHS. {ECO:0000255|PROSITE- ProRule:PRU00218}.				endosomal transport (GO:0016197)|epidermal growth factor receptor signaling pathway (GO:0007173)|intracellular protein transport (GO:0006886)|membrane organization (GO:0061024)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|positive regulation of signal transduction (GO:0009967)|signal transduction (GO:0007165)	cytosol (GO:0005829)|endosome (GO:0005768)|membrane (GO:0016020)	SH3/SH2 adaptor activity (GO:0005070)			breast(2)|endometrium(4)|kidney(2)|large_intestine(3)|lung(11)|ovary(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	26						TGAATGGACAGATGAATTTAA	0.353													G|||	1	0.000199681	0.0	0.0014	5008	,	,		16406	0.0		0.0	False		,,,				2504	0.0				p.D117H		.											.	STAM-154	0			c.G349C						.						128.0	131.0	130.0					10																	17730077		2203	4300	6503	SO:0001583	missense	8027	exon5			TGGACAGATGAAT	U43899	CCDS7122.1	10p14-p13	2009-04-29			ENSG00000136738	ENSG00000136738			11357	protein-coding gene	gene with protein product	"""HSE1 homolog (S. cerevisiae)"""	601899				8780729	Standard	NM_003473		Approved	STAM1	uc001ipj.2	Q92783	OTTHUMG00000017749	ENST00000377524.3:c.349G>C	10.37:g.17730077G>C	ENSP00000366746:p.Asp117His	Somatic	120	0		WXS	Illumina GAIIx	Phase_I	117	4	NM_003473	0	0	5	5	0	B0YJ99|D3DRU5|Q8N6D9	Missense_Mutation	SNP	ENST00000377524.3	37	CCDS7122.1	.	.	.	.	.	.	.	.	.	.	G	19.20	3.781683	0.70222	.	.	ENSG00000136738	ENST00000377524;ENST00000445846;ENST00000377500;ENST00000540523	T;T	0.23950	1.91;1.88	5.83	4.92	0.64577	VHS subgroup (1);ENTH/VHS (2);VHS (2);	0.140240	0.64402	D	0.000006	T	0.33731	0.0873	L	0.28054	0.825	0.80722	D	1	D	0.60575	0.988	P	0.58928	0.848	T	0.04203	-1.0969	10	0.59425	D	0.04	-28.5957	15.329	0.74190	0.0682:0.0:0.9318:0.0	.	117	Q92783	STAM1_HUMAN	H	117;67;20;6	ENSP00000366746:D117H;ENSP00000438073:D6H	ENSP00000366721:D20H	D	+	1	0	STAM	17770083	1.000000	0.71417	0.999000	0.59377	0.998000	0.95712	7.943000	0.87716	2.762000	0.94881	0.591000	0.81541	GAT	.		0.353	STAM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047039.1	NM_003473	
IDE	3416	broad.mit.edu	37	10	94268534	94268534	+	Silent	SNP	G	G	T	rs201815833		TCGA-PA-A5YG-01A-11D-A29I-10	TCGA-PA-A5YG-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bc84db10-201a-4c8c-b43f-6a4557ecd98c	13f7f8b4-77e2-4100-b2fe-c35064ead1ea	g.chr10:94268534G>T	ENST00000265986.6	-	7	1067	c.1011C>A	c.(1009-1011)ctC>ctA	p.L337L		NM_004969.3	NP_004960.2	P14735	IDE_HUMAN	insulin-degrading enzyme	337	Substrate binding exosite.				beta-amyloid metabolic process (GO:0050435)|bradykinin catabolic process (GO:0010815)|determination of adult lifespan (GO:0008340)|hormone catabolic process (GO:0042447)|insulin catabolic process (GO:1901143)|insulin metabolic process (GO:1901142)|insulin receptor signaling pathway (GO:0008286)|negative regulation of proteolysis (GO:0045861)|positive regulation of protein oligomerization (GO:0032461)|protein heterooligomerization (GO:0051291)|protein homooligomerization (GO:0051260)|protein homotetramerization (GO:0051289)|proteolysis (GO:0006508)|proteolysis involved in cellular protein catabolic process (GO:0051603)|ubiquitin homeostasis (GO:0010992)|viral process (GO:0016032)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|cytosolic proteasome complex (GO:0031597)|extracellular space (GO:0005615)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|peroxisomal matrix (GO:0005782)|peroxisome (GO:0005777)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|beta-amyloid binding (GO:0001540)|beta-endorphin binding (GO:0031626)|glycoprotein binding (GO:0001948)|insulin binding (GO:0043559)|metalloendopeptidase activity (GO:0004222)|peptide binding (GO:0042277)|protein homodimerization activity (GO:0042803)|receptor binding (GO:0005102)|ubiquitin binding (GO:0043130)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(10)|liver(1)|lung(10)|ovary(2)|urinary_tract(2)	33					"""""""Insulin(DB00071)|Bacitracin(DB00626)|Insulin Regular(DB00030)"""	CATGCCCAATGAGATGACCAA	0.408																																					p.L337L		.											.	IDE-92	0			c.C1011A						.						156.0	153.0	154.0					10																	94268534		2203	4300	6503	SO:0001819	synonymous_variant	3416	exon7			CCCAATGAGATGA	M21188	CCDS7421.1, CCDS53554.1	10q23-q25	2007-03-27			ENSG00000119912	ENSG00000119912			5381	protein-coding gene	gene with protein product	"""insulysin"""	146680				2293021	Standard	NM_004969		Approved		uc001kia.3	P14735	OTTHUMG00000018759	ENST00000265986.6:c.1011C>A	10.37:g.94268534G>T		Somatic	111	0		WXS	Illumina GAIIx	Phase_I	109	5	NM_004969	0	0	16	16	0	B2R721|B7ZAU2|D3DR35|Q5T5N2	Silent	SNP	ENST00000265986.6	37	CCDS7421.1																																																																																			.		0.408	IDE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049393.1	NM_004969	
ERLIN1	10613	bcgsc.ca	37	10	101912064	101912064	+	Missense_Mutation	SNP	T	T	C	rs2862954	byFrequency	TCGA-PA-A5YG-01A-11D-A29I-10	TCGA-PA-A5YG-10A-01D-A29L-10	T	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bc84db10-201a-4c8c-b43f-6a4557ecd98c	13f7f8b4-77e2-4100-b2fe-c35064ead1ea	g.chr10:101912064T>C	ENST00000421367.2	-	11	3578	c.871A>G	c.(871-873)Att>Gtt	p.I291V	ERLIN1_ENST00000407654.3_Missense_Mutation_p.I291V	NM_001100626.1|NM_006459.3	NP_001094096.1|NP_006450.2	O75477	ERLN1_HUMAN	ER lipid raft associated 1	289					ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|protein complex (GO:0043234)							Colorectal(252;0.234)		Epithelial(162;3.85e-10)|all cancers(201;3.25e-08)		TTAGAAGCAATGGCCTGGTAC	0.438													T|||	940	0.1877	0.0295	0.2997	5008	,	,		21899	0.0665		0.4811	False		,,,				2504	0.1452				p.I291V		.											.	.	0			c.A871G						.	T	VAL/ILE,VAL/ILE	460,3946	220.7+/-238.1	29,402,1772	112.0	110.0	111.0		871,871	4.4	1.0	10	dbSNP_101	111	4044,4556	558.7+/-387.3	949,2146,1205	yes	missense,missense	ERLIN1	NM_001100626.1,NM_006459.3	29,29	978,2548,2977	CC,CT,TT		47.0233,10.4403,34.6302	benign,benign	291/349,291/349	101912064	4504,8502	2203	4300	6503	SO:0001583	missense	10613	exon11			AAGCAATGGCCTG	AF064093	CCDS7487.2	10q24.31	2014-03-03	2007-01-26	2007-01-26	ENSG00000107566	ENSG00000107566			16947	protein-coding gene	gene with protein product	"""Band_7 23-211 Keo4 (Interim) similar to C.elegans protein C42C1.9"""	611604	"""chromosome 10 open reading frame 69"", ""SPFH domain family, member 1"""	C10orf69, SPFH1		11118313, 16835267, 24482476	Standard	NM_006459		Approved	KE04, Erlin-1, SPG62	uc001kqo.4	O75477	OTTHUMG00000018900	ENST00000421367.2:c.871A>G	10.37:g.101912064T>C	ENSP00000410964:p.Ile291Val	Somatic	150	1		WXS	Illumina GAIIx	Phase_I	180	6	NM_006459	0	0	24	24	0	B0QZ42|Q53HV0	Missense_Mutation	SNP	ENST00000421367.2	37	CCDS7487.2	540	0.24725274725274726	15	0.03048780487804878	135	0.3729281767955801	39	0.06818181818181818	351	0.4630606860158311	T	14.97	2.695080	0.48202	0.104403	0.470233	ENSG00000107566	ENST00000421367;ENST00000407654;ENST00000370410	T;T	0.66638	-0.22;-0.22	5.49	4.36	0.52297	.	0.175745	0.46442	U	0.000283	T	0.00012	0.0000	L	0.31157	0.91	0.09310	P	0.99999600384	B;B	0.13594	0.008;0.004	B;B	0.18263	0.021;0.015	T	0.41610	-0.9499	9	0.37606	T	0.19	-9.2173	9.7803	0.40645	0.0:0.0821:0.0:0.9179	rs2862954;rs17728805;rs59558087;rs2862954	289;291	O75477;D3DR65	ERLN1_HUMAN;.	V	291;291;207	ENSP00000410964:I291V;ENSP00000384900:I291V	ENSP00000359438:I207V	I	-	1	0	ERLIN1	101902054	1.000000	0.71417	1.000000	0.80357	0.973000	0.67179	5.751000	0.68720	1.037000	0.40024	0.459000	0.35465	ATT	A|0.005;C|0.270		0.438	ERLIN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049840.2	NM_006459	
MUC2	4583	broad.mit.edu	37	11	1093292	1093292	+	Missense_Mutation	SNP	C	C	T			TCGA-PA-A5YG-01A-11D-A29I-10	TCGA-PA-A5YG-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bc84db10-201a-4c8c-b43f-6a4557ecd98c	13f7f8b4-77e2-4100-b2fe-c35064ead1ea	g.chr11:1093292C>T	ENST00000441003.2	+	30	5138	c.5111C>T	c.(5110-5112)aCc>aTc	p.T1704I	MUC2_ENST00000359061.5_Missense_Mutation_p.T1671I|MUC2_ENST00000333592.6_5'Flank|MUC2_ENST00000361558.6_Intron	NM_002457.2	NP_002448.2	Q02817	MUC2_HUMAN	mucin 2, oligomeric mucus/gel-forming	0	Approximate repeats.				cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi lumen (GO:0005796)|inner mucus layer (GO:0070702)|outer mucus layer (GO:0070703)				NS(3)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(26)|haematopoietic_and_lymphoid_tissue(4)|kidney(11)|large_intestine(5)|lung(22)|ovary(2)|prostate(16)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	102		all_cancers(49;1.08e-07)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.191)		BRCA - Breast invasive adenocarcinoma(625;0.000207)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)	Pranlukast(DB01411)	atcaccaccaccactacggtg	0.637																																					p.T1704I		.											.	MUC2-90	0			c.C5111T						.						107.0	156.0	138.0					11																	1093292		1878	3453	5331	SO:0001583	missense	4583	exon30			CCACCACCACTAC	L21998		11p15.5	2011-01-28	2006-03-14		ENSG00000198788	ENSG00000198788		"""Mucins"""	7512	protein-coding gene	gene with protein product		158370	"""mucin 2, intestinal/tracheal"""			15081123	Standard	NM_002457		Approved		uc001lsx.1	Q02817	OTTHUMG00000156800	ENST00000441003.2:c.5111C>T	11.37:g.1093292C>T	ENSP00000415183:p.Thr1704Ile	Somatic	86	0		WXS	Illumina GAIIx	Phase_I	132	4	NM_002457	0	0	0	0	0	Q14878	Missense_Mutation	SNP	ENST00000441003.2	37		.	.	.	.	.	.	.	.	.	.	C	2.150	-0.394632	0.04899	.	.	ENSG00000198788	ENST00000441003;ENST00000359061	T;T	0.11063	2.81;2.84	1.6	-2.66	0.06077	.	2.760050	0.04005	U	0.297091	T	0.06416	0.0165	.	.	.	0.09310	N	1	B	0.09022	0.002	B	0.01281	0.0	T	0.36286	-0.9754	9	0.36615	T	0.2	.	2.477	0.04578	0.4942:0.3128:0.0:0.1931	.	1704	E7EUV1	.	I	1704;1671	ENSP00000415183:T1704I;ENSP00000351956:T1671I	ENSP00000351956:T1671I	T	+	2	0	MUC2	1083292	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	0.330000	0.19715	-0.514000	0.06488	0.184000	0.17185	ACC	.		0.637	MUC2-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000345894.2	NM_002457	
MUC5B	727897	hgsc.bcm.edu	37	11	1271221	1271221	+	Missense_Mutation	SNP	A	A	G	rs61430934|rs199629887	byFrequency	TCGA-PA-A5YG-01A-11D-A29I-10	TCGA-PA-A5YG-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bc84db10-201a-4c8c-b43f-6a4557ecd98c	13f7f8b4-77e2-4100-b2fe-c35064ead1ea	g.chr11:1271221A>G	ENST00000529681.1	+	31	13169	c.13111A>G	c.(13111-13113)Acc>Gcc	p.T4371A	RP11-532E4.2_ENST00000532061.2_RNA|MUC5B_ENST00000447027.1_Missense_Mutation_p.T4374A	NM_002458.2	NP_002449.2	Q9HC84	MUC5B_HUMAN	mucin 5B, oligomeric mucus/gel-forming	4371	23 X approximate tandem repeats, Ser/Thr- rich.|Thr-rich.				cellular protein metabolic process (GO:0044267)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to glucocorticoid stimulus (GO:0071385)|cellular response to retinoic acid (GO:0071300)|epithelial cell differentiation (GO:0030855)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|response to lipopolysaccharide (GO:0032496)|response to ozone (GO:0010193)|response to sulfur dioxide (GO:0010477)|response to vitamin A (GO:0033189)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)				cervix(2)|endometrium(36)|kidney(9)|lung(89)|urinary_tract(1)	137		all_cancers(49;6.97e-08)|all_epithelial(84;3.45e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00141)|Lung(200;0.0853)|LUSC - Lung squamous cell carcinoma(625;0.1)		CACGAAGGCCACCACGACAAG	0.637																																					p.T4371A		.											.	.	0			c.A13111G						.						100.0	111.0	107.0					11																	1271221		2126	4211	6337	SO:0001583	missense	727897	exon31			AAGGCCACCACGA	U95031, AF086604	CCDS44515.1, CCDS44515.2	11p15.5	2007-01-19	2006-03-14			ENSG00000117983		"""Mucins"""	7516	protein-coding gene	gene with protein product		600770	"""mucin 5, subtype B, tracheobronchial"""	MUC5		9804771	Standard	NM_002458		Approved	MG1	uc001lta.3	Q9HC84		ENST00000529681.1:c.13111A>G	11.37:g.1271221A>G	ENSP00000436812:p.Thr4371Ala	Somatic	462	0		WXS	Illumina GAIIx	Phase_I	549	23	NM_002458	0	0	0	0	0	O00447|O00573|O14985|O15494|O95291|O95451|Q14881|Q7M4S5|Q99552|Q9UE28	Missense_Mutation	SNP	ENST00000529681.1	37	CCDS44515.2	.	.	.	.	.	.	.	.	.	.	-	5.021	0.189632	0.09547	.	.	ENSG00000117983	ENST00000529681;ENST00000447027;ENST00000349637;ENST00000406844;ENST00000535652	T;T	0.19250	2.16;2.35	2.29	-4.58	0.03410	.	.	.	.	.	T	0.16896	0.0406	L	0.55481	1.735	0.09310	N	1	B;B	0.21309	0.054;0.054	B;B	0.21360	0.034;0.034	T	0.35525	-0.9785	9	0.87932	D	0	.	5.3519	0.16040	0.6731:0.1246:0.0:0.2023	.	4844;4374	A7Y9J9;E9PBJ0	.;.	A	4371;4374;4315;4221;150	ENSP00000436812:T4371A;ENSP00000415793:T4374A	ENSP00000343037:T4315A	T	+	1	0	MUC5B	1227797	0.000000	0.05858	0.000000	0.03702	0.005000	0.04900	-5.260000	0.00137	-1.046000	0.03246	0.155000	0.16302	ACC	.		0.637	MUC5B-002	NOVEL	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000390041.2	XM_001126093	
SYT8	90019	bcgsc.ca	37	11	1858262	1858262	+	Missense_Mutation	SNP	C	C	T	rs484955	byFrequency	TCGA-PA-A5YG-01A-11D-A29I-10	TCGA-PA-A5YG-10A-01D-A29L-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bc84db10-201a-4c8c-b43f-6a4557ecd98c	13f7f8b4-77e2-4100-b2fe-c35064ead1ea	g.chr11:1858262C>T	ENST00000381968.3	+	8	1036	c.908C>T	c.(907-909)aCg>aTg	p.T303M	SYT8_ENST00000535046.1_3'UTR|TNNI2_ENST00000381911.1_5'Flank|TNNI2_ENST00000252898.7_5'Flank|TNNI2_ENST00000381906.1_5'Flank|SYT8_ENST00000341958.3_Missense_Mutation_p.T289M	NM_138567.3	NP_612634	Q8NBV8	SYT8_HUMAN	synaptotagmin VIII	303	C2 2. {ECO:0000255|PROSITE- ProRule:PRU00041}.				acrosome reaction (GO:0007340)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|synaptic vesicle (GO:0008021)	transporter activity (GO:0005215)			breast(1)|large_intestine(1)|lung(2)|ovary(1)|skin(1)	6		all_epithelial(84;0.000138)|Breast(177;0.000962)|Ovarian(85;0.0014)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00136)|Lung(200;0.0681)|LUSC - Lung squamous cell carcinoma(625;0.082)		AAAAAGGGCACGGCGGCCCCC	0.622													C|||	929	0.185503	0.0507	0.2262	5008	,	,		18566	0.4137		0.1282	False		,,,				2504	0.1626				p.T303M		.											.	SYT8-91	0			c.C908T						.	C	MET/THR	270,4134	151.0+/-185.0	12,246,1944	97.0	112.0	107.0		908	2.3	0.1	11	dbSNP_83	107	1035,7563	219.7+/-257.6	60,915,3324	yes	missense	SYT8	NM_138567.3	81	72,1161,5268	TT,TC,CC		12.0377,6.1308,10.0369	probably-damaging	303/402	1858262	1305,11697	2202	4299	6501	SO:0001583	missense	90019	exon8			AGGGCACGGCGGC	AL137708	CCDS7726.2	11p15.5	2013-01-21			ENSG00000149043	ENSG00000149043		"""Synaptotagmins"""	19264	protein-coding gene	gene with protein product		607719				7791877	Standard	XM_005253216		Approved	DKFZp434K0322	uc001lue.1	Q8NBV8	OTTHUMG00000009026	ENST00000381968.3:c.908C>T	11.37:g.1858262C>T	ENSP00000371394:p.Thr303Met	Somatic	189	1		WXS	Illumina GAIIx	Phase_I	121	8	NM_138567	0	0	0	0	0	A6NFJ4|Q9NSV9	Missense_Mutation	SNP	ENST00000381968.3	37	CCDS7726.2	417	0.19093406593406592	22	0.044715447154471545	80	0.22099447513812154	220	0.38461538461538464	95	0.12532981530343007	c	13.83	2.354034	0.41700	0.061308	0.120377	ENSG00000149043	ENST00000381968;ENST00000341958	T;T	0.12039	2.72;2.72	3.28	2.34	0.29019	C2 membrane targeting protein (1);C2 calcium-dependent membrane targeting (2);C2 calcium/lipid-binding domain, CaLB (1);	.	.	.	.	T	0.00012	0.0000	H	0.94620	3.56	0.09310	P	1.0	D;D	0.89917	1.0;1.0	D;D	0.79784	0.993;0.993	T	0.29274	-1.0017	8	0.87932	D	0	.	10.6724	0.45766	0.0:0.9005:0.0:0.0995	rs484955;rs484955	303;289	Q8NBV8;A6NCR4	SYT8_HUMAN;.	M	303;289	ENSP00000371394:T303M;ENSP00000343691:T289M	ENSP00000343691:T289M	T	+	2	0	SYT8	1814838	0.689000	0.27690	0.051000	0.19133	0.176000	0.22953	2.807000	0.47955	0.720000	0.32209	0.436000	0.28706	ACG	C|0.863;T|0.137		0.622	SYT8-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000025013.4		
PGAP2	27315	broad.mit.edu	37	11	3845156	3845156	+	Missense_Mutation	SNP	A	A	G	rs533117826	byFrequency	TCGA-PA-A5YG-01A-11D-A29I-10	TCGA-PA-A5YG-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bc84db10-201a-4c8c-b43f-6a4557ecd98c	13f7f8b4-77e2-4100-b2fe-c35064ead1ea	g.chr11:3845156A>G	ENST00000463452.2	+	3	292	c.209A>G	c.(208-210)gAg>gGg	p.E70G	PGAP2_ENST00000300730.6_Missense_Mutation_p.E127G|PGAP2_ENST00000278243.4_Missense_Mutation_p.E131G|PGAP2_ENST00000396986.2_Missense_Mutation_p.E127G|PGAP2_ENST00000496834.2_5'UTR|PGAP2_ENST00000493547.2_Missense_Mutation_p.E70G|AC090587.2_ENST00000507938.1_RNA|PGAP2_ENST00000396991.2_Missense_Mutation_p.E131G|PGAP2_ENST00000532017.1_3'UTR|PGAP2_ENST00000396993.4_Silent_p.G23G|PGAP2_ENST00000479072.1_5'UTR|PGAP2_ENST00000465307.2_Silent_p.G73G	NM_001256240.1	NP_001243169.1	Q9UHJ9	PGAP2_HUMAN	post-GPI attachment to proteins 2	70					GPI anchor biosynthetic process (GO:0006506)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|negative regulation of intrinsic apoptotic signaling pathway in response to DNA damage (GO:1902230)|signal transduction in response to DNA damage (GO:0042770)	endoplasmic reticulum membrane (GO:0005789)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	protein transporter activity (GO:0008565)			NS(2)|endometrium(1)|kidney(1)|large_intestine(4)|lung(2)|urinary_tract(1)	11						ATCGGCGGGGAGGTGCCCCAG	0.642													A|||	26	0.00519169	0.0076	0.0014	5008	,	,		16736	0.003		0.003	False		,,,				2504	0.0092				p.E188G		.											.	PGAP2-90	0			c.A563G						.						69.0	70.0	70.0					11																	3845156		2201	4298	6499	SO:0001583	missense	27315	exon5			GCGGGGAGGTGCC	AF159615	CCDS7747.1, CCDS44523.1, CCDS58112.1, CCDS58113.1, CCDS73244.1, CCDS73245.1	11p15.4	2014-01-31			ENSG00000148985	ENSG00000148985			17893	protein-coding gene	gene with protein product	"""FGF receptor activating protein 1"", ""cell wall biogenesis 43 N-terminal homolog (S. cerevisiae)"""	615187	"""mental retardation, non-syndromic, autosomal recessive, 21"""	MRT21		10585768, 16407401, 23561846	Standard	NM_014489		Approved	FRAG1, CWH43-N	uc010qxw.3	Q9UHJ9	OTTHUMG00000012238	ENST00000463452.2:c.209A>G	11.37:g.3845156A>G	ENSP00000435223:p.Glu70Gly	Somatic	20	3		WXS	Illumina GAIIx	Phase_I	81	30	NM_001256236	0	0	10	10	0	E9PJG5|H7BXL9|Q6UC77|Q96G66|Q9UF01|Q9Y4N1	Missense_Mutation	SNP	ENST00000463452.2	37	CCDS58112.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	18.91|18.91	3.723931|3.723931	0.68959|0.68959	.|.	.|.	ENSG00000148985|ENSG00000148985	ENST00000396986;ENST00000300730;ENST00000396991;ENST00000464261;ENST00000493547;ENST00000278243;ENST00000463452;ENST00000469307|ENST00000459679;ENST00000464906	T;T;T;T;T;T;T;T|.	0.44482|.	0.92;0.92;0.92;0.92;0.92;0.92;0.92;0.92|.	5.86|5.86	5.86|5.86	0.93980|0.93980	.|.	0.000000|.	0.64402|.	D|.	0.000006|.	T|T	0.64994|0.64994	0.2649|0.2649	L|L	0.60455|0.60455	1.87|1.87	0.40366|0.40366	D|D	0.97929|0.97929	D;P;P;D;P|.	0.76494|.	0.973;0.865;0.942;0.999;0.865|.	P;B;P;D;B|.	0.87578|.	0.783;0.343;0.783;0.998;0.343|.	T|T	0.65236|0.65236	-0.6217|-0.6217	10|5	0.26408|.	T|.	0.33|.	-17.084|-17.084	12.6354|12.6354	0.56681|0.56681	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	127;70;131;70;70|.	A8MYS5;Q9UHJ9-3;Q9UHJ9;E9PJG5;Q9UHJ9-2|.	.;.;PGAP2_HUMAN;.;.|.	G|G	127;127;131;100;70;131;70;70|101;161	ENSP00000380183:E127G;ENSP00000300730:E127G;ENSP00000380188:E131G;ENSP00000434088:E100G;ENSP00000431851:E70G;ENSP00000278243:E131G;ENSP00000435223:E70G;ENSP00000434507:E70G|.	ENSP00000278243:E131G|.	E|R	+|+	2|1	0|2	PGAP2|PGAP2	3801732|3801732	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.997000|0.997000	0.91878|0.91878	4.258000|4.258000	0.58822|0.58822	2.232000|2.232000	0.73038|0.73038	0.533000|0.533000	0.62120|0.62120	GAG|AGG	.		0.642	PGAP2-049	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000383260.1		
PTPRJ	5795	bcgsc.ca	37	11	48166267	48166267	+	Missense_Mutation	SNP	G	G	C	rs4752904	byFrequency	TCGA-PA-A5YG-01A-11D-A29I-10	TCGA-PA-A5YG-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bc84db10-201a-4c8c-b43f-6a4557ecd98c	13f7f8b4-77e2-4100-b2fe-c35064ead1ea	g.chr11:48166267G>C	ENST00000418331.2	+	13	2968	c.2616G>C	c.(2614-2616)gaG>gaC	p.E872D		NM_002843.3	NP_002834.3	Q12913	PTPRJ_HUMAN	protein tyrosine phosphatase, receptor type, J	872	Fibronectin type-III 9. {ECO:0000255|PROSITE-ProRule:PRU00316}.		E -> D (in dbSNP:rs4752904). {ECO:0000269|PubMed:12089527, ECO:0000269|PubMed:15378013, ECO:0000269|PubMed:7937872, ECO:0000269|PubMed:7994032}.		contact inhibition (GO:0060242)|heart development (GO:0007507)|negative regulation of cell growth (GO:0030308)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of platelet-derived growth factor receptor signaling pathway (GO:0010642)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of T cell receptor signaling pathway (GO:0050860)|negative regulation of vascular permeability (GO:0043116)|oligodendrocyte differentiation (GO:0048709)|peptidyl-tyrosine dephosphorylation (GO:0035335)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive chemotaxis (GO:0050918)|positive regulation of cell adhesion (GO:0045785)|positive regulation of focal adhesion assembly (GO:0051894)|positive regulation of protein kinase B signaling (GO:0051897)|regulation of cell adhesion (GO:0030155)|vasculogenesis (GO:0001570)	cell projection (GO:0042995)|cell surface (GO:0009986)|cell-cell junction (GO:0005911)|extracellular vesicular exosome (GO:0070062)|immunological synapse (GO:0001772)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	beta-catenin binding (GO:0008013)|delta-catenin binding (GO:0070097)|gamma-catenin binding (GO:0045295)|mitogen-activated protein kinase binding (GO:0051019)|phosphatase activity (GO:0016791)|platelet-derived growth factor receptor binding (GO:0005161)|protein kinase binding (GO:0019901)|protein tyrosine phosphatase activity (GO:0004725)			breast(3)|endometrium(7)|kidney(7)|large_intestine(5)|lung(15)|ovary(1)|prostate(2)|skin(6)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	52						ACACGTATGAGGATTTCAAAA	0.403													G|||	1839	0.367212	0.056	0.5908	5008	,	,		23017	0.3839		0.5835	False		,,,				2504	0.3896				p.E872D		.											.	PTPRJ-541	0			c.G2616C	GRCh37	CM043073	PTPRJ	M	rs4752904	.	G	ASP/GLU	654,3748	277.5+/-273.7	49,556,1596	99.0	94.0	96.0		2616	-10.9	0.0	11	dbSNP_111	96	4952,3644	625.0+/-397.7	1407,2138,753	yes	missense	PTPRJ	NM_002843.3	45	1456,2694,2349	CC,CG,GG		42.3918,14.8569,43.1297	possibly-damaging	872/1338	48166267	5606,7392	2201	4298	6499	SO:0001583	missense	5795	exon13			GTATGAGGATTTC	U10886	CCDS7945.1, CCDS44596.1	11p11.2	2013-02-11			ENSG00000149177	ENSG00000149177		"""CD molecules"", ""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Fibronectin type III domain containing"""	9673	protein-coding gene	gene with protein product		600925				7937872, 7994032	Standard	NM_001098503		Approved	DEP1, HPTPeta, CD148	uc001ngp.4	Q12913	OTTHUMG00000166573	ENST00000418331.2:c.2616G>C	11.37:g.48166267G>C	ENSP00000400010:p.Glu872Asp	Somatic	133	1		WXS	Illumina GAIIx	Phase_I	112	5	NM_002843	0	0	0	0	0	Q15255|Q6P4H4|Q8NHM2|Q9UDA9	Missense_Mutation	SNP	ENST00000418331.2	37	CCDS7945.1	955	0.43727106227106227	39	0.07926829268292683	214	0.5911602209944752	252	0.4405594405594406	450	0.5936675461741425	G	4.648	0.120524	0.08881	0.148569	0.576082	ENSG00000149177	ENST00000418331	T	0.13657	2.57	5.45	-10.9	0.00192	Fibronectin, type III (2);	.	.	.	.	T	0.00012	0.0000	N	0.17082	0.46	0.21184	P	0.999766262	B	0.13145	0.007	B	0.11329	0.006	T	0.47535	-0.9110	8	0.02654	T	1	.	1.7439	0.02958	0.2538:0.0802:0.3284:0.3375	rs4752904;rs17789721;rs52831595;rs56898824;rs4752904	872	Q12913	PTPRJ_HUMAN	D	872	ENSP00000400010:E872D	ENSP00000400010:E872D	E	+	3	2	PTPRJ	48122843	0.000000	0.05858	0.000000	0.03702	0.071000	0.16799	-4.356000	0.00247	-2.555000	0.00477	-0.911000	0.02809	GAG	G|0.569;C|0.431		0.403	PTPRJ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390525.1		
ATN1	1822	hgsc.bcm.edu;ucsc.edu	37	12	7045900	7045900	+	Silent	SNP	G	G	A	rs377147612|rs60216939		TCGA-PA-A5YG-01A-11D-A29I-10	TCGA-PA-A5YG-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bc84db10-201a-4c8c-b43f-6a4557ecd98c	13f7f8b4-77e2-4100-b2fe-c35064ead1ea	g.chr12:7045900G>A	ENST00000356654.4	+	5	1707	c.1470G>A	c.(1468-1470)caG>caA	p.Q490Q	ATN1_ENST00000396684.2_Silent_p.Q490Q	NM_001007026.1	NP_001007027.1	P54259	ATN1_HUMAN	atrophin 1	490	Poly-Gln.				cell migration (GO:0016477)|central nervous system development (GO:0007417)|maintenance of cell polarity (GO:0030011)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuron apoptotic process (GO:0051402)|toxin metabolic process (GO:0009404)|transcription, DNA-templated (GO:0006351)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|nuclear matrix (GO:0016363)|nucleus (GO:0005634)	protein domain specific binding (GO:0019904)|transcription corepressor activity (GO:0003714)			breast(5)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(15)|ovary(2)|pancreas(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(2)	40						aacagcagcagcagcagcagc	0.642																																					p.Q490Q		.											.	ATN1-139	0			c.G1470A						.						50.0	62.0	58.0					12																	7045900		2202	4291	6493	SO:0001819	synonymous_variant	1822	exon5			GCAGCAGCAGCAG	U23851	CCDS31734.1	12p	2007-08-01	2005-03-15	2005-03-17		ENSG00000111676			3033	protein-coding gene	gene with protein product		607462	"""dentatorubral-pallidoluysian atrophy (atrophin-1)"""	D12S755E, DRPLA		8136826	Standard	NM_001940		Approved	B37	uc001qrw.1	P54259		ENST00000356654.4:c.1470G>A	12.37:g.7045900G>A		Somatic	118	0		WXS	Illumina GAIIx	Phase_I	209	18	NM_001007026	0	0	247	252	5	Q99495|Q99621|Q9UEK7	Silent	SNP	ENST00000356654.4	37	CCDS31734.1																																																																																			G|0.985;A|0.015		0.642	ATN1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401948.2	NM_001940	
ATN1	1822	ucsc.edu	37	12	7045906	7045906	+	Silent	SNP	G	G	A	rs377147612		TCGA-PA-A5YG-01A-11D-A29I-10	TCGA-PA-A5YG-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bc84db10-201a-4c8c-b43f-6a4557ecd98c	13f7f8b4-77e2-4100-b2fe-c35064ead1ea	g.chr12:7045906G>A	ENST00000356654.4	+	5	1713	c.1476G>A	c.(1474-1476)caG>caA	p.Q492Q	ATN1_ENST00000396684.2_Silent_p.Q492Q	NM_001007026.1	NP_001007027.1	P54259	ATN1_HUMAN	atrophin 1	492	Poly-Gln.				cell migration (GO:0016477)|central nervous system development (GO:0007417)|maintenance of cell polarity (GO:0030011)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuron apoptotic process (GO:0051402)|toxin metabolic process (GO:0009404)|transcription, DNA-templated (GO:0006351)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|nuclear matrix (GO:0016363)|nucleus (GO:0005634)	protein domain specific binding (GO:0019904)|transcription corepressor activity (GO:0003714)			breast(5)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(15)|ovary(2)|pancreas(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(2)	40						agcagcagcagcagcagcagc	0.647																																					p.Q492Q		.											.	ATN1-139	0			c.G1476A						.						43.0	53.0	49.0					12																	7045906		2188	4263	6451	SO:0001819	synonymous_variant	1822	exon5			GCAGCAGCAGCAG	U23851	CCDS31734.1	12p	2007-08-01	2005-03-15	2005-03-17		ENSG00000111676			3033	protein-coding gene	gene with protein product		607462	"""dentatorubral-pallidoluysian atrophy (atrophin-1)"""	D12S755E, DRPLA		8136826	Standard	NM_001940		Approved	B37	uc001qrw.1	P54259		ENST00000356654.4:c.1476G>A	12.37:g.7045906G>A		Somatic	98	0		WXS	Illumina GAIIx	Phase_I	195	27	NM_001007026	0	0	361	364	3	Q99495|Q99621|Q9UEK7	Silent	SNP	ENST00000356654.4	37	CCDS31734.1																																																																																			.		0.647	ATN1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401948.2	NM_001940	
ATN1	1822	hgsc.bcm.edu	37	12	7045924	7045924	+	Missense_Mutation	SNP	G	G	T	rs199988271		TCGA-PA-A5YG-01A-11D-A29I-10	TCGA-PA-A5YG-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bc84db10-201a-4c8c-b43f-6a4557ecd98c	13f7f8b4-77e2-4100-b2fe-c35064ead1ea	g.chr12:7045924G>T	ENST00000356654.4	+	5	1731	c.1494G>T	c.(1492-1494)caG>caT	p.Q498H	ATN1_ENST00000396684.2_Missense_Mutation_p.Q498H	NM_001007026.1	NP_001007027.1	P54259	ATN1_HUMAN	atrophin 1	498	Poly-Gln.				cell migration (GO:0016477)|central nervous system development (GO:0007417)|maintenance of cell polarity (GO:0030011)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuron apoptotic process (GO:0051402)|toxin metabolic process (GO:0009404)|transcription, DNA-templated (GO:0006351)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|nuclear matrix (GO:0016363)|nucleus (GO:0005634)	protein domain specific binding (GO:0019904)|transcription corepressor activity (GO:0003714)			breast(5)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(15)|ovary(2)|pancreas(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(2)	40						agcagcagcagcagcagcagc	0.637																																					p.Q498H		.											.	ATN1-139	0			c.G1494T						.						43.0	53.0	49.0					12																	7045924		2201	4297	6498	SO:0001583	missense	1822	exon5			GCAGCAGCAGCAG	U23851	CCDS31734.1	12p	2007-08-01	2005-03-15	2005-03-17		ENSG00000111676			3033	protein-coding gene	gene with protein product		607462	"""dentatorubral-pallidoluysian atrophy (atrophin-1)"""	D12S755E, DRPLA		8136826	Standard	NM_001940		Approved	B37	uc001qrw.1	P54259		ENST00000356654.4:c.1494G>T	12.37:g.7045924G>T	ENSP00000349076:p.Gln498His	Somatic	81	0		WXS	Illumina GAIIx	Phase_I	194	20	NM_001007026	0	0	344	344	0	Q99495|Q99621|Q9UEK7	Missense_Mutation	SNP	ENST00000356654.4	37	CCDS31734.1	.	.	.	.	.	.	.	.	.	.	g	0.004	-2.273578	0.00257	.	.	ENSG00000111676	ENST00000356654;ENST00000396684;ENST00000544325;ENST00000229279	T;T;T	0.56776	0.44;0.44;0.44	1.44	-2.88	0.05682	.	.	.	.	.	T	0.24392	0.0591	N	0.22421	0.69	0.09310	N	1	P	0.40970	0.734	B	0.30401	0.115	T	0.19353	-1.0308	9	0.17832	T	0.49	.	3.3676	0.07208	0.2981:0.2446:0.4573:0.0	.	498	P54259	ATN1_HUMAN	H	498;498;498;83	ENSP00000349076:Q498H;ENSP00000379915:Q498H;ENSP00000441744:Q498H	ENSP00000229279:Q83H	Q	+	3	2	ATN1	6916185	0.175000	0.23083	0.269000	0.24586	0.334000	0.28698	-0.489000	0.06490	-0.760000	0.04677	0.109000	0.15622	CAG	G|0.999;A|0.001		0.637	ATN1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401948.2	NM_001940	
TAS2R46	259292	hgsc.bcm.edu	37	12	11214495	11214510	+	Frame_Shift_Del	DEL	TAGTATCACCAGAACA	TAGTATCACCAGAACA	-	rs537338046|rs200321584	byFrequency	TCGA-PA-A5YG-01A-11D-A29I-10	TCGA-PA-A5YG-10A-01D-A29L-10	TAGTATCACCAGAACA	TAGTATCACCAGAACA	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bc84db10-201a-4c8c-b43f-6a4557ecd98c	13f7f8b4-77e2-4100-b2fe-c35064ead1ea	g.chr12:11214495_11214510delTAGTATCACCAGAACA	ENST00000533467.1	-	1	383_398	c.384_399delTGTTCTGGTGATACTA	c.(382-399)gttgttctggtgatactafs	p.VVLVIL128fs	TAS2R14_ENST00000381852.4_Intron|PRR4_ENST00000536668.1_Intron	NM_176887.2	NP_795368.2	P59540	T2R46_HUMAN	taste receptor, type 2, member 46	128					detection of chemical stimulus involved in sensory perception of bitter taste (GO:0001580)	cilium (GO:0005929)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	bitter taste receptor activity (GO:0033038)			endometrium(1)|kidney(1)|large_intestine(2)|lung(3)|ovary(1)|prostate(3)|upper_aerodigestive_tract(1)	12			OV - Ovarian serous cystadenocarcinoma(49;0.0344)	BRCA - Breast invasive adenocarcinoma(232;0.196)		AAGGCCCCAATAGTATCACCAGAACAACACTCTTAA	0.356																																					p.128_133del		.											.	TAS2R46-1	0			c.384_399del						.																																			SO:0001589	frameshift_variant	259292	exon1			CCCCAATAGTATC	AF494227	CCDS53748.1	12p13.2	2012-08-22				ENSG00000226761		"""Taste receptors / Type 2"", ""GPCR / Unclassified : Taste receptors"""	18877	protein-coding gene	gene with protein product		612774				12379855	Standard	NM_176887		Approved	T2R54	uc001qzp.1	P59540		ENST00000533467.1:c.384_399delTGTTCTGGTGATACTA	12.37:g.11214495_11214510delTAGTATCACCAGAACA	ENSP00000436450:p.Val128fs	Somatic	125	0		WXS	Illumina GAIIx	Phase_I	231	0	NM_176887	0	0	0	0	0	P59548|Q645X6	Frame_Shift_Del	DEL	ENST00000533467.1	37	CCDS53748.1																																																																																			.		0.356	TAS2R46-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383559.1	NM_176887	
TUBA1C	84790	ucsc.edu	37	12	49666152	49666152	+	Silent	SNP	G	G	A	rs199599214	byFrequency	TCGA-PA-A5YG-01A-11D-A29I-10	TCGA-PA-A5YG-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bc84db10-201a-4c8c-b43f-6a4557ecd98c	13f7f8b4-77e2-4100-b2fe-c35064ead1ea	g.chr12:49666152G>A	ENST00000301072.6	+	4	767	c.492G>A	c.(490-492)aaG>aaA	p.K164K	TUBA1C_ENST00000541364.1_Silent_p.K234K|RP11-161H23.5_ENST00000550468.2_RNA	NM_032704.3	NP_116093.1	Q9BQE3	TBA1C_HUMAN	tubulin, alpha 1c	164					'de novo' posttranslational protein folding (GO:0051084)|cell division (GO:0051301)|cellular protein metabolic process (GO:0044267)|cytoskeleton-dependent intracellular transport (GO:0030705)|microtubule-based process (GO:0007017)|protein folding (GO:0006457)|protein polymerization (GO:0051258)	cytoplasmic microtubule (GO:0005881)|microtubule (GO:0005874)|nucleus (GO:0005634)|vesicle (GO:0031982)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)	p.K164K(1)		endometrium(1)|large_intestine(3)|liver(1)|lung(7)|skin(1)	13						ATGGCAAGAAGTCCAAGCTGG	0.547																																					p.K164K		.											.	TUBA1C-90	1	Substitution - coding silent(1)	large_intestine(1)	c.G492A						.						56.0	58.0	57.0					12																	49666152		2203	4300	6503	SO:0001819	synonymous_variant	84790	exon4			CAAGAAGTCCAAG	BC004949	CCDS8782.1	12q13.12	2007-03-16	2007-02-12	2007-02-12		ENSG00000167553		"""Tubulins"""	20768	protein-coding gene	gene with protein product			"""tubulin, alpha 6"""	TUBA6		7821789	Standard	NM_032704		Approved	MGC14580, MGC10851, bcm948	uc001rtt.1	Q9BQE3		ENST00000301072.6:c.492G>A	12.37:g.49666152G>A		Somatic	252	37		WXS	Illumina GAIIx	Phase_I	373	38	NM_032704	0	0	386	1150	764		Silent	SNP	ENST00000301072.6	37	CCDS8782.1																																																																																			G|0.998;A|0.002		0.547	TUBA1C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404424.1	NM_032704	
FAM186A	121006	broad.mit.edu	37	12	50744753	50744753	+	Silent	SNP	T	T	C	rs10506292	byFrequency	TCGA-PA-A5YG-01A-11D-A29I-10	TCGA-PA-A5YG-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bc84db10-201a-4c8c-b43f-6a4557ecd98c	13f7f8b4-77e2-4100-b2fe-c35064ead1ea	g.chr12:50744753T>C	ENST00000327337.5	-	4	5861	c.5862A>G	c.(5860-5862)aaA>aaG	p.K1954K	FAM186A_ENST00000543096.1_5'Flank|FAM186A_ENST00000543111.1_Silent_p.K1954K	NM_001145475.1	NP_001138947.1	A6NE01	F186A_HUMAN	family with sequence similarity 186, member A	1954								p.K1954K(1)									TTGCCAATCTTTTCTTAGCAA	0.458													T|||	3031	0.605232	0.4985	0.732	5008	,	,		17768	0.7431		0.659	False		,,,				2504	0.4622				p.K1954K	NSCLC(138;1796 1887 12511 19463 37884)	.											.	FAM186A-68	1	Substitution - coding silent(1)	stomach(1)	c.A5862G						.						30.0	29.0	29.0					12																	50744753		692	1591	2283	SO:0001819	synonymous_variant	121006	exon4			CAATCTTTTCTTA		CCDS44878.1	12q13.13	2009-04-22			ENSG00000185958	ENSG00000185958			26980	protein-coding gene	gene with protein product							Standard	NM_001145475		Approved	LOC121006	uc001rwl.2	A6NE01	OTTHUMG00000167889	ENST00000327337.5:c.5862A>G	12.37:g.50744753T>C		Somatic	69	0		WXS	Illumina GAIIx	Phase_I	116	4	NM_001145475	0	0	0	0	0		Silent	SNP	ENST00000327337.5	37	CCDS44878.1																																																																																			T|0.350;C|0.650		0.458	FAM186A-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000396838.1	XM_001718353	
DIP2B	57609	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	51072495	51072495	+	Missense_Mutation	SNP	A	A	G			TCGA-PA-A5YG-01A-11D-A29I-10	TCGA-PA-A5YG-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bc84db10-201a-4c8c-b43f-6a4557ecd98c	13f7f8b4-77e2-4100-b2fe-c35064ead1ea	g.chr12:51072495A>G	ENST00000301180.5	+	8	984	c.950A>G	c.(949-951)gAg>gGg	p.E317G		NM_173602.2	NP_775873.2	Q9P265	DIP2B_HUMAN	DIP2 disco-interacting protein 2 homolog B (Drosophila)	317						cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)	catalytic activity (GO:0003824)			breast(1)|central_nervous_system(1)|endometrium(7)|kidney(4)|large_intestine(15)|lung(18)|ovary(4)|pancreas(1)|prostate(1)|skin(6)|urinary_tract(2)	60						CCCAAGCCGGAGGGACGGCAG	0.517																																					p.E317G		.											.	DIP2B-95	0			c.A950G						.						76.0	72.0	73.0					12																	51072495		2203	4300	6503	SO:0001583	missense	57609	exon8			AGCCGGAGGGACG	AB040896	CCDS31799.1	12q13.12	2012-10-02	2006-01-13		ENSG00000066084	ENSG00000066084			29284	protein-coding gene	gene with protein product		611379					Standard	XM_005269044		Approved	KIAA1463, FLJ34278	uc001rwv.3	Q9P265	OTTHUMG00000169475	ENST00000301180.5:c.950A>G	12.37:g.51072495A>G	ENSP00000301180:p.Glu317Gly	Somatic	136	0		WXS	Illumina GAIIx	Phase_I	240	25	NM_173602	0	0	10	12	2	Q6B011|Q8N1L5|Q8NB38	Missense_Mutation	SNP	ENST00000301180.5	37	CCDS31799.1	.	.	.	.	.	.	.	.	.	.	A	26.8	4.770898	0.90108	.	.	ENSG00000066084	ENST00000455310;ENST00000301180	T	0.39406	1.08	4.73	4.73	0.59995	.	0.000000	0.85682	D	0.000000	T	0.66117	0.2757	M	0.80616	2.505	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.997	T	0.72007	-0.4420	10	0.87932	D	0	-19.5995	14.6888	0.69068	1.0:0.0:0.0:0.0	.	317;327	Q9P265;E9PHD6	DIP2B_HUMAN;.	G	327;317	ENSP00000301180:E317G	ENSP00000301180:E317G	E	+	2	0	DIP2B	49358762	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	9.087000	0.94110	2.117000	0.64856	0.383000	0.25322	GAG	.		0.517	DIP2B-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404243.1	NM_173602	
WSCD2	9671	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	108589790	108589790	+	Missense_Mutation	SNP	G	G	T			TCGA-PA-A5YG-01A-11D-A29I-10	TCGA-PA-A5YG-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bc84db10-201a-4c8c-b43f-6a4557ecd98c	13f7f8b4-77e2-4100-b2fe-c35064ead1ea	g.chr12:108589790G>T	ENST00000332082.4	+	3	999	c.181G>T	c.(181-183)Ggt>Tgt	p.G61C	WSCD2_ENST00000549903.1_Missense_Mutation_p.G61C|WSCD2_ENST00000261400.3_Missense_Mutation_p.G61C|WSCD2_ENST00000547525.1_Missense_Mutation_p.G61C			Q2TBF2	WSCD2_HUMAN	WSC domain containing 2	61						integral component of membrane (GO:0016021)				breast(4)|endometrium(3)|kidney(1)|large_intestine(16)|liver(2)|lung(23)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)	57						CCCAGCTGAGGGTGCTGAGCT	0.617																																					p.G61C		.											.	WSCD2-136	0			c.G181T						.						126.0	130.0	129.0					12																	108589790		2065	4204	6269	SO:0001583	missense	9671	exon2			GCTGAGGGTGCTG		CCDS41828.1	12q23.3	2008-02-05				ENSG00000075035			29117	protein-coding gene	gene with protein product							Standard	NM_014653		Approved	KIAA0789	uc001tms.3	Q2TBF2		ENST00000332082.4:c.181G>T	12.37:g.108589790G>T	ENSP00000331933:p.Gly61Cys	Somatic	173	1		WXS	Illumina GAIIx	Phase_I	339	74	NM_014653	0	0	1	1	0	B2RN48|B4DES1|Q8IY35|Q9Y4B7	Missense_Mutation	SNP	ENST00000332082.4	37	CCDS41828.1	.	.	.	.	.	.	.	.	.	.	G	13.53	2.264650	0.40095	.	.	ENSG00000075035	ENST00000547525;ENST00000261400;ENST00000332082;ENST00000549903	T;T;T;T	0.32753	1.45;1.44;1.45;1.44	5.74	5.74	0.90152	.	0.049620	0.85682	D	0.000000	T	0.42154	0.1190	M	0.62723	1.935	0.32805	D	0.500642	D	0.58620	0.983	P	0.47206	0.541	T	0.56733	-0.7930	10	0.72032	D	0.01	-15.4019	18.8897	0.92395	0.0:0.0:1.0:0.0	.	61	Q2TBF2	WSCD2_HUMAN	C	61	ENSP00000448047:G61C;ENSP00000261400:G61C;ENSP00000331933:G61C;ENSP00000447272:G61C	ENSP00000261400:G61C	G	+	1	0	WSCD2	107113920	1.000000	0.71417	0.269000	0.24586	0.002000	0.02628	5.354000	0.66040	2.704000	0.92352	0.655000	0.94253	GGT	.		0.617	WSCD2-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405554.1	NM_014653	
TAOK3	51347	broad.mit.edu	37	12	118610311	118610311	+	Missense_Mutation	SNP	C	C	T			TCGA-PA-A5YG-01A-11D-A29I-10	TCGA-PA-A5YG-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bc84db10-201a-4c8c-b43f-6a4557ecd98c	13f7f8b4-77e2-4100-b2fe-c35064ead1ea	g.chr12:118610311C>T	ENST00000392533.3	-	17	2340	c.1850G>A	c.(1849-1851)cGg>cAg	p.R617Q	TAOK3_ENST00000537952.1_Missense_Mutation_p.R157Q|TAOK3_ENST00000419821.2_Missense_Mutation_p.R617Q	NM_016281.3	NP_057365.3	Q9H2K8	TAOK3_HUMAN	TAO kinase 3	617					cellular response to DNA damage stimulus (GO:0006974)|DNA repair (GO:0006281)|MAPK cascade (GO:0000165)|mitotic G2 DNA damage checkpoint (GO:0007095)|negative regulation of JNK cascade (GO:0046329)|negative regulation of protein kinase activity (GO:0006469)|positive regulation of JNK cascade (GO:0046330)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of stress-activated MAPK cascade (GO:0032874)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|protein kinase inhibitor activity (GO:0004860)|protein serine/threonine kinase activity (GO:0004674)|transferase activity (GO:0016740)			central_nervous_system(1)|lung(5)|skin(1)	7	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)					CATTATTTTCCGCTTGAAGAA	0.433																																					p.R617Q		.											.	TAOK3-933	0			c.G1850A						.						268.0	230.0	243.0					12																	118610311		2203	4300	6503	SO:0001583	missense	51347	exon17			ATTTTCCGCTTGA	AF135158	CCDS9188.1	12q	2007-08-03				ENSG00000135090			18133	protein-coding gene	gene with protein product						10559204, 10924369	Standard	NM_016281		Approved	JIK, DPK, MAP3K18	uc001twy.4	Q9H2K8		ENST00000392533.3:c.1850G>A	12.37:g.118610311C>T	ENSP00000376317:p.Arg617Gln	Somatic	264	0		WXS	Illumina GAIIx	Phase_I	494	10	NM_016281	0	0	54	56	2	Q658N1|Q8IUM4|Q9HC79|Q9NZM9|Q9UHG7	Missense_Mutation	SNP	ENST00000392533.3	37	CCDS9188.1	.	.	.	.	.	.	.	.	.	.	c	32	5.142701	0.94560	.	.	ENSG00000135090	ENST00000419821;ENST00000392533;ENST00000537952;ENST00000359811	T;T;T	0.50548	0.74;0.74;0.74	4.58	3.67	0.42095	.	0.000000	0.85682	D	0.000000	T	0.56615	0.1997	M	0.82193	2.58	0.58432	D	0.999999	P	0.46578	0.88	P	0.45474	0.482	T	0.65981	-0.6036	10	0.56958	D	0.05	.	14.1756	0.65539	0.151:0.849:0.0:0.0	.	617	Q9H2K8	TAOK3_HUMAN	Q	617;617;157;237	ENSP00000416374:R617Q;ENSP00000376317:R617Q;ENSP00000443834:R157Q	ENSP00000352863:R237Q	R	-	2	0	TAOK3	117094694	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	5.891000	0.69782	1.247000	0.43917	0.651000	0.88453	CGG	.		0.433	TAOK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401456.2	NM_016281	
FZD10	11211	broad.mit.edu	37	12	130647553	130647553	+	Missense_Mutation	SNP	C	C	A	rs200800452		TCGA-PA-A5YG-01A-11D-A29I-10	TCGA-PA-A5YG-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bc84db10-201a-4c8c-b43f-6a4557ecd98c	13f7f8b4-77e2-4100-b2fe-c35064ead1ea	g.chr12:130647553C>A	ENST00000229030.4	+	1	550	c.66C>A	c.(64-66)agC>agA	p.S22R	FZD10-AS1_ENST00000505807.2_RNA|FZD10_ENST00000539839.1_5'UTR			Q9ULW2	FZD10_HUMAN	frizzled class receptor 10	22					brain development (GO:0007420)|canonical Wnt signaling pathway (GO:0060070)|cellular response to retinoic acid (GO:0071300)|gonad development (GO:0008406)|negative regulation of Rho GTPase activity (GO:0034259)|neuron differentiation (GO:0030182)|non-canonical Wnt signaling pathway via JNK cascade (GO:0038031)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of Rac GTPase activity (GO:0032855)|regulation of actin cytoskeleton organization (GO:0032956)|vasculature development (GO:0001944)	cell projection (GO:0042995)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|PDZ domain binding (GO:0030165)|Wnt-activated receptor activity (GO:0042813)|Wnt-protein binding (GO:0017147)	p.S22R(2)		breast(1)|central_nervous_system(1)|endometrium(3)|kidney(4)|large_intestine(7)|lung(14)|pancreas(1)|prostate(3)|urinary_tract(1)	35	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;1.3e-06)|Epithelial(86;1.66e-05)|all cancers(50;5.18e-05)		CCGCCATCAGCTCCATGGACA	0.667																																					p.S22R		.											.	FZD10-658	2	Substitution - Missense(2)	prostate(1)|lung(1)	c.C66A						.						11.0	11.0	11.0					12																	130647553		2191	4283	6474	SO:0001583	missense	11211	exon1			CATCAGCTCCATG	AB027464	CCDS9267.1	12q24.33	2014-01-29	2014-01-29			ENSG00000111432		"""GPCR / Class F : Frizzled receptors"", ""CD molecules"""	4039	protein-coding gene	gene with protein product		606147	"""frizzled (Drosophila) homolog 10"", ""frizzled homolog 10 (Drosophila)"", ""frizzled 10, seven transmembrane spanning receptor"", ""frizzled family receptor 10"""			10448064	Standard	NM_007197		Approved	CD350	uc001uii.3	Q9ULW2		ENST00000229030.4:c.66C>A	12.37:g.130647553C>A	ENSP00000229030:p.Ser22Arg	Somatic	71	1		WXS	Illumina GAIIx	Phase_I	244	17	NM_007197	0	0	0	0	0		Missense_Mutation	SNP	ENST00000229030.4	37	CCDS9267.1	.	.	.	.	.	.	.	.	.	.	C	10.57	1.386995	0.25031	.	.	ENSG00000111432	ENST00000229030	T	0.76968	-1.06	3.43	-0.743	0.11105	.	1.117550	0.07024	U	0.827300	T	0.63698	0.2533	L	0.27053	0.805	0.50813	D	0.999897	B	0.10296	0.003	B	0.04013	0.001	T	0.44711	-0.9310	10	0.25106	T	0.35	.	8.7037	0.34340	0.0:0.6722:0.0:0.3278	.	22	Q9ULW2	FZD10_HUMAN	R	22	ENSP00000229030:S22R	ENSP00000229030:S22R	S	+	3	2	FZD10	129213506	1.000000	0.71417	0.997000	0.53966	0.993000	0.82548	2.073000	0.41519	-0.099000	0.12263	0.561000	0.74099	AGC	.		0.667	FZD10-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding			
RNF17	56163	broad.mit.edu	37	13	25367256	25367256	+	Missense_Mutation	SNP	G	G	T	rs572750591		TCGA-PA-A5YG-01A-11D-A29I-10	TCGA-PA-A5YG-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bc84db10-201a-4c8c-b43f-6a4557ecd98c	13f7f8b4-77e2-4100-b2fe-c35064ead1ea	g.chr13:25367256G>T	ENST00000255324.5	+	10	1064	c.1012G>T	c.(1012-1014)Gat>Tat	p.D338Y	RNF17_ENST00000381921.1_Missense_Mutation_p.D338Y|RNF17_ENST00000255325.6_Missense_Mutation_p.D338Y|RNF17_ENST00000255326.4_3'UTR	NM_001184993.1|NM_031277.2	NP_001171922.1|NP_112567.2	Q9BXT8	RNF17_HUMAN	ring finger protein 17	338					multicellular organismal development (GO:0007275)|spermatid development (GO:0007286)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	hydrolase activity, acting on ester bonds (GO:0016788)|nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(15)|ovary(1)|prostate(3)|skin(6)	36		Lung SC(185;0.0225)|Breast(139;0.077)		all cancers(112;0.0114)|OV - Ovarian serous cystadenocarcinoma(117;0.0311)|Epithelial(112;0.0524)		TTCTTGTTACGATACATACCC	0.343																																					p.D338Y		.											.	RNF17-228	0			c.G1012T						.						136.0	133.0	134.0					13																	25367256		2203	4300	6503	SO:0001583	missense	56163	exon10			TGTTACGATACAT	AF285602, AK001907	CCDS9308.2	13q12.13	2013-01-23			ENSG00000132972	ENSG00000132972		"""RING-type (C3HC4) zinc fingers"", ""Tudor domain containing"""	10060	protein-coding gene	gene with protein product	"""spermatogenesis associated 23"""	605793	"""tudor domain containing 4"""	TDRD4		11279525	Standard	NM_001184993		Approved	Mmip-2, SPATA23, FLJ11045	uc001upr.3	Q9BXT8	OTTHUMG00000016589	ENST00000255324.5:c.1012G>T	13.37:g.25367256G>T	ENSP00000255324:p.Asp338Tyr	Somatic	103	0		WXS	Illumina GAIIx	Phase_I	126	3	NM_001184993	0	0	0	0	0	Q5T2J9|Q6P1W3|Q9BXT7|Q9NUY9	Missense_Mutation	SNP	ENST00000255324.5	37	CCDS9308.2	.	.	.	.	.	.	.	.	.	.	G	9.650	1.141351	0.21205	.	.	ENSG00000132972	ENST00000255324;ENST00000381921;ENST00000429047;ENST00000255325;ENST00000255326	T;T;T	0.32272	2.58;2.6;1.46	5.07	3.33	0.38152	.	0.281525	0.30611	N	0.009250	T	0.38639	0.1048	L	0.32530	0.975	0.09310	N	1	D;D;D	0.89917	0.99;0.99;1.0	P;P;D	0.76575	0.706;0.706;0.988	T	0.08638	-1.0712	10	0.59425	D	0.04	.	6.8838	0.24189	0.0933:0.1763:0.7303:0.0	.	338;338;338	B7Z7S1;Q9BXT8;Q9BXT8-2	.;RNF17_HUMAN;.	Y	338;338;197;339;338	ENSP00000255324:D338Y;ENSP00000371346:D338Y;ENSP00000255325:D339Y	ENSP00000255324:D338Y	D	+	1	0	RNF17	24265256	0.042000	0.20092	0.003000	0.11579	0.001000	0.01503	1.518000	0.35877	0.723000	0.32274	-0.142000	0.14014	GAT	.		0.343	RNF17-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044217.1	NM_031994	
FRY	10129	bcgsc.ca	37	13	32811974	32811974	+	Missense_Mutation	SNP	C	C	T	rs73169136	byFrequency	TCGA-PA-A5YG-01A-11D-A29I-10	TCGA-PA-A5YG-10A-01D-A29L-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bc84db10-201a-4c8c-b43f-6a4557ecd98c	13f7f8b4-77e2-4100-b2fe-c35064ead1ea	g.chr13:32811974C>T	ENST00000380250.3	+	44	6765	c.6269C>T	c.(6268-6270)gCa>gTa	p.A2090V		NM_023037.2	NP_075463.2	Q5TBA9	FRY_HUMAN	furry homolog (Drosophila)	2090						cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)				NS(3)|breast(4)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(31)|lung(50)|ovary(5)|pancreas(1)|prostate(6)|skin(9)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	132		Lung SC(185;0.0271)		all cancers(112;4.81e-05)|Epithelial(112;0.000656)|OV - Ovarian serous cystadenocarcinoma(117;0.0123)|BRCA - Breast invasive adenocarcinoma(63;0.0295)|GBM - Glioblastoma multiforme(144;0.104)		AAACTCCAGGCACAGCTGAAG	0.527													C|||	39	0.00778754	0.0	0.0346	5008	,	,		18641	0.0		0.0129	False		,,,				2504	0.002				p.A2090V		.											.	FRY-142	0			c.C6269T						.	C	VAL/ALA	6,3982		0,6,1988	61.0	65.0	63.0		6269	4.3	0.9	13	dbSNP_130	63	95,8227		0,95,4066	yes	missense	FRY	NM_023037.2	64	0,101,6054	TT,TC,CC		1.1416,0.1505,0.8205	benign	2090/3014	32811974	101,12209	1994	4161	6155	SO:0001583	missense	10129	exon44			TCCAGGCACAGCT	AL049784	CCDS41875.1	13q13.1	2008-02-05	2005-11-24	2005-11-24	ENSG00000073910	ENSG00000073910			20367	protein-coding gene	gene with protein product		614818	"""chromosome 13 open reading frame 14"""	C13orf14		14702039, 8812419	Standard	NM_023037		Approved	bA37E23.1, 13CDNA73, CG003	uc001utx.3	Q5TBA9	OTTHUMG00000016696	ENST00000380250.3:c.6269C>T	13.37:g.32811974C>T	ENSP00000369600:p.Ala2090Val	Somatic	149	0		WXS	Illumina GAIIx	Phase_I	211	7	NM_023037	0	0	10	10	0	Q9Y3N6	Missense_Mutation	SNP	ENST00000380250.3	37	CCDS41875.1	24	0.01098901098901099	1	0.0020325203252032522	13	0.03591160220994475	0	0.0	10	0.013192612137203167	C	15.28	2.786075	0.49997	0.001505	0.011416	ENSG00000073910	ENST00000380250;ENST00000380257	T	0.23950	1.88	6.03	4.26	0.50523	.	0.390654	0.30850	N	0.008748	T	0.07234	0.0183	L	0.50333	1.59	0.80722	D	1	B	0.11235	0.004	B	0.19666	0.026	T	0.02805	-1.1108	10	0.52906	T	0.07	.	16.0022	0.80301	0.0:0.623:0.377:0.0	.	2090	Q5TBA9	FRY_HUMAN	V	2090;927	ENSP00000369600:A2090V	ENSP00000369600:A2090V	A	+	2	0	FRY	31709974	0.424000	0.25490	0.926000	0.36857	0.984000	0.73092	0.907000	0.28531	1.543000	0.49345	0.655000	0.94253	GCA	C|0.990;T|0.010		0.527	FRY-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044405.1	NM_023037	
RNASE4	6038	bcgsc.ca	37	14	21167576	21167576	+	Missense_Mutation	SNP	A	A	T	rs3748338	byFrequency	TCGA-PA-A5YG-01A-11D-A29I-10	TCGA-PA-A5YG-10A-01D-A29L-10	A	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bc84db10-201a-4c8c-b43f-6a4557ecd98c	13f7f8b4-77e2-4100-b2fe-c35064ead1ea	g.chr14:21167576A>T	ENST00000555835.1	+	2	722	c.46A>T	c.(46-48)Acc>Tcc	p.T16S	RP11-903H12.3_ENST00000554286.1_RNA|RNASE4_ENST00000555597.1_Missense_Mutation_p.T16S|AL163636.6_ENST00000553909.1_3'UTR|RNASE4_ENST00000304704.4_Missense_Mutation_p.T16S|RNASE4_ENST00000397995.2_Missense_Mutation_p.T16S	NM_002937.3	NP_002928.1	P34096	RNAS4_HUMAN	ribonuclease, RNase A family, 4	16			T -> S (in dbSNP:rs3748338).		cellular response to starvation (GO:0009267)|mRNA cleavage (GO:0006379)|RNA phosphodiester bond hydrolysis, endonucleolytic (GO:0090502)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	nucleic acid binding (GO:0003676)|pancreatic ribonuclease activity (GO:0004522)			central_nervous_system(1)|large_intestine(1)|lung(3)|skin(1)	6	all_cancers(95;0.00304)		Epithelial(56;5.13e-07)|all cancers(55;4.73e-06)	GBM - Glioblastoma multiforme(265;0.0133)		TTTGCTGCTGACCCTGCTGGG	0.562													A|||	639	0.127596	0.0068	0.1023	5008	,	,		19999	0.1935		0.1431	False		,,,				2504	0.2249				p.T16S	Esophageal Squamous(59;1059 1362 26290 51151)	.											.	RNASE4-514	0			c.A46T						.	A	SER/THR,SER/THR	141,4265	95.7+/-134.4	3,135,2065	97.0	94.0	95.0		46,46	4.1	1.0	14	dbSNP_107	95	1256,7344	245.3+/-274.2	82,1092,3126	yes	missense,missense	RNASE4	NM_002937.3,NM_194431.1	58,58	85,1227,5191	TT,TA,AA		14.6047,3.2002,10.7412	possibly-damaging,possibly-damaging	16/148,16/148	21167576	1397,11609	2203	4300	6503	SO:0001583	missense	6038	exon2			CTGCTGACCCTGC	U36775	CCDS9555.1	14q11	2014-07-16			ENSG00000258818	ENSG00000258818		"""Ribonucleases, RNase A"""	10047	protein-coding gene	gene with protein product		601030				7501448	Standard	NM_002937		Approved		uc001vxy.4	P34096	OTTHUMG00000029575	ENST00000555835.1:c.46A>T	14.37:g.21167576A>T	ENSP00000452245:p.Thr16Ser	Somatic	59	0		WXS	Illumina GAIIx	Phase_I	57	4	NM_002937	0	0	2	2	0		Missense_Mutation	SNP	ENST00000555835.1	37	CCDS9555.1	257	0.11767399267399267	4	0.008130081300813009	36	0.09944751381215469	109	0.19055944055944055	108	0.1424802110817942	A	19.15	3.772011	0.69992	0.032002	0.146047	ENSG00000258818;ENSG00000258818;ENSG00000258818;ENSG00000181784;ENSG00000181784;ENSG00000181784	ENST00000555835;ENST00000397995;ENST00000555597;ENST00000398001;ENST00000304704;ENST00000397999	T;T;T;T;T;T	0.80393	-1.37;-1.37;-1.37;-1.37;-1.37;-1.37	5.24	4.12	0.48240	Ribonuclease A, domain (1);	0.641420	0.15716	N	0.248145	T	0.00300	0.0009	L	0.46157	1.445	0.43835	P	0.0035809999999999453	D	0.54772	0.968	P	0.45856	0.495	T	0.32929	-0.9888	9	0.87932	D	0	-15.0045	6.9947	0.24777	0.9021:0.0:0.0979:0.0	rs3748338;rs17242797;rs52831469;rs3748338	16	P34096	RNAS4_HUMAN	S	16	ENSP00000452245:T16S;ENSP00000381081:T16S;ENSP00000451624:T16S;ENSP00000381087:T16S;ENSP00000307096:T16S;ENSP00000381085:T16S	ENSP00000307096:T16S	T	+	1	0	AL163636.2;RNASE4	20237416	0.998000	0.40836	0.999000	0.59377	0.879000	0.50718	0.755000	0.26405	2.285000	0.76669	0.533000	0.62120	ACC	A|0.887;N|0.000		0.562	RNASE4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000073729.3		
ANKRD34C	390616	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	15	79587017	79587017	+	Missense_Mutation	SNP	C	C	T			TCGA-PA-A5YG-01A-11D-A29I-10	TCGA-PA-A5YG-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bc84db10-201a-4c8c-b43f-6a4557ecd98c	13f7f8b4-77e2-4100-b2fe-c35064ead1ea	g.chr15:79587017C>T	ENST00000558647.2	+	1	1391	c.1391C>T	c.(1390-1392)cCg>cTg	p.P464L	ANKRD34C_ENST00000421388.2_Missense_Mutation_p.P464L			P0C6C1	AN34C_HUMAN	ankyrin repeat domain 34C	464										endometrium(3)|kidney(1)|skin(1)	5						GGCTTCCTGCCGCCTTTAAAT	0.502																																					p.P464L		.											.	.	0			c.C1391T						.						108.0	96.0	100.0					15																	79587017		685	1584	2269	SO:0001583	missense	390616	exon2			TCCTGCCGCCTTT		CCDS53965.1	15q25.1	2013-01-10			ENSG00000235711	ENSG00000235711		"""Ankyrin repeat domain containing"""	33888	protein-coding gene	gene with protein product							Standard	NM_001146341		Approved		uc002bet.3	P0C6C1		ENST00000558647.2:c.1391C>T	15.37:g.79587017C>T	ENSP00000454921:p.Pro464Leu	Somatic	73	0		WXS	Illumina GAIIx	Phase_I	84	6	NM_001146341	0	0	0	0	0	H3BNM1	Missense_Mutation	SNP	ENST00000558647.2	37	CCDS53965.1	.	.	.	.	.	.	.	.	.	.	C	15.60	2.881826	0.51908	.	.	ENSG00000235711	ENST00000421388	T	0.31510	1.49	4.72	4.72	0.59763	.	.	.	.	.	T	0.55909	0.1950	M	0.74647	2.275	0.58432	D	0.999999	D	0.89917	1.0	D	0.91635	0.999	T	0.60880	-0.7175	9	0.87932	D	0	.	15.2172	0.73277	0.0:1.0:0.0:0.0	.	464	P0C6C1	AN34C_HUMAN	L	464	ENSP00000401089:P464L	ENSP00000401089:P464L	P	+	2	0	ANKRD34C	77374072	1.000000	0.71417	0.361000	0.25849	0.031000	0.12232	7.207000	0.77899	2.428000	0.82296	0.655000	0.94253	CCG	.		0.502	ANKRD34C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000416713.2	NM_001146341	
ST20	400410	bcgsc.ca	37	15	80216532	80216532	+	5'Flank	SNP	A	A	T	rs2733101	byFrequency	TCGA-PA-A5YG-01A-11D-A29I-10	TCGA-PA-A5YG-10A-01D-A29L-10	A	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bc84db10-201a-4c8c-b43f-6a4557ecd98c	13f7f8b4-77e2-4100-b2fe-c35064ead1ea	g.chr15:80216532A>T	ENST00000485386.1	-	0	0				C15orf37_ENST00000560255.1_3'UTR|C15ORF37_ENST00000542003.1_3'UTR|ST20-MTHFS_ENST00000494999.1_5'Flank|ST20-MTHFS_ENST00000479961.1_5'Flank			Q9HBF5	ST20_HUMAN	suppressor of tumorigenicity 20						extrinsic apoptotic signaling pathway in absence of ligand (GO:0097192)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|negative regulation of apoptotic process (GO:0043066)|negative regulation of intrinsic apoptotic signaling pathway (GO:2001243)	mitochondrial outer membrane (GO:0005741)	protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)			kidney(1)|large_intestine(1)|lung(1)|urinary_tract(1)	4						TATTTAACCGATGCCTATTTT	0.527													A|||	1739	0.347244	0.202	0.4481	5008	,	,		14549	0.4851		0.338	False		,,,				2504	0.3395				.		.											.	.	0			.						.																																			SO:0001631	upstream_gene_variant	283687	.			TAACCGATGCCTA	AF249277	CCDS42067.1	15q25.1	2007-07-16				ENSG00000180953			33520	protein-coding gene	gene with protein product							Standard	NM_001100879		Approved	HCCS-1		Q9HBF5			15.37:g.80216532A>T	Exception_encountered	Somatic	90	0		WXS	Illumina GAIIx	Phase_I	122	5	.	0	0	0	0	0		RNA	SNP	ENST00000485386.1	37	CCDS42067.1																																																																																			A|0.380;T|0.620		0.527	ST20-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000416729.1		
KREMEN2	79412	hgsc.bcm.edu	37	16	3017992	3017992	+	Missense_Mutation	SNP	T	T	C			TCGA-PA-A5YG-01A-11D-A29I-10	TCGA-PA-A5YG-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bc84db10-201a-4c8c-b43f-6a4557ecd98c	13f7f8b4-77e2-4100-b2fe-c35064ead1ea	g.chr16:3017992T>C	ENST00000303746.5	+	9	1937	c.1360T>C	c.(1360-1362)Tcc>Ccc	p.S454P	KREMEN2_ENST00000575769.1_3'UTR|KREMEN2_ENST00000575885.1_3'UTR|PAQR4_ENST00000293978.8_5'Flank|PAQR4_ENST00000574988.1_5'Flank|KREMEN2_ENST00000571007.1_Missense_Mutation_p.S415P|PAQR4_ENST00000318782.8_5'Flank|PAQR4_ENST00000576565.1_5'Flank|PKMYT1_ENST00000571102.1_5'Flank|KREMEN2_ENST00000319500.6_3'UTR|PAQR4_ENST00000572687.1_5'Flank|KREMEN2_ENST00000572045.1_3'UTR			Q8NCW0	KREM2_HUMAN	kringle containing transmembrane protein 2	454					Wnt signaling pathway (GO:0016055)	integral component of membrane (GO:0016021)				central_nervous_system(2)|endometrium(1)|large_intestine(1)	4						CAGCCAGAGCTCCCTGCGCTC	0.726																																					p.S454P		.											.	KREMEN2-659	0			c.T1360C						.						6.0	8.0	7.0					16																	3017992		2141	4223	6364	SO:0001583	missense	79412	exon9			CAGAGCTCCCTGC	BC003533	CCDS10483.1, CCDS10484.1, CCDS58412.1, CCDS58413.1	16p13.11	2008-08-04			ENSG00000131650	ENSG00000131650			18797	protein-coding gene	gene with protein product		609899				12050670	Standard	NM_172229		Approved	MGC10791, KRM2	uc002csg.3	Q8NCW0	OTTHUMG00000128976	ENST00000303746.5:c.1360T>C	16.37:g.3017992T>C	ENSP00000304422:p.Ser454Pro	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	9	5	NM_172229	0	0	1	4	3	B4DXF6|I3L2S2|Q8N2J4|Q8NCW1|Q96GL8|Q9BTP9	Missense_Mutation	SNP	ENST00000303746.5	37	CCDS10483.1	.	.	.	.	.	.	.	.	.	.	T	12.75	2.032151	0.35893	.	.	ENSG00000131650	ENST00000303746	T	0.63417	-0.04	5.02	5.02	0.67125	.	0.000000	0.40640	U	0.001060	T	0.62514	0.2434	L	0.29908	0.895	0.80722	D	1	D;D	0.65815	0.995;0.995	P;P	0.56278	0.795;0.795	T	0.66646	-0.5871	10	0.87932	D	0	.	11.1287	0.48334	0.0:0.0:0.0:1.0	.	415;454	B4DXF6;Q8NCW0	.;KREM2_HUMAN	P	454	ENSP00000304422:S454P	ENSP00000304422:S454P	S	+	1	0	KREMEN2	2957993	0.997000	0.39634	1.000000	0.80357	0.975000	0.68041	1.265000	0.33027	1.898000	0.54952	0.448000	0.29417	TCC	.		0.726	KREMEN2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000250964.2	NM_145347	
RRN3	54700	broad.mit.edu	37	16	15188060	15188060	+	Missense_Mutation	SNP	G	G	A	rs201504364		TCGA-PA-A5YG-01A-11D-A29I-10	TCGA-PA-A5YG-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bc84db10-201a-4c8c-b43f-6a4557ecd98c	13f7f8b4-77e2-4100-b2fe-c35064ead1ea	g.chr16:15188060G>A	ENST00000198767.6	-	1	114	c.31C>T	c.(31-33)Ccg>Tcg	p.P11S	PDXDC1_ENST00000535621.2_Intron|RP11-72I8.1_ENST00000569858.1_RNA|RRN3_ENST00000563559.1_Missense_Mutation_p.P11S|RRN3_ENST00000429751.2_Missense_Mutation_p.P11S|RRN3_ENST00000327307.7_5'Flank|RRN3_ENST00000564131.1_Missense_Mutation_p.P11S	NM_018427.3	NP_060897.3	Q9NYV6	RRN3_HUMAN	RRN3 RNA polymerase I transcription factor homolog (S. cerevisiae)	11					cell proliferation (GO:0008283)|cytoplasm organization (GO:0007028)|gene expression (GO:0010467)|homeostasis of number of cells (GO:0048872)|in utero embryonic development (GO:0001701)|negative regulation of intrinsic apoptotic signaling pathway by p53 class mediator (GO:1902254)|nucleolus organization (GO:0007000)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of DNA-templated transcription, initiation (GO:2000142)|ribosome biogenesis (GO:0042254)|transcription from RNA polymerase I promoter (GO:0006360)|transcription initiation from RNA polymerase I promoter (GO:0006361)	nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)		p.P11S(3)		NS(2)|central_nervous_system(3)|endometrium(1)|kidney(1)|large_intestine(2)|lung(7)|ovary(2)|prostate(2)	20						GCATCTCCCGGCAAACGCGTG	0.637																																					p.P11S		.											.	RRN3-91	3	Substitution - Missense(3)	lung(1)|prostate(1)|central_nervous_system(1)	c.C31T						.						15.0	14.0	14.0					16																	15188060		2193	4294	6487	SO:0001583	missense	54700	exon1			CTCCCGGCAAACG	AF227156	CCDS10559.1, CCDS73833.1	16p13.11	2009-10-26	2006-04-04		ENSG00000085721	ENSG00000085721			30346	protein-coding gene	gene with protein product		605121	"""RRN3 RNA polymerase I transcription factor homolog (yeast)"""			10758157, 11250903	Standard	XM_005255375		Approved	DKFZp566E104	uc002dde.3	Q9NYV6	OTTHUMG00000129847	ENST00000198767.6:c.31C>T	16.37:g.15188060G>A	ENSP00000198767:p.Pro11Ser	Somatic	88	2		WXS	Illumina GAIIx	Phase_I	407	11	NM_018427	0	0	27	27	0	A2RTY9|B4E0J7|B4E3T2|Q3MHU9|Q6IPL4|Q9H4F0	Missense_Mutation	SNP	ENST00000198767.6	37	CCDS10559.1	.	.	.	.	.	.	.	.	.	.	.	10.34	1.323150	0.24080	.	.	ENSG00000085721	ENST00000198767;ENST00000429751	T;T	0.46819	1.02;0.86	3.13	0.948	0.19561	.	.	.	.	.	T	0.19485	0.0468	N	0.08118	0	0.09310	N	0.999994	B;B;B	0.10296	0.0;0.003;0.0	B;B;B	0.04013	0.001;0.001;0.001	T	0.26538	-1.0100	9	0.06494	T	0.89	.	3.8332	0.08883	0.1556:0.2546:0.5898:0.0	.	11;11;11	F5H148;Q3MHU9;Q9NYV6	.;.;RRN3_HUMAN	S	11	ENSP00000198767:P11S;ENSP00000402027:P11S	ENSP00000198767:P11S	P	-	1	0	RRN3	15095561	0.001000	0.12720	0.003000	0.11579	0.038000	0.13279	0.733000	0.26087	0.121000	0.18284	0.305000	0.20034	CCG	G|0.997;A|0.003		0.637	RRN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252087.2	NM_018427	
RRN3	54700	broad.mit.edu	37	16	15188066	15188066	+	Missense_Mutation	SNP	G	G	A	rs200006712		TCGA-PA-A5YG-01A-11D-A29I-10	TCGA-PA-A5YG-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bc84db10-201a-4c8c-b43f-6a4557ecd98c	13f7f8b4-77e2-4100-b2fe-c35064ead1ea	g.chr16:15188066G>A	ENST00000198767.6	-	1	108	c.25C>T	c.(25-27)Cgt>Tgt	p.R9C	PDXDC1_ENST00000535621.2_Intron|RP11-72I8.1_ENST00000569858.1_RNA|RRN3_ENST00000563559.1_Missense_Mutation_p.R9C|RRN3_ENST00000429751.2_Missense_Mutation_p.R9C|RRN3_ENST00000327307.7_5'Flank|RRN3_ENST00000564131.1_Missense_Mutation_p.R9C	NM_018427.3	NP_060897.3	Q9NYV6	RRN3_HUMAN	RRN3 RNA polymerase I transcription factor homolog (S. cerevisiae)	9					cell proliferation (GO:0008283)|cytoplasm organization (GO:0007028)|gene expression (GO:0010467)|homeostasis of number of cells (GO:0048872)|in utero embryonic development (GO:0001701)|negative regulation of intrinsic apoptotic signaling pathway by p53 class mediator (GO:1902254)|nucleolus organization (GO:0007000)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of DNA-templated transcription, initiation (GO:2000142)|ribosome biogenesis (GO:0042254)|transcription from RNA polymerase I promoter (GO:0006360)|transcription initiation from RNA polymerase I promoter (GO:0006361)	nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)		p.R9C(3)		NS(2)|central_nervous_system(3)|endometrium(1)|kidney(1)|large_intestine(2)|lung(7)|ovary(2)|prostate(2)	20						CCCGGCAAACGCGTGTGAAGC	0.642																																					p.R9C		.											.	RRN3-91	3	Substitution - Missense(3)	lung(1)|prostate(1)|central_nervous_system(1)	c.C25T						.						15.0	13.0	14.0					16																	15188066		2194	4290	6484	SO:0001583	missense	54700	exon1			GCAAACGCGTGTG	AF227156	CCDS10559.1, CCDS73833.1	16p13.11	2009-10-26	2006-04-04		ENSG00000085721	ENSG00000085721			30346	protein-coding gene	gene with protein product		605121	"""RRN3 RNA polymerase I transcription factor homolog (yeast)"""			10758157, 11250903	Standard	XM_005255375		Approved	DKFZp566E104	uc002dde.3	Q9NYV6	OTTHUMG00000129847	ENST00000198767.6:c.25C>T	16.37:g.15188066G>A	ENSP00000198767:p.Arg9Cys	Somatic	80	2		WXS	Illumina GAIIx	Phase_I	382	11	NM_018427	0	0	21	21	0	A2RTY9|B4E0J7|B4E3T2|Q3MHU9|Q6IPL4|Q9H4F0	Missense_Mutation	SNP	ENST00000198767.6	37	CCDS10559.1	.	.	.	.	.	.	.	.	.	.	.	18.86	3.712820	0.68730	.	.	ENSG00000085721	ENST00000198767;ENST00000429751	T;T	0.59906	0.68;0.23	3.13	3.13	0.36017	.	.	.	.	.	T	0.59032	0.2164	N	0.19112	0.55	0.80722	D	1	D;D;D	0.89917	0.999;1.0;1.0	D;D;D	0.77557	0.988;0.99;0.982	T	0.62627	-0.6814	9	0.87932	D	0	.	9.8894	0.41281	0.0:0.0:1.0:0.0	.	9;9;9	F5H148;Q3MHU9;Q9NYV6	.;.;RRN3_HUMAN	C	9	ENSP00000198767:R9C;ENSP00000402027:R9C	ENSP00000198767:R9C	R	-	1	0	RRN3	15095567	1.000000	0.71417	0.965000	0.40720	0.035000	0.12851	2.717000	0.47227	1.752000	0.51891	0.305000	0.20034	CGT	G|0.997;A|0.003		0.642	RRN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252087.2	NM_018427	
KNOP1	400506	broad.mit.edu	37	16	19722724	19722724	+	Frame_Shift_Del	DEL	T	T	-			TCGA-PA-A5YG-01A-11D-A29I-10	TCGA-PA-A5YG-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bc84db10-201a-4c8c-b43f-6a4557ecd98c	13f7f8b4-77e2-4100-b2fe-c35064ead1ea	g.chr16:19722724delT	ENST00000219837.7	-	3	1035	c.957delA	c.(955-957)aaafs	p.K319fs	AC002550.5_ENST00000565916.1_RNA|KNOP1_ENST00000568230.1_5'UTR	NM_001012991.2	NP_001013009.2	Q1ED39	KNOP1_HUMAN	lysine-rich nucleolar protein 1	319	Interaction with ZNF106. {ECO:0000250}.					nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)	p.G320fs*5(1)|p.K319N(1)									CCATGTTGCCTTTTTTTTCCA	0.562																																					p.K319fs		.											.	C16orf88-68	2	Substitution - Missense(1)|Insertion - Frameshift(1)	large_intestine(1)|lung(1)	c.957delA						.			8,4200		0,8,2096	224.0	244.0	237.0			3.5	0.9	16		241	11,8211		0,11,4100	no	frameshift	C16orf88	NM_001012991.2		0,19,6196	A1A1,A1R,RR		0.1338,0.1901,0.1529			19722724	19,12411	2184	4291	6475	SO:0001589	frameshift_variant	400506	exon3			GTTGCCTTTTTTT	BC047010	CCDS42127.1	16p12.3	2013-03-12	2013-03-12	2013-03-12	ENSG00000103550	ENSG00000103550			34404	protein-coding gene	gene with protein product	"""family with sequence similarity 191, member A"", ""testis-specific gene 118"""		"""chromosome 16 open reading frame 88"""	C16orf88			Standard	NM_001012991		Approved	101F10.1, FAM191A, TSG118	uc002dgq.3	Q1ED39		ENST00000219837.7:c.957delA	16.37:g.19722724delT	ENSP00000219837:p.Lys319fs	Somatic	155	0		WXS	Illumina GAIIx	Phase_I	333	8	NM_001012991	0	0	0	0	0	O43328|Q5FWF3	Frame_Shift_Del	DEL	ENST00000219837.7	37	CCDS42127.1																																																																																			.		0.562	KNOP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000435993.2	NM_001012991	
SEZ6L2	26470	hgsc.bcm.edu;ucsc.edu	37	16	29884982	29884982	+	Missense_Mutation	SNP	C	C	T	rs146085461		TCGA-PA-A5YG-01A-11D-A29I-10	TCGA-PA-A5YG-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bc84db10-201a-4c8c-b43f-6a4557ecd98c	13f7f8b4-77e2-4100-b2fe-c35064ead1ea	g.chr16:29884982C>T	ENST00000308713.5	-	13	2700	c.2173G>A	c.(2173-2175)Gtt>Att	p.V725I	SEZ6L2_ENST00000350527.3_Missense_Mutation_p.V655I|SEZ6L2_ENST00000537485.1_Missense_Mutation_p.V681I|SEZ6L2_ENST00000346932.5_Missense_Mutation_p.V611I	NM_001114099.2|NM_201575.3	NP_001107571.1|NP_963869.2	Q6UXD5	SE6L2_HUMAN	seizure related 6 homolog (mouse)-like 2	725	Sushi 4. {ECO:0000255|PROSITE- ProRule:PRU00302}.				adult locomotory behavior (GO:0008344)|cerebellar Purkinje cell layer development (GO:0021680)|regulation of protein kinase C signaling (GO:0090036)|synapse maturation (GO:0060074)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)				breast(2)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(10)|lung(16)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	39						TGGGAGCCAACGGGGAAGCCG	0.662																																					p.V725I		.											.	SEZ6L2-92	0			c.G2173A						.	C	ILE/VAL,ILE/VAL,ILE/VAL,ILE/VAL	1,4393	2.1+/-5.4	0,1,2196	38.0	38.0	38.0		1963,1831,1963,2173	3.6	1.0	16	dbSNP_134	38	0,8600		0,0,4300	no	missense,missense,missense,missense	SEZ6L2	NM_001114099.2,NM_001114100.2,NM_012410.3,NM_201575.3	29,29,29,29	0,1,6496	TT,TC,CC		0.0,0.0228,0.0077	benign,benign,benign,benign	655/841,611/810,655/854,725/911	29884982	1,12993	2197	4300	6497	SO:0001583	missense	26470	exon13			AGCCAACGGGGAA	AY358404	CCDS10658.1, CCDS10659.1, CCDS45458.1, CCDS58447.1, CCDS73865.1	16p12.1	2008-02-05			ENSG00000174938	ENSG00000174938			30844	protein-coding gene	gene with protein product	"""type I transmembrane receptor (seizure related protein)"""					12975309	Standard	NM_012410		Approved	PSK-1, FLJ90517	uc010vec.2	Q6UXD5	OTTHUMG00000132112	ENST00000308713.5:c.2173G>A	16.37:g.29884982C>T	ENSP00000312550:p.Val725Ile	Somatic	18	0		WXS	Illumina GAIIx	Phase_I	117	53	NM_001243332	0	0	9	38	29	B7Z1N0|F5H293|H7BXQ6|Q9BW82|Q9UJ45|Q9UJ46|Q9UJ47	Missense_Mutation	SNP	ENST00000308713.5	37	CCDS10659.1	.	.	.	.	.	.	.	.	.	.	C	13.36	2.215009	0.39102	2.28E-4	0.0	ENSG00000174938	ENST00000350527;ENST00000308713;ENST00000346932;ENST00000537485	T;T;T;T	0.65364	-0.15;-0.15;-0.15;-0.15	4.67	3.6	0.41247	Complement control module (2);Sushi/SCR/CCP (3);	0.168473	0.27861	N	0.017541	T	0.47340	0.1440	L	0.41961	1.31	0.47153	D	0.999331	B;B;B;B;B;B	0.23937	0.094;0.006;0.01;0.009;0.006;0.011	B;B;B;B;B;B	0.20577	0.03;0.004;0.008;0.004;0.004;0.006	T	0.51450	-0.8704	10	0.48119	T	0.1	.	3.6333	0.08140	0.0:0.6245:0.0:0.3755	.	681;725;611;655;725;655	F5H293;B7Z5L4;Q9BW82;Q6UXD5-2;Q6UXD5;Q6UXD5-3	.;.;.;.;SE6L2_HUMAN;.	I	655;725;611;681	ENSP00000310206:V655I;ENSP00000312550:V725I;ENSP00000319215:V611I;ENSP00000439412:V681I	ENSP00000312550:V725I	V	-	1	0	SEZ6L2	29792483	0.935000	0.31712	0.996000	0.52242	0.938000	0.57974	1.893000	0.39758	2.138000	0.66242	0.655000	0.94253	GTT	C|1.000;T|0.000		0.662	SEZ6L2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000255154.2	NM_012410	
DHODH	1723	bcgsc.ca	37	16	72042682	72042682	+	Missense_Mutation	SNP	A	A	C	rs3213422	byFrequency	TCGA-PA-A5YG-01A-11D-A29I-10	TCGA-PA-A5YG-10A-01D-A29L-10	A	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bc84db10-201a-4c8c-b43f-6a4557ecd98c	13f7f8b4-77e2-4100-b2fe-c35064ead1ea	g.chr16:72042682A>C	ENST00000219240.4	+	1	40	c.19A>C	c.(19-21)Aaa>Caa	p.K7Q	DHODH_ENST00000572887.1_Missense_Mutation_p.K7Q	NM_001361.4	NP_001352.2	Q02127	PYRD_HUMAN	dihydroorotate dehydrogenase (quinone)	7			K -> Q (in dbSNP:rs3213422). {ECO:0000269|PubMed:1446837, ECO:0000269|PubMed:14702039}.		'de novo' pyrimidine nucleobase biosynthetic process (GO:0006207)|'de novo' UMP biosynthetic process (GO:0044205)|female pregnancy (GO:0007565)|lactation (GO:0007595)|nucleobase-containing small molecule metabolic process (GO:0055086)|positive regulation of apoptotic process (GO:0043065)|pyrimidine nucleobase metabolic process (GO:0006206)|pyrimidine nucleoside biosynthetic process (GO:0046134)|regulation of mitochondrial fission (GO:0090140)|response to caffeine (GO:0031000)|response to drug (GO:0042493)|response to starvation (GO:0042594)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|neuronal cell body (GO:0043025)	dihydroorotate dehydrogenase activity (GO:0004152)|dihydroorotate oxidase activity (GO:0004158)|drug binding (GO:0008144)|FMN binding (GO:0010181)|ubiquinone binding (GO:0048039)			breast(1)|endometrium(2)|large_intestine(4)|ovary(1)|skin(1)|stomach(1)	10		Ovarian(137;0.125)			Atovaquone(DB01117)|Leflunomide(DB01097)|Teriflunomide(DB08880)	GAGACACCTGAAAGTGAGTCC	0.657													A|||	2825	0.564097	0.5204	0.6441	5008	,	,		16500	0.7381		0.4901	False		,,,				2504	0.4632				p.K7Q		.											.	DHODH-227	0			c.A19C						.	A	GLN/LYS	2268,1612		715,838,387	31.0	37.0	35.0		19	2.9	1.0	16	dbSNP_106	35	4234,3824		1200,1834,995	yes	missense	DHODH	NM_001361.4	53	1915,2672,1382	CC,CA,AA		47.4559,41.5464,45.5353	benign	7/396	72042682	6502,5436	1940	4029	5969	SO:0001583	missense	1723	exon1			CACCTGAAAGTGA		CCDS42192.1	16q22.2	2012-10-02	2011-09-05		ENSG00000102967	ENSG00000102967	1.3.5.2		2867	protein-coding gene	gene with protein product		126064	"""dihydroorotate dehydrogenase"""			8211381	Standard	NM_001361		Approved		uc002fbp.3	Q02127	OTTHUMG00000178093	ENST00000219240.4:c.19A>C	16.37:g.72042682A>C	ENSP00000219240:p.Lys7Gln	Somatic	187	0		WXS	Illumina GAIIx	Phase_I	493	11	NM_001361	0	0	0	0	0	A8K8C8|Q6P176	Missense_Mutation	SNP	ENST00000219240.4	37	CCDS42192.1	1246	0.5705128205128205	237	0.4817073170731707	219	0.6049723756906077	413	0.722027972027972	377	0.4973614775725594	A	11.65	1.702177	0.30232	0.584536	0.525441	ENSG00000102967	ENST00000219240	D	0.85013	-1.93	4.01	2.88	0.33553	.	0.499875	0.21331	N	0.076300	T	0.00012	0.0000	L	0.48642	1.525	0.39894	P	0.02618699999999996	B	0.09022	0.002	B	0.10450	0.005	T	0.46233	-0.9206	9	0.30078	T	0.28	-4.161	7.4494	0.27229	0.7786:0.2214:0.0:0.0	rs3213422;rs17665243;rs52805696;rs61491058;rs3213422	7	Q02127	PYRD_HUMAN	Q	7	ENSP00000219240:K7Q	ENSP00000219240:K7Q	K	+	1	0	DHODH	70600183	0.938000	0.31826	0.995000	0.50966	0.471000	0.32888	1.402000	0.34600	0.851000	0.35264	0.472000	0.43445	AAA	A|0.433;C|0.567		0.657	DHODH-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		NM_001361	
TBC1D26	353149	broad.mit.edu	37	17	15641610	15641610	+	Missense_Mutation	SNP	A	A	G	rs202131240		TCGA-PA-A5YG-01A-11D-A29I-10	TCGA-PA-A5YG-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bc84db10-201a-4c8c-b43f-6a4557ecd98c	13f7f8b4-77e2-4100-b2fe-c35064ead1ea	g.chr17:15641610A>G	ENST00000437605.2	+	7	546	c.296A>G	c.(295-297)tAc>tGc	p.Y99C	AC005324.6_ENST00000434017.1_RNA|ZNF286A_ENST00000413242.2_3'UTR|AC005324.6_ENST00000433873.1_RNA|TBC1D26_ENST00000579428.1_Missense_Mutation_p.Y99C|AC005324.6_ENST00000580194.1_RNA	NM_178571.4	NP_848666	Q86UD7	TBC26_HUMAN	TBC1 domain family, member 26	99							Rab GTPase activator activity (GO:0005097)			endometrium(1)|large_intestine(1)|lung(4)|skin(1)	7				UCEC - Uterine corpus endometrioid carcinoma (92;0.0822)|READ - Rectum adenocarcinoma(1115;0.0222)|BRCA - Breast invasive adenocarcinoma(8;0.078)		CAAAGAGTATACAAAGTCATT	0.527																																					p.Y99C		.											.	TBC1D26-90	0			c.A296G						.						94.0	90.0	91.0					17																	15641610		1953	4139	6092	SO:0001583	missense	353149	exon7			GAGTATACAAAGT		CCDS42265.1	17p11.2	2008-11-04			ENSG00000214946	ENSG00000214946			28745	protein-coding gene	gene with protein product						11347906	Standard	NM_178571		Approved	MGC51025	uc010cov.3	Q86UD7	OTTHUMG00000059071	ENST00000437605.2:c.296A>G	17.37:g.15641610A>G	ENSP00000410111:p.Tyr99Cys	Somatic	191	0		WXS	Illumina GAIIx	Phase_I	208	4	NM_178571	0	0	0	0	0	A8K929|Q4G172	Missense_Mutation	SNP	ENST00000437605.2	37	CCDS42265.1	.	.	.	.	.	.	.	.	.	.	a	6.884	0.532498	0.13127	.	.	ENSG00000214946	ENST00000437605	T	0.40756	1.02	1.44	-0.0271	0.13927	Rab-GAP/TBC domain (2);	0.436109	0.22940	U	0.053784	T	0.48943	0.1528	L	0.58583	1.82	0.19945	N	0.999948	D;D	0.76494	0.999;0.981	D;D	0.67231	0.95;0.914	T	0.36601	-0.9741	10	0.52906	T	0.07	.	3.1782	0.06576	0.6204:0.0:0.0:0.3796	.	99;99	Q86UD7;Q86UD7-2	TBC26_HUMAN;.	C	99	ENSP00000410111:Y99C	ENSP00000410111:Y99C	Y	+	2	0	TBC1D26	15582335	0.952000	0.32445	0.008000	0.14137	0.029000	0.11900	1.676000	0.37565	-0.258000	0.09446	0.338000	0.21704	TAC	.		0.527	TBC1D26-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_178571	
KRT12	3859	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	39021191	39021191	+	Missense_Mutation	SNP	C	C	T			TCGA-PA-A5YG-01A-11D-A29I-10	TCGA-PA-A5YG-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bc84db10-201a-4c8c-b43f-6a4557ecd98c	13f7f8b4-77e2-4100-b2fe-c35064ead1ea	g.chr17:39021191C>T	ENST00000251643.4	-	3	697	c.674G>A	c.(673-675)cGc>cAc	p.R225H	RP5-1110E20.1_ENST00000579136.1_RNA	NM_000223.3	NP_000214.1	Q99456	K1C12_HUMAN	keratin 12	225	Coil 1B.|Rod.				visual perception (GO:0007601)	extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)	structural molecule activity (GO:0005198)			central_nervous_system(1)|endometrium(1)|large_intestine(3)|liver(1)|lung(5)|ovary(2)|upper_aerodigestive_tract(2)	15		Breast(137;0.000301)			Griseofulvin(DB00400)	TACGCCCTGGCGCAGGGCCAG	0.557																																					p.R225H		.											.	KRT12-91	0			c.G674A						.						70.0	70.0	70.0					17																	39021191		2203	4300	6503	SO:0001583	missense	3859	exon3			CCCTGGCGCAGGG		CCDS11378.1	17q21.2	2013-06-20	2008-08-01		ENSG00000187242	ENSG00000187242		"""-"", ""Intermediate filaments type I, keratins (acidic)"""	6414	protein-coding gene	gene with protein product	"""Meesmann corneal dystrophy"""	601687				9171831, 16831889	Standard	NM_000223		Approved	K12	uc002hvk.2	Q99456	OTTHUMG00000133369	ENST00000251643.4:c.674G>A	17.37:g.39021191C>T	ENSP00000251643:p.Arg225His	Somatic	94	0		WXS	Illumina GAIIx	Phase_I	131	56	NM_000223	0	0	0	0	0	B2R9E0	Missense_Mutation	SNP	ENST00000251643.4	37	CCDS11378.1	.	.	.	.	.	.	.	.	.	.	C	10.14	1.267188	0.23136	.	.	ENSG00000187242	ENST00000251643	D	0.91945	-2.94	5.96	1.16	0.20824	Filament (1);	0.548852	0.16745	N	0.201287	D	0.89681	0.6785	M	0.85462	2.755	0.40623	D	0.981787	B	0.27951	0.195	B	0.22386	0.039	T	0.82596	-0.0379	10	0.29301	T	0.29	.	5.9905	0.19458	0.1281:0.6352:0.0:0.2367	.	225	Q99456	K1C12_HUMAN	H	225	ENSP00000251643:R225H	ENSP00000251643:R225H	R	-	2	0	KRT12	36274717	0.010000	0.17322	0.143000	0.22291	0.254000	0.26022	0.490000	0.22403	0.289000	0.22422	0.655000	0.94253	CGC	.		0.557	KRT12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257214.2	NM_000223	
KLHL10	317719	broad.mit.edu;bcgsc.ca	37	17	40004254	40004254	+	Missense_Mutation	SNP	C	C	T			TCGA-PA-A5YG-01A-11D-A29I-10	TCGA-PA-A5YG-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bc84db10-201a-4c8c-b43f-6a4557ecd98c	13f7f8b4-77e2-4100-b2fe-c35064ead1ea	g.chr17:40004254C>T	ENST00000293303.4	+	5	1675	c.1522C>T	c.(1522-1524)Cgc>Tgc	p.R508C	RP11-156E6.1_ENST00000560400.1_RNA	NM_152467.3	NP_689680.2	Q6JEL2	KLH10_HUMAN	kelch-like family member 10	508					cell morphogenesis (GO:0000902)|fertilization (GO:0009566)|homeostasis of number of cells within a tissue (GO:0048873)|male genitalia morphogenesis (GO:0048808)|male gonad development (GO:0008584)|protein ubiquitination (GO:0016567)|spermatid development (GO:0007286)	cytoplasm (GO:0005737)				breast(1)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(5)|lung(7)|ovary(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	26		Breast(137;0.000162)				TAACACTTGGCGCACAATCCC	0.493																																					p.R508C		.											.	KLHL10-227	0			c.C1522T						.						130.0	124.0	126.0					17																	40004254		1965	4155	6120	SO:0001583	missense	317719	exon5			ACTTGGCGCACAA	AK057224	CCDS42340.1	17q21.2	2013-01-30	2013-01-30		ENSG00000161594	ENSG00000161594		"""Kelch-like"", ""BTB/POZ domain containing"""	18829	protein-coding gene	gene with protein product		608778	"""kelch-like 10 (Drosophila)"""				Standard	NM_152467		Approved	FLJ32662	uc010cxr.3	Q6JEL2	OTTHUMG00000152510	ENST00000293303.4:c.1522C>T	17.37:g.40004254C>T	ENSP00000293303:p.Arg508Cys	Somatic	323	1		WXS	Illumina GAIIx	Phase_I	393	9	NM_152467	0	0	0	0	0	Q6NW28|Q96MC0	Missense_Mutation	SNP	ENST00000293303.4	37	CCDS42340.1	.	.	.	.	.	.	.	.	.	.	C	14.90	2.673695	0.47781	.	.	ENSG00000161594	ENST00000293303	T	0.79454	-1.27	5.98	5.98	0.97165	Galactose oxidase, beta-propeller (1);	0.275753	0.41396	D	0.000894	D	0.85150	0.5631	L	0.61218	1.895	0.58432	D	0.999992	D	0.89917	1.0	D	0.68621	0.959	D	0.84074	0.0381	9	.	.	.	.	13.9226	0.63942	0.1521:0.8479:0.0:0.0	.	508	Q6JEL2	KLH10_HUMAN	C	508	ENSP00000293303:R508C	.	R	+	1	0	KLHL10	37257780	0.949000	0.32298	1.000000	0.80357	0.974000	0.67602	0.595000	0.24029	2.838000	0.97847	0.591000	0.81541	CGC	.		0.493	KLHL10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000326535.1	NM_152467	
ENOSF1	55556	broad.mit.edu	37	18	683362	683362	+	Missense_Mutation	SNP	G	G	A	rs142662421	byFrequency	TCGA-PA-A5YG-01A-11D-A29I-10	TCGA-PA-A5YG-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bc84db10-201a-4c8c-b43f-6a4557ecd98c	13f7f8b4-77e2-4100-b2fe-c35064ead1ea	g.chr18:683362G>A	ENST00000251101.7	-	11	848	c.760C>T	c.(760-762)Cgc>Tgc	p.R254C	ENOSF1_ENST00000319815.6_Missense_Mutation_p.R24C|ENOSF1_ENST00000583973.1_5'UTR|ENOSF1_ENST00000340116.7_Missense_Mutation_p.R275C|ENOSF1_ENST00000383578.3_Missense_Mutation_p.R172C|ENOSF1_ENST00000580982.1_Missense_Mutation_p.R178C	NM_017512.5	NP_059982.2	Q7L5Y1	ENOF1_HUMAN	enolase superfamily member 1	254					cellular amino acid catabolic process (GO:0009063)|cellular carbohydrate catabolic process (GO:0044275)	mitochondrion (GO:0005739)	isomerase activity (GO:0016853)|L-fuconate dehydratase activity (GO:0050023)|magnesium ion binding (GO:0000287)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(3)|ovary(1)|prostate(1)	10						ACATCCCAGCGCTGGTTGGCA	0.582																																					p.R275C		.											.	ENOSF1-91	0			c.C823T						.	G	CYS/ARG,CYS/ARG,CYS/ARG	0,4406		0,0,2203	102.0	89.0	94.0		514,760,823	4.8	1.0	18	dbSNP_134	94	4,8596	3.0+/-9.4	0,4,4296	yes	missense,missense,missense	ENOSF1	NM_001126123.3,NM_017512.5,NM_202758.3	180,180,180	0,4,6499	AA,AG,GG		0.0465,0.0,0.0308	probably-damaging,probably-damaging,probably-damaging	172/362,254/444,275/451	683362	4,13002	2203	4300	6503	SO:0001583	missense	55556	exon11			CCCAGCGCTGGTT	X67098	CCDS11822.1, CCDS11823.1, CCDS45821.1	18p11.32	2005-01-26			ENSG00000132199	ENSG00000132199			30365	protein-coding gene	gene with protein product		607427				14508106	Standard	NM_001126123		Approved	HSRTSBETA, rTS, TYMSAS	uc002kku.4	Q7L5Y1	OTTHUMG00000131470	ENST00000251101.7:c.760C>T	18.37:g.683362G>A	ENSP00000251101:p.Arg254Cys	Somatic	231	0		WXS	Illumina GAIIx	Phase_I	252	5	NM_202758	0	0	37	37	0	A6NMP3|A8K9R5|B3KSL6|B3KXE4|D3DUH0|Q15407|Q15594|Q15595|Q6ZS08|Q9HAS5|Q9HAS6	Missense_Mutation	SNP	ENST00000251101.7	37	CCDS11822.1	.	.	.	.	.	.	.	.	.	.	G	14.46	2.540647	0.45280	0.0	4.65E-4	ENSG00000132199	ENST00000383578;ENST00000319815;ENST00000251101;ENST00000340116	T;T;T;T	0.47177	0.85;0.85;0.85;0.85	5.68	4.81	0.61882	Mandelate racemase/muconate lactonizing enzyme, conserved site (1);Mandelate racemase/muconate lactonizing enzyme, C-terminal (2);	0.100716	0.64402	D	0.000003	T	0.40498	0.1119	M	0.78637	2.42	0.80722	D	1	B;B;P;B;B	0.39181	0.276;0.047;0.663;0.078;0.146	B;B;B;B;B	0.25987	0.065;0.026;0.06;0.026;0.024	T	0.39440	-0.9614	10	0.36615	T	0.2	.	7.3827	0.26864	0.0797:0.0:0.6585:0.2618	.	275;73;299;254;172	A6NMP3;B3KXE4;Q6ZS08;Q7L5Y1;Q7L5Y1-2	.;.;.;ENOF1_HUMAN;.	C	172;24;254;275	ENSP00000373072:R172C;ENSP00000313346:R24C;ENSP00000251101:R254C;ENSP00000345974:R275C	ENSP00000251101:R254C	R	-	1	0	ENOSF1	673362	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	2.139000	0.42149	1.396000	0.46663	0.585000	0.79938	CGC	G|0.999;A|0.001		0.582	ENOSF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254312.2	NM_017512	
NCOA1	8648	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	24951320	24951320	+	Missense_Mutation	SNP	C	C	T			TCGA-PA-A5YG-01A-11D-A29I-10	TCGA-PA-A5YG-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bc84db10-201a-4c8c-b43f-6a4557ecd98c	13f7f8b4-77e2-4100-b2fe-c35064ead1ea	g.chr2:24951320C>T	ENST00000406961.1	+	16	3513	c.2861C>T	c.(2860-2862)gCt>gTt	p.A954V	NCOA1_ENST00000405141.1_Missense_Mutation_p.A954V|NCOA1_ENST00000407230.1_Missense_Mutation_p.A803V|NCOA1_ENST00000395856.3_Missense_Mutation_p.A954V|NCOA1_ENST00000538539.1_Missense_Mutation_p.A954V|NCOA1_ENST00000348332.3_Missense_Mutation_p.A954V|NCOA1_ENST00000288599.5_Missense_Mutation_p.A954V			Q15788	NCOA1_HUMAN	nuclear receptor coactivator 1	954	Interaction with CREBBP.				androgen receptor signaling pathway (GO:0030521)|cellular lipid metabolic process (GO:0044255)|cellular response to hormone stimulus (GO:0032870)|cerebellum development (GO:0021549)|cerebral cortex development (GO:0021987)|estrous cycle phase (GO:0060206)|hippocampus development (GO:0021766)|histone H4 acetylation (GO:0043967)|hypothalamus development (GO:0021854)|labyrinthine layer morphogenesis (GO:0060713)|lactation (GO:0007595)|male gonad development (GO:0008584)|male mating behavior (GO:0060179)|ovulation cycle (GO:0042698)|positive regulation of apoptotic process (GO:0043065)|positive regulation of female receptivity (GO:0045925)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase II promoter by galactose (GO:0000435)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cellular response to drug (GO:2001038)|response to estradiol (GO:0032355)|response to progesterone (GO:0032570)|response to retinoic acid (GO:0032526)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|neuron projection (GO:0043005)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)	androgen receptor binding (GO:0050681)|chromatin binding (GO:0003682)|enzyme binding (GO:0019899)|histone acetyltransferase activity (GO:0004402)|ligand-dependent nuclear receptor binding (GO:0016922)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|nuclear hormone receptor binding (GO:0035257)|protein N-terminus binding (GO:0047485)|RNA polymerase II regulatory region DNA binding (GO:0001012)|RNA polymerase II transcription coactivator activity (GO:0001105)|signal transducer activity (GO:0004871)|transcription coactivator activity (GO:0003713)		PAX3/NCOA1(8)	breast(3)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(13)|lung(26)|ovary(2)|prostate(1)|skin(1)|urinary_tract(1)	53	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					CTAGACAGAGCTCTGGGAATT	0.368			T	PAX3	alveolar rhadomyosarcoma																																p.A954V		.		Dom	yes		2	2p23	8648	nuclear receptor coactivator 1		M	.	NCOA1-228	0			c.C2861T						.						70.0	67.0	68.0					2																	24951320		2203	4300	6503	SO:0001583	missense	8648	exon14			ACAGAGCTCTGGG	U40396	CCDS1712.1, CCDS1713.1, CCDS42660.1	2p23	2011-07-01			ENSG00000084676	ENSG00000084676		"""Chromatin-modifying enzymes / K-acetyltransferases"", ""Basic helix-loop-helix proteins"""	7668	protein-coding gene	gene with protein product		602691				7481822, 9575154	Standard	XM_005264625		Approved	SRC1, F-SRC-1, NCoA-1, KAT13A, RIP160, bHLHe74	uc002rfk.3	Q15788	OTTHUMG00000125523	ENST00000406961.1:c.2861C>T	2.37:g.24951320C>T	ENSP00000385216:p.Ala954Val	Somatic	64	0		WXS	Illumina GAIIx	Phase_I	64	27	NM_147223	0	0	13	24	11	O00150|O43792|O43793|Q13071|Q13420|Q2T9G5|Q53SX3|Q6GVI5|Q7KYV3	Missense_Mutation	SNP	ENST00000406961.1	37	CCDS1712.1	.	.	.	.	.	.	.	.	.	.	C	36	5.659225	0.96734	.	.	ENSG00000084676	ENST00000406961;ENST00000405141;ENST00000407230;ENST00000538539;ENST00000348332;ENST00000288599;ENST00000395856	T;T;T;T;T;T;T	0.04119	3.7;3.7;3.71;3.7;3.7;3.7;3.71	5.75	5.75	0.90469	Nuclear receptor coactivator, interlocking (1);Nuclear receptor coactivator, Ncoa-type, interlocking (1);	0.052374	0.85682	D	0.000000	T	0.22437	0.0541	M	0.67397	2.05	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.87578	0.997;0.998;0.997;0.998	T	0.00010	-1.2453	10	0.72032	D	0.01	.	19.9262	0.97102	0.0:1.0:0.0:0.0	.	954;954;954;803	Q15788-3;Q15788;Q15788-2;B5MCN7	.;NCOA1_HUMAN;.;.	V	954;954;803;954;954;954;954	ENSP00000385216:A954V;ENSP00000385097:A954V;ENSP00000385195:A803V;ENSP00000444039:A954V;ENSP00000320940:A954V;ENSP00000288599:A954V;ENSP00000379197:A954V	ENSP00000288599:A954V	A	+	2	0	NCOA1	24804824	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.423000	0.80229	2.894000	0.99253	0.655000	0.94253	GCT	.		0.368	NCOA1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000246852.3	NM_147223	
ST6GAL2	84620	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	107423245	107423245	+	Missense_Mutation	SNP	C	C	A			TCGA-PA-A5YG-01A-11D-A29I-10	TCGA-PA-A5YG-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bc84db10-201a-4c8c-b43f-6a4557ecd98c	13f7f8b4-77e2-4100-b2fe-c35064ead1ea	g.chr2:107423245C>A	ENST00000409382.3	-	6	2089	c.1479G>T	c.(1477-1479)caG>caT	p.Q493H	ST6GAL2_ENST00000361686.4_Missense_Mutation_p.Q493H	NM_001142351.1	NP_001135823.1	Q96JF0	SIAT2_HUMAN	ST6 beta-galactosamide alpha-2,6-sialyltranferase 2	493					growth (GO:0040007)|multicellular organismal development (GO:0007275)|oligosaccharide metabolic process (GO:0009311)|protein glycosylation (GO:0006486)|sialylation (GO:0097503)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	beta-galactoside alpha-2,6-sialyltransferase activity (GO:0003835)			autonomic_ganglia(1)|breast(1)|endometrium(2)|kidney(1)|large_intestine(8)|liver(1)|lung(30)|ovary(5)|pancreas(6)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	65						TGTTCAGGCGCTGCACCAGGA	0.622																																					p.Q493H		.											.	ST6GAL2-191	0			c.G1479T						.						93.0	80.0	84.0					2																	107423245		2203	4300	6503	SO:0001583	missense	84620	exon6			CAGGCGCTGCACC	AB059555	CCDS2073.1, CCDS46380.1	2q11-q12	2008-02-05	2005-02-07	2005-02-07	ENSG00000144057	ENSG00000144057	2.4.99.2		10861	protein-coding gene	gene with protein product		608472	"""sialyltransferase 2 (monosialoganglioside sialyltransferase)"""	SIAT2			Standard	NM_032528		Approved	KIAA1877, St6gal2, St6GalII	uc002tdr.3	Q96JF0	OTTHUMG00000130923	ENST00000409382.3:c.1479G>T	2.37:g.107423245C>A	ENSP00000386942:p.Gln493His	Somatic	120	1		WXS	Illumina GAIIx	Phase_I	159	32	NM_032528	0	0	0	0	0	D3DVK3|Q53QP4|Q86Y44|Q8IUG7|Q96HE4	Missense_Mutation	SNP	ENST00000409382.3	37	CCDS2073.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	20.3|20.3	3.974809|3.974809	0.74360|0.74360	.|.	.|.	ENSG00000144057|ENSG00000144057	ENST00000361803|ENST00000361686;ENST00000409382	.|T;T	.|0.34072	.|1.38;1.38	5.8|5.8	4.0|4.0	0.46444|0.46444	.|.	.|0.053669	.|0.85682	.|D	.|0.000000	T|T	0.45337|0.45337	0.1337|0.1337	M|M	0.69823|0.69823	2.125|2.125	0.80722|0.80722	D|D	1|1	.|P	.|0.42248	.|0.774	.|P	.|0.48873	.|0.593	T|T	0.44498|0.44498	-0.9324|-0.9324	5|10	.|0.54805	.|T	.|0.06	-46.3163|-46.3163	9.0825|9.0825	0.36561|0.36561	0.0:0.7776:0.0:0.2224|0.0:0.7776:0.0:0.2224	.|.	.|493	.|Q96JF0	.|SIAT2_HUMAN	S|H	59|493	.|ENSP00000355273:Q493H;ENSP00000386942:Q493H	.|ENSP00000355273:Q493H	A|Q	-|-	1|3	0|2	ST6GAL2|ST6GAL2	106789677|106789677	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.967000|0.967000	0.64934|0.64934	2.076000|2.076000	0.41548|0.41548	1.453000|1.453000	0.47775|0.47775	0.655000|0.655000	0.94253|0.94253	GCG|CAG	.		0.622	ST6GAL2-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000330065.1	NM_032528	
FAM171B	165215	ucsc.edu	37	2	187559047	187559047	+	Silent	SNP	G	G	A	rs73979342|rs144403657|rs71017336	byFrequency	TCGA-PA-A5YG-01A-11D-A29I-10	TCGA-PA-A5YG-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bc84db10-201a-4c8c-b43f-6a4557ecd98c	13f7f8b4-77e2-4100-b2fe-c35064ead1ea	g.chr2:187559047G>A	ENST00000304698.5	+	1	350	c.147G>A	c.(145-147)caG>caA	p.Q49Q	AC017101.10_ENST00000453665.1_RNA	NM_177454.3	NP_803237.3	Q6P995	F171B_HUMAN	family with sequence similarity 171, member B	49	Gln-rich.					integral component of membrane (GO:0016021)	DNA binding (GO:0003677)			NS(1)|breast(6)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(10)|lung(22)|ovary(6)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	54						agcagcagcagcaacaacaac	0.632																																					p.Q49Q		.											.	FAM171B-141	0			c.G147A						.						23.0	26.0	25.0					2																	187559047		2202	4300	6502	SO:0001819	synonymous_variant	165215	exon1			GCAGCAGCAACAA	AF361495	CCDS33347.1	2q32.2	2008-06-16	2008-06-16	2008-06-16	ENSG00000144369	ENSG00000144369			29412	protein-coding gene	gene with protein product			"""KIAA1946"""	KIAA1946		11853319	Standard	NM_177454		Approved	FLJ34104	uc002ups.3	Q6P995	OTTHUMG00000154278	ENST00000304698.5:c.147G>A	2.37:g.187559047G>A		Somatic	88	0		WXS	Illumina GAIIx	Phase_I	135	16	NM_177454	0	0	18	29	11	Q53SK3|Q8N1Y4|Q8N3K1|Q8N970|Q8NB81|Q8TF55|Q8WYR8	Silent	SNP	ENST00000304698.5	37	CCDS33347.1																																																																																			G|0.500;A|0.500		0.632	FAM171B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000334679.1	NM_177454	
SLC23A2	9962	hgsc.bcm.edu	37	20	4850569	4850569	+	Frame_Shift_Del	DEL	G	G	-			TCGA-PA-A5YG-01A-11D-A29I-10	TCGA-PA-A5YG-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bc84db10-201a-4c8c-b43f-6a4557ecd98c	13f7f8b4-77e2-4100-b2fe-c35064ead1ea	g.chr20:4850569delG	ENST00000379333.1	-	12	1625	c.1233delC	c.(1231-1233)cccfs	p.P411fs	SLC23A2_ENST00000424750.2_Frame_Shift_Del_p.P297fs|SLC23A2_ENST00000338244.1_Frame_Shift_Del_p.P411fs|SNORA31_ENST00000516287.1_RNA|SLC23A2_ENST00000468355.1_5'UTR	NM_203327.1	NP_976072.1	Q9UGH3	S23A2_HUMAN	solute carrier family 23 (ascorbic acid transporter), member 2	411					L-ascorbic acid metabolic process (GO:0019852)|L-ascorbic acid transport (GO:0015882)|molecular hydrogen transport (GO:0015993)|nucleobase transport (GO:0015851)|nucleobase-containing compound metabolic process (GO:0006139)|response to oxidative stress (GO:0006979)|small molecule metabolic process (GO:0044281)|transepithelial L-ascorbic acid transport (GO:0070904)|vitamin metabolic process (GO:0006766)|vitamin transmembrane transport (GO:0035461)|water-soluble vitamin metabolic process (GO:0006767)	apical plasma membrane (GO:0016324)|basal plasma membrane (GO:0009925)|basolateral plasma membrane (GO:0016323)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	L-ascorbate:sodium symporter activity (GO:0008520)|L-ascorbic acid transporter activity (GO:0015229)|nucleobase transmembrane transporter activity (GO:0015205)|sodium-dependent L-ascorbate transmembrane transporter activity (GO:0070890)|sodium-dependent multivitamin transmembrane transporter activity (GO:0008523)	p.I412fs*4(1)		endometrium(1)|kidney(3)|large_intestine(9)|lung(7)|ovary(3)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	27						TTGCGTGGATGGGGGGGGGTG	0.527																																					p.P411fs		.											.	SLC23A2-92	1	Deletion - Frameshift(1)	ovary(1)	c.1233delC						.						65.0	70.0	68.0					20																	4850569		2203	4300	6503	SO:0001589	frameshift_variant	9962	exon12			GTGGATGGGGGGG	AF058319	CCDS13085.1	20p13	2013-07-18	2013-07-18	2003-03-21	ENSG00000089057	ENSG00000089057		"""Solute carriers"""	10973	protein-coding gene	gene with protein product		603791	"""solute carrier family 23 (nucleobase transporters), member 1"""	SLC23A1		9804989, 10331392	Standard	NM_005116		Approved	SVCT2, KIAA0238, YSPL2	uc002wlh.1	Q9UGH3	OTTHUMG00000031793	ENST00000379333.1:c.1233delC	20.37:g.4850569delG	ENSP00000368637:p.Pro411fs	Somatic	183	2		WXS	Illumina GAIIx	Phase_I	405	11	NM_203327	0	0	0	0	0	B4DJZ1|Q8WWR4|Q92512|Q96D54|Q9UNU1|Q9UP85	Frame_Shift_Del	DEL	ENST00000379333.1	37	CCDS13085.1																																																																																			.		0.527	SLC23A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077832.1		
RBM12	10137	ucsc.edu	37	20	34240740	34240740	+	Silent	SNP	A	A	G	rs376657170|rs201181145		TCGA-PA-A5YG-01A-11D-A29I-10	TCGA-PA-A5YG-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bc84db10-201a-4c8c-b43f-6a4557ecd98c	13f7f8b4-77e2-4100-b2fe-c35064ead1ea	g.chr20:34240740A>G	ENST00000374114.3	-	3	2768	c.2505T>C	c.(2503-2505)ccT>ccC	p.P835P	CPNE1_ENST00000397446.1_Intron|CPNE1_ENST00000397443.1_Intron|CPNE1_ENST00000317619.3_Intron|RBM12_ENST00000359646.1_Silent_p.P835P|CPNE1_ENST00000397445.1_Intron|CPNE1_ENST00000397442.1_Intron|CPNE1_ENST00000352393.4_Intron|CPNE1_ENST00000317677.5_Intron|RP1-309K20.6_ENST00000541176.2_Intron|RBM12_ENST00000374104.3_Silent_p.P835P	NM_001198838.1|NM_001198840.1|NM_006047.5	NP_001185767.1|NP_001185769.1|NP_006038.2	Q9NTZ6	RBM12_HUMAN	RNA binding motif protein 12	835	Gly-rich.|Pro-rich.					nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			breast(3)|endometrium(7)|kidney(1)|large_intestine(3)|lung(14)|ovary(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	36	Lung NSC(9;0.00608)|all_lung(11;0.00918)		BRCA - Breast invasive adenocarcinoma(18;0.00953)			GGATTgggccagggccggggc	0.597																																					p.P835P		.											.	RBM12-93	0			c.T2505C						.						20.0	22.0	21.0					20																	34240740		2143	4252	6395	SO:0001819	synonymous_variant	10137	exon2			TGGGCCAGGGCCG	AJ289772	CCDS13261.1	20q11.21	2013-02-12			ENSG00000244462	ENSG00000244462		"""RNA binding motif (RRM) containing"""	9898	protein-coding gene	gene with protein product		607179				11435693	Standard	NM_006047		Approved	HRIHFB2091, KIAA0765, SWAN	uc021wcq.1	Q9NTZ6	OTTHUMG00000032350	ENST00000374114.3:c.2505T>C	20.37:g.34240740A>G		Somatic	23	0		WXS	Illumina GAIIx	Phase_I	41	6	NM_001198840	0	0	27	27	0	B3KRU2|E1P5R6|O94865|Q8N3B1|Q9H196	Silent	SNP	ENST00000374114.3	37	CCDS13261.1																																																																																			.		0.597	RBM12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078894.1	NM_006047	
SMTN	6525	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	22	31495743	31495743	+	Nonsense_Mutation	SNP	C	C	T			TCGA-PA-A5YG-01A-11D-A29I-10	TCGA-PA-A5YG-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bc84db10-201a-4c8c-b43f-6a4557ecd98c	13f7f8b4-77e2-4100-b2fe-c35064ead1ea	g.chr22:31495743C>T	ENST00000347557.2	+	19	2682	c.2464C>T	c.(2464-2466)Cag>Tag	p.Q822*	SMTN_ENST00000333137.7_Nonsense_Mutation_p.Q822*|SMTN_ENST00000358743.1_Nonsense_Mutation_p.Q822*|SMTN_ENST00000404574.1_Nonsense_Mutation_p.Q345*	NM_001207017.1|NM_006932.4	NP_001193946.1|NP_008863.3	P53814	SMTN_HUMAN	smoothelin	822	CH. {ECO:0000255|PROSITE- ProRule:PRU00044}.				muscle organ development (GO:0007517)|smooth muscle contraction (GO:0006939)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)	actin binding (GO:0003779)|structural constituent of muscle (GO:0008307)			breast(2)|endometrium(2)|large_intestine(5)|lung(9)|ovary(3)|pancreas(1)|prostate(3)	25						CGTCGACATCCAGAACTTCTC	0.567																																					p.Q907X		.											.	SMTN-154	0			c.C2719T						.						143.0	104.0	117.0					22																	31495743		2203	4300	6503	SO:0001587	stop_gained	6525	exon20			GACATCCAGAACT	AY061972	CCDS13886.1, CCDS13887.1, CCDS13888.1, CCDS74845.1, CCDS74846.1	22q12	2006-01-27			ENSG00000183963	ENSG00000183963			11126	protein-coding gene	gene with protein product		602127				9244445, 8707825	Standard	NM_006932		Approved		uc011ale.2	P53814	OTTHUMG00000151203	ENST00000347557.2:c.2464C>T	22.37:g.31495743C>T	ENSP00000328635:p.Gln822*	Somatic	118	0		WXS	Illumina GAIIx	Phase_I	150	8	NM_001207017	0	0	1	1	0	O00569|O95769|O95937|Q8N4H8|Q8WWW1|Q8WWW2|Q9P1S8|Q9UIT1|Q9UIT2	Nonsense_Mutation	SNP	ENST00000347557.2	37	CCDS13886.1	.	.	.	.	.	.	.	.	.	.	C	41	9.100588	0.99066	.	.	ENSG00000183963	ENST00000358743;ENST00000347557;ENST00000333137;ENST00000329852;ENST00000404496;ENST00000404574;ENST00000403419	.	.	.	5.17	5.17	0.71159	.	0.000000	0.35936	N	0.002883	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-29.157	19.0644	0.93104	0.0:1.0:0.0:0.0	.	.	.	.	X	822;822;822;820;845;345;202	.	ENSP00000329393:Q820X	Q	+	1	0	SMTN	29825743	1.000000	0.71417	1.000000	0.80357	0.967000	0.64934	4.673000	0.61604	2.600000	0.87896	0.650000	0.86243	CAG	.		0.567	SMTN-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000321766.1	NM_134270	
TMPRSS6	164656	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	22	37462261	37462261	+	Silent	SNP	C	C	T			TCGA-PA-A5YG-01A-11D-A29I-10	TCGA-PA-A5YG-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bc84db10-201a-4c8c-b43f-6a4557ecd98c	13f7f8b4-77e2-4100-b2fe-c35064ead1ea	g.chr22:37462261C>T	ENST00000346753.3	-	18	2411	c.2295G>A	c.(2293-2295)ccG>ccA	p.P765P	TMPRSS6_ENST00000406856.1_Silent_p.P778P|TMPRSS6_ENST00000381792.2_Silent_p.P778P|TMPRSS6_ENST00000406725.1_Silent_p.P756P	NM_153609.2	NP_705837.1	Q8IU80	TMPS6_HUMAN	transmembrane protease, serine 6	765	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.		P -> A (in IRIDA; severely reduced proteolytic processing; loss of activity). {ECO:0000269|PubMed:22581667}.		angiogenesis (GO:0001525)|extracellular matrix organization (GO:0030198)|fibrinolysis (GO:0042730)|intracellular signal transduction (GO:0035556)|iron ion homeostasis (GO:0055072)|proteolysis (GO:0006508)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	serine-type endopeptidase activity (GO:0004252)			breast(5)|central_nervous_system(4)|endometrium(4)|kidney(4)|large_intestine(3)|lung(13)|ovary(1)|prostate(1)|skin(2)|stomach(3)	40						TGCACACCAGCGGACCACCTG	0.617																																					p.P765P		.											.	TMPRSS6-292	0			c.G2295A						.						25.0	25.0	25.0					22																	37462261		2203	4299	6502	SO:0001819	synonymous_variant	164656	exon18			CACCAGCGGACCA	AY055383	CCDS13941.1, CCDS74856.1, CCDS74857.1	22q13.1	2010-04-13			ENSG00000187045	ENSG00000187045		"""Serine peptidases / Transmembrane"""	16517	protein-coding gene	gene with protein product		609862					Standard	NM_001289000		Approved	FLJ30744	uc003aqs.1	Q8IU80	OTTHUMG00000150541	ENST00000346753.3:c.2295G>A	22.37:g.37462261C>T		Somatic	88	0		WXS	Illumina GAIIx	Phase_I	185	47	NM_153609	0	0	0	0	0	B0QYB4|B0QYB7|B0QYB8|Q5TI06|Q6ICC2|Q6UXD8|Q8IUE2|Q8IXV8	Silent	SNP	ENST00000346753.3	37	CCDS13941.1																																																																																			.		0.617	TMPRSS6-003	NOVEL	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000318822.1	NM_153609	
NBEAL2	23218	broad.mit.edu	37	3	47043602	47043602	+	Missense_Mutation	SNP	G	G	A			TCGA-PA-A5YG-01A-11D-A29I-10	TCGA-PA-A5YG-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bc84db10-201a-4c8c-b43f-6a4557ecd98c	13f7f8b4-77e2-4100-b2fe-c35064ead1ea	g.chr3:47043602G>A	ENST00000450053.3	+	31	5154	c.4975G>A	c.(4975-4977)Gag>Aag	p.E1659K	NBEAL2_ENST00000383740.2_5'UTR|NBEAL2_ENST00000292309.5_Missense_Mutation_p.E1475K	NM_015175.2	NP_055990.1	Q6ZNJ1	NBEL2_HUMAN	neurobeachin-like 2	1659					blood coagulation (GO:0007596)|megakaryocyte development (GO:0035855)|platelet alpha granule organization (GO:0070889)|platelet formation (GO:0030220)	endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)				NS(1)|breast(1)|central_nervous_system(3)|cervix(2)|endometrium(8)|kidney(5)|large_intestine(9)|lung(9)|ovary(4)|pancreas(1)|prostate(3)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	51		Acute lymphoblastic leukemia(5;0.0534)		BRCA - Breast invasive adenocarcinoma(193;0.0012)|KIRC - Kidney renal clear cell carcinoma(197;0.00575)|Kidney(197;0.00656)		agcagctgcagAGCGCTGCTC	0.667																																					p.E1659K		.											.	NBEAL2-69	0			c.G4975A						.						4.0	6.0	5.0					3																	47043602		1988	3958	5946	SO:0001583	missense	23218	exon31			GCTGCAGAGCGCT	AB011112	CCDS46817.1	3p21.31	2014-09-17			ENSG00000160796	ENSG00000160796		"""WD repeat domain containing"""	31928	protein-coding gene	gene with protein product		614169					Standard	NM_015175		Approved	KIAA0540	uc003cqp.3	Q6ZNJ1	OTTHUMG00000156497	ENST00000450053.3:c.4975G>A	3.37:g.47043602G>A	ENSP00000415034:p.Glu1659Lys	Somatic	35	0		WXS	Illumina GAIIx	Phase_I	73	3	NM_015175	0	0	4	4	0	O60288|Q6P994|Q6UX91|Q8NAC9	Missense_Mutation	SNP	ENST00000450053.3	37	CCDS46817.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	17.97|17.97	3.519048|3.519048	0.64634|0.64634	.|.	.|.	ENSG00000160796|ENSG00000160796	ENST00000292309;ENST00000450053|ENST00000443829	T;T|.	0.67345|.	-0.15;-0.26|.	4.33|4.33	4.33|4.33	0.51752|0.51752	.|.	0.423781|.	0.24305|.	N|.	0.039684|.	T|T	0.73528|0.73528	0.3598|0.3598	M|M	0.73217|0.73217	2.22|2.22	0.80722|0.80722	D|D	1|1	P;D|.	0.56521|.	0.884;0.976|.	P;P|.	0.59487|.	0.503;0.858|.	T|T	0.74737|0.74737	-0.3564|-0.3564	10|5	0.56958|.	D|.	0.05|.	.|.	15.7432|15.7432	0.77918|0.77918	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	1475;1659|.	Q6ZNJ1-2;Q6ZNJ1|.	.;NBEL2_HUMAN|.	K|K	1475;1659|27	ENSP00000292309:E1475K;ENSP00000415034:E1659K|.	ENSP00000292309:E1475K|.	E|R	+|+	1|2	0|0	NBEAL2|NBEAL2	47018606|47018606	0.995000|0.995000	0.38212|0.38212	0.928000|0.928000	0.36995|0.36995	0.506000|0.506000	0.33950|0.33950	0.075000|0.075000	0.14686|0.14686	2.287000|2.287000	0.76781|0.76781	0.479000|0.479000	0.44913|0.44913	GAG|AGA	.		0.667	NBEAL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344363.3	XM_291064	
PLXND1	23129	bcgsc.ca	37	3	129285429	129285429	+	Missense_Mutation	SNP	G	G	T			TCGA-PA-A5YG-01A-11D-A29I-10	TCGA-PA-A5YG-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bc84db10-201a-4c8c-b43f-6a4557ecd98c	13f7f8b4-77e2-4100-b2fe-c35064ead1ea	g.chr3:129285429G>T	ENST00000324093.4	-	23	4310	c.4132C>A	c.(4132-4134)Ctc>Atc	p.L1378I	PLXND1_ENST00000393239.1_Missense_Mutation_p.L1378I	NM_015103.2	NP_055918	Q9Y4D7	PLXD1_HUMAN	plexin D1	1378					angiogenesis (GO:0001525)|axon guidance (GO:0007411)|dichotomous subdivision of terminal units involved in salivary gland branching (GO:0060666)|endothelial cell migration (GO:0043542)|outflow tract morphogenesis (GO:0003151)|patterning of blood vessels (GO:0001569)|positive regulation of protein binding (GO:0032092)|regulation of angiogenesis (GO:0045765)|regulation of cell migration (GO:0030334)|semaphorin-plexin signaling pathway (GO:0071526)|synapse assembly (GO:0007416)	integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)	protein domain specific binding (GO:0019904)|semaphorin receptor activity (GO:0017154)		PLXND1/TMCC1(4)	NS(1)|breast(1)|endometrium(4)|kidney(5)|large_intestine(17)|lung(28)|prostate(10)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	72						TGGGAGTTGAGGGTCTGGGAG	0.632																																					p.L1378I	Ovarian(97;366 1484 3738 22084 39045)	.											.	PLXND1-90	0			c.C4132A						.						88.0	78.0	81.0					3																	129285429		2203	4300	6503	SO:0001583	missense	23129	exon23			AGTTGAGGGTCTG	AY116661	CCDS33854.1	3q21.3	2007-05-16			ENSG00000004399	ENSG00000004399		"""Plexins"""	9107	protein-coding gene	gene with protein product		604282				12412018	Standard	NM_015103		Approved	KIAA0620	uc003emx.2	Q9Y4D7	OTTHUMG00000159547	ENST00000324093.4:c.4132C>A	3.37:g.129285429G>T	ENSP00000317128:p.Leu1378Ile	Somatic	63	0		WXS	Illumina GAIIx	Phase_I	79	4	NM_015103	0	0	30	30	0	A7E2C6|C9JPZ6|Q6PJS9|Q8IZJ2|Q9BTQ2	Missense_Mutation	SNP	ENST00000324093.4	37	CCDS33854.1	.	.	.	.	.	.	.	.	.	.	G	13.29	2.192262	0.38707	.	.	ENSG00000004399	ENST00000324093;ENST00000393239	T;T	0.35421	1.37;1.31	5.21	4.33	0.51752	Plexin, cytoplasmic RasGAP domain (1);	28.477000	0.00855	N	0.001874	T	0.22742	0.0549	N	0.08118	0	0.36131	D	0.84615	B	0.32010	0.351	B	0.25506	0.061	T	0.17198	-1.0377	10	0.36615	T	0.2	.	9.5532	0.39324	0.1558:0.0:0.8442:0.0	.	1378	Q9Y4D7	PLXD1_HUMAN	I	1378	ENSP00000317128:L1378I;ENSP00000376931:L1378I	ENSP00000317128:L1378I	L	-	1	0	PLXND1	130768119	1.000000	0.71417	0.974000	0.42286	0.830000	0.47004	2.685000	0.46959	2.415000	0.81967	0.563000	0.77884	CTC	.		0.632	PLXND1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356132.4	NM_015103	
MUC4	4585	bcgsc.ca	37	3	195505805	195505805	+	Missense_Mutation	SNP	A	A	C	rs540560059	byFrequency	TCGA-PA-A5YG-01A-11D-A29I-10	TCGA-PA-A5YG-10A-01D-A29L-10	A	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bc84db10-201a-4c8c-b43f-6a4557ecd98c	13f7f8b4-77e2-4100-b2fe-c35064ead1ea	g.chr3:195505805A>C	ENST00000463781.3	-	2	13105	c.12646T>G	c.(12646-12648)Tca>Gca	p.S4216A	MUC4_ENST00000475231.1_Missense_Mutation_p.S4216A|MUC4_ENST00000346145.4_Intron|MUC4_ENST00000349607.4_Intron	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		GTGGATGCTGAGGAAGTGTCG	0.592													.|||	14	0.00279553	0.0015	0.0029	5008	,	,		14788	0.001		0.004	False		,,,				2504	0.0051				p.S4216A		.											.	MUC4-90	0			c.T12646G						.						31.0	26.0	28.0					3																	195505805		692	1581	2273	SO:0001583	missense	4585	exon2			ATGCTGAGGAAGT	AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.12646T>G	3.37:g.195505805A>C	ENSP00000417498:p.Ser4216Ala	Somatic	306	8		WXS	Illumina GAIIx	Phase_I	646	34	NM_018406	0	0	0	0	0	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	ENST00000463781.3	37	CCDS54700.1	.	.	.	.	.	.	.	.	.	.	a	1.575	-0.533159	0.04082	.	.	ENSG00000145113	ENST00000463781;ENST00000475231	T;T	0.29655	1.56;1.58	0.93	-0.342	0.12635	.	.	.	.	.	T	0.12646	0.0307	N	0.19112	0.55	0.09310	N	1	P	0.37985	0.613	B	0.28139	0.086	T	0.15954	-1.0419	8	.	.	.	.	2.8918	0.05678	0.6746:0.0:0.3254:0.0	.	4088	E7ESK3	.	A	4216	ENSP00000417498:S4216A;ENSP00000420243:S4216A	.	S	-	1	0	MUC4	196990584	.	.	0.001000	0.08648	0.002000	0.02628	.	.	-0.091000	0.12440	0.421000	0.28195	TCA	.		0.592	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324081.6	NM_018406	
UGT2B15	7366	bcgsc.ca	37	4	69536084	69536084	+	Missense_Mutation	SNP	A	A	C	rs1902023	byFrequency	TCGA-PA-A5YG-01A-11D-A29I-10	TCGA-PA-A5YG-10A-01D-A29L-10	A	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bc84db10-201a-4c8c-b43f-6a4557ecd98c	13f7f8b4-77e2-4100-b2fe-c35064ead1ea	g.chr4:69536084A>C	ENST00000338206.5	-	1	262	c.253T>G	c.(253-255)Tat>Gat	p.Y85D		NM_001076.3	NP_001067.2	P54855	UDB15_HUMAN	UDP glucuronosyltransferase 2 family, polypeptide B15	85			Y -> D (in dbSNP:rs1902023). {ECO:0000269|PubMed:7835232, ECO:0000269|PubMed:8399210}.		cellular glucuronidation (GO:0052695)|steroid metabolic process (GO:0008202)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	glucuronosyltransferase activity (GO:0015020)									Acetaminophen(DB00316)|Dabigatran etexilate(DB06695)|Ezetimibe(DB00973)|Lorazepam(DB00186)|Morphine(DB00295)|Oxazepam(DB00842)|Valproic Acid(DB00313)	TCTTCCAAATAATTTTTAGTT	0.308													c|||	2737	0.546526	0.6021	0.6052	5008	,	,		19778	0.5774		0.4871	False		,,,				2504	0.4591				p.Y85D		.											.	UGT2B15-46	0			c.T253G	GRCh37	CM004865	UGT2B15	M	rs1902023	.	C	ASP/TYR	2534,1866		729,1076,395	76.0	90.0	86.0	http://www.ncbi.nlm.nih.gov/omim/600069,601903,606497|http://omim.org/entry/606497|http://omim.org/entry/601903|http://omim.org/entry/600069	253	2.6	0.0	4	dbSNP_92	86	3995,4599		937,2121,1239	no	missense	UGT2B15	NM_001076.2	160	1666,3197,1634	CC,CA,AA		46.4859,42.4091,49.7537	benign	85/531	69536084	6529,6465	2200	4297	6497	SO:0001583	missense	7366	exon1			CCAAATAATTTTT	AF180322	CCDS3524.1	4q13	2008-02-05	2005-07-20		ENSG00000196620	ENSG00000196620		"""UDP glucuronosyltransferases"""	12546	protein-coding gene	gene with protein product		600069	"""UDP glycosyltransferase 2 family, polypeptide B15"""			7835904	Standard	NM_001076		Approved	UGT2B8	uc021xow.1	P54855	OTTHUMG00000161507	ENST00000338206.5:c.253T>G	4.37:g.69536084A>C	ENSP00000341045:p.Tyr85Asp	Somatic	294	2		WXS	Illumina GAIIx	Phase_I	289	10	NM_001076	0	0	0	0	0	A6NDX0|A6NNJ4|A8K054|P23765|Q9UK63	Missense_Mutation	SNP	ENST00000338206.5	37	CCDS3524.1	1230	0.5631868131868132	315	0.6402439024390244	221	0.6104972375690608	331	0.5786713286713286	363	0.4788918205804749	N	0.004	-2.341011	0.00222	0.575909	0.464859	ENSG00000196620	ENST00000338206	T	0.55588	0.51	2.58	2.58	0.30949	.	1.156670	0.06579	N	0.750000	T	0.00012	0.0000	N	0.00815	-1.16	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.43734	-0.9373	9	0.11794	T	0.64	.	3.3319	0.07087	0.259:0.5958:0.0:0.1453	.	85	P54855	UDB15_HUMAN	D	85	ENSP00000341045:Y85D	ENSP00000341045:Y85D	Y	-	1	0	UGT2B15	69218679	0.000000	0.05858	0.005000	0.12908	0.073000	0.16967	-1.341000	0.02647	0.401000	0.25424	-0.407000	0.06327	TAT	A|0.468;C|0.532		0.308	UGT2B15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365172.1	NM_001076	
ADH1A	124	ucsc.edu	37	4	100203572	100203572	+	Silent	SNP	C	C	T			TCGA-PA-A5YG-01A-11D-A29I-10	TCGA-PA-A5YG-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bc84db10-201a-4c8c-b43f-6a4557ecd98c	13f7f8b4-77e2-4100-b2fe-c35064ead1ea	g.chr4:100203572C>T	ENST00000209668.2	-	6	872	c.759G>A	c.(757-759)gaG>gaA	p.E253E	RP11-696N14.1_ENST00000506160.1_RNA|RP11-696N14.1_ENST00000500358.2_RNA	NM_000667.3	NP_000658.1	P07327	ADH1A_HUMAN	alcohol dehydrogenase 1A (class I), alpha polypeptide	253					alcohol metabolic process (GO:0006066)|drug metabolic process (GO:0017144)|ethanol oxidation (GO:0006069)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)	alcohol dehydrogenase (NAD) activity (GO:0004022)|alcohol dehydrogenase activity, zinc-dependent (GO:0004024)|zinc ion binding (GO:0008270)			endometrium(2)|kidney(2)|large_intestine(3)|lung(11)|ovary(1)|prostate(1)|skin(4)|stomach(1)	25				OV - Ovarian serous cystadenocarcinoma(123;9.56e-08)	Ethanol(DB00898)|Fomepizole(DB01213)	CCTTTAGCACCTCCTGGATGG	0.463																																					p.E253E		.											.	ADH1A-227	0			c.G759A						.						352.0	350.0	351.0					4																	100203572		2203	4300	6503	SO:0001819	synonymous_variant	124	exon6			TAGCACCTCCTGG	M12963	CCDS3648.1	4q23	2009-12-04			ENSG00000187758	ENSG00000187758	1.1.1.1	"""Alcohol dehydrogenases"""	249	protein-coding gene	gene with protein product		103700		ADH1		3006456	Standard	NM_000667		Approved		uc003hur.2	P07327	OTTHUMG00000131026	ENST00000209668.2:c.759G>A	4.37:g.100203572C>T		Somatic	282	16		WXS	Illumina GAIIx	Phase_I	404	15	NM_000667	1	1	1	1788	1785	A8K3E3|Q17R68	Silent	SNP	ENST00000209668.2	37	CCDS3648.1																																																																																			.		0.463	ADH1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253669.1	NM_000667	
PCDHB3	56132	ucsc.edu	37	5	140482342	140482342	+	Silent	SNP	T	T	C	rs17844403	byFrequency	TCGA-PA-A5YG-01A-11D-A29I-10	TCGA-PA-A5YG-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bc84db10-201a-4c8c-b43f-6a4557ecd98c	13f7f8b4-77e2-4100-b2fe-c35064ead1ea	g.chr5:140482342T>C	ENST00000231130.2	+	1	2109	c.2109T>C	c.(2107-2109)ttT>ttC	p.F703F	AC005754.7_ENST00000607216.1_RNA	NM_018937.2	NP_061760.1	Q9Y5E6	PCDB3_HUMAN	protocadherin beta 3	703					calcium-dependent cell-cell adhesion (GO:0016339)|cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			NS(2)|breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(19)|lung(24)|ovary(1)|pancreas(1)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	72			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			TCTTCCTCTTTTCGGTGCTCC	0.692																																					p.F703F		.											.	PCDHB3-92	0			c.T2109C						.						75.0	77.0	77.0					5																	140482342		2191	4265	6456	SO:0001819	synonymous_variant	56132	exon1			CCTCTTTTCGGTG	AF152496	CCDS4245.1	5q31	2010-01-26			ENSG00000113205	ENSG00000113205		"""Cadherins / Protocadherins : Clustered"""	8688	other	protocadherin		606329				10380929	Standard	NM_018937		Approved	PCDH-BETA3	uc003lio.3	Q9Y5E6	OTTHUMG00000129622	ENST00000231130.2:c.2109T>C	5.37:g.140482342T>C		Somatic	11	0		WXS	Illumina GAIIx	Phase_I	67	9	NM_018937	0	0	10	34	24	B2R8P2	Silent	SNP	ENST00000231130.2	37	CCDS4245.1																																																																																			T|0.997;C|0.003		0.692	PCDHB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251817.2	NM_018937	
PRRC2A	7916	broad.mit.edu	37	6	31597341	31597358	+	In_Frame_Del	DEL	AGCAGCAGCAGCACCAGT	AGCAGCAGCAGCACCAGT	-			TCGA-PA-A5YG-01A-11D-A29I-10	TCGA-PA-A5YG-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bc84db10-201a-4c8c-b43f-6a4557ecd98c	13f7f8b4-77e2-4100-b2fe-c35064ead1ea	g.chr6:31597341_31597358delAGCAGCAGCAGCACCAGT	ENST00000376033.2	+	14	2207_2224	c.1973_1990delAGCAGCAGCAGCACCAGT	c.(1972-1992)cagcagcagcagcaccagtgg>cgg	p.658_664QQQQHQW>R	PRRC2A_ENST00000376007.4_In_Frame_Del_p.658_664QQQQHQW>R	NM_004638.3	NP_004629.3	P48634	PRC2A_HUMAN	proline-rich coiled-coil 2A	658	4 X 57 AA type A repeats.|Poly-Gln.					cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			breast(6)|central_nervous_system(1)|endometrium(7)|kidney(5)|large_intestine(14)|lung(19)|ovary(3)|pancreas(2)|prostate(4)|skin(5)|soft_tissue(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	70						CTCCTGAagcagcagcagcagcaccagtggcagcagca	0.578																																					p.658_664del		.											.	PRRC2A-156	0			c.1973_1990del						.																																			SO:0001651	inframe_deletion	7916	exon14			TGAAGCAGCAGCA	M31293	CCDS4708.1	6p21.3	2010-12-09	2010-12-09	2010-12-09	ENSG00000204469	ENSG00000204469			13918	protein-coding gene	gene with protein product		142580	"""HLA-B associated transcript 2"""	BAT2		2156268, 8499947	Standard	NM_080686		Approved	G2, D6S51E	uc003nvc.4	P48634	OTTHUMG00000031168	ENST00000376033.2:c.1973_1990delAGCAGCAGCAGCACCAGT	6.37:g.31597341_31597358delAGCAGCAGCAGCACCAGT	ENSP00000365201:p.Gln658_Trp664delinsArg	Somatic	4	0		WXS	Illumina GAIIx	Phase_I	6	4	NM_004638	0	0	0	0	0	B0UX77|B0UZE9|B0UZL3|O95875|Q05BK4|Q4LE37|Q5SQ29|Q5SQ30|Q5ST84|Q5STX6|Q5STX7|Q68DW9|Q6P9P7|Q6PIN1|Q8MGQ9|Q96QC6	In_Frame_Del	DEL	ENST00000376033.2	37	CCDS4708.1																																																																																			.		0.578	PRRC2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000259319.1	NM_080686	
LAMA2	3908	bcgsc.ca	37	6	129722453	129722453	+	Missense_Mutation	SNP	C	C	A	rs56173620	byFrequency	TCGA-PA-A5YG-01A-11D-A29I-10	TCGA-PA-A5YG-10A-01D-A29L-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bc84db10-201a-4c8c-b43f-6a4557ecd98c	13f7f8b4-77e2-4100-b2fe-c35064ead1ea	g.chr6:129722453C>A	ENST00000421865.2	+	38	5579	c.5530C>A	c.(5530-5532)Cgt>Agt	p.R1844S		NM_000426.3|NM_001079823.1	NP_000417|NP_001073291.1	P24043	LAMA2_HUMAN	laminin, alpha 2	1844	Domain II and I.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|muscle organ development (GO:0007517)|myelination in peripheral nervous system (GO:0022011)|positive regulation of synaptic transmission, cholinergic (GO:0032224)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of embryonic development (GO:0045995)	basement membrane (GO:0005604)|dendritic spine (GO:0043197)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|laminin-1 complex (GO:0005606)|sarcolemma (GO:0042383)	structural molecule activity (GO:0005198)			NS(2)|biliary_tract(2)|breast(10)|central_nervous_system(1)|endometrium(18)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(35)|lung(84)|ovary(10)|prostate(4)|skin(9)|stomach(1)|upper_aerodigestive_tract(7)|urinary_tract(2)	194				OV - Ovarian serous cystadenocarcinoma(136;0.178)|all cancers(137;0.245)		TGAAGCCAACCGTCTTGCAGA	0.403													C|||	25	0.00499201	0.0	0.0043	5008	,	,		20618	0.0		0.0199	False		,,,				2504	0.002				p.R1844S		.											.	LAMA2-162	0			c.C5530A						.	C	SER/ARG,SER/ARG	18,4388	26.2+/-53.5	0,18,2185	132.0	127.0	129.0		5530,5530	4.4	1.0	6	dbSNP_129	129	147,8453	71.3+/-133.9	4,139,4157	yes	missense,missense	LAMA2	NM_000426.3,NM_001079823.1	110,110	4,157,6342	AA,AC,CC		1.7093,0.4085,1.2686	benign,benign	1844/3123,1844/3119	129722453	165,12841	2203	4300	6503	SO:0001583	missense	3908	exon38			GCCAACCGTCTTG	Z26653	CCDS5138.1	6q22-q23	2014-09-17	2008-08-01		ENSG00000196569	ENSG00000196569		"""Laminins"""	6482	protein-coding gene	gene with protein product	"""merosin"", ""congenital muscular dystrophy"""	156225		LAMM		2185464, 8294519	Standard	NM_000426		Approved		uc003qbn.3	P24043	OTTHUMG00000015545	ENST00000421865.2:c.5530C>A	6.37:g.129722453C>A	ENSP00000400365:p.Arg1844Ser	Somatic	67	0		WXS	Illumina GAIIx	Phase_I	88	4	NM_000426	0	0	0	0	0	Q14736|Q5VUM2|Q93022	Missense_Mutation	SNP	ENST00000421865.2	37	CCDS5138.1	14	0.00641025641025641	0	0.0	1	0.0027624309392265192	0	0.0	13	0.017150395778364115	C	7.208	0.594825	0.13875	0.004085	0.017093	ENSG00000196569	ENST00000358023;ENST00000354729;ENST00000421865	T	0.22134	1.97	5.28	4.4	0.53042	Laminin I (1);	0.586969	0.17927	N	0.157316	T	0.03915	0.0110	N	0.24115	0.695	0.26528	N	0.974306	B;B	0.23442	0.085;0.085	B;B	0.25291	0.059;0.059	T	0.39800	-0.9596	10	0.08837	T	0.75	.	8.7839	0.34809	0.3635:0.442:0.1945:0.0	rs56173620	1844;1844	A6NF00;P24043	.;LAMA2_HUMAN	S	1844	ENSP00000400365:R1844S	ENSP00000346769:R1844S	R	+	1	0	LAMA2	129764146	0.020000	0.18652	0.986000	0.45419	0.833000	0.47200	1.080000	0.30779	1.312000	0.45043	0.655000	0.94253	CGT	C|0.989;A|0.011		0.403	LAMA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042180.1		
POU5F1B	5462	bcgsc.ca	37	8	128428621	128428621	+	Silent	SNP	C	C	A			TCGA-PA-A5YG-01A-11D-A29I-10	TCGA-PA-A5YG-10A-01D-A29L-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bc84db10-201a-4c8c-b43f-6a4557ecd98c	13f7f8b4-77e2-4100-b2fe-c35064ead1ea	g.chr8:128428621C>A	ENST00000465342.2	+	2	1667	c.510C>A	c.(508-510)atC>atA	p.I170I	CASC8_ENST00000523825.1_RNA|CASC8_ENST00000501396.1_RNA|POU5F1B_ENST00000391675.1_Silent_p.I170I|CASC8_ENST00000502082.1_RNA			Q06416	P5F1B_HUMAN	POU class 5 homeobox 1B	170	POU-specific. {ECO:0000255|PROSITE- ProRule:PRU00530}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			lung(1)|prostate(1)|urinary_tract(1)	3						TGGGGCTCATCCTGGGGGTTC	0.522																																					p.I170I		.											.	.	0			c.C510A						.						84.0	88.0	86.0					8																	128428621		692	1591	2283	SO:0001819	synonymous_variant	5462	exon1			GCTCATCCTGGGG	AF268615	CCDS55274.1	8q24.21	2011-06-20	2009-04-15	2009-04-15	ENSG00000212993	ENSG00000212993		"""Homeoboxes / POU class"""	9223	protein-coding gene	gene with protein product		615739	"""POU domain class 5, transcription factor 1 pseudogene 1"", ""POU class 5 homeobox 1 pseudogene 1"""	OTF3P1, POU5F1P1		1408763	Standard	NM_001159542		Approved	OTF3C	uc003ysf.3	Q06416	OTTHUMG00000157807	ENST00000465342.2:c.510C>A	8.37:g.128428621C>A		Somatic	45	0		WXS	Illumina GAIIx	Phase_I	30	4	NM_001159542	0	0	0	0	0	D5K9S4|D5K9S9|D5K9T0|D5K9T1|D5K9T3|D5K9U3|D5K9U6|D5K9V4|D5K9V6|D5K9W0|D5K9W2|D5K9W7|D5K9X2|D5K9X3|D5K9X5|D5K9X8|D5K9X9|E9LRB1|E9LRB2|E9LRH5|E9LRH6|E9LRH7|E9LRK4|E9LRK5|E9LRK7|E9LRK8|E9LRM7|E9LRM9|E9LRN2|E9LRN4|E9LRN5|E9LRP8|E9LRQ0|E9LRQ2|E9LRQ3|E9LRQ4|E9LRQ5|E9LRS3|Q2VIK6|Q9BZV7|Q9BZV9	Silent	SNP	ENST00000465342.2	37	CCDS55274.1																																																																																			.		0.522	POU5F1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349649.2	NM_001159542	
GNAQ	2776	broad.mit.edu	37	9	80646047	80646047	+	Silent	SNP	G	G	A			TCGA-PA-A5YG-01A-11D-A29I-10	TCGA-PA-A5YG-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bc84db10-201a-4c8c-b43f-6a4557ecd98c	13f7f8b4-77e2-4100-b2fe-c35064ead1ea	g.chr9:80646047G>A	ENST00000286548.4	-	1	327	c.105C>T	c.(103-105)gaC>gaT	p.D35D		NM_002072.3	NP_002063.2	P50148	GNAQ_HUMAN	guanine nucleotide binding protein (G protein), q polypeptide	35					action potential (GO:0001508)|activation of phospholipase C activity (GO:0007202)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|blood coagulation (GO:0007596)|developmental pigmentation (GO:0048066)|embryonic digit morphogenesis (GO:0042733)|forebrain neuron development (GO:0021884)|glutamate receptor signaling pathway (GO:0007215)|heart development (GO:0007507)|maternal behavior (GO:0042711)|negative regulation of protein kinase activity (GO:0006469)|neuron remodeling (GO:0016322)|phospholipase C-activating dopamine receptor signaling pathway (GO:0060158)|platelet activation (GO:0030168)|positive regulation of GTPase activity (GO:0043547)|post-embryonic development (GO:0009791)|protein stabilization (GO:0050821)|regulation of catenin import into nucleus (GO:0035412)|regulation of melanocyte differentiation (GO:0045634)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|heterotrimeric G-protein complex (GO:0005834)|lysosomal membrane (GO:0005765)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	G-protein beta/gamma-subunit complex binding (GO:0031683)|GTP binding (GO:0005525)|GTPase activator activity (GO:0005096)|GTPase activity (GO:0003924)|metal ion binding (GO:0046872)|signal transducer activity (GO:0004871)|type 2A serotonin receptor binding (GO:0031826)			NS(1)|endometrium(3)|eye(229)|kidney(1)|large_intestine(4)|lung(6)|meninges(11)|ovary(1)|prostate(1)|skin(44)|upper_aerodigestive_tract(1)	302						CCCGGCGGGCGTCCCGCTTGT	0.716			Mis		uveal melanoma																																p.D35D		.		Dom	yes		9	9q21	2776	"""guanine nucleotide binding protein (G protein), q polypeptide"""		E	.	GNAQ-3808	0			c.C105T						.						10.0	11.0	11.0					9																	80646047		2164	4251	6415	SO:0001819	synonymous_variant	2776	exon1			GCGGGCGTCCCGC		CCDS6658.1	9q21	2010-03-17			ENSG00000156052	ENSG00000156052			4390	protein-coding gene	gene with protein product		600998				8825633	Standard	NM_002072		Approved	G-ALPHA-q, GAQ	uc004akw.3	P50148	OTTHUMG00000020059	ENST00000286548.4:c.105C>T	9.37:g.80646047G>A		Somatic	18	0		WXS	Illumina GAIIx	Phase_I	100	10	NM_002072	0	0	4	4	0	O15108|Q13462|Q6NT27|Q92471|Q9BZB9	Silent	SNP	ENST00000286548.4	37	CCDS6658.1																																																																																			.		0.716	GNAQ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052761.1	NM_002072	
COL15A1	1306	ucsc.edu	37	9	101748114	101748114	+	Missense_Mutation	SNP	G	G	A			TCGA-PA-A5YG-01A-11D-A29I-10	TCGA-PA-A5YG-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bc84db10-201a-4c8c-b43f-6a4557ecd98c	13f7f8b4-77e2-4100-b2fe-c35064ead1ea	g.chr9:101748114G>A	ENST00000375001.3	+	3	791	c.368G>A	c.(367-369)cGg>cAg	p.R123Q		NM_001855.3	NP_001846.3	P39059	COFA1_HUMAN	collagen, type XV, alpha 1	123	Laminin G-like.				angiogenesis (GO:0001525)|cell adhesion (GO:0007155)|cell differentiation (GO:0030154)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|signal transduction (GO:0007165)	collagen type XV trimer (GO:0005582)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	extracellular matrix structural constituent (GO:0005201)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(20)|liver(1)|lung(42)|ovary(6)|prostate(5)|skin(6)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	107		Acute lymphoblastic leukemia(62;0.0562)				CTGGGCCTGCGGCTCTCAGGT	0.632																																					p.R123Q		.											.	COL15A1-96	0			c.G368A						.						72.0	70.0	71.0					9																	101748114		2203	4300	6503	SO:0001583	missense	1306	exon3			GCCTGCGGCTCTC	L25286	CCDS35081.1	9q21-q22	2013-01-16			ENSG00000204291	ENSG00000204291		"""Proteoglycans / Extracellular Matrix : Collagen proteoglycans"", ""Collagens"""	2192	protein-coding gene	gene with protein product	"""collagen type XV proteoglycan"""	120325				1427836	Standard	NM_001855		Approved		uc004azb.2	P39059	OTTHUMG00000020351	ENST00000375001.3:c.368G>A	9.37:g.101748114G>A	ENSP00000364140:p.Arg123Gln	Somatic	113	0		WXS	Illumina GAIIx	Phase_I	140	2	NM_001855	0	0	34	64	30	Q5T6J4|Q9UDC5|Q9Y4W4	Missense_Mutation	SNP	ENST00000375001.3	37	CCDS35081.1	.	.	.	.	.	.	.	.	.	.	G	13.60	2.284260	0.40394	.	.	ENSG00000204291	ENST00000375001;ENST00000536083	T	0.73469	-0.75	5.25	4.35	0.52113	Concanavalin A-like lectin/glucanase (1);Laminin G domain (1);Laminin G, thrombospondin-type, N-terminal (1);	0.339351	0.30649	N	0.009161	T	0.59756	0.2217	L	0.52364	1.645	0.33484	D	0.58789	B;P	0.37122	0.175;0.583	B;B	0.31614	0.027;0.133	T	0.62872	-0.6762	10	0.08381	T	0.77	-10.2132	8.3769	0.32449	0.179:0.0:0.821:0.0	.	123;93	P39059;B3KTP7	COFA1_HUMAN;.	Q	123;93	ENSP00000364140:R123Q	ENSP00000364140:R123Q	R	+	2	0	COL15A1	100787935	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	2.239000	0.43079	1.343000	0.45638	0.650000	0.86243	CGG	.		0.632	COL15A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053386.3	NM_001855	
KIAA0368	23392	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	9	114195628	114195628	+	Missense_Mutation	SNP	T	T	C			TCGA-PA-A5YG-01A-11D-A29I-10	TCGA-PA-A5YG-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bc84db10-201a-4c8c-b43f-6a4557ecd98c	13f7f8b4-77e2-4100-b2fe-c35064ead1ea	g.chr9:114195628T>C	ENST00000338205.5	-	7	952	c.733A>G	c.(733-735)Ata>Gta	p.I245V	KIAA0368_ENST00000259335.4_Missense_Mutation_p.I423V			Q5VYK3	ECM29_HUMAN	KIAA0368	251					ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)	centrosome (GO:0005813)|cytoplasmic membrane-bounded vesicle (GO:0016023)|early endosome (GO:0005769)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|ER to Golgi transport vesicle (GO:0030134)|late endosome (GO:0005770)|membrane (GO:0016020)|multivesicular body (GO:0005771)|nucleus (GO:0005634)|proteasome complex (GO:0000502)				NS(2)|breast(3)|cervix(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(14)|lung(23)|prostate(3)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	65						TCAGCTTCTATGAATTTCACG	0.463																																					p.I423V		.											.	KIAA0368-68	0			c.A1267G						.						94.0	89.0	90.0					9																	114195628		1929	4128	6057	SO:0001583	missense	23392	exon9			CTTCTATGAATTT	AK025689	CCDS48006.1	9q32	2012-11-29	2006-11-23	2006-11-23	ENSG00000136813	ENSG00000136813			29020	protein-coding gene	gene with protein product	"""ECM29 homolog (S. cerevisiae)"""					9205841, 15496406, 20682791	Standard	NM_001080398		Approved	FLJ22036, ECM29	uc004bfe.1	Q5VYK3	OTTHUMG00000020489	ENST00000338205.5:c.733A>G	9.37:g.114195628T>C	ENSP00000339889:p.Ile245Val	Somatic	120	0		WXS	Illumina GAIIx	Phase_I	152	8	NM_001080398	0	0	14	14	0	O15074|Q8WU82	Missense_Mutation	SNP	ENST00000338205.5	37		.	.	.	.	.	.	.	.	.	.	T	15.95	2.984508	0.53934	.	.	ENSG00000136813	ENST00000338205;ENST00000259335	T	0.44083	0.93	5.95	4.78	0.61160	Armadillo-type fold (1);	0.043412	0.85682	D	0.000000	T	0.32041	0.0816	L	0.39020	1.185	0.80722	D	1	B	0.18968	0.032	B	0.23018	0.043	T	0.08700	-1.0709	10	0.37606	T	0.19	.	8.4058	0.32614	0.1311:0.0:0.1374:0.7314	.	251	Q5VYK3	ECM29_HUMAN	V	245;423	ENSP00000259335:I423V	ENSP00000259335:I423V	I	-	1	0	KIAA0368	113235449	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	5.842000	0.69417	1.031000	0.39867	0.460000	0.39030	ATA	.		0.463	KIAA0368-001	NOVEL	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000053637.2	NM_014686	
TNMD	64102	broad.mit.edu	37	X	99854070	99854070	+	Frame_Shift_Del	DEL	A	A	-			TCGA-PA-A5YG-01A-11D-A29I-10	TCGA-PA-A5YG-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bc84db10-201a-4c8c-b43f-6a4557ecd98c	13f7f8b4-77e2-4100-b2fe-c35064ead1ea	g.chrX:99854070delA	ENST00000373031.4	+	6	852	c.635delA	c.(634-636)gaafs	p.E212fs		NM_022144.2	NP_071427.2	Q9H2S6	TNMD_HUMAN	tenomodulin	212					cellular response to BMP stimulus (GO:0071773)|endothelial cell morphogenesis (GO:0001886)|negative regulation of angiogenesis (GO:0016525)|negative regulation of endothelial cell proliferation (GO:0001937)|tendon cell differentiation (GO:0035990)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)				NS(1)|breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(4)|lung(7)|skin(1)	16						CCTGCCAACGAAAAAAAAGGG	0.418																																					p.E212fs		.											.	TNMD-130	0			c.635delA						.						73.0	60.0	64.0					X																	99854070		2203	4300	6503	SO:0001589	frameshift_variant	64102	exon6			CCAACGAAAAAAA	AF191770	CCDS14469.1	Xq21.33-q23	2012-10-10			ENSG00000000005	ENSG00000000005		"""BRICHOS domain containing"""	17757	protein-coding gene	gene with protein product	"""BRICHOS domain containing 4"""	300459					Standard	NM_022144		Approved	myodulin, ChM1L, tendin, TEM, BRICD4	uc004efy.4	Q9H2S6	OTTHUMG00000022001	ENST00000373031.4:c.635delA	X.37:g.99854070delA	ENSP00000362122:p.Glu212fs	Somatic	226	0		WXS	Illumina GAIIx	Phase_I	458	7	NM_022144	0	0	0	0	0	Q9HBX0|Q9UJG0	Frame_Shift_Del	DEL	ENST00000373031.4	37	CCDS14469.1																																																																																			.		0.418	TNMD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057481.1	NM_022144	
CAPN6	827	bcgsc.ca	37	X	110494841	110494841	+	Missense_Mutation	SNP	C	C	G	rs12013711	byFrequency	TCGA-PA-A5YG-01A-11D-A29I-10	TCGA-PA-A5YG-10A-01D-A29L-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bc84db10-201a-4c8c-b43f-6a4557ecd98c	13f7f8b4-77e2-4100-b2fe-c35064ead1ea	g.chrX:110494841C>G	ENST00000324068.1	-	6	996	c.829G>C	c.(829-831)Gtg>Ctg	p.V277L	CAPN6_ENST00000541758.1_Missense_Mutation_p.V22L	NM_014289.3	NP_055104.2	Q9Y6Q1	CAN6_HUMAN	calpain 6	277	Calpain catalytic. {ECO:0000255|PROSITE- ProRule:PRU00239}.		V -> L (in dbSNP:rs12013711). {ECO:0000269|Ref.4}.		microtubule bundle formation (GO:0001578)|proteolysis (GO:0006508)|regulation of cytoskeleton organization (GO:0051493)	perinuclear region of cytoplasm (GO:0048471)|spindle microtubule (GO:0005876)	calcium-dependent cysteine-type endopeptidase activity (GO:0004198)|microtubule binding (GO:0008017)			cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(25)|ovary(3)|skin(3)|upper_aerodigestive_tract(1)	47						ACCATATACACCTTCTCAGCA	0.478													G|||	740	0.196026	0.5083	0.0605	3775	,	,		14134	0.002		0.0239	False		,,,				2504	0.0				p.V277L		.											.	CAPN6-195	0			c.G829C						.	G	LEU/VAL	2345,1490		605,789,346,238,225	253.0	254.0	254.0		829	5.3	1.0	X	dbSNP_120	254	211,6517		4,155,48,2269,1824	yes	missense	CAPN6	NM_014289.3	32	609,944,394,2507,2049	GG,GC,G,CC,C		3.1361,38.8527,24.1977	benign	277/642	110494841	2556,8007	2203	4300	6503	SO:0001583	missense	827	exon6			TATACACCTTCTC	AF029232	CCDS14555.1	Xq23	2008-07-29			ENSG00000077274	ENSG00000077274			1483	protein-coding gene	gene with protein product		300146				9503024, 9339374	Standard	NM_014289		Approved	CAPNX, CalpM, CANPX	uc004epc.2	Q9Y6Q1	OTTHUMG00000022203	ENST00000324068.1:c.829G>C	X.37:g.110494841C>G	ENSP00000317214:p.Val277Leu	Somatic	154	0		WXS	Illumina GAIIx	Phase_I	288	8	NM_014289	0	0	0	0	0	D3DUY7|Q9UEQ1|Q9UJA8	Missense_Mutation	SNP	ENST00000324068.1	37	CCDS14555.1	288	0.1735985533453888	171	0.5181818181818182	16	0.04519774011299435	0	0.0	12	0.016	G	4.454	0.084028	0.08583	0.611473	0.031361	ENSG00000077274	ENST00000324068;ENST00000541758	T;T	0.41758	0.99;2.39	6.17	5.31	0.75309	Peptidase C2, calpain, catalytic domain (3);	0.137951	0.49916	N	0.000139	T	0.00012	0.0000	N	0.04768	-0.165	0.58432	P	9.000000000036756E-6	B	0.02656	0.0	B	0.04013	0.001	T	0.43376	-0.9395	9	0.02654	T	1	.	11.5044	0.50456	0.0682:0.1227:0.8091:0.0	rs12013711;rs17880204;rs52812550;rs56633453;rs60491464;rs12013711	277	Q9Y6Q1	CAN6_HUMAN	L	277;22	ENSP00000317214:V277L;ENSP00000441736:V22L	ENSP00000317214:V277L	V	-	1	0	CAPN6	110381497	1.000000	0.71417	0.998000	0.56505	0.978000	0.69477	2.455000	0.44988	0.729000	0.32403	-0.170000	0.13304	GTG	C|0.723;0|0.021		0.478	CAPN6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057922.1		
PGRMC1	10857	broad.mit.edu	37	X	118370384	118370384	+	Missense_Mutation	SNP	G	G	T			TCGA-PA-A5YG-01A-11D-A29I-10	TCGA-PA-A5YG-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bc84db10-201a-4c8c-b43f-6a4557ecd98c	13f7f8b4-77e2-4100-b2fe-c35064ead1ea	g.chrX:118370384G>T	ENST00000217971.7	+	1	169	c.58G>T	c.(58-60)Ggg>Tgg	p.G20W	PGRMC1_ENST00000535419.1_Missense_Mutation_p.G20W	NM_006667.3	NP_006658.1	O00264	PGRC1_HUMAN	progesterone receptor membrane component 1	20					axon guidance (GO:0007411)	endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleolus (GO:0005730)	heme binding (GO:0020037)|steroid binding (GO:0005496)			lung(6)	6					Dextromethorphan(DB00514)|Nortriptyline(DB00540)	GGAGAGCGGCGGGCTGCTGCA	0.647																																					p.G20W		.											.	PGRMC1-130	0			c.G58T						.						33.0	28.0	29.0					X																	118370384		2195	4289	6484	SO:0001583	missense	10857	exon1			AGCGGCGGGCTGC		CCDS14576.1, CCDS65313.1	Xq22-q24	2005-11-29			ENSG00000101856	ENSG00000101856			16090	protein-coding gene	gene with protein product		300435				9705155	Standard	NM_006667		Approved	HPR6.6	uc004erb.3	O00264	OTTHUMG00000022268	ENST00000217971.7:c.58G>T	X.37:g.118370384G>T	ENSP00000217971:p.Gly20Trp	Somatic	29	0		WXS	Illumina GAIIx	Phase_I	139	5	NM_006667	0	0	43	43	0	B7Z1L3|Q9UGJ9	Missense_Mutation	SNP	ENST00000217971.7	37	CCDS14576.1	.	.	.	.	.	.	.	.	.	.	.	21.2	4.117980	0.77323	.	.	ENSG00000101856	ENST00000217971;ENST00000535419	T;T	0.79352	-1.2;-1.26	4.04	4.04	0.47022	.	0.058689	0.64402	D	0.000002	D	0.85173	0.5636	L	0.57536	1.79	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.996	D	0.87043	0.2142	10	0.87932	D	0	0.0329	14.2902	0.66273	0.0:0.0:1.0:0.0	.	20;20	B7Z1L3;O00264	.;PGRC1_HUMAN	W	20	ENSP00000217971:G20W;ENSP00000442821:G20W	ENSP00000217971:G20W	G	+	1	0	PGRMC1	118254412	1.000000	0.71417	0.997000	0.53966	0.635000	0.38103	6.221000	0.72243	2.000000	0.58554	0.418000	0.28097	GGG	.		0.647	PGRMC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058024.1	NM_006667	
KRTAP9-1	728318	hgsc.bcm.edu	37	17	39346616	39346617	+	In_Frame_Ins	INS	-	-	AGCCTAGCTGTGGGTCCAGCTGCTGCC			TCGA-PA-A5YG-01A-11D-A29I-10	TCGA-PA-A5YG-10A-01D-A29L-10	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bc84db10-201a-4c8c-b43f-6a4557ecd98c	13f7f8b4-77e2-4100-b2fe-c35064ead1ea	g.chr17:39346616_39346617insAGCCTAGCTGTGGGTCCAGCTGCTGCC	ENST00000398470.1	+	1	478_479	c.478_479insAGCCTAGCTGTGGGTCCAGCTGCTGCC	c.(478-480)cag>cAGCCTAGCTGTGGGTCCAGCTGCTGCCag	p.160_160Q>QPSCGSSCCQ	KRTAP9-1_ENST00000318329.5_In_Frame_Ins_p.77_77Q>QPSCGSSCCQ|KRTAP9-1_ENST00000377723.3_Intron	NM_001190460.1	NP_001177389.1	A8MXZ3	KRA91_HUMAN	keratin associated protein 9-1	160	30 X 5 AA repeats of C-C-[CGSVRQH]- [SQTNP]-[PTSI].					keratin filament (GO:0045095)				breast(1)|lung(3)	4						CAGCTGCTGCCAGCCTTGCTGC	0.599																																					p.Q160delinsQPSCGSSCCQ		.											.	.	0			c.478_479insAGCCTAGCTGTGGGTCCAGCTGCTGCC						.																																			SO:0001652	inframe_insertion	728318	exon1			TGCTGCCAGCCTT	AC006070	CCDS56029.1	17q21.2	2010-06-03			ENSG00000240542	ENSG00000240542		"""Keratin associated proteins"""	18912	protein-coding gene	gene with protein product			"""keratin associated protein 9-like 3"""	KRTAP9L3			Standard	NM_001190460		Approved	KAP9.1	uc021txf.1	A8MXZ3	OTTHUMG00000133636	Exception_encountered	17.37:g.39346616_39346617insAGCCTAGCTGTGGGTCCAGCTGCTGCC	Exception_encountered	Somatic	106	0		WXS	Illumina GAIIx	Phase_I	227	0	NM_001190460	0	0	0	0	0		In_Frame_Ins	INS	ENST00000398470.1	37	CCDS56029.1																																																																																			.		0.599	KRTAP9-1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000257781.1		
