#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_TTotCov	i_TVarCov	i_Transcript_Id	i_Trna_alt1	i_Trna_alt2	i_Trna_ref	i_Trna_tot	i_Trna_var	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
HES3	390992	hgsc.bcm.edu	37	1	6305303	6305303	+	Silent	SNP	C	C	A	rs61760837	byFrequency	TCGA-PK-A5H9-01A-11D-A29I-10	TCGA-PK-A5H9-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	cb1f20fc-0df5-42f5-91b8-624bee1a532a	4fa707a6-752b-4fda-9bc0-b07c80cf65c1	g.chr1:6305303C>A	ENST00000377898.3	+	4	362	c.297C>A	c.(295-297)gcC>gcA	p.A99A		NM_001024598.3	NP_001019769.1	Q5TGS1	HES3_HUMAN	hes family bHLH transcription factor 3	99	Orange.				hindbrain morphogenesis (GO:0021575)|in utero embryonic development (GO:0001701)|midbrain development (GO:0030901)|midbrain-hindbrain boundary morphogenesis (GO:0021555)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|oculomotor nerve development (GO:0021557)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of timing of neuron differentiation (GO:0060164)|transcription, DNA-templated (GO:0006351)|trochlear nerve development (GO:0021558)	nucleus (GO:0005634)	DNA binding (GO:0003677)|transcription factor binding (GO:0008134)			lung(2)|skin(1)	3	Ovarian(185;0.0634)	all_cancers(23;2.48e-32)|all_epithelial(116;1.14e-17)|all_lung(118;2.85e-06)|all_neural(13;3.68e-06)|all_hematologic(16;2.39e-05)|Lung NSC(185;3.77e-05)|Acute lymphoblastic leukemia(12;0.000372)|Glioma(11;0.00127)|Renal(390;0.00188)|Colorectal(325;0.00342)|Breast(487;0.00475)|Hepatocellular(190;0.0218)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.15)		Epithelial(90;1.2e-37)|GBM - Glioblastoma multiforme(13;3.2e-29)|OV - Ovarian serous cystadenocarcinoma(86;2.52e-19)|Colorectal(212;1.19e-07)|COAD - Colon adenocarcinoma(227;1.3e-05)|Kidney(185;4.88e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.000871)|BRCA - Breast invasive adenocarcinoma(365;0.00105)|STAD - Stomach adenocarcinoma(132;0.00308)|READ - Rectum adenocarcinoma(331;0.0642)|Lung(427;0.241)		CCGAGAGCGCCGCCGGCAGCA	0.771													C|||	2792	0.557508	0.3079	0.7536	5008	,	,		7640	0.5615		0.6839	False		,,,				2504	0.6217				p.A99A		.											.	HES3-514	0			c.C297A						.	C		1446,1378		419,608,385	2.0	3.0	2.0		297	0.2	0.0	1	dbSNP_129	2	4876,1552		1960,956,298	no	coding-synonymous	HES3	NM_001024598.3		2379,1564,683	AA,AC,CC		24.1444,48.796,31.6688		99/187	6305303	6322,2930	1412	3214	4626	SO:0001819	synonymous_variant	390992	exon4			GAGCGCCGCCGGC		CCDS41238.1	1p36.31	2013-10-17	2013-10-17		ENSG00000173673	ENSG00000173673		"""Basic helix-loop-helix proteins"""	26226	protein-coding gene	gene with protein product		609971	"""hairy and enhancer of split 3 (Drosophila)"""				Standard	NM_001024598		Approved	bHLHb43	uc009vly.2	Q5TGS1	OTTHUMG00000001271	ENST00000377898.3:c.297C>A	1.37:g.6305303C>A		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	4	4	NM_001024598	0	0	0	0	0	Q5TGS0	Silent	SNP	ENST00000377898.3	37	CCDS41238.1																																																																																			C|0.438;A|0.562		0.771	HES3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000003716.3	NM_001024598	
CTNNBIP1	56998	broad.mit.edu	37	1	9910794	9910794	+	Silent	SNP	C	C	T			TCGA-PK-A5H9-01A-11D-A29I-10	TCGA-PK-A5H9-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	cb1f20fc-0df5-42f5-91b8-624bee1a532a	4fa707a6-752b-4fda-9bc0-b07c80cf65c1	g.chr1:9910794C>T	ENST00000377263.1	-	6	539	c.228G>A	c.(226-228)acG>acA	p.T76T	CTNNBIP1_ENST00000377256.1_Silent_p.T76T|CTNNBIP1_ENST00000537447.1_Silent_p.T76T|CTNNBIP1_ENST00000400904.3_Silent_p.T76T|RP11-84A14.5_ENST00000454104.1_RNA|CTNNBIP1_ENST00000377258.1_Silent_p.T76T	NM_001012329.1|NM_020248.2	NP_001012329.1|NP_064633.1	Q9NSA3	CNBP1_HUMAN	catenin, beta interacting protein 1	76					anterior/posterior pattern specification (GO:0009952)|branching involved in ureteric bud morphogenesis (GO:0001658)|negative regulation of DNA binding (GO:0043392)|negative regulation of mesenchymal cell proliferation (GO:0072201)|negative regulation of protein binding (GO:0032091)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of smooth muscle cell proliferation (GO:0048662)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription initiation from RNA polymerase II promoter (GO:0060633)|negative regulation of Wnt signaling pathway (GO:0030178)|positive regulation of monocyte differentiation (GO:0045657)|positive regulation of osteoblast differentiation (GO:0045669)|regulation of vascular permeability involved in acute inflammatory response (GO:0002528)|Wnt signaling pathway (GO:0016055)	beta-catenin destruction complex (GO:0030877)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	armadillo repeat domain binding (GO:0070016)|beta-catenin binding (GO:0008013)			cervix(1)|large_intestine(1)|lung(1)	3		all_lung(284;1.82e-05)|Lung NSC(185;3.08e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Hepatocellular(190;0.00825)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.023)|Colorectal(212;7.32e-08)|COAD - Colon adenocarcinoma(227;1.73e-05)|Kidney(185;4.89e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000912)|KIRC - Kidney renal clear cell carcinoma(229;0.00112)|STAD - Stomach adenocarcinoma(132;0.00644)|READ - Rectum adenocarcinoma(331;0.0419)		TCCGGTCTTCCGTCTCCGACC	0.602																																					p.T76T		.											.	CTNNBIP1-226	0			c.G228A						.						139.0	126.0	130.0					1																	9910794		2203	4300	6503	SO:0001819	synonymous_variant	56998	exon5			GTCTTCCGTCTCC	AB021262	CCDS106.1	1p36.22	2013-09-19	2001-11-29		ENSG00000178585	ENSG00000178585			16913	protein-coding gene	gene with protein product	"""beta-catenin-interacting protein ICAT"", ""inhibitor of beta-catenin and Tcf-4"""	607758	"""catenin, beta-interacting protein 1"""			10898789	Standard	XM_006710779		Approved	ICAT, MGC15093	uc001aql.1	Q9NSA3	OTTHUMG00000001796	ENST00000377263.1:c.228G>A	1.37:g.9910794C>T		Somatic	232	1		WXS	Illumina GAIIx	Phase_I	235	6	NM_001012329	0	0	18	18	0	Q5T4V2	Silent	SNP	ENST00000377263.1	37	CCDS106.1																																																																																			.		0.602	CTNNBIP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000005012.1	NM_020248	
PGD	5226	bcgsc.ca	37	1	10460485	10460485	+	Silent	SNP	T	T	C	rs1049887	byFrequency	TCGA-PK-A5H9-01A-11D-A29I-10	TCGA-PK-A5H9-10A-01D-A29L-10	T	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	cb1f20fc-0df5-42f5-91b8-624bee1a532a	4fa707a6-752b-4fda-9bc0-b07c80cf65c1	g.chr1:10460485T>C	ENST00000270776.8	+	3	158	c.120T>C	c.(118-120)gaT>gaC	p.D40D	PGD_ENST00000538557.1_Silent_p.D27D|PGD_ENST00000541529.1_Silent_p.D40D	NM_002631.2	NP_002622.2	P52209	6PGD_HUMAN	phosphogluconate dehydrogenase	40					carbohydrate metabolic process (GO:0005975)|D-gluconate metabolic process (GO:0019521)|oxidation-reduction process (GO:0055114)|pentose biosynthetic process (GO:0019322)|pentose-phosphate shunt (GO:0006098)|pentose-phosphate shunt, oxidative branch (GO:0009051)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	NADP binding (GO:0050661)|phosphogluconate dehydrogenase (decarboxylating) activity (GO:0004616)	p.D40D(1)		NS(1)|breast(1)|cervix(1)|kidney(1)|large_intestine(1)|lung(3)|ovary(1)|skin(1)|stomach(3)|upper_aerodigestive_tract(1)	14	Ovarian(185;0.203)	all_lung(284;1.31e-05)|Lung NSC(185;2.19e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Hepatocellular(190;0.00913)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;3.14e-07)|COAD - Colon adenocarcinoma(227;7.11e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000294)|Kidney(185;0.000728)|KIRC - Kidney renal clear cell carcinoma(229;0.00258)|STAD - Stomach adenocarcinoma(132;0.00832)|READ - Rectum adenocarcinoma(331;0.0487)	Dacarbazine(DB00851)|Furosemide(DB00695)|Gadopentetate dimeglumine(DB00789)|Ketotifen(DB00920)|Meloxicam(DB00814)|Methotrexate(DB00563)|Ritodrine(DB00867)	CCAAAGTTGATGATTTCTTGG	0.502													T|||	1171	0.233826	0.0658	0.3199	5008	,	,		19744	0.2817		0.3111	False		,,,				2504	0.271				p.D40D		.											.	PGD-91	1	Substitution - coding silent(1)	stomach(1)	c.T120C						.	T		430,3976	206.5+/-228.1	33,364,1806	119.0	111.0	114.0		120	1.4	0.9	1	dbSNP_86	114	2603,5997	421.0+/-353.6	419,1765,2116	no	coding-synonymous	PGD	NM_002631.2		452,2129,3922	CC,CT,TT		30.2674,9.7594,23.32		40/484	10460485	3033,9973	2203	4300	6503	SO:0001819	synonymous_variant	5226	exon3			AGTTGATGATTTC	BC000368	CCDS113.1	1p36.22	2012-10-02			ENSG00000142657	ENSG00000142657	1.1.1.43		8891	protein-coding gene	gene with protein product		172200					Standard	NM_002631		Approved		uc001arc.3	P52209	OTTHUMG00000001905	ENST00000270776.8:c.120T>C	1.37:g.10460485T>C		Somatic	115	0		WXS	Illumina GAIIx	Phase_I	140	6	NM_002631	0	0	51	51	0	A8K2Y9|B4DQJ8|Q9BWD8	Silent	SNP	ENST00000270776.8	37	CCDS113.1	577	0.2641941391941392	42	0.08536585365853659	126	0.34806629834254144	172	0.3006993006993007	237	0.31266490765171506	T	10.62	1.401045	0.25291	0.097594	0.302674	ENSG00000142657	ENST00000543846	.	.	.	5.18	1.38	0.22167	.	.	.	.	.	T	0.00012	0.0000	.	.	.	0.09310	P	0.9999999999999991	.	.	.	.	.	.	T	0.31308	-0.9948	4	0.87932	D	0	-24.6496	5.1933	0.15223	0.0:0.2189:0.1402:0.641	rs1049887;rs2070193;rs2229686;rs3190072;rs11547607;rs12754332	.	.	.	T	18	.	ENSP00000438783:M18T	M	+	2	0	PGD	10383072	0.999000	0.42202	0.913000	0.36048	0.993000	0.82548	0.528000	0.23002	0.038000	0.15604	0.533000	0.62120	ATG	T|0.754;C|0.246		0.502	PGD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000005398.1	NM_002631	
PRAMEF11	440560	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	12884876	12884876	+	Nonsense_Mutation	SNP	A	A	T			TCGA-PK-A5H9-01A-11D-A29I-10	TCGA-PK-A5H9-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	cb1f20fc-0df5-42f5-91b8-624bee1a532a	4fa707a6-752b-4fda-9bc0-b07c80cf65c1	g.chr1:12884876A>T	ENST00000535591.1	-	4	1430	c.1235T>A	c.(1234-1236)tTg>tAg	p.L412*	RP5-845O24.8_ENST00000438401.1_lincRNA	NM_001146344.1	NP_001139816.1	O60813	PRA11_HUMAN	PRAME family member 11	412					negative regulation of apoptotic process (GO:0043066)|negative regulation of cell differentiation (GO:0045596)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cell proliferation (GO:0008284)					NS(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|lung(7)|pancreas(2)|skin(4)|urinary_tract(1)	27						AGTACAGAACAAGATCCTCTT	0.478																																					p.L412X		.											.	.	0			c.T1235A						.						80.0	62.0	68.0					1																	12884876		692	1590	2282	SO:0001587	stop_gained	440560	exon4			CAGAACAAGATCC	AL049680	CCDS53268.1	1p36.21	2013-01-17			ENSG00000204513	ENSG00000239810		"""-"""	14086	protein-coding gene	gene with protein product							Standard	XM_006710645		Approved		uc001auk.2	O60813	OTTHUMG00000001929	ENST00000535591.1:c.1235T>A	1.37:g.12884876A>T	ENSP00000439551:p.Leu412*	Somatic	714	1		WXS	Illumina GAIIx	Phase_I	769	109	NM_001146344	0	0	0	0	0		Nonsense_Mutation	SNP	ENST00000535591.1	37	CCDS53268.1	.	.	.	.	.	.	.	.	.	.	.	14.10	2.434663	0.43224	.	.	ENSG00000204513	ENST00000535591;ENST00000331684;ENST00000437584	.	.	.	1.52	-3.04	0.05412	.	1.140860	0.06740	N	0.778154	.	.	.	.	.	.	0.47862	D	0.999537	.	.	.	.	.	.	.	.	.	.	0.19147	T	0.46	.	4.238	0.10635	0.2795:0.5365:0.184:0.0	.	.	.	.	X	412;453;412	.	ENSP00000328783:L453X	L	-	2	0	PRAMEF11	12807463	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-0.768000	0.04715	-1.123000	0.02940	0.334000	0.21626	TTG	.		0.478	PRAMEF11-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		XM_496341	
FUCA1	2517	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	24186340	24186340	+	Missense_Mutation	SNP	T	T	G			TCGA-PK-A5H9-01A-11D-A29I-10	TCGA-PK-A5H9-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	cb1f20fc-0df5-42f5-91b8-624bee1a532a	4fa707a6-752b-4fda-9bc0-b07c80cf65c1	g.chr1:24186340T>G	ENST00000374479.3	-	4	723	c.716A>C	c.(715-717)tAc>tCc	p.Y239S		NM_000147.4	NP_000138.2	P04066	FUCO_HUMAN	fucosidase, alpha-L- 1, tissue	239					fucose metabolic process (GO:0006004)|glycosaminoglycan catabolic process (GO:0006027)|glycoside catabolic process (GO:0016139)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|lysosome (GO:0005764)	alpha-L-fucosidase activity (GO:0004560)|fucose binding (GO:0042806)			breast(1)|endometrium(1)|large_intestine(3)|lung(3)	8		Colorectal(325;3.46e-05)|Renal(390;0.000219)|Lung NSC(340;0.000233)|all_lung(284;0.000321)|Ovarian(437;0.00348)|Breast(348;0.00957)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|OV - Ovarian serous cystadenocarcinoma(117;1.11e-24)|Colorectal(126;5.69e-08)|COAD - Colon adenocarcinoma(152;3.15e-06)|GBM - Glioblastoma multiforme(114;9.04e-06)|BRCA - Breast invasive adenocarcinoma(304;0.000986)|KIRC - Kidney renal clear cell carcinoma(1967;0.00342)|STAD - Stomach adenocarcinoma(196;0.0128)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.144)		GGAGTTCCAGTAAGTATCAGG	0.393																																					p.Y239S		.											.	FUCA1-153	0			c.A716C						.						119.0	109.0	113.0					1																	24186340		2203	4300	6503	SO:0001583	missense	2517	exon4			TTCCAGTAAGTAT	BC017338	CCDS244.2	1p34	2012-10-02			ENSG00000179163	ENSG00000179163	3.2.1.51		4006	protein-coding gene	gene with protein product		612280				2803312	Standard	NM_000147		Approved		uc001bie.3	P04066	OTTHUMG00000002965	ENST00000374479.3:c.716A>C	1.37:g.24186340T>G	ENSP00000363603:p.Tyr239Ser	Somatic	86	0		WXS	Illumina GAIIx	Phase_I	87	14	NM_000147	0	0	54	65	11	B2RBG3|Q14334|Q14335|Q3LID0|Q8NAC2	Missense_Mutation	SNP	ENST00000374479.3	37	CCDS244.2	.	.	.	.	.	.	.	.	.	.	T	26.4	4.737558	0.89482	.	.	ENSG00000179163	ENST00000374479;ENST00000374475	T	0.56776	0.44	6.16	6.16	0.99307	Glycoside hydrolase, subgroup, catalytic domain (1);Glycoside hydrolase, superfamily (1);	0.000000	0.85682	D	0.000000	T	0.76793	0.4037	M	0.87269	2.87	0.80722	D	1	D	0.67145	0.996	D	0.72982	0.979	T	0.80924	-0.1165	10	0.87932	D	0	-9.835	16.8061	0.85666	0.0:0.0:0.0:1.0	.	239	P04066	FUCO_HUMAN	S	239;28	ENSP00000363603:Y239S	ENSP00000363599:Y28S	Y	-	2	0	FUCA1	24058927	1.000000	0.71417	0.997000	0.53966	0.930000	0.56654	7.546000	0.82137	2.367000	0.80283	0.528000	0.53228	TAC	.		0.393	FUCA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000008259.2	NM_000147	
OPRD1	4985	hgsc.bcm.edu	37	1	29138975	29138975	+	Missense_Mutation	SNP	G	G	T	rs1042114	byFrequency	TCGA-PK-A5H9-01A-11D-A29I-10	TCGA-PK-A5H9-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	cb1f20fc-0df5-42f5-91b8-624bee1a532a	4fa707a6-752b-4fda-9bc0-b07c80cf65c1	g.chr1:29138975G>T	ENST00000234961.2	+	1	322	c.80G>T	c.(79-81)tGc>tTc	p.C27F		NM_000911.3	NP_000902.3	P41143	OPRD_HUMAN	opioid receptor, delta 1	27			C -> F (improved maturation and increased expression at the cell surface; dbSNP:rs1042114). {ECO:0000269|PubMed:10982041, ECO:0000269|PubMed:8201839, ECO:0000269|Ref.4}.		adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|adult locomotory behavior (GO:0008344)|cellular response to growth factor stimulus (GO:0071363)|cellular response to hypoxia (GO:0071456)|cellular response to toxic substance (GO:0097237)|G-protein coupled receptor signaling pathway (GO:0007186)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|immune response (GO:0006955)|negative regulation of gene expression (GO:0010629)|negative regulation of protein oligomerization (GO:0032460)|neuropeptide signaling pathway (GO:0007218)|opioid receptor signaling pathway (GO:0038003)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|positive regulation of CREB transcription factor activity (GO:0032793)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|protein import into nucleus, translocation (GO:0000060)|regulation of calcium ion transport (GO:0051924)|regulation of mitochondrial membrane potential (GO:0051881)|regulation of sensory perception of pain (GO:0051930)	axon terminus (GO:0043679)|cytoplasm (GO:0005737)|dendrite membrane (GO:0032590)|integral component of plasma membrane (GO:0005887)|intrinsic component of plasma membrane (GO:0031226)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|vesicle (GO:0031982)	enkephalin receptor activity (GO:0038046)|opioid receptor activity (GO:0004985)			breast(1)|central_nervous_system(1)|kidney(3)|large_intestine(1)|lung(2)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	15		Colorectal(325;3.46e-05)|Lung NSC(340;0.000947)|all_lung(284;0.00131)|Renal(390;0.00758)|Breast(348;0.00765)|all_neural(195;0.0199)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0563)|Medulloblastoma(700;0.123)		Colorectal(126;1.29e-07)|COAD - Colon adenocarcinoma(152;7.51e-06)|STAD - Stomach adenocarcinoma(196;0.00306)|BRCA - Breast invasive adenocarcinoma(304;0.0241)|READ - Rectum adenocarcinoma(331;0.0649)|KIRC - Kidney renal clear cell carcinoma(1967;0.147)	Alvimopan(DB06274)|Amitriptyline(DB00321)|Buprenorphine(DB00921)|Butorphanol(DB00611)|Codeine(DB00318)|Dextromethorphan(DB00514)|Dextropropoxyphene(DB00647)|Diphenoxylate(DB01081)|Fentanyl(DB00813)|Heroin(DB01452)|Hydrocodone(DB00956)|Hydromorphone(DB00327)|Ketamine(DB01221)|Ketobemidone(DB06738)|Levorphanol(DB00854)|Loperamide(DB00836)|Methadone(DB00333)|Morphine(DB00295)|Nalbuphine(DB00844)|Naloxone(DB01183)|Naltrexone(DB00704)|Oxycodone(DB00497)|Oxymorphone(DB01192)|Remifentanil(DB00899)|Sufentanil(DB00708)|Tapentadol(DB06204)|Tramadol(DB00193)	CCTAGCGCCTGCCCCAGCGCT	0.771													T|||	4730	0.944489	0.9796	0.9193	5008	,	,		9147	1.0		0.8678	False		,,,				2504	0.9366				p.C27F		.											.	OPRD1-69	0			c.G80T						.	T	PHE/CYS	3689,115		1788,113,1	4.0	6.0	5.0	http://www.ncbi.nlm.nih.gov/omim/103780,165195|http://omim.org/entry/165195|http://omim.org/entry/103780	80	2.9	1.0	1	dbSNP_86	5	6762,846		2982,798,24	no	missense	OPRD1	NM_000911.3	205	4770,911,25	TT,TG,GG		11.1199,3.0231,8.421	benign	27/373	29138975	10451,961	1902	3804	5706	SO:0001583	missense	4985	exon1			GCGCCTGCCCCAG	U10504	CCDS329.1	1p36.1-p34.3	2012-08-08			ENSG00000116329	ENSG00000116329		"""GPCR / Class A : Opioid receptors"""	8153	protein-coding gene	gene with protein product		165195				8415697	Standard	NM_000911		Approved		uc001brf.1	P41143	OTTHUMG00000003646	ENST00000234961.2:c.80G>T	1.37:g.29138975G>T	ENSP00000234961:p.Cys27Phe	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	26	26	NM_000911	0	0	0	0	0	B5B0B8	Missense_Mutation	SNP	ENST00000234961.2	37	CCDS329.1	2035	0.9317765567765568	474	0.9634146341463414	331	0.914364640883978	572	1.0	658	0.8680738786279684	T	0.016	-1.513433	0.00975	0.969769	0.888801	ENSG00000116329	ENST00000234961;ENST00000536280	T	0.67698	-0.28	4.0	2.89	0.33648	.	1.802200	0.02327	N	0.073605	T	0.00012	0.0000	N	0.01874	-0.695	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.41342	-0.9514	9	0.09338	T	0.73	.	3.8109	0.08796	0.0:0.1144:0.2238:0.6618	rs1042114;rs59349662;rs1042114	27	P41143	OPRD_HUMAN	F	27	ENSP00000234961:C27F	ENSP00000234961:C27F	C	+	2	0	OPRD1	29011562	0.002000	0.14202	0.992000	0.48379	0.116000	0.19942	0.521000	0.22893	0.713000	0.32060	-0.694000	0.03704	TGC	G|0.061;T|0.939		0.771	OPRD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000010330.1	NM_000911	
EPHA10	284656	hgsc.bcm.edu	37	1	38227086	38227086	+	Missense_Mutation	SNP	A	A	T	rs4653328	byFrequency	TCGA-PK-A5H9-01A-11D-A29I-10	TCGA-PK-A5H9-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	cb1f20fc-0df5-42f5-91b8-624bee1a532a	4fa707a6-752b-4fda-9bc0-b07c80cf65c1	g.chr1:38227086A>T	ENST00000373048.4	-	3	840	c.841T>A	c.(841-843)Ttc>Atc	p.F281I	EPHA10_ENST00000427468.2_Missense_Mutation_p.F281I|EPHA10_ENST00000319637.6_Missense_Mutation_p.F281I	NM_001099439.1	NP_001092909.1	Q5JZY3	EPHAA_HUMAN	EPH receptor A10	281			F -> I (in dbSNP:rs4653328). {ECO:0000269|PubMed:17344846}.		ephrin receptor signaling pathway (GO:0048013)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)	ATP binding (GO:0005524)|ephrin receptor activity (GO:0005003)|transmembrane-ephrin receptor activity (GO:0005005)			NS(2)|breast(4)|cervix(1)|endometrium(5)|kidney(4)|large_intestine(4)|lung(13)|prostate(3)|skin(8)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	50	Acute lymphoblastic leukemia(166;0.074)|all_hematologic(146;0.197)	Myeloproliferative disorder(586;0.0255)|all_neural(195;0.164)				CCTTCGCAGAAGTCACCACGC	0.667													T|||	1769	0.353235	0.4402	0.3012	5008	,	,		11536	0.4831		0.2833	False		,,,				2504	0.2106				p.F281I		.											.	EPHA10-1246	0			c.T841A						.	T	ILE/PHE,ILE/PHE	1706,2604		311,1084,760	59.0	63.0	62.0		841,841	-1.5	0.8	1	dbSNP_111	62	2269,6083		305,1659,2212	yes	missense,missense	EPHA10	NM_001099439.1,NM_173641.2	21,21	616,2743,2972	TT,TA,AA		27.1671,39.5824,31.3931	benign,benign	281/1009,281/296	38227086	3975,8687	2155	4176	6331	SO:0001583	missense	284656	exon3			CGCAGAAGTCACC	AK090974	CCDS425.1, CCDS41305.1	1p34.3	2013-02-11			ENSG00000183317	ENSG00000183317		"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	19987	protein-coding gene	gene with protein product		611123				12477932	Standard	NM_001099439		Approved	FLJ16103, FLJ33655	uc009vvi.3	Q5JZY3	OTTHUMG00000004325	ENST00000373048.4:c.841T>A	1.37:g.38227086A>T	ENSP00000362139:p.Phe281Ile	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	22	22	NM_001099439	0	0	0	0	0	A4FU89|J3KPB5|Q6NW42	Missense_Mutation	SNP	ENST00000373048.4	37	CCDS41305.1	785	0.35943223443223443	208	0.42276422764227645	97	0.26795580110497236	252	0.4405594405594406	228	0.3007915567282322	T	7.996	0.754258	0.15778	0.395824	0.271671	ENSG00000183317	ENST00000427468;ENST00000373048;ENST00000319637	D;D;T	0.97279	-4.32;-4.32;4.58	4.23	-1.55	0.08558	.	0.934531	0.08818	N	0.889212	T	0.00012	0.0000	N	0.01352	-0.895	0.09310	P	0.999999624185	B;B	0.10296	0.0;0.003	B;B	0.04013	0.0;0.001	T	0.26121	-1.0112	9	0.25751	T	0.34	.	3.9977	0.09566	0.3304:0.2198:0.0:0.4498	rs4653328;rs52814760;rs4653328	281;281	Q5JZY3;Q5JZY3-2	EPHAA_HUMAN;.	I	281	ENSP00000397746:F281I;ENSP00000362139:F281I;ENSP00000316395:F281I	ENSP00000316395:F281I	F	-	1	0	EPHA10	37999673	0.003000	0.15002	0.803000	0.32268	0.397000	0.30659	-0.342000	0.07801	-0.327000	0.08551	-1.255000	0.01485	TTC	A|0.665;T|0.335		0.667	EPHA10-003	KNOWN	not_organism_supported|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000012497.2	NM_173641	
BMP8A	353500	hgsc.bcm.edu	37	1	39957913	39957913	+	Missense_Mutation	SNP	A	A	G	rs4660269	byFrequency	TCGA-PK-A5H9-01A-11D-A29I-10	TCGA-PK-A5H9-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	cb1f20fc-0df5-42f5-91b8-624bee1a532a	4fa707a6-752b-4fda-9bc0-b07c80cf65c1	g.chr1:39957913A>G	ENST00000331593.5	+	1	596	c.250A>G	c.(250-252)Atg>Gtg	p.M84V		NM_181809.3	NP_861525.2	Q7Z5Y6	BMP8A_HUMAN	bone morphogenetic protein 8a	84			M -> V (in dbSNP:rs4660269).		cartilage development (GO:0051216)|cell differentiation (GO:0030154)|diet induced thermogenesis (GO:0002024)|growth (GO:0040007)|negative regulation of insulin secretion (GO:0046676)|ossification (GO:0001503)|regulation of energy homeostasis (GO:2000505)	extracellular space (GO:0005615)				kidney(1)|large_intestine(2)|lung(1)|skin(1)	5	Lung NSC(20;2.08e-06)|Ovarian(52;0.00769)|all_hematologic(146;0.0501)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;9.69e-19)|Epithelial(16;9.34e-17)|all cancers(16;1.73e-15)|LUSC - Lung squamous cell carcinoma(16;0.00146)|Lung(16;0.00204)			GTACCACGCCATGGCTGGCGA	0.771													A|||	3367	0.672324	0.2897	0.8069	5008	,	,		8040	0.6825		0.8887	False		,,,				2504	0.8609				p.M84V		.											.	BMP8A-90	0			c.A250G						.	A	VAL/MET	1486,1350		387,712,319	7.0	9.0	8.0		250	3.3	1.0	1	dbSNP_111	8	5431,485		2501,429,28	no	missense	BMP8A	NM_181809.3	21	2888,1141,347	GG,GA,AA		8.1981,47.6023,20.9666	benign	84/403	39957913	6917,1835	1418	2958	4376	SO:0001583	missense	353500	exon1			CACGCCATGGCTG	AY303954	CCDS437.1	1p35-p32	2014-01-30			ENSG00000183682	ENSG00000183682		"""Bone morphogenetic proteins"", ""Endogenous ligands"""	21650	protein-coding gene	gene with protein product							Standard	NM_181809		Approved		uc001cdi.3	Q7Z5Y6	OTTHUMG00000008394	ENST00000331593.5:c.250A>G	1.37:g.39957913A>G	ENSP00000327440:p.Met84Val	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	10	7	NM_181809	0	0	0	0	0	Q5T3A5	Missense_Mutation	SNP	ENST00000331593.5	37	CCDS437.1	1496	0.684981684981685	135	0.27439024390243905	297	0.8204419889502762	384	0.6713286713286714	680	0.8970976253298153	a	12.21	1.871113	0.33069	0.523977	0.918019	ENSG00000183682	ENST00000331593	T	0.64438	-0.1	3.32	3.32	0.38043	Transforming growth factor-beta, N-terminal (1);	0.094831	0.64402	U	0.000001	T	0.00012	0.0000	L	0.36672	1.1	0.25817	P	0.984325	B	0.13594	0.008	B	0.18263	0.021	T	0.28996	-1.0026	8	.	.	.	.	7.876	0.29595	0.8917:0.0:0.1083:0.0	rs4660269	84	Q7Z5Y6	BMP8A_HUMAN	V	84	ENSP00000327440:M84V	.	M	+	1	0	BMP8A	39730500	1.000000	0.71417	1.000000	0.80357	0.758000	0.43043	2.578000	0.46051	1.285000	0.44548	0.254000	0.18369	ATG	A|0.302;G|0.698		0.771	BMP8A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000023079.1	NM_181809	
TCTEX1D4	343521	hgsc.bcm.edu	37	1	45271912	45271912	+	Silent	SNP	G	G	A	rs17886118	byFrequency	TCGA-PK-A5H9-01A-11D-A29I-10	TCGA-PK-A5H9-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	cb1f20fc-0df5-42f5-91b8-624bee1a532a	4fa707a6-752b-4fda-9bc0-b07c80cf65c1	g.chr1:45271912G>A	ENST00000339355.2	-	1	435	c.429C>T	c.(427-429)gaC>gaT	p.D143D	BTBD19_ENST00000450269.1_5'Flank|TCTEX1D4_ENST00000372200.1_Silent_p.D143D|BTBD19_ENST00000453418.1_5'Flank|BTBD19_ENST00000409335.2_5'Flank			Q5JR98	TC1D4_HUMAN	Tctex1 domain containing 4	143						acrosomal vesicle (GO:0001669)|axoneme (GO:0005930)|microtubule organizing center (GO:0005815)|nucleus (GO:0005634)|sperm flagellum (GO:0036126)	protein phosphatase 1 binding (GO:0008157)			pancreas(1)	1	Acute lymphoblastic leukemia(166;0.155)					GCGCGGCCTCGTCGCTGGAGT	0.731													G|||	882	0.176118	0.0855	0.2421	5008	,	,		10287	0.2847		0.1412	False		,,,				2504	0.1759				p.D143D		.											.	TCTEX1D4-91	0			c.C429T						.	G		233,2847		5,223,1312	2.0	3.0	3.0		429	-11.1	0.0	1	dbSNP_124	3	925,5617		49,827,2395	no	coding-synonymous	TCTEX1D4	NM_001013632.2		54,1050,3707	AA,AG,GG		14.1394,7.5649,12.0349		143/222	45271912	1158,8464	1540	3271	4811	SO:0001819	synonymous_variant	343521	exon2			GGCCTCGTCGCTG	BC092499	CCDS30699.1	1p34.1	2007-12-17				ENSG00000188396			32315	protein-coding gene	gene with protein product	"""novel Tctex-1 family domain-containing protein"""	611713				12477932	Standard	XM_006710614		Approved		uc001cmp.3	Q5JR98		ENST00000339355.2:c.429C>T	1.37:g.45271912G>A		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	11	5	NM_001013632	0	0	0	0	0		Silent	SNP	ENST00000339355.2	37	CCDS30699.1																																																																																			G|0.822;A|0.178		0.731	TCTEX1D4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000023733.1	NM_001013632	
ODF2L	57489	ucsc.edu	37	1	86842004	86842004	+	Missense_Mutation	SNP	G	G	A			TCGA-PK-A5H9-01A-11D-A29I-10	TCGA-PK-A5H9-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	cb1f20fc-0df5-42f5-91b8-624bee1a532a	4fa707a6-752b-4fda-9bc0-b07c80cf65c1	g.chr1:86842004G>A	ENST00000359242.3	-	8	1003	c.722C>T	c.(721-723)gCt>gTt	p.A241V	ODF2L_ENST00000370567.1_Missense_Mutation_p.A241V|ODF2L_ENST00000370566.3_Missense_Mutation_p.A241V|ODF2L_ENST00000394731.1_Missense_Mutation_p.A110V|ODF2L_ENST00000524695.1_5'Flank|ODF2L_ENST00000294678.2_Missense_Mutation_p.A241V|ODF2L_ENST00000317336.7_Missense_Mutation_p.A241V	NM_001007022.2	NP_001007023.2	Q9ULJ1	ODF2L_HUMAN	outer dense fiber of sperm tails 2-like	241						centrosome (GO:0005813)				endometrium(2)|kidney(2)|large_intestine(10)|lung(6)|ovary(1)|pancreas(1)|skin(1)|stomach(1)	24				all cancers(265;0.0313)|Epithelial(280;0.0611)		CTTTTTTAAAGCTACAGTTTT	0.358																																					p.A241V		.											.	ODF2L-69	0			c.C722T						.						137.0	125.0	129.0					1																	86842004		2201	4300	6501	SO:0001583	missense	57489	exon8			TTTAAAGCTACAG		CCDS30763.1, CCDS41354.1, CCDS30763.2, CCDS41354.2, CCDS53339.1	1p22.3	2008-02-05			ENSG00000122417	ENSG00000122417			29225	protein-coding gene	gene with protein product						10574462	Standard	NM_020729		Approved	KIAA1229	uc001dll.2	Q9ULJ1	OTTHUMG00000010080	ENST00000359242.3:c.722C>T	1.37:g.86842004G>A	ENSP00000359600:p.Ala241Val	Somatic	80	0		WXS	Illumina GAIIx	Phase_I	86	1	NM_001007022	0	0	11	14	3	A8MU56|B4E037|Q05C40|Q5BJG5|Q5TBX3|Q5TBX4|Q86X31	Missense_Mutation	SNP	ENST00000359242.3	37	CCDS41354.2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	16.13|16.13	3.036874|3.036874	0.54896|0.54896	.|.	.|.	ENSG00000122417|ENSG00000122417	ENST00000441121;ENST00000370566;ENST00000359242;ENST00000460698;ENST00000317336;ENST00000370567;ENST00000394731;ENST00000457680;ENST00000294678;ENST00000479890|ENST00000459999	T;T;T;T;T;T;T;D|.	0.83335|.	1.7;1.66;1.74;1.68;1.71;1.74;1.69;-1.71|.	5.77|5.77	5.77|5.77	0.91146|0.91146	.|.	0.287529|.	0.40385|.	N|.	0.001112|.	T|T	0.53012|0.53012	0.1770|0.1770	M|M	0.67953|0.67953	2.075|2.075	0.32657|0.32657	N|N	0.518577|0.518577	D;D;D;D;D;D|.	0.89917|.	1.0;1.0;1.0;1.0;1.0;1.0|.	D;D;D;D;D;D|.	0.91635|.	0.988;0.999;0.982;0.983;0.998;0.999|.	T|T	0.55774|0.55774	-0.8088|-0.8088	10|5	0.41790|.	T|.	0.15|.	-8.8769|-8.8769	13.4444|13.4444	0.61131|0.61131	0.0:0.1571:0.8428:0.0|0.0:0.1571:0.8428:0.0	.|.	241;241;241;241;241;241|.	B4E037;B4DZ83;Q9ULJ1-2;Q9ULJ1-4;Q9ULJ1-3;Q9ULJ1|.	.;.;.;.;.;ODF2L_HUMAN|.	V|F	241;241;241;117;241;241;110;71;241;71|90	ENSP00000359597:A241V;ENSP00000359600:A241V;ENSP00000433092:A117V;ENSP00000320165:A241V;ENSP00000359598:A241V;ENSP00000378219:A110V;ENSP00000294678:A241V;ENSP00000432834:A71V|.	ENSP00000294678:A241V|.	A|L	-|-	2|1	0|0	ODF2L|ODF2L	86614592|86614592	1.000000|1.000000	0.71417|0.71417	0.993000|0.993000	0.49108|0.49108	0.131000|0.131000	0.20780|0.20780	3.422000|3.422000	0.52749|0.52749	2.885000|2.885000	0.99019|0.99019	0.655000|0.655000	0.94253|0.94253	GCT|CTT	.		0.358	ODF2L-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000027873.2		
NOTCH2	4853	hgsc.bcm.edu	37	1	120611964	120611964	+	Missense_Mutation	SNP	G	G	C	rs11810554	byFrequency	TCGA-PK-A5H9-01A-11D-A29I-10	TCGA-PK-A5H9-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	cb1f20fc-0df5-42f5-91b8-624bee1a532a	4fa707a6-752b-4fda-9bc0-b07c80cf65c1	g.chr1:120611964G>C	ENST00000256646.2	-	1	276	c.57C>G	c.(55-57)tgC>tgG	p.C19W		NM_024408.3	NP_077719.2	Q04721	NOTC2_HUMAN	notch 2	19					apoptotic process (GO:0006915)|atrial septum morphogenesis (GO:0060413)|bone remodeling (GO:0046849)|cell cycle arrest (GO:0007050)|cell fate determination (GO:0001709)|cell growth (GO:0016049)|ciliary body morphogenesis (GO:0061073)|determination of left/right symmetry (GO:0007368)|embryonic limb morphogenesis (GO:0030326)|gene expression (GO:0010467)|hemopoiesis (GO:0030097)|humoral immune response (GO:0006959)|in utero embryonic development (GO:0001701)|inflammatory response to antigenic stimulus (GO:0002437)|interleukin-4 secretion (GO:0072602)|intracellular receptor signaling pathway (GO:0030522)|morphogenesis of an epithelial sheet (GO:0002011)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nervous system development (GO:0007399)|Notch receptor processing (GO:0007220)|Notch signaling involved in heart development (GO:0061314)|Notch signaling pathway (GO:0007219)|organ morphogenesis (GO:0009887)|placenta blood vessel development (GO:0060674)|positive regulation of apoptotic process (GO:0043065)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of cell proliferation (GO:0008284)|positive regulation of Ras protein signal transduction (GO:0046579)|pulmonary valve morphogenesis (GO:0003184)|regulation of transcription, DNA-templated (GO:0006355)|stem cell maintenance (GO:0019827)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cell surface (GO:0009986)|cilium (GO:0005929)|endoplasmic reticulum membrane (GO:0005789)|extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|ligand-activated RNA polymerase II transcription factor binding transcription factor activity (GO:0038049)|receptor activity (GO:0004872)	p.C19W(1)		breast(4)|central_nervous_system(6)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(9)|kidney(9)|large_intestine(19)|liver(1)|lung(57)|ovary(4)|pancreas(1)|prostate(7)|skin(24)|stomach(2)|upper_aerodigestive_tract(5)|urinary_tract(1)	158	all_neural(166;0.153)	all_lung(203;1.96e-06)|Lung NSC(69;1.47e-05)|all_epithelial(167;0.000809)		Lung(183;0.0242)|LUSC - Lung squamous cell carcinoma(189;0.133)		CGGGGGCCGCGCAGCACAGCC	0.766			"""N, F, Mis"""		"""marginal zone lymphoma, DLBCL"""				Alagille Syndrome																												p.C19W		.		Dom	yes		1	1p13-p11	4853	Notch homolog 2		L	.	NOTCH2-1441	1	Substitution - Missense(1)	central_nervous_system(1)	c.C57G						.						6.0	8.0	8.0					1																	120611964		1705	3721	5426	SO:0001583	missense	4853	exon1	Familial Cancer Database	ALGS1, ALGS2.Alagille-Watson syndrome	GGCCGCGCAGCAC	AF315356	CCDS908.1	1p13-p11	2013-01-10	2010-06-24		ENSG00000134250	ENSG00000134250		"""Ankyrin repeat domain containing"""	7882	protein-coding gene	gene with protein product		600275	"""Notch (Drosophila) homolog 2"", ""Notch homolog 2 (Drosophila)"""			7698746	Standard	NM_001200001		Approved		uc001eik.3	Q04721	OTTHUMG00000012177	ENST00000256646.2:c.57C>G	1.37:g.120611964G>C	ENSP00000256646:p.Cys19Trp	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	14	11	NM_024408	0	0	4	5	1	Q5T3X7|Q99734|Q9H240	Missense_Mutation	SNP	ENST00000256646.2	37	CCDS908.1	697|697	0.3191391941391941|0.3191391941391941	81|81	0.16463414634146342|0.16463414634146342	112|112	0.30939226519337015|0.30939226519337015	224|224	0.3916083916083916|0.3916083916083916	280|280	0.36939313984168864|0.36939313984168864	G|G	6.292|6.292	0.421956|0.421956	0.11928|0.11928	.|.	.|.	ENSG00000134250|ENSG00000134250	ENST00000538680|ENST00000256646	.|T	.|0.57436	.|0.4	3.09|3.09	2.04|2.04	0.26737|0.26737	.|.	.|.	.|.	.|.	.|.	T|T	0.14917|0.14917	0.0360|0.0360	N|N	0.14661|0.14661	0.345|0.345	0.26751|0.26751	N|N	0.970205|0.970205	.|B;B	.|0.09022	.|0.001;0.002	.|B;B	.|0.01281	.|0.0;0.0	T|T	0.14337|0.14337	-1.0476|-1.0476	6|9	0.87932|0.37606	D|T	0|0.19	.|.	6.7594|6.7594	0.23532|0.23532	0.0:0.0:0.7206:0.2794|0.0:0.0:0.7206:0.2794	rs11810554|rs11810554	.|19;19	.|Q6IQ50;Q04721	.|.;NOTC2_HUMAN	G|W	36|19	.|ENSP00000256646:C19W	ENSP00000439516:A36G|ENSP00000256646:C19W	A|C	-|-	2|3	0|2	NOTCH2|NOTCH2	120413487|120413487	0.998000|0.998000	0.40836|0.40836	0.998000|0.998000	0.56505|0.56505	0.313000|0.313000	0.28021|0.28021	0.766000|0.766000	0.26560|0.26560	1.760000|1.760000	0.52011|0.52011	0.184000|0.184000	0.17185|0.17185	GCG|TGC	G|0.680;C|0.320		0.766	NOTCH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033679.1	NM_024408	
NOTCH2	4853	hgsc.bcm.edu	37	1	120612006	120612006	+	Silent	SNP	G	G	A	rs4021006	byFrequency	TCGA-PK-A5H9-01A-11D-A29I-10	TCGA-PK-A5H9-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	cb1f20fc-0df5-42f5-91b8-624bee1a532a	4fa707a6-752b-4fda-9bc0-b07c80cf65c1	g.chr1:120612006G>A	ENST00000256646.2	-	1	234	c.15C>T	c.(13-15)cgC>cgT	p.R5R		NM_024408.3	NP_077719.2	Q04721	NOTC2_HUMAN	notch 2	5					apoptotic process (GO:0006915)|atrial septum morphogenesis (GO:0060413)|bone remodeling (GO:0046849)|cell cycle arrest (GO:0007050)|cell fate determination (GO:0001709)|cell growth (GO:0016049)|ciliary body morphogenesis (GO:0061073)|determination of left/right symmetry (GO:0007368)|embryonic limb morphogenesis (GO:0030326)|gene expression (GO:0010467)|hemopoiesis (GO:0030097)|humoral immune response (GO:0006959)|in utero embryonic development (GO:0001701)|inflammatory response to antigenic stimulus (GO:0002437)|interleukin-4 secretion (GO:0072602)|intracellular receptor signaling pathway (GO:0030522)|morphogenesis of an epithelial sheet (GO:0002011)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nervous system development (GO:0007399)|Notch receptor processing (GO:0007220)|Notch signaling involved in heart development (GO:0061314)|Notch signaling pathway (GO:0007219)|organ morphogenesis (GO:0009887)|placenta blood vessel development (GO:0060674)|positive regulation of apoptotic process (GO:0043065)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of cell proliferation (GO:0008284)|positive regulation of Ras protein signal transduction (GO:0046579)|pulmonary valve morphogenesis (GO:0003184)|regulation of transcription, DNA-templated (GO:0006355)|stem cell maintenance (GO:0019827)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cell surface (GO:0009986)|cilium (GO:0005929)|endoplasmic reticulum membrane (GO:0005789)|extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|ligand-activated RNA polymerase II transcription factor binding transcription factor activity (GO:0038049)|receptor activity (GO:0004872)			breast(4)|central_nervous_system(6)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(9)|kidney(9)|large_intestine(19)|liver(1)|lung(57)|ovary(4)|pancreas(1)|prostate(7)|skin(24)|stomach(2)|upper_aerodigestive_tract(5)|urinary_tract(1)	158	all_neural(166;0.153)	all_lung(203;1.96e-06)|Lung NSC(69;1.47e-05)|all_epithelial(167;0.000809)		Lung(183;0.0242)|LUSC - Lung squamous cell carcinoma(189;0.133)		GCAGAGCGGGGCGCAGGGCGG	0.761			"""N, F, Mis"""		"""marginal zone lymphoma, DLBCL"""				Alagille Syndrome				g|||	1973	0.39397	0.2632	0.4049	5008	,	,		21911	0.4315		0.4423	False		,,,				2504	0.4744				p.R5R		.		Dom	yes		1	1p13-p11	4853	Notch homolog 2		L	.	NOTCH2-1441	0			c.C15T						.						6.0	8.0	8.0					1																	120612006		1838	3882	5720	SO:0001819	synonymous_variant	4853	exon1	Familial Cancer Database	ALGS1, ALGS2.Alagille-Watson syndrome	AGCGGGGCGCAGG	AF315356	CCDS908.1	1p13-p11	2013-01-10	2010-06-24		ENSG00000134250	ENSG00000134250		"""Ankyrin repeat domain containing"""	7882	protein-coding gene	gene with protein product		600275	"""Notch (Drosophila) homolog 2"", ""Notch homolog 2 (Drosophila)"""			7698746	Standard	NM_001200001		Approved		uc001eik.3	Q04721	OTTHUMG00000012177	ENST00000256646.2:c.15C>T	1.37:g.120612006G>A		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	11	10	NM_024408	0	0	6	13	7	Q5T3X7|Q99734|Q9H240	Silent	SNP	ENST00000256646.2	37	CCDS908.1	.	.	.	.	.	.	.	.	.	.	G	9.758	1.169358	0.21621	.	.	ENSG00000134250	ENST00000538680	.	.	.	2.9	1.95	0.26073	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	5.0819	0.14661	0.1818:0.0:0.8182:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	NOTCH2	120413529	0.988000	0.35896	0.959000	0.39883	0.588000	0.36517	1.074000	0.30703	0.543000	0.28864	0.184000	0.17185	.	G|0.500;A|0.500		0.761	NOTCH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033679.1	NM_024408	
THEM4	117145	hgsc.bcm.edu	37	1	151881885	151881885	+	Missense_Mutation	SNP	A	A	C	rs3748805	byFrequency	TCGA-PK-A5H9-01A-11D-A29I-10	TCGA-PK-A5H9-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	cb1f20fc-0df5-42f5-91b8-624bee1a532a	4fa707a6-752b-4fda-9bc0-b07c80cf65c1	g.chr1:151881885A>C	ENST00000368814.3	-	1	399	c.50T>G	c.(49-51)cTg>cGg	p.L17R	THEM4_ENST00000489410.1_Missense_Mutation_p.L17R	NM_053055.4	NP_444283.2	Q5T1C6	THEM4_HUMAN	thioesterase superfamily member 4	17			L -> R (in dbSNP:rs3748805). {ECO:0000269|PubMed:11598301, ECO:0000269|PubMed:14702039, ECO:0000269|PubMed:15489334, ECO:0000269|PubMed:17013611, ECO:0000269|Ref.4}.		epidermal growth factor receptor signaling pathway (GO:0007173)|fatty acid metabolic process (GO:0006631)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|protein kinase B signaling (GO:0043491)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)	cell projection (GO:0042995)|cytosol (GO:0005829)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	palmitoyl-CoA hydrolase activity (GO:0016290)			endometrium(1)|large_intestine(4)|lung(3)|urinary_tract(1)	9	Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.14)		LUSC - Lung squamous cell carcinoma(543;0.181)			TACTGGCGGCAGGCACAGAGC	0.741													C|||	4622	0.922923	0.8986	0.9092	5008	,	,		8223	0.9494		0.9155	False		,,,				2504	0.9458				p.L17R		.											.	THEM4-522	0			c.T50G						.						1.0	1.0	1.0					1																	151881885		1068	2473	3541	SO:0001583	missense	117145	exon1			GGCGGCAGGCACA	AJ313515	CCDS1006.1	1q21.3	2008-02-05			ENSG00000159445	ENSG00000159445			17947	protein-coding gene	gene with protein product	"""C-terminal modulator protein"""	606388				11598301	Standard	NM_053055		Approved	CTMP	uc001ezj.2	Q5T1C6	OTTHUMG00000013049	ENST00000368814.3:c.50T>G	1.37:g.151881885A>C	ENSP00000357804:p.Leu17Arg	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	8	8	NM_053055	0	0	0	14	14	B2RBX2|Q96KR2	Missense_Mutation	SNP	ENST00000368814.3	37	CCDS1006.1	2023	0.9262820512820513	453	0.9207317073170732	320	0.8839779005524862	545	0.9527972027972028	705	0.9300791556728232	C	0.562	-0.845033	0.02671	.	.	ENSG00000159445	ENST00000368814;ENST00000489410	T;T	0.25579	2.45;1.79	1.92	-0.278	0.12894	.	16.336300	0.02935	N	0.139768	T	0.02455	0.0075	N	0.08118	0	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.21143	-1.0254	9	0.10111	T	0.7	0.3431	0.4569	0.00510	0.2457:0.3181:0.2427:0.1934	rs3748805;rs17855960	17	Q5T1C6	THEM4_HUMAN	R	17	ENSP00000357804:L17R;ENSP00000433304:L17R	ENSP00000357804:L17R	L	-	2	0	THEM4	150148509	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.350000	0.07721	-0.432000	0.07297	-0.358000	0.07595	CTG	T|0.073;G|0.921		0.741	THEM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000036615.1	NM_053055	
HRNR	388697	bcgsc.ca	37	1	152193286	152193286	+	Missense_Mutation	SNP	G	G	T	rs7545406	byFrequency	TCGA-PK-A5H9-01A-11D-A29I-10	TCGA-PK-A5H9-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	cb1f20fc-0df5-42f5-91b8-624bee1a532a	4fa707a6-752b-4fda-9bc0-b07c80cf65c1	g.chr1:152193286G>T	ENST00000368801.2	-	3	894	c.819C>A	c.(817-819)caC>caA	p.H273Q	FLG-AS1_ENST00000420707.1_RNA|FLG-AS1_ENST00000593011.1_RNA	NM_001009931.1	NP_001009931.1	Q86YZ3	HORN_HUMAN	hornerin	273			H -> Q (in dbSNP:rs7545406).		establishment of skin barrier (GO:0061436)|hematopoietic progenitor cell differentiation (GO:0002244)|keratinization (GO:0031424)	cornified envelope (GO:0001533)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)	p.H273Q(1)		autonomic_ganglia(1)|breast(6)|central_nervous_system(2)|cervix(2)|endometrium(22)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(19)|liver(1)|lung(84)|ovary(5)|prostate(6)|skin(12)|stomach(9)|upper_aerodigestive_tract(5)|urinary_tract(6)	192	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			AGCTAGATCTGTGTCGTTCAC	0.567													G|||	1732	0.345847	0.2088	0.2795	5008	,	,		21880	0.2917		0.5855	False		,,,				2504	0.3875				p.H273Q		.											.	HRNR-93	1	Substitution - Missense(1)	stomach(1)	c.C819A						.	G	GLN/HIS	1161,3245	410.0+/-335.2	154,853,1196	312.0	282.0	292.0		819	-8.8	0.0	1	dbSNP_116	292	5083,3517	632.9+/-398.7	1502,2079,719	no	missense	HRNR	NM_001009931.1	24	1656,2932,1915	TT,TG,GG		40.8953,26.3504,48.0086	benign	273/2851	152193286	6244,6762	2203	4300	6503	SO:0001583	missense	388697	exon3			AGATCTGTGTCGT	AB104446	CCDS30859.1	1q21.3	2013-01-10			ENSG00000197915	ENSG00000197915		"""EF-hand domain containing"""	20846	protein-coding gene	gene with protein product	"""filaggrin family member 3"""						Standard	NM_001009931		Approved	S100a18, S100A16, FLG3	uc001ezt.2	Q86YZ3	OTTHUMG00000012243	ENST00000368801.2:c.819C>A	1.37:g.152193286G>T	ENSP00000357791:p.His273Gln	Somatic	243	2		WXS	Illumina GAIIx	Phase_I	254	8	NM_001009931	0	0	0	0	0	Q5DT20|Q5U1F4	Missense_Mutation	SNP	ENST00000368801.2	37	CCDS30859.1	869	0.39789377289377287	109	0.22154471544715448	131	0.36187845303867405	182	0.3181818181818182	447	0.5897097625329816	G	4.913	0.169574	0.09339	0.263504	0.591047	ENSG00000197915	ENST00000368801	T	0.02974	4.09	4.41	-8.81	0.00813	.	.	.	.	.	T	0.00300	0.0009	N	0.12182	0.205	0.80722	P	0.0	B	0.06786	0.001	B	0.04013	0.001	T	0.48768	-0.9006	8	0.10902	T	0.67	.	0.9813	0.01437	0.1922:0.1758:0.306:0.326	rs7545406	273	Q86YZ3	HORN_HUMAN	Q	273	ENSP00000357791:H273Q	ENSP00000357791:H273Q	H	-	3	2	HRNR	150459910	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-4.851000	0.00178	-3.578000	0.00138	-1.517000	0.00937	CAC	G|0.544;T|0.456		0.567	HRNR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000034016.1	XM_373868	
HRNR	388697	bcgsc.ca	37	1	152193291	152193291	+	Silent	SNP	G	G	T	rs6587652	byFrequency	TCGA-PK-A5H9-01A-11D-A29I-10	TCGA-PK-A5H9-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	cb1f20fc-0df5-42f5-91b8-624bee1a532a	4fa707a6-752b-4fda-9bc0-b07c80cf65c1	g.chr1:152193291G>T	ENST00000368801.2	-	3	889	c.814C>A	c.(814-816)Cga>Aga	p.R272R	FLG-AS1_ENST00000420707.1_RNA|FLG-AS1_ENST00000593011.1_RNA	NM_001009931.1	NP_001009931.1	Q86YZ3	HORN_HUMAN	hornerin	272					establishment of skin barrier (GO:0061436)|hematopoietic progenitor cell differentiation (GO:0002244)|keratinization (GO:0031424)	cornified envelope (GO:0001533)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)	p.R272R(1)		autonomic_ganglia(1)|breast(6)|central_nervous_system(2)|cervix(2)|endometrium(22)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(19)|liver(1)|lung(84)|ovary(5)|prostate(6)|skin(12)|stomach(9)|upper_aerodigestive_tract(5)|urinary_tract(6)	192	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			GATCTGTGTCGTTCACCCCTA	0.572													G|||	2805	0.560104	0.5295	0.5576	5008	,	,		21934	0.38		0.83	False		,,,				2504	0.5112				p.R272R		.											.	HRNR-93	1	Substitution - coding silent(1)	stomach(1)	c.C814A						.	G		2592,1814	638.2+/-396.9	768,1056,379	318.0	286.0	297.0		814	-1.3	0.0	1	dbSNP_116	297	7147,1453	751.1+/-407.4	2970,1207,123	no	coding-synonymous	HRNR	NM_001009931.1		3738,2263,502	TT,TG,GG		16.8953,41.1711,25.1192		272/2851	152193291	9739,3267	2203	4300	6503	SO:0001819	synonymous_variant	388697	exon3			TGTGTCGTTCACC	AB104446	CCDS30859.1	1q21.3	2013-01-10			ENSG00000197915	ENSG00000197915		"""EF-hand domain containing"""	20846	protein-coding gene	gene with protein product	"""filaggrin family member 3"""						Standard	NM_001009931		Approved	S100a18, S100A16, FLG3	uc001ezt.2	Q86YZ3	OTTHUMG00000012243	ENST00000368801.2:c.814C>A	1.37:g.152193291G>T		Somatic	242	2		WXS	Illumina GAIIx	Phase_I	266	11	NM_001009931	0	0	0	0	0	Q5DT20|Q5U1F4	Silent	SNP	ENST00000368801.2	37	CCDS30859.1																																																																																			G|0.294;T|0.706		0.572	HRNR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000034016.1	XM_373868	
FLG	2312	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	152281825	152281825	+	Missense_Mutation	SNP	G	G	T			TCGA-PK-A5H9-01A-11D-A29I-10	TCGA-PK-A5H9-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	cb1f20fc-0df5-42f5-91b8-624bee1a532a	4fa707a6-752b-4fda-9bc0-b07c80cf65c1	g.chr1:152281825G>T	ENST00000368799.1	-	3	5572	c.5537C>A	c.(5536-5538)aCc>aAc	p.T1846N	FLG-AS1_ENST00000420707.1_RNA|FLG-AS1_ENST00000593011.1_RNA	NM_002016.1	NP_002007.1	P20930	FILA_HUMAN	filaggrin	1846	Ser-rich.				establishment of skin barrier (GO:0061436)|keratinocyte differentiation (GO:0030216)|multicellular organismal development (GO:0007275)	cytoplasmic membrane-bounded vesicle (GO:0016023)|intermediate filament (GO:0005882)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|structural molecule activity (GO:0005198)			autonomic_ganglia(1)|breast(13)|central_nervous_system(5)|cervix(2)|endometrium(38)|haematopoietic_and_lymphoid_tissue(1)|kidney(16)|large_intestine(57)|lung(211)|ovary(13)|pancreas(1)|prostate(15)|skin(24)|stomach(5)|upper_aerodigestive_tract(10)|urinary_tract(12)	424	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			CTGGGACGTGGTGTGGCTGTG	0.542									Ichthyosis																												p.T1846N		.											.	FLG-106	0			c.C5537A						.						359.0	351.0	353.0					1																	152281825		2203	4300	6503	SO:0001583	missense	2312	exon3	Familial Cancer Database	X-linked Ichthyosis, Steroid Sulfatase Deficiency, Ichthyosis Vulgaris	GACGTGGTGTGGC	XM_048104	CCDS30860.1	1q21.3	2013-01-10			ENSG00000143631	ENSG00000143631		"""EF-hand domain containing"""	3748	protein-coding gene	gene with protein product		135940				2740331, 2248957, 16444271	Standard	NM_002016		Approved		uc001ezu.1	P20930	OTTHUMG00000012202	ENST00000368799.1:c.5537C>A	1.37:g.152281825G>T	ENSP00000357789:p.Thr1846Asn	Somatic	219	0		WXS	Illumina GAIIx	Phase_I	259	88	NM_002016	0	0	2	3	1	Q01720|Q5T583|Q9UC71	Missense_Mutation	SNP	ENST00000368799.1	37	CCDS30860.1	.	.	.	.	.	.	.	.	.	.	G	8.236	0.805675	0.16467	.	.	ENSG00000143631	ENST00000368799;ENST00000271820	T	0.01665	4.7	3.05	-0.222	0.13122	.	.	.	.	.	T	0.02119	0.0066	M	0.77820	2.39	0.09310	N	1	D	0.58268	0.982	P	0.53006	0.715	T	0.33240	-0.9876	9	0.72032	D	0.01	-0.4712	8.7336	0.34514	0.0:0.0:0.4035:0.5965	.	1846	P20930	FILA_HUMAN	N	1846;81	ENSP00000357789:T1846N	ENSP00000271820:T81N	T	-	2	0	FLG	150548449	0.001000	0.12720	0.000000	0.03702	0.002000	0.02628	0.711000	0.25764	-0.143000	0.11334	-0.377000	0.06932	ACC	.		0.542	FLG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033742.1	NM_002016	
KCNN3	3782	broad.mit.edu	37	1	154842333	154842333	+	Silent	SNP	C	C	T			TCGA-PK-A5H9-01A-11D-A29I-10	TCGA-PK-A5H9-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	cb1f20fc-0df5-42f5-91b8-624bee1a532a	4fa707a6-752b-4fda-9bc0-b07c80cf65c1	g.chr1:154842333C>T	ENST00000271915.4	-	1	423	c.108G>A	c.(106-108)caG>caA	p.Q36Q	KCNN3_ENST00000358505.2_5'Flank	NM_001204087.1|NM_002249.5	NP_001191016.1|NP_002240.3	Q9UGI6	KCNN3_HUMAN	potassium intermediate/small conductance calcium-activated channel, subfamily N, member 3	36	Gln-rich.				potassium ion transmembrane transport (GO:0071805)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	calmodulin binding (GO:0005516)|small conductance calcium-activated potassium channel activity (GO:0016286)			cervix(1)|endometrium(3)|kidney(2)|large_intestine(6)|lung(11)|prostate(4)|skin(1)	28	all_lung(78;2.29e-27)|all_hematologic(923;0.088)|Hepatocellular(266;0.108)|all_neural(408;0.245)		BRCA - Breast invasive adenocarcinoma(34;0.00819)		Miconazole(DB01110)|Procaine(DB00721)	gctgctgttgctgctgctgct	0.672																																					p.Q36Q		.											.	KCNN3-91	0			c.G108A						.						8.0	8.0	8.0					1																	154842333		1967	3874	5841	SO:0001819	synonymous_variant	3782	exon1			CTGTTGCTGCTGC	AF031815	CCDS1072.1, CCDS30880.1, CCDS72928.1	1q21.3	2012-07-05			ENSG00000143603	ENSG00000143603		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, calcium-activated"""	6292	protein-coding gene	gene with protein product		602983				9491810, 16382103	Standard	NM_002249		Approved	KCa2.3, hSK3, SKCA3	uc021pah.1	Q9UGI6	OTTHUMG00000037260	ENST00000271915.4:c.108G>A	1.37:g.154842333C>T		Somatic	47	2		WXS	Illumina GAIIx	Phase_I	70	4	NM_001204087	0	1	138	150	11	B1ANX0|O43517|Q86VF9|Q8WXG7	Silent	SNP	ENST00000271915.4	37	CCDS30880.1																																																																																			.		0.672	KCNN3-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090688.3	NM_002249	
RRNAD1	51093	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	1	156703253	156703253	+	Nonsense_Mutation	SNP	C	C	T			TCGA-PK-A5H9-01A-11D-A29I-10	TCGA-PK-A5H9-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	cb1f20fc-0df5-42f5-91b8-624bee1a532a	4fa707a6-752b-4fda-9bc0-b07c80cf65c1	g.chr1:156703253C>T	ENST00000368216.4	+	5	1207	c.577C>T	c.(577-579)Cag>Tag	p.Q193*	RRNAD1_ENST00000368218.4_Nonsense_Mutation_p.Q193*|RRNAD1_ENST00000476229.1_Nonsense_Mutation_p.Q70*	NM_015997.3	NP_057081.3	Q96FB5	RRNAD_HUMAN	ribosomal RNA adenine dimethylase domain containing 1	193						integral component of membrane (GO:0016021)	rRNA (adenine-N6,N6-)-dimethyltransferase activity (GO:0000179)			NS(1)|breast(1)|kidney(1)|large_intestine(3)|lung(3)	9						GGAGAGAGCCCAGCGCCTGGA	0.617																																					p.Q193X		.											.	RRNAD1-90	0			c.C577T						.						84.0	93.0	90.0					1																	156703253		2203	4300	6503	SO:0001587	stop_gained	51093	exon5			AGAGCCCAGCGCC	BC011382	CCDS1154.1, CCDS44246.1	1q23.1	2011-01-28	2011-01-28	2011-01-28	ENSG00000143303	ENSG00000143303			24273	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 66"""	C1orf66		10810093, 310876	Standard	NM_015997		Approved	CGI-41	uc001fpu.3	Q96FB5	OTTHUMG00000041302	ENST00000368216.4:c.577C>T	1.37:g.156703253C>T	ENSP00000357199:p.Gln193*	Somatic	52	0		WXS	Illumina GAIIx	Phase_I	58	6	NM_015997	0	0	25	26	1	D3DVC7|Q4VX71|Q5SZ03|Q9Y358	Nonsense_Mutation	SNP	ENST00000368216.4	37	CCDS1154.1	.	.	.	.	.	.	.	.	.	.	C	18.32	3.598026	0.66332	.	.	ENSG00000143303	ENST00000368218;ENST00000368216;ENST00000519086;ENST00000484742;ENST00000476229	.	.	.	4.75	3.84	0.44239	.	0.546041	0.18924	N	0.127396	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.11794	T	0.64	-13.4534	8.2843	0.31920	0.1593:0.5596:0.2811:0.0	.	.	.	.	X	193;193;172;91;70	.	ENSP00000357199:Q193X	Q	+	1	0	RRNAD1	154969877	0.537000	0.26386	1.000000	0.80357	0.849000	0.48306	1.016000	0.29976	1.231000	0.43661	-0.310000	0.09108	CAG	.		0.617	RRNAD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000098973.1	NM_015997	
TOR3A	64222	hgsc.bcm.edu	37	1	179051300	179051300	+	Missense_Mutation	SNP	T	T	C	rs2296377	byFrequency	TCGA-PK-A5H9-01A-11D-A29I-10	TCGA-PK-A5H9-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	cb1f20fc-0df5-42f5-91b8-624bee1a532a	4fa707a6-752b-4fda-9bc0-b07c80cf65c1	g.chr1:179051300T>C	ENST00000367627.3	+	1	789	c.37T>C	c.(37-39)Ttc>Ctc	p.F13L	TOR3A_ENST00000352445.6_Missense_Mutation_p.F13L	NM_022371.3	NP_071766.2	Q9H497	TOR3A_HUMAN	torsin family 3, member A	13			F -> L (in dbSNP:rs2296377). {ECO:0000269|PubMed:14702039, ECO:0000269|PubMed:15489334, ECO:0000269|Ref.3}.		ATP catabolic process (GO:0006200)|chaperone mediated protein folding requiring cofactor (GO:0051085)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum lumen (GO:0005788)|extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)			endometrium(1)|kidney(2)|large_intestine(4)|lung(4)|pancreas(1)|urinary_tract(1)	13						TTGGCTCTTTTTCCTGCTGCT	0.751													C|||	3842	0.767173	0.9879	0.6441	5008	,	,		12722	0.6677		0.7117	False		,,,				2504	0.7157				p.F13L		.											.	TOR3A-90	0			c.T37C						.	C	LEU/PHE	3262,174		1547,168,3	2.0	3.0	3.0		37	-0.8	0.0	1	dbSNP_100	3	5365,1739		2051,1263,238	yes	missense	TOR3A	NM_022371.3	22	3598,1431,241	CC,CT,TT		24.4792,5.064,18.1499	benign	13/398	179051300	8627,1913	1718	3552	5270	SO:0001583	missense	64222	exon1			CTCTTTTTCCTGC	BC001085	CCDS1329.1	1q25.2	2008-02-05	2003-04-02		ENSG00000186283	ENSG00000186283			11997	protein-coding gene	gene with protein product		607555	"""ATP-dependant interferon responsive"""	ADIR		10644435	Standard	NM_022371		Approved	FLJ22345, ADIR2	uc001gmd.3	Q9H497	OTTHUMG00000035077	ENST00000367627.3:c.37T>C	1.37:g.179051300T>C	ENSP00000356599:p.Phe13Leu	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	7	7	NM_022371	0	0	0	6	6	B4DSY0|B7ZB65|Q5M7Y7|Q8WVA7|Q8WWM2|Q9H495|Q9H6E7	Missense_Mutation	SNP	ENST00000367627.3	37	CCDS1329.1	1679	0.7687728937728938	484	0.983739837398374	250	0.6906077348066298	393	0.6870629370629371	552	0.7282321899736148	C	0.033	-1.323382	0.01309	0.94936	0.755208	ENSG00000186283	ENST00000367627;ENST00000367625;ENST00000352445	T;T;T	0.35421	1.31;1.4;1.63	0.427	-0.794	0.10918	.	1.274350	0.05916	N	0.632520	T	0.00012	0.0000	N	0.00368	-1.59	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.45906	-0.9229	8	0.02654	T	1	-1.1524	.	.	.	rs2296377;rs17844883;rs17856371;rs17857600;rs17857917;rs17858479;rs59034332;rs2296377	13	Q9H497	TOR3A_HUMAN	L	13	ENSP00000356599:F13L;ENSP00000356597:F13L;ENSP00000335351:F13L	ENSP00000335351:F13L	F	+	1	0	TOR3A	177317923	0.000000	0.05858	0.002000	0.10522	0.004000	0.04260	-1.490000	0.02304	-1.608000	0.01587	-1.610000	0.00802	TTC	T|0.229;C|0.771		0.751	TOR3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084927.1	NM_022371	
C10orf71	118461	bcgsc.ca	37	10	50533617	50533617	+	Silent	SNP	T	T	C	rs2377940	byFrequency	TCGA-PK-A5H9-01A-11D-A29I-10	TCGA-PK-A5H9-10A-01D-A29L-10	T	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	cb1f20fc-0df5-42f5-91b8-624bee1a532a	4fa707a6-752b-4fda-9bc0-b07c80cf65c1	g.chr10:50533617T>C	ENST00000374144.3	+	3	3315	c.3027T>C	c.(3025-3027)ggT>ggC	p.G1009G	C10orf71_ENST00000323868.4_Intron			Q711Q0	CJ071_HUMAN	chromosome 10 open reading frame 71	1009										endometrium(1)	1						TACCCGAGGGTGACATAGAAG	0.572													C|||	4367	0.872005	0.8071	0.8775	5008	,	,		18096	0.7837		0.9533	False		,,,				2504	0.9632				p.G1009G		.											.	C10orf71-90	0			c.T3027C						.	C	,	1126,258		460,206,26	57.0	59.0	58.0		3027,	-9.9	0.0	10	dbSNP_100	58	3039,143		1450,139,2	no	coding-synonymous,intron	C10orf71	NM_001135196.1,NM_199459.3	,	1910,345,28	CC,CT,TT		4.494,18.6416,8.7823	,	1009/1436,	50533617	4165,401	692	1591	2283	SO:0001819	synonymous_variant	118461	exon3			CGAGGGTGACATA	AL833265	CCDS44387.1	10q11.23	2012-05-31			ENSG00000177354	ENSG00000177354			26973	protein-coding gene	gene with protein product							Standard	NM_001135196		Approved	FLJ45913	uc021pqa.2	Q711Q0	OTTHUMG00000018190	ENST00000374144.3:c.3027T>C	10.37:g.50533617T>C		Somatic	201	1		WXS	Illumina GAIIx	Phase_I	266	8	NM_001135196	0	0	0	0	0	A0AVL8	Silent	SNP	ENST00000374144.3	37	CCDS44387.1																																																																																			T|0.133;C|0.867		0.572	C10orf71-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000047984.2	NM_199459	
STAMBPL1	57559	broad.mit.edu;bcgsc.ca	37	10	90665212	90665212	+	Missense_Mutation	SNP	G	G	T			TCGA-PK-A5H9-01A-11D-A29I-10	TCGA-PK-A5H9-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	cb1f20fc-0df5-42f5-91b8-624bee1a532a	4fa707a6-752b-4fda-9bc0-b07c80cf65c1	g.chr10:90665212G>T	ENST00000371926.3	+	3	1001	c.43G>T	c.(43-45)Gct>Tct	p.A15S	STAMBPL1_ENST00000371927.3_Missense_Mutation_p.A15S|STAMBPL1_ENST00000371924.1_Missense_Mutation_p.A15S	NM_020799.3	NP_065850.1	Q96FJ0	STALP_HUMAN	STAM binding protein-like 1	15						membrane (GO:0016020)	metal ion binding (GO:0046872)|metallopeptidase activity (GO:0008237)			breast(2)|endometrium(1)|large_intestine(2)|liver(2)|lung(2)|ovary(1)|skin(1)	11		Colorectal(252;0.0381)		Colorectal(12;6.38e-05)|COAD - Colon adenocarcinoma(12;7.75e-05)		AAAGTTAGCTGCTATGCCTGA	0.378																																					p.A15S		.											.	STAMBPL1-523	0			c.G43T						.						105.0	99.0	101.0					10																	90665212		2203	4300	6503	SO:0001583	missense	57559	exon3			TTAGCTGCTATGC	AB037794	CCDS7391.1	10q23.32	2006-11-08			ENSG00000138134	ENSG00000138134			24105	protein-coding gene	gene with protein product	"""associated molecule with the SH3 domain of STAM (AMSH) like protein"", ""associated molecule with the SH3 domain of STAM (AMSH) - Family Protein"""	612352				12810066, 12943674	Standard	NM_020799		Approved	AMSH-LP, KIAA1373, AMSH-FP, FLJ31524, ALMalpha, bA399O19.2	uc001kfk.4	Q96FJ0	OTTHUMG00000018702	ENST00000371926.3:c.43G>T	10.37:g.90665212G>T	ENSP00000360994:p.Ala15Ser	Somatic	58	0		WXS	Illumina GAIIx	Phase_I	71	5	NM_020799	0	0	1	1	0	B3KPA7|Q5T9N4|Q5T9N9|Q7Z420|Q9P2H4	Missense_Mutation	SNP	ENST00000371926.3	37	CCDS7391.1	.	.	.	.	.	.	.	.	.	.	G	15.18	2.756065	0.49362	.	.	ENSG00000138134	ENST00000371926;ENST00000371927;ENST00000371924	T;T;T	0.24151	1.9;1.87;1.9	5.24	4.33	0.51752	.	0.000000	0.85682	D	0.000000	T	0.41903	0.1179	L	0.41710	1.295	0.80722	D	1	B;D	0.76494	0.42;0.999	B;D	0.78314	0.155;0.991	T	0.31308	-0.9948	10	0.52906	T	0.07	-3.6166	15.2811	0.73784	0.0:0.1416:0.8584:0.0	.	15;15	Q96FJ0-2;Q96FJ0	.;STALP_HUMAN	S	15	ENSP00000360994:A15S;ENSP00000360995:A15S;ENSP00000360992:A15S	ENSP00000360992:A15S	A	+	1	0	STAMBPL1	90655192	1.000000	0.71417	0.979000	0.43373	0.041000	0.13682	9.224000	0.95209	1.513000	0.48852	-0.175000	0.13238	GCT	.		0.378	STAMBPL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049283.1	NM_020799	
MYOF	26509	bcgsc.ca	37	10	95107428	95107428	+	Missense_Mutation	SNP	G	G	A	rs11187393	byFrequency	TCGA-PK-A5H9-01A-11D-A29I-10	TCGA-PK-A5H9-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	cb1f20fc-0df5-42f5-91b8-624bee1a532a	4fa707a6-752b-4fda-9bc0-b07c80cf65c1	g.chr10:95107428G>A	ENST00000359263.4	-	37	4194	c.4195C>T	c.(4195-4197)Cgc>Tgc	p.R1399C	MYOF_ENST00000371502.4_Missense_Mutation_p.R1399C|MYOF_ENST00000371501.4_Missense_Mutation_p.R1399C|MYOF_ENST00000358334.5_Missense_Mutation_p.R1386C	NM_013451.3	NP_038479.1	Q9NZM1	MYOF_HUMAN	myoferlin	1399			R -> C (in dbSNP:rs11187393).		blood circulation (GO:0008015)|cellular response to heat (GO:0034605)|muscle contraction (GO:0006936)|plasma membrane repair (GO:0001778)|regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030947)	caveola (GO:0005901)|cytoplasmic vesicle (GO:0031410)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|nuclear envelope (GO:0005635)|plasma membrane (GO:0005886)	phospholipid binding (GO:0005543)			NS(2)|autonomic_ganglia(1)|breast(3)|endometrium(7)|kidney(7)|large_intestine(15)|lung(14)|ovary(4)|prostate(4)|skin(6)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	67						CAGCGAAAGCGGTCCAGGCGC	0.547													G|||	113	0.0225639	0.0045	0.0403	5008	,	,		15768	0.0		0.0656	False		,,,				2504	0.0133				p.R1399C		.											.	MYOF-93	0			c.C4195T						.	G	CYS/ARG,CYS/ARG	53,3885		0,53,1916	44.0	47.0	46.0		4195,4156	5.7	1.0	10	dbSNP_120	46	497,7795		13,471,3662	yes	missense,missense	MYOF	NM_013451.3,NM_133337.2	180,180	13,524,5578	AA,AG,GG		5.9937,1.3459,4.4971	possibly-damaging,possibly-damaging	1399/2062,1386/2049	95107428	550,11680	1969	4146	6115	SO:0001583	missense	26509	exon37			GAAAGCGGTCCAG	AB033033	CCDS41550.1, CCDS41551.1	10q24	2014-06-27	2008-11-26	2008-11-26	ENSG00000138119	ENSG00000138119			3656	protein-coding gene	gene with protein product	"""fer-1-like family member 3"""	604603	"""fer-1 (C.elegans)-like 3 (myoferlin)"", ""fer-1-like 3, myoferlin (C. elegans)"""	FER1L3		10607832, 10995573, 17702744	Standard	NM_013451		Approved	KIAA1207	uc001kin.3	Q9NZM1	OTTHUMG00000018772	ENST00000359263.4:c.4195C>T	10.37:g.95107428G>A	ENSP00000352208:p.Arg1399Cys	Somatic	171	0		WXS	Illumina GAIIx	Phase_I	163	7	NM_013451	0	0	24	24	0	B3KQN5|Q5VWW2|Q5VWW3|Q5VWW4|Q5VWW5|Q7Z642|Q8IWH0|Q9HBU3|Q9NZM0|Q9ULL3|Q9Y4U4	Missense_Mutation	SNP	ENST00000359263.4	37	CCDS41551.1	73	0.033424908424908424	4	0.008130081300813009	21	0.058011049723756904	0	0.0	48	0.0633245382585752	G	18.40	3.615468	0.66672	0.013459	0.059937	ENSG00000138119	ENST00000358334;ENST00000359263;ENST00000371501;ENST00000371502	T;T;T;T	0.67171	-0.25;-0.25;-0.25;-0.25	5.69	5.69	0.88448	C2 calcium-dependent membrane targeting (1);C2 calcium/lipid-binding domain, CaLB (1);	0.364053	0.30732	N	0.008983	T	0.11410	0.0278	N	0.14661	0.345	0.42947	D	0.994363	D;D	0.62365	0.959;0.991	P;B	0.51229	0.663;0.394	T	0.42103	-0.9471	10	0.59425	D	0.04	-11.0812	5.1512	0.15011	0.0773:0.1355:0.628:0.1592	rs11187393;rs52820934;rs11187393	1386;1399	Q9NZM1-6;Q9NZM1	.;MYOF_HUMAN	C	1386;1399;1399;1399	ENSP00000351094:R1386C;ENSP00000352208:R1399C;ENSP00000360556:R1399C;ENSP00000360557:R1399C	ENSP00000351094:R1386C	R	-	1	0	MYOF	95097418	1.000000	0.71417	1.000000	0.80357	0.671000	0.39405	1.330000	0.33781	2.691000	0.91804	0.561000	0.74099	CGC	G|0.960;A|0.040		0.547	MYOF-005	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000049423.2	NM_013451	
NFKB2	4791	hgsc.bcm.edu	37	10	104159196	104159196	+	Silent	SNP	A	A	G	rs4919633	byFrequency	TCGA-PK-A5H9-01A-11D-A29I-10	TCGA-PK-A5H9-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	cb1f20fc-0df5-42f5-91b8-624bee1a532a	4fa707a6-752b-4fda-9bc0-b07c80cf65c1	g.chr10:104159196A>G	ENST00000369966.3	+	13	1519	c.1269A>G	c.(1267-1269)ccA>ccG	p.P423P	NFKB2_ENST00000336486.5_3'UTR|NFKB2_ENST00000428099.1_Silent_p.P423P|NFKB2_ENST00000189444.6_Silent_p.P423P	NM_001077494.2	NP_001070962.1	Q00653	NFKB2_HUMAN	nuclear factor of kappa light polypeptide gene enhancer in B-cells 2 (p49/p100)	423					extracellular matrix organization (GO:0030198)|follicular dendritic cell differentiation (GO:0002268)|germinal center formation (GO:0002467)|innate immune response (GO:0045087)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|NIK/NF-kappaB signaling (GO:0038061)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of type I interferon production (GO:0032481)|regulation of transcription, DNA-templated (GO:0006355)|rhythmic process (GO:0048511)|spleen development (GO:0048536)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|transcription, DNA-templated (GO:0006351)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	Bcl3/NF-kappaB2 complex (GO:0033257)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)			NS(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(10)|skin(2)	23		Colorectal(252;0.00957)		Epithelial(162;3.4e-08)|all cancers(201;6.41e-07)	Acetylsalicylic acid(DB00945)|Glucosamine(DB01296)	CCGCGGAGCCAAGCGCCCCCT	0.786			T	IGH@	B-NHL								G|||	4942	0.986821	0.9539	0.9942	5008	,	,		10589	1.0		0.999	False		,,,				2504	1.0				p.P423P		.		Dom	yes		10	10q24	4791	nuclear factor of kappa light polypeptide gene enhancer in B-cells 2 (p49/p100)		L	.	NFKB2-522	0			c.A1269G						.	G	,,	2876,76		1401,74,1	3.0	5.0	4.0		1269,1269,1269	-4.9	0.0	10	dbSNP_111	4	6622,2		3310,2,0	no	coding-synonymous,coding-synonymous,coding-synonymous	NFKB2	NM_001077493.1,NM_001077494.1,NM_002502.3	,,	4711,76,1	GG,GA,AA		0.0302,2.5745,0.8145	,,	423/900,423/901,423/900	104159196	9498,78	1476	3312	4788	SO:0001819	synonymous_variant	4791	exon13			GGAGCCAAGCGCC	X61498	CCDS41564.1, CCDS41565.1	10q24	2013-01-10			ENSG00000077150	ENSG00000077150		"""Ankyrin repeat domain containing"""	7795	protein-coding gene	gene with protein product		164012				1876189	Standard	XM_005269860		Approved	LYT-10, p52, p105, NF-kB2	uc001kvb.4	Q00653	OTTHUMG00000018962	ENST00000369966.3:c.1269A>G	10.37:g.104159196A>G		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	10	10	NM_001077494	0	0	0	7	7	A8K9D9|D3DR83|Q04860|Q9BU75|Q9H471|Q9H472	Silent	SNP	ENST00000369966.3	37	CCDS41564.1																																																																																			A|0.009;G|0.991		0.786	NFKB2-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000050080.2		
TAF5	6877	hgsc.bcm.edu	37	10	105128134	105128134	+	Missense_Mutation	SNP	T	T	G	rs10883859	byFrequency	TCGA-PK-A5H9-01A-11D-A29I-10	TCGA-PK-A5H9-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	cb1f20fc-0df5-42f5-91b8-624bee1a532a	4fa707a6-752b-4fda-9bc0-b07c80cf65c1	g.chr10:105128134T>G	ENST00000369839.3	+	1	411	c.388T>G	c.(388-390)Tcc>Gcc	p.S130A	TAF5_ENST00000351396.4_Missense_Mutation_p.S130A	NM_006951.3	NP_008882.2	Q15542	TAF5_HUMAN	TAF5 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 100kDa	130			S -> A (in dbSNP:rs10883859). {ECO:0000269|PubMed:15489334, ECO:0000269|PubMed:8758937, ECO:0000269|PubMed:9045704, ECO:0000269|Ref.5}.		chromatin modification (GO:0016568)|DNA-templated transcription, initiation (GO:0006352)|gene expression (GO:0010467)|histone acetylation (GO:0016573)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	actin cytoskeleton (GO:0015629)|intracellular membrane-bounded organelle (GO:0043231)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor TFIID complex (GO:0005669)|transcription factor TFTC complex (GO:0033276)	protein dimerization activity (GO:0046983)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			breast(1)|central_nervous_system(1)|kidney(2)|large_intestine(5)|lung(4)|ovary(2)	15		Colorectal(252;0.0747)|Breast(234;0.128)		Epithelial(162;1.83e-09)|all cancers(201;1.4e-08)|BRCA - Breast invasive adenocarcinoma(275;0.198)		AGTGGCGGGCTCCGGAGCCCC	0.741													T|||	1553	0.310104	0.1952	0.4078	5008	,	,		9029	0.4206		0.329	False		,,,				2504	0.2628				p.S130A		.											.	TAF5-92	0			c.T388G						.	T	ALA/SER	635,2955		63,509,1223	3.0	5.0	4.0		388	1.9	1.0	10	dbSNP_120	4	2122,5176		327,1468,1854	no	missense	TAF5	NM_006951.3	99	390,1977,3077	GG,GT,TT		29.0765,17.688,25.3215	benign	130/801	105128134	2757,8131	1795	3649	5444	SO:0001583	missense	6877	exon1			GCGGGCTCCGGAG	X95525	CCDS7547.1	10q24-q25.2	2013-01-10	2002-08-29	2001-12-07	ENSG00000148835	ENSG00000148835		"""WD repeat domain containing"""	11539	protein-coding gene	gene with protein product		601787	"""TATA box binding protein (TBP)-associated factor, RNA polymerase II, D, 100kD"""	TAF2D		8884287, 8942982	Standard	NM_006951		Approved	TAFII100	uc001kwv.3	Q15542	OTTHUMG00000018985	ENST00000369839.3:c.388T>G	10.37:g.105128134T>G	ENSP00000358854:p.Ser130Ala	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	21	8	NM_006951	0	0	0	0	0	A8K5B4|B2RMR0|B7ZKJ6|Q53EM4|Q5SYD5|Q86UZ7|Q9Y4K5	Missense_Mutation	SNP	ENST00000369839.3	37	CCDS7547.1	821	0.3759157509157509	127	0.258130081300813	150	0.4143646408839779	277	0.48426573426573427	267	0.35224274406332456	T	12.78	2.040311	0.35989	0.17688	0.290765	ENSG00000148835	ENST00000369839;ENST00000351396	T;T	0.55930	0.73;0.49	4.45	1.88	0.25563	.	0.435426	0.24978	N	0.034100	T	0.00012	0.0000	N	0.04508	-0.205	0.41867	P	0.009742999999999946	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.0	T	0.46373	-0.9196	9	0.09338	T	0.73	-0.0936	6.2404	0.20787	0.1492:0.0:0.2595:0.5913	rs10883859	130;130	Q15542-2;Q15542	.;TAF5_HUMAN	A	130	ENSP00000358854:S130A;ENSP00000311024:S130A	ENSP00000311024:S130A	S	+	1	0	TAF5	105118124	0.988000	0.35896	1.000000	0.80357	0.948000	0.59901	0.932000	0.28884	0.814000	0.34374	0.459000	0.35465	TCC	T|0.623;G|0.377		0.741	TAF5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050144.1		
PWWP2B	170394	hgsc.bcm.edu	37	10	134219045	134219045	+	Silent	SNP	C	C	T	rs11146364	byFrequency	TCGA-PK-A5H9-01A-11D-A29I-10	TCGA-PK-A5H9-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	cb1f20fc-0df5-42f5-91b8-624bee1a532a	4fa707a6-752b-4fda-9bc0-b07c80cf65c1	g.chr10:134219045C>T	ENST00000305233.5	+	2	1100	c.1041C>T	c.(1039-1041)ccC>ccT	p.P347P	PWWP2B_ENST00000368609.4_Silent_p.P347P	NM_138499.3	NP_612508.3	Q6NUJ5	PWP2B_HUMAN	PWWP domain containing 2B	347										central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(5)|urinary_tract(1)	9		all_cancers(35;6.69e-12)|all_epithelial(44;1.55e-08)|Lung NSC(174;0.000845)|all_lung(145;0.00144)|all_neural(114;0.0299)|Breast(234;0.106)|Colorectal(31;0.109)|Melanoma(40;0.123)|Glioma(114;0.203)|all_hematologic(284;0.224)		OV - Ovarian serous cystadenocarcinoma(35;7.49e-05)|Epithelial(32;0.00016)|all cancers(32;0.000186)		AGCACGAGCCCGTGTACCGGG	0.721													C|||	820	0.163738	0.2027	0.2104	5008	,	,		13504	0.1429		0.1074	False		,,,				2504	0.1575				p.P347P		.											.	PWWP2B-90	0			c.C1041T						.	C	,	636,3612		51,534,1539	16.0	21.0	20.0		1041,1041	-2.7	0.1	10	dbSNP_120	20	704,7662		24,656,3503	yes	coding-synonymous,coding-synonymous	PWWP2B	NM_001098637.1,NM_138499.3	,	75,1190,5042	TT,TC,CC		8.415,14.9718,10.6231	,	347/500,347/591	134219045	1340,11274	2124	4183	6307	SO:0001819	synonymous_variant	170394	exon2			CGAGCCCGTGTAC	AK128663	CCDS7667.2	10q26.3	2009-06-03	2007-10-22	2007-10-22	ENSG00000171813	ENSG00000171813			25150	protein-coding gene	gene with protein product			"""PWWP domain containing 2"""	PWWP2			Standard	NM_001098637		Approved	bA432J24.1, FLJ46823	uc001lll.4	Q6NUJ5	OTTHUMG00000019286	ENST00000305233.5:c.1041C>T	10.37:g.134219045C>T		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	20	13	NM_001098637	0	0	29	60	31	A6NM90|B5MDQ1|H9KV61|Q5SZI0|Q6ZQX5|Q96F43	Silent	SNP	ENST00000305233.5	37	CCDS7667.2																																																																																			C|0.860;T|0.140		0.721	PWWP2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051075.3	NM_138499	
MUC2	4583	bcgsc.ca	37	11	1093393	1093393	+	Missense_Mutation	SNP	G	G	A	rs199525790		TCGA-PK-A5H9-01A-11D-A29I-10	TCGA-PK-A5H9-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	cb1f20fc-0df5-42f5-91b8-624bee1a532a	4fa707a6-752b-4fda-9bc0-b07c80cf65c1	g.chr11:1093393G>A	ENST00000441003.2	+	30	5239	c.5212G>A	c.(5212-5214)Ggc>Agc	p.G1738S	MUC2_ENST00000361558.6_Intron|MUC2_ENST00000359061.5_Missense_Mutation_p.G1705S|MUC2_ENST00000333592.6_Missense_Mutation_p.G26S	NM_002457.2	NP_002448.2	Q02817	MUC2_HUMAN	mucin 2, oligomeric mucus/gel-forming	0	Approximate repeats.				cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi lumen (GO:0005796)|inner mucus layer (GO:0070702)|outer mucus layer (GO:0070703)				NS(3)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(26)|haematopoietic_and_lymphoid_tissue(4)|kidney(11)|large_intestine(5)|lung(22)|ovary(2)|prostate(16)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	102		all_cancers(49;1.08e-07)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.191)		BRCA - Breast invasive adenocarcinoma(625;0.000207)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)	Pranlukast(DB01411)	aacacccaccggcacacagac	0.647																																					p.G1738S		.											.	MUC2-90	0			c.G5212A						.						167.0	217.0	200.0					11																	1093393		1999	3870	5869	SO:0001583	missense	4583	exon30			CCCACCGGCACAC	L21998		11p15.5	2011-01-28	2006-03-14		ENSG00000198788	ENSG00000198788		"""Mucins"""	7512	protein-coding gene	gene with protein product		158370	"""mucin 2, intestinal/tracheal"""			15081123	Standard	NM_002457		Approved		uc001lsx.1	Q02817	OTTHUMG00000156800	ENST00000441003.2:c.5212G>A	11.37:g.1093393G>A	ENSP00000415183:p.Gly1738Ser	Somatic	130	3		WXS	Illumina GAIIx	Phase_I	140	7	NM_002457	0	0	0	0	0	Q14878	Missense_Mutation	SNP	ENST00000441003.2	37		.	.	.	.	.	.	.	.	.	.	G	0.322	-0.961495	0.02249	.	.	ENSG00000198788	ENST00000441003;ENST00000359061;ENST00000333592	T;T;T	0.16743	3.21;3.25;2.32	0.677	-1.35	0.09114	.	381.381000	0.01358	N	0.012136	T	0.08537	0.0212	.	.	.	0.09310	N	1	B	0.06786	0.001	B	0.01281	0.0	T	0.21861	-1.0233	9	0.12430	T	0.62	.	4.7623	0.13113	0.7467:0.0:0.2533:0.0	.	1738	E7EUV1	.	S	1738;1705;26	ENSP00000415183:G1738S;ENSP00000351956:G1705S;ENSP00000331373:G26S	ENSP00000331373:G26S	G	+	1	0	MUC2	1083393	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	0.042000	0.13949	-0.796000	0.04456	-1.112000	0.02068	GGC	.		0.647	MUC2-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000345894.2	NM_002457	
SYT8	90019	hgsc.bcm.edu	37	11	1858572	1858572	+	Missense_Mutation	SNP	C	C	T	rs2292474	byFrequency	TCGA-PK-A5H9-01A-11D-A29I-10	TCGA-PK-A5H9-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	cb1f20fc-0df5-42f5-91b8-624bee1a532a	4fa707a6-752b-4fda-9bc0-b07c80cf65c1	g.chr11:1858572C>T	ENST00000381968.3	+	9	1245	c.1117C>T	c.(1117-1119)Cgg>Tgg	p.R373W	TNNI2_ENST00000381906.1_5'Flank|SYT8_ENST00000535046.1_3'UTR|TNNI2_ENST00000381911.1_5'Flank|SYT8_ENST00000341958.3_Missense_Mutation_p.R359W|TNNI2_ENST00000381905.3_5'Flank|TNNI2_ENST00000252898.7_5'Flank	NM_138567.3	NP_612634	Q8NBV8	SYT8_HUMAN	synaptotagmin VIII	373					acrosome reaction (GO:0007340)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|synaptic vesicle (GO:0008021)	transporter activity (GO:0005215)			breast(1)|large_intestine(1)|lung(2)|ovary(1)|skin(1)	6		all_epithelial(84;0.000138)|Breast(177;0.000962)|Ovarian(85;0.0014)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00136)|Lung(200;0.0681)|LUSC - Lung squamous cell carcinoma(625;0.082)		CATTGCCCAGCGGCACCCCCT	0.731													T|||	1928	0.384984	0.1679	0.415	5008	,	,		13483	0.378		0.498	False		,,,				2504	0.5481				p.R373W		.											.	SYT8-91	0			c.C1117T						.	T	TRP/ARG	906,3442		119,668,1387	12.0	14.0	14.0		1117	2.7	1.0	11	dbSNP_100	14	4072,4398		1026,2020,1189	no	missense	SYT8	NM_138567.3	101	1145,2688,2576	TT,TC,CC		48.0756,20.8372,38.836	benign	373/402	1858572	4978,7840	2174	4235	6409	SO:0001583	missense	90019	exon9			GCCCAGCGGCACC	AL137708	CCDS7726.2	11p15.5	2013-01-21			ENSG00000149043	ENSG00000149043		"""Synaptotagmins"""	19264	protein-coding gene	gene with protein product		607719				7791877	Standard	XM_005253216		Approved	DKFZp434K0322	uc001lue.1	Q8NBV8	OTTHUMG00000009026	ENST00000381968.3:c.1117C>T	11.37:g.1858572C>T	ENSP00000371394:p.Arg373Trp	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	30	4	NM_138567	0	0	0	0	0	A6NFJ4|Q9NSV9	Missense_Mutation	SNP	ENST00000381968.3	37	CCDS7726.2	855|855	0.3914835164835165|0.3914835164835165	84|84	0.17073170731707318|0.17073170731707318	163|163	0.45027624309392267|0.45027624309392267	226|226	0.3951048951048951|0.3951048951048951	382|382	0.503957783641161|0.503957783641161	t|t	1.107|1.107	-0.659353|-0.659353	0.03454|0.03454	0.208372|0.208372	0.480756|0.480756	ENSG00000149043|ENSG00000149043	ENST00000381978|ENST00000381968;ENST00000341958	.|T;T	.|0.03951	.|3.77;3.75	3.85|3.85	2.68|2.68	0.31781|0.31781	.|.	.|.	.|.	.|.	.|.	T|T	0.00012|0.00012	0.0000|0.0000	N|N	0.00005|0.00005	-3.275|-3.275	0.09310|0.09310	P|P	1.0|1.0	.|B;B	.|0.02656	.|0.0;0.0	.|B;B	.|0.01281	.|0.0;0.0	T|T	0.41928|0.41928	-0.9481|-0.9481	4|8	.|0.02654	.|T	.|1	.|.	8.5203|8.5203	0.33270|0.33270	0.0:0.1655:0.0:0.8345|0.0:0.1655:0.0:0.8345	rs2292474|rs2292474	.|373;359	.|Q8NBV8;A6NCR4	.|SYT8_HUMAN;.	V|W	371|373;359	.|ENSP00000371394:R373W;ENSP00000343691:R359W	.|ENSP00000343691:R359W	A|R	+|+	2|1	0|2	SYT8|SYT8	1815148|1815148	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.293000|0.293000	0.27360|0.27360	3.304000|3.304000	0.51866|0.51866	0.174000|0.174000	0.19809|0.19809	-0.665000|-0.665000	0.03846|0.03846	GCG|CGG	C|0.602;T|0.398		0.731	SYT8-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000025013.4		
STIM1	6786	bcgsc.ca	37	11	4103524	4103524	+	Silent	SNP	A	A	G	rs2304891	byFrequency	TCGA-PK-A5H9-01A-11D-A29I-10	TCGA-PK-A5H9-10A-01D-A29L-10	A	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	cb1f20fc-0df5-42f5-91b8-624bee1a532a	4fa707a6-752b-4fda-9bc0-b07c80cf65c1	g.chr11:4103524A>G	ENST00000300737.4	+	8	1649	c.1080A>G	c.(1078-1080)caA>caG	p.Q360Q	STIM1_ENST00000533977.1_Silent_p.Q187Q|STIM1_ENST00000527651.1_Silent_p.Q360Q	NM_003156.3	NP_003147.2	Q13586	STIM1_HUMAN	stromal interaction molecule 1	360	SOAR/CAD.				activation of store-operated calcium channel activity (GO:0032237)|blood coagulation (GO:0007596)|detection of calcium ion (GO:0005513)|regulation of calcium ion transport (GO:0051924)|regulation of store-operated calcium entry (GO:2001256)|store-operated calcium entry (GO:0002115)	cortical endoplasmic reticulum (GO:0032541)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|growth cone (GO:0030426)|integral component of endoplasmic reticulum membrane (GO:0030176)|integral component of plasma membrane (GO:0005887)|microtubule (GO:0005874)	calcium channel regulator activity (GO:0005246)|calcium ion binding (GO:0005509)|identical protein binding (GO:0042802)|microtubule plus-end binding (GO:0051010)|store-operated calcium channel activity (GO:0015279)			haematopoietic_and_lymphoid_tissue(1)|large_intestine(6)|liver(1)|lung(14)|pancreas(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	30		Breast(177;0.00159)|Medulloblastoma(188;0.00258)|all_neural(188;0.0233)		BRCA - Breast invasive adenocarcinoma(625;0.114)|LUSC - Lung squamous cell carcinoma(625;0.141)		TGGAGGTGCAATATTACAACA	0.507													A|||	1948	0.388978	0.0976	0.4841	5008	,	,		19607	0.4425		0.5676	False		,,,				2504	0.4765				p.Q360Q		.											.	STIM1-91	0			c.A1080G						.	A		765,3637	309.4+/-291.0	79,607,1515	68.0	62.0	64.0		1080	1.5	1.0	11	dbSNP_100	64	4938,3658	623.1+/-397.4	1403,2132,763	no	coding-synonymous	STIM1	NM_003156.3		1482,2739,2278	GG,GA,AA		42.5547,17.3785,43.876		360/686	4103524	5703,7295	2201	4298	6499	SO:0001819	synonymous_variant	6786	exon8			GGTGCAATATTAC	BC021300, U52426	CCDS7749.1, CCDS60706.1, CCDS73247.1	11p15.5	2014-09-17			ENSG00000167323	ENSG00000167323		"""Sterile alpha motif (SAM) domain containing"""	11386	protein-coding gene	gene with protein product		605921				8921403, 11463338, 11983428	Standard	NM_003156		Approved	GOK, D11S4896E	uc021qco.1	Q13586	OTTHUMG00000133360	ENST00000300737.4:c.1080A>G	11.37:g.4103524A>G		Somatic	173	0		WXS	Illumina GAIIx	Phase_I	178	7	NM_003156	0	0	42	42	0	E9PQJ4|Q8N382	Silent	SNP	ENST00000300737.4	37	CCDS7749.1	938	0.42948717948717946	51	0.10365853658536585	194	0.5359116022099447	272	0.4755244755244755	421	0.5554089709762533	A	10.06	1.246080	0.22796	0.173785	0.574453	ENSG00000167323	ENST00000526596	.	.	.	5.49	1.5	0.22942	.	.	.	.	.	T	0.00012	0.0000	.	.	.	0.09310	P	1.0	.	.	.	.	.	.	T	0.48570	-0.9024	3	.	.	.	-27.0925	9.4534	0.38741	0.2918:0.0:0.7082:0.0	rs2304891;rs17209912;rs57302968;rs2304891	.	.	.	S	91	.	.	N	+	2	0	STIM1	4060100	1.000000	0.71417	0.998000	0.56505	0.985000	0.73830	1.794000	0.38774	0.016000	0.14998	-0.375000	0.07067	AAT	A|0.576;G|0.424		0.507	STIM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257196.1	NM_003156	
NLRP10	338322	broad.mit.edu	37	11	7982353	7982353	+	Missense_Mutation	SNP	G	G	T			TCGA-PK-A5H9-01A-11D-A29I-10	TCGA-PK-A5H9-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	cb1f20fc-0df5-42f5-91b8-624bee1a532a	4fa707a6-752b-4fda-9bc0-b07c80cf65c1	g.chr11:7982353G>T	ENST00000328600.2	-	2	967	c.806C>A	c.(805-807)cCc>cAc	p.P269H		NM_176821.3	NP_789791.1	Q86W26	NAL10_HUMAN	NLR family, pyrin domain containing 10	269	NACHT. {ECO:0000255|PROSITE- ProRule:PRU00136}.				defense response to fungus (GO:0050832)|defense response to Gram-negative bacterium (GO:0050829)|dendritic cell migration (GO:0036336)|helper T cell enhancement of adaptive immune response (GO:0035397)|innate immune response (GO:0045087)|positive regulation of interleukin-6 secretion (GO:2000778)|positive regulation of interleukin-8 secretion (GO:2000484)|positive regulation of T-helper 1 type immune response (GO:0002827)|positive regulation of T-helper 17 type immune response (GO:2000318)	cytoplasm (GO:0005737)|extrinsic component of plasma membrane (GO:0019897)	ATP binding (GO:0005524)			breast(1)|endometrium(2)|kidney(2)|large_intestine(8)|liver(1)|lung(28)|ovary(2)|pancreas(1)|prostate(2)|skin(8)|upper_aerodigestive_tract(1)|urinary_tract(2)	58				Epithelial(150;1.47e-07)|BRCA - Breast invasive adenocarcinoma(625;0.189)		GCTCTCCTTGGGACTCAAACC	0.552																																					p.P269H		.											.	NLRP10-209	0			c.C806A						.						82.0	82.0	82.0					11																	7982353		2201	4296	6497	SO:0001583	missense	338322	exon2			TCCTTGGGACTCA	AY154465	CCDS7784.1	11p15.4	2006-12-08	2006-12-08	2006-12-08		ENSG00000182261		"""Nucleotide-binding domain and leucine rich repeat containing"""	21464	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 10"""	609662	"""NACHT, leucine rich repeat and PYD containing 10"""	NALP10		12563287	Standard	NM_176821		Approved	NOD8, PAN5, Pynod, CLR11.1	uc001mfv.1	Q86W26		ENST00000328600.2:c.806C>A	11.37:g.7982353G>T	ENSP00000327763:p.Pro269His	Somatic	63	0		WXS	Illumina GAIIx	Phase_I	66	3	NM_176821	0	0	0	0	0	Q2M3C4|Q6JGT0	Missense_Mutation	SNP	ENST00000328600.2	37	CCDS7784.1	.	.	.	.	.	.	.	.	.	.	G	9.207	1.029885	0.19512	.	.	ENSG00000182261	ENST00000328600	T	0.79554	-1.28	4.72	1.65	0.23941	NACHT nucleoside triphosphatase (1);	0.823287	0.10256	N	0.696578	D	0.86125	0.5858	M	0.90019	3.08	0.09310	N	1	P	0.42692	0.787	P	0.48524	0.58	T	0.75679	-0.3234	10	0.87932	D	0	.	7.1511	0.25612	0.096:0.3446:0.5593:0.0	.	269	Q86W26	NAL10_HUMAN	H	269	ENSP00000327763:P269H	ENSP00000327763:P269H	P	-	2	0	NLRP10	7938929	0.061000	0.20836	0.001000	0.08648	0.040000	0.13550	2.226000	0.42963	0.240000	0.21263	0.563000	0.77884	CCC	.		0.552	NLRP10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385705.1	NM_176821	
FNBP4	23360	hgsc.bcm.edu	37	11	47788664	47788669	+	In_Frame_Del	DEL	GGTGGT	GGTGGT	-	rs59413596|rs67450550|rs397711020	byFrequency	TCGA-PK-A5H9-01A-11D-A29I-10	TCGA-PK-A5H9-10A-01D-A29L-10	GGTGGT	GGTGGT	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	cb1f20fc-0df5-42f5-91b8-624bee1a532a	4fa707a6-752b-4fda-9bc0-b07c80cf65c1	g.chr11:47788664_47788669delGGTGGT	ENST00000263773.5	-	1	184_189	c.172_177delACCACC	c.(172-177)accaccdel	p.TT58del	FNBP4_ENST00000534003.1_5'UTR	NM_015308.2	NP_056123.2	Q8N3X1	FNBP4_HUMAN	formin binding protein 4	58						nucleus (GO:0005634)		p.T58_T59delTT(3)		NS(1)|breast(2)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(6)|lung(12)|ovary(3)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	44						CAGTCACCGCGGTGGTGGTGGTCGTC	0.748														1722	0.34385	0.084	0.317	5008	,	,		12964	0.4345		0.4304	False		,,,				2504	0.5317				p.58_59del		.											.	FNBP4-91	3	Deletion - In frame(3)	prostate(1)|breast(1)|central_nervous_system(1)	c.172_177del						.			233,2043		62,109,967						-2.3	0.0		dbSNP_130	3	1924,3380		655,614,1383	no	coding	FNBP4	NM_015308.2		717,723,2350	A1A1,A1R,RR		36.2745,10.2373,28.4565				2157,5423				SO:0001651	inframe_deletion	23360	exon1			CACCGCGGTGGTG	BC037404	CCDS41644.1	11q12.1	2008-02-05			ENSG00000109920	ENSG00000109920			19752	protein-coding gene	gene with protein product		615265				10231032	Standard	NM_015308		Approved	KIAA1014	uc009ylv.3	Q8N3X1	OTTHUMG00000166533	ENST00000263773.5:c.172_177delACCACC	11.37:g.47788670_47788675delGGTGGT	ENSP00000263773:p.Thr58_Thr59del	Somatic	5	4		WXS	Illumina GAIIx	Phase_I	13	12	NM_015308	0	0	0	0	0	Q9H985|Q9NT81|Q9Y2L7	In_Frame_Del	DEL	ENST00000263773.5	37	CCDS41644.1																																																																																			.		0.748	FNBP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390237.3		
FNBP4	23360	hgsc.bcm.edu	37	11	47788695	47788695	+	Missense_Mutation	SNP	G	G	C	rs11039375	byFrequency	TCGA-PK-A5H9-01A-11D-A29I-10	TCGA-PK-A5H9-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	cb1f20fc-0df5-42f5-91b8-624bee1a532a	4fa707a6-752b-4fda-9bc0-b07c80cf65c1	g.chr11:47788695G>C	ENST00000263773.5	-	1	158	c.146C>G	c.(145-147)cCc>cGc	p.P49R	FNBP4_ENST00000534003.1_5'UTR	NM_015308.2	NP_056123.2	Q8N3X1	FNBP4_HUMAN	formin binding protein 4	49						nucleus (GO:0005634)				NS(1)|breast(2)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(6)|lung(12)|ovary(3)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	44						CGACGGGGCGGGCTGGCTGGG	0.756													G|||	41	0.0081869	0.0	0.0	5008	,	,		11982	0.0367		0.0	False		,,,				2504	0.0041				p.P49R		.											.	FNBP4-91	0			c.C146G						.						2.0	4.0	3.0					11																	47788695		1314	3088	4402	SO:0001583	missense	23360	exon1			GGGGCGGGCTGGC	BC037404	CCDS41644.1	11q12.1	2008-02-05			ENSG00000109920	ENSG00000109920			19752	protein-coding gene	gene with protein product		615265				10231032	Standard	NM_015308		Approved	KIAA1014	uc009ylv.3	Q8N3X1	OTTHUMG00000166533	ENST00000263773.5:c.146C>G	11.37:g.47788695G>C	ENSP00000263773:p.Pro49Arg	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	23	13	NM_015308	0	0	0	2	2	Q9H985|Q9NT81|Q9Y2L7	Missense_Mutation	SNP	ENST00000263773.5	37	CCDS41644.1	55	0.025183150183150184	0	0.0	11	0.03038674033149171	44	0.07692307692307693	0	0.0	G	16.71	3.199136	0.58126	.	.	ENSG00000109920	ENST00000263773	T	0.29917	1.55	4.6	3.69	0.42338	.	1.454350	0.03901	N	0.280319	T	0.01661	0.0053	L	0.44542	1.39	0.19300	N	0.999975	B	0.23650	0.089	B	0.23716	0.048	T	0.11179	-1.0598	10	0.28530	T	0.3	-2.4883	9.9918	0.41877	0.0948:0.0:0.9052:0.0	rs11039375	49	Q8N3X1	FNBP4_HUMAN	R	49	ENSP00000263773:P49R	ENSP00000263773:P49R	P	-	2	0	FNBP4	47745271	1.000000	0.71417	0.659000	0.29680	0.864000	0.49448	2.392000	0.44433	1.301000	0.44836	-0.218000	0.12543	CCC	G|0.975;C|0.025		0.756	FNBP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390237.3		
SLC22A24	283238	broad.mit.edu;bcgsc.ca	37	11	62886800	62886800	+	Missense_Mutation	SNP	G	G	C	rs4963245	byFrequency	TCGA-PK-A5H9-01A-11D-A29I-10	TCGA-PK-A5H9-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	cb1f20fc-0df5-42f5-91b8-624bee1a532a	4fa707a6-752b-4fda-9bc0-b07c80cf65c1	g.chr11:62886800G>C	ENST00000417740.1	-	3	955	c.514C>G	c.(514-516)Cgg>Ggg	p.R172G	SLC22A24_ENST00000326192.5_Missense_Mutation_p.R172G	NM_001136506.2	NP_001129978.2	Q8N4F4	S22AO_HUMAN	solute carrier family 22, member 24	172					ion transport (GO:0006811)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)				kidney(1)|stomach(1)	2						ATGATCTTCCGTCCAACCCTA	0.418													G|||	820	0.163738	0.0522	0.3415	5008	,	,		20519	0.0317		0.3002	False		,,,				2504	0.184				p.R172G		.											.	.	0			c.C514G						.	G	GLY/ARG	145,1239		10,125,557	132.0	116.0	121.0		514	-3.7	0.0	11	dbSNP_111	121	1023,2159		172,679,740	yes	missense	SLC22A24	NM_001136506.2	125	182,804,1297	CC,CG,GG		32.1496,10.4769,25.5804	probably-damaging	172/553	62886800	1168,3398	692	1591	2283	SO:0001583	missense	283238	exon3			TCTTCCGTCCAAC		CCDS73308.1	11q12.3	2013-05-22			ENSG00000197658	ENSG00000197658		"""Solute carriers"""	28542	protein-coding gene	gene with protein product		611698				17714910	Standard	NM_001136506		Approved	MGC34821, NET46	uc021qkp.1	Q8N4F4	OTTHUMG00000165372	ENST00000417740.1:c.514C>G	11.37:g.62886800G>C	ENSP00000396586:p.Arg172Gly	Somatic	107	0		WXS	Illumina GAIIx	Phase_I	127	5	NM_001136506	0	0	0	0	0		Missense_Mutation	SNP	ENST00000417740.1	37		369	0.16895604395604397	28	0.056910569105691054	102	0.281767955801105	23	0.04020979020979021	216	0.2849604221635884	G	13.83	2.352998	0.41700	0.104769	0.321496	ENSG00000197658	ENST00000417740;ENST00000531535;ENST00000326192	D;T	0.84370	-1.84;-0.25	3.86	-3.71	0.04424	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.000000	0.85682	U	0.000000	T	0.00039	0.0001	H	0.98446	4.235	0.80722	P	0.0	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.48559	-0.9025	9	0.87932	D	0	.	5.6254	0.17480	0.1821:0.0:0.2292:0.5887	rs4963245;rs52815620;rs4963245	172;172	Q8N4F4;C9JC66	S22AO_HUMAN;.	G	172	ENSP00000396586:R172G;ENSP00000321549:R172G	ENSP00000321549:R172G	R	-	1	2	SLC22A24	62643376	0.000000	0.05858	0.000000	0.03702	0.083000	0.17756	-3.203000	0.00559	-0.444000	0.07170	-0.403000	0.06358	CGG	G|0.827;C|0.173		0.418	SLC22A24-003	PUTATIVE	non_canonical_polymorphism|basic|appris_principal|exp_conf	protein_coding	protein_coding	OTTHUMT00000383747.1	NM_173586	
SNX15	29907	hgsc.bcm.edu	37	11	64809090	64809090	+	IGR	SNP	T	T	G	rs12271134	byFrequency	TCGA-PK-A5H9-01A-11D-A29I-10	TCGA-PK-A5H9-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	cb1f20fc-0df5-42f5-91b8-624bee1a532a	4fa707a6-752b-4fda-9bc0-b07c80cf65c1	g.chr11:64809090T>G	ENST00000377244.3	+	0	1939				SAC3D1_ENST00000398846.1_Missense_Mutation_p.L109R|SAC3D1_ENST00000531072.1_Missense_Mutation_p.L109R|SAC3D1_ENST00000530213.1_3'UTR	NM_013306.4|NM_147777.3	NP_037438.2|NP_680086.2	Q9NRS6	SNX15_HUMAN	sorting nexin 15						intracellular protein transport (GO:0006886)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleolus (GO:0005730)	phosphatidylinositol binding (GO:0035091)			endometrium(1)|large_intestine(1)|lung(6)|ovary(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	14						CGAGCTGTGCTCCTGGACCTG	0.746													G|||	4995	0.997404	0.9909	0.9986	5008	,	,		9130	1.0		1.0	False		,,,				2504	1.0				p.L109R	Esophageal Squamous(56;269 1304 3324 8253)	.											.	SAC3D1-90	0			c.T326G						.	G	ARG/LEU	2642,10		1316,10,0	2.0	2.0	2.0		326	3.9	0.9	11	dbSNP_120	2	5685,1		2842,1,0	no	missense	SAC3D1	NM_013299.3	102	4158,11,0	GG,GT,TT		0.0176,0.3771,0.1319	benign	109/359	64809090	8327,11	1326	2843	4169	SO:0001628	intergenic_variant	29901	exon1			CTGTGCTCCTGGA	AF175267	CCDS8089.1, CCDS8090.1	11q12	2008-05-22			ENSG00000110025	ENSG00000110025		"""Sorting nexins"""	14978	protein-coding gene	gene with protein product		605964				11208079	Standard	NM_013306		Approved			Q9NRS6	OTTHUMG00000037387		11.37:g.64809090T>G		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	5	5	NM_013299	0	0	0	3	3	E5KQS6|Q9NRS5	Missense_Mutation	SNP	ENST00000377244.3	37	CCDS8089.1	2174	0.9954212454212454	489	0.9939024390243902	361	0.9972375690607734	566	0.9895104895104895	758	1.0	G	5.044	0.193816	0.09599	0.996229	0.999824	ENSG00000168061	ENST00000531072;ENST00000398846;ENST00000301885;ENST00000529996	T;T;T	0.20598	2.06;2.06;2.06	3.9	3.9	0.45041	.	0.000000	0.38272	N	0.001754	T	0.00012	0.0000	N	0.00104	-2.125	0.53688	P	2.8999999999945736E-5	B	0.02656	0.0	B	0.01281	0.0	T	0.37798	-0.9690	9	0.02654	T	1	-10.6158	10.9504	0.47325	0.0:0.0:0.811:0.189	rs12271134	155	A6NKF1	SAC31_HUMAN	R	109;109;154;125	ENSP00000436649:L109R;ENSP00000381824:L109R;ENSP00000436704:L125R	ENSP00000301885:L154R	L	+	2	0	SAC3D1	64565666	1.000000	0.71417	0.924000	0.36721	0.504000	0.33889	3.759000	0.55227	1.003000	0.39130	-0.217000	0.12591	CTC	T|0.005;G|0.995		0.746	SNX15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000091004.3		
FAM86C1	55199	hgsc.bcm.edu	37	11	71498648	71498648	+	Silent	SNP	A	A	G	rs12277291	byFrequency	TCGA-PK-A5H9-01A-11D-A29I-10	TCGA-PK-A5H9-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	cb1f20fc-0df5-42f5-91b8-624bee1a532a	4fa707a6-752b-4fda-9bc0-b07c80cf65c1	g.chr11:71498648A>G	ENST00000359244.4	+	1	89	c.66A>G	c.(64-66)gcA>gcG	p.A22A	FAM86C1_ENST00000426628.2_Silent_p.A22A|FAM86C1_ENST00000346333.6_Silent_p.A22A	NM_018172.2	NP_060642.2	Q9NVL1	FA86C_HUMAN	family with sequence similarity 86, member C1	22										lung(1)	1						GCTTCCTGGCAGCGCGCGCCC	0.736													.|||	2256	0.450479	0.3336	0.3487	5008	,	,		9324	0.3452		0.5666	False		,,,				2504	0.6697				p.A22A		.											.	FAM86C1-90	0			c.A66G						.						4.0	4.0	4.0					11																	71498648		1821	3489	5310	SO:0001819	synonymous_variant	55199	exon1			CCTGGCAGCGCGC	AK130709	CCDS8202.1, CCDS41686.1, CCDS44664.1	11q13.4	2011-07-07	2011-07-07	2011-07-07	ENSG00000158483	ENSG00000158483			25561	protein-coding gene	gene with protein product			"""family with sequence similarity 86, member C"""	FAM86C		12477932	Standard	NM_152563		Approved	FLJ10661, FLJ27199	uc001oqv.4	Q9NVL1	OTTHUMG00000160552	ENST00000359244.4:c.66A>G	11.37:g.71498648A>G		Somatic	2	0		WXS	Illumina GAIIx	Phase_I	22	8	NM_152563	0	0	1	1	0	Q8N5D3	Silent	SNP	ENST00000359244.4	37	CCDS41686.1																																																																																			A|0.630;G|0.370		0.736	FAM86C1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000361120.1	NM_152563	
FAM86C1	55199	hgsc.bcm.edu	37	11	71498671	71498671	+	Missense_Mutation	SNP	G	G	C	rs12283346	byFrequency	TCGA-PK-A5H9-01A-11D-A29I-10	TCGA-PK-A5H9-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	cb1f20fc-0df5-42f5-91b8-624bee1a532a	4fa707a6-752b-4fda-9bc0-b07c80cf65c1	g.chr11:71498671G>C	ENST00000359244.4	+	1	112	c.89G>C	c.(88-90)cGc>cCc	p.R30P	FAM86C1_ENST00000426628.2_Missense_Mutation_p.R30P|FAM86C1_ENST00000346333.6_Missense_Mutation_p.R30P	NM_018172.2	NP_060642.2	Q9NVL1	FA86C_HUMAN	family with sequence similarity 86, member C1	30			R -> P (in dbSNP:rs12283346). {ECO:0000269|PubMed:14702039}.							lung(1)	1						CGCTCCTTCCGCTGGCAGGTG	0.741													.|||	2261	0.451478	0.3351	0.3516	5008	,	,		10448	0.3452		0.5666	False		,,,				2504	0.6708				p.R30P		.											.	FAM86C1-90	0			c.G89C						.						3.0	3.0	3.0					11																	71498671		1774	3427	5201	SO:0001583	missense	55199	exon1			CCTTCCGCTGGCA	AK130709	CCDS8202.1, CCDS41686.1, CCDS44664.1	11q13.4	2011-07-07	2011-07-07	2011-07-07	ENSG00000158483	ENSG00000158483			25561	protein-coding gene	gene with protein product			"""family with sequence similarity 86, member C"""	FAM86C		12477932	Standard	NM_152563		Approved	FLJ10661, FLJ27199	uc001oqv.4	Q9NVL1	OTTHUMG00000160552	ENST00000359244.4:c.89G>C	11.37:g.71498671G>C	ENSP00000352182:p.Arg30Pro	Somatic	2	0		WXS	Illumina GAIIx	Phase_I	21	8	NM_152563	0	0	0	0	0	Q8N5D3	Missense_Mutation	SNP	ENST00000359244.4	37	CCDS41686.1	871	0.39880952380952384	166	0.33739837398373984	136	0.3756906077348066	173	0.30244755244755245	396	0.5224274406332454	.	1.506	-0.550640	0.03996	.	.	ENSG00000158483	ENST00000346333;ENST00000359244;ENST00000426628;ENST00000528685	T;T;T;T	0.08634	3.07;3.07;3.07;3.07	2.47	2.47	0.30058	.	.	.	.	.	T	0.00012	0.0000	.	.	.	0.58432	P	4.000000000004E-6	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.01281	0.0;0.0;0.0	T	0.44483	-0.9325	7	0.02654	T	1	.	7.3824	0.26864	0.0:0.7256:0.2744:0.0	rs12283346	30;30;30	G3V0F7;Q9NVL1-2;Q9NVL1	.;.;FA86C_HUMAN	P	30	ENSP00000325662:R30P;ENSP00000352182:R30P;ENSP00000391329:R30P;ENSP00000436598:R30P	ENSP00000325662:R30P	R	+	2	0	FAM86C1	71176319	0.633000	0.27181	0.784000	0.31847	0.041000	0.13682	0.888000	0.28268	0.155000	0.19261	-1.123000	0.02005	CGC	G|0.601;C|0.399		0.741	FAM86C1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000361120.1	NM_152563	
CHRDL2	25884	broad.mit.edu;bcgsc.ca	37	11	74429769	74429769	+	Nonsense_Mutation	SNP	G	G	T			TCGA-PK-A5H9-01A-11D-A29I-10	TCGA-PK-A5H9-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	cb1f20fc-0df5-42f5-91b8-624bee1a532a	4fa707a6-752b-4fda-9bc0-b07c80cf65c1	g.chr11:74429769G>T	ENST00000376332.3	-	2	687	c.191C>A	c.(190-192)tCa>tAa	p.S64*	CHRDL2_ENST00000263671.5_Nonsense_Mutation_p.S64*|CHRDL2_ENST00000534159.1_5'UTR|SNORD43_ENST00000390975.1_RNA|MIR4696_ENST00000581431.1_RNA	NM_001278473.1	NP_001265402.1	Q6WN34	CRDL2_HUMAN	chordin-like 2	64	VWFC 1. {ECO:0000255|PROSITE- ProRule:PRU00220}.				cartilage development (GO:0051216)|cell differentiation (GO:0030154)|ossification (GO:0001503)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)				endometrium(1)|kidney(1)|large_intestine(6)|lung(4)|prostate(1)|skin(2)	15	Hepatocellular(1;0.098)					ACCTACCTCTGAGCAGGTACA	0.577																																					p.S64X		.											.	CHRDL2-90	0			c.C191A						.						69.0	52.0	58.0					11																	74429769		2200	4293	6493	SO:0001587	stop_gained	25884	exon2			ACCTCTGAGCAGG	AL110168	CCDS8234.1, CCDS60893.1	11q13.4	2013-09-20			ENSG00000054938	ENSG00000054938			24168	protein-coding gene	gene with protein product		613127				12853144, 12975309	Standard	NM_015424		Approved	BNF1	uc001ovh.3	Q6WN34	OTTHUMG00000165623	ENST00000376332.3:c.191C>A	11.37:g.74429769G>T	ENSP00000365510:p.Ser64*	Somatic	62	0		WXS	Illumina GAIIx	Phase_I	52	4	NM_015424	0	0	0	0	0	A5PKU9|Q6WN30|Q6WN31|Q6WN32|Q7Z5J3	Nonsense_Mutation	SNP	ENST00000376332.3	37		.	.	.	.	.	.	.	.	.	.	G	37	6.586123	0.97684	.	.	ENSG00000054938	ENST00000263671;ENST00000376332;ENST00000528789	.	.	.	5.47	5.47	0.80525	.	0.242522	0.36374	N	0.002635	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-9.4982	16.8041	0.85621	0.0:0.0:1.0:0.0	.	.	.	.	X	64	.	ENSP00000263671:S64X	S	-	2	0	CHRDL2	74107417	1.000000	0.71417	0.930000	0.37139	0.077000	0.17291	6.315000	0.72853	2.572000	0.86782	0.561000	0.74099	TCA	.		0.577	CHRDL2-002	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000385391.1		
B3GNT6	192134	hgsc.bcm.edu	37	11	76751542	76751542	+	Frame_Shift_Del	DEL	T	T	-	rs11292198		TCGA-PK-A5H9-01A-11D-A29I-10	TCGA-PK-A5H9-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	cb1f20fc-0df5-42f5-91b8-624bee1a532a	4fa707a6-752b-4fda-9bc0-b07c80cf65c1	g.chr11:76751542delT	ENST00000533140.1	+	2	1085	c.947delT	c.(946-948)cttfs	p.L316fs	B3GNT6_ENST00000421061.1_Intron|B3GNT6_ENST00000354301.5_Splice_Site_p.L316fs			O43505	B3GN1_HUMAN	UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 6 (core 3 synthase)	0					axon guidance (GO:0007411)|carbohydrate metabolic process (GO:0005975)|glycosaminoglycan metabolic process (GO:0030203)|keratan sulfate biosynthetic process (GO:0018146)|keratan sulfate metabolic process (GO:0042339)|poly-N-acetyllactosamine biosynthetic process (GO:0030311)|protein glycosylation (GO:0006486)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|integral component of Golgi membrane (GO:0030173)	N-acetyllactosaminide beta-1,3-N-acetylglucosaminyltransferase activity (GO:0008532)			central_nervous_system(1)|kidney(2)|lung(4)|prostate(1)	8						GGCATGTGTCTTGGAGCGCGC	0.741													T|TT|T|insertion	5008	1.0	1.0	1.0	5008	,	,		12582	1.0		1.0	False		,,,				2504	1.0				.		.											.	.	0			c.946+1T>-						.						1.0	1.0	1.0					11																	76751542		431	917	1348	SO:0001589	frameshift_variant	192134	exon2			TGTGTCTTGGAGC	AB073740	CCDS53681.1	11q13.4	2013-02-19			ENSG00000198488	ENSG00000198488		"""Beta 3-glycosyltransferases"""	24141	protein-coding gene	gene with protein product		615315				11821425	Standard	NM_138706		Approved	B3Gn-T6	uc021qnp.1	Q6ZMB0		ENST00000533140.1:c.947delT	11.37:g.76751542delT	ENSP00000435352:p.Leu316fs	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	29	28	NM_138706	0	0	0	0	0	Q4TTN0	Splice_Site	DEL	ENST00000533140.1	37	CCDS53681.1																																																																																			.		0.741	B3GNT6-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000382740.2	NM_138706	
PLBD1	79887	hgsc.bcm.edu	37	12	14720583	14720583	+	Silent	SNP	T	T	C	rs7954623	byFrequency	TCGA-PK-A5H9-01A-11D-A29I-10	TCGA-PK-A5H9-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	cb1f20fc-0df5-42f5-91b8-624bee1a532a	4fa707a6-752b-4fda-9bc0-b07c80cf65c1	g.chr12:14720583T>C	ENST00000240617.5	-	1	700	c.48A>G	c.(46-48)ccA>ccG	p.P16P	RP11-695J4.2_ENST00000545424.1_RNA|RP11-695J4.2_ENST00000542401.1_RNA	NM_024829.5	NP_079105.4	Q6P4A8	PLBL1_HUMAN	phospholipase B domain containing 1	16					glycerophospholipid biosynthetic process (GO:0046474)|lipid catabolic process (GO:0016042)|phosphatidylcholine acyl-chain remodeling (GO:0036151)|phosphatidylethanolamine acyl-chain remodeling (GO:0036152)|phosphatidylinositol acyl-chain remodeling (GO:0036149)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|lysosome (GO:0005764)	hydrolase activity (GO:0016787)			central_nervous_system(1)|cervix(2)|endometrium(3)|kidney(3)|large_intestine(2)|lung(3)|prostate(1)|upper_aerodigestive_tract(1)	16						gcagaagcggtggcggctgtg	0.766													C|||	4627	0.923922	0.7663	0.9741	5008	,	,		9999	0.9861		0.9871	False		,,,				2504	0.9724				p.P16P		.											.	PLBD1-90	0			c.A48G						.						1.0	1.0	1.0					12																	14720583		540	1082	1622	SO:0001819	synonymous_variant	79887	exon1			AAGCGGTGGCGGC	BC000909	CCDS31751.1	12p13.1	2013-10-11			ENSG00000121316	ENSG00000121316			26215	protein-coding gene	gene with protein product	"""PLB homolog 1 (Dictyostelium)"""					15193148, 19019078	Standard	NM_024829		Approved	FLJ22662	uc001rcc.1	Q6P4A8	OTTHUMG00000168821	ENST00000240617.5:c.48A>G	12.37:g.14720583T>C		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	6	6	NM_024829	0	0	0	3	3	A8K4E9|Q9BVV3|Q9H625	Silent	SNP	ENST00000240617.5	37	CCDS31751.1																																																																																			T|0.056;C|0.944		0.766	PLBD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401203.1	NM_024829	
TUBA1C	84790	ucsc.edu	37	12	49666152	49666152	+	Silent	SNP	G	G	A	rs199599214	byFrequency	TCGA-PK-A5H9-01A-11D-A29I-10	TCGA-PK-A5H9-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	cb1f20fc-0df5-42f5-91b8-624bee1a532a	4fa707a6-752b-4fda-9bc0-b07c80cf65c1	g.chr12:49666152G>A	ENST00000301072.6	+	4	767	c.492G>A	c.(490-492)aaG>aaA	p.K164K	TUBA1C_ENST00000541364.1_Silent_p.K234K|RP11-161H23.5_ENST00000550468.2_RNA	NM_032704.3	NP_116093.1	Q9BQE3	TBA1C_HUMAN	tubulin, alpha 1c	164					'de novo' posttranslational protein folding (GO:0051084)|cell division (GO:0051301)|cellular protein metabolic process (GO:0044267)|cytoskeleton-dependent intracellular transport (GO:0030705)|microtubule-based process (GO:0007017)|protein folding (GO:0006457)|protein polymerization (GO:0051258)	cytoplasmic microtubule (GO:0005881)|microtubule (GO:0005874)|nucleus (GO:0005634)|vesicle (GO:0031982)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)	p.K164K(1)		endometrium(1)|large_intestine(3)|liver(1)|lung(7)|skin(1)	13						ATGGCAAGAAGTCCAAGCTGG	0.547																																					p.K164K		.											.	TUBA1C-90	1	Substitution - coding silent(1)	large_intestine(1)	c.G492A						.						56.0	58.0	57.0					12																	49666152		2203	4300	6503	SO:0001819	synonymous_variant	84790	exon4			CAAGAAGTCCAAG	BC004949	CCDS8782.1	12q13.12	2007-03-16	2007-02-12	2007-02-12		ENSG00000167553		"""Tubulins"""	20768	protein-coding gene	gene with protein product			"""tubulin, alpha 6"""	TUBA6		7821789	Standard	NM_032704		Approved	MGC14580, MGC10851, bcm948	uc001rtt.1	Q9BQE3		ENST00000301072.6:c.492G>A	12.37:g.49666152G>A		Somatic	218	34		WXS	Illumina GAIIx	Phase_I	250	19	NM_032704	0	0	419	1045	626		Silent	SNP	ENST00000301072.6	37	CCDS8782.1																																																																																			G|0.998;A|0.002		0.547	TUBA1C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404424.1	NM_032704	
KRT7	3855	hgsc.bcm.edu	37	12	52627215	52627215	+	Silent	SNP	A	A	G	rs7308888	byFrequency	TCGA-PK-A5H9-01A-11D-A29I-10	TCGA-PK-A5H9-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	cb1f20fc-0df5-42f5-91b8-624bee1a532a	4fa707a6-752b-4fda-9bc0-b07c80cf65c1	g.chr12:52627215A>G	ENST00000331817.5	+	1	318	c.135A>G	c.(133-135)tcA>tcG	p.S45S		NM_005556.3	NP_005547.3	P08729	K2C7_HUMAN	keratin 7	45	Head.				viral process (GO:0016032)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)|keratin filament (GO:0045095)|nucleus (GO:0005634)	structural molecule activity (GO:0005198)			endometrium(1)|kidney(1)|large_intestine(3)|lung(5)|prostate(2)|stomach(1)|urinary_tract(1)	14				BRCA - Breast invasive adenocarcinoma(357;0.105)	Primaquine(DB01087)	TCGGCGCCTCACGGCCGCGCG	0.771													g|||	4451	0.888778	0.9781	0.8473	5008	,	,		10346	0.9048		0.8191	False		,,,				2504	0.8528				p.S45S		.											.	KRT7-90	0			c.A135G						.			3161,173		1496,169,2	4.0	6.0	5.0		135	-5.3	0.0	12	dbSNP_116	5	5763,1251		2369,1025,113	no	coding-synonymous	KRT7	NM_005556.3		3865,1194,115	GG,GA,AA		17.8358,5.189,13.7611		45/470	52627215	8924,1424	1667	3507	5174	SO:0001819	synonymous_variant	3855	exon1			CGCCTCACGGCCG		CCDS8822.1	12q13.13	2013-01-16			ENSG00000135480	ENSG00000135480		"""-"", ""Intermediate filaments type II, keratins (basic)"""	6445	protein-coding gene	gene with protein product	"""keratin, type II cytoskeletal 7"", ""cytokeratin 7"", ""sarcolectin"", ""keratin, 55K type II cytoskeletal"""	148059				1713141, 16831889	Standard	XR_245927		Approved	K7, CK7, K2C7, SCL	uc001saa.1	P08729	OTTHUMG00000169580	ENST00000331817.5:c.135A>G	12.37:g.52627215A>G		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	21	21	NM_005556	0	0	0	0	0	Q92676|Q9BUD8|Q9Y3R7	Silent	SNP	ENST00000331817.5	37	CCDS8822.1																																																																																			A|0.133;G|0.867		0.771	KRT7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404897.1	NM_005556	
AMDHD1	144193	hgsc.bcm.edu	37	12	96337183	96337183	+	Missense_Mutation	SNP	A	A	G	rs7955450	byFrequency	TCGA-PK-A5H9-01A-11D-A29I-10	TCGA-PK-A5H9-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	cb1f20fc-0df5-42f5-91b8-624bee1a532a	4fa707a6-752b-4fda-9bc0-b07c80cf65c1	g.chr12:96337183A>G	ENST00000266736.2	+	1	113	c.7A>G	c.(7-9)Agc>Ggc	p.S3G	CCDC38_ENST00000546386.1_5'Flank|CCDC38_ENST00000344280.3_5'Flank|CCDC38_ENST00000549752.1_5'Flank	NM_152435.2	NP_689648.2	Q96NU7	HUTI_HUMAN	amidohydrolase domain containing 1	3			S -> G (in dbSNP:rs7955450). {ECO:0000269|PubMed:14702039, ECO:0000269|PubMed:15221005, ECO:0000269|PubMed:15489334, ECO:0000269|PubMed:16541075}.		cellular nitrogen compound metabolic process (GO:0034641)|histidine catabolic process (GO:0006548)|histidine catabolic process to glutamate and formamide (GO:0019556)|histidine catabolic process to glutamate and formate (GO:0019557)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	imidazolonepropionase activity (GO:0050480)|metal ion binding (GO:0046872)			central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(7)|lung(7)|ovary(1)|skin(1)	22						CGACATGGCAAGCGGCCACAG	0.736													G|||	3598	0.71845	0.702	0.6888	5008	,	,		10480	0.9554		0.6004	False		,,,				2504	0.6391				p.S3G		.											.	AMDHD1-90	0			c.A7G						.						2.0	3.0	3.0					12																	96337183		1177	2379	3556	SO:0001583	missense	144193	exon1			ATGGCAAGCGGCC	AB075878	CCDS9057.1	12q23.1	2006-02-02				ENSG00000139344			28577	protein-coding gene	gene with protein product							Standard	NM_152435		Approved	MGC35366	uc001tel.2	Q96NU7	OTTHUMG00000170353	ENST00000266736.2:c.7A>G	12.37:g.96337183A>G	ENSP00000266736:p.Ser3Gly	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	21	21	NM_152435	0	0	0	1	1	A8K463|Q68CI8	Missense_Mutation	SNP	ENST00000266736.2	37	CCDS9057.1	1561	0.7147435897435898	348	0.7073170731707317	233	0.643646408839779	540	0.9440559440559441	440	0.5804749340369393	G	5.553	0.286982	0.10513	.	.	ENSG00000139344	ENST00000266736	T	0.30714	1.52	4.39	-8.69	0.00855	.	0.734274	0.13810	N	0.361153	T	0.00012	0.0000	N	0.01576	-0.805	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.28427	-1.0044	9	0.21540	T	0.41	.	1.8829	0.03231	0.44:0.0902:0.1959:0.2739	rs7955450;rs17856824;rs58541549;rs7955450	3	Q96NU7	HUTI_HUMAN	G	3	ENSP00000266736:S3G	ENSP00000266736:S3G	S	+	1	0	AMDHD1	94861314	0.000000	0.05858	0.000000	0.03702	0.134000	0.20937	-0.592000	0.05747	-2.316000	0.00645	-1.140000	0.01884	AGC	A|0.273;G|0.727		0.736	AMDHD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408640.1	NM_152435	
AMDHD1	144193	hgsc.bcm.edu	37	12	96337225	96337225	+	Silent	SNP	C	C	T	rs1436121	byFrequency	TCGA-PK-A5H9-01A-11D-A29I-10	TCGA-PK-A5H9-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	cb1f20fc-0df5-42f5-91b8-624bee1a532a	4fa707a6-752b-4fda-9bc0-b07c80cf65c1	g.chr12:96337225C>T	ENST00000266736.2	+	1	155	c.49C>T	c.(49-51)Ctg>Ttg	p.L17L	CCDC38_ENST00000546386.1_5'Flank|CCDC38_ENST00000344280.3_5'Flank|CCDC38_ENST00000549752.1_5'Flank	NM_152435.2	NP_689648.2	Q96NU7	HUTI_HUMAN	amidohydrolase domain containing 1	17					cellular nitrogen compound metabolic process (GO:0034641)|histidine catabolic process (GO:0006548)|histidine catabolic process to glutamate and formamide (GO:0019556)|histidine catabolic process to glutamate and formate (GO:0019557)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	imidazolonepropionase activity (GO:0050480)|metal ion binding (GO:0046872)			central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(7)|lung(7)|ovary(1)|skin(1)	22						GCAAGTGGTGCTGGTGTGCGC	0.741													C|||	1276	0.254792	0.09	0.1297	5008	,	,		11076	0.4732		0.2445	False		,,,				2504	0.3517				p.L17L		.											.	AMDHD1-90	0			c.C49T						.	C		259,2703		9,241,1231	3.0	4.0	4.0		49	1.4	1.0	12	dbSNP_88	4	983,4553		75,833,1860	no	coding-synonymous	AMDHD1	NM_152435.2		84,1074,3091	TT,TC,CC		17.7565,8.7441,14.6152		17/427	96337225	1242,7256	1481	2768	4249	SO:0001819	synonymous_variant	144193	exon1			GTGGTGCTGGTGT	AB075878	CCDS9057.1	12q23.1	2006-02-02				ENSG00000139344			28577	protein-coding gene	gene with protein product							Standard	NM_152435		Approved	MGC35366	uc001tel.2	Q96NU7	OTTHUMG00000170353	ENST00000266736.2:c.49C>T	12.37:g.96337225C>T		Somatic	1	0		WXS	Illumina GAIIx	Phase_I	32	20	NM_152435	0	0	0	0	0	A8K463|Q68CI8	Silent	SNP	ENST00000266736.2	37	CCDS9057.1																																																																																			C|0.752;T|0.248		0.741	AMDHD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408640.1	NM_152435	
FAM109A	144717	hgsc.bcm.edu	37	12	111800827	111800835	+	In_Frame_Del	DEL	GCCACCCCC	GCCACCCCC	-	rs3840795|rs139032867|rs199734407|rs200911236	byFrequency	TCGA-PK-A5H9-01A-11D-A29I-10	TCGA-PK-A5H9-10A-01D-A29L-10	GCCACCCCC	GCCACCCCC	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	cb1f20fc-0df5-42f5-91b8-624bee1a532a	4fa707a6-752b-4fda-9bc0-b07c80cf65c1	g.chr12:111800827_111800835delGCCACCCCC	ENST00000547838.2	-	2	494_502	c.397_405delGGGGGTGGC	c.(397-405)gggggtggcdel	p.GGG133del	FAM109A_ENST00000450786.2_In_Frame_Del_p.113_116AGVA>A|FAM109A_ENST00000548163.1_In_Frame_Del_p.GGG133del|FAM109A_ENST00000361483.3_In_Frame_Del_p.GGG146del|FAM109A_ENST00000392658.5_In_Frame_Del_p.GGG133del			Q8N4B1	SESQ1_HUMAN	family with sequence similarity 109, member A	133					endosome organization (GO:0007032)|receptor recycling (GO:0001881)|retrograde transport, endosome to Golgi (GO:0042147)	clathrin-coated vesicle (GO:0030136)|early endosome (GO:0005769)|recycling endosome (GO:0055037)|trans-Golgi network (GO:0005802)	protein homodimerization activity (GO:0042803)	p.G133M(1)|p.G146_G148delGGG(1)|p.G133_G135delGGG(1)		breast(1)|endometrium(1)|lung(1)|ovary(1)	4						gcagggCCATGCCACCCCCGCCACGTACA	0.732														1710	0.341454	0.233	0.3732	5008	,	,		9526	0.6518		0.2078	False		,,,				2504	0.2832				p.146_148del		.											.	FAM109A-90	3	Deletion - In frame(2)|Substitution - Missense(1)	breast(2)|ovary(1)	c.436_444del						.		,,	674,3090		134,406,1342				http://www.ncbi.nlm.nih.gov/sites/varvu?gene	,,	-4.5	0.0		dbSNP_107	6	1126,6432		186,754,2839	no	coding,coding,coding	FAM109A	NM_144671.4,NM_001177997.1,NM_001177996.1	,,	320,1160,4181	A1A1,A1R,RR		14.8981,17.9065,15.8983	,,	,,		1800,9522				SO:0001651	inframe_deletion	144717	exon4			GGCCATGCCACCC	BC034809	CCDS9152.1, CCDS53833.1	12q24.12	2013-01-10			ENSG00000198324	ENSG00000198324		"""Pleckstrin homology (PH) domain containing"""	26509	protein-coding gene	gene with protein product		614239				12477932	Standard	NM_144671		Approved	FLJ32356	uc009zvu.3	Q8N4B1	OTTHUMG00000169547	ENST00000547838.2:c.397_405delGGGGGTGGC	12.37:g.111800827_111800835delGCCACCCCC	ENSP00000447353:p.Gly133_Gly135del	Somatic	2	1		WXS	Illumina GAIIx	Phase_I	24	20	NM_001177996	0	0	0	0	0	J3KP50|Q6PJL9|Q96MH8	In_Frame_Del	DEL	ENST00000547838.2	37	CCDS9152.1																																																																																			.		0.732	FAM109A-007	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404768.2	NM_144671	
IRS2	8660	hgsc.bcm.edu	37	13	110435728	110435728	+	Silent	SNP	C	C	G	rs75172981	byFrequency	TCGA-PK-A5H9-01A-11D-A29I-10	TCGA-PK-A5H9-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	cb1f20fc-0df5-42f5-91b8-624bee1a532a	4fa707a6-752b-4fda-9bc0-b07c80cf65c1	g.chr13:110435728C>G	ENST00000375856.3	-	1	3187	c.2673G>C	c.(2671-2673)acG>acC	p.T891T		NM_003749.2	NP_003740.2	Q9Y4H2	IRS2_HUMAN	insulin receptor substrate 2	891					brain development (GO:0007420)|cell proliferation (GO:0008283)|cellular response to glucose stimulus (GO:0071333)|cellular response to insulin stimulus (GO:0032869)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glucose metabolic process (GO:0006006)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|JAK-STAT cascade involved in growth hormone signaling pathway (GO:0060397)|lipid homeostasis (GO:0055088)|mammary gland development (GO:0030879)|negative regulation of B cell apoptotic process (GO:0002903)|negative regulation of kinase activity (GO:0033673)|negative regulation of plasma membrane long-chain fatty acid transport (GO:0010748)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of fatty acid beta-oxidation (GO:0032000)|positive regulation of glucose import (GO:0046326)|positive regulation of glucose metabolic process (GO:0010907)|positive regulation of glycogen biosynthetic process (GO:0045725)|positive regulation of insulin secretion (GO:0032024)|positive regulation of mesenchymal cell proliferation (GO:0002053)|regulation of lipid metabolic process (GO:0019216)|response to glucose (GO:0009749)|signal transduction (GO:0007165)	cytosol (GO:0005829)|plasma membrane (GO:0005886)	signal transducer activity (GO:0004871)			kidney(2)|large_intestine(2)|lung(8)|ovary(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(2)	19	all_cancers(4;7.57e-15)|all_epithelial(4;5.91e-09)|all_lung(23;7.64e-07)|Lung NSC(43;0.000183)|Colorectal(4;0.00159)|all_neural(89;0.00294)|Medulloblastoma(90;0.00596)|Lung SC(71;0.0155)	Breast(118;0.159)	all cancers(43;0.00815)|BRCA - Breast invasive adenocarcinoma(86;0.11)|Epithelial(84;0.127)|GBM - Glioblastoma multiforme(44;0.147)			GGGACAGGCGCGTGGGCCTCA	0.721													.|||	135	0.0269569	0.0023	0.0663	5008	,	,		7040	0.0367		0.0278	False		,,,				2504	0.0215				p.T891T	Melanoma(100;613 2409 40847)	.											.	IRS2-1334	0			c.G2673C						.	C		15,4041		0,15,2013	4.0	5.0	4.0		2673	-1.7	1.0	13	dbSNP_131	4	205,7881		2,201,3840	no	coding-synonymous	IRS2	NM_003749.2		2,216,5853	GG,GC,CC		2.5352,0.3698,1.8119		891/1339	110435728	220,11922	2028	4043	6071	SO:0001819	synonymous_variant	8660	exon1			CAGGCGCGTGGGC	AB000732	CCDS9510.1	13q34	2013-01-10			ENSG00000185950	ENSG00000185950		"""Pleckstrin homology (PH) domain containing"""	6126	protein-coding gene	gene with protein product		600797				9312143	Standard	NM_003749		Approved		uc001vqv.3	Q9Y4H2	OTTHUMG00000017338	ENST00000375856.3:c.2673G>C	13.37:g.110435728C>G		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	12	6	NM_003749	0	0	3	6	3	Q96RR2|Q9BZG0|Q9Y6I5	Silent	SNP	ENST00000375856.3	37	CCDS9510.1																																																																																			C|0.970;G|0.030		0.721	IRS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045755.1	NM_003749	
ING1	3621	hgsc.bcm.edu	37	13	111368316	111368316	+	Silent	SNP	C	C	T	rs9555726	byFrequency	TCGA-PK-A5H9-01A-11D-A29I-10	TCGA-PK-A5H9-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	cb1f20fc-0df5-42f5-91b8-624bee1a532a	4fa707a6-752b-4fda-9bc0-b07c80cf65c1	g.chr13:111368316C>T	ENST00000375774.3	+	1	988	c.526C>T	c.(526-528)Ctg>Ttg	p.L176L	CARS2_ENST00000535398.1_5'Flank|ING1_ENST00000333219.7_Intron|ING1_ENST00000338450.7_Intron|ING1_ENST00000375775.3_Intron|ING1_ENST00000464141.1_Intron	NM_005537.4	NP_005528.3	Q9UK53	ING1_HUMAN	inhibitor of growth family, member 1	176					cell cycle (GO:0007049)|chromatin modification (GO:0016568)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|positive regulation of transcription, DNA-templated (GO:0045893)|protein import into nucleus (GO:0006606)|regulation of cell death (GO:0010941)	nucleus (GO:0005634)	methylated histone binding (GO:0035064)|zinc ion binding (GO:0008270)			endometrium(4)|large_intestine(6)|lung(1)|ovary(1)	12	all_lung(23;3.61e-05)|Lung NSC(43;0.00144)|Lung SC(71;0.0753)|all_neural(89;0.077)|Medulloblastoma(90;0.148)		BRCA - Breast invasive adenocarcinoma(86;0.188)			GGCCGCATCTCTGCTGACCCG	0.706													C|||	2912	0.58147	0.23	0.6816	5008	,	,		11066	0.7252		0.6909	False		,,,				2504	0.7249				p.L176L		.											.	ING1-515	0			c.C526T						.	C	,,,	1347,2085		295,757,664	14.0	24.0	21.0		526,,,	-5.6	0.0	13	dbSNP_119	21	5238,1736		2020,1198,269	no	coding-synonymous,intron,intron,intron	ING1	NM_005537.3,NM_198217.1,NM_198218.1,NM_198219.1	,,,	2315,1955,933	TT,TC,CC		24.8925,39.2483,36.7192	,,,	176/423,,,	111368316	6585,3821	1716	3487	5203	SO:0001819	synonymous_variant	3621	exon1			GCATCTCTGCTGA		CCDS9515.1, CCDS9516.1, CCDS9517.1, CCDS9518.1	13q34	2013-01-28			ENSG00000153487	ENSG00000153487		"""Zinc fingers, PHD-type"""	6062	protein-coding gene	gene with protein product	"""inhibitor of growth 1"", ""tumor suppressor ING1"", ""growth inhibitor ING1"", ""growth inhibitory protein ING1"""	601566				8944021, 9186514	Standard	NM_198219		Approved	p33ING1, p33ING1b, p24ING1c, p33, p47, p47ING1a	uc001vri.3	Q9UK53	OTTHUMG00000017346	ENST00000375774.3:c.526C>T	13.37:g.111368316C>T		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	14	7	NM_005537	0	0	2	2	0	O00532|O43658|Q53ZR3|Q5T9G8|Q5T9G9|Q5T9H0|Q5T9H1|Q9H007|Q9HD98|Q9HD99|Q9NS83|Q9P0U6|Q9UBC6|Q9UIJ1|Q9UIJ2|Q9UIJ3|Q9UIJ4|Q9UK52	Silent	SNP	ENST00000375774.3	37	CCDS9517.1																																																																																			C|0.372;T|0.628		0.706	ING1-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000045770.2	NM_005537	
HEATR5A	25938	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	14	31765136	31765136	+	Silent	SNP	A	A	G			TCGA-PK-A5H9-01A-11D-A29I-10	TCGA-PK-A5H9-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	cb1f20fc-0df5-42f5-91b8-624bee1a532a	4fa707a6-752b-4fda-9bc0-b07c80cf65c1	g.chr14:31765136A>G	ENST00000389961.3	-	33	5579	c.5580T>C	c.(5578-5580)acT>acC	p.T1860T	RP11-596D21.1_ENST00000551799.1_RNA|HEATR5A_ENST00000543095.2_Silent_p.T1866T|HEATR5A_ENST00000439727.1_Silent_p.T1573T|HEATR5A_ENST00000439348.1_Silent_p.T1785T			Q86XA9	HTR5A_HUMAN	HEAT repeat containing 5A	1860										breast(1)|central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(5)|lung(13)|ovary(1)	26	Hepatocellular(127;0.0877)|Breast(36;0.137)		LUAD - Lung adenocarcinoma(48;0.00292)|Lung(238;0.0164)|BRCA - Breast invasive adenocarcinoma(188;0.0797)|STAD - Stomach adenocarcinoma(7;0.173)	GBM - Glioblastoma multiforme(265;0.0059)		TTATCTCAAGAGTAGCTTTAA	0.368																																					p.T1866T		.											.	HEATR5A-23	0			c.T5598C						.						159.0	150.0	153.0					14																	31765136		1836	4098	5934	SO:0001819	synonymous_variant	25938	exon34			CTCAAGAGTAGCT	AB037737		14q12	2012-04-19	2007-01-02	2007-01-02	ENSG00000129493	ENSG00000129493			20276	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 125"""	C14orf125			Standard	NM_015473		Approved	DKFZP434I1735	uc001wrf.4	Q86XA9	OTTHUMG00000169043	ENST00000389961.3:c.5580T>C	14.37:g.31765136A>G		Somatic	53	0		WXS	Illumina GAIIx	Phase_I	82	24	NM_015473	0	0	14	17	3	Q68DD8|Q6P3S5|Q6P5R9|Q9H8D7|Q9NXB7|Q9P2N0|Q9UFQ3	Silent	SNP	ENST00000389961.3	37		.	.	.	.	.	.	.	.	.	.	A	9.928	1.213952	0.22289	.	.	ENSG00000129493	ENST00000538864	.	.	.	5.65	-0.786	0.10946	.	.	.	.	.	T	0.49864	0.1582	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.38415	-0.9662	4	.	.	.	.	4.8413	0.13492	0.3155:0.0:0.3733:0.3113	.	.	.	.	P	1419	.	.	L	-	2	0	HEATR5A	30834887	1.000000	0.71417	0.861000	0.33841	0.971000	0.66376	1.350000	0.34010	-0.016000	0.14127	0.482000	0.46254	CTC	.		0.368	HEATR5A-201	KNOWN	basic|appris_candidate	protein_coding	protein_coding		NM_015473	
NEMF	9147	broad.mit.edu	37	14	50295792	50295792	+	Missense_Mutation	SNP	G	G	T			TCGA-PK-A5H9-01A-11D-A29I-10	TCGA-PK-A5H9-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	cb1f20fc-0df5-42f5-91b8-624bee1a532a	4fa707a6-752b-4fda-9bc0-b07c80cf65c1	g.chr14:50295792G>T	ENST00000298310.5	-	13	1661	c.1212C>A	c.(1210-1212)aaC>aaA	p.N404K	NEMF_ENST00000546046.1_Missense_Mutation_p.N404K|NEMF_ENST00000556925.1_5'UTR|NEMF_ENST00000545773.1_Missense_Mutation_p.N362K			O60524	NEMF_HUMAN	nuclear export mediator factor	404					nuclear export (GO:0051168)	nucleus (GO:0005634)				breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(13)|liver(1)|lung(9)|prostate(1)|skin(1)|urinary_tract(1)	36						TTGTAACATGGTTTGTTTGTA	0.338																																					p.N404K		.											.	NEMF-90	0			c.C1212A						.						180.0	174.0	176.0					14																	50295792		2203	4300	6503	SO:0001583	missense	9147	exon13			AACATGGTTTGTT	AF039687	CCDS9694.1	14q21.3	2012-11-19	2011-01-31	2011-01-31	ENSG00000165525	ENSG00000165525			10663	protein-coding gene	gene with protein product		608378	"""serologically defined colon cancer antigen 1"""	SDCCAG1		9610721, 10575219	Standard	XR_429334		Approved	NY-CO-1, FLJ10051	uc001wxc.3	O60524	OTTHUMG00000170857	ENST00000298310.5:c.1212C>A	14.37:g.50295792G>T	ENSP00000298310:p.Asn404Lys	Somatic	88	0		WXS	Illumina GAIIx	Phase_I	84	4	NM_004713	0	0	18	18	0	A0JLQ3|B3KSK1|B4DDL3|B4DHA9|B4E3F3|Q32Q66|Q8WW70|Q9NWG1	Missense_Mutation	SNP	ENST00000298310.5	37	CCDS9694.1	.	.	.	.	.	.	.	.	.	.	G	16.77	3.215154	0.58452	.	.	ENSG00000165525	ENST00000298310;ENST00000545773;ENST00000546046;ENST00000534912;ENST00000555970	T;T;T;T	0.56275	0.5;0.47;0.53;0.48	5.34	-0.975	0.10289	Fibronectin-binding A, N-terminal (1);	0.000000	0.85682	D	0.000000	T	0.75810	0.3900	H	0.94462	3.54	0.80722	D	1	D;D;D;D;D	0.89917	0.979;0.999;1.0;1.0;1.0	D;D;D;D;D	0.91635	0.914;0.994;0.991;0.991;0.999	T	0.78150	-0.2316	10	0.46703	T	0.11	-27.4208	12.3777	0.55289	0.4153:0.0:0.5847:0.0	.	404;175;379;362;404	O60524-3;F5H639;O60524-5;O60524-4;O60524	.;.;.;.;NEMF_HUMAN	K	404;362;404;175;362	ENSP00000298310:N404K;ENSP00000438309:N362K;ENSP00000441016:N404K;ENSP00000452540:N362K	ENSP00000298310:N404K	N	-	3	2	NEMF	49365542	0.994000	0.37717	0.997000	0.53966	0.977000	0.68977	0.468000	0.22051	-0.171000	0.10797	-0.312000	0.09012	AAC	.		0.338	NEMF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000410798.1	NM_004713	
VSX2	338917	hgsc.bcm.edu	37	14	74706435	74706435	+	Silent	SNP	C	C	G	rs201395979	byFrequency	TCGA-PK-A5H9-01A-11D-A29I-10	TCGA-PK-A5H9-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	cb1f20fc-0df5-42f5-91b8-624bee1a532a	4fa707a6-752b-4fda-9bc0-b07c80cf65c1	g.chr14:74706435C>G	ENST00000261980.2	+	1	261	c.171C>G	c.(169-171)gcC>gcG	p.A57A		NM_182894.2	NP_878314.1	P58304	VSX2_HUMAN	visual system homeobox 2	57	Pro-rich.				cell fate commitment (GO:0045165)|negative regulation of cell proliferation (GO:0008285)|positive regulation of cell proliferation (GO:0008284)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|response to stimulus (GO:0050896)|retinal bipolar neuron differentiation (GO:0060040)|transcription, DNA-templated (GO:0006351)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)			endometrium(1)|large_intestine(1)|lung(1)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	7				BRCA - Breast invasive adenocarcinoma(234;0.00154)		ACGGCCTGGCCCCCGGGCACT	0.751													C|||	9	0.00179712	0.0	0.0	5008	,	,		10282	0.0089		0.0	False		,,,				2504	0.0				p.A57A		.											.	VSX2-69	0			c.C171G						.						4.0	5.0	5.0					14																	74706435		1862	3660	5522	SO:0001819	synonymous_variant	338917	exon1			CCTGGCCCCCGGG	AC005519	CCDS9827.1	14q24.3	2011-06-20	2007-08-21	2007-08-21		ENSG00000119614		"""Homeoboxes / PRD class"""	1975	protein-coding gene	gene with protein product		142993	"""C elegans ceh-10 homeo domain-containing homolog"", ""ceh-10 homeo domain containing homolog (C. elegans)"", ""ceh-10 homeodomain containing homolog (C. elegans)"""	HOX10, CHX10		1973146	Standard	NM_182894		Approved	RET1	uc001xpq.3	P58304		ENST00000261980.2:c.171C>G	14.37:g.74706435C>G		Somatic	3	0		WXS	Illumina GAIIx	Phase_I	21	10	NM_182894	0	0	0	0	0	A1A4X6	Silent	SNP	ENST00000261980.2	37	CCDS9827.1																																																																																			C|0.996;G|0.004		0.751	VSX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412323.1	NM_182894	
BCL11B	64919	hgsc.bcm.edu	37	14	99641967	99641967	+	Silent	SNP	C	C	T			TCGA-PK-A5H9-01A-11D-A29I-10	TCGA-PK-A5H9-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	cb1f20fc-0df5-42f5-91b8-624bee1a532a	4fa707a6-752b-4fda-9bc0-b07c80cf65c1	g.chr14:99641967C>T	ENST00000357195.3	-	4	1215	c.1206G>A	c.(1204-1206)ccG>ccA	p.P402P	BCL11B_ENST00000443726.2_Silent_p.P208P|BCL11B_ENST00000345514.2_Silent_p.P331P	NM_001282237.1|NM_138576.2	NP_001269166.1|NP_612808.1	Q9C0K0	BC11B_HUMAN	B-cell CLL/lymphoma 11B (zinc finger protein)	402					alpha-beta T cell differentiation (GO:0046632)|epithelial cell morphogenesis (GO:0003382)|keratinocyte development (GO:0003334)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|odontogenesis of dentin-containing tooth (GO:0042475)|olfactory bulb axon guidance (GO:0071678)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive T cell selection (GO:0043368)|post-embryonic camera-type eye development (GO:0031077)|regulation of keratinocyte proliferation (GO:0010837)|regulation of lipid metabolic process (GO:0019216)|regulation of neuron differentiation (GO:0045664)|striatal medium spiny neuron differentiation (GO:0021773)|T cell differentiation in thymus (GO:0033077)|T cell receptor V(D)J recombination (GO:0033153)|thymus development (GO:0048538)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			NS(3)|breast(1)|central_nervous_system(9)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(2)|lung(9)|prostate(2)|skin(2)	34		Melanoma(154;0.0866)|all_epithelial(191;0.241)		COAD - Colon adenocarcinoma(157;0.103)		TGCTCAGGAACGGGGACTTGG	0.736			T	TLX3	T-ALL																																p.P402P		.		Dom	yes		14	14q32.1	64919	B-cell CLL/lymphoma 11B  (CTIP2)		L	.	BCL11B-1147	0			c.G1206A						.						6.0	8.0	8.0					14																	99641967		2015	4010	6025	SO:0001819	synonymous_variant	64919	exon4			CAGGAACGGGGAC	AJ404614	CCDS9949.1, CCDS9950.1	14q32	2013-01-08			ENSG00000127152	ENSG00000127152		"""Zinc fingers, C2H2-type"""	13222	protein-coding gene	gene with protein product		606558		ZNF856B		11719382, 16950772	Standard	NM_138576		Approved	CTIP-2, CTIP2, hRIT1-alpha	uc001yga.3	Q9C0K0	OTTHUMG00000028967	ENST00000357195.3:c.1206G>A	14.37:g.99641967C>T		Somatic	1	1		WXS	Illumina GAIIx	Phase_I	8	4	NM_138576	0	0	1	1	0	Q9H162	Silent	SNP	ENST00000357195.3	37	CCDS9950.1																																																																																			.		0.736	BCL11B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000072332.2	NM_138576	
CCDC85C	317762	hgsc.bcm.edu	37	14	100069940	100069940	+	Silent	SNP	C	C	T	rs189673537	byFrequency	TCGA-PK-A5H9-01A-11D-A29I-10	TCGA-PK-A5H9-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	cb1f20fc-0df5-42f5-91b8-624bee1a532a	4fa707a6-752b-4fda-9bc0-b07c80cf65c1	g.chr14:100069940C>T	ENST00000380243.4	-	1	423	c.357G>A	c.(355-357)gaG>gaA	p.E119E	RP11-543C4.1_ENST00000502101.2_lincRNA	NM_001144995.1	NP_001138467.1	A6NKD9	CC85C_HUMAN	coiled-coil domain containing 85C	119					cerebral cortex development (GO:0021987)	apical junction complex (GO:0043296)|tight junction (GO:0005923)				endometrium(1)|skin(1)	2						AGCGGGCCACCTCGTGCCACA	0.726													C|||	30	0.00599042	0.0	0.0	5008	,	,		7213	0.0228		0.002	False		,,,				2504	0.0051				p.E119E		.											.	.	0			c.G357A						.						1.0	1.0	1.0					14																	100069940		287	827	1114	SO:0001819	synonymous_variant	317762	exon1			GGCCACCTCGTGC		CCDS45161.1	14q32.31	2009-02-18				ENSG00000205476			35459	protein-coding gene	gene with protein product							Standard	NM_001144995		Approved		uc010avr.3	A6NKD9		ENST00000380243.4:c.357G>A	14.37:g.100069940C>T		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	6	5	NM_001144995	0	0	0	0	0		Silent	SNP	ENST00000380243.4	37	CCDS45161.1																																																																																			C|0.982;T|0.018		0.726	CCDC85C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000413802.1	NM_001144995	
CKB	1152	hgsc.bcm.edu	37	14	103988180	103988180	+	Silent	SNP	G	G	T	rs1136165	byFrequency	TCGA-PK-A5H9-01A-11D-A29I-10	TCGA-PK-A5H9-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	cb1f20fc-0df5-42f5-91b8-624bee1a532a	4fa707a6-752b-4fda-9bc0-b07c80cf65c1	g.chr14:103988180G>T	ENST00000348956.2	-	4	813	c.456C>A	c.(454-456)cgC>cgA	p.R152R		NM_001823.4	NP_001814.2	P12277	KCRB_HUMAN	creatine kinase, brain	152	Phosphagen kinase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00843}.				cellular chloride ion homeostasis (GO:0030644)|cellular nitrogen compound metabolic process (GO:0034641)|creatine metabolic process (GO:0006600)|small molecule metabolic process (GO:0044281)|substantia nigra development (GO:0021762)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|creatine kinase activity (GO:0004111)			lung(2)|prostate(1)	3		Melanoma(154;0.155)	Epithelial(46;0.14)		Creatine(DB00148)	TCTCGATGGCGCGGCGCTCCC	0.756													G|||	3294	0.657748	0.5416	0.7349	5008	,	,		7060	0.8264		0.6233	False		,,,				2504	0.6217				p.R152R	Esophageal Squamous(186;2492 2823 49929 50127)	.											.	CKB-115	0			c.C456A						.	G		1738,1164		574,590,287	3.0	4.0	3.0		456	-0.0	1.0	14	dbSNP_86	3	4002,2154		1387,1228,463	no	coding-synonymous	CKB	NM_001823.3		1961,1818,750	TT,TG,GG		34.9903,40.1103,36.6306		152/382	103988180	5740,3318	1451	3078	4529	SO:0001819	synonymous_variant	1152	exon4			GATGGCGCGGCGC		CCDS9981.1	14q32.32	2012-10-02			ENSG00000166165	ENSG00000166165	2.7.3.2		1991	protein-coding gene	gene with protein product		123280		CKBB			Standard	NM_001823		Approved		uc001ynf.2	P12277	OTTHUMG00000171786	ENST00000348956.2:c.456C>A	14.37:g.103988180G>T		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	8	8	NM_001823	0	0	0	58	58	A8K236|B2R5R4|Q2LE07|Q6FG40|Q9UC66	Silent	SNP	ENST00000348956.2	37	CCDS9981.1	1462	0.6694139194139194	285	0.5792682926829268	250	0.6906077348066298	460	0.8041958041958042	467	0.6160949868073878	G	13.11	2.138272	0.37728	0.598897	0.650097	ENSG00000166165	ENST00000428256	.	.	.	4.64	-0.0349	0.13894	.	0.000000	0.85682	D	0.000000	T	0.00012	0.0000	.	.	.	0.09310	P	0.9999999999999624	.	.	.	.	.	.	T	0.17592	-1.0364	5	0.41790	T	0.15	-18.9304	4.9837	0.14180	0.3841:0.2745:0.3414:0.0	rs1136165;rs2227867;rs2765044;rs3179077;rs3199393;rs17366340;rs17423634;rs17849441;rs17850309;rs17850603;rs17851735;rs17851741;rs17857802	.	.	.	S	118	.	ENSP00000395515:R118S	R	-	1	0	CKB	103057933	0.001000	0.12720	0.999000	0.59377	0.996000	0.88848	-2.081000	0.01367	0.066000	0.16515	0.449000	0.29647	CGC	G|0.327;T|0.673		0.756	CKB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000415111.1		
C14orf180	400258	hgsc.bcm.edu	37	14	105054934	105054934	+	Silent	SNP	A	A	G	rs12880814	byFrequency	TCGA-PK-A5H9-01A-11D-A29I-10	TCGA-PK-A5H9-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	cb1f20fc-0df5-42f5-91b8-624bee1a532a	4fa707a6-752b-4fda-9bc0-b07c80cf65c1	g.chr14:105054934A>G	ENST00000557649.1	+	5	633	c.297A>G	c.(295-297)ccA>ccG	p.P99P	C14orf180_ENST00000331952.2_Intron|C14orf180_ENST00000410013.1_Silent_p.P99P|RP11-614O9.1_ENST00000556073.1_RNA			Q8N912	NRAC_HUMAN	chromosome 14 open reading frame 180	99						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)							Melanoma(154;0.226)	all cancers(16;0.00405)|OV - Ovarian serous cystadenocarcinoma(23;0.0319)|Epithelial(46;0.0784)|GBM - Glioblastoma multiforme(11;0.116)	Epithelial(152;0.127)		GGCCCAGGCCACACGGCGGCT	0.731													A|||	2110	0.421326	0.7436	0.2911	5008	,	,		14114	0.6002		0.0994	False		,,,				2504	0.2249				p.P99P		.											.	C14orf180-492	0			c.A297G						.	A		1749,1969		425,899,535	4.0	4.0	4.0		297	-2.2	0.0	14	dbSNP_121	4	533,6777		29,475,3151	no	coding-synonymous	C14orf180	NM_001008404.1		454,1374,3686	GG,GA,AA		7.2914,47.0414,20.6928		99/161	105054934	2282,8746	1859	3655	5514	SO:0001819	synonymous_variant	400258	exon5			CAGGCCACACGGC		CCDS32166.1, CCDS66722.1	14q32.33	2012-11-12	2012-11-12	2012-11-12	ENSG00000184601	ENSG00000184601			33795	protein-coding gene	gene with protein product	"""nutritionally-regulated adipose and cardiac-enriched"""		"""chromosome 14 open reading frame 77"""	C14orf77		23029450	Standard	XM_005267638		Approved	NRAC	uc001yow.1	Q8N912	OTTHUMG00000029806	ENST00000557649.1:c.297A>G	14.37:g.105054934A>G		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	20	20	NM_001008404	0	0	0	0	0		Silent	SNP	ENST00000557649.1	37	CCDS32166.1																																																																																			A|0.615;G|0.385		0.731	C14orf180-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000410580.1	NM_001008404	
C14orf180	400258	hgsc.bcm.edu	37	14	105055119	105055127	+	Stop_Codon_Del	DEL	GACGGGCAG	GACGGGCAG	-	rs111285011|rs569942489|rs11278058	byFrequency	TCGA-PK-A5H9-01A-11D-A29I-10	TCGA-PK-A5H9-10A-01D-A29L-10	GACGGGCAG	GACGGGCAG	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	cb1f20fc-0df5-42f5-91b8-624bee1a532a	4fa707a6-752b-4fda-9bc0-b07c80cf65c1	g.chr14:105055119_105055127delGACGGGCAG	ENST00000557649.1	+	0	818_826				C14orf180_ENST00000331952.2_In_Frame_Del_p.TGR153del|C14orf180_ENST00000410013.1_Stop_Codon_Del|RP11-614O9.1_ENST00000556073.1_RNA			Q8N912	NRAC_HUMAN	chromosome 14 open reading frame 180							integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)							Melanoma(154;0.226)	all cancers(16;0.00405)|OV - Ovarian serous cystadenocarcinoma(23;0.0319)|Epithelial(46;0.0784)|GBM - Glioblastoma multiforme(11;0.116)	Epithelial(152;0.127)		CTGCGGCTCTgacgggcaggacgggcagg	0.718														3012	0.601438	0.8079	0.6095	5008	,	,		14598	0.6954		0.4235	False		,,,				2504	0.4029				p.161_161del		.											.	C14orf180-492	0			c.482_784del						.			1070,740		494,82,329						3.0	0.1		dbSNP_132	3	1279,3127		502,275,1426	no	coding	C14orf180	NM_001008404.1		996,357,1755	A1A1,A1R,RR		29.0286,40.884,37.7896				2349,3867				SO:0001567	stop_retained_variant	400258	exon5			GGCTCTGACGGGC		CCDS32166.1, CCDS66722.1	14q32.33	2012-11-12	2012-11-12	2012-11-12	ENSG00000184601	ENSG00000184601			33795	protein-coding gene	gene with protein product	"""nutritionally-regulated adipose and cardiac-enriched"""		"""chromosome 14 open reading frame 77"""	C14orf77		23029450	Standard	XM_005267638		Approved	NRAC	uc001yow.1	Q8N912	OTTHUMG00000029806	Exception_encountered	14.37:g.105055128_105055136delGACGGGCAG		Somatic	1	0		WXS	Illumina GAIIx	Phase_I	22	8	NM_001008404	0	0	0	0	0		Frame_Shift_Del	DEL	ENST00000557649.1	37	CCDS32166.1																																																																																			-|1.000;|0.000		0.718	C14orf180-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000410580.1	NM_001008404	
KBTBD13	390594	hgsc.bcm.edu	37	15	65369531	65369531	+	Silent	SNP	G	G	T	rs2946642	byFrequency	TCGA-PK-A5H9-01A-11D-A29I-10	TCGA-PK-A5H9-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	cb1f20fc-0df5-42f5-91b8-624bee1a532a	4fa707a6-752b-4fda-9bc0-b07c80cf65c1	g.chr15:65369531G>T	ENST00000432196.2	+	1	378	c.378G>T	c.(376-378)gcG>gcT	p.A126A	RASL12_ENST00000434605.2_5'Flank	NM_001101362.2	NP_001094832.1	C9JR72	KBTBD_HUMAN	kelch repeat and BTB (POZ) domain containing 13	126					protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)				lung(1)|prostate(1)|skin(1)	3						ACAGTGCCGCGCTCTTCATCT	0.716													G|||	2512	0.501597	0.531	0.5403	5008	,	,		9855	0.7302		0.3877	False		,,,				2504	0.316				p.A126A		.											.	.	0			c.G378T						.	G		1399,1573		380,639,467	2.0	2.0	2.0		378	-0.2	1.0	15	dbSNP_101	2	2035,4139		455,1125,1507	no	coding-synonymous	KBTBD13	NM_001101362.2		835,1764,1974	TT,TG,GG		32.9608,47.0727,37.5465		126/459	65369531	3434,5712	1486	3087	4573	SO:0001819	synonymous_variant	390594	exon1			TGCCGCGCTCTTC		CCDS45281.1	15q22.31	2014-09-17			ENSG00000234438	ENSG00000234438		"""BTB/POZ domain containing"""	37227	protein-coding gene	gene with protein product	"""nemaline myopathy type 6"""	613727				21109227, 22542517	Standard	NM_001101362		Approved	hCG_1645727, NEM6	uc010uis.2	C9JR72		ENST00000432196.2:c.378G>T	15.37:g.65369531G>T		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	15	15	NM_001101362	0	0	0	0	0		Silent	SNP	ENST00000432196.2	37	CCDS45281.1																																																																																			G|0.479;T|0.521		0.716	KBTBD13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000418468.2	NM_001101362	
CSPG4	1464	broad.mit.edu	37	15	75977087	75977087	+	Missense_Mutation	SNP	G	G	T			TCGA-PK-A5H9-01A-11D-A29I-10	TCGA-PK-A5H9-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	cb1f20fc-0df5-42f5-91b8-624bee1a532a	4fa707a6-752b-4fda-9bc0-b07c80cf65c1	g.chr15:75977087G>T	ENST00000308508.5	-	5	4531	c.4439C>A	c.(4438-4440)aCa>aAa	p.T1480K		NM_001897.4	NP_001888.2	Q6UVK1	CSPG4_HUMAN	chondroitin sulfate proteoglycan 4	1480	Gly/Ser-rich (glycosaminoglycan attachment domain).				activation of MAPK activity (GO:0000187)|angiogenesis (GO:0001525)|carbohydrate metabolic process (GO:0005975)|cell proliferation (GO:0008283)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate catabolic process (GO:0030207)|chondroitin sulfate metabolic process (GO:0030204)|dermatan sulfate biosynthetic process (GO:0030208)|glial cell migration (GO:0008347)|glycosaminoglycan metabolic process (GO:0030203)|intracellular signal transduction (GO:0035556)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|small molecule metabolic process (GO:0044281)|tissue remodeling (GO:0048771)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cell projection (GO:0042995)|cell surface (GO:0009986)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|lysosomal lumen (GO:0043202)	protein kinase binding (GO:0019901)|signal transducer activity (GO:0004871)			breast(1)|cervix(2)|endometrium(5)|kidney(5)|large_intestine(3)|liver(2)|lung(18)|ovary(2)|pancreas(2)|prostate(4)|skin(4)	48						CTGCAGGCCTGTGTTTGTAGT	0.592																																					p.T1480K		.											.	CSPG4-229	0			c.C4439A						.						74.0	63.0	67.0					15																	75977087		2197	4294	6491	SO:0001583	missense	1464	exon5			AGGCCTGTGTTTG	X96753, AY359468	CCDS10284.1	15q24.2	2010-04-19	2007-02-16		ENSG00000173546	ENSG00000173546		"""Proteoglycans / Cell surface : Other"""	2466	protein-coding gene	gene with protein product	"""melanoma-associated chondroitin sulfate proteoglycan"""	601172	"""chondroitin sulfate proteoglycan 4 (melanoma-associated)"""			8790396, 16407841	Standard	NM_001897		Approved	MCSPG, MEL-CSPG, MSK16, NG2, MCSP, HMW-MAA	uc002baw.3	Q6UVK1	OTTHUMG00000142836	ENST00000308508.5:c.4439C>A	15.37:g.75977087G>T	ENSP00000312506:p.Thr1480Lys	Somatic	51	0		WXS	Illumina GAIIx	Phase_I	59	7	NM_001897	0	0	0	0	0	D3DW77|Q92675	Missense_Mutation	SNP	ENST00000308508.5	37	CCDS10284.1	.	.	.	.	.	.	.	.	.	.	.	11.21	1.570398	0.28003	.	.	ENSG00000173546	ENST00000308508	T	0.72942	-0.7	4.33	2.43	0.29744	.	0.202340	0.33631	N	0.004710	T	0.53546	0.1803	L	0.31664	0.95	0.46458	D	0.999057	P	0.44627	0.839	B	0.43623	0.425	T	0.52533	-0.8563	10	0.06236	T	0.91	.	9.0545	0.36397	0.1754:0.0:0.8246:0.0	.	1480	Q6UVK1	CSPG4_HUMAN	K	1480	ENSP00000312506:T1480K	ENSP00000312506:T1480K	T	-	2	0	CSPG4	73764142	0.987000	0.35691	0.996000	0.52242	0.334000	0.28698	1.971000	0.40530	0.291000	0.22468	0.555000	0.69702	ACA	.		0.592	CSPG4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000286472.1	NM_001897	
CSPG4	1464	bcgsc.ca	37	15	75979782	75979782	+	Silent	SNP	G	G	T	rs8030131	byFrequency	TCGA-PK-A5H9-01A-11D-A29I-10	TCGA-PK-A5H9-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	cb1f20fc-0df5-42f5-91b8-624bee1a532a	4fa707a6-752b-4fda-9bc0-b07c80cf65c1	g.chr15:75979782G>T	ENST00000308508.5	-	3	3716	c.3624C>A	c.(3622-3624)cgC>cgA	p.R1208R		NM_001897.4	NP_001888.2	Q6UVK1	CSPG4_HUMAN	chondroitin sulfate proteoglycan 4	1208	Gly/Ser-rich (glycosaminoglycan attachment domain).|Interaction with COL5A1. {ECO:0000250}.			R -> E (in Ref. 1; CAA65529). {ECO:0000305}.	activation of MAPK activity (GO:0000187)|angiogenesis (GO:0001525)|carbohydrate metabolic process (GO:0005975)|cell proliferation (GO:0008283)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate catabolic process (GO:0030207)|chondroitin sulfate metabolic process (GO:0030204)|dermatan sulfate biosynthetic process (GO:0030208)|glial cell migration (GO:0008347)|glycosaminoglycan metabolic process (GO:0030203)|intracellular signal transduction (GO:0035556)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|small molecule metabolic process (GO:0044281)|tissue remodeling (GO:0048771)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cell projection (GO:0042995)|cell surface (GO:0009986)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|lysosomal lumen (GO:0043202)	protein kinase binding (GO:0019901)|signal transducer activity (GO:0004871)			breast(1)|cervix(2)|endometrium(5)|kidney(5)|large_intestine(3)|liver(2)|lung(18)|ovary(2)|pancreas(2)|prostate(4)|skin(4)	48						CCATGGTGTCGCGGGGGCTGA	0.642													G|||	1925	0.384385	0.2716	0.5245	5008	,	,		20048	0.2292		0.5189	False		,,,				2504	0.4591				p.R1208R		.											.	CSPG4-229	0			c.C3624A						.	G		1317,3075		195,927,1074	52.0	53.0	53.0		3624	-10.1	0.0	15	dbSNP_116	53	4650,3936		1272,2106,915	no	coding-synonymous	CSPG4	NM_001897.4		1467,3033,1989	TT,TG,GG		45.8421,29.9863,45.9778		1208/2323	75979782	5967,7011	2196	4293	6489	SO:0001819	synonymous_variant	1464	exon3			GGTGTCGCGGGGG	X96753, AY359468	CCDS10284.1	15q24.2	2010-04-19	2007-02-16		ENSG00000173546	ENSG00000173546		"""Proteoglycans / Cell surface : Other"""	2466	protein-coding gene	gene with protein product	"""melanoma-associated chondroitin sulfate proteoglycan"""	601172	"""chondroitin sulfate proteoglycan 4 (melanoma-associated)"""			8790396, 16407841	Standard	NM_001897		Approved	MCSPG, MEL-CSPG, MSK16, NG2, MCSP, HMW-MAA	uc002baw.3	Q6UVK1	OTTHUMG00000142836	ENST00000308508.5:c.3624C>A	15.37:g.75979782G>T		Somatic	159	1		WXS	Illumina GAIIx	Phase_I	159	7	NM_001897	0	0	5	5	0	D3DW77|Q92675	Silent	SNP	ENST00000308508.5	37	CCDS10284.1																																																																																			G|0.567;T|0.433		0.642	CSPG4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000286472.1	NM_001897	
ZNF710	374655	bcgsc.ca	37	15	90622936	90622936	+	Missense_Mutation	SNP	G	G	A	rs117711777	byFrequency	TCGA-PK-A5H9-01A-11D-A29I-10	TCGA-PK-A5H9-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	cb1f20fc-0df5-42f5-91b8-624bee1a532a	4fa707a6-752b-4fda-9bc0-b07c80cf65c1	g.chr15:90622936G>A	ENST00000268154.4	+	5	2121	c.1870G>A	c.(1870-1872)Ggc>Agc	p.G624S	RP11-617F23.1_ENST00000558334.1_RNA	NM_198526.2	NP_940928.2	Q8N1W2	ZN710_HUMAN	zinc finger protein 710	624					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(2)|endometrium(2)|kidney(2)|large_intestine(4)|lung(1)|ovary(2)|prostate(1)|stomach(1)|urinary_tract(3)	19	Melanoma(11;0.00551)|Lung NSC(78;0.0196)|all_lung(78;0.04)		BRCA - Breast invasive adenocarcinoma(143;0.00769)|KIRC - Kidney renal clear cell carcinoma(17;0.0286)|Kidney(142;0.0514)|STAD - Stomach adenocarcinoma(125;0.129)			AGAGCTCGACGGCCAGCAGGA	0.602													G|||	33	0.00658946	0.0091	0.0058	5008	,	,		19039	0.0		0.0169	False		,,,				2504	0.0				p.G624S		.											.	ZNF710-90	0			c.G1870A						.	G	SER/GLY	41,4359	43.8+/-77.6	0,41,2159	87.0	79.0	82.0		1870	-3.0	0.4	15	dbSNP_132	82	92,8504	51.5+/-111.7	1,90,4207	yes	missense	ZNF710	NM_198526.2	56	1,131,6366	AA,AG,GG		1.0703,0.9318,1.0234	benign	624/665	90622936	133,12863	2200	4298	6498	SO:0001583	missense	374655	exon5			CTCGACGGCCAGC	AK094712	CCDS10358.1	15q26.1	2013-01-08			ENSG00000140548	ENSG00000140548		"""Zinc fingers, C2H2-type"""	25352	protein-coding gene	gene with protein product							Standard	XM_005254905		Approved	DKFZp547K1113, FLJ37393, FLJ00306	uc002bov.2	Q8N1W2	OTTHUMG00000149812	ENST00000268154.4:c.1870G>A	15.37:g.90622936G>A	ENSP00000268154:p.Gly624Ser	Somatic	235	3		WXS	Illumina GAIIx	Phase_I	268	8	NM_198526	0	0	21	21	0	A0AVS3|Q6ZMK9|Q8NDU0	Missense_Mutation	SNP	ENST00000268154.4	37	CCDS10358.1	15	0.006868131868131868	1	0.0020325203252032522	3	0.008287292817679558	0	0.0	11	0.014511873350923483	G	10.33	1.321323	0.23994	0.009318	0.010703	ENSG00000140548	ENST00000268154	T	0.08193	3.12	5.35	-2.98	0.05513	.	1.266040	0.05215	N	0.507522	T	0.03959	0.0111	N	0.19112	0.55	0.27332	N	0.956743	B	0.06786	0.001	B	0.04013	0.001	T	0.45454	-0.9260	10	0.06625	T	0.88	-11.9095	15.6231	0.76824	0.1703:0.0:0.8297:0.0	.	624	Q8N1W2	ZN710_HUMAN	S	624	ENSP00000268154:G624S	ENSP00000268154:G624S	G	+	1	0	ZNF710	88423940	0.001000	0.12720	0.414000	0.26521	0.375000	0.29983	-0.577000	0.05847	-0.507000	0.06549	-0.367000	0.07326	GGC	G|0.992;A|0.008		0.602	ZNF710-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313423.1	NM_198526	
RCCD1	91433	hgsc.bcm.edu	37	15	91499986	91499986	+	Missense_Mutation	SNP	G	G	T	rs4932380	byFrequency	TCGA-PK-A5H9-01A-11D-A29I-10	TCGA-PK-A5H9-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	cb1f20fc-0df5-42f5-91b8-624bee1a532a	4fa707a6-752b-4fda-9bc0-b07c80cf65c1	g.chr15:91499986G>T	ENST00000394258.2	+	2	224	c.22G>T	c.(22-24)Gcc>Tcc	p.A8S	AC068831.6_ENST00000553321.1_RNA|RCCD1_ENST00000556774.1_Intron|RCCD1_ENST00000556618.1_Missense_Mutation_p.A8S|RCCD1_ENST00000555155.1_Missense_Mutation_p.A8S	NM_001017919.1|NM_033544.2	NP_001017919.1|NP_291022.2	A6NED2	RCCD1_HUMAN	RCC1 domain containing 1	8			A -> S (in dbSNP:rs4932380).			cytoplasm (GO:0005737)|plasma membrane (GO:0005886)				breast(1)|kidney(1)|large_intestine(2)	4	Lung NSC(78;0.0987)|all_lung(78;0.175)		Lung(145;0.189)			GCGGCCGGGGGCCTGGTTCGG	0.761											OREG0023477	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	G|||	951	0.189896	0.0469	0.2954	5008	,	,		8275	0.3819		0.0835	False		,,,				2504	0.2198				p.A8S		.											.	RCCD1-90	0			c.G22T						.	G	SER/ALA,SER/ALA	202,3844		4,194,1825	5.0	9.0	7.0		22,22	-4.2	0.0	15	dbSNP_111	7	594,7378		19,556,3411	yes	missense,missense	RCCD1	NM_001017919.1,NM_033544.2	99,99	23,750,5236	TT,TG,GG		7.4511,4.9926,6.6234	benign,benign	8/377,8/377	91499986	796,11222	2023	3986	6009	SO:0001583	missense	91433	exon2			CCGGGGGCCTGGT		CCDS32333.1	15q26.1	2005-10-21	2005-10-21			ENSG00000166965			30457	protein-coding gene	gene with protein product						12477932	Standard	XM_006720763		Approved	MGC14386	uc002bqk.3	A6NED2		ENST00000394258.2:c.22G>T	15.37:g.91499986G>T	ENSP00000377801:p.Ala8Ser	Somatic	1	0	1283	WXS	Illumina GAIIx	Phase_I	33	21	NM_001017919	0	0	1	3	2	B2RTP9|Q29RX6	Missense_Mutation	SNP	ENST00000394258.2	37	CCDS32333.1	390	0.17857142857142858	22	0.044715447154471545	89	0.24585635359116023	223	0.38986013986013984	56	0.07387862796833773	G	3.046	-0.196425	0.06259	0.049926	0.074511	ENSG00000166965	ENST00000394258;ENST00000555155;ENST00000556618	T;T;T	0.79653	-1.29;-1.29;-1.29	3.71	-4.18	0.03846	Regulator of chromosome condensation/beta-lactamase-inhibitor protein II (2);	0.620743	0.15175	N	0.276447	T	0.00012	0.0000	L	0.27053	0.805	0.58432	P	5.000000000032756E-6	B;B	0.16802	0.019;0.011	B;B	0.14578	0.011;0.005	T	0.30208	-0.9986	9	0.16420	T	0.52	.	0.4602	0.00515	0.2924:0.2652:0.2603:0.1821	rs4932380	8;8	G3V2I3;A6NED2	.;RCCD1_HUMAN	S	8	ENSP00000377801:A8S;ENSP00000450678:A8S;ENSP00000451963:A8S	ENSP00000377801:A8S	A	+	1	0	RCCD1	89300990	0.000000	0.05858	0.021000	0.16686	0.107000	0.19398	-1.567000	0.02146	-0.916000	0.03818	-0.225000	0.12378	GCC	G|0.822;T|0.178		0.761	RCCD1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000414748.1	NM_033544	
IRX3	79191	hgsc.bcm.edu	37	16	54318528	54318528	+	Missense_Mutation	SNP	A	A	G	rs1450355	byFrequency	TCGA-PK-A5H9-01A-11D-A29I-10	TCGA-PK-A5H9-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	cb1f20fc-0df5-42f5-91b8-624bee1a532a	4fa707a6-752b-4fda-9bc0-b07c80cf65c1	g.chr16:54318528A>G	ENST00000329734.3	-	2	1977	c.1265T>C	c.(1264-1266)cTg>cCg	p.L422P		NM_024336.2	NP_077312.2	P78415	IRX3_HUMAN	iroquois homeobox 3	422	Pro-rich.		L -> P (in dbSNP:rs1450355). {ECO:0000269|PubMed:15489334}.		mesoderm development (GO:0007498)|metanephros development (GO:0001656)|negative regulation of neuron differentiation (GO:0045665)|positive regulation of neuron differentiation (GO:0045666)|regulation of transcription, DNA-templated (GO:0006355)|specification of loop of Henle identity (GO:0072086)|transcription, DNA-templated (GO:0006351)	axon (GO:0030424)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)			endometrium(2)|kidney(1)|large_intestine(5)|lung(3)|ovary(1)|soft_tissue(1)|urinary_tract(1)	14						GAGCGGGTGCAGGCGGGGGCC	0.776													g|||	4851	0.96865	0.888	0.987	5008	,	,		8017	1.0		1.0	False		,,,				2504	1.0				p.L422P	GBM(143;1830 1866 4487 4646 37383)	.											.	IRX3-90	0			c.T1265C						.	T	PRO/LEU	1678,102		788,102,0	1.0	2.0	2.0		1265	2.5	1.0	16	dbSNP_88	2	4195,3		2096,3,0	no	missense	IRX3	NM_024336.2	98	2884,105,0	GG,GA,AA		0.0715,5.7303,1.7564	benign	422/502	54318528	5873,105	890	2099	2989	SO:0001583	missense	79191	exon2			GGGTGCAGGCGGG	U90308	CCDS10750.1	16q12.2	2011-06-20	2007-07-13		ENSG00000177508	ENSG00000177508		"""Homeoboxes / TALE class"""	14360	protein-coding gene	gene with protein product		612985					Standard	NM_024336		Approved	IRX-1	uc002eht.1	P78415	OTTHUMG00000133200	ENST00000329734.3:c.1265T>C	16.37:g.54318528A>G	ENSP00000331608:p.Leu422Pro	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	7	7	NM_024336	0	0	0	3	3	Q7Z4A4|Q7Z4A5|Q8IVC6	Missense_Mutation	SNP	ENST00000329734.3	37	CCDS10750.1	2108	0.9652014652014652	433	0.8800813008130082	354	0.9779005524861878	567	0.9912587412587412	754	0.9947229551451188	g	5.642	0.303067	0.10678	0.942697	0.999285	ENSG00000177508	ENST00000329734	T	0.54279	0.58	4.4	2.45	0.29901	.	0.652897	0.14990	N	0.286760	T	0.00012	0.0000	N	0.01352	-0.895	0.29914	P	0.82336	B	0.02656	0.0	B	0.01281	0.0	T	0.21861	-1.0233	9	0.33940	T	0.23	-4.0049	5.143	0.14969	0.1733:0.0:0.6627:0.164	rs1450355;rs17852160;rs60836119	422	P78415	IRX3_HUMAN	P	422	ENSP00000331608:L422P	ENSP00000331608:L422P	L	-	2	0	IRX3	52876029	1.000000	0.71417	0.984000	0.44739	0.000000	0.00434	1.455000	0.35190	0.155000	0.19261	-1.528000	0.00924	CTG	T|0.035;G|0.004		0.776	IRX3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256910.2		
CCDC102A	92922	hgsc.bcm.edu	37	16	57562804	57562804	+	Missense_Mutation	SNP	G	G	A	rs12935069		TCGA-PK-A5H9-01A-11D-A29I-10	TCGA-PK-A5H9-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	cb1f20fc-0df5-42f5-91b8-624bee1a532a	4fa707a6-752b-4fda-9bc0-b07c80cf65c1	g.chr16:57562804G>A	ENST00000258214.2	-	2	532	c.286C>T	c.(286-288)Cgg>Tgg	p.R96W		NM_033212.3	NP_149989.2	Q96A19	C102A_HUMAN	coiled-coil domain containing 102A	96				R -> W (in Ref. 2; AAH08285/AAH09941). {ECO:0000305}.						endometrium(1)|large_intestine(1)|lung(4)|ovary(1)|prostate(1)	8						TCCGACCACCGGCGCATGGTC	0.731													A|||	5008	1.0	1.0	1.0	5008	,	,		3757	1.0		1.0	False		,,,				2504	1.0				p.R96W		.											.	CCDC102A-91	0			c.C286T						.						8.0	10.0	9.0					16																	57562804		1834	3717	5551	SO:0001583	missense	92922	exon2			ACCACCGGCGCAT	BC008285	CCDS10784.1	16q13	2008-02-05			ENSG00000135736	ENSG00000135736			28097	protein-coding gene	gene with protein product						12477932	Standard	NM_033212		Approved	MGC10992	uc002elw.3	Q96A19	OTTHUMG00000133472	ENST00000258214.2:c.286C>T	16.37:g.57562804G>A	ENSP00000258214:p.Arg96Trp	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	4	4	NM_033212	0	0	0	0	0	Q9BT74	Missense_Mutation	SNP	ENST00000258214.2	37	CCDS10784.1	2180	0.9981684981684982	492	1.0	360	0.994475138121547	570	0.9965034965034965	758	1.0	A	10.17	1.277909	0.23307	.	.	ENSG00000135736	ENST00000258214	T	0.37752	1.18	4.82	4.82	0.62117	.	0.000000	0.64402	N	0.000001	T	0.00012	0.0000	N	0.00049	-2.415	0.40217	P	0.022302999999999962	B	0.02656	0.0	B	0.01281	0.0	T	0.44787	-0.9305	9	0.33141	T	0.24	-23.2491	9.5348	0.39216	0.9152:0.0:0.0848:0.0	rs12935069;rs12935069	96	Q96A19	C102A_HUMAN	W	96	ENSP00000258214:R96W	ENSP00000258214:R96W	R	-	1	2	CCDC102A	56120305	1.000000	0.71417	1.000000	0.80357	0.971000	0.66376	6.801000	0.75170	0.698000	0.31739	-0.556000	0.04195	CGG	G|0.001;A|0.999		0.731	CCDC102A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257348.1	NM_033212	
ZFPM1	161882	hgsc.bcm.edu	37	16	88599697	88599705	+	In_Frame_Del	DEL	AGCCTCTGG	AGCCTCTGG	-	rs67873604|rs149145771|rs368520732|rs67322929|rs201915453|rs67712719	byFrequency	TCGA-PK-A5H9-01A-11D-A29I-10	TCGA-PK-A5H9-10A-01D-A29L-10	AGCCTCTGG	AGCCTCTGG	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	cb1f20fc-0df5-42f5-91b8-624bee1a532a	4fa707a6-752b-4fda-9bc0-b07c80cf65c1	g.chr16:88599697_88599705delAGCCTCTGG	ENST00000319555.3	+	10	1653_1661	c.1331_1339delAGCCTCTGG	c.(1330-1341)gagcctctggcc>gcc	p.EPL444del	RP11-21B21.4_ENST00000563243.1_RNA	NM_153813.2	NP_722520.2	Q8IX07	FOG1_HUMAN	zinc finger protein, FOG family member 1	444				EPLA -> AP (in Ref. 1; AAN45858). {ECO:0000305}.	atrial septum morphogenesis (GO:0060413)|atrioventricular valve morphogenesis (GO:0003181)|blood coagulation (GO:0007596)|cardiac muscle tissue morphogenesis (GO:0055008)|definitive erythrocyte differentiation (GO:0060318)|embryonic hemopoiesis (GO:0035162)|erythrocyte differentiation (GO:0030218)|granulocyte differentiation (GO:0030851)|megakaryocyte development (GO:0035855)|megakaryocyte differentiation (GO:0030219)|mitral valve formation (GO:0003192)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of interleukin-4 biosynthetic process (GO:0045403)|negative regulation of mast cell differentiation (GO:0060377)|negative regulation of protein binding (GO:0032091)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|outflow tract morphogenesis (GO:0003151)|platelet formation (GO:0030220)|positive regulation of interferon-gamma biosynthetic process (GO:0045078)|primitive erythrocyte differentiation (GO:0060319)|regulation of chemokine production (GO:0032642)|regulation of definitive erythrocyte differentiation (GO:0010724)|T-helper cell lineage commitment (GO:0002295)|transcriptional activation by promoter-enhancer looping (GO:0071733)|tricuspid valve formation (GO:0003195)|ventricular septum morphogenesis (GO:0060412)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|transcription factor complex (GO:0005667)|transcriptional repressor complex (GO:0017053)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II transcription factor binding (GO:0001085)|transcription factor binding (GO:0008134)			central_nervous_system(1)|ovary(2)|urinary_tract(1)	4				BRCA - Breast invasive adenocarcinoma(80;0.0478)		GCCAGAGCGGAGCCTCTGGCCCAGAATGG	0.746																																					p.444_447del	Pancreas(49;850 1106 29641 32847 38344)	.											.	ZFPM1-90	0			c.1331_1339del						.																																			SO:0001651	inframe_deletion	161882	exon10			GAGCGGAGCCTCT	AF488691	CCDS32502.1	16q24.2	2013-01-10	2012-11-27		ENSG00000179588	ENSG00000179588		"""Zinc fingers, C2H2-type"", ""Zinc fingers, C2HC-type containing"""	19762	protein-coding gene	gene with protein product		601950	"""zinc finger protein, multitype 1"""				Standard	NM_153813		Approved	FOG1, FOG, ZNF89A, ZC2HC11A	uc002fkv.3	Q8IX07	OTTHUMG00000173152	ENST00000319555.3:c.1331_1339delAGCCTCTGG	16.37:g.88599697_88599705delAGCCTCTGG	ENSP00000326630:p.Glu444_Leu446del	Somatic	2	0		WXS	Illumina GAIIx	Phase_I	21	0	NM_153813	0	0	0	0	0		In_Frame_Del	DEL	ENST00000319555.3	37	CCDS32502.1																																																																																			.		0.746	ZFPM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000422270.2		
CDH15	1013	hgsc.bcm.edu	37	16	89258747	89258747	+	Missense_Mutation	SNP	A	A	C	rs75791347	byFrequency	TCGA-PK-A5H9-01A-11D-A29I-10	TCGA-PK-A5H9-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	cb1f20fc-0df5-42f5-91b8-624bee1a532a	4fa707a6-752b-4fda-9bc0-b07c80cf65c1	g.chr16:89258747A>C	ENST00000289746.2	+	11	1815	c.1750A>C	c.(1750-1752)Aag>Cag	p.K584Q		NM_004933.2	NP_004924.1	P55291	CAD15_HUMAN	cadherin 15, type 1, M-cadherin (myotubule)	584	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)|muscle cell differentiation (GO:0042692)|positive regulation of muscle cell differentiation (GO:0051149)	caveola (GO:0005901)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|neuromuscular junction (GO:0031594)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			central_nervous_system(1)|endometrium(2)|large_intestine(1)|lung(9)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	18				BRCA - Breast invasive adenocarcinoma(80;0.0261)		CCGCTGCGGCAAGGACGGCGT	0.751													c|||	2269	0.453075	0.3616	0.3804	5008	,	,		8209	0.6528		0.4304	False		,,,				2504	0.4458				p.K584Q		.											.	CDH15-523	0			c.A1750C						.		GLN/LYS	719,2255		126,467,894	2.0	3.0	2.0		1750	-4.4	0.0	16	dbSNP_131	2	1977,4371		402,1173,1599	no	missense	CDH15	NM_004933.2	53	528,1640,2493	CC,CA,AA		31.1437,24.1762,28.9208	benign	584/815	89258747	2696,6626	1487	3174	4661	SO:0001583	missense	1013	exon11			TGCGGCAAGGACG	D83542	CCDS10976.1	16q24.3	2010-01-26	2008-10-30		ENSG00000129910	ENSG00000129910		"""Cadherins / Major cadherins"""	1754	protein-coding gene	gene with protein product		114019	"""cadherin 15, M-cadherin (myotubule)"""	CDH3, CDH14		1427864	Standard	NM_004933		Approved		uc002fmt.3	P55291	OTTHUMG00000138045	ENST00000289746.2:c.1750A>C	16.37:g.89258747A>C	ENSP00000289746:p.Lys584Gln	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	4	4	NM_004933	0	0	0	0	0		Missense_Mutation	SNP	ENST00000289746.2	37	CCDS10976.1	1014	0.4642857142857143	172	0.34959349593495936	127	0.35082872928176795	372	0.6503496503496503	343	0.4525065963060686	c	3.132	-0.178252	0.06380	0.241762	0.311437	ENSG00000129910	ENST00000289746	T	0.56941	0.43	4.6	-4.43	0.03568	Cadherin (1);	1.872270	0.03679	N	0.245167	T	0.00012	0.0000	N	0.05383	-0.06	0.80722	P	0.0	B	0.06786	0.001	B	0.08055	0.003	T	0.38802	-0.9644	9	0.18276	T	0.48	.	3.3286	0.07076	0.1871:0.1478:0.4907:0.1744	.	584	P55291	CAD15_HUMAN	Q	584	ENSP00000289746:K584Q	ENSP00000289746:K584Q	K	+	1	0	CDH15	87786248	0.000000	0.05858	0.000000	0.03702	0.049000	0.14656	-0.609000	0.05635	-0.999000	0.03442	-0.675000	0.03792	AAG	A|0.532;C|0.468		0.751	CDH15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269920.1	NM_004933	
SPIRE2	84501	hgsc.bcm.edu	37	16	89894998	89894998	+	Missense_Mutation	SNP	G	G	A	rs571363661	byFrequency	TCGA-PK-A5H9-01A-11D-A29I-10	TCGA-PK-A5H9-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	cb1f20fc-0df5-42f5-91b8-624bee1a532a	4fa707a6-752b-4fda-9bc0-b07c80cf65c1	g.chr16:89894998G>A	ENST00000378247.3	+	1	83	c.40G>A	c.(40-42)Gca>Aca	p.A14T	SPIRE2_ENST00000393062.2_Missense_Mutation_p.A14T|SPIRE2_ENST00000563972.1_Missense_Mutation_p.A14T|SPIRE2_ENST00000564878.1_Intron	NM_032451.1	NP_115827.1	Q8WWL2	SPIR2_HUMAN	spire-type actin nucleation factor 2	14					actin cytoskeleton organization (GO:0030036)|cleavage furrow formation (GO:0036089)|establishment of meiotic spindle localization (GO:0051295)|formin-nucleated actin cable assembly (GO:0070649)|intracellular transport (GO:0046907)|polar body extrusion after meiotic divisions (GO:0040038)|protein transport (GO:0015031)|vesicle-mediated transport (GO:0016192)	cell cortex (GO:0005938)|cleavage furrow (GO:0032154)|cytoplasmic vesicle membrane (GO:0030659)|cytoskeleton (GO:0005856)|plasma membrane (GO:0005886)				central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(1)|lung(10)|upper_aerodigestive_tract(2)|urinary_tract(1)	21		Lung NSC(15;5.15e-06)|all_lung(18;8.38e-06)|all_hematologic(23;0.0194)		BRCA - Breast invasive adenocarcinoma(80;0.0286)		cgcggcgggcgcagggcggcc	0.781													G|||	27	0.00539137	0.0	0.0	5008	,	,		2946	0.0248		0.0	False		,,,				2504	0.002				p.A14T		.											.	SPIRE2-90	0			c.G40A						.																																			SO:0001583	missense	84501	exon1			GCGGGCGCAGGGC	AL834408	CCDS32516.1	16q24	2013-08-27	2013-08-27			ENSG00000204991			30623	protein-coding gene	gene with protein product		609217	"""spire homolog 2 (Drosophila)"", ""spire family actin nucleation factor 2"""			11347906	Standard	NM_032451		Approved	spir-2, KIAA1832	uc002foz.1	Q8WWL2		ENST00000378247.3:c.40G>A	16.37:g.89894998G>A	ENSP00000367494:p.Ala14Thr	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	5	4	NM_032451	0	0	0	0	0	A4QPB1|Q2TA98|Q6P433|Q8ND47|Q96JJ5	Missense_Mutation	SNP	ENST00000378247.3	37	CCDS32516.1	.	.	.	.	.	.	.	.	.	.	G	5.874	0.345493	0.11126	.	.	ENSG00000204991	ENST00000378247;ENST00000393062	T;T	0.38887	1.11;1.11	2.95	1.85	0.25348	.	0.451332	0.19243	U	0.119108	T	0.21062	0.0507	L	0.34521	1.04	0.25979	N	0.982406	B;B	0.33022	0.394;0.394	B;B	0.22880	0.042;0.042	T	0.06588	-1.0818	10	0.13470	T	0.59	0.3845	4.5276	0.11988	0.0:0.2218:0.5104:0.2678	.	14;14	Q8WWL2-2;Q8WWL2	.;SPIR2_HUMAN	T	14	ENSP00000367494:A14T;ENSP00000376782:A14T	ENSP00000367494:A14T	A	+	1	0	SPIRE2	88422499	0.830000	0.29337	0.825000	0.32803	0.093000	0.18481	0.297000	0.19101	1.478000	0.48253	0.174000	0.16983	GCA	.		0.781	SPIRE2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000421843.1	XM_047462	
KDM6B	23135	broad.mit.edu;bcgsc.ca	37	17	7752668	7752668	+	Missense_Mutation	SNP	T	T	G			TCGA-PK-A5H9-01A-11D-A29I-10	TCGA-PK-A5H9-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	cb1f20fc-0df5-42f5-91b8-624bee1a532a	4fa707a6-752b-4fda-9bc0-b07c80cf65c1	g.chr17:7752668T>G	ENST00000448097.2	+	11	3393	c.3062T>G	c.(3061-3063)cTg>cGg	p.L1021R	KDM6B_ENST00000254846.5_Missense_Mutation_p.L1021R			O15054	KDM6B_HUMAN	lysine (K)-specific demethylase 6B	1021					cardiac muscle cell differentiation (GO:0055007)|cellular response to hydrogen peroxide (GO:0070301)|endothelial cell differentiation (GO:0045446)|inflammatory response (GO:0006954)|mesodermal cell differentiation (GO:0048333)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	dioxygenase activity (GO:0051213)|histone demethylase activity (H3-K27 specific) (GO:0071558)|metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)			central_nervous_system(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(3)|lung(18)|ovary(1)|pancreas(1)|skin(5)	37						CTGGGGAACCTGGACCTGCAG	0.667																																					p.L1021R		.											.	KDM6B-205	0			c.T3062G						.						11.0	10.0	10.0					17																	7752668		2156	4260	6416	SO:0001583	missense	23135	exon11			GGAACCTGGACCT	AB002344	CCDS32552.1	17p13.1	2011-07-01	2009-04-17	2009-04-17		ENSG00000132510		"""Chromatin-modifying enzymes / K-demethylases"""	29012	protein-coding gene	gene with protein product		611577	"""jumonji domain containing 3"", ""jumonji domain containing 3, histone lysine demethylase"""	JMJD3		10662545, 9205841	Standard	NM_001080424		Approved	KIAA0346	uc002giw.1	O15054		ENST00000448097.2:c.3062T>G	17.37:g.7752668T>G	ENSP00000412513:p.Leu1021Arg	Somatic	177	0		WXS	Illumina GAIIx	Phase_I	174	8	NM_001080424	0	0	44	45	1	C9IZ40|Q96G33	Missense_Mutation	SNP	ENST00000448097.2	37		.	.	.	.	.	.	.	.	.	.	T	13.51	2.257320	0.39896	.	.	ENSG00000132510	ENST00000254846;ENST00000448097	T;T	0.47177	0.85;0.87	3.78	3.78	0.43462	.	0.562419	0.14741	N	0.301186	T	0.48786	0.1519	N	0.19112	0.55	0.43608	D	0.995979	D;D	0.71674	0.997;0.998	P;D	0.69654	0.888;0.965	T	0.22521	-1.0214	10	0.17369	T	0.5	-4.6507	11.9288	0.52835	0.0:0.0:0.0:1.0	.	1021;1021	O15054;O15054-1	KDM6B_HUMAN;.	R	1021	ENSP00000254846:L1021R;ENSP00000412513:L1021R	ENSP00000254846:L1021R	L	+	2	0	KDM6B	7693393	1.000000	0.71417	0.998000	0.56505	0.987000	0.75469	4.714000	0.61902	1.724000	0.51502	0.379000	0.24179	CTG	.		0.667	KDM6B-002	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000440248.1	XM_043272	
MYH3	4621	bcgsc.ca	37	17	10541515	10541515	+	Missense_Mutation	SNP	C	C	T	rs2285477	byFrequency	TCGA-PK-A5H9-01A-11D-A29I-10	TCGA-PK-A5H9-10A-01D-A29L-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	cb1f20fc-0df5-42f5-91b8-624bee1a532a	4fa707a6-752b-4fda-9bc0-b07c80cf65c1	g.chr17:10541515C>T	ENST00000583535.1	-	27	3661	c.3574G>A	c.(3574-3576)Gcg>Acg	p.A1192T	MYH3_ENST00000226209.7_Missense_Mutation_p.A1192T	NM_002470.3	NP_002461.2	P11055	MYH3_HUMAN	myosin, heavy chain 3, skeletal muscle, embryonic	1192			A -> T (in dbSNP:rs2285477). {ECO:0000269|PubMed:1691980, ECO:0000269|PubMed:2726495, ECO:0000269|PubMed:2771643, ECO:0000269|PubMed:2806546}.		actin filament-based movement (GO:0030048)|ATP catabolic process (GO:0006200)|embryonic limb morphogenesis (GO:0030326)|face morphogenesis (GO:0060325)|muscle filament sliding (GO:0030049)|muscle organ development (GO:0007517)|sarcomere organization (GO:0045214)|skeletal muscle contraction (GO:0003009)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|muscle myosin complex (GO:0005859)|myosin filament (GO:0032982)|sarcomere (GO:0030017)	actin filament binding (GO:0051015)|ATP binding (GO:0005524)|ATPase activity, coupled (GO:0042623)|calmodulin binding (GO:0005516)|microfilament motor activity (GO:0000146)			breast(2)|central_nervous_system(2)|cervix(1)|endometrium(8)|kidney(5)|large_intestine(18)|lung(30)|ovary(4)|pancreas(1)|prostate(4)|skin(2)|upper_aerodigestive_tract(5)|urinary_tract(1)	83						TTCCTCAGCGCGGCCACCATG	0.602													T|||	2937	0.586462	0.5371	0.6023	5008	,	,		16794	0.3929		0.8161	False		,,,				2504	0.6053				p.A1192T		.											.	MYH3-95	0			c.G3574A						.	T	THR/ALA	2529,1877	541.9+/-375.9	710,1109,384	88.0	74.0	78.0		3574	-2.2	0.3	17	dbSNP_100	78	6787,1813	325.6+/-317.0	2668,1451,181	yes	missense	MYH3	NM_002470.3	58	3378,2560,565	TT,TC,CC		21.0814,42.601,28.3715	benign	1192/1941	10541515	9316,3690	2203	4300	6503	SO:0001583	missense	4621	exon27			TCAGCGCGGCCAC		CCDS11157.1	17p13.1	2013-09-19	2006-09-29		ENSG00000109063	ENSG00000109063		"""Myosins / Myosin superfamily : Class II"""	7573	protein-coding gene	gene with protein product	"""myosin, skeletal, heavy chain, embryonic 1"", ""muscle embryonic myosin heavy chain 3"""	160720	"""myosin, heavy polypeptide 3, skeletal muscle, embryonic"""			2726495	Standard	NM_002470		Approved	MYHC-EMB, MYHSE1, HEMHC, SMHCE	uc002gmq.2	P11055	OTTHUMG00000130367	ENST00000583535.1:c.3574G>A	17.37:g.10541515C>T	ENSP00000464317:p.Ala1192Thr	Somatic	119	0		WXS	Illumina GAIIx	Phase_I	106	6	NM_002470	0	0	1	1	0	Q15492	Missense_Mutation	SNP	ENST00000583535.1	37	CCDS11157.1	1297	0.5938644688644689	257	0.5223577235772358	216	0.5966850828729282	213	0.3723776223776224	611	0.8060686015831134	T	11.56	1.676116	0.29783	0.57399	0.789186	ENSG00000109063	ENST00000226209	T	0.77489	-1.1	5.45	-2.15	0.07102	Myosin tail (1);	.	.	.	.	T	0.00012	0.0000	N	0.25789	0.76	0.54753	P	1.7000000000044757E-5	B	0.15719	0.014	B	0.17979	0.02	T	0.37865	-0.9687	8	0.10636	T	0.68	.	7.8259	0.29315	0.2426:0.5284:0.0:0.229	rs2285477;rs16943298;rs57754906;rs2285477	1192	P11055	MYH3_HUMAN	T	1192	ENSP00000226209:A1192T	ENSP00000226209:A1192T	A	-	1	0	MYH3	10482240	0.000000	0.05858	0.313000	0.25210	0.961000	0.63080	-0.429000	0.06982	-0.722000	0.04922	-0.360000	0.07572	GCG	C|0.348;T|0.652		0.602	MYH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252734.2	NM_002470	
VTN	7448	hgsc.bcm.edu	37	17	26699121	26699121	+	5'Flank	SNP	G	G	C	rs7212814		TCGA-PK-A5H9-01A-11D-A29I-10	TCGA-PK-A5H9-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	cb1f20fc-0df5-42f5-91b8-624bee1a532a	4fa707a6-752b-4fda-9bc0-b07c80cf65c1	g.chr17:26699121G>C	ENST00000226218.4	-	0	0				SARM1_ENST00000457710.3_5'UTR|TMEM199_ENST00000509083.1_Intron|VTN_ENST00000536498.1_5'Flank|SARM1_ENST00000379061.4_Intron|CTB-96E2.3_ENST00000591482.1_RNA	NM_000638.3	NP_000629.3	P04004	VTNC_HUMAN	vitronectin						cell adhesion (GO:0007155)|cell adhesion mediated by integrin (GO:0033627)|cell-matrix adhesion (GO:0007160)|endodermal cell differentiation (GO:0035987)|extracellular matrix organization (GO:0030198)|immune response (GO:0006955)|innate immune response (GO:0045087)|negative regulation of blood coagulation (GO:0030195)|negative regulation of endopeptidase activity (GO:0010951)|positive regulation of cell-substrate adhesion (GO:0010811)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein binding (GO:0032092)|positive regulation of receptor-mediated endocytosis (GO:0048260)|positive regulation of smooth muscle cell migration (GO:0014911)|positive regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030949)|positive regulation of wound healing (GO:0090303)|regulation of complement activation (GO:0030449)|smooth muscle cell-matrix adhesion (GO:0061302)	alphav-beta3 integrin-vitronectin complex (GO:0071062)|blood microparticle (GO:0072562)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix binding (GO:0050840)|heparin binding (GO:0008201)|integrin binding (GO:0005178)|polysaccharide binding (GO:0030247)|scavenger receptor activity (GO:0005044)			kidney(2)|large_intestine(7)|lung(2)|ovary(1)|upper_aerodigestive_tract(1)	13	all_lung(13;0.000533)|Lung NSC(42;0.00171)			UCEC - Uterine corpus endometrioid carcinoma (53;0.153)	Abciximab(DB00054)	GGCCCACGGCGGGGCGCCGAG	0.761													C|||	5008	1.0	1.0	1.0	5008	,	,		9002	1.0		1.0	False		,,,				2504	1.0				p.R23P		.											.	.	0			c.G68C						.						2.0	2.0	2.0					17																	26699121		1378	3066	4444	SO:0001631	upstream_gene_variant	23098	exon1			CACGGCGGGGCGC	BC005046	CCDS11229.1	17q11.2	2014-08-08	2006-02-10		ENSG00000109072	ENSG00000109072		"""Endogenous ligands"""	12724	protein-coding gene	gene with protein product	"""serum spreading factor"", ""somatomedin B"", ""complement S-protein"""	193190	"""vitronectin (serum spreading factor, somatomedin B, complement S-protein)"""			2447940	Standard	NM_000638		Approved	VN	uc002hbc.3	P04004	OTTHUMG00000132500		17.37:g.26699121G>C	Exception_encountered	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	11	11	NM_015077	0	0	0	2	2	B2R7G0|P01141|Q9BSH7	Missense_Mutation	SNP	ENST00000226218.4	37	CCDS11229.1	2181	0.9986263736263736	490	0.9959349593495935	362	1.0	571	0.9982517482517482	758	1.0	C	4.627	0.116613	0.08881	.	.	ENSG00000004139	ENST00000457710	.	.	.	4.93	3.94	0.45596	.	1.216040	0.06217	N	0.686070	T	0.00012	0.0000	.	.	.	0.45837	P	0.0012929999999999886	.	.	.	.	.	.	T	0.38757	-0.9646	5	0.02654	T	1	0.2642	5.2918	0.15731	0.1514:0.6261:0.1455:0.077	rs7212814	.	.	.	P	23	.	ENSP00000406738:R23P	R	+	2	0	SARM1	23723248	0.001000	0.12720	0.000000	0.03702	0.001000	0.01503	1.263000	0.33004	0.497000	0.27926	-1.514000	0.00941	CGG	G|0.001;C|0.999		0.761	VTN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255680.2	NM_000638	
ARHGAP23	57636	hgsc.bcm.edu	37	17	36666551	36666551	+	Silent	SNP	T	T	C	rs62074752	byFrequency	TCGA-PK-A5H9-01A-11D-A29I-10	TCGA-PK-A5H9-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	cb1f20fc-0df5-42f5-91b8-624bee1a532a	4fa707a6-752b-4fda-9bc0-b07c80cf65c1	g.chr17:36666551T>C	ENST00000431231.2	+	24	3887	c.3819T>C	c.(3817-3819)gaT>gaC	p.D1273D	ARHGAP23_ENST00000443378.1_Silent_p.D1179D	NM_001199417.1	NP_001186346.1	Q9P227	RHG23_HUMAN	Rho GTPase activating protein 23	1273					regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	GTPase activator activity (GO:0005096)			breast(2)|endometrium(8)|kidney(6)|lung(1)|skin(1)|stomach(2)	20						GGGCGGGGGATGAGGCGGACG	0.746													C|||	4194	0.83746	0.792	0.8617	5008	,	,		5789	0.9365		0.7883	False		,,,				2504	0.8303				p.D1273D		.											.	ARHGAP23-205	0			c.T3819C						.						2.0	3.0	3.0					17																	36666551		517	1330	1847	SO:0001819	synonymous_variant	57636	exon24			GGGGGATGAGGCG	AB040934	CCDS56027.1	17q12	2014-05-06			ENSG00000225485	ENSG00000275832		"""Rho GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"""	29293	protein-coding gene	gene with protein product		610590				10819331, 15254754	Standard	NM_001199417		Approved	KIAA1501	uc021twd.1	Q9P227	OTTHUMG00000188547	ENST00000431231.2:c.3819T>C	17.37:g.36666551T>C		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	8	8	NM_001199417	0	0	0	1	1		Silent	SNP	ENST00000431231.2	37	CCDS56027.1																																																																																			C|0.823;G|0.000;T|0.177		0.746	ARHGAP23-006	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000441789.1	XM_290799	
C17orf96	100170841	hgsc.bcm.edu	37	17	36830562	36830562	+	Missense_Mutation	SNP	G	G	C	rs79676758	byFrequency	TCGA-PK-A5H9-01A-11D-A29I-10	TCGA-PK-A5H9-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	cb1f20fc-0df5-42f5-91b8-624bee1a532a	4fa707a6-752b-4fda-9bc0-b07c80cf65c1	g.chr17:36830562G>C	ENST00000325814.5	-	1	625	c.187C>G	c.(187-189)Ctg>Gtg	p.L63V		NM_001130677.1	NP_001124149.1	A6NHQ4	CQ096_HUMAN	chromosome 17 open reading frame 96	63	Pro-rich.				neuron fate commitment (GO:0048663)												CGCGCCGCCAGCTCCCCAGGC	0.766													G|||	965	0.192692	0.2693	0.1239	5008	,	,		11134	0.2004		0.1779	False		,,,				2504	0.1452				p.L63V		.											.	.	0			c.C187G						.						1.0	2.0	2.0					17																	36830562		328	928	1256	SO:0001583	missense	100170841	exon1			CCGCCAGCTCCCC		CCDS45661.1	17q12	2014-04-17			ENSG00000179294	ENSG00000273604			34493	protein-coding gene	gene with protein product	"""proline rich 28"""					24550272	Standard	NM_001130677		Approved	LOC100170841, PRR28	uc010wdq.2	A6NHQ4	OTTHUMG00000188495	ENST00000325814.5:c.187C>G	17.37:g.36830562G>C	ENSP00000317905:p.Leu63Val	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	11	11	NM_001130677	0	0	0	0	0		Missense_Mutation	SNP	ENST00000325814.5	37	CCDS45661.1	383	0.17536630036630035	117	0.23780487804878048	48	0.13259668508287292	93	0.16258741258741258	125	0.16490765171503957	G	13.17	2.158099	0.38119	.	.	ENSG00000179294	ENST00000325814	.	.	.	3.48	3.48	0.39840	.	.	.	.	.	T	0.00012	0.0000	N	0.24115	0.695	0.39035	P	0.03997899999999999	P	0.50443	0.935	P	0.46479	0.518	T	0.10847	-1.0612	7	0.87932	D	0	.	10.799	0.46476	0.0:0.0:1.0:0.0	.	63	A6NHQ4	CQ096_HUMAN	V	63	.	ENSP00000317905:L63V	L	-	1	2	C17orf96	34084088	0.995000	0.38212	0.991000	0.47740	0.004000	0.04260	0.513000	0.22770	1.657000	0.50732	0.462000	0.41574	CTG	G|0.824;C|0.176		0.766	C17orf96-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255465.2	NM_001130677	
TBX21	30009	hgsc.bcm.edu	37	17	45810919	45810919	+	Missense_Mutation	SNP	C	C	G	rs2240017	byFrequency	TCGA-PK-A5H9-01A-11D-A29I-10	TCGA-PK-A5H9-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	cb1f20fc-0df5-42f5-91b8-624bee1a532a	4fa707a6-752b-4fda-9bc0-b07c80cf65c1	g.chr17:45810919C>G	ENST00000177694.1	+	1	310	c.99C>G	c.(97-99)caC>caG	p.H33Q		NM_013351.1	NP_037483.1	Q9UL17	TBX21_HUMAN	T-box 21	33			H -> Q (in dbSNP:rs2240017). {ECO:0000269|PubMed:15806396}.		cellular response to organic substance (GO:0071310)|lymphocyte migration (GO:0072676)|multicellular organismal development (GO:0007275)|positive regulation of isotype switching to IgG isotypes (GO:0048304)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|response to virus (GO:0009615)|T cell differentiation (GO:0030217)|transcription, DNA-templated (GO:0006351)	neuronal cell body (GO:0043025)|nucleus (GO:0005634)	sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			NS(1)|endometrium(1)|large_intestine(3)|lung(14)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)	22						ACCCGCAGCACCGCTACTTCT	0.771													C|||	250	0.0499201	0.0076	0.0865	5008	,	,		8307	0.1062		0.0199	False		,,,				2504	0.0542				p.H33Q		.											.	TBX21-90	0			c.C99G	GRCh37	CM042119	TBX21	M	rs2240017	.	C	GLN/HIS	12,2300		0,12,1144	1.0	2.0	2.0		99	0.4	1.0	17	dbSNP_98	2	86,5180		0,86,2547	no	missense	TBX21	NM_013351.1	24	0,98,3691	GG,GC,CC		1.6331,0.519,1.2932	benign	33/536	45810919	98,7480	1156	2633	3789	SO:0001583	missense	30009	exon1			GCAGCACCGCTAC	AF093098	CCDS11514.1	17q21.2	2008-06-23				ENSG00000073861		"""T-boxes"""	11599	protein-coding gene	gene with protein product		604895					Standard	NM_013351		Approved	TBLYM, T-bet	uc002ilv.1	Q9UL17		ENST00000177694.1:c.99C>G	17.37:g.45810919C>G	ENSP00000177694:p.His33Gln	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	14	7	NM_013351	0	0	0	0	0		Missense_Mutation	SNP	ENST00000177694.1	37	CCDS11514.1	94	0.04304029304029304	8	0.016260162601626018	20	0.055248618784530384	56	0.0979020979020979	10	0.013192612137203167	C	6.598	0.478682	0.12521	0.00519	0.016331	ENSG00000073861	ENST00000177694	D	0.84873	-1.91	3.64	0.45	0.16624	.	1.114810	0.06919	N	0.809058	T	0.05640	0.0148	N	0.14661	0.345	0.37472	P	0.084368	B	0.11235	0.004	B	0.09377	0.004	T	0.22382	-1.0218	9	0.18276	T	0.48	.	5.3817	0.16196	0.0:0.5926:0.0:0.4074	rs2240017;rs2240017	33	Q9UL17	TBX21_HUMAN	Q	33	ENSP00000177694:H33Q	ENSP00000177694:H33Q	H	+	3	2	TBX21	43165918	0.000000	0.05858	0.964000	0.40570	0.049000	0.14656	0.245000	0.18142	-0.053000	0.13289	-0.339000	0.08088	CAC	C|0.189;G|0.811		0.771	TBX21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000441365.1	NM_013351	
SCN4A	6329	bcgsc.ca	37	17	62020348	62020348	+	Missense_Mutation	SNP	T	T	C	rs2058194	byFrequency	TCGA-PK-A5H9-01A-11D-A29I-10	TCGA-PK-A5H9-10A-01D-A29L-10	T	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	cb1f20fc-0df5-42f5-91b8-624bee1a532a	4fa707a6-752b-4fda-9bc0-b07c80cf65c1	g.chr17:62020348T>C	ENST00000435607.1	-	23	4202	c.4126A>G	c.(4126-4128)Aac>Gac	p.N1376D	SCN4A_ENST00000578147.1_Missense_Mutation_p.N1376D	NM_000334.4	NP_000325.4	P35499	SCN4A_HUMAN	sodium channel, voltage-gated, type IV, alpha subunit	1376			N -> D (in dbSNP:rs2058194). {ECO:0000269|PubMed:1315496}.		membrane depolarization during action potential (GO:0086010)|muscle contraction (GO:0006936)|neuronal action potential (GO:0019228)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)	p.N1376D(1)		breast(4)|central_nervous_system(3)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(23)|lung(40)|ovary(3)|pancreas(1)|prostate(6)|skin(4)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	101					Diclofenac(DB00586)|Flecainide(DB01195)|Propofol(DB00818)|Valproic Acid(DB00313)|Zonisamide(DB00909)	TGGCTCTGGTTGTCTGTCTCC	0.532													C|||	2812	0.561502	0.7837	0.4697	5008	,	,		24608	0.5377		0.5557	False		,,,				2504	0.3569				p.N1376D		.											.	SCN4A-93	1	Substitution - Missense(1)	stomach(1)	c.A4126G						.	C	ASP/ASN	3221,1185	414.6+/-336.9	1193,835,175	224.0	209.0	214.0		4126	3.9	1.0	17	dbSNP_94	214	4574,4026	556.3+/-386.8	1265,2044,991	yes	missense	SCN4A	NM_000334.4	23	2458,2879,1166	CC,CT,TT		46.814,26.8951,40.0661	benign	1376/1837	62020348	7795,5211	2203	4300	6503	SO:0001583	missense	6329	exon23			TCTGGTTGTCTGT	U24693		17q23.3	2012-02-26	2007-01-23					"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10591	protein-coding gene	gene with protein product		603967		HYKPP		1654742, 1659948, 16382098	Standard	XM_005257566		Approved	Nav1.4, HYPP, SkM1	uc002jds.1	P35499		ENST00000435607.1:c.4126A>G	17.37:g.62020348T>C	ENSP00000396320:p.Asn1376Asp	Somatic	467	3		WXS	Illumina GAIIx	Phase_I	483	12	NM_000334	0	0	2	2	0	Q15478|Q16447|Q7Z6B1	Missense_Mutation	SNP	ENST00000435607.1	37	CCDS45761.1	1282	0.586996336996337	387	0.7865853658536586	184	0.5082872928176796	289	0.5052447552447552	422	0.5567282321899736	C	8.322	0.824528	0.16678	0.731049	0.53186	ENSG00000007314	ENST00000435607	D	0.97328	-4.34	3.87	3.87	0.44632	.	0.050633	0.85682	N	0.000000	T	0.00012	0.0000	N	0.00045	-2.445	0.48288	P	3.769999999999607E-4	B	0.02656	0.0	B	0.01281	0.0	T	0.47100	-0.9143	9	0.02654	T	1	.	11.0601	0.47942	0.0:0.9087:0.0:0.0913	rs2058194;rs52833416;rs56720134;rs2058194	1376	P35499	SCN4A_HUMAN	D	1376	ENSP00000396320:N1376D	ENSP00000396320:N1376D	N	-	1	0	SCN4A	59374080	1.000000	0.71417	0.988000	0.46212	0.969000	0.65631	4.799000	0.62517	0.993000	0.38866	-0.355000	0.07637	AAC	T|0.407;C|0.593		0.532	SCN4A-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		NM_000334	
SLC16A5	9121	bcgsc.ca	37	17	73089852	73089852	+	Silent	SNP	T	T	C	rs4788863	byFrequency	TCGA-PK-A5H9-01A-11D-A29I-10	TCGA-PK-A5H9-10A-01D-A29L-10	T	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	cb1f20fc-0df5-42f5-91b8-624bee1a532a	4fa707a6-752b-4fda-9bc0-b07c80cf65c1	g.chr17:73089852T>C	ENST00000450736.2	+	2	536	c.121T>C	c.(121-123)Ttg>Ctg	p.L41L	SLC16A5_ENST00000329783.4_Silent_p.L41L|SLC16A5_ENST00000538213.2_Silent_p.L81L|SLC16A5_ENST00000585293.1_3'UTR|SLC16A5_ENST00000580123.1_Silent_p.L41L			O15375	MOT6_HUMAN	solute carrier family 16 (monocarboxylate transporter), member 5	41					monocarboxylic acid transport (GO:0015718)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)	monocarboxylic acid transmembrane transporter activity (GO:0008028)|secondary active monocarboxylate transmembrane transporter activity (GO:0015355)|symporter activity (GO:0015293)			central_nervous_system(1)|cervix(2)|endometrium(5)|kidney(1)|large_intestine(4)|lung(7)|skin(1)|upper_aerodigestive_tract(1)	22	all_lung(278;0.226)		LUSC - Lung squamous cell carcinoma(166;0.162)|Lung(188;0.235)		Pyruvic acid(DB00119)	CTTCACTGAATTGCAATGGGA	0.632													C|||	3132	0.625399	0.7186	0.6412	5008	,	,		20101	0.3442		0.7127	False		,,,				2504	0.6881				p.L41L		.											.	SLC16A5-90	0			c.T121C						.	C		3245,1161	411.5+/-335.8	1186,873,144	143.0	123.0	130.0		121	4.8	0.2	17	dbSNP_111	130	6255,2345	390.7+/-343.4	2274,1707,319	no	coding-synonymous	SLC16A5	NM_004695.2		3460,2580,463	CC,CT,TT		27.2674,26.3504,26.9568		41/506	73089852	9500,3506	2203	4300	6503	SO:0001819	synonymous_variant	9121	exon3			ACTGAATTGCAAT	U59299	CCDS11713.1	17q25.1	2013-07-18	2013-07-18		ENSG00000170190	ENSG00000170190		"""Solute carriers"""	10926	protein-coding gene	gene with protein product		603879	"""solute carrier family 16 (monocarboxylic acid transporters), member 5"", ""solute carrier family 16, member 5 (monocarboxylic acid transporter 6)"""			9425115	Standard	NM_004695		Approved	MCT5, MCT6	uc002jmr.4	O15375	OTTHUMG00000179277	ENST00000450736.2:c.121T>C	17.37:g.73089852T>C		Somatic	209	1		WXS	Illumina GAIIx	Phase_I	201	12	NM_001271765	0	0	3	3	0	B4E288	Silent	SNP	ENST00000450736.2	37	CCDS11713.1																																																																																			T|0.323;C|0.677		0.632	SLC16A5-004	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000445547.1	NM_004695	
NPTX1	4884	hgsc.bcm.edu	37	17	78450174	78450174	+	Missense_Mutation	SNP	A	A	T	rs201884300	byFrequency	TCGA-PK-A5H9-01A-11D-A29I-10	TCGA-PK-A5H9-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	cb1f20fc-0df5-42f5-91b8-624bee1a532a	4fa707a6-752b-4fda-9bc0-b07c80cf65c1	g.chr17:78450174A>T	ENST00000306773.4	-	1	230	c.73T>A	c.(73-75)Ttc>Atc	p.F25I	NPTX1_ENST00000575212.1_Intron	NM_002522.3	NP_002513.2	Q15818	NPTX1_HUMAN	neuronal pentraxin I	25					axonogenesis involved in innervation (GO:0060385)|cellular response to glucose stimulus (GO:0071333)|cellular response to potassium ion (GO:0035865)|central nervous system development (GO:0007417)|mitochondrial fragmentation involved in apoptotic process (GO:0043653)|mitochondrial transport (GO:0006839)|synaptic transmission (GO:0007268)|transport (GO:0006810)	cytoplasmic vesicle (GO:0031410)|mitochondrion (GO:0005739)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)			kidney(1)|large_intestine(2)|liver(1)|lung(4)|prostate(2)|upper_aerodigestive_tract(1)	11	all_neural(118;0.0538)		BRCA - Breast invasive adenocarcinoma(99;0.0232)|OV - Ovarian serous cystadenocarcinoma(97;0.0487)			GTCGGCCCGAAATCCTGGGCC	0.791													A|||	2	0.000399361	0.0	0.0	5008	,	,		7648	0.002		0.0	False		,,,				2504	0.0				p.F25I		.											.	NPTX1-90	0			c.T73A						.						3.0	3.0	3.0					17																	78450174		1728	3378	5106	SO:0001583	missense	4884	exon1			GCCCGAAATCCTG	U61849	CCDS32762.1	17q25.3	2008-05-14				ENSG00000171246			7952	protein-coding gene	gene with protein product		602367				8884281	Standard	NM_002522		Approved		uc002jyp.1	Q15818		ENST00000306773.4:c.73T>A	17.37:g.78450174A>T	ENSP00000307549:p.Phe25Ile	Somatic	2	0		WXS	Illumina GAIIx	Phase_I	21	8	NM_002522	0	0	0	0	0	B3KXH3|Q5FWE6	Missense_Mutation	SNP	ENST00000306773.4	37	CCDS32762.1	5	0.0022893772893772895	2	0.0040650406504065045	0	0.0	3	0.005244755244755245	0	0.0	A	13.58	2.279458	0.40294	.	.	ENSG00000171246	ENST00000306773	T	0.09255	3.0	2.47	2.47	0.30058	.	0.063724	0.64402	U	0.000006	T	0.06462	0.0166	L	0.51422	1.61	0.47153	D	0.999339	P	0.37061	0.58	B	0.35114	0.196	T	0.26292	-1.0107	10	0.22109	T	0.4	.	9.2929	0.37797	1.0:0.0:0.0:0.0	.	25	Q15818	NPTX1_HUMAN	I	25	ENSP00000307549:F25I	ENSP00000307549:F25I	F	-	1	0	NPTX1	76064769	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	3.246000	0.51414	1.003000	0.39130	0.254000	0.18369	TTC	A|0.998;T|0.002		0.791	NPTX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000438051.1		
TTC39C	125488	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	18	21703901	21703901	+	Silent	SNP	G	G	A			TCGA-PK-A5H9-01A-11D-A29I-10	TCGA-PK-A5H9-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	cb1f20fc-0df5-42f5-91b8-624bee1a532a	4fa707a6-752b-4fda-9bc0-b07c80cf65c1	g.chr18:21703901G>A	ENST00000317571.3	+	9	1526	c.1290G>A	c.(1288-1290)gtG>gtA	p.V430V	RP11-799B12.2_ENST00000583782.1_RNA|TTC39C_ENST00000540918.2_Silent_p.V123V|RNU5A-6P_ENST00000384136.1_RNA|TTC39C_ENST00000304621.6_Silent_p.V369V	NM_001135993.1	NP_001129465.1	Q8N584	TT39C_HUMAN	tetratricopeptide repeat domain 39C	430										breast(1)|endometrium(3)|kidney(3)|large_intestine(4)|lung(5)|ovary(1)|prostate(1)|skin(1)	19						AGTTCTCGGTGAAAAAGGTAT	0.408																																					p.V430V		.											.	TTC39C-91	0			c.G1290A						.						51.0	46.0	48.0					18																	21703901		2203	4300	6503	SO:0001819	synonymous_variant	125488	exon9			CTCGGTGAAAAAG	AK091080	CCDS32804.1, CCDS45839.1, CCDS58616.1	18q11.2	2014-02-07	2008-06-23	2008-06-23	ENSG00000168234	ENSG00000168234		"""Tetratricopeptide (TTC) repeat domain containing"""	26595	protein-coding gene	gene with protein product			"""chromosome 18 open reading frame 17"""	C18orf17		14702039	Standard	NM_153211		Approved	FLJ33761, HsT2697	uc002kuw.3	Q8N584	OTTHUMG00000179403	ENST00000317571.3:c.1290G>A	18.37:g.21703901G>A		Somatic	110	0		WXS	Illumina GAIIx	Phase_I	86	17	NM_001135993	0	0	0	0	0	B7WP63|J3QRR1|Q0VAJ2|Q8N284	Silent	SNP	ENST00000317571.3	37	CCDS45839.1																																																																																			.		0.408	TTC39C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000446107.1	NM_153211	
TAF4B	6875	broad.mit.edu	37	18	23807117	23807117	+	Missense_Mutation	SNP	G	G	T			TCGA-PK-A5H9-01A-11D-A29I-10	TCGA-PK-A5H9-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	cb1f20fc-0df5-42f5-91b8-624bee1a532a	4fa707a6-752b-4fda-9bc0-b07c80cf65c1	g.chr18:23807117G>T	ENST00000269142.5	+	1	1218	c.220G>T	c.(220-222)Gct>Tct	p.A74S	TAF4B_ENST00000400466.2_Missense_Mutation_p.A74S|TAF4B_ENST00000578121.1_Missense_Mutation_p.A74S	NM_005640.1	NP_005631.1	Q92750	TAF4B_HUMAN	TAF4b RNA polymerase II, TATA box binding protein (TBP)-associated factor, 105kDa	74					gene expression (GO:0010467)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor TFIID complex (GO:0005669)	DNA binding (GO:0003677)|NF-kappaB binding (GO:0051059)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(13)|prostate(1)|skin(1)	29	all_cancers(21;0.00151)|Lung NSC(5;0.000401)|all_lung(6;0.00115)|Ovarian(20;0.124)		Epithelial(2;9.57e-07)|all cancers(3;5.15e-06)|OV - Ovarian serous cystadenocarcinoma(3;1.96e-05)|LUSC - Lung squamous cell carcinoma(2;0.00594)|Lung(2;0.0267)			GACCAAAGTGGCTCCGGTCAG	0.672																																					p.A74S		.											.	TAF4B-71	0			c.G220T						.						45.0	50.0	48.0					18																	23807117		1951	4131	6082	SO:0001583	missense	6875	exon1			AAAGTGGCTCCGG	Y09321	CCDS42421.1	18q11.1	2008-08-01	2002-08-29	2001-12-07		ENSG00000141384			11538	protein-coding gene	gene with protein product	"""TATA box binding protein (TBP)-associated factor 4B"""	601689	"""TATA box binding protein (TBP)-associated factor, RNA polymerase II, C2, 105kD"""	TAF2C2		8858156, 10849440	Standard	XM_005258339		Approved	TAFII105	uc002kvu.4	Q92750		ENST00000269142.5:c.220G>T	18.37:g.23807117G>T	ENSP00000269142:p.Ala74Ser	Somatic	82	0		WXS	Illumina GAIIx	Phase_I	80	4	NM_005640	0	0	1	1	0	Q29YA4|Q29YA5	Missense_Mutation	SNP	ENST00000269142.5	37	CCDS42421.1	.	.	.	.	.	.	.	.	.	.	G	12.95	2.092567	0.36952	.	.	ENSG00000141384	ENST00000418698;ENST00000269142;ENST00000400466	T;T;T	0.25250	1.81;1.85;1.81	4.84	3.96	0.45880	.	0.239623	0.32430	N	0.006111	T	0.16257	0.0391	L	0.47716	1.5	0.26261	N	0.978575	B;P	0.37781	0.103;0.608	B;B	0.24701	0.019;0.055	T	0.14254	-1.0479	10	0.17369	T	0.5	-3.6003	9.2613	0.37614	0.102:0.0:0.898:0.0	.	74;74	Q92750;A4PBF7	TAF4B_HUMAN;.	S	74	ENSP00000389365:A74S;ENSP00000269142:A74S;ENSP00000383314:A74S	ENSP00000269142:A74S	A	+	1	0	TAF4B	22061115	1.000000	0.71417	0.963000	0.40424	0.703000	0.40648	3.076000	0.50081	1.025000	0.39708	0.455000	0.32223	GCT	.		0.672	TAF4B-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000446260.3	NM_005640	
SALL3	27164	hgsc.bcm.edu	37	18	76753768	76753768	+	Missense_Mutation	SNP	C	C	G	rs2447437	byFrequency	TCGA-PK-A5H9-01A-11D-A29I-10	TCGA-PK-A5H9-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	cb1f20fc-0df5-42f5-91b8-624bee1a532a	4fa707a6-752b-4fda-9bc0-b07c80cf65c1	g.chr18:76753768C>G	ENST00000537592.2	+	2	1777	c.1777C>G	c.(1777-1779)Ctc>Gtc	p.L593V	SALL3_ENST00000575389.2_Missense_Mutation_p.L593V|SALL3_ENST00000536229.3_Missense_Mutation_p.L460V	NM_171999.3	NP_741996.2	Q9BXA9	SALL3_HUMAN	spalt-like transcription factor 3	593			L -> V (in dbSNP:rs2447437). {ECO:0000269|Ref.1}.		forelimb morphogenesis (GO:0035136)|hindlimb morphogenesis (GO:0035137)|negative regulation of smoothened signaling pathway (GO:0045879)|olfactory bulb interneuron development (GO:0021891)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.L593V(1)		NS(2)|breast(1)|central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(8)|lung(40)|ovary(4)|prostate(5)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	74		Esophageal squamous(42;0.129)|Melanoma(33;0.16)|Prostate(75;0.167)		OV - Ovarian serous cystadenocarcinoma(15;4.69e-06)|BRCA - Breast invasive adenocarcinoma(31;0.0256)		CGGGCCGCCCCTCACTAAAGC	0.731													C|||	3973	0.793331	0.5825	0.8444	5008	,	,		9900	0.9226		0.8648	False		,,,				2504	0.8354				p.L593V		.											.	SALL3-155	1	Substitution - Missense(1)	prostate(1)	c.C1777G						.	C	VAL/LEU	2422,1000		875,672,164	3.0	4.0	4.0		1777	5.2	0.2	18	dbSNP_100	4	6372,926		2808,756,85	yes	missense	SALL3	NM_171999.2	32	3683,1428,249	GG,GC,CC		12.6884,29.2227,17.9664	benign	593/1301	76753768	8794,1926	1711	3649	5360	SO:0001583	missense	27164	exon2			CCGCCCCTCACTA	AJ007421	CCDS12013.1	18q23	2013-10-17	2013-10-17		ENSG00000256463	ENSG00000256463		"""Zinc fingers, C2H2-type"""	10527	protein-coding gene	gene with protein product		605079	"""sal (Drosophila)-like 3"", ""sal-like 3 (Drosophila)"""			10610715	Standard	NM_171999		Approved	ZNF796	uc002lmt.3	Q9BXA9	OTTHUMG00000132896	ENST00000537592.2:c.1777C>G	18.37:g.76753768C>G	ENSP00000441823:p.Leu593Val	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	4	4	NM_171999	0	0	0	0	0	Q9UGH1	Missense_Mutation	SNP	ENST00000537592.2	37	CCDS12013.1	1724	0.7893772893772893	287	0.5833333333333334	299	0.8259668508287292	511	0.8933566433566433	627	0.8271767810026385	C	0.073	-1.197989	0.01594	0.707773	0.873116	ENSG00000256463	ENST00000537592;ENST00000536229;ENST00000543056	T	0.08984	3.03	5.2	5.2	0.72013	.	0.464067	0.17974	N	0.155779	T	0.00012	0.0000	L	0.35288	1.05	0.80722	P	0.0	B;B	0.15473	0.013;0.006	B;B	0.18561	0.022;0.002	T	0.36237	-0.9756	9	0.14656	T	0.56	-21.7235	10.231	0.43256	0.2471:0.6277:0.1252:0.0	rs2447437	325;593	F5GXY4;Q9BXA9	.;SALL3_HUMAN	V	593;593;325	ENSP00000441823:L593V	ENSP00000299466:L593V	L	+	1	0	SALL3	74854756	0.002000	0.14202	0.157000	0.22605	0.006000	0.05464	0.292000	0.19011	2.584000	0.87258	0.563000	0.77884	CTC	C|0.780;G|0.220		0.731	SALL3-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256397.1	NM_171999	
KISS1R	84634	hgsc.bcm.edu	37	19	920642	920642	+	Missense_Mutation	SNP	T	T	A	rs350132	byFrequency	TCGA-PK-A5H9-01A-11D-A29I-10	TCGA-PK-A5H9-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	cb1f20fc-0df5-42f5-91b8-624bee1a532a	4fa707a6-752b-4fda-9bc0-b07c80cf65c1	g.chr19:920642T>A	ENST00000234371.5	+	5	1244	c.1091T>A	c.(1090-1092)cTc>cAc	p.L364H	KISS1R_ENST00000606939.1_3'UTR	NM_032551.4	NP_115940.2	Q969F8	KISSR_HUMAN	KISS1 receptor	364			L -> H (in dbSNP:rs350132). {ECO:0000269|PubMed:11385580, ECO:0000269|PubMed:11414709, ECO:0000269|PubMed:11457843, ECO:0000269|PubMed:14573733, ECO:0000269|PubMed:15489334, ECO:0000269|PubMed:15598687, ECO:0000269|Ref.8}.		activation of MAPKK activity (GO:0000186)|arachidonic acid secretion (GO:0050482)|calcium-mediated signaling (GO:0019722)|G-protein coupled receptor signaling pathway (GO:0007186)|negative regulation of cell proliferation (GO:0008285)|neuropeptide signaling pathway (GO:0007218)|positive regulation of hormone secretion (GO:0046887)|positive regulation of stress fiber assembly (GO:0051496)|positive regulation of synaptic transmission (GO:0050806)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	neuropeptide binding (GO:0042923)|neuropeptide receptor activity (GO:0008188)			cervix(1)|kidney(1)|ovary(1)|pancreas(1)|skin(1)	5		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;1.04e-05)|all_lung(49;1.53e-05)|Breast(49;9.42e-05)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		GCGGAGCTGCTCCGCCTGGGG	0.816													a|||	3926	0.783946	0.916	0.6988	5008	,	,		7496	0.7589		0.7485	False		,,,				2504	0.728				p.L364H		.											.	KISS1R-91	0			c.T1091A						.						1.0	2.0	1.0					19																	920642		976	2331	3307	SO:0001583	missense	84634	exon5			AGCTGCTCCGCCT	AB051065	CCDS12049.1	19p13.3	2012-08-10	2006-02-15	2006-02-15	ENSG00000116014	ENSG00000116014		"""GPCR / Class A : RF amide peptide receptors"""	4510	protein-coding gene	gene with protein product		604161	"""G protein-coupled receptor 54"""	GPR54		10100623	Standard	NM_032551		Approved	HOT7T175, AXOR12	uc002lqk.4	Q969F8		ENST00000234371.5:c.1091T>A	19.37:g.920642T>A	ENSP00000234371:p.Leu364His	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	7	5	NM_032551	0	0	0	0	0	A5D8U2|B2RTV1|Q96QG0	Missense_Mutation	SNP	ENST00000234371.5	37	CCDS12049.1	1676	0.7673992673992674	432	0.8780487804878049	253	0.6988950276243094	435	0.7604895104895105	556	0.7335092348284961	N	2.523	-0.310400	0.05458	.	.	ENSG00000116014	ENST00000234371	T	0.71579	-0.58	4.36	-0.607	0.11615	.	0.579379	0.14719	N	0.302432	T	0.00012	0.0000	N	0.03608	-0.345	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.31998	-0.9923	9	0.13108	T	0.6	.	0.8843	0.01241	0.3667:0.1686:0.3009:0.1639	rs350132;rs3746148	364	Q969F8	KISSR_HUMAN	H	364	ENSP00000234371:L364H	ENSP00000234371:L364H	L	+	2	0	KISS1R	871642	0.000000	0.05858	0.075000	0.20258	0.190000	0.23558	-1.559000	0.02162	-0.349000	0.08274	-0.385000	0.06624	CTC	T|0.232;A|0.768		0.816	KISS1R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458217.3	NM_032551	
KLF16	83855	hgsc.bcm.edu	37	19	1854557	1854557	+	Silent	SNP	A	A	G	rs3746045	byFrequency	TCGA-PK-A5H9-01A-11D-A29I-10	TCGA-PK-A5H9-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	cb1f20fc-0df5-42f5-91b8-624bee1a532a	4fa707a6-752b-4fda-9bc0-b07c80cf65c1	g.chr19:1854557A>G	ENST00000250916.4	-	2	730	c.660T>C	c.(658-660)ccT>ccC	p.P220P	CTB-31O20.6_ENST00000592884.1_RNA|KLF16_ENST00000592313.1_5'UTR	NM_031918.3	NP_114124.1	Q9BXK1	KLF16_HUMAN	Kruppel-like factor 16	220	Pro/Ser-rich.				dopamine receptor signaling pathway (GO:0007212)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			lung(1)	1		Ovarian(11;1.78e-06)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		TGCGGGCACCAGGGCGCCGGA	0.756													A|||	2119	0.423123	0.6785	0.4611	5008	,	,		10654	0.3829		0.2177	False		,,,				2504	0.3037				p.P220P		.											.	KLF16-90	0			c.T660C						.	A		2319,1817		694,931,443	10.0	16.0	14.0		660	-6.7	0.2	19	dbSNP_107	14	1682,6356		211,1260,2548	no	coding-synonymous	KLF16	NM_031918.3		905,2191,2991	GG,GA,AA		20.9256,43.9313,32.8651		220/253	1854557	4001,8173	2068	4019	6087	SO:0001819	synonymous_variant	83855	exon2			GGCACCAGGGCGC	AF327440	CCDS12075.1	19p13.3	2013-10-15			ENSG00000129911	ENSG00000129911		"""Kruppel-like transcription factors"", ""Zinc fingers, C2H2-type"""	16857	protein-coding gene	gene with protein product		606139				11438660	Standard	NM_031918		Approved	NSLP2, BTEB4, DRRF	uc002luc.3	Q9BXK1	OTTHUMG00000179994	ENST00000250916.4:c.660T>C	19.37:g.1854557A>G		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	23	22	NM_031918	0	0	0	14	14		Silent	SNP	ENST00000250916.4	37	CCDS12075.1																																																																																			A|0.591;G|0.409		0.756	KLF16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000449214.1		
TICAM1	148022	broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	4818321	4818321	+	Silent	SNP	G	G	A			TCGA-PK-A5H9-01A-11D-A29I-10	TCGA-PK-A5H9-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	cb1f20fc-0df5-42f5-91b8-624bee1a532a	4fa707a6-752b-4fda-9bc0-b07c80cf65c1	g.chr19:4818321G>A	ENST00000248244.5	-	2	298	c.69C>T	c.(67-69)ctC>ctT	p.L23L		NM_182919.3	NP_891549.1	Q8IUC6	TCAM1_HUMAN	toll-like receptor adaptor molecule 1	23					apoptotic signaling pathway (GO:0097190)|defense response to virus (GO:0051607)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|lipopolysaccharide-mediated signaling pathway (GO:0031663)|macrophage activation involved in immune response (GO:0002281)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of chemokine biosynthetic process (GO:0045080)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interferon-beta biosynthetic process (GO:0045359)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of natural killer cell activation (GO:0032816)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|positive regulation of protein binding (GO:0032092)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of tumor necrosis factor production (GO:0032760)|positive regulation of type I interferon production (GO:0032481)|regulation of protein homodimerization activity (GO:0043496)|response to exogenous dsRNA (GO:0043330)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytosol (GO:0005829)|endosome membrane (GO:0010008)|ripoptosome (GO:0097342)	protein kinase binding (GO:0019901)|signal transducer activity (GO:0004871)			NS(2)|breast(2)|endometrium(2)|kidney(2)|large_intestine(4)|lung(6)|ovary(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	26				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0139)		TCAGATACAAGAGCTTGTCCT	0.612																																					p.L23L		.											.	TICAM1-153	0			c.C69T						.						40.0	39.0	40.0					19																	4818321		2203	4300	6503	SO:0001819	synonymous_variant	148022	exon2			ATACAAGAGCTTG	AB086380	CCDS12136.1	19p13.3	2014-09-17				ENSG00000127666			18348	protein-coding gene	gene with protein product		607601				12539043, 12471095	Standard	NM_182919		Approved	TRIF, TICAM-1, MGC35334, PRVTIRB	uc002mbi.4	Q8IUC6		ENST00000248244.5:c.69C>T	19.37:g.4818321G>A		Somatic	51	0		WXS	Illumina GAIIx	Phase_I	47	7	NM_182919	0	0	10	12	2	B3Y691|O75532|Q86XP8|Q96GA0	Silent	SNP	ENST00000248244.5	37	CCDS12136.1																																																																																			.		0.612	TICAM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000450435.1	NM_014261	
ARHGEF18	23370	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	7506565	7506565	+	Missense_Mutation	SNP	C	C	A			TCGA-PK-A5H9-01A-11D-A29I-10	TCGA-PK-A5H9-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	cb1f20fc-0df5-42f5-91b8-624bee1a532a	4fa707a6-752b-4fda-9bc0-b07c80cf65c1	g.chr19:7506565C>A	ENST00000359920.6	+	2	822	c.569C>A	c.(568-570)gCc>gAc	p.A190D	CTD-2207O23.3_ENST00000593531.1_Missense_Mutation_p.P148T|ARHGEF18_ENST00000319670.9_Missense_Mutation_p.A32D	NM_001130955.1	NP_001124427.1	Q6ZSZ5	ARHGI_HUMAN	Rho/Rac guanine nucleotide exchange factor (GEF) 18	190					actin cytoskeleton organization (GO:0030036)|apoptotic signaling pathway (GO:0097190)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|regulation of cell shape (GO:0008360)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|transforming growth factor beta receptor signaling pathway (GO:0007179)	apical part of cell (GO:0045177)|cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytosol (GO:0005829)	guanyl-nucleotide exchange factor activity (GO:0005085)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(6)|lung(4)|ovary(2)|prostate(2)|stomach(1)|urinary_tract(1)	23		Renal(5;0.0902)				ATGGATGAAGCCGATTCTGCG	0.403																																					p.A190D		.											.	ARHGEF18-228	0			c.C569A						.						147.0	142.0	143.0					19																	7506565		2203	4300	6503	SO:0001583	missense	23370	exon2			ATGAAGCCGATTC	AK074372	CCDS12177.1, CCDS45946.1	19p13.3	2013-01-10	2009-06-12			ENSG00000104880		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	17090	protein-coding gene	gene with protein product	"""Rho-specific guanine nucleotide exchange factor p114"""		"""rho/rac guanine nucleotide exchange factor (GEF) 18"""			9628581, 11318610	Standard	NM_015318		Approved	P114-RhoGEF, KIAA0521, MGC15913	uc002mgi.3	Q6ZSZ5		ENST00000359920.6:c.569C>A	19.37:g.7506565C>A	ENSP00000352995:p.Ala190Asp	Somatic	55	0		WXS	Illumina GAIIx	Phase_I	57	9	NM_001130955	0	0	17	20	3	A8MV62|B5ME81|O60274|Q6DD92	Missense_Mutation	SNP	ENST00000359920.6	37	CCDS45946.1	.	.	.	.	.	.	.	.	.	.	C	14.94	2.684395	0.47991	.	.	ENSG00000104880	ENST00000319670;ENST00000359920	T;T	0.32988	1.45;1.43	5.54	4.46	0.54185	.	0.712446	0.12329	N	0.478585	T	0.24774	0.0601	L	0.27053	0.805	0.19575	N	0.999968	B	0.15473	0.013	B	0.19666	0.026	T	0.10109	-1.0644	10	0.54805	T	0.06	-6.1055	12.4798	0.55836	0.0:0.8328:0.1672:0.0	.	190	Q6ZSZ5	ARHGI_HUMAN	D	32;190	ENSP00000319200:A32D;ENSP00000352995:A190D	ENSP00000319200:A32D	A	+	2	0	ARHGEF18	7412565	0.017000	0.18338	0.089000	0.20774	0.688000	0.40055	0.952000	0.29149	2.612000	0.88384	0.505000	0.49811	GCC	.		0.403	ARHGEF18-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000436340.1	NM_015318	
LPPR2	64748	broad.mit.edu	37	19	11472132	11472132	+	Missense_Mutation	SNP	G	G	T			TCGA-PK-A5H9-01A-11D-A29I-10	TCGA-PK-A5H9-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	cb1f20fc-0df5-42f5-91b8-624bee1a532a	4fa707a6-752b-4fda-9bc0-b07c80cf65c1	g.chr19:11472132G>T	ENST00000251473.5	+	6	1007	c.631G>T	c.(631-633)Gcc>Tcc	p.A211S	DKFZP761J1410_ENST00000591608.1_Missense_Mutation_p.A186S	NM_001170635.1|NM_022737.2	NP_001164106.1|NP_073574.2																					CAAGGATGCGGCCCTCTGCGC	0.692																																					p.A211S		.											.	LPPR2-153	0			c.G631T						.						26.0	29.0	28.0					19																	11472132		2199	4277	6476	SO:0001583	missense	0	exon6			GATGCGGCCCTCT																												ENST00000251473.5:c.631G>T	19.37:g.11472132G>T	ENSP00000251473:p.Ala211Ser	Somatic	14	0		WXS	Illumina GAIIx	Phase_I	121	8	NM_022737	0	0	7	7	0		Missense_Mutation	SNP	ENST00000251473.5	37	CCDS12258.1	.	.	.	.	.	.	.	.	.	.	g	33	5.243323	0.95272	.	.	ENSG00000105520	ENST00000251473	T	0.75477	-0.94	5.36	5.36	0.76844	Phosphatidic acid phosphatase/chloroperoxidase, N-terminal (1);	0.000000	0.85682	D	0.000000	T	0.70613	0.3244	N	0.16166	0.38	0.80722	D	1	P;P	0.45902	0.851;0.868	P;P	0.59012	0.58;0.85	T	0.64415	-0.6413	10	0.02654	T	1	-25.3512	17.8761	0.88825	0.0:0.0:1.0:0.0	.	186;211	Q96GM1-2;Q96GM1	.;LPPR2_HUMAN	S	211	ENSP00000251473:A211S	ENSP00000251473:A211S	A	+	1	0	AC024575.1	11333132	1.000000	0.71417	0.969000	0.41365	0.979000	0.70002	7.161000	0.77505	2.524000	0.85096	0.550000	0.68814	GCC	.		0.692	DKFZP761J1410-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458779.1		
CACNA1A	773	hgsc.bcm.edu	37	19	13409696	13409696	+	Missense_Mutation	SNP	C	C	G	rs16022	byFrequency	TCGA-PK-A5H9-01A-11D-A29I-10	TCGA-PK-A5H9-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	cb1f20fc-0df5-42f5-91b8-624bee1a532a	4fa707a6-752b-4fda-9bc0-b07c80cf65c1	g.chr19:13409696C>G	ENST00000360228.5	-	19	2750	c.2751G>C	c.(2749-2751)gaG>gaC	p.E917D	CACNA1A_ENST00000573710.2_Missense_Mutation_p.E918D	NM_000068.3|NM_001127222.1|NM_001174080.1|NM_023035.2	NP_000059.3|NP_001120694.1|NP_001167551.1|NP_075461.2	O00555	CAC1A_HUMAN	calcium channel, voltage-dependent, P/Q type, alpha 1A subunit	918					adult walking behavior (GO:0007628)|behavioral response to pain (GO:0048266)|calcium ion import (GO:0070509)|calcium ion-dependent exocytosis (GO:0017156)|calcium ion-dependent exocytosis of neurotransmitter (GO:0048791)|cell death (GO:0008219)|cell growth (GO:0016049)|cellular chloride ion homeostasis (GO:0030644)|cerebellar molecular layer development (GO:0021679)|cerebellar Purkinje cell differentiation (GO:0021702)|cerebellum maturation (GO:0021590)|dendrite morphogenesis (GO:0048813)|energy reserve metabolic process (GO:0006112)|gamma-aminobutyric acid secretion (GO:0014051)|gamma-aminobutyric acid signaling pathway (GO:0007214)|glucose metabolic process (GO:0006006)|hormone metabolic process (GO:0042445)|membrane depolarization (GO:0051899)|membrane depolarization during action potential (GO:0086010)|musculoskeletal movement, spinal reflex action (GO:0050883)|negative regulation of hormone biosynthetic process (GO:0032353)|negative regulation of neuron apoptotic process (GO:0043524)|neuromuscular process controlling balance (GO:0050885)|neuromuscular synaptic transmission (GO:0007274)|neurotransmitter metabolic process (GO:0042133)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|receptor clustering (GO:0043113)|regulation of acetylcholine secretion, neurotransmission (GO:0014056)|regulation of axonogenesis (GO:0050770)|regulation of calcium ion-dependent exocytosis (GO:0017158)|regulation of insulin secretion (GO:0050796)|rhythmic synaptic transmission (GO:0060024)|small molecule metabolic process (GO:0044281)|spinal cord motor neuron differentiation (GO:0021522)|sulfur amino acid metabolic process (GO:0000096)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transmission of nerve impulse (GO:0019226)|vestibular nucleus development (GO:0021750)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	high voltage-gated calcium channel activity (GO:0008331)|metal ion binding (GO:0046872)|syntaxin binding (GO:0019905)|voltage-gated calcium channel activity (GO:0005245)	p.E918D(3)		breast(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(25)|prostate(2)|urinary_tract(1)	42			OV - Ovarian serous cystadenocarcinoma(19;5.07e-21)		Bepridil(DB01244)|Loperamide(DB00836)|Pregabalin(DB00230)|Spironolactone(DB00421)|Verapamil(DB00661)	CGGCCTCGCCCTCCCAGAACC	0.776													C|||	530	0.105831	0.0605	0.1254	5008	,	,		10618	0.1171		0.1471	False		,,,				2504	0.0992				p.E918D		.											.	CACNA1A-67	3	Substitution - Missense(3)	haematopoietic_and_lymphoid_tissue(3)	c.G2754C						.	C	ASP/GLU,ASP/GLU,ASP/GLU,ASP/GLU,ASP/GLU	206,3316		5,196,1560	8.0	9.0	8.0	http://www.ncbi.nlm.nih.gov/sites/varvu?gene	2763,2754,2751,2754,2763	1.5	0.9	19	dbSNP_54	8	883,6727		33,817,2955	no	missense,missense,missense,missense,missense	CACNA1A	NM_000068.3,NM_001127221.1,NM_001127222.1,NM_001174080.1,NM_023035.2	45,45,45,45,45	38,1013,4515	GG,GC,CC		11.6032,5.8489,9.7826	possibly-damaging,possibly-damaging,possibly-damaging,possibly-damaging,possibly-damaging	921/2267,918/2262,917/2507,918/2264,921/2513	13409696	1089,10043	1761	3805	5566	SO:0001583	missense	773	exon19			CTCGCCCTCCCAG	U79666	CCDS45998.1, CCDS45999.1	19p13	2014-09-17			ENSG00000141837	ENSG00000141837		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1388	protein-coding gene	gene with protein product		601011		CACNL1A4, SCA6, MHP1, MHP		8825650, 16382099, 23827678	Standard	NM_000068		Approved	Cav2.1, EA2, APCA, HPCA, FHM	uc010xne.2	O00555	OTTHUMG00000044590	ENST00000360228.5:c.2751G>C	19.37:g.13409696C>G	ENSP00000353362:p.Glu917Asp	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	20	8	NM_001127221	0	0	0	0	0	J3KP41|P78510|P78511|Q16290|Q92690|Q99790|Q99791|Q99792|Q99793|Q9NS88|Q9UDC4	Missense_Mutation	SNP	ENST00000360228.5	37	CCDS45998.1	247	0.1130952380952381	27	0.054878048780487805	43	0.11878453038674033	69	0.12062937062937062	108	0.1424802110817942	C	2.711	-0.268795	0.05716	0.058489	0.116032	ENSG00000141837	ENST00000360228;ENST00000418012;ENST00000357018;ENST00000325084	D	0.96265	-3.96	3.79	1.49	0.22878	.	4.032560	0.00550	N	0.000240	T	0.06508	0.0167	N	0.03608	-0.345	0.58432	P	9.99999999995449E-6	B;B;B	0.24963	0.0;0.001;0.115	B;B;B	0.24848	0.001;0.003;0.056	T	0.70303	-0.4909	9	0.30854	T	0.27	.	5.84	0.18629	0.0:0.484:0.3995:0.1165	rs16022;rs3752173	918;921;917	O00555;E9PD31;Q9NS88	CAC1A_HUMAN;.;.	D	917;921;918;918	ENSP00000353362:E917D	ENSP00000317661:E918D	E	-	3	2	CACNA1A	13270696	0.372000	0.25064	0.886000	0.34754	0.118000	0.20060	0.109000	0.15417	0.091000	0.17302	0.462000	0.41574	GAG	C|0.363;G|0.637		0.776	CACNA1A-001	KNOWN	non_canonical_U12|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000104062.2	NM_000068	
RFX1	5989	hgsc.bcm.edu	37	19	14073588	14073588	+	Silent	SNP	G	G	T			TCGA-PK-A5H9-01A-11D-A29I-10	TCGA-PK-A5H9-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	cb1f20fc-0df5-42f5-91b8-624bee1a532a	4fa707a6-752b-4fda-9bc0-b07c80cf65c1	g.chr19:14073588G>T	ENST00000254325.4	-	21	3093	c.2859C>A	c.(2857-2859)ggC>ggA	p.G953G		NM_002918.4	NP_002909.4	P22670	RFX1_HUMAN	regulatory factor X, 1 (influences HLA class II expression)	953	Necessary for dimerization.				immune response (GO:0006955)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)			NS(1)|breast(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(8)|ovary(2)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)	21			OV - Ovarian serous cystadenocarcinoma(19;6.67e-23)			GGGTCTCCGGGCCCAGCGCGG	0.716																																					p.G953G		.											.	RFX1-92	0			c.C2859A						.						3.0	3.0	3.0					19																	14073588		1600	3265	4865	SO:0001819	synonymous_variant	5989	exon21			CTCCGGGCCCAGC		CCDS12301.1	19p13.1	2008-07-17				ENSG00000132005			9982	protein-coding gene	gene with protein product	"""trans-acting regulatory factor 1"", ""enhancer factor C"", ""MHC class II regulatory factor RFX"""	600006				1505960, 8289803	Standard	NM_002918		Approved	EF-C	uc002mxv.3	P22670		ENST00000254325.4:c.2859C>A	19.37:g.14073588G>T		Somatic	2	0		WXS	Illumina GAIIx	Phase_I	11	9	NM_002918	0	0	4	8	4		Silent	SNP	ENST00000254325.4	37	CCDS12301.1																																																																																			.		0.716	RFX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458510.1	NM_002918	
CALR3	125972	bcgsc.ca	37	19	16591464	16591464	+	Silent	SNP	G	G	A	rs9305079	byFrequency	TCGA-PK-A5H9-01A-11D-A29I-10	TCGA-PK-A5H9-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	cb1f20fc-0df5-42f5-91b8-624bee1a532a	4fa707a6-752b-4fda-9bc0-b07c80cf65c1	g.chr19:16591464G>A	ENST00000269881.3	-	8	1034	c.972C>T	c.(970-972)taC>taT	p.Y324Y	CTD-3222D19.2_ENST00000409035.1_3'UTR|CALR3_ENST00000602234.1_5'Flank	NM_145046.4	NP_659483.2	Q96L12	CALR3_HUMAN	calreticulin 3	324	C-domain.				cell differentiation (GO:0030154)|protein folding (GO:0006457)|spermatogenesis (GO:0007283)	endoplasmic reticulum (GO:0005783)	calcium ion binding (GO:0005509)|carbohydrate binding (GO:0030246)			NS(1)|breast(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|prostate(1)|skin(1)	15						AATTATCTGCGTACTCTTCAT	0.353													C|||	3258	0.650559	0.5318	0.7493	5008	,	,		18662	0.628		0.6829	False		,,,				2504	0.7311				p.Y324Y		.											.	CALR3-90	0			c.C972T						.	A		2448,1958	555.1+/-379.2	674,1100,429	94.0	88.0	90.0		972	-0.8	0.9	19	dbSNP_119	90	6057,2543	415.9+/-351.9	2142,1773,385	no	coding-synonymous	CALR3	NM_145046.3		2816,2873,814	AA,AG,GG		29.5698,44.4394,34.6071		324/385	16591464	8505,4501	2203	4300	6503	SO:0001819	synonymous_variant	125972	exon8			ATCTGCGTACTCT	AK058084	CCDS12344.1	19p13.11	2014-09-17				ENSG00000269058			20407	protein-coding gene	gene with protein product	"""cancer/testis antigen 93"", ""calsperin"""	611414				12384296	Standard	NM_145046		Approved	CRT2, FLJ25355, MGC26577, CT93	uc002ned.3	Q96L12		ENST00000269881.3:c.972C>T	19.37:g.16591464G>A		Somatic	67	0		WXS	Illumina GAIIx	Phase_I	76	6	NM_145046	0	0	1	1	0	D9N574|Q96LN3	Silent	SNP	ENST00000269881.3	37	CCDS12344.1																																																																																			G|0.352;A|0.648		0.353	CALR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000461089.1	NM_145046	
ZNF676	163223	ucsc.edu	37	19	22363448	22363448	+	Silent	SNP	A	A	T	rs200452805		TCGA-PK-A5H9-01A-11D-A29I-10	TCGA-PK-A5H9-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	cb1f20fc-0df5-42f5-91b8-624bee1a532a	4fa707a6-752b-4fda-9bc0-b07c80cf65c1	g.chr19:22363448A>T	ENST00000397121.2	-	3	1388	c.1071T>A	c.(1069-1071)atT>atA	p.I357I		NM_001001411.2	NP_001001411.2	Q8N7Q3	ZN676_HUMAN	zinc finger protein 676	357					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(49)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(2)	67		Lung NSC(12;0.0207)|all_lung(12;0.0214)|all_epithelial(12;0.114)				CAGTATGAATAATCTTATGTT	0.383																																					p.I357I		.											.	ZNF676-90	0			c.T1071A						.						68.0	74.0	72.0					19																	22363448		2162	4271	6433	SO:0001819	synonymous_variant	163223	exon3			ATGAATAATCTTA	AK097798	CCDS42539.1	19p12	2013-01-08				ENSG00000196109		"""Zinc fingers, C2H2-type"""	20429	protein-coding gene	gene with protein product							Standard	NM_001001411		Approved		uc002nqs.1	Q8N7Q3		ENST00000397121.2:c.1071T>A	19.37:g.22363448A>T		Somatic	26	1		WXS	Illumina GAIIx	Phase_I	33	4	NM_001001411	1	0	0	41	40	A8MVX5	Silent	SNP	ENST00000397121.2	37	CCDS42539.1																																																																																			.		0.383	ZNF676-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464392.1	NM_001001411	
NUDT19	390916	hgsc.bcm.edu	37	19	33183352	33183352	+	Silent	SNP	G	G	C	rs61732600	byFrequency	TCGA-PK-A5H9-01A-11D-A29I-10	TCGA-PK-A5H9-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	cb1f20fc-0df5-42f5-91b8-624bee1a532a	4fa707a6-752b-4fda-9bc0-b07c80cf65c1	g.chr19:33183352G>C	ENST00000397061.3	+	1	486	c.486G>C	c.(484-486)ccG>ccC	p.P162P	CTD-2538C1.2_ENST00000592431.1_lincRNA	NM_001105570.1	NP_001099040.1	A8MXV4	NUD19_HUMAN	nudix (nucleoside diphosphate linked moiety X)-type motif 19	162	Nudix hydrolase. {ECO:0000255|PROSITE- ProRule:PRU00794}.					mitochondrion (GO:0005739)|peroxisome (GO:0005777)	hydrolase activity (GO:0016787)|metal ion binding (GO:0046872)|receptor binding (GO:0005102)			endometrium(1)|large_intestine(1)|lung(4)|ovary(1)|upper_aerodigestive_tract(1)	8	Esophageal squamous(110;0.137)					AGCCACCGCCGGGCCTGGCCT	0.751													G|||	1109	0.221446	0.1498	0.245	5008	,	,		11161	0.249		0.3062	False		,,,				2504	0.1861				p.P162P		.											.	NUDT19-22	0			c.G486C						.	G		469,2861		40,389,1236	4.0	5.0	5.0		486	-9.6	0.0	19	dbSNP_129	5	1887,5465		292,1303,2081	no	coding-synonymous	NUDT19	NM_001105570.1		332,1692,3317	CC,CG,GG		25.6665,14.0841,22.0558		162/376	33183352	2356,8326	1665	3676	5341	SO:0001819	synonymous_variant	390916	exon1			ACCGCCGGGCCTG		CCDS42543.1	19q13.11	2011-11-16			ENSG00000213965	ENSG00000213965		"""Nudix motif containing"""	32036	protein-coding gene	gene with protein product							Standard	NM_001105570		Approved	RP2	uc010edf.3	A8MXV4		ENST00000397061.3:c.486G>C	19.37:g.33183352G>C		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	20	9	NM_001105570	0	0	0	1	1		Silent	SNP	ENST00000397061.3	37	CCDS42543.1																																																																																			G|0.743;C|0.257		0.751	NUDT19-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000450338.3	XM_372723	
GGN	199720	hgsc.bcm.edu	37	19	38876464	38876464	+	Missense_Mutation	SNP	C	C	G	rs11083455	byFrequency	TCGA-PK-A5H9-01A-11D-A29I-10	TCGA-PK-A5H9-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	cb1f20fc-0df5-42f5-91b8-624bee1a532a	4fa707a6-752b-4fda-9bc0-b07c80cf65c1	g.chr19:38876464C>G	ENST00000334928.6	-	3	1570	c.1438G>C	c.(1438-1440)Gca>Cca	p.A480P	AC005789.9_ENST00000585411.1_RNA|SPRED3_ENST00000587013.1_5'Flank|GGN_ENST00000591809.1_Intron	NM_152657.3	NP_689870.3	Q86UU5	GGN_HUMAN	gametogenetin	480	Interaction with GGNBP1. {ECO:0000250}.|Pro-rich.				cell differentiation (GO:0030154)|gamete generation (GO:0007276)|multicellular organismal development (GO:0007275)|protein localization (GO:0008104)|spermatogenesis (GO:0007283)	nucleolus (GO:0005730)|perinuclear region of cytoplasm (GO:0048471)				breast(1)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(5)|lung(7)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	24	all_cancers(60;3.4e-06)		Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)			gcaggggctgcggtgggagcc	0.756													G|||	1149	0.229433	0.1437	0.2522	5008	,	,		9781	0.4514		0.1074	False		,,,				2504	0.226				p.A480P		.											.	GGN-90	0			c.G1438C						.	G	PRO/ALA	210,3338		0,210,1564	3.0	4.0	3.0		1438	2.6	0.0	19	dbSNP_120	3	369,6773		3,363,3205	no	missense	GGN	NM_152657.3	27	3,573,4769	GG,GC,CC		5.1666,5.9188,5.4163	benign	480/653	38876464	579,10111	1774	3571	5345	SO:0001583	missense	199720	exon3			GGGCTGCGGTGGG	AF538035	CCDS12516.1	19q13.2	2008-09-04				ENSG00000179168			18869	protein-coding gene	gene with protein product		609966				12574169	Standard	NM_152657		Approved	FLJ35713, MGC33369	uc002oij.1	Q86UU5		ENST00000334928.6:c.1438G>C	19.37:g.38876464C>G	ENSP00000334940:p.Ala480Pro	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	16	13	NM_152657	0	0	0	0	0	Q7RTU6|Q86UU4|Q8NAA1	Missense_Mutation	SNP	ENST00000334928.6	37	CCDS12516.1	461	0.21108058608058608	72	0.14634146341463414	65	0.17955801104972377	262	0.458041958041958	62	0.08179419525065963	G	1.972	-0.436347	0.04636	0.059188	0.051666	ENSG00000179168	ENST00000334928	.	.	.	3.69	2.63	0.31362	.	0.580033	0.13105	N	0.413421	T	0.00012	0.0000	N	0.01576	-0.805	0.80722	P	0.0	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.47649	-0.9101	8	0.09843	T	0.71	0.5499	9.8256	0.40910	0.0:0.4094:0.5906:0.0	rs11083455;rs60130214	397;480	Q86UU5-2;Q86UU5	.;GGN_HUMAN	P	480	.	ENSP00000334940:A480P	A	-	1	0	GGN	43568304	0.365000	0.25006	0.001000	0.08648	0.091000	0.18340	0.603000	0.24149	0.245000	0.21373	-0.371000	0.07208	GCA	C|0.789;G|0.211		0.756	GGN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000459205.1	NM_152657	
RINL	126432	hgsc.bcm.edu	37	19	39360720	39360720	+	Missense_Mutation	SNP	G	G	A	rs8110393	byFrequency	TCGA-PK-A5H9-01A-11D-A29I-10	TCGA-PK-A5H9-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	cb1f20fc-0df5-42f5-91b8-624bee1a532a	4fa707a6-752b-4fda-9bc0-b07c80cf65c1	g.chr19:39360720G>A	ENST00000591812.1	-	9	1291	c.1205C>T	c.(1204-1206)cCc>cTc	p.P402L	RINL_ENST00000602238.1_5'Flank|RINL_ENST00000340740.3_Missense_Mutation_p.P288L|CTC-360G5.6_ENST00000593830.1_RNA|RINL_ENST00000598904.1_Missense_Mutation_p.P288L			Q6ZS11	RINL_HUMAN	Ras and Rab interactor-like	402	VPS9. {ECO:0000255|PROSITE- ProRule:PRU00550}.		P -> L (in dbSNP:rs8110393).		endocytosis (GO:0006897)|positive regulation of GTPase activity (GO:0043547)|protein transport (GO:0015031)	actin cytoskeleton (GO:0015629)|cytoplasmic vesicle (GO:0031410)|ruffle (GO:0001726)	GTPase activator activity (GO:0005096)|guanyl-nucleotide exchange factor activity (GO:0005085)			endometrium(3)|kidney(4)|large_intestine(2)|lung(4)|pancreas(1)|skin(1)|urinary_tract(2)	17						GGCGGGGGCGGGGCTCTGCCC	0.781													G|||	3477	0.694289	0.9289	0.6153	5008	,	,		10275	0.7619		0.4642	False		,,,				2504	0.6002				p.P402L		.											.	RINL-91	0			c.C1205T						.	G	LEU/PRO,LEU/PRO	3328,464		1489,350,57	4.0	4.0	4.0		1205,863	3.5	1.0	19	dbSNP_116	4	4059,3433		1245,1569,932	no	missense,missense	RINL	NM_001195833.1,NM_198445.3	98,98	2734,1919,989	AA,AG,GG		45.8222,12.2363,34.5356	probably-damaging,probably-damaging	402/567,288/453	39360720	7387,3897	1896	3746	5642	SO:0001583	missense	126432	exon9			GGGGCGGGGCTCT	AK127808	CCDS12522.1, CCDS59386.1	19q13.2	2010-07-13			ENSG00000187994	ENSG00000187994			24795	protein-coding gene	gene with protein product							Standard	NM_001195833		Approved	FLJ45909	uc010xuo.2	Q6ZS11		ENST00000591812.1:c.1205C>T	19.37:g.39360720G>A	ENSP00000467107:p.Pro402Leu	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	18	14	NM_001195833	0	0	0	0	0	B4DPG5	Missense_Mutation	SNP	ENST00000591812.1	37	CCDS59386.1	1421	0.6506410256410257	458	0.9308943089430894	225	0.6215469613259669	401	0.701048951048951	337	0.4445910290237467	G	17.17	3.320891	0.60634	0.877637	0.541778	ENSG00000187994	ENST00000340740;ENST00000536520	T	0.28454	1.61	4.57	3.53	0.40419	Vacuolar sorting protein 9 (1);	0.269737	0.35235	N	0.003350	T	0.00012	0.0000	M	0.67700	2.07	0.21553	P	0.999649277	B;B	0.21225	0.053;0.053	B;B	0.22152	0.038;0.038	T	0.17776	-1.0358	9	0.72032	D	0.01	-26.0247	8.5759	0.33598	0.1063:0.0:0.8937:0.0	rs8110393;rs61482706	402;288	B4DPG5;Q6ZS11	.;RINL_HUMAN	L	288	ENSP00000340369:P288L	ENSP00000340369:P288L	P	-	2	0	RINL	44052560	1.000000	0.71417	0.987000	0.45799	0.313000	0.28021	4.771000	0.62318	1.273000	0.44346	0.407000	0.27541	CCC	G|0.349;A|0.651		0.781	RINL-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000460433.1	NM_198445	
NTN5	126147	hgsc.bcm.edu	37	19	49164952	49164952	+	Silent	SNP	A	A	G	rs281392	byFrequency	TCGA-PK-A5H9-01A-11D-A29I-10	TCGA-PK-A5H9-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	cb1f20fc-0df5-42f5-91b8-624bee1a532a	4fa707a6-752b-4fda-9bc0-b07c80cf65c1	g.chr19:49164952A>G	ENST00000270235.4	-	7	1547	c.1452T>C	c.(1450-1452)agT>agC	p.S484S	SEC1P_ENST00000430145.2_RNA	NM_145807.1	NP_665806.1	Q8WTR8	NET5_HUMAN	netrin 5	484						extracellular region (GO:0005576)				central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(4)|pancreas(1)|prostate(1)	10						CCGGCCTGGGACTGGGTGTGG	0.687													G|||	2669	0.532947	0.351	0.4669	5008	,	,		9559	0.5625		0.6421	False		,,,				2504	0.683				p.S484S		.											.	NTN5-136	0			c.T1452C						.	G		1663,2349		390,883,733	9.0	9.0	9.0		1452	2.2	0.0	19	dbSNP_79	9	5217,2785		1816,1585,600	no	coding-synonymous	NTN5	NM_145807.1		2206,2468,1333	GG,GA,AA		34.8038,41.4506,42.7335		484/490	49164952	6880,5134	2006	4001	6007	SO:0001819	synonymous_variant	126147	exon7			CCTGGGACTGGGT		CCDS33068.1	19q13.33	2013-03-01			ENSG00000142233	ENSG00000142233		"""Netrins"""	25208	protein-coding gene	gene with protein product	"""Netrin-5"""					12477932	Standard	NM_145807		Approved		uc002pkb.3	Q8WTR8		ENST00000270235.4:c.1452T>C	19.37:g.49164952A>G		Somatic	1	0		WXS	Illumina GAIIx	Phase_I	10	6	NM_145807	0	0	0	0	0	Q8N4X9|Q8WU63	Silent	SNP	ENST00000270235.4	37	CCDS33068.1																																																																																			A|0.464;G|0.536		0.687	NTN5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466176.1	NM_145807	
IRF3	3661	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	50163981	50163981	+	Missense_Mutation	SNP	C	C	T	rs148672096	byFrequency	TCGA-PK-A5H9-01A-11D-A29I-10	TCGA-PK-A5H9-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	cb1f20fc-0df5-42f5-91b8-624bee1a532a	4fa707a6-752b-4fda-9bc0-b07c80cf65c1	g.chr19:50163981C>T	ENST00000597198.1	-	7	1468	c.1087G>A	c.(1087-1089)Gtg>Atg	p.V363M	IRF3_ENST00000596822.1_Intron|IRF3_ENST00000309877.7_Missense_Mutation_p.V363M|IRF3_ENST00000599144.1_Missense_Mutation_p.V217M|IRF3_ENST00000600911.1_Intron|IRF3_ENST00000599223.1_Missense_Mutation_p.V236M|IRF3_ENST00000598808.1_Missense_Mutation_p.V217M|IRF3_ENST00000601291.1_Missense_Mutation_p.R368H|IRF3_ENST00000600022.1_Missense_Mutation_p.V90M|IRF3_ENST00000377139.3_Missense_Mutation_p.V363M|IRF3_ENST00000596765.1_Missense_Mutation_p.V90M|IRF3_ENST00000377135.4_Missense_Mutation_p.V236M|IRF3_ENST00000599680.1_5'UTR|IRF3_ENST00000593922.1_Missense_Mutation_p.V217M			Q14653	IRF3_HUMAN	interferon regulatory factor 3	363					apoptotic process (GO:0006915)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to dsRNA (GO:0071359)|cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|innate immune response (GO:0045087)|interferon-gamma-mediated signaling pathway (GO:0060333)|lipopolysaccharide-mediated signaling pathway (GO:0031663)|macrophage apoptotic process (GO:0071888)|MDA-5 signaling pathway (GO:0039530)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of defense response to virus by host (GO:0050689)|negative regulation of interferon-beta biosynthetic process (GO:0045358)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of type I interferon production (GO:0032480)|positive regulation of cytokine secretion (GO:0050715)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interferon-alpha production (GO:0032727)|positive regulation of interferon-beta production (GO:0032728)|positive regulation of type I interferon production (GO:0032481)|positive regulation of type I interferon-mediated signaling pathway (GO:0060340)|programmed necrotic cell death (GO:0097300)|response to exogenous dsRNA (GO:0043330)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)|transcription from RNA polymerase II promoter (GO:0006366)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)|type I interferon biosynthetic process (GO:0045351)|type I interferon signaling pathway (GO:0060337)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|identical protein binding (GO:0042802)|protein homodimerization activity (GO:0042803)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription cofactor activity (GO:0003712)|transcription regulatory region DNA binding (GO:0044212)			breast(1)|large_intestine(2)|lung(4)|ovary(2)|stomach(1)	10		all_lung(116;3.24e-07)|Lung NSC(112;1.6e-06)|all_neural(266;0.0459)|Ovarian(192;0.0728)		OV - Ovarian serous cystadenocarcinoma(262;0.0011)|GBM - Glioblastoma multiforme(134;0.02)		TTGACCATCACGAGCCTCTTG	0.617													C|||	26	0.00519169	0.0197	0.0	5008	,	,		14348	0.0		0.0	False		,,,				2504	0.0				p.R368H		.											.	IRF3-92	0			c.G1103A						.	C	HIS/ARG,MET/VAL,MET/VAL,MET/VAL,MET/VAL,MET/VAL,MET/VAL,MET/VAL	51,4355	48.2+/-83.0	0,51,2152	52.0	38.0	43.0		1103,982,706,649,649,268,268,1087	3.5	0.8	19	dbSNP_134	43	1,8599		0,1,4299	yes	missense,missense,missense,missense,missense,missense,missense,missense	IRF3	NM_001197122.1,NM_001197123.1,NM_001197124.1,NM_001197125.1,NM_001197126.1,NM_001197127.1,NM_001197128.1,NM_001571.5	29,21,21,21,21,21,21,21	0,52,6451	TT,TC,CC		0.0116,1.1575,0.3998	probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging	368/453,328/393,236/301,217/282,217/282,90/155,90/155,363/428	50163981	52,12954	2203	4300	6503	SO:0001583	missense	3661	exon7			CCATCACGAGCCT		CCDS12775.1, CCDS56099.1, CCDS59407.1, CCDS59408.1, CCDS59409.1	19q13.3-q13.4	2008-07-16				ENSG00000126456			6118	protein-coding gene	gene with protein product		603734				8524823	Standard	NM_001571		Approved		uc002pow.3	Q14653		ENST00000597198.1:c.1087G>A	19.37:g.50163981C>T	ENSP00000469113:p.Val363Met	Somatic	55	0		WXS	Illumina GAIIx	Phase_I	57	26	NM_001197122	0	0	1	1	0	A8K7L2|B2RAZ3|Q5FBY1|Q5FBY2|Q5FBY4|Q7Z5G6	Missense_Mutation	SNP	ENST00000597198.1	37	CCDS12775.1	11	0.005036630036630037	11	0.022357723577235773	0	0.0	0	0.0	0	0.0	C	16.21	3.058528	0.55325	0.011575	1.16E-4	ENSG00000126456	ENST00000377139;ENST00000309877;ENST00000377135	D;D;D	0.94650	-3.48;-3.48;-3.48	4.53	3.48	0.39840	SMAD domain-like (1);SMAD/FHA domain (1);Interferon regulatory factor-3 (1);	.	.	.	.	D	0.93009	0.7775	M	0.77103	2.36	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.79784	0.993;0.989	D	0.91970	0.5586	9	0.87932	D	0	-2.0523	6.1825	0.20480	0.0:0.7077:0.192:0.1003	.	363;236	Q14653;Q5FBY1	IRF3_HUMAN;.	M	363;363;236	ENSP00000366344:V363M;ENSP00000310127:V363M;ENSP00000366339:V236M	ENSP00000310127:V363M	V	-	1	0	IRF3	54855793	0.670000	0.27512	0.833000	0.33012	0.840000	0.47671	0.873000	0.28052	1.120000	0.41904	0.585000	0.79938	GTG	C|0.995;T|0.005		0.617	IRF3-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465962.1	NM_001571	
CTU1	90353	hgsc.bcm.edu	37	19	51607507	51607507	+	Missense_Mutation	SNP	G	G	A	rs17855403|rs200498841	byFrequency	TCGA-PK-A5H9-01A-11D-A29I-10	TCGA-PK-A5H9-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	cb1f20fc-0df5-42f5-91b8-624bee1a532a	4fa707a6-752b-4fda-9bc0-b07c80cf65c1	g.chr19:51607507G>A	ENST00000421832.2	-	2	364	c.320C>T	c.(319-321)gCg>gTg	p.A107V		NM_145232.3	NP_660275.2			cytosolic thiouridylase subunit 1											large_intestine(2)|lung(1)|urinary_tract(1)	4						CTCCCAGCGCGCCGCCTGGCG	0.746													G|||	692	0.138179	0.0908	0.0879	5008	,	,		6423	0.2312		0.1402	False		,,,				2504	0.1401				p.A107V		.											.	CTU1-68	0			c.C320T						.						1.0	2.0	2.0					19																	51607507		896	2080	2976	SO:0001583	missense	90353	exon2			CAGCGCGCCGCCT		CCDS12824.1	19q13.41	2013-05-31	2013-05-31	2009-08-19		ENSG00000142544			29590	protein-coding gene	gene with protein product		612694	"""ATP binding domain 3"", ""cytosolic thiouridylase subunit 1 homolog (S. pombe)"""	ATPBD3		19017811	Standard	NM_145232		Approved	MGC17332, NCS6	uc010eop.3	Q7Z7A3		ENST00000421832.2:c.320C>T	19.37:g.51607507G>A	ENSP00000390011:p.Ala107Val	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	6	6	NM_145232	0	0	0	4	4		Missense_Mutation	SNP	ENST00000421832.2	37	CCDS12824.1	354	0.1620879120879121	45	0.09146341463414634	43	0.11878453038674033	144	0.2517482517482518	122	0.16094986807387862	.	17.02	3.282346	0.59867	.	.	ENSG00000142544	ENST00000421832	T	0.45276	0.9	4.38	3.32	0.38043	Rossmann-like alpha/beta/alpha sandwich fold (1);tRNA(Ile)-lysidine/2-thiocytidine synthase (1);	0.135763	0.48767	D	0.000169	T	0.00012	0.0000	L	0.59967	1.855	0.34690	P	0.274319	D	0.56035	0.974	P	0.48921	0.595	T	0.15435	-1.0437	9	0.24483	T	0.36	-8.3278	9.5404	0.39248	0.0:0.0:0.618:0.382	rs17855403	107	Q7Z7A3	CTU1_HUMAN	V	107	ENSP00000390011:A107V	ENSP00000390011:A107V	A	-	2	0	CTU1	56299319	0.931000	0.31567	0.997000	0.53966	0.901000	0.52897	1.314000	0.33597	0.803000	0.34113	0.561000	0.74099	GCG	G|0.838;A|0.162		0.746	CTU1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464292.1	NM_145232	
PPP1R12C	54776	hgsc.bcm.edu	37	19	55628609	55628609	+	Silent	SNP	A	A	G	rs66707428	byFrequency	TCGA-PK-A5H9-01A-11D-A29I-10	TCGA-PK-A5H9-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	cb1f20fc-0df5-42f5-91b8-624bee1a532a	4fa707a6-752b-4fda-9bc0-b07c80cf65c1	g.chr19:55628609A>G	ENST00000263433.3	-	1	318	c.303T>C	c.(301-303)ggT>ggC	p.G101G	PPP1R12C_ENST00000376393.2_Silent_p.G101G	NM_001271618.1|NM_017607.2	NP_001258547.1|NP_060077.1			protein phosphatase 1, regulatory subunit 12C											central_nervous_system(1)|endometrium(2)|large_intestine(4)|lung(11)|ovary(1)|prostate(1)|urinary_tract(2)	22			BRCA - Breast invasive adenocarcinoma(297;0.209)	GBM - Glioblastoma multiforme(193;0.0449)		GGGCGCTGATACCGTCGGCGT	0.781													N|||	1009	0.201478	0.2806	0.0965	5008	,	,		7556	0.2738		0.1093	False		,,,				2504	0.1892				p.G101G		.											.	PPP1R12C-227	0			c.T303C						.						1.0	2.0	1.0					19																	55628609		1184	2666	3850	SO:0001819	synonymous_variant	54776	exon1			GCTGATACCGTCG	AF312028	CCDS12916.1	19q13.42	2013-01-10	2011-10-04		ENSG00000125503	ENSG00000125503		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Ankyrin repeat domain containing"""	14947	protein-coding gene	gene with protein product	"""myosin-binding subunit 85"""	613245	"""leukocyte receptor cluster (LRC) member 3"", ""protein phosphatase 1, regulatory (inhibitor) subunit 12C"""	LENG3		11399775	Standard	NM_017607		Approved	DKFZP434D0412, p84, MBS85, p85	uc002qix.4	Q9BZL4		ENST00000263433.3:c.303T>C	19.37:g.55628609A>G		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	13	6	NM_017607	0	0	2	3	1		Silent	SNP	ENST00000263433.3	37	CCDS12916.1																																																																																			A|0.808;G|0.192		0.781	PPP1R12C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451814.2	NM_017607	
SSC5D	284297	hgsc.bcm.edu	37	19	56002175	56002175	+	Missense_Mutation	SNP	C	C	T			TCGA-PK-A5H9-01A-11D-A29I-10	TCGA-PK-A5H9-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	cb1f20fc-0df5-42f5-91b8-624bee1a532a	4fa707a6-752b-4fda-9bc0-b07c80cf65c1	g.chr19:56002175C>T	ENST00000389623.6	+	6	646	c.623C>T	c.(622-624)gCc>gTc	p.A208V	SSC5D_ENST00000587166.1_Missense_Mutation_p.A208V	NM_001144950.1	NP_001138422.1	A1L4H1	SRCRL_HUMAN	scavenger receptor cysteine rich family, 5 domains	208	SRCR 2. {ECO:0000255|PROSITE- ProRule:PRU00196}.				defense response to Gram-negative bacterium (GO:0050829)|defense response to Gram-positive bacterium (GO:0050830)|detection of bacterial lipoprotein (GO:0042494)|innate immune response (GO:0045087)|multicellular organismal development (GO:0007275)|negative regulation of interleukin-8 secretion (GO:2000483)|receptor-mediated endocytosis (GO:0006898)	cytoplasm (GO:0005737)|extracellular matrix (GO:0031012)|extracellular space (GO:0005615)|intracellular (GO:0005622)|membrane (GO:0016020)	extracellular matrix binding (GO:0050840)|fibronectin binding (GO:0001968)|laminin binding (GO:0043236)|scavenger receptor activity (GO:0005044)			NS(1)|breast(1)|skin(2)	4						CACAGGTGCGCCGGACGCCTG	0.682																																					p.A208V		.											.	.	0			c.C623T						.						2.0	3.0	3.0					19																	56002175		512	1323	1835	SO:0001583	missense	284297	exon6			GGTGCGCCGGACG		CCDS46196.1, CCDS59424.1	19q13.42	2014-07-09	2014-07-09		ENSG00000179954	ENSG00000179954			26641	protein-coding gene	gene with protein product	"""soluble scavenger with 5 domains"""		"""scavenger receptor cysteine rich domain containing (5 domains)"""			19535143	Standard	NM_001144950		Approved	FLJ35258	uc002qlg.4	A1L4H1		ENST00000389623.6:c.623C>T	19.37:g.56002175C>T	ENSP00000374274:p.Ala208Val	Somatic	3	0		WXS	Illumina GAIIx	Phase_I	39	24	NM_001195267	0	0	0	0	0	B5MDQ5|C7S7T9|C7S7U0|K7EP70	Missense_Mutation	SNP	ENST00000389623.6	37	CCDS46196.1	.	.	.	.	.	.	.	.	.	.	.	8.543	0.873614	0.17322	.	.	ENSG00000179954	ENST00000389623;ENST00000541230	T	0.37058	1.22	3.88	1.57	0.23409	Speract/scavenger receptor (4);Speract/scavenger receptor-related (2);	.	.	.	.	T	0.38134	0.1029	M	0.82132	2.575	0.09310	N	1	B	0.14805	0.011	B	0.20767	0.031	T	0.39440	-0.9614	9	0.51188	T	0.08	.	5.7533	0.18158	0.1897:0.6949:0.0:0.1154	.	208	A1L4H1	SRCRL_HUMAN	V	208	ENSP00000374274:A208V	ENSP00000374274:A208V	A	+	2	0	SSC5D	60693987	0.000000	0.05858	0.002000	0.10522	0.046000	0.14306	0.206000	0.17375	0.208000	0.20626	0.498000	0.49722	GCC	.		0.682	SSC5D-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000453345.2	XM_001718392	
TPO	7173	hgsc.bcm.edu	37	2	1481231	1481231	+	Missense_Mutation	SNP	G	G	C	rs2175977	byFrequency	TCGA-PK-A5H9-01A-11D-A29I-10	TCGA-PK-A5H9-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	cb1f20fc-0df5-42f5-91b8-624bee1a532a	4fa707a6-752b-4fda-9bc0-b07c80cf65c1	g.chr2:1481231G>C	ENST00000345913.4	+	8	1284	c.1193G>C	c.(1192-1194)aGc>aCc	p.S398T	TPO_ENST00000349624.3_Intron|TPO_ENST00000382198.1_Intron|TPO_ENST00000382201.3_Missense_Mutation_p.S398T|TPO_ENST00000329066.4_Missense_Mutation_p.S398T|TPO_ENST00000346956.3_Missense_Mutation_p.S398T|TPO_ENST00000497517.2_Intron|TPO_ENST00000337415.3_Missense_Mutation_p.S398T	NM_000547.5	NP_000538.3	P07202	PERT_HUMAN	thyroid peroxidase	398			S -> T (in dbSNP:rs2175977). {ECO:0000269|PubMed:7550241}.		cellular nitrogen compound metabolic process (GO:0034641)|embryonic hemopoiesis (GO:0035162)|hormone biosynthetic process (GO:0042446)|hydrogen peroxide catabolic process (GO:0042744)|small molecule metabolic process (GO:0044281)|thyroid hormone generation (GO:0006590)	extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|heme binding (GO:0020037)|iodide peroxidase activity (GO:0004447)|peroxidase activity (GO:0004601)			breast(1)|central_nervous_system(3)|endometrium(8)|kidney(4)|large_intestine(14)|liver(2)|lung(33)|ovary(8)|pancreas(6)|prostate(4)|skin(7)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	95	all_hematologic(175;0.0487)|Acute lymphoblastic leukemia(172;0.0627)	all_cancers(51;0.0338)		all cancers(51;0.0356)|OV - Ovarian serous cystadenocarcinoma(76;0.0748)|Epithelial(75;0.12)	Carbimazole(DB00389)|Dextrothyroxine(DB00509)|Methimazole(DB00763)|Propylthiouracil(DB00550)	GGCCGCGCCAGCGAGGTCCCC	0.761													G|||	3557	0.710264	0.8185	0.6571	5008	,	,		9157	0.7758		0.6034	False		,,,				2504	0.6442				p.S398T		.											.	TPO-332	0			c.G1193C						.	G	THR/SER,THR/SER,THR/SER,THR/SER,THR/SER,	2498,394		1072,354,20	2.0	2.0	2.0		1193,1193,1193,1193,1193,	4.1	1.0	2	dbSNP_96	2	4199,1477		1511,1177,150	no	missense,missense,missense,missense,missense,intron	TPO	NM_000547.5,NM_001206744.1,NM_001206745.1,NM_175719.3,NM_175721.3,NM_175722.3	58,58,58,58,58,	2583,1531,170	CC,CG,GG		26.0218,13.6238,21.8371	probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging,	398/934,398/934,398/877,398/877,398/890,	1481231	6697,1871	1446	2838	4284	SO:0001583	missense	7173	exon8			GCGCCAGCGAGGT		CCDS1643.1, CCDS1644.1, CCDS1646.1	2p25	2008-02-05			ENSG00000115705	ENSG00000115705	1.11.1.7		12015	protein-coding gene	gene with protein product		606765					Standard	NM_175722		Approved	TPX	uc002qww.3	P07202	OTTHUMG00000090271	ENST00000345913.4:c.1193G>C	2.37:g.1481231G>C	ENSP00000318820:p.Ser398Thr	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	22	11	NM_175719	0	0	0	0	0	P09934|P09935|Q8IUL0|Q8NF94|Q8NF95|Q8NF96|Q8NF97|Q8TCI9	Missense_Mutation	SNP	ENST00000345913.4	37	CCDS1643.1	1512|1512	0.6923076923076923|0.6923076923076923	388|388	0.7886178861788617|0.7886178861788617	227|227	0.6270718232044199|0.6270718232044199	438|438	0.7657342657342657|0.7657342657342657	459|459	0.6055408970976254|0.6055408970976254	G|G	18.72|18.72	3.683431|3.683431	0.68157|0.68157	0.863762|0.863762	0.739782|0.739782	ENSG00000115705|ENSG00000115705	ENST00000536482|ENST00000337415;ENST00000345913;ENST00000346956;ENST00000329066;ENST00000382201;ENST00000422464	.|T;T;T;T;T;T	.|0.73897	.|-0.79;-0.79;-0.79;-0.79;-0.79;-0.79	4.99|4.99	4.08|4.08	0.47627|0.47627	.|.	.|0.142496	.|0.64402	.|N	.|0.000004	T|T	0.00012|0.00012	0.0000|0.0000	M|M	0.62723|0.62723	1.935|1.935	0.09310|0.09310	P|P	1.0|1.0	.|D;D;D	.|0.76494	.|0.998;0.998;0.999	.|D;D;D	.|0.69654	.|0.956;0.94;0.965	T|T	0.30060|0.30060	-0.9991|-0.9991	5|9	0.48119|0.56958	T|D	0.1|0.05	-48.0867|-48.0867	8.6411|8.6411	0.33978|0.33978	0.08:0.1541:0.7659:0.0|0.08:0.1541:0.7659:0.0	rs2175977|rs2175977	.|398;398;398	.|P07202-4;P07202-2;P07202	.|.;.;PERT_HUMAN	H|T	81|398;398;398;398;398;327	.|ENSP00000337263:S398T;ENSP00000318820:S398T;ENSP00000263886:S398T;ENSP00000329869:S398T;ENSP00000371636:S398T;ENSP00000405788:S327T	ENSP00000439133:Q81H|ENSP00000329869:S398T	Q|S	+|+	3|2	2|0	TPO|TPO	1460238|1460238	0.956000|0.956000	0.32656|0.32656	1.000000|1.000000	0.80357|0.80357	0.986000|0.986000	0.74619|0.74619	1.297000|1.297000	0.33400|0.33400	1.031000|1.031000	0.39867|0.39867	0.460000|0.460000	0.39030|0.39030	CAG|AGC	G|0.301;C|0.699		0.761	TPO-202	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000206594.2	NM_000547	
GAREML	150946	hgsc.bcm.edu	37	2	26408064	26408064	+	Silent	SNP	T	T	C	rs4665833	byFrequency	TCGA-PK-A5H9-01A-11D-A29I-10	TCGA-PK-A5H9-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	cb1f20fc-0df5-42f5-91b8-624bee1a532a	4fa707a6-752b-4fda-9bc0-b07c80cf65c1	g.chr2:26408064T>C	ENST00000401533.2	+	4	1477	c.1347T>C	c.(1345-1347)gaT>gaC	p.D449D	GAREML_ENST00000407684.1_Silent_p.D372D	NM_001168241.1	NP_001161713.1	Q75VX8	GAREL_HUMAN	GRB2 associated, regulator of MAPK1-like	449	Pro-rich.					extracellular vesicular exosome (GO:0070062)											CAGGGCTCGATCTCATCTCCT	0.776													C|||	4607	0.919928	0.7897	0.9669	5008	,	,		7665	0.9603		0.9702	False		,,,				2504	0.9693				p.D449D		.											.	.	0			c.T1347C						.						1.0	2.0	1.0					2																	26408064		237	781	1018	SO:0001819	synonymous_variant	150946	exon4			GCTCGATCTCATC	AK090454, AB015349, AB124552	CCDS54336.1, CCDS54337.1	2p23.3	2012-11-30	2012-11-30	2012-11-30	ENSG00000157833	ENSG00000157833			27172	protein-coding gene	gene with protein product			"""family with sequence similarity 59, member B"""	FAM59B			Standard	NM_001168241		Approved	KIAA2038, FLJ00375	uc002rgw.2	Q75VX8	OTTHUMG00000151935	ENST00000401533.2:c.1347T>C	2.37:g.26408064T>C		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	4	4	NM_001168241	0	0	0	0	0	B5MC97|B7WNK9|Q8NF27|Q9UIK8	Silent	SNP	ENST00000401533.2	37	CCDS54336.1																																																																																			T|0.084;C|0.916		0.776	GAREML-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000324498.2	NM_001168241	
FEZ2	9637	hgsc.bcm.edu	37	2	36825137	36825137	+	Missense_Mutation	SNP	G	G	A	rs1544655	byFrequency	TCGA-PK-A5H9-01A-11D-A29I-10	TCGA-PK-A5H9-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	cb1f20fc-0df5-42f5-91b8-624bee1a532a	4fa707a6-752b-4fda-9bc0-b07c80cf65c1	g.chr2:36825137G>A	ENST00000405912.3	-	1	148	c.149C>T	c.(148-150)cCg>cTg	p.P50L	FEZ2_ENST00000379245.4_Missense_Mutation_p.P50L	NM_005102.2	NP_005093.2	Q9UHY8	FEZ2_HUMAN	fasciculation and elongation protein zeta 2 (zygin II)	50			P -> L (in dbSNP:rs1544655). {ECO:0000269|PubMed:10931946}.		axon guidance (GO:0007411)|nervous system development (GO:0007399)|signal transduction (GO:0007165)					breast(1)|kidney(1)|large_intestine(2)|lung(1)|ovary(1)|urinary_tract(1)	7		all_hematologic(82;0.21)				GCTGCAGGCCGGGGCCGGGAA	0.761													A|||	4355	0.869609	0.9039	0.8372	5008	,	,		3879	0.9881		0.7435	False		,,,				2504	0.8538				p.P50L		.											.	FEZ2-23	0			c.C149T						.						2.0	3.0	3.0					2																	36825137		1191	2916	4107	SO:0001583	missense	9637	exon1			CAGGCCGGGGCCG	U60061	CCDS46257.1, CCDS46258.1	2p21	2008-05-15			ENSG00000171055	ENSG00000171055			3660	protein-coding gene	gene with protein product		604826				9096408	Standard	NM_005102		Approved		uc002rpg.2	Q9UHY8	OTTHUMG00000152148	ENST00000405912.3:c.149C>T	2.37:g.36825137G>A	ENSP00000385112:p.Pro50Leu	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	4	4	NM_001042548	0	0	0	29	29	Q5EBN3|Q76LN0|Q99690	Missense_Mutation	SNP	ENST00000405912.3	37	CCDS46257.1	1789	0.8191391941391941	416	0.8455284552845529	284	0.7845303867403315	557	0.9737762237762237	532	0.7018469656992085	A	9.679	1.148856	0.21288	.	.	ENSG00000171055	ENST00000379245;ENST00000405912	T;T	0.16897	2.31;2.31	3.93	3.93	0.45458	.	0.000000	0.64402	N	0.000005	T	0.00012	0.0000	N	0.00121	-2.07	0.09310	P	0.9999999999999999	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.01281	0.0;0.0;0.0	T	0.32025	-0.9922	9	0.02654	T	1	-21.1042	7.5473	0.27775	0.8952:0.0:0.1048:0.0	rs1544655	50;50;50	G3V0F5;Q9UHY8;Q9UHY8-2	.;FEZ2_HUMAN;.	L	50	ENSP00000368547:P50L;ENSP00000385112:P50L	ENSP00000368547:P50L	P	-	2	0	FEZ2	36678641	1.000000	0.71417	0.997000	0.53966	0.540000	0.34992	0.606000	0.24194	0.590000	0.29694	-0.775000	0.03384	CCG	T|0.817;C|0.180		0.761	FEZ2-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000325432.1		
KIAA1211L	343990	hgsc.bcm.edu	37	2	99439792	99439792	+	Missense_Mutation	SNP	G	G	C	rs3731660	byFrequency	TCGA-PK-A5H9-01A-11D-A29I-10	TCGA-PK-A5H9-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	cb1f20fc-0df5-42f5-91b8-624bee1a532a	4fa707a6-752b-4fda-9bc0-b07c80cf65c1	g.chr2:99439792G>C	ENST00000397899.2	-	7	1275	c.944C>G	c.(943-945)tCc>tGc	p.S315C		NM_207362.2	NP_997245.2	Q6NV74	K121L_HUMAN	KIAA1211-like	315	Pro-rich.		S -> C (in dbSNP:rs3731660).														GAGCGCGGAGGAGTGCTGCAG	0.791													C|||	230	0.0459265	0.0348	0.0187	5008	,	,		10485	0.0903		0.0219	False		,,,				2504	0.0593				p.S315C		.											.	.	0			c.C944G						.						2.0	3.0	3.0					2																	99439792		1393	3090	4483	SO:0001583	missense	343990	exon7			GCGGAGGAGTGCT	BC068277	CCDS42720.1	2q11.2	2012-08-03	2012-08-03	2012-08-03	ENSG00000196872	ENSG00000196872			33454	protein-coding gene	gene with protein product			"""chromosome 2 open reading frame 55"""	C2orf55			Standard	NM_207362		Approved	MGC42367	uc002szf.1	Q6NV74	OTTHUMG00000153171	ENST00000397899.2:c.944C>G	2.37:g.99439792G>C	ENSP00000380996:p.Ser315Cys	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	5	5	NM_207362	0	0	0	0	0		Missense_Mutation	SNP	ENST00000397899.2	37	CCDS42720.1	78	0.03571428571428571	7	0.014227642276422764	5	0.013812154696132596	50	0.08741258741258741	16	0.021108179419525065	C	5.261	0.233650	0.09969	.	.	ENSG00000196872	ENST00000397899	T	0.52526	0.66	5.38	-1.57	0.08506	.	0.536026	0.17356	N	0.177208	T	0.00875	0.0029	N	0.04508	-0.205	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.04427	-1.0952	10	0.41790	T	0.15	-0.9551	15.7544	0.78013	0.0993:0.2695:0.6312:0.0	rs3731660	315	Q6NV74	CB055_HUMAN	C	315	ENSP00000380996:S315C	ENSP00000380996:S315C	S	-	2	0	C2orf55	98806224	0.033000	0.19621	0.033000	0.17914	0.060000	0.15804	0.283000	0.18846	-0.252000	0.09528	-1.195000	0.01675	TCC	G|0.964;C|0.036		0.791	KIAA1211L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000329933.1	NM_207362	
C2orf40	84417	hgsc.bcm.edu	37	2	106682226	106682226	+	Silent	SNP	T	T	C	rs4271786|rs543094154	byFrequency	TCGA-PK-A5H9-01A-11D-A29I-10	TCGA-PK-A5H9-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	cb1f20fc-0df5-42f5-91b8-624bee1a532a	4fa707a6-752b-4fda-9bc0-b07c80cf65c1	g.chr2:106682226T>C	ENST00000238044.3	+	1	115	c.6T>C	c.(4-6)gcT>gcC	p.A2A	C2orf40_ENST00000489174.1_Intron|C2orf40_ENST00000409944.1_Intron	NM_032411.2	NP_115787.1	Q9H1Z8	AUGN_HUMAN	chromosome 2 open reading frame 40	2					cellular senescence (GO:0090398)|cyclin catabolic process (GO:0008054)|G1 to G0 transition (GO:0070314)	cytoplasmic vesicle (GO:0031410)|extracellular space (GO:0005615)				lung(7)|urinary_tract(1)	8						CCGCCATGGCTGCCTCCCCCG	0.766													C|||	1272	0.253994	0.2753	0.1369	5008	,	,		11771	0.2411		0.2227	False		,,,				2504	0.3538				p.A2A		.											.	C2orf40-90	0			c.T6C						.	C		520,2666		23,474,1096	2.0	3.0	3.0		6	1.0	0.3	2	dbSNP_111	3	871,5647		54,763,2442	no	coding-synonymous	C2orf40	NM_032411.2		77,1237,3538	CC,CT,TT		13.363,16.3214,14.3343		2/149	106682226	1391,8313	1593	3259	4852	SO:0001819	synonymous_variant	84417	exon1			CATGGCTGCCTCC	BC021742	CCDS2072.1	2q12.2	2014-01-28			ENSG00000119147	ENSG00000119147			24642	protein-coding gene	gene with protein product	"""esophageal cancer related gene 4 protein"""	611752				12800218	Standard	NM_032411		Approved	ECRG4, augurin	uc010fjf.3	Q9H1Z8	OTTHUMG00000130921	ENST00000238044.3:c.6T>C	2.37:g.106682226T>C		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	21	5	NM_032411	0	0	8	8	0	D3DVK2	Silent	SNP	ENST00000238044.3	37	CCDS2072.1																																																																																			T|0.765;C|0.235		0.766	C2orf40-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253515.2	NM_032411	
C2orf40	84417	hgsc.bcm.edu	37	2	106682235	106682235	+	Silent	SNP	C	C	G	rs4266035	byFrequency	TCGA-PK-A5H9-01A-11D-A29I-10	TCGA-PK-A5H9-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	cb1f20fc-0df5-42f5-91b8-624bee1a532a	4fa707a6-752b-4fda-9bc0-b07c80cf65c1	g.chr2:106682235C>G	ENST00000238044.3	+	1	124	c.15C>G	c.(13-15)ccC>ccG	p.P5P	C2orf40_ENST00000489174.1_Intron|C2orf40_ENST00000409944.1_Intron	NM_032411.2	NP_115787.1	Q9H1Z8	AUGN_HUMAN	chromosome 2 open reading frame 40	5					cellular senescence (GO:0090398)|cyclin catabolic process (GO:0008054)|G1 to G0 transition (GO:0070314)	cytoplasmic vesicle (GO:0031410)|extracellular space (GO:0005615)				lung(7)|urinary_tract(1)	8						CTGCCTCCCCCGCGCGGCCTG	0.751													C|||	1156	0.230831	0.18	0.1239	5008	,	,		11837	0.2391		0.2187	False		,,,				2504	0.3793				p.P5P		.											.	C2orf40-90	0			c.C15G						.						2.0	3.0	3.0					2																	106682235		1650	3370	5020	SO:0001819	synonymous_variant	84417	exon1			CTCCCCCGCGCGG	BC021742	CCDS2072.1	2q12.2	2014-01-28			ENSG00000119147	ENSG00000119147			24642	protein-coding gene	gene with protein product	"""esophageal cancer related gene 4 protein"""	611752				12800218	Standard	NM_032411		Approved	ECRG4, augurin	uc010fjf.3	Q9H1Z8	OTTHUMG00000130921	ENST00000238044.3:c.15C>G	2.37:g.106682235C>G		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	21	5	NM_032411	0	0	8	8	0	D3DVK2	Silent	SNP	ENST00000238044.3	37	CCDS2072.1																																																																																			C|0.795;G|0.205		0.751	C2orf40-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253515.2	NM_032411	
SOWAHC	65124	hgsc.bcm.edu	37	2	110372192	110372192	+	Silent	SNP	A	A	G	rs6594048		TCGA-PK-A5H9-01A-11D-A29I-10	TCGA-PK-A5H9-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	cb1f20fc-0df5-42f5-91b8-624bee1a532a	4fa707a6-752b-4fda-9bc0-b07c80cf65c1	g.chr2:110372192A>G	ENST00000356454.3	+	1	282	c.126A>G	c.(124-126)ctA>ctG	p.L42L	SEPT10_ENST00000415095.1_5'Flank|SEPT10_ENST00000397714.2_5'Flank|SEPT10_ENST00000334001.6_5'Flank|SEPT10_ENST00000437928.1_5'Flank|SEPT10_ENST00000356688.4_5'Flank|SEPT10_ENST00000397712.2_5'Flank|SEPT10_ENST00000545389.1_5'Flank	NM_023016.3	NP_075392.2	Q53LP3	SWAHC_HUMAN	sosondowah ankyrin repeat domain family member C	42																	GGGGCGCCCTAGGCGGCGAAC	0.771													G|||	5008	1.0	1.0	1.0	5008	,	,		6158	1.0		1.0	False		,,,				2504	1.0				p.L42L		.											.	.	0			c.A126G						.						1.0	2.0	2.0					2																	110372192		1239	2477	3716	SO:0001819	synonymous_variant	65124	exon1			CGCCCTAGGCGGC	AK023346	CCDS33270.1	2q13	2013-01-10	2012-01-12	2012-01-12	ENSG00000198142	ENSG00000198142		"""Ankyrin repeat domain containing"""	26149	protein-coding gene	gene with protein product			"""ankyrin repeat domain 57"""	C2orf26, ANKRD57		22234889	Standard	NM_023016		Approved	FLJ21870	uc002tfb.3	Q53LP3	OTTHUMG00000153219	ENST00000356454.3:c.126A>G	2.37:g.110372192A>G		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	13	13	NM_023016	0	0	0	0	0	Q8NE15|Q9H6U1	Silent	SNP	ENST00000356454.3	37	CCDS33270.1																																																																																			A|0.029;G|0.971		0.771	SOWAHC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000330168.1	NM_023016	
TANK	10010	broad.mit.edu	37	2	162036237	162036237	+	Missense_Mutation	SNP	G	G	T			TCGA-PK-A5H9-01A-11D-A29I-10	TCGA-PK-A5H9-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	cb1f20fc-0df5-42f5-91b8-624bee1a532a	4fa707a6-752b-4fda-9bc0-b07c80cf65c1	g.chr2:162036237G>T	ENST00000392749.2	+	2	303	c.64G>T	c.(64-66)Gat>Tat	p.D22Y	TANK_ENST00000405852.1_Missense_Mutation_p.D22Y|TANK_ENST00000457476.1_Missense_Mutation_p.D22Y|TANK_ENST00000406287.1_Missense_Mutation_p.D80Y|TANK_ENST00000403609.1_Missense_Mutation_p.D22Y|TANK_ENST00000259075.2_Missense_Mutation_p.D22Y|TANK_ENST00000402568.1_Missense_Mutation_p.D80Y	NM_001199135.1	NP_001186064.1	Q92844	TANK_HUMAN	TRAF family member-associated NFKB activator	22					I-kappaB kinase/NF-kappaB signaling (GO:0007249)|innate immune response (GO:0045087)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytosol (GO:0005829)	metal ion binding (GO:0046872)|ubiquitin protein ligase binding (GO:0031625)	p.D22N(1)		breast(1)|endometrium(3)|kidney(2)|large_intestine(6)|lung(7)|ovary(1)|prostate(1)	21						GGCATGCATGGATAGAGATTC	0.403																																					p.D22Y		.											.	TANK-228	1	Substitution - Missense(1)	large_intestine(1)	c.G64T						.						121.0	115.0	117.0					2																	162036237		2203	4300	6503	SO:0001583	missense	10010	exon2			TGCATGGATAGAG	U59863	CCDS2215.1, CCDS46436.1	2q24-q31	2008-02-05			ENSG00000136560	ENSG00000136560			11562	protein-coding gene	gene with protein product		603893		TRAF2		8710854, 8855313	Standard	NM_004180		Approved	I-TRAF	uc002ubr.2	Q92844	OTTHUMG00000132037	ENST00000392749.2:c.64G>T	2.37:g.162036237G>T	ENSP00000376505:p.Asp22Tyr	Somatic	97	0		WXS	Illumina GAIIx	Phase_I	91	3	NM_004180	0	0	121	121	0	D3DPB5|Q7Z4J6|Q92885	Missense_Mutation	SNP	ENST00000392749.2	37	CCDS2215.1	.	.	.	.	.	.	.	.	.	.	G	22.2	4.258424	0.80246	.	.	ENSG00000136560	ENST00000259075;ENST00000432002;ENST00000457476;ENST00000392749;ENST00000440506;ENST00000429217;ENST00000406287;ENST00000402568;ENST00000405852;ENST00000456358;ENST00000403609	T;T;T;T;T	0.52983	1.11;1.11;1.93;0.64;1.93	6.03	6.03	0.97812	.	0.050782	0.85682	D	0.000000	T	0.62109	0.2401	L	0.34521	1.04	0.53688	D	0.999979	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	T	0.62515	-0.6838	10	0.87932	D	0	-14.7684	20.1547	0.98103	0.0:0.0:1.0:0.0	.	22;22	Q92844;Q7Z4J6	TANK_HUMAN;.	Y	22;22;22;22;22;22;80;80;22;48;22	ENSP00000259075:D22Y;ENSP00000376505:D22Y;ENSP00000384492:D80Y;ENSP00000385487:D22Y;ENSP00000392776:D48Y	ENSP00000259075:D22Y	D	+	1	0	TANK	161744483	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.432000	0.80349	2.868000	0.98415	0.555000	0.69702	GAT	.		0.403	TANK-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000324232.1	NM_133484	
SP5	389058	hgsc.bcm.edu	37	2	171573185	171573185	+	Silent	SNP	G	G	T	rs1134626	byFrequency	TCGA-PK-A5H9-01A-11D-A29I-10	TCGA-PK-A5H9-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	cb1f20fc-0df5-42f5-91b8-624bee1a532a	4fa707a6-752b-4fda-9bc0-b07c80cf65c1	g.chr2:171573185G>T	ENST00000375281.3	+	2	630	c.468G>T	c.(466-468)ccG>ccT	p.P156P	AC007405.2_ENST00000409786.1_5'Flank	NM_001003845.2	NP_001003845.1	Q6BEB4	SP5_HUMAN	Sp5 transcription factor	156					bone morphogenesis (GO:0060349)|post-anal tail morphogenesis (GO:0036342)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)	p.P156P(1)		NS(1)|endometrium(2)|lung(1)|prostate(1)	5						CCGCGCTGCCGCCAGGCTACT	0.751													G|||	1034	0.20647	0.0242	0.2017	5008	,	,		6711	0.1815		0.3579	False		,,,				2504	0.3262				p.P156P		.											.	SP5-90	1	Substitution - coding silent(1)	NS(1)	c.G468T						.	G		219,2535		16,187,1174	5.0	6.0	6.0		468	-7.5	0.4	2	dbSNP_86	6	2090,4520		318,1454,1533	no	coding-synonymous	SP5	NM_001003845.2		334,1641,2707	TT,TG,GG		31.6188,7.9521,24.6583		156/399	171573185	2309,7055	1377	3305	4682	SO:0001819	synonymous_variant	389058	exon2			GCTGCCGCCAGGC		CCDS33322.1	2q31	2013-01-08			ENSG00000204335	ENSG00000204335		"""Specificity protein transcription factors"", ""Zinc fingers, C2H2-type"""	14529	protein-coding gene	gene with protein product		609391					Standard	NM_001003845		Approved		uc002uge.3	Q6BEB4	OTTHUMG00000154053	ENST00000375281.3:c.468G>T	2.37:g.171573185G>T		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	13	8	NM_001003845	0	0	0	0	0		Silent	SNP	ENST00000375281.3	37	CCDS33322.1																																																																																			G|0.766;T|0.234		0.751	SP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000333670.1	XM_371581	
DYTN	391475	bcgsc.ca	37	2	207527840	207527840	+	Missense_Mutation	SNP	G	G	T	rs2115591	byFrequency	TCGA-PK-A5H9-01A-11D-A29I-10	TCGA-PK-A5H9-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	cb1f20fc-0df5-42f5-91b8-624bee1a532a	4fa707a6-752b-4fda-9bc0-b07c80cf65c1	g.chr2:207527840G>T	ENST00000452335.2	-	11	1536	c.1420C>A	c.(1420-1422)Cag>Aag	p.Q474K		NM_001093730.1	NP_001087199.1	A2CJ06	DYTN_HUMAN	dystrotelin	474			Q -> K (in dbSNP:rs2115591).			plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(1)|endometrium(1)|large_intestine(6)|lung(24)|ovary(1)|upper_aerodigestive_tract(1)	36				LUSC - Lung squamous cell carcinoma(261;0.082)|Epithelial(149;0.129)|Lung(261;0.153)		ATGACTTTCTGTGGCATCTTT	0.507													T|||	1978	0.394968	0.643	0.4942	5008	,	,		21098	0.1716		0.3738	False		,,,				2504	0.2413				p.Q474K		.											.	DYTN-23	0			c.C1420A						.	T	LYS/GLN	2301,1677		671,959,359	175.0	164.0	168.0		1420	0.3	0.0	2	dbSNP_96	168	2992,5368		531,1930,1719	yes	missense	DYTN	NM_001093730.1	53	1202,2889,2078	TT,TG,GG		35.7895,42.1569,42.9	benign	474/579	207527840	5293,7045	1989	4180	6169	SO:0001583	missense	391475	exon11			CTTTCTGTGGCAT	ABF55377	CCDS46502.1	2q33.3	2007-01-22			ENSG00000232125	ENSG00000232125			23279	protein-coding gene	gene with protein product						17233888	Standard	NM_001093730		Approved		uc002vbr.1	A2CJ06	OTTHUMG00000154729	ENST00000452335.2:c.1420C>A	2.37:g.207527840G>T	ENSP00000396593:p.Gln474Lys	Somatic	217	1		WXS	Illumina GAIIx	Phase_I	252	7	NM_001093730	0	0	0	0	0		Missense_Mutation	SNP	ENST00000452335.2	37	CCDS46502.1	861	0.3942307692307692	307	0.6239837398373984	163	0.45027624309392267	109	0.19055944055944055	282	0.3720316622691293	T	0.022	-1.412533	0.01145	0.578431	0.357895	ENSG00000232125	ENST00000452335	T	0.12465	2.68	5.12	0.26	0.15588	.	.	.	.	.	T	0.00012	0.0000	N	0.01874	-0.695	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.40590	-0.9555	8	0.02654	T	1	-0.7123	4.8672	0.13615	0.0:0.3448:0.1647:0.4904	rs2115591;rs52796299;rs57633224;rs2115591	474	A2CJ06	DYTN_HUMAN	K	474	ENSP00000396593:Q474K	ENSP00000396593:Q474K	Q	-	1	0	DYTN	207236085	0.002000	0.14202	0.000000	0.03702	0.000000	0.00434	0.883000	0.28200	-0.055000	0.13244	-1.816000	0.00601	CAG	G|0.615;N|0.000		0.507	DYTN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336799.1		
LOC151174	151174	broad.mit.edu	37	2	239134056	239134056	+	Silent	SNP	A	A	G	rs7572285	byFrequency	TCGA-PK-A5H9-01A-11D-A29I-10	TCGA-PK-A5H9-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	cb1f20fc-0df5-42f5-91b8-624bee1a532a	4fa707a6-752b-4fda-9bc0-b07c80cf65c1	g.chr2:239134056A>G	ENST00000409070.1	-	3	430	c.219T>C	c.(217-219)gcT>gcC	p.A73A	AC016757.3_ENST00000470346.1_5'UTR|AC016757.3_ENST00000409942.1_Silent_p.A53A|AC016757.3_ENST00000334973.4_Silent_p.A50A|AC016757.3_ENST00000409376.1_Silent_p.A53A																							tacgtgcaagagcaccagggc	0.632													G|||	1686	0.336661	0.3858	0.3458	5008	,	,		15883	0.248		0.3996	False		,,,				2504	0.2904				.		.											.	.	0			.						.																																			SO:0001819	synonymous_variant	0	.			TGCAAGAGCACCA																												ENST00000409070.1:c.219T>C	2.37:g.239134056A>G		Somatic	202	2		WXS	Illumina GAIIx	Phase_I	202	6	.	0	0	2	2	0		RNA	SNP	ENST00000409070.1	37																																																																																				A|0.645;G|0.355		0.632	AC016757.3-006	PUTATIVE	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000328480.1		
LOC151174	151174	broad.mit.edu	37	2	239134063	239134063	+	Missense_Mutation	SNP	G	G	T	rs7584376	byFrequency	TCGA-PK-A5H9-01A-11D-A29I-10	TCGA-PK-A5H9-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	cb1f20fc-0df5-42f5-91b8-624bee1a532a	4fa707a6-752b-4fda-9bc0-b07c80cf65c1	g.chr2:239134063G>T	ENST00000409070.1	-	3	423	c.212C>A	c.(211-213)cCt>cAt	p.P71H	AC016757.3_ENST00000470346.1_5'UTR|AC016757.3_ENST00000409942.1_Missense_Mutation_p.P51H|AC016757.3_ENST00000334973.4_Missense_Mutation_p.P48H|AC016757.3_ENST00000409376.1_Missense_Mutation_p.P51H																							aagagcaccagggcAGAGCTC	0.627													G|||	845	0.16873	0.0325	0.2392	5008	,	,		16107	0.12		0.326	False		,,,				2504	0.1912				.		.											.	.	0			.						.																																			SO:0001583	missense	0	.			GCACCAGGGCAGA																												ENST00000409070.1:c.212C>A	2.37:g.239134063G>T	ENSP00000386947:p.Pro71His	Somatic	199	2		WXS	Illumina GAIIx	Phase_I	200	6	.	0	0	1	1	0		RNA	SNP	ENST00000409070.1	37		446	0.2042124542124542	18	0.036585365853658534	105	0.2900552486187845	68	0.11888111888111888	255	0.33641160949868076	G	7.455	0.643471	0.14451	.	.	ENSG00000186235	ENST00000409376;ENST00000334973;ENST00000409070;ENST00000409942	T;T;T;T	0.75589	-0.95;-0.95;-0.95;-0.95	1.68	-1.83	0.07833	.	.	.	.	.	T	0.00012	0.0000	.	.	.	.	.	.	D	0.76494	0.999	P	0.62740	0.906	T	0.08743	-1.0707	7	0.87932	D	0	.	2.759	0.05302	0.4028:0.2517:0.3455:0.0	rs7584376;rs58314458;rs7584376	71	E7EUL1	.	H	51;48;71;51	ENSP00000386409:P51H;ENSP00000334143:P48H;ENSP00000386947:P71H;ENSP00000386755:P51H	ENSP00000334143:P48H	P	-	2	0	AC016757.3	238798802	0.009000	0.17119	0.000000	0.03702	0.092000	0.18411	-0.181000	0.09740	-0.607000	0.05738	0.563000	0.77884	CCT	G|0.823;T|0.177		0.627	AC016757.3-006	PUTATIVE	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000328480.1		
LOC151174	151174	broad.mit.edu	37	2	239140728	239140728	+	5'Flank	SNP	A	A	G	rs11689033	byFrequency	TCGA-PK-A5H9-01A-11D-A29I-10	TCGA-PK-A5H9-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	cb1f20fc-0df5-42f5-91b8-624bee1a532a	4fa707a6-752b-4fda-9bc0-b07c80cf65c1	g.chr2:239140728A>G	ENST00000409070.1	-	0	0				AC016757.3_ENST00000470346.1_5'Flank|AC016757.3_ENST00000409942.1_5'Flank|AC016757.3_ENST00000334973.4_5'Flank|AC016757.3_ENST00000409376.1_5'Flank|AC096574.4_ENST00000456601.1_RNA																							CTGGCTGGAGAAATCCGGTGT	0.493													A|||	841	0.167931	0.0212	0.2478	5008	,	,		18366	0.121		0.335	False		,,,				2504	0.1861				.		.											.	.	0			.						.																																			SO:0001631	upstream_gene_variant	0	.			CTGGAGAAATCCG																													2.37:g.239140728A>G	Exception_encountered	Somatic	96	2		WXS	Illumina GAIIx	Phase_I	110	5	.	0	0	0	0	0		RNA	SNP	ENST00000409070.1	37																																																																																				A|0.825;G|0.175		0.493	AC016757.3-006	PUTATIVE	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000328480.1		
PANK2	80025	hgsc.bcm.edu	37	20	3870124	3870124	+	Missense_Mutation	SNP	G	G	C	rs3737084	byFrequency	TCGA-PK-A5H9-01A-11D-A29I-10	TCGA-PK-A5H9-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	cb1f20fc-0df5-42f5-91b8-624bee1a532a	4fa707a6-752b-4fda-9bc0-b07c80cf65c1	g.chr20:3870124G>C	ENST00000316562.4	+	1	383	c.377G>C	c.(376-378)gGg>gCg	p.G126A	RP11-119B16.2_ENST00000451507.1_RNA|PANK2_ENST00000610179.1_Missense_Mutation_p.G3A|PANK2_ENST00000497424.1_Intron	NM_153638.2	NP_705902.2	Q9BZ23	PANK2_HUMAN	pantothenate kinase 2	126			G -> A (in dbSNP:rs3737084). {ECO:0000269|PubMed:11479594, ECO:0000269|PubMed:12554685, ECO:0000269|Ref.3}.		aerobic respiration (GO:0009060)|cell death (GO:0008219)|coenzyme A biosynthetic process (GO:0015937)|coenzyme biosynthetic process (GO:0009108)|mitochondrion morphogenesis (GO:0070584)|pantothenate metabolic process (GO:0015939)|regulation of mitochondrial membrane potential (GO:0051881)|small molecule metabolic process (GO:0044281)|spermatid development (GO:0007286)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)|mitochondrial intermembrane space (GO:0005758)	ATP binding (GO:0005524)|pantothenate kinase activity (GO:0004594)			breast(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(5)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	15						CGGATGGGAGGGGGCCGGCTC	0.766													C|||	4403	0.879193	0.9939	0.9323	5008	,	,		9294	0.7946		0.8757	False		,,,				2504	0.7771				p.G126A		.											.	PANK2-115	0			c.G377C						.		,ALA/GLY	3009,53		1478,53,0	2.0	3.0	3.0		,377	4.7	1.0	20	dbSNP_107	3	6120,564		2797,526,19	no	intron,missense	PANK2	NM_024960.4,NM_153638.2	,60	4275,579,19	CC,CG,GG		8.4381,1.7309,6.3308	,benign	,126/571	3870124	9129,617	1531	3342	4873	SO:0001583	missense	80025	exon1			TGGGAGGGGGCCG	AK021791	CCDS13071.2, CCDS13072.1	20p13	2008-07-31	2008-07-31	2002-09-06	ENSG00000125779	ENSG00000125779	2.7.1.33		15894	protein-coding gene	gene with protein product	"""Hallervorden-Spatz syndrome"""	606157	"""neurodegeneration with brain iron accumulation 1 (Hallervorden-Spatz syndrome)"""	C20orf48, NBIA1		8944032, 11479594	Standard	XM_005260835		Approved	HSS, FLJ11729, PKAN, HARP	uc002wkc.3	Q9BZ23	OTTHUMG00000031768	ENST00000316562.4:c.377G>C	20.37:g.3870124G>C	ENSP00000313377:p.Gly126Ala	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	9	9	NM_153638	0	0	0	1	1	B1AK33|B2Z3X0|D3DVZ0|Q5T7I2|Q5T7I4|Q7RTX5|Q8N7Q4|Q8TCR5|Q9BYW5|Q9HAF2	Missense_Mutation	SNP	ENST00000316562.4	37	CCDS13071.2	1920	0.8791208791208791	489	0.9939024390243902	334	0.9226519337016574	438	0.7657342657342657	659	0.8693931398416886	C	8.681	0.905209	0.17760	0.982691	0.915619	ENSG00000125779	ENST00000316562	D	0.96265	-3.96	4.73	4.73	0.59995	.	0.504726	0.16798	N	0.199120	T	0.00012	0.0000	N	0.08118	0	0.58432	P	1.0000000000287557E-6	B	0.02656	0.0	B	0.01281	0.0	T	0.41574	-0.9501	9	0.02654	T	1	.	11.198	0.48724	0.0:0.8144:0.1856:0.0	rs3737084	126	Q9BZ23	PANK2_HUMAN	A	126	ENSP00000313377:G126A	ENSP00000313377:G126A	G	+	2	0	PANK2	3818124	0.994000	0.37717	0.990000	0.47175	0.991000	0.79684	1.019000	0.30014	1.369000	0.46134	-0.164000	0.13417	GGG	G|0.122;C|0.878		0.766	PANK2-007	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000077793.2	NM_024960	
PLCB4	5332	broad.mit.edu;bcgsc.ca	37	20	9453937	9453937	+	Silent	SNP	G	G	A			TCGA-PK-A5H9-01A-11D-A29I-10	TCGA-PK-A5H9-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	cb1f20fc-0df5-42f5-91b8-624bee1a532a	4fa707a6-752b-4fda-9bc0-b07c80cf65c1	g.chr20:9453937G>A	ENST00000378493.1	+	34	3399	c.3384G>A	c.(3382-3384)aaG>aaA	p.K1128K	PLCB4_ENST00000492632.1_3'UTR|PLCB4_ENST00000278655.4_Silent_p.K1128K|PLCB4_ENST00000334005.3_Silent_p.K1128K|PLCB4_ENST00000414679.2_Silent_p.K1140K|PLCB4_ENST00000378473.3_Silent_p.K1140K|PLCB4_ENST00000378501.2_Silent_p.K1128K			Q15147	PLCB4_HUMAN	phospholipase C, beta 4	1128					inositol phosphate metabolic process (GO:0043647)|intracellular signal transduction (GO:0035556)|lipid catabolic process (GO:0016042)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|dendrite (GO:0030425)|nucleus (GO:0005634)|postsynaptic density (GO:0014069)|smooth endoplasmic reticulum (GO:0005790)	calcium ion binding (GO:0005509)|phosphatidylinositol phospholipase C activity (GO:0004435)|phospholipase C activity (GO:0004629)|signal transducer activity (GO:0004871)			NS(2)|breast(4)|cervix(1)|endometrium(2)|kidney(4)|large_intestine(11)|liver(4)|lung(34)|ovary(3)|pancreas(1)|prostate(1)|skin(19)|upper_aerodigestive_tract(1)	87						TTGCCATGAAGCAGTCCAAAG	0.313																																					p.K1140K		.											.	PLCB4-274	0			c.G3420A						.						48.0	47.0	47.0					20																	9453937		2203	4300	6503	SO:0001819	synonymous_variant	5332	exon37			CATGAAGCAGTCC		CCDS13104.1, CCDS13105.1, CCDS54447.1	20p12	2008-03-18			ENSG00000101333	ENSG00000101333	3.1.4.11		9059	protein-coding gene	gene with protein product		600810				8530101	Standard	NM_000933		Approved		uc021wam.1	Q15147	OTTHUMG00000031853	ENST00000378493.1:c.3384G>A	20.37:g.9453937G>A		Somatic	86	3		WXS	Illumina GAIIx	Phase_I	78	9	NM_001172646	0	0	0	0	0	B7ZLK6|E2QRH8|Q17R56|Q5JYS8|Q5JYS9|Q5JYT0|Q5JYT3|Q5JYT4|Q9BQW5|Q9BQW6|Q9BQW8|Q9UJQ2	Silent	SNP	ENST00000378493.1	37	CCDS13105.1																																																																																			.		0.313	PLCB4-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000077948.2		
WFDC5	149708	bcgsc.ca	37	20	43739119	43739119	+	Missense_Mutation	SNP	G	G	A	rs17422688	byFrequency	TCGA-PK-A5H9-01A-11D-A29I-10	TCGA-PK-A5H9-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	cb1f20fc-0df5-42f5-91b8-624bee1a532a	4fa707a6-752b-4fda-9bc0-b07c80cf65c1	g.chr20:43739119G>A	ENST00000307971.4	-	3	367	c.289C>T	c.(289-291)Cac>Tac	p.H97Y	WFDC5_ENST00000372789.4_Missense_Mutation_p.H97Y			Q8TCV5	WFDC5_HUMAN	WAP four-disulfide core domain 5	97	WAP 2. {ECO:0000255|PROSITE- ProRule:PRU00722}.		H -> Y (in dbSNP:rs17422688). {ECO:0000269|PubMed:12975309}.			extracellular region (GO:0005576)	serine-type endopeptidase inhibitor activity (GO:0004867)			kidney(1)|large_intestine(1)|lung(1)|ovary(1)|skin(1)	5		Myeloproliferative disorder(115;0.0122)				GAGTCCTTGTGACACAGGTGG	0.647													G|||	368	0.0734824	0.0174	0.0764	5008	,	,		19271	0.0288		0.16	False		,,,				2504	0.1043				p.H97Y	NSCLC(199;98 2227 9943 13455 41914)	.											.	WFDC5-91	0			c.C289T						.	G	TYR/HIS	195,4211	122.5+/-159.9	3,189,2011	42.0	40.0	41.0		289	-4.0	0.0	20	dbSNP_123	41	1466,7134	276.7+/-292.4	120,1226,2954	yes	missense	WFDC5	NM_145652.3	83	123,1415,4965	AA,AG,GG		17.0465,4.4258,12.771	possibly-damaging	97/124	43739119	1661,11345	2203	4300	6503	SO:0001583	missense	149708	exon3			CCTTGTGACACAG	AY038181	CCDS33475.1	20q13.11	2013-01-21			ENSG00000175121	ENSG00000175121		"""WAP four-disulfide core domain containing"""	20477	protein-coding gene	gene with protein product		605161				12206714, 10680116	Standard	NM_145652		Approved	WAP1, dJ211D12.5	uc002xne.2	Q8TCV5	OTTHUMG00000046411	ENST00000307971.4:c.289C>T	20.37:g.43739119G>A	ENSP00000312381:p.His97Tyr	Somatic	118	1		WXS	Illumina GAIIx	Phase_I	119	6	NM_145652	0	0	0	0	0	Q5H981|Q6UWE4	Missense_Mutation	SNP	ENST00000307971.4	37		178	0.0815018315018315	6	0.012195121951219513	34	0.09392265193370165	17	0.02972027972027972	121	0.15963060686015831	G	16.78	3.217685	0.58560	0.044258	0.170465	ENSG00000175121	ENST00000372789;ENST00000307971	T;T	0.71817	-0.6;-0.6	5.08	-3.96	0.04106	Whey acidic protein, 4-disulphide core (5);4-disulphide core (1);	1.882690	0.02463	N	0.086740	T	0.00271	0.0008	N	0.21240	0.645	0.80722	P	0.0	D	0.59357	0.985	P	0.51055	0.657	T	0.11518	-1.0584	9	0.39692	T	0.17	-7.7373	2.352	0.04286	0.1046:0.2258:0.1744:0.4952	rs17422688;rs52814649;rs17422688	97	Q8TCV5	WFDC5_HUMAN	Y	97	ENSP00000361875:H97Y;ENSP00000312381:H97Y	ENSP00000312381:H97Y	H	-	1	0	WFDC5	43172533	0.004000	0.15560	0.039000	0.18376	0.163000	0.22366	-0.226000	0.09139	-0.253000	0.09514	0.467000	0.42956	CAC	G|0.896;A|0.104		0.647	WFDC5-002	KNOWN	not_organism_supported|basic	protein_coding	protein_coding	OTTHUMT00000107192.1		
CLIC6	54102	hgsc.bcm.edu	37	21	36041978	36041978	+	Silent	SNP	A	A	G	rs7280973		TCGA-PK-A5H9-01A-11D-A29I-10	TCGA-PK-A5H9-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	cb1f20fc-0df5-42f5-91b8-624bee1a532a	4fa707a6-752b-4fda-9bc0-b07c80cf65c1	g.chr21:36041978A>G	ENST00000360731.3	+	1	291	c.291A>G	c.(289-291)caA>caG	p.Q97Q	CLIC6_ENST00000349499.2_Silent_p.Q97Q			Q96NY7	CLIC6_HUMAN	chloride intracellular channel 6	97						chloride channel complex (GO:0034707)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	voltage-gated chloride channel activity (GO:0005247)			breast(1)|central_nervous_system(2)|endometrium(2)|kidney(3)|large_intestine(2)|lung(2)|ovary(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	19						AGGTGCCCCAAGGAGGGGAGG	0.796													G|||	5008	1.0	1.0	1.0	5008	,	,		8940	1.0		1.0	False		,,,				2504	1.0				p.Q97Q		.											.	CLIC6-91	0			c.A291G						.						2.0	2.0	2.0					21																	36041978		1056	2327	3383	SO:0001819	synonymous_variant	54102	exon1			GCCCCAAGGAGGG	AF426169	CCDS13638.1	21q22.12	2012-09-26			ENSG00000159212	ENSG00000159212		"""Ion channels / Chloride channels : Intracellular"""	2065	protein-coding gene	gene with protein product		615321		CLIC1L		10830953	Standard	NM_053277		Approved	CLIC5	uc002yuf.1	Q96NY7	OTTHUMG00000086237	ENST00000360731.3:c.291A>G	21.37:g.36041978A>G		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	6	6	NM_053277	0	0	0	0	0	A8K0U8|Q8IX31	Silent	SNP	ENST00000360731.3	37																																																																																				A|0.001;G|0.999		0.796	CLIC6-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000194156.1		
TBX1	6899	hgsc.bcm.edu	37	22	19753444	19753444	+	Missense_Mutation	SNP	G	G	A	rs41298838	byFrequency	TCGA-PK-A5H9-01A-11D-A29I-10	TCGA-PK-A5H9-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	cb1f20fc-0df5-42f5-91b8-624bee1a532a	4fa707a6-752b-4fda-9bc0-b07c80cf65c1	g.chr22:19753444G>A	ENST00000329705.7	+	8	1057	c.928G>A	c.(928-930)Ggc>Agc	p.G310S	TBX1_ENST00000332710.4_Missense_Mutation_p.G310S|TBX1_ENST00000359500.3_Missense_Mutation_p.G310S	NM_080646.1	NP_542377.1	O43435	TBX1_HUMAN	T-box 1	310			G -> S (in DGS; dbSNP:rs41298838). {ECO:0000269|PubMed:14585638}.		angiogenesis (GO:0001525)|anterior/posterior pattern specification (GO:0009952)|aorta morphogenesis (GO:0035909)|artery morphogenesis (GO:0048844)|blood vessel development (GO:0001568)|blood vessel morphogenesis (GO:0048514)|blood vessel remodeling (GO:0001974)|cell fate specification (GO:0001708)|cell proliferation (GO:0008283)|cellular response to fibroblast growth factor stimulus (GO:0044344)|cellular response to retinoic acid (GO:0071300)|cochlea morphogenesis (GO:0090103)|coronary artery morphogenesis (GO:0060982)|determination of left/right symmetry (GO:0007368)|ear morphogenesis (GO:0042471)|embryonic cranial skeleton morphogenesis (GO:0048701)|embryonic viscerocranium morphogenesis (GO:0048703)|enamel mineralization (GO:0070166)|epithelial cell differentiation (GO:0030855)|face morphogenesis (GO:0060325)|heart development (GO:0007507)|heart morphogenesis (GO:0003007)|inner ear morphogenesis (GO:0042472)|lymph vessel development (GO:0001945)|mesenchymal cell apoptotic process (GO:0097152)|mesoderm development (GO:0007498)|middle ear morphogenesis (GO:0042474)|muscle cell fate commitment (GO:0042693)|muscle organ development (GO:0007517)|muscle organ morphogenesis (GO:0048644)|muscle tissue morphogenesis (GO:0060415)|negative regulation of cell differentiation (GO:0045596)|negative regulation of mesenchymal cell apoptotic process (GO:2001054)|neural crest cell migration (GO:0001755)|odontogenesis of dentin-containing tooth (GO:0042475)|otic vesicle morphogenesis (GO:0071600)|outer ear morphogenesis (GO:0042473)|outflow tract morphogenesis (GO:0003151)|outflow tract septum morphogenesis (GO:0003148)|parathyroid gland development (GO:0060017)|pattern specification process (GO:0007389)|pharyngeal system development (GO:0060037)|positive regulation of cell proliferation (GO:0008284)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of secondary heart field cardioblast proliferation (GO:0072513)|positive regulation of tongue muscle cell differentiation (GO:2001037)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of organ morphogenesis (GO:2000027)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|retinoic acid receptor signaling pathway (GO:0048384)|semicircular canal morphogenesis (GO:0048752)|sensory perception of sound (GO:0007605)|social behavior (GO:0035176)|soft palate development (GO:0060023)|thymus development (GO:0048538)|thyroid gland development (GO:0030878)|tongue morphogenesis (GO:0043587)|transcription, DNA-templated (GO:0006351)|vagus nerve morphogenesis (GO:0021644)	nucleus (GO:0005634)	DNA binding (GO:0003677)|protein dimerization activity (GO:0046983)|protein homodimerization activity (GO:0042803)|sequence-specific DNA binding (GO:0043565)			breast(2)|central_nervous_system(1)|lung(3)|ovary(2)	8	Colorectal(54;0.0993)	all_lung(157;3.05e-06)				CCACCGGCCCGGCGCACTGCC	0.761													G|||	45	0.00898562	0.0	0.0	5008	,	,		6689	0.0437		0.0	False		,,,				2504	0.001				p.G310S		.											.	TBX1-154	0			c.G928A	GRCh37	CM033032	TBX1	M	rs41298838	.																																			SO:0001583	missense	6899	exon8			CGGCCCGGCGCAC	AF012131	CCDS13765.1, CCDS13766.1, CCDS13767.1	22q11.21	2014-09-17			ENSG00000184058	ENSG00000184058		"""T-boxes"""	11592	protein-coding gene	gene with protein product		602054	"""velocardiofacial syndrome"""	VCF		9268629, 23000736	Standard	NM_080646		Approved	CATCH22	uc002zqa.1	O43435	OTTHUMG00000150421	ENST00000329705.7:c.928G>A	22.37:g.19753444G>A	ENSP00000331176:p.Gly310Ser	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	6	6	NM_080647	0	0	0	0	0	C6G493|C6G494|O43436|Q96RJ2	Missense_Mutation	SNP	ENST00000329705.7	37	CCDS13766.1	23	0.010531135531135532	4	0.008130081300813009	0	0.0	19	0.033216783216783216	0	0.0	G	22.2	4.259117	0.80246	.	.	ENSG00000184058	ENST00000332710;ENST00000329705;ENST00000359500	D;D;D	0.86562	-2.09;-2.03;-2.14	3.9	3.9	0.45041	.	.	.	.	.	T	0.54515	0.1863	L	0.34521	1.04	0.80722	A	1	P;P;P	0.44429	0.751;0.835;0.703	B;B;B	0.28991	0.097;0.06;0.072	T	0.74876	-0.3515	8	0.14252	T	0.57	.	15.7315	0.77807	0.0:0.0:1.0:0.0	rs41298838	310;310;310	Q152R5;O43435;D9ZGG0	.;TBX1_HUMAN;.	S	310	ENSP00000331791:G310S;ENSP00000331176:G310S;ENSP00000352483:G310S	ENSP00000331176:G310S	G	+	1	0	TBX1	18133444	1.000000	0.71417	0.912000	0.35992	0.990000	0.78478	8.566000	0.90734	2.034000	0.60081	0.485000	0.47835	GGC	G|0.989;A|0.011		0.761	TBX1-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000318033.1	NM_080647	
LHFPL4	375323	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	9543923	9543923	+	Missense_Mutation	SNP	C	C	A			TCGA-PK-A5H9-01A-11D-A29I-10	TCGA-PK-A5H9-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	cb1f20fc-0df5-42f5-91b8-624bee1a532a	4fa707a6-752b-4fda-9bc0-b07c80cf65c1	g.chr3:9543923C>A	ENST00000287585.6	-	4	1001	c.716G>T	c.(715-717)tGc>tTc	p.C239F	RP11-58B17.2_ENST00000602693.1_lincRNA	NM_198560.2	NP_940962.1	Q86UP9	LHPL3_HUMAN	lipoma HMGIC fusion partner-like 4	0						integral component of membrane (GO:0016021)				endometrium(1)|kidney(1)|large_intestine(2)|lung(2)|ovary(3)|skin(1)	10	Medulloblastoma(99;0.227)					AGCCACGGGGCAGGGAAGGAC	0.577																																					p.C239F		.											.	LHFPL4-71	0			c.G716T						.						56.0	52.0	53.0					3																	9543923		2203	4300	6503	SO:0001583	missense	375323	exon4			ACGGGGCAGGGAA	AY278320	CCDS33691.1	3p25.3	2006-06-13			ENSG00000156959	ENSG00000156959			29568	protein-coding gene	gene with protein product		610240				15905332	Standard	NM_198560		Approved		uc003bry.3	Q7Z7J7	OTTHUMG00000155066	ENST00000287585.6:c.716G>T	3.37:g.9543923C>A	ENSP00000287585:p.Cys239Phe	Somatic	182	0		WXS	Illumina GAIIx	Phase_I	173	70	NM_198560	0	0	0	0	0	A1L383|A4D0Q5	Missense_Mutation	SNP	ENST00000287585.6	37	CCDS33691.1	.	.	.	.	.	.	.	.	.	.	C	13.71	2.317734	0.40996	.	.	ENSG00000156959	ENST00000287585	T	0.71934	-0.61	4.3	4.3	0.51218	.	1.567390	0.04664	N	0.409527	T	0.58104	0.2099	N	0.08118	0	0.35665	D	0.812878	P	0.39520	0.676	B	0.39738	0.308	T	0.55842	-0.8077	10	0.56958	D	0.05	-12.1742	12.1617	0.54107	0.0:1.0:0.0:0.0	.	239	Q7Z7J7	LHPL4_HUMAN	F	239	ENSP00000287585:C239F	ENSP00000287585:C239F	C	-	2	0	LHFPL4	9518923	1.000000	0.71417	0.998000	0.56505	0.993000	0.82548	2.187000	0.42602	2.238000	0.73509	0.563000	0.77884	TGC	.		0.577	LHFPL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000338298.1	NM_198560	
ZMYND10	51364	hgsc.bcm.edu	37	3	50378176	50378176	+	IGR	SNP	T	T	G	rs4688725	byFrequency	TCGA-PK-A5H9-01A-11D-A29I-10	TCGA-PK-A5H9-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	cb1f20fc-0df5-42f5-91b8-624bee1a532a	4fa707a6-752b-4fda-9bc0-b07c80cf65c1	g.chr3:50378176T>G	ENST00000231749.3	-	0	2896				RASSF1_ENST00000488024.1_5'UTR|RASSF1_ENST00000359365.4_Missense_Mutation_p.K21Q|RASSF1_ENST00000395126.3_5'Flank|RASSF1_ENST00000357043.2_Missense_Mutation_p.K21Q|ZMYND10-AS1_ENST00000440013.1_RNA|ZMYND10_ENST00000490675.1_5'Flank	NM_015896.2	NP_056980.2	O75800	ZMY10_HUMAN	zinc finger, MYND-type containing 10						inner dynein arm assembly (GO:0036159)|motile cilium assembly (GO:0044458)|outer dynein arm assembly (GO:0036158)	centriolar satellite (GO:0034451)|cytoplasm (GO:0005737)	metal ion binding (GO:0046872)			endometrium(3)|kidney(2)|large_intestine(1)|lung(5)|ovary(1)|urinary_tract(2)	14				BRCA - Breast invasive adenocarcinoma(193;0.000272)|KIRC - Kidney renal clear cell carcinoma(197;0.00544)|Kidney(197;0.00607)		GTGCGGCCCTTCCCAGCGCGC	0.736										TSP Lung(30;0.18)			G|||	1175	0.234625	0.2436	0.2954	5008	,	,		13606	0.62		0.0119	False		,,,				2504	0.0112				p.K21Q		.											.	RASSF1-417	0			c.A61C						.	G	,GLN/LYS,GLN/LYS	402,2740		7,388,1176	2.0	3.0	3.0		,61,61	4.5	0.0	3	dbSNP_111	3	24,6908		0,24,3442	no	utr-5,missense,missense	RASSF1	NM_001206957.1,NM_007182.4,NM_170714.1	,53,53	7,412,4618	GG,GT,TT		0.3462,12.7944,4.2287	,benign,benign	,21/341,21/345	50378176	426,9648	1571	3466	5037	SO:0001628	intergenic_variant	11186	exon1			GGCCCTTCCCAGC	U70824	CCDS2825.1	3p21.3	2014-02-03			ENSG00000004838	ENSG00000004838		"""Zinc fingers, MYND-type"""	19412	protein-coding gene	gene with protein product		607070				12629521, 23891469	Standard	NM_015896		Approved	BLU, CILD22	uc003dag.1	O75800	OTTHUMG00000156874		3.37:g.50378176T>G		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	15	4	NM_007182	0	0	0	0	0	A6NK41|B3KU54|O14570|O75801|Q53FE6|Q8N4R6|Q8NDN6	Missense_Mutation	SNP	ENST00000231749.3	37	CCDS2825.1	588	0.2692307692307692	154	0.3130081300813008	87	0.24033149171270718	338	0.5909090909090909	9	0.011873350923482849	G	1.302	-0.604589	0.03717	0.127944	0.003462	ENSG00000068028	ENST00000357043;ENST00000359365	T;T	0.76448	-1.02;-1.01	5.35	4.48	0.54585	.	1.004080	0.08017	N	0.991328	T	0.00012	0.0000	N	0.08118	0	0.80722	P	0.0	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.01281	0.0;0.0;0.0	T	0.45920	-0.9228	9	0.12766	T	0.61	-7.5566	7.9536	0.30029	0.0764:0.0:0.6392:0.2844	rs4688725	21;21;21	B4DVA1;Q9NS23-2;Q9NS23	.;.;RASF1_HUMAN	Q	21	ENSP00000349547:K21Q;ENSP00000352323:K21Q	ENSP00000349547:K21Q	K	-	1	0	RASSF1	50353180	0.003000	0.15002	0.029000	0.17559	0.010000	0.07245	0.412000	0.21131	0.652000	0.30806	-0.121000	0.15023	AAG	T|0.731;G|0.269		0.736	ZMYND10-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000346376.1	NM_015896	
LRIG1	26018	hgsc.bcm.edu	37	3	66550756	66550756	+	Missense_Mutation	SNP	G	G	C	rs1403625	byFrequency	TCGA-PK-A5H9-01A-11D-A29I-10	TCGA-PK-A5H9-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	cb1f20fc-0df5-42f5-91b8-624bee1a532a	4fa707a6-752b-4fda-9bc0-b07c80cf65c1	g.chr3:66550756G>C	ENST00000273261.3	-	1	600	c.76C>G	c.(76-78)Ctt>Gtt	p.L26V	LRIG1_ENST00000383703.3_Missense_Mutation_p.L26V	NM_015541.2	NP_056356.2	Q96JA1	LRIG1_HUMAN	leucine-rich repeats and immunoglobulin-like domains 1	26				LLL -> VLV (in Ref. 1; AAK62357 and 3; AAH71561). {ECO:0000305}.	innervation (GO:0060384)|otolith morphogenesis (GO:0032474)|sensory perception of sound (GO:0007605)	integral component of membrane (GO:0016021)				NS(2)|breast(2)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(7)|lung(12)|ovary(3)|prostate(1)|skin(4)|stomach(4)|urinary_tract(1)	42		Lung NSC(201;0.0101)		BRCA - Breast invasive adenocarcinoma(55;0.00047)		TCCAGCCGAAGCAAAAGCAGC	0.761													g|||	3605	0.719848	0.1808	0.8833	5008	,	,		8093	0.8284		0.9732	False		,,,				2504	0.9601				p.L26V		.											.	LRIG1-230	0			c.C76G						.		VAL/LEU	1298,1386		255,788,299	3.0	4.0	4.0		76	2.9	0.5	3	dbSNP_88	4	5191,89		2555,81,4	yes	missense	LRIG1	NM_015541.2	32	2810,869,303	CC,CG,GG		1.6856,48.3607,18.5208	benign	26/1094	66550756	6489,1475	1342	2640	3982	SO:0001583	missense	26018	exon1			GCCGAAGCAAAAG	AB050468	CCDS33783.1	3p14	2013-01-14			ENSG00000144749	ENSG00000144749		"""Immunoglobulin superfamily / I-set domain containing"""	17360	protein-coding gene	gene with protein product	"""ortholog of mouse integral membrane glycoprotein LIG-1"", ""leucine-rich repeat protein LRIG1"""	608868				11414704, 12234026	Standard	NM_015541		Approved	LIG-1, DKFZP586O1624, LIG1	uc003dmx.3	Q96JA1	OTTHUMG00000158727	ENST00000273261.3:c.76C>G	3.37:g.66550756G>C	ENSP00000273261:p.Leu26Val	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	13	5	NM_015541	0	0	0	0	0	Q6IQ51|Q96CF9|Q9BYB8|Q9UFI4	Missense_Mutation	SNP	ENST00000273261.3	37	CCDS33783.1	1666	0.7628205128205128	118	0.23983739837398374	325	0.8977900552486188	489	0.8548951048951049	734	0.9683377308707124	g	6.572	0.473779	0.12521	0.483607	0.983144	ENSG00000144749	ENST00000273261;ENST00000383703	T;T	0.67345	-0.26;-0.13	3.84	2.93	0.34026	.	0.847359	0.09512	U	0.792175	T	0.00012	0.0000	N	0.19112	0.55	0.80722	P	0.0	P;P	0.44139	0.827;0.484	B;B	0.37731	0.257;0.096	T	0.48854	-0.8998	9	0.23302	T	0.38	.	8.6883	0.34251	0.1185:0.0:0.8815:0.0	rs1403625;rs13083628	26;26	Q96JA1-2;Q96JA1	.;LRIG1_HUMAN	V	26	ENSP00000273261:L26V;ENSP00000373208:L26V	ENSP00000273261:L26V	L	-	1	0	LRIG1	66633446	.	.	0.520000	0.27837	0.020000	0.10135	.	.	1.845000	0.53610	0.472000	0.43445	CTT	G|0.237;C|0.763		0.761	LRIG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351930.1	NM_015541	
LRIG1	26018	hgsc.bcm.edu	37	3	66550762	66550762	+	Missense_Mutation	SNP	G	G	C	rs1403626	byFrequency	TCGA-PK-A5H9-01A-11D-A29I-10	TCGA-PK-A5H9-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	cb1f20fc-0df5-42f5-91b8-624bee1a532a	4fa707a6-752b-4fda-9bc0-b07c80cf65c1	g.chr3:66550762G>C	ENST00000273261.3	-	1	594	c.70C>G	c.(70-72)Ctt>Gtt	p.L24V	LRIG1_ENST00000383703.3_Missense_Mutation_p.L24V	NM_015541.2	NP_056356.2	Q96JA1	LRIG1_HUMAN	leucine-rich repeats and immunoglobulin-like domains 1	24			L -> V (in dbSNP:rs1403626).	LLL -> VLV (in Ref. 1; AAK62357 and 3; AAH71561). {ECO:0000305}.	innervation (GO:0060384)|otolith morphogenesis (GO:0032474)|sensory perception of sound (GO:0007605)	integral component of membrane (GO:0016021)				NS(2)|breast(2)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(7)|lung(12)|ovary(3)|prostate(1)|skin(4)|stomach(4)|urinary_tract(1)	42		Lung NSC(201;0.0101)		BRCA - Breast invasive adenocarcinoma(55;0.00047)		CGAAGCAAAAGCAGCCAGAGA	0.766													g|||	3605	0.719848	0.1808	0.8833	5008	,	,		8368	0.8284		0.9732	False		,,,				2504	0.9601				p.L24V		.											.	LRIG1-230	0			c.C70G						.		VAL/LEU	1309,1447		265,779,334	3.0	4.0	4.0		70	3.1	0.5	3	dbSNP_88	4	5325,93		2620,85,4	no	missense	LRIG1	NM_015541.2	32	2885,864,338	CC,CG,GG		1.7165,47.4964,18.8402	benign	24/1094	66550762	6634,1540	1378	2709	4087	SO:0001583	missense	26018	exon1			GCAAAAGCAGCCA	AB050468	CCDS33783.1	3p14	2013-01-14			ENSG00000144749	ENSG00000144749		"""Immunoglobulin superfamily / I-set domain containing"""	17360	protein-coding gene	gene with protein product	"""ortholog of mouse integral membrane glycoprotein LIG-1"", ""leucine-rich repeat protein LRIG1"""	608868				11414704, 12234026	Standard	NM_015541		Approved	LIG-1, DKFZP586O1624, LIG1	uc003dmx.3	Q96JA1	OTTHUMG00000158727	ENST00000273261.3:c.70C>G	3.37:g.66550762G>C	ENSP00000273261:p.Leu24Val	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	16	6	NM_015541	0	0	0	0	0	Q6IQ51|Q96CF9|Q9BYB8|Q9UFI4	Missense_Mutation	SNP	ENST00000273261.3	37	CCDS33783.1	1670	0.7646520146520146	119	0.241869918699187	326	0.9005524861878453	488	0.8531468531468531	737	0.9722955145118733	g	9.592	1.126319	0.20959	0.474964	0.982835	ENSG00000144749	ENST00000273261;ENST00000383703	T;T	0.68765	-0.35;-0.2	3.11	3.11	0.35812	.	0.429988	0.15146	U	0.278020	T	0.00012	0.0000	N	0.19112	0.55	0.39998	P	0.024872000000000005	P;B	0.36282	0.546;0.282	B;B	0.32465	0.146;0.069	T	0.40572	-0.9556	9	0.23891	T	0.37	.	12.0321	0.53403	0.0:0.0:1.0:0.0	rs1403626;rs13083630;rs1403626	24;24	Q96JA1-2;Q96JA1	.;LRIG1_HUMAN	V	24	ENSP00000273261:L24V;ENSP00000373208:L24V	ENSP00000273261:L24V	L	-	1	0	LRIG1	66633452	.	.	0.546000	0.28166	0.017000	0.09413	.	.	1.734000	0.51633	0.472000	0.43445	CTT	G|0.252;C|0.748		0.766	LRIG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351930.1	NM_015541	
EFCC1	79825	hgsc.bcm.edu	37	3	128720487	128720487	+	Missense_Mutation	SNP	A	A	G	rs1871951	byFrequency	TCGA-PK-A5H9-01A-11D-A29I-10	TCGA-PK-A5H9-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	cb1f20fc-0df5-42f5-91b8-624bee1a532a	4fa707a6-752b-4fda-9bc0-b07c80cf65c1	g.chr3:128720487A>G	ENST00000480450.1	+	1	16	c.16A>G	c.(16-18)Acg>Gcg	p.T6A	KIAA1257_ENST00000510149.1_Intron|EFCC1_ENST00000436022.2_5'UTR			Q9HA90	EFCC1_HUMAN	EF-hand and coiled-coil domain containing 1	6							calcium ion binding (GO:0005509)										GCCGGTCAGCACGGGCGCGGA	0.756													G|||	3483	0.695487	0.9592	0.6052	5008	,	,		11644	0.6677		0.5915	False		,,,				2504	0.5389				p.T6A		.											.	.	0			c.A16G						.						2.0	4.0	3.0					3																	128720487		494	1283	1777	SO:0001583	missense	79825	exon1			GTCAGCACGGGCG	AK022119	CCDS3054.1, CCDS3054.2	3q21.3	2013-01-11	2013-01-11	2013-01-11	ENSG00000114654	ENSG00000114654		"""EF-hand domain containing"""	25692	protein-coding gene	gene with protein product			"""chromosome 3 open reading frame 73"", ""coiled-coil domain containing 48"""	C3orf73, CCDC48			Standard	NM_024768		Approved	FLJ12057	uc011bkt.2	Q9HA90	OTTHUMG00000158996	ENST00000480450.1:c.16A>G	3.37:g.128720487A>G	ENSP00000420075:p.Thr6Ala	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	5	5	NM_024768	0	0	0	0	0	A8MYE2	Missense_Mutation	SNP	ENST00000480450.1	37	CCDS3054.2	1498	0.6858974358974359	465	0.9451219512195121	229	0.6325966850828729	362	0.6328671328671329	442	0.58311345646438	g	0.361	-0.939497	0.02322	.	.	ENSG00000114654	ENST00000480450	T	0.41400	1.0	2.78	-3.05	0.05396	.	.	.	.	.	T	0.00012	0.0000	N	0.08118	0	0.58432	P	6.999999999979245E-6	B	0.02656	0.0	B	0.01281	0.0	T	0.37407	-0.9707	8	0.02654	T	1	.	3.5784	0.07943	0.1405:0.2998:0.4439:0.1159	rs1871951	6	Q9HA90	CCD48_HUMAN	A	6	ENSP00000420075:T6A	ENSP00000420075:T6A	T	+	1	0	CCDC48	130203177	0.000000	0.05858	0.000000	0.03702	0.007000	0.05969	-1.263000	0.02850	-0.802000	0.04421	-0.701000	0.03672	ACG	A|0.315;G|0.685		0.756	EFCC1-001	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000352832.1	NM_024768	
PRR23C	389152	hgsc.bcm.edu	37	3	138763343	138763343	+	Silent	SNP	T	T	G	rs6804898	byFrequency	TCGA-PK-A5H9-01A-11D-A29I-10	TCGA-PK-A5H9-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	cb1f20fc-0df5-42f5-91b8-624bee1a532a	4fa707a6-752b-4fda-9bc0-b07c80cf65c1	g.chr3:138763343T>G	ENST00000413199.1	-	1	391	c.120A>C	c.(118-120)cgA>cgC	p.R40R	MRPS22_ENST00000495075.1_Intron|PRR23C_ENST00000502927.2_Silent_p.R40R	NM_001134657.1	NP_001128129.1	Q6ZRP0	PR23C_HUMAN	proline rich 23C	40										breast(2)|lung(7)|skin(2)	11						TGGGCGCCGCTCGGGATTCGG	0.761													G|||	852	0.170128	0.1301	0.2651	5008	,	,		10616	0.2718		0.0845	False		,,,				2504	0.1401				p.R40R		.											.	PRR23C-23	0			c.A120C						.						3.0	5.0	4.0					3																	138763343		573	1394	1967	SO:0001819	synonymous_variant	389152	exon1			CGCCGCTCGGGAT		CCDS46924.1	3q22.3	2014-06-03				ENSG00000233701			37173	protein-coding gene	gene with protein product							Standard	NM_001134657		Approved	FLJ46210	uc011bmt.1	Q6ZRP0		ENST00000413199.1:c.120A>C	3.37:g.138763343T>G		Somatic	1	0		WXS	Illumina GAIIx	Phase_I	32	11	NM_001134657	0	0	0	0	0		Silent	SNP	ENST00000413199.1	37	CCDS46924.1																																																																																			T|0.848;G|0.152		0.761	PRR23C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000361502.1	NM_001134657	
IDUA	3425	bcgsc.ca	37	4	994414	994414	+	Missense_Mutation	SNP	G	G	A	rs3755955	byFrequency	TCGA-PK-A5H9-01A-11D-A29I-10	TCGA-PK-A5H9-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	cb1f20fc-0df5-42f5-91b8-624bee1a532a	4fa707a6-752b-4fda-9bc0-b07c80cf65c1	g.chr4:994414G>A	ENST00000247933.4	+	3	402	c.314G>A	c.(313-315)cGg>cAg	p.R105Q	IDUA_ENST00000453894.1_Missense_Mutation_p.R58Q|IDUA_ENST00000514224.1_5'UTR	NM_000203.3	NP_000194.2	P35475	IDUA_HUMAN	iduronidase, alpha-L-	105			R -> Q (in dbSNP:rs3755955). {ECO:0000269|PubMed:15300847, ECO:0000269|PubMed:21394825}.		carbohydrate metabolic process (GO:0005975)|cell morphogenesis (GO:0000902)|chemical homeostasis (GO:0048878)|chondroitin sulfate catabolic process (GO:0030207)|chondroitin sulfate metabolic process (GO:0030204)|dermatan sulfate catabolic process (GO:0030209)|disaccharide metabolic process (GO:0005984)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|limb morphogenesis (GO:0035108)|lysosome organization (GO:0007040)|skeletal system morphogenesis (GO:0048705)|small molecule metabolic process (GO:0044281)	coated vesicle (GO:0030135)|extracellular vesicular exosome (GO:0070062)|lysosomal lumen (GO:0043202)	L-iduronidase activity (GO:0003940)			breast(1)|endometrium(3)|kidney(1)|large_intestine(1)|lung(5)|upper_aerodigestive_tract(1)	12			OV - Ovarian serous cystadenocarcinoma(23;0.0158)			TCCACTGGACGGGGCCTGAGC	0.647													G|||	845	0.16873	0.1271	0.0908	5008	,	,		16643	0.2073		0.167	False		,,,				2504	0.2423				p.R105Q		.											.	IDUA-91	0			c.G314A						.	G	GLN/ARG	473,3931	221.7+/-238.7	27,419,1756	72.0	66.0	68.0		314	1.5	0.0	4	dbSNP_107	68	1376,7222	266.8+/-286.9	113,1150,3036	yes	missense	IDUA	NM_000203.3	43	140,1569,4792	AA,AG,GG	http://www.ncbi.nlm.nih.gov/pubmed?term	16.0037,10.7402,14.2209	benign	105/654	994414	1849,11153	2202	4299	6501	SO:0001583	missense	3425	exon3			CTGGACGGGGCCT	M74715	CCDS3343.1	4p16.3	2012-10-02			ENSG00000127415	ENSG00000127415	3.2.1.76		5391	protein-coding gene	gene with protein product		252800				1832239	Standard	NM_000203		Approved	MPS1	uc003gby.3	P35475	OTTHUMG00000088901	ENST00000247933.4:c.314G>A	4.37:g.994414G>A	ENSP00000247933:p.Arg105Gln	Somatic	261	1		WXS	Illumina GAIIx	Phase_I	216	7	NM_000203	0	0	28	28	0	B3KWK6	Missense_Mutation	SNP	ENST00000247933.4	37	CCDS3343.1	328|328	0.15018315018315018|0.15018315018315018	56|56	0.11382113821138211|0.11382113821138211	33|33	0.09116022099447514|0.09116022099447514	114|114	0.1993006993006993|0.1993006993006993	125|125	0.16490765171503957|0.16490765171503957	G|G	4.542|4.542	0.100603|0.100603	0.08731|0.08731	0.107402|0.107402	0.160037|0.160037	ENSG00000127415|ENSG00000127415	ENST00000504568|ENST00000247933;ENST00000453894;ENST00000502910;ENST00000514192;ENST00000509948	.|D;D;D;D;D	.|0.92299	.|-3.01;-3.01;-3.01;-3.01;-3.01	4.97|4.97	1.53|1.53	0.23141|0.23141	.|Glycoside hydrolase, subgroup, catalytic domain (1);Glycoside hydrolase, superfamily (1);	.|0.771606	.|0.12090	.|N	.|0.500501	T|T	0.00210|0.00210	0.0006|0.0006	N|N	0.01482|0.01482	-0.84|-0.84	0.80722|0.80722	P|P	0.0|0.0	.|B;B	.|0.10296	.|0.002;0.003	.|B;B	.|0.06405	.|0.001;0.002	T|T	0.14783|0.14783	-1.0460|-1.0460	4|9	.|0.08599	.|T	.|0.76	-26.7134|-26.7134	3.6885|3.6885	0.08338|0.08338	0.3914:0.0:0.4299:0.1786|0.3914:0.0:0.4299:0.1786	rs3755955;rs57374078;rs3755955|rs3755955;rs57374078;rs3755955	.|58;105	.|B3KWK6;P35475	.|.;IDUA_HUMAN	R|Q	92|105;58;58;44;36	.|ENSP00000247933:R105Q;ENSP00000396458:R58Q;ENSP00000422952:R58Q;ENSP00000423685:R44Q;ENSP00000424227:R36Q	.|ENSP00000247933:R105Q	G|R	+|+	1|2	0|0	IDUA|IDUA	984414|984414	0.001000|0.001000	0.12720|0.12720	0.001000|0.001000	0.08648|0.08648	0.001000|0.001000	0.01503|0.01503	0.012000|0.012000	0.13287|0.13287	-0.017000|-0.017000	0.14103|0.14103	-1.326000|-1.326000	0.01283|0.01283	GGG|CGG	G|0.859;A|0.141		0.647	IDUA-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000201812.1	NM_000203	
RBM47	54502	hgsc.bcm.edu	37	4	40440854	40440854	+	Silent	SNP	G	G	C	rs1052153	byFrequency	TCGA-PK-A5H9-01A-11D-A29I-10	TCGA-PK-A5H9-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	cb1f20fc-0df5-42f5-91b8-624bee1a532a	4fa707a6-752b-4fda-9bc0-b07c80cf65c1	g.chr4:40440854G>C	ENST00000381793.2	-	3	453	c.57C>G	c.(55-57)tcC>tcG	p.S19S	RBM47_ENST00000514014.1_Intron|RBM47_ENST00000381795.6_Silent_p.S19S|RBM47_ENST00000295971.7_Silent_p.S19S|RBM47_ENST00000319592.4_Silent_p.S19S|RBM47_ENST00000515809.1_Intron			A0AV96	RBM47_HUMAN	RNA binding motif protein 47	19					hematopoietic progenitor cell differentiation (GO:0002244)	nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			breast(5)|endometrium(1)|kidney(3)|large_intestine(2)|lung(9)|ovary(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(1)	29						GCACCTTGGCGGAGGACCCGG	0.662													C|||	4016	0.801917	0.6808	0.8588	5008	,	,		14653	0.7679		0.8837	False		,,,				2504	0.8763				p.S19S		.											.	RBM47-25	0			c.C57G						.	C	,	3111,1133		1151,809,162	8.0	9.0	9.0		57,57	-7.6	0.0	4	dbSNP_86	9	7487,919		3358,771,74	no	coding-synonymous,coding-synonymous	RBM47	NM_001098634.1,NM_019027.3	,	4509,1580,236	CC,CG,GG		10.9327,26.6965,16.2213	,	19/594,19/525	40440854	10598,2052	2122	4203	6325	SO:0001819	synonymous_variant	54502	exon4			CTTGGCGGAGGAC	AK000280	CCDS3460.1, CCDS43223.1	4p14	2013-02-12			ENSG00000163694	ENSG00000163694		"""RNA binding motif (RRM) containing"""	30358	protein-coding gene	gene with protein product							Standard	NM_019027		Approved	FLJ20273, NET18	uc003gvc.2	A0AV96	OTTHUMG00000128598	ENST00000381793.2:c.57C>G	4.37:g.40440854G>C		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	12	12	NM_001098634	0	0	0	41	41	A0PJK2|B5MED4|Q8NI52|Q8NI53|Q9NXG3	Silent	SNP	ENST00000381793.2	37	CCDS43223.1																																																																																			G|0.794;C|0.206		0.662	RBM47-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250456.2	NM_019027	
ZAR1	326340	hgsc.bcm.edu	37	4	48492769	48492769	+	Missense_Mutation	SNP	A	A	T	rs74929644	byFrequency	TCGA-PK-A5H9-01A-11D-A29I-10	TCGA-PK-A5H9-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	cb1f20fc-0df5-42f5-91b8-624bee1a532a	4fa707a6-752b-4fda-9bc0-b07c80cf65c1	g.chr4:48492769A>T	ENST00000327939.4	+	1	501	c.461A>T	c.(460-462)cAg>cTg	p.Q154L		NM_175619.1	NP_783318.1	Q86SH2	ZAR1_HUMAN	zygote arrest 1	154					multicellular organismal development (GO:0007275)	cytoplasm (GO:0005737)				endometrium(1)|large_intestine(4)	5						TTCTCCCAGCAGCCATCCCGT	0.781													A|||	1944	0.388179	0.171	0.572	5008	,	,		7581	0.4454		0.5089	False		,,,				2504	0.3681				p.Q154L		.											.	ZAR1-90	0			c.A461T						.	A	LEU/GLN	483,2381		61,361,1010	4.0	4.0	4.0		461	-6.2	0.0	4	dbSNP_131	4	2428,3758		540,1348,1205	no	missense	ZAR1	NM_175619.1	113	601,1709,2215	TT,TA,AA		39.2499,16.8645,32.1657	benign	154/425	48492769	2911,6139	1432	3093	4525	SO:0001583	missense	326340	exon1			CCCAGCAGCCATC	AY193890	CCDS3483.1	4p11	2014-02-20			ENSG00000182223	ENSG00000182223			20436	protein-coding gene	gene with protein product	"""zinc finger, 3CxxC-type 6"""	607520				12539046	Standard	NM_175619		Approved	Z3CXXC6	uc003gyd.3	Q86SH2	OTTHUMG00000102093	ENST00000327939.4:c.461A>T	4.37:g.48492769A>T	ENSP00000329803:p.Gln154Leu	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	8	8	NM_175619	0	0	0	0	0		Missense_Mutation	SNP	ENST00000327939.4	37	CCDS3483.1	979	0.4482600732600733	95	0.19308943089430894	212	0.585635359116022	288	0.5034965034965035	384	0.5065963060686016	A	12.09	1.834066	0.32421	0.168645	0.392499	ENSG00000182223	ENST00000327939	.	.	.	3.61	-6.17	0.02091	.	.	.	.	.	T	0.00012	0.0000	N	0.19112	0.55	0.80722	P	0.0	B	0.02656	0.0	B	0.04013	0.001	T	0.49194	-0.8965	7	0.25751	T	0.34	.	0.9878	0.01450	0.443:0.2168:0.1793:0.1609	.	154	Q86SH2	ZAR1_HUMAN	L	154	.	ENSP00000329803:Q154L	Q	+	2	0	ZAR1	48187526	0.000000	0.05858	0.002000	0.10522	0.003000	0.03518	-0.738000	0.04871	-0.489000	0.06716	-0.680000	0.03767	CAG	A|0.552;T|0.448		0.781	ZAR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219927.3		
NMU	10874	hgsc.bcm.edu	37	4	56502307	56502307	+	Missense_Mutation	SNP	G	G	T	rs3828555	byFrequency	TCGA-PK-A5H9-01A-11D-A29I-10	TCGA-PK-A5H9-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	cb1f20fc-0df5-42f5-91b8-624bee1a532a	4fa707a6-752b-4fda-9bc0-b07c80cf65c1	g.chr4:56502307G>T	ENST00000264218.3	-	1	158	c.53C>A	c.(52-54)gCg>gAg	p.A18E	NMU_ENST00000505262.1_Missense_Mutation_p.A18E|NMU_ENST00000511469.1_Missense_Mutation_p.A18E|NMU_ENST00000507338.1_Missense_Mutation_p.A18E|NMU_ENST00000515325.1_Intron	NM_006681.2	NP_006672.1	P48645	NMU_HUMAN	neuromedin U	18					digestion (GO:0007586)|eating behavior (GO:0042755)|G-protein coupled receptor signaling pathway (GO:0007186)|gastric acid secretion (GO:0001696)|neuropeptide signaling pathway (GO:0007218)|photoperiodism (GO:0009648)|positive regulation of hormone secretion (GO:0046887)|positive regulation of smooth muscle contraction (GO:0045987)|positive regulation of synaptic transmission (GO:0050806)|regulation of smooth muscle contraction (GO:0006940)|sensory perception of pain (GO:0019233)|signal transduction (GO:0007165)	extracellular region (GO:0005576)|terminal bouton (GO:0043195)	receptor binding (GO:0005102)			lung(3)|ovary(1)|urinary_tract(1)	5	Lung NSC(11;0.00256)|all_epithelial(27;0.075)|Glioma(25;0.08)|all_neural(26;0.101)	all_hematologic(202;0.103)	LUSC - Lung squamous cell carcinoma(4;6.72e-08)|Lung(4;6.22e-07)|Epithelial(7;0.00559)	LUSC - Lung squamous cell carcinoma(721;0.0115)		cGGGGACGCCGCGGCCACCTG	0.761													G|||	730	0.145767	0.0764	0.2003	5008	,	,		10197	0.3343		0.0199	False		,,,				2504	0.136				p.A18E		.											.	NMU-650	0			c.C53A						.	G	GLU/ALA	168,3058		3,162,1448	5.0	7.0	6.0		53	0.1	0.0	4	dbSNP_107	6	138,5846		0,138,2854	no	missense	NMU	NM_006681.2	107	3,300,4302	TT,TG,GG		2.3061,5.2077,3.3225	probably-damaging	18/175	56502307	306,8904	1613	2992	4605	SO:0001583	missense	10874	exon1			GACGCCGCGGCCA	X76029	CCDS3501.1, CCDS75125.1	4q12	2013-02-26			ENSG00000109255	ENSG00000109255		"""Endogenous ligands"""	7859	protein-coding gene	gene with protein product	"""prepro-NMU"""	605103				7619205	Standard	XM_005265713		Approved		uc003hbc.3	P48645	OTTHUMG00000102161	ENST00000264218.3:c.53C>A	4.37:g.56502307G>T	ENSP00000264218:p.Ala18Glu	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	12	12	NM_006681	0	0	0	0	0		Missense_Mutation	SNP	ENST00000264218.3	37	CCDS3501.1	315	0.14423076923076922	55	0.11178861788617886	55	0.15193370165745856	187	0.3269230769230769	18	0.023746701846965697	G	17.40	3.379938	0.61845	0.052077	0.023061	ENSG00000109255	ENST00000511469;ENST00000264218;ENST00000505262;ENST00000541393;ENST00000507338	T;T;T;T	0.35973	1.28;1.42;1.4;1.39	2.89	0.0796	0.14417	.	1.355690	0.05554	U	0.568010	T	0.00012	0.0000	N	0.22421	0.69	0.80722	P	0.0	P	0.38827	0.649	B	0.37015	0.239	T	0.31110	-0.9955	9	0.62326	D	0.03	-4.4644	5.3309	0.15932	0.4241:0.0:0.5759:0.0	rs3828555	18	P48645	NMU_HUMAN	E	18	ENSP00000422399:A18E;ENSP00000264218:A18E;ENSP00000424246:A18E;ENSP00000422870:A18E	ENSP00000264218:A18E	A	-	2	0	NMU	56197064	0.000000	0.05858	0.003000	0.11579	0.256000	0.26092	0.190000	0.17057	-0.022000	0.13986	0.195000	0.17529	GCG	G|0.853;T|0.147		0.761	NMU-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000220006.2		
DSPP	1834	bcgsc.ca	37	4	88537270	88537270	+	Silent	SNP	C	C	T			TCGA-PK-A5H9-01A-11D-A29I-10	TCGA-PK-A5H9-10A-01D-A29L-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	cb1f20fc-0df5-42f5-91b8-624bee1a532a	4fa707a6-752b-4fda-9bc0-b07c80cf65c1	g.chr4:88537270C>T	ENST00000282478.7	+	4	3489	c.3456C>T	c.(3454-3456)gaC>gaT	p.D1152D	DSPP_ENST00000399271.1_Silent_p.D1152D|RP11-742B18.1_ENST00000506480.1_RNA			Q9NZW4	DSPP_HUMAN	dentin sialophosphoprotein	1152	Asp/Ser-rich.			D -> N (in Ref. 3; AAD16120). {ECO:0000305}.	biomineral tissue development (GO:0031214)|cellular response to cell-matrix adhesion (GO:0071460)|extracellular matrix organization (GO:0030198)|multicellular organismal development (GO:0007275)|ossification (GO:0001503)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|collagen binding (GO:0005518)|extracellular matrix structural constituent (GO:0005201)			breast(2)|central_nervous_system(1)|endometrium(9)|kidney(4)|large_intestine(8)|lung(13)|ovary(1)|skin(3)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	47		Hepatocellular(203;0.114)|all_hematologic(202;0.236)		OV - Ovarian serous cystadenocarcinoma(123;0.000508)		aaagcagcgacagcagtgaca	0.557																																					p.D1152D		.											.	DSPP-90	0			c.C3456T						.						47.0	61.0	56.0					4																	88537270		1584	2865	4449	SO:0001819	synonymous_variant	1834	exon5			CAGCGACAGCAGT	AF163151	CCDS43248.1	4q21.3	2008-02-05			ENSG00000152591	ENSG00000152591			3054	protein-coding gene	gene with protein product		125485		DFNA39, DGI1		8995371, 9533027	Standard	NM_014208		Approved	DMP3	uc003hqu.3	Q9NZW4	OTTHUMG00000161061	ENST00000282478.7:c.3456C>T	4.37:g.88537270C>T		Somatic	674	7		WXS	Illumina GAIIx	Phase_I	756	51	NM_014208	0	0	0	0	0	A8MUI0|O95815	Silent	SNP	ENST00000282478.7	37	CCDS43248.1																																																																																			.		0.557	DSPP-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000363616.3	NM_014208	
LRIT3	345193	broad.mit.edu	37	4	110772859	110772859	+	Missense_Mutation	SNP	C	C	A			TCGA-PK-A5H9-01A-11D-A29I-10	TCGA-PK-A5H9-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	cb1f20fc-0df5-42f5-91b8-624bee1a532a	4fa707a6-752b-4fda-9bc0-b07c80cf65c1	g.chr4:110772859C>A	ENST00000594814.1	+	2	316	c.316C>A	c.(316-318)Caa>Aaa	p.Q106K	LRIT3_ENST00000327908.3_5'UTR|LRIT3_ENST00000379920.3_Missense_Mutation_p.Q61K	NM_198506.3	NP_940908.3	Q3SXY7	LRIT3_HUMAN	leucine-rich repeat, immunoglobulin-like and transmembrane domains 3	106					regulation of fibroblast growth factor receptor signaling pathway (GO:0040036)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)				cervix(1)|kidney(1)|large_intestine(3)|lung(8)|prostate(2)|skin(1)	16				OV - Ovarian serous cystadenocarcinoma(123;0.0011)		CAACCTGAAGCAACTGCATGA	0.532																																					p.Q106K		.											.	LRIT3-90	0			c.C316A						.						98.0	84.0	88.0					4																	110772859		692	1591	2283	SO:0001583	missense	345193	exon2			CTGAAGCAACTGC	AK126648	CCDS3688.2, CCDS3688.3	4q25	2014-01-28	2007-06-19		ENSG00000183423	ENSG00000183423		"""Immunoglobulin superfamily / I-set domain containing"""	24783	protein-coding gene	gene with protein product	"""fibronectin type III, immunoglobulin and leucine rich repeat domains 4"""	615004					Standard	NM_198506		Approved	FLJ44691, FIGLER4, CSNB1F	uc031sgv.1	Q3SXY7	OTTHUMG00000132043	ENST00000594814.1:c.316C>A	4.37:g.110772859C>A	ENSP00000469759:p.Gln106Lys	Somatic	64	1		WXS	Illumina GAIIx	Phase_I	60	7	NM_198506	0	0	0	0	0	C9J1C2|Q6ZTG1	Missense_Mutation	SNP	ENST00000594814.1	37	CCDS3688.3	.	.	.	.	.	.	.	.	.	.	C	7.573	0.667179	0.14710	.	.	ENSG00000183423	ENST00000379920	T	0.55413	0.52	6.17	5.32	0.75619	.	.	.	.	.	T	0.32041	0.0816	N	0.03999	-0.3	0.80722	D	1	B	0.27932	0.194	B	0.27076	0.076	T	0.13764	-1.0497	9	0.15499	T	0.54	.	17.4526	0.87596	0.0:0.8757:0.1243:0.0	.	61	Q3SXY7	LRIT3_HUMAN	K	61	ENSP00000369252:Q61K	ENSP00000369252:Q61K	Q	+	1	0	LRIT3	110992308	0.996000	0.38824	0.106000	0.21319	0.953000	0.61014	2.447000	0.44917	1.587000	0.49959	0.655000	0.94253	CAA	.		0.532	LRIT3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335270.2	NM_198506	
FAT4	79633	ucsc.edu	37	4	126240510	126240510	+	Silent	SNP	T	T	C	rs2940779	byFrequency	TCGA-PK-A5H9-01A-11D-A29I-10	TCGA-PK-A5H9-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	cb1f20fc-0df5-42f5-91b8-624bee1a532a	4fa707a6-752b-4fda-9bc0-b07c80cf65c1	g.chr4:126240510T>C	ENST00000394329.3	+	1	2957	c.2944T>C	c.(2944-2946)Tta>Cta	p.L982L		NM_024582.4	NP_078858.4	Q6V0I7	FAT4_HUMAN	FAT atypical cadherin 4	982	Cadherin 9. {ECO:0000255|PROSITE- ProRule:PRU00043}.				branching involved in ureteric bud morphogenesis (GO:0001658)|cerebral cortex development (GO:0021987)|digestive tract development (GO:0048565)|heart morphogenesis (GO:0003007)|heterophilic cell-cell adhesion (GO:0007157)|hippo signaling (GO:0035329)|homophilic cell adhesion (GO:0007156)|inner ear receptor stereocilium organization (GO:0060122)|neurogenesis (GO:0022008)|ossification involved in bone maturation (GO:0043931)|plasma membrane organization (GO:0007009)|regulation of metanephric nephron tubule epithelial cell differentiation (GO:0072307)	apical part of cell (GO:0045177)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(6)|autonomic_ganglia(1)|breast(4)|central_nervous_system(3)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(3)|kidney(10)|large_intestine(93)|liver(3)|lung(120)|ovary(9)|pancreas(2)|prostate(21)|skin(31)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(6)	355						TAGTGTCATCTTAACAGTTTA	0.443													C|||	3611	0.721046	0.9251	0.7291	5008	,	,		20548	0.4603		0.7127	False		,,,				2504	0.7168				p.L982L		.											.	FAT4-108	0			c.T2944C						.	C		3480,428		1553,374,27	97.0	95.0	96.0		2944	0.1	0.3	4	dbSNP_101	96	5860,2426		2053,1754,336	no	coding-synonymous	FAT4	NM_024582.4		3606,2128,363	CC,CT,TT		29.2783,10.9519,23.405		982/4982	126240510	9340,2854	1954	4143	6097	SO:0001819	synonymous_variant	79633	exon1			GTCATCTTAACAG	AY356402	CCDS3732.3	4q28.1	2013-05-31	2013-05-31		ENSG00000196159	ENSG00000196159		"""Cadherins / Cadherin-related"""	23109	protein-coding gene	gene with protein product	"""cadherin-related family member 11"""	612411	"""FAT tumor suppressor homolog 4 (Drosophila)"""			15003449	Standard	NM_024582		Approved	CDHF14, FAT-J, CDHR11	uc003ifj.4	Q6V0I7	OTTHUMG00000133100	ENST00000394329.3:c.2944T>C	4.37:g.126240510T>C		Somatic	17	0		WXS	Illumina GAIIx	Phase_I	30	4	NM_024582	0	0	1	1	0	A8K5Z6|B5MDG4|Q3LIA6|Q8TCK7|Q9H5T6	Silent	SNP	ENST00000394329.3	37	CCDS3732.3																																																																																			T|0.291;C|0.709		0.443	FAT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256765.2	NM_024582	
TRIO	7204	bcgsc.ca	37	5	14397238	14397238	+	Silent	SNP	T	T	C	rs30774	byFrequency	TCGA-PK-A5H9-01A-11D-A29I-10	TCGA-PK-A5H9-10A-01D-A29L-10	T	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	cb1f20fc-0df5-42f5-91b8-624bee1a532a	4fa707a6-752b-4fda-9bc0-b07c80cf65c1	g.chr5:14397238T>C	ENST00000344204.4	+	29	4422	c.4398T>C	c.(4396-4398)gaT>gaC	p.D1466D	TRIO_ENST00000509967.2_Silent_p.D1417D|TRIO_ENST00000537187.1_Silent_p.D1466D	NM_007118.2	NP_009049.2	O75962	TRIO_HUMAN	trio Rho guanine nucleotide exchange factor	1466	DH 1. {ECO:0000255|PROSITE- ProRule:PRU00062}.				apoptotic signaling pathway (GO:0097190)|axon guidance (GO:0007411)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|transmembrane receptor protein tyrosine phosphatase signaling pathway (GO:0007185)	cytosol (GO:0005829)	ATP binding (GO:0005524)|guanyl-nucleotide exchange factor activity (GO:0005085)|protein serine/threonine kinase activity (GO:0004674)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			NS(2)|breast(6)|central_nervous_system(4)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(21)|lung(34)|ovary(4)|prostate(2)|skin(11)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(4)	118	Lung NSC(4;0.000742)					GAGCCAATGATGCCATGCACC	0.498													C|||	1970	0.393371	0.6974	0.3761	5008	,	,		19858	0.0982		0.334	False		,,,				2504	0.3599				p.D1466D		.											.	TRIO-562	0			c.T4398C						.	C		2842,1564	475.7+/-357.4	918,1006,279	97.0	87.0	90.0		4398	-7.6	0.2	5	dbSNP_76	90	2907,5691	654.6+/-401.2	511,1885,1903	no	coding-synonymous	TRIO	NM_007118.2		1429,2891,2182	CC,CT,TT		33.8102,35.497,44.2095		1466/3098	14397238	5749,7255	2203	4299	6502	SO:0001819	synonymous_variant	7204	exon29			CAATGATGCCATG	AF091395	CCDS3883.1	5p14-p15.1	2013-01-11	2012-07-12		ENSG00000038382	ENSG00000038382		"""Rho guanine nucleotide exchange factors"", ""Immunoglobulin superfamily / I-set domain containing"""	12303	protein-coding gene	gene with protein product		601893	"""triple functional domain (PTPRF interacting)"""			8643598	Standard	NM_007118		Approved	ARHGEF23	uc003jff.3	O75962	OTTHUMG00000131057	ENST00000344204.4:c.4398T>C	5.37:g.14397238T>C		Somatic	96	1		WXS	Illumina GAIIx	Phase_I	109	5	NM_007118	0	0	13	13	0	D3DTD1|Q13458|Q59EQ7|Q6PJC9|Q6ZN05|Q8IWK8	Silent	SNP	ENST00000344204.4	37	CCDS3883.1																																																																																			T|0.590;C|0.410		0.498	TRIO-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253711.2	NM_007118	
RGMB	285704	hgsc.bcm.edu	37	5	98109828	98109828	+	Silent	SNP	G	G	A	rs2547973	byFrequency	TCGA-PK-A5H9-01A-11D-A29I-10	TCGA-PK-A5H9-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	cb1f20fc-0df5-42f5-91b8-624bee1a532a	4fa707a6-752b-4fda-9bc0-b07c80cf65c1	g.chr5:98109828G>A	ENST00000513185.1	+	1	490	c.54G>A	c.(52-54)gaG>gaA	p.E18E	RGMB_ENST00000308234.7_Silent_p.E59E|RGMB-AS1_ENST00000505362.1_RNA|RGMB-AS1_ENST00000515003.1_RNA|RGMB-AS1_ENST00000501938.2_RNA|RGMB-AS1_ENST00000505677.1_RNA|RGMB_ENST00000504776.1_3'UTR|RGMB-AS1_ENST00000498871.2_RNA			Q6NW40	RGMB_HUMAN	repulsive guidance molecule family member b	18					axon guidance (GO:0007411)|BMP signaling pathway (GO:0030509)|cell adhesion (GO:0007155)|positive regulation of transcription, DNA-templated (GO:0045893)|signal transduction (GO:0007165)	anchored component of plasma membrane (GO:0046658)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)	identical protein binding (GO:0042802)			haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(2)|upper_aerodigestive_tract(1)	10		all_cancers(142;2.76e-08)|all_epithelial(76;2.98e-11)|all_lung(232;0.000485)|Lung NSC(167;0.000693)|Prostate(80;0.000986)|Ovarian(225;0.024)|Colorectal(57;0.117)		COAD - Colon adenocarcinoma(37;0.0587)		ccgaggttgagcagcgccgca	0.756													G|||	1477	0.294928	0.1672	0.2824	5008	,	,		8223	0.2956		0.3012	False		,,,				2504	0.4693				p.E59E		.											.	.	0			c.G177A						.						1.0	1.0	1.0					5																	98109828		405	1009	1414	SO:0001819	synonymous_variant	285704	exon3			GGTTGAGCAGCGC	AK074887	CCDS47251.1	5q21.1	2013-11-06	2013-11-06		ENSG00000174136	ENSG00000174136			26896	protein-coding gene	gene with protein product		612687	"""RGM domain family, member B"""			19324014	Standard	NM_001012761		Approved	FLJ90406, DRAGON	uc003knc.3	Q6NW40	OTTHUMG00000162745	ENST00000513185.1:c.54G>A	5.37:g.98109828G>A		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	12	10	NM_001012761	0	0	0	0	0	D6R9A0|Q8NC92	Silent	SNP	ENST00000513185.1	37																																																																																				G|0.735;A|0.265		0.756	RGMB-003	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000370308.1	NM_173670	
PCDHA2	56146	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	5	140174742	140174742	+	Missense_Mutation	SNP	C	C	T			TCGA-PK-A5H9-01A-11D-A29I-10	TCGA-PK-A5H9-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	cb1f20fc-0df5-42f5-91b8-624bee1a532a	4fa707a6-752b-4fda-9bc0-b07c80cf65c1	g.chr5:140174742C>T	ENST00000526136.1	+	1	193	c.193C>T	c.(193-195)Cgg>Tgg	p.R65W	PCDHA1_ENST00000394633.3_Intron|PCDHA2_ENST00000378132.1_Missense_Mutation_p.R65W|PCDHA2_ENST00000520672.2_Missense_Mutation_p.R65W|PCDHA1_ENST00000504120.2_Intron	NM_018905.2	NP_061728.1	Q9Y5H9	PCDA2_HUMAN	protocadherin alpha 2	65	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			NS(1)|breast(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(16)|lung(26)|ovary(4)|prostate(6)|skin(2)|upper_aerodigestive_tract(1)	71			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GCGCCTGTTCCGGGTGGCGTC	0.637																																					p.R65W		.											.	PCDHA2-94	0			c.C193T						.						52.0	63.0	59.0					5																	140174742		2197	4291	6488	SO:0001583	missense	56146	exon1			CTGTTCCGGGTGG	AF152480	CCDS54914.1, CCDS64269.1	5q31	2010-11-26				ENSG00000204969		"""Cadherins / Protocadherins : Clustered"""	8668	other	complex locus constituent	"""KIAA0345-like 12"""	606308				10380929	Standard	NM_018905		Approved			Q9Y5H9		ENST00000526136.1:c.193C>T	5.37:g.140174742C>T	ENSP00000431748:p.Arg65Trp	Somatic	56	0		WXS	Illumina GAIIx	Phase_I	67	5	NM_031495	0	0	1	1	0	O75287|Q9BTV3	Missense_Mutation	SNP	ENST00000526136.1	37	CCDS54914.1	.	.	.	.	.	.	.	.	.	.	c	17.56	3.419373	0.62622	.	.	ENSG00000204969	ENST00000520672;ENST00000378132;ENST00000526136	T;T;T	0.38887	1.11;1.11;1.11	3.66	2.74	0.32292	Cadherin, N-terminal (1);Cadherin (3);Cadherin-like (1);	0.000000	0.36268	U	0.002685	T	0.76300	0.3968	H	0.99336	4.52	0.28259	N	0.924904	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.81914	0.994;0.995;0.994	T	0.74188	-0.3746	10	0.87932	D	0	.	10.5125	0.44870	0.3651:0.6349:0.0:0.0	.	65;65;65	Q9Y5H9-3;Q9Y5H9;Q9Y5H9-2	.;PCDA2_HUMAN;.	W	65	ENSP00000430584:R65W;ENSP00000367372:R65W;ENSP00000431748:R65W	ENSP00000367372:R65W	R	+	1	2	PCDHA2	140154926	0.856000	0.29760	1.000000	0.80357	0.987000	0.75469	1.534000	0.36051	0.822000	0.34565	0.644000	0.83932	CGG	.		0.637	PCDHA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372877.3	NM_018905	
PCDHA9	9752	bcgsc.ca	37	5	140228164	140228164	+	Missense_Mutation	SNP	C	C	A	rs251353	byFrequency	TCGA-PK-A5H9-01A-11D-A29I-10	TCGA-PK-A5H9-10A-01D-A29L-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	cb1f20fc-0df5-42f5-91b8-624bee1a532a	4fa707a6-752b-4fda-9bc0-b07c80cf65c1	g.chr5:140228164C>A	ENST00000532602.1	+	1	1117	c.84C>A	c.(82-84)agC>agA	p.S28R	PCDHA1_ENST00000394633.3_Intron|PCDHA4_ENST00000530339.1_Intron|PCDHA9_ENST00000378122.3_Missense_Mutation_p.S28R|PCDHA5_ENST00000529619.1_Intron|PCDHA5_ENST00000529859.1_Intron|PCDHA3_ENST00000522353.2_Intron|PCDHA8_ENST00000531613.1_Intron|PCDHA6_ENST00000527624.1_Intron|PCDHA7_ENST00000525929.1_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHA6_ENST00000529310.1_Intron|PCDHA4_ENST00000512229.2_Intron	NM_031857.1	NP_114063.1	Q9Y5H5	PCDA9_HUMAN	protocadherin alpha 9	28			S -> R (in dbSNP:rs251353).		homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(1)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(17)|lung(18)|ovary(4)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	59			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TGGTGGGGAGCGGCCAGCTCC	0.612													.|||	2256	0.450479	0.2398	0.4496	5008	,	,		14896	0.4554		0.5109	False		,,,				2504	0.6687				p.S28R	Melanoma(55;1800 1972 14909)	.											.	PCDHA9-138	0			c.C84A						.	C	ARG/SER,,,,,,,,,,,ARG/SER	1153,3241		198,757,1242	63.0	64.0	64.0		84,,,,,,,,,,,84	2.9	0.9	5	dbSNP_79	64	4581,3957		1407,1767,1095	yes	missense,intron,intron,intron,intron,intron,intron,intron,intron,intron,intron,missense	PCDHA9,PCDHA8,PCDHA7,PCDHA6,PCDHA5,PCDHA4,PCDHA3,PCDHA2,PCDHA1	NM_014005.3,NM_018900.2,NM_018905.2,NM_018906.2,NM_018907.2,NM_018908.2,NM_018909.2,NM_018910.2,NM_018911.2,NM_031411.1,NM_031849.1,NM_031857.1	110,,,,,,,,,,,110	1605,2524,2337	AA,AC,CC		46.3457,26.2403,44.3396	,,,,,,,,,,,	28/843,,,,,,,,,,,28/951	140228164	5734,7198	2197	4269	6466	SO:0001583	missense	9752	exon1			GGGGAGCGGCCAG	AF152487	CCDS54920.1	5q31	2010-11-26				ENSG00000204961		"""Cadherins / Protocadherins : Clustered"""	8675	other	complex locus constituent	"""KIAA0345-like 5"""	606315				10380929	Standard	NM_031857		Approved	KIAA0345, PCDH-ALPHA9		Q9Y5H5		ENST00000532602.1:c.84C>A	5.37:g.140228164C>A	ENSP00000436042:p.Ser28Arg	Somatic	212	0		WXS	Illumina GAIIx	Phase_I	229	7	NM_031857	0	0	0	0	0	O15053|Q2M3S5	Missense_Mutation	SNP	ENST00000532602.1	37	CCDS54920.1	974	0.445970695970696	132	0.2682926829268293	194	0.5359116022099447	265	0.4632867132867133	383	0.5052770448548812	C	9.854	1.194548	0.22037	0.262403	0.536543	ENSG00000204961	ENST00000532602;ENST00000378122	T;T	0.53206	0.68;0.63	3.73	2.86	0.33363	Cadherin (1);Cadherin-like (1);	.	.	.	.	T	0.00012	0.0000	M	0.85462	2.755	0.49687	P	1.8499999999999073E-4	B;B	0.13594	0.006;0.008	B;B	0.14023	0.009;0.01	T	0.37079	-0.9721	8	0.49607	T	0.09	.	8.1612	0.31201	0.0:0.8136:0.0:0.1864	rs251353;rs17844320;rs56888738	28;28	Q9Y5H5;Q9Y5H5-2	PCDA9_HUMAN;.	R	28	ENSP00000436042:S28R;ENSP00000367362:S28R	ENSP00000367362:S28R	S	+	3	2	PCDHA9	140208348	0.460000	0.25776	0.907000	0.35723	0.134000	0.20937	0.177000	0.16801	0.889000	0.36185	0.591000	0.81541	AGC	C|0.554;A|0.446		0.612	PCDHA9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372896.2	NM_031857	
PCDHB10	56126	hgsc.bcm.edu;mdanderson.org	37	5	140573844	140573844	+	Silent	SNP	C	C	T			TCGA-PK-A5H9-01A-11D-A29I-10	TCGA-PK-A5H9-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	cb1f20fc-0df5-42f5-91b8-624bee1a532a	4fa707a6-752b-4fda-9bc0-b07c80cf65c1	g.chr5:140573844C>T	ENST00000239446.4	+	1	1903	c.1719C>T	c.(1717-1719)acC>acT	p.T573T		NM_018930.3	NP_061753.1	Q9UN67	PCDBA_HUMAN	protocadherin beta 10	573	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|homophilic cell adhesion (GO:0007156)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(14)|lung(30)|ovary(4)|prostate(5)|skin(3)|upper_aerodigestive_tract(4)|urinary_tract(2)	76			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			CGCCCTGCACCGAGCTGGTGC	0.711																																					p.T573T		.											.	PCDHB10-92	0			c.C1719T						.						7.0	10.0	9.0					5																	140573844		1626	3527	5153	SO:0001819	synonymous_variant	56126	exon1			CTGCACCGAGCTG	AF152489	CCDS4252.1	5q31.3	2010-06-15			ENSG00000120324	ENSG00000120324		"""Cadherins / Protocadherins : Clustered"""	8681	other	protocadherin		606336				10380929	Standard	NM_018930		Approved		uc003lix.3	Q9UN67	OTTHUMG00000129626	ENST00000239446.4:c.1719C>T	5.37:g.140573844C>T		Somatic	11	0		WXS	Illumina GAIIx	Phase_I	202	49	NM_018930	0	0	17	17	0	Q96T99	Silent	SNP	ENST00000239446.4	37	CCDS4252.1																																																																																			.		0.711	PCDHB10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251821.1	NM_018930	
ARL10	285598	hgsc.bcm.edu	37	5	175792605	175792605	+	Silent	SNP	G	G	C	rs2303667	byFrequency	TCGA-PK-A5H9-01A-11D-A29I-10	TCGA-PK-A5H9-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	cb1f20fc-0df5-42f5-91b8-624bee1a532a	4fa707a6-752b-4fda-9bc0-b07c80cf65c1	g.chr5:175792605G>C	ENST00000310389.5	+	1	135	c.39G>C	c.(37-39)ctG>ctC	p.L13L	MIR1271_ENST00000408537.1_RNA	NM_173664.4	NP_775935.1	Q8N8L6	ARL10_HUMAN	ADP-ribosylation factor-like 10	13					small GTPase mediated signal transduction (GO:0007264)	intracellular (GO:0005622)	GTP binding (GO:0005525)			endometrium(2)|lung(1)|ovary(1)	4	all_cancers(89;0.0064)|Renal(175;0.000269)|Lung NSC(126;0.0105)|all_lung(126;0.0168)	Medulloblastoma(196;0.0208)|all_neural(177;0.0416)|all_hematologic(541;0.214)	Kidney(164;3.85e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	Kidney(146;0.0965)		TGCTGGCGCTGGGCGGCGCCG	0.756													G|||	2787	0.55651	0.5938	0.4928	5008	,	,		9772	0.5556		0.6093	False		,,,				2504	0.498				p.L13L		.											.	ARL10-91	0			c.G39C						.	G		1858,1528		603,652,438	3.0	4.0	3.0		39	3.2	0.8	5	dbSNP_100	3	4085,2705		1416,1253,726	no	coding-synonymous	ARL10	NM_173664.4		2019,1905,1164	CC,CG,GG		39.838,45.127,41.5979		13/245	175792605	5943,4233	1693	3395	5088	SO:0001819	synonymous_variant	285598	exon1			GGCGCTGGGCGGC	BK001673	CCDS4400.1	5q35.3	2014-05-09	2005-11-03	2005-11-03	ENSG00000175414	ENSG00000175414		"""ADP-ribosylation factors-like"", ""ADP-ribosylation factors"""	22042	protein-coding gene	gene with protein product			"""ADP-ribosylation factor-like 10A"""	ARL10A			Standard	NM_173664		Approved		uc003mec.1	Q8N8L6	OTTHUMG00000130655	ENST00000310389.5:c.39G>C	5.37:g.175792605G>C		Somatic	2	0		WXS	Illumina GAIIx	Phase_I	11	5	NM_173664	0	0	0	0	0		Silent	SNP	ENST00000310389.5	37	CCDS4400.1																																																																																			G|0.585;C|0.415		0.756	ARL10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253145.2	NM_173664	
CLPSL1	340204	bcgsc.ca	37	6	35748931	35748931	+	Missense_Mutation	SNP	T	T	C	rs34109614	byFrequency	TCGA-PK-A5H9-01A-11D-A29I-10	TCGA-PK-A5H9-10A-01D-A29L-10	T	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	cb1f20fc-0df5-42f5-91b8-624bee1a532a	4fa707a6-752b-4fda-9bc0-b07c80cf65c1	g.chr6:35748931T>C	ENST00000373861.5	+	1	138	c.44T>C	c.(43-45)tTc>tCc	p.F15S	CLPSL1_ENST00000542261.1_Missense_Mutation_p.F14S			A2RUU4	COLL1_HUMAN	colipase-like 1	15			F -> S (in dbSNP:rs34109614).		digestion (GO:0007586)|lipid catabolic process (GO:0016042)	extracellular region (GO:0005576)	enzyme activator activity (GO:0008047)										CTTCTCTTCTTCTTTCTCTTC	0.532													c|||	1485	0.296526	0.3351	0.2522	5008	,	,		19574	0.2917		0.2992	False		,,,				2504	0.2781				p.F15S		.											.	.	0			c.T44C						.	T	SER/PHE	1350,2706		224,902,902	161.0	176.0	171.0		44	-0.4	0.0	6	dbSNP_126	171	2676,5686		429,1818,1934	yes	missense	C6orf127	NM_001010886.3	155	653,2720,2836	CC,CT,TT		32.0019,33.284,32.4207	benign	15/122	35748931	4026,8392	2028	4181	6209	SO:0001583	missense	340204	exon1			TCTTCTTCTTTCT		CCDS43456.1	6p21.31	2014-01-28	2012-02-06	2012-02-06	ENSG00000204140	ENSG00000204140			21251	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 127"""	C6orf127			Standard	NM_001010886		Approved	dJ510O8.6	uc003old.4	A2RUU4	OTTHUMG00000014582	ENST00000373861.5:c.44T>C	6.37:g.35748931T>C	ENSP00000362968:p.Phe15Ser	Somatic	112	0		WXS	Illumina GAIIx	Phase_I	118	6	NM_001010886	0	0	0	0	0	A7E2T6|B2RPE2|B5G4V2|B6ZDM9|Q5T9G1	Missense_Mutation	SNP	ENST00000373861.5	37	CCDS43456.1	635	0.2907509157509158	173	0.3516260162601626	89	0.24585635359116023	147	0.256993006993007	226	0.29815303430079154	c	0.006	-2.049623	0.00394	0.33284	0.320019	ENSG00000204140	ENST00000373861;ENST00000373860;ENST00000542261	T;T	0.31769	1.48;1.49	1.62	-0.45	0.12223	.	1.624490	0.04724	N	0.419874	T	0.02767	0.0083	N	0.00926	-1.1	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.30966	-0.9960	9	0.48119	T	0.1	.	2.9097	0.05733	0.0:0.5052:0.2934:0.2014	rs34109614;rs58544058	15	A2RUU4	CF127_HUMAN	S	15;15;14	ENSP00000362968:F15S;ENSP00000438478:F14S	ENSP00000362967:F15S	F	+	2	0	C6orf127	35856909	0.010000	0.17322	0.000000	0.03702	0.038000	0.13279	-0.240000	0.08952	-0.170000	0.10816	-0.741000	0.03529	TTC	C|0.301;G|0.000;T|0.699		0.532	CLPSL1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000040317.2	NM_001010886	
PRIM2	5558	bcgsc.ca	37	6	57393160	57393160	+	Silent	SNP	G	G	A	rs76686926	byFrequency	TCGA-PK-A5H9-01A-11D-A29I-10	TCGA-PK-A5H9-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	cb1f20fc-0df5-42f5-91b8-624bee1a532a	4fa707a6-752b-4fda-9bc0-b07c80cf65c1	g.chr6:57393160G>A	ENST00000607273.1	+	9	897	c.810G>A	c.(808-810)aaG>aaA	p.K270K	PRIM2_ENST00000389488.2_3'UTR	NM_000947.3	NP_000938.2	P49643	PRI2_HUMAN	primase, DNA, polypeptide 2 (58kDa)	270					DNA replication initiation (GO:0006270)|DNA replication, synthesis of RNA primer (GO:0006269)|DNA strand elongation involved in DNA replication (GO:0006271)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)|telomere maintenance (GO:0000723)|telomere maintenance via recombination (GO:0000722)|telomere maintenance via semi-conservative replication (GO:0032201)	nucleoplasm (GO:0005654)|primosome complex (GO:1990077)	4 iron, 4 sulfur cluster binding (GO:0051539)|DNA binding (GO:0003677)|DNA primase activity (GO:0003896)|metal ion binding (GO:0046872)	p.K270K(2)		NS(1)|central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(7)|lung(34)|prostate(6)|stomach(4)|upper_aerodigestive_tract(1)	59				Colorectal(6;0.041)|READ - Rectum adenocarcinoma(7;0.193)		ATGTTGGGAAGATTTCTTTAG	0.284																																					.		.											.	PRIM2-227	2	Substitution - coding silent(2)	prostate(2)	.						.						93.0	86.0	88.0					6																	57393160		1829	4074	5903	SO:0001819	synonymous_variant	5558	.			TGGGAAGATTTCT		CCDS75476.1, CCDS75477.1	6p12-p11.1	2013-01-31	2007-06-19	2007-06-19	ENSG00000146143	ENSG00000146143			9370	protein-coding gene	gene with protein product		176636	"""primase, polypeptide 2A (58kD)"", ""primase, polypeptide 2A, 58kDa"""	PRIM2A		8530050, 20675616	Standard	NM_001282487		Approved		uc003pdx.3	P49643	OTTHUMG00000016190	ENST00000607273.1:c.810G>A	6.37:g.57393160G>A		Somatic	30	0		WXS	Illumina GAIIx	Phase_I	24	7	.	0	0	4	4	0	Q53FJ8|Q6P1Q7|Q8WVL2|Q9H413	RNA	SNP	ENST00000607273.1	37																																																																																				G|0.500;A|0.500		0.284	PRIM2-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_000947	
ADGB	79747	broad.mit.edu;bcgsc.ca	37	6	147106841	147106841	+	Silent	SNP	A	A	G	rs259391	byFrequency	TCGA-PK-A5H9-01A-11D-A29I-10	TCGA-PK-A5H9-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	cb1f20fc-0df5-42f5-91b8-624bee1a532a	4fa707a6-752b-4fda-9bc0-b07c80cf65c1	g.chr6:147106841A>G	ENST00000397944.3	+	32	4384	c.4308A>G	c.(4306-4308)aaA>aaG	p.K1436K	ADGB_ENST00000367493.3_Missense_Mutation_p.K711R|ADGB_ENST00000367488.1_Silent_p.K159K	NM_024694.3	NP_078970.3	Q8N7X0	ADGB_HUMAN	androglobin	1436					oxygen transport (GO:0015671)|proteolysis (GO:0006508)	cytoplasm (GO:0005737)	calcium-dependent cysteine-type endopeptidase activity (GO:0004198)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|oxygen binding (GO:0019825)			breast(1)|endometrium(2)|kidney(2)	5						CTAAACCAAAAGAAGAAGGTG	0.438													G|||	2742	0.547524	0.5522	0.6931	5008	,	,		16553	0.4067		0.5736	False		,,,				2504	0.5562				p.K1436K		.											.	.	0			c.A4308G						.	G		773,611		218,337,137	98.0	82.0	87.0		4308	-6.1	0.0	6	dbSNP_79	87	1703,1477		471,761,358	no	coding-synonymous	C6orf103	NM_024694.3		689,1098,495	GG,GA,AA		46.4465,44.1474,45.7493		1436/1668	147106841	2476,2088	692	1590	2282	SO:0001819	synonymous_variant	79747	exon32			ACCAAAAGAAGAA	AK026774		6q24.2	2012-02-03	2012-02-03	2012-02-03	ENSG00000118492	ENSG00000118492			21212	protein-coding gene	gene with protein product		614630	"""chromosome 6 open reading frame 103"""	C6orf103		22115833	Standard	NM_024694		Approved	FLJ23121, dJ408K24.1	uc010khx.3	Q8N7X0	OTTHUMG00000015758	ENST00000397944.3:c.4308A>G	6.37:g.147106841A>G		Somatic	78	0		WXS	Illumina GAIIx	Phase_I	77	4	NM_024694	0	0	0	0	0	Q5T402|Q5T904|Q5T905	Silent	SNP	ENST00000397944.3	37		1200	0.5494505494505495	283	0.5752032520325203	245	0.6767955801104972	228	0.3986013986013986	444	0.5857519788918206	G	3.481	-0.105794	0.06924	0.558526	0.535535	ENSG00000118492	ENST00000367493	.	.	.	3.6	-6.13	0.02118	.	.	.	.	.	T	0.15869	0.0382	.	.	.	0.80722	P	0.0	.	.	.	.	.	.	T	0.29336	-1.0015	4	0.87932	D	0	.	4.398	0.11372	0.5907:0.1141:0.1796:0.1155	rs259391;rs518825;rs3827634;rs17619302;rs52795579;rs60202758;rs259391	.	.	.	R	711	.	ENSP00000356463:K711R	K	+	2	0	C6orf103	147148534	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-1.146000	0.03191	-2.182000	0.00764	-2.123000	0.00347	AAG	A|0.449;G|0.551		0.438	ADGB-009	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000376350.2	NM_024694	
ZC3H12D	340152	hgsc.bcm.edu	37	6	149772180	149772180	+	Missense_Mutation	SNP	C	C	T			TCGA-PK-A5H9-01A-11D-A29I-10	TCGA-PK-A5H9-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	cb1f20fc-0df5-42f5-91b8-624bee1a532a	4fa707a6-752b-4fda-9bc0-b07c80cf65c1	g.chr6:149772180C>T	ENST00000409806.3	-	6	1541	c.1223G>A	c.(1222-1224)gGc>gAc	p.G408D	ZC3H12D_ENST00000542614.1_Silent_p.R310R|ZC3H12D_ENST00000416573.2_Silent_p.R310R|ZC3H12D_ENST00000498662.1_5'Flank|ZC3H12D_ENST00000389942.5_Missense_Mutation_p.G408D			A2A288	ZC12D_HUMAN	zinc finger CCCH-type containing 12D	408	Pro-rich. {ECO:0000255}.				negative regulation of cell growth (GO:0030308)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	endonuclease activity (GO:0004519)|metal ion binding (GO:0046872)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(1)|prostate(1)	6		Ovarian(120;0.0907)		OV - Ovarian serous cystadenocarcinoma(155;1.23e-11)|GBM - Glioblastoma multiforme(68;0.0921)		GAGCTGCAGGCCGGGCGGAGG	0.776																																					p.G408D		.											.	.	0			c.G1223A						.						3.0	5.0	5.0					6																	149772180		1712	3773	5485	SO:0001583	missense	340152	exon6			TGCAGGCCGGGCG			6q25.1	2012-07-05	2005-06-30	2005-06-30	ENSG00000178199	ENSG00000178199		"""Zinc fingers, CCCH-type domain containing"""	21175	protein-coding gene	gene with protein product	"""MCP induced protein 4"""	611106	"""chromosome 6 open reading frame 95"""	C6orf95		18178554	Standard	NM_207360		Approved	dJ281H8.1, MCPIP4	uc010kid.3	A2A288	OTTHUMG00000015786	ENST00000409806.3:c.1223G>A	6.37:g.149772180C>T	ENSP00000386616:p.Gly408Asp	Somatic	4	0		WXS	Illumina GAIIx	Phase_I	25	13	NM_207360	0	0	0	0	0	A1L178|B2RXF4|B7WNU7|B9ZZP9|B9ZZQ0|Q6ZRW2	Missense_Mutation	SNP	ENST00000409806.3	37		.	.	.	.	.	.	.	.	.	.	C	11.68	1.710303	0.30322	.	.	ENSG00000178199	ENST00000389942;ENST00000409806	T;T	0.30714	1.52;1.52	2.45	1.54	0.23209	.	.	.	.	.	T	0.06050	0.0157	N	0.22421	0.69	0.09310	N	0.999997	B	0.17465	0.022	B	0.17098	0.017	T	0.39461	-0.9613	9	0.13108	T	0.6	-8.2189	6.9831	0.24713	0.0:0.8486:0.0:0.1514	.	408	A2A288	ZC12D_HUMAN	D	408	ENSP00000374592:G408D;ENSP00000386616:G408D	ENSP00000374592:G408D	G	-	2	0	ZC3H12D	149813873	0.000000	0.05858	0.002000	0.10522	0.606000	0.37113	-0.413000	0.07123	1.337000	0.45525	0.313000	0.20887	GGC	.		0.776	ZC3H12D-003	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000286400.2	NM_207360	
LRP11	84918	hgsc.bcm.edu	37	6	150184882	150184882	+	Missense_Mutation	SNP	G	G	C	rs9322225	byFrequency	TCGA-PK-A5H9-01A-11D-A29I-10	TCGA-PK-A5H9-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	cb1f20fc-0df5-42f5-91b8-624bee1a532a	4fa707a6-752b-4fda-9bc0-b07c80cf65c1	g.chr6:150184882G>C	ENST00000239367.2	-	1	280	c.275C>G	c.(274-276)cCg>cGg	p.P92R	LRP11_ENST00000546019.1_Intron|RP11-244K5.8_ENST00000606915.1_RNA|RP11-244K5.8_ENST00000596229.1_RNA|LRP11_ENST00000367368.2_Missense_Mutation_p.P92R	NM_032832.5	NP_116221.3	Q86VZ4	LRP11_HUMAN	low density lipoprotein receptor-related protein 11	92			P -> R (in dbSNP:rs9322225). {ECO:0000269|PubMed:15489334}.			integral component of membrane (GO:0016021)				cervix(1)|kidney(5)|large_intestine(1)|lung(1)	8		Ovarian(120;0.0907)	BRCA - Breast invasive adenocarcinoma(37;0.193)	OV - Ovarian serous cystadenocarcinoma(155;4.56e-12)|GBM - Glioblastoma multiforme(68;0.225)		GCCGCTGCCCGGGCCCGGGCA	0.756													g|||	2394	0.478035	0.3071	0.5101	5008	,	,		7691	0.8224		0.4165	False		,,,				2504	0.3947				p.P92R		.											.	LRP11-90	0			c.C275G						.	G	ARG/PRO	799,1991		151,497,747	2.0	2.0	2.0		275	3.0	0.3	6	dbSNP_119	2	2072,3740		444,1184,1278	yes	missense	LRP11	NM_032832.5	103	595,1681,2025	CC,CG,GG		35.6504,28.638,33.376	possibly-damaging	92/501	150184882	2871,5731	1395	2906	4301	SO:0001583	missense	84918	exon1			CTGCCCGGGCCCG	AK027641	CCDS5220.1	6q24.3	2013-02-27			ENSG00000120256	ENSG00000120256		"""Low density lipoprotein receptors"""	16936	protein-coding gene	gene with protein product							Standard	NM_032832		Approved	bA350J20.3, MANSC3	uc003qng.2	Q86VZ4	OTTHUMG00000015801	ENST00000239367.2:c.275C>G	6.37:g.150184882G>C	ENSP00000239367:p.Pro92Arg	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	8	6	NM_032832	0	0	1	3	2	Q5VYC0|Q96SN6	Missense_Mutation	SNP	ENST00000239367.2	37	CCDS5220.1	1110	0.5082417582417582	147	0.29878048780487804	188	0.5193370165745856	465	0.8129370629370629	310	0.40897097625329815	G	12.02	1.812850	0.32053	0.28638	0.356504	ENSG00000120256	ENST00000239367;ENST00000367368	T;T	0.20463	2.07;2.07	3.91	2.96	0.34315	Seven cysteines, N-terminal (2);	1.059560	0.07539	N	0.913589	T	0.07279	0.0184	L	0.36672	1.1	0.51767	P	7.00000000000145E-5	B;B	0.25743	0.133;0.012	B;B	0.23150	0.044;0.025	T	0.19484	-1.0304	9	0.19590	T	0.45	-4.154	11.8365	0.52327	0.0:0.1787:0.8213:0.0	rs9322225;rs17846346;rs17859381	92;92	Q5VYB9;Q86VZ4	.;LRP11_HUMAN	R	92	ENSP00000239367:P92R;ENSP00000356338:P92R	ENSP00000239367:P92R	P	-	2	0	LRP11	150226575	0.132000	0.22450	0.342000	0.25602	0.428000	0.31595	0.489000	0.22387	1.900000	0.55004	0.484000	0.47621	CCG	G|0.492;C|0.508		0.756	LRP11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042664.1	NM_032832	
PRR18	285800	hgsc.bcm.edu	37	6	166720806	166720806	+	Silent	SNP	G	G	C	rs911203	byFrequency	TCGA-PK-A5H9-01A-11D-A29I-10	TCGA-PK-A5H9-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	cb1f20fc-0df5-42f5-91b8-624bee1a532a	4fa707a6-752b-4fda-9bc0-b07c80cf65c1	g.chr6:166720806G>C	ENST00000322583.3	-	1	1065	c.825C>G	c.(823-825)tcC>tcG	p.S275S		NM_175922.3	NP_787118.2	Q8N4B5	PRR18_HUMAN	proline rich 18	275										haematopoietic_and_lymphoid_tissue(2)|lung(1)	3		Breast(66;2.35e-05)|Ovarian(120;0.0606)|Prostate(117;0.0959)		OV - Ovarian serous cystadenocarcinoma(33;1.5e-19)|BRCA - Breast invasive adenocarcinoma(81;4.45e-06)|GBM - Glioblastoma multiforme(31;7.96e-05)		cggcagccgcggACTCCACGC	0.741													C|||	3992	0.797125	0.8525	0.6196	5008	,	,		7867	0.9206		0.7465	False		,,,				2504	0.773				p.S275S		.											.	PRR18-514	0			c.C825G						.	C		3541,683		1503,535,74	7.0	7.0	7.0		825	2.4	1.0	6	dbSNP_86	7	6180,2074		2355,1470,302	no	coding-synonymous	PRR18	NM_175922.3		3858,2005,376	CC,CG,GG		25.1272,16.1695,22.0949		275/296	166720806	9721,2757	2112	4127	6239	SO:0001819	synonymous_variant	285800	exon1			AGCCGCGGACTCC	BC034775	CCDS5291.1	6q27	2009-01-27	2009-01-27						28574	protein-coding gene	gene with protein product			"""proline rich region 18"""			12477932	Standard	NM_175922		Approved	MGC35308	uc003quw.1	Q8N4B5		ENST00000322583.3:c.825C>G	6.37:g.166720806G>C		Somatic	2	0		WXS	Illumina GAIIx	Phase_I	11	6	NM_175922	0	0	0	0	0		Silent	SNP	ENST00000322583.3	37	CCDS5291.1																																																																																			G|0.796;C|0.204		0.741	PRR18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000392563.3	NM_175922	
USP42	84132	hgsc.bcm.edu	37	7	6193521	6193521	+	Missense_Mutation	SNP	G	G	C	rs61729726	byFrequency	TCGA-PK-A5H9-01A-11D-A29I-10	TCGA-PK-A5H9-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	cb1f20fc-0df5-42f5-91b8-624bee1a532a	4fa707a6-752b-4fda-9bc0-b07c80cf65c1	g.chr7:6193521G>C	ENST00000306177.5	+	15	2494	c.2336G>C	c.(2335-2337)cGc>cCc	p.R779P		NM_032172.2	NP_115548.1	Q9H9J4	UBP42_HUMAN	ubiquitin specific peptidase 42	779	Pro-rich.				cell differentiation (GO:0030154)|protein deubiquitination (GO:0016579)|spermatogenesis (GO:0007283)|ubiquitin-dependent protein catabolic process (GO:0006511)		ubiquitin-specific protease activity (GO:0004843)			breast(1)|central_nervous_system(1)|endometrium(5)|kidney(4)|large_intestine(2)|lung(14)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|urinary_tract(1)	35		Ovarian(82;0.0423)		UCEC - Uterine corpus endometrioid carcinoma (126;0.108)|OV - Ovarian serous cystadenocarcinoma(56;5.77e-14)		CCGCCGCCCCGCGATCCCGGC	0.756													C|||	2895	0.578075	0.8638	0.4121	5008	,	,		10724	0.7331		0.3082	False		,,,				2504	0.4274				p.R779P		.											.	USP42-659	0			c.G2336C						.	C	PRO/ARG	2157,1125		751,655,235	4.0	6.0	5.0		2336	2.6	0.0	7	dbSNP_129	5	1843,5693		290,1263,2215	no	missense	USP42	NM_032172.2	103	1041,1918,2450	CC,CG,GG		24.4559,34.2779,36.9754	benign	779/1317	6193521	4000,6818	1641	3768	5409	SO:0001583	missense	84132	exon15			CGCCCCGCGATCC	AK022759	CCDS47535.1	7p22.2	2005-08-08	2005-08-08		ENSG00000106346	ENSG00000106346		"""Ubiquitin-specific peptidases"""	20068	protein-coding gene	gene with protein product			"""ubiquitin specific protease 42"""			12838346	Standard	NM_032172		Approved	FLJ12697	uc011jwp.2	Q9H9J4	OTTHUMG00000151888	ENST00000306177.5:c.2336G>C	7.37:g.6193521G>C	ENSP00000301962:p.Arg779Pro	Somatic	1	0		WXS	Illumina GAIIx	Phase_I	24	11	NM_032172	0	0	6	9	3	A2RUE3|B5MDA5|Q0VIN8|Q3C166|Q6P9B4	Missense_Mutation	SNP	ENST00000306177.5	37	CCDS47535.1	1188	0.5439560439560439	401	0.8150406504065041	130	0.35911602209944754	440	0.7692307692307693	217	0.2862796833773087	C	10.95	1.494372	0.26774	0.657221	0.244559	ENSG00000106346	ENST00000306177;ENST00000426246	T;T	0.14266	2.52;2.93	5.46	2.59	0.31030	.	0.841331	0.10600	N	0.655737	T	0.00012	0.0000	N	0.08118	0	0.80722	P	0.0	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.09164	-1.0687	9	0.28530	T	0.3	.	2.8136	0.05448	0.1458:0.5508:0.1414:0.162	rs61729726	779;779	Q9H9J4-2;Q9H9J4	.;UBP42_HUMAN	P	779;625	ENSP00000301962:R779P;ENSP00000408217:R625P	ENSP00000301962:R779P	R	+	2	0	USP42	6160046	0.001000	0.12720	0.000000	0.03702	0.000000	0.00434	0.469000	0.22067	0.265000	0.21872	-0.120000	0.15030	CGC	G|0.456;C|0.544		0.756	USP42-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000324262.3	XM_166526	
GLI3	2737	hgsc.bcm.edu	37	7	42005678	42005678	+	Missense_Mutation	SNP	G	G	A	rs929387	byFrequency	TCGA-PK-A5H9-01A-11D-A29I-10	TCGA-PK-A5H9-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	cb1f20fc-0df5-42f5-91b8-624bee1a532a	4fa707a6-752b-4fda-9bc0-b07c80cf65c1	g.chr7:42005678G>A	ENST00000395925.3	-	15	3077	c.2993C>T	c.(2992-2994)cCg>cTg	p.P998L	GLI3_ENST00000479210.1_5'UTR	NM_000168.5	NP_000159.3	P10071	GLI3_HUMAN	GLI family zinc finger 3	998			P -> L (in dbSNP:rs929387). {ECO:0000269|PubMed:10441342, ECO:0000269|PubMed:15489334, ECO:0000269|PubMed:2118997}.		anterior semicircular canal development (GO:0060873)|anterior/posterior pattern specification (GO:0009952)|artery development (GO:0060840)|axon guidance (GO:0007411)|branching involved in ureteric bud morphogenesis (GO:0001658)|camera-type eye morphogenesis (GO:0048593)|cell differentiation involved in kidney development (GO:0061005)|cerebral cortex radial glia guided migration (GO:0021801)|developmental growth (GO:0048589)|embryonic digestive tract development (GO:0048566)|embryonic digestive tract morphogenesis (GO:0048557)|embryonic digit morphogenesis (GO:0042733)|embryonic skeletal system morphogenesis (GO:0048704)|forebrain dorsal/ventral pattern formation (GO:0021798)|forebrain radial glial cell differentiation (GO:0021861)|frontal suture morphogenesis (GO:0060364)|heart development (GO:0007507)|hindgut morphogenesis (GO:0007442)|hippocampus development (GO:0021766)|in utero embryonic development (GO:0001701)|lambdoid suture morphogenesis (GO:0060366)|lateral ganglionic eminence cell proliferation (GO:0022018)|lateral semicircular canal development (GO:0060875)|limb morphogenesis (GO:0035108)|lung development (GO:0030324)|mammary gland specification (GO:0060594)|melanocyte differentiation (GO:0030318)|metanephros development (GO:0001656)|negative regulation of alpha-beta T cell differentiation (GO:0046639)|negative regulation of apoptotic process (GO:0043066)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell proliferation (GO:0008285)|negative regulation of neuron differentiation (GO:0045665)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative thymic T cell selection (GO:0045060)|nose morphogenesis (GO:0043585)|odontogenesis of dentin-containing tooth (GO:0042475)|oligodendrocyte differentiation (GO:0048709)|optic nerve morphogenesis (GO:0021631)|palate development (GO:0060021)|positive regulation of alpha-beta T cell differentiation (GO:0046638)|positive regulation of chondrocyte differentiation (GO:0032332)|positive regulation of neuroblast proliferation (GO:0002052)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of protein import into nucleus (GO:0042307)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein processing (GO:0016485)|proximal/distal pattern formation (GO:0009954)|response to estrogen (GO:0043627)|sagittal suture morphogenesis (GO:0060367)|smoothened signaling pathway (GO:0007224)|smoothened signaling pathway involved in dorsal/ventral neural tube patterning (GO:0060831)|smoothened signaling pathway involved in spinal cord motor neuron cell fate specification (GO:0021776)|smoothened signaling pathway involved in ventral spinal cord interneuron specification (GO:0021775)|T cell differentiation in thymus (GO:0033077)|thymocyte apoptotic process (GO:0070242)|tongue development (GO:0043586)|transcription, DNA-templated (GO:0006351)|wound healing (GO:0042060)	cilium (GO:0005929)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|primary cilium (GO:0072372)|transcriptional repressor complex (GO:0017053)	beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|histone acetyltransferase binding (GO:0035035)|histone deacetylase binding (GO:0042826)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(2)|biliary_tract(1)|breast(4)|central_nervous_system(2)|endometrium(12)|kidney(7)|large_intestine(25)|lung(49)|ovary(3)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	112						GCCGTGGCCCGGCGCATCGTG	0.746									Pallister-Hall syndrome;Greig Cephalopolysyndactyly				G|||	2111	0.421526	0.1619	0.4424	5008	,	,		11700	0.7688		0.3161	False		,,,				2504	0.5082				p.P998L		.											.	GLI3-1149	0			c.C2993T						.	G	LEU/PRO	654,2960		69,516,1222	4.0	5.0	5.0	http://www.ncbi.nlm.nih.gov/sites/varvu?gene	2993	3.8	0.2	7	dbSNP_86	5	2170,5232		331,1508,1862	no	missense	GLI3	NM_000168.5	98	400,2024,3084	AA,AG,GG		29.3164,18.0963,25.6354	benign	998/1581	42005678	2824,8192	1807	3701	5508	SO:0001583	missense	2737	exon15	Familial Cancer Database	;	TGGCCCGGCGCAT		CCDS5465.1	7p13	2013-01-25	2009-03-05		ENSG00000106571	ENSG00000106571		"""Zinc fingers, C2H2-type"""	4319	protein-coding gene	gene with protein product	"""zinc finger protein GLI3"", ""oncogene GLI3"", ""DNA-binding protein"""	165240	"""Greig cephalopolysyndactyly syndrome"", ""GLI-Kruppel family member GLI3"", ""glioma-associated oncogene family zinc finger 3"""	GCPS, PHS		2118997	Standard	NM_000168		Approved	PAP-A, PAPA, PAPA1, PAPB, ACLS, PPDIV	uc011kbh.2	P10071	OTTHUMG00000023630	ENST00000395925.3:c.2993C>T	7.37:g.42005678G>A	ENSP00000379258:p.Pro998Leu	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	14	14	NM_000168	0	0	0	2	2	A4D1W1|O75219|Q17RW4|Q75MT0|Q75MU9|Q9UDT5|Q9UJ39	Missense_Mutation	SNP	ENST00000395925.3	37	CCDS5465.1	917	0.4198717948717949	75	0.1524390243902439	153	0.42265193370165743	451	0.7884615384615384	238	0.31398416886543534	G	1.729	-0.494582	0.04322	0.180963	0.293164	ENSG00000106571	ENST00000395925	T	0.15256	2.44	4.98	3.83	0.44106	.	0.327528	0.33217	N	0.005158	T	0.00012	0.0000	N	0.05554	-0.025	0.09310	P	0.9999999999224007	B	0.06786	0.001	B	0.04013	0.001	T	0.16247	-1.0409	9	0.17369	T	0.5	.	5.4162	0.16376	0.7624:0.0:0.0842:0.1533	rs929387;rs929387	998	P10071	GLI3_HUMAN	L	998	ENSP00000379258:P998L	ENSP00000379258:P998L	P	-	2	0	GLI3	41972203	1.000000	0.71417	0.171000	0.22900	0.021000	0.10359	4.758000	0.62220	0.733000	0.32492	-0.471000	0.05019	CCG	G|0.565;A|0.435		0.746	GLI3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250806.3	NM_000168	
MUC17	140453	hgsc.bcm.edu	37	7	100677145	100677145	+	Silent	SNP	A	A	G			TCGA-PK-A5H9-01A-11D-A29I-10	TCGA-PK-A5H9-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	cb1f20fc-0df5-42f5-91b8-624bee1a532a	4fa707a6-752b-4fda-9bc0-b07c80cf65c1	g.chr7:100677145A>G	ENST00000306151.4	+	3	2512	c.2448A>G	c.(2446-2448)acA>acG	p.T816T		NM_001040105.1	NP_001035194.1	Q685J3	MUC17_HUMAN	mucin 17, cell surface associated	816	59 X approximate tandem repeats.|Ser-rich.				cellular homeostasis (GO:0019725)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	apical plasma membrane (GO:0016324)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)	extracellular matrix constituent, lubricant activity (GO:0030197)|PDZ domain binding (GO:0030165)			NS(3)|breast(14)|central_nervous_system(2)|cervix(2)|endometrium(27)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(28)|lung(179)|ovary(19)|pancreas(1)|prostate(13)|skin(26)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(4)	343	Lung NSC(181;0.136)|all_lung(186;0.182)					TCAGCATCACACCGGTGACCA	0.483																																					p.T816T		.											.	MUC17-95	0			c.A2448G						.						284.0	290.0	288.0					7																	100677145		2203	4300	6503	SO:0001819	synonymous_variant	140453	exon3			CATCACACCGGTG	AJ606307	CCDS34711.1	7q22	2007-01-17	2006-03-14		ENSG00000169876	ENSG00000169876		"""Mucins"""	16800	protein-coding gene	gene with protein product		608424				11855812	Standard	NM_001040105		Approved		uc003uxp.1	Q685J3	OTTHUMG00000157030	ENST00000306151.4:c.2448A>G	7.37:g.100677145A>G		Somatic	131	0		WXS	Illumina GAIIx	Phase_I	148	11	NM_001040105	0	0	0	0	0	O14761|Q685J2|Q8TDH7	Silent	SNP	ENST00000306151.4	37	CCDS34711.1																																																																																			.		0.483	MUC17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347161.1	NM_001040105	
MUC17	140453	bcgsc.ca	37	7	100681211	100681211	+	Missense_Mutation	SNP	G	G	C	rs147094151	byFrequency	TCGA-PK-A5H9-01A-11D-A29I-10	TCGA-PK-A5H9-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	cb1f20fc-0df5-42f5-91b8-624bee1a532a	4fa707a6-752b-4fda-9bc0-b07c80cf65c1	g.chr7:100681211G>C	ENST00000306151.4	+	3	6578	c.6514G>C	c.(6514-6516)Gtg>Ctg	p.V2172L		NM_001040105.1	NP_001035194.1	Q685J3	MUC17_HUMAN	mucin 17, cell surface associated	2172	59 X approximate tandem repeats.|Ser-rich.				cellular homeostasis (GO:0019725)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	apical plasma membrane (GO:0016324)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)	extracellular matrix constituent, lubricant activity (GO:0030197)|PDZ domain binding (GO:0030165)			NS(3)|breast(14)|central_nervous_system(2)|cervix(2)|endometrium(27)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(28)|lung(179)|ovary(19)|pancreas(1)|prostate(13)|skin(26)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(4)	343	Lung NSC(181;0.136)|all_lung(186;0.182)					CAGCACCACAGTGGTGGCCAG	0.468																																					p.V2172L		.											.	MUC17-95	0			c.G6514C						.	C	LEU/VAL	33,4373		0,33,2170	246.0	241.0	243.0		6514	-1.4	0.0	7	dbSNP_134	243	373,8227		6,361,3933	no	missense	MUC17	NM_001040105.1	32	6,394,6103	CC,CG,GG		4.3372,0.749,3.1216	benign	2172/4494	100681211	406,12600	2203	4300	6503	SO:0001583	missense	140453	exon3			ACCACAGTGGTGG	AJ606307	CCDS34711.1	7q22	2007-01-17	2006-03-14		ENSG00000169876	ENSG00000169876		"""Mucins"""	16800	protein-coding gene	gene with protein product		608424				11855812	Standard	NM_001040105		Approved		uc003uxp.1	Q685J3	OTTHUMG00000157030	ENST00000306151.4:c.6514G>C	7.37:g.100681211G>C	ENSP00000302716:p.Val2172Leu	Somatic	136	8		WXS	Illumina GAIIx	Phase_I	130	11	NM_001040105	0	0	0	0	0	O14761|Q685J2|Q8TDH7	Missense_Mutation	SNP	ENST00000306151.4	37	CCDS34711.1	.	.	.	.	.	.	.	.	.	.	N	0.655	-0.807913	0.02819	0.00749	0.043372	ENSG00000169876	ENST00000306151	T	0.02446	4.29	0.683	-1.37	0.09056	.	.	.	.	.	T	0.00328	0.0010	N	0.03608	-0.345	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.44667	-0.9313	9	0.24483	T	0.36	.	3.5846	0.07966	0.3877:0.2157:0.3965:0.0	.	2172	Q685J3	MUC17_HUMAN	L	2172	ENSP00000302716:V2172L	ENSP00000302716:V2172L	V	+	1	0	MUC17	100467931	.	.	0.000000	0.03702	0.000000	0.00434	.	.	-2.419000	0.00565	-1.314000	0.01303	GTG	G|0.968;C|0.032		0.468	MUC17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347161.1	NM_001040105	
KCP	375616	broad.mit.edu	37	7	128526968	128526968	+	RNA	SNP	T	T	G			TCGA-PK-A5H9-01A-11D-A29I-10	TCGA-PK-A5H9-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	cb1f20fc-0df5-42f5-91b8-624bee1a532a	4fa707a6-752b-4fda-9bc0-b07c80cf65c1	g.chr7:128526968T>G	ENST00000476647.2	-	0	2693							Q6ZWJ8	KCP_HUMAN	kielin/chordin-like protein							extracellular region (GO:0005576)				central_nervous_system(1)|endometrium(3)	4						TGGAGAGGGGTGGGGGCAGAG	0.652																																					.		.											.	KCP-68	0			.						.						17.0	25.0	22.0					7																	128526968		692	1591	2283			375616	.			GAGGGGTGGGGGC	AK122706		7q32.3	2009-11-06	2009-02-18	2009-02-18	ENSG00000135253	ENSG00000135253			17585	protein-coding gene	gene with protein product	"""kielin"""	609344	"""cysteine rich BMP regulator 2 (chordin-like)"""	CRIM2		15793581	Standard	NM_001135914		Approved	FLJ33365, NET67	uc011kor.2	Q6ZWJ8	OTTHUMG00000158363		7.37:g.128526968T>G		Somatic	45	2		WXS	Illumina GAIIx	Phase_I	42	4	.	0	0	0	0	0	Q8NBE0	RNA	SNP	ENST00000476647.2	37																																																																																				.		0.652	KCP-006	KNOWN	basic	processed_transcript	processed_transcript	OTTHUMT00000403051.1	NM_199349	
SSPO	23145	bcgsc.ca	37	7	149518961	149518961	+	RNA	SNP	T	T	C	rs1008335	byFrequency	TCGA-PK-A5H9-01A-11D-A29I-10	TCGA-PK-A5H9-10A-01D-A29L-10	T	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	cb1f20fc-0df5-42f5-91b8-624bee1a532a	4fa707a6-752b-4fda-9bc0-b07c80cf65c1	g.chr7:149518961T>C	ENST00000378016.2	+	0	12765							A2VEC9	SSPO_HUMAN	SCO-spondin						cell adhesion (GO:0007155)	extracellular space (GO:0005615)	peptidase inhibitor activity (GO:0030414)					Melanoma(164;0.165)|Ovarian(565;0.177)		OV - Ovarian serous cystadenocarcinoma(82;0.00625)			TGCCTGAGGCTTGGACGCTGT	0.667													C|||	2318	0.462859	0.7481	0.3833	5008	,	,		17849	0.4256		0.3091	False		,,,				2504	0.3303				p.A4255A		.											.	.	0			c.T12765C						.	C		2831,1417		970,891,263	15.0	18.0	17.0		12779	2.1	0.8	7	dbSNP_86	17	2794,5670		476,1842,1914	yes	coding-notMod3	SSPO	NM_198455.2		1446,2733,2177	CC,CT,TT		33.0104,33.3569,44.2495			149518961	5625,7087	2124	4232	6356			23145	exon90			TGAGGCTTGGACG	AK093431		7q36.1	2013-08-07	2013-08-06		ENSG00000197558	ENSG00000197558			21998	protein-coding gene	gene with protein product	"""subcommissural organ spondin"", ""SCO protein, thrombospondin domain containing"""		"""SCO-spondin homolog (Bos taurus)"""			8743952, 11008217	Standard	NM_198455		Approved	SCO-spondin, KIAA0543, FLJ36112	uc010lpk.3	A2VEC9	OTTHUMG00000157884		7.37:g.149518961T>C		Somatic	346	3		WXS	Illumina GAIIx	Phase_I	365	12	NM_198455	0	0	0	0	0	Q76B61	Silent	SNP	ENST00000378016.2	37																																																																																				T|0.553;C|0.447		0.667	SSPO-202	KNOWN	basic	processed_transcript	processed_transcript			
SHH	6469	hgsc.bcm.edu	37	7	155596114	155596114	+	Missense_Mutation	SNP	C	C	T	rs104894047	byFrequency	TCGA-PK-A5H9-01A-11D-A29I-10	TCGA-PK-A5H9-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	cb1f20fc-0df5-42f5-91b8-624bee1a532a	4fa707a6-752b-4fda-9bc0-b07c80cf65c1	g.chr7:155596114C>T	ENST00000297261.2	-	3	1019	c.869G>A	c.(868-870)gGc>gAc	p.G290D		NM_000193.2	NP_000184.1	Q15465	SHH_HUMAN	sonic hedgehog	290			G -> D (in HPE3; sporadic; dbSNP:rs104894047). {ECO:0000269|PubMed:10556296, ECO:0000269|PubMed:19603532}.		androgen metabolic process (GO:0008209)|apoptotic signaling pathway (GO:0097190)|artery development (GO:0060840)|axon guidance (GO:0007411)|Bergmann glial cell differentiation (GO:0060020)|blood coagulation (GO:0007596)|branching involved in salivary gland morphogenesis (GO:0060445)|branching involved in ureteric bud morphogenesis (GO:0001658)|branching morphogenesis of an epithelial tube (GO:0048754)|bud outgrowth involved in lung branching (GO:0060447)|camera-type eye development (GO:0043010)|canonical Wnt signaling pathway (GO:0060070)|CD4-positive or CD8-positive, alpha-beta T cell lineage commitment (GO:0043369)|cell development (GO:0048468)|cell fate specification (GO:0001708)|cell-cell signaling (GO:0007267)|cellular response to lithium ion (GO:0071285)|central nervous system development (GO:0007417)|cerebellar granule cell precursor proliferation (GO:0021930)|determination of left/right asymmetry in lateral mesoderm (GO:0003140)|dorsal/ventral neural tube patterning (GO:0021904)|dorsal/ventral pattern formation (GO:0009953)|ectoderm development (GO:0007398)|embryo development (GO:0009790)|embryonic digestive tract morphogenesis (GO:0048557)|embryonic digit morphogenesis (GO:0042733)|embryonic foregut morphogenesis (GO:0048617)|embryonic forelimb morphogenesis (GO:0035115)|embryonic hindlimb morphogenesis (GO:0035116)|embryonic limb morphogenesis (GO:0030326)|embryonic pattern specification (GO:0009880)|embryonic skeletal system development (GO:0048706)|endocytosis (GO:0006897)|epithelial cell proliferation involved in salivary gland morphogenesis (GO:0060664)|epithelial-mesenchymal signaling involved in prostate gland development (GO:0060738)|establishment of cell polarity (GO:0030010)|forebrain development (GO:0030900)|formation of anatomical boundary (GO:0048859)|hair follicle morphogenesis (GO:0031069)|heart development (GO:0007507)|heart looping (GO:0001947)|hindbrain development (GO:0030902)|hindgut morphogenesis (GO:0007442)|inner ear development (GO:0048839)|intein-mediated protein splicing (GO:0016539)|intermediate filament organization (GO:0045109)|left lung development (GO:0060459)|limb bud formation (GO:0060174)|lung development (GO:0030324)|lung epithelium development (GO:0060428)|lung lobe morphogenesis (GO:0060463)|lung-associated mesenchyme development (GO:0060484)|lymphoid progenitor cell differentiation (GO:0002320)|male genitalia development (GO:0030539)|mesenchymal cell proliferation involved in lung development (GO:0060916)|mesenchymal smoothened signaling pathway involved in prostate gland development (GO:0060783)|metanephric mesenchymal cell proliferation involved in metanephros development (GO:0072136)|metanephros development (GO:0001656)|midbrain development (GO:0030901)|multicellular structure septum development (GO:0080125)|myoblast differentiation (GO:0045445)|myotube differentiation (GO:0014902)|negative regulation of alpha-beta T cell differentiation (GO:0046639)|negative regulation of apoptotic process (GO:0043066)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell differentiation (GO:0045596)|negative regulation of cell migration (GO:0030336)|negative regulation of cholesterol efflux (GO:0090370)|negative regulation of kidney smooth muscle cell differentiation (GO:2000357)|negative regulation of mesenchymal cell apoptotic process (GO:2001054)|negative regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032435)|negative regulation of T cell proliferation (GO:0042130)|negative regulation of transcription elongation from RNA polymerase II promoter (GO:0034244)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of ureter smooth muscle cell differentiation (GO:2000062)|negative thymic T cell selection (GO:0045060)|neural crest cell migration (GO:0001755)|neuroblast proliferation (GO:0007405)|neuron fate commitment (GO:0048663)|odontogenesis of dentin-containing tooth (GO:0042475)|oligodendrocyte development (GO:0014003)|organ formation (GO:0048645)|osteoblast development (GO:0002076)|palate development (GO:0060021)|pancreas development (GO:0031016)|pattern specification process (GO:0007389)|patterning of blood vessels (GO:0001569)|polarity specification of anterior/posterior axis (GO:0009949)|positive regulation of alpha-beta T cell differentiation (GO:0046638)|positive regulation of cell division (GO:0051781)|positive regulation of cell proliferation (GO:0008284)|positive regulation of epithelial cell proliferation involved in prostate gland development (GO:0060769)|positive regulation of hh target transcription factor activity (GO:0007228)|positive regulation of immature T cell proliferation in thymus (GO:0033092)|positive regulation of kidney smooth muscle cell differentiation (GO:2000358)|positive regulation of mesenchymal cell proliferation involved in ureter development (GO:2000729)|positive regulation of neuroblast proliferation (GO:0002052)|positive regulation of oligodendrocyte differentiation (GO:0048714)|positive regulation of protein import into nucleus (GO:0042307)|positive regulation of sclerotome development (GO:0061189)|positive regulation of skeletal muscle cell proliferation (GO:0014858)|positive regulation of skeletal muscle tissue development (GO:0048643)|positive regulation of smoothened signaling pathway (GO:0045880)|positive regulation of striated muscle cell differentiation (GO:0051155)|positive regulation of T cell differentiation in thymus (GO:0033089)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of ureter smooth muscle cell differentiation (GO:2000063)|positive regulation of Wnt signaling pathway (GO:0030177)|positive thymic T cell selection (GO:0045059)|primary prostatic bud elongation (GO:0060516)|prostate epithelial cord elongation (GO:0060523)|prostate gland development (GO:0030850)|protein localization to nucleus (GO:0034504)|regulation of cell proliferation (GO:0042127)|regulation of mesenchymal cell proliferation involved in prostate gland development (GO:0060782)|regulation of nodal signaling pathway involved in determination of lateral mesoderm left/right asymmetry (GO:1900175)|regulation of odontogenesis (GO:0042481)|regulation of prostatic bud formation (GO:0060685)|regulation of protein localization to nucleus (GO:1900180)|regulation of proteolysis (GO:0030162)|renal system development (GO:0072001)|right lung development (GO:0060458)|salivary gland cavitation (GO:0060662)|smoothened signaling pathway (GO:0007224)|smoothened signaling pathway involved in regulation of cerebellar granule cell precursor cell proliferation (GO:0021938)|somite development (GO:0061053)|spinal cord dorsal/ventral patterning (GO:0021513)|spinal cord motor neuron differentiation (GO:0021522)|stem cell development (GO:0048864)|striated muscle tissue development (GO:0014706)|T cell differentiation in thymus (GO:0033077)|telencephalon regionalization (GO:0021978)|thalamus development (GO:0021794)|thymus development (GO:0048538)|thyroid gland development (GO:0030878)|trachea morphogenesis (GO:0060439)|vasculogenesis (GO:0001570)|ventral midline development (GO:0007418)	cell surface (GO:0009986)|extracellular matrix (GO:0031012)|extracellular space (GO:0005615)|membrane raft (GO:0045121)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|glycosaminoglycan binding (GO:0005539)|laminin-1 binding (GO:0043237)|morphogen activity (GO:0016015)|patched binding (GO:0005113)|peptidase activity (GO:0008233)|zinc ion binding (GO:0008270)			central_nervous_system(3)|kidney(1)|large_intestine(1)|lung(7)|skin(1)|upper_aerodigestive_tract(1)	14	all_neural(206;0.101)	all_hematologic(28;0.0592)	OV - Ovarian serous cystadenocarcinoma(82;0.00882)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)		CGGCCCCGAGCCCGAGGACGC	0.781													C|||	28	0.00559105	0.0	0.0	5008	,	,		7248	0.0258		0.001	False		,,,				2504	0.001				p.G290D		.											.	SHH-1134	0			c.G869A	GRCh37	CM992971	SHH	M	rs104894047	.						2.0	2.0	2.0					7																	155596114		1264	2791	4055	SO:0001583	missense	6469	exon3			CCCGAGCCCGAGG		CCDS5942.1	7q36	2010-06-25	2010-06-25		ENSG00000164690	ENSG00000164690			10848	protein-coding gene	gene with protein product		600725	"""sonic hedgehog (Drosophila) homolog"", ""sonic hedgehog homolog (Drosophila)"""	HPE3, HLP3		7590746	Standard	NM_000193		Approved	HHG1, SMMCI, TPT, TPTPS, MCOPCB5	uc003wmk.1	Q15465	OTTHUMG00000151349	ENST00000297261.2:c.869G>A	7.37:g.155596114C>T	ENSP00000297261:p.Gly290Asp	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	10	8	NM_000193	0	0	0	2	2	A4D247|Q75MC9	Missense_Mutation	SNP	ENST00000297261.2	37	CCDS5942.1	17	0.007783882783882784	2	0.0040650406504065045	0	0.0	14	0.024475524475524476	1	0.0013192612137203166	C	0.010	-1.742168	0.00675	.	.	ENSG00000164690	ENST00000297261	D	0.99784	-6.74	2.85	0.852	0.18995	Hedgehog/intein hint, N-terminal (1);Peptidase C46, hedgehog protein, hint region (1);	.	.	.	.	D	0.97748	0.9261	L	0.54323	1.7	0.09310	A	4.19023e-12	P;P	0.36282	0.546;0.546	B;B	0.41135	0.348;0.095	D	0.97909	1.0307	8	0.27082	T	0.32	.	5.2043	0.15283	0.2374:0.5314:0.2312:0.0	.	290;293	Q15465;D9ZGF9	SHH_HUMAN;.	D	290	ENSP00000297261:G290D	ENSP00000297261:G290D	G	-	2	0	SHH	155288875	0.893000	0.30496	0.000000	0.03702	0.006000	0.05464	-0.022000	0.12480	0.055000	0.16094	0.313000	0.20887	GGC	C|0.993;T|0.007		0.781	SHH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000322327.1	NM_000193	
FAM160B2	64760	bcgsc.ca	37	8	21956108	21956108	+	Missense_Mutation	SNP	A	A	G	rs35497596	byFrequency	TCGA-PK-A5H9-01A-11D-A29I-10	TCGA-PK-A5H9-10A-01D-A29L-10	A	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	cb1f20fc-0df5-42f5-91b8-624bee1a532a	4fa707a6-752b-4fda-9bc0-b07c80cf65c1	g.chr8:21956108A>G	ENST00000289921.7	+	7	989	c.943A>G	c.(943-945)Acc>Gcc	p.T315A		NM_022749.5	NP_073586.5	Q86V87	F16B2_HUMAN	family with sequence similarity 160, member B2	315			T -> A (in dbSNP:rs35497596). {ECO:0000269|PubMed:15489334, ECO:0000269|PubMed:15498874}.							endometrium(2)|kidney(1)|lung(2)|prostate(3)|urinary_tract(1)	9						AGACATTGCCACCTTAGAGGG	0.647													.|||	1895	0.378395	0.3729	0.2723	5008	,	,		16177	0.377		0.4026	False		,,,				2504	0.4376				p.T315A		.											.	.	0			c.A943G						.	G	ALA/THR	1386,2650		253,880,885	14.0	15.0	15.0		943	-6.1	0.0	8	dbSNP_126	15	3488,4854		735,2018,1418	yes	missense	FAM160B2	NM_022749.5	58	988,2898,2303	GG,GA,AA		41.8125,34.3409,39.3763	benign	315/744	21956108	4874,7504	2018	4171	6189	SO:0001583	missense	64760	exon7			ATTGCCACCTTAG	AK025454	CCDS6021.2	8p21.3	2012-11-30	2008-06-05	2008-06-05	ENSG00000158863	ENSG00000158863			16492	protein-coding gene	gene with protein product			"""retinoic acid induced 16"""	RAI16		22971576, 15626329	Standard	XR_247128		Approved	FLJ21801	uc011kyx.2	Q86V87	OTTHUMG00000097088	ENST00000289921.7:c.943A>G	8.37:g.21956108A>G	ENSP00000289921:p.Thr315Ala	Somatic	171	1		WXS	Illumina GAIIx	Phase_I	133	5	NM_022749	0	0	30	30	0	B2RDQ5|B3KNX1|Q2M211|Q71JB5|Q7L3J6|Q969T0|Q9H6W4	Missense_Mutation	SNP	ENST00000289921.7	37	CCDS6021.2	800	0.3663003663003663	174	0.35365853658536583	106	0.292817679558011	221	0.38636363636363635	299	0.3944591029023747	.	10.81	1.455570	0.26161	0.343409	0.418125	ENSG00000158863	ENST00000289921	T	0.62639	0.01	5.37	-6.05	0.02172	.	0.788308	0.12147	N	0.495270	T	0.00012	0.0000	L	0.29908	0.895	0.80722	P	0.0	B	0.06786	0.001	B	0.15484	0.013	T	0.31503	-0.9941	9	0.25751	T	0.34	0.0394	10.6218	0.45484	0.6713:0.0:0.2318:0.0969	rs35497596	315	Q86V87	F16B2_HUMAN	A	315	ENSP00000289921:T315A	ENSP00000289921:T315A	T	+	1	0	FAM160B2	22012053	0.000000	0.05858	0.000000	0.03702	0.768000	0.43524	-0.607000	0.05648	-1.577000	0.01650	-1.016000	0.02456	ACC	A|0.627;G|0.373		0.647	FAM160B2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000375334.2		
ZNF696	79943	hgsc.bcm.edu	37	8	144378868	144378868	+	Silent	SNP	A	A	G	rs7386259	byFrequency	TCGA-PK-A5H9-01A-11D-A29I-10	TCGA-PK-A5H9-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	cb1f20fc-0df5-42f5-91b8-624bee1a532a	4fa707a6-752b-4fda-9bc0-b07c80cf65c1	g.chr8:144378868A>G	ENST00000330143.3	+	3	1432	c.1023A>G	c.(1021-1023)cgA>cgG	p.R341R		NM_030895.2	NP_112157.2	Q9H7X3	ZN696_HUMAN	zinc finger protein 696	341					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			lung(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	8	all_cancers(97;1.01e-10)|all_epithelial(106;4.86e-09)|Lung NSC(106;0.000167)|all_lung(105;0.000459)|Ovarian(258;0.0212)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.156)|Colorectal(110;0.173)			GGCACCAGCGACTCCACACGG	0.726													G|||	4505	0.899561	0.9425	0.9179	5008	,	,		11520	0.8403		0.8608	False		,,,				2504	0.9294				p.R341R		.											.	ZNF696-90	0			c.A1023G						.	G		3773,275		1771,231,22	5.0	5.0	5.0		1023	-0.3	0.0	8	dbSNP_116	5	6735,1261		2843,1049,106	no	coding-synonymous	ZNF696	NM_030895.2		4614,1280,128	GG,GA,AA		15.7704,6.7935,12.7532		341/375	144378868	10508,1536	2024	3998	6022	SO:0001819	synonymous_variant	79943	exon3			CCAGCGACTCCAC	AK024191	CCDS6399.1	8q24.3	2013-01-08				ENSG00000185730		"""Zinc fingers, C2H2-type"""	25872	protein-coding gene	gene with protein product							Standard	NM_030895		Approved	FLJ14129	uc003yxy.4	Q9H7X3		ENST00000330143.3:c.1023A>G	8.37:g.144378868A>G		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	29	8	NM_030895	0	0	1	2	1	A0AVE2	Silent	SNP	ENST00000330143.3	37	CCDS6399.1																																																																																			A|0.118;G|0.882		0.726	ZNF696-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381164.2	NM_030895	
OPLAH	26873	hgsc.bcm.edu	37	8	145106939	145106940	+	Splice_Site	DEL	CC	CC	-	rs60949781		TCGA-PK-A5H9-01A-11D-A29I-10	TCGA-PK-A5H9-10A-01D-A29L-10	CC	CC	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	cb1f20fc-0df5-42f5-91b8-624bee1a532a	4fa707a6-752b-4fda-9bc0-b07c80cf65c1	g.chr8:145106939_145106940delCC	ENST00000426825.1	-	26	3580_3581	c.3499_3500delGG	c.(3499-3501)ggc>c	p.G1167fs	CTD-3065J16.6_ENST00000561181.1_RNA|OPLAH_ENST00000534424.1_5'UTR|CTD-3065J16.6_ENST00000528912.1_RNA	NM_017570.3	NP_060040.1	O14841	OPLA_HUMAN	5-oxoprolinase (ATP-hydrolysing)	1167					glutathione biosynthetic process (GO:0006750)|glutathione derivative biosynthetic process (GO:1901687)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)	5-oxoprolinase (ATP-hydrolyzing) activity (GO:0017168)|ATP binding (GO:0005524)			breast(1)|central_nervous_system(1)|endometrium(1)|lung(13)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)	20	all_cancers(97;1.06e-10)|all_epithelial(106;1.5e-09)|Lung NSC(106;5.89e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;6.79e-41)|Epithelial(56;1.02e-39)|all cancers(56;2.24e-35)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.105)			GCCCCCCGAGCCCCCCGCCGCA	0.748														5008	1.0	1.0	1.0	5008	,	,		7120	1.0		1.0	False		,,,				2504	1.0				.		.											.	OPLAH-68	0			.						.			2721,11		1360,1,5						3.7	0.9		dbSNP_130	11	6356,8		3177,2,3	no	frameshift	OPLAH	NM_017570.3		4537,3,8	A1A1,A1R,RR		0.1257,0.4026,0.2089				9077,19				SO:0001630	splice_region_variant	26873	.			CCCGAGCCCCCCG	AF024672, AB122018	CCDS75802.1	8q24.3	2010-11-23			ENSG00000178814	ENSG00000178814	3.5.2.9		8149	protein-coding gene	gene with protein product		614243				14993790	Standard	NM_017570		Approved	OPLA, 5-Opase	uc003zar.3	O14841		ENST00000426825.1:c.3499-1GG>-	8.37:g.145106943_145106944delCC		Somatic	1	1		WXS	Illumina GAIIx	Phase_I	16	16	.	0	0	0	0	0	A5PKY8|Q75W65|Q9Y4Q0	Splice_Site	DEL	ENST00000426825.1	37																																																																																				.		0.748	OPLAH-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_017570	Frame_Shift_Del
ZNF517	340385	hgsc.bcm.edu	37	8	146033347	146033347	+	Missense_Mutation	SNP	T	T	C	rs2976653	byFrequency	TCGA-PK-A5H9-01A-11D-A29I-10	TCGA-PK-A5H9-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	cb1f20fc-0df5-42f5-91b8-624bee1a532a	4fa707a6-752b-4fda-9bc0-b07c80cf65c1	g.chr8:146033347T>C	ENST00000531720.1	+	4	1091	c.1046T>C	c.(1045-1047)gTg>gCg	p.V349A	ZNF517_ENST00000359971.3_Missense_Mutation_p.V349A|ZNF517_ENST00000525105.1_Intron|ZNF517_ENST00000526178.1_Intron			Q6ZMY9	ZN517_HUMAN	zinc finger protein 517	349				V -> A (in Ref. 1; BAD18586). {ECO:0000305}.	regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(2)|large_intestine(2)|lung(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	13	all_cancers(97;1.03e-11)|all_epithelial(106;6.69e-11)|Lung NSC(106;4.08e-05)|all_lung(105;0.000125)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		Epithelial(56;5.47e-39)|OV - Ovarian serous cystadenocarcinoma(54;6.38e-39)|all cancers(56;5.47e-34)|BRCA - Breast invasive adenocarcinoma(115;0.0355)|Colorectal(110;0.055)			GACGGCGGCGTGGGGCAGGGC	0.746													C|||	4981	0.994609	1.0	1.0	5008	,	,		12856	1.0		0.994	False		,,,				2504	0.9785				p.V349A		.											.	ZNF517-90	0			c.T1046C						.	C	ALA/VAL	3411,3		1704,3,0	3.0	5.0	4.0		1046	-0.8	0.0	8	dbSNP_101	4	7050,46		3502,46,0	no	missense	ZNF517	NM_213605.2	64	5206,49,0	CC,CT,TT		0.6483,0.0879,0.4662	benign	349/493	146033347	10461,49	1707	3548	5255	SO:0001583	missense	340385	exon5			GCGGCGTGGGGCA	AK096527	CCDS6434.1	8q24.3	2013-01-08				ENSG00000197363		"""Zinc fingers, C2H2-type"", ""-"""	27984	protein-coding gene	gene with protein product							Standard	NM_213605		Approved		uc003zed.1	Q6ZMY9		ENST00000531720.1:c.1046T>C	8.37:g.146033347T>C	ENSP00000436103:p.Val349Ala	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	22	22	NM_213605	0	0	0	3	3		Missense_Mutation	SNP	ENST00000531720.1	37	CCDS6434.1	2179|2179	0.9977106227106227|0.9977106227106227	492|492	1.0|1.0	362|362	1.0|1.0	572|572	1.0|1.0	753|753	0.9934036939313984|0.9934036939313984	C|C	0.021|0.021	-1.418607|-1.418607	0.01136|0.01136	0.999121|0.999121	0.993517|0.993517	ENSG00000197363|ENSG00000197363	ENST00000359971;ENST00000531720|ENST00000529429	T;T|.	0.05319|.	3.46;3.46|.	2.17|2.17	-0.838|-0.838	0.10762|0.10762	.|.	.|.	.|.	.|.	.|.	T|T	0.00012|0.00012	0.0000|0.0000	L|L	0.35644|0.35644	1.08|1.08	0.80722|0.80722	P|P	0.0|0.0	B|.	0.02656|.	0.0|.	B|.	0.01281|.	0.0|.	T|T	0.21449|0.21449	-1.0245|-1.0245	8|4	0.59425|.	D|.	0.04|.	.|.	0.241|0.241	0.00192|0.00192	0.362:0.2246:0.2135:0.1999|0.362:0.2246:0.2135:0.1999	rs2976653;rs59817342|rs2976653;rs59817342	349|.	Q6ZMY9|.	ZN517_HUMAN|.	A|R	349|316	ENSP00000353058:V349A;ENSP00000436103:V349A|.	ENSP00000353058:V349A|.	V|W	+|+	2|1	0|0	ZNF517|ZNF517	146004151|146004151	0.001000|0.001000	0.12720|0.12720	0.002000|0.002000	0.10522|0.10522	0.004000|0.004000	0.04260|0.04260	-0.400000|-0.400000	0.07241|0.07241	-0.612000|-0.612000	0.05701|0.05701	-1.157000|-1.157000	0.01802|0.01802	GTG|TGG	G|0.992;C|0.006		0.746	ZNF517-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382642.1	XM_291261	
RIC1	57589	broad.mit.edu	37	9	5763487	5763487	+	Silent	SNP	G	G	T			TCGA-PK-A5H9-01A-11D-A29I-10	TCGA-PK-A5H9-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	cb1f20fc-0df5-42f5-91b8-624bee1a532a	4fa707a6-752b-4fda-9bc0-b07c80cf65c1	g.chr9:5763487G>T	ENST00000414202.2	+	19	2651	c.2460G>T	c.(2458-2460)gtG>gtT	p.V820V	KIAA1432_ENST00000381532.2_Silent_p.V741V|KIAA1432_ENST00000449720.2_Silent_p.V704V|KIAA1432_ENST00000251879.6_Silent_p.V820V|KIAA1432_ENST00000418622.3_Silent_p.V741V	NM_001206557.1|NM_020829.3	NP_001193486.1|NP_065880.2														breast(2)|cervix(2)|endometrium(6)|kidney(4)|large_intestine(6)|lung(23)|prostate(1)|upper_aerodigestive_tract(1)	45		Acute lymphoblastic leukemia(23;0.154)		GBM - Glioblastoma multiforme(50;0.000525)|Lung(218;0.122)		TCTGTGTTGTGGAGAGAACCT	0.483																																					p.V820V		.											.	KIAA1432-90	0			c.G2460T						.						132.0	121.0	125.0					9																	5763487		2203	4300	6503	SO:0001819	synonymous_variant	57589	exon19			TGTTGTGGAGAGA																												ENST00000414202.2:c.2460G>T	9.37:g.5763487G>T		Somatic	95	0		WXS	Illumina GAIIx	Phase_I	91	5	NM_001135920	0	0	11	11	0		Silent	SNP	ENST00000414202.2	37	CCDS34982.2	.	.	.	.	.	.	.	.	.	.	G	7.552	0.662916	0.14710	.	.	ENSG00000107036	ENST00000545641	.	.	.	5.78	2.9	0.33743	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-17.3083	4.9117	0.13825	0.0738:0.1139:0.4907:0.3216	.	.	.	.	X	712	.	.	G	+	1	0	KIAA1432	5753487	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	1.889000	0.39718	0.745000	0.32763	0.561000	0.74099	GGA	.		0.483	KIAA1432-002	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051636.3		
FAM154A	158297	broad.mit.edu;ucsc.edu;bcgsc.ca	37	9	18928282	18928282	+	Missense_Mutation	SNP	C	C	T			TCGA-PK-A5H9-01A-11D-A29I-10	TCGA-PK-A5H9-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	cb1f20fc-0df5-42f5-91b8-624bee1a532a	4fa707a6-752b-4fda-9bc0-b07c80cf65c1	g.chr9:18928282C>T	ENST00000380534.4	-	4	1472	c.1193G>A	c.(1192-1194)gGa>gAa	p.G398E	FAM154A_ENST00000380530.1_3'UTR|FAM154A_ENST00000542071.1_Missense_Mutation_p.G206E	NM_153707.2	NP_714918.2	Q8IYX7	F154A_HUMAN	family with sequence similarity 154, member A	398										breast(1)|endometrium(3)|kidney(2)|large_intestine(4)|lung(13)|pancreas(1)|prostate(1)|skin(1)	26				GBM - Glioblastoma multiforme(50;6.53e-16)		AGGGACATTTCCTCGAGGGCC	0.567																																					p.G398E		.											.	FAM154A-69	0			c.G1193A						.						98.0	84.0	89.0					9																	18928282		2203	4300	6503	SO:0001583	missense	158297	exon4			ACATTTCCTCGAG	BC033489	CCDS6487.1, CCDS75819.1, CCDS75820.1	9p22.1	2012-03-23	2008-02-21	2008-02-21	ENSG00000155875	ENSG00000155875			28566	protein-coding gene	gene with protein product			"""chromosome 9 open reading frame 138"""	C9orf138		12477932	Standard	NM_153707		Approved	MGC35182	uc003zni.2	Q8IYX7	OTTHUMG00000019609	ENST00000380534.4:c.1193G>A	9.37:g.18928282C>T	ENSP00000369907:p.Gly398Glu	Somatic	118	1		WXS	Illumina GAIIx	Phase_I	111	20	NM_153707	0	0	0	0	0	Q5VY58	Missense_Mutation	SNP	ENST00000380534.4	37	CCDS6487.1	.	.	.	.	.	.	.	.	.	.	C	6.905	0.536471	0.13188	.	.	ENSG00000155875	ENST00000380534;ENST00000542071	T;T	0.22539	2.74;1.95	5.09	-1.75	0.08031	.	1.211850	0.05822	N	0.615848	T	0.17066	0.0410	L	0.51422	1.61	0.09310	N	1	B	0.29341	0.242	B	0.26969	0.075	T	0.34354	-0.9832	10	0.07482	T	0.82	0.8033	10.0393	0.42148	0.108:0.1893:0.6318:0.0709	.	398	Q8IYX7	F154A_HUMAN	E	398;206	ENSP00000369907:G398E;ENSP00000438823:G206E	ENSP00000369907:G398E	G	-	2	0	FAM154A	18918282	0.000000	0.05858	0.000000	0.03702	0.862000	0.49288	-0.339000	0.07832	-0.539000	0.06273	-0.142000	0.14014	GGA	.		0.567	FAM154A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051811.1	NM_153707	
SPTLC1	10558	ucsc.edu;bcgsc.ca	37	9	94842321	94842321	+	Missense_Mutation	SNP	G	G	T			TCGA-PK-A5H9-01A-11D-A29I-10	TCGA-PK-A5H9-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	cb1f20fc-0df5-42f5-91b8-624bee1a532a	4fa707a6-752b-4fda-9bc0-b07c80cf65c1	g.chr9:94842321G>T	ENST00000262554.2	-	5	409	c.404C>A	c.(403-405)cCc>cAc	p.P135H	SPTLC1_ENST00000337841.4_Missense_Mutation_p.P135H|SPTLC1_ENST00000482632.1_5'UTR	NM_006415.2	NP_006406.1	O15269	SPTC1_HUMAN	serine palmitoyltransferase, long chain base subunit 1	135					ceramide biosynthetic process (GO:0046513)|small molecule metabolic process (GO:0044281)|sphinganine biosynthetic process (GO:0046511)|sphingolipid biosynthetic process (GO:0030148)|sphingolipid metabolic process (GO:0006665)|sphingomyelin biosynthetic process (GO:0006686)|sphingosine biosynthetic process (GO:0046512)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|serine C-palmitoyltransferase complex (GO:0017059)|SPOTS complex (GO:0035339)	pyridoxal phosphate binding (GO:0030170)|serine C-palmitoyltransferase activity (GO:0004758)			breast(2)|kidney(1)|large_intestine(4)|lung(4)|ovary(1)|skin(1)|urinary_tract(1)	14					L-Serine(DB00133)	AAATCCTCTGGGTCCACAAGT	0.368																																					p.P135H		.											.	SPTLC1-154	0			c.C404A						.						95.0	92.0	93.0					9																	94842321		2203	4300	6503	SO:0001583	missense	10558	exon5			CCTCTGGGTCCAC	Y08685	CCDS6692.1, CCDS6693.1	9q22.31	2014-09-17	2003-12-02		ENSG00000090054	ENSG00000090054	2.3.1.50		11277	protein-coding gene	gene with protein product		605712	"""hereditary sensory neuropathy, type 1"""	HSN1		9363775	Standard	NM_006415		Approved	LCB1, SPTI, HSAN1, hLCB1	uc004arl.1	O15269	OTTHUMG00000021047	ENST00000262554.2:c.404C>A	9.37:g.94842321G>T	ENSP00000262554:p.Pro135His	Somatic	23	0		WXS	Illumina GAIIx	Phase_I	28	4	NM_006415	0	0	29	29	0	A8K681|Q5VWB4|Q96IX6	Missense_Mutation	SNP	ENST00000262554.2	37	CCDS6692.1	.	.	.	.	.	.	.	.	.	.	G	24.2	4.500731	0.85176	.	.	ENSG00000090054	ENST00000262554;ENST00000337841	D;D	0.95137	-3.62;-3.62	5.44	5.44	0.79542	Aminotransferase, class I/classII (1);Pyridoxal phosphate-dependent transferase, major region, subdomain 1 (1);Pyridoxal phosphate-dependent transferase, major domain (1);	0.000000	0.85682	D	0.000000	D	0.98308	0.9439	H	0.96547	3.84	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;0.999;1.0;1.0	D	0.99081	1.0837	10	0.87932	D	0	-20.3435	19.0494	0.93036	0.0:0.0:1.0:0.0	.	135;135;130;135	Q6NUL7;Q96IX6;Q59EQ4;O15269	.;.;.;SPTC1_HUMAN	H	135	ENSP00000262554:P135H;ENSP00000337635:P135H	ENSP00000262554:P135H	P	-	2	0	SPTLC1	93882142	1.000000	0.71417	0.971000	0.41717	0.993000	0.82548	7.135000	0.77276	2.832000	0.97577	0.655000	0.94253	CCC	.		0.368	SPTLC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055553.1	NM_006415	
CRB2	286204	hgsc.bcm.edu	37	9	126136139	126136139	+	Missense_Mutation	SNP	C	C	T	rs73571431	byFrequency	TCGA-PK-A5H9-01A-11D-A29I-10	TCGA-PK-A5H9-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	cb1f20fc-0df5-42f5-91b8-624bee1a532a	4fa707a6-752b-4fda-9bc0-b07c80cf65c1	g.chr9:126136139C>T	ENST00000373631.3	+	10	3330	c.3329C>T	c.(3328-3330)aCg>aTg	p.T1110M	CRB2_ENST00000373629.2_Missense_Mutation_p.T778M|CRB2_ENST00000359999.3_Missense_Mutation_p.T1110M	NM_173689.5	NP_775960.4	Q5IJ48	CRUM2_HUMAN	crumbs family member 2	1110	EGF-like 13. {ECO:0000255|PROSITE- ProRule:PRU00076}.		T -> M (in dbSNP:rs73571431). {ECO:0000269|PubMed:15851977}.		cardiovascular system development (GO:0072358)|maintenance of epithelial cell apical/basal polarity (GO:0045199)|mesoderm formation (GO:0001707)|negative regulation of endopeptidase activity (GO:0010951)|notochord formation (GO:0014028)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|somitogenesis (GO:0001756)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	calcium ion binding (GO:0005509)|enzyme binding (GO:0019899)			NS(2)|breast(1)|cervix(1)|endometrium(2)|lung(11)|ovary(1)|prostate(2)|skin(3)	23						CGCTGTCACACGCACCCCGAC	0.771													C|||	530	0.105831	0.1059	0.1873	5008	,	,		9885	0.0764		0.1412	False		,,,				2504	0.0419				p.T1110M		.											.	CRB2-91	0			c.C3329T						.	C	MET/THR	273,2733		10,253,1240	3.0	3.0	3.0		3329	2.8	0.1	9	dbSNP_131	3	523,5481		24,475,2503	no	missense	CRB2	NM_173689.5	81	34,728,3743	TT,TC,CC		8.7109,9.0818,8.8346	possibly-damaging	1110/1286	126136139	796,8214	1503	3002	4505	SO:0001583	missense	286204	exon10			GTCACACGCACCC	AK095783	CCDS6852.2	9q33.2	2014-02-06	2014-02-06		ENSG00000148204	ENSG00000148204			18688	protein-coding gene	gene with protein product		609720	"""crumbs homolog 2 (Drosophila)"""			14767562	Standard	XM_005251934		Approved	FLJ38464, FLJ16786	uc004bnx.1	Q5IJ48	OTTHUMG00000020638	ENST00000373631.3:c.3329C>T	9.37:g.126136139C>T	ENSP00000362734:p.Thr1110Met	Somatic	1	0		WXS	Illumina GAIIx	Phase_I	11	4	NM_173689	0	0	0	0	0	A2A3N4|Q0QD46|Q5JS41|Q5JS43|Q6ZTA9|Q6ZWI6	Missense_Mutation	SNP	ENST00000373631.3	37	CCDS6852.2	272	0.12454212454212454	60	0.12195121951219512	50	0.13812154696132597	56	0.0979020979020979	106	0.13984168865435356	.	6.539	0.467763	0.12402	0.090818	0.087109	ENSG00000148204	ENST00000359999;ENST00000373631;ENST00000373629	D;D;D	0.90732	-2.1;-2.0;-2.72	3.77	2.82	0.32997	Epidermal growth factor-like (1);Epidermal growth factor-like, type 3 (1);	1.339200	0.05453	N	0.549893	T	0.01976	0.0062	N	0.12746	0.255	0.80722	P	0.0	P;D	0.56521	0.925;0.976	B;B	0.38562	0.101;0.276	T	0.57100	-0.7869	9	0.36615	T	0.2	.	3.1184	0.06382	0.0:0.4522:0.2781:0.2698	.	1110;1110	Q5IJ48;Q5IJ48-2	CRUM2_HUMAN;.	M	1110;1110;778	ENSP00000353092:T1110M;ENSP00000362734:T1110M;ENSP00000362732:T778M	ENSP00000353092:T1110M	T	+	2	0	CRB2	125175960	0.000000	0.05858	0.081000	0.20488	0.039000	0.13416	0.001000	0.13038	1.929000	0.55896	0.455000	0.32223	ACG	C|0.875;T|0.125		0.771	CRB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053990.3	NM_173689	
PRDM12	59335	hgsc.bcm.edu	37	9	133556930	133556930	+	Silent	SNP	C	C	T	rs12004652	byFrequency	TCGA-PK-A5H9-01A-11D-A29I-10	TCGA-PK-A5H9-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	cb1f20fc-0df5-42f5-91b8-624bee1a532a	4fa707a6-752b-4fda-9bc0-b07c80cf65c1	g.chr9:133556930C>T	ENST00000253008.2	+	5	1038	c.978C>T	c.(976-978)ccC>ccT	p.P326P		NM_021619.2	NP_067632.2	Q9H4Q4	PRD12_HUMAN	PR domain containing 12	326					neurogenesis (GO:0022008)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|methyltransferase activity (GO:0008168)			kidney(2)|large_intestine(3)|lung(4)|ovary(1)|upper_aerodigestive_tract(1)	11		all_hematologic(13;0.0433)|Acute lymphoblastic leukemia(5;0.0534)		OV - Ovarian serous cystadenocarcinoma(145;0.000344)		ACCGGCCGCCCAGCACCGCGC	0.821													C|||	1718	0.343051	0.3442	0.3487	5008	,	,		3938	0.5367		0.159	False		,,,				2504	0.3272				p.P326P		.											.	PRDM12-90	0			c.C978T						.	C		767,2301		98,571,865	2.0	2.0	2.0		978	3.3	1.0	9	dbSNP_120	2	765,5515		67,631,2442	no	coding-synonymous	PRDM12	NM_021619.2		165,1202,3307	TT,TC,CC		12.1815,25.0,16.3885		326/368	133556930	1532,7816	1534	3140	4674	SO:0001819	synonymous_variant	59335	exon5			GCCGCCCAGCACC	AY004252	CCDS6934.1	9q33-q34	2013-01-08			ENSG00000130711	ENSG00000130711		"""Zinc fingers, C2H2-type"""	13997	protein-coding gene	gene with protein product	"""PR-domain containing protein 12"", ""PR-domain zinc finger protein 12"""					14523459	Standard	NM_021619		Approved		uc004bzt.1	Q9H4Q4	OTTHUMG00000020808	ENST00000253008.2:c.978C>T	9.37:g.133556930C>T		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	15	15	NM_021619	0	0	0	0	0	A3KFK9	Silent	SNP	ENST00000253008.2	37	CCDS6934.1																																																																																			C|0.686;T|0.314		0.821	PRDM12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054664.1	NM_021619	
QSOX2	169714	hgsc.bcm.edu	37	9	139137420	139137420	+	Missense_Mutation	SNP	T	T	C			TCGA-PK-A5H9-01A-11D-A29I-10	TCGA-PK-A5H9-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	cb1f20fc-0df5-42f5-91b8-624bee1a532a	4fa707a6-752b-4fda-9bc0-b07c80cf65c1	g.chr9:139137420T>C	ENST00000358701.5	-	1	267	c.230A>G	c.(229-231)aAc>aGc	p.N77S		NM_181701.3	NP_859052.3	Q6ZRP7	QSOX2_HUMAN	quiescin Q6 sulfhydryl oxidase 2	77	Thioredoxin. {ECO:0000255|PROSITE- ProRule:PRU00691}.				cell redox homeostasis (GO:0045454)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	thiol oxidase activity (GO:0016972)			NS(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(10)|ovary(4)|prostate(1)|upper_aerodigestive_tract(1)	22		Myeloproliferative disorder(178;0.0511)		Epithelial(140;7.78e-08)|OV - Ovarian serous cystadenocarcinoma(145;1.55e-07)		GGCCGAGCTGTTGGCGGTGGC	0.756																																					p.N77S		.											.	QSOX2-91	0			c.A230G						.						11.0	13.0	12.0					9																	139137420		1767	3587	5354	SO:0001583	missense	169714	exon1			GAGCTGTTGGCGG	AJ318051	CCDS35178.1	9q34.3	2008-02-05	2007-04-23	2007-04-23	ENSG00000165661	ENSG00000165661			30249	protein-coding gene	gene with protein product		612860	"""quiescin Q6-like 1"""	QSCN6L1		12176051	Standard	NM_181701		Approved	SOXN, DKFZp762A2013	uc010nbi.2	Q6ZRP7	OTTHUMG00000020923	ENST00000358701.5:c.230A>G	9.37:g.139137420T>C	ENSP00000351536:p.Asn77Ser	Somatic	1	0		WXS	Illumina GAIIx	Phase_I	10	6	NM_181701	0	0	3	6	3	A2CEE0|A6NLB0|Q5TB37|Q7Z7B6|Q86VV7|Q8N3G2	Missense_Mutation	SNP	ENST00000358701.5	37	CCDS35178.1	.	.	.	.	.	.	.	.	.	.	t	17.73	3.462121	0.63513	.	.	ENSG00000165661	ENST00000358701	T	0.03242	4.0	3.04	1.82	0.25136	Thioredoxin domain (1);Thioredoxin-like fold (3);	0.000000	0.64402	U	0.000001	T	0.09818	0.0241	L	0.52364	1.645	0.47153	D	0.999339	D	0.76494	0.999	D	0.81914	0.995	T	0.12372	-1.0550	10	0.35671	T	0.21	.	7.1382	0.25541	0.2009:0.0:0.0:0.799	.	77	Q6ZRP7	QSOX2_HUMAN	S	77	ENSP00000351536:N77S	ENSP00000351536:N77S	N	-	2	0	QSOX2	138277241	1.000000	0.71417	1.000000	0.80357	0.940000	0.58332	3.873000	0.56093	0.248000	0.21435	0.332000	0.21555	AAC	.		0.756	QSOX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055046.2	NM_181701	
PNPLA7	375775	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	9	140414395	140414395	+	Missense_Mutation	SNP	G	G	T			TCGA-PK-A5H9-01A-11D-A29I-10	TCGA-PK-A5H9-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	cb1f20fc-0df5-42f5-91b8-624bee1a532a	4fa707a6-752b-4fda-9bc0-b07c80cf65c1	g.chr9:140414395G>T	ENST00000277531.4	-	10	1169	c.983C>A	c.(982-984)cCg>cAg	p.P328Q	PNPLA7_ENST00000406427.1_Missense_Mutation_p.P353Q	NM_152286.3	NP_689499.3	Q6ZV29	PLPL7_HUMAN	patatin-like phospholipase domain containing 7	328					lipid metabolic process (GO:0006629)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	lysophospholipase activity (GO:0004622)			breast(1)|central_nervous_system(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(9)|lung(13)|ovary(1)|prostate(1)|skin(2)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	40	all_cancers(76;0.126)			OV - Ovarian serous cystadenocarcinoma(145;0.000268)|Epithelial(140;0.000839)		CTGGAGCCGCGGTGGCTTTTT	0.612																																					p.P353Q		.											.	PNPLA7-91	0			c.C1058A						.						92.0	94.0	93.0					9																	140414395		2203	4300	6503	SO:0001583	missense	375775	exon11			AGCCGCGGTGGCT	AK126267	CCDS7045.1, CCDS48070.1	9q34.3	2009-01-12	2006-06-12	2006-06-12	ENSG00000130653	ENSG00000130653		"""Patatin-like phospholipase domain containing"""	24768	protein-coding gene	gene with protein product		612122	"""chromosome 9 open reading frame 111"""	C9orf111		16799181, 12640454, 19029121	Standard	XM_005266082		Approved	FLJ43070, FLJ31318, FLJ44279, RP11-48C7.2, NTEL1, NTE-R1	uc010ncj.1	Q6ZV29	OTTHUMG00000020990	ENST00000277531.4:c.983C>A	9.37:g.140414395G>T	ENSP00000277531:p.Pro328Gln	Somatic	69	0		WXS	Illumina GAIIx	Phase_I	71	5	NM_001098537	0	0	1	1	0	B5MDD3|Q5T364|Q658X0|Q658Y3|Q6ZTS1|Q86YU8|Q8TAY5|Q96N75|Q9H7N5	Missense_Mutation	SNP	ENST00000277531.4	37	CCDS7045.1	.	.	.	.	.	.	.	.	.	.	G	6.074	0.381937	0.11524	.	.	ENSG00000130653	ENST00000371446;ENST00000277531;ENST00000406427;ENST00000371451;ENST00000434090;ENST00000371450	T;T;T;T	0.58652	3.38;0.32;0.32;0.33	2.98	-4.54	0.03452	.	2.245010	0.01570	N	0.020522	T	0.42291	0.1196	L	0.48642	1.525	0.09310	N	1	P;B;B	0.44090	0.826;0.034;0.029	B;B;B	0.32465	0.146;0.025;0.031	T	0.43507	-0.9387	10	0.15499	T	0.54	0.1069	9.2793	0.37718	0.4178:0.0:0.5822:0.0	.	59;353;328	E2QRF8;Q6ZV29-5;Q6ZV29	.;.;PLPL7_HUMAN	Q	59;328;353;328;319;353	ENSP00000360501:P59Q;ENSP00000277531:P328Q;ENSP00000384610:P353Q;ENSP00000400582:P319Q	ENSP00000277531:P328Q	P	-	2	0	PNPLA7	139534216	0.000000	0.05858	0.000000	0.03702	0.029000	0.11900	-0.245000	0.08890	-1.010000	0.03396	-0.683000	0.03753	CCG	.		0.612	PNPLA7-007	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000254787.1	NM_152286	
CSF2RA	1438	bcgsc.ca	37	X	1422868	1422868	+	Silent	SNP	G	G	A			TCGA-PK-A5H9-01A-11D-A29I-10	TCGA-PK-A5H9-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	cb1f20fc-0df5-42f5-91b8-624bee1a532a	4fa707a6-752b-4fda-9bc0-b07c80cf65c1	g.chrX:1422868G>A	ENST00000381524.3	+	11	1185	c.999G>A	c.(997-999)gtG>gtA	p.V333V	CSF2RA_ENST00000355432.3_Intron|CSF2RA_ENST00000494969.2_Intron|CSF2RA_ENST00000381500.1_Intron|CSF2RA_ENST00000498153.1_3'UTR|CSF2RA_ENST00000417535.2_Silent_p.V367V|CSF2RA_ENST00000432318.2_Silent_p.V333V|CSF2RA_ENST00000381529.3_Silent_p.V333V|CSF2RA_ENST00000501036.2_Silent_p.V200V|CSF2RA_ENST00000381509.3_Silent_p.V333V|CSF2RA_ENST00000355805.2_Intron|CSF2RA_ENST00000361536.3_Intron			P15509	CSF2R_HUMAN	colony stimulating factor 2 receptor, alpha, low-affinity (granulocyte-macrophage)	333					response to ethanol (GO:0045471)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	cytokine receptor activity (GO:0004896)|receptor activity (GO:0004872)			central_nervous_system(2)|endometrium(6)|kidney(3)|large_intestine(6)|lung(21)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	45		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)			Sargramostim(DB00020)	TCCTAATCGTGGGAACCCTTG	0.537													g|||	1634	0.326278	0.2769	0.3156	5008	,	,		17482	0.3442		0.4056	False		,,,				2504	0.3006				p.V367V	Esophageal Squamous(131;723 1707 25334 40494 41806)	.											.	CSF2RA-42	0			c.G1101A						.		,,,,,,,,	1242,3164		172,898,1133	514.0	449.0	471.0		999,1101,999,600,999,999,,,	0.8	0.1	X	dbSNP_134	471	3695,4897		800,2095,1401	no	coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,intron,intron,intron	CSF2RA	NM_001161529.1,NM_001161530.1,NM_001161531.1,NM_001161532.1,NM_006140.4,NM_172245.2,NM_172246.2,NM_172247.2,NM_172249.2	,,,,,,,,	972,2993,2534	AA,AG,GG		43.0051,28.1888,37.9828	,,,,,,,,	333/401,367/435,333/411,200/268,333/401,333/401,,,	1422868	4937,8061	2203	4296	6499	SO:0001819	synonymous_variant	1438	exon10			AATCGTGGGAACC	M64445	CCDS35190.1, CCDS35191.1, CCDS35192.1, CCDS35193.1, CCDS55359.1, CCDS55360.1, CCDS55361.1	Xp22.32 and Yp11.3	2014-09-17			ENSG00000198223	ENSG00000198223		"""CD molecules"", ""Pseudoautosomal regions / PAR1"""	2435	protein-coding gene	gene with protein product		306250, 425000		CSF2R		1702217	Standard	NM_006140		Approved	CD116	uc010ncv.2	P15509	OTTHUMG00000012533	ENST00000381524.3:c.999G>A	X.37:g.1422868G>A		Somatic	879	9		WXS	Illumina GAIIx	Phase_I	881	18	NM_001161530	0	0	1	1	0	A7J003|A8KAM1|B4DW68|J3JS76|J3JS77|O00207|Q14429|Q14430|Q14431|Q16564	Silent	SNP	ENST00000381524.3	37	CCDS35191.1																																																																																			G|0.634;A|0.367		0.537	CSF2RA-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000035013.2		
TFDP3	51270	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	X	132351801	132351801	+	Missense_Mutation	SNP	G	G	A			TCGA-PK-A5H9-01A-11D-A29I-10	TCGA-PK-A5H9-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	cb1f20fc-0df5-42f5-91b8-624bee1a532a	4fa707a6-752b-4fda-9bc0-b07c80cf65c1	g.chrX:132351801G>A	ENST00000310125.4	-	1	575	c.487C>T	c.(487-489)Cgc>Tgc	p.R163C		NM_016521.2	NP_057605.3	Q5H9I0	TFDP3_HUMAN	transcription factor Dp family, member 3	163					cellular response to DNA damage stimulus (GO:0006974)|G1/S transition of mitotic cell cycle (GO:0000082)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|protein heterodimerization activity (GO:0046982)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.R163S(1)|p.R103S(1)		breast(1)|endometrium(2)|kidney(4)|large_intestine(1)|lung(8)|ovary(1)|prostate(2)	19	Acute lymphoblastic leukemia(192;0.000127)					TCGTAGGTGCGCCGTTTTATG	0.517																																					p.R163C		.											.	TFDP3-131	2	Substitution - Missense(2)	lung(2)	c.C487T						.						119.0	102.0	107.0					X																	132351801		2203	4300	6503	SO:0001583	missense	51270	exon1			AGGTGCGCCGTTT	AF219119	CCDS14636.2	Xq26.2	2009-03-25			ENSG00000183434	ENSG00000183434			24603	protein-coding gene	gene with protein product	"""E2F-like protein"", ""cancer/testis antigen 30"""	300772				12097419	Standard	NM_016521		Approved	HCA661, E2F-like, CT30	uc004exb.1	Q5H9I0	OTTHUMG00000022433	ENST00000310125.4:c.487C>T	X.37:g.132351801G>A	ENSP00000385461:p.Arg163Cys	Somatic	94	0		WXS	Illumina GAIIx	Phase_I	116	18	NM_016521	0	0	0	0	0	Q6DK49|Q9NZ54	Missense_Mutation	SNP	ENST00000310125.4	37	CCDS14636.2	.	.	.	.	.	.	.	.	.	.	g	14.75	2.627284	0.46944	.	.	ENSG00000183434	ENST00000310125	T	0.77489	-1.1	0.208	0.208	0.15221	Transcription factor E2F/dimerisation partner (TDP) (1);Winged helix-turn-helix transcription repressor DNA-binding (1);	.	.	.	.	D	0.87010	0.6071	M	0.89968	3.075	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.84435	0.0579	9	0.87932	D	0	.	6.1509	0.20310	4.0E-4:0.0:0.9996:0.0	.	163	Q5H9I0	TFDP3_HUMAN	C	163	ENSP00000385461:R163C	ENSP00000385461:R163C	R	-	1	0	TFDP3	132179467	0.999000	0.42202	0.078000	0.20375	0.079000	0.17450	1.886000	0.39688	0.268000	0.21939	0.271000	0.19318	CGC	.		0.517	TFDP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058337.1	NM_016521	
HLX	3142	hgsc.bcm.edu	37	1	221053600	221053601	+	In_Frame_Ins	INS	-	-	GCAGCAACAGCCGCC	rs201006102		TCGA-PK-A5H9-01A-11D-A29I-10	TCGA-PK-A5H9-10A-01D-A29L-10	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	cb1f20fc-0df5-42f5-91b8-624bee1a532a	4fa707a6-752b-4fda-9bc0-b07c80cf65c1	g.chr1:221053600_221053601insGCAGCAACAGCCGCC	ENST00000366903.6	+	1	1902_1903	c.401_402insGCAGCAACAGCCGCC	c.(400-405)cagcag>caGCAGCAACAGCCGCCgcag	p.135_136insQQPPQ	HLA-AS1_ENST00000552026.1_RNA|HLX_ENST00000549319.1_5'Flank	NM_021958.3	NP_068777.1	Q14774	HLX_HUMAN	H2.0-like homeobox	135	Poly-Gln.|Pro-rich.			QQQ -> RRE (in Ref. 1; M60721). {ECO:0000305}.	cell differentiation (GO:0030154)|embryonic digestive tract morphogenesis (GO:0048557)|enteric nervous system development (GO:0048484)|liver development (GO:0001889)|multicellular organismal development (GO:0007275)|negative regulation of T-helper 2 cell differentiation (GO:0045629)|positive regulation of cell proliferation (GO:0008284)|positive regulation of organ growth (GO:0046622)|positive regulation of T-helper 1 cell differentiation (GO:0045627)|regulation of transcription, DNA-templated (GO:0006355)|skeletal muscle tissue development (GO:0007519)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)			breast(1)|central_nervous_system(1)|endometrium(5)|large_intestine(9)|lung(11)|ovary(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	32				GBM - Glioblastoma multiforme(131;0.00914)		caacagccgcagcagcaacagc	0.718																																					p.Q134delinsQQQQPP		.											.	HLX-70	0			c.401_402insGCAGCAACAGCCGCC						.																																			SO:0001652	inframe_insertion	3142	exon1			AGCCGCAGCAGCA	BC033808	CCDS1527.1	1q41	2011-06-20	2007-07-26	2007-07-26	ENSG00000136630	ENSG00000136630		"""Homeoboxes / ANTP class : NKL subclass"""	4978	protein-coding gene	gene with protein product		142995	"""H2.0 (Drosophila)-like homeo box 1"", ""H2.0-like homeobox 1 (Drosophila)"", ""H2.0-like homeobox 1"""	HLX1		1676597, 7806220	Standard	NM_021958		Approved	HB24	uc001hmv.4	Q14774	OTTHUMG00000037352	Exception_encountered	1.37:g.221053600_221053601insGCAGCAACAGCCGCC	ENSP00000355870:p.Gln135_Gln136insGlnGlnProProGln	Somatic	23	0		WXS	Illumina GAIIx	Phase_I	92	19	NM_021958	0	0	0	0	0	B2R8A8|Q15988|Q59HE7|Q9NZ75	In_Frame_Ins	INS	ENST00000366903.6	37	CCDS1527.1																																																																																			.		0.718	HLX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090902.3	NM_021958	
ADAMTS19	171019	hgsc.bcm.edu	37	5	128797315	128797316	+	In_Frame_Ins	INS	-	-	CCCGGC	rs3980042|rs373500239|rs142924298	byFrequency	TCGA-PK-A5H9-01A-11D-A29I-10	TCGA-PK-A5H9-10A-01D-A29L-10	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	cb1f20fc-0df5-42f5-91b8-624bee1a532a	4fa707a6-752b-4fda-9bc0-b07c80cf65c1	g.chr5:128797315_128797316insCCCGGC	ENST00000274487.4	+	2	739_740	c.594_595insCCCGGC	c.(595-597)ccc>CCCGGCccc	p.199_199P>PGP	ADAMTS19-AS1_ENST00000502827.1_RNA	NM_133638.3	NP_598377.3	Q8TE59	ATS19_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 19	199	Pro-rich.					proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)	p.N198_P199insPG(1)		NS(1)|breast(4)|endometrium(10)|kidney(9)|large_intestine(14)|lung(34)|ovary(6)|pancreas(1)|prostate(6)|skin(6)	91		all_cancers(142;0.0148)|Prostate(80;0.0494)|Breast(839;0.238)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)	OV - Ovarian serous cystadenocarcinoma(64;0.222)		AGCGGCCAAATCCCGGCCCCGG	0.713														951	0.189896	0.1815	0.1254	5008	,	,		13147	0.3294		0.1083	False		,,,				2504	0.1871				p.N198delinsNPG		.											.	ADAMTS19-295	1	Insertion - In frame(1)	breast(1)	c.594_595insCCCGGC						.			443,3611		48,347,1632						-6.8	0.0		dbSNP_134	11	670,7398		63,544,3427	no	coding	ADAMTS19	NM_133638.3		111,891,5059	A1A1,A1R,RR		8.3044,10.9275,9.1817				1113,11009				SO:0001652	inframe_insertion	171019	exon2			GCCAAATCCCGGC	AJ311904	CCDS4146.1	5q23.3	2009-04-27	2005-08-19		ENSG00000145808	ENSG00000145808		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	17111	protein-coding gene	gene with protein product		607513	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 19"""			11867212	Standard	NM_133638		Approved		uc003kvb.1	Q8TE59	OTTHUMG00000128990	ENST00000274487.4:c.601_606dupCCCGGC	5.37:g.128797316_128797321dupCCCGGC	Exception_encountered	Somatic	5	2		WXS	Illumina GAIIx	Phase_I	38	7	NM_133638	0	0	0	0	0		In_Frame_Ins	INS	ENST00000274487.4	37	CCDS4146.1																																																																																			-|0.817;CCCGGC|0.183		0.713	ADAMTS19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250979.2	NM_133638	
PODXL	5420	hgsc.bcm.edu	37	7	131241029	131241030	+	In_Frame_Ins	INS	-	-	GGCGAC	rs11277659|rs547816245|rs532078953|rs79759078|rs571821675	byFrequency	TCGA-PK-A5H9-01A-11D-A29I-10	TCGA-PK-A5H9-10A-01D-A29L-10	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	cb1f20fc-0df5-42f5-91b8-624bee1a532a	4fa707a6-752b-4fda-9bc0-b07c80cf65c1	g.chr7:131241029_131241030insGGCGAC	ENST00000378555.3	-	1	336_337	c.89_90insGTCGCC	c.(88-90)ccc>ccGTCGCCc	p.30_30P>PSP	PODXL_ENST00000541194.1_In_Frame_Ins_p.30_30P>PSP|PODXL_ENST00000537928.1_In_Frame_Ins_p.30_30P>PSP|PODXL_ENST00000322985.9_In_Frame_Ins_p.30_30P>PSP|PODXL_ENST00000465001.1_Intron			O00592	PODXL_HUMAN	podocalyxin-like	30					cell adhesion (GO:0007155)|cell migration (GO:0016477)|epithelial tube formation (GO:0072175)|glomerular visceral epithelial cell development (GO:0072015)|leukocyte migration (GO:0050900)|negative regulation of cell adhesion (GO:0007162)|negative regulation of cell-cell adhesion (GO:0022408)|positive regulation of cell migration (GO:0030335)|positive regulation of cell-cell adhesion mediated by integrin (GO:0033634)|regulation of microvillus assembly (GO:0032534)	apical plasma membrane (GO:0016324)|cell body (GO:0044297)|cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|integral component of plasma membrane (GO:0005887)|lamellipodium (GO:0030027)|microvillus membrane (GO:0031528)|plasma membrane (GO:0005886)|ruffle (GO:0001726)|slit diaphragm (GO:0036057)		p.P30_S31delPS(2)		NS(1)|breast(3)|endometrium(3)|kidney(3)|large_intestine(4)|lung(4)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	24	Melanoma(18;0.162)					CATTCTGGGAGggcgacggcga	0.752																																					p.P30delinsPSP		.											.	PODXL-136	2	Deletion - In frame(2)	prostate(2)	c.90_91insGTCGCC						.																																			SO:0001652	inframe_insertion	5420	exon1			CTGGGAGGGCGAC		CCDS34755.1, CCDS47714.1	7q32-q33	2008-07-18			ENSG00000128567	ENSG00000128567			9171	protein-coding gene	gene with protein product		602632					Standard	NM_001018111		Approved	PCLP, Gp200, PC	uc003vqx.4	O00592	OTTHUMG00000154918	ENST00000378555.3:c.84_89dupGTCGCC	7.37:g.131241030_131241035dupGGCGAC	ENSP00000367817:p.SerPro30dup	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	40	12	NM_005397	0	0	0	0	0	A6NHX8|Q52LZ7|Q53ER6	In_Frame_Ins	INS	ENST00000378555.3	37	CCDS34755.1																																																																																			.		0.752	PODXL-005	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000337627.2	NM_001018111	
