#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_TTotCov	i_TVarCov	i_Transcript_Id	i_Trna_alt1	i_Trna_alt2	i_Trna_ref	i_Trna_tot	i_Trna_var	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
AKR7L	246181	broad.mit.edu	37	1	19596124	19596124	+	RNA	SNP	C	C	T	rs2235794	byFrequency	TCGA-PK-A5HA-01A-11D-A29I-10	TCGA-PK-A5HA-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2bd7613-8a82-453c-b1d0-f0ad6fbc0766	688c5eb5-c374-4bfb-81d1-c0ba622386cf	g.chr1:19596124C>T	ENST00000429712.1	-	0	676				AKR7L_ENST00000420396.2_RNA			Q8NHP1	ARK74_HUMAN	aldo-keto reductase family 7-like							extracellular vesicular exosome (GO:0070062)	oxidoreductase activity (GO:0016491)			breast(1)|endometrium(2)|ovary(1)|prostate(1)|urinary_tract(1)	6						GTGCCTGAGGCAGGGGAAGAG	0.602													.|||	3330	0.664936	0.3964	0.7334	5008	,	,		17409	0.8016		0.6918	False		,,,				2504	0.8108				.		.											.	AKR7L-90	0			.						.	C		601,783		133,335,224	83.0	84.0	84.0			3.9	1.0	1	dbSNP_98	84	2111,1071		724,663,204	no	intergenic				857,998,428	TT,TC,CC		33.6581,43.4249,40.6045			19596124	2712,1854	692	1591	2283			246181	.			CTGAGGCAGGGGA			1p36.1-p35	2008-12-09			ENSG00000211454	ENSG00000211454			24056	protein-coding gene	gene with protein product		608478				12879023	Standard	NR_040288		Approved	AFAR3	uc021ohn.1	Q8NHP1	OTTHUMG00000002520		1.37:g.19596124C>T		Somatic	373	1		WXS	Illumina GAIIx	Phase_I	231	7	.	0	0	41	41	0	Q5U614	RNA	SNP	ENST00000429712.1	37		1440	0.6593406593406593	200	0.4065040650406504	262	0.7237569060773481	462	0.8076923076923077	516	0.6807387862796834	C	21.4	4.144836	0.77888	0.434249	0.663419	ENSG00000211454	ENST00000429712;ENST00000388886	.	.	.	3.88	3.88	0.44766	NADP-dependent oxidoreductase domain (3);	0.000000	0.85682	D	0.000000	T	0.00012	0.0000	.	.	.	0.09310	P	1.0	D	0.89917	1.0	D	0.85130	0.997	T	0.39418	-0.9615	7	0.72032	D	0.01	.	14.9091	0.70743	0.0:1.0:0.0:0.0	rs2235794;rs6675160;rs59131782	186	Q8NHP1	ARK74_HUMAN	Y	186;151	.	ENSP00000373538:C151Y	C	-	2	0	AKR7L	19468711	1.000000	0.71417	1.000000	0.80357	0.961000	0.63080	7.077000	0.76814	2.161000	0.67846	0.305000	0.20034	TGC	C|0.341;T|0.659		0.602	AKR7L-001	KNOWN	basic	polymorphic_pseudogene	polymorphic_pseudogene	OTTHUMT00000007163.3	NM_201252	
LUZP1	7798	ucsc.edu;bcgsc.ca	37	1	23418153	23418153	+	Missense_Mutation	SNP	C	C	T	rs10799790	byFrequency	TCGA-PK-A5HA-01A-11D-A29I-10	TCGA-PK-A5HA-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2bd7613-8a82-453c-b1d0-f0ad6fbc0766	688c5eb5-c374-4bfb-81d1-c0ba622386cf	g.chr1:23418153C>T	ENST00000302291.4	-	4	3403	c.2602G>A	c.(2602-2604)Gac>Aac	p.D868N	LUZP1_ENST00000314174.5_Missense_Mutation_p.D868N|LUZP1_ENST00000374623.3_Missense_Mutation_p.D868N|LUZP1_ENST00000418342.1_Missense_Mutation_p.D868N			Q86V48	LUZP1_HUMAN	leucine zipper protein 1	868			D -> N (in dbSNP:rs10799790). {ECO:0000269|PubMed:12693554, ECO:0000269|PubMed:15489334}.		artery development (GO:0060840)|neural fold bending (GO:0021503)|ventricular septum development (GO:0003281)	membrane (GO:0016020)|nucleus (GO:0005634)				NS(1)|breast(1)|endometrium(6)|kidney(1)|large_intestine(8)|lung(12)|upper_aerodigestive_tract(2)	31		Colorectal(325;3.46e-05)|Lung NSC(340;4.15e-05)|all_lung(284;6.64e-05)|Renal(390;0.000219)|Ovarian(437;0.00373)|Breast(348;0.00815)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|OV - Ovarian serous cystadenocarcinoma(117;4.88e-27)|Colorectal(126;8.36e-08)|COAD - Colon adenocarcinoma(152;4.31e-06)|GBM - Glioblastoma multiforme(114;8.64e-05)|BRCA - Breast invasive adenocarcinoma(304;0.00112)|KIRC - Kidney renal clear cell carcinoma(1967;0.00176)|STAD - Stomach adenocarcinoma(196;0.0146)|READ - Rectum adenocarcinoma(331;0.0686)|Lung(427;0.0967)|LUSC - Lung squamous cell carcinoma(448;0.199)		TCTGGCCTGTCCTTCAGGGGC	0.532													T|||	3737	0.746206	0.8404	0.6225	5008	,	,		19242	0.8065		0.827	False		,,,				2504	0.5613				p.D868N		.											.	LUZP1-90	0			c.G2602A						.	T	ASN/ASP,ASN/ASP	3607,799	319.3+/-296.1	1485,637,81	106.0	101.0	103.0		2602,2602	2.7	0.6	1	dbSNP_120	103	7132,1468	279.5+/-294.0	2964,1204,132	yes	missense,missense	LUZP1	NM_001142546.1,NM_033631.3	23,23	4449,1841,213	TT,TC,CC		17.0698,18.1344,17.4304	benign,benign	868/1077,868/1077	23418153	10739,2267	2203	4300	6503	SO:0001583	missense	7798	exon4			GCCTGTCCTTCAG	BC051733	CCDS30628.1	1p36	2008-02-05			ENSG00000169641	ENSG00000169641			14985	protein-coding gene	gene with protein product		601422				8812416	Standard	NM_033631		Approved	LUZP	uc010odv.1	Q86V48	OTTHUMG00000003227	ENST00000302291.4:c.2602G>A	1.37:g.23418153C>T	ENSP00000303758:p.Asp868Asn	Somatic	74	1		WXS	Illumina GAIIx	Phase_I	41	6	NM_033631	0	0	0	0	0	Q5TH93|Q8N4X3|Q8TEH1	Missense_Mutation	SNP	ENST00000302291.4	37	CCDS30628.1	1721	0.788003663003663	407	0.8272357723577236	232	0.6408839779005525	450	0.7867132867132867	632	0.8337730870712401	T	2.972	-0.212251	0.06140	0.818656	0.829302	ENSG00000169641	ENST00000418342;ENST00000374623;ENST00000302291;ENST00000314174	T;T;T;T	0.12879	2.87;2.87;2.87;2.64	5.28	2.74	0.32292	.	0.240601	0.29335	N	0.012449	T	0.00012	0.0000	N	0.00237	-1.79	0.80722	P	0.0	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.28586	-1.0039	9	0.02654	T	1	.	6.2314	0.20736	0.0:0.0809:0.3064:0.6127	rs10799790;rs52820719;rs60368709;rs10799790	868;868	Q86V48-2;Q86V48	.;LUZP1_HUMAN	N	868	ENSP00000393460:D868N;ENSP00000363752:D868N;ENSP00000303758:D868N;ENSP00000313705:D868N	ENSP00000303758:D868N	D	-	1	0	LUZP1	23290740	0.013000	0.17824	0.591000	0.28745	0.939000	0.58152	0.800000	0.27042	0.315000	0.23110	-0.504000	0.04507	GAC	C|0.198;T|0.802		0.532	LUZP1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000008900.3	NM_033631	
OPRD1	4985	hgsc.bcm.edu	37	1	29138975	29138975	+	Missense_Mutation	SNP	G	G	T	rs1042114	byFrequency	TCGA-PK-A5HA-01A-11D-A29I-10	TCGA-PK-A5HA-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2bd7613-8a82-453c-b1d0-f0ad6fbc0766	688c5eb5-c374-4bfb-81d1-c0ba622386cf	g.chr1:29138975G>T	ENST00000234961.2	+	1	322	c.80G>T	c.(79-81)tGc>tTc	p.C27F		NM_000911.3	NP_000902.3	P41143	OPRD_HUMAN	opioid receptor, delta 1	27			C -> F (improved maturation and increased expression at the cell surface; dbSNP:rs1042114). {ECO:0000269|PubMed:10982041, ECO:0000269|PubMed:8201839, ECO:0000269|Ref.4}.		adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|adult locomotory behavior (GO:0008344)|cellular response to growth factor stimulus (GO:0071363)|cellular response to hypoxia (GO:0071456)|cellular response to toxic substance (GO:0097237)|G-protein coupled receptor signaling pathway (GO:0007186)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|immune response (GO:0006955)|negative regulation of gene expression (GO:0010629)|negative regulation of protein oligomerization (GO:0032460)|neuropeptide signaling pathway (GO:0007218)|opioid receptor signaling pathway (GO:0038003)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|positive regulation of CREB transcription factor activity (GO:0032793)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|protein import into nucleus, translocation (GO:0000060)|regulation of calcium ion transport (GO:0051924)|regulation of mitochondrial membrane potential (GO:0051881)|regulation of sensory perception of pain (GO:0051930)	axon terminus (GO:0043679)|cytoplasm (GO:0005737)|dendrite membrane (GO:0032590)|integral component of plasma membrane (GO:0005887)|intrinsic component of plasma membrane (GO:0031226)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|vesicle (GO:0031982)	enkephalin receptor activity (GO:0038046)|opioid receptor activity (GO:0004985)			breast(1)|central_nervous_system(1)|kidney(3)|large_intestine(1)|lung(2)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	15		Colorectal(325;3.46e-05)|Lung NSC(340;0.000947)|all_lung(284;0.00131)|Renal(390;0.00758)|Breast(348;0.00765)|all_neural(195;0.0199)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0563)|Medulloblastoma(700;0.123)		Colorectal(126;1.29e-07)|COAD - Colon adenocarcinoma(152;7.51e-06)|STAD - Stomach adenocarcinoma(196;0.00306)|BRCA - Breast invasive adenocarcinoma(304;0.0241)|READ - Rectum adenocarcinoma(331;0.0649)|KIRC - Kidney renal clear cell carcinoma(1967;0.147)	Alvimopan(DB06274)|Amitriptyline(DB00321)|Buprenorphine(DB00921)|Butorphanol(DB00611)|Codeine(DB00318)|Dextromethorphan(DB00514)|Dextropropoxyphene(DB00647)|Diphenoxylate(DB01081)|Fentanyl(DB00813)|Heroin(DB01452)|Hydrocodone(DB00956)|Hydromorphone(DB00327)|Ketamine(DB01221)|Ketobemidone(DB06738)|Levorphanol(DB00854)|Loperamide(DB00836)|Methadone(DB00333)|Morphine(DB00295)|Nalbuphine(DB00844)|Naloxone(DB01183)|Naltrexone(DB00704)|Oxycodone(DB00497)|Oxymorphone(DB01192)|Remifentanil(DB00899)|Sufentanil(DB00708)|Tapentadol(DB06204)|Tramadol(DB00193)	CCTAGCGCCTGCCCCAGCGCT	0.771													T|||	4730	0.944489	0.9796	0.9193	5008	,	,		9147	1.0		0.8678	False		,,,				2504	0.9366				p.C27F		.											.	OPRD1-69	0			c.G80T						.	T	PHE/CYS	3689,115		1788,113,1	4.0	6.0	5.0	http://www.ncbi.nlm.nih.gov/omim/103780,165195|http://omim.org/entry/165195|http://omim.org/entry/103780	80	2.9	1.0	1	dbSNP_86	5	6762,846		2982,798,24	no	missense	OPRD1	NM_000911.3	205	4770,911,25	TT,TG,GG		11.1199,3.0231,8.421	benign	27/373	29138975	10451,961	1902	3804	5706	SO:0001583	missense	4985	exon1			GCGCCTGCCCCAG	U10504	CCDS329.1	1p36.1-p34.3	2012-08-08			ENSG00000116329	ENSG00000116329		"""GPCR / Class A : Opioid receptors"""	8153	protein-coding gene	gene with protein product		165195				8415697	Standard	NM_000911		Approved		uc001brf.1	P41143	OTTHUMG00000003646	ENST00000234961.2:c.80G>T	1.37:g.29138975G>T	ENSP00000234961:p.Cys27Phe	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	8	8	NM_000911	0	0	0	0	0	B5B0B8	Missense_Mutation	SNP	ENST00000234961.2	37	CCDS329.1	2035	0.9317765567765568	474	0.9634146341463414	331	0.914364640883978	572	1.0	658	0.8680738786279684	T	0.016	-1.513433	0.00975	0.969769	0.888801	ENSG00000116329	ENST00000234961;ENST00000536280	T	0.67698	-0.28	4.0	2.89	0.33648	.	1.802200	0.02327	N	0.073605	T	0.00012	0.0000	N	0.01874	-0.695	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.41342	-0.9514	9	0.09338	T	0.73	.	3.8109	0.08796	0.0:0.1144:0.2238:0.6618	rs1042114;rs59349662;rs1042114	27	P41143	OPRD_HUMAN	F	27	ENSP00000234961:C27F	ENSP00000234961:C27F	C	+	2	0	OPRD1	29011562	0.002000	0.14202	0.992000	0.48379	0.116000	0.19942	0.521000	0.22893	0.713000	0.32060	-0.694000	0.03704	TGC	G|0.061;T|0.939		0.771	OPRD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000010330.1	NM_000911	
KCNQ4	9132	bcgsc.ca	37	1	41296828	41296828	+	Missense_Mutation	SNP	T	T	G	rs34287852	byFrequency	TCGA-PK-A5HA-01A-11D-A29I-10	TCGA-PK-A5HA-10A-01D-A29L-10	T	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2bd7613-8a82-453c-b1d0-f0ad6fbc0766	688c5eb5-c374-4bfb-81d1-c0ba622386cf	g.chr1:41296828T>G	ENST00000347132.5	+	10	1447	c.1365T>G	c.(1363-1365)caT>caG	p.H455Q	KCNQ4_ENST00000509682.2_Missense_Mutation_p.H401Q|KCNQ4_ENST00000506017.1_3'UTR	NM_004700.3|NM_172163.2	NP_004691.2|NP_751895.1	P56696	KCNQ4_HUMAN	potassium voltage-gated channel, KQT-like subfamily, member 4	455			H -> Q (in dbSNP:rs34287852). {ECO:0000269|PubMed:10025409}.		inner ear morphogenesis (GO:0042472)|potassium ion transport (GO:0006813)|sensory perception of sound (GO:0007605)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|potassium channel activity (GO:0005267)			central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(8)|lung(13)|skin(1)	26	Ovarian(52;0.00769)|all_hematologic(146;0.0977)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;1.38e-17)		Ezogabine(DB04953)	CCAAGCAGCATCTGGCACCTC	0.642													T|||	471	0.0940495	0.0061	0.1124	5008	,	,		14942	0.0516		0.2167	False		,,,				2504	0.1176				p.H455Q		.											.	KCNQ4-90	0			c.T1365G	GRCh37	CM062786	KCNQ4	M	rs34287852	.	T	GLN/HIS,GLN/HIS	215,4187		3,209,1989	43.0	34.0	37.0		1365,1203	2.0	1.0	1	dbSNP_126	37	2062,6538		256,1550,2494	yes	missense,missense	KCNQ4	NM_004700.3,NM_172163.2	24,24	259,1759,4483	GG,GT,TT		23.9767,4.8841,17.5127	benign,benign	455/696,401/642	41296828	2277,10725	2201	4300	6501	SO:0001583	missense	9132	exon10			GCAGCATCTGGCA	AF105202	CCDS456.1	1p34	2012-07-05			ENSG00000117013	ENSG00000117013		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6298	protein-coding gene	gene with protein product		603537		DFNA2		10025409, 16382104	Standard	NM_004700		Approved	Kv7.4	uc001cgh.2	P56696	OTTHUMG00000007730	ENST00000347132.5:c.1365T>G	1.37:g.41296828T>G	ENSP00000262916:p.His455Gln	Somatic	315	4		WXS	Illumina GAIIx	Phase_I	197	8	NM_004700	0	0	0	0	0	O96025	Missense_Mutation	SNP	ENST00000347132.5	37	CCDS456.1	244|244	0.11172161172161173|0.11172161172161173	5|5	0.01016260162601626|0.01016260162601626	48|48	0.13259668508287292|0.13259668508287292	33|33	0.057692307692307696|0.057692307692307696	158|158	0.20844327176781002|0.20844327176781002	T|T	10.83|10.83	1.461499|1.461499	0.26248|0.26248	0.048841|0.048841	0.239767|0.239767	ENSG00000117013|ENSG00000117013	ENST00000347132;ENST00000509682|ENST00000443478	D;D|.	0.98717|.	-5.09;-4.95|.	5.02|5.02	2.05|2.05	0.26809|0.26809	.|.	0.530165|.	0.18743|.	N|.	0.132418|.	T|T	0.00012|0.00012	0.0000|0.0000	N|N	0.14661|0.14661	0.345|0.345	0.35098|0.35098	P|P	0.23502900000000004|0.23502900000000004	B;B|.	0.17465|.	0.001;0.022|.	B;B|.	0.10450|.	0.001;0.005|.	T|T	0.35251|0.35251	-0.9796|-0.9796	9|4	0.17832|.	T|.	0.49|.	-13.1202|-13.1202	7.873|7.873	0.29578|0.29578	0.0:0.7067:0.0:0.2933|0.0:0.7067:0.0:0.2933	rs34287852|rs34287852	401;455|.	P56696-2;P56696|.	.;KCNQ4_HUMAN|.	Q|A	455;401|316	ENSP00000262916:H455Q;ENSP00000423756:H401Q|.	ENSP00000262916:H455Q|.	H|S	+|+	3|1	2|0	KCNQ4|KCNQ4	41069415|41069415	0.995000|0.995000	0.38212|0.38212	1.000000|1.000000	0.80357|0.80357	0.970000|0.970000	0.65996|0.65996	0.412000|0.412000	0.21131|0.21131	0.215000|0.215000	0.20761|0.20761	-0.394000|-0.394000	0.06481|0.06481	CAT|TCT	T|0.858;G|0.142		0.642	KCNQ4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000020812.1	NM_004700	
DMAP1	55929	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	44685739	44685739	+	Nonsense_Mutation	SNP	C	C	T			TCGA-PK-A5HA-01A-11D-A29I-10	TCGA-PK-A5HA-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2bd7613-8a82-453c-b1d0-f0ad6fbc0766	688c5eb5-c374-4bfb-81d1-c0ba622386cf	g.chr1:44685739C>T	ENST00000372289.2	+	9	1365	c.1102C>T	c.(1102-1104)Cga>Tga	p.R368*	DMAP1_ENST00000361745.6_Nonsense_Mutation_p.R368*|DMAP1_ENST00000488433.1_3'UTR|DMAP1_ENST00000315913.5_Nonsense_Mutation_p.R368*	NM_019100.4	NP_061973.1	Q9NPF5	DMAP1_HUMAN	DNA methyltransferase 1 associated protein 1	368					chromatin organization (GO:0006325)|chromatin remodeling (GO:0006338)|DNA methylation (GO:0006306)|DNA repair (GO:0006281)|histone H2A acetylation (GO:0043968)|histone H4 acetylation (GO:0043967)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription factor import into nucleus (GO:0042993)|regulation of growth (GO:0040008)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|NuA4 histone acetyltransferase complex (GO:0035267)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|replication fork (GO:0005657)	chromatin binding (GO:0003682)|RNA polymerase II repressing transcription factor binding (GO:0001103)|transcription corepressor activity (GO:0003714)			breast(1)|cervix(1)|endometrium(6)|large_intestine(1)|lung(4)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	16	Acute lymphoblastic leukemia(166;0.155)					CAATGAGCTGCGAAGCGACCT	0.647											OREG0013438	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.R368X		.											.	DMAP1-226	0			c.C1102T						.						22.0	22.0	22.0					1																	44685739		2203	4300	6503	SO:0001587	stop_gained	55929	exon10			GAGCTGCGAAGCG	AB037846	CCDS509.1	1p34	2009-07-13			ENSG00000178028	ENSG00000178028			18291	protein-coding gene	gene with protein product		605077				10888872, 10718198	Standard	XM_005271039		Approved	DNMAP1, FLJ11543, KIAA1425, DNMTAP1, EAF2, MEAF2, SWC4	uc001clq.1	Q9NPF5	OTTHUMG00000007577	ENST00000372289.2:c.1102C>T	1.37:g.44685739C>T	ENSP00000361363:p.Arg368*	Somatic	117	0	925	WXS	Illumina GAIIx	Phase_I	83	27	NM_001034024	0	0	29	37	8	A8K001|D3DPY8|Q0JSM4|Q5TG41|Q7Z3H7|Q9H0S8|Q9P2C2	Nonsense_Mutation	SNP	ENST00000372289.2	37	CCDS509.1	.	.	.	.	.	.	.	.	.	.	C	26.7	4.762488	0.89932	.	.	ENSG00000178028	ENST00000361745;ENST00000315913;ENST00000372289	.	.	.	4.83	2.83	0.33086	.	0.120386	0.56097	D	0.000026	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-12.1336	10.956	0.47358	0.1468:0.712:0.1412:0.0	.	.	.	.	X	368	.	ENSP00000312697:R368X	R	+	1	2	DMAP1	44458326	1.000000	0.71417	0.992000	0.48379	0.721000	0.41392	4.468000	0.60162	0.395000	0.25257	0.313000	0.20887	CGA	.		0.647	DMAP1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000020027.3	NM_019100	
IPP	3652	hgsc.bcm.edu;broad.mit.edu	37	1	46165768	46165768	+	Missense_Mutation	SNP	G	G	C			TCGA-PK-A5HA-01A-11D-A29I-10	TCGA-PK-A5HA-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2bd7613-8a82-453c-b1d0-f0ad6fbc0766	688c5eb5-c374-4bfb-81d1-c0ba622386cf	g.chr1:46165768G>C	ENST00000396478.3	-	9	1727	c.1625C>G	c.(1624-1626)tCt>tGt	p.S542C	IPP_ENST00000495072.1_5'UTR	NM_005897.2	NP_005888.1	Q9Y573	IPP_HUMAN	intracisternal A particle-promoted polypeptide	542						actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)	actin binding (GO:0003779)			central_nervous_system(1)|endometrium(1)|kidney(4)|large_intestine(6)|lung(5)|ovary(1)|stomach(2)	20	Acute lymphoblastic leukemia(166;0.155)					ATGGCTGGAAGATCGACCTCC	0.443																																					p.S542C		.											.	IPP-91	0			c.C1625G						.						147.0	145.0	145.0					1																	46165768		2203	4300	6503	SO:0001583	missense	3652	exon9			CTGGAAGATCGAC	BC032544	CCDS30702.1, CCDS44132.1	1p34-p32	2013-01-30			ENSG00000197429	ENSG00000197429		"""Kelch-like"", ""BTB/POZ domain containing"""	6108	protein-coding gene	gene with protein product	"""kelch-like family member 27"""	147485				1905535, 8432546	Standard	NM_005897		Approved	KLHL27	uc001cou.3	Q9Y573	OTTHUMG00000008004	ENST00000396478.3:c.1625C>G	1.37:g.46165768G>C	ENSP00000379739:p.Ser542Cys	Somatic	92	0		WXS	Illumina GAIIx	Phase_I	61	4	NM_001145349	0	0	6	7	1	A2A6V4|D3DQ11|Q8N5C3	Missense_Mutation	SNP	ENST00000396478.3	37	CCDS30702.1	.	.	.	.	.	.	.	.	.	.	G	27.9	4.870349	0.91587	.	.	ENSG00000197429	ENST00000359942;ENST00000396478	T;T	0.78707	-0.79;-1.2	5.87	5.87	0.94306	Galactose oxidase, beta-propeller (1);	0.143377	0.48767	D	0.000170	T	0.77232	0.4100	L	0.31804	0.96	0.58432	D	0.999993	P;P	0.44521	0.83;0.837	P;P	0.47981	0.563;0.469	T	0.79200	-0.1901	10	0.87932	D	0	.	20.2147	0.98293	0.0:0.0:1.0:0.0	.	542;542	Q9Y573;A2A6V3	IPP_HUMAN;.	C	542	ENSP00000353024:S542C;ENSP00000379739:S542C	ENSP00000353024:S542C	S	-	2	0	IPP	45938355	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.123000	0.94387	2.785000	0.95823	0.591000	0.81541	TCT	.		0.443	IPP-001	KNOWN	mRNA_end_NF|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000021974.3	NM_005897	
PTGFR	5737	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	1	78958569	78958569	+	Silent	SNP	C	C	A			TCGA-PK-A5HA-01A-11D-A29I-10	TCGA-PK-A5HA-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2bd7613-8a82-453c-b1d0-f0ad6fbc0766	688c5eb5-c374-4bfb-81d1-c0ba622386cf	g.chr1:78958569C>A	ENST00000370757.3	+	2	378	c.141C>A	c.(139-141)gcC>gcA	p.A47A	PTGFR_ENST00000370756.3_Silent_p.A47A|PTGFR_ENST00000370758.1_Silent_p.A47A	NM_000959.3	NP_000950.1	P43088	PF2R_HUMAN	prostaglandin F receptor (FP)	47					calcium-mediated signaling using intracellular calcium source (GO:0035584)|G-protein coupled receptor signaling pathway (GO:0007186)|negative regulation of apoptotic process (GO:0043066)|parturition (GO:0007567)|response to lipopolysaccharide (GO:0032496)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	prostaglandin F receptor activity (GO:0004958)			breast(6)|endometrium(2)|kidney(1)|large_intestine(6)|lung(11)|ovary(3)|prostate(1)|skin(2)|urinary_tract(1)	33				Colorectal(170;0.248)	Bimatoprost(DB00905)|Dinoprost Tromethamine(DB01160)|Latanoprost(DB00654)|Tafluprost(DB08819)|Travoprost(DB00287)	ACAGCCTTGCCATCGCCATTC	0.458																																					p.A47A		.											.	PTGFR-527	0			c.C141A						.						109.0	107.0	107.0					1																	78958569		2203	4300	6503	SO:0001819	synonymous_variant	5737	exon2			CCTTGCCATCGCC	AF004021	CCDS686.1, CCDS30759.1	1p31.1	2012-08-08			ENSG00000122420	ENSG00000122420		"""GPCR / Class A : Prostanoid receptors"""	9600	protein-coding gene	gene with protein product		600563				8300593, 7759114	Standard	XM_006710781		Approved	FP	uc001din.3	P43088	OTTHUMG00000009644	ENST00000370757.3:c.141C>A	1.37:g.78958569C>A		Somatic	139	0		WXS	Illumina GAIIx	Phase_I	84	60	NM_000959	0	0	0	0	0	A8K9Y0|Q2KHP3|Q6RYQ6|Q9P1X4	Silent	SNP	ENST00000370757.3	37	CCDS686.1																																																																																			.		0.458	PTGFR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000026582.1	NM_000959	
ELTD1	64123	ucsc.edu	37	1	79404917	79404917	+	Missense_Mutation	SNP	C	C	G			TCGA-PK-A5HA-01A-11D-A29I-10	TCGA-PK-A5HA-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2bd7613-8a82-453c-b1d0-f0ad6fbc0766	688c5eb5-c374-4bfb-81d1-c0ba622386cf	g.chr1:79404917C>G	ENST00000370742.3	-	4	415	c.352G>C	c.(352-354)Gat>Cat	p.D118H		NM_022159.3	NP_071442.2	Q9HBW9	ELTD1_HUMAN	EGF, latrophilin and seven transmembrane domain containing 1	118					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)			NS(1)|breast(1)|endometrium(3)|kidney(2)|large_intestine(10)|lung(45)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	69				COAD - Colon adenocarcinoma(225;0.0905)|Colorectal(170;0.103)|all cancers(265;0.105)|Epithelial(280;0.148)		CAGACATTATCTAAATGGCAG	0.239																																					p.D118H		.											.	ELTD1-24	0			c.G352C						.						40.0	40.0	40.0					1																	79404917		1779	4032	5811	SO:0001583	missense	64123	exon4			CATTATCTAAATG	AF192403	CCDS41352.1	1p33-p32	2014-08-08			ENSG00000162618	ENSG00000162618		"""-"", ""GPCR / Class B : Orphans"""	20822	protein-coding gene	gene with protein product						11050079	Standard	NM_022159		Approved	ETL	uc001diq.4	Q9HBW9	OTTHUMG00000009738	ENST00000370742.3:c.352G>C	1.37:g.79404917C>G	ENSP00000359778:p.Asp118His	Somatic	183	0		WXS	Illumina GAIIx	Phase_I	95	1	NM_022159	0	0	13	15	2	B1AR71|Q5KU34	Missense_Mutation	SNP	ENST00000370742.3	37	CCDS41352.1	.	.	.	.	.	.	.	.	.	.	C	16.18	3.049363	0.55218	.	.	ENSG00000162618	ENST00000370742	T	0.38240	1.15	6.07	5.16	0.70880	.	0.238522	0.48767	D	0.000170	T	0.19805	0.0476	L	0.59436	1.845	0.37405	D	0.913013	P	0.47106	0.89	B	0.42692	0.395	T	0.12344	-1.0551	9	.	.	.	.	6.1684	0.20404	0.1614:0.6864:0.0:0.1523	.	118	Q9HBW9	ELTD1_HUMAN	H	118	ENSP00000359778:D118H	.	D	-	1	0	ELTD1	79177505	0.999000	0.42202	0.998000	0.56505	0.862000	0.49288	1.043000	0.30316	1.588000	0.49971	0.585000	0.79938	GAT	.		0.239	ELTD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000026859.1	NM_022159	
EPS8L3	79574	bcgsc.ca	37	1	110302006	110302006	+	Missense_Mutation	SNP	C	C	T			TCGA-PK-A5HA-01A-11D-A29I-10	TCGA-PK-A5HA-10A-01D-A29L-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2bd7613-8a82-453c-b1d0-f0ad6fbc0766	688c5eb5-c374-4bfb-81d1-c0ba622386cf	g.chr1:110302006C>T	ENST00000361965.4	-	5	365	c.259G>A	c.(259-261)Gag>Aag	p.E87K	RP4-735C1.4_ENST00000431955.1_RNA|EPS8L3_ENST00000494151.1_5'UTR|EPS8L3_ENST00000369805.3_Missense_Mutation_p.E87K|EPS8L3_ENST00000361852.4_Missense_Mutation_p.E87K	NM_133181.3	NP_573444.2	Q8TE67	ES8L3_HUMAN	EPS8-like 3	87						cytoplasm (GO:0005737)				breast(1)|endometrium(3)|large_intestine(6)|lung(15)|ovary(5)|skin(1)|upper_aerodigestive_tract(1)	32		all_epithelial(167;1.95e-05)|all_lung(203;0.000135)|Lung NSC(277;0.000269)		Lung(183;0.0245)|Colorectal(144;0.0365)|all cancers(265;0.103)|Epithelial(280;0.109)|LUSC - Lung squamous cell carcinoma(189;0.137)|COAD - Colon adenocarcinoma(174;0.141)		GAGTCCAGCTCCTCCTGGGCC	0.597																																					p.E87K		.											.	EPS8L3-93	0			c.G259A						.						97.0	98.0	98.0					1																	110302006		2203	4300	6503	SO:0001583	missense	79574	exon5			CCAGCTCCTCCTG	AK025175	CCDS813.1, CCDS814.1, CCDS815.1	1p13.2	2008-02-05			ENSG00000198758	ENSG00000198758			21297	protein-coding gene	gene with protein product		614989				12620401	Standard	NM_139053		Approved	FLJ21522, MGC16817	uc001dyq.2	Q8TE67	OTTHUMG00000011651	ENST00000361965.4:c.259G>A	1.37:g.110302006C>T	ENSP00000355255:p.Glu87Lys	Somatic	327	2		WXS	Illumina GAIIx	Phase_I	179	7	NM_133181	0	0	0	0	0	A8K833|Q5T8Q6|Q5T8Q7|Q5T8Q8|Q96E47|Q9H719	Missense_Mutation	SNP	ENST00000361965.4	37	CCDS814.1	.	.	.	.	.	.	.	.	.	.	C	28.9	4.960330	0.92791	.	.	ENSG00000198758	ENST00000361852;ENST00000369805;ENST00000361965	T;T;T	0.33654	1.4;1.4;1.4	5.1	5.1	0.69264	Tensin phosphotyrosine-binding domain (1);	0.403645	0.29737	N	0.011329	T	0.52757	0.1754	M	0.81497	2.545	0.47905	D	0.999543	D;D;D;D	0.71674	0.996;0.995;0.996;0.998	D;D;D;D	0.68353	0.942;0.928;0.957;0.911	T	0.52268	-0.8598	10	0.38643	T	0.18	-19.9393	15.7847	0.78294	0.0:1.0:0.0:0.0	.	87;87;87;87	A8K2J6;Q8TE67-2;Q8TE67;Q8TE67-3	.;.;ES8L3_HUMAN;.	K	87	ENSP00000354551:E87K;ENSP00000358820:E87K;ENSP00000355255:E87K	ENSP00000354551:E87K	E	-	1	0	EPS8L3	110103529	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	5.726000	0.68515	2.518000	0.84900	0.655000	0.94253	GAG	.		0.597	EPS8L3-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000032234.1	NM_024526	
FLG	2312	ucsc.edu	37	1	152276598	152276598	+	Silent	SNP	G	G	A	rs12742178	byFrequency	TCGA-PK-A5HA-01A-11D-A29I-10	TCGA-PK-A5HA-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2bd7613-8a82-453c-b1d0-f0ad6fbc0766	688c5eb5-c374-4bfb-81d1-c0ba622386cf	g.chr1:152276598G>A	ENST00000368799.1	-	3	10799	c.10764C>T	c.(10762-10764)caC>caT	p.H3588H	FLG-AS1_ENST00000420707.1_RNA|FLG-AS1_ENST00000593011.1_RNA	NM_002016.1	NP_002007.1	P20930	FILA_HUMAN	filaggrin	3588	Ser-rich.				establishment of skin barrier (GO:0061436)|keratinocyte differentiation (GO:0030216)|multicellular organismal development (GO:0007275)	cytoplasmic membrane-bounded vesicle (GO:0016023)|intermediate filament (GO:0005882)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|structural molecule activity (GO:0005198)			autonomic_ganglia(1)|breast(13)|central_nervous_system(5)|cervix(2)|endometrium(38)|haematopoietic_and_lymphoid_tissue(1)|kidney(16)|large_intestine(57)|lung(211)|ovary(13)|pancreas(1)|prostate(15)|skin(24)|stomach(5)|upper_aerodigestive_tract(10)|urinary_tract(12)	424	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			CAGAGTGCCCGTGACCGGCTC	0.557									Ichthyosis				G|||	444	0.0886581	0.0227	0.0965	5008	,	,		15977	0.1984		0.0199	False		,,,				2504	0.1299				p.H3588H		.											.	FLG-106	0			c.C10764T						.						187.0	241.0	223.0					1																	152276598		2199	4293	6492	SO:0001819	synonymous_variant	2312	exon3	Familial Cancer Database	X-linked Ichthyosis, Steroid Sulfatase Deficiency, Ichthyosis Vulgaris	GTGCCCGTGACCG	XM_048104	CCDS30860.1	1q21.3	2013-01-10			ENSG00000143631	ENSG00000143631		"""EF-hand domain containing"""	3748	protein-coding gene	gene with protein product		135940				2740331, 2248957, 16444271	Standard	NM_002016		Approved		uc001ezu.1	P20930	OTTHUMG00000012202	ENST00000368799.1:c.10764C>T	1.37:g.152276598G>A		Somatic	221	32		WXS	Illumina GAIIx	Phase_I	114	53	NM_002016	0	0	0	0	0	Q01720|Q5T583|Q9UC71	Silent	SNP	ENST00000368799.1	37	CCDS30860.1																																																																																			G|0.963;A|0.037		0.557	FLG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033742.1	NM_002016	
KIRREL	55243	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	158058193	158058193	+	Missense_Mutation	SNP	G	G	T			TCGA-PK-A5HA-01A-11D-A29I-10	TCGA-PK-A5HA-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2bd7613-8a82-453c-b1d0-f0ad6fbc0766	688c5eb5-c374-4bfb-81d1-c0ba622386cf	g.chr1:158058193G>T	ENST00000359209.6	+	8	1060	c.993G>T	c.(991-993)tgG>tgT	p.W331C	KIRREL_ENST00000392272.2_Missense_Mutation_p.W228C|KIRREL_ENST00000368172.1_Missense_Mutation_p.W129C|KIRREL_ENST00000416935.2_Missense_Mutation_p.W231C|KIRREL_ENST00000360089.4_Missense_Mutation_p.W167C|KIRREL_ENST00000368173.3_Missense_Mutation_p.W331C			Q96J84	KIRR1_HUMAN	kin of IRRE like (Drosophila)	331	Ig-like C2-type 4.				excretion (GO:0007588)|negative regulation of protein phosphorylation (GO:0001933)|positive regulation of actin filament polymerization (GO:0030838)|single organismal cell-cell adhesion (GO:0016337)	cell-cell junction (GO:0005911)|dendritic shaft (GO:0043198)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	myosin binding (GO:0017022)			NS(1)|autonomic_ganglia(1)|breast(2)|cervix(1)|endometrium(7)|kidney(2)|large_intestine(5)|lung(9)|ovary(1)|prostate(5)|skin(3)|stomach(1)	38	all_hematologic(112;0.0378)					CCTGTGTCTGGGTTGGGAATC	0.453																																					p.W331C		.											.	KIRREL-91	0			c.G993T						.						118.0	115.0	116.0					1																	158058193		2203	4300	6503	SO:0001583	missense	55243	exon8			TGTCTGGGTTGGG	AK001707	CCDS1172.2, CCDS72952.1	1q21-q25	2013-01-29			ENSG00000183853	ENSG00000183853		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	15734	protein-coding gene	gene with protein product	"""nephrin-like protein 1"""	607428				12424224	Standard	NM_001286349		Approved	NEPH1	uc001frn.4	Q96J84	OTTHUMG00000022438	ENST00000359209.6:c.993G>T	1.37:g.158058193G>T	ENSP00000352138:p.Trp331Cys	Somatic	192	1		WXS	Illumina GAIIx	Phase_I	207	42	NM_018240	0	0	3	3	0	Q5W0F8|Q5XKC6|Q7Z696|Q7Z7N8|Q8TB15|Q9H9N1|Q9NVA5	Missense_Mutation	SNP	ENST00000359209.6	37	CCDS1172.2	.	.	.	.	.	.	.	.	.	.	G	21.8	4.202537	0.79127	.	.	ENSG00000183853	ENST00000360089;ENST00000368173;ENST00000392272;ENST00000359209;ENST00000416935;ENST00000368172	T;T;T;T;T;T	0.12255	2.7;2.7;2.7;2.7;2.7;2.7	5.08	5.08	0.68730	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.35838	N	0.002949	T	0.18635	0.0447	L	0.34521	1.04	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	0.999;1.0;0.998;1.0	T	0.01635	-1.1307	10	0.51188	T	0.08	-18.4027	15.9486	0.79813	0.0:0.0:1.0:0.0	.	231;167;129;331	B4DN67;Q5W0F9;Q5W0G0;Q96J84	.;.;.;KIRR1_HUMAN	C	167;331;228;331;231;129	ENSP00000353202:W167C;ENSP00000357155:W331C;ENSP00000376098:W228C;ENSP00000352138:W331C;ENSP00000389674:W231C;ENSP00000357154:W129C	ENSP00000352138:W331C	W	+	3	0	KIRREL	156324817	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.141000	0.94612	2.362000	0.80069	0.557000	0.71058	TGG	.		0.453	KIRREL-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000058342.3	NM_018240	
ATP1A4	480	broad.mit.edu;bcgsc.ca	37	1	160141212	160141212	+	Silent	SNP	C	C	T			TCGA-PK-A5HA-01A-11D-A29I-10	TCGA-PK-A5HA-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2bd7613-8a82-453c-b1d0-f0ad6fbc0766	688c5eb5-c374-4bfb-81d1-c0ba622386cf	g.chr1:160141212C>T	ENST00000368081.4	+	11	2134	c.1663C>T	c.(1663-1665)Ctg>Ttg	p.L555L	ATP1A4_ENST00000418334.1_3'UTR	NM_144699.3	NP_653300.2	Q13733	AT1A4_HUMAN	ATPase, Na+/K+ transporting, alpha 4 polypeptide	555					ATP biosynthetic process (GO:0006754)|ATP hydrolysis coupled proton transport (GO:0015991)|fertilization (GO:0009566)|ion transmembrane transport (GO:0034220)|potassium ion transport (GO:0006813)|regulation of cellular pH (GO:0030641)|regulation of membrane potential (GO:0042391)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)|sperm motility (GO:0030317)|spermatogenesis (GO:0007283)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|sodium:potassium-exchanging ATPase complex (GO:0005890)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|sodium:potassium-exchanging ATPase activity (GO:0005391)			breast(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(16)|lung(34)|ovary(2)|prostate(4)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(2)	75	all_cancers(52;2.56e-18)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.111)			ACTGGGAGGTCTGGGGGAACG	0.443																																					p.L555L		.											.	ATP1A4-94	0			c.C1663T						.						73.0	72.0	72.0					1																	160141212		2203	4300	6503	SO:0001819	synonymous_variant	480	exon11			GGAGGTCTGGGGG	BC028297	CCDS1197.1, CCDS44255.1	1q23.2	2012-10-22	2002-02-25		ENSG00000132681	ENSG00000132681		"""ATPases / P-type"""	14073	protein-coding gene	gene with protein product	"""sodium/potassium-transporting ATPase subunit alpha-4"", ""sodium pump subunit alpha-4"", ""sodium-potassium ATPase catalytic subunit alpha-4"""	607321	"""ATPase, Na+/K+ transporting, alpha polypeptide-like 2"""	ATP1AL2		1981991, 3035563	Standard	NM_144699		Approved		uc001fve.4	Q13733	OTTHUMG00000031609	ENST00000368081.4:c.1663C>T	1.37:g.160141212C>T		Somatic	135	0		WXS	Illumina GAIIx	Phase_I	148	6	NM_144699	0	0	0	0	0	Q504T2|Q7Z4I9|Q8TBN8|Q8WXA7|Q8WXH7|Q8WY13	Silent	SNP	ENST00000368081.4	37	CCDS1197.1																																																																																			.		0.443	ATP1A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077415.1	NM_144699	
SLAMF6	114836	broad.mit.edu;bcgsc.ca	37	1	160460476	160460476	+	Splice_Site	SNP	C	C	A			TCGA-PK-A5HA-01A-11D-A29I-10	TCGA-PK-A5HA-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2bd7613-8a82-453c-b1d0-f0ad6fbc0766	688c5eb5-c374-4bfb-81d1-c0ba622386cf	g.chr1:160460476C>A	ENST00000368057.3	-	4	707		c.e4-1		SLAMF6_ENST00000368055.1_Splice_Site|SLAMF6_ENST00000368059.3_Splice_Site			Q96DU3	SLAF6_HUMAN	SLAM family member 6							extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(4)|lung(8)|ovary(1)|pancreas(1)|skin(4)	22	all_cancers(52;1.05e-18)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.0923)			ATTTTAACATCTGAAAAGAGA	0.398																																					.		.											.	SLAMF6-228	0			c.647-1G>T						.						53.0	53.0	53.0					1																	160460476		2203	4300	6503	SO:0001630	splice_region_variant	114836	exon5			TAACATCTGAAAA	AL832854	CCDS1205.1, CCDS53393.1, CCDS53394.1	1q23.1	2013-01-29			ENSG00000162739	ENSG00000162739		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	21392	protein-coding gene	gene with protein product		606446				11489943	Standard	NM_052931		Approved	KALI, NTBA, KALIb, Ly108, SF2000, NTB-A, CD352	uc001fwe.2	Q96DU3	OTTHUMG00000022729	ENST00000368057.3:c.647-1G>T	1.37:g.160460476C>A		Somatic	117	0		WXS	Illumina GAIIx	Phase_I	140	6	NM_052931	0	0	0	0	0	A6NMW2|B2R8X8|Q14CF0|Q5TAS4|Q5TAS6|Q5TAT3|Q96DV0	Splice_Site	SNP	ENST00000368057.3	37	CCDS53394.1	.	.	.	.	.	.	.	.	.	.	C	13.75	2.328895	0.41197	.	.	ENSG00000162739	ENST00000368059;ENST00000368057;ENST00000368055	.	.	.	4.62	4.62	0.57501	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.3434	0.60557	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	SLAMF6	158727100	0.930000	0.31532	0.886000	0.34754	0.085000	0.17905	1.858000	0.39408	2.290000	0.77057	0.655000	0.94253	.	.		0.398	SLAMF6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000059010.1	NM_052931	Intron
ITLN1	55600	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	160850441	160850441	+	Missense_Mutation	SNP	G	G	A			TCGA-PK-A5HA-01A-11D-A29I-10	TCGA-PK-A5HA-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2bd7613-8a82-453c-b1d0-f0ad6fbc0766	688c5eb5-c374-4bfb-81d1-c0ba622386cf	g.chr1:160850441G>A	ENST00000326245.3	-	6	737	c.622C>T	c.(622-624)Cct>Tct	p.P208S	ITLN1_ENST00000487531.1_5'UTR	NM_017625.2	NP_060095.2	Q8WWA0	ITLN1_HUMAN	intelectin 1 (galactofuranose binding)	208	Fibrinogen C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00739}.				positive regulation of glucose import (GO:0046326)|positive regulation of protein phosphorylation (GO:0001934)|response to nematode (GO:0009624)	anchored component of membrane (GO:0031225)|brush border membrane (GO:0031526)|extracellular vesicular exosome (GO:0070062)|membrane raft (GO:0045121)|receptor complex (GO:0043235)	carbohydrate binding (GO:0030246)			breast(1)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(1)|lung(6)|ovary(2)|pancreas(1)|skin(3)|upper_aerodigestive_tract(1)	21	all_cancers(52;2.99e-17)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.00737)			TAGACCACAGGGATCACCGGG	0.443																																					p.P208S		.											.	ITLN1-96	0			c.C622T						.						181.0	179.0	180.0					1																	160850441		2203	4300	6503	SO:0001583	missense	55600	exon6			CCACAGGGATCAC	AB036706	CCDS1211.1	1q21.3	2008-02-05			ENSG00000179914	ENSG00000179914			18259	protein-coding gene	gene with protein product		609873				11313366, 11181563	Standard	NM_017625		Approved	ITLN, FLJ20022, LFR, HL-1, hIntL	uc001fxc.3	Q8WWA0	OTTHUMG00000028604	ENST00000326245.3:c.622C>T	1.37:g.160850441G>A	ENSP00000323587:p.Pro208Ser	Somatic	131	0		WXS	Illumina GAIIx	Phase_I	168	80	NM_017625	0	0	0	0	0	Q5IWS4|Q5VYI4|Q6YDJ3|Q9NP67	Missense_Mutation	SNP	ENST00000326245.3	37	CCDS1211.1	.	.	.	.	.	.	.	.	.	.	G	13.22	2.172056	0.38315	.	.	ENSG00000179914	ENST00000326245	T	0.20069	2.1	4.17	3.25	0.37280	Fibrinogen, alpha/beta/gamma chain, C-terminal globular (2);	0.000000	0.64402	D	0.000006	T	0.21103	0.0508	M	0.83692	2.655	0.43536	D	0.995829	P	0.49961	0.93	P	0.47864	0.559	T	0.04078	-1.0979	10	0.62326	D	0.03	-10.3178	9.5912	0.39548	0.1051:0.0:0.8949:0.0	.	208	Q8WWA0	ITLN1_HUMAN	S	208	ENSP00000323587:P208S	ENSP00000323587:P208S	P	-	1	0	ITLN1	159117065	0.995000	0.38212	0.629000	0.29254	0.208000	0.24298	4.043000	0.57354	0.938000	0.37419	0.655000	0.94253	CCT	.		0.443	ITLN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000071462.1	NM_017625	
PAPPA2	60676	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	176564267	176564267	+	Missense_Mutation	SNP	G	G	C			TCGA-PK-A5HA-01A-11D-A29I-10	TCGA-PK-A5HA-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2bd7613-8a82-453c-b1d0-f0ad6fbc0766	688c5eb5-c374-4bfb-81d1-c0ba622386cf	g.chr1:176564267G>C	ENST00000367662.3	+	3	2691	c.1527G>C	c.(1525-1527)ttG>ttC	p.L509F	PAPPA2_ENST00000367661.3_Missense_Mutation_p.L509F	NM_020318.2	NP_064714.2	Q9BXP8	PAPP2_HUMAN	pappalysin 2	509	Metalloprotease.				bone morphogenesis (GO:0060349)|cell differentiation (GO:0030154)|cellular protein metabolic process (GO:0044267)|proteolysis (GO:0006508)|regulation of cell growth (GO:0001558)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|membrane (GO:0016020)	metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			NS(3)|breast(3)|central_nervous_system(7)|cervix(5)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(19)|lung(136)|ovary(7)|pancreas(1)|prostate(4)|skin(10)|upper_aerodigestive_tract(8)|urinary_tract(1)	226						ATGTGGAATTGATCTCCCAGT	0.532																																					p.L509F		.											.	PAPPA2-548	0			c.G1527C						.						56.0	57.0	57.0					1																	176564267		1982	4163	6145	SO:0001583	missense	60676	exon3			GGAATTGATCTCC	BG354569	CCDS41438.1, CCDS41439.1	1q23-q25	2008-05-23	2004-07-07	2004-07-09	ENSG00000116183	ENSG00000116183			14615	protein-coding gene	gene with protein product			"""placenta-specific 3"""	PLAC3		11018262, 11264294	Standard	NM_021936		Approved	PAPPE, PAPP-A2	uc001gkz.3	Q9BXP8	OTTHUMG00000035025	ENST00000367662.3:c.1527G>C	1.37:g.176564267G>C	ENSP00000356634:p.Leu509Phe	Somatic	107	0		WXS	Illumina GAIIx	Phase_I	116	47	NM_020318	0	0	0	0	0	A9Z1Y8|Q96PH7|Q96PH8|Q9H4C9	Missense_Mutation	SNP	ENST00000367662.3	37	CCDS41438.1	.	.	.	.	.	.	.	.	.	.	G	11.19	1.565720	0.27915	.	.	ENSG00000116183	ENST00000367662;ENST00000367661	T;T	0.44881	0.91;0.91	5.32	0.997	0.19851	.	0.157237	0.44902	D	0.000417	T	0.56615	0.1997	M	0.67953	2.075	0.39623	D	0.970067	D;D	0.76494	0.996;0.999	D;D	0.68943	0.943;0.961	T	0.59252	-0.7489	10	0.72032	D	0.01	-4.0782	10.5337	0.44992	0.0713:0.3889:0.5398:0.0	.	509;509	Q9BXP8;A9Z1Y8	PAPP2_HUMAN;.	F	509	ENSP00000356634:L509F;ENSP00000356633:L509F	ENSP00000356633:L509F	L	+	3	2	PAPPA2	174830890	1.000000	0.71417	0.796000	0.32109	0.014000	0.08584	0.672000	0.25187	0.210000	0.20664	0.650000	0.86243	TTG	.		0.532	PAPPA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084763.1		
TOR3A	64222	hgsc.bcm.edu	37	1	179051300	179051300	+	Missense_Mutation	SNP	T	T	C	rs2296377	byFrequency	TCGA-PK-A5HA-01A-11D-A29I-10	TCGA-PK-A5HA-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2bd7613-8a82-453c-b1d0-f0ad6fbc0766	688c5eb5-c374-4bfb-81d1-c0ba622386cf	g.chr1:179051300T>C	ENST00000367627.3	+	1	789	c.37T>C	c.(37-39)Ttc>Ctc	p.F13L	TOR3A_ENST00000352445.6_Missense_Mutation_p.F13L	NM_022371.3	NP_071766.2	Q9H497	TOR3A_HUMAN	torsin family 3, member A	13			F -> L (in dbSNP:rs2296377). {ECO:0000269|PubMed:14702039, ECO:0000269|PubMed:15489334, ECO:0000269|Ref.3}.		ATP catabolic process (GO:0006200)|chaperone mediated protein folding requiring cofactor (GO:0051085)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum lumen (GO:0005788)|extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)			endometrium(1)|kidney(2)|large_intestine(4)|lung(4)|pancreas(1)|urinary_tract(1)	13						TTGGCTCTTTTTCCTGCTGCT	0.751													C|||	3842	0.767173	0.9879	0.6441	5008	,	,		12722	0.6677		0.7117	False		,,,				2504	0.7157				p.F13L		.											.	TOR3A-90	0			c.T37C						.	C	LEU/PHE	3262,174		1547,168,3	2.0	3.0	3.0		37	-0.8	0.0	1	dbSNP_100	3	5365,1739		2051,1263,238	yes	missense	TOR3A	NM_022371.3	22	3598,1431,241	CC,CT,TT		24.4792,5.064,18.1499	benign	13/398	179051300	8627,1913	1718	3552	5270	SO:0001583	missense	64222	exon1			CTCTTTTTCCTGC	BC001085	CCDS1329.1	1q25.2	2008-02-05	2003-04-02		ENSG00000186283	ENSG00000186283			11997	protein-coding gene	gene with protein product		607555	"""ATP-dependant interferon responsive"""	ADIR		10644435	Standard	NM_022371		Approved	FLJ22345, ADIR2	uc001gmd.3	Q9H497	OTTHUMG00000035077	ENST00000367627.3:c.37T>C	1.37:g.179051300T>C	ENSP00000356599:p.Phe13Leu	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	6	6	NM_022371	0	0	0	2	2	B4DSY0|B7ZB65|Q5M7Y7|Q8WVA7|Q8WWM2|Q9H495|Q9H6E7	Missense_Mutation	SNP	ENST00000367627.3	37	CCDS1329.1	1679	0.7687728937728938	484	0.983739837398374	250	0.6906077348066298	393	0.6870629370629371	552	0.7282321899736148	C	0.033	-1.323382	0.01309	0.94936	0.755208	ENSG00000186283	ENST00000367627;ENST00000367625;ENST00000352445	T;T;T	0.35421	1.31;1.4;1.63	0.427	-0.794	0.10918	.	1.274350	0.05916	N	0.632520	T	0.00012	0.0000	N	0.00368	-1.59	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.45906	-0.9229	8	0.02654	T	1	-1.1524	.	.	.	rs2296377;rs17844883;rs17856371;rs17857600;rs17857917;rs17858479;rs59034332;rs2296377	13	Q9H497	TOR3A_HUMAN	L	13	ENSP00000356599:F13L;ENSP00000356597:F13L;ENSP00000335351:F13L	ENSP00000335351:F13L	F	+	1	0	TOR3A	177317923	0.000000	0.05858	0.002000	0.10522	0.004000	0.04260	-1.490000	0.02304	-1.608000	0.01587	-1.610000	0.00802	TTC	T|0.229;C|0.771		0.751	TOR3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084927.1	NM_022371	
TOR1AIP1	26092	broad.mit.edu	37	1	179851685	179851685	+	Silent	SNP	T	T	G			TCGA-PK-A5HA-01A-11D-A29I-10	TCGA-PK-A5HA-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2bd7613-8a82-453c-b1d0-f0ad6fbc0766	688c5eb5-c374-4bfb-81d1-c0ba622386cf	g.chr1:179851685T>G	ENST00000606911.2	+	1	239	c.48T>G	c.(46-48)ggT>ggG	p.G16G	TOR1AIP1_ENST00000435319.4_5'Flank|RP11-533E19.7_ENST00000610272.1_lincRNA|TOR1AIP1_ENST00000528443.2_Silent_p.G16G|TOR1AIP1_ENST00000271583.3_Silent_p.G16G			Q5JTV8	TOIP1_HUMAN	torsin A interacting protein 1	16					positive regulation of ATPase activity (GO:0032781)	integral component of membrane (GO:0016021)|nucleus (GO:0005634)	ATPase activator activity (GO:0001671)|ATPase binding (GO:0051117)|cytoskeletal protein binding (GO:0008092)			breast(4)|central_nervous_system(1)|endometrium(3)|large_intestine(2)|lung(4)|ovary(2)|skin(1)|urinary_tract(1)	18						AAGGATGGGGTGTGTACGTCA	0.647																																					p.G16G		.											.	TOR1AIP1-153	0			c.T48G						.						10.0	9.0	10.0					1																	179851685		2175	4267	6442	SO:0001819	synonymous_variant	26092	exon1			ATGGGGTGTGTAC		CCDS1335.1, CCDS65737.1	1q24.2	2008-02-05			ENSG00000143337	ENSG00000143337			29456	protein-coding gene	gene with protein product	"""lamina associated polypeptide 1B"""	614512				12061773, 15767459	Standard	NM_015602		Approved	LAP1B, FLJ13142	uc001gnp.2	Q5JTV8	OTTHUMG00000035257	ENST00000606911.2:c.48T>G	1.37:g.179851685T>G		Somatic	77	8		WXS	Illumina GAIIx	Phase_I	101	18	NM_001267578	0	0	18	18	0	A8K630|B0QZ57|Q5JTV6|Q8IZ65|Q9H8Y6|Q9HAJ1|Q9NV52|Q9Y3X5	Silent	SNP	ENST00000606911.2	37	CCDS1335.1																																																																																			.		0.647	TOR1AIP1-004	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000100313.4	NM_015602	
CACNA1E	777	broad.mit.edu	37	1	181745248	181745248	+	Silent	SNP	G	G	C			TCGA-PK-A5HA-01A-11D-A29I-10	TCGA-PK-A5HA-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2bd7613-8a82-453c-b1d0-f0ad6fbc0766	688c5eb5-c374-4bfb-81d1-c0ba622386cf	g.chr1:181745248G>C	ENST00000367573.2	+	38	5151	c.5151G>C	c.(5149-5151)ctG>ctC	p.L1717L	CACNA1E_ENST00000526775.1_Silent_p.L1698L|CACNA1E_ENST00000367567.4_Silent_p.L1324L|CACNA1E_ENST00000358338.5_Silent_p.L1649L|CACNA1E_ENST00000357570.5_Silent_p.L1668L|CACNA1E_ENST00000360108.3_Silent_p.L1698L|CACNA1E_ENST00000367570.1_Silent_p.L1717L	NM_001205293.1	NP_001192222.1	Q15878	CAC1E_HUMAN	calcium channel, voltage-dependent, R type, alpha 1E subunit	1717					calcium ion import (GO:0070509)|energy reserve metabolic process (GO:0006112)|membrane depolarization (GO:0051899)|membrane depolarization during action potential (GO:0086010)|regulation of insulin secretion (GO:0050796)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transport (GO:0006810)	plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	calcium ion binding (GO:0005509)|high voltage-gated calcium channel activity (GO:0008331)|voltage-gated calcium channel activity (GO:0005245)			NS(2)|breast(9)|central_nervous_system(3)|cervix(1)|endometrium(22)|haematopoietic_and_lymphoid_tissue(6)|kidney(4)|large_intestine(34)|lung(99)|ovary(6)|pancreas(1)|prostate(9)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	204						TGCTCAACCTGTTTGTGGCCG	0.557																																					p.L1717L		.											.	CACNA1E-95	0			c.G5151C						.						230.0	230.0	230.0					1																	181745248		2010	4192	6202	SO:0001819	synonymous_variant	777	exon38			CAACCTGTTTGTG	AK096563	CCDS53443.1, CCDS55664.1, CCDS55665.1	1q25.3	2013-01-10	2007-02-16		ENSG00000198216	ENSG00000198216		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"", ""EF-hand domain containing"""	1392	protein-coding gene	gene with protein product		601013		CACNL1A6		8388125, 16382099	Standard	NM_001205293		Approved	Cav2.3, BII, CACH6	uc009wxt.3	Q15878	OTTHUMG00000037301	ENST00000367573.2:c.5151G>C	1.37:g.181745248G>C		Somatic	114	0		WXS	Illumina GAIIx	Phase_I	156	5	NM_000721	0	0	0	0	0	B1AM12|B1AM13|B1AM14|Q14580|Q14581	Silent	SNP	ENST00000367573.2	37	CCDS55664.1																																																																																			.		0.557	CACNA1E-003	KNOWN	non_canonical_U12|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000090793.2	NM_000721	
SOX13	9580	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	204093978	204093978	+	Missense_Mutation	SNP	G	G	A			TCGA-PK-A5HA-01A-11D-A29I-10	TCGA-PK-A5HA-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2bd7613-8a82-453c-b1d0-f0ad6fbc0766	688c5eb5-c374-4bfb-81d1-c0ba622386cf	g.chr1:204093978G>A	ENST00000367204.1	+	13	1694	c.1585G>A	c.(1585-1587)Gtg>Atg	p.V529M		NM_005686.2	NP_005677.2	Q9UN79	SOX13_HUMAN	SRY (sex determining region Y)-box 13	529					anatomical structure morphogenesis (GO:0009653)|regulation of gamma-delta T cell differentiation (GO:0045586)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(3)|lung(2)|ovary(2)|prostate(2)	13	all_cancers(21;0.0754)|Breast(84;0.116)|all_epithelial(62;0.189)		KIRC - Kidney renal clear cell carcinoma(13;0.0584)|Kidney(21;0.0934)|BRCA - Breast invasive adenocarcinoma(75;0.109)			CCAGAGCTACGTGATCCCGTG	0.652																																					p.V529M		.											.	SOX13-514	0			c.G1585A						.						11.0	15.0	14.0					1																	204093978		2149	4241	6390	SO:0001583	missense	9580	exon13			AGCTACGTGATCC		CCDS44299.1	1q32	2008-07-18			ENSG00000143842	ENSG00000143842		"""SRY (sex determining region Y)-boxes"""	11192	protein-coding gene	gene with protein product	"""islet cell antibody 12"", ""SRY-related HMG-box gene 13"", ""type 1 diabetes autoantigen"", ""SRY-box 13"""	604748				10198172	Standard	NM_005686		Approved	Sox-13, ICA12, MGC117216	uc001ham.3	Q9UN79	OTTHUMG00000036050	ENST00000367204.1:c.1585G>A	1.37:g.204093978G>A	ENSP00000356172:p.Val529Met	Somatic	210	0		WXS	Illumina GAIIx	Phase_I	210	90	NM_005686	0	0	0	0	0	B4E2B0|O95275|O95826|Q3KQV7|Q5SXX1|Q9UHW7	Missense_Mutation	SNP	ENST00000367204.1	37	CCDS44299.1	.	.	.	.	.	.	.	.	.	.	G	11.34	1.610283	0.28712	.	.	ENSG00000143842	ENST00000367204	T	0.42513	0.97	5.53	0.0196	0.14121	.	1.153750	0.06073	N	0.660400	T	0.18087	0.0434	N	0.12182	0.205	0.09310	N	1	P;B;P	0.39131	0.661;0.349;0.661	B;B;B	0.21546	0.035;0.035;0.035	T	0.15065	-1.0450	10	0.54805	T	0.06	.	3.1662	0.06536	0.2034:0.2837:0.4103:0.1026	.	396;396;529	B4DX26;B4E3N9;Q9UN79	.;.;SOX13_HUMAN	M	529	ENSP00000356172:V529M	ENSP00000356172:V529M	V	+	1	0	SOX13	202360601	0.015000	0.18098	0.021000	0.16686	0.846000	0.48090	-0.079000	0.11357	0.022000	0.15160	0.491000	0.48974	GTG	.		0.652	SOX13-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087881.2	NM_005686	
KCNH1	3756	broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	210971042	210971042	+	Missense_Mutation	SNP	C	C	G			TCGA-PK-A5HA-01A-11D-A29I-10	TCGA-PK-A5HA-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2bd7613-8a82-453c-b1d0-f0ad6fbc0766	688c5eb5-c374-4bfb-81d1-c0ba622386cf	g.chr1:210971042C>G	ENST00000271751.4	-	9	1750	c.1723G>C	c.(1723-1725)Gtg>Ctg	p.V575L	KCNH1_ENST00000367007.4_Missense_Mutation_p.V548L			O95259	KCNH1_HUMAN	potassium voltage-gated channel, subfamily H (eag-related), member 1	575					myoblast fusion (GO:0007520)|potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)	nucleus (GO:0005634)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|phosphorelay sensor kinase activity (GO:0000155)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(13)|lung(35)|ovary(4)|prostate(4)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	68				OV - Ovarian serous cystadenocarcinoma(81;0.0109)|all cancers(67;0.141)|Epithelial(68;0.185)		TCCTTGAACACCTTGCGGTTC	0.607																																					p.V575L		.											.	KCNH1-94	0			c.G1723C						.						64.0	60.0	61.0					1																	210971042		2203	4300	6503	SO:0001583	missense	3756	exon9			TGAACACCTTGCG	AJ001366	CCDS1496.1, CCDS31015.1	1q32.2	2012-07-05			ENSG00000143473	ENSG00000143473		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6250	protein-coding gene	gene with protein product		603305				9738473, 16382104	Standard	NM_172362		Approved	Kv10.1, eag, h-eag, eag1	uc001hib.2	O95259	OTTHUMG00000036309	ENST00000271751.4:c.1723G>C	1.37:g.210971042C>G	ENSP00000271751:p.Val575Leu	Somatic	207	0		WXS	Illumina GAIIx	Phase_I	246	23	NM_172362	0	0	0	0	0	B1AQ26|O76035|Q14CL3	Missense_Mutation	SNP	ENST00000271751.4	37	CCDS1496.1	.	.	.	.	.	.	.	.	.	.	C	15.33	2.801009	0.50315	.	.	ENSG00000143473	ENST00000271751;ENST00000367007	D;D	0.96136	-3.92;-3.92	5.36	5.36	0.76844	Cyclic nucleotide-binding-like (1);RmlC-like jelly roll fold (1);	0.060118	0.64402	D	0.000002	D	0.93403	0.7896	L	0.39566	1.225	0.80722	D	1	B;B	0.29162	0.235;0.058	B;B	0.33339	0.162;0.102	D	0.91058	0.4883	10	0.31617	T	0.26	.	19.0956	0.93249	0.0:1.0:0.0:0.0	.	548;575	Q14CL3;O95259	.;KCNH1_HUMAN	L	575;548	ENSP00000271751:V575L;ENSP00000355974:V548L	ENSP00000271751:V575L	V	-	1	0	KCNH1	209037665	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	7.531000	0.81973	2.506000	0.84524	0.655000	0.94253	GTG	.		0.607	KCNH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000088332.1	NM_002238	
OBSCN	84033	hgsc.bcm.edu	37	1	228504670	228504670	+	Missense_Mutation	SNP	C	C	T	rs11810627	byFrequency	TCGA-PK-A5HA-01A-11D-A29I-10	TCGA-PK-A5HA-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2bd7613-8a82-453c-b1d0-f0ad6fbc0766	688c5eb5-c374-4bfb-81d1-c0ba622386cf	g.chr1:228504670C>T	ENST00000422127.1	+	51	13590	c.13546C>T	c.(13546-13548)Cgg>Tgg	p.R4516W	OBSCN_ENST00000366707.4_Missense_Mutation_p.R2150W|OBSCN_ENST00000570156.2_Missense_Mutation_p.R5473W|OBSCN_ENST00000284548.11_Missense_Mutation_p.R4516W|OBSCN_ENST00000366709.4_Missense_Mutation_p.R1635W	NM_001098623.2	NP_001092093.2	Q5VST9	OBSCN_HUMAN	obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF	4516	Ig-like 46.		R -> W (in dbSNP:rs11810627).		apoptotic signaling pathway (GO:0097190)|multicellular organismal development (GO:0007275)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|protein localization to M-band (GO:0036309)|regulation of small GTPase mediated signal transduction (GO:0051056)|sarcomere organization (GO:0045214)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|M band (GO:0031430)|myofibril (GO:0030016)|Z disc (GO:0030018)	ankyrin binding (GO:0030506)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|structural constituent of muscle (GO:0008307)|titin binding (GO:0031432)			NS(2)|breast(7)|central_nervous_system(5)|cervix(2)|endometrium(30)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(37)|lung(89)|ovary(8)|pancreas(3)|prostate(13)|skin(6)|stomach(11)|upper_aerodigestive_tract(2)|urinary_tract(3)	223		Prostate(94;0.0405)				GGCCTCTGCGCGGCTCACCGT	0.736													c|||	1654	0.330272	0.2791	0.4006	5008	,	,		13971	0.249		0.4861	False		,,,				2504	0.273				p.R5473W		.											.	OBSCN-403	0			c.C16417T						.		TRP/ARG,TRP/ARG	923,2833		165,593,1120	5.0	6.0	6.0		13546,13546	-1.0	0.0	1	dbSNP_120	6	3333,4245		861,1611,1317	yes	missense,missense	OBSCN	NM_001098623.1,NM_052843.2	101,101	1026,2204,2437	TT,TC,CC		43.9826,24.574,37.5507	probably-damaging,probably-damaging	4516/7969,4516/6621	228504670	4256,7078	1878	3789	5667	SO:0001583	missense	84033	exon62			TCTGCGCGGCTCA	AJ002535	CCDS1570.2, CCDS58065.1, CCDS59204.1	1q42	2014-09-17			ENSG00000154358	ENSG00000154358		"""Rho guanine nucleotide exchange factors"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	15719	protein-coding gene	gene with protein product		608616				11448995, 11814696	Standard	NM_001098623		Approved	KIAA1556, UNC89, KIAA1639, ARHGEF30	uc001hsq.2	Q5VST9	OTTHUMG00000039772	ENST00000422127.1:c.13546C>T	1.37:g.228504670C>T	ENSP00000409493:p.Arg4516Trp	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	56	55	NM_001271223	0	0	0	0	0	Q2A664|Q5T7G8|Q5T7G9|Q5VSU2|Q86YC7|Q8NHN0|Q8NHN1|Q8NHN2|Q8NHN3|Q8NHN4|Q8NHN5|Q8NHN6|Q8NHN7|Q8NHN8|Q8NHN9|Q96AA2|Q9HCD3|Q9HCL6	Missense_Mutation	SNP	ENST00000422127.1	37	CCDS58065.1	774	0.3543956043956044	137	0.2784552845528455	144	0.39779005524861877	134	0.23426573426573427	359	0.4736147757255937	c	11.94	1.787178	0.31593	0.24574	0.439826	ENSG00000154358	ENST00000284548;ENST00000422127;ENST00000366707;ENST00000366709	T;T;T;T	0.77098	-1.07;-1.07;0.2;0.2	5.41	-0.971	0.10303	Immunoglobulin subtype (1);Fibronectin, type III (1);Immunoglobulin-like fold (1);	0.167607	0.36519	N	0.002550	T	0.00012	0.0000	L	0.41824	1.3	0.50632	P	1.1499999999997623E-4	B;B	0.22541	0.071;0.067	B;B	0.12156	0.007;0.007	T	0.42275	-0.9461	9	0.45353	T	0.12	.	10.3619	0.43998	0.6084:0.317:0.0:0.0747	rs11810627	4516;4516	Q5VST9;Q5VST9-3	OBSCN_HUMAN;.	W	4516;4516;2150;1635	ENSP00000284548:R4516W;ENSP00000409493:R4516W;ENSP00000355668:R2150W;ENSP00000355670:R1635W	ENSP00000284548:R4516W	R	+	1	2	OBSCN	226571293	0.968000	0.33430	0.013000	0.15412	0.016000	0.09150	2.032000	0.41127	-0.028000	0.13850	0.550000	0.68814	CGG	C|0.643;T|0.357		0.736	OBSCN-204	KNOWN	basic|CCDS	protein_coding	protein_coding		NM_052843	
DISC1	27185	bcgsc.ca	37	1	232098998	232098998	+	Intron	SNP	C	C	A			TCGA-PK-A5HA-01A-11D-A29I-10	TCGA-PK-A5HA-10A-01D-A29L-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2bd7613-8a82-453c-b1d0-f0ad6fbc0766	688c5eb5-c374-4bfb-81d1-c0ba622386cf	g.chr1:232098998C>A	ENST00000439617.2	+	10	2095				DISC1_ENST00000366637.3_Intron|DISC1_ENST00000535983.1_Intron|DISC1_ENST00000427560.1_Intron|DISC1_ENST00000537876.1_Intron	NM_001164537.1|NM_001164540.1|NM_018662.2	NP_001158009.1|NP_001158012.1|NP_061132.2	Q9NRI5	DISC1_HUMAN	disrupted in schizophrenia 1						canonical Wnt signaling pathway (GO:0060070)|cell proliferation in forebrain (GO:0021846)|cellular protein localization (GO:0034613)|cerebral cortex radially oriented cell migration (GO:0021799)|microtubule cytoskeleton organization (GO:0000226)|mitochondrial calcium ion homeostasis (GO:0051560)|neuron migration (GO:0001764)|positive regulation of neuroblast proliferation (GO:0002052)|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000060)|positive regulation of Wnt signaling pathway (GO:0030177)|regulation of neuron projection development (GO:0010975)|regulation of synapse maturation (GO:0090128)|TOR signaling (GO:0031929)	cell junction (GO:0030054)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|microtubule (GO:0005874)|mitochondrion (GO:0005739)|postsynaptic membrane (GO:0045211)				breast(1)|cervix(1)|kidney(1)|large_intestine(1)|liver(2)|lung(6)|skin(2)|upper_aerodigestive_tract(1)	15		all_cancers(173;0.0208)|Prostate(94;0.0975)				AATGCCATTGCATTTTTTTTT	0.383																																					.		.											.	.	0			.						.																																			SO:0001627	intron_variant	0	.			CCATTGCATTTTT	AF222980	CCDS31055.1, CCDS31056.1, CCDS53482.1, CCDS53483.1, CCDS53484.1, CCDS59205.1, CCDS59206.1, CCDS59207.1	1q42.1	2008-02-05			ENSG00000162946	ENSG00000162946			2888	protein-coding gene	gene with protein product		605210				10814723	Standard	NM_001164550		Approved		uc010pxh.2	Q9NRI5	OTTHUMG00000037835	ENST00000439617.2:c.2042+4364C>A	1.37:g.232098998C>A		Somatic	68	0		WXS	Illumina GAIIx	Phase_I	49	7	.	0	0	0	0	0	A6NLH2|C4P091|C4P095|C4P0A1|C4P0A3|C4P0B3|C4P0B6|C4P0C1|C9J6D0|O75045|Q5VT44|Q5VT45|Q8IXJ0|Q8IXJ1|Q9BX19|Q9NRI3|Q9NRI4	RNA	SNP	ENST00000439617.2	37																																																																																				.		0.383	DISC1-001	KNOWN	non_canonical_conserved|basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000092351.2	NM_018662	
OR2M2	391194	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	248343508	248343508	+	Missense_Mutation	SNP	T	T	A			TCGA-PK-A5HA-01A-11D-A29I-10	TCGA-PK-A5HA-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2bd7613-8a82-453c-b1d0-f0ad6fbc0766	688c5eb5-c374-4bfb-81d1-c0ba622386cf	g.chr1:248343508T>A	ENST00000359682.2	+	1	221	c.221T>A	c.(220-222)aTc>aAc	p.I74N		NM_001004688.1	NP_001004688.1	Q96R28	OR2M2_HUMAN	olfactory receptor, family 2, subfamily M, member 2	74						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|autonomic_ganglia(1)|breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|lung(45)|ovary(3)|prostate(1)|skin(3)	70	all_cancers(71;0.000149)|all_epithelial(71;1.27e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0245)			CTCATGCTCATCTGCACCACC	0.502																																					p.I74N		.											.	OR2M2-72	0			c.T221A						.						267.0	257.0	260.0					1																	248343508		2203	4297	6500	SO:0001583	missense	391194	exon1			TGCTCATCTGCAC	AF399616	CCDS31106.1	1q44	2012-08-09			ENSG00000198601	ENSG00000198601		"""GPCR / Class A : Olfactory receptors"""	8268	protein-coding gene	gene with protein product						12213199	Standard	NM_001004688		Approved	OST423, OR2M2Q	uc010pzf.2	Q96R28	OTTHUMG00000040460	ENST00000359682.2:c.221T>A	1.37:g.248343508T>A	ENSP00000352710:p.Ile74Asn	Somatic	264	1		WXS	Illumina GAIIx	Phase_I	256	46	NM_001004688	0	0	0	0	0	A3KFT4	Missense_Mutation	SNP	ENST00000359682.2	37	CCDS31106.1	.	.	.	.	.	.	.	.	.	.	t	11.41	1.629952	0.28978	.	.	ENSG00000198601	ENST00000359682	T	0.00424	7.45	2.03	-2.71	0.05986	GPCR, rhodopsin-like superfamily (1);	0.585147	0.12867	U	0.432637	T	0.00580	0.0019	M	0.81179	2.53	0.09310	N	1	P	0.48640	0.913	P	0.51135	0.66	T	0.36286	-0.9754	10	0.87932	D	0	.	4.8624	0.13590	0.0:0.3627:0.1595:0.4778	.	74	Q96R28	OR2M2_HUMAN	N	74	ENSP00000352710:I74N	ENSP00000352710:I74N	I	+	2	0	OR2M2	246410131	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	-0.204000	0.09425	-0.657000	0.05373	0.373000	0.22412	ATC	.		0.502	OR2M2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097356.2	NM_001004688	
PTPLA	9200	hgsc.bcm.edu	37	10	17659149	17659149	+	Missense_Mutation	SNP	C	C	G	rs7895850	byFrequency	TCGA-PK-A5HA-01A-11D-A29I-10	TCGA-PK-A5HA-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2bd7613-8a82-453c-b1d0-f0ad6fbc0766	688c5eb5-c374-4bfb-81d1-c0ba622386cf	g.chr10:17659149C>G	ENST00000361271.3	-	1	227	c.190G>C	c.(190-192)Gag>Cag	p.E64Q	PTPLA_ENST00000326961.6_Missense_Mutation_p.E64Q	NM_014241.3	NP_055056.3	B0YJ81	HACD1_HUMAN	protein tyrosine phosphatase-like (proline instead of catalytic arginine), member A	64			E -> K (in dbSNP:rs7895850). {ECO:0000269|PubMed:10644438, ECO:0000269|PubMed:11054553, ECO:0000269|PubMed:15489334}.|E -> Q (in dbSNP:rs7895850). {ECO:0000269|PubMed:11054553}.		fatty acid biosynthetic process (GO:0006633)|multicellular organismal development (GO:0007275)|myotube differentiation (GO:0014902)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|regulation of G1/S transition of mitotic cell cycle (GO:2000045)|regulation of G2/M transition of mitotic cell cycle (GO:0010389)|signal transduction (GO:0007165)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	lyase activity (GO:0016829)|protein tyrosine phosphatase activity (GO:0004725)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(1)|large_intestine(2)|lung(6)|skin(1)	13						CGCCTCCGCTCGCCGGGAGCC	0.766													T|||	543	0.108427	0.0401	0.121	5008	,	,		6575	0.2321		0.1103	False		,,,				2504	0.0624				p.E64Q		.											.	PTPLA-226	0			c.G190C						.	T	LYS/GLN/GLU	2648,64,0		1292,64,0,0,0,0	2.0	4.0	4.0		190	2.0	0.1	10	dbSNP_116	4	4685,237,0		2230,225,0,6,0,0	no	missense	PTPLA	NM_014241.3	29,56	3522,289,0,6,0,0	TT,TG,TC,GG,GC,CC		4.8151,2.3599,3.9429	benign	64/289	17659149	7333,301,0	1356	2461	3817	SO:0001583	missense	9200	exon1			TCCGCTCGCCGGG	AF114494	CCDS7121.1	10p14-p13	2008-08-01	2005-11-11		ENSG00000165996	ENSG00000165996			9639	protein-coding gene	gene with protein product	"""cementum attachment protein"""	610467	"""protein tyrosine phosphatase-like (proline instead of catalytic arginine), member a"""			10644438	Standard	XM_005252641		Approved	CAP	uc001ipg.3	B0YJ81	OTTHUMG00000017750	ENST00000361271.3:c.190G>C	10.37:g.17659149C>G	ENSP00000355308:p.Glu64Gln	Somatic	1	0		WXS	Illumina GAIIx	Phase_I	42	42	NM_014241	0	0	0	2	2	B0YJ80|Q6JIC5|Q96FW7|Q9HB93|Q9UHX2	Missense_Mutation	SNP	ENST00000361271.3	37	CCDS7121.1	.	.	.	.	.	.	.	.	.	.	T	6.487	0.458102	0.12342	0.023599	0.0481510000000001	ENSG00000165996	ENST00000361271;ENST00000326961	T;T	0.19105	2.75;2.17	3.35	2.04	0.26737	.	0.660756	0.13666	N	0.371221	T	0.01156	0.0038	N	0.08118	0	0.09310	N	0.999999	B;B;B	0.23854	0.092;0.009;0.007	B;B;B	0.12837	0.008;0.001;0.002	T	0.33137	-0.9880	10	0.24483	T	0.36	-20.0823	3.214	0.06692	0.0:0.1393:0.2442:0.6165	.	64;64;64	A6NP58;B0YJ81-2;B0YJ81	.;.;HACD1_HUMAN	Q	64	ENSP00000355308:E64Q;ENSP00000322923:E64Q	ENSP00000322923:E64Q	E	-	1	0	PTPLA	17699155	1.000000	0.71417	0.050000	0.19076	0.003000	0.03518	1.138000	0.31491	0.439000	0.26476	-0.381000	0.06696	GAG	C|0.007;G|0.002;T|0.991		0.766	PTPLA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047046.1	NM_014241	
ALOX5	240	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	45878015	45878015	+	Missense_Mutation	SNP	G	G	T			TCGA-PK-A5HA-01A-11D-A29I-10	TCGA-PK-A5HA-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2bd7613-8a82-453c-b1d0-f0ad6fbc0766	688c5eb5-c374-4bfb-81d1-c0ba622386cf	g.chr10:45878015G>T	ENST00000374391.2	+	2	288	c.235G>T	c.(235-237)Gac>Tac	p.D79Y	ALOX5_ENST00000542434.1_Missense_Mutation_p.D79Y	NM_000698.3|NM_001256153.1	NP_000689.1|NP_001243082.1	P09917	LOX5_HUMAN	arachidonate 5-lipoxygenase	79	PLAT. {ECO:0000255|PROSITE- ProRule:PRU00152}.				arachidonic acid metabolic process (GO:0019369)|leukotriene biosynthetic process (GO:0019370)|leukotriene metabolic process (GO:0006691)|leukotriene production involved in inflammatory response (GO:0002540)|lipoxin metabolic process (GO:2001300)|lipoxygenase pathway (GO:0019372)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular space (GO:0005615)|nuclear envelope (GO:0005635)|nuclear envelope lumen (GO:0005641)|nuclear matrix (GO:0016363)|nuclear membrane (GO:0031965)	arachidonate 5-lipoxygenase activity (GO:0004051)|iron ion binding (GO:0005506)			breast(1)|cervix(2)|endometrium(3)|kidney(1)|large_intestine(6)|lung(14)|ovary(2)|pancreas(2)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	37		Lung SC(717;0.0257)			Aminosalicylic Acid(DB00233)|Balsalazide(DB01014)|Diclofenac(DB00586)|Diethylcarbamazine(DB00711)|Masoprocol(DB00179)|Meclofenamic acid(DB00939)|Mesalazine(DB00244)|Minocycline(DB01017)|Montelukast(DB00471)|Sulfasalazine(DB00795)|Vitamin E(DB00163)|Zileuton(DB00744)	CTGGCTGAATGACGACTGGTA	0.567																																					p.D79Y		.											.	ALOX5-228	0			c.G235T						.						152.0	111.0	125.0					10																	45878015		2203	4300	6503	SO:0001583	missense	240	exon2			CTGAATGACGACT	J03571	CCDS7212.1, CCDS58078.1	10q11.2	2008-03-18			ENSG00000012779	ENSG00000012779	1.13.11.34	"""Arachidonate lipoxygenases"""	435	protein-coding gene	gene with protein product		152390				2565035	Standard	NM_001256153		Approved	5-LOX	uc001jce.4	P09917	OTTHUMG00000018081	ENST00000374391.2:c.235G>T	10.37:g.45878015G>T	ENSP00000363512:p.Asp79Tyr	Somatic	222	2		WXS	Illumina GAIIx	Phase_I	217	94	NM_000698	0	0	6	6	0	B7ZLS0|E5FPY5|E5FPY7|E5FPY8|Q5JQ14	Missense_Mutation	SNP	ENST00000374391.2	37	CCDS7212.1	.	.	.	.	.	.	.	.	.	.	G	23.7	4.452248	0.84209	.	.	ENSG00000012779	ENST00000542434;ENST00000374391	T;T	0.68765	-0.35;-0.35	4.91	4.91	0.64330	Lipoxygenase, LH2 (4);Lipase/lipooxygenase, PLAT/LH2 (1);	0.097175	0.64402	D	0.000002	D	0.85017	0.5601	M	0.91090	3.175	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.999;1.0;0.999	D	0.87795	0.2621	10	0.59425	D	0.04	-30.5964	15.6337	0.76933	0.0:0.0:1.0:0.0	.	79;79;79	B7ZLS0;E5FPY8;P09917	.;.;LOX5_HUMAN	Y	79	ENSP00000437634:D79Y;ENSP00000363512:D79Y	ENSP00000363512:D79Y	D	+	1	0	ALOX5	45198021	1.000000	0.71417	0.518000	0.27811	0.853000	0.48598	9.657000	0.98554	2.563000	0.86464	0.655000	0.94253	GAC	.		0.567	ALOX5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047780.1		
OGDHL	55753	bcgsc.ca	37	10	50950976	50950976	+	Missense_Mutation	SNP	G	G	A	rs11101224	byFrequency	TCGA-PK-A5HA-01A-11D-A29I-10	TCGA-PK-A5HA-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2bd7613-8a82-453c-b1d0-f0ad6fbc0766	688c5eb5-c374-4bfb-81d1-c0ba622386cf	g.chr10:50950976G>A	ENST00000374103.4	-	15	1995	c.1910C>T	c.(1909-1911)aCg>aTg	p.T637M	OGDHL_ENST00000419399.1_Missense_Mutation_p.T580M|OGDHL_ENST00000432695.1_Missense_Mutation_p.T428M	NM_018245.2	NP_060715.2	Q9ULD0	OGDHL_HUMAN	oxoglutarate dehydrogenase-like	637			T -> M (in dbSNP:rs11101224). {ECO:0000269|PubMed:14702039}.		glycolytic process (GO:0006096)|tricarboxylic acid cycle (GO:0006099)	mitochondrion (GO:0005739)	metal ion binding (GO:0046872)|oxoglutarate dehydrogenase (succinyl-transferring) activity (GO:0004591)|thiamine pyrophosphate binding (GO:0030976)			central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(14)|lung(30)|ovary(1)|pancreas(1)|prostate(2)|skin(1)|soft_tissue(1)|upper_aerodigestive_tract(1)	61						CCAGTCCACCGTCCGGTTCTT	0.652													g|||	1045	0.208666	0.3048	0.2565	5008	,	,		20432	0.0407		0.1958	False		,,,				2504	0.2311				p.T637M		.											.	OGDHL-69	0			c.C1910T						.	G	MET/THR,MET/THR,MET/THR	1199,3207	419.1+/-338.5	166,867,1170	86.0	70.0	75.0		1739,1283,1910	0.0	0.0	10	dbSNP_120	75	1581,7019	296.7+/-303.1	136,1309,2855	yes	missense,missense,missense	OGDHL	NM_001143996.1,NM_001143997.1,NM_018245.2	81,81,81	302,2176,4025	AA,AG,GG		18.3837,27.2129,21.3748	benign,benign,benign	580/954,428/802,637/1011	50950976	2780,10226	2203	4300	6503	SO:0001583	missense	55753	exon15			TCCACCGTCCGGT	AK001713	CCDS7234.1, CCDS44390.1, CCDS44391.1	10q11.23	2013-09-20			ENSG00000197444	ENSG00000197444			25590	protein-coding gene	gene with protein product						10574462	Standard	NM_018245		Approved	FLJ10851	uc001jie.3	Q9ULD0	OTTHUMG00000018200	ENST00000374103.4:c.1910C>T	10.37:g.50950976G>A	ENSP00000363216:p.Thr637Met	Somatic	83	1		WXS	Illumina GAIIx	Phase_I	111	5	NM_018245	0	0	32	32	0	A8K2G1|B4DKG2|B4E193|Q8TAN9|Q9NVA0	Missense_Mutation	SNP	ENST00000374103.4	37	CCDS7234.1	410	0.18772893772893773	151	0.30691056910569103	84	0.23204419889502761	28	0.04895104895104895	147	0.19393139841688653	g	6.119	0.390152	0.11581	0.272129	0.183837	ENSG00000197444	ENST00000374103;ENST00000419399;ENST00000432695	D;D;D	0.91577	-2.87;-2.87;-2.87	5.22	0.0223	0.14133	Transketolase-like, pyrimidine-binding domain (1);	0.792037	0.12112	N	0.498421	T	0.00012	0.0000	L	0.39020	1.185	0.80722	P	0.0	B;B;B	0.18461	0.016;0.006;0.028	B;B;B	0.20184	0.017;0.017;0.028	T	0.05273	-1.0895	9	0.56958	D	0.05	.	5.7086	0.17923	0.3992:0.0:0.4704:0.1304	rs11101224;rs61669512;rs11101224	580;428;637	Q9ULD0-2;Q9ULD0-3;Q9ULD0	.;.;OGDHL_HUMAN	M	637;580;428	ENSP00000363216:T637M;ENSP00000401356:T580M;ENSP00000390240:T428M	ENSP00000363216:T637M	T	-	2	0	OGDHL	50620982	0.000000	0.05858	0.000000	0.03702	0.156000	0.22039	-0.513000	0.06305	0.028000	0.15324	-0.141000	0.14075	ACG	G|0.792;A|0.208		0.652	OGDHL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048007.1	NM_018245	
CFAP58	159686	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	106214282	106214282	+	Silent	SNP	G	G	A	rs370337063		TCGA-PK-A5HA-01A-11D-A29I-10	TCGA-PK-A5HA-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2bd7613-8a82-453c-b1d0-f0ad6fbc0766	688c5eb5-c374-4bfb-81d1-c0ba622386cf	g.chr10:106214282G>A	ENST00000369704.3	+	18	2747	c.2613G>A	c.(2611-2613)acG>acA	p.T871T		NM_001008723.1	NP_001008723.1	Q5T655	CC147_HUMAN		871						extracellular space (GO:0005615)				NS(1)|breast(1)|central_nervous_system(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(16)|ovary(3)|pancreas(1)|prostate(3)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(2)	52		Colorectal(252;0.103)|Breast(234;0.122)		Epithelial(162;7.55e-10)|all cancers(201;3.37e-08)|BRCA - Breast invasive adenocarcinoma(275;0.0189)		CCAAAATGACGTTCTAACCTG	0.458																																					p.T871T		.											.	CCDC147-71	0			c.G2613A						.	G		0,4406		0,0,2203	112.0	105.0	107.0		2613	-1.0	0.0	10		107	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	CCDC147	NM_001008723.1		0,1,6502	AA,AG,GG		0.0116,0.0,0.0077		871/873	106214282	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	159686	exon18			AATGACGTTCTAA																												ENST00000369704.3:c.2613G>A	10.37:g.106214282G>A		Somatic	159	0		WXS	Illumina GAIIx	Phase_I	158	27	NM_001008723	0	0	0	0	0	D3DRA6|Q8NA27	Silent	SNP	ENST00000369704.3	37	CCDS31282.1																																																																																			.		0.458	CCDC147-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050216.1		
XPNPEP1	7511	broad.mit.edu	37	10	111642322	111642322	+	Silent	SNP	T	T	C			TCGA-PK-A5HA-01A-11D-A29I-10	TCGA-PK-A5HA-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2bd7613-8a82-453c-b1d0-f0ad6fbc0766	688c5eb5-c374-4bfb-81d1-c0ba622386cf	g.chr10:111642322T>C	ENST00000502935.1	-	10	1028	c.909A>G	c.(907-909)gaA>gaG	p.E303E	XPNPEP1_ENST00000322238.8_Silent_p.E303E|XPNPEP1_ENST00000369683.1_Silent_p.E189E|XPNPEP1_ENST00000369680.4_Silent_p.E260E|XPNPEP1_ENST00000430337.1_5'UTR					X-prolyl aminopeptidase (aminopeptidase P) 1, soluble											endometrium(2)|kidney(9)|large_intestine(4)|lung(9)|ovary(3)|pancreas(2)|skin(1)|urinary_tract(1)	31		Breast(234;0.174)		Epithelial(162;1.64e-05)|all cancers(201;0.000564)|BRCA - Breast invasive adenocarcinoma(275;0.0721)		GGATCCTGTATTCGGCTTCCA	0.577																																					p.E303E		.											.	XPNPEP1-94	0			c.A909G						.						136.0	122.0	127.0					10																	111642322		2203	4300	6503	SO:0001819	synonymous_variant	7511	exon10			CCTGTATTCGGCT		CCDS7560.1, CCDS7560.2, CCDS53576.1	10q25.3	2006-01-16	2002-07-17		ENSG00000108039	ENSG00000108039	3.4.11.9		12822	protein-coding gene	gene with protein product		602443	"""X-prolyl aminopeptidase (aminopeptidase P)-like"""	XPNPEP, XPNPEPL1, XPNPEPL			Standard	NM_020383		Approved		uc001kyp.2	Q9NQW7	OTTHUMG00000019029	ENST00000502935.1:c.909A>G	10.37:g.111642322T>C		Somatic	84	2		WXS	Illumina GAIIx	Phase_I	89	14	NM_001167604	0	0	20	27	7		Silent	SNP	ENST00000502935.1	37	CCDS7560.2																																																																																			.		0.577	XPNPEP1-015	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000050264.2		
MUC6	4588	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	1031972	1031972	+	Missense_Mutation	SNP	G	G	A	rs372014357		TCGA-PK-A5HA-01A-11D-A29I-10	TCGA-PK-A5HA-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2bd7613-8a82-453c-b1d0-f0ad6fbc0766	688c5eb5-c374-4bfb-81d1-c0ba622386cf	g.chr11:1031972G>A	ENST00000421673.2	-	3	247	c.197C>T	c.(196-198)aCg>aTg	p.T66M		NM_005961.2	NP_005952.2	Q6W4X9	MUC6_HUMAN	mucin 6, oligomeric mucus/gel-forming	66	VWFD 1. {ECO:0000255|PROSITE- ProRule:PRU00580}.				cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular region (GO:0005576)|Golgi lumen (GO:0005796)	extracellular matrix structural constituent (GO:0005201)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(8)|kidney(10)|large_intestine(6)|lung(43)|ovary(4)|prostate(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	80		all_cancers(49;3.3e-08)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		all cancers(45;1.24e-24)|BRCA - Breast invasive adenocarcinoma(625;0.00031)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)		GTAGTTGCACGTCCCCGAGAA	0.632																																					p.T66M		.											.	MUC6-23	0			c.C197T						.	G	MET/THR	1,4271		0,1,2135	101.0	112.0	108.0		197	3.1	0.6	11		108	2,8454		0,2,4226	no	missense	MUC6	NM_005961.2	81	0,3,6361	AA,AG,GG		0.0237,0.0234,0.0236	possibly-damaging	66/2440	1031972	3,12725	2136	4228	6364	SO:0001583	missense	4588	exon3			TTGCACGTCCCCG	U97698, AY312160	CCDS44513.1	11p15.5	2008-02-05	2006-03-14		ENSG00000184956	ENSG00000184956		"""Mucins"""	7517	protein-coding gene	gene with protein product		158374	"""mucin 6, gastric"""			7680650	Standard	NM_005961		Approved		uc001lsw.2	Q6W4X9	OTTHUMG00000165140	ENST00000421673.2:c.197C>T	11.37:g.1031972G>A	ENSP00000406861:p.Thr66Met	Somatic	185	0		WXS	Illumina GAIIx	Phase_I	125	86	NM_005961	0	0	0	0	0	O15329|Q14394|Q2TUQ5|Q4L207|Q8N8I1|Q8NAK1	Missense_Mutation	SNP	ENST00000421673.2	37	CCDS44513.1	.	.	.	.	.	.	.	.	.	.	G	8.560	0.877484	0.17395	2.34E-4	2.37E-4	ENSG00000184956	ENST00000421673;ENST00000525923	T;T	0.60424	0.19;0.19	4.03	3.09	0.35607	von Willebrand factor, type D domain (3);	0.000000	0.31636	U	0.007314	T	0.55909	0.1950	M	0.76838	2.35	0.23254	N	0.998034	P	0.52316	0.952	B	0.43225	0.412	T	0.51164	-0.8740	10	0.21540	T	0.41	.	10.7022	0.45934	0.0993:0.0:0.9007:0.0	.	66	Q6W4X9	MUC6_HUMAN	M	66;90	ENSP00000406861:T66M;ENSP00000433790:T90M	ENSP00000406861:T66M	T	-	2	0	MUC6	1021972	0.003000	0.15002	0.554000	0.28268	0.200000	0.23975	1.146000	0.31589	0.785000	0.33685	0.462000	0.41574	ACG	.		0.632	MUC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382120.2	XM_290540	
CARS	833	ucsc.edu	37	11	3028140	3028140	+	Silent	SNP	G	G	A	rs729662	byFrequency	TCGA-PK-A5HA-01A-11D-A29I-10	TCGA-PK-A5HA-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2bd7613-8a82-453c-b1d0-f0ad6fbc0766	688c5eb5-c374-4bfb-81d1-c0ba622386cf	g.chr11:3028140G>A	ENST00000397111.5	-	18	2114	c.1869C>T	c.(1867-1869)ccC>ccT	p.P623P	CARS_ENST00000401769.3_Silent_p.P636P|CARS_ENST00000278224.9_Silent_p.P623P|CARS_ENST00000380525.4_Silent_p.P706P|CARS_ENST00000470221.2_5'UTR|CARS_ENST00000397114.3_Silent_p.P613P			P49589	SYCC_HUMAN	cysteinyl-tRNA synthetase	623					cysteinyl-tRNA aminoacylation (GO:0006423)|gene expression (GO:0010467)|tRNA aminoacylation for protein translation (GO:0006418)	cytoplasm (GO:0005737)|cytosol (GO:0005829)	ATP binding (GO:0005524)|cysteine-tRNA ligase activity (GO:0004817)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|tRNA binding (GO:0000049)		CARS/ALK(5)	central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(14)|ovary(3)|skin(1)	31		all_epithelial(84;0.000236)|Medulloblastoma(188;0.00106)|Breast(177;0.00328)|Ovarian(85;0.00556)|all_neural(188;0.00681)		BRCA - Breast invasive adenocarcinoma(625;0.00317)|LUSC - Lung squamous cell carcinoma(625;0.218)	L-Cysteine(DB00151)	CCCCAAGCTCGGGCAGGATGT	0.587			T	ALK	ALCL								G|||	1757	0.350839	0.0303	0.4957	5008	,	,		20311	0.6627		0.2922	False		,,,				2504	0.4202				p.P706P	Ovarian(61;932 1157 5961 20446 52152)	.		Dom	yes		11	11p15.5	833	cysteinyl-tRNA synthetase		L	.	CARS-664	0			c.C2118T						.	G	,,,	333,4071	174.4+/-204.0	12,309,1881	177.0	169.0	172.0		2118,2118,1869,1869	-4.1	1.0	11	dbSNP_86	172	2504,6092	409.7+/-349.9	363,1778,2157	no	coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous	CARS	NM_001014437.2,NM_001194997.1,NM_001751.5,NM_139273.3	,,,	375,2087,4038	AA,AG,GG		29.1298,7.5613,21.8231	,,,	706/832,706/810,623/749,623/727	3028140	2837,10163	2202	4298	6500	SO:0001819	synonymous_variant	833	exon19			AAGCTCGGGCAGG	AF288207	CCDS7742.1, CCDS41600.1, CCDS41602.1	11p15.5	2011-07-01			ENSG00000110619	ENSG00000110619	6.1.1.16	"""Aminoacyl tRNA synthetases / Class I"""	1493	protein-coding gene	gene with protein product	"""cysteine tRNA ligase 1, cytoplasmic"""	123859				8468064	Standard	NM_139273		Approved	CARS1	uc001lxf.3	P49589	OTTHUMG00000010927	ENST00000397111.5:c.1869C>T	11.37:g.3028140G>A		Somatic	114	2		WXS	Illumina GAIIx	Phase_I	52	6	NM_001014437	0	0	36	36	0	Q53XI8|Q5HYE4|Q9HD24|Q9HD25	Silent	SNP	ENST00000397111.5	37	CCDS7742.1																																																																																			G|0.727;A|0.273		0.587	CARS-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000030117.4	NM_001751	
OR51S1	119692	bcgsc.ca	37	11	4870298	4870298	+	Silent	SNP	T	T	G	rs11601065	byFrequency	TCGA-PK-A5HA-01A-11D-A29I-10	TCGA-PK-A5HA-10A-01D-A29L-10	T	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2bd7613-8a82-453c-b1d0-f0ad6fbc0766	688c5eb5-c374-4bfb-81d1-c0ba622386cf	g.chr11:4870298T>G	ENST00000322101.2	-	1	216	c.141A>C	c.(139-141)gcA>gcC	p.A47A	MMP26_ENST00000477339.1_Intron|MMP26_ENST00000380390.1_Intron	NM_001004758.1	NP_001004758.1	Q8NGJ8	O51S1_HUMAN	olfactory receptor, family 51, subfamily S, member 1	47						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(3)|lung(15)|ovary(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	33		Medulloblastoma(188;0.0075)|all_neural(188;0.0577)|Breast(177;0.086)		Epithelial(150;5.06e-12)|BRCA - Breast invasive adenocarcinoma(625;0.00438)|LUSC - Lung squamous cell carcinoma(625;0.19)		CATTTCCCAGTGCAGAGAGAA	0.562													T|||	844	0.16853	0.0227	0.1441	5008	,	,		19755	0.0675		0.2555	False		,,,				2504	0.3978				p.A47A		.											.	OR51S1-72	0			c.A141C						.	T		234,4168	137.3+/-173.1	8,218,1975	105.0	86.0	93.0		141	-0.3	0.7	11	dbSNP_120	93	2515,6081	412.0+/-350.7	363,1789,2146	no	coding-synonymous	OR51S1	NM_001004758.1		371,2007,4121	GG,GT,TT		29.2578,5.3158,21.1494		47/324	4870298	2749,10249	2201	4298	6499	SO:0001819	synonymous_variant	119692	exon1			TCCCAGTGCAGAG	AB065796	CCDS31362.1	11p15.4	2012-08-09			ENSG00000176922	ENSG00000176922		"""GPCR / Class A : Olfactory receptors"""	15204	protein-coding gene	gene with protein product							Standard	NM_001004758		Approved		uc010qyo.2	Q8NGJ8	OTTHUMG00000066506	ENST00000322101.2:c.141A>C	11.37:g.4870298T>G		Somatic	226	2		WXS	Illumina GAIIx	Phase_I	165	7	NM_001004758	0	0	0	0	0	B9EGZ1|Q6IFI2	Silent	SNP	ENST00000322101.2	37	CCDS31362.1																																																																																			T|0.828;G|0.172		0.562	OR51S1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000142179.1	NM_001004758	
OR52W1	120787	bcgsc.ca	37	11	6221214	6221214	+	Missense_Mutation	SNP	T	T	A	rs11040799	byFrequency	TCGA-PK-A5HA-01A-11D-A29I-10	TCGA-PK-A5HA-10A-01D-A29L-10	T	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2bd7613-8a82-453c-b1d0-f0ad6fbc0766	688c5eb5-c374-4bfb-81d1-c0ba622386cf	g.chr11:6221214T>A	ENST00000311352.2	+	1	839	c.761T>A	c.(760-762)cTg>cAg	p.L254Q	RP11-290F24.6_ENST00000600308.1_lincRNA	NM_001005178.1	NP_001005178.1	Q6IF63	O52W1_HUMAN	olfactory receptor, family 52, subfamily W, member 1	254			L -> Q (in dbSNP:rs11040799).			integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(2)|kidney(2)|large_intestine(1)|lung(6)	11		Medulloblastoma(188;0.00776)|all_neural(188;0.0652)|Breast(177;0.114)		Epithelial(150;2.13e-08)|BRCA - Breast invasive adenocarcinoma(625;0.135)		TGTGTCATTCTGGCCTTCTAC	0.527													T|||	2854	0.569888	0.2133	0.598	5008	,	,		22584	0.7976		0.7475	False		,,,				2504	0.6145				p.L254Q		.											.	OR52W1-68	0			c.T761A						.	T	GLN/LEU	1330,3072	444.5+/-347.4	187,956,1058	430.0	374.0	393.0		761	5.1	1.0	11	dbSNP_120	393	6325,2267	706.6+/-405.5	2336,1653,307	yes	missense	OR52W1	NM_001005178.1	113	2523,2609,1365	AA,AT,TT		26.385,30.2135,41.0882	probably-damaging	254/321	6221214	7655,5339	2201	4296	6497	SO:0001583	missense	120787	exon1			TCATTCTGGCCTT	AB065511	CCDS31407.1	11p15.4	2012-08-09		2004-03-10	ENSG00000175485	ENSG00000175485		"""GPCR / Class A : Olfactory receptors"""	15239	protein-coding gene	gene with protein product				OR52W1P			Standard	NM_001005178		Approved		uc010qzz.2	Q6IF63	OTTHUMG00000165378	ENST00000311352.2:c.761T>A	11.37:g.6221214T>A	ENSP00000309673:p.Leu254Gln	Somatic	133	0		WXS	Illumina GAIIx	Phase_I	60	5	NM_001005178	0	0	0	0	0	Q8NH78	Missense_Mutation	SNP	ENST00000311352.2	37	CCDS31407.1	1359	0.6222527472527473	110	0.22357723577235772	241	0.6657458563535912	445	0.777972027972028	563	0.7427440633245382	T	17.31	3.357877	0.61403	0.302135	0.73615	ENSG00000175485	ENST00000311352	T	0.40756	1.02	5.11	5.11	0.69529	GPCR, rhodopsin-like superfamily (1);	0.000000	0.30742	N	0.008963	T	0.00012	0.0000	M	0.92507	3.315	0.28985	P	0.888391	D	0.76494	0.999	D	0.71184	0.972	T	0.38585	-0.9654	9	0.87932	D	0	.	14.3679	0.66817	0.0:0.0:0.0:1.0	rs11040799;rs52835192;rs56637918;rs11040799	254	Q6IF63	O52W1_HUMAN	Q	254	ENSP00000309673:L254Q	ENSP00000309673:L254Q	L	+	2	0	OR52W1	6177790	0.129000	0.22400	1.000000	0.80357	0.946000	0.59487	3.012000	0.49575	2.036000	0.60181	0.460000	0.39030	CTG	T|0.402;A|0.598		0.527	OR52W1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383758.1	NM_001005178	
CYB5R2	51700	bcgsc.ca	37	11	7694002	7694002	+	Missense_Mutation	SNP	G	G	A	rs61729556	byFrequency	TCGA-PK-A5HA-01A-11D-A29I-10	TCGA-PK-A5HA-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2bd7613-8a82-453c-b1d0-f0ad6fbc0766	688c5eb5-c374-4bfb-81d1-c0ba622386cf	g.chr11:7694002G>A	ENST00000533558.1	-	2	611	c.55C>T	c.(55-57)Ccg>Tcg	p.P19S	CYB5R2_ENST00000524790.1_Missense_Mutation_p.P19S|CYB5R2_ENST00000299497.9_Missense_Mutation_p.P19S|CYB5R2_ENST00000299498.6_Missense_Mutation_p.P19S			Q6BCY4	NB5R2_HUMAN	cytochrome b5 reductase 2	19	FAD-binding FR-type. {ECO:0000255|PROSITE-ProRule:PRU00716}.				oxidation-reduction process (GO:0055114)|sterol biosynthetic process (GO:0016126)	membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	cytochrome-b5 reductase activity, acting on NAD(P)H (GO:0004128)			cervix(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(3)|prostate(1)|skin(1)	11				Epithelial(150;5.48e-08)|BRCA - Breast invasive adenocarcinoma(625;0.189)		AAGGGCAGCGGGTACTTGGCT	0.557													G|||	129	0.0257588	0.0189	0.0187	5008	,	,		18973	0.002		0.0378	False		,,,				2504	0.0521				p.P19S		.											.	CYB5R2-90	0			c.C55T						.	G	SER/PRO	64,4338	59.9+/-96.7	1,62,2138	183.0	147.0	159.0		55	3.3	1.0	11	dbSNP_129	159	353,8239	119.5+/-178.9	15,323,3958	yes	missense	CYB5R2	NM_016229.3	74	16,385,6096	AA,AG,GG		4.1085,1.4539,3.2092	benign	19/277	7694002	417,12577	2201	4296	6497	SO:0001583	missense	51700	exon2			GCAGCGGGTACTT	AF169802	CCDS7780.1	11p15.4	2014-08-12			ENSG00000166394	ENSG00000166394	1.6.2.2		24376	protein-coding gene	gene with protein product		608342				10611283	Standard	XM_005252973		Approved		uc001mfm.3	Q6BCY4	OTTHUMG00000165665	ENST00000533558.1:c.55C>T	11.37:g.7694002G>A	ENSP00000437041:p.Pro19Ser	Somatic	273	1		WXS	Illumina GAIIx	Phase_I	178	7	NM_016229	0	0	0	0	0	Q9BVA3|Q9UF68|Q9UHJ0	Missense_Mutation	SNP	ENST00000533558.1	37	CCDS7780.1	44	0.020146520146520148	12	0.024390243902439025	8	0.022099447513812154	0	0.0	24	0.0316622691292876	G	12.53	1.967013	0.34754	0.014539	0.041085	ENSG00000166394	ENST00000524790;ENST00000299498;ENST00000533558;ENST00000299497;ENST00000531096;ENST00000527542;ENST00000524608;ENST00000436351	D;D;D;D;D;D;D;D	0.84800	-1.9;-1.9;-1.9;-1.9;-1.9;-1.9;-1.9;-1.9	5.21	3.31	0.37934	Riboflavin synthase-like beta-barrel (1);Ferredoxin reductase-type FAD-binding domain (1);	0.203246	0.52532	D	0.000069	T	0.50343	0.1610	L	0.42632	1.34	0.53005	D	0.999969	B;B	0.02656	0.0;0.0	B;B	0.12156	0.007;0.007	T	0.65985	-0.6035	10	0.40728	T	0.16	-5.6124	10.6269	0.45512	0.1702:0.0:0.8298:0.0	.	19;19	E9PIV9;Q6BCY4	.;NB5R2_HUMAN	S	19;19;19;19;19;19;79;19	ENSP00000435916:P19S;ENSP00000299498:P19S;ENSP00000437041:P19S;ENSP00000299497:P19S;ENSP00000434969:P19S;ENSP00000433856:P19S;ENSP00000432482:P79S;ENSP00000392777:P19S	ENSP00000299497:P19S	P	-	1	0	CYB5R2	7650578	0.993000	0.37304	0.991000	0.47740	0.786000	0.44442	0.797000	0.26999	1.341000	0.45600	-0.244000	0.11960	CCG	G|0.968;A|0.032		0.557	CYB5R2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385679.1	NM_016229	
MICALCL	84953	hgsc.bcm.edu	37	11	12316389	12316389	+	Missense_Mutation	SNP	A	A	C	rs3812754|rs542581403|rs199786165	byFrequency	TCGA-PK-A5HA-01A-11D-A29I-10	TCGA-PK-A5HA-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2bd7613-8a82-453c-b1d0-f0ad6fbc0766	688c5eb5-c374-4bfb-81d1-c0ba622386cf	g.chr11:12316389A>C	ENST00000256186.2	+	3	1702	c.1411A>C	c.(1411-1413)Aca>Cca	p.T471P		NM_032867.2	NP_116256.2	Q6ZW33	MICLK_HUMAN	MICAL C-terminal like	471			T -> P (in dbSNP:rs3812754).		cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)	mitogen-activated protein kinase binding (GO:0051019)	p.T471delT(2)		breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(5)|lung(5)|ovary(3)|skin(3)|upper_aerodigestive_tract(1)	30				Epithelial(150;0.00177)		tcctcctcctACAGCGGGAGG	0.572													A|||	1475	0.294529	0.1331	0.3386	5008	,	,		4509	0.1815		0.5537	False		,,,				2504	0.3313				p.T471P		.											.	MICALCL-91	2	Deletion - In frame(2)	upper_aerodigestive_tract(1)|skin(1)	c.A1411C						.	A	PRO/THR	721,2429		137,447,991	4.0	4.0	4.0		1411	-0.8	0.0	11	dbSNP_107	4	3523,3545		1029,1465,1040	yes	missense	MICALCL	NM_032867.2	38	1166,1912,2031	CC,CA,AA		49.8444,22.8889,41.5345	benign	471/696	12316389	4244,5974	1575	3534	5109	SO:0001583	missense	84953	exon3			CCTCCTACAGCGG	BK000463	CCDS41620.1	11p15.3	2005-11-01			ENSG00000133808	ENSG00000133808			25933	protein-coding gene	gene with protein product		612355				12110185	Standard	NM_032867		Approved	FLJ14966	uc001mkg.1	Q6ZW33	OTTHUMG00000165777	ENST00000256186.2:c.1411A>C	11.37:g.12316389A>C	ENSP00000256186:p.Thr471Pro	Somatic	2	0		WXS	Illumina GAIIx	Phase_I	5	5	NM_032867	0	0	0	0	0	Q7RTP7|Q96JU6	Missense_Mutation	SNP	ENST00000256186.2	37	CCDS41620.1	766	0.3507326007326007	103	0.20934959349593496	147	0.40607734806629836	106	0.1853146853146853	410	0.5408970976253298	A	0.021	-1.425527	0.01126	0.228889	0.498444	ENSG00000133808	ENST00000256186	T	0.13307	2.6	0.418	-0.835	0.10775	.	.	.	.	.	T	0.00012	0.0000	N	0.08118	0	0.80722	P	0.0	P	0.38110	0.618	B	0.25759	0.063	T	0.38045	-0.9679	7	0.23302	T	0.38	.	.	.	.	rs3812754	471	Q6ZW33	MICLK_HUMAN	P	471	ENSP00000256186:T471P	ENSP00000256186:T471P	T	+	1	0	MICALCL	12272965	0.001000	0.12720	0.028000	0.17463	0.023000	0.10783	-0.872000	0.04219	-0.631000	0.05560	-0.661000	0.03856	ACA	A|0.649;C|0.351		0.572	MICALCL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000386164.1	NM_032867	
ABCC8	6833	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	17485036	17485036	+	Silent	SNP	C	C	G			TCGA-PK-A5HA-01A-11D-A29I-10	TCGA-PK-A5HA-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2bd7613-8a82-453c-b1d0-f0ad6fbc0766	688c5eb5-c374-4bfb-81d1-c0ba622386cf	g.chr11:17485036C>G	ENST00000389817.3	-	4	596	c.528G>C	c.(526-528)gtG>gtC	p.V176V	ABCC8_ENST00000302539.4_Silent_p.V176V			Q09428	ABCC8_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP), member 8	176					carbohydrate metabolic process (GO:0005975)|energy reserve metabolic process (GO:0006112)|potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|regulation of insulin secretion (GO:0050796)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|ion channel binding (GO:0044325)|potassium ion transmembrane transporter activity (GO:0015079)|sulfonylurea receptor activity (GO:0008281)	p.V176V(1)		NS(1)|breast(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(14)|lung(38)|ovary(1)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	67				READ - Rectum adenocarcinoma(2;0.0325)|Colorectal(2;0.1)	Adenosine triphosphate(DB00171)|Chlorpropamide(DB00672)|Gliclazide(DB01120)|Glimepiride(DB00222)|Glipizide(DB01067)|Gliquidone(DB01251)|Glyburide(DB01016)|Glycodiazine(DB01382)|Mitiglinide(DB01252)|Nateglinide(DB00731)|Repaglinide(DB00912)|Tolbutamide(DB01124)	CATAGAGGATCACCAGCAGCC	0.597																																					p.V176V		.											.	ABCC8-91	1	Substitution - coding silent(1)	lung(1)	c.G528C						.						73.0	56.0	61.0					11																	17485036		2200	4293	6493	SO:0001819	synonymous_variant	6833	exon4			GAGGATCACCAGC	L78207	CCDS31437.1, CCDS73264.1	11p15.1	2014-09-17			ENSG00000006071	ENSG00000006071		"""ATP binding cassette transporters / subfamily C"""	59	protein-coding gene	gene with protein product	"""sulfonylurea receptor (hyperinsulinemia)"""	600509		SUR, HRINS		7920639, 7716548	Standard	NM_000352		Approved	HI, PHHI, SUR1, MRP8, ABC36, HHF1, TNDM2	uc001mnc.3	Q09428	OTTHUMG00000166316	ENST00000389817.3:c.528G>C	11.37:g.17485036C>G		Somatic	142	0		WXS	Illumina GAIIx	Phase_I	101	21	NM_000352	0	0	0	0	0	A6NMX8|E3UYX6|O75948|Q16583	Silent	SNP	ENST00000389817.3	37	CCDS31437.1																																																																																			.		0.597	ABCC8-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000389093.1	NM_000352	
OR4B1	119765	broad.mit.edu	37	11	48238646	48238646	+	Silent	SNP	T	T	C			TCGA-PK-A5HA-01A-11D-A29I-10	TCGA-PK-A5HA-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2bd7613-8a82-453c-b1d0-f0ad6fbc0766	688c5eb5-c374-4bfb-81d1-c0ba622386cf	g.chr11:48238646T>C	ENST00000309562.2	+	1	303	c.285T>C	c.(283-285)tgT>tgC	p.C95C		NM_001005470.1	NP_001005470.1	Q8NGF8	OR4B1_HUMAN	olfactory receptor, family 4, subfamily B, member 1	95						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|kidney(1)|large_intestine(3)|lung(14)|ovary(1)|pancreas(1)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	28						TGGAAGGCTGTCTGACTCAGA	0.458																																					p.C95C		.											.	OR4B1-72	0			c.T285C						.						199.0	193.0	195.0					11																	48238646		2201	4298	6499	SO:0001819	synonymous_variant	119765	exon1			AGGCTGTCTGACT	AB065848	CCDS31485.1	11p11.2	2012-08-09			ENSG00000175619	ENSG00000175619		"""GPCR / Class A : Olfactory receptors"""	8290	protein-coding gene	gene with protein product							Standard	NM_001005470		Approved	OST208	uc010rhs.2	Q8NGF8	OTTHUMG00000166576	ENST00000309562.2:c.285T>C	11.37:g.48238646T>C		Somatic	121	0		WXS	Illumina GAIIx	Phase_I	75	3	NM_001005470	0	0	0	0	0	Q6IF75|Q96R64	Silent	SNP	ENST00000309562.2	37	CCDS31485.1																																																																																			.		0.458	OR4B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390554.1	NM_001005470	
OR5J2	282775	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	55944120	55944120	+	Silent	SNP	C	C	T			TCGA-PK-A5HA-01A-11D-A29I-10	TCGA-PK-A5HA-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2bd7613-8a82-453c-b1d0-f0ad6fbc0766	688c5eb5-c374-4bfb-81d1-c0ba622386cf	g.chr11:55944120C>T	ENST00000312298.1	+	1	27	c.27C>T	c.(25-27)gtC>gtT	p.V9V		NM_001005492.1	NP_001005492.1	Q8NH18	OR5J2_HUMAN	olfactory receptor, family 5, subfamily J, member 2	9						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(30)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|stomach(1)	44	Esophageal squamous(21;0.00693)					TTACAGTTGTCACTGAGTTTA	0.348																																					p.V9V		.											.	OR5J2-115	0			c.C27T						.						108.0	112.0	111.0					11																	55944120		2201	4296	6497	SO:0001819	synonymous_variant	282775	exon1			AGTTGTCACTGAG	AB065595	CCDS31522.1	11q11	2012-08-09			ENSG00000174957	ENSG00000174957		"""GPCR / Class A : Olfactory receptors"""	19612	protein-coding gene	gene with protein product							Standard	NM_001005492		Approved		uc010rjb.2	Q8NH18	OTTHUMG00000166835	ENST00000312298.1:c.27C>T	11.37:g.55944120C>T		Somatic	146	0		WXS	Illumina GAIIx	Phase_I	78	23	NM_001005492	0	0	0	0	0	Q6IEU5	Silent	SNP	ENST00000312298.1	37	CCDS31522.1																																																																																			.		0.348	OR5J2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391544.1	NM_001005492	
RTN3	10313	bcgsc.ca	37	11	63449125	63449125	+	Missense_Mutation	SNP	C	C	A	rs11551944	byFrequency	TCGA-PK-A5HA-01A-11D-A29I-10	TCGA-PK-A5HA-10A-01D-A29L-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2bd7613-8a82-453c-b1d0-f0ad6fbc0766	688c5eb5-c374-4bfb-81d1-c0ba622386cf	g.chr11:63449125C>A	ENST00000377819.5	+	1	171	c.17C>A	c.(16-18)gCg>gAg	p.A6E	RTN3_ENST00000540798.1_Missense_Mutation_p.A6E|RTN3_ENST00000341307.2_Missense_Mutation_p.A6E|RTN3_ENST00000538995.1_3'UTR|RTN3_ENST00000339997.4_Missense_Mutation_p.A6E|RTN3_ENST00000537981.1_Missense_Mutation_p.A6E|RTN3_ENST00000356000.3_Missense_Mutation_p.A6E|RTN3_ENST00000354497.4_Missense_Mutation_p.A6E	NM_001265589.1	NP_001252518.1	O95197	RTN3_HUMAN	reticulon 3	6			A -> E (in dbSNP:rs11551944). {ECO:0000269|PubMed:15946766}.		apoptotic process (GO:0006915)|endoplasmic reticulum tubular network organization (GO:0071786)|response to stress (GO:0006950)|vesicle-mediated transport (GO:0016192)|viral process (GO:0016032)	endoplasmic reticulum (GO:0005783)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)				cervix(1)|endometrium(1)|kidney(2)|large_intestine(4)|lung(9)|ovary(1)|skin(1)|urinary_tract(1)	20						GAGCCGTCGGCGGCCACTCAG	0.687													C|||	380	0.0758786	0.0295	0.0648	5008	,	,		13038	0.003		0.1332	False		,,,				2504	0.1626				p.A6E		.											.	RTN3-91	0			c.C17A						.	C	GLU/ALA,GLU/ALA,GLU/ALA,GLU/ALA	234,4126		8,218,1954	27.0	33.0	31.0		17,17,17,17	3.4	1.0	11	dbSNP_120	31	1271,7283		98,1075,3104	yes	missense,missense,missense,missense	RTN3	NM_006054.2,NM_201428.1,NM_201429.1,NM_201430.1	107,107,107,107	106,1293,5058	AA,AC,CC		14.8585,5.367,11.654	probably-damaging,probably-damaging,probably-damaging,probably-damaging	6/237,6/1014,6/256,6/242	63449125	1505,11409	2180	4277	6457	SO:0001583	missense	10313	exon1			CGTCGGCGGCCAC	AF059524	CCDS8048.1, CCDS8049.1, CCDS8050.1, CCDS41664.1, CCDS58141.1, CCDS58142.1, CCDS58143.1	11q13	2011-01-14			ENSG00000133318	ENSG00000133318			10469	protein-coding gene	gene with protein product	"""neuroendocrine-specific protein-like 2"", ""NSP-like protein II"", ""isoforme III"", ""ASY interacting protein"", ""homolog of ASY protein"""	604249				10331947	Standard	NM_006054		Approved	NSPL2, NSPLII, ASYIP, HAP, RTN3-A1	uc001nxq.3	O95197		ENST00000377819.5:c.17C>A	11.37:g.63449125C>A	ENSP00000367050:p.Ala6Glu	Somatic	46	0		WXS	Illumina GAIIx	Phase_I	63	5	NM_201428	0	0	42	42	0	B3KQS2|B7Z308|B7Z4M0|F5H774|Q147U9|Q496K2|Q53GN3|Q59EP0|Q5UEP2|Q6T930|Q7RTM7|Q7RTM8|Q7RTN3	Missense_Mutation	SNP	ENST00000377819.5	37	CCDS58141.1	143	0.06547619047619048	15	0.03048780487804878	27	0.07458563535911603	1	0.0017482517482517483	100	0.13192612137203166	C	17.49	3.403311	0.62288	0.05367	0.148585	ENSG00000133318	ENST00000341307;ENST00000356000;ENST00000542238;ENST00000377819;ENST00000339997;ENST00000540798;ENST00000545432;ENST00000543552;ENST00000537981;ENST00000354497	T;T;T;T;T;T;T;T;T;T	0.60548	0.55;0.58;0.65;1.1;1.01;0.97;0.22;0.26;0.76;0.18	4.33	3.42	0.39159	.	0.599771	0.13805	N	0.361511	T	0.00524	0.0017	L	0.27053	0.805	0.45930	P	0.0012349999999999861	P;D;D;P;D;D;D	0.65815	0.856;0.992;0.987;0.613;0.995;0.992;0.995	B;P;P;B;D;P;D	0.69142	0.434;0.906;0.807;0.298;0.962;0.906;0.962	T	0.23404	-1.0189	9	0.87932	D	0	-2.6338	8.4535	0.32884	0.0:0.8889:0.0:0.1111	rs11551944;rs17249377;rs11551944	6;6;6;6;6;6;6	B7Z4M0;F5H774;O95197;O95197-5;O95197-3;O95197-2;O95197-4	.;.;RTN3_HUMAN;.;.;.;.	E	6	ENSP00000340903:A6E;ENSP00000348279:A6E;ENSP00000437971:A6E;ENSP00000367050:A6E;ENSP00000344106:A6E;ENSP00000442733:A6E;ENSP00000441614:A6E;ENSP00000442080:A6E;ENSP00000440874:A6E;ENSP00000346492:A6E	ENSP00000344106:A6E	A	+	2	0	RTN3	63205701	1.000000	0.71417	1.000000	0.80357	0.798000	0.45092	0.821000	0.27338	0.819000	0.34492	0.462000	0.41574	GCG	C|0.903;A|0.097		0.687	RTN3-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000397846.1	NM_006054	
TM7SF2	7108	hgsc.bcm.edu	37	11	64880090	64880090	+	Silent	SNP	G	G	C	rs4930284	byFrequency	TCGA-PK-A5HA-01A-11D-A29I-10	TCGA-PK-A5HA-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2bd7613-8a82-453c-b1d0-f0ad6fbc0766	688c5eb5-c374-4bfb-81d1-c0ba622386cf	g.chr11:64880090G>C	ENST00000279263.7	+	2	318	c.156G>C	c.(154-156)ccG>ccC	p.P52P	AP003068.9_ENST00000528887.1_RNA|TM7SF2_ENST00000345348.5_Silent_p.P52P|TM7SF2_ENST00000540748.1_5'UTR	NM_003273.2	NP_003264.2	O76062	ERG24_HUMAN	transmembrane 7 superfamily member 2	52					cholesterol biosynthetic process (GO:0006695)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of plasma membrane (GO:0005887)|receptor complex (GO:0043235)	delta14-sterol reductase activity (GO:0050613)			lung(14)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	18						CGTCCCTGCCGGGGCTGGAGG	0.756													C|||	4990	0.996406	0.9879	0.9986	5008	,	,		10438	1.0		0.999	False		,,,				2504	1.0				p.P52P		.											.	TM7SF2-91	0			c.G156C						.	C		2924,8		1458,8,0	2.0	2.0	2.0		156	-9.8	0.0	11	dbSNP_111	2	6426,0		3213,0,0	no	coding-synonymous	TM7SF2	NM_003273.2		4671,8,0	CC,CG,GG		0.0,0.2729,0.0855		52/419	64880090	9350,8	1466	3213	4679	SO:0001819	synonymous_variant	7108	exon2			CCTGCCGGGGCTG	BC012857	CCDS41669.1, CCDS60846.1	11q13.1	2013-05-23			ENSG00000149809	ENSG00000149809	1.3.1.70		11863	protein-coding gene	gene with protein product	"""delta(14)-sterol reductase"""	603414				9615229, 9286704	Standard	NM_003273		Approved	ANG1, DHCR14A, NET47	uc001oct.4	O76062	OTTHUMG00000165603	ENST00000279263.7:c.156G>C	11.37:g.64880090G>C		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	9	9	NM_003273	0	0	0	202	202	A8K4H0|O95982|Q8IY06|Q96E64|Q96GZ1	Silent	SNP	ENST00000279263.7	37	CCDS41669.1																																																																																			G|0.005;C|0.995		0.756	TM7SF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385234.1	NM_003273	
ALDH3B2	222	bcgsc.ca	37	11	67432799	67432799	+	Silent	SNP	G	G	A	rs80147122		TCGA-PK-A5HA-01A-11D-A29I-10	TCGA-PK-A5HA-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2bd7613-8a82-453c-b1d0-f0ad6fbc0766	688c5eb5-c374-4bfb-81d1-c0ba622386cf	g.chr11:67432799G>A	ENST00000349015.3	-	7	1101	c.663C>T	c.(661-663)cgC>cgT	p.R221R	ALDH3B2_ENST00000531881.1_5'Flank|ALDH3B2_ENST00000530069.1_Silent_p.R221R	NM_000695.3	NP_000686	P48448	AL3B2_HUMAN	aldehyde dehydrogenase 3 family, member B2	221					alcohol metabolic process (GO:0006066)|ethanol catabolic process (GO:0006068)|lipid metabolic process (GO:0006629)		3-chloroallyl aldehyde dehydrogenase activity (GO:0004028)|aldehyde dehydrogenase [NAD(P)+] activity (GO:0004030)			central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(3)|lung(5)|prostate(2)|stomach(1)|urinary_tract(1)	18						CAATGGCCACGCGGCTGCAGC	0.632																																					p.R221R		.											.	ALDH3B2-226	0			c.C663T						.						52.0	59.0	57.0					11																	67432799		2200	4293	6493	SO:0001819	synonymous_variant	222	exon7			GGCCACGCGGCTG	U37519	CCDS31622.1	11q13.2	2014-09-04			ENSG00000132746	ENSG00000132746	1.2.1.5	"""Aldehyde dehydrogenases"""	411	protein-coding gene	gene with protein product	"""aldehyde dehydrogenase 8"", ""acetaldehyde dehydrogenase 8"""	601917		ALDH8		8890755, 9161417	Standard	NM_000695		Approved		uc001oms.3	P48448	OTTHUMG00000167284	ENST00000349015.3:c.663C>T	11.37:g.67432799G>A		Somatic	183	0		WXS	Illumina GAIIx	Phase_I	133	6	NM_001031615	0	0	0	0	0	Q53Y98|Q8NAL5|Q96IB2	Silent	SNP	ENST00000349015.3	37	CCDS31622.1																																																																																			.		0.632	ALDH3B2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394004.1	NM_000695	
MYO7A	4647	bcgsc.ca	37	11	76868372	76868372	+	Silent	SNP	T	T	C	rs762667	byFrequency	TCGA-PK-A5HA-01A-11D-A29I-10	TCGA-PK-A5HA-10A-01D-A29L-10	T	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2bd7613-8a82-453c-b1d0-f0ad6fbc0766	688c5eb5-c374-4bfb-81d1-c0ba622386cf	g.chr11:76868372T>C	ENST00000409709.3	+	8	1055	c.783T>C	c.(781-783)ggT>ggC	p.G261G	MYO7A_ENST00000458637.2_Silent_p.G261G|MYO7A_ENST00000409619.2_Silent_p.G250G|MYO7A_ENST00000409893.1_Silent_p.G261G	NM_000260.3	NP_000251.3	Q13402	MYO7A_HUMAN	myosin VIIA	261	Myosin motor.				actin filament-based movement (GO:0030048)|auditory receptor cell stereocilium organization (GO:0060088)|equilibrioception (GO:0050957)|eye photoreceptor cell development (GO:0042462)|intracellular protein transport (GO:0006886)|lysosome organization (GO:0007040)|metabolic process (GO:0008152)|phagolysosome assembly (GO:0001845)|pigment granule transport (GO:0051904)|post-embryonic organ morphogenesis (GO:0048563)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	apical plasma membrane (GO:0016324)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|lysosomal membrane (GO:0005765)|melanosome (GO:0042470)|myosin VII complex (GO:0031477)|photoreceptor connecting cilium (GO:0032391)|photoreceptor inner segment (GO:0001917)|photoreceptor outer segment (GO:0001750)|stereocilium (GO:0032420)|synapse (GO:0045202)	actin filament binding (GO:0051015)|actin-dependent ATPase activity (GO:0030898)|ADP binding (GO:0043531)|ATP binding (GO:0005524)|calmodulin binding (GO:0005516)|microfilament motor activity (GO:0000146)|spectrin binding (GO:0030507)			NS(2)|breast(2)|central_nervous_system(1)|endometrium(7)|kidney(1)|large_intestine(10)|lung(32)|ovary(4)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	64						TGCTGGAGGGTATGAGTGAGG	0.612													C|||	2374	0.474042	0.8351	0.4971	5008	,	,		20807	0.3383		0.3777	False		,,,				2504	0.2086				p.G261G		.											.	MYO7A-138	0			c.T783C						.	-	,,	2878,1042		1054,770,136	84.0	94.0	91.0	http://www.ncbi.nlm.nih.gov/sites/varvu?gene	783,783,783	1.0	1.0	11	dbSNP_86	91	2928,5360		532,1864,1748	no	coding-synonymous,coding-synonymous,coding-synonymous	MYO7A	NM_000260.3,NM_001127179.2,NM_001127180.1	,,	1586,2634,1884	CC,CT,TT		35.3282,26.5816,47.559	,,	261/2216,261/1179,261/2176	76868372	5806,6402	1960	4144	6104	SO:0001819	synonymous_variant	4647	exon8			GGAGGGTATGAGT	U39226	CCDS53683.1, CCDS53684.1, CCDS53685.1	11q13.5	2013-01-08	2005-09-12		ENSG00000137474	ENSG00000137474		"""A-kinase anchor proteins"", ""Myosins / Myosin superfamily : Class VII"""	7606	protein-coding gene	gene with protein product		276903	"""myosin VIIA (Usher syndrome 1B (autosomal recessive, severe))"""	USH1B, DFNB2, DFNA11		8884266	Standard	NM_000260		Approved	NSRD2	uc001oyb.2	Q13402	OTTHUMG00000152822	ENST00000409709.3:c.783T>C	11.37:g.76868372T>C		Somatic	137	1		WXS	Illumina GAIIx	Phase_I	91	5	NM_001127179	0	0	0	0	0	B9A011|F8VUN5|P78427|Q13321|Q14785|Q92821|Q92822	Silent	SNP	ENST00000409709.3	37	CCDS53683.1																																																																																			T|0.516;C|0.484		0.612	MYO7A-001	KNOWN	non_canonical_conserved|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000328133.1	NM_000260	
OR10G9	219870	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	11	123893785	123893785	+	Silent	SNP	C	C	T			TCGA-PK-A5HA-01A-11D-A29I-10	TCGA-PK-A5HA-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2bd7613-8a82-453c-b1d0-f0ad6fbc0766	688c5eb5-c374-4bfb-81d1-c0ba622386cf	g.chr11:123893785C>T	ENST00000375024.1	+	1	66	c.66C>T	c.(64-66)gaC>gaT	p.D22D		NM_001001953.1	NP_001001953.1	Q8NGN4	O10G9_HUMAN	olfactory receptor, family 10, subfamily G, member 9	22						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.D22D(2)|p.D22E(1)		breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(33)|prostate(2)|skin(4)|stomach(8)|urinary_tract(1)	61		Breast(109;0.00867)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.22)		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0399)		CAGGGCTGGACGCCCCACTCT	0.587																																					p.D22D		.											.	OR10G9-92	3	Substitution - coding silent(2)|Substitution - Missense(1)	prostate(1)|lung(1)|endometrium(1)	c.C66T						.						203.0	192.0	196.0					11																	123893785		2201	4299	6500	SO:0001819	synonymous_variant	219870	exon1			GCTGGACGCCCCA	AB065756	CCDS31703.1	11q24.1	2012-08-09			ENSG00000236981	ENSG00000236981		"""GPCR / Class A : Olfactory receptors"""	15129	protein-coding gene	gene with protein product				OR10G10P			Standard	NM_001001953		Approved		uc010sad.2	Q8NGN4	OTTHUMG00000165967	ENST00000375024.1:c.66C>T	11.37:g.123893785C>T		Somatic	370	0		WXS	Illumina GAIIx	Phase_I	231	12	NM_001001953	0	0	0	0	0		Silent	SNP	ENST00000375024.1	37	CCDS31703.1																																																																																			.		0.587	OR10G9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387269.1	NM_001001953	
OR8G5	219865	ucsc.edu	37	11	124135619	124135619	+	Silent	SNP	T	T	C			TCGA-PK-A5HA-01A-11D-A29I-10	TCGA-PK-A5HA-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2bd7613-8a82-453c-b1d0-f0ad6fbc0766	688c5eb5-c374-4bfb-81d1-c0ba622386cf	g.chr11:124135619T>C	ENST00000524943.2	+	1	897	c.897T>C	c.(895-897)tcT>tcC	p.S299S	OR8G1_ENST00000341493.2_RNA	NM_001005198.1	NP_001005198.1	Q8NG78	OR8G5_HUMAN	olfactory receptor, family 8, subfamily G, member 5	299						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)						Breast(109;0.0157)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.22)		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0523)		AGCCATCATCTGTCAGCTCCA	0.507																																					p.S299S	Ovarian(169;523 1969 8640 31295 51256)	.											.	.	0			c.T897C						.						106.0	104.0	105.0					11																	124135619		2109	4260	6369	SO:0001819	synonymous_variant	219865	exon1			ATCATCTGTCAGC	BK004516	CCDS66256.1	11q24.1	2014-04-17		2004-03-10	ENSG00000255298	ENSG00000255298		"""GPCR / Class A : Olfactory receptors"""	19622	protein-coding gene	gene with protein product				OR8G5P, OR8G6			Standard	NM_001005198		Approved			Q8NG78	OTTHUMG00000186059	ENST00000524943.2:c.897T>C	11.37:g.124135619T>C		Somatic	199	16		WXS	Illumina GAIIx	Phase_I	158	25	NM_001005198	0	0	0	0	0	B2RND3|Q6IEU6	Silent	SNP	ENST00000524943.2	37																																																																																				.		0.507	OR8G5-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000387283.2	NM_001005198	
CCND2	894	broad.mit.edu	37	12	4409090	4409090	+	Missense_Mutation	SNP	G	G	A	rs142170178	byFrequency	TCGA-PK-A5HA-01A-11D-A29I-10	TCGA-PK-A5HA-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2bd7613-8a82-453c-b1d0-f0ad6fbc0766	688c5eb5-c374-4bfb-81d1-c0ba622386cf	g.chr12:4409090G>A	ENST00000261254.3	+	5	1054	c.785G>A	c.(784-786)cGt>cAt	p.R262H		NM_001759.3	NP_001750.1	P30279	CCND2_HUMAN	cyclin D2	262					cell cycle (GO:0007049)|cell division (GO:0051301)|positive regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045737)|positive regulation of protein phosphorylation (GO:0001934)	chromatin (GO:0000785)|cyclin-dependent protein kinase holoenzyme complex (GO:0000307)|cytosol (GO:0005829)|nuclear membrane (GO:0031965)|nucleolus (GO:0005730)|nucleus (GO:0005634)	protein kinase binding (GO:0019901)	p.R262L(1)		breast(1)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(1)|lung(7)|prostate(1)|upper_aerodigestive_tract(1)	17			all cancers(3;4.15e-10)|GBM - Glioblastoma multiforme(3;6.34e-05)|Colorectal(7;0.00245)|OV - Ovarian serous cystadenocarcinoma(31;0.00301)|COAD - Colon adenocarcinoma(12;0.0264)|STAD - Stomach adenocarcinoma(119;0.206)			CAGCAGTACCGTCAGGACCAA	0.547			T	IGL@	"""NHL,CLL"""								G|||	5	0.000998403	0.0023	0.0014	5008	,	,		18043	0.0		0.001	False		,,,				2504	0.0				p.R262H		.		Dom	yes		12	12p13	894	cyclin D2		L	.	CCND2-1271	1	Substitution - Missense(1)	kidney(1)	c.G785A						.	G	HIS/ARG	4,4402	8.1+/-20.4	0,4,2199	108.0	88.0	95.0		785	3.4	1.0	12	dbSNP_134	95	4,8596	3.7+/-12.6	0,4,4296	yes	missense	CCND2	NM_001759.3	29	0,8,6495	AA,AG,GG		0.0465,0.0908,0.0615	benign	262/290	4409090	8,12998	2203	4300	6503	SO:0001583	missense	894	exon5			AGTACCGTCAGGA	AF518005	CCDS8524.1	12p13	2008-08-04			ENSG00000118971	ENSG00000118971			1583	protein-coding gene	gene with protein product	"""G1/S-specific cyclin D2"""	123833				1386335	Standard	NM_001759		Approved		uc001qmo.3	P30279	OTTHUMG00000168123	ENST00000261254.3:c.785G>A	12.37:g.4409090G>A	ENSP00000261254:p.Arg262His	Somatic	117	0		WXS	Illumina GAIIx	Phase_I	146	5	NM_001759	0	0	59	62	3	A8K531|Q13955|Q5U035	Missense_Mutation	SNP	ENST00000261254.3	37	CCDS8524.1	4	0.0018315018315018315	2	0.0040650406504065045	1	0.0027624309392265192	0	0.0	1	0.0013192612137203166	G	14.66	2.602067	0.46423	9.08E-4	4.65E-4	ENSG00000118971	ENST00000261254	T	0.20881	2.04	4.28	3.39	0.38822	Cyclin, C-terminal (1);	0.123452	0.56097	D	0.000027	T	0.21881	0.0527	M	0.68317	2.08	0.42647	D	0.993436	B	0.15719	0.014	B	0.15484	0.013	T	0.04825	-1.0924	10	0.22706	T	0.39	.	11.2148	0.48819	0.0888:0.0:0.9112:0.0	.	262	P30279	CCND2_HUMAN	H	262	ENSP00000261254:R262H	ENSP00000261254:R262H	R	+	2	0	CCND2	4279351	1.000000	0.71417	0.999000	0.59377	0.856000	0.48823	3.158000	0.50723	1.021000	0.39600	-0.251000	0.11542	CGT	G|0.999;A|0.001		0.547	CCND2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398287.1	NM_001759	
LRRK2	120892	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	12	40715839	40715839	+	Nonsense_Mutation	SNP	C	C	T	rs11564176	byFrequency	TCGA-PK-A5HA-01A-11D-A29I-10	TCGA-PK-A5HA-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2bd7613-8a82-453c-b1d0-f0ad6fbc0766	688c5eb5-c374-4bfb-81d1-c0ba622386cf	g.chr12:40715839C>T	ENST00000298910.7	+	36	5231	c.5173C>T	c.(5173-5175)Cga>Tga	p.R1725*		NM_198578.3	NP_940980	Q5S007	LRRK2_HUMAN	leucine-rich repeat kinase 2	1725					activation of MAPK activity (GO:0000187)|activation of MAPKK activity (GO:0000186)|autophagy (GO:0006914)|cellular protein localization (GO:0034613)|cellular response to dopamine (GO:1903351)|cellular response to manganese ion (GO:0071287)|cellular response to oxidative stress (GO:0034599)|determination of adult lifespan (GO:0008340)|endocytosis (GO:0006897)|exploration behavior (GO:0035640)|GTP catabolic process (GO:0006184)|intracellular distribution of mitochondria (GO:0048312)|intracellular signal transduction (GO:0035556)|locomotory exploration behavior (GO:0035641)|MAPK cascade (GO:0000165)|negative regulation of GTPase activity (GO:0034260)|negative regulation of hydrogen peroxide-induced cell death (GO:1903206)|negative regulation of late endosome to lysosome transport (GO:1902823)|negative regulation of peroxidase activity (GO:2000469)|negative regulation of protein binding (GO:0032091)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of protein processing (GO:0010955)|negative regulation of protein processing involved in protein targeting to mitochondrion (GO:1903217)|negative regulation of protein targeting to mitochondrion (GO:1903215)|negative regulation of thioredoxin peroxidase activity by peptidyl-threonine phosphorylation (GO:1903125)|neuromuscular junction development (GO:0007528)|neuron death (GO:0070997)|neuron projection morphogenesis (GO:0048812)|olfactory bulb development (GO:0021772)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of autophagy (GO:0010508)|positive regulation of dopamine receptor signaling pathway (GO:0060161)|positive regulation of GTPase activity (GO:0043547)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of programmed cell death (GO:0043068)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of protein autoubiquitination (GO:1902499)|positive regulation of protein binding (GO:0032092)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of protein ubiquitination (GO:0031398)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|reactive oxygen species metabolic process (GO:0072593)|regulation of branching morphogenesis of a nerve (GO:2000172)|regulation of dendritic spine morphogenesis (GO:0061001)|regulation of dopamine receptor signaling pathway (GO:0060159)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of kidney size (GO:0035564)|regulation of locomotion (GO:0040012)|regulation of membrane potential (GO:0042391)|regulation of mitochondrial depolarization (GO:0051900)|regulation of neuroblast proliferation (GO:1902692)|regulation of neuron death (GO:1901214)|regulation of neuron maturation (GO:0014041)|regulation of protein kinase A signaling (GO:0010738)|regulation of synaptic transmission, glutamatergic (GO:0051966)|regulation of synaptic vesicle exocytosis (GO:2000300)|regulation of synaptic vesicle transport (GO:1902803)|response to oxidative stress (GO:0006979)|small GTPase mediated signal transduction (GO:0007264)|tangential migration from the subventricular zone to the olfactory bulb (GO:0022028)	axon (GO:0030424)|cytoplasm (GO:0005737)|cytoplasmic side of mitochondrial outer membrane (GO:0032473)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|dendrite (GO:0030425)|dendrite cytoplasm (GO:0032839)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|inclusion body (GO:0016234)|lysosome (GO:0005764)|membrane raft (GO:0045121)|mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrial membrane (GO:0031966)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|perikaryon (GO:0043204)|plasma membrane (GO:0005886)|synaptic vesicle (GO:0008021)|terminal bouton (GO:0043195)|trans-Golgi network (GO:0005802)	actin binding (GO:0003779)|ATP binding (GO:0005524)|clathrin binding (GO:0030276)|glycoprotein binding (GO:0001948)|GTP binding (GO:0005525)|GTP-dependent protein kinase activity (GO:0034211)|GTPase activator activity (GO:0005096)|GTPase activity (GO:0003924)|identical protein binding (GO:0042802)|ion channel binding (GO:0044325)|kinase activity (GO:0016301)|MAP kinase kinase activity (GO:0004708)|peroxidase inhibitor activity (GO:0036479)|protein homodimerization activity (GO:0042803)|protein kinase A binding (GO:0051018)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|Rho GTPase binding (GO:0017048)|SNARE binding (GO:0000149)|syntaxin-1 binding (GO:0017075)|tubulin binding (GO:0015631)	p.R1725G(1)		NS(3)|biliary_tract(1)|breast(6)|central_nervous_system(2)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(23)|large_intestine(31)|lung(55)|ovary(15)|pancreas(2)|prostate(4)|skin(4)|stomach(9)|upper_aerodigestive_tract(7)|urinary_tract(2)	181	all_cancers(12;0.00108)|Breast(8;0.218)	Lung NSC(34;0.0942)|all_lung(34;0.11)				TTTTTTAGAACGAGCACTTCG	0.363																																					p.R1725X		.											.	LRRK2-533	1	Substitution - Missense(1)	lung(1)	c.C5173T						.						60.0	62.0	61.0					12																	40715839		2203	4299	6502	SO:0001587	stop_gained	120892	exon36			TTAGAACGAGCAC	AK026776	CCDS31774.1	12q12	2011-07-21			ENSG00000188906	ENSG00000188906		"""Parkinson disease"""	18618	protein-coding gene	gene with protein product		609007	"""Parkinson disease (autosomal dominant) 8"""	PARK8		15541308	Standard	NM_198578		Approved	ROCO2, DKFZp434H2111, FLJ45829, RIPK7	uc001rmg.4	Q5S007	OTTHUMG00000059742	ENST00000298910.7:c.5173C>T	12.37:g.40715839C>T	ENSP00000298910:p.Arg1725*	Somatic	30	0		WXS	Illumina GAIIx	Phase_I	46	6	NM_198578	0	0	0	0	0	A6NJU2|Q6ZS50|Q8NCX9	Nonsense_Mutation	SNP	ENST00000298910.7	37	CCDS31774.1	.	.	.	.	.	.	.	.	.	.	C	45	11.966081	0.99622	.	.	ENSG00000188906	ENST00000298910	.	.	.	5.35	2.38	0.29361	.	0.242674	0.35936	N	0.002891	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.05959	T	0.93	.	6.7126	0.23286	0.2572:0.6093:0.0:0.1336	rs11564176;rs11564176	.	.	.	X	1725	.	ENSP00000298910:R1725X	R	+	1	2	LRRK2	39002106	1.000000	0.71417	0.998000	0.56505	0.992000	0.81027	1.735000	0.38176	0.587000	0.29643	0.555000	0.69702	CGA	C|0.989;T|0.011		0.363	LRRK2-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000277179.1	XM_058513	
KMT2D	8085	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	49421629	49421629	+	Missense_Mutation	SNP	T	T	C			TCGA-PK-A5HA-01A-11D-A29I-10	TCGA-PK-A5HA-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2bd7613-8a82-453c-b1d0-f0ad6fbc0766	688c5eb5-c374-4bfb-81d1-c0ba622386cf	g.chr12:49421629T>C	ENST00000301067.7	-	47	14599	c.14600A>G	c.(14599-14601)tAt>tGt	p.Y4867C		NM_003482.3	NP_003473.3	O14686	KMT2D_HUMAN	lysine (K)-specific methyltransferase 2D	4867					chromatin silencing (GO:0006342)|histone H3-K4 methylation (GO:0051568)|oocyte growth (GO:0001555)|oogenesis (GO:0048477)|positive regulation of cell proliferation (GO:0008284)|positive regulation of intracellular estrogen receptor signaling pathway (GO:0033148)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|response to estrogen (GO:0043627)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)										CTTCAGGGTATAGCCAGGCAA	0.552																																					p.Y4867C		.											.	MLL2-612	0			c.A14600G						.						57.0	56.0	56.0					12																	49421629		1951	4143	6094	SO:0001583	missense	8085	exon47			AGGGTATAGCCAG	AF010403	CCDS44873.1	12q13.12	2013-05-09	2013-05-09	2013-05-09	ENSG00000167548	ENSG00000167548		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	7133	protein-coding gene	gene with protein product		602113	"""trinucleotide repeat containing 21"", ""myeloid/lymphoid or mixed-lineage leukemia 2"""	TNRC21, MLL2		9247308	Standard	NM_003482		Approved	ALR, MLL4, CAGL114		O14686	OTTHUMG00000166524	ENST00000301067.7:c.14600A>G	12.37:g.49421629T>C	ENSP00000301067:p.Tyr4867Cys	Somatic	150	0		WXS	Illumina GAIIx	Phase_I	153	36	NM_003482	0	0	4	4	0	O14687	Missense_Mutation	SNP	ENST00000301067.7	37	CCDS44873.1	.	.	.	.	.	.	.	.	.	.	T	10.94	1.492545	0.26774	.	.	ENSG00000167548	ENST00000301067	T	0.78481	-1.18	4.63	4.63	0.57726	.	0.000000	0.31747	N	0.007128	T	0.54935	0.1889	N	0.02011	-0.69	0.41997	D	0.990879	B	0.18310	0.027	B	0.18263	0.021	T	0.58544	-0.7618	10	0.87932	D	0	.	13.3194	0.60424	0.0:0.0:0.0:1.0	.	4867	O14686	MLL2_HUMAN	C	4867	ENSP00000301067:Y4867C	ENSP00000301067:Y4867C	Y	-	2	0	MLL2	47707896	1.000000	0.71417	1.000000	0.80357	0.895000	0.52256	4.263000	0.58853	1.852000	0.53769	0.460000	0.39030	TAT	.		0.552	KMT2D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390183.2		
TUBA1C	84790	ucsc.edu	37	12	49666152	49666152	+	Silent	SNP	G	G	A	rs199599214	byFrequency	TCGA-PK-A5HA-01A-11D-A29I-10	TCGA-PK-A5HA-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2bd7613-8a82-453c-b1d0-f0ad6fbc0766	688c5eb5-c374-4bfb-81d1-c0ba622386cf	g.chr12:49666152G>A	ENST00000301072.6	+	4	767	c.492G>A	c.(490-492)aaG>aaA	p.K164K	TUBA1C_ENST00000541364.1_Silent_p.K234K|RP11-161H23.5_ENST00000550468.2_RNA	NM_032704.3	NP_116093.1	Q9BQE3	TBA1C_HUMAN	tubulin, alpha 1c	164					'de novo' posttranslational protein folding (GO:0051084)|cell division (GO:0051301)|cellular protein metabolic process (GO:0044267)|cytoskeleton-dependent intracellular transport (GO:0030705)|microtubule-based process (GO:0007017)|protein folding (GO:0006457)|protein polymerization (GO:0051258)	cytoplasmic microtubule (GO:0005881)|microtubule (GO:0005874)|nucleus (GO:0005634)|vesicle (GO:0031982)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)	p.K164K(1)		endometrium(1)|large_intestine(3)|liver(1)|lung(7)|skin(1)	13						ATGGCAAGAAGTCCAAGCTGG	0.547																																					p.K164K		.											.	TUBA1C-90	1	Substitution - coding silent(1)	large_intestine(1)	c.G492A						.						56.0	58.0	57.0					12																	49666152		2203	4300	6503	SO:0001819	synonymous_variant	84790	exon4			CAAGAAGTCCAAG	BC004949	CCDS8782.1	12q13.12	2007-03-16	2007-02-12	2007-02-12		ENSG00000167553		"""Tubulins"""	20768	protein-coding gene	gene with protein product			"""tubulin, alpha 6"""	TUBA6		7821789	Standard	NM_032704		Approved	MGC14580, MGC10851, bcm948	uc001rtt.1	Q9BQE3		ENST00000301072.6:c.492G>A	12.37:g.49666152G>A		Somatic	308	27		WXS	Illumina GAIIx	Phase_I	311	38	NM_032704	0	0	320	805	485		Silent	SNP	ENST00000301072.6	37	CCDS8782.1																																																																																			G|0.998;A|0.002		0.547	TUBA1C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404424.1	NM_032704	
KRT7	3855	hgsc.bcm.edu	37	12	52627215	52627215	+	Silent	SNP	A	A	G	rs7308888	byFrequency	TCGA-PK-A5HA-01A-11D-A29I-10	TCGA-PK-A5HA-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2bd7613-8a82-453c-b1d0-f0ad6fbc0766	688c5eb5-c374-4bfb-81d1-c0ba622386cf	g.chr12:52627215A>G	ENST00000331817.5	+	1	318	c.135A>G	c.(133-135)tcA>tcG	p.S45S		NM_005556.3	NP_005547.3	P08729	K2C7_HUMAN	keratin 7	45	Head.				viral process (GO:0016032)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)|keratin filament (GO:0045095)|nucleus (GO:0005634)	structural molecule activity (GO:0005198)			endometrium(1)|kidney(1)|large_intestine(3)|lung(5)|prostate(2)|stomach(1)|urinary_tract(1)	14				BRCA - Breast invasive adenocarcinoma(357;0.105)	Primaquine(DB01087)	TCGGCGCCTCACGGCCGCGCG	0.771													g|||	4451	0.888778	0.9781	0.8473	5008	,	,		10346	0.9048		0.8191	False		,,,				2504	0.8528				p.S45S		.											.	KRT7-90	0			c.A135G						.			3161,173		1496,169,2	4.0	6.0	5.0		135	-5.3	0.0	12	dbSNP_116	5	5763,1251		2369,1025,113	no	coding-synonymous	KRT7	NM_005556.3		3865,1194,115	GG,GA,AA		17.8358,5.189,13.7611		45/470	52627215	8924,1424	1667	3507	5174	SO:0001819	synonymous_variant	3855	exon1			CGCCTCACGGCCG		CCDS8822.1	12q13.13	2013-01-16			ENSG00000135480	ENSG00000135480		"""-"", ""Intermediate filaments type II, keratins (basic)"""	6445	protein-coding gene	gene with protein product	"""keratin, type II cytoskeletal 7"", ""cytokeratin 7"", ""sarcolectin"", ""keratin, 55K type II cytoskeletal"""	148059				1713141, 16831889	Standard	XR_245927		Approved	K7, CK7, K2C7, SCL	uc001saa.1	P08729	OTTHUMG00000169580	ENST00000331817.5:c.135A>G	12.37:g.52627215A>G		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	5	5	NM_005556	0	0	0	0	0	Q92676|Q9BUD8|Q9Y3R7	Silent	SNP	ENST00000331817.5	37	CCDS8822.1																																																																																			A|0.133;G|0.867		0.771	KRT7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404897.1	NM_005556	
KRT4	3851	bcgsc.ca	37	12	53207603	53207603	+	Silent	SNP	A	A	G	rs7135148		TCGA-PK-A5HA-01A-11D-A29I-10	TCGA-PK-A5HA-10A-01D-A29L-10	A	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2bd7613-8a82-453c-b1d0-f0ad6fbc0766	688c5eb5-c374-4bfb-81d1-c0ba622386cf	g.chr12:53207603A>G	ENST00000551956.1	-	1	732	c.240T>C	c.(238-240)ttT>ttC	p.F80F	KRT4_ENST00000293774.4_Silent_p.F154F|KRT4_ENST00000458244.2_Silent_p.F60F			P19013	K2C4_HUMAN	keratin 4	80	Gly-rich.|Head.				cytoskeleton organization (GO:0007010)|epithelial cell differentiation (GO:0030855)|negative regulation of epithelial cell proliferation (GO:0050680)	cell surface (GO:0009986)|intermediate filament (GO:0005882)|intermediate filament cytoskeleton (GO:0045111)|keratin filament (GO:0045095)|nucleus (GO:0005634)	structural molecule activity (GO:0005198)			endometrium(3)|kidney(4)|large_intestine(6)|lung(8)|ovary(4)|prostate(2)|skin(2)	29						CACCAGTGCCAAAGCCTCCAG	0.602																																					p.F80F	Pancreas(190;284 2995 41444 45903)	.											.	KRT4-96	0			c.T240C						.						82.0	99.0	94.0					12																	53207603		2119	4253	6372	SO:0001819	synonymous_variant	3851	exon1			AGTGCCAAAGCCT		CCDS41787.1, CCDS41787.2	12q13.13	2013-01-16			ENSG00000170477	ENSG00000170477		"""-"", ""Intermediate filaments type II, keratins (basic)"""	6441	protein-coding gene	gene with protein product	"""cytokeratin 4"", ""keratin, type II cytoskeletal 4"""	123940		CYK4		16831889	Standard	NM_002272		Approved	CK4, K4	uc031qhk.1	P19013		ENST00000551956.1:c.240T>C	12.37:g.53207603A>G		Somatic	50	1		WXS	Illumina GAIIx	Phase_I	72	24	NM_002272	0	0	0	0	0	F8VS64|Q6GTR8|Q96LA7|Q9BTL1	Silent	SNP	ENST00000551956.1	37	CCDS41787.2																																																																																			A|1.000;|0.000		0.602	KRT4-001	KNOWN	upstream_ATG|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000405931.1	NM_002272	
KRT4	3851	bcgsc.ca	37	12	53207606	53207606	+	Silent	SNP	G	G	A	rs79164931		TCGA-PK-A5HA-01A-11D-A29I-10	TCGA-PK-A5HA-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2bd7613-8a82-453c-b1d0-f0ad6fbc0766	688c5eb5-c374-4bfb-81d1-c0ba622386cf	g.chr12:53207606G>A	ENST00000551956.1	-	1	729	c.237C>T	c.(235-237)ggC>ggT	p.G79G	KRT4_ENST00000293774.4_Silent_p.G153G|KRT4_ENST00000458244.2_Silent_p.G59G			P19013	K2C4_HUMAN	keratin 4	79	Gly-rich.|Head.				cytoskeleton organization (GO:0007010)|epithelial cell differentiation (GO:0030855)|negative regulation of epithelial cell proliferation (GO:0050680)	cell surface (GO:0009986)|intermediate filament (GO:0005882)|intermediate filament cytoskeleton (GO:0045111)|keratin filament (GO:0045095)|nucleus (GO:0005634)	structural molecule activity (GO:0005198)			endometrium(3)|kidney(4)|large_intestine(6)|lung(8)|ovary(4)|prostate(2)|skin(2)	29						CAGTGCCAAAGCCTCCAGCAC	0.597																																					p.G79G	Pancreas(190;284 2995 41444 45903)	.											.	KRT4-96	0			c.C237T						.						85.0	102.0	96.0					12																	53207606		2113	4248	6361	SO:0001819	synonymous_variant	3851	exon1			GCCAAAGCCTCCA		CCDS41787.1, CCDS41787.2	12q13.13	2013-01-16			ENSG00000170477	ENSG00000170477		"""-"", ""Intermediate filaments type II, keratins (basic)"""	6441	protein-coding gene	gene with protein product	"""cytokeratin 4"", ""keratin, type II cytoskeletal 4"""	123940		CYK4		16831889	Standard	NM_002272		Approved	CK4, K4	uc031qhk.1	P19013		ENST00000551956.1:c.237C>T	12.37:g.53207606G>A		Somatic	52	1		WXS	Illumina GAIIx	Phase_I	69	21	NM_002272	0	0	0	0	0	F8VS64|Q6GTR8|Q96LA7|Q9BTL1	Silent	SNP	ENST00000551956.1	37	CCDS41787.2																																																																																			.		0.597	KRT4-001	KNOWN	upstream_ATG|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000405931.1	NM_002272	
OTOGL	283310	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	12	80749522	80749522	+	Missense_Mutation	SNP	C	C	G			TCGA-PK-A5HA-01A-11D-A29I-10	TCGA-PK-A5HA-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2bd7613-8a82-453c-b1d0-f0ad6fbc0766	688c5eb5-c374-4bfb-81d1-c0ba622386cf	g.chr12:80749522C>G	ENST00000547103.1	+	46	5543	c.5537C>G	c.(5536-5538)aCt>aGt	p.T1846S	OTOGL_ENST00000546620.1_5'Flank|OTOGL_ENST00000458043.2_Missense_Mutation_p.T1858S			Q3ZCN5	OTOGL_HUMAN	otogelin-like	1846					L-arabinose metabolic process (GO:0046373)	extracellular region (GO:0005576)	alpha-L-arabinofuranosidase activity (GO:0046556)			breast(1)|endometrium(3)|kidney(2)|large_intestine(2)|lung(14)|prostate(1)	23						TAAGCATGCACTGATAGTGAA	0.428																																					p.T1858S		.											.	.	0			c.C5573G						.						58.0	57.0	57.0					12																	80749522		1878	4103	5981	SO:0001583	missense	283310	exon46			CATGCACTGATAG	AK096852		12q21.31	2011-02-11	2011-02-11	2011-02-11	ENSG00000165899	ENSG00000165899			26901	protein-coding gene	gene with protein product		614925	"""chromosome 12 open reading frame 64"""	C12orf64			Standard	NM_173591		Approved	FLJ90579	uc001szd.3	Q3ZCN5	OTTHUMG00000150509	ENST00000547103.1:c.5537C>G	12.37:g.80749522C>G	ENSP00000447211:p.Thr1846Ser	Somatic	79	0		WXS	Illumina GAIIx	Phase_I	117	8	NM_173591	0	0	0	0	0	F8W0C3|Q495U8|Q8N8G5|Q8NC28	Missense_Mutation	SNP	ENST00000547103.1	37		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	16.48|16.48	3.136424|3.136424	0.56936|0.56936	.|.	.|.	ENSG00000165899|ENSG00000165899	ENST00000298820|ENST00000547103;ENST00000458043	.|T;T	.|0.17213	.|2.29;2.29	5.12|5.12	4.21|4.21	0.49690|0.49690	.|.	.|.	.|.	.|.	.|.	T|T	0.30355|0.30355	0.0762|0.0762	M|M	0.68952|0.68952	2.095|2.095	0.33837|0.33837	D|D	0.630934|0.630934	.|.	.|.	.|.	.|.	.|.	.|.	T|T	0.39099|0.39099	-0.9630|-0.9630	5|7	.|0.22109	.|T	.|0.4	.|.	15.6698|15.6698	0.77264|0.77264	0.0:0.8624:0.1376:0.0|0.0:0.8624:0.1376:0.0	.|.	.|.	.|.	.|.	V|S	301|1846;1858	.|ENSP00000447211:T1846S;ENSP00000400895:T1858S	.|ENSP00000400895:T1858S	L|T	+|+	1|2	2|0	OTOGL|OTOGL	79273653|79273653	1.000000|1.000000	0.71417|0.71417	0.998000|0.998000	0.56505|0.56505	0.995000|0.995000	0.86356|0.86356	5.461000|5.461000	0.66699|0.66699	1.237000|1.237000	0.43756|0.43756	0.655000|0.655000	0.94253|0.94253	CTG|ACT	.		0.428	OTOGL-001	NOVEL	not_organism_supported|basic	protein_coding	protein_coding	OTTHUMT00000407438.1	NM_173591	
DNAH10	196385	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	124413963	124413963	+	Nonsense_Mutation	SNP	C	C	T			TCGA-PK-A5HA-01A-11D-A29I-10	TCGA-PK-A5HA-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2bd7613-8a82-453c-b1d0-f0ad6fbc0766	688c5eb5-c374-4bfb-81d1-c0ba622386cf	g.chr12:124413963C>T	ENST00000409039.3	+	70	12119	c.12094C>T	c.(12094-12096)Cag>Tag	p.Q4032*	CCDC92_ENST00000544798.1_Intron|DNAH10OS_ENST00000514254.2_3'UTR	NM_207437.3	NP_997320.2	Q8IVF4	DYH10_HUMAN	dynein, axonemal, heavy chain 10	4032	AAA 6. {ECO:0000250}.				microtubule-based movement (GO:0007018)	cilium (GO:0005929)|cytoplasm (GO:0005737)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(14)|ovary(4)|prostate(2)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	52	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000207)|Epithelial(86;0.000556)|all cancers(50;0.00346)		TGCTGTGGTGCAGGAGAGAAG	0.522																																					p.Q4032X		.											.	DNAH10-95	0			c.C12094T						.						66.0	68.0	68.0					12																	124413963		2066	4204	6270	SO:0001587	stop_gained	196385	exon70			GTGGTGCAGGAGA	AJ132089	CCDS9255.2	12q24	2008-02-05	2006-09-04		ENSG00000197653	ENSG00000197653		"""Axonemal dyneins"""	2941	protein-coding gene	gene with protein product		605884	"""dynein, axonemal, heavy polypeptide 10"""				Standard	NM_207437		Approved	FLJ43808	uc001uft.4	Q8IVF4	OTTHUMG00000154477	ENST00000409039.3:c.12094C>T	12.37:g.124413963C>T	ENSP00000386770:p.Gln4032*	Somatic	188	0		WXS	Illumina GAIIx	Phase_I	239	101	NM_207437	0	0	0	0	0	C9JMF5|O95495|Q6ZUC9|Q6ZUP6|Q8N761	Nonsense_Mutation	SNP	ENST00000409039.3	37	CCDS9255.2	.	.	.	.	.	.	.	.	.	.	C	53	21.382608	0.99940	.	.	ENSG00000197653	ENST00000409039	.	.	.	5.43	5.43	0.79202	.	0.128236	0.53938	D	0.000047	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.52906	T	0.07	.	19.5914	0.95514	0.0:1.0:0.0:0.0	.	.	.	.	X	4032	.	ENSP00000386770:Q4032X	Q	+	1	0	DNAH10	122979916	1.000000	0.71417	1.000000	0.80357	0.851000	0.48451	7.776000	0.85560	2.720000	0.93068	0.591000	0.81541	CAG	.		0.522	DNAH10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335420.3		
NCOR2	9612	bcgsc.ca	37	12	124810065	124810065	+	Silent	SNP	T	T	G			TCGA-PK-A5HA-01A-11D-A29I-10	TCGA-PK-A5HA-10A-01D-A29L-10	T	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2bd7613-8a82-453c-b1d0-f0ad6fbc0766	688c5eb5-c374-4bfb-81d1-c0ba622386cf	g.chr12:124810065T>G	ENST00000405201.1	-	47	7428	c.7428A>C	c.(7426-7428)ccA>ccC	p.P2476P	NCOR2_ENST00000404121.2_Silent_p.P2037P|NCOR2_ENST00000356219.3_Silent_p.P2483P|NCOR2_ENST00000404621.1_Silent_p.P2420P|NCOR2_ENST00000397355.1_Silent_p.P2421P|NCOR2_ENST00000429285.2_Silent_p.P2466P			Q9Y618	NCOR2_HUMAN	nuclear receptor corepressor 2	2487					cellular lipid metabolic process (GO:0044255)|gene expression (GO:0010467)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|Notch signaling pathway (GO:0007219)|regulation of cellular ketone metabolic process by negative regulation of transcription from RNA polymerase II promoter (GO:0072365)|small molecule metabolic process (GO:0044281)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	membrane (GO:0016020)|nuclear body (GO:0016604)|nuclear matrix (GO:0016363)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|histone deacetylase binding (GO:0042826)|Notch binding (GO:0005112)|protein N-terminus binding (GO:0047485)|transcription corepressor activity (GO:0003714)			breast(5)|central_nervous_system(2)|endometrium(7)|kidney(5)|large_intestine(7)|lung(28)|ovary(3)|pancreas(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	69	all_neural(191;0.0804)|Medulloblastoma(191;0.163)			Epithelial(86;3.99e-05)|OV - Ovarian serous cystadenocarcinoma(86;9.14e-05)|all cancers(50;0.000402)|BRCA - Breast invasive adenocarcinoma(302;0.0764)		CCGGTGGGGGTGGGGAAGCCA	0.692																																					p.P2476P		.											.	NCOR2-229	0			c.A7428C						.						7.0	9.0	9.0					12																	124810065		1790	3922	5712	SO:0001819	synonymous_variant	9612	exon49			TGGGGGTGGGGAA	U37146	CCDS41857.1, CCDS41858.1, CCDS41857.2, CCDS41858.2, CCDS55892.1	12q24	2010-06-10	2010-06-10		ENSG00000196498	ENSG00000196498			7673	protein-coding gene	gene with protein product		600848	"""nuclear receptor co-repressor 2"""			7566127, 8813722	Standard	NM_001077261		Approved	SMRT, SMRTE, TRAC-1, CTG26, TNRC14	uc010tbb.2	Q9Y618	OTTHUMG00000150455	ENST00000405201.1:c.7428A>C	12.37:g.124810065T>G		Somatic	37	3		WXS	Illumina GAIIx	Phase_I	141	29	NM_006312	0	1	59	61	1	O00613|O15416|O15421|Q13354|Q56D06|Q59GM0|Q9Y5U0	Silent	SNP	ENST00000405201.1	37	CCDS41858.2	.	.	.	.	.	.	.	.	.	.	T	1.654	-0.513293	0.04200	.	.	ENSG00000196498	ENST00000443451	.	.	.	4.38	-8.76	0.00830	.	.	.	.	.	T	0.43964	0.1271	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.51965	-0.8638	4	.	.	.	-14.5673	5.3418	0.15988	0.0781:0.2146:0.1551:0.5521	.	.	.	.	P	273	.	.	H	-	2	0	NCOR2	123376018	0.000000	0.05858	0.092000	0.20876	0.334000	0.28698	-6.438000	0.00066	-3.221000	0.00212	-0.828000	0.03084	CAC	.		0.692	NCOR2-005	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000318173.2	NM_006312	
RIMBP2	23504	broad.mit.edu	37	12	130919325	130919325	+	Frame_Shift_Del	DEL	C	C	-			TCGA-PK-A5HA-01A-11D-A29I-10	TCGA-PK-A5HA-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2bd7613-8a82-453c-b1d0-f0ad6fbc0766	688c5eb5-c374-4bfb-81d1-c0ba622386cf	g.chr12:130919325delC	ENST00000261655.4	-	11	2319	c.2156delG	c.(2155-2157)ggcfs	p.G719fs	RIMBP2_ENST00000535703.1_Frame_Shift_Del_p.G627fs|RIMBP2_ENST00000536002.1_Frame_Shift_Del_p.G627fs	NM_015347.4	NP_056162.4	O15034	RIMB2_HUMAN	RIMS binding protein 2	719					negative regulation of phosphatase activity (GO:0010923)	cell junction (GO:0030054)|plasma membrane (GO:0005886)|synapse (GO:0045202)				NS(2)|breast(1)|central_nervous_system(5)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(23)|lung(33)|ovary(3)|pancreas(1)|prostate(3)|skin(6)|upper_aerodigestive_tract(5)|urinary_tract(1)	96	all_neural(191;0.101)|Medulloblastoma(191;0.163)	all_epithelial(31;0.213)		OV - Ovarian serous cystadenocarcinoma(86;4.29e-06)|all cancers(50;4.56e-05)|Epithelial(86;5.41e-05)		CACCGAGGCGCCCCTCCTCTT	0.637																																					p.G719fs		.											.	RIMBP2-142	0			c.2156delG						.						72.0	79.0	77.0					12																	130919325		2203	4300	6503	SO:0001589	frameshift_variant	23504	exon11			GAGGCGCCCCTCC	AB002316	CCDS31925.1	12q24.33	2014-06-13				ENSG00000060709			30339	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 133"""	611602				10748113	Standard	NM_015347		Approved	KIAA0318, RBP2, MGC15831, RIM-BP2, PPP1R133	uc001uil.2	O15034		ENST00000261655.4:c.2156delG	12.37:g.130919325delC	ENSP00000261655:p.Gly719fs	Somatic	66	0		WXS	Illumina GAIIx	Phase_I	63	9	NM_015347	0	0	0	0	0	Q96ID2	Frame_Shift_Del	DEL	ENST00000261655.4	37	CCDS31925.1																																																																																			.		0.637	RIMBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399520.1	NM_015347	
MICU2	221154	hgsc.bcm.edu	37	13	22178258	22178258	+	Silent	SNP	C	C	T	rs9509812	byFrequency	TCGA-PK-A5HA-01A-11D-A29I-10	TCGA-PK-A5HA-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2bd7613-8a82-453c-b1d0-f0ad6fbc0766	688c5eb5-c374-4bfb-81d1-c0ba622386cf	g.chr13:22178258C>T	ENST00000382374.4	-	1	95	c.30G>A	c.(28-30)cgG>cgA	p.R10R		NM_152726.2	NP_689939.1	Q8IYU8	MICU2_HUMAN	mitochondrial calcium uptake 2	10	Ala-rich.				mitochondrial calcium ion transport (GO:0006851)|negative regulation of mitochondrial calcium ion concentration (GO:0051562)|positive regulation of mitochondrial calcium ion concentration (GO:0051561)	calcium channel complex (GO:0034704)|mitochondrial intermembrane space (GO:0005758)|mitochondrion (GO:0005739)|uniplex complex (GO:1990246)	calcium ion binding (GO:0005509)|protein heterodimerization activity (GO:0046982)										AGGCCGCCACCCGCGCGCAGC	0.751													C|||	455	0.0908546	0.0113	0.1441	5008	,	,		12694	0.002		0.2545	False		,,,				2504	0.0838				p.R10R		.											.	EFHA1-90	0			c.G30A						.	C		108,3144		5,98,1523	3.0	3.0	3.0		30	-1.6	0.0	13	dbSNP_119	3	1216,5514		95,1026,2244	no	coding-synonymous	EFHA1	NM_152726.2		100,1124,3767	TT,TC,CC		18.0684,3.321,13.2639		10/435	22178258	1324,8658	1626	3365	4991	SO:0001819	synonymous_variant	221154	exon1			CGCCACCCGCGCG	AK091907	CCDS9297.1	13q12.11	2013-03-13	2013-03-13	2013-03-13	ENSG00000165487	ENSG00000165487		"""EF-hand domain containing"""	31830	protein-coding gene	gene with protein product		610632	"""EF hand domain family A1"", ""EF-hand domain family, member A1"""	EFHA1		23409044	Standard	NM_152726		Approved		uc001uof.3	Q8IYU8	OTTHUMG00000067414	ENST00000382374.4:c.30G>A	13.37:g.22178258C>T		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	7	7	NM_152726	0	0	0	5	5	Q8N0T6|Q8NAX8	Silent	SNP	ENST00000382374.4	37	CCDS9297.1																																																																																			C|0.873;T|0.127		0.751	MICU2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000144355.1	NM_152726	
MEDAG	84935	hgsc.bcm.edu	37	13	31480827	31480827	+	Missense_Mutation	SNP	A	A	G	rs9531945	byFrequency	TCGA-PK-A5HA-01A-11D-A29I-10	TCGA-PK-A5HA-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2bd7613-8a82-453c-b1d0-f0ad6fbc0766	688c5eb5-c374-4bfb-81d1-c0ba622386cf	g.chr13:31480827A>G	ENST00000380482.4	+	1	500	c.175A>G	c.(175-177)Agg>Ggg	p.R59G	TEX26-AS1_ENST00000592950.1_RNA|TEX26-AS1_ENST00000590721.1_RNA|TEX26-AS1_ENST00000585870.1_RNA|TEX26-AS1_ENST00000588726.1_RNA|TEX26-AS1_ENST00000590344.1_RNA|TEX26-AS1_ENST00000593246.1_RNA	NM_032849.3	NP_116238	Q5VYS4	MEDAG_HUMAN	mesenteric estrogen-dependent adipogenesis	59			R -> G (in dbSNP:rs9531945). {ECO:0000269|PubMed:14702039, ECO:0000269|PubMed:15489334}.		positive regulation of fat cell differentiation (GO:0045600)	cytoplasm (GO:0005737)											CGTGGTGGCCAggcccgggga	0.726													G|||	4890	0.976438	0.913	0.9957	5008	,	,		11722	1.0		1.0	False		,,,				2504	1.0				p.R59G		.											.	.	0			c.A175G						.	G	GLY/ARG	2883,187		1349,185,1	3.0	4.0	4.0		175	3.2	0.0	13	dbSNP_119	4	6648,4		3322,4,0	no	missense	C13orf33	NM_032849.3	125	4671,189,1	GG,GA,AA		0.0601,6.0912,1.9646	benign	59/304	31480827	9531,191	1535	3326	4861	SO:0001583	missense	84935	exon1			GTGGCCAGGCCCG	AB055407	CCDS9338.1	13q12.3	2013-10-11	2012-09-26	2012-09-26	ENSG00000102802	ENSG00000102802			25926	protein-coding gene	gene with protein product	"""mesenteric estrogen-dependent adipose 4"", ""activated in W/Wv mouse stomach 3 homolog"""		"""chromosome 13 open reading frame 33"""	C13orf33		22510272	Standard	NM_032849		Approved	FLJ14834, AWMS3, MEDA-4	uc001uth.4	Q5VYS4	OTTHUMG00000016679	ENST00000380482.4:c.175A>G	13.37:g.31480827A>G	ENSP00000369849:p.Arg59Gly	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	4	4	NM_032849	0	0	0	0	0	Q8IXF1|Q96K26|Q96NC8	Missense_Mutation	SNP	ENST00000380482.4	37	CCDS9338.1	2123	0.9720695970695971	437	0.8882113821138211	361	0.9972375690607734	567	0.9912587412587412	758	1.0	G	0.006	-2.044123	0.00398	0.939088	0.999399	ENSG00000102802	ENST00000380482	T	0.40225	1.04	4.92	3.15	0.36227	.	0.260438	0.31495	N	0.007559	T	0.00012	0.0000	N	0.02539	-0.55	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.42616	-0.9441	9	0.02654	T	1	-3.5214	6.5331	0.22338	0.1691:0.1474:0.6836:0.0	rs9531945;rs17857210;rs57016010;rs9531945	59	Q5VYS4	CM033_HUMAN	G	59	ENSP00000369849:R59G	ENSP00000369849:R59G	R	+	1	2	C13orf33	30378827	0.386000	0.25180	0.001000	0.08648	0.005000	0.04900	2.086000	0.41643	0.132000	0.18615	-1.032000	0.02404	AGG	A|0.219;G|0.781		0.726	MEDAG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044375.1	NM_032849	
UPF3A	65110	broad.mit.edu	37	13	115047559	115047559	+	Silent	SNP	C	C	T			TCGA-PK-A5HA-01A-11D-A29I-10	TCGA-PK-A5HA-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2bd7613-8a82-453c-b1d0-f0ad6fbc0766	688c5eb5-c374-4bfb-81d1-c0ba622386cf	g.chr13:115047559C>T	ENST00000375299.3	+	2	327	c.271C>T	c.(271-273)Ctg>Ttg	p.L91L	UPF3A_ENST00000351487.5_Silent_p.L91L	NM_023011.3	NP_075387.1	Q9H1J1	REN3A_HUMAN	UPF3 regulator of nonsense transcripts homolog A (yeast)	91	Required for interaction with UPF2.				gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|mRNA transport (GO:0051028)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|nucleocytoplasmic transport (GO:0006913)|positive regulation of translation (GO:0045727)|RNA metabolic process (GO:0016070)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	nucleocytoplasmic transporter activity (GO:0005487)|nucleotide binding (GO:0000166)|RNA binding (GO:0003723)	p.L91L(8)		autonomic_ganglia(1)|central_nervous_system(2)|kidney(2)|large_intestine(2)|lung(3)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	16	Lung NSC(43;0.00299)|all_neural(89;0.0337)|Medulloblastoma(90;0.163)|Lung SC(71;0.218)	all_cancers(25;0.0191)|all_epithelial(44;0.00716)|all_lung(25;0.0173)|Lung NSC(25;0.0634)|Breast(118;0.238)	BRCA - Breast invasive adenocarcinoma(86;0.0886)	OV - Ovarian serous cystadenocarcinoma(48;0.195)|Epithelial(10;0.2)		GCTGCGCCCGCTGCCAGCACA	0.731																																					p.L91L		.											.	UPF3A-91	8	Substitution - coding silent(8)	lung(2)|prostate(2)|kidney(2)|central_nervous_system(2)	c.C271T						.						4.0	4.0	4.0					13																	115047559		1902	3804	5706	SO:0001819	synonymous_variant	65110	exon2			CGCCCGCTGCCAG	AF318575	CCDS9543.1, CCDS9544.1	13q34	2010-04-30			ENSG00000169062	ENSG00000169062			20332	protein-coding gene	gene with protein product		605530				11113196, 11163187	Standard	NM_023011		Approved	RENT3A, UPF3, HUPF3A	uc001vup.3	Q9H1J1	OTTHUMG00000017403	ENST00000375299.3:c.271C>T	13.37:g.115047559C>T		Somatic	31	0		WXS	Illumina GAIIx	Phase_I	47	9	NM_080687	0	0	4	4	0	A2A366|Q5T8C3|Q5T8C9|Q7Z6N3|Q86YK1|Q9BZI8	Silent	SNP	ENST00000375299.3	37	CCDS9543.1																																																																																			.		0.731	UPF3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045968.2		
ZNF219	51222	hgsc.bcm.edu	37	14	21560753	21560758	+	In_Frame_Del	DEL	GAGGCT	GAGGCT	-	rs71794845|rs11278664|rs3841049	byFrequency	TCGA-PK-A5HA-01A-11D-A29I-10	TCGA-PK-A5HA-10A-01D-A29L-10	GAGGCT	GAGGCT	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2bd7613-8a82-453c-b1d0-f0ad6fbc0766	688c5eb5-c374-4bfb-81d1-c0ba622386cf	g.chr14:21560753_21560758delGAGGCT	ENST00000360947.3	-	3	1109_1114	c.698_703delAGCCTC	c.(697-705)cagcctcca>cca	p.QP233del	ZNF219_ENST00000451119.2_In_Frame_Del_p.QP233del|RP11-998D10.7_ENST00000554733.2_lincRNA|ZNF219_ENST00000556101.1_5'Flank|ZNF219_ENST00000421093.2_In_Frame_Del_p.QP233del	NM_016423.2	NP_057507.2	Q9P2Y4	ZN219_HUMAN	zinc finger protein 219	233				Missing (in Ref. 4; AAH00694). {ECO:0000305}.	negative regulation of transcription, DNA-templated (GO:0045892)|regulation of neurotransmitter levels (GO:0001505)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	integral component of membrane (GO:0016021)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histamine receptor activity (GO:0004969)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.Q233_P234delQP(3)		breast(1)|central_nervous_system(1)|cervix(1)|large_intestine(1)|lung(1)|ovary(1)|prostate(2)	8	all_cancers(95;0.00185)		OV - Ovarian serous cystadenocarcinoma(11;9.86e-11)|Epithelial(56;1.27e-08)|all cancers(55;6.06e-08)	GBM - Glioblastoma multiforme(265;0.0191)		ggctggggtggaggctgaggctgagg	0.743											OREG0022565	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)		1230	0.245607	0.2549	0.3775	5008	,	,		14407	0.125		0.1879	False		,,,				2504	0.3231				p.233_235del		.											.	ZNF219-90	3	Deletion - In frame(3)	large_intestine(1)|prostate(1)|breast(1)	c.698_703del						.		,,	821,2789		238,345,1222					,,	2.7	1.0		dbSNP_107	4	1173,6075		279,615,2730	no	coding,coding,coding	ZNF219	NM_016423.2,NM_001102454.1,NM_001101672.1	,,	517,960,3952	A1A1,A1R,RR		16.1838,22.7424,18.3643	,,	,,		1994,8864				SO:0001651	inframe_deletion	51222	exon3			GGGGTGGAGGCTG	AB015427	CCDS9568.1	14q11	2013-01-08			ENSG00000165804	ENSG00000165804		"""Zinc fingers, C2H2-type"""	13011	protein-coding gene	gene with protein product		605036				10819330	Standard	NM_016423		Approved		uc001vzs.2	Q9P2Y4	OTTHUMG00000029647	ENST00000360947.3:c.698_703delAGCCTC	14.37:g.21560759_21560764delGAGGCT	ENSP00000354206:p.Gln233_Pro234del	Somatic	1	1	749	WXS	Illumina GAIIx	Phase_I	35	27	NM_001102454	0	0	0	0	0	D3DS16|Q53Y57|Q8IYC1|Q9BW28	In_Frame_Del	DEL	ENST00000360947.3	37	CCDS9568.1																																																																																			.		0.743	ZNF219-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000073931.2		
AJUBA	84962	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	14	23450590	23450590	+	Missense_Mutation	SNP	C	C	T			TCGA-PK-A5HA-01A-11D-A29I-10	TCGA-PK-A5HA-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2bd7613-8a82-453c-b1d0-f0ad6fbc0766	688c5eb5-c374-4bfb-81d1-c0ba622386cf	g.chr14:23450590C>T	ENST00000262713.2	-	1	1261	c.886G>A	c.(886-888)Gga>Aga	p.G296R	RP11-298I3.4_ENST00000555294.1_RNA|RP11-298I3.4_ENST00000556503.1_RNA|RP11-298I3.4_ENST00000557615.1_RNA|AJUBA_ENST00000361265.4_Missense_Mutation_p.G296R|RP11-298I3.5_ENST00000555074.1_Intron	NM_032876.4	NP_116265.1	Q96IF1	AJUBA_HUMAN	ajuba LIM protein	296	PreLIM.				calcium-dependent cell-cell adhesion (GO:0016339)|cellular protein localization (GO:0034613)|focal adhesion assembly (GO:0048041)|G2/M transition of mitotic cell cycle (GO:0000086)|gene silencing by miRNA (GO:0035195)|glycerophospholipid biosynthetic process (GO:0046474)|lamellipodium assembly (GO:0030032)|mitotic cell cycle (GO:0000278)|negative regulation of hippo signaling (GO:0035331)|negative regulation of kinase activity (GO:0033673)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of cellular biosynthetic process (GO:0031328)|positive regulation of gene silencing by miRNA (GO:2000637)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of protein complex assembly (GO:0031334)|regulation of cell migration (GO:0030334)|regulation of cellular response to hypoxia (GO:1900037)|regulation of GTPase activity (GO:0043087)|response to hypoxia (GO:0001666)|transcription, DNA-templated (GO:0006351)|wound healing, spreading of epidermal cells (GO:0035313)	cell-cell junction (GO:0005911)|cytoplasmic mRNA processing body (GO:0000932)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|transcription factor complex (GO:0005667)	alpha-catenin binding (GO:0045294)|chromatin binding (GO:0003682)|transcription corepressor activity (GO:0003714)|zinc ion binding (GO:0008270)										CCGCGGGCTCCGGCTTCTCGC	0.706																																					p.G296R		.											.	.	0			c.G886A						.						14.0	18.0	17.0					14																	23450590		2195	4292	6487	SO:0001583	missense	84962	exon1			GGGCTCCGGCTTC	AK025567	CCDS9581.1, CCDS9582.1	14q11.2	2011-11-10	2011-11-10	2011-11-10	ENSG00000129474	ENSG00000129474			20250	protein-coding gene	gene with protein product		609066	"""jub, ajuba homolog (Xenopus laevis)"""	JUB		10330178	Standard	NM_032876		Approved	MGC15563	uc001whz.3	Q96IF1	OTTHUMG00000028711	ENST00000262713.2:c.886G>A	14.37:g.23450590C>T	ENSP00000262713:p.Gly296Arg	Somatic	54	0		WXS	Illumina GAIIx	Phase_I	96	41	NM_032876	0	0	0	1	1	A8MX18|D3DS37	Missense_Mutation	SNP	ENST00000262713.2	37	CCDS9581.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	12.78|12.78	2.041518|2.041518	0.35989|0.35989	.|.	.|.	ENSG00000129474|ENSG00000129474	ENST00000262713;ENST00000361265|ENST00000553736	T;T|.	0.58652|.	0.32;0.32|.	5.16|5.16	3.26|3.26	0.37387|0.37387	.|.	0.395237|.	0.23123|.	N|.	0.051666|.	T|T	0.34978|0.34978	0.0916|0.0916	L|L	0.29908|0.29908	0.895|0.895	0.19575|0.19575	N|N	0.999967|0.999967	B|.	0.29590|.	0.25|.	B|.	0.16289|.	0.015|.	T|T	0.19160|0.19160	-1.0314|-1.0314	10|5	0.13470|.	T|.	0.59|.	.|.	11.1395|11.1395	0.48394|0.48394	0.4866:0.5134:0.0:0.0|0.4866:0.5134:0.0:0.0	.|.	296|.	Q96IF1|.	JUB_HUMAN|.	R|Q	296|69	ENSP00000262713:G296R;ENSP00000354491:G296R|.	ENSP00000262713:G296R|.	G|R	-|-	1|2	0|0	JUB|JUB	22520430|22520430	0.026000|0.026000	0.19158|0.19158	0.069000|0.069000	0.20011|0.20011	0.390000|0.390000	0.30446|0.30446	1.150000|1.150000	0.31639|0.31639	0.502000|0.502000	0.28037|0.28037	0.655000|0.655000	0.94253|0.94253	GGA|CGG	.		0.706	AJUBA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000071685.2		
ADCY4	196883	broad.mit.edu	37	14	24801000	24801000	+	Silent	SNP	C	C	T			TCGA-PK-A5HA-01A-11D-A29I-10	TCGA-PK-A5HA-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2bd7613-8a82-453c-b1d0-f0ad6fbc0766	688c5eb5-c374-4bfb-81d1-c0ba622386cf	g.chr14:24801000C>T	ENST00000310677.4	-	5	776	c.663G>A	c.(661-663)aaG>aaA	p.K221K	ADCY4_ENST00000418030.2_Silent_p.K221K|ADCY4_ENST00000554068.2_Silent_p.K221K|ADCY4_ENST00000558563.1_5'Flank|ADCY4_ENST00000396747.3_5'UTR	NM_001198568.1|NM_001198592.1|NM_139247.3	NP_001185497.1|NP_001185521.1|NP_640340.2	Q8NFM4	ADCY4_HUMAN	adenylate cyclase 4	221					activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|cAMP biosynthetic process (GO:0006171)|cellular response to glucagon stimulus (GO:0071377)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|neurotrophin TRK receptor signaling pathway (GO:0048011)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	adenylate cyclase activity (GO:0004016)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)			cervix(1)|endometrium(1)|kidney(1)|large_intestine(10)|lung(13)|ovary(2)|pancreas(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	34				GBM - Glioblastoma multiforme(265;0.0192)		TGACCTGGTGCTTCTTCTCGG	0.637																																					p.K221K		.											.	ADCY4-93	0			c.G663A						.						23.0	25.0	25.0					14																	24801000		2203	4300	6503	SO:0001819	synonymous_variant	196883	exon5			CTGGTGCTTCTTC	AF497516	CCDS9627.1	14q11.2	2013-02-04			ENSG00000129467	ENSG00000129467	4.6.1.1	"""Adenylate cyclases"""	235	protein-coding gene	gene with protein product		600292				7766992	Standard	NM_001198592		Approved	AC4	uc001woy.3	Q8NFM4	OTTHUMG00000029347	ENST00000310677.4:c.663G>A	14.37:g.24801000C>T		Somatic	55	0		WXS	Illumina GAIIx	Phase_I	73	3	NM_001198592	0	0	0	0	0	B3KV74|D3DS75|Q17R40|Q6ZTM6|Q96ML7	Silent	SNP	ENST00000310677.4	37	CCDS9627.1																																																																																			.		0.637	ADCY4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000073200.4		
MYEF2	50804	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	15	48460977	48460977	+	Missense_Mutation	SNP	C	C	T			TCGA-PK-A5HA-01A-11D-A29I-10	TCGA-PK-A5HA-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2bd7613-8a82-453c-b1d0-f0ad6fbc0766	688c5eb5-c374-4bfb-81d1-c0ba622386cf	g.chr15:48460977C>T	ENST00000324324.7	-	2	500	c.221G>A	c.(220-222)aGt>aAt	p.S74N	MYEF2_ENST00000267836.6_Missense_Mutation_p.S74N	NM_016132.3	NP_057216	Q9P2K5	MYEF2_HUMAN	myelin expression factor 2	74					myotube differentiation (GO:0014902)|neuron differentiation (GO:0030182)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			endometrium(3)|kidney(1)|large_intestine(8)|lung(16)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	31		all_lung(180;0.00217)		all cancers(107;3.73e-10)|GBM - Glioblastoma multiforme(94;7.81e-07)		GGCCTTCTTACTTCCTGTAGA	0.358																																					p.S74N		.											.	MYEF2-523	0			c.G221A						.						132.0	125.0	128.0					15																	48460977		2196	4295	6491	SO:0001583	missense	50804	exon2			TTCTTACTTCCTG	AB037762	CCDS32230.1, CCDS73722.1	15q15.1	2013-07-16				ENSG00000104177		"""RNA binding motif (RRM) containing"""	17940	protein-coding gene	gene with protein product						10718198, 2601707	Standard	XM_005254422		Approved	MEF-2, FLJ11213, KIAA1341, HsT18564	uc001zwi.4	Q9P2K5		ENST00000324324.7:c.221G>A	15.37:g.48460977C>T	ENSP00000316950:p.Ser74Asn	Somatic	73	0		WXS	Illumina GAIIx	Phase_I	26	18	NM_016132	0	0	0	1	1	A7MCZ9|C9J921|C9K0J4|Q6NUM5|Q7L388|Q7Z4B7|Q9H922|Q9NUQ1	Missense_Mutation	SNP	ENST00000324324.7	37	CCDS32230.1	.	.	.	.	.	.	.	.	.	.	C	1.828	-0.470479	0.04445	.	.	ENSG00000104177	ENST00000324324;ENST00000267836	T;T	0.21191	2.63;2.02	5.78	-0.715	0.11215	Nucleotide-binding, alpha-beta plait (1);	0.398333	0.31784	N	0.007073	T	0.04137	0.0115	N	0.00823	-1.155	0.23320	N	0.997914	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.0	T	0.33369	-0.9871	10	0.19590	T	0.45	-6.0636	2.012	0.03489	0.118:0.2023:0.1227:0.557	.	74;74	Q9P2K5-2;Q9P2K5	.;MYEF2_HUMAN	N	74	ENSP00000316950:S74N;ENSP00000267836:S74N	ENSP00000267836:S74N	S	-	2	0	MYEF2	46248269	1.000000	0.71417	0.998000	0.56505	0.990000	0.78478	1.871000	0.39539	-0.072000	0.12864	-0.469000	0.05056	AGT	.		0.358	MYEF2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000416909.2	NM_016132	
CSPG4	1464	broad.mit.edu	37	15	75981976	75981976	+	Missense_Mutation	SNP	C	C	T	rs200493777		TCGA-PK-A5HA-01A-11D-A29I-10	TCGA-PK-A5HA-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2bd7613-8a82-453c-b1d0-f0ad6fbc0766	688c5eb5-c374-4bfb-81d1-c0ba622386cf	g.chr15:75981976C>T	ENST00000308508.5	-	3	1522	c.1430G>A	c.(1429-1431)cGc>cAc	p.R477H		NM_001897.4	NP_001888.2	Q6UVK1	CSPG4_HUMAN	chondroitin sulfate proteoglycan 4	477	Globular or compact configuration stabilized by disulfide bonds.|Neurite growth inhibition. {ECO:0000250}.			RH -> HY (in Ref. 1; CAA65529). {ECO:0000305}.	activation of MAPK activity (GO:0000187)|angiogenesis (GO:0001525)|carbohydrate metabolic process (GO:0005975)|cell proliferation (GO:0008283)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate catabolic process (GO:0030207)|chondroitin sulfate metabolic process (GO:0030204)|dermatan sulfate biosynthetic process (GO:0030208)|glial cell migration (GO:0008347)|glycosaminoglycan metabolic process (GO:0030203)|intracellular signal transduction (GO:0035556)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|small molecule metabolic process (GO:0044281)|tissue remodeling (GO:0048771)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cell projection (GO:0042995)|cell surface (GO:0009986)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|lysosomal lumen (GO:0043202)	protein kinase binding (GO:0019901)|signal transducer activity (GO:0004871)	p.R477H(1)		breast(1)|cervix(2)|endometrium(5)|kidney(5)|large_intestine(3)|liver(2)|lung(18)|ovary(2)|pancreas(2)|prostate(4)|skin(4)	48						CTCGCCATGGCGTGCCCCTCG	0.637																																					p.R477H		.											.	CSPG4-229	1	Substitution - Missense(1)	kidney(1)	c.G1430A						.						67.0	61.0	63.0					15																	75981976		2197	4291	6488	SO:0001583	missense	1464	exon3			CCATGGCGTGCCC	X96753, AY359468	CCDS10284.1	15q24.2	2010-04-19	2007-02-16		ENSG00000173546	ENSG00000173546		"""Proteoglycans / Cell surface : Other"""	2466	protein-coding gene	gene with protein product	"""melanoma-associated chondroitin sulfate proteoglycan"""	601172	"""chondroitin sulfate proteoglycan 4 (melanoma-associated)"""			8790396, 16407841	Standard	NM_001897		Approved	MCSPG, MEL-CSPG, MSK16, NG2, MCSP, HMW-MAA	uc002baw.3	Q6UVK1	OTTHUMG00000142836	ENST00000308508.5:c.1430G>A	15.37:g.75981976C>T	ENSP00000312506:p.Arg477His	Somatic	254	0		WXS	Illumina GAIIx	Phase_I	167	5	NM_001897	0	0	4	4	0	D3DW77|Q92675	Missense_Mutation	SNP	ENST00000308508.5	37	CCDS10284.1	.	.	.	.	.	.	.	.	.	.	.	9.517	1.107225	0.20714	.	.	ENSG00000173546	ENST00000308508	T	0.19532	2.14	5.12	4.19	0.49359	.	0.096704	0.44483	D	0.000447	T	0.17746	0.0426	L	0.57536	1.79	0.27465	N	0.953023	P	0.35628	0.513	B	0.27380	0.079	T	0.14783	-1.0460	10	0.41790	T	0.15	.	9.3594	0.38186	0.0:0.8315:0.0:0.1685	.	477	Q6UVK1	CSPG4_HUMAN	H	477	ENSP00000312506:R477H	ENSP00000312506:R477H	R	-	2	0	CSPG4	73769031	0.038000	0.19896	0.145000	0.22337	0.035000	0.12851	1.407000	0.34657	2.375000	0.81037	0.555000	0.69702	CGC	C|0.999;T|0.001		0.637	CSPG4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000286472.1	NM_001897	
CAPN15	6650	hgsc.bcm.edu	37	16	599306	599306	+	Silent	SNP	G	G	T			TCGA-PK-A5HA-01A-11D-A29I-10	TCGA-PK-A5HA-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2bd7613-8a82-453c-b1d0-f0ad6fbc0766	688c5eb5-c374-4bfb-81d1-c0ba622386cf	g.chr16:599306G>T	ENST00000219611.2	+	6	2040	c.1677G>T	c.(1675-1677)gcG>gcT	p.A559A	LA16c-366D1.3_ENST00000565879.1_RNA	NM_005632.2	NP_005623.1	O75808	CAN15_HUMAN	calpain 15	559	Calpain catalytic. {ECO:0000255|PROSITE- ProRule:PRU00239}.				proteolysis (GO:0006508)|regulation of transcription, DNA-templated (GO:0006355)	cytoplasm (GO:0005737)	calcium-dependent cysteine-type endopeptidase activity (GO:0004198)|cysteine-type peptidase activity (GO:0008234)|peptidase activity (GO:0008233)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)										GCGCCCTGGCGGTGCTGGCGG	0.746																																					p.A559A		.											.	SOLH-523	0			c.G1677T						.						9.0	10.0	10.0					16																	599306		2126	4227	6353	SO:0001819	synonymous_variant	6650	exon6			CCTGGCGGTGCTG	U85647	CCDS10410.1	16p13.3	2013-06-27	2013-06-27	2013-06-27	ENSG00000103326	ENSG00000103326			11182	protein-coding gene	gene with protein product		603267	"""small optic lobes (Drosophila) homolog"", ""small optic lobes homolog (Drosophila)"""	SOLH		9722942	Standard	NM_005632		Approved		uc002chi.3	O75808	OTTHUMG00000119059	ENST00000219611.2:c.1677G>T	16.37:g.599306G>T		Somatic	2	0		WXS	Illumina GAIIx	Phase_I	61	4	NM_005632	0	0	22	22	0	B1B1M4|Q2KHS2|Q8WTY9|Q9BUW0	Silent	SNP	ENST00000219611.2	37	CCDS10410.1																																																																																			.		0.746	CAPN15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000239271.1	NM_005632	
PRSS21	10942	hgsc.bcm.edu	37	16	2867326	2867326	+	Silent	SNP	G	G	A	rs376418132	byFrequency	TCGA-PK-A5HA-01A-11D-A29I-10	TCGA-PK-A5HA-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2bd7613-8a82-453c-b1d0-f0ad6fbc0766	688c5eb5-c374-4bfb-81d1-c0ba622386cf	g.chr16:2867326G>A	ENST00000005995.3	+	1	99	c.57G>A	c.(55-57)agG>agA	p.R19R	PRSS21_ENST00000455114.1_Silent_p.R19R|PRSS21_ENST00000450020.3_Silent_p.R19R			Q9Y6M0	TEST_HUMAN	protease, serine, 21 (testisin)	19					spermatogenesis (GO:0007283)	anchored component of membrane (GO:0031225)|cytoplasm (GO:0005737)|membrane (GO:0016020)|plasma membrane (GO:0005886)	serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)			breast(1)|endometrium(1)|kidney(2)|large_intestine(3)|lung(5)|ovary(1)|skin(2)	15						CTGGACTCAGGAAGCCGGGTG	0.756													g|||	21	0.00419329	0.0	0.0043	5008	,	,		6500	0.0		0.0159	False		,,,				2504	0.002				p.R19R		.											.	PRSS21-92	0			c.G57A						.		,,	4,3520		0,4,1758	3.0	4.0	3.0		57,57,57	2.2	0.0	16		3	24,7128		0,24,3552	no	coding-synonymous,coding-synonymous,coding-synonymous	PRSS21	NM_006799.2,NM_144956.1,NM_144957.1	,,	0,28,5310	AA,AG,GG		0.3356,0.1135,0.2623	,,	19/315,19/313,19/301	2867326	28,10648	1762	3576	5338	SO:0001819	synonymous_variant	10942	exon1			ACTCAGGAAGCCG	AF058300	CCDS10478.1, CCDS45388.1	16p13.3	2010-05-07			ENSG00000007038	ENSG00000007038		"""Serine peptidases / Serine peptidases"""	9485	protein-coding gene	gene with protein product		608159				10397266, 9826525	Standard	NM_006799		Approved	ESP-1, TEST1, TESTISIN	uc002crt.4	Q9Y6M0	OTTHUMG00000128931	ENST00000005995.3:c.57G>A	16.37:g.2867326G>A		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	13	9	NM_144957	0	0	0	0	0	Q9NS34|Q9P2V6	Silent	SNP	ENST00000005995.3	37	CCDS10478.1																																																																																			.		0.756	PRSS21-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000250910.1	NM_006799	
MEFV	4210	hgsc.bcm.edu	37	16	3304573	3304573	+	Silent	SNP	G	G	T	rs224223	byFrequency	TCGA-PK-A5HA-01A-11D-A29I-10	TCGA-PK-A5HA-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2bd7613-8a82-453c-b1d0-f0ad6fbc0766	688c5eb5-c374-4bfb-81d1-c0ba622386cf	g.chr16:3304573G>T	ENST00000219596.1	-	2	534	c.495C>A	c.(493-495)gcC>gcA	p.A165A	MEFV_ENST00000541159.1_Intron|MEFV_ENST00000536379.1_Intron|MEFV_ENST00000339854.4_Intron	NM_000243.2	NP_000234.1	O15553	MEFV_HUMAN	Mediterranean fever	165					inflammatory response (GO:0006954)|innate immune response (GO:0045087)|negative regulation of inflammatory response (GO:0050728)|negative regulation of interleukin-1 beta production (GO:0032691)|negative regulation of interleukin-12 production (GO:0032695)|negative regulation of macrophage inflammatory protein 1 alpha production (GO:0071641)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|positive regulation of cysteine-type endopeptidase activity (GO:2001056)	cell projection (GO:0042995)|cytosol (GO:0005829)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|nucleus (GO:0005634)	actin binding (GO:0003779)|zinc ion binding (GO:0008270)	p.A165A(2)		NS(2)|biliary_tract(1)|breast(5)|central_nervous_system(2)|endometrium(2)|kidney(3)|large_intestine(6)|lung(19)|ovary(3)|prostate(1)|skin(6)	50						GGCCCTCCGAGGCCTTCTCTC	0.766													G|||	1935	0.386382	0.528	0.5965	5008	,	,		10896	0.1667		0.4732	False		,,,				2504	0.183				p.A165A		.											.	MEFV-228	2	Substitution - coding silent(2)	prostate(2)	c.C495A						.	G	,	2112,2188		580,952,618	7.0	7.0	7.0		495,	2.9	0.0	16	dbSNP_79	7	3826,4590		964,1898,1346	no	coding-synonymous,intron	MEFV	NM_000243.2,NM_001198536.1	,	1544,2850,1964	TT,TG,GG		45.461,49.1163,46.6971	,	165/782,	3304573	5938,6778	2150	4208	6358	SO:0001819	synonymous_variant	4210	exon2			CTCCGAGGCCTTC	AF018080	CCDS10498.1, CCDS55981.1	16p13.3	2014-09-17			ENSG00000103313	ENSG00000103313		"""Tripartite motif containing / Tripartite motif containing"""	6998	protein-coding gene	gene with protein product	"""pyrin"""	608107		MEF		9288094	Standard	NM_000243		Approved	FMF, TRIM20	uc002cun.1	O15553	OTTHUMG00000129324	ENST00000219596.1:c.495C>A	16.37:g.3304573G>T		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	17	11	NM_000243	0	0	0	0	0	D3DUC0|F5H0Q3|Q3MJ84|Q96PN4|Q96PN5	Silent	SNP	ENST00000219596.1	37	CCDS10498.1																																																																																			G|0.570;T|0.430		0.766	MEFV-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251464.1	NM_000243	
HS3ST2	9956	bcgsc.ca	37	16	22826339	22826339	+	Silent	SNP	A	A	G	rs208951	byFrequency	TCGA-PK-A5HA-01A-11D-A29I-10	TCGA-PK-A5HA-10A-01D-A29L-10	A	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2bd7613-8a82-453c-b1d0-f0ad6fbc0766	688c5eb5-c374-4bfb-81d1-c0ba622386cf	g.chr16:22826339A>G	ENST00000261374.3	+	1	842	c.408A>G	c.(406-408)gtA>gtG	p.V136V		NM_006043.1	NP_006034.1	Q9Y278	HS3S2_HUMAN	heparan sulfate (glucosamine) 3-O-sulfotransferase 2	136					carbohydrate metabolic process (GO:0005975)|circadian rhythm (GO:0007623)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan metabolic process (GO:0030203)|small molecule metabolic process (GO:0044281)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	[heparan sulfate]-glucosamine 3-sulfotransferase 2 activity (GO:0033871)|sulfotransferase activity (GO:0008146)			breast(2)|kidney(1)|large_intestine(5)|liver(2)|lung(5)|ovary(1)|pancreas(2)|skin(1)	19				GBM - Glioblastoma multiforme(48;0.0299)		TTATCCGAGTACACCCGGACG	0.642													G|||	2053	0.409944	0.5393	0.4741	5008	,	,		13709	0.3571		0.3688	False		,,,				2504	0.2863				p.V136V		.											.	HS3ST2-516	0			c.A408G						.	G		2219,2135		595,1029,553	18.0	22.0	20.0		408	3.1	1.0	16	dbSNP_79	20	3139,5409		615,1909,1750	no	coding-synonymous	HS3ST2	NM_006043.1		1210,2938,2303	GG,GA,AA		36.722,49.0354,41.5284		136/368	22826339	5358,7544	2177	4274	6451	SO:0001819	synonymous_variant	9956	exon1			CCGAGTACACCCG	AF105374	CCDS10606.1	16p12	2008-02-05			ENSG00000122254	ENSG00000122254	2.8.2.23	"""Sulfotransferases, membrane-bound"""	5195	protein-coding gene	gene with protein product		604056				9988767	Standard	NM_006043		Approved	3OST2	uc002dli.3	Q9Y278	OTTHUMG00000094785	ENST00000261374.3:c.408A>G	16.37:g.22826339A>G		Somatic	138	0		WXS	Illumina GAIIx	Phase_I	146	5	NM_006043	0	0	0	0	0	Q52LZ1	Silent	SNP	ENST00000261374.3	37	CCDS10606.1																																																																																			A|0.600;G|0.400		0.642	HS3ST2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000211598.1	NM_006043	
HS3ST2	9956	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	16	22826384	22826384	+	Missense_Mutation	SNP	C	C	G			TCGA-PK-A5HA-01A-11D-A29I-10	TCGA-PK-A5HA-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2bd7613-8a82-453c-b1d0-f0ad6fbc0766	688c5eb5-c374-4bfb-81d1-c0ba622386cf	g.chr16:22826384C>G	ENST00000261374.3	+	1	887	c.453C>G	c.(451-453)gaC>gaG	p.D151E		NM_006043.1	NP_006034.1	Q9Y278	HS3S2_HUMAN	heparan sulfate (glucosamine) 3-O-sulfotransferase 2	151	Substrate binding. {ECO:0000250}.				carbohydrate metabolic process (GO:0005975)|circadian rhythm (GO:0007623)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan metabolic process (GO:0030203)|small molecule metabolic process (GO:0044281)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	[heparan sulfate]-glucosamine 3-sulfotransferase 2 activity (GO:0033871)|sulfotransferase activity (GO:0008146)			breast(2)|kidney(1)|large_intestine(5)|liver(2)|lung(5)|ovary(1)|pancreas(2)|skin(1)	19				GBM - Glioblastoma multiforme(48;0.0299)		ACTTCTTTGACAGGAACTACG	0.632																																					p.D151E		.											.	HS3ST2-516	0			c.C453G						.						19.0	24.0	22.0					16																	22826384		2105	4160	6265	SO:0001583	missense	9956	exon1			CTTTGACAGGAAC	AF105374	CCDS10606.1	16p12	2008-02-05			ENSG00000122254	ENSG00000122254	2.8.2.23	"""Sulfotransferases, membrane-bound"""	5195	protein-coding gene	gene with protein product		604056				9988767	Standard	NM_006043		Approved	3OST2	uc002dli.3	Q9Y278	OTTHUMG00000094785	ENST00000261374.3:c.453C>G	16.37:g.22826384C>G	ENSP00000261374:p.Asp151Glu	Somatic	125	0		WXS	Illumina GAIIx	Phase_I	150	51	NM_006043	0	0	2	2	0	Q52LZ1	Missense_Mutation	SNP	ENST00000261374.3	37	CCDS10606.1	.	.	.	.	.	.	.	.	.	.	C	21.8	4.199419	0.79015	.	.	ENSG00000122254	ENST00000261374;ENST00000540146	D	0.82433	-1.61	5.12	3.95	0.45737	Sulfotransferase domain (1);	0.000000	0.85682	D	0.000000	D	0.90981	0.7164	M	0.88842	2.985	0.80722	D	1	D	0.76494	0.999	D	0.85130	0.997	D	0.91589	0.5285	10	0.87932	D	0	.	9.7836	0.40662	0.0:0.82:0.0:0.18	.	151	Q9Y278	HS3S2_HUMAN	E	151;159	ENSP00000261374:D151E	ENSP00000261374:D151E	D	+	3	2	HS3ST2	22733885	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	2.488000	0.45276	2.363000	0.80096	0.655000	0.94253	GAC	.		0.632	HS3ST2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000211598.1	NM_006043	
SNX20	124460	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	16	50707759	50707759	+	Missense_Mutation	SNP	G	G	A			TCGA-PK-A5HA-01A-11D-A29I-10	TCGA-PK-A5HA-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2bd7613-8a82-453c-b1d0-f0ad6fbc0766	688c5eb5-c374-4bfb-81d1-c0ba622386cf	g.chr16:50707759G>A	ENST00000330943.4	-	4	680	c.509C>T	c.(508-510)gCc>gTc	p.A170V	SNX20_ENST00000300590.3_Intron|RP11-401P9.5_ENST00000570167.1_RNA|SNX20_ENST00000423026.2_Intron|RP11-401P9.5_ENST00000570241.2_RNA	NM_182854.2	NP_878274.1	Q7Z614	SNX20_HUMAN	sorting nexin 20	170	PX. {ECO:0000255|PROSITE- ProRule:PRU00147}.				protein transport (GO:0015031)	endosome (GO:0005768)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	phosphatidylinositol binding (GO:0035091)			kidney(1)|large_intestine(3)|lung(5)|ovary(2)|prostate(1)|skin(2)|stomach(1)	15						GCAGCGGATGGCGTAGAGCAG	0.687																																					p.A170V		.											.	SNX20-23	0			c.C509T						.						31.0	31.0	31.0					16																	50707759		2198	4300	6498	SO:0001583	missense	124460	exon4			CGGATGGCGTAGA	AK055837	CCDS10745.1, CCDS10744.1, CCDS45481.1	16q12.1	2008-03-25	2008-03-25		ENSG00000167208	ENSG00000167208		"""Sorting nexins"""	30390	protein-coding gene	gene with protein product	"""selectin ligand interactor cytoplasmic 1"""	613281				18196517, 16782399	Standard	NM_182854		Approved	SLIC-1, SLIC1	uc002egk.2	Q7Z614	OTTHUMG00000133173	ENST00000330943.4:c.509C>T	16.37:g.50707759G>A	ENSP00000332062:p.Ala170Val	Somatic	18	0		WXS	Illumina GAIIx	Phase_I	30	6	NM_182854	0	0	0	0	0	A8K9D5|Q08E98|Q6P4H2|Q8IV59	Missense_Mutation	SNP	ENST00000330943.4	37	CCDS10745.1	.	.	.	.	.	.	.	.	.	.	G	25.4	4.631657	0.87660	.	.	ENSG00000167208	ENST00000330943	T	0.39997	1.05	5.63	3.59	0.41128	Phox homologous domain (5);	0.476231	0.23706	N	0.045365	T	0.46870	0.1415	M	0.61703	1.905	0.41694	D	0.989366	P	0.40000	0.698	B	0.43413	0.419	T	0.48736	-0.9009	10	0.52906	T	0.07	-14.3099	14.473	0.67529	0.0:0.2794:0.7206:0.0	.	170	Q7Z614	SNX20_HUMAN	V	170	ENSP00000332062:A170V	ENSP00000332062:A170V	A	-	2	0	SNX20	49265260	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	4.113000	0.57851	0.680000	0.31366	0.561000	0.74099	GCC	.		0.687	SNX20-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256879.2	NM_153337	
CCDC102A	92922	hgsc.bcm.edu	37	16	57562804	57562804	+	Missense_Mutation	SNP	G	G	A	rs12935069		TCGA-PK-A5HA-01A-11D-A29I-10	TCGA-PK-A5HA-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2bd7613-8a82-453c-b1d0-f0ad6fbc0766	688c5eb5-c374-4bfb-81d1-c0ba622386cf	g.chr16:57562804G>A	ENST00000258214.2	-	2	532	c.286C>T	c.(286-288)Cgg>Tgg	p.R96W		NM_033212.3	NP_149989.2	Q96A19	C102A_HUMAN	coiled-coil domain containing 102A	96				R -> W (in Ref. 2; AAH08285/AAH09941). {ECO:0000305}.						endometrium(1)|large_intestine(1)|lung(4)|ovary(1)|prostate(1)	8						TCCGACCACCGGCGCATGGTC	0.731													A|||	5008	1.0	1.0	1.0	5008	,	,		3757	1.0		1.0	False		,,,				2504	1.0				p.R96W		.											.	CCDC102A-91	0			c.C286T						.						8.0	10.0	9.0					16																	57562804		1834	3717	5551	SO:0001583	missense	92922	exon2			ACCACCGGCGCAT	BC008285	CCDS10784.1	16q13	2008-02-05			ENSG00000135736	ENSG00000135736			28097	protein-coding gene	gene with protein product						12477932	Standard	NM_033212		Approved	MGC10992	uc002elw.3	Q96A19	OTTHUMG00000133472	ENST00000258214.2:c.286C>T	16.37:g.57562804G>A	ENSP00000258214:p.Arg96Trp	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	8	8	NM_033212	0	0	0	1	1	Q9BT74	Missense_Mutation	SNP	ENST00000258214.2	37	CCDS10784.1	2180	0.9981684981684982	492	1.0	360	0.994475138121547	570	0.9965034965034965	758	1.0	A	10.17	1.277909	0.23307	.	.	ENSG00000135736	ENST00000258214	T	0.37752	1.18	4.82	4.82	0.62117	.	0.000000	0.64402	N	0.000001	T	0.00012	0.0000	N	0.00049	-2.415	0.40217	P	0.022302999999999962	B	0.02656	0.0	B	0.01281	0.0	T	0.44787	-0.9305	9	0.33141	T	0.24	-23.2491	9.5348	0.39216	0.9152:0.0:0.0848:0.0	rs12935069;rs12935069	96	Q96A19	C102A_HUMAN	W	96	ENSP00000258214:R96W	ENSP00000258214:R96W	R	-	1	2	CCDC102A	56120305	1.000000	0.71417	1.000000	0.80357	0.971000	0.66376	6.801000	0.75170	0.698000	0.31739	-0.556000	0.04195	CGG	G|0.001;A|0.999		0.731	CCDC102A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257348.1	NM_033212	
SLC7A6OS	84138	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	16	68330375	68330375	+	IGR	SNP	T	T	G			TCGA-PK-A5HA-01A-11D-A29I-10	TCGA-PK-A5HA-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2bd7613-8a82-453c-b1d0-f0ad6fbc0766	688c5eb5-c374-4bfb-81d1-c0ba622386cf	g.chr16:68330375T>G	ENST00000263997.6	-	0	4189				SLC7A6_ENST00000566454.1_Missense_Mutation_p.Y410D|SLC7A6_ENST00000219343.6_Missense_Mutation_p.Y410D	NM_032178.2	NP_115554.2	Q96CW6	S7A6O_HUMAN	solute carrier family 7, member 6 opposite strand						hematopoietic progenitor cell differentiation (GO:0002244)|protein transport (GO:0015031)	cytoplasm (GO:0005737)|nucleus (GO:0005634)				breast(1)|endometrium(1)|large_intestine(2)|lung(5)|ovary(1)	10		Ovarian(137;0.192)		OV - Ovarian serous cystadenocarcinoma(108;0.034)|Epithelial(162;0.106)		TGGACAGCTCTACCTCCGCTG	0.577																																					p.Y410D		.											.	SLC7A6-90	0			c.T1228G						.						146.0	136.0	140.0					16																	68330375		2198	4300	6498	SO:0001628	intergenic_variant	9057	exon9			CAGCTCTACCTCC		CCDS10865.1	16q22.1	2010-03-11			ENSG00000103061	ENSG00000103061			25807	protein-coding gene	gene with protein product							Standard	NM_032178		Approved	FLJ13291	uc002evw.2	Q96CW6	OTTHUMG00000137558		16.37:g.68330375T>G		Somatic	60	0		WXS	Illumina GAIIx	Phase_I	94	33	NM_003983	0	0	5	7	2	Q8TCZ3|Q9H8R8	Missense_Mutation	SNP	ENST00000263997.6	37	CCDS10865.1	.	.	.	.	.	.	.	.	.	.	T	24.1	4.490903	0.84962	.	.	ENSG00000103064	ENST00000219343	D	0.89875	-2.58	5.17	5.17	0.71159	Amino acid permease domain (1);	0.052694	0.85682	D	0.000000	D	0.95392	0.8504	M	0.92555	3.32	0.80722	D	1	D	0.71674	0.998	D	0.76575	0.988	D	0.96171	0.9123	10	0.72032	D	0.01	.	13.2394	0.59987	0.0:0.0:0.0:1.0	.	410	Q92536	YLAT2_HUMAN	D	410	ENSP00000219343:Y410D	ENSP00000219343:Y410D	Y	+	1	0	SLC7A6	66887876	1.000000	0.71417	1.000000	0.80357	0.967000	0.64934	7.891000	0.87319	2.079000	0.62486	0.459000	0.35465	TAC	.		0.577	SLC7A6OS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268894.3	NM_032178	
PKD1L2	114780	broad.mit.edu	37	16	81181855	81181855	+	RNA	SNP	G	G	A	rs373542968		TCGA-PK-A5HA-01A-11D-A29I-10	TCGA-PK-A5HA-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2bd7613-8a82-453c-b1d0-f0ad6fbc0766	688c5eb5-c374-4bfb-81d1-c0ba622386cf	g.chr16:81181855G>A	ENST00000525539.1	-	0	4860				PKD1L2_ENST00000533478.1_RNA	NM_052892.3	NP_443124.3	Q7Z442	PK1L2_HUMAN	polycystic kidney disease 1-like 2						ion transport (GO:0006811)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)	calcium ion binding (GO:0005509)|carbohydrate binding (GO:0030246)			breast(2)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(9)|lung(20)|ovary(2)|pancreas(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	44						TTCGCGACCCGGGGACGGGTG	0.587																																					.		.											.	PKD1L2-92	0			.						.	G	TRP/ARG	0,3738		0,0,1869	51.0	53.0	52.0		4861	1.7	0.8	16		52	2,8216		0,2,4107	no	missense	PKD1L2	NM_052892.3	101	0,2,5976	AA,AG,GG		0.0243,0.0,0.0167	possibly-damaging	1621/2460	81181855	2,11954	1869	4109	5978			114780	.			CGACCCGGGGACG	AY164483	CCDS61998.1, CCDS61999.1	16q23.2	2014-09-11			ENSG00000166473	ENSG00000166473			21715	protein-coding gene	gene with protein product		607894				12782129	Standard	NM_052892		Approved	KIAA1879	uc002fgf.1	Q7Z442	OTTHUMG00000166126		16.37:g.81181855G>A		Somatic	85	0		WXS	Illumina GAIIx	Phase_I	96	3	.	0	0	2	2	0	Q6UEE1|Q6ZN46|Q6ZSP2|Q8N1H9|Q96CL2|Q96Q08	RNA	SNP	ENST00000525539.1	37																																																																																				.		0.587	PKD1L2-001	KNOWN	non_canonical_polymorphism|basic	polymorphic_pseudogene	polymorphic_pseudogene	OTTHUMT00000387972.2		
ADAD2	161931	hgsc.bcm.edu	37	16	84224967	84224967	+	Missense_Mutation	SNP	G	G	A	rs8044695|rs554488585	byFrequency	TCGA-PK-A5HA-01A-11D-A29I-10	TCGA-PK-A5HA-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2bd7613-8a82-453c-b1d0-f0ad6fbc0766	688c5eb5-c374-4bfb-81d1-c0ba622386cf	g.chr16:84224967G>A	ENST00000315906.5	+	1	183	c.131G>A	c.(130-132)gGg>gAg	p.G44E	RP11-486L19.2_ENST00000565643.1_RNA|ADAD2_ENST00000268624.3_Missense_Mutation_p.G44E|RP11-486L19.2_ENST00000561900.1_RNA|RP11-486L19.2_ENST00000536986.1_RNA|ADAD2_ENST00000567413.1_3'UTR	NM_001145400.1	NP_001138872.1	Q8NCV1	ADAD2_HUMAN	adenosine deaminase domain containing 2	44			G -> E (in dbSNP:rs8044695). {ECO:0000269|PubMed:14702039, ECO:0000269|Ref.3}.		RNA processing (GO:0006396)		adenosine deaminase activity (GO:0004000)|RNA binding (GO:0003723)			NS(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(3)|ovary(1)|prostate(2)|skin(1)	13						AGTGCCTgggggcccgcgccc	0.751														3435	0.685903	0.8616	0.6686	5008	,	,		11640	0.6677		0.6471	False		,,,				2504	0.5194				p.G44E		.											.	ADAD2-68	0			c.G131A						.	A	GLU/GLY,GLU/GLY	3145,519		1356,433,43	5.0	7.0	7.0		131,131	-1.1	0.0	16	dbSNP_116	7	5102,2224		1808,1486,369	no	missense,missense	ADAD2	NM_001145400.1,NM_139174.3	98,98	3164,1919,412	AA,AG,GG		30.3576,14.1648,24.9591	benign,benign	44/584,44/666	84224967	8247,2743	1832	3663	5495	SO:0001583	missense	161931	exon1			CCTGGGGGCCCGC	AF447586	CCDS10944.1, CCDS45536.1	16q24.1	2007-05-31			ENSG00000140955	ENSG00000140955			30714	protein-coding gene	gene with protein product							Standard	NM_139174		Approved	TENRL, FLJ00337	uc002fhr.2	Q8NCV1	OTTHUMG00000137637	ENST00000315906.5:c.131G>A	16.37:g.84224967G>A	ENSP00000325153:p.Gly44Glu	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	5	5	NM_001145400	0	0	0	0	0	B2RCL6|Q8NA94	Missense_Mutation	SNP	ENST00000315906.5	37	CCDS45536.1	1545	0.7074175824175825	420	0.8536585365853658	227	0.6270718232044199	403	0.7045454545454546	495	0.6530343007915568	A	0.689	-0.795256	0.02862	0.858352	0.696424	ENSG00000140955	ENST00000315906;ENST00000268624	T;T	0.16196	2.36;2.47	3.61	-1.07	0.09968	.	1.276770	0.06034	N	0.653713	T	0.00012	0.0000	N	0.01874	-0.695	0.80722	P	0.0	B;B	0.06786	0.0;0.001	B;B	0.04013	0.0;0.001	T	0.30297	-0.9983	9	0.02654	T	1	-5.6132	8.9029	0.35505	0.4397:0.0:0.5603:0.0	rs8044695;rs57310648	44;44	Q8NCV1;Q8NCV1-2	ADAD2_HUMAN;.	E	44	ENSP00000325153:G44E;ENSP00000268624:G44E	ENSP00000268624:G44E	G	+	2	0	ADAD2	82782468	0.057000	0.20700	0.000000	0.03702	0.002000	0.02628	-0.069000	0.11542	-0.575000	0.05982	-1.305000	0.01319	GGG	G|0.292;A|0.708		0.751	ADAD2-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000433385.1	NM_139174	
ZFPM1	161882	hgsc.bcm.edu	37	16	88599696	88599697	+	Frame_Shift_Del	DEL	GA	GA	-	rs368520732|rs67712719	byFrequency	TCGA-PK-A5HA-01A-11D-A29I-10	TCGA-PK-A5HA-10A-01D-A29L-10	GA	GA	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2bd7613-8a82-453c-b1d0-f0ad6fbc0766	688c5eb5-c374-4bfb-81d1-c0ba622386cf	g.chr16:88599696_88599697delGA	ENST00000319555.3	+	10	1652_1653	c.1330_1331delGA	c.(1330-1332)gagfs	p.E444fs	RP11-21B21.4_ENST00000563243.1_RNA	NM_153813.2	NP_722520.2	Q8IX07	FOG1_HUMAN	zinc finger protein, FOG family member 1	444				EPLA -> AP (in Ref. 1; AAN45858). {ECO:0000305}.	atrial septum morphogenesis (GO:0060413)|atrioventricular valve morphogenesis (GO:0003181)|blood coagulation (GO:0007596)|cardiac muscle tissue morphogenesis (GO:0055008)|definitive erythrocyte differentiation (GO:0060318)|embryonic hemopoiesis (GO:0035162)|erythrocyte differentiation (GO:0030218)|granulocyte differentiation (GO:0030851)|megakaryocyte development (GO:0035855)|megakaryocyte differentiation (GO:0030219)|mitral valve formation (GO:0003192)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of interleukin-4 biosynthetic process (GO:0045403)|negative regulation of mast cell differentiation (GO:0060377)|negative regulation of protein binding (GO:0032091)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|outflow tract morphogenesis (GO:0003151)|platelet formation (GO:0030220)|positive regulation of interferon-gamma biosynthetic process (GO:0045078)|primitive erythrocyte differentiation (GO:0060319)|regulation of chemokine production (GO:0032642)|regulation of definitive erythrocyte differentiation (GO:0010724)|T-helper cell lineage commitment (GO:0002295)|transcriptional activation by promoter-enhancer looping (GO:0071733)|tricuspid valve formation (GO:0003195)|ventricular septum morphogenesis (GO:0060412)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|transcription factor complex (GO:0005667)|transcriptional repressor complex (GO:0017053)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II transcription factor binding (GO:0001085)|transcription factor binding (GO:0008134)			central_nervous_system(1)|ovary(2)|urinary_tract(1)	4				BRCA - Breast invasive adenocarcinoma(80;0.0478)		GGCCAGAGCGGAGCCTCTGGCC	0.743														4881	0.974641	0.9138	0.9914	5008	,	,		7261	0.996		1.0	False		,,,				2504	0.9969				p.444_444del	Pancreas(49;850 1106 29641 32847 38344)	.											.	ZFPM1-90	0			c.1330_1331del						.			2219,383		1063,93,145						-6.5	0.0		dbSNP_130	3	4709,133		2339,31,51	no	frameshift	ZFPM1	NM_153813.2		3402,124,196	A1A1,A1R,RR		2.7468,14.7194,6.9318				6928,516				SO:0001589	frameshift_variant	161882	exon10			AGAGCGGAGCCTC	AF488691	CCDS32502.1	16q24.2	2013-01-10	2012-11-27		ENSG00000179588	ENSG00000179588		"""Zinc fingers, C2H2-type"", ""Zinc fingers, C2HC-type containing"""	19762	protein-coding gene	gene with protein product		601950	"""zinc finger protein, multitype 1"""				Standard	NM_153813		Approved	FOG1, FOG, ZNF89A, ZC2HC11A	uc002fkv.3	Q8IX07	OTTHUMG00000173152	ENST00000319555.3:c.1330_1331delGA	16.37:g.88599696_88599697delGA	ENSP00000326630:p.Glu444fs	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	21	16	NM_153813	0	0	0	0	0		Frame_Shift_Del	DEL	ENST00000319555.3	37	CCDS32502.1																																																																																			.		0.743	ZFPM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000422270.2		
ZFPM1	161882	hgsc.bcm.edu	37	16	88599697	88599705	+	In_Frame_Del	DEL	AGCCTCTGG	AGCCTCTGG	-	rs67873604|rs149145771|rs368520732|rs67322929|rs201915453|rs67712719	byFrequency	TCGA-PK-A5HA-01A-11D-A29I-10	TCGA-PK-A5HA-10A-01D-A29L-10	AGCCTCTGG	AGCCTCTGG	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2bd7613-8a82-453c-b1d0-f0ad6fbc0766	688c5eb5-c374-4bfb-81d1-c0ba622386cf	g.chr16:88599697_88599705delAGCCTCTGG	ENST00000319555.3	+	10	1653_1661	c.1331_1339delAGCCTCTGG	c.(1330-1341)gagcctctggcc>gcc	p.EPL444del	RP11-21B21.4_ENST00000563243.1_RNA	NM_153813.2	NP_722520.2	Q8IX07	FOG1_HUMAN	zinc finger protein, FOG family member 1	444				EPLA -> AP (in Ref. 1; AAN45858). {ECO:0000305}.	atrial septum morphogenesis (GO:0060413)|atrioventricular valve morphogenesis (GO:0003181)|blood coagulation (GO:0007596)|cardiac muscle tissue morphogenesis (GO:0055008)|definitive erythrocyte differentiation (GO:0060318)|embryonic hemopoiesis (GO:0035162)|erythrocyte differentiation (GO:0030218)|granulocyte differentiation (GO:0030851)|megakaryocyte development (GO:0035855)|megakaryocyte differentiation (GO:0030219)|mitral valve formation (GO:0003192)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of interleukin-4 biosynthetic process (GO:0045403)|negative regulation of mast cell differentiation (GO:0060377)|negative regulation of protein binding (GO:0032091)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|outflow tract morphogenesis (GO:0003151)|platelet formation (GO:0030220)|positive regulation of interferon-gamma biosynthetic process (GO:0045078)|primitive erythrocyte differentiation (GO:0060319)|regulation of chemokine production (GO:0032642)|regulation of definitive erythrocyte differentiation (GO:0010724)|T-helper cell lineage commitment (GO:0002295)|transcriptional activation by promoter-enhancer looping (GO:0071733)|tricuspid valve formation (GO:0003195)|ventricular septum morphogenesis (GO:0060412)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|transcription factor complex (GO:0005667)|transcriptional repressor complex (GO:0017053)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II transcription factor binding (GO:0001085)|transcription factor binding (GO:0008134)			central_nervous_system(1)|ovary(2)|urinary_tract(1)	4				BRCA - Breast invasive adenocarcinoma(80;0.0478)		GCCAGAGCGGAGCCTCTGGCCCAGAATGG	0.746																																					p.444_447del	Pancreas(49;850 1106 29641 32847 38344)	.											.	ZFPM1-90	0			c.1331_1339del						.																																			SO:0001651	inframe_deletion	161882	exon10			GAGCGGAGCCTCT	AF488691	CCDS32502.1	16q24.2	2013-01-10	2012-11-27		ENSG00000179588	ENSG00000179588		"""Zinc fingers, C2H2-type"", ""Zinc fingers, C2HC-type containing"""	19762	protein-coding gene	gene with protein product		601950	"""zinc finger protein, multitype 1"""				Standard	NM_153813		Approved	FOG1, FOG, ZNF89A, ZC2HC11A	uc002fkv.3	Q8IX07	OTTHUMG00000173152	ENST00000319555.3:c.1331_1339delAGCCTCTGG	16.37:g.88599697_88599705delAGCCTCTGG	ENSP00000326630:p.Glu444_Leu446del	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	20	0	NM_153813	0	0	0	0	0		In_Frame_Del	DEL	ENST00000319555.3	37	CCDS32502.1																																																																																			.		0.746	ZFPM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000422270.2		
ZFPM1	161882	hgsc.bcm.edu	37	16	88599701	88599701	+	Frame_Shift_Del	DEL	T	T	-	rs67322929|rs149145771	byFrequency	TCGA-PK-A5HA-01A-11D-A29I-10	TCGA-PK-A5HA-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2bd7613-8a82-453c-b1d0-f0ad6fbc0766	688c5eb5-c374-4bfb-81d1-c0ba622386cf	g.chr16:88599701delT	ENST00000319555.3	+	10	1657	c.1335delT	c.(1333-1335)cctfs	p.P445fs	RP11-21B21.4_ENST00000563243.1_RNA	NM_153813.2	NP_722520.2	Q8IX07	FOG1_HUMAN	zinc finger protein, FOG family member 1	445				EPLA -> AP (in Ref. 1; AAN45858). {ECO:0000305}.	atrial septum morphogenesis (GO:0060413)|atrioventricular valve morphogenesis (GO:0003181)|blood coagulation (GO:0007596)|cardiac muscle tissue morphogenesis (GO:0055008)|definitive erythrocyte differentiation (GO:0060318)|embryonic hemopoiesis (GO:0035162)|erythrocyte differentiation (GO:0030218)|granulocyte differentiation (GO:0030851)|megakaryocyte development (GO:0035855)|megakaryocyte differentiation (GO:0030219)|mitral valve formation (GO:0003192)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of interleukin-4 biosynthetic process (GO:0045403)|negative regulation of mast cell differentiation (GO:0060377)|negative regulation of protein binding (GO:0032091)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|outflow tract morphogenesis (GO:0003151)|platelet formation (GO:0030220)|positive regulation of interferon-gamma biosynthetic process (GO:0045078)|primitive erythrocyte differentiation (GO:0060319)|regulation of chemokine production (GO:0032642)|regulation of definitive erythrocyte differentiation (GO:0010724)|T-helper cell lineage commitment (GO:0002295)|transcriptional activation by promoter-enhancer looping (GO:0071733)|tricuspid valve formation (GO:0003195)|ventricular septum morphogenesis (GO:0060412)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|transcription factor complex (GO:0005667)|transcriptional repressor complex (GO:0017053)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II transcription factor binding (GO:0001085)|transcription factor binding (GO:0008134)			central_nervous_system(1)|ovary(2)|urinary_tract(1)	4				BRCA - Breast invasive adenocarcinoma(80;0.0478)		GAGCGGAGCCTCTGGCCCAGA	0.746													-|T|-|insertion	4871	0.972644	0.9145	0.9899	5008	,	,		7405	0.995		0.994	False		,,,				2504	0.9939				p.P445fs	Pancreas(49;850 1106 29641 32847 38344)	.											.	ZFPM1-90	0			c.1335delT						.						1.0	1.0	1.0					16																	88599701		392	657	1049	SO:0001589	frameshift_variant	161882	exon10			GGAGCCTCTGGCC	AF488691	CCDS32502.1	16q24.2	2013-01-10	2012-11-27		ENSG00000179588	ENSG00000179588		"""Zinc fingers, C2H2-type"", ""Zinc fingers, C2HC-type containing"""	19762	protein-coding gene	gene with protein product		601950	"""zinc finger protein, multitype 1"""				Standard	NM_153813		Approved	FOG1, FOG, ZNF89A, ZC2HC11A	uc002fkv.3	Q8IX07	OTTHUMG00000173152	ENST00000319555.3:c.1335delT	16.37:g.88599701delT	ENSP00000326630:p.Pro445fs	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	17	13	NM_153813	0	0	0	0	0		Frame_Shift_Del	DEL	ENST00000319555.3	37	CCDS32502.1																																																																																			.		0.746	ZFPM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000422270.2		
ZFPM1	161882	hgsc.bcm.edu	37	16	88599703	88599705	+	In_Frame_Del	DEL	TGG	TGG	-	rs149145771|rs67873604	byFrequency	TCGA-PK-A5HA-01A-11D-A29I-10	TCGA-PK-A5HA-10A-01D-A29L-10	TGG	TGG	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2bd7613-8a82-453c-b1d0-f0ad6fbc0766	688c5eb5-c374-4bfb-81d1-c0ba622386cf	g.chr16:88599703_88599705delTGG	ENST00000319555.3	+	10	1659_1661	c.1337_1339delTGG	c.(1336-1341)ctggcc>ccc	p.446_447LA>P	RP11-21B21.4_ENST00000563243.1_RNA	NM_153813.2	NP_722520.2	Q8IX07	FOG1_HUMAN	zinc finger protein, FOG family member 1	446				EPLA -> AP (in Ref. 1; AAN45858). {ECO:0000305}.	atrial septum morphogenesis (GO:0060413)|atrioventricular valve morphogenesis (GO:0003181)|blood coagulation (GO:0007596)|cardiac muscle tissue morphogenesis (GO:0055008)|definitive erythrocyte differentiation (GO:0060318)|embryonic hemopoiesis (GO:0035162)|erythrocyte differentiation (GO:0030218)|granulocyte differentiation (GO:0030851)|megakaryocyte development (GO:0035855)|megakaryocyte differentiation (GO:0030219)|mitral valve formation (GO:0003192)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of interleukin-4 biosynthetic process (GO:0045403)|negative regulation of mast cell differentiation (GO:0060377)|negative regulation of protein binding (GO:0032091)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|outflow tract morphogenesis (GO:0003151)|platelet formation (GO:0030220)|positive regulation of interferon-gamma biosynthetic process (GO:0045078)|primitive erythrocyte differentiation (GO:0060319)|regulation of chemokine production (GO:0032642)|regulation of definitive erythrocyte differentiation (GO:0010724)|T-helper cell lineage commitment (GO:0002295)|transcriptional activation by promoter-enhancer looping (GO:0071733)|tricuspid valve formation (GO:0003195)|ventricular septum morphogenesis (GO:0060412)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|transcription factor complex (GO:0005667)|transcriptional repressor complex (GO:0017053)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II transcription factor binding (GO:0001085)|transcription factor binding (GO:0008134)			central_nervous_system(1)|ovary(2)|urinary_tract(1)	4				BRCA - Breast invasive adenocarcinoma(80;0.0478)		GCGGAGCCTCTGGCCCAGAATGG	0.739														4871	0.972644	0.9145	0.9899	5008	,	,		7191	0.995		0.994	False		,,,				2504	0.9939				p.446_447del	Pancreas(49;850 1106 29641 32847 38344)	.											.	ZFPM1-90	0			c.1337_1339del						.																																			SO:0001651	inframe_deletion	161882	exon10			AGCCTCTGGCCCA	AF488691	CCDS32502.1	16q24.2	2013-01-10	2012-11-27		ENSG00000179588	ENSG00000179588		"""Zinc fingers, C2H2-type"", ""Zinc fingers, C2HC-type containing"""	19762	protein-coding gene	gene with protein product		601950	"""zinc finger protein, multitype 1"""				Standard	NM_153813		Approved	FOG1, FOG, ZNF89A, ZC2HC11A	uc002fkv.3	Q8IX07	OTTHUMG00000173152	ENST00000319555.3:c.1337_1339delTGG	16.37:g.88599703_88599705delTGG	ENSP00000326630:p.Leu446_Ala447delinsPro	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	16	13	NM_153813	0	0	0	0	0		In_Frame_Del	DEL	ENST00000319555.3	37	CCDS32502.1																																																																																			.		0.739	ZFPM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000422270.2		
IGFBP4	3487	hgsc.bcm.edu	37	17	38600092	38600092	+	Silent	SNP	G	G	A	rs598892	byFrequency	TCGA-PK-A5HA-01A-11D-A29I-10	TCGA-PK-A5HA-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2bd7613-8a82-453c-b1d0-f0ad6fbc0766	688c5eb5-c374-4bfb-81d1-c0ba622386cf	g.chr17:38600092G>A	ENST00000269593.4	+	1	380	c.105G>A	c.(103-105)ctG>ctA	p.L35L	IGFBP4_ENST00000542955.1_Intron	NM_001552.2	NP_001543.2	P22692	IBP4_HUMAN	insulin-like growth factor binding protein 4	35	IGFBP N-terminal. {ECO:0000255|PROSITE- ProRule:PRU00653}.				cell proliferation (GO:0008283)|cellular protein metabolic process (GO:0044267)|DNA metabolic process (GO:0006259)|inflammatory response (GO:0006954)|positive regulation of insulin-like growth factor receptor signaling pathway (GO:0043568)|positive regulation of MAPK cascade (GO:0043410)|regulation of cell growth (GO:0001558)|regulation of glucose metabolic process (GO:0010906)|signal transduction (GO:0007165)|skeletal system development (GO:0001501)|type B pancreatic cell proliferation (GO:0044342)	extracellular region (GO:0005576)|extracellular space (GO:0005615)				NS(1)|endometrium(1)|kidney(1)|large_intestine(2)	5		Breast(137;0.000496)	STAD - Stomach adenocarcinoma(5;5.91e-05)			AGGAGAAGCTGGCGCGCTGCC	0.771													G|||	1792	0.357827	0.0386	0.5	5008	,	,		9796	0.4752		0.3946	False		,,,				2504	0.5297				p.L35L	GBM(160;940 3581 26177)	.											.	IGFBP4-522	0			c.G105A						.	G		266,3270		24,218,1526	3.0	3.0	3.0		105	4.0	1.0	17	dbSNP_83	3	2267,4893		352,1563,1665	no	coding-synonymous	IGFBP4	NM_001552.2		376,1781,3191	AA,AG,GG		31.662,7.5226,23.6818		35/259	38600092	2533,8163	1768	3580	5348	SO:0001819	synonymous_variant	3487	exon1			GAAGCTGGCGCGC	M38177	CCDS11367.1	17q21.2	2014-09-16	2001-11-28		ENSG00000141753	ENSG00000141753			5473	protein-coding gene	gene with protein product	"""IGF-binding protein 4"""	146733	"""insulin-like growth factor-binding protein 4"""			1707125, 1704481	Standard	NM_001552		Approved	IBP4, BP-4, HT29-IGFBP, IGFBP-4	uc002hus.3	P22692	OTTHUMG00000133326	ENST00000269593.4:c.105G>A	17.37:g.38600092G>A		Somatic	1	0		WXS	Illumina GAIIx	Phase_I	13	12	NM_001552	0	0	15	28	13	A0N9W2|B4E351|Q5U012|Q9UCL6	Silent	SNP	ENST00000269593.4	37	CCDS11367.1																																																																																			G|0.645;A|0.355		0.771	IGFBP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257134.1	NM_001552	
AOC3	8639	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	41008411	41008411	+	Silent	SNP	C	C	T			TCGA-PK-A5HA-01A-11D-A29I-10	TCGA-PK-A5HA-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2bd7613-8a82-453c-b1d0-f0ad6fbc0766	688c5eb5-c374-4bfb-81d1-c0ba622386cf	g.chr17:41008411C>T	ENST00000308423.2	+	4	2296	c.2136C>T	c.(2134-2136)gaC>gaT	p.D712D	AOC3_ENST00000591562.1_Silent_p.D169D	NM_003734.2	NP_003725.1	Q16853	AOC3_HUMAN	amine oxidase, copper containing 3	712					amine metabolic process (GO:0009308)|cation transmembrane transport (GO:0098655)|cation transport (GO:0006812)|cell adhesion (GO:0007155)|inflammatory response (GO:0006954)|response to antibiotic (GO:0046677)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|microvillus (GO:0005902)|plasma membrane (GO:0005886)	aliphatic-amine oxidase activity (GO:0052595)|aminoacetone:oxygen oxidoreductase(deaminating) activity (GO:0052594)|calcium ion binding (GO:0005509)|cation channel activity (GO:0005261)|copper ion binding (GO:0005507)|phenethylamine:oxygen oxidoreductase (deaminating) activity (GO:0052596)|primary amine oxidase activity (GO:0008131)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|quinone binding (GO:0048038)|tryptamine:oxygen oxidoreductase (deaminating) activity (GO:0052593)			breast(1)|central_nervous_system(4)|endometrium(4)|kidney(1)|large_intestine(8)|lung(14)|ovary(1)|skin(8)	41		Breast(137;0.000143)		BRCA - Breast invasive adenocarcinoma(366;0.156)	Hydralazine(DB01275)|Phenelzine(DB00780)	ACTTCTTTGACGAAGACCCCT	0.577																																					p.D712D	NSCLC(3;192 220 10664 11501 16477)	.											.	AOC3-516	0			c.C2136T						.						69.0	67.0	68.0					17																	41008411		2203	4300	6503	SO:0001819	synonymous_variant	8639	exon4			CTTTGACGAAGAC	AF067406	CCDS11444.1, CCDS62198.1, CCDS74071.1	17q21	2013-05-08	2013-05-08			ENSG00000131471	1.4.3.21		550	protein-coding gene	gene with protein product	"""vascular adhesion protein 1"""	603735				9653080, 8972912	Standard	NM_003734		Approved	VAP1, HPAO, VAP-1	uc002ibv.4	Q16853		ENST00000308423.2:c.2136C>T	17.37:g.41008411C>T		Somatic	203	0		WXS	Illumina GAIIx	Phase_I	108	80	NM_003734	0	0	14	14	0	B2RCI5|K7ESB3|L0L8N9|Q45F94	Silent	SNP	ENST00000308423.2	37	CCDS11444.1																																																																																			.		0.577	AOC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452444.1	NM_003734	
CDC27	996	bcgsc.ca	37	17	45234303	45234303	+	Missense_Mutation	SNP	G	G	C	rs200611688		TCGA-PK-A5HA-01A-11D-A29I-10	TCGA-PK-A5HA-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2bd7613-8a82-453c-b1d0-f0ad6fbc0766	688c5eb5-c374-4bfb-81d1-c0ba622386cf	g.chr17:45234303G>C	ENST00000066544.3	-	7	911	c.818C>G	c.(817-819)gCa>gGa	p.A273G	CDC27_ENST00000527547.1_Missense_Mutation_p.A273G|CDC27_ENST00000446365.2_Missense_Mutation_p.A212G|CDC27_ENST00000528748.1_5'Flank|CDC27_ENST00000531206.1_Missense_Mutation_p.A273G	NM_001114091.1|NM_001256.3	NP_001107563.1|NP_001247.3	P30260	CDC27_HUMAN	cell division cycle 27	273					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|cell proliferation (GO:0008283)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|mitotic cell cycle (GO:0000278)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein K11-linked ubiquitination (GO:0070979)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)	anaphase-promoting complex (GO:0005680)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle (GO:0005819)	protein phosphatase binding (GO:0019903)			NS(1)|breast(5)|central_nervous_system(3)|cervix(1)|endometrium(2)|kidney(17)|large_intestine(18)|lung(11)|ovary(5)|pancreas(1)|prostate(19)|skin(5)|upper_aerodigestive_tract(2)	90						ACTAAGAGCTGCTGGTCCTCC	0.358																																					p.A273G		.											.	CDC27-291	0			c.C818G						.						62.0	66.0	65.0					17																	45234303		2201	4293	6494	SO:0001583	missense	996	exon7			AGAGCTGCTGGTC	U00001	CCDS11509.1, CCDS45720.1, CCDS74090.1	17q21.32	2013-01-17	2013-01-17		ENSG00000004897	ENSG00000004897		"""Anaphase promoting complex subunits"", ""Tetratricopeptide (TTC) repeat domain containing"""	1728	protein-coding gene	gene with protein product	"""anaphase promoting complex subunit 3"""	116946	"""cell division cycle 27"", ""cell division cycle 27 homolog (S. cerevisiae)"""	D0S1430E, D17S978E		8234252	Standard	XM_005257892		Approved	APC3, ANAPC3, NUC2	uc002ile.4	P30260	OTTHUMG00000166429	ENST00000066544.3:c.818C>G	17.37:g.45234303G>C	ENSP00000066544:p.Ala273Gly	Somatic	43	0		WXS	Illumina GAIIx	Phase_I	22	7	NM_001114091	0	0	4	4	0	G3V1C4|Q16349|Q96F35	Missense_Mutation	SNP	ENST00000066544.3	37	CCDS11509.1	.	.	.	.	.	.	.	.	.	.	G	15.95	2.983381	0.53827	.	.	ENSG00000004897	ENST00000066544;ENST00000531206;ENST00000446365;ENST00000527547;ENST00000526866	T;T;T;T;T	0.69175	-0.37;-0.38;-0.11;-0.36;0.76	5.64	5.64	0.86602	.	0.116892	0.56097	D	0.000021	T	0.54647	0.1871	L	0.29908	0.895	0.51233	D	0.999911	B;P;P;B	0.43094	0.304;0.629;0.799;0.304	B;B;B;B	0.36092	0.15;0.213;0.217;0.046	T	0.57911	-0.7729	10	0.40728	T	0.16	-26.4879	17.2083	0.86924	0.0:0.0:1.0:0.0	.	212;273;273;273	B4DL80;G5EA36;G3V1C4;P30260	.;.;.;CDC27_HUMAN	G	273;273;212;273;273	ENSP00000066544:A273G;ENSP00000434614:A273G;ENSP00000392802:A212G;ENSP00000437339:A273G;ENSP00000432105:A273G	ENSP00000066544:A273G	A	-	2	0	CDC27	42589302	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	9.260000	0.95568	2.665000	0.90641	0.460000	0.39030	GCA	.		0.358	CDC27-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000389742.2		
AATK	9625	broad.mit.edu	37	17	79094110	79094110	+	Missense_Mutation	SNP	C	C	A			TCGA-PK-A5HA-01A-11D-A29I-10	TCGA-PK-A5HA-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2bd7613-8a82-453c-b1d0-f0ad6fbc0766	688c5eb5-c374-4bfb-81d1-c0ba622386cf	g.chr17:79094110C>A	ENST00000326724.4	-	11	3650	c.3626G>T	c.(3625-3627)aGc>aTc	p.S1209I	AATK_ENST00000417379.1_Missense_Mutation_p.S1106I	NM_001080395.2	NP_001073864.2	Q6ZMQ8	LMTK1_HUMAN	apoptosis-associated tyrosine kinase	1209					brain development (GO:0007420)|negative regulation of axon extension (GO:0030517)|neuron apoptotic process (GO:0051402)|peptidyl-tyrosine autophosphorylation (GO:0038083)|Rab protein signal transduction (GO:0032482)	axonal growth cone (GO:0044295)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|perinuclear region of cytoplasm (GO:0048471)|recycling endosome (GO:0055037)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)|protein tyrosine kinase activity (GO:0004713)			endometrium(2)|kidney(2)|lung(8)|ovary(3)|prostate(1)|stomach(4)|upper_aerodigestive_tract(1)	21	all_neural(118;0.101)		BRCA - Breast invasive adenocarcinoma(99;0.0228)|OV - Ovarian serous cystadenocarcinoma(97;0.0524)			CTTGAGCAGGCTGCGCAGGTT	0.657																																					p.S1209I		.											.	AATK-933	0			c.G3626T						.						25.0	30.0	29.0					17																	79094110		2167	4254	6421	SO:0001583	missense	9625	exon11			AGCAGGCTGCGCA	AB014541	CCDS45807.1, CCDS58607.1	17q25.3	2014-06-12			ENSG00000181409	ENSG00000181409			21	protein-coding gene	gene with protein product	"""lemur tyrosine kinase 1"", ""protein phosphatase 1, regulatory subunit 77"""	605276				9734811, 10083745	Standard	NM_001080395		Approved	AATYK, KIAA0641, LMTK1, LMR1, AATYK1, PPP1R77	uc010dia.3	Q6ZMQ8	OTTHUMG00000132717	ENST00000326724.4:c.3626G>T	17.37:g.79094110C>A	ENSP00000324196:p.Ser1209Ile	Somatic	68	2		WXS	Illumina GAIIx	Phase_I	179	8	NM_001080395	0	0	6	6	0	O75136|Q6ZN31|Q86X28	Missense_Mutation	SNP	ENST00000326724.4	37	CCDS45807.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	26.2|26.2	4.717764|4.717764	0.89205|0.89205	.|.	.|.	ENSG00000181409|ENSG00000181409	ENST00000417379|ENST00000326724	.|T	.|0.11385	.|2.78	3.98|3.98	3.98|3.98	0.46160|0.46160	.|.	.|0.049240	.|0.85682	.|D	.|0.000000	T|T	0.35189|0.35189	0.0923|0.0923	M|M	0.82716|0.82716	2.605|2.605	0.40672|0.40672	D|D	0.982222|0.982222	.|D	.|0.89917	.|1.0	.|D	.|0.69307	.|0.963	T|T	0.44314|0.44314	-0.9336|-0.9336	5|10	.|0.87932	.|D	.|0	.|.	15.8191|15.8191	0.78626|0.78626	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|1209	.|Q6ZMQ8	.|LMTK1_HUMAN	S|I	1162|1209	.|ENSP00000324196:S1209I	.|ENSP00000324196:S1209I	A|S	-|-	1|2	0|0	AATK|AATK	76708705|76708705	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.982000|0.982000	0.71751|0.71751	4.399000|4.399000	0.59703|0.59703	2.042000|2.042000	0.60477|0.60477	0.313000|0.313000	0.20887|0.20887	GCC|AGC	.		0.657	AATK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256055.1	NM_004920	
AATK	9625	hgsc.bcm.edu	37	17	79096115	79096115	+	Missense_Mutation	SNP	C	C	T	rs61738821	byFrequency	TCGA-PK-A5HA-01A-11D-A29I-10	TCGA-PK-A5HA-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2bd7613-8a82-453c-b1d0-f0ad6fbc0766	688c5eb5-c374-4bfb-81d1-c0ba622386cf	g.chr17:79096115C>T	ENST00000326724.4	-	11	1645	c.1621G>A	c.(1621-1623)Gcc>Acc	p.A541T	AATK_ENST00000572339.1_5'Flank|MIR657_ENST00000385003.1_RNA|AATK_ENST00000417379.1_Missense_Mutation_p.A438T	NM_001080395.2	NP_001073864.2	Q6ZMQ8	LMTK1_HUMAN	apoptosis-associated tyrosine kinase	541				A -> T (in Ref. 1; BAD18544). {ECO:0000305}.	brain development (GO:0007420)|negative regulation of axon extension (GO:0030517)|neuron apoptotic process (GO:0051402)|peptidyl-tyrosine autophosphorylation (GO:0038083)|Rab protein signal transduction (GO:0032482)	axonal growth cone (GO:0044295)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|perinuclear region of cytoplasm (GO:0048471)|recycling endosome (GO:0055037)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)|protein tyrosine kinase activity (GO:0004713)			endometrium(2)|kidney(2)|lung(8)|ovary(3)|prostate(1)|stomach(4)|upper_aerodigestive_tract(1)	21	all_neural(118;0.101)		BRCA - Breast invasive adenocarcinoma(99;0.0228)|OV - Ovarian serous cystadenocarcinoma(97;0.0524)			TCGTGGCCGGCGGCGGGTGCG	0.756													C|||	710	0.141773	0.2451	0.0836	5008	,	,		7975	0.0337		0.1342	False		,,,				2504	0.1626				p.A541T		.											.	AATK-933	0			c.G1621A						.						2.0	2.0	2.0					17																	79096115		1391	2783	4174	SO:0001583	missense	9625	exon11			GGCCGGCGGCGGG	AB014541	CCDS45807.1, CCDS58607.1	17q25.3	2014-06-12			ENSG00000181409	ENSG00000181409			21	protein-coding gene	gene with protein product	"""lemur tyrosine kinase 1"", ""protein phosphatase 1, regulatory subunit 77"""	605276				9734811, 10083745	Standard	NM_001080395		Approved	AATYK, KIAA0641, LMTK1, LMR1, AATYK1, PPP1R77	uc010dia.3	Q6ZMQ8	OTTHUMG00000132717	ENST00000326724.4:c.1621G>A	17.37:g.79096115C>T	ENSP00000324196:p.Ala541Thr	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	9	7	NM_001080395	0	0	0	0	0	O75136|Q6ZN31|Q86X28	Missense_Mutation	SNP	ENST00000326724.4	37	CCDS45807.1	322	0.14743589743589744	149	0.30284552845528456	49	0.13535911602209943	11	0.019230769230769232	113	0.14907651715039577	C	10.34	1.324257	0.24080	.	.	ENSG00000181409	ENST00000326724;ENST00000374792	T;T	0.77489	-1.1;-1.09	4.26	3.26	0.37387	.	0.388682	0.24547	N	0.037589	T	0.00012	0.0000	L	0.48642	1.525	0.80722	P	0.0	P	0.45986	0.87	B	0.27608	0.081	T	0.05716	-1.0868	9	0.29301	T	0.29	.	11.2582	0.49067	0.1833:0.8167:0.0:0.0	rs61738821	541	Q6ZMQ8	LMTK1_HUMAN	T	541;505	ENSP00000324196:A541T;ENSP00000363924:A505T	ENSP00000324196:A541T	A	-	1	0	AATK	76710710	0.009000	0.17119	0.030000	0.17652	0.032000	0.12392	0.876000	0.28092	0.731000	0.32448	0.561000	0.74099	GCC	C|0.850;T|0.150		0.756	AATK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256055.1	NM_004920	
EPB41L3	23136	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	18	5397119	5397119	+	Missense_Mutation	SNP	G	G	T			TCGA-PK-A5HA-01A-11D-A29I-10	TCGA-PK-A5HA-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2bd7613-8a82-453c-b1d0-f0ad6fbc0766	688c5eb5-c374-4bfb-81d1-c0ba622386cf	g.chr18:5397119G>T	ENST00000341928.2	-	18	3119	c.2779C>A	c.(2779-2781)Caa>Aaa	p.Q927K	EPB41L3_ENST00000427684.2_Missense_Mutation_p.Q224K|EPB41L3_ENST00000400111.3_Missense_Mutation_p.Q705K|EPB41L3_ENST00000342933.3_Missense_Mutation_p.Q927K|EPB41L3_ENST00000540638.2_Missense_Mutation_p.Q705K|EPB41L3_ENST00000544123.1_Missense_Mutation_p.Q758K|EPB41L3_ENST00000542146.1_Missense_Mutation_p.Q232K|EPB41L3_ENST00000542652.2_5'UTR	NM_012307.2	NP_036439.2	Q9Y2J2	E41L3_HUMAN	erythrocyte membrane protein band 4.1-like 3	927	C-terminal (CTD).				apoptotic process (GO:0006915)|cortical actin cytoskeleton organization (GO:0030866)|cortical cytoskeleton organization (GO:0030865)|cytoskeletal anchoring at plasma membrane (GO:0007016)|myelin maintenance (GO:0043217)|neuron projection morphogenesis (GO:0048812)|paranodal junction assembly (GO:0030913)|protein localization to juxtaparanode region of axon (GO:0071205)|protein localization to paranode region of axon (GO:0002175)|protein localization to plasma membrane (GO:0072659)|regulation of cell shape (GO:0008360)	axolemma (GO:0030673)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extrinsic component of membrane (GO:0019898)|juxtaparanode region of axon (GO:0044224)|paranode region of axon (GO:0033270)|plasma membrane (GO:0005886)	structural constituent of cytoskeleton (GO:0005200)			breast(1)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(24)|lung(52)|ovary(5)|prostate(4)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	105						TGCTCCTCTTGTCGCTCACGG	0.483																																					p.Q927K		.											.	EPB41L3-95	0			c.C2779A						.						92.0	80.0	84.0					18																	5397119		2203	4300	6503	SO:0001583	missense	23136	exon18			CCTCTTGTCGCTC	AB023204	CCDS11838.1, CCDS62381.1, CCDS62382.1	18p11.32	2006-06-28			ENSG00000082397	ENSG00000082397			3380	protein-coding gene	gene with protein product		605331				9828140, 9892180	Standard	NM_012307		Approved	DAL1, KIAA0987, 4.1B	uc002kmt.1	Q9Y2J2	OTTHUMG00000131562	ENST00000341928.2:c.2779C>A	18.37:g.5397119G>T	ENSP00000343158:p.Gln927Lys	Somatic	53	0		WXS	Illumina GAIIx	Phase_I	29	21	NM_012307	0	0	6	22	16	B7Z4I5|F5GX05|O95713|Q9BRP5	Missense_Mutation	SNP	ENST00000341928.2	37	CCDS11838.1	.	.	.	.	.	.	.	.	.	.	G	1.531	-0.544303	0.04024	.	.	ENSG00000082397	ENST00000341928;ENST00000540638;ENST00000544123;ENST00000545076;ENST00000427684;ENST00000542146;ENST00000342933;ENST00000400111	T;T;T;T;T;T	0.42900	0.96;0.96;0.96;0.96;0.96;0.96	5.72	1.94	0.25998	.	0.567997	0.19533	N	0.111982	T	0.25005	0.0607	N	0.14661	0.345	0.09310	N	1	B;B;B;B;B;B;B;B	0.30511	0.019;0.282;0.2;0.002;0.0;0.002;0.002;0.001	B;B;B;B;B;B;B;B	0.37731	0.021;0.257;0.117;0.007;0.0;0.026;0.012;0.002	T	0.32161	-0.9917	10	0.11182	T	0.66	.	8.3505	0.32299	0.0:0.5924:0.2701:0.1374	.	758;224;232;319;596;705;927;162	F5GX05;E7EUF8;F5H7W5;B7Z8M8;A8K968;Q9Y2J2-2;Q9Y2J2;B3KT50	.;.;.;.;.;.;E41L3_HUMAN;.	K	927;596;758;596;224;232;927;705	ENSP00000343158:Q927K;ENSP00000441174:Q758K;ENSP00000392195:Q224K;ENSP00000442233:Q232K;ENSP00000341138:Q927K;ENSP00000382981:Q705K	ENSP00000343158:Q927K	Q	-	1	0	EPB41L3	5387119	0.335000	0.24748	0.043000	0.18650	0.011000	0.07611	1.237000	0.32695	0.073000	0.16731	0.591000	0.81541	CAA	.		0.483	EPB41L3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000254424.1	NM_012307	
PTPRM	5797	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	18	8069961	8069961	+	Silent	SNP	C	C	T			TCGA-PK-A5HA-01A-11D-A29I-10	TCGA-PK-A5HA-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2bd7613-8a82-453c-b1d0-f0ad6fbc0766	688c5eb5-c374-4bfb-81d1-c0ba622386cf	g.chr18:8069961C>T	ENST00000332175.8	+	8	2447	c.1410C>T	c.(1408-1410)agC>agT	p.S470S	PTPRM_ENST00000400053.4_Silent_p.S408S|PTPRM_ENST00000444013.1_Silent_p.S257S|PTPRM_ENST00000400060.4_Silent_p.S470S|PTPRM_ENST00000578571.1_3'UTR|PTPRM_ENST00000580170.1_Silent_p.S470S	NM_002845.3	NP_002836.3	P28827	PTPRM_HUMAN	protein tyrosine phosphatase, receptor type, M	470	Fibronectin type-III 2. {ECO:0000255|PROSITE-ProRule:PRU00316}.				homophilic cell adhesion (GO:0007156)|negative regulation of angiogenesis (GO:0016525)|negative regulation of endothelial cell migration (GO:0010596)|negative regulation of endothelial cell proliferation (GO:0001937)|neuron projection development (GO:0031175)|peptidyl-tyrosine dephosphorylation (GO:0035335)|positive regulation of vasodilation (GO:0045909)|protein dephosphorylation (GO:0006470)|response to drug (GO:0042493)|retina layer formation (GO:0010842)|retinal ganglion cell axon guidance (GO:0031290)|signal transduction (GO:0007165)	cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|lamellipodium (GO:0030027)|perinuclear region of cytoplasm (GO:0048471)	cadherin binding (GO:0045296)|identical protein binding (GO:0042802)|protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			breast(3)|central_nervous_system(1)|cervix(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(32)|lung(25)|ovary(2)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	90		Colorectal(10;0.234)				GGAAGGAAAGCCAAGAACTCA	0.423																																					p.S470S		.											.	PTPRM-228	0			c.C1410T						.						94.0	75.0	81.0					18																	8069961		2203	4300	6503	SO:0001819	synonymous_variant	5797	exon8			GGAAAGCCAAGAA	X58288	CCDS11840.1, CCDS58613.1	18p11.2	2013-02-11			ENSG00000173482	ENSG00000173482		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	9675	protein-coding gene	gene with protein product		176888		PTPRL1		1655529, 8404049	Standard	NM_002845		Approved	RPTPU, hR-PTPu	uc010dkv.3	P28827	OTTHUMG00000131575	ENST00000332175.8:c.1410C>T	18.37:g.8069961C>T		Somatic	146	0		WXS	Illumina GAIIx	Phase_I	91	7	NM_001105244	0	0	18	19	1	A7MBN1|D3DUH8|J3QL11	Silent	SNP	ENST00000332175.8	37	CCDS11840.1																																																																																			.		0.423	PTPRM-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000254456.1		
MPPE1	65258	broad.mit.edu	37	18	11885772	11885772	+	Missense_Mutation	SNP	G	G	T	rs73945269	byFrequency	TCGA-PK-A5HA-01A-11D-A29I-10	TCGA-PK-A5HA-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2bd7613-8a82-453c-b1d0-f0ad6fbc0766	688c5eb5-c374-4bfb-81d1-c0ba622386cf	g.chr18:11885772G>T	ENST00000588072.1	-	10	2132	c.911C>A	c.(910-912)aCg>aAg	p.T304K	MPPE1_ENST00000344987.7_Missense_Mutation_p.T282K|MPPE1_ENST00000399978.2_Missense_Mutation_p.T305K|MPPE1_ENST00000309976.9_Missense_Mutation_p.T241K|MPPE1_ENST00000317235.7_Missense_Mutation_p.T241K|MPPE1_ENST00000592755.1_5'Flank	NM_023075.5	NP_075563.3	Q53F39	MPPE1_HUMAN	metallophosphoesterase 1	304					ER to Golgi vesicle-mediated transport (GO:0006888)|GPI anchor biosynthetic process (GO:0006506)	cis-Golgi network (GO:0005801)|endoplasmic reticulum exit site (GO:0070971)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	GPI anchor binding (GO:0034235)|manganese ion binding (GO:0030145)|phosphoric diester hydrolase activity (GO:0008081)			endometrium(1)|large_intestine(1)|lung(1)|ovary(1)|skin(1)	5						GGCGCTGTGCGTGTGGCCACT	0.607																																					p.T304K		.											.	MPPE1-90	0			c.C911A						.						27.0	28.0	28.0					18																	11885772		2202	4297	6499	SO:0001583	missense	65258	exon10			CTGTGCGTGTGGC	BC002877	CCDS11853.1, CCDS56054.1	18p11.21	2004-04-30			ENSG00000154889	ENSG00000154889			15988	protein-coding gene	gene with protein product		611900				11978971	Standard	NM_001242904		Approved		uc002kqf.3	Q53F39	OTTHUMG00000131661	ENST00000588072.1:c.911C>A	18.37:g.11885772G>T	ENSP00000465894:p.Thr304Lys	Somatic	89	0		WXS	Illumina GAIIx	Phase_I	96	3	NM_023075	0	0	35	35	0	B0YJ39|B0YJ40|B0YJ41|B5ME53|B7WNJ3|D3DUI5|D3DUI7|Q6GMP1|Q8TAD6|Q8TE26|Q8WZ32|Q9BU58|Q9H958|Q9HAI4	Missense_Mutation	SNP	ENST00000588072.1	37	CCDS11853.1	.	.	.	.	.	.	.	.	.	.	G	27.2	4.806664	0.90623	.	.	ENSG00000154889	ENST00000317235;ENST00000309976;ENST00000317251;ENST00000344987;ENST00000399978	T;T;T	0.21361	2.01;2.01;2.01	5.64	5.64	0.86602	Calcineurin-like phosphoesterase superfamily domain (1);	0.000000	0.85682	D	0.000000	T	0.55130	0.1901	M	0.86651	2.83	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.91635	0.999;0.998;0.997;0.996	T	0.60037	-0.7341	10	0.59425	D	0.04	-26.5832	19.7167	0.96124	0.0:0.0:1.0:0.0	.	241;207;304;304	Q53F39-4;B3KNP1;Q53F39-2;Q53F39	.;.;.;MPPE1_HUMAN	K	241;304;207;305;305	ENSP00000327257:T241K;ENSP00000312935:T207K;ENSP00000382860:T305K	ENSP00000311200:T304K	T	-	2	0	MPPE1	11875772	1.000000	0.71417	1.000000	0.80357	0.507000	0.33981	9.206000	0.95056	2.667000	0.90743	0.655000	0.94253	ACG	G|0.996;A|0.004		0.607	MPPE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254562.2	NM_023075	
DSG1	1828	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	18	28934939	28934939	+	Missense_Mutation	SNP	T	T	A			TCGA-PK-A5HA-01A-11D-A29I-10	TCGA-PK-A5HA-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2bd7613-8a82-453c-b1d0-f0ad6fbc0766	688c5eb5-c374-4bfb-81d1-c0ba622386cf	g.chr18:28934939T>A	ENST00000257192.4	+	15	2992	c.2780T>A	c.(2779-2781)aTc>aAc	p.I927N	RP11-534N16.1_ENST00000578119.1_RNA|DSG1_ENST00000462981.2_Missense_Mutation_p.I286N|RP11-534N16.1_ENST00000578477.1_RNA|RP11-534N16.1_ENST00000581452.1_RNA|RP11-534N16.1_ENST00000581856.1_RNA	NM_001942.2	NP_001933.2	Q02413	DSG1_HUMAN	desmoglein 1	927					apoptotic process (GO:0006915)|calcium-dependent cell-cell adhesion (GO:0016339)|cell-cell junction assembly (GO:0007043)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|homophilic cell adhesion (GO:0007156)|maternal process involved in female pregnancy (GO:0060135)|protein stabilization (GO:0050821)|response to progesterone (GO:0032570)|single organismal cell-cell adhesion (GO:0016337)	apical plasma membrane (GO:0016324)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|desmosome (GO:0030057)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|lateral plasma membrane (GO:0016328)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|gamma-catenin binding (GO:0045295)|toxic substance binding (GO:0015643)			NS(2)|central_nervous_system(2)|endometrium(5)|kidney(7)|large_intestine(11)|lung(36)|ovary(3)|prostate(1)|skin(7)|stomach(1)|upper_aerodigestive_tract(1)	76			OV - Ovarian serous cystadenocarcinoma(10;0.00559)			GAAAGAGTAATCCAACCAACT	0.478																																					p.I927N		.											.	DSG1-519	0			c.T2780A						.						221.0	214.0	216.0					18																	28934939		2203	4300	6503	SO:0001583	missense	1828	exon15			GAGTAATCCAACC	X56654	CCDS11896.1	18q12.1	2014-05-13			ENSG00000134760	ENSG00000134760		"""Cadherins / Major cadherins"""	3048	protein-coding gene	gene with protein product		125670		DSG		1889810	Standard	NM_001942		Approved	CDHF4	uc002kwp.3	Q02413	OTTHUMG00000131983	ENST00000257192.4:c.2780T>A	18.37:g.28934939T>A	ENSP00000257192:p.Ile927Asn	Somatic	344	1		WXS	Illumina GAIIx	Phase_I	161	102	NM_001942	0	0	0	0	0	B7Z845	Missense_Mutation	SNP	ENST00000257192.4	37	CCDS11896.1	.	.	.	.	.	.	.	.	.	.	T	12.86	2.065208	0.36470	.	.	ENSG00000134760	ENST00000257192	D	0.82433	-1.61	6.17	6.17	0.99709	.	0.082390	0.52532	D	0.000073	D	0.91267	0.7247	M	0.83603	2.65	0.51233	D	0.999911	D	0.71674	0.998	D	0.64776	0.929	D	0.92283	0.5835	10	0.87932	D	0	.	16.8222	0.85835	0.0:0.0:0.0:1.0	.	927	Q02413	DSG1_HUMAN	N	927	ENSP00000257192:I927N	ENSP00000257192:I927N	I	+	2	0	DSG1	27188937	1.000000	0.71417	1.000000	0.80357	0.973000	0.67179	3.893000	0.56243	2.371000	0.80710	0.533000	0.62120	ATC	.		0.478	DSG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254947.1	NM_001942	
ASXL3	80816	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	18	31319098	31319098	+	Missense_Mutation	SNP	C	C	A	rs377377828		TCGA-PK-A5HA-01A-11D-A29I-10	TCGA-PK-A5HA-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2bd7613-8a82-453c-b1d0-f0ad6fbc0766	688c5eb5-c374-4bfb-81d1-c0ba622386cf	g.chr18:31319098C>A	ENST00000269197.5	+	11	1730	c.1730C>A	c.(1729-1731)tCt>tAt	p.S577Y		NM_030632.1	NP_085135.1	Q9C0F0	ASXL3_HUMAN	additional sex combs like transcriptional regulator 3	577					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(3)|endometrium(3)|kidney(3)|large_intestine(6)|lung(22)|ovary(2)|pancreas(1)|skin(2)|urinary_tract(1)	43						ACAGGGTCATCTTCTCTAGAA	0.423																																					p.S577Y		.											.	ASXL3-49	0			c.C1730A						.						56.0	55.0	55.0					18																	31319098		1875	4118	5993	SO:0001583	missense	80816	exon11			GGTCATCTTCTCT	AB051500	CCDS45847.1	18q11	2014-06-17	2014-06-17	2007-02-01		ENSG00000141431			29357	protein-coding gene	gene with protein product		615115	"""KIAA1713"", ""additional sex combs like 3 (Drosophila)"""	KIAA1713		11214970	Standard	NM_030632		Approved		uc010dmg.1	Q9C0F0		ENST00000269197.5:c.1730C>A	18.37:g.31319098C>A	ENSP00000269197:p.Ser577Tyr	Somatic	60	0		WXS	Illumina GAIIx	Phase_I	39	12	NM_030632	0	0	0	0	0	Q6ZMX6|Q96MU3|Q9UFC5	Missense_Mutation	SNP	ENST00000269197.5	37	CCDS45847.1	.	.	.	.	.	.	.	.	.	.	C	8.359	0.832644	0.16820	.	.	ENSG00000141431	ENST00000269197	T	0.15603	2.41	4.85	3.98	0.46160	.	0.912124	0.09438	N	0.802170	T	0.18425	0.0442	L	0.44542	1.39	0.24024	N	0.996132	B	0.29805	0.257	B	0.27500	0.08	T	0.20306	-1.0279	10	0.72032	D	0.01	.	13.0384	0.58885	0.0:0.9219:0.0:0.0781	.	577	Q9C0F0	ASXL3_HUMAN	Y	577	ENSP00000269197:S577Y	ENSP00000269197:S577Y	S	+	2	0	ASXL3	29573096	0.092000	0.21681	0.074000	0.20217	0.638000	0.38207	1.752000	0.38349	1.164000	0.42652	0.467000	0.42956	TCT	.		0.423	ASXL3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000441865.2		
TSHZ1	10194	bcgsc.ca	37	18	72998268	72998268	+	Silent	SNP	T	T	C	rs3744909	byFrequency	TCGA-PK-A5HA-01A-11D-A29I-10	TCGA-PK-A5HA-10A-01D-A29L-10	T	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2bd7613-8a82-453c-b1d0-f0ad6fbc0766	688c5eb5-c374-4bfb-81d1-c0ba622386cf	g.chr18:72998268T>C	ENST00000580243.1	+	2	1254	c.906T>C	c.(904-906)gaT>gaC	p.D302D	TSHZ1_ENST00000322038.5_Silent_p.D257D			Q6ZSZ6	TSH1_HUMAN	teashirt zinc finger homeobox 1	302					anterior/posterior pattern specification (GO:0009952)|middle ear morphogenesis (GO:0042474)|regulation of transcription, DNA-templated (GO:0006355)|soft palate development (GO:0060023)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(11)|liver(1)|lung(14)|ovary(1)|skin(6)|upper_aerodigestive_tract(2)	42		Esophageal squamous(42;0.129)|Prostate(75;0.142)|Melanoma(33;0.211)		Colorectal(1;0.000501)|READ - Rectum adenocarcinoma(2;0.00226)|BRCA - Breast invasive adenocarcinoma(31;0.246)		GGAAGGAGGATGCCCAGAAGG	0.552													C|||	1432	0.285942	0.1778	0.3732	5008	,	,		19407	0.1677		0.4085	False		,,,				2504	0.3661				p.D257D		.											.	TSHZ1-90	0			c.T771C						.	C		911,3495	738.6+/-411.0	95,721,1387	140.0	113.0	122.0		771	-2.9	1.0	18	dbSNP_107	122	3455,5145	636.2+/-399.1	696,2063,1541	no	coding-synonymous	TSHZ1	NM_005786.4		791,2784,2928	CC,CT,TT		40.1744,20.6764,33.5691		257/1033	72998268	4366,8640	2203	4300	6503	SO:0001819	synonymous_variant	10194	exon2			GGAGGATGCCCAG	AF039698	CCDS12009.1	18q22.3	2013-11-20	2007-07-16	2006-03-14	ENSG00000179981	ENSG00000179981		"""Teashirt zinc fingers"", ""Homeoboxes / ZF class"", ""Zinc fingers, C2H2-type"""	10669	protein-coding gene	gene with protein product		614427	"""serologically defined colon cancer antigen 33"", ""teashirt zinc finger 1"", ""teashirt family zinc finger 1"""	SDCCAG33		17586487	Standard	NM_005786		Approved	NY-CO-33, TSH1	uc002lly.4	Q6ZSZ6	OTTHUMG00000132859	ENST00000580243.1:c.906T>C	18.37:g.72998268T>C		Somatic	250	3		WXS	Illumina GAIIx	Phase_I	159	6	NM_005786	0	0	0	0	0	O60534|Q4LE29|Q53EU4	Silent	SNP	ENST00000580243.1	37																																																																																				T|0.676;C|0.324		0.552	TSHZ1-005	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000444913.1	NM_005786	
SALL3	27164	hgsc.bcm.edu	37	18	76752545	76752545	+	Missense_Mutation	SNP	C	C	T	rs191414199	byFrequency	TCGA-PK-A5HA-01A-11D-A29I-10	TCGA-PK-A5HA-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2bd7613-8a82-453c-b1d0-f0ad6fbc0766	688c5eb5-c374-4bfb-81d1-c0ba622386cf	g.chr18:76752545C>T	ENST00000537592.2	+	2	554	c.554C>T	c.(553-555)gCg>gTg	p.A185V	SALL3_ENST00000575389.2_Missense_Mutation_p.A185V|SALL3_ENST00000536229.3_Missense_Mutation_p.A52V	NM_171999.3	NP_741996.2	Q9BXA9	SALL3_HUMAN	spalt-like transcription factor 3	185					forelimb morphogenesis (GO:0035136)|hindlimb morphogenesis (GO:0035137)|negative regulation of smoothened signaling pathway (GO:0045879)|olfactory bulb interneuron development (GO:0021891)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(8)|lung(40)|ovary(4)|prostate(5)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	74		Esophageal squamous(42;0.129)|Melanoma(33;0.16)|Prostate(75;0.167)		OV - Ovarian serous cystadenocarcinoma(15;4.69e-06)|BRCA - Breast invasive adenocarcinoma(31;0.0256)		TCGCAGGGCGCGCGCGCGGCA	0.721													C|||	126	0.0251597	0.0015	0.0706	5008	,	,		3537	0.004		0.0527	False		,,,				2504	0.0184				p.A185V		.											.	SALL3-155	0			c.C554T						.	C	VAL/ALA	8,3578		0,8,1785	3.0	4.0	4.0		554	3.9	0.0	18		4	64,7050		1,62,3494	no	missense	SALL3	NM_171999.2	64	1,70,5279	TT,TC,CC		0.8996,0.2231,0.6729	benign	185/1301	76752545	72,10628	1793	3557	5350	SO:0001583	missense	27164	exon2			AGGGCGCGCGCGC	AJ007421	CCDS12013.1	18q23	2013-10-17	2013-10-17		ENSG00000256463	ENSG00000256463		"""Zinc fingers, C2H2-type"""	10527	protein-coding gene	gene with protein product		605079	"""sal (Drosophila)-like 3"", ""sal-like 3 (Drosophila)"""			10610715	Standard	NM_171999		Approved	ZNF796	uc002lmt.3	Q9BXA9	OTTHUMG00000132896	ENST00000537592.2:c.554C>T	18.37:g.76752545C>T	ENSP00000441823:p.Ala185Val	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	6	4	NM_171999	0	0	0	0	0	Q9UGH1	Missense_Mutation	SNP	ENST00000537592.2	37	CCDS12013.1	73	0.033424908424908424	2	0.0040650406504065045	22	0.06077348066298342	1	0.0017482517482517483	48	0.0633245382585752	C	5.481	0.273775	0.10403	0.002231	0.008996	ENSG00000256463	ENST00000537592;ENST00000536229	T	0.11930	2.73	3.89	3.89	0.44902	.	0.237510	0.28082	N	0.016672	T	0.01730	0.0055	M	0.65677	2.01	0.21220	N	0.999754	B	0.21452	0.056	B	0.08055	0.003	T	0.03555	-1.1025	10	0.35671	T	0.21	-16.504	16.066	0.80870	0.0:1.0:0.0:0.0	.	185	Q9BXA9	SALL3_HUMAN	V	185	ENSP00000441823:A185V	ENSP00000299466:A185V	A	+	2	0	SALL3	74853533	0.637000	0.27216	0.003000	0.11579	0.031000	0.12232	4.434000	0.59935	2.023000	0.59567	0.491000	0.48974	GCG	C|0.967;T|0.033		0.721	SALL3-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256397.1	NM_171999	
POLRMT	5442	broad.mit.edu	37	19	622193	622193	+	Missense_Mutation	SNP	C	C	A	rs201211645		TCGA-PK-A5HA-01A-11D-A29I-10	TCGA-PK-A5HA-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2bd7613-8a82-453c-b1d0-f0ad6fbc0766	688c5eb5-c374-4bfb-81d1-c0ba622386cf	g.chr19:622193C>A	ENST00000588649.2	-	9	1891	c.1807G>T	c.(1807-1809)Gtc>Ttc	p.V603F	LLNLR-299G3.1_ENST00000607288.1_RNA	NM_005035.3	NP_005026.3	O00411	RPOM_HUMAN	polymerase (RNA) mitochondrial (DNA directed)	603					gene expression (GO:0010467)|transcription from mitochondrial promoter (GO:0006390)|transcription initiation from mitochondrial promoter (GO:0006391)	mitochondrial matrix (GO:0005759)|mitochondrial nucleoid (GO:0042645)|mitochondrion (GO:0005739)	DNA binding (GO:0003677)|DNA-directed RNA polymerase activity (GO:0003899)|poly(A) RNA binding (GO:0044822)			cervix(2)|endometrium(3)|large_intestine(1)|lung(9)|ovary(1)|pancreas(2)|prostate(1)|stomach(1)	20		all_epithelial(18;2.78e-22)|Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;3.55e-06)|all_lung(49;5.41e-06)|Breast(49;4.08e-05)|Hepatocellular(1079;0.137)|Renal(1328;0.228)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		AGCACGGGGACAAGCCGAGAG	0.652																																					p.V603F		.											.	POLRMT-92	0			c.G1807T						.						16.0	13.0	14.0					19																	622193		2180	4276	6456	SO:0001583	missense	5442	exon9			CGGGGACAAGCCG		CCDS12036.1	19p13.3	2010-10-22			ENSG00000099821	ENSG00000099821	2.7.7.6		9200	protein-coding gene	gene with protein product		601778				9097968	Standard	NM_005035		Approved	h-mtRPOL, APOLMT, MTRNAP, MTRPOL	uc002lpf.1	O00411		ENST00000588649.2:c.1807G>T	19.37:g.622193C>A	ENSP00000465759:p.Val603Phe	Somatic	44	0		WXS	Illumina GAIIx	Phase_I	46	4	NM_005035	0	0	28	28	0	O60370	Missense_Mutation	SNP	ENST00000588649.2	37	CCDS12036.1	.	.	.	.	.	.	.	.	.	.	.	15.59	2.878614	0.51801	.	.	ENSG00000099821	ENST00000215591	T	0.47869	0.83	4.02	-0.579	0.11720	.	0.053759	0.64402	D	0.000001	T	0.39172	0.1068	L	0.38175	1.15	0.25061	N	0.99106	P	0.40332	0.713	P	0.44732	0.459	T	0.34030	-0.9845	10	0.49607	T	0.09	-30.7214	9.718	0.40286	0.0:0.4522:0.0:0.5478	.	603	O00411	RPOM_HUMAN	F	603	ENSP00000215591:V603F	ENSP00000215591:V603F	V	-	1	0	POLRMT	573193	1.000000	0.71417	0.015000	0.15790	0.004000	0.04260	2.047000	0.41269	-0.292000	0.08999	-0.379000	0.06801	GTC	.		0.652	POLRMT-001	KNOWN	upstream_ATG|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452172.3	NM_005035	
ABCA7	10347	hgsc.bcm.edu	37	19	1065044	1065044	+	Silent	SNP	C	C	T	rs4147935	byFrequency	TCGA-PK-A5HA-01A-11D-A29I-10	TCGA-PK-A5HA-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2bd7613-8a82-453c-b1d0-f0ad6fbc0766	688c5eb5-c374-4bfb-81d1-c0ba622386cf	g.chr19:1065044C>T	ENST00000263094.6	+	46	6390	c.6159C>T	c.(6157-6159)ggC>ggT	p.G2053G	ABCA7_ENST00000435683.2_Silent_p.G1915G|HMHA1_ENST00000536472.1_5'Flank|ABCA7_ENST00000433129.1_Silent_p.G2053G|HMHA1_ENST00000586866.1_5'Flank|HMHA1_ENST00000313093.2_5'Flank|HMHA1_ENST00000590214.1_5'Flank|HMHA1_ENST00000539243.2_5'Flank	NM_019112.3	NP_061985.2	Q8IZY2	ABCA7_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 7	2053					apolipoprotein A-I-mediated signaling pathway (GO:0038027)|ATP catabolic process (GO:0006200)|cholesterol efflux (GO:0033344)|high-density lipoprotein particle assembly (GO:0034380)|memory (GO:0007613)|negative regulation of amyloid precursor protein biosynthetic process (GO:0042985)|negative regulation of ATPase activity (GO:0032780)|negative regulation of beta-amyloid formation (GO:1902430)|peptide cross-linking (GO:0018149)|phagocytosis (GO:0006909)|phospholipid efflux (GO:0033700)|phospholipid scrambling (GO:0017121)|positive regulation of ATPase activity (GO:0032781)|positive regulation of beta-amyloid clearance (GO:1900223)|positive regulation of cholesterol efflux (GO:0010875)|positive regulation of engulfment of apoptotic cell (GO:1901076)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of phagocytosis (GO:0050766)|positive regulation of phospholipid efflux (GO:1902995)|protein localization to nucleus (GO:0034504)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|ATP-binding cassette (ABC) transporter complex (GO:0043190)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|phagocytic cup (GO:0001891)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)	apolipoprotein A-I receptor activity (GO:0034188)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|phospholipid transporter activity (GO:0005548)|transporter activity (GO:0005215)			NS(1)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(7)|lung(22)|ovary(1)|pancreas(7)|prostate(4)|skin(3)|upper_aerodigestive_tract(1)	65		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;1.04e-05)|all_lung(49;1.53e-05)|Breast(49;9.42e-05)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		CACATGGAGGCCGCCTGCGCT	0.736																																					p.G2053G		.											.	ABCA7-98	0			c.C6159T						.	C		327,3757		20,287,1735	5.0	6.0	6.0		6159	1.5	0.8	19	dbSNP_110	6	2858,5242		553,1752,1745	no	coding-synonymous	ABCA7	NM_019112.3		573,2039,3480	TT,TC,CC		35.284,8.0069,26.1408		2053/2147	1065044	3185,8999	2042	4050	6092	SO:0001819	synonymous_variant	10347	exon46			TGGAGGCCGCCTG	AF328787	CCDS12055.1	19p13.3	2012-03-14			ENSG00000064687	ENSG00000064687		"""ATP binding cassette transporters / subfamily A"""	37	protein-coding gene	gene with protein product		605414					Standard	NM_019112		Approved	ABCX	uc002lqw.4	Q8IZY2	OTTHUMG00000167547	ENST00000263094.6:c.6159C>T	19.37:g.1065044C>T		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	18	12	NM_019112	0	0	1	5	4	Q96S58|Q9BZC4|Q9NR73|Q9UKP8	Silent	SNP	ENST00000263094.6	37	CCDS12055.1																																																																																			C|0.766;T|0.234		0.736	ABCA7-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000394993.1	NM_019112	
KLF16	83855	hgsc.bcm.edu	37	19	1854557	1854557	+	Silent	SNP	A	A	G	rs3746045	byFrequency	TCGA-PK-A5HA-01A-11D-A29I-10	TCGA-PK-A5HA-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2bd7613-8a82-453c-b1d0-f0ad6fbc0766	688c5eb5-c374-4bfb-81d1-c0ba622386cf	g.chr19:1854557A>G	ENST00000250916.4	-	2	730	c.660T>C	c.(658-660)ccT>ccC	p.P220P	KLF16_ENST00000592313.1_5'UTR|CTB-31O20.6_ENST00000592884.1_RNA	NM_031918.3	NP_114124.1	Q9BXK1	KLF16_HUMAN	Kruppel-like factor 16	220	Pro/Ser-rich.				dopamine receptor signaling pathway (GO:0007212)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			lung(1)	1		Ovarian(11;1.78e-06)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		TGCGGGCACCAGGGCGCCGGA	0.756													A|||	2119	0.423123	0.6785	0.4611	5008	,	,		10654	0.3829		0.2177	False		,,,				2504	0.3037				p.P220P		.											.	KLF16-90	0			c.T660C						.	A		2319,1817		694,931,443	10.0	16.0	14.0		660	-6.7	0.2	19	dbSNP_107	14	1682,6356		211,1260,2548	no	coding-synonymous	KLF16	NM_031918.3		905,2191,2991	GG,GA,AA		20.9256,43.9313,32.8651		220/253	1854557	4001,8173	2068	4019	6087	SO:0001819	synonymous_variant	83855	exon2			GGCACCAGGGCGC	AF327440	CCDS12075.1	19p13.3	2013-10-15			ENSG00000129911	ENSG00000129911		"""Kruppel-like transcription factors"", ""Zinc fingers, C2H2-type"""	16857	protein-coding gene	gene with protein product		606139				11438660	Standard	NM_031918		Approved	NSLP2, BTEB4, DRRF	uc002luc.3	Q9BXK1	OTTHUMG00000179994	ENST00000250916.4:c.660T>C	19.37:g.1854557A>G		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	19	19	NM_031918	0	0	0	10	10		Silent	SNP	ENST00000250916.4	37	CCDS12075.1																																																																																			A|0.591;G|0.409		0.756	KLF16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000449214.1		
CACTIN	58509	hgsc.bcm.edu	37	19	3613346	3613346	+	Missense_Mutation	SNP	G	G	A	rs2074789	byFrequency	TCGA-PK-A5HA-01A-11D-A29I-10	TCGA-PK-A5HA-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2bd7613-8a82-453c-b1d0-f0ad6fbc0766	688c5eb5-c374-4bfb-81d1-c0ba622386cf	g.chr19:3613346G>A	ENST00000429344.2	-	9	1548	c.1496C>T	c.(1495-1497)gCg>gTg	p.A499V	CACTIN-AS1_ENST00000592274.1_RNA|CACTIN_ENST00000221899.3_Missense_Mutation_p.A431V|CACTIN_ENST00000248420.5_Missense_Mutation_p.A499V	NM_001080543.1	NP_001074012.1	Q8WUQ7	CATIN_HUMAN	cactin, spliceosome C complex subunit	499				A -> V (in Ref. 4; AAH19848). {ECO:0000305}.	cellular response to interleukin-1 (GO:0071347)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to tumor necrosis factor (GO:0071356)|innate immune response (GO:0045087)|mRNA splicing, via spliceosome (GO:0000398)|multicellular organismal development (GO:0007275)|negative regulation of interferon-beta production (GO:0032688)|negative regulation of interleukin-8 production (GO:0032717)|negative regulation of lipopolysaccharide-mediated signaling pathway (GO:0031665)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of toll-like receptor signaling pathway (GO:0034122)|negative regulation of tumor necrosis factor production (GO:0032720)|negative regulation of type I interferon-mediated signaling pathway (GO:0060339)	catalytic step 2 spliceosome (GO:0071013)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)										GGTGGGCGCCGCGTCCTCAGG	0.781													G|||	2156	0.430511	0.3018	0.6037	5008	,	,		8769	0.3294		0.5795	False		,,,				2504	0.4325				p.A499V		.											.	.	0			c.C1496T						.	G	VAL/ALA,VAL/ALA	1466,1576		408,650,463	4.0	5.0	5.0		1496,1496	-5.6	0.0	19	dbSNP_96	5	4326,2414		1492,1342,536	yes	missense,missense	C19orf29	NM_001080543.1,NM_021231.1	64,64	1900,1992,999	AA,AG,GG		35.816,48.192,40.7892	benign,benign	499/759,499/759	3613346	5792,3990	1521	3370	4891	SO:0001583	missense	58509	exon9			GGCGCCGCGTCCT	BC019848	CCDS45920.1	19p13.3	2012-06-08	2012-06-08	2012-06-08	ENSG00000105298	ENSG00000105298			29938	protein-coding gene	gene with protein product	"""NY REN 24 antigen"", ""functional spliceosome-associated protein c"", ""cactin homolog (Drosophila)"""		"""chromosome 19 open reading frame 29"""	C19orf29		8619474, 9110174, 21429463, 20829348	Standard	NM_001080543		Approved	NY-REN-24, fSAPc, cactin	uc002lyh.3	Q8WUQ7		ENST00000429344.2:c.1496C>T	19.37:g.3613346G>A	ENSP00000415078:p.Ala499Val	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	4	4	NM_021231	0	0	0	2	2	A6NNA9|A9UL12|O75229|Q7LE08|Q9BTA6|Q9Y5A4	Missense_Mutation	SNP	ENST00000429344.2	37	CCDS45920.1	1016|1016	0.4652014652014652|0.4652014652014652	166|166	0.33739837398373984|0.33739837398373984	219|219	0.6049723756906077|0.6049723756906077	189|189	0.3304195804195804|0.3304195804195804	442|442	0.58311345646438|0.58311345646438	G|G	10.30|10.30	1.311266|1.311266	0.23821|0.23821	0.48192|0.48192	0.64184|0.64184	ENSG00000105298|ENSG00000226800	ENST00000429344;ENST00000248420;ENST00000221899|ENST00000447295	.|.	.|.	.|.	3.38|3.38	-5.6|-5.6	0.02497|0.02497	.|.	2.059910|.	0.01925|.	N|.	0.040837|.	T|T	0.00012|0.00012	0.0000|0.0000	N|N	0.08118|0.08118	0|0	0.80722|0.80722	P|P	0.0|0.0	B;B|.	0.26602|.	0.116;0.154|.	B;B|.	0.18561|.	0.022;0.004|.	T|T	0.46952|0.46952	-0.9154|-0.9154	8|4	0.30078|.	T|.	0.28|.	.|.	0.7428|0.7428	0.00977|0.00977	0.2199:0.145:0.1962:0.4388|0.2199:0.145:0.1962:0.4388	rs2074789;rs11557007|rs2074789;rs11557007	499;499|.	Q8WUQ7-2;Q8WUQ7|.	.;CS029_HUMAN|.	V|H	499;499;431|325	.|.	ENSP00000221899:A431V|.	A|R	-|+	2|2	0|0	C19orf29|C19orf29OS	3564346|3564346	0.000000|0.000000	0.05858|0.05858	0.001000|0.001000	0.08648|0.08648	0.007000|0.007000	0.05969|0.05969	-1.122000|-1.122000	0.03267|0.03267	-0.535000|-0.535000	0.06307|0.06307	-0.258000|-0.258000	0.10820|0.10820	GCG|CGC	G|0.535;A|0.465		0.781	CACTIN-007	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000457370.2		
MUC16	94025	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	19	9047465	9047465	+	Missense_Mutation	SNP	G	G	A			TCGA-PK-A5HA-01A-11D-A29I-10	TCGA-PK-A5HA-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2bd7613-8a82-453c-b1d0-f0ad6fbc0766	688c5eb5-c374-4bfb-81d1-c0ba622386cf	g.chr19:9047465G>A	ENST00000397910.4	-	5	34369	c.34166C>T	c.(34165-34167)tCa>tTa	p.S11389L		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	11391	Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						TGGAAAATCTGAAGTGGCTTC	0.468																																					p.S11389L		.											.	MUC16-566	0			c.C34166T						.						213.0	206.0	208.0					19																	9047465		1962	4152	6114	SO:0001583	missense	94025	exon5			AAATCTGAAGTGG	AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.34166C>T	19.37:g.9047465G>A	ENSP00000381008:p.Ser11389Leu	Somatic	181	0		WXS	Illumina GAIIx	Phase_I	176	15	NM_024690	0	0	0	0	0	Q6ZQW5|Q96RK2	Missense_Mutation	SNP	ENST00000397910.4	37	CCDS54212.1	.	.	.	.	.	.	.	.	.	.	g	10.62	1.402422	0.25291	.	.	ENSG00000181143	ENST00000397910	T	0.02656	4.21	3.68	3.68	0.42216	.	.	.	.	.	T	0.10937	0.0267	L	0.59436	1.845	.	.	.	D	0.76494	0.999	D	0.75484	0.986	T	0.03503	-1.1030	8	0.87932	D	0	.	11.1976	0.48722	0.0:0.0:1.0:0.0	.	11389	B5ME49	.	L	11389	ENSP00000381008:S11389L	ENSP00000381008:S11389L	S	-	2	0	MUC16	8908465	0.694000	0.27738	0.171000	0.22900	0.013000	0.08279	2.614000	0.46359	2.345000	0.79718	0.586000	0.80456	TCA	.		0.468	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402806.1	NM_024690	
CILP2	148113	hgsc.bcm.edu	37	19	19651140	19651140	+	Silent	SNP	A	A	G	rs4808970	byFrequency	TCGA-PK-A5HA-01A-11D-A29I-10	TCGA-PK-A5HA-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2bd7613-8a82-453c-b1d0-f0ad6fbc0766	688c5eb5-c374-4bfb-81d1-c0ba622386cf	g.chr19:19651140A>G	ENST00000291495.5	+	3	376	c.291A>G	c.(289-291)gaA>gaG	p.E97E	CILP2_ENST00000586018.1_Silent_p.E103E	NM_153221.2	NP_694953.2	Q8IUL8	CILP2_HUMAN	cartilage intermediate layer protein 2	97						extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)				NS(1)|breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(3)|lung(17)|ovary(2)|prostate(2)|skin(1)|urinary_tract(1)	32						TGGCGCTGGAAGCGCGCACCA	0.726													A|||	593	0.118411	0.1626	0.1167	5008	,	,		10102	0.0		0.168	False		,,,				2504	0.1309				p.E97E		.											.	CILP2-91	0			c.A291G						.	A		612,3678		42,528,1575	10.0	11.0	11.0		291	3.2	1.0	19	dbSNP_111	11	1223,7149		89,1045,3052	no	coding-synonymous	CILP2	NM_153221.2		131,1573,4627	GG,GA,AA		14.6082,14.2657,14.4922		97/1157	19651140	1835,10827	2145	4186	6331	SO:0001819	synonymous_variant	148113	exon3			GCTGGAAGCGCGC	AF542080	CCDS12405.1	19p13.11	2013-01-14				ENSG00000160161		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	24213	protein-coding gene	gene with protein product		612419				12477932	Standard	NM_153221		Approved	MGC45771	uc002nmv.4	Q8IUL8		ENST00000291495.5:c.291A>G	19.37:g.19651140A>G		Somatic	1	0		WXS	Illumina GAIIx	Phase_I	29	8	NM_153221	0	0	0	0	0	Q6NV88|Q8N4A6|Q8WV21	Silent	SNP	ENST00000291495.5	37	CCDS12405.1																																																																																			A|0.873;G|0.127		0.726	CILP2-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000459738.3	NM_153221	
RGS9BP	388531	hgsc.bcm.edu	37	19	33167455	33167455	+	Missense_Mutation	SNP	G	G	T	rs259290	byFrequency	TCGA-PK-A5HA-01A-11D-A29I-10	TCGA-PK-A5HA-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2bd7613-8a82-453c-b1d0-f0ad6fbc0766	688c5eb5-c374-4bfb-81d1-c0ba622386cf	g.chr19:33167455G>T	ENST00000334176.3	+	1	1143	c.286G>T	c.(286-288)Gcg>Tcg	p.A96S	ANKRD27_ENST00000587352.1_5'Flank|ANKRD27_ENST00000306065.4_5'Flank	NM_207391.2	NP_997274.2	Q6ZS82	R9BP_HUMAN	regulator of G protein signaling 9 binding protein	96			A -> S (in dbSNP:rs259290). {ECO:0000269|PubMed:14702039}.		detection of light stimulus involved in visual perception (GO:0050908)|negative regulation of signal transduction (GO:0009968)|phototransduction, visible light (GO:0007603)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|rhodopsin mediated signaling pathway (GO:0016056)	integral component of membrane (GO:0016021)				central_nervous_system(1)|lung(2)	3	Esophageal squamous(110;0.137)					CATGCGACGCGCGCTGGAGCT	0.786													G|||	2178	0.434904	0.3805	0.4856	5008	,	,		10415	0.2579		0.6233	False		,,,				2504	0.4611				p.A96S		.											.	RGS9BP-90	0			c.G286T						.	G	SER/ALA	1584,1384		459,666,359	2.0	2.0	2.0		286	3.5	1.0	19	dbSNP_79	2	4397,1763		1670,1057,353	yes	missense	RGS9BP	NM_207391.2	99	2129,1723,712	TT,TG,GG		28.6201,46.6307,34.4763	possibly-damaging	96/236	33167455	5981,3147	1484	3080	4564	SO:0001583	missense	388531	exon1			CGACGCGCGCTGG	AW302149	CCDS12424.1	19q13.11	2008-02-05	2007-08-14			ENSG00000186326			30304	protein-coding gene	gene with protein product		607814	"""regulator of G protein signalling 9 binding protein"""			12119397, 8889548	Standard	NM_207391		Approved	FLJ45744, PERRS, R9AP, RGS9	uc002ntp.1	Q6ZS82		ENST00000334176.3:c.286G>T	19.37:g.33167455G>T	ENSP00000334134:p.Ala96Ser	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	9	9	NM_207391	0	0	0	0	0	Q6ZVJ6	Missense_Mutation	SNP	ENST00000334176.3	37	CCDS12424.1	1007	0.4610805860805861	184	0.37398373983739835	188	0.5193370165745856	161	0.28146853146853146	474	0.6253298153034301	G	15.38	2.815844	0.50527	0.533693	0.713799	ENSG00000186326	ENST00000334176	T	0.33654	1.4	4.57	3.5	0.40072	.	0.065802	0.64402	U	0.000009	T	0.00012	0.0000	L	0.28115	0.83	0.20873	P	0.999831543	P	0.52170	0.951	P	0.50352	0.638	T	0.12528	-1.0544	9	0.35671	T	0.21	-21.6697	13.7833	0.63094	0.0:0.0:0.8453:0.1547	rs259290	96	Q6ZS82	R9BP_HUMAN	S	96	ENSP00000334134:A96S	ENSP00000334134:A96S	A	+	1	0	RGS9BP	37859295	1.000000	0.71417	1.000000	0.80357	0.125000	0.20455	4.816000	0.62642	1.092000	0.41356	0.313000	0.20887	GCG	G|0.540;T|0.460		0.786	RGS9BP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000450337.1	NM_207391	
LRP3	4037	ucsc.edu	37	19	33697629	33697629	+	Missense_Mutation	SNP	G	G	A			TCGA-PK-A5HA-01A-11D-A29I-10	TCGA-PK-A5HA-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2bd7613-8a82-453c-b1d0-f0ad6fbc0766	688c5eb5-c374-4bfb-81d1-c0ba622386cf	g.chr19:33697629G>A	ENST00000253193.7	+	6	1917	c.1715G>A	c.(1714-1716)aGt>aAt	p.S572N	CTD-2540B15.13_ENST00000609744.1_RNA	NM_002333.3	NP_002324.2	O75074	LRP3_HUMAN	low density lipoprotein receptor-related protein 3	572					receptor-mediated endocytosis (GO:0006898)	coated pit (GO:0005905)|integral component of membrane (GO:0016021)				breast(1)|kidney(1)|large_intestine(1)|lung(9)|ovary(1)|pancreas(2)	15	Esophageal squamous(110;0.137)					CCTGTCTACAGTGCGTCCCAG	0.682																																					p.S572N		.											.	LRP3-92	0			c.G1715A						.						77.0	73.0	74.0					19																	33697629		2203	4300	6503	SO:0001583	missense	4037	exon6			TCTACAGTGCGTC	AB009462	CCDS12430.1	19q13.11	2013-05-30			ENSG00000130881	ENSG00000130881		"""Low density lipoprotein receptors"""	6695	protein-coding gene	gene with protein product		603159				9693042, 7959795	Standard	NM_002333		Approved	LRP-3, hLRp105	uc010edh.3	O75074	OTTHUMG00000180343	ENST00000253193.7:c.1715G>A	19.37:g.33697629G>A	ENSP00000253193:p.Ser572Asn	Somatic	78	0		WXS	Illumina GAIIx	Phase_I	65	4	NM_002333	0	0	2	2	0	B3KQD6|B4DKF2	Missense_Mutation	SNP	ENST00000253193.7	37	CCDS12430.1	.	.	.	.	.	.	.	.	.	.	G	4.212	0.038153	0.08148	.	.	ENSG00000130881	ENST00000253193	D	0.85411	-1.98	4.32	3.28	0.37604	.	0.055371	0.64402	D	0.000001	T	0.61299	0.2336	N	0.03071	-0.42	0.29748	N	0.836607	B;B	0.06786	0.0;0.001	B;B	0.06405	0.001;0.002	T	0.52852	-0.8520	10	0.10636	T	0.68	-3.6598	7.9801	0.30179	0.166:0.0:0.834:0.0	.	572;490	O75074;B7ZAJ9	LRP3_HUMAN;.	N	572	ENSP00000253193:S572N	ENSP00000253193:S572N	S	+	2	0	LRP3	38389469	1.000000	0.71417	0.997000	0.53966	0.946000	0.59487	4.162000	0.58177	2.407000	0.81776	0.491000	0.48974	AGT	.		0.682	LRP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000450842.4		
ZNF585B	92285	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	37676152	37676152	+	Missense_Mutation	SNP	C	C	A			TCGA-PK-A5HA-01A-11D-A29I-10	TCGA-PK-A5HA-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2bd7613-8a82-453c-b1d0-f0ad6fbc0766	688c5eb5-c374-4bfb-81d1-c0ba622386cf	g.chr19:37676152C>A	ENST00000532828.2	-	5	2538	c.2287G>T	c.(2287-2289)Gtt>Ttt	p.V763F	CTC-454I21.3_ENST00000585860.2_Intron|ZNF585B_ENST00000531805.1_Missense_Mutation_p.V708F|ZNF585B_ENST00000312908.5_Missense_Mutation_p.V351F|ZNF585B_ENST00000527838.1_3'UTR	NM_152279.3	NP_689492.3	Q52M93	Z585B_HUMAN	zinc finger protein 585B	763					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(3)|endometrium(1)|large_intestine(9)|lung(13)|ovary(1)|prostate(1)	29			COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)			CTCTGATGAACACTGAACACT	0.468																																					p.V763F	Melanoma(93;882 1454 18863 28917 48427)	.											.	ZNF585B-91	0			c.G2287T						.						167.0	146.0	153.0					19																	37676152		2203	4300	6503	SO:0001583	missense	92285	exon5			GATGAACACTGAA	AK027834	CCDS12500.1	19q13.13	2013-01-08				ENSG00000245680		"""Zinc fingers, C2H2-type"", ""-"""	30948	protein-coding gene	gene with protein product						12477932	Standard	NM_152279		Approved	FLJ14928, SZFP41	uc002ofq.3	Q52M93		ENST00000532828.2:c.2287G>T	19.37:g.37676152C>A	ENSP00000433773:p.Val763Phe	Somatic	156	0		WXS	Illumina GAIIx	Phase_I	160	61	NM_152279	0	0	4	7	3	Q8IZD3|Q96JW6	Missense_Mutation	SNP	ENST00000532828.2	37	CCDS12500.1	.	.	.	.	.	.	.	.	.	.	C	6.577	0.474822	0.12521	.	.	ENSG00000245680	ENST00000531805;ENST00000532828;ENST00000312908	T;T;T	0.08720	3.06;3.06;3.06	2.72	-0.881	0.10607	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.832692	0.09735	N	0.762669	T	0.07728	0.0194	M	0.65975	2.015	0.09310	N	1	B;P	0.36315	0.089;0.547	B;B	0.24006	0.005;0.05	T	0.26916	-1.0089	10	0.36615	T	0.2	.	6.846	0.23988	0.0:0.5217:0.0:0.4783	.	708;763	E9PQH3;Q52M93	.;Z585B_HUMAN	F	708;763;351	ENSP00000436774:V708F;ENSP00000433773:V763F;ENSP00000442139:V351F	ENSP00000442139:V351F	V	-	1	0	ZNF585B	42367992	0.000000	0.05858	0.003000	0.11579	0.156000	0.22039	-3.444000	0.00469	0.002000	0.14630	0.305000	0.20034	GTT	.		0.468	ZNF585B-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000388272.2	NM_152279	
FBXO17	115290	hgsc.bcm.edu	37	19	39440918	39440918	+	Silent	SNP	T	T	C	rs2304117	byFrequency	TCGA-PK-A5HA-01A-11D-A29I-10	TCGA-PK-A5HA-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2bd7613-8a82-453c-b1d0-f0ad6fbc0766	688c5eb5-c374-4bfb-81d1-c0ba622386cf	g.chr19:39440918T>C	ENST00000292852.4	-	2	383	c.42A>G	c.(40-42)ccA>ccG	p.P14P	SARS2_ENST00000448145.2_5'Flank|FBXO17_ENST00000595329.1_Silent_p.P14P|CTC-360G5.8_ENST00000599996.1_5'Flank	NM_024907.5	NP_079183.4	Q96EF6	FBX17_HUMAN	F-box protein 17	14						SCF ubiquitin ligase complex (GO:0019005)	glycoprotein binding (GO:0001948)			breast(1)|endometrium(1)|large_intestine(1)|lung(3)|prostate(1)	7	all_cancers(60;8.37e-07)|all_lung(34;3.71e-07)|Lung NSC(34;4.17e-07)|all_epithelial(25;1.13e-06)|Ovarian(47;0.0454)		Lung(45;0.000419)|LUSC - Lung squamous cell carcinoma(53;0.000554)			GGGCCAGGGATGGGTCCGCCG	0.731													c|||	2378	0.47484	0.3336	0.3746	5008	,	,		11867	0.6796		0.4195	False		,,,				2504	0.5828				p.P23P		.											.	FBXO17-226	0			c.A69G						.		,	1052,2556		213,626,965	3.0	4.0	3.0		42,69	0.5	0.0	19	dbSNP_100	3	2265,4819		496,1273,1773	no	coding-synonymous,coding-synonymous	FBXO17	NM_024907.5,NM_148169.1	,	709,1899,2738	CC,CT,TT		31.9735,29.1574,31.0232	,	14/279,23/288	39440918	3317,7375	1804	3542	5346	SO:0001819	synonymous_variant	115290	exon2			CAGGGATGGGTCC	AF386743	CCDS12526.1	19q13.2	2010-07-02	2004-06-15	2004-06-16		ENSG00000269190		"""F-boxes /  ""other"""""	18754	protein-coding gene	gene with protein product	"""F-box only protein 26"""	609094	"""F-box only protein 17"""	FBXO26			Standard	NM_148169		Approved	FBG4, FLJ25205, MGC9379, FLJ11798, Fbx17		Q96EF6		ENST00000292852.4:c.42A>G	19.37:g.39440918T>C		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	25	8	NM_148169	0	0	0	0	0	Q96LQ4	Silent	SNP	ENST00000292852.4	37	CCDS12526.1																																																																																			T|0.545;C|0.455		0.731	FBXO17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463273.1	NM_024907	
ZFP36	7538	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	39899249	39899249	+	Silent	SNP	C	C	T			TCGA-PK-A5HA-01A-11D-A29I-10	TCGA-PK-A5HA-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2bd7613-8a82-453c-b1d0-f0ad6fbc0766	688c5eb5-c374-4bfb-81d1-c0ba622386cf	g.chr19:39899249C>T	ENST00000248673.3	+	2	949	c.891C>T	c.(889-891)ccC>ccT	p.P297P	ZFP36_ENST00000597629.1_Silent_p.P303P|MIR4530_ENST00000581459.1_RNA	NM_003407.3	NP_003398.2	P26651	TTP_HUMAN	ZFP36 ring finger protein	297					3'-UTR-mediated mRNA stabilization (GO:0070935)|gene expression (GO:0010467)|intracellular signal transduction (GO:0035556)|mRNA catabolic process (GO:0006402)|mRNA metabolic process (GO:0016071)|negative regulation of inflammatory response (GO:0050728)|negative regulation of myeloid cell differentiation (GO:0045638)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of translation involved in gene silencing by miRNA (GO:0035278)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|positive regulation of nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:1900153)|positive regulation of nuclear-transcribed mRNA poly(A) tail shortening (GO:0060213)|regulation of tumor necrosis factor production (GO:0032680)|response to starvation (GO:0042594)|RNA destabilization (GO:0050779)|RNA metabolic process (GO:0016070)	cytoplasm (GO:0005737)|cytoplasmic stress granule (GO:0010494)|cytosol (GO:0005829)|nucleus (GO:0005634)	14-3-3 protein binding (GO:0071889)|AU-rich element binding (GO:0017091)|C-C chemokine binding (GO:0019957)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)|mRNA 3'-UTR AU-rich region binding (GO:0035925)|mRNA binding (GO:0003729)|poly(A) RNA binding (GO:0044822)|protein kinase binding (GO:0019901)|single-stranded RNA binding (GO:0003727)			large_intestine(1)|lung(5)|pancreas(1)	7	all_cancers(60;6.54e-07)|all_lung(34;4.03e-08)|Lung NSC(34;4.66e-08)|all_epithelial(25;1.53e-06)|Ovarian(47;0.0512)		Epithelial(26;2.92e-26)|all cancers(26;2.01e-23)|Lung(45;0.000499)|LUSC - Lung squamous cell carcinoma(53;0.000657)			CTGACTCTCCCGTCTTCGAGG	0.622																																					p.P303P	NSCLC(67;1164 1324 12056 21056 30097)	.											.	ZFP36-227	0			c.C909T						.						26.0	29.0	28.0					19																	39899249		2200	4297	6497	SO:0001819	synonymous_variant	7538	exon2			CTCTCCCGTCTTC	M63625	CCDS12534.1, CCDS12534.2	19q13.1	2012-11-27	2012-11-27			ENSG00000128016		"""RING-type (C3HC4) zinc fingers"""	12862	protein-coding gene	gene with protein product		190700	"""zinc finger protein 36, C3H type, homolog (mouse)"""			1699942	Standard	NM_003407		Approved	RNF162A, TIS11, G0S24, TTP, NUP475, tristetraprolin	uc002olh.2	P26651		ENST00000248673.3:c.891C>T	19.37:g.39899249C>T		Somatic	59	0		WXS	Illumina GAIIx	Phase_I	48	21	NM_003407	0	0	110	110	0	B2RA54	Silent	SNP	ENST00000248673.3	37																																																																																				.		0.622	ZFP36-201	KNOWN	basic|appris_candidate	protein_coding	protein_coding			
ERCC2	2068	hgsc.bcm.edu	37	19	45867259	45867259	+	Missense_Mutation	SNP	C	C	T	rs1799793	byFrequency	TCGA-PK-A5HA-01A-11D-A29I-10	TCGA-PK-A5HA-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2bd7613-8a82-453c-b1d0-f0ad6fbc0766	688c5eb5-c374-4bfb-81d1-c0ba622386cf	g.chr19:45867259C>T	ENST00000391945.4	-	10	1011	c.934G>A	c.(934-936)Gac>Aac	p.D312N	ERCC2_ENST00000221481.6_3'UTR|ERCC2_ENST00000485403.2_Missense_Mutation_p.D288N|ERCC2_ENST00000391944.3_Missense_Mutation_p.D234N|ERCC2_ENST00000391940.4_Missense_Mutation_p.D288N	NM_000400.3	NP_000391.1	P18074	ERCC2_HUMAN	excision repair cross-complementation group 2	312			D -> N (in dbSNP:rs1799793). {ECO:0000269|PubMed:11245433, ECO:0000269|PubMed:11470747, ECO:0000269|PubMed:11709541, ECO:0000269|Ref.3}.		7-methylguanosine mRNA capping (GO:0006370)|aging (GO:0007568)|apoptotic process (GO:0006915)|ATP catabolic process (GO:0006200)|bone mineralization (GO:0030282)|cell proliferation (GO:0008283)|central nervous system myelin formation (GO:0032289)|chromosome segregation (GO:0007059)|DNA duplex unwinding (GO:0032508)|DNA repair (GO:0006281)|embryonic cleavage (GO:0040016)|erythrocyte maturation (GO:0043249)|extracellular matrix organization (GO:0030198)|gene expression (GO:0010467)|hair cell differentiation (GO:0035315)|hair follicle maturation (GO:0048820)|hematopoietic stem cell differentiation (GO:0060218)|in utero embryonic development (GO:0001701)|multicellular organism growth (GO:0035264)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA damage removal (GO:0000718)|nucleotide-excision repair, DNA incision (GO:0033683)|positive regulation of DNA binding (GO:0043388)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of viral transcription (GO:0050434)|post-embryonic development (GO:0009791)|protein phosphorylation (GO:0006468)|regulation of mitotic cell cycle phase transition (GO:1901990)|response to hypoxia (GO:0001666)|response to oxidative stress (GO:0006979)|small molecule metabolic process (GO:0044281)|spinal cord development (GO:0021510)|termination of RNA polymerase I transcription (GO:0006363)|transcription elongation from RNA polymerase I promoter (GO:0006362)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase I promoter (GO:0006360)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase I promoter (GO:0006361)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription-coupled nucleotide-excision repair (GO:0006283)|UV protection (GO:0009650)|viral process (GO:0016032)	cytoplasm (GO:0005737)|holo TFIIH complex (GO:0005675)|MMXD complex (GO:0071817)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle (GO:0005819)	4 iron, 4 sulfur cluster binding (GO:0051539)|5'-3' DNA helicase activity (GO:0043139)|ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|DNA binding (GO:0003677)|DNA-dependent ATPase activity (GO:0008094)|metal ion binding (GO:0046872)|protein C-terminus binding (GO:0008022)|protein N-terminus binding (GO:0047485)			large_intestine(4)|lung(2)|ovary(1)|pancreas(1)|stomach(1)	9		Ovarian(192;0.0728)|all_neural(266;0.112)		OV - Ovarian serous cystadenocarcinoma(262;0.0226)		AGCACTTCGTCGGGCAGCACG	0.746			"""Mis, N, F, S"""			"""skin basal cell, skin squamous cell, melanoma"""		Nucleotide excision repair (NER)	Xeroderma Pigmentosum				C|||	974	0.194489	0.0734	0.1988	5008	,	,		10423	0.0496		0.3588	False		,,,				2504	0.3354				p.D312N		.	yes	Rec		Xeroderma pigmentosum (D)	19	19q13.2-q13.3	2068	"""excision repair cross-complementing rodent repair deficiency, complementation group 2 (xeroderma pigmentosum D)"""		E	.	ERCC2-848	0			c.G934A	GRCh37	CM015299	ERCC2	M	rs1799793	.	C	ASN/ASP,ASN/ASP	387,3577		30,327,1625	5.0	8.0	7.0		934,862	5.2	0.5	19	dbSNP_89	7	2507,5397		444,1619,1889	no	missense,missense	ERCC2	NM_000400.3,NM_001130867.1	23,23	474,1946,3514	TT,TC,CC		31.7181,9.7629,24.3849	benign,benign	312/761,288/406	45867259	2894,8974	1982	3952	5934	SO:0001583	missense	2068	exon10	Familial Cancer Database	incl. XPA, XPB, XPC, XPD, XPE, XPF, XPG, XP Variant, XPV	CTTCGTCGGGCAG		CCDS33049.1, CCDS46112.1	19q13.3	2014-09-17	2014-03-07		ENSG00000104884	ENSG00000104884	3.6.4.12	"""General transcription factor IIH complex subunits"""	3434	protein-coding gene	gene with protein product	"""excision repair cross-complementing rodent repair deficiency, complementation group 2 protein"", ""TFIIH basal transcription factor complex helicase XPB subunit"""	126340	"""xeroderma pigmentosum complementary group D"", ""excision repair cross-complementing rodent repair deficiency, complementation group 2"""	XPD		8413672, 2184031	Standard	NM_000400		Approved	MAG, EM9, MGC102762, MGC126218, MGC126219, TFIIH	uc002pbj.2	P18074	OTTHUMG00000048190	ENST00000391945.4:c.934G>A	19.37:g.45867259C>T	ENSP00000375809:p.Asp312Asn	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	27	27	NM_000400	0	0	1	28	27	Q2TB78|Q2YDY2|Q7KZU6|Q8N721	Missense_Mutation	SNP	ENST00000391945.4	37	CCDS33049.1	423	0.1936813186813187	34	0.06910569105691057	70	0.19337016574585636	38	0.06643356643356643	281	0.370712401055409	C	20.0	3.930510	0.73327	0.097629	0.317181	ENSG00000104884	ENST00000391941;ENST00000391942;ENST00000391945;ENST00000391944;ENST00000391940	T;T;T	0.64438	-0.1;-0.1;-0.1	5.15	5.15	0.70609	Domain of unknown function DUF1227 (1);	0.000000	0.85682	D	0.000000	T	0.00012	0.0000	L	0.46947	1.48	0.09310	P	1.0	B;P;B	0.34639	0.065;0.461;0.053	B;B;B	0.35353	0.059;0.201;0.051	T	0.28267	-1.0049	9	0.33940	T	0.23	-30.0006	16.1268	0.81402	0.0:1.0:0.0:0.0	rs1799793;rs3916814;rs58989209;rs1799793	234;288;312	E7EVE9;Q7KZU6;P18074	.;.;ERCC2_HUMAN	N	262;288;312;234;288	ENSP00000375809:D312N;ENSP00000375808:D234N;ENSP00000375804:D288N	ENSP00000375804:D288N	D	-	1	0	ERCC2	50559099	1.000000	0.71417	0.523000	0.27875	0.865000	0.49528	7.192000	0.77771	2.388000	0.81334	0.561000	0.74099	GAC	C|0.804;T|0.196		0.746	ERCC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109626.2	NM_000400	
PTGIR	5739	hgsc.bcm.edu	37	19	47127324	47127324	+	Silent	SNP	C	C	G	rs2229128	byFrequency	TCGA-PK-A5HA-01A-11D-A29I-10	TCGA-PK-A5HA-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2bd7613-8a82-453c-b1d0-f0ad6fbc0766	688c5eb5-c374-4bfb-81d1-c0ba622386cf	g.chr19:47127324C>G	ENST00000291294.2	-	2	292	c.159G>C	c.(157-159)gtG>gtC	p.V53V	PTGIR_ENST00000597185.1_Intron|PTGIR_ENST00000596260.1_Silent_p.V53V|PTGIR_ENST00000598865.1_Intron|PTGIR_ENST00000594275.1_Intron	NM_000960.3	NP_000951.1	P43119	PI2R_HUMAN	prostaglandin I2 (prostacyclin) receptor (IP)	53					adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|blood coagulation (GO:0007596)|cell-cell signaling (GO:0007267)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|negative regulation of platelet-derived growth factor receptor signaling pathway (GO:0010642)|negative regulation of smooth muscle cell proliferation (GO:0048662)|positive regulation of cAMP biosynthetic process (GO:0030819)|positive regulation of cAMP-mediated signaling (GO:0043950)|positive regulation of GTPase activity (GO:0043547)|response to lipopolysaccharide (GO:0032496)	cytosol (GO:0005829)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|guanyl-nucleotide exchange factor activity (GO:0005085)			endometrium(1)|kidney(1)|large_intestine(1)|lung(5)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	13		Ovarian(192;0.0129)|all_neural(266;0.0459)|Breast(70;0.212)		OV - Ovarian serous cystadenocarcinoma(262;0.000327)|all cancers(93;0.000641)|Epithelial(262;0.0174)|GBM - Glioblastoma multiforme(486;0.0331)	Dinoprost Tromethamine(DB01160)|Epoprostenol(DB01240)|Iloprost(DB01088)|Treprostinil(DB00374)	CCAGTCCGGTCACCAGCACCG	0.731													G|||	1139	0.227436	0.1362	0.2133	5008	,	,		13968	0.3313		0.2465	False		,,,				2504	0.2342				p.V53V		.											.	PTGIR-522	0			c.G159C						.	G		523,3103		62,399,1352	3.0	5.0	5.0		159	2.2	1.0	19	dbSNP_98	5	1678,5498		231,1216,2141	no	coding-synonymous	PTGIR	NM_000960.3		293,1615,3493	GG,GC,CC		23.3835,14.4236,20.3759		53/387	47127324	2201,8601	1813	3588	5401	SO:0001819	synonymous_variant	5739	exon2			TCCGGTCACCAGC		CCDS12686.1	19q13.3	2012-08-08				ENSG00000160013		"""GPCR / Class A : Prostanoid receptors"""	9602	protein-coding gene	gene with protein product		600022				7759114	Standard	NM_000960		Approved	IP	uc002pex.3	P43119		ENST00000291294.2:c.159G>C	19.37:g.47127324C>G		Somatic	3	0		WXS	Illumina GAIIx	Phase_I	30	15	NM_000960	0	0	0	0	0		Silent	SNP	ENST00000291294.2	37	CCDS12686.1																																																																																			C|0.254;G|0.746		0.731	PTGIR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466581.1		
ALDH16A1	126133	hgsc.bcm.edu	37	19	49964883	49964883	+	Silent	SNP	C	C	T	rs142557990	byFrequency	TCGA-PK-A5HA-01A-11D-A29I-10	TCGA-PK-A5HA-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2bd7613-8a82-453c-b1d0-f0ad6fbc0766	688c5eb5-c374-4bfb-81d1-c0ba622386cf	g.chr19:49964883C>T	ENST00000293350.4	+	6	748	c.585C>T	c.(583-585)acC>acT	p.T195T	ALDH16A1_ENST00000433981.2_Silent_p.T30T|CTD-3148I10.9_ENST00000599536.1_5'Flank|ALDH16A1_ENST00000540132.1_Silent_p.T32T|ALDH16A1_ENST00000455361.2_Silent_p.T195T	NM_153329.3	NP_699160.2	Q8IZ83	A16A1_HUMAN	aldehyde dehydrogenase 16 family, member A1	195						extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	oxidoreductase activity, acting on the aldehyde or oxo group of donors, NAD or NADP as acceptor (GO:0016620)			cervix(2)|endometrium(3)|kidney(2)|large_intestine(3)|lung(5)|skin(2)|urinary_tract(3)	20		all_lung(116;5.39e-06)|Lung NSC(112;1.97e-05)|all_neural(266;0.0966)|Ovarian(192;0.15)		OV - Ovarian serous cystadenocarcinoma(262;0.00156)|GBM - Glioblastoma multiforme(486;0.0251)		CAGGCTGCACCGTGGTGGCCC	0.721													C|||	10	0.00199681	0.0068	0.0014	5008	,	,		10938	0.0		0.0	False		,,,				2504	0.0				p.T195T		.											.	ALDH16A1-91	0			c.C585T						.	C	,	10,4240		0,10,2115	5.0	6.0	6.0		585,585	-9.1	0.4	19	dbSNP_134	6	0,8196		0,0,4098	no	coding-synonymous,coding-synonymous	ALDH16A1	NM_001145396.1,NM_153329.3	,	0,10,6213	TT,TC,CC		0.0,0.2353,0.0803	,	195/752,195/803	49964883	10,12436	2125	4098	6223	SO:0001819	synonymous_variant	126133	exon6			CTGCACCGTGGTG	AY007096	CCDS12766.1, CCDS46141.1	19q13.33	2014-08-12			ENSG00000161618	ENSG00000161618		"""Aldehyde dehydrogenases"""	28114	protein-coding gene	gene with protein product		613358					Standard	NM_153329		Approved	MGC10204	uc002pnt.3	Q8IZ83	OTTHUMG00000183163	ENST00000293350.4:c.585C>T	19.37:g.49964883C>T		Somatic	1	0		WXS	Illumina GAIIx	Phase_I	35	15	NM_001145396	0	0	1	6	5	B4DLQ1|C9JBH6|Q86YF0|Q8IYL4|Q8TEI8	Silent	SNP	ENST00000293350.4	37	CCDS12766.1																																																																																			C|0.997;T|0.003		0.721	ALDH16A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465358.1	NM_153329	
IZUMO2	126123	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	19	50666417	50666417	+	Missense_Mutation	SNP	C	C	A			TCGA-PK-A5HA-01A-11D-A29I-10	TCGA-PK-A5HA-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2bd7613-8a82-453c-b1d0-f0ad6fbc0766	688c5eb5-c374-4bfb-81d1-c0ba622386cf	g.chr19:50666417C>A	ENST00000293405.3	-	1	35	c.35G>T	c.(34-36)gGc>gTc	p.G12V		NM_152358.2	NP_689571.2	Q6UXV1	IZUM2_HUMAN	IZUMO family member 2	12						integral component of membrane (GO:0016021)				cervix(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(2)|prostate(1)	7						GGCGCCCAAGCCCGAGAGCAG	0.716																																					p.G12V		.											.	IZUMO2-90	0			c.G35T						.						7.0	10.0	9.0					19																	50666417		1876	4021	5897	SO:0001583	missense	126123	exon1			CCCAAGCCCGAGA	AY358196	CCDS12792.2	19q13.33	2014-02-17	2010-07-29	2010-07-29	ENSG00000161652	ENSG00000161652		"""-"""	28518	protein-coding gene	gene with protein product			"""chromosome 19 open reading frame 41"""	C19orf41		19658160, 22957301	Standard	XM_006723007		Approved	MGC33947, SCRL	uc002prp.1	Q6UXV1	OTTHUMG00000074063	ENST00000293405.3:c.35G>T	19.37:g.50666417C>A	ENSP00000293405:p.Gly12Val	Somatic	46	0		WXS	Illumina GAIIx	Phase_I	117	10	NM_152358	0	0	0	0	0	Q5GRG3|Q5GRG4|Q6ZNM5|Q8NHR8	Missense_Mutation	SNP	ENST00000293405.3	37	CCDS12792.2	.	.	.	.	.	.	.	.	.	.	C	9.877	1.200440	0.22121	.	.	ENSG00000161652	ENST00000293405;ENST00000377000	T	0.49139	0.79	3.47	3.47	0.39725	.	0.282399	0.19850	N	0.104643	T	0.54854	0.1884	L	0.32530	0.975	0.48830	D	0.999715	D	0.89917	1.0	D	0.91635	0.999	T	0.56595	-0.7953	10	0.66056	D	0.02	.	10.7501	0.46205	0.0:1.0:0.0:0.0	.	12	Q6UXV1	IZUM2_HUMAN	V	12	ENSP00000293405:G12V	ENSP00000293405:G12V	G	-	2	0	IZUMO2	55358229	0.007000	0.16637	0.900000	0.35374	0.006000	0.05464	0.620000	0.24403	2.232000	0.73038	0.655000	0.94253	GGC	.		0.716	IZUMO2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000157232.1	NM_152358	
LILRB4	11006	bcgsc.ca	37	19	55175740	55175740	+	Silent	SNP	C	C	T	rs3745871	byFrequency	TCGA-PK-A5HA-01A-11D-A29I-10	TCGA-PK-A5HA-10A-01D-A29L-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2bd7613-8a82-453c-b1d0-f0ad6fbc0766	688c5eb5-c374-4bfb-81d1-c0ba622386cf	g.chr19:55175740C>T	ENST00000391736.1	+	6	774	c.459C>T	c.(457-459)ttC>ttT	p.F153F	LILRB4_ENST00000391733.3_Silent_p.F153F|LILRB4_ENST00000391734.3_Silent_p.F153F|LILRB4_ENST00000270452.2_Silent_p.F153F|LILRB4_ENST00000430952.2_Silent_p.F153F	NM_001278426.2|NM_001278428.2|NM_001278429.2|NM_001278430.2	NP_001265355.1|NP_001265357.1|NP_001265358.1|NP_001265359.1	Q8NHJ6	LIRB4_HUMAN	leukocyte immunoglobulin-like receptor, subfamily B (with TM and ITIM domains), member 4	153	Ig-like C2-type 2.				immune system process (GO:0002376)|negative regulation of osteoclast differentiation (GO:0045671)|signal transduction (GO:0007165)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	antigen binding (GO:0003823)|receptor activity (GO:0004872)			breast(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(20)|ovary(3)|skin(1)|stomach(2)|upper_aerodigestive_tract(3)	39				GBM - Glioblastoma multiforme(193;0.035)		TGGACACTTTCCTTCTGATCA	0.572													C|||	1997	0.398762	0.3048	0.4179	5008	,	,		20496	0.5804		0.3817	False		,,,				2504	0.3425				p.F153F		.											.	LILRB4-93	0			c.C459T						.	C	,	1448,2958	468.3+/-355.1	233,982,988	103.0	92.0	96.0		459,459	-1.3	0.0	19	dbSNP_107	96	3157,5443	482.1+/-370.8	594,1969,1737	no	coding-synonymous,coding-synonymous	LILRB4	NM_001081438.1,NM_006847.3	,	827,2951,2725	TT,TC,CC		36.7093,32.8643,35.4067	,	153/448,153/449	55175740	4605,8401	2203	4300	6503	SO:0001819	synonymous_variant	11006	exon4			CACTTTCCTTCTG	U82979	CCDS12902.1, CCDS42618.1	19q13.4	2013-01-11				ENSG00000186818		"""Leukocyte immunoglobulin-like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6608	protein-coding gene	gene with protein product		604821				9151699, 9079806	Standard	XM_005277050		Approved	LIR-5, ILT3, HM18, LIR5, CD85k	uc002qgp.3	Q8NHJ6		ENST00000391736.1:c.459C>T	19.37:g.55175740C>T		Somatic	180	2		WXS	Illumina GAIIx	Phase_I	172	6	NM_006847	0	0	6	6	0	A8MVL8|O15468|O75021|Q6FGQ9|Q8N1C7|Q8NHL5	Silent	SNP	ENST00000391736.1	37	CCDS12902.1																																																																																			C|0.609;N|0.000		0.572	LILRB4-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000141127.3		
TRAPPC12	51112	hgsc.bcm.edu	37	2	3391826	3391826	+	Silent	SNP	C	C	T	rs11127423	byFrequency	TCGA-PK-A5HA-01A-11D-A29I-10	TCGA-PK-A5HA-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2bd7613-8a82-453c-b1d0-f0ad6fbc0766	688c5eb5-c374-4bfb-81d1-c0ba622386cf	g.chr2:3391826C>T	ENST00000324266.5	+	2	627	c.432C>T	c.(430-432)gcC>gcT	p.A144A	TRAPPC12_ENST00000382110.2_Silent_p.A144A	NM_016030.5	NP_057114.5	Q8WVT3	TPC12_HUMAN	trafficking protein particle complex 12	144					vesicle-mediated transport (GO:0016192)												GCAGCGAAGCCGCGCGCCCGG	0.781													C|||	1528	0.305112	0.2352	0.1628	5008	,	,		6707	0.4048		0.2435	False		,,,				2504	0.4611				p.A144A		.											.	.	0			c.C432T						.						2.0	2.0	2.0					2																	3391826		1308	2977	4285	SO:0001819	synonymous_variant	51112	exon2			CGAAGCCGCGCGC	BC017475	CCDS1652.1	2p25.3	2013-01-10	2011-12-12	2011-12-12	ENSG00000171853	ENSG00000171853		"""Trafficking protein particle complex"", ""Tetratricopeptide (TTC) repeat domain containing"""	24284	protein-coding gene	gene with protein product		614139	"""tetratricopeptide repeat domain 15"""	TTC15		10810093, 21525244, 20562859	Standard	NM_016030		Approved	CGI-87, TTC-15	uc002qxm.1	Q8WVT3	OTTHUMG00000090328	ENST00000324266.5:c.432C>T	2.37:g.3391826C>T		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	5	4	NM_016030	0	0	0	4	4	B3KV01|D6W4Y2|Q8WVW1|Q9Y395	Silent	SNP	ENST00000324266.5	37	CCDS1652.1																																																																																			C|0.719;T|0.281		0.781	TRAPPC12-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206693.2	NM_016030	
CMPK2	129607	hgsc.bcm.edu	37	2	7005369	7005369	+	Silent	SNP	A	A	G	rs11678810	byFrequency	TCGA-PK-A5HA-01A-11D-A29I-10	TCGA-PK-A5HA-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2bd7613-8a82-453c-b1d0-f0ad6fbc0766	688c5eb5-c374-4bfb-81d1-c0ba622386cf	g.chr2:7005369A>G	ENST00000256722.5	-	1	458	c.459T>C	c.(457-459)tgT>tgC	p.C153C	CMPK2_ENST00000478738.1_Intron|CMPK2_ENST00000404168.1_Silent_p.C153C|CMPK2_ENST00000458098.1_Silent_p.C153C	NM_207315.3	NP_997198.2	Q5EBM0	CMPK2_HUMAN	cytidine monophosphate (UMP-CMP) kinase 2, mitochondrial	153					cellular response to lipopolysaccharide (GO:0071222)|dTDP biosynthetic process (GO:0006233)|dUDP biosynthetic process (GO:0006227)|nucleoside diphosphate phosphorylation (GO:0006165)|nucleoside triphosphate biosynthetic process (GO:0009142)	mitochondrion (GO:0005739)|nucleus (GO:0005634)	ATP binding (GO:0005524)|cytidylate kinase activity (GO:0004127)|nucleoside diphosphate kinase activity (GO:0004550)|thymidylate kinase activity (GO:0004798)|UMP kinase activity (GO:0033862)			large_intestine(1)|lung(13)|prostate(1)|upper_aerodigestive_tract(1)	16	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)					GTGCCTCCTGACAGGCGCCCA	0.741													G|||	4998	0.998003	0.9924	1.0	5008	,	,		10694	1.0		1.0	False		,,,				2504	1.0				p.C153C		.											.	CMPK2-68	0			c.T459C						.	G		3605,39		1783,39,0	3.0	4.0	4.0		459	1.6	0.0	2	dbSNP_120	4	7874,0		3937,0,0	no	coding-synonymous	CMPK2	NM_207315.2		5720,39,0	GG,GA,AA		0.0,1.0703,0.3386		153/450	7005369	11479,39	1822	3937	5759	SO:0001819	synonymous_variant	129607	exon1			CTCCTGACAGGCG		CCDS42648.1, CCDS58695.1, CCDS58696.1	2p25.2	2008-01-25			ENSG00000134326	ENSG00000134326	2.7.4.14		27015	protein-coding gene	gene with protein product	"""cytidylate kinase 2"""	611787				17999954	Standard	NM_207315		Approved	TYKi, UMP-CMPK2	uc002qyo.4	Q5EBM0	OTTHUMG00000151629	ENST00000256722.5:c.459T>C	2.37:g.7005369A>G		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	8	8	NM_001256478	0	0	0	0	0	A2RUB0|A5D8T2|B7ZM18|Q6ZRU2|Q96AL8	Silent	SNP	ENST00000256722.5	37	CCDS42648.1																																																																																			A|0.003;G|0.997		0.741	CMPK2-002	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323339.2	NM_207315	
GPR113	165082	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	26540927	26540927	+	Missense_Mutation	SNP	C	C	G			TCGA-PK-A5HA-01A-11D-A29I-10	TCGA-PK-A5HA-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2bd7613-8a82-453c-b1d0-f0ad6fbc0766	688c5eb5-c374-4bfb-81d1-c0ba622386cf	g.chr2:26540927C>G	ENST00000311519.1	-	2	242	c.243G>C	c.(241-243)caG>caC	p.Q81H	GPR113_ENST00000333478.6_Intron|GPR113_ENST00000459892.1_Intron|GPR113_ENST00000421160.2_Intron|GPR113_ENST00000541401.1_Intron	NM_001145168.1	NP_001138640.1	Q8IZF5	GP113_HUMAN	G protein-coupled receptor 113	81					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			NS(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(5)|ovary(4)|prostate(2)|skin(1)|stomach(1)|urinary_tract(1)	24	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					CCCACATTGTCTGGCCCTTGG	0.587																																					p.Q81H		.											.	GPR113-94	0			c.G243C						.						54.0	56.0	55.0					2																	26540927		692	1591	2283	SO:0001583	missense	165082	exon2			CATTGTCTGGCCC	AB083619	CCDS33159.2, CCDS46238.1, CCDS46239.1	2p24.1	2014-08-08			ENSG00000173567	ENSG00000173567		"""-"", ""GPCR / Class B : Orphans"""	18989	protein-coding gene	gene with protein product						12435584	Standard	NM_153835		Approved	hGPCR37, PGR23	uc002rhe.4	Q8IZF5	OTTHUMG00000150225	ENST00000311519.1:c.243G>C	2.37:g.26540927C>G	ENSP00000307831:p.Gln81His	Somatic	97	0		WXS	Illumina GAIIx	Phase_I	64	36	NM_001145168	0	0	0	0	0	B4DF15|E9PEV1|Q53TA5|Q6UXT7|Q6UXX3|Q86SL7|Q8IXD8|Q8TDT3	Missense_Mutation	SNP	ENST00000311519.1	37	CCDS46239.1	.	.	.	.	.	.	.	.	.	.	C	3.281	-0.146994	0.06627	.	.	ENSG00000173567	ENST00000311519	T	0.32272	1.46	0.645	0.645	0.17782	.	.	.	.	.	T	0.12050	0.0293	N	0.14661	0.345	0.09310	N	1	P	0.37101	0.582	B	0.20384	0.029	T	0.17077	-1.0381	8	0.22706	T	0.39	.	.	.	.	.	81	Q8IZF5	GP113_HUMAN	H	81	ENSP00000307831:Q81H	ENSP00000307831:Q81H	Q	-	3	2	GPR113	26394431	0.000000	0.05858	0.007000	0.13788	0.053000	0.15095	-1.315000	0.02713	0.621000	0.30232	0.313000	0.20887	CAG	.		0.587	GPR113-004	PUTATIVE	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000316892.1	NM_153835	
SPTBN1	6711	broad.mit.edu	37	2	54856389	54856389	+	Silent	SNP	G	G	A	rs374502234		TCGA-PK-A5HA-01A-11D-A29I-10	TCGA-PK-A5HA-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2bd7613-8a82-453c-b1d0-f0ad6fbc0766	688c5eb5-c374-4bfb-81d1-c0ba622386cf	g.chr2:54856389G>A	ENST00000356805.4	+	14	2399	c.2118G>A	c.(2116-2118)gcG>gcA	p.A706A	SPTBN1_ENST00000333896.5_Silent_p.A693A	NM_003128.2	NP_003119.2	Q01082	SPTB2_HUMAN	spectrin, beta, non-erythrocytic 1	706					actin filament capping (GO:0051693)|axon guidance (GO:0007411)|Golgi to plasma membrane protein transport (GO:0043001)|membrane assembly (GO:0071709)|mitotic cytokinesis (GO:0000281)|plasma membrane organization (GO:0007009)|protein targeting to plasma membrane (GO:0072661)	axolemma (GO:0030673)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleolus (GO:0005730)|protein complex (GO:0043234)|spectrin (GO:0008091)|spectrin-associated cytoskeleton (GO:0014731)	actin binding (GO:0003779)|ankyrin binding (GO:0030506)|phospholipid binding (GO:0005543)|poly(A) RNA binding (GO:0044822)|structural constituent of cytoskeleton (GO:0005200)			NS(1)|breast(8)|central_nervous_system(2)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(11)|lung(27)|ovary(4)|prostate(2)|skin(5)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	82			Lung(47;0.24)			ACATGATCGCGGAGGAGCACT	0.607																																					p.A706A		.											.	SPTBN1-140	0			c.G2118A						.						63.0	63.0	63.0					2																	54856389		2203	4300	6503	SO:0001819	synonymous_variant	6711	exon14			GATCGCGGAGGAG		CCDS33198.1, CCDS33199.1	2p21	2013-01-10			ENSG00000115306	ENSG00000115306		"""Pleckstrin homology (PH) domain containing"""	11275	protein-coding gene	gene with protein product		182790					Standard	NM_003128		Approved		uc002rxu.3	Q01082	OTTHUMG00000133746	ENST00000356805.4:c.2118G>A	2.37:g.54856389G>A		Somatic	146	0		WXS	Illumina GAIIx	Phase_I	94	3	NM_003128	0	0	6	6	0	B2RP63|O60837|Q16057|Q53R99|Q59ER3|Q8IX99	Silent	SNP	ENST00000356805.4	37	CCDS33198.1																																																																																			.		0.607	SPTBN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000258115.3		
TIA1	7072	broad.mit.edu	37	2	70443366	70443366	+	Silent	SNP	A	A	G	rs567115305		TCGA-PK-A5HA-01A-11D-A29I-10	TCGA-PK-A5HA-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2bd7613-8a82-453c-b1d0-f0ad6fbc0766	688c5eb5-c374-4bfb-81d1-c0ba622386cf	g.chr2:70443366A>G	ENST00000433529.2	-	10	948	c.738T>C	c.(736-738)ttT>ttC	p.F246F	TIA1_ENST00000415783.2_Silent_p.F235F|C2orf42_ENST00000470096.1_Intron|TIA1_ENST00000482876.1_5'UTR|TIA1_ENST00000445587.1_Silent_p.F235F|TIA1_ENST00000282574.4_Silent_p.F246F	NM_022173.2	NP_071505.2	P31483	TIA1_HUMAN	TIA1 cytotoxic granule-associated RNA binding protein	246	RRM 3. {ECO:0000255|PROSITE- ProRule:PRU00176}.				apoptotic process (GO:0006915)|negative regulation of cytokine biosynthetic process (GO:0042036)|negative regulation of translation (GO:0017148)|regulation of mRNA splicing, via spliceosome (GO:0048024)	cytoplasmic stress granule (GO:0010494)|nuclear stress granule (GO:0097165)	AU-rich element binding (GO:0017091)|nucleotide binding (GO:0000166)|poly(A) binding (GO:0008143)|poly(A) RNA binding (GO:0044822)			endometrium(3)|kidney(2)|large_intestine(2)|lung(8)|skin(1)|urinary_tract(1)	17						CTTTATCTGGAAAGACTCGAA	0.289													A|||	1	0.000199681	0.0	0.0	5008	,	,		16114	0.0		0.001	False		,,,				2504	0.0				p.F246F		.											.	TIA1-90	0			c.T738C						.						40.0	38.0	39.0					2																	70443366		2203	4300	6503	SO:0001819	synonymous_variant	7072	exon10			ATCTGGAAAGACT		CCDS1900.1, CCDS1901.1	2p13	2013-02-12	2001-11-28		ENSG00000116001	ENSG00000116001		"""RNA binding motif (RRM) containing"""	11802	protein-coding gene	gene with protein product	"""T-cell-restricted intracellular antigen-1"", ""nucleolysin TIA-1 isoform p40"""	603518	"""TIA1 cytotoxic granule-associated RNA-binding protein"""			8176212, 12486009	Standard	NM_022173		Approved		uc002sgj.4	P31483	OTTHUMG00000129644	ENST00000433529.2:c.738T>C	2.37:g.70443366A>G		Somatic	83	1		WXS	Illumina GAIIx	Phase_I	78	6	NM_022173	0	0	17	17	0	Q53SS9	Silent	SNP	ENST00000433529.2	37	CCDS1901.1																																																																																			.		0.289	TIA1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000251842.2	NM_022037	
LRRTM4	80059	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	77745739	77745739	+	Missense_Mutation	SNP	T	T	A	rs549481910		TCGA-PK-A5HA-01A-11D-A29I-10	TCGA-PK-A5HA-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2bd7613-8a82-453c-b1d0-f0ad6fbc0766	688c5eb5-c374-4bfb-81d1-c0ba622386cf	g.chr2:77745739T>A	ENST00000409093.1	-	3	1592	c.1256A>T	c.(1255-1257)cAt>cTt	p.H419L	LRRTM4_ENST00000409884.1_Missense_Mutation_p.H419L|LRRTM4_ENST00000409282.1_Missense_Mutation_p.H420L|LRRTM4_ENST00000409088.3_Missense_Mutation_p.H419L|LRRTM4_ENST00000409911.1_Missense_Mutation_p.H420L			Q86VH4	LRRT4_HUMAN	leucine rich repeat transmembrane neuronal 4	419					alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor clustering (GO:0097113)|regulation of presynaptic membrane organization (GO:1901629)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|cell junction (GO:0030054)|postsynaptic membrane (GO:0045211)				autonomic_ganglia(1)|endometrium(1)|large_intestine(6)|lung(49)|ovary(2)|pancreas(3)|prostate(1)|upper_aerodigestive_tract(1)	64				Colorectal(11;0.059)		AAATGAAACATGCTCATACTC	0.493																																					p.H419L		.											.	LRRTM4-94	0			c.A1256T						.						97.0	97.0	97.0					2																	77745739		1934	4137	6071	SO:0001583	missense	80059	exon3			GAAACATGCTCAT	AK122612	CCDS46346.1, CCDS46347.1, CCDS74530.1	2p12	2008-02-05			ENSG00000176204	ENSG00000176204			19411	protein-coding gene	gene with protein product		610870				12676565	Standard	NM_024993		Approved	FLJ12568	uc002snr.3	Q86VH4	OTTHUMG00000152842	ENST00000409093.1:c.1256A>T	2.37:g.77745739T>A	ENSP00000386357:p.His419Leu	Somatic	77	0		WXS	Illumina GAIIx	Phase_I	36	8	NM_024993	0	0	0	0	0	Q4FZ98|Q6UXJ7	Missense_Mutation	SNP	ENST00000409093.1	37	CCDS46346.1	.	.	.	.	.	.	.	.	.	.	T	5.504	0.277921	0.10403	.	.	ENSG00000176204	ENST00000409911;ENST00000409884;ENST00000409093;ENST00000409088;ENST00000409282	T;T;T;T;T	0.75704	-0.96;-0.96;-0.96;-0.96;-0.96	5.68	4.5	0.54988	.	0.231431	0.45361	D	0.000375	T	0.65207	0.2669	L	0.46157	1.445	0.45172	D	0.998185	B;B;B	0.18166	0.006;0.011;0.026	B;B;B	0.22152	0.017;0.038;0.029	T	0.56263	-0.8008	10	0.11794	T	0.64	.	11.7944	0.52090	0.0:0.0:0.1471:0.8529	.	420;419;419	Q4KMX1;Q86VH4-2;Q86VH4	.;.;LRRT4_HUMAN	L	420;419;419;419;420	ENSP00000387228:H420L;ENSP00000387297:H419L;ENSP00000386357:H419L;ENSP00000386236:H419L;ENSP00000386286:H420L	ENSP00000386236:H419L	H	-	2	0	LRRTM4	77599247	0.998000	0.40836	1.000000	0.80357	0.998000	0.95712	2.695000	0.47043	0.933000	0.37291	0.533000	0.62120	CAT	.		0.493	LRRTM4-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000328225.1	NM_024993	
SOWAHC	65124	hgsc.bcm.edu	37	2	110372192	110372192	+	Silent	SNP	A	A	G	rs6594048		TCGA-PK-A5HA-01A-11D-A29I-10	TCGA-PK-A5HA-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2bd7613-8a82-453c-b1d0-f0ad6fbc0766	688c5eb5-c374-4bfb-81d1-c0ba622386cf	g.chr2:110372192A>G	ENST00000356454.3	+	1	282	c.126A>G	c.(124-126)ctA>ctG	p.L42L	SEPT10_ENST00000397712.2_5'Flank|SEPT10_ENST00000397714.2_5'Flank|SEPT10_ENST00000334001.6_5'Flank|SEPT10_ENST00000415095.1_5'Flank|SEPT10_ENST00000437928.1_5'Flank|SEPT10_ENST00000356688.4_5'Flank|SEPT10_ENST00000545389.1_5'Flank	NM_023016.3	NP_075392.2	Q53LP3	SWAHC_HUMAN	sosondowah ankyrin repeat domain family member C	42																	GGGGCGCCCTAGGCGGCGAAC	0.771													G|||	5008	1.0	1.0	1.0	5008	,	,		6158	1.0		1.0	False		,,,				2504	1.0				p.L42L		.											.	.	0			c.A126G						.						1.0	2.0	2.0					2																	110372192		1239	2477	3716	SO:0001819	synonymous_variant	65124	exon1			CGCCCTAGGCGGC	AK023346	CCDS33270.1	2q13	2013-01-10	2012-01-12	2012-01-12	ENSG00000198142	ENSG00000198142		"""Ankyrin repeat domain containing"""	26149	protein-coding gene	gene with protein product			"""ankyrin repeat domain 57"""	C2orf26, ANKRD57		22234889	Standard	NM_023016		Approved	FLJ21870	uc002tfb.3	Q53LP3	OTTHUMG00000153219	ENST00000356454.3:c.126A>G	2.37:g.110372192A>G		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	10	10	NM_023016	0	0	0	2	2	Q8NE15|Q9H6U1	Silent	SNP	ENST00000356454.3	37	CCDS33270.1																																																																																			A|0.029;G|0.971		0.771	SOWAHC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000330168.1	NM_023016	
STK36	27148	bcgsc.ca	37	2	219563496	219563496	+	Silent	SNP	T	T	C	rs58753698	byFrequency	TCGA-PK-A5HA-01A-11D-A29I-10	TCGA-PK-A5HA-10A-01D-A29L-10	T	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2bd7613-8a82-453c-b1d0-f0ad6fbc0766	688c5eb5-c374-4bfb-81d1-c0ba622386cf	g.chr2:219563496T>C	ENST00000295709.3	+	26	3508	c.3229T>C	c.(3229-3231)Ttg>Ctg	p.L1077L	STK36_ENST00000440309.1_Silent_p.L1077L|STK36_ENST00000392105.3_Silent_p.L1056L|STK36_ENST00000392106.2_Silent_p.L1056L	NM_015690.4	NP_056505.2			serine/threonine kinase 36											biliary_tract(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(6)|lung(20)|ovary(4)|prostate(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)	52		Renal(207;0.0915)		Epithelial(149;9.65e-07)|all cancers(144;0.000174)|LUSC - Lung squamous cell carcinoma(224;0.00813)|Lung(261;0.00984)		CCAGCCACTGTTGACCTCCGA	0.552													C|||	299	0.0597045	0.2171	0.0159	5008	,	,		19406	0.0		0.001	False		,,,				2504	0.0				p.L1077L		.											.	STK36-1004	0			c.T3229C						.	C		889,3517	742.9+/-411.4	82,725,1396	177.0	148.0	158.0		3229	2.1	0.2	2	dbSNP_129	158	11,8589	818.8+/-406.8	0,11,4289	no	coding-synonymous	STK36	NM_015690.4		82,736,5685	CC,CT,TT		0.1279,20.177,6.9199		1077/1316	219563496	900,12106	2203	4300	6503	SO:0001819	synonymous_variant	27148	exon26			CCACTGTTGACCT	AB033104	CCDS2421.1, CCDS58750.1	2q35	2010-06-25	2010-06-25		ENSG00000163482	ENSG00000163482			17209	protein-coding gene	gene with protein product	"""fused homolog (Drosophila)"""	607652	"""serine/threonine kinase 36 (fused homolog, Drosophila)"""			10806483	Standard	NM_001243313		Approved	KIAA1278, FU	uc002viu.3	Q9NRP7	OTTHUMG00000133079	ENST00000295709.3:c.3229T>C	2.37:g.219563496T>C		Somatic	184	1		WXS	Illumina GAIIx	Phase_I	122	5	NM_015690	0	0	12	12	0		Silent	SNP	ENST00000295709.3	37	CCDS2421.1																																																																																			T|0.946;C|0.054		0.552	STK36-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256723.2		
GAL3ST2	64090	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	2	242742905	242742905	+	Missense_Mutation	SNP	C	C	T	rs143165919		TCGA-PK-A5HA-01A-11D-A29I-10	TCGA-PK-A5HA-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2bd7613-8a82-453c-b1d0-f0ad6fbc0766	688c5eb5-c374-4bfb-81d1-c0ba622386cf	g.chr2:242742905C>T	ENST00000192314.6	+	4	652	c.521C>T	c.(520-522)cCg>cTg	p.P174L	AC114730.5_ENST00000437438.1_RNA	NM_022134.2	NP_071417.2	Q9H3Q3	G3ST2_HUMAN	galactose-3-O-sulfotransferase 2	174					biosynthetic process (GO:0009058)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	galactosylceramide sulfotransferase activity (GO:0001733)|sulfotransferase activity (GO:0008146)			endometrium(1)|kidney(1)|large_intestine(1)|lung(9)|prostate(1)|skin(1)	14		all_cancers(19;1.09e-40)|all_epithelial(40;2.03e-18)|Breast(86;1.53e-05)|all_lung(227;0.00338)|Renal(207;0.00502)|Ovarian(221;0.00716)|Lung NSC(271;0.012)|Esophageal squamous(248;0.129)|Melanoma(123;0.144)|all_hematologic(139;0.158)|all_neural(83;0.243)|Hepatocellular(293;0.244)		Epithelial(32;4.59e-33)|all cancers(36;9.89e-31)|OV - Ovarian serous cystadenocarcinoma(60;7.89e-15)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;1.63e-06)|Lung(119;0.000152)|LUSC - Lung squamous cell carcinoma(224;0.00154)|Colorectal(34;0.0129)|COAD - Colon adenocarcinoma(134;0.0833)		CTGGCCTCGCCGCGGACGTTC	0.632																																					p.P174L		.											.	GAL3ST2-90	0			c.C521T						.	C	LEU/PRO	0,4402		0,0,2201	36.0	33.0	34.0		521	3.2	0.0	2	dbSNP_134	34	1,8595	1.2+/-3.3	0,1,4297	no	missense	GAL3ST2	NM_022134.2	98	0,1,6498	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging	174/399	242742905	1,12997	2201	4298	6499	SO:0001583	missense	64090	exon4			CCTCGCCGCGGAC	AB040610	CCDS33427.1	2q37.2	2014-05-19			ENSG00000154252	ENSG00000154252		"""Sulfotransferases, membrane-bound"""	24869	protein-coding gene	gene with protein product		608237				11029462	Standard	NM_022134		Approved	GP3ST	uc002wcj.1	Q9H3Q3	OTTHUMG00000151473	ENST00000192314.6:c.521C>T	2.37:g.242742905C>T	ENSP00000192314:p.Pro174Leu	Somatic	308	0		WXS	Illumina GAIIx	Phase_I	257	72	NM_022134	0	0	0	0	0	Q17RK0|Q57Z52	Missense_Mutation	SNP	ENST00000192314.6	37	CCDS33427.1	.	.	.	.	.	.	.	.	.	.	C	18.06	3.538553	0.65085	0.0	1.16E-4	ENSG00000154252	ENST00000192314	T	0.31247	1.5	4.11	3.21	0.36854	.	0.000000	0.56097	D	0.000031	T	0.60958	0.2309	H	0.95224	3.64	0.09310	N	0.999993	D	0.76494	0.999	D	0.69142	0.962	T	0.55945	-0.8060	10	0.59425	D	0.04	-63.9023	8.2052	0.31452	0.0:0.8168:0.0:0.1832	.	174	Q9H3Q3	G3ST2_HUMAN	L	174	ENSP00000192314:P174L	ENSP00000192314:P174L	P	+	2	0	GAL3ST2	242391578	0.935000	0.31712	0.010000	0.14722	0.193000	0.23685	3.990000	0.56965	2.000000	0.58554	0.455000	0.32223	CCG	C|1.000;T|0.000		0.632	GAL3ST2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000322792.1	NM_022134	
FAM209B	388799	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	20	55108589	55108589	+	Missense_Mutation	SNP	G	G	T	rs386815439		TCGA-PK-A5HA-01A-11D-A29I-10	TCGA-PK-A5HA-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2bd7613-8a82-453c-b1d0-f0ad6fbc0766	688c5eb5-c374-4bfb-81d1-c0ba622386cf	g.chr20:55108589G>T	ENST00000371325.1	+	1	288	c.192G>T	c.(190-192)ttG>ttT	p.L64F		NM_001013646.2	NP_001013668.2	Q5JX69	F209B_HUMAN	family with sequence similarity 209, member B	64						integral component of membrane (GO:0016021)|nucleus (GO:0005634)											TCTGGCTTTTGTTTGCTGTTG	0.483																																					p.L64F		.											.	.	0			c.G192T						.						168.0	146.0	153.0					20																	55108589		2203	4300	6503	SO:0001583	missense	388799	exon1			GCTTTTGTTTGCT	AL109806	CCDS33494.1	20q13.31	2011-11-24	2011-11-24	2011-11-24	ENSG00000213714	ENSG00000213714			16101	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 107"""	C20orf107			Standard	NM_001013646		Approved	dJ1153D9.4	uc002xxz.4	Q5JX69	OTTHUMG00000032800	ENST00000371325.1:c.192G>T	20.37:g.55108589G>T	ENSP00000360376:p.Leu64Phe	Somatic	251	2		WXS	Illumina GAIIx	Phase_I	264	46	NM_001013646	0	0	0	0	0	Q3KRB5	Missense_Mutation	SNP	ENST00000371325.1	37	CCDS33494.1	.	.	.	.	.	.	.	.	.	.	G	0.325	-0.959853	0.02267	.	.	ENSG00000213714	ENST00000371325	T	0.08896	3.04	2.8	-3.7	0.04437	.	1.580090	0.04046	N	0.303922	T	0.04137	0.0115	N	0.17474	0.49	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.38090	-0.9677	10	0.07990	T	0.79	0.1847	4.0099	0.09618	0.0:0.2385:0.3799:0.3817	.	64	Q5JX69	CT107_HUMAN	F	64	ENSP00000360376:L64F	ENSP00000360376:L64F	L	+	3	2	C20orf107	54541996	0.000000	0.05858	0.000000	0.03702	0.033000	0.12548	-1.684000	0.01932	-1.037000	0.03283	-0.782000	0.03352	TTG	.		0.483	FAM209B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079816.1		
SCARF2	91179	hgsc.bcm.edu	37	22	20780097	20780097	+	Silent	SNP	G	G	C	rs759609		TCGA-PK-A5HA-01A-11D-A29I-10	TCGA-PK-A5HA-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2bd7613-8a82-453c-b1d0-f0ad6fbc0766	688c5eb5-c374-4bfb-81d1-c0ba622386cf	g.chr22:20780097G>C	ENST00000266214.5	-	11	2285	c.2181C>G	c.(2179-2181)cgC>cgG	p.R727R	SCARF2_ENST00000405555.3_Silent_p.R722R	NM_153334.4	NP_699165.2	Q96GP6	SREC2_HUMAN	scavenger receptor class F, member 2	727	Pro-rich.				cell adhesion (GO:0007155)	focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)				breast(1)|central_nervous_system(1)|kidney(1)|large_intestine(1)|lung(3)|prostate(1)|skin(2)	10	Melanoma(16;0.000465)|Ovarian(15;0.00167)|Colorectal(54;0.0221)|all_neural(72;0.219)	Lung SC(17;0.0262)	LUSC - Lung squamous cell carcinoma(15;0.00102)|Lung(15;0.0173)			GCCCCGGGGGGCGCGGCGTTG	0.781																																					p.R727R		.											.	SCARF2-341	0			c.C2181G						.	C	,	3271,119		1585,101,9	5.0	5.0	5.0		2181,2166	-5.3	0.0	22	dbSNP_86	5	6306,190		3060,186,2	no	coding-synonymous,coding-synonymous	SCARF2	NM_153334.4,NM_182895.2	,	4645,287,11	CC,CG,GG		2.9249,3.5103,3.1256	,	727/871,722/866	20780097	9577,309	1695	3248	4943	SO:0001819	synonymous_variant	91179	exon11			CGGGGGGCGCGGC	AF522196	CCDS13779.1, CCDS46666.1	22q11.21	2011-10-10			ENSG00000244486	ENSG00000244486			19869	protein-coding gene	gene with protein product		613619				12154095	Standard	XM_006724364		Approved	SREC-II, SREC2, HUMZD58C02	uc002zsk.2	Q96GP6	OTTHUMG00000150779	ENST00000266214.5:c.2181C>G	22.37:g.20780097G>C		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	4	4	NM_153334	0	0	0	0	0	E5RFB8|Q58A83|Q8IXF3|Q9BW74	Silent	SNP	ENST00000266214.5	37	CCDS13779.1																																																																																			G|0.826;C|0.174		0.781	SCARF2-001	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000320047.1		
RFPL2	10739	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	22	32589228	32589228	+	Intron	SNP	G	G	T			TCGA-PK-A5HA-01A-11D-A29I-10	TCGA-PK-A5HA-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2bd7613-8a82-453c-b1d0-f0ad6fbc0766	688c5eb5-c374-4bfb-81d1-c0ba622386cf	g.chr22:32589228G>T	ENST00000400237.1	-	4	1201				RFPL2_ENST00000248980.4_Missense_Mutation_p.L12I|RFPL2_ENST00000400236.3_Intron|RFPL2_ENST00000489846.1_5'UTR|RFPL2_ENST00000248983.4_Intron			O75678	RFPL2_HUMAN	ret finger protein-like 2								zinc ion binding (GO:0008270)			endometrium(2)|kidney(4)|large_intestine(3)|lung(9)|ovary(1)|skin(2)	21						TGAGGTGAAAGCCTGTTAGTT	0.453																																					p.L12I		.											.	RFPL2-91	0			c.C34A						.						70.0	76.0	74.0					22																	32589228		1326	2306	3632	SO:0001627	intron_variant	10739	exon1			GTGAAAGCCTGTT	AJ010231	CCDS43009.1, CCDS46694.1, CCDS43009.2	22q12.3	2008-06-12				ENSG00000128253		"""RING-type (C3HC4) zinc fingers"""	9979	protein-coding gene	gene with protein product		605969				10508838	Standard	NM_001098527		Approved	RNF79	uc003amg.3	O75678		ENST00000400237.1:c.266-49C>A	22.37:g.32589228G>T		Somatic	227	0		WXS	Illumina GAIIx	Phase_I	107	61	NM_006605	0	0	0	0	0		Missense_Mutation	SNP	ENST00000400237.1	37	CCDS43009.2	.	.	.	.	.	.	.	.	.	.	G	0.762	-0.769020	0.02974	.	.	ENSG00000128253	ENST00000248980	T	0.52754	0.65	0.501	0.501	0.16925	.	.	.	.	.	T	0.19005	0.0456	N	0.08118	0	0.09310	N	1	P	0.37061	0.58	B	0.24394	0.053	T	0.10064	-1.0646	7	.	.	.	.	.	.	.	.	12	O75678-3	.	I	12	ENSP00000248980:L12I	.	L	-	1	0	RFPL2	30919228	0.370000	0.25047	0.006000	0.13384	0.020000	0.10135	1.067000	0.30616	0.512000	0.28257	0.305000	0.20034	CTT	.		0.453	RFPL2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000075262.2	NM_006605	
APOL2	23780	bcgsc.ca	37	22	36623920	36623920	+	Missense_Mutation	SNP	G	G	A	rs7285167	byFrequency	TCGA-PK-A5HA-01A-11D-A29I-10	TCGA-PK-A5HA-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2bd7613-8a82-453c-b1d0-f0ad6fbc0766	688c5eb5-c374-4bfb-81d1-c0ba622386cf	g.chr22:36623920G>A	ENST00000249066.6	-	6	1020	c.544C>T	c.(544-546)Cgc>Tgc	p.R182C	APOL2_ENST00000451256.2_Missense_Mutation_p.R294C|APOL2_ENST00000358502.5_Missense_Mutation_p.R182C	NM_145637.1	NP_663612.1	Q9BQE5	APOL2_HUMAN	apolipoprotein L, 2	182			R -> C (in dbSNP:rs7285167).		acute-phase response (GO:0006953)|cholesterol metabolic process (GO:0008203)|lipid metabolic process (GO:0006629)|lipid transport (GO:0006869)|lipoprotein metabolic process (GO:0042157)|maternal process involved in female pregnancy (GO:0060135)|multicellular organismal development (GO:0007275)	endoplasmic reticulum membrane (GO:0005789)|extracellular region (GO:0005576)|membrane (GO:0016020)	high-density lipoprotein particle binding (GO:0008035)|lipid binding (GO:0008289)|receptor binding (GO:0005102)			breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(2)|lung(1)|skin(1)|urinary_tract(2)	9						TCCAAGTTGCGGGCTTGGGCT	0.522													N|||	757	0.151158	0.3381	0.0576	5008	,	,		20870	0.0367		0.0865	False		,,,				2504	0.1493				p.R182C		.											.	APOL2-90	0			c.C544T						.	G	CYS/ARG,CYS/ARG	1172,2976		145,882,1047	74.0	76.0	76.0		544,544	-0.0	0.0	22	dbSNP_116	76	650,7788		28,594,3597	yes	missense,missense	APOL2	NM_030882.2,NM_145637.1	180,180	173,1476,4644	AA,AG,GG		7.7032,28.2546,14.4764	probably-damaging,probably-damaging	182/338,182/338	36623920	1822,10764	2074	4219	6293	SO:0001583	missense	23780	exon5			AGTTGCGGGCTTG	AF324224	CCDS43014.1	22q12.3	2013-09-20			ENSG00000128335	ENSG00000128335		"""Apolipoproteins"""	619	protein-coding gene	gene with protein product	"""apolipoprotein L-II"""	607252				10591208, 11374903	Standard	NM_145637		Approved	APOL-II	uc003apa.3	Q9BQE5	OTTHUMG00000150634	ENST00000249066.6:c.544C>T	22.37:g.36623920G>A	ENSP00000249066:p.Arg182Cys	Somatic	74	0		WXS	Illumina GAIIx	Phase_I	67	4	NM_030882	0	0	24	24	0	B0QYK7|O95915|Q59GW9|Q5TH96|Q969T6|Q9BT28|Q9UGT1|Q9UH10	Missense_Mutation	SNP	ENST00000249066.6	37	CCDS43014.1	242	0.1108058608058608	137	0.2784552845528455	23	0.06353591160220995	15	0.026223776223776224	67	0.08839050131926121	G	9.300	1.052840	0.19907	0.282546	0.077032	ENSG00000128335	ENST00000358502;ENST00000249066;ENST00000451256	T;T;T	0.03635	3.86;3.86;3.86	3.66	-0.00713	0.14010	.	0.766380	0.12807	N	0.437490	T	0.00012	0.0000	L	0.58101	1.795	0.80722	P	0.0	B;B	0.15141	0.012;0.012	B;B	0.10450	0.005;0.005	T	0.41034	-0.9531	9	0.59425	D	0.04	.	4.7381	0.12999	0.0:0.1125:0.3888:0.4987	rs7285167;rs52814068;rs56937731;rs7285167	294;182	B4E1T5;Q9BQE5	.;APOL2_HUMAN	C	182;182;294	ENSP00000351292:R182C;ENSP00000249066:R182C;ENSP00000403153:R294C	ENSP00000249066:R182C	R	-	1	0	APOL2	34953866	0.000000	0.05858	0.007000	0.13788	0.001000	0.01503	-0.067000	0.11579	-0.179000	0.10654	-0.718000	0.03613	CGC	G|0.885;A|0.115		0.522	APOL2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000319279.1	NM_145637	
TRIOBP	11078	hgsc.bcm.edu	37	22	38122462	38122462	+	Missense_Mutation	SNP	A	A	G	rs739138	byFrequency	TCGA-PK-A5HA-01A-11D-A29I-10	TCGA-PK-A5HA-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2bd7613-8a82-453c-b1d0-f0ad6fbc0766	688c5eb5-c374-4bfb-81d1-c0ba622386cf	g.chr22:38122462A>G	ENST00000406386.3	+	7	4154	c.3899A>G	c.(3898-3900)cAc>cGc	p.H1300R		NM_001039141.2	NP_001034230.1	Q9H2D6	TARA_HUMAN	TRIO and F-actin binding protein	1300			H -> R (in dbSNP:rs739138).		actin modification (GO:0030047)|barbed-end actin filament capping (GO:0051016)|mitotic nuclear division (GO:0007067)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|nucleus (GO:0005634)	actin filament binding (GO:0051015)|GTP-Rho binding (GO:0017049)|myosin II binding (GO:0045159)|ubiquitin protein ligase binding (GO:0031625)			central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(3)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	12	Melanoma(58;0.0574)					GGCCGCACCCACAGCCCTGGC	0.741													G|||	3010	0.601038	0.1944	0.5836	5008	,	,		13399	0.8859		0.7157	False		,,,				2504	0.7515				p.H1300R		.											.	TRIOBP-136	0			c.A3899G						.	G	ARG/HIS	1221,2235		265,691,772	4.0	6.0	5.0		3899	3.9	1.0	22	dbSNP_86	5	5694,1808		2238,1218,295	yes	missense	TRIOBP	NM_001039141.2	29	2503,1909,1067	GG,GA,AA		24.1002,35.3299,36.8954	benign	1300/2366	38122462	6915,4043	1728	3751	5479	SO:0001583	missense	11078	exon7			GCACCCACAGCCC	AB051449	CCDS33644.1, CCDS43015.1, CCDS43016.1	22q13.1	2014-06-03			ENSG00000100106	ENSG00000100106		"""Pleckstrin homology (PH) domain containing"""	17009	protein-coding gene	gene with protein product		609761		DFNB28		11148140, 16385457, 16385458	Standard	NM_001039141		Approved	HRIHFB2122, KIAA1662, Tara, TAP68	uc003atr.3	Q9H2D6	OTTHUMG00000150657	ENST00000406386.3:c.3899A>G	22.37:g.38122462A>G	ENSP00000384312:p.His1300Arg	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	21	20	NM_001039141	0	0	0	0	0	B1AHD4|B1AHD7|F2Z2W0|F8W6V6|O94797|Q2PZW8|Q2Q3Z9|Q2Q400|Q5R3M6|Q96DW1|Q9BT77|Q9BTL7|Q9BY98|Q9Y3L4	Missense_Mutation	SNP	ENST00000406386.3	37	CCDS43015.1	1409	0.6451465201465202	110	0.22357723577235772	222	0.6132596685082873	531	0.9283216783216783	546	0.7203166226912929	G	12.86	2.065195	0.36470	0.353299	0.758998	ENSG00000100106	ENST00000406386;ENST00000417174	T	0.11063	2.81	4.93	3.9	0.45041	.	.	.	.	.	T	0.00012	0.0000	N	0.01576	-0.805	0.09310	P	0.999999999370294	B	0.02656	0.0	B	0.01281	0.0	T	0.29671	-1.0004	8	0.02654	T	1	.	4.383	0.11304	0.2555:0.0:0.5874:0.1571	rs739138	1300	Q9H2D6	TARA_HUMAN	R	1300	ENSP00000384312:H1300R	ENSP00000384312:H1300R	H	+	2	0	TRIOBP	36452408	1.000000	0.71417	1.000000	0.80357	0.841000	0.47740	1.338000	0.33873	0.503000	0.28060	-0.366000	0.07423	CAC	A|0.354;G|0.646		0.741	TRIOBP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000319439.2		
ANKRD54	129138	broad.mit.edu	37	22	38228644	38228644	+	Splice_Site	SNP	C	C	T	rs143173080	byFrequency	TCGA-PK-A5HA-01A-11D-A29I-10	TCGA-PK-A5HA-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2bd7613-8a82-453c-b1d0-f0ad6fbc0766	688c5eb5-c374-4bfb-81d1-c0ba622386cf	g.chr22:38228644C>T	ENST00000215941.4	-	7	1020	c.828G>A	c.(826-828)caG>caA	p.Q276Q	ANKRD54_ENST00000411961.2_Splice_Site_p.Q260Q|ANKRD54_ENST00000498417.1_5'UTR|ANKRD54_ENST00000406423.1_Splice_Site_p.Q156Q|ANKRD54_ENST00000609454.1_Splice_Site_p.Q83Q	NM_138797.2	NP_620152.1	Q6NXT1	ANR54_HUMAN	ankyrin repeat domain 54	276					nucleocytoplasmic transport (GO:0006913)|positive regulation of erythrocyte differentiation (GO:0045648)|regulation of intracellular signal transduction (GO:1902531)	cytoplasm (GO:0005737)|midbody (GO:0030496)|nucleus (GO:0005634)	protein kinase regulator activity (GO:0019887)			lung(1)	1	Melanoma(58;0.045)					TGCAGCTCACCTGCTCTTTGG	0.612													C|||	14	0.00279553	0.0	0.0086	5008	,	,		17697	0.0		0.004	False		,,,				2504	0.0041				p.Q276Q		.											.	ANKRD54-68	0			c.G828A						.	C		3,4403	6.2+/-15.9	0,3,2200	55.0	52.0	53.0		828	5.6	1.0	22	dbSNP_134	53	48,8552	29.0+/-79.6	0,48,4252	yes	coding-synonymous-near-splice	ANKRD54	NM_138797.2		0,51,6452	TT,TC,CC		0.5581,0.0681,0.3921		276/301	38228644	51,12955	2203	4300	6503	SO:0001630	splice_region_variant	129138	exon7			GCTCACCTGCTCT	BC014641	CCDS13959.1	22q13.1	2013-01-10			ENSG00000100124	ENSG00000100124		"""Ankyrin repeat domain containing"""	25185	protein-coding gene	gene with protein product		613383				15461802	Standard	NM_138797		Approved	LIAR	uc003auc.3	Q6NXT1	OTTHUMG00000150663	ENST00000215941.4:c.828+1G>A	22.37:g.38228644C>T		Somatic	68	1		WXS	Illumina GAIIx	Phase_I	50	3	NM_138797	0	0	0	0	0	Q6ZSB1|Q9UGV1	Silent	SNP	ENST00000215941.4	37	CCDS13959.1	6	0.0027472527472527475	0	0.0	3	0.008287292817679558	0	0.0	3	0.00395778364116095	C	10.84	1.462933	0.26248	6.81E-4	0.005581	ENSG00000100124	ENST00000458278	.	.	.	5.59	5.59	0.84812	.	.	.	.	.	T	0.70029	0.3177	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.71928	-0.4444	4	.	.	.	-9.4381	19.5996	0.95554	0.0:1.0:0.0:0.0	.	.	.	.	K	192	.	.	R	-	2	0	ANKRD54	36558590	1.000000	0.71417	1.000000	0.80357	0.197000	0.23852	6.761000	0.74945	2.635000	0.89317	0.650000	0.86243	AGG	C|0.998;T|0.002		0.612	ANKRD54-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319490.1	NM_138797	Silent
SGSM3	27352	ucsc.edu	37	22	40802191	40802191	+	Silent	SNP	G	G	T			TCGA-PK-A5HA-01A-11D-A29I-10	TCGA-PK-A5HA-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2bd7613-8a82-453c-b1d0-f0ad6fbc0766	688c5eb5-c374-4bfb-81d1-c0ba622386cf	g.chr22:40802191G>T	ENST00000248929.9	+	9	1113	c.924G>T	c.(922-924)gtG>gtT	p.V308V	SGSM3_ENST00000454798.2_Silent_p.V241V	NM_015705.4	NP_056520.2			small G protein signaling modulator 3											cervix(1)|endometrium(4)|large_intestine(1)|lung(4)|ovary(2)|prostate(1)|skin(6)	19						GCTCCCGGGTGCTGTTCCAGC	0.627																																					p.V308V		.											.	SGSM3-494	0			c.G924T						.						73.0	64.0	67.0					22																	40802191		2203	4300	6503	SO:0001819	synonymous_variant	27352	exon9			CCGGGTGCTGTTC	AL022238	CCDS14002.1	22q13.1-q13.2	2013-07-09	2007-08-14	2007-08-14	ENSG00000100359	ENSG00000100359		"""Small G protein signaling modulators"""	25228	protein-coding gene	gene with protein product	"""RUN and SH3 containing 3"""	610440	"""RUN and TBC1 domain containing 3"""	RUTBC3		11214971, 17509819	Standard	XM_005261572		Approved	DJ1042K10.2, RUSC3, RabGAP-5, RABGAP5	uc003ayu.1	Q96HU1	OTTHUMG00000151141	ENST00000248929.9:c.924G>T	22.37:g.40802191G>T		Somatic	92	9		WXS	Illumina GAIIx	Phase_I	83	12	NM_015705	0	0	16	17	1		Silent	SNP	ENST00000248929.9	37	CCDS14002.1																																																																																			.		0.627	SGSM3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321504.2	NM_015705	
NUP210	23225	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	13368936	13368936	+	Splice_Site	SNP	C	C	G			TCGA-PK-A5HA-01A-11D-A29I-10	TCGA-PK-A5HA-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2bd7613-8a82-453c-b1d0-f0ad6fbc0766	688c5eb5-c374-4bfb-81d1-c0ba622386cf	g.chr3:13368936C>G	ENST00000254508.5	-	32	4370	c.4288G>C	c.(4288-4290)Gac>Cac	p.D1430H		NM_024923.2	NP_079199.2	Q8TEM1	PO210_HUMAN	nucleoporin 210kDa	1430			D -> E (in dbSNP:rs13081937).		carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|protein transport (GO:0015031)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)|nuclear envelope (GO:0005635)|nuclear pore (GO:0005643)				NS(1)|biliary_tract(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(9)|kidney(2)|large_intestine(10)|liver(1)|lung(16)|ovary(7)|pancreas(1)|prostate(1)|skin(8)|upper_aerodigestive_tract(3)|urinary_tract(2)	66	all_neural(104;0.187)					ACAAAGTCGTCTCTAGGCACA	0.567																																					p.D1430H		.											.	NUP210-256	0			c.G4288C						.						41.0	29.0	33.0					3																	13368936		2203	4300	6503	SO:0001630	splice_region_variant	23225	exon32			AGTCGTCTCTAGG	AB020713	CCDS33704.1	3p25	2008-02-05			ENSG00000132182	ENSG00000132182			30052	protein-coding gene	gene with protein product		607703				2184032, 7504063	Standard	NM_024923		Approved	GP210, POM210, FLJ22389, KIAA0906	uc003bxv.1	Q8TEM1	OTTHUMG00000157268	ENST00000254508.5:c.4287-1G>C	3.37:g.13368936C>G		Somatic	219	0		WXS	Illumina GAIIx	Phase_I	216	66	NM_024923	0	0	0	0	0	A6NN56|O94980|Q6NXG6|Q8NBJ1|Q9H6C8|Q9UFP3	Missense_Mutation	SNP	ENST00000254508.5	37	CCDS33704.1	.	.	.	.	.	.	.	.	.	.	C	17.58	3.424177	0.62733	.	.	ENSG00000132182	ENST00000254508	T	0.05199	3.48	5.74	5.74	0.90152	.	0.000000	0.85682	D	0.000000	T	0.29783	0.0744	M	0.80616	2.505	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.00589	-1.1656	10	0.49607	T	0.09	.	19.9197	0.97082	0.0:1.0:0.0:0.0	.	1430	Q8TEM1	PO210_HUMAN	H	1430	ENSP00000254508:D1430H	ENSP00000254508:D1430H	D	-	1	0	NUP210	13343936	1.000000	0.71417	0.944000	0.38274	0.070000	0.16714	7.818000	0.86416	2.702000	0.92279	0.655000	0.94253	GAC	.		0.567	NUP210-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340085.1	NM_024923	Missense_Mutation
ACVR2B	93	broad.mit.edu	37	3	38519900	38519900	+	Missense_Mutation	SNP	G	G	T			TCGA-PK-A5HA-01A-11D-A29I-10	TCGA-PK-A5HA-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2bd7613-8a82-453c-b1d0-f0ad6fbc0766	688c5eb5-c374-4bfb-81d1-c0ba622386cf	g.chr3:38519900G>T	ENST00000352511.4	+	5	1029	c.557G>T	c.(556-558)gGc>gTc	p.G186V		NM_001106.3	NP_001097.2	Q13705	AVR2B_HUMAN	activin A receptor, type IIB	186					activation of protein kinase activity (GO:0032147)|activin receptor signaling pathway (GO:0032924)|anterior/posterior pattern specification (GO:0009952)|artery development (GO:0060840)|blood vessel remodeling (GO:0001974)|BMP signaling pathway (GO:0030509)|determination of left/right symmetry (GO:0007368)|embryonic foregut morphogenesis (GO:0048617)|gastrulation with mouth forming second (GO:0001702)|heart development (GO:0007507)|insulin secretion (GO:0030073)|kidney development (GO:0001822)|lung development (GO:0030324)|lymphangiogenesis (GO:0001946)|lymphatic endothelial cell differentiation (GO:0060836)|mesoderm development (GO:0007498)|odontogenesis of dentin-containing tooth (GO:0042475)|organ growth (GO:0035265)|palate development (GO:0060021)|pancreas development (GO:0031016)|positive regulation of activin receptor signaling pathway (GO:0032927)|positive regulation of bone mineralization (GO:0030501)|positive regulation of osteoblast differentiation (GO:0045669)|post-embryonic development (GO:0009791)|regulation of transcription, DNA-templated (GO:0006355)|response to glucose (GO:0009749)|retina vasculature development in camera-type eye (GO:0061298)|signal transduction (GO:0007165)|skeletal system morphogenesis (GO:0048705)|transmembrane receptor protein serine/threonine kinase signaling pathway (GO:0007178)|venous blood vessel development (GO:0060841)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	ATP binding (GO:0005524)|growth factor binding (GO:0019838)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|receptor signaling protein serine/threonine kinase activity (GO:0004702)|transforming growth factor beta-activated receptor activity (GO:0005024)			lung(1)	1	Medulloblastoma(35;0.163)			KIRC - Kidney renal clear cell carcinoma(284;0.0565)|Kidney(284;0.071)		CCTCTGGTGGGCCTGAAGCCA	0.602																																					p.G186V		.											.	ACVR2B-942	0			c.G557T						.						40.0	39.0	39.0					3																	38519900		2203	4300	6503	SO:0001583	missense	93	exon5			TGGTGGGCCTGAA	X77533	CCDS2679.1	3p22	2006-11-06			ENSG00000114739	ENSG00000114739			174	protein-coding gene	gene with protein product		602730				8161782, 9621519	Standard	NM_001106		Approved	ActR-IIB	uc003cif.3	Q13705	OTTHUMG00000131291	ENST00000352511.4:c.557G>T	3.37:g.38519900G>T	ENSP00000340361:p.Gly186Val	Somatic	75	2		WXS	Illumina GAIIx	Phase_I	68	5	NM_001106	0	0	2	2	0	Q4VAV0	Missense_Mutation	SNP	ENST00000352511.4	37	CCDS2679.1	.	.	.	.	.	.	.	.	.	.	G	13.75	2.329499	0.41197	.	.	ENSG00000114739	ENST00000352511	D	0.92805	-3.11	4.23	4.23	0.50019	Protein kinase-like domain (1);	0.113198	0.64402	D	0.000013	D	0.90974	0.7162	M	0.72479	2.2	0.80722	D	1	B	0.20261	0.043	B	0.21546	0.035	D	0.88453	0.3050	10	0.27082	T	0.32	.	16.7733	0.85544	0.0:0.0:1.0:0.0	.	186	Q13705	AVR2B_HUMAN	V	186	ENSP00000340361:G186V	ENSP00000340361:G186V	G	+	2	0	ACVR2B	38494904	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	6.451000	0.73481	2.195000	0.70347	0.563000	0.77884	GGC	.		0.602	ACVR2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254059.3	NM_001106	
CDCP1	64866	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	45132893	45132893	+	Missense_Mutation	SNP	T	T	A			TCGA-PK-A5HA-01A-11D-A29I-10	TCGA-PK-A5HA-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2bd7613-8a82-453c-b1d0-f0ad6fbc0766	688c5eb5-c374-4bfb-81d1-c0ba622386cf	g.chr3:45132893T>A	ENST00000296129.1	-	7	1899	c.1765A>T	c.(1765-1767)Act>Tct	p.T589S		NM_022842.3	NP_073753.3	Q9H5V8	CDCP1_HUMAN	CUB domain containing protein 1	589						extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(12)|ovary(1)|skin(4)|urinary_tract(1)	29				BRCA - Breast invasive adenocarcinoma(193;0.00928)|KIRC - Kidney renal clear cell carcinoma(197;0.0519)|Kidney(197;0.0651)		TTAAAGAAAGTCAGGCAGGCC	0.627																																					p.T589S		.											.	CDCP1-117	0			c.A1765T						.						31.0	31.0	31.0					3																	45132893		2203	4300	6503	SO:0001583	missense	64866	exon7			AGAAAGTCAGGCA	AF468010	CCDS2727.1, CCDS46812.1	3p21.3	2006-03-28			ENSG00000163814	ENSG00000163814		"""CD molecules"""	24357	protein-coding gene	gene with protein product		611735				11466621	Standard	NM_022842		Approved	CD318, SIMA135	uc003com.3	Q9H5V8	OTTHUMG00000133090	ENST00000296129.1:c.1765A>T	3.37:g.45132893T>A	ENSP00000296129:p.Thr589Ser	Somatic	110	0		WXS	Illumina GAIIx	Phase_I	119	44	NM_022842	0	0	1	1	0	Q49UB4|Q6NT71|Q6U9Y2|Q8WU91|Q96QU7|Q9H676|Q9H8C2	Missense_Mutation	SNP	ENST00000296129.1	37	CCDS2727.1	.	.	.	.	.	.	.	.	.	.	T	16.70	3.196932	0.58126	.	.	ENSG00000163814	ENST00000296129	T	0.23950	1.88	5.84	4.7	0.59300	.	0.498207	0.23591	N	0.046549	T	0.26011	0.0634	M	0.63428	1.95	0.80722	D	1	P	0.46859	0.885	P	0.45753	0.492	T	0.04467	-1.0949	10	0.12766	T	0.61	.	6.9782	0.24688	0.0:0.2082:0.0:0.7918	.	589	Q9H5V8	CDCP1_HUMAN	S	589	ENSP00000296129:T589S	ENSP00000296129:T589S	T	-	1	0	CDCP1	45107897	0.887000	0.30362	1.000000	0.80357	0.767000	0.43475	1.137000	0.31479	2.233000	0.73108	0.454000	0.30748	ACT	.		0.627	CDCP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256748.3	NM_022842	
RHOA	387	broad.mit.edu	37	3	49395674	49395679	+	IGR	DEL	GCCGCC	GCCGCC	-	rs71077799|rs56041243|rs139760138|rs17838762	byFrequency	TCGA-PK-A5HA-01A-11D-A29I-10	TCGA-PK-A5HA-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2bd7613-8a82-453c-b1d0-f0ad6fbc0766	688c5eb5-c374-4bfb-81d1-c0ba622386cf	g.chr3:49395674_49395679delGCCGCC	ENST00000418115.1	-	0	2031				GPX1_ENST00000419349.1_In_Frame_Del_p.11_13AAA>A|GPX1_ENST00000419783.1_In_Frame_Del_p.11_13AAA>A|GPX1_ENST00000496791.1_5'UTR	NM_001664.2	NP_001655.1	P61586	RHOA_HUMAN	ras homolog family member A						actin cytoskeleton organization (GO:0030036)|androgen receptor signaling pathway (GO:0030521)|apical junction assembly (GO:0043297)|apolipoprotein A-I-mediated signaling pathway (GO:0038027)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell-matrix adhesion (GO:0007160)|cerebral cortex cell migration (GO:0021795)|cleavage furrow formation (GO:0036089)|forebrain radial glial cell differentiation (GO:0021861)|negative chemotaxis (GO:0050919)|negative regulation of axonogenesis (GO:0050771)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of intracellular steroid hormone receptor signaling pathway (GO:0033144)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of neuron differentiation (GO:0045665)|neurotrophin TRK receptor signaling pathway (GO:0048011)|ossification involved in bone maturation (GO:0043931)|phosphatidylinositol-mediated signaling (GO:0048015)|platelet activation (GO:0030168)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of axonogenesis (GO:0050772)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell growth (GO:0030307)|positive regulation of cell migration (GO:0030335)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of cytokinesis (GO:0032467)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of NF-kappaB import into nucleus (GO:0042346)|positive regulation of podosome assembly (GO:0071803)|positive regulation of smooth muscle contraction (GO:0045987)|positive regulation of stress fiber assembly (GO:0051496)|positive regulation of translation (GO:0045727)|positive regulation of vasoconstriction (GO:0045907)|regulation of axonogenesis (GO:0050770)|regulation of calcium ion transport (GO:0051924)|regulation of cell migration (GO:0030334)|regulation of dendrite development (GO:0050773)|regulation of neural precursor cell proliferation (GO:2000177)|regulation of osteoblast proliferation (GO:0033688)|regulation of small GTPase mediated signal transduction (GO:0051056)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to amino acid (GO:0043200)|response to drug (GO:0042493)|response to ethanol (GO:0045471)|response to glucocorticoid (GO:0051384)|response to glucose (GO:0009749)|response to hypoxia (GO:0001666)|response to mechanical stimulus (GO:0009612)|Rho protein signal transduction (GO:0007266)|skeletal muscle tissue development (GO:0007519)|small GTPase mediated signal transduction (GO:0007264)|spindle assembly involved in mitosis (GO:0090307)|stress fiber assembly (GO:0043149)|stress-activated protein kinase signaling cascade (GO:0031098)|substantia nigra development (GO:0021762)|trabecula morphogenesis (GO:0061383)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	apical junction complex (GO:0043296)|axon (GO:0030424)|cell cortex (GO:0005938)|cell junction (GO:0030054)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)	GDP binding (GO:0019003)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|myosin binding (GO:0017022)	p.A12_A13delAA(1)		cervix(1)|kidney(1)|large_intestine(5)|lung(1)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	12				BRCA - Breast invasive adenocarcinoma(193;8.58e-05)|Kidney(197;0.0023)|KIRC - Kidney renal clear cell carcinoma(197;0.00258)		CACCGACTGGgccgccgccgccgccg	0.694																																					.		.											.	GPX1-68	1	Deletion - In frame(1)	breast(1)	.						.		,	23,168,347		11,0,1,79,10,168					,	-0.2	0.0		dbSNP_123	2	116,720,1030		46,10,14,333,44,486	no	codingComplex,codingComplex	GPX1	NM_201397.1,NM_000581.2	,	57,10,15,412,54,654	A1A1,A1A2,A1R,A2A2,A2R,RR		44.8017,35.5019,42.7205	,	,		139,888,1377				SO:0001628	intergenic_variant	2876	.			GACTGGGCCGCCG	BC001360	CCDS2795.1	3p21.3	2012-02-27	2012-02-27	2004-03-23	ENSG00000067560	ENSG00000067560			667	protein-coding gene	gene with protein product		165390	"""ras homolog gene family, member A"""	ARH12, ARHA		9605859	Standard	NM_001664		Approved	RhoA, Rho12, RHOH12	uc003cwu.3	P61586	OTTHUMG00000156838		3.37:g.49395680_49395685delGCCGCC		Somatic	12	0		WXS	Illumina GAIIx	Phase_I	74	37	.	0	0	0	0	0	P06749|Q53HM4|Q5U024|Q9UDJ0|Q9UEJ4	In_Frame_Del	DEL	ENST00000418115.1	37	CCDS2795.1																																																																																			.		0.694	RHOA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346157.3	NM_001664	
STAB1	23166	ucsc.edu	37	3	52546452	52546452	+	Splice_Site	SNP	G	G	T			TCGA-PK-A5HA-01A-11D-A29I-10	TCGA-PK-A5HA-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2bd7613-8a82-453c-b1d0-f0ad6fbc0766	688c5eb5-c374-4bfb-81d1-c0ba622386cf	g.chr3:52546452G>T	ENST00000321725.6	+	27	3055	c.2979G>T	c.(2977-2979)cgG>cgT	p.R993R		NM_015136.2	NP_055951.2	Q9NY15	STAB1_HUMAN	stabilin 1	993	FAS1 3. {ECO:0000255|PROSITE- ProRule:PRU00082, ECO:0000305}.				cell adhesion (GO:0007155)|cell-cell signaling (GO:0007267)|defense response to bacterium (GO:0042742)|inflammatory response (GO:0006954)|negative regulation of angiogenesis (GO:0016525)|oxidation-reduction process (GO:0055114)|receptor-mediated endocytosis (GO:0006898)	endocytic vesicle membrane (GO:0030666)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	hyaluronic acid binding (GO:0005540)|low-density lipoprotein particle binding (GO:0030169)|low-density lipoprotein receptor activity (GO:0005041)|protein disulfide oxidoreductase activity (GO:0015035)|scavenger receptor activity (GO:0005044)			breast(4)|central_nervous_system(3)|endometrium(7)|kidney(2)|large_intestine(13)|liver(1)|lung(27)|ovary(1)|pancreas(1)|prostate(4)|skin(6)|upper_aerodigestive_tract(4)|urinary_tract(3)	76				BRCA - Breast invasive adenocarcinoma(193;1.73e-05)|Kidney(197;0.00182)|KIRC - Kidney renal clear cell carcinoma(197;0.00205)|OV - Ovarian serous cystadenocarcinoma(275;0.0482)		ACATCTTCCGGGTAAGGGGTG	0.632																																					p.R993R		.											.	STAB1-139	0			c.G2979T						.						94.0	87.0	89.0					3																	52546452		2203	4300	6503	SO:0001630	splice_region_variant	23166	exon27			CTTCCGGGTAAGG	AJ275213	CCDS33768.1	3p21.31	2008-07-18			ENSG00000010327	ENSG00000010327			18628	protein-coding gene	gene with protein product	"""MS-1 antigen"", ""fasciclin egf-like, laminin-type egf-like, and link domain-containing scavenger receptor-1"", ""common lymphatic endothelial and vascular endothelial receptor-1"""	608560				11829752, 12077138	Standard	XM_005264973		Approved	KIAA0246, STAB-1, FEEL-1, CLEVER-1, FELE-1, FEX1	uc003dej.3	Q9NY15	OTTHUMG00000158574	ENST00000321725.6:c.2979+1G>T	3.37:g.52546452G>T		Somatic	35	0		WXS	Illumina GAIIx	Phase_I	39	4	NM_015136	0	0	0	0	0	A7E297|Q8IUH0|Q8IUH1|Q93072	Silent	SNP	ENST00000321725.6	37	CCDS33768.1																																																																																			.		0.632	STAB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351380.2	NM_015136	Silent
CHDH	55349	hgsc.bcm.edu	37	3	53857917	53857917	+	Missense_Mutation	SNP	T	T	G	rs9001	byFrequency	TCGA-PK-A5HA-01A-11D-A29I-10	TCGA-PK-A5HA-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2bd7613-8a82-453c-b1d0-f0ad6fbc0766	688c5eb5-c374-4bfb-81d1-c0ba622386cf	g.chr3:53857917T>G	ENST00000315251.6	-	3	556	c.119A>C	c.(118-120)gAg>gCg	p.E40A		NM_018397.4	NP_060867.2	Q8NE62	CHDH_HUMAN	choline dehydrogenase	40			E -> A (in dbSNP:rs9001).		glycine betaine biosynthetic process from choline (GO:0019285)	mitochondrial inner membrane (GO:0005743)	choline dehydrogenase activity (GO:0008812)|flavin adenine dinucleotide binding (GO:0050660)			NS(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(4)|ovary(2)|prostate(1)	17		Hepatocellular(537;0.152)		BRCA - Breast invasive adenocarcinoma(193;0.000158)|KIRC - Kidney renal clear cell carcinoma(284;0.00588)|Kidney(284;0.00673)|OV - Ovarian serous cystadenocarcinoma(275;0.118)	Choline(DB00122)	ATAGCTGTACTCGTCCCGGCT	0.761													T|||	1221	0.24381	0.3238	0.2781	5008	,	,		12724	0.3651		0.1004	False		,,,				2504	0.1339				p.E40A		.											.	CHDH-91	0			c.A119C						.	T	ALA/GLU	816,2768		76,664,1052	6.0	6.0	6.0		119	3.8	1.0	3	dbSNP_52	6	469,6875		12,445,3215	no	missense	CHDH	NM_018397.4	107	88,1109,4267	GG,GT,TT		6.3862,22.7679,11.7588	possibly-damaging	40/595	53857917	1285,9643	1792	3672	5464	SO:0001583	missense	55349	exon3			CTGTACTCGTCCC	AJ272267	CCDS2873.1	3p21	2004-11-24			ENSG00000016391	ENSG00000016391	1.1.99.1		24288	protein-coding gene	gene with protein product							Standard	NM_018397		Approved		uc003dgz.3	Q8NE62	OTTHUMG00000158281	ENST00000315251.6:c.119A>C	3.37:g.53857917T>G	ENSP00000319851:p.Glu40Ala	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	21	14	NM_018397	0	0	0	0	0	Q9NY17	Missense_Mutation	SNP	ENST00000315251.6	37	CCDS2873.1	536	0.2454212454212454	164	0.3333333333333333	82	0.2265193370165746	201	0.3513986013986014	89	0.11741424802110818	T	14.21	2.467073	0.43839	0.227679	0.063862	ENSG00000016391	ENST00000315251;ENST00000481668;ENST00000467802	T;T;T	0.68479	-0.33;1.42;-0.33	5.03	3.8	0.43715	.	0.330341	0.32134	N	0.006528	T	0.00012	0.0000	N	0.08118	0	0.37702	P	0.07576799999999995	B	0.17465	0.022	B	0.12156	0.007	T	0.12372	-1.0550	9	0.56958	D	0.05	-41.8442	8.4332	0.32771	0.0:0.0:0.1978:0.8022	rs9001;rs3172489;rs58735855;rs9001	40	Q8NE62	CHDH_HUMAN	A	40	ENSP00000319851:E40A;ENSP00000418273:E40A;ENSP00000419863:E40A	ENSP00000319851:E40A	E	-	2	0	CHDH	53832957	0.187000	0.23238	0.988000	0.46212	0.816000	0.46133	1.016000	0.29976	2.240000	0.73641	0.533000	0.62120	GAG	T|0.749;G|0.251		0.761	CHDH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350567.2	NM_018397	
LRIG1	26018	hgsc.bcm.edu	37	3	66550756	66550756	+	Missense_Mutation	SNP	G	G	C	rs1403625	byFrequency	TCGA-PK-A5HA-01A-11D-A29I-10	TCGA-PK-A5HA-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2bd7613-8a82-453c-b1d0-f0ad6fbc0766	688c5eb5-c374-4bfb-81d1-c0ba622386cf	g.chr3:66550756G>C	ENST00000273261.3	-	1	600	c.76C>G	c.(76-78)Ctt>Gtt	p.L26V	LRIG1_ENST00000383703.3_Missense_Mutation_p.L26V	NM_015541.2	NP_056356.2	Q96JA1	LRIG1_HUMAN	leucine-rich repeats and immunoglobulin-like domains 1	26				LLL -> VLV (in Ref. 1; AAK62357 and 3; AAH71561). {ECO:0000305}.	innervation (GO:0060384)|otolith morphogenesis (GO:0032474)|sensory perception of sound (GO:0007605)	integral component of membrane (GO:0016021)				NS(2)|breast(2)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(7)|lung(12)|ovary(3)|prostate(1)|skin(4)|stomach(4)|urinary_tract(1)	42		Lung NSC(201;0.0101)		BRCA - Breast invasive adenocarcinoma(55;0.00047)		TCCAGCCGAAGCAAAAGCAGC	0.761													g|||	3605	0.719848	0.1808	0.8833	5008	,	,		8093	0.8284		0.9732	False		,,,				2504	0.9601				p.L26V		.											.	LRIG1-230	0			c.C76G						.		VAL/LEU	1298,1386		255,788,299	3.0	4.0	4.0		76	2.9	0.5	3	dbSNP_88	4	5191,89		2555,81,4	yes	missense	LRIG1	NM_015541.2	32	2810,869,303	CC,CG,GG		1.6856,48.3607,18.5208	benign	26/1094	66550756	6489,1475	1342	2640	3982	SO:0001583	missense	26018	exon1			GCCGAAGCAAAAG	AB050468	CCDS33783.1	3p14	2013-01-14			ENSG00000144749	ENSG00000144749		"""Immunoglobulin superfamily / I-set domain containing"""	17360	protein-coding gene	gene with protein product	"""ortholog of mouse integral membrane glycoprotein LIG-1"", ""leucine-rich repeat protein LRIG1"""	608868				11414704, 12234026	Standard	NM_015541		Approved	LIG-1, DKFZP586O1624, LIG1	uc003dmx.3	Q96JA1	OTTHUMG00000158727	ENST00000273261.3:c.76C>G	3.37:g.66550756G>C	ENSP00000273261:p.Leu26Val	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	10	10	NM_015541	0	0	0	0	0	Q6IQ51|Q96CF9|Q9BYB8|Q9UFI4	Missense_Mutation	SNP	ENST00000273261.3	37	CCDS33783.1	1666	0.7628205128205128	118	0.23983739837398374	325	0.8977900552486188	489	0.8548951048951049	734	0.9683377308707124	g	6.572	0.473779	0.12521	0.483607	0.983144	ENSG00000144749	ENST00000273261;ENST00000383703	T;T	0.67345	-0.26;-0.13	3.84	2.93	0.34026	.	0.847359	0.09512	U	0.792175	T	0.00012	0.0000	N	0.19112	0.55	0.80722	P	0.0	P;P	0.44139	0.827;0.484	B;B	0.37731	0.257;0.096	T	0.48854	-0.8998	9	0.23302	T	0.38	.	8.6883	0.34251	0.1185:0.0:0.8815:0.0	rs1403625;rs13083628	26;26	Q96JA1-2;Q96JA1	.;LRIG1_HUMAN	V	26	ENSP00000273261:L26V;ENSP00000373208:L26V	ENSP00000273261:L26V	L	-	1	0	LRIG1	66633446	.	.	0.520000	0.27837	0.020000	0.10135	.	.	1.845000	0.53610	0.472000	0.43445	CTT	G|0.237;C|0.763		0.761	LRIG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351930.1	NM_015541	
LRIG1	26018	hgsc.bcm.edu	37	3	66550762	66550762	+	Missense_Mutation	SNP	G	G	C	rs1403626	byFrequency	TCGA-PK-A5HA-01A-11D-A29I-10	TCGA-PK-A5HA-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2bd7613-8a82-453c-b1d0-f0ad6fbc0766	688c5eb5-c374-4bfb-81d1-c0ba622386cf	g.chr3:66550762G>C	ENST00000273261.3	-	1	594	c.70C>G	c.(70-72)Ctt>Gtt	p.L24V	LRIG1_ENST00000383703.3_Missense_Mutation_p.L24V	NM_015541.2	NP_056356.2	Q96JA1	LRIG1_HUMAN	leucine-rich repeats and immunoglobulin-like domains 1	24			L -> V (in dbSNP:rs1403626).	LLL -> VLV (in Ref. 1; AAK62357 and 3; AAH71561). {ECO:0000305}.	innervation (GO:0060384)|otolith morphogenesis (GO:0032474)|sensory perception of sound (GO:0007605)	integral component of membrane (GO:0016021)				NS(2)|breast(2)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(7)|lung(12)|ovary(3)|prostate(1)|skin(4)|stomach(4)|urinary_tract(1)	42		Lung NSC(201;0.0101)		BRCA - Breast invasive adenocarcinoma(55;0.00047)		CGAAGCAAAAGCAGCCAGAGA	0.766													g|||	3605	0.719848	0.1808	0.8833	5008	,	,		8368	0.8284		0.9732	False		,,,				2504	0.9601				p.L24V		.											.	LRIG1-230	0			c.C70G						.		VAL/LEU	1309,1447		265,779,334	3.0	4.0	4.0		70	3.1	0.5	3	dbSNP_88	4	5325,93		2620,85,4	no	missense	LRIG1	NM_015541.2	32	2885,864,338	CC,CG,GG		1.7165,47.4964,18.8402	benign	24/1094	66550762	6634,1540	1378	2709	4087	SO:0001583	missense	26018	exon1			GCAAAAGCAGCCA	AB050468	CCDS33783.1	3p14	2013-01-14			ENSG00000144749	ENSG00000144749		"""Immunoglobulin superfamily / I-set domain containing"""	17360	protein-coding gene	gene with protein product	"""ortholog of mouse integral membrane glycoprotein LIG-1"", ""leucine-rich repeat protein LRIG1"""	608868				11414704, 12234026	Standard	NM_015541		Approved	LIG-1, DKFZP586O1624, LIG1	uc003dmx.3	Q96JA1	OTTHUMG00000158727	ENST00000273261.3:c.70C>G	3.37:g.66550762G>C	ENSP00000273261:p.Leu24Val	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	11	11	NM_015541	0	0	0	0	0	Q6IQ51|Q96CF9|Q9BYB8|Q9UFI4	Missense_Mutation	SNP	ENST00000273261.3	37	CCDS33783.1	1670	0.7646520146520146	119	0.241869918699187	326	0.9005524861878453	488	0.8531468531468531	737	0.9722955145118733	g	9.592	1.126319	0.20959	0.474964	0.982835	ENSG00000144749	ENST00000273261;ENST00000383703	T;T	0.68765	-0.35;-0.2	3.11	3.11	0.35812	.	0.429988	0.15146	U	0.278020	T	0.00012	0.0000	N	0.19112	0.55	0.39998	P	0.024872000000000005	P;B	0.36282	0.546;0.282	B;B	0.32465	0.146;0.069	T	0.40572	-0.9556	9	0.23891	T	0.37	.	12.0321	0.53403	0.0:0.0:1.0:0.0	rs1403626;rs13083630;rs1403626	24;24	Q96JA1-2;Q96JA1	.;LRIG1_HUMAN	V	24	ENSP00000273261:L24V;ENSP00000373208:L24V	ENSP00000273261:L24V	L	-	1	0	LRIG1	66633452	.	.	0.546000	0.28166	0.017000	0.09413	.	.	1.734000	0.51633	0.472000	0.43445	CTT	G|0.252;C|0.748		0.766	LRIG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351930.1	NM_015541	
ADCY5	111	broad.mit.edu	37	3	123166708	123166708	+	Missense_Mutation	SNP	G	G	T	rs557056000	byFrequency	TCGA-PK-A5HA-01A-11D-A29I-10	TCGA-PK-A5HA-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2bd7613-8a82-453c-b1d0-f0ad6fbc0766	688c5eb5-c374-4bfb-81d1-c0ba622386cf	g.chr3:123166708G>T	ENST00000462833.1	-	1	1897	c.685C>A	c.(685-687)Ctg>Atg	p.L229M		NM_183357.2	NP_899200.1	O95622	ADCY5_HUMAN	adenylate cyclase 5	229					activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|adenosine receptor signaling pathway (GO:0001973)|adenylate cyclase-activating dopamine receptor signaling pathway (GO:0007191)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-inhibiting dopamine receptor signaling pathway (GO:0007195)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|cellular response to glucagon stimulus (GO:0071377)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|locomotory behavior (GO:0007626)|neuromuscular process controlling balance (GO:0050885)|neurotrophin TRK receptor signaling pathway (GO:0048011)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|primary cilium (GO:0072372)	adenylate cyclase activity (GO:0004016)|adenylate cyclase binding (GO:0008179)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein heterodimerization activity (GO:0046982)			breast(2)|endometrium(4)|kidney(3)|large_intestine(12)|lung(22)|ovary(5)|prostate(2)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(2)	60				GBM - Glioblastoma multiforme(114;0.0342)		CGCTGGTACAGCCGCTCCAGT	0.662													G|||	15	0.00299521	0.0023	0.0014	5008	,	,		11742	0.004		0.003	False		,,,				2504	0.0041				p.L229M		.											.	ADCY5-94	0			c.C685A						.						28.0	27.0	27.0					3																	123166708		2202	4296	6498	SO:0001583	missense	111	exon1			GGTACAGCCGCTC	U65473	CCDS3022.1, CCDS56274.1	3q21.1	2013-02-04			ENSG00000173175	ENSG00000173175	4.6.1.1	"""Adenylate cyclases"""	236	protein-coding gene	gene with protein product		600293				10481931	Standard	NM_183357		Approved	AC5	uc003egh.2	O95622	OTTHUMG00000159517	ENST00000462833.1:c.685C>A	3.37:g.123166708G>T	ENSP00000419361:p.Leu229Met	Somatic	119	1		WXS	Illumina GAIIx	Phase_I	214	16	NM_183357	0	0	3	3	0	B7Z8A6|Q7RTV7|Q8NFM3	Missense_Mutation	SNP	ENST00000462833.1	37	CCDS3022.1	.	.	.	.	.	.	.	.	.	.	G	19.73	3.882557	0.72294	.	.	ENSG00000173175	ENST00000462833	T	0.80304	-1.36	4.9	4.03	0.46877	.	0.000000	0.56097	D	0.000026	D	0.88599	0.6480	M	0.77820	2.39	0.80722	D	1	D	0.76494	0.999	D	0.74674	0.984	D	0.89552	0.3800	10	0.87932	D	0	.	13.0093	0.58722	0.079:0.0:0.921:0.0	.	229	O95622	ADCY5_HUMAN	M	229	ENSP00000419361:L229M	ENSP00000419361:L229M	L	-	1	2	ADCY5	124649398	1.000000	0.71417	1.000000	0.80357	0.972000	0.66771	6.630000	0.74272	1.076000	0.40961	0.499000	0.49734	CTG	.		0.662	ADCY5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355889.4	XM_171048	
TSC22D2	9819	hgsc.bcm.edu	37	3	150128392	150128392	+	Missense_Mutation	SNP	G	G	A	rs879634	byFrequency	TCGA-PK-A5HA-01A-11D-A29I-10	TCGA-PK-A5HA-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2bd7613-8a82-453c-b1d0-f0ad6fbc0766	688c5eb5-c374-4bfb-81d1-c0ba622386cf	g.chr3:150128392G>A	ENST00000361875.3	+	1	2271	c.1255G>A	c.(1255-1257)Gct>Act	p.A419T	TSC22D2_ENST00000361136.2_Missense_Mutation_p.A419T	NM_014779.2	NP_055594.1	O75157	T22D2_HUMAN	TSC22 domain family, member 2	419			A -> T (in dbSNP:rs879634).		response to osmotic stress (GO:0006970)		sequence-specific DNA binding transcription factor activity (GO:0003700)			cervix(2)|endometrium(2)|kidney(1)|large_intestine(3)|lung(8)|ovary(1)|upper_aerodigestive_tract(1)	18			LUSC - Lung squamous cell carcinoma(72;0.0538)|Lung(72;0.066)			CGGCCAGAATGCTTCCTCGGT	0.771													G|||	952	0.190096	0.2224	0.1657	5008	,	,		13018	0.0407		0.2724	False		,,,				2504	0.2331				p.A419T		.											.	TSC22D2-91	0			c.G1255A						.	G	THR/ALA	435,2751		29,377,1187	2.0	3.0	3.0		1255	1.5	0.0	3	dbSNP_86	3	1458,5444		170,1118,2163	yes	missense	TSC22D2	NM_014779.2	58	199,1495,3350	AA,AG,GG		21.1243,13.6535,18.7649	benign	419/781	150128392	1893,8195	1593	3451	5044	SO:0001583	missense	9819	exon1			CAGAATGCTTCCT	AB014569	CCDS3149.1	3q25.1	2005-03-01			ENSG00000196428	ENSG00000196428			29095	protein-coding gene	gene with protein product						9734811	Standard	NM_014779		Approved	KIAA0669, TILZ4a, TILZ4b, TILZ4c	uc003exv.3	O75157	OTTHUMG00000159744	ENST00000361875.3:c.1255G>A	3.37:g.150128392G>A	ENSP00000354543:p.Ala419Thr	Somatic	1	0		WXS	Illumina GAIIx	Phase_I	18	12	NM_014779	0	0	1	3	2	D3DNI5|Q6PI50|Q9H2Z6|Q9H2Z7|Q9H2Z8	Missense_Mutation	SNP	ENST00000361875.3	37	CCDS3149.1	433	0.19826007326007325	126	0.25609756097560976	72	0.19889502762430938	23	0.04020979020979021	212	0.2796833773087071	G	1.438	-0.568481	0.03910	0.136535	0.211243	ENSG00000196428	ENST00000361875;ENST00000361136	T;T	0.30182	1.54;1.54	3.57	1.47	0.22746	.	0.687211	0.12935	N	0.427041	T	0.00012	0.0000	N	0.19112	0.55	0.80722	P	0.0	B;B	0.10296	0.003;0.001	B;B	0.09377	0.004;0.002	T	0.33599	-0.9862	9	0.51188	T	0.08	.	6.993	0.24765	0.0:0.4503:0.379:0.1707	rs879634;rs3749399;rs58335631	419;419	O75157-2;O75157	.;T22D2_HUMAN	T	419	ENSP00000354543:A419T;ENSP00000354893:A419T	ENSP00000354893:A419T	A	+	1	0	TSC22D2	151611082	0.002000	0.14202	0.001000	0.08648	0.002000	0.02628	0.305000	0.19254	0.805000	0.34159	0.557000	0.71058	GCT	G|0.797;A|0.203		0.771	TSC22D2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000357123.2	NM_014779	
IL1RAP	3556	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	190321957	190321957	+	Silent	SNP	C	C	T			TCGA-PK-A5HA-01A-11D-A29I-10	TCGA-PK-A5HA-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2bd7613-8a82-453c-b1d0-f0ad6fbc0766	688c5eb5-c374-4bfb-81d1-c0ba622386cf	g.chr3:190321957C>T	ENST00000412504.2	+	3	357	c.105C>T	c.(103-105)atC>atT	p.I35I	IL1RAP_ENST00000443369.2_Silent_p.I35I|IL1RAP_ENST00000422485.1_Silent_p.I35I|IL1RAP_ENST00000422940.1_Silent_p.I35I|IL1RAP_ENST00000072516.3_Silent_p.I35I|IL1RAP_ENST00000439062.1_Silent_p.I35I|IL1RAP_ENST00000434491.1_Intron|IL1RAP_ENST00000317757.3_Silent_p.I35I|IL1RAP_ENST00000447382.1_Silent_p.I35I			Q9NPH3	IL1AP_HUMAN	interleukin 1 receptor accessory protein	35	Ig-like C2-type 1.				immune response (GO:0006955)|inflammatory response (GO:0006954)|interleukin-2 biosynthetic process (GO:0042094)|protein complex assembly (GO:0006461)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	interleukin-1 receptor activity (GO:0004908)|signal transducer activity (GO:0004871)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(1)|lung(8)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	20	all_cancers(143;3.61e-10)|Ovarian(172;0.0733)|Breast(254;0.21)		Lung(62;1.95e-06)|LUSC - Lung squamous cell carcinoma(58;2.05e-06)	GBM - Glioblastoma multiforme(93;0.00851)		TGAGGCAAATCCAAGTGTTTG	0.453																																					p.I35I		.											.	IL1RAP-91	0			c.C105T						.						101.0	92.0	95.0					3																	190321957		2203	4300	6503	SO:0001819	synonymous_variant	3556	exon3			GCAAATCCAAGTG	AB006537	CCDS3298.1, CCDS46982.1, CCDS54696.1	3q28	2013-01-11			ENSG00000196083	ENSG00000196083		"""Interleukins and interleukin receptors"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5995	protein-coding gene	gene with protein product		602626				9479509, 9065432	Standard	NM_002182		Approved	IL-1RAcP, IL1R3, C3orf13	uc003fsq.3	Q9NPH3	OTTHUMG00000156211	ENST00000412504.2:c.105C>T	3.37:g.190321957C>T		Somatic	130	0		WXS	Illumina GAIIx	Phase_I	168	30	NM_001167929	0	0	0	0	0	B1NLD0|D3DNW0|O14915|Q86WJ7	Silent	SNP	ENST00000412504.2	37	CCDS3298.1																																																																																			.		0.453	IL1RAP-201	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000343497.1		
TNK2	10188	hgsc.bcm.edu	37	3	195595405	195595405	+	Silent	SNP	G	G	A	rs1056726	byFrequency	TCGA-PK-A5HA-01A-11D-A29I-10	TCGA-PK-A5HA-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2bd7613-8a82-453c-b1d0-f0ad6fbc0766	688c5eb5-c374-4bfb-81d1-c0ba622386cf	g.chr3:195595405G>A	ENST00000333602.6	-	12	2336	c.1719C>T	c.(1717-1719)ttC>ttT	p.F573F	TNK2_ENST00000428187.1_Silent_p.F605F|TNK2_ENST00000392400.1_Silent_p.F573F|TNK2_ENST00000381916.2_Silent_p.F651F	NM_005781.4	NP_005772.3	Q07912	ACK1_HUMAN	tyrosine kinase, non-receptor, 2	573				Missing (in Ref. 4; AAH08884). {ECO:0000305}.	cell surface receptor signaling pathway (GO:0007166)|endocytosis (GO:0006897)|negative regulation of catalytic activity (GO:0043086)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphorylation (GO:0016310)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|regulation of clathrin-mediated endocytosis (GO:2000369)|small GTPase mediated signal transduction (GO:0007264)	axon (GO:0030424)|cell junction (GO:0030054)|clathrin-coated vesicle (GO:0030136)|coated pit (GO:0005905)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|endosome (GO:0005768)|Grb2-EGFR complex (GO:0070436)|growth cone (GO:0030426)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|epidermal growth factor receptor binding (GO:0005154)|GTPase inhibitor activity (GO:0005095)|metal ion binding (GO:0046872)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|protein tyrosine kinase activity (GO:0004713)|WW domain binding (GO:0050699)			central_nervous_system(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(11)|ovary(3)|prostate(4)|skin(2)|stomach(1)|urinary_tract(1)	29	all_cancers(143;6.48e-09)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;1.46e-22)|OV - Ovarian serous cystadenocarcinoma(49;8.3e-19)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;0.000757)	Adenosine triphosphate(DB00171)	GCTCCTCACCGAAGTCGATGA	0.746													a|||	310	0.061901	0.0847	0.0259	5008	,	,		10834	0.0704		0.0467	False		,,,				2504	0.0634				p.F651F		.											.	TNK2-957	0			c.C1953T						.		,	269,3657		9,251,1703	5.0	6.0	6.0		1953,1719	-5.7	0.0	3	dbSNP_86	6	322,7600		4,314,3643	no	coding-synonymous,coding-synonymous	TNK2	NM_001010938.1,NM_005781.4	,	13,565,5346	AA,AG,GG		4.0646,6.8518,4.9882	,	651/1087,573/1039	195595405	591,11257	1963	3961	5924	SO:0001819	synonymous_variant	10188	exon13			CTCACCGAAGTCG	L13738	CCDS33927.1, CCDS33928.1	3q29	2013-09-02			ENSG00000061938	ENSG00000061938			19297	protein-coding gene	gene with protein product	"""activated Cdc42-associated kinase 1"""	606994				8497321, 14506255	Standard	XM_006713460		Approved	p21cdc42Hs, ACK, ACK1	uc003fvt.1	Q07912	OTTHUMG00000155737	ENST00000333602.6:c.1719C>T	3.37:g.195595405G>A		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	20	7	NM_001010938	0	0	16	19	3	Q6ZMQ0|Q8N6U7|Q96H59	Silent	SNP	ENST00000333602.6	37	CCDS33928.1	134	0.06135531135531135	38	0.07723577235772358	10	0.027624309392265192	53	0.09265734265734266	33	0.04353562005277045	A	0.025	-1.382365	0.01204	0.068518	0.040646	ENSG00000061938	ENST00000424563	.	.	.	5.41	-5.74	0.02391	.	.	.	.	.	T	0.06096	0.0158	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.56288	-0.8004	4	.	.	.	.	15.998	0.80265	0.6944:0.0:0.3056:0.0	rs1056726;rs3197336;rs57297005	.	.	.	L	183	.	.	S	-	2	0	TNK2	197079802	0.028000	0.19301	0.045000	0.18777	0.071000	0.16799	-0.555000	0.05999	-1.423000	0.02002	-2.075000	0.00382	TCG	G|0.936;A|0.064		0.746	TNK2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341437.3	NM_005781	
ZNF718	255403	bcgsc.ca	37	4	155163	155163	+	lincRNA	SNP	G	G	T			TCGA-PK-A5HA-01A-11D-A29I-10	TCGA-PK-A5HA-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2bd7613-8a82-453c-b1d0-f0ad6fbc0766	688c5eb5-c374-4bfb-81d1-c0ba622386cf	g.chr4:155163G>T	ENST00000510175.1	+	0	598							Q3SXZ3	ZN718_HUMAN	zinc finger protein 718						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)						all_cancers(4;0.0738)|all_epithelial(65;0.139)		Lung(54;0.0681)|Epithelial(2;0.0838)|all cancers(2;0.135)|LUSC - Lung squamous cell carcinoma(95;0.18)		CTACAAGTGTGAAGAATGTGG	0.383																																					p.E230X		.											.	.	0			c.G688T						.						26.0	30.0	28.0					4																	155163		2123	4263	6386			255403	exon4			AAGTGTGAAGAAT	AK096662	CCDS75078.1, CCDS75079.1	4p16.3	2011-05-24			ENSG00000250312	ENSG00000250312		"""Zinc fingers, C2H2-type"""	26889	protein-coding gene	gene with protein product							Standard	XM_005278364		Approved	FLJ90036	uc003fzt.4	Q3SXZ3	OTTHUMG00000159873		4.37:g.155163G>T		Somatic	45	0		WXS	Illumina GAIIx	Phase_I	42	4	NM_001039127	0	0	3	3	0	Q3SXZ4|Q3SXZ5	Nonsense_Mutation	SNP	ENST00000510175.1	37																																																																																				.		0.383	ZNF718-002	KNOWN	basic	lincRNA	lincRNA	OTTHUMT00000357865.3	NM_001039127	
CRIPAK	285464	ucsc.edu	37	4	1388974	1388974	+	Silent	SNP	T	T	C	rs71614969	byFrequency	TCGA-PK-A5HA-01A-11D-A29I-10	TCGA-PK-A5HA-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2bd7613-8a82-453c-b1d0-f0ad6fbc0766	688c5eb5-c374-4bfb-81d1-c0ba622386cf	g.chr4:1388974T>C	ENST00000324803.4	+	1	3635	c.675T>C	c.(673-675)gaT>gaC	p.D225D		NM_175918.3	NP_787114.2	Q8N1N5	CRPAK_HUMAN	cysteine-rich PAK1 inhibitor	225					negative regulation of intracellular estrogen receptor signaling pathway (GO:0033147)|negative regulation of protein kinase activity (GO:0006469)|regulation of cytoskeleton organization (GO:0051493)|response to estrogen (GO:0043627)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				NS(3)|breast(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(11)|ovary(1)|pancreas(2)|prostate(6)|skin(4)|urinary_tract(1)	35			OV - Ovarian serous cystadenocarcinoma(23;0.0106)			CACGTGCCGATGCGGAGTGCC	0.667													N|||	706	0.140974	0.087	0.1888	5008	,	,		14021	0.0268		0.2326	False		,,,				2504	0.2035				p.D225D		.											.	CRIPAK-90	0			c.T675C						.						177.0	128.0	145.0					4																	1388974		2168	4272	6440	SO:0001819	synonymous_variant	285464	exon1			TGCCGATGCGGAG	AK096209	CCDS3349.1	4p16.3	2011-02-10	2006-09-04		ENSG00000179979	ENSG00000179979			26619	protein-coding gene	gene with protein product		610203	"""cysteine-rich PAK1inhibitor"""			16278681	Standard	NM_175918		Approved	FLJ34443	uc003gdf.2	Q8N1N5	OTTHUMG00000121131	ENST00000324803.4:c.675T>C	4.37:g.1388974T>C		Somatic	25	1		WXS	Illumina GAIIx	Phase_I	79	10	NM_175918	0	0	15	23	8	Q8NB03	Silent	SNP	ENST00000324803.4	37	CCDS3349.1																																																																																			C|1.000;|0.000		0.667	CRIPAK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000241607.2	NM_175918	
ZFYVE28	57732	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	4	2306391	2306391	+	Missense_Mutation	SNP	C	C	A			TCGA-PK-A5HA-01A-11D-A29I-10	TCGA-PK-A5HA-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2bd7613-8a82-453c-b1d0-f0ad6fbc0766	688c5eb5-c374-4bfb-81d1-c0ba622386cf	g.chr4:2306391C>A	ENST00000290974.2	-	8	2015	c.1676G>T	c.(1675-1677)tGc>tTc	p.C559F	ZFYVE28_ENST00000515312.1_Missense_Mutation_p.C489F|ZFYVE28_ENST00000511071.1_Missense_Mutation_p.C529F|RP11-478C1.7_ENST00000510632.1_RNA	NM_020972.2	NP_066023.2	Q9HCC9	LST2_HUMAN	zinc finger, FYVE domain containing 28	559					negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|negative regulation of epidermal growth factor-activated receptor activity (GO:0007175)	cytosol (GO:0005829)|early endosome membrane (GO:0031901)	metal ion binding (GO:0046872)|phosphatidylinositol-3-phosphate binding (GO:0032266)			NS(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(17)|ovary(1)|pancreas(1)|prostate(1)|skin(4)	31						ATGCAGAAGGCAGTTGGTGGC	0.687																																					p.C559F		.											.	ZFYVE28-93	0			c.G1676T						.						32.0	30.0	30.0					4																	2306391		2202	4299	6501	SO:0001583	missense	57732	exon8			AGAAGGCAGTTGG	AK126692	CCDS33942.1, CCDS54708.1, CCDS54709.1, CCDS54710.1, CCDS54711.1, CCDS54712.1	4p16.3	2008-05-02			ENSG00000159733	ENSG00000159733		"""Zinc fingers, FYVE domain containing"""	29334	protein-coding gene	gene with protein product		614176				10997877	Standard	NM_020972		Approved	KIAA1643	uc003gex.2	Q9HCC9	OTTHUMG00000160292	ENST00000290974.2:c.1676G>T	4.37:g.2306391C>A	ENSP00000290974:p.Cys559Phe	Somatic	116	0		WXS	Illumina GAIIx	Phase_I	125	16	NM_020972	0	0	4	4	0	B2RP83|B3KX50|B7Z1Q7|B7Z2G9|B7Z2M2|B7ZB19|E9PB54|E9PB64|E9PG77|Q7Z6J3	Missense_Mutation	SNP	ENST00000290974.2	37	CCDS33942.1	.	.	.	.	.	.	.	.	.	.	C	16.00	2.997295	0.54147	.	.	ENSG00000159733	ENST00000290974;ENST00000511071;ENST00000515312	T;T;T	0.76578	-0.82;-1.03;-0.85	4.61	4.61	0.57282	.	0.103879	0.64402	D	0.000002	D	0.85561	0.5725	M	0.68952	2.095	0.80722	D	1	D;D	0.65815	0.993;0.995	P;P	0.62491	0.804;0.903	D	0.87551	0.2465	10	0.87932	D	0	.	16.6858	0.85306	0.0:1.0:0.0:0.0	.	529;559	Q9HCC9-2;Q9HCC9	.;LST2_HUMAN	F	559;529;489	ENSP00000290974:C559F;ENSP00000425706:C529F;ENSP00000426299:C489F	ENSP00000290974:C559F	C	-	2	0	ZFYVE28	2276189	1.000000	0.71417	0.991000	0.47740	0.074000	0.17049	5.020000	0.64066	2.410000	0.81850	0.460000	0.39030	TGC	.		0.687	ZFYVE28-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000360078.1	XM_035371	
FAM184B	27146	hgsc.bcm.edu	37	4	17643848	17643848	+	Missense_Mutation	SNP	G	G	A	rs2286771	byFrequency	TCGA-PK-A5HA-01A-11D-A29I-10	TCGA-PK-A5HA-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2bd7613-8a82-453c-b1d0-f0ad6fbc0766	688c5eb5-c374-4bfb-81d1-c0ba622386cf	g.chr4:17643848G>A	ENST00000265018.3	-	13	2562	c.2350C>T	c.(2350-2352)Cgg>Tgg	p.R784W		NM_015688.1	NP_056503.1	Q9ULE4	F184B_HUMAN	family with sequence similarity 184, member B	784				R -> W (in Ref. 1; BAA86590). {ECO:0000305}.						NS(1)|central_nervous_system(1)|endometrium(1)|prostate(1)	4						GGGCCGCCCCGCTCCTGAGGA	0.701													G|||	2697	0.538538	0.1725	0.6599	5008	,	,		10215	0.8522		0.6233	False		,,,				2504	0.5368				p.R784W		.											.	FAM184B-23	0			c.C2350T						.						1.0	2.0	2.0					4																	17643848		374	1044	1418	SO:0001583	missense	27146	exon13			CGCCCCGCTCCTG		CCDS47033.1	4p16	2009-04-22			ENSG00000047662	ENSG00000047662			29235	protein-coding gene	gene with protein product						10574462	Standard	NM_015688		Approved	KIAA1276	uc003gpm.4	Q9ULE4	OTTHUMG00000160287	ENST00000265018.3:c.2350C>T	4.37:g.17643848G>A	ENSP00000265018:p.Arg784Trp	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	9	9	NM_015688	0	0	0	0	0		Missense_Mutation	SNP	ENST00000265018.3	37	CCDS47033.1	1272	0.5824175824175825	75	0.1524390243902439	232	0.6408839779005525	493	0.8618881118881119	472	0.6226912928759895	G	13.83	2.354233	0.41700	.	.	ENSG00000047662	ENST00000265018	T	0.34072	1.38	3.29	-3.67	0.04476	.	3.541600	0.00901	N	0.002342	T	0.00012	0.0000	N	0.14661	0.345	0.80722	P	0.0	D	0.56968	0.978	B	0.40741	0.339	T	0.48547	-0.9026	9	0.72032	D	0.01	2.0681	6.7491	0.23477	0.107:0.2547:0.5506:0.0877	rs2286771;rs58699512;rs2286771	784	Q9ULE4	F184B_HUMAN	W	784	ENSP00000265018:R784W	ENSP00000265018:R784W	R	-	1	2	FAM184B	17252946	0.000000	0.05858	0.000000	0.03702	0.516000	0.34256	-0.323000	0.07997	-1.014000	0.03379	-0.369000	0.07265	CGG	G|0.440;A|0.560		0.701	FAM184B-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000360137.1	NM_015688	
PDGFRA	5156	bcgsc.ca	37	4	55143577	55143577	+	Silent	SNP	G	G	A	rs10028020	byFrequency	TCGA-PK-A5HA-01A-11D-A29I-10	TCGA-PK-A5HA-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2bd7613-8a82-453c-b1d0-f0ad6fbc0766	688c5eb5-c374-4bfb-81d1-c0ba622386cf	g.chr4:55143577G>A	ENST00000257290.5	+	13	2140	c.1809G>A	c.(1807-1809)gcG>gcA	p.A603A	FIP1L1_ENST00000507166.1_Silent_p.A363A	NM_006206.4	NP_006197.1	P16234	PGFRA_HUMAN	platelet-derived growth factor receptor, alpha polypeptide	603	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				adrenal gland development (GO:0030325)|cardiac myofibril assembly (GO:0055003)|cell activation (GO:0001775)|cell chemotaxis (GO:0060326)|cellular response to amino acid stimulus (GO:0071230)|embryonic cranial skeleton morphogenesis (GO:0048701)|embryonic digestive tract morphogenesis (GO:0048557)|embryonic skeletal system morphogenesis (GO:0048704)|epidermal growth factor receptor signaling pathway (GO:0007173)|estrogen metabolic process (GO:0008210)|extracellular matrix organization (GO:0030198)|face morphogenesis (GO:0060325)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|hematopoietic progenitor cell differentiation (GO:0002244)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|Leydig cell differentiation (GO:0033327)|lung development (GO:0030324)|luteinization (GO:0001553)|male genitalia development (GO:0030539)|metanephric glomerular capillary formation (GO:0072277)|negative regulation of platelet activation (GO:0010544)|neurotrophin TRK receptor signaling pathway (GO:0048011)|odontogenesis of dentin-containing tooth (GO:0042475)|palate development (GO:0060021)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol-mediated signaling (GO:0048015)|platelet aggregation (GO:0070527)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|platelet-derived growth factor receptor-alpha signaling pathway (GO:0035790)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cell proliferation by VEGF-activated platelet derived growth factor receptor signaling pathway (GO:0038091)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of DNA replication (GO:0045740)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of phospholipase C activity (GO:0010863)|protein autophosphorylation (GO:0046777)|regulation of actin cytoskeleton reorganization (GO:2000249)|regulation of chemotaxis (GO:0050920)|regulation of mesenchymal stem cell differentiation (GO:2000739)|retina vasculature development in camera-type eye (GO:0061298)|signal transduction involved in regulation of gene expression (GO:0023019)|viral process (GO:0016032)|wound healing (GO:0042060)	cytoplasm (GO:0005737)|external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)|intrinsic component of plasma membrane (GO:0031226)|membrane (GO:0016020)|microvillus (GO:0005902)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|platelet-derived growth factor alpha-receptor activity (GO:0005018)|platelet-derived growth factor binding (GO:0048407)|platelet-derived growth factor receptor binding (GO:0005161)|protein homodimerization activity (GO:0042803)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)|vascular endothelial growth factor binding (GO:0038085)|vascular endothelial growth factor-activated receptor activity (GO:0005021)			NS(1)|autonomic_ganglia(1)|bone(1)|breast(4)|central_nervous_system(17)|cervix(1)|endometrium(4)|eye(1)|gastrointestinal_tract_(site_indeterminate)(1)|haematopoietic_and_lymphoid_tissue(22)|kidney(6)|large_intestine(26)|liver(4)|lung(48)|ovary(4)|prostate(6)|skin(11)|small_intestine(49)|soft_tissue(727)|stomach(32)|urinary_tract(1)	967	all_cancers(7;0.000425)|all_lung(4;0.000343)|Lung NSC(11;0.000467)|all_epithelial(27;0.0131)|all_neural(26;0.0209)|Glioma(25;0.08)		GBM - Glioblastoma multiforme(1;4.18e-71)|all cancers(1;4.76e-45)|LUSC - Lung squamous cell carcinoma(32;0.00256)		Becaplermin(DB00102)|Imatinib(DB00619)|Pazopanib(DB06589)|Ponatinib(DB08901)|Regorafenib(DB08896)|Sunitinib(DB01268)	GGTCTGGAGCGTTTGGGAAGG	0.532			"""Mis, O, T"""	FIP1L1	"""GIST, idiopathic hypereosinophilic syndrome, paediatric GBM"""				Gastrointestinal Stromal Tumors, Sporadic Multiple Primary;Familial Intestinal Neurofibromatosis	TSP Lung(21;0.16)			G|||	1142	0.228035	0.3366	0.2666	5008	,	,		16391	0.1726		0.1064	False		,,,				2504	0.2362				p.A603A	Pancreas(151;208 1913 7310 23853 37092)	.		Dom	yes		4	4q11-q13	5156	"""platelet-derived growth factor, alpha-receptor"""		"""L, M, O"""	.	PDGFRA-9497	0			c.G1809A						.	G		1306,3100	441.2+/-346.3	179,948,1076	141.0	145.0	144.0		1809	-11.3	0.1	4	dbSNP_119	144	855,7745	193.8+/-239.4	54,747,3499	no	coding-synonymous	PDGFRA	NM_006206.4		233,1695,4575	AA,AG,GG		9.9419,29.6414,16.6154		603/1090	55143577	2161,10845	2203	4300	6503	SO:0001819	synonymous_variant	5156	exon13	Familial Cancer Database	Sporadic Multiple GIST;Familial Intestinal Stromal Tumors, NF3B, subset of Familial GIST,	TGGAGCGTTTGGG	D50001	CCDS3495.1	4q12	2014-09-17			ENSG00000134853	ENSG00000134853		"""CD molecules"", ""Immunoglobulin superfamily / I-set domain containing"""	8803	protein-coding gene	gene with protein product		173490					Standard	NM_006206		Approved	CD140a, PDGFR2	uc003han.4	P16234	OTTHUMG00000128699	ENST00000257290.5:c.1809G>A	4.37:g.55143577G>A		Somatic	150	1		WXS	Illumina GAIIx	Phase_I	138	5	NM_006206	0	0	0	0	0	B2RE69|E9PBH0|Q6P4H5|Q96KZ7|Q9UD28	Silent	SNP	ENST00000257290.5	37	CCDS3495.1																																																																																			A|0.170;C|0.000;G|0.830		0.532	PDGFRA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250598.2	NM_006206	
SHROOM3	57619	hgsc.bcm.edu	37	4	77662309	77662309	+	Silent	SNP	C	C	T	rs344143	byFrequency	TCGA-PK-A5HA-01A-11D-A29I-10	TCGA-PK-A5HA-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2bd7613-8a82-453c-b1d0-f0ad6fbc0766	688c5eb5-c374-4bfb-81d1-c0ba622386cf	g.chr4:77662309C>T	ENST00000296043.6	+	5	3936	c.2983C>T	c.(2983-2985)Ctg>Ttg	p.L995L		NM_020859.3	NP_065910.3	Q8TF72	SHRM3_HUMAN	shroom family member 3	995	ASD1. {ECO:0000255|PROSITE- ProRule:PRU00637}.				actin cytoskeleton organization (GO:0030036)|apical protein localization (GO:0045176)|cell morphogenesis (GO:0000902)|cellular pigment accumulation (GO:0043482)|columnar/cuboidal epithelial cell development (GO:0002066)|neural tube closure (GO:0001843)|pattern specification process (GO:0007389)|regulation of cell shape (GO:0008360)	adherens junction (GO:0005912)|apical junction complex (GO:0043296)|apical plasma membrane (GO:0016324)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|microtubule (GO:0005874)				NS(3)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(10)|kidney(2)|large_intestine(6)|lung(29)|ovary(1)|skin(5)|upper_aerodigestive_tract(1)	60			Lung(101;0.0903)			TGAGGGCGACCTGGCCAGGCC	0.741													C|||	1906	0.380591	0.4115	0.4078	5008	,	,		9710	0.2669		0.4245	False		,,,				2504	0.3916				p.L995L		.											.	SHROOM3-93	0			c.C2983T						.	C		1365,2227		322,721,753	3.0	4.0	4.0		2983	-0.1	0.0	4	dbSNP_79	4	3066,4302		771,1524,1389	no	coding-synonymous	SHROOM3	NM_020859.3		1093,2245,2142	TT,TC,CC		41.6124,38.0011,40.4288		995/1997	77662309	4431,6529	1796	3684	5480	SO:0001819	synonymous_variant	57619	exon5			GGCGACCTGGCCA	AB055660	CCDS3579.2	4q21.1	2009-11-25			ENSG00000138771	ENSG00000138771			30422	protein-coding gene	gene with protein product		604570				10589677, 16615870	Standard	NM_020859		Approved	ShrmL, SHRM, KIAA1481, APXL3	uc011cbx.2	Q8TF72	OTTHUMG00000157075	ENST00000296043.6:c.2983C>T	4.37:g.77662309C>T		Somatic	1	0		WXS	Illumina GAIIx	Phase_I	21	16	NM_020859	0	0	0	0	0	Q5QTQ3|Q6ZRW3|Q96IR9|Q9P247	Silent	SNP	ENST00000296043.6	37	CCDS3579.2																																																																																			C|0.604;T|0.396		0.741	SHROOM3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252408.2	NM_020859	
DSPP	1834	bcgsc.ca	37	4	88537294	88537294	+	Silent	SNP	T	T	C	rs111216206		TCGA-PK-A5HA-01A-11D-A29I-10	TCGA-PK-A5HA-10A-01D-A29L-10	T	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2bd7613-8a82-453c-b1d0-f0ad6fbc0766	688c5eb5-c374-4bfb-81d1-c0ba622386cf	g.chr4:88537294T>C	ENST00000282478.7	+	4	3513	c.3480T>C	c.(3478-3480)agT>agC	p.S1160S	DSPP_ENST00000399271.1_Silent_p.S1160S|RP11-742B18.1_ENST00000506480.1_RNA			Q9NZW4	DSPP_HUMAN	dentin sialophosphoprotein	1160	Asp/Ser-rich.				biomineral tissue development (GO:0031214)|cellular response to cell-matrix adhesion (GO:0071460)|extracellular matrix organization (GO:0030198)|multicellular organismal development (GO:0007275)|ossification (GO:0001503)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|collagen binding (GO:0005518)|extracellular matrix structural constituent (GO:0005201)			breast(2)|central_nervous_system(1)|endometrium(9)|kidney(4)|large_intestine(8)|lung(13)|ovary(1)|skin(3)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	47		Hepatocellular(203;0.114)|all_hematologic(202;0.236)		OV - Ovarian serous cystadenocarcinoma(123;0.000508)		gcgacagcagtgacagcagcg	0.567																																					p.S1160S		.											.	DSPP-90	0			c.T3480C						.						43.0	58.0	53.0					4																	88537294		1580	2849	4429	SO:0001819	synonymous_variant	1834	exon5			CAGCAGTGACAGC	AF163151	CCDS43248.1	4q21.3	2008-02-05			ENSG00000152591	ENSG00000152591			3054	protein-coding gene	gene with protein product		125485		DFNA39, DGI1		8995371, 9533027	Standard	NM_014208		Approved	DMP3	uc003hqu.3	Q9NZW4	OTTHUMG00000161061	ENST00000282478.7:c.3480T>C	4.37:g.88537294T>C		Somatic	784	8		WXS	Illumina GAIIx	Phase_I	520	56	NM_014208	0	0	0	0	0	A8MUI0|O95815	Silent	SNP	ENST00000282478.7	37	CCDS43248.1																																																																																			.		0.567	DSPP-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000363616.3	NM_014208	
TMEM155	132332	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	122681582	122681582	+	Missense_Mutation	SNP	G	G	C			TCGA-PK-A5HA-01A-11D-A29I-10	TCGA-PK-A5HA-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2bd7613-8a82-453c-b1d0-f0ad6fbc0766	688c5eb5-c374-4bfb-81d1-c0ba622386cf	g.chr4:122681582G>C	ENST00000337677.5	-	6	818	c.260C>G	c.(259-261)cCa>cGa	p.P87R	TMEM155_ENST00000394396.1_Missense_Mutation_p.P87R|TMEM155_ENST00000394394.1_Missense_Mutation_p.P87R	NM_152399.2	NP_689612.2	Q4W5P6	TM155_HUMAN	transmembrane protein 155	87						extracellular region (GO:0005576)				breast(1)|lung(5)	6						ttttctctgtgggcttcctcc	0.507																																					p.P87R		.											.	TMEM155-90	0			c.C260G						.						61.0	57.0	58.0					4																	122681582		2182	4247	6429	SO:0001583	missense	132332	exon6			CTCTGTGGGCTTC	AK055396	CCDS3721.1	4q27	2008-02-05			ENSG00000164112	ENSG00000164112			26418	protein-coding gene	gene with protein product							Standard	NM_152399		Approved	FLJ30834	uc003idx.1	Q4W5P6	OTTHUMG00000133035	ENST00000337677.5:c.260C>G	4.37:g.122681582G>C	ENSP00000336987:p.Pro87Arg	Somatic	121	0		WXS	Illumina GAIIx	Phase_I	100	22	NM_152399	0	0	0	0	0	D3DNW9|Q96NI2	Missense_Mutation	SNP	ENST00000337677.5	37	CCDS3721.1	.	.	.	.	.	.	.	.	.	.	G	10.31	1.313857	0.23908	.	.	ENSG00000164112	ENST00000394396;ENST00000337677;ENST00000394394	T;T;T	0.57595	0.39;0.39;0.39	4.2	-0.0531	0.13819	.	0.664722	0.12627	N	0.452524	T	0.30885	0.0779	N	0.19112	0.55	0.09310	N	1	P	0.44816	0.844	B	0.39152	0.292	T	0.18241	-1.0343	10	0.87932	D	0	-5.1438	3.8131	0.08805	0.0975:0.4481:0.3043:0.1502	.	87	Q4W5P6	TM155_HUMAN	R	87	ENSP00000377919:P87R;ENSP00000336987:P87R;ENSP00000377917:P87R	ENSP00000336987:P87R	P	-	2	0	TMEM155	122901032	0.000000	0.05858	0.000000	0.03702	0.089000	0.18198	0.382000	0.20635	-0.064000	0.13043	0.650000	0.86243	CCA	.		0.507	TMEM155-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256637.2	NM_152399	
SORBS2	8470	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	4	186535995	186535995	+	Missense_Mutation	SNP	G	G	A			TCGA-PK-A5HA-01A-11D-A29I-10	TCGA-PK-A5HA-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2bd7613-8a82-453c-b1d0-f0ad6fbc0766	688c5eb5-c374-4bfb-81d1-c0ba622386cf	g.chr4:186535995G>A	ENST00000284776.7	-	17	3382	c.2873C>T	c.(2872-2874)tCa>tTa	p.S958L	SORBS2_ENST00000393528.3_Missense_Mutation_p.S524L|SORBS2_ENST00000498125.1_5'UTR|SORBS2_ENST00000449407.2_Missense_Mutation_p.S502L|SORBS2_ENST00000319471.9_Missense_Mutation_p.S589L|SORBS2_ENST00000355634.5_Missense_Mutation_p.S1058L|SORBS2_ENST00000418609.1_Missense_Mutation_p.S862L|SORBS2_ENST00000431808.1_Missense_Mutation_p.S958L|SORBS2_ENST00000437304.2_Missense_Mutation_p.S682L|SORBS2_ENST00000448662.2_Missense_Mutation_p.S519L	NM_021069.4	NP_066547.1	O94875	SRBS2_HUMAN	sorbin and SH3 domain containing 2	958	SH3 2. {ECO:0000255|PROSITE- ProRule:PRU00192}.				actin filament organization (GO:0007015)|cell adhesion (GO:0007155)|cell migration (GO:0016477)	actin cytoskeleton (GO:0015629)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|Z disc (GO:0030018)	cytoskeletal adaptor activity (GO:0008093)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|structural constituent of cytoskeleton (GO:0005200)|structural constituent of muscle (GO:0008307)			endometrium(7)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(9)|lung(21)|ovary(2)|prostate(2)|skin(4)|urinary_tract(1)	53		all_cancers(14;4.27e-52)|all_epithelial(14;6.58e-39)|all_lung(41;1.42e-13)|Lung NSC(41;3.73e-13)|Melanoma(20;1.91e-06)|Colorectal(36;0.00692)|Hepatocellular(41;0.00826)|Renal(120;0.00994)|Prostate(90;0.0101)|all_hematologic(60;0.0174)|all_neural(102;0.244)		OV - Ovarian serous cystadenocarcinoma(60;1.54e-09)|BRCA - Breast invasive adenocarcinoma(30;0.000232)|GBM - Glioblastoma multiforme(59;0.000385)|STAD - Stomach adenocarcinoma(60;0.00109)|LUSC - Lung squamous cell carcinoma(40;0.0205)		CTTTCTCAGTGACAGCTCCAC	0.438																																					p.S1058L	Esophageal Squamous(153;41 2433 9491 36028)	.											.	SORBS2-91	0			c.C3173T						.						109.0	111.0	111.0					4																	186535995		2203	4300	6503	SO:0001583	missense	8470	exon20			CTCAGTGACAGCT		CCDS3845.1, CCDS43289.2, CCDS47173.1, CCDS47174.1, CCDS47175.1, CCDS47176.1, CCDS54825.1, CCDS59482.1	4q35.1	2008-02-05			ENSG00000154556	ENSG00000154556			24098	protein-coding gene	gene with protein product	"""Arg/Abl interacting protein"""					9211900, 9872452	Standard	NM_021069		Approved	ARGBP2, KIAA0777	uc003iym.3	O94875	OTTHUMG00000157215	ENST00000284776.7:c.2873C>T	4.37:g.186535995G>A	ENSP00000284776:p.Ser958Leu	Somatic	96	0		WXS	Illumina GAIIx	Phase_I	91	10	NM_001270771	0	0	0	0	0	A6NEK9|B3KPQ7|B7Z1G5|B7Z3X6|C9JKV9|D3DP62|D3DP63|E9PAS5|E9PAW4|G3XAI0|H7BXR4|J3KNZ5|O60592|O60593|Q96EX0	Missense_Mutation	SNP	ENST00000284776.7	37	CCDS3845.1	.	.	.	.	.	.	.	.	.	.	G	24.5	4.536627	0.85812	.	.	ENSG00000154556	ENST00000284776;ENST00000448662;ENST00000431808;ENST00000418609;ENST00000437304;ENST00000319471;ENST00000449407;ENST00000355634;ENST00000393528;ENST00000319454	T;T;T;T;T;T;T;T;T;T	0.39056	1.1;1.1;1.1;1.1;1.1;1.1;1.1;1.1;1.1;1.1	5.94	5.94	0.96194	Src homology-3 domain (4);	0.000000	0.85682	D	0.000000	T	0.76471	0.3992	H	0.94582	3.555	0.80722	D	1	D;D;B;P;D;D;B;B;D;D;D;D;D;D	0.89917	0.992;0.972;0.444;0.883;0.996;0.984;0.444;0.17;0.987;1.0;1.0;0.988;0.997;0.994	D;P;B;P;D;P;B;B;D;D;D;D;D;D	0.87578	0.974;0.77;0.285;0.718;0.993;0.757;0.285;0.345;0.93;0.998;0.98;0.923;0.988;0.981	T	0.82176	-0.0587	10	0.87932	D	0	-11.4289	20.3771	0.98923	0.0:0.0:1.0:0.0	.	524;519;862;350;407;549;1058;958;502;682;519;549;503;524	G3XAI0;C9JKV9;B7Z3X6;B7Z997;B3KPU4;O94875-4;B3KPQ7;O94875;E9PAS5;E9PAW4;B7Z1G5;O94875-5;O94875-3;O94875-2	.;.;.;.;.;.;.;SRBS2_HUMAN;.;.;.;.;.;.	L	958;519;958;862;682;589;502;1058;524;549	ENSP00000284776:S958L;ENSP00000409158:S519L;ENSP00000411764:S958L;ENSP00000397482:S862L;ENSP00000396008:S682L;ENSP00000322182:S589L;ENSP00000397262:S502L;ENSP00000347852:S1058L;ENSP00000377162:S524L;ENSP00000321983:S549L	ENSP00000284776:S958L	S	-	2	0	SORBS2	186772989	1.000000	0.71417	0.166000	0.22797	0.759000	0.43091	9.809000	0.99208	2.824000	0.97209	0.650000	0.86243	TCA	.		0.438	SORBS2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000347944.3	NM_003603	
NLN	57486	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	65054536	65054536	+	Missense_Mutation	SNP	G	G	C			TCGA-PK-A5HA-01A-11D-A29I-10	TCGA-PK-A5HA-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2bd7613-8a82-453c-b1d0-f0ad6fbc0766	688c5eb5-c374-4bfb-81d1-c0ba622386cf	g.chr5:65054536G>C	ENST00000380985.5	+	2	362	c.184G>C	c.(184-186)Gag>Cag	p.E62Q	NLN_ENST00000502464.1_Intron	NM_020726.4	NP_065777.1	Q9BYT8	NEUL_HUMAN	neurolysin (metallopeptidase M3 family)	62						mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)|metalloendopeptidase activity (GO:0004222)|peptide binding (GO:0042277)			central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(4)|lung(10)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	26		Lung NSC(167;7.21e-05)|Prostate(74;0.0174)|Ovarian(174;0.186)		UCEC - Uterine corpus endometrioid carcinoma (4;0.0743)|Lung(70;0.00616)		AACAAGAACTGAGGAGCTCAT	0.448																																					p.E62Q		.											.	NLN-90	0			c.G184C						.						110.0	101.0	104.0					5																	65054536		2203	4300	6503	SO:0001583	missense	57486	exon2			AGAACTGAGGAGC	AJ300837	CCDS3989.1	5q12.3	2008-02-05	2005-03-31		ENSG00000123213	ENSG00000123213	3.4.24.16		16058	protein-coding gene	gene with protein product		611530	"""angiotensin binding protein"""	AGTBP		10574462	Standard	NM_020726		Approved	KIAA1226	uc003juf.3	Q9BYT8	OTTHUMG00000097803	ENST00000380985.5:c.184G>C	5.37:g.65054536G>C	ENSP00000370372:p.Glu62Gln	Somatic	168	0		WXS	Illumina GAIIx	Phase_I	194	65	NM_020726	0	0	6	7	1	Q9ULJ4	Missense_Mutation	SNP	ENST00000380985.5	37	CCDS3989.1	.	.	.	.	.	.	.	.	.	.	G	18.71	3.682245	0.68042	.	.	ENSG00000123213	ENST00000380985;ENST00000340159	T	0.10005	2.92	5.5	5.5	0.81552	Neurolysin/Thimet oligopeptidase, N-terminal (1);	0.254451	0.40469	N	0.001087	T	0.16938	0.0407	L	0.52364	1.645	0.80722	D	1	B;P	0.42757	0.009;0.789	B;B	0.43301	0.01;0.415	T	0.00503	-1.1701	10	0.46703	T	0.11	-19.3608	19.4102	0.94670	0.0:0.0:1.0:0.0	.	62;62	Q9BYT8;Q9BQD0	NEUL_HUMAN;.	Q	62	ENSP00000370372:E62Q	ENSP00000339283:E62Q	E	+	1	0	NLN	65090292	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.193000	0.94954	2.599000	0.87857	0.655000	0.94253	GAG	.		0.448	NLN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000215060.1		
PCDHB8	56128	hgsc.bcm.edu	37	5	140559493	140559493	+	Silent	SNP	C	C	T	rs34866056		TCGA-PK-A5HA-01A-11D-A29I-10	TCGA-PK-A5HA-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2bd7613-8a82-453c-b1d0-f0ad6fbc0766	688c5eb5-c374-4bfb-81d1-c0ba622386cf	g.chr5:140559493C>T	ENST00000239444.2	+	1	2123	c.1878C>T	c.(1876-1878)cgC>cgT	p.R626R	PCDHB16_ENST00000361016.2_5'Flank	NM_019120.3	NP_061993.2	Q9UN66	PCDB8_HUMAN	protocadherin beta 8	626	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.R626R(2)		NS(2)|breast(1)|cervix(2)|endometrium(5)|kidney(6)|large_intestine(14)|liver(1)|lung(38)|prostate(6)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(2)	83			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			GCGAGGTGCGCACCGCCAGGC	0.701																																					p.R626R		.											.	PCDHB8-131	2	Substitution - coding silent(2)	prostate(2)	c.C1878T						.																																			SO:0001819	synonymous_variant	56128	exon1			GGTGCGCACCGCC	AF152501	CCDS4250.1	5q31	2010-01-26			ENSG00000120322	ENSG00000120322		"""Cadherins / Protocadherins : Clustered"""	8693	other	protocadherin		606334				10380929	Standard	NM_019120		Approved	PCDH-BETA8, PCDH3I	uc011dai.2	Q9UN66	OTTHUMG00000129621	ENST00000239444.2:c.1878C>T	5.37:g.140559493C>T		Somatic	7	0		WXS	Illumina GAIIx	Phase_I	144	11	NM_019120	0	0	78	97	19	B9EGV1	Silent	SNP	ENST00000239444.2	37	CCDS4250.1																																																																																			.		0.701	PCDHB8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251816.2	NM_019120	
PCDHB12	56124	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	140590650	140590650	+	Missense_Mutation	SNP	G	G	A			TCGA-PK-A5HA-01A-11D-A29I-10	TCGA-PK-A5HA-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2bd7613-8a82-453c-b1d0-f0ad6fbc0766	688c5eb5-c374-4bfb-81d1-c0ba622386cf	g.chr5:140590650G>A	ENST00000239450.2	+	1	2360	c.2171G>A	c.(2170-2172)cGc>cAc	p.R724H	PCDHB12_ENST00000541609.1_Missense_Mutation_p.R387H|PCDHB13_ENST00000341948.4_5'Flank	NM_018932.3	NP_061755.1	Q9Y5F1	PCDBC_HUMAN	protocadherin beta 12	724					cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			NS(1)|breast(3)|endometrium(10)|large_intestine(17)|lung(38)|ovary(3)|pancreas(1)|prostate(2)|skin(7)|stomach(1)	83			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			CCGGTCGGTCGCTGCTCGGTG	0.657																																					p.R724H		.											.	PCDHB12-93	0			c.G2171A						.						69.0	78.0	75.0					5																	140590650		2203	4300	6503	SO:0001583	missense	56124	exon1			TCGGTCGCTGCTC	AF152491	CCDS4254.1	5q31	2010-01-26			ENSG00000120328	ENSG00000120328		"""Cadherins / Protocadherins : Clustered"""	8683	other	protocadherin		606338				10380929	Standard	NM_018932		Approved	PCDH-BETA12	uc003liz.3	Q9Y5F1	OTTHUMG00000129620	ENST00000239450.2:c.2171G>A	5.37:g.140590650G>A	ENSP00000239450:p.Arg724His	Somatic	63	0		WXS	Illumina GAIIx	Phase_I	111	19	NM_018932	0	0	4	5	1	B4DDU1	Missense_Mutation	SNP	ENST00000239450.2	37	CCDS4254.1	.	.	.	.	.	.	.	.	.	.	G	16.68	3.190749	0.58017	.	.	ENSG00000120328	ENST00000541609;ENST00000239450;ENST00000507840	T;T	0.54071	0.59;0.76	3.67	-2.34	0.06704	.	.	.	.	.	T	0.52500	0.1738	M	0.76002	2.32	0.09310	N	1	P	0.38535	0.635	P	0.44732	0.459	T	0.52808	-0.8526	9	0.59425	D	0.04	.	4.3541	0.11169	0.1001:0.1228:0.571:0.2062	.	724	Q9Y5F1	PCDBC_HUMAN	H	387;724;344	ENSP00000440199:R387H;ENSP00000239450:R724H	ENSP00000239450:R724H	R	+	2	0	PCDHB12	140570834	0.000000	0.05858	0.000000	0.03702	0.401000	0.30781	0.500000	0.22562	-0.049000	0.13379	0.479000	0.44913	CGC	.		0.657	PCDHB12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251815.2	NM_018932	
CSF1R	1436	broad.mit.edu	37	5	149441082	149441082	+	Silent	SNP	G	G	T	rs200536087		TCGA-PK-A5HA-01A-11D-A29I-10	TCGA-PK-A5HA-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2bd7613-8a82-453c-b1d0-f0ad6fbc0766	688c5eb5-c374-4bfb-81d1-c0ba622386cf	g.chr5:149441082G>T	ENST00000286301.3	-	13	2121	c.1830C>A	c.(1828-1830)gtC>gtA	p.V610V	CSF1R_ENST00000515239.1_5'UTR	NM_005211.3	NP_005202.2	P07333	CSF1R_HUMAN	colony stimulating factor 1 receptor	610	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.		GKTLGAGAFGKVVEATAFGLGKEDAVLKVAVKMLK -> A (in HDLS). {ECO:0000269|PubMed:22197934}.		cell proliferation (GO:0008283)|cell-cell junction maintenance (GO:0045217)|cellular response to cytokine stimulus (GO:0071345)|cellular response to macrophage colony-stimulating factor stimulus (GO:0036006)|cytokine-mediated signaling pathway (GO:0019221)|hemopoiesis (GO:0030097)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|macrophage differentiation (GO:0030225)|mammary gland duct morphogenesis (GO:0060603)|monocyte differentiation (GO:0030224)|multicellular organismal development (GO:0007275)|osteoclast differentiation (GO:0030316)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol metabolic process (GO:0046488)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cell migration (GO:0030335)|positive regulation of cell motility (GO:2000147)|positive regulation of cell proliferation (GO:0008284)|positive regulation of chemokine secretion (GO:0090197)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of protein serine/threonine kinase activity (GO:0071902)|positive regulation of protein tyrosine kinase activity (GO:0061098)|positive regulation of tyrosine phosphorylation of Stat3 protein (GO:0042517)|protein autophosphorylation (GO:0046777)|regulation of actin cytoskeleton reorganization (GO:2000249)|regulation of bone resorption (GO:0045124)|regulation of cell shape (GO:0008360)|ruffle organization (GO:0031529)|signal transduction (GO:0007165)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|cytokine binding (GO:0019955)|macrophage colony-stimulating factor receptor activity (GO:0005011)|protein homodimerization activity (GO:0042803)			NS(2)|breast(2)|central_nervous_system(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(38)|kidney(2)|large_intestine(6)|liver(3)|lung(23)|ovary(2)|pancreas(1)|prostate(3)|upper_aerodigestive_tract(2)|urinary_tract(3)	93			KIRC - Kidney renal clear cell carcinoma(527;0.000962)|Kidney(363;0.00147)		Imatinib(DB00619)|Sunitinib(DB01268)	CCACCTTCAGGACAGCATCCT	0.617													G|||	1	0.000199681	0.0	0.0014	5008	,	,		13732	0.0		0.0	False		,,,				2504	0.0				p.V610V		.											.	CSF1R-2640	0			c.C1830A						.						149.0	137.0	141.0					5																	149441082		2203	4300	6503	SO:0001819	synonymous_variant	1436	exon13			CTTCAGGACAGCA	U63963	CCDS4302.1	5q32	2013-01-11	2008-08-01		ENSG00000182578	ENSG00000182578		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	2433	protein-coding gene	gene with protein product		164770	"""McDonough feline sarcoma viral (v-fms) oncogene homolog"""	FMS		1611909	Standard	NM_005211		Approved	C-FMS, CSFR, CD115	uc003lrm.3	P07333	OTTHUMG00000130050	ENST00000286301.3:c.1830C>A	5.37:g.149441082G>T		Somatic	51	0		WXS	Illumina GAIIx	Phase_I	85	3	NM_005211	0	0	37	37	0	B5A955|D3DQG2|Q6LDW5|Q6LDY4|Q86VW7	Silent	SNP	ENST00000286301.3	37	CCDS4302.1																																																																																			G|0.999;T|0.000		0.617	CSF1R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252329.2	NM_005211	
HUS1B	135458	hgsc.bcm.edu	37	6	656555	656555	+	Missense_Mutation	SNP	G	G	T	rs1766848	byFrequency	TCGA-PK-A5HA-01A-11D-A29I-10	TCGA-PK-A5HA-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2bd7613-8a82-453c-b1d0-f0ad6fbc0766	688c5eb5-c374-4bfb-81d1-c0ba622386cf	g.chr6:656555G>T	ENST00000380907.2	-	1	408	c.390C>A	c.(388-390)caC>caA	p.H130Q	EXOC2_ENST00000230449.4_Intron|EXOC2_ENST00000448181.3_Intron	NM_148959.3	NP_683762.2	Q8NHY5	HUS1B_HUMAN	HUS1 checkpoint homolog b (S. pombe)	130			H -> Q (in dbSNP:rs1766848).		DNA damage checkpoint (GO:0000077)|DNA repair (GO:0006281)	checkpoint clamp complex (GO:0030896)|nucleolus (GO:0005730)				endometrium(3)|large_intestine(1)|lung(7)	11	Ovarian(93;0.0733)	Breast(5;0.00139)|all_lung(73;0.0691)|all_hematologic(90;0.0895)		OV - Ovarian serous cystadenocarcinoma(45;0.041)|BRCA - Breast invasive adenocarcinoma(62;0.0965)		CGGGCAGATCGTGCACCACGC	0.731													G|||	327	0.0652955	0.0121	0.1297	5008	,	,		14786	0.0694		0.0964	False		,,,				2504	0.0552				p.H130Q		.											.	HUS1B-227	0			c.C390A						.	G	,GLN/HIS	83,4301		0,83,2109	17.0	21.0	20.0		,390	-2.9	0.0	6	dbSNP_89	20	799,7759		33,733,3513	yes	intron,missense	EXOC2,HUS1B	NM_018303.4,NM_148959.3	,24	33,816,5622	TT,TG,GG		9.3363,1.8932,6.815	,possibly-damaging	,130/279	656555	882,12060	2192	4279	6471	SO:0001583	missense	135458	exon1			CAGATCGTGCACC	AF508547	CCDS4470.1	6p25.3	2008-08-08	2001-11-28		ENSG00000188996	ENSG00000188996			16485	protein-coding gene	gene with protein product		609713	"""HUS1 (S. pombe) checkpoint homolog b"""			11944979	Standard	NM_148959		Approved		uc003mtg.3	Q8NHY5	OTTHUMG00000090059	ENST00000380907.2:c.390C>A	6.37:g.656555G>T	ENSP00000370293:p.His130Gln	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	34	19	NM_148959	0	0	0	0	0	Q5T4Z2	Missense_Mutation	SNP	ENST00000380907.2	37	CCDS4470.1	135	0.061813186813186816	10	0.02032520325203252	29	0.08011049723756906	26	0.045454545454545456	70	0.09234828496042216	G	13.85	2.361073	0.41801	0.018932	0.093363	ENSG00000188996	ENST00000380907	T	0.11821	2.74	3.44	-2.93	0.05598	.	0.000000	0.85682	U	0.000000	T	0.09862	0.0242	M	0.62154	1.92	0.46028	P	0.0011719999999999509	D	0.76494	0.999	D	0.74023	0.982	T	0.23048	-1.0199	9	0.06365	T	0.9	.	8.8272	0.35063	0.6959:0.0:0.3041:0.0	rs1766848;rs17236996;rs61178836;rs1766848	130	Q8NHY5	HUS1B_HUMAN	Q	130	ENSP00000370293:H130Q	ENSP00000370293:H130Q	H	-	3	2	HUS1B	601555	0.001000	0.12720	0.000000	0.03702	0.010000	0.07245	-0.096000	0.11059	-0.638000	0.05509	-0.258000	0.10820	CAC	G|0.938;T|0.062		0.731	HUS1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000205617.2	NM_148959	
FOXQ1	94234	hgsc.bcm.edu	37	6	1313078	1313078	+	Missense_Mutation	SNP	G	G	A	rs78460560	byFrequency	TCGA-PK-A5HA-01A-11D-A29I-10	TCGA-PK-A5HA-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2bd7613-8a82-453c-b1d0-f0ad6fbc0766	688c5eb5-c374-4bfb-81d1-c0ba622386cf	g.chr6:1313078G>A	ENST00000296839.2	+	1	404	c.139G>A	c.(139-141)Gcg>Acg	p.A47T		NM_033260.3	NP_150285.3	Q9C009	FOXQ1_HUMAN	forkhead box Q1	47	Ala/Gly-rich.				hair follicle morphogenesis (GO:0031069)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			lung(1)|urinary_tract(1)	2	Ovarian(93;0.0733)	Breast(5;0.052)|all_lung(73;0.0713)|all_hematologic(90;0.0895)		OV - Ovarian serous cystadenocarcinoma(45;0.0954)|BRCA - Breast invasive adenocarcinoma(62;0.18)		TGGGGACTGCGCGGCCAACAG	0.776													G|||	1032	0.20607	0.152	0.1167	5008	,	,		7714	0.3204		0.2028	False		,,,				2504	0.228				p.A47T		.											.	FOXQ1-226	0			c.G139A						.	G	THR/ALA	383,2509		22,339,1085	4.0	6.0	5.0		139	2.8	0.6	6	dbSNP_131	5	975,4829		79,817,2006	no	missense	FOXQ1	NM_033260.3	58	101,1156,3091	AA,AG,GG		16.7988,13.2434,15.6164	benign	47/404	1313078	1358,7338	1446	2902	4348	SO:0001583	missense	94234	exon1			GACTGCGCGGCCA	AF153341	CCDS4471.1	6p25	2008-02-05			ENSG00000164379	ENSG00000164379		"""Forkhead boxes"""	20951	protein-coding gene	gene with protein product		612788				11747606, 12011061	Standard	NM_033260		Approved	HFH1	uc003mtl.4	Q9C009	OTTHUMG00000016160	ENST00000296839.2:c.139G>A	6.37:g.1313078G>A	ENSP00000296839:p.Ala47Thr	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	5	4	NM_033260	0	0	0	0	0	Q9NS06	Missense_Mutation	SNP	ENST00000296839.2	37	CCDS4471.1	515	0.2358058608058608	92	0.18699186991869918	61	0.1685082872928177	186	0.32517482517482516	176	0.23218997361477572	G	12.03	1.816453	0.32145	0.132434	0.167988	ENSG00000164379	ENST00000296839	T	0.55760	0.5	3.7	2.83	0.33086	.	0.188662	0.33938	N	0.004403	T	0.18467	0.0443	L	0.40543	1.245	0.43642	P	0.003958000000000017	P	0.47106	0.89	B	0.30646	0.118	T	0.04255	-1.0965	9	0.52906	T	0.07	.	9.136	0.36875	0.1132:0.0:0.8868:0.0	.	47	Q9C009	FOXQ1_HUMAN	T	47	ENSP00000296839:A47T	ENSP00000296839:A47T	A	+	1	0	FOXQ1	1258078	0.028000	0.19301	0.567000	0.28434	0.485000	0.33311	1.776000	0.38594	0.551000	0.29008	-0.384000	0.06662	GCG	G|0.763;A|0.237		0.776	FOXQ1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043410.1	NM_033260	
GCNT2	2651	broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	10586905	10586905	+	Intron	SNP	G	G	A			TCGA-PK-A5HA-01A-11D-A29I-10	TCGA-PK-A5HA-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2bd7613-8a82-453c-b1d0-f0ad6fbc0766	688c5eb5-c374-4bfb-81d1-c0ba622386cf	g.chr6:10586905G>A	ENST00000379597.3	+	2	1481				GCNT2_ENST00000397423.2_Intron|GCNT2_ENST00000410107.1_Intron|GCNT2_ENST00000265012.4_Missense_Mutation_p.R228Q|GCNT2_ENST00000316170.3_Intron|GCNT2_ENST00000495262.1_Intron			Q8N0V5	GNT2A_HUMAN	glucosaminyl (N-acetyl) transferase 2, I-branching enzyme (I blood group)						maintenance of lens transparency (GO:0036438)|negative regulation of cell-substrate adhesion (GO:0010812)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of heterotypic cell-cell adhesion (GO:0034116)|positive regulation of protein kinase B signaling (GO:0051897)|posttranscriptional regulation of gene expression (GO:0010608)|protein glycosylation (GO:0006486)|transforming growth factor beta receptor signaling pathway (GO:0007179)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	N-acetyllactosaminide beta-1,6-N-acetylglucosaminyltransferase activity (GO:0008109)			endometrium(2)|kidney(1)|large_intestine(5)|lung(2)|ovary(2)	12	Ovarian(93;0.107)|Breast(50;0.148)	all_hematologic(90;0.107)		KIRC - Kidney renal clear cell carcinoma(1;0.099)|Kidney(1;0.119)		GCAATTAAGCGAACTAAATAT	0.418																																					p.R228Q		.											.	GCNT2-92	0			c.G683A						.						72.0	76.0	75.0					6																	10586905		2203	4300	6503	SO:0001627	intron_variant	2651	exon1			TTAAGCGAACTAA	L41605	CCDS4512.1, CCDS4513.1, CCDS34338.1	6p24.2	2014-07-18	2006-02-23		ENSG00000111846	ENSG00000111846	2.4.1.150	"""Blood group antigens"", ""Glucosaminyl (N-acetyl) transferase and xylosyltransferase family"""	4204	protein-coding gene	gene with protein product	"""Ii blood group"", ""unassigned linkage group 3"""	600429	"""glucosaminyl (N-acetyl) transferase 5"", ""glucosaminyl (N-acetyl) transferase 2, I-branching enzyme"", ""glucosaminyl (N-acetyl) transferase 2, I-branching enzyme (Ii blood group)"", ""cataract, congenital"""	NACGT1, II, GCNT5, CCAT		8449405, 9915862	Standard	NM_145649		Approved	IGNT, NAGCT1, bA421M1.1, bA360O19.2, ULG3	uc003mze.3	Q06430	OTTHUMG00000014244	ENST00000379597.3:c.926-34679G>A	6.37:g.10586905G>A		Somatic	169	1		WXS	Illumina GAIIx	Phase_I	194	31	NM_145655	0	0	0	0	0		Missense_Mutation	SNP	ENST00000379597.3	37	CCDS34338.1	.	.	.	.	.	.	.	.	.	.	G	18.65	3.669014	0.67814	.	.	ENSG00000111846	ENST00000265012	T	0.11712	2.75	5.47	5.47	0.80525	.	.	.	.	.	T	0.41096	0.1144	H	0.94183	3.505	0.52501	D	0.999953	D	0.89917	1.0	D	0.87578	0.998	T	0.58244	-0.7670	9	0.87932	D	0	.	19.3314	0.94291	0.0:0.0:1.0:0.0	rs55795227	228	Q8NFS9	GNT2C_HUMAN	Q	228	ENSP00000265012:R228Q	ENSP00000265012:R228Q	R	+	2	0	GCNT2	10694891	1.000000	0.71417	0.201000	0.23476	0.043000	0.13939	5.558000	0.67319	2.552000	0.86080	0.655000	0.94253	CGA	.		0.418	GCNT2-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000327912.3	NM_145649	
HIVEP1	3096	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	12125518	12125518	+	Missense_Mutation	SNP	G	G	C	rs201245007		TCGA-PK-A5HA-01A-11D-A29I-10	TCGA-PK-A5HA-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2bd7613-8a82-453c-b1d0-f0ad6fbc0766	688c5eb5-c374-4bfb-81d1-c0ba622386cf	g.chr6:12125518G>C	ENST00000379388.2	+	4	5822	c.5490G>C	c.(5488-5490)ttG>ttC	p.L1830F	HIVEP1_ENST00000541134.1_5'Flank	NM_002114.2	NP_002105.2	P15822	ZEP1_HUMAN	human immunodeficiency virus type I enhancer binding protein 1	1830					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	mitochondrion (GO:0005739)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(5)|central_nervous_system(1)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(11)|liver(1)|lung(31)|ovary(4)|prostate(1)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(3)	90	Breast(50;0.0639)|Ovarian(93;0.0816)	all_hematologic(90;0.117)				CTGTTAATTTGACAAATGTTT	0.358																																					p.L1830F		.											.	HIVEP1-139	0			c.G5490C						.						124.0	114.0	117.0					6																	12125518		1833	4087	5920	SO:0001583	missense	3096	exon4			TAATTTGACAAAT	J05011	CCDS43426.1	6p24-p22.3	2012-10-05	2001-11-28		ENSG00000095951	ENSG00000095951		"""Zinc fingers, C2H2-type"""	4920	protein-coding gene	gene with protein product		194540	"""human immunodeficiency virus type I enhancer-binding protein 1"", ""zinc finger protein 40"""	ZNF40		2037300	Standard	XR_241895		Approved	CIRIP, MBP-1, CRYBP1, PRDII-BF1, ZAS1, Schnurri-1, ZNF40A	uc003nac.3	P15822	OTTHUMG00000014265	ENST00000379388.2:c.5490G>C	6.37:g.12125518G>C	ENSP00000368698:p.Leu1830Phe	Somatic	117	0		WXS	Illumina GAIIx	Phase_I	120	38	NM_002114	0	0	2	3	1	B2RTU3|Q14122|Q5MPB1|Q5VW60	Missense_Mutation	SNP	ENST00000379388.2	37	CCDS43426.1	.	.	.	.	.	.	.	.	.	.	G	2.449	-0.326900	0.05350	.	.	ENSG00000095951	ENST00000379388	T	0.10382	2.88	5.33	1.56	0.23342	.	0.314577	0.17702	N	0.164891	T	0.06735	0.0172	L	0.46157	1.445	0.09310	N	0.999999	D	0.62365	0.991	P	0.55871	0.786	T	0.18808	-1.0325	9	.	.	.	-2.3655	5.4746	0.16688	0.3603:0.0:0.5059:0.1337	.	1830	P15822	ZEP1_HUMAN	F	1830	ENSP00000368698:L1830F	.	L	+	3	2	HIVEP1	12233504	0.170000	0.23016	0.001000	0.08648	0.033000	0.12548	0.474000	0.22148	0.098000	0.17522	0.655000	0.94253	TTG	G|0.999;A|0.000		0.358	HIVEP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039870.2	NM_002114	
RANBP9	10048	bcgsc.ca	37	6	13711279	13711279	+	Silent	SNP	A	A	G	rs6905991	byFrequency	TCGA-PK-A5HA-01A-11D-A29I-10	TCGA-PK-A5HA-10A-01D-A29L-10	A	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2bd7613-8a82-453c-b1d0-f0ad6fbc0766	688c5eb5-c374-4bfb-81d1-c0ba622386cf	g.chr6:13711279A>G	ENST00000011619.3	-	1	517	c.459T>C	c.(457-459)cgT>cgC	p.R153R		NM_005493.2	NP_005484.2	Q96S59	RANB9_HUMAN	RAN binding protein 9	153	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.				axon guidance (GO:0007411)|microtubule nucleation (GO:0007020)|protein complex assembly (GO:0006461)	cytosol (GO:0005829)|microtubule associated complex (GO:0005875)|nucleus (GO:0005634)	enzyme binding (GO:0019899)|Ran GTPase binding (GO:0008536)			breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(8)|skin(1)	16	Breast(50;0.00669)|Ovarian(93;0.0634)	all_hematologic(90;0.117)	Epithelial(50;0.223)			CCGGGTAGAGACGCTTCAGCC	0.677													G|||	2173	0.433906	0.4796	0.4179	5008	,	,		7364	0.2847		0.4622	False		,,,				2504	0.5082				p.R153R		.											.	RANBP9-414	0			c.T459C						.	G		1906,2464		464,978,743	12.0	14.0	13.0		459	2.6	1.0	6	dbSNP_116	13	3907,4663		916,2075,1294	no	coding-synonymous	RANBP9	NM_005493.2		1380,3053,2037	GG,GA,AA		45.5893,43.6156,44.9227		153/730	13711279	5813,7127	2185	4285	6470	SO:0001819	synonymous_variant	10048	exon1			GTAGAGACGCTTC	AB008515	CCDS4529.1	6p23	2010-05-25			ENSG00000010017	ENSG00000010017			13727	protein-coding gene	gene with protein product	"""Ran Binding Protein in the Microtubule organizing center"""	603854				9817760	Standard	NM_005493		Approved	RanBPM	uc003nbb.3	Q96S59	OTTHUMG00000015642	ENST00000011619.3:c.459T>C	6.37:g.13711279A>G		Somatic	87	0		WXS	Illumina GAIIx	Phase_I	127	5	NM_005493	0	0	7	7	0	A0PJA2|B2R8E1|O94764|Q6P3T7|Q7LBR2|Q7Z7F9	Silent	SNP	ENST00000011619.3	37	CCDS4529.1																																																																																			A|0.575;C|0.000;G|0.424;T|0.000		0.677	RANBP9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042373.1		
NHLRC1	378884	hgsc.bcm.edu	37	6	18122526	18122526	+	Silent	SNP	A	A	G	rs115931931	byFrequency	TCGA-PK-A5HA-01A-11D-A29I-10	TCGA-PK-A5HA-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2bd7613-8a82-453c-b1d0-f0ad6fbc0766	688c5eb5-c374-4bfb-81d1-c0ba622386cf	g.chr6:18122526A>G	ENST00000340650.3	-	1	325	c.312T>C	c.(310-312)caT>caC	p.H104H		NM_198586.2	NP_940988.2	Q6VVB1	NHLC1_HUMAN	NHL repeat containing E3 ubiquitin protein ligase 1	104					autophagy (GO:0006914)|carbohydrate metabolic process (GO:0005975)|glucose metabolic process (GO:0006006)|glycogen biosynthetic process (GO:0005978)|positive regulation of protein ubiquitination (GO:0031398)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein polyubiquitination (GO:0000209)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(1)|kidney(1)|large_intestine(3)|lung(3)|skin(1)|urinary_tract(2)	11	Ovarian(93;0.016)|Breast(50;0.0245)	all_hematologic(90;0.165)	all cancers(50;0.0451)|Epithelial(50;0.0493)			GGGCGGCGCGATGGGCGGCCG	0.726													G|||	580	0.115815	0.2277	0.1138	5008	,	,		13206	0.0218		0.0905	False		,,,				2504	0.089				p.H104H		.											.	NHLRC1-90	0			c.T312C						.	G		697,3599		63,571,1514	7.0	9.0	9.0		312	-4.7	0.0	6	dbSNP_132	9	658,7728		34,590,3569	no	coding-synonymous	NHLRC1	NM_198586.2		97,1161,5083	GG,GA,AA		7.8464,16.2244,10.6844		104/396	18122526	1355,11327	2148	4193	6341	SO:0001819	synonymous_variant	378884	exon1			GGCGCGATGGGCG	AY324849	CCDS4542.1	6p22.3	2014-01-28	2013-12-12		ENSG00000187566	ENSG00000187566			21576	protein-coding gene	gene with protein product	"""epilepsy, progressive myoclonus type 2B"""	608072	"""NHL repeat containing 1"""			12958597	Standard	NM_198586		Approved	bA204B7.2, EPM2B, malin	uc003ncl.1	Q6VVB1	OTTHUMG00000014315	ENST00000340650.3:c.312T>C	6.37:g.18122526A>G		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	11	11	NM_198586	0	0	0	2	2	Q3SYB1|Q5VUK7|Q6IMH1	Silent	SNP	ENST00000340650.3	37	CCDS4542.1																																																																																			A|0.885;G|0.115		0.726	NHLRC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039958.1		
PEX6	5190	hgsc.bcm.edu	37	6	42946490	42946490	+	Silent	SNP	C	C	A	rs9462858	byFrequency	TCGA-PK-A5HA-01A-11D-A29I-10	TCGA-PK-A5HA-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2bd7613-8a82-453c-b1d0-f0ad6fbc0766	688c5eb5-c374-4bfb-81d1-c0ba622386cf	g.chr6:42946490C>A	ENST00000304611.8	-	1	468	c.399G>T	c.(397-399)gtG>gtT	p.V133V	PEX6_ENST00000244546.4_Silent_p.V133V	NM_000287.3	NP_000278.3	Q13608	PEX6_HUMAN	peroxisomal biogenesis factor 6	133					ATP catabolic process (GO:0006200)|peroxisome organization (GO:0007031)|protein import into peroxisome matrix, translocation (GO:0016561)|protein stabilization (GO:0050821)|protein targeting to peroxisome (GO:0006625)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|peroxisomal membrane (GO:0005778)|peroxisome (GO:0005777)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|ATPase activity, coupled (GO:0042623)|protein C-terminus binding (GO:0008022)|protein complex binding (GO:0032403)			NS(1)|breast(1)|endometrium(2)|large_intestine(2)|lung(5)|ovary(1)|prostate(3)	15			all cancers(41;0.00235)|Colorectal(64;0.00237)|COAD - Colon adenocarcinoma(64;0.00473)|KIRC - Kidney renal clear cell carcinoma(15;0.02)|Kidney(15;0.0388)|OV - Ovarian serous cystadenocarcinoma(102;0.0562)			GCGGTCCGGGCACTGGGAGGG	0.746													C|||	1662	0.331869	0.3691	0.3516	5008	,	,		10923	0.1002		0.4612	False		,,,				2504	0.3732				p.V133V		.											.	PEX6-91	0			c.G399T						.	C		1002,2080		214,574,753	2.0	3.0	3.0	http://www.ncbi.nlm.nih.gov/sites/varvu?gene	399	2.1	0.9	6	dbSNP_119	3	2653,4001		636,1381,1310	no	coding-synonymous	PEX6	NM_000287.3		850,1955,2063	AA,AC,CC		39.8708,32.5114,37.5411		133/981	42946490	3655,6081	1541	3327	4868	SO:0001819	synonymous_variant	5190	exon1			TCCGGGCACTGGG	U56602	CCDS4877.1	6p22-p11	2010-04-21			ENSG00000124587	ENSG00000124587		"""ATPases / AAA-type"""	8859	protein-coding gene	gene with protein product		601498				8670792	Standard	NM_000287		Approved	PXAAA1, PAF-2	uc003otf.3	Q13608	OTTHUMG00000014713	ENST00000304611.8:c.399G>T	6.37:g.42946490C>A		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	15	8	NM_000287	0	0	4	8	4	Q5T8W1|Q8WYQ0|Q8WYQ1|Q8WYQ2|Q99476	Silent	SNP	ENST00000304611.8	37	CCDS4877.1																																																																																			C|0.673;A|0.327		0.746	PEX6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040569.1	NM_000287	
HSP90AB1	3326	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	44217213	44217213	+	Missense_Mutation	SNP	A	A	G			TCGA-PK-A5HA-01A-11D-A29I-10	TCGA-PK-A5HA-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2bd7613-8a82-453c-b1d0-f0ad6fbc0766	688c5eb5-c374-4bfb-81d1-c0ba622386cf	g.chr6:44217213A>G	ENST00000371554.1	+	3	461	c.247A>G	c.(247-249)Acc>Gcc	p.T83A	HSP90AB1_ENST00000371646.5_Missense_Mutation_p.T83A|HSP90AB1_ENST00000353801.3_Missense_Mutation_p.T83A			P08238	HS90B_HUMAN	heat shock protein 90kDa alpha (cytosolic), class B member 1	83					axon guidance (GO:0007411)|cellular response to interleukin-4 (GO:0071353)|cellular response to organic cyclic compound (GO:0071407)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032435)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|placenta development (GO:0001890)|positive regulation of cell size (GO:0045793)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|positive regulation of protein binding (GO:0032092)|positive regulation of protein import into nucleus, translocation (GO:0033160)|positive regulation of protein serine/threonine kinase activity (GO:0071902)|protein folding (GO:0006457)|regulation of interferon-gamma-mediated signaling pathway (GO:0060334)|regulation of type I interferon-mediated signaling pathway (GO:0060338)|response to salt stress (GO:0009651)|response to unfolded protein (GO:0006986)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|brush border membrane (GO:0031526)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|inclusion body (GO:0016234)|membrane (GO:0016020)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|CTP binding (GO:0002135)|dATP binding (GO:0032564)|double-stranded RNA binding (GO:0003725)|GTP binding (GO:0005525)|MHC class II protein complex binding (GO:0023026)|nitric-oxide synthase regulator activity (GO:0030235)|poly(A) RNA binding (GO:0044822)|TPR domain binding (GO:0030911)|UTP binding (GO:0002134)			NS(1)|breast(1)|endometrium(6)|kidney(2)|large_intestine(5)|lung(12)|prostate(2)|skin(2)|urinary_tract(2)	33	all_cancers(18;1.7e-05)|all_lung(25;0.00747)|Hepatocellular(11;0.00908)|Ovarian(13;0.0273)		Colorectal(64;0.00337)|COAD - Colon adenocarcinoma(64;0.00536)			TCAGGAACGTACCCTGACTTT	0.473																																					p.T83A		.											.	HSP90AB1-658	0			c.A247G						.						90.0	82.0	84.0					6																	44217213		2203	4300	6503	SO:0001583	missense	3326	exon3			GAACGTACCCTGA	AF275719	CCDS4909.1	6p12	2011-09-02	2006-02-24	2006-02-24	ENSG00000096384	ENSG00000096384		"""Heat shock proteins / HSPC"""	5258	protein-coding gene	gene with protein product		140572	"""heat shock 90kD protein 1, beta"", ""heat shock 90kDa protein 1, beta"""	HSPC2, HSPCB		2768249, 16269234	Standard	NM_001271969		Approved		uc031sor.1	P08238	OTTHUMG00000014761	ENST00000371554.1:c.247A>G	6.37:g.44217213A>G	ENSP00000360609:p.Thr83Ala	Somatic	100	0		WXS	Illumina GAIIx	Phase_I	96	8	NM_007355	3	13	1367	1776	393	B2R5P0|Q5T9W7|Q9NQW0|Q9NTK6	Missense_Mutation	SNP	ENST00000371554.1	37	CCDS4909.1	.	.	.	.	.	.	.	.	.	.	A	16.48	3.135073	0.56828	.	.	ENSG00000096384	ENST00000371646;ENST00000353801;ENST00000371554	T;T;T	0.17854	2.25;2.25;2.25	4.57	3.38	0.38709	Heat shock protein Hsp90, N-terminal (1);ATPase-like, ATP-binding domain (4);	0.000000	0.64402	U	0.000001	T	0.32734	0.0839	H	0.99783	4.775	0.80722	D	1	B;P	0.37548	0.076;0.599	B;B	0.39503	0.052;0.301	T	0.50849	-0.8779	10	0.87932	D	0	-4.1174	11.4587	0.50197	0.8488:0.1512:0.0:0.0	.	83;83	B4DGL0;P08238	.;HS90B_HUMAN	A	83	ENSP00000360709:T83A;ENSP00000325875:T83A;ENSP00000360609:T83A	ENSP00000325875:T83A	T	+	1	0	HSP90AB1	44325191	1.000000	0.71417	0.020000	0.16555	0.861000	0.49209	9.339000	0.96797	0.705000	0.31890	0.454000	0.30748	ACC	.		0.473	HSP90AB1-005	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040730.1	NM_007355	
SMAP1	60682	broad.mit.edu	37	6	71508370	71508370	+	Frame_Shift_Del	DEL	A	A	-			TCGA-PK-A5HA-01A-11D-A29I-10	TCGA-PK-A5HA-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2bd7613-8a82-453c-b1d0-f0ad6fbc0766	688c5eb5-c374-4bfb-81d1-c0ba622386cf	g.chr6:71508370delA	ENST00000370455.3	+	6	754	c.506delA	c.(505-507)gaafs	p.E169fs	SMAP1_ENST00000370452.3_Frame_Shift_Del_p.E142fs|SMAP1_ENST00000316999.5_Frame_Shift_Del_p.E142fs	NM_001044305.1|NM_001281440.1	NP_001037770.1|NP_001268369.1	Q8IYB5	SMAP1_HUMAN	small ArfGAP 1	169					positive regulation of erythrocyte differentiation (GO:0045648)|regulation of ARF GTPase activity (GO:0032312)|regulation of clathrin-mediated endocytosis (GO:2000369)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	ARF GTPase activator activity (GO:0008060)|zinc ion binding (GO:0008270)	p.K145fs*48(1)		breast(3)|central_nervous_system(1)|endometrium(1)|large_intestine(2)|lung(6)|prostate(1)|urinary_tract(1)	15						aaagaaaaggaaaaaaaaaag	0.289																																					p.E169fs		.											.	SMAP1-90	1	Deletion - Frameshift(1)	prostate(1)	c.506delA						.						23.0	28.0	26.0					6																	71508370		2184	4254	6438	SO:0001589	frameshift_variant	60682	exon6			AAAAGGAAAAAAA	AK023221	CCDS4973.1, CCDS43478.1, CCDS64459.1, CCDS75478.1	6q12-q13	2009-11-30	2008-09-05		ENSG00000112305	ENSG00000112305		"""ADP-ribosylation factor GTPase activating proteins"""	19651	protein-coding gene	gene with protein product		611372	"""stromal membrane-associated protein 1"", ""stromal membrane-associated GTPase-activating protein 1"""			9644265, 12119110	Standard	NM_001044305		Approved	FLJ13159, SMAP-1	uc003pfr.3	Q8IYB5	OTTHUMG00000014996	ENST00000370455.3:c.506delA	6.37:g.71508370delA	ENSP00000359484:p.Glu169fs	Somatic	87	0		WXS	Illumina GAIIx	Phase_I	129	7	NM_001044305	0	0	0	0	0	Q53H70|Q5SYQ2|Q6PK24|Q8NDH4|Q96L38|Q96L39|Q9H8X4	Frame_Shift_Del	DEL	ENST00000370455.3	37	CCDS43478.1																																																																																			.		0.289	SMAP1-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041149.1	NM_001044305	
POU3F2	5454	hgsc.bcm.edu	37	6	99283376	99283376	+	Silent	SNP	T	T	G	rs195860	byFrequency	TCGA-PK-A5HA-01A-11D-A29I-10	TCGA-PK-A5HA-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2bd7613-8a82-453c-b1d0-f0ad6fbc0766	688c5eb5-c374-4bfb-81d1-c0ba622386cf	g.chr6:99283376T>G	ENST00000328345.5	+	1	797	c.627T>G	c.(625-627)ggT>ggG	p.G209G		NM_005604.3	NP_005595.2	P20265	PO3F2_HUMAN	POU class 3 homeobox 2	209					astrocyte development (GO:0014002)|cellular response to organic substance (GO:0071310)|cerebral cortex radially oriented cell migration (GO:0021799)|epidermis development (GO:0008544)|forebrain ventricular zone progenitor cell division (GO:0021869)|hypothalamus cell differentiation (GO:0021979)|myelination in peripheral nervous system (GO:0022011)|neurohypophysis development (GO:0021985)|neuron differentiation (GO:0030182)|positive regulation of cell proliferation (GO:0008284)|positive regulation of multicellular organism growth (GO:0040018)|regulation of axonogenesis (GO:0050770)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	identical protein binding (GO:0042802)|RNA polymerase II transcription coactivator activity (GO:0001105)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(2)|large_intestine(3)|lung(5)	10		all_cancers(76;1.56e-06)|Acute lymphoblastic leukemia(125;4.93e-10)|all_hematologic(75;3.55e-07)|all_epithelial(107;0.00893)|Colorectal(196;0.069)|Lung NSC(302;0.197)		BRCA - Breast invasive adenocarcinoma(108;0.0355)		AGCCGGCCGGTCTGCACCACC	0.736													G|||	4460	0.890575	0.8994	0.9121	5008	,	,		6412	0.9544		0.8598	False		,,,				2504	0.8292				p.G209G		.											.	POU3F2-90	0			c.T627G						.	G		3186,306		1453,280,13	4.0	4.0	4.0		627	3.1	1.0	6	dbSNP_79	4	6282,930		2738,806,62	no	coding-synonymous	POU3F2	NM_005604.2		4191,1086,75	GG,GT,TT		12.8952,8.7629,11.5471		209/444	99283376	9468,1236	1746	3606	5352	SO:0001819	synonymous_variant	5454	exon1			GGCCGGTCTGCAC	Z11933	CCDS5040.1	6q16.2	2011-06-20	2007-07-13		ENSG00000184486	ENSG00000184486		"""Homeoboxes / POU class"""	9215	protein-coding gene	gene with protein product		600494	"""POU domain class 3, transcription factor 2"""	OTF7		8441633	Standard	NM_005604		Approved	POUF3, BRN2, OCT7	uc003ppe.3	P20265	OTTHUMG00000015258	ENST00000328345.5:c.627T>G	6.37:g.99283376T>G		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	20	19	NM_005604	0	0	0	0	0	Q14960|Q86V54|Q9UJL0	Silent	SNP	ENST00000328345.5	37	CCDS5040.1																																																																																			T|0.089;G|0.911		0.736	POU3F2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041586.2		
ARHGAP18	93663	ucsc.edu	37	6	129959611	129959611	+	Silent	SNP	C	C	T			TCGA-PK-A5HA-01A-11D-A29I-10	TCGA-PK-A5HA-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2bd7613-8a82-453c-b1d0-f0ad6fbc0766	688c5eb5-c374-4bfb-81d1-c0ba622386cf	g.chr6:129959611C>T	ENST00000368149.2	-	3	568	c.480G>A	c.(478-480)agG>agA	p.R160R		NM_033515.2	NP_277050.2			Rho GTPase activating protein 18											NS(2)|endometrium(1)|large_intestine(4)|lung(4)|ovary(2)|prostate(2)|skin(3)	18				OV - Ovarian serous cystadenocarcinoma(136;0.0621)|GBM - Glioblastoma multiforme(226;0.0638)|all cancers(137;0.074)		TGTTTTTTTTCCTCAAGGTCT	0.433																																					p.R160R		.											.	ARHGAP18-230	0			c.G480A						.						218.0	216.0	217.0					6																	129959611		2203	4300	6503	SO:0001819	synonymous_variant	93663	exon3			TTTTTTCCTCAAG	AB053293	CCDS34535.1	6q23.1	2011-06-29			ENSG00000146376	ENSG00000146376		"""Rho GTPase activating proteins"""	21035	protein-coding gene	gene with protein product		613351					Standard	NM_033515		Approved	MacGAP, bA307O14.2	uc003qbr.3	Q8N392	OTTHUMG00000015547	ENST00000368149.2:c.480G>A	6.37:g.129959611C>T		Somatic	92	0		WXS	Illumina GAIIx	Phase_I	159	1	NM_033515	0	0	13	15	2		Silent	SNP	ENST00000368149.2	37	CCDS34535.1																																																																																			.		0.433	ARHGAP18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042185.2	NM_033515	
CTGF	1490	hgsc.bcm.edu	37	6	132271980	132271980	+	Silent	SNP	T	T	G	rs6934749		TCGA-PK-A5HA-01A-11D-A29I-10	TCGA-PK-A5HA-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2bd7613-8a82-453c-b1d0-f0ad6fbc0766	688c5eb5-c374-4bfb-81d1-c0ba622386cf	g.chr6:132271980T>G	ENST00000367976.3	-	2	419	c.219A>C	c.(217-219)ccA>ccC	p.P73P	RP11-69I8.3_ENST00000435287.1_RNA	NM_001901.2	NP_001892	P29279	CTGF_HUMAN	connective tissue growth factor	73	IGFBP N-terminal. {ECO:0000255|PROSITE- ProRule:PRU00653}.				angiogenesis (GO:0001525)|cartilage condensation (GO:0001502)|cell differentiation (GO:0030154)|cell migration (GO:0016477)|cell-matrix adhesion (GO:0007160)|cellular lipid metabolic process (GO:0044255)|chondrocyte proliferation (GO:0035988)|cytosolic calcium ion transport (GO:0060401)|DNA replication (GO:0006260)|epidermis development (GO:0008544)|extracellular matrix constituent secretion (GO:0070278)|fibroblast growth factor receptor signaling pathway (GO:0008543)|gene expression (GO:0010467)|integrin-mediated signaling pathway (GO:0007229)|intracellular signal transduction (GO:0035556)|lung development (GO:0030324)|negative regulation of cell death (GO:0060548)|negative regulation of gene expression (GO:0010629)|organ senescence (GO:0010260)|ossification (GO:0001503)|positive regulation of cardiac muscle contraction (GO:0060452)|positive regulation of cell activation (GO:0050867)|positive regulation of cell death (GO:0010942)|positive regulation of cell differentiation (GO:0045597)|positive regulation of cell proliferation (GO:0008284)|positive regulation of collagen biosynthetic process (GO:0032967)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of G0 to G1 transition (GO:0070318)|positive regulation of gene expression (GO:0010628)|positive regulation of JNK cascade (GO:0046330)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of stress fiber assembly (GO:0051496)|reactive oxygen species metabolic process (GO:0072593)|regulation of cell growth (GO:0001558)|regulation of chondrocyte differentiation (GO:0032330)|response to amino acid (GO:0043200)|response to anoxia (GO:0034059)|response to estradiol (GO:0032355)|response to fatty acid (GO:0070542)|response to glucose (GO:0009749)|response to mineralocorticoid (GO:0051385)|response to peptide hormone (GO:0043434)|response to wounding (GO:0009611)|small molecule metabolic process (GO:0044281)|tissue homeostasis (GO:0001894)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cell cortex (GO:0005938)|cis-Golgi network (GO:0005801)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)	heparin binding (GO:0008201)|insulin-like growth factor binding (GO:0005520)			breast(1)|endometrium(6)|kidney(1)|large_intestine(1)|lung(3)|prostate(1)	13	Breast(56;0.0602)			GBM - Glioblastoma multiforme(226;0.015)|OV - Ovarian serous cystadenocarcinoma(155;0.0169)		GCGGGTCGCATGGGTCGCGCT	0.716													G|||	5008	1.0	1.0	1.0	5008	,	,		7576	1.0		1.0	False		,,,				2504	1.0				p.P73P	Esophageal Squamous(127;510 1660 12817 24400 38449)	.											.	CTGF-90	0			c.A219C						.						6.0	8.0	7.0					6																	132271980		2100	4127	6227	SO:0001819	synonymous_variant	1490	exon2			GTCGCATGGGTCG	X78947	CCDS5151.1	6q23.2	2008-02-05			ENSG00000118523	ENSG00000118523			2500	protein-coding gene	gene with protein product		121009				1654338	Standard	NM_001901		Approved	IGFBP8, CCN2	uc003qcz.3	P29279	OTTHUMG00000015573	ENST00000367976.3:c.219A>C	6.37:g.132271980T>G		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	4	4	NM_001901	0	0	0	9	9	E1P578|Q6LCY0|Q96A79|Q96QX2|Q9UDL6	Silent	SNP	ENST00000367976.3	37	CCDS5151.1																																																																																			T|0.000;G|1.000		0.716	CTGF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042239.2	NM_001901	
VNN3	55350	broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	133049936	133049936	+	Missense_Mutation	SNP	A	A	G			TCGA-PK-A5HA-01A-11D-A29I-10	TCGA-PK-A5HA-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2bd7613-8a82-453c-b1d0-f0ad6fbc0766	688c5eb5-c374-4bfb-81d1-c0ba622386cf	g.chr6:133049936A>G	ENST00000367927.5	-	3	553	c.481T>C	c.(481-483)Tac>Cac	p.Y161H	VNN3_ENST00000423615.2_Intron|VNN3_ENST00000392393.3_3'UTR|VNN3_ENST00000425515.2_3'UTR|VNN3_ENST00000414302.2_Intron|VNN3_ENST00000519686.2_3'UTR|VNN3_ENST00000509351.1_Intron|VNN3_ENST00000275223.3_3'UTR|VNN3_ENST00000580813.1_5'Flank|VNN3_ENST00000450865.2_Intron|VNN3_ENST00000427187.2_Missense_Mutation_p.Y161H|VNN3_ENST00000207771.3_Missense_Mutation_p.Y161H|VNN3_ENST00000417437.2_Intron			Q9NY84	VNN3_HUMAN	vanin 3	161	CN hydrolase. {ECO:0000255|PROSITE- ProRule:PRU00054}.				nitrogen compound metabolic process (GO:0006807)	anchored component of membrane (GO:0031225)|plasma membrane (GO:0005886)	pantetheine hydrolase activity (GO:0017159)			cervix(1)|endometrium(1)|large_intestine(2)|lung(2)|skin(1)|stomach(1)	8	Breast(56;0.135)			OV - Ovarian serous cystadenocarcinoma(155;0.00242)|GBM - Glioblastoma multiforme(226;0.0168)		TCAGTGTTGTATTGGTAACGG	0.478																																					.		.											.	VNN3-90	0			.						.						196.0	161.0	172.0					6																	133049936		2203	4300	6503	SO:0001583	missense	55350	.			TGTTGTATTGGTA	AJ238982		6q23.2	2014-04-09	2010-11-15	2010-11-15	ENSG00000093134	ENSG00000093134	3.5.1.92	"""Vanins"""	16431	other	unknown		606592				10501839, 19932582, 19322213	Standard	NR_028290		Approved	HSA238982	uc010kfs.3	Q9NY84	OTTHUMG00000015589	ENST00000367927.5:c.481T>C	6.37:g.133049936A>G	ENSP00000438024:p.Tyr161His	Somatic	150	0		WXS	Illumina GAIIx	Phase_I	208	22	.	0	0	0	0	0	B2DFY0|B2DFY1|B2DFY3|B2DFY5|B2DFY6|B2DFY7|B2DFY8|Q3SX90|Q9BQY2	RNA	SNP	ENST00000367927.5	37		.	.	.	.	.	.	.	.	.	.	A	19.77	3.889634	0.72524	.	.	ENSG00000093134	ENST00000367927;ENST00000207771;ENST00000427187	D;D;D	0.88975	-2.45;-2.45;-2.45	5.29	4.11	0.48088	.	0.000000	0.56097	D	0.000023	D	0.88149	0.6359	.	.	.	0.80722	D	1	.	.	.	.	.	.	D	0.87253	0.2274	7	0.44086	T	0.13	-25.7339	12.6421	0.56714	0.8617:0.1383:0.0:0.0	.	.	.	.	H	161	ENSP00000438024:Y161H;ENSP00000440594:Y161H;ENSP00000444491:Y161H	ENSP00000440594:Y161H	Y	-	1	0	VNN3	133091629	0.991000	0.36638	0.855000	0.33649	0.971000	0.66376	3.045000	0.49838	0.937000	0.37394	0.533000	0.62120	TAC	.		0.478	VNN3-001	KNOWN	NMD_exception|basic	protein_coding	protein_coding	OTTHUMT00000042265.4	NR_028290	
FNDC1	84624	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	6	159652989	159652989	+	Missense_Mutation	SNP	C	C	A			TCGA-PK-A5HA-01A-11D-A29I-10	TCGA-PK-A5HA-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2bd7613-8a82-453c-b1d0-f0ad6fbc0766	688c5eb5-c374-4bfb-81d1-c0ba622386cf	g.chr6:159652989C>A	ENST00000297267.9	+	11	1645	c.1445C>A	c.(1444-1446)cCc>cAc	p.P482H	FNDC1_ENST00000340366.6_Missense_Mutation_p.P419H	NM_032532.2	NP_115921.2	Q4ZHG4	FNDC1_HUMAN	fibronectin type III domain containing 1	482					cellular response to hypoxia (GO:0071456)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of protein phosphorylation (GO:0001934)|regulation of protein transport (GO:0051223)	cell-cell junction (GO:0005911)|extracellular region (GO:0005576)|mitochondrial membrane (GO:0031966)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|endometrium(16)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(29)|liver(2)|lung(23)|ovary(3)|pancreas(1)|prostate(5)|skin(1)|upper_aerodigestive_tract(3)	93		Breast(66;0.000781)|Ovarian(120;0.0308)|Prostate(117;0.195)		OV - Ovarian serous cystadenocarcinoma(65;2.6e-16)|BRCA - Breast invasive adenocarcinoma(81;1.06e-05)		TCACCTTCTCCCAGAGCTCCA	0.502																																					p.P482H		.											.	FNDC1-138	0			c.C1445A						.						44.0	47.0	46.0					6																	159652989		1941	4146	6087	SO:0001583	missense	84624	exon11			CTTCTCCCAGAGC	AB058769	CCDS47512.1	6q25	2013-02-11			ENSG00000164694	ENSG00000164694		"""Fibronectin type III domain containing"""	21184	protein-coding gene	gene with protein product		609991	"""fibronectin type III domain containing 2"""	FNDC2		11347906	Standard	NM_032532		Approved	bA243O10.1, KIAA1866, dJ322A24.1	uc010kjv.3	Q4ZHG4	OTTHUMG00000015927	ENST00000297267.9:c.1445C>A	6.37:g.159652989C>A	ENSP00000297267:p.Pro482His	Somatic	94	0		WXS	Illumina GAIIx	Phase_I	153	11	NM_032532	0	0	0	0	0	A6H8X2|B7ZBR4|B7ZBR5|B9EK49|Q5JPI0|Q5VU31|Q5VU32|Q5VXX4|Q70CQ6|Q96JG1	Missense_Mutation	SNP	ENST00000297267.9	37	CCDS47512.1	.	.	.	.	.	.	.	.	.	.	C	13.19	2.163781	0.38217	.	.	ENSG00000164694	ENST00000297267;ENST00000340366	T;T	0.08546	3.08;4.0	4.96	3.07	0.35406	.	1.258880	0.05167	N	0.498954	T	0.02083	0.0065	L	0.29908	0.895	0.09310	N	1	B;B	0.32031	0.352;0.24	B;B	0.30855	0.121;0.046	T	0.41484	-0.9506	10	0.15066	T	0.55	-11.2503	8.856	0.35227	0.1472:0.774:0.0:0.0788	.	419;482	Q4ZHG4-2;Q4ZHG4	.;FNDC1_HUMAN	H	482;419	ENSP00000297267:P482H;ENSP00000342460:P419H	ENSP00000297267:P482H	P	+	2	0	FNDC1	159572979	0.000000	0.05858	0.001000	0.08648	0.113000	0.19764	0.298000	0.19120	1.272000	0.44329	0.644000	0.83932	CCC	.		0.502	FNDC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042897.3	NM_032532	
SMOC2	64094	hgsc.bcm.edu;bcgsc.ca	37	6	168842113	168842113	+	Silent	SNP	T	T	G	rs73270928	byFrequency	TCGA-PK-A5HA-01A-11D-A29I-10	TCGA-PK-A5HA-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2bd7613-8a82-453c-b1d0-f0ad6fbc0766	688c5eb5-c374-4bfb-81d1-c0ba622386cf	g.chr6:168842113T>G	ENST00000356284.2	+	1	283	c.63T>G	c.(61-63)gcT>gcG	p.A21A	SMOC2_ENST00000354536.5_Silent_p.A21A	NM_001166412.1	NP_001159884.1	Q9H3U7	SMOC2_HUMAN	SPARC related modular calcium binding 2	21					extracellular matrix organization (GO:0030198)|positive regulation of cell-substrate adhesion (GO:0010811)|signal transduction (GO:0007165)	basement membrane (GO:0005604)|interstitial matrix (GO:0005614)	calcium ion binding (GO:0005509)|heparin binding (GO:0008201)			NS(1)|autonomic_ganglia(1)|breast(2)|endometrium(1)|kidney(1)|large_intestine(6)|lung(12)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	32		Breast(66;0.000141)|Esophageal squamous(34;0.222)|Ovarian(120;0.231)		OV - Ovarian serous cystadenocarcinoma(33;1.31e-19)|BRCA - Breast invasive adenocarcinoma(81;3.06e-06)|GBM - Glioblastoma multiforme(31;0.00109)		CGGTGCCCGCTCAGAAGTTCT	0.751													G|||	1980	0.395367	0.5787	0.2839	5008	,	,		9314	0.4593		0.167	False		,,,				2504	0.3957				p.A21A		.											.	SMOC2-91	0			c.T63G						.	G	,	924,2074		89,746,664	2.0	3.0	3.0		63,63	-0.4	1.0	6	dbSNP_131	3	645,5799		34,577,2611	no	coding-synonymous,coding-synonymous	SMOC2	NM_001166412.1,NM_022138.2	,	123,1323,3275	GG,GT,TT		10.0093,30.8205,16.6172	,	21/447,21/458	168842113	1569,7873	1499	3222	4721	SO:0001819	synonymous_variant	64094	exon1			GCCCGCTCAGAAG	AB014730	CCDS5307.1, CCDS55076.1	6q27	2013-01-10			ENSG00000112562	ENSG00000112562		"""EF-hand domain containing"""	20323	protein-coding gene	gene with protein product		607223				12031507	Standard	NM_022138		Approved	SMAP2	uc003qwr.2	Q9H3U7	OTTHUMG00000016050	ENST00000356284.2:c.63T>G	6.37:g.168842113T>G		Somatic	12	0		WXS	Illumina GAIIx	Phase_I	77	22	NM_022138	0	0	1	2	1	B3KPS7|Q4G169|Q5TAT7|Q5TAT8|Q86VV9|Q96SF3|Q9H1L3|Q9H1L4|Q9H3U0|Q9H4F7|Q9HCV2	Silent	SNP	ENST00000356284.2	37	CCDS55076.1																																																																																			T|0.654;G|0.346		0.751	SMOC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043201.1		
TNRC18	84629	hgsc.bcm.edu	37	7	5427517	5427517	+	Silent	SNP	G	G	A	rs34693947	byFrequency	TCGA-PK-A5HA-01A-11D-A29I-10	TCGA-PK-A5HA-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2bd7613-8a82-453c-b1d0-f0ad6fbc0766	688c5eb5-c374-4bfb-81d1-c0ba622386cf	g.chr7:5427517G>A	ENST00000430969.1	-	5	2286	c.1938C>T	c.(1936-1938)ggC>ggT	p.G646G	TNRC18_ENST00000399537.4_Silent_p.G646G	NM_001080495.2	NP_001073964.2	O15417	TNC18_HUMAN	trinucleotide repeat containing 18	646							chromatin binding (GO:0003682)			central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(8)	11		Ovarian(82;0.142)		UCEC - Uterine corpus endometrioid carcinoma (126;0.195)|OV - Ovarian serous cystadenocarcinoma(56;5.32e-15)		GCCGGCCGCCGCCCGCTGCAG	0.716													G|||	998	0.199281	0.0552	0.0908	5008	,	,		13710	0.6597		0.0437	False		,,,				2504	0.1564				p.G646G		.											.	TNRC18-46	0			c.C1938T						.	G		141,3189		2,137,1526	4.0	6.0	5.0		1938	-5.6	0.0	7	dbSNP_126	5	219,7185		3,213,3486	no	coding-synonymous	TNRC18	NM_001080495.2		5,350,5012	AA,AG,GG		2.9579,4.2342,3.3538		646/2969	5427517	360,10374	1665	3702	5367	SO:0001819	synonymous_variant	84629	exon5			GCCGCCGCCCGCT	U80753	CCDS47534.1	7p22.1	2012-04-17			ENSG00000182095	ENSG00000182095		"""Trinucleotide (CAG) repeat containing"""	11962	protein-coding gene	gene with protein product						9225980	Standard	NM_001080495		Approved	CAGL79, TNRC18A, KIAA1856	uc003soi.4	O15417	OTTHUMG00000151831	ENST00000430969.1:c.1938C>T	7.37:g.5427517G>A		Somatic	2	0		WXS	Illumina GAIIx	Phase_I	56	34	NM_001080495	0	0	4	6	2	A8MX41|Q96JH1|Q96K91	Silent	SNP	ENST00000430969.1	37	CCDS47534.1																																																																																			G|0.797;A|0.203		0.716	TNRC18-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding			
PMS2	5395	broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	6029443	6029443	+	Missense_Mutation	SNP	G	G	T			TCGA-PK-A5HA-01A-11D-A29I-10	TCGA-PK-A5HA-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2bd7613-8a82-453c-b1d0-f0ad6fbc0766	688c5eb5-c374-4bfb-81d1-c0ba622386cf	g.chr7:6029443G>T	ENST00000265849.7	-	10	1237	c.1132C>A	c.(1132-1134)Ctg>Atg	p.L378M	PMS2_ENST00000382321.4_Intron|PMS2_ENST00000441476.2_Missense_Mutation_p.L272M|PMS2_ENST00000469652.1_Intron|PMS2_ENST00000406569.3_Missense_Mutation_p.L378M	NM_000535.5	NP_000526	P54278	PMS2_HUMAN	PMS2 postmeiotic segregation increased 2 (S. cerevisiae)	378					ATP catabolic process (GO:0006200)|mismatch repair (GO:0006298)|response to drug (GO:0042493)|somatic hypermutation of immunoglobulin genes (GO:0016446)|somatic recombination of immunoglobulin gene segments (GO:0016447)	cytoplasm (GO:0005737)|microtubule cytoskeleton (GO:0015630)|MutLalpha complex (GO:0032389)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|DNA binding (GO:0003677)|endonuclease activity (GO:0004519)|single base insertion or deletion binding (GO:0032138)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(6)|kidney(2)|large_intestine(11)|lung(13)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	46		Ovarian(82;0.0694)		UCEC - Uterine corpus endometrioid carcinoma (126;0.101)|OV - Ovarian serous cystadenocarcinoma(56;4.39e-15)		TCAACATCCAGCAGTGGCTGC	0.353			"""Mis, N, F"""			"""colorectal, endometrial, ovarian, medulloblastoma, glioma"""		Direct reversal of damage;Mismatch excision repair (MMR)	Turcot syndrome;Lynch syndrome;Constitutional Mismatch Repair Deficiency Syndrome																												p.L378M		.	yes	Rec		"""Hereditary non-polyposis colorectal cancer, Turcot syndrome"""	7	7p22	5395	PMS2 postmeiotic segregation increased 2 (S. cerevisiae)		E	.	PMS2-1083	0			c.C1132A						.						104.0	100.0	102.0					7																	6029443		2203	4300	6503	SO:0001583	missense	5395	exon10	Familial Cancer Database	Brain tumor-colorectal polyp(osis) syndrome;Hereditary Non-Polyposis Colorectal Cancer, HNPCC, Lynch syndromes 1 and 2 (= Cancer Family Syndrome), Hereditary Mismatch Repair Deficiency syndrome, HMRDS;Mismatch Repair Cancer syndrome, MMRCS, Childhood Cancer Syndrome, CCS, Biallelic Mismatch Repair Gene Mutations Associated Early Onset Cancer, Lynch syndrome type III	CATCCAGCAGTGG		CCDS5343.1	7p22.1	2014-09-17	2001-11-28		ENSG00000122512	ENSG00000122512			9122	protein-coding gene	gene with protein product		600259	"""postmeiotic segregation increased (S. cerevisiae) 2"""	PMSL2		8072530	Standard	NM_000535		Approved	H_DJ0042M02.9, HNPCC4	uc003spl.3	P54278	OTTHUMG00000023135	ENST00000265849.7:c.1132C>A	7.37:g.6029443G>T	ENSP00000265849:p.Leu378Met	Somatic	133	1		WXS	Illumina GAIIx	Phase_I	93	21	NM_000535	0	0	2	4	2	B2R610|Q52LH6|Q5FBW9|Q5FBX1|Q5FBX2|Q75MR2	Missense_Mutation	SNP	ENST00000265849.7	37	CCDS5343.1	.	.	.	.	.	.	.	.	.	.	g	19.28	3.797318	0.70567	.	.	ENSG00000122512	ENST00000265849;ENST00000382322;ENST00000441476;ENST00000406569	D;T;D	0.87334	-2.02;-1.42;-2.24	5.73	-10.2	0.00374	.	0.451997	0.19589	N	0.110672	D	0.86928	0.6051	L	0.50333	1.59	0.09310	N	1	D;D;D	0.69078	0.997;0.991;0.994	D;P;D	0.67900	0.954;0.83;0.944	D	0.84074	0.0381	10	0.31617	T	0.26	-3.9976	14.9394	0.70980	0.1137:0.0828:0.7218:0.0817	.	378;378;272	P54278-3;P54278;C9J167	.;PMS2_HUMAN;.	M	378;331;272;378	ENSP00000265849:L378M;ENSP00000392843:L272M;ENSP00000384308:L378M	ENSP00000265849:L378M	L	-	1	2	PMS2	5995969	0.131000	0.22433	0.001000	0.08648	0.705000	0.40729	-0.612000	0.05616	-1.951000	0.01029	-0.303000	0.09236	CTG	.		0.353	PMS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207353.3	NM_000535	
USP42	84132	hgsc.bcm.edu	37	7	6193521	6193521	+	Missense_Mutation	SNP	G	G	C	rs61729726	byFrequency	TCGA-PK-A5HA-01A-11D-A29I-10	TCGA-PK-A5HA-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2bd7613-8a82-453c-b1d0-f0ad6fbc0766	688c5eb5-c374-4bfb-81d1-c0ba622386cf	g.chr7:6193521G>C	ENST00000306177.5	+	15	2494	c.2336G>C	c.(2335-2337)cGc>cCc	p.R779P		NM_032172.2	NP_115548.1	Q9H9J4	UBP42_HUMAN	ubiquitin specific peptidase 42	779	Pro-rich.				cell differentiation (GO:0030154)|protein deubiquitination (GO:0016579)|spermatogenesis (GO:0007283)|ubiquitin-dependent protein catabolic process (GO:0006511)		ubiquitin-specific protease activity (GO:0004843)			breast(1)|central_nervous_system(1)|endometrium(5)|kidney(4)|large_intestine(2)|lung(14)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|urinary_tract(1)	35		Ovarian(82;0.0423)		UCEC - Uterine corpus endometrioid carcinoma (126;0.108)|OV - Ovarian serous cystadenocarcinoma(56;5.77e-14)		CCGCCGCCCCGCGATCCCGGC	0.756													C|||	2895	0.578075	0.8638	0.4121	5008	,	,		10724	0.7331		0.3082	False		,,,				2504	0.4274				p.R779P		.											.	USP42-659	0			c.G2336C						.	C	PRO/ARG	2157,1125		751,655,235	4.0	6.0	5.0		2336	2.6	0.0	7	dbSNP_129	5	1843,5693		290,1263,2215	no	missense	USP42	NM_032172.2	103	1041,1918,2450	CC,CG,GG		24.4559,34.2779,36.9754	benign	779/1317	6193521	4000,6818	1641	3768	5409	SO:0001583	missense	84132	exon15			CGCCCCGCGATCC	AK022759	CCDS47535.1	7p22.2	2005-08-08	2005-08-08		ENSG00000106346	ENSG00000106346		"""Ubiquitin-specific peptidases"""	20068	protein-coding gene	gene with protein product			"""ubiquitin specific protease 42"""			12838346	Standard	NM_032172		Approved	FLJ12697	uc011jwp.2	Q9H9J4	OTTHUMG00000151888	ENST00000306177.5:c.2336G>C	7.37:g.6193521G>C	ENSP00000301962:p.Arg779Pro	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	26	11	NM_032172	0	0	2	4	2	A2RUE3|B5MDA5|Q0VIN8|Q3C166|Q6P9B4	Missense_Mutation	SNP	ENST00000306177.5	37	CCDS47535.1	1188	0.5439560439560439	401	0.8150406504065041	130	0.35911602209944754	440	0.7692307692307693	217	0.2862796833773087	C	10.95	1.494372	0.26774	0.657221	0.244559	ENSG00000106346	ENST00000306177;ENST00000426246	T;T	0.14266	2.52;2.93	5.46	2.59	0.31030	.	0.841331	0.10600	N	0.655737	T	0.00012	0.0000	N	0.08118	0	0.80722	P	0.0	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.09164	-1.0687	9	0.28530	T	0.3	.	2.8136	0.05448	0.1458:0.5508:0.1414:0.162	rs61729726	779;779	Q9H9J4-2;Q9H9J4	.;UBP42_HUMAN	P	779;625	ENSP00000301962:R779P;ENSP00000408217:R625P	ENSP00000301962:R779P	R	+	2	0	USP42	6160046	0.001000	0.12720	0.000000	0.03702	0.000000	0.00434	0.469000	0.22067	0.265000	0.21872	-0.120000	0.15030	CGC	G|0.456;C|0.544		0.756	USP42-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000324262.3	XM_166526	
ZNF853	54753	hgsc.bcm.edu	37	7	6662086	6662086	+	Silent	SNP	G	G	C	rs9770042	byFrequency	TCGA-PK-A5HA-01A-11D-A29I-10	TCGA-PK-A5HA-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2bd7613-8a82-453c-b1d0-f0ad6fbc0766	688c5eb5-c374-4bfb-81d1-c0ba622386cf	g.chr7:6662086G>C	ENST00000457543.3	+	3	2022	c.1464G>C	c.(1462-1464)ggG>ggC	p.G488G		NM_017560.1	NP_060030.1	P0CG23	ZN853_HUMAN	zinc finger protein 853	488							metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)			endometrium(1)|kidney(1)	2						CCATCTGCGGGGAGTGCGGCA	0.776													G|||	678	0.135383	0.298	0.1095	5008	,	,		7265	0.0546		0.0785	False		,,,				2504	0.0757				p.G488G		.											.	.	0			c.G1464C						.						4.0	5.0	5.0					7																	6662086		625	1469	2094	SO:0001819	synonymous_variant	54753	exon3			CTGCGGGGAGTGC	AL133055	CCDS59048.1	7p22.1	2013-01-08				ENSG00000236609		"""Zinc fingers, C2H2-type"""	21767	protein-coding gene	gene with protein product							Standard	NM_017560		Approved	DKFZp434J1015	uc011jwz.2	P0CG23		ENST00000457543.3:c.1464G>C	7.37:g.6662086G>C		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	20	7	NM_017560	0	0	1	1	0		Silent	SNP	ENST00000457543.3	37	CCDS59048.1																																																																																			G|0.869;C|0.131		0.776	ZNF853-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000324169.2	NM_017560	
GARS	2617	hgsc.bcm.edu	37	7	30634661	30634661	+	Missense_Mutation	SNP	C	C	G	rs1049402	byFrequency	TCGA-PK-A5HA-01A-11D-A29I-10	TCGA-PK-A5HA-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2bd7613-8a82-453c-b1d0-f0ad6fbc0766	688c5eb5-c374-4bfb-81d1-c0ba622386cf	g.chr7:30634661C>G	ENST00000389266.3	+	1	365	c.124C>G	c.(124-126)Ccc>Gcc	p.P42A	AC005154.6_ENST00000578994.1_RNA|AC005154.6_ENST00000582549.1_RNA|AC005154.6_ENST00000581665.1_RNA|AC005154.6_ENST00000584199.1_RNA|AC005154.6_ENST00000579174.1_RNA|AC005154.6_ENST00000580440.1_RNA|AC005154.6_ENST00000583664.1_RNA|AC005154.6_ENST00000584372.1_RNA	NM_002047.2	NP_002038.2	P41250	SYG_HUMAN	glycyl-tRNA synthetase	42			P -> A (in dbSNP:rs1049402). {ECO:0000269|PubMed:14702039, ECO:0000269|PubMed:15489334, ECO:0000269|PubMed:7753621, ECO:0000269|PubMed:7961834, ECO:0000269|PubMed:7962006}.		cell death (GO:0008219)|diadenosine tetraphosphate biosynthetic process (GO:0015966)|gene expression (GO:0010467)|glycyl-tRNA aminoacylation (GO:0006426)|tRNA aminoacylation for protein translation (GO:0006418)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|mitochondrial matrix (GO:0005759)|nucleus (GO:0005634)|secretory granule (GO:0030141)	ATP binding (GO:0005524)|glycine-tRNA ligase activity (GO:0004820)|protein dimerization activity (GO:0046983)	p.P42fs*20(1)		breast(3)|endometrium(2)|kidney(1)|large_intestine(4)|lung(9)|ovary(1)|skin(3)|urinary_tract(1)	24					Glycine(DB00145)	GGCCTCCTGCCCCCCGATCTC	0.736													G|||	3252	0.649361	0.5219	0.7147	5008	,	,		13746	0.6677		0.7634	False		,,,				2504	0.6391				p.P42A		.											.	GARS-91	1	Insertion - Frameshift(1)	large_intestine(1)	c.C124G						.	G	ALA/PRO	2445,1427		776,893,267	5.0	8.0	7.0		124	-6.6	0.0	7	dbSNP_86	7	6367,1671		2577,1213,229	no	missense	GARS	NM_002047.2	27	3353,2106,496	GG,GC,CC		20.7888,36.8543,26.0118	benign	42/740	30634661	8812,3098	1936	4019	5955	SO:0001583	missense	2617	exon1			TCCTGCCCCCCGA	AK074524	CCDS43564.1	7p15	2014-09-17	2004-02-13		ENSG00000106105	ENSG00000106105	6.1.1.14	"""Aminoacyl tRNA synthetases / Class II"""	4162	protein-coding gene	gene with protein product	"""glycine tRNA ligase"""	600287	"""Charcot-Marie-Tooth neuropathy 2D"""	CMT2D		8595897, 8872480	Standard	NM_002047		Approved	GlyRS, DSMAV, SMAD1	uc003tbm.3	P41250	OTTHUMG00000152769	ENST00000389266.3:c.124C>G	7.37:g.30634661C>G	ENSP00000373918:p.Pro42Ala	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	14	13	NM_002047	0	0	0	24	24	B3KQA2|B4DIA0|Q969Y1	Missense_Mutation	SNP	ENST00000389266.3	37	CCDS43564.1	1456	0.6666666666666666	278	0.5650406504065041	268	0.7403314917127072	337	0.5891608391608392	573	0.7559366754617414	G	0.005	-2.164835	0.00318	0.631457	0.792112	ENSG00000106105	ENST00000389266	T	0.80393	-1.37	3.31	-6.63	0.01807	.	1.037800	0.07609	N	0.925137	T	0.00012	0.0000	N	0.08118	0	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.13575	-1.0504	9	0.08179	T	0.78	.	5.5596	0.17135	0.0726:0.2689:0.1197:0.5389	rs1049402;rs3189564;rs11553500;rs17856223;rs17856227;rs1049402	42	P41250	SYG_HUMAN	A	42	ENSP00000373918:P42A	ENSP00000373918:P42A	P	+	1	0	GARS	30601186	0.000000	0.05858	0.000000	0.03702	0.037000	0.13140	-0.671000	0.05250	-2.551000	0.00479	-0.744000	0.03518	CCC	C|0.329;G|0.671		0.736	GARS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000327735.1	NM_002047	
NRCAM	4897	bcgsc.ca	37	7	107872816	107872816	+	Silent	SNP	G	G	A	rs2072546	byFrequency	TCGA-PK-A5HA-01A-11D-A29I-10	TCGA-PK-A5HA-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2bd7613-8a82-453c-b1d0-f0ad6fbc0766	688c5eb5-c374-4bfb-81d1-c0ba622386cf	g.chr7:107872816G>A	ENST00000425651.2	-	4	380	c.381C>T	c.(379-381)aaC>aaT	p.N127N	NRCAM_ENST00000379028.3_Silent_p.N127N|NRCAM_ENST00000413765.2_Silent_p.N127N|NRCAM_ENST00000379024.4_Silent_p.N127N|NRCAM_ENST00000379022.4_Silent_p.N127N|NRCAM_ENST00000351718.4_Silent_p.N121N	NM_001037132.2	NP_001032209.1	Q92823	NRCAM_HUMAN	neuronal cell adhesion molecule	127	Ig-like 1.				angiogenesis (GO:0001525)|axon guidance (GO:0007411)|axonal fasciculation (GO:0007413)|axonogenesis (GO:0007409)|central nervous system development (GO:0007417)|clustering of voltage-gated sodium channels (GO:0045162)|heterotypic cell-cell adhesion (GO:0034113)|neuron migration (GO:0001764)|neuronal action potential propagation (GO:0019227)|positive regulation of neuron differentiation (GO:0045666)|protein localization (GO:0008104)|regulation of axon extension (GO:0030516)|retinal ganglion cell axon guidance (GO:0031290)|single organismal cell-cell adhesion (GO:0016337)|synapse assembly (GO:0007416)	axon initial segment (GO:0043194)|external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)|synapse (GO:0045202)	ankyrin binding (GO:0030506)			breast(4)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(8)|liver(1)|lung(36)|ovary(3)|prostate(2)|skin(3)|upper_aerodigestive_tract(4)	65						CTCCGCGTTCGTTCCTTGCTG	0.458													G|||	1067	0.213059	0.0061	0.2723	5008	,	,		18947	0.5466		0.1243	False		,,,				2504	0.1984				p.N127N		.											.	NRCAM-156	0			c.C381T						.	G	,,,,	144,4262	101.6+/-140.2	1,142,2060	193.0	174.0	181.0		381,381,381,381,363	-9.8	0.4	7	dbSNP_96	181	1168,7432	239.4+/-270.5	87,994,3219	no	coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous	NRCAM	NM_001037132.2,NM_001193582.1,NM_001193583.1,NM_001193584.1,NM_005010.4	,,,,	88,1136,5279	AA,AG,GG		13.5814,3.2683,10.0877	,,,,	127/1305,127/1212,127/1193,127/1181,121/1184	107872816	1312,11694	2203	4300	6503	SO:0001819	synonymous_variant	4897	exon4			GCGTTCGTTCCTT		CCDS5751.1, CCDS47686.1, CCDS55153.1, CCDS75652.1	7q31	2013-02-11			ENSG00000091129	ENSG00000091129		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	7994	protein-coding gene	gene with protein product	"""NgCAM-related cell adhesion molecule"""	601581				8812479	Standard	NM_001037132		Approved	KIAA0343, Bravo	uc022aka.1	Q92823	OTTHUMG00000154973	ENST00000425651.2:c.381C>T	7.37:g.107872816G>A		Somatic	145	0		WXS	Illumina GAIIx	Phase_I	171	6	NM_001037132	0	0	3	3	0	A4D0S3|E9PDA4|O15051|O15179|Q14BM2|Q9UHI3|Q9UHI4	Silent	SNP	ENST00000425651.2	37	CCDS47686.1																																																																																			G|0.834;A|0.166		0.458	NRCAM-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337942.2	NM_001037132	
PODXL	5420	hgsc.bcm.edu	37	7	131241055	131241055	+	Missense_Mutation	SNP	A	A	G			TCGA-PK-A5HA-01A-11D-A29I-10	TCGA-PK-A5HA-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2bd7613-8a82-453c-b1d0-f0ad6fbc0766	688c5eb5-c374-4bfb-81d1-c0ba622386cf	g.chr7:131241055A>G	ENST00000378555.3	-	1	311	c.64T>C	c.(64-66)Tcg>Ccg	p.S22P	PODXL_ENST00000541194.1_Missense_Mutation_p.S22P|PODXL_ENST00000322985.9_Missense_Mutation_p.S22P|PODXL_ENST00000465001.1_Intron|PODXL_ENST00000537928.1_Missense_Mutation_p.S22P			O00592	PODXL_HUMAN	podocalyxin-like	22					cell adhesion (GO:0007155)|cell migration (GO:0016477)|epithelial tube formation (GO:0072175)|glomerular visceral epithelial cell development (GO:0072015)|leukocyte migration (GO:0050900)|negative regulation of cell adhesion (GO:0007162)|negative regulation of cell-cell adhesion (GO:0022408)|positive regulation of cell migration (GO:0030335)|positive regulation of cell-cell adhesion mediated by integrin (GO:0033634)|regulation of microvillus assembly (GO:0032534)	apical plasma membrane (GO:0016324)|cell body (GO:0044297)|cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|integral component of plasma membrane (GO:0005887)|lamellipodium (GO:0030027)|microvillus membrane (GO:0031528)|plasma membrane (GO:0005886)|ruffle (GO:0001726)|slit diaphragm (GO:0036057)				NS(1)|breast(3)|endometrium(3)|kidney(3)|large_intestine(4)|lung(4)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	24	Melanoma(18;0.162)					gacggcgacgacggcagcagc	0.741																																					p.S22P		.											.	PODXL-136	0			c.T64C						.						5.0	8.0	7.0					7																	131241055		1914	3836	5750	SO:0001583	missense	5420	exon1			GCGACGACGGCAG		CCDS34755.1, CCDS47714.1	7q32-q33	2008-07-18			ENSG00000128567	ENSG00000128567			9171	protein-coding gene	gene with protein product		602632					Standard	NM_001018111		Approved	PCLP, Gp200, PC	uc003vqx.4	O00592	OTTHUMG00000154918	ENST00000378555.3:c.64T>C	7.37:g.131241055A>G	ENSP00000367817:p.Ser22Pro	Somatic	1	0		WXS	Illumina GAIIx	Phase_I	33	7	NM_001018111	0	0	2	2	0	A6NHX8|Q52LZ7|Q53ER6	Missense_Mutation	SNP	ENST00000378555.3	37	CCDS34755.1	.	.	.	.	.	.	.	.	.	.	A	10.93	1.488975	0.26686	.	.	ENSG00000128567	ENST00000541194;ENST00000537928;ENST00000378555;ENST00000322985	T;T;T;T	0.12774	2.82;2.65;2.82;2.85	.	.	.	.	7739.210000	0.00166	U	0.000000	T	0.08670	0.0215	N	0.14661	0.345	0.09310	N	0.999994	.	.	.	.	.	.	T	0.24728	-1.0152	6	0.29301	T	0.29	.	.	.	.	.	22;22	O00592-2;O00592	.;PODXL_HUMAN	P	22	ENSP00000440518:S22P;ENSP00000442655:S22P;ENSP00000367817:S22P;ENSP00000319782:S22P	ENSP00000319782:S22P	S	-	1	0	PODXL	130891595	0.001000	0.12720	0.027000	0.17364	0.027000	0.11550	0.743000	0.26231	0.056000	0.16144	0.055000	0.15244	TCG	.		0.741	PODXL-005	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000337627.2	NM_001018111	
KIAA1549	57670	broad.mit.edu;bcgsc.ca	37	7	138602801	138602801	+	Missense_Mutation	SNP	G	G	C			TCGA-PK-A5HA-01A-11D-A29I-10	TCGA-PK-A5HA-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2bd7613-8a82-453c-b1d0-f0ad6fbc0766	688c5eb5-c374-4bfb-81d1-c0ba622386cf	g.chr7:138602801G>C	ENST00000422774.1	-	2	1619	c.1571C>G	c.(1570-1572)gCc>gGc	p.A524G	KIAA1549_ENST00000242365.4_Missense_Mutation_p.A474G|KIAA1549_ENST00000440172.1_Missense_Mutation_p.A524G			Q9HCM3	K1549_HUMAN	KIAA1549	524	Ser-rich.					integral component of membrane (GO:0016021)			KIAA1549/BRAF(703)	large_intestine(4)|pancreas(1)|upper_aerodigestive_tract(2)	7						GCGGCCGTGGGCAGGGGGAAC	0.542			O	BRAF	pilocytic astrocytoma																																p.A524G	NSCLC(119;1534 1718 44213 46230 50068)	.		Dom	yes		7	7q34	57670	KIAA1549		O	.	KIAA1549-369	0			c.C1571G						.						26.0	28.0	28.0					7																	138602801		2023	4188	6211	SO:0001583	missense	57670	exon2			CCGTGGGCAGGGG		CCDS47723.1, CCDS47723.2, CCDS56513.1	7q34	2009-10-09			ENSG00000122778	ENSG00000122778			22219	protein-coding gene	gene with protein product		613344					Standard	NM_020910		Approved		uc011kql.2	Q9HCM3	OTTHUMG00000157214	ENST00000422774.1:c.1571C>G	7.37:g.138602801G>C	ENSP00000416040:p.Ala524Gly	Somatic	113	0		WXS	Illumina GAIIx	Phase_I	103	5	NM_020910	0	0	3	3	0	B6HY55|B6HY56|B6HY58|B6HY60|B6HY61|B6HY62|B6HY63|B6HY64|B6HY65|B6HY66|Q5BJD6|Q8IY15|Q9H0M3	Missense_Mutation	SNP	ENST00000422774.1	37	CCDS56513.1	.	.	.	.	.	.	.	.	.	.	G	6.707	0.499111	0.12762	.	.	ENSG00000122778	ENST00000440172;ENST00000242365;ENST00000422774	T;T;T	0.23754	1.89;1.9;1.89	4.16	3.25	0.37280	.	0.412136	0.20841	N	0.084715	T	0.10465	0.0256	N	0.03608	-0.345	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.04013	0.0;0.001	T	0.21690	-1.0238	10	0.24483	T	0.36	.	9.6814	0.40072	0.0994:0.0:0.9006:0.0	.	524;524	Q9HCM3;Q9HCM3-2	K1549_HUMAN;.	G	524;474;524	ENSP00000406661:A524G;ENSP00000242365:A474G;ENSP00000416040:A524G	ENSP00000242365:A474G	A	-	2	0	KIAA1549	138253341	0.005000	0.15991	0.028000	0.17463	0.003000	0.03518	1.217000	0.32455	2.166000	0.68216	0.655000	0.94253	GCC	.		0.542	KIAA1549-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000348092.1		
KLRG2	346689	broad.mit.edu	37	7	139138349	139138349	+	Missense_Mutation	SNP	G	G	T			TCGA-PK-A5HA-01A-11D-A29I-10	TCGA-PK-A5HA-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2bd7613-8a82-453c-b1d0-f0ad6fbc0766	688c5eb5-c374-4bfb-81d1-c0ba622386cf	g.chr7:139138349G>T	ENST00000340940.4	-	5	1283	c.1214C>A	c.(1213-1215)gCc>gAc	p.A405D	KLRG2_ENST00000393039.2_Missense_Mutation_p.P288T	NM_198508.2	NP_940910.1	A4D1S0	KLRG2_HUMAN	killer cell lectin-like receptor subfamily G, member 2	405	C-type lectin. {ECO:0000255|PROSITE- ProRule:PRU00040}.					integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)			central_nervous_system(1)|large_intestine(2)|lung(3)	6	Melanoma(164;0.233)					GGTCCCCTTGGCACAGACCCA	0.632																																					p.A405D		.											.	KLRG2-90	0			c.C1214A						.						35.0	28.0	30.0					7																	139138349		2203	4299	6502	SO:0001583	missense	346689	exon5			CCCTTGGCACAGA	AK126174	CCDS5854.1	7q34	2011-08-30			ENSG00000188883	ENSG00000188883		"""Killer cell lectin-like receptors"", ""C-type lectin domain containing"""	24778	protein-coding gene	gene with protein product	"""C-type lectin domain family 15, member B"""						Standard	XM_005250311		Approved	FLJ44186, CLEC15B	uc003vvb.3	A4D1S0	OTTHUMG00000157705	ENST00000340940.4:c.1214C>A	7.37:g.139138349G>T	ENSP00000339356:p.Ala405Asp	Somatic	41	0		WXS	Illumina GAIIx	Phase_I	60	4	NM_198508	0	0	0	0	0	Q2NL79|Q6ZTV6	Missense_Mutation	SNP	ENST00000340940.4	37	CCDS5854.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	8.838|8.838	0.941481|0.941481	0.18281|0.18281	.|.	.|.	ENSG00000188883|ENSG00000188883	ENST00000340940|ENST00000393039	T|T	0.17213|0.42513	2.29|0.97	4.68|4.68	0.596|0.596	0.17496|0.17496	C-type lectin fold (1);C-type lectin-like (1);C-type lectin (3);|.	0.399718|.	0.18309|.	N|.	0.145171|.	T|T	0.43942|0.43942	0.1270|0.1270	L|L	0.57536|0.57536	1.79|1.79	0.09310|0.09310	N|N	0.999999|0.999999	D|D	0.58268|0.54207	0.982|0.965	P|P	0.54924|0.50049	0.764|0.629	T|T	0.31696|0.31696	-0.9934|-0.9934	10|9	0.59425|0.87932	D|D	0.04|0	-11.9566|-11.9566	5.9504|5.9504	0.19242|0.19242	0.4743:0.0:0.5257:0.0|0.4743:0.0:0.5257:0.0	.|.	405|288	A4D1S0|A4D1S0-2	KLRG2_HUMAN|.	D|T	405|288	ENSP00000339356:A405D|ENSP00000376759:P288T	ENSP00000339356:A405D|ENSP00000376759:P288T	A|P	-|-	2|1	0|0	KLRG2|KLRG2	138788889|138788889	0.901000|0.901000	0.30685|0.30685	0.831000|0.831000	0.32960|0.32960	0.820000|0.820000	0.46376|0.46376	0.494000|0.494000	0.22467|0.22467	0.226000|0.226000	0.20979|0.20979	0.591000|0.591000	0.81541|0.81541	GCC|CCA	.		0.632	KLRG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349433.1	NM_198508	
ATP6V0E2	155066	hgsc.bcm.edu	37	7	149571095	149571095	+	5'UTR	SNP	G	G	A	rs79377053	byFrequency	TCGA-PK-A5HA-01A-11D-A29I-10	TCGA-PK-A5HA-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2bd7613-8a82-453c-b1d0-f0ad6fbc0766	688c5eb5-c374-4bfb-81d1-c0ba622386cf	g.chr7:149571095G>A	ENST00000464662.1	+	0	14				ATP6V0E2_ENST00000456496.2_Missense_Mutation_p.A30T|ATP6V0E2_ENST00000606024.1_5'UTR|ATP6V0E2_ENST00000421974.2_Missense_Mutation_p.A30T|ATP6V0E2-AS1_ENST00000461019.1_RNA|ATP6V0E2_ENST00000479613.1_5'UTR|ATP6V0E2_ENST00000425642.2_5'Flank|ATP6V0E2-AS1_ENST00000464939.1_RNA|ATP6V0E2-AS1_ENST00000488315.1_RNA			Q8NHE4	VA0E2_HUMAN	ATPase, H+ transporting V0 subunit e2						ATP hydrolysis coupled proton transport (GO:0015991)|cell growth (GO:0016049)|cellular iron ion homeostasis (GO:0006879)|insulin receptor signaling pathway (GO:0008286)|interaction with host (GO:0051701)|phagosome maturation (GO:0090382)|transferrin transport (GO:0033572)|transmembrane transport (GO:0055085)|vacuolar acidification (GO:0007035)	endosome membrane (GO:0010008)|integral component of membrane (GO:0016021)|phagocytic vesicle membrane (GO:0030670)|proton-transporting V-type ATPase, V0 domain (GO:0033179)	ATPase activity, coupled to transmembrane movement of ions (GO:0042625)|hydrogen ion transmembrane transporter activity (GO:0015078)			lung(1)	1			OV - Ovarian serous cystadenocarcinoma(82;0.00256)			CTGGGGACCCGCGCACCTGCA	0.716													G|||	682	0.136182	0.3994	0.049	5008	,	,		12396	0.0526		0.0368	False		,,,				2504	0.0307				p.A30T		.											.	.	0			c.G88A						.	G	THR/ALA,THR/ALA	991,2511		116,759,876	4.0	6.0	5.0		88,88	1.7	0.0	7	dbSNP_132	5	266,6746		7,252,3247	no	missense,missense	ATP6V0E2	NM_001100592.1,NM_145230.2	58,58	123,1011,4123	AA,AG,GG		3.7935,28.2981,11.9555	probably-damaging,probably-damaging	30/214,30/131	149571095	1257,9257	1751	3506	5257	SO:0001623	5_prime_UTR_variant	155066	exon1			GGACCCGCGCACC	AK057700	CCDS47742.1, CCDS55181.1	7q36.1	2010-04-21	2006-10-12	2006-10-12	ENSG00000171130	ENSG00000171130		"""ATPases / V-type"""	21723	protein-coding gene	gene with protein product		611019	"""chromosome 7 open reading frame 32"", ""ATPase, H+ transporting V0 subunit E isoform 2-like (rat)"""	C7orf32, ATP6V0E2L			Standard	XM_005249958		Approved		uc003wgs.3	Q8NHE4	OTTHUMG00000158094	ENST00000464662.1:c.-60G>A	7.37:g.149571095G>A		Somatic	1	0		WXS	Illumina GAIIx	Phase_I	55	36	NM_001100592	0	0	5	6	1	A2T863|A2T8L7|B5MDP5|J3KQW7|Q6MZW1|Q75L47|Q7Z4R7|Q8N7I8	Missense_Mutation	SNP	ENST00000464662.1	37		283	0.1295787545787546	188	0.3821138211382114	21	0.058011049723756904	42	0.07342657342657342	32	0.04221635883905013	G	14.56	2.570645	0.45798	0.282981	0.037935	ENSG00000171130	ENST00000421974;ENST00000456496	.	.	.	2.57	1.67	0.24075	.	.	.	.	.	T	0.00012	0.0000	N	0.08118	0	0.43550	P	0.004141999999999979	P	0.40638	0.725	B	0.27608	0.081	T	0.43988	-0.9357	7	0.87932	D	0	.	7.3999	0.26958	0.0:0.2709:0.7291:0.0	.	30	E9PAS2	.	T	30	.	ENSP00000411672:A30T	A	+	1	0	ATP6V0E2	149202028	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	0.103000	0.15292	0.651000	0.30788	0.563000	0.77884	GCG	G|0.870;A|0.130		0.716	ATP6V0E2-007	KNOWN	alternative_3_UTR|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000350177.2	NM_145230	
LRRC61	65999	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	150034045	150034045	+	Missense_Mutation	SNP	C	C	T			TCGA-PK-A5HA-01A-11D-A29I-10	TCGA-PK-A5HA-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2bd7613-8a82-453c-b1d0-f0ad6fbc0766	688c5eb5-c374-4bfb-81d1-c0ba622386cf	g.chr7:150034045C>T	ENST00000359623.4	+	3	683	c.95C>T	c.(94-96)tCc>tTc	p.S32F	LRRC61_ENST00000493307.1_Missense_Mutation_p.S32F|LRRC61_ENST00000323078.7_Missense_Mutation_p.S32F	NM_001142928.1	NP_001136400.1	Q9BV99	LRC61_HUMAN	leucine rich repeat containing 61	32										endometrium(2)|large_intestine(1)|skin(1)|upper_aerodigestive_tract(1)	5			OV - Ovarian serous cystadenocarcinoma(82;0.011)			TCCCTGGAGTCCATCCTGCTA	0.642																																					p.S32F		.											.	LRRC61-90	0			c.C95T						.						76.0	68.0	71.0					7																	150034045		2203	4300	6503	SO:0001583	missense	65999	exon2			TGGAGTCCATCCT	BC001354	CCDS5901.1	7q31-q35	2006-02-07			ENSG00000127399	ENSG00000127399			21704	protein-coding gene	gene with protein product							Standard	NM_023942		Approved	MGC3036, FLJ31392, HSPC295	uc003wgv.4	Q9BV99	OTTHUMG00000158326	ENST00000359623.4:c.95C>T	7.37:g.150034045C>T	ENSP00000352642:p.Ser32Phe	Somatic	106	0		WXS	Illumina GAIIx	Phase_I	93	16	NM_023942	0	0	0	0	0	B3KUW0|D3DWY8	Missense_Mutation	SNP	ENST00000359623.4	37	CCDS5901.1	.	.	.	.	.	.	.	.	.	.	C	22.5	4.298738	0.81025	.	.	ENSG00000127399	ENST00000323078;ENST00000359623;ENST00000493307	T;T;T	0.25912	1.77;1.77;1.77	5.02	5.02	0.67125	.	0.000000	0.85682	D	0.000000	T	0.41143	0.1146	L	0.59436	1.845	0.80722	D	1	P	0.51791	0.948	P	0.54499	0.754	T	0.31724	-0.9933	10	0.72032	D	0.01	-24.2777	15.8648	0.79057	0.0:1.0:0.0:0.0	.	32	Q9BV99	LRC61_HUMAN	F	32	ENSP00000339047:S32F;ENSP00000352642:S32F;ENSP00000420560:S32F	ENSP00000339047:S32F	S	+	2	0	LRRC61	149664978	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	5.290000	0.65661	2.339000	0.79563	0.555000	0.69702	TCC	.		0.642	LRRC61-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350696.1	NM_023942	
MFHAS1	9258	hgsc.bcm.edu	37	8	8750467	8750467	+	Silent	SNP	A	A	G	rs1062988	byFrequency	TCGA-PK-A5HA-01A-11D-A29I-10	TCGA-PK-A5HA-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2bd7613-8a82-453c-b1d0-f0ad6fbc0766	688c5eb5-c374-4bfb-81d1-c0ba622386cf	g.chr8:8750467A>G	ENST00000276282.6	-	1	688	c.102T>C	c.(100-102)ctT>ctC	p.L34L	RNU6-682P_ENST00000363843.1_RNA	NM_004225.2	NP_004216.2	Q9Y4C4	MFHA1_HUMAN	malignant fibrous histiocytoma amplified sequence 1	34										endometrium(1)|kidney(3)|large_intestine(7)|lung(6)|ovary(1)|prostate(2)|stomach(1)	21		Hepatocellular(245;0.217)		COAD - Colon adenocarcinoma(149;0.124)		cggcggcggTAAGCGTGAGCT	0.741													G|||	814	0.16254	0.3419	0.1196	5008	,	,		8355	0.001		0.1521	False		,,,				2504	0.1278				p.L34L	Melanoma(103;1201 2045 17515 28966)	.											.	MFHAS1-90	0			c.T102C						.	G		875,3021		81,713,1154	4.0	4.0	4.0		102	2.3	1.0	8	dbSNP_86	4	854,6846		52,750,3048	no	coding-synonymous	MFHAS1	NM_004225.2		133,1463,4202	GG,GA,AA		11.0909,22.4589,14.9103		34/1053	8750467	1729,9867	1948	3850	5798	SO:0001819	synonymous_variant	9258	exon1			GGCGGTAAGCGTG	AB016816	CCDS34844.1	8p23.1	2014-03-07			ENSG00000147324	ENSG00000147324			16982	protein-coding gene	gene with protein product	"""leucine rich repeat containing 65"", ""malignant fibrous histiocytoma-amplified sequences with leucine-rich tandem repeats 1"""	605352				9973190	Standard	NM_004225		Approved	MASL1, LRRC65	uc003wsj.1	Q9Y4C4	OTTHUMG00000163676	ENST00000276282.6:c.102T>C	8.37:g.8750467A>G		Somatic	1	0		WXS	Illumina GAIIx	Phase_I	11	5	NM_004225	0	0	0	0	0	Q96CI0	Silent	SNP	ENST00000276282.6	37	CCDS34844.1																																																																																			A|0.857;G|0.143		0.741	MFHAS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374724.2	NM_004225	
XKR6	286046	broad.mit.edu	37	8	10755519	10755519	+	Silent	SNP	A	A	T			TCGA-PK-A5HA-01A-11D-A29I-10	TCGA-PK-A5HA-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2bd7613-8a82-453c-b1d0-f0ad6fbc0766	688c5eb5-c374-4bfb-81d1-c0ba622386cf	g.chr8:10755519A>T	ENST00000416569.2	-	3	1895	c.1869T>A	c.(1867-1869)atT>atA	p.I623I	XKR6_ENST00000304437.2_Silent_p.I344I	NM_173683.3	NP_775954.2	Q5GH73	XKR6_HUMAN	XK, Kell blood group complex subunit-related family, member 6	623						integral component of membrane (GO:0016021)				breast(1)|endometrium(3)|kidney(3)|large_intestine(10)|lung(8)|ovary(2)|prostate(1)|skin(3)	31				Lung(29;0.0407)|COAD - Colon adenocarcinoma(149;0.0555)		CTCGATATCGAATGCCTACTG	0.458																																					p.I623I		.											.	XKR6-92	0			c.T1869A						.						124.0	114.0	117.0					8																	10755519		2203	4300	6503	SO:0001819	synonymous_variant	286046	exon3			ATATCGAATGCCT	BC024146	CCDS5978.2	8p23.1	2009-05-27	2006-01-12	2005-07-28	ENSG00000171044	ENSG00000171044			27806	protein-coding gene	gene with protein product			"""chromosome 8 open reading frame 7"", ""chromosome 8 open reading frame 21"", ""X Kell blood group precursor-related family, member 6"", ""chromosome 8 open reading frame 5"""	C8orf7, C8orf21, C8orf5			Standard	NM_173683		Approved		uc003wtk.1	Q5GH73	OTTHUMG00000129351	ENST00000416569.2:c.1869T>A	8.37:g.10755519A>T		Somatic	148	3		WXS	Illumina GAIIx	Phase_I	172	5	NM_173683	0	0	0	0	0	Q8TBA0	Silent	SNP	ENST00000416569.2	37	CCDS5978.2	.	.	.	.	.	.	.	.	.	.	A	4.325	0.059621	0.08339	.	.	ENSG00000171044	ENST00000382461	.	.	.	4.55	2.19	0.27852	.	.	.	.	.	T	0.55641	0.1933	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.46034	-0.9220	4	.	.	.	-11.7943	7.8645	0.29528	0.8294:0.0:0.1706:0.0	.	.	.	.	Y	400	.	.	F	-	2	0	XKR6	10792929	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	4.855000	0.62925	0.293000	0.22520	0.449000	0.29647	TTC	.		0.458	XKR6-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383958.1	NM_173683	
CDCA2	157313	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	8	25364323	25364323	+	Missense_Mutation	SNP	G	G	T			TCGA-PK-A5HA-01A-11D-A29I-10	TCGA-PK-A5HA-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2bd7613-8a82-453c-b1d0-f0ad6fbc0766	688c5eb5-c374-4bfb-81d1-c0ba622386cf	g.chr8:25364323G>T	ENST00000330560.3	+	15	2618	c.2141G>T	c.(2140-2142)tGt>tTt	p.C714F	CDCA2_ENST00000521098.2_3'UTR|CDCA2_ENST00000380665.3_Missense_Mutation_p.C699F	NM_152562.2	NP_689775.2	Q69YH5	CDCA2_HUMAN	cell division cycle associated 2	714					mitotic nuclear division (GO:0007067)|positive regulation of protein dephosphorylation (GO:0035307)	chromosome (GO:0005694)|cytoplasm (GO:0005737)|nucleus (GO:0005634)				breast(3)|cervix(1)|endometrium(3)|kidney(7)|large_intestine(7)|lung(10)|ovary(1)|prostate(3)	35		all_cancers(63;0.0378)|Ovarian(32;0.000878)|all_epithelial(46;0.0162)|Breast(100;0.0164)|Prostate(55;0.191)		UCEC - Uterine corpus endometrioid carcinoma (27;0.022)|Epithelial(17;1.37e-11)|Colorectal(74;0.0129)|COAD - Colon adenocarcinoma(73;0.0443)		CCTGTTTCTTGTGCTTCTGTA	0.378																																					p.C714F		.											.	CDCA2-90	0			c.G2141T						.						37.0	38.0	37.0					8																	25364323		2203	4300	6503	SO:0001583	missense	157313	exon15			TTTCTTGTGCTTC	BG354575	CCDS6049.1	8p21.2	2014-06-12			ENSG00000184661	ENSG00000184661			14623	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 81"""					12188893, 16492807	Standard	NM_152562		Approved	Repo-Man, PPP1R81	uc003xep.1	Q69YH5	OTTHUMG00000099429	ENST00000330560.3:c.2141G>T	8.37:g.25364323G>T	ENSP00000328228:p.Cys714Phe	Somatic	22	0		WXS	Illumina GAIIx	Phase_I	22	7	NM_152562	0	0	0	0	0	Q3SX74|Q4G0W0|Q5RKN0|Q69YI4|Q6P464|Q8N7C1	Missense_Mutation	SNP	ENST00000330560.3	37	CCDS6049.1	.	.	.	.	.	.	.	.	.	.	G	13.42	2.232626	0.39498	.	.	ENSG00000184661	ENST00000330560;ENST00000380665;ENST00000434814	T;T	0.49432	0.78;0.78	5.07	0.872	0.19113	.	0.571389	0.17790	N	0.161906	T	0.35566	0.0936	L	0.50333	1.59	0.09310	N	1	B;B	0.24882	0.025;0.113	B;B	0.25405	0.027;0.06	T	0.25950	-1.0117	10	0.48119	T	0.1	0.0215	3.7452	0.08545	0.1887:0.0:0.4553:0.356	.	699;714	E9PEI0;Q69YH5	.;CDCA2_HUMAN	F	714;699;113	ENSP00000328228:C714F;ENSP00000370040:C699F	ENSP00000328228:C714F	C	+	2	0	CDCA2	25420240	0.000000	0.05858	0.014000	0.15608	0.052000	0.14988	-0.096000	0.11059	0.313000	0.23062	0.650000	0.86243	TGT	.		0.378	CDCA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000216891.3	NM_152562	
C8orf34	116328	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	69552682	69552682	+	Missense_Mutation	SNP	C	C	T			TCGA-PK-A5HA-01A-11D-A29I-10	TCGA-PK-A5HA-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2bd7613-8a82-453c-b1d0-f0ad6fbc0766	688c5eb5-c374-4bfb-81d1-c0ba622386cf	g.chr8:69552682C>T	ENST00000539993.1	+	8	1468	c.919C>T	c.(919-921)Cgt>Tgt	p.R307C	C8orf34_ENST00000518698.1_Missense_Mutation_p.R393C|C8orf34_ENST00000325233.3_Missense_Mutation_p.R51C|C8orf34_ENST00000337103.4_Missense_Mutation_p.R282C			Q49A92	CH034_HUMAN	chromosome 8 open reading frame 34	307										NS(1)|breast(2)|endometrium(3)|kidney(2)|large_intestine(9)|lung(12)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)	36			Epithelial(68;0.0117)|OV - Ovarian serous cystadenocarcinoma(28;0.0227)|all cancers(69;0.0502)			TAACCAAGGCCGTCCTACTTA	0.413																																					p.R393C		.											.	C8orf34-153	0			c.C1177T						.						98.0	90.0	93.0					8																	69552682		2203	4300	6503	SO:0001583	missense	116328	exon8			CAAGGCCGTCCTA	AB056652	CCDS6203.1, CCDS6203.2	8q13	2009-10-01			ENSG00000165084	ENSG00000165084			30905	protein-coding gene	gene with protein product	"""vestibule 1"""						Standard	NM_052958		Approved	vest-1, VEST1	uc010lyz.3	Q49A92	OTTHUMG00000164438	ENST00000539993.1:c.919C>T	8.37:g.69552682C>T	ENSP00000438159:p.Arg307Cys	Somatic	72	0		WXS	Illumina GAIIx	Phase_I	80	25	NM_052958	0	0	0	0	0	A8K5X1|G3XAM6|Q8N1X0|Q8N9M7|Q8ND19|Q96Q28	Missense_Mutation	SNP	ENST00000539993.1	37		.	.	.	.	.	.	.	.	.	.	C	18.81	3.702577	0.68501	.	.	ENSG00000165084	ENST00000518698;ENST00000539993;ENST00000337103;ENST00000325233	T;T;T;T	0.64085	0.7;0.75;0.74;-0.08	5.46	4.53	0.55603	.	0.000000	0.85682	D	0.000000	T	0.74023	0.3662	L	0.56769	1.78	0.58432	D	0.999994	D	0.89917	1.0	D	0.85130	0.997	T	0.72918	-0.4146	9	.	.	.	-10.9267	13.521	0.61568	0.3413:0.6587:0.0:0.0	.	307	Q49A92	CH034_HUMAN	C	393;307;282;51	ENSP00000427820:R393C;ENSP00000438159:R307C;ENSP00000337174:R282C;ENSP00000319532:R51C	.	R	+	1	0	C8orf34	69715236	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.540000	0.53611	2.567000	0.86603	0.585000	0.79938	CGT	.		0.413	C8orf34-201	KNOWN	basic|appris_candidate	protein_coding	protein_coding		NM_052958	
E2F5	1875	hgsc.bcm.edu	37	8	86089787	86089787	+	Silent	SNP	C	C	G	rs12926	byFrequency	TCGA-PK-A5HA-01A-11D-A29I-10	TCGA-PK-A5HA-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2bd7613-8a82-453c-b1d0-f0ad6fbc0766	688c5eb5-c374-4bfb-81d1-c0ba622386cf	g.chr8:86089787C>G	ENST00000416274.2	+	1	166	c.132C>G	c.(130-132)gcC>gcG	p.A44A	E2F5_ENST00000418930.2_Silent_p.A44A|RP11-219B4.3_ENST00000520129.1_RNA|RP11-219B4.7_ENST00000566000.1_RNA|E2F5_ENST00000256117.5_Silent_p.A44A|RP11-219B4.7_ENST00000562577.1_RNA	NM_001083588.1|NM_001951.3	NP_001077057.1|NP_001942.2	Q15329	E2F5_HUMAN	E2F transcription factor 5, p130-binding	44					gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|organ morphogenesis (GO:0009887)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of cell cycle (GO:0051726)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)			NS(1)|kidney(1)|large_intestine(2)|lung(3)|ovary(1)	8						TCGGGGGCGCCGGGGGCGGCA	0.751													C|||	2815	0.562101	0.5545	0.549	5008	,	,		6370	0.4157		0.6928	False		,,,				2504	0.5982				p.A44A		.											.	E2F5-415	0			c.C132G						.	C	,	2392,1558		800,792,383	4.0	5.0	5.0		132,132	0.9	0.1	8	dbSNP_52	5	5668,2428		2076,1516,456	no	coding-synonymous,coding-synonymous	E2F5	NM_001083588.1,NM_001951.3	,	2876,2308,839	GG,GC,CC		29.9901,39.443,33.0898	,	44/346,44/347	86089787	8060,3986	1975	4048	6023	SO:0001819	synonymous_variant	1875	exon1			GGGCGCCGGGGGC	X86097	CCDS47885.1, CCDS47886.1, CCDS55254.1	8q21.2	2004-01-29			ENSG00000133740	ENSG00000133740			3119	protein-coding gene	gene with protein product		600967				7892279	Standard	NM_001083588		Approved		uc003ycz.4	Q15329	OTTHUMG00000164785	ENST00000416274.2:c.132C>G	8.37:g.86089787C>G		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	4	4	NM_001083588	0	0	0	3	3	E9PBN9|Q16601|Q92756	Silent	SNP	ENST00000416274.2	37	CCDS47885.1																																																																																			C|0.434;G|0.566		0.751	E2F5-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000380274.1	NM_001951	
TRIB1	10221	hgsc.bcm.edu	37	8	126443348	126443348	+	Silent	SNP	C	C	T	rs2385113	byFrequency	TCGA-PK-A5HA-01A-11D-A29I-10	TCGA-PK-A5HA-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2bd7613-8a82-453c-b1d0-f0ad6fbc0766	688c5eb5-c374-4bfb-81d1-c0ba622386cf	g.chr8:126443348C>T	ENST00000311922.3	+	1	786	c.204C>T	c.(202-204)agC>agT	p.S68S	TRIB1_ENST00000520847.1_5'Flank|TRIB1_ENST00000519576.1_5'Flank	NM_001282985.1|NM_025195.2	NP_001269914.1|NP_079471.1			tribbles pseudokinase 1											NS(1)|large_intestine(2)|lung(2)|prostate(2)|urinary_tract(1)	8	all_hematologic(1;4.97e-05)|Ovarian(258;0.00167)|all_neural(195;0.00294)|Hepatocellular(40;0.108)		STAD - Stomach adenocarcinoma(47;0.000918)			CGCCCTGCAGCCCGCAGCCCC	0.796													C|||	2128	0.42492	0.2466	0.4597	5008	,	,		8166	0.3036		0.4632	False		,,,				2504	0.727				p.S68S		.											.	TRIB1-358	0			c.C204T						.						1.0	1.0	1.0					8																	126443348		434	1113	1547	SO:0001819	synonymous_variant	10221	exon1			CTGCAGCCCGCAG	AF205437	CCDS6357.1, CCDS64971.1	8q24.13	2013-10-03	2013-10-03			ENSG00000173334			16891	protein-coding gene	gene with protein product		609461	"""tribbles homolog 1 (Drosophila)"""			9342215, 16715410	Standard	NM_001282985		Approved	C8FW, GIG2, TRB1	uc003yrx.3	Q96RU8		ENST00000311922.3:c.204C>T	8.37:g.126443348C>T		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	5	5	NM_025195	0	0	0	0	0		Silent	SNP	ENST00000311922.3	37	CCDS6357.1																																																																																			C|0.640;T|0.360		0.796	TRIB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381430.1	NM_025195	
ST3GAL1	6482	ucsc.edu;bcgsc.ca	37	8	134474162	134474162	+	Missense_Mutation	SNP	T	T	C			TCGA-PK-A5HA-01A-11D-A29I-10	TCGA-PK-A5HA-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2bd7613-8a82-453c-b1d0-f0ad6fbc0766	688c5eb5-c374-4bfb-81d1-c0ba622386cf	g.chr8:134474162T>C	ENST00000319914.5	-	8	1832	c.805A>G	c.(805-807)Acc>Gcc	p.T269A	ST3GAL1_ENST00000522652.1_Missense_Mutation_p.T269A|ST3GAL1_ENST00000399640.2_Missense_Mutation_p.T269A|ST3GAL1_ENST00000521180.1_Missense_Mutation_p.T269A			Q11201	SIA4A_HUMAN	ST3 beta-galactoside alpha-2,3-sialyltransferase 1	269					carbohydrate metabolic process (GO:0005975)|cellular protein metabolic process (GO:0044267)|cellular protein modification process (GO:0006464)|glycosaminoglycan metabolic process (GO:0030203)|keratan sulfate biosynthetic process (GO:0018146)|keratan sulfate metabolic process (GO:0042339)|N-acetylneuraminate metabolic process (GO:0006054)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation (GO:0006487)|protein phosphorylation (GO:0006468)|sialylation (GO:0097503)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|integral component of Golgi membrane (GO:0030173)|membrane (GO:0016020)	beta-galactoside (CMP) alpha-2,3-sialyltransferase activity (GO:0003836)			endometrium(3)|large_intestine(2)|lung(11)|prostate(1)	17	all_epithelial(106;1.53e-23)|Lung NSC(106;3.15e-07)|all_lung(105;1.26e-06)|Ovarian(258;0.00438)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.00721)			AGGATGCCGGTAGATGGGTAT	0.587																																					p.T269A		.											.	ST3GAL1-90	0			c.A805G						.						171.0	140.0	151.0					8																	134474162		2203	4300	6503	SO:0001583	missense	6482	exon9			TGCCGGTAGATGG	L29555	CCDS6373.1	8q24.22	2013-03-01	2003-01-14	2005-02-07	ENSG00000008513	ENSG00000008513	2.4.99.4	"""Sialyltransferases"""	10862	protein-coding gene	gene with protein product	"""ST3Gal I"""	607187	"""sialyltransferase 4A (beta-galactosidase alpha-2,3-sialytransferase)"""	SIAT4A		10504389, 7655169	Standard	NM_003033		Approved	ST3O, SIATFL, ST3GalA.1	uc003yuk.2	Q11201	OTTHUMG00000164534	ENST00000319914.5:c.805A>G	8.37:g.134474162T>C	ENSP00000318445:p.Thr269Ala	Somatic	195	4		WXS	Illumina GAIIx	Phase_I	154	54	NM_173344	0	0	7	7	0	O60677|Q9UN51	Missense_Mutation	SNP	ENST00000319914.5	37	CCDS6373.1	.	.	.	.	.	.	.	.	.	.	T	29.1	4.976784	0.92982	.	.	ENSG00000008513	ENST00000319914;ENST00000399640;ENST00000521180;ENST00000522652	T;T;T;T	0.39229	1.09;1.09;1.09;1.09	5.01	5.01	0.66863	.	0.000000	0.85682	D	0.000000	T	0.69967	0.3170	M	0.92077	3.27	0.80722	D	1	D	0.65815	0.995	D	0.64687	0.928	T	0.77948	-0.2396	10	0.59425	D	0.04	-5.3127	14.1925	0.65646	0.0:0.0:0.0:1.0	.	269	Q11201	SIA4A_HUMAN	A	269	ENSP00000318445:T269A;ENSP00000414073:T269A;ENSP00000428540:T269A;ENSP00000430515:T269A	ENSP00000318445:T269A	T	-	1	0	ST3GAL1	134543344	1.000000	0.71417	0.995000	0.50966	0.856000	0.48823	7.996000	0.88334	2.018000	0.59344	0.533000	0.62120	ACC	T|1.000;G|0.000		0.587	ST3GAL1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379132.1	NM_003033	
JRK	8629	broad.mit.edu;bcgsc.ca	37	8	143746396	143746396	+	RNA	SNP	T	T	G			TCGA-PK-A5HA-01A-11D-A29I-10	TCGA-PK-A5HA-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2bd7613-8a82-453c-b1d0-f0ad6fbc0766	688c5eb5-c374-4bfb-81d1-c0ba622386cf	g.chr8:143746396T>G	ENST00000507178.2	-	0	1414							O75564	JERKY_HUMAN	Jrk homolog (mouse)							nucleus (GO:0005634)	DNA binding (GO:0003677)					all_cancers(97;3.96e-12)|all_epithelial(106;1.19e-08)|Lung NSC(106;0.000413)|all_lung(105;0.00106)|Medulloblastoma(13;0.00276)|all_neural(13;0.00559)|Ovarian(258;0.0254)|Acute lymphoblastic leukemia(118;0.155)	Acute lymphoblastic leukemia(644;2.31e-05)				gaatatggcatcgttcatgtt	0.612																																					p.D361A		.											.	.	0			c.A1082C						.						9.0	10.0	10.0					8																	143746396		2076	4210	6286			8629	exon2			ATGGCATCGTTCA	AF072467	CCDS75796.1, CCDS75797.1	8q24.3	2014-03-28	2014-03-28			ENSG00000234616			6199	protein-coding gene	gene with protein product		603210	"""jerky (mouse) homolog"", ""jerky homolog (mouse)"""			9675132	Standard	NM_003724		Approved	JH8, jerky	uc003ywo.3	O75564			8.37:g.143746396T>G		Somatic	110	0		WXS	Illumina GAIIx	Phase_I	152	5	NM_003724	0	0	0	0	0	O75565	Missense_Mutation	SNP	ENST00000507178.2	37																																																																																				.		0.612	JRK-003	KNOWN	basic	processed_transcript	processed_transcript	OTTHUMT00000362914.1	NM_003724	
ZNF696	79943	hgsc.bcm.edu	37	8	144378868	144378868	+	Silent	SNP	A	A	G	rs7386259	byFrequency	TCGA-PK-A5HA-01A-11D-A29I-10	TCGA-PK-A5HA-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2bd7613-8a82-453c-b1d0-f0ad6fbc0766	688c5eb5-c374-4bfb-81d1-c0ba622386cf	g.chr8:144378868A>G	ENST00000330143.3	+	3	1432	c.1023A>G	c.(1021-1023)cgA>cgG	p.R341R		NM_030895.2	NP_112157.2	Q9H7X3	ZN696_HUMAN	zinc finger protein 696	341					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			lung(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	8	all_cancers(97;1.01e-10)|all_epithelial(106;4.86e-09)|Lung NSC(106;0.000167)|all_lung(105;0.000459)|Ovarian(258;0.0212)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.156)|Colorectal(110;0.173)			GGCACCAGCGACTCCACACGG	0.726													G|||	4505	0.899561	0.9425	0.9179	5008	,	,		11520	0.8403		0.8608	False		,,,				2504	0.9294				p.R341R		.											.	ZNF696-90	0			c.A1023G						.	G		3773,275		1771,231,22	5.0	5.0	5.0		1023	-0.3	0.0	8	dbSNP_116	5	6735,1261		2843,1049,106	no	coding-synonymous	ZNF696	NM_030895.2		4614,1280,128	GG,GA,AA		15.7704,6.7935,12.7532		341/375	144378868	10508,1536	2024	3998	6022	SO:0001819	synonymous_variant	79943	exon3			CCAGCGACTCCAC	AK024191	CCDS6399.1	8q24.3	2013-01-08				ENSG00000185730		"""Zinc fingers, C2H2-type"""	25872	protein-coding gene	gene with protein product							Standard	NM_030895		Approved	FLJ14129	uc003yxy.4	Q9H7X3		ENST00000330143.3:c.1023A>G	8.37:g.144378868A>G		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	10	10	NM_030895	0	0	0	2	2	A0AVE2	Silent	SNP	ENST00000330143.3	37	CCDS6399.1																																																																																			A|0.118;G|0.882		0.726	ZNF696-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381164.2	NM_030895	
PLEC	5339	hgsc.bcm.edu	37	8	145001784	145001784	+	Silent	SNP	A	A	G	rs3135109	byFrequency	TCGA-PK-A5HA-01A-11D-A29I-10	TCGA-PK-A5HA-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2bd7613-8a82-453c-b1d0-f0ad6fbc0766	688c5eb5-c374-4bfb-81d1-c0ba622386cf	g.chr8:145001784A>G	ENST00000322810.4	-	27	4130	c.3961T>C	c.(3961-3963)Ttg>Ctg	p.L1321L	PLEC_ENST00000354589.3_Silent_p.L1184L|PLEC_ENST00000527096.1_Silent_p.L1207L|PLEC_ENST00000345136.3_Silent_p.L1184L|PLEC_ENST00000356346.3_Silent_p.L1170L|PLEC_ENST00000398774.2_Silent_p.L1152L|PLEC_ENST00000354958.2_Silent_p.L1162L|PLEC_ENST00000436759.2_Silent_p.L1211L|PLEC_ENST00000357649.2_Silent_p.L1188L	NM_201380.2	NP_958782.1	Q15149	PLEC_HUMAN	plectin	1321	Globular 1.		L -> V (in dbSNP:rs3135109). {ECO:0000269|PubMed:8698233}.		apoptotic process (GO:0006915)|cell junction assembly (GO:0034329)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)	costamere (GO:0043034)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|hemidesmosome (GO:0030056)|intermediate filament cytoskeleton (GO:0045111)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|sarcoplasm (GO:0016528)	ankyrin binding (GO:0030506)|poly(A) RNA binding (GO:0044822)|structural constituent of muscle (GO:0008307)			NS(1)|breast(3)|central_nervous_system(4)|cervix(7)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(8)|lung(57)|ovary(4)|pancreas(2)|prostate(11)|skin(9)|stomach(2)|upper_aerodigestive_tract(10)	137						CGCTCAAGCAACTGGGCGACC	0.716													G|||	1156	0.230831	0.028	0.2954	5008	,	,		12494	0.1429		0.4274	False		,,,				2504	0.3476				p.L1321L		.											.	PLEC-141	0			c.T3961C						.	G	,,,,,,,	296,3620		20,256,1682	5.0	6.0	6.0		3631,3508,3484,3961,3454,3550,3562,3550	4.4	0.9	8	dbSNP_103	6	2835,5065		532,1771,1647	no	coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous	PLEC	NM_000445.3,NM_201378.2,NM_201379.1,NM_201380.2,NM_201381.1,NM_201382.2,NM_201383.1,NM_201384.1	,,,,,,,	552,2027,3329	GG,GA,AA		35.8861,7.5587,26.498	,,,,,,,	1211/4575,1170/4534,1162/4526,1321/4685,1152/4516,1184/4548,1188/4552,1184/4548	145001784	3131,8685	1958	3950	5908	SO:0001819	synonymous_variant	5339	exon27			CAAGCAACTGGGC	U53204	CCDS43769.1, CCDS43770.1, CCDS43771.1, CCDS43772.1, CCDS43773.1, CCDS43774.1, CCDS43775.1, CCDS47936.1	8q24	2010-02-04	2010-02-04	2010-02-04	ENSG00000178209	ENSG00000178209			9069	protein-coding gene	gene with protein product		601282	"""plectin 1, intermediate filament binding protein, 500kD"", ""epidermolysis bullosa simplex 1 (Ogna)"", ""plectin 1, intermediate filament binding protein 500kDa"""	EBS1, PLEC1		8633055, 8696340	Standard	XM_005250976		Approved	PCN, PLTN	uc003zaf.1	Q15149	OTTHUMG00000165291	ENST00000322810.4:c.3961T>C	8.37:g.145001784A>G		Somatic	5	0		WXS	Illumina GAIIx	Phase_I	26	26	NM_201380	0	0	0	21	21	Q15148|Q16640|Q6S376|Q6S377|Q6S378|Q6S379|Q6S380|Q6S381|Q6S382|Q6S383	Silent	SNP	ENST00000322810.4	37	CCDS43772.1																																																																																			G|0.246;A|0.754		0.716	PLEC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383281.1	NM_000445	
CHMP5	51510	hgsc.bcm.edu	37	9	33264540	33264540	+	5'Flank	SNP	C	C	G	rs1071545	byFrequency	TCGA-PK-A5HA-01A-11D-A29I-10	TCGA-PK-A5HA-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2bd7613-8a82-453c-b1d0-f0ad6fbc0766	688c5eb5-c374-4bfb-81d1-c0ba622386cf	g.chr9:33264540C>G	ENST00000223500.8	+	0	0				BAG1_ENST00000379704.2_5'UTR|CHMP5_ENST00000419016.2_5'Flank|BAG1_ENST00000472232.3_Missense_Mutation_p.G45R	NM_016410.5	NP_057494.3	Q9NZZ3	CHMP5_HUMAN	charged multivesicular body protein 5						endosomal transport (GO:0016197)|endosome to lysosome transport (GO:0008333)|lysosome organization (GO:0007040)|membrane organization (GO:0061024)|protein transport (GO:0015031)|regulation of receptor recycling (GO:0001919)|viral life cycle (GO:0019058)|viral process (GO:0016032)	cytosol (GO:0005829)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)				endometrium(1)|kidney(1)|large_intestine(3)|lung(4)|ovary(1)	10			LUSC - Lung squamous cell carcinoma(29;0.00506)			GGTGGACGCCCAGAGGGAGGC	0.771													G|||	4905	0.979433	0.9251	0.9942	5008	,	,		8749	1.0		1.0	False		,,,				2504	1.0				p.G45R		.											.	BAG1-228	0			c.G133C						.		,ARG/GLY	3714,198		1759,196,1	4.0	5.0	4.0		,133	3.6	0.0	9	dbSNP_86	4	7514,4		3755,4,0	no	utr-5,missense	BAG1	NM_001172415.1,NM_004323.5	,125	5514,200,1	GG,GC,CC		0.0532,5.0613,1.7673	,benign	,45/346	33264540	11228,202	1956	3759	5715	SO:0001631	upstream_gene_variant	573	exon1			GACGCCCAGAGGG	AF132968	CCDS6537.1, CCDS56569.1	9p13.3	2011-09-21	2011-09-21	2005-08-09	ENSG00000086065	ENSG00000086065		"""Charged multivesicular body proteins"""	26942	protein-coding gene	gene with protein product		610900	"""chromosome 9 open reading frame 83"", ""chromatin modifying protein 5"""	C9orf83, SNF7DC2		15644320, 11559748	Standard	NM_016410		Approved	HSPC177, CGI-34, Vps60	uc003zsm.4	Q9NZZ3	OTTHUMG00000019765		9.37:g.33264540C>G	Exception_encountered	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	17	17	NM_004323	0	0	0	58	58	B2RD95|B4DIR6|Q5VXW2|Q96AV2|Q9HB68|Q9NYS4|Q9Y323	Missense_Mutation	SNP	ENST00000223500.8	37	CCDS6537.1	2143	0.9812271062271062	452	0.9186991869918699	361	0.9972375690607734	572	1.0	758	1.0	G	5.424	0.263435	0.10294	0.949387	0.999468	ENSG00000107262	ENST00000472232	.	.	.	3.62	3.62	0.41486	.	0.965269	0.08484	N	0.939035	T	0.00012	0.0000	N	0.08118	0	0.47407	P	5.870000000000042E-4	B	0.02656	0.0	B	0.01281	0.0	T	0.39761	-0.9598	8	0.06236	T	0.91	-3.4106	9.2895	0.37778	0.0:0.2201:0.7798:0.0	rs1071545;rs1702659;rs59772010	45	Q99933	BAG1_HUMAN	R	45	.	ENSP00000420514:G45R	G	-	1	0	BAG1	33254540	0.798000	0.28890	0.040000	0.18447	0.006000	0.05464	0.985000	0.29578	1.113000	0.41760	-0.674000	0.03794	GGG	C|0.976;G|0.024		0.771	CHMP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052040.3	NM_016410	
CNTNAP3	79937	hgsc.bcm.edu	37	9	39132974	39132974	+	Silent	SNP	G	G	T	rs149597063	byFrequency	TCGA-PK-A5HA-01A-11D-A29I-10	TCGA-PK-A5HA-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2bd7613-8a82-453c-b1d0-f0ad6fbc0766	688c5eb5-c374-4bfb-81d1-c0ba622386cf	g.chr9:39132974G>T	ENST00000297668.6	-	13	2108	c.2035C>A	c.(2035-2037)Cgg>Agg	p.R679R	CNTNAP3_ENST00000358144.2_Silent_p.R591R|CNTNAP3_ENST00000323947.7_Silent_p.R585R|CNTNAP3_ENST00000377659.1_Silent_p.R678R|CNTNAP3_ENST00000377656.2_Silent_p.R678R	NM_033655.3	NP_387504.2	Q9BZ76	CNTP3_HUMAN	contactin associated protein-like 3	679	Fibrinogen C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00739}.				cell adhesion (GO:0007155)|cell recognition (GO:0008037)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(1)|endometrium(3)|kidney(2)|large_intestine(5)|liver(2)|lung(8)|ovary(1)|upper_aerodigestive_tract(2)	24				GBM - Glioblastoma multiforme(29;0.02)|Lung(182;0.0681)		AGAGCCAGCCGCTGCTCGCAG	0.771													G|||	110	0.0219649	0.0045	0.0346	5008	,	,		11895	0.0		0.0686	False		,,,				2504	0.0112				p.R679R		.											.	CNTNAP3-91	0			c.C2035A						.						3.0	3.0	3.0					9																	39132974		1104	2452	3556	SO:0001819	synonymous_variant	79937	exon13			CCAGCCGCTGCTC	AF333769	CCDS6616.1	9q12	2008-02-05			ENSG00000106714	ENSG00000106714			13834	protein-coding gene	gene with protein product	"""cell recognition molecule CASPR3 (FLJ14195, KIAA1714)"""	610517				12093160	Standard	NM_033655		Approved	CASPR3, KIAA1714, FLJ14195, CNTNAP3A	uc004abi.3	Q9BZ76	OTTHUMG00000019954	ENST00000297668.6:c.2035C>A	9.37:g.39132974G>T		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	6	5	NM_033655	0	0	2	2	0	B1AMA0|Q9C0E9	Silent	SNP	ENST00000297668.6	37	CCDS6616.1																																																																																			G|0.961;T|0.039		0.771	CNTNAP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052511.1	NM_033655	
ZCCHC6	79670	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	88967902	88967902	+	Silent	SNP	A	A	T			TCGA-PK-A5HA-01A-11D-A29I-10	TCGA-PK-A5HA-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2bd7613-8a82-453c-b1d0-f0ad6fbc0766	688c5eb5-c374-4bfb-81d1-c0ba622386cf	g.chr9:88967902A>T	ENST00000375963.3	-	2	385	c.213T>A	c.(211-213)gcT>gcA	p.A71A	ZCCHC6_ENST00000375960.2_Silent_p.A71A|ZCCHC6_ENST00000375961.2_Silent_p.A71A|ZCCHC6_ENST00000277141.6_5'UTR|ZCCHC6_ENST00000375947.1_5'Flank	NM_001185059.1|NM_024617.3	NP_001171988.1|NP_078893.2	Q5VYS8	TUT7_HUMAN	zinc finger, CCHC domain containing 6	71					RNA 3'-end processing (GO:0031123)		poly(A) RNA binding (GO:0044822)|RNA uridylyltransferase activity (GO:0050265)|zinc ion binding (GO:0008270)			breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(10)|liver(1)|lung(14)|ovary(2)|prostate(1)|skin(2)|urinary_tract(1)	46						TGCTGGAAACAGCACATGGTC	0.438																																					p.A71A		.											.	ZCCHC6-92	0			c.T213A						.						161.0	151.0	154.0					9																	88967902		2203	4300	6503	SO:0001819	synonymous_variant	79670	exon2			GGAAACAGCACAT	AL832026	CCDS35057.1, CCDS55323.1	9q21	2014-03-05			ENSG00000083223	ENSG00000083223		"""Zinc fingers, CCHC domain containing"""	25817	protein-coding gene	gene with protein product	"""TUTase7"""					11214970	Standard	NM_001185059		Approved	KIAA1711, FLJ13409, PAPD6, TUT7	uc004aoq.3	Q5VYS8	OTTHUMG00000020137	ENST00000375963.3:c.213T>A	9.37:g.88967902A>T		Somatic	153	0		WXS	Illumina GAIIx	Phase_I	136	57	NM_024617	0	0	4	6	2	Q5H9T0|Q5VYS5|Q5VYS7|Q658Z9|Q659A2|Q6MZJ3|Q8N5F0|Q96N57|Q96NE8|Q9C0F2|Q9H8M6	Silent	SNP	ENST00000375963.3	37	CCDS35057.1																																																																																			.		0.438	ZCCHC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052918.1	NM_024617	
FPGS	2356	hgsc.bcm.edu	37	9	130565267	130565267	+	Missense_Mutation	SNP	A	A	G	rs11554717|rs10760502	byFrequency	TCGA-PK-A5HA-01A-11D-A29I-10	TCGA-PK-A5HA-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2bd7613-8a82-453c-b1d0-f0ad6fbc0766	688c5eb5-c374-4bfb-81d1-c0ba622386cf	g.chr9:130565267A>G	ENST00000373247.2	+	1	114	c.64A>G	c.(64-66)Ata>Gta	p.I22V	FPGS_ENST00000373225.3_5'Flank|FPGS_ENST00000393706.2_Missense_Mutation_p.I22V|FPGS_ENST00000460181.1_3'UTR|FPGS_ENST00000373245.1_Missense_Mutation_p.I22V	NM_004957.4	NP_004948.4	Q05932	FOLC_HUMAN	folylpolyglutamate synthase	22			I -> V (in dbSNP:rs10760502). {ECO:0000269|PubMed:14702039, ECO:0000269|PubMed:15489334, ECO:0000269|PubMed:7721888}.		brain development (GO:0007420)|folic acid metabolic process (GO:0046655)|liver development (GO:0001889)|nucleobase-containing compound metabolic process (GO:0006139)|one-carbon metabolic process (GO:0006730)|organ regeneration (GO:0031100)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|tetrahydrofolylpolyglutamate synthase activity (GO:0004326)			endometrium(2)|kidney(1)|lung(3)|ovary(1)	7					Methotrexate(DB00563)|Pralatrexate(DB06813)|Raltitrexed(DB00293)	TGCGCGCGGCATAACGACCCA	0.761													g|||	3912	0.78115	0.8956	0.6153	5008	,	,		6680	0.9583		0.6352	False		,,,				2504	0.7117				p.I22V		.											.	FPGS-90	0			c.A64G						.		VAL/ILE	2249,281		997,255,13	1.0	3.0	2.0		64	1.8	0.0	9	dbSNP_120	2	3848,1396		1394,1060,168	no	missense	FPGS	NM_004957.4	29	2391,1315,181	GG,GA,AA		26.6209,11.1067,21.5719	benign	22/588	130565267	6097,1677	1265	2622	3887	SO:0001583	missense	2356	exon1			CGCGGCATAACGA		CCDS35148.1, CCDS35149.1, CCDS75905.1	9q34.11	2013-09-19			ENSG00000136877	ENSG00000136877	6.3.2.17		3824	protein-coding gene	gene with protein product		136510					Standard	NM_004957		Approved		uc004bsg.1	Q05932	OTTHUMG00000020716	ENST00000373247.2:c.64A>G	9.37:g.130565267A>G	ENSP00000362344:p.Ile22Val	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	4	4	NM_004957	0	0	0	4	4	B3KPW4|B7Z2Z3|F5H0K6|Q5JU19|Q5JU22|Q6P2P6	Missense_Mutation	SNP	ENST00000373247.2	37	CCDS35148.1	1668	0.7637362637362637	432	0.8780487804878049	215	0.5939226519337016	545	0.9527972027972028	476	0.6279683377308707	g	3.002	-0.205821	0.06180	0.888933	0.733791	ENSG00000136877	ENST00000373247;ENST00000373245;ENST00000393706;ENST00000373228	T;T;T;T	0.29655	3.02;1.56;3.03;1.56	4.93	1.83	0.25207	.	0.868559	0.09918	N	0.738853	T	0.00012	0.0000	N	0.08118	0	0.80722	P	0.0	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.37361	-0.9709	9	0.02654	T	1	-12.2003	6.0757	0.19913	0.2469:0.2097:0.5434:0.0	rs10760502;rs17855899;rs56845445	22;22	Q05932-4;Q05932	.;FOLC_HUMAN	V	22	ENSP00000362344:I22V;ENSP00000362342:I22V;ENSP00000377309:I22V;ENSP00000362325:I22V	ENSP00000362325:I22V	I	+	1	0	FPGS	129605088	0.000000	0.05858	0.001000	0.08648	0.021000	0.10359	0.242000	0.18087	0.210000	0.20664	-0.258000	0.10820	ATA	A|0.235;G|0.765		0.761	FPGS-011	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054251.1		
SLC2A6	11182	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	136338637	136338637	+	Silent	SNP	G	G	A			TCGA-PK-A5HA-01A-11D-A29I-10	TCGA-PK-A5HA-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2bd7613-8a82-453c-b1d0-f0ad6fbc0766	688c5eb5-c374-4bfb-81d1-c0ba622386cf	g.chr9:136338637G>A	ENST00000371899.4	-	8	1199	c.1122C>T	c.(1120-1122)ggC>ggT	p.G374G	SLC2A6_ENST00000371897.4_Intron|SLC2A6_ENST00000485978.1_5'UTR	NM_017585.3	NP_060055.2	Q9UGQ3	GTR6_HUMAN	solute carrier family 2 (facilitated glucose transporter), member 6	374					glucose transport (GO:0015758)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	glucose transmembrane transporter activity (GO:0005355)			cervix(1)|endometrium(1)|large_intestine(1)|lung(3)|prostate(3)|skin(1)	10				OV - Ovarian serous cystadenocarcinoma(145;8.47e-08)|Epithelial(140;9.37e-07)|all cancers(34;1.03e-05)		CGCTTTCCAGGCCCGCAGTGC	0.647																																					p.G374G		.											.	SLC2A6-90	0			c.C1122T						.						32.0	33.0	33.0					9																	136338637		2198	4297	6495	SO:0001819	synonymous_variant	11182	exon8			TTCCAGGCCCGCA	AJ011372	CCDS6975.1, CCDS48052.1	9q34	2013-05-22			ENSG00000160326	ENSG00000160326		"""Solute carriers"""	11011	protein-coding gene	gene with protein product		606813				10970791	Standard	NM_001145099		Approved	GLUT9, GLUT6, HSA011372	uc004cee.3	Q9UGQ3	OTTHUMG00000020874	ENST00000371899.4:c.1122C>T	9.37:g.136338637G>A		Somatic	159	0		WXS	Illumina GAIIx	Phase_I	143	67	NM_017585	0	0	1	1	0	A6NNU6|Q5SXD7|Q8NCC2	Silent	SNP	ENST00000371899.4	37	CCDS6975.1																																																																																			.		0.647	SLC2A6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054909.1	NM_017585	
LHX3	8022	hgsc.bcm.edu	37	9	139094805	139094805	+	Intron	SNP	C	C	T	rs2274116	byFrequency	TCGA-PK-A5HA-01A-11D-A29I-10	TCGA-PK-A5HA-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2bd7613-8a82-453c-b1d0-f0ad6fbc0766	688c5eb5-c374-4bfb-81d1-c0ba622386cf	g.chr9:139094805C>T	ENST00000371748.5	-	1	176				LHX3_ENST00000371746.3_Silent_p.A27A	NM_178138.4	NP_835258.1	Q9UBR4	LHX3_HUMAN	LIM homeobox 3						inner ear development (GO:0048839)|lung development (GO:0030324)|medial motor column neuron differentiation (GO:0021526)|motor neuron axon guidance (GO:0008045)|negative regulation of apoptotic process (GO:0043066)|organ morphogenesis (GO:0009887)|pituitary gland development (GO:0021983)|placenta development (GO:0001890)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|spinal cord association neuron differentiation (GO:0021527)|spinal cord motor neuron cell fate specification (GO:0021520)|ventral spinal cord interneuron specification (GO:0021521)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	RNA polymerase II transcription factor binding transcription factor activity (GO:0001076)|sequence-specific DNA binding (GO:0043565)|zinc ion binding (GO:0008270)			large_intestine(2)|lung(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	8		Myeloproliferative disorder(178;0.0511)		Epithelial(140;8.43e-08)|OV - Ovarian serous cystadenocarcinoma(145;1.26e-07)		GGCGCAGGTCCGCCCTCCGCG	0.776													C|||	808	0.161342	0.0136	0.2133	5008	,	,		7650	0.1042		0.3121	False		,,,				2504	0.228				p.A27A		.											.	LHX3-91	0			c.G81A						.	C	,	128,2392		3,122,1135	2.0	2.0	2.0		81,	-1.9	1.0	9	dbSNP_100	2	1156,4286		104,948,1669	no	coding-synonymous,intron	LHX3	NM_014564.3,NM_178138.4	,	107,1070,2804	TT,TC,CC		21.2422,5.0794,16.1266	,	27/403,	139094805	1284,6678	1260	2721	3981	SO:0001627	intron_variant	8022	exon1			CAGGTCCGCCCTC	AF096169	CCDS6994.1, CCDS6995.1	9q34.3	2011-06-20			ENSG00000107187	ENSG00000107187		"""Homeoboxes / LIM class"""	6595	protein-coding gene	gene with protein product		600577				10598593, 10717474	Standard	NM_178138		Approved		uc004cgz.3	Q9UBR4	OTTHUMG00000020924	ENST00000371748.5:c.79+1974G>A	9.37:g.139094805C>T		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	4	4	NM_014564	0	0	0	0	0	Q5TB39|Q5TB40|Q9NZB5|Q9P0I8|Q9P0I9	Silent	SNP	ENST00000371748.5	37	CCDS6994.1																																																																																			C|0.842;T|0.158		0.776	LHX3-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000055048.3		
DCAF8L2	347442	bcgsc.ca	37	X	27766776	27766776	+	Silent	SNP	G	G	A	rs45553337	byFrequency	TCGA-PK-A5HA-01A-11D-A29I-10	TCGA-PK-A5HA-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2bd7613-8a82-453c-b1d0-f0ad6fbc0766	688c5eb5-c374-4bfb-81d1-c0ba622386cf	g.chrX:27766776G>A	ENST00000451261.2	+	5	2163	c.1764G>A	c.(1762-1764)acG>acA	p.T588T		NM_001136533.1	NP_001130005.1	P0C7V8	DC8L2_HUMAN	DDB1 and CUL4 associated factor 8-like 2	588								p.T555T(1)		central_nervous_system(1)|endometrium(9)|kidney(3)|lung(7)|pancreas(1)|skin(3)	24						GTCACGTGACGCAGAGAGGTC	0.507													A|||	620	0.164238	0.1324	0.1167	3775	,	,		15143	0.0546		0.2078	False		,,,				2504	0.1022				p.T588T		.											.	DCAF8L2-42	1	Substitution - coding silent(1)	kidney(1)	c.G1764A						.	A		250,959		19,183,29,315,146	83.0	59.0	67.0		1764	2.5	0.0	X	dbSNP_127	67	671,1720		61,306,243,433,548	no	coding-synonymous	DCAF8L2	NM_001136533.1		80,489,272,748,694	AA,AG,A,GG,G		28.0636,20.6782,25.5833		588/632	27766776	921,2679	692	1591	2283	SO:0001819	synonymous_variant	347442	exon1			CGTGACGCAGAGA		CCDS59162.1	Xp22.11	2013-01-09	2009-07-17	2009-07-17		ENSG00000189186		"""WD repeat domain containing"""	31811	protein-coding gene	gene with protein product			"""WD repeat domain 42C"""	WDR42C			Standard	NM_001136533		Approved		uc011mjy.2	P0C7V8		ENST00000451261.2:c.1764G>A	X.37:g.27766776G>A		Somatic	228	2		WXS	Illumina GAIIx	Phase_I	241	9	NM_001136533	0	0	0	0	0	B2RXH9|J3KT06	Silent	SNP	ENST00000451261.2	37	CCDS59162.1																																																																																			G|0.816;A|0.184		0.507	DCAF8L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056143.4	XM_293354	
GLUD2	2747	hgsc.bcm.edu	37	X	120181641	120181641	+	Missense_Mutation	SNP	G	G	A	rs191769566		TCGA-PK-A5HA-01A-11D-A29I-10	TCGA-PK-A5HA-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2bd7613-8a82-453c-b1d0-f0ad6fbc0766	688c5eb5-c374-4bfb-81d1-c0ba622386cf	g.chrX:120181641G>A	ENST00000328078.1	+	1	180	c.103G>A	c.(103-105)Gga>Aga	p.G35R		NM_012084.3	NP_036216.2	P49448	DHE4_HUMAN	glutamate dehydrogenase 2	35					glutamate biosynthetic process (GO:0006537)|glutamate catabolic process (GO:0006538)|glutamate metabolic process (GO:0006536)|oxidation-reduction process (GO:0055114)	mitochondrion (GO:0005739)	ADP binding (GO:0043531)|glutamate dehydrogenase (NAD+) activity (GO:0004352)|glutamate dehydrogenase [NAD(P)+] activity (GO:0004353)|GTP binding (GO:0005525)|leucine binding (GO:0070728)	p.G35R(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(7)|kidney(1)|large_intestine(9)|lung(15)|ovary(1)|pancreas(1)|urinary_tract(1)	38						CCGGGGCCGCGGACAGCCCGC	0.756													G|||	298	0.0789404	0.0567	0.0375	3775	,	,		5781	0.0109		0.0795	False		,,,				2504	0.1084				p.G35R		.											.	GLUD2-131	1	Substitution - Missense(1)	central_nervous_system(1)	c.G103A						.						5.0	7.0	6.0					X																	120181641		1839	3632	5471	SO:0001583	missense	2747	exon1			GGCCGCGGACAGC	U08997	CCDS14603.1	Xq24-q25	2008-02-05	2003-02-24	2003-02-28	ENSG00000182890	ENSG00000182890			4336	protein-coding gene	gene with protein product		300144	"""glutamate dehydrogenase pseudogene 1"""	GLUDP1		8207021, 9109504	Standard	NM_012084		Approved		uc004eto.3	P49448	OTTHUMG00000022320	ENST00000328078.1:c.103G>A	X.37:g.120181641G>A	ENSP00000327589:p.Gly35Arg	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	27	27	NM_012084	0	0	0	0	0	B2R8G0|Q9UDQ4	Missense_Mutation	SNP	ENST00000328078.1	37	CCDS14603.1	113	0.06811332127787824	20	0.04219409282700422	10	0.02824858757062147	3	0.005263157894736842	48	0.06685236768802229	G	13.05	2.122283	0.37436	.	.	ENSG00000182890	ENST00000328078	D	0.96716	-4.1	1.47	0.567	0.17325	.	0.153194	0.41194	U	0.000939	T	0.37376	0.1001	N	0.08118	0	0.80722	P	0.0	B	0.31413	0.322	B	0.15484	0.013	T	0.70321	-0.4904	9	0.14252	T	0.57	.	3.6288	0.08123	0.2648:0.0:0.7352:0.0	.	35	P49448	DHE4_HUMAN	R	35	ENSP00000327589:G35R	ENSP00000327589:G35R	G	+	1	0	GLUD2	120009322	0.018000	0.18449	0.000000	0.03702	0.001000	0.01503	1.266000	0.33039	0.143000	0.18926	0.372000	0.22366	GGA	G|0.932;A|0.068		0.756	GLUD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058133.1	NM_012084	
KCNN3	3782	broad.mit.edu	37	1	154842199	154842200	+	In_Frame_Ins	INS	-	-	GCTGCTGCTGCT	rs56352724|rs3831942|rs367921715|rs58327065		TCGA-PK-A5HA-01A-11D-A29I-10	TCGA-PK-A5HA-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2bd7613-8a82-453c-b1d0-f0ad6fbc0766	688c5eb5-c374-4bfb-81d1-c0ba622386cf	g.chr1:154842199_154842200insGCTGCTGCTGCT	ENST00000271915.4	-	1	556_557	c.241_242insAGCAGCAGCAGC	c.(241-243)cca>cAGCAGCAGCAGCca	p.80_81insQQQQ	KCNN3_ENST00000358505.2_5'Flank	NM_001204087.1|NM_002249.5	NP_001191016.1|NP_002240.3	Q9UGI6	KCNN3_HUMAN	potassium intermediate/small conductance calcium-activated channel, subfamily N, member 3	80	Gln-rich.		Missing.		potassium ion transmembrane transport (GO:0071805)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	calmodulin binding (GO:0005516)|small conductance calcium-activated potassium channel activity (GO:0016286)	p.Q80_P81insQQ(2)		cervix(1)|endometrium(3)|kidney(2)|large_intestine(6)|lung(11)|prostate(4)|skin(1)	28	all_lung(78;2.29e-27)|all_hematologic(923;0.088)|Hepatocellular(266;0.108)|all_neural(408;0.245)		BRCA - Breast invasive adenocarcinoma(34;0.00819)		Miconazole(DB01110)|Procaine(DB00721)	GGGATGCGGTGgctgctgctgc	0.698																																					p.P81delinsQQQQP		.											.	KCNN3-91	2	Insertion - In frame(2)	prostate(2)	c.242_243insAGCAGCAGCAGC						.																																			SO:0001652	inframe_insertion	3782	exon1			TGCGGTGGCTGCT	AF031815	CCDS1072.1, CCDS30880.1, CCDS72928.1	1q21.3	2012-07-05			ENSG00000143603	ENSG00000143603		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, calcium-activated"""	6292	protein-coding gene	gene with protein product		602983				9491810, 16382103	Standard	NM_002249		Approved	KCa2.3, hSK3, SKCA3	uc021pah.1	Q9UGI6	OTTHUMG00000037260	ENST00000271915.4:c.230_241dupAGCAGCAGCAGC	1.37:g.154842199_154842200insGCTGCTGCTGCT	ENSP00000271915:p.Gln77_Gln80dup	Somatic	61	0		WXS	Illumina GAIIx	Phase_I	71	24	NM_001204087	0	0	0	0	0	B1ANX0|O43517|Q86VF9|Q8WXG7	In_Frame_Ins	INS	ENST00000271915.4	37	CCDS30880.1																																																																																			.		0.698	KCNN3-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090688.3	NM_002249	
PODXL	5420	hgsc.bcm.edu	37	7	131241029	131241030	+	In_Frame_Ins	INS	-	-	GGCGAC	rs11277659|rs547816245|rs532078953|rs79759078|rs571821675	byFrequency	TCGA-PK-A5HA-01A-11D-A29I-10	TCGA-PK-A5HA-10A-01D-A29L-10	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2bd7613-8a82-453c-b1d0-f0ad6fbc0766	688c5eb5-c374-4bfb-81d1-c0ba622386cf	g.chr7:131241029_131241030insGGCGAC	ENST00000378555.3	-	1	336_337	c.89_90insGTCGCC	c.(88-90)ccc>ccGTCGCCc	p.30_30P>PSP	PODXL_ENST00000541194.1_In_Frame_Ins_p.30_30P>PSP|PODXL_ENST00000322985.9_In_Frame_Ins_p.30_30P>PSP|PODXL_ENST00000465001.1_Intron|PODXL_ENST00000537928.1_In_Frame_Ins_p.30_30P>PSP			O00592	PODXL_HUMAN	podocalyxin-like	30					cell adhesion (GO:0007155)|cell migration (GO:0016477)|epithelial tube formation (GO:0072175)|glomerular visceral epithelial cell development (GO:0072015)|leukocyte migration (GO:0050900)|negative regulation of cell adhesion (GO:0007162)|negative regulation of cell-cell adhesion (GO:0022408)|positive regulation of cell migration (GO:0030335)|positive regulation of cell-cell adhesion mediated by integrin (GO:0033634)|regulation of microvillus assembly (GO:0032534)	apical plasma membrane (GO:0016324)|cell body (GO:0044297)|cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|integral component of plasma membrane (GO:0005887)|lamellipodium (GO:0030027)|microvillus membrane (GO:0031528)|plasma membrane (GO:0005886)|ruffle (GO:0001726)|slit diaphragm (GO:0036057)		p.P30_S31delPS(2)		NS(1)|breast(3)|endometrium(3)|kidney(3)|large_intestine(4)|lung(4)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	24	Melanoma(18;0.162)					CATTCTGGGAGggcgacggcga	0.752																																					p.P30delinsPSP		.											.	PODXL-136	2	Deletion - In frame(2)	prostate(2)	c.90_91insGTCGCC						.																																			SO:0001652	inframe_insertion	5420	exon1			CTGGGAGGGCGAC		CCDS34755.1, CCDS47714.1	7q32-q33	2008-07-18			ENSG00000128567	ENSG00000128567			9171	protein-coding gene	gene with protein product		602632					Standard	NM_001018111		Approved	PCLP, Gp200, PC	uc003vqx.4	O00592	OTTHUMG00000154918	ENST00000378555.3:c.84_89dupGTCGCC	7.37:g.131241030_131241035dupGGCGAC	ENSP00000367817:p.SerPro30dup	Somatic	1	0		WXS	Illumina GAIIx	Phase_I	35	0	NM_005397	0	0	0	0	0	A6NHX8|Q52LZ7|Q53ER6	In_Frame_Ins	INS	ENST00000378555.3	37	CCDS34755.1																																																																																			.		0.752	PODXL-005	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000337627.2	NM_001018111	
TTLL11	158135	hgsc.bcm.edu	37	9	124855330	124855331	+	In_Frame_Ins	INS	-	-	TGGCCT	rs3833704|rs201653732	byFrequency	TCGA-PK-A5HA-01A-11D-A29I-10	TCGA-PK-A5HA-10A-01D-A29L-10	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2bd7613-8a82-453c-b1d0-f0ad6fbc0766	688c5eb5-c374-4bfb-81d1-c0ba622386cf	g.chr9:124855330_124855331insTGGCCT	ENST00000373776.3	-	1	554_555	c.367_368insAGGCCA	c.(367-369)aca>aAGGCCAca	p.122_123insKA	TTLL11_ENST00000474723.1_5'UTR|TTLL11_ENST00000321582.5_In_Frame_Ins_p.122_123insKA	NM_194252.2	NP_919228.2	Q8NHH1	TTL11_HUMAN	tubulin tyrosine ligase-like family, member 11	122					cellular protein modification process (GO:0006464)	cilium (GO:0005929)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)	ligase activity (GO:0016874)			breast(1)|endometrium(1)|kidney(1)|large_intestine(6)|lung(5)|prostate(3)|skin(1)	18						cgtctccgctgtggcctcggcc	0.762														678	0.135383	0.1044	0.1254	5008	,	,		10384	0.0367		0.2773	False		,,,				2504	0.1401				p.T123delinsKAT		.											.	TTLL11-112	0			c.368_369insAGGCCA						.		,	363,1875		124,115,880					,	-4.8	0.0		dbSNP_107	2	1330,3776		463,404,1686	no	coding,coding	TTLL11	NM_194252.2,NM_001139442.1	,	587,519,2566	A1A1,A1R,RR		26.0478,16.2198,23.0528	,	,		1693,5651				SO:0001652	inframe_insertion	158135	exon1			TCCGCTGTGGCCT	AF521886	CCDS6834.2, CCDS48012.1	9q34.11	2013-02-14	2005-07-28	2005-07-28	ENSG00000175764	ENSG00000175764		"""Tubulin tyrosine ligase-like family"""	18113	protein-coding gene	gene with protein product			"""chromosome 9 open reading frame 20"""	C9orf20		15890843	Standard	NM_001139442		Approved	bA244O19.1	uc011lyl.2	Q8NHH1	OTTHUMG00000020597	ENST00000373776.3:c.362_367dupAGGCCA	9.37:g.124855331_124855336dupTGGCCT	ENSP00000362881:p.Ala122_Thr123insLysAla	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	16	10	NM_001139442	0	0	0	0	0		In_Frame_Ins	INS	ENST00000373776.3	37	CCDS6834.2																																																																																			-|0.843;TGGCCT|0.157		0.762	TTLL11-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000053907.1	XM_088486	
KNDC1	85442	hgsc.bcm.edu	37	10	135012429	135012430	+	Missense_Mutation	DNP	TT	TT	AC	rs386749477|rs3008390|rs3008389	byFrequency	TCGA-PK-A5HA-01A-11D-A29I-10	TCGA-PK-A5HA-10A-01D-A29L-10	TT	TT	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2bd7613-8a82-453c-b1d0-f0ad6fbc0766	688c5eb5-c374-4bfb-81d1-c0ba622386cf	g.chr10:135012429_135012430TT>AC	ENST00000304613.3	+	14	2438_2439	c.2417_2418TT>AC	c.(2416-2418)gTT>gAC	p.V806D	KNDC1_ENST00000368571.2_Missense_Mutation_p.V741D|KNDC1_ENST00000368572.2_Missense_Mutation_p.V806D			Q76NI1	VKIND_HUMAN	kinase non-catalytic C-lobe domain (KIND) containing 1	806	Pro-rich.			V -> D (in Ref. 1; BAD12625). {ECO:0000305}.	cerebellar granule cell differentiation (GO:0021707)|positive regulation of protein phosphorylation (GO:0001934)|regulation of dendrite morphogenesis (GO:0048814)|small GTPase mediated signal transduction (GO:0007264)	dendrite (GO:0030425)|guanyl-nucleotide exchange factor complex (GO:0032045)|neuronal cell body (GO:0043025)	protein serine/threonine kinase activity (GO:0004674)|Ras guanyl-nucleotide exchange factor activity (GO:0005088)			NS(4)|breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(27)|ovary(1)|prostate(5)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	60		all_cancers(35;4.16e-10)|all_epithelial(44;2.07e-08)|Lung NSC(174;0.000845)|all_lung(145;0.00145)|all_neural(114;0.0299)|Melanoma(40;0.123)|Colorectal(31;0.173)|Glioma(114;0.203)		OV - Ovarian serous cystadenocarcinoma(35;8.77e-06)|Epithelial(32;1.13e-05)|all cancers(32;1.51e-05)		CCACCTGGAGTTGCTTCCGGGG	0.748																																					p.V806D		.											.	KNDC1-229	0			c.T2418C						.																																			SO:0001583	missense	85442	exon14			TGGAGTTGCTTCC	AK074179	CCDS7674.1	10q26.3	2004-09-14	2004-04-07		ENSG00000171798	ENSG00000171798			29374	protein-coding gene	gene with protein product			"""RasGEF domain family, member 2"""	RASGEF2, C10orf23		11214970	Standard	NM_152643		Approved	KIAA1768, bB439H18.3, FLJ25027	uc001llz.1	Q76NI1	OTTHUMG00000019303	Exception_encountered	10.37:g.135012429_135012430delinsAC	ENSP00000304437:p.Val806Asp	Somatic	1	0		WXS	Illumina GAIIx	Phase_I	6	0	NM_152643	0	0	0	0	0	B0QZC5|Q5T233|Q6ZNH8|Q8TEE5|Q96LV7|Q9C095	Missense_Mutation	DNP	ENST00000304613.3	37	CCDS7674.1																																																																																			T|0.470;C|0.530		0.748	KNDC1-006	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000277044.3	NM_152643	
ARHGAP44	9912	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	12893459	12893460	+	Missense_Mutation	DNP	GA	GA	TC			TCGA-PK-A5HA-01A-11D-A29I-10	TCGA-PK-A5HA-10A-01D-A29L-10	GA	GA	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2bd7613-8a82-453c-b1d0-f0ad6fbc0766	688c5eb5-c374-4bfb-81d1-c0ba622386cf	g.chr17:12893459_12893460GA>TC	ENST00000379672.5	+	21	2728_2729	c.2428_2429GA>TC	c.(2428-2430)GAg>TCg	p.E810S	RP11-597M12.1_ENST00000582915.1_RNA|ARHGAP44_ENST00000262444.9_3'UTR|ARHGAP44_ENST00000340825.3_Missense_Mutation_p.E804S	NM_014859.4	NP_055674.4	Q17R89	RHG44_HUMAN	Rho GTPase activating protein 44	810	Interaction with BST2.				exocytosis (GO:0006887)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cell junction (GO:0030054)|cell projection (GO:0042995)|cytosol (GO:0005829)|endosome (GO:0005768)|leading edge membrane (GO:0031256)|synapse (GO:0045202)	GTPase activator activity (GO:0005096)|phospholipid binding (GO:0005543)			NS(2)|breast(3)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(8)|lung(7)|skin(1)|urinary_tract(1)	31						GAGGGACTCGGAGGAGGAGTCT	0.614																																					p.E810S		.											.	ARHGAP44-90	0			c.A2429C						.																																			SO:0001583	missense	9912	exon21			ACTCGGAGGAGGA		CCDS45616.1	17p12	2011-06-29			ENSG00000006740	ENSG00000006740		"""Rho GTPase activating proteins"""	29096	protein-coding gene	gene with protein product						19273615	Standard	NM_014859		Approved	KIAA0672, RICH-2, RICH2	uc002gnr.4	Q17R89	OTTHUMG00000058765	Exception_encountered	17.37:g.12893459_12893460delinsTC	ENSP00000368994:p.Glu810Ser	Somatic	136	0		WXS	Illumina GAIIx	Phase_I	69	0	NM_014859	0	0	0	0	0	A6NCP5|A8MQB2|O75160|Q7Z5Z7|Q9Y4Q4	Missense_Mutation	DNP	ENST00000379672.5	37	CCDS45616.1																																																																																			.		0.614	ARHGAP44-011	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000441566.1	NM_014859	
FSTL4	23105	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	5	132545983	132545984	+	Missense_Mutation	DNP	CC	CC	TA			TCGA-PK-A5HA-01A-11D-A29I-10	TCGA-PK-A5HA-10A-01D-A29L-10	CC	CC	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2bd7613-8a82-453c-b1d0-f0ad6fbc0766	688c5eb5-c374-4bfb-81d1-c0ba622386cf	g.chr5:132545983_132545984CC>TA	ENST00000265342.7	-	14	1864_1865	c.1615_1616GG>TA	c.(1615-1617)GGt>TAt	p.G539Y	CTB-49A3.2_ENST00000509051.1_RNA|CTB-49A3.2_ENST00000502776.1_RNA	NM_015082.1	NP_055897.1	Q6MZW2	FSTL4_HUMAN	follistatin-like 4	539						extracellular region (GO:0005576)	calcium ion binding (GO:0005509)			autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|endometrium(1)|kidney(3)|large_intestine(4)|lung(8)|skin(2)|upper_aerodigestive_tract(1)	23		all_cancers(142;0.244)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)			AGGGTCCACACCTATGGACTTG	0.53																																					p.G539Y		.											.	FSTL4-91	0			c.G1615T						.																																			SO:0001583	missense	23105	exon14			CCACACCTATGGA	AB028984	CCDS34238.1	5q31.1	2013-01-29			ENSG00000053108	ENSG00000053108		"""EF-hand domain containing"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	21389	protein-coding gene	gene with protein product						10470851, 15527507	Standard	NM_015082		Approved	KIAA1061	uc003kyn.1	Q6MZW2	OTTHUMG00000162729	ENST00000265342.7:c.1615_1616delinsTA	5.37:g.132545983_132545984delinsTA	ENSP00000265342:p.Gly539Tyr	Somatic	113	0		WXS	Illumina GAIIx	Phase_I	150	0	NM_015082	0	0	0	0	0	Q8TBU0|Q9UPU1	Missense_Mutation	DNP	ENST00000265342.7	37	CCDS34238.1																																																																																			.		0.530	FSTL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000370212.1	XM_048786	
