#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
ACRBP	84519	genome.wustl.edu	37	12	6753643	6753643	+	Missense_Mutation	SNP	C	C	T			TCGA-A1-A0SF-01A-11D-A142-09	TCGA-A1-A0SF-10B-01D-A142-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b291200e-3c22-411a-85d0-fbe1570acda2	cc8ae8d4-315d-492a-84e9-7ed8630e9c70	g.chr12:6753643C>T	ENST00000229243.2	-	5	697	c.604G>A	c.(604-606)Gag>Aag	p.E202K	ACRBP_ENST00000536350.1_Missense_Mutation_p.E202K|ACRBP_ENST00000414226.2_Missense_Mutation_p.E169K|ACRBP_ENST00000542357.1_5'Flank	NM_032489.2	NP_115878.2			acrosin binding protein											NS(1)|breast(1)|central_nervous_system(1)|large_intestine(8)|lung(5)|ovary(1)	17						TGCCTGTGCTCCACTCCTTGC	0.572																																						dbGAP											0													153.0	130.0	138.0					12																	6753643		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB051833	CCDS8554.1	12p13.31	2009-03-12			ENSG00000111644	ENSG00000111644			17195	protein-coding gene	gene with protein product	"""proacrosin binding protein sp32"", ""cancer/testis antigen 23"""	608352				11248070	Standard	NM_032489		Approved	SP32, OY-TES-1, CT23	uc001qpu.1	Q8NEB7	OTTHUMG00000168715	ENST00000229243.2:c.604G>A	12.37:g.6753643C>T	ENSP00000229243:p.Glu202Lys	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Proacrosin-bd	p.E202K	ENST00000229243.2	37	c.604	CCDS8554.1	12	.	.	.	.	.	.	.	.	.	.	C	7.825	0.718589	0.15372	.	.	ENSG00000111644	ENST00000229243;ENST00000414226;ENST00000536350	T;T	0.45668	0.94;0.89	3.83	2.91	0.33838	.	0.695183	0.13059	N	0.417035	T	0.39545	0.1082	L	0.60455	1.87	0.09310	N	1	P;P	0.34892	0.474;0.474	B;B	0.35727	0.209;0.209	T	0.31024	-0.9958	10	0.54805	T	0.06	.	9.2123	0.37326	0.0:0.7781:0.2219:0.0	.	169;202	E7EP66;Q8NEB7	.;ACRBP_HUMAN	K	202;169;202	ENSP00000229243:E202K;ENSP00000402725:E169K	ENSP00000229243:E202K	E	-	1	0	ACRBP	6623904	0.878000	0.30173	0.088000	0.20740	0.033000	0.12548	1.752000	0.38349	1.138000	0.42230	0.561000	0.74099	GAG	ACRBP	-	pfam_Proacrosin-bd	ENSG00000111644		0.572	ACRBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACRBP	HGNC	protein_coding	OTTHUMT00000400703.1	133	0.00	0	C	NM_032489		6753643	6753643	-1	no_errors	ENST00000229243	ensembl	human	known	69_37n	missense	177	16.51	35	SNP	0.120	T
ARL6IP6	151188	genome.wustl.edu	37	2	153591548	153591548	+	Silent	SNP	C	C	T			TCGA-A1-A0SF-01A-11D-A142-09	TCGA-A1-A0SF-10B-01D-A142-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b291200e-3c22-411a-85d0-fbe1570acda2	cc8ae8d4-315d-492a-84e9-7ed8630e9c70	g.chr2:153591548C>T	ENST00000326446.5	+	3	1206	c.495C>T	c.(493-495)ttC>ttT	p.F165F	ARL6IP6_ENST00000463690.1_3'UTR	NM_152522.5	NP_689735.1	Q8N6S5	AR6P6_HUMAN	ADP-ribosylation factor-like 6 interacting protein 6	165						integral component of membrane (GO:0016021)				kidney(1)|large_intestine(1)|lung(2)|pancreas(1)	5						CTGCTGGATTCTCCTGTTGCA	0.368																																						dbGAP											0													162.0	161.0	161.0					2																	153591548		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK023109	CCDS2197.1	2q23	2014-05-12	2014-05-12		ENSG00000177917	ENSG00000177917			24048	protein-coding gene	gene with protein product							Standard	NM_152522		Approved	MGC33864	uc002tyn.3	Q8N6S5	OTTHUMG00000131901	ENST00000326446.5:c.495C>T	2.37:g.153591548C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B2RDS6|Q7Z4G7	Silent	SNP	NULL	p.F165	ENST00000326446.5	37	c.495	CCDS2197.1	2																																																																																			ARL6IP6	-	NULL	ENSG00000177917		0.368	ARL6IP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARL6IP6	HGNC	protein_coding	OTTHUMT00000254852.3	62	0.00	0	C	NM_152522		153591548	153591548	+1	no_errors	ENST00000326446	ensembl	human	known	69_37n	silent	49	15.52	9	SNP	1.000	T
BEST3	144453	genome.wustl.edu	37	12	70072563	70072563	+	Nonsense_Mutation	SNP	C	C	A			TCGA-A1-A0SF-01A-11D-A142-09	TCGA-A1-A0SF-10B-01D-A142-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b291200e-3c22-411a-85d0-fbe1570acda2	cc8ae8d4-315d-492a-84e9-7ed8630e9c70	g.chr12:70072563C>A	ENST00000330891.5	-	5	818	c.592G>T	c.(592-594)Gaa>Taa	p.E198*	BEST3_ENST00000476098.1_Nonsense_Mutation_p.E36*|BEST3_ENST00000553096.1_Nonsense_Mutation_p.E92*|BEST3_ENST00000488961.1_Nonsense_Mutation_p.E36*|BEST3_ENST00000331471.4_Nonsense_Mutation_p.E198*	NM_001282613.1|NM_032735.2	NP_001269542.1|NP_116124.2	Q8N1M1	BEST3_HUMAN	bestrophin 3	198					negative regulation of ion transport (GO:0043271)	chloride channel complex (GO:0034707)|plasma membrane (GO:0005886)	chloride channel activity (GO:0005254)			cervix(2)|endometrium(1)|kidney(1)|large_intestine(1)|lung(4)|prostate(1)|skin(2)	12	Breast(13;2.31e-06)|Esophageal squamous(21;0.187)		Lung(24;0.000278)|OV - Ovarian serous cystadenocarcinoma(12;0.0019)|STAD - Stomach adenocarcinoma(21;0.00694)			ATTCTACCTTCATTCCGGGCT	0.368																																						dbGAP											0													125.0	116.0	119.0					12																	70072563		1886	4116	6002	-	-	-	SO:0001587	stop_gained	0			AF440758	CCDS8992.2, CCDS41810.1, CCDS61192.1, CCDS61193.1, CCDS73496.1	12q14.2-q15	2012-09-26	2006-10-18	2006-10-18	ENSG00000127325	ENSG00000127325		"""Ion channels / Chloride channels : Calcium activated : Bestrophins"""	17105	protein-coding gene	gene with protein product		607337	"""vitelliform macular dystrophy 2-like 3"""	VMD2L3		12032738	Standard	NM_032735		Approved	MGC40411, MGC13168	uc001svg.3	Q8N1M1	OTTHUMG00000149919	ENST00000330891.5:c.592G>T	12.37:g.70072563C>A	ENSP00000332413:p.Glu198*	Somatic		WXS	Illumina GAIIx	Phase_IV	B5MDI8|F8VVZ2|Q53YQ7|Q8N356|Q8NFT9|Q9BR80	Nonsense_Mutation	SNP	pfam_Bestrophin/UPF0187	p.E198*	ENST00000330891.5	37	c.592	CCDS8992.2	12	.	.	.	.	.	.	.	.	.	.	C	37	6.529577	0.97641	.	.	ENSG00000127325	ENST00000331471;ENST00000488961;ENST00000330891;ENST00000553096;ENST00000476098;ENST00000552295;ENST00000548658	.	.	.	5.59	5.59	0.84812	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.40728	T	0.16	-23.5009	19.6101	0.95602	0.0:1.0:0.0:0.0	.	.	.	.	X	198;36;198;92;36;92;120	.	ENSP00000332413:E198X	E	-	1	0	BEST3	68358830	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.487000	0.81328	2.640000	0.89533	0.650000	0.86243	GAA	BEST3	-	pfam_Bestrophin/UPF0187	ENSG00000127325		0.368	BEST3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BEST3	HGNC	protein_coding	OTTHUMT00000313908.2	66	0.00	0	C	NM_152439		70072563	70072563	-1	no_errors	ENST00000330891	ensembl	human	known	69_37n	nonsense	80	12.09	11	SNP	1.000	A
C9orf43	257169	genome.wustl.edu	37	9	116187646	116187648	+	In_Frame_Del	DEL	GCA	GCA	-	rs374165893|rs371732185		TCGA-A1-A0SF-01A-11D-A142-09	TCGA-A1-A0SF-10B-01D-A142-09	GCA	GCA					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b291200e-3c22-411a-85d0-fbe1570acda2	cc8ae8d4-315d-492a-84e9-7ed8630e9c70	g.chr9:116187646_116187648delGCA	ENST00000288462.4	+	10	1334_1336	c.888_890delGCA	c.(886-891)cggcag>cgg	p.Q304del	C9orf43_ENST00000374165.1_In_Frame_Del_p.Q304del	NM_152786.1	NP_689999.1	Q8TAL5	CI043_HUMAN	chromosome 9 open reading frame 43	304	Gln-rich.									breast(2)|large_intestine(6)|lung(2)|ovary(1)|pancreas(1)|prostate(3)	15						agcagcagcggcagcagcagcag	0.557																																						dbGAP											0										2,231,68,3961		0,0,0,2,0,0,231,2,64,1832						-2.8	0.0			63	18,338,431,7463		2,0,0,14,0,0,338,9,413,3349	no	codingComplex	C9orf43	NM_152786.1		2,0,0,16,0,0,569,11,477,5181	A1A1,A1A2,A1A3,A1R,A2A2,A2A3,A2R,A3A3,A3R,RR		9.5394,7.0624,8.6957				20,569,499,11424				-	-	-	SO:0001651	inframe_deletion	0			BC026884	CCDS6796.1	9q33.1	2012-03-15			ENSG00000157653	ENSG00000157653			23570	protein-coding gene	gene with protein product						12477932	Standard	NM_152786		Approved	MGC17358	uc004bhp.3	Q8TAL5	OTTHUMG00000020526	ENST00000288462.4:c.888_890delGCA	9.37:g.116187655_116187657delGCA	ENSP00000288462:p.Gln304del	Somatic		WXS	Illumina GAIIx	Phase_IV		In_Frame_Del	DEL	NULL	p.Q300in_frame_del	ENST00000288462.4	37	c.888_890	CCDS6796.1	9																																																																																			C9orf43	-	NULL	ENSG00000157653		0.557	C9orf43-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	C9orf43	HGNC	protein_coding	OTTHUMT00000053739.1	47	0.00	0	GCA	NM_152786		116187646	116187648	+1	no_errors	ENST00000288462	ensembl	human	known	69_37n	in_frame_del	31	11.43	4	DEL	0.211:0.207:0.211	-
CECR2	27443	genome.wustl.edu	37	22	18018340	18018340	+	Missense_Mutation	SNP	G	G	A			TCGA-A1-A0SF-01A-11D-A142-09	TCGA-A1-A0SF-10B-01D-A142-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b291200e-3c22-411a-85d0-fbe1570acda2	cc8ae8d4-315d-492a-84e9-7ed8630e9c70	g.chr22:18018340G>A	ENST00000400585.2	+	12	1237	c.799G>A	c.(799-801)Gta>Ata	p.V267I	CECR2_ENST00000342247.5_Missense_Mutation_p.V380I|CECR2_ENST00000400573.5_Missense_Mutation_p.V408I|CECR2_ENST00000262608.8_Missense_Mutation_p.V409I			Q9BXF3	CECR2_HUMAN	cat eye syndrome chromosome region, candidate 2	450					apoptotic DNA fragmentation (GO:0006309)|ATP-dependent chromatin remodeling (GO:0043044)|cytokinesis (GO:0000910)|cytoskeleton organization (GO:0007010)|execution phase of apoptosis (GO:0097194)|neural tube development (GO:0021915)|vesicle-mediated transport (GO:0016192)	CERF complex (GO:0090537)|nucleus (GO:0005634)				NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|lung(22)|ovary(1)|pancreas(1)|prostate(2)|skin(5)|stomach(1)|urinary_tract(1)	59		all_epithelial(15;0.139)		Lung(27;0.146)		TCTAGACGTGGTAAAGGCTCA	0.408																																						dbGAP											0													196.0	182.0	187.0					22																	18018340		1863	4107	5970	-	-	-	SO:0001583	missense	0			AF336133		22q11.2	2012-04-19			ENSG00000099954	ENSG00000099954			1840	protein-coding gene	gene with protein product		607576				11381032	Standard	XM_006724077		Approved	KIAA1740	uc002zml.2	Q9BXF3	OTTHUMG00000150072	ENST00000400585.2:c.799G>A	22.37:g.18018340G>A	ENSP00000383428:p.Val267Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	A8MS90|A8MX16|Q658Z4|Q96P58|Q9C0C3	Missense_Mutation	SNP	pfam_Bromodomain,superfamily_Bromodomain,smart_Bromodomain,pfscan_Bromodomain,prints_Bromodomain	p.V408I	ENST00000400585.2	37	c.1222		22	.	.	.	.	.	.	.	.	.	.	G	20.3	3.968550	0.74131	.	.	ENSG00000099954	ENST00000342247;ENST00000400585;ENST00000400573;ENST00000262608	T;T;T;T	0.24723	1.84;1.84;1.84;1.84	5.65	5.65	0.86999	Bromodomain (4);	0.000000	0.48286	D	0.000195	T	0.32763	0.0840	N	0.10782	0.045	0.42507	D	0.992953	P;D;P	0.55605	0.527;0.972;0.79	P;P;B	0.62184	0.569;0.899;0.39	T	0.28650	-1.0037	10	0.51188	T	0.08	-22.1348	20.0887	0.97806	0.0:0.0:1.0:0.0	.	450;267;408	Q9BXF3;B7WPH3;E2QRE6	CECR2_HUMAN;.;.	I	380;267;408;409	ENSP00000341219:V380I;ENSP00000383428:V267I;ENSP00000383417:V408I;ENSP00000262608:V409I	ENSP00000262608:V409I	V	+	1	0	CECR2	16398340	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	4.693000	0.61753	2.825000	0.97269	0.655000	0.94253	GTA	CECR2	-	pfam_Bromodomain,superfamily_Bromodomain,smart_Bromodomain	ENSG00000099954		0.408	CECR2-002	NOVEL	basic|appris_candidate|exp_conf	protein_coding	CECR2	HGNC	protein_coding	OTTHUMT00000316226.2	93	0.00	0	G	NM_031413		18018340	18018340	+1	no_errors	ENST00000400573	ensembl	human	novel	69_37n	missense	97	10.19	11	SNP	1.000	A
CUL7	9820	genome.wustl.edu	37	6	43018789	43018789	+	Missense_Mutation	SNP	G	G	A			TCGA-A1-A0SF-01A-11D-A142-09	TCGA-A1-A0SF-10B-01D-A142-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b291200e-3c22-411a-85d0-fbe1570acda2	cc8ae8d4-315d-492a-84e9-7ed8630e9c70	g.chr6:43018789G>A	ENST00000265348.3	-	4	1235	c.1150C>T	c.(1150-1152)Cgg>Tgg	p.R384W	CUL7_ENST00000535468.1_Missense_Mutation_p.R468W|CUL7_ENST00000478630.1_5'Flank			Q14999	CUL7_HUMAN	cullin 7	384	Interaction with TP53.				activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|epithelial to mesenchymal transition (GO:0001837)|Golgi organization (GO:0007030)|microtubule cytoskeleton organization (GO:0000226)|mitotic cytokinesis (GO:0000281)|placenta development (GO:0001890)|positive regulation of dendrite morphogenesis (GO:0050775)|protein ubiquitination (GO:0016567)|proteolysis (GO:0006508)|regulation of mitosis (GO:0007088)|ubiquitin-dependent protein catabolic process (GO:0006511)|vasculogenesis (GO:0001570)|viral process (GO:0016032)	3M complex (GO:1990393)|anaphase-promoting complex (GO:0005680)|centrosome (GO:0005813)|Cul7-RING ubiquitin ligase complex (GO:0031467)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)				breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(8)|liver(1)|lung(11)|ovary(3)|prostate(2)|skin(3)|stomach(1)|urinary_tract(1)	49			all cancers(41;0.00231)|Colorectal(64;0.00237)|COAD - Colon adenocarcinoma(64;0.00473)|OV - Ovarian serous cystadenocarcinoma(102;0.0442)|KIRC - Kidney renal clear cell carcinoma(15;0.133)|Kidney(15;0.188)			TCCAGCATCCGCACTCGCATC	0.567																																						dbGAP											0													108.0	94.0	99.0					6																	43018789		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC033647	CCDS4881.1, CCDS55003.1	6p21.1	2011-05-24	2004-03-22	2004-03-22	ENSG00000044090	ENSG00000044090			21024	protein-coding gene	gene with protein product		609577	"""KIAA0076"""	KIAA0076		12481031, 12904573	Standard	NM_014780		Approved	dJ20C7.5	uc011dvb.2	Q14999	OTTHUMG00000014718	ENST00000265348.3:c.1150C>T	6.37:g.43018789G>A	ENSP00000265348:p.Arg384Trp	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DYZ0|F5H0L1|Q5T654	Missense_Mutation	SNP	pfam_Cullin_N,pfam_CPH_domain,pfam_APC_su10/DOC_dom,superfamily_Galactose-bd-like,superfamily_Cullin_homology,superfamily_ARM-type_fold,smart_Cullin_neddylation_domain,pfscan_Cullin_homology	p.R468W	ENST00000265348.3	37	c.1402	CCDS4881.1	6	.	.	.	.	.	.	.	.	.	.	G	21.9	4.223361	0.79464	.	.	ENSG00000044090	ENST00000265348;ENST00000535468	D;D	0.87103	-2.21;-2.19	5.39	5.39	0.77823	CPH domain (1);Translation protein SH3-like, subgroup (1);	0.196855	0.44285	D	0.000466	D	0.92880	0.7735	M	0.86028	2.79	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.997;1.0	D	0.93735	0.7045	10	0.87932	D	0	-15.0299	14.0371	0.64651	0.0:0.0:0.8489:0.1511	.	468;384	F5H0L1;Q14999	.;CUL7_HUMAN	W	384;468	ENSP00000265348:R384W;ENSP00000438788:R468W	ENSP00000265348:R384W	R	-	1	2	CUL7	43126767	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	6.317000	0.72862	2.533000	0.85409	0.563000	0.77884	CGG	CUL7	-	pfam_CPH_domain	ENSG00000044090		0.567	CUL7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CUL7	HGNC	protein_coding	OTTHUMT00000040575.1	46	0.00	0	G	NM_014780		43018789	43018789	-1	no_errors	ENST00000535468	ensembl	human	known	69_37n	missense	42	10.64	5	SNP	1.000	A
DDX53	168400	genome.wustl.edu	37	X	23018658	23018658	+	Missense_Mutation	SNP	G	G	A			TCGA-A1-A0SF-01A-11D-A142-09	TCGA-A1-A0SF-10B-01D-A142-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b291200e-3c22-411a-85d0-fbe1570acda2	cc8ae8d4-315d-492a-84e9-7ed8630e9c70	g.chrX:23018658G>A	ENST00000327968.5	+	1	572	c.484G>A	c.(484-486)Gag>Aag	p.E162K	RP11-40F8.2_ENST00000455399.1_lincRNA	NM_182699.3	NP_874358.2	Q86TM3	DDX53_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 53	162						nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|RNA binding (GO:0003723)			breast(2)|endometrium(5)|kidney(4)|large_intestine(3)|lung(15)|ovary(1)|prostate(1)|skin(2)|urinary_tract(2)	35						AGCAGTCGTGGAGTGCGAAAA	0.428																																						dbGAP											0													118.0	112.0	114.0					X																	23018658		2203	4300	6503	-	-	-	SO:0001583	missense	0			AY039237	CCDS35214.1	Xp22.13	2009-03-25			ENSG00000184735	ENSG00000184735		"""DEAD-boxes"""	20083	protein-coding gene	gene with protein product	"""cancer associated gene"", ""cancer/testis antigen 26"""						Standard	NM_182699		Approved	CAGE, CT26	uc004daj.3	Q86TM3	OTTHUMG00000021248	ENST00000327968.5:c.484G>A	X.37:g.23018658G>A	ENSP00000368667:p.Glu162Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q0D2N2|Q6NVV4	Missense_Mutation	SNP	pfam_DNA/RNA_helicase_DEAD/DEAH_N,pfam_Helicase_C,pfam_KH_dom_type_1,smart_KH_dom,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_KH_dom_type_1,pfscan_Helicase_ATP-bd,pfscan_Helicase_C	p.E162K	ENST00000327968.5	37	c.484	CCDS35214.1	X	.	.	.	.	.	.	.	.	.	.	G	3.169	-0.170467	0.06461	.	.	ENSG00000184735	ENST00000327968	T	0.19938	2.11	4.83	-5.16	0.02857	.	0.312630	0.32314	N	0.006267	T	0.06826	0.0174	N	0.19112	0.55	0.09310	N	1	B	0.09022	0.002	B	0.08055	0.003	T	0.36986	-0.9725	10	0.06494	T	0.89	-3.6943	3.3029	0.06989	0.2564:0.4565:0.1707:0.1164	.	162	Q86TM3	DDX53_HUMAN	K	162	ENSP00000368667:E162K	ENSP00000368667:E162K	E	+	1	0	DDX53	22928579	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.431000	0.06965	-0.854000	0.04131	0.600000	0.82982	GAG	DDX53	-	NULL	ENSG00000184735		0.428	DDX53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DDX53	HGNC	protein_coding	OTTHUMT00000056043.1	47	0.00	0	G	NM_182699		23018658	23018658	+1	no_errors	ENST00000327968	ensembl	human	known	69_37n	missense	38	19.15	9	SNP	0.000	A
DUSP27	92235	genome.wustl.edu	37	1	167097747	167097747	+	Missense_Mutation	SNP	G	G	A			TCGA-A1-A0SF-01A-11D-A142-09	TCGA-A1-A0SF-10B-01D-A142-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b291200e-3c22-411a-85d0-fbe1570acda2	cc8ae8d4-315d-492a-84e9-7ed8630e9c70	g.chr1:167097747G>A	ENST00000361200.2	+	6	3545	c.3379G>A	c.(3379-3381)Gag>Aag	p.E1127K	DUSP27_ENST00000271385.5_Missense_Mutation_p.E1127K|DUSP27_ENST00000443333.1_Missense_Mutation_p.E1127K|DUSP27_ENST00000485151.1_Intron			Q5VZP5	DUS27_HUMAN	dual specificity phosphatase 27 (putative)	1127					protein dephosphorylation (GO:0006470)		protein tyrosine/serine/threonine phosphatase activity (GO:0008138)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(11)|liver(1)|lung(46)|ovary(5)|prostate(5)|skin(4)|upper_aerodigestive_tract(3)	89						CACTGACAGGGAGGAAGAGGA	0.532																																						dbGAP											0													46.0	42.0	44.0					1																	167097747		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF119045	CCDS30932.1	1q22-q24	2008-02-05			ENSG00000198842	ENSG00000198842			25034	protein-coding gene	gene with protein product							Standard	NM_001080426		Approved		uc001geb.1	Q5VZP5	OTTHUMG00000034434	ENST00000361200.2:c.3379G>A	1.37:g.167097747G>A	ENSP00000354483:p.Glu1127Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	A0AUM4|Q9C074	Missense_Mutation	SNP	pfam_Dual-sp_phosphatase_cat-dom,smart_Dual-sp_phosphatase_subgr_cat,pfscan_Tyr/Dual-specificity_Pase,pfscan_Dual-sp_phosphatase_subgr_cat,prints_Atypical_DUSP,prints_Atypical_DUSP_famA	p.E1127K	ENST00000361200.2	37	c.3379	CCDS30932.1	1	.	.	.	.	.	.	.	.	.	.	G	14.01	2.407619	0.42715	.	.	ENSG00000198842	ENST00000361200;ENST00000271385;ENST00000443333	T;T;T	0.03889	3.77;3.77;3.77	5.4	4.47	0.54385	.	0.262150	0.26951	N	0.021669	T	0.03434	0.0099	L	0.60455	1.87	0.31242	N	0.695078	P	0.39060	0.657	B	0.37650	0.255	T	0.08146	-1.0736	10	0.87932	D	0	-21.1225	15.7531	0.78001	0.0:0.1416:0.8584:0.0	.	1127	Q5VZP5	DUS27_HUMAN	K	1127	ENSP00000354483:E1127K;ENSP00000271385:E1127K;ENSP00000404874:E1127K	ENSP00000271385:E1127K	E	+	1	0	DUSP27	165364371	1.000000	0.71417	0.750000	0.31169	0.354000	0.29330	4.610000	0.61155	1.238000	0.43771	0.549000	0.68633	GAG	DUSP27	-	NULL	ENSG00000198842		0.532	DUSP27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DUSP27	HGNC	protein_coding	OTTHUMT00000083244.1	13	0.00	0	G	NM_001080426		167097747	167097747	+1	no_errors	ENST00000271385	ensembl	human	known	69_37n	missense	13	23.53	4	SNP	0.989	A
EPPK1	83481	genome.wustl.edu	37	8	144940615	144940615	+	Silent	SNP	G	G	A			TCGA-A1-A0SF-01A-11D-A142-09	TCGA-A1-A0SF-10B-01D-A142-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b291200e-3c22-411a-85d0-fbe1570acda2	cc8ae8d4-315d-492a-84e9-7ed8630e9c70	g.chr8:144940615G>A	ENST00000525985.1	-	2	6878	c.6807C>T	c.(6805-6807)acC>acT	p.T2269T				P58107	EPIPL_HUMAN	epiplakin 1	2269						cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)	poly(A) RNA binding (GO:0044822)			NS(1)|autonomic_ganglia(1)|breast(1)|central_nervous_system(5)|cervix(1)|endometrium(8)|kidney(4)|large_intestine(2)|lung(30)|ovary(2)|pancreas(1)|prostate(10)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	71	all_cancers(97;1.42e-10)|all_epithelial(106;1.99e-09)|Lung NSC(106;0.000126)|all_lung(105;0.000354)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;2.46e-41)|Epithelial(56;2.88e-40)|all cancers(56;1.82e-35)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.105)			TGACGAAGCCGGTGGCCGCCT	0.716																																						dbGAP											0													36.0	36.0	36.0					8																	144940615		2150	4233	6383	-	-	-	SO:0001819	synonymous_variant	0			AB051895	CCDS75800.1	8q24.3	2014-09-17				ENSG00000261150			15577	protein-coding gene	gene with protein product	"""epidermal autoantigen 450K"""	607553				11278896, 15671067	Standard	NM_031308		Approved	EPIPL1	uc003zaa.1	P58107		ENST00000525985.1:c.6807C>T	8.37:g.144940615G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q76E58|Q9NSU9	Silent	SNP	pfam_Plectin_repeat,smart_Plectin_repeat	p.T2269	ENST00000525985.1	37	c.6807		8																																																																																			EPPK1	-	pfam_Plectin_repeat,smart_Plectin_repeat	ENSG00000227184		0.716	EPPK1-001	KNOWN	basic|appris_principal	protein_coding	EPPK1	HGNC	protein_coding	OTTHUMT00000382675.1	39	0.00	0	G	NM_031308		144940615	144940615	-1	no_errors	ENST00000525985	ensembl	human	known	69_37n	silent	36	14.29	6	SNP	0.242	A
EXT2	2132	genome.wustl.edu	37	11	44129420	44129420	+	Missense_Mutation	SNP	C	C	T			TCGA-A1-A0SF-01A-11D-A142-09	TCGA-A1-A0SF-10B-01D-A142-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b291200e-3c22-411a-85d0-fbe1570acda2	cc8ae8d4-315d-492a-84e9-7ed8630e9c70	g.chr11:44129420C>T	ENST00000343631.3	+	2	287	c.158C>T	c.(157-159)tCa>tTa	p.S53L	EXT2_ENST00000533608.1_Missense_Mutation_p.S53L|EXT2_ENST00000358681.4_Missense_Mutation_p.S53L|EXT2_ENST00000395673.3_Missense_Mutation_p.S86L			Q93063	EXT2_HUMAN	exostosin glycosyltransferase 2	53					carbohydrate metabolic process (GO:0005975)|cell differentiation (GO:0030154)|cellular polysaccharide biosynthetic process (GO:0033692)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan metabolic process (GO:0030203)|heparan sulfate proteoglycan biosynthetic process (GO:0015012)|heparan sulfate proteoglycan biosynthetic process, polysaccharide chain biosynthetic process (GO:0015014)|mesoderm formation (GO:0001707)|ossification (GO:0001503)|protein glycosylation (GO:0006486)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|intrinsic component of endoplasmic reticulum membrane (GO:0031227)|membrane (GO:0016020)	glucuronosyl-N-acetylglucosaminyl-proteoglycan 4-alpha-N-acetylglucosaminyltransferase activity (GO:0050508)|glucuronosyltransferase activity (GO:0015020)|heparan sulfate N-acetylglucosaminyltransferase activity (GO:0042328)|N-acetylglucosaminyl-proteoglycan 4-beta-glucuronosyltransferase activity (GO:0050509)|protein heterodimerization activity (GO:0046982)|transferase activity, transferring glycosyl groups (GO:0016757)			breast(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|lung(17)|prostate(1)|skin(5)|upper_aerodigestive_tract(2)	32						ATCGAGTCCTCAAATGACTGG	0.537			"""Mis, N, F, S"""			"""exostoses, osteosarcoma"""			Hereditary Multiple Exostoses																													dbGAP	yes	Rec		Multiple Exostoses Type 2	11	11p12-p11	2132	multiple exostoses type 2 gene		M	0													141.0	143.0	142.0					11																	44129420		2203	4300	6503	-	-	-	SO:0001583	missense	0	Familial Cancer Database	HME, Hereditary Exostoses, Multiple Osteochondromatosis, Multiple Cartilaginous Exostoses		CCDS7908.1, CCDS53618.1, CCDS53619.1	11p12-p11	2014-09-17	2013-03-01		ENSG00000151348	ENSG00000151348	2.4.1.224, 2.4.1.225	"""Exostosin glycosyltransferase family"""	3513	protein-coding gene	gene with protein product	"""Glucuronosyl-N-acetylglucosaminyl-proteoglycan 4-alpha-N- acetylglucosaminyltransferase"", ""N-acetylglucosaminyl-proteoglycan 4-beta-glucuronosyltransferase"""	608210	"""exostoses (multiple) 2"", ""exostosin 2"""			8162019, 9576285	Standard	NM_000401		Approved	SOTV	uc001mya.3	Q93063	OTTHUMG00000166498	ENST00000343631.3:c.158C>T	11.37:g.44129420C>T	ENSP00000342656:p.Ser53Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R5Z6|C9JU51|J3KPT2|O15288	Missense_Mutation	SNP	pfam_HexNAc_Trfase_a,pfam_Exostosin	p.S86L	ENST00000343631.3	37	c.257	CCDS7908.1	11	.	.	.	.	.	.	.	.	.	.	C	15.01	2.706407	0.48412	.	.	ENSG00000151348	ENST00000533608;ENST00000527014;ENST00000358681;ENST00000395673;ENST00000343631	T;T;T;T;T	0.44881	0.91;0.91;0.91;0.91;0.91	5.45	5.45	0.79879	.	0.110592	0.64402	D	0.000005	T	0.31136	0.0787	N	0.19112	0.55	0.80722	D	1	B;B;B;B;B	0.32781	0.22;0.384;0.307;0.029;0.004	B;B;B;B;B	0.30572	0.086;0.08;0.117;0.016;0.004	T	0.06075	-1.0847	10	0.24483	T	0.36	-1.0025	19.302	0.94148	0.0:1.0:0.0:0.0	.	53;53;53;53;66	Q6NUL1;C9JU51;Q93063-2;Q93063;D3DR24	.;.;.;EXT2_HUMAN;.	L	53;53;53;86;53	ENSP00000431173:S53L;ENSP00000434716:S53L;ENSP00000351509:S53L;ENSP00000379032:S86L;ENSP00000342656:S53L	ENSP00000342656:S53L	S	+	2	0	EXT2	44085996	0.927000	0.31430	0.951000	0.38953	0.501000	0.33797	7.380000	0.79704	2.568000	0.86640	0.650000	0.86243	TCA	EXT2	-	NULL	ENSG00000151348		0.537	EXT2-005	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	EXT2	HGNC	protein_coding	OTTHUMT00000390074.1	76	0.00	0	C	NM_000401		44129420	44129420	+1	no_errors	ENST00000395673	ensembl	human	known	69_37n	missense	68	12.82	10	SNP	0.998	T
FIGN	55137	genome.wustl.edu	37	2	164468287	164468287	+	Missense_Mutation	SNP	C	C	A			TCGA-A1-A0SF-01A-11D-A142-09	TCGA-A1-A0SF-10B-01D-A142-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b291200e-3c22-411a-85d0-fbe1570acda2	cc8ae8d4-315d-492a-84e9-7ed8630e9c70	g.chr2:164468287C>A	ENST00000333129.3	-	3	369	c.55G>T	c.(55-57)Gcc>Tcc	p.A19S	FIGN_ENST00000409634.1_Intron|FIGN_ENST00000482917.1_5'UTR	NM_018086.2	NP_060556.2	Q5HY92	FIGN_HUMAN	fidgetin	19					mitotic nuclear division (GO:0007067)	cytoplasm (GO:0005737)|microtubule (GO:0005874)|nuclear matrix (GO:0016363)	ATP binding (GO:0005524)			breast(2)|endometrium(3)|kidney(2)|large_intestine(13)|lung(23)|ovary(1)|prostate(2)|skin(1)	47						GGCCACTGGGCATGCTCTGGC	0.478																																						dbGAP											0													69.0	71.0	70.0					2																	164468287		2068	4209	6277	-	-	-	SO:0001583	missense	0			AK001267	CCDS2221.2	2q24	2010-04-21			ENSG00000182263	ENSG00000182263		"""ATPases / AAA-type"""	13285	protein-coding gene	gene with protein product		605295				11017077	Standard	XM_005246661		Approved		uc002uck.1	Q5HY92	OTTHUMG00000074059	ENST00000333129.3:c.55G>T	2.37:g.164468287C>A	ENSP00000333836:p.Ala19Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KWM0|Q9H6M5|Q9NVZ9	Missense_Mutation	SNP	pfam_ATPase_AAA_core,smart_AAA+_ATPase	p.A19S	ENST00000333129.3	37	c.55	CCDS2221.2	2	.	.	.	.	.	.	.	.	.	.	C	10.25	1.299402	0.23650	.	.	ENSG00000182263	ENST00000333129	T	0.24350	1.86	6.17	6.17	0.99709	.	0.067017	0.64402	U	0.000012	T	0.19525	0.0469	N	0.20401	0.57	0.58432	D	0.999994	B	0.21520	0.057	B	0.15870	0.014	T	0.10753	-1.0616	10	0.13108	T	0.6	-28.1443	20.8794	0.99867	0.0:1.0:0.0:0.0	.	19	Q5HY92	FIGN_HUMAN	S	19	ENSP00000333836:A19S	ENSP00000333836:A19S	A	-	1	0	FIGN	164176533	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.664000	0.61540	2.941000	0.99782	0.655000	0.94253	GCC	FIGN	-	NULL	ENSG00000182263		0.478	FIGN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FIGN	HGNC	protein_coding	OTTHUMT00000157220.2	25	0.00	0	C	NM_018086		164468287	164468287	-1	no_errors	ENST00000333129	ensembl	human	known	69_37n	missense	20	20.00	5	SNP	1.000	A
H2AFZ	3015	genome.wustl.edu	37	4	100870052	100870052	+	Missense_Mutation	SNP	G	G	A			TCGA-A1-A0SF-01A-11D-A142-09	TCGA-A1-A0SF-10B-01D-A142-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b291200e-3c22-411a-85d0-fbe1570acda2	cc8ae8d4-315d-492a-84e9-7ed8630e9c70	g.chr4:100870052G>A	ENST00000296417.5	-	4	458	c.241C>T	c.(241-243)Cgt>Tgt	p.R81C	H2AFZ_ENST00000529158.1_5'UTR|RP11-15B17.1_ENST00000507494.1_RNA|DNAJB14_ENST00000471738.1_5'Flank|DNAJB14_ENST00000442697.2_5'Flank|RP11-15B17.1_ENST00000514624.1_RNA|RP11-15B17.1_ENST00000501976.2_RNA	NM_002106.3	NP_002097.1	P0C0S5	H2AZ_HUMAN	H2A histone family, member Z	81					cellular response to estradiol stimulus (GO:0071392)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	extracellular vesicular exosome (GO:0070062)|nuclear euchromatin (GO:0005719)|nuclear heterochromatin (GO:0005720)|nucleosome (GO:0000786)|nucleus (GO:0005634)	chromatin DNA binding (GO:0031490)|nucleosomal DNA binding (GO:0031492)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)			breast(1)|endometrium(3)|lung(1)	5				OV - Ovarian serous cystadenocarcinoma(123;2.32e-08)		GGGGTAATACGCTTTACCTTT	0.418											OREG0016271	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP											0													93.0	88.0	90.0					4																	100870052		2203	4300	6503	-	-	-	SO:0001583	missense	0			X52317	CCDS3654.1	4q23	2011-01-27			ENSG00000164032	ENSG00000164032		"""Histones / Replication-independent"""	4741	protein-coding gene	gene with protein product		142763		H2AZ		1697587	Standard	XM_005262971		Approved	H2A.Z	uc003hvo.1	P0C0S5	OTTHUMG00000131048	ENST00000296417.5:c.241C>T	4.37:g.100870052G>A	ENSP00000296417:p.Arg81Cys	Somatic	1354	WXS	Illumina GAIIx	Phase_IV	B2RD56|P17317|Q6I9U0	Missense_Mutation	SNP	pfam_Histone_core_D,superfamily_Histone-fold,smart_Histone_H2A,prints_Histone_H2A	p.R81C	ENST00000296417.5	37	c.241	CCDS3654.1	4	.	.	.	.	.	.	.	.	.	.	G	17.20	3.329373	0.60743	.	.	ENSG00000164032	ENST00000296417	T	0.69561	-0.41	4.74	4.74	0.60224	Histone-fold (2);Histone core (1);Histone H2A (2);	0.000000	0.85682	D	0.000000	T	0.79335	0.4428	H	0.97315	3.98	0.80722	D	1	B	0.25312	0.123	B	0.16722	0.016	T	0.82824	-0.0266	10	0.62326	D	0.03	-12.0973	17.7576	0.88453	0.0:0.0:1.0:0.0	.	81	P0C0S5	H2AZ_HUMAN	C	81	ENSP00000296417:R81C	ENSP00000296417:R81C	R	-	1	0	H2AFZ	101089075	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	8.910000	0.92685	2.187000	0.69744	0.655000	0.94253	CGT	H2AFZ	-	pfam_Histone_core_D,superfamily_Histone-fold,smart_Histone_H2A,prints_Histone_H2A	ENSG00000164032		0.418	H2AFZ-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	H2AFZ	HGNC	protein_coding	OTTHUMT00000253695.1	52	0.00	0	G	NM_002106		100870052	100870052	-1	no_errors	ENST00000296417	ensembl	human	known	69_37n	missense	52	13.33	8	SNP	1.000	A
HMGB2	3148	genome.wustl.edu	37	4	174254704	174254704	+	Missense_Mutation	SNP	C	C	T			TCGA-A1-A0SF-01A-11D-A142-09	TCGA-A1-A0SF-10B-01D-A142-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b291200e-3c22-411a-85d0-fbe1570acda2	cc8ae8d4-315d-492a-84e9-7ed8630e9c70	g.chr4:174254704C>T	ENST00000296503.5	-	2	970	c.97G>A	c.(97-99)Gac>Aac	p.D33N	HMGB2_ENST00000438704.2_Missense_Mutation_p.D33N|HMGB2_ENST00000446922.2_Missense_Mutation_p.D33N			P26583	HMGB2_HUMAN	high mobility group box 2	33					apoptotic DNA fragmentation (GO:0006309)|apoptotic process (GO:0006915)|base-excision repair, DNA ligation (GO:0006288)|cell chemotaxis (GO:0060326)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to lipopolysaccharide (GO:0071222)|chromatin organization (GO:0006325)|DNA ligation involved in DNA repair (GO:0051103)|DNA topological change (GO:0006265)|male gonad development (GO:0008584)|negative regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902042)|negative regulation of transcription, DNA-templated (GO:0045892)|nucleosome assembly (GO:0006334)|positive chemotaxis (GO:0050918)|positive regulation of DNA binding (GO:0043388)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of erythrocyte differentiation (GO:0045648)|positive regulation of megakaryocyte differentiation (GO:0045654)|positive regulation of nuclease activity (GO:0032075)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to steroid hormone (GO:0048545)|spermatid nucleus differentiation (GO:0007289)|V(D)J recombination (GO:0033151)	condensed chromosome (GO:0000793)|cytoplasm (GO:0005737)|extracellular space (GO:0005615)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|protein complex (GO:0043234)	chemoattractant activity (GO:0042056)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|DNA binding, bending (GO:0008301)|double-stranded DNA binding (GO:0003690)|poly(A) RNA binding (GO:0044822)|RAGE receptor binding (GO:0050786)|sequence-specific DNA binding transcription factor activity (GO:0003700)|single-stranded DNA binding (GO:0003697)|transcription regulatory region DNA binding (GO:0044212)			endometrium(2)|kidney(1)|large_intestine(2)|lung(6)|urinary_tract(3)	14		Prostate(90;0.0132)|Renal(120;0.0183)|Melanoma(52;0.0749)|all_hematologic(60;0.107)|all_neural(102;0.122)		all cancers(43;9.58e-18)|Epithelial(43;3.75e-16)|OV - Ovarian serous cystadenocarcinoma(60;6.24e-09)|STAD - Stomach adenocarcinoma(60;0.00273)|GBM - Glioblastoma multiforme(59;0.0064)|LUSC - Lung squamous cell carcinoma(193;0.0903)|Kidney(143;0.249)		ACGGAAGAGTCCGGGTGTTTC	0.562																																						dbGAP											0													100.0	99.0	99.0					4																	174254704		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS3816.1	4q31	2011-07-01	2011-04-05	2002-08-16	ENSG00000164104	ENSG00000164104		"""High-mobility group / Canonical"""	5000	protein-coding gene	gene with protein product		163906	"""high-mobility group (nonhistone chromosomal) protein 2"", ""high-mobility group box 2"""	HMG2		1754403	Standard	NM_002129		Approved		uc011ckc.1	P26583	OTTHUMG00000160799	ENST00000296503.5:c.97G>A	4.37:g.174254704C>T	ENSP00000296503:p.Asp33Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R4K8|D3DP37|Q5U072	Missense_Mutation	SNP	pfam_HMG_superfamily,superfamily_HMG_superfamily,smart_HMG_superfamily,pfscan_HMG_superfamily	p.D33N	ENST00000296503.5	37	c.97	CCDS3816.1	4	.	.	.	.	.	.	.	.	.	.	C	18.05	3.536005	0.64972	.	.	ENSG00000164104	ENST00000296503;ENST00000446922;ENST00000438704;ENST00000506267	T;T;T;T	0.17691	2.26;2.26;2.26;2.26	5.45	5.45	0.79879	High mobility group, superfamily (1);High mobility group, HMG1/HMG2 (4);	0.175745	0.39083	N	0.001470	T	0.22742	0.0549	L	0.28649	0.875	0.80722	D	1	B	0.27732	0.187	B	0.42163	0.378	T	0.08617	-1.0713	10	0.28530	T	0.3	.	18.8904	0.92399	0.0:1.0:0.0:0.0	.	33	P26583	HMGB2_HUMAN	N	33	ENSP00000296503:D33N;ENSP00000393448:D33N;ENSP00000404912:D33N;ENSP00000423001:D33N	ENSP00000296503:D33N	D	-	1	0	HMGB2	174491279	1.000000	0.71417	0.860000	0.33809	0.097000	0.18754	7.538000	0.82048	2.573000	0.86826	0.563000	0.77884	GAC	HMGB2	-	pfam_HMG_superfamily,superfamily_HMG_superfamily,smart_HMG_superfamily,pfscan_HMG_superfamily	ENSG00000164104		0.562	HMGB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HMGB2	HGNC	protein_coding	OTTHUMT00000362362.1	42	0.00	0	C	NM_001130688		174254704	174254704	-1	no_errors	ENST00000296503	ensembl	human	known	69_37n	missense	30	16.67	6	SNP	1.000	T
IGHV1-24	28467	genome.wustl.edu	37	14	106733410	106733410	+	RNA	SNP	C	C	T			TCGA-A1-A0SF-01A-11D-A142-09	TCGA-A1-A0SF-10B-01D-A142-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b291200e-3c22-411a-85d0-fbe1570acda2	cc8ae8d4-315d-492a-84e9-7ed8630e9c70	g.chr14:106733410C>T	ENST00000390610.2	-	0	144									immunoglobulin heavy variable 1-24																		TTCTTCACCTCAGCCCCAGAC	0.582																																						dbGAP											0													123.0	118.0	120.0					14																	106733410		1943	4132	6075	-	-	-			0			M99642		14q32.33	2012-02-08			ENSG00000211950	ENSG00000211950		"""Immunoglobulins / IGH locus"""	5551	other	immunoglobulin gene							Standard	NG_001019		Approved				OTTHUMG00000152095		14.37:g.106733410C>T		Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Ig_V-set,smart_Ig_V-set_subgr,pfscan_Ig-like	p.E29K	ENST00000390610.2	37	c.85		14																																																																																			IGHV1-24	-	pfam_Ig_V-set,pfscan_Ig-like	ENSG00000211950		0.582	IGHV1-24-001	KNOWN	mRNA_end_NF|cds_end_NF|basic|appris_principal	IG_V_gene	IGHV1-24	HGNC	IG_V_gene	OTTHUMT00000325192.1	48	0.00	0	C	NG_001019		106733410	106733410	-1	no_stop_codon	ENST00000390610	ensembl	human	known	69_37n	missense	60	21.05	16	SNP	0.832	T
INPP5F	22876	genome.wustl.edu	37	10	121563758	121563758	+	Frame_Shift_Del	DEL	T	T	-			TCGA-A1-A0SF-01A-11D-A142-09	TCGA-A1-A0SF-10B-01D-A142-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b291200e-3c22-411a-85d0-fbe1570acda2	cc8ae8d4-315d-492a-84e9-7ed8630e9c70	g.chr10:121563758delT	ENST00000361976.2	+	10	1356	c.1190delT	c.(1189-1191)cttfs	p.L397fs		NM_014937.3	NP_055752.1	Q01968	OCRL_HUMAN	inositol polyphosphate-5-phosphatase F	0	5-phosphatase.				cilium assembly (GO:0042384)|in utero embryonic development (GO:0001701)|inositol phosphate metabolic process (GO:0043647)|lipid metabolic process (GO:0006629)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol dephosphorylation (GO:0046856)|phospholipid metabolic process (GO:0006644)|positive regulation of Rac GTPase activity (GO:0032855)|regulation of Rac GTPase activity (GO:0032314)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|small molecule metabolic process (GO:0044281)	clathrin-coated vesicle (GO:0030136)|coated pit (GO:0005905)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|early endosome (GO:0005769)|extracellular vesicular exosome (GO:0070062)|Golgi stack (GO:0005795)|Golgi-associated vesicle (GO:0005798)|nucleus (GO:0005634)|photoreceptor outer segment (GO:0001750)|plasma membrane (GO:0005886)|trans-Golgi network (GO:0005802)	inositol phosphate phosphatase activity (GO:0052745)|phosphatidylinositol-4,5-bisphosphate 5-phosphatase activity (GO:0004439)|Rac GTPase activator activity (GO:0030675)|Rac GTPase binding (GO:0048365)			breast(1)|cervix(1)|endometrium(7)|kidney(4)|large_intestine(9)|lung(5)|ovary(5)|pancreas(1)|prostate(1)|skin(1)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	42		Lung NSC(174;0.109)|all_lung(145;0.142)		all cancers(201;0.00205)|BRCA - Breast invasive adenocarcinoma(275;0.158)		CAAGTGTTGCTTTTCAACAAC	0.393																																						dbGAP											0													177.0	156.0	163.0					10																	121563758		2203	4300	6503	-	-	-	SO:0001589	frameshift_variant	0			AB023183	CCDS7616.1, CCDS58098.1	10q26.13	2009-02-03			ENSG00000198825	ENSG00000198825			17054	protein-coding gene	gene with protein product		609389				10231032, 11274189	Standard	NM_014937		Approved	SAC2, KIAA0966, hSac2	uc001leo.3	Q9Y2H2	OTTHUMG00000019158	ENST00000361976.2:c.1190delT	10.37:g.121563758delT	ENSP00000354519:p.Leu397fs	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NKI1|A8KAP2|B7ZLX2|O60800|Q15684|Q15774|Q4VY09|Q4VY10|Q5JQF1|Q5JQF2|Q9UJG5|Q9UMA5	Frame_Shift_Del	DEL	pfam_Syja_N,pfam_Inositol_phosphatase,pfscan_Syja_N	p.F398fs	ENST00000361976.2	37	c.1190	CCDS7616.1	10																																																																																			INPP5F	-	pfam_Syja_N,pfscan_Syja_N	ENSG00000198825		0.393	INPP5F-001	KNOWN	basic|appris_principal|CCDS	protein_coding	INPP5F	HGNC	protein_coding	OTTHUMT00000050679.1	65	0.00	0	T	NM_014937		121563758	121563758	+1	no_errors	ENST00000361976	ensembl	human	known	69_37n	frame_shift_del	47	14.29	8	DEL	1.000	-
KDM5B	10765	genome.wustl.edu	37	1	202743781	202743781	+	Missense_Mutation	SNP	T	T	C			TCGA-A1-A0SF-01A-11D-A142-09	TCGA-A1-A0SF-10B-01D-A142-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b291200e-3c22-411a-85d0-fbe1570acda2	cc8ae8d4-315d-492a-84e9-7ed8630e9c70	g.chr1:202743781T>C	ENST00000367265.3	-	3	1529	c.365A>G	c.(364-366)cAt>cGt	p.H122R	KDM5B_ENST00000367264.2_Missense_Mutation_p.H122R	NM_006618.3	NP_006609.3	Q9UGL1	KDM5B_HUMAN	lysine (K)-specific demethylase 5B	122	ARID. {ECO:0000255|PROSITE- ProRule:PRU00355}.				histone H3-K4 demethylation (GO:0034720)|histone H3-K4 demethylation, trimethyl-H3-K4-specific (GO:0034721)|negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|histone demethylase activity (H3-dimethyl-K4 specific) (GO:0034648)|histone demethylase activity (H3-trimethyl-K4 specific) (GO:0034647)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors (GO:0016706)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)|zinc ion binding (GO:0008270)			breast(2)|ovary(2)|skin(1)|urinary_tract(1)	6						CCTCTCCACATGTGGAATTTT	0.353																																						dbGAP											0													92.0	93.0	93.0					1																	202743781		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ243706	CCDS30974.1	1q32.1	2014-06-12	2009-04-06	2009-04-06	ENSG00000117139	ENSG00000117139		"""Chromatin-modifying enzymes / K-demethylases"", ""Zinc fingers, PHD-type"""	18039	protein-coding gene	gene with protein product	"""cancer/testis antigen 31"", ""protein phosphatase 1, regulatory subunit 98"""	605393	"""Jumonji, AT rich interactive domain 1B (RBP2-like)"", ""jumonji, AT rich interactive domain 1B"""	JARID1B		11483573, 11478881	Standard	NM_006618		Approved	RBBP2H1A, PLU-1, CT31, PPP1R98	uc001gyf.3	Q9UGL1	OTTHUMG00000041401	ENST00000367265.3:c.365A>G	1.37:g.202743781T>C	ENSP00000356234:p.His122Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	O95811|Q15752|Q9Y3Q5	Missense_Mutation	SNP	pfam_Lys_sp_deMease_like_dom,pfam_JmjC_dom,pfam_Znf_PHD-finger,pfam_ARID/BRIGHT_DNA-bd,pfam_Znf_C5HC2,pfam_TF_JmjN,superfamily_ARID/BRIGHT_DNA-bd,superfamily_Znf_FYVE_PHD,smart_TF_JmjN,smart_ARID/BRIGHT_DNA-bd,smart_Znf_PHD,smart_JmjC_dom,pfscan_TF_JmjN,pfscan_JmjC_dom,pfscan_Znf_PHD-finger,pfscan_ARID/BRIGHT_DNA-bd	p.H122R	ENST00000367265.3	37	c.365	CCDS30974.1	1	.	.	.	.	.	.	.	.	.	.	T	21.9	4.222031	0.79464	.	.	ENSG00000117139	ENST00000367265;ENST00000367264	T;T	0.62788	0.0;0.0	5.49	5.49	0.81192	ARID/BRIGHT DNA-binding domain (5);	0.000000	0.85682	D	0.000000	T	0.68274	0.2983	L	0.39245	1.2	0.54753	D	0.999987	D;B	0.58620	0.983;0.05	P;B	0.57679	0.825;0.201	T	0.71199	-0.4663	10	0.62326	D	0.03	-21.3021	15.5876	0.76495	0.0:0.0:0.0:1.0	.	122;122	Q9UGL1-2;Q9UGL1	.;KDM5B_HUMAN	R	122	ENSP00000356234:H122R;ENSP00000356233:H122R	ENSP00000356233:H122R	H	-	2	0	KDM5B	201010404	1.000000	0.71417	0.957000	0.39632	0.996000	0.88848	6.030000	0.70903	2.080000	0.62538	0.528000	0.53228	CAT	KDM5B	-	pfam_ARID/BRIGHT_DNA-bd,superfamily_ARID/BRIGHT_DNA-bd,smart_ARID/BRIGHT_DNA-bd,pfscan_ARID/BRIGHT_DNA-bd	ENSG00000117139		0.353	KDM5B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KDM5B	HGNC	protein_coding	OTTHUMT00000099184.2	43	0.00	0	T	NM_006618		202743781	202743781	-1	no_errors	ENST00000367265	ensembl	human	known	69_37n	missense	64	14.67	11	SNP	0.999	C
KIF2A	3796	genome.wustl.edu	37	5	61643897	61643897	+	Missense_Mutation	SNP	C	C	T			TCGA-A1-A0SF-01A-11D-A142-09	TCGA-A1-A0SF-10B-01D-A142-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b291200e-3c22-411a-85d0-fbe1570acda2	cc8ae8d4-315d-492a-84e9-7ed8630e9c70	g.chr5:61643897C>T	ENST00000401507.3	+	3	493	c.182C>T	c.(181-183)tCa>tTa	p.S61L	KIF2A_ENST00000407818.3_Missense_Mutation_p.S61L|KIF2A_ENST00000506857.1_Missense_Mutation_p.S34L|KIF2A_ENST00000381103.2_Missense_Mutation_p.S41L|KIF2A_ENST00000509663.2_Intron	NM_001243953.1|NM_004520.4	NP_001230882.1|NP_004511.2	O00139	KIF2A_HUMAN	kinesin heavy chain member 2A	61	Globular. {ECO:0000255}.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|ATP catabolic process (GO:0006200)|blood coagulation (GO:0007596)|cell differentiation (GO:0030154)|metabolic process (GO:0008152)|microtubule depolymerization (GO:0007019)|microtubule-based movement (GO:0007018)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic spindle organization (GO:0007052)|nervous system development (GO:0007399)	centrosome (GO:0005813)|cytosol (GO:0005829)|kinesin complex (GO:0005871)|membrane (GO:0016020)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|motor activity (GO:0003774)			NS(1)|endometrium(3)|kidney(3)|large_intestine(3)|lung(3)|ovary(1)|skin(1)	15		Lung NSC(810;8.94e-06)|Prostate(74;0.0132)|Ovarian(174;0.051)|Breast(144;0.077)		Lung(70;0.14)		AGCATCTTTTCACTTAACCCT	0.373																																						dbGAP											0													136.0	133.0	134.0					5																	61643897		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC031828	CCDS3980.2, CCDS47216.1, CCDS58949.1	5q12-q13	2008-02-05	2006-09-26	2006-09-26	ENSG00000068796	ENSG00000068796		"""Kinesins"""	6318	protein-coding gene	gene with protein product		602591	"""kinesin heavy chain member 2"""	KIF2		9177777	Standard	NM_001098511		Approved	HK2	uc003jsz.4	O00139	OTTHUMG00000097755	ENST00000401507.3:c.182C>T	5.37:g.61643897C>T	ENSP00000385622:p.Ser61Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	A5YM42|A5YM54|B4DY54|D3DW97|E9PB70|Q7Z5I3|Q8N5Q7	Missense_Mutation	SNP	pfam_Kinesin_motor_dom,smart_Kinesin_motor_dom,pfscan_Kinesin_motor_dom,prints_Kinesin_motor_dom	p.S61L	ENST00000401507.3	37	c.182	CCDS3980.2	5	.	.	.	.	.	.	.	.	.	.	C	16.47	3.131988	0.56828	.	.	ENSG00000068796	ENST00000401507;ENST00000381103;ENST00000514082;ENST00000407818;ENST00000512541;ENST00000506857	T;T;T;T;T;T	0.73469	-0.59;-0.6;1.91;-0.75;0.89;-0.64	5.36	5.36	0.76844	.	0.062767	0.64402	D	0.000003	T	0.63733	0.2536	N	0.24115	0.695	0.80722	D	1	B;B;B;B	0.09022	0.001;0.002;0.001;0.001	B;B;B;B	0.12837	0.003;0.008;0.003;0.003	T	0.57294	-0.7836	10	0.21014	T	0.42	.	19.0952	0.93248	0.0:1.0:0.0:0.0	.	61;61;61;41	B4DM85;O00139-4;O00139;E9PB70	.;.;KIF2A_HUMAN;.	L	61;41;61;61;34;34	ENSP00000385622:S61L;ENSP00000370493:S41L;ENSP00000423542:S61L;ENSP00000385000:S61L;ENSP00000425411:S34L;ENSP00000423772:S34L	ENSP00000370493:S41L	S	+	2	0	KIF2A	61679654	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.366000	0.79548	2.522000	0.85027	0.460000	0.39030	TCA	KIF2A	-	NULL	ENSG00000068796		0.373	KIF2A-003	KNOWN	basic|appris_principal|CCDS	protein_coding	KIF2A	HGNC	protein_coding	OTTHUMT00000317989.1	54	0.00	0	C	NM_004520		61643897	61643897	+1	no_errors	ENST00000407818	ensembl	human	known	69_37n	missense	54	16.92	11	SNP	1.000	T
KITLG	4254	genome.wustl.edu	37	12	88939633	88939633	+	Missense_Mutation	SNP	G	G	A			TCGA-A1-A0SF-01A-11D-A142-09	TCGA-A1-A0SF-10B-01D-A142-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b291200e-3c22-411a-85d0-fbe1570acda2	cc8ae8d4-315d-492a-84e9-7ed8630e9c70	g.chr12:88939633G>A	ENST00000228280.5	-	2	207	c.25C>T	c.(25-27)Ctc>Ttc	p.L9F	KITLG_ENST00000357116.4_Intron|KITLG_ENST00000347404.5_Missense_Mutation_p.L9F	NM_000899.4	NP_000890.1	P21583	SCF_HUMAN	KIT ligand	9					cell adhesion (GO:0007155)|cell proliferation (GO:0008283)|ectopic germ cell programmed cell death (GO:0035234)|embryonic hemopoiesis (GO:0035162)|epidermal growth factor receptor signaling pathway (GO:0007173)|extrinsic apoptotic signaling pathway in absence of ligand (GO:0097192)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|male gonad development (GO:0008584)|negative regulation of mast cell apoptotic process (GO:0033026)|neural crest cell migration (GO:0001755)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of DNA replication (GO:0045740)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of mast cell proliferation (GO:0070668)|positive regulation of melanocyte differentiation (GO:0045636)|positive regulation of myeloid leukocyte differentiation (GO:0002763)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of Ras protein signal transduction (GO:0046579)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	stem cell factor receptor binding (GO:0005173)			kidney(2)|large_intestine(3)|lung(1)|ovary(1)|prostate(1)|stomach(1)	9						ATGCAAGTGAGAATCCAAGTC	0.348									Testicular Cancer, Familial Clustering of																													dbGAP											0													71.0	67.0	68.0					12																	88939633		2203	4300	6503	-	-	-	SO:0001583	missense	0	Familial Cancer Database		M59964	CCDS31867.1, CCDS31868.1	12q22	2010-11-23			ENSG00000049130	ENSG00000049130			6343	protein-coding gene	gene with protein product	"""mast cell growth factor"", ""stem cell factor"", ""steel factor"", ""familial progressive hyperpigmentation 2"""	184745		MGF		2208279, 1707188, 19375057	Standard	NM_003994		Approved	SCF, SF, Kitl, KL-1, FPH2	uc001tav.3	P21583	OTTHUMG00000169888	ENST00000228280.5:c.25C>T	12.37:g.88939633G>A	ENSP00000228280:p.Leu9Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	A0AV09|A8K2Q4|B7ZLM4|Q16487|Q68DZ2|Q7M4N8|Q9UQK7	Missense_Mutation	SNP	pfam_SCF,superfamily_4_helix_cytokine-like_core,pirsf_SCF	p.L9F	ENST00000228280.5	37	c.25	CCDS31868.1	12	.	.	.	.	.	.	.	.	.	.	G	13.67	2.305048	0.40795	.	.	ENSG00000049130	ENST00000228280;ENST00000347404	T;T	0.65732	-0.17;-0.17	5.66	1.83	0.25207	.	0.349592	0.32868	N	0.005545	T	0.34803	0.0910	N	0.08118	0	0.24281	N	0.995203	B;B	0.09022	0.001;0.002	B;B	0.09377	0.003;0.004	T	0.22871	-1.0204	10	0.87932	D	0	-1.4313	3.1767	0.06571	0.1414:0.0767:0.1408:0.6411	.	9;9	P21583-2;P21583	.;SCF_HUMAN	F	9	ENSP00000228280:L9F;ENSP00000054216:L9F	ENSP00000228280:L9F	L	-	1	0	KITLG	87463764	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	0.673000	0.25203	0.117000	0.18138	-0.262000	0.10625	CTC	KITLG	-	pfam_SCF,pirsf_SCF	ENSG00000049130		0.348	KITLG-002	KNOWN	basic|appris_principal|CCDS	protein_coding	KITLG	HGNC	protein_coding	OTTHUMT00000406424.2	34	0.00	0	G	NM_003994		88939633	88939633	-1	no_errors	ENST00000228280	ensembl	human	known	69_37n	missense	25	19.35	6	SNP	1.000	A
KPNA5	3841	genome.wustl.edu	37	6	117013507	117013507	+	Missense_Mutation	SNP	G	G	A			TCGA-A1-A0SF-01A-11D-A142-09	TCGA-A1-A0SF-10B-01D-A142-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b291200e-3c22-411a-85d0-fbe1570acda2	cc8ae8d4-315d-492a-84e9-7ed8630e9c70	g.chr6:117013507G>A	ENST00000368564.1	+	4	440	c.292G>A	c.(292-294)Gat>Aat	p.D98N	KPNA5_ENST00000356348.1_Missense_Mutation_p.D98N			O15131	IMA6_HUMAN	karyopherin alpha 5 (importin alpha 6)	95					cytokine-mediated signaling pathway (GO:0019221)|NLS-bearing protein import into nucleus (GO:0006607)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)	protein transporter activity (GO:0008565)	p.D98H(1)		breast(6)|kidney(2)|large_intestine(5)|lung(5)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	22		all_cancers(87;0.0314)|all_epithelial(87;0.0216)|Colorectal(196;0.234)		GBM - Glioblastoma multiforme(226;0.0298)|all cancers(137;0.0461)|OV - Ovarian serous cystadenocarcinoma(136;0.0513)|Epithelial(106;0.212)		TAATAATGCTGATCAACAGCT	0.279																																						dbGAP											1	Substitution - Missense(1)	large_intestine(1)											78.0	84.0	82.0					6																	117013507		2201	4281	6482	-	-	-	SO:0001583	missense	0			AF005361	CCDS5111.1	6q22.2	2013-02-14			ENSG00000196911	ENSG00000196911		"""Importins"", ""Armadillo repeat containing"""	6398	protein-coding gene	gene with protein product		604545				9395085	Standard	NM_002269		Approved	SRP6, IPOA6	uc003pxh.3	O15131	OTTHUMG00000015448	ENST00000368564.1:c.292G>A	6.37:g.117013507G>A	ENSP00000357552:p.Asp98Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RAI5|Q86X23	Missense_Mutation	SNP	pfam_Armadillo,pfam_Importin-a_IBB,pfam_HEAT,superfamily_ARM-type_fold,smart_Armadillo,pfscan_Armadillo,pfscan_Importin-a_IBB	p.D98N	ENST00000368564.1	37	c.292	CCDS5111.1	6	.	.	.	.	.	.	.	.	.	.	G	14.46	2.540985	0.45280	.	.	ENSG00000196911	ENST00000368564;ENST00000413340;ENST00000356348	T;T;T	0.30714	1.52;1.52;1.52	5.85	4.99	0.66335	Armadillo-like helical (1);Armadillo-type fold (1);	0.351990	0.27846	N	0.017613	T	0.09512	0.0234	N	0.25286	0.73	0.44024	D	0.996748	B	0.02656	0.0	B	0.04013	0.001	T	0.08289	-1.0729	10	0.27785	T	0.31	.	11.7495	0.51841	0.1409:0.0:0.8591:0.0	.	95	O15131	IMA5_HUMAN	N	98;95;98	ENSP00000357552:D98N;ENSP00000396791:D95N;ENSP00000348704:D98N	ENSP00000348704:D98N	D	+	1	0	KPNA5	117120200	1.000000	0.71417	0.931000	0.37212	0.993000	0.82548	6.344000	0.72991	1.483000	0.48342	0.484000	0.47621	GAT	KPNA5	-	superfamily_ARM-type_fold	ENSG00000196911		0.279	KPNA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KPNA5	HGNC	protein_coding	OTTHUMT00000041967.1	64	0.00	0	G	NM_002269		117013507	117013507	+1	no_errors	ENST00000356348	ensembl	human	known	69_37n	missense	51	20.31	13	SNP	1.000	A
KRT86	3892	genome.wustl.edu	37	12	52700027	52700027	+	Missense_Mutation	SNP	G	G	A			TCGA-A1-A0SF-01A-11D-A142-09	TCGA-A1-A0SF-10B-01D-A142-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b291200e-3c22-411a-85d0-fbe1570acda2	cc8ae8d4-315d-492a-84e9-7ed8630e9c70	g.chr12:52700027G>A	ENST00000423955.2	+	9	1388	c.1210G>A	c.(1210-1212)Gcc>Acc	p.A404T	KRT86_ENST00000544024.1_Missense_Mutation_p.A404T|RP11-845M18.6_ENST00000552441.1_RNA|KRT86_ENST00000293525.5_Missense_Mutation_p.A404T			O43790	KRT86_HUMAN	keratin 86	404	Coil 2.|Rod.					extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|keratin filament (GO:0045095)	structural molecule activity (GO:0005198)			breast(1)|cervix(1)|large_intestine(1)|lung(5)|ovary(1)|skin(1)	10				BRCA - Breast invasive adenocarcinoma(357;0.189)		CATCGAGATCGCCACCTACAG	0.622											OREG0021845	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP											0													67.0	69.0	69.0					12																	52700027		2203	4298	6501	-	-	-	SO:0001583	missense	0			X99142	CCDS41785.1	12q13	2013-01-16	2006-07-17	2006-07-17		ENSG00000170442		"""-"", ""Intermediate filaments type II, keratins (basic)"""	6463	protein-coding gene	gene with protein product	"""hard keratin type II 6"""	601928	"""keratin, hair, basic, 6 (monilethrix)"""	KRTHB6		9241275, 16831889	Standard	NM_002284		Approved	MNX, Hb6	uc001sad.3	O43790		ENST00000423955.2:c.1210G>A	12.37:g.52700027G>A	ENSP00000444533:p.Ala404Thr	Somatic	987	WXS	Illumina GAIIx	Phase_IV	P78387	Missense_Mutation	SNP	pfam_F,superfamily_Prefoldin,prints_Keratin_II	p.A404T	ENST00000423955.2	37	c.1210	CCDS41785.1	12	.	.	.	.	.	.	.	.	.	.	G	25.9	4.682529	0.88542	.	.	ENSG00000170442;ENSG00000170442;ENSG00000170442;ENSG00000258832	ENST00000544024;ENST00000423955;ENST00000293525;ENST00000553310	D;D;D	0.90900	-2.75;-2.75;-2.75	5.35	4.45	0.53987	Filament (1);Intermediate filament protein, conserved site (1);	0.000000	0.41500	U	0.000866	D	0.91831	0.7415	M	0.82517	2.595	0.35815	D	0.824175	P	0.45078	0.85	P	0.45232	0.474	D	0.94309	0.7544	10	0.62326	D	0.03	.	12.7685	0.57405	0.0775:0.0:0.9225:0.0	.	404	O43790	KRT86_HUMAN	T	404	ENSP00000443169:A404T;ENSP00000444533:A404T;ENSP00000293525:A404T	ENSP00000293525:A404T	A	+	1	0	AC021066.1;KRT86	50986294	1.000000	0.71417	1.000000	0.80357	0.910000	0.53928	7.898000	0.87363	1.217000	0.43442	0.555000	0.69702	GCC	AC021066.1	-	pfam_F	ENSG00000170442		0.622	KRT86-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRT86	Clone_based_ensembl_gene	protein_coding	OTTHUMT00000404911.1	39	0.00	0	G	NM_002284		52700027	52700027	+1	no_errors	ENST00000293525	ensembl	human	known	69_37n	missense	18	35.71	10	SNP	1.000	A
LAMA2	3908	genome.wustl.edu	37	6	129722392	129722392	+	Silent	SNP	C	C	T			TCGA-A1-A0SF-01A-11D-A142-09	TCGA-A1-A0SF-10B-01D-A142-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b291200e-3c22-411a-85d0-fbe1570acda2	cc8ae8d4-315d-492a-84e9-7ed8630e9c70	g.chr6:129722392C>T	ENST00000421865.2	+	38	5518	c.5469C>T	c.(5467-5469)agC>agT	p.S1823S		NM_000426.3|NM_001079823.1	NP_000417|NP_001073291.1	P24043	LAMA2_HUMAN	laminin, alpha 2	1823	Domain II and I.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|muscle organ development (GO:0007517)|myelination in peripheral nervous system (GO:0022011)|positive regulation of synaptic transmission, cholinergic (GO:0032224)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of embryonic development (GO:0045995)	basement membrane (GO:0005604)|dendritic spine (GO:0043197)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|laminin-1 complex (GO:0005606)|sarcolemma (GO:0042383)	structural molecule activity (GO:0005198)	p.S1823S(1)		NS(2)|biliary_tract(2)|breast(10)|central_nervous_system(1)|endometrium(18)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(35)|lung(84)|ovary(10)|prostate(4)|skin(9)|stomach(1)|upper_aerodigestive_tract(7)|urinary_tract(2)	194				OV - Ovarian serous cystadenocarcinoma(136;0.178)|all cancers(137;0.245)		CTGTTGAAAGCGGCAAACGAC	0.398																																						dbGAP											1	Substitution - coding silent(1)	large_intestine(1)											141.0	140.0	141.0					6																	129722392		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			Z26653	CCDS5138.1	6q22-q23	2014-09-17	2008-08-01		ENSG00000196569	ENSG00000196569		"""Laminins"""	6482	protein-coding gene	gene with protein product	"""merosin"", ""congenital muscular dystrophy"""	156225		LAMM		2185464, 8294519	Standard	NM_000426		Approved		uc003qbn.3	P24043	OTTHUMG00000015545	ENST00000421865.2:c.5469C>T	6.37:g.129722392C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q14736|Q5VUM2|Q93022	Silent	SNP	pfam_Laminin_G,pfam_EGF_laminin,pfam_Laminin_N,pfam_Laminin_I,pfam_Laminin_B_type_IV,pfam_Laminin_II,superfamily_ConA-like_lec_gl,superfamily_Galactose-bd-like,superfamily_t-SNARE,smart_Laminin_N,smart_EGF_laminin,smart_EGF-like,smart_Laminin_B_subgr,smart_Laminin_G,pfscan_Laminin_B_type_IV,pfscan_EGF_laminin,pfscan_Laminin_G,pfscan_Laminin_N	p.S1823	ENST00000421865.2	37	c.5469	CCDS5138.1	6																																																																																			LAMA2	-	pfam_Laminin_I	ENSG00000196569		0.398	LAMA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LAMA2	HGNC	protein_coding	OTTHUMT00000042180.1	31	0.00	0	C			129722392	129722392	+1	no_errors	ENST00000421865	ensembl	human	known	69_37n	silent	28	15.15	5	SNP	0.999	T
C17orf49	124944	genome.wustl.edu	37	17	6921010	6921010	+	IGR	DEL	C	C	-			TCGA-A1-A0SF-01A-11D-A142-09	TCGA-A1-A0SF-10B-01D-A142-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b291200e-3c22-411a-85d0-fbe1570acda2	cc8ae8d4-315d-492a-84e9-7ed8630e9c70	g.chr17:6921010delC	ENST00000439424.2	+	0	850				RP11-589P10.7_ENST00000572547.1_RNA|MIR497HG_ENST00000443997.1_RNA|MIR497HG_ENST00000572453.1_RNA|MIR497HG_ENST00000385194.1_RNA|MIR497HG_ENST00000385056.1_RNA	NM_001142798.2|NM_174893.3	NP_001136270.1|NP_777553.1	Q8IXM2	BAP18_HUMAN	chromosome 17 open reading frame 49						chromatin modification (GO:0016568)	MLL1 complex (GO:0071339)|NURF complex (GO:0016589)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)			kidney(1)|large_intestine(2)|ovary(1)	4						GCTGCTAGAGCCAGGGAAGCT	0.542																																						dbGAP											0													28.0	28.0	28.0					17																	6921010		1568	3582	5150	-	-	-	SO:0001628	intergenic_variant	0			AK055800	CCDS32542.1, CCDS45595.1, CCDS45596.1	17p13.1	2013-02-11			ENSG00000258315	ENSG00000258315			28737	protein-coding gene	gene with protein product	"""BPTF associated protein of 18 kDa"", ""human embryo lung cellular protein interacting with SARS-CoV nsp-10"""						Standard	NM_174893		Approved	MGC49942, BAP18, HEPIS		Q8IXM2	OTTHUMG00000170147		17.37:g.6921010delC		Somatic		WXS	Illumina GAIIx	Phase_IV	B4DIV3|C9J4G0|E9PB29	RNA	DEL	-	NULL	ENST00000439424.2	37	NULL	CCDS32542.1	17																																																																																			MIR195	-	-	ENSG00000207929		0.542	C17orf49-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MIR195	HGNC	protein_coding	OTTHUMT00000407666.1	18	0.00	0	C	NM_174893		6921010	6921010	-1	no_errors	ENST00000385194	ensembl	human	known	69_37n	rna	3	40.00	2	DEL	1.000	-
KMT2C	58508	genome.wustl.edu	37	7	151879568	151879568	+	Missense_Mutation	SNP	G	G	A			TCGA-A1-A0SF-01A-11D-A142-09	TCGA-A1-A0SF-10B-01D-A142-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b291200e-3c22-411a-85d0-fbe1570acda2	cc8ae8d4-315d-492a-84e9-7ed8630e9c70	g.chr7:151879568G>A	ENST00000262189.6	-	36	5595	c.5377C>T	c.(5377-5379)Ctt>Ttt	p.L1793F	KMT2C_ENST00000355193.2_Missense_Mutation_p.L1793F	NM_170606.2	NP_733751.2	Q8NEZ4	KMT2C_HUMAN	lysine (K)-specific methyltransferase 2C	1793	Gln-rich.				histone H3-K4 methylation (GO:0051568)|intracellular signal transduction (GO:0035556)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)										TGCACCAGAAGATGCTGAGAA	0.458																																						dbGAP											0													136.0	136.0	136.0					7																	151879568		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF264750	CCDS5931.1	7q36	2013-05-09	2013-05-09	2013-05-09	ENSG00000055609	ENSG00000055609		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	13726	protein-coding gene	gene with protein product		606833	"""myeloid/lymphoid or mixed-lineage leukemia 3"""	MLL3		10819331	Standard	XM_005250026		Approved	KIAA1506, HALR		Q8NEZ4	OTTHUMG00000150553	ENST00000262189.6:c.5377C>T	7.37:g.151879568G>A	ENSP00000262189:p.Leu1793Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8NC02|Q8NDF6|Q9H9P4|Q9NR13|Q9P222|Q9UDR7	Missense_Mutation	SNP	pfam_Znf_PHD-finger,pfam_SET_dom,pfam_FYrich_C,pfam_FYrich_N,superfamily_Znf_FYVE_PHD,superfamily_HMG_superfamily,smart_Znf_PHD,smart_Znf_RING,smart_HMG_superfamily,smart_FYrich_N,smart_FYrich_C,smart_SET_dom,smart_Post-SET_dom,pfscan_SET_dom,pfscan_Post-SET_dom,pfscan_Znf_DHHC_palmitoyltrfase,pfscan_Znf_PHD-finger,pfscan_Znf_RING	p.L1793F	ENST00000262189.6	37	c.5377	CCDS5931.1	7	.	.	.	.	.	.	.	.	.	.	G	12.76	2.033152	0.35893	.	.	ENSG00000055609	ENST00000262189;ENST00000355193	D;D	0.86230	-2.09;-2.09	5.4	4.51	0.55191	.	0.000000	0.39759	N	0.001275	D	0.88303	0.6400	L	0.29908	0.895	0.40579	D	0.98137	P;D	0.65815	0.938;0.995	P;P	0.61201	0.548;0.885	D	0.88620	0.3162	10	0.42905	T	0.14	.	16.1232	0.81375	0.0:0.1341:0.8659:0.0	.	1793;854	Q8NEZ4;Q8NEZ4-2	MLL3_HUMAN;.	F	1793	ENSP00000262189:L1793F;ENSP00000347325:L1793F	ENSP00000262189:L1793F	L	-	1	0	MLL3	151510501	0.540000	0.26410	0.003000	0.11579	0.989000	0.77384	3.492000	0.53259	1.266000	0.44231	0.557000	0.71058	CTT	MLL3	-	NULL	ENSG00000055609		0.458	KMT2C-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	MLL3	HGNC	protein_coding	OTTHUMT00000318887.3	19	0.00	0	G			151879568	151879568	-1	no_errors	ENST00000355193	ensembl	human	known	69_37n	missense	20	25.93	7	SNP	0.058	A
MTO1	25821	genome.wustl.edu	37	6	74176211	74176211	+	Splice_Site	SNP	G	G	A			TCGA-A1-A0SF-01A-11D-A142-09	TCGA-A1-A0SF-10B-01D-A142-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b291200e-3c22-411a-85d0-fbe1570acda2	cc8ae8d4-315d-492a-84e9-7ed8630e9c70	g.chr6:74176211G>A	ENST00000370300.4	+	3	507		c.e3-1		MTO1_ENST00000518210.1_Splice_Site|MTO1_ENST00000498286.1_Splice_Site|MTO1_ENST00000370305.1_Splice_Site|MTO1_ENST00000415954.2_Splice_Site|RNU6-975P_ENST00000384296.1_RNA	NM_012123.3|NM_133645.2	NP_036255.2|NP_598400.1	Q9Y2Z2	MTO1_HUMAN	mitochondrial tRNA translation optimization 1						mitochondrial tRNA wobble uridine modification (GO:0070899)|oxidation-reduction process (GO:0055114)	mitochondrion (GO:0005739)	flavin adenine dinucleotide binding (GO:0050660)|poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(8)|ovary(3)|pancreas(1)|prostate(3)|skin(4)|stomach(1)	27						TCTTTTGACAGAAAGAAATCT	0.398																																						dbGAP											0													97.0	91.0	93.0					6																	74176211		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			AF132937	CCDS4979.1, CCDS34485.1, CCDS47452.1	6q14.1	2013-05-07	2013-05-07		ENSG00000135297	ENSG00000135297			19261	protein-coding gene	gene with protein product		614667	"""mitochondrial translation optimization 1 homolog (S. cerevisiae)"""			12011058, 22608499	Standard	NM_012123		Approved		uc003pgy.4	Q9Y2Z2	OTTHUMG00000015032	ENST00000370300.4:c.418-1G>A	6.37:g.74176211G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B3KQB5|Q5SWL2|Q5SWL3|Q5SWL4|Q8NDN7|Q8WZ57|Q96FE6|Q9BS06	Splice_Site	SNP	-	e3-1	ENST00000370300.4	37	c.418-1	CCDS4979.1	6	.	.	.	.	.	.	.	.	.	.	G	21.2	4.111417	0.77210	.	.	ENSG00000135297	ENST00000415954;ENST00000498286;ENST00000357845;ENST00000370305;ENST00000370300	.	.	.	5.69	5.69	0.88448	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.3409	0.90304	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	MTO1	74232932	1.000000	0.71417	1.000000	0.80357	0.916000	0.54674	6.313000	0.72844	2.843000	0.97960	0.591000	0.81541	.	MTO1	-	-	ENSG00000135297		0.398	MTO1-003	KNOWN	basic|CCDS	protein_coding	MTO1	HGNC	protein_coding	OTTHUMT00000041215.2	48	0.00	0	G	NM_012123	Intron	74176211	74176211	+1	no_errors	ENST00000415954	ensembl	human	known	69_37n	splice_site	48	14.29	8	SNP	1.000	A
MUC16	94025	genome.wustl.edu	37	19	9072222	9072222	+	Missense_Mutation	SNP	C	C	A			TCGA-A1-A0SF-01A-11D-A142-09	TCGA-A1-A0SF-10B-01D-A142-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b291200e-3c22-411a-85d0-fbe1570acda2	cc8ae8d4-315d-492a-84e9-7ed8630e9c70	g.chr19:9072222C>A	ENST00000397910.4	-	3	15427	c.15224G>T	c.(15223-15225)gGc>gTc	p.G5075V		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	5077	Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						CTTCACTAGGCCAGAGGTGAG	0.468																																						dbGAP											0													152.0	137.0	142.0					19																	9072222		1924	4131	6055	-	-	-	SO:0001583	missense	0			AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.15224G>T	19.37:g.9072222C>A	ENSP00000381008:p.Gly5075Val	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6ZQW5|Q96RK2	Missense_Mutation	SNP	pfam_SEA,smart_SEA,pfscan_SEA	p.G5075V	ENST00000397910.4	37	c.15224	CCDS54212.1	19	.	.	.	.	.	.	.	.	.	.	c	5.072	0.198879	0.09652	.	.	ENSG00000181143	ENST00000397910	T	0.39997	1.05	1.84	-0.695	0.11291	.	.	.	.	.	T	0.40743	0.1129	L	0.52573	1.65	.	.	.	D	0.65815	0.995	P	0.51945	0.685	T	0.46400	-0.9194	8	0.87932	D	0	.	3.0972	0.06313	0.0:0.5279:0.2856:0.1865	.	5075	B5ME49	.	V	5075	ENSP00000381008:G5075V	ENSP00000381008:G5075V	G	-	2	0	MUC16	8933222	0.000000	0.05858	0.000000	0.03702	0.393000	0.30537	-0.485000	0.06520	-0.062000	0.13088	0.282000	0.19409	GGC	MUC16	-	NULL	ENSG00000181143		0.468	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MUC16	HGNC	protein_coding	OTTHUMT00000402806.1	47	0.00	0	C	NM_024690		9072222	9072222	-1	no_errors	ENST00000397910	ensembl	human	known	69_37n	missense	36	23.40	11	SNP	0.000	A
MUC5B	727897	genome.wustl.edu	37	11	1266400	1266400	+	Missense_Mutation	SNP	C	C	A	rs201537972		TCGA-A1-A0SF-01A-11D-A142-09	TCGA-A1-A0SF-10B-01D-A142-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b291200e-3c22-411a-85d0-fbe1570acda2	cc8ae8d4-315d-492a-84e9-7ed8630e9c70	g.chr11:1266400C>A	ENST00000529681.1	+	31	8348	c.8290C>A	c.(8290-8292)Ccc>Acc	p.P2764T	RP11-532E4.2_ENST00000532061.2_RNA|MUC5B_ENST00000447027.1_Missense_Mutation_p.P2767T	NM_002458.2	NP_002449.2	Q9HC84	MUC5B_HUMAN	mucin 5B, oligomeric mucus/gel-forming	2764	7 X Cys-rich subdomain repeats.|Thr-rich.			Missing (in Ref. 6; AAB61398). {ECO:0000305}.	cellular protein metabolic process (GO:0044267)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to glucocorticoid stimulus (GO:0071385)|cellular response to retinoic acid (GO:0071300)|epithelial cell differentiation (GO:0030855)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|response to lipopolysaccharide (GO:0032496)|response to ozone (GO:0010193)|response to sulfur dioxide (GO:0010477)|response to vitamin A (GO:0033189)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)				cervix(2)|endometrium(36)|kidney(9)|lung(89)|urinary_tract(1)	137		all_cancers(49;6.97e-08)|all_epithelial(84;3.45e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00141)|Lung(200;0.0853)|LUSC - Lung squamous cell carcinoma(625;0.1)		CCCCAGCAGTCCCCACACGGT	0.672																																						dbGAP											0													4.0	6.0	5.0					11																	1266400		1551	3613	5164	-	-	-	SO:0001583	missense	0			U95031, AF086604	CCDS44515.1, CCDS44515.2	11p15.5	2007-01-19	2006-03-14			ENSG00000117983		"""Mucins"""	7516	protein-coding gene	gene with protein product		600770	"""mucin 5, subtype B, tracheobronchial"""	MUC5		9804771	Standard	NM_002458		Approved	MG1	uc001lta.3	Q9HC84		ENST00000529681.1:c.8290C>A	11.37:g.1266400C>A	ENSP00000436812:p.Pro2764Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	O00447|O00573|O14985|O15494|O95291|O95451|Q14881|Q7M4S5|Q99552|Q9UE28	Missense_Mutation	SNP	pfam_VWF_type-D,pfam_Unchr_dom_Cys-rich,pfam_TIL_dom,pfam_VWF_C,superfamily_TIL_dom,smart_VWF_type-D,smart_Unchr_dom_Cys-rich,smart_VWC_out,smart_VWF_C,smart_Cys_knot_C,pfscan_Cys_knot_C,pfscan_VWF_C	p.P2767T	ENST00000529681.1	37	c.8299	CCDS44515.2	11	.	.	.	.	.	.	.	.	.	.	-	1.801	-0.476960	0.04414	.	.	ENSG00000117983	ENST00000529681;ENST00000447027;ENST00000349637;ENST00000406844	T;T	0.22134	1.97;2.15	0.97	0.97	0.19692	.	.	.	.	.	T	0.16769	0.0403	L	0.56769	1.78	0.09310	N	1	B;P	0.51933	0.012;0.949	B;B	0.37304	0.001;0.246	T	0.22695	-1.0209	9	0.87932	D	0	.	5.2452	0.15493	0.0:1.0:0.0:0.0	.	3347;2767	A7Y9J9;E9PBJ0	.;.	T	2764;2767;2736;2724	ENSP00000436812:P2764T;ENSP00000415793:P2767T	ENSP00000343037:P2736T	P	+	1	0	MUC5B	1222976	0.068000	0.21057	0.004000	0.12327	0.019000	0.09904	0.746000	0.26275	0.808000	0.34231	0.195000	0.17529	CCC	MUC5B	-	NULL	ENSG00000117983		0.672	MUC5B-002	NOVEL	basic|appris_candidate|CCDS	protein_coding	MUC5B	HGNC	protein_coding	OTTHUMT00000390041.2	28	0.00	0	C	XM_001126093		1266400	1266400	+1	no_errors	ENST00000447027	ensembl	human	known	69_37n	missense	27	25.00	9	SNP	0.004	A
PHF13	148479	genome.wustl.edu	37	1	6676836	6676836	+	Missense_Mutation	SNP	A	A	C			TCGA-A1-A0SF-01A-11D-A142-09	TCGA-A1-A0SF-10B-01D-A142-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b291200e-3c22-411a-85d0-fbe1570acda2	cc8ae8d4-315d-492a-84e9-7ed8630e9c70	g.chr1:6676836A>C	ENST00000377648.4	+	2	441	c.59A>C	c.(58-60)aAg>aCg	p.K20T	KLHL21_ENST00000467612.1_5'Flank|KLHL21_ENST00000463043.1_5'Flank|PHF13_ENST00000495385.1_Intron	NM_153812.2	NP_722519.2	Q86YI8	PHF13_HUMAN	PHD finger protein 13	20			K -> E (in dbSNP:rs17853850). {ECO:0000269|PubMed:15489334}.		chromatin modification (GO:0016568)|chromosome segregation (GO:0007059)|mitotic cell cycle (GO:0000278)|mitotic chromosome condensation (GO:0007076)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|methylated histone binding (GO:0035064)|zinc ion binding (GO:0008270)			endometrium(3)|large_intestine(1)|lung(3)	7	Ovarian(185;0.0212)|all_lung(157;0.154)	all_cancers(23;1.46e-33)|all_epithelial(116;9.26e-22)|all_lung(118;7.57e-07)|Lung NSC(185;4.26e-06)|Breast(487;0.000353)|Renal(390;0.0007)|Colorectal(325;0.00104)|Hepatocellular(190;0.00308)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0443)		Colorectal(212;1.19e-07)|COAD - Colon adenocarcinoma(227;1.3e-05)|Kidney(185;4.88e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000501)|KIRC - Kidney renal clear cell carcinoma(229;0.000871)|STAD - Stomach adenocarcinoma(132;0.0165)|READ - Rectum adenocarcinoma(331;0.0642)		CCCAGTTGCAAGAGGCGCAGG	0.478																																						dbGAP											0													124.0	110.0	114.0					1																	6676836		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK027492	CCDS85.1	1p36.23	2013-01-28			ENSG00000116273	ENSG00000116273		"""Zinc fingers, PHD-type"""	22983	protein-coding gene	gene with protein product							Standard	NM_153812		Approved	MGC43399	uc001aob.4	Q86YI8	OTTHUMG00000001439	ENST00000377648.4:c.59A>C	1.37:g.6676836A>C	ENSP00000366876:p.Lys20Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KUQ7|Q59FB6|Q5TH65|Q8N551|Q9UJP2	Missense_Mutation	SNP	pfam_Znf_PHD-finger,superfamily_Znf_FYVE_PHD,smart_Znf_PHD	p.K20T	ENST00000377648.4	37	c.59	CCDS85.1	1	.	.	.	.	.	.	.	.	.	.	A	15.16	2.749605	0.49257	.	.	ENSG00000116273	ENST00000377648	T	0.43688	0.94	4.98	4.98	0.66077	.	0.265083	0.35708	N	0.003031	T	0.34542	0.0901	L	0.58101	1.795	0.44477	D	0.997418	P	0.37466	0.596	B	0.32864	0.154	T	0.36407	-0.9749	10	0.87932	D	0	-2.6625	6.6217	0.22806	0.8269:0.0:0.1731:0.0	.	20	Q86YI8	PHF13_HUMAN	T	20	ENSP00000366876:K20T	ENSP00000366876:K20T	K	+	2	0	PHF13	6599423	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	2.219000	0.42899	1.981000	0.57761	0.533000	0.62120	AAG	PHF13	-	NULL	ENSG00000116273		0.478	PHF13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PHF13	HGNC	protein_coding	OTTHUMT00000004201.1	54	0.00	0	A	NM_153812		6676836	6676836	+1	no_errors	ENST00000377648	ensembl	human	known	69_37n	missense	34	26.09	12	SNP	1.000	C
PLXNA4	91584	genome.wustl.edu	37	7	131831430	131831430	+	Missense_Mutation	SNP	C	C	T			TCGA-A1-A0SF-01A-11D-A142-09	TCGA-A1-A0SF-10B-01D-A142-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b291200e-3c22-411a-85d0-fbe1570acda2	cc8ae8d4-315d-492a-84e9-7ed8630e9c70	g.chr7:131831430C>T	ENST00000359827.3	-	28	5856	c.4894G>A	c.(4894-4896)Gac>Aac	p.D1632N	PLXNA4_ENST00000321063.4_Missense_Mutation_p.D1632N			Q9HCM2	PLXA4_HUMAN	plexin A4	1632					anterior commissure morphogenesis (GO:0021960)|axon guidance (GO:0007411)|chemorepulsion of branchiomotor axon (GO:0021793)|facial nerve structural organization (GO:0021612)|glossopharyngeal nerve morphogenesis (GO:0021615)|postganglionic parasympathetic nervous system development (GO:0021784)|regulation of axon extension involved in axon guidance (GO:0048841)|regulation of negative chemotaxis (GO:0050923)|semaphorin-plexin signaling pathway (GO:0071526)|semaphorin-plexin signaling pathway involved in axon guidance (GO:1902287)|sympathetic nervous system development (GO:0048485)|trigeminal nerve structural organization (GO:0021637)|vagus nerve morphogenesis (GO:0021644)	integral component of membrane (GO:0016021)|intracellular (GO:0005622)|plasma membrane (GO:0005886)|semaphorin receptor complex (GO:0002116)	semaphorin receptor activity (GO:0017154)			NS(1)|breast(1)|endometrium(3)|kidney(4)|large_intestine(14)|lung(17)|ovary(1)|prostate(2)|skin(1)|stomach(1)	45						CGGAGGCTGTCGGGGCTGCCC	0.567																																						dbGAP											0													130.0	144.0	139.0					7																	131831430		2175	4291	6466	-	-	-	SO:0001583	missense	0			AB046770, AK123428	CCDS5826.1, CCDS43646.1, CCDS43647.1	7q32.3	2007-09-26	2007-09-26	2007-09-26	ENSG00000221866	ENSG00000221866		"""Plexins"""	9102	protein-coding gene	gene with protein product		604280	"""plexin A4, A"", ""plexin A4, B"""	PLXNA4A, PLXNA4B			Standard	NM_181775		Approved	KIAA1550, DKFZp434G0625PRO34003, FAYV2820	uc003vra.4	Q9HCM2	OTTHUMG00000155108	ENST00000359827.3:c.4894G>A	7.37:g.131831430C>T	ENSP00000352882:p.Asp1632Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	A4D1N6|E9PAM2|Q6UWC6|Q6ZW89|Q8N969|Q8ND00|Q8NEN3|Q9NTD4	Missense_Mutation	SNP	pfam_Plexin_cytoplasmic_RasGAP_dom,pfam_Semaphorin/CD100_Ag,pfam_IPT_TIG_rcpt,pfam_Plexin_repeat,superfamily_Semaphorin/CD100_Ag,superfamily_Rho_GTPase_activation_prot,superfamily_Ig_E-set,superfamily_Plexin-like_fold,smart_Semaphorin/CD100_Ag,smart_Plexin-like,smart_IPT_TIG_rcpt,pfscan_Semaphorin/CD100_Ag	p.D1632N	ENST00000359827.3	37	c.4894	CCDS43646.1	7	.	.	.	.	.	.	.	.	.	.	C	36	5.715818	0.96830	.	.	ENSG00000221866	ENST00000321063;ENST00000359827	T;T	0.11604	2.76;2.76	5.8	5.8	0.92144	Plexin, cytoplasmic RasGAP domain (1);Rho GTPase activation protein (1);	0.292545	0.41823	D	0.000807	T	0.36771	0.0979	M	0.77313	2.365	0.80722	D	1	D	0.89917	1.0	D	0.74023	0.982	T	0.01566	-1.1323	10	0.42905	T	0.14	.	20.0537	0.97638	0.0:1.0:0.0:0.0	.	1632	Q9HCM2	PLXA4_HUMAN	N	1632	ENSP00000323194:D1632N;ENSP00000352882:D1632N	ENSP00000323194:D1632N	D	-	1	0	PLXNA4	131481970	1.000000	0.71417	0.972000	0.41901	0.956000	0.61745	7.670000	0.83925	2.758000	0.94735	0.561000	0.74099	GAC	PLXNA4	-	pfam_Plexin_cytoplasmic_RasGAP_dom,superfamily_Rho_GTPase_activation_prot	ENSG00000221866		0.567	PLXNA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLXNA4	HGNC	protein_coding	OTTHUMT00000338422.2	39	0.00	0	C	NM_181775		131831430	131831430	-1	no_errors	ENST00000321063	ensembl	human	known	69_37n	missense	47	12.96	7	SNP	1.000	T
PPFIBP2	8495	genome.wustl.edu	37	11	7672087	7672087	+	Missense_Mutation	SNP	C	C	T			TCGA-A1-A0SF-01A-11D-A142-09	TCGA-A1-A0SF-10B-01D-A142-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b291200e-3c22-411a-85d0-fbe1570acda2	cc8ae8d4-315d-492a-84e9-7ed8630e9c70	g.chr11:7672087C>T	ENST00000299492.4	+	22	2526	c.2138C>T	c.(2137-2139)tCa>tTa	p.S713L	PPFIBP2_ENST00000533792.1_Missense_Mutation_p.S555L|PPFIBP2_ENST00000530181.1_Missense_Mutation_p.S570L|PPFIBP2_ENST00000530582.1_3'UTR|PPFIBP2_ENST00000528883.1_Missense_Mutation_p.S601L	NM_003621.3	NP_003612	Q8ND30	LIPB2_HUMAN	PTPRF interacting protein, binding protein 2 (liprin beta 2)	713					cell-matrix adhesion (GO:0007160)|signal transduction (GO:0007165)	extracellular space (GO:0005615)|intracellular (GO:0005622)|presynaptic active zone (GO:0048786)	DNA binding (GO:0003677)|integrase activity (GO:0008907)			breast(8)|cervix(1)|kidney(1)|large_intestine(8)|lung(8)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	32				Epithelial(150;2.01e-07)|BRCA - Breast invasive adenocarcinoma(625;0.236)		CTTTCTCCTTCAGAAGTTGTA	0.522																																						dbGAP											0													173.0	163.0	166.0					11																	7672087		2201	4296	6497	-	-	-	SO:0001583	missense	0			AF034803	CCDS31419.1, CCDS58116.1, CCDS58117.1	11p15.4	2013-01-10			ENSG00000166387	ENSG00000166387		"""Sterile alpha motif (SAM) domain containing"""	9250	protein-coding gene	gene with protein product		603142				9624153	Standard	NM_003621		Approved	Cclp1	uc001mfj.5	Q8ND30	OTTHUMG00000165617	ENST00000299492.4:c.2138C>T	11.37:g.7672087C>T	ENSP00000299492:p.Ser713Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	B7Z433|E9PK77|O75337|Q8WW26	Missense_Mutation	SNP	pfam_SAM_2,pfam_SAM_type1,pfam_Integrase_Tn916-type_DNA-bd_N,superfamily_SAM/pointed,smart_SAM,pfscan_SAM	p.S713L	ENST00000299492.4	37	c.2138	CCDS31419.1	11	.	.	.	.	.	.	.	.	.	.	C	16.51	3.143006	0.57044	.	.	ENSG00000166387	ENST00000299492;ENST00000537211;ENST00000533792;ENST00000541115;ENST00000528883;ENST00000530181	T;T;T;T	0.43294	0.95;0.95;0.95;0.95	5.35	5.35	0.76521	Sterile alpha motif/pointed domain (2);	0.000000	0.64402	D	0.000016	T	0.52289	0.1725	N	0.25647	0.755	0.47819	D	0.999523	D;P;D;D;D;D	0.89917	0.999;0.811;1.0;0.997;1.0;0.999	D;B;D;P;D;D	0.76071	0.947;0.164;0.987;0.864;0.952;0.954	T	0.49570	-0.8926	10	0.49607	T	0.09	-12.3071	16.9412	0.86218	0.0:1.0:0.0:0.0	.	601;601;636;555;570;713	E9PK77;B7Z433;F5GWB0;E9PP16;E9PMU1;Q8ND30	.;.;.;.;.;LIPB2_HUMAN	L	713;54;555;636;601;570	ENSP00000299492:S713L;ENSP00000436498:S555L;ENSP00000435469:S601L;ENSP00000437321:S570L	ENSP00000299492:S713L	S	+	2	0	PPFIBP2	7628663	1.000000	0.71417	1.000000	0.80357	0.290000	0.27261	5.548000	0.67255	2.941000	0.99782	0.655000	0.94253	TCA	PPFIBP2	-	superfamily_SAM/pointed	ENSG00000166387		0.522	PPFIBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPFIBP2	HGNC	protein_coding	OTTHUMT00000385345.2	70	0.00	0	C	NM_003621		7672087	7672087	+1	no_errors	ENST00000299492	ensembl	human	known	69_37n	missense	52	23.53	16	SNP	1.000	T
PROP1	5626	genome.wustl.edu	37	5	177420032	177420032	+	Missense_Mutation	SNP	C	C	T			TCGA-A1-A0SF-01A-11D-A142-09	TCGA-A1-A0SF-10B-01D-A142-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b291200e-3c22-411a-85d0-fbe1570acda2	cc8ae8d4-315d-492a-84e9-7ed8630e9c70	g.chr5:177420032C>T	ENST00000308304.2	-	3	667	c.359G>A	c.(358-360)cGc>cAc	p.R120H		NM_006261.4	NP_006252	O75360	PROP1_HUMAN	PROP paired-like homeobox 1	120			R -> C (in CPHD2; familial). {ECO:0000269|PubMed:9462743, ECO:0000269|PubMed:9768691}.		blood vessel development (GO:0001568)|canonical Wnt signaling pathway (GO:0060070)|cell migration (GO:0016477)|central nervous system development (GO:0007417)|dorsal/ventral pattern formation (GO:0009953)|hypophysis morphogenesis (GO:0048850)|hypothalamus cell differentiation (GO:0021979)|negative regulation of apoptotic process (GO:0043066)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|somatotropin secreting cell differentiation (GO:0060126)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|sequence-specific DNA binding (GO:0043565)			endometrium(1)|large_intestine(2)|lung(9)|stomach(1)	13	all_cancers(89;0.00176)|Renal(175;0.000269)|Lung NSC(126;0.00858)|all_lung(126;0.0139)	all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			CTTAGCTCTGCGGTTCTGGAA	0.562																																						dbGAP											0			GRCh37	CM024247	PROP1	M							98.0	91.0	93.0					5																	177420032		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF076215	CCDS4430.1	5q35.3	2011-06-20	2007-07-12		ENSG00000175325	ENSG00000175325		"""Homeoboxes / PRD class"""	9455	protein-coding gene	gene with protein product		601538	"""prophet of Pit1, paired-like homeodomain transcription factor"""			9462743	Standard	NM_006261		Approved		uc003mif.1	O75360	OTTHUMG00000130887	ENST00000308304.2:c.359G>A	5.37:g.177420032C>T	ENSP00000311290:p.Arg120His	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Homeodomain,superfamily_Homeodomain-like,smart_Homeodomain,pfscan_Homeodomain,prints_HTH_motif	p.R120H	ENST00000308304.2	37	c.359	CCDS4430.1	5	.	.	.	.	.	.	.	.	.	.	.	19.78	3.890281	0.72524	.	.	ENSG00000175325	ENST00000308304	D	0.97529	-4.42	2.82	2.82	0.32997	Homeodomain-related (1);Helix-turn-helix motif, lambda-like repressor (1);Homeobox (3);Homeodomain-like (1);Homeobox, conserved site (1);	0.000000	0.42294	D	0.000723	D	0.98798	0.9595	H	0.97051	3.93	0.51233	D	0.999919	D	0.89917	1.0	D	0.87578	0.998	D	0.98701	1.0700	10	0.87932	D	0	-25.6122	11.3851	0.49780	0.0:1.0:0.0:0.0	.	120	O75360	PROP1_HUMAN	H	120	ENSP00000311290:R120H	ENSP00000311290:R120H	R	-	2	0	PROP1	177352638	1.000000	0.71417	1.000000	0.80357	0.913000	0.54294	4.336000	0.59304	1.601000	0.50113	0.313000	0.20887	CGC	PROP1	-	pfam_Homeodomain,superfamily_Homeodomain-like,smart_Homeodomain,pfscan_Homeodomain,prints_HTH_motif	ENSG00000175325		0.562	PROP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PROP1	HGNC	protein_coding	OTTHUMT00000253472.1	50	0.00	0	C	NM_006261		177420032	177420032	-1	no_errors	ENST00000308304	ensembl	human	known	69_37n	missense	45	32.84	22	SNP	1.000	T
PTPRD	5789	genome.wustl.edu	37	9	8471022	8471022	+	Silent	SNP	C	C	T			TCGA-A1-A0SF-01A-11D-A142-09	TCGA-A1-A0SF-10B-01D-A142-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b291200e-3c22-411a-85d0-fbe1570acda2	cc8ae8d4-315d-492a-84e9-7ed8630e9c70	g.chr9:8471022C>T	ENST00000381196.4	-	28	4020	c.3477G>A	c.(3475-3477)gaG>gaA	p.E1159E	PTPRD_ENST00000355233.5_Silent_p.E748E|PTPRD_ENST00000486161.1_Silent_p.E748E|PTPRD_ENST00000397606.3_Silent_p.E738E|PTPRD_ENST00000397617.3_Silent_p.E738E|PTPRD_ENST00000540109.1_Silent_p.E1159E|PTPRD_ENST00000356435.5_Silent_p.E1159E|PTPRD_ENST00000397611.3_Silent_p.E745E|PTPRD_ENST00000537002.1_Silent_p.E745E|PTPRD_ENST00000360074.4_Silent_p.E1146E|PTPRD_ENST00000358503.5_Silent_p.E1137E	NM_002839.3	NP_002830.1	P23468	PTPRD_HUMAN	protein tyrosine phosphatase, receptor type, D	1159					heterophilic cell-cell adhesion (GO:0007157)|neuron differentiation (GO:0030182)|peptidyl-tyrosine dephosphorylation (GO:0035335)|phosphate-containing compound metabolic process (GO:0006796)|positive regulation of dendrite morphogenesis (GO:0050775)|presynaptic membrane assembly (GO:0097105)|protein dephosphorylation (GO:0006470)|transmembrane receptor protein tyrosine phosphatase signaling pathway (GO:0007185)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	cell adhesion molecule binding (GO:0050839)|receptor binding (GO:0005102)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			NS(1)|breast(7)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(22)|liver(1)|lung(83)|ovary(4)|pancreas(1)|prostate(7)|skin(19)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(1)	168		all_cancers(3;3.38e-95)|all_epithelial(3;2.84e-91)|all_lung(3;7.3e-56)|Lung NSC(3;1.82e-52)|Renal(3;3.42e-19)|all_hematologic(3;0.000134)|all_neural(3;0.00409)|Acute lymphoblastic leukemia(23;0.0069)|Melanoma(3;0.0121)|Myeloproliferative disorder(4;0.0122)|Medulloblastoma(3;0.0144)|Lung SC(3;0.0301)|Ovarian(56;0.0694)|Hepatocellular(3;0.0824)		all cancers(1;3.38e-12)|Epithelial(1;2.12e-09)|STAD - Stomach adenocarcinoma(1;1.29e-07)|KIRC - Kidney renal clear cell carcinoma(3;5.49e-07)|Kidney(3;6.36e-07)|GBM - Glioblastoma multiforme(50;9.05e-05)|Lung(1;0.000189)|BRCA - Breast invasive adenocarcinoma(1;0.00178)|LUSC - Lung squamous cell carcinoma(1;0.0115)|LUAD - Lung adenocarcinoma(58;0.119)		CATCTGGACTCTCCCATGGCT	0.398										TSP Lung(15;0.13)																												dbGAP											0													160.0	153.0	156.0					9																	8471022		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			X54133	CCDS6472.1, CCDS43786.1, CCDS6472.2, CCDS55288.1, CCDS55289.1, CCDS55290.1, CCDS75813.1	9p24.1-p23	2013-02-11			ENSG00000153707	ENSG00000153707		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	9668	protein-coding gene	gene with protein product		601598				7896816, 8355697	Standard	NM_002839		Approved	PTPD, HPTP	uc003zkk.3	P23468	OTTHUMG00000021005	ENST00000381196.4:c.3477G>A	9.37:g.8471022C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B1ALA0|F5GWT7|Q3KPJ0|Q3KPJ1|Q3KPJ2	Silent	SNP	pfam_Tyr_Pase_rcpt/non-rcpt,pfam_Fibronectin_type3,pfam_Ig_I-set,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,smart_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,pfscan_Fibronectin_type3,pfscan_Tyr/Dual-specificity_Pase,pfscan_Tyr_Pase_rcpt/non-rcpt,pfscan_Ig-like,prints_Tyr_Pase_rcpt/non-rcpt	p.E1159	ENST00000381196.4	37	c.3477	CCDS43786.1	9																																																																																			PTPRD	-	NULL	ENSG00000153707		0.398	PTPRD-002	KNOWN	basic|appris_principal|CCDS	protein_coding	PTPRD	HGNC	protein_coding	OTTHUMT00000055395.3	85	0.00	0	C			8471022	8471022	-1	no_errors	ENST00000356435	ensembl	human	known	69_37n	silent	58	14.71	10	SNP	1.000	T
RIT2	6014	genome.wustl.edu	37	18	40323522	40323522	+	Missense_Mutation	SNP	C	C	T	rs77976328		TCGA-A1-A0SF-01A-11D-A142-09	TCGA-A1-A0SF-10B-01D-A142-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b291200e-3c22-411a-85d0-fbe1570acda2	cc8ae8d4-315d-492a-84e9-7ed8630e9c70	g.chr18:40323522C>T	ENST00000326695.5	-	5	761	c.590G>A	c.(589-591)aGa>aAa	p.R197K	RIT2_ENST00000590910.1_3'UTR|RIT2_ENST00000589109.1_3'UTR	NM_002930.2	NP_002921.1	Q99578	RIT2_HUMAN	Ras-like without CAAX 2	197					neurotrophin TRK receptor signaling pathway (GO:0048011)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)|synaptic transmission (GO:0007268)	nucleus (GO:0005634)|plasma membrane (GO:0005886)	calmodulin binding (GO:0005516)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)	p.R197T(1)|p.K198fs*>19(1)		endometrium(1)|large_intestine(2)|lung(11)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	19						GCTGTCTTTTCTCTTCAGTTT	0.413																																						dbGAP											2	Substitution - Missense(1)|Deletion - Frameshift(1)	urinary_tract(1)|large_intestine(1)											144.0	149.0	147.0					18																	40323522		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC018060	CCDS11921.1, CCDS62431.1	18q12.3	2014-05-09	2002-09-11	2002-09-13	ENSG00000152214	ENSG00000152214			10017	protein-coding gene	gene with protein product		609592	"""Ric (Drosophila)-like, expressed in neurons"""	RIN		8824319, 8918462	Standard	NM_002930		Approved	RIBA	uc002lav.4	Q99578	OTTHUMG00000132611	ENST00000326695.5:c.590G>A	18.37:g.40323522C>T	ENSP00000321805:p.Arg197Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R9L1|O15295|Q8TD69|Q8WVF6|Q92964	Missense_Mutation	SNP	pfam_Small_GTPase,pfam_MIRO-like,pfam_Small_GTPase_ARF/SAR,pfam_ProtSyn_GTP-bd,smart_Small_GTPase_Ras,smart_Small_GTPase_Rab_type,smart_Small_GTPase_Rho,smart_Ran_GTPase,prints_Small_GTPase,tigrfam_Small_GTP-bd_dom	p.R197K	ENST00000326695.5	37	c.590	CCDS11921.1	18	.	.	.	.	.	.	.	.	.	.	C	8.853	0.945081	0.18356	.	.	ENSG00000152214	ENST00000326695	T	0.79033	-1.23	5.41	5.41	0.78517	.	.	.	.	.	T	0.52549	0.1741	N	0.08118	0	0.80722	D	1	B	0.25105	0.118	B	0.21917	0.037	T	0.53215	-0.8470	9	0.05351	T	0.99	.	9.2299	0.37430	0.0:0.7766:0.1469:0.0765	.	197	Q99578	RIT2_HUMAN	K	197	ENSP00000321805:R197K	ENSP00000321805:R197K	R	-	2	0	RIT2	38577520	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	2.252000	0.43196	2.551000	0.86045	0.655000	0.94253	AGA	RIT2	-	smart_Ran_GTPase	ENSG00000152214		0.413	RIT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RIT2	HGNC	protein_coding	OTTHUMT00000255852.1	63	0.00	0	C	NM_002930		40323522	40323522	-1	no_errors	ENST00000326695	ensembl	human	known	69_37n	missense	52	18.75	12	SNP	1.000	T
SFMBT2	57713	genome.wustl.edu	37	10	7262382	7262382	+	Missense_Mutation	SNP	G	G	A	rs576691840	byFrequency	TCGA-A1-A0SF-01A-11D-A142-09	TCGA-A1-A0SF-10B-01D-A142-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b291200e-3c22-411a-85d0-fbe1570acda2	cc8ae8d4-315d-492a-84e9-7ed8630e9c70	g.chr10:7262382G>A	ENST00000361972.4	-	11	1411	c.1321C>T	c.(1321-1323)Cac>Tac	p.H441Y	SFMBT2_ENST00000397167.1_Missense_Mutation_p.H441Y	NM_001018039.1	NP_001018049.1	Q5VUG0	SMBT2_HUMAN	Scm-like with four mbt domains 2	441					negative regulation of gene expression (GO:0010629)|regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	histone binding (GO:0042393)			NS(2)|breast(3)|central_nervous_system(4)|endometrium(7)|kidney(2)|large_intestine(26)|lung(34)|ovary(5)|pancreas(2)|skin(9)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	99						CCTTCCAGGTGAAGCCACATT	0.532													G|||	236	0.0471246	0.0363	0.0807	5008	,	,		18739	0.0546		0.0746	False		,,,				2504	0.002					dbGAP											0													238.0	228.0	231.0					10																	7262382		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB046837	CCDS31138.1	10p15.1	2013-01-10	2003-11-14		ENSG00000198879	ENSG00000198879		"""Sterile alpha motif (SAM) domain containing"""	20256	protein-coding gene	gene with protein product		615392	"""Scm-related gene containing four mbt domains 2"""			10997877	Standard	NM_001029880		Approved	KIAA1617	uc009xio.2	Q5VUG0	OTTHUMG00000017630	ENST00000361972.4:c.1321C>T	10.37:g.7262382G>A	ENSP00000355109:p.His441Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV	A7MD09|Q9HCF5	Missense_Mutation	SNP	pfam_Mbt,pfam_DUF3588,pfam_SAM_type1,pfam_Pointed_dom,superfamily_SAM/pointed,superfamily_ARM-type_fold,smart_Mbt,smart_SAM,pfscan_Mbt	p.H441Y	ENST00000361972.4	37	c.1321	CCDS31138.1	10	.	.	.	.	.	.	.	.	.	.	G	14.89	2.669445	0.47677	.	.	ENSG00000198879	ENST00000361972;ENST00000397167	T;T	0.49139	0.79;0.79	5.4	5.4	0.78164	.	0.213848	0.49305	D	0.000149	T	0.61763	0.2373	M	0.90922	3.16	0.80722	D	1	P	0.36438	0.553	B	0.40009	0.316	T	0.70163	-0.4947	10	0.72032	D	0.01	.	14.5147	0.67811	0.0:0.0:0.8527:0.1473	.	441	Q5VUG0	SMBT2_HUMAN	Y	441	ENSP00000355109:H441Y;ENSP00000380353:H441Y	ENSP00000355109:H441Y	H	-	1	0	SFMBT2	7302388	0.995000	0.38212	0.960000	0.40013	0.698000	0.40448	2.910000	0.48766	2.530000	0.85305	0.563000	0.77884	CAC	SFMBT2	-	pfam_Mbt,smart_Mbt,pfscan_Mbt	ENSG00000198879		0.532	SFMBT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SFMBT2	HGNC	protein_coding	OTTHUMT00000046673.1	33	0.00	0	G	NM_001029880		7262382	7262382	-1	no_errors	ENST00000361972	ensembl	human	known	69_37n	missense	46	16.36	9	SNP	0.996	A
SKOR1	390598	genome.wustl.edu	37	15	68118729	68118729	+	Missense_Mutation	SNP	C	C	T			TCGA-A1-A0SF-01A-11D-A142-09	TCGA-A1-A0SF-10B-01D-A142-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b291200e-3c22-411a-85d0-fbe1570acda2	cc8ae8d4-315d-492a-84e9-7ed8630e9c70	g.chr15:68118729C>T	ENST00000380035.2	+	2	621	c.563C>T	c.(562-564)gCg>gTg	p.A188V	SKOR1_ENST00000341418.5_Missense_Mutation_p.A374V|SKOR1_ENST00000389002.1_Missense_Mutation_p.A179V|SKOR1_ENST00000554054.1_Missense_Mutation_p.A160V|SKOR1_ENST00000554240.1_Missense_Mutation_p.A149V			P84550	SKOR1_HUMAN	SKI family transcriptional corepressor 1	188					negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	SMAD binding (GO:0046332)|transcription corepressor activity (GO:0003714)			endometrium(8)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(4)|lung(7)|urinary_tract(1)	23						CACGAGTGCGCGTGGGGCTCG	0.597																																						dbGAP											0													99.0	89.0	92.0					15																	68118729		2200	4298	6498	-	-	-	SO:0001583	missense	0				CCDS58374.1	15q23	2011-08-04	2010-06-23	2010-06-23	ENSG00000188779	ENSG00000188779		"""SKI transcriptional corepressors"""	21326	protein-coding gene	gene with protein product	"""transcriptional corepressor CORL1"", ""functional smad suppressing element 15"", ""corepressor for LBX1"""	611273	"""Lbxcor1 homolog (mouse)"""	LBXCOR1		15528197	Standard	NM_001258024		Approved	CORL1, FUSSEL15	uc031qsn.1	P84550		ENST00000380035.2:c.563C>T	15.37:g.68118729C>T	ENSP00000369374:p.Ala188Val	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NIP4|A6NJY0|Q2VWA5	Missense_Mutation	SNP	pfam_Transform_Ski,pfam_c-SKI_SMAD4-bd_dom,superfamily_DNA-bd_dom_put,superfamily_SAND_dom-like	p.A188V	ENST00000380035.2	37	c.563		15	.	.	.	.	.	.	.	.	.	.	C	23.2	4.392246	0.83011	.	.	ENSG00000188779	ENST00000341418;ENST00000554240;ENST00000554054;ENST00000380035;ENST00000389002	T;T;T;T;T	0.73681	-0.75;-0.75;-0.75;-0.77;-0.77	4.74	4.74	0.60224	.	0.057709	0.64402	D	0.000002	D	0.86243	0.5886	M	0.80982	2.52	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	D	0.86760	0.1966	10	0.42905	T	0.14	-19.2265	16.3123	0.82883	0.0:1.0:0.0:0.0	.	179	P84550-3	.	V	374;149;160;188;179	ENSP00000343200:A374V;ENSP00000451193:A149V;ENSP00000452361:A160V;ENSP00000369374:A188V;ENSP00000373654:A179V	ENSP00000343200:A374V	A	+	2	0	SKOR1	65905783	1.000000	0.71417	0.973000	0.42090	0.599000	0.36880	7.674000	0.83992	2.184000	0.69523	0.561000	0.74099	GCG	SKOR1	-	pfam_c-SKI_SMAD4-bd_dom,superfamily_SAND_dom-like	ENSG00000188779		0.597	SKOR1-003	KNOWN	not_organism_supported|basic|appris_candidate_longest	protein_coding	SKOR1	HGNC	protein_coding	OTTHUMT00000410832.1	28	0.00	0	C	NM_001031807		68118729	68118729	+1	no_errors	ENST00000380035	ensembl	human	known	69_37n	missense	13	27.78	5	SNP	1.000	T
SPPL2C	162540	genome.wustl.edu	37	17	43922887	43922887	+	Silent	SNP	C	C	T	rs539381167		TCGA-A1-A0SF-01A-11D-A142-09	TCGA-A1-A0SF-10B-01D-A142-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b291200e-3c22-411a-85d0-fbe1570acda2	cc8ae8d4-315d-492a-84e9-7ed8630e9c70	g.chr17:43922887C>T	ENST00000329196.5	+	1	632	c.615C>T	c.(613-615)gcC>gcT	p.A205A	MAPT-AS1_ENST00000579599.1_RNA|MAPT-AS1_ENST00000581125.1_RNA|MAPT-AS1_ENST00000579244.1_RNA	NM_175882.2	NP_787078.2	Q8IUH8	SPP2C_HUMAN	signal peptide peptidase like 2C	205						endoplasmic reticulum membrane (GO:0005789)|integral component of cytoplasmic side of endoplasmic reticulum membrane (GO:0071458)|integral component of lumenal side of endoplasmic reticulum membrane (GO:0071556)	aspartic-type endopeptidase activity (GO:0004190)|protein homodimerization activity (GO:0042803)										GCTACTGGGCCGGCCTGACCG	0.652													c|||	1	0.000199681	0.0	0.0	5008	,	,		17144	0.0		0.0	False		,,,				2504	0.001					dbGAP											0													57.0	48.0	51.0					17																	43922887		2203	4299	6502	-	-	-	SO:0001819	synonymous_variant	0				CCDS32673.1	17q21.31	2014-02-12			ENSG00000185294	ENSG00000185294			28902	protein-coding gene	gene with protein product	"""intramembrane protease 5"""	608284				12139484	Standard	NM_175882		Approved	IMP5	uc010wka.2	Q8IUH8		ENST00000329196.5:c.615C>T	17.37:g.43922887C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q8TC67|Q8WVZ6	Silent	SNP	pfam_Peptidase_A22B_SPP,pfam_Protease-assoc_domain,smart_Peptidase_A22	p.A205	ENST00000329196.5	37	c.615	CCDS32673.1	17																																																																																			SPPL2C	-	NULL	ENSG00000185294		0.652	SPPL2C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPPL2C	HGNC	protein_coding	OTTHUMT00000441156.1	18	0.00	0	C	NM_175882		43922887	43922887	+1	no_errors	ENST00000329196	ensembl	human	known	69_37n	silent	11	35.29	6	SNP	0.246	T
ST7	7982	genome.wustl.edu	37	7	116593630	116593630	+	Silent	SNP	C	C	T			TCGA-A1-A0SF-01A-11D-A142-09	TCGA-A1-A0SF-10B-01D-A142-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b291200e-3c22-411a-85d0-fbe1570acda2	cc8ae8d4-315d-492a-84e9-7ed8630e9c70	g.chr7:116593630C>T	ENST00000393446.2	+	1	339	c.36C>T	c.(34-36)ctC>ctT	p.L12L	ST7_ENST00000393451.3_Silent_p.L12L|ST7_ENST00000323984.3_Silent_p.L12L|ST7-AS1_ENST00000456775.1_RNA|ST7-OT4_ENST00000397751.1_5'Flank|ST7_ENST00000265437.5_Silent_p.L12L|ST7-OT4_ENST00000397750.3_5'Flank|ST7_ENST00000393449.1_Silent_p.L12L			Q9Y561	LRP12_HUMAN	suppression of tumorigenicity 7	0					endocytosis (GO:0006897)|receptor-mediated endocytosis (GO:0006898)|regulation of growth (GO:0040008)|signal transduction (GO:0007165)	coated pit (GO:0005905)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)	low-density lipoprotein receptor activity (GO:0005041)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(4)|liver(2)|lung(5)|ovary(1)|skin(1)	21	all_cancers(3;3.88e-07)|all_epithelial(6;3.42e-07)|Lung NSC(10;0.00072)|all_lung(10;0.000847)		STAD - Stomach adenocarcinoma(10;0.000512)	LUSC - Lung squamous cell carcinoma(290;0.133)		TGGAGCAGCTCAAGTCCTGCA	0.572																																						dbGAP											0													234.0	231.0	232.0					7																	116593630		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AJ277291	CCDS5769.1, CCDS5770.1	7q31.2	2008-06-06			ENSG00000004866	ENSG00000004866			11351	protein-coding gene	gene with protein product		600833		FAM4A1		8105370, 8938430	Standard	NM_021908		Approved	TSG7, SEN4, ETS7q, HELG, RAY1, FAM4A	uc003vin.3	Q9NRC1	OTTHUMG00000023888	ENST00000393446.2:c.36C>T	7.37:g.116593630C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K137|B4DRQ2	Silent	SNP	pfam_ST7	p.L12	ENST00000393446.2	37	c.36		7																																																																																			ST7	-	NULL	ENSG00000004866		0.572	ST7-013	NOVEL	not_organism_supported|basic|exp_conf	protein_coding	ST7	HGNC	protein_coding	OTTHUMT00000319687.1	53	0.00	0	C	NM_021908		116593630	116593630	+1	no_errors	ENST00000265437	ensembl	human	known	69_37n	silent	50	27.54	19	SNP	1.000	T
TP73	7161	genome.wustl.edu	37	1	3599659	3599659	+	Missense_Mutation	SNP	C	C	T			TCGA-A1-A0SF-01A-11D-A142-09	TCGA-A1-A0SF-10B-01D-A142-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b291200e-3c22-411a-85d0-fbe1570acda2	cc8ae8d4-315d-492a-84e9-7ed8630e9c70	g.chr1:3599659C>T	ENST00000378295.4	+	3	256	c.101C>T	c.(100-102)tCa>tTa	p.S34L	TP73_ENST00000604479.1_Missense_Mutation_p.S34L|TP73_ENST00000357733.3_Missense_Mutation_p.S34L|TP73_ENST00000354437.4_Missense_Mutation_p.S34L|TP73_ENST00000346387.4_Missense_Mutation_p.S34L|TP73_ENST00000604074.1_Missense_Mutation_p.S34L|TP73_ENST00000603362.1_Missense_Mutation_p.S34L	NM_001204185.1|NM_005427.3	NP_001191114.1|NP_005418.1	O15350	P73_HUMAN	tumor protein p73	34	Asp/Glu-rich (acidic).|Transactivation. {ECO:0000250}.				activation of MAPK activity (GO:0000187)|cell cycle arrest (GO:0007050)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to UV (GO:0034644)|cerebrospinal fluid secretion (GO:0033326)|digestive tract morphogenesis (GO:0048546)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|hippocampus development (GO:0021766)|inflammatory response (GO:0006954)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|kidney development (GO:0001822)|mismatch repair (GO:0006298)|mitotic G1 DNA damage checkpoint (GO:0031571)|negative regulation of JUN kinase activity (GO:0043508)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of neuron differentiation (GO:0045665)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuron development (GO:0048666)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell size (GO:0045793)|positive regulation of intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:1902167)|positive regulation of oligodendrocyte differentiation (GO:0048714)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|post-embryonic development (GO:0009791)|protein tetramerization (GO:0051262)|release of cytochrome c from mitochondria (GO:0001836)|response to gamma radiation (GO:0010332)|response to organonitrogen compound (GO:0010243)|response to X-ray (GO:0010165)|transcription, DNA-templated (GO:0006351)	chromatin (GO:0000785)|cytosol (GO:0005829)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|damaged DNA binding (GO:0003684)|double-stranded DNA binding (GO:0003690)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|p53 binding (GO:0002039)|protein kinase binding (GO:0019901)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)			breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|lung(8)|ovary(1)|prostate(1)	20	all_cancers(77;0.0395)|Ovarian(185;0.0634)|Lung NSC(156;0.188)|all_lung(157;0.198)	all_epithelial(116;7.42e-17)|all_lung(118;1.86e-06)|Lung NSC(185;0.000163)|Renal(390;0.00357)|Breast(487;0.00446)|Hepatocellular(190;0.0218)|Myeloproliferative disorder(586;0.0393)|Lung SC(97;0.109)|Ovarian(437;0.127)		Epithelial(90;5.57e-38)|OV - Ovarian serous cystadenocarcinoma(86;1.87e-22)|GBM - Glioblastoma multiforme(42;5.72e-16)|Colorectal(212;2.22e-05)|COAD - Colon adenocarcinoma(227;8.48e-05)|Kidney(185;0.000539)|BRCA - Breast invasive adenocarcinoma(365;0.000868)|STAD - Stomach adenocarcinoma(132;0.0072)|KIRC - Kidney renal clear cell carcinoma(229;0.00751)|Lung(427;0.226)		CTTCCCCAGTCAAGCCGGGGG	0.582																																						dbGAP											0													121.0	117.0	118.0					1																	3599659		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB055065	CCDS49.1, CCDS44049.1, CCDS44050.1, CCDS44051.1, CCDS55566.1, CCDS55567.1, CCDS55568.1, CCDS55569.1, CCDS59965.1	1p36.3	2010-06-15			ENSG00000078900	ENSG00000078900			12003	protein-coding gene	gene with protein product		601990				9296498, 9288759	Standard	NM_001204186		Approved	P73	uc001akp.3	O15350	OTTHUMG00000000610	ENST00000378295.4:c.101C>T	1.37:g.3599659C>T	ENSP00000367545:p.Ser34Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	B7Z7J4|B7Z8Z1|B7Z9C1|C9J521|O15351|Q17RN8|Q5TBV5|Q5TBV6|Q8NHW9|Q8TDY5|Q8TDY6|Q9NTK8	Missense_Mutation	SNP	pfam_p53_DNA-bd,pfam_p53_tetrameristn,pfam_SAM_2,superfamily_p53-like_TF_DNA-bd,superfamily_SAM/pointed,superfamily_p53_tetrameristn,smart_SAM,prints_p53_tumour_suppressor	p.S34L	ENST00000378295.4	37	c.101	CCDS49.1	1	.	.	.	.	.	.	.	.	.	.	C	11.60	1.686401	0.29962	.	.	ENSG00000078900	ENST00000378295;ENST00000354437;ENST00000357733;ENST00000346387	D;D;D;D	0.99382	-5.66;-5.8;-5.55;-5.65	4.74	4.74	0.60224	.	0.799171	0.11172	U	0.591874	D	0.97701	0.9246	N	0.19112	0.55	0.80722	D	1	B;B	0.24258	0.068;0.1	B;B	0.35182	0.197;0.036	D	0.94462	0.7677	10	0.25106	T	0.35	-1.3419	17.0975	0.86639	0.0:1.0:0.0:0.0	.	34;34	O15350-2;O15350	.;P73_HUMAN	L	34	ENSP00000367545:S34L;ENSP00000346423:S34L;ENSP00000350366:S34L;ENSP00000340740:S34L	ENSP00000340740:S34L	S	+	2	0	TP73	3589519	0.121000	0.22262	0.024000	0.17045	0.803000	0.45373	3.141000	0.50593	2.342000	0.79632	0.563000	0.77884	TCA	TP73	-	NULL	ENSG00000078900		0.582	TP73-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP73	HGNC	protein_coding	OTTHUMT00000001468.4	45	0.00	0	C	NM_005427		3599659	3599659	+1	no_errors	ENST00000378295	ensembl	human	known	69_37n	missense	40	13.04	6	SNP	0.589	T
TPH1	7166	genome.wustl.edu	37	11	18044348	18044348	+	Frame_Shift_Del	DEL	A	A	-			TCGA-A1-A0SF-01A-11D-A142-09	TCGA-A1-A0SF-10B-01D-A142-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b291200e-3c22-411a-85d0-fbe1570acda2	cc8ae8d4-315d-492a-84e9-7ed8630e9c70	g.chr11:18044348delA	ENST00000250018.2	-	9	1719	c.1157delT	c.(1156-1158)atgfs	p.M386fs	RP1-59M18.2_ENST00000525523.1_RNA|TPH1_ENST00000525406.1_5'UTR|TPH1_ENST00000341556.2_Frame_Shift_Del_p.M386fs	NM_004179.2	NP_004170.1	P17752	TPH1_HUMAN	tryptophan hydroxylase 1	386					aromatic amino acid family metabolic process (GO:0009072)|bone remodeling (GO:0046849)|cellular nitrogen compound metabolic process (GO:0034641)|circadian rhythm (GO:0007623)|indolalkylamine biosynthetic process (GO:0046219)|mammary gland alveolus development (GO:0060749)|negative regulation of ossification (GO:0030279)|response to immobilization stress (GO:0035902)|serotonin biosynthetic process (GO:0042427)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|neuron projection (GO:0043005)	amino acid binding (GO:0016597)|iron ion binding (GO:0005506)|tryptophan 5-monooxygenase activity (GO:0004510)			NS(1)|breast(1)|endometrium(1)|kidney(3)|large_intestine(3)|lung(14)|prostate(1)|stomach(1)	25					L-Tryptophan(DB00150)|Tetrahydrobiopterin(DB00360)	ACTGTACCTCATCTTCTCCTT	0.388																																						dbGAP											0													82.0	75.0	77.0					11																	18044348		2200	4293	6493	-	-	-	SO:0001589	frameshift_variant	0			X52836	CCDS7829.1	11p15.3-p14	2012-10-02	2008-07-31	2003-04-04	ENSG00000129167	ENSG00000129167	1.14.16.4		12008	protein-coding gene	gene with protein product	"""tryptophan 5-monooxygenase"""	191060	"""tryptophan hydroxylase (tryptophan 5-monooxygenase)"""	TPRH, TPH		1463016	Standard	NM_004179		Approved		uc001mnp.2	P17752	OTTHUMG00000166421	ENST00000250018.2:c.1157delT	11.37:g.18044348delA	ENSP00000250018:p.Met386fs	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DQX6|O95188|O95189|Q16736|Q3KPG8	Frame_Shift_Del	DEL	pfam_Aromatic-AA_hydroxylase_C,pfam_ACT_dom,superfamily_Aromatic-AA_hydroxylase_C,pirsf_Tyrosine_3-monooxygenase-like,prints_Aromatic-AA_hydroxylase_C,tigrfam_Trp_5_mOase	p.M386fs	ENST00000250018.2	37	c.1157	CCDS7829.1	11																																																																																			TPH1	-	pfam_Aromatic-AA_hydroxylase_C,superfamily_Aromatic-AA_hydroxylase_C,pirsf_Tyrosine_3-monooxygenase-like,tigrfam_Trp_5_mOase	ENSG00000129167		0.388	TPH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TPH1	HGNC	protein_coding	OTTHUMT00000389696.1	37	0.00	0	A	NM_004179		18044348	18044348	-1	no_errors	ENST00000341556	ensembl	human	known	69_37n	frame_shift_del	18	10.00	2	DEL	1.000	-
UBE2QL1	134111	genome.wustl.edu	37	5	6491344	6491344	+	Missense_Mutation	SNP	G	G	A			TCGA-A1-A0SF-01A-11D-A142-09	TCGA-A1-A0SF-10B-01D-A142-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b291200e-3c22-411a-85d0-fbe1570acda2	cc8ae8d4-315d-492a-84e9-7ed8630e9c70	g.chr5:6491344G>A	ENST00000399816.3	+	2	639	c.368G>A	c.(367-369)aGa>aAa	p.R123K		NM_001145161.2	NP_001138633.1	A1L167	U2QL1_HUMAN	ubiquitin-conjugating enzyme E2Q family-like 1	123					protein ubiquitination (GO:0016567)		acid-amino acid ligase activity (GO:0016881)|ATP binding (GO:0005524)			breast(1)|endometrium(1)	2						CGGATCTGTAGAAAAGCTGGC	0.438																																						dbGAP											0													103.0	93.0	96.0					5																	6491344		692	1591	2283	-	-	-	SO:0001583	missense	0			AK057805	CCDS47189.1	5p15.31	2010-02-17			ENSG00000215218	ENSG00000215218			37269	protein-coding gene	gene with protein product		615832					Standard	NM_001145161		Approved	FLJ25076	uc003jdp.4	A1L167	OTTHUMG00000161683	ENST00000399816.3:c.368G>A	5.37:g.6491344G>A	ENSP00000382713:p.Arg123Lys	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_UBQ-conjugat_E2,superfamily_UBQ-conjugating_enzyme/RWD,pfscan_UBQ-conjugat_E2	p.R123K	ENST00000399816.3	37	c.368	CCDS47189.1	5	.	.	.	.	.	.	.	.	.	.	G	10.65	1.409018	0.25378	.	.	ENSG00000215218	ENST00000399816	.	.	.	5.03	5.03	0.67393	Ubiquitin-conjugating enzyme/RWD-like (2);	0.133611	0.47852	U	0.000206	T	0.57330	0.2046	L	0.52126	1.63	0.80722	D	1	P	0.34462	0.454	B	0.38156	0.266	T	0.54390	-0.8301	9	0.06891	T	0.86	-31.5957	17.3664	0.87365	0.0:0.0:1.0:0.0	.	123	A1L167	U2QL1_HUMAN	K	123	.	ENSP00000382713:R123K	R	+	2	0	UBE2QL1	6544344	1.000000	0.71417	0.997000	0.53966	0.875000	0.50365	9.246000	0.95438	2.337000	0.79520	0.561000	0.74099	AGA	UBE2QL1	-	superfamily_UBQ-conjugating_enzyme/RWD	ENSG00000215218		0.438	UBE2QL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UBE2QL1	HGNC	protein_coding	OTTHUMT00000365717.1	44	0.00	0	G	NM_001145161		6491344	6491344	+1	no_errors	ENST00000399816	ensembl	human	known	69_37n	missense	27	22.86	8	SNP	1.000	A
ZNF91	7644	genome.wustl.edu	37	19	23543097	23543097	+	Missense_Mutation	SNP	G	G	A			TCGA-A1-A0SF-01A-11D-A142-09	TCGA-A1-A0SF-10B-01D-A142-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b291200e-3c22-411a-85d0-fbe1570acda2	cc8ae8d4-315d-492a-84e9-7ed8630e9c70	g.chr19:23543097G>A	ENST00000300619.7	-	4	2889	c.2684C>T	c.(2683-2685)tCa>tTa	p.S895L	ZNF91_ENST00000397082.2_Missense_Mutation_p.S863L|ZNF91_ENST00000599743.1_Intron|ZNF91_ENST00000596528.1_5'Flank	NM_003430.2	NP_003421.2	Q05481	ZNF91_HUMAN	zinc finger protein 91	895					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)						all_lung(12;0.0349)|Lung NSC(12;0.0538)|all_epithelial(12;0.0611)				AGTAAGGGTTGAGGACCAGAT	0.363																																						dbGAP											0													68.0	75.0	73.0					19																	23543097		2182	4292	6474	-	-	-	SO:0001583	missense	0			M61871	CCDS42541.1, CCDS74322.1	19p12	2014-02-04	2006-05-12		ENSG00000167232	ENSG00000167232		"""Zinc fingers, C2H2-type"", ""-"""	13166	protein-coding gene	gene with protein product		603971	"""zinc finger protein 91 (HPF7, HTF10)"""			2023909, 2505992	Standard	XR_430154		Approved	HPF7, HTF10	uc002nre.3	Q05481	OTTHUMG00000183268	ENST00000300619.7:c.2684C>T	19.37:g.23543097G>A	ENSP00000300619:p.Ser895Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K5E1|B7Z6G6	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.S895L	ENST00000300619.7	37	c.2684	CCDS42541.1	19	.	.	.	.	.	.	.	.	.	.	G	10.55	1.382052	0.24944	.	.	ENSG00000167232	ENST00000300619;ENST00000397082	T;T	0.17854	2.25;2.25	1.34	0.0656	0.14357	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.38878	0.1057	M	0.86343	2.81	0.09310	N	1	D;D	0.69078	0.997;0.986	D;P	0.83275	0.996;0.807	T	0.15896	-1.0421	9	0.54805	T	0.06	.	3.2692	0.06875	0.186:0.0:0.5666:0.2475	.	863;895	Q05481-2;Q05481	.;ZNF91_HUMAN	L	895;863	ENSP00000300619:S895L;ENSP00000380272:S863L	ENSP00000300619:S895L	S	-	2	0	ZNF91	23334937	0.000000	0.05858	0.001000	0.08648	0.005000	0.04900	0.089000	0.15002	-0.153000	0.11137	0.205000	0.17691	TCA	ZNF91	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000167232		0.363	ZNF91-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZNF91	HGNC	protein_coding	OTTHUMT00000465891.1	52	0.00	0	G	NM_003430		23543097	23543097	-1	no_errors	ENST00000300619	ensembl	human	known	69_37n	missense	36	37.93	22	SNP	0.000	A
