#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
ACSL4	2182	genome.wustl.edu	37	X	108911440	108911440	+	Missense_Mutation	SNP	C	C	T			TCGA-A1-A0SH-01A-11D-A099-09	TCGA-A1-A0SH-10A-03D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	473d6ae4-162a-4136-b44f-fad42529a31a	7df4bbf4-7ac5-4fd3-b0b9-ca6e49674cfd	g.chrX:108911440C>T	ENST00000469796.2	-	11	1724	c.1328G>A	c.(1327-1329)gGg>gAg	p.G443E	ACSL4_ENST00000348502.6_Missense_Mutation_p.G402E|ACSL4_ENST00000340800.2_Missense_Mutation_p.G443E			O60488	ACSL4_HUMAN	acyl-CoA synthetase long-chain family member 4	443					cellular lipid metabolic process (GO:0044255)|dendritic spine development (GO:0060996)|embryonic process involved in female pregnancy (GO:0060136)|fatty acid transport (GO:0015908)|lipid biosynthetic process (GO:0008610)|lipid metabolic process (GO:0006629)|long-chain fatty acid metabolic process (GO:0001676)|long-chain fatty-acyl-CoA biosynthetic process (GO:0035338)|negative regulation of prostaglandin secretion (GO:0032307)|positive regulation of cell growth (GO:0030307)|response to interleukin-15 (GO:0070672)|response to nutrient (GO:0007584)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)	cytoplasm (GO:0005737)|endoplasmic reticulum membrane (GO:0005789)|ER-mitochondrion membrane contact site (GO:0044233)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|lipid particle (GO:0005811)|membrane (GO:0016020)|mitochondrial outer membrane (GO:0005741)|neuronal cell body (GO:0043025)|peroxisome (GO:0005777)	arachidonate-CoA ligase activity (GO:0047676)|ATP binding (GO:0005524)|long-chain fatty acid-CoA ligase activity (GO:0004467)|very long-chain fatty acid-CoA ligase activity (GO:0031957)	p.G443E(1)		breast(3)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(6)|lung(6)|ovary(2)	22					Icosapent(DB00159)|Rosiglitazone(DB00412)	TAGCGGGGCCCCTCCAGACAG	0.488																																					Pancreas(188;358 2127 38547 41466 45492)	dbGAP											1	Substitution - Missense(1)	breast(1)											121.0	102.0	109.0					X																	108911440		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC034959	CCDS14548.1, CCDS14549.1	Xq22.3-q23	2008-02-05	2004-02-19	2004-02-20	ENSG00000068366	ENSG00000068366		"""Acyl-CoA synthetase family"""	3571	protein-coding gene	gene with protein product	"""lignoceroyl-CoA synthase"", "" long-chain fatty-acid-Coenzyme A ligase 4"""	300157	"""fatty-acid-Coenzyme A ligase, long-chain 4"", ""mental retardation, X-linked 63"", ""mental retardation, X-linked 68"""	FACL4, MRX63, MRX68		9480748, 12949969	Standard	NM_022977		Approved	ACS4, LACS4	uc004eoi.2	O60488	OTTHUMG00000022190	ENST00000469796.2:c.1328G>A	X.37:g.108911440C>T	ENSP00000419171:p.Gly443Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DUY2|O60848|O60849|Q5JWV8	Missense_Mutation	SNP	pfam_AMP-dep_Synth/Lig	p.G443E	ENST00000469796.2	37	c.1328	CCDS14548.1	X	.	.	.	.	.	.	.	.	.	.	C	20.4	3.992377	0.74703	.	.	ENSG00000068366	ENST00000348502;ENST00000469796;ENST00000340800	T;T;T	0.33654	1.4;1.4;1.4	5.65	5.65	0.86999	AMP-dependent synthetase/ligase (1);	0.000000	0.85682	D	0.000000	T	0.73110	0.3545	H	0.95294	3.65	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.82224	-0.0563	10	0.87932	D	0	-12.8914	18.7662	0.91874	0.0:1.0:0.0:0.0	.	443	O60488	ACSL4_HUMAN	E	402;443;443	ENSP00000262835:G402E;ENSP00000419171:G443E;ENSP00000339787:G443E	ENSP00000339787:G443E	G	-	2	0	ACSL4	108798096	1.000000	0.71417	0.487000	0.27428	0.646000	0.38490	5.999000	0.70665	2.377000	0.81083	0.600000	0.82982	GGG	ACSL4	-	pfam_AMP-dep_Synth/Lig	ENSG00000068366		0.488	ACSL4-003	KNOWN	basic|CCDS	protein_coding	ACSL4	HGNC	protein_coding	OTTHUMT00000358155.2	101	0.00	0	C	NM_004458		108911440	108911440	-1	no_errors	ENST00000340800	ensembl	human	known	69_37n	missense	86	25.86	30	SNP	1.000	T
AHCTF1	25909	genome.wustl.edu	37	1	247040513	247040513	+	Nonsense_Mutation	SNP	C	C	A	rs139700015		TCGA-A1-A0SH-01A-11D-A099-09	TCGA-A1-A0SH-10A-03D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	473d6ae4-162a-4136-b44f-fad42529a31a	7df4bbf4-7ac5-4fd3-b0b9-ca6e49674cfd	g.chr1:247040513C>A	ENST00000391829.2	-	22	2875	c.2752G>T	c.(2752-2754)Gaa>Taa	p.E918*	AHCTF1_ENST00000470300.1_5'UTR|AHCTF1_ENST00000326225.3_Nonsense_Mutation_p.E927*|AHCTF1_ENST00000366508.1_Nonsense_Mutation_p.E953*			Q8WYP5	ELYS_HUMAN	AT hook containing transcription factor 1	918	Necessary for cytoplasmic localization. {ECO:0000250}.				cytokinesis (GO:0000910)|mitotic cell cycle (GO:0000278)|mRNA transport (GO:0051028)|nuclear pore complex assembly (GO:0051292)|protein transport (GO:0015031)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|kinetochore (GO:0000776)|nuclear matrix (GO:0016363)|nuclear membrane (GO:0031965)|nuclear pore (GO:0005643)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.E918*(1)		NS(1)|breast(6)|cervix(3)|endometrium(8)|kidney(6)|large_intestine(12)|liver(2)|lung(21)|ovary(5)|prostate(1)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(2)	74	all_cancers(71;3.05e-05)|all_epithelial(71;6.72e-06)|Ovarian(71;0.0173)|Breast(184;0.0318)|all_lung(81;0.0458)|Lung NSC(105;0.0518)	all_cancers(173;0.0266)	OV - Ovarian serous cystadenocarcinoma(106;0.00271)			AAGCCCATTTCCTGACAGACT	0.383																																					Colon(145;197 1800 4745 15099 26333)	dbGAP											1	Substitution - Nonsense(1)	breast(1)											98.0	98.0	98.0					1																	247040513		2203	4297	6500	-	-	-	SO:0001587	stop_gained	0				CCDS1629.1, CCDS1629.2	1q44	2008-09-09			ENSG00000153207	ENSG00000153207			24618	protein-coding gene	gene with protein product	"""ELYS transcription factor like protein TMBS62"""	610853				11952839	Standard	NM_015446		Approved	ELYS	uc001ibv.2	Q8WYP5	OTTHUMG00000040706	ENST00000391829.2:c.2752G>T	1.37:g.247040513C>A	ENSP00000375705:p.Glu918*	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NGM0|A8MSG9|A8MZ86|Q7Z4E3|Q8IZA4|Q96EH9|Q9Y4Q6	Nonsense_Mutation	SNP	superfamily_Quinonprotein_ADH-like	p.E927*	ENST00000391829.2	37	c.2779		1	.	.	.	.	.	.	.	.	.	.	C	44	10.702369	0.99453	.	.	ENSG00000153207	ENST00000366508;ENST00000326225;ENST00000391829	.	.	.	5.35	5.35	0.76521	.	0.059561	0.64402	D	0.000004	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.33940	T	0.23	-17.2744	19.4287	0.94755	0.0:1.0:0.0:0.0	.	.	.	.	X	953;927;918	.	ENSP00000355465:E927X	E	-	1	0	AHCTF1	245107136	1.000000	0.71417	1.000000	0.80357	0.953000	0.61014	7.245000	0.78237	2.673000	0.90976	0.585000	0.79938	GAA	AHCTF1	-	NULL	ENSG00000153207		0.383	AHCTF1-201	KNOWN	basic|appris_candidate	protein_coding	AHCTF1	HGNC	protein_coding		149	0.00	0	C	NM_015446		247040513	247040513	-1	no_errors	ENST00000326225	ensembl	human	known	69_37n	nonsense	153	19.47	37	SNP	1.000	A
ALPK3	57538	genome.wustl.edu	37	15	85400295	85400295	+	Missense_Mutation	SNP	G	G	A			TCGA-A1-A0SH-01A-11D-A099-09	TCGA-A1-A0SH-10A-03D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	473d6ae4-162a-4136-b44f-fad42529a31a	7df4bbf4-7ac5-4fd3-b0b9-ca6e49674cfd	g.chr15:85400295G>A	ENST00000258888.5	+	6	3099	c.2932G>A	c.(2932-2934)Gag>Aag	p.E978K		NM_020778.4	NP_065829.3	Q96L96	ALPK3_HUMAN	alpha-kinase 3	978					heart development (GO:0007507)	nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)	p.E978K(2)		NS(3)|breast(2)|central_nervous_system(2)|endometrium(12)|kidney(4)|large_intestine(9)|lung(27)|ovary(3)|prostate(5)|skin(8)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	81			BRCA - Breast invasive adenocarcinoma(143;0.0587)			GCCCAGATCTGAGGAGGCAGT	0.547																																						dbGAP											2	Substitution - Missense(2)	breast(2)											70.0	80.0	77.0					15																	85400295		2203	4299	6502	-	-	-	SO:0001583	missense	0			AY044449	CCDS10333.1	15q25.2	2013-01-29			ENSG00000136383	ENSG00000136383		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	17574	protein-coding gene	gene with protein product	"""myocyte induction differentiation originator"", ""muscle alpha-kinase"""					10021370	Standard	NM_020778		Approved	MAK, KIAA1330, Midori	uc002ble.3	Q96L96	OTTHUMG00000148667	ENST00000258888.5:c.2932G>A	15.37:g.85400295G>A	ENSP00000258888:p.Glu978Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q9P2L6	Missense_Mutation	SNP	pfam_MHCK_EF2_kinase,pfam_Ig_I-set,superfamily_Kinase-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_MHCK_EF2_kinase,pfscan_MHCK_EF2_kinase,pfscan_Ig-like	p.E978K	ENST00000258888.5	37	c.2932	CCDS10333.1	15	.	.	.	.	.	.	.	.	.	.	G	15.11	2.735694	0.49045	.	.	ENSG00000136383	ENST00000258888	T	0.66280	-0.2	4.26	2.35	0.29111	.	3.514380	0.01387	N	0.013131	T	0.53206	0.1782	L	0.32530	0.975	0.09310	N	1	P	0.37781	0.608	B	0.35413	0.202	T	0.49771	-0.8904	10	0.66056	D	0.02	-9.893	7.3634	0.26760	0.2189:0.0:0.7811:0.0	.	978	Q96L96	ALPK3_HUMAN	K	978	ENSP00000258888:E978K	ENSP00000258888:E978K	E	+	1	0	ALPK3	83201299	0.218000	0.23608	0.001000	0.08648	0.327000	0.28475	1.362000	0.34148	0.771000	0.33359	0.467000	0.42956	GAG	ALPK3	-	NULL	ENSG00000136383		0.547	ALPK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ALPK3	HGNC	protein_coding	OTTHUMT00000308997.1	72	0.00	0	G	NM_020778		85400295	85400295	+1	no_errors	ENST00000258888	ensembl	human	known	69_37n	missense	67	30.93	30	SNP	0.003	A
ANK3	288	genome.wustl.edu	37	10	61965629	61965629	+	Missense_Mutation	SNP	T	T	C			TCGA-A1-A0SH-01A-11D-A099-09	TCGA-A1-A0SH-10A-03D-A099-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	473d6ae4-162a-4136-b44f-fad42529a31a	7df4bbf4-7ac5-4fd3-b0b9-ca6e49674cfd	g.chr10:61965629T>C	ENST00000280772.2	-	11	1405	c.1214A>G	c.(1213-1215)cAt>cGt	p.H405R	ANK3_ENST00000373827.2_Missense_Mutation_p.H399R|ANK3_ENST00000503366.1_Missense_Mutation_p.H388R	NM_020987.3	NP_066267.2	Q12955	ANK3_HUMAN	ankyrin 3, node of Ranvier (ankyrin G)	405					axon guidance (GO:0007411)|axonogenesis (GO:0007409)|cytoskeletal anchoring at plasma membrane (GO:0007016)|establishment of protein localization (GO:0045184)|Golgi to plasma membrane protein transport (GO:0043001)|maintenance of protein location in plasma membrane (GO:0072660)|membrane assembly (GO:0071709)|mitotic cytokinesis (GO:0000281)|neuromuscular junction development (GO:0007528)|neuronal action potential (GO:0019228)|plasma membrane organization (GO:0007009)|positive regulation of cell communication by electrical coupling (GO:0010650)|positive regulation of gene expression (GO:0010628)|positive regulation of homotypic cell-cell adhesion (GO:0034112)|positive regulation of membrane depolarization during cardiac muscle cell action potential (GO:1900827)|positive regulation of membrane potential (GO:0045838)|positive regulation of protein targeting to membrane (GO:0090314)|positive regulation of sodium ion transmembrane transporter activity (GO:2000651)|positive regulation of sodium ion transport (GO:0010765)|protein localization to plasma membrane (GO:0072659)|protein targeting to plasma membrane (GO:0072661)|regulation of potassium ion transport (GO:0043266)|signal transduction (GO:0007165)	axon initial segment (GO:0043194)|basolateral plasma membrane (GO:0016323)|cell surface (GO:0009986)|costamere (GO:0043034)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|intercalated disc (GO:0014704)|lateral plasma membrane (GO:0016328)|lysosome (GO:0005764)|neuromuscular junction (GO:0031594)|node of Ranvier (GO:0033268)|paranode region of axon (GO:0033270)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|sarcolemma (GO:0042383)|sarcoplasmic reticulum (GO:0016529)|spectrin-associated cytoskeleton (GO:0014731)|T-tubule (GO:0030315)|Z disc (GO:0030018)	cadherin binding (GO:0045296)|cytoskeletal protein binding (GO:0008092)|ion channel binding (GO:0044325)|protein binding, bridging (GO:0030674)|spectrin binding (GO:0030507)|structural constituent of cytoskeleton (GO:0005200)	p.H405R(1)|p.H66R(1)		NS(4)|breast(7)|central_nervous_system(5)|endometrium(19)|haematopoietic_and_lymphoid_tissue(5)|kidney(14)|large_intestine(30)|liver(2)|lung(59)|ovary(8)|pancreas(2)|prostate(5)|skin(26)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(7)	196						GCAGGCAATATGAAGAGGGGT	0.403																																						dbGAP											2	Substitution - Missense(2)	breast(2)											110.0	95.0	100.0					10																	61965629		2203	4300	6503	-	-	-	SO:0001583	missense	0			U13616	CCDS7258.1, CCDS7259.1, CCDS55711.1, CCDS55712.1	10q21	2013-01-10			ENSG00000151150	ENSG00000151150		"""Ankyrin repeat domain containing"""	494	protein-coding gene	gene with protein product	"""ankyrin-3, node of Ranvier"", ""ankyrin-G"""	600465				7665168	Standard	NM_020987		Approved		uc001jky.3	Q12955	OTTHUMG00000018288	ENST00000280772.2:c.1214A>G	10.37:g.61965629T>C	ENSP00000280772:p.His405Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	B1AQT2|B4DIL1|E9PE32|Q13484|Q5CZH9|Q5VXD5|Q7Z3G4|Q9H0P5	Missense_Mutation	SNP	pfam_Ankyrin_rpt,pfam_ZU5,pfam_Death,superfamily_Ankyrin_rpt-contain_dom,superfamily_DEATH-like,smart_Ankyrin_rpt,smart_ZU5,smart_Death,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_Death,pfscan_ZU5,prints_Ankyrin_rpt	p.H405R	ENST00000280772.2	37	c.1214	CCDS7258.1	10	.	.	.	.	.	.	.	.	.	.	T	22.9	4.350156	0.82132	.	.	ENSG00000151150	ENST00000280772;ENST00000373827;ENST00000503366;ENST00000395299;ENST00000395293;ENST00000395304	T;T;T	0.71461	-0.57;-0.57;-0.57	5.01	5.01	0.66863	Ankyrin repeat-containing domain (4);	0.000000	0.43416	D	0.000570	D	0.86556	0.5961	M	0.90542	3.125	0.80722	D	1	P;D;D;D	0.89917	0.784;0.972;0.965;1.0	B;P;P;D	0.87578	0.418;0.9;0.893;0.998	D	0.89549	0.3798	10	0.87932	D	0	.	14.9102	0.70752	0.0:0.0:0.0:1.0	.	388;66;399;405	E9PE32;E7EMJ1;Q5CZH9;Q12955	.;.;.;ANK3_HUMAN	R	405;399;388;367;66;66	ENSP00000280772:H405R;ENSP00000362933:H399R;ENSP00000425236:H388R	ENSP00000280772:H405R	H	-	2	0	ANK3	61635635	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	7.868000	0.87116	2.114000	0.64651	0.533000	0.62120	CAT	ANK3	-	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	ENSG00000151150		0.403	ANK3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ANK3	HGNC	protein_coding	OTTHUMT00000048201.4	63	0.00	0	T	NM_020987		61965629	61965629	-1	no_errors	ENST00000280772	ensembl	human	known	69_37n	missense	97	17.09	20	SNP	1.000	C
ANKRD7	56311	genome.wustl.edu	37	7	117865025	117865025	+	Missense_Mutation	SNP	C	C	G			TCGA-A1-A0SH-01A-11D-A099-09	TCGA-A1-A0SH-10A-03D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	473d6ae4-162a-4136-b44f-fad42529a31a	7df4bbf4-7ac5-4fd3-b0b9-ca6e49674cfd	g.chr7:117865025C>G	ENST00000265224.4	+	1	296	c.141C>G	c.(139-141)atC>atG	p.I47M	ANKRD7_ENST00000417525.1_5'UTR|ANKRD7_ENST00000357099.4_Missense_Mutation_p.I47M|ANKRD7_ENST00000477532.1_Intron|ANKRD7_ENST00000433239.1_5'UTR	NM_019644.3	NP_062618.2	Q92527	ANKR7_HUMAN	ankyrin repeat domain 7	47					male gonad development (GO:0008584)	nucleus (GO:0005634)		p.I47M(1)		breast(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(4)|lung(12)|ovary(2)|upper_aerodigestive_tract(1)	29						ACCTTCAGATCAAGAAATATG	0.483																																						dbGAP											1	Substitution - Missense(1)	breast(1)											74.0	73.0	73.0					7																	117865025		1847	4091	5938	-	-	-	SO:0001583	missense	0			D78334	CCDS43638.1	7q31	2013-01-10			ENSG00000106013	ENSG00000106013		"""Ankyrin repeat domain containing"""	18588	protein-coding gene	gene with protein product	"""testis-specific ankyrin motif containing protein"""	610731				8812458	Standard	NM_019644		Approved	TSA806	uc003vji.3	Q92527	OTTHUMG00000156960	ENST00000265224.4:c.141C>G	7.37:g.117865025C>G	ENSP00000265224:p.Ile47Met	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DYF5|Q96QN1|Q9UDM3	Missense_Mutation	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,prints_Ankyrin_rpt	p.I47M	ENST00000265224.4	37	c.141	CCDS43638.1	7	.	.	.	.	.	.	.	.	.	.	C	8.925	0.962070	0.18583	.	.	ENSG00000106013	ENST00000357099;ENST00000265224;ENST00000486422	T;T;T	0.70869	1.56;1.56;-0.52	4.13	2.24	0.28232	Ankyrin repeat-containing domain (4);	1.103240	0.07197	U	0.856721	T	0.55000	0.1893	N	0.11845	0.185	0.09310	N	1	B	0.31625	0.332	B	0.36766	0.232	T	0.51044	-0.8755	10	0.49607	T	0.09	0.9821	6.2966	0.21089	0.0:0.5287:0.3708:0.1005	.	47	Q92527	ANKR7_HUMAN	M	47	ENSP00000349612:I47M;ENSP00000265224:I47M;ENSP00000417353:I47M	ENSP00000265224:I47M	I	+	3	3	ANKRD7	117652261	0.656000	0.27385	0.002000	0.10522	0.009000	0.06853	0.525000	0.22956	0.490000	0.27771	0.543000	0.68304	ATC	ANKRD7	-	superfamily_Ankyrin_rpt-contain_dom	ENSG00000106013		0.483	ANKRD7-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	ANKRD7	HGNC	protein_coding	OTTHUMT00000346826.1	42	0.00	0	C	NM_001077708		117865025	117865025	+1	no_errors	ENST00000357099	ensembl	human	known	69_37n	missense	51	26.09	18	SNP	0.009	G
APOBR	55911	genome.wustl.edu	37	16	28506628	28506628	+	Missense_Mutation	SNP	G	G	T			TCGA-A1-A0SH-01A-11D-A099-09	TCGA-A1-A0SH-10A-03D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	473d6ae4-162a-4136-b44f-fad42529a31a	7df4bbf4-7ac5-4fd3-b0b9-ca6e49674cfd	g.chr16:28506628G>T	ENST00000431282.1	+	2	276	c.266G>T	c.(265-267)aGa>aTa	p.R89I	CLN3_ENST00000569430.1_Intron|CLN3_ENST00000567160.1_5'UTR|APOBR_ENST00000328423.5_Missense_Mutation_p.R89I|APOBR_ENST00000564831.1_Missense_Mutation_p.R89I			Q0VD83	APOBR_HUMAN	apolipoprotein B receptor	89					cholesterol metabolic process (GO:0008203)|lipid transport (GO:0006869)|triglyceride metabolic process (GO:0006641)	chylomicron (GO:0042627)|low-density lipoprotein particle (GO:0034362)|membrane (GO:0016020)|plasma membrane (GO:0005886)|very-low-density lipoprotein particle (GO:0034361)	very-low-density lipoprotein particle receptor activity (GO:0030229)	p.R89I(1)		breast(1)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(11)|prostate(1)|skin(2)|stomach(1)	29						GATGACAGAAGACATGAAGTG	0.617																																						dbGAP											1	Substitution - Missense(1)	breast(1)											24.0	32.0	29.0					16																	28506628		2001	4164	6165	-	-	-	SO:0001583	missense	0			AK025123	CCDS58442.1	16p11.2	2011-02-14			ENSG00000184730	ENSG00000184730			24087	protein-coding gene	gene with protein product	"""apolipoprotein B48 receptor"", ""apolipoprotein B100 receptor"""	605220				10852956	Standard	NM_018690		Approved	APOB48R, APOB100R	uc002dqb.2	Q0VD83		ENST00000431282.1:c.266G>T	16.37:g.28506628G>T	ENSP00000416094:p.Arg89Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	H3BU97|Q0VD81|Q8NC15|Q9NPJ9	Missense_Mutation	SNP	NULL	p.R89I	ENST00000431282.1	37	c.266		16	.	.	.	.	.	.	.	.	.	.	g	12.72	2.022263	0.35701	.	.	ENSG00000184730	ENST00000328423;ENST00000431282	T;T	0.59083	0.29;0.29	5.17	-0.507	0.11985	.	.	.	.	.	T	0.57315	0.2045	L	0.34521	1.04	0.09310	N	1	D	0.62365	0.991	P	0.62382	0.901	T	0.48115	-0.9063	9	0.72032	D	0.01	-2.7193	5.8573	0.18727	0.2236:0.2711:0.5053:0.0	.	89	Q9NS13	.	I	89	ENSP00000327669:R89I;ENSP00000416094:R89I	ENSP00000327669:R89I	R	+	2	0	APOBR	28414129	0.174000	0.23070	0.001000	0.08648	0.010000	0.07245	1.477000	0.35431	0.159000	0.19401	0.552000	0.68991	AGA	APOBR	-	NULL	ENSG00000184730		0.617	APOBR-202	KNOWN	basic|appris_candidate	protein_coding	APOBR	HGNC	protein_coding		107	0.00	0	G	NM_182804		28506628	28506628	+1	no_errors	ENST00000564831	ensembl	human	known	69_37n	missense	122	15.86	23	SNP	0.026	T
ARHGAP28	79822	genome.wustl.edu	37	18	6837365	6837365	+	Missense_Mutation	SNP	G	G	C			TCGA-A1-A0SH-01A-11D-A099-09	TCGA-A1-A0SH-10A-03D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	473d6ae4-162a-4136-b44f-fad42529a31a	7df4bbf4-7ac5-4fd3-b0b9-ca6e49674cfd	g.chr18:6837365G>C	ENST00000383472.4	+	3	599	c.495G>C	c.(493-495)aaG>aaC	p.K165N	ARHGAP28_ENST00000419673.2_Missense_Mutation_p.K6N|ARHGAP28_ENST00000314319.3_Missense_Mutation_p.K6N|ARHGAP28_ENST00000400091.2_Missense_Mutation_p.K165N|ARHGAP28_ENST00000418986.1_Missense_Mutation_p.K6N|ARHGAP28_ENST00000531294.1_Missense_Mutation_p.K6N|ARHGAP28_ENST00000262227.3_Missense_Mutation_p.K113N			Q9P2N2	RHG28_HUMAN	Rho GTPase activating protein 28	165					regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cell junction (GO:0030054)|cytosol (GO:0005829)|nucleus (GO:0005634)	GTPase activator activity (GO:0005096)	p.K6N(1)|p.K165N(1)		breast(1)|central_nervous_system(1)|kidney(2)|large_intestine(10)|lung(17)|ovary(1)|pancreas(1)|skin(2)|urinary_tract(2)	37		Colorectal(10;0.168)				AAAAGGATAAGCAATCTATCA	0.458																																						dbGAP											2	Substitution - Missense(2)	breast(2)											113.0	103.0	106.0					18																	6837365		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC033668	CCDS32785.1	18p11.23	2011-06-29				ENSG00000088756		"""Rho GTPase activating proteins"""	25509	protein-coding gene	gene with protein product		610592				10718198	Standard	NM_001010000		Approved	KIAA1314, FLJ10312	uc002kne.3	Q9P2N2		ENST00000383472.4:c.495G>C	18.37:g.6837365G>C	ENSP00000372964:p.Lys165Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	A8MQB7|A8MU88|Q6P160|Q8N4T3|Q9NW53	Missense_Mutation	SNP	pfam_RhoGAP_dom,superfamily_Rho_GTPase_activation_prot,smart_RhoGAP_dom,pfscan_RhoGAP_dom	p.K165N	ENST00000383472.4	37	c.495		18	.	.	.	.	.	.	.	.	.	.	G	16.75	3.209563	0.58343	.	.	ENSG00000088756	ENST00000400091;ENST00000532723;ENST00000262227;ENST00000419673;ENST00000531294;ENST00000314319;ENST00000418986	T;T;T;T;T;T;T	0.33216	1.65;1.42;1.65;2.72;2.74;2.72;2.57	5.65	2.84	0.33178	.	0.043198	0.85682	D	0.000000	T	0.48333	0.1494	L	0.60904	1.88	0.41051	D	0.985309	D;D	0.89917	0.984;1.0	P;D	0.80764	0.902;0.994	T	0.49818	-0.8899	10	0.87932	D	0	.	11.2361	0.48942	0.2021:0.0:0.7979:0.0	.	6;113	F6VKJ9;Q9P2N2-2	.;.	N	165;113;113;6;6;6;6	ENSP00000382963:K165N;ENSP00000433390:K113N;ENSP00000262227:K113N;ENSP00000392660:K6N;ENSP00000437262:K6N;ENSP00000313506:K6N;ENSP00000406907:K6N	ENSP00000262227:K113N	K	+	3	2	ARHGAP28	6827365	1.000000	0.71417	0.999000	0.59377	0.514000	0.34195	1.284000	0.33249	0.834000	0.34852	0.655000	0.94253	AAG	ARHGAP28	-	NULL	ENSG00000088756		0.458	ARHGAP28-006	NOVEL	basic|appris_principal	protein_coding	ARHGAP28	HGNC	protein_coding	OTTHUMT00000442123.3	102	0.00	0	G	XM_371108		6837365	6837365	+1	no_errors	ENST00000400091	ensembl	human	known	69_37n	missense	90	23.08	27	SNP	1.000	C
ASL	435	genome.wustl.edu	37	7	65546799	65546799	+	Missense_Mutation	SNP	C	C	T			TCGA-A1-A0SH-01A-11D-A099-09	TCGA-A1-A0SH-10A-03D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	473d6ae4-162a-4136-b44f-fad42529a31a	7df4bbf4-7ac5-4fd3-b0b9-ca6e49674cfd	g.chr7:65546799C>T	ENST00000304874.9	+	3	124	c.22C>T	c.(22-24)Ctt>Ttt	p.L8F	ASL_ENST00000395332.3_Missense_Mutation_p.L8F|ASL_ENST00000380839.4_Missense_Mutation_p.L8F|ASL_ENST00000395331.3_Missense_Mutation_p.L8F	NM_000048.3	NP_000039.2	P04424	ARLY_HUMAN	argininosuccinate lyase	8					arginine biosynthetic process via ornithine (GO:0042450)|arginine catabolic process (GO:0006527)|cellular nitrogen compound metabolic process (GO:0034641)|internal protein amino acid acetylation (GO:0006475)|small molecule metabolic process (GO:0044281)|urea cycle (GO:0000050)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	argininosuccinate lyase activity (GO:0004056)	p.L8F(1)		breast(3)|endometrium(3)|large_intestine(2)|lung(9)|upper_aerodigestive_tract(1)	18					L-Arginine(DB00125)	GAGTGGGAAGCTTTGGGGTGG	0.532																																						dbGAP											1	Substitution - Missense(1)	breast(1)											66.0	49.0	55.0					7																	65546799		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS5531.1, CCDS47597.1, CCDS47598.1	7q11.21	2012-10-02			ENSG00000126522	ENSG00000126522	4.3.2.1		746	protein-coding gene	gene with protein product		608310					Standard	NM_001024943		Approved		uc003tuo.3	P04424	OTTHUMG00000022876	ENST00000304874.9:c.22C>T	7.37:g.65546799C>T	ENSP00000307188:p.Leu8Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	E7EMI0|E9PE48|Q6LDS5|Q96HS2	Missense_Mutation	SNP	pfam_Lyase1_N,superfamily_L-Aspartase-like,prints_D_crystallin,prints_Fumarate_lyase,tigrfam_Argininosuccinate_lyase	p.L8F	ENST00000304874.9	37	c.22	CCDS5531.1	7	.	.	.	.	.	.	.	.	.	.	c	24.0	4.482139	0.84747	.	.	ENSG00000126522	ENST00000304874;ENST00000380839;ENST00000395332;ENST00000395331	D;D;D;D	0.99376	-5.79;-5.72;-5.79;-5.69	4.9	4.9	0.64082	.	0.000000	0.85682	D	0.000000	D	0.99560	0.9842	H	0.96175	3.78	0.80722	D	1	D;D;D;D	0.69078	0.994;0.997;0.991;0.983	P;D;P;P	0.69142	0.898;0.962;0.786;0.786	D	0.97959	1.0336	10	0.87932	D	0	.	13.8685	0.63603	0.1526:0.8473:0.0:0.0	.	8;8;8;8	B4DU69;E9PE48;E7EMI0;P04424	.;.;.;ARLY_HUMAN	F	8	ENSP00000307188:L8F;ENSP00000370219:L8F;ENSP00000378741:L8F;ENSP00000378740:L8F	ENSP00000307188:L8F	L	+	1	0	ASL	65184234	1.000000	0.71417	0.998000	0.56505	0.992000	0.81027	3.254000	0.51477	2.551000	0.86045	0.561000	0.74099	CTT	ASL	-	tigrfam_Argininosuccinate_lyase	ENSG00000126522		0.532	ASL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ASL	HGNC	protein_coding	OTTHUMT00000251695.2	20	0.00	0	C	NM_000048		65546799	65546799	+1	no_errors	ENST00000304874	ensembl	human	known	69_37n	missense	31	22.50	9	SNP	1.000	T
ATPIF1	93974	genome.wustl.edu	37	1	28562879	28562915	+	Frame_Shift_Del	DEL	ATGTCGACCGGGGCGCGGGCTCCATCCGGGAAGCCGG	ATGTCGACCGGGGCGCGGGCTCCATCCGGGAAGCCGG	-	rs115825196|rs201123839	byFrequency	TCGA-A1-A0SH-01A-11D-A099-09	TCGA-A1-A0SH-10A-03D-A099-09	ATGTCGACCGGGGCGCGGGCTCCATCCGGGAAGCCGG	ATGTCGACCGGGGCGCGGGCTCCATCCGGGAAGCCGG					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	473d6ae4-162a-4136-b44f-fad42529a31a	7df4bbf4-7ac5-4fd3-b0b9-ca6e49674cfd	g.chr1:28562879_28562915delATGTCGACCGGGGCGCGGGCTCCATCCGGGAAGCCGG	ENST00000335514.5	+	2	146_182	c.95_131delATGTCGACCGGGGCGCGGGCTCCATCCGGGAAGCCGG	c.(94-132)aatgtcgaccggggcgcgggctccatccgggaagccggtfs	p.NVDRGAGSIREAG32fs	ATPIF1_ENST00000468425.2_Frame_Shift_Del_p.NVDRGAGSIREAG32fs|ATPIF1_ENST00000497986.1_Frame_Shift_Del_p.NVDRGAGSIREAG32fs|ATPIF1_ENST00000465645.1_Frame_Shift_Del_p.NVDRGAGSIREAG32fs	NM_016311.4	NP_057395.1	Q9UII2	ATIF1_HUMAN	ATPase inhibitory factor 1	32	N-terminal inhibitory region. {ECO:0000250}.				angiogenesis (GO:0001525)|erythrocyte differentiation (GO:0030218)|generation of precursor metabolites and energy (GO:0006091)|heme biosynthetic process (GO:0006783)|negative regulation of endothelial cell proliferation (GO:0001937)|negative regulation of hydrolase activity (GO:0051346)|negative regulation of nucleotide metabolic process (GO:0045980)|positive regulation of mitochondrial outer membrane permeabilization involved in apoptotic signaling pathway (GO:1901030)|protein homooligomerization (GO:0051260)|protein homotetramerization (GO:0051289)|reactive oxygen species metabolic process (GO:0072593)	cell surface (GO:0009986)|mitochondrion (GO:0005739)	angiostatin binding (GO:0043532)|ATPase binding (GO:0051117)|ATPase inhibitor activity (GO:0042030)|calmodulin binding (GO:0005516)|enzyme inhibitor activity (GO:0004857)|protein homodimerization activity (GO:0042803)			lung(4)	4		Colorectal(325;3.46e-05)|Lung NSC(340;4.37e-05)|all_lung(284;4.76e-05)|Renal(390;0.00121)|Breast(348;0.00345)|all_neural(195;0.0208)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0261)		OV - Ovarian serous cystadenocarcinoma(117;2.36e-22)|Colorectal(126;2.96e-08)|COAD - Colon adenocarcinoma(152;1.7e-06)|KIRC - Kidney renal clear cell carcinoma(1967;0.00269)|BRCA - Breast invasive adenocarcinoma(304;0.00574)|STAD - Stomach adenocarcinoma(196;0.00656)|READ - Rectum adenocarcinoma(331;0.0649)		CAGTCCGAGAATGTCGACCGGGGCGCGGGCTCCATCCGGGAAGCCGGTGGGGCCTTC	0.633																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			AL050386	CCDS319.1, CCDS320.1, CCDS44096.1	1p35.3	2011-07-04			ENSG00000130770	ENSG00000130770		"""Mitochondrial respiratory chain complex / Complex V"""	871	protein-coding gene	gene with protein product	"""ATPase inhibitor protein"", ""ATP synthase inhibitor protein"""	614981				10664857, 19559621	Standard	NM_016311		Approved	ATPI, IP, ATPIP, MGC1167, MGC8898	uc001bpq.3	Q9UII2	OTTHUMG00000003533	ENST00000335514.5:c.95_131delATGTCGACCGGGGCGCGGGCTCCATCCGGGAAGCCGG	1.37:g.28562879_28562915delATGTCGACCGGGGCGCGGGCTCCATCCGGGAAGCCGG	ENSP00000335203:p.Asn32fs	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5JXL8|Q6IAQ7|Q9BSL9	Frame_Shift_Del	DEL	pfam_ATPase_inhibitor_IATP_mt	p.N32fs	ENST00000335514.5	37	c.95_131	CCDS319.1	1																																																																																			ATPIF1	-	pfam_ATPase_inhibitor_IATP_mt	ENSG00000130770		0.633	ATPIF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATPIF1	HGNC	protein_coding	OTTHUMT00000009841.1	62	0.00	0	ATGTCGACCGGGGCGCGGGCTCCATCCGGGAAGCCGG	NM_016311		28562879	28562915	+1	no_errors	ENST00000335514	ensembl	human	known	69_37n	frame_shift_del	21	15.38	4	DEL	0.000:0.000:0.000:0.000:0.000:0.002:0.002:0.000:0.000:0.001:0.000:0.000:0.000:0.000:0.001:0.005:0.003:0.998:1.000:1.000:0.997:0.996:0.021:0.252:0.991:0.996:1.000:1.000:0.999:1.000:1.000:0.959:0.997:0.996:0.932:1.000:1.000	-
BDP1	55814	genome.wustl.edu	37	5	70858273	70858273	+	Missense_Mutation	SNP	G	G	C			TCGA-A1-A0SH-01A-11D-A099-09	TCGA-A1-A0SH-10A-03D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	473d6ae4-162a-4136-b44f-fad42529a31a	7df4bbf4-7ac5-4fd3-b0b9-ca6e49674cfd	g.chr5:70858273G>C	ENST00000358731.4	+	38	7932	c.7669G>C	c.(7669-7671)Gag>Cag	p.E2557Q	BDP1_ENST00000380675.2_3'UTR	NM_018429.2	NP_060899.2	A6H8Y1	BDP1_HUMAN	B double prime 1, subunit of RNA polymerase III transcription initiation factor IIIB	2557					gene expression (GO:0010467)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase III promoter (GO:0006383)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)	p.E2557Q(1)		NS(2)|breast(3)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(13)|lung(34)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	72		Lung NSC(167;0.000422)|Prostate(74;0.00815)|Ovarian(174;0.0176)|Breast(144;0.198)		OV - Ovarian serous cystadenocarcinoma(47;5.28e-56)|Epithelial(20;2.31e-50)		AAAAAATCGAGAGTCCTCTGA	0.358																																						dbGAP											1	Substitution - Missense(1)	breast(1)											84.0	77.0	79.0					5																	70858273		1821	4091	5912	-	-	-	SO:0001583	missense	0			AF298151	CCDS43328.1	5q12-q13	2008-02-05	2001-11-29	2001-11-30	ENSG00000145734	ENSG00000145734			13652	protein-coding gene	gene with protein product		607012	"""TATA box binding protein (TBP)-associated factor, RNA polymerase III, GTF3B subunit 1"""	TFNR, TAF3B1		11214970, 11040218	Standard	NM_018429		Approved	TFIIIB150, TFC5, TFIIIB90, KIAA1689, HSA238520, KIAA1241	uc003kbp.1	A6H8Y1	OTTHUMG00000162506	ENST00000358731.4:c.7669G>C	5.37:g.70858273G>C	ENSP00000351575:p.Glu2557Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	Q68DS6|Q68DY5|Q6MZL9|Q6PIM7|Q86W98|Q96LR8|Q9C0H4|Q9H197|Q9H1A1|Q9HAW1|Q9HAW2|Q9HCY0|Q9ULH9	Missense_Mutation	SNP	superfamily_Homeodomain-like,smart_SANT/Myb	p.E2557Q	ENST00000358731.4	37	c.7669	CCDS43328.1	5	.	.	.	.	.	.	.	.	.	.	G	12.27	1.888704	0.33348	.	.	ENSG00000145734	ENST00000358731;ENST00000451951	T	0.06449	3.3	5.87	4.97	0.65823	.	0.735963	0.12602	N	0.454576	T	0.12008	0.0292	M	0.64997	1.995	0.29828	N	0.830282	P	0.44478	0.836	P	0.45276	0.475	T	0.05037	-1.0910	10	0.66056	D	0.02	.	10.1576	0.42831	0.0957:0.0:0.9043:0.0	.	2557	A6H8Y1	BDP1_HUMAN	Q	2557;2105	ENSP00000351575:E2557Q	ENSP00000351575:E2557Q	E	+	1	0	BDP1	70894029	0.995000	0.38212	0.079000	0.20413	0.416000	0.31233	3.552000	0.53705	1.418000	0.47098	0.650000	0.86243	GAG	BDP1	-	NULL	ENSG00000145734		0.358	BDP1-016	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	BDP1	HGNC	protein_coding	OTTHUMT00000374681.2	128	0.76	1	G	NM_018429		70858273	70858273	+1	no_errors	ENST00000358731	ensembl	human	known	69_37n	missense	136	14.37	23	SNP	0.081	C
BLOC1S1	2647	genome.wustl.edu	37	12	56113352	56113352	+	Missense_Mutation	SNP	G	G	C			TCGA-A1-A0SH-01A-11D-A099-09	TCGA-A1-A0SH-10A-03D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	473d6ae4-162a-4136-b44f-fad42529a31a	7df4bbf4-7ac5-4fd3-b0b9-ca6e49674cfd	g.chr12:56113352G>C	ENST00000548925.1	+	4	436	c.421G>C	c.(421-423)Gaa>Caa	p.E141Q	BLOC1S1_ENST00000548556.1_Missense_Mutation_p.E63Q|RP11-644F5.10_ENST00000549424.1_Intron|RP11-644F5.10_ENST00000550412.1_Intron|RDH5_ENST00000548082.1_5'Flank|BLOC1S1_ENST00000547076.1_Missense_Mutation_p.E63Q|BLOC1S1_ENST00000549147.1_3'UTR|RDH5_ENST00000257895.5_5'Flank|RDH5_ENST00000547072.1_5'Flank|BLOC1S1_ENST00000257899.2_Missense_Mutation_p.E113Q			P78537	BL1S1_HUMAN	biogenesis of lysosomal organelles complex-1, subunit 1	141					aerobic respiration (GO:0009060)|anterograde axon cargo transport (GO:0008089)|anterograde synaptic vesicle transport (GO:0048490)|melanosome organization (GO:0032438)|membrane organization (GO:0061024)|neuron projection development (GO:0031175)|peptidyl-lysine acetylation (GO:0018394)|platelet dense granule organization (GO:0060155)|post-Golgi vesicle-mediated transport (GO:0006892)	BLOC-1 complex (GO:0031083)|cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|lysosomal membrane (GO:0005765)|mitochondrial intermembrane space (GO:0005758)|mitochondrial matrix (GO:0005759)		p.E113Q(1)|p.E141Q(1)		breast(1)|endometrium(1)|large_intestine(1)|prostate(1)	4						CACTGCACTGGAATATGTCTA	0.617																																					Colon(112;1254 2715 13015)	dbGAP											2	Substitution - Missense(2)	breast(2)											81.0	72.0	75.0					12																	56113352		2203	4300	6503	-	-	-	SO:0001583	missense	0			S82447	CCDS8889.1, CCDS8889.2	12q13-q14	2012-08-01	2008-08-11	2004-05-26		ENSG00000135441		"""Biogenesis of lysosomal organelles complex-1 subunits"""	4200	protein-coding gene	gene with protein product	"""GCN5 (general control of amino-acid synthesis, yeast, homolog)-like 1"", ""BLOC-1 Subunit 1"", ""Biogenesis of Lysosome-related Organelles complex-1 Subunit 1"""	601444	"""GCN5 general control of amino-acid synthesis 5-like 1 (yeast)"""	GCN5L1		8646881, 15102850	Standard	NM_001487		Approved	BLOS1	uc001shi.4	P78537		ENST00000548925.1:c.421G>C	12.37:g.56113352G>C	ENSP00000447537:p.Glu141Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	A1L4Q9|Q6NZ45	Missense_Mutation	SNP	pfam_GCN5L1	p.E141Q	ENST00000548925.1	37	c.421	CCDS8889.2	12	.	.	.	.	.	.	.	.	.	.	G	27.1	4.796361	0.90453	.	.	ENSG00000135441	ENST00000257899;ENST00000548925;ENST00000547076;ENST00000548556	.	.	.	5.24	5.24	0.73138	.	0.000000	0.85682	D	0.000000	T	0.67813	0.2933	L	0.39326	1.205	0.80722	D	1	D	0.89917	1.0	D	0.70487	0.969	T	0.66160	-0.5993	9	0.41790	T	0.15	-19.7945	16.7135	0.85392	0.0:0.0:1.0:0.0	.	141	P78537	BL1S1_HUMAN	Q	113;141;63;63	.	ENSP00000257899:E113Q	E	+	1	0	BLOC1S1	54399619	1.000000	0.71417	1.000000	0.80357	0.953000	0.61014	9.476000	0.97823	2.614000	0.88457	0.563000	0.77884	GAA	BLOC1S1	-	pfam_GCN5L1	ENSG00000135441		0.617	BLOC1S1-001	KNOWN	downstream_ATG|basic|CCDS	protein_coding	BLOC1S1	HGNC	protein_coding	OTTHUMT00000406681.1	49	0.00	0	G	NM_001487		56113352	56113352	+1	no_errors	ENST00000548925	ensembl	human	known	69_37n	missense	51	19.05	12	SNP	1.000	C
C14orf37	145407	genome.wustl.edu	37	14	58605932	58605932	+	Missense_Mutation	SNP	T	T	C			TCGA-A1-A0SH-01A-11D-A099-09	TCGA-A1-A0SH-10A-03D-A099-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	473d6ae4-162a-4136-b44f-fad42529a31a	7df4bbf4-7ac5-4fd3-b0b9-ca6e49674cfd	g.chr14:58605932T>C	ENST00000267485.7	-	2	339	c.145A>G	c.(145-147)Aag>Gag	p.K49E	C14orf37_ENST00000334342.5_5'UTR	NM_001001872.2	NP_001001872.2	Q86TY3	CN037_HUMAN	chromosome 14 open reading frame 37	49						integral component of membrane (GO:0016021)		p.K49E(1)		breast(7)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(16)|pancreas(1)|skin(1)	33						GTGTTCATCTTATCGGACTGC	0.478																																						dbGAP											1	Substitution - Missense(1)	breast(1)											274.0	270.0	272.0					14																	58605932		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS32089.1	14q23.1	2012-09-03			ENSG00000139971	ENSG00000139971			19846	protein-coding gene	gene with protein product							Standard	NM_001001872		Approved		uc001xdc.3	Q86TY3	OTTHUMG00000171173	ENST00000267485.7:c.145A>G	14.37:g.58605932T>C	ENSP00000267485:p.Lys49Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K8Z8|Q6P5Q1|Q86TY1	Missense_Mutation	SNP	NULL	p.K49E	ENST00000267485.7	37	c.145	CCDS32089.1	14	.	.	.	.	.	.	.	.	.	.	T	11.75	1.730460	0.30684	.	.	ENSG00000139971	ENST00000267485;ENST00000438670	T	0.32753	1.44	5.28	2.75	0.32379	.	0.685442	0.14489	N	0.316459	T	0.20333	0.0489	L	0.34521	1.04	0.09310	N	1	B;B;B;B	0.27732	0.187;0.187;0.187;0.187	B;B;B;B	0.27500	0.058;0.08;0.058;0.058	T	0.16247	-1.0409	10	0.39692	T	0.17	-1.9131	4.9453	0.13985	0.0:0.1044:0.184:0.7116	.	87;49;49;49	B4DMS4;Q86TY3-2;A8K990;Q86TY3	.;.;.;CN037_HUMAN	E	49;87	ENSP00000267485:K49E	ENSP00000267485:K49E	K	-	1	0	C14orf37	57675685	0.026000	0.19158	0.164000	0.22755	0.088000	0.18126	0.304000	0.19228	0.838000	0.34948	0.533000	0.62120	AAG	C14orf37	-	NULL	ENSG00000139971		0.478	C14orf37-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C14orf37	HGNC	protein_coding	OTTHUMT00000412059.1	154	0.00	0	T	NM_001001872		58605932	58605932	-1	no_errors	ENST00000267485	ensembl	human	known	69_37n	missense	124	15.07	22	SNP	0.079	C
CAP2	10486	genome.wustl.edu	37	6	17551770	17551770	+	Missense_Mutation	SNP	G	G	C			TCGA-A1-A0SH-01A-11D-A099-09	TCGA-A1-A0SH-10A-03D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	473d6ae4-162a-4136-b44f-fad42529a31a	7df4bbf4-7ac5-4fd3-b0b9-ca6e49674cfd	g.chr6:17551770G>C	ENST00000229922.2	+	12	1817	c.1285G>C	c.(1285-1287)Gac>Cac	p.D429H	CAP2_ENST00000489374.1_Missense_Mutation_p.D317H|CAP2_ENST00000465994.1_Missense_Mutation_p.D365H|CAP2_ENST00000493172.1_Missense_Mutation_p.D169H|CAP2_ENST00000378990.2_Missense_Mutation_p.D403H	NM_006366.2	NP_006357.1	P40123	CAP2_HUMAN	CAP, adenylate cyclase-associated protein, 2 (yeast)	429	C-CAP/cofactor C-like. {ECO:0000255|PROSITE-ProRule:PRU00659}.				activation of adenylate cyclase activity (GO:0007190)|axon guidance (GO:0007411)|cytoskeleton organization (GO:0007010)|establishment or maintenance of cell polarity (GO:0007163)|signal transduction (GO:0007165)	plasma membrane (GO:0005886)		p.D429H(1)		breast(3)|endometrium(4)|kidney(1)|large_intestine(6)|lung(7)|ovary(1)|skin(4)|urinary_tract(1)	27	Breast(50;0.0333)|Ovarian(93;0.0386)	all_hematologic(90;0.0466)	all cancers(50;0.194)|Epithelial(50;0.227)			AGATGCATTAGACTGTGAGAT	0.398																																						dbGAP											1	Substitution - Missense(1)	breast(1)											158.0	145.0	149.0					6																	17551770		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC008481	CCDS4539.1	6p22.3	2008-02-05			ENSG00000112186	ENSG00000112186			20039	protein-coding gene	gene with protein product						7962207, 8761950	Standard	NM_006366		Approved		uc003ncb.3	P40123	OTTHUMG00000014311	ENST00000229922.2:c.1285G>C	6.37:g.17551770G>C	ENSP00000229922:p.Asp429His	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R5Y3|B7Z1C4|B7Z214|Q6IAY2	Missense_Mutation	SNP	pfam_Adenylate_cyclase-assoc_CAP_N,pfam_Adenylate_cyclase-assoc_CAP_C,superfamily_Adenylate_cyclase-assoc_CAP_N,superfamily_Adenylate_cyclase-assoc_CAP_C,smart_CARP_motif	p.D429H	ENST00000229922.2	37	c.1285	CCDS4539.1	6	.	.	.	.	.	.	.	.	.	.	G	16.45	3.127240	0.56721	.	.	ENSG00000112186	ENST00000229922;ENST00000378994;ENST00000489374;ENST00000378990;ENST00000493172;ENST00000465994	T;T;T;T	0.09350	3.0;3.01;3.0;2.99	5.78	5.78	0.91487	CARP motif (1);Cyclase-associated protein CAP/septum formation inhibitor MinC, C-terminal (1);Adenylate cyclase-associated CAP, C-terminal (2);C-CAP/cofactor C-like domain (1);	0.174558	0.64402	D	0.000008	T	0.12050	0.0293	M	0.74546	2.27	0.58432	D	0.999996	P;P;B;B;B	0.44260	0.619;0.83;0.438;0.297;0.418	B;B;B;B;B	0.39419	0.275;0.299;0.275;0.15;0.167	T	0.02877	-1.1099	10	0.66056	D	0.02	-32.0565	20.3681	0.98887	0.0:0.0:1.0:0.0	.	169;317;365;403;429	B7Z214;B7Z385;B7Z1C4;E9PDI2;P40123	.;.;.;.;CAP2_HUMAN	H	429;346;317;403;169;365	ENSP00000229922:D429H;ENSP00000417705:D317H;ENSP00000368275:D403H;ENSP00000418604:D365H	ENSP00000229922:D429H	D	+	1	0	CAP2	17659749	1.000000	0.71417	0.985000	0.45067	0.996000	0.88848	3.424000	0.52764	2.890000	0.99128	0.655000	0.94253	GAC	CAP2	-	pfam_Adenylate_cyclase-assoc_CAP_C,superfamily_Adenylate_cyclase-assoc_CAP_C,smart_CARP_motif	ENSG00000112186		0.398	CAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CAP2	HGNC	protein_coding	OTTHUMT00000039952.2	120	0.00	0	G			17551770	17551770	+1	no_errors	ENST00000229922	ensembl	human	known	69_37n	missense	138	17.37	29	SNP	1.000	C
CCT8	10694	genome.wustl.edu	37	21	30439299	30439299	+	Missense_Mutation	SNP	C	C	T			TCGA-A1-A0SH-01A-11D-A099-09	TCGA-A1-A0SH-10A-03D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	473d6ae4-162a-4136-b44f-fad42529a31a	7df4bbf4-7ac5-4fd3-b0b9-ca6e49674cfd	g.chr21:30439299C>T	ENST00000286788.4	-	5	681	c.475G>A	c.(475-477)Gaa>Aaa	p.E159K	CCT8_ENST00000542732.1_Missense_Mutation_p.E140K|CCT8_ENST00000470450.1_5'UTR|CCT8_ENST00000540844.1_Missense_Mutation_p.E86K	NM_006585.2	NP_006576.2	P50990	TCPQ_HUMAN	chaperonin containing TCP1, subunit 8 (theta)	159					'de novo' posttranslational protein folding (GO:0051084)|ATP catabolic process (GO:0006200)|binding of sperm to zona pellucida (GO:0007339)|cellular protein metabolic process (GO:0044267)|protein folding (GO:0006457)	aggresome (GO:0016235)|cell body (GO:0044297)|centrosome (GO:0005813)|chaperonin-containing T-complex (GO:0005832)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|intermediate filament cytoskeleton (GO:0045111)|microtubule (GO:0005874)|zona pellucida receptor complex (GO:0002199)	ATP binding (GO:0005524)|ATPase activity, coupled (GO:0042623)	p.E159K(1)		breast(3)|endometrium(1)|kidney(1)|large_intestine(4)|liver(1)|lung(1)|prostate(3)	14						GATGAGACTTCATCAATATCT	0.368																																						dbGAP											1	Substitution - Missense(1)	breast(1)											94.0	89.0	91.0					21																	30439299		2203	4299	6502	-	-	-	SO:0001583	missense	0			Z37163	CCDS33528.1, CCDS68180.1	21q21.3	2011-09-02			ENSG00000156261	ENSG00000156261		"""Heat Shock Proteins / Chaperonins"""	1623	protein-coding gene	gene with protein product			"""chromosome 21 open reading frame 112"""	C21orf112		7890169	Standard	NM_006585		Approved	Cctq, PRED71	uc002ynb.3	P50990	OTTHUMG00000044595	ENST00000286788.4:c.475G>A	21.37:g.30439299C>T	ENSP00000286788:p.Glu159Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NN54|B4DEM7|B4DQH4|Q4VBP8	Missense_Mutation	SNP	pfam_Cpn60/TCP-1,superfamily_Cpn60/TCP-1,prints_Chaperone_TCP-1,tigrfam_Chap_CCT_theta	p.E159K	ENST00000286788.4	37	c.475	CCDS33528.1	21	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	17.52|17.52	3.409841|3.409841	0.62399|0.62399	.|.	.|.	ENSG00000156261|ENSG00000156261	ENST00000389159;ENST00000286788;ENST00000542732;ENST00000540844|ENST00000431234	T;T;T|.	0.78481|.	-1.18;-1.18;-1.18|.	5.73|5.73	5.73|5.73	0.89815|0.89815	.|.	0.045472|.	0.85682|.	D|.	0.000000|.	T|T	0.69314|0.69314	0.3097|0.3097	L|L	0.45422|0.45422	1.42|1.42	0.80722|0.80722	D|D	1|1	B;B;B;P|.	0.42483|.	0.017;0.142;0.013;0.781|.	B;B;B;B|.	0.37346|.	0.022;0.058;0.009;0.247|.	T|T	0.63088|0.63088	-0.6715|-0.6715	10|5	0.23302|.	T|.	0.38|.	-26.7159|-26.7159	20.27|20.27	0.98469|0.98469	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	86;140;158;159|.	B4DQH4;B4DEM7;G5E9B2;P50990|.	.;.;.;TCPQ_HUMAN|.	K|I	158;159;140;86|150	ENSP00000286788:E159K;ENSP00000444984:E140K;ENSP00000442730:E86K|.	ENSP00000286788:E159K|.	E|M	-|-	1|3	0|0	CCT8|CCT8	29361170|29361170	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.828000|0.828000	0.46876|0.46876	5.644000|5.644000	0.67902|0.67902	2.854000|2.854000	0.98071|0.98071	0.655000|0.655000	0.94253|0.94253	GAA|ATG	CCT8	-	pfam_Cpn60/TCP-1,superfamily_Cpn60/TCP-1,tigrfam_Chap_CCT_theta	ENSG00000156261		0.368	CCT8-003	KNOWN	basic|appris_principal|CCDS	protein_coding	CCT8	HGNC	protein_coding	OTTHUMT00000171822.1	141	0.00	0	C			30439299	30439299	-1	no_errors	ENST00000286788	ensembl	human	known	69_37n	missense	125	19.87	31	SNP	1.000	T
CDCA2	157313	genome.wustl.edu	37	8	25364913	25364913	+	Missense_Mutation	SNP	C	C	T			TCGA-A1-A0SH-01A-11D-A099-09	TCGA-A1-A0SH-10A-03D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	473d6ae4-162a-4136-b44f-fad42529a31a	7df4bbf4-7ac5-4fd3-b0b9-ca6e49674cfd	g.chr8:25364913C>T	ENST00000330560.3	+	15	3208	c.2731C>T	c.(2731-2733)Cca>Tca	p.P911S	CDCA2_ENST00000521098.2_3'UTR|CDCA2_ENST00000380665.3_Missense_Mutation_p.P896S	NM_152562.2	NP_689775.2	Q69YH5	CDCA2_HUMAN	cell division cycle associated 2	911					mitotic nuclear division (GO:0007067)|positive regulation of protein dephosphorylation (GO:0035307)	chromosome (GO:0005694)|cytoplasm (GO:0005737)|nucleus (GO:0005634)		p.P911S(1)		breast(3)|cervix(1)|endometrium(3)|kidney(7)|large_intestine(7)|lung(10)|ovary(1)|prostate(3)	35		all_cancers(63;0.0378)|Ovarian(32;0.000878)|all_epithelial(46;0.0162)|Breast(100;0.0164)|Prostate(55;0.191)		UCEC - Uterine corpus endometrioid carcinoma (27;0.022)|Epithelial(17;1.37e-11)|Colorectal(74;0.0129)|COAD - Colon adenocarcinoma(73;0.0443)		GATTTCACTTCCACTTCCTTC	0.408																																						dbGAP											1	Substitution - Missense(1)	breast(1)											146.0	156.0	153.0					8																	25364913		2203	4300	6503	-	-	-	SO:0001583	missense	0			BG354575	CCDS6049.1	8p21.2	2014-06-12			ENSG00000184661	ENSG00000184661			14623	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 81"""					12188893, 16492807	Standard	NM_152562		Approved	Repo-Man, PPP1R81	uc003xep.1	Q69YH5	OTTHUMG00000099429	ENST00000330560.3:c.2731C>T	8.37:g.25364913C>T	ENSP00000328228:p.Pro911Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	Q3SX74|Q4G0W0|Q5RKN0|Q69YI4|Q6P464|Q8N7C1	Missense_Mutation	SNP	NULL	p.P911S	ENST00000330560.3	37	c.2731	CCDS6049.1	8	.	.	.	.	.	.	.	.	.	.	C	12.17	1.856977	0.32791	.	.	ENSG00000184661	ENST00000330560;ENST00000380665;ENST00000434814	T;T	0.43688	0.94;0.94	5.49	4.61	0.57282	.	0.337955	0.27411	N	0.019491	T	0.47985	0.1475	L	0.34521	1.04	0.20196	N	0.999924	D;D	0.55605	0.972;0.972	P;P	0.58130	0.833;0.833	T	0.40720	-0.9548	10	0.56958	D	0.05	-12.0838	13.4032	0.60896	0.0:0.8422:0.1578:0.0	.	896;911	E9PEI0;Q69YH5	.;CDCA2_HUMAN	S	911;896;310	ENSP00000328228:P911S;ENSP00000370040:P896S	ENSP00000328228:P911S	P	+	1	0	CDCA2	25420830	0.012000	0.17670	0.115000	0.21578	0.402000	0.30811	1.183000	0.32041	1.302000	0.44855	0.650000	0.86243	CCA	CDCA2	-	NULL	ENSG00000184661		0.408	CDCA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDCA2	HGNC	protein_coding	OTTHUMT00000216891.3	88	0.00	0	C	NM_152562		25364913	25364913	+1	no_errors	ENST00000330560	ensembl	human	known	69_37n	missense	65	20.73	17	SNP	0.286	T
CDK18	5129	genome.wustl.edu	37	1	205494302	205494302	+	Silent	SNP	G	G	C			TCGA-A1-A0SH-01A-11D-A099-09	TCGA-A1-A0SH-10A-03D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	473d6ae4-162a-4136-b44f-fad42529a31a	7df4bbf4-7ac5-4fd3-b0b9-ca6e49674cfd	g.chr1:205494302G>C	ENST00000360066.2	+	5	736	c.435G>C	c.(433-435)gtG>gtC	p.V145V	CDK18_ENST00000429964.2_Silent_p.V145V|CDK18_ENST00000509056.1_3'UTR|CDK18_ENST00000506784.1_Silent_p.V175V	NM_002596.3|NM_212502.2|NM_212503.2	NP_002587.2|NP_997667.1|NP_997668.1	Q07002	CDK18_HUMAN	cyclin-dependent kinase 18	143	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.						ATP binding (GO:0005524)|cyclin-dependent protein serine/threonine kinase activity (GO:0004693)	p.V145V(1)|p.V175V(1)		breast(2)|endometrium(2)|large_intestine(2)|lung(10)|stomach(2)|urinary_tract(1)	19						AAACATACGTGAAACTGGACA	0.547																																					Pancreas(180;489 2072 28461 40831 44265)	dbGAP											2	Substitution - coding silent(2)	breast(2)											141.0	121.0	128.0					1																	205494302		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			X66362	CCDS1454.1, CCDS44300.1	1q31-q32	2011-11-08	2009-12-16	2009-12-16	ENSG00000117266	ENSG00000117266		"""Cyclin-dependent kinases"""	8751	protein-coding gene	gene with protein product		169190	"""PCTAIRE protein kinase 3"""	PCTK3		1437147, 19884882	Standard	NM_002596		Approved	PCTAIRE3	uc010pri.2	Q07002	OTTHUMG00000037203	ENST00000360066.2:c.435G>C	1.37:g.205494302G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	Q5VXQ2|Q6V3A2|Q6V3A3|Q96F90	Silent	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.V175	ENST00000360066.2	37	c.525	CCDS44300.1	1																																																																																			CDK18	-	pfam_Prot_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	ENSG00000117266		0.547	CDK18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDK18	HGNC	protein_coding	OTTHUMT00000090407.2	149	0.00	0	G	NM_002596		205494302	205494302	+1	no_errors	ENST00000506784	ensembl	human	known	69_37n	silent	233	26.03	82	SNP	0.997	C
CHCHD1	118487	genome.wustl.edu	37	10	75541933	75541933	+	Missense_Mutation	SNP	G	G	T			TCGA-A1-A0SH-01A-11D-A099-09	TCGA-A1-A0SH-10A-03D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	473d6ae4-162a-4136-b44f-fad42529a31a	7df4bbf4-7ac5-4fd3-b0b9-ca6e49674cfd	g.chr10:75541933G>T	ENST00000372833.5	+	1	113	c.100G>T	c.(100-102)Ggg>Tgg	p.G34W	CHCHD1_ENST00000372837.3_Missense_Mutation_p.G34W	NM_203298.2	NP_976043.1	Q96BP2	CHCH1_HUMAN	coiled-coil-helix-coiled-coil-helix domain containing 1	34	CHCH.					cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)	p.G34W(1)		breast(1)	1	Prostate(51;0.0112)					TAACCGCGTCGGGGAGCGGCG	0.677																																						dbGAP											1	Substitution - Missense(1)	breast(1)											44.0	54.0	51.0					10																	75541933		2203	4299	6502	-	-	-	SO:0001583	missense	0			AK098720	CCDS7334.1	10q22.3	2014-02-12	2004-01-19		ENSG00000172586	ENSG00000172586		"""Coiled-coil-helix-coiled-coil-helix domain containing"""	23518	protein-coding gene	gene with protein product		608842	"""chromosome 10 open reading frame 34"""	C10orf34			Standard	NM_203298		Approved	FLJ25854	uc001jvc.4	Q96BP2	OTTHUMG00000018475	ENST00000372833.5:c.100G>T	10.37:g.75541933G>T	ENSP00000361923:p.Gly34Trp	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_CHCH,superfamily_MTCP1	p.G34W	ENST00000372833.5	37	c.100	CCDS7334.1	10	.	.	.	.	.	.	.	.	.	.	G	20.6	4.013821	0.75161	.	.	ENSG00000172586	ENST00000372837;ENST00000372833	.	.	.	5.58	5.58	0.84498	.	0.202659	0.38897	N	0.001537	T	0.76891	0.4051	L	0.57536	1.79	0.38052	D	0.935811	D;D	0.89917	0.99;1.0	P;D	0.83275	0.731;0.996	T	0.80308	-0.1437	9	0.87932	D	0	-21.4644	17.0659	0.86559	0.0:0.0:1.0:0.0	.	34;34	Q96BP2;A6NJX6	CHCH1_HUMAN;.	W	34	.	ENSP00000361923:G34W	G	+	1	0	CHCHD1	75211939	1.000000	0.71417	0.790000	0.31976	0.119000	0.20118	5.442000	0.66575	2.630000	0.89119	0.655000	0.94253	GGG	CHCHD1	-	NULL	ENSG00000172586		0.677	CHCHD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHCHD1	HGNC	protein_coding	OTTHUMT00000048676.1	25	0.00	0	G	XM_058325		75541933	75541933	+1	no_errors	ENST00000372833	ensembl	human	known	69_37n	missense	26	16.13	5	SNP	0.970	T
CNTN4	152330	genome.wustl.edu	37	3	3078931	3078931	+	Missense_Mutation	SNP	G	G	C			TCGA-A1-A0SH-01A-11D-A099-09	TCGA-A1-A0SH-10A-03D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	473d6ae4-162a-4136-b44f-fad42529a31a	7df4bbf4-7ac5-4fd3-b0b9-ca6e49674cfd	g.chr3:3078931G>C	ENST00000397461.1	+	17	2395	c.2011G>C	c.(2011-2013)Gaa>Caa	p.E671Q	CNTN4-AS1_ENST00000442749.2_RNA|CNTN4_ENST00000418658.1_Missense_Mutation_p.E671Q|CNTN4_ENST00000358480.3_Missense_Mutation_p.E452Q|CNTN4_ENST00000397459.2_Missense_Mutation_p.E343Q|CNTN4_ENST00000448906.2_Missense_Mutation_p.E343Q|CNTN4_ENST00000427331.1_Missense_Mutation_p.E671Q	NM_001206955.1	NP_001193884.1	Q8IWV2	CNTN4_HUMAN	contactin 4	671	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.				axon guidance (GO:0007411)|axonal fasciculation (GO:0007413)|axonogenesis (GO:0007409)|brain development (GO:0007420)|negative regulation of neuron differentiation (GO:0045665)|nervous system development (GO:0007399)|neuron cell-cell adhesion (GO:0007158)|neuron projection development (GO:0031175)|regulation of synaptic plasticity (GO:0048167)	anchored component of membrane (GO:0031225)|axon (GO:0030424)|extracellular region (GO:0005576)|plasma membrane (GO:0005886)		p.E343Q(1)|p.E671Q(1)		NS(1)|breast(4)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(14)|lung(19)|ovary(2)|pancreas(4)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	61		Ovarian(110;0.156)		Epithelial(13;0.000695)|all cancers(10;0.0047)|OV - Ovarian serous cystadenocarcinoma(96;0.01)		GGTTGAATATGAATTCCGCAC	0.522																																						dbGAP											2	Substitution - Missense(2)	breast(2)											182.0	185.0	184.0					3																	3078931		2203	4300	6503	-	-	-	SO:0001583	missense	0			AW665944	CCDS2558.1, CCDS43041.1	3p26.3	2013-02-11			ENSG00000144619	ENSG00000144619		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	2174	protein-coding gene	gene with protein product		607280				8586965, 12202991	Standard	NM_175607		Approved	BIG-2	uc003bpc.3	Q8IWV2	OTTHUMG00000119031	ENST00000397461.1:c.2011G>C	3.37:g.3078931G>C	ENSP00000380602:p.Glu671Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RAX3|Q8IX14|Q8TC35	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Fibronectin_type3,pfam_Ig_V-set,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like	p.E671Q	ENST00000397461.1	37	c.2011	CCDS43041.1	3	.	.	.	.	.	.	.	.	.	.	G	31	5.066335	0.93898	.	.	ENSG00000144619	ENST00000418658;ENST00000397461;ENST00000427331;ENST00000358480;ENST00000397459;ENST00000448906	T;T;T;T;T;T	0.58358	0.34;0.34;0.34;0.34;0.34;0.34	5.48	5.48	0.80851	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	T	0.69593	0.3128	L	0.53780	1.695	0.80722	D	1	D;D;D	0.89917	0.999;0.999;1.0	D;D;D	0.87578	0.991;0.991;0.998	T	0.66744	-0.5846	10	0.39692	T	0.17	.	19.387	0.94560	0.0:0.0:1.0:0.0	.	670;671;671	Q8IWV2-3;B3KTK4;Q8IWV2	.;.;CNTN4_HUMAN	Q	671;671;671;452;343;343	ENSP00000396010:E671Q;ENSP00000380602:E671Q;ENSP00000413642:E671Q;ENSP00000351267:E452Q;ENSP00000380600:E343Q;ENSP00000392077:E343Q	ENSP00000351267:E452Q	E	+	1	0	CNTN4	3053931	1.000000	0.71417	0.986000	0.45419	0.816000	0.46133	9.640000	0.98453	2.572000	0.86782	0.655000	0.94253	GAA	CNTN4	-	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000144619		0.522	CNTN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CNTN4	HGNC	protein_coding	OTTHUMT00000239236.2	80	0.00	0	G			3078931	3078931	+1	no_errors	ENST00000397461	ensembl	human	known	69_37n	missense	83	23.15	25	SNP	1.000	C
COL14A1	7373	genome.wustl.edu	37	8	121209170	121209170	+	Missense_Mutation	SNP	G	G	C			TCGA-A1-A0SH-01A-11D-A099-09	TCGA-A1-A0SH-10A-03D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	473d6ae4-162a-4136-b44f-fad42529a31a	7df4bbf4-7ac5-4fd3-b0b9-ca6e49674cfd	g.chr8:121209170G>C	ENST00000297848.3	+	6	847	c.577G>C	c.(577-579)Gag>Cag	p.E193Q	COL14A1_ENST00000432943.2_3'UTR|COL14A1_ENST00000309791.4_Missense_Mutation_p.E193Q|COL14A1_ENST00000537875.1_Missense_Mutation_p.E193Q|COL14A1_ENST00000247781.3_Missense_Mutation_p.E193Q	NM_021110.1	NP_066933.1			collagen, type XIV, alpha 1									p.E193Q(1)		NS(1)|autonomic_ganglia(1)|breast(11)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(9)|large_intestine(31)|lung(42)|ovary(5)|pancreas(1)|prostate(1)|skin(8)|stomach(2)|upper_aerodigestive_tract(2)	119	Lung NSC(37;6.52e-07)|Ovarian(258;0.00769)|Hepatocellular(40;0.161)		OV - Ovarian serous cystadenocarcinoma(1;6.47e-38)|STAD - Stomach adenocarcinoma(47;0.00503)			TGTGGGCTCAGAGAAGACACG	0.388																																						dbGAP											1	Substitution - Missense(1)	breast(1)											166.0	155.0	159.0					8																	121209170		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS34938.1	8q23	2013-02-11	2008-02-04		ENSG00000187955	ENSG00000187955		"""Collagens"", ""Fibronectin type III domain containing"""	2191	protein-coding gene	gene with protein product		120324	"""undulin"""	UND		1716629, 9427527	Standard	NM_021110		Approved		uc003yox.4	Q05707	OTTHUMG00000149877	ENST00000297848.3:c.577G>C	8.37:g.121209170G>C	ENSP00000297848:p.Glu193Gln	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_VWF_A,pfam_Fibronectin_type3,pfam_Collagen,superfamily_ConA-like_lec_gl,superfamily_Fibronectin_type3,smart_Fibronectin_type3,smart_VWF_A,smart_Laminin_G,pfscan_Fibronectin_type3,pfscan_VWF_A	p.E193Q	ENST00000297848.3	37	c.577	CCDS34938.1	8	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	19.50|19.50	3.838509|3.838509	0.71373|0.71373	.|.	.|.	ENSG00000187955|ENSG00000187955	ENST00000537875;ENST00000309791;ENST00000297848;ENST00000247781;ENST00000434620|ENST00000523142	D;D;D;D;D|.	0.84146|.	-1.81;-1.81;-1.81;-1.81;-1.81|.	5.43|5.43	4.48|4.48	0.54585|0.54585	von Willebrand factor, type A (3);|.	0.267459|.	0.42053|.	D|.	0.000778|.	T|T	0.56187|0.56187	0.1968|0.1968	L|L	0.35593|0.35593	1.075|1.075	0.37953|0.37953	D|D	0.932713|0.932713	P|.	0.40302|.	0.712|.	B|.	0.38985|.	0.287|.	T|T	0.54977|0.54977	-0.8212|-0.8212	10|5	0.19147|.	T|.	0.46|.	.|.	14.7726|14.7726	0.69691|0.69691	0.0789:0.0:0.9211:0.0|0.0789:0.0:0.9211:0.0	.|.	193|.	Q05707|.	COEA1_HUMAN|.	Q|T	193;193;193;193;6|44	ENSP00000443974:E193Q;ENSP00000311809:E193Q;ENSP00000297848:E193Q;ENSP00000247781:E193Q;ENSP00000409461:E6Q|.	ENSP00000247781:E193Q|.	E|R	+|+	1|2	0|0	COL14A1|COL14A1	121278351|121278351	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.977000|0.977000	0.68977|0.68977	6.506000|6.506000	0.73712|0.73712	2.827000|2.827000	0.97445|0.97445	0.650000|0.650000	0.86243|0.86243	GAG|AGA	COL14A1	-	pfam_VWF_A,smart_VWF_A,pfscan_VWF_A	ENSG00000187955		0.388	COL14A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL14A1	HGNC	protein_coding	OTTHUMT00000313657.2	127	0.00	0	G	NM_021110		121209170	121209170	+1	no_errors	ENST00000297848	ensembl	human	known	69_37n	missense	127	23.95	40	SNP	0.999	C
COL7A1	1294	genome.wustl.edu	37	3	48612826	48612826	+	Silent	SNP	G	G	A			TCGA-A1-A0SH-01A-11D-A099-09	TCGA-A1-A0SH-10A-03D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	473d6ae4-162a-4136-b44f-fad42529a31a	7df4bbf4-7ac5-4fd3-b0b9-ca6e49674cfd	g.chr3:48612826G>A	ENST00000328333.8	-	73	6233	c.6126C>T	c.(6124-6126)ccC>ccT	p.P2042P	COL7A1_ENST00000454817.1_Silent_p.P2010P	NM_000094.3	NP_000085.1	Q02388	CO7A1_HUMAN	collagen, type VII, alpha 1	2042	Triple-helical region.				cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|endodermal cell differentiation (GO:0035987)|epidermis development (GO:0008544)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)	basement membrane (GO:0005604)|collagen type VII trimer (GO:0005590)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular space (GO:0005615)	serine-type endopeptidase inhibitor activity (GO:0004867)	p.P2042P(1)		NS(3)|breast(8)|central_nervous_system(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(18)|lung(57)|ovary(7)|prostate(5)|skin(9)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(5)	137				BRCA - Breast invasive adenocarcinoma(193;0.000293)|KIRC - Kidney renal clear cell carcinoma(197;0.00558)|Kidney(197;0.00632)		CTGGGAGCCCGGGAATACCAG	0.716																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											17.0	20.0	19.0					3																	48612826		2198	4283	6481	-	-	-	SO:0001819	synonymous_variant	0			L02870	CCDS2773.1	3p21.1	2014-09-17	2008-08-01		ENSG00000114270	ENSG00000114270		"""Collagens"", ""Fibronectin type III domain containing"""	2214	protein-coding gene	gene with protein product	"""collagen VII, alpha-1 polypeptide"", ""LC collagen"""	120120	"""epidermolysis bullosa, dystrophic, dominant and recessive"""	EBDCT, EBD1, EBR1		1871109	Standard	NM_000094		Approved		uc003ctz.2	Q02388	OTTHUMG00000133541	ENST00000328333.8:c.6126C>T	3.37:g.48612826G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q14054|Q16507	Silent	SNP	pfam_Collagen,pfam_Fibronectin_type3,pfam_VWF_A,pfam_Prot_inh_Kunz-m,superfamily_Fibronectin_type3,superfamily_Prot_inh_Kunz-m,smart_VWF_A,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_VWF_A,pfscan_Prot_inh_Kunz-m,prints_Prot_inh_Kunz-m	p.P2042	ENST00000328333.8	37	c.6126	CCDS2773.1	3																																																																																			COL7A1	-	pfam_Collagen	ENSG00000114270		0.716	COL7A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL7A1	HGNC	protein_coding	OTTHUMT00000257519.1	41	0.00	0	G	NM_000094		48612826	48612826	-1	no_errors	ENST00000328333	ensembl	human	known	69_37n	silent	39	15.22	7	SNP	0.996	A
CSMD1	64478	genome.wustl.edu	37	8	2967831	2967831	+	Nonsense_Mutation	SNP	G	G	A			TCGA-A1-A0SH-01A-11D-A099-09	TCGA-A1-A0SH-10A-03D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	473d6ae4-162a-4136-b44f-fad42529a31a	7df4bbf4-7ac5-4fd3-b0b9-ca6e49674cfd	g.chr8:2967831G>A	ENST00000520002.1	-	44	7015	c.6460C>T	c.(6460-6462)Cag>Tag	p.Q2154*	CSMD1_ENST00000537824.1_Nonsense_Mutation_p.Q2153*|CSMD1_ENST00000602723.1_Nonsense_Mutation_p.Q2154*|CSMD1_ENST00000400186.3_Nonsense_Mutation_p.Q2154*|CSMD1_ENST00000542608.1_Nonsense_Mutation_p.Q2153*|CSMD1_ENST00000602557.1_Nonsense_Mutation_p.Q2154*			Q96PZ7	CSMD1_HUMAN	CUB and Sushi multiple domains 1	2154	CUB 13. {ECO:0000255|PROSITE- ProRule:PRU00059}.					integral component of membrane (GO:0016021)		p.Q1882*(1)|p.Q2153*(1)		breast(20)|large_intestine(5)	25		all_cancers(1;5.7e-41)|all_epithelial(1;2.54e-36)|Lung NSC(1;7.54e-11)|all_lung(1;3.2e-10)|Hepatocellular(1;3.78e-05)|Breast(1;0.000196)|Myeloproliferative disorder(4;0.000374)|Esophageal squamous(1;0.0157)|Ovarian(12;0.091)|Renal(68;0.144)|Colorectal(14;0.234)		all cancers(1;5.03e-41)|Epithelial(1;4.78e-31)|Lung(1;1.14e-14)|LUSC - Lung squamous cell carcinoma(1;2.34e-14)|GBM - Glioblastoma multiforme(1;4.49e-10)|Colorectal(4;1.18e-07)|OV - Ovarian serous cystadenocarcinoma(1;3.2e-07)|BRCA - Breast invasive adenocarcinoma(1;6.17e-07)|COAD - Colon adenocarcinoma(4;0.000539)|READ - Rectum adenocarcinoma(4;0.00896)|Kidney(5;0.00957)|KIRC - Kidney renal clear cell carcinoma(5;0.0689)		GTGCCGTTCTGAGAAGTTACG	0.478																																						dbGAP											2	Substitution - Nonsense(2)	breast(2)											77.0	76.0	76.0					8																	2967831		1908	4125	6033	-	-	-	SO:0001587	stop_gained	0					8p23.2	2012-04-17			ENSG00000183117	ENSG00000183117		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	14026	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 24"""	608397					Standard	NM_033225		Approved	KIAA1890, PPP1R24	uc022aqr.1	Q96PZ7	OTTHUMG00000163605	ENST00000520002.1:c.6460C>T	8.37:g.2967831G>A	ENSP00000430733:p.Gln2154*	Somatic		WXS	Illumina GAIIx	Phase_IV	Q0H0J5|Q96QU9|Q96RM4	Nonsense_Mutation	SNP	pfam_CUB,pfam_Sushi_SCR_CCP,superfamily_CUB,superfamily_Complement_control_module,smart_CUB,smart_Sushi_SCR_CCP,pfscan_CUB,pfscan_Sushi_SCR_CCP	p.Q2154*	ENST00000520002.1	37	c.6460		8	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	46|46	12.646569|12.646569	0.99685|0.99685	.|.	.|.	ENSG00000183117|ENSG00000183117	ENST00000400186;ENST00000520002;ENST00000318252;ENST00000537824;ENST00000542608|ENST00000335551	.|T	.|0.18960	.|2.18	5.2|5.2	4.31|4.31	0.51392|0.51392	.|.	0.072823|.	0.56097|.	D|.	0.000033|.	.|T	.|0.24586	.|0.0596	.|.	.|.	.|.	0.40179|0.40179	D|D	0.977279|0.977279	.|.	.|.	.|.	.|.	.|.	.|.	.|T	.|0.03933	.|-1.0991	.|6	0.07325|0.27082	T|T	0.83|0.32	.|.	9.0413|9.0413	0.36319|0.36319	0.075:0.2823:0.6427:0.0|0.075:0.2823:0.6427:0.0	.|.	.|.	.|.	.|.	X|L	2154;2154;2015;2153;2153|1633	.|ENSP00000334828:S1633L	ENSP00000320445:Q2015X|ENSP00000334828:S1633L	Q|S	-|-	1|2	0|0	CSMD1|CSMD1	2955238|2955238	1.000000|1.000000	0.71417|0.71417	0.141000|0.141000	0.22245|0.22245	0.202000|0.202000	0.24057|0.24057	3.150000|3.150000	0.50662|0.50662	1.292000|1.292000	0.44672|0.44672	0.453000|0.453000	0.30009|0.30009	CAG|TCA	CSMD1	-	pfam_CUB,superfamily_CUB,smart_CUB,pfscan_CUB	ENSG00000183117		0.478	CSMD1-001	KNOWN	basic|appris_candidate_longest	protein_coding	CSMD1	HGNC	protein_coding	OTTHUMT00000374500.2	127	0.00	0	G	NM_033225		2967831	2967831	-1	no_errors	ENST00000520002	ensembl	human	known	69_37n	nonsense	118	23.38	36	SNP	0.484	A
CUBN	8029	genome.wustl.edu	37	10	16979594	16979594	+	Missense_Mutation	SNP	G	G	A			TCGA-A1-A0SH-01A-11D-A099-09	TCGA-A1-A0SH-10A-03D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	473d6ae4-162a-4136-b44f-fad42529a31a	7df4bbf4-7ac5-4fd3-b0b9-ca6e49674cfd	g.chr10:16979594G>A	ENST00000377833.4	-	39	5988	c.5923C>T	c.(5923-5925)Cca>Tca	p.P1975S		NM_001081.3	NP_001072.2	O60494	CUBN_HUMAN	cubilin (intrinsic factor-cobalamin receptor)	1975					cholesterol metabolic process (GO:0008203)|cobalamin metabolic process (GO:0009235)|cobalamin transport (GO:0015889)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|receptor-mediated endocytosis (GO:0006898)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|tissue homeostasis (GO:0001894)|vitamin D metabolic process (GO:0042359)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|coated pit (GO:0005905)|cytosol (GO:0005829)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|extrinsic component of external side of plasma membrane (GO:0031232)|Golgi apparatus (GO:0005794)|lysosomal lumen (GO:0043202)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|cobalamin binding (GO:0031419)|protein homodimerization activity (GO:0042803)|receptor activity (GO:0004872)|transporter activity (GO:0005215)	p.P1975S(1)		breast(8)|central_nervous_system(4)|cervix(1)|endometrium(18)|haematopoietic_and_lymphoid_tissue(3)|kidney(12)|large_intestine(42)|liver(1)|lung(107)|ovary(9)|pancreas(2)|prostate(3)|skin(9)|stomach(3)|upper_aerodigestive_tract(11)|urinary_tract(8)	241					Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)	AACACACCTGGAGCAATGGTA	0.403																																						dbGAP											1	Substitution - Missense(1)	breast(1)											44.0	45.0	44.0					10																	16979594		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF034611	CCDS7113.1	10p12	2014-09-17			ENSG00000107611	ENSG00000107611			2548	protein-coding gene	gene with protein product		602997		MGA1		9572993, 9478979	Standard	NM_001081		Approved	IFCR, gp280	uc001ioo.3	O60494	OTTHUMG00000017741	ENST00000377833.4:c.5923C>T	10.37:g.16979594G>A	ENSP00000367064:p.Pro1975Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	B0YIZ4|Q5VTA6|Q96RU9	Missense_Mutation	SNP	pfam_CUB,pfam_EGF-like_dom,pfam_EGF-like_Ca-bd,superfamily_CUB,superfamily_Growth_fac_rcpt,smart_EGF-like_Ca-bd,smart_EGF-like,smart_CUB,pfscan_CUB,pfscan_EG-like_dom	p.P1975S	ENST00000377833.4	37	c.5923	CCDS7113.1	10	.	.	.	.	.	.	.	.	.	.	G	13.27	2.187292	0.38609	.	.	ENSG00000107611	ENST00000377833	T	0.75704	-0.96	5.24	-10.5	0.00291	.	0.705094	0.11607	N	0.547145	T	0.46698	0.1406	L	0.33485	1.01	0.43598	D	0.995953	P	0.37122	0.583	B	0.30646	0.118	T	0.51379	-0.8713	10	0.07644	T	0.81	.	8.8481	0.35184	0.0704:0.1695:0.5891:0.171	.	1975	O60494	CUBN_HUMAN	S	1975	ENSP00000367064:P1975S	ENSP00000367064:P1975S	P	-	1	0	CUBN	17019600	0.438000	0.25602	0.261000	0.24466	0.936000	0.57629	-0.759000	0.04761	-2.469000	0.00531	0.591000	0.81541	CCA	CUBN	-	NULL	ENSG00000107611		0.403	CUBN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CUBN	HGNC	protein_coding	OTTHUMT00000047009.1	87	0.00	0	G	NM_001081		16979594	16979594	-1	no_errors	ENST00000377833	ensembl	human	known	69_37n	missense	69	23.33	21	SNP	0.300	A
CYP7A1	1581	genome.wustl.edu	37	8	59405044	59405044	+	Silent	SNP	G	G	C			TCGA-A1-A0SH-01A-11D-A099-09	TCGA-A1-A0SH-10A-03D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	473d6ae4-162a-4136-b44f-fad42529a31a	7df4bbf4-7ac5-4fd3-b0b9-ca6e49674cfd	g.chr8:59405044G>C	ENST00000301645.3	-	5	1220	c.1083C>G	c.(1081-1083)ctC>ctG	p.L361L		NM_000780.3	NP_000771.2	P22680	CP7A1_HUMAN	cytochrome P450, family 7, subfamily A, polypeptide 1	361					bile acid biosynthetic process (GO:0006699)|bile acid metabolic process (GO:0008206)|cellular lipid metabolic process (GO:0044255)|cellular response to cholesterol (GO:0071397)|cellular response to glucose stimulus (GO:0071333)|cholesterol catabolic process (GO:0006707)|cholesterol homeostasis (GO:0042632)|regulation of bile acid biosynthetic process (GO:0070857)|small molecule metabolic process (GO:0044281)|sterol metabolic process (GO:0016125)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)|intracellular membrane-bounded organelle (GO:0043231)	cholesterol 7-alpha-monooxygenase activity (GO:0008123)|heme binding (GO:0020037)|iron ion binding (GO:0005506)	p.L361L(1)		breast(4)|endometrium(1)|kidney(2)|large_intestine(5)|lung(19)|ovary(1)|prostate(1)|urinary_tract(1)	34		all_lung(136;0.0271)|Lung NSC(129;0.0351)|all_epithelial(80;0.0554)				TCCGGATGTTGAGGGAGGCAC	0.408									Neonatal Giant Cell Hepatitis																													dbGAP											1	Substitution - coding silent(1)	breast(1)											119.0	108.0	111.0					8																	59405044		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0	Familial Cancer Database	Neonatal Hemochromatosis	M89803	CCDS6171.1	8q11-q12	2010-05-04	2003-01-14		ENSG00000167910	ENSG00000167910	1.14.13.17	"""Cytochrome P450s"""	2651	protein-coding gene	gene with protein product	"""cholesterol 7 alpha-monooxygenase"""	118455	"""cytochrome P450, subfamily VIIA (cholesterol 7 alpha-monooxygenase), polypeptide 1"""	CYP7		1358792	Standard	NM_000780		Approved		uc003xtm.4	P22680	OTTHUMG00000164301	ENST00000301645.3:c.1083C>G	8.37:g.59405044G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	P78454|Q3MIL8|Q7KZ19	Silent	SNP	pfam_Cyt_P450,superfamily_Cyt_P450,prints_Cyt_P450_E_grp-IV,prints_Cyt_P450_E_grp-I	p.L361	ENST00000301645.3	37	c.1083	CCDS6171.1	8																																																																																			CYP7A1	-	pfam_Cyt_P450,superfamily_Cyt_P450	ENSG00000167910		0.408	CYP7A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CYP7A1	HGNC	protein_coding	OTTHUMT00000378190.1	100	0.96	1	G	NM_000780		59405044	59405044	-1	no_errors	ENST00000301645	ensembl	human	known	69_37n	silent	100	19.35	24	SNP	0.999	C
DAPK2	23604	genome.wustl.edu	37	15	64204356	64204356	+	Missense_Mutation	SNP	A	A	T			TCGA-A1-A0SH-01A-11D-A099-09	TCGA-A1-A0SH-10A-03D-A099-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	473d6ae4-162a-4136-b44f-fad42529a31a	7df4bbf4-7ac5-4fd3-b0b9-ca6e49674cfd	g.chr15:64204356A>T	ENST00000457488.1	-	10	929	c.899T>A	c.(898-900)gTg>gAg	p.V300E	DAPK2_ENST00000261891.3_Missense_Mutation_p.V300E	NM_014326.3	NP_055141.2	Q9UIK4	DAPK2_HUMAN	death-associated protein kinase 2	300	Autoinhibitory domain. {ECO:0000250}.|Calmodulin-binding.				anoikis (GO:0043276)|apoptotic process (GO:0006915)|intracellular signal transduction (GO:0035556)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of apoptotic process (GO:0042981)|regulation of autophagy (GO:0010506)|regulation of intrinsic apoptotic signaling pathway (GO:2001242)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)	ATP binding (GO:0005524)|calmodulin binding (GO:0005516)|calmodulin-dependent protein kinase activity (GO:0004683)|identical protein binding (GO:0042802)|protein serine/threonine kinase activity (GO:0004674)	p.V300E(1)		breast(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(2)|skin(1)|stomach(1)	11				LUAD - Lung adenocarcinoma(2;0.215)		CAGATTGACCACAGACTCCCT	0.632																																						dbGAP											1	Substitution - Missense(1)	breast(1)											73.0	58.0	63.0					15																	64204356		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB018001	CCDS10188.1	15q22.1	2008-07-18			ENSG00000035664	ENSG00000035664			2675	protein-coding gene	gene with protein product						10376525	Standard	XM_005254265		Approved	DRP-1, MGC119312	uc002amr.3	Q9UIK4	OTTHUMG00000132947	ENST00000457488.1:c.899T>A	15.37:g.64204356A>T	ENSP00000408277:p.Val300Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	E9JGM7|O75892|Q24JS1	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_RIO-like_kinase,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	p.V300E	ENST00000457488.1	37	c.899	CCDS10188.1	15	.	.	.	.	.	.	.	.	.	.	A	13.89	2.373313	0.42105	.	.	ENSG00000035664	ENST00000261891;ENST00000457488	T;T	0.39787	1.06;1.06	5.15	1.6	0.23607	Protein kinase-like domain (1);	0.638766	0.12248	N	0.485906	T	0.30103	0.0754	L	0.51422	1.61	0.38918	D	0.957679	B	0.16603	0.018	B	0.17098	0.017	T	0.20840	-1.0263	10	0.05620	T	0.96	.	7.2942	0.26383	0.7423:0.0:0.2577:0.0	.	300	Q9UIK4	DAPK2_HUMAN	E	300	ENSP00000261891:V300E;ENSP00000408277:V300E	ENSP00000261891:V300E	V	-	2	0	DAPK2	61991409	0.254000	0.23992	0.332000	0.25469	0.995000	0.86356	2.391000	0.44424	0.021000	0.15133	0.496000	0.49642	GTG	DAPK2	-	superfamily_Kinase-like_dom	ENSG00000035664		0.632	DAPK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DAPK2	HGNC	protein_coding	OTTHUMT00000256479.1	28	0.00	0	A	NM_014326		64204356	64204356	-1	no_errors	ENST00000261891	ensembl	human	known	69_37n	missense	20	25.93	7	SNP	0.831	T
DHX33	56919	genome.wustl.edu	37	17	5356907	5356907	+	Silent	SNP	T	T	C			TCGA-A1-A0SH-01A-11D-A099-09	TCGA-A1-A0SH-10A-03D-A099-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	473d6ae4-162a-4136-b44f-fad42529a31a	7df4bbf4-7ac5-4fd3-b0b9-ca6e49674cfd	g.chr17:5356907T>C	ENST00000225296.3	-	8	1589	c.1389A>G	c.(1387-1389)ccA>ccG	p.P463P	DHX33_ENST00000433302.3_Silent_p.P239P	NM_001199699.1|NM_020162.3	NP_001186628.1|NP_064547.2	Q9H6R0	DHX33_HUMAN	DEAH (Asp-Glu-Ala-His) box polypeptide 33	463					positive regulation of transcription from RNA polymerase I promoter (GO:0045943)	nucleolus (GO:0005730)|nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|poly(A) RNA binding (GO:0044822)|rDNA binding (GO:0000182)	p.P463P(1)		breast(1)|cervix(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(2)|lung(2)|ovary(1)|pancreas(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	17						TACCTGGAGATGGCTTCGACA	0.438																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											132.0	119.0	123.0					17																	5356907		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AL359945	CCDS11072.1	17p13	2003-06-13	2003-06-13	2003-06-13	ENSG00000005100	ENSG00000005100		"""DEAH-boxes"""	16718	protein-coding gene	gene with protein product		614405	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 33"""	DDX33			Standard	NM_020162		Approved	FLJ21972, DKFZp762F2011	uc002gca.3	Q9H6R0	OTTHUMG00000102041	ENST00000225296.3:c.1389A>G	17.37:g.5356907T>C		Somatic		WXS	Illumina GAIIx	Phase_IV	B4DHF9|Q4G149|Q5CZ73|Q9H5M9	Missense_Mutation	SNP	pfam_Helicase-assoc_dom,pfam_DUF1605,pfam_Helicase_C,smart_Helicase_C,smart_Helicase-assoc_dom,pfscan_Helicase_ATP-bd,pfscan_Helicase_C	p.I373V	ENST00000225296.3	37	c.1117	CCDS11072.1	17																																																																																			DHX33	-	NULL	ENSG00000005100		0.438	DHX33-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DHX33	HGNC	protein_coding	OTTHUMT00000219826.2	111	0.00	0	T	NM_020162		5356907	5356907	-1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000572490	ensembl	human	novel	69_37n	missense	79	26.17	28	SNP	0.020	C
DHRS13	147015	genome.wustl.edu	37	17	27225602	27225602	+	Missense_Mutation	SNP	C	C	G			TCGA-A1-A0SH-01A-11D-A099-09	TCGA-A1-A0SH-10A-03D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	473d6ae4-162a-4136-b44f-fad42529a31a	7df4bbf4-7ac5-4fd3-b0b9-ca6e49674cfd	g.chr17:27225602C>G	ENST00000378895.4	-	5	1117	c.991G>C	c.(991-993)Gag>Cag	p.E331Q	FLOT2_ENST00000585169.1_5'Flank|RP11-20B24.4_ENST00000580603.1_RNA|DHRS13_ENST00000394901.3_Missense_Mutation_p.E281Q|FLOT2_ENST00000394906.2_5'Flank|DHRS13_ENST00000426464.2_Missense_Mutation_p.E250Q|DHRS13_ENST00000581974.1_5'Flank|RP11-20B24.4_ENST00000579187.1_RNA|FLOT2_ENST00000577789.1_5'Flank|FLOT2_ENST00000394908.4_5'Flank	NM_144683.3	NP_653284.2	Q6UX07	DHR13_HUMAN	dehydrogenase/reductase (SDR family) member 13	331						extracellular region (GO:0005576)|membrane (GO:0016020)	oxidoreductase activity (GO:0016491)	p.E331Q(1)		breast(1)|endometrium(2)|kidney(1)|large_intestine(1)|ovary(1)|prostate(1)|upper_aerodigestive_tract(2)	9	all_cancers(5;2.12e-15)|all_epithelial(6;3.44e-19)|Lung NSC(42;0.01)		Epithelial(11;1.59e-06)|all cancers(11;9.27e-06)|BRCA - Breast invasive adenocarcinoma(11;5.78e-05)|OV - Ovarian serous cystadenocarcinoma(11;0.0602)			GATGGGGCCTCTGAGTCCTCA	0.612																																						dbGAP											1	Substitution - Missense(1)	breast(1)											26.0	27.0	27.0					17																	27225602		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC015582	CCDS11246.2	17q11.2	2011-09-14			ENSG00000167536	ENSG00000167536	1.1.-.-	"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 2"""	28326	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 7C, member 5"""					12975309, 19027726	Standard	NM_144683		Approved	MGC23280, SDR7C5	uc002hde.4	Q6UX07	OTTHUMG00000132678	ENST00000378895.4:c.991G>C	17.37:g.27225602C>G	ENSP00000368173:p.Glu331Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	Q96BH7	Missense_Mutation	SNP	pfam_DH_sc/Rdtase_SDR,pfam_PKS_KR,pfam_Epimerase_deHydtase,prints_Glc/ribitol_DH	p.E331Q	ENST00000378895.4	37	c.991	CCDS11246.2	17	.	.	.	.	.	.	.	.	.	.	C	5.606	0.296588	0.10622	.	.	ENSG00000167536	ENST00000378895;ENST00000394901;ENST00000426464	T;T;D	0.82344	-1.44;-0.98;-1.6	4.99	-0.891	0.10573	.	0.784973	0.11456	N	0.562233	T	0.59459	0.2195	N	0.08118	0	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.04013	0.0;0.001	T	0.44097	-0.9350	10	0.15499	T	0.54	.	4.5705	0.12207	0.0:0.4234:0.3054:0.2712	.	250;331	B4DJC5;Q6UX07	.;DHR13_HUMAN	Q	331;281;250	ENSP00000368173:E331Q;ENSP00000378361:E281Q;ENSP00000412826:E250Q	ENSP00000368173:E331Q	E	-	1	0	DHRS13	24249728	0.000000	0.05858	0.173000	0.22940	0.147000	0.21601	-0.282000	0.08445	0.030000	0.15379	0.561000	0.74099	GAG	DHRS13	-	NULL	ENSG00000167536		0.612	DHRS13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DHRS13	HGNC	protein_coding	OTTHUMT00000255952.1	54	0.00	0	C	NM_144683		27225602	27225602	-1	no_errors	ENST00000378895	ensembl	human	known	69_37n	missense	54	14.29	9	SNP	0.002	G
DMD	1756	genome.wustl.edu	37	X	31792151	31792151	+	Missense_Mutation	SNP	C	C	T			TCGA-A1-A0SH-01A-11D-A099-09	TCGA-A1-A0SH-10A-03D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	473d6ae4-162a-4136-b44f-fad42529a31a	7df4bbf4-7ac5-4fd3-b0b9-ca6e49674cfd	g.chrX:31792151C>T	ENST00000357033.4	-	51	7674	c.7468G>A	c.(7468-7470)Gat>Aat	p.D2490N	DMD_ENST00000378677.2_Missense_Mutation_p.D2486N|DMD_ENST00000343523.2_Missense_Mutation_p.D30N|DMD_ENST00000474231.1_Missense_Mutation_p.D30N|DMD_ENST00000541735.1_Missense_Mutation_p.D30N|DMD_ENST00000378707.3_Missense_Mutation_p.D30N|DMD_ENST00000359836.1_Missense_Mutation_p.D30N	NM_000109.3|NM_004006.2|NM_004011.3|NM_004012.3|NM_004014.2	NP_000100.2|NP_003997|NP_004002.2|NP_004003.1|NP_004005.1	P11532	DMD_HUMAN	dystrophin	2490					cardiac muscle cell action potential (GO:0086001)|cardiac muscle contraction (GO:0060048)|cellular protein complex assembly (GO:0043623)|cellular protein localization (GO:0034613)|extracellular matrix organization (GO:0030198)|motile cilium assembly (GO:0044458)|muscle filament sliding (GO:0030049)|muscle organ development (GO:0007517)|negative regulation of peptidyl-cysteine S-nitrosylation (GO:1902083)|negative regulation of peptidyl-serine phosphorylation (GO:0033137)|peptide biosynthetic process (GO:0043043)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of neuron projection development (GO:0010976)|positive regulation of sodium ion transmembrane transporter activity (GO:2000651)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of cellular response to growth factor stimulus (GO:0090287)|regulation of heart rate (GO:0002027)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)|regulation of ryanodine-sensitive calcium-release channel activity (GO:0060314)|regulation of skeletal muscle contraction (GO:0014819)|regulation of skeletal muscle contraction by regulation of release of sequestered calcium ion (GO:0014809)|regulation of voltage-gated calcium channel activity (GO:1901385)	cell junction (GO:0030054)|cell surface (GO:0009986)|costamere (GO:0043034)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dystrophin-associated glycoprotein complex (GO:0016010)|filopodium (GO:0030175)|filopodium membrane (GO:0031527)|membrane raft (GO:0045121)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|protein complex (GO:0043234)|sarcolemma (GO:0042383)|syntrophin complex (GO:0016013)	actin binding (GO:0003779)|calcium ion binding (GO:0005509)|dystroglycan binding (GO:0002162)|myosin binding (GO:0017022)|nitric-oxide synthase binding (GO:0050998)|structural constituent of cytoskeleton (GO:0005200)|structural constituent of muscle (GO:0008307)|vinculin binding (GO:0017166)|zinc ion binding (GO:0008270)	p.D2486N(1)|p.D30N(1)|p.D2490N(1)|p.D2485N(1)|p.D1149N(1)		NS(2)|breast(3)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(17)|liver(1)|lung(25)|ovary(3)|pancreas(3)|prostate(2)|skin(1)|urinary_tract(2)	77		all_cancers(2;1.22e-16)|Acute lymphoblastic leukemia(2;4.65e-06)|all_hematologic(2;0.00108)|all_epithelial(3;0.00626)|all_neural(2;0.0189)|all_lung(315;0.182)|Glioma(3;0.203)				ATAACTTGATCAAGCAGAGAA	0.438																																						dbGAP											5	Substitution - Missense(5)	breast(5)											107.0	97.0	100.0					X																	31792151		2202	4300	6502	-	-	-	SO:0001583	missense	0			AF047505	CCDS14231.1, CCDS14232.1, CCDS14233.1, CCDS14234.1, CCDS48091.1, CCDS55394.1, CCDS55395.1, CCDS75965.1	Xp21.2	2014-09-17	2008-08-01		ENSG00000198947	ENSG00000198947			2928	protein-coding gene	gene with protein product	"""muscular dystrophy, Duchenne and Becker types"""	300377	"""dystrophin (muscular dystrophy, Duchenne and Becker types), includes DXS142, DXS164, DXS206, DXS230, DXS239, DXS268, DXS269, DXS270, DXS272"", ""mental retardation, X-linked 85"""	MRX85		3282674, 3607877, 23900271	Standard	NM_004019		Approved	BMD, DXS142, DXS164, DXS206, DXS230, DXS239, DXS268, DXS269, DXS270, DXS272	uc004dda.1	P11532	OTTHUMG00000021336	ENST00000357033.4:c.7468G>A	X.37:g.31792151C>T	ENSP00000354923:p.Asp2490Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	E9PDN1|Q02295|Q14169|Q14170|Q5JYU0|Q6NSJ9|Q7KZ48|Q8N754|Q9UCW3|Q9UCW4	Missense_Mutation	SNP	pfam_Spectrin_repeat,pfam_EF-hand_dom_typ1,pfam_EF-hand_dom_typ2,pfam_CH-domain,pfam_Znf_ZZ,pfam_WW_Rsp5_WWP,pfam_CAMSAP_CH,superfamily_CH-domain,superfamily_WW_Rsp5_WWP,smart_CH-domain,smart_Spectrin/alpha-actinin,smart_WW_Rsp5_WWP,smart_Znf_ZZ,pirsf_Dystrophin/utrophin,pfscan_CH-domain,pfscan_WW_Rsp5_WWP,pfscan_Znf_ZZ	p.D2490N	ENST00000357033.4	37	c.7468	CCDS14233.1	X	.	.	.	.	.	.	.	.	.	.	C	25.0	4.592892	0.86953	.	.	ENSG00000198947	ENST00000534884;ENST00000378682;ENST00000378684;ENST00000358062;ENST00000378677;ENST00000357033;ENST00000359836;ENST00000343523;ENST00000542849;ENST00000535280;ENST00000378707;ENST00000541735;ENST00000474231	T;T;T;T;T;T;T;T	0.35236	1.32;1.32;1.32;1.32;1.32;1.32;1.32;1.32	5.08	5.08	0.68730	.	0.400348	0.17236	U	0.181742	T	0.62270	0.2414	M	0.74258	2.255	0.43559	D	0.995873	P;D;P;D;D;B;B;B;B;P	0.89917	0.947;1.0;0.899;0.999;0.999;0.144;0.194;0.194;0.334;0.592	P;D;P;D;D;B;P;P;B;B	0.77557	0.79;0.99;0.677;0.979;0.979;0.24;0.569;0.569;0.41;0.287	T	0.64871	-0.6305	10	0.56958	D	0.05	.	17.6536	0.88171	0.0:1.0:0.0:0.0	.	2482;2490;2486;1149;1146;30;30;30;30;30	P11532-4;P11532;E9PDN5;E7EQS7;E7EQS6;F8VX32;E7ESB2;E7EQS5;E7EQR9;F5GZY3	.;DMD_HUMAN;.;.;.;.;.;.;.;.	N	2482;1149;1146;186;2486;2490;30;30;2490;2367;30;30;30	ENSP00000350765:D186N;ENSP00000367948:D2486N;ENSP00000354923:D2490N;ENSP00000352894:D30N;ENSP00000340057:D30N;ENSP00000367979:D30N;ENSP00000444119:D30N;ENSP00000417123:D30N	ENSP00000340057:D30N	D	-	1	0	DMD	31702072	1.000000	0.71417	0.994000	0.49952	0.769000	0.43574	6.223000	0.72257	2.096000	0.63516	0.594000	0.82650	GAT	DMD	-	pfam_Spectrin_repeat,smart_Spectrin/alpha-actinin,pirsf_Dystrophin/utrophin	ENSG00000198947		0.438	DMD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DMD	HGNC	protein_coding	OTTHUMT00000056182.2	189	0.00	0	C	NM_004006		31792151	31792151	-1	no_errors	ENST00000357033	ensembl	human	known	69_37n	missense	162	11.96	22	SNP	1.000	T
DNAH8	1769	genome.wustl.edu	37	6	38830152	38830152	+	Missense_Mutation	SNP	G	G	T			TCGA-A1-A0SH-01A-11D-A099-09	TCGA-A1-A0SH-10A-03D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	473d6ae4-162a-4136-b44f-fad42529a31a	7df4bbf4-7ac5-4fd3-b0b9-ca6e49674cfd	g.chr6:38830152G>T	ENST00000359357.3	+	42	5831	c.5577G>T	c.(5575-5577)atG>atT	p.M1859I	DNAH8_ENST00000441566.1_Missense_Mutation_p.M1859I|DNAH8_ENST00000449981.2_Missense_Mutation_p.M2076I			Q96JB1	DYH8_HUMAN	dynein, axonemal, heavy chain 8	1859	AAA 1. {ECO:0000250}.				cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)	p.M1859I(2)		NS(7)|breast(9)|central_nervous_system(4)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(3)|kidney(16)|large_intestine(44)|liver(4)|lung(101)|ovary(7)|pancreas(2)|prostate(8)|skin(28)|stomach(4)|upper_aerodigestive_tract(6)|urinary_tract(4)	260						CAAAAGACATGGGAAGGTGTT	0.468																																						dbGAP											2	Substitution - Missense(2)	breast(2)											149.0	146.0	147.0					6																	38830152		2203	4300	6503	-	-	-	SO:0001583	missense	0			Z83806	CCDS75447.1	6p21.2	2012-04-19	2006-09-04		ENSG00000124721	ENSG00000124721		"""Axonemal dyneins"""	2952	protein-coding gene	gene with protein product		603337	"""dynein, axonemal, heavy polypeptide 8"""			9373155	Standard	NM_001206927		Approved	hdhc9	uc021yzh.1	Q96JB1	OTTHUMG00000016253	ENST00000359357.3:c.5577G>T	6.37:g.38830152G>T	ENSP00000352312:p.Met1859Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	O00438|Q5JYI2|Q5T2M3|Q5T2M4|Q5TG00|Q9UEM4	Missense_Mutation	SNP	pfam_Dynein_heavy,pfam_Dynein_heavy_dom-1,pfam_Dynein_heavy_dom-2,pfam_ATPase_dyneun-rel_AAA,smart_AAA+_ATPase	p.M1859I	ENST00000359357.3	37	c.5577		6	.	.	.	.	.	.	.	.	.	.	G	34	5.401346	0.96030	.	.	ENSG00000124721	ENST00000449981;ENST00000327475;ENST00000359357;ENST00000441566	T;T;T	0.35421	1.31;1.31;1.31	6.04	6.04	0.98038	ATPase, AAA+ type, core (1);	0.000000	0.85682	D	0.000000	T	0.57460	0.2055	M	0.70903	2.155	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.57740	-0.7759	10	0.87932	D	0	.	20.5948	0.99439	0.0:0.0:1.0:0.0	.	1859	Q96JB1	DYH8_HUMAN	I	2064;2064;1859;1859	ENSP00000333363:M2064I;ENSP00000352312:M1859I;ENSP00000402294:M1859I	ENSP00000333363:M2064I	M	+	3	0	DNAH8	38938130	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.813000	0.99286	2.873000	0.98535	0.563000	0.77884	ATG	DNAH8	-	smart_AAA+_ATPase	ENSG00000124721		0.468	DNAH8-001	KNOWN	basic|appris_principal	protein_coding	DNAH8	HGNC	protein_coding	OTTHUMT00000043574.1	157	0.00	0	G	NM_001206927		38830152	38830152	+1	no_errors	ENST00000359357	ensembl	human	known	69_37n	missense	140	17.54	30	SNP	1.000	T
DRGX	644168	genome.wustl.edu	37	10	50599285	50599285	+	Missense_Mutation	SNP	G	G	C	rs267602506		TCGA-A1-A0SH-01A-11D-A099-09	TCGA-A1-A0SH-10A-03D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	473d6ae4-162a-4136-b44f-fad42529a31a	7df4bbf4-7ac5-4fd3-b0b9-ca6e49674cfd	g.chr10:50599285G>C	ENST00000374139.2	-	2	67	c.57C>G	c.(55-57)caC>caG	p.H19Q	DRGX_ENST00000434016.1_Missense_Mutation_p.H24Q			A6NNA5	DRGX_HUMAN	dorsal root ganglia homeobox	19					axon guidance (GO:0007411)|detection of chemical stimulus (GO:0009593)|detection of temperature stimulus (GO:0016048)|dorsal spinal cord development (GO:0021516)|neuron migration (GO:0001764)|regulation of transcription, DNA-templated (GO:0006355)|sensory perception of mechanical stimulus (GO:0050954)|transcription, DNA-templated (GO:0006351)|trigeminal nerve development (GO:0021559)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)	p.H24Q(1)		breast(2)|endometrium(1)|kidney(1)|large_intestine(2)|lung(5)	11						CCCCCGAAGAGTGATTGCCAA	0.552																																						dbGAP											1	Substitution - Missense(1)	breast(1)											42.0	42.0	42.0					10																	50599285		1914	4110	6024	-	-	-	SO:0001583	missense	0				CCDS44388.1, CCDS44388.2	10q11.23	2011-06-20	2007-07-26	2007-07-26	ENSG00000165606	ENSG00000165606		"""Homeoboxes / PRD class"""	21536	protein-coding gene	gene with protein product	"""paired-like homeodomain trancription factor DRG11"""	606701	"""paired related homeobox-like 1"""	PRRXL1		7496632	Standard	NM_001276451		Approved	DRG11	uc021pqd.2	A6NNA5	OTTHUMG00000018192	ENST00000374139.2:c.57C>G	10.37:g.50599285G>C	ENSP00000363254:p.His19Gln	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Homeodomain,pfam_OAR_dom,superfamily_Homeodomain-like,smart_Homeodomain,pfscan_OAR_dom,pfscan_Homeodomain	p.H24Q	ENST00000374139.2	37	c.72		10	.	.	.	.	.	.	.	.	.	.	G	17.57	3.422647	0.62733	.	.	ENSG00000165606	ENST00000374139;ENST00000434016	D;D	0.95554	-3.74;-3.74	5.82	3.98	0.46160	.	0.000000	0.85682	D	0.000000	D	0.91294	0.7255	N	0.19112	0.55	0.53688	D	0.999976	D	0.56521	0.976	P	0.47299	0.543	D	0.89610	0.3841	10	0.49607	T	0.09	.	9.7755	0.40616	0.2094:0.0:0.7906:0.0	.	24	C9JW76	.	Q	19;24	ENSP00000363254:H19Q;ENSP00000401653:H24Q	ENSP00000363254:H19Q	H	-	3	2	DRGX	50269291	1.000000	0.71417	0.989000	0.46669	0.580000	0.36256	4.359000	0.59449	0.819000	0.34492	0.561000	0.74099	CAC	DRGX	-	NULL	ENSG00000165606		0.552	DRGX-001	KNOWN	basic|appris_principal	protein_coding	DRGX	HGNC	protein_coding	OTTHUMT00000047987.2	56	0.00	0	G	XM_060970		50599285	50599285	-1	no_errors	ENST00000434016	ensembl	human	known	69_37n	missense	53	28.38	21	SNP	1.000	C
EDC4	23644	genome.wustl.edu	37	16	67914876	67914876	+	Silent	SNP	C	C	T			TCGA-A1-A0SH-01A-11D-A099-09	TCGA-A1-A0SH-10A-03D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	473d6ae4-162a-4136-b44f-fad42529a31a	7df4bbf4-7ac5-4fd3-b0b9-ca6e49674cfd	g.chr16:67914876C>T	ENST00000358933.5	+	18	2753	c.2514C>T	c.(2512-2514)tgC>tgT	p.C838C	CTC-479C5.10_ENST00000572067.1_lincRNA	NM_014329.4	NP_055144.3	Q6P2E9	EDC4_HUMAN	enhancer of mRNA decapping 4	838					exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay (GO:0043928)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|RNA metabolic process (GO:0016070)	cytoplasm (GO:0005737)|cytoplasmic mRNA processing body (GO:0000932)|cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nucleus (GO:0005634)		p.C838C(1)		breast(3)|central_nervous_system(2)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(4)|lung(8)|ovary(4)|skin(2)|upper_aerodigestive_tract(4)|urinary_tract(2)	41		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0042)|Epithelial(162;0.0185)|all cancers(182;0.121)		GTGAGACCTGCAGCACCCTGG	0.577																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											56.0	59.0	58.0					16																	67914876		2198	4300	6498	-	-	-	SO:0001819	synonymous_variant	0			U17474	CCDS10849.1	16q22.1	2008-02-05			ENSG00000038358	ENSG00000038358			17157	protein-coding gene	gene with protein product		606030				9067524	Standard	NM_014329		Approved	RCD-8, Ge-1, HEDLS	uc002eur.3	Q6P2E9	OTTHUMG00000137543	ENST00000358933.5:c.2514C>T	16.37:g.67914876C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A6NGM1|A8K4T4|Q13025|Q13826|Q6ZR12|Q7Z6H7	Silent	SNP	superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.C838	ENST00000358933.5	37	c.2514	CCDS10849.1	16																																																																																			EDC4	-	NULL	ENSG00000038358		0.577	EDC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EDC4	HGNC	protein_coding	OTTHUMT00000268874.2	44	0.00	0	C	NM_014329		67914876	67914876	+1	no_errors	ENST00000358933	ensembl	human	known	69_37n	silent	27	12.90	4	SNP	0.999	T
MT-ND2	4536	genome.wustl.edu	37	M	2492	2492	+	5'Flank	SNP	G	G	A			TCGA-A1-A0SH-01A-11D-A099-09	TCGA-A1-A0SH-10A-03D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	473d6ae4-162a-4136-b44f-fad42529a31a	7df4bbf4-7ac5-4fd3-b0b9-ca6e49674cfd	g.chrM:2492G>A	ENST00000361453.3	+	0	0				MT-TF_ENST00000387314.1_RNA|MT-TV_ENST00000387342.1_RNA|MT-TQ_ENST00000387372.1_RNA|MT-TL1_ENST00000386347.1_RNA|MT-TM_ENST00000387377.1_RNA|MT-ND1_ENST00000361390.2_5'Flank|MT-RNR1_ENST00000389680.2_RNA|MT-TI_ENST00000387365.1_RNA|MT-RNR2_ENST00000387347.2_RNA			P03891	NU2M_HUMAN	mitochondrially encoded NADH dehydrogenase 2						cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|reactive oxygen species metabolic process (GO:0072593)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex I (GO:0005747)	NADH dehydrogenase (ubiquinone) activity (GO:0008137)			breast(2)|lung(1)	3						AAACCTTACCCCGCCTGTTTA	0.468																																						dbGAP											0																																										-	-	-	SO:0001631	upstream_gene_variant	0					mitochondria	2011-07-04	2005-02-15	2005-02-16	ENSG00000198763	ENSG00000198763	1.6.5.3	"""Mitochondrial respiratory chain complex / Complex I"""	7456	protein-coding gene	gene with protein product	"""complex I ND2 subunit"", ""NADH-ubiquinone oxidoreductase chain 2"""	516001	"""NADH dehydrogenase 2"""	MTND2			Standard			Approved	ND2, NAD2		P03891			M.37:g.2492G>A	Exception_encountered	Somatic		WXS	Illumina GAIIx	Phase_IV	Q34769|Q9TGI0|Q9TGI1|Q9TGI2|Q9TGI3|Q9TGI4	RNA	SNP	-	NULL	ENST00000361453.3	37	NULL		MT																																																																																			J01415.4	-	-	ENSG00000210082		0.468	MT-ND2-201	KNOWN	basic|appris_principal	protein_coding	ENSG00000210082	Clone_based_ensembl_gene	protein_coding		61	0.00	0	G	YP_003024027		2492	2492	+1	no_errors	ENST00000387347	ensembl	human	known	69_37n	rna	14	87.50	98	SNP	NULL	A
MT-ND2	4536	genome.wustl.edu	37	M	2700	2700	+	5'Flank	SNP	G	G	A			TCGA-A1-A0SH-01A-11D-A099-09	TCGA-A1-A0SH-10A-03D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	473d6ae4-162a-4136-b44f-fad42529a31a	7df4bbf4-7ac5-4fd3-b0b9-ca6e49674cfd	g.chrM:2700G>A	ENST00000361453.3	+	0	0				MT-TF_ENST00000387314.1_RNA|MT-TV_ENST00000387342.1_RNA|MT-TA_ENST00000387392.1_RNA|MT-TN_ENST00000387400.1_RNA|MT-TQ_ENST00000387372.1_RNA|MT-TL1_ENST00000386347.1_RNA|MT-TM_ENST00000387377.1_RNA|MT-ND1_ENST00000361390.2_5'Flank|MT-RNR1_ENST00000389680.2_RNA|MT-TI_ENST00000387365.1_RNA|MT-RNR2_ENST00000387347.2_RNA|MT-TW_ENST00000387382.1_RNA			P03891	NU2M_HUMAN	mitochondrially encoded NADH dehydrogenase 2						cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|reactive oxygen species metabolic process (GO:0072593)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex I (GO:0005747)	NADH dehydrogenase (ubiquinone) activity (GO:0008137)			breast(2)|lung(1)	3						ccgtgaagaggcgggcatgac	0.443																																						dbGAP											0																																										-	-	-	SO:0001631	upstream_gene_variant	0					mitochondria	2011-07-04	2005-02-15	2005-02-16	ENSG00000198763	ENSG00000198763	1.6.5.3	"""Mitochondrial respiratory chain complex / Complex I"""	7456	protein-coding gene	gene with protein product	"""complex I ND2 subunit"", ""NADH-ubiquinone oxidoreductase chain 2"""	516001	"""NADH dehydrogenase 2"""	MTND2			Standard			Approved	ND2, NAD2		P03891			M.37:g.2700G>A	Exception_encountered	Somatic		WXS	Illumina GAIIx	Phase_IV	Q34769|Q9TGI0|Q9TGI1|Q9TGI2|Q9TGI3|Q9TGI4	RNA	SNP	-	NULL	ENST00000361453.3	37	NULL		MT																																																																																			J01415.4	-	-	ENSG00000210082		0.443	MT-ND2-201	KNOWN	basic|appris_principal	protein_coding	ENSG00000210082	Clone_based_ensembl_gene	protein_coding		24	0.00	0	G	YP_003024027		2700	2700	+1	no_errors	ENST00000387347	ensembl	human	known	69_37n	rna	35	42.62	26	SNP	NULL	A
RP11-114H24.4	0	genome.wustl.edu	37	15	78234749	78234749	+	RNA	SNP	A	A	T			TCGA-A1-A0SH-01A-11D-A099-09	TCGA-A1-A0SH-10A-03D-A099-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	473d6ae4-162a-4136-b44f-fad42529a31a	7df4bbf4-7ac5-4fd3-b0b9-ca6e49674cfd	g.chr15:78234749A>T	ENST00000568184.1	-	0	246																											CTGTCCCAGCAGCTCCTTTAG	0.572																																						dbGAP											0																																										-	-	-			0																															15.37:g.78234749A>T		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000568184.1	37	NULL		15	.	.	.	.	.	.	.	.	.	.	A	4.936	0.173922	0.09391	.	.	ENSG00000214646	ENST00000398727	.	.	.	.	.	.	.	0.000000	0.64402	D	0.000001	T	0.46210	0.1381	.	.	.	.	.	.	.	.	.	.	.	.	T	0.55042	-0.8202	4	0.59425	D	0.04	.	6.2267	0.20711	1.0:0.0:0.0:0.0	.	.	.	.	Q	41	.	ENSP00000394723:L41Q	L	-	2	0	AC104758.1	76021804	1.000000	0.71417	0.095000	0.20976	0.095000	0.18619	4.679000	0.61649	0.077000	0.16863	0.076000	0.15429	CTG	RP11-114H24.4	-	-	ENSG00000214646		0.572	RP11-114H24.4-002	KNOWN	basic	processed_transcript	ENSG00000214646	Clone_based_vega_gene	pseudogene	OTTHUMT00000421589.1	69	0.00	0	A			78234749	78234749	-1	no_errors	ENST00000568184	ensembl	human	known	69_37n	rna	83	11.70	11	SNP	1.000	T
EVPL	2125	genome.wustl.edu	37	17	74005590	74005590	+	Silent	SNP	C	C	T			TCGA-A1-A0SH-01A-11D-A099-09	TCGA-A1-A0SH-10A-03D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	473d6ae4-162a-4136-b44f-fad42529a31a	7df4bbf4-7ac5-4fd3-b0b9-ca6e49674cfd	g.chr17:74005590C>T	ENST00000301607.3	-	22	3949	c.3696G>A	c.(3694-3696)gaG>gaA	p.E1232E	EVPL_ENST00000586740.1_Silent_p.E1254E	NM_001988.2	NP_001979.2	Q92817	EVPL_HUMAN	envoplakin	1232	Central fibrous rod domain.				epidermis development (GO:0008544)|keratinization (GO:0031424)|keratinocyte differentiation (GO:0030216)|peptide cross-linking (GO:0018149)	cell junction (GO:0030054)|cornified envelope (GO:0001533)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	protein binding, bridging (GO:0030674)|structural molecule activity (GO:0005198)	p.E1232E(1)		breast(4)|central_nervous_system(4)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(8)|lung(14)|ovary(2)|pancreas(2)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(4)	54						GCAGCAGCTTCTCCACCTCCT	0.642																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											115.0	90.0	98.0					17																	74005590		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			U53786	CCDS11737.1	17q25	2008-07-18				ENSG00000167880			3503	protein-coding gene	gene with protein product		601590				8938451, 10409435	Standard	NM_001988		Approved	EVPK	uc002jqi.2	Q92817		ENST00000301607.3:c.3696G>A	17.37:g.74005590C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A0AUV5	Silent	SNP	pfam_Plectin_repeat,superfamily_Ferritin/RR-like,smart_Spectrin/alpha-actinin,smart_Plectin_repeat	p.E1232	ENST00000301607.3	37	c.3696	CCDS11737.1	17																																																																																			EVPL	-	superfamily_Ferritin/RR-like	ENSG00000167880		0.642	EVPL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EVPL	HGNC	protein_coding	OTTHUMT00000449483.1	28	0.00	0	C	NM_001988		74005590	74005590	-1	no_errors	ENST00000301607	ensembl	human	known	69_37n	silent	46	17.86	10	SNP	0.010	T
FAM111A	63901	genome.wustl.edu	37	11	58920660	58920660	+	Missense_Mutation	SNP	G	G	A			TCGA-A1-A0SH-01A-11D-A099-09	TCGA-A1-A0SH-10A-03D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	473d6ae4-162a-4136-b44f-fad42529a31a	7df4bbf4-7ac5-4fd3-b0b9-ca6e49674cfd	g.chr11:58920660G>A	ENST00000528737.1	+	5	4337	c.1519G>A	c.(1519-1521)Gaa>Aaa	p.E507K	FAM111A_ENST00000533703.1_Missense_Mutation_p.E507K|FAM111A_ENST00000531147.1_Missense_Mutation_p.E507K|FAM111A_ENST00000420244.1_Missense_Mutation_p.E507K|FAM111A_ENST00000361723.3_Missense_Mutation_p.E507K			Q96PZ2	F111A_HUMAN	family with sequence similarity 111, member A	507	Interaction with SV40 large T antigen.				defense response to virus (GO:0051607)|DNA replication (GO:0006260)|negative regulation of viral genome replication (GO:0045071)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	catalytic activity (GO:0003824)	p.E507K(1)		breast(2)|endometrium(2)|kidney(1)|large_intestine(5)|lung(5)|ovary(3)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	22		all_epithelial(135;0.139)				TAAAAAAGCAGAAAGTCCAGA	0.408																																						dbGAP											1	Substitution - Missense(1)	breast(1)											94.0	97.0	96.0					11																	58920660		2201	4295	6496	-	-	-	SO:0001583	missense	0			AK092953	CCDS7973.1	11q12.1	2014-03-13				ENSG00000166801			24725	protein-coding gene	gene with protein product		615292				11572484, 23996431, 23684011	Standard	NM_022074		Approved	FLJ22794, KIAA1895	uc001nnq.3	Q96PZ2		ENST00000528737.1:c.1519G>A	11.37:g.58920660G>A	ENSP00000434435:p.Glu507Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K5Y8|Q5RKS9|Q5XKM2|Q68DK9|Q6IPR7|Q9H5Y1	Missense_Mutation	SNP	pfam_Peptidase_S1_S6,superfamily_Pept_cys/ser_Trypsin-like	p.E507K	ENST00000528737.1	37	c.1519	CCDS7973.1	11	.	.	.	.	.	.	.	.	.	.	G	7.987	0.752448	0.15778	.	.	ENSG00000166801	ENST00000528737;ENST00000420244;ENST00000361723;ENST00000533703;ENST00000531147	D;D;D;D;D	0.88046	-2.33;-2.33;-2.33;-2.33;-2.33	4.81	-0.598	0.11649	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (1);	1.172490	0.06339	N	0.707590	T	0.73552	0.3601	L	0.36672	1.1	0.09310	N	1	B	0.30146	0.27	B	0.25614	0.062	T	0.58148	-0.7687	10	0.06099	T	0.92	-16.3414	1.2459	0.01973	0.3269:0.1396:0.3901:0.1433	.	507	Q96PZ2	F111A_HUMAN	K	507	ENSP00000434435:E507K;ENSP00000406683:E507K;ENSP00000355264:E507K;ENSP00000433154:E507K;ENSP00000431631:E507K	ENSP00000355264:E507K	E	+	1	0	FAM111A	58677236	0.000000	0.05858	0.000000	0.03702	0.005000	0.04900	0.345000	0.19979	-0.170000	0.10816	0.591000	0.81541	GAA	FAM111A	-	pfam_Peptidase_S1_S6,superfamily_Pept_cys/ser_Trypsin-like	ENSG00000166801		0.408	FAM111A-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	FAM111A	HGNC	protein_coding	OTTHUMT00000393975.1	80	0.00	0	G	NM_022074		58920660	58920660	+1	no_errors	ENST00000361723	ensembl	human	known	69_37n	missense	61	22.78	18	SNP	0.000	A
EXPH5	23086	genome.wustl.edu	37	11	108383322	108383322	+	Missense_Mutation	SNP	C	C	T			TCGA-A1-A0SH-01A-11D-A099-09	TCGA-A1-A0SH-10A-03D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	473d6ae4-162a-4136-b44f-fad42529a31a	7df4bbf4-7ac5-4fd3-b0b9-ca6e49674cfd	g.chr11:108383322C>T	ENST00000265843.4	-	6	3022	c.2912G>A	c.(2911-2913)aGa>aAa	p.R971K	EXPH5_ENST00000428840.1_Missense_Mutation_p.R895K|EXPH5_ENST00000524840.1_5'Flank|EXPH5_ENST00000525344.1_Missense_Mutation_p.R964K|EXPH5_ENST00000443411.1_Missense_Mutation_p.R783K	NM_015065.2	NP_055880	Q8NEV8	EXPH5_HUMAN	exophilin 5	971					intracellular protein transport (GO:0006886)|keratinocyte development (GO:0003334)|multivesicular body sorting pathway (GO:0071985)|positive regulation of exocytosis (GO:0045921)|positive regulation of protein secretion (GO:0050714)	endosome (GO:0005768)	Rab GTPase binding (GO:0017137)	p.R971K(1)		breast(3)|central_nervous_system(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(13)|liver(1)|lung(34)|ovary(3)|pancreas(2)|prostate(2)|skin(11)|stomach(3)|upper_aerodigestive_tract(1)	91		all_cancers(61;3.99e-08)|Acute lymphoblastic leukemia(157;3.97e-05)|Melanoma(852;4.04e-05)|all_epithelial(67;0.000116)|all_hematologic(158;0.000315)|Breast(348;0.104)|all_neural(303;0.16)		Epithelial(105;8.1e-06)|BRCA - Breast invasive adenocarcinoma(274;1.22e-05)|all cancers(92;0.000129)|OV - Ovarian serous cystadenocarcinoma(223;0.11)|Colorectal(284;0.184)		TCCTTTTCCTCTTTCATTCCT	0.388																																						dbGAP											1	Substitution - Missense(1)	breast(1)											187.0	172.0	177.0					11																	108383322		2201	4298	6499	-	-	-	SO:0001583	missense	0				CCDS8341.1	11q22.3	2008-02-05			ENSG00000110723	ENSG00000110723			30578	protein-coding gene	gene with protein product	"""synaptotagmin-like homologue lacking C2 domains b"""	612878				9734811, 11773082	Standard	NM_015065		Approved	SLAC2-B	uc001pkk.3	Q8NEV8	OTTHUMG00000166536	ENST00000265843.4:c.2912G>A	11.37:g.108383322C>T	ENSP00000265843:p.Arg971Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q2KHM1|Q9Y4D6	Missense_Mutation	SNP	superfamily_Znf_FYVE_PHD,pfscan_Rab-bd_domain	p.R971K	ENST00000265843.4	37	c.2912	CCDS8341.1	11	.	.	.	.	.	.	.	.	.	.	C	5.947	0.358800	0.11239	.	.	ENSG00000110723	ENST00000265843;ENST00000428840;ENST00000443411;ENST00000525344;ENST00000526312;ENST00000533052	T;T;T;T;T;T	0.04454	4.2;4.12;3.97;4.2;4.02;3.62	5.89	-4.47	0.03525	.	0.562803	0.18099	N	0.151757	T	0.01523	0.0049	N	0.01789	-0.72	0.09310	N	1	B	0.14012	0.009	B	0.11329	0.006	T	0.40289	-0.9571	10	0.02654	T	1	-6.3533	14.4582	0.67431	0.0:0.5816:0.0:0.4184	.	971	Q8NEV8	EXPH5_HUMAN	K	971;895;783;964;895;783	ENSP00000265843:R971K;ENSP00000391966:R895K;ENSP00000411390:R783K;ENSP00000432546:R964K;ENSP00000432683:R895K;ENSP00000446434:R783K	ENSP00000265843:R971K	R	-	2	0	EXPH5	107888532	0.016000	0.18221	0.053000	0.19242	0.043000	0.13939	-0.173000	0.09854	-0.693000	0.05121	-0.471000	0.05019	AGA	EXPH5	-	NULL	ENSG00000110723		0.388	EXPH5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EXPH5	HGNC	protein_coding	OTTHUMT00000390279.1	213	0.00	0	C	NM_015065		108383322	108383322	-1	no_errors	ENST00000265843	ensembl	human	known	69_37n	missense	108	27.03	40	SNP	0.001	T
FAM149B1	317662	genome.wustl.edu	37	10	74994996	74994996	+	Missense_Mutation	SNP	G	G	A			TCGA-A1-A0SH-01A-11D-A099-09	TCGA-A1-A0SH-10A-03D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	473d6ae4-162a-4136-b44f-fad42529a31a	7df4bbf4-7ac5-4fd3-b0b9-ca6e49674cfd	g.chr10:74994996G>A	ENST00000242505.6	+	12	1696	c.1522G>A	c.(1522-1524)Gaa>Aaa	p.E508K		NM_173348.1	NP_775483.1	Q96BN6	F149B_HUMAN	family with sequence similarity 149, member B1	508								p.E508K(1)		breast(2)|endometrium(1)|kidney(1)|stomach(3)	7						GGTGGTGGATGAACCTAACTA	0.463																																						dbGAP											1	Substitution - Missense(1)	breast(1)											82.0	67.0	72.0					10																	74994996		692	1591	2283	-	-	-	SO:0001583	missense	0			AB023191	CCDS44435.1	10q22.2	2008-10-27	2007-11-14	2007-11-14	ENSG00000138286	ENSG00000138286			29162	protein-coding gene	gene with protein product			"""KIAA0974"""	KIAA0974		10231032	Standard	NM_173348		Approved		uc009xqz.3	Q96BN6	OTTHUMG00000067794	ENST00000242505.6:c.1522G>A	10.37:g.74994996G>A	ENSP00000242505:p.Glu508Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q9Y2I0	Missense_Mutation	SNP	pfam_DUF3719	p.E508K	ENST00000242505.6	37	c.1522	CCDS44435.1	10	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	21.9|21.9	4.216865|4.216865	0.79352|0.79352	.|.	.|.	ENSG00000138286|ENSG00000138286	ENST00000242505|ENST00000372955	T|.	0.54279|.	0.58|.	6.01|6.01	6.01|6.01	0.97437|0.97437	.|.	0.099386|.	0.64402|.	D|.	0.000002|.	T|T	0.74336|0.74336	0.3703|0.3703	M|M	0.70275|0.70275	2.135|2.135	0.80722|0.80722	D|D	1|1	D;D;D|.	0.76494|.	0.999;0.999;0.999|.	D;D;D|.	0.71184|.	0.941;0.941;0.972|.	T|T	0.72337|0.72337	-0.4324|-0.4324	10|5	0.51188|.	T|.	0.08|.	-8.4848|-8.4848	16.0212|16.0212	0.80493|0.80493	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	486;508;500|.	B4E0M2;Q96BN6;Q96BN6-2|.	.;F149B_HUMAN;.|.	K|I	508|440	ENSP00000242505:E508K|.	ENSP00000242505:E508K|.	E|M	+|+	1|3	0|0	FAM149B1|FAM149B1	74665002|74665002	1.000000|1.000000	0.71417|0.71417	0.996000|0.996000	0.52242|0.52242	0.271000|0.271000	0.26615|0.26615	6.732000|6.732000	0.74790|0.74790	2.861000|2.861000	0.98227|0.98227	0.650000|0.650000	0.86243|0.86243	GAA|ATG	FAM149B1	-	NULL	ENSG00000138286		0.463	FAM149B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM149B1	HGNC	protein_coding	OTTHUMT00000145438.1	101	0.96	1	G	NM_173348		74994996	74994996	+1	no_errors	ENST00000242505	ensembl	human	known	69_37n	missense	79	21.00	21	SNP	1.000	A
FAM150B	285016	genome.wustl.edu	37	2	286186	286186	+	Missense_Mutation	SNP	G	G	C			TCGA-A1-A0SH-01A-11D-A099-09	TCGA-A1-A0SH-10A-03D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	473d6ae4-162a-4136-b44f-fad42529a31a	7df4bbf4-7ac5-4fd3-b0b9-ca6e49674cfd	g.chr2:286186G>C	ENST00000403610.4	-	4	665	c.325C>G	c.(325-327)Cca>Gca	p.P109A	FAM150B_ENST00000401503.1_Missense_Mutation_p.P17A|AC079779.4_ENST00000427831.1_RNA|FAM150B_ENST00000405290.1_Missense_Mutation_p.P17A|FAM150B_ENST00000344414.5_Missense_Mutation_p.P17A	NM_001002919.2	NP_001002919.2	Q6UX46	F150B_HUMAN	family with sequence similarity 150, member B	109						extracellular region (GO:0005576)		p.P109A(2)		breast(1)|kidney(2)	3	all_hematologic(175;0.0429)|Acute lymphoblastic leukemia(172;0.0627)	all_cancers(51;0.00175)|Lung NSC(108;0.216)|all_epithelial(98;0.236)		all cancers(51;0.00091)|Epithelial(75;0.00656)|OV - Ovarian serous cystadenocarcinoma(76;0.00954)|GBM - Glioblastoma multiforme(21;0.128)		CTGCACTTTGGACTAAAATAA	0.428																																						dbGAP											2	Substitution - Missense(2)	breast(2)											161.0	157.0	158.0					2																	286186		1894	4120	6014	-	-	-	SO:0001583	missense	0				CCDS46218.1	2p25.3	2008-05-02			ENSG00000189292	ENSG00000189292			27683	protein-coding gene	gene with protein product							Standard	NM_001002919		Approved		uc002qwi.4	Q6UX46	OTTHUMG00000151366	ENST00000403610.4:c.325C>G	2.37:g.286186G>C	ENSP00000384604:p.Pro109Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	B5MC76	Missense_Mutation	SNP	NULL	p.P109A	ENST00000403610.4	37	c.325	CCDS46218.1	2	.	.	.	.	.	.	.	.	.	.	G	14.36	2.510837	0.44660	.	.	ENSG00000189292	ENST00000436353;ENST00000403610;ENST00000401503;ENST00000405290;ENST00000344414;ENST00000452023	.	.	.	5.91	5.03	0.67393	.	0.121727	0.56097	D	0.000024	T	0.60222	0.2252	L	0.46614	1.455	0.50467	D	0.99987	D	0.57571	0.98	P	0.54856	0.762	T	0.56986	-0.7888	9	0.27082	T	0.32	.	11.0043	0.47624	0.0847:0.0:0.9153:0.0	.	109	Q6UX46	F150B_HUMAN	A	49;109;17;17;17;109	.	ENSP00000339565:P17A	P	-	1	0	FAM150B	276186	1.000000	0.71417	0.346000	0.25655	0.319000	0.28217	8.505000	0.90515	1.509000	0.48786	-0.136000	0.14681	CCA	FAM150B	-	NULL	ENSG00000189292		0.428	FAM150B-001	NOVEL	basic|appris_principal|CCDS	protein_coding	FAM150B	HGNC	protein_coding	OTTHUMT00000322394.2	217	0.00	0	G	NM_001002919		286186	286186	-1	no_errors	ENST00000403610	ensembl	human	novel	69_37n	missense	171	19.34	41	SNP	0.994	C
FAM171A1	221061	genome.wustl.edu	37	10	15255676	15255676	+	Silent	SNP	G	G	A			TCGA-A1-A0SH-01A-11D-A099-09	TCGA-A1-A0SH-10A-03D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	473d6ae4-162a-4136-b44f-fad42529a31a	7df4bbf4-7ac5-4fd3-b0b9-ca6e49674cfd	g.chr10:15255676G>A	ENST00000378116.4	-	8	1917	c.1911C>T	c.(1909-1911)ccC>ccT	p.P637P	FAM171A1_ENST00000477161.1_5'Flank	NM_001010924.1	NP_001010924.1	Q5VUB5	F1711_HUMAN	family with sequence similarity 171, member A1	637						extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)		p.P637P(2)		breast(6)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(9)|lung(20)|ovary(3)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	52						GGGAAGACAGGGGCTGGGGCT	0.612																																						dbGAP											2	Substitution - coding silent(2)	breast(2)											51.0	59.0	56.0					10																	15255676		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK022946	CCDS31154.1	10p13	2008-06-16	2008-06-16	2008-06-16	ENSG00000148468	ENSG00000148468			23522	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 38"""	C10orf38			Standard	NM_001010924		Approved	FLJ12884	uc001iob.3	Q5VUB5	OTTHUMG00000017732	ENST00000378116.4:c.1911C>T	10.37:g.15255676G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	D3DRT9|Q32M49|Q8N4I0	Silent	SNP	pfam_Uncharacterised_FAM171	p.P637	ENST00000378116.4	37	c.1911	CCDS31154.1	10																																																																																			FAM171A1	-	pfam_Uncharacterised_FAM171	ENSG00000148468		0.612	FAM171A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM171A1	HGNC	protein_coding	OTTHUMT00000046984.1	78	0.00	0	G	XM_167709		15255676	15255676	-1	no_errors	ENST00000378116	ensembl	human	known	69_37n	silent	81	22.12	23	SNP	0.005	A
FAM83B	222584	genome.wustl.edu	37	6	54791317	54791317	+	Missense_Mutation	SNP	C	C	T			TCGA-A1-A0SH-01A-11D-A099-09	TCGA-A1-A0SH-10A-03D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	473d6ae4-162a-4136-b44f-fad42529a31a	7df4bbf4-7ac5-4fd3-b0b9-ca6e49674cfd	g.chr6:54791317C>T	ENST00000306858.7	+	3	709	c.593C>T	c.(592-594)tCa>tTa	p.S198L		NM_001010872.1	NP_001010872.1	Q5T0W9	FA83B_HUMAN	family with sequence similarity 83, member B	198								p.S198L(1)		autonomic_ganglia(1)|breast(2)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(6)|lung(28)|ovary(6)|prostate(6)|skin(6)|upper_aerodigestive_tract(1)	71	Lung NSC(77;0.0178)|Renal(3;0.122)					CAAGGTTGTTCAGTTCAGCGT	0.348																																						dbGAP											1	Substitution - Missense(1)	breast(1)											86.0	88.0	88.0					6																	54791317		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK055204	CCDS34479.1	6p12.1	2014-03-13	2006-03-23	2006-03-23	ENSG00000168143	ENSG00000168143			21357	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 143"""	C6orf143		22886302	Standard	NM_001010872		Approved	FLJ30642	uc003pck.4	Q5T0W9	OTTHUMG00000014899	ENST00000306858.7:c.593C>T	6.37:g.54791317C>T	ENSP00000304078:p.Ser198Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q2M1P3|Q96DQ2	Missense_Mutation	SNP	pfam_DUF1669	p.S198L	ENST00000306858.7	37	c.593	CCDS34479.1	6	.	.	.	.	.	.	.	.	.	.	C	14.82	2.649782	0.47362	.	.	ENSG00000168143	ENST00000306858	T	0.14022	2.54	5.35	4.2	0.49525	.	0.394941	0.28688	N	0.014465	T	0.03095	0.0091	N	0.16656	0.425	0.29972	N	0.818488	B	0.20887	0.049	B	0.22152	0.038	T	0.38499	-0.9658	10	0.30854	T	0.27	-10.7039	12.3299	0.55033	0.8519:0.1481:0.0:0.0	.	198	Q5T0W9	FA83B_HUMAN	L	198	ENSP00000304078:S198L	ENSP00000304078:S198L	S	+	2	0	FAM83B	54899276	1.000000	0.71417	0.999000	0.59377	0.855000	0.48748	5.917000	0.69989	0.878000	0.35920	-0.457000	0.05445	TCA	FAM83B	-	pfam_DUF1669	ENSG00000168143		0.348	FAM83B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM83B	HGNC	protein_coding	OTTHUMT00000040994.1	68	0.00	0	C	XM_294139		54791317	54791317	+1	no_errors	ENST00000306858	ensembl	human	known	69_37n	missense	67	22.99	20	SNP	1.000	T
FBXO4	26272	genome.wustl.edu	37	5	41934239	41934239	+	Nonsense_Mutation	SNP	G	G	T			TCGA-A1-A0SH-01A-11D-A099-09	TCGA-A1-A0SH-10A-03D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	473d6ae4-162a-4136-b44f-fad42529a31a	7df4bbf4-7ac5-4fd3-b0b9-ca6e49674cfd	g.chr5:41934239G>T	ENST00000281623.3	+	5	783	c.727G>T	c.(727-729)Gaa>Taa	p.E243*	FBXO4_ENST00000509134.1_Nonsense_Mutation_p.E243*|FBXO4_ENST00000296812.2_Nonsense_Mutation_p.E243*	NM_012176.2	NP_036308.1	Q9UKT5	FBX4_HUMAN	F-box protein 4	243					positive regulation of protein ubiquitination (GO:0031398)|protein polyubiquitination (GO:0000209)|protein ubiquitination (GO:0016567)|SCF-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031146)|telomere maintenance (GO:0000723)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|SCF ubiquitin ligase complex (GO:0019005)|ubiquitin ligase complex (GO:0000151)	protein homodimerization activity (GO:0042803)|ubiquitin-protein transferase activity (GO:0004842)	p.E243*(1)		breast(2)|endometrium(1)|kidney(2)|large_intestine(6)|liver(1)|lung(11)|prostate(1)|stomach(1)|urinary_tract(2)	27		Lung NSC(810;4.15e-05)|Breast(839;0.00093)|Ovarian(839;0.00965)|Myeloproliferative disorder(839;0.0255)|all_neural(839;0.0604)				TTCTAGAAAGGAAAGAGATAG	0.383																																						dbGAP											1	Substitution - Nonsense(1)	breast(1)											72.0	70.0	71.0					5																	41934239		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AF129534	CCDS3938.1, CCDS3939.1, CCDS75238.1	5p12	2008-02-05	2004-06-15		ENSG00000151876	ENSG00000151876		"""F-boxes /  ""other"""""	13583	protein-coding gene	gene with protein product		609090	"""F-box only protein 4"""			10531035, 10531037	Standard	NM_033484		Approved	FBX4	uc003jmq.3	Q9UKT5	OTTHUMG00000094799	ENST00000281623.3:c.727G>T	5.37:g.41934239G>T	ENSP00000281623:p.Glu243*	Somatic		WXS	Illumina GAIIx	Phase_IV	Q68CU8|Q86VT8|Q9UK98	Nonsense_Mutation	SNP	pfam_F-box_dom_cyclin-like,superfamily_F-box_dom_cyclin-like,smart_F-box_dom_cyclin-like,pfscan_F-box_dom_cyclin-like	p.E243*	ENST00000281623.3	37	c.727	CCDS3938.1	5	.	.	.	.	.	.	.	.	.	.	G	33	5.197643	0.94997	.	.	ENSG00000151876	ENST00000296812;ENST00000281623;ENST00000509134	.	.	.	5.78	5.78	0.91487	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-19.7845	20.012	0.97458	0.0:0.0:1.0:0.0	.	.	.	.	X	243	.	ENSP00000281623:E243X	E	+	1	0	FBXO4	41969996	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.274000	0.95731	2.731000	0.93534	0.655000	0.94253	GAA	FBXO4	-	NULL	ENSG00000151876		0.383	FBXO4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FBXO4	HGNC	protein_coding	OTTHUMT00000211614.1	143	0.00	0	G			41934239	41934239	+1	no_errors	ENST00000281623	ensembl	human	known	69_37n	nonsense	151	22.16	43	SNP	1.000	T
FIP1L1	81608	genome.wustl.edu	37	4	54243868	54243868	+	5'UTR	SNP	C	C	T			TCGA-A1-A0SH-01A-11D-A099-09	TCGA-A1-A0SH-10A-03D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	473d6ae4-162a-4136-b44f-fad42529a31a	7df4bbf4-7ac5-4fd3-b0b9-ca6e49674cfd	g.chr4:54243868C>T	ENST00000337488.6	+	0	57				FIP1L1_ENST00000507922.1_5'UTR|FIP1L1_ENST00000507166.1_5'Flank|FIP1L1_ENST00000306932.6_5'UTR|FIP1L1_ENST00000358575.5_5'UTR	NM_030917.3	NP_112179.2	Q6UN15	FIP1_HUMAN	factor interacting with PAPOLA and CPSF1						mRNA processing (GO:0006397)	mRNA cleavage and polyadenylation specificity factor complex (GO:0005847)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			large_intestine(3)|liver(1)|ovary(1)|skin(1)	6			GBM - Glioblastoma multiforme(3;3.31e-36)|LUSC - Lung squamous cell carcinoma(32;0.0134)			CCGTCGCCTTCCTGGGATTGG	0.682			T	PDGFRA	idiopathic hypereosinophilic syndrome																																	dbGAP		Dom	yes		4	4q12	81608	FIP1 like 1 (S. cerevisiae)		L	0																																										-	-	-	SO:0001623	5_prime_UTR_variant	0			AF161429	CCDS3491.1, CCDS47055.1, CCDS47056.1	4q12	2013-06-18	2013-06-18		ENSG00000145216	ENSG00000145216			19124	protein-coding gene	gene with protein product		607686	"""FIP1 like 1 (S. cerevisiae)"", ""FIP1L1 cleavage and polyadenylation specific factor subunit"""			11230166, 14749727	Standard	NM_030917		Approved	DKFZp586K0717, FIP1	uc003hae.3	Q6UN15	OTTHUMG00000128701	ENST00000337488.6:c.-138C>T	4.37:g.54243868C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B4DIR3|G3XAD6|Q0VGE0|Q499Y4|Q49AU3|Q7Z608|Q8WVN3|Q96F80|Q9H077	RNA	SNP	-	NULL	ENST00000337488.6	37	NULL	CCDS3491.1	4																																																																																			FIP1L1	-	-	ENSG00000145216		0.682	FIP1L1-001	KNOWN	basic|CCDS	protein_coding	FIP1L1	HGNC	protein_coding	OTTHUMT00000250602.1	47	0.00	0	C	NM_030917		54243868	54243868	+1	no_errors	ENST00000511376	ensembl	human	known	69_37n	rna	51	15.00	9	SNP	0.000	T
GDF9	2661	genome.wustl.edu	37	5	132197631	132197631	+	Missense_Mutation	SNP	G	G	C			TCGA-A1-A0SH-01A-11D-A099-09	TCGA-A1-A0SH-10A-03D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	473d6ae4-162a-4136-b44f-fad42529a31a	7df4bbf4-7ac5-4fd3-b0b9-ca6e49674cfd	g.chr5:132197631G>C	ENST00000378673.2	-	3	1881	c.1015C>G	c.(1015-1017)Ctg>Gtg	p.L339V	GDF9_ENST00000296875.2_Missense_Mutation_p.L339V|GDF9_ENST00000464378.1_5'Flank			O60383	GDF9_HUMAN	growth differentiation factor 9	339					female gamete generation (GO:0007292)|negative regulation of cell growth (GO:0030308)|oocyte growth (GO:0001555)|positive regulation of cell proliferation (GO:0008284)|regulation of progesterone secretion (GO:2000870)|transforming growth factor beta receptor signaling pathway (GO:0007179)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)	growth factor activity (GO:0008083)	p.L339V(1)		NS(1)|breast(2)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(3)|prostate(1)|skin(5)|upper_aerodigestive_tract(2)	22		all_cancers(142;0.105)|Breast(839;0.198)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)			TATTCACTCAGATTGAAGGAA	0.478																																						dbGAP											1	Substitution - Missense(1)	breast(1)											64.0	68.0	66.0					5																	132197631		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS4162.1, CCDS75299.1	5q31.1	2014-01-30			ENSG00000164404	ENSG00000164404		"""Endogenous ligands"""	4224	protein-coding gene	gene with protein product		601918				7760846	Standard	NM_005260		Approved		uc003kxz.1	O60383	OTTHUMG00000059842	ENST00000378673.2:c.1015C>G	5.37:g.132197631G>C	ENSP00000367942:p.Leu339Val	Somatic		WXS	Illumina GAIIx	Phase_IV	Q4VAW5	Missense_Mutation	SNP	pfam_TGF-b_C,smart_TGF-b_C	p.L339V	ENST00000378673.2	37	c.1015	CCDS4162.1	5	.	.	.	.	.	.	.	.	.	.	G	16.54	3.152541	0.57259	.	.	ENSG00000164404	ENST00000378673;ENST00000296875	D;D	0.81659	-1.52;-1.52	6.13	5.26	0.73747	Transforming growth factor-beta, C-terminal (1);	0.138155	0.50627	D	0.000104	D	0.84933	0.5582	M	0.85373	2.75	0.38790	D	0.954962	D	0.60160	0.987	P	0.51999	0.687	D	0.86530	0.1821	10	0.48119	T	0.1	.	7.5567	0.27829	0.2669:0.0:0.7331:0.0	.	339	O60383	GDF9_HUMAN	V	339	ENSP00000367942:L339V;ENSP00000296875:L339V	ENSP00000296875:L339V	L	-	1	2	GDF9	132225530	0.990000	0.36364	0.955000	0.39395	0.658000	0.38924	1.428000	0.34892	1.623000	0.50342	0.644000	0.83932	CTG	GDF9	-	NULL	ENSG00000164404		0.478	GDF9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GDF9	HGNC	protein_coding	OTTHUMT00000133060.2	54	0.00	0	G	NM_005260		132197631	132197631	-1	no_errors	ENST00000296875	ensembl	human	known	69_37n	missense	49	15.52	9	SNP	0.967	C
GOLGA6L2	283685	genome.wustl.edu	37	15	23685261	23685263	+	In_Frame_Del	DEL	TCT	TCT	-	rs572675457	byFrequency	TCGA-A1-A0SH-01A-11D-A099-09	TCGA-A1-A0SH-10A-03D-A099-09	TCT	TCT					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	473d6ae4-162a-4136-b44f-fad42529a31a	7df4bbf4-7ac5-4fd3-b0b9-ca6e49674cfd	g.chr15:23685261_23685263delTCT	ENST00000567107.1	-	8	2411_2413	c.2359_2361delAGA	c.(2359-2361)agadel	p.R787del	GOLGA6L2_ENST00000345070.5_Intron|GOLGA6L2_ENST00000312015.5_Intron			Q8N9W4	GG6L2_HUMAN	golgin A6 family-like 2	0										breast(1)|endometrium(7)	8						ctgcatcttctcttcctgctccc	0.571																																						dbGAP											0																																										-	-	-	SO:0001651	inframe_deletion	0			AK093463		15q11.2	2012-10-05	2010-02-12		ENSG00000174450	ENSG00000174450			26695	protein-coding gene	gene with protein product	"""cancer/testis antigen 105"""		"""golgi autoantigen, golgin subfamily a, 6-like 2"""				Standard	XM_002343322		Approved	CT105, FLJ36144	uc021sfy.1	Q8N9W4	OTTHUMG00000176417	ENST00000567107.1:c.2359_2361delAGA	15.37:g.23685261_23685263delTCT	ENSP00000454407:p.Arg787del	Somatic		WXS	Illumina GAIIx	Phase_IV	A1L301	In_Frame_Del	DEL	NULL	p.R787in_frame_del	ENST00000567107.1	37	c.2361_2359		15																																																																																			GOLGA6L2	-	NULL	ENSG00000174450		0.571	GOLGA6L2-002	PUTATIVE	basic|appris_candidate_longest	protein_coding	GOLGA6L2	HGNC	protein_coding	OTTHUMT00000431937.1	11	0.00	0	TCT	NM_182561		23685261	23685263	-1	no_errors	ENST00000567107	ensembl	human	putative	69_37n	in_frame_del	13	31.58	6	DEL	0.002:0.002:0.003	-
GOLGB1	2804	genome.wustl.edu	37	3	121415260	121415260	+	Silent	SNP	G	G	T			TCGA-A1-A0SH-01A-11D-A099-09	TCGA-A1-A0SH-10A-03D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	473d6ae4-162a-4136-b44f-fad42529a31a	7df4bbf4-7ac5-4fd3-b0b9-ca6e49674cfd	g.chr3:121415260G>T	ENST00000340645.5	-	13	4220	c.4095C>A	c.(4093-4095)gtC>gtA	p.V1365V	GOLGB1_ENST00000393667.3_Silent_p.V1370V	NM_001256487.1|NM_001256488.1|NM_004487.4	NP_001243416.1|NP_001243417.1|NP_004478.3	Q14789	GOGB1_HUMAN	golgin B1	1365					Golgi organization (GO:0007030)	cis-Golgi network (GO:0005801)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|Golgi stack (GO:0005795)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	poly(A) RNA binding (GO:0044822)	p.V1365V(1)		NS(1)|autonomic_ganglia(1)|breast(7)|central_nervous_system(2)|cervix(2)|endometrium(12)|kidney(3)|large_intestine(26)|liver(2)|lung(36)|ovary(7)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(13)	119				GBM - Glioblastoma multiforme(114;0.0989)		TTTCGGCATGGACTTCAGCTT	0.393																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											153.0	158.0	156.0					3																	121415260		2203	4299	6502	-	-	-	SO:0001819	synonymous_variant	0			X75304	CCDS3004.1, CCDS58847.1, CCDS74989.1	3q13	2010-02-12	2010-02-12	2007-07-27	ENSG00000173230	ENSG00000173230			4429	protein-coding gene	gene with protein product	"""macrogolgin"", ""golgi integral membrane protein 1"""	602500	"""golgi autoantigen, golgin subfamily b, macrogolgin (with transmembrane signal), 1"", ""golgin B1, golgi integral membrane protein"""			7691276, 15004235	Standard	NM_001256486		Approved	GCP, GCP372, giantin, GOLIM1	uc010hrc.4	Q14789	OTTHUMG00000159411	ENST00000340645.5:c.4095C>A	3.37:g.121415260G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B2ZZ91|D3DN92|E7EP74|Q14398	Silent	SNP	superfamily_Prefoldin,superfamily_STAT_TF_coiled-coil,smart_Leu_zip_homeo	p.V1365	ENST00000340645.5	37	c.4095	CCDS3004.1	3																																																																																			GOLGB1	-	NULL	ENSG00000173230		0.393	GOLGB1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	GOLGB1	HGNC	protein_coding	OTTHUMT00000355159.1	86	0.00	0	G	NM_004487		121415260	121415260	-1	no_errors	ENST00000340645	ensembl	human	known	69_37n	silent	61	19.48	15	SNP	0.064	T
GPR179	440435	genome.wustl.edu	37	17	36486443	36486443	+	Silent	SNP	C	C	T			TCGA-A1-A0SH-01A-11D-A099-09	TCGA-A1-A0SH-10A-03D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	473d6ae4-162a-4136-b44f-fad42529a31a	7df4bbf4-7ac5-4fd3-b0b9-ca6e49674cfd	g.chr17:36486443C>T	ENST00000342292.4	-	11	3029	c.3009G>A	c.(3007-3009)aaG>aaA	p.K1003K	GPR179_ENST00000584976.1_5'Flank	NM_001004334.2	NP_001004334.2	Q6PRD1	GP179_HUMAN	G protein-coupled receptor 179	1003					visual perception (GO:0007601)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)	p.K1003K(1)		breast(4)|cervix(2)|endometrium(9)|kidney(3)|large_intestine(16)|lung(15)|ovary(4)|pancreas(1)|prostate(1)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	60	Breast(7;2.97e-12)	Breast(25;0.0101)|Ovarian(249;0.15)				CATTTTCTTGCTTGGCTGGCA	0.642																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											49.0	51.0	51.0					17																	36486443		1922	4141	6063	-	-	-	SO:0001819	synonymous_variant	0				CCDS42308.1	17q21.1	2014-05-06	2006-02-16	2006-02-16	ENSG00000188888	ENSG00000277399		"""GPCR / Class C : Orphans"""	31371	protein-coding gene	gene with protein product		614515	"""GPR158-like 1"", ""GPR179"""	GPR158L1			Standard	NM_001004334		Approved	CSNB1E	uc002hpz.3	Q6PRD1	OTTHUMG00000188545	ENST00000342292.4:c.3009G>A	17.37:g.36486443C>T		Somatic		WXS	Illumina GAIIx	Phase_IV		Silent	SNP	pfam_GPCR_3_C,superfamily_Growth_fac_rcpt,pfscan_GPCR_3_C	p.K1003	ENST00000342292.4	37	c.3009	CCDS42308.1	17																																																																																			GPR179	-	NULL	ENSG00000188888		0.642	GPR179-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR179	HGNC	protein_coding	OTTHUMT00000255329.2	58	0.00	0	C			36486443	36486443	-1	no_errors	ENST00000342292	ensembl	human	known	69_37n	silent	57	44.12	45	SNP	0.991	T
GPR4	2828	genome.wustl.edu	37	19	46094651	46094651	+	Silent	SNP	G	G	C			TCGA-A1-A0SH-01A-11D-A099-09	TCGA-A1-A0SH-10A-03D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	473d6ae4-162a-4136-b44f-fad42529a31a	7df4bbf4-7ac5-4fd3-b0b9-ca6e49674cfd	g.chr19:46094651G>C	ENST00000323040.4	-	2	1418	c.474C>G	c.(472-474)ctC>ctG	p.L158L	OPA3_ENST00000544371.1_Intron|GPR4_ENST00000591614.1_5'Flank	NM_005282.2	NP_005273.1	P46093	GPR4_HUMAN	G protein-coupled receptor 4	158					G-protein coupled receptor signaling pathway (GO:0007186)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)	p.L158L(1)		breast(2)|endometrium(1)|kidney(3)|large_intestine(1)|lung(11)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	23				OV - Ovarian serous cystadenocarcinoma(262;0.0071)|GBM - Glioblastoma multiforme(486;0.128)|Epithelial(262;0.223)		GGTCTCGGAAGAGCTCGTCAT	0.647																																					Esophageal Squamous(117;181 1612 1673 14956 42937)	dbGAP											1	Substitution - coding silent(1)	breast(1)											62.0	62.0	62.0					19																	46094651		2203	4299	6502	-	-	-	SO:0001819	synonymous_variant	0			BC067536	CCDS12669.1	19q13.3	2012-08-21				ENSG00000177464		"""GPCR / Class A : Orphans"""	4497	protein-coding gene	gene with protein product		600551				8595909	Standard	NM_005282		Approved		uc002pcm.3	P46093		ENST00000323040.4:c.474C>G	19.37:g.46094651G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K3T3|B0M0K1|Q6NWM4	Silent	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_serpentine_rcpt_Srx,pfscan_GPCR_Rhodpsn_supfam,prints_GPR4_rcpt,prints_7TM_GPCR_Rhodpsn,prints_P2_purnocptor,prints_Psych_rcpt	p.L158	ENST00000323040.4	37	c.474	CCDS12669.1	19																																																																																			GPR4	-	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_serpentine_rcpt_Srx,pfscan_GPCR_Rhodpsn_supfam,prints_GPR4_rcpt	ENSG00000177464		0.647	GPR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR4	HGNC	protein_coding	OTTHUMT00000459603.1	31	0.00	0	G	NM_005282		46094651	46094651	-1	no_errors	ENST00000323040	ensembl	human	known	69_37n	silent	45	18.18	10	SNP	1.000	C
GPR32	2854	genome.wustl.edu	37	19	51274646	51274646	+	Missense_Mutation	SNP	C	C	A	rs372938540		TCGA-A1-A0SH-01A-11D-A099-09	TCGA-A1-A0SH-10A-03D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	473d6ae4-162a-4136-b44f-fad42529a31a	7df4bbf4-7ac5-4fd3-b0b9-ca6e49674cfd	g.chr19:51274646C>A	ENST00000270590.4	+	1	926	c.789C>A	c.(787-789)agC>agA	p.S263R		NM_001506.1	NP_001497.1	O75388	GPR32_HUMAN	G protein-coupled receptor 32	263					G-protein coupled receptor signaling pathway (GO:0007186)	integral component of plasma membrane (GO:0005887)	G-protein coupled receptor activity (GO:0004930)	p.S263R(1)		breast(4)|endometrium(4)|kidney(1)|large_intestine(3)|lung(12)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	29		all_neural(266;0.131)		OV - Ovarian serous cystadenocarcinoma(262;0.00641)|GBM - Glioblastoma multiforme(134;0.028)		TGCTGGTGAGCGCTTTCTTTA	0.602																																					Esophageal Squamous(113;152 1581 5732 15840 44398)	dbGAP											1	Substitution - Missense(1)	breast(1)											69.0	72.0	71.0					19																	51274646		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF045764	CCDS12801.1	19q13.33	2012-08-20			ENSG00000142511	ENSG00000142511		"""GPCR / Class A : Resolvin receptors"""	4487	protein-coding gene	gene with protein product	"""resolvin D1 receptor"""	603195				9653656	Standard	NM_001506		Approved	RVDR1	uc010ycf.3	O75388		ENST00000270590.4:c.789C>A	19.37:g.51274646C>A	ENSP00000270590:p.Ser263Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	Q502U7|Q6NWS5	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam,prints_7TM_GPCR_Rhodpsn,prints_Frt_met_rcpt	p.S263R	ENST00000270590.4	37	c.789	CCDS12801.1	19	.	.	.	.	.	.	.	.	.	.	C	12.94	2.088626	0.36855	.	.	ENSG00000142511	ENST00000270590	T	0.38077	1.16	2.56	0.155	0.14906	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	T	0.46034	0.1372	L	0.53249	1.67	0.09310	N	1	D	0.60575	0.988	D	0.63033	0.91	T	0.28713	-1.0035	9	0.62326	D	0.03	.	5.7302	0.18036	0.0:0.5701:0.0:0.4299	.	263	O75388	GPR32_HUMAN	R	263	ENSP00000270590:S263R	ENSP00000270590:S263R	S	+	3	2	GPR32	55966458	0.000000	0.05858	0.014000	0.15608	0.894000	0.52154	-1.124000	0.03260	-0.031000	0.13781	0.313000	0.20887	AGC	GPR32	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_7TM_GPCR_Rhodpsn	ENSG00000142511		0.602	GPR32-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR32	HGNC	protein_coding	OTTHUMT00000465016.1	82	0.00	0	C			51274646	51274646	+1	no_errors	ENST00000270590	ensembl	human	known	69_37n	missense	103	16.94	21	SNP	0.150	A
H2BFWT	158983	genome.wustl.edu	37	X	103267770	103267770	+	Nonsense_Mutation	SNP	C	C	A			TCGA-A1-A0SH-01A-11D-A099-09	TCGA-A1-A0SH-10A-03D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	473d6ae4-162a-4136-b44f-fad42529a31a	7df4bbf4-7ac5-4fd3-b0b9-ca6e49674cfd	g.chrX:103267770C>A	ENST00000217926.5	-	1	489	c.463G>T	c.(463-465)Gag>Tag	p.E155*	H2BFM_ENST00000243297.5_5'Flank	NM_001002916.3	NP_001002916.3	Q7Z2G1	H2BWT_HUMAN	H2B histone family, member W, testis-specific	155						membrane (GO:0016020)|nucleosome (GO:0000786)|nucleus (GO:0005634)	DNA binding (GO:0003677)	p.E155*(1)		breast(2)|endometrium(3)|large_intestine(2)|lung(7)|ovary(1)|upper_aerodigestive_tract(1)	16						CCTTCGGACTCGGCGAGCTTG	0.662																																						dbGAP											1	Substitution - Nonsense(1)	breast(1)											33.0	33.0	33.0					X																	103267770		2200	4296	6496	-	-	-	SO:0001587	stop_gained	0			BC038109	CCDS35362.1	Xq22.2	2011-01-27			ENSG00000123569	ENSG00000123569		"""Histones / Replication-independent"""	27252	protein-coding gene	gene with protein product		300507				12477932	Standard	NM_001002916		Approved		uc004elr.3	Q7Z2G1	OTTHUMG00000022120	ENST00000217926.5:c.463G>T	X.37:g.103267770C>A	ENSP00000354723:p.Glu155*	Somatic		WXS	Illumina GAIIx	Phase_IV	B1AK72|Q147W3	Nonsense_Mutation	SNP	pfam_Histone_core_D,superfamily_Histone-fold,smart_Histone_H2B,prints_Histone_H2B	p.E155*	ENST00000217926.5	37	c.463	CCDS35362.1	X	.	.	.	.	.	.	.	.	.	.	.	15.84	2.950984	0.53186	.	.	ENSG00000123569	ENST00000217926	.	.	.	2.84	-0.0968	0.13635	.	0.659413	0.09928	U	0.737553	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.59425	D	0.04	.	2.481	0.04587	0.1878:0.51:0.181:0.1212	.	.	.	.	X	155	.	ENSP00000354723:E155X	E	-	1	0	H2BFWT	103154426	0.972000	0.33761	0.000000	0.03702	0.000000	0.00434	2.059000	0.41384	-0.136000	0.11475	-0.229000	0.12294	GAG	H2BFWT	-	superfamily_Histone-fold,smart_Histone_H2B,prints_Histone_H2B	ENSG00000123569		0.662	H2BFWT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	H2BFWT	HGNC	protein_coding	OTTHUMT00000057756.2	53	0.00	0	C	NM_001002916		103267770	103267770	-1	no_errors	ENST00000217926	ensembl	human	known	69_37n	nonsense	44	15.38	8	SNP	0.996	A
HCFC2	29915	genome.wustl.edu	37	12	104460047	104460047	+	Missense_Mutation	SNP	G	G	A			TCGA-A1-A0SH-01A-11D-A099-09	TCGA-A1-A0SH-10A-03D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	473d6ae4-162a-4136-b44f-fad42529a31a	7df4bbf4-7ac5-4fd3-b0b9-ca6e49674cfd	g.chr12:104460047G>A	ENST00000229330.4	+	2	370	c.266G>A	c.(265-267)gGa>gAa	p.G89E	GLT8D2_ENST00000548660.1_5'Flank	NM_013320.2	NP_037452.1	Q9Y5Z7	HCFC2_HUMAN	host cell factor C2	89					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|viral process (GO:0016032)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	transcription coactivator activity (GO:0003713)	p.G89E(1)		breast(3)|central_nervous_system(1)|endometrium(4)|large_intestine(6)|lung(14)|ovary(3)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	35						GTATTTGGGGGAATGGTTGAA	0.378																																					Esophageal Squamous(184;1814 2036 4771 6974 15702)	dbGAP											1	Substitution - Missense(1)	breast(1)											161.0	165.0	164.0					12																	104460047		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF117210	CCDS9097.1	12q23.3	2011-03-30			ENSG00000111727	ENSG00000111727			24972	protein-coding gene	gene with protein product		607926				10196288	Standard	NM_013320		Approved	HCF-2	uc001tkj.4	Q9Y5Z7	OTTHUMG00000170175	ENST00000229330.4:c.266G>A	12.37:g.104460047G>A	ENSP00000229330:p.Gly89Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R8Q5|C0H5X3	Missense_Mutation	SNP	pfam_Kelch_1,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	p.G89E	ENST00000229330.4	37	c.266	CCDS9097.1	12	.	.	.	.	.	.	.	.	.	.	G	23.9	4.465739	0.84425	.	.	ENSG00000111727	ENST00000229330	D	0.97941	-4.62	4.11	4.11	0.48088	Kelch-type beta propeller (1);	0.000000	0.85682	D	0.000000	D	0.99278	0.9748	H	0.98276	4.19	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.98523	1.0624	10	0.87932	D	0	-12.1478	16.7318	0.85436	0.0:0.0:1.0:0.0	.	89	Q9Y5Z7	HCFC2_HUMAN	E	89	ENSP00000229330:G89E	ENSP00000229330:G89E	G	+	2	0	HCFC2	102984177	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	9.575000	0.98187	1.986000	0.57962	0.655000	0.94253	GGA	HCFC2	-	NULL	ENSG00000111727		0.378	HCFC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HCFC2	HGNC	protein_coding	OTTHUMT00000407780.1	161	0.00	0	G	NM_013320		104460047	104460047	+1	no_errors	ENST00000229330	ensembl	human	known	69_37n	missense	142	16.96	29	SNP	1.000	A
HYDIN	54768	genome.wustl.edu	37	16	70989287	70989287	+	Nonsense_Mutation	SNP	C	C	A			TCGA-A1-A0SH-01A-11D-A099-09	TCGA-A1-A0SH-10A-03D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	473d6ae4-162a-4136-b44f-fad42529a31a	7df4bbf4-7ac5-4fd3-b0b9-ca6e49674cfd	g.chr16:70989287C>A	ENST00000393567.2	-	40	6457	c.6307G>T	c.(6307-6309)Gag>Tag	p.E2103*		NM_001270974.1	NP_001257903.1	Q4G0P3	HYDIN_HUMAN	HYDIN, axonemal central pair apparatus protein	2103					cilium assembly (GO:0042384)|cilium movement (GO:0003341)|epithelial cell development (GO:0002064)|trachea development (GO:0060438)|ventricular system development (GO:0021591)	cell projection (GO:0042995)		p.E2102*(1)|p.E2054*(1)		breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(17)|lung(12)|ovary(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)	43		Ovarian(137;0.0654)				CCAGCCTCCTCTCCTTCCTTC	0.567																																						dbGAP											2	Substitution - Nonsense(2)	breast(2)											62.0	61.0	61.0					16																	70989287		1949	4142	6091	-	-	-	SO:0001587	stop_gained	0			AK074472	CCDS10897.1, CCDS56004.1, CCDS56005.1, CCDS59269.1	16q22.2	2014-02-05	2012-01-06		ENSG00000157423	ENSG00000157423		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	19368	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 31"""	610812	"""hydrocephalus inducing"", ""hydrocephalus inducing homolog (mouse)"""			12719380, 23022101	Standard	NM_001198542		Approved	DKFZp434D0513, KIAA1864, PPP1R31, CILD5	uc031qwy.1	Q4G0P3	OTTHUMG00000137584	ENST00000393567.2:c.6307G>T	16.37:g.70989287C>A	ENSP00000377197:p.Glu2103*	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NC70|A6NLZ0|B4DQY4|B4DRN4|F5H6V3|Q8N3H8|Q8N3P6|Q8TC08|Q96JG3|Q96SS4|Q9H5U3|Q9H9B8|Q9NTI0|Q9UBE5	Nonsense_Mutation	SNP	superfamily_PapD-like	p.E2102*	ENST00000393567.2	37	c.6304	CCDS59269.1	16	.	.	.	.	.	.	.	.	.	.	C	46	12.422949	0.99666	.	.	ENSG00000157423	ENST00000393567;ENST00000316490	.	.	.	3.92	3.92	0.45320	.	0.000000	0.33180	U	0.005190	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.72032	D	0.01	.	15.8593	0.79009	0.0:1.0:0.0:0.0	.	.	.	.	X	2103;2102	.	ENSP00000310485:E394X	E	-	1	0	HYDIN	69546788	0.998000	0.40836	0.770000	0.31555	0.280000	0.26924	5.591000	0.67536	1.875000	0.54330	0.511000	0.50034	GAG	HYDIN	-	NULL	ENSG00000157423		0.567	HYDIN-001	PUTATIVE	not_organism_supported|basic|appris_principal|exp_conf|CCDS	protein_coding	HYDIN	HGNC	protein_coding	OTTHUMT00000398624.3	55	0.00	0	C			70989287	70989287	-1	no_errors	ENST00000316490	ensembl	human	known	69_37n	nonsense	48	12.73	7	SNP	0.920	A
IPO4	79711	genome.wustl.edu	37	14	24652347	24652347	+	Silent	SNP	C	C	G			TCGA-A1-A0SH-01A-11D-A099-09	TCGA-A1-A0SH-10A-03D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	473d6ae4-162a-4136-b44f-fad42529a31a	7df4bbf4-7ac5-4fd3-b0b9-ca6e49674cfd	g.chr14:24652347C>G	ENST00000354464.6	-	23	2432	c.2256G>C	c.(2254-2256)gtG>gtC	p.V752V	RP11-468E2.2_ENST00000561419.1_3'UTR	NM_024658.3	NP_078934.3	Q8TEX9	IPO4_HUMAN	importin 4	752					DNA replication-dependent nucleosome assembly (GO:0006335)|DNA replication-independent nucleosome assembly (GO:0006336)|intracellular protein transport (GO:0006886)|protein transport (GO:0015031)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nuclear chromatin (GO:0000790)|protein complex (GO:0043234)		p.V752V(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(5)|lung(10)|ovary(1)|stomach(2)|urinary_tract(1)	33				GBM - Glioblastoma multiforme(265;0.0087)		TGTAGGATGGCACGACTCGGG	0.662																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											44.0	51.0	49.0					14																	24652347		2105	4238	6343	-	-	-	SO:0001819	synonymous_variant	0			AF411122	CCDS9616.1	14q11.2	2003-03-10			ENSG00000196497	ENSG00000196497		"""Importins"""	19426	protein-coding gene	gene with protein product						11823430	Standard	NR_051979		Approved	Imp4, FLJ23338	uc001wmv.1	Q8TEX9	OTTHUMG00000028801	ENST00000354464.6:c.2256G>C	14.37:g.24652347C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	B2RN95|Q2NL96|Q86TZ9|Q8NCG8|Q96SJ3|Q9BTI4|Q9H5L0	Missense_Mutation	SNP	pfam_HEAT,superfamily_ARM-type_fold,pfscan_HEAT_type_2	p.A216P	ENST00000354464.6	37	c.646	CCDS9616.1	14																																																																																			IPO4	-	superfamily_ARM-type_fold	ENSG00000196497		0.662	IPO4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IPO4	HGNC	protein_coding	OTTHUMT00000071931.4	34	0.00	0	C	NM_024658		24652347	24652347	-1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000561462	ensembl	human	putative	69_37n	missense	29	27.50	11	SNP	0.899	G
IGHV3-20	28445	genome.wustl.edu	37	14	106667991	106667991	+	RNA	SNP	T	T	C			TCGA-A1-A0SH-01A-11D-A099-09	TCGA-A1-A0SH-10A-03D-A099-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	473d6ae4-162a-4136-b44f-fad42529a31a	7df4bbf4-7ac5-4fd3-b0b9-ca6e49674cfd	g.chr14:106667991T>C	ENST00000390606.2	-	0	104				AB019440.50_ENST00000605005.1_lincRNA					immunoglobulin heavy variable 3-20																		GAATCACCTTTTAAAATAGCA	0.463																																						dbGAP											0													136.0	126.0	129.0					14																	106667991		1894	4128	6022	-	-	-			0			M99657		14q32.33	2012-02-08			ENSG00000211946	ENSG00000211946		"""Immunoglobulins / IGH locus"""	5585	other	immunoglobulin gene							Standard	NG_001019		Approved				OTTHUMG00000152285		14.37:g.106667991T>C		Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Ig_V-set,smart_Ig_V-set_subgr,pfscan_Ig-like	p.K15E	ENST00000390606.2	37	c.43		14																																																																																			IGHV3-20	-	NULL	ENSG00000211946		0.463	IGHV3-20-001	KNOWN	mRNA_end_NF|cds_end_NF|basic|appris_principal	IG_V_gene	IGHV3-20	HGNC	IG_V_gene	OTTHUMT00000325673.1	163	0.00	0	T	NG_001019		106667991	106667991	-1	no_stop_codon	ENST00000390606	ensembl	human	known	69_37n	missense	133	24.72	44	SNP	0.053	C
IRS4	8471	genome.wustl.edu	37	X	107978508	107978508	+	Missense_Mutation	SNP	G	G	C			TCGA-A1-A0SH-01A-11D-A099-09	TCGA-A1-A0SH-10A-03D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	473d6ae4-162a-4136-b44f-fad42529a31a	7df4bbf4-7ac5-4fd3-b0b9-ca6e49674cfd	g.chrX:107978508G>C	ENST00000372129.2	-	1	1143	c.1067C>G	c.(1066-1068)tCc>tGc	p.S356C	RP6-24A23.3_ENST00000436013.1_RNA|RP6-24A23.3_ENST00000608811.1_RNA|RP6-24A23.6_ENST00000563887.1_5'Flank	NM_003604.2	NP_003595.1	O14654	IRS4_HUMAN	insulin receptor substrate 4	356					positive regulation of signal transduction (GO:0009967)|signal transduction (GO:0007165)	plasma membrane (GO:0005886)	SH3/SH2 adaptor activity (GO:0005070)|signal transducer activity (GO:0004871)			NS(1)|breast(2)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(22)|lung(30)|ovary(5)|pancreas(2)|prostate(1)|skin(1)	78						CCTCCTAGCGGACAGCAGGGT	0.622																																						dbGAP											0													104.0	109.0	108.0					X																	107978508		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF007567	CCDS14544.1	Xq22.3	2008-08-01			ENSG00000133124	ENSG00000133124			6128	protein-coding gene	gene with protein product		300904				9261155, 9553137	Standard	NM_003604		Approved	PY160, IRS-4	uc004eoc.2	O14654	OTTHUMG00000022181	ENST00000372129.2:c.1067C>G	X.37:g.107978508G>C	ENSP00000361202:p.Ser356Cys	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Insln_rcpt_S1,smart_Pleckstrin_homology,smart_Insln_rcpt_S1,pfscan_Pleckstrin_homology,pfscan_Insln_rcpt_S1,prints_Insln_rcpt_S1	p.S356C	ENST00000372129.2	37	c.1067	CCDS14544.1	X	.	.	.	.	.	.	.	.	.	.	G	16.84	3.234377	0.58886	.	.	ENSG00000133124	ENST00000372129	T	0.38077	1.16	4.73	4.73	0.59995	.	0.401710	0.23849	N	0.043963	T	0.48607	0.1509	L	0.32530	0.975	0.44834	D	0.997842	D	0.76494	0.999	D	0.68192	0.956	T	0.44112	-0.9349	10	0.40728	T	0.16	-15.5059	17.0078	0.86398	0.0:0.0:1.0:0.0	.	356	O14654	IRS4_HUMAN	C	356	ENSP00000361202:S356C	ENSP00000361202:S356C	S	-	2	0	IRS4	107865164	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.356000	0.97091	2.193000	0.70182	0.600000	0.82982	TCC	IRS4	-	NULL	ENSG00000133124		0.622	IRS4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IRS4	HGNC	protein_coding	OTTHUMT00000057879.1	40	0.00	0	G	NM_003604		107978508	107978508	-1	no_errors	ENST00000372129	ensembl	human	known	69_37n	missense	53	25.35	18	SNP	1.000	C
ITIH5	80760	genome.wustl.edu	37	10	7605129	7605129	+	Missense_Mutation	SNP	C	C	T			TCGA-A1-A0SH-01A-11D-A099-09	TCGA-A1-A0SH-10A-03D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	473d6ae4-162a-4136-b44f-fad42529a31a	7df4bbf4-7ac5-4fd3-b0b9-ca6e49674cfd	g.chr10:7605129C>T	ENST00000256861.6	-	14	2824	c.2746G>A	c.(2746-2748)Gac>Aac	p.D916N	ITIH5_ENST00000298441.6_Missense_Mutation_p.D702N|ITIH5_ENST00000446830.2_Missense_Mutation_p.D698N|ITIH5_ENST00000397146.2_Intron	NM_030569.6	NP_085046.5	Q86UX2	ITIH5_HUMAN	inter-alpha-trypsin inhibitor heavy chain family, member 5	916					hyaluronan metabolic process (GO:0030212)	extracellular region (GO:0005576)	serine-type endopeptidase inhibitor activity (GO:0004867)	p.D916N(1)		NS(1)|breast(3)|central_nervous_system(3)|endometrium(5)|kidney(6)|large_intestine(21)|lung(25)|ovary(4)|pancreas(1)|skin(2)|stomach(1)|urinary_tract(3)	75						TACTCCCCGTCAATCAGTTTG	0.527																																						dbGAP											1	Substitution - Missense(1)	breast(1)											188.0	156.0	167.0					10																	7605129		2203	4300	6503	-	-	-	SO:0001583	missense	0					10p14	2011-10-26	2011-10-26		ENSG00000123243	ENSG00000123243			21449	protein-coding gene	gene with protein product		609783	"""inter-alpha (globulin) inhibitor H5"""			14744536	Standard	NM_001001851		Approved	MGC10848	uc021pmv.1	Q86UX2	OTTHUMG00000017635	ENST00000256861.6:c.2746G>A	10.37:g.7605129C>T	ENSP00000256861:p.Asp916Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5T664|Q5T665|Q5T666|Q6AI60|Q6UXB7|Q8TF48|Q8WYV2|Q96K70	Missense_Mutation	SNP	pfam_ITI_HC_C,pfam_VIT,pfam_VWF_A,smart_VIT,smart_VWF_A,pfscan_VWF_A	p.D916N	ENST00000256861.6	37	c.2746		10	.	.	.	.	.	.	.	.	.	.	C	32	5.153656	0.94645	.	.	ENSG00000123243	ENST00000256861;ENST00000298441;ENST00000446830	T;T;T	0.03801	3.99;3.8;3.83	5.79	5.79	0.91817	.	0.000000	0.85682	D	0.000000	T	0.25306	0.0615	.	.	.	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.00152	-1.1983	9	0.87932	D	0	-36.0076	20.0275	0.97527	0.0:1.0:0.0:0.0	.	916;702	Q86UX2;Q86UX2-3	ITIH5_HUMAN;.	N	916;702;698	ENSP00000256861:D916N;ENSP00000298441:D702N;ENSP00000387969:D698N	ENSP00000256861:D916N	D	-	1	0	ITIH5	7645135	1.000000	0.71417	0.141000	0.22245	0.682000	0.39822	7.338000	0.79269	2.737000	0.93849	0.650000	0.86243	GAC	ITIH5	-	NULL	ENSG00000123243		0.527	ITIH5-001	KNOWN	basic|appris_principal	protein_coding	ITIH5	HGNC	protein_coding	OTTHUMT00000046688.1	92	0.00	0	C	NM_030569		7605129	7605129	-1	no_errors	ENST00000256861	ensembl	human	known	69_37n	missense	102	23.88	32	SNP	1.000	T
KCNU1	157855	genome.wustl.edu	37	8	36663872	36663872	+	Missense_Mutation	SNP	C	C	T			TCGA-A1-A0SH-01A-11D-A099-09	TCGA-A1-A0SH-10A-03D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	473d6ae4-162a-4136-b44f-fad42529a31a	7df4bbf4-7ac5-4fd3-b0b9-ca6e49674cfd	g.chr8:36663872C>T	ENST00000399881.3	+	5	591	c.554C>T	c.(553-555)tCt>tTt	p.S185F		NM_001031836.2	NP_001027006.2	A8MYU2	KCNU1_HUMAN	potassium channel, subfamily U, member 1	185					multicellular organism reproduction (GO:0032504)|potassium ion transmembrane transport (GO:0071805)|single fertilization (GO:0007338)|sperm-egg recognition (GO:0035036)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	large conductance calcium-activated potassium channel activity (GO:0060072)|potassium channel activity (GO:0005267)|voltage-gated potassium channel activity (GO:0005249)	p.S185F(2)		breast(4)|central_nervous_system(1)|cervix(1)|endometrium(8)|kidney(1)|large_intestine(9)|lung(31)|ovary(1)|urinary_tract(1)	57				KIRC - Kidney renal clear cell carcinoma(67;0.0504)|Kidney(114;0.0634)		ACCTTTATTTCTTATTATTTG	0.353																																						dbGAP											2	Substitution - Missense(2)	breast(2)											85.0	81.0	82.0					8																	36663872		1821	4083	5904	-	-	-	SO:0001583	missense	0			BC028701	CCDS55220.1	8p11.2	2012-07-05				ENSG00000215262		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, calcium-activated"""	18867	protein-coding gene	gene with protein product		615215				16382103	Standard	NM_001031836		Approved	KCa5.1, Slo3, KCNMC1, Kcnma3	uc010lvw.3	A8MYU2		ENST00000399881.3:c.554C>T	8.37:g.36663872C>T	ENSP00000382770:p.Ser185Phe	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_K_chnl_Ca-activ_BK_asu,pfam_Ion_trans_2,prints_K_chnl_Ca-activ_BK_asu	p.S185F	ENST00000399881.3	37	c.554	CCDS55220.1	8	.	.	.	.	.	.	.	.	.	.	C	19.88	3.909944	0.72983	.	.	ENSG00000215262	ENST00000523973;ENST00000399881	T;T	0.53206	0.63;0.63	5.57	4.68	0.58851	Ion transport (1);	0.097290	0.41823	U	0.000806	T	0.62998	0.2474	L	0.49126	1.545	0.80722	D	1	D	0.76494	0.999	D	0.72338	0.977	T	0.66720	-0.5852	10	0.87932	D	0	-0.5576	15.3286	0.74186	0.0:0.8591:0.1409:0.0	.	185	A8MYU2	KCNU1_HUMAN	F	185	ENSP00000429951:S185F;ENSP00000382770:S185F	ENSP00000382770:S185F	S	+	2	0	KCNU1	36783030	1.000000	0.71417	1.000000	0.80357	0.769000	0.43574	6.980000	0.76160	1.331000	0.45412	-0.312000	0.09012	TCT	KCNU1	-	NULL	ENSG00000215262		0.353	KCNU1-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	KCNU1	HGNC	protein_coding	OTTHUMT00000376631.1	178	0.00	0	C	NM_001031836		36663872	36663872	+1	no_errors	ENST00000399881	ensembl	human	known	69_37n	missense	186	16.59	37	SNP	1.000	T
KDELR3	11015	genome.wustl.edu	37	22	38875700	38875700	+	Missense_Mutation	SNP	C	C	G			TCGA-A1-A0SH-01A-11D-A099-09	TCGA-A1-A0SH-10A-03D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	473d6ae4-162a-4136-b44f-fad42529a31a	7df4bbf4-7ac5-4fd3-b0b9-ca6e49674cfd	g.chr22:38875700C>G	ENST00000216014.4	+	3	467	c.295C>G	c.(295-297)Ctg>Gtg	p.L99V	KDELR3_ENST00000409006.3_Missense_Mutation_p.L99V|KDELR3_ENST00000471268.1_3'UTR	NM_006855.2	NP_006846.1	O43731	ERD23_HUMAN	KDEL (Lys-Asp-Glu-Leu) endoplasmic reticulum protein retention receptor 3	99					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|protein retention in ER lumen (GO:0006621)|protein transport (GO:0015031)|vesicle-mediated transport (GO:0016192)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	ER retention sequence binding (GO:0046923)	p.L99V(2)		breast(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(5)|ovary(2)|prostate(1)	13	Melanoma(58;0.0286)					GGAGTTTCTTCTGGTCCCAGT	0.433																																					Ovarian(11;103 529 24120 28493 32980)	dbGAP											2	Substitution - Missense(2)	breast(2)											282.0	287.0	286.0					22																	38875700		2203	4300	6503	-	-	-	SO:0001583	missense	0			AL035081	CCDS13972.1, CCDS46705.1	22q13	2008-05-02			ENSG00000100196	ENSG00000100196			6306	protein-coding gene	gene with protein product							Standard	NM_006855		Approved		uc003avu.3	O43731	OTTHUMG00000153520	ENST00000216014.4:c.295C>G	22.37:g.38875700C>G	ENSP00000216014:p.Leu99Val	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K7T7|B8ZZ26|O95557|Q4V750|Q4V767|Q53FP4|Q53GK1	Missense_Mutation	SNP	pfam_ER_ret_rcpt,superfamily_Cyt_c_oxidase_su2-like_TM_dom,prints_ER_ret_rcpt	p.L99V	ENST00000216014.4	37	c.295	CCDS13972.1	22	.	.	.	.	.	.	.	.	.	.	C	1.249	-0.619001	0.03663	.	.	ENSG00000100196	ENST00000216014;ENST00000409006	T;T	0.27104	1.69;1.69	4.39	-0.541	0.11858	.	0.080255	0.51477	N	0.000082	T	0.09774	0.0240	N	0.14661	0.345	0.58432	D	0.999997	B;B	0.06786	0.0;0.001	B;B	0.17433	0.003;0.018	T	0.34576	-0.9823	10	0.05436	T	0.98	.	6.3699	0.21475	0.0:0.4914:0.2703:0.2383	.	99;99	O43731;O43731-2	ERD23_HUMAN;.	V	99	ENSP00000216014:L99V;ENSP00000386918:L99V	ENSP00000216014:L99V	L	+	1	2	KDELR3	37205646	0.096000	0.21769	0.977000	0.42913	0.998000	0.95712	-0.232000	0.09055	0.110000	0.17919	0.655000	0.94253	CTG	KDELR3	-	pfam_ER_ret_rcpt,superfamily_Cyt_c_oxidase_su2-like_TM_dom	ENSG00000100196		0.433	KDELR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KDELR3	HGNC	protein_coding	OTTHUMT00000331474.1	139	0.70	1	C			38875700	38875700	+1	no_errors	ENST00000409006	ensembl	human	known	69_37n	missense	152	22.45	44	SNP	0.657	G
KLHL25	64410	genome.wustl.edu	37	15	86311940	86311940	+	Missense_Mutation	SNP	A	A	T			TCGA-A1-A0SH-01A-11D-A099-09	TCGA-A1-A0SH-10A-03D-A099-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	473d6ae4-162a-4136-b44f-fad42529a31a	7df4bbf4-7ac5-4fd3-b0b9-ca6e49674cfd	g.chr15:86311940A>T	ENST00000337975.5	-	2	1376	c.1102T>A	c.(1102-1104)Tgg>Agg	p.W368R	KLHL25_ENST00000559131.1_Intron|KLHL25_ENST00000536947.1_Missense_Mutation_p.W368R|MIR1276_ENST00000408707.1_RNA	NM_022480.3	NP_071925.2	Q9H0H3	KLH25_HUMAN	kelch-like family member 25	368					protein ubiquitination (GO:0016567)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|regulation of translational initiation (GO:0006446)	Cul3-RING ubiquitin ligase complex (GO:0031463)|cytoplasm (GO:0005737)				breast(1)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(7)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	25						GCCTTGGACCATTCCTCATGT	0.627																																						dbGAP											0													42.0	42.0	42.0					15																	86311940		2202	4299	6501	-	-	-	SO:0001583	missense	0				CCDS10339.1	15q25.3	2013-02-22	2013-02-22		ENSG00000183655	ENSG00000183655		"""Kelch-like"", ""BTB/POZ domain containing"""	25732	protein-coding gene	gene with protein product	"""ectodermal-neural cortex 2"""		"""kelch-like 25 (Drosophila)"""				Standard	XM_006720635		Approved	FLJ12587, ENC2, ENC-2	uc002bly.3	Q9H0H3	OTTHUMG00000148672	ENST00000337975.5:c.1102T>A	15.37:g.86311940A>T	ENSP00000336800:p.Trp368Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RDH2|B3KRT7	Missense_Mutation	SNP	pfam_Kelch_1,pfam_BACK,pfam_BTB_POZ,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_BACK,smart_Kelch_1,pirsf_Kelch-like_gigaxonin,pfscan_BTB/POZ-like	p.W368R	ENST00000337975.5	37	c.1102	CCDS10339.1	15	.	.	.	.	.	.	.	.	.	.	A	15.48	2.846299	0.51164	.	.	ENSG00000183655	ENST00000337975;ENST00000538153;ENST00000536947	D;D	0.96940	-4.18;-4.18	5.18	5.18	0.71444	Kelch-type beta propeller (1);	0.000000	0.85682	D	0.000000	D	0.98741	0.9577	H	0.96943	3.91	0.58432	D	0.999999	D	0.89917	1.0	D	0.97110	1.0	D	0.99628	1.0985	10	0.87932	D	0	.	14.2134	0.65778	1.0:0.0:0.0:0.0	.	368	Q9H0H3	ENC2_HUMAN	R	368;337;368	ENSP00000336800:W368R;ENSP00000444739:W368R	ENSP00000336800:W368R	W	-	1	0	KLHL25	84112944	1.000000	0.71417	1.000000	0.80357	0.539000	0.34962	9.339000	0.96797	1.964000	0.57103	0.379000	0.24179	TGG	KLHL25	-	pfam_Kelch_1,smart_Kelch_1,pirsf_Kelch-like_gigaxonin	ENSG00000183655		0.627	KLHL25-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KLHL25	HGNC	protein_coding	OTTHUMT00000309023.1	37	0.00	0	A	NM_022480		86311940	86311940	-1	no_errors	ENST00000337975	ensembl	human	known	69_37n	missense	32	23.81	10	SNP	1.000	T
KRT28	162605	genome.wustl.edu	37	17	38955885	38955885	+	Missense_Mutation	SNP	C	C	A			TCGA-A1-A0SH-01A-11D-A099-09	TCGA-A1-A0SH-10A-03D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	473d6ae4-162a-4136-b44f-fad42529a31a	7df4bbf4-7ac5-4fd3-b0b9-ca6e49674cfd	g.chr17:38955885C>A	ENST00000306658.7	-	1	326	c.261G>T	c.(259-261)aaG>aaT	p.K87N		NM_181535.3	NP_853513.2			keratin 28									p.K87N(1)		NS(1)|breast(3)|endometrium(1)|kidney(1)|large_intestine(4)|lung(14)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	30		Breast(137;0.000301)				GCATGGTCACCTTCTCATTTC	0.502																																					Melanoma(19;789 869 15380 26882 39836)	dbGAP											1	Substitution - Missense(1)	breast(1)											98.0	97.0	98.0					17																	38955885		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK129827	CCDS11376.1	17q21.2	2013-01-16	2006-07-17	2006-07-17	ENSG00000173908	ENSG00000173908		"""-"", ""Intermediate filaments type I, keratins (acidic)"""	30842	protein-coding gene	gene with protein product			"""keratin 25D"""	KRT25D		16831889	Standard	NM_181535		Approved		uc002hvh.1	Q7Z3Y7	OTTHUMG00000133365	ENST00000306658.7:c.261G>T	17.37:g.38955885C>A	ENSP00000305263:p.Lys87Asn	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_F,superfamily_Prefoldin,prints_Keratin_I	p.K87N	ENST00000306658.7	37	c.261	CCDS11376.1	17	.	.	.	.	.	.	.	.	.	.	C	18.33	3.600504	0.66332	.	.	ENSG00000173908	ENST00000306658	D	0.93547	-3.24	5.5	4.54	0.55810	Filament (1);	0.000000	0.64402	D	0.000014	D	0.97548	0.9197	H	0.96996	3.92	0.43703	D	0.996168	D	0.89917	1.0	D	0.87578	0.998	D	0.97713	1.0192	10	0.87932	D	0	.	10.1996	0.43075	0.0:0.8306:0.0:0.1694	.	87	Q7Z3Y7	K1C28_HUMAN	N	87	ENSP00000305263:K87N	ENSP00000305263:K87N	K	-	3	2	KRT28	36209411	0.978000	0.34361	1.000000	0.80357	0.976000	0.68499	2.511000	0.45476	1.467000	0.48044	-0.145000	0.13849	AAG	KRT28	-	pfam_F	ENSG00000173908		0.502	KRT28-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRT28	HGNC	protein_coding	OTTHUMT00000257201.2	93	0.00	0	C	NM_181535		38955885	38955885	-1	no_errors	ENST00000306658	ensembl	human	known	69_37n	missense	79	26.17	28	SNP	1.000	A
LPP	4026	genome.wustl.edu	37	3	188327441	188327441	+	Missense_Mutation	SNP	G	G	C			TCGA-A1-A0SH-01A-11D-A099-09	TCGA-A1-A0SH-10A-03D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	473d6ae4-162a-4136-b44f-fad42529a31a	7df4bbf4-7ac5-4fd3-b0b9-ca6e49674cfd	g.chr3:188327441G>C	ENST00000312675.4	+	6	1168	c.922G>C	c.(922-924)Ggg>Cgg	p.G308R	LPP_ENST00000543006.1_Missense_Mutation_p.G308R|LPP_ENST00000471917.1_3'UTR|LPP_ENST00000448637.1_Missense_Mutation_p.G308R	NM_001167672.1|NM_005578.3	NP_001161144.1|NP_005569.1	Q93052	LPP_HUMAN	LIM domain containing preferred translocation partner in lipoma	308	Pro-rich.				cell adhesion (GO:0007155)	cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	zinc ion binding (GO:0008270)	p.G308R(1)	HMGA2/LPP(161)	NS(1)|breast(1)|large_intestine(3)|lung(2)|ovary(1)|upper_aerodigestive_tract(2)	10	all_cancers(143;1.37e-09)|all_hematologic(3;0.0429)|Ovarian(172;0.088)	all_lung(153;0.00139)|Lung NSC(153;0.00202)		GBM - Glioblastoma multiforme(93;0.00602)		GCCAGGCTATGGGGGCAGAAA	0.557			T	"""HMGA2, MLL, C12orf9"""	"""lipoma, leukemia"""																																	dbGAP		Dom	yes		3	3q28	4026	LIM domain containing preferred translocation partner in lipoma		"""L, M"""	1	Substitution - Missense(1)	breast(1)											68.0	62.0	64.0					3																	188327441		2203	4300	6503	-	-	-	SO:0001583	missense	0			AL833171	CCDS3291.1	3q27-q28	2004-03-02	2002-01-14		ENSG00000145012	ENSG00000145012			6679	protein-coding gene	gene with protein product		600700	"""LIM domain-containing preferred translocation partner in lipoma"""			8812423	Standard	XM_005247453		Approved		uc003frs.2	Q93052	OTTHUMG00000156387	ENST00000312675.4:c.922G>C	3.37:g.188327441G>C	ENSP00000318089:p.Gly308Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	A1L4L6|D3DNV6|Q8NFX5	Missense_Mutation	SNP	pfam_Znf_LIM,smart_Znf_LIM,pfscan_Znf_LIM	p.G308R	ENST00000312675.4	37	c.922	CCDS3291.1	3	.	.	.	.	.	.	.	.	.	.	G	21.5	4.158004	0.78114	.	.	ENSG00000145012	ENST00000448637;ENST00000312675;ENST00000543006;ENST00000415906	T;T;T;T	0.58797	1.55;0.31;0.31;1.12	5.71	5.71	0.89125	.	0.460966	0.23760	N	0.044823	T	0.72755	0.3500	M	0.65498	2.005	0.58432	D	0.999999	D;D	0.76494	0.999;0.996	D;P	0.78314	0.991;0.818	T	0.65442	-0.6167	10	0.10377	T	0.69	.	18.8558	0.92251	0.0:0.0:1.0:0.0	.	308;308	C9JUT4;Q93052	.;LPP_HUMAN	R	308;308;308;145	ENSP00000393602:G308R;ENSP00000318089:G308R;ENSP00000438891:G308R;ENSP00000393008:G145R	ENSP00000318089:G308R	G	+	1	0	LPP	189810135	1.000000	0.71417	1.000000	0.80357	0.900000	0.52787	6.777000	0.75028	2.709000	0.92574	0.655000	0.94253	GGG	LPP	-	NULL	ENSG00000145012		0.557	LPP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LPP	HGNC	protein_coding	OTTHUMT00000344030.1	49	0.00	0	G	NM_005578		188327441	188327441	+1	no_errors	ENST00000312675	ensembl	human	known	69_37n	missense	78	11.36	10	SNP	1.000	C
LRRC8A	56262	genome.wustl.edu	37	9	131671269	131671269	+	Missense_Mutation	SNP	C	C	G			TCGA-A1-A0SH-01A-11D-A099-09	TCGA-A1-A0SH-10A-03D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	473d6ae4-162a-4136-b44f-fad42529a31a	7df4bbf4-7ac5-4fd3-b0b9-ca6e49674cfd	g.chr9:131671269C>G	ENST00000259324.5	+	3	2349	c.1826C>G	c.(1825-1827)tCc>tGc	p.S609C	LRRC8A_ENST00000372599.3_Missense_Mutation_p.S609C|LRRC8A_ENST00000372600.4_Missense_Mutation_p.S609C	NM_001127244.1	NP_001120716.1	Q8IWT6	LRC8A_HUMAN	leucine rich repeat containing 8 family, member A	609					anion transport (GO:0006820)|cell volume homeostasis (GO:0006884)|pre-B cell differentiation (GO:0002329)|response to osmotic stress (GO:0006970)	cell surface (GO:0009986)|ion channel complex (GO:0034702)|membrane (GO:0016020)|plasma membrane (GO:0005886)		p.S609C(1)		breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(9)|lung(8)|ovary(1)|pancreas(1)|skin(3)	28						ATCCCCCACTCCATCTTCAGC	0.567																																						dbGAP											1	Substitution - Missense(1)	breast(1)											148.0	116.0	127.0					9																	131671269		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB037858	CCDS35155.1	9q34.2	2014-09-17	2005-06-29	2005-06-29	ENSG00000136802	ENSG00000136802			19027	protein-coding gene	gene with protein product		608360	"""leucine rich repeat containing 8"""	LRRC8			Standard	NM_001127244		Approved	KIAA1437, FLJ10337	uc010myp.3	Q8IWT6	OTTHUMG00000020766	ENST00000259324.5:c.1826C>G	9.37:g.131671269C>G	ENSP00000259324:p.Ser609Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6UXM2|Q8NCI0|Q9P2B1	Missense_Mutation	SNP	pfam_LRR_protein-8_N,pfam_Leu-rich_rpt,smart_Leu-rich_rpt_typical-subtyp	p.S609C	ENST00000259324.5	37	c.1826	CCDS35155.1	9	.	.	.	.	.	.	.	.	.	.	C	17.04	3.287448	0.59976	.	.	ENSG00000136802	ENST00000372600;ENST00000372599;ENST00000259324	T;T;T	0.59502	0.26;0.26;0.26	5.34	5.34	0.76211	.	0.000000	0.85682	D	0.000000	T	0.74665	0.3746	M	0.64404	1.975	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.76825	-0.2816	10	0.72032	D	0.01	.	18.0463	0.89334	0.0:1.0:0.0:0.0	.	609	Q8IWT6	LRC8A_HUMAN	C	609	ENSP00000361682:S609C;ENSP00000361680:S609C;ENSP00000259324:S609C	ENSP00000259324:S609C	S	+	2	0	LRRC8A	130711090	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.818000	0.86416	2.494000	0.84150	0.561000	0.74099	TCC	LRRC8A	-	smart_Leu-rich_rpt_typical-subtyp	ENSG00000136802		0.567	LRRC8A-201	KNOWN	basic|appris_principal|CCDS	protein_coding	LRRC8A	HGNC	protein_coding	OTTHUMT00000054516.2	45	0.00	0	C	NM_019594		131671269	131671269	+1	no_errors	ENST00000259324	ensembl	human	known	69_37n	missense	60	22.08	17	SNP	1.000	G
MARCH7	64844	genome.wustl.edu	37	2	160585678	160585678	+	Missense_Mutation	SNP	G	G	C			TCGA-A1-A0SH-01A-11D-A099-09	TCGA-A1-A0SH-10A-03D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	473d6ae4-162a-4136-b44f-fad42529a31a	7df4bbf4-7ac5-4fd3-b0b9-ca6e49674cfd	g.chr2:160585678G>C	ENST00000259050.4	+	2	267	c.145G>C	c.(145-147)Gaa>Caa	p.E49Q	MARCH7_ENST00000539065.1_Missense_Mutation_p.E49Q|MARCH7_ENST00000473749.1_3'UTR|MARCH7_ENST00000409175.1_Missense_Mutation_p.E49Q	NM_001282805.1|NM_001282807.1|NM_022826.2	NP_001269734.1|NP_001269736.1|NP_073737.1	Q9H992	MARH7_HUMAN	membrane-associated ring finger (C3HC4) 7, E3 ubiquitin protein ligase	49	Ser-rich.				protein ubiquitination (GO:0016567)		ligase activity (GO:0016874)|zinc ion binding (GO:0008270)	p.E49Q(1)		breast(1)|endometrium(2)|kidney(3)|large_intestine(5)|lung(3)|prostate(1)|skin(1)|stomach(2)	18						ATTGGATTCTGAATATCAGGT	0.368																																						dbGAP											1	Substitution - Missense(1)	breast(1)											53.0	55.0	55.0					2																	160585678		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK022973	CCDS2210.1, CCDS63038.1, CCDS63039.1	2q24.2	2013-01-09	2012-02-23	2005-01-27	ENSG00000136536	ENSG00000136536		"""MARCH membrane-associated ring fingers"", ""RING-type (C3HC4) zinc fingers"""	17393	protein-coding gene	gene with protein product		613334	"""axotrophin"", ""membrane-associated ring finger (C3HC4) 7"""	AXOT		14722266	Standard	XM_005246773		Approved	MARCH-VII, RNF177	uc002uax.3	Q9H992	OTTHUMG00000132029	ENST00000259050.4:c.145G>C	2.37:g.160585678G>C	ENSP00000259050:p.Glu49Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K9X1|B7Z7P5|D3DPB0|Q53GQ1|Q9BTR9	Missense_Mutation	SNP	pfam_Znf_C3HC4_RING-type,smart_Znf_RING-CH	p.E49Q	ENST00000259050.4	37	c.145	CCDS2210.1	2	.	.	.	.	.	.	.	.	.	.	G	13.75	2.329788	0.41297	.	.	ENSG00000136536	ENST00000409175;ENST00000539065;ENST00000259050;ENST00000421037	T;T;T;T	0.49432	2.67;2.55;2.67;0.78	5.9	5.9	0.94986	.	0.469877	0.24016	N	0.042336	T	0.51991	0.1707	L	0.51422	1.61	0.31465	N	0.669049	P;B	0.40476	0.718;0.181	P;B	0.44359	0.447;0.134	T	0.59516	-0.7440	10	0.52906	T	0.07	-0.0808	18.0481	0.89338	0.0:0.0:1.0:0.0	.	49;49	F5H6W4;Q9H992	.;MARH7_HUMAN	Q	49	ENSP00000386830:E49Q;ENSP00000442992:E49Q;ENSP00000259050:E49Q;ENSP00000392862:E49Q	ENSP00000259050:E49Q	E	+	1	0	MARCH7	160293924	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	5.924000	0.70054	2.800000	0.96347	0.455000	0.32223	GAA	MARCH7	-	NULL	ENSG00000136536		0.368	MARCH7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MARCH7	HGNC	protein_coding	OTTHUMT00000255040.3	79	0.00	0	G	NM_022826		160585678	160585678	+1	no_errors	ENST00000259050	ensembl	human	known	69_37n	missense	54	32.10	26	SNP	1.000	C
MED13L	23389	genome.wustl.edu	37	12	116408458	116408458	+	Missense_Mutation	SNP	G	G	A			TCGA-A1-A0SH-01A-11D-A099-09	TCGA-A1-A0SH-10A-03D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	473d6ae4-162a-4136-b44f-fad42529a31a	7df4bbf4-7ac5-4fd3-b0b9-ca6e49674cfd	g.chr12:116408458G>A	ENST00000281928.3	-	27	6214	c.6008C>T	c.(6007-6009)tCa>tTa	p.S2003L		NM_015335.4	NP_056150.1	Q71F56	MD13L_HUMAN	mediator complex subunit 13-like	2003						mediator complex (GO:0016592)	RNA polymerase II transcription cofactor activity (GO:0001104)	p.S2003L(1)		NS(2)|breast(1)|endometrium(9)|kidney(3)|large_intestine(18)|lung(34)|ovary(4)|prostate(4)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	85	all_neural(191;0.117)|Medulloblastoma(191;0.163)			BRCA - Breast invasive adenocarcinoma(302;0.0407)		CTGGATGGTTGATGATGTTGG	0.483																																						dbGAP											1	Substitution - Missense(1)	breast(1)											197.0	161.0	173.0					12																	116408458		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB028948	CCDS9177.1	12q24.22	2010-07-29	2007-07-30	2007-07-30	ENSG00000123066	ENSG00000123066			22962	protein-coding gene	gene with protein product		608771	"""thyroid hormone receptor associated protein 2"""	THRAP2			Standard	NM_015335		Approved	KIAA1025, TRAP240L	uc001tvw.3	Q71F56	OTTHUMG00000169404	ENST00000281928.3:c.6008C>T	12.37:g.116408458G>A	ENSP00000281928:p.Ser2003Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	A1L469|Q68DN4|Q9H8C0|Q9NSY9|Q9UFD8|Q9UPX5	Missense_Mutation	SNP	pfam_Mediator_Med13,pfam_Mediator_Med13_N_met/fun	p.S2003L	ENST00000281928.3	37	c.6008	CCDS9177.1	12	.	.	.	.	.	.	.	.	.	.	G	35	5.597126	0.96602	.	.	ENSG00000123066	ENST00000281928	D	0.82893	-1.66	5.55	5.55	0.83447	.	0.060804	0.64402	D	0.000005	T	0.73528	0.3598	N	0.08118	0	0.54753	D	0.999982	B	0.28128	0.201	B	0.31946	0.138	T	0.73078	-0.4096	10	0.87932	D	0	.	19.6941	0.96016	0.0:0.0:1.0:0.0	.	2003	Q71F56	MD13L_HUMAN	L	2003	ENSP00000281928:S2003L	ENSP00000281928:S2003L	S	-	2	0	MED13L	114892841	1.000000	0.71417	0.984000	0.44739	0.997000	0.91878	9.263000	0.95617	2.885000	0.99019	0.655000	0.94253	TCA	MED13L	-	pfam_Mediator_Med13	ENSG00000123066		0.483	MED13L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MED13L	HGNC	protein_coding	OTTHUMT00000403879.3	140	0.00	0	G			116408458	116408458	-1	no_errors	ENST00000281928	ensembl	human	known	69_37n	missense	125	16.56	25	SNP	1.000	A
METTL15	196074	genome.wustl.edu	37	11	28135038	28135038	+	Missense_Mutation	SNP	C	C	G	rs546057534		TCGA-A1-A0SH-01A-11D-A099-09	TCGA-A1-A0SH-10A-03D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	473d6ae4-162a-4136-b44f-fad42529a31a	7df4bbf4-7ac5-4fd3-b0b9-ca6e49674cfd	g.chr11:28135038C>G	ENST00000407364.3	+	3	509	c.157C>G	c.(157-159)Caa>Gaa	p.Q53E	METTL15_ENST00000379199.2_Missense_Mutation_p.Q53E|METTL15_ENST00000303459.6_Missense_Mutation_p.Q53E|METTL15_ENST00000342303.5_Missense_Mutation_p.Q53E|METTL15_ENST00000406787.3_Missense_Mutation_p.Q53E|METTL15_ENST00000403099.1_Missense_Mutation_p.Q53E			A6NJ78	MET15_HUMAN	methyltransferase like 15	53							methyltransferase activity (GO:0008168)	p.Q53E(2)		NS(1)|breast(1)|endometrium(4)|large_intestine(2)|lung(2)|ovary(2)|skin(1)|urinary_tract(1)	14						AGATCAAACTCAAGCCCAGGA	0.388													C|||	1	0.000199681	0.0	0.0014	5008	,	,		14062	0.0		0.0	False		,,,				2504	0.0					dbGAP											2	Substitution - Missense(2)	breast(2)											57.0	64.0	61.0					11																	28135038		2202	4299	6501	-	-	-	SO:0001583	missense	0			AL832668	CCDS31450.1, CCDS44559.1, CCDS73269.1	11p14.1	2011-03-02	2011-03-02	2011-03-02	ENSG00000169519	ENSG00000169519			26606	protein-coding gene	gene with protein product			"""methyltransferase 5 domain containing 1"""	METT5D1		12477932	Standard	NM_152636		Approved	FLJ33979	uc001msh.2	A6NJ78	OTTHUMG00000150448	ENST00000407364.3:c.157C>G	11.37:g.28135038C>G	ENSP00000384369:p.Gln53Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	A8MRS5|B7WNU2|Q3MHD3|Q8N601|Q8NBA7	Missense_Mutation	SNP	pfam_SAM-dep_MeTrfase_MraW,superfamily_SAM-dep_MeTrfase_MraW_recog,tigrfam_SAM-dep_MeTrfase_MraW	p.Q53E	ENST00000407364.3	37	c.157	CCDS44559.1	11	.	.	.	.	.	.	.	.	.	.	C	0.005	-2.177403	0.00312	.	.	ENSG00000169519	ENST00000406787;ENST00000342303;ENST00000403099;ENST00000407364;ENST00000379199;ENST00000303459	T;T;T;T;T;T	0.41065	1.6;1.62;1.01;2.04;1.01;1.62	5.68	1.7	0.24286	.	0.857111	0.10391	N	0.680392	T	0.17704	0.0425	N	0.08118	0	0.09310	N	1	B;B;B	0.09022	0.0;0.0;0.002	B;B;B	0.06405	0.0;0.001;0.002	T	0.28776	-1.0033	10	0.02654	T	1	.	6.6472	0.22941	0.2331:0.1381:0.6287:0.0	.	53;53;53	A6NJ78;A6NJ78-2;A6NJ78-4	MET15_HUMAN;.;.	E	53	ENSP00000385507:Q53E;ENSP00000342259:Q53E;ENSP00000385860:Q53E;ENSP00000384369:Q53E;ENSP00000368497:Q53E;ENSP00000307251:Q53E	ENSP00000307251:Q53E	Q	+	1	0	METTL15	28091614	0.624000	0.27102	0.000000	0.03702	0.116000	0.19942	2.850000	0.48294	0.434000	0.26340	-0.340000	0.08031	CAA	METTL15	-	NULL	ENSG00000169519		0.388	METTL15-003	NOVEL	basic|appris_principal|CCDS	protein_coding	METTL15	HGNC	protein_coding	OTTHUMT00000318135.2	162	0.00	0	C	NM_152636		28135038	28135038	+1	no_errors	ENST00000303459	ensembl	human	known	69_37n	missense	107	20.15	27	SNP	0.000	G
MICAL1	64780	genome.wustl.edu	37	6	109770913	109770913	+	Missense_Mutation	SNP	C	C	G			TCGA-A1-A0SH-01A-11D-A099-09	TCGA-A1-A0SH-10A-03D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	473d6ae4-162a-4136-b44f-fad42529a31a	7df4bbf4-7ac5-4fd3-b0b9-ca6e49674cfd	g.chr6:109770913C>G	ENST00000358807.3	-	10	1692	c.1381G>C	c.(1381-1383)Gac>Cac	p.D461H	MICAL1_ENST00000358577.3_Missense_Mutation_p.D375H|MICAL1_ENST00000368952.4_Missense_Mutation_p.D480H|MICAL1_ENST00000483856.1_5'Flank	NM_022765.3	NP_073602.3	Q8TDZ2	MICA1_HUMAN	microtubule associated monooxygenase, calponin and LIM domain containing 1	461	Monooxygenase domain. {ECO:0000250}.				actin filament depolymerization (GO:0030042)|cytoskeleton organization (GO:0007010)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of protein phosphorylation (GO:0001933)|oxidation-reduction process (GO:0055114)|signal transduction (GO:0007165)|sulfur oxidation (GO:0019417)	cytoplasm (GO:0005737)|intermediate filament (GO:0005882)	actin binding (GO:0003779)|FAD binding (GO:0071949)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, NAD(P)H as one donor, and incorporation of one atom of oxygen (GO:0016709)|SH3 domain binding (GO:0017124)|zinc ion binding (GO:0008270)	p.D461H(1)		NS(1)|breast(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(6)|liver(1)|lung(7)|ovary(3)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	40		all_cancers(87;0.000189)|Acute lymphoblastic leukemia(125;3.07e-08)|all_hematologic(75;3.33e-06)|all_epithelial(87;0.00686)|Lung SC(18;0.0743)|Colorectal(196;0.101)|all_lung(197;0.149)		Epithelial(106;0.0142)|all cancers(137;0.0197)|OV - Ovarian serous cystadenocarcinoma(136;0.0233)|BRCA - Breast invasive adenocarcinoma(108;0.0574)		GTGGCTGGGTCCAGCCCATAC	0.622																																						dbGAP											1	Substitution - Missense(1)	breast(1)											104.0	96.0	98.0					6																	109770913		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB048948	CCDS5076.1, CCDS55047.1	6q21	2013-03-26	2013-03-26	2005-02-16	ENSG00000135596	ENSG00000135596			20619	protein-coding gene	gene with protein product		607129	"""NEDD9 interacting protein with calponin homology and LIM domains"""	NICAL		11827972	Standard	NM_022765		Approved	MICAL, FLJ11937, DKFZp434B1517, FLJ21739	uc003ptk.3	Q8TDZ2	OTTHUMG00000015350	ENST00000358807.3:c.1381G>C	6.37:g.109770913C>G	ENSP00000351664:p.Asp461His	Somatic		WXS	Illumina GAIIx	Phase_IV	B7Z3R5|E1P5F0|Q7Z633|Q8IVS9|Q96G47|Q9H6X6|Q9H7I0|Q9HAA1|Q9UFF7	Missense_Mutation	SNP	pfam_DUF3585,pfam_CH-domain,pfam_Znf_LIM,pfam_mOase_FAD-bd,superfamily_CH-domain,smart_CH-domain,smart_Znf_LIM,pfscan_CH-domain,pfscan_Znf_LIM	p.D480H	ENST00000358807.3	37	c.1438	CCDS5076.1	6	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	21.6|21.6	4.177835|4.177835	0.78564|0.78564	.|.	.|.	ENSG00000135596|ENSG00000135596	ENST00000358807;ENST00000368952;ENST00000358577|ENST00000433205	T;T;T|.	0.65549|.	-0.16;-0.16;-0.16|.	5.1|5.1	4.22|4.22	0.49857|0.49857	Calponin homology domain (1);|.	0.204155|.	0.39274|.	N|.	0.001415|.	T|T	0.66147|0.66147	0.2760|0.2760	M|M	0.84082|0.84082	2.675|2.675	0.45261|0.45261	D|D	0.99826|0.99826	D;D;D|.	0.89917|.	0.986;1.0;1.0|.	P;D;D|.	0.91635|.	0.876;0.999;0.998|.	T|T	0.69946|0.69946	-0.5007|-0.5007	10|5	0.72032|.	D|.	0.01|.	.|.	10.1565|10.1565	0.42825|0.42825	0.0:0.9051:0.0:0.0949|0.0:0.9051:0.0:0.0949	.|.	480;375;461|.	B7Z3R5;Q8TDZ2-2;Q8TDZ2|.	.;.;MICA1_HUMAN|.	H|A	461;480;375|25	ENSP00000351664:D461H;ENSP00000357948:D480H;ENSP00000351385:D375H|.	ENSP00000351385:D375H|.	D|G	-|-	1|2	0|0	MICAL1|MICAL1	109877606|109877606	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.996000|0.996000	0.88848|0.88848	3.879000|3.879000	0.56138|0.56138	1.252000|1.252000	0.44001|0.44001	0.655000|0.655000	0.94253|0.94253	GAC|GGA	MICAL1	-	superfamily_CH-domain	ENSG00000135596		0.622	MICAL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MICAL1	HGNC	protein_coding	OTTHUMT00000041759.2	72	0.00	0	C	NM_022765		109770913	109770913	-1	no_errors	ENST00000368952	ensembl	human	known	69_37n	missense	69	23.33	21	SNP	1.000	G
MTM1	4534	genome.wustl.edu	37	X	149828220	149828220	+	Missense_Mutation	SNP	G	G	C			TCGA-A1-A0SH-01A-11D-A099-09	TCGA-A1-A0SH-10A-03D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	473d6ae4-162a-4136-b44f-fad42529a31a	7df4bbf4-7ac5-4fd3-b0b9-ca6e49674cfd	g.chrX:149828220G>C	ENST00000370396.2	+	12	1398	c.1344G>C	c.(1342-1344)atG>atC	p.M448I	MTM1_ENST00000542741.1_Missense_Mutation_p.M353I|MTM1_ENST00000306167.7_3'UTR|MTM1_ENST00000543350.1_Missense_Mutation_p.M333I|MTM1_ENST00000413012.2_Missense_Mutation_p.M411I	NM_000252.2	NP_000243.1	Q13496	MTM1_HUMAN	myotubularin 1	448	Myotubularin phosphatase. {ECO:0000255|PROSITE-ProRule:PRU00669}.				endosome to lysosome transport (GO:0008333)|intermediate filament organization (GO:0045109)|mitochondrion distribution (GO:0048311)|mitochondrion morphogenesis (GO:0070584)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol dephosphorylation (GO:0046856)|phospholipid metabolic process (GO:0006644)|protein dephosphorylation (GO:0006470)|protein transport (GO:0015031)|regulation of vacuole organization (GO:0044088)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|late endosome (GO:0005770)|plasma membrane (GO:0005886)|ruffle (GO:0001726)	intermediate filament binding (GO:0019215)|phosphatidylinositol binding (GO:0035091)|phosphatidylinositol-3,5-bisphosphate 3-phosphatase activity (GO:0052629)|phosphatidylinositol-3-phosphatase activity (GO:0004438)|phosphoprotein phosphatase activity (GO:0004721)|protein tyrosine phosphatase activity (GO:0004725)	p.M448I(1)		breast(2)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(4)|liver(1)|lung(10)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	26	Acute lymphoblastic leukemia(192;6.56e-05)					TGTGGCAAATGTCAAAACAGG	0.328																																						dbGAP											1	Substitution - Missense(1)	breast(1)											154.0	128.0	137.0					X																	149828220		2203	4300	6503	-	-	-	SO:0001583	missense	0			U46024	CCDS14694.1	Xq27.3-q28	2014-09-17			ENSG00000171100	ENSG00000171100		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Myotubularins"""	7448	protein-coding gene	gene with protein product		300415	"""myotubular myopathy 1"""				Standard	NM_000252		Approved		uc004fef.4	Q13496	OTTHUMG00000024158	ENST00000370396.2:c.1344G>C	X.37:g.149828220G>C	ENSP00000359423:p.Met448Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NDB1|B7Z491|F2Z330|Q8NEL1	Missense_Mutation	SNP	pfam_Myotub-related,pfam_GRAM,smart_GRAM,smart_Tyr_Pase_cat,pfscan_Tyr/Dual-specificity_Pase	p.M448I	ENST00000370396.2	37	c.1344	CCDS14694.1	X	.	.	.	.	.	.	.	.	.	.	G	8.855	0.945452	0.18356	.	.	ENSG00000171100	ENST00000370396;ENST00000542741;ENST00000543350;ENST00000413012	D;D;D;D	0.87887	-2.31;-2.31;-2.31;-2.31	5.3	5.3	0.74995	Myotubularin phosphatase domain (1);	0.074271	0.85682	D	0.000000	T	0.75250	0.3824	N	0.04880	-0.145	0.48341	D	0.999634	B;B	0.09022	0.001;0.002	B;B	0.11329	0.006;0.004	T	0.69862	-0.5030	10	0.16896	T	0.51	.	18.0978	0.89496	0.0:0.0:1.0:0.0	.	411;448	B7Z491;Q13496	.;MTM1_HUMAN	I	448;353;333;411	ENSP00000359423:M448I;ENSP00000444015:M353I;ENSP00000439784:M333I;ENSP00000389157:M411I	ENSP00000359423:M448I	M	+	3	0	MTM1	149578878	1.000000	0.71417	0.999000	0.59377	0.877000	0.50540	3.971000	0.56831	2.210000	0.71456	0.544000	0.68410	ATG	MTM1	-	smart_Tyr_Pase_cat	ENSG00000171100		0.328	MTM1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	MTM1	HGNC	protein_coding	OTTHUMT00000060847.3	371	0.26	1	G	NM_000252		149828220	149828220	+1	no_errors	ENST00000370396	ensembl	human	known	69_37n	missense	334	18.34	75	SNP	1.000	C
MUC12	10071	genome.wustl.edu	37	7	100646022	100646022	+	Missense_Mutation	SNP	C	C	A			TCGA-A1-A0SH-01A-11D-A099-09	TCGA-A1-A0SH-10A-03D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	473d6ae4-162a-4136-b44f-fad42529a31a	7df4bbf4-7ac5-4fd3-b0b9-ca6e49674cfd	g.chr7:100646022C>A	ENST00000379442.3	+	5	12607	c.12607C>A	c.(12607-12609)Cac>Aac	p.H4203N	MUC12_ENST00000536621.1_Missense_Mutation_p.H4060N			Q9UKN1	MUC12_HUMAN	mucin 12, cell surface associated	4203	28 X 19 AA approximate tandem repeats of E-E-S-X-X-X-H-X-X-P-X-X-T-X-T-X-X-X-P.|Ser-rich.				cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|regulation of cell growth (GO:0001558)	Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)		p.H4060N(1)		breast(6)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|prostate(1)|stomach(13)	25						TGGCTCGCTACACACAACACT	0.567																																						dbGAP											1	Substitution - Missense(1)	breast(1)											30.0	29.0	29.0					7																	100646022		675	1548	2223	-	-	-	SO:0001583	missense	0			AF147790, AF147791	CCDS55139.1	7q22	2007-01-17	2006-03-14		ENSG00000205277	ENSG00000205277		"""Mucins"""	7510	protein-coding gene	gene with protein product		604609	"""mucin 11"""	MUC11		10463611	Standard	NM_001164462		Approved		uc003uxo.3	Q9UKN1	OTTHUMG00000157042	ENST00000379442.3:c.12607C>A	7.37:g.100646022C>A	ENSP00000368755:p.His4203Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	A6ND38|F5GWV9|Q9UKN0	Missense_Mutation	SNP	pfam_SEA	p.H4203N	ENST00000379442.3	37	c.12607		7	.	.	.	.	.	.	.	.	.	.	-	1.773	-0.483955	0.04383	.	.	ENSG00000205277	ENST00000379442;ENST00000536621	T;T	0.12039	2.72;2.72	0.668	0.668	0.17912	.	.	.	.	.	T	0.06050	0.0157	N	0.08118	0	0.09310	N	1	.	.	.	.	.	.	T	0.44034	-0.9354	7	0.17832	T	0.49	.	7.1354	0.25525	0.0:0.9999:0.0:1.0E-4	.	.	.	.	N	4203;4060	ENSP00000368755:H4203N;ENSP00000441929:H4060N	ENSP00000368755:H4203N	H	+	1	0	MUC12	100432742	0.006000	0.16342	0.002000	0.10522	0.008000	0.06430	0.251000	0.18257	0.628000	0.30357	0.195000	0.17529	CAC	MUC12	-	NULL	ENSG00000205277		0.567	MUC12-001	NOVEL	basic|appris_candidate_longest	protein_coding	MUC12	HGNC	protein_coding	OTTHUMT00000347234.1	329	0.30	1	C	XM_379904		100646022	100646022	+1	no_errors	ENST00000379442	ensembl	human	known	69_37n	missense	311	12.64	45	SNP	0.007	A
MUC21	394263	genome.wustl.edu	37	6	30954351	30954351	+	Missense_Mutation	SNP	C	C	A			TCGA-A1-A0SH-01A-11D-A099-09	TCGA-A1-A0SH-10A-03D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	473d6ae4-162a-4136-b44f-fad42529a31a	7df4bbf4-7ac5-4fd3-b0b9-ca6e49674cfd	g.chr6:30954351C>A	ENST00000376296.3	+	2	640	c.399C>A	c.(397-399)agC>agA	p.S133R	MUC21_ENST00000486149.2_5'UTR	NM_001010909.2	NP_001010909.2	Q5SSG8	MUC21_HUMAN	mucin 21, cell surface associated	133	28 X 15 AA approximate tandem repeats.|Ser-rich.				cellular protein metabolic process (GO:0044267)|negative regulation of cell-cell adhesion (GO:0022408)|negative regulation of cell-substrate adhesion (GO:0010812)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.S133R(1)		NS(4)|breast(1)|central_nervous_system(2)|endometrium(1)|kidney(1)|large_intestine(7)|lung(11)|ovary(3)|prostate(4)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	42						GTGGGGCCAGCACAGCCACCA	0.612																																						dbGAP											1	Substitution - Missense(1)	breast(1)											165.0	154.0	158.0					6																	30954351		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK056612	CCDS34388.1	6p21.33	2008-05-14	2008-05-14	2008-05-14	ENSG00000204544	ENSG00000204544		"""Mucins"""	21661	protein-coding gene	gene with protein product	"""epiglycanin"""		"""chromosome 6 open reading frame 205"""	C6orf205		17977904	Standard	NM_001010909		Approved	bCX31G15.2	uc003nsh.2	Q5SSG8	OTTHUMG00000031216	ENST00000376296.3:c.399C>A	6.37:g.30954351C>A	ENSP00000365473:p.Ser133Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	B0UZT7|B4DQ55|C9JMK2|D9N007|Q0VGF1|Q3B7T2|Q5SS94|Q6UXC5	Missense_Mutation	SNP	NULL	p.S133R	ENST00000376296.3	37	c.399	CCDS34388.1	6	.	.	.	.	.	.	.	.	.	.	C	13.15	2.150589	0.37923	.	.	ENSG00000204544	ENST00000450707;ENST00000376296	T	0.02890	4.12	3.56	1.65	0.23941	.	.	.	.	.	T	0.01387	0.0045	L	0.27053	0.805	0.20489	N	0.999898	P	0.51351	0.944	P	0.53722	0.733	T	0.50056	-0.8872	8	.	.	.	-0.1118	5.0392	0.14451	0.0:0.5268:0.0:0.4731	.	133	Q5SSG8	MUC21_HUMAN	R	133	ENSP00000365473:S133R	.	S	+	3	2	MUC21	31062330	0.000000	0.05858	0.002000	0.10522	0.191000	0.23601	-1.082000	0.03400	0.267000	0.21916	0.485000	0.47835	AGC	MUC21	-	NULL	ENSG00000204544		0.612	MUC21-001	KNOWN	basic|CCDS	protein_coding	MUC21	HGNC	protein_coding	OTTHUMT00000128579.3	141	0.00	0	C	NM_001010909		30954351	30954351	+1	no_errors	ENST00000376296	ensembl	human	known	69_37n	missense	101	22.90	30	SNP	0.628	A
NOS3	4846	genome.wustl.edu	37	7	150706129	150706129	+	Missense_Mutation	SNP	G	G	C			TCGA-A1-A0SH-01A-11D-A099-09	TCGA-A1-A0SH-10A-03D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	473d6ae4-162a-4136-b44f-fad42529a31a	7df4bbf4-7ac5-4fd3-b0b9-ca6e49674cfd	g.chr7:150706129G>C	ENST00000297494.3	+	18	2581	c.2224G>C	c.(2224-2226)Gag>Cag	p.E742Q	NOS3_ENST00000461406.1_Missense_Mutation_p.E536Q	NM_000603.4	NP_000594.2	P60323	NANO3_HUMAN	nitric oxide synthase 3 (endothelial cell)	0					germ cell development (GO:0007281)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic signaling pathway (GO:2001234)|oogenesis (GO:0048477)|regulation of cell cycle (GO:0051726)|regulation of translation (GO:0006417)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|cytoplasmic mRNA processing body (GO:0000932)|cytoplasmic stress granule (GO:0010494)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	RNA binding (GO:0003723)|zinc ion binding (GO:0008270)	p.E742Q(1)		NS(3)|breast(3)|central_nervous_system(5)|endometrium(1)|kidney(4)|large_intestine(6)|liver(2)|lung(11)|ovary(3)|prostate(3)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	50	all_neural(206;0.219)		OV - Ovarian serous cystadenocarcinoma(82;0.0121)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)		CGCCCAGGCCGAGGGCCTGCA	0.682											OREG0018442	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP											1	Substitution - Missense(1)	breast(1)											18.0	22.0	21.0					7																	150706129		2203	4297	6500	-	-	-	SO:0001583	missense	0				CCDS5912.1, CCDS55182.1, CCDS55183.1	7q36	2007-02-15			ENSG00000164867	ENSG00000164867	1.14.13.39		7876	protein-coding gene	gene with protein product	"""endothelial nitric oxide synthase"""	163729				1379542	Standard	NM_000603		Approved	ECNOS, eNOS	uc003wif.3	P29474	OTTHUMG00000158343	ENST00000297494.3:c.2224G>C	7.37:g.150706129G>C	ENSP00000297494:p.Glu742Gln	Somatic	1734	WXS	Illumina GAIIx	Phase_IV	Q495E5	Missense_Mutation	SNP	pfam_NO_synthase_oxygenase_dom,pfam_FAD-binding_1,pfam_Flavodoxin/NO_synth,pfam_OxRdtase_FAD/NAD-bd,superfamily_NO_synthase_oxygenase_dom,superfamily_Riboflavin_synthase-like_b-brl,pirsf_NOS_met,pfscan_Flavodoxin/NO_synth,prints_Flavoprot_Pyr_Nucl_cyt_Rdtase,prints_Flavdoxin	p.E742Q	ENST00000297494.3	37	c.2224	CCDS5912.1	7	.	.	.	.	.	.	.	.	.	.	G	13.84	2.358322	0.41801	.	.	ENSG00000164867	ENST00000297494;ENST00000484576;ENST00000461406	T;T	0.33216	1.42;1.42	5.03	3.1	0.35709	Riboflavin synthase-like beta-barrel (1);	0.519812	0.17489	N	0.172416	T	0.15176	0.0366	N	0.13098	0.295	0.80722	D	1	B;B	0.13145	0.002;0.007	B;B	0.15052	0.011;0.012	T	0.08249	-1.0731	10	0.19590	T	0.45	-20.6715	5.9374	0.19173	0.1099:0.374:0.5161:0.0	.	536;742	E7ESA7;P29474	.;NOS3_HUMAN	Q	742;61;536	ENSP00000297494:E742Q;ENSP00000417143:E536Q	ENSP00000297494:E742Q	E	+	1	0	NOS3	150337062	0.779000	0.28652	0.938000	0.37757	0.988000	0.76386	1.007000	0.29860	0.602000	0.29896	0.555000	0.69702	GAG	NOS3	-	superfamily_Riboflavin_synthase-like_b-brl,pirsf_NOS_met	ENSG00000164867		0.682	NOS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NOS3	HGNC	protein_coding	OTTHUMT00000350750.2	22	0.00	0	G	NM_000603		150706129	150706129	+1	no_errors	ENST00000297494	ensembl	human	known	69_37n	missense	20	22.22	6	SNP	0.887	C
NUAK2	81788	genome.wustl.edu	37	1	205272579	205272579	+	Silent	SNP	C	C	T			TCGA-A1-A0SH-01A-11D-A099-09	TCGA-A1-A0SH-10A-03D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	473d6ae4-162a-4136-b44f-fad42529a31a	7df4bbf4-7ac5-4fd3-b0b9-ca6e49674cfd	g.chr1:205272579C>T	ENST00000367157.3	-	7	2012	c.1886G>A	c.(1885-1887)tGa>tAa	p.*629*		NM_030952.1	NP_112214.1			NUAK family, SNF1-like kinase, 2									p.*629*(2)		breast(3)|kidney(3)|large_intestine(4)|lung(4)|ovary(3)|prostate(3)|skin(1)|stomach(1)|urinary_tract(1)	23	Breast(84;0.186)		BRCA - Breast invasive adenocarcinoma(75;0.117)			CTACTCCACTCAGGTGAGCTT	0.627																																						dbGAP											2	Substitution - coding silent(2)	breast(2)											57.0	51.0	53.0					1																	205272579		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK074830	CCDS1453.1	1q32.1	2008-02-05			ENSG00000163545	ENSG00000163545			29558	protein-coding gene	gene with protein product	"""SNF1/AMP activated protein kinase"""	608131				11230166	Standard	NM_030952		Approved	SNARK, FLJ90349	uc001hce.3	Q9H093	OTTHUMG00000037196	ENST00000367157.3:c.1886G>A	1.37:g.205272579C>T		Somatic		WXS	Illumina GAIIx	Phase_IV		Silent	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_LipoPS_kinase,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.*629	ENST00000367157.3	37	c.1886	CCDS1453.1	1																																																																																			NUAK2	-	NULL	ENSG00000163545		0.627	NUAK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NUAK2	HGNC	protein_coding	OTTHUMT00000090390.1	41	0.00	0	C	NM_030952		205272579	205272579	-1	no_errors	ENST00000367157	ensembl	human	known	69_37n	silent	81	12.77	12	SNP	1.000	T
JADE1	79960	genome.wustl.edu	37	4	129792615	129792615	+	Missense_Mutation	SNP	C	C	G			TCGA-A1-A0SH-01A-11D-A099-09	TCGA-A1-A0SH-10A-03D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	473d6ae4-162a-4136-b44f-fad42529a31a	7df4bbf4-7ac5-4fd3-b0b9-ca6e49674cfd	g.chr4:129792615C>G	ENST00000226319.6	+	11	2007	c.1727C>G	c.(1726-1728)tCt>tGt	p.S576C	PHF17_ENST00000512960.1_Missense_Mutation_p.S576C|PHF17_ENST00000452328.2_Missense_Mutation_p.S564C	NM_199320.2	NP_955352.1												p.S576C(1)		NS(1)|breast(2)|endometrium(1)|kidney(2)|large_intestine(10)|lung(10)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	29						AAGTGGCATTCTGCATTCTTC	0.463																																						dbGAP											1	Substitution - Missense(1)	breast(1)											150.0	146.0	147.0					4																	129792615		2203	4300	6503	-	-	-	SO:0001583	missense	0																														ENST00000226319.6:c.1727C>G	4.37:g.129792615C>G	ENSP00000226319:p.Ser576Cys	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Enhancer_polycomb-like_N,pfam_Znf_PHD-finger,superfamily_Znf_FYVE_PHD,smart_Znf_PHD,pfscan_Znf_PHD-finger	p.S576C	ENST00000226319.6	37	c.1727	CCDS34062.1	4	.	.	.	.	.	.	.	.	.	.	C	18.39	3.612530	0.66672	.	.	ENSG00000077684	ENST00000226319;ENST00000452328;ENST00000512960;ENST00000535321	T;T;T	0.48201	0.82;0.83;0.82	4.49	4.49	0.54785	.	0.597839	0.18899	N	0.128094	T	0.43188	0.1236	L	0.29908	0.895	0.80722	D	1	D;B	0.55800	0.973;0.0	P;B	0.46339	0.513;0.001	T	0.31530	-0.9940	9	.	.	.	.	17.7588	0.88457	0.0:1.0:0.0:0.0	.	564;576	Q6IE81-2;Q6IE81	.;JADE1_HUMAN	C	576;564;576;576	ENSP00000226319:S576C;ENSP00000388015:S564C;ENSP00000425730:S576C	.	S	+	2	0	PHF17	130012065	1.000000	0.71417	0.998000	0.56505	0.961000	0.63080	4.863000	0.62983	2.483000	0.83821	0.655000	0.94253	TCT	PHF17	-	NULL	ENSG00000077684		0.463	PHF17-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PHF17	HGNC	protein_coding	OTTHUMT00000364280.1	195	0.00	0	C			129792615	129792615	+1	no_errors	ENST00000226319	ensembl	human	known	69_37n	missense	171	21.20	46	SNP	1.000	G
PLCE1	51196	genome.wustl.edu	37	10	96022290	96022323	+	Frame_Shift_Del	DEL	TTAAGAGTAAACAGCAGCTATCGGACAACCAGAG	TTAAGAGTAAACAGCAGCTATCGGACAACCAGAG	-	rs201423664|rs200409656		TCGA-A1-A0SH-01A-11D-A099-09	TCGA-A1-A0SH-10A-03D-A099-09	TTAAGAGTAAACAGCAGCTATCGGACAACCAGAG	TTAAGAGTAAACAGCAGCTATCGGACAACCAGAG					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	473d6ae4-162a-4136-b44f-fad42529a31a	7df4bbf4-7ac5-4fd3-b0b9-ca6e49674cfd	g.chr10:96022290_96022323delTTAAGAGTAAACAGCAGCTATCGGACAACCAGAG	ENST00000371380.3	+	13	4089_4122	c.3854_3887delTTAAGAGTAAACAGCAGCTATCGGACAACCAGAG	c.(3853-3888)attaagagtaaacagcagctatcggacaaccagaggfs	p.IKSKQQLSDNQR1285fs	PLCE1_ENST00000260766.3_Frame_Shift_Del_p.IKSKQQLSDNQR1285fs|PLCE1_ENST00000371385.3_Frame_Shift_Del_p.IKSKQQLSDNQR977fs|PLCE1_ENST00000371375.1_Frame_Shift_Del_p.IKSKQQLSDNQR977fs			Q9P212	PLCE1_HUMAN	phospholipase C, epsilon 1	1285					activation of MAPK activity (GO:0000187)|calcium-mediated signaling (GO:0019722)|cell proliferation (GO:0008283)|cytoskeleton organization (GO:0007010)|diacylglycerol biosynthetic process (GO:0006651)|epidermal growth factor receptor signaling pathway (GO:0007173)|glomerulus development (GO:0032835)|heart development (GO:0007507)|inositol phosphate metabolic process (GO:0043647)|inositol phosphate-mediated signaling (GO:0048016)|lipid catabolic process (GO:0016042)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|phospholipid metabolic process (GO:0006644)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of GTPase activity (GO:0043547)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|Ras protein signal transduction (GO:0007265)|regulation of cell growth (GO:0001558)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|regulation of protein kinase activity (GO:0045859)|regulation of Ras protein signal transduction (GO:0046578)|regulation of smooth muscle contraction (GO:0006940)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|enzyme binding (GO:0019899)|guanyl-nucleotide exchange factor activity (GO:0005085)|phosphatidylinositol phospholipase C activity (GO:0004435)|phospholipase C activity (GO:0004629)|Ras GTPase binding (GO:0017016)|receptor signaling protein activity (GO:0005057)	p.I1285fs*13(1)|p.I977fs*13(1)		liver(1)|ovary(2)|skin(4)|upper_aerodigestive_tract(1)	8		Colorectal(252;0.0458)				GGGTTGTTCATTAAGAGTAAACAGCAGCTATCGGACAACCAGAGGCAGATATCT	0.453																																						dbGAP											2	Deletion - Frameshift(2)	breast(2)																																								-	-	-	SO:0001589	frameshift_variant	0				CCDS41552.1, CCDS53555.1	10q23	2010-02-22			ENSG00000138193	ENSG00000138193	3.1.4.11		17175	protein-coding gene	gene with protein product	"""nephrosis type 3"""	608414				11022047, 11022048	Standard	NM_016341		Approved	KIAA1516, PLCE, NPHS3	uc001kjk.3	Q9P212	OTTHUMG00000018789	ENST00000371380.3:c.3854_3887delTTAAGAGTAAACAGCAGCTATCGGACAACCAGAG	10.37:g.96022290_96022323delTTAAGAGTAAACAGCAGCTATCGGACAACCAGAG	ENSP00000360431:p.Ile1285fs	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NGW0|A6NLA1|A7MBN7|A8K1D7|B9EIJ6|Q1X6H8|Q5VWL4|Q5VWL5|Q9H9X8|Q9HBX6|Q9HC53|Q9UHV3	Frame_Shift_Del	DEL	pfam_PLipase_C_PInositol-sp_X_dom,pfam_PLipase_C_Pinositol-sp_Y,pfam_Ras-assoc,pfam_RasGRF_CDC25,pfam_PLipase_C_EF-hand-like,pfam_C2_Ca-dep,superfamily_PLC-like_Pdiesterase_TIM-brl,superfamily_Ras_GEF_dom,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_RasGRF_CDC25,smart_PLipase_C_PInositol-sp_X_dom,smart_PLipase_C_Pinositol-sp_Y,smart_C2_Ca-dep,smart_Ras-assoc,pfscan_C2_membr_targeting,pfscan_Ras-assoc,pfscan_PLipase_C_PInositol-sp_X_dom,pfscan_PLipase_C_Pinositol-sp_Y,pfscan_RasGRF_CDC25,prints_Pinositol_PLipase_C	p.I1285fs	ENST00000371380.3	37	c.3854_3887	CCDS41552.1	10																																																																																			PLCE1	-	NULL	ENSG00000138193		0.453	PLCE1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PLCE1	HGNC	protein_coding	OTTHUMT00000049469.3	136	0.00	0	TTAAGAGTAAACAGCAGCTATCGGACAACCAGAG	NM_016341		96022290	96022323	+1	no_errors	ENST00000371380	ensembl	human	known	69_37n	frame_shift_del	137	10.32	16	DEL	1.000:1.000:1.000:1.000:0.994:1.000:1.000:1.000:1.000:1.000:0.992:1.000:1.000:1.000:1.000:1.000:1.000:1.000:0.999:0.621:0.998:0.999:0.292:1.000:1.000:1.000:1.000:1.000:1.000:1.000:1.000:1.000:1.000:1.000	-
PPARA	5465	genome.wustl.edu	37	22	46631235	46631237	+	In_Frame_Del	DEL	GCT	GCT	-			TCGA-A1-A0SH-01A-11D-A099-09	TCGA-A1-A0SH-10A-03D-A099-09	GCT	GCT					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	473d6ae4-162a-4136-b44f-fad42529a31a	7df4bbf4-7ac5-4fd3-b0b9-ca6e49674cfd	g.chr22:46631235_46631237delGCT	ENST00000396000.2	+	8	1630_1632	c.1365_1367delGCT	c.(1363-1368)gcgctg>gcg	p.L456del	PPARA_ENST00000402126.1_In_Frame_Del_p.L456del|PPARA_ENST00000262735.5_In_Frame_Del_p.L456del|PPARA_ENST00000407236.1_In_Frame_Del_p.L456del|PPARA_ENST00000434345.2_3'UTR			Q07869	PPARA_HUMAN	peroxisome proliferator-activated receptor alpha	456	Ligand-binding.				behavioral response to nicotine (GO:0035095)|cellular lipid metabolic process (GO:0044255)|circadian regulation of gene expression (GO:0032922)|enamel mineralization (GO:0070166)|epidermis development (GO:0008544)|fatty acid metabolic process (GO:0006631)|fatty acid transport (GO:0015908)|gene expression (GO:0010467)|heart development (GO:0007507)|intracellular receptor signaling pathway (GO:0030522)|lipid metabolic process (GO:0006629)|lipoprotein metabolic process (GO:0042157)|negative regulation of appetite (GO:0032099)|negative regulation of blood pressure (GO:0045776)|negative regulation of cholesterol storage (GO:0010887)|negative regulation of glycolytic process (GO:0045820)|negative regulation of macrophage derived foam cell differentiation (GO:0010745)|negative regulation of neuron death (GO:1901215)|negative regulation of protein binding (GO:0032091)|negative regulation of receptor biosynthetic process (GO:0010871)|negative regulation of sequestering of triglyceride (GO:0010891)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription regulatory region DNA binding (GO:2000678)|positive regulation of fatty acid beta-oxidation (GO:0032000)|positive regulation of fatty acid oxidation (GO:0046321)|positive regulation of gluconeogenesis (GO:0045722)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cellular ketone metabolic process by positive regulation of transcription from RNA polymerase II promoter (GO:0072366)|regulation of circadian rhythm (GO:0042752)|regulation of glycolytic by positive regulation of transcription from RNA polymerase II promoter (GO:0072363)|regulation of lipid transport by positive regulation of transcription from RNA polymerase II promoter (GO:0072369)|response to hypoxia (GO:0001666)|response to insulin (GO:0032868)|small molecule metabolic process (GO:0044281)|transcription initiation from RNA polymerase II promoter (GO:0006367)|wound healing (GO:0042060)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|drug binding (GO:0008144)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|lipid binding (GO:0008289)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II repressing transcription factor binding (GO:0001103)|RNA polymerase II transcription factor binding transcription factor activity involved in positive regulation of transcription (GO:0001190)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|steroid hormone receptor activity (GO:0003707)|ubiquitin conjugating enzyme binding (GO:0031624)|zinc ion binding (GO:0008270)	p.L456delL(1)		breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(5)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	15		Ovarian(80;0.00965)|all_neural(38;0.0416)		UCEC - Uterine corpus endometrioid carcinoma (28;0.00522)	Bezafibrate(DB01393)|Clofibrate(DB00636)|Fenofibrate(DB01039)|Gemfibrozil(DB01241)|Indomethacin(DB00328)	CGGATGCTGCGCTGCACCCGCTA	0.527																																						dbGAP											1	Deletion - In frame(1)	breast(1)																																								-	-	-	SO:0001651	inframe_deletion	0			L02932	CCDS33669.1	22q12-q13.1	2013-01-16	2006-10-17		ENSG00000186951	ENSG00000186951		"""Nuclear hormone receptors"""	9232	protein-coding gene	gene with protein product		170998	"""peroxisome proliferative activated receptor, alpha"""	PPAR		7684926, 10591208	Standard	XM_005261655		Approved	hPPAR, NR1C1	uc003bgx.1	Q07869	OTTHUMG00000150443	ENST00000396000.2:c.1365_1367delGCT	22.37:g.46631235_46631237delGCT	ENSP00000379322:p.Leu456del	Somatic		WXS	Illumina GAIIx	Phase_IV	B0G0X3|Q16241|Q6I9S0|Q92486|Q92689|Q9Y3N1	In_Frame_Del	DEL	pfam_Znf_hrmn_rcpt,pfam_Nucl_hrmn_rcpt_lig-bd_core,superfamily_Nucl_hormone_rcpt_ligand-bd,smart_Znf_hrmn_rcpt,smart_Nucl_hrmn_rcpt_lig-bd_core,pfscan_Znf_hrmn_rcpt,prints_1Cnucl_rcpt_A,prints_1Cnucl_rcpt,prints_Str_hrmn_rcpt,prints_Znf_hrmn_rcpt	p.L456in_frame_del	ENST00000396000.2	37	c.1365_1367	CCDS33669.1	22																																																																																			PPARA	-	pfam_Nucl_hrmn_rcpt_lig-bd_core,superfamily_Nucl_hormone_rcpt_ligand-bd,prints_1Cnucl_rcpt	ENSG00000186951		0.527	PPARA-202	KNOWN	basic|appris_principal|CCDS	protein_coding	PPARA	HGNC	protein_coding	OTTHUMT00000318129.3	40	0.00	0	GCT	NM_001001928		46631235	46631237	+1	no_errors	ENST00000262735	ensembl	human	known	69_37n	in_frame_del	39	21.57	11	DEL	0.064:0.961:1.000	-
PREX1	57580	genome.wustl.edu	37	20	47258785	47258785	+	Missense_Mutation	SNP	G	G	C			TCGA-A1-A0SH-01A-11D-A099-09	TCGA-A1-A0SH-10A-03D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	473d6ae4-162a-4136-b44f-fad42529a31a	7df4bbf4-7ac5-4fd3-b0b9-ca6e49674cfd	g.chr20:47258785G>C	ENST00000371941.3	-	29	3718	c.3696C>G	c.(3694-3696)atC>atG	p.I1232M	PREX1_ENST00000496915.1_5'UTR|PREX1_ENST00000396220.1_Missense_Mutation_p.I1232M	NM_020820.3	NP_065871	Q8TCU6	PREX1_HUMAN	phosphatidylinositol-3,4,5-trisphosphate-dependent Rac exchange factor 1	1232					actin filament polymerization (GO:0030041)|G-protein coupled receptor signaling pathway (GO:0007186)|intracellular signal transduction (GO:0035556)|neutrophil activation (GO:0042119)|neutrophil chemotaxis (GO:0030593)|positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)|regulation of actin filament polymerization (GO:0030833)|regulation of dendrite development (GO:0050773)|superoxide metabolic process (GO:0006801)|T cell differentiation (GO:0030217)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|growth cone (GO:0030426)|intracellular membrane-bounded organelle (GO:0043231)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	enzyme binding (GO:0019899)|phospholipid binding (GO:0005543)|Rho GTPase activator activity (GO:0005100)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.I1232M(2)		breast(3)|central_nervous_system(1)|endometrium(4)|kidney(6)|large_intestine(27)|lung(53)|ovary(3)|pancreas(1)|prostate(1)|skin(2)|stomach(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	110			BRCA - Breast invasive adenocarcinoma(12;0.0135)|Colorectal(8;0.198)			GGAGAGCATTGATGGAGTCCA	0.597																																						dbGAP											2	Substitution - Missense(2)	breast(2)											71.0	70.0	71.0					20																	47258785		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB037836	CCDS13410.1	20q13.13	2013-01-10	2008-09-15		ENSG00000124126	ENSG00000124126		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	32594	protein-coding gene	gene with protein product		606905				11955434, 15545267, 16301320	Standard	NM_020820		Approved	KIAA1415, P-REX1	uc002xtw.1	Q8TCU6	OTTHUMG00000032685	ENST00000371941.3:c.3696C>G	20.37:g.47258785G>C	ENSP00000361009:p.Ile1232Met	Somatic		WXS	Illumina GAIIx	Phase_IV	E1P5X9|Q5JS95|Q5JS96|Q69YL2|Q7Z2L9|Q9BQH0|Q9BX55|Q9H4Q6|Q9P2D2|Q9UGQ4	Nonsense_Mutation	SNP	superfamily_PDZ	p.S554*	ENST00000371941.3	37	c.1661	CCDS13410.1	20	.	.	.	.	.	.	.	.	.	.	g	15.47	2.843795	0.51164	.	.	ENSG00000124126	ENST00000371941;ENST00000396220	T;T	0.46451	0.87;0.87	5.4	4.45	0.53987	.	0.000000	0.56097	U	0.000040	T	0.59998	0.2235	M	0.70275	2.135	0.51767	D	0.999939	D;D	0.89917	1.0;0.999	D;D	0.74348	0.968;0.983	T	0.62969	-0.6741	10	0.87932	D	0	.	9.6559	0.39925	0.2177:0.0:0.7823:0.0	.	1232;529	Q8TCU6;Q8TCU6-2	PREX1_HUMAN;.	M	1232	ENSP00000361009:I1232M;ENSP00000379522:I1232M	ENSP00000361009:I1232M	I	-	3	3	PREX1	46692192	1.000000	0.71417	0.948000	0.38648	0.493000	0.33554	3.932000	0.56537	1.292000	0.44672	0.639000	0.83563	ATC	PREX1	-	NULL	ENSG00000124126		0.597	PREX1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PREX1	HGNC	protein_coding	OTTHUMT00000079623.1	73	0.00	0	G	NM_020820		47258785	47258785	-1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000482556	ensembl	human	known	69_37n	nonsense	91	14.81	16	SNP	1.000	C
PZP	5858	genome.wustl.edu	37	12	9317862	9317862	+	Missense_Mutation	SNP	G	G	T			TCGA-A1-A0SH-01A-11D-A099-09	TCGA-A1-A0SH-10A-03D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	473d6ae4-162a-4136-b44f-fad42529a31a	7df4bbf4-7ac5-4fd3-b0b9-ca6e49674cfd	g.chr12:9317862G>T	ENST00000261336.2	-	19	2388	c.2360C>A	c.(2359-2361)tCt>tAt	p.S787Y	PZP_ENST00000539983.1_5'UTR|PZP_ENST00000381997.2_Missense_Mutation_p.S656Y	NM_002864.2	NP_002855.2	P20742	PZP_HUMAN	pregnancy-zone protein	787					female pregnancy (GO:0007565)|negative regulation of endopeptidase activity (GO:0010951)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	endopeptidase inhibitor activity (GO:0004866)|serine-type endopeptidase inhibitor activity (GO:0004867)	p.S656Y(1)|p.S787Y(1)		breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(21)|lung(46)|ovary(3)|prostate(2)|skin(6)|stomach(3)|upper_aerodigestive_tract(5)	102						GGCAGTGGAAGAGATACCAAG	0.557																																					Melanoma(125;1402 1695 4685 34487 38571)	dbGAP											2	Substitution - Missense(2)	breast(2)											96.0	87.0	90.0					12																	9317862		2203	4299	6502	-	-	-	SO:0001583	missense	0			X54380, M24416, X51541	CCDS8600.1	12p13-p12.2	2008-02-01			ENSG00000126838	ENSG00000126838			9750	protein-coding gene	gene with protein product		176420					Standard	NM_002864		Approved	CPAMD6	uc001qvl.3	P20742	OTTHUMG00000154915	ENST00000261336.2:c.2360C>A	12.37:g.9317862G>T	ENSP00000261336:p.Ser787Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV	A6ND27|Q15273|Q2NKL2|Q7M4N7	Missense_Mutation	SNP	pfam_A2M_comp,pfam_A2M_N_2,pfam_Macroglobln_a2,pfam_A-macroglobulin_rcpt-bd,pfam_A2M_N,pfam_MacrogloblnA2_thiol-ester-bond,pfam_SV_autoAg,superfamily_Terpenoid_cyclase/PrenylTrfase,superfamily_A-macroglobulin_rcpt-bd	p.S787Y	ENST00000261336.2	37	c.2360	CCDS8600.1	12	.	.	.	.	.	.	.	.	.	.	G	17.15	3.315656	0.60524	.	.	ENSG00000126838	ENST00000261336;ENST00000381997	T;T	0.27402	1.67;1.67	3.48	3.48	0.39840	Alpha-2-macroglobulin (1);	0.108654	0.40222	U	0.001143	T	0.64929	0.2643	M	0.93854	3.465	0.34786	D	0.735224	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.999;0.999	T	0.82563	-0.0395	10	0.87932	D	0	.	15.4315	0.75102	0.0:0.0:1.0:0.0	.	787;656;787	B2R950;P20742-2;P20742	.;.;PZP_HUMAN	Y	787;656	ENSP00000261336:S787Y;ENSP00000371427:S656Y	ENSP00000261336:S787Y	S	-	2	0	PZP	9209129	1.000000	0.71417	0.059000	0.19551	0.631000	0.37964	5.043000	0.64208	1.898000	0.54952	0.467000	0.42956	TCT	PZP	-	pfam_Macroglobln_a2	ENSG00000126838		0.557	PZP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PZP	HGNC	protein_coding	OTTHUMT00000337624.1	118	0.82	1	G	NM_002864		9317862	9317862	-1	no_errors	ENST00000261336	ensembl	human	known	69_37n	missense	121	15.97	23	SNP	0.999	T
RHCG	51458	genome.wustl.edu	37	15	90016021	90016021	+	Nonsense_Mutation	SNP	G	G	T	rs562119923	byFrequency	TCGA-A1-A0SH-01A-11D-A099-09	TCGA-A1-A0SH-10A-03D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	473d6ae4-162a-4136-b44f-fad42529a31a	7df4bbf4-7ac5-4fd3-b0b9-ca6e49674cfd	g.chr15:90016021G>T	ENST00000268122.4	-	10	1453	c.1385C>A	c.(1384-1386)tCa>tAa	p.S462*	RHCG_ENST00000544600.1_Intron	NM_016321.1	NP_057405.1	Q9UBD6	RHCG_HUMAN	Rh family, C glycoprotein	462					amine transport (GO:0015837)|ammonium transmembrane transport (GO:0072488)|ammonium transport (GO:0015696)|cellular ion homeostasis (GO:0006873)|epithelial cell differentiation (GO:0030855)|homeostatic process (GO:0042592)|regulation of pH (GO:0006885)|transepithelial ammonium transport (GO:0070634)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|cytoplasmic vesicle (GO:0031410)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	ammonium transmembrane transporter activity (GO:0008519)|ankyrin binding (GO:0030506)	p.S462*(1)		breast(1)|endometrium(2)|kidney(2)|large_intestine(5)|lung(9)|upper_aerodigestive_tract(1)|urinary_tract(1)	21	Lung NSC(78;0.0237)|all_lung(78;0.0478)					CATgggtactgagggtactga	0.592																																						dbGAP											1	Substitution - Nonsense(1)	breast(1)											133.0	93.0	107.0					15																	90016021		2197	4293	6490	-	-	-	SO:0001587	stop_gained	0			AF081497	CCDS10351.1	15q25	2013-05-22	2006-02-23		ENSG00000140519	ENSG00000140519		"""Solute carriers"""	18140	protein-coding gene	gene with protein product		605381	"""chromosome 15 open reading frame 6"", ""Rhesus blood group, C glycoprotein"""	C15orf6		10852913	Standard	NM_016321		Approved	RHGK, PDRC2, SLC42A3	uc002bnz.2	Q9UBD6	OTTHUMG00000149647	ENST00000268122.4:c.1385C>A	15.37:g.90016021G>T	ENSP00000268122:p.Ser462*	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K4D4|Q6X3Y4	Nonsense_Mutation	SNP	pfam_NH4_transpt_AmtB-like,superfamily_NH4_transpt_AmtB-like,prints_RhesusRHD	p.S462*	ENST00000268122.4	37	c.1385	CCDS10351.1	15	.	.	.	.	.	.	.	.	.	.	G	15.05	2.718609	0.48622	.	.	ENSG00000140519	ENST00000268122;ENST00000536247	.	.	.	2.13	0.174	0.15040	.	6.473340	0.00166	N	0.000006	.	.	.	.	.	.	0.09310	N	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	4.4935	0.11826	0.3294:0.0:0.6706:0.0	.	.	.	.	X	462;453	.	.	S	-	2	0	RHCG	87817025	0.001000	0.12720	0.000000	0.03702	0.002000	0.02628	0.678000	0.25277	0.046000	0.15833	0.655000	0.94253	TCA	RHCG	-	NULL	ENSG00000140519		0.592	RHCG-001	KNOWN	basic|CCDS	protein_coding	RHCG	HGNC	protein_coding	OTTHUMT00000312855.2	169	0.00	0	G	NM_016321		90016021	90016021	-1	no_errors	ENST00000268122	ensembl	human	known	69_37n	nonsense	176	18.89	41	SNP	0.000	T
RYR2	6262	genome.wustl.edu	37	1	237868586	237868586	+	Missense_Mutation	SNP	C	C	G			TCGA-A1-A0SH-01A-11D-A099-09	TCGA-A1-A0SH-10A-03D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	473d6ae4-162a-4136-b44f-fad42529a31a	7df4bbf4-7ac5-4fd3-b0b9-ca6e49674cfd	g.chr1:237868586C>G	ENST00000366574.2	+	67	9840	c.9523C>G	c.(9523-9525)Ctg>Gtg	p.L3175V	RYR2_ENST00000609119.1_3'UTR|RYR2_ENST00000360064.6_Missense_Mutation_p.L3173V|RYR2_ENST00000542537.1_Missense_Mutation_p.L3159V	NM_001035.2	NP_001026.2	Q92736	RYR2_HUMAN	ryanodine receptor 2 (cardiac)	3175					BMP signaling pathway (GO:0030509)|calcium ion transport (GO:0006816)|calcium ion transport into cytosol (GO:0060402)|calcium-mediated signaling (GO:0019722)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle contraction (GO:0060048)|cardiac muscle hypertrophy (GO:0003300)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular calcium ion homeostasis (GO:0006874)|cellular response to caffeine (GO:0071313)|cellular response to epinephrine stimulus (GO:0071872)|cytosolic calcium ion homeostasis (GO:0051480)|detection of calcium ion (GO:0005513)|embryonic heart tube morphogenesis (GO:0003143)|establishment of protein localization to endoplasmic reticulum (GO:0072599)|ion transmembrane transport (GO:0034220)|left ventricular cardiac muscle tissue morphogenesis (GO:0003220)|positive regulation of calcium-transporting ATPase activity (GO:1901896)|positive regulation of heart rate (GO:0010460)|positive regulation of ryanodine-sensitive calcium-release channel activity by adrenergic receptor signaling pathway involved in positive regulation of cardiac muscle contraction (GO:0086094)|positive regulation of sequestering of calcium ion (GO:0051284)|Purkinje myocyte to ventricular cardiac muscle cell signaling (GO:0086029)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|response to redox state (GO:0051775)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|transmembrane transport (GO:0055085)|type B pancreatic cell apoptotic process (GO:0097050)|ventricular cardiac muscle cell action potential (GO:0086005)	calcium channel complex (GO:0034704)|extracellular vesicular exosome (GO:0070062)|junctional sarcoplasmic reticulum membrane (GO:0014701)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|Z disc (GO:0030018)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|intracellular ligand-gated calcium channel activity (GO:0005218)|ion channel binding (GO:0044325)|protein kinase A catalytic subunit binding (GO:0034236)|protein kinase A regulatory subunit binding (GO:0034237)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|suramin binding (GO:0043924)	p.L3173V(1)		NS(4)|breast(8)|central_nervous_system(11)|cervix(2)|endometrium(39)|haematopoietic_and_lymphoid_tissue(5)|kidney(17)|large_intestine(83)|liver(4)|lung(353)|ovary(18)|pancreas(5)|prostate(12)|skin(8)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(4)	586	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			GGAAACTCATCTGGACAAACA	0.383																																						dbGAP											1	Substitution - Missense(1)	breast(1)											113.0	104.0	107.0					1																	237868586		1882	4126	6008	-	-	-	SO:0001583	missense	0			X91869	CCDS55691.1	1q43	2014-09-17			ENSG00000198626	ENSG00000198626		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10484	protein-coding gene	gene with protein product		180902	"""arrhythmogenic right ventricular dysplasia 2"""	ARVD2		2380170, 8406504, 11159936	Standard	NM_001035		Approved	ARVC2, VTSIP	uc001hyl.1	Q92736	OTTHUMG00000039543	ENST00000366574.2:c.9523C>G	1.37:g.237868586C>G	ENSP00000355533:p.Leu3175Val	Somatic		WXS	Illumina GAIIx	Phase_IV	Q15411|Q546N8|Q5T3P2	Missense_Mutation	SNP	pfam_Ca-rel_channel,pfam_Ryanodine_rcpt,pfam_Ryanrecept_TM4-6,pfam_SPRY_rcpt,pfam_Ins145_P3_rcpt,pfam_MIR,pfam_RIH_assoc-dom,pfam_Ion_trans_dom,superfamily_MIR,superfamily_ConA-like_lec_gl,smart_MIR_motif,smart_SPla/RYanodine_receptor_subgr,prints_Ryan_recept,pfscan_B30.2/SPRY,pfscan_EF_HAND_2,pfscan_MIR_motif	p.L3173V	ENST00000366574.2	37	c.9517	CCDS55691.1	1	.	.	.	.	.	.	.	.	.	.	C	13.98	2.399903	0.42613	.	.	ENSG00000198626	ENST00000366574;ENST00000360064;ENST00000542537;ENST00000542288;ENST00000540213	T;T;T	0.28666	1.6;1.6;1.6	4.51	4.51	0.55191	.	0.155915	0.29699	U	0.011437	T	0.33962	0.0881	M	0.87269	2.87	0.80722	D	1	P	0.39940	0.696	B	0.32022	0.139	T	0.44742	-0.9308	10	0.87932	D	0	.	8.5292	0.33324	0.0:0.8166:0.0:0.1834	.	3175	Q92736	RYR2_HUMAN	V	3175;3173;3159;130;170	ENSP00000355533:L3175V;ENSP00000353174:L3173V;ENSP00000443798:L3159V	ENSP00000353174:L3173V	L	+	1	2	RYR2	235935209	0.481000	0.25941	0.991000	0.47740	0.991000	0.79684	1.047000	0.30367	2.233000	0.73108	0.650000	0.86243	CTG	RYR2	-	NULL	ENSG00000198626		0.383	RYR2-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	RYR2	HGNC	protein_coding	OTTHUMT00000095402.2	173	0.00	0	C	NM_001035		237868586	237868586	+1	no_errors	ENST00000360064	ensembl	human	known	69_37n	missense	144	37.39	86	SNP	0.988	G
SCAPER	49855	genome.wustl.edu	37	15	77057342	77057342	+	Missense_Mutation	SNP	C	C	T			TCGA-A1-A0SH-01A-11D-A099-09	TCGA-A1-A0SH-10A-03D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	473d6ae4-162a-4136-b44f-fad42529a31a	7df4bbf4-7ac5-4fd3-b0b9-ca6e49674cfd	g.chr15:77057342C>T	ENST00000563290.1	-	14	1780	c.1685G>A	c.(1684-1686)cGc>cAc	p.R562H	SCAPER_ENST00000538941.2_Missense_Mutation_p.R316H|SCAPER_ENST00000324767.7_Missense_Mutation_p.R562H			Q9BY12	SCAPE_HUMAN	S-phase cyclin A-associated protein in the ER	562	Glu-rich.					endoplasmic reticulum (GO:0005783)|nucleus (GO:0005634)	metal ion binding (GO:0046872)	p.R562H(1)		NS(1)|breast(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(8)|lung(16)|ovary(2)|prostate(2)|skin(1)|urinary_tract(2)	39						TTTCTCTTCGCGTAACTTTTC	0.328																																						dbGAP											1	Substitution - Missense(1)	breast(1)											103.0	89.0	93.0					15																	77057342		1800	4059	5859	-	-	-	SO:0001583	missense	0			AB040887, AF242528	CCDS53961.1, CCDS53962.1	15q24.3	2012-10-05	2009-03-11	2007-08-20	ENSG00000140386	ENSG00000140386		"""Zinc fingers, C2H2-type"""	13081	protein-coding gene	gene with protein product		611611	"""zinc finger protein 291"""	ZNF291		17698606	Standard	NM_020843		Approved	Zfp291	uc002bby.3	Q9BY12	OTTHUMG00000172655	ENST00000563290.1:c.1685G>A	15.37:g.77057342C>T	ENSP00000454973:p.Arg562His	Somatic		WXS	Illumina GAIIx	Phase_IV	F5H7X8|H3BNR7|Q3B7X7|Q96BS9|Q9H3D8|Q9NT03|Q9P274	Missense_Mutation	SNP	smart_Znf_U1	p.R562H	ENST00000563290.1	37	c.1685	CCDS53962.1	15	.	.	.	.	.	.	.	.	.	.	C	25.1	4.606765	0.87157	.	.	ENSG00000140386	ENST00000324767;ENST00000538941;ENST00000303521	T;T	0.24538	1.86;1.85	5.76	5.76	0.90799	.	0.000000	0.85682	D	0.000000	T	0.26085	0.0636	N	0.25647	0.755	0.80722	D	1	P;D	0.55385	0.937;0.971	P;B	0.45506	0.483;0.378	T	0.00867	-1.1534	10	0.41790	T	0.15	.	19.9721	0.97287	0.0:1.0:0.0:0.0	.	583;316	Q9BY12-2;F5H7X8	.;.	H	562;316;584	ENSP00000326924:R562H;ENSP00000442190:R316H	ENSP00000303560:R584H	R	-	2	0	SCAPER	74844397	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	7.487000	0.81328	2.724000	0.93272	0.462000	0.41574	CGC	SCAPER	-	NULL	ENSG00000140386		0.328	SCAPER-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SCAPER	HGNC	protein_coding	OTTHUMT00000419698.1	216	0.00	0	C	NM_020843		77057342	77057342	-1	no_errors	ENST00000324767	ensembl	human	known	69_37n	missense	203	16.80	41	SNP	1.000	T
SLC17A4	10050	genome.wustl.edu	37	6	25776822	25776822	+	Splice_Site	SNP	G	G	C			TCGA-A1-A0SH-01A-11D-A099-09	TCGA-A1-A0SH-10A-03D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	473d6ae4-162a-4136-b44f-fad42529a31a	7df4bbf4-7ac5-4fd3-b0b9-ca6e49674cfd	g.chr6:25776822G>C	ENST00000377905.4	+	9	1106		c.e9-1		SLC17A4_ENST00000397076.2_Splice_Site|SLC17A4_ENST00000439485.2_Splice_Site	NM_005495.2	NP_005486.1	Q9Y2C5	S17A4_HUMAN	solute carrier family 17, member 4						phosphate ion transmembrane transport (GO:0035435)|phosphate-containing compound metabolic process (GO:0006796)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)	sodium:phosphate symporter activity (GO:0005436)	p.?(1)		breast(4)|endometrium(1)|kidney(4)|large_intestine(3)|lung(21)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	39						CTGGTCCTCAGAGTGGGATCC	0.493																																						dbGAP											1	Unknown(1)	breast(1)											263.0	249.0	254.0					6																	25776822		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			AB020527	CCDS4564.1, CCDS75411.1	6p22.2	2013-07-18	2013-07-18		ENSG00000146039	ENSG00000146039		"""Solute carriers"""	10932	protein-coding gene	gene with protein product		604216	"""solute carrier family 17 (sodium phosphate), member 4"""			10319585	Standard	NM_005495		Approved	KIAA2138	uc003nfe.3	Q9Y2C5	OTTHUMG00000014410	ENST00000377905.4:c.988-1G>C	6.37:g.25776822G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	B4DDV9|E7EPE8|E7EU17|Q32MB7|Q32MB8	Splice_Site	SNP	-	e8-1	ENST00000377905.4	37	c.988-1	CCDS4564.1	6	.	.	.	.	.	.	.	.	.	.	G	21.5	4.159670	0.78226	.	.	ENSG00000146039	ENST00000377905;ENST00000439485;ENST00000397076	.	.	.	5.48	5.48	0.80851	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.2347	0.73419	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	SLC17A4	25884801	1.000000	0.71417	1.000000	0.80357	0.931000	0.56810	4.866000	0.63005	2.756000	0.94617	0.655000	0.94253	.	SLC17A4	-	-	ENSG00000146039		0.493	SLC17A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC17A4	HGNC	protein_coding	OTTHUMT00000040068.1	174	0.00	0	G		Intron	25776822	25776822	+1	no_errors	ENST00000377905	ensembl	human	known	69_37n	splice_site	160	20.00	40	SNP	1.000	C
SLC19A3	80704	genome.wustl.edu	37	2	228563717	228563717	+	Silent	SNP	G	G	C			TCGA-A1-A0SH-01A-11D-A099-09	TCGA-A1-A0SH-10A-03D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	473d6ae4-162a-4136-b44f-fad42529a31a	7df4bbf4-7ac5-4fd3-b0b9-ca6e49674cfd	g.chr2:228563717G>C	ENST00000258403.3	-	3	785	c.714C>G	c.(712-714)ctC>ctG	p.L238L	SLC19A3_ENST00000541617.1_Silent_p.L234L|SLC19A3_ENST00000409287.1_Intron	NM_025243.3	NP_079519.1	Q9BZV2	S19A3_HUMAN	solute carrier family 19 (thiamine transporter), member 3	238					small molecule metabolic process (GO:0044281)|thiamine transmembrane transport (GO:0071934)|thiamine-containing compound metabolic process (GO:0042723)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	thiamine uptake transmembrane transporter activity (GO:0015403)	p.L238L(1)		breast(1)|cervix(1)|endometrium(6)|kidney(4)|large_intestine(5)|lung(8)|ovary(2)|skin(3)	30		Renal(207;0.0112)|all_lung(227;0.0335)|Lung NSC(271;0.142)|all_hematologic(139;0.21)|Esophageal squamous(248;0.236)		Epithelial(121;1.58e-10)|all cancers(144;8.55e-08)|Lung(261;0.00948)|LUSC - Lung squamous cell carcinoma(224;0.0125)	L-Cysteine(DB00151)	CTGAAGTGCTGAGTATTTCTG	0.458																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											142.0	125.0	131.0					2																	228563717		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF271633	CCDS2468.1	2q37	2013-07-18	2013-07-18		ENSG00000135917	ENSG00000135917		"""Solute carriers"""	16266	protein-coding gene	gene with protein product	"""thiamine transporter 2"""	606152	"""solute carrier family 19, member 3"""			11136550, 15871139	Standard	XM_005246871		Approved	THTR2	uc002vpi.3	Q9BZV2	OTTHUMG00000133185	ENST00000258403.3:c.714C>G	2.37:g.228563717G>C		Somatic		WXS	Illumina GAIIx	Phase_IV		Silent	SNP	pfam_Folate_carrier,pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pirsf_Folate_carrier,tigrfam_Folate_carrier	p.L238	ENST00000258403.3	37	c.714	CCDS2468.1	2																																																																																			SLC19A3	-	pfam_Folate_carrier,pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pirsf_Folate_carrier,tigrfam_Folate_carrier	ENSG00000135917		0.458	SLC19A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC19A3	HGNC	protein_coding	OTTHUMT00000256894.1	170	0.00	0	G			228563717	228563717	-1	no_errors	ENST00000258403	ensembl	human	known	69_37n	silent	140	22.22	40	SNP	0.000	C
SLC43A1	8501	genome.wustl.edu	37	11	57263602	57263602	+	Silent	SNP	G	G	A			TCGA-A1-A0SH-01A-11D-A099-09	TCGA-A1-A0SH-10A-03D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	473d6ae4-162a-4136-b44f-fad42529a31a	7df4bbf4-7ac5-4fd3-b0b9-ca6e49674cfd	g.chr11:57263602G>A	ENST00000278426.3	-	7	949	c.594C>T	c.(592-594)atC>atT	p.I198I	SLC43A1_ENST00000533515.1_5'UTR|SLC43A1_ENST00000528450.1_Silent_p.I198I	NM_003627.5	NP_003618.1			solute carrier family 43 (amino acid system L transporter), member 1									p.I198I(1)		breast(1)|endometrium(2)|large_intestine(5)|liver(1)|lung(6)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)	19						AGGTGAACATGATGACCACGA	0.597																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											91.0	73.0	79.0					11																	57263602		2201	4296	6497	-	-	-	SO:0001819	synonymous_variant	0			AF045584	CCDS7958.1	11q12.1	2013-07-17	2013-07-17	2003-09-12	ENSG00000149150	ENSG00000149150		"""Solute carriers"""	9225	protein-coding gene	gene with protein product		603733	"""prostate cancer overexpressed gene 1"""	POV1		9255310, 9722952	Standard	NM_003627		Approved	R00504, PB39	uc001nkk.3	O75387	OTTHUMG00000167030	ENST00000278426.3:c.594C>T	11.37:g.57263602G>A		Somatic		WXS	Illumina GAIIx	Phase_IV		Silent	SNP	pfam_MFS,superfamily_MFS_dom_general_subst_transpt	p.I198	ENST00000278426.3	37	c.594	CCDS7958.1	11																																																																																			SLC43A1	-	pfam_MFS,superfamily_MFS_dom_general_subst_transpt	ENSG00000149150		0.597	SLC43A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC43A1	HGNC	protein_coding	OTTHUMT00000392541.1	80	0.00	0	G	NM_003627		57263602	57263602	-1	no_errors	ENST00000278426	ensembl	human	known	69_37n	silent	63	17.11	13	SNP	1.000	A
SPTBN1	6711	genome.wustl.edu	37	2	54874337	54874337	+	Missense_Mutation	SNP	G	G	A			TCGA-A1-A0SH-01A-11D-A099-09	TCGA-A1-A0SH-10A-03D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	473d6ae4-162a-4136-b44f-fad42529a31a	7df4bbf4-7ac5-4fd3-b0b9-ca6e49674cfd	g.chr2:54874337G>A	ENST00000356805.4	+	24	5217	c.4936G>A	c.(4936-4938)Gag>Aag	p.E1646K	SPTBN1_ENST00000333896.5_Missense_Mutation_p.E1633K	NM_003128.2	NP_003119.2	Q01082	SPTB2_HUMAN	spectrin, beta, non-erythrocytic 1	1646	Interaction with ANK2.				actin filament capping (GO:0051693)|axon guidance (GO:0007411)|Golgi to plasma membrane protein transport (GO:0043001)|membrane assembly (GO:0071709)|mitotic cytokinesis (GO:0000281)|plasma membrane organization (GO:0007009)|protein targeting to plasma membrane (GO:0072661)	axolemma (GO:0030673)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleolus (GO:0005730)|protein complex (GO:0043234)|spectrin (GO:0008091)|spectrin-associated cytoskeleton (GO:0014731)	actin binding (GO:0003779)|ankyrin binding (GO:0030506)|phospholipid binding (GO:0005543)|poly(A) RNA binding (GO:0044822)|structural constituent of cytoskeleton (GO:0005200)	p.E1646K(1)|p.E1633K(1)		NS(1)|breast(8)|central_nervous_system(2)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(11)|lung(27)|ovary(4)|prostate(2)|skin(5)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	82			Lung(47;0.24)			GGACTATGCAGAGACCGTGCA	0.547																																						dbGAP											2	Substitution - Missense(2)	breast(2)											110.0	101.0	104.0					2																	54874337		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS33198.1, CCDS33199.1	2p21	2013-01-10			ENSG00000115306	ENSG00000115306		"""Pleckstrin homology (PH) domain containing"""	11275	protein-coding gene	gene with protein product		182790					Standard	NM_003128		Approved		uc002rxu.3	Q01082	OTTHUMG00000133746	ENST00000356805.4:c.4936G>A	2.37:g.54874337G>A	ENSP00000349259:p.Glu1646Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RP63|O60837|Q16057|Q53R99|Q59ER3|Q8IX99	Missense_Mutation	SNP	pirsf_Spectrin_bsu,pfam_Spectrin_repeat,pfam_CH-domain,pfam_Pleckstrin_homology,pfam_CAMSAP_CH,superfamily_CH-domain,smart_CH-domain,smart_Spectrin/alpha-actinin,smart_Pleckstrin_homology,prints_PH_dom-spectrin-type,pfscan_CH-domain,pfscan_Pleckstrin_homology	p.E1646K	ENST00000356805.4	37	c.4936	CCDS33198.1	2	.	.	.	.	.	.	.	.	.	.	G	23.6	4.441458	0.83993	.	.	ENSG00000115306	ENST00000356805;ENST00000333896	T;T	0.68765	-0.35;1.23	5.93	5.93	0.95920	.	0.100721	0.64402	D	0.000002	T	0.61388	0.2343	L	0.33293	1	0.58432	D	0.999999	B;B	0.14805	0.009;0.011	B;B	0.21546	0.022;0.035	T	0.53408	-0.8443	10	0.40728	T	0.16	.	20.3334	0.98727	0.0:0.0:1.0:0.0	.	1633;1646	Q01082-3;Q01082	.;SPTB2_HUMAN	K	1646;1633	ENSP00000349259:E1646K;ENSP00000334156:E1633K	ENSP00000334156:E1633K	E	+	1	0	SPTBN1	54727841	1.000000	0.71417	0.998000	0.56505	0.991000	0.79684	7.824000	0.86668	2.818000	0.97014	0.591000	0.81541	GAG	SPTBN1	-	pirsf_Spectrin_bsu,pfam_Spectrin_repeat,smart_Spectrin/alpha-actinin	ENSG00000115306		0.547	SPTBN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPTBN1	HGNC	protein_coding	OTTHUMT00000258115.3	48	0.00	0	G			54874337	54874337	+1	no_errors	ENST00000356805	ensembl	human	known	69_37n	missense	35	23.91	11	SNP	1.000	A
TEK	7010	genome.wustl.edu	37	9	27169623	27169623	+	Silent	SNP	C	C	T			TCGA-A1-A0SH-01A-11D-A099-09	TCGA-A1-A0SH-10A-03D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	473d6ae4-162a-4136-b44f-fad42529a31a	7df4bbf4-7ac5-4fd3-b0b9-ca6e49674cfd	g.chr9:27169623C>T	ENST00000380036.4	+	4	1066	c.624C>T	c.(622-624)gtC>gtT	p.V208V	TEK_ENST00000406359.4_Silent_p.V208V|TEK_ENST00000519097.1_Silent_p.V104V	NM_000459.3	NP_000450	Q02763	TIE2_HUMAN	TEK tyrosine kinase, endothelial	208					angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cell-cell signaling (GO:0007267)|cell-matrix adhesion (GO:0007160)|definitive hemopoiesis (GO:0060216)|endochondral ossification (GO:0001958)|endothelial cell proliferation (GO:0001935)|glomerulus vasculature development (GO:0072012)|heart development (GO:0007507)|heart trabecula formation (GO:0060347)|intracellular signal transduction (GO:0035556)|leukocyte migration (GO:0050900)|negative regulation of angiogenesis (GO:0016525)|negative regulation of apoptotic process (GO:0043066)|negative regulation of endothelial cell apoptotic process (GO:2000352)|negative regulation of inflammatory response (GO:0050728)|organ regeneration (GO:0031100)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of actin cytoskeleton reorganization (GO:2000251)|positive regulation of angiogenesis (GO:0045766)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of focal adhesion assembly (GO:0051894)|positive regulation of intracellular signal transduction (GO:1902533)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein phosphorylation (GO:0001934)|protein autophosphorylation (GO:0046777)|protein oligomerization (GO:0051259)|regulation of endothelial cell apoptotic process (GO:2000351)|regulation of establishment or maintenance of cell polarity (GO:0032878)|regulation of vascular permeability (GO:0043114)|response to cAMP (GO:0051591)|response to estrogen (GO:0043627)|response to hypoxia (GO:0001666)|response to peptide hormone (GO:0043434)|signal transduction (GO:0007165)|single organismal cell-cell adhesion (GO:0016337)|sprouting angiogenesis (GO:0002040)|substrate adhesion-dependent cell spreading (GO:0034446)|Tie signaling pathway (GO:0048014)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	apical plasma membrane (GO:0016324)|basal plasma membrane (GO:0009925)|basolateral plasma membrane (GO:0016323)|cell surface (GO:0009986)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)|microvillus (GO:0005902)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein tyrosine kinase activity (GO:0004713)|receptor activity (GO:0004872)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)	p.V208V(1)		breast(3)|central_nervous_system(3)|kidney(1)|lung(2)|ovary(3)|skin(3)	15		all_neural(11;7.57e-10)|Myeloproliferative disorder(762;0.0255)		Lung(218;4.08e-05)|LUSC - Lung squamous cell carcinoma(38;0.00027)	Ponatinib(DB08901)|Regorafenib(DB08896)|Vandetanib(DB05294)	GGCTGATAGTCCGGAGTAAGT	0.478																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											92.0	85.0	87.0					9																	27169623		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			L06139	CCDS6519.1, CCDS75825.1	9p21	2013-02-11	2008-07-31		ENSG00000120156	ENSG00000120156		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	11724	protein-coding gene	gene with protein product		600221	"""venous malformations, multiple cutaneous and mucosal"""	VMCM		1312667, 7833915	Standard	XM_005251561		Approved	TIE2, TIE-2, VMCM1, CD202b	uc003zqi.4	Q02763	OTTHUMG00000019712	ENST00000380036.4:c.624C>T	9.37:g.27169623C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K6W0|B4DH20|B4DHD3|D3DRK5|E7EWI2|Q5TCU2|Q8IV34	Silent	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Tyr_kin_Tie2_Ig-like_dom-1_N,pfam_Prot_kinase_cat_dom,pfam_Fibronectin_type3,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,smart_EGF-like,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_EG-like_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_cat_dom,pfscan_Ig-like,prints_Ser-Thr/Tyr_kinase_cat_dom	p.V208	ENST00000380036.4	37	c.624	CCDS6519.1	9																																																																																			TEK	-	NULL	ENSG00000120156		0.478	TEK-002	KNOWN	basic|appris_principal|CCDS	protein_coding	TEK	HGNC	protein_coding	OTTHUMT00000051965.3	63	0.00	0	C			27169623	27169623	+1	no_errors	ENST00000380036	ensembl	human	known	69_37n	silent	62	27.06	23	SNP	1.000	T
THRSP	7069	genome.wustl.edu	37	11	77774954	77774954	+	Silent	SNP	C	C	G			TCGA-A1-A0SH-01A-11D-A099-09	TCGA-A1-A0SH-10A-03D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	473d6ae4-162a-4136-b44f-fad42529a31a	7df4bbf4-7ac5-4fd3-b0b9-ca6e49674cfd	g.chr11:77774954C>G	ENST00000281030.2	+	1	48	c.27C>G	c.(25-27)ccC>ccG	p.P9P	NDUFC2-KCTD14_ENST00000530054.1_Intron|NDUFC2-KCTD14_ENST00000528251.1_Intron	NM_003251.3	NP_003242.1	Q92748	THRSP_HUMAN	thyroid hormone responsive	9					lipid metabolic process (GO:0006629)|regulation of lipid biosynthetic process (GO:0046890)|regulation of transcription, DNA-templated (GO:0006355)|regulation of triglyceride biosynthetic process (GO:0010866)|transcription, DNA-templated (GO:0006351)	cytosol (GO:0005829)|nucleus (GO:0005634)		p.P9P(1)		breast(2)|central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(2)	7	all_cancers(14;2.23e-19)|all_epithelial(13;7.49e-22)|Breast(9;6.38e-17)|Ovarian(111;0.152)		OV - Ovarian serous cystadenocarcinoma(8;2.15e-25)			AGCGTTACCCCAAGAACTGCC	0.577																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											98.0	73.0	82.0					11																	77774954		2200	4292	6492	-	-	-	SO:0001819	synonymous_variant	0			Y08409	CCDS8256.1	11q14.1	2012-06-19	2010-06-25		ENSG00000151365	ENSG00000151365			11800	protein-coding gene	gene with protein product	"""SPOT14 homolog (rat)"""	601926	"""thyroid hormone responsive SPOT14 (rat) homolog"", ""lipogenic protein 1"""	LPGP1		9003802	Standard	NM_003251		Approved	SPOT14, Lpgp, S14, THRP	uc001oyx.3	Q92748	OTTHUMG00000166632	ENST00000281030.2:c.27C>G	11.37:g.77774954C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	B2R4W7	Silent	SNP	pfam_Spot_14	p.P9	ENST00000281030.2	37	c.27	CCDS8256.1	11																																																																																			THRSP	-	pfam_Spot_14	ENSG00000151365		0.577	THRSP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	THRSP	HGNC	protein_coding	OTTHUMT00000390939.1	69	0.00	0	C	NM_003251		77774954	77774954	+1	no_errors	ENST00000281030	ensembl	human	known	69_37n	silent	65	22.62	19	SNP	1.000	G
DCANP1	140947	genome.wustl.edu	37	5	134785234	134785234	+	5'Flank	SNP	G	G	T			TCGA-A1-A0SH-01A-11D-A099-09	TCGA-A1-A0SH-10A-03D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	473d6ae4-162a-4136-b44f-fad42529a31a	7df4bbf4-7ac5-4fd3-b0b9-ca6e49674cfd	g.chr5:134785234G>T	ENST00000503143.2	-	0	0				CTB-138E5.1_ENST00000510230.1_RNA|TIFAB_ENST00000537858.1_Missense_Mutation_p.S132R	NM_130848.2	NP_570900.1	Q8TF63	DCNP1_HUMAN								nucleus (GO:0005634)		p.S132R(1)		endometrium(1)|lung(1)|prostate(1)	3			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0233)			GGGGTGAAGGGCTGACATGGA	0.562																																						dbGAP											1	Substitution - Missense(1)	breast(1)											65.0	70.0	68.0					5																	134785234		1997	4165	6162	-	-	-	SO:0001631	upstream_gene_variant	0																															5.37:g.134785234G>T	Exception_encountered	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_FHA_dom,superfamily_SMAD_FHA_domain	p.S132R	ENST00000503143.2	37	c.396	CCDS4186.1	5	.	.	.	.	.	.	.	.	.	.	G	16.02	3.003652	0.54254	.	.	ENSG00000255833	ENST00000537858	T	0.54675	0.56	5.49	3.72	0.42706	.	0.344730	0.26446	U	0.024327	T	0.53932	0.1827	L	0.32530	0.975	0.27986	N	0.935832	D	0.60160	0.987	P	0.59825	0.864	T	0.48703	-0.9012	10	0.72032	D	0.01	.	8.0483	0.30562	0.1846:0.0:0.8154:0.0	.	132	Q6ZNK6	TIFAB_HUMAN	R	132	ENSP00000440509:S132R	ENSP00000440509:S132R	S	-	3	2	TIFAB	134813133	0.992000	0.36948	0.754000	0.31244	0.671000	0.39405	1.428000	0.34892	0.699000	0.31761	0.563000	0.77884	AGC	TIFAB	-	NULL	ENSG00000255833		0.562	C5orf20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TIFAB	HGNC	protein_coding	OTTHUMT00000372531.1	42	0.00	0	G			134785234	134785234	-1	no_errors	ENST00000537858	ensembl	human	known	69_37n	missense	43	20.37	11	SNP	0.984	T
TMC8	147138	genome.wustl.edu	37	17	76134257	76134257	+	Silent	SNP	C	C	T			TCGA-A1-A0SH-01A-11D-A099-09	TCGA-A1-A0SH-10A-03D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	473d6ae4-162a-4136-b44f-fad42529a31a	7df4bbf4-7ac5-4fd3-b0b9-ca6e49674cfd	g.chr17:76134257C>T	ENST00000318430.5	+	12	1895	c.1521C>T	c.(1519-1521)ttC>ttT	p.F507F	TMC8_ENST00000589691.1_Silent_p.F284F	NM_152468.4	NP_689681.2	Q8IU68	TMC8_HUMAN	transmembrane channel-like 8	507					ion transport (GO:0006811)|negative regulation of protein binding (GO:0032091)|negative regulation of protein oligomerization (GO:0032460)|regulation of cell growth (GO:0001558)|regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902041)|zinc ion homeostasis (GO:0055069)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nuclear membrane (GO:0031965)	receptor binding (GO:0005102)	p.F507F(1)		breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(2)|ovary(1)|prostate(1)|skin(1)|urinary_tract(1)	12			BRCA - Breast invasive adenocarcinoma(99;0.00269)|Lung(188;0.0973)|OV - Ovarian serous cystadenocarcinoma(97;0.192)			TCCTCACCTTCTACATCAAGA	0.627																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											59.0	61.0	60.0					17																	76134257		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AY057380	CCDS32749.1	17q25.3	2014-09-17	2005-11-10	2005-11-10	ENSG00000167895	ENSG00000167895			20474	protein-coding gene	gene with protein product		605829	"""epidermodysplasia verruciformis 2"""	EVER2		12426567	Standard	NM_152468		Approved	EVIN2	uc002jup.2	Q8IU68		ENST00000318430.5:c.1521C>T	17.37:g.76134257C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q2YDC0|Q8IWU7|Q8N358|Q8NF04	Silent	SNP	pfam_TMC	p.F507	ENST00000318430.5	37	c.1521	CCDS32749.1	17																																																																																			TMC8	-	pfam_TMC	ENSG00000167895		0.627	TMC8-002	KNOWN	basic|appris_principal|CCDS	protein_coding	TMC8	HGNC	protein_coding	OTTHUMT00000436900.3	71	0.00	0	C			76134257	76134257	+1	no_errors	ENST00000318430	ensembl	human	known	69_37n	silent	117	13.33	18	SNP	1.000	T
TTC39A	22996	genome.wustl.edu	37	1	51754571	51754571	+	Missense_Mutation	SNP	G	G	C			TCGA-A1-A0SH-01A-11D-A099-09	TCGA-A1-A0SH-10A-03D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	473d6ae4-162a-4136-b44f-fad42529a31a	7df4bbf4-7ac5-4fd3-b0b9-ca6e49674cfd	g.chr1:51754571G>C	ENST00000447632.2	-	17	1706	c.1658C>G	c.(1657-1659)gCc>gGc	p.A553G	TTC39A_ENST00000371750.5_Missense_Mutation_p.A518G|TTC39A_ENST00000262675.7_Missense_Mutation_p.A490G|TTC39A_ENST00000534098.1_5'UTR|TTC39A_ENST00000451380.1_Missense_Mutation_p.A517G|TTC39A_ENST00000413473.2_Missense_Mutation_p.A521G|TTC39A_ENST00000530004.1_Missense_Mutation_p.A161G			Q5SRH9	TT39A_HUMAN	tetratricopeptide repeat domain 39A	553								p.0?(2)|p.A553G(1)|p.A490G(1)		breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(3)|lung(2)|prostate(2)|skin(3)|urinary_tract(1)	17						AAGCAGCAGGGCCAGCTCCAG	0.502																																						dbGAP											4	Substitution - Missense(2)|Whole gene deletion(2)	breast(2)|thyroid(1)|central_nervous_system(1)											59.0	60.0	60.0					1																	51754571		1916	4127	6043	-	-	-	SO:0001583	missense	0			AB007921	CCDS44143.1, CCDS44144.1, CCDS72789.1, CCDS72790.1	1p32.3	2013-01-11	2008-06-23	2008-06-23	ENSG00000085831	ENSG00000085831		"""Tetratricopeptide (TTC) repeat domain containing"""	18657	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 34"""	C1orf34		9455484, 9461476	Standard	XM_005270643		Approved	KIAA0452, DEME-6	uc010onf.2	Q5SRH9	OTTHUMG00000008193	ENST00000447632.2:c.1658C>G	1.37:g.51754571G>C	ENSP00000393952:p.Ala553Gly	Somatic		WXS	Illumina GAIIx	Phase_IV	B7Z782|E7EQY9|G3XAF8|O43417|O75040|Q5SRH5|Q5SRH6|Q5SRH7|Q5SRH8|Q5SRI0|Q5SRI1|Q5SRI2|Q5T7S1|Q6PIU8|Q9BT24	Missense_Mutation	SNP	pfam_OMP_IML2_mit/TPR_39,smart_TPR_repeat	p.A553G	ENST00000447632.2	37	c.1658		1	.	.	.	.	.	.	.	.	.	.	G	8.965	0.971419	0.18736	.	.	ENSG00000085831	ENST00000530004;ENST00000447632;ENST00000413473;ENST00000262675;ENST00000451380;ENST00000371750	T;T;T;T;T;T	0.58506	0.33;0.93;0.93;0.93;0.93;0.93	5.75	5.75	0.90469	Tetratricopeptide-like helical (1);	0.156954	0.56097	D	0.000024	T	0.40297	0.1111	N	0.12443	0.215	0.53005	D	0.99996	B;B;B;B;B	0.10296	0.002;0.001;0.001;0.002;0.003	B;B;B;B;B	0.18263	0.021;0.009;0.005;0.013;0.011	T	0.32481	-0.9905	10	0.08179	T	0.78	-19.7014	18.7237	0.91705	0.0:0.0:1.0:0.0	.	521;517;490;553;518	Q5SRH9-4;E7EQY9;D3DQ30;Q5SRH9;G3XAF8	.;.;.;TT39A_HUMAN;.	G	161;553;521;490;517;518	ENSP00000431228:A161G;ENSP00000393952:A553G;ENSP00000406144:A521G;ENSP00000262675:A490G;ENSP00000397207:A517G;ENSP00000360815:A518G	ENSP00000262675:A490G	A	-	2	0	TTC39A	51527159	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	5.663000	0.68038	2.725000	0.93324	0.655000	0.94253	GCC	TTC39A	-	smart_TPR_repeat	ENSG00000085831		0.502	TTC39A-004	KNOWN	basic	protein_coding	TTC39A	HGNC	protein_coding	OTTHUMT00000022434.2	111	0.88	1	G			51754571	51754571	-1	no_errors	ENST00000447632	ensembl	human	known	69_37n	missense	115	18.44	26	SNP	1.000	C
UNC93B1	81622	genome.wustl.edu	37	11	67763132	67763132	+	Missense_Mutation	SNP	G	G	A			TCGA-A1-A0SH-01A-11D-A099-09	TCGA-A1-A0SH-10A-03D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	473d6ae4-162a-4136-b44f-fad42529a31a	7df4bbf4-7ac5-4fd3-b0b9-ca6e49674cfd	g.chr11:67763132G>A	ENST00000227471.2	-	10	1389	c.1310C>T	c.(1309-1311)gCa>gTa	p.A437V	UNC93B1_ENST00000530331.1_5'UTR	NM_030930.2	NP_112192.2	Q9H1C4	UN93B_HUMAN	unc-93 homolog B1 (C. elegans)	438					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|defense response to virus (GO:0051607)|innate immune response (GO:0045087)|intracellular protein transport (GO:0006886)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 7 signaling pathway (GO:0034154)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)	early phagosome (GO:0032009)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|endosome (GO:0005768)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)		p.A437V(1)									AAGGGCAGCTGCCACATAGAG	0.642																																						dbGAP											1	Substitution - Missense(1)	breast(1)											8.0	8.0	8.0					11																	67763132		1796	3813	5609	-	-	-	SO:0001583	missense	0			AJ271326	CCDS73334.1	11q13.2	2014-09-17	2001-11-28		ENSG00000110057	ENSG00000110057			13481	protein-coding gene	gene with protein product		608204	"""unc93 (C. elegans) homolog B1"""			11867227	Standard	NM_030930		Approved	UNC93	uc001omw.1	Q9H1C4	OTTHUMG00000167472	ENST00000227471.2:c.1310C>T	11.37:g.67763132G>A	ENSP00000227471:p.Ala437Val	Somatic		WXS	Illumina GAIIx	Phase_IV	O95764|Q569H6|Q710D4	Missense_Mutation	SNP	pfam_Ion_channel_UNC-93,superfamily_MFS_dom_general_subst_transpt	p.A437V	ENST00000227471.2	37	c.1310		11	.	.	.	.	.	.	.	.	.	.	.	1.713	-0.498516	0.04291	.	.	ENSG00000110057	ENST00000227471	T	0.14516	2.5	5.44	-0.691	0.11305	.	0.431108	0.27043	N	0.021211	T	0.03871	0.0109	N	0.02916	-0.46	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.44620	-0.9316	10	0.05959	T	0.93	-2.0E-4	9.0759	0.36522	0.7377:0.0:0.2623:0.0	.	438	Q9H1C4	UN93B_HUMAN	V	437	ENSP00000227471:A437V	ENSP00000227471:A437V	A	-	2	0	UNC93B1	67519708	0.224000	0.23674	0.001000	0.08648	0.699000	0.40488	1.795000	0.38784	-0.008000	0.14320	0.556000	0.70494	GCA	UNC93B1	-	NULL	ENSG00000110057		0.642	UNC93B1-201	KNOWN	basic|appris_principal	protein_coding	UNC93B1	HGNC	protein_coding		17	0.00	0	G	NM_030930		67763132	67763132	-1	no_errors	ENST00000227471	ensembl	human	known	69_37n	missense	12	36.84	7	SNP	0.164	A
UPRT	139596	genome.wustl.edu	37	X	74519698	74519698	+	Missense_Mutation	SNP	C	C	T			TCGA-A1-A0SH-01A-11D-A099-09	TCGA-A1-A0SH-10A-03D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	473d6ae4-162a-4136-b44f-fad42529a31a	7df4bbf4-7ac5-4fd3-b0b9-ca6e49674cfd	g.chrX:74519698C>T	ENST00000373383.4	+	5	858	c.691C>T	c.(691-693)Cgg>Tgg	p.R231W	UPRT_ENST00000373379.1_Missense_Mutation_p.R231W|UPRT_ENST00000530743.1_Missense_Mutation_p.R95W	NM_145052.3	NP_659489.1	Q96BW1	UPP_HUMAN	uracil phosphoribosyltransferase (FUR1) homolog (S. cerevisiae)	231					female pregnancy (GO:0007565)|lactation (GO:0007595)|response to insulin (GO:0032868)|UMP biosynthetic process (GO:0006222)	cytoplasm (GO:0005737)|nucleus (GO:0005634)		p.R231W(1)		breast(1)|endometrium(7)|kidney(2)|large_intestine(4)|lung(4)	18						AGACATTTACCGGAGAAAAGT	0.423																																						dbGAP											1	Substitution - Missense(1)	breast(1)											147.0	133.0	137.0					X																	74519698		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC015116	CCDS14429.1	Xq13.3	2009-01-14			ENSG00000094841	ENSG00000094841			28334	protein-coding gene	gene with protein product		300656				12477932	Standard	NM_145052		Approved	DKFZp781E1243, MGC23937, FUR1, RP11-311P8.3	uc004ecb.2	Q96BW1	OTTHUMG00000021864	ENST00000373383.4:c.691C>T	X.37:g.74519698C>T	ENSP00000362481:p.Arg231Trp	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5JRL1|Q5JRL3|Q68DN0|Q96MW2	Missense_Mutation	SNP	pfam_PRibTrfase	p.R231W	ENST00000373383.4	37	c.691	CCDS14429.1	X	.	.	.	.	.	.	.	.	.	.	C	17.62	3.433974	0.62955	.	.	ENSG00000094841	ENST00000373383;ENST00000373379;ENST00000530743	D;D;D	0.91464	-2.85;-2.85;-2.85	5.79	2.84	0.33178	Phosphoribosyltransferase (1);	0.000000	0.85682	D	0.000000	D	0.94545	0.8243	M	0.79475	2.455	0.53005	D	0.999964	D;D	0.89917	1.0;1.0	D;D	0.71184	0.972;0.972	D	0.93851	0.7145	10	0.87932	D	0	-2.7518	14.1708	0.65508	0.5526:0.4474:0.0:0.0	.	231;231	A8KAF9;Q96BW1	.;UPP_HUMAN	W	231;231;95	ENSP00000362481:R231W;ENSP00000362477:R231W;ENSP00000434037:R95W	ENSP00000362477:R231W	R	+	1	2	UPRT	74436423	1.000000	0.71417	0.992000	0.48379	0.966000	0.64601	1.361000	0.34136	0.124000	0.18369	-0.351000	0.07748	CGG	UPRT	-	pfam_PRibTrfase	ENSG00000094841		0.423	UPRT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UPRT	HGNC	protein_coding	OTTHUMT00000057278.1	158	0.00	0	C	NM_145052		74519698	74519698	+1	no_errors	ENST00000373383	ensembl	human	known	69_37n	missense	150	10.71	18	SNP	1.000	T
USH2A	7399	genome.wustl.edu	37	1	216420207	216420207	+	Silent	SNP	G	G	A			TCGA-A1-A0SH-01A-11D-A099-09	TCGA-A1-A0SH-10A-03D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	473d6ae4-162a-4136-b44f-fad42529a31a	7df4bbf4-7ac5-4fd3-b0b9-ca6e49674cfd	g.chr1:216420207G>A	ENST00000307340.3	-	13	2915	c.2529C>T	c.(2527-2529)ctC>ctT	p.L843L	USH2A_ENST00000366942.3_Silent_p.L843L|USH2A_ENST00000366943.2_Silent_p.L843L	NM_206933.2	NP_996816	O75445	USH2A_HUMAN	Usher syndrome 2A (autosomal recessive, mild)	843	Laminin EGF-like 6. {ECO:0000255|PROSITE- ProRule:PRU00460}.				hair cell differentiation (GO:0035315)|inner ear receptor cell differentiation (GO:0060113)|maintenance of organ identity (GO:0048496)|photoreceptor cell maintenance (GO:0045494)|response to stimulus (GO:0050896)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	apical plasma membrane (GO:0016324)|basement membrane (GO:0005604)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|stereocilia ankle link complex (GO:0002142)|stereocilium bundle (GO:0032421)|stereocilium membrane (GO:0060171)	collagen binding (GO:0005518)|myosin binding (GO:0017022)	p.L843L(1)		NS(7)|breast(20)|central_nervous_system(3)|cervix(2)|endometrium(32)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(71)|liver(2)|lung(282)|ovary(25)|pancreas(2)|prostate(12)|skin(22)|stomach(7)|upper_aerodigestive_tract(20)|urinary_tract(3)	527				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)		AAGGCAGACAGAGGAAAGAAT	0.443										HNSCC(13;0.011)																												dbGAP											1	Substitution - coding silent(1)	breast(1)											182.0	174.0	177.0					1																	216420207		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF055580	CCDS1516.1, CCDS31025.1	1q41	2013-02-11			ENSG00000042781	ENSG00000042781		"""Fibronectin type III domain containing"""	12601	protein-coding gene	gene with protein product	"""usherin"""	608400		USH2		9624053, 10729113	Standard	NM_007123		Approved	RP39	uc001hku.1	O75445	OTTHUMG00000037079	ENST00000307340.3:c.2529C>T	1.37:g.216420207G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q5VVM9|Q6S362|Q9NS27	Silent	SNP	pfam_Fibronectin_type3,pfam_EGF_laminin,pfam_Laminin_G,superfamily_ConA-like_lec_gl,superfamily_Fibronectin_type3,smart_LamG-like,smart_Laminin_N,smart_EGF_laminin,smart_Fibronectin_type3,smart_Laminin_G,pfscan_EGF_laminin,pfscan_Fibronectin_type3,pfscan_Laminin_G,pfscan_Laminin_N	p.L843	ENST00000307340.3	37	c.2529	CCDS31025.1	1																																																																																			USH2A	-	smart_EGF_laminin,pfscan_EGF_laminin	ENSG00000042781		0.443	USH2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	USH2A	HGNC	protein_coding	OTTHUMT00000128138.1	173	0.00	0	G	NM_007123		216420207	216420207	-1	no_errors	ENST00000366943	ensembl	human	known	69_37n	silent	194	14.16	32	SNP	0.885	A
WDR7	23335	genome.wustl.edu	37	18	54424074	54424074	+	Missense_Mutation	SNP	C	C	G			TCGA-A1-A0SH-01A-11D-A099-09	TCGA-A1-A0SH-10A-03D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	473d6ae4-162a-4136-b44f-fad42529a31a	7df4bbf4-7ac5-4fd3-b0b9-ca6e49674cfd	g.chr18:54424074C>G	ENST00000254442.3	+	15	2461	c.2250C>G	c.(2248-2250)atC>atG	p.I750M	WDR7_ENST00000589935.1_Intron|WDR7_ENST00000357574.3_Missense_Mutation_p.I750M	NM_015285.2	NP_056100.2	Q9Y4E6	WDR7_HUMAN	WD repeat domain 7	750					hematopoietic progenitor cell differentiation (GO:0002244)			p.I750M(1)		NS(1)|breast(5)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(14)|lung(37)|ovary(3)|prostate(2)|skin(4)|upper_aerodigestive_tract(3)	78				Lung(128;0.0238)|Colorectal(16;0.0296)		AAGAAACGATCAAAGAGAACA	0.438																																						dbGAP											1	Substitution - Missense(1)	breast(1)											60.0	59.0	59.0					18																	54424074		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB011113	CCDS11962.1, CCDS11963.1	18q21.31	2013-01-09			ENSG00000091157	ENSG00000091157		"""WD repeat domain containing"""	13490	protein-coding gene	gene with protein product		613473				10828621	Standard	XM_005266674		Approved	KIAA0541, TRAG	uc002lgk.1	Q9Y4E6	OTTHUMG00000132721	ENST00000254442.3:c.2250C>G	18.37:g.54424074C>G	ENSP00000254442:p.Ile750Met	Somatic		WXS	Illumina GAIIx	Phase_IV	A7E2C8|Q86UX5|Q86VP2|Q96PS7	Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_Quinonprotein_ADH-like,superfamily_ARM-type_fold,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.I750M	ENST00000254442.3	37	c.2250	CCDS11962.1	18	.	.	.	.	.	.	.	.	.	.	C	11.01	1.511836	0.27036	.	.	ENSG00000091157	ENST00000254442;ENST00000357574;ENST00000444065;ENST00000398311	T;T	0.67345	-0.26;-0.26	5.96	5.08	0.68730	.	0.050317	0.85682	D	0.000000	T	0.48943	0.1528	N	0.08118	0	0.41700	D	0.989398	B;B	0.34372	0.451;0.062	B;B	0.34722	0.188;0.015	T	0.51903	-0.8646	10	0.36615	T	0.2	.	16.0774	0.80976	0.1354:0.8646:0.0:0.0	.	750;750	Q9Y4E6-2;Q9Y4E6	.;WDR7_HUMAN	M	750;750;75;750	ENSP00000254442:I750M;ENSP00000350187:I750M	ENSP00000254442:I750M	I	+	3	3	WDR7	52575072	1.000000	0.71417	0.998000	0.56505	0.849000	0.48306	2.472000	0.45136	1.490000	0.48466	0.655000	0.94253	ATC	WDR7	-	NULL	ENSG00000091157		0.438	WDR7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WDR7	HGNC	protein_coding	OTTHUMT00000256062.1	97	0.00	0	C			54424074	54424074	+1	no_errors	ENST00000254442	ensembl	human	known	69_37n	missense	102	22.14	29	SNP	1.000	G
WDR87	83889	genome.wustl.edu	37	19	38379723	38379723	+	Missense_Mutation	SNP	G	G	T			TCGA-A1-A0SH-01A-11D-A099-09	TCGA-A1-A0SH-10A-03D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	473d6ae4-162a-4136-b44f-fad42529a31a	7df4bbf4-7ac5-4fd3-b0b9-ca6e49674cfd	g.chr19:38379723G>T	ENST00000303868.5	-	6	4695	c.4471C>A	c.(4471-4473)Cag>Aag	p.Q1491K	WDR87_ENST00000447313.2_Missense_Mutation_p.Q1530K	NM_031951.3	NP_114157.3	Q6ZQQ6	WDR87_HUMAN	WD repeat domain 87	1491	Glu-rich.							p.Q1491K(1)		NS(4)|autonomic_ganglia(2)|breast(3)|central_nervous_system(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|lung(2)|prostate(1)|skin(3)|stomach(1)	36						TCCTCTTCCTGAAGAAGCCTC	0.507																																						dbGAP											1	Substitution - Missense(1)	breast(1)											77.0	58.0	64.0					19																	38379723		692	1591	2283	-	-	-	SO:0001583	missense	0			AK128826	CCDS46063.1, CCDS74356.1	19q13.13	2013-01-09			ENSG00000171804	ENSG00000171804		"""WD repeat domain containing"""	29934	protein-coding gene	gene with protein product							Standard	XM_005259304		Approved	NYD-SP11	uc010efu.2	Q6ZQQ6	OTTHUMG00000048187	ENST00000303868.5:c.4471C>A	19.37:g.38379723G>T	ENSP00000368025:p.Gln1491Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q9BWV9	Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,superfamily_ARM-type_fold,superfamily_Quinolinate_PRibosylTrfase_C,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.Q1530K	ENST00000303868.5	37	c.4588	CCDS46063.1	19	.	.	.	.	.	.	.	.	.	.	G	9.174	1.022001	0.19433	.	.	ENSG00000171804	ENST00000447313;ENST00000303868	T;T	0.44482	0.92;0.92	2.19	-2.21	0.06973	.	.	.	.	.	T	0.21801	0.0525	N	0.19112	0.55	0.09310	N	1	B;B	0.20887	0.049;0.049	B;B	0.10450	0.005;0.005	T	0.26503	-1.0101	9	0.16896	T	0.51	.	7.0863	0.25259	0.1671:0.2492:0.5837:0.0	.	1491;1530	Q6ZQQ6;E7ESW6	WDR87_HUMAN;.	K	1530;1491	ENSP00000405012:Q1530K;ENSP00000368025:Q1491K	ENSP00000368025:Q1491K	Q	-	1	0	WDR87	43071563	0.000000	0.05858	0.002000	0.10522	0.861000	0.49209	-2.627000	0.00874	-0.309000	0.08779	0.289000	0.19496	CAG	WDR87	-	superfamily_ARM-type_fold	ENSG00000171804		0.507	WDR87-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	WDR87	HGNC	protein_coding	OTTHUMT00000314628.2	90	0.00	0	G	XM_940478		38379723	38379723	-1	no_errors	ENST00000447313	ensembl	human	known	69_37n	missense	97	18.49	22	SNP	0.000	T
ZFHX4	79776	genome.wustl.edu	37	8	77616522	77616522	+	Missense_Mutation	SNP	G	G	A			TCGA-A1-A0SH-01A-11D-A099-09	TCGA-A1-A0SH-10A-03D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	473d6ae4-162a-4136-b44f-fad42529a31a	7df4bbf4-7ac5-4fd3-b0b9-ca6e49674cfd	g.chr8:77616522G>A	ENST00000521891.2	+	2	647	c.199G>A	c.(199-201)Gag>Aag	p.E67K	ZFHX4_ENST00000517683.1_Intron|ZFHX4_ENST00000455469.2_Missense_Mutation_p.E67K|ZFHX4_ENST00000518282.1_Missense_Mutation_p.E67K|ZFHX4_ENST00000050961.6_Missense_Mutation_p.E67K	NM_024721.4	NP_078997.4	Q86UP3	ZFHX4_HUMAN	zinc finger homeobox 4	67					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|zinc ion binding (GO:0008270)	p.E67K(1)		NS(3)|breast(11)|central_nervous_system(1)|endometrium(36)|haematopoietic_and_lymphoid_tissue(2)|kidney(15)|large_intestine(66)|liver(2)|lung(245)|ovary(11)|pancreas(3)|prostate(11)|skin(7)|upper_aerodigestive_tract(13)|urinary_tract(6)	432			BRCA - Breast invasive adenocarcinoma(89;0.0895)			TTTCAGCGTTGAGAATGCAGC	0.493										HNSCC(33;0.089)																												dbGAP											1	Substitution - Missense(1)	breast(1)											101.0	107.0	105.0					8																	77616522		2083	4225	6308	-	-	-	SO:0001583	missense	0				CCDS47878.1, CCDS47878.2	8q21.11	2012-07-02	2007-07-16		ENSG00000091656	ENSG00000091656		"""Homeoboxes / ZF class"""	30939	protein-coding gene	gene with protein product		606940	"""zinc finger homeodomain 4"""			10873665, 11935336	Standard	NM_024721		Approved	ZFH4, FLJ20980	uc003yau.2	Q86UP3	OTTHUMG00000164557	ENST00000521891.2:c.199G>A	8.37:g.77616522G>A	ENSP00000430497:p.Glu67Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	G3V138|Q18PS0|Q6ZN20	Missense_Mutation	SNP	pfam_Homeodomain,superfamily_Homeodomain-like,superfamily_Adenylate_cyclase-assoc_CAP_N,smart_Znf_C2H2-like,smart_Znf_U1,smart_Homeodomain,pfscan_Homeodomain,pfscan_Znf_C2H2	p.E67K	ENST00000521891.2	37	c.199	CCDS47878.2	8	.	.	.	.	.	.	.	.	.	.	G	11.01	1.513812	0.27123	.	.	ENSG00000091656	ENST00000521891;ENST00000399468;ENST00000455469;ENST00000050961;ENST00000520307;ENST00000523885;ENST00000517585;ENST00000523809;ENST00000518282	T;T;T;T;T;T;T;T	0.23348	1.91;1.91;1.91;1.91;1.91;1.91;1.91;1.91	5.53	5.53	0.82687	.	0.000000	0.44902	U	0.000406	T	0.19366	0.0465	N	0.14661	0.345	0.53688	D	0.999973	P;P;P;D	0.53745	0.702;0.655;0.802;0.962	B;B;B;B	0.42593	0.182;0.173;0.337;0.392	T	0.02037	-1.1225	10	0.29301	T	0.29	.	19.6556	0.95837	0.0:0.0:1.0:0.0	.	67;67;67;67	Q86UP3;Q86UP3-4;G3V138;Q86UP3-3	ZFHX4_HUMAN;.;.;.	K	67	ENSP00000430497:E67K;ENSP00000399605:E67K;ENSP00000050961:E67K;ENSP00000428525:E67K;ENSP00000429495:E67K;ENSP00000427775:E67K;ENSP00000427739:E67K;ENSP00000430848:E67K	ENSP00000050961:E67K	E	+	1	0	ZFHX4	77779077	1.000000	0.71417	0.995000	0.50966	0.907000	0.53573	6.406000	0.73276	2.882000	0.98803	0.655000	0.94253	GAG	ZFHX4	-	NULL	ENSG00000091656		0.493	ZFHX4-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZFHX4	HGNC	protein_coding	OTTHUMT00000379197.2	108	0.00	0	G	NM_024721		77616522	77616522	+1	no_errors	ENST00000521891	ensembl	human	known	69_37n	missense	100	16.67	20	SNP	1.000	A
ZNF606	80095	genome.wustl.edu	37	19	58489941	58489941	+	Missense_Mutation	SNP	T	T	C			TCGA-A1-A0SH-01A-11D-A099-09	TCGA-A1-A0SH-10A-03D-A099-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	473d6ae4-162a-4136-b44f-fad42529a31a	7df4bbf4-7ac5-4fd3-b0b9-ca6e49674cfd	g.chr19:58489941T>C	ENST00000341164.4	-	7	2727	c.2107A>G	c.(2107-2109)Act>Gct	p.T703A	ZNF606_ENST00000536132.1_Missense_Mutation_p.T613A	NM_025027.3	NP_079303.2	Q8WXB4	ZN606_HUMAN	zinc finger protein 606	703					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.T703A(2)		NS(1)|breast(2)|endometrium(4)|kidney(1)|large_intestine(5)|lung(10)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	26		Colorectal(82;5.46e-05)|all_neural(62;0.0182)|Breast(46;0.0389)|Ovarian(87;0.0443)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0168)		TTCTCTCCAGTATGAGTTCTC	0.403																																						dbGAP											2	Substitution - Missense(2)	breast(2)											101.0	102.0	102.0					19																	58489941		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB058755	CCDS12968.1	19q13.43	2013-01-08			ENSG00000166704	ENSG00000166704		"""Zinc fingers, C2H2-type"", ""-"""	25879	protein-coding gene	gene with protein product		613905		ZNF328		11347906	Standard	XM_005259276		Approved	FLJ14260, KIAA1852	uc002qqw.3	Q8WXB4	OTTHUMG00000169804	ENST00000341164.4:c.2107A>G	19.37:g.58489941T>C	ENSP00000343617:p.Thr703Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	A8KAN2|Q8NE04|Q96JH5	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.T703A	ENST00000341164.4	37	c.2107	CCDS12968.1	19	.	.	.	.	.	.	.	.	.	.	T	13.72	2.321842	0.41096	.	.	ENSG00000166704	ENST00000341164;ENST00000536132	T;T	0.26518	1.73;1.73	4.43	4.43	0.53597	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.46758	D	0.000271	T	0.41026	0.1141	L	0.46819	1.47	0.46028	D	0.998821	D	0.57571	0.98	D	0.65010	0.931	T	0.25433	-1.0132	10	0.59425	D	0.04	.	13.0673	0.59041	0.0:0.0:0.0:1.0	.	703	Q8WXB4	ZN606_HUMAN	A	703;613	ENSP00000343617:T703A;ENSP00000445624:T613A	ENSP00000343617:T703A	T	-	1	0	ZNF606	63181753	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.027000	0.41078	1.965000	0.57142	0.459000	0.35465	ACT	ZNF606	-	pfscan_Znf_C2H2	ENSG00000166704		0.403	ZNF606-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF606	HGNC	protein_coding	OTTHUMT00000405961.1	157	0.62	1	T	NM_025027		58489941	58489941	-1	no_errors	ENST00000341164	ensembl	human	known	69_37n	missense	102	51.89	110	SNP	1.000	C
