#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
ALG1	56052	genome.wustl.edu	37	16	5132586	5132586	+	Missense_Mutation	SNP	C	C	T			TCGA-A1-A0SJ-01A-11D-A099-09	TCGA-A1-A0SJ-10A-02D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a55c6a44-c0f5-4300-8df4-4a70befe2d3b	aaf63cff-b2e2-4f9b-868e-e7a1637cc14b	g.chr16:5132586C>T	ENST00000262374.5	+	11	1130	c.1099C>T	c.(1099-1101)Cac>Tac	p.H367Y	ALG1_ENST00000588623.1_Missense_Mutation_p.H256Y|ALG1_ENST00000544428.1_Missense_Mutation_p.H256Y	NM_019109.4	NP_061982.3	Q9BT22	ALG1_HUMAN	ALG1, chitobiosyldiphosphodolichol beta-mannosyltransferase	367					cellular protein metabolic process (GO:0044267)|dolichol-linked oligosaccharide biosynthetic process (GO:0006488)|lipopolysaccharide biosynthetic process (GO:0009103)|mannosylation (GO:0097502)|post-translational protein modification (GO:0043687)|protein glycosylation (GO:0006486)|protein N-linked glycosylation via asparagine (GO:0018279)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	chitobiosyldiphosphodolichol beta-mannosyltransferase activity (GO:0004578)|mannosyltransferase activity (GO:0000030)	p.H367Y(1)		breast(1)|cervix(1)|endometrium(1)|large_intestine(1)|lung(5)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	13		Ovarian(90;0.0164)				TGTCTGTCTGCACACGTCCTC	0.597																																						dbGAP											1	Substitution - Missense(1)	breast(1)											64.0	52.0	56.0					16																	5132586		2078	3944	6022	-	-	-	SO:0001583	missense	0			AB019038	CCDS10528.1	16p13.3	2013-02-22	2013-02-22		ENSG00000033011	ENSG00000033011	2.4.1.142	"""Glycosyltransferase group 1 domain containing"""	18294	protein-coding gene	gene with protein product		605907	"""asparagine-linked glycosylation 1 homolog (yeast, beta-1,4-mannosyltransferase)"", ""asparagine-linked glycosylation 1, beta-1,4-mannosyltransferase homolog (S. cerevisiae)"""			10704531	Standard	NM_019109		Approved	HMT-1, HMAT1	uc002cym.3	Q9BT22	OTTHUMG00000129529	ENST00000262374.5:c.1099C>T	16.37:g.5132586C>T	ENSP00000262374:p.His367Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DP08|Q6UVZ9|Q8N5Y4|Q9P2Y2	Missense_Mutation	SNP	pfam_Glyco_trans_1	p.H367Y	ENST00000262374.5	37	c.1099	CCDS10528.1	16	.	.	.	.	.	.	.	.	.	.	C	26.1	4.700185	0.88924	.	.	ENSG00000033011	ENST00000262374;ENST00000544428	T;T	0.75050	-0.9;-0.9	5.28	5.28	0.74379	Glycosyl transferase, family 1 (1);	0.000000	0.85682	D	0.000000	D	0.89894	0.6847	M	0.93462	3.42	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.997;0.998	D	0.92453	0.5971	10	0.87932	D	0	-24.1817	17.5165	0.87775	0.0:1.0:0.0:0.0	.	256;367	B4DP08;Q9BT22	.;ALG1_HUMAN	Y	367;256	ENSP00000262374:H367Y;ENSP00000440019:H256Y	ENSP00000262374:H367Y	H	+	1	0	ALG1	5072587	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	5.492000	0.66893	2.474000	0.83562	0.555000	0.69702	CAC	ALG1	-	pfam_Glyco_trans_1	ENSG00000033011		0.597	ALG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ALG1	HGNC	protein_coding	OTTHUMT00000251716.2	138	0.00	0	C	NM_019109		5132586	5132586	+1	no_errors	ENST00000262374	ensembl	human	known	69_37n	missense	170	17.48	36	SNP	1.000	T
AMZ2	51321	genome.wustl.edu	37	17	66246548	66246548	+	Missense_Mutation	SNP	T	T	G			TCGA-A1-A0SJ-01A-11D-A099-09	TCGA-A1-A0SJ-10A-02D-A099-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a55c6a44-c0f5-4300-8df4-4a70befe2d3b	aaf63cff-b2e2-4f9b-868e-e7a1637cc14b	g.chr17:66246548T>G	ENST00000359904.3	+	2	1352	c.220T>G	c.(220-222)Ttc>Gtc	p.F74V	AMZ2_ENST00000577273.1_Missense_Mutation_p.F74V|AMZ2_ENST00000577985.1_Missense_Mutation_p.F74V|RP11-147L13.2_ENST00000577698.1_RNA|AMZ2_ENST00000580753.1_Missense_Mutation_p.F74V|AMZ2_ENST00000392720.2_Missense_Mutation_p.F74V|AMZ2_ENST00000359783.4_Missense_Mutation_p.F74V|AMZ2_ENST00000577866.1_Missense_Mutation_p.F74V|AMZ2_ENST00000585050.1_3'UTR	NM_016627.4	NP_057711.3	Q86W34	AMZ2_HUMAN	archaelysin family metallopeptidase 2	74							metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)	p.F74V(2)		breast(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(3)	9	all_cancers(12;1.12e-09)		BRCA - Breast invasive adenocarcinoma(8;3.17e-08)|LUSC - Lung squamous cell carcinoma(166;0.24)			TGAACAGTTCTTCAGTGATCC	0.453																																						dbGAP											2	Substitution - Missense(2)	breast(2)											118.0	117.0	117.0					17																	66246548		2203	4300	6503	-	-	-	SO:0001583	missense	0			CR609550	CCDS11674.1, CCDS32714.1	17q24.2	2010-04-08			ENSG00000196704	ENSG00000196704			28041	protein-coding gene	gene with protein product	"""archaemetzincin-2"""	615169				15972818	Standard	XM_005257436		Approved		uc002jgr.1	Q86W34		ENST00000359904.3:c.220T>G	17.37:g.66246548T>G	ENSP00000352976:p.Phe74Val	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NLD9|B3KR44|Q5XKF1|Q9NZE2	Missense_Mutation	SNP	pfam_Pept_M54_archaemetzincn	p.F74V	ENST00000359904.3	37	c.220	CCDS11674.1	17	.	.	.	.	.	.	.	.	.	.	T	12.23	1.876264	0.33162	.	.	ENSG00000196704	ENST00000359904;ENST00000359783;ENST00000392720	T;T;T	0.30714	1.52;2.21;1.52	3.68	3.68	0.42216	.	0.200522	0.33438	N	0.004906	T	0.26774	0.0655	L	0.60455	1.87	0.35552	D	0.803985	B;P	0.36282	0.321;0.546	B;B	0.30943	0.122;0.073	T	0.43458	-0.9390	10	0.49607	T	0.09	-26.51	10.6469	0.45626	0.0:0.0:0.0:1.0	.	74;74	A6NLD9;Q86W34	.;AMZ2_HUMAN	V	74	ENSP00000352976:F74V;ENSP00000352831:F74V;ENSP00000376481:F74V	ENSP00000352831:F74V	F	+	1	0	AMZ2	63758143	1.000000	0.71417	1.000000	0.80357	0.933000	0.57130	6.437000	0.73421	1.666000	0.50821	0.254000	0.18369	TTC	AMZ2	-	NULL	ENSG00000196704		0.453	AMZ2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AMZ2	HGNC	protein_coding	OTTHUMT00000448261.1	96	0.00	0	T	NM_016627		66246548	66246548	+1	no_errors	ENST00000359904	ensembl	human	known	69_37n	missense	96	48.13	90	SNP	1.000	G
ASCL3	56676	genome.wustl.edu	37	11	8959533	8959533	+	Missense_Mutation	SNP	G	G	C			TCGA-A1-A0SJ-01A-11D-A099-09	TCGA-A1-A0SJ-10A-02D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a55c6a44-c0f5-4300-8df4-4a70befe2d3b	aaf63cff-b2e2-4f9b-868e-e7a1637cc14b	g.chr11:8959533G>C	ENST00000531618.1	-	1	225	c.176C>G	c.(175-177)cCc>cGc	p.P59R	ASCL3_ENST00000325884.1_Missense_Mutation_p.P59R			Q9NQ33	ASCL3_HUMAN	achaete-scute family bHLH transcription factor 3	58					regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)	p.P59R(1)		breast(1)|large_intestine(2)|lung(5)|stomach(1)	9				Epithelial(150;1.48e-08)|BRCA - Breast invasive adenocarcinoma(625;0.0228)		AGAGTCGCTGGGAAAAGGCAG	0.562																																						dbGAP											1	Substitution - Missense(1)	breast(1)											67.0	73.0	71.0					11																	8959533		2201	4295	6496	-	-	-	SO:0001583	missense	0			AJ400877	CCDS7795.1	11p15.3	2013-10-17	2013-10-17			ENSG00000176009		"""Basic helix-loop-helix proteins"""	740	protein-coding gene	gene with protein product		609154	"""achaete-scute complex (Drosophila) homolog-like 3"", ""achaete-scute complex homolog 3 (Drosophila)"""			11528127	Standard	NM_020646		Approved	bHLHa42, HASH3, Sgn1	uc001mhd.1	Q9NQ33	OTTHUMG00000165679	ENST00000531618.1:c.176C>G	11.37:g.8959533G>C	ENSP00000435770:p.Pro59Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8WYQ6	Missense_Mutation	SNP	pfam_HLH_DNA-bd,superfamily_HLH_DNA-bd,smart_HLH_DNA-bd,pfscan_HLH_DNA-bd	p.P59R	ENST00000531618.1	37	c.176	CCDS7795.1	11	.	.	.	.	.	.	.	.	.	.	G	11.92	1.781285	0.31502	.	.	ENSG00000176009	ENST00000325884;ENST00000531618	D;D	0.97505	-4.41;-4.41	5.72	4.81	0.61882	.	0.915621	0.09279	N	0.824068	D	0.92430	0.7597	N	0.24115	0.695	0.09310	N	1	B	0.28128	0.201	B	0.26969	0.075	D	0.84025	0.0356	10	0.27785	T	0.31	-3.2475	6.4318	0.21801	0.189:0.0:0.811:0.0	.	58	Q9NQ33	ASCL3_HUMAN	R	59	ENSP00000318846:P59R;ENSP00000435770:P59R	ENSP00000318846:P59R	P	-	2	0	ASCL3	8916109	0.007000	0.16637	0.888000	0.34837	0.726000	0.41606	1.294000	0.33365	2.717000	0.92951	0.650000	0.86243	CCC	ASCL3	-	NULL	ENSG00000176009		0.562	ASCL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ASCL3	HGNC	protein_coding	OTTHUMT00000385773.1	129	0.76	1	G			8959533	8959533	-1	no_errors	ENST00000325884	ensembl	human	known	69_37n	missense	80	23.08	24	SNP	0.167	C
CHML	1122	genome.wustl.edu	37	1	241798828	241798828	+	Frame_Shift_Del	DEL	G	G	-			TCGA-A1-A0SJ-01A-11D-A099-09	TCGA-A1-A0SJ-10A-02D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a55c6a44-c0f5-4300-8df4-4a70befe2d3b	aaf63cff-b2e2-4f9b-868e-e7a1637cc14b	g.chr1:241798828delG	ENST00000366553.1	-	1	404	c.241delC	c.(241-243)catfs	p.H81fs	OPN3_ENST00000331838.5_Intron|OPN3_ENST00000469376.1_Intron|OPN3_ENST00000366554.2_Intron	NM_001821.3	NP_001812.2	P26374	RAE2_HUMAN	choroideremia-like (Rab escort protein 2)	81					intracellular protein transport (GO:0006886)|protein geranylgeranylation (GO:0018344)	Rab-protein geranylgeranyltransferase complex (GO:0005968)	GTPase activator activity (GO:0005096)|Rab geranylgeranyltransferase activity (GO:0004663)|Rab GTPase binding (GO:0017137)	p.H81fs*87(1)		breast(2)|endometrium(1)|kidney(2)|large_intestine(6)|lung(7)|ovary(4)|skin(3)|stomach(1)	26	Ovarian(103;0.103)|all_lung(81;0.23)	all_cancers(173;0.0231)	OV - Ovarian serous cystadenocarcinoma(106;0.0125)			TCTGTTTCATGGATCAGGTCC	0.438																																						dbGAP											1	Deletion - Frameshift(1)	breast(1)											234.0	224.0	228.0					1																	241798828		2203	4299	6502	-	-	-	SO:0001589	frameshift_variant	0			X64728	CCDS31073.1	1q43	2013-09-19			ENSG00000203668	ENSG00000203668			1941	protein-coding gene	gene with protein product		118825				7981670	Standard	NM_001821		Approved	REP-2	uc001hzd.3	P26374	OTTHUMG00000039690	ENST00000366553.1:c.241delC	1.37:g.241798828delG	ENSP00000355511:p.His81fs	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RAB9|Q17RE0|Q9H1Y4	Frame_Shift_Del	DEL	pfam_GDP_dissociation_inhibitor,pirsf_Rab_geranylTrfase_A_euk,prints_Rab_escort,prints_GDP_dissociation_inhibitor	p.H81fs	ENST00000366553.1	37	c.241	CCDS31073.1	1																																																																																			CHML	-	pirsf_Rab_geranylTrfase_A_euk,prints_Rab_escort	ENSG00000203668		0.438	CHML-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHML	HGNC	protein_coding	OTTHUMT00000095712.1	92	0.00	0	G	NM_001821		241798828	241798828	-1	no_errors	ENST00000366553	ensembl	human	known	69_37n	frame_shift_del	124	36.04	71	DEL	0.004	-
CILP	8483	genome.wustl.edu	37	15	65489601	65489601	+	Missense_Mutation	SNP	A	A	T			TCGA-A1-A0SJ-01A-11D-A099-09	TCGA-A1-A0SJ-10A-02D-A099-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a55c6a44-c0f5-4300-8df4-4a70befe2d3b	aaf63cff-b2e2-4f9b-868e-e7a1637cc14b	g.chr15:65489601A>T	ENST00000261883.4	-	9	3189	c.3023T>A	c.(3022-3024)tTc>tAc	p.F1008Y		NM_003613.3	NP_003604	O75339	CILP1_HUMAN	cartilage intermediate layer protein, nucleotide pyrophosphohydrolase	1008					negative regulation of insulin-like growth factor receptor signaling pathway (GO:0043569)	extracellular matrix (GO:0031012)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)		p.F1008Y(1)		breast(5)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(14)|lung(17)|ovary(4)|pancreas(2)|prostate(4)|skin(2)|urinary_tract(1)	55						ACTGCACTTGAACTCCAGACA	0.602																																						dbGAP											1	Substitution - Missense(1)	breast(1)											83.0	65.0	71.0					15																	65489601		2202	4299	6501	-	-	-	SO:0001583	missense	0			AY358904	CCDS10203.1	15q22	2013-01-14			ENSG00000138615	ENSG00000138615		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	1980	protein-coding gene	gene with protein product		603489				9722584, 9722583	Standard	NM_003613		Approved	HsT18872	uc002aon.2	O75339	OTTHUMG00000133140	ENST00000261883.4:c.3023T>A	15.37:g.65489601A>T	ENSP00000261883:p.Phe1008Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R8F7|Q6UW99|Q8IYI5	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Thrombospondin_1_rpt,superfamily_Thrombospondin_1_rpt,superfamily_CarboxyPept-like_regulatory,smart_Thrombospondin_1_rpt,smart_Ig_sub,smart_Ig_sub2,pfscan_Thrombospondin_1_rpt,pfscan_Ig-like	p.F1008Y	ENST00000261883.4	37	c.3023	CCDS10203.1	15	.	.	.	.	.	.	.	.	.	.	A	19.09	3.759474	0.69763	.	.	ENSG00000138615	ENST00000261883	T	0.09911	2.93	5.54	5.54	0.83059	.	0.000000	0.85682	D	0.000000	T	0.32194	0.0821	M	0.70842	2.15	0.58432	D	0.999998	D	0.71674	0.998	D	0.79108	0.992	T	0.02009	-1.1230	10	0.49607	T	0.09	-29.35	14.8642	0.70401	1.0:0.0:0.0:0.0	.	1008	O75339	CILP1_HUMAN	Y	1008	ENSP00000261883:F1008Y	ENSP00000261883:F1008Y	F	-	2	0	CILP	63276654	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.311000	0.96282	2.108000	0.64289	0.533000	0.62120	TTC	CILP	-	NULL	ENSG00000138615		0.602	CILP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CILP	HGNC	protein_coding	OTTHUMT00000256829.1	54	0.00	0	A	NM_003613		65489601	65489601	-1	no_errors	ENST00000261883	ensembl	human	known	69_37n	missense	39	23.53	12	SNP	1.000	T
COL20A1	57642	genome.wustl.edu	37	20	61939981	61939981	+	Missense_Mutation	SNP	C	C	T			TCGA-A1-A0SJ-01A-11D-A099-09	TCGA-A1-A0SJ-10A-02D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a55c6a44-c0f5-4300-8df4-4a70befe2d3b	aaf63cff-b2e2-4f9b-868e-e7a1637cc14b	g.chr20:61939981C>T	ENST00000358894.6	+	8	963	c.863C>T	c.(862-864)aCg>aTg	p.T288M	COL20A1_ENST00000326996.6_Missense_Mutation_p.T288M|COL20A1_ENST00000435874.1_Missense_Mutation_p.T295M|COL20A1_ENST00000422202.1_Missense_Mutation_p.T295M	NM_020882.2	NP_065933.2	Q9P218	COKA1_HUMAN	collagen, type XX, alpha 1	288	VWFA. {ECO:0000255|PROSITE- ProRule:PRU00219}.				extracellular matrix organization (GO:0030198)	collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)		p.T288M(1)		NS(3)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(1)|lung(21)|ovary(1)|prostate(3)|urinary_tract(2)	36	all_cancers(38;1.39e-10)					ATTCTGGTGACGGACGGCAAG	0.667																																						dbGAP											1	Substitution - Missense(1)	lung(1)											24.0	29.0	27.0					20																	61939981		2096	4208	6304	-	-	-	SO:0001583	missense	0			BC043183	CCDS46628.1	20q13.33	2014-02-12			ENSG00000101203	ENSG00000101203		"""Collagens"", ""Fibronectin type III domain containing"""	14670	protein-coding gene	gene with protein product						10819331	Standard	NM_020882		Approved	KIAA1510	uc011aau.2	Q9P218	OTTHUMG00000032964	ENST00000358894.6:c.863C>T	20.37:g.61939981C>T	ENSP00000351767:p.Thr288Met	Somatic		WXS	Illumina GAIIx	Phase_IV	Q4VXQ4|Q6PI59|Q8WUT2|Q96CY9|Q9BQU6|Q9BQU7	Missense_Mutation	SNP	pfam_Fibronectin_type3,pfam_VWF_A,pfam_Collagen,superfamily_ConA-like_lec_gl,superfamily_Fibronectin_type3,smart_Fibronectin_type3,smart_VWF_A,smart_Laminin_G,pfscan_Fibronectin_type3,pfscan_VWF_A	p.T288M	ENST00000358894.6	37	c.863	CCDS46628.1	20	.	.	.	.	.	.	.	.	.	.	C	17.27	3.346793	0.61073	.	.	ENSG00000101203	ENST00000358894;ENST00000326996;ENST00000435874;ENST00000422202	D;D;D;D	0.88354	-2.37;-2.37;-2.37;-2.37	4.07	4.07	0.47477	von Willebrand factor, type A (3);	0.000000	0.85682	D	0.000000	D	0.96374	0.8817	H	0.96720	3.87	0.49389	D	0.999782	D;D	0.89917	1.0;1.0	D;D	0.97110	0.999;1.0	D	0.98111	1.0420	10	0.87932	D	0	.	16.2463	0.82446	0.0:1.0:0.0:0.0	.	295;288	Q9P218-2;Q9P218	.;COKA1_HUMAN	M	288;288;295;295	ENSP00000351767:T288M;ENSP00000323077:T288M;ENSP00000408690:T295M;ENSP00000414753:T295M	ENSP00000323077:T288M	T	+	2	0	COL20A1	61410426	1.000000	0.71417	0.973000	0.42090	0.051000	0.14879	6.565000	0.73974	1.982000	0.57802	0.467000	0.42956	ACG	COL20A1	-	pfam_VWF_A,smart_VWF_A,pfscan_VWF_A	ENSG00000101203		0.667	COL20A1-006	KNOWN	basic|CCDS	protein_coding	COL20A1	HGNC	protein_coding	OTTHUMT00000144595.2	20	0.00	0	C	NM_020882		61939981	61939981	+1	no_errors	ENST00000326996	ensembl	human	known	69_37n	missense	121	15.97	23	SNP	1.000	T
HIATL2	84278	genome.wustl.edu	37	9	99673410	99673410	+	Intron	SNP	G	G	A	rs145346988		TCGA-A1-A0SJ-01A-11D-A099-09	TCGA-A1-A0SJ-10A-02D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a55c6a44-c0f5-4300-8df4-4a70befe2d3b	aaf63cff-b2e2-4f9b-868e-e7a1637cc14b	g.chr9:99673410G>A	ENST00000506067.1	-	4	486							Q5VZR4	HIAL2_HUMAN	hippocampus abundant transcript-like 2						transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)	transporter activity (GO:0005215)										AATCTCAAAGGAGGAAAAAAA	0.493																																						dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			BC005058		9q22.33	2008-09-12	2008-09-12		ENSG00000196312	ENSG00000196312			23672	protein-coding gene	gene with protein product						12477932	Standard	NR_002894		Approved	MGC12945	uc004aws.3	Q5VZR4	OTTHUMG00000020317	ENST00000506067.1:c.62+7514C>T	9.37:g.99673410G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q9BSG7	Splice_Site	SNP	-	NULL	ENST00000506067.1	37	c.NULL		9																																																																																			RP11-330M2.4	-	-	ENSG00000235041		0.493	HIATL2-002	KNOWN	basic	processed_transcript	ENSG00000235041	Clone_based_vega_gene	protein_coding	OTTHUMT00000470418.1	9	0.00	0	G	NM_032318		99673410	99673410	+1	no_coding_region:pseudogene	ENST00000435150	ensembl	human	known	69_37n	splice_site	7	50.00	7	SNP	0.999	A
FAF2	23197	genome.wustl.edu	37	5	175875463	175875463	+	Missense_Mutation	SNP	C	C	A			TCGA-A1-A0SJ-01A-11D-A099-09	TCGA-A1-A0SJ-10A-02D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a55c6a44-c0f5-4300-8df4-4a70befe2d3b	aaf63cff-b2e2-4f9b-868e-e7a1637cc14b	g.chr5:175875463C>A	ENST00000261942.6	+	1	108	c.55C>A	c.(55-57)Cag>Aag	p.Q19K		NM_014613.2	NP_055428.1	Q96CS3	FAF2_HUMAN	Fas associated factor family member 2	19	UBA.				lipid particle organization (GO:0034389)|negative regulation of catalytic activity (GO:0043086)|response to unfolded protein (GO:0006986)	Cdc48p-Npl4p-Ufd1p AAA ATPase complex (GO:0034098)|endoplasmic reticulum (GO:0005783)|intracellular membrane-bounded organelle (GO:0043231)|lipid particle (GO:0005811)	lipase binding (GO:0035473)|lipase inhibitor activity (GO:0055102)|ubiquitin binding (GO:0043130)|ubiquitin protein ligase binding (GO:0031625)	p.Q19K(1)		breast(1)|large_intestine(3)|lung(4)|ovary(1)|skin(1)	10						GAAGCTGCTGCAGTTTCAGGT	0.622																																						dbGAP											1	Substitution - Missense(1)	breast(1)											38.0	37.0	37.0					5																	175875463		2195	4294	6489	-	-	-	SO:0001583	missense	0			BC015791	CCDS34296.1	5q35.2	2011-06-28	2008-07-25	2008-07-25	ENSG00000113194	ENSG00000113194		"""UBX domain containing"""	24666	protein-coding gene	gene with protein product	"""expressed in T cells and eosinophils in atopic dermatitis"", ""UBX domain protein 3B"""		"""UBX domain containing 8"""	UBXD8		10048485, 12372427	Standard	NM_014613		Approved	ETEA, KIAA0887, UBXN3B	uc003mej.4	Q96CS3	OTTHUMG00000163228	ENST00000261942.6:c.55C>A	5.37:g.175875463C>A	ENSP00000261942:p.Gln19Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	O94963|Q8IUF2|Q9BRP2|Q9BVM7	Missense_Mutation	SNP	pfam_UBX,superfamily_UBA-like,smart_UAS,pfscan_UBX	p.Q19K	ENST00000261942.6	37	c.55	CCDS34296.1	5	.	.	.	.	.	.	.	.	.	.	C	20.9	4.064136	0.76187	.	.	ENSG00000113194	ENST00000261942;ENST00000540174	.	.	.	5.06	5.06	0.68205	UBA-like (1);	0.056011	0.85682	D	0.000000	T	0.55465	0.1922	L	0.59436	1.845	0.80722	D	1	P	0.40000	0.698	B	0.35770	0.21	T	0.62520	-0.6837	9	0.56958	D	0.05	-10.2866	18.2212	0.89902	0.0:1.0:0.0:0.0	.	19	Q96CS3	FAF2_HUMAN	K	19	.	ENSP00000261942:Q19K	Q	+	1	0	FAF2	175808069	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.629000	0.61290	2.632000	0.89209	0.603000	0.83216	CAG	FAF2	-	superfamily_UBA-like	ENSG00000113194		0.622	FAF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAF2	HGNC	protein_coding	OTTHUMT00000372194.1	45	0.00	0	C	NM_014613		175875463	175875463	+1	no_errors	ENST00000261942	ensembl	human	known	69_37n	missense	47	32.86	23	SNP	1.000	A
FAM115C	285966	genome.wustl.edu	37	7	143417083	143417083	+	Missense_Mutation	SNP	T	T	C	rs62486261		TCGA-A1-A0SJ-01A-11D-A099-09	TCGA-A1-A0SJ-10A-02D-A099-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a55c6a44-c0f5-4300-8df4-4a70befe2d3b	aaf63cff-b2e2-4f9b-868e-e7a1637cc14b	g.chr7:143417083T>C	ENST00000441159.2	+	3	997	c.931T>C	c.(931-933)Tgt>Cgt	p.C311R	FAM115C_ENST00000357344.4_Missense_Mutation_p.C311R|FAM115C_ENST00000444908.2_Missense_Mutation_p.C311R|FAM115C_ENST00000411497.2_Missense_Mutation_p.C30R|FAM115C_ENST00000425618.2_Missense_Mutation_p.C30R|FAM115C_ENST00000411935.1_Missense_Mutation_p.C147R|FAM115C_ENST00000409703.3_Missense_Mutation_p.C147R			A6NFQ2	F115C_HUMAN	family with sequence similarity 115, member C	311					hematopoietic progenitor cell differentiation (GO:0002244)					endometrium(2)|large_intestine(4)|lung(2)|prostate(1)	9						AAAAGATCTGTGTCCTCTCCT	0.567																																						dbGAP											0													2.0	1.0	1.0					7																	143417083		121	275	396	-	-	-	SO:0001583	missense	0			AY167570	CCDS34769.1, CCDS47735.1, CCDS47735.2	7q35	2010-08-03	2008-06-12	2008-06-12	ENSG00000170379	ENSG00000170379			26878	protein-coding gene	gene with protein product			"""family with sequence similarity 139, member A"""	FAM139A			Standard	NM_173678		Approved	FLJ40722	uc003wdf.3	A6NFQ2	OTTHUMG00000153232	ENST00000441159.2:c.931T>C	7.37:g.143417083T>C	ENSP00000404265:p.Cys311Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DK02|Q14D25|Q17RQ4|Q8IWQ0|Q8NF84	Missense_Mutation	SNP	NULL	p.C311R	ENST00000441159.2	37	c.931		7	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	t|t	3.201|3.201	-0.163625|-0.163625	0.06502|0.06502	.|.	.|.	ENSG00000170379|ENSG00000170379	ENST00000444908;ENST00000411497;ENST00000357344;ENST00000441159;ENST00000411935;ENST00000409703;ENST00000425618|ENST00000518791	T;T;T;T;T|.	0.21361|.	2.01;2.01;2.01;2.01;2.01|.	3.58|3.58	-3.76|-3.76	0.04359|0.04359	.|.	1.065300|.	0.07032|.	N|.	0.828672|.	T|T	0.34308|0.34308	0.0893|0.0893	L|L	0.60455|0.60455	1.87|1.87	0.58432|0.58432	P|P	1.0000000000287557E-6|1.0000000000287557E-6	P;B;B;B|.	0.42785|.	0.79;0.173;0.17;0.265|.	B;B;B;B|.	0.38020|.	0.263;0.045;0.052;0.098|.	T|T	0.39396|0.39396	-0.9616|-0.9616	9|4	0.26408|.	T|.	0.33|.	-0.2194|-0.2194	0.6288|0.6288	0.00791|0.00791	0.1771:0.2911:0.1682:0.3637|0.1771:0.2911:0.1682:0.3637	.|.	147;311;30;311|.	A6NFQ2-3;A6NFQ2;Q8N1I1;A6NFQ2-2|.	.;F115C_HUMAN;.;.|.	R|A	311;30;311;311;147;147;30|125	ENSP00000412724:C311R;ENSP00000349902:C311R;ENSP00000404265:C311R;ENSP00000389100:C147R;ENSP00000386405:C147R|.	ENSP00000349902:C311R|.	C|V	+|+	1|2	0|0	FAM115C|FAM115C	143048016|143048016	0.000000|0.000000	0.05858|0.05858	0.004000|0.004000	0.12327|0.12327	0.564000|0.564000	0.35744|0.35744	-0.003000|-0.003000	0.12901|0.12901	-0.826000|-0.826000	0.04284|0.04284	0.338000|0.338000	0.21704|0.21704	TGT|GTG	FAM115C	-	NULL	ENSG00000170379		0.567	FAM115C-001	KNOWN	basic|appris_principal	protein_coding	FAM115C	HGNC	protein_coding	OTTHUMT00000330287.1	11	0.00	0	T	NM_173678		143417083	143417083	+1	no_errors	ENST00000441159	ensembl	human	known	69_37n	missense	4	69.23	9	SNP	0.002	C
GJB2	2706	genome.wustl.edu	37	13	20763283	20763283	+	Missense_Mutation	SNP	G	G	C			TCGA-A1-A0SJ-01A-11D-A099-09	TCGA-A1-A0SJ-10A-02D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a55c6a44-c0f5-4300-8df4-4a70befe2d3b	aaf63cff-b2e2-4f9b-868e-e7a1637cc14b	g.chr13:20763283G>C	ENST00000382844.1	-	1	636	c.438C>G	c.(436-438)ttC>ttG	p.F146L	GJB2_ENST00000382848.4_Missense_Mutation_p.F146L			P29033	CXB2_HUMAN	gap junction protein, beta 2, 26kDa	146					cell-cell signaling (GO:0007267)|gap junction assembly (GO:0016264)|male genitalia development (GO:0030539)|membrane organization (GO:0061024)|sensory perception of sound (GO:0007605)|transport (GO:0006810)	connexon complex (GO:0005922)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|integral component of membrane (GO:0016021)|lateral plasma membrane (GO:0016328)|plasma membrane (GO:0005886)	gap junction channel activity (GO:0005243)	p.F146L(1)		breast(1)|endometrium(2)|large_intestine(1)|lung(2)|skin(1)	7		all_cancers(29;3.95e-22)|all_epithelial(30;2.36e-19)|all_lung(29;2.27e-18)|Lung SC(185;0.0257)|Ovarian(182;0.0822)		all cancers(112;0.000435)|Epithelial(112;0.000722)|OV - Ovarian serous cystadenocarcinoma(117;0.0096)|Lung(94;0.0236)|LUSC - Lung squamous cell carcinoma(192;0.0738)		AGGCGGCTTCGAAGATGACCC	0.537									Keratitis, Ichthyosis and Deafness syndrome		OREG0022282	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP											1	Substitution - Missense(1)	breast(1)											112.0	100.0	104.0					13																	20763283		2203	4300	6503	-	-	-	SO:0001583	missense	0	Familial Cancer Database	KID syndrome	M86849	CCDS9290.1	13q11-q12	2010-01-06	2007-01-16		ENSG00000165474	ENSG00000165474		"""Ion channels / Gap junction proteins (connexins)"""	4284	protein-coding gene	gene with protein product	"""connexin 26"""	121011	"""gap junction protein, beta 2, 26kD (connexin 26)"", ""gap junction protein, beta 2, 26kDa (connexin 26)"""	DFNB1, DFNA3		9139825	Standard	NM_004004		Approved	CX26, NSRD1	uc001umy.3	P29033	OTTHUMG00000016513	ENST00000382844.1:c.438C>G	13.37:g.20763283G>C	ENSP00000372295:p.Phe146Leu	Somatic	743	WXS	Illumina GAIIx	Phase_IV	Q508A5|Q508A6|Q5YLL0|Q5YLL1|Q5YLL4|Q6IPV5|Q86U88|Q96AK0|Q9H536|Q9NNY4	Missense_Mutation	SNP	pfam_Connexin_N,pfam_Connexin_CCC,smart_Connexin_N,prints_Connexin,prints_Connexin26	p.F146L	ENST00000382844.1	37	c.438	CCDS9290.1	13	.	.	.	.	.	.	.	.	.	.	G	9.689	1.151381	0.21371	.	.	ENSG00000165474	ENST00000382848;ENST00000382844	D;D	0.94417	-3.42;-3.42	5.47	-7.9	0.01169	Gap junction protein, cysteine-rich domain (1);	0.000000	0.85682	D	0.000000	D	0.89406	0.6706	L	0.45470	1.425	0.58432	D	0.999995	P	0.45768	0.866	B	0.41466	0.358	D	0.85462	0.1167	10	0.32370	T	0.25	.	15.7132	0.77646	0.708:0.0:0.292:0.0	.	146	P29033	CXB2_HUMAN	L	146	ENSP00000372299:F146L;ENSP00000372295:F146L	ENSP00000372295:F146L	F	-	3	2	GJB2	19661283	0.294000	0.24380	0.256000	0.24389	0.086000	0.17979	-0.228000	0.09114	-1.615000	0.01573	-0.140000	0.14226	TTC	GJB2	-	pfam_Connexin_CCC,prints_Connexin	ENSG00000165474		0.537	GJB2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	GJB2	HGNC	protein_coding	OTTHUMT00000044064.1	88	0.00	0	G			20763283	20763283	-1	no_errors	ENST00000382844	ensembl	human	known	69_37n	missense	75	21.05	20	SNP	0.647	C
GNPTAB	79158	genome.wustl.edu	37	12	102161847	102161847	+	Missense_Mutation	SNP	G	G	A			TCGA-A1-A0SJ-01A-11D-A099-09	TCGA-A1-A0SJ-10A-02D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a55c6a44-c0f5-4300-8df4-4a70befe2d3b	aaf63cff-b2e2-4f9b-868e-e7a1637cc14b	g.chr12:102161847G>A	ENST00000299314.7	-	11	1638	c.1376C>T	c.(1375-1377)tCa>tTa	p.S459L	GNPTAB_ENST00000549940.1_Missense_Mutation_p.S459L|RNU6-101P_ENST00000410323.1_RNA	NM_024312.4	NP_077288.2	Q3T906	GNPTA_HUMAN	N-acetylglucosamine-1-phosphate transferase, alpha and beta subunits	459					carbohydrate phosphorylation (GO:0046835)|cell differentiation (GO:0030154)|lysosome organization (GO:0007040)|protein secretion (GO:0009306)	Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|UDP-N-acetylglucosamine-lysosomal-enzyme N-acetylglucosaminephosphotransferase activity (GO:0003976)	p.S459L(1)		NS(1)|breast(3)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(8)|lung(8)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	37						ATCGCAGGCTGAATTATTACA	0.413																																						dbGAP											1	Substitution - Missense(1)	breast(1)											98.0	90.0	92.0					12																	102161847		2203	4300	6503	-	-	-	SO:0001583	missense	0			AY687932	CCDS9088.1	12q23.3	2013-01-10				ENSG00000111670		"""EF-hand domain containing"""	29670	protein-coding gene	gene with protein product		607840		GNPTA		10574462, 16116615	Standard	NM_024312		Approved	KIAA1208, MGC4170	uc001tit.3	Q3T906	OTTHUMG00000170444	ENST00000299314.7:c.1376C>T	12.37:g.102161847G>A	ENSP00000299314:p.Ser459Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	A2RRQ9|Q3ZQK2|Q6IPW5|Q86TQ2|Q96N13|Q9ULL2	Missense_Mutation	SNP	pfam_DMAP1-bd,pfam_Notch_dom,pfam_DUF3184,superfamily_Notch_dom,smart_Notch_dom,pfscan_EF_HAND_2,pfscan_Notch_dom	p.S459L	ENST00000299314.7	37	c.1376	CCDS9088.1	12	.	.	.	.	.	.	.	.	.	.	G	22.0	4.228780	0.79576	.	.	ENSG00000111670	ENST00000299314;ENST00000549940	D;D	0.91180	-2.8;-2.8	5.71	4.82	0.62117	Notch domain (4);	0.000000	0.85682	D	0.000000	D	0.93006	0.7774	L	0.42686	1.345	0.80722	D	1	P;D	0.63046	0.741;0.992	B;D	0.72338	0.372;0.977	D	0.93837	0.7133	10	0.87932	D	0	-15.7287	15.1351	0.72558	0.068:0.0:0.932:0.0	.	459;459	Q3T906-2;Q3T906	.;GNPTA_HUMAN	L	459	ENSP00000299314:S459L;ENSP00000449150:S459L	ENSP00000299314:S459L	S	-	2	0	GNPTAB	100685978	1.000000	0.71417	0.637000	0.29366	0.966000	0.64601	9.154000	0.94694	1.561000	0.49584	0.650000	0.86243	TCA	GNPTAB	-	pfam_Notch_dom,superfamily_Notch_dom,smart_Notch_dom,pfscan_Notch_dom	ENSG00000111670		0.413	GNPTAB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GNPTAB	HGNC	protein_coding	OTTHUMT00000409182.1	66	0.00	0	G			102161847	102161847	-1	no_errors	ENST00000299314	ensembl	human	known	69_37n	missense	61	31.46	28	SNP	0.999	A
GRIN2C	2905	genome.wustl.edu	37	17	72846850	72846850	+	Silent	SNP	G	G	A			TCGA-A1-A0SJ-01A-11D-A099-09	TCGA-A1-A0SJ-10A-02D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a55c6a44-c0f5-4300-8df4-4a70befe2d3b	aaf63cff-b2e2-4f9b-868e-e7a1637cc14b	g.chr17:72846850G>A	ENST00000293190.5	-	5	1316	c.1170C>T	c.(1168-1170)taC>taT	p.Y390Y	GRIN2C_ENST00000578159.1_5'Flank|GRIN2C_ENST00000347612.4_Silent_p.Y390Y	NM_000835.3	NP_000826.2	Q14957	NMDE3_HUMAN	glutamate receptor, ionotropic, N-methyl D-aspartate 2C	390					directional locomotion (GO:0033058)|glutamate receptor signaling pathway (GO:0007215)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|negative regulation of protein catabolic process (GO:0042177)|neuromuscular process controlling balance (GO:0050885)|protein localization (GO:0008104)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|response to wounding (GO:0009611)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)	cell junction (GO:0030054)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)	cation channel activity (GO:0005261)|extracellular-glutamate-gated ion channel activity (GO:0005234)|N-methyl-D-aspartate selective glutamate receptor activity (GO:0004972)	p.Y390Y(2)		NS(1)|breast(3)|central_nervous_system(1)|endometrium(2)|large_intestine(6)|lung(15)|ovary(2)|skin(2)|urinary_tract(1)	33	all_lung(278;0.172)|Lung NSC(278;0.207)				Acamprosate(DB00659)|Atomoxetine(DB00289)|Gabapentin(DB00996)|Glycine(DB00145)|Ketobemidone(DB06738)|Milnacipran(DB04896)|Pentobarbital(DB00312)|Pethidine(DB00454)|Phenobarbital(DB01174)|Secobarbital(DB00418)	GAGAGGCACTGTAGCGAGGCC	0.652																																						dbGAP											2	Substitution - coding silent(2)	breast(2)											70.0	50.0	57.0					17																	72846850		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS32724.1, CCDS62330.1	17q25.1	2012-08-29			ENSG00000161509	ENSG00000161509		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4587	protein-coding gene	gene with protein product		138254		NMDAR2C		9480759	Standard	NM_001278553		Approved	GluN2C	uc002jlt.1	Q14957	OTTHUMG00000044524	ENST00000293190.5:c.1170C>T	17.37:g.72846850G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B2RTT1	Silent	SNP	pfam_Iontro_glu_rcpt,pfam_SBP_bac_3,pfam_Glu_rcpt_Glu/Gly-bd,pfam_ANF_lig-bd_rcpt,pfam_NMDAR2_C,smart_Iontro_glu_rcpt,smart_Glu_rcpt_Glu/Gly-bd,prints_NMDA_rcpt	p.Y390	ENST00000293190.5	37	c.1170	CCDS32724.1	17																																																																																			GRIN2C	-	NULL	ENSG00000161509		0.652	GRIN2C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GRIN2C	HGNC	protein_coding	OTTHUMT00000103824.1	20	0.00	0	G			72846850	72846850	-1	no_errors	ENST00000293190	ensembl	human	known	69_37n	silent	23	28.12	9	SNP	1.000	A
HNRNPDL	9987	genome.wustl.edu	37	4	83350497	83350497	+	Missense_Mutation	SNP	C	C	G			TCGA-A1-A0SJ-01A-11D-A099-09	TCGA-A1-A0SJ-10A-02D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a55c6a44-c0f5-4300-8df4-4a70befe2d3b	aaf63cff-b2e2-4f9b-868e-e7a1637cc14b	g.chr4:83350497C>G	ENST00000295470.5	-	1	522	c.347G>C	c.(346-348)aGc>aCc	p.S116T	ENOPH1_ENST00000509635.1_5'Flank|ENOPH1_ENST00000273920.3_5'Flank|HNRNPDL_ENST00000502762.1_Missense_Mutation_p.S116T|HNRNPDL_ENST00000602300.1_5'UTR|HNRNPDL_ENST00000514511.1_5'UTR|HNRNPDL_ENST00000349655.4_5'UTR	NM_001207000.1|NM_031372.3	NP_001193929.1|NP_112740.1	O14979	HNRDL_HUMAN	heterogeneous nuclear ribonucleoprotein D-like	116					regulation of gene expression (GO:0010468)|regulation of transcription, DNA-templated (GO:0006355)|RNA processing (GO:0006396)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)	DNA binding (GO:0003677)|double-stranded DNA binding (GO:0003690)|nucleotide binding (GO:0000166)|poly(A) binding (GO:0008143)|poly(A) RNA binding (GO:0044822)|poly(G) binding (GO:0034046)|single-stranded DNA binding (GO:0003697)	p.S116T(1)									AGTGACGGAGCTGTCGGCAGG	0.587																																						dbGAP											1	Substitution - Missense(1)	breast(1)											75.0	86.0	82.0					4																	83350497		2203	4300	6503	-	-	-	SO:0001583	missense	0			D89092	CCDS3593.1, CCDS75153.1	4q21.22	2013-06-12		2013-06-12	ENSG00000152795	ENSG00000152795		"""RNA binding motif (RRM) containing"""	5037	protein-coding gene	gene with protein product		607137		HNRPDL		10072754, 9524220	Standard	NM_001207000		Approved	JKTBP, laAUF1	uc003hmr.3	O14979	OTTHUMG00000130299	ENST00000295470.5:c.347G>C	4.37:g.83350497C>G	ENSP00000295470:p.Ser116Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6SPF2|Q7KZ74|Q7KZ75|Q96IM0|Q96S43	Missense_Mutation	SNP	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	p.S116T	ENST00000295470.5	37	c.347	CCDS3593.1	4	.	.	.	.	.	.	.	.	.	.	c	11.30	1.598526	0.28445	.	.	ENSG00000152795	ENST00000295470;ENST00000502762	T;T	0.67865	-0.29;-0.29	4.9	-0.342	0.12635	.	0.769305	0.11392	N	0.568652	T	0.45577	0.1349	N	0.25647	0.755	0.32993	D	0.525232	B	0.23377	0.084	B	0.24006	0.05	T	0.44862	-0.9300	10	0.10377	T	0.69	.	6.1985	0.20563	0.1259:0.5643:0.0:0.3098	.	116	O14979	HNRDL_HUMAN	T	116	ENSP00000295470:S116T;ENSP00000422040:S116T	ENSP00000295470:S116T	S	-	2	0	HNRPDL	83569521	0.000000	0.05858	0.264000	0.24511	0.909000	0.53808	-0.518000	0.06267	-0.316000	0.08690	0.484000	0.47621	AGC	HNRPDL	-	NULL	ENSG00000152795		0.587	HNRNPDL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HNRPDL	HGNC	protein_coding	OTTHUMT00000252644.1	14	0.00	0	C	NM_005463		83350497	83350497	-1	no_errors	ENST00000295470	ensembl	human	known	69_37n	missense	48	36.00	27	SNP	0.255	G
IKZF1	10320	genome.wustl.edu	37	7	50468114	50468114	+	Missense_Mutation	SNP	G	G	A			TCGA-A1-A0SJ-01A-11D-A099-09	TCGA-A1-A0SJ-10A-02D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a55c6a44-c0f5-4300-8df4-4a70befe2d3b	aaf63cff-b2e2-4f9b-868e-e7a1637cc14b	g.chr7:50468114G>A	ENST00000331340.3	+	8	1504	c.1349G>A	c.(1348-1350)cGc>cAc	p.R450H	IKZF1_ENST00000346667.4_Missense_Mutation_p.R220H|IKZF1_ENST00000438033.1_Missense_Mutation_p.R363H|IKZF1_ENST00000440768.2_3'UTR|IKZF1_ENST00000349824.4_Missense_Mutation_p.R307H|IKZF1_ENST00000343574.5_Missense_Mutation_p.R363H|IKZF1_ENST00000359197.5_Missense_Mutation_p.R408H|IKZF1_ENST00000439701.1_Missense_Mutation_p.R408H|IKZF1_ENST00000357364.4_Missense_Mutation_p.R363H	NM_001220769.1|NM_001220772.1|NM_001220773.1|NM_001220775.1|NM_006060.4	NP_001207698.1|NP_001207701.1|NP_001207702.1|NP_001207704.1|NP_006051.1	Q13422	IKZF1_HUMAN	IKAROS family zinc finger 1 (Ikaros)	450					B cell differentiation (GO:0030183)|cell cycle (GO:0007049)|chromatin modification (GO:0016568)|forebrain development (GO:0030900)|lymph node development (GO:0048535)|mesoderm development (GO:0007498)|natural killer cell differentiation (GO:0001779)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|Peyer's patch development (GO:0048541)|positive regulation of multicellular organism growth (GO:0040018)|positive regulation of neutrophil differentiation (GO:0045660)|positive regulation of NK T cell differentiation (GO:0051138)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|retina development in camera-type eye (GO:0060041)|T cell differentiation (GO:0030217)|thymus development (GO:0048538)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|pericentric heterochromatin (GO:0005721)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.?(28)|p.R450H(1)		haematopoietic_and_lymphoid_tissue(275)|lung(1)	276	Glioma(55;0.08)|all_neural(89;0.245)	Acute lymphoblastic leukemia(4;7.29e-10)|all_hematologic(4;4.8e-07)				GACGCGCTCCGCGTGGTCAGC	0.662			"""D,T"""	BCL6	"""ALL, DLBCL"""																																	dbGAP		"""Rec,Dom"""	yes		7	7p12.2	10320	IKAROS family zinc finger 1		L	29	Unknown(28)|Substitution - Missense(1)	haematopoietic_and_lymphoid_tissue(28)|breast(1)											28.0	32.0	31.0					7																	50468114		2108	4243	6351	-	-	-	SO:0001583	missense	0			U40462	CCDS59055.1, CCDS69299.1, CCDS75596.1, CCDS75597.1	7p12.2	2014-06-12	2006-08-25	2006-08-25	ENSG00000185811	ENSG00000185811		"""Zinc fingers, C2H2-type"", ""IKAROS zinc fingers"""	13176	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 92"""	603023	"""zinc finger protein, subfamily 1A, 1 (Ikaros)"""	ZNFN1A1		1439790, 7935426	Standard	NM_006060		Approved	hIk-1, LyF-1, Hs.54452, IKAROS, PPP1R92	uc003tow.4	Q13422	OTTHUMG00000155907	ENST00000331340.3:c.1349G>A	7.37:g.50468114G>A	ENSP00000331614:p.Arg450His	Somatic		WXS	Illumina GAIIx	Phase_IV	A4D260|B4E0Z1|D3DVM5|O00598|Q53XL2|Q69BM4|Q8WVA3	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.R450H	ENST00000331340.3	37	c.1349		7	.	.	.	.	.	.	.	.	.	.	G	18.55	3.648279	0.67358	.	.	ENSG00000185811	ENST00000346667;ENST00000343574;ENST00000359197;ENST00000349824;ENST00000357364;ENST00000331340;ENST00000438033;ENST00000439701	D;D;D;D;D;D;D;D	0.96830	-4.14;-4.14;-4.14;-4.14;-4.14;-4.14;-4.14;-4.14	5.74	4.75	0.60458	.	0.047664	0.85682	D	0.000000	D	0.92864	0.7730	.	.	.	0.80722	D	1	D;D;D;D;P	0.58620	0.983;0.975;0.961;0.961;0.884	P;P;P;P;P	0.56474	0.799;0.584;0.708;0.787;0.514	D	0.88983	0.3409	9	0.02654	T	1	-13.6857	3.7774	0.08667	0.3334:0.0:0.6666:0.0	.	363;220;363;408;450	Q13422-2;Q13422-6;Q13422-3;Q13422-7;Q13422	.;.;.;.;IKZF1_HUMAN	H	220;363;408;307;363;450;363;408	ENSP00000340080:R220H;ENSP00000342750:R363H;ENSP00000352123:R408H;ENSP00000342485:R307H;ENSP00000349928:R363H;ENSP00000331614:R450H;ENSP00000396554:R363H;ENSP00000413025:R408H	ENSP00000331614:R450H	R	+	2	0	IKZF1	50435608	1.000000	0.71417	0.902000	0.35471	0.088000	0.18126	5.437000	0.66544	2.706000	0.92434	0.650000	0.86243	CGC	IKZF1	-	NULL	ENSG00000185811		0.662	IKZF1-001	KNOWN	basic|appris_principal	protein_coding	IKZF1	HGNC	protein_coding	OTTHUMT00000342242.1	30	0.00	0	G	NM_006060		50468114	50468114	+1	no_errors	ENST00000331340	ensembl	human	known	69_37n	missense	19	24.00	6	SNP	1.000	A
LRRD1	401387	genome.wustl.edu	37	7	91792659	91792659	+	Nonsense_Mutation	SNP	C	C	A			TCGA-A1-A0SJ-01A-11D-A099-09	TCGA-A1-A0SJ-10A-02D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a55c6a44-c0f5-4300-8df4-4a70befe2d3b	aaf63cff-b2e2-4f9b-868e-e7a1637cc14b	g.chr7:91792659C>A	ENST00000458448.1	-	2	2058	c.1858G>T	c.(1858-1860)Gaa>Taa	p.E620*	LRRD1_ENST00000343318.5_Intron|LRRD1_ENST00000454089.2_5'UTR|LRRD1_ENST00000430130.2_Nonsense_Mutation_p.E620*|CTB-161K23.1_ENST00000453068.1_RNA|LRRD1_ENST00000422722.1_Intron			A4D1F6	LRRD1_HUMAN	leucine-rich repeats and death domain containing 1	620					signal transduction (GO:0007165)			p.E620*(1)		breast(4)|endometrium(1)	5						TGGCACAGTTCAATAGGAAAA	0.363																																						dbGAP											1	Substitution - Nonsense(1)	breast(1)											151.0	117.0	127.0					7																	91792659		692	1591	2283	-	-	-	SO:0001587	stop_gained	0			BC026112	CCDS55124.1	7q21.2	2011-05-23			ENSG00000240720	ENSG00000240720			34300	protein-coding gene	gene with protein product							Standard	NM_001161528		Approved	IMAGE:4798971	uc011khp.1	A4D1F6	OTTHUMG00000155861	ENST00000458448.1:c.1858G>T	7.37:g.91792659C>A	ENSP00000405987:p.Glu620*	Somatic		WXS	Illumina GAIIx	Phase_IV	B7ZMM9|Q49AT9	Nonsense_Mutation	SNP	pfam_Leu-rich_rpt,superfamily_DEATH-like,smart_Leu-rich_rpt_typical-subtyp,pfscan_Death	p.E620*	ENST00000458448.1	37	c.1858	CCDS55124.1	7	.	.	.	.	.	.	.	.	.	.	C	39	7.462249	0.98299	.	.	ENSG00000240720	ENST00000458448;ENST00000430130	.	.	.	5.21	5.21	0.72293	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.40728	T	0.16	.	18.3408	0.90304	0.0:1.0:0.0:0.0	.	.	.	.	X	620	.	ENSP00000411568:E620X	E	-	1	0	LRRD1	91630595	1.000000	0.71417	0.996000	0.52242	0.993000	0.82548	5.275000	0.65575	2.408000	0.81797	0.585000	0.79938	GAA	LRRD1	-	NULL	ENSG00000240720		0.363	LRRD1-002	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	LRRD1	HGNC	protein_coding	OTTHUMT00000342027.2	174	0.00	0	C	NM_001045475		91792659	91792659	-1	no_errors	ENST00000430130	ensembl	human	known	69_37n	nonsense	180	16.67	36	SNP	0.996	A
MCTS1	28985	genome.wustl.edu	37	X	119738713	119738713	+	Intron	SNP	G	G	A			TCGA-A1-A0SJ-01A-11D-A099-09	TCGA-A1-A0SJ-10A-02D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a55c6a44-c0f5-4300-8df4-4a70befe2d3b	aaf63cff-b2e2-4f9b-868e-e7a1637cc14b	g.chrX:119738713G>A	ENST00000371317.5	+	2	268				MCTS1_ENST00000371315.3_Missense_Mutation_p.G2D	NM_014060.2	NP_054779.1	Q9ULC4	MCTS1_HUMAN	malignant T cell amplified sequence 1						cell cycle (GO:0007049)|cellular response to DNA damage stimulus (GO:0006974)|formation of translation preinitiation complex (GO:0001731)|IRES-dependent translational initiation (GO:0002192)|positive regulation of cell proliferation (GO:0008284)|regulation of growth (GO:0040008)|regulation of transcription, DNA-templated (GO:0006355)|ribosome disassembly (GO:0032790)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	translation initiation factor activity (GO:0003743)	p.G2D(1)		breast(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(4)|stomach(1)|urinary_tract(1)	10						GGGAACATGGGCAAAGGAAGG	0.383																																						dbGAP											1	Substitution - Missense(1)	breast(1)											142.0	108.0	118.0					X																	119738713		692	1591	2283	-	-	-	SO:0001627	intron_variant	0			AB034206	CCDS14601.1, CCDS48160.1	Xq24	2008-05-14			ENSG00000232119	ENSG00000232119			23357	protein-coding gene	gene with protein product		300587				9766643	Standard	NM_014060		Approved	MCT-1	uc011mub.2	Q9ULC4	OTTHUMG00000022303	ENST00000371317.5:c.12-549G>A	X.37:g.119738713G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B4DGY2|Q502X6	Missense_Mutation	SNP	pfam_PUA,superfamily_PUA-like_domain,smart_PUA,pirsf_Transl_RNA-bd_prd,pfscan_PUA,tigrfam_Uncharacterised_CHP00451	p.G2D	ENST00000371317.5	37	c.5	CCDS14601.1	X	.	.	.	.	.	.	.	.	.	.	G	11.31	1.602424	0.28534	.	.	ENSG00000232119	ENST00000371315	T	0.51817	0.69	4.66	2.86	0.33363	.	1.201710	0.05868	N	0.624134	T	0.32615	0.0835	.	.	.	0.24173	N	0.995615	B	0.23058	0.079	B	0.26517	0.07	T	0.28332	-1.0047	8	.	.	.	-2.661	5.4275	0.16433	0.2539:0.0:0.7461:0.0	.	2	Q9ULC4-3	.	D	2	ENSP00000360365:G2D	.	G	+	2	0	MCTS1	119622741	1.000000	0.71417	1.000000	0.80357	0.857000	0.48899	1.887000	0.39698	1.038000	0.40049	0.415000	0.27848	GGC	MCTS1	-	NULL	ENSG00000232119		0.383	MCTS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MCTS1	HGNC	protein_coding	OTTHUMT00000058110.1	243	0.41	1	G	NM_014060		119738713	119738713	+1	no_errors	ENST00000371315	ensembl	human	known	69_37n	missense	237	17.87	52	SNP	0.999	A
NFATC4	4776	genome.wustl.edu	37	14	24845882	24845882	+	Silent	SNP	G	G	A			TCGA-A1-A0SJ-01A-11D-A099-09	TCGA-A1-A0SJ-10A-02D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a55c6a44-c0f5-4300-8df4-4a70befe2d3b	aaf63cff-b2e2-4f9b-868e-e7a1637cc14b	g.chr14:24845882G>A	ENST00000250373.4	+	9	2580	c.2439G>A	c.(2437-2439)ccG>ccA	p.P813P	NFATC4_ENST00000413692.2_Silent_p.P876P|NFATC4_ENST00000556759.1_Silent_p.P348P|NFATC4_ENST00000557451.1_Silent_p.P743P|NFATC4_ENST00000555167.1_Silent_p.P348P|NFATC4_ENST00000554344.1_Silent_p.P743P|NFATC4_ENST00000424781.2_Silent_p.P826P|NFATC4_ENST00000553879.1_Silent_p.P743P|NFATC4_ENST00000554661.1_Intron|NFATC4_ENST00000556169.1_Intron|NFATC4_ENST00000554966.1_Intron|NFATC4_ENST00000555453.1_Silent_p.P801P|NFATC4_ENST00000539237.2_Silent_p.P845P|NFATC4_ENST00000554050.1_Intron|NFATC4_ENST00000554473.1_Intron|NFATC4_ENST00000555802.1_Silent_p.P101P|NFATC4_ENST00000554591.1_Intron|NFATC4_ENST00000422617.3_Silent_p.P801P|NFATC4_ENST00000556279.1_Silent_p.P845P|NFATC4_ENST00000553708.1_Silent_p.P813P|NFATC4_ENST00000555393.1_Silent_p.P101P|NFATC4_ENST00000553469.1_Intron|NFATC4_ENST00000557767.1_Intron|NFATC4_ENST00000555590.1_Silent_p.P826P	NM_004554.4	NP_004545.2	Q14934	NFAC4_HUMAN	nuclear factor of activated T-cells, cytoplasmic, calcineurin-dependent 4	813	Pro-rich.				cellular respiration (GO:0045333)|cellular response to lithium ion (GO:0071285)|cellular response to UV (GO:0034644)|heart development (GO:0007507)|inflammatory response (GO:0006954)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|muscle cell development (GO:0055001)|patterning of blood vessels (GO:0001569)|positive regulation of apoptotic process (GO:0043065)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of tumor necrosis factor production (GO:0032760)|regulation of synaptic plasticity (GO:0048167)|smooth muscle cell differentiation (GO:0051145)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intermediate filament cytoskeleton (GO:0045111)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|transcription coactivator activity (GO:0003713)	p.P813P(1)|p.P876P(1)		breast(2)|central_nervous_system(1)|endometrium(1)|kidney(4)|large_intestine(7)|liver(4)|lung(12)|ovary(1)|skin(2)	34				GBM - Glioblastoma multiforme(265;0.018)		CCTTTCGGCCGCCTCCTCTTC	0.627																																						dbGAP											2	Substitution - coding silent(2)	breast(2)											66.0	77.0	73.0					14																	24845882		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			BC053855	CCDS9629.1, CCDS45089.1, CCDS55909.1, CCDS55910.1, CCDS55911.1, CCDS73625.1	14q11.2	2009-11-24			ENSG00000100968	ENSG00000100968		"""Nuclear factor of activated T-cells"""	7778	protein-coding gene	gene with protein product		602699				7749981	Standard	NM_004554		Approved	NFAT3	uc010tok.2	Q14934	OTTHUMG00000029351	ENST00000250373.4:c.2439G>A	14.37:g.24845882G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B4DDG5|B4DY55|B5B2U7|B5B2U8|B5B2U9|B5B2V0|B5B2V1|B5B2V2|B5B2V3|B5B2V4|B5B2V5|B5B2V7|B5B2V8|B5B2V9|B5B2W0|B5B2W1|B5B2W2|B5B2W3|B5B2W4|B5B2W5|B5B2W6|B5B2W7|B5B2W8|B5B2W9|B5B2X0|Q7Z598|Q96H68	Silent	SNP	pfam_RHD,pfam_IPT_TIG_rcpt,superfamily_p53-like_TF_DNA-bd,superfamily_Ig_E-set,smart_IPT_TIG_rcpt,pfscan_RHD,prints_NFAT	p.P876	ENST00000250373.4	37	c.2628	CCDS9629.1	14																																																																																			NFATC4	-	NULL	ENSG00000100968		0.627	NFATC4-001	KNOWN	basic|CCDS	protein_coding	NFATC4	HGNC	protein_coding	OTTHUMT00000073206.6	29	0.00	0	G	NM_004554		24845882	24845882	+1	no_errors	ENST00000413692	ensembl	human	known	69_37n	silent	61	16.44	12	SNP	0.948	A
NLRC5	84166	genome.wustl.edu	37	16	57059665	57059665	+	Silent	SNP	C	C	T			TCGA-A1-A0SJ-01A-11D-A099-09	TCGA-A1-A0SJ-10A-02D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a55c6a44-c0f5-4300-8df4-4a70befe2d3b	aaf63cff-b2e2-4f9b-868e-e7a1637cc14b	g.chr16:57059665C>T	ENST00000262510.6	+	6	1035	c.810C>T	c.(808-810)ttC>ttT	p.F270F	NLRC5_ENST00000539144.1_Silent_p.F270F|NLRC5_ENST00000436936.1_Silent_p.F270F|NLRC5_ENST00000308149.7_Silent_p.F270F	NM_032206.4	NP_115582.4	Q86WI3	NLRC5_HUMAN	NLR family, CARD domain containing 5	270	NACHT. {ECO:0000255|PROSITE- ProRule:PRU00136}.				defense response to virus (GO:0051607)|innate immune response (GO:0045087)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of type I interferon production (GO:0032480)|negative regulation of type I interferon-mediated signaling pathway (GO:0060339)|positive regulation of interferon-gamma-mediated signaling pathway (GO:0060335)|positive regulation of MHC class I biosynthetic process (GO:0045345)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of type I interferon-mediated signaling pathway (GO:0060340)|regulation of kinase activity (GO:0043549)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	ATP binding (GO:0005524)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)	p.F270F(1)		NS(2)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(16)|lung(21)|ovary(8)|prostate(1)|skin(6)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	75		all_neural(199;0.225)				TCACGAGGTTCCTGACACCGT	0.557																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											105.0	111.0	109.0					16																	57059665		2198	4300	6498	-	-	-	SO:0001819	synonymous_variant	0			AF389420	CCDS10773.1	16q13	2008-02-05			ENSG00000140853	ENSG00000140853		"""Nucleotide-binding domain and leucine rich repeat containing"""	29933	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and CARD domain containing 5"", ""NOD-like receptor C5"""	613537				12615073	Standard	NM_032206		Approved	NOD27, CLR16.1, FLJ21709	uc021tiu.1	Q86WI3	OTTHUMG00000133470	ENST00000262510.6:c.810C>T	16.37:g.57059665C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B5MEF1|C9JMD8|Q6P4A6|Q86VM7|Q8NF42|Q8TEE2|Q8TEJ1|Q969L7	Missense_Mutation	SNP	smart_Leu-rich_rpt_RNase_inh_sub-typ	p.P23S	ENST00000262510.6	37	c.67	CCDS10773.1	16	.	.	.	.	.	.	.	.	.	.	C	0.051	-1.251443	0.01469	.	.	ENSG00000140853	ENST00000538805	.	.	.	5.48	-0.333	0.12671	.	.	.	.	.	T	0.20700	0.0498	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.24190	-1.0167	4	.	.	.	.	1.9147	0.03294	0.2247:0.245:0.371:0.1592	.	.	.	.	S	23	.	.	P	+	1	0	NLRC5	55617166	0.000000	0.05858	0.014000	0.15608	0.027000	0.11550	-0.333000	0.07894	0.611000	0.30052	0.561000	0.74099	CCT	NLRC5	-	NULL	ENSG00000140853		0.557	NLRC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NLRC5	HGNC	protein_coding	OTTHUMT00000257346.1	80	0.00	0	C	NM_032206		57059665	57059665	+1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000538805	ensembl	human	putative	69_37n	missense	81	33.06	40	SNP	0.000	T
NOTUM	147111	genome.wustl.edu	37	17	79914949	79914949	+	Splice_Site	SNP	C	C	T			TCGA-A1-A0SJ-01A-11D-A099-09	TCGA-A1-A0SJ-10A-02D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a55c6a44-c0f5-4300-8df4-4a70befe2d3b	aaf63cff-b2e2-4f9b-868e-e7a1637cc14b	g.chr17:79914949C>T	ENST00000409678.3	-	7	1080	c.697G>A	c.(697-699)Gcg>Acg	p.A233T		NM_178493.5	NP_848588.3	Q6P988	NOTUM_HUMAN	notum pectinacetylesterase homolog (Drosophila)	233						extracellular region (GO:0005576)	hydrolase activity (GO:0016787)	p.A167T(1)		breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(8)|ovary(1)|skin(1)|urinary_tract(1)	15	all_neural(118;0.0878)|Ovarian(332;0.12)		BRCA - Breast invasive adenocarcinoma(99;0.0114)|OV - Ovarian serous cystadenocarcinoma(97;0.0382)			GTGCCCCCCGCGCTGCAAGGA	0.701																																						dbGAP											1	Substitution - Missense(1)	breast(1)											30.0	31.0	31.0					17																	79914949		2202	4299	6501	-	-	-	SO:0001630	splice_region_variant	0			BC060882	CCDS32771.2	17q25.3	2008-02-05			ENSG00000185269	ENSG00000185269			27106	protein-coding gene	gene with protein product		609847					Standard	NM_178493		Approved		uc010wvg.2	Q6P988	OTTHUMG00000154416	ENST00000409678.3:c.696-1G>A	17.37:g.79914949C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q8N410|Q8NI82	Missense_Mutation	SNP	pfam_Pec_acetylest	p.A233T	ENST00000409678.3	37	c.697	CCDS32771.2	17	.	.	.	.	.	.	.	.	.	.	C	19.51	3.841170	0.71488	.	.	ENSG00000185269	ENST00000409678;ENST00000425009	.	.	.	4.54	4.54	0.55810	.	0.000000	0.85682	D	0.000000	D	0.85986	0.5825	M	0.92649	3.33	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.90173	0.4237	9	0.87932	D	0	.	17.2663	0.87087	0.0:1.0:0.0:0.0	.	233	Q6P988	NOTUM_HUMAN	T	233	.	ENSP00000387310:A233T	A	-	1	0	NOTUM	77508239	1.000000	0.71417	0.970000	0.41538	0.105000	0.19272	7.249000	0.78278	2.055000	0.61198	0.313000	0.20887	GCG	NOTUM	-	pfam_Pec_acetylest	ENSG00000185269		0.701	NOTUM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NOTUM	HGNC	protein_coding	OTTHUMT00000335123.2	22	0.00	0	C	NM_178493	Missense_Mutation	79914949	79914949	-1	no_errors	ENST00000409678	ensembl	human	known	69_37n	missense	11	70.27	26	SNP	1.000	T
NUP62	23636	genome.wustl.edu	37	19	50412785	50412785	+	Missense_Mutation	SNP	C	C	A			TCGA-A1-A0SJ-01A-11D-A099-09	TCGA-A1-A0SJ-10A-02D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a55c6a44-c0f5-4300-8df4-4a70befe2d3b	aaf63cff-b2e2-4f9b-868e-e7a1637cc14b	g.chr19:50412785C>A	ENST00000596217.1	-	2	2167	c.280G>T	c.(280-282)Gct>Tct	p.A94S	NUP62_ENST00000600583.1_5'Flank|NUP62_ENST00000597029.1_Missense_Mutation_p.A94S|NUP62_ENST00000413454.1_Missense_Mutation_p.A94S|IL4I1_ENST00000595948.1_Intron|NUP62_ENST00000422090.2_Missense_Mutation_p.A94S|CTC-326K19.6_ENST00000451973.1_3'UTR|IL4I1_ENST00000341114.3_Intron|NUP62_ENST00000597723.1_Missense_Mutation_p.A94S|NUP62_ENST00000352066.3_Missense_Mutation_p.A94S			P37198	NUP62_HUMAN	nucleoporin 62kDa	94	15 X 9 AA approximate repeats.|Thr-rich.				carbohydrate metabolic process (GO:0005975)|cell aging (GO:0007569)|cell death (GO:0008219)|cell surface receptor signaling pathway (GO:0007166)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|hormone-mediated signaling pathway (GO:0009755)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of programmed cell death (GO:0043069)|negative regulation of Ras protein signal transduction (GO:0046580)|nucleocytoplasmic transport (GO:0006913)|positive regulation of epidermal growth factor receptor signaling pathway (GO:0045742)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of transcription, DNA-templated (GO:0045893)|protein transport (GO:0015031)|regulation of glucose transport (GO:0010827)|regulation of Ras protein signal transduction (GO:0046578)|regulation of signal transduction (GO:0009966)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|intracellular membrane-bounded organelle (GO:0043231)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nuclear pore (GO:0005643)|nucleocytoplasmic shuttling complex (GO:0031074)|pore complex (GO:0046930)|ribonucleoprotein complex (GO:0030529)	chromatin binding (GO:0003682)|receptor signaling complex scaffold activity (GO:0030159)|SH2 domain binding (GO:0042169)|structural constituent of nuclear pore (GO:0017056)|thyroid hormone receptor binding (GO:0046966)|ubiquitin binding (GO:0043130)	p.A94S(1)		breast(2)|endometrium(1)|kidney(1)|large_intestine(4)|lung(8)|stomach(1)|urinary_tract(2)	19		all_lung(116;1.47e-05)|all_neural(266;0.0459)|Ovarian(192;0.0481)		GBM - Glioblastoma multiforme(134;0.00242)|OV - Ovarian serous cystadenocarcinoma(262;0.0177)		AGCTTTGAAGCACCGATCCCC	0.567																																						dbGAP											1	Substitution - Missense(1)	breast(1)											100.0	101.0	101.0					19																	50412785		2203	4300	6503	-	-	-	SO:0001583	missense	0			X58521	CCDS12788.1	19q13.33	2013-09-20	2002-08-29		ENSG00000213024	ENSG00000213024			8066	protein-coding gene	gene with protein product	"""nuclear pore glycoprotein p62"""	605815	"""nucleoporin 62kD"""			1915414	Standard	NM_016553		Approved	p62, DKFZp547L134, IBSN, SNDI, MGC841, FLJ20822, FLJ43869	uc002pqx.3	P37198	OTTHUMG00000183077	ENST00000596217.1:c.280G>T	19.37:g.50412785C>A	ENSP00000471191:p.Ala94Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KWU5|Q503A4|Q6GTM2|Q96C43|Q9NSL1	Missense_Mutation	SNP	pfam_Nucleoporin_NSP1_C	p.A94S	ENST00000596217.1	37	c.280	CCDS12788.1	19	.	.	.	.	.	.	.	.	.	.	C	5.682	0.310321	0.10733	.	.	ENSG00000213024	ENST00000319225;ENST00000352066;ENST00000422090;ENST00000413454	T;T;T	0.37915	1.17;1.17;1.17	5.2	-2.27	0.06846	Nucleoporin, NSP1-like, C-terminal (1);	0.293927	0.28104	U	0.016589	T	0.15132	0.0365	N	0.11201	0.11	0.09310	N	1	B;B	0.12630	0.006;0.003	B;B	0.08055	0.003;0.002	T	0.08617	-1.0713	10	0.54805	T	0.06	0.2452	5.7557	0.18172	0.0:0.3539:0.1418:0.5043	.	94;94	Q8WYU3;P37198	.;NUP62_HUMAN	S	94	ENSP00000305503:A94S;ENSP00000407331:A94S;ENSP00000387991:A94S	ENSP00000321866:A94S	A	-	1	0	NUP62	55104597	0.000000	0.05858	0.000000	0.03702	0.017000	0.09413	-0.455000	0.06762	-0.492000	0.06687	0.655000	0.94253	GCT	NUP62	-	NULL	ENSG00000213024		0.567	NUP62-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	NUP62	HGNC	protein_coding	OTTHUMT00000464991.1	118	0.00	0	C	NM_153719		50412785	50412785	-1	no_errors	ENST00000352066	ensembl	human	known	69_37n	missense	98	37.97	60	SNP	0.000	A
OFD1	8481	genome.wustl.edu	37	X	13776561	13776561	+	Nonsense_Mutation	SNP	C	C	T			TCGA-A1-A0SJ-01A-11D-A099-09	TCGA-A1-A0SJ-10A-02D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a55c6a44-c0f5-4300-8df4-4a70befe2d3b	aaf63cff-b2e2-4f9b-868e-e7a1637cc14b	g.chrX:13776561C>T	ENST00000340096.6	+	15	1975	c.1648C>T	c.(1648-1650)Cag>Tag	p.Q550*	OFD1_ENST00000490265.1_3'UTR|OFD1_ENST00000380550.3_Nonsense_Mutation_p.Q510*|OFD1_ENST00000380567.1_Nonsense_Mutation_p.Q410*	NM_003611.2	NP_003602.1	O75665	OFD1_HUMAN	oral-facial-digital syndrome 1	550					axoneme assembly (GO:0035082)|cilium morphogenesis (GO:0060271)|embryonic body morphogenesis (GO:0010172)|epithelial cilium movement involved in determination of left/right asymmetry (GO:0060287)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|negative regulation of fibroblast growth factor receptor signaling pathway involved in neural plate anterior/posterior pattern formation (GO:2000314)	centriolar satellite (GO:0034451)|centriole (GO:0005814)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cilium (GO:0005929)|cytosol (GO:0005829)|membrane (GO:0016020)|microtubule cytoskeleton (GO:0015630)|nucleus (GO:0005634)	alpha-tubulin binding (GO:0043014)|gamma-tubulin binding (GO:0043015)	p.Q550*(1)		breast(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(5)|lung(7)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	25						GAAGCAAACTCAGACAGGTTA	0.338																																						dbGAP											1	Substitution - Nonsense(1)	breast(1)											49.0	47.0	48.0					X																	13776561		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			Y15164	CCDS14157.1	Xp22	2014-06-18			ENSG00000046651	ENSG00000046651			2567	protein-coding gene	gene with protein product		300170	"""retinitis pigmentosa 23 (X-linked recessive)"""	CXorf5, RP23		9722947, 9215688, 22619378	Standard	NM_003611		Approved	71-7A, JBTS10	uc004cvp.4	O75665	OTTHUMG00000021159	ENST00000340096.6:c.1648C>T	X.37:g.13776561C>T	ENSP00000344314:p.Gln550*	Somatic		WXS	Illumina GAIIx	Phase_IV	B9ZVU5|O75666|Q4VAK4	Nonsense_Mutation	SNP	superfamily_Lipoprotein_6,smart_LisH_dimerisation,pfscan_LisH_dimerisation	p.Q550*	ENST00000340096.6	37	c.1648	CCDS14157.1	X	.	.	.	.	.	.	.	.	.	.	.	45	11.942288	0.99620	.	.	ENSG00000046651	ENST00000380550;ENST00000340096;ENST00000380567	.	.	.	5.56	5.56	0.83823	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.20519	T	0.43	-13.572	18.7488	0.91806	0.0:1.0:0.0:0.0	.	.	.	.	X	510;550;410	.	ENSP00000344314:Q550X	Q	+	1	0	OFD1	13686482	0.999000	0.42202	0.960000	0.40013	0.628000	0.37860	4.144000	0.58057	2.460000	0.83146	0.600000	0.82982	CAG	OFD1	-	NULL	ENSG00000046651		0.338	OFD1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	OFD1	HGNC	protein_coding	OTTHUMT00000055808.1	154	0.00	0	C	NM_003611		13776561	13776561	+1	no_errors	ENST00000340096	ensembl	human	known	69_37n	nonsense	108	25.52	37	SNP	0.998	T
PPFIBP2	8495	genome.wustl.edu	37	11	7650734	7650734	+	Silent	SNP	G	G	T			TCGA-A1-A0SJ-01A-11D-A099-09	TCGA-A1-A0SJ-10A-02D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a55c6a44-c0f5-4300-8df4-4a70befe2d3b	aaf63cff-b2e2-4f9b-868e-e7a1637cc14b	g.chr11:7650734G>T	ENST00000299492.4	+	10	1321	c.933G>T	c.(931-933)cgG>cgT	p.R311R	PPFIBP2_ENST00000533792.1_Silent_p.R153R|PPFIBP2_ENST00000528883.1_Silent_p.R199R|PPFIBP2_ENST00000530181.1_Silent_p.R168R	NM_003621.3	NP_003612	Q8ND30	LIPB2_HUMAN	PTPRF interacting protein, binding protein 2 (liprin beta 2)	311					cell-matrix adhesion (GO:0007160)|signal transduction (GO:0007165)	extracellular space (GO:0005615)|intracellular (GO:0005622)|presynaptic active zone (GO:0048786)	DNA binding (GO:0003677)|integrase activity (GO:0008907)	p.R311R(1)		breast(8)|cervix(1)|kidney(1)|large_intestine(8)|lung(8)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	32				Epithelial(150;2.01e-07)|BRCA - Breast invasive adenocarcinoma(625;0.236)		ACCAGTACCGGAAGGTAAAGG	0.473																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											139.0	137.0	138.0					11																	7650734		2201	4296	6497	-	-	-	SO:0001819	synonymous_variant	0			AF034803	CCDS31419.1, CCDS58116.1, CCDS58117.1	11p15.4	2013-01-10			ENSG00000166387	ENSG00000166387		"""Sterile alpha motif (SAM) domain containing"""	9250	protein-coding gene	gene with protein product		603142				9624153	Standard	NM_003621		Approved	Cclp1	uc001mfj.5	Q8ND30	OTTHUMG00000165617	ENST00000299492.4:c.933G>T	11.37:g.7650734G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B7Z433|E9PK77|O75337|Q8WW26	Silent	SNP	pfam_SAM_2,pfam_SAM_type1,pfam_Integrase_Tn916-type_DNA-bd_N,superfamily_SAM/pointed,smart_SAM,pfscan_SAM	p.R311	ENST00000299492.4	37	c.933	CCDS31419.1	11																																																																																			PPFIBP2	-	NULL	ENSG00000166387		0.473	PPFIBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPFIBP2	HGNC	protein_coding	OTTHUMT00000385345.2	194	0.00	0	G	NM_003621		7650734	7650734	+1	no_errors	ENST00000299492	ensembl	human	known	69_37n	silent	162	28.32	64	SNP	0.475	T
PSMD11	5717	genome.wustl.edu	37	17	30771560	30771560	+	Missense_Mutation	SNP	G	G	C			TCGA-A1-A0SJ-01A-11D-A099-09	TCGA-A1-A0SJ-10A-02D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a55c6a44-c0f5-4300-8df4-4a70befe2d3b	aaf63cff-b2e2-4f9b-868e-e7a1637cc14b	g.chr17:30771560G>C	ENST00000261712.3	+	1	282	c.19G>C	c.(19-21)Gtg>Ctg	p.V7L	PSMD11_ENST00000457654.2_Missense_Mutation_p.V7L	NM_001270482.1|NM_002815.3	NP_001257411.1|NP_002806.2	O00231	PSD11_HUMAN	proteasome (prosome, macropain) 26S subunit, non-ATPase, 11	7					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|cellular nitrogen compound metabolic process (GO:0034641)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|G1/S transition of mitotic cell cycle (GO:0000082)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|negative regulation of apoptotic process (GO:0043066)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|proteasome assembly (GO:0043248)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|stem cell differentiation (GO:0048863)|ubiquitin-dependent protein catabolic process (GO:0006511)|viral process (GO:0016032)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|proteasome accessory complex (GO:0022624)|proteasome complex (GO:0000502)|proteasome regulatory particle (GO:0005838)		p.V7L(1)		breast(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(7)|ovary(1)|skin(4)|upper_aerodigestive_tract(1)	19		Breast(31;0.159)|Ovarian(249;0.182)	BRCA - Breast invasive adenocarcinoma(9;0.109)			ggcggcggtggtggAGTTCCA	0.711																																					Ovarian(130;1038 1716 9294 11987 19279)	dbGAP											1	Substitution - Missense(1)	breast(1)											21.0	20.0	21.0					17																	30771560		2190	4286	6476	-	-	-	SO:0001583	missense	0			AB003102	CCDS11272.1	17q12	2008-05-22			ENSG00000108671	ENSG00000108671		"""Proteasome (prosome, macropain) subunits"""	9556	protein-coding gene	gene with protein product		604449				9426256, 9119060	Standard	NM_001270482		Approved	S9, p44.5, MGC3844, Rpn6	uc010cta.2	O00231	OTTHUMG00000132811	ENST00000261712.3:c.19G>C	17.37:g.30771560G>C	ENSP00000261712:p.Val7Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K3I7|E1P663|O00495|Q53FT5	Missense_Mutation	SNP	pfam_PCI_dom,smart_PAM,smart_PCI_dom	p.V7L	ENST00000261712.3	37	c.19	CCDS11272.1	17	.	.	.	.	.	.	.	.	.	.	G	13.02	2.112951	0.37242	.	.	ENSG00000108671	ENST00000261712	.	.	.	4.95	4.95	0.65309	.	0.276929	0.30771	N	0.008912	T	0.29458	0.0734	N	0.08118	0	0.45733	D	0.998638	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.0	T	0.11616	-1.0580	9	0.25751	T	0.34	3.3866	9.4951	0.38984	0.0943:0.0:0.9057:0.0	.	7;7	B4DTS5;O00231	.;PSD11_HUMAN	L	7	.	ENSP00000261712:V7L	V	+	1	0	PSMD11	27795673	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.703000	0.54808	2.750000	0.94351	0.558000	0.71614	GTG	PSMD11	-	NULL	ENSG00000108671		0.711	PSMD11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PSMD11	HGNC	protein_coding	OTTHUMT00000256252.2	32	0.00	0	G	NM_002815		30771560	30771560	+1	no_errors	ENST00000261712	ensembl	human	known	69_37n	missense	19	40.62	13	SNP	1.000	C
RANBP6	26953	genome.wustl.edu	37	9	6012961	6012961	+	Missense_Mutation	SNP	T	T	C			TCGA-A1-A0SJ-01A-11D-A099-09	TCGA-A1-A0SJ-10A-02D-A099-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a55c6a44-c0f5-4300-8df4-4a70befe2d3b	aaf63cff-b2e2-4f9b-868e-e7a1637cc14b	g.chr9:6012961T>C	ENST00000259569.5	-	1	2657	c.2647A>G	c.(2647-2649)Agt>Ggt	p.S883G	RANBP6_ENST00000485372.1_5'Flank	NM_001243202.1|NM_001243203.1|NM_012416.3	NP_001230131.1|NP_001230132.1|NP_036548.1	O60518	RNBP6_HUMAN	RAN binding protein 6	883					protein transport (GO:0015031)	cytoplasm (GO:0005737)|nucleus (GO:0005634)		p.S883G(1)		NS(1)|breast(4)|central_nervous_system(1)|endometrium(8)|kidney(5)|large_intestine(8)|lung(9)|ovary(7)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	51		Acute lymphoblastic leukemia(23;0.158)		GBM - Glioblastoma multiforme(50;0.00522)|Lung(218;0.101)		CATGGCCTACTTGAACAAATT	0.338																																						dbGAP											1	Substitution - Missense(1)	breast(1)											66.0	67.0	67.0					9																	6012961		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF039023	CCDS6467.1	9p24.1	2008-03-26			ENSG00000137040	ENSG00000137040			9851	protein-coding gene	gene with protein product							Standard	NM_001243202		Approved		uc003zjr.3	O60518	OTTHUMG00000019512	ENST00000259569.5:c.2647A>G	9.37:g.6012961T>C	ENSP00000259569:p.Ser883Gly	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5T7X4|Q7Z3V2|Q96E78	Missense_Mutation	SNP	pfam_HEAT,superfamily_ARM-type_fold	p.S883G	ENST00000259569.5	37	c.2647	CCDS6467.1	9	.	.	.	.	.	.	.	.	.	.	T	6.598	0.478782	0.12521	.	.	ENSG00000137040	ENST00000259569	T	0.68479	-0.33	4.37	3.21	0.36854	Armadillo-like helical (1);Armadillo-type fold (1);	0.545284	0.20250	N	0.096103	T	0.44456	0.1294	N	0.12746	0.255	0.30495	N	0.770979	B;B;B	0.06786	0.0;0.001;0.001	B;B;B	0.06405	0.002;0.001;0.001	T	0.39078	-0.9631	10	0.29301	T	0.29	-2.5979	8.805	0.34932	0.0:0.0:0.3751:0.6249	.	50;471;883	B4E340;B4DTX6;O60518	.;.;RNBP6_HUMAN	G	883	ENSP00000259569:S883G	ENSP00000259569:S883G	S	-	1	0	RANBP6	6002961	1.000000	0.71417	0.990000	0.47175	0.995000	0.86356	3.201000	0.51059	0.986000	0.38683	0.477000	0.44152	AGT	RANBP6	-	superfamily_ARM-type_fold	ENSG00000137040		0.338	RANBP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RANBP6	HGNC	protein_coding	OTTHUMT00000051650.1	84	0.00	0	T	NM_012416		6012961	6012961	-1	no_errors	ENST00000259569	ensembl	human	known	69_37n	missense	40	58.33	56	SNP	0.932	C
SCN4A	6329	genome.wustl.edu	37	17	62022840	62022840	+	Missense_Mutation	SNP	G	G	C			TCGA-A1-A0SJ-01A-11D-A099-09	TCGA-A1-A0SJ-10A-02D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a55c6a44-c0f5-4300-8df4-4a70befe2d3b	aaf63cff-b2e2-4f9b-868e-e7a1637cc14b	g.chr17:62022840G>C	ENST00000435607.1	-	19	3676	c.3600C>G	c.(3598-3600)atC>atG	p.I1200M	SCN4A_ENST00000578147.1_Missense_Mutation_p.I1200M	NM_000334.4	NP_000325.4	P35499	SCN4A_HUMAN	sodium channel, voltage-gated, type IV, alpha subunit	1200					membrane depolarization during action potential (GO:0086010)|muscle contraction (GO:0006936)|neuronal action potential (GO:0019228)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)	p.I1200M(1)		breast(4)|central_nervous_system(3)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(23)|lung(40)|ovary(3)|pancreas(1)|prostate(6)|skin(4)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	101					Diclofenac(DB00586)|Flecainide(DB01195)|Propofol(DB00818)|Valproic Acid(DB00313)|Zonisamide(DB00909)	TGACCTCGGAGATGTCGAACC	0.542																																						dbGAP											1	Substitution - Missense(1)	breast(1)											254.0	255.0	255.0					17																	62022840		2198	4298	6496	-	-	-	SO:0001583	missense	0			U24693		17q23.3	2012-02-26	2007-01-23					"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10591	protein-coding gene	gene with protein product		603967		HYKPP		1654742, 1659948, 16382098	Standard	XM_005257566		Approved	Nav1.4, HYPP, SkM1	uc002jds.1	P35499		ENST00000435607.1:c.3600C>G	17.37:g.62022840G>C	ENSP00000396320:p.Ile1200Met	Somatic		WXS	Illumina GAIIx	Phase_IV	Q15478|Q16447|Q7Z6B1	Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_Na_trans_assoc,pfam_PKD1_2_channel,prints_Na_channel_a4su,prints_Na_channel_asu,prints_PKD_2,pfscan_IQ_motif_EF-hand-BS	p.I1200M	ENST00000435607.1	37	c.3600	CCDS45761.1	17	.	.	.	.	.	.	.	.	.	.	G	9.280	1.047826	0.19827	.	.	ENSG00000007314	ENST00000435607	D	0.96619	-4.07	3.76	-0.751	0.11076	Ion transport (1);	0.422280	0.27327	N	0.019880	D	0.95214	0.8448	M	0.76002	2.32	0.25080	N	0.990937	B	0.32324	0.364	P	0.44732	0.459	D	0.90136	0.4210	10	0.48119	T	0.1	.	3.8276	0.08861	0.083:0.1406:0.4866:0.2898	.	1200	P35499	SCN4A_HUMAN	M	1200	ENSP00000396320:I1200M	ENSP00000396320:I1200M	I	-	3	3	SCN4A	59376572	0.910000	0.30920	0.465000	0.27155	0.899000	0.52679	1.281000	0.33214	-0.176000	0.10707	-1.157000	0.01802	ATC	SCN4A	-	pfam_Ion_trans_dom	ENSG00000007314		0.542	SCN4A-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SCN4A	HGNC	protein_coding		109	0.00	0	G	NM_000334		62022840	62022840	-1	no_errors	ENST00000435607	ensembl	human	known	69_37n	missense	674	28.37	267	SNP	0.255	C
SNAI1	6615	genome.wustl.edu	37	20	48604526	48604526	+	Missense_Mutation	SNP	G	G	A			TCGA-A1-A0SJ-01A-11D-A099-09	TCGA-A1-A0SJ-10A-02D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a55c6a44-c0f5-4300-8df4-4a70befe2d3b	aaf63cff-b2e2-4f9b-868e-e7a1637cc14b	g.chr20:48604526G>A	ENST00000244050.2	+	3	789	c.728G>A	c.(727-729)cGg>cAg	p.R243Q		NM_005985.3	NP_005976.2	O95863	SNAI1_HUMAN	snail family zinc finger 1	243	Required for nuclear localization and interaction with KPNB1, NOTCH1 and PARP1.				cartilage morphogenesis (GO:0060536)|cell migration (GO:0016477)|epithelial to mesenchymal transition (GO:0001837)|hair follicle morphogenesis (GO:0031069)|left/right pattern formation (GO:0060972)|mesoderm formation (GO:0001707)|negative regulation of cell differentiation involved in embryonic placenta development (GO:0060806)|negative regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043518)|negative regulation of intrinsic apoptotic signaling pathway in response to DNA damage (GO:1902230)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of vitamin D biosynthetic process (GO:0010957)|Notch signaling involved in heart development (GO:0061314)|osteoblast differentiation (GO:0001649)|palate development (GO:0060021)|positive regulation of cell migration (GO:0030335)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of tight junction assembly (GO:2000810)|trophoblast giant cell differentiation (GO:0060707)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	kinase binding (GO:0019900)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)	p.R243Q(1)		breast(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(10)|ovary(2)	17			BRCA - Breast invasive adenocarcinoma(9;4.03e-06)			GCGTGTGCTCGGACCTTCTCC	0.632																																						dbGAP											1	Substitution - Missense(1)	breast(1)											140.0	116.0	124.0					20																	48604526		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF125377	CCDS13423.1	20q13.2	2013-05-23	2013-05-23		ENSG00000124216	ENSG00000124216		"""Snail homologs"", ""Zinc fingers, C2H2-type"""	11128	protein-coding gene	gene with protein product		604238	"""snail 1 (drosophila homolog), zinc finger protein"", ""snail homolog 1 (Drosophila)"""			10585766	Standard	NM_005985		Approved	SNA, SLUGH2, SNAH, SNAIL1, SNAIL	uc002xuz.3	O95863	OTTHUMG00000033048	ENST00000244050.2:c.728G>A	20.37:g.48604526G>A	ENSP00000244050:p.Arg243Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R842|Q9P113|Q9UBP7|Q9UHH7	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.R243Q	ENST00000244050.2	37	c.728	CCDS13423.1	20	.	.	.	.	.	.	.	.	.	.	G	20.7	4.042134	0.75732	.	.	ENSG00000124216	ENST00000244050	T	0.18960	2.18	4.97	4.97	0.65823	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.85682	D	0.000000	T	0.31009	0.0783	N	0.16130	0.375	0.45541	D	0.998499	D	0.76494	0.999	D	0.68353	0.957	T	0.31943	-0.9925	10	0.87932	D	0	-26.6192	18.6122	0.91290	0.0:0.0:1.0:0.0	.	243	O95863	SNAI1_HUMAN	Q	243	ENSP00000244050:R243Q	ENSP00000244050:R243Q	R	+	2	0	SNAI1	48037933	0.940000	0.31905	0.032000	0.17829	0.703000	0.40648	4.250000	0.58772	2.467000	0.83353	0.462000	0.41574	CGG	SNAI1	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000124216		0.632	SNAI1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SNAI1	HGNC	protein_coding	OTTHUMT00000080350.1	94	0.00	0	G			48604526	48604526	+1	no_errors	ENST00000244050	ensembl	human	known	69_37n	missense	167	30.71	74	SNP	0.963	A
SPEN	23013	genome.wustl.edu	37	1	16258909	16258915	+	Frame_Shift_Del	DEL	CCCTGTT	CCCTGTT	-	rs373073371		TCGA-A1-A0SJ-01A-11D-A099-09	TCGA-A1-A0SJ-10A-02D-A099-09	CCCTGTT	CCCTGTT					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a55c6a44-c0f5-4300-8df4-4a70befe2d3b	aaf63cff-b2e2-4f9b-868e-e7a1637cc14b	g.chr1:16258909_16258915delCCCTGTT	ENST00000375759.3	+	11	6378_6384	c.6174_6180delCCCTGTT	c.(6172-6180)gcccctgttfs	p.APV2058fs		NM_015001.2	NP_055816.2	Q96T58	MINT_HUMAN	spen family transcriptional repressor	2058					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|Notch signaling pathway (GO:0007219)|positive regulation of neurogenesis (GO:0050769)|positive regulation of transcription, DNA-templated (GO:0045893)|viral process (GO:0016032)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription factor binding transcription factor activity involved in negative regulation of transcription (GO:0001191)|sequence-specific DNA binding transcription factor activity (GO:0003700)|single-stranded DNA binding (GO:0003697)|transcription corepressor activity (GO:0003714)	p.P2059fs*3(1)		NS(1)|breast(13)|central_nervous_system(3)|cervix(5)|endometrium(16)|kidney(18)|large_intestine(27)|liver(2)|lung(37)|ovary(7)|prostate(7)|skin(7)|upper_aerodigestive_tract(5)|urinary_tract(1)	149		Colorectal(325;0.000258)|Breast(348;0.000278)|Lung NSC(340;0.000419)|Renal(390;0.000518)|all_lung(284;0.000567)|Ovarian(437;0.0129)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0185)|Colorectal(212;5.96e-07)|COAD - Colon adenocarcinoma(227;3.11e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000115)|Kidney(64;0.000212)|KIRC - Kidney renal clear cell carcinoma(64;0.003)|STAD - Stomach adenocarcinoma(313;0.013)|READ - Rectum adenocarcinoma(331;0.0681)		CTGAAACCGCCCCTGTTGAAGTTGTAG	0.493																																						dbGAP											1	Deletion - Frameshift(1)	breast(1)																																								-	-	-	SO:0001589	frameshift_variant	0				CCDS164.1	1p36	2013-10-17	2013-10-17		ENSG00000065526	ENSG00000065526		"""RNA binding motif (RRM) containing"""	17575	protein-coding gene	gene with protein product		613484	"""SPEN homolog, transcriptional regulator (Drosophila)"", ""spen homolog, transcriptional regulator (Drosophila)"""			10451362, 11331609	Standard	NM_015001		Approved	KIAA0929, MINT, SHARP, RBM15C	uc001axk.1	Q96T58	OTTHUMG00000009376	ENST00000375759.3:c.6174_6180delCCCTGTT	1.37:g.16258909_16258915delCCCTGTT	ENSP00000364912:p.Ala2058fs	Somatic		WXS	Illumina GAIIx	Phase_IV	Q9H9A8|Q9NWH5|Q9UQ01|Q9Y556	Frame_Shift_Del	DEL	pfam_RRM_dom,pfam_SPOC_C,superfamily_SPOC-like,smart_RRM_dom,pfscan_SPOC_met,pfscan_RRM_dom	p.P2059fs	ENST00000375759.3	37	c.6174_6180	CCDS164.1	1																																																																																			SPEN	-	NULL	ENSG00000065526		0.493	SPEN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPEN	HGNC	protein_coding	OTTHUMT00000025993.1	135	0.00	0	CCCTGTT	NM_015001		16258909	16258915	+1	no_errors	ENST00000375759	ensembl	human	known	69_37n	frame_shift_del	39	17.65	9	DEL	0.005:0.012:0.131:0.122:0.233:0.299:0.561	-
NELFCD	51497	genome.wustl.edu	37	20	57566094	57566094	+	Missense_Mutation	SNP	G	G	C			TCGA-A1-A0SJ-01A-11D-A099-09	TCGA-A1-A0SJ-10A-02D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a55c6a44-c0f5-4300-8df4-4a70befe2d3b	aaf63cff-b2e2-4f9b-868e-e7a1637cc14b	g.chr20:57566094G>C	ENST00000344018.3	+	8	972	c.945G>C	c.(943-945)aaG>aaC	p.K315N	NELFCD_ENST00000602795.1_Missense_Mutation_p.K324N			Q8IXH7	NELFD_HUMAN	negative elongation factor complex member C/D	315					gene expression (GO:0010467)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of viral transcription (GO:0050434)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|viral process (GO:0016032)	membrane (GO:0016020)|NELF complex (GO:0032021)|nucleoplasm (GO:0005654)		p.K315N(1)									TCCTGTTCAAGATGTTCACAA	0.557																																						dbGAP											1	Substitution - Missense(1)	breast(1)											93.0	84.0	87.0					20																	57566094		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF161479	CCDS13473.1, CCDS13473.2	20q13	2013-01-31	2013-01-31	2013-01-31	ENSG00000101158	ENSG00000101158			15934	protein-coding gene	gene with protein product	"""trihydrophobin 1"""	605297	"""TH1-like (Drosophila homolog)"", ""TH1-like (Drosophila)"""	TH1L		11030415, 11042152	Standard	NM_198976		Approved	HSPC130, TH1, NELF-C, NELF-D	uc002yag.4	Q8IXH7	OTTHUMG00000032861	ENST00000344018.3:c.945G>C	20.37:g.57566094G>C	ENSP00000342300:p.Lys315Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DE06|Q9BYL2|Q9H405|Q9H888|Q9H8T3|Q9NVX5|Q9P029|Q9UGN1|Q9UGN2|Q9UGN3	Missense_Mutation	SNP	pfam_TH1	p.K315N	ENST00000344018.3	37	c.945		20	.	.	.	.	.	.	.	.	.	.	G	16.93	3.257090	0.59321	.	.	ENSG00000101158	ENST00000344018	.	.	.	6.07	5.12	0.69794	.	0.042982	0.85682	D	0.000000	T	0.63414	0.2509	L	0.39085	1.19	0.58432	D	0.999998	D;D	0.69078	0.997;0.991	D;D	0.80764	0.994;0.991	T	0.60919	-0.7167	9	0.44086	T	0.13	-40.8249	9.3088	0.37891	0.1555:0.0:0.8445:0.0	.	324;315	E1P5H4;Q8IXH7	.;NELFD_HUMAN	N	315	.	ENSP00000342300:K315N	K	+	3	2	TH1L	56999489	1.000000	0.71417	1.000000	0.80357	0.912000	0.54170	5.344000	0.65981	2.885000	0.99019	0.650000	0.86243	AAG	TH1L	-	pfam_TH1	ENSG00000101158		0.557	NELFCD-201	KNOWN	basic|appris_principal	protein_coding	TH1L	HGNC	protein_coding		83	0.00	0	G	NM_198976		57566094	57566094	+1	no_errors	ENST00000344018	ensembl	human	known	69_37n	missense	147	15.52	27	SNP	1.000	C
TRBV6-8	28599	genome.wustl.edu	37	7	142124196	142124196	+	RNA	SNP	G	G	A			TCGA-A1-A0SJ-01A-11D-A099-09	TCGA-A1-A0SJ-10A-02D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a55c6a44-c0f5-4300-8df4-4a70befe2d3b	aaf63cff-b2e2-4f9b-868e-e7a1637cc14b	g.chr7:142124196G>A	ENST00000390376.2	-	0	281									T cell receptor beta variable 6-8																		ACACCAGCCTGAGTGGGAAAT	0.507																																						dbGAP											0													203.0	211.0	209.0					7																	142124196		1958	4139	6097	-	-	-			0			L36092		7q34	2012-02-07			ENSG00000253534	ENSG00000253534		"""T cell receptors / TRB locus"""	12233	other	T cell receptor gene						8650574	Standard	NG_001333		Approved	TRBV68, TCRBV13S7P, TCRBV6S8			OTTHUMG00000158916		7.37:g.142124196G>A		Somatic		WXS	Illumina GAIIx	Phase_IV		Silent	SNP	pfam_Ig_V-set,smart_Ig_V-set_subgr,pfscan_Ig-like	p.L94	ENST00000390376.2	37	c.282		7																																																																																			TRBV6-8	-	pfam_Ig_V-set,smart_Ig_V-set_subgr,pfscan_Ig-like	ENSG00000253534		0.507	TRBV6-8-001	KNOWN	mRNA_end_NF|cds_end_NF|basic|appris_principal	TR_V_gene	TRBV6-8	HGNC	TR_V_gene	OTTHUMT00000352531.2	150	0.00	0	G	NG_001333		142124196	142124196	-1	no_stop_codon:bad_bp_length_for_coding_region	ENST00000390376	ensembl	human	known	69_37n	silent	176	21.08	47	SNP	0.183	A
UBAP1L	390595	genome.wustl.edu	37	15	65385553	65385553	+	Missense_Mutation	SNP	C	C	T	rs573485318		TCGA-A1-A0SJ-01A-11D-A099-09	TCGA-A1-A0SJ-10A-02D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a55c6a44-c0f5-4300-8df4-4a70befe2d3b	aaf63cff-b2e2-4f9b-868e-e7a1637cc14b	g.chr15:65385553C>T	ENST00000559089.1	-	6	1248	c.1028G>A	c.(1027-1029)cGc>cAc	p.R343H	UBAP1L_ENST00000502113.2_Missense_Mutation_p.R343H			F5GYI3	UBA1L_HUMAN	ubiquitin associated protein 1-like	343								p.R343H(2)		breast(1)|endometrium(1)|kidney(1)	3						CTCCCAGAGGCGCAGGAACTC	0.657																																						dbGAP											2	Substitution - Missense(2)	breast(2)											30.0	35.0	33.0					15																	65385553		691	1590	2281	-	-	-	SO:0001583	missense	0				CCDS53948.1	15q22.31	2011-08-15			ENSG00000246922	ENSG00000246922			40028	protein-coding gene	gene with protein product							Standard	NM_001163692		Approved		uc010uit.2	F5GYI3		ENST00000559089.1:c.1028G>A	15.37:g.65385553C>T	ENSP00000454012:p.Arg343His	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	superfamily_UBA-like	p.R343H	ENST00000559089.1	37	c.1028	CCDS53948.1	15	.	.	.	.	.	.	.	.	.	.	C	6.482	0.457018	0.12283	.	.	ENSG00000246922	ENST00000502113	.	.	.	5.22	1.8	0.24995	.	.	.	.	.	T	0.12987	0.0315	N	0.01874	-0.695	0.21499	N	0.999662	B	0.28667	0.219	B	0.22386	0.039	T	0.24621	-1.0155	8	0.21540	T	0.41	.	8.9628	0.35858	0.0:0.6331:0.0:0.3669	.	343	F5GYI3	UBA1L_HUMAN	H	343	.	ENSP00000440243:R343H	R	-	2	0	AC013553.1	63172606	0.245000	0.23899	0.997000	0.53966	0.557000	0.35523	0.191000	0.17076	0.596000	0.29794	-0.379000	0.06801	CGC	UBAP1L	-	superfamily_UBA-like	ENSG00000246922		0.657	UBAP1L-002	NOVEL	basic|appris_principal|CCDS	protein_coding	UBAP1L	HGNC	protein_coding	OTTHUMT00000418469.1	37	0.00	0	C	NM_001163692		65385553	65385553	-1	no_errors	ENST00000502113	ensembl	human	known	69_37n	missense	21	30.00	9	SNP	0.477	T
ZBTB11	27107	genome.wustl.edu	37	3	101378855	101378855	+	Missense_Mutation	SNP	A	A	C			TCGA-A1-A0SJ-01A-11D-A099-09	TCGA-A1-A0SJ-10A-02D-A099-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a55c6a44-c0f5-4300-8df4-4a70befe2d3b	aaf63cff-b2e2-4f9b-868e-e7a1637cc14b	g.chr3:101378855A>C	ENST00000312938.4	-	6	2398	c.1818T>G	c.(1816-1818)ttT>ttG	p.F606L	Y_RNA_ENST00000364251.1_RNA	NM_014415.3	NP_055230.2	O95625	ZBT11_HUMAN	zinc finger and BTB domain containing 11	606					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.F606L(1)		breast(1)|endometrium(6)|kidney(2)|large_intestine(7)|lung(14)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	37						CACTGTACTGAAACTGTTTTT	0.353																																						dbGAP											1	Substitution - Missense(1)	breast(1)											81.0	78.0	79.0					3																	101378855		2203	4300	6503	-	-	-	SO:0001583	missense	0			U69274	CCDS2943.1	3q12.3	2013-01-09			ENSG00000066422	ENSG00000066422		"""-"", ""BTB/POZ domain containing"", ""Zinc fingers, C2H2-type"""	16740	protein-coding gene	gene with protein product							Standard	NM_014415		Approved	ZNF-U69274, ZNF913	uc003dve.4	O95625	OTTHUMG00000159133	ENST00000312938.4:c.1818T>G	3.37:g.101378855A>C	ENSP00000326200:p.Phe606Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q2NKP9	Missense_Mutation	SNP	pfam_BTB_POZ,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_Znf_C2H2-like,pfscan_BTB/POZ-like,pfscan_Znf_C2H2	p.F606L	ENST00000312938.4	37	c.1818	CCDS2943.1	3	.	.	.	.	.	.	.	.	.	.	A	23.4	4.409601	0.83340	.	.	ENSG00000066422	ENST00000312938	D	0.85861	-2.04	5.94	2.3	0.28687	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.85682	D	0.000000	D	0.92665	0.7669	M	0.92649	3.33	0.80722	D	1	D	0.76494	0.999	D	0.83275	0.996	D	0.91021	0.4857	10	0.87932	D	0	-20.0377	8.5409	0.33393	0.5646:0.0:0.4354:0.0	.	606	O95625	ZBT11_HUMAN	L	606	ENSP00000326200:F606L	ENSP00000326200:F606L	F	-	3	2	ZBTB11	102861545	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	2.397000	0.44477	0.166000	0.19597	0.397000	0.26171	TTT	ZBTB11	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000066422		0.353	ZBTB11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZBTB11	HGNC	protein_coding	OTTHUMT00000353441.2	135	0.00	0	A	NM_014415		101378855	101378855	-1	no_errors	ENST00000312938	ensembl	human	known	69_37n	missense	82	42.66	61	SNP	1.000	C
ZNF543	125919	genome.wustl.edu	37	19	57839971	57839971	+	Missense_Mutation	SNP	G	G	A			TCGA-A1-A0SJ-01A-11D-A099-09	TCGA-A1-A0SJ-10A-02D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a55c6a44-c0f5-4300-8df4-4a70befe2d3b	aaf63cff-b2e2-4f9b-868e-e7a1637cc14b	g.chr19:57839971G>A	ENST00000321545.4	+	4	1486	c.1141G>A	c.(1141-1143)Gac>Aac	p.D381N		NM_213598.3	NP_998763.2	Q08ER8	ZN543_HUMAN	zinc finger protein 543	381					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.D381N(1)		breast(1)|kidney(2)|large_intestine(8)|lung(11)|pancreas(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)	28		Colorectal(82;0.000256)|all_neural(62;0.0577)|Ovarian(87;0.221)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0257)		CGAGAGTGCAGACCTCATTCA	0.502																																						dbGAP											1	Substitution - Missense(1)	breast(1)											85.0	73.0	77.0					19																	57839971		2203	4300	6503	-	-	-	SO:0001583	missense	0			AL834534	CCDS33130.1	19q13.43	2013-01-08				ENSG00000178229		"""Zinc fingers, C2H2-type"", ""-"""	25281	protein-coding gene	gene with protein product							Standard	NM_213598		Approved	DKFZp434H055	uc002qoi.2	Q08ER8		ENST00000321545.4:c.1141G>A	19.37:g.57839971G>A	ENSP00000322545:p.Asp381Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	Q495U9|Q495V0|Q6ZMP4|Q8NCX4	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.D381N	ENST00000321545.4	37	c.1141	CCDS33130.1	19	.	.	.	.	.	.	.	.	.	.	G	3.305	-0.141950	0.06669	.	.	ENSG00000178229	ENST00000321545	T	0.14144	2.53	3.14	-1.65	0.08291	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.03871	0.0109	N	0.00760	-1.21	0.09310	N	1	P	0.42409	0.779	B	0.43680	0.427	T	0.20907	-1.0261	9	0.31617	T	0.26	.	2.74	0.05251	0.3922:0.0:0.2626:0.3452	.	381	Q08ER8	ZN543_HUMAN	N	381	ENSP00000322545:D381N	ENSP00000322545:D381N	D	+	1	0	ZNF543	62531783	0.000000	0.05858	0.000000	0.03702	0.649000	0.38597	-1.974000	0.01499	-0.108000	0.12066	0.561000	0.74099	GAC	ZNF543	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000178229		0.502	ZNF543-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF543	HGNC	protein_coding	OTTHUMT00000465780.1	127	0.00	0	G	XM_064865		57839971	57839971	+1	no_errors	ENST00000321545	ensembl	human	known	69_37n	missense	101	12.93	15	SNP	0.000	A
