#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
ZNF721	170960	genome.wustl.edu	37	4	420664	420664	+	3'UTR	SNP	G	G	T	rs1053401	byFrequency	TCGA-A1-A0SK-01A-12D-A099-09	TCGA-A1-A0SK-10A-03D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d1b43161-cbc1-4bf6-b8bb-a72a2e5e1150	2a5384f3-fec7-4265-b104-987f0718574b	g.chr4:420664G>T	ENST00000506646.1	-	0	848				ABCA11P_ENST00000451020.2_RNA			Q8TF20	ZN721_HUMAN	zinc finger protein 721						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(2)|kidney(2)|large_intestine(15)|lung(6)|ovary(1)|skin(1)|stomach(5)|urinary_tract(1)	33						ATCTTCTTCAGGCTCTTCTGG	0.423													G|||	874	0.174521	0.3495	0.0865	5008	,	,		19242	0.1151		0.1064	False		,,,				2504	0.1319					dbGAP											0																																										-	-	-	SO:0001624	3_prime_UTR_variant	0			AK092362	CCDS46991.1	4p16.3	2013-01-08			ENSG00000182903	ENSG00000182903		"""Zinc fingers, C2H2-type"", ""-"""	29425	protein-coding gene	gene with protein product						11853319	Standard	NM_133474		Approved	KIAA1982	uc003gag.4	Q8TF20		ENST00000506646.1:c.*291C>A	4.37:g.420664G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q69YG7	RNA	SNP	-	NULL	ENST00000506646.1	37	NULL		4																																																																																			ABCA11P	-	-	ENSG00000251595		0.423	ZNF721-003	PUTATIVE	basic	protein_coding	ABCA11P	HGNC	protein_coding	OTTHUMT00000357869.2	254	0.00	0	G	NM_133474		420664	420664	-1	no_errors	ENST00000451020	ensembl	human	known	69_37n	rna	453	11.18	57	SNP	0.979	T
ACBD5	91452	genome.wustl.edu	37	10	27520705	27520705	+	Missense_Mutation	SNP	A	A	C			TCGA-A1-A0SK-01A-12D-A099-09	TCGA-A1-A0SK-10A-03D-A099-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d1b43161-cbc1-4bf6-b8bb-a72a2e5e1150	2a5384f3-fec7-4265-b104-987f0718574b	g.chr10:27520705A>C	ENST00000375888.1	-	3	405	c.341T>G	c.(340-342)aTg>aGg	p.M114R	ACBD5_ENST00000375901.1_Missense_Mutation_p.M7R|RNU7-12P_ENST00000516030.1_RNA|ACBD5_ENST00000375897.3_Missense_Mutation_p.M7R|ACBD5_ENST00000476758.1_5'UTR|ACBD5_ENST00000375905.4_Missense_Mutation_p.M81R|ACBD5_ENST00000396271.3_Missense_Mutation_p.M116R			Q5T8D3	ACBD5_HUMAN	acyl-CoA binding domain containing 5	114	ACB. {ECO:0000255|PROSITE- ProRule:PRU00573}.				peroxisome degradation (GO:0030242)|transport (GO:0006810)	integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nucleus (GO:0005634)|peroxisome (GO:0005777)	fatty-acyl-CoA binding (GO:0000062)|lipid binding (GO:0008289)			breast(1)|endometrium(1)|large_intestine(3)|lung(7)|prostate(1)	13						ATATGCAATCATGGCTTCCTC	0.338																																						dbGAP											0													181.0	164.0	170.0					10																	27520705		2203	4299	6502	-	-	-	SO:0001583	missense	0			AF505653	CCDS7154.1, CCDS44368.1, CCDS73079.1	10p12.1	2010-04-30	2010-04-30		ENSG00000107897	ENSG00000107897			23338	protein-coding gene	gene with protein product			"""acyl-Coenzyme A binding domain containing 5"""			12056414	Standard	NR_024150		Approved	DKFZp434A2417, KIAA1996	uc010qdp.2	Q5T8D3	OTTHUMG00000017854	ENST00000375888.1:c.341T>G	10.37:g.27520705A>C	ENSP00000365049:p.Met114Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KQ56|D3DRW0|Q5T8D4|Q5T8E1|Q5T8E2|Q86UV1|Q8N6E3|Q9UFB5	Missense_Mutation	SNP	pfam_Acyl-CoA-binding_protein,superfamily_Acyl-CoA-binding_protein,pirsf_M-assoc_diazepam-bd-inh,prints_Acyl-CoA-binding_protein	p.M114R	ENST00000375888.1	37	c.341		10	.	.	.	.	.	.	.	.	.	.	A	24.0	4.477331	0.84640	.	.	ENSG00000107897	ENST00000375889;ENST00000396271;ENST00000375905;ENST00000375901;ENST00000375897;ENST00000375888;ENST00000426079;ENST00000412279	T;T;T;T;T;T;T	0.70164	1.88;1.88;-0.46;-0.23;1.88;1.88;1.88	5.66	5.66	0.87406	.	0.073442	0.85682	D	0.000000	T	0.81327	0.4799	M	0.75615	2.305	0.58432	D	0.999994	D;D;D	0.89917	1.0;0.999;1.0	D;D;D	0.80764	0.988;0.994;0.989	T	0.82434	-0.0459	10	0.51188	T	0.08	-15.1415	15.898	0.79350	1.0:0.0:0.0:0.0	.	116;7;114	Q5T8D3-3;B7Z2A7;B7Z2R7	.;.;.	R	111;116;81;7;7;114;123;81	ENSP00000379568:M116R;ENSP00000365070:M81R;ENSP00000365066:M7R;ENSP00000365062:M7R;ENSP00000365049:M114R;ENSP00000401591:M123R;ENSP00000393398:M81R	ENSP00000365049:M114R	M	-	2	0	ACBD5	27560711	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.984000	0.93482	2.150000	0.67090	0.528000	0.53228	ATG	ACBD5	-	pfam_Acyl-CoA-binding_protein,superfamily_Acyl-CoA-binding_protein,pirsf_M-assoc_diazepam-bd-inh,prints_Acyl-CoA-binding_protein	ENSG00000107897		0.338	ACBD5-005	KNOWN	basic	protein_coding	ACBD5	HGNC	protein_coding	OTTHUMT00000047314.1	509	0.00	0	A	NM_145698		27520705	27520705	-1	no_errors	ENST00000375888	ensembl	human	known	69_37n	missense	59	50.83	61	SNP	1.000	C
AHNAK	79026	genome.wustl.edu	37	11	62297801	62297801	+	Missense_Mutation	SNP	T	T	C			TCGA-A1-A0SK-01A-12D-A099-09	TCGA-A1-A0SK-10A-03D-A099-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d1b43161-cbc1-4bf6-b8bb-a72a2e5e1150	2a5384f3-fec7-4265-b104-987f0718574b	g.chr11:62297801T>C	ENST00000378024.4	-	5	4362	c.4088A>G	c.(4087-4089)aAa>aGa	p.K1363R	AHNAK_ENST00000530124.1_Intron|AHNAK_ENST00000257247.7_Intron	NM_001620.1	NP_001611.1	Q09666	AHNK_HUMAN	AHNAK nucleoprotein	1363					protein oligomerization (GO:0051259)|regulation of RNA splicing (GO:0043484)|regulation of voltage-gated calcium channel activity (GO:1901385)	actin cytoskeleton (GO:0015629)|cell-cell contact zone (GO:0044291)|costamere (GO:0043034)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|vesicle (GO:0031982)	poly(A) RNA binding (GO:0044822)|S100 protein binding (GO:0044548)|structural molecule activity conferring elasticity (GO:0097493)			NS(3)|autonomic_ganglia(1)|breast(10)|central_nervous_system(5)|endometrium(17)|haematopoietic_and_lymphoid_tissue(2)|kidney(33)|large_intestine(40)|liver(1)|lung(108)|ovary(13)|pancreas(4)|prostate(5)|skin(16)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(6)	268		Melanoma(852;0.155)				AATGTCAACTTTGGGCCCTTT	0.478																																						dbGAP											0													264.0	259.0	260.0					11																	62297801		2202	4299	6501	-	-	-	SO:0001583	missense	0			M80899	CCDS31584.1, CCDS44625.1	11q12-q13	2008-02-05	2007-03-30		ENSG00000124942	ENSG00000124942			347	protein-coding gene	gene with protein product	"""desmoyokin"""	103390	"""AHNAK nucleoprotein (desmoyokin)"""			7987395, 12153988	Standard	NM_024060		Approved	MGC5395	uc001ntl.3	Q09666	OTTHUMG00000167558	ENST00000378024.4:c.4088A>G	11.37:g.62297801T>C	ENSP00000367263:p.Lys1363Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	A1A586	Missense_Mutation	SNP	superfamily_PDZ,smart_PDZ,pfscan_PDZ	p.K1363R	ENST00000378024.4	37	c.4088	CCDS31584.1	11	.	.	.	.	.	.	.	.	.	.	t	10.76	1.440619	0.25900	.	.	ENSG00000124942	ENST00000378024	T	0.27557	1.66	4.66	4.66	0.58398	.	.	.	.	.	T	0.57607	0.2065	M	0.86028	2.79	0.27330	N	0.9568	D	0.67145	0.996	D	0.77557	0.99	T	0.54735	-0.8249	9	0.23891	T	0.37	.	14.0989	0.65042	0.0:0.0:0.0:1.0	.	1363	Q09666	AHNK_HUMAN	R	1363	ENSP00000367263:K1363R	ENSP00000367263:K1363R	K	-	2	0	AHNAK	62054377	0.773000	0.28580	0.827000	0.32855	0.600000	0.36913	3.288000	0.51739	1.873000	0.54277	0.524000	0.50904	AAA	AHNAK	-	NULL	ENSG00000124942		0.478	AHNAK-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	AHNAK	HGNC	protein_coding	OTTHUMT00000395572.1	680	0.00	0	T	NM_024060		62297801	62297801	-1	no_errors	ENST00000378024	ensembl	human	known	69_37n	missense	477	39.24	308	SNP	1.000	C
ALMS1P	200420	genome.wustl.edu	37	2	73898264	73898264	+	RNA	SNP	G	G	C			TCGA-A1-A0SK-01A-12D-A099-09	TCGA-A1-A0SK-10A-03D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d1b43161-cbc1-4bf6-b8bb-a72a2e5e1150	2a5384f3-fec7-4265-b104-987f0718574b	g.chr2:73898264G>C	ENST00000450720.1	+	0	294					NR_003683.2		Q96L16	ALM1L_HUMAN	Alstrom syndrome 1 pseudogene						endosomal transport (GO:0016197)|regulation of stress fiber assembly (GO:0051492)												TGTTAAACAAGGGCACACAAG	0.358																																						dbGAP											0																																										-	-	-			0			BC014492		2p13.2	2008-01-31	2008-01-31	2008-01-31	ENSG00000163016	ENSG00000163016			29586	pseudogene	pseudogene			"""Alstrom syndrome 1-like"""	ALMS1L		12477932	Standard	NR_003683		Approved		uc010yrl.2	Q96L16	OTTHUMG00000152773		2.37:g.73898264G>C		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000450720.1	37	NULL		2																																																																																			ALMS1P	-	-	ENSG00000163016		0.358	ALMS1P-002	KNOWN	basic	processed_transcript	ALMS1P	HGNC	pseudogene	OTTHUMT00000339824.1	246	0.00	0	G	NR_003683		73898264	73898264	+1	no_errors	ENST00000450720	ensembl	human	known	69_37n	rna	131	36.71	76	SNP	0.924	C
ANKRD36B	57730	genome.wustl.edu	37	2	98165911	98165911	+	RNA	SNP	T	T	C	rs1839230|rs112877086	byFrequency	TCGA-A1-A0SK-01A-12D-A099-09	TCGA-A1-A0SK-10A-03D-A099-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d1b43161-cbc1-4bf6-b8bb-a72a2e5e1150	2a5384f3-fec7-4265-b104-987f0718574b	g.chr2:98165911T>C	ENST00000443455.1	-	0	1558							Q8N2N9	AN36B_HUMAN	ankyrin repeat domain 36B																		ATCCTTTTTTTCTCTGGCTAT	0.308													.|||	980	0.195687	0.5703	0.1239	5008	,	,		38822	0.0069		0.1004	False		,,,				2504	0.0327					dbGAP											0													45.0	18.0	26.0					2																	98165911		1759	3782	5541	-	-	-			0			AK024934	CCDS74543.1	2q11.2	2013-01-11	2008-03-25	2008-03-25	ENSG00000196912	ENSG00000196912		"""Ankyrin repeat domain containing"""	29333	protein-coding gene	gene with protein product	"""melanoma-associated antigen"", ""CLL-associated antigen KW-1"""		"""KIAA1641"""	KIAA1641		10997877	Standard	NM_025190		Approved	FLJ21281	uc010yvc.1	Q8N2N9	OTTHUMG00000130547		2.37:g.98165911T>C		Somatic		WXS	Illumina GAIIx	Phase_IV	Q08AK5|Q6IPR0|Q6PI49|Q8IZM7|Q8TDH6|Q96N30|Q9H759	RNA	SNP	-	NULL	ENST00000443455.1	37	NULL		2																																																																																			ANKRD36B	-	-	ENSG00000196912		0.308	ANKRD36B-003	KNOWN	basic	processed_transcript	ANKRD36B	HGNC	pseudogene	OTTHUMT00000328967.2	123	0.00	0	T	NM_025190		98165911	98165911	-1	no_errors	ENST00000443455	ensembl	human	known	69_37n	rna	258	24.71	85	SNP	0.003	C
ANKRD42	338699	genome.wustl.edu	37	11	82938872	82938872	+	Missense_Mutation	SNP	A	A	T			TCGA-A1-A0SK-01A-12D-A099-09	TCGA-A1-A0SK-10A-03D-A099-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d1b43161-cbc1-4bf6-b8bb-a72a2e5e1150	2a5384f3-fec7-4265-b104-987f0718574b	g.chr11:82938872A>T	ENST00000393392.2	+	7	949	c.787A>T	c.(787-789)Att>Ttt	p.I263F	ANKRD42_ENST00000533342.1_Missense_Mutation_p.I291F|ANKRD42_ENST00000260047.6_Missense_Mutation_p.I290F|ANKRD42_ENST00000531895.1_Missense_Mutation_p.I291F	NM_182603.2	NP_872409.2	Q8N9B4	ANR42_HUMAN	ankyrin repeat domain 42	263					positive regulation of cytokine production involved in inflammatory response (GO:1900017)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)	nucleus (GO:0005634)				central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(6)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	18						AGTAATCAATATTAATGAGCG	0.368																																						dbGAP											0													144.0	131.0	136.0					11																	82938872		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK095193	CCDS8265.1, CCDS73355.1, CCDS73356.1	11q14.1	2014-06-12			ENSG00000137494	ENSG00000137494		"""Ankyrin repeat domain containing"""	26752	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 79"""						Standard	XM_005273971		Approved	FLJ37874, SARP, PPP1R79	uc001ozz.1	Q8N9B4	OTTHUMG00000167075	ENST00000393392.2:c.787A>T	11.37:g.82938872A>T	ENSP00000377051:p.Ile263Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	Q49A49	Missense_Mutation	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,prints_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	p.I263F	ENST00000393392.2	37	c.787	CCDS8265.1	11	.	.	.	.	.	.	.	.	.	.	A	15.88	2.964833	0.53507	.	.	ENSG00000137494	ENST00000260047;ENST00000531895;ENST00000393392;ENST00000533342;ENST00000342658;ENST00000531815	T;T;T;T;T	0.67698	-0.28;-0.28;-0.28;-0.28;0.4	5.2	1.29	0.21616	Ankyrin repeat-containing domain (4);	0.411994	0.22550	N	0.058620	T	0.52980	0.1768	L	0.56124	1.755	0.36259	D	0.854397	B;B;B;B	0.30542	0.176;0.284;0.107;0.024	B;B;B;B	0.32342	0.144;0.144;0.144;0.056	T	0.44711	-0.9310	9	.	.	.	0.047	2.0064	0.03478	0.5762:0.1414:0.0912:0.1912	.	291;555;382;263	E9PIL2;A1DRY3;A1XPJ0;Q8N9B4	.;.;.;ANR42_HUMAN	F	290;291;263;291;31;16	ENSP00000260047:I290F;ENSP00000434666:I291F;ENSP00000377051:I263F;ENSP00000435790:I291F;ENSP00000435197:I16F	.	I	+	1	0	ANKRD42	82616520	0.999000	0.42202	0.987000	0.45799	0.989000	0.77384	0.750000	0.26334	-0.062000	0.13088	0.459000	0.35465	ATT	ANKRD42	-	superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	ENSG00000137494		0.368	ANKRD42-001	KNOWN	basic|CCDS	protein_coding	ANKRD42	HGNC	protein_coding	OTTHUMT00000392934.1	260	0.00	0	A	NM_182603		82938872	82938872	+1	no_errors	ENST00000393392	ensembl	human	known	69_37n	missense	122	20.26	31	SNP	0.999	T
ARHGAP42	143872	genome.wustl.edu	37	11	100845328	100845328	+	Missense_Mutation	SNP	C	C	T			TCGA-A1-A0SK-01A-12D-A099-09	TCGA-A1-A0SK-10A-03D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d1b43161-cbc1-4bf6-b8bb-a72a2e5e1150	2a5384f3-fec7-4265-b104-987f0718574b	g.chr11:100845328C>T	ENST00000298815.8	+	19	1852	c.1849C>T	c.(1849-1851)Cct>Tct	p.P617S	ARHGAP42_ENST00000524892.2_Missense_Mutation_p.P583S	NM_152432.2	NP_689645.2	A6NI28	RHG42_HUMAN	Rho GTPase activating protein 42	617					signal transduction (GO:0007165)	intracellular (GO:0005622)	GTPase activator activity (GO:0005096)			endometrium(3)|skin(2)	5						CCTGGCCGAACCTGATAGTAA	0.483																																						dbGAP											0													54.0	51.0	52.0					11																	100845328		692	1591	2283	-	-	-	SO:0001583	missense	0					11q22.1	2012-04-19			ENSG00000165895	ENSG00000165895		"""Rho GTPase activating proteins"""	26545	protein-coding gene	gene with protein product		615936				18954304	Standard	NM_152432		Approved	FLJ32810, GRAF3	uc001pge.2	A6NI28	OTTHUMG00000167530	ENST00000298815.8:c.1849C>T	11.37:g.100845328C>T	ENSP00000298815:p.Pro617Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	Q96M56	Missense_Mutation	SNP	pfam_RhoGAP_dom,pfam_SH3_domain,superfamily_Rho_GTPase_activation_prot,superfamily_SH3_domain,smart_Pleckstrin_homology,smart_RhoGAP_dom,smart_SH3_domain,pfscan_Pleckstrin_homology,pfscan_SH3_domain,pfscan_RhoGAP_dom	p.P617S	ENST00000298815.8	37	c.1849		11	.	.	.	.	.	.	.	.	.	.	C	4.441	0.081627	0.08533	.	.	ENSG00000165895	ENST00000524892;ENST00000298815	T;T	0.07021	3.23;3.31	6.17	6.17	0.99709	.	0.477998	0.21363	N	0.075770	T	0.08403	0.0209	L	0.29908	0.895	0.80722	D	1	B	0.34372	0.451	B	0.30179	0.112	T	0.41875	-0.9484	10	0.17832	T	0.49	.	20.8794	0.99867	0.0:1.0:0.0:0.0	.	617	A6NI28	RHG42_HUMAN	S	583;617	ENSP00000431776:P583S;ENSP00000298815:P617S	ENSP00000298815:P617S	P	+	1	0	ARHGAP42	100350538	1.000000	0.71417	0.512000	0.27736	0.048000	0.14542	5.677000	0.68142	2.941000	0.99782	0.655000	0.94253	CCT	ARHGAP42	-	NULL	ENSG00000165895		0.483	ARHGAP42-201	KNOWN	basic|appris_principal	protein_coding	ARHGAP42	HGNC	protein_coding		242	0.00	0	C	NM_152432		100845328	100845328	+1	no_errors	ENST00000298815	ensembl	human	known	69_37n	missense	134	12.42	19	SNP	0.998	T
ARL11	115761	genome.wustl.edu	37	13	50204651	50204651	+	Missense_Mutation	SNP	C	C	T			TCGA-A1-A0SK-01A-12D-A099-09	TCGA-A1-A0SK-10A-03D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d1b43161-cbc1-4bf6-b8bb-a72a2e5e1150	2a5384f3-fec7-4265-b104-987f0718574b	g.chr13:50204651C>T	ENST00000282026.1	+	2	403	c.68C>T	c.(67-69)gCg>gTg	p.A23V	ARL11_ENST00000490932.1_Intron	NM_138450.5	NP_612459.1	Q969Q4	ARL11_HUMAN	ADP-ribosylation factor-like 11	23					hematopoietic progenitor cell differentiation (GO:0002244)|small GTPase mediated signal transduction (GO:0007264)	intracellular (GO:0005622)	GTP binding (GO:0005525)			kidney(1)|large_intestine(4)|ovary(1)	6		Lung NSC(96;2.1e-05)|Breast(56;0.00015)|Prostate(109;0.00174)|Hepatocellular(98;0.0207)|Myeloproliferative disorder(33;0.163)|Lung SC(185;0.187)|all_neural(104;0.19)	KIRC - Kidney renal clear cell carcinoma(9;0.119)|Kidney(9;0.169)	GBM - Glioblastoma multiforme(99;1.67e-09)		CTGGACTCGGCGGGCAAGACC	0.597																																						dbGAP											0													69.0	71.0	70.0					13																	50204651		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF441378	CCDS9419.1	13q14.12	2014-05-09			ENSG00000152213	ENSG00000152213		"""ADP-ribosylation factors-like"", ""ADP-ribosylation factors"""	24046	protein-coding gene	gene with protein product		609351				12477932	Standard	NM_138450		Approved	ARLTS1, FLJ33930	uc001vdf.2	Q969Q4	OTTHUMG00000016919	ENST00000282026.1:c.68C>T	13.37:g.50204651C>T	ENSP00000282026:p.Ala23Val	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Small_GTPase_ARF/SAR,pfam_SRP_receptor_beta_su,pfam_Small_GTPase,pfam_Gtr1_RagA,pfam_MIRO-like,smart_Small_GTPase_SAR1,smart_Small_GTPase_ARF,prints_Small_GTPase_ARF/SAR,tigrfam_Small_GTP-bd_dom	p.A23V	ENST00000282026.1	37	c.68	CCDS9419.1	13	.	.	.	.	.	.	.	.	.	.	C	21.6	4.174342	0.78452	.	.	ENSG00000152213	ENST00000282026	T	0.74002	-0.8	5.09	5.09	0.68999	Small GTP-binding protein domain (1);	0.122243	0.53938	D	0.000044	D	0.89760	0.6808	M	0.93808	3.46	0.80722	D	1	D	0.89917	1.0	D	0.78314	0.991	D	0.92533	0.6035	10	0.87932	D	0	0.3082	17.4868	0.87691	0.0:1.0:0.0:0.0	.	23	Q969Q4	ARL11_HUMAN	V	23	ENSP00000282026:A23V	ENSP00000282026:A23V	A	+	2	0	ARL11	49102652	1.000000	0.71417	0.066000	0.19879	0.319000	0.28217	5.791000	0.69045	2.368000	0.80403	0.655000	0.94253	GCG	ARL11	-	pfam_Small_GTPase_ARF/SAR,pfam_SRP_receptor_beta_su,pfam_Small_GTPase,pfam_Gtr1_RagA,pfam_MIRO-like,smart_Small_GTPase_SAR1,smart_Small_GTPase_ARF,prints_Small_GTPase_ARF/SAR,tigrfam_Small_GTP-bd_dom	ENSG00000152213		0.597	ARL11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARL11	HGNC	protein_coding	OTTHUMT00000044929.2	83	0.00	0	C	NM_138450		50204651	50204651	+1	no_errors	ENST00000282026	ensembl	human	known	69_37n	missense	14	86.36	95	SNP	0.995	T
ASB10	136371	genome.wustl.edu	37	7	150878405	150878405	+	Missense_Mutation	SNP	T	T	C			TCGA-A1-A0SK-01A-12D-A099-09	TCGA-A1-A0SK-10A-03D-A099-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d1b43161-cbc1-4bf6-b8bb-a72a2e5e1150	2a5384f3-fec7-4265-b104-987f0718574b	g.chr7:150878405T>C	ENST00000420175.2	-	3	749	c.725A>G	c.(724-726)gAt>gGt	p.D242G	ASB10_ENST00000275838.1_Missense_Mutation_p.D242G|ASB10_ENST00000377867.3_Missense_Mutation_p.D227G|ASB10_ENST00000422024.1_Missense_Mutation_p.D287G|ASB10_ENST00000434669.1_Missense_Mutation_p.D287G			Q8WXI3	ASB10_HUMAN	ankyrin repeat and SOCS box containing 10	242					intracellular signal transduction (GO:0035556)|protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)|nucleus (GO:0005634)				NS(1)|endometrium(2)|lung(7)|skin(2)	12			OV - Ovarian serous cystadenocarcinoma(82;0.00448)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)		ATTGCGGGCATCAGGACATGC	0.662																																						dbGAP											0													35.0	35.0	35.0					7																	150878405		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK055536	CCDS5921.2, CCDS47749.1, CCDS47750.1, CCDS47749.2, CCDS47750.2	7q35	2014-02-04	2011-01-25		ENSG00000146926	ENSG00000146926		"""Ankyrin repeat domain containing"""	17185	protein-coding gene	gene with protein product		615054	"""ankyrin repeat and SOCS box-containing 10"", ""glaucoma 1, open angle, F (adult-onset)"""	GLC1F		22156576	Standard	NM_080871		Approved		uc003wjm.1	Q8WXI3	OTTHUMG00000157013	ENST00000420175.2:c.725A>G	7.37:g.150878405T>C	ENSP00000391137:p.Asp242Gly	Somatic		WXS	Illumina GAIIx	Phase_IV	A0AVH0|Q6ZUL6	Missense_Mutation	SNP	pfam_Ankyrin_rpt,pfam_SOCS_C,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,smart_SOCS_C,prints_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_SOCS_C	p.D287G	ENST00000420175.2	37	c.860	CCDS47750.2	7	.	.	.	.	.	.	.	.	.	.	T	16.38	3.108179	0.56291	.	.	ENSG00000146926	ENST00000275838;ENST00000377867;ENST00000422024;ENST00000434669;ENST00000420175	T;T;T;T;T	0.67523	-0.27;-0.27;-0.27;-0.27;-0.27	5.24	5.24	0.73138	Ankyrin repeat-containing domain (3);	0.416320	0.27906	N	0.017370	T	0.68869	0.3048	M	0.79258	2.445	0.34553	D	0.711581	B;B;B	0.15141	0.004;0.002;0.012	B;B;B	0.17722	0.019;0.009;0.019	T	0.75808	-0.3187	10	0.72032	D	0.01	-0.3782	14.611	0.68517	0.0:0.0:0.0:1.0	.	227;242;287	Q8WXI3-3;Q8WXI3;D5MNW9	.;ASB10_HUMAN;.	G	242;227;287;287;242	ENSP00000275838:D242G;ENSP00000367098:D227G;ENSP00000401369:D287G;ENSP00000398247:D287G;ENSP00000391137:D242G	ENSP00000275838:D242G	D	-	2	0	ASB10	150509338	0.973000	0.33851	0.394000	0.26270	0.900000	0.52787	7.733000	0.84916	2.107000	0.64212	0.533000	0.62120	GAT	ASB10	-	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	ENSG00000146926		0.662	ASB10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ASB10	HGNC	protein_coding	OTTHUMT00000347096.3	81	0.00	0	T	NM_080871		150878405	150878405	-1	no_errors	ENST00000422024	ensembl	human	known	69_37n	missense	32	20.00	8	SNP	0.663	C
ASMTL	8623	genome.wustl.edu	37	X	1531838	1531838	+	Intron	SNP	A	A	G			TCGA-A1-A0SK-01A-12D-A099-09	TCGA-A1-A0SK-10A-03D-A099-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d1b43161-cbc1-4bf6-b8bb-a72a2e5e1150	2a5384f3-fec7-4265-b104-987f0718574b	g.chrX:1531838A>G	ENST00000381317.3	-	12	1555				ASMTL-AS1_ENST00000425740.2_RNA|ASMTL-AS1_ENST00000420411.2_RNA|ASMTL-AS1_ENST00000419737.2_RNA|ASMTL_ENST00000381333.4_Intron|ASMTL_ENST00000534940.1_Intron|ASMTL_ENST00000416733.2_Intron|ASMTL-AS1_ENST00000602357.1_RNA	NM_004192.3	NP_004183.2	O95671	ASML_HUMAN	acetylserotonin O-methyltransferase-like							cytoplasm (GO:0005737)	O-methyltransferase activity (GO:0008171)			NS(1)|breast(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(1)|lung(9)|pancreas(1)|soft_tissue(1)	23		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)				CGCATCCTAAATCAGGGACAG	0.537													a|||	2047	0.408746	0.4365	0.415	5008	,	,		16440	0.372		0.4205	False		,,,				2504	0.3926					dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			Y15521	CCDS43917.1, CCDS55362.1, CCDS55363.1	Xp22.3 and Yp11.3	2008-02-05			ENSG00000169093	ENSG00000169093		"""Pseudoautosomal regions / PAR1"""	751	protein-coding gene	gene with protein product		300162, 400011				9736779	Standard	NM_004192		Approved		uc004cpx.2	O95671	OTTHUMG00000021057	ENST00000381317.3:c.1523-91T>C	X.37:g.1531838A>G		Somatic		WXS	Illumina GAIIx	Phase_IV	B4DX75|F5GXH4|J3JS33|Q5JQ53|Q8NBH5|Q96G02|Q9BUL6	RNA	SNP	-	NULL	ENST00000381317.3	37	NULL	CCDS43917.1	X																																																																																			ASMTL-AS1	-	-	ENSG00000236017		0.537	ASMTL-005	KNOWN	basic|appris_principal|CCDS	protein_coding	ASMTL-AS1	HGNC	protein_coding	OTTHUMT00000055595.1	43	0.00	0	A	NM_004192		1531838	1531838	+1	no_errors	ENST00000420411	ensembl	human	known	69_37n	rna	176	12.87	26	SNP	0.000	G
ATG2A	23130	genome.wustl.edu	37	11	64673972	64673972	+	Missense_Mutation	SNP	A	A	C			TCGA-A1-A0SK-01A-12D-A099-09	TCGA-A1-A0SK-10A-03D-A099-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d1b43161-cbc1-4bf6-b8bb-a72a2e5e1150	2a5384f3-fec7-4265-b104-987f0718574b	g.chr11:64673972A>C	ENST00000377264.3	-	21	3129	c.3017T>G	c.(3016-3018)cTg>cGg	p.L1006R	ATG2A_ENST00000421419.2_Missense_Mutation_p.L1006R	NM_015104.2	NP_055919.2	Q2TAZ0	ATG2A_HUMAN	autophagy related 2A	1006					autophagic vacuole assembly (GO:0000045)|cellular response to nitrogen starvation (GO:0006995)|mitochondrion degradation (GO:0000422)|nucleophagy (GO:0044804)	extrinsic component of membrane (GO:0019898)|lipid particle (GO:0005811)|pre-autophagosomal structure (GO:0000407)				breast(3)|central_nervous_system(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(19)|ovary(3)|prostate(5)|skin(1)|stomach(1)|urinary_tract(3)	55						GGGAAGGTCCAGGTGACTGGG	0.687																																						dbGAP											0													35.0	41.0	39.0					11																	64673972		2201	4297	6498	-	-	-	SO:0001583	missense	0				CCDS31602.1	11q13.1	2014-02-12	2012-06-06		ENSG00000110046	ENSG00000110046			29028	protein-coding gene	gene with protein product			"""ATG2 autophagy related 2 homolog A (S. cerevisiae)"""			21887408	Standard	NM_015104		Approved	KIAA0404	uc001obx.3	Q2TAZ0	OTTHUMG00000066831	ENST00000377264.3:c.3017T>G	11.37:g.64673972A>C	ENSP00000366475:p.Leu1006Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	O43154|Q14DM2|Q6ZTV2|Q7Z6K8|Q8IVY5|Q8TAI8|Q96HH7	Missense_Mutation	SNP	pfam_Autophagy-rel_C	p.L1006R	ENST00000377264.3	37	c.3017	CCDS31602.1	11	.	.	.	.	.	.	.	.	.	.	A	21.5	4.160243	0.78226	.	.	ENSG00000110046	ENST00000421419;ENST00000377264	T;T	0.08984	3.03;3.03	5.15	5.15	0.70609	.	0.000000	0.64402	D	0.000011	T	0.26846	0.0657	M	0.70275	2.135	0.53005	D	0.999967	D	0.89917	1.0	D	0.76071	0.987	T	0.00728	-1.1591	10	0.51188	T	0.08	.	13.2326	0.59951	1.0:0.0:0.0:0.0	.	1006	Q2TAZ0	ATG2A_HUMAN	R	1006	ENSP00000410522:L1006R;ENSP00000366475:L1006R	ENSP00000366475:L1006R	L	-	2	0	ATG2A	64430548	1.000000	0.71417	0.991000	0.47740	0.974000	0.67602	5.192000	0.65115	2.081000	0.62600	0.533000	0.62120	CTG	ATG2A	-	NULL	ENSG00000110046		0.687	ATG2A-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	ATG2A	HGNC	protein_coding	OTTHUMT00000143224.1	88	0.00	0	A	NM_015104		64673972	64673972	-1	no_errors	ENST00000421419	ensembl	human	known	69_37n	missense	56	12.50	8	SNP	1.000	C
TEX38	374973	genome.wustl.edu	37	1	47139124	47139124	+	Missense_Mutation	SNP	T	T	C			TCGA-A1-A0SK-01A-12D-A099-09	TCGA-A1-A0SK-10A-03D-A099-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d1b43161-cbc1-4bf6-b8bb-a72a2e5e1150	2a5384f3-fec7-4265-b104-987f0718574b	g.chr1:47139124T>C	ENST00000334122.4	+	2	724	c.617T>C	c.(616-618)cTg>cCg	p.L206P	EFCAB14-AS1_ENST00000442839.1_RNA|TEX38_ENST00000564373.1_Missense_Mutation_p.L152P|TEX38_ENST00000415500.1_Missense_Mutation_p.L130P|ATPAF1_ENST00000525633.1_Intron|EFCAB14_ENST00000544071.1_Intron|TEX38_ENST00000569393.1_Missense_Mutation_p.L260P|EFCAB14-AS1_ENST00000418985.1_RNA	NM_001145474.2	NP_001138946.1	Q6PEX7	TEX38_HUMAN	testis expressed 38	206						integral component of membrane (GO:0016021)											CCTTCAGAACTGTAGCCTCCT	0.512																																						dbGAP											0													40.0	32.0	34.0					1																	47139124		692	1591	2283	-	-	-	SO:0001583	missense	0				CCDS57999.1, CCDS72780.1, CCDS72781.1	1p33	2012-10-12	2012-10-12	2012-10-12	ENSG00000186118	ENSG00000186118			29589	protein-coding gene	gene with protein product	"""testis highly expressed protein 4"""		"""chromosome 1 open reading frame 223"", ""ATPAF1 antisense RNA 1 (non-protein coding)"", ""ATPAF1 antisense RNA 1"""	C1orf223, ATPAF1-AS1		12477932	Standard	XM_005270845		Approved	LOC374973, THEG4	uc001cqj.3	Q6PEX7	OTTHUMG00000007991	ENST00000334122.4:c.617T>C	1.37:g.47139124T>C	ENSP00000455854:p.Leu206Pro	Somatic		WXS	Illumina GAIIx	Phase_IV	A1A4F8	Missense_Mutation	SNP	NULL	p.L260P	ENST00000334122.4	37	c.779	CCDS57999.1	1																																																																																			ATPAF1-AS1	-	NULL	ENSG00000186118		0.512	TEX38-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	ATPAF1-AS1	HGNC	protein_coding	OTTHUMT00000021929.2	118	0.00	0	T	NM_001145474		47139124	47139124	+1	no_errors	ENST00000569393	ensembl	human	known	69_37n	missense	159	10.00	18	SNP	0.513	C
BOD1	91272	genome.wustl.edu	37	5	173036257	173036257	+	Silent	SNP	A	A	G	rs77014290	byFrequency	TCGA-A1-A0SK-01A-12D-A099-09	TCGA-A1-A0SK-10A-03D-A099-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d1b43161-cbc1-4bf6-b8bb-a72a2e5e1150	2a5384f3-fec7-4265-b104-987f0718574b	g.chr5:173036257A>G	ENST00000311086.4	-	3	766	c.543T>C	c.(541-543)tcT>tcC	p.S181S	BOD1_ENST00000480951.1_Intron|BOD1_ENST00000471339.1_5'Flank|BOD1_ENST00000285908.5_Intron	NM_138369.2	NP_612378.1	Q96IK1	BOD1_HUMAN	biorientation of chromosomes in cell division 1	181					mitotic nuclear division (GO:0007067)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|kinetochore (GO:0000776)		p.S181S(1)		endometrium(1)|large_intestine(2)|lung(2)|ovary(2)	7						AAGTGTCCTGAGATGGAGCTG	0.512																																						dbGAP											1	Substitution - coding silent(1)	lung(1)											92.0	91.0	91.0					5																	173036257		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AY303777	CCDS4389.1, CCDS54951.1	5q35.2	2013-10-11	2009-03-04	2009-03-04	ENSG00000145919	ENSG00000145919			25114	protein-coding gene	gene with protein product	"""biorientation defective 1"""		"""family with sequence similarity 44, member B"""	FAM44B		17938248	Standard	NM_138369		Approved		uc003mcq.2	Q96IK1	OTTHUMG00000130540	ENST00000311086.4:c.543T>C	5.37:g.173036257A>G		Somatic		WXS	Illumina GAIIx	Phase_IV	B4DXH8|Q9BTW1	Missense_Mutation	SNP	NULL	p.S114P	ENST00000311086.4	37	c.340	CCDS4389.1	5	.	.	.	.	.	.	.	.	.	.	A	10.16	1.274704	0.23307	.	.	ENSG00000145919	ENST00000477985	.	.	.	5.86	2.54	0.30619	.	0.220881	0.48767	D	0.000172	T	0.46580	0.1400	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.40701	-0.9549	6	0.39692	T	0.17	-11.0788	1.6489	0.02767	0.2536:0.1527:0.4384:0.1553	.	.	.	.	P	114	.	ENSP00000420005:S114P	S	-	1	0	BOD1	172968863	0.999000	0.42202	0.962000	0.40283	0.898000	0.52572	0.891000	0.28309	0.806000	0.34183	-0.177000	0.13119	TCA	BOD1	-	NULL	ENSG00000145919		0.512	BOD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BOD1	HGNC	protein_coding	OTTHUMT00000252963.1	210	0.47	1	A	NM_138369		173036257	173036257	-1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000477985	ensembl	human	putative	69_37n	missense	46	14.55	8	SNP	0.995	G
BRCA1	672	genome.wustl.edu	37	17	41245985	41245985	+	Silent	SNP	T	T	C	rs273897663|rs397508883		TCGA-A1-A0SK-01A-12D-A099-09	TCGA-A1-A0SK-10A-03D-A099-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d1b43161-cbc1-4bf6-b8bb-a72a2e5e1150	2a5384f3-fec7-4265-b104-987f0718574b	g.chr17:41245985T>C	ENST00000357654.3	-	10	1681	c.1563A>G	c.(1561-1563)gcA>gcG	p.A521A	BRCA1_ENST00000491747.2_Intron|BRCA1_ENST00000346315.3_Silent_p.A521A|BRCA1_ENST00000352993.3_Intron|BRCA1_ENST00000591849.1_Intron|BRCA1_ENST00000586385.1_Intron|BRCA1_ENST00000309486.4_Silent_p.A225A|BRCA1_ENST00000493795.1_Silent_p.A474A|BRCA1_ENST00000354071.3_Silent_p.A521A|BRCA1_ENST00000591534.1_Intron|BRCA1_ENST00000471181.2_Silent_p.A521A|BRCA1_ENST00000468300.1_Intron|BRCA1_ENST00000351666.3_Intron	NM_007294.3	NP_009225.1	P38398	BRCA1_HUMAN	breast cancer 1, early onset	521					androgen receptor signaling pathway (GO:0030521)|apoptotic process (GO:0006915)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to indole-3-methanol (GO:0071681)|cellular response to tumor necrosis factor (GO:0071356)|chromosome segregation (GO:0007059)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|fatty acid biosynthetic process (GO:0006633)|G2 DNA damage checkpoint (GO:0031572)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|negative regulation of centriole replication (GO:0046600)|negative regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902042)|negative regulation of fatty acid biosynthetic process (GO:0045717)|negative regulation of histone H3-K9 methylation (GO:0051573)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of DNA repair (GO:0045739)|positive regulation of gene expression (GO:0010628)|positive regulation of histone acetylation (GO:0035066)|positive regulation of histone H3-K4 methylation (GO:0051571)|positive regulation of histone H3-K9 acetylation (GO:2000617)|positive regulation of histone H4-K16 acetylation (GO:2000620)|positive regulation of histone H4-K20 methylation (GO:0070512)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation vascular endothelial growth factor production (GO:0010575)|postreplication repair (GO:0006301)|protein autoubiquitination (GO:0051865)|protein K6-linked ubiquitination (GO:0085020)|protein ubiquitination (GO:0016567)|regulation of apoptotic process (GO:0042981)|regulation of cell proliferation (GO:0042127)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription from RNA polymerase III promoter (GO:0006359)|response to estrogen (GO:0043627)|response to ionizing radiation (GO:0010212)	BRCA1-A complex (GO:0070531)|BRCA1-BARD1 complex (GO:0031436)|chromosome (GO:0005694)|cytoplasm (GO:0005737)|gamma-tubulin ring complex (GO:0008274)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|ribonucleoprotein complex (GO:0030529)|ubiquitin ligase complex (GO:0000151)	androgen receptor binding (GO:0050681)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|ligase activity (GO:0016874)|RNA binding (GO:0003723)|transcription coactivator activity (GO:0003713)|transcription regulatory region DNA binding (GO:0044212)|tubulin binding (GO:0015631)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(1)|breast(30)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(7)|lung(28)|ovary(36)|skin(2)|stomach(4)|urinary_tract(2)	120		Breast(137;0.000717)		BRCA - Breast invasive adenocarcinoma(366;0.126)		CTGCCAAATCTGCTTTCTTGA	0.398			"""D, Mis, N, F, S"""		ovarian	"""breast, ovarian"""		Homologous recombination	Hereditary Breast-Ovarian Cancer, BRCA1 type	TCGA Ovarian(2;0.000030)																												dbGAP	yes	Rec	yes	Hereditary breast/ovarian cancer	17	17q21	672	familial breast/ovarian cancer gene 1		E	0													66.0	61.0	63.0					17																	41245985		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0	Familial Cancer Database		U14680	CCDS11453.1, CCDS11454.1, CCDS11455.1, CCDS11456.1, CCDS11459.1, CCDS11455.2, CCDS11456.2, CCDS11459.2, CCDS11454.2	17q21.31	2014-09-17			ENSG00000012048	ENSG00000012048		"""RING-type (C3HC4) zinc fingers"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	1100	protein-coding gene	gene with protein product	"""BRCA1/BRCA2-containing complex, subunit 1"", ""protein phosphatase 1, regulatory subunit 53"""	113705				1676470	Standard	NM_007300		Approved	RNF53, BRCC1, PPP1R53	uc002ict.3	P38398	OTTHUMG00000157426	ENST00000357654.3:c.1563A>G	17.37:g.41245985T>C		Somatic		WXS	Illumina GAIIx	Phase_IV	O15129|Q1RMC1|Q3LRJ0|Q3LRJ6|Q6IN79|Q7KYU9	Missense_Mutation	SNP	NULL	p.Q305R	ENST00000357654.3	37	c.914	CCDS11453.1	17																																																																																			BRCA1	-	NULL	ENSG00000012048		0.398	BRCA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BRCA1	HGNC	protein_coding	OTTHUMT00000348798.2	96	0.00	0	T	NM_007294		41245985	41245985	-1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000412061	ensembl	human	known	69_37n	missense	41	76.16	131	SNP	0.567	C
BUB1	699	genome.wustl.edu	37	2	111419365	111419365	+	Silent	SNP	C	C	T			TCGA-A1-A0SK-01A-12D-A099-09	TCGA-A1-A0SK-10A-03D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d1b43161-cbc1-4bf6-b8bb-a72a2e5e1150	2a5384f3-fec7-4265-b104-987f0718574b	g.chr2:111419365C>T	ENST00000302759.6	-	10	1129	c.1011G>A	c.(1009-1011)gcG>gcA	p.A337A	BUB1_ENST00000535254.1_Silent_p.A317A|BUB1_ENST00000409311.1_Silent_p.A337A	NM_004336.3	NP_004327.1	O43683	BUB1_HUMAN	BUB1 mitotic checkpoint serine/threonine kinase	337					apoptotic process (GO:0006915)|cell proliferation (GO:0008283)|chromosome segregation (GO:0007059)|mitotic cell cycle (GO:0000278)|mitotic cell cycle checkpoint (GO:0007093)|mitotic nuclear division (GO:0007067)|mitotic spindle assembly checkpoint (GO:0007094)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|regulation of chromosome segregation (GO:0051983)|regulation of sister chromatid cohesion (GO:0007063)|spindle assembly checkpoint (GO:0071173)|viral process (GO:0016032)	condensed chromosome kinetochore (GO:0000777)|condensed nuclear chromosome, centromeric region (GO:0000780)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinetochore (GO:0000776)|membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			breast(3)|endometrium(8)|kidney(4)|large_intestine(9)|lung(18)|ovary(1)|prostate(1)|stomach(1)	45		Ovarian(717;0.0822)		BRCA - Breast invasive adenocarcinoma(221;0.0556)		GAAGACATGGCGCTCTCAGTT	0.453																																						dbGAP											0													136.0	130.0	132.0					2																	111419365		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF046078	CCDS33273.1, CCDS62984.1, CCDS62985.1	2q13	2013-01-17	2013-01-17		ENSG00000169679	ENSG00000169679			1148	protein-coding gene	gene with protein product		602452	"""budding uninhibited by benzimidazoles 1 (yeast homolog)"", ""budding uninhibited by benzimidazoles 1 homolog (yeast)"""	BUB1L			Standard	NM_004336		Approved	hBUB1, BUB1A	uc002tgc.3	O43683	OTTHUMG00000153638	ENST00000302759.6:c.1011G>A	2.37:g.111419365C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	E9PC26|F5GXI5|O43430|O43643|O60626|Q53QE4	Silent	SNP	pfam_Mad3_BUB1_I,pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Mad3_BUB1_I,smart_Ser/Thr_dual-sp_kinase_dom,pfscan_Prot_kinase_cat_dom	p.A337	ENST00000302759.6	37	c.1011	CCDS33273.1	2																																																																																			BUB1	-	NULL	ENSG00000169679		0.453	BUB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BUB1	HGNC	protein_coding	OTTHUMT00000331925.1	273	0.36	1	C	NM_004336		111419365	111419365	-1	no_errors	ENST00000302759	ensembl	human	known	69_37n	silent	60	38.78	38	SNP	0.000	T
C16orf59	80178	genome.wustl.edu	37	16	2512471	2512471	+	Missense_Mutation	SNP	G	G	A			TCGA-A1-A0SK-01A-12D-A099-09	TCGA-A1-A0SK-10A-03D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d1b43161-cbc1-4bf6-b8bb-a72a2e5e1150	2a5384f3-fec7-4265-b104-987f0718574b	g.chr16:2512471G>A	ENST00000361837.4	+	7	871	c.806G>A	c.(805-807)cGc>cAc	p.R269H	C16orf59_ENST00000569496.1_Missense_Mutation_p.R269H|C16orf59_ENST00000563531.1_Missense_Mutation_p.R269H|RP11-715J22.4_ENST00000566085.1_lincRNA|C16orf59_ENST00000483320.1_Missense_Mutation_p.R102H|RP11-715J22.2_ENST00000563775.1_RNA	NM_025108.2	NP_079384.2	Q7L2K0	CP059_HUMAN	chromosome 16 open reading frame 59	269										lung(1)|skin(1)|urinary_tract(1)	3		Ovarian(90;0.17)				GAGGCGGGGCGCCTGCGGAAG	0.662																																						dbGAP											0													20.0	25.0	23.0					16																	2512471		2059	4188	6247	-	-	-	SO:0001583	missense	0			AK023971	CCDS10468.2	16p13.3	2008-10-30			ENSG00000162062	ENSG00000162062			25849	protein-coding gene	gene with protein product						12477932	Standard	XM_006720955		Approved	FLJ13909	uc002cqh.3	Q7L2K0	OTTHUMG00000128859	ENST00000361837.4:c.806G>A	16.37:g.2512471G>A	ENSP00000355022:p.Arg269His	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DXD7|Q96H61|Q9H872	Missense_Mutation	SNP	NULL	p.R269H	ENST00000361837.4	37	c.806	CCDS10468.2	16	.	.	.	.	.	.	.	.	.	.	G	16.46	3.128334	0.56721	.	.	ENSG00000162062	ENST00000361837	T	0.49139	0.79	4.52	-3.92	0.04155	.	1.313290	0.05097	N	0.486427	T	0.51958	0.1705	L	0.59436	1.845	0.09310	N	1	D;B;B;B	0.76494	0.999;0.01;0.05;0.01	D;B;B;B	0.63113	0.911;0.007;0.012;0.005	T	0.50939	-0.8768	10	0.29301	T	0.29	-0.5679	0.7079	0.00919	0.2461:0.121:0.2355:0.3973	.	102;269;102;102	Q7L2K0-3;Q7L2K0;D3DU95;Q7L2K0-2	.;CP059_HUMAN;.;.	H	269	ENSP00000355022:R269H	ENSP00000355022:R269H	R	+	2	0	C16orf59	2452472	0.035000	0.19736	0.000000	0.03702	0.007000	0.05969	0.040000	0.13905	-0.482000	0.06782	-0.140000	0.14226	CGC	C16orf59	-	NULL	ENSG00000162062		0.662	C16orf59-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C16orf59	HGNC	protein_coding	OTTHUMT00000250802.3	82	0.00	0	G	NM_025108		2512471	2512471	+1	no_errors	ENST00000361837	ensembl	human	known	69_37n	missense	43	18.87	10	SNP	0.000	A
C1QTNF9	338872	genome.wustl.edu	37	13	24895393	24895393	+	Silent	SNP	A	A	G	rs3751355	byFrequency	TCGA-A1-A0SK-01A-12D-A099-09	TCGA-A1-A0SK-10A-03D-A099-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d1b43161-cbc1-4bf6-b8bb-a72a2e5e1150	2a5384f3-fec7-4265-b104-987f0718574b	g.chr13:24895393A>G	ENST00000382071.2	+	4	574	c.489A>G	c.(487-489)aaA>aaG	p.K163K	C1QTNF9_ENST00000332018.4_Silent_p.K163K|C1QTNF9-AS1_ENST00000449656.1_RNA|AL359736.1_ENST00000422229.2_Silent_p.P58P			P0C862	C1T9A_HUMAN	C1q and tumor necrosis factor related protein 9	163	Collagen-like 3.					collagen trimer (GO:0005581)|extracellular region (GO:0005576)				endometrium(1)|kidney(2)|lung(6)	9		all_cancers(29;3.55e-20)|all_epithelial(30;4.25e-17)|all_lung(29;1.04e-16)|Lung SC(185;0.0225)|Breast(139;0.052)		all cancers(112;0.00565)|Epithelial(112;0.027)|OV - Ovarian serous cystadenocarcinoma(117;0.115)|Lung(94;0.159)		CTGGTCCCAAAGGAGAAGCTG	0.612																																						dbGAP											0													16.0	10.0	12.0					13																	24895393		1939	3303	5242	-	-	-	SO:0001819	synonymous_variant	0			BC040438	CCDS9306.1	13q12.12	2010-08-18			ENSG00000240654	ENSG00000240654			28732	protein-coding gene	gene with protein product		614285				12975309, 18787108	Standard	NM_178540		Approved	MGC48915, CTRP9, C1QTNF9A, AQL1	uc001upj.3	P0C862	OTTHUMG00000016576	ENST00000382071.2:c.489A>G	13.37:g.24895393A>G		Somatic		WXS	Illumina GAIIx	Phase_IV	A2A3T6|Q0VGC5|Q5VX65|Q5VX66|Q8IUU4	Silent	SNP	pfam_C1q,pfam_Collagen,superfamily_Tumour_necrosis_fac-like,smart_C1q,pfscan_C1q,prints_C1q	p.K163	ENST00000382071.2	37	c.489	CCDS9306.1	13																																																																																			C1QTNF9	-	pfam_Collagen	ENSG00000240654		0.612	C1QTNF9-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	C1QTNF9	HGNC	protein_coding	OTTHUMT00000044177.1	16	0.00	0	A	NM_178540		24895393	24895393	+1	no_errors	ENST00000332018	ensembl	human	known	69_37n	silent	0	100.00	44	SNP	1.000	G
CALHM3	119395	genome.wustl.edu	37	10	105236242	105236242	+	Missense_Mutation	SNP	G	G	A	rs186020415	byFrequency	TCGA-A1-A0SK-01A-12D-A099-09	TCGA-A1-A0SK-10A-03D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d1b43161-cbc1-4bf6-b8bb-a72a2e5e1150	2a5384f3-fec7-4265-b104-987f0718574b	g.chr10:105236242G>A	ENST00000369783.4	-	2	559	c.352C>T	c.(352-354)Ctc>Ttc	p.L118F		NM_001129742.1	NP_001123214.1	Q86XJ0	CAHM3_HUMAN	calcium homeostasis modulator 3	118					ion transport (GO:0006811)	integral component of membrane (GO:0016021)				kidney(1)|large_intestine(1)	2						CCGTCAAGGAGGGCCAGCAGG	0.622													G|||	18	0.00359425	0.0121	0.0029	5008	,	,		20952	0.0		0.0	False		,,,				2504	0.0					dbGAP											0													38.0	37.0	37.0					10																	105236242		692	1591	2283	-	-	-	SO:0001583	missense	0			BC043367	CCDS44476.1	10q24.33	2008-07-02	2008-07-02	2008-07-02	ENSG00000183128	ENSG00000183128			23458	protein-coding gene	gene with protein product			"""family with sequence similarity 26, member A"""	FAM26A		18585350	Standard	NM_001129742		Approved	bA225H22.7	uc001kxg.4	Q86XJ0	OTTHUMG00000018989	ENST00000369783.4:c.352C>T	10.37:g.105236242G>A	ENSP00000358798:p.Leu118Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5W090|Q8IXR2	Missense_Mutation	SNP	NULL	p.L118F	ENST00000369783.4	37	c.352	CCDS44476.1	10	2	9.157509157509158E-4	2	0.0040650406504065045	0	0.0	0	0.0	0	0.0	G	24.1	4.491653	0.84962	.	.	ENSG00000183128	ENST00000369783	T	0.38560	1.13	5.48	5.48	0.80851	.	0.000000	0.64402	D	0.000001	T	0.68906	0.3052	M	0.82517	2.595	0.52501	D	0.999959	D	0.89917	1.0	D	0.87578	0.998	T	0.69351	-0.5168	10	0.41790	T	0.15	-14.0674	19.3361	0.94319	0.0:0.0:1.0:0.0	.	118	Q86XJ0-2	.	F	118	ENSP00000358798:L118F	ENSP00000358798:L118F	L	-	1	0	CALHM3	105226232	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	4.199000	0.58426	2.577000	0.86979	0.462000	0.41574	CTC	CALHM3	-	NULL	ENSG00000183128		0.622	CALHM3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CALHM3	HGNC	protein_coding	OTTHUMT00000050157.1	115	0.00	0	G	NM_182494		105236242	105236242	-1	no_errors	ENST00000369783	ensembl	human	known	69_37n	missense	61	10.29	7	SNP	1.000	A
CAMTA2	23125	genome.wustl.edu	37	17	4883751	4883751	+	Missense_Mutation	SNP	G	G	A			TCGA-A1-A0SK-01A-12D-A099-09	TCGA-A1-A0SK-10A-03D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d1b43161-cbc1-4bf6-b8bb-a72a2e5e1150	2a5384f3-fec7-4265-b104-987f0718574b	g.chr17:4883751G>A	ENST00000348066.3	-	9	989	c.866C>T	c.(865-867)tCc>tTc	p.S289F	CAMTA2_ENST00000572543.1_Missense_Mutation_p.S294F|CAMTA2_ENST00000571831.1_5'Flank|CAMTA2_ENST00000361571.5_Missense_Mutation_p.S288F|CAMTA2_ENST00000414043.3_Missense_Mutation_p.S312F|CAMTA2_ENST00000358183.4_Missense_Mutation_p.S289F|CAMTA2_ENST00000381311.5_Missense_Mutation_p.S291F	NM_015099.3	NP_055914.2	O94983	CMTA2_HUMAN	calmodulin binding transcription activator 2	289	Ser-rich.				cardiac muscle hypertrophy in response to stress (GO:0014898)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|histone deacetylase binding (GO:0042826)|transcription factor binding (GO:0008134)			breast(2)|central_nervous_system(1)|endometrium(6)|kidney(3)|large_intestine(6)|lung(5)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	31						AGAAGATGGGGAGGTGTGTGC	0.592											OREG0024111	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP											0													42.0	49.0	47.0					17																	4883751		2193	4294	6487	-	-	-	SO:0001583	missense	0			AB020716	CCDS11063.1, CCDS54071.1, CCDS54072.1, CCDS54073.1	17p13.3	2004-09-01			ENSG00000108509	ENSG00000108509			18807	protein-coding gene	gene with protein product		611508				11925432	Standard	NM_015099		Approved	KIAA0909	uc010cku.2	O94983	OTTHUMG00000099417	ENST00000348066.3:c.866C>T	17.37:g.4883751G>A	ENSP00000321813:p.Ser289Phe	Somatic	622	WXS	Illumina GAIIx	Phase_IV	B9EGL0|D3DTL5|E7EWU5|Q7Z6M8|Q8N3V0|Q8NDG4|Q96G17	Missense_Mutation	SNP	pfam_CG-1_dom,pfam_IPT_TIG_rcpt,pfam_IQ_motif_EF-hand-BS,superfamily_Ig_E-set,superfamily_Ankyrin_rpt-contain_dom,pfscan_Ankyrin_rpt-contain_dom,pfscan_IQ_motif_EF-hand-BS	p.S312F	ENST00000348066.3	37	c.935	CCDS11063.1	17	.	.	.	.	.	.	.	.	.	.	G	17.83	3.484927	0.63962	.	.	ENSG00000108509	ENST00000414043;ENST00000381311;ENST00000361571;ENST00000358183;ENST00000348066	T;T;T;T;T	0.48836	0.8;0.8;0.8;0.8;0.8	4.37	4.37	0.52481	.	0.103397	0.42294	D	0.000725	T	0.51126	0.1656	N	0.24115	0.695	0.30496	N	0.770902	D;D;D;D	0.71674	0.996;0.998;0.996;0.994	D;D;D;D	0.79108	0.982;0.992;0.982;0.977	T	0.52895	-0.8514	10	0.72032	D	0.01	-14.8488	9.6491	0.39886	0.0:0.0:0.7923:0.2077	.	312;291;289;288	E7EWU5;O94983-3;O94983;O94983-4	.;.;CMTA2_HUMAN;.	F	312;291;288;289;289	ENSP00000412886:S312F;ENSP00000370712:S291F;ENSP00000354828:S288F;ENSP00000350910:S289F;ENSP00000321813:S289F	ENSP00000321813:S289F	S	-	2	0	CAMTA2	4824475	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	5.600000	0.67599	2.271000	0.75665	0.650000	0.86243	TCC	CAMTA2	-	NULL	ENSG00000108509		0.592	CAMTA2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CAMTA2	HGNC	protein_coding	OTTHUMT00000216876.1	129	0.00	0	G	NM_015099		4883751	4883751	-1	no_errors	ENST00000414043	ensembl	human	known	69_37n	missense	29	66.28	57	SNP	1.000	A
CECR2	27443	genome.wustl.edu	37	22	18022211	18022211	+	Silent	SNP	C	C	T			TCGA-A1-A0SK-01A-12D-A099-09	TCGA-A1-A0SK-10A-03D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d1b43161-cbc1-4bf6-b8bb-a72a2e5e1150	2a5384f3-fec7-4265-b104-987f0718574b	g.chr22:18022211C>T	ENST00000400585.2	+	16	2328	c.1890C>T	c.(1888-1890)caC>caT	p.H630H	CECR2_ENST00000400573.5_Silent_p.H771H|CECR2_ENST00000262608.8_Silent_p.H772H			Q9BXF3	CECR2_HUMAN	cat eye syndrome chromosome region, candidate 2	813					apoptotic DNA fragmentation (GO:0006309)|ATP-dependent chromatin remodeling (GO:0043044)|cytokinesis (GO:0000910)|cytoskeleton organization (GO:0007010)|execution phase of apoptosis (GO:0097194)|neural tube development (GO:0021915)|vesicle-mediated transport (GO:0016192)	CERF complex (GO:0090537)|nucleus (GO:0005634)				NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|lung(22)|ovary(1)|pancreas(1)|prostate(2)|skin(5)|stomach(1)|urinary_tract(1)	59		all_epithelial(15;0.139)		Lung(27;0.146)		AGAAGCCCCACCTGGGGCCAG	0.577																																						dbGAP											0													43.0	49.0	47.0					22																	18022211		1963	4130	6093	-	-	-	SO:0001819	synonymous_variant	0			AF336133		22q11.2	2012-04-19			ENSG00000099954	ENSG00000099954			1840	protein-coding gene	gene with protein product		607576				11381032	Standard	XM_006724077		Approved	KIAA1740	uc002zml.2	Q9BXF3	OTTHUMG00000150072	ENST00000400585.2:c.1890C>T	22.37:g.18022211C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A8MS90|A8MX16|Q658Z4|Q96P58|Q9C0C3	Silent	SNP	pfam_Bromodomain,superfamily_Bromodomain,smart_Bromodomain,pfscan_Bromodomain,prints_Bromodomain	p.H771	ENST00000400585.2	37	c.2313		22																																																																																			CECR2	-	NULL	ENSG00000099954		0.577	CECR2-002	NOVEL	basic|appris_candidate|exp_conf	protein_coding	CECR2	HGNC	protein_coding	OTTHUMT00000316226.2	87	0.00	0	C	NM_031413		18022211	18022211	+1	no_errors	ENST00000400573	ensembl	human	novel	69_37n	silent	103	43.41	79	SNP	0.000	T
CES1P1	51716	genome.wustl.edu	37	16	55794514	55794514	+	RNA	SNP	C	C	T	rs7199449	byFrequency	TCGA-A1-A0SK-01A-12D-A099-09	TCGA-A1-A0SK-10A-03D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d1b43161-cbc1-4bf6-b8bb-a72a2e5e1150	2a5384f3-fec7-4265-b104-987f0718574b	g.chr16:55794514C>T	ENST00000571348.1	+	0	4					NR_003276.2		Q9UKY3	CES1P_HUMAN	carboxylesterase 1 pseudogene 1						anatomical structure morphogenesis (GO:0009653)|metabolic process (GO:0008152)	endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)	carboxylic ester hydrolase activity (GO:0052689)										CTGAGCTGCACGGAGACCTCG	0.642													.|||	758	0.151358	0.3109	0.0778	5008	,	,		16064	0.0069		0.1193	False		,,,				2504	0.1697					dbGAP											0																																										-	-	-			0			AF106005		16q12.2	2013-07-10	2010-10-12	2010-10-12	ENSG00000228695	ENSG00000228695			18546	pseudogene	pseudogene			"""carboxylesterase 4-like"", ""carboxylesterase 4, pseudogene"""	CES4		10452915, 20931200	Standard	NR_003276		Approved	PCE-3, CESR, CES1A3	uc010cce.3	Q9UKY3	OTTHUMG00000154668		16.37:g.55794514C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A2RRL8|B9ZVS2	RNA	SNP	-	NULL	ENST00000571348.1	37	NULL		16																																																																																			CES1P1	-	-	ENSG00000228695		0.642	CES1P1-003	KNOWN	basic	processed_transcript	CES1P1	HGNC	pseudogene	OTTHUMT00000440035.1	83	0.00	0	C	NR_003276		55794514	55794514	+1	no_errors	ENST00000571348	ensembl	human	known	69_37n	rna	33	10.81	4	SNP	0.000	T
CHRNB4	1143	genome.wustl.edu	37	15	78921983	78921983	+	Missense_Mutation	SNP	C	C	T			TCGA-A1-A0SK-01A-12D-A099-09	TCGA-A1-A0SK-10A-03D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d1b43161-cbc1-4bf6-b8bb-a72a2e5e1150	2a5384f3-fec7-4265-b104-987f0718574b	g.chr15:78921983C>T	ENST00000261751.3	-	5	775	c.664G>A	c.(664-666)Gtg>Atg	p.V222M	CHRNB4_ENST00000560511.1_5'Flank|RP11-335K5.2_ENST00000559120.1_RNA|CHRNB4_ENST00000412074.2_Intron	NM_000750.3	NP_000741.1	P30926	ACHB4_HUMAN	cholinergic receptor, nicotinic, beta 4 (neuronal)	222					action potential (GO:0001508)|behavioral response to nicotine (GO:0035095)|cation transmembrane transport (GO:0098655)|cation transport (GO:0006812)|ion transmembrane transport (GO:0034220)|ion transport (GO:0006811)|locomotory behavior (GO:0007626)|regulation of neurotransmitter secretion (GO:0046928)|regulation of smooth muscle contraction (GO:0006940)|signal transduction (GO:0007165)|smooth muscle contraction (GO:0006939)|synaptic transmission (GO:0007268)|synaptic transmission involved in micturition (GO:0060084)|synaptic transmission, cholinergic (GO:0007271)	acetylcholine-gated channel complex (GO:0005892)|cell junction (GO:0030054)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	acetylcholine receptor activity (GO:0015464)|acetylcholine-activated cation-selective channel activity (GO:0004889)|ligand-gated ion channel activity (GO:0015276)			endometrium(7)|kidney(1)|lung(13)|prostate(1)	22					Dextromethorphan(DB00514)|Galantamine(DB00674)|Levomethadyl Acetate(DB01227)|Nicotine(DB00184)|Pentolinium(DB01090)	TCGTAAGTCACGTCCACGTAG	0.552																																						dbGAP											0													363.0	278.0	307.0					15																	78921983		2196	4293	6489	-	-	-	SO:0001583	missense	0			U48861	CCDS10306.1, CCDS58392.1	15q24	2012-02-11	2012-02-07		ENSG00000117971	ENSG00000117971		"""Cholinergic receptors"", ""Ligand-gated ion channels / Acetylcholine receptors, nicotinic"""	1964	protein-coding gene	gene with protein product	"""acetylcholine receptor, nicotinic, beta 4 (neuronal)"""	118509	"""cholinergic receptor, nicotinic, beta polypeptide 4"""			2004777	Standard	NM_000750		Approved		uc002bed.1	P30926	OTTHUMG00000143860	ENST00000261751.3:c.664G>A	15.37:g.78921983C>T	ENSP00000261751:p.Val222Met	Somatic		WXS	Illumina GAIIx	Phase_IV	A4FTX5|E9PHE8|Q16607|Q4VBA5|Q8WXC8|Q9BQR4	Missense_Mutation	SNP	pfam_Neurotrans-gated_channel_TM,pfam_Neur_chan_lig-bd,superfamily_Neurotrans-gated_channel_TM,superfamily_Neur_chan_lig-bd,prints_Nicotinic_acetylcholine_rcpt,prints_Neur_channel,tigrfam_Neur_channel	p.V222M	ENST00000261751.3	37	c.664	CCDS10306.1	15	.	.	.	.	.	.	.	.	.	.	C	15.19	2.758482	0.49468	.	.	ENSG00000117971	ENST00000261751	D	0.83335	-1.71	5.05	3.13	0.36017	Neurotransmitter-gated ion-channel ligand-binding (3);	0.072472	0.56097	D	0.000025	D	0.87752	0.6256	M	0.77486	2.375	0.80722	D	1	D	0.59767	0.986	D	0.63113	0.911	D	0.85879	0.1421	10	0.87932	D	0	.	6.1253	0.20176	0.1393:0.6519:0.1345:0.0744	.	222	P30926	ACHB4_HUMAN	M	222	ENSP00000261751:V222M	ENSP00000261751:V222M	V	-	1	0	CHRNB4	76709038	0.208000	0.23494	0.998000	0.56505	0.923000	0.55619	0.212000	0.17497	0.519000	0.28406	-0.243000	0.11985	GTG	CHRNB4	-	pfam_Neur_chan_lig-bd,superfamily_Neur_chan_lig-bd,tigrfam_Neur_channel	ENSG00000117971		0.552	CHRNB4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHRNB4	HGNC	protein_coding	OTTHUMT00000290108.1	873	0.00	0	C			78921983	78921983	-1	no_errors	ENST00000261751	ensembl	human	known	69_37n	missense	137	38.57	86	SNP	0.997	T
CLUAP1	23059	genome.wustl.edu	37	16	3558440	3558440	+	Missense_Mutation	SNP	A	A	G			TCGA-A1-A0SK-01A-12D-A099-09	TCGA-A1-A0SK-10A-03D-A099-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d1b43161-cbc1-4bf6-b8bb-a72a2e5e1150	2a5384f3-fec7-4265-b104-987f0718574b	g.chr16:3558440A>G	ENST00000576634.1	+	4	515	c.371A>G	c.(370-372)aAc>aGc	p.N124S	CLUAP1_ENST00000572600.1_5'Flank|LA16c-306E5.3_ENST00000574423.2_RNA|CLUAP1_ENST00000417763.2_5'UTR|CLUAP1_ENST00000341633.5_Missense_Mutation_p.N124S|CLUAP1_ENST00000571025.1_Missense_Mutation_p.N124S	NM_015041.2	NP_055856.1	Q96AJ1	CLUA1_HUMAN	clusterin associated protein 1	124					cilium assembly (GO:0042384)	centrosome (GO:0005813)|cilium (GO:0005929)|intracellular membrane-bounded organelle (GO:0043231)|intraciliary transport particle B (GO:0030992)|nucleus (GO:0005634)				breast(2)|endometrium(1)|kidney(1)|large_intestine(7)|lung(1)|ovary(1)|pancreas(1)|urinary_tract(2)	16						GAAGATGTCAACAAGTTCAAG	0.453																																						dbGAP											0													144.0	124.0	130.0					16																	3558440		2197	4300	6497	-	-	-	SO:0001583	missense	0			BC017070	CCDS32381.1, CCDS45398.1	16p13.3	2014-07-18				ENSG00000103351		"""Intraflagellar transport homologs"""	19009	protein-coding gene	gene with protein product	"""flagellar associated protein 22, qilin-like protein, homolog (Chlamydomonas)"", ""cilia and flagella associated protein 22"""					15480429, 9734811, 19253336	Standard	NM_015041		Approved	FLJ13297, KIAA0643, FAP22, CFAP22	uc002cvk.2	Q96AJ1		ENST00000576634.1:c.371A>G	16.37:g.3558440A>G	ENSP00000460850:p.Asn124Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	O75138|Q65ZA3|Q9H8R4|Q9H8T1	Missense_Mutation	SNP	pfam_Clusterin-associated_protein-1,superfamily_CH-domain	p.N124S	ENST00000576634.1	37	c.371	CCDS32381.1	16	.	.	.	.	.	.	.	.	.	.	A	4.376	0.069321	0.08436	.	.	ENSG00000103351	ENST00000341633	T	0.32753	1.44	4.89	3.89	0.44902	.	0.387304	0.32231	N	0.006397	T	0.05593	0.0147	N	0.00188	-1.89	0.80722	D	1	B	0.02656	0.0	B	0.01281	0.0	T	0.27806	-1.0063	10	0.02654	T	1	-11.1969	6.9153	0.24357	0.0971:0.1756:0.7273:0.0	.	124	Q96AJ1	CLUA1_HUMAN	S	124	ENSP00000344392:N124S	ENSP00000344392:N124S	N	+	2	0	CLUAP1	3498441	1.000000	0.71417	0.946000	0.38457	0.044000	0.14063	2.649000	0.46656	1.045000	0.40225	-0.621000	0.04028	AAC	CLUAP1	-	pfam_Clusterin-associated_protein-1	ENSG00000103351		0.453	CLUAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CLUAP1	HGNC	protein_coding	OTTHUMT00000437883.2	332	0.30	1	A	NM_024793		3558440	3558440	+1	no_errors	ENST00000576634	ensembl	human	known	69_37n	missense	83	14.43	14	SNP	0.990	G
CLEC18B	497190	genome.wustl.edu	37	16	74446051	74446051	+	Splice_Site	SNP	C	C	T			TCGA-A1-A0SK-01A-12D-A099-09	TCGA-A1-A0SK-10A-03D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d1b43161-cbc1-4bf6-b8bb-a72a2e5e1150	2a5384f3-fec7-4265-b104-987f0718574b	g.chr16:74446051C>T	ENST00000339953.5	-	7	999		c.e7+1			NM_001011880.2	NP_001011880.2	Q6UXF7	CL18B_HUMAN	C-type lectin domain family 18, member B							extracellular region (GO:0005576)	carbohydrate binding (GO:0030246)			endometrium(3)|kidney(9)|large_intestine(3)|lung(7)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	27						GCAGGACTCACTGGCACACTG	0.652																																						dbGAP											0													1.0	2.0	2.0					16																	74446051		872	2288	3160	-	-	-	SO:0001630	splice_region_variant	0			AY358373	CCDS32484.1	16q22.3	2010-04-27	2009-03-10	2009-03-10		ENSG00000140839		"""C-type lectin domain containing"""	33849	protein-coding gene	gene with protein product							Standard	NM_001011880		Approved		uc002fct.3	Q6UXF7		ENST00000339953.5:c.877+1G>A	16.37:g.74446051C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B4DF90	Splice_Site	SNP	-	e7+1	ENST00000339953.5	37	c.877+1	CCDS32484.1	16	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	c|-	16.96|16.96	3.266958|3.266958	0.59540|0.59540	.|.	.|.	ENSG00000140839|ENSG00000140839	ENST00000429489;ENST00000339953;ENST00000268492|ENST00000425714	.|.	.|.	.|.	3.28|3.28	3.28|3.28	0.37604|0.37604	.|.	.|.	.|.	.|.	.|.	.|T	.|0.38585	.|0.1046	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|B	.|0.18610	.|0.029	.|B	.|0.13407	.|0.009	.|T	.|0.15009	.|-1.0452	.|7	.|0.15952	.|T	.|0.53	.|.	9.9286|9.9286	0.41507|0.41507	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|241	.|Q6UXF7-2	.|.	.|N	-1|241	.|.	.|ENSP00000394600:S241N	.|S	-|-	.|2	.|0	CLEC18B|CLEC18B	73003552|73003552	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.947000|0.947000	0.59692|0.59692	5.880000|5.880000	0.69698|0.69698	1.676000|1.676000	0.50930|0.50930	0.425000|0.425000	0.28330|0.28330	.|AGT	CLEC18B	-	-	ENSG00000140839		0.652	CLEC18B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CLEC18B	HGNC	protein_coding	OTTHUMT00000434697.1	17	0.00	0	C	NM_001011880	Intron	74446051	74446051	-1	no_errors	ENST00000339953	ensembl	human	known	69_37n	splice_site	27	22.86	8	SNP	1.000	T
COL20A1	57642	genome.wustl.edu	37	20	61956698	61956698	+	Intron	SNP	T	T	C	rs6010902	byFrequency	TCGA-A1-A0SK-01A-12D-A099-09	TCGA-A1-A0SK-10A-03D-A099-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d1b43161-cbc1-4bf6-b8bb-a72a2e5e1150	2a5384f3-fec7-4265-b104-987f0718574b	g.chr20:61956698T>C	ENST00000358894.6	+	28	3394				COL20A1_ENST00000422202.1_Intron|COL20A1_ENST00000326996.6_Silent_p.R1124R|COL20A1_ENST00000435874.1_Intron	NM_020882.2	NP_065933.2	Q9P218	COKA1_HUMAN	collagen, type XX, alpha 1						extracellular matrix organization (GO:0030198)	collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)				NS(3)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(1)|lung(21)|ovary(1)|prostate(3)|urinary_tract(2)	36	all_cancers(38;1.39e-10)					CCCAGGGCCGTGCAGTCCAGG	0.701													C|||	289	0.0577077	0.1914	0.013	5008	,	,		12479	0.0		0.004	False		,,,				2504	0.0235					dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			BC043183	CCDS46628.1	20q13.33	2014-02-12			ENSG00000101203	ENSG00000101203		"""Collagens"", ""Fibronectin type III domain containing"""	14670	protein-coding gene	gene with protein product						10819331	Standard	NM_020882		Approved	KIAA1510	uc011aau.2	Q9P218	OTTHUMG00000032964	ENST00000358894.6:c.3295-95T>C	20.37:g.61956698T>C		Somatic		WXS	Illumina GAIIx	Phase_IV	Q4VXQ4|Q6PI59|Q8WUT2|Q96CY9|Q9BQU6|Q9BQU7	Silent	SNP	pfam_Fibronectin_type3,pfam_VWF_A,pfam_Collagen,superfamily_ConA-like_lec_gl,superfamily_Fibronectin_type3,smart_Fibronectin_type3,smart_VWF_A,smart_Laminin_G,pfscan_Fibronectin_type3,pfscan_VWF_A	p.R1124	ENST00000358894.6	37	c.3372	CCDS46628.1	20																																																																																			COL20A1	-	pfam_Collagen	ENSG00000101203		0.701	COL20A1-006	KNOWN	basic|CCDS	protein_coding	COL20A1	HGNC	protein_coding	OTTHUMT00000144595.2	82	0.00	0	T	NM_020882		61956698	61956698	+1	no_errors	ENST00000326996	ensembl	human	known	69_37n	silent	42	14.00	7	SNP	0.000	C
COL21A1	81578	genome.wustl.edu	37	6	55940289	55940289	+	Silent	SNP	G	G	T			TCGA-A1-A0SK-01A-12D-A099-09	TCGA-A1-A0SK-10A-03D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d1b43161-cbc1-4bf6-b8bb-a72a2e5e1150	2a5384f3-fec7-4265-b104-987f0718574b	g.chr6:55940289G>T	ENST00000244728.5	-	19	2296	c.1899C>A	c.(1897-1899)gcC>gcA	p.A633A	COL21A1_ENST00000467045.1_5'UTR|COL21A1_ENST00000370819.1_Silent_p.A630A|COL21A1_ENST00000535941.1_Silent_p.A633A|COL21A1_ENST00000370808.2_Silent_p.A33A	NM_030820.3	NP_110447.2	Q96P44	COLA1_HUMAN	collagen, type XXI, alpha 1	633					extracellular matrix organization (GO:0030198)	collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)				breast(1)|endometrium(1)|kidney(3)|large_intestine(11)|lung(21)|ovary(2)|prostate(2)	41	Lung NSC(77;0.0483)		LUSC - Lung squamous cell carcinoma(124;0.181)			GCATCCCTGGGGCTCCTTTTT	0.338																																						dbGAP											0													64.0	58.0	60.0					6																	55940289		1788	4042	5830	-	-	-	SO:0001819	synonymous_variant	0			AF330693	CCDS55025.1	6p12.3-p11.2	2013-01-16			ENSG00000124749	ENSG00000124749		"""Collagens"""	17025	protein-coding gene	gene with protein product		610002				11566190	Standard	XR_241922		Approved		uc003pcs.3	Q96P44	OTTHUMG00000014907	ENST00000244728.5:c.1899C>A	6.37:g.55940289G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A6NIX5|B2R8J9|Q49A51|Q71RF4|Q8WXV8|Q9H0V3	Silent	SNP	pfam_Collagen,pfam_VWF_A,superfamily_ConA-like_lec_gl,smart_VWF_A,smart_Laminin_G,pfscan_VWF_A	p.A633	ENST00000244728.5	37	c.1899	CCDS55025.1	6																																																																																			COL21A1	-	NULL	ENSG00000124749		0.338	COL21A1-001	KNOWN	non_canonical_conserved|basic|appris_candidate_longest|CCDS	protein_coding	COL21A1	HGNC	protein_coding	OTTHUMT00000041004.2	168	0.00	0	G			55940289	55940289	-1	no_errors	ENST00000244728	ensembl	human	known	69_37n	silent	85	27.35	32	SNP	0.896	T
COMT	1312	genome.wustl.edu	37	22	19951897	19951897	+	Intron	SNP	G	G	C	rs4646315	byFrequency	TCGA-A1-A0SK-01A-12D-A099-09	TCGA-A1-A0SK-10A-03D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d1b43161-cbc1-4bf6-b8bb-a72a2e5e1150	2a5384f3-fec7-4265-b104-987f0718574b	g.chr22:19951897G>C	ENST00000361682.6	+	5	997				COMT_ENST00000407537.1_Intron|COMT_ENST00000449653.1_Intron|COMT_ENST00000406520.3_Intron|COMT_ENST00000403710.1_Intron|COMT_ENST00000403184.1_Missense_Mutation_p.K230N|MIR4761_ENST00000585066.1_RNA	NM_000754.3	NP_000745.1	P21964	COMT_HUMAN	catechol-O-methyltransferase						cellular response to phosphate starvation (GO:0016036)|dopamine catabolic process (GO:0042420)|estrogen metabolic process (GO:0008210)|female pregnancy (GO:0007565)|learning (GO:0007612)|methylation (GO:0032259)|multicellular organismal reproductive process (GO:0048609)|negative regulation of dopamine metabolic process (GO:0045963)|negative regulation of smooth muscle cell proliferation (GO:0048662)|neurotransmitter biosynthetic process (GO:0042136)|neurotransmitter catabolic process (GO:0042135)|positive regulation of homocysteine metabolic process (GO:0050668)|response to drug (GO:0042493)|response to lipopolysaccharide (GO:0032496)|response to organic cyclic compound (GO:0014070)|response to pain (GO:0048265)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	catechol O-methyltransferase activity (GO:0016206)|magnesium ion binding (GO:0000287)|O-methyltransferase activity (GO:0008171)			kidney(1)|lung(1)|ovary(1)|prostate(1)|stomach(1)	5	Colorectal(54;0.0993)				Conjugated Estrogens(DB00286)|Diethylstilbestrol(DB00255)|Dobutamine(DB00841)|Dopamine(DB00988)|Entacapone(DB00494)|Methyldopa(DB00968)|Micafungin(DB01141)|S-Adenosylmethionine(DB00118)|Testosterone Propionate(DB01420)|Tolcapone(DB00323)	CCTCTCCAAAGAGCCAGGCAT	0.632													G|||	874	0.174521	0.1241	0.2219	5008	,	,		18599	0.123		0.1869	False		,,,				2504	0.2495					dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0				CCDS13770.1, CCDS46663.1	22q11.21	2012-10-02			ENSG00000093010	ENSG00000093010	2.1.1.6		2228	protein-coding gene	gene with protein product		116790				1572656	Standard	NM_000754		Approved		uc002zqu.3	P21964	OTTHUMG00000150529	ENST00000361682.6:c.615+75G>C	22.37:g.19951897G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	A8MPV9|Q6IB07|Q6ICE6|Q9BWC7	Missense_Mutation	SNP	pfam_O-MeTrfase_3,pirsf_Catechol_O-MeTrfase_euk	p.K230N	ENST00000361682.6	37	c.690	CCDS13770.1	22	362	0.16575091575091574	73	0.1483739837398374	78	0.2154696132596685	64	0.11188811188811189	147	0.19393139841688653	G	9.617	1.132749	0.21041	.	.	ENSG00000093010	ENST00000403184	T	0.70631	-0.5	3.19	-1.95	0.07548	.	.	.	.	.	T	0.00039	0.0001	.	.	.	0.80722	P	0.0	B	0.06786	0.001	B	0.01281	0.0	T	0.06716	-1.0811	6	.	.	.	.	8.6346	0.33939	0.0:0.5136:0.2239:0.2625	rs4646315	230	E7EUU8	.	N	230	ENSP00000383966:K230N	.	K	+	3	2	COMT	18331897	0.002000	0.14202	0.001000	0.08648	0.022000	0.10575	0.783000	0.26802	-0.236000	0.09753	0.462000	0.41574	AAG	COMT	-	pirsf_Catechol_O-MeTrfase_euk	ENSG00000093010		0.632	COMT-011	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	COMT	HGNC	protein_coding	OTTHUMT00000318936.2	51	0.00	0	G	NM_000754		19951897	19951897	+1	no_errors	ENST00000403184	ensembl	human	putative	69_37n	missense	45	13.46	7	SNP	0.000	C
COPE	11316	genome.wustl.edu	37	19	19030117	19030117	+	Missense_Mutation	SNP	C	C	G			TCGA-A1-A0SK-01A-12D-A099-09	TCGA-A1-A0SK-10A-03D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d1b43161-cbc1-4bf6-b8bb-a72a2e5e1150	2a5384f3-fec7-4265-b104-987f0718574b	g.chr19:19030117C>G	ENST00000262812.4	-	1	89	c.41G>C	c.(40-42)gGg>gCg	p.G14A	COPE_ENST00000351079.4_Missense_Mutation_p.G14A|COPE_ENST00000600932.1_Missense_Mutation_p.G14A|DDX49_ENST00000438170.2_5'Flank|COPE_ENST00000349893.4_Missense_Mutation_p.G14A|AC002985.3_ENST00000596918.1_Intron|DDX49_ENST00000247003.4_5'Flank	NM_007263.3	NP_009194.2	O14579	COPE_HUMAN	coatomer protein complex, subunit epsilon	14					COPI coating of Golgi vesicle (GO:0048205)|intra-Golgi vesicle-mediated transport (GO:0006891)|membrane organization (GO:0061024)|protein transport (GO:0015031)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)	COPI vesicle coat (GO:0030126)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)	structural molecule activity (GO:0005198)			breast(1)|central_nervous_system(2)|kidney(2)|large_intestine(2)|lung(2)|ovary(1)|skin(1)	11						GTCTACCTCCCCGGAGCCGCC	0.647																																						dbGAP											0													37.0	40.0	39.0					19																	19030117		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ131182	CCDS12387.1, CCDS12388.1, CCDS12389.1	19p13.11	2008-02-05				ENSG00000105669			2234	protein-coding gene	gene with protein product		606942				10469566	Standard	NM_007263		Approved	epsilon-COP	uc002nkk.3	O14579		ENST00000262812.4:c.41G>C	19.37:g.19030117C>G	ENSP00000262812:p.Gly14Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NE29|A6NKA3|O76097|Q6IBB8|Q9UGP6	Missense_Mutation	SNP	pfam_Coatomer_esu,pirsf_Coatomer_esu	p.G14A	ENST00000262812.4	37	c.41	CCDS12387.1	19	.	.	.	.	.	.	.	.	.	.	C	19.55	3.848047	0.71603	.	.	ENSG00000105669	ENST00000262812;ENST00000351079;ENST00000349893;ENST00000538245	T;T;T	0.44482	1.53;0.92;1.55	5.66	5.66	0.87406	.	0.000000	0.85682	D	0.000000	T	0.43875	0.1267	N	0.05414	-0.055	0.51482	D	0.999923	D;D;D;D	0.76494	0.999;0.999;0.999;0.999	D;D;D;D	0.81914	0.995;0.995;0.995;0.987	T	0.36915	-0.9728	10	0.13108	T	0.6	-55.8936	18.7336	0.91746	0.0:1.0:0.0:0.0	.	14;14;14;14	Q53HJ6;A6NE29;A6NKA3;O14579	.;.;.;COPE_HUMAN	A	14;14;14;13	ENSP00000262812:G14A;ENSP00000345674:G14A;ENSP00000343134:G14A	ENSP00000262812:G14A	G	-	2	0	COPE	18891117	1.000000	0.71417	0.979000	0.43373	0.709000	0.40893	5.771000	0.68881	2.679000	0.91253	0.563000	0.77884	GGG	COPE	-	pirsf_Coatomer_esu	ENSG00000105669		0.647	COPE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COPE	HGNC	protein_coding	OTTHUMT00000464801.1	74	0.00	0	C	NM_007263		19030117	19030117	-1	no_errors	ENST00000262812	ensembl	human	known	69_37n	missense	61	24.69	20	SNP	0.999	G
MAGEA12	4111	genome.wustl.edu	37	X	151896334	151896334	+	IGR	SNP	G	G	A	rs2515828	byFrequency	TCGA-A1-A0SK-01A-12D-A099-09	TCGA-A1-A0SK-10A-03D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d1b43161-cbc1-4bf6-b8bb-a72a2e5e1150	2a5384f3-fec7-4265-b104-987f0718574b	g.chrX:151896334G>A	ENST00000357916.4	-	0	1664				CSAG4_ENST00000361201.4_RNA	NM_005367.5	NP_005358.2	P43365	MAGAC_HUMAN	melanoma antigen family A, 12									p.P26P(2)		breast(5)|large_intestine(5)|liver(1)|lung(14)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	28	Acute lymphoblastic leukemia(192;6.56e-05)					GTTCCCTTCCGGGTTGTCTTG	0.527													.|||	1768	0.468344	0.4735	0.5231	3775	,	,		11227	0.245		0.2793	False		,,,				2504	0.2566					dbGAP											2	Substitution - coding silent(2)	kidney(1)|endometrium(1)																																								-	-	-	SO:0001628	intergenic_variant	0				CCDS76048.1	Xq28	2009-03-13			ENSG00000213401	ENSG00000213401			6799	protein-coding gene	gene with protein product	"""cancer/testis antigen family 1, member 12"""	300177		MAGE12		8575766	Standard	NM_001166386		Approved	CT1.12	uc004fgc.3	P43365	OTTHUMG00000022650		X.37:g.151896334G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q9NSD3	RNA	SNP	-	NULL	ENST00000357916.4	37	NULL	CCDS14710.1	X																																																																																			CSAG4	-	-	ENSG00000242599		0.527	MAGEA12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CSAG4	HGNC	protein_coding	OTTHUMT00000058764.1	561	0.18	1	G	NM_005367		151896334	151896334	-1	no_errors	ENST00000361201	ensembl	human	known	69_37n	rna	222	13.95	36	SNP	0.000	A
CTSO	1519	genome.wustl.edu	37	4	156863572	156863572	+	Missense_Mutation	SNP	C	C	A			TCGA-A1-A0SK-01A-12D-A099-09	TCGA-A1-A0SK-10A-03D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d1b43161-cbc1-4bf6-b8bb-a72a2e5e1150	2a5384f3-fec7-4265-b104-987f0718574b	g.chr4:156863572C>A	ENST00000433477.3	-	3	350	c.281G>T	c.(280-282)aGa>aTa	p.R94I		NM_001334.2	NP_001325.1	P43235	CATK_HUMAN	cathepsin O	0					bone resorption (GO:0045453)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|innate immune response (GO:0045087)|intramembranous ossification (GO:0001957)|proteolysis (GO:0006508)|proteolysis involved in cellular protein catabolic process (GO:0051603)|toll-like receptor signaling pathway (GO:0002224)	endolysosome lumen (GO:0036021)|extracellular region (GO:0005576)|extracellular space (GO:0005615)	collagen binding (GO:0005518)|cysteine-type endopeptidase activity (GO:0004197)|cysteine-type peptidase activity (GO:0008234)|fibronectin binding (GO:0001968)|proteoglycan binding (GO:0043394)			breast(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(3)|prostate(1)	16	all_hematologic(180;0.24)	Renal(120;0.0458)		KIRC - Kidney renal clear cell carcinoma(143;0.05)|Kidney(143;0.0627)|COAD - Colon adenocarcinoma(41;0.148)		TGCTGAGTATCTGGGAAACTT	0.348																																					Pancreas(148;2303 2598 8989 35298)	dbGAP											0													133.0	121.0	125.0					4																	156863572		2203	4300	6503	-	-	-	SO:0001583	missense	0			X77383	CCDS3794.1	4q32.1	2012-10-03			ENSG00000256043	ENSG00000256043		"""Cathepsins"""	2542	protein-coding gene	gene with protein product		600550		CTSO1		9790772	Standard	NM_001334		Approved		uc003ipg.3	P43234	OTTHUMG00000161942	ENST00000433477.3:c.281G>T	4.37:g.156863572C>A	ENSP00000414904:p.Arg94Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6FHS6	Missense_Mutation	SNP	pfam_Peptidase_C1A_C,smart_Peptidase_C1A_C,prints_Peptidase_C1A_C	p.R94I	ENST00000433477.3	37	c.281	CCDS3794.1	4	.	.	.	.	.	.	.	.	.	.	C	9.490	1.100345	0.20552	.	.	ENSG00000256043	ENST00000433477	T	0.28895	1.59	5.52	2.54	0.30619	.	0.515591	0.21181	N	0.078803	T	0.24624	0.0597	L	0.58101	1.795	0.21220	N	0.999758	B	0.16166	0.016	B	0.15484	0.013	T	0.17501	-1.0367	10	0.36615	T	0.2	.	3.9295	0.09278	0.1201:0.5646:0.106:0.2093	.	94	P43234	CATO_HUMAN	I	94	ENSP00000414904:R94I	ENSP00000281527:R94I	R	-	2	0	CTSO	157083022	0.922000	0.31269	0.439000	0.26833	0.228000	0.25075	0.105000	0.15333	0.708000	0.31955	0.655000	0.94253	AGA	CTSO	-	NULL	ENSG00000256043		0.348	CTSO-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CTSO	HGNC	protein_coding	OTTHUMT00000366469.1	278	0.00	0	C	NM_001334		156863572	156863572	-1	no_errors	ENST00000433477	ensembl	human	known	69_37n	missense	79	11.24	10	SNP	0.050	A
CXXC5	51523	genome.wustl.edu	37	5	139060486	139060486	+	Silent	SNP	G	G	A	rs356445	byFrequency	TCGA-A1-A0SK-01A-12D-A099-09	TCGA-A1-A0SK-10A-03D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d1b43161-cbc1-4bf6-b8bb-a72a2e5e1150	2a5384f3-fec7-4265-b104-987f0718574b	g.chr5:139060486G>A	ENST00000302517.3	+	2	1092	c.378G>A	c.(376-378)gcG>gcA	p.A126A	CXXC5_ENST00000511048.1_Silent_p.A126A	NM_016463.7	NP_057547.5	Q7LFL8	CXXC5_HUMAN	CXXC finger protein 5	126					positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nucleolus (GO:0005730)	DNA binding (GO:0003677)|signal transducer activity (GO:0004871)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(1)|large_intestine(2)|lung(7)|upper_aerodigestive_tract(1)	12			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CGGCCATGGCGGTGGACAAAA	0.652													G|||	957	0.191094	0.5015	0.0634	5008	,	,		16819	0.0585		0.0517	False		,,,				2504	0.1421					dbGAP											0													68.0	83.0	78.0					5																	139060486		2111	4242	6353	-	-	-	SO:0001819	synonymous_variant	0			AK024338	CCDS43370.1	5q31.3	2014-02-18	2011-12-01						26943	protein-coding gene	gene with protein product	"""retinoid-inducible nuclear factor"", ""WT1-induced Inhibitor of Dishevelled"""	612752				11042152, 19001364, 19182210, 20220130	Standard	NM_016463		Approved	HSPC195, RINF, WID	uc010jfg.1	Q7LFL8		ENST00000302517.3:c.378G>A	5.37:g.139060486G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B3KND0|C8CBA8|Q8TB79|Q9NV51|Q9P0S8	Silent	SNP	pfam_Znf_CXXC,pfscan_Znf_CXXC	p.A126	ENST00000302517.3	37	c.378	CCDS43370.1	5																																																																																			CXXC5	-	NULL	ENSG00000171604		0.652	CXXC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CXXC5	HGNC	protein_coding	OTTHUMT00000372744.1	76	0.00	0	G	NM_016463		139060486	139060486	+1	no_errors	ENST00000302517	ensembl	human	known	69_37n	silent	26	25.71	9	SNP	0.097	A
CYP2D7	1564	genome.wustl.edu	37	22	42538826	42538826	+	RNA	SNP	C	C	G	rs184023369	byFrequency	TCGA-A1-A0SK-01A-12D-A099-09	TCGA-A1-A0SK-10A-03D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d1b43161-cbc1-4bf6-b8bb-a72a2e5e1150	2a5384f3-fec7-4265-b104-987f0718574b	g.chr22:42538826C>G	ENST00000428786.1	-	0	0				CYP2D7P1_ENST00000358097.4_RNA|CYP2D7P1_ENST00000424775.1_RNA|CYP2D7P1_ENST00000433992.1_RNA																							GCAAGGTGGACACGGAGAAGC	0.692													c|||	49	0.00978435	0.0015	0.0058	5008	,	,		13211	0.0317		0.0089	False		,,,				2504	0.002					dbGAP											0																																										-	-	-			0																															22.37:g.42538826C>G		Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	NULL	p.V137L	ENST00000428786.1	37	c.409		22																																																																																			CYP2D7P1	-	NULL	ENSG00000205702		0.692	RP4-669P10.16-001	KNOWN	basic|exp_conf	sense_intronic	CYP2D7P1	HGNC	sense_intronic	OTTHUMT00000320534.1	111	0.00	0	C			42538826	42538826	-1	pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000433992	ensembl	human	known	69_37n	missense	80	11.11	10	SNP	0.360	G
DDHD1	80821	genome.wustl.edu	37	14	53525231	53525231	+	Missense_Mutation	SNP	G	G	C	rs369099316		TCGA-A1-A0SK-01A-12D-A099-09	TCGA-A1-A0SK-10A-03D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d1b43161-cbc1-4bf6-b8bb-a72a2e5e1150	2a5384f3-fec7-4265-b104-987f0718574b	g.chr14:53525231G>C	ENST00000323669.5	-	9	1955	c.1956C>G	c.(1954-1956)aaC>aaG	p.N652K	DDHD1_ENST00000395606.1_Missense_Mutation_p.N659K|DDHD1_ENST00000357758.3_Missense_Mutation_p.N652K	NM_001160148.1	NP_001153620.1	Q8NEL9	DDHD1_HUMAN	DDHD domain containing 1	652	DDHD. {ECO:0000255|PROSITE- ProRule:PRU00378}.				cell death (GO:0008219)|lipid catabolic process (GO:0016042)	cytoplasm (GO:0005737)	hydrolase activity (GO:0016787)|metal ion binding (GO:0046872)			breast(2)|cervix(1)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(4)|lung(11)|ovary(3)|prostate(1)	25	Breast(41;0.037)					TTAGTAACCGGTTACAAATCT	0.393																																						dbGAP											0													98.0	107.0	104.0					14																	53525231		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB051492	CCDS9714.1, CCDS53895.1, CCDS53896.1	14q21	2012-11-23			ENSG00000100523	ENSG00000100523			19714	protein-coding gene	gene with protein product	"""phosphatidic acid-preferring phospholipase A1"""	614603	"""spastic paraplegia 28 (autosomal recessive)"""	SPG28		11214970, 20359546	Standard	NM_030637		Approved	KIAA1705, PA-PLA1	uc001xai.3	Q8NEL9	OTTHUMG00000140305	ENST00000323669.5:c.1956C>G	14.37:g.53525231G>C	ENSP00000327104:p.Asn652Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	G5E9D1|Q8WVH3|Q96LL2|Q9C0F8	Missense_Mutation	SNP	pfam_DDHD,pfscan_DDHD	p.N652K	ENST00000323669.5	37	c.1956	CCDS53895.1	14	.	.	.	.	.	.	.	.	.	.	G	5.834	0.338189	0.11069	.	.	ENSG00000100523	ENST00000323669;ENST00000395606;ENST00000357758;ENST00000395610	.	.	.	6.14	3.38	0.38709	DDHD (2);	0.261081	0.49305	D	0.000143	T	0.28928	0.0718	N	0.10916	0.065	0.40763	D	0.983022	B;B;B;B	0.25486	0.026;0.037;0.127;0.022	B;B;B;B	0.31869	0.017;0.032;0.137;0.032	T	0.15122	-1.0448	9	0.02654	T	1	-23.8042	9.477	0.38878	0.2161:0.0:0.7839:0.0	.	48;659;652;652	Q2VYF2;G5E9D1;Q8NEL9;Q8NEL9-2	.;.;DDHD1_HUMAN;.	K	652;659;652;523	.	ENSP00000327104:N652K	N	-	3	2	DDHD1	52594981	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.590000	0.46154	0.487000	0.27698	0.637000	0.83480	AAC	DDHD1	-	pfam_DDHD,pfscan_DDHD	ENSG00000100523		0.393	DDHD1-003	KNOWN	basic|exp_conf|CCDS	protein_coding	DDHD1	HGNC	protein_coding	OTTHUMT00000276901.1	115	0.00	0	G			53525231	53525231	-1	no_errors	ENST00000323669	ensembl	human	known	69_37n	missense	110	11.29	14	SNP	1.000	C
DDX11	1663	genome.wustl.edu	37	12	31254897	31254897	+	Missense_Mutation	SNP	G	G	A	rs201399897		TCGA-A1-A0SK-01A-12D-A099-09	TCGA-A1-A0SK-10A-03D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d1b43161-cbc1-4bf6-b8bb-a72a2e5e1150	2a5384f3-fec7-4265-b104-987f0718574b	g.chr12:31254897G>A	ENST00000407793.2	+	21	2434	c.2183G>A	c.(2182-2184)cGt>cAt	p.R728H	DDX11_ENST00000542838.1_Missense_Mutation_p.R728H|DDX11_ENST00000228264.6_Missense_Mutation_p.R702H|DDX11_ENST00000350437.4_Intron|DDX11_ENST00000545668.1_Missense_Mutation_p.R728H|DDX11_ENST00000251758.5_3'UTR	NM_030653.3|NM_152438.1	NP_085911.2|NP_689651.1	Q96FC9	DDX11_HUMAN	DEAD/H (Asp-Glu-Ala-Asp/His) box helicase 11	728					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|ATP catabolic process (GO:0006200)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|sister chromatid cohesion (GO:0007062)|viral process (GO:0016032)	midbody (GO:0030496)|nuclear chromatin (GO:0000790)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle pole (GO:0000922)	4 iron, 4 sulfur cluster binding (GO:0051539)|ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|DNA-dependent ATPase activity (GO:0008094)|double-stranded DNA binding (GO:0003690)|helicase activity (GO:0004386)|metal ion binding (GO:0046872)|RNA binding (GO:0003723)|single-stranded DNA binding (GO:0003697)			breast(4)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(11)|large_intestine(5)|lung(23)|prostate(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	57	all_cancers(9;1.77e-11)|all_lung(12;6.21e-11)|all_epithelial(9;6.49e-11)|Lung NSC(12;1.06e-08)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.0429)|Lung SC(12;0.0592)|Esophageal squamous(101;0.233)					CTGCTGGGCCGTCTGGCTGCC	0.637										Multiple Myeloma(12;0.14)																												dbGAP											0													48.0	48.0	48.0					12																	31254897		1874	4064	5938	-	-	-	SO:0001583	missense	0			U75969	CCDS8721.1, CCDS41767.1, CCDS44856.1, CCDS58224.1	12p11.21	2012-02-23	2012-02-23		ENSG00000013573	ENSG00000013573		"""DEAD-boxes"""	2736	protein-coding gene	gene with protein product	"""CHL1-like helicase homolog (S. cerevisiae)"""	601150	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 11 (S.cerevisiae CHL1-like helicase)"", ""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 11"""				Standard	NM_030653		Approved	CHLR1, KRG2, CHL1, ChlR1, WABS	uc001rjv.2	Q96FC9	OTTHUMG00000168435	ENST00000407793.2:c.2183G>A	12.37:g.31254897G>A	ENSP00000384703:p.Arg728His	Somatic		WXS	Illumina GAIIx	Phase_IV	Q13333|Q86VQ4|Q86W62|Q92498|Q92770|Q92998|Q92999	Missense_Mutation	SNP	pfam_DEAD_2,smart_Helicase-like_DEXD_c2,smart_ATP-dep_Helicase_C,pfscan_Helic_SF1/SF2_ATP-bd_DinG/Rad3,tigrfam_DNA_helicase_DNA-repair_Rad3	p.R728H	ENST00000407793.2	37	c.2183	CCDS44856.1	12	.	.	.	.	.	.	.	.	.	.	G	13.79	2.341021	0.41498	.	.	ENSG00000013573	ENST00000542838;ENST00000407793;ENST00000404673;ENST00000228264;ENST00000545668	D;T;D;T	0.82619	-1.63;-0.79;-1.54;-0.79	3.85	2.92	0.33932	Helicase, ATP-dependent, c2 type (1);	0.106585	0.64402	N	0.000003	D	0.89612	0.6765	M	0.83118	2.625	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.72982	0.961;0.979;0.961	D	0.89845	0.4005	10	0.66056	D	0.02	.	9.6123	0.39670	0.1097:0.0:0.8903:0.0	.	702;728;728	Q96FC9-3;Q96FC9;Q96FC9-2	.;DDX11_HUMAN;.	H	728;728;453;702;728	ENSP00000443426:R728H;ENSP00000384703:R728H;ENSP00000228264:R702H;ENSP00000440402:R728H	ENSP00000228264:R702H	R	+	2	0	DDX11	31146164	1.000000	0.71417	0.981000	0.43875	0.032000	0.12392	7.072000	0.76777	1.973000	0.57446	0.603000	0.83216	CGT	DDX11	-	smart_ATP-dep_Helicase_C,tigrfam_DNA_helicase_DNA-repair_Rad3	ENSG00000013573		0.637	DDX11-202	KNOWN	basic|CCDS	protein_coding	DDX11	HGNC	protein_coding	OTTHUMT00000399728.1	477	0.42	2	G	NM_030653		31254897	31254897	+1	no_errors	ENST00000407793	ensembl	human	known	69_37n	missense	121	13.57	19	SNP	0.998	A
DHDDS	79947	genome.wustl.edu	37	1	26784300	26784300	+	Silent	SNP	G	G	C			TCGA-A1-A0SK-01A-12D-A099-09	TCGA-A1-A0SK-10A-03D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d1b43161-cbc1-4bf6-b8bb-a72a2e5e1150	2a5384f3-fec7-4265-b104-987f0718574b	g.chr1:26784300G>C	ENST00000236342.7	+	7	654	c.561G>C	c.(559-561)ctG>ctC	p.L187L	DHDDS_ENST00000525682.2_Silent_p.L153L|DHDDS_ENST00000526219.1_Silent_p.L148L|DHDDS_ENST00000360009.2_Silent_p.L187L			Q86SQ9	DHDDS_HUMAN	dehydrodolichyl diphosphate synthase	187					cellular protein metabolic process (GO:0044267)|dolichol-linked oligosaccharide biosynthetic process (GO:0006488)|dolichyl diphosphate biosynthetic process (GO:0006489)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)	endoplasmic reticulum membrane (GO:0005789)	transferase activity, transferring alkyl or aryl (other than methyl) groups (GO:0016765)			breast(5)|endometrium(2)|large_intestine(2)|lung(4)|stomach(1)|urinary_tract(1)	15		all_cancers(24;2.04e-25)|Colorectal(325;3.46e-05)|all_lung(284;5.94e-05)|Lung NSC(340;7.26e-05)|Renal(390;0.0007)|Ovarian(437;0.00473)|Breast(348;0.00637)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|OV - Ovarian serous cystadenocarcinoma(117;1.11e-27)|Colorectal(126;1.61e-08)|COAD - Colon adenocarcinoma(152;9.32e-07)|KIRC - Kidney renal clear cell carcinoma(1967;0.000794)|BRCA - Breast invasive adenocarcinoma(304;0.00104)|STAD - Stomach adenocarcinoma(196;0.00154)|GBM - Glioblastoma multiforme(114;0.0161)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.166)|LUSC - Lung squamous cell carcinoma(448;0.239)		CTGAGTCTCTGCTTGATAAGT	0.458																																						dbGAP											0													290.0	250.0	264.0					1																	26784300		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK023164	CCDS281.1, CCDS282.1, CCDS57984.1, CCDS57983.1	1p35.3	2014-01-28			ENSG00000117682	ENSG00000117682			20603	protein-coding gene	gene with protein product		608172				12591616	Standard	NM_024887		Approved	HDS, FLJ13102, DS, RP59	uc001bmk.3	Q86SQ9	OTTHUMG00000003554	ENST00000236342.7:c.561G>C	1.37:g.26784300G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	B7Z4B9|B7ZB20|D3DPK7|D3DPK8|D3DPK9|E9KL43|Q5T0A4|Q8NE90|Q9BTG5|Q9BTK3|Q9H905	Missense_Mutation	SNP	pfam_UPP_synth-like,superfamily_UPP_synth-like,tigrfam_UPP_synth-like	p.A64P	ENST00000236342.7	37	c.190	CCDS282.1	1	.	.	.	.	.	.	.	.	.	.	G	7.428	0.638082	0.14386	.	.	ENSG00000117682	ENST00000416052	.	.	.	5.76	1.38	0.22167	.	.	.	.	.	T	0.57725	0.2073	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.51725	-0.8669	4	.	.	.	-11.8515	9.3357	0.38049	0.0:0.2423:0.3845:0.3731	.	.	.	.	P	64	.	.	A	+	1	0	DHDDS	26656887	1.000000	0.71417	1.000000	0.80357	0.900000	0.52787	1.784000	0.38674	0.403000	0.25479	-1.045000	0.02358	GCT	DHDDS	-	pfam_UPP_synth-like,superfamily_UPP_synth-like,tigrfam_UPP_synth-like	ENSG00000117682		0.458	DHDDS-011	KNOWN	basic|appris_candidate|CCDS	protein_coding	DHDDS	HGNC	protein_coding	OTTHUMT00000392504.1	652	0.00	0	G	NM_024887		26784300	26784300	+1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000416052	ensembl	human	putative	69_37n	missense	102	15.00	18	SNP	1.000	C
DNAH14	127602	genome.wustl.edu	37	1	225380398	225380398	+	Splice_Site	SNP	A	A	G	rs143317903	byFrequency	TCGA-A1-A0SK-01A-12D-A099-09	TCGA-A1-A0SK-10A-03D-A099-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d1b43161-cbc1-4bf6-b8bb-a72a2e5e1150	2a5384f3-fec7-4265-b104-987f0718574b	g.chr1:225380398A>G	ENST00000445597.2	+	25	4390	c.4390A>G	c.(4390-4392)Att>Gtt	p.I1464V	DNAH14_ENST00000439375.2_Splice_Site_p.I1869V|DNAH14_ENST00000430092.1_Splice_Site_p.I1869V			Q0VDD8	DYH14_HUMAN	dynein, axonemal, heavy chain 14	1464					microtubule-based movement (GO:0007018)	cilium (GO:0005929)|cytoplasm (GO:0005737)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|microtubule motor activity (GO:0003777)			NS(2)|breast(3)|central_nervous_system(3)|endometrium(8)|kidney(4)|large_intestine(2)|lung(2)|skin(2)|stomach(1)	27						TTTTTCCCAGATTTCAGAAAG	0.299													A|||	40	0.00798722	0.0257	0.0086	5008	,	,		16059	0.0		0.0	False		,,,				2504	0.0					dbGAP											0													34.0	27.0	29.0					1																	225380398		692	1585	2277	-	-	-	SO:0001630	splice_region_variant	0			U61741	CCDS41472.1, CCDS44322.1	1q42.13	2009-02-12	2006-09-04		ENSG00000185842	ENSG00000185842		"""Axonemal dyneins"""	2945	protein-coding gene	gene with protein product		603341	"""dynein, axonemal, heavy polypeptide 14"", ""chromosome 1 open reading frame 67"""	C1orf67		8812413	Standard	NM_144989		Approved	Dnahc14, HL-18, HL18, DKFZp781B1548, MGC27277	uc001how.2	Q0VDD8	OTTHUMG00000037447	ENST00000445597.2:c.4390-1A>G	1.37:g.225380398A>G		Somatic		WXS	Illumina GAIIx	Phase_IV	A6NG62|A6NNL2|Q0VDD9|Q4VXC7|Q4VXG4|Q4VXG5|Q5VU33|Q5VU34	Missense_Mutation	SNP	pfam_Dynein_heavy,pfam_Dynein_heavy_dom-2,superfamily_Tautomerase,smart_AAA+_ATPase	p.I1869V	ENST00000445597.2	37	c.5605		1	14	0.00641025641025641	11	0.022357723577235773	3	0.008287292817679558	0	0.0	0	0.0	A	4.003	-0.002214	0.07819	.	.	ENSG00000185842	ENST00000445597;ENST00000430092;ENST00000439375;ENST00000328556	T;D;D;D	0.86366	3.32;-2.11;-2.11;-2.11	5.22	-2.86	0.05717	.	.	.	.	.	T	0.57932	0.2087	L	0.34521	1.04	0.40301	D	0.978605	B	0.06786	0.001	B	0.08055	0.003	T	0.52396	-0.8581	8	.	.	.	.	0.756	0.00999	0.381:0.1152:0.2664:0.2374	.	1869	Q0VDD8-4	.	V	1464;1869;1869;963	ENSP00000409472:I1464V;ENSP00000414402:I1869V;ENSP00000392061:I1869V;ENSP00000332424:I963V	.	I	+	1	0	DNAH14	223447021	0.012000	0.17670	0.135000	0.22099	0.100000	0.18952	-0.167000	0.09940	-0.275000	0.09219	0.491000	0.48974	ATT	DNAH14	-	smart_AAA+_ATPase	ENSG00000185842		0.299	DNAH14-007	PUTATIVE	basic|exp_conf	protein_coding	DNAH14	HGNC	protein_coding	OTTHUMT00000331217.3	27	0.00	0	A	XM_059166	Missense_Mutation	225380398	225380398	+1	no_errors	ENST00000430092	ensembl	human	known	69_37n	missense	62	11.43	8	SNP	0.025	G
DNM1P46	196968	genome.wustl.edu	37	15	100333090	100333090	+	RNA	SNP	T	T	C	rs201082411		TCGA-A1-A0SK-01A-12D-A099-09	TCGA-A1-A0SK-10A-03D-A099-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d1b43161-cbc1-4bf6-b8bb-a72a2e5e1150	2a5384f3-fec7-4265-b104-987f0718574b	g.chr15:100333090T>C	ENST00000341853.1	-	0	1101				AC090825.1_ENST00000408584.1_RNA|RN7SL484P_ENST00000462651.2_RNA	NR_003260.1		Q6ZS02	DMP46_HUMAN	DNM1 pseudogene 46							microtubule (GO:0005874)	GTPase activity (GO:0003924)	p.C178R(2)									GCCATTCTTTTGCTGGGCTTG	0.478																																						dbGAP											2	Substitution - Missense(2)	prostate(2)											121.0	101.0	107.0					15																	100333090		876	1990	2866	-	-	-			0			AJ576275		15q26.3	2013-04-25			ENSG00000182397	ENSG00000182397			35199	pseudogene	pseudogene			"""chromosome 15 open reading frame 51"""	DNM1DN14@, C15orf51			Standard	NR_003260		Approved	DNM1DN14.2, FLJ45937, DKFZp434I1020	uc021sxl.1	Q6ZS02	OTTHUMG00000149852		15.37:g.100333090T>C		Somatic		WXS	Illumina GAIIx	Phase_IV	Q3ZCN3	RNA	SNP	-	NULL	ENST00000341853.1	37	NULL		15																																																																																			DNM1P46	-	-	ENSG00000182397		0.478	DNM1P46-002	KNOWN	basic	processed_transcript	DNM1P46	HGNC	pseudogene	OTTHUMT00000313543.1	20	0.00	0	T	NR_003260		100333090	100333090	-1	no_errors	ENST00000341853	ensembl	human	known	69_37n	rna	486	13.52	76	SNP	0.002	C
DTX2	113878	genome.wustl.edu	37	7	76121509	76121509	+	Silent	SNP	C	C	T	rs148279131	byFrequency	TCGA-A1-A0SK-01A-12D-A099-09	TCGA-A1-A0SK-10A-03D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d1b43161-cbc1-4bf6-b8bb-a72a2e5e1150	2a5384f3-fec7-4265-b104-987f0718574b	g.chr7:76121509C>T	ENST00000324432.5	+	6	1458	c.948C>T	c.(946-948)agC>agT	p.S316S	DTX2_ENST00000413936.2_Silent_p.S316S|DTX2_ENST00000446820.2_Silent_p.S316S|DTX2_ENST00000307569.8_Silent_p.S316S|DTX2_ENST00000430490.2_Silent_p.S316S|DTX2_ENST00000446600.1_Silent_p.S225S	NM_020892.2	NP_065943.2	Q86UW9	DTX2_HUMAN	deltex 2, E3 ubiquitin ligase	316					Notch signaling pathway (GO:0007219)|protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)	ligase activity (GO:0016874)|zinc ion binding (GO:0008270)			NS(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(14)|ovary(1)|skin(1)|stomach(2)	27						GCCCAGGGAGCGTCCCTGCCA	0.632																																						dbGAP											0													6.0	10.0	9.0					7																	76121509		1723	3883	5606	-	-	-	SO:0001819	synonymous_variant	0				CCDS5587.1, CCDS43605.1	7q11.23	2014-01-28	2014-01-28		ENSG00000091073	ENSG00000091073		"""RING-type (C3HC4) zinc fingers"""	15973	protein-coding gene	gene with protein product		613141	"""deltex (Drosophila) homolog 2"", ""deltex homolog 2 (Drosophila)"""			12670957	Standard	NM_020892		Approved	RNF58, KIAA1528	uc003ufh.4	Q86UW9	OTTHUMG00000162594	ENST00000324432.5:c.948C>T	7.37:g.76121509C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q6XM87|Q6XM88|Q96H69|Q9H890|Q9P200	Missense_Mutation	SNP	NULL	p.R14C	ENST00000324432.5	37	c.40	CCDS5587.1	7																																																																																			DTX2	-	NULL	ENSG00000091073		0.632	DTX2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	DTX2	Clone_based_vega_gene	protein_coding	OTTHUMT00000253104.2	72	0.00	0	C			76121509	76121509	+1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000435251	ensembl	human	known	69_37n	missense	19	26.92	7	SNP	0.015	T
AC007952.5	0	genome.wustl.edu	37	17	18997106	18997106	+	Silent	SNP	G	G	T	rs201530851	byFrequency	TCGA-A1-A0SK-01A-12D-A099-09	TCGA-A1-A0SK-10A-03D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d1b43161-cbc1-4bf6-b8bb-a72a2e5e1150	2a5384f3-fec7-4265-b104-987f0718574b	g.chr17:18997106G>T	ENST00000399091.1	+	2	662	c.396G>T	c.(394-396)ggG>ggT	p.G132G	AC007952.5_ENST00000399093.1_Intron|AC007952.5_ENST00000428928.1_Silent_p.G148G|AC007952.5_ENST00000443876.1_Intron|RP11-160E2.19_ENST00000583141.1_lincRNA																							AAATGGCTGGGACGGGTGGGT	0.632																																						dbGAP											0																																										-	-	-	SO:0001819	synonymous_variant	0																														ENST00000399091.1:c.396G>T	17.37:g.18997106G>T		Somatic		WXS	Illumina GAIIx	Phase_IV		Silent	SNP	NULL	p.G148	ENST00000399091.1	37	c.444		17																																																																																			AC007952.5	-	NULL	ENSG00000228157		0.632	AC007952.5-002	NOVEL	not_best_in_genome_evidence|basic|appris_candidate	protein_coding	ENSG00000228157	Clone_based_vega_gene	protein_coding	OTTHUMT00000132165.1	49	0.00	0	G			18997106	18997106	+1	no_errors	ENST00000428928	ensembl	human	known	69_37n	silent	33	13.16	5	SNP	0.051	T
FABP5P3	220832	genome.wustl.edu	37	7	152139854	152139854	+	RNA	SNP	A	A	C	rs1972551	byFrequency	TCGA-A1-A0SK-01A-12D-A099-09	TCGA-A1-A0SK-10A-03D-A099-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d1b43161-cbc1-4bf6-b8bb-a72a2e5e1150	2a5384f3-fec7-4265-b104-987f0718574b	g.chr7:152139854A>C	ENST00000477993.1	+	0	609					NR_002935.1		A8MUU1	FB5L3_HUMAN	fatty acid binding protein 5 pseudogene 3								lipid binding (GO:0008289)|transporter activity (GO:0005215)										TTTGAAGAAAACACAGCTGAT	0.418													C|||	1853	0.370008	0.5666	0.3862	5008	,	,		19163	0.2222		0.3588	False		,,,				2504	0.2566					dbGAP											0																																										-	-	-			0					7q36.1	2010-10-12	2010-10-12	2010-10-12	ENSG00000241735	ENSG00000241735			22573	pseudogene	pseudogene			"""fatty acid binding protein 5-like 3"", ""fatty acid binding protein 5-like 3 (pseudogene)"""	FABP5L3			Standard	NR_002935		Approved	TCAG_1781704	uc003wlb.3	A8MUU1	OTTHUMG00000157257		7.37:g.152139854A>C		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000477993.1	37	NULL		7																																																																																			FABP5P3	-	-	ENSG00000241735		0.418	FABP5P3-001	KNOWN	basic	processed_transcript	FABP5P3	HGNC	pseudogene	OTTHUMT00000348208.1	27	0.00	0	A	NR_002935		152139854	152139854	+1	no_errors	ENST00000477993	ensembl	human	known	69_37n	rna	500	14.97	88	SNP	0.998	C
LOC101929008	101929008	genome.wustl.edu	37	16	90173048	90173048	+	lincRNA	SNP	C	C	T			TCGA-A1-A0SK-01A-12D-A099-09	TCGA-A1-A0SK-10A-03D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d1b43161-cbc1-4bf6-b8bb-a72a2e5e1150	2a5384f3-fec7-4265-b104-987f0718574b	g.chr16:90173048C>T	ENST00000562203.1	-	0	0																											GCCTCCTTCTCCTCAGCTCCT	0.642																																						dbGAP											0																																										-	-	-			0																															16.37:g.90173048C>T		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000562203.1	37	NULL		16																																																																																			FAM157C	-	-	ENSG00000260528		0.642	RP11-356C4.3-001	KNOWN	basic	lincRNA	FAM157C	HGNC	lincRNA	OTTHUMT00000420874.1	56	0.00	0	C			90173048	90173048	+1	no_errors	ENST00000563357	ensembl	human	known	69_37n	rna	109	11.38	14	SNP	0.016	T
FAM178B	51252	genome.wustl.edu	37	2	97613616	97613616	+	Silent	SNP	T	T	C	rs1624844	byFrequency	TCGA-A1-A0SK-01A-12D-A099-09	TCGA-A1-A0SK-10A-03D-A099-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d1b43161-cbc1-4bf6-b8bb-a72a2e5e1150	2a5384f3-fec7-4265-b104-987f0718574b	g.chr2:97613616T>C	ENST00000417561.3	-	12	1460	c.1461A>G	c.(1459-1461)acA>acG	p.T487T	FAM178B_ENST00000327896.3_Silent_p.T307T|FAM178B_ENST00000490605.2_Silent_p.T339T			Q8IXR5	F178B_HUMAN	family with sequence similarity 178, member B	487										large_intestine(1)|ovary(1)	2						CTCCCAAAGATGTTTCTGGAG	0.468													C|||	3322	0.663339	0.9569	0.5879	5008	,	,		19644	0.504		0.8131	False		,,,				2504	0.3303					dbGAP											0													90.0	77.0	81.0					2																	97613616		692	1591	2283	-	-	-	SO:0001819	synonymous_variant	0			AF151068, BC039488	CCDS33252.1, CCDS46366.1, CCDS46366.2	2q11.2	2008-08-08			ENSG00000168754	ENSG00000168754			28036	protein-coding gene	gene with protein product						11042152	Standard	NM_001122646		Approved	LOC51252	uc002sxl.4	Q8IXR5	OTTHUMG00000155257	ENST00000417561.3:c.1461A>G	2.37:g.97613616T>C		Somatic		WXS	Illumina GAIIx	Phase_IV	A8MXN2|E9PD86|Q8IUY0|Q9P0P4	Silent	SNP	NULL	p.T487	ENST00000417561.3	37	c.1461		2																																																																																			FAM178B	-	NULL	ENSG00000168754		0.468	FAM178B-202	KNOWN	basic	protein_coding	FAM178B	HGNC	protein_coding		145	0.00	0	T	NM_016490		97613616	97613616	-1	no_errors	ENST00000417561	ensembl	human	known	69_37n	silent	120	16.67	24	SNP	0.758	C
FAM178B	51252	genome.wustl.edu	37	2	97617140	97617140	+	Silent	SNP	T	T	C	rs1257019	byFrequency	TCGA-A1-A0SK-01A-12D-A099-09	TCGA-A1-A0SK-10A-03D-A099-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d1b43161-cbc1-4bf6-b8bb-a72a2e5e1150	2a5384f3-fec7-4265-b104-987f0718574b	g.chr2:97617140T>C	ENST00000417561.3	-	11	1412	c.1413A>G	c.(1411-1413)gtA>gtG	p.V471V	FAM178B_ENST00000327896.3_Silent_p.V291V|FAM178B_ENST00000490605.2_Silent_p.V323V			Q8IXR5	F178B_HUMAN	family with sequence similarity 178, member B	471										large_intestine(1)|ovary(1)	2						GGAGCAGGGATACCGGGCAGT	0.677											OREG0014816	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	C|||	3265	0.651957	0.9183	0.5807	5008	,	,		16840	0.504		0.8131	False		,,,				2504	0.3292					dbGAP											0													64.0	70.0	68.0					2																	97617140		692	1591	2283	-	-	-	SO:0001819	synonymous_variant	0			AF151068, BC039488	CCDS33252.1, CCDS46366.1, CCDS46366.2	2q11.2	2008-08-08			ENSG00000168754	ENSG00000168754			28036	protein-coding gene	gene with protein product						11042152	Standard	NM_001122646		Approved	LOC51252	uc002sxl.4	Q8IXR5	OTTHUMG00000155257	ENST00000417561.3:c.1413A>G	2.37:g.97617140T>C		Somatic	1329	WXS	Illumina GAIIx	Phase_IV	A8MXN2|E9PD86|Q8IUY0|Q9P0P4	Silent	SNP	NULL	p.V471	ENST00000417561.3	37	c.1413		2																																																																																			FAM178B	-	NULL	ENSG00000168754		0.677	FAM178B-202	KNOWN	basic	protein_coding	FAM178B	HGNC	protein_coding		289	0.00	0	T	NM_016490		97617140	97617140	-1	no_errors	ENST00000417561	ensembl	human	known	69_37n	silent	72	13.25	11	SNP	0.144	C
FAM86B1	85002	genome.wustl.edu	37	8	12041205	12041205	+	Frame_Shift_Del	DEL	C	C	-	rs562886765	byFrequency	TCGA-A1-A0SK-01A-12D-A099-09	TCGA-A1-A0SK-10A-03D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d1b43161-cbc1-4bf6-b8bb-a72a2e5e1150	2a5384f3-fec7-4265-b104-987f0718574b	g.chr8:12041205delC	ENST00000448228.2	-	7	850	c.801delG	c.(799-801)gggfs	p.G267fs	AC145124.1_ENST00000579282.1_RNA|FAM86B1_ENST00000533852.2_Frame_Shift_Del_p.G301fs|FAM86B1_ENST00000321602.8_Frame_Shift_Del_p.D121fs	NM_001083537.1	NP_001077006.1	Q8N7N1	F86B1_HUMAN	family with sequence similarity 86, member B1	267										kidney(1)|prostate(1)|stomach(1)	3			STAD - Stomach adenocarcinoma(15;0.033)	COAD - Colon adenocarcinoma(149;0.0965)		CCCATCTGATCCCATCCCGGC	0.552													ccc|CCC|CC|deletion	11	0.00219649	0.0068	0.0029	5008	,	,		21199	0.0		0.0	False		,,,				2504	0.0					dbGAP											0										38,2610		4,30,1290	7.0	5.0	5.0			1.2	0.1	8		5	0,5352		0,0,2676	no	frameshift	FAM86B1	NM_001083537.1		4,30,3966	A1A1,A1R,RR		0.0,1.435,0.475			12041205	38,7962	1820	3866	5686	-	-	-	SO:0001589	frameshift_variant	0			BC007983	CCDS59512.1	8p23.1	2014-02-12	2005-08-19		ENSG00000186523	ENSG00000186523			28268	protein-coding gene	gene with protein product						12477932	Standard	NM_001083537		Approved	MGC16279	uc010lse.3	Q8N7N1	OTTHUMG00000165298	ENST00000448228.2:c.801delG	8.37:g.12041205delC	ENSP00000407067:p.Gly267fs	Somatic		WXS	Illumina GAIIx	Phase_IV		Frame_Shift_Del	DEL	pfam_Nicotinamide_N-MeTfrase-like	p.I302fs	ENST00000448228.2	37	c.903	CCDS59512.1	8																																																																																			FAM86B1	-	NULL	ENSG00000186523		0.552	FAM86B1-016	KNOWN	basic|CCDS	protein_coding	FAM86B1	HGNC	protein_coding	OTTHUMT00000383317.1	108	0.00	0	C	NM_032916		12041205	12041205	-1	no_errors	ENST00000431227	ensembl	human	known	69_37n	frame_shift_del	26	10.00	3	DEL	0.089	-
FAM86B1	85002	genome.wustl.edu	37	8	12042939	12042939	+	Missense_Mutation	SNP	C	C	T	rs202021440	byFrequency	TCGA-A1-A0SK-01A-12D-A099-09	TCGA-A1-A0SK-10A-03D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d1b43161-cbc1-4bf6-b8bb-a72a2e5e1150	2a5384f3-fec7-4265-b104-987f0718574b	g.chr8:12042939C>T	ENST00000448228.2	-	6	785	c.736G>A	c.(736-738)Gtg>Atg	p.V246M	FAM86B1_ENST00000534520.1_3'UTR|FAM86B1_ENST00000533852.2_Missense_Mutation_p.V280M|FAM86B1_ENST00000321602.8_Missense_Mutation_p.V52M	NM_001083537.1	NP_001077006.1	Q8N7N1	F86B1_HUMAN	family with sequence similarity 86, member B1	246										kidney(1)|prostate(1)|stomach(1)	3			STAD - Stomach adenocarcinoma(15;0.033)	COAD - Colon adenocarcinoma(149;0.0965)		GTAAAGGCCACGTAGACCTCA	0.657													c|||	9	0.00179712	0.0053	0.0029	5008	,	,		13388	0.0		0.0	False		,,,				2504	0.0					dbGAP											0													18.0	23.0	21.0					8																	12042939		1390	2535	3925	-	-	-	SO:0001583	missense	0			BC007983	CCDS59512.1	8p23.1	2014-02-12	2005-08-19		ENSG00000186523	ENSG00000186523			28268	protein-coding gene	gene with protein product						12477932	Standard	NM_001083537		Approved	MGC16279	uc010lse.3	Q8N7N1	OTTHUMG00000165298	ENST00000448228.2:c.736G>A	8.37:g.12042939C>T	ENSP00000407067:p.Val246Met	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Nicotinamide_N-MeTfrase-like	p.V280M	ENST00000448228.2	37	c.838	CCDS59512.1	8	.	.	.	.	.	.	.	.	.	.	-	12.12	1.841867	0.32513	.	.	ENSG00000186523	ENST00000431227;ENST00000448228;ENST00000321602;ENST00000526708	T;T	0.34859	3.19;1.34	1.17	-0.9	0.10544	.	.	.	.	.	T	0.36936	0.0985	M	0.63428	1.95	0.54753	D	0.99998	P;B;D;D	0.58268	0.807;0.259;0.982;0.973	P;B;P;P	0.50049	0.629;0.259;0.571;0.536	T	0.32025	-0.9922	9	0.72032	D	0.01	.	3.9705	0.09451	0.0:0.5201:0.0:0.4799	.	246;280;52;89	Q8N7N1;E9PN63;F6QN85;Q4KMP3	F86B1_HUMAN;.;.;.	M	280;246;52;280	ENSP00000407067:V246M;ENSP00000439686:V52M	ENSP00000439686:V52M	V	-	1	0	FAM86B1	12080348	0.171000	0.23029	0.186000	0.23195	0.038000	0.13279	-0.701000	0.05075	-0.324000	0.08589	-1.195000	0.01675	GTG	FAM86B1	-	pfam_Nicotinamide_N-MeTfrase-like	ENSG00000186523		0.657	FAM86B1-016	KNOWN	basic|CCDS	protein_coding	FAM86B1	HGNC	protein_coding	OTTHUMT00000383317.1	91	0.00	0	C	NM_032916		12042939	12042939	-1	no_errors	ENST00000431227	ensembl	human	known	69_37n	missense	61	13.89	10	SNP	0.784	T
FAM86B2	653333	genome.wustl.edu	37	8	12286498	12286498	+	Missense_Mutation	SNP	G	G	C	rs552358938	byFrequency	TCGA-A1-A0SK-01A-12D-A099-09	TCGA-A1-A0SK-10A-03D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d1b43161-cbc1-4bf6-b8bb-a72a2e5e1150	2a5384f3-fec7-4265-b104-987f0718574b	g.chr8:12286498G>C	ENST00000262365.4	-	5	467	c.468C>G	c.(466-468)ttC>ttG	p.F156L	FAM86B2_ENST00000393715.3_Nonsense_Mutation_p.S17*|FAM86B2_ENST00000351291.4_Missense_Mutation_p.F122L|FAM86B2_ENST00000309608.5_Missense_Mutation_p.F122L	NM_001137610.1	NP_001131082.1	P0C5J1	F86B2_HUMAN	family with sequence similarity 86, member B2	156										endometrium(1)|kidney(2)	3						ACCTGTTAATGAAGGCTGCCG	0.612													g|||	392	0.0782748	0.0295	0.1297	5008	,	,		20523	0.0764		0.0885	False		,,,				2504	0.0992					dbGAP											0													1.0	1.0	1.0					8																	12286498		129	503	632	-	-	-	SO:0001583	missense	0				CCDS59092.1	8p23.1	2011-07-01			ENSG00000145002	ENSG00000145002			32222	protein-coding gene	gene with protein product							Standard	NM_001137610		Approved		uc003wvt.4	P0C5J1	OTTHUMG00000165462	ENST00000262365.4:c.468C>G	8.37:g.12286498G>C	ENSP00000262365:p.Phe156Leu	Somatic		WXS	Illumina GAIIx	Phase_IV		Nonsense_Mutation	SNP	NULL	p.S17*	ENST00000262365.4	37	c.50	CCDS59092.1	8	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	g|g	18.35|18.35	3.603943|3.603943	0.66445|0.66445	.|.	.|.	ENSG00000145002|ENSG00000145002	ENST00000262365;ENST00000351291;ENST00000309608;ENST00000527331;ENST00000532480|ENST00000393715	T;T;T;T;T|.	0.22134|.	2.38;2.38;1.97;2.38;2.05|.	1.16|1.16	0.229|0.229	0.15368|0.15368	.|.	.|.	.|.	.|.	.|.	T|.	0.54711|.	0.1875|.	L|L	0.49640|0.49640	1.575|1.575	0.58432|0.58432	D|D	0.999997|0.999997	D|.	0.55605|.	0.972|.	P|.	0.60415|.	0.874|.	T|.	0.52518|.	-0.8565|.	9|.	0.45353|0.62326	T|D	0.12|0.03	.|.	5.4544|5.4544	0.16582|0.16582	0.216:0.0:0.784:0.0|0.216:0.0:0.784:0.0	.|.	156|.	P0C5J1|.	F86B2_HUMAN|.	L|X	156;122;122;122;122|17	ENSP00000262365:F156L;ENSP00000283479:F122L;ENSP00000311330:F122L;ENSP00000432491:F122L;ENSP00000436338:F122L|.	ENSP00000262365:F156L|ENSP00000377318:S17X	F|S	-|-	3|2	2|0	FAM86B2|FAM86B2	12330869|12330869	0.912000|0.912000	0.30974|0.30974	0.029000|0.029000	0.17559|0.17559	0.125000|0.125000	0.20455|0.20455	1.259000|1.259000	0.32956|0.32956	0.065000|0.065000	0.16485|0.16485	0.162000|0.162000	0.16502|0.16502	TTC|TCA	FAM86B2	-	NULL	ENSG00000145002		0.612	FAM86B2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM86B2	HGNC	protein_coding		22	0.00	0	G	XM_928336		12286498	12286498	-1	no_errors	ENST00000393715	ensembl	human	known	69_37n	nonsense	8	50.00	8	SNP	0.829	C
FAM86DP	692099	genome.wustl.edu	37	3	75471777	75471777	+	RNA	SNP	G	G	A	rs112361877	byFrequency	TCGA-A1-A0SK-01A-12D-A099-09	TCGA-A1-A0SK-10A-03D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d1b43161-cbc1-4bf6-b8bb-a72a2e5e1150	2a5384f3-fec7-4265-b104-987f0718574b	g.chr3:75471777G>A	ENST00000459803.1	-	0	1364					NR_024241.1				family with sequence similarity 86, member D, pseudogene																		CAGGGATGTGGCAGCTGCAGT	0.527													.|||	311	0.0621006	0.1815	0.0173	5008	,	,		17421	0.003		0.0199	False		,,,				2504	0.0368					dbGAP											0																																										-	-	-			0			BC016686		3p12.3	2010-06-04	2010-06-04	2010-06-04	ENSG00000244026	ENSG00000244026			32659	pseudogene	pseudogene			"""family with sequence similarity 86, member D"""	FAM86D			Standard	NR_024241		Approved		uc003dpp.4		OTTHUMG00000158855		3.37:g.75471777G>A		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000459803.1	37	NULL		3																																																																																			FAM86DP	-	-	ENSG00000244026		0.527	FAM86DP-003	KNOWN	basic	processed_transcript	FAM86DP	HGNC	pseudogene	OTTHUMT00000352425.1	25	0.00	0	G	NR_024241		75471777	75471777	-1	no_errors	ENST00000459803	ensembl	human	known	69_37n	rna	410	10.65	49	SNP	0.001	A
FAT3	120114	genome.wustl.edu	37	11	92533189	92533189	+	Missense_Mutation	SNP	T	T	A			TCGA-A1-A0SK-01A-12D-A099-09	TCGA-A1-A0SK-10A-03D-A099-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d1b43161-cbc1-4bf6-b8bb-a72a2e5e1150	2a5384f3-fec7-4265-b104-987f0718574b	g.chr11:92533189T>A	ENST00000298047.6	+	9	7027	c.7010T>A	c.(7009-7011)tTt>tAt	p.F2337Y	FAT3_ENST00000525166.1_Missense_Mutation_p.F2187Y|FAT3_ENST00000409404.2_Missense_Mutation_p.F2337Y			Q8TDW7	FAT3_HUMAN	FAT atypical cadherin 3	2337	Cadherin 21. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)|multicellular organismal development (GO:0007275)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|endometrium(10)|kidney(4)|large_intestine(11)|liver(2)|lung(37)|ovary(5)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(5)	85		Acute lymphoblastic leukemia(157;3.01e-05)|all_hematologic(158;0.00858)				ACAGATTATTTTCACATAGAT	0.383										TCGA Ovarian(4;0.039)																												dbGAP											0													94.0	86.0	88.0					11																	92533189		1915	4121	6036	-	-	-	SO:0001583	missense	0			AB076400		11q14.3	2013-05-31	2013-05-31		ENSG00000165323	ENSG00000165323		"""Cadherins / Cadherin-related"""	23112	protein-coding gene	gene with protein product	"""cadherin-related family member 10"""	612483	"""FAT tumor suppressor homolog 3 (Drosophila)"""			11811999	Standard	NM_001008781		Approved	KIAA1989, CDHF15, CDHR10	uc001pdj.4	Q8TDW7	OTTHUMG00000154468	ENST00000298047.6:c.7010T>A	11.37:g.92533189T>A	ENSP00000298047:p.Phe2337Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV	B5MDB0|Q96AU6	Missense_Mutation	SNP	pfam_Cadherin,pfam_Laminin_G,pfam_EGF-like_Ca-bd,superfamily_ConA-like_lec_gl,superfamily_Cadherin-like,smart_Cadherin,smart_EGF-like,smart_Laminin_G,smart_EGF-like_Ca-bd,prints_Cadherin,pfscan_EG-like_dom,pfscan_Laminin_G,pfscan_Cadherin	p.F2337Y	ENST00000298047.6	37	c.7010		11	.	.	.	.	.	.	.	.	.	.	T	19.77	3.889640	0.72524	.	.	ENSG00000165323	ENST00000298047;ENST00000409404;ENST00000525166	T;T;T	0.71934	-0.61;-0.61;-0.61	5.95	5.95	0.96441	.	.	.	.	.	D	0.90013	0.6882	H	0.97611	4.04	0.80722	D	1	D	0.76494	0.999	D	0.83275	0.996	D	0.93308	0.6682	9	0.72032	D	0.01	.	16.4237	0.83790	0.0:0.0:0.0:1.0	.	2337	Q8TDW7-3	.	Y	2337;2337;2187	ENSP00000298047:F2337Y;ENSP00000387040:F2337Y;ENSP00000432586:F2187Y	ENSP00000298047:F2337Y	F	+	2	0	FAT3	92172837	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.975000	0.88055	2.279000	0.76181	0.533000	0.62120	TTT	FAT3	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000165323		0.383	FAT3-201	KNOWN	basic	protein_coding	FAT3	HGNC	protein_coding		278	0.00	0	T	NM_001008781		92533189	92533189	+1	no_errors	ENST00000298047	ensembl	human	known	69_37n	missense	127	42.08	93	SNP	1.000	A
FAM86B3P	286042	genome.wustl.edu	37	8	8088411	8088411	+	IGR	SNP	A	A	G	rs2980481	byFrequency	TCGA-A1-A0SK-01A-12D-A099-09	TCGA-A1-A0SK-10A-03D-A099-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d1b43161-cbc1-4bf6-b8bb-a72a2e5e1150	2a5384f3-fec7-4265-b104-987f0718574b	g.chr8:8088411A>G								FAM85B (4275 upstream) : ALG1L13P (6784 downstream)														p.Q48R(3)									GAGCTGCTGCAGGATATTTTG	0.488																																						dbGAP											3	Substitution - Missense(3)	kidney(2)|urinary_tract(1)																																								-	-	-	SO:0001628	intergenic_variant	0																															8.37:g.8088411A>G		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL		37	NULL		8																																																																																			RP11-556O5.3	-	-	ENSG00000173295	0	0.488					FLJ10661	Clone_based_vega_gene			8	0.00	0	A			8088411	8088411	+1	no_errors	ENST00000522601	ensembl	human	known	69_37n	rna	23	46.51	20	SNP	0.976	G
MIR7162	102466227	genome.wustl.edu	37	15	62539304	62539304	+	RNA	SNP	G	G	A	rs116584675	byFrequency	TCGA-A1-A0SK-01A-12D-A099-09	TCGA-A1-A0SK-10A-03D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d1b43161-cbc1-4bf6-b8bb-a72a2e5e1150	2a5384f3-fec7-4265-b104-987f0718574b	g.chr15:62539304G>A	ENST00000570077.1	-	0	285																											CTCCCTCAACGTGTGCACCTG	0.602													.|||	129	0.0257588	0.0961	0.0029	5008	,	,		20332	0.0		0.0	False		,,,				2504	0.0					dbGAP											0																																										-	-	-			0																															15.37:g.62539304G>A		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000570077.1	37	NULL		15	57	0.0260989010989011	56	0.11382113821138211	1	0.0027624309392265192	0	0.0	0	0.0	G	3.648	-0.072093	0.07228	.	.	ENSG00000166104	ENST00000429274	.	.	.	1.85	-0.459	0.12179	.	.	.	.	.	T	0.01905	0.0060	.	.	.	.	.	.	D	0.67145	0.996	D	0.67382	0.951	T	0.27673	-1.0067	6	0.72032	D	0.01	.	3.7121	0.08424	0.0:0.2425:0.4208:0.3368	.	123	Q8N8X6-2	.	M	123	.	ENSP00000396161:T123M	T	-	2	0	AC126323.1	60326596	0.000000	0.05858	0.000000	0.03702	0.005000	0.04900	0.123000	0.15708	-0.107000	0.12088	0.289000	0.19496	ACG	RP11-299H22.3	-	-	ENSG00000166104		0.602	hsa-mir-7162.1-004	KNOWN	basic	processed_transcript	FLJ38723	Clone_based_vega_gene	pseudogene	OTTHUMT00000422143.1	194	0.00	0	G			62539304	62539304	-1	no_errors	ENST00000570077	ensembl	human	known	69_37n	rna	120	11.03	15	SNP	0.001	A
GDPD5	81544	genome.wustl.edu	37	11	75160132	75160132	+	Missense_Mutation	SNP	C	C	T			TCGA-A1-A0SK-01A-12D-A099-09	TCGA-A1-A0SK-10A-03D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d1b43161-cbc1-4bf6-b8bb-a72a2e5e1150	2a5384f3-fec7-4265-b104-987f0718574b	g.chr11:75160132C>T	ENST00000336898.3	-	9	1441	c.604G>A	c.(604-606)Gtg>Atg	p.V202M	GDPD5_ENST00000526177.1_Missense_Mutation_p.V64M|GDPD5_ENST00000529721.1_Missense_Mutation_p.V202M|GDPD5_ENST00000376282.3_Missense_Mutation_p.V83M|GDPD5_ENST00000533805.1_De_novo_Start_OutOfFrame|GDPD5_ENST00000533784.1_Missense_Mutation_p.V83M|GDPD5_ENST00000443276.2_3'UTR	NM_030792.6	NP_110419.5	Q8WTR4	GDPD5_HUMAN	glycerophosphodiester phosphodiesterase domain containing 5	202					cerebral cortex neuron differentiation (GO:0021895)|glycerol metabolic process (GO:0006071)|lipid metabolic process (GO:0006629)|negative regulation of Notch signaling pathway (GO:0045746)|neuron projection development (GO:0031175)|positive regulation of neuron differentiation (GO:0045666)|regulation of timing of cell differentiation (GO:0048505)|spinal cord motor neuron differentiation (GO:0021522)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)	glycerophosphodiester phosphodiesterase activity (GO:0008889)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(3)|lung(6)|ovary(3)|skin(2)	20						GCAAACACCACGGTGAAGAAG	0.612																																						dbGAP											0													113.0	98.0	103.0					11																	75160132		2197	4293	6490	-	-	-	SO:0001583	missense	0			AF318377	CCDS8238.1	11q13.4-q13.5	2011-01-25				ENSG00000158555			28804	protein-coding gene	gene with protein product		609632				18667693, 17275818	Standard	NM_030792		Approved	PP1665, GDE2	uc001owp.4	Q8WTR4		ENST00000336898.3:c.604G>A	11.37:g.75160132C>T	ENSP00000337972:p.Val202Met	Somatic		WXS	Illumina GAIIx	Phase_IV	Q49AQ5|Q6UX76|Q7Z4S0|Q8N781|Q8NCB7|Q8TB77	Missense_Mutation	SNP	pfam_GlyceroP-diester-Pdiesterase,superfamily_PLC-like_Pdiesterase_TIM-brl	p.V202M	ENST00000336898.3	37	c.604	CCDS8238.1	11	.	.	.	.	.	.	.	.	.	.	C	17.01	3.279400	0.59758	.	.	ENSG00000158555	ENST00000526177;ENST00000533784;ENST00000529721;ENST00000336898;ENST00000376282	T;T;T;T;T	0.19938	2.17;2.23;2.11;2.11;2.23	5.07	4.16	0.48862	.	0.432357	0.24933	N	0.034450	T	0.39517	0.1081	L	0.58810	1.83	0.58432	D	0.999999	D;D;D	0.76494	0.999;0.999;0.997	D;D;P	0.68353	0.957;0.952;0.875	T	0.21381	-1.0247	10	0.72032	D	0.01	-14.9417	11.4607	0.50208	0.0:0.9127:0.0:0.0873	.	64;83;202	Q8WTR4-3;Q8WTR4-2;Q8WTR4	.;.;GDPD5_HUMAN	M	64;83;202;202;83	ENSP00000434050:V64M;ENSP00000437049:V83M;ENSP00000433214:V202M;ENSP00000337972:V202M;ENSP00000365459:V83M	ENSP00000337972:V202M	V	-	1	0	GDPD5	74837780	0.525000	0.26290	0.949000	0.38748	0.989000	0.77384	1.222000	0.32515	1.380000	0.46344	0.561000	0.74099	GTG	GDPD5	-	NULL	ENSG00000158555		0.612	GDPD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GDPD5	HGNC	protein_coding	OTTHUMT00000384409.1	361	0.00	0	C	NM_030792		75160132	75160132	-1	no_errors	ENST00000336898	ensembl	human	known	69_37n	missense	100	15.13	18	SNP	0.608	T
GLIPR1	11010	genome.wustl.edu	37	12	75874811	75874811	+	Missense_Mutation	SNP	A	A	C	rs76259505		TCGA-A1-A0SK-01A-12D-A099-09	TCGA-A1-A0SK-10A-03D-A099-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d1b43161-cbc1-4bf6-b8bb-a72a2e5e1150	2a5384f3-fec7-4265-b104-987f0718574b	g.chr12:75874811A>C	ENST00000266659.3	+	1	352	c.151A>C	c.(151-153)Aca>Cca	p.T51P		NM_006851.2	NP_006842.2	P48060	GLIP1_HUMAN	GLI pathogenesis-related 1	51	SCP.				cellular lipid metabolic process (GO:0044255)|small molecule metabolic process (GO:0044281)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)				endometrium(1)|kidney(2)|large_intestine(3)|lung(6)|ovary(1)|skin(1)	14						GGTGAAACCAACAGCCAGTGA	0.363																																						dbGAP											0													87.0	84.0	85.0					12																	75874811		2203	4300	6503	-	-	-	SO:0001583	missense	0			U16307	CCDS9011.1	12q14.1	2008-08-15	2008-08-15			ENSG00000139278			17001	protein-coding gene	gene with protein product		602692	"""GLI pathogenesis-related 1 (glioma)"""			7607567, 8973356	Standard	NM_006851		Approved	RTVP1, GliPR	uc001sxs.3	P48060	OTTHUMG00000169757	ENST00000266659.3:c.151A>C	12.37:g.75874811A>C	ENSP00000266659:p.Thr51Pro	Somatic		WXS	Illumina GAIIx	Phase_IV	A7YET6|F8VUC2|Q15409|Q969K2	Missense_Mutation	SNP	pfam_CAP_domain,superfamily_CAP_domain,smart_Allrgn_V5/Tpx1,prints_Allrgn_V5/Tpx1,prints_V5_allergen	p.T51P	ENST00000266659.3	37	c.151	CCDS9011.1	12	.	.	.	.	.	.	.	.	.	.	A	11.68	1.710927	0.30322	.	.	ENSG00000139278	ENST00000266659;ENST00000456650	T;T	0.38077	1.16;1.16	6.03	-4.7	0.03288	CAP domain (3);	0.904398	0.09715	N	0.765185	T	0.08358	0.0208	N	0.01473	-0.845	0.09310	N	1	B;B	0.13145	0.007;0.0	B;B	0.09377	0.004;0.001	T	0.31806	-0.9930	10	0.02654	T	1	.	3.9602	0.09407	0.2227:0.4237:0.2633:0.0903	.	51;51	F6VVE8;P48060	.;GLIP1_HUMAN	P	51	ENSP00000266659:T51P;ENSP00000391144:T51P	ENSP00000266659:T51P	T	+	1	0	GLIPR1	74161078	0.000000	0.05858	0.001000	0.08648	0.973000	0.67179	-1.295000	0.02764	-0.701000	0.05063	0.533000	0.62120	ACA	GLIPR1	-	pfam_CAP_domain,superfamily_CAP_domain,smart_Allrgn_V5/Tpx1	ENSG00000139278		0.363	GLIPR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GLIPR1	HGNC	protein_coding	OTTHUMT00000405722.1	202	0.98	2	A	NM_006851		75874811	75874811	+1	no_errors	ENST00000266659	ensembl	human	known	69_37n	missense	37	39.34	24	SNP	0.037	C
GMEB1	10691	genome.wustl.edu	37	1	29016663	29016663	+	Missense_Mutation	SNP	A	A	T	rs561478354		TCGA-A1-A0SK-01A-12D-A099-09	TCGA-A1-A0SK-10A-03D-A099-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d1b43161-cbc1-4bf6-b8bb-a72a2e5e1150	2a5384f3-fec7-4265-b104-987f0718574b	g.chr1:29016663A>T	ENST00000294409.2	+	3	296	c.206A>T	c.(205-207)gAa>gTa	p.E69V	GMEB1_ENST00000361872.4_Missense_Mutation_p.E59V|SCARNA24_ENST00000516968.1_RNA|GMEB1_ENST00000373816.1_Missense_Mutation_p.E59V|GMEB1_ENST00000480454.1_3'UTR	NM_006582.3	NP_006573.2	Q9Y692	GMEB1_HUMAN	glucocorticoid modulatory element binding protein 1	69					transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(4)	11		Colorectal(325;3.46e-05)|Lung NSC(340;0.000451)|all_lung(284;0.00063)|Breast(348;0.00502)|Renal(390;0.00555)|all_neural(195;0.0227)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0563)|Medulloblastoma(700;0.123)		Colorectal(126;2.96e-08)|COAD - Colon adenocarcinoma(152;1.7e-06)|STAD - Stomach adenocarcinoma(196;0.00299)|BRCA - Breast invasive adenocarcinoma(304;0.0221)|KIRC - Kidney renal clear cell carcinoma(1967;0.0296)|READ - Rectum adenocarcinoma(331;0.0649)		GTAGCAGTAGAAACTCACACG	0.323																																						dbGAP											0													72.0	65.0	68.0					1																	29016663		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF099013	CCDS327.1, CCDS328.1	1p35	2008-02-05			ENSG00000162419	ENSG00000162419			4370	protein-coding gene	gene with protein product		604409				10386584, 10523663	Standard	NM_006582		Approved	P96PIF, PIF96	uc001bra.3	Q9Y692	OTTHUMG00000003647	ENST00000294409.2:c.206A>T	1.37:g.29016663A>T	ENSP00000294409:p.Glu69Val	Somatic		WXS	Illumina GAIIx	Phase_IV	B1AT48|Q9NWH1|Q9UKD0	Missense_Mutation	SNP	pfam_SAND_dom,superfamily_SAND_dom-like,smart_SAND_dom,pfscan_SAND_dom	p.E69V	ENST00000294409.2	37	c.206	CCDS327.1	1	.	.	.	.	.	.	.	.	.	.	A	21.3	4.134874	0.77662	.	.	ENSG00000162419	ENST00000373816;ENST00000456852;ENST00000361872;ENST00000294409	T;T;T	0.58797	0.36;0.36;0.31	5.64	4.52	0.55395	.	0.109105	0.64402	D	0.000010	T	0.61751	0.2372	L	0.27053	0.805	0.25758	N	0.98497	D;P	0.71674	0.998;0.596	D;B	0.73708	0.981;0.245	T	0.55573	-0.8120	10	0.62326	D	0.03	-27.6659	10.521	0.44918	0.9231:0.0:0.0769:0.0	.	69;59	Q9Y692;B1AT47	GMEB1_HUMAN;.	V	59;35;59;69	ENSP00000362922:E59V;ENSP00000355186:E59V;ENSP00000294409:E69V	ENSP00000294409:E69V	E	+	2	0	GMEB1	28889250	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	4.624000	0.61254	0.981000	0.38548	0.533000	0.62120	GAA	GMEB1	-	NULL	ENSG00000162419		0.323	GMEB1-003	KNOWN	basic|CCDS	protein_coding	GMEB1	HGNC	protein_coding	OTTHUMT00000010333.1	131	0.00	0	A	NM_006582		29016663	29016663	+1	no_errors	ENST00000294409	ensembl	human	known	69_37n	missense	58	42.00	42	SNP	1.000	T
GOLGA8I	283796	genome.wustl.edu	37	15	23259512	23259512	+	Missense_Mutation	SNP	T	T	A	rs202127964	byFrequency	TCGA-A1-A0SK-01A-12D-A099-09	TCGA-A1-A0SK-10A-03D-A099-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d1b43161-cbc1-4bf6-b8bb-a72a2e5e1150	2a5384f3-fec7-4265-b104-987f0718574b	g.chr15:23259512T>A	ENST00000450802.3	+	6	463	c.365T>A	c.(364-366)aTc>aAc	p.I122N		NM_001282468.1|NM_001282472.1|NM_001282484.1|NM_001282490.1|NM_001282493.1|NM_001282494.1	NP_001269397.1|NP_001269401.1|NP_001269413.1|NP_001269419.1|NP_001269422.1|NP_001269423.1	A6NC78	GOG8I_HUMAN	golgin A8 family, member I	122						Golgi apparatus (GO:0005794)|membrane (GO:0016020)											AAAGCAAACATCAAGAAACAG	0.507													.|||	3120	0.623003	0.6316	0.4957	5008	,	,		5765	0.9613		0.2942	False		,,,				2504	0.6912					dbGAP											0																																										-	-	-	SO:0001583	missense	0			AK093104		15q11.2	2013-01-17	2012-10-05	2012-10-05	ENSG00000153666	ENSG00000277561			26660	other	unknown	"""FLJ35785"""		"""golgi autoantigen, golgin subfamily a, 9 pseudogene"", ""golgin A9, pseudogene"", ""golgin A8 family, member I, pseudogene"""	GOLGA9P, GOLGA8IP			Standard	NR_024074		Approved	FLJ35785	uc001yvh.1	A6NC78	OTTHUMG00000129149	ENST00000450802.3:c.365T>A	15.37:g.23259512T>A	ENSP00000399637:p.Ile122Asn	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	NULL	p.I122N	ENST00000450802.3	37	c.365		15	.	.	.	.	.	.	.	.	.	.	.	0.001	-2.982707	0.00046	.	.	ENSG00000153666	ENST00000450802	T	0.20069	2.1	0.83	-1.66	0.08265	.	.	.	.	.	T	0.05593	0.0147	.	.	.	.	.	.	B	0.29590	0.25	B	0.22152	0.038	T	0.32798	-0.9893	7	0.02654	T	1	.	1.7309	0.02931	0.2833:0.3182:0.0:0.3985	.	41	Q8NA68	.	N	122	ENSP00000399637:I122N	ENSP00000399637:I122N	I	+	2	0	GOLGA8IP	20810953	0.000000	0.05858	0.001000	0.08648	0.029000	0.11900	-1.711000	0.01886	-1.161000	0.02800	-2.408000	0.00222	ATC	GOLGA8IP	-	NULL	ENSG00000153666		0.507	GOLGA8I-001	KNOWN	not_best_in_genome_evidence|basic|appris_principal	protein_coding	GOLGA8IP	HGNC	protein_coding	OTTHUMT00000251213.2	10	0.00	0	T	NR_024074		23259512	23259512	+1	no_errors	ENST00000450802	ensembl	human	known	69_37n	missense	0	100.00	25	SNP	0.002	A
GOLGA8G	283768	genome.wustl.edu	37	15	28769168	28769168	+	Missense_Mutation	SNP	C	C	T	rs150644606	byFrequency	TCGA-A1-A0SK-01A-12D-A099-09	TCGA-A1-A0SK-10A-03D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d1b43161-cbc1-4bf6-b8bb-a72a2e5e1150	2a5384f3-fec7-4265-b104-987f0718574b	g.chr15:28769168C>T	ENST00000525590.2	-	15	1389	c.1328G>A	c.(1327-1329)gGa>gAa	p.G443E	GOLGA8G_ENST00000329523.6_Intron|AC138749.1_ENST00000458870.1_RNA|RN7SL829P_ENST00000489494.2_RNA			Q08AF8	GOG8F_HUMAN	golgin A8 family, member G	225						Golgi apparatus (GO:0005794)				lung(1)	1		all_lung(180;1.98e-11)|Breast(32;0.000194)|Colorectal(260;0.227)		all cancers(64;4.69e-10)|Epithelial(43;5.34e-09)|BRCA - Breast invasive adenocarcinoma(123;0.0201)|GBM - Glioblastoma multiforme(186;0.0503)|Lung(196;0.171)		GTCCAGATGTCCTCCTCCATC	0.612																																						dbGAP											0													23.0	13.0	17.0					15																	28769168		1851	2322	4173	-	-	-	SO:0001583	missense	0					15q13.1	2013-01-17	2010-02-12		ENSG00000183629	ENSG00000183629			25328	other	unknown			"""golgi autoantigen, golgin subfamily a, 8G"""			12477932	Standard	NR_033353		Approved	DKFZp434K052		Q08AF8	OTTHUMG00000167134	ENST00000525590.2:c.1328G>A	15.37:g.28769168C>T	ENSP00000458130:p.Gly443Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	A4FTY1|Q1A5X9|Q8NDK0	Missense_Mutation	SNP	NULL	p.G225E	ENST00000525590.2	37	c.674		15																																																																																			GOLGA8G	-	NULL	ENSG00000183629		0.612	GOLGA8G-001	NOVEL	basic|appris_candidate_longest	protein_coding	GOLGA8G	HGNC	protein_coding	OTTHUMT00000393332.2	81	0.00	0	C	NR_033353.1		28769168	28769168	-1	no_errors	ENST00000433304	ensembl	human	known	69_37n	missense	11	54.17	13	SNP	0.869	T
GPR42	2866	genome.wustl.edu	37	19	35863141	35863141	+	Silent	SNP	T	T	C	rs2267581	byFrequency	TCGA-A1-A0SK-01A-12D-A099-09	TCGA-A1-A0SK-10A-03D-A099-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d1b43161-cbc1-4bf6-b8bb-a72a2e5e1150	2a5384f3-fec7-4265-b104-987f0718574b	g.chr19:35863141T>C	ENST00000454971.1	+	2	1081	c.880T>C	c.(880-882)Ttg>Ctg	p.L294L	GPR42_ENST00000597214.1_Silent_p.L294L			O15529	GPR42_HUMAN	G protein-coupled receptor 42 (gene/pseudogene)	294						integral component of plasma membrane (GO:0005887)	signal transducer activity (GO:0004871)			endometrium(1)|kidney(1)|skin(2)	4	all_lung(56;9.78e-09)|Lung NSC(56;1.46e-08)|Esophageal squamous(110;0.162)		Epithelial(14;1.29e-19)|OV - Ovarian serous cystadenocarcinoma(14;4.63e-18)|all cancers(14;5.19e-17)|LUSC - Lung squamous cell carcinoma(66;0.0221)			GCTGAGGAGGTTGTGTGGGCT	0.592																																						dbGAP											0													6.0	8.0	8.0					19																	35863141		1986	3759	5745	-	-	-	SO:0001819	synonymous_variant	0			AF024689		19q13.12	2012-08-20	2010-02-09	2010-02-09	ENSG00000126251	ENSG00000126251		"""GPCR / Class A : Fatty acid receptors"""	4500	protein-coding gene	gene with protein product		603822	"""G protein-coupled receptor 42 pseudogene"""	GPR42P		9344866, 19630535	Standard	NG_008348		Approved	GPR41L, FFAR3L		O15529	OTTHUMG00000157124	ENST00000454971.1:c.880T>C	19.37:g.35863141T>C		Somatic		WXS	Illumina GAIIx	Phase_IV		Silent	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_7TM_GPCR_Rhodpsn,prints_GPR40-rel_recept	p.L294	ENST00000454971.1	37	c.880		19																																																																																			GPR42	-	NULL	ENSG00000126251		0.592	GPR42-001	KNOWN	not_best_in_genome_evidence|basic|appris_principal	protein_coding	GPR42	HGNC	protein_coding	OTTHUMT00000347518.1	28	0.00	0	T	NM_005305		35863141	35863141	+1	no_errors	ENST00000454971	ensembl	human	known	69_37n	silent	1	87.50	7	SNP	0.051	C
GTF3C1	2975	genome.wustl.edu	37	16	27480677	27480686	+	Frame_Shift_Del	DEL	ACCACAATGC	ACCACAATGC	-			TCGA-A1-A0SK-01A-12D-A099-09	TCGA-A1-A0SK-10A-03D-A099-09	ACCACAATGC	ACCACAATGC					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d1b43161-cbc1-4bf6-b8bb-a72a2e5e1150	2a5384f3-fec7-4265-b104-987f0718574b	g.chr16:27480677_27480686delACCACAATGC	ENST00000356183.4	-	32	5015_5024	c.5000_5009delGCATTGTGGT	c.(4999-5010)agcattgtggtcfs	p.SIVV1667fs	GTF3C1_ENST00000561623.1_Frame_Shift_Del_p.SIVV1667fs	NM_001520.3	NP_001511.2	Q12789	TF3C1_HUMAN	general transcription factor IIIC, polypeptide 1, alpha 220kDa	1667					5S class rRNA transcription from RNA polymerase III type 1 promoter (GO:0042791)|gene expression (GO:0010467)|rRNA transcription (GO:0009303)|transcription from RNA polymerase III promoter (GO:0006383)|transcription, DNA-templated (GO:0006351)|tRNA transcription (GO:0009304)|tRNA transcription from RNA polymerase III promoter (GO:0042797)	membrane (GO:0016020)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)|transcription factor TFIIIC complex (GO:0000127)	DNA binding (GO:0003677)			breast(2)|central_nervous_system(4)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(14)|liver(3)|lung(28)|ovary(2)|pancreas(1)|prostate(2)|skin(5)|upper_aerodigestive_tract(2)	80						GCAGGAGTTGACCACAATGCTGTCGTTGGG	0.643																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			U06485	CCDS32414.1, CCDS66988.1	16p12	2010-03-23	2002-08-29			ENSG00000077235		"""General transcription factors"""	4664	protein-coding gene	gene with protein product		603246	"""general transcription factor IIIC, polypeptide 1 (alpha subunit, 220kD )"""			8164661, 8127861	Standard	NM_001520		Approved	TFIIIC220	uc002dov.2	Q12789		ENST00000356183.4:c.5000_5009delGCATTGTGGT	16.37:g.27480677_27480686delACCACAATGC	ENSP00000348510:p.Ser1667fs	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RP21|Q12838|Q6DKN9|Q9Y4W9	Frame_Shift_Del	DEL	pfam_TFIIIC_Bblock-bd	p.S1667fs	ENST00000356183.4	37	c.5009_5000	CCDS32414.1	16																																																																																			GTF3C1	-	NULL	ENSG00000077235		0.643	GTF3C1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GTF3C1	HGNC	protein_coding	OTTHUMT00000433856.1	314	0.00	0	ACCACAATGC	NM_001520		27480677	27480686	-1	no_errors	ENST00000356183	ensembl	human	known	69_37n	frame_shift_del	27	21.62	8	DEL	1.000:1.000:1.000:1.000:1.000:0.905:1.000:1.000:1.000:1.000	-
GUSBP1	728411	genome.wustl.edu	37	5	21497300	21497300	+	RNA	SNP	C	C	T	rs377644647	byFrequency	TCGA-A1-A0SK-01A-12D-A099-09	TCGA-A1-A0SK-10A-03D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d1b43161-cbc1-4bf6-b8bb-a72a2e5e1150	2a5384f3-fec7-4265-b104-987f0718574b	g.chr5:21497300C>T	ENST00000607545.1	+	0	179					NR_027026.1		Q15486	GUSP1_HUMAN	glucuronidase, beta pseudogene 1						carbohydrate metabolic process (GO:0005975)|nervous system development (GO:0007399)|skeletal system development (GO:0001501)		hydrolase activity, hydrolyzing O-glycosyl compounds (GO:0004553)										TGTAGGGTTTCACCAGGTAAG	0.532													.|||	35	0.00698882	0.0008	0.0014	5008	,	,		31133	0.0327		0.0	False		,,,				2504	0.0					dbGAP											0																																										-	-	-			0			BC064850, X75940		5p14.3	2012-10-04			ENSG00000183666	ENSG00000183666			13670	pseudogene	pseudogene						8565635	Standard	NR_027026		Approved		uc010iub.3	Q15486	OTTHUMG00000162474		5.37:g.21497300C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A6NLY8|A8K1B7|Q969T8|Q9BUH2	RNA	SNP	-	NULL	ENST00000607545.1	37	NULL		5																																																																																			RP11-823P9.1	-	-	ENSG00000183666		0.532	GUSBP1-006	KNOWN	basic	processed_transcript	GUSBP1	Clone_based_vega_gene	pseudogene	OTTHUMT00000470546.1	22	0.00	0	C	NG_008324		21497300	21497300	+1	no_errors	ENST00000508260	ensembl	human	known	69_37n	rna	268	42.74	200	SNP	1.000	T
HLA-A	3105	genome.wustl.edu	37	6	29910699	29910699	+	Missense_Mutation	SNP	G	G	A	rs1059451		TCGA-A1-A0SK-01A-12D-A099-09	TCGA-A1-A0SK-10A-03D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d1b43161-cbc1-4bf6-b8bb-a72a2e5e1150	2a5384f3-fec7-4265-b104-987f0718574b	g.chr6:29910699G>A	ENST00000396634.1	+	4	580	c.239G>A	c.(238-240)gGg>gAg	p.G80E	HLA-A_ENST00000376802.2_Missense_Mutation_p.G80E|HLA-A_ENST00000376809.5_Missense_Mutation_p.G80E|HLA-A_ENST00000376806.5_Missense_Mutation_p.G80E			P16189	1A31_HUMAN	major histocompatibility complex, class I, A	80	Alpha-1.				antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-independent (GO:0002480)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cytokine-mediated signaling pathway (GO:0019221)|interferon-gamma-mediated signaling pathway (GO:0060333)|positive regulation of T cell mediated cytotoxicity (GO:0001916)|regulation of immune response (GO:0050776)|type I interferon signaling pathway (GO:0060337)|viral process (GO:0016032)	cell surface (GO:0009986)|early endosome membrane (GO:0031901)|endoplasmic reticulum (GO:0005783)|ER to Golgi transport vesicle membrane (GO:0012507)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of lumenal side of endoplasmic reticulum membrane (GO:0071556)|MHC class I protein complex (GO:0042612)|phagocytic vesicle membrane (GO:0030670)|plasma membrane (GO:0005886)	beta-2-microglobulin binding (GO:0030881)|peptide antigen binding (GO:0042605)|TAP binding (GO:0046977)			central_nervous_system(2)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(10)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	30						GAGCAGGAGGGGCCGGAGTAT	0.657									Osteosarcoma, Familial Clustering of;Naso-/Oropharyngeal/Laryngeal Cancer, Familial Clustering of;Melanoma, Familial Clustering of;Lichen Sclerosis et Atrophicus, Familial Clustering of	Multiple Myeloma(9;0.094)																												dbGAP											0													60.0	64.0	63.0					6																	29910699		2203	4300	6503	-	-	-	SO:0001583	missense	0	Familial Cancer Database	Familial Osteogenic Sarcoma;incl.: Familial Head and Neck Cancer; ;Lichen Sclerosis, Familial	D32129	CCDS34373.1	6p21.3	2013-01-11			ENSG00000206503	ENSG00000206503		"""Histocompatibility complex"", ""Immunoglobulin superfamily / C1-set domain containing"""	4931	protein-coding gene	gene with protein product		142800				8838351	Standard	NM_001242758		Approved		uc003nol.3	P01891	OTTHUMG00000130501	ENST00000396634.1:c.239G>A	6.37:g.29910699G>A	ENSP00000379873:p.Gly80Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	O62924|O98009|O98137|Q8MHM1|Q9TPQ3|Q9TQ24|Q9UQU6|Q9UQU7	Missense_Mutation	SNP	pfam_MHC_I_a_a1/a2,pfam_Ig_C1-set,pfam_MHC_I_a_C,superfamily_MHC_I/II-like_Ag-recog,smart_Ig_C1-set,pfscan_Ig-like,prints_MHC_I_a_a1/a2	p.G80E	ENST00000396634.1	37	c.239	CCDS34373.1	6	.	.	.	.	.	.	.	.	.	.	.	10.31	1.314580	0.23908	.	.	ENSG00000206503	ENST00000396634;ENST00000376806;ENST00000376809;ENST00000355767;ENST00000376802	T;T;T;T	0.00856	5.61;5.61;5.61;5.61	3.72	-6.15	0.02105	MHC class I, alpha chain, alpha1/alpha2 (2);MHC classes I/II-like antigen recognition protein (2);MHC class I-like antigen recognition (2);	.	.	.	.	T	0.00552	0.0018	M	0.80183	2.485	0.09310	N	1	B;B;B;B	0.18610	0.002;0.008;0.029;0.017	B;B;B;B	0.28849	0.019;0.049;0.049;0.095	T	0.36407	-0.9749	9	0.72032	D	0.01	.	5.6199	0.17451	0.4487:0.2137:0.3376:0.0	rs1059451;rs2230986;rs3173428;rs41545313	80;80;80;80	P13746;Q5SRN7;Q5SRN5;P04439	1A11_HUMAN;.;.;1A03_HUMAN	E	80	ENSP00000379873:G80E;ENSP00000366002:G80E;ENSP00000366005:G80E;ENSP00000365998:G80E	ENSP00000348012:G80E	G	+	2	0	HLA-A	30018678	0.000000	0.05858	0.000000	0.03702	0.198000	0.23893	-0.747000	0.04823	-1.556000	0.01695	-0.346000	0.07831	GGG	HLA-A	-	pfam_MHC_I_a_a1/a2,superfamily_MHC_I/II-like_Ag-recog	ENSG00000206503		0.657	HLA-A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HLA-A	HGNC	protein_coding	OTTHUMT00000252909.1	210	0.47	1	G	NM_002116		29910699	29910699	+1	no_errors	ENST00000376806	ensembl	human	known	69_37n	missense	80	11.11	10	SNP	0.000	A
HLA-B	3106	genome.wustl.edu	37	6	31324568	31324568	+	Silent	SNP	C	C	A	rs41551615		TCGA-A1-A0SK-01A-12D-A099-09	TCGA-A1-A0SK-10A-03D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d1b43161-cbc1-4bf6-b8bb-a72a2e5e1150	2a5384f3-fec7-4265-b104-987f0718574b	g.chr6:31324568C>A	ENST00000412585.2	-	2	268	c.240G>T	c.(238-240)ggG>ggT	p.G80G		NM_005514.6	NP_005505.2	P30486	1B48_HUMAN	major histocompatibility complex, class I, B	80	Alpha-1.				antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|immune response (GO:0006955)|positive regulation of T cell mediated cytotoxicity (GO:0001916)|viral process (GO:0016032)	cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|MHC class I protein complex (GO:0042612)	peptide antigen binding (GO:0042605)			endometrium(4)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(4)|lung(4)|prostate(1)|upper_aerodigestive_tract(2)	27						AATACTCCGGCCCCTCCTGCT	0.642									Melanoma, Familial Clustering of;Lichen Sclerosis et Atrophicus, Familial Clustering of																													dbGAP											0													54.0	53.0	53.0					6																	31324568		2149	4176	6325	-	-	-	SO:0001819	synonymous_variant	0	Familial Cancer Database	;Lichen Sclerosis, Familial	M15470	CCDS34394.1	6p21.3	2013-01-11			ENSG00000234745	ENSG00000234745		"""Histocompatibility complex"", ""Immunoglobulin superfamily / C1-set domain containing"""	4932	protein-coding gene	gene with protein product		142830	"""ankylosing spondylitis"""	AS		3459708	Standard	NM_005514		Approved		uc011imz.2	P01889	OTTHUMG00000031153	ENST00000412585.2:c.240G>T	6.37:g.31324568C>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q29764	Missense_Mutation	SNP	pfam_MHC_I_a_a1/a2,superfamily_MHC_I/II-like_Ag-recog,prints_MHC_I_a_a1/a2	p.G81V	ENST00000412585.2	37	c.242	CCDS34394.1	6																																																																																			HLA-B	-	pfam_MHC_I_a_a1/a2,superfamily_MHC_I/II-like_Ag-recog	ENSG00000234745		0.642	HLA-B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HLA-B	HGNC	protein_coding	OTTHUMT00000076280.4	76	0.00	0	C	NM_005514		31324568	31324568	-1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000426590	ensembl	human	known	69_37n	missense	54	12.90	8	SNP	0.750	A
HNRNPA1	3178	genome.wustl.edu	37	12	54678053	54678053	+	Missense_Mutation	SNP	G	G	A			TCGA-A1-A0SK-01A-12D-A099-09	TCGA-A1-A0SK-10A-03D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d1b43161-cbc1-4bf6-b8bb-a72a2e5e1150	2a5384f3-fec7-4265-b104-987f0718574b	g.chr12:54678053G>A	ENST00000340913.6	+	10	1128	c.1075G>A	c.(1075-1077)Ggt>Agt	p.G359S	HNRNPA1_ENST00000547276.1_Missense_Mutation_p.G254S|RP11-968A15.8_ENST00000553061.1_RNA|HNRNPA1_ENST00000546500.1_Missense_Mutation_p.G307S|HNRNPA1_ENST00000330752.8_Missense_Mutation_p.G294S	NM_002136.2|NM_031157.2	NP_002127.1|NP_112420.1	P09651	ROA1_HUMAN	heterogeneous nuclear ribonucleoprotein A1	359	Gly-rich.				cell death (GO:0008219)|gene expression (GO:0010467)|mRNA processing (GO:0006397)|mRNA splicing, via spliceosome (GO:0000398)|mRNA transport (GO:0051028)|nuclear export (GO:0051168)|nuclear import (GO:0051170)|RNA export from nucleus (GO:0006405)|RNA splicing (GO:0008380)|viral process (GO:0016032)	catalytic step 2 spliceosome (GO:0071013)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|intermediate filament cytoskeleton (GO:0045111)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)|spliceosomal complex (GO:0005681)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|single-stranded DNA binding (GO:0003697)|single-stranded RNA binding (GO:0003727)			endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(4)|lung(6)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	20						TGGCTATGGCGGTTCCAGCAG	0.338																																					Colon(83;502 1289 8436 16406 24870)	dbGAP											0													59.0	60.0	60.0					12																	54678053		1847	4101	5948	-	-	-	SO:0001583	missense	0			BC009600	CCDS41793.1, CCDS44909.1	12q13.1	2013-10-11		2007-08-16	ENSG00000135486	ENSG00000135486		"""RNA binding motif (RRM) containing"""	5031	protein-coding gene	gene with protein product		164017		HNRPA1		1733858	Standard	XR_245923		Approved	hnRNPA1, hnRNP-A1	uc001sfl.3	P09651		ENST00000340913.6:c.1075G>A	12.37:g.54678053G>A	ENSP00000341826:p.Gly359Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K4Z8|Q3MIB7|Q6PJZ7	Missense_Mutation	SNP	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	p.G359S	ENST00000340913.6	37	c.1075	CCDS44909.1	12	.	.	.	.	.	.	.	.	.	.	G	13.52	2.260613	0.39995	.	.	ENSG00000135486	ENST00000546500;ENST00000547617;ENST00000340913;ENST00000330752;ENST00000551133;ENST00000547276;ENST00000550482	D;D;D;D	0.86769	-2.17;-2.17;-2.17;-2.17	3.93	3.05	0.35203	.	0.000000	0.56097	D	0.000031	T	0.76147	0.3947	N	0.25332	0.735	0.30619	N	0.75868	D;P;P;B;P;D	0.52996	0.957;0.85;0.944;0.167;0.944;0.957	B;B;B;B;B;B	0.40602	0.334;0.249;0.249;0.063;0.249;0.228	T	0.73665	-0.3911	10	0.25106	T	0.35	.	10.1751	0.42933	0.1002:0.0:0.8998:0.0	.	285;294;307;254;307;359	Q9BSM5;F8VRQ1;F8W6I7;P09651-3;P09651-2;P09651	.;.;.;.;.;ROA1_HUMAN	S	307;291;359;307;294;254;178	ENSP00000448617:G307S;ENSP00000341826:G359S;ENSP00000447260:G254S;ENSP00000446486:G178S	ENSP00000333504:G307S	G	+	1	0	HNRNPA1	52964320	1.000000	0.71417	0.957000	0.39632	0.496000	0.33645	3.540000	0.53611	1.267000	0.44247	-0.369000	0.07265	GGT	HNRNPA1	-	NULL	ENSG00000135486		0.338	HNRNPA1-002	KNOWN	basic|CCDS	protein_coding	HNRNPA1	HGNC	protein_coding	OTTHUMT00000405480.1	180	0.00	0	G	NM_031157		54678053	54678053	+1	no_errors	ENST00000340913	ensembl	human	known	69_37n	missense	73	39.67	48	SNP	0.998	A
HOXA13	3209	genome.wustl.edu	37	7	27239116	27239116	+	Missense_Mutation	SNP	C	C	G			TCGA-A1-A0SK-01A-12D-A099-09	TCGA-A1-A0SK-10A-03D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d1b43161-cbc1-4bf6-b8bb-a72a2e5e1150	2a5384f3-fec7-4265-b104-987f0718574b	g.chr7:27239116C>G	ENST00000222753.4	-	1	609	c.581G>C	c.(580-582)tGc>tCc	p.C194S	HOTTIP_ENST00000421733.1_RNA|HOTTIP_ENST00000521028.2_RNA|HOTTIP_ENST00000472494.1_RNA|HOTTIP_ENST00000605136.1_RNA	NM_000522.4	NP_000513.2	P31271	HXA13_HUMAN	homeobox A13	194					artery morphogenesis (GO:0048844)|branching involved in prostate gland morphogenesis (GO:0060442)|embryonic forelimb morphogenesis (GO:0035115)|endothelial cell fate specification (GO:0060847)|endothelial cell morphogenesis (GO:0001886)|inner ear development (GO:0048839)|male genitalia development (GO:0030539)|positive regulation of mesenchymal cell apoptotic process (GO:2001055)|positive regulation of mitosis (GO:0045840)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of BMP signaling pathway (GO:0030510)|skeletal system development (GO:0001501)|tissue homeostasis (GO:0001894)|transcription, DNA-templated (GO:0006351)|vasculogenesis (GO:0001570)|ventricular septum development (GO:0003281)	intermediate filament cytoskeleton (GO:0045111)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(2)	6						gggcTGCGCGCACGACTTGAT	0.726			T	NUP98	AML																																	dbGAP		Dom	yes		7	7p15-p14.2	3209	homeo box A13		L	0													8.0	10.0	9.0					7																	27239116		2143	4183	6326	-	-	-	SO:0001583	missense	0				CCDS5412.1	7p15.2	2011-06-20	2005-12-22		ENSG00000106031	ENSG00000106031		"""Homeoboxes / ANTP class : HOXL subclass"""	5102	protein-coding gene	gene with protein product		142959	"""homeo box A13"""	HOX1J, HOX1		1973146, 1358459	Standard	NM_000522		Approved		uc003szb.1	P31271	OTTHUMG00000023438	ENST00000222753.4:c.581G>C	7.37:g.27239116C>G	ENSP00000222753:p.Cys194Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	A4D188|O43371	Missense_Mutation	SNP	pfam_HoxA13_N,pfam_Homeodomain,superfamily_Homeodomain-like,smart_Homeodomain,pfscan_Homeodomain,prints_Antifreeze_1	p.C194S	ENST00000222753.4	37	c.581	CCDS5412.1	7	.	.	.	.	.	.	.	.	.	.	C	17.86	3.492826	0.64074	.	.	ENSG00000106031	ENST00000222753	T	0.50277	0.75	3.72	3.72	0.42706	.	0.000000	0.85682	D	0.000000	T	0.44973	0.1319	L	0.42744	1.35	0.49051	D	0.999748	B	0.29188	0.236	B	0.37989	0.262	T	0.38200	-0.9672	10	0.25751	T	0.34	.	14.8933	0.70625	0.0:1.0:0.0:0.0	.	194	P31271	HXA13_HUMAN	S	194	ENSP00000222753:C194S	ENSP00000222753:C194S	C	-	2	0	HOXA13	27205641	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	3.441000	0.52893	1.795000	0.52594	0.456000	0.33151	TGC	HOXA13	-	pfam_HoxA13_N	ENSG00000106031		0.726	HOXA13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HOXA13	HGNC	protein_coding	OTTHUMT00000358752.3	22	0.00	0	C			27239116	27239116	-1	no_errors	ENST00000222753	ensembl	human	known	69_37n	missense	12	25.00	4	SNP	1.000	G
HYDIN	54768	genome.wustl.edu	37	16	71163693	71163693	+	Silent	SNP	A	A	G	rs4788770	byFrequency	TCGA-A1-A0SK-01A-12D-A099-09	TCGA-A1-A0SK-10A-03D-A099-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d1b43161-cbc1-4bf6-b8bb-a72a2e5e1150	2a5384f3-fec7-4265-b104-987f0718574b	g.chr16:71163693A>G	ENST00000393567.2	-	9	1227	c.1077T>C	c.(1075-1077)gaT>gaC	p.D359D	HYDIN_ENST00000393550.2_Silent_p.D359D|HYDIN_ENST00000541601.1_Silent_p.D376D|HYDIN_ENST00000288168.10_Silent_p.D376D|HYDIN_ENST00000448691.1_Silent_p.D359D|HYDIN_ENST00000321489.5_Silent_p.D359D|HYDIN_ENST00000448089.2_Silent_p.D359D|HYDIN_ENST00000538248.1_Silent_p.D386D	NM_001270974.1	NP_001257903.1	Q4G0P3	HYDIN_HUMAN	HYDIN, axonemal central pair apparatus protein	359					cilium assembly (GO:0042384)|cilium movement (GO:0003341)|epithelial cell development (GO:0002064)|trachea development (GO:0060438)|ventricular system development (GO:0021591)	cell projection (GO:0042995)				breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(17)|lung(12)|ovary(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)	43		Ovarian(137;0.0654)				CATCAGTCTCATCCTTCTCCT	0.453																																						dbGAP											0													21.0	21.0	21.0					16																	71163693		2197	4279	6476	-	-	-	SO:0001819	synonymous_variant	0			AK074472	CCDS10897.1, CCDS56004.1, CCDS56005.1, CCDS59269.1	16q22.2	2014-02-05	2012-01-06		ENSG00000157423	ENSG00000157423		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	19368	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 31"""	610812	"""hydrocephalus inducing"", ""hydrocephalus inducing homolog (mouse)"""			12719380, 23022101	Standard	NM_001198542		Approved	DKFZp434D0513, KIAA1864, PPP1R31, CILD5	uc031qwy.1	Q4G0P3	OTTHUMG00000137584	ENST00000393567.2:c.1077T>C	16.37:g.71163693A>G		Somatic		WXS	Illumina GAIIx	Phase_IV	A6NC70|A6NLZ0|B4DQY4|B4DRN4|F5H6V3|Q8N3H8|Q8N3P6|Q8TC08|Q96JG3|Q96SS4|Q9H5U3|Q9H9B8|Q9NTI0|Q9UBE5	Silent	SNP	superfamily_PapD-like	p.D359	ENST00000393567.2	37	c.1077	CCDS59269.1	16																																																																																			HYDIN	-	NULL	ENSG00000157423		0.453	HYDIN-001	PUTATIVE	not_organism_supported|basic|appris_principal|exp_conf|CCDS	protein_coding	HYDIN	HGNC	protein_coding	OTTHUMT00000398624.3	231	0.00	0	A			71163693	71163693	-1	no_errors	ENST00000316490	ensembl	human	known	69_37n	silent	64	18.99	15	SNP	0.002	G
KIAA0825	285600	genome.wustl.edu	37	5	93722036	93722036	+	Missense_Mutation	SNP	G	G	A	rs72771666	byFrequency	TCGA-A1-A0SK-01A-12D-A099-09	TCGA-A1-A0SK-10A-03D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d1b43161-cbc1-4bf6-b8bb-a72a2e5e1150	2a5384f3-fec7-4265-b104-987f0718574b	g.chr5:93722036G>A	ENST00000513200.3	-	18	3602	c.3530C>T	c.(3529-3531)aCg>aTg	p.T1177M	KIAA0825_ENST00000427991.2_Missense_Mutation_p.T1177M	NM_001145678.1	NP_001139150.1	Q8IV33	K0825_HUMAN	KIAA0825	1177										breast(1)|endometrium(1)|kidney(1)|large_intestine(6)|lung(1)|pancreas(1)|prostate(1)|skin(1)	13						CCTCAAGGTCGTCTTTAAAGG	0.363													G|||	158	0.0315495	0.0023	0.0173	5008	,	,		17528	0.0685		0.0249	False		,,,				2504	0.0501					dbGAP											0													165.0	145.0	151.0					5																	93722036		692	1591	2283	-	-	-	SO:0001583	missense	0			BX648338	CCDS4070.1	5q15	2011-02-23	2011-02-23	2011-02-23	ENSG00000185261	ENSG00000185261			28532	protein-coding gene	gene with protein product			"""chromosome 5 open reading frame 36"""	C5orf36		12477932	Standard	NM_173665		Approved	DKFZp686F0372, MGC34713	uc011cuk.2	Q8IV33	OTTHUMG00000131331	ENST00000513200.3:c.3530C>T	5.37:g.93722036G>A	ENSP00000424618:p.Thr1177Met	Somatic		WXS	Illumina GAIIx	Phase_IV	O94914|Q6ZNN2	Missense_Mutation	SNP	NULL	p.T1177M	ENST00000513200.3	37	c.3530		5	68	0.031135531135531136	2	0.0040650406504065045	9	0.024861878453038673	37	0.06468531468531469	20	0.026385224274406333	G	7.600	0.672637	0.14776	.	.	ENSG00000185261	ENST00000513200;ENST00000427991	T;T	0.44083	0.93;0.93	5.97	-3.57	0.04612	.	.	.	.	.	T	0.01870	0.0059	N	0.02539	-0.55	0.09310	N	1	B;B	0.15719	0.014;0.014	B;B	0.08055	0.003;0.002	T	0.10683	-1.0619	9	0.46703	T	0.11	7.7312	13.5506	0.61730	0.9083:0.0:0.0917:0.0	.	1177;1177	Q8IV33;C9J0Q2	K0825_HUMAN;.	M	1177	ENSP00000424618:T1177M;ENSP00000400288:T1177M	ENSP00000400288:T1177M	T	-	2	0	KIAA0825	93747792	0.007000	0.16637	0.000000	0.03702	0.495000	0.33615	-0.032000	0.12266	-0.908000	0.03857	-0.312000	0.09012	ACG	KIAA0825	-	NULL	ENSG00000185261		0.363	KIAA0825-001	KNOWN	not_organism_supported|basic	protein_coding	KIAA0825	HGNC	protein_coding	OTTHUMT00000254102.5	243	0.00	0	G	NM_173665		93722036	93722036	-1	no_errors	ENST00000427991	ensembl	human	known	69_37n	missense	95	18.10	21	SNP	0.007	A
Unknown	0	genome.wustl.edu	37	GL000209.1	35888	35888	+	IGR	SNP	A	A	G			TCGA-A1-A0SK-01A-12D-A099-09	TCGA-A1-A0SK-10A-03D-A099-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d1b43161-cbc1-4bf6-b8bb-a72a2e5e1150	2a5384f3-fec7-4265-b104-987f0718574b	g.chrGL000209.1:35888A>G								None (None upstream) : None (None downstream)																							CATCGTGTACACGGAACTTCC	0.512																																						dbGAP											0																																										-	-	-	SO:0001628	intergenic_variant	0																															GL000209.1.37:g.35888A>G		Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Immunoglobulin,smart_Ig_sub	p.T333A		37	c.997		GL000209.1																																																																																			KIR2DL2	-	NULL	ENSG00000215764	0	0.512					KIR2DL2	HGNC			18	0.00	0	A			35888	35888	+1	no_errors	ENST00000344867	ensembl	human	known	69_37n	missense	3	70.00	7	SNP	NULL	G
KRT8P11	347265	genome.wustl.edu	37	9	102068058	102068058	+	IGR	SNP	A	A	G	rs184437	byFrequency	TCGA-A1-A0SK-01A-12D-A099-09	TCGA-A1-A0SK-10A-03D-A099-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d1b43161-cbc1-4bf6-b8bb-a72a2e5e1150	2a5384f3-fec7-4265-b104-987f0718574b	g.chr9:102068058A>G								RN7SKP225 (21403 upstream) : NAMA (49633 downstream)																							GCTTACATGAACAAGGCAGAA	0.483													A|||	806	0.160942	0.2027	0.1643	5008	,	,		25508	0.1052		0.2147	False		,,,				2504	0.1043					dbGAP											0																																										-	-	-	SO:0001628	intergenic_variant	0																															9.37:g.102068058A>G		Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_F,superfamily_Prefoldin,prints_Keratin_II	p.N222S		37	c.665		9	379	0.17353479853479853	88	0.17886178861788618	75	0.20718232044198895	49	0.08566433566433566	167	0.22031662269129287	A	9.168	1.020494	0.19433	.	.	ENSG00000222039	ENST00000409686	D	0.88431	-2.38	0.522	0.522	0.17053	.	.	.	.	.	T	0.00241	0.0007	.	.	.	0.26420	P	0.9761123	.	.	.	.	.	.	T	0.11591	-1.0581	5	0.48119	T	0.1	.	5.277	0.15655	0.9999:0.0:1.0E-4:0.0	rs184437;rs184554;rs16918468;rs52833471;rs184437	.	.	.	S	222	ENSP00000404011:N222S	ENSP00000404011:N222S	N	+	2	0	KRT8P11	101107879	1.000000	0.71417	0.330000	0.25442	0.032000	0.12392	1.824000	0.39072	0.428000	0.26173	0.260000	0.18958	AAC	KRT8P11	-	pfam_F,superfamily_Prefoldin	ENSG00000259197	0	0.483					KRT8P11	HGNC			31	0.00	0	A			102068058	102068058	+1	no_errors	ENST00000409686	ensembl	human	known	69_37n	missense	532	13.19	81	SNP	1.000	G
KRTAP2-3	730755	genome.wustl.edu	37	17	39216128	39216128	+	Missense_Mutation	SNP	G	G	A	rs35027423	byFrequency	TCGA-A1-A0SK-01A-12D-A099-09	TCGA-A1-A0SK-10A-03D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d1b43161-cbc1-4bf6-b8bb-a72a2e5e1150	2a5384f3-fec7-4265-b104-987f0718574b	g.chr17:39216128G>A	ENST00000391418.2	-	1	216	c.175C>T	c.(175-177)Cgc>Tgc	p.R59C		NM_001165252.1	NP_001158724.1	P0C7H8	KRA23_HUMAN	keratin associated protein 2-3	59	10 X 5 AA repeats of C-C-[CDPQRWG]- [APRS]-[CIPSTVD].					keratin filament (GO:0045095)											ACCGGGCGGCGGCAGGGCTCG	0.751													g|||	537	0.107228	0.3911	0.0245	5008	,	,		14479	0.002		0.0	False		,,,				2504	0.001					dbGAP											0													1.0	1.0	1.0					17																	39216128		313	861	1174	-	-	-	SO:0001583	missense	0			BC012486	CCDS54123.1	17q21.2	2012-08-03			ENSG00000212724	ENSG00000212724		"""Keratin associated proteins"""	18906	protein-coding gene	gene with protein product							Standard	NM_001165252		Approved	KAP2.3	uc002hvx.3	P0C7H8	OTTHUMG00000133655	ENST00000391418.2:c.175C>T	17.37:g.39216128G>A	ENSP00000375237:p.Arg59Cys	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Keratin-assoc	p.R59C	ENST00000391418.2	37	c.175	CCDS54123.1	17	195	0.08928571428571429	187	0.3800813008130081	8	0.022099447513812154	0	0.0	0	0.0	.	17.56	3.420519	0.62622	.	.	ENSG00000212724	ENST00000391418	T	0.25749	1.78	5.33	0.645	0.17782	.	0.779484	0.10800	N	0.632793	T	0.00012	0.0000	.	.	.	0.25906	P	0.9832981	B	0.14012	0.009	B	0.13407	0.009	T	0.47169	-0.9138	8	0.02654	T	1	.	3.3429	0.07124	0.0921:0.3286:0.4098:0.1695	rs35027423	59	Q9BYR9	KRA24_HUMAN	C	59	ENSP00000375237:R59C	ENSP00000375237:R59C	R	-	1	0	KRTAP2-3	36469654	0.980000	0.34600	0.999000	0.59377	0.892000	0.51952	0.562000	0.23531	0.684000	0.31448	0.556000	0.70494	CGC	KRTAP2-3	-	pfam_Keratin-assoc	ENSG00000212724		0.751	KRTAP2-3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRTAP2-3	HGNC	protein_coding	OTTHUMT00000257692.1	23	0.00	0	G	NM_001165252		39216128	39216128	-1	no_errors	ENST00000391418	ensembl	human	known	69_37n	missense	45	15.09	8	SNP	0.992	A
KRTAP9-9	81870	genome.wustl.edu	37	17	39411711	39411711	+	Missense_Mutation	SNP	C	C	G	rs150962386	byFrequency	TCGA-A1-A0SK-01A-12D-A099-09	TCGA-A1-A0SK-10A-03D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d1b43161-cbc1-4bf6-b8bb-a72a2e5e1150	2a5384f3-fec7-4265-b104-987f0718574b	g.chr17:39411711C>G	ENST00000394008.1	+	1	76	c.74C>G	c.(73-75)aCc>aGc	p.T25S		NM_030975.2	NP_112237.2	Q9BYP9	KRA99_HUMAN	keratin associated protein 9-9	30	14 X 5 AA repeats of C-C-[RQVGE]- [SPSTNQ]-[TASL].					keratin filament (GO:0045095)				endometrium(3)|skin(2)|upper_aerodigestive_tract(1)	6		Breast(137;0.000496)	STAD - Stomach adenocarcinoma(17;0.000397)			ACCACTGTGACCACCTGCAGC	0.627													.|||	219	0.04373	0.1566	0.0159	5008	,	,		17225	0.0		0.001	False		,,,				2504	0.0					dbGAP											0																																										-	-	-	SO:0001583	missense	0			AJ406951	CCDS54127.1	17q21.2	2010-06-03			ENSG00000198083	ENSG00000198083		"""Keratin associated proteins"""	16773	protein-coding gene	gene with protein product			"""keratin associated protein 9-5"""	KRTAP9-5		11279113	Standard	NM_030975		Approved	KAP9.9, KAP9.5	uc021txh.1	Q9BYP9	OTTHUMG00000133602	ENST00000394008.1:c.74C>G	17.37:g.39411711C>G	ENSP00000377576:p.Thr25Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	B5MDD6|Q9BYQ1	Missense_Mutation	SNP	NULL	p.T25S	ENST00000394008.1	37	c.74	CCDS54127.1	17	82	0.037545787545787544	72	0.14634146341463414	10	0.027624309392265192	0	0.0	0	0.0	.	6.971	0.549071	0.13312	.	.	ENSG00000198083	ENST00000394008	T	0.00724	5.78	2.19	1.14	0.20703	.	.	.	.	.	T	0.00012	0.0000	N	0.13168	0.305	0.09310	N	1	B	0.11235	0.004	B	0.08055	0.003	T	0.40997	-0.9533	9	0.08381	T	0.77	.	7.4223	0.27079	0.0:0.8514:0.0:0.1486	.	30	Q9BYP9	KRA99_HUMAN	S	25	ENSP00000377576:T25S	ENSP00000377576:T25S	T	+	2	0	KRTAP9-9	36665237	0.931000	0.31567	0.005000	0.12908	0.354000	0.29330	2.718000	0.47236	0.474000	0.27392	0.456000	0.33151	ACC	KRTAP9-9	-	NULL	ENSG00000198083		0.627	KRTAP9-9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRTAP9-9	HGNC	protein_coding	OTTHUMT00000257710.1	236	0.00	0	C	NM_030975		39411711	39411711	+1	no_errors	ENST00000394008	ensembl	human	known	69_37n	missense	212	12.03	29	SNP	0.130	G
KRTAP9-7	100505724	genome.wustl.edu	37	17	39432306	39432306	+	Silent	SNP	G	G	A	rs28485549	byFrequency	TCGA-A1-A0SK-01A-12D-A099-09	TCGA-A1-A0SK-10A-03D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d1b43161-cbc1-4bf6-b8bb-a72a2e5e1150	2a5384f3-fec7-4265-b104-987f0718574b	g.chr17:39432306G>A	ENST00000391354.1	+	1	396	c.357G>A	c.(355-357)acG>acA	p.T119T		NM_001277332.1	NP_001264261.1	A8MTY7	KRA97_HUMAN	keratin associated protein 9-7	119	17 X 5 AA repeats of C-C-[VGSREQH]- [SQTPN]-[STPAI].					keratin filament (GO:0045095)				ovary(1)	1						ACCACCCCACGAGTGTCTACC	0.637													A|||	135	0.0269569	0.0961	0.0101	5008	,	,		18458	0.0		0.001	False		,,,				2504	0.0					dbGAP											0																																										-	-	-	SO:0001819	synonymous_variant	0			AC006070	CCDS59287.1	17q21.2	2013-06-25			ENSG00000180386	ENSG00000180386		"""Keratin associated proteins"""	18915	protein-coding gene	gene with protein product			"""keratin associated protein 9-like 1"""	KRTAP9L1			Standard	NM_001277332		Approved	KAP9.7	uc031rah.1	A8MTY7	OTTHUMG00000133605	ENST00000391354.1:c.357G>A	17.37:g.39432306G>A		Somatic		WXS	Illumina GAIIx	Phase_IV		Silent	SNP	NULL	p.T119	ENST00000391354.1	37	c.357	CCDS59287.1	17																																																																																			KRTAP9-7	-	NULL	ENSG00000180386		0.637	KRTAP9-7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRTAP9-7	HGNC	protein_coding	OTTHUMT00000257713.1	351	0.00	0	G	XM_003118738		39432306	39432306	+1	no_errors	ENST00000391354	ensembl	human	known	69_37n	silent	249	11.70	33	SNP	0.000	A
LAMA3	3909	genome.wustl.edu	37	18	21534511	21534511	+	Missense_Mutation	SNP	G	G	A			TCGA-A1-A0SK-01A-12D-A099-09	TCGA-A1-A0SK-10A-03D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d1b43161-cbc1-4bf6-b8bb-a72a2e5e1150	2a5384f3-fec7-4265-b104-987f0718574b	g.chr18:21534511G>A	ENST00000313654.9	+	75	10142	c.9901G>A	c.(9901-9903)Ggc>Agc	p.G3301S	LAMA3_ENST00000588770.1_3'UTR|LAMA3_ENST00000587184.1_Missense_Mutation_p.G1636S|LAMA3_ENST00000269217.6_Missense_Mutation_p.G1692S|LAMA3_ENST00000399516.3_Missense_Mutation_p.G3245S	NM_198129.1	NP_937762.1	Q16787	LAMA3_HUMAN	laminin, alpha 3	3301	Laminin G-like 5. {ECO:0000255|PROSITE- ProRule:PRU00122}.				cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|endodermal cell differentiation (GO:0035987)|epidermis development (GO:0008544)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of embryonic development (GO:0045995)	basement membrane (GO:0005604)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|laminin-1 complex (GO:0005606)|laminin-5 complex (GO:0005610)	structural molecule activity (GO:0005198)			NS(2)|breast(4)|central_nervous_system(3)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(24)|lung(54)|ovary(8)|prostate(6)|skin(7)|urinary_tract(4)	128	all_cancers(21;7.81e-05)|all_epithelial(16;4.45e-07)|Lung NSC(20;0.00156)|all_lung(20;0.00508)|Colorectal(14;0.0202)|Ovarian(20;0.17)					ATCATTCTTTGGCTGTCTGAG	0.468																																						dbGAP											0													128.0	115.0	119.0					18																	21534511		2203	4300	6503	-	-	-	SO:0001583	missense	0			L34155	CCDS11880.1, CCDS42419.1, CCDS45838.1, CCDS59307.1	18q11.2	2013-03-01	2002-08-29		ENSG00000053747	ENSG00000053747		"""Laminins"""	6483	protein-coding gene	gene with protein product		600805	"""laminin, alpha 3 (nicein (150kD), kalinin (165kD), BM600 (150kD), epilegrin)"""	LAMNA		8077230	Standard	NM_000227		Approved	nicein-150kDa, kalinin-165kDa, BM600-150kDa, epiligrin	uc002kuq.3	Q16787	OTTHUMG00000131874	ENST00000313654.9:c.9901G>A	18.37:g.21534511G>A	ENSP00000324532:p.Gly3301Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	B0YJ33|Q13679|Q13680|Q6VU67|Q6VU68|Q6VU69|Q76E14|Q96TG0	Nonsense_Mutation	SNP	pfam_Laminin_G,superfamily_ConA-like_lec_gl,smart_Laminin_G,pfscan_Laminin_G	p.W101*	ENST00000313654.9	37	c.302	CCDS42419.1	18	.	.	.	.	.	.	.	.	.	.	G	31	5.077305	0.94000	.	.	ENSG00000053747	ENST00000313654;ENST00000399516;ENST00000269217	D;D;D	0.98531	-4.98;-4.98;-4.98	5.22	5.22	0.72569	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Laminin G domain (2);Laminin G, subdomain 2 (1);	.	.	.	.	D	0.99149	0.9706	M	0.91663	3.23	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;1.0;1.0;1.0	D	0.99346	1.0913	9	0.87932	D	0	.	17.1281	0.86719	0.0:0.0:1.0:0.0	.	1636;1692;3245;3301	Q6VU69;B0YJ33;Q6VU67;Q16787	.;.;.;LAMA3_HUMAN	S	3301;3245;1692	ENSP00000324532:G3301S;ENSP00000382432:G3245S;ENSP00000269217:G1692S	ENSP00000269217:G1692S	G	+	1	0	LAMA3	19788509	1.000000	0.71417	1.000000	0.80357	0.929000	0.56500	6.952000	0.75989	2.712000	0.92718	0.655000	0.94253	GGC	LAMA3	-	superfamily_ConA-like_lec_gl,smart_Laminin_G,pfscan_Laminin_G	ENSG00000053747		0.468	LAMA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LAMA3	HGNC	protein_coding	OTTHUMT00000254824.3	256	0.00	0	G	NM_000227, NM_198129		21534511	21534511	+1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000588004	ensembl	human	putative	69_37n	nonsense	78	34.17	41	SNP	1.000	A
LAMA5	3911	genome.wustl.edu	37	20	60893617	60893617	+	Missense_Mutation	SNP	C	C	G			TCGA-A1-A0SK-01A-12D-A099-09	TCGA-A1-A0SK-10A-03D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d1b43161-cbc1-4bf6-b8bb-a72a2e5e1150	2a5384f3-fec7-4265-b104-987f0718574b	g.chr20:60893617C>G	ENST00000252999.3	-	53	7198	c.7132G>C	c.(7132-7134)Gag>Cag	p.E2378Q		NM_005560.3	NP_005551.3	O15230	LAMA5_HUMAN	laminin, alpha 5	2378	Domain II and I.				angiogenesis (GO:0001525)|branching involved in salivary gland morphogenesis (GO:0060445)|branching involved in ureteric bud morphogenesis (GO:0001658)|cell differentiation (GO:0030154)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|cell recognition (GO:0008037)|cilium assembly (GO:0042384)|cytoskeleton organization (GO:0007010)|embryo development (GO:0009790)|endothelial cell differentiation (GO:0045446)|establishment of protein localization to plasma membrane (GO:0090002)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|focal adhesion assembly (GO:0048041)|hair follicle development (GO:0001942)|integrin-mediated signaling pathway (GO:0007229)|lung development (GO:0030324)|morphogenesis of a polarized epithelium (GO:0001738)|morphogenesis of embryonic epithelium (GO:0016331)|muscle organ development (GO:0007517)|neural crest cell migration (GO:0001755)|odontogenesis of dentin-containing tooth (GO:0042475)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of cell proliferation (GO:0042127)|regulation of embryonic development (GO:0045995)|substrate adhesion-dependent cell spreading (GO:0034446)	basal lamina (GO:0005605)|basement membrane (GO:0005604)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|laminin-1 complex (GO:0005606)|laminin-10 complex (GO:0043259)|laminin-11 complex (GO:0043260)|laminin-5 complex (GO:0005610)|nucleus (GO:0005634)	integrin binding (GO:0005178)|structural molecule activity (GO:0005198)			breast(2)|central_nervous_system(3)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(3)|kidney(7)|lung(40)|ovary(1)|pancreas(1)|prostate(3)|skin(6)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	81	Breast(26;1.57e-08)		BRCA - Breast invasive adenocarcinoma(19;4.36e-06)			AGGCCGGCCTCGTGCTGGGCC	0.687																																						dbGAP											0																																										-	-	-	SO:0001583	missense	0			AF443072	CCDS33502.1	20q13.2-q13.3	2013-03-01			ENSG00000130702	ENSG00000130702		"""Laminins"""	6485	protein-coding gene	gene with protein product		601033				9271224	Standard	NM_005560		Approved		uc002ycq.3	O15230	OTTHUMG00000032908	ENST00000252999.3:c.7132G>C	20.37:g.60893617C>G	ENSP00000252999:p.Glu2378Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8TDF8|Q8WZA7|Q9H1P1	Missense_Mutation	SNP	pfam_EGF_laminin,pfam_Laminin_I,pfam_Laminin_G,pfam_Laminin_N,pfam_Laminin_II,pfam_Laminin_B_type_IV,superfamily_ConA-like_lec_gl,superfamily_Galactose-bd-like,smart_Laminin_N,smart_EGF_laminin,smart_EGF-like,smart_Laminin_B_subgr,smart_Laminin_G,pfscan_Laminin_B_type_IV,pfscan_EGF_laminin,pfscan_Laminin_G,pfscan_Laminin_N,pfscan_TNFR/NGFR_Cys_rich_reg	p.E2378Q	ENST00000252999.3	37	c.7132	CCDS33502.1	20	.	.	.	.	.	.	.	.	.	.	-	9.228	1.035031	0.19590	.	.	ENSG00000130702	ENST00000252999	T	0.11604	2.76	3.88	1.5	0.22942	Laminin I (1);	0.339478	0.28859	U	0.013920	T	0.08447	0.0210	L	0.42245	1.32	0.09310	N	0.999999	P	0.42518	0.782	B	0.41860	0.368	T	0.16600	-1.0397	10	0.40728	T	0.16	.	3.2643	0.06859	0.2212:0.5123:0.0:0.2665	.	2378	O15230	LAMA5_HUMAN	Q	2378	ENSP00000252999:E2378Q	ENSP00000252999:E2378Q	E	-	1	0	LAMA5	60327012	0.966000	0.33281	0.577000	0.28562	0.042000	0.13812	1.006000	0.29847	1.735000	0.51646	0.436000	0.28706	GAG	LAMA5	-	pfam_Laminin_I	ENSG00000130702		0.687	LAMA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LAMA5	HGNC	protein_coding	OTTHUMT00000080014.2	63	0.00	0	C	NM_005560		60893617	60893617	-1	no_errors	ENST00000252999	ensembl	human	known	69_37n	missense	34	29.17	14	SNP	0.005	G
LARGE	9215	genome.wustl.edu	37	22	34157362	34157362	+	Missense_Mutation	SNP	G	G	T			TCGA-A1-A0SK-01A-12D-A099-09	TCGA-A1-A0SK-10A-03D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d1b43161-cbc1-4bf6-b8bb-a72a2e5e1150	2a5384f3-fec7-4265-b104-987f0718574b	g.chr22:34157362G>T	ENST00000354992.2	-	3	673	c.102C>A	c.(100-102)ttC>ttA	p.F34L	LARGE_ENST00000437602.2_Missense_Mutation_p.F34L|LARGE_ENST00000397394.2_Missense_Mutation_p.F34L|LARGE_ENST00000337431.2_Missense_Mutation_p.F34L|LARGE_ENST00000402320.1_Missense_Mutation_p.F34L	NM_004737.4	NP_004728.1	O95461	LARGE_HUMAN	like-glycosyltransferase	34					glycoprotein biosynthetic process (GO:0009101)|glycosphingolipid biosynthetic process (GO:0006688)|muscle cell cellular homeostasis (GO:0046716)|N-acetylglucosamine metabolic process (GO:0006044)|protein glycosylation (GO:0006486)	integral component of Golgi membrane (GO:0030173)	acetylglucosaminyltransferase activity (GO:0008375)|transferase activity, transferring glycosyl groups (GO:0016757)	p.F34F(1)		breast(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(13)|lung(23)|ovary(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	51		Lung NSC(1;0.219)				TCTTACCTTCGAAGCTCCCAG	0.483																																					Colon(70;397 1175 4573 19089 45288)	dbGAP											1	Substitution - coding silent(1)	large_intestine(1)											139.0	138.0	138.0					22																	34157362		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ007583	CCDS13912.1	22q12.3	2013-02-22			ENSG00000133424	ENSG00000133424		"""Glycosyltransferase family 8 domain containing"""	6511	protein-coding gene	gene with protein product		603590				9892679, 10591208, 12966029	Standard	NM_004737		Approved	KIAA0609	uc003ane.4	O95461	OTTHUMG00000150914	ENST00000354992.2:c.102C>A	22.37:g.34157362G>T	ENSP00000347088:p.Phe34Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	B0QXZ7|O60348|Q17R80|Q9UGD1|Q9UGE7|Q9UGG3|Q9UGZ8|Q9UH22	Missense_Mutation	SNP	pfam_Glyco_trans_8	p.F34L	ENST00000354992.2	37	c.102	CCDS13912.1	22	.	.	.	.	.	.	.	.	.	.	G	5.286	0.238101	0.10023	.	.	ENSG00000133424	ENST00000354992;ENST00000337431;ENST00000397394;ENST00000402320;ENST00000437602;ENST00000430220;ENST00000413114;ENST00000434071;ENST00000432776;ENST00000423375	T;T;T;T;T;T;T;T	0.44083	1.42;1.39;1.42;1.39;0.93;1.8;1.8;1.78	5.7	-0.13	0.13498	.	0.114051	0.64402	N	0.000012	T	0.14184	0.0343	N	0.03608	-0.345	0.80722	D	1	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.04013	0.0;0.001;0.001	T	0.36261	-0.9755	10	0.02654	T	1	.	9.0112	0.36142	0.6115:0.0:0.3885:0.0	.	34;34;34	B7Z2I9;O95461-2;O95461	.;.;LARGE_HUMAN	L	34	ENSP00000347088:F34L;ENSP00000336636:F34L;ENSP00000380549:F34L;ENSP00000385223:F34L;ENSP00000388544:F34L;ENSP00000396277:F34L;ENSP00000415546:F34L;ENSP00000389605:F34L	ENSP00000336636:F34L	F	-	3	2	LARGE	32487362	0.970000	0.33590	0.998000	0.56505	0.990000	0.78478	0.147000	0.16202	0.000000	0.14550	0.561000	0.74099	TTC	LARGE	-	NULL	ENSG00000133424		0.483	LARGE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LARGE	HGNC	protein_coding	OTTHUMT00000320515.2	308	0.00	0	G	NM_133642		34157362	34157362	-1	no_errors	ENST00000354992	ensembl	human	known	69_37n	missense	34	42.37	25	SNP	1.000	T
LILRB3	11025	genome.wustl.edu	37	19	54725907	54725907	+	Missense_Mutation	SNP	G	G	C	rs55662384	byFrequency	TCGA-A1-A0SK-01A-12D-A099-09	TCGA-A1-A0SK-10A-03D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d1b43161-cbc1-4bf6-b8bb-a72a2e5e1150	2a5384f3-fec7-4265-b104-987f0718574b	g.chr19:54725907G>C	ENST00000391750.1	-	5	587	c.451C>G	c.(451-453)Cac>Gac	p.H151D	LILRB3_ENST00000346401.6_Missense_Mutation_p.H151D|LILRB3_ENST00000424807.1_Missense_Mutation_p.H151D|LILRA6_ENST00000419410.2_Intron|LILRB3_ENST00000469273.1_5'Flank|LILRB3_ENST00000407860.2_Missense_Mutation_p.H151D|CTB-83J4.1_ENST00000601161.1_lincRNA|LILRB3_ENST00000245620.9_Missense_Mutation_p.H151D|LILRA6_ENST00000391735.3_Intron|LILRA6_ENST00000440558.2_Intron|LILRA6_ENST00000270464.5_Intron			O75022	LIRB3_HUMAN	leukocyte immunoglobulin-like receptor, subfamily B (with TM and ITIM domains), member 3	151	Ig-like C2-type 2.				cell surface receptor signaling pathway (GO:0007166)|defense response (GO:0006952)|immune system process (GO:0002376)|negative regulation of osteoclast differentiation (GO:0045671)	integral component of plasma membrane (GO:0005887)	receptor activity (GO:0004872)|transmembrane signaling receptor activity (GO:0004888)			endometrium(3)|kidney(13)|large_intestine(1)|lung(6)|ovary(2)|prostate(5)|skin(2)|stomach(1)|urinary_tract(1)	34	all_cancers(19;0.00723)|all_epithelial(19;0.00389)|all_lung(19;0.0175)|Lung NSC(19;0.0325)|Ovarian(34;0.19)			GBM - Glioblastoma multiforme(193;0.105)		ACAAAATGGTGATATCCCTTC	0.607													.|||	412	0.0822684	0.2844	0.0346	5008	,	,		11604	0.0		0.005	False		,,,				2504	0.0072					dbGAP											0													21.0	14.0	17.0					19																	54725907		2080	3877	5957	-	-	-	SO:0001583	missense	0			U91928	CCDS33105.1, CCDS46175.1	19q13.4	2013-01-11			ENSG00000204577	ENSG00000204577		"""Leukocyte immunoglobulin-like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6607	protein-coding gene	gene with protein product		604820				9278324, 9382880	Standard	NM_006864		Approved	LIR-3, HL9, ILT5, LIR3, CD85a	uc002qee.1	O75022	OTTHUMG00000066626	ENST00000391750.1:c.451C>G	19.37:g.54725907G>C	ENSP00000375630:p.His151Asp	Somatic		WXS	Illumina GAIIx	Phase_IV	C9J1P3|C9JIP1|O15471|Q86U49	Missense_Mutation	SNP	smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	p.H151D	ENST00000391750.1	37	c.451	CCDS33105.1	19	.	.	.	.	.	.	.	.	.	.	g	0.003	-2.570640	0.00133	.	.	ENSG00000204577	ENST00000391750;ENST00000424807;ENST00000346401;ENST00000245620;ENST00000407860;ENST00000445347	T;T;T;T;T;T	0.10960	2.82;2.82;2.82;2.82;2.82;5.85	2.87	-4.31	0.03698	Immunoglobulin-like fold (1);	2.010510	0.02119	N	0.055507	T	0.01905	0.0060	N	0.00128	-2.045	0.09310	N	1	B;B;B;B;B	0.06786	0.0;0.0;0.001;0.001;0.0	B;B;B;B;B	0.09377	0.004;0.0;0.003;0.0;0.001	T	0.48570	-0.9024	10	0.02654	T	1	.	8.7737	0.34749	0.1378:0.4079:0.4543:0.0	rs55662384	151;151;151;151;151	B5MCX0;F8WD89;O75022-2;O75022;O75022-3	.;.;.;LIRB3_HUMAN;.	D	151	ENSP00000375630:H151D;ENSP00000412771:H151D;ENSP00000345184:H151D;ENSP00000245620:H151D;ENSP00000384274:H151D;ENSP00000388199:H151D	ENSP00000245620:H151D	H	-	1	0	LILRB3	59417719	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-3.740000	0.00378	-0.678000	0.05224	-2.793000	0.00115	CAC	LILRB3	-	NULL	ENSG00000204577		0.607	LILRB3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	LILRB3	HGNC	protein_coding	OTTHUMT00000142844.5	79	0.00	0	G	NM_006864		54725907	54725907	-1	no_errors	ENST00000407860	ensembl	human	known	69_37n	missense	88	10.20	10	SNP	0.000	C
LIN28B	389421	genome.wustl.edu	37	6	105526463	105526463	+	Silent	SNP	A	A	T			TCGA-A1-A0SK-01A-12D-A099-09	TCGA-A1-A0SK-10A-03D-A099-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d1b43161-cbc1-4bf6-b8bb-a72a2e5e1150	2a5384f3-fec7-4265-b104-987f0718574b	g.chr6:105526463A>T	ENST00000345080.4	+	4	761	c.558A>T	c.(556-558)ccA>ccT	p.P186P		NM_001004317.3	NP_001004317.1	Q6ZN17	LN28B_HUMAN	lin-28 homolog B (C. elegans)	186					miRNA catabolic process (GO:0010587)|pre-miRNA processing (GO:0031054)|regulation of transcription, DNA-templated (GO:0006355)|RNA 3'-end processing (GO:0031123)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|zinc ion binding (GO:0008270)			large_intestine(1)|lung(10)|ovary(1)	12		all_cancers(87;0.00346)|Acute lymphoblastic leukemia(125;2.26e-08)|all_hematologic(75;2.79e-06)|all_epithelial(87;0.204)				AATCCCAGCCATGCACTTCAA	0.552																																						dbGAP											0													89.0	79.0	83.0					6																	105526463		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK131411	CCDS34504.1	6q21	2010-04-06			ENSG00000187772	ENSG00000187772			32207	protein-coding gene	gene with protein product		611044					Standard	NM_001004317		Approved	FLJ16517, CSDD2	uc003pqv.2	Q6ZN17	OTTHUMG00000015290	ENST00000345080.4:c.558A>T	6.37:g.105526463A>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A1L165|B2RPN6|Q5TCM4	Silent	SNP	pfam_CSP_DNA-bd,superfamily_NA-bd_OB-fold-like,superfamily_Znf_CCHC,smart_Cold_shock_prot,smart_Znf_CCHC,prints_CSP_DNA-bd,pfscan_Znf_CCHC	p.P186	ENST00000345080.4	37	c.558	CCDS34504.1	6																																																																																			LIN28B	-	NULL	ENSG00000187772		0.552	LIN28B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LIN28B	HGNC	protein_coding	OTTHUMT00000041646.2	241	0.00	0	A	NM_001004317		105526463	105526463	+1	no_errors	ENST00000345080	ensembl	human	known	69_37n	silent	112	43.15	85	SNP	0.338	T
LIN9	286826	genome.wustl.edu	37	1	226426717	226426717	+	Silent	SNP	C	C	T			TCGA-A1-A0SK-01A-12D-A099-09	TCGA-A1-A0SK-10A-03D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d1b43161-cbc1-4bf6-b8bb-a72a2e5e1150	2a5384f3-fec7-4265-b104-987f0718574b	g.chr1:226426717C>T	ENST00000328205.5	-	12	1793	c.1248G>A	c.(1246-1248)aaG>aaA	p.K416K	LIN9_ENST00000481685.1_Silent_p.K381K|LIN9_ENST00000366801.1_Silent_p.K365K	NM_173083.3	NP_775106.2	Q5TKA1	LIN9_HUMAN	lin-9 DREAM MuvB core complex component	400					DNA replication (GO:0006260)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|regulation of cell cycle (GO:0051726)|transcription, DNA-templated (GO:0006351)	nucleoplasm (GO:0005654)|transcriptional repressor complex (GO:0017053)				breast(3)|endometrium(4)|kidney(2)|large_intestine(6)|lung(9)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	28	Breast(184;0.158)			GBM - Glioblastoma multiforme(131;0.131)		TGTTTAGGTCCTTGTTCAGCT	0.348																																					Ovarian(197;1696 2974 11248 14117)	dbGAP											0													130.0	122.0	125.0					1																	226426717		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AY166858	CCDS1553.1	1q42	2014-07-17	2014-07-17		ENSG00000183814	ENSG00000183814			30830	protein-coding gene	gene with protein product	"""TUDOR gene similar"", ""rb related pathway actor"""	609375	"""lin-9 homolog (C. elegans)"""			15538385, 23667535	Standard	NM_173083		Approved	TGS	uc001hqa.3	Q5TKA1	OTTHUMG00000037557	ENST00000328205.5:c.1248G>A	1.37:g.226426717C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q5U5L8|Q5U7E1|Q6PI55|Q6ZTV4|Q7Z3J1	Silent	SNP	pfam_DIRP	p.K416	ENST00000328205.5	37	c.1248	CCDS1553.1	1																																																																																			LIN9	-	NULL	ENSG00000183814		0.348	LIN9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LIN9	HGNC	protein_coding	OTTHUMT00000091523.2	336	0.00	0	C	NM_173083		226426717	226426717	-1	no_errors	ENST00000328205	ensembl	human	known	69_37n	silent	46	38.67	29	SNP	0.999	T
LMLN	89782	genome.wustl.edu	37	3	197765665	197765665	+	3'UTR	SNP	T	T	C	rs73891808	byFrequency	TCGA-A1-A0SK-01A-12D-A099-09	TCGA-A1-A0SK-10A-03D-A099-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d1b43161-cbc1-4bf6-b8bb-a72a2e5e1150	2a5384f3-fec7-4265-b104-987f0718574b	g.chr3:197765665T>C	ENST00000330198.4	+	0	2117				LMLN-AS1_ENST00000423460.1_RNA|LMLN_ENST00000420910.2_3'UTR	NM_033029.3	NP_149018.2	Q96KR4	LMLN_HUMAN	leishmanolysin-like (metallopeptidase M8 family)						cell adhesion (GO:0007155)|mitotic nuclear division (GO:0007067)	cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|lipid particle (GO:0005811)|membrane (GO:0016020)	metal ion binding (GO:0046872)|metalloendopeptidase activity (GO:0004222)			endometrium(3)|kidney(2)|large_intestine(4)|lung(12)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	25	all_cancers(143;1.15e-09)|Ovarian(172;0.0418)|Breast(254;0.0976)	Lung NSC(153;0.132)	Epithelial(36;9.84e-24)|all cancers(36;3.18e-22)|OV - Ovarian serous cystadenocarcinoma(49;5.35e-19)|LUSC - Lung squamous cell carcinoma(58;6.94e-07)|Lung(62;9.92e-07)	GBM - Glioblastoma multiforme(93;0.111)		CTTGGAAGAATTGACGACCAT	0.468													T|||	23	0.00459265	0.0166	0.0014	5008	,	,		22657	0.0		0.0	False		,,,				2504	0.0					dbGAP											0																																										-	-	-	SO:0001624	3_prime_UTR_variant	0			AJ312398	CCDS3332.1, CCDS46988.1	3q29	2008-02-04			ENSG00000185621	ENSG00000185621	3.4.24.36		15991	protein-coding gene	gene with protein product		609380					Standard	NM_033029		Approved	Gp63, Msp	uc010iar.3	Q96KR4	OTTHUMG00000155375	ENST00000330198.4:c.*127T>C	3.37:g.197765665T>C		Somatic		WXS	Illumina GAIIx	Phase_IV	B3LDG9|B3LDH0|C9J796|F8WB28|Q96KR5	RNA	SNP	-	NULL	ENST00000330198.4	37	NULL	CCDS3332.1	3																																																																																			LMLN-AS1	-	-	ENSG00000232832		0.468	LMLN-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	LMLN-AS1	HGNC	protein_coding	OTTHUMT00000339701.1	42	0.00	0	T	NM_033029		197765665	197765665	-1	no_errors	ENST00000423460	ensembl	human	putative	69_37n	rna	195	11.36	25	SNP	0.078	C
NPIPB5	100132247	genome.wustl.edu	37	16	22545339	22545339	+	Silent	SNP	T	T	C	rs199834720	byFrequency	TCGA-A1-A0SK-01A-12D-A099-09	TCGA-A1-A0SK-10A-03D-A099-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d1b43161-cbc1-4bf6-b8bb-a72a2e5e1150	2a5384f3-fec7-4265-b104-987f0718574b	g.chr16:22545339T>C	ENST00000517539.1	+	8	1110	c.1035T>C	c.(1033-1035)tgT>tgC	p.C345C	NPIPB5_ENST00000424340.1_Silent_p.C345C|NPIPB5_ENST00000415654.1_3'UTR			A8MRT5	NPIB5_HUMAN	nuclear pore complex interacting protein family, member B5	345	Pro-rich.					integral component of membrane (GO:0016021)											CTCCCGAGTGTCTGCTCACTC	0.562													.|||	574	0.114617	0.4054	0.049	5008	,	,		41546	0.0		0.003	False		,,,				2504	0.001					dbGAP											0													8.0	5.0	6.0					16																	22545339		82	554	636	-	-	-	SO:0001819	synonymous_variant	0				CCDS45443.1	16p12.2	2013-06-11			ENSG00000243716	ENSG00000243716			37233	protein-coding gene	gene with protein product							Standard	NM_001135865		Approved			A8MRT5	OTTHUMG00000163573	ENST00000517539.1:c.1035T>C	16.37:g.22545339T>C		Somatic		WXS	Illumina GAIIx	Phase_IV	B4DK13	Silent	SNP	pfam_NPIP	p.C345	ENST00000517539.1	37	c.1035	CCDS45443.1	16																																																																																			RP11-368J21.2	-	pfam_NPIP	ENSG00000243716		0.562	NPIPB5-002	NOVEL	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	LOC100132247	Clone_based_vega_gene	protein_coding	OTTHUMT00000374343.2	105	0.00	0	T	NM_001135865		22545339	22545339	+1	no_errors	ENST00000424340	ensembl	human	known	69_37n	silent	69	40.00	46	SNP	0.917	C
LOC653786	653786	genome.wustl.edu	37	16	22563822	22563822	+	RNA	SNP	G	G	A	rs569172145	byFrequency	TCGA-A1-A0SK-01A-12D-A099-09	TCGA-A1-A0SK-10A-03D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d1b43161-cbc1-4bf6-b8bb-a72a2e5e1150	2a5384f3-fec7-4265-b104-987f0718574b	g.chr16:22563822G>A	ENST00000550753.1	+	0	1477					NR_003676.2																						CCCCAGCTCTGACCCTATGCC	0.512													G|||	5	0.000998403	0.0038	0.0	5008	,	,		31231	0.0		0.0	False		,,,				2504	0.0					dbGAP											0																																										-	-	-			0																															16.37:g.22563822G>A		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000550753.1	37	NULL		16																																																																																			RP11-368J21.3	-	-	ENSG00000257838		0.512	RP11-368J21.3-001	KNOWN	basic	processed_transcript	LOC653786	Clone_based_vega_gene	pseudogene	OTTHUMT00000409041.1	210	0.00	0	G			22563822	22563822	+1	no_errors	ENST00000550753	ensembl	human	known	69_37n	rna	60	10.45	7	SNP	0.003	A
GOLGA8O	728047	genome.wustl.edu	37	15	32737911	32737911	+	Missense_Mutation	SNP	A	A	G	rs202039765	byFrequency	TCGA-A1-A0SK-01A-12D-A099-09	TCGA-A1-A0SK-10A-03D-A099-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d1b43161-cbc1-4bf6-b8bb-a72a2e5e1150	2a5384f3-fec7-4265-b104-987f0718574b	g.chr15:32737911A>G	ENST00000509311.2	-	17	1572	c.1475T>C	c.(1474-1476)aTc>aCc	p.I492T	AC135983.1_ENST00000408391.1_RNA|RN7SL539P_ENST00000482670.2_RNA	NM_001277308.1	NP_001264237.1	A6NCC3	GOG8O_HUMAN	golgin A8 family, member O	492						Golgi apparatus (GO:0005794)											AAGGTGATGGATTTTCCTGCG	0.602													.|||	84	0.0167732	0.0507	0.0086	5008	,	,		8710	0.003		0.003	False		,,,				2504	0.0051					dbGAP											0																																										-	-	-	SO:0001583	missense	0				CCDS59252.1	15q13.3	2012-10-05			ENSG00000206127	ENSG00000206127			44406	protein-coding gene	gene with protein product							Standard	NM_001277308		Approved		uc031qrg.1	A6NCC3	OTTHUMG00000162878	ENST00000509311.2:c.1475T>C	15.37:g.32737911A>G	ENSP00000423159:p.Ile492Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NHZ1|E7ENU5	Missense_Mutation	SNP	NULL	p.I492T	ENST00000509311.2	37	c.1475	CCDS59252.1	15	.	.	.	.	.	.	.	.	.	.	a	7.268	0.606557	0.14002	.	.	ENSG00000206127	ENST00000509311	T	0.21932	1.98	1.61	1.61	0.23674	.	.	.	.	.	T	0.25419	0.0618	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.03344	-1.1046	6	0.41790	T	0.15	.	7.357	0.26725	1.0:0.0:0.0:0.0	.	.	.	.	T	492	ENSP00000423159:I492T	ENSP00000423159:I492T	I	-	2	0	RP11-632K20.1	30525203	1.000000	0.71417	0.071000	0.20095	0.105000	0.19272	6.566000	0.73978	1.020000	0.39573	0.076000	0.15429	ATC	RP11-632K20.1	-	NULL	ENSG00000206127		0.602	GOLGA8O-001	NOVEL	not_best_in_genome_evidence|basic|appris_candidate_longest|CCDS	protein_coding	LOC728047	Clone_based_vega_gene	protein_coding	OTTHUMT00000370931.3	23	0.00	0	A			32737911	32737911	-1	no_errors	ENST00000509311	ensembl	human	novel	69_37n	missense	4	71.43	10	SNP	1.000	G
LRRC37A11P	342666	genome.wustl.edu	37	17	37188240	37188240	+	RNA	SNP	C	C	T	rs34700711	byFrequency	TCGA-A1-A0SK-01A-12D-A099-09	TCGA-A1-A0SK-10A-03D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d1b43161-cbc1-4bf6-b8bb-a72a2e5e1150	2a5384f3-fec7-4265-b104-987f0718574b	g.chr17:37188240C>T	ENST00000425901.2	+	0	2082					NR_033753.2				leucine rich repeat containing 37, member A11, pseudogene																		ACAGTTCAACCTCTGGACCTG	0.512													C|||	1269	0.253395	0.0212	0.438	5008	,	,		22408	0.3294		0.2932	False		,,,				2504	0.317					dbGAP											0																																										-	-	-			0					17q12	2013-05-14			ENSG00000214553	ENSG00000214553			43815	pseudogene	pseudogene							Standard	NR_033753		Approved		uc002hrd.1		OTTHUMG00000133184		17.37:g.37188240C>T		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000425901.2	37	NULL		17																																																																																			LRRC37A11P	-	-	ENSG00000214553		0.512	LRRC37A11P-002	KNOWN	basic	processed_transcript	LRRC37A11P	HGNC	pseudogene	OTTHUMT00000444105.1	212	0.93	2	C	NR_033753		37188240	37188240	+1	no_errors	ENST00000425901	ensembl	human	known	69_37n	rna	449	10.91	55	SNP	0.006	T
LRRC37A11P	342666	genome.wustl.edu	37	17	37188613	37188613	+	RNA	SNP	C	C	T	rs35008241	byFrequency	TCGA-A1-A0SK-01A-12D-A099-09	TCGA-A1-A0SK-10A-03D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d1b43161-cbc1-4bf6-b8bb-a72a2e5e1150	2a5384f3-fec7-4265-b104-987f0718574b	g.chr17:37188613C>T	ENST00000425901.2	+	0	2455					NR_033753.2				leucine rich repeat containing 37, member A11, pseudogene																		TGTCGTGTATCGATCTCAGCC	0.512													T|||	1406	0.280751	0.0719	0.4539	5008	,	,		21176	0.3264		0.3171	False		,,,				2504	0.3558					dbGAP											0																																										-	-	-			0					17q12	2013-05-14			ENSG00000214553	ENSG00000214553			43815	pseudogene	pseudogene							Standard	NR_033753		Approved		uc002hrd.1		OTTHUMG00000133184		17.37:g.37188613C>T		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000425901.2	37	NULL		17																																																																																			LRRC37A11P	-	-	ENSG00000214553		0.512	LRRC37A11P-002	KNOWN	basic	processed_transcript	LRRC37A11P	HGNC	pseudogene	OTTHUMT00000444105.1	31	0.00	0	C	NR_033753		37188613	37188613	+1	no_errors	ENST00000425901	ensembl	human	known	69_37n	rna	426	13.06	64	SNP	0.000	T
MBD3L5	284428	genome.wustl.edu	37	19	7032902	7032902	+	Silent	SNP	G	G	A	rs78637972	byFrequency	TCGA-A1-A0SK-01A-12D-A099-09	TCGA-A1-A0SK-10A-03D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d1b43161-cbc1-4bf6-b8bb-a72a2e5e1150	2a5384f3-fec7-4265-b104-987f0718574b	g.chr19:7032902G>A	ENST00000329753.5	+	2	658	c.624G>A	c.(622-624)ggG>ggA	p.G208G		NM_001136507.1	NP_001129979.1	A6NJ08	MB3L5_HUMAN	methyl-CpG binding domain protein 3-like 5	208																	TGACAGGTGGGTGAAGCTCAG	0.542													-|||	1282	0.25599	0.4092	0.1383	5008	,	,		4697	0.1617		0.2127	False		,,,				2504	0.274					dbGAP											0													8.0	11.0	10.0					19																	7032902		253	837	1090	-	-	-	SO:0001819	synonymous_variant	0				CCDS45942.1	19p13.2	2014-04-01			ENSG00000237247	ENSG00000237247			37204	protein-coding gene	gene with protein product							Standard	NM_001136507		Approved		uc010xjl.2	A6NJ08	OTTHUMG00000181973	ENST00000329753.5:c.624G>A	19.37:g.7032902G>A		Somatic		WXS	Illumina GAIIx	Phase_IV		Silent	SNP	NULL	p.G208	ENST00000329753.5	37	c.624	CCDS45942.1	19																																																																																			MBD3L5	-	NULL	ENSG00000237247		0.542	MBD3L5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MBD3L5	HGNC	protein_coding	OTTHUMT00000458497.1	27	0.00	0	G	NM_001136507		7032902	7032902	+1	no_errors	ENST00000329753	ensembl	human	known	69_37n	silent	135	15.09	24	SNP	0.002	A
LSR	51599	genome.wustl.edu	37	19	35749935	35749935	+	Missense_Mutation	SNP	A	A	G			TCGA-A1-A0SK-01A-12D-A099-09	TCGA-A1-A0SK-10A-03D-A099-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d1b43161-cbc1-4bf6-b8bb-a72a2e5e1150	2a5384f3-fec7-4265-b104-987f0718574b	g.chr19:35749935A>G	ENST00000361790.3	+	3	845	c.686A>G	c.(685-687)aAc>aGc	p.N229S	LSR_ENST00000602122.1_Missense_Mutation_p.N229S|LSR_ENST00000347609.4_Missense_Mutation_p.N192S|LSR_ENST00000354900.3_Missense_Mutation_p.N229S|LSR_ENST00000360798.3_Missense_Mutation_p.N229S|LSR_ENST00000427250.1_Intron|LSR_ENST00000597933.1_3'UTR	NM_205834.3	NP_991403.1	Q86X29	LSR_HUMAN	lipolysis stimulated lipoprotein receptor	229	Ig-like V-type.				embryo development (GO:0009790)|liver development (GO:0001889)	chylomicron (GO:0042627)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|low-density lipoprotein particle (GO:0034362)|plasma membrane (GO:0005886)|very-low-density lipoprotein particle (GO:0034361)				breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	13	all_lung(56;3.91e-09)|Lung NSC(56;5.64e-09)|Esophageal squamous(110;0.162)		Epithelial(14;1.33e-19)|OV - Ovarian serous cystadenocarcinoma(14;1.29e-18)|all cancers(14;7.11e-17)|LUSC - Lung squamous cell carcinoma(66;0.0417)			CTCCAGGGGAACAATGAGGCC	0.607																																						dbGAP											0													126.0	91.0	103.0					19																	35749935		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF130366	CCDS12449.1, CCDS12450.1, CCDS12451.1, CCDS59376.1	19q13.12	2013-01-11			ENSG00000105699	ENSG00000105699		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	29572	protein-coding gene	gene with protein product	"""lipolysis-stimulated remnant"", ""immunoglobulin-like domain containing receptor 3"""					10224102	Standard	NM_015925		Approved	LISCH7, ILDR3	uc002nyl.3	Q86X29		ENST00000361790.3:c.686A>G	19.37:g.35749935A>G	ENSP00000354575:p.Asn229Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NDW3|B4DKL4|E9PHD4|O00112|O00426|Q6ZT80|Q8NBM0|Q9BT33|Q9UQL3	Missense_Mutation	SNP	pfam_LISCH7,smart_Ig_sub,pfscan_Ig-like	p.N229S	ENST00000361790.3	37	c.686	CCDS12450.1	19	.	.	.	.	.	.	.	.	.	.	A	18.90	3.720743	0.68959	.	.	ENSG00000105699	ENST00000361790;ENST00000354900;ENST00000360798;ENST00000347609	T;T;T;T	0.59906	0.39;0.57;0.23;0.24	4.99	4.99	0.66335	Immunoglobulin subtype (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.050262	0.85682	D	0.000000	T	0.71702	0.3371	M	0.62723	1.935	0.80722	D	1	D;D;D;D;D	0.76494	0.995;0.995;0.999;0.992;0.978	P;D;D;D;P	0.85130	0.861;0.96;0.997;0.913;0.833	T	0.73043	-0.4107	10	0.51188	T	0.08	-40.8547	12.6918	0.56978	1.0:0.0:0.0:0.0	.	192;229;229;229;229	Q86X29-2;Q86X29-3;A6NDW3;E9PHD4;Q86X29	.;.;.;.;LSR_HUMAN	S	229;229;229;192	ENSP00000354575:N229S;ENSP00000346976:N229S;ENSP00000354034:N229S;ENSP00000262627:N192S	ENSP00000262627:N192S	N	+	2	0	LSR	40441775	1.000000	0.71417	0.996000	0.52242	0.893000	0.52053	6.303000	0.72794	2.106000	0.64143	0.459000	0.35465	AAC	LSR	-	smart_Ig_sub,pfscan_Ig-like	ENSG00000105699		0.607	LSR-003	KNOWN	basic|appris_principal|CCDS	protein_coding	LSR	HGNC	protein_coding	OTTHUMT00000465513.2	327	0.00	0	A	NM_015925		35749935	35749935	+1	no_errors	ENST00000361790	ensembl	human	known	69_37n	missense	124	12.68	18	SNP	1.000	G
MED15	51586	genome.wustl.edu	37	22	20905620	20905620	+	Intron	SNP	A	A	G	rs116430800	byFrequency	TCGA-A1-A0SK-01A-12D-A099-09	TCGA-A1-A0SK-10A-03D-A099-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d1b43161-cbc1-4bf6-b8bb-a72a2e5e1150	2a5384f3-fec7-4265-b104-987f0718574b	g.chr22:20905620A>G	ENST00000263205.7	+	3	225				MED15_ENST00000542773.1_Intron|MED15_ENST00000406969.1_Intron|MED15_ENST00000382974.2_Intron|MED15_ENST00000292733.7_Intron|MED15_ENST00000425759.2_Intron|MED15_ENST00000541476.1_Intron	NM_001003891.1	NP_001003891.1	Q96RN5	MED15_HUMAN	mediator complex subunit 15						gene expression (GO:0010467)|stem cell maintenance (GO:0019827)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cytoplasm (GO:0005737)|mediator complex (GO:0016592)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	RNA polymerase II transcription cofactor activity (GO:0001104)			central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(2)|lung(8)|ovary(1)|prostate(1)|skin(3)|urinary_tract(1)	25	all_cancers(11;2.07e-24)|Melanoma(16;0.000465)|Ovarian(15;0.00167)|Colorectal(54;0.0221)|all_neural(72;0.142)	Lung SC(17;0.0262)	LUSC - Lung squamous cell carcinoma(15;0.00102)|Lung(15;0.0173)|Epithelial(17;0.209)			GCCTTGCAGGATGGGCTTCAG	0.567													A|||	181	0.0361422	0.1339	0.0058	5008	,	,		18657	0.0		0.0	False		,,,				2504	0.0					dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			AF056191	CCDS13781.1, CCDS33602.1, CCDS74824.1	22q11.2	2007-07-30	2007-07-30	2007-07-30	ENSG00000099917	ENSG00000099917			14248	protein-coding gene	gene with protein product		607372	"""trinucleotide repeat containing 7"", ""PC2 (positive cofactor 2, multiprotein complex) glutamine/Q-rich-associated protein"""	TNRC7, PCQAP		11024300, 11414760, 15175163	Standard	XM_005261632		Approved	TIG-1, CAG7A, Arc105	uc002zsp.3	Q96RN5	OTTHUMG00000150810	ENST00000263205.7:c.157-103A>G	22.37:g.20905620A>G		Somatic		WXS	Illumina GAIIx	Phase_IV	D3DX31|D3DX32|O15413|Q6IC31|Q8NF16|Q96CT0|Q96IH7|Q9P1T3	Missense_Mutation	SNP	NULL	p.M1V	ENST00000263205.7	37	c.1	CCDS33602.1	22	70|70	0.03205128205128205|0.03205128205128205	68|68	0.13821138211382114|0.13821138211382114	2|2	0.0055248618784530384|0.0055248618784530384	0|0	0.0|0.0	0|0	0.0|0.0	A|A	6.793|6.793	0.515398|0.515398	0.12944|0.12944	.|.	.|.	ENSG00000099917|ENSG00000099917	ENST00000423862|ENST00000428629;ENST00000424287	.|.	.|.	.|.	4.92|4.92	-2.88|-2.88	0.05682|0.05682	.|.	.|.	.|.	.|.	.|.	T|T	0.00210|0.00210	0.0006|0.0006	.|.	.|.	.|.	0.09310|0.09310	N|N	0.999998|0.999998	.|.	.|.	.|.	.|.	.|.	.|.	T|T	0.18555|0.18555	-1.0333|-1.0333	4|5	.|0.87932	.|D	.|0	.|.	1.9672|1.9672	0.03398|0.03398	0.3718:0.1561:0.3452:0.1268|0.3718:0.1561:0.3452:0.1268	.|.	.|.	.|.	.|.	G|V	15|1	.|.	.|ENSP00000416109:M1V	D|M	+|+	2|1	0|0	MED15|MED15	19235620|19235620	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.001000|0.001000	0.01503|0.01503	0.264000|0.264000	0.18497|0.18497	-0.648000|-0.648000	0.05437|0.05437	-1.098000|-1.098000	0.02139|0.02139	GAT|ATG	MED15	-	NULL	ENSG00000099917		0.567	MED15-004	KNOWN	basic|CCDS	protein_coding	MED15	HGNC	protein_coding	OTTHUMT00000320177.2	146	0.00	0	A	NM_015889		20905620	20905620	+1	no_errors	ENST00000420849	ensembl	human	known	69_37n	missense	44	11.76	6	SNP	0.000	G
MRPL55	128308	genome.wustl.edu	37	1	228295526	228295526	+	Missense_Mutation	SNP	C	C	T			TCGA-A1-A0SK-01A-12D-A099-09	TCGA-A1-A0SK-10A-03D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d1b43161-cbc1-4bf6-b8bb-a72a2e5e1150	2a5384f3-fec7-4265-b104-987f0718574b	g.chr1:228295526C>T	ENST00000411464.2	-	4	864	c.71G>A	c.(70-72)cGc>cAc	p.R24H	MRPL55_ENST00000391867.3_Missense_Mutation_p.R24H|MRPL55_ENST00000336300.5_Missense_Mutation_p.R24H|MRPL55_ENST00000366746.3_Missense_Mutation_p.R24H|MRPL55_ENST00000366740.1_Missense_Mutation_p.R24H|MRPL55_ENST00000366734.1_Missense_Mutation_p.R24H|MRPL55_ENST00000348259.5_Missense_Mutation_p.R24H|MRPL55_ENST00000430433.1_Missense_Mutation_p.R60H|MRPL55_ENST00000366731.5_Missense_Mutation_p.R60H|MRPL55_ENST00000295008.4_Missense_Mutation_p.R24H|MRPL55_ENST00000366742.1_Missense_Mutation_p.R24H|MRPL55_ENST00000465397.1_5'UTR|MRPL55_ENST00000366741.1_Missense_Mutation_p.R24H|MRPL55_ENST00000366732.1_Missense_Mutation_p.R21H|C1orf35_ENST00000472617.1_5'Flank|MRPL55_ENST00000366739.1_Missense_Mutation_p.R24H|MRPL55_ENST00000366735.1_Missense_Mutation_p.R24H|MRPL55_ENST00000366747.3_Missense_Mutation_p.R24H|MRPL55_ENST00000366733.1_Missense_Mutation_p.R24H|MRPL55_ENST00000366744.1_Missense_Mutation_p.R24H|MRPL55_ENST00000366738.1_Missense_Mutation_p.R60H|MRPL55_ENST00000366736.1_Missense_Mutation_p.R24H|MRPL55_ENST00000336520.3_Missense_Mutation_p.R24H			Q7Z7F7	RM55_HUMAN	mitochondrial ribosomal protein L55	24			R -> C (in dbSNP:rs822730).		translation (GO:0006412)	mitochondrial large ribosomal subunit (GO:0005762)	structural constituent of ribosome (GO:0003735)			central_nervous_system(1)|lung(4)	5		Prostate(94;0.0405)				GTGCAGGCGGCGGAGTGCAGG	0.632																																						dbGAP											0													67.0	58.0	61.0					1																	228295526		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK056987	CCDS1567.1, CCDS44325.1	1q42.13	2012-09-13			ENSG00000162910	ENSG00000162910		"""Mitochondrial ribosomal proteins / large subunits"""	16686	protein-coding gene	gene with protein product		611859					Standard	NM_181463		Approved		uc001hrz.4	Q7Z7F7	OTTHUMG00000037965	ENST00000411464.2:c.71G>A	1.37:g.228295526C>T	ENSP00000401737:p.Arg24His	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5TBY3|Q5TBY6|Q6UWI8	Missense_Mutation	SNP	pfam_Ribosomal_L55_mit	p.R60H	ENST00000411464.2	37	c.179	CCDS1567.1	1	.	.	.	.	.	.	.	.	.	.	C	5.937	0.356984	0.11239	.	.	ENSG00000162910	ENST00000366732;ENST00000366733;ENST00000366734;ENST00000366735;ENST00000366736;ENST00000366738;ENST00000366741;ENST00000366740;ENST00000366739;ENST00000366742;ENST00000366744;ENST00000348259;ENST00000366747;ENST00000366746;ENST00000295008;ENST00000336520;ENST00000336300;ENST00000430433;ENST00000391867;ENST00000366731;ENST00000411464;ENST00000457264	T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T	0.36340	1.26;1.26;1.26;1.26;1.26;1.26;1.26;1.26;1.26;1.26;1.26;1.26;1.26;1.26;1.26;1.26;1.26;1.26;1.26;1.26;1.26;1.26	4.36	2.32	0.28847	.	1.159180	0.06191	N	0.681324	T	0.28732	0.0712	L	0.38838	1.175	0.09310	N	1	B;B	0.21606	0.058;0.031	B;B	0.19148	0.024;0.011	T	0.22521	-1.0214	10	0.15952	T	0.53	-6.647	9.8172	0.40860	0.0:0.802:0.0:0.198	.	60;24	Q7Z7F7-2;Q7Z7F7	.;RM55_HUMAN	H	21;24;24;24;24;60;24;24;24;24;24;24;24;24;24;24;24;60;24;60;24;24	ENSP00000355693:R21H;ENSP00000355694:R24H;ENSP00000355695:R24H;ENSP00000355696:R24H;ENSP00000355697:R24H;ENSP00000355699:R60H;ENSP00000355702:R24H;ENSP00000355701:R24H;ENSP00000355700:R24H;ENSP00000355703:R24H;ENSP00000355705:R24H;ENSP00000338189:R24H;ENSP00000355708:R24H;ENSP00000355707:R24H;ENSP00000295008:R24H;ENSP00000337342:R24H;ENSP00000337361:R24H;ENSP00000403614:R60H;ENSP00000375740:R24H;ENSP00000355692:R60H;ENSP00000401737:R24H;ENSP00000409966:R24H	ENSP00000295008:R24H	R	-	2	0	MRPL55	226362149	0.000000	0.05858	0.002000	0.10522	0.002000	0.02628	0.124000	0.15728	1.052000	0.40392	0.650000	0.86243	CGC	MRPL55	-	pfam_Ribosomal_L55_mit	ENSG00000162910		0.632	MRPL55-203	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MRPL55	HGNC	protein_coding	OTTHUMT00000092808.1	113	0.00	0	C	XM_059233		228295526	228295526	-1	no_errors	ENST00000366731	ensembl	human	known	69_37n	missense	45	13.46	7	SNP	0.000	T
MT-CO1	4512	genome.wustl.edu	37	M	6026	6026	+	Silent	SNP	G	G	A			TCGA-A1-A0SK-01A-12D-A099-09	TCGA-A1-A0SK-10A-03D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d1b43161-cbc1-4bf6-b8bb-a72a2e5e1150	2a5384f3-fec7-4265-b104-987f0718574b	g.chrM:6026G>A	ENST00000361624.2	+	1	123	c.123G>A	c.(121-123)ctG>ctA	p.L41L	MT-TD_ENST00000387419.1_RNA|MT-TK_ENST00000387421.1_RNA|MT-TI_ENST00000387365.1_RNA|MT-ATP6_ENST00000361899.2_5'Flank|MT-RNR2_ENST00000387347.2_RNA|MT-TW_ENST00000387382.1_RNA|MT-TN_ENST00000387400.1_RNA|MT-TY_ENST00000387409.1_RNA|MT-TS1_ENST00000387416.2_RNA|MT-TC_ENST00000387405.1_RNA|MT-TA_ENST00000387392.1_RNA|MT-ATP8_ENST00000361851.1_5'Flank|MT-CO2_ENST00000361739.1_5'Flank|MT-TL1_ENST00000386347.1_RNA|MT-TQ_ENST00000387372.1_RNA|MT-TM_ENST00000387377.1_RNA			P00395	COX1_HUMAN	mitochondrially encoded cytochrome c oxidase I	41					aerobic respiration (GO:0009060)|cellular metabolic process (GO:0044237)|hydrogen ion transmembrane transport (GO:1902600)|oxidative phosphorylation (GO:0006119)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex IV (GO:0005751)|respiratory chain complex IV (GO:0045277)	cytochrome-c oxidase activity (GO:0004129)|heme binding (GO:0020037)|iron ion binding (GO:0005506)			breast(4)|endometrium(25)|kidney(19)|lung(3)|prostate(3)	54						CGAGCCGAGCTGGGCCAGCCA	0.458																																						dbGAP											0																																										-	-	-	SO:0001819	synonymous_variant	0					mitochondria	2011-07-04	2005-02-15	2005-02-16	ENSG00000198804	ENSG00000198804		"""Mitochondrial respiratory chain complex / Complex IV"""	7419	protein-coding gene	gene with protein product		516030	"""cytochrome c oxidase I"""	MTCO1		7219534	Standard			Approved	COX1, COI		P00395		ENST00000361624.2:c.123G>A	M.37:g.6026G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q34770	Silent	SNP	pfam_Cyt_c_Oxase_su1,superfamily_Cyt_c_Oxase_su1_dom,pfscan_Cyt_c_Oxase_su1_dom,prints_Cyt_c_Oxase_su1	p.L41	ENST00000361624.2	37	c.123		MT																																																																																			MT-CO1	-	pfam_Cyt_c_Oxase_su1,superfamily_Cyt_c_Oxase_su1_dom,pfscan_Cyt_c_Oxase_su1_dom	ENSG00000198804		0.458	MT-CO1-201	KNOWN	basic|appris_principal	protein_coding	MT-CO1	HGNC	protein_coding		107	0.00	0	G	YP_003024028		6026	6026	+1	no_errors	ENST00000361624	ensembl	human	known	69_37n	silent	37	19.57	9	SNP	NULL	A
MT-ND2	4536	genome.wustl.edu	37	M	5027	5027	+	Silent	SNP	C	C	T			TCGA-A1-A0SK-01A-12D-A099-09	TCGA-A1-A0SK-10A-03D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d1b43161-cbc1-4bf6-b8bb-a72a2e5e1150	2a5384f3-fec7-4265-b104-987f0718574b	g.chrM:5027C>T	ENST00000361453.3	+	1	558	c.558C>T	c.(556-558)caC>caT	p.H186H	MT-TD_ENST00000387419.1_RNA|MT-CO1_ENST00000361624.2_5'Flank|MT-TI_ENST00000387365.1_RNA|MT-RNR2_ENST00000387347.2_RNA|MT-TW_ENST00000387382.1_RNA|MT-TN_ENST00000387400.1_RNA|MT-TY_ENST00000387409.1_RNA|MT-TS1_ENST00000387416.2_RNA|MT-TC_ENST00000387405.1_RNA|MT-TA_ENST00000387392.1_RNA|MT-CO2_ENST00000361739.1_5'Flank|MT-TL1_ENST00000386347.1_RNA|MT-TQ_ENST00000387372.1_RNA|MT-TM_ENST00000387377.1_RNA			P03891	NU2M_HUMAN	mitochondrially encoded NADH dehydrogenase 2	186					cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|reactive oxygen species metabolic process (GO:0072593)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex I (GO:0005747)	NADH dehydrogenase (ubiquinone) activity (GO:0008137)			breast(2)|lung(1)	3						TCAATTACCCACATAGGATGA	0.383																																						dbGAP											0																																										-	-	-	SO:0001819	synonymous_variant	0					mitochondria	2011-07-04	2005-02-15	2005-02-16	ENSG00000198763	ENSG00000198763	1.6.5.3	"""Mitochondrial respiratory chain complex / Complex I"""	7456	protein-coding gene	gene with protein product	"""complex I ND2 subunit"", ""NADH-ubiquinone oxidoreductase chain 2"""	516001	"""NADH dehydrogenase 2"""	MTND2			Standard			Approved	ND2, NAD2		P03891		ENST00000361453.3:c.558C>T	M.37:g.5027C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q34769|Q9TGI0|Q9TGI1|Q9TGI2|Q9TGI3|Q9TGI4	Silent	SNP	pfam_NADH_UbQ/plastoQ_OxRdtase,pfam_NADH_DH_su2_C,prints_NADH_UbQ_OxRdtase_chain2	p.H186	ENST00000361453.3	37	c.558		MT																																																																																			MT-ND2	-	pfam_NADH_UbQ/plastoQ_OxRdtase,prints_NADH_UbQ_OxRdtase_chain2	ENSG00000198763		0.383	MT-ND2-201	KNOWN	basic|appris_principal	protein_coding	MT-ND2	HGNC	protein_coding		55	0.00	0	C	YP_003024027		5027	5027	+1	no_stop_codon:bad_bp_length_for_coding_region	ENST00000361453	ensembl	human	known	69_37n	silent	40	14.89	7	SNP	NULL	T
MT-CO2	4513	genome.wustl.edu	37	M	7624	7624	+	Silent	SNP	T	T	A			TCGA-A1-A0SK-01A-12D-A099-09	TCGA-A1-A0SK-10A-03D-A099-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d1b43161-cbc1-4bf6-b8bb-a72a2e5e1150	2a5384f3-fec7-4265-b104-987f0718574b	g.chrM:7624T>A	ENST00000361739.1	+	1	39	c.39T>A	c.(37-39)acT>acA	p.T13T	MT-TD_ENST00000387419.1_RNA|MT-TK_ENST00000387421.1_RNA|MT-ND3_ENST00000361227.2_5'Flank|MT-ATP6_ENST00000361899.2_5'Flank|MT-TG_ENST00000387429.1_RNA|MT-TW_ENST00000387382.1_RNA|MT-ND4L_ENST00000361335.1_5'Flank|MT-TN_ENST00000387400.1_RNA|MT-TY_ENST00000387409.1_RNA|MT-TS1_ENST00000387416.2_RNA|MT-TR_ENST00000387439.1_RNA|MT-TC_ENST00000387405.1_RNA|MT-TA_ENST00000387392.1_RNA|MT-ATP8_ENST00000361851.1_5'Flank|MT-CO3_ENST00000362079.2_5'Flank			P00403	COX2_HUMAN	mitochondrially encoded cytochrome c oxidase II	13					cellular metabolic process (GO:0044237)|hydrogen ion transmembrane transport (GO:1902600)|mitochondrial electron transport, cytochrome c to oxygen (GO:0006123)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)|respiratory chain complex IV (GO:0045277)	copper ion binding (GO:0005507)|cytochrome-c oxidase activity (GO:0004129)			endometrium(5)|kidney(8)|lung(2)|pancreas(3)|prostate(1)	19						CAAGACGCTACTTCCCCTATC	0.378																																						dbGAP											0																																										-	-	-	SO:0001819	synonymous_variant	0					mitochondria	2012-11-16	2005-02-15	2005-02-16	ENSG00000198712	ENSG00000198712		"""Mitochondrial respiratory chain complex / Complex IV"""	7421	protein-coding gene	gene with protein product		516040	"""cytochrome c oxidase II"""	MTCO2		1712754, 1989603	Standard			Approved	COX2, CO2		P00403		ENST00000361739.1:c.39T>A	M.37:g.7624T>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q37526	Silent	SNP	pfam_Cyt_c_oxidase_su2_C,pfam_Cyt_c_oxidase_su2_TM_dom,superfamily_Cupredoxin,superfamily_Cyt_c_oxidase_su2-like_TM_dom,pfscan_Cyt_c_oxidase_su2_TM_dom,pfscan_Cyt_c_oxidase_su2_C,prints_Cyt_c_oxidase_su2_C,tigrfam_Cyt_c_oxidase_su2	p.T13	ENST00000361739.1	37	c.39		MT																																																																																			MT-CO2	-	pfam_Cyt_c_oxidase_su2_TM_dom,superfamily_Cyt_c_oxidase_su2-like_TM_dom,pfscan_Cyt_c_oxidase_su2_TM_dom,tigrfam_Cyt_c_oxidase_su2	ENSG00000198712		0.378	MT-CO2-201	KNOWN	basic|appris_principal	protein_coding	MT-CO2	HGNC	protein_coding		30	0.00	0	T	YP_003024029		7624	7624	+1	no_errors	ENST00000361739	ensembl	human	known	69_37n	silent	38	13.64	6	SNP	NULL	A
MT-ND4	4538	genome.wustl.edu	37	M	10828	10828	+	Silent	SNP	T	T	C			TCGA-A1-A0SK-01A-12D-A099-09	TCGA-A1-A0SK-10A-03D-A099-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d1b43161-cbc1-4bf6-b8bb-a72a2e5e1150	2a5384f3-fec7-4265-b104-987f0718574b	g.chrM:10828T>C	ENST00000361381.2	+	1	69	c.69T>C	c.(67-69)atT>atC	p.I23I	MT-TS2_ENST00000387449.1_RNA|MT-TL2_ENST00000387456.1_RNA|MT-TK_ENST00000387421.1_RNA|MT-ND5_ENST00000361567.2_5'Flank|MT-TG_ENST00000387429.1_RNA|MT-TH_ENST00000387441.1_RNA|MT-TR_ENST00000387439.1_RNA			P03905	NU4M_HUMAN	mitochondrially encoded NADH dehydrogenase 4	23					cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex I (GO:0005747)	NADH dehydrogenase (ubiquinone) activity (GO:0008137)			breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|prostate(1)	13						AAGCACATAATTTGAATCAAC	0.368																																						dbGAP											0																																										-	-	-	SO:0001819	synonymous_variant	0					mitochondria	2014-02-03	2005-02-15	2005-02-16	ENSG00000198886	ENSG00000198886	1.6.5.3	"""Mitochondrial respiratory chain complex / Complex I"""	7459	protein-coding gene	gene with protein product	"""complex I ND4 subunit"", ""NADH-ubiquinone oxidoreductase chain 4"""	516003	"""NADH dehydrogenase 4"", ""Leber optic neuropathy"""	MTND4, LHON		8103501	Standard			Approved	ND4, NAD4		P03905		ENST00000361381.2:c.69T>C	M.37:g.10828T>C		Somatic		WXS	Illumina GAIIx	Phase_IV	Q6RL39|Q6RQN9|Q8HNR8	Silent	SNP	pfam_NADH_UbQ/plastoQ_OxRdtase,pfam_NADH_UbQ_OxRdtase_chain4_N,prints_NADH_UbQ_OxRdtase,tigrfam_NADH_Q_OxRdtase_chainM/4	p.I23	ENST00000361381.2	37	c.69		MT																																																																																			MT-ND4	-	pfam_NADH_UbQ_OxRdtase_chain4_N	ENSG00000198886		0.368	MT-ND4-201	KNOWN	basic|appris_principal	protein_coding	MT-ND4	HGNC	protein_coding		47	0.00	0	T	YP_003024035		10828	10828	+1	no_stop_codon:bad_bp_length_for_coding_region	ENST00000361381	ensembl	human	known	69_37n	silent	40	16.33	8	SNP	NULL	C
MT-ND6	4541	genome.wustl.edu	37	M	14182	14182	+	Silent	SNP	T	T	C			TCGA-A1-A0SK-01A-12D-A099-09	TCGA-A1-A0SK-10A-03D-A099-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d1b43161-cbc1-4bf6-b8bb-a72a2e5e1150	2a5384f3-fec7-4265-b104-987f0718574b	g.chrM:14182T>C	ENST00000361681.2	-	1	491	c.492A>G	c.(490-492)gtA>gtG	p.V164V	MT-TS2_ENST00000387449.1_RNA|MT-TL2_ENST00000387456.1_RNA|MT-TP_ENST00000387461.2_RNA|MT-CYB_ENST00000361789.2_5'Flank|MT-TE_ENST00000387459.1_RNA|MT-TT_ENST00000387460.2_RNA|MT-TH_ENST00000387441.1_RNA			P03923	NU6M_HUMAN	mitochondrially encoded NADH dehydrogenase 6	164					cellular metabolic process (GO:0044237)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|respiratory chain (GO:0070469)	NADH dehydrogenase (ubiquinone) activity (GO:0008137)			breast(1)|endometrium(10)|kidney(17)|urinary_tract(1)	29						ATTACAATATATACACCAACA	0.418																																						dbGAP											0																																										-	-	-	SO:0001819	synonymous_variant	0					mitochondria	2011-07-04	2005-02-15	2005-02-16	ENSG00000198695	ENSG00000198695	1.6.5.3	"""Mitochondrial respiratory chain complex / Complex I"""	7462	protein-coding gene	gene with protein product	"""complex I ND6 subunit"", ""NADH-ubiquinone oxidoreductase chain 6"""	516006	"""NADH dehydrogenase 6"""	MTND6			Standard			Approved	NAD6, ND6		P03923		ENST00000361681.2:c.492A>G	M.37:g.14182T>C		Somatic		WXS	Illumina GAIIx	Phase_IV	Q34774|Q8HG30	Silent	SNP	pfam_NADH_UbQ/plastoQ_OxRdtase_su6	p.V164	ENST00000361681.2	37	c.492		MT																																																																																			MT-ND6	-	pfam_NADH_UbQ/plastoQ_OxRdtase_su6	ENSG00000198695		0.418	MT-ND6-201	KNOWN	basic|appris_principal	protein_coding	MT-ND6	HGNC	protein_coding		58	0.00	0	T	YP_003024037		14182	14182	-1	no_errors	ENST00000361681	ensembl	human	known	69_37n	silent	65	12.16	9	SNP	NULL	C
MTPAP	55149	genome.wustl.edu	37	10	30653319	30653319	+	Intron	SNP	T	T	G	rs2255854	byFrequency	TCGA-A1-A0SK-01A-12D-A099-09	TCGA-A1-A0SK-10A-03D-A099-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d1b43161-cbc1-4bf6-b8bb-a72a2e5e1150	2a5384f3-fec7-4265-b104-987f0718574b	g.chr10:30653319T>G	ENST00000488290.1	-	9	1912				AL161651.1_ENST00000408070.1_RNA|RN7SL241P_ENST00000482973.2_RNA|MTPAP_ENST00000358107.4_Intron			Q9NVV4	PAPD1_HUMAN	mitochondrial poly(A) polymerase						cell death (GO:0008219)|histone mRNA catabolic process (GO:0071044)|mRNA polyadenylation (GO:0006378)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|identical protein binding (GO:0042802)|magnesium ion binding (GO:0000287)|manganese ion binding (GO:0030145)|poly(A) RNA binding (GO:0044822)|polynucleotide adenylyltransferase activity (GO:0004652)|protein homodimerization activity (GO:0042803)|UTP binding (GO:0002134)			breast(1)|endometrium(5)|kidney(1)|large_intestine(8)|lung(13)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	33						TTTCTTCTTTTTTAATTTCTT	0.378													.|||	894	0.178514	0.112	0.1066	5008	,	,		18029	0.1647		0.2316	False		,,,				2504	0.2791					dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			AL122121	CCDS7165.1	10p12.1	2014-01-30	2009-01-12	2009-01-12	ENSG00000107951	ENSG00000107951			25532	protein-coding gene	gene with protein product	"""TUTase1"""	613669	"""PAP associated domain containing 1"""	PAPD1		12239557, 15769737, 15547249	Standard	NM_018109		Approved	FLJ10486, mtPAP, SPAX4	uc001iva.4	Q9NVV4	OTTHUMG00000017895	ENST00000488290.1:c.2191+315A>C	10.37:g.30653319T>G		Somatic		WXS	Illumina GAIIx	Phase_IV	D3DRX0|Q659E3|Q6P7E5|Q9HA74	RNA	SNP	-	NULL	ENST00000488290.1	37	NULL		10																																																																																			MTPAP	-	-	ENSG00000107951		0.378	MTPAP-002	KNOWN	basic	processed_transcript	MTPAP	HGNC	protein_coding	OTTHUMT00000047427.1	37	0.00	0	T	NM_018109		30653319	30653319	-1	no_errors	ENST00000471055	ensembl	human	known	69_37n	rna	178	11.88	24	SNP	0.034	G
MTPAP	55149	genome.wustl.edu	37	10	30653849	30653849	+	Silent	SNP	A	A	G	rs7097904	byFrequency	TCGA-A1-A0SK-01A-12D-A099-09	TCGA-A1-A0SK-10A-03D-A099-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d1b43161-cbc1-4bf6-b8bb-a72a2e5e1150	2a5384f3-fec7-4265-b104-987f0718574b	g.chr10:30653849A>G	ENST00000358107.4	-	2	332	c.333T>C	c.(331-333)ggT>ggC	p.G111G	MTPAP_ENST00000488290.1_5'UTR|AL161651.1_ENST00000408070.1_RNA|RN7SL241P_ENST00000482973.2_RNA			Q9NVV4	PAPD1_HUMAN	mitochondrial poly(A) polymerase	0					cell death (GO:0008219)|histone mRNA catabolic process (GO:0071044)|mRNA polyadenylation (GO:0006378)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|identical protein binding (GO:0042802)|magnesium ion binding (GO:0000287)|manganese ion binding (GO:0030145)|poly(A) RNA binding (GO:0044822)|polynucleotide adenylyltransferase activity (GO:0004652)|protein homodimerization activity (GO:0042803)|UTP binding (GO:0002134)			breast(1)|endometrium(5)|kidney(1)|large_intestine(8)|lung(13)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	33						ccacgctcacacccaccccac	0.647													.|||	554	0.110623	0.388	0.0562	5008	,	,		11511	0.0		0.002	False		,,,				2504	0.0					dbGAP											0																																										-	-	-	SO:0001819	synonymous_variant	0			AL122121	CCDS7165.1	10p12.1	2014-01-30	2009-01-12	2009-01-12	ENSG00000107951	ENSG00000107951			25532	protein-coding gene	gene with protein product	"""TUTase1"""	613669	"""PAP associated domain containing 1"""	PAPD1		12239557, 15769737, 15547249	Standard	NM_018109		Approved	FLJ10486, mtPAP, SPAX4	uc001iva.4	Q9NVV4	OTTHUMG00000017895	ENST00000358107.4:c.333T>C	10.37:g.30653849A>G		Somatic		WXS	Illumina GAIIx	Phase_IV	D3DRX0|Q659E3|Q6P7E5|Q9HA74	Silent	SNP	pfam_PAP_assoc	p.G111	ENST00000358107.4	37	c.333		10																																																																																			MTPAP	-	NULL	ENSG00000107951		0.647	MTPAP-201	KNOWN	basic	protein_coding	MTPAP	HGNC	protein_coding		31	0.00	0	A	NM_018109		30653849	30653849	-1	no_errors	ENST00000358107	ensembl	human	known	69_37n	silent	68	13.10	11	SNP	0.000	G
MUC12	10071	genome.wustl.edu	37	7	100636722	100636722	+	Missense_Mutation	SNP	G	G	C	rs201822262	byFrequency	TCGA-A1-A0SK-01A-12D-A099-09	TCGA-A1-A0SK-10A-03D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d1b43161-cbc1-4bf6-b8bb-a72a2e5e1150	2a5384f3-fec7-4265-b104-987f0718574b	g.chr7:100636722G>C	ENST00000379442.3	+	5	3307	c.3307G>C	c.(3307-3309)Gtt>Ctt	p.V1103L	MUC12_ENST00000536621.1_Missense_Mutation_p.V960L			Q9UKN1	MUC12_HUMAN	mucin 12, cell surface associated	1103	28 X 19 AA approximate tandem repeats of E-E-S-X-X-X-H-X-X-P-X-X-T-X-T-X-X-X-P.|Ser-rich.				cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|regulation of cell growth (GO:0001558)	Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)				breast(6)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|prostate(1)|stomach(13)	25						CTCAGGCATCGTTGAAGCATC	0.552													c|||	724	0.144569	0.2511	0.1167	5008	,	,		21543	0.0188		0.1402	False		,,,				2504	0.1544					dbGAP											0													11.0	19.0	17.0					7																	100636722		326	943	1269	-	-	-	SO:0001583	missense	0			AF147790, AF147791	CCDS55139.1	7q22	2007-01-17	2006-03-14		ENSG00000205277	ENSG00000205277		"""Mucins"""	7510	protein-coding gene	gene with protein product		604609	"""mucin 11"""	MUC11		10463611	Standard	NM_001164462		Approved		uc003uxo.3	Q9UKN1	OTTHUMG00000157042	ENST00000379442.3:c.3307G>C	7.37:g.100636722G>C	ENSP00000368755:p.Val1103Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	A6ND38|F5GWV9|Q9UKN0	Missense_Mutation	SNP	pfam_SEA	p.V1103L	ENST00000379442.3	37	c.3307		7	.	.	.	.	.	.	.	.	.	.	g	0.039	-1.293060	0.01375	.	.	ENSG00000205277	ENST00000379442;ENST00000536621	T;T	0.11930	2.73;2.73	0.49	-0.979	0.10276	.	.	.	.	.	T	0.04815	0.0130	N	0.08118	0	0.80722	P	0.0	.	.	.	.	.	.	T	0.40194	-0.9576	6	0.19147	T	0.46	.	2.7178	0.05192	0.4852:0.2627:0.2521:0.0	.	.	.	.	L	1103;960	ENSP00000368755:V1103L;ENSP00000441929:V960L	ENSP00000368755:V1103L	V	+	1	0	MUC12	100423442	0.000000	0.05858	0.000000	0.03702	0.014000	0.08584	-1.863000	0.01651	-1.795000	0.01255	-1.271000	0.01417	GTT	MUC12	-	NULL	ENSG00000205277		0.552	MUC12-001	NOVEL	basic|appris_candidate_longest	protein_coding	MUC12	HGNC	protein_coding	OTTHUMT00000347234.1	431	0.00	0	G	XM_379904		100636722	100636722	+1	no_errors	ENST00000379442	ensembl	human	known	69_37n	missense	134	29.47	56	SNP	0.000	C
MUC12	10071	genome.wustl.edu	37	7	100637839	100637839	+	Missense_Mutation	SNP	C	C	G	rs202092843	byFrequency	TCGA-A1-A0SK-01A-12D-A099-09	TCGA-A1-A0SK-10A-03D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d1b43161-cbc1-4bf6-b8bb-a72a2e5e1150	2a5384f3-fec7-4265-b104-987f0718574b	g.chr7:100637839C>G	ENST00000379442.3	+	5	4424	c.4424C>G	c.(4423-4425)cCa>cGa	p.P1475R	MUC12_ENST00000536621.1_Missense_Mutation_p.P1332R			Q9UKN1	MUC12_HUMAN	mucin 12, cell surface associated	1475	28 X 19 AA approximate tandem repeats of E-E-S-X-X-X-H-X-X-P-X-X-T-X-T-X-X-X-P.|Ser-rich.				cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|regulation of cell growth (GO:0001558)	Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)				breast(6)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|prostate(1)|stomach(13)	25						CACAGTCAACCAGGCTCAACG	0.547													C|||	904	0.180511	0.3933	0.1095	5008	,	,		26629	0.0179		0.1431	False		,,,				2504	0.1493					dbGAP											0													27.0	35.0	32.0					7																	100637839		541	1131	1672	-	-	-	SO:0001583	missense	0			AF147790, AF147791	CCDS55139.1	7q22	2007-01-17	2006-03-14		ENSG00000205277	ENSG00000205277		"""Mucins"""	7510	protein-coding gene	gene with protein product		604609	"""mucin 11"""	MUC11		10463611	Standard	NM_001164462		Approved		uc003uxo.3	Q9UKN1	OTTHUMG00000157042	ENST00000379442.3:c.4424C>G	7.37:g.100637839C>G	ENSP00000368755:p.Pro1475Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	A6ND38|F5GWV9|Q9UKN0	Missense_Mutation	SNP	pfam_SEA	p.P1475R	ENST00000379442.3	37	c.4424		7	.	.	.	.	.	.	.	.	.	.	c	0.512	-0.866163	0.02590	.	.	ENSG00000205277	ENST00000379442;ENST00000536621	T;T	0.15017	2.46;2.46	0.722	0.722	0.18225	.	.	.	.	.	T	0.07683	0.0193	N	0.08118	0	0.09310	N	1	.	.	.	.	.	.	T	0.41251	-0.9519	6	0.19590	T	0.45	.	.	.	.	.	.	.	.	R	1475;1332	ENSP00000368755:P1475R;ENSP00000441929:P1332R	ENSP00000368755:P1475R	P	+	2	0	MUC12	100424559	0.005000	0.15991	0.001000	0.08648	0.003000	0.03518	1.927000	0.40094	0.679000	0.31345	0.194000	0.17425	CCA	MUC12	-	NULL	ENSG00000205277		0.547	MUC12-001	NOVEL	basic|appris_candidate_longest	protein_coding	MUC12	HGNC	protein_coding	OTTHUMT00000347234.1	325	0.00	0	C	XM_379904		100637839	100637839	+1	no_errors	ENST00000379442	ensembl	human	known	69_37n	missense	114	25.00	38	SNP	0.001	G
MUC12	10071	genome.wustl.edu	37	7	100645121	100645121	+	Silent	SNP	T	T	C	rs147541791	byFrequency	TCGA-A1-A0SK-01A-12D-A099-09	TCGA-A1-A0SK-10A-03D-A099-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d1b43161-cbc1-4bf6-b8bb-a72a2e5e1150	2a5384f3-fec7-4265-b104-987f0718574b	g.chr7:100645121T>C	ENST00000379442.3	+	5	11706	c.11706T>C	c.(11704-11706)agT>agC	p.S3902S	MUC12_ENST00000536621.1_Silent_p.S3759S			Q9UKN1	MUC12_HUMAN	mucin 12, cell surface associated	3902	28 X 19 AA approximate tandem repeats of E-E-S-X-X-X-H-X-X-P-X-X-T-X-T-X-X-X-P.|Ser-rich.				cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|regulation of cell growth (GO:0001558)	Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)				breast(6)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|prostate(1)|stomach(13)	25						CACCTGCCAGTATGACAAGCC	0.572																																						dbGAP											0																																										-	-	-	SO:0001819	synonymous_variant	0			AF147790, AF147791	CCDS55139.1	7q22	2007-01-17	2006-03-14		ENSG00000205277	ENSG00000205277		"""Mucins"""	7510	protein-coding gene	gene with protein product		604609	"""mucin 11"""	MUC11		10463611	Standard	NM_001164462		Approved		uc003uxo.3	Q9UKN1	OTTHUMG00000157042	ENST00000379442.3:c.11706T>C	7.37:g.100645121T>C		Somatic		WXS	Illumina GAIIx	Phase_IV	A6ND38|F5GWV9|Q9UKN0	Silent	SNP	pfam_SEA	p.S3902	ENST00000379442.3	37	c.11706		7																																																																																			MUC12	-	NULL	ENSG00000205277		0.572	MUC12-001	NOVEL	basic|appris_candidate_longest	protein_coding	MUC12	HGNC	protein_coding	OTTHUMT00000347234.1	11	0.00	0	T	XM_379904		100645121	100645121	+1	no_errors	ENST00000379442	ensembl	human	known	69_37n	silent	3	62.50	5	SNP	0.000	C
MUC12	10071	genome.wustl.edu	37	7	100646199	100646199	+	Missense_Mutation	SNP	T	T	C	rs181671450	byFrequency	TCGA-A1-A0SK-01A-12D-A099-09	TCGA-A1-A0SK-10A-03D-A099-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d1b43161-cbc1-4bf6-b8bb-a72a2e5e1150	2a5384f3-fec7-4265-b104-987f0718574b	g.chr7:100646199T>C	ENST00000379442.3	+	5	12784	c.12784T>C	c.(12784-12786)Ttt>Ctt	p.F4262L	MUC12_ENST00000536621.1_Missense_Mutation_p.F4119L			Q9UKN1	MUC12_HUMAN	mucin 12, cell surface associated	4262	28 X 19 AA approximate tandem repeats of E-E-S-X-X-X-H-X-X-P-X-X-T-X-T-X-X-X-P.|Ser-rich.				cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|regulation of cell growth (GO:0001558)	Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)				breast(6)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|prostate(1)|stomach(13)	25						AACAACACACTTTTCTGCCAG	0.552													T|||	1164	0.232428	0.2829	0.1571	5008	,	,		41858	0.2063		0.2624	False		,,,				2504	0.2137					dbGAP											0													8.0	10.0	9.0					7																	100646199		491	1071	1562	-	-	-	SO:0001583	missense	0			AF147790, AF147791	CCDS55139.1	7q22	2007-01-17	2006-03-14		ENSG00000205277	ENSG00000205277		"""Mucins"""	7510	protein-coding gene	gene with protein product		604609	"""mucin 11"""	MUC11		10463611	Standard	NM_001164462		Approved		uc003uxo.3	Q9UKN1	OTTHUMG00000157042	ENST00000379442.3:c.12784T>C	7.37:g.100646199T>C	ENSP00000368755:p.Phe4262Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	A6ND38|F5GWV9|Q9UKN0	Missense_Mutation	SNP	pfam_SEA	p.F4262L	ENST00000379442.3	37	c.12784		7	.	.	.	.	.	.	.	.	.	.	T	4.831	0.154453	0.09236	.	.	ENSG00000205277	ENST00000379442;ENST00000536621	T;T	0.11712	2.75;2.75	0.53	0.53	0.17102	.	.	.	.	.	T	0.04679	0.0127	N	0.08118	0	0.80722	P	0.0	.	.	.	.	.	.	T	0.41645	-0.9497	6	0.20519	T	0.43	.	5.2833	0.15688	0.0:1.0E-4:0.0:0.9999	.	.	.	.	L	4262;4119	ENSP00000368755:F4262L;ENSP00000441929:F4119L	ENSP00000368755:F4262L	F	+	1	0	MUC12	100432919	0.000000	0.05858	0.002000	0.10522	0.001000	0.01503	-0.028000	0.12350	0.435000	0.26365	0.164000	0.16699	TTT	MUC12	-	NULL	ENSG00000205277		0.552	MUC12-001	NOVEL	basic|appris_candidate_longest	protein_coding	MUC12	HGNC	protein_coding	OTTHUMT00000347234.1	111	0.00	0	T	XM_379904		100646199	100646199	+1	no_errors	ENST00000379442	ensembl	human	known	69_37n	missense	402	18.09	89	SNP	0.015	C
MUC12	10071	genome.wustl.edu	37	7	100646364	100646364	+	Missense_Mutation	SNP	G	G	A	rs149795204	byFrequency	TCGA-A1-A0SK-01A-12D-A099-09	TCGA-A1-A0SK-10A-03D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d1b43161-cbc1-4bf6-b8bb-a72a2e5e1150	2a5384f3-fec7-4265-b104-987f0718574b	g.chr7:100646364G>A	ENST00000379442.3	+	5	12949	c.12949G>A	c.(12949-12951)Gcg>Acg	p.A4317T	MUC12_ENST00000536621.1_Missense_Mutation_p.A4174T			Q9UKN1	MUC12_HUMAN	mucin 12, cell surface associated	4317	28 X 19 AA approximate tandem repeats of E-E-S-X-X-X-H-X-X-P-X-X-T-X-T-X-X-X-P.|Ser-rich.				cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|regulation of cell growth (GO:0001558)	Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)				breast(6)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|prostate(1)|stomach(13)	25						GGAAACAACAGCGTTACCTGG	0.527													g|||	602	0.120208	0.2133	0.085	5008	,	,		31076	0.0169		0.1272	False		,,,				2504	0.1186					dbGAP											0													5.0	7.0	6.0					7																	100646364		419	978	1397	-	-	-	SO:0001583	missense	0			AF147790, AF147791	CCDS55139.1	7q22	2007-01-17	2006-03-14		ENSG00000205277	ENSG00000205277		"""Mucins"""	7510	protein-coding gene	gene with protein product		604609	"""mucin 11"""	MUC11		10463611	Standard	NM_001164462		Approved		uc003uxo.3	Q9UKN1	OTTHUMG00000157042	ENST00000379442.3:c.12949G>A	7.37:g.100646364G>A	ENSP00000368755:p.Ala4317Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	A6ND38|F5GWV9|Q9UKN0	Missense_Mutation	SNP	pfam_SEA	p.A4317T	ENST00000379442.3	37	c.12949		7	.	.	.	.	.	.	.	.	.	.	g	1.190	-0.635644	0.03584	.	.	ENSG00000205277	ENST00000379442;ENST00000536621	T;T	0.12774	2.65;2.65	0.9	-1.8	0.07907	.	.	.	.	.	T	0.05273	0.0140	N	0.08118	0	0.80722	P	0.0	.	.	.	.	.	.	T	0.48525	-0.9028	6	0.10111	T	0.7	.	8.0073	0.30332	0.2949:0.0:0.7051:0.0	.	.	.	.	T	4317;4174	ENSP00000368755:A4317T;ENSP00000441929:A4174T	ENSP00000368755:A4317T	A	+	1	0	MUC12	100433084	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-1.111000	0.03303	-1.372000	0.02137	-1.076000	0.02234	GCG	MUC12	-	NULL	ENSG00000205277		0.527	MUC12-001	NOVEL	basic|appris_candidate_longest	protein_coding	MUC12	HGNC	protein_coding	OTTHUMT00000347234.1	162	0.00	0	G	XM_379904		100646364	100646364	+1	no_errors	ENST00000379442	ensembl	human	known	69_37n	missense	277	12.62	40	SNP	0.000	A
MUC4	4585	genome.wustl.edu	37	3	195510361	195510361	+	Missense_Mutation	SNP	G	G	A	rs199950848		TCGA-A1-A0SK-01A-12D-A099-09	TCGA-A1-A0SK-10A-03D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d1b43161-cbc1-4bf6-b8bb-a72a2e5e1150	2a5384f3-fec7-4265-b104-987f0718574b	g.chr3:195510361G>A	ENST00000463781.3	-	2	8549	c.8090C>T	c.(8089-8091)gCa>gTa	p.A2697V	MUC4_ENST00000475231.1_Missense_Mutation_p.A2697V|MUC4_ENST00000349607.4_Intron|MUC4_ENST00000346145.4_Intron	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		ACCTGTGGATGCTGAGGAAGT	0.557																																						dbGAP											0																																										-	-	-	SO:0001583	missense	0			AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.8090C>T	3.37:g.195510361G>A	ENSP00000417498:p.Ala2697Val	Somatic		WXS	Illumina GAIIx	Phase_IV	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	pfam_Nidogen_extracell_dom,pfam_AMOP,pfam_VWF_type-D,smart_Nidogen_extracell_dom,smart_AMOP,smart_VWF_type-D,smart_EGF-like,pfscan_AMOP,pfscan_EG-like_dom	p.A2697V	ENST00000463781.3	37	c.8090	CCDS54700.1	3	.	.	.	.	.	.	.	.	.	.	-	3.118	-0.181170	0.06380	.	.	ENSG00000145113	ENST00000463781;ENST00000475231	T;T	0.30981	1.51;1.55	1.02	-2.03	0.07365	.	.	.	.	.	T	0.11196	0.0273	N	0.08118	0	0.09310	N	1	.	.	.	.	.	.	T	0.21484	-1.0244	6	.	.	.	.	3.2478	0.06803	0.5571:0.2313:0.2116:0.0	.	.	.	.	V	2697	ENSP00000417498:A2697V;ENSP00000420243:A2697V	.	A	-	2	0	MUC4	196993460	0.000000	0.05858	0.003000	0.11579	0.035000	0.12851	-0.227000	0.09126	-1.749000	0.01330	-1.973000	0.00462	GCA	MUC4	-	NULL	ENSG00000145113		0.557	MUC4-001	KNOWN	basic|CCDS	protein_coding	MUC4	HGNC	protein_coding	OTTHUMT00000324081.6	116	0.00	0	G	NM_018406		195510361	195510361	-1	no_errors	ENST00000463781	ensembl	human	known	69_37n	missense	208	14.40	35	SNP	0.001	A
MUC6	4588	genome.wustl.edu	37	11	1018692	1018693	+	Frame_Shift_Ins	INS	-	-	C			TCGA-A1-A0SK-01A-12D-A099-09	TCGA-A1-A0SK-10A-03D-A099-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d1b43161-cbc1-4bf6-b8bb-a72a2e5e1150	2a5384f3-fec7-4265-b104-987f0718574b	g.chr11:1018692_1018693insC	ENST00000421673.2	-	31	4158_4159	c.4108_4109insG	c.(4108-4110)acafs	p.T1370fs		NM_005961.2	NP_005952.2	Q6W4X9	MUC6_HUMAN	mucin 6, oligomeric mucus/gel-forming	1370	Pro-rich.|Thr-rich.				cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular region (GO:0005576)|Golgi lumen (GO:0005796)	extracellular matrix structural constituent (GO:0005201)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(8)|kidney(10)|large_intestine(6)|lung(43)|ovary(4)|prostate(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	80		all_cancers(49;3.3e-08)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		all cancers(45;1.24e-24)|BRCA - Breast invasive adenocarcinoma(625;0.00031)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)		GGTTGGGCCTGTGGTGCTTGCT	0.574																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			U97698, AY312160	CCDS44513.1	11p15.5	2008-02-05	2006-03-14		ENSG00000184956	ENSG00000184956		"""Mucins"""	7517	protein-coding gene	gene with protein product		158374	"""mucin 6, gastric"""			7680650	Standard	NM_005961		Approved		uc001lsw.2	Q6W4X9	OTTHUMG00000165140	ENST00000421673.2:c.4108_4109insG	11.37:g.1018692_1018693insC	ENSP00000406861:p.Thr1370fs	Somatic		WXS	Illumina GAIIx	Phase_IV	O15329|Q14394|Q2TUQ5|Q4L207|Q8N8I1|Q8NAK1	Frame_Shift_Ins	INS	pfam_VWF_type-D,pfam_Unchr_dom_Cys-rich,pfam_TIL_dom,superfamily_TIL_dom,smart_VWF_type-D,smart_Unchr_dom_Cys-rich,smart_VWC_out,smart_Cys_knot_C,pfscan_Cys_knot_C	p.T1370fs	ENST00000421673.2	37	c.4109_4108	CCDS44513.1	11																																																																																			MUC6	-	NULL	ENSG00000184956		0.574	MUC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MUC6	HGNC	protein_coding	OTTHUMT00000382120.2	1365	0.44	6	-	XM_290540		1018692	1018693	-1	no_errors	ENST00000421673	ensembl	human	known	69_37n	frame_shift_ins	108	10.00	12	INS	0.006:0.019	C
MYPN	84665	genome.wustl.edu	37	10	69881873	69881873	+	Silent	SNP	C	C	T			TCGA-A1-A0SK-01A-12D-A099-09	TCGA-A1-A0SK-10A-03D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d1b43161-cbc1-4bf6-b8bb-a72a2e5e1150	2a5384f3-fec7-4265-b104-987f0718574b	g.chr10:69881873C>T	ENST00000358913.5	+	2	1166	c.678C>T	c.(676-678)caC>caT	p.H226H	MYPN_ENST00000373675.3_Silent_p.H226H|MYPN_ENST00000540630.1_Silent_p.H226H|MYPN_ENST00000354393.2_Intron	NM_001256267.1|NM_032578.3	NP_001243196.1|NP_115967.2	Q86TC9	MYPN_HUMAN	myopalladin	226	Interaction with CARP.				sarcomere organization (GO:0045214)	I band (GO:0031674)|nucleus (GO:0005634)|Z disc (GO:0030018)	cytoskeletal protein binding (GO:0008092)|muscle alpha-actinin binding (GO:0051371)|SH3 domain binding (GO:0017124)			breast(2)|central_nervous_system(1)|endometrium(13)|kidney(6)|large_intestine(13)|liver(1)|lung(43)|ovary(3)|prostate(1)|skin(6)|upper_aerodigestive_tract(5)	94						AAGTGAATCACGCCCTGGAAC	0.537																																						dbGAP											0													51.0	49.0	49.0					10																	69881873		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AL834247	CCDS7275.1, CCDS73142.1	10q22.1	2014-09-17			ENSG00000138347	ENSG00000138347		"""Immunoglobulin superfamily / I-set domain containing"""	23246	protein-coding gene	gene with protein product	"""sarcomeric protein myopalladin, 145 kDa"""	608517				11309420, 12482578	Standard	NM_032578		Approved	MYOP	uc001jnm.5	Q86TC9	OTTHUMG00000018344	ENST00000358913.5:c.678C>T	10.37:g.69881873C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q5VV35|Q5VV36|Q86T37|Q8N3L4|Q96K90|Q96KF5	Silent	SNP	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	p.H226	ENST00000358913.5	37	c.678	CCDS7275.1	10																																																																																			MYPN	-	NULL	ENSG00000138347		0.537	MYPN-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MYPN	HGNC	protein_coding	OTTHUMT00000048307.1	62	0.00	0	C	NM_032578		69881873	69881873	+1	no_errors	ENST00000358913	ensembl	human	known	69_37n	silent	118	41.58	84	SNP	0.015	T
NABP2	79035	genome.wustl.edu	37	12	56619427	56619427	+	Frame_Shift_Del	DEL	G	G	-			TCGA-A1-A0SK-01A-12D-A099-09	TCGA-A1-A0SK-10A-03D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d1b43161-cbc1-4bf6-b8bb-a72a2e5e1150	2a5384f3-fec7-4265-b104-987f0718574b	g.chr12:56619427delG	ENST00000380198.2	+	3	736	c.238delG	c.(238-240)ggtfs	p.G80fs	NABP2_ENST00000267023.4_Frame_Shift_Del_p.G80fs|NABP2_ENST00000341463.5_Frame_Shift_Del_p.G80fs			Q9BQ15	SOSB1_HUMAN	nucleic acid binding protein 2	80					cellular response to DNA damage stimulus (GO:0006974)|DNA repair (GO:0006281)|double-strand break repair via homologous recombination (GO:0000724)|mitotic cell cycle checkpoint (GO:0007093)|response to ionizing radiation (GO:0010212)	nucleus (GO:0005634)|SOSS complex (GO:0070876)	single-stranded DNA binding (GO:0003697)										AGTTTTCAAAGGTTGTCTGAC	0.463																																						dbGAP											0													216.0	208.0	211.0					12																	56619427		2203	4300	6503	-	-	-	SO:0001589	frameshift_variant	0			BC006171	CCDS8911.1	12q13.3	2012-06-19	2012-06-19	2012-06-19	ENSG00000139579	ENSG00000139579			28412	protein-coding gene	gene with protein product	"""single strand DNA-binding protein 1"", ""sensor of single-strand DNA complex subunit B1"""	612104	"""oligonucleotide/oligosaccharide-binding fold containing 2B"""	OBFC2B			Standard	NM_024068		Approved	MGC2731, SSB1, hSSB1, SOSS-B1	uc001ski.3	Q9BQ15	OTTHUMG00000152527	ENST00000380198.2:c.238delG	12.37:g.56619427delG	ENSP00000369545:p.Gly80fs	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NDF8|Q6XYC8	Frame_Shift_Del	DEL	pfam_NA-bd_OB_tRNA-helicase,superfamily_NA-bd_OB-fold-like	p.G80fs	ENST00000380198.2	37	c.238	CCDS8911.1	12																																																																																			NABP2	-	pfam_NA-bd_OB_tRNA-helicase,superfamily_NA-bd_OB-fold-like	ENSG00000139579		0.463	NABP2-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	NABP2	HGNC	protein_coding	OTTHUMT00000326610.1	770	0.00	0	G	NM_024068		56619427	56619427	+1	no_errors	ENST00000267023	ensembl	human	known	69_37n	frame_shift_del	256	10.49	30	DEL	1.000	-
NCAPH2	29781	genome.wustl.edu	37	22	50960792	50960792	+	Silent	SNP	G	G	T	rs199797587	byFrequency	TCGA-A1-A0SK-01A-12D-A099-09	TCGA-A1-A0SK-10A-03D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d1b43161-cbc1-4bf6-b8bb-a72a2e5e1150	2a5384f3-fec7-4265-b104-987f0718574b	g.chr22:50960792G>T	ENST00000420993.2	+	15	1376	c.1254G>T	c.(1252-1254)cgG>cgT	p.R418R	NCAPH2_ENST00000395701.3_Silent_p.R418R|CTA-384D8.36_ENST00000608319.1_RNA|NCAPH2_ENST00000520297.1_3'UTR|NCAPH2_ENST00000299821.11_Silent_p.R418R	NM_001185011.1|NM_152299.3	NP_001171940.1|NP_689512.2	Q6IBW4	CNDH2_HUMAN	non-SMC condensin II complex, subunit H2	418					chromosome condensation (GO:0030261)|mitotic cell cycle (GO:0000278)	chromosome (GO:0005694)|membrane (GO:0016020)|nucleoplasm (GO:0005654)				breast(1)|cervix(1)|endometrium(2)|kidney(3)|lung(10)|ovary(1)|prostate(2)|skin(3)|stomach(1)	24		all_cancers(38;4.58e-14)|all_epithelial(38;1.12e-12)|all_lung(38;3.07e-05)|Breast(42;6.27e-05)|Lung NSC(38;0.000813)|Ovarian(80;0.0221)|Hepatocellular(38;0.0691)|Lung SC(80;0.113)		BRCA - Breast invasive adenocarcinoma(115;0.212)		AGTGGCTGCGGCCTGCAGAGG	0.657													G|||	3	0.000599042	0.0	0.0	5008	,	,		14795	0.0		0.0	False		,,,				2504	0.0031					dbGAP											0													51.0	56.0	54.0					22																	50960792		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			BC001937	CCDS14094.2, CCDS43038.1, CCDS54546.1	22q13.33	2008-02-04			ENSG00000025770	ENSG00000025770			25071	protein-coding gene	gene with protein product	"""kleisin beta"", ""CAP-H2 subunit of the condensin II complex"""	611230				10493829	Standard	NM_014551		Approved	384D8-2, hCAP-H2, CAP-H2	uc003blx.4	Q6IBW4	OTTHUMG00000150205	ENST00000420993.2:c.1254G>T	22.37:g.50960792G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B7WPH1|O43788|Q13391|Q96C14|Q96GJ0|Q9BQ71|Q9BUT3|Q9BVD1	Silent	SNP	pfam_Condensin_II_H2-like	p.R418	ENST00000420993.2	37	c.1254	CCDS14094.2	22																																																																																			NCAPH2	-	pfam_Condensin_II_H2-like	ENSG00000025770		0.657	NCAPH2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	NCAPH2	HGNC	protein_coding	OTTHUMT00000317012.1	96	0.00	0	G	NM_152299		50960792	50960792	+1	no_errors	ENST00000299821	ensembl	human	known	69_37n	silent	91	14.15	15	SNP	0.986	T
NFATC4	4776	genome.wustl.edu	37	14	24846866	24846866	+	Missense_Mutation	SNP	C	C	A			TCGA-A1-A0SK-01A-12D-A099-09	TCGA-A1-A0SK-10A-03D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d1b43161-cbc1-4bf6-b8bb-a72a2e5e1150	2a5384f3-fec7-4265-b104-987f0718574b	g.chr14:24846866C>A	ENST00000250373.4	+	10	2805	c.2664C>A	c.(2662-2664)gaC>gaA	p.D888E	NFATC4_ENST00000555453.1_Missense_Mutation_p.D876E|NFATC4_ENST00000413692.2_3'UTR|NFATC4_ENST00000554473.1_Missense_Mutation_p.D315E|NFATC4_ENST00000555590.1_Missense_Mutation_p.D901E|NFATC4_ENST00000422617.3_3'UTR|NFATC4_ENST00000554966.1_Missense_Mutation_p.D793E|NFATC4_ENST00000424781.2_3'UTR|NFATC4_ENST00000554050.1_Missense_Mutation_p.D780E|NFATC4_ENST00000556759.1_Missense_Mutation_p.D423E|NFATC4_ENST00000555802.1_Missense_Mutation_p.D176E|NFATC4_ENST00000553879.1_Missense_Mutation_p.D818E|NFATC4_ENST00000539237.2_3'UTR|NFATC4_ENST00000555393.1_3'UTR|NFATC4_ENST00000554591.1_Missense_Mutation_p.D843E|NFATC4_ENST00000557451.1_3'UTR|NFATC4_ENST00000554344.1_Missense_Mutation_p.D818E|NFATC4_ENST00000555167.1_3'UTR|NFATC4_ENST00000556279.1_Missense_Mutation_p.D920E|NFATC4_ENST00000557767.1_Missense_Mutation_p.D68E|NFATC4_ENST00000556169.1_Missense_Mutation_p.D768E|NFATC4_ENST00000553469.1_Missense_Mutation_p.D812E|NFATC4_ENST00000553708.1_3'UTR|NFATC4_ENST00000554661.1_Missense_Mutation_p.D710E	NM_004554.4	NP_004545.2	Q14934	NFAC4_HUMAN	nuclear factor of activated T-cells, cytoplasmic, calcineurin-dependent 4	888					cellular respiration (GO:0045333)|cellular response to lithium ion (GO:0071285)|cellular response to UV (GO:0034644)|heart development (GO:0007507)|inflammatory response (GO:0006954)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|muscle cell development (GO:0055001)|patterning of blood vessels (GO:0001569)|positive regulation of apoptotic process (GO:0043065)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of tumor necrosis factor production (GO:0032760)|regulation of synaptic plasticity (GO:0048167)|smooth muscle cell differentiation (GO:0051145)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intermediate filament cytoskeleton (GO:0045111)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|transcription coactivator activity (GO:0003713)			breast(2)|central_nervous_system(1)|endometrium(1)|kidney(4)|large_intestine(7)|liver(4)|lung(12)|ovary(1)|skin(2)	34				GBM - Glioblastoma multiforme(265;0.018)		TTGGCCGAGACCTGAGTGGCT	0.602																																						dbGAP											0													131.0	105.0	114.0					14																	24846866		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC053855	CCDS9629.1, CCDS45089.1, CCDS55909.1, CCDS55910.1, CCDS55911.1, CCDS73625.1	14q11.2	2009-11-24			ENSG00000100968	ENSG00000100968		"""Nuclear factor of activated T-cells"""	7778	protein-coding gene	gene with protein product		602699				7749981	Standard	NM_004554		Approved	NFAT3	uc010tok.2	Q14934	OTTHUMG00000029351	ENST00000250373.4:c.2664C>A	14.37:g.24846866C>A	ENSP00000250373:p.Asp888Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DDG5|B4DY55|B5B2U7|B5B2U8|B5B2U9|B5B2V0|B5B2V1|B5B2V2|B5B2V3|B5B2V4|B5B2V5|B5B2V7|B5B2V8|B5B2V9|B5B2W0|B5B2W1|B5B2W2|B5B2W3|B5B2W4|B5B2W5|B5B2W6|B5B2W7|B5B2W8|B5B2W9|B5B2X0|Q7Z598|Q96H68	Missense_Mutation	SNP	pfam_RHD,pfam_IPT_TIG_rcpt,superfamily_p53-like_TF_DNA-bd,superfamily_Ig_E-set,smart_IPT_TIG_rcpt,pfscan_RHD,prints_NFAT	p.D920E	ENST00000250373.4	37	c.2760	CCDS9629.1	14	.	.	.	.	.	.	.	.	.	.	C	16.44	3.123442	0.56613	.	.	ENSG00000100968	ENST00000554591;ENST00000555590;ENST00000554966;ENST00000556279;ENST00000553469;ENST00000554050;ENST00000250373;ENST00000553879;ENST00000554344;ENST00000554661;ENST00000556169;ENST00000555453;ENST00000554473;ENST00000556759;ENST00000557767;ENST00000555802	T;T;T;T;T;T;T;T;T;T;T;T;T;T;T	0.61040	2.97;2.82;3.01;2.8;2.99;3.02;2.84;2.53;2.53;2.7;2.67;2.47;1.37;1.12;0.14	5.72	5.72	0.89469	.	0.000000	0.64402	D	0.000012	T	0.60090	0.2242	N	0.19112	0.55	0.36173	D	0.848885	D;D;D;D;D;D;D;D;D	0.89917	0.99;0.99;0.99;0.996;0.99;0.99;1.0;0.996;0.984	D;D;D;D;D;D;D;D;D	0.83275	0.986;0.986;0.986;0.99;0.986;0.986;0.996;0.99;0.967	T	0.65417	-0.6173	10	0.39692	T	0.17	.	10.7592	0.46256	0.0:0.9147:0.0:0.0853	.	768;876;812;920;793;901;951;843;888	Q14934-17;Q14934-9;Q14934-14;Q14934-4;Q14934-15;Q14934-6;Q14934-2;Q14934-11;Q14934	.;.;.;.;.;.;.;.;NFAC4_HUMAN	E	843;901;793;920;812;780;888;818;818;710;768;876;315;423;68;176	ENSP00000452039:D843E;ENSP00000451224:D901E;ENSP00000450644:D793E;ENSP00000452270:D920E;ENSP00000451502:D812E;ENSP00000451151:D780E;ENSP00000250373:D888E;ENSP00000452349:D818E;ENSP00000450469:D818E;ENSP00000450733:D710E;ENSP00000451454:D768E;ENSP00000450686:D876E;ENSP00000450810:D315E;ENSP00000451183:D423E;ENSP00000451590:D176E	ENSP00000250373:D888E	D	+	3	2	NFATC4	23916706	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	3.514000	0.53422	2.691000	0.91804	0.655000	0.94253	GAC	NFATC4	-	NULL	ENSG00000100968		0.602	NFATC4-001	KNOWN	basic|CCDS	protein_coding	NFATC4	HGNC	protein_coding	OTTHUMT00000073206.6	269	0.00	0	C	NM_004554		24846866	24846866	+1	no_errors	ENST00000556279	ensembl	human	known	69_37n	missense	65	13.33	10	SNP	1.000	A
NLRC5	84166	genome.wustl.edu	37	16	57095775	57095775	+	Intron	SNP	C	C	T	rs3751710	byFrequency	TCGA-A1-A0SK-01A-12D-A099-09	TCGA-A1-A0SK-10A-03D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d1b43161-cbc1-4bf6-b8bb-a72a2e5e1150	2a5384f3-fec7-4265-b104-987f0718574b	g.chr16:57095775C>T	ENST00000262510.6	+	32	4379				NLRC5_ENST00000436936.1_Intron|NLRC5_ENST00000539144.1_Intron|NLRC5_ENST00000308149.7_Intron	NM_032206.4	NP_115582.4	Q86WI3	NLRC5_HUMAN	NLR family, CARD domain containing 5						defense response to virus (GO:0051607)|innate immune response (GO:0045087)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of type I interferon production (GO:0032480)|negative regulation of type I interferon-mediated signaling pathway (GO:0060339)|positive regulation of interferon-gamma-mediated signaling pathway (GO:0060335)|positive regulation of MHC class I biosynthetic process (GO:0045345)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of type I interferon-mediated signaling pathway (GO:0060340)|regulation of kinase activity (GO:0043549)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	ATP binding (GO:0005524)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)			NS(2)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(16)|lung(21)|ovary(8)|prostate(1)|skin(6)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	75		all_neural(199;0.225)				GTCCCAGAGACTCCACAAGGC	0.512													C|||	499	0.0996406	0.0719	0.0922	5008	,	,		18391	0.0476		0.1571	False		,,,				2504	0.137					dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			AF389420	CCDS10773.1	16q13	2008-02-05			ENSG00000140853	ENSG00000140853		"""Nucleotide-binding domain and leucine rich repeat containing"""	29933	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and CARD domain containing 5"", ""NOD-like receptor C5"""	613537				12615073	Standard	NM_032206		Approved	NOD27, CLR16.1, FLJ21709	uc021tiu.1	Q86WI3	OTTHUMG00000133470	ENST00000262510.6:c.4154+162C>T	16.37:g.57095775C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B5MEF1|C9JMD8|Q6P4A6|Q86VM7|Q8NF42|Q8TEE2|Q8TEJ1|Q969L7	Missense_Mutation	SNP	smart_Leu-rich_rpt_RNase_inh_sub-typ	p.L1138F	ENST00000262510.6	37	c.3412	CCDS10773.1	16	241|241	0.11034798534798534|0.11034798534798534	50|50	0.1016260162601626|0.1016260162601626	40|40	0.11049723756906077|0.11049723756906077	28|28	0.04895104895104895|0.04895104895104895	123|123	0.16226912928759896|0.16226912928759896	c|c	8.691|8.691	0.907468|0.907468	0.17833|0.17833	.|.	.|.	ENSG00000140853|ENSG00000140853	ENST00000538805|ENST00000399221	.|.	.|.	.|.	2.61|2.61	1.65|1.65	0.23941|0.23941	.|.	.|.	.|.	.|.	.|.	T|T	0.00178|0.00178	0.0005|0.0005	.|.	.|.	.|.	0.58432|0.58432	P|P	2.9999999999752447E-6|2.9999999999752447E-6	.|.	.|.	.|.	.|.	.|.	.|.	T|T	0.09796|0.09796	-1.0658|-1.0658	3|3	.|.	.|.	.|.	.|.	5.1471|5.1471	0.14991|0.14991	0.0:0.8352:0.0:0.1648|0.0:0.8352:0.0:0.1648	rs3751710;rs17400583;rs58869278;rs3751710|rs3751710;rs17400583;rs58869278;rs3751710	.|.	.|.	.|.	F|I	1138|137	.|.	.|.	L|T	+|+	1|2	0|0	NLRC5|NLRC5	55653276|55653276	0.000000|0.000000	0.05858|0.05858	0.001000|0.001000	0.08648|0.08648	0.060000|0.060000	0.15804|0.15804	0.306000|0.306000	0.19279|0.19279	0.672000|0.672000	0.31204|0.31204	0.436000|0.436000	0.28706|0.28706	CTC|ACT	NLRC5	-	NULL	ENSG00000140853		0.512	NLRC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NLRC5	HGNC	protein_coding	OTTHUMT00000257346.1	10	0.00	0	C	NM_032206		57095775	57095775	+1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000538805	ensembl	human	putative	69_37n	missense	2	66.67	4	SNP	0.001	T
NPAS2	4862	genome.wustl.edu	37	2	101541639	101541639	+	Missense_Mutation	SNP	C	C	T			TCGA-A1-A0SK-01A-12D-A099-09	TCGA-A1-A0SK-10A-03D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d1b43161-cbc1-4bf6-b8bb-a72a2e5e1150	2a5384f3-fec7-4265-b104-987f0718574b	g.chr2:101541639C>T	ENST00000335681.5	+	3	349	c.64C>T	c.(64-66)Cgg>Tgg	p.R22W	NPAS2_ENST00000486017.1_3'UTR|NPAS2_ENST00000542504.1_Missense_Mutation_p.R87W	NM_002518.3	NP_002509.2	Q99743	NPAS2_HUMAN	neuronal PAS domain protein 2	22	Sufficient for heterodimer formation with ARNTL/BMAL1, E-box binding and for the effect of NADPH. {ECO:0000250|UniProtKB:P97460}.|bHLH. {ECO:0000255|PROSITE- ProRule:PRU00981}.				cellular lipid metabolic process (GO:0044255)|cellular response to DNA damage stimulus (GO:0006974)|central nervous system development (GO:0007417)|circadian regulation of gene expression (GO:0032922)|circadian sleep/wake cycle (GO:0042745)|locomotor rhythm (GO:0045475)|negative regulation of cell death (GO:0060548)|positive regulation of DNA repair (GO:0045739)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of response to DNA damage stimulus (GO:2001020)|response to redox state (GO:0051775)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	cytosol (GO:0005829)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	core promoter binding (GO:0001047)|DNA binding (GO:0003677)|Hsp90 protein binding (GO:0051879)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)			cervix(1)|endometrium(3)|large_intestine(7)|lung(9)|ovary(3)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	29						GAAGAAGCGTCGGGACCAGTT	0.463																																						dbGAP											0													121.0	112.0	115.0					2																	101541639		2203	4300	6503	-	-	-	SO:0001583	missense	0			U77970	CCDS2048.1	2q11.2	2013-05-21			ENSG00000170485	ENSG00000170485		"""Basic helix-loop-helix proteins"""	7895	protein-coding gene	gene with protein product		603347				9012850, 9079689	Standard	NM_002518		Approved	MOP4, PASD4, bHLHe9	uc002tap.1	Q99743	OTTHUMG00000130675	ENST00000335681.5:c.64C>T	2.37:g.101541639C>T	ENSP00000338283:p.Arg22Trp	Somatic		WXS	Illumina GAIIx	Phase_IV	Q4ZFV9|Q53SQ3|Q86V96|Q99629	Missense_Mutation	SNP	pfam_PAS_fold_3,pfam_PAS_fold,pfam_HLH_DNA-bd,superfamily_HLH_DNA-bd,smart_HLH_DNA-bd,smart_PAS,smart_PAC,prints_Nuc_translocat,pfscan_PAS,pfscan_HLH_DNA-bd,tigrfam_PAS	p.R87W	ENST00000335681.5	37	c.259	CCDS2048.1	2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	25.1|25.1	4.602110|4.602110	0.87055|0.87055	.|.	.|.	ENSG00000170485|ENSG00000170485	ENST00000335681;ENST00000542504;ENST00000451740|ENST00000448812	D;D;D|.	0.99232|.	-5.6;-5.6;-5.6|.	5.65|5.65	5.65|5.65	0.86999|0.86999	Helix-loop-helix DNA-binding (5);|.	0.058103|.	0.64402|.	D|.	0.000002|.	D|D	0.84933|0.84933	0.5582|0.5582	M|M	0.88640|0.88640	2.97|2.97	0.80722|0.80722	D|D	1|1	D;D|.	0.89917|.	1.0;1.0|.	D;D|.	0.97110|.	1.0;1.0|.	D|D	0.86505|0.86505	0.1806|0.1806	10|5	0.87932|.	D|.	0|.	.|.	19.7272|19.7272	0.96168|0.96168	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	87;22|.	F5H027;Q99743|.	.;NPAS2_HUMAN|.	W|L	22;87;6|11	ENSP00000338283:R22W;ENSP00000438428:R87W;ENSP00000395265:R6W|.	ENSP00000338283:R22W|.	R|S	+|+	1|2	2|0	NPAS2|NPAS2	100908071|100908071	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	1.000000|1.000000	0.99986|0.99986	3.244000|3.244000	0.51399|0.51399	2.646000|2.646000	0.89796|0.89796	0.655000|0.655000	0.94253|0.94253	CGG|TCG	NPAS2	-	pfam_HLH_DNA-bd,superfamily_HLH_DNA-bd,smart_HLH_DNA-bd,pfscan_HLH_DNA-bd	ENSG00000170485		0.463	NPAS2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	NPAS2	HGNC	protein_coding	OTTHUMT00000253168.3	228	0.44	1	C			101541639	101541639	+1	no_errors	ENST00000542504	ensembl	human	known	69_37n	missense	82	44.59	66	SNP	1.000	T
OBSCN	84033	genome.wustl.edu	37	1	228486227	228486227	+	Intron	SNP	G	G	T			TCGA-A1-A0SK-01A-12D-A099-09	TCGA-A1-A0SK-10A-03D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d1b43161-cbc1-4bf6-b8bb-a72a2e5e1150	2a5384f3-fec7-4265-b104-987f0718574b	g.chr1:228486227G>T	ENST00000422127.1	+	43	11703				OBSCN_ENST00000366707.4_Missense_Mutation_p.C1030F|OBSCN_ENST00000366709.4_Intron|OBSCN_ENST00000284548.11_Intron|RP5-1139B12.4_ENST00000602778.1_RNA|OBSCN_ENST00000570156.2_Missense_Mutation_p.C4340F|OBSCN_ENST00000359599.6_Silent_p.V2757V	NM_001098623.2	NP_001092093.2	Q5VST9	OBSCN_HUMAN	obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF						apoptotic signaling pathway (GO:0097190)|multicellular organismal development (GO:0007275)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|protein localization to M-band (GO:0036309)|regulation of small GTPase mediated signal transduction (GO:0051056)|sarcomere organization (GO:0045214)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|M band (GO:0031430)|myofibril (GO:0030016)|Z disc (GO:0030018)	ankyrin binding (GO:0030506)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|structural constituent of muscle (GO:0008307)|titin binding (GO:0031432)			NS(2)|breast(7)|central_nervous_system(5)|cervix(2)|endometrium(30)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(37)|lung(89)|ovary(8)|pancreas(3)|prostate(13)|skin(6)|stomach(11)|upper_aerodigestive_tract(2)|urinary_tract(3)	223		Prostate(94;0.0405)				ACACTGCAGTGTGAGCTGAGC	0.577																																						dbGAP											0													210.0	186.0	193.0					1																	228486227		876	1991	2867	-	-	-	SO:0001627	intron_variant	0			AJ002535	CCDS1570.2, CCDS58065.1, CCDS59204.1	1q42	2014-09-17			ENSG00000154358	ENSG00000154358		"""Rho guanine nucleotide exchange factors"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	15719	protein-coding gene	gene with protein product		608616				11448995, 11814696	Standard	NM_001098623		Approved	KIAA1556, UNC89, KIAA1639, ARHGEF30	uc001hsq.2	Q5VST9	OTTHUMG00000039772	ENST00000422127.1:c.11659+3483G>T	1.37:g.228486227G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q2A664|Q5T7G8|Q5T7G9|Q5VSU2|Q86YC7|Q8NHN0|Q8NHN1|Q8NHN2|Q8NHN3|Q8NHN4|Q8NHN5|Q8NHN6|Q8NHN7|Q8NHN8|Q8NHN9|Q96AA2|Q9HCD3|Q9HCL6	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Ig_V-set,pfam_Immunoglobulin,pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_DH-domain,pfam_Fibronectin_type3,pfam_IQ_motif_EF-hand-BS,superfamily_Kinase-like_dom,superfamily_DH-domain,superfamily_Fibronectin_type3,superfamily_SH3_domain,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,smart_IQ_motif_EF-hand-BS,smart_DH-domain,smart_Pleckstrin_homology,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_IQ_motif_EF-hand-BS,pfscan_Pleckstrin_homology,pfscan_Prot_kinase_cat_dom,pfscan_Ig-like,pfscan_DH-domain	p.C1030F	ENST00000422127.1	37	c.3089	CCDS58065.1	1	.	.	.	.	.	.	.	.	.	.	G	20.6	4.009502	0.75046	.	.	ENSG00000154358	ENST00000366707	T	0.65178	-0.14	4.47	4.47	0.54385	.	.	.	.	.	T	0.76176	0.3951	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.79799	-0.1651	6	0.62326	D	0.03	.	17.3165	0.87226	0.0:0.0:1.0:0.0	.	.	.	.	F	1030	ENSP00000355668:C1030F	ENSP00000355668:C1030F	C	+	2	0	OBSCN	226552850	1.000000	0.71417	0.953000	0.39169	0.932000	0.56968	7.560000	0.82277	2.319000	0.78375	0.561000	0.74099	TGT	OBSCN	-	pfam_Ig_I-set,pfam_Ig_V-set,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,pfscan_Ig-like	ENSG00000154358		0.577	OBSCN-204	KNOWN	basic|CCDS	protein_coding	OBSCN	HGNC	protein_coding		22	0.00	0	G	NM_052843		228486227	228486227	+1	no_errors	ENST00000366707	ensembl	human	known	69_37n	missense	65	35.64	36	SNP	1.000	T
OCSTAMP	128506	genome.wustl.edu	37	20	45170213	45170213	+	Silent	SNP	A	A	G	rs847078	byFrequency	TCGA-A1-A0SK-01A-12D-A099-09	TCGA-A1-A0SK-10A-03D-A099-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d1b43161-cbc1-4bf6-b8bb-a72a2e5e1150	2a5384f3-fec7-4265-b104-987f0718574b	g.chr20:45170213A>G	ENST00000279028.2	-	3	1414	c.1401T>C	c.(1399-1401)tcT>tcC	p.S467S		NM_080721.1	NP_542452.1	Q9BR26	OCSTP_HUMAN	osteoclast stimulatory transmembrane protein	467					cellular response to estrogen stimulus (GO:0071391)|cellular response to tumor necrosis factor (GO:0071356)|multinuclear osteoclast differentiation (GO:0072674)|positive regulation of macrophage fusion (GO:0034241)|positive regulation of osteoclast differentiation (GO:0045672)|positive regulation of osteoclast proliferation (GO:0090290)	integral component of membrane (GO:0016021)				breast(1)|endometrium(1)	2						TGGGGACGCAAGAAGGATCCC	0.637													G|||	1216	0.242812	0.5386	0.0908	5008	,	,		15461	0.1667		0.1014	False		,,,				2504	0.1748					dbGAP											0													67.0	68.0	68.0					20																	45170213		692	1591	2283	-	-	-	SO:0001819	synonymous_variant	0			AL034424	CCDS54468.1	20q13.12	2012-03-27	2012-03-27	2012-03-27	ENSG00000149635	ENSG00000149635			16116	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 123"""	C20orf123		18064667	Standard	NM_080721		Approved	dJ257E24.3	uc010zxu.2	Q9BR26	OTTHUMG00000032652	ENST00000279028.2:c.1401T>C	20.37:g.45170213A>G		Somatic		WXS	Illumina GAIIx	Phase_IV		Silent	SNP	pfam_DC_STAMP-like	p.S467	ENST00000279028.2	37	c.1401	CCDS54468.1	20																																																																																			OCSTAMP	-	NULL	ENSG00000149635		0.637	OCSTAMP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OCSTAMP	HGNC	protein_coding	OTTHUMT00000079573.2	196	0.00	0	A	XM_496476		45170213	45170213	-1	no_errors	ENST00000279028	ensembl	human	known	69_37n	silent	101	10.62	12	SNP	0.000	G
OR2T34	127068	genome.wustl.edu	37	1	248737734	248737734	+	Missense_Mutation	SNP	G	G	A	rs139616012		TCGA-A1-A0SK-01A-12D-A099-09	TCGA-A1-A0SK-10A-03D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d1b43161-cbc1-4bf6-b8bb-a72a2e5e1150	2a5384f3-fec7-4265-b104-987f0718574b	g.chr1:248737734G>A	ENST00000328782.2	-	1	346	c.325C>T	c.(325-327)Cac>Tac	p.H109Y		NM_001001821.1	NP_001001821.1	Q8NGX1	O2T34_HUMAN	olfactory receptor, family 2, subfamily T, member 34	109						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|endometrium(1)|large_intestine(6)|lung(28)|ovary(2)|skin(2)|stomach(3)	43	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0265)			AGGGTCAGGTGGAAGAACATC	0.542																																						dbGAP											0													120.0	109.0	112.0					1																	248737734		2163	4276	6439	-	-	-	SO:0001583	missense	0			BK004477	CCDS31120.1	1q44	2012-08-09			ENSG00000183310	ENSG00000183310		"""GPCR / Class A : Olfactory receptors"""	31256	protein-coding gene	gene with protein product							Standard	NM_001001821		Approved		uc001iep.1	Q8NGX1	OTTHUMG00000040387	ENST00000328782.2:c.325C>T	1.37:g.248737734G>A	ENSP00000330904:p.His109Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RNJ8|Q6IEY5|Q96R31	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.H109Y	ENST00000328782.2	37	c.325	CCDS31120.1	1	296	0.13553113553113552	69	0.1402439024390244	61	0.1685082872928177	71	0.12412587412587413	95	0.12532981530343007	.	0.011	-1.710055	0.00712	.	.	ENSG00000183310	ENST00000328782	T	0.01304	5.03	2.34	-0.481	0.12082	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	T	0.00012	0.0000	N	0.00109	-2.105	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.38908	-0.9639	8	0.02654	T	1	.	4.2299	0.10597	0.597:0.1723:0.2307:0.0	.	109	Q8NGX1	O2T34_HUMAN	Y	109	ENSP00000330904:H109Y	ENSP00000330904:H109Y	H	-	1	0	OR2T34	246804357	0.001000	0.12720	0.040000	0.18447	0.392000	0.30506	0.697000	0.25556	-0.366000	0.08064	-1.344000	0.01245	CAC	OR2T34	-	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam,prints_7TM_GPCR_Rhodpsn	ENSG00000183310		0.542	OR2T34-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR2T34	HGNC	protein_coding	OTTHUMT00000097138.1	443	0.23	1	G	NM_001001821		248737734	248737734	-1	no_errors	ENST00000328782	ensembl	human	known	69_37n	missense	162	18.18	36	SNP	0.000	A
OR2T35	403244	genome.wustl.edu	37	1	248801602	248801603	+	Frame_Shift_Ins	INS	-	-	CA	rs370874670|rs375058001		TCGA-A1-A0SK-01A-12D-A099-09	TCGA-A1-A0SK-10A-03D-A099-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d1b43161-cbc1-4bf6-b8bb-a72a2e5e1150	2a5384f3-fec7-4265-b104-987f0718574b	g.chr1:248801602_248801603insCA	ENST00000317450.3	-	1	956_957	c.957_958insTG	c.(955-960)gtgatcfs	p.I320fs		NM_001001827.1	NP_001001827.1	Q8NGX2	O2T35_HUMAN	olfactory receptor, family 2, subfamily T, member 35	320						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.I320fs*1(1)		endometrium(1)|large_intestine(1)|lung(1)|ovary(1)|prostate(1)|skin(1)	6	all_cancers(71;2.04e-05)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)	all_cancers(173;0.237)	OV - Ovarian serous cystadenocarcinoma(106;0.0265)			CCCTTCCTGATCACAGTCGCCA	0.545																																						dbGAP											1	Insertion - Frameshift(1)	prostate(1)																																								-	-	-	SO:0001589	frameshift_variant	0			BK004475	CCDS31123.1	1q44	2012-08-09			ENSG00000177151	ENSG00000177151		"""GPCR / Class A : Olfactory receptors"""	31257	protein-coding gene	gene with protein product							Standard	NM_001001827		Approved		uc001ies.1	Q8NGX2	OTTHUMG00000040380	ENST00000317450.3:c.956_957dupTG	1.37:g.248801605_248801606dupCA	ENSP00000324369:p.Ile320fs	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6IEY7	Frame_Shift_Ins	INS	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.I319fs	ENST00000317450.3	37	c.958_957	CCDS31123.1	1																																																																																			OR2T35	-	NULL	ENSG00000177151		0.545	OR2T35-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR2T35	HGNC	protein_coding	OTTHUMT00000097130.1	12	0.00	0	-	NM_001001827		248801602	248801603	-1	no_errors	ENST00000317450	ensembl	human	known	69_37n	frame_shift_ins	11	54.17	13	INS	0.000:0.000	CA
OR51A2	401667	genome.wustl.edu	37	11	4976554	4976554	+	Silent	SNP	A	A	G	rs2595986	byFrequency	TCGA-A1-A0SK-01A-12D-A099-09	TCGA-A1-A0SK-10A-03D-A099-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d1b43161-cbc1-4bf6-b8bb-a72a2e5e1150	2a5384f3-fec7-4265-b104-987f0718574b	g.chr11:4976554A>G	ENST00000380371.1	-	1	389	c.390T>C	c.(388-390)aaT>aaC	p.N130N	MMP26_ENST00000477339.1_Intron|MMP26_ENST00000380390.1_Intron	NM_001004748.1	NP_001004748.1	Q8NGJ7	O51A2_HUMAN	olfactory receptor, family 51, subfamily A, member 2	130						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(4)|kidney(1)|large_intestine(3)|lung(5)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	17		Medulloblastoma(188;0.0075)|all_neural(188;0.0577)|Breast(177;0.086)		Epithelial(150;3.22e-11)|BRCA - Breast invasive adenocarcinoma(625;0.0284)|LUSC - Lung squamous cell carcinoma(625;0.19)		ATCTCAGAGGATTGTGGATGG	0.458													a|||	3024	0.603834	0.4054	0.7003	5008	,	,		10244	0.8353		0.5278	False		,,,				2504	0.6431					dbGAP											0													153.0	105.0	122.0					11																	4976554		1988	3629	5617	-	-	-	SO:0001819	synonymous_variant	0			AB065797	CCDS31368.1	11p15.4	2012-08-09			ENSG00000205496	ENSG00000205496		"""GPCR / Class A : Olfactory receptors"""	14764	protein-coding gene	gene with protein product							Standard	NM_001004748		Approved		uc010qyt.2	Q8NGJ7	OTTHUMG00000066602	ENST00000380371.1:c.390T>C	11.37:g.4976554A>G		Somatic		WXS	Illumina GAIIx	Phase_IV		Silent	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.N130	ENST00000380371.1	37	c.390	CCDS31368.1	11																																																																																			OR51A2	-	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam	ENSG00000205496		0.458	OR51A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR51A2	HGNC	protein_coding	OTTHUMT00000142809.1	163	0.61	1	A	NM_001004748		4976554	4976554	-1	no_errors	ENST00000380371	ensembl	human	known	69_37n	silent	257	10.45	30	SNP	0.705	G
OR5AU1	390445	genome.wustl.edu	37	14	21623196	21623196	+	Missense_Mutation	SNP	G	G	C			TCGA-A1-A0SK-01A-12D-A099-09	TCGA-A1-A0SK-10A-03D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d1b43161-cbc1-4bf6-b8bb-a72a2e5e1150	2a5384f3-fec7-4265-b104-987f0718574b	g.chr14:21623196G>C	ENST00000304418.3	-	1	1026	c.989C>G	c.(988-990)aCa>aGa	p.T330R		NM_001004731.1	NP_001004731.1	Q8NGC0	O5AU1_HUMAN	olfactory receptor, family 5, subfamily AU, member 1	330						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(12)|pancreas(1)	21	all_cancers(95;0.00238)		Epithelial(56;6.88e-07)|all cancers(55;6.02e-06)	GBM - Glioblastoma multiforme(265;0.0192)		GATCACCACTGTGTAGATGAC	0.478																																						dbGAP											0													108.0	103.0	104.0					14																	21623196		2203	4300	6503	-	-	-	SO:0001583	missense	0			AL157687	CCDS32042.1	14q11.2	2013-09-23			ENSG00000169327	ENSG00000169327		"""GPCR / Class A : Olfactory receptors"""	15362	protein-coding gene	gene with protein product							Standard	NM_001004731		Approved		uc010tlp.2	Q8NGC0	OTTHUMG00000170753	ENST00000304418.3:c.989C>G	14.37:g.21623196G>C	ENSP00000302057:p.Thr330Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RP78|Q6IEU2|Q96R10	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.T330R	ENST00000304418.3	37	c.989	CCDS32042.1	14	.	.	.	.	.	.	.	.	.	.	G	11.30	1.599215	0.28534	.	.	ENSG00000169327	ENST00000304418	T	0.00267	8.38	4.48	4.48	0.54585	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	T	0.00875	0.0029	H	0.97077	3.935	0.35141	D	0.768848	D	0.76494	0.999	D	0.79108	0.992	T	0.14531	-1.0469	9	0.87932	D	0	.	10.5522	0.45095	0.0:0.196:0.804:0.0	.	330	Q8NGC0	O5AU1_HUMAN	R	330	ENSP00000302057:T330R	ENSP00000302057:T330R	T	-	2	0	OR5AU1	20693036	0.998000	0.40836	1.000000	0.80357	0.078000	0.17371	2.865000	0.48412	2.323000	0.78572	0.491000	0.48974	ACA	OR5AU1	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_7TM_GPCR_Rhodpsn	ENSG00000169327		0.478	OR5AU1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR5AU1	HGNC	protein_coding	OTTHUMT00000410213.1	285	0.00	0	G			21623196	21623196	-1	no_errors	ENST00000304418	ensembl	human	known	69_37n	missense	174	18.31	39	SNP	0.999	C
PALB2	79728	genome.wustl.edu	37	16	23646404	23646404	+	Missense_Mutation	SNP	C	C	A			TCGA-A1-A0SK-01A-12D-A099-09	TCGA-A1-A0SK-10A-03D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d1b43161-cbc1-4bf6-b8bb-a72a2e5e1150	2a5384f3-fec7-4265-b104-987f0718574b	g.chr16:23646404C>A	ENST00000261584.4	-	4	1615	c.1463G>T	c.(1462-1464)aGc>aTc	p.S488I		NM_024675.3	NP_078951.2	Q86YC2	PALB2_HUMAN	partner and localizer of BRCA2	488	DNA-binding (with the preference D loop > dsDNA > ssDNA).				DNA repair (GO:0006281)|double-strand break repair via homologous recombination (GO:0000724)|inner cell mass cell proliferation (GO:0001833)|mesoderm development (GO:0007498)|negative regulation of apoptotic process (GO:0043066)|organ morphogenesis (GO:0009887)|post-anal tail morphogenesis (GO:0036342)|somitogenesis (GO:0001756)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)			breast(5)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(11)|lung(21)|ovary(3)|pancreas(1)|prostate(3)|skin(1)|stomach(1)|urinary_tract(3)	55				GBM - Glioblastoma multiforme(48;0.0167)		AGCGGGAGAGCTGACTTTAGT	0.458			"""F, N, Mis"""			"""Wilms tumor, medulloblastoma, AML ,breast"""		Involved in tolerance or repair of DNA crosslinks																														dbGAP	yes	Rec		"""Fanconi anaemia N, breast cancer susceptibility """	16	16p12.1	79728	partner and localizer of BRCA2		"""L, O, E"""	0													133.0	133.0	133.0					16																	23646404		2197	4300	6497	-	-	-	SO:0001583	missense	0				CCDS32406.1	16p12.1	2014-09-17				ENSG00000083093		"""Fanconi anemia, complementation groups"""	26144	protein-coding gene	gene with protein product	"""Fanconi anemia, complementation group N"""	610355				16793542, 17200672	Standard	NM_024675		Approved	FLJ21816, FANCN	uc002dlx.1	Q86YC2		ENST00000261584.4:c.1463G>T	16.37:g.23646404C>A	ENSP00000261584:p.Ser488Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NIE1|Q8N7Y6|Q8ND31|Q9H6W1	Missense_Mutation	SNP	superfamily_WD40_repeat_dom	p.S488I	ENST00000261584.4	37	c.1463	CCDS32406.1	16	.	.	.	.	.	.	.	.	.	.	C	12.36	1.914943	0.33815	.	.	ENSG00000083093	ENST00000261584	T	0.18502	2.21	5.67	-7.15	0.01521	.	0.801047	0.11917	N	0.517116	T	0.13286	0.0322	M	0.63428	1.95	0.09310	N	1	B	0.15473	0.013	B	0.17433	0.018	T	0.35847	-0.9772	10	0.87932	D	0	0.7566	4.8129	0.13353	0.1114:0.1801:0.11:0.5986	.	488	Q86YC2	PALB2_HUMAN	I	488	ENSP00000261584:S488I	ENSP00000261584:S488I	S	-	2	0	PALB2	23553905	0.000000	0.05858	0.000000	0.03702	0.144000	0.21451	-1.416000	0.02467	-1.105000	0.03011	-0.982000	0.02568	AGC	PALB2	-	NULL	ENSG00000083093		0.458	PALB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PALB2	HGNC	protein_coding	OTTHUMT00000435287.2	214	0.47	1	C	NM_024675		23646404	23646404	-1	no_errors	ENST00000261584	ensembl	human	known	69_37n	missense	91	12.38	13	SNP	0.000	A
PASK	23178	genome.wustl.edu	37	2	242054403	242054403	+	Intron	SNP	G	G	A	rs3815305	byFrequency	TCGA-A1-A0SK-01A-12D-A099-09	TCGA-A1-A0SK-10A-03D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d1b43161-cbc1-4bf6-b8bb-a72a2e5e1150	2a5384f3-fec7-4265-b104-987f0718574b	g.chr2:242054403G>A	ENST00000405260.1	-	14	4032				PASK_ENST00000403638.3_Missense_Mutation_p.R1130W|PASK_ENST00000234040.4_Intron|PASK_ENST00000358649.4_Intron|PASK_ENST00000539818.1_Intron|PASK_ENST00000475666.1_5'Flank|PASK_ENST00000544142.1_Intron	NM_001252120.1	NP_001239049.1	Q96RG2	PASK_HUMAN	PAS domain containing serine/threonine kinase						negative regulation of glycogen biosynthetic process (GO:0045719)|positive regulation of translation (GO:0045727)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of energy homeostasis (GO:2000505)|regulation of glucagon secretion (GO:0070092)|regulation of respiratory gaseous exchange (GO:0043576)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)	ATP binding (GO:0005524)|phosphatidylinositol binding (GO:0035091)|protein serine/threonine kinase activity (GO:0004674)|signal transducer activity (GO:0004871)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(6)|lung(20)|ovary(4)|prostate(4)|skin(1)|stomach(1)|urinary_tract(2)	53		all_cancers(19;4.46e-39)|all_epithelial(40;1.34e-17)|Breast(86;1.53e-05)|Renal(207;0.00179)|all_lung(227;0.00481)|Lung NSC(271;0.017)|Ovarian(221;0.0228)|Esophageal squamous(248;0.129)|all_hematologic(139;0.158)|Melanoma(123;0.16)|all_neural(83;0.243)|Hepatocellular(293;0.244)		Epithelial(32;1.34e-31)|all cancers(36;1e-28)|OV - Ovarian serous cystadenocarcinoma(60;3.53e-14)|Kidney(56;4.31e-09)|KIRC - Kidney renal clear cell carcinoma(57;4.35e-08)|BRCA - Breast invasive adenocarcinoma(100;5.64e-06)|Lung(119;0.000596)|LUSC - Lung squamous cell carcinoma(224;0.00481)|Colorectal(34;0.014)|COAD - Colon adenocarcinoma(134;0.0968)		TGCAGCCACCGGACCCAGGCA	0.547													G|||	1220	0.24361	0.3162	0.2291	5008	,	,		18665	0.4147		0.0974	False		,,,				2504	0.1299					dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			U79240	CCDS2545.1, CCDS58758.1, CCDS58759.1	2q37.3	2008-05-23			ENSG00000115687	ENSG00000115687			17270	protein-coding gene	gene with protein product		607505				11688972, 11459942, 15148392	Standard	NM_001252119		Approved	PASKIN, KIAA0135, STK37	uc010fzl.2	Q96RG2	OTTHUMG00000133392	ENST00000405260.1:c.3333+54C>T	2.37:g.242054403G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	G5E9F1|Q05BE4|Q68DY3|Q6GSJ5|Q86XH6|Q99763|Q9UFR7	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_PAS_fold,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_PAS,smart_Ser/Thr_dual-sp_kinase_dom,pfscan_PAS,pfscan_Prot_kinase_cat_dom,tigrfam_PAS	p.R1130W	ENST00000405260.1	37	c.3388	CCDS2545.1	2	531	0.24313186813186813	146	0.2967479674796748	72	0.19889502762430938	237	0.4143356643356643	76	0.10026385224274406	G	10.73	1.432611	0.25813	.	.	ENSG00000115687	ENST00000403638	T	0.51817	0.69	3.78	-2.3	0.06785	.	.	.	.	.	T	0.00012	0.0000	.	.	.	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.41680	-0.9495	7	0.87932	D	0	.	6.7909	0.23699	0.2611:0.1384:0.6005:0.0	rs3815305;rs61610946;rs3815305	1130	G5E9F1	.	W	1130	ENSP00000384438:R1130W	ENSP00000384438:R1130W	R	-	1	2	PASK	241703076	0.000000	0.05858	0.000000	0.03702	0.021000	0.10359	-0.947000	0.03901	-0.677000	0.05231	-0.416000	0.06073	CGG	PASK	-	pfscan_Prot_kinase_cat_dom	ENSG00000115687		0.547	PASK-003	KNOWN	alternative_5_UTR|basic|appris_candidate|CCDS	protein_coding	PASK	HGNC	protein_coding	OTTHUMT00000323753.1	46	0.00	0	G	NM_015148		242054403	242054403	-1	no_errors	ENST00000403638	ensembl	human	putative	69_37n	missense	36	29.41	15	SNP	0.000	A
PCDHB16	57717	genome.wustl.edu	37	5	140563656	140563656	+	Missense_Mutation	SNP	G	G	A	rs17844648	byFrequency	TCGA-A1-A0SK-01A-12D-A099-09	TCGA-A1-A0SK-10A-03D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d1b43161-cbc1-4bf6-b8bb-a72a2e5e1150	2a5384f3-fec7-4265-b104-987f0718574b	g.chr5:140563656G>A	ENST00000361016.2	+	1	2677	c.1522G>A	c.(1522-1524)Gca>Aca	p.A508T		NM_020957.1	NP_066008.1	Q9NRJ7	PCDBG_HUMAN	protocadherin beta 16	508	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.		A -> T (in dbSNP:rs56327450).		calcium-dependent cell-cell adhesion (GO:0016339)|homophilic cell adhesion (GO:0007156)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(1)|endometrium(10)|kidney(3)|large_intestine(14)|lung(29)|ovary(5)|pancreas(2)|prostate(3)|skin(1)|urinary_tract(1)	69			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			CTCCATCAACGCAGACAACGG	0.682													G|||	808	0.161342	0.2655	0.196	5008	,	,		11928	0.0536		0.167	False		,,,				2504	0.1012					dbGAP											0													31.0	32.0	32.0					5																	140563656		2152	4189	6341	-	-	-	SO:0001583	missense	0			AF217757	CCDS4251.1	5q31	2014-04-11			ENSG00000196963			"""Cadherins / Protocadherins : Clustered"""	14546	other	protocadherin	"""cadherin ME1"", ""protocadherin-3x"", ""PCDHbeta 16"""	606345				11230163, 11322959	Standard	NM_020957		Approved	PCDHB8a, PCDH3X, KIAA1621, PCDH-BETA16, ME1	uc003liv.3	Q9NRJ7	OTTHUMG00000188325	ENST00000361016.2:c.1522G>A	5.37:g.140563656G>A	ENSP00000354293:p.Ala508Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KPK5|Q8IYD5|Q96SE9|Q9HCF1	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.A508T	ENST00000361016.2	37	c.1522	CCDS4251.1	5	317	0.14514652014652016	120	0.24390243902439024	63	0.17403314917127072	30	0.05244755244755245	104	0.13720316622691292	g	8.751	0.921300	0.17982	.	.	ENSG00000196963	ENST00000361016	T	0.47869	0.83	4.26	2.16	0.27623	Cadherin (4);Cadherin-like (1);	0.833276	0.09771	N	0.757982	T	0.00012	0.0000	N	0.11818	0.18	0.58432	P	1.999999999946489E-6	P	0.36587	0.559	B	0.35413	0.202	T	0.17992	-1.0351	9	0.46703	T	0.11	.	1.8655	0.03198	0.1902:0.1415:0.4691:0.1993	rs56327450	508	Q9NRJ7	PCDBG_HUMAN	T	508	ENSP00000354293:A508T	ENSP00000354293:A508T	A	+	1	0	PCDHB16	140543840	0.000000	0.05858	0.224000	0.23877	0.037000	0.13140	-0.701000	0.05075	0.777000	0.33496	0.580000	0.79431	GCA	PCDHB16	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000196963		0.682	PCDHB16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHB16	HGNC	protein_coding	OTTHUMT00000251800.1	95	0.00	0	G	NM_020957		140563656	140563656	+1	no_errors	ENST00000361016	ensembl	human	known	69_37n	missense	99	13.16	15	SNP	0.066	A
PCDHB14	56122	genome.wustl.edu	37	5	140604126	140604126	+	Missense_Mutation	SNP	C	C	T			TCGA-A1-A0SK-01A-12D-A099-09	TCGA-A1-A0SK-10A-03D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d1b43161-cbc1-4bf6-b8bb-a72a2e5e1150	2a5384f3-fec7-4265-b104-987f0718574b	g.chr5:140604126C>T	ENST00000239449.4	+	1	1049	c.1049C>T	c.(1048-1050)tCg>tTg	p.S350L	PCDHB14_ENST00000515856.2_Missense_Mutation_p.S197L	NM_018934.2	NP_061757.1	Q9Y5E9	PCDBE_HUMAN	protocadherin beta 14	350					calcium-dependent cell-cell adhesion (GO:0016339)|homophilic cell adhesion (GO:0007156)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.S350L(1)		NS(1)|breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(21)|ovary(2)|prostate(3)|skin(6)|urinary_tract(1)	49			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			GTGACCATATCGTCGATTACA	0.423																																					Ovarian(141;50 1831 27899 33809 37648)	dbGAP											1	Substitution - Missense(1)	NS(1)											88.0	96.0	93.0					5																	140604126		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF152493	CCDS4256.1	5q31	2010-01-26			ENSG00000120327	ENSG00000120327		"""Cadherins / Protocadherins : Clustered"""	8685	other	protocadherin		606340				10380929	Standard	NM_018934		Approved	PCDH-BETA14	uc003ljb.3	Q9Y5E9	OTTHUMG00000129619	ENST00000239449.4:c.1049C>T	5.37:g.140604126C>T	ENSP00000239449:p.Ser350Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DPE2|Q4FZA4|Q4KN11	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.S350L	ENST00000239449.4	37	c.1049	CCDS4256.1	5	.	.	.	.	.	.	.	.	.	.	-	14.24	2.476307	0.44044	.	.	ENSG00000120327	ENST00000515856;ENST00000239449	T;T	0.61392	0.11;0.11	4.86	4.86	0.63082	Cadherin (2);Cadherin-like (1);	.	.	.	.	T	0.68035	0.2957	M	0.72576	2.205	0.09310	N	1	D	0.64830	0.994	P	0.50109	0.631	T	0.65001	-0.6274	9	0.87932	D	0	.	17.9827	0.89146	0.0:1.0:0.0:0.0	.	350	Q9Y5E9	PCDBE_HUMAN	L	197;350	ENSP00000444518:S197L;ENSP00000239449:S350L	ENSP00000239449:S350L	S	+	2	0	PCDHB14	140584310	0.000000	0.05858	0.043000	0.18650	0.914000	0.54420	-0.632000	0.05489	2.412000	0.81896	0.655000	0.94253	TCG	PCDHB14	-	superfamily_Cadherin-like,pfscan_Cadherin	ENSG00000120327		0.423	PCDHB14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHB14	HGNC	protein_coding	OTTHUMT00000251814.2	98	0.00	0	C	NM_018934		140604126	140604126	+1	no_errors	ENST00000239449	ensembl	human	known	69_37n	missense	95	11.21	12	SNP	0.061	T
PDPR	55066	genome.wustl.edu	37	16	70172890	70172890	+	Missense_Mutation	SNP	C	C	T	rs112617700		TCGA-A1-A0SK-01A-12D-A099-09	TCGA-A1-A0SK-10A-03D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d1b43161-cbc1-4bf6-b8bb-a72a2e5e1150	2a5384f3-fec7-4265-b104-987f0718574b	g.chr16:70172890C>T	ENST00000288050.4	+	11	2236	c.1279C>T	c.(1279-1281)Cgc>Tgc	p.R427C	PDPR_ENST00000562100.1_3'UTR|PDPR_ENST00000568530.1_Missense_Mutation_p.R427C|PDPR_ENST00000398122.3_Missense_Mutation_p.R327C	NM_017990.3	NP_060460.4	Q8NCN5	PDPR_HUMAN	pyruvate dehydrogenase phosphatase regulatory subunit	427					cellular metabolic process (GO:0044237)|glycine catabolic process (GO:0006546)|pyruvate metabolic process (GO:0006090)|regulation of acetyl-CoA biosynthetic process from pyruvate (GO:0010510)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|mitochondrial matrix (GO:0005759)	aminomethyltransferase activity (GO:0004047)|oxidoreductase activity (GO:0016491)	p.R427C(1)		breast(1)|central_nervous_system(1)|cervix(2)|endometrium(2)|kidney(2)|large_intestine(3)|lung(17)|skin(2)|stomach(3)	33				BRCA - Breast invasive adenocarcinoma(221;0.124)		CCAGAGCAGCCGCACCTTTCT	0.512																																						dbGAP											1	Substitution - Missense(1)	stomach(1)											20.0	21.0	21.0					16																	70172890		1801	4043	5844	-	-	-	SO:0001583	missense	0				CCDS45520.1	16q22.1	2010-08-24			ENSG00000090857	ENSG00000090857			30264	protein-coding gene	gene with protein product						9395502	Standard	NM_017990		Approved	PDP3	uc002eyf.1	Q8NCN5		ENST00000288050.4:c.1279C>T	16.37:g.70172890C>T	ENSP00000288050:p.Arg427Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	A7E298|A8K8Y7|B3KSE1|Q6AI20|Q6AWC9	Missense_Mutation	SNP	pfam_FAD-dep_OxRdtase,pfam_GCV_T_N,pfam_GCV_T_C,pfam_FAD_bind_dom	p.R427C	ENST00000288050.4	37	c.1279	CCDS45520.1	16	287	0.13141025641025642	69	0.1402439024390244	43	0.11878453038674033	51	0.08916083916083917	124	0.16358839050131926	C	29.1	4.978510	0.92982	.	.	ENSG00000090857	ENST00000288050;ENST00000398122;ENST00000205055	D;D	0.85773	-2.03;-2.03	4.42	4.42	0.53409	.	0.119515	0.64402	D	0.000017	T	0.03136	0.0092	M	0.77406	2.37	0.80722	D	1	D;D	0.89917	1.0;0.998	P;P	0.56216	0.794;0.676	T	0.26087	-1.0113	10	0.72032	D	0.01	.	16.0044	0.80349	0.0:1.0:0.0:0.0	.	155;427	Q9NWE6;Q8NCN5	.;PDPR_HUMAN	C	427;327;155	ENSP00000288050:R427C;ENSP00000381190:R327C	ENSP00000205055:R155C	R	+	1	0	PDPR	68730391	1.000000	0.71417	0.996000	0.52242	0.954000	0.61252	7.645000	0.83430	1.985000	0.57927	0.455000	0.32223	CGC	PDPR	-	NULL	ENSG00000090857		0.512	PDPR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PDPR	HGNC	protein_coding	OTTHUMT00000434502.1	182	0.00	0	C	NM_017990		70172890	70172890	+1	no_errors	ENST00000288050	ensembl	human	known	69_37n	missense	116	14.07	19	SNP	1.000	T
PEPD	5184	genome.wustl.edu	37	19	33892709	33892709	+	Silent	SNP	G	G	A			TCGA-A1-A0SK-01A-12D-A099-09	TCGA-A1-A0SK-10A-03D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d1b43161-cbc1-4bf6-b8bb-a72a2e5e1150	2a5384f3-fec7-4265-b104-987f0718574b	g.chr19:33892709G>A	ENST00000244137.7	-	12	918	c.885C>T	c.(883-885)aaC>aaT	p.N295N	PEPD_ENST00000436370.3_Silent_p.N231N|PEPD_ENST00000397032.4_Silent_p.N254N	NM_000285.3	NP_000276.2	P12955	PEPD_HUMAN	peptidase D	295					cellular amino acid metabolic process (GO:0006520)|collagen catabolic process (GO:0030574)|proteolysis (GO:0006508)	extracellular vesicular exosome (GO:0070062)	aminopeptidase activity (GO:0004177)|dipeptidase activity (GO:0016805)|manganese ion binding (GO:0030145)|metallocarboxypeptidase activity (GO:0004181)			endometrium(3)|kidney(3)|large_intestine(2)|lung(7)|ovary(2)	17	Esophageal squamous(110;0.137)					TGAACTTGCCGTTGGCGGGAA	0.612																																						dbGAP											0													62.0	73.0	70.0					19																	33892709		2117	4222	6339	-	-	-	SO:0001819	synonymous_variant	0			BC015027	CCDS42544.1, CCDS54244.1, CCDS54245.1	19q13.11	2008-02-05				ENSG00000124299	3.4.13.9		8840	protein-coding gene	gene with protein product	"""prolidase"""	613230				2925654, 1972707	Standard	NM_000285		Approved		uc002nur.4	P12955		ENST00000244137.7:c.885C>T	19.37:g.33892709G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K3Z1|A8K416|A8K696|A8MX47|B4DDB7|B4DGJ1|E9PCE8|Q8TBN9|Q9BT75	Silent	SNP	pfam_Pept_M24_structural-domain,pfam_Aminopep_P_N,superfamily_Pept_M24_structural-domain	p.N295	ENST00000244137.7	37	c.885	CCDS42544.1	19																																																																																			PEPD	-	pfam_Pept_M24_structural-domain,superfamily_Pept_M24_structural-domain	ENSG00000124299		0.612	PEPD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PEPD	HGNC	protein_coding	OTTHUMT00000451432.3	340	0.00	0	G	NM_000285		33892709	33892709	-1	no_errors	ENST00000244137	ensembl	human	known	69_37n	silent	76	38.71	48	SNP	0.944	A
PIEZO1	9780	genome.wustl.edu	37	16	88786311	88786311	+	Silent	SNP	G	G	A	rs34388120	byFrequency	TCGA-A1-A0SK-01A-12D-A099-09	TCGA-A1-A0SK-10A-03D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d1b43161-cbc1-4bf6-b8bb-a72a2e5e1150	2a5384f3-fec7-4265-b104-987f0718574b	g.chr16:88786311G>A	ENST00000301015.9	-	43	6468	c.6222C>T	c.(6220-6222)ttC>ttT	p.F2074F	PIEZO1_ENST00000327397.7_5'Flank|RP5-1142A6.9_ENST00000564984.1_RNA	NM_001142864.2	NP_001136336.2	Q92508	PIEZ1_HUMAN	piezo-type mechanosensitive ion channel component 1	2074					cation transmembrane transport (GO:0098655)|cation transport (GO:0006812)|detection of mechanical stimulus (GO:0050982)|positive regulation of cell-cell adhesion mediated by integrin (GO:0033634)|positive regulation of integrin activation (GO:0033625)|regulation of membrane potential (GO:0042391)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	cation channel activity (GO:0005261)|mechanically-gated ion channel activity (GO:0008381)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(2)|prostate(2)|skin(1)	10						CGGACAGGGCGAAGTAGATGC	0.577													G|||	33	0.00658946	0.025	0.0	5008	,	,		16056	0.0		0.0	False		,,,				2504	0.0					dbGAP											0													67.0	72.0	71.0					16																	88786311		692	1591	2283	-	-	-	SO:0001819	synonymous_variant	0			D87071	CCDS54058.1	16q24.3	2011-08-31	2011-08-31	2011-08-31	ENSG00000103335	ENSG00000103335			28993	protein-coding gene	gene with protein product		611184	"""family with sequence similarity 38, member A"""	FAM38A		20813920, 21056836, 21299953, 21696149	Standard	NM_001142864		Approved	KIAA0233	uc010vpb.2	Q92508	OTTHUMG00000156776	ENST00000301015.9:c.6222C>T	16.37:g.88786311G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A6NHT9|A7E2B7|Q0KKZ9	Missense_Mutation	SNP	pfam_DUF3595	p.S916L	ENST00000301015.9	37	c.2747	CCDS54058.1	16	11	0.005036630036630037	11	0.022357723577235773	0	0.0	0	0.0	0	0.0	G	13.27	2.187447	0.38609	.	.	ENSG00000103335	ENST00000451779	.	.	.	5.91	-2.69	0.06022	.	.	.	.	.	T	0.47377	0.1442	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.59225	-0.7494	4	.	.	.	-29.9924	13.4314	0.61057	0.5987:0.0:0.4013:0.0	rs34388120	.	.	.	C	2020	.	.	R	-	1	0	FAM38A	87313812	0.982000	0.34865	0.975000	0.42487	0.948000	0.59901	0.158000	0.16422	-0.297000	0.08934	-0.263000	0.10527	CGC	PIEZO1	-	NULL	ENSG00000103335		0.577	PIEZO1-001	NOVEL	not_organism_supported|basic|appris_principal|exp_conf|CCDS	protein_coding	PIEZO1	HGNC	protein_coding	OTTHUMT00000345699.4	112	0.00	0	G	NM_014745		88786311	88786311	-1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000451779	ensembl	human	putative	69_37n	missense	53	11.67	7	SNP	0.946	A
PJA1	64219	genome.wustl.edu	37	X	68383057	68383057	+	Missense_Mutation	SNP	C	C	A			TCGA-A1-A0SK-01A-12D-A099-09	TCGA-A1-A0SK-10A-03D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d1b43161-cbc1-4bf6-b8bb-a72a2e5e1150	2a5384f3-fec7-4265-b104-987f0718574b	g.chrX:68383057C>A	ENST00000361478.1	-	2	402	c.25G>T	c.(25-27)Gta>Tta	p.V9L	PJA1_ENST00000374584.3_Missense_Mutation_p.V9L|PJA1_ENST00000477231.1_Intron|PJA1_ENST00000374571.4_Intron|PJA1_ENST00000374583.1_Missense_Mutation_p.V9L	NM_001032396.2|NM_022368.4|NM_145119.3	NP_001027568.1|NP_071763.2|NP_660095.1	Q8NG27	PJA1_HUMAN	praja ring finger 1, E3 ubiquitin protein ligase	9					protein catabolic process (GO:0030163)	cytoplasm (GO:0005737)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			endometrium(3)|large_intestine(5)|lung(12)|ovary(1)	21						TTGGGCCATACAGGCTTGCTA	0.542																																						dbGAP											0													90.0	79.0	83.0					X																	68383057		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK021892	CCDS14392.1, CCDS14393.1, CCDS35316.1	Xq13.1	2013-01-09	2012-02-23		ENSG00000181191	ENSG00000181191		"""RING-type (C3HC4) zinc fingers"""	16648	protein-coding gene	gene with protein product		300420	"""praja 1"", ""praja ring finger 1"""			12036302	Standard	NM_001032396		Approved	FLJ11830, RNF70	uc004dxh.3	Q8NG27	OTTHUMG00000021753	ENST00000361478.1:c.25G>T	X.37:g.68383057C>A	ENSP00000355014:p.Val9Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	A2A322|Q5JUT8|Q5JUT9|Q8NG28|Q9HAC1	Missense_Mutation	SNP	pfam_Znf_C3HC4_RING-type,smart_Znf_RING,pfscan_Znf_RING	p.V9L	ENST00000361478.1	37	c.25	CCDS14393.1	X	.	.	.	.	.	.	.	.	.	.	C	12.32	1.902497	0.33628	.	.	ENSG00000181191	ENST00000374584;ENST00000374583;ENST00000361478	T;T;T	0.15256	2.44;2.69;2.69	3.53	1.72	0.24424	.	0.974432	0.08215	N	0.980038	T	0.13286	0.0322	L	0.29908	0.895	0.28510	N	0.913599	B;B	0.18610	0.001;0.029	B;B	0.20384	0.001;0.029	T	0.31166	-0.9953	10	0.72032	D	0.01	.	6.1908	0.20524	0.0:0.6714:0.2117:0.1169	.	9;9	Q8NG27;Q8NG27-2	PJA1_HUMAN;.	L	9	ENSP00000363712:V9L;ENSP00000363711:V9L;ENSP00000355014:V9L	ENSP00000355014:V9L	V	-	1	0	PJA1	68299782	0.004000	0.15560	0.118000	0.21660	0.910000	0.53928	-0.482000	0.06544	0.350000	0.24002	0.530000	0.56133	GTA	PJA1	-	NULL	ENSG00000181191		0.542	PJA1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PJA1	HGNC	protein_coding	OTTHUMT00000057031.2	384	0.52	2	C	NM_145119		68383057	68383057	-1	no_errors	ENST00000361478	ensembl	human	known	69_37n	missense	333	19.37	80	SNP	0.491	A
PLEC	5339	genome.wustl.edu	37	8	145007427	145007427	+	Silent	SNP	G	G	A			TCGA-A1-A0SK-01A-12D-A099-09	TCGA-A1-A0SK-10A-03D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d1b43161-cbc1-4bf6-b8bb-a72a2e5e1150	2a5384f3-fec7-4265-b104-987f0718574b	g.chr8:145007427G>A	ENST00000322810.4	-	13	1936	c.1767C>T	c.(1765-1767)ctC>ctT	p.L589L	PLEC_ENST00000357649.2_Silent_p.L456L|PLEC_ENST00000356346.3_Silent_p.L438L|PLEC_ENST00000398774.2_Silent_p.L420L|PLEC_ENST00000354958.2_Silent_p.L430L|PLEC_ENST00000354589.3_Silent_p.L452L|PLEC_ENST00000345136.3_Silent_p.L452L|PLEC_ENST00000527096.1_Silent_p.L475L|PLEC_ENST00000436759.2_Silent_p.L479L	NM_201380.2	NP_958782.1	Q15149	PLEC_HUMAN	plectin	589	Globular 1.				apoptotic process (GO:0006915)|cell junction assembly (GO:0034329)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)	costamere (GO:0043034)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|hemidesmosome (GO:0030056)|intermediate filament cytoskeleton (GO:0045111)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|sarcoplasm (GO:0016528)	ankyrin binding (GO:0030506)|poly(A) RNA binding (GO:0044822)|structural constituent of muscle (GO:0008307)			NS(1)|breast(3)|central_nervous_system(4)|cervix(7)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(8)|lung(57)|ovary(4)|pancreas(2)|prostate(11)|skin(9)|stomach(2)|upper_aerodigestive_tract(10)	137						CGTCGTTGAAGAGCAGCCGGA	0.662																																						dbGAP											0													76.0	85.0	82.0					8																	145007427		2095	4197	6292	-	-	-	SO:0001819	synonymous_variant	0			U53204	CCDS43769.1, CCDS43770.1, CCDS43771.1, CCDS43772.1, CCDS43773.1, CCDS43774.1, CCDS43775.1, CCDS47936.1	8q24	2010-02-04	2010-02-04	2010-02-04	ENSG00000178209	ENSG00000178209			9069	protein-coding gene	gene with protein product		601282	"""plectin 1, intermediate filament binding protein, 500kD"", ""epidermolysis bullosa simplex 1 (Ogna)"", ""plectin 1, intermediate filament binding protein 500kDa"""	EBS1, PLEC1		8633055, 8696340	Standard	XM_005250976		Approved	PCN, PLTN	uc003zaf.1	Q15149	OTTHUMG00000165291	ENST00000322810.4:c.1767C>T	8.37:g.145007427G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q15148|Q16640|Q6S376|Q6S377|Q6S378|Q6S379|Q6S380|Q6S381|Q6S382|Q6S383	Silent	SNP	pfam_Plectin_repeat,pfam_CH-domain,pfam_S10_plectin_N,superfamily_CH-domain,superfamily_Chorismate_mutase_type_II,smart_CH-domain,smart_Spectrin/alpha-actinin,smart_Plectin_repeat,pfscan_CH-domain	p.L589	ENST00000322810.4	37	c.1767	CCDS43772.1	8																																																																																			PLEC	-	NULL	ENSG00000178209		0.662	PLEC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLEC	HGNC	protein_coding	OTTHUMT00000383281.1	274	0.00	0	G	NM_000445		145007427	145007427	-1	no_errors	ENST00000322810	ensembl	human	known	69_37n	silent	114	21.92	32	SNP	0.983	A
PMS2CL	441194	genome.wustl.edu	37	7	6776956	6776956	+	RNA	SNP	A	A	G	rs7804542	byFrequency	TCGA-A1-A0SK-01A-12D-A099-09	TCGA-A1-A0SK-10A-03D-A099-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d1b43161-cbc1-4bf6-b8bb-a72a2e5e1150	2a5384f3-fec7-4265-b104-987f0718574b	g.chr7:6776956A>G	ENST00000486256.1	+	0	1083					NR_002217.1		Q68D20	PMS2L_HUMAN	PMS2 C-terminal like pseudogene																		ATCTCTGACAAAGGCGTCCTG	0.557													G|||	1418	0.283147	0.3321	0.2219	5008	,	,		16629	0.3413		0.2078	False		,,,				2504	0.2781					dbGAP											0																																										-	-	-			0			BC041364		7p22.1	2010-10-26			ENSG00000187953	ENSG00000187953			30061	pseudogene	pseudogene	"""postmeiotic segregation increased 2 pseudogene 13"""					15256438, 17253626	Standard	NR_002217		Approved	PMS2P13	uc011jxb.1	Q68D20	OTTHUMG00000151857		7.37:g.6776956A>G		Somatic		WXS	Illumina GAIIx	Phase_IV	B4DK88|Q764P1	RNA	SNP	-	NULL	ENST00000486256.1	37	NULL		7																																																																																			PMS2CL	-	-	ENSG00000187953		0.557	PMS2CL-002	KNOWN	basic	processed_transcript	PMS2CL	HGNC	pseudogene	OTTHUMT00000324193.1	262	0.00	0	A	NR_002217		6776956	6776956	+1	no_errors	ENST00000486256	ensembl	human	known	69_37n	rna	361	14.79	63	SNP	0.000	G
POLR2J4	84820	genome.wustl.edu	37	7	44005513	44005513	+	RNA	SNP	G	G	A	rs2595699	byFrequency	TCGA-A1-A0SK-01A-12D-A099-09	TCGA-A1-A0SK-10A-03D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d1b43161-cbc1-4bf6-b8bb-a72a2e5e1150	2a5384f3-fec7-4265-b104-987f0718574b	g.chr7:44005513G>A	ENST00000427076.1	-	0	1379				RP5-1165K10.2_ENST00000454572.1_RNA	NR_003655.2				polymerase (RNA) II (DNA directed) polypeptide J4, pseudogene																		GCCGGAACCAGCCCTCCTCCT	0.637													g|||	345	0.0688898	0.0855	0.072	5008	,	,		9925	0.1171		0.0606	False		,,,				2504	0.0031					dbGAP											0																																										-	-	-			0					7p13	2008-08-21			ENSG00000214783	ENSG00000214783			28195	pseudogene	pseudogene						15586814	Standard	NR_003655		Approved	MGC13098	uc010kxw.2		OTTHUMG00000155253		7.37:g.44005513G>A		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000427076.1	37	NULL		7																																																																																			POLR2J4	-	-	ENSG00000214783		0.637	POLR2J4-002	KNOWN	basic|readthrough_transcript	processed_transcript	POLR2J4	HGNC	processed_transcript	OTTHUMT00000473169.1	115	0.00	0	G	NR_003655		44005513	44005513	-1	no_errors	ENST00000427076	ensembl	human	known	69_37n	rna	43	17.31	9	SNP	1.000	A
PRAMEF11	440560	genome.wustl.edu	37	1	12888389	12888389	+	Silent	SNP	A	A	C	rs1830486	byFrequency	TCGA-A1-A0SK-01A-12D-A099-09	TCGA-A1-A0SK-10A-03D-A099-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d1b43161-cbc1-4bf6-b8bb-a72a2e5e1150	2a5384f3-fec7-4265-b104-987f0718574b	g.chr1:12888389A>C	ENST00000535591.1	-	2	330	c.135T>G	c.(133-135)ctT>ctG	p.L45L		NM_001146344.1	NP_001139816.1	O60813	PRA11_HUMAN	PRAME family member 11	45					negative regulation of apoptotic process (GO:0043066)|negative regulation of cell differentiation (GO:0045596)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cell proliferation (GO:0008284)					NS(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|lung(7)|pancreas(2)|skin(4)|urinary_tract(1)	27						GCAGTGCATCAAGCCCATCGA	0.617													.|||	3268	0.652556	0.5144	0.6138	5008	,	,		16703	0.8254		0.6431	False		,,,				2504	0.6984					dbGAP											0																																										-	-	-	SO:0001819	synonymous_variant	0			AL049680	CCDS53268.1	1p36.21	2013-01-17			ENSG00000204513	ENSG00000239810		"""-"""	14086	protein-coding gene	gene with protein product							Standard	XM_006710645		Approved		uc001auk.2	O60813	OTTHUMG00000001929	ENST00000535591.1:c.135T>G	1.37:g.12888389A>C		Somatic		WXS	Illumina GAIIx	Phase_IV		Silent	SNP	NULL	p.L45	ENST00000535591.1	37	c.135	CCDS53268.1	1																																																																																			PRAMEF11	-	NULL	ENSG00000204513		0.617	PRAMEF11-201	KNOWN	basic|appris_principal|CCDS	protein_coding	PRAMEF11	HGNC	protein_coding		62	0.00	0	A	XM_496341		12888389	12888389	-1	no_errors	ENST00000535591	ensembl	human	known	69_37n	silent	136	17.07	28	SNP	0.000	C
PRAMEF4	400735	genome.wustl.edu	37	1	12939782	12939782	+	Silent	SNP	A	A	G	rs200129543		TCGA-A1-A0SK-01A-12D-A099-09	TCGA-A1-A0SK-10A-03D-A099-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d1b43161-cbc1-4bf6-b8bb-a72a2e5e1150	2a5384f3-fec7-4265-b104-987f0718574b	g.chr1:12939782A>G	ENST00000235349.5	-	4	1090	c.1020T>C	c.(1018-1020)ctT>ctC	p.L340L		NM_001009611.2	NP_001009611.1	O60810	PRAM4_HUMAN	PRAME family member 4	340					negative regulation of apoptotic process (GO:0043066)|negative regulation of cell differentiation (GO:0045596)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cell proliferation (GO:0008284)					breast(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(10)|ovary(2)|prostate(3)|skin(1)	24	Ovarian(185;0.249)	Lung NSC(185;3.67e-05)|all_lung(284;4.03e-05)|Renal(390;0.000147)|Breast(348;0.000278)|Colorectal(325;0.00058)|Ovarian(437;0.00965)|Hepatocellular(190;0.0245)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00812)|Colorectal(212;4.88e-06)|Kidney(185;4.89e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.000194)|COAD - Colon adenocarcinoma(227;0.000241)|BRCA - Breast invasive adenocarcinoma(304;0.000293)|STAD - Stomach adenocarcinoma(313;0.0072)|READ - Rectum adenocarcinoma(331;0.0649)		GGAGAGGCACAAGACTGTAAT	0.473																																						dbGAP											0																																										-	-	-	SO:0001819	synonymous_variant	0				CCDS30592.1	1p36.21	2013-01-17			ENSG00000243073	ENSG00000243073		"""-"""	31971	protein-coding gene	gene with protein product							Standard	NM_001009611		Approved	RP5-845O24.6	uc001aun.2	O60810	OTTHUMG00000001987	ENST00000235349.5:c.1020T>C	1.37:g.12939782A>G		Somatic		WXS	Illumina GAIIx	Phase_IV	Q5LJB5	Silent	SNP	NULL	p.L340	ENST00000235349.5	37	c.1020	CCDS30592.1	1																																																																																			PRAMEF4	-	NULL	ENSG00000243073		0.473	PRAMEF4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRAMEF4	HGNC	protein_coding	OTTHUMT00000005518.1	157	0.00	0	A	NM_001009611		12939782	12939782	-1	no_errors	ENST00000235349	ensembl	human	known	69_37n	silent	441	13.67	70	SNP	0.000	G
PRAMEF4	400735	genome.wustl.edu	37	1	12939851	12939851	+	Silent	SNP	G	G	A			TCGA-A1-A0SK-01A-12D-A099-09	TCGA-A1-A0SK-10A-03D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d1b43161-cbc1-4bf6-b8bb-a72a2e5e1150	2a5384f3-fec7-4265-b104-987f0718574b	g.chr1:12939851G>A	ENST00000235349.5	-	4	1021	c.951C>T	c.(949-951)tcC>tcT	p.S317S		NM_001009611.2	NP_001009611.1	O60810	PRAM4_HUMAN	PRAME family member 4	317					negative regulation of apoptotic process (GO:0043066)|negative regulation of cell differentiation (GO:0045596)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cell proliferation (GO:0008284)					breast(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(10)|ovary(2)|prostate(3)|skin(1)	24	Ovarian(185;0.249)	Lung NSC(185;3.67e-05)|all_lung(284;4.03e-05)|Renal(390;0.000147)|Breast(348;0.000278)|Colorectal(325;0.00058)|Ovarian(437;0.00965)|Hepatocellular(190;0.0245)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00812)|Colorectal(212;4.88e-06)|Kidney(185;4.89e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.000194)|COAD - Colon adenocarcinoma(227;0.000241)|BRCA - Breast invasive adenocarcinoma(304;0.000293)|STAD - Stomach adenocarcinoma(313;0.0072)|READ - Rectum adenocarcinoma(331;0.0649)		TCGGGCACTGGGATAGATGCT	0.448																																						dbGAP											0													32.0	43.0	39.0					1																	12939851		1288	2489	3777	-	-	-	SO:0001819	synonymous_variant	0				CCDS30592.1	1p36.21	2013-01-17			ENSG00000243073	ENSG00000243073		"""-"""	31971	protein-coding gene	gene with protein product							Standard	NM_001009611		Approved	RP5-845O24.6	uc001aun.2	O60810	OTTHUMG00000001987	ENST00000235349.5:c.951C>T	1.37:g.12939851G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q5LJB5	Silent	SNP	NULL	p.S317	ENST00000235349.5	37	c.951	CCDS30592.1	1																																																																																			PRAMEF4	-	NULL	ENSG00000243073		0.448	PRAMEF4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRAMEF4	HGNC	protein_coding	OTTHUMT00000005518.1	274	0.00	0	G	NM_001009611		12939851	12939851	-1	no_errors	ENST00000235349	ensembl	human	known	69_37n	silent	395	14.47	67	SNP	0.003	A
PRAMEF7	441871	genome.wustl.edu	37	1	12980232	12980232	+	Silent	SNP	G	G	A	rs201674075		TCGA-A1-A0SK-01A-12D-A099-09	TCGA-A1-A0SK-10A-03D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d1b43161-cbc1-4bf6-b8bb-a72a2e5e1150	2a5384f3-fec7-4265-b104-987f0718574b	g.chr1:12980232G>A	ENST00000361079.2	+	4	1507	c.1424G>A	c.(1423-1425)tGa>tAa	p.*475*	RNU6-1072P_ENST00000384703.1_RNA			Q5VXH5	PRAM7_HUMAN	PRAME family member 7	0					negative regulation of apoptotic process (GO:0043066)|negative regulation of cell differentiation (GO:0045596)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cell proliferation (GO:0008284)					endometrium(2)|kidney(5)|large_intestine(3)|lung(4)|prostate(2)|upper_aerodigestive_tract(2)	18	Ovarian(185;0.249)	Renal(390;0.000469)|Lung NSC(185;0.00143)|all_lung(284;0.00181)|Colorectal(325;0.00215)|Breast(348;0.00224)|Myeloproliferative disorder(586;0.0393)|Hepatocellular(190;0.0623)|Ovarian(437;0.0731)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00812)|Colorectal(212;4.88e-06)|Kidney(185;4.89e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.000194)|COAD - Colon adenocarcinoma(227;0.000241)|BRCA - Breast invasive adenocarcinoma(304;0.000293)|STAD - Stomach adenocarcinoma(313;0.0072)|READ - Rectum adenocarcinoma(331;0.0649)		TGCCTCTGTTGAATGCCTGCC	0.532																																						dbGAP											0																																										-	-	-	SO:0001819	synonymous_variant	0				CCDS30593.1	1p36.21	2013-01-17			ENSG00000204510	ENSG00000204510		"""-"""	28415	protein-coding gene	gene with protein product							Standard	NM_001012277		Approved			Q5VXH5	OTTHUMG00000001982	ENST00000361079.2:c.1424G>A	1.37:g.12980232G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B9EIP0	Silent	SNP	NULL	p.*475	ENST00000361079.2	37	c.1424	CCDS30593.1	1																																																																																			PRAMEF7	-	NULL	ENSG00000204510		0.532	PRAMEF7-201	KNOWN	basic|appris_principal|CCDS	protein_coding	PRAMEF7	HGNC	protein_coding		44	0.00	0	G	NM_001012277		12980232	12980232	+1	no_errors	ENST00000330881	ensembl	human	known	69_37n	silent	39	27.78	15	SNP	0.000	A
PRAMEF13	400736	genome.wustl.edu	37	1	13448455	13448455	+	Silent	SNP	G	G	T	rs200145993	byFrequency	TCGA-A1-A0SK-01A-12D-A099-09	TCGA-A1-A0SK-10A-03D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d1b43161-cbc1-4bf6-b8bb-a72a2e5e1150	2a5384f3-fec7-4265-b104-987f0718574b	g.chr1:13448455G>T	ENST00000376132.3	-	4	1122	c.1020C>A	c.(1018-1020)ctC>ctA	p.L340L		NM_001024661.1	NP_001019832.1	Q5VWM6	PRA13_HUMAN	PRAME family member 13	340					negative regulation of apoptotic process (GO:0043066)|negative regulation of cell differentiation (GO:0045596)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cell proliferation (GO:0008284)					breast(1)|large_intestine(1)|lung(3)|skin(2)	7	Ovarian(185;0.249)	Renal(390;0.000469)|Lung NSC(185;0.00143)|all_lung(284;0.00181)|Colorectal(325;0.00215)|Breast(348;0.00224)|Myeloproliferative disorder(586;0.0393)|Hepatocellular(190;0.0623)|Ovarian(437;0.0731)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00812)|Colorectal(212;9.86e-06)|Kidney(185;4.89e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.000194)|BRCA - Breast invasive adenocarcinoma(304;0.000293)|COAD - Colon adenocarcinoma(227;0.000502)|STAD - Stomach adenocarcinoma(313;0.0072)|READ - Rectum adenocarcinoma(331;0.0649)		GCAGAGCTCCGAGGGGTTCAA	0.527													g|||	594	0.11861	0.2632	0.0562	5008	,	,		16947	0.0347		0.0268	False		,,,				2504	0.1483					dbGAP											0													6.0	6.0	6.0					1																	13448455		1797	3924	5721	-	-	-	SO:0001819	synonymous_variant	0					1p36.21	2013-01-17			ENSG00000204495			"""-"""	13262	protein-coding gene	gene with protein product							Standard	NG_005159		Approved	OTTHUMG00000008034	uc010obi.1	Q5VWM6	OTTHUMG00000008034	ENST00000376132.3:c.1020C>A	1.37:g.13448455G>T		Somatic		WXS	Illumina GAIIx	Phase_IV		Silent	SNP	NULL	p.L340	ENST00000376132.3	37	c.1020	CCDS41257.1	1																																																																																			PRAMEF13	-	NULL	ENSG00000204495		0.527	PRAMEF13-001	KNOWN	not_best_in_genome_evidence|basic|appris_principal|CCDS	protein_coding	PRAMEF13	HGNC	protein_coding	OTTHUMT00000022040.1	76	0.00	0	G	XM_375688		13448455	13448455	-1	no_errors	ENST00000376132	ensembl	human	known	69_37n	silent	67	16.25	13	SNP	0.000	T
RAD21L1	642636	genome.wustl.edu	37	20	1210647	1210647	+	Missense_Mutation	SNP	T	T	C	rs450739	byFrequency	TCGA-A1-A0SK-01A-12D-A099-09	TCGA-A1-A0SK-10A-03D-A099-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d1b43161-cbc1-4bf6-b8bb-a72a2e5e1150	2a5384f3-fec7-4265-b104-987f0718574b	g.chr20:1210647T>C	ENST00000409241.1	+	3	361	c.268T>C	c.(268-270)Tgc>Cgc	p.C90R	RAD21L1_ENST00000402452.1_Missense_Mutation_p.C90R|RAD21L1_ENST00000381882.2_Missense_Mutation_p.C90R	NM_001136566.2	NP_001130038.2	Q9H4I0	RD21L_HUMAN	RAD21-like 1 (S. pombe)	90			C -> R (in dbSNP:rs450739). {ECO:0000269|PubMed:15489334}.		attachment of telomeric heterochromatin to nuclear envelope (GO:0070197)|chromosome segregation (GO:0007059)|double-strand break repair via homologous recombination (GO:0000724)|fertilization (GO:0009566)|linear element assembly (GO:0030999)|seminiferous tubule development (GO:0072520)|spermatogenesis (GO:0007283)	chromosome (GO:0005694)|lateral element (GO:0000800)|meiotic cohesin complex (GO:0030893)|nuclear meiotic cohesin complex (GO:0034991)|nucleus (GO:0005634)				NS(1)|breast(1)|large_intestine(1)|lung(2)|skin(1)|stomach(1)	7						GATGACATTTTGCCCAGGTAT	0.373													C|||	2474	0.49401	0.7542	0.428	5008	,	,		17544	0.2202		0.5378	False		,,,				2504	0.4264					dbGAP											0													158.0	132.0	140.0					20																	1210647		692	1591	2283	-	-	-	SO:0001583	missense	0			AL031665	CCDS46568.1	20p13	2011-08-12			ENSG00000244588	ENSG00000244588			16271	protein-coding gene	gene with protein product							Standard	NM_001136566		Approved	dJ545L17.2, RAD21L	uc010gab.1	Q9H4I0	OTTHUMG00000031664	ENST00000409241.1:c.268T>C	20.37:g.1210647T>C	ENSP00000386414:p.Cys90Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RXL0|B7ZBB1|B7ZW76|Q5W0X5	Missense_Mutation	SNP	pfam_Rad21_Rec8_N,pfam_Rad21/Rec8_C_eu	p.C90R	ENST00000409241.1	37	c.268	CCDS46568.1	20	1057	0.483974358974359	373	0.758130081300813	175	0.48342541436464087	113	0.19755244755244755	396	0.5224274406332454	C	3.037	-0.198432	0.06219	.	.	ENSG00000244588	ENST00000402452;ENST00000409241;ENST00000381882	T;T;T	0.25912	1.77;1.77;1.77	5.16	5.16	0.70880	Rad21/Rec8-like protein, N-terminal (1);	0.000000	0.64402	N	0.000007	T	0.00012	0.0000	N	0.00009	-3.09	0.22330	P	0.999196335	B	0.02656	0.0	B	0.01281	0.0	T	0.43130	-0.9410	9	0.02654	T	1	.	14.0293	0.64606	0.0:0.9264:0.0:0.0736	rs450739;rs52795523;rs59077672;rs450739	90	Q9H4I0	RD21L_HUMAN	R	90	ENSP00000385925:C90R;ENSP00000386414:C90R;ENSP00000371306:C90R	ENSP00000371306:C90R	C	+	1	0	RAD21L1	1158647	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	3.090000	0.50191	1.555000	0.49500	-0.186000	0.12905	TGC	RAD21L1	-	pfam_Rad21_Rec8_N	ENSG00000244588		0.373	RAD21L1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	RAD21L1	HGNC	protein_coding	OTTHUMT00000334022.1	308	0.00	0	T			1210647	1210647	+1	no_errors	ENST00000409241	ensembl	human	known	69_37n	missense	69	23.33	21	SNP	1.000	C
RALY	22913	genome.wustl.edu	37	20	32664862	32664862	+	Silent	SNP	C	C	T	rs11538301	byFrequency	TCGA-A1-A0SK-01A-12D-A099-09	TCGA-A1-A0SK-10A-03D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d1b43161-cbc1-4bf6-b8bb-a72a2e5e1150	2a5384f3-fec7-4265-b104-987f0718574b	g.chr20:32664862C>T	ENST00000246194.3	+	8	1189	c.687C>T	c.(685-687)ggC>ggT	p.G229G	RALY_ENST00000375114.3_Silent_p.G213G	NM_016732.2	NP_057951.1	Q9UKM9	RALY_HUMAN	RALY heterogeneous nuclear ribonucleoprotein	229	Epitope (recognized by BKRF1 antibodies).|Poly-Gly.				mRNA splicing, via spliceosome (GO:0000398)	catalytic step 2 spliceosome (GO:0071013)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			kidney(2)|large_intestine(3)|lung(2)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	12						ATGGAggtggcgccggcggcg	0.667													C|||	536	0.107029	0.3843	0.0389	5008	,	,		15073	0.0		0.001	False		,,,				2504	0.0					dbGAP											0													6.0	8.0	7.0					20																	32664862		2130	4163	6293	-	-	-	SO:0001819	synonymous_variant	0			AF148457	CCDS13229.1, CCDS13230.1	20q11.21-q11.23	2013-08-06	2013-08-06		ENSG00000125970	ENSG00000125970		"""RNA binding motif (RRM) containing"""	15921	protein-coding gene	gene with protein product		614663	"""RNA-binding protein (autoantigenic, hnRNP-associated with lethal yellow)"", ""RNA binding protein, autoantigenic (hnRNP-associated with lethal yellow homolog (mouse))"""			10500250, 23614458	Standard	NM_016732		Approved	P542, HNRPCL2	uc002xab.3	Q9UKM9	OTTHUMG00000032283	ENST00000246194.3:c.687C>T	20.37:g.32664862C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q14621|Q2M365|Q5QPL8|Q9BQX6|Q9UJE3	Silent	SNP	pfam_RRM_dom,smart_RRM_dom,pirsf_hnRNP_C_Raly,pfscan_RRM_dom	p.G229	ENST00000246194.3	37	c.687	CCDS13230.1	20																																																																																			RALY	-	pirsf_hnRNP_C_Raly	ENSG00000125970		0.667	RALY-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RALY	HGNC	protein_coding	OTTHUMT00000078753.1	32	0.00	0	C			32664862	32664862	+1	no_errors	ENST00000246194	ensembl	human	known	69_37n	silent	44	15.09	8	SNP	0.049	T
RFWD2	64326	genome.wustl.edu	37	1	176012391	176012391	+	Silent	SNP	T	T	G			TCGA-A1-A0SK-01A-12D-A099-09	TCGA-A1-A0SK-10A-03D-A099-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d1b43161-cbc1-4bf6-b8bb-a72a2e5e1150	2a5384f3-fec7-4265-b104-987f0718574b	g.chr1:176012391T>G	ENST00000367669.3	-	14	2057	c.1543A>C	c.(1543-1545)Agg>Cgg	p.R515R	RFWD2_ENST00000308769.8_Silent_p.R491R	NM_022457.5	NP_071902.2	Q8NHY2	RFWD2_HUMAN	ring finger and WD repeat domain 2, E3 ubiquitin protein ligase	515					DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|response to ionizing radiation (GO:0010212)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|Golgi membrane (GO:0000139)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin protein ligase activity (GO:0061630)|zinc ion binding (GO:0008270)			endometrium(1)|kidney(2)|large_intestine(5)|lung(17)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	30						CTCCAACACCTCTTCTCATGC	0.378																																					Ovarian(134;1413 1765 5706 35534 51541)	dbGAP											0													138.0	133.0	135.0					1																	176012391		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK001278	CCDS30944.1, CCDS44279.1	1q25.1-q25.2	2013-01-09	2012-02-23		ENSG00000143207	ENSG00000143207		"""WD repeat domain containing"", ""RING-type (C3HC4) zinc fingers"""	17440	protein-coding gene	gene with protein product		608067	"""ring finger and WD repeat domain 2"""			10395541	Standard	XM_005245447		Approved	FLJ10416, COP1, RNF200	uc001gku.1	Q8NHY2	OTTHUMG00000034986	ENST00000367669.3:c.1543A>C	1.37:g.176012391T>G		Somatic		WXS	Illumina GAIIx	Phase_IV	E9PKI0|Q504W6|Q6H103|Q9H6L7|X5D9B4	Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat	p.R234S	ENST00000367669.3	37	c.702	CCDS30944.1	1	.	.	.	.	.	.	.	.	.	.	T	9.519	1.107683	0.20714	.	.	ENSG00000143207	ENST00000459744	.	.	.	5.56	4.42	0.53409	.	0.000000	0.85682	D	0.000000	T	0.63581	0.2523	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.61068	-0.7137	5	.	.	.	-14.9383	12.4049	0.55434	0.0:0.0:0.1529:0.847	.	.	.	.	S	234	.	.	R	-	3	2	RFWD2	174279014	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	2.973000	0.49264	1.037000	0.40024	0.460000	0.39030	AGA	RFWD2	-	superfamily_WD40_repeat_dom	ENSG00000143207		0.378	RFWD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RFWD2	HGNC	protein_coding	OTTHUMT00000084672.2	185	0.00	0	T	NM_022457		176012391	176012391	-1	no_start_codon:pseudogene:no_stop_codon	ENST00000459744	ensembl	human	novel	69_37n	missense	86	44.16	68	SNP	1.000	G
RFX8	731220	genome.wustl.edu	37	2	102014145	102014145	+	Silent	SNP	T	T	A			TCGA-A1-A0SK-01A-12D-A099-09	TCGA-A1-A0SK-10A-03D-A099-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d1b43161-cbc1-4bf6-b8bb-a72a2e5e1150	2a5384f3-fec7-4265-b104-987f0718574b	g.chr2:102014145T>A	ENST00000376826.2	-	15	1625	c.1626A>T	c.(1624-1626)gcA>gcT	p.A542A	RFX8_ENST00000428343.1_Silent_p.A429A			Q6ZV50	RFX8_HUMAN	RFX family member 8, lacking RFX DNA binding domain	542					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)			endometrium(1)|kidney(1)|stomach(1)	3						TGAGTTTAACTGCGCTTTCAG	0.413																																						dbGAP											0													254.0	201.0	217.0					2																	102014145		692	1591	2283	-	-	-	SO:0001819	synonymous_variant	0			AK124976	CCDS46376.1	2q11.2	2012-11-15	2012-11-15		ENSG00000196460	ENSG00000196460			37253	protein-coding gene	gene with protein product			"""regulatory factor X, 8"", ""RFX gene family member 8, lacking RFX DNA binding domain"""				Standard	NM_001145664		Approved	FLJ42986	uc010yvx.1	Q6ZV50	OTTHUMG00000130693	ENST00000376826.2:c.1626A>T	2.37:g.102014145T>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B4DQ32	Silent	SNP	pfam_DNA-bd_RFX	p.A542	ENST00000376826.2	37	c.1626		2																																																																																			RFX8	-	NULL	ENSG00000196460		0.413	RFX8-201	KNOWN	basic|appris_principal	protein_coding	RFX8	HGNC	protein_coding		530	0.00	0	T	NM_001145664		102014145	102014145	-1	no_errors	ENST00000376826	ensembl	human	known	69_37n	silent	9	43.75	7	SNP	0.000	A
RGPD3	653489	genome.wustl.edu	37	2	107040572	107040572	+	Missense_Mutation	SNP	T	T	C	rs3870235		TCGA-A1-A0SK-01A-12D-A099-09	TCGA-A1-A0SK-10A-03D-A099-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d1b43161-cbc1-4bf6-b8bb-a72a2e5e1150	2a5384f3-fec7-4265-b104-987f0718574b	g.chr2:107040572T>C	ENST00000409886.3	-	20	3938	c.3851A>G	c.(3850-3852)cAc>cGc	p.H1284R	RGPD3_ENST00000304514.7_Missense_Mutation_p.H1284R	NM_001144013.1	NP_001137485.1	A6NKT7	RGPD3_HUMAN	RANBP2-like and GRIP domain containing 3	1284					protein targeting to Golgi (GO:0000042)					breast(2)|central_nervous_system(1)|endometrium(50)|kidney(4)|lung(11)|ovary(1)|urinary_tract(2)	71						CTCATCAAAGTGGAAAAGATT	0.403																																						dbGAP											0													183.0	135.0	149.0					2																	107040572		659	1516	2175	-	-	-	SO:0001583	missense	0				CCDS46379.1	2q12.2	2013-01-10			ENSG00000153165	ENSG00000153165		"""Tetratricopeptide (TTC) repeat domain containing"""	32416	protein-coding gene	gene with protein product		612706				15710750, 15815621	Standard	NM_001144013		Approved	RGP3	uc010ywi.1	A6NKT7	OTTHUMG00000153182	ENST00000409886.3:c.3851A>G	2.37:g.107040572T>C	ENSP00000386588:p.His1284Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	B8ZZM4	Missense_Mutation	SNP	pfam_Ran_bind_dom,pfam_GRIP,pfam_TPR-1,pfam_TPR_2,smart_TPR_repeat,smart_Ran_bind_dom,smart_GRIP,pfscan_GRIP,pfscan_TPR_repeat,pfscan_TPR-contain_dom,pfscan_Ran_bind_dom	p.H1284R	ENST00000409886.3	37	c.3851	CCDS46379.1	2	.	.	.	.	.	.	.	.	.	.	.	0.001	-2.926314	0.00054	.	.	ENSG00000153165	ENST00000409886;ENST00000304514	T;T	0.34859	1.34;1.34	2.35	2.35	0.29111	.	.	.	.	.	T	0.10723	0.0262	N	0.00926	-1.1	0.45261	P	0.0017359999999999598	B	0.02656	0.0	B	0.01281	0.0	T	0.30937	-0.9961	8	0.10636	T	0.68	-3.2817	7.1563	0.25639	0.0:0.8506:0.0:0.1494	.	1284	A6NKT7	RGPD3_HUMAN	R	1284	ENSP00000386588:H1284R;ENSP00000303659:H1284R	ENSP00000303659:H1284R	H	-	2	0	RGPD3	106407004	1.000000	0.71417	0.999000	0.59377	0.042000	0.13812	4.693000	0.61753	0.328000	0.23435	-1.128000	0.01989	CAC	RGPD3	-	NULL	ENSG00000153165		0.403	RGPD3-002	KNOWN	not_best_in_genome_evidence|basic|appris_candidate|CCDS	protein_coding	RGPD3	HGNC	protein_coding	OTTHUMT00000329975.1	207	0.48	1	T	XM_929931		107040572	107040572	-1	no_errors	ENST00000304514	ensembl	human	known	69_37n	missense	80	40.30	54	SNP	1.000	C
RHBDF1	64285	genome.wustl.edu	37	16	111120	111120	+	Missense_Mutation	SNP	A	A	C			TCGA-A1-A0SK-01A-12D-A099-09	TCGA-A1-A0SK-10A-03D-A099-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d1b43161-cbc1-4bf6-b8bb-a72a2e5e1150	2a5384f3-fec7-4265-b104-987f0718574b	g.chr16:111120A>C	ENST00000262316.6	-	11	1697	c.1555T>G	c.(1555-1557)Tcg>Gcg	p.S519A	RHBDF1_ENST00000454039.2_Missense_Mutation_p.L553R	NM_022450.3	NP_071895.3	Q96CC6	RHDF1_HUMAN	rhomboid 5 homolog 1 (Drosophila)	519					cell migration (GO:0016477)|cell proliferation (GO:0008283)|negative regulation of protein secretion (GO:0050709)|protein transport (GO:0015031)|proteolysis (GO:0006508)|regulation of epidermal growth factor receptor signaling pathway (GO:0042058)|regulation of proteasomal protein catabolic process (GO:0061136)|regulation of protein secretion (GO:0050708)	endoplasmic reticulum membrane (GO:0005789)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)				breast(1)|endometrium(2)|kidney(4)|large_intestine(2)|lung(3)|ovary(1)|pancreas(1)|prostate(2)|soft_tissue(1)|upper_aerodigestive_tract(1)	18		all_cancers(16;2.56e-05)|all_epithelial(16;0.000116)|Hepatocellular(780;0.0068)|Lung NSC(18;0.0795)|all_lung(18;0.159)				AAACGCACCGAGCACTCCTCC	0.662																																						dbGAP											0													19.0	12.0	14.0					16																	111120		1820	3397	5217	-	-	-	SO:0001583	missense	0			BC014425	CCDS32344.1	16p13.3	2008-02-05	2006-02-22		ENSG00000007384	ENSG00000007384			20561	protein-coding gene	gene with protein product		614403	"""chromosome 16 open reading frame 8"", ""rhomboid family 1 (Drosophila)"""	C16orf8		8318735, 15965977	Standard	NM_022450		Approved	EGFR-RS, FLJ2235, Dist1	uc002cfl.4	Q96CC6	OTTHUMG00000060719	ENST00000262316.6:c.1555T>G	16.37:g.111120A>C	ENSP00000262316:p.Ser519Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	Q04842|Q1W6H2|Q4TT59|Q96S34|Q9H6E1	Missense_Mutation	SNP	pfam_Rhomboid_SP,pfam_Peptidase_S54_rhomboid_dom	p.S519A	ENST00000262316.6	37	c.1555	CCDS32344.1	16	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	11.69|11.69	1.714952|1.714952	0.30413|0.30413	.|.	.|.	ENSG00000007384|ENSG00000007384	ENST00000454039|ENST00000262316	T|T	0.70045|0.41065	-0.45|1.01	5.29|5.29	5.29|5.29	0.74685|0.74685	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.46054|0.46054	0.1373|0.1373	M|M	0.76170|0.76170	2.325|2.325	0.38781|0.38781	D|D	0.954761|0.954761	D;D|B	0.89917|0.10296	1.0;0.999|0.003	D;D|B	0.91635|0.14023	0.999;0.998|0.01	T|T	0.49322|0.49322	-0.8952|-0.8952	9|10	0.87932|0.51188	D|T	0|0.08	-15.5141|-15.5141	14.4007|14.4007	0.67044|0.67044	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	553;576|519	F5GWL4;B4E3Q0|Q96CC6	.;.|RHDF1_HUMAN	R|A	553|519	ENSP00000392133:L553R|ENSP00000262316:S519A	ENSP00000392133:L553R|ENSP00000262316:S519A	L|S	-|-	2|1	0|0	RHBDF1|RHBDF1	51120|51120	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.571000|0.571000	0.35966|0.35966	9.246000|9.246000	0.95438|0.95438	2.007000|2.007000	0.58848|0.58848	0.334000|0.334000	0.21626|0.21626	CTC|TCG	RHBDF1	-	NULL	ENSG00000007384		0.662	RHBDF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RHBDF1	HGNC	protein_coding	OTTHUMT00000134178.2	14	0.00	0	A	NM_022450		111120	111120	-1	no_errors	ENST00000262316	ensembl	human	known	69_37n	missense	17	32.00	8	SNP	1.000	C
RTL1	388015	genome.wustl.edu	37	14	101347090	101347090	+	Missense_Mutation	SNP	C	C	T	rs73349352	byFrequency	TCGA-A1-A0SK-01A-12D-A099-09	TCGA-A1-A0SK-10A-03D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d1b43161-cbc1-4bf6-b8bb-a72a2e5e1150	2a5384f3-fec7-4265-b104-987f0718574b	g.chr14:101347090C>T	ENST00000534062.1	-	1	4094	c.4036G>A	c.(4036-4038)Gaa>Aaa	p.E1346K	MIR127_ENST00000384876.1_RNA|MIR431_ENST00000385266.1_RNA|MIR433_ENST00000384837.1_RNA	NM_001134888.2	NP_001128360.1	A6NKG5	RTL1_HUMAN	retrotransposon-like 1	1346					multicellular organismal development (GO:0007275)	integral component of membrane (GO:0016021)				breast(1)|endometrium(5)|kidney(4)|large_intestine(1)|lung(5)|pancreas(1)|prostate(2)|skin(2)	21						GGCAGCTCTTCTAGCCTTGCC	0.627													C|||	213	0.0425319	0.1536	0.0144	5008	,	,		14165	0.0		0.0	False		,,,				2504	0.0					dbGAP											0													32.0	32.0	32.0					14																	101347090		692	1591	2283	-	-	-	SO:0001583	missense	0				CCDS53910.1	14q32.2	2012-04-18			ENSG00000254656	ENSG00000254656			14665	protein-coding gene	gene with protein product		611896				16155747, 15854907, 12796779	Standard	NM_001134888		Approved	PEG11, MART1, Mar1	uc010txj.1	A6NKG5	OTTHUMG00000167573	ENST00000534062.1:c.4036G>A	14.37:g.101347090C>T	ENSP00000435342:p.Glu1346Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	E9PKS8	Missense_Mutation	SNP	pfam_Retrotrans_gag,superfamily_Peptidase_aspartic	p.E1346K	ENST00000534062.1	37	c.4036	CCDS53910.1	14	73	0.033424908424908424	70	0.14227642276422764	3	0.008287292817679558	0	0.0	0	0.0	C	12.39	1.924506	0.34002	.	.	ENSG00000254656	ENST00000534062	T	0.28255	1.62	3.29	0.236	0.15471	.	.	.	.	.	T	0.00144	0.0004	N	0.24115	0.695	0.80722	P	0.0	B	0.34103	0.437	B	0.24541	0.054	T	0.09552	-1.0669	8	0.87932	D	0	.	10.9898	0.47543	0.0:0.4239:0.5761:0.0	.	1346	E9PKS8	.	K	1346	ENSP00000435342:E1346K	ENSP00000435342:E1346K	E	-	1	0	RTL1	100416843	0.000000	0.05858	0.000000	0.03702	0.084000	0.17831	-0.458000	0.06737	0.044000	0.15775	-0.222000	0.12452	GAA	RTL1	-	NULL	ENSG00000254656		0.627	RTL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RTL1	HGNC	protein_coding	OTTHUMT00000395127.1	98	0.00	0	C	NM_001134888		101347090	101347090	-1	no_errors	ENST00000534062	ensembl	human	known	69_37n	missense	52	10.34	6	SNP	0.000	T
RXFP4	339403	genome.wustl.edu	37	1	155912487	155912487	+	Missense_Mutation	SNP	G	G	T			TCGA-A1-A0SK-01A-12D-A099-09	TCGA-A1-A0SK-10A-03D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d1b43161-cbc1-4bf6-b8bb-a72a2e5e1150	2a5384f3-fec7-4265-b104-987f0718574b	g.chr1:155912487G>T	ENST00000368318.3	+	1	1008	c.987G>T	c.(985-987)ttG>ttT	p.L329F		NM_181885.2	NP_871001.1	Q8TDU9	RL3R2_HUMAN	relaxin/insulin-like family peptide receptor 4	329			L -> S (in dbSNP:rs2152051). {ECO:0000269|PubMed:14522967, ECO:0000269|PubMed:15489334, ECO:0000269|Ref.7}.			integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	angiotensin type II receptor activity (GO:0004945)			endometrium(1)|large_intestine(4)|lung(6)|ovary(1)|skin(1)	13	Hepatocellular(266;0.133)|all_hematologic(923;0.145)|all_neural(408;0.195)					ATCTGCGGTTGAGGCTGTGGC	0.662																																						dbGAP											0													41.0	45.0	44.0					1																	155912487		2202	4300	6502	-	-	-	SO:0001583	missense	0			AB065617	CCDS1124.1	1q22	2012-08-08	2006-05-09	2006-03-15	ENSG00000173080	ENSG00000173080		"""GPCR / Class A : Relaxin family peptide receptors"""	14666	protein-coding gene	gene with protein product		609043	"""G protein-coupled receptor 100"", ""relaxin 3 receptor 2"", ""relaxin family peptide receptor 4"""	GPR100, RLN3R2		15956688, 16507880	Standard	NM_181885		Approved	GPCR142, RXFPR4	uc010pgs.2	Q8TDU9	OTTHUMG00000017463	ENST00000368318.3:c.987G>T	1.37:g.155912487G>T	ENSP00000357301:p.Leu329Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	B0M0L4|Q3MJB1|Q8NGZ8	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_7TM_GPCR_Rhodpsn,prints_ATII_rcpt	p.L329F	ENST00000368318.3	37	c.987	CCDS1124.1	1	.	.	.	.	.	.	.	.	.	.	G	14.36	2.511532	0.44660	.	.	ENSG00000173080	ENST00000368318	T	0.37411	1.2	4.9	-9.8	0.00490	.	0.686209	0.11960	N	0.512802	T	0.03178	0.0093	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.24297	-1.0164	10	0.09843	T	0.71	-0.3264	9.664	0.39972	0.451:0.2342:0.3148:0.0	.	329	Q8TDU9	RL3R2_HUMAN	F	329	ENSP00000357301:L329F	ENSP00000357301:L329F	L	+	3	2	RXFP4	154179111	0.000000	0.05858	0.000000	0.03702	0.540000	0.34992	-1.810000	0.01729	-2.863000	0.00326	-1.094000	0.02160	TTG	RXFP4	-	NULL	ENSG00000173080		0.662	RXFP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RXFP4	HGNC	protein_coding	OTTHUMT00000046203.1	34	0.00	0	G	NM_181885		155912487	155912487	+1	no_errors	ENST00000368318	ensembl	human	known	69_37n	missense	37	28.85	15	SNP	0.000	T
SCD5	79966	genome.wustl.edu	37	4	83719603	83719603	+	Missense_Mutation	SNP	C	C	A			TCGA-A1-A0SK-01A-12D-A099-09	TCGA-A1-A0SK-10A-03D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d1b43161-cbc1-4bf6-b8bb-a72a2e5e1150	2a5384f3-fec7-4265-b104-987f0718574b	g.chr4:83719603C>A	ENST00000319540.4	-	1	407	c.88G>T	c.(88-90)Ggc>Tgc	p.G30C	SCD5_ENST00000273908.4_Missense_Mutation_p.G30C|SCD5_ENST00000282709.4_Missense_Mutation_p.G30C	NM_001037582.2	NP_001032671.2	Q86SK9	SCD5_HUMAN	stearoyl-CoA desaturase 5	30					fatty acid biosynthetic process (GO:0006633)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	iron ion binding (GO:0005506)|stearoyl-CoA 9-desaturase activity (GO:0004768)			endometrium(1)|kidney(2)|large_intestine(3)|lung(6)|ovary(1)	13		Colorectal(4;0.0323)|Hepatocellular(203;0.115)				GGGCCGCCGCCGCCCTCAGAG	0.682																																						dbGAP											0													22.0	23.0	22.0					4																	83719603		2200	4295	6495	-	-	-	SO:0001583	missense	0			AF389338	CCDS3595.1, CCDS34024.1	4q21.3	2013-01-25	2005-06-09	2005-06-09	ENSG00000145284	ENSG00000145284		"""Fatty acid desaturases"""	21088	protein-coding gene	gene with protein product		608370	"""stearoyl-CoA desaturase 4"""	SCD4		12477932	Standard	NM_024906		Approved	ACOD4, FLJ21032, FADS4, HSCD5	uc003hna.2	Q86SK9	OTTHUMG00000130293	ENST00000319540.4:c.88G>T	4.37:g.83719603C>A	ENSP00000316329:p.Gly30Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RPG0|Q4W5Q5|Q8NDS0|Q9H7D1	Missense_Mutation	SNP	pfam_Fatty_acid_desaturase-1,prints_Fatty_acid_desaturase-1_core	p.G30C	ENST00000319540.4	37	c.88	CCDS34024.1	4	.	.	.	.	.	.	.	.	.	.	C	11.28	1.591251	0.28357	.	.	ENSG00000145284	ENST00000319540;ENST00000273908;ENST00000282709	T	0.45668	0.89	4.3	3.41	0.39046	.	1.075620	0.07258	N	0.867027	T	0.44052	0.1275	N	0.14661	0.345	0.09310	N	1	D;D;P	0.71674	0.99;0.998;0.855	P;P;B	0.61874	0.796;0.895;0.374	T	0.41142	-0.9525	10	0.41790	T	0.15	-3.8306	9.8169	0.40858	0.3145:0.6855:0.0:0.0	.	30;30;30	Q9BSN4;Q86SK9-2;Q86SK9	.;.;SCD5_HUMAN	C	30	ENSP00000316329:G30C	ENSP00000273908:G30C	G	-	1	0	SCD5	83938627	0.003000	0.15002	0.016000	0.15963	0.124000	0.20399	0.683000	0.25349	2.203000	0.70933	0.542000	0.68232	GGC	SCD5	-	NULL	ENSG00000145284		0.682	SCD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SCD5	HGNC	protein_coding	OTTHUMT00000252635.1	63	0.00	0	C	NM_024906		83719603	83719603	-1	no_errors	ENST00000319540	ensembl	human	known	69_37n	missense	12	36.84	7	SNP	0.004	A
SCN9A	6335	genome.wustl.edu	37	2	167159748	167159748	+	Silent	SNP	C	C	T			TCGA-A1-A0SK-01A-12D-A099-09	TCGA-A1-A0SK-10A-03D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d1b43161-cbc1-4bf6-b8bb-a72a2e5e1150	2a5384f3-fec7-4265-b104-987f0718574b	g.chr2:167159748C>T	ENST00000409435.1	-	6	752	c.753G>A	c.(751-753)ctG>ctA	p.L251L	SCN9A_ENST00000375387.4_Silent_p.L252L|AC010127.3_ENST00000447809.2_RNA|SCN9A_ENST00000303354.6_Silent_p.L252L|SCN9A_ENST00000409672.1_Silent_p.L251L			Q15858	SCN9A_HUMAN	sodium channel, voltage-gated, type IX, alpha subunit	251					behavioral response to pain (GO:0048266)|inflammatory response (GO:0006954)|membrane depolarization during action potential (GO:0086010)|neuronal action potential (GO:0019228)|post-embryonic development (GO:0009791)|response to toxic substance (GO:0009636)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)	sodium ion binding (GO:0031402)|voltage-gated sodium channel activity (GO:0005248)			NS(1)|breast(5)|central_nervous_system(6)|endometrium(6)|kidney(3)|large_intestine(27)|lung(38)|ovary(6)|prostate(8)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	108					Lacosamide(DB06218)|Lidocaine(DB00281)|Ranolazine(DB00243)|Rufinamide(DB06201)|Valproic Acid(DB00313)|Zonisamide(DB00909)	AGAACACAGTCAGGATCATGA	0.383																																						dbGAP											0													103.0	100.0	101.0					2																	167159748		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			X82835	CCDS46441.1	2q24	2014-09-17	2007-01-23		ENSG00000169432	ENSG00000169432		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10597	protein-coding gene	gene with protein product		603415	"""sodium channel, voltage-gated, type IX, alpha polypeptide"""			7720699, 10198179, 16382098	Standard	NM_002977		Approved	Nav1.7, PN1, NE-NA, NENA, ETHA	uc010fpl.3	Q15858	OTTHUMG00000154044	ENST00000409435.1:c.753G>A	2.37:g.167159748C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A1BUH5|Q6B4R9|Q6B4S0|Q6B4S1|Q70HX1|Q70HX2|Q8WTU1|Q8WWN4	Silent	SNP	pfam_Ion_trans_dom,pfam_DUF3451,pfam_Na_trans_assoc,pfam_PKD1_2_channel,smart_IQ_motif_EF-hand-BS,prints_Na_channel_asu,prints_PKD_2	p.L252	ENST00000409435.1	37	c.756	CCDS46441.1	2																																																																																			SCN9A	-	pfam_Ion_trans_dom	ENSG00000169432		0.383	SCN9A-004	KNOWN	basic|CCDS	protein_coding	SCN9A	HGNC	protein_coding	OTTHUMT00000333639.1	339	0.00	0	C	NM_002977		167159748	167159748	-1	no_errors	ENST00000303354	ensembl	human	known	69_37n	silent	103	32.24	49	SNP	1.000	T
SEMA6C	10500	genome.wustl.edu	37	1	151109550	151109550	+	Splice_Site	SNP	C	C	A			TCGA-A1-A0SK-01A-12D-A099-09	TCGA-A1-A0SK-10A-03D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d1b43161-cbc1-4bf6-b8bb-a72a2e5e1150	2a5384f3-fec7-4265-b104-987f0718574b	g.chr1:151109550C>A	ENST00000341697.3	-	11	2448	c.757G>T	c.(757-759)Gtg>Ttg	p.V253L				Q9H3T2	SEM6C_HUMAN	sema domain, transmembrane domain (TM), and cytoplasmic domain, (semaphorin) 6C	253	Sema. {ECO:0000255|PROSITE- ProRule:PRU00352}.				axon guidance (GO:0007411)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)			central_nervous_system(2)|endometrium(1)|kidney(1)|large_intestine(5)|lung(15)|ovary(1)|prostate(1)|skin(1)|urinary_tract(1)	28	Lung SC(34;0.00471)|Ovarian(49;0.0147)|all_hematologic(923;0.0597)|Hepatocellular(266;0.0997)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0486)|LUSC - Lung squamous cell carcinoma(543;0.211)			GAGAACTGCACCTAGGGGAGG	0.602																																						dbGAP											0													50.0	49.0	49.0					1																	151109550		2203	4297	6500	-	-	-	SO:0001630	splice_region_variant	0			AF339154	CCDS984.1, CCDS53363.1, CCDS53364.1	1q21.2	2008-02-05			ENSG00000143434	ENSG00000143434		"""Semaphorins"""	10740	protein-coding gene	gene with protein product	"""m-Sema Y2"""	609294				12110693	Standard	NM_030913		Approved	KIAA1869	uc001ewv.3	Q9H3T2	OTTHUMG00000012261	ENST00000341697.3:c.757-1G>T	1.37:g.151109550C>A		Somatic		WXS	Illumina GAIIx	Phase_IV	D3DV15|Q5JR71|Q5JR72|Q5JR73|Q8WXT8|Q8WXT9|Q8WXU0|Q96JF8	Missense_Mutation	SNP	pfam_Semaphorin/CD100_Ag,pfam_Plexin_repeat,superfamily_Semaphorin/CD100_Ag,superfamily_Plexin-like_fold,smart_Semaphorin/CD100_Ag,pfscan_Semaphorin/CD100_Ag	p.V253L	ENST00000341697.3	37	c.757	CCDS984.1	1	.	.	.	.	.	.	.	.	.	.	C	24.4	4.524665	0.85600	.	.	ENSG00000143434	ENST00000368914;ENST00000368912;ENST00000368913;ENST00000341697;ENST00000392792	T;T;T;T	0.10288	2.89;2.89;2.89;2.89	4.69	4.69	0.59074	WD40/YVTN repeat-like-containing domain (1);Semaphorin/CD100 antigen (4);	0.000000	0.85682	D	0.000000	T	0.16171	0.0389	L	0.41124	1.26	0.54753	D	0.999981	P;D;P;D	0.63046	0.929;0.959;0.912;0.992	P;D;P;D	0.73380	0.666;0.949;0.661;0.98	T	0.00896	-1.1523	10	0.56958	D	0.05	.	15.1613	0.72788	0.0:1.0:0.0:0.0	.	253;213;253;253	B4DZD4;Q9H3T2-2;Q9H3T2-3;Q9H3T2	.;.;.;SEM6C_HUMAN	L	253;213;253;253;253	ENSP00000357910:V253L;ENSP00000357908:V213L;ENSP00000357909:V253L;ENSP00000344148:V253L	ENSP00000344148:V253L	V	-	1	0	SEMA6C	149376174	1.000000	0.71417	1.000000	0.80357	0.890000	0.51754	5.844000	0.69430	2.434000	0.82447	0.561000	0.74099	GTG	SEMA6C	-	pfam_Semaphorin/CD100_Ag,superfamily_Semaphorin/CD100_Ag,smart_Semaphorin/CD100_Ag,pfscan_Semaphorin/CD100_Ag	ENSG00000143434		0.602	SEMA6C-004	KNOWN	alternative_5_UTR|mRNA_start_NF|basic|CCDS	protein_coding	SEMA6C	HGNC	protein_coding	OTTHUMT00000034074.1	58	0.00	0	C	NM_030913	Missense_Mutation	151109550	151109550	-1	no_errors	ENST00000368913	ensembl	human	known	69_37n	missense	46	32.35	22	SNP	1.000	A
SERTAD3	29946	genome.wustl.edu	37	19	40947651	40947651	+	Missense_Mutation	SNP	G	G	C			TCGA-A1-A0SK-01A-12D-A099-09	TCGA-A1-A0SK-10A-03D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d1b43161-cbc1-4bf6-b8bb-a72a2e5e1150	2a5384f3-fec7-4265-b104-987f0718574b	g.chr19:40947651G>C	ENST00000322354.3	-	2	833	c.337C>G	c.(337-339)Cag>Gag	p.Q113E	SERTAD3_ENST00000601217.1_5'Flank|CTC-492K19.4_ENST00000599050.1_RNA|SERTAD3_ENST00000392028.4_Missense_Mutation_p.Q113E	NM_203344.2	NP_976219.1	Q9UJW9	SRTD3_HUMAN	SERTA domain containing 3	113					negative regulation of cell growth (GO:0030308)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)				kidney(1)|large_intestine(4)|lung(2)	7			Lung(22;6.24e-05)|LUSC - Lung squamous cell carcinoma(20;0.000384)			ACTGGATTCTGAGGGGGCTCA	0.597																																						dbGAP											0													51.0	55.0	53.0					19																	40947651		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF192529	CCDS12558.1	19q13.2	2008-02-05				ENSG00000167565			17931	protein-coding gene	gene with protein product	"""RPA-binding trans-activator"""	612125				10982866, 11331592	Standard	NM_013368		Approved	RBT1	uc002onv.4	Q9UJW9		ENST00000322354.3:c.337C>G	19.37:g.40947651G>C	ENSP00000325414:p.Gln113Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KQB3|Q96CQ2	Missense_Mutation	SNP	pfam_SERTA,pfscan_SERTA	p.Q113E	ENST00000322354.3	37	c.337	CCDS12558.1	19	.	.	.	.	.	.	.	.	.	.	G	4.453	0.083825	0.08583	.	.	ENSG00000167565	ENST00000322354;ENST00000392028	.	.	.	5.34	5.34	0.76211	.	0.797162	0.11186	N	0.590417	T	0.23094	0.0558	N	0.08118	0	0.28335	N	0.921605	B	0.27559	0.181	B	0.24155	0.051	T	0.02009	-1.1230	9	0.06236	T	0.91	0.0062	14.9085	0.70737	0.0:0.0:1.0:0.0	.	113	Q9UJW9	SRTD3_HUMAN	E	113	.	ENSP00000325414:Q113E	Q	-	1	0	SERTAD3	45639491	0.530000	0.26330	0.040000	0.18447	0.061000	0.15899	1.879000	0.39618	2.672000	0.90937	0.655000	0.94253	CAG	SERTAD3	-	NULL	ENSG00000167565		0.597	SERTAD3-001	KNOWN	upstream_uORF|basic|appris_principal|CCDS	protein_coding	SERTAD3	HGNC	protein_coding	OTTHUMT00000462573.1	120	0.00	0	G	NM_013368		40947651	40947651	-1	no_errors	ENST00000322354	ensembl	human	known	69_37n	missense	75	11.76	10	SNP	0.844	C
SHPK	23729	genome.wustl.edu	37	17	3518763	3518763	+	Missense_Mutation	SNP	G	G	C			TCGA-A1-A0SK-01A-12D-A099-09	TCGA-A1-A0SK-10A-03D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d1b43161-cbc1-4bf6-b8bb-a72a2e5e1150	2a5384f3-fec7-4265-b104-987f0718574b	g.chr17:3518763G>C	ENST00000225519.3	-	6	994	c.892C>G	c.(892-894)Cca>Gca	p.P298A		NM_013276.2	NP_037408	Q9UHJ6	SHPK_HUMAN	sedoheptulokinase	298					carbohydrate metabolic process (GO:0005975)|cellular response to interleukin-13 (GO:0035963)|cellular response to interleukin-4 (GO:0071353)|cellular response to lipopolysaccharide (GO:0071222)|pentose-phosphate shunt, non-oxidative branch (GO:0009052)|phosphorylation (GO:0016310)|regulation of inflammatory response (GO:0050727)|regulation of macrophage activation (GO:0043030)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|sedoheptulokinase activity (GO:0050277)			breast(1)|endometrium(1)|large_intestine(2)|lung(6)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	16				COAD - Colon adenocarcinoma(5;0.0828)		GTAGGGTCTGGAGTCTGTGCA	0.607																																						dbGAP											0													84.0	73.0	77.0					17																	3518763		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF163573	CCDS11030.1	17p13	2008-02-08	2008-02-08	2008-02-08	ENSG00000197417	ENSG00000197417	2.7.1.14		1492	protein-coding gene	gene with protein product		605060	"""carbohydrate kinase-like"""	CARKL		10673275, 18186520	Standard	NM_013276		Approved	SHK	uc002fvz.1	Q9UHJ6	OTTHUMG00000090694	ENST00000225519.3:c.892C>G	17.37:g.3518763G>C	ENSP00000225519:p.Pro298Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R640|Q8WUH3	Missense_Mutation	SNP	pfam_Carb_kinase_FGGY_N	p.P298A	ENST00000225519.3	37	c.892	CCDS11030.1	17	.	.	.	.	.	.	.	.	.	.	G	11.83	1.755843	0.31046	.	.	ENSG00000197417	ENST00000225519	T	0.14893	2.47	5.33	4.34	0.51931	.	0.153967	0.64402	N	0.000014	T	0.18800	0.0451	L	0.53671	1.685	0.52501	D	0.999956	B	0.02656	0.0	B	0.08055	0.003	T	0.02844	-1.1103	10	0.27082	T	0.32	-3.8653	15.6235	0.76829	0.0:0.1376:0.8624:0.0	.	298	Q9UHJ6	SHPK_HUMAN	A	298	ENSP00000225519:P298A	ENSP00000225519:P298A	P	-	1	0	SHPK	3465512	1.000000	0.71417	1.000000	0.80357	0.147000	0.21601	7.202000	0.77856	1.373000	0.46208	0.650000	0.86243	CCA	SHPK	-	NULL	ENSG00000197417		0.607	SHPK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SHPK	HGNC	protein_coding	OTTHUMT00000207378.2	282	0.00	0	G			3518763	3518763	-1	no_errors	ENST00000225519	ensembl	human	known	69_37n	missense	23	77.67	80	SNP	1.000	C
SHROOM2	357	genome.wustl.edu	37	X	9914857	9914857	+	Silent	SNP	C	C	T			TCGA-A1-A0SK-01A-12D-A099-09	TCGA-A1-A0SK-10A-03D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d1b43161-cbc1-4bf6-b8bb-a72a2e5e1150	2a5384f3-fec7-4265-b104-987f0718574b	g.chrX:9914857C>T	ENST00000380913.3	+	10	4821	c.4731C>T	c.(4729-4731)caC>caT	p.H1577H	SHROOM2_ENST00000418909.2_Silent_p.H412H	NM_001649.2	NP_001640.1	Q13796	SHRM2_HUMAN	shroom family member 2	1577	ASD2. {ECO:0000255|PROSITE- ProRule:PRU00638}.				apical protein localization (GO:0045176)|brain development (GO:0007420)|camera-type eye development (GO:0043010)|camera-type eye morphogenesis (GO:0048593)|cell migration (GO:0016477)|cell-cell junction maintenance (GO:0045217)|cellular pigment accumulation (GO:0043482)|ear development (GO:0043583)|establishment of melanosome localization (GO:0032401)|eye pigment granule organization (GO:0008057)|lens morphogenesis in camera-type eye (GO:0002089)|melanosome organization (GO:0032438)|negative regulation of actin filament depolymerization (GO:0030835)|sodium ion transmembrane transport (GO:0035725)	apical plasma membrane (GO:0016324)|cell cortex (GO:0005938)|cell-cell adherens junction (GO:0005913)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|filamentous actin (GO:0031941)|microtubule (GO:0005874)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|tight junction (GO:0005923)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|beta-catenin binding (GO:0008013)|ligand-gated sodium channel activity (GO:0015280)			breast(4)|central_nervous_system(2)|cervix(3)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(13)|ovary(3)|prostate(3)|skin(6)|upper_aerodigestive_tract(2)	57		Hepatocellular(5;0.000888)				ACTATGAGCACTTCGTGAAGA	0.547																																						dbGAP											0													46.0	38.0	40.0					X																	9914857		2203	4299	6502	-	-	-	SO:0001819	synonymous_variant	0			X83543	CCDS14135.1	Xp22.3	2008-02-05	2006-07-20	2006-07-20	ENSG00000146950	ENSG00000146950			630	protein-coding gene	gene with protein product		300103	"""apical protein, Xenopus laevis-like"", ""apical protein-like (Xenopus laevis)"""	APXL		7795590, 16615870	Standard	NM_001649		Approved		uc004csu.1	Q13796	OTTHUMG00000021121	ENST00000380913.3:c.4731C>T	X.37:g.9914857C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B9EIQ7	Silent	SNP	pfam_ASD2,pfam_ASD1,pfam_PDZ,superfamily_PDZ,smart_PDZ,pfscan_PDZ	p.H1577	ENST00000380913.3	37	c.4731	CCDS14135.1	X																																																																																			SHROOM2	-	pfam_ASD2	ENSG00000146950		0.547	SHROOM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SHROOM2	HGNC	protein_coding	OTTHUMT00000055721.1	159	0.00	0	C	NM_001649		9914857	9914857	+1	no_errors	ENST00000380913	ensembl	human	known	69_37n	silent	106	43.01	80	SNP	1.000	T
SIGLEC11	114132	genome.wustl.edu	37	19	50462687	50462687	+	Silent	SNP	T	T	C	rs200227828	byFrequency	TCGA-A1-A0SK-01A-12D-A099-09	TCGA-A1-A0SK-10A-03D-A099-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d1b43161-cbc1-4bf6-b8bb-a72a2e5e1150	2a5384f3-fec7-4265-b104-987f0718574b	g.chr19:50462687T>C	ENST00000447370.2	-	5	1077	c.987A>G	c.(985-987)tcA>tcG	p.S329S	CTC-326K19.6_ENST00000451973.1_5'Flank|SIGLEC11_ENST00000426971.2_Silent_p.S329S	NM_052884.2	NP_443116.2	Q96RL6	SIG11_HUMAN	sialic acid binding Ig-like lectin 11	329	Ig-like C2-type 2.				cell adhesion (GO:0007155)	integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)			breast(1)|central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(8)|lung(9)|ovary(6)|pancreas(1)|prostate(1)|skin(1)	32		all_lung(116;0.00318)|all_neural(266;0.107)|Ovarian(192;0.17)		GBM - Glioblastoma multiforme(134;0.00107)|OV - Ovarian serous cystadenocarcinoma(262;0.00517)		TGTAGCGCCCTGAATCCCCGG	0.677													T|||	483	0.0964457	0.0	0.0216	5008	,	,		11815	0.2232		0.005	False		,,,				2504	0.2434					dbGAP											0																																										-	-	-	SO:0001819	synonymous_variant	0			AF337818	CCDS12790.2, CCDS46150.1	19q13.3	2013-01-29			ENSG00000161640	ENSG00000161640		"""Sialic acid binding Ig-like lectins"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	15622	protein-coding gene	gene with protein product		607157				11986327	Standard	NM_052884		Approved		uc010ybi.2	Q96RL6	OTTHUMG00000157077	ENST00000447370.2:c.987A>G	19.37:g.50462687T>C		Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_CD80_C2-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	p.Q319R	ENST00000447370.2	37	c.956	CCDS12790.2	19	.	.	.	.	.	.	.	.	.	.	T	0.047	-1.264304	0.01433	.	.	ENSG00000161640	ENST00000426971	.	.	.	1.61	-3.23	0.05109	.	.	.	.	.	T	0.19927	0.0479	.	.	.	0.49299	P	2.2200000000005549E-4	.	.	.	.	.	.	T	0.27905	-1.0060	3	.	.	.	.	2.6446	0.04980	0.2383:0.4434:0.0:0.3183	.	.	.	.	R	319	.	.	Q	-	2	0	SIGLEC11	55154499	0.004000	0.15560	0.102000	0.21198	0.024000	0.10985	-1.022000	0.03611	-1.003000	0.03425	-0.343000	0.07986	CAG	SIGLEC11	-	pfam_Ig_I-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	ENSG00000161640		0.677	SIGLEC11-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SIGLEC11	HGNC	protein_coding	OTTHUMT00000347382.1	27	0.00	0	T	NM_052884		50462687	50462687	-1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000426971	ensembl	human	novel	69_37n	missense	22	36.11	13	SNP	0.137	C
SLITRK4	139065	genome.wustl.edu	37	X	142716453	142716453	+	Nonsense_Mutation	SNP	G	G	C			TCGA-A1-A0SK-01A-12D-A099-09	TCGA-A1-A0SK-10A-03D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d1b43161-cbc1-4bf6-b8bb-a72a2e5e1150	2a5384f3-fec7-4265-b104-987f0718574b	g.chrX:142716453G>C	ENST00000381779.4	-	2	2697	c.2472C>G	c.(2470-2472)taC>taG	p.Y824*	SLITRK4_ENST00000356928.1_Nonsense_Mutation_p.Y824*|SLITRK4_ENST00000338017.4_Nonsense_Mutation_p.Y824*	NM_001184749.2|NM_001184750.1|NM_173078.4	NP_001171678.1|NP_001171679.1|NP_775101.1	Q8IW52	SLIK4_HUMAN	SLIT and NTRK-like family, member 4	824						integral component of membrane (GO:0016021)				autonomic_ganglia(1)|breast(1)|endometrium(6)|kidney(2)|large_intestine(11)|lung(27)|ovary(2)|pancreas(2)|prostate(4)|skin(2)|upper_aerodigestive_tract(2)	60	Acute lymphoblastic leukemia(192;6.56e-05)					GGACCTGTAGGTAGTCAGGGG	0.403																																						dbGAP											0													118.0	103.0	108.0					X																	142716453		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			BC040986	CCDS14679.1	Xq27.3	2004-06-23			ENSG00000179542	ENSG00000179542			23502	protein-coding gene	gene with protein product		300562				14557068	Standard	NM_001184749		Approved	DKFZp547M2010	uc004fby.3	Q8IW52	OTTHUMG00000022580	ENST00000381779.4:c.2472C>G	X.37:g.142716453G>C	ENSP00000371198:p.Tyr824*	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5JXG3|Q8TCM8|Q96DL3	Nonsense_Mutation	SNP	pfam_Leu-rich_rpt,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C	p.Y824*	ENST00000381779.4	37	c.2472	CCDS14679.1	X	.	.	.	.	.	.	.	.	.	.	G	41	8.621589	0.98888	.	.	ENSG00000179542	ENST00000381779;ENST00000356928;ENST00000338017	.	.	.	5.36	5.36	0.76844	.	0.000000	0.64402	U	0.000003	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-5.7321	16.6088	0.84838	0.0:0.0:1.0:0.0	.	.	.	.	X	824	.	ENSP00000336627:Y824X	Y	-	3	2	SLITRK4	142544119	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.801000	0.75170	2.236000	0.73375	0.529000	0.55759	TAC	SLITRK4	-	NULL	ENSG00000179542		0.403	SLITRK4-201	KNOWN	basic|appris_principal|CCDS	protein_coding	SLITRK4	HGNC	protein_coding	OTTHUMT00000058617.1	238	0.00	0	G	NM_173078		142716453	142716453	-1	no_errors	ENST00000338017	ensembl	human	known	69_37n	nonsense	127	36.50	73	SNP	1.000	C
SLITRK4	139065	genome.wustl.edu	37	X	142718044	142718044	+	Missense_Mutation	SNP	G	G	A			TCGA-A1-A0SK-01A-12D-A099-09	TCGA-A1-A0SK-10A-03D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d1b43161-cbc1-4bf6-b8bb-a72a2e5e1150	2a5384f3-fec7-4265-b104-987f0718574b	g.chrX:142718044G>A	ENST00000381779.4	-	2	1106	c.881C>T	c.(880-882)aCa>aTa	p.T294I	SLITRK4_ENST00000356928.1_Missense_Mutation_p.T294I|SLITRK4_ENST00000338017.4_Missense_Mutation_p.T294I	NM_001184749.2|NM_001184750.1|NM_173078.4	NP_001171678.1|NP_001171679.1|NP_775101.1	Q8IW52	SLIK4_HUMAN	SLIT and NTRK-like family, member 4	294						integral component of membrane (GO:0016021)				autonomic_ganglia(1)|breast(1)|endometrium(6)|kidney(2)|large_intestine(11)|lung(27)|ovary(2)|pancreas(2)|prostate(4)|skin(2)|upper_aerodigestive_tract(2)	60	Acute lymphoblastic leukemia(192;6.56e-05)					GTGTAAAGATGTTTGGGTAGT	0.483																																						dbGAP											0													160.0	141.0	147.0					X																	142718044		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC040986	CCDS14679.1	Xq27.3	2004-06-23			ENSG00000179542	ENSG00000179542			23502	protein-coding gene	gene with protein product		300562				14557068	Standard	NM_001184749		Approved	DKFZp547M2010	uc004fby.3	Q8IW52	OTTHUMG00000022580	ENST00000381779.4:c.881C>T	X.37:g.142718044G>A	ENSP00000371198:p.Thr294Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5JXG3|Q8TCM8|Q96DL3	Missense_Mutation	SNP	pfam_Leu-rich_rpt,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C	p.T294I	ENST00000381779.4	37	c.881	CCDS14679.1	X	.	.	.	.	.	.	.	.	.	.	G	4.888	0.165040	0.09339	.	.	ENSG00000179542	ENST00000381779;ENST00000356928;ENST00000338017	T;T;T	0.53423	0.62;0.62;0.62	5.88	5.02	0.67125	.	0.114996	0.56097	D	0.000022	T	0.35770	0.0943	N	0.25890	0.77	0.47905	D	0.999549	B	0.25007	0.116	B	0.25987	0.065	T	0.10042	-1.0647	10	0.30854	T	0.27	-7.344	12.9155	0.58203	0.0804:0.0:0.9196:0.0	.	294	Q8IW52	SLIK4_HUMAN	I	294	ENSP00000371198:T294I;ENSP00000349400:T294I;ENSP00000336627:T294I	ENSP00000336627:T294I	T	-	2	0	SLITRK4	142545710	1.000000	0.71417	0.748000	0.31131	0.234000	0.25298	5.292000	0.65673	1.232000	0.43678	-0.208000	0.12717	ACA	SLITRK4	-	NULL	ENSG00000179542		0.483	SLITRK4-201	KNOWN	basic|appris_principal|CCDS	protein_coding	SLITRK4	HGNC	protein_coding	OTTHUMT00000058617.1	297	0.00	0	G	NM_173078		142718044	142718044	-1	no_errors	ENST00000338017	ensembl	human	known	69_37n	missense	97	38.51	62	SNP	0.992	A
SMPD4	55627	genome.wustl.edu	37	2	130914346	130914346	+	Intron	SNP	G	G	T	rs113975436	byFrequency	TCGA-A1-A0SK-01A-12D-A099-09	TCGA-A1-A0SK-10A-03D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d1b43161-cbc1-4bf6-b8bb-a72a2e5e1150	2a5384f3-fec7-4265-b104-987f0718574b	g.chr2:130914346G>T	ENST00000409031.1	-	13	2363				SMPD4_ENST00000431183.2_Intron|SMPD4_ENST00000473720.1_Intron|SMPD4_ENST00000443958.2_Intron|SMPD4_ENST00000339679.7_Intron|SMPD4_ENST00000452225.2_Intron|SMPD4_ENST00000351288.6_Intron|SMPD4_ENST00000453750.1_Intron|SMPD4_ENST00000426662.2_Intron	NM_017951.4	NP_060421.2	Q9NXE4	NSMA3_HUMAN	sphingomyelin phosphodiesterase 4, neutral membrane (neutral sphingomyelinase-3)						cellular response to tumor necrosis factor (GO:0071356)|ceramide biosynthetic process (GO:0046513)|glycerophospholipid catabolic process (GO:0046475)|glycosphingolipid metabolic process (GO:0006687)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)|sphingomyelin catabolic process (GO:0006685)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|trans-Golgi network (GO:0005802)	metal ion binding (GO:0046872)|sphingomyelin phosphodiesterase activity (GO:0004767)|sphingomyelin phosphodiesterase D activity (GO:0050290)			breast(2)|central_nervous_system(1)|endometrium(3)|large_intestine(2)|lung(17)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	29	Colorectal(110;0.1)				Phosphatidylserine(DB00144)	TGGCTCCGCCGGGGGAGAGCA	0.617													.|||	293	0.0585064	0.2118	0.0187	5008	,	,		18276	0.0		0.0	False		,,,				2504	0.0					dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			AF052134	CCDS2156.2, CCDS42751.1, CCDS54398.1	2q21.1	2009-11-06			ENSG00000136699	ENSG00000136699			32949	protein-coding gene	gene with protein product		610457				16517606	Standard	NM_001171083		Approved	FLJ20297, FLJ20756, nSMase-3, KIAA1418, NSMASE3, NET13	uc002tqr.2	Q9NXE4	OTTHUMG00000131624	ENST00000409031.1:c.1215-98C>A	2.37:g.130914346G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B4DM23|B4DQ31|B4DRB8|B4DWK7|B4E0L6|E7ESA2|E9PCE6|Q6FI76|Q6P1P7|Q6ZT43|Q9H0M2|Q9NW20|Q9NWL2|Q9P2C9	Silent	SNP	NULL	p.P247	ENST00000409031.1	37	c.741	CCDS42751.1	2																																																																																			SMPD4	-	NULL	ENSG00000136699		0.617	SMPD4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SMPD4	HGNC	protein_coding	OTTHUMT00000254516.3	42	0.00	0	G	NM_017751		130914346	130914346	-1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000439886	ensembl	human	novel	69_37n	silent	27	18.18	6	SNP	0.003	T
JMJD4	65094	genome.wustl.edu	37	1	227920447	227920447	+	Intron	SNP	C	C	T	rs751748	byFrequency	TCGA-A1-A0SK-01A-12D-A099-09	TCGA-A1-A0SK-10A-03D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d1b43161-cbc1-4bf6-b8bb-a72a2e5e1150	2a5384f3-fec7-4265-b104-987f0718574b	g.chr1:227920447C>T	ENST00000366758.3	-	6	1107				JMJD4_ENST00000438896.2_Intron|SNAP47_ENST00000366760.1_Intron|SNAP47_ENST00000315781.5_5'Flank|SNAP47_ENST00000366759.4_5'Flank|SNAP47_ENST00000480897.1_3'UTR|JMJD4_ENST00000485807.1_Intron	NM_023007.2	NP_075383.2	Q9H9V9	JMJD4_HUMAN	jumonji domain containing 4											endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(2)|ovary(1)|prostate(1)|skin(1)	9		Prostate(94;0.0885)				ACCCGACATGCGCCCAGTCCC	0.582													c|||	881	0.175919	0.1445	0.2723	5008	,	,		21127	0.2093		0.1531	False		,,,				2504	0.1391					dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			AK022579	CCDS1561.1, CCDS59203.1	1q42.13	2008-02-05			ENSG00000081692	ENSG00000081692			25724	protein-coding gene	gene with protein product						12477932	Standard	NM_023007		Approved	FLJ12517	uc001hrb.3	Q9H9V9	OTTHUMG00000037698	ENST00000366758.3:c.1108-70G>A	1.37:g.227920447C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q5TBZ1|Q5TBZ6|Q9H970	RNA	SNP	-	NULL	ENST00000366758.3	37	NULL	CCDS1561.1	1																																																																																			SNAP47	-	-	ENSG00000143740		0.582	JMJD4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SNAP47	HGNC	protein_coding	OTTHUMT00000091970.1	62	0.00	0	C	NM_023007		227920447	227920447	+1	no_errors	ENST00000480265	ensembl	human	known	69_37n	rna	104	11.86	14	SNP	0.000	T
SPPL2B	56928	genome.wustl.edu	37	19	2339888	2339888	+	RNA	SNP	C	C	T	rs372155490		TCGA-A1-A0SK-01A-12D-A099-09	TCGA-A1-A0SK-10A-03D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d1b43161-cbc1-4bf6-b8bb-a72a2e5e1150	2a5384f3-fec7-4265-b104-987f0718574b	g.chr19:2339888C>T	ENST00000452401.2	+	0	745							Q8TCT7	SPP2B_HUMAN	signal peptide peptidase like 2B						membrane protein ectodomain proteolysis (GO:0006509)|membrane protein intracellular domain proteolysis (GO:0031293)|regulation of immune response (GO:0050776)	endosome membrane (GO:0010008)|Golgi-associated vesicle membrane (GO:0030660)|integral component of cytoplasmic side of endoplasmic reticulum membrane (GO:0071458)|integral component of lumenal side of endoplasmic reticulum membrane (GO:0071556)|lysosomal membrane (GO:0005765)|plasma membrane (GO:0005886)	aspartic endopeptidase activity, intramembrane cleaving (GO:0042500)|protein homodimerization activity (GO:0042803)						Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		GTGGACGTGACGCCGGTGATG	0.642																																						dbGAP											0													140.0	164.0	156.0					19																	2339888		2195	4287	6482	-	-	-			0				CCDS74252.1, CCDS74253.1	19p13.3	2012-02-21			ENSG00000005206	ENSG00000005206			30627	protein-coding gene	gene with protein product	"""intramembrane protease 4"""	608239				10819331	Standard	NM_001077238		Approved	IMP4, PSL1, KIAA1532	uc002lvs.3	Q8TCT7			19.37:g.2339888C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	D6W609|O60365|Q567S3|Q8IUH9|Q9BUY6|Q9H3M4|Q9NPN2|Q9P1Z6	RNA	SNP	-	NULL	ENST00000452401.2	37	NULL		19	.	.	.	.	.	.	.	.	.	.	C	15.56	2.869958	0.51588	.	.	ENSG00000005206	ENST00000452401;ENST00000382189	.	.	.	4.09	4.09	0.47781	.	0.100977	0.64402	D	0.000002	T	0.81460	0.4827	M	0.88906	2.99	0.50813	D	0.999895	D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;0.998	D;D;D;D;D;D	0.75484	0.973;0.98;0.957;0.977;0.986;0.94	D	0.87477	0.2418	8	0.87932	D	0	-38.2629	15.0275	0.71680	0.0:1.0:0.0:0.0	.	222;222;222;222;222;222	Q8TCT7-4;A6NFV1;Q8TCT7-3;Q8TCT7-2;Q8TCT7;C9JFE6	.;.;.;.;PSL1_HUMAN;.	M	222	.	ENSP00000371624:T222M	T	+	2	0	AC004410.1	2290888	1.000000	0.71417	0.998000	0.56505	0.334000	0.28698	4.272000	0.58908	2.107000	0.64212	0.561000	0.74099	ACG	SPPL2B	-	-	ENSG00000005206		0.642	SPPL2B-202	KNOWN	basic	processed_transcript	SPPL2B	HGNC	processed_transcript		525	0.19	1	C	NM_020172		2339888	2339888	+1	no_errors	ENST00000382189	ensembl	human	known	69_37n	rna	15	65.12	28	SNP	1.000	T
SPRY1	10252	genome.wustl.edu	37	4	124323702	124323702	+	Nonsense_Mutation	SNP	C	C	G			TCGA-A1-A0SK-01A-12D-A099-09	TCGA-A1-A0SK-10A-03D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d1b43161-cbc1-4bf6-b8bb-a72a2e5e1150	2a5384f3-fec7-4265-b104-987f0718574b	g.chr4:124323702C>G	ENST00000394339.2	+	2	1296	c.956C>G	c.(955-957)tCa>tGa	p.S319*	SPRY1_ENST00000339241.1_Nonsense_Mutation_p.S319*	NM_001258039.1|NM_005841.2	NP_001244968.1|NP_005832.1	O43609	SPY1_HUMAN	sprouty homolog 1, antagonist of FGF signaling (Drosophila)	319					epidermal growth factor receptor signaling pathway (GO:0007173)|multicellular organismal development (GO:0007275)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)	cytosol (GO:0005829)|plasma membrane (GO:0005886)				NS(1)|large_intestine(4)|lung(2)|ovary(1)|skin(3)	11						GGTAAACCATCATGATTTTTG	0.428																																						dbGAP											0													68.0	71.0	70.0					4																	124323702		2186	4284	6470	-	-	-	SO:0001587	stop_gained	0			AF041037	CCDS3731.1	4q	2009-04-17	2001-11-28		ENSG00000164056	ENSG00000164056			11269	protein-coding gene	gene with protein product		602465	"""sprouty (Drosophila) homolog 1 (antagonist of FGF signaling)"""			9458049, 15962011	Standard	NM_001258038		Approved	hSPRY1	uc003ifa.4	O43609	OTTHUMG00000133071	ENST00000394339.2:c.956C>G	4.37:g.124323702C>G	ENSP00000377871:p.Ser319*	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DNX6|Q6PNE0	Nonsense_Mutation	SNP	pfam_Sprouty	p.S319*	ENST00000394339.2	37	c.956	CCDS3731.1	4	.	.	.	.	.	.	.	.	.	.	C	35	5.467854	0.96257	.	.	ENSG00000164056	ENST00000339241;ENST00000394339	.	.	.	5.06	4.22	0.49857	.	0.105108	0.39834	N	0.001246	.	.	.	.	.	.	0.34295	D	0.683686	.	.	.	.	.	.	.	.	.	.	.	.	.	.	12.9358	0.58313	0.0:0.922:0.0:0.078	.	.	.	.	X	319	.	.	S	+	2	0	SPRY1	124543152	1.000000	0.71417	0.990000	0.47175	0.976000	0.68499	3.093000	0.50217	1.357000	0.45904	0.561000	0.74099	TCA	SPRY1	-	NULL	ENSG00000164056		0.428	SPRY1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPRY1	HGNC	protein_coding	OTTHUMT00000256711.1	42	0.00	0	C			124323702	124323702	+1	no_errors	ENST00000339241	ensembl	human	known	69_37n	nonsense	98	14.66	17	SNP	1.000	G
SRRM2	23524	genome.wustl.edu	37	16	2816674	2816674	+	Missense_Mutation	SNP	G	G	C			TCGA-A1-A0SK-01A-12D-A099-09	TCGA-A1-A0SK-10A-03D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d1b43161-cbc1-4bf6-b8bb-a72a2e5e1150	2a5384f3-fec7-4265-b104-987f0718574b	g.chr16:2816674G>C	ENST00000301740.8	+	11	6694	c.6145G>C	c.(6145-6147)Gct>Cct	p.A2049P		NM_016333.3	NP_057417.3	Q9UQ35	SRRM2_HUMAN	serine/arginine repetitive matrix 2	2049	Arg-rich.|Ser-rich.				mRNA splicing, via spliceosome (GO:0000398)	Cajal body (GO:0015030)|catalytic step 2 spliceosome (GO:0071013)|nuclear speck (GO:0016607)|nucleus (GO:0005634)	C2H2 zinc finger domain binding (GO:0070742)|poly(A) RNA binding (GO:0044822)|protein N-terminus binding (GO:0047485)			breast(3)|central_nervous_system(1)|cervix(3)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(20)|lung(34)|ovary(6)|pancreas(3)|prostate(2)|skin(6)|upper_aerodigestive_tract(3)|urinary_tract(7)	105						CTCACCACTTGCTATCCGCCG	0.602																																						dbGAP											0													70.0	56.0	61.0					16																	2816674		2198	4300	6498	-	-	-	SO:0001583	missense	0			AF201422	CCDS32373.1	16p13.3	2012-07-02			ENSG00000167978	ENSG00000167978			16639	protein-coding gene	gene with protein product		606032				10668804, 11004489	Standard	NM_016333		Approved	SRm300, SRL300, KIAA0324, Cwc21	uc002crk.3	Q9UQ35	OTTHUMG00000177358	ENST00000301740.8:c.6145G>C	16.37:g.2816674G>C	ENSP00000301740:p.Ala2049Pro	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NKB9|D3DU97|O15038|O94803|Q6NSL3|Q6PIM3|Q6PK40|Q8IW17|Q96GY7|Q9P0G1|Q9UHA8|Q9UQ36|Q9UQ37|Q9UQ38|Q9UQ40	Missense_Mutation	SNP	pfam_mRNA_splic_Cwf21	p.A2049P	ENST00000301740.8	37	c.6145	CCDS32373.1	16	.	.	.	.	.	.	.	.	.	.	G	9.759	1.169541	0.21621	.	.	ENSG00000167978	ENST00000301740;ENST00000544933	T	0.28895	1.59	5.47	4.49	0.54785	.	0.320649	0.27004	N	0.021415	T	0.24275	0.0588	N	0.08118	0	0.31660	N	0.645698	P	0.48407	0.91	P	0.49226	0.603	T	0.21314	-1.0249	10	0.51188	T	0.08	-0.068	13.8246	0.63343	0.0:0.1546:0.8454:0.0	.	2049	Q9UQ35	SRRM2_HUMAN	P	2049;1301	ENSP00000301740:A2049P	ENSP00000301740:A2049P	A	+	1	0	SRRM2	2756675	0.590000	0.26815	0.999000	0.59377	0.995000	0.86356	2.430000	0.44766	1.272000	0.44329	0.655000	0.94253	GCT	SRRM2	-	NULL	ENSG00000167978		0.602	SRRM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SRRM2	HGNC	protein_coding	OTTHUMT00000436411.1	94	0.00	0	G			2816674	2816674	+1	no_errors	ENST00000301740	ensembl	human	known	69_37n	missense	87	10.31	10	SNP	1.000	C
STXBP6	29091	genome.wustl.edu	37	14	25288513	25288513	+	Intron	SNP	C	C	T	rs872978	byFrequency	TCGA-A1-A0SK-01A-12D-A099-09	TCGA-A1-A0SK-10A-03D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d1b43161-cbc1-4bf6-b8bb-a72a2e5e1150	2a5384f3-fec7-4265-b104-987f0718574b	g.chr14:25288513C>T	ENST00000323944.5	-	5	903				STXBP6_ENST00000548724.1_Intron|STXBP6_ENST00000546511.1_Intron|STXBP6_ENST00000396700.1_Intron|STXBP6_ENST00000419632.2_Intron|STXBP6_ENST00000548369.1_Silent_p.A11A|STXBP6_ENST00000358326.2_Intron|STXBP6_ENST00000550887.1_Intron			Q8NFX7	STXB6_HUMAN	syntaxin binding protein 6 (amisyn)						negative regulation of exocytosis (GO:0045920)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)				central_nervous_system(2)|endometrium(2)|large_intestine(3)	7				GBM - Glioblastoma multiforme(265;0.0296)		GCAGAAAGGCCGCTCGTCTAG	0.527													C|||	1037	0.207069	0.472	0.0677	5008	,	,		19267	0.1766		0.0964	False		,,,				2504	0.093					dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			AF161505	CCDS9634.1	14q11.2	2002-12-18			ENSG00000168952	ENSG00000168952			19666	protein-coding gene	gene with protein product		607958				12145319	Standard	NM_014178		Approved	amisyn, HSPC156	uc001wpu.3	Q8NFX7	OTTHUMG00000140186	ENST00000323944.5:c.452-113G>A	14.37:g.25288513C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	D3DS78|Q8N3H1|Q8N8D5|Q96GF3|Q9P008	Silent	SNP	pfam_Synaptobrevin,pfscan_Synaptobrevin	p.A11	ENST00000323944.5	37	c.33	CCDS9634.1	14																																																																																			STXBP6	-	NULL	ENSG00000168952		0.527	STXBP6-006	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	STXBP6	HGNC	protein_coding	OTTHUMT00000409166.1	47	0.00	0	C			25288513	25288513	-1	no_errors	ENST00000548369	ensembl	human	known	69_37n	silent	17	32.00	8	SNP	0.000	T
TCP10	6953	genome.wustl.edu	37	6	167790053	167790053	+	Missense_Mutation	SNP	C	C	T	rs138727280		TCGA-A1-A0SK-01A-12D-A099-09	TCGA-A1-A0SK-10A-03D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d1b43161-cbc1-4bf6-b8bb-a72a2e5e1150	2a5384f3-fec7-4265-b104-987f0718574b	g.chr6:167790053C>T	ENST00000397829.4	-	5	724	c.557G>A	c.(556-558)gGg>gAg	p.G186E	TCP10_ENST00000366827.2_Missense_Mutation_p.G186E	NM_004610.3	NP_004601.3	Q12799	TCP10_HUMAN	t-complex 10	213						cytosol (GO:0005829)				NS(1)|breast(1)|central_nervous_system(1)|endometrium(2)|kidney(5)|large_intestine(2)|lung(6)	18		Breast(66;1.53e-05)|Ovarian(120;0.024)		OV - Ovarian serous cystadenocarcinoma(33;4.05e-20)|BRCA - Breast invasive adenocarcinoma(81;1.1e-06)|GBM - Glioblastoma multiforme(31;0.0386)		TTCAGACACCCCCCGTCTTTC	0.527																																						dbGAP											0													80.0	73.0	75.0					6																	167790053		1574	3143	4717	-	-	-	SO:0001583	missense	0			U03399	CCDS43527.1	6q27	2012-09-20	2012-09-20		ENSG00000203690	ENSG00000203690			11656	protein-coding gene	gene with protein product		187020	"""t-complex 10 (a murine tcp homolog)"", ""t-complex 10 (mouse)"", ""t-complex 10 homolog (mouse)"""			8111376	Standard	NM_004610		Approved		uc003qvv.1	Q12799	OTTHUMG00000016026	ENST00000397829.4:c.557G>A	6.37:g.167790053C>T	ENSP00000380929:p.Gly186Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5JR60|Q6P4F4	Missense_Mutation	SNP	NULL	p.G186E	ENST00000397829.4	37	c.557	CCDS43527.1	6	448	0.20512820512820512	77	0.1565040650406504	66	0.18232044198895028	114	0.1993006993006993	191	0.2519788918205805	c	0.004	-2.263860	0.00262	.	.	ENSG00000203690	ENST00000366827;ENST00000397829;ENST00000460930	T;T;T	0.33865	2.34;2.34;1.39	2.01	-3.34	0.04943	.	.	.	.	.	T	0.04452	0.0122	L	0.44542	1.39	0.80722	P	0.0	P;B;B	0.39809	0.689;0.033;0.003	B;B;B	0.32022	0.139;0.012;0.004	T	0.35847	-0.9772	8	0.02654	T	1	.	0.2311	0.00180	0.3417:0.212:0.2438:0.2024	.	186;213;213	D1MPS5;Q12799;Q12799-2	.;TCP10_HUMAN;.	E	186;186;182	ENSP00000355792:G186E;ENSP00000380929:G186E;ENSP00000426065:G182E	ENSP00000355792:G186E	G	-	2	0	TCP10	167710043	0.001000	0.12720	0.000000	0.03702	0.012000	0.07955	-0.399000	0.07250	-0.805000	0.04404	-0.970000	0.02610	GGG	TCP10	-	NULL	ENSG00000203690		0.527	TCP10-008	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TCP10	HGNC	protein_coding	OTTHUMT00000365570.1	93	0.00	0	C	NM_004610		167790053	167790053	-1	no_errors	ENST00000397829	ensembl	human	known	69_37n	missense	8	20.00	2	SNP	0.000	T
TCP10	6953	genome.wustl.edu	37	6	167790110	167790110	+	Missense_Mutation	SNP	C	C	T	rs201005141		TCGA-A1-A0SK-01A-12D-A099-09	TCGA-A1-A0SK-10A-03D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d1b43161-cbc1-4bf6-b8bb-a72a2e5e1150	2a5384f3-fec7-4265-b104-987f0718574b	g.chr6:167790110C>T	ENST00000397829.4	-	5	667	c.500G>A	c.(499-501)cGt>cAt	p.R167H	TCP10_ENST00000366827.2_Missense_Mutation_p.R167H	NM_004610.3	NP_004601.3	Q12799	TCP10_HUMAN	t-complex 10	194						cytosol (GO:0005829)				NS(1)|breast(1)|central_nervous_system(1)|endometrium(2)|kidney(5)|large_intestine(2)|lung(6)	18		Breast(66;1.53e-05)|Ovarian(120;0.024)		OV - Ovarian serous cystadenocarcinoma(33;4.05e-20)|BRCA - Breast invasive adenocarcinoma(81;1.1e-06)|GBM - Glioblastoma multiforme(31;0.0386)		TCTGTCTTGACGTCTCCCGGG	0.507																																						dbGAP											0													34.0	33.0	33.0					6																	167790110		1384	2863	4247	-	-	-	SO:0001583	missense	0			U03399	CCDS43527.1	6q27	2012-09-20	2012-09-20		ENSG00000203690	ENSG00000203690			11656	protein-coding gene	gene with protein product		187020	"""t-complex 10 (a murine tcp homolog)"", ""t-complex 10 (mouse)"", ""t-complex 10 homolog (mouse)"""			8111376	Standard	NM_004610		Approved		uc003qvv.1	Q12799	OTTHUMG00000016026	ENST00000397829.4:c.500G>A	6.37:g.167790110C>T	ENSP00000380929:p.Arg167His	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5JR60|Q6P4F4	Missense_Mutation	SNP	NULL	p.R167H	ENST00000397829.4	37	c.500	CCDS43527.1	6	259	0.11858974358974358	19	0.03861788617886179	43	0.11878453038674033	77	0.1346153846153846	120	0.158311345646438	C	4.738	0.137311	0.09032	.	.	ENSG00000203690	ENST00000366827;ENST00000397829;ENST00000460930	T;T;T	0.46063	2.31;2.31;0.88	2.01	-3.81	0.04294	.	.	.	.	.	T	0.05823	0.0152	N	0.22421	0.69	0.80722	P	0.0	B;B;B	0.10296	0.0;0.001;0.003	B;B;B	0.04013	0.0;0.001;0.001	T	0.33445	-0.9868	8	0.14656	T	0.56	.	0.1293	0.00072	0.3461:0.2399:0.1818:0.2322	.	167;194;194	D1MPS5;Q12799;Q12799-2	.;TCP10_HUMAN;.	H	167;167;163	ENSP00000355792:R167H;ENSP00000380929:R167H;ENSP00000426065:R163H	ENSP00000355792:R167H	R	-	2	0	TCP10	167710100	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	0.003000	0.13083	-1.001000	0.03434	-1.021000	0.02439	CGT	TCP10	-	NULL	ENSG00000203690		0.507	TCP10-008	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TCP10	HGNC	protein_coding	OTTHUMT00000365570.1	93	0.00	0	C	NM_004610		167790110	167790110	-1	no_errors	ENST00000397829	ensembl	human	known	69_37n	missense	13	23.53	4	SNP	0.001	T
TECTA	7007	genome.wustl.edu	37	11	121008612	121008612	+	Missense_Mutation	SNP	G	G	C			TCGA-A1-A0SK-01A-12D-A099-09	TCGA-A1-A0SK-10A-03D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d1b43161-cbc1-4bf6-b8bb-a72a2e5e1150	2a5384f3-fec7-4265-b104-987f0718574b	g.chr11:121008612G>C	ENST00000392793.1	+	11	3695	c.3424G>C	c.(3424-3426)Gtt>Ctt	p.V1142L	TECTA_ENST00000264037.2_Missense_Mutation_p.V1142L			O75443	TECTA_HUMAN	tectorin alpha	1142	VWFD 3. {ECO:0000255|PROSITE- ProRule:PRU00580}.				cell-matrix adhesion (GO:0007160)|sensory perception of sound (GO:0007605)	anchored component of membrane (GO:0031225)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)			TECTA/TBCEL(2)	NS(1)|breast(9)|central_nervous_system(1)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(38)|liver(1)|lung(46)|ovary(3)|prostate(4)|skin(6)|upper_aerodigestive_tract(3)|urinary_tract(1)	135	all_hematologic(175;0.208)	Breast(109;0.000766)|Medulloblastoma(222;0.0427)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;8.04e-06)|OV - Ovarian serous cystadenocarcinoma(223;0.166)		CCCCAAGTTTGTTGTCACAGC	0.567																																						dbGAP											0													92.0	71.0	78.0					11																	121008612		2203	4299	6502	-	-	-	SO:0001583	missense	0			AF055136	CCDS8434.1	11q22-q24	2008-02-05			ENSG00000109927	ENSG00000109927			11720	protein-coding gene	gene with protein product		602574		DFNA12, DFNA8, DFNB21		9503015, 9590290	Standard	NM_005422		Approved		uc010rzo.2	O75443	OTTHUMG00000149908	ENST00000392793.1:c.3424G>C	11.37:g.121008612G>C	ENSP00000376543:p.Val1142Leu	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_VWF_type-D,pfam_Unchr_dom_Cys-rich,pfam_Zona_pellucida_Endoglin/CD105,pfam_Nidogen_extracell_dom,pfam_TIL_dom,superfamily_TIL_dom,smart_Nidogen_extracell_dom,smart_VWC_out,smart_VWF_type-D,smart_Unchr_dom_Cys-rich,smart_EGF-like,smart_Zona_pellucida_Endoglin/CD105,pfscan_Zona_pellucida_Endoglin/CD105	p.V1142L	ENST00000392793.1	37	c.3424	CCDS8434.1	11	.	.	.	.	.	.	.	.	.	.	G	7.547	0.661886	0.14645	.	.	ENSG00000109927	ENST00000392793;ENST00000264037	T;T	0.60171	0.21;0.21	4.63	0.651	0.17817	von Willebrand factor, type D domain (3);	0.627633	0.16002	N	0.234261	T	0.34106	0.0886	N	0.12182	0.205	0.09310	N	0.999997	B	0.02656	0.0	B	0.06405	0.002	T	0.16100	-1.0414	10	0.30854	T	0.27	.	8.4832	0.33057	0.7609:0.0:0.2391:0.0	.	1142	O75443	TECTA_HUMAN	L	1142	ENSP00000376543:V1142L;ENSP00000264037:V1142L	ENSP00000264037:V1142L	V	+	1	0	TECTA	120513822	0.014000	0.17966	0.613000	0.29037	0.335000	0.28730	0.579000	0.23788	-0.047000	0.13423	-0.290000	0.09829	GTT	TECTA	-	pfam_VWF_type-D,smart_VWF_type-D	ENSG00000109927		0.567	TECTA-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	TECTA	HGNC	protein_coding	OTTHUMT00000313850.1	235	0.00	0	G	NM_005422		121008612	121008612	+1	no_errors	ENST00000264037	ensembl	human	known	69_37n	missense	34	46.03	29	SNP	0.410	C
TEN1	100134934	genome.wustl.edu	37	17	73987652	73987652	+	Silent	SNP	C	C	T	rs10852767	byFrequency	TCGA-A1-A0SK-01A-12D-A099-09	TCGA-A1-A0SK-10A-03D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d1b43161-cbc1-4bf6-b8bb-a72a2e5e1150	2a5384f3-fec7-4265-b104-987f0718574b	g.chr17:73987652C>T	ENST00000397640.1	+	3	496	c.198C>T	c.(196-198)caC>caT	p.H66H	TEN1_ENST00000416485.1_Silent_p.H65H|TEN1-CDK3_ENST00000567351.1_RNA|TEN1_ENST00000588202.1_Silent_p.H66H	NM_001113324.2	NP_001106795.2	Q86WV5	TEN1L_HUMAN	TEN1 CST complex subunit	66						nuclear chromosome, telomeric region (GO:0000784)|nucleus (GO:0005634)|Stn1-Ten1 complex (GO:0070188)	single-stranded DNA binding (GO:0003697)			breast(1)	1						AGCCCTTCCACGCCCAGGTGG	0.587													C|||	947	0.189097	0.5991	0.0879	5008	,	,		18980	0.0089		0.0577	False		,,,				2504	0.0276					dbGAP											0													134.0	110.0	117.0					17																	73987652		692	1591	2283	-	-	-	SO:0001819	synonymous_variant	0				CCDS45780.1, CCDS45780.2	17q25.1	2013-05-23	2013-05-23	2011-06-14	ENSG00000257949	ENSG00000257949			37242	protein-coding gene	gene with protein product		613130	"""chromosome 17 open reading frame 106"", ""TEN1 telomerase capping complex subunit homolog (S. cerevisiae)"""	C17orf106		19854130	Standard	NM_001113324		Approved	FLJ39785		Q86WV5	OTTHUMG00000132686	ENST00000397640.1:c.198C>T	17.37:g.73987652C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	I3L0C7	Silent	SNP	NULL	p.H66	ENST00000397640.1	37	c.198	CCDS45780.2	17																																																																																			TEN1	-	NULL	ENSG00000257949		0.587	TEN1-001	KNOWN	basic|CCDS	protein_coding	TEN1	HGNC	protein_coding	OTTHUMT00000255983.1	300	0.00	0	C	NM_001113324		73987652	73987652	+1	no_errors	ENST00000397640	ensembl	human	known	69_37n	silent	62	17.33	13	SNP	0.974	T
TEX11	56159	genome.wustl.edu	37	X	69749698	69749698	+	Missense_Mutation	SNP	C	C	T			TCGA-A1-A0SK-01A-12D-A099-09	TCGA-A1-A0SK-10A-03D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d1b43161-cbc1-4bf6-b8bb-a72a2e5e1150	2a5384f3-fec7-4265-b104-987f0718574b	g.chrX:69749698C>T	ENST00000395889.2	-	30	2872	c.2717G>A	c.(2716-2718)aGc>aAc	p.S906N	TEX11_ENST00000374320.2_Missense_Mutation_p.S581N|TEX11_ENST00000374333.2_Missense_Mutation_p.S891N|TEX11_ENST00000344304.3_Missense_Mutation_p.S906N	NM_001003811.1	NP_001003811.1	Q8IYF3	TEX11_HUMAN	testis expressed 11	906					chiasma assembly (GO:0051026)|fertilization (GO:0009566)|male gonad development (GO:0008584)|male meiosis chromosome segregation (GO:0007060)|meiotic gene conversion (GO:0006311)|negative regulation of apoptotic process (GO:0043066)|reciprocal meiotic recombination (GO:0007131)|resolution of meiotic recombination intermediates (GO:0000712)|synaptonemal complex assembly (GO:0007130)	central element (GO:0000801)				breast(4)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(12)|lung(13)|ovary(3)|prostate(3)|skin(3)	48	Renal(35;0.156)					AGTTTCATAGCTTTCCTTGAA	0.522																																						dbGAP											0													88.0	60.0	69.0					X																	69749698		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF285594	CCDS35323.1, CCDS43968.1	Xp11	2008-02-05	2007-03-13		ENSG00000120498	ENSG00000120498			11733	protein-coding gene	gene with protein product		300311	"""testis expressed sequence 11"""			11279525	Standard	NM_001003811		Approved	TSGA3, TGC1	uc004dyl.3	Q8IYF3	OTTHUMG00000021782	ENST00000395889.2:c.2717G>A	X.37:g.69749698C>T	ENSP00000379226:p.Ser906Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K8V6|Q5JQQ8|Q96LZ4|Q96M47|Q9BXU6	Missense_Mutation	SNP	pfam_Meiosis_specific_SPO22,smart_TPR_repeat	p.S906N	ENST00000395889.2	37	c.2717	CCDS35323.1	X	.	.	.	.	.	.	.	.	.	.	C	0.069	-1.205650	0.01568	.	.	ENSG00000120498	ENST00000374333;ENST00000395889;ENST00000374320;ENST00000344304	T;T;T;T	0.46819	1.44;1.44;0.86;1.44	4.33	-8.66	0.00866	.	0.273238	0.33515	N	0.004836	T	0.13670	0.0331	N	0.04724	-0.175	0.09310	N	1	B;B	0.14012	0.009;0.005	B;B	0.11329	0.006;0.002	T	0.22173	-1.0224	9	.	.	.	7.4964	0.5949	0.00734	0.2679:0.1268:0.2639:0.3415	.	891;906	Q8IYF3-3;Q8IYF3	.;TEX11_HUMAN	N	891;906;581;906	ENSP00000363453:S891N;ENSP00000379226:S906N;ENSP00000363440:S581N;ENSP00000340995:S906N	.	S	-	2	0	TEX11	69666423	0.001000	0.12720	0.000000	0.03702	0.187000	0.23431	-1.977000	0.01495	-3.752000	0.00111	-1.484000	0.00983	AGC	TEX11	-	NULL	ENSG00000120498		0.522	TEX11-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TEX11	HGNC	protein_coding	OTTHUMT00000359072.1	367	0.00	0	C			69749698	69749698	-1	no_errors	ENST00000344304	ensembl	human	known	69_37n	missense	106	15.87	20	SNP	0.000	T
TNFAIP2	7127	genome.wustl.edu	37	14	103592944	103592946	+	In_Frame_Del	DEL	GAA	GAA	-	rs142147196|rs368270988		TCGA-A1-A0SK-01A-12D-A099-09	TCGA-A1-A0SK-10A-03D-A099-09	GAA	GAA					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d1b43161-cbc1-4bf6-b8bb-a72a2e5e1150	2a5384f3-fec7-4265-b104-987f0718574b	g.chr14:103592944_103592946delGAA	ENST00000560869.1	+	2	789_791	c.150_152delGAA	c.(148-153)gggaag>ggg	p.K54del	TNFAIP2_ENST00000333007.1_In_Frame_Del_p.K54del|TNFAIP2_ENST00000451723.2_5'Flank			Q03169	TNAP2_HUMAN	tumor necrosis factor, alpha-induced protein 2	54	Lys-rich (basic).				angiogenesis (GO:0001525)|cell differentiation (GO:0030154)|exocytosis (GO:0006887)	exocyst (GO:0000145)|extracellular space (GO:0005615)				NS(1)|breast(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(4)|prostate(1)|upper_aerodigestive_tract(1)	11		Melanoma(154;0.155)	Epithelial(46;0.191)			TCACCAAAGGGAAGAAGAAGAAG	0.616																																						dbGAP											0										48,4048		9,30,2009						2.3	1.0			16	128,7958		16,96,3931	no	coding	TNFAIP2	NM_006291.2		25,126,5940	A1A1,A1R,RR		1.583,1.1719,1.4448				176,12006				-	-	-	SO:0001651	inframe_deletion	0				CCDS9979.1	14q32	2011-01-31				ENSG00000185215			11895	protein-coding gene	gene with protein product	"""exocyst complex component 3-like 3"""	603300				1374453	Standard	NM_006291		Approved	B94, EXOC3L3	uc001ymm.1	Q03169		ENST00000560869.1:c.150_152delGAA	14.37:g.103592953_103592955delGAA	ENSP00000452634:p.Lys54del	Somatic		WXS	Illumina GAIIx	Phase_IV	Q86VI0	In_Frame_Del	DEL	pfam_Sec6	p.K54in_frame_del	ENST00000560869.1	37	c.150_152	CCDS9979.1	14																																																																																			TNFAIP2	-	NULL	ENSG00000185215		0.616	TNFAIP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TNFAIP2	HGNC	protein_coding	OTTHUMT00000415674.1	39	0.00	0	GAA	NM_006291		103592944	103592946	+1	no_errors	ENST00000333007	ensembl	human	known	69_37n	in_frame_del	23	11.54	3	DEL	0.977:0.957:0.888	-
TP53	7157	genome.wustl.edu	37	17	7578532	7578532	+	Missense_Mutation	SNP	A	A	T	rs28934873		TCGA-A1-A0SK-01A-12D-A099-09	TCGA-A1-A0SK-10A-03D-A099-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d1b43161-cbc1-4bf6-b8bb-a72a2e5e1150	2a5384f3-fec7-4265-b104-987f0718574b	g.chr17:7578532A>T	ENST00000269305.4	-	5	587	c.398T>A	c.(397-399)aTg>aAg	p.M133K	TP53_ENST00000420246.2_Missense_Mutation_p.M133K|TP53_ENST00000359597.4_Missense_Mutation_p.M133K|TP53_ENST00000413465.2_Missense_Mutation_p.M133K|TP53_ENST00000455263.2_Missense_Mutation_p.M133K|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000445888.2_Missense_Mutation_p.M133K	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	133	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		KM -> NL (in a sporadic cancer; somatic mutation).|M -> I (in sporadic cancers; somatic mutation).|M -> K (in sporadic cancers; somatic mutation).|M -> L (in sporadic cancers; somatic mutation).|M -> R (in LFS; germline mutation and in sporadic cancers; somatic mutation).|M -> T (in LFS; germline mutation and in sporadic cancers; somatic mutation; dbSNP:rs28934873). {ECO:0000269|PubMed:1933902}.|M -> V (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.M133K(12)|p.0?(8)|p.M133R(5)|p.N131fs*27(2)|p.M133T(2)|p.V73fs*9(1)|p.M133fs*37(1)|p.S127fs*36(1)|p.Y126fs*11(1)|p.K132_A138delKMFCQLA(1)|p.S127_Q136del10(1)|p.L130_M133delLNKM(1)|p.M133fs*13(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	TTGGCAAAACATCTTGTTGAG	0.562		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	dbGAP	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	37	Substitution - Missense(19)|Whole gene deletion(8)|Deletion - Frameshift(7)|Deletion - In frame(3)	haematopoietic_and_lymphoid_tissue(7)|oesophagus(5)|stomach(4)|central_nervous_system(4)|bone(4)|urinary_tract(3)|breast(3)|large_intestine(2)|adrenal_gland(1)|liver(1)|lung(1)|prostate(1)|pancreas(1)	GRCh37	CM910373|CM973400	TP53	M	rs28934873						48.0	49.0	48.0					17																	7578532		2203	4300	6503	-	-	-	SO:0001583	missense	0	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.398T>A	17.37:g.7578532A>T	ENSP00000269305:p.Met133Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	pfam_p53_DNA-bd,pfam_p53_tetrameristn,pfam_p53_transactivation_domain,superfamily_p53-like_TF_DNA-bd,superfamily_p53_tetrameristn,prints_p53_tumour_suppressor	p.M133K	ENST00000269305.4	37	c.398	CCDS11118.1	17	.	.	.	.	.	.	.	.	.	.	A	19.47	3.834113	0.71373	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944;ENST00000414315;ENST00000508793	D;D;D;D;D;D;D;D;D	0.99771	-6.71;-6.71;-6.71;-6.71;-6.71;-6.71;-6.71;-6.71;-6.71	5.48	5.48	0.80851	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.072317	0.56097	D	0.000036	D	0.99048	0.9674	N	0.08118	0	0.43874	D	0.996482	D;B;B;P;B;B;D	0.62365	0.991;0.006;0.005;0.805;0.002;0.007;0.989	P;B;B;P;B;B;P	0.59643	0.861;0.102;0.058;0.733;0.078;0.165;0.849	D	0.98945	1.0792	10	0.87932	D	0	-10.9959	13.8301	0.63375	1.0:0.0:0.0:0.0	.	94;133;133;40;133;133;133	B4E095;P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;.;P53_HUMAN;.;.	K	133;133;133;133;133;133;122;40;1;40;1;133	ENSP00000410739:M133K;ENSP00000352610:M133K;ENSP00000269305:M133K;ENSP00000398846:M133K;ENSP00000391127:M133K;ENSP00000391478:M133K;ENSP00000425104:M1K;ENSP00000423862:M40K;ENSP00000424104:M133K	ENSP00000269305:M133K	M	-	2	0	TP53	7519257	1.000000	0.71417	0.997000	0.53966	0.797000	0.45037	9.283000	0.95860	2.206000	0.71126	0.533000	0.62120	ATG	TP53	-	pfam_p53_DNA-bd,superfamily_p53-like_TF_DNA-bd,prints_p53_tumour_suppressor	ENSG00000141510		0.562	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	HGNC	protein_coding	OTTHUMT00000367397.1	204	0.00	0	A	NM_000546		7578532	7578532	-1	no_errors	ENST00000269305	ensembl	human	known	69_37n	missense	3	92.68	38	SNP	1.000	T
TPSAB1	7177	genome.wustl.edu	37	16	1291622	1291622	+	Missense_Mutation	SNP	A	A	G	rs149113013	byFrequency	TCGA-A1-A0SK-01A-12D-A099-09	TCGA-A1-A0SK-10A-03D-A099-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d1b43161-cbc1-4bf6-b8bb-a72a2e5e1150	2a5384f3-fec7-4265-b104-987f0718574b	g.chr16:1291622A>G	ENST00000338844.3	+	4	454	c.421A>G	c.(421-423)Acc>Gcc	p.T141A	TPSAB1_ENST00000461509.2_Missense_Mutation_p.T148A	NM_003294.3	NP_003285.2	Q15661	TRYB1_HUMAN	tryptase alpha/beta 1	141	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.		T -> A (in dbSNP:rs1800992). {ECO:0000269|PubMed:10898108}.|T -> M (in allele alpha).		defense response (GO:0006952)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)			NS(2)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|lung(4)|skin(1)	10		Hepatocellular(780;0.00369)				CCACACGGTCACCCTGCCCCC	0.662													A|||	1009	0.201478	0.2874	0.2695	5008	,	,		17793	0.1171		0.1918	False		,,,				2504	0.1339					dbGAP											0													30.0	25.0	26.0					16																	1291622		2198	4297	6495	-	-	-	SO:0001583	missense	0			M33494	CCDS10431.1	16p13.3	2009-11-13	2004-10-14	2004-10-15	ENSG00000172236	ENSG00000172236			12019	protein-coding gene	gene with protein product	"""tryptase alpha II"", ""tryptase beta I"", ""tryptase-I"", ""tryptase-II"", ""tryptase-III"""	191080	"""tryptase beta 1"""	TPSB1, TPS1, TPS2		2203827, 9920877	Standard	NM_003294		Approved		uc002ckz.3	Q15661	OTTHUMG00000090467	ENST00000338844.3:c.421A>G	16.37:g.1291622A>G	ENSP00000343577:p.Thr141Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	D2E6R9|D2E6S1|P15157|Q15663|Q6B052|Q9H2Y4|Q9H2Y5|Q9UQI1	Missense_Mutation	SNP	pfam_Peptidase_S1_S6,superfamily_Pept_cys/ser_Trypsin-like,smart_Peptidase_S1_S6,pfscan_Peptidase_S1_S6,prints_Peptidase_S1A	p.T141A	ENST00000338844.3	37	c.421	CCDS10431.1	16	448	0.20512820512820512	154	0.3130081300813008	86	0.23756906077348067	75	0.13111888111888112	133	0.17546174142480211	A	0.171	-1.071903	0.01918	.	.	ENSG00000172236	ENST00000338844;ENST00000461509	T;T	0.80994	-1.44;-1.44	3.74	0.17	0.15021	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	0.872655	0.09671	N	0.771165	T	0.00012	0.0000	N	0.03268	-0.37	0.45477	P	0.0015540000000000553	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.001	T	0.06463	-1.0825	9	0.33141	T	0.24	.	7.8036	0.29189	0.3416:0.0:0.0:0.6584	.	132;141	Q15661-2;Q15661	.;TRYB1_HUMAN	A	141;148	ENSP00000343577:T141A;ENSP00000418247:T148A	ENSP00000343577:T141A	T	+	1	0	TPSAB1	1231623	0.000000	0.05858	0.458000	0.27068	0.169000	0.22640	0.545000	0.23268	0.161000	0.19458	0.392000	0.25879	ACC	TPSAB1	-	pfam_Peptidase_S1_S6,superfamily_Pept_cys/ser_Trypsin-like,smart_Peptidase_S1_S6,pfscan_Peptidase_S1_S6	ENSG00000172236		0.662	TPSAB1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	TPSAB1	HGNC	protein_coding	OTTHUMT00000206914.1	90	0.00	0	A	NM_003294		1291622	1291622	+1	no_errors	ENST00000562675	ensembl	human	known	69_37n	missense	83	11.00	11	SNP	0.983	G
TROAP	10024	genome.wustl.edu	37	12	49717675	49717675	+	Silent	SNP	T	T	C			TCGA-A1-A0SK-01A-12D-A099-09	TCGA-A1-A0SK-10A-03D-A099-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d1b43161-cbc1-4bf6-b8bb-a72a2e5e1150	2a5384f3-fec7-4265-b104-987f0718574b	g.chr12:49717675T>C	ENST00000257909.3	+	3	268	c.192T>C	c.(190-192)gaT>gaC	p.D64D	TROAP_ENST00000549534.1_3'UTR|TROAP_ENST00000380327.5_Silent_p.D64D|TROAP_ENST00000549275.1_Intron|TROAP_ENST00000550709.1_Silent_p.D64D|TROAP_ENST00000547923.1_5'Flank|RP11-161H23.9_ENST00000553259.1_RNA|TROAP_ENST00000551245.1_Silent_p.D64D|TROAP_ENST00000548311.1_Silent_p.D64D	NM_005480.3	NP_005471.3	Q12815	TROAP_HUMAN	trophinin associated protein	64					cell adhesion (GO:0007155)	cytoplasm (GO:0005737)				breast(1)|endometrium(1)|kidney(2)|large_intestine(4)|lung(14)|ovary(1)|prostate(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(4)	32						CCCTCGTTGATTCAGCAGGCC	0.567																																						dbGAP											0													78.0	80.0	80.0					12																	49717675		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			U04810	CCDS8784.1, CCDS41779.1, CCDS61117.1	12q13.12	2012-10-17	2012-10-17		ENSG00000135451	ENSG00000135451			12327	protein-coding gene	gene with protein product	"""tastin"""	603872				7758945	Standard	NM_005480		Approved	TASTIN	uc001rtx.4	Q12815	OTTHUMG00000169486	ENST00000257909.3:c.192T>C	12.37:g.49717675T>C		Somatic		WXS	Illumina GAIIx	Phase_IV	F8VSF9|Q6PJU7|Q8N5B2	Silent	SNP	NULL	p.D64	ENST00000257909.3	37	c.192	CCDS8784.1	12																																																																																			TROAP	-	NULL	ENSG00000135451		0.567	TROAP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TROAP	HGNC	protein_coding	OTTHUMT00000404300.1	108	0.00	0	T	NM_005480		49717675	49717675	+1	no_errors	ENST00000257909	ensembl	human	known	69_37n	silent	57	42.00	42	SNP	0.002	C
UGT2B17	7367	genome.wustl.edu	37	4	69416556	69416556	+	Silent	SNP	T	T	C	rs13102139		TCGA-A1-A0SK-01A-12D-A099-09	TCGA-A1-A0SK-10A-03D-A099-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d1b43161-cbc1-4bf6-b8bb-a72a2e5e1150	2a5384f3-fec7-4265-b104-987f0718574b	g.chr4:69416556T>C	ENST00000317746.2	-	5	1194	c.1152A>G	c.(1150-1152)gcA>gcG	p.A384A		NM_001077.3	NP_001068.1	O75795	UDB17_HUMAN	UDP glucuronosyltransferase 2 family, polypeptide B17	384					cellular glucuronidation (GO:0052695)|steroid metabolic process (GO:0008202)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	glucuronosyltransferase activity (GO:0015020)			central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(7)|lung(14)|ovary(2)|prostate(1)	30					Losartan(DB00678)	CATGGTAGATTGCCTCATAGA	0.428																																					Melanoma(18;649 833 28984 37818 38500)	dbGAP											0													143.0	105.0	118.0					4																	69416556		2108	3990	6098	-	-	-	SO:0001819	synonymous_variant	0			U59209	CCDS3523.1	4q13	2008-02-05	2005-07-20		ENSG00000197888	ENSG00000197888		"""UDP glucuronosyltransferases"""	12547	protein-coding gene	gene with protein product		601903	"""UDP glycosyltransferase 2 family, polypeptide B17"""			8798464	Standard	NM_001077		Approved		uc021xov.1	O75795	OTTHUMG00000129305	ENST00000317746.2:c.1152A>G	4.37:g.69416556T>C		Somatic		WXS	Illumina GAIIx	Phase_IV		Silent	SNP	pfam_UDP_glucos_trans,pfam_Glyco_trans_28_C	p.A384	ENST00000317746.2	37	c.1152	CCDS3523.1	4																																																																																			UGT2B17	-	pfam_UDP_glucos_trans,pfam_Glyco_trans_28_C	ENSG00000197888		0.428	UGT2B17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UGT2B17	HGNC	protein_coding	OTTHUMT00000251436.1	134	0.00	0	T	NM_001077		69416556	69416556	-1	no_errors	ENST00000317746	ensembl	human	known	69_37n	silent	45	15.09	8	SNP	0.720	C
UGT2B15	7366	genome.wustl.edu	37	4	69533861	69533861	+	Nonsense_Mutation	SNP	C	C	T			TCGA-A1-A0SK-01A-12D-A099-09	TCGA-A1-A0SK-10A-03D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d1b43161-cbc1-4bf6-b8bb-a72a2e5e1150	2a5384f3-fec7-4265-b104-987f0718574b	g.chr4:69533861C>T	ENST00000338206.5	-	2	779	c.770G>A	c.(769-771)tGg>tAg	p.W257*		NM_001076.3	NP_001067.2	P54855	UDB15_HUMAN	UDP glucuronosyltransferase 2 family, polypeptide B15	257					cellular glucuronidation (GO:0052695)|steroid metabolic process (GO:0008202)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	glucuronosyltransferase activity (GO:0015020)									Acetaminophen(DB00316)|Dabigatran etexilate(DB06695)|Ezetimibe(DB00973)|Lorazepam(DB00186)|Morphine(DB00295)|Oxazepam(DB00842)|Valproic Acid(DB00313)	TCGAATGAGCCACATTTCAGC	0.393																																						dbGAP											0													84.0	91.0	89.0					4																	69533861		2202	4280	6482	-	-	-	SO:0001587	stop_gained	0			AF180322	CCDS3524.1	4q13	2008-02-05	2005-07-20		ENSG00000196620	ENSG00000196620		"""UDP glucuronosyltransferases"""	12546	protein-coding gene	gene with protein product		600069	"""UDP glycosyltransferase 2 family, polypeptide B15"""			7835904	Standard	NM_001076		Approved	UGT2B8	uc021xow.1	P54855	OTTHUMG00000161507	ENST00000338206.5:c.770G>A	4.37:g.69533861C>T	ENSP00000341045:p.Trp257*	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NDX0|A6NNJ4|A8K054|P23765|Q9UK63	Nonsense_Mutation	SNP	pfam_UDP_glucos_trans,pfam_Glyco_trans_28_C	p.W257*	ENST00000338206.5	37	c.770	CCDS3524.1	4	.	.	.	.	.	.	.	.	.	.	c	25.0	4.595516	0.86953	.	.	ENSG00000196620	ENST00000338206	.	.	.	2.44	2.44	0.29823	.	0.000000	0.64402	U	0.000001	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	10.5504	0.45085	0.0:1.0:0.0:0.0	.	.	.	.	X	257	.	ENSP00000341045:W257X	W	-	2	0	UGT2B15	69216456	1.000000	0.71417	0.610000	0.28997	0.756000	0.42949	6.700000	0.74619	1.352000	0.45808	0.305000	0.20034	TGG	UGT2B15	-	pfam_UDP_glucos_trans	ENSG00000196620		0.393	UGT2B15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UGT2B15	HGNC	protein_coding	OTTHUMT00000365172.1	223	0.00	0	C	NM_001076		69533861	69533861	-1	no_errors	ENST00000338206	ensembl	human	known	69_37n	nonsense	139	21.47	38	SNP	1.000	T
UNC5D	137970	genome.wustl.edu	37	8	35584005	35584005	+	Missense_Mutation	SNP	G	G	T	rs77054671		TCGA-A1-A0SK-01A-12D-A099-09	TCGA-A1-A0SK-10A-03D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d1b43161-cbc1-4bf6-b8bb-a72a2e5e1150	2a5384f3-fec7-4265-b104-987f0718574b	g.chr8:35584005G>T	ENST00000404895.2	+	10	1967	c.1639G>T	c.(1639-1641)Gtc>Ttc	p.V547F	UNC5D_ENST00000449677.1_Missense_Mutation_p.V123F|UNC5D_ENST00000287272.2_Missense_Mutation_p.V478F|UNC5D_ENST00000420357.1_Missense_Mutation_p.V480F|UNC5D_ENST00000416672.1_Missense_Mutation_p.V552F|UNC5D_ENST00000453357.2_Missense_Mutation_p.V542F	NM_080872.2	NP_543148.2	Q6UXZ4	UNC5D_HUMAN	unc-5 homolog D (C. elegans)	547	ZU5. {ECO:0000255|PROSITE- ProRule:PRU00485}.				apoptotic process (GO:0006915)|axon guidance (GO:0007411)|pyramidal neuron differentiation (GO:0021859)|regulation of neuron migration (GO:2001222)|signal transduction (GO:0007165)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)				NS(2)|breast(7)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(14)|lung(56)|ovary(3)|pancreas(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(6)|urinary_tract(2)	112				READ - Rectum adenocarcinoma(1;1.31e-05)|Colorectal(1;0.000723)		GACAACTGGTGTCTTTGGCCA	0.413																																						dbGAP											0													152.0	154.0	153.0					8																	35584005		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB055056	CCDS6093.2	8p12	2013-01-11			ENSG00000156687	ENSG00000156687		"""Immunoglobulin superfamily / I-set domain containing"""	18634	protein-coding gene	gene with protein product						18402767	Standard	NM_080872		Approved	KIAA1777, Unc5h4	uc003xjr.2	Q6UXZ4	OTTHUMG00000157145	ENST00000404895.2:c.1639G>T	8.37:g.35584005G>T	ENSP00000385143:p.Val547Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8WYP7	Missense_Mutation	SNP	pfam_ZU5,pfam_Ig_I-set,pfam_Thrombospondin_1_rpt,pfam_Death,pfam_Immunoglobulin,superfamily_DEATH-like,superfamily_Thrombospondin_1_rpt,smart_Ig_sub,smart_Ig_sub2,smart_Thrombospondin_1_rpt,smart_ZU5,smart_Death,pfscan_Thrombospondin_1_rpt,pfscan_ZU5,pfscan_Ig-like	p.V547F	ENST00000404895.2	37	c.1639	CCDS6093.2	8	.	.	.	.	.	.	.	.	.	.	G	17.39	3.377704	0.61735	.	.	ENSG00000156687	ENST00000404895;ENST00000420357;ENST00000287272;ENST00000416672;ENST00000453357;ENST00000449677	T;T;T;T;T;T	0.45276	0.9;0.9;0.9;0.9;0.9;0.9	5.71	4.84	0.62591	ZU5 (2);	0.245822	0.40908	D	0.000985	T	0.38321	0.1036	L	0.44542	1.39	0.39372	D	0.966101	P;P;P;P	0.43542	0.81;0.81;0.773;0.81	P;P;B;P	0.44860	0.462;0.462;0.332;0.462	T	0.39014	-0.9634	10	0.87932	D	0	-21.6467	7.5475	0.27775	0.1408:0.2485:0.6107:0.0	.	123;552;542;547	E9PDS8;C9J2B6;Q6UXZ4-2;Q6UXZ4	.;.;.;UNC5D_HUMAN	F	547;480;478;552;542;123	ENSP00000385143:V547F;ENSP00000392739:V480F;ENSP00000287272:V478F;ENSP00000412652:V552F;ENSP00000394303:V542F;ENSP00000397211:V123F	ENSP00000287272:V478F	V	+	1	0	UNC5D	35703547	1.000000	0.71417	0.999000	0.59377	0.867000	0.49689	1.473000	0.35387	1.430000	0.47334	-0.251000	0.11542	GTC	UNC5D	-	pfam_ZU5,smart_ZU5,pfscan_ZU5	ENSG00000156687		0.413	UNC5D-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	UNC5D	HGNC	protein_coding	OTTHUMT00000347586.2	286	0.00	0	G			35584005	35584005	+1	no_errors	ENST00000404895	ensembl	human	known	69_37n	missense	204	32.67	99	SNP	0.994	T
USH2A	7399	genome.wustl.edu	37	1	215848217	215848217	+	Missense_Mutation	SNP	G	G	T			TCGA-A1-A0SK-01A-12D-A099-09	TCGA-A1-A0SK-10A-03D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d1b43161-cbc1-4bf6-b8bb-a72a2e5e1150	2a5384f3-fec7-4265-b104-987f0718574b	g.chr1:215848217G>T	ENST00000307340.3	-	63	13422	c.13036C>A	c.(13036-13038)Ccc>Acc	p.P4346T	USH2A_ENST00000366943.2_Missense_Mutation_p.P4346T	NM_206933.2	NP_996816	O75445	USH2A_HUMAN	Usher syndrome 2A (autosomal recessive, mild)	4346	Fibronectin type-III 28. {ECO:0000255|PROSITE-ProRule:PRU00316}.				hair cell differentiation (GO:0035315)|inner ear receptor cell differentiation (GO:0060113)|maintenance of organ identity (GO:0048496)|photoreceptor cell maintenance (GO:0045494)|response to stimulus (GO:0050896)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	apical plasma membrane (GO:0016324)|basement membrane (GO:0005604)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|stereocilia ankle link complex (GO:0002142)|stereocilium bundle (GO:0032421)|stereocilium membrane (GO:0060171)	collagen binding (GO:0005518)|myosin binding (GO:0017022)			NS(7)|breast(20)|central_nervous_system(3)|cervix(2)|endometrium(32)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(71)|liver(2)|lung(282)|ovary(25)|pancreas(2)|prostate(12)|skin(22)|stomach(7)|upper_aerodigestive_tract(20)|urinary_tract(3)	527				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)		ATGCTGGTGGGTTTGCTGGTG	0.512										HNSCC(13;0.011)																												dbGAP											0													70.0	70.0	70.0					1																	215848217		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF055580	CCDS1516.1, CCDS31025.1	1q41	2013-02-11			ENSG00000042781	ENSG00000042781		"""Fibronectin type III domain containing"""	12601	protein-coding gene	gene with protein product	"""usherin"""	608400		USH2		9624053, 10729113	Standard	NM_007123		Approved	RP39	uc001hku.1	O75445	OTTHUMG00000037079	ENST00000307340.3:c.13036C>A	1.37:g.215848217G>T	ENSP00000305941:p.Pro4346Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5VVM9|Q6S362|Q9NS27	Missense_Mutation	SNP	pfam_Fibronectin_type3,pfam_EGF_laminin,pfam_Laminin_G,superfamily_ConA-like_lec_gl,superfamily_Fibronectin_type3,smart_LamG-like,smart_Laminin_N,smart_EGF_laminin,smart_Fibronectin_type3,smart_Laminin_G,pfscan_EGF_laminin,pfscan_Fibronectin_type3,pfscan_Laminin_G,pfscan_Laminin_N	p.P4346T	ENST00000307340.3	37	c.13036	CCDS31025.1	1	.	.	.	.	.	.	.	.	.	.	G	8.631	0.893729	0.17613	.	.	ENSG00000042781	ENST00000307340;ENST00000366943	T;T	0.55234	0.54;0.53	5.12	0.501	0.16925	Fibronectin, type III (3);Immunoglobulin-like fold (1);	0.635768	0.12739	N	0.443226	T	0.41328	0.1154	L	0.52364	1.645	0.09310	N	1	B	0.11235	0.004	B	0.12156	0.007	T	0.29058	-1.0024	10	0.21540	T	0.41	.	7.5293	0.27674	0.0685:0.3277:0.4998:0.104	.	4346	O75445	USH2A_HUMAN	T	4346	ENSP00000305941:P4346T;ENSP00000355910:P4346T	ENSP00000305941:P4346T	P	-	1	0	USH2A	213914840	0.085000	0.21516	0.002000	0.10522	0.946000	0.59487	0.857000	0.27831	0.170000	0.19704	-0.362000	0.07510	CCC	USH2A	-	superfamily_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000042781		0.512	USH2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	USH2A	HGNC	protein_coding	OTTHUMT00000128138.1	197	0.00	0	G	NM_007123		215848217	215848217	-1	no_errors	ENST00000366943	ensembl	human	known	69_37n	missense	77	40.77	53	SNP	0.002	T
VIT	5212	genome.wustl.edu	37	2	37010495	37010497	+	In_Frame_Del	DEL	AAG	AAG	-	rs374739571		TCGA-A1-A0SK-01A-12D-A099-09	TCGA-A1-A0SK-10A-03D-A099-09	AAG	AAG					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d1b43161-cbc1-4bf6-b8bb-a72a2e5e1150	2a5384f3-fec7-4265-b104-987f0718574b	g.chr2:37010495_37010497delAAG	ENST00000389975.3	+	10	1117_1119	c.815_817delAAG	c.(814-819)aaagaa>aaa	p.E274del	VIT_ENST00000404084.1_In_Frame_Del_p.E226del|VIT_ENST00000401530.1_Intron|VIT_ENST00000379241.3_In_Frame_Del_p.E252del|VIT_ENST00000497382.1_5'UTR|VIT_ENST00000379242.3_In_Frame_Del_p.E289del	NM_001177969.1|NM_001177970.1	NP_001171440.1|NP_001171441.1	Q6UXI7	VITRN_HUMAN	vitrin	274					extracellular matrix organization (GO:0030198)|positive regulation of cell-substrate adhesion (GO:0010811)	interstitial matrix (GO:0005614)	glycosaminoglycan binding (GO:0005539)	p.E288*(1)		autonomic_ganglia(1)|breast(3)|endometrium(18)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|lung(15)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	57		all_hematologic(82;0.248)				CTTGTTCCAAAAGAAGAATTGAG	0.448																																						dbGAP											1	Substitution - Nonsense(1)	large_intestine(1)																																								-	-	-	SO:0001651	inframe_deletion	0			AF063833	CCDS33180.1, CCDS54347.1, CCDS54348.1, CCDS54349.1, CCDS54350.1	2p22.2	2008-05-15			ENSG00000205221	ENSG00000205221			12697	protein-coding gene	gene with protein product							Standard	NM_001177969		Approved		uc002rpl.3	Q6UXI7	OTTHUMG00000152149	ENST00000389975.3:c.815_817delAAG	2.37:g.37010498_37010500delAAG	ENSP00000374625:p.Glu274del	Somatic		WXS	Illumina GAIIx	Phase_IV	A1A526|A6NKI9|A8K7Y4|E9PF47|Q6P7T3|Q96DM8|Q96DT1|Q9UDN0	In_Frame_Del	DEL	pfam_VWF_A,pfam_LCCL,superfamily_LCCL,smart_LCCL,smart_VWF_A,pfscan_LCCL,pfscan_VWF_A	p.E289in_frame_del	ENST00000389975.3	37	c.860_862	CCDS54347.1	2																																																																																			VIT	-	NULL	ENSG00000205221		0.448	VIT-201	KNOWN	basic|appris_candidate|CCDS	protein_coding	VIT	HGNC	protein_coding		210	0.00	0	AAG			37010495	37010497	+1	no_errors	ENST00000379242	ensembl	human	known	69_37n	in_frame_del	126	37.80	79	DEL	1.000:0.995:1.000	-
YIPF7	285525	genome.wustl.edu	37	4	44626655	44626655	+	Missense_Mutation	SNP	C	C	T			TCGA-A1-A0SK-01A-12D-A099-09	TCGA-A1-A0SK-10A-03D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d1b43161-cbc1-4bf6-b8bb-a72a2e5e1150	2a5384f3-fec7-4265-b104-987f0718574b	g.chr4:44626655C>T	ENST00000332990.5	-	5	659	c.643G>A	c.(643-645)Gtc>Atc	p.V215I	YIPF7_ENST00000415895.4_Missense_Mutation_p.V191I	NM_182592.2	NP_872398.2	Q8N8F6	YIPF7_HUMAN	Yip1 domain family, member 7	215						endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)				breast(1)|large_intestine(1)|lung(9)|upper_aerodigestive_tract(1)	12						GACAGGATGACCATGGGGAGC	0.547																																						dbGAP											0													55.0	61.0	59.0					4																	44626655		2108	4234	6342	-	-	-	SO:0001583	missense	0			AK096895	CCDS54766.1	4p13	2008-08-07			ENSG00000177752	ENSG00000177752		"""Yip1 domain family"""	26825	protein-coding gene	gene with protein product							Standard	NM_182592		Approved	FLJ39576, FinGER9	uc021xnx.1	Q8N8F6	OTTHUMG00000160467	ENST00000332990.5:c.643G>A	4.37:g.44626655C>T	ENSP00000332772:p.Val215Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	Q3SY21|Q3SY22	Missense_Mutation	SNP	pfam_Yip1	p.V215I	ENST00000332990.5	37	c.643	CCDS54766.1	4	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	13.91|13.91	2.378585|2.378585	0.42207|0.42207	.|.	.|.	ENSG00000177752|ENSG00000177752	ENST00000415895|ENST00000332990	.|T	.|0.40756	.|1.02	5.1|5.1	4.26|4.26	0.50523|0.50523	.|Yip1 domain (1);	.|.	.|.	.|.	.|.	T|T	0.41627|0.41627	0.1167|0.1167	L|L	0.46157|0.46157	1.445|1.445	0.46396|0.46396	D|D	0.999024|0.999024	.|P	.|0.36465	.|0.554	.|B	.|0.42245	.|0.381	T|T	0.24764|0.24764	-1.0151|-1.0151	5|9	.|0.33940	.|T	.|0.23	-16.4873|-16.4873	12.9339|12.9339	0.58303|0.58303	0.0:0.9222:0.0:0.0778|0.0:0.9222:0.0:0.0778	.|.	.|215	.|Q8N8F6	.|YIPF7_HUMAN	D|I	191|215	.|ENSP00000332772:V215I	.|ENSP00000332772:V215I	G|V	-|-	2|1	0|0	YIPF7|YIPF7	44321412|44321412	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.982000|0.982000	0.71751|0.71751	4.330000|4.330000	0.59266|0.59266	1.381000|1.381000	0.46364|0.46364	0.655000|0.655000	0.94253|0.94253	GGT|GTC	YIPF7	-	pfam_Yip1	ENSG00000177752		0.547	YIPF7-201	KNOWN	basic|CCDS	protein_coding	YIPF7	HGNC	protein_coding		249	0.00	0	C	NM_182592		44626655	44626655	-1	no_errors	ENST00000332990	ensembl	human	known	69_37n	missense	36	15.91	7	SNP	1.000	T
YTHDF2	51441	genome.wustl.edu	37	1	29064036	29064036	+	Intron	SNP	C	C	T	rs61787567	byFrequency	TCGA-A1-A0SK-01A-12D-A099-09	TCGA-A1-A0SK-10A-03D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d1b43161-cbc1-4bf6-b8bb-a72a2e5e1150	2a5384f3-fec7-4265-b104-987f0718574b	g.chr1:29064036C>T	ENST00000373812.3	+	2	389				YTHDF2_ENST00000478283.1_3'UTR|YTHDF2_ENST00000541996.1_Intron|YTHDF2_ENST00000542507.1_Intron	NM_016258.2	NP_057342.2	Q9Y5A9	YTHD2_HUMAN	YTH domain family, member 2						humoral immune response (GO:0006959)|regulation of mRNA stability (GO:0043488)	cytoplasmic mRNA processing body (GO:0000932)	N6-methyladenosine-containing RNA binding (GO:1990247)|poly(A) RNA binding (GO:0044822)			NS(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(7)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	20		Colorectal(325;3.46e-05)|Lung NSC(340;0.000601)|all_lung(284;0.000771)|Breast(348;0.00502)|Renal(390;0.00758)|all_neural(195;0.0227)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0563)|Medulloblastoma(700;0.123)		Colorectal(126;8.36e-08)|COAD - Colon adenocarcinoma(152;5.46e-06)|STAD - Stomach adenocarcinoma(196;0.00299)|BRCA - Breast invasive adenocarcinoma(304;0.0221)|KIRC - Kidney renal clear cell carcinoma(1967;0.0296)|READ - Rectum adenocarcinoma(331;0.0649)		CAGCCTCTTCCTCACTACCAT	0.607													C|||	443	0.0884585	0.0219	0.134	5008	,	,		12515	0.0		0.2276	False		,,,				2504	0.0941					dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			AF155095	CCDS41296.1, CCDS53287.1	1p35	2008-02-05	2004-11-16		ENSG00000198492	ENSG00000198492			31675	protein-coding gene	gene with protein product		610640	"""YTH domain family 2"""			10508479	Standard	NM_016258		Approved	HGRG8, NY-REN-2	uc021okf.1	Q9Y5A9	OTTHUMG00000003648	ENST00000373812.3:c.28-134C>T	1.37:g.29064036C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A6NKG4|A8K966|B4E1G7|D3DPM8|Q5VSZ9|Q8TDH0|Q9BUJ5	RNA	SNP	-	NULL	ENST00000373812.3	37	NULL	CCDS41296.1	1																																																																																			YTHDF2	-	-	ENSG00000198492		0.607	YTHDF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	YTHDF2	HGNC	protein_coding	OTTHUMT00000010335.1	114	0.00	0	C	NM_016258		29064036	29064036	+1	no_errors	ENST00000478283	ensembl	human	known	69_37n	rna	23	17.86	5	SNP	0.801	T
ZNF234	10780	genome.wustl.edu	37	19	44660912	44660912	+	Missense_Mutation	SNP	C	C	G			TCGA-A1-A0SK-01A-12D-A099-09	TCGA-A1-A0SK-10A-03D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d1b43161-cbc1-4bf6-b8bb-a72a2e5e1150	2a5384f3-fec7-4265-b104-987f0718574b	g.chr19:44660912C>G	ENST00000426739.2	+	6	1001	c.743C>G	c.(742-744)aCt>aGt	p.T248S	ZNF234_ENST00000592437.1_Missense_Mutation_p.T248S	NM_006630.2	NP_006621.1	Q14588	ZN234_HUMAN	zinc finger protein 234	248					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(2)|lung(11)|ovary(1)|prostate(1)	23		Prostate(69;0.0435)				TCAACACTTACTGTACATTGC	0.423																																						dbGAP											0													153.0	158.0	156.0					19																	44660912		2202	4300	6502	-	-	-	SO:0001583	missense	0			X78927	CCDS46101.1	19q13	2013-01-08				ENSG00000263002		"""Zinc fingers, C2H2-type"", ""-"""	13027	protein-coding gene	gene with protein product		604750		ZNF269		7865130	Standard	NM_006630		Approved	HZF4	uc002oyl.4	Q14588		ENST00000426739.2:c.743C>G	19.37:g.44660912C>G	ENSP00000400878:p.Thr248Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K1C8|Q96IR4|Q9NS45|Q9NYT7	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.T248S	ENST00000426739.2	37	c.743	CCDS46101.1	19	.	.	.	.	.	.	.	.	.	.	C	1.046	-0.677458	0.03378	.	.	ENSG00000167380	ENST00000426739	T	0.03358	3.96	3.98	-7.95	0.01148	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.01353	0.0044	N	0.04148	-0.265	0.09310	N	1	B	0.13145	0.007	B	0.10450	0.005	T	0.46938	-0.9155	9	0.22706	T	0.39	.	3.2014	0.06651	0.4731:0.1945:0.2365:0.0959	.	248	Q14588	ZN234_HUMAN	S	248	ENSP00000400878:T248S	ENSP00000400878:T248S	T	+	2	0	ZNF226	49352752	0.000000	0.05858	0.000000	0.03702	0.992000	0.81027	-4.561000	0.00215	-1.857000	0.01159	0.586000	0.80456	ACT	ZNF234	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000263002		0.423	ZNF234-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF234	HGNC	protein_coding	OTTHUMT00000460586.2	327	0.00	0	C			44660912	44660912	+1	no_errors	ENST00000426739	ensembl	human	known	69_37n	missense	587	11.20	74	SNP	0.000	G
ZNF417	147687	genome.wustl.edu	37	19	58421080	58421080	+	Missense_Mutation	SNP	G	G	T	rs145569539	byFrequency	TCGA-A1-A0SK-01A-12D-A099-09	TCGA-A1-A0SK-10A-03D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d1b43161-cbc1-4bf6-b8bb-a72a2e5e1150	2a5384f3-fec7-4265-b104-987f0718574b	g.chr19:58421080G>T	ENST00000312026.5	-	3	730	c.566C>A	c.(565-567)gCa>gAa	p.A189E	ZNF417_ENST00000536263.1_5'UTR|CTD-2583A14.9_ENST00000602124.1_Intron|ZNF417_ENST00000595559.1_Missense_Mutation_p.A188E	NM_152475.2	NP_689688.2	Q8TAU3	ZN417_HUMAN	zinc finger protein 417	189					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(7)|stomach(3)|upper_aerodigestive_tract(1)	18		Colorectal(82;5.46e-05)|all_neural(62;0.0218)|Breast(46;0.0389)|Ovarian(87;0.0443)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0151)		TACAGCAGCTGCTTCTTGGCA	0.483													g|||	500	0.0998403	0.1286	0.1455	5008	,	,		17026	0.1389		0.0656	False		,,,				2504	0.0235					dbGAP											0													149.0	149.0	149.0					19																	58421080		1885	4009	5894	-	-	-	SO:0001583	missense	0			BC025783	CCDS12965.1, CCDS74469.1	19q13.43	2013-01-08				ENSG00000173480		"""Zinc fingers, C2H2-type"", ""-"""	20646	protein-coding gene	gene with protein product							Standard	NM_152475		Approved	MGC34079	uc002qqq.3	Q8TAU3		ENST00000312026.5:c.566C>A	19.37:g.58421080G>T	ENSP00000311319:p.Ala189Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DEU1	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.A189E	ENST00000312026.5	37	c.566	CCDS12965.1	19	485	0.22206959706959706	81	0.16463414634146342	83	0.2292817679558011	191	0.3339160839160839	130	0.17150395778364116	.	0.016	-1.514720	0.00975	.	.	ENSG00000173480	ENST00000312026	T	0.05513	3.43	1.86	1.86	0.25419	.	.	.	.	.	T	0.00012	0.0000	N	0.00554	-1.385	0.51233	P	8.60000000000305E-5	B	0.02656	0.0	B	0.01281	0.0	T	0.44205	-0.9343	8	0.07482	T	0.82	.	7.374	0.26818	0.0:0.0:0.2233:0.7767	.	189	Q8TAU3	ZN417_HUMAN	E	189	ENSP00000311319:A189E	ENSP00000311319:A189E	A	-	2	0	ZNF417	63112892	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	-1.231000	0.02939	0.187000	0.20147	-0.904000	0.02843	GCA	ZNF417	-	NULL	ENSG00000173480		0.483	ZNF417-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZNF417	HGNC	protein_coding	OTTHUMT00000466860.1	98	0.00	0	G	NM_152475		58421080	58421080	-1	no_errors	ENST00000312026	ensembl	human	known	69_37n	missense	65	49.61	64	SNP	0.001	T
ZNF469	84627	genome.wustl.edu	37	16	88494870	88494870	+	Missense_Mutation	SNP	C	C	T	rs149485731	byFrequency	TCGA-A1-A0SK-01A-12D-A099-09	TCGA-A1-A0SK-10A-03D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d1b43161-cbc1-4bf6-b8bb-a72a2e5e1150	2a5384f3-fec7-4265-b104-987f0718574b	g.chr16:88494870C>T	ENST00000437464.1	+	1	992	c.992C>T	c.(991-993)gCg>gTg	p.A331V	ZNF469_ENST00000565624.1_Missense_Mutation_p.A331V	NM_001127464.1	NP_001120936.1	Q96JG9	ZN469_HUMAN	zinc finger protein 469	331	Pro-rich.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(4)|endometrium(6)|kidney(3)|large_intestine(1)|skin(6)	20						ACCCAGCCTGCGCCCTCACCC	0.706													C|||	2	0.000399361	0.0015	0.0	5008	,	,		10677	0.0		0.0	False		,,,				2504	0.0					dbGAP											0													4.0	6.0	5.0					16																	88494870		665	1538	2203	-	-	-	SO:0001583	missense	0			AB058761	CCDS45544.1	16q24	2010-08-04				ENSG00000225614		"""Zinc fingers, C2H2-type"""	23216	protein-coding gene	gene with protein product		612078				11347906	Standard	NM_001127464		Approved	KIAA1858	uc002fku.2	Q96JG9		ENST00000437464.1:c.992C>T	16.37:g.88494870C>T	ENSP00000402343:p.Ala331Val	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.A331V	ENST00000437464.1	37	c.992	CCDS45544.1	16	6	0.0027472527472527475	6	0.012195121951219513	0	0.0	0	0.0	0	0.0	C	6.644	0.487347	0.12641	.	.	ENSG00000225614	ENST00000437464	T	0.06687	3.27	3.82	1.4	0.22301	.	.	.	.	.	T	0.01800	0.0057	N	0.08118	0	0.09310	N	1	P	0.39624	0.681	B	0.26969	0.075	T	0.42949	-0.9421	9	0.17832	T	0.49	.	4.5431	0.12067	0.0:0.5607:0.176:0.2633	.	331	Q96JG9	ZN469_HUMAN	V	331	ENSP00000402343:A331V	ENSP00000402343:A331V	A	+	2	0	ZNF469	87022371	0.000000	0.05858	0.000000	0.03702	0.038000	0.13279	0.757000	0.26433	-0.012000	0.14223	0.462000	0.41574	GCG	ZNF469	-	NULL	ENSG00000225614		0.706	ZNF469-201	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF469	HGNC	protein_coding		11	0.00	0	C	NG_012236		88494870	88494870	+1	no_errors	ENST00000437464	ensembl	human	known	69_37n	missense	22	18.52	5	SNP	0.000	T
ZNF469	84627	genome.wustl.edu	37	16	88496452	88496452	+	Silent	SNP	G	G	C	rs74384633	byFrequency	TCGA-A1-A0SK-01A-12D-A099-09	TCGA-A1-A0SK-10A-03D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d1b43161-cbc1-4bf6-b8bb-a72a2e5e1150	2a5384f3-fec7-4265-b104-987f0718574b	g.chr16:88496452G>C	ENST00000437464.1	+	1	2574	c.2574G>C	c.(2572-2574)ccG>ccC	p.P858P	ZNF469_ENST00000565624.1_Silent_p.P858P	NM_001127464.1	NP_001120936.1	Q96JG9	ZN469_HUMAN	zinc finger protein 469	858					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(4)|endometrium(6)|kidney(3)|large_intestine(1)|skin(6)	20						CGGACAACCCGGAGATCGACA	0.642													C|||	61	0.0121805	0.0454	0.0014	5008	,	,		14223	0.0		0.0	False		,,,				2504	0.0					dbGAP											0													11.0	14.0	13.0					16																	88496452		689	1582	2271	-	-	-	SO:0001819	synonymous_variant	0			AB058761	CCDS45544.1	16q24	2010-08-04				ENSG00000225614		"""Zinc fingers, C2H2-type"""	23216	protein-coding gene	gene with protein product		612078				11347906	Standard	NM_001127464		Approved	KIAA1858	uc002fku.2	Q96JG9		ENST00000437464.1:c.2574G>C	16.37:g.88496452G>C		Somatic		WXS	Illumina GAIIx	Phase_IV		Silent	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.P858	ENST00000437464.1	37	c.2574	CCDS45544.1	16																																																																																			ZNF469	-	NULL	ENSG00000225614		0.642	ZNF469-201	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF469	HGNC	protein_coding		24	0.00	0	G	NG_012236		88496452	88496452	+1	no_errors	ENST00000437464	ensembl	human	known	69_37n	silent	35	16.67	7	SNP	0.001	C
ZNF66	7617	genome.wustl.edu	37	19	20976654	20976654	+	Missense_Mutation	SNP	C	C	A	rs10413187	byFrequency	TCGA-A1-A0SK-01A-12D-A099-09	TCGA-A1-A0SK-10A-03D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d1b43161-cbc1-4bf6-b8bb-a72a2e5e1150	2a5384f3-fec7-4265-b104-987f0718574b	g.chr19:20976654C>A	ENST00000344519.8	+	3	219	c.196C>A	c.(196-198)Cag>Aag	p.Q66K	ZNF66_ENST00000360204.5_Missense_Mutation_p.Q44K|ZNF66_ENST00000594534.1_Missense_Mutation_p.Q66K|ZNF66_ENST00000425625.1_Missense_Mutation_p.Q112K			Q6ZN08	ZNF66_HUMAN	zinc finger protein 66	66	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)										TTCGACTATGCAGAGACATGA	0.408													.|||	360	0.071885	0.0915	0.0663	5008	,	,		16588	0.0228		0.1014	False		,,,				2504	0.0695					dbGAP											0																																										-	-	-	SO:0001583	missense	0			M88375		19p12	2013-03-06	2013-03-06	2013-03-06	ENSG00000160229	ENSG00000160229			13135	other	unknown			"""zinc finger protein 66, pseudogene"""	ZNF66P		1505991	Standard	NG_023377		Approved	FLJ16537	uc002npe.3	Q6ZN08	OTTHUMG00000167735	ENST00000344519.8:c.196C>A	19.37:g.20976654C>A	ENSP00000461425:p.Gln66Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	I3L4P5|Q15939	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.Q112K	ENST00000344519.8	37	c.334		19																																																																																			ZNF66P	-	pfscan_Krueppel-associated_box	ENSG00000160229		0.408	ZNF66-001	KNOWN	basic|appris_principal	protein_coding	ZNF66P	HGNC	protein_coding	OTTHUMT00000395955.2	353	0.56	2	C	NG_023377		20976654	20976654	+1	no_errors	ENST00000425625	ensembl	human	known	69_37n	missense	71	10.13	8	SNP	0.000	A
ZNF717	100131827	genome.wustl.edu	37	3	75786392	75786392	+	Silent	SNP	A	A	G	rs566558183	byFrequency	TCGA-A1-A0SK-01A-12D-A099-09	TCGA-A1-A0SK-10A-03D-A099-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d1b43161-cbc1-4bf6-b8bb-a72a2e5e1150	2a5384f3-fec7-4265-b104-987f0718574b	g.chr3:75786392A>G	ENST00000478296.1	-	4	2508	c.2232T>C	c.(2230-2232)acT>acC	p.T744T	ZNF717_ENST00000491507.1_Intron|ZNF717_ENST00000422325.1_Silent_p.T794T|MIR4273_ENST00000582824.1_RNA|ZNF717_ENST00000477374.1_Intron|ZNF717_ENST00000400845.3_Silent_p.T787T			Q9BY31	ZN717_HUMAN	zinc finger protein 717	784					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			autonomic_ganglia(6)|endometrium(3)|lung(2)|ovary(1)|stomach(7)	19						TATCGTAAAAAGTTTTCCTAC	0.413													a|||	3	0.000599042	0.0023	0.0	5008	,	,		11249	0.0		0.0	False		,,,				2504	0.0					dbGAP											0													51.0	39.0	43.0					3																	75786392		682	1407	2089	-	-	-	SO:0001819	synonymous_variant	0			AF226994		3p12.3	2013-01-08			ENSG00000227124	ENSG00000227124		"""Zinc fingers, C2H2-type"", ""-"""	29448	protein-coding gene	gene with protein product			"""zinc finger protein 838"""	ZNF838			Standard	NM_001128223		Approved	X17	uc011bgi.2	Q9BY31	OTTHUMG00000158965	ENST00000478296.1:c.2232T>C	3.37:g.75786392A>G		Somatic		WXS	Illumina GAIIx	Phase_IV		Silent	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.T794	ENST00000478296.1	37	c.2382		3																																																																																			ZNF717	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000227124		0.413	ZNF717-002	NOVEL	not_organism_supported|basic	protein_coding	ZNF717	HGNC	protein_coding	OTTHUMT00000352764.2	121	0.00	0	A	NM_001128223		75786392	75786392	-1	no_errors	ENST00000422325	ensembl	human	known	69_37n	silent	69	25.81	24	SNP	0.023	G
ZNF777	27153	genome.wustl.edu	37	7	149128876	149128876	+	Silent	SNP	C	C	T			TCGA-A1-A0SK-01A-12D-A099-09	TCGA-A1-A0SK-10A-03D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d1b43161-cbc1-4bf6-b8bb-a72a2e5e1150	2a5384f3-fec7-4265-b104-987f0718574b	g.chr7:149128876C>T	ENST00000247930.4	-	6	2810	c.2487G>A	c.(2485-2487)acG>acA	p.T829T		NM_015694.2	NP_056509.2	Q9ULD5	ZN777_HUMAN	zinc finger protein 777	745					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			large_intestine(5)|lung(17)|ovary(1)|skin(2)|urinary_tract(1)	26	Melanoma(164;0.165)		OV - Ovarian serous cystadenocarcinoma(82;0.00358)			cTCACTCGCCCGTGTGGGTCC	0.781																																						dbGAP											0													9.0	11.0	10.0					7																	149128876		2136	4242	6378	-	-	-	SO:0001819	synonymous_variant	0			AB033111	CCDS43675.1	7q36.1	2013-01-08			ENSG00000196453	ENSG00000196453		"""Zinc fingers, C2H2-type"", ""-"""	22213	protein-coding gene	gene with protein product							Standard	NM_015694		Approved	KIAA1285	uc003wfv.3	Q9ULD5	OTTHUMG00000158967	ENST00000247930.4:c.2487G>A	7.37:g.149128876C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q8N2R2|Q8N659	Silent	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,pfam_DUF3669_Znf,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.T829	ENST00000247930.4	37	c.2487	CCDS43675.1	7																																																																																			ZNF777	-	pfscan_Znf_C2H2	ENSG00000196453		0.781	ZNF777-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF777	HGNC	protein_coding	OTTHUMT00000352708.1	22	0.00	0	C	NM_015694		149128876	149128876	-1	no_errors	ENST00000247930	ensembl	human	known	69_37n	silent	15	62.50	25	SNP	1.000	T
