#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
ACVR1B	91	genome.wustl.edu	37	12	52374976	52374976	+	Missense_Mutation	SNP	C	C	G			TCGA-A2-A04R-01A-41D-A117-09	TCGA-A2-A04R-10B-01D-A10G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f8e4326-dfc7-4635-a9b7-a9207a392748	6234c5ee-14f2-427c-9ebc-4911da27a849	g.chr12:52374976C>G	ENST00000257963.4	+	4	881	c.804C>G	c.(802-804)gaC>gaG	p.D268E	ACVR1B_ENST00000541224.1_Missense_Mutation_p.D268E|ACVR1B_ENST00000426655.2_Missense_Mutation_p.D268E|ACVR1B_ENST00000542485.1_Missense_Mutation_p.D216E|ACVR1B_ENST00000415850.2_Missense_Mutation_p.D268E	NM_004302.4|NM_020328.3	NP_004293.1|NP_064733.3	P36896	ACV1B_HUMAN	activin A receptor, type IB	268	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activin receptor signaling pathway (GO:0032924)|central nervous system development (GO:0007417)|development of primary female sexual characteristics (GO:0046545)|extrinsic apoptotic signaling pathway (GO:0097191)|G1/S transition of mitotic cell cycle (GO:0000082)|hair follicle development (GO:0001942)|in utero embryonic development (GO:0001701)|negative regulation of cell growth (GO:0030308)|nodal signaling pathway (GO:0038092)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of activin receptor signaling pathway (GO:0032927)|positive regulation of erythrocyte differentiation (GO:0045648)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of trophoblast cell migration (GO:1901165)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of transcription, DNA-templated (GO:0006355)|signal transduction (GO:0007165)|transmembrane receptor protein serine/threonine kinase signaling pathway (GO:0007178)	cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	activin receptor activity, type I (GO:0016361)|ATP binding (GO:0005524)|inhibin binding (GO:0034711)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|receptor signaling protein serine/threonine kinase activity (GO:0004702)|SMAD binding (GO:0046332)|transforming growth factor beta-activated receptor activity (GO:0005024)|transmembrane receptor protein serine/threonine kinase activity (GO:0004675)|ubiquitin protein ligase binding (GO:0031625)	p.D268E(2)		breast(5)|endometrium(4)|kidney(5)|large_intestine(12)|lung(10)|ovary(1)|pancreas(6)|prostate(1)	44				BRCA - Breast invasive adenocarcinoma(357;0.104)	Adenosine triphosphate(DB00171)	TTGCTGCTGACAATAAAGGTA	0.468											OREG0021829	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP											2	Substitution - Missense(2)	breast(2)											89.0	86.0	87.0					12																	52374976		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS8816.1, CCDS44893.1, CCDS44894.1, CCDS44893.2, CCDS44894.2	12q13	2006-11-09			ENSG00000135503	ENSG00000135503			172	protein-coding gene	gene with protein product		601300		ACVRLK4		8397373	Standard	NM_020327		Approved	ALK4, SKR2, ActRIB	uc010snn.2	P36896	OTTHUMG00000167920	ENST00000257963.4:c.804C>G	12.37:g.52374976C>G	ENSP00000257963:p.Asp268Glu	Somatic	984	WXS	Illumina GAIIx	Phase_IV	B7Z5L8|B7Z5W5|Q15479|Q15480|Q15481|Q15482	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_TGF_beta_rcpt_GS,pfam_Activin_rcpt,superfamily_Kinase-like_dom,smart_TGF_beta_rcpt_GS,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.D268E	ENST00000257963.4	37	c.804	CCDS8816.1	12	.	.	.	.	.	.	.	.	.	.	C	16.44	3.124504	0.56613	.	.	ENSG00000135503	ENST00000257963;ENST00000541224;ENST00000426655;ENST00000415850;ENST00000542485	D;D;D;D;D	0.93133	-3.17;-3.17;-3.17;-3.17;-3.17	5.13	5.13	0.70059	Serine/threonine-protein kinase-like domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	D	0.96197	0.8760	M	0.73962	2.25	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;0.999;1.0	D;D;D;D	0.85130	0.996;0.995;0.991;0.997	D	0.96395	0.9292	10	0.87932	D	0	.	14.2412	0.65959	0.0:0.9263:0.0:0.0737	.	268;268;268;268	P36896-4;P36896;P36896-2;P36896-3	.;ACV1B_HUMAN;.;.	E	268;268;268;268;216	ENSP00000257963:D268E;ENSP00000442656:D268E;ENSP00000390477:D268E;ENSP00000397550:D268E;ENSP00000442885:D216E	ENSP00000257963:D268E	D	+	3	2	ACVR1B	50661243	1.000000	0.71417	1.000000	0.80357	0.379000	0.30106	0.925000	0.28791	2.567000	0.86603	0.655000	0.94253	GAC	ACVR1B	-	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	ENSG00000135503		0.468	ACVR1B-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ACVR1B	HGNC	protein_coding	OTTHUMT00000397000.1	89	0.00	0	C	NM_020328		52374976	52374976	+1	no_errors	ENST00000257963	ensembl	human	known	69_37n	missense	54	44.33	43	SNP	1.000	G
ADAMTSL1	92949	genome.wustl.edu	37	9	18817201	18817202	+	Nonsense_Mutation	DNP	GG	GG	CT			TCGA-A2-A04R-01A-41D-A117-09	TCGA-A2-A04R-10B-01D-A10G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f8e4326-dfc7-4635-a9b7-a9207a392748	6234c5ee-14f2-427c-9ebc-4911da27a849	g.chr9:18817201_18817202GG>CT	ENST00000380548.4	+	21	4239_4240	c.3900_3901GG>CT	c.(3898-3903)caGGga>caCTga	p.1300_1301QG>H*		NM_001040272.5	NP_001035362.3	Q8N6G6	ATL1_HUMAN	ADAMTS-like 1	1300	Ig-like C2-type 3.					proteinaceous extracellular matrix (GO:0005578)	metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)	p.Q1300H(1)|p.G1301*(1)		breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|liver(2)|lung(17)|ovary(3)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	42				GBM - Glioblastoma multiforme(50;1.29e-17)		AAACAGTGCAGGGAGTGAATGT	0.46																																						dbGAP											2	Substitution - Missense(1)|Substitution - Nonsense(1)	breast(2)																																								-	-	-	SO:0001587	stop_gained	0			AF176313	CCDS6485.1, CCDS47954.1	9p21.3	2013-01-11			ENSG00000178031	ENSG00000178031		"""Immunoglobulin superfamily / I-set domain containing"""	14632	protein-coding gene	gene with protein product	"""punctin"""	609198	"""chromosome 9 open reading frame 94"""	C9orf94		9628581, 11805097	Standard	NM_001040272		Approved	ADAMTSR1, FLJ35283	uc003zne.4	Q8N6G6	OTTHUMG00000019604	Exception_encountered	9.37:g.18817201_18817202delinsCT	ENSP00000369921:p.Q1300_G1301delinsH*	Somatic		WXS	Illumina GAIIx	Phase_IV	A6PVN1|A8K7E1|Q496M6|Q496M8|Q5T708|Q5VZT8|Q8NAI9|Q96RW4|Q9BXY3	Missense_Mutation|Nonsense_Mutation	SNP	pfam_Ig_I-set,pfam_Thrombospondin_1_rpt,pfam_Immunoglobulin,pfam_PLAC,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,smart_Ig_sub,smart_Ig_sub2,pfscan_PLAC,pfscan_Thrombospondin_1_rpt,pfscan_Ig-like,prints_Peptidase_M12B_ADAM-TS	p.Q1300H|p.G1301*	ENST00000380548.4	37	c.3900|c.3901	CCDS47954.1	9																																																																																			ADAMTSL1	-	pfam_Ig_I-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	ENSG00000178031		0.460	ADAMTSL1-012	NOVEL	basic|appris_principal|CCDS	protein_coding	ADAMTSL1	HGNC	protein_coding	OTTHUMT00000401206.1	93|90	0.00	0	G			18817201|18817202	18817201|18817202	+1	no_errors	ENST00000380548	ensembl	human	novel	69_37n	missense|nonsense	44	39.73	29	SNP	0.004|0.971	C|T
B4GALT6	9331	genome.wustl.edu	37	18	29211065	29211065	+	Silent	SNP	G	G	A			TCGA-A2-A04R-01A-41D-A117-09	TCGA-A2-A04R-10B-01D-A10G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f8e4326-dfc7-4635-a9b7-a9207a392748	6234c5ee-14f2-427c-9ebc-4911da27a849	g.chr18:29211065G>A	ENST00000306851.5	-	6	929	c.633C>T	c.(631-633)ggC>ggT	p.G211G	B4GALT6_ENST00000237019.7_Silent_p.G172G|B4GALT6_ENST00000383131.3_Silent_p.G172G	NM_004775.3	NP_004766.2	Q9UBX8	B4GT6_HUMAN	UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 6	211					carbohydrate metabolic process (GO:0005975)|cellular protein metabolic process (GO:0044267)|glycosaminoglycan metabolic process (GO:0030203)|keratan sulfate biosynthetic process (GO:0018146)|keratan sulfate metabolic process (GO:0042339)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)|small molecule metabolic process (GO:0044281)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	galactosyltransferase activity (GO:0008378)|metal ion binding (GO:0046872)	p.G211G(1)		breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(6)|lung(6)|pancreas(1)	20			OV - Ovarian serous cystadenocarcinoma(10;0.00791)			CCTCTTTGAAGCCCACATTGA	0.433																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											87.0	82.0	84.0					18																	29211065		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF038664	CCDS11900.1	18q11	2013-02-19			ENSG00000118276	ENSG00000118276		"""Beta 4-glycosyltransferases"""	929	protein-coding gene	gene with protein product	"""UDP-Gal:glucosylceramide beta-1,4-galactosyltransferase"""	604017				9597550, 12180132	Standard	NM_004775		Approved	beta4GalT-VI	uc002kwz.4	Q9UBX8	OTTHUMG00000131980	ENST00000306851.5:c.633C>T	18.37:g.29211065G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	O60514|Q6NT09	Silent	SNP	pfam_Galactosyl_T_2_met,prints_Galactosyl_T_2_met	p.G211	ENST00000306851.5	37	c.633	CCDS11900.1	18																																																																																			B4GALT6	-	pfam_Galactosyl_T_2_met,prints_Galactosyl_T_2_met	ENSG00000118276		0.433	B4GALT6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	B4GALT6	HGNC	protein_coding	OTTHUMT00000254942.2	59	0.00	0	G	NM_004775		29211065	29211065	-1	no_errors	ENST00000306851	ensembl	human	known	69_37n	silent	37	27.45	14	SNP	1.000	A
C10orf88	80007	genome.wustl.edu	37	10	124708257	124708257	+	Missense_Mutation	SNP	G	G	T			TCGA-A2-A04R-01A-41D-A117-09	TCGA-A2-A04R-10B-01D-A10G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f8e4326-dfc7-4635-a9b7-a9207a392748	6234c5ee-14f2-427c-9ebc-4911da27a849	g.chr10:124708257G>T	ENST00000481909.1	-	4	780	c.556C>A	c.(556-558)Ctt>Att	p.L186I	C10orf88_ENST00000368891.5_5'UTR	NM_024942.3	NP_079218.2	Q9H8K7	CJ088_HUMAN	chromosome 10 open reading frame 88	186								p.L186I(1)		breast(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(11)|prostate(1)	18		all_neural(114;0.0765)|Lung NSC(174;0.163)|all_lung(145;0.205)		Colorectal(40;0.0686)|COAD - Colon adenocarcinoma(40;0.0735)		ACCTTGTCAAGGTCTATCCTT	0.453																																						dbGAP											1	Substitution - Missense(1)	breast(1)											125.0	114.0	118.0					10																	124708257		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK023552	CCDS7632.1	10q26.13	2012-11-09			ENSG00000119965	ENSG00000119965			25822	protein-coding gene	gene with protein product						12477932	Standard	NM_024942		Approved	FLJ13490, Em:AC073585.5	uc001lgw.2	Q9H8K7	OTTHUMG00000019190	ENST00000481909.1:c.556C>A	10.37:g.124708257G>T	ENSP00000419126:p.Leu186Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	Q0P6C6|Q8N597	Missense_Mutation	SNP	NULL	p.L186I	ENST00000481909.1	37	c.556	CCDS7632.1	10	.	.	.	.	.	.	.	.	.	.	G	19.29	3.799462	0.70567	.	.	ENSG00000119965	ENST00000481909	.	.	.	4.33	4.33	0.51752	.	0.187113	0.36591	U	0.002504	T	0.77611	0.4156	M	0.80183	2.485	0.40315	D	0.978765	D	0.89917	1.0	D	0.80764	0.994	T	0.81019	-0.1122	9	0.72032	D	0.01	.	10.8906	0.46994	0.0887:0.0:0.9113:0.0	.	186	Q9H8K7	CJ088_HUMAN	I	186	.	ENSP00000419126:L186I	L	-	1	0	C10orf88	124698247	1.000000	0.71417	0.984000	0.44739	0.952000	0.60782	5.179000	0.65043	2.111000	0.64477	0.440000	0.28878	CTT	C10orf88	-	NULL	ENSG00000119965		0.453	C10orf88-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C10orf88	HGNC	protein_coding	OTTHUMT00000050807.1	146	0.00	0	G	NM_024942		124708257	124708257	-1	no_errors	ENST00000481909	ensembl	human	known	69_37n	missense	67	44.17	53	SNP	1.000	T
CACNA1D	776	genome.wustl.edu	37	3	53769505	53769505	+	Missense_Mutation	SNP	T	T	A			TCGA-A2-A04R-01A-41D-A117-09	TCGA-A2-A04R-10B-01D-A10G-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f8e4326-dfc7-4635-a9b7-a9207a392748	6234c5ee-14f2-427c-9ebc-4911da27a849	g.chr3:53769505T>A	ENST00000350061.5	+	20	3237	c.2726T>A	c.(2725-2727)aTc>aAc	p.I909N	CACNA1D_ENST00000422281.2_Missense_Mutation_p.I909N|CACNA1D_ENST00000288139.4_Missense_Mutation_p.I929N	NM_001128840.1	NP_001122312.1	Q01668	CAC1D_HUMAN	calcium channel, voltage-dependent, L type, alpha 1D subunit	909					adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|axon guidance (GO:0007411)|calcium ion import (GO:0070509)|calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|energy reserve metabolic process (GO:0006112)|membrane depolarization during action potential (GO:0086010)|membrane depolarization during cardiac muscle cell action potential (GO:0086012)|membrane repolarization during SA node cell action potential (GO:0086052)|positive regulation of calcium ion transport (GO:0051928)|regulation of atrial cardiac muscle cell membrane repolarization (GO:0060372)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of insulin secretion (GO:0050796)|regulation of potassium ion transmembrane transport (GO:1901379)|regulation of potassium ion transmembrane transporter activity (GO:1901016)|sensory perception of sound (GO:0007605)|small molecule metabolic process (GO:0044281)	plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)|Z disc (GO:0030018)	alpha-actinin binding (GO:0051393)|ankyrin binding (GO:0030506)|high voltage-gated calcium channel activity (GO:0008331)|metal ion binding (GO:0046872)|voltage-gated calcium channel activity (GO:0005245)|voltage-gated calcium channel activity involved in cardiac muscle cell action potential (GO:0086007)|voltage-gated calcium channel activity involved SA node cell action potential (GO:0086059)	p.I929N(1)		breast(3)|central_nervous_system(9)|cervix(2)|endometrium(11)|kidney(7)|large_intestine(13)|liver(1)|lung(29)|ovary(6)|prostate(2)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	90				BRCA - Breast invasive adenocarcinoma(193;0.00029)|KIRC - Kidney renal clear cell carcinoma(284;0.0145)|Kidney(284;0.0175)|OV - Ovarian serous cystadenocarcinoma(275;0.0613)	Amlodipine(DB00381)|Cinnarizine(DB00568)|Clevidipine(DB04920)|Dronedarone(DB04855)|Felodipine(DB01023)|Isradipine(DB00270)|Nicardipine(DB00622)|Nifedipine(DB01115)|Nilvadipine(DB06712)|Nimodipine(DB00393)|Nisoldipine(DB00401)|Nitrendipine(DB01054)|Spironolactone(DB00421)|Verapamil(DB00661)	GAGGACCCCATCCGCAGCCAC	0.622																																						dbGAP											1	Substitution - Missense(1)	breast(1)											74.0	64.0	67.0					3																	53769505		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB209171	CCDS2872.1, CCDS46848.1, CCDS46849.1	3p14.3	2012-03-07			ENSG00000157388	ENSG00000157388		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1391	protein-coding gene	gene with protein product		114206		CCHL1A2, CACNL1A2		1664412	Standard	NM_000720		Approved	Cav1.3, CACH3, CACN4	uc003dgu.5	Q01668	OTTHUMG00000158278	ENST00000350061.5:c.2726T>A	3.37:g.53769505T>A	ENSP00000288133:p.Ile909Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	B0FYA3|Q13916|Q13931|Q71UT1|Q9UDC3	Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_VDCC_a1su_IQ,pfam_PKD1_2_channel,prints_VDCCAlpha1,prints_VDCC_L_a1su,prints_LVDCC_a1dsu	p.I929N	ENST00000350061.5	37	c.2786	CCDS46848.1	3	.	.	.	.	.	.	.	.	.	.	T	28.1	4.887525	0.91814	.	.	ENSG00000157388	ENST00000350061;ENST00000288139;ENST00000422281;ENST00000481478	D;D;D;D	0.97480	-4.4;-4.4;-4.4;-4.4	5.46	5.46	0.80206	.	0.000000	0.85682	D	0.000000	D	0.98469	0.9490	M	0.84585	2.705	0.80722	D	1	D;D;D;D	0.89917	1.0;0.997;0.997;0.998	D;D;D;D	0.77557	0.984;0.957;0.947;0.99	D	0.99686	1.1000	10	0.87932	D	0	.	15.8404	0.78840	0.0:0.0:0.0:1.0	.	909;602;909;929	B0FYA3;Q59GD8;Q01668;Q01668-2	.;.;CAC1D_HUMAN;.	N	909;929;909;602	ENSP00000288133:I909N;ENSP00000288139:I929N;ENSP00000409174:I909N;ENSP00000418014:I602N	ENSP00000288139:I929N	I	+	2	0	CACNA1D	53744545	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	7.978000	0.88095	2.197000	0.70478	0.454000	0.30748	ATC	CACNA1D	-	NULL	ENSG00000157388		0.622	CACNA1D-003	KNOWN	basic|appris_principal|CCDS	protein_coding	CACNA1D	HGNC	protein_coding	OTTHUMT00000350557.1	43	0.00	0	T	NM_000720		53769505	53769505	+1	no_errors	ENST00000288139	ensembl	human	known	69_37n	missense	14	61.11	22	SNP	1.000	A
CACNA2D3	55799	genome.wustl.edu	37	3	54676226	54676226	+	Silent	SNP	C	C	T			TCGA-A2-A04R-01A-41D-A117-09	TCGA-A2-A04R-10B-01D-A10G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f8e4326-dfc7-4635-a9b7-a9207a392748	6234c5ee-14f2-427c-9ebc-4911da27a849	g.chr3:54676226C>T	ENST00000474759.1	+	11	1173	c.1125C>T	c.(1123-1125)acC>acT	p.T375T	CACNA2D3_ENST00000288197.5_Silent_p.T375T|ESRG_ENST00000583516.1_RNA|CACNA2D3_ENST00000415676.2_Silent_p.T375T|CACNA2D3_ENST00000490478.1_Silent_p.T281T	NM_018398.2	NP_060868.2	Q8IZS8	CA2D3_HUMAN	calcium channel, voltage-dependent, alpha 2/delta subunit 3	375	VWFA. {ECO:0000255|PROSITE- ProRule:PRU00219}.					integral component of membrane (GO:0016021)	metal ion binding (GO:0046872)|voltage-gated calcium channel activity (GO:0005245)	p.T375T(1)		NS(1)|breast(3)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(17)|lung(17)|ovary(1)|prostate(1)|skin(5)|stomach(1)|urinary_tract(3)	59				KIRC - Kidney renal clear cell carcinoma(284;0.00287)|Kidney(284;0.00327)	Amlodipine(DB00381)|Nilvadipine(DB06712)|Spironolactone(DB00421)	CGGTGGACACCTATGATACAA	0.438																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											82.0	81.0	81.0					3																	54676226		1986	4156	6142	-	-	-	SO:0001819	synonymous_variant	0			AJ272268	CCDS54598.1	3p21.1	2010-10-05	2008-02-26		ENSG00000157445	ENSG00000157445		"""Calcium channel subunits"""	15460	protein-coding gene	gene with protein product		606399				11245980	Standard	XM_005265318		Approved	HSA272268	uc003dhf.3	Q8IZS8	OTTHUMG00000158580	ENST00000474759.1:c.1125C>T	3.37:g.54676226C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B2RPL6|Q9NY16|Q9NY18	Silent	SNP	pfam_VWA_N,pfam_Cache_domain,pfam_VWF_A,smart_VWF_A,pfscan_VWF_A	p.T375	ENST00000474759.1	37	c.1125	CCDS54598.1	3																																																																																			CACNA2D3	-	pfam_VWF_A,smart_VWF_A,pfscan_VWF_A	ENSG00000157445		0.438	CACNA2D3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CACNA2D3	HGNC	protein_coding	OTTHUMT00000351402.1	86	0.00	0	C			54676226	54676226	+1	no_errors	ENST00000288197	ensembl	human	known	69_37n	silent	49	52.88	55	SNP	0.998	T
CAMTA2	23125	genome.wustl.edu	37	17	4875737	4875738	+	Frame_Shift_Ins	INS	-	-	G			TCGA-A2-A04R-01A-41D-A117-09	TCGA-A2-A04R-10B-01D-A10G-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f8e4326-dfc7-4635-a9b7-a9207a392748	6234c5ee-14f2-427c-9ebc-4911da27a849	g.chr17:4875737_4875738insG	ENST00000348066.3	-	16	2720_2721	c.2597_2598insC	c.(2596-2598)cctfs	p.P866fs	RP5-1050D4.2_ENST00000430920.1_RNA|CAMTA2_ENST00000572543.1_Frame_Shift_Ins_p.P871fs|CAMTA2_ENST00000381311.5_Frame_Shift_Ins_p.P868fs|CAMTA2_ENST00000414043.3_Frame_Shift_Ins_p.P889fs|CAMTA2_ENST00000358183.4_Frame_Shift_Ins_p.P866fs|CAMTA2_ENST00000361571.5_Frame_Shift_Ins_p.P865fs	NM_015099.3	NP_055914.2	O94983	CMTA2_HUMAN	calmodulin binding transcription activator 2	866					cardiac muscle hypertrophy in response to stress (GO:0014898)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|histone deacetylase binding (GO:0042826)|transcription factor binding (GO:0008134)			breast(2)|central_nervous_system(1)|endometrium(6)|kidney(3)|large_intestine(6)|lung(5)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	31						GCAGAGGTGCAGGGGGGGGACT	0.614																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			AB020716	CCDS11063.1, CCDS54071.1, CCDS54072.1, CCDS54073.1	17p13.3	2004-09-01			ENSG00000108509	ENSG00000108509			18807	protein-coding gene	gene with protein product		611508				11925432	Standard	NM_015099		Approved	KIAA0909	uc010cku.2	O94983	OTTHUMG00000099417	ENST00000348066.3:c.2598dupC	17.37:g.4875745_4875745dupG	ENSP00000321813:p.Pro866fs	Somatic		WXS	Illumina GAIIx	Phase_IV	B9EGL0|D3DTL5|E7EWU5|Q7Z6M8|Q8N3V0|Q8NDG4|Q96G17	Frame_Shift_Ins	INS	pfam_CG-1_dom,pfam_IPT_TIG_rcpt,pfam_IQ_motif_EF-hand-BS,superfamily_Ig_E-set,superfamily_Ankyrin_rpt-contain_dom,pfscan_Ankyrin_rpt-contain_dom,pfscan_IQ_motif_EF-hand-BS	p.A890fs	ENST00000348066.3	37	c.2667_2666	CCDS11063.1	17																																																																																			CAMTA2	-	NULL	ENSG00000108509		0.614	CAMTA2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CAMTA2	HGNC	protein_coding	OTTHUMT00000216876.1	18	0.00	0	-	NM_015099		4875737	4875738	-1	no_errors	ENST00000414043	ensembl	human	known	69_37n	frame_shift_ins	14	12.50	2	INS	0.999:1.000	G
CASK	8573	genome.wustl.edu	37	X	41413141	41413141	+	Missense_Mutation	SNP	C	C	G			TCGA-A2-A04R-01A-41D-A117-09	TCGA-A2-A04R-10B-01D-A10G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f8e4326-dfc7-4635-a9b7-a9207a392748	6234c5ee-14f2-427c-9ebc-4911da27a849	g.chrX:41413141C>G	ENST00000378163.1	-	21	2344	c.1870G>C	c.(1870-1872)Gat>Cat	p.D624H	CASK_ENST00000421587.2_Missense_Mutation_p.D595H|CASK_ENST00000361962.4_Missense_Mutation_p.D612H|CASK_ENST00000378166.4_Missense_Mutation_p.D624H|CASK_ENST00000472704.1_5'UTR|CASK_ENST00000442742.2_Missense_Mutation_p.D601H|CASK_ENST00000318588.9_Missense_Mutation_p.D624H|CASK_ENST00000378158.1_Missense_Mutation_p.D612H			O14936	CSKP_HUMAN	calcium/calmodulin-dependent serine protein kinase (MAGUK family)	624	SH3. {ECO:0000255|PROSITE- ProRule:PRU00192}.				calcium ion import (GO:0070509)|cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of cellular response to growth factor stimulus (GO:0090288)|negative regulation of keratinocyte proliferation (GO:0010839)|negative regulation of wound healing (GO:0061045)|nucleotide phosphorylation (GO:0046939)|positive regulation of calcium ion import (GO:0090280)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	actin cytoskeleton (GO:0015629)|basement membrane (GO:0005604)|basolateral plasma membrane (GO:0016323)|cell-cell junction (GO:0005911)|ciliary membrane (GO:0060170)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|nuclear lamina (GO:0005652)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|plasma membrane (GO:0005886)|presynaptic membrane (GO:0042734)	ATP binding (GO:0005524)|guanylate kinase activity (GO:0004385)|protein serine/threonine kinase activity (GO:0004674)	p.D624H(1)		breast(3)|endometrium(5)|kidney(1)|large_intestine(6)|liver(1)|lung(11)|ovary(3)|prostate(1)|stomach(1)	32						TTGGCTGGATCATATTCAAAT	0.388																																					NSCLC(42;104 1086 3090 27189 35040)	dbGAP											1	Substitution - Missense(1)	breast(1)											112.0	88.0	96.0					X																	41413141		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF035582	CCDS14257.1, CCDS48094.1, CCDS48095.1	Xp11.4	2010-02-09			ENSG00000147044	ENSG00000147044			1497	protein-coding gene	gene with protein product		300172	"""trinucleotide repeat containing 8"""	TNRC8		9722958	Standard	NM_003688		Approved	LIN2, CAGH39, FGS4	uc004dfl.4	O14936	OTTHUMG00000021378	ENST00000378163.1:c.1870G>C	X.37:g.41413141C>G	ENSP00000367405:p.Asp624His	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NES1|B7ZKY0|O43215|Q17RI4|Q59HA0|Q5VT16|Q5VT17|Q5VT18|Q5VT19|Q66T42|Q9BYH6|Q9NYB2|Q9NYB3	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Guanylate_kin,pfam_L27_C,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_PDZ,pfam_SH3_2,pfam_SH3_domain,superfamily_Kinase-like_dom,superfamily_SH3_domain,superfamily_PDZ,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_L27,smart_PDZ,smart_SH3_domain,smart_Guanylate_kin/L-typ_Ca_channel,pfscan_L27,pfscan_PDZ,pfscan_SH3_domain,pfscan_Prot_kinase_cat_dom,pfscan_Guanylate_kin	p.D624H	ENST00000378163.1	37	c.1870		X	.	.	.	.	.	.	.	.	.	.	C	27.6	4.841843	0.91197	.	.	ENSG00000147044	ENST00000421587;ENST00000318588;ENST00000361962;ENST00000378163;ENST00000378179;ENST00000378168;ENST00000378158;ENST00000378166;ENST00000442742	T;T;T;T;T;T;T;T;T	0.08546	3.08;3.08;3.08;3.08;3.08;3.08;3.08;3.08;3.08	6.07	6.07	0.98685	Src homology-3 domain (3);Variant SH3 (1);	0.000000	0.64402	D	0.000014	T	0.38453	0.1041	M	0.88704	2.975	0.80722	D	1	D;D;D;D;D	0.89917	1.0;0.994;0.999;1.0;0.999	D;D;D;D;D	0.78314	0.984;0.986;0.965;0.991;0.991	T	0.35773	-0.9775	10	0.87932	D	0	.	19.4917	0.95052	0.0:1.0:0.0:0.0	.	595;601;624;624;216	O14936-3;O14936-4;O14936-2;O14936;Q5JS72	.;.;.;CSKP_HUMAN;.	H	595;624;612;624;216;79;612;624;601	ENSP00000400526:D595H;ENSP00000322727:D624H;ENSP00000354641:D612H;ENSP00000367405:D624H;ENSP00000367421:D216H;ENSP00000367410:D79H;ENSP00000367400:D612H;ENSP00000367408:D624H;ENSP00000398007:D601H	ENSP00000322727:D624H	D	-	1	0	CASK	41298085	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.487000	0.81328	2.557000	0.86248	0.594000	0.82650	GAT	CASK	-	pfam_SH3_2,superfamily_SH3_domain,smart_SH3_domain,pfscan_SH3_domain	ENSG00000147044		0.388	CASK-007	KNOWN	basic|appris_candidate_longest	protein_coding	CASK	HGNC	protein_coding	OTTHUMT00000056285.1	170	0.00	0	C	NM_003688		41413141	41413141	-1	no_errors	ENST00000378163	ensembl	human	known	69_37n	missense	99	37.50	60	SNP	1.000	G
COL5A3	50509	genome.wustl.edu	37	19	10097018	10097018	+	Missense_Mutation	SNP	C	C	A			TCGA-A2-A04R-01A-41D-A117-09	TCGA-A2-A04R-10B-01D-A10G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f8e4326-dfc7-4635-a9b7-a9207a392748	6234c5ee-14f2-427c-9ebc-4911da27a849	g.chr19:10097018C>A	ENST00000264828.3	-	30	2410	c.2325G>T	c.(2323-2325)gaG>gaT	p.E775D		NM_015719.3	NP_056534.2	P25940	CO5A3_HUMAN	collagen, type V, alpha 3	775	Triple-helical region.				axon guidance (GO:0007411)|cell-matrix adhesion (GO:0007160)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|skin development (GO:0043588)	collagen type V trimer (GO:0005588)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	collagen binding (GO:0005518)|extracellular matrix structural constituent (GO:0005201)|heparin binding (GO:0008201)			NS(2)|breast(3)|central_nervous_system(2)|endometrium(11)|kidney(23)|large_intestine(12)|liver(2)|lung(35)|ovary(8)|prostate(5)|skin(10)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	116			Epithelial(33;7.11e-05)			CTGGGGGCCCCTCCTCGCCAG	0.632																																						dbGAP											0													23.0	28.0	27.0					19																	10097018		2202	4299	6501	-	-	-	SO:0001583	missense	0			AF177941	CCDS12222.1	19p13.2	2013-01-16			ENSG00000080573	ENSG00000080573		"""Collagens"""	14864	protein-coding gene	gene with protein product		120216				10722718	Standard	NM_015719		Approved		uc002mmq.1	P25940	OTTHUMG00000150019	ENST00000264828.3:c.2325G>T	19.37:g.10097018C>A	ENSP00000264828:p.Glu775Asp	Somatic		WXS	Illumina GAIIx	Phase_IV	Q9NZQ6	Missense_Mutation	SNP	pfam_Collagen,pfam_Fib_collagen_C,superfamily_ConA-like_lec_gl,smart_Laminin_G,smart_Fib_collagen_C	p.E775D	ENST00000264828.3	37	c.2325	CCDS12222.1	19	.	.	.	.	.	.	.	.	.	.	C	12.39	1.922907	0.33908	.	.	ENSG00000080573	ENST00000264828	D	0.95656	-3.77	4.32	3.25	0.37280	.	0.487586	0.19162	N	0.121157	D	0.87172	0.6111	N	0.04820	-0.15	0.27243	N	0.9591	B	0.34015	0.435	B	0.35510	0.204	T	0.80752	-0.1242	10	0.37606	T	0.19	.	7.2905	0.26364	0.0:0.7913:0.0:0.2087	.	775	P25940	CO5A3_HUMAN	D	775	ENSP00000264828:E775D	ENSP00000264828:E775D	E	-	3	2	COL5A3	9958018	0.008000	0.16893	0.999000	0.59377	0.873000	0.50193	-0.215000	0.09279	0.886000	0.36113	0.462000	0.41574	GAG	COL5A3	-	NULL	ENSG00000080573		0.632	COL5A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL5A3	HGNC	protein_coding	OTTHUMT00000315788.1	34	0.00	0	C	NM_015719		10097018	10097018	-1	no_errors	ENST00000264828	ensembl	human	known	69_37n	missense	23	43.90	18	SNP	0.966	A
COMP	1311	genome.wustl.edu	37	19	18897405	18897405	+	Silent	SNP	G	G	A			TCGA-A2-A04R-01A-41D-A117-09	TCGA-A2-A04R-10B-01D-A10G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f8e4326-dfc7-4635-a9b7-a9207a392748	6234c5ee-14f2-427c-9ebc-4911da27a849	g.chr19:18897405G>A	ENST00000222271.2	-	11	1235	c.1191C>T	c.(1189-1191)gaC>gaT	p.D397D	COMP_ENST00000425807.1_Silent_p.D344D|COMP_ENST00000542601.2_Silent_p.D364D	NM_000095.2	NP_000086.2	P49747	COMP_HUMAN	cartilage oligomeric matrix protein	397			D -> H (in EDM1). {ECO:0000269|PubMed:21922596}.		apoptotic process (GO:0006915)|cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|growth plate cartilage development (GO:0003417)|limb development (GO:0060173)|negative regulation of apoptotic process (GO:0043066)|organ morphogenesis (GO:0009887)|skeletal system development (GO:0001501)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|collagen binding (GO:0005518)|extracellular matrix structural constituent (GO:0005201)|heparan sulfate proteoglycan binding (GO:0043395)|heparin binding (GO:0008201)|protease binding (GO:0002020)	p.D397D(1)		breast(6)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(12)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	32						CGCCATCACTGTCCTTCTGGT	0.602																																						dbGAP											1	Substitution - coding silent(1)	breast(1)	GRCh37	CD991683	COMP	D							167.0	123.0	138.0					19																	18897405		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			L32137	CCDS12385.1	19p13.1	2008-02-05				ENSG00000105664			2227	protein-coding gene	gene with protein product	"""thrombospondin-5"""	600310	"""cartilage oligomeric matrix protein (pseudoachondroplasia, epiphyseal dysplasia 1, multiple)"""	PSACH, EDM1, EPD1		7713493, 8307576	Standard	NM_000095		Approved	MED, THBS5	uc002nke.3	P49747	OTTHUMG00000169318	ENST00000222271.2:c.1191C>T	19.37:g.18897405G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B4DKJ3|O14592|Q16388|Q16389|Q2NL86|Q8N4T2	Silent	SNP	pfam_Thrombospondin_C,pfam_EGF-like_Ca-bd,pfam_Thbs/COMP_coiled-coil,pfam_Thrombospondin_3-like_rpt,superfamily_ConA-like_lec_gl,smart_EGF-like,smart_EGF-like_Ca-bd,pfscan_EG-like_dom	p.D397	ENST00000222271.2	37	c.1191	CCDS12385.1	19																																																																																			COMP	-	pfam_Thrombospondin_3-like_rpt	ENSG00000105664		0.602	COMP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COMP	HGNC	protein_coding	OTTHUMT00000403457.1	100	0.00	0	G	NM_000095		18897405	18897405	-1	no_errors	ENST00000222271	ensembl	human	known	69_37n	silent	64	38.46	40	SNP	1.000	A
CSMD2	114784	genome.wustl.edu	37	1	34068091	34068091	+	Missense_Mutation	SNP	G	G	T			TCGA-A2-A04R-01A-41D-A117-09	TCGA-A2-A04R-10B-01D-A10G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f8e4326-dfc7-4635-a9b7-a9207a392748	6234c5ee-14f2-427c-9ebc-4911da27a849	g.chr1:34068091G>T	ENST00000373380.1	-	22	3427	c.3207C>A	c.(3205-3207)ttC>ttA	p.F1069L	CSMD2_ENST00000489419.1_5'Flank|CSMD2_ENST00000373381.4_Missense_Mutation_p.F2196L|CSMD2_ENST00000373377.1_Missense_Mutation_p.F295L|CSMD2_ENST00000373388.2_Missense_Mutation_p.F295L			Q7Z408	CSMD2_HUMAN	CUB and Sushi multiple domains 2	2198	Sushi 6. {ECO:0000255|PROSITE- ProRule:PRU00302}.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.F2198L(1)		NS(5)|breast(5)|central_nervous_system(3)|cervix(2)|endometrium(20)|haematopoietic_and_lymphoid_tissue(4)|kidney(9)|large_intestine(43)|lung(114)|ovary(8)|pancreas(1)|prostate(6)|skin(20)|upper_aerodigestive_tract(5)|urinary_tract(1)	246		Myeloproliferative disorder(586;0.0294)|all_neural(195;0.249)				ACGGGCTAGGGAACCCCGGGG	0.622																																						dbGAP											1	Substitution - Missense(1)	breast(1)											65.0	61.0	63.0					1																	34068091		2203	4300	6503	-	-	-	SO:0001583	missense	0			AY210418	CCDS380.1, CCDS60082.1	1p34.3	2014-01-28			ENSG00000121904	ENSG00000121904			19290	protein-coding gene	gene with protein product		608398				11472063, 11572484	Standard	NM_001281956		Approved	KIAA1884	uc001bxn.1	Q7Z408	OTTHUMG00000011135	ENST00000373380.1:c.3207C>A	1.37:g.34068091G>T	ENSP00000362478:p.Phe1069Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	B1AM50|E7EUA6|Q53TY4|Q5VT59|Q8N963|Q96Q03|Q9H4V7|Q9H4V8|Q9H4V9|Q9H4W0|Q9H4W1|Q9H4W2|Q9H4W3|Q9H4W4|Q9HCY5|Q9HCY6|Q9HCY7	Missense_Mutation	SNP	pfam_CUB,pfam_Sushi_SCR_CCP,superfamily_CUB,superfamily_Complement_control_module,smart_CUB,smart_Sushi_SCR_CCP,pfscan_CUB,pfscan_Sushi_SCR_CCP	p.F2196L	ENST00000373380.1	37	c.6588		1	.	.	.	.	.	.	.	.	.	.	G	23.1	4.380908	0.82792	.	.	ENSG00000121904	ENST00000373381;ENST00000373380;ENST00000373377;ENST00000373388	T;T;T;T	0.20200	2.09;2.09;2.09;2.09	5.49	3.61	0.41365	CUB (5);	0.139770	0.51477	D	0.000085	T	0.33673	0.0871	M	0.88704	2.975	0.45930	D	0.998768	B;B;B	0.34255	0.069;0.445;0.281	B;B;B	0.39617	0.168;0.305;0.305	T	0.08722	-1.0708	10	0.34782	T	0.22	.	10.752	0.46216	0.2153:0.0:0.7847:0.0	.	1069;2198;2196	Q7Z408-2;Q7Z408;E7EUA6	.;CSMD2_HUMAN;.	L	2196;1069;295;295	ENSP00000362479:F2196L;ENSP00000362478:F1069L;ENSP00000362475:F295L;ENSP00000362486:F295L	ENSP00000241312:F2198L	F	-	3	2	CSMD2	33840678	1.000000	0.71417	0.991000	0.47740	0.974000	0.67602	2.584000	0.46102	0.693000	0.31634	0.655000	0.94253	TTC	CSMD2	-	pfam_CUB,superfamily_CUB,smart_CUB,pfscan_CUB	ENSG00000121904		0.622	CSMD2-002	KNOWN	basic	protein_coding	CSMD2	HGNC	protein_coding	OTTHUMT00000030635.4	43	0.00	0	G	NM_052896		34068091	34068091	-1	no_errors	ENST00000373381	ensembl	human	known	69_37n	missense	7	66.67	14	SNP	1.000	T
DNAH12	201625	genome.wustl.edu	37	3	57456362	57456362	+	Splice_Site	SNP	T	T	A			TCGA-A2-A04R-01A-41D-A117-09	TCGA-A2-A04R-10B-01D-A10G-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f8e4326-dfc7-4635-a9b7-a9207a392748	6234c5ee-14f2-427c-9ebc-4911da27a849	g.chr3:57456362T>A	ENST00000351747.2	-	16	2093	c.1913A>T	c.(1912-1914)tAt>tTt	p.Y638F	snoU13_ENST00000459308.1_RNA|DNAH12_ENST00000389536.4_Splice_Site_p.Y638F	NM_178504.4	NP_848599.3	Q6ZR08	DYH12_HUMAN	dynein, axonemal, heavy chain 12	638	Stem. {ECO:0000250}.				microtubule-based movement (GO:0007018)	cilium (GO:0005929)|cytoplasm (GO:0005737)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)	p.Y638F(1)		breast(3)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(4)|lung(7)|pancreas(1)|prostate(1)|skin(1)	25						ATCTGTCACATACTGAAAGTA	0.279																																						dbGAP											1	Substitution - Missense(1)	breast(1)											40.0	33.0	35.0					3																	57456362		692	1585	2277	-	-	-	SO:0001630	splice_region_variant	0			U53532, AK126276	CCDS33771.1	3p21.1	2009-02-04	2006-09-04		ENSG00000174844	ENSG00000174844		"""Axonemal dyneins"""	2943	protein-coding gene	gene with protein product		603340	"""dynein, axonemal, heavy polypeptide 12"", ""dynein heavy chain domain 2"", ""dynein heavy domain 2"", ""dynein, axonemal, heavy chain 12-like"", ""dynein, axonemal, heavy chain 7-like"""	DNHD2, DNAH12L, DNAH7L		8812413, 8666668	Standard	NM_198564		Approved	DLP12, Dnahc3, HL-19, hdhc3, DHC3, FLJ40427, FLJ44290	uc003dit.2	Q6ZR08	OTTHUMG00000158598	ENST00000351747.2:c.1912-1A>T	3.37:g.57456362T>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A6NGI2|Q6ZTR8|Q8N7R9|Q8WXK2|Q92816	Missense_Mutation	SNP	pfam_Dynein_heavy,pfam_Dynein_heavy_dom-2,pfam_ATPase_dyneun-rel_AAA,smart_AAA+_ATPase	p.Y638F	ENST00000351747.2	37	c.1913		3	.	.	.	.	.	.	.	.	.	.	T	18.01	3.526869	0.64860	.	.	ENSG00000174844	ENST00000351747;ENST00000495027;ENST00000389536	T;T;T	0.24908	2.0;1.83;3.2	5.46	5.46	0.80206	.	0.304271	0.22012	N	0.065844	T	0.51244	0.1663	M	0.77103	2.36	0.80722	D	1	D	0.69078	0.997	D	0.75020	0.985	T	0.48410	-0.9038	10	0.30078	T	0.28	.	15.5364	0.76007	0.0:0.0:0.0:1.0	.	638	Q6ZR08	DYH12_HUMAN	F	638	ENSP00000295937:Y638F;ENSP00000418137:Y638F;ENSP00000374187:Y638F	ENSP00000295937:Y638F	Y	-	2	0	DNAH12	57431402	1.000000	0.71417	1.000000	0.80357	0.672000	0.39443	7.954000	0.87848	2.057000	0.61298	0.482000	0.46254	TAT	DNAH12	-	NULL	ENSG00000174844		0.279	DNAH12-202	KNOWN	basic|appris_principal	protein_coding	DNAH12	HGNC	protein_coding		124	0.00	0	T	NM_178504	Missense_Mutation	57456362	57456362	-1	no_errors	ENST00000351747	ensembl	human	known	69_37n	missense	54	41.30	38	SNP	1.000	A
DOK3	79930	genome.wustl.edu	37	5	176931757	176931757	+	Missense_Mutation	SNP	A	A	T			TCGA-A2-A04R-01A-41D-A117-09	TCGA-A2-A04R-10B-01D-A10G-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f8e4326-dfc7-4635-a9b7-a9207a392748	6234c5ee-14f2-427c-9ebc-4911da27a849	g.chr5:176931757A>T	ENST00000357198.4	-	5	804	c.800T>A	c.(799-801)tTc>tAc	p.F267Y	DOK3_ENST00000312943.6_Missense_Mutation_p.F211Y|DOK3_ENST00000501403.2_Missense_Mutation_p.F211Y|DOK3_ENST00000377112.4_Missense_Mutation_p.F109Y|RP11-1334A24.6_ENST00000506025.1_RNA	NM_024872.2	NP_079148.2	Q7L591	DOK3_HUMAN	docking protein 3	267	IRS-type PTB. {ECO:0000255|PROSITE- ProRule:PRU00389}.			F -> L (in Ref. 1; BAB15399). {ECO:0000305}.	Ras protein signal transduction (GO:0007265)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)		p.L267H(1)		NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|lung(7)	13	all_cancers(89;0.00033)|Renal(175;0.000269)|Lung NSC(126;0.00161)|all_lung(126;0.00286)	all_neural(177;0.00802)|Medulloblastoma(196;0.0145)|all_hematologic(541;0.248)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)|Epithelial(233;0.191)			GTCGGAGCCGAACTTGCGCAG	0.687																																						dbGAP											1	Substitution - Missense(1)	breast(1)											50.0	56.0	54.0					5																	176931757		2202	4300	6502	-	-	-	SO:0001583	missense	0			AK026223	CCDS4426.1, CCDS47349.1, CCDS47350.1	5q35	2008-02-05			ENSG00000146094	ENSG00000146094			24583	protein-coding gene	gene with protein product		611435				10733577, 12595900	Standard	NM_024872		Approved	FLJ22570	uc003mhk.3	Q7L591	OTTHUMG00000130850	ENST00000357198.4:c.800T>A	5.37:g.176931757A>T	ENSP00000349727:p.Phe267Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV	E9PAT0|H7BXS0|Q8N864|Q9BQB3|Q9H666	Missense_Mutation	SNP	pfam_Insln_rcpt_S1,smart_Pleckstrin_homology,smart_Insln_rcpt_S1,pfscan_Insln_rcpt_S1	p.F267Y	ENST00000357198.4	37	c.800	CCDS4426.1	5	.	.	.	.	.	.	.	.	.	.	A	11.80	1.747787	0.30955	.	.	ENSG00000146094	ENST00000312943;ENST00000377112;ENST00000357198;ENST00000501403;ENST00000510380	T;T;T;T;T	0.74002	-0.8;-0.8;-0.8;-0.8;-0.8	4.83	3.63	0.41609	Pleckstrin homology-type (1);Insulin receptor substrate-1, PTB (3);	0.086995	0.44483	N	0.000443	T	0.57417	0.2052	N	0.11789	0.175	0.29007	N	0.887091	B;B;B;P	0.45474	0.064;0.449;0.154;0.859	B;B;B;P	0.48677	0.213;0.116;0.048;0.586	T	0.56390	-0.7987	10	0.02654	T	1	-0.4934	9.4539	0.38743	0.8422:0.0:0.0:0.1578	.	267;109;211;97	Q7L591;E9PAT0;Q7L591-3;Q7L591-2	DOK3_HUMAN;.;.;.	Y	211;109;267;211;211	ENSP00000325174:F211Y;ENSP00000366316:F109Y;ENSP00000349727:F267Y;ENSP00000421688:F211Y;ENSP00000422395:F211Y	ENSP00000325174:F211Y	F	-	2	0	DOK3	176864363	1.000000	0.71417	0.997000	0.53966	0.676000	0.39594	4.554000	0.60760	0.649000	0.30751	0.402000	0.26972	TTC	DOK3	-	pfam_Insln_rcpt_S1,smart_Insln_rcpt_S1,pfscan_Insln_rcpt_S1	ENSG00000146094		0.687	DOK3-001	KNOWN	basic|CCDS	protein_coding	DOK3	HGNC	protein_coding	OTTHUMT00000253420.4	25	0.00	0	A	NM_024872		176931757	176931757	-1	no_errors	ENST00000357198	ensembl	human	known	69_37n	missense	10	41.18	7	SNP	1.000	T
DUSP9	1852	genome.wustl.edu	37	X	152915602	152915602	+	Missense_Mutation	SNP	T	T	A			TCGA-A2-A04R-01A-41D-A117-09	TCGA-A2-A04R-10B-01D-A10G-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f8e4326-dfc7-4635-a9b7-a9207a392748	6234c5ee-14f2-427c-9ebc-4911da27a849	g.chrX:152915602T>A	ENST00000342782.3	+	4	1262	c.997T>A	c.(997-999)Ttc>Atc	p.F333I	DUSP9_ENST00000370167.4_Missense_Mutation_p.F333I			Q99956	DUS9_HUMAN	dual specificity phosphatase 9	333	Tyrosine-protein phosphatase.				inactivation of MAPK activity (GO:0000188)|JNK cascade (GO:0007254)|protein dephosphorylation (GO:0006470)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	MAP kinase tyrosine/serine/threonine phosphatase activity (GO:0017017)|phosphoprotein phosphatase activity (GO:0004721)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)	p.F333I(1)		breast(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(9)|ovary(2)|prostate(1)	16	all_hematologic(71;4.25e-06)|Acute lymphoblastic leukemia(192;6.56e-05)					CAACTTCAACTTCATGGGGCA	0.597																																						dbGAP											1	Substitution - Missense(1)	breast(1)											227.0	198.0	208.0					X																	152915602		2203	4300	6503	-	-	-	SO:0001583	missense	0			Y08302	CCDS14724.1	Xq28	2011-06-09			ENSG00000130829	ENSG00000130829		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : MAP kinase phosphatases"""	3076	protein-coding gene	gene with protein product	"""map kinase phosphatase 4"""	300134				9030581, 9286695	Standard	NM_001395		Approved	MKP-4, MKP4	uc004fhx.4	Q99956	OTTHUMG00000024211	ENST00000342782.3:c.997T>A	X.37:g.152915602T>A	ENSP00000345853:p.Phe333Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DWU5	Missense_Mutation	SNP	pfam_Dual-sp_phosphatase_cat-dom,pfam_Rhodanese-like_dom,superfamily_Rhodanese-like_dom,smart_Rhodanese-like_dom,smart_Dual-sp_phosphatase_subgr_cat,pirsf_MKP,pfscan_Rhodanese-like_dom,pfscan_Tyr/Dual-specificity_Pase,pfscan_Dual-sp_phosphatase_subgr_cat,prints_MKP	p.F333I	ENST00000342782.3	37	c.997	CCDS14724.1	X	.	.	.	.	.	.	.	.	.	.	t	26.4	4.738468	0.89573	.	.	ENSG00000130829	ENST00000370167;ENST00000342782	D;D	0.90004	-2.6;-2.6	4.53	3.32	0.38043	Dual specificity phosphatase, catalytic domain (1);Dual specificity phosphatase, subgroup, catalytic domain (2);	0.000000	0.64402	D	0.000004	D	0.96741	0.8936	H	0.99609	4.655	0.58432	D	0.999999	D	0.89917	1.0	D	0.83275	0.996	D	0.95499	0.8576	10	0.87932	D	0	.	9.6754	0.40037	0.0:0.0:0.1732:0.8268	.	333	Q99956	DUS9_HUMAN	I	333	ENSP00000359186:F333I;ENSP00000345853:F333I	ENSP00000345853:F333I	F	+	1	0	DUSP9	152568796	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	7.676000	0.84012	0.663000	0.31027	0.430000	0.28490	TTC	DUSP9	-	pfam_Dual-sp_phosphatase_cat-dom,smart_Dual-sp_phosphatase_subgr_cat,pirsf_MKP,pfscan_Dual-sp_phosphatase_subgr_cat	ENSG00000130829		0.597	DUSP9-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	DUSP9	HGNC	protein_coding	OTTHUMT00000061022.3	69	0.00	0	T	NM_001395		152915602	152915602	+1	no_errors	ENST00000342782	ensembl	human	known	69_37n	missense	33	46.77	29	SNP	1.000	A
E2F1	1869	genome.wustl.edu	37	20	32267630	32267630	+	Missense_Mutation	SNP	T	T	C			TCGA-A2-A04R-01A-41D-A117-09	TCGA-A2-A04R-10B-01D-A10G-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f8e4326-dfc7-4635-a9b7-a9207a392748	6234c5ee-14f2-427c-9ebc-4911da27a849	g.chr20:32267630T>C	ENST00000343380.5	-	3	642	c.503A>G	c.(502-504)tAt>tGt	p.Y168C		NM_005225.2	NP_005216.1	Q01094	E2F1_HUMAN	E2F transcription factor 1	168	Interaction with BIRC2/c-IAP1.|Leucine-zipper.				anoikis (GO:0043276)|apoptotic process (GO:0006915)|cellular response to fatty acid (GO:0071398)|cellular response to hypoxia (GO:0071456)|DNA damage checkpoint (GO:0000077)|forebrain development (GO:0030900)|G1/S transition of mitotic cell cycle (GO:0000082)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|lens fiber cell apoptotic process (GO:1990086)|mitotic cell cycle (GO:0000278)|mRNA stabilization (GO:0048255)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0071930)|negative regulation of transcription, DNA-templated (GO:0045892)|Notch signaling pathway (GO:0007219)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of gene expression (GO:0010628)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of G1/S transition of mitotic cell cycle (GO:2000045)|regulation of transcription, DNA-templated (GO:0006355)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|Rb-E2F complex (GO:0035189)	core promoter binding (GO:0001047)|DNA binding (GO:0003677)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)	p.Y168C(1)		NS(2)|breast(1)|endometrium(3)|lung(8)|prostate(1)|upper_aerodigestive_tract(1)	16						GGTGATGTCATAGATGCGCCG	0.602																																						dbGAP											1	Substitution - Missense(1)	breast(1)											182.0	152.0	162.0					20																	32267630		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS13224.1	20q11	2008-05-14			ENSG00000101412	ENSG00000101412			3113	protein-coding gene	gene with protein product		189971		RBBP3		8964493	Standard	NM_005225		Approved	RBP3	uc002wzu.4	Q01094	OTTHUMG00000032265	ENST00000343380.5:c.503A>G	20.37:g.32267630T>C	ENSP00000345571:p.Tyr168Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q13143|Q92768	Missense_Mutation	SNP	pfam_E2F_TDP	p.Y168C	ENST00000343380.5	37	c.503	CCDS13224.1	20	.	.	.	.	.	.	.	.	.	.	T	22.7	4.324844	0.81580	.	.	ENSG00000101412	ENST00000343380	T	0.71817	-0.6	4.72	4.72	0.59763	Transcription factor E2F/dimerisation partner (TDP) (1);Winged helix-turn-helix transcription repressor DNA-binding (1);	0.000000	0.85682	D	0.000000	D	0.88855	0.6550	H	0.96996	3.92	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.92236	0.5796	10	0.87932	D	0	0.5254	13.6053	0.62044	0.0:0.0:0.0:1.0	.	168	Q01094	E2F1_HUMAN	C	168	ENSP00000345571:Y168C	ENSP00000345571:Y168C	Y	-	2	0	E2F1	31731291	1.000000	0.71417	0.977000	0.42913	0.924000	0.55760	7.825000	0.86693	2.108000	0.64289	0.379000	0.24179	TAT	E2F1	-	pfam_E2F_TDP	ENSG00000101412		0.602	E2F1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	E2F1	HGNC	protein_coding	OTTHUMT00000078731.2	95	0.00	0	T			32267630	32267630	-1	no_errors	ENST00000343380	ensembl	human	known	69_37n	missense	53	32.91	26	SNP	1.000	C
ECM1	1893	genome.wustl.edu	37	1	150484230	150484230	+	Missense_Mutation	SNP	C	C	A			TCGA-A2-A04R-01A-41D-A117-09	TCGA-A2-A04R-10B-01D-A10G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f8e4326-dfc7-4635-a9b7-a9207a392748	6234c5ee-14f2-427c-9ebc-4911da27a849	g.chr1:150484230C>A	ENST00000369047.4	+	7	1131	c.1006C>A	c.(1006-1008)Ctg>Atg	p.L336M	ECM1_ENST00000369049.4_Missense_Mutation_p.L363M|ECM1_ENST00000346569.6_Intron|ECM1_ENST00000470432.1_3'UTR	NM_004425.3	NP_004416.2	Q16610	ECM1_HUMAN	extracellular matrix protein 1	336	2 X approximate repeats.				angiogenesis (GO:0001525)|biomineral tissue development (GO:0031214)|inflammatory response (GO:0006954)|negative regulation of bone mineralization (GO:0030502)|negative regulation of cytokine-mediated signaling pathway (GO:0001960)|negative regulation of peptidase activity (GO:0010466)|ossification (GO:0001503)|positive regulation of angiogenesis (GO:0045766)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|regulation of T cell migration (GO:2000404)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of type 2 immune response (GO:0002828)|signal transduction (GO:0007165)	extracellular matrix (GO:0031012)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	enzyme binding (GO:0019899)|laminin binding (GO:0043236)|protease binding (GO:0002020)|protein C-terminus binding (GO:0008022)|signal transducer activity (GO:0004871)	p.L336M(1)|p.L363M(1)		NS(1)|breast(2)|central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(1)|lung(7)|ovary(2)|prostate(3)|urinary_tract(1)	22	all_cancers(9;3.13e-53)|all_epithelial(9;3.74e-43)|all_lung(15;2.43e-34)|Lung NSC(24;8.86e-31)|Breast(34;0.000326)|Lung SC(34;0.00471)|Ovarian(49;0.0167)|all_hematologic(923;0.0395)|Hepatocellular(266;0.108)|Melanoma(130;0.128)|Colorectal(459;0.171)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0757)|all cancers(9;1.29e-21)|BRCA - Breast invasive adenocarcinoma(12;0.000734)|LUSC - Lung squamous cell carcinoma(543;0.171)|STAD - Stomach adenocarcinoma(528;0.206)			AAGGGAGCTGCTGGCACTGAT	0.607																																					Melanoma(156;1696 2560 11093 19685)	dbGAP											2	Substitution - Missense(2)	breast(2)											45.0	44.0	44.0					1																	150484230		2203	4300	6503	-	-	-	SO:0001583	missense	0			U68186	CCDS953.1, CCDS954.1, CCDS55632.1	1q21	2008-02-05			ENSG00000143369	ENSG00000143369			3153	protein-coding gene	gene with protein product		602201				9367673, 9501329	Standard	NM_004425		Approved		uc001eus.3	Q16610	OTTHUMG00000012806	ENST00000369047.4:c.1006C>A	1.37:g.150484230C>A	ENSP00000358043:p.Leu336Met	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K8S0|B4DW49|B4DY60|O43266|Q5T5G4|Q5T5G5|Q5T5G6|Q8IZ60	Missense_Mutation	SNP	pfam_ECM1,superfamily_Serum_albumin-like	p.L363M	ENST00000369047.4	37	c.1087	CCDS953.1	1	.	.	.	.	.	.	.	.	.	.	C	10.71	1.428051	0.25726	.	.	ENSG00000143369	ENST00000369049;ENST00000369047	T;T	0.76578	-1.03;-1.03	4.19	4.19	0.49359	.	0.628980	0.14745	N	0.300908	T	0.63271	0.2497	N	0.22421	0.69	0.80722	D	1	P;P;P	0.45634	0.856;0.863;0.728	B;P;B	0.48227	0.346;0.571;0.295	T	0.67377	-0.5686	10	0.54805	T	0.06	-0.8122	12.1957	0.54296	0.0:1.0:0.0:0.0	.	363;336;336	Q16610-4;C8CHS3;Q16610	.;.;ECM1_HUMAN	M	363;336	ENSP00000358045:L363M;ENSP00000358043:L336M	ENSP00000358043:L336M	L	+	1	2	ECM1	148750854	0.058000	0.20735	0.867000	0.34043	0.296000	0.27459	1.437000	0.34991	2.331000	0.79229	0.555000	0.69702	CTG	ECM1	-	pfam_ECM1	ENSG00000143369		0.607	ECM1-011	KNOWN	basic|appris_principal|CCDS	protein_coding	ECM1	HGNC	protein_coding	OTTHUMT00000035832.2	19	0.00	0	C	NM_004425		150484230	150484230	+1	no_errors	ENST00000369049	ensembl	human	known	69_37n	missense	27	25.00	9	SNP	0.791	A
EFNB1	1947	genome.wustl.edu	37	X	68060252	68060252	+	Missense_Mutation	SNP	C	C	T			TCGA-A2-A04R-01A-41D-A117-09	TCGA-A2-A04R-10B-01D-A10G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f8e4326-dfc7-4635-a9b7-a9207a392748	6234c5ee-14f2-427c-9ebc-4911da27a849	g.chrX:68060252C>T	ENST00000204961.4	+	5	1576	c.796C>T	c.(796-798)Cgc>Tgc	p.R266C		NM_004429.4	NP_004420.1	P98172	EFNB1_HUMAN	ephrin-B1	266					axon guidance (GO:0007411)|cell adhesion (GO:0007155)|cell-cell signaling (GO:0007267)|embryonic pattern specification (GO:0009880)|ephrin receptor signaling pathway (GO:0048013)|neural crest cell migration (GO:0001755)|positive regulation of T cell proliferation (GO:0042102)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|synapse (GO:0045202)	ephrin receptor binding (GO:0046875)	p.R266C(2)		breast(1)|endometrium(7)|kidney(1)|large_intestine(3)|lung(9)|ovary(1)	22						ACTGAAGCTACGCAAGCGGCA	0.627																																						dbGAP											2	Substitution - Missense(2)	ovary(1)|breast(1)											47.0	42.0	44.0					X																	68060252		2203	4300	6503	-	-	-	SO:0001583	missense	0			U09303	CCDS14391.1	Xq12	2011-03-09			ENSG00000090776	ENSG00000090776		"""Ephrins"""	3226	protein-coding gene	gene with protein product		300035	"""craniofrontonasal syndrome (craniofrontonasal dysplasia)"""	EPLG2, CFNS		7774950, 16526919	Standard	NM_004429		Approved	LERK2, Elk-L	uc004dxd.4	P98172	OTTHUMG00000021751	ENST00000204961.4:c.796C>T	X.37:g.68060252C>T	ENSP00000204961:p.Arg266Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DVU0	Missense_Mutation	SNP	pfam_Ephrin,superfamily_Cupredoxin,prints_Ephrin	p.R266C	ENST00000204961.4	37	c.796	CCDS14391.1	X	.	.	.	.	.	.	.	.	.	.	C	21.0	4.074672	0.76415	.	.	ENSG00000090776	ENST00000204961	D	0.92699	-3.09	5.06	5.06	0.68205	.	0.000000	0.85682	D	0.000000	D	0.95674	0.8593	M	0.78637	2.42	0.80722	D	1	D	0.89917	1.0	D	0.80764	0.994	D	0.96106	0.9073	10	0.87932	D	0	-23.9897	14.6783	0.68998	0.0:1.0:0.0:0.0	.	266	P98172	EFNB1_HUMAN	C	266	ENSP00000204961:R266C	ENSP00000204961:R266C	R	+	1	0	EFNB1	67976977	1.000000	0.71417	0.997000	0.53966	0.963000	0.63663	4.349000	0.59385	2.343000	0.79666	0.529000	0.55759	CGC	EFNB1	-	NULL	ENSG00000090776		0.627	EFNB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EFNB1	HGNC	protein_coding	OTTHUMT00000057029.1	58	0.00	0	C	NM_004429		68060252	68060252	+1	no_errors	ENST00000204961	ensembl	human	known	69_37n	missense	44	41.33	31	SNP	0.998	T
EDA	1896	genome.wustl.edu	37	X	69247730	69247730	+	Missense_Mutation	SNP	C	C	A	rs397516666|rs397516665		TCGA-A2-A04R-01A-41D-A117-09	TCGA-A2-A04R-10B-01D-A10G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f8e4326-dfc7-4635-a9b7-a9207a392748	6234c5ee-14f2-427c-9ebc-4911da27a849	g.chrX:69247730C>A	ENST00000374552.4	+	4	792	c.550C>A	c.(550-552)Ccc>Acc	p.P184T	EDA_ENST00000374553.2_Missense_Mutation_p.P184T|EDA_ENST00000524573.1_Missense_Mutation_p.P184T	NM_001399.4	NP_001390.1	Q92838	EDA_HUMAN	ectodysplasin A	184	Collagen-like.		Missing (in XHED). {ECO:0000269|PubMed:11279189, ECO:0000269|PubMed:18231121}.|Missing (in XHED). {ECO:0000269|PubMed:18231121}.		cell differentiation (GO:0030154)|cell-matrix adhesion (GO:0007160)|ectoderm development (GO:0007398)|gene expression (GO:0010467)|hair follicle placode formation (GO:0060789)|immune response (GO:0006955)|odontogenesis of dentin-containing tooth (GO:0042475)|pigmentation (GO:0043473)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of NF-kappaB import into nucleus (GO:0042346)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|salivary gland cavitation (GO:0060662)|signal transduction (GO:0007165)|trachea gland development (GO:0061153)	apical part of cell (GO:0045177)|collagen trimer (GO:0005581)|cytoskeleton (GO:0005856)|endoplasmic reticulum membrane (GO:0005789)|extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|plasma membrane (GO:0005886)	receptor binding (GO:0005102)	p.P184T(2)		breast(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(3)|ovary(2)|urinary_tract(1)	14						ACCTCCTGGACCCAATGGCCC	0.542																																						dbGAP											2	Substitution - Missense(2)	breast(2)											13.0	13.0	13.0					X																	69247730		2150	4177	6327	-	-	-	SO:0001583	missense	0			U59227	CCDS14394.1, CCDS35318.1, CCDS35319.1, CCDS43966.1, CCDS35318.2, CCDS35319.2, CCDS55436.1	Xq12-q13.1	2013-05-22	2004-08-09	2004-08-12	ENSG00000158813	ENSG00000158813		"""Tumor necrosis factor (ligand) superfamily"""	3157	protein-coding gene	gene with protein product		300451	"""ectodermal dysplasia 1, anhidrotic"", ""oligodontia 1"""	ED1, EDA2, ODT1		8696334, 18657636, 16583127	Standard	NM_001005612		Approved	EDA1, XLHED, HED, XHED, ED1-A1, ED1-A2, EDA-A1, EDA-A2	uc004dxs.3	Q92838	OTTHUMG00000021764	ENST00000374552.4:c.550C>A	X.37:g.69247730C>A	ENSP00000363680:p.Pro184Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	A0AUZ2|A2A337|B7ZLU2|B7ZLU4|O75910|Q5JS00|Q5JUM7|Q9UP77|Q9Y6L0|Q9Y6L1|Q9Y6L2|Q9Y6L3|Q9Y6L4	Missense_Mutation	SNP	pfam_TNF,pfam_Collagen,superfamily_Tumour_necrosis_fac-like,pfscan_TNF	p.P184T	ENST00000374552.4	37	c.550	CCDS14394.1	X	.	.	.	.	.	.	.	.	.	.	C	15.86	2.956885	0.53293	.	.	ENSG00000158813	ENST00000374552;ENST00000374553;ENST00000524573;ENST00000503592	D;D;D;T	0.95724	-3.79;-3.79;-3.79;0.86	4.67	4.67	0.58626	.	0.172194	0.38326	N	0.001726	D	0.97188	0.9081	M	0.70842	2.15	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.87578	0.996;0.998;0.996	D	0.97118	0.9809	10	0.45353	T	0.12	-8.8461	15.7687	0.78146	0.0:1.0:0.0:0.0	.	184;184;184	Q92838-9;Q92838;Q92838-3	.;EDA_HUMAN;.	T	184;184;184;52	ENSP00000363680:P184T;ENSP00000363681:P184T;ENSP00000432585:P184T;ENSP00000423037:P52T	ENSP00000363680:P184T	P	+	1	0	EDA	69164455	1.000000	0.71417	0.991000	0.47740	0.984000	0.73092	3.248000	0.51430	2.173000	0.68751	0.597000	0.82753	CCC	EDA	-	pfam_Collagen	ENSG00000158813		0.542	EDA-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	EDA	HGNC	protein_coding	OTTHUMT00000057048.2	23	0.00	0	C	NM_001399		69247730	69247730	+1	no_errors	ENST00000374552	ensembl	human	known	69_37n	missense	12	58.62	17	SNP	0.997	A
EXPH5	23086	genome.wustl.edu	37	11	108381259	108381259	+	Missense_Mutation	SNP	A	A	T			TCGA-A2-A04R-01A-41D-A117-09	TCGA-A2-A04R-10B-01D-A10G-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f8e4326-dfc7-4635-a9b7-a9207a392748	6234c5ee-14f2-427c-9ebc-4911da27a849	g.chr11:108381259A>T	ENST00000265843.4	-	6	5085	c.4975T>A	c.(4975-4977)Ttg>Atg	p.L1659M	EXPH5_ENST00000428840.1_Missense_Mutation_p.L1583M|EXPH5_ENST00000525344.1_Missense_Mutation_p.L1652M|EXPH5_ENST00000443411.1_Missense_Mutation_p.L1471M|EXPH5_ENST00000524840.1_5'Flank	NM_015065.2	NP_055880	Q8NEV8	EXPH5_HUMAN	exophilin 5	1659					intracellular protein transport (GO:0006886)|keratinocyte development (GO:0003334)|multivesicular body sorting pathway (GO:0071985)|positive regulation of exocytosis (GO:0045921)|positive regulation of protein secretion (GO:0050714)	endosome (GO:0005768)	Rab GTPase binding (GO:0017137)	p.L1659M(1)		breast(3)|central_nervous_system(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(13)|liver(1)|lung(34)|ovary(3)|pancreas(2)|prostate(2)|skin(11)|stomach(3)|upper_aerodigestive_tract(1)	91		all_cancers(61;3.99e-08)|Acute lymphoblastic leukemia(157;3.97e-05)|Melanoma(852;4.04e-05)|all_epithelial(67;0.000116)|all_hematologic(158;0.000315)|Breast(348;0.104)|all_neural(303;0.16)		Epithelial(105;8.1e-06)|BRCA - Breast invasive adenocarcinoma(274;1.22e-05)|all cancers(92;0.000129)|OV - Ovarian serous cystadenocarcinoma(223;0.11)|Colorectal(284;0.184)		TTCTCACTCAACCTGCTTTCG	0.488																																						dbGAP											1	Substitution - Missense(1)	breast(1)											187.0	183.0	184.0					11																	108381259		2201	4298	6499	-	-	-	SO:0001583	missense	0				CCDS8341.1	11q22.3	2008-02-05			ENSG00000110723	ENSG00000110723			30578	protein-coding gene	gene with protein product	"""synaptotagmin-like homologue lacking C2 domains b"""	612878				9734811, 11773082	Standard	NM_015065		Approved	SLAC2-B	uc001pkk.3	Q8NEV8	OTTHUMG00000166536	ENST00000265843.4:c.4975T>A	11.37:g.108381259A>T	ENSP00000265843:p.Leu1659Met	Somatic		WXS	Illumina GAIIx	Phase_IV	Q2KHM1|Q9Y4D6	Missense_Mutation	SNP	superfamily_Znf_FYVE_PHD,pfscan_Rab-bd_domain	p.L1659M	ENST00000265843.4	37	c.4975	CCDS8341.1	11	.	.	.	.	.	.	.	.	.	.	A	16.65	3.182634	0.57800	.	.	ENSG00000110723	ENST00000265843;ENST00000428840;ENST00000443411;ENST00000525344;ENST00000526312	T;T;T;T;T	0.03635	4.09;4.01;3.86;4.09;3.93	5.2	-1.37	0.09056	.	0.841152	0.10395	N	0.679929	T	0.08179	0.0204	L	0.57536	1.79	0.09310	N	1	D	0.53151	0.958	P	0.54312	0.748	T	0.25047	-1.0143	10	0.44086	T	0.13	-1.1891	7.1282	0.25484	0.3417:0.1557:0.5026:0.0	.	1659	Q8NEV8	EXPH5_HUMAN	M	1659;1583;1471;1652;1583	ENSP00000265843:L1659M;ENSP00000391966:L1583M;ENSP00000411390:L1471M;ENSP00000432546:L1652M;ENSP00000432683:L1583M	ENSP00000265843:L1659M	L	-	1	2	EXPH5	107886469	0.000000	0.05858	0.001000	0.08648	0.119000	0.20118	-0.914000	0.04038	-0.313000	0.08728	0.528000	0.53228	TTG	EXPH5	-	NULL	ENSG00000110723		0.488	EXPH5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EXPH5	HGNC	protein_coding	OTTHUMT00000390279.1	136	0.00	0	A	NM_015065		108381259	108381259	-1	no_errors	ENST00000265843	ensembl	human	known	69_37n	missense	21	74.70	62	SNP	0.000	T
FAM107B	83641	genome.wustl.edu	37	10	14816305	14816305	+	Missense_Mutation	SNP	C	C	A			TCGA-A2-A04R-01A-41D-A117-09	TCGA-A2-A04R-10B-01D-A10G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f8e4326-dfc7-4635-a9b7-a9207a392748	6234c5ee-14f2-427c-9ebc-4911da27a849	g.chr10:14816305C>A	ENST00000181796.2	-	1	591	c.358G>T	c.(358-360)Gca>Tca	p.A120S		NM_031453.2	NP_113641.2	Q9H098	F107B_HUMAN	family with sequence similarity 107, member B	0					sensory perception of sound (GO:0007605)			p.A120S(1)		breast(7)|kidney(1)|large_intestine(4)|lung(7)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	25						AACACCACTGCTTCACAGTCC	0.587																																						dbGAP											1	Substitution - Missense(1)	breast(1)											113.0	98.0	103.0					10																	14816305		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK127413	CCDS7102.1, CCDS60486.1	10p14	2006-01-17	2006-01-17	2005-11-20	ENSG00000065809	ENSG00000065809			23726	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 45"""	C10orf45		11230166	Standard	XM_005252616		Approved	FLJ45505, MGC11034	uc001ina.1	Q9H098	OTTHUMG00000017709	ENST00000181796.2:c.358G>T	10.37:g.14816305C>A	ENSP00000181796:p.Ala120Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K1P4|D3DRT2|Q5T9K7|Q5T9K8|Q6ZSI4	Missense_Mutation	SNP	pfam_DUF1151	p.A120S	ENST00000181796.2	37	c.358	CCDS7102.1	10	.	.	.	.	.	.	.	.	.	.	C	9.196	1.027311	0.19512	.	.	ENSG00000065809	ENST00000181796	T	0.38077	1.16	4.95	2.96	0.34315	.	1.002710	0.08043	N	0.995485	T	0.21227	0.0511	N	0.14661	0.345	0.09310	N	1	B	0.14012	0.009	B	0.12837	0.008	T	0.17930	-1.0353	10	0.31617	T	0.26	-16.6751	5.9194	0.19073	0.1668:0.6547:0.0:0.1786	.	120	Q9H098-2	.	S	120	ENSP00000181796:A120S	ENSP00000181796:A120S	A	-	1	0	FAM107B	14856311	0.000000	0.05858	0.027000	0.17364	0.097000	0.18754	0.729000	0.26028	1.311000	0.45024	0.561000	0.74099	GCA	FAM107B	-	NULL	ENSG00000065809		0.587	FAM107B-001	KNOWN	basic|CCDS	protein_coding	FAM107B	HGNC	protein_coding	OTTHUMT00000356966.1	44	0.00	0	C	NM_031453		14816305	14816305	-1	no_errors	ENST00000181796	ensembl	human	known	69_37n	missense	29	50.00	29	SNP	0.000	A
FAM114A2	10827	genome.wustl.edu	37	5	153374519	153374519	+	Missense_Mutation	SNP	G	G	A			TCGA-A2-A04R-01A-41D-A117-09	TCGA-A2-A04R-10B-01D-A10G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f8e4326-dfc7-4635-a9b7-a9207a392748	6234c5ee-14f2-427c-9ebc-4911da27a849	g.chr5:153374519G>A	ENST00000351797.4	-	13	1419	c.1343C>T	c.(1342-1344)gCa>gTa	p.A448V	FAM114A2_ENST00000520667.1_Missense_Mutation_p.A448V|FAM114A2_ENST00000518946.1_5'UTR|FAM114A2_ENST00000522858.1_Missense_Mutation_p.A448V|FAM114A2_ENST00000520313.1_Missense_Mutation_p.A378V	NM_018691.2	NP_061161.2	Q9NRY5	F1142_HUMAN	family with sequence similarity 114, member A2	448							purine nucleotide binding (GO:0017076)	p.A448V(1)		NS(1)|breast(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(1)|lung(9)|skin(1)|urinary_tract(1)	18						AAGGACATCTGCCATTTCTTT	0.348																																						dbGAP											1	Substitution - Missense(1)	breast(1)											104.0	104.0	104.0					5																	153374519		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF159700	CCDS4323.1	5q31-q33	2008-06-13	2008-06-13	2008-06-13	ENSG00000055147	ENSG00000055147			1333	protein-coding gene	gene with protein product			"""chromosome 5 open reading frame 3"""	C5orf3		10843801	Standard	XM_005268359		Approved	133K02	uc003lvc.3	Q9NRY5	OTTHUMG00000130147	ENST00000351797.4:c.1343C>T	5.37:g.153374519G>A	ENSP00000341597:p.Ala448Val	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R8D8|Q9H7E0	Missense_Mutation	SNP	pfam_DUF719	p.A448V	ENST00000351797.4	37	c.1343	CCDS4323.1	5	.	.	.	.	.	.	.	.	.	.	G	12.85	2.060683	0.36373	.	.	ENSG00000055147	ENST00000351797;ENST00000522858;ENST00000520667;ENST00000520313	T;T;T;T	0.20881	2.28;2.28;2.28;2.04	5.2	5.2	0.72013	.	0.187317	0.47852	D	0.000204	T	0.27933	0.0688	M	0.69823	2.125	0.38759	D	0.954293	P;P	0.37122	0.544;0.583	B;B	0.36186	0.122;0.219	T	0.23476	-1.0187	10	0.72032	D	0.01	-9.3105	15.6444	0.77036	0.0:0.0:1.0:0.0	.	378;448	E7ESJ7;Q9NRY5	.;F1142_HUMAN	V	448;448;448;378	ENSP00000341597:A448V;ENSP00000430489:A448V;ENSP00000430384:A448V;ENSP00000429088:A378V	ENSP00000341597:A448V	A	-	2	0	FAM114A2	153354712	1.000000	0.71417	0.985000	0.45067	0.024000	0.10985	5.371000	0.66150	2.415000	0.81967	0.655000	0.94253	GCA	FAM114A2	-	NULL	ENSG00000055147		0.348	FAM114A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM114A2	HGNC	protein_coding	OTTHUMT00000252455.1	165	0.00	0	G	NM_018691		153374519	153374519	-1	no_errors	ENST00000351797	ensembl	human	known	69_37n	missense	84	41.26	59	SNP	1.000	A
FAM155A	728215	genome.wustl.edu	37	13	108518417	108518417	+	Silent	SNP	C	C	T			TCGA-A2-A04R-01A-41D-A117-09	TCGA-A2-A04R-10B-01D-A10G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f8e4326-dfc7-4635-a9b7-a9207a392748	6234c5ee-14f2-427c-9ebc-4911da27a849	g.chr13:108518417C>T	ENST00000375915.2	-	1	666	c.528G>A	c.(526-528)gcG>gcA	p.A176A		NM_001080396.2	NP_001073865.1	B1AL88	F155A_HUMAN	family with sequence similarity 155, member A	176						integral component of membrane (GO:0016021)		p.A176A(1)		breast(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(11)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	33						GGCCCGAGGACGCGCCCTGGG	0.672																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											31.0	39.0	36.0					13																	108518417		2192	4287	6479	-	-	-	SO:0001819	synonymous_variant	0			L10374	CCDS32006.1	13q33.3	2008-04-15			ENSG00000204442	ENSG00000204442			33877	protein-coding gene	gene with protein product							Standard	NM_001080396		Approved		uc001vql.3	B1AL88	OTTHUMG00000017326	ENST00000375915.2:c.528G>A	13.37:g.108518417C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B2RUV1|B7Z334	Silent	SNP	NULL	p.A176	ENST00000375915.2	37	c.528	CCDS32006.1	13																																																																																			FAM155A	-	NULL	ENSG00000204442		0.672	FAM155A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM155A	HGNC	protein_coding	OTTHUMT00000045736.2	11	0.00	0	C	NM_001080396		108518417	108518417	-1	no_errors	ENST00000375915	ensembl	human	known	69_37n	silent	6	45.45	5	SNP	0.984	T
FAM167A	83648	genome.wustl.edu	37	8	11301703	11301703	+	Missense_Mutation	SNP	T	T	A			TCGA-A2-A04R-01A-41D-A117-09	TCGA-A2-A04R-10B-01D-A10G-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f8e4326-dfc7-4635-a9b7-a9207a392748	6234c5ee-14f2-427c-9ebc-4911da27a849	g.chr8:11301703T>A	ENST00000528897.1	-	2	837	c.218A>T	c.(217-219)gAg>gTg	p.E73V	FAM167A_ENST00000284486.4_Missense_Mutation_p.E73V|FAM167A_ENST00000534308.1_Missense_Mutation_p.E73V|FAM167A_ENST00000531564.1_5'Flank			Q96KS9	F167A_HUMAN	family with sequence similarity 167, member A	73								p.E73V(1)		breast(1)|endometrium(1)|large_intestine(4)|lung(2)|prostate(1)	9						ACGCTCCCCCTCCTCCAAGCT	0.706																																						dbGAP											1	Substitution - Missense(1)	breast(1)											24.0	29.0	27.0					8																	11301703		2199	4297	6496	-	-	-	SO:0001583	missense	0				CCDS5981.1	8p23-p22	2010-08-27	2008-06-11	2008-06-11	ENSG00000154319	ENSG00000154319			15549	protein-coding gene	gene with protein product		610085	"""chromosome 8 open reading frame 13"""	C8orf13			Standard	NM_053279		Approved		uc003wtw.2	Q96KS9	OTTHUMG00000129361	ENST00000528897.1:c.218A>T	8.37:g.11301703T>A	ENSP00000436655:p.Glu73Val	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K3T9|Q3SXY1|Q3SXY3|Q8N3M3|Q9NSR0	Missense_Mutation	SNP	pfam_FAM167	p.E73V	ENST00000528897.1	37	c.218	CCDS5981.1	8	.	.	.	.	.	.	.	.	.	.	T	12.04	1.818208	0.32145	.	.	ENSG00000154319	ENST00000284486;ENST00000534308;ENST00000528897;ENST00000531804	T;T;T;T	0.09445	2.98;2.98;2.98;2.98	5.16	1.27	0.21489	.	1.067590	0.07289	N	0.872100	T	0.10165	0.0249	N	0.22421	0.69	0.09310	N	1	B	0.28128	0.201	B	0.29785	0.107	T	0.42982	-0.9419	10	0.52906	T	0.07	-0.5545	13.3603	0.60652	0.0:0.0:0.4891:0.5109	.	73	Q96KS9	F167A_HUMAN	V	73	ENSP00000284486:E73V;ENSP00000432232:E73V;ENSP00000436655:E73V;ENSP00000431951:E73V	ENSP00000284486:E73V	E	-	2	0	FAM167A	11339113	0.000000	0.05858	0.018000	0.16275	0.031000	0.12232	0.095000	0.15127	0.400000	0.25396	-0.316000	0.08728	GAG	FAM167A	-	NULL	ENSG00000154319		0.706	FAM167A-003	PUTATIVE	alternative_5_UTR|basic|appris_principal|exp_conf|CCDS	protein_coding	FAM167A	HGNC	protein_coding	OTTHUMT00000383901.1	22	0.00	0	T			11301703	11301703	-1	no_errors	ENST00000284486	ensembl	human	known	69_37n	missense	16	40.74	11	SNP	0.011	A
FBN3	84467	genome.wustl.edu	37	19	8171110	8171110	+	Missense_Mutation	SNP	G	G	C	rs576030557		TCGA-A2-A04R-01A-41D-A117-09	TCGA-A2-A04R-10B-01D-A10G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f8e4326-dfc7-4635-a9b7-a9207a392748	6234c5ee-14f2-427c-9ebc-4911da27a849	g.chr19:8171110G>C	ENST00000600128.1	-	38	5109	c.4695C>G	c.(4693-4695)gaC>gaG	p.D1565E	FBN3_ENST00000270509.2_Missense_Mutation_p.D1565E|FBN3_ENST00000601739.1_Missense_Mutation_p.D1565E			Q75N90	FBN3_HUMAN	fibrillin 3	1565	EGF-like 24; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.					proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|extracellular matrix structural constituent (GO:0005201)	p.D1565E(1)		NS(1)|breast(9)|central_nervous_system(2)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(15)|lung(53)|ovary(7)|pancreas(2)|prostate(3)|skin(10)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	132						CTTGGCACTCGTCGATGTCTG	0.587																																						dbGAP											1	Substitution - Missense(1)	breast(1)											84.0	66.0	72.0					19																	8171110		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS12196.1	19p13	2008-02-05							18794	protein-coding gene	gene with protein product		608529					Standard	NM_032447		Approved		uc002mjf.3	Q75N90		ENST00000600128.1:c.4695C>G	19.37:g.8171110G>C	ENSP00000470498:p.Asp1565Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q75N91|Q75N92|Q75N93|Q86SJ5|Q96JP8	Missense_Mutation	SNP	pfam_EGF-like_Ca-bd,pfam_TB_dom,pfam_EGF-like_dom,superfamily_TB_dom,smart_EGF-like,smart_EGF-like_Ca-bd,pirsf_Fibrillin,pfscan_EG-like_dom	p.D1565E	ENST00000600128.1	37	c.4695	CCDS12196.1	19	.	.	.	.	.	.	.	.	.	.	G	14.38	2.518815	0.44763	.	.	ENSG00000142449	ENST00000270509	D	0.95307	-3.67	3.25	-2.6	0.06190	EGF-like calcium-binding, conserved site (1);EGF-like calcium-binding (2);Epidermal growth factor-like, type 3 (1);	0.000000	0.85682	U	0.000000	D	0.93664	0.7976	M	0.91140	3.18	0.43637	D	0.996038	B	0.31599	0.33	B	0.32533	0.147	D	0.87427	0.2386	10	0.72032	D	0.01	.	8.8337	0.35100	0.5417:0.0:0.4583:0.0	.	1565	Q75N90	FBN3_HUMAN	E	1565	ENSP00000270509:D1565E	ENSP00000270509:D1565E	D	-	3	2	FBN3	8077110	0.001000	0.12720	0.991000	0.47740	0.989000	0.77384	-1.282000	0.02799	-0.418000	0.07450	0.561000	0.74099	GAC	FBN3	-	pfam_EGF-like_Ca-bd,smart_EGF-like_Ca-bd,pirsf_Fibrillin,pfscan_EG-like_dom	ENSG00000142449		0.587	FBN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FBN3	HGNC	protein_coding	OTTHUMT00000461428.2	36	0.00	0	G	NM_032447		8171110	8171110	-1	no_errors	ENST00000270509	ensembl	human	known	69_37n	missense	24	45.45	20	SNP	0.994	C
FMN1	342184	genome.wustl.edu	37	15	33359400	33359400	+	Intron	SNP	C	C	T			TCGA-A2-A04R-01A-41D-A117-09	TCGA-A2-A04R-10B-01D-A10G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f8e4326-dfc7-4635-a9b7-a9207a392748	6234c5ee-14f2-427c-9ebc-4911da27a849	g.chr15:33359400C>T	ENST00000559047.1	-	3	2043				FMN1_ENST00000559150.1_Intron|FMN1_ENST00000558197.1_Missense_Mutation_p.R229H|FMN1_ENST00000334528.9_Missense_Mutation_p.R229H|FMN1_ENST00000561249.1_Intron			Q68DA7	FMN1_HUMAN	formin 1						actin nucleation (GO:0045010)	actin filament (GO:0005884)|cell junction (GO:0030054)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)		p.R229H(1)		endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(3)|lung(14)|ovary(2)|prostate(1)|upper_aerodigestive_tract(3)	29		all_lung(180;1.14e-07)		all cancers(64;3.05e-15)|Epithelial(43;1.67e-10)|GBM - Glioblastoma multiforme(186;4.95e-05)|BRCA - Breast invasive adenocarcinoma(123;0.0262)		CTGGCTGGGGCGACGCTCTGT	0.522																																						dbGAP											1	Substitution - Missense(1)	breast(1)											63.0	67.0	66.0					15																	33359400		2064	4209	6273	-	-	-	SO:0001627	intron_variant	0			AH002864	CCDS45209.1, CCDS61581.1, CCDS61582.1	15q13.3	2013-06-13	2005-01-20	2005-01-22	ENSG00000248905	ENSG00000248905			3768	protein-coding gene	gene with protein product	"""limb deformity protein"""	136535	"""formin (limb deformity)"""	LD, FMN		1673046	Standard	NM_001277313		Approved	DKFZP686C2281, FLJ45135, MGC125288, MGC125289	uc031qrh.1	Q68DA7	OTTHUMG00000172201	ENST00000559047.1:c.2044-2125G>A	15.37:g.33359400C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q3B7I6|Q3ZAR4|Q6ZSY1	Missense_Mutation	SNP	pfam_FH2_actin-bd,superfamily_FH2_actin-bd,smart_Actin-bd_FH2/DRF_autoreg,prints_Formin	p.R229H	ENST00000559047.1	37	c.686		15	.	.	.	.	.	.	.	.	.	.	C	4.242	0.043782	0.08196	.	.	ENSG00000248905	ENST00000334528	T	0.37915	1.17	5.59	-0.18	0.13295	.	.	.	.	.	T	0.16514	0.0397	.	.	.	.	.	.	B;B	0.09022	0.002;0.0	B;B	0.04013	0.001;0.001	T	0.36432	-0.9748	7	0.11794	T	0.64	.	6.0108	0.19573	0.1278:0.4863:0.0:0.3859	.	229;229	Q68DA7-3;Q68DA7-5	.;.	H	229	ENSP00000333950:R229H	ENSP00000333950:R229H	R	-	2	0	FMN1	31146692	0.000000	0.05858	0.006000	0.13384	0.002000	0.02628	-0.658000	0.05329	0.059000	0.16252	-1.923000	0.00514	CGC	FMN1	-	NULL	ENSG00000248905		0.522	FMN1-005	NOVEL	basic|exp_conf	protein_coding	FMN1	HGNC	protein_coding	OTTHUMT00000417414.1	32	0.00	0	C	NM_001103184		33359400	33359400	-1	no_errors	ENST00000334528	ensembl	human	known	69_37n	missense	30	49.15	29	SNP	0.000	T
FRMD6	122786	genome.wustl.edu	37	14	52186774	52186774	+	Splice_Site	SNP	G	G	T			TCGA-A2-A04R-01A-41D-A117-09	TCGA-A2-A04R-10B-01D-A10G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f8e4326-dfc7-4635-a9b7-a9207a392748	6234c5ee-14f2-427c-9ebc-4911da27a849	g.chr14:52186774G>T	ENST00000344768.5	+	11	1222	c.1026G>T	c.(1024-1026)gaG>gaT	p.E342D	FRMD6_ENST00000395718.2_Splice_Site_p.E334D|FRMD6_ENST00000356218.4_Splice_Site_p.E334D|FRMD6_ENST00000553556.1_5'UTR|FRMD6_ENST00000554167.1_Splice_Site_p.E265D			Q96NE9	FRMD6_HUMAN	FERM domain containing 6	342					apical constriction (GO:0003383)|cellular protein localization (GO:0034613)|regulation of actin filament-based process (GO:0032970)	apical junction complex (GO:0043296)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|plasma membrane (GO:0005886)		p.E334D(1)		breast(2)|central_nervous_system(1)|endometrium(7)|large_intestine(7)|lung(11)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	34	all_epithelial(31;0.0163)|Breast(41;0.089)					ACCACGTAGAGAAGAAGCAGT	0.522																																						dbGAP											1	Substitution - Missense(1)	breast(1)											57.0	55.0	56.0					14																	52186774		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			BI465118	CCDS9704.1, CCDS58318.1, CCDS58319.1	14q22.1	2011-06-22	2005-07-20	2005-07-20	ENSG00000139926	ENSG00000139926			19839	protein-coding gene	gene with protein product	"""expanded homolog"""	614555	"""chromosome 14 open reading frame 31"""	C14orf31			Standard	NM_152330		Approved	MGC17921, willin, EX1	uc001wzd.3	Q96NE9	OTTHUMG00000140294	ENST00000344768.5:c.1025-1G>T	14.37:g.52186774G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	D3DSB9|Q5HYF2|Q8N2X1|Q8WUH7	Missense_Mutation	SNP	pfam_FERM_central,pfam_FERM_PH-like_C,pfam_FERM_N,superfamily_FERM_central,smart_Band_41_domain,pfscan_FERM_domain	p.E342D	ENST00000344768.5	37	c.1026	CCDS58318.1	14	.	.	.	.	.	.	.	.	.	.	G	13.63	2.293514	0.40594	.	.	ENSG00000139926	ENST00000356218;ENST00000395718;ENST00000344768;ENST00000554167;ENST00000555197	D;D;D;D;D	0.82344	-1.6;-1.6;-1.6;-1.6;-1.6	6.07	2.86	0.33363	.	0.055767	0.64402	D	0.000001	T	0.79587	0.4471	L	0.53249	1.67	0.80722	D	1	B;B;B	0.26258	0.145;0.05;0.083	B;B;B	0.35550	0.159;0.101;0.205	T	0.72609	-0.4241	10	0.27082	T	0.32	.	10.6287	0.45523	0.2836:0.0:0.7164:0.0	.	265;342;334	G3V4T7;Q96NE9;Q96NE9-2	.;FRMD6_HUMAN;.	D	334;334;342;265;72	ENSP00000348550:E334D;ENSP00000379068:E334D;ENSP00000343899:E342D;ENSP00000451977:E265D;ENSP00000451157:E72D	ENSP00000343899:E342D	E	+	3	2	FRMD6	51256524	1.000000	0.71417	1.000000	0.80357	0.726000	0.41606	2.450000	0.44943	0.899000	0.36444	0.655000	0.94253	GAG	FRMD6	-	NULL	ENSG00000139926		0.522	FRMD6-002	KNOWN	basic|CCDS	protein_coding	FRMD6	HGNC	protein_coding	OTTHUMT00000276881.1	22	0.00	0	G	NM_152330	Missense_Mutation	52186774	52186774	+1	no_errors	ENST00000344768	ensembl	human	known	69_37n	missense	12	36.84	7	SNP	0.998	T
FUT11	170384	genome.wustl.edu	37	10	75532267	75532267	+	Missense_Mutation	SNP	C	C	A			TCGA-A2-A04R-01A-41D-A117-09	TCGA-A2-A04R-10B-01D-A10G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f8e4326-dfc7-4635-a9b7-a9207a392748	6234c5ee-14f2-427c-9ebc-4911da27a849	g.chr10:75532267C>A	ENST00000372841.3	+	1	219	c.176C>A	c.(175-177)aCg>aAg	p.T59K	AC022400.2_ENST00000595757.1_Missense_Mutation_p.V38F|FUT11_ENST00000394790.1_Missense_Mutation_p.T59K|RMRPP1_ENST00000517236.1_RNA	NM_173540.2	NP_775811.2	Q495W5	FUT11_HUMAN	fucosyltransferase 11 (alpha (1,3) fucosyltransferase)	59					protein glycosylation (GO:0006486)	extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	alpha-(1->3)-fucosyltransferase activity (GO:0046920)	p.T59K(1)		breast(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(3)	7	Prostate(51;0.0112)					GTGGGGGTGACGCGCAGCTCT	0.741																																						dbGAP											1	Substitution - Missense(1)	breast(1)											11.0	12.0	11.0					10																	75532267		2189	4243	6432	-	-	-	SO:0001583	missense	0			BC036037	CCDS7333.1, CCDS60558.1	10q22.3	2014-01-02			ENSG00000196968	ENSG00000196968		"""Fucosyltransferases"""	19233	protein-coding gene	gene with protein product						11698403, 24318988	Standard	NM_173540		Approved	MGC33202	uc001jva.3	Q495W5	OTTHUMG00000018483	ENST00000372841.3:c.176C>A	10.37:g.75532267C>A	ENSP00000361932:p.Thr59Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q495W7|Q8IYE4	Missense_Mutation	SNP	pfam_Glyco_trans_10,pirsf_Alpha-1_3-FUT_met	p.T59K	ENST00000372841.3	37	c.176	CCDS7333.1	10	.	.	.	.	.	.	.	.	.	.	C	7.425	0.637534	0.14386	.	.	ENSG00000196968	ENST00000372841;ENST00000394790	T;T	0.34072	1.4;1.38	4.75	2.91	0.33838	.	0.487703	0.21462	N	0.074151	T	0.14442	0.0349	N	0.08118	0	0.25979	N	0.982408	B;B;B	0.21821	0.002;0.006;0.061	B;B;B	0.26416	0.005;0.006;0.069	T	0.34354	-0.9832	10	0.05436	T	0.98	-2.8866	5.8669	0.18781	0.153:0.685:0.0:0.162	.	59;59;59	Q495W5;Q495W5-2;B2RC53	FUT11_HUMAN;.;.	K	59	ENSP00000361932:T59K;ENSP00000378270:T59K	ENSP00000361932:T59K	T	+	2	0	FUT11	75202273	1.000000	0.71417	0.975000	0.42487	0.057000	0.15508	2.381000	0.44336	0.625000	0.30304	-0.379000	0.06801	ACG	FUT11	-	pirsf_Alpha-1_3-FUT_met	ENSG00000196968		0.741	FUT11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FUT11	HGNC	protein_coding	OTTHUMT00000048689.1	18	0.00	0	C	NM_173540		75532267	75532267	+1	no_errors	ENST00000372841	ensembl	human	known	69_37n	missense	11	38.89	7	SNP	1.000	A
GCC2	9648	genome.wustl.edu	37	2	109100752	109100752	+	Missense_Mutation	SNP	C	C	G			TCGA-A2-A04R-01A-41D-A117-09	TCGA-A2-A04R-10B-01D-A10G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f8e4326-dfc7-4635-a9b7-a9207a392748	6234c5ee-14f2-427c-9ebc-4911da27a849	g.chr2:109100752C>G	ENST00000309863.6	+	13	4312	c.3598C>G	c.(3598-3600)Cta>Gta	p.L1200V		NM_181453.3	NP_852118	Q8IWJ2	GCC2_HUMAN	GRIP and coiled-coil domain containing 2	1200					Golgi ribbon formation (GO:0090161)|late endosome to Golgi transport (GO:0034499)|microtubule anchoring (GO:0034453)|microtubule organizing center organization (GO:0031023)|protein localization to Golgi apparatus (GO:0034067)|protein targeting to Golgi (GO:0000042)|protein targeting to lysosome (GO:0006622)|recycling endosome to Golgi transport (GO:0071955)|regulation of protein exit from endoplasmic reticulum (GO:0070861)|retrograde transport, endosome to Golgi (GO:0042147)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|nucleus (GO:0005634)|trans-Golgi network (GO:0005802)	identical protein binding (GO:0042802)	p.L1200V(1)		breast(8)|central_nervous_system(1)|endometrium(2)|kidney(5)|large_intestine(10)|lung(19)|ovary(2)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	54						ACAAGAAACCCTACAAGAAGA	0.274																																						dbGAP											1	Substitution - Missense(1)	breast(1)											33.0	33.0	33.0					2																	109100752		2193	4289	6482	-	-	-	SO:0001583	missense	0			BC020645	CCDS33268.1	2q12.3	2008-02-05	2004-03-05		ENSG00000135968	ENSG00000135968			23218	protein-coding gene	gene with protein product		612711	"""GRIP and coiled-coil domain-containing 2"""			12446665	Standard	NM_181453		Approved	GCC185, KIAA0336	uc002tec.3	Q8IWJ2	OTTHUMG00000153214	ENST00000309863.6:c.3598C>G	2.37:g.109100752C>G	ENSP00000307939:p.Leu1200Val	Somatic		WXS	Illumina GAIIx	Phase_IV	A6H8X8|O15045|Q4ZG46|Q8TDH3|Q9H2G8	Missense_Mutation	SNP	pfam_GRIP,superfamily_GRIP,superfamily_tRNA-bd_arm,smart_GRIP,pfscan_GRIP	p.L1200V	ENST00000309863.6	37	c.3598	CCDS33268.1	2	.	.	.	.	.	.	.	.	.	.	C	14.36	2.512191	0.44660	.	.	ENSG00000135968	ENST00000309863	T	0.50001	0.76	5.98	1.2	0.21068	.	0.082974	0.49916	D	0.000138	T	0.54711	0.1875	M	0.69823	2.125	0.45129	D	0.998149	P	0.45768	0.866	P	0.53006	0.715	T	0.49224	-0.8962	10	0.33141	T	0.24	.	10.3309	0.43823	0.0:0.684:0.0:0.316	.	1200	Q8IWJ2	GCC2_HUMAN	V	1200	ENSP00000307939:L1200V	ENSP00000307939:L1200V	L	+	1	2	GCC2	108467184	0.954000	0.32549	0.797000	0.32132	0.649000	0.38597	1.155000	0.31700	-0.056000	0.13221	-0.948000	0.02665	CTA	GCC2	-	NULL	ENSG00000135968		0.274	GCC2-014	KNOWN	basic|appris_principal|CCDS	protein_coding	GCC2	HGNC	protein_coding	OTTHUMT00000358516.3	102	0.00	0	C	NM_014635		109100752	109100752	+1	no_errors	ENST00000309863	ensembl	human	known	69_37n	missense	77	37.40	46	SNP	0.891	G
GPR179	440435	genome.wustl.edu	37	17	36485058	36485058	+	Nonsense_Mutation	SNP	C	C	T			TCGA-A2-A04R-01A-41D-A117-09	TCGA-A2-A04R-10B-01D-A10G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f8e4326-dfc7-4635-a9b7-a9207a392748	6234c5ee-14f2-427c-9ebc-4911da27a849	g.chr17:36485058C>T	ENST00000342292.4	-	11	4414	c.4394G>A	c.(4393-4395)tGg>tAg	p.W1465*	GPR179_ENST00000584976.1_5'Flank	NM_001004334.2	NP_001004334.2	Q6PRD1	GP179_HUMAN	G protein-coupled receptor 179	1465					visual perception (GO:0007601)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)	p.W1465*(1)		breast(4)|cervix(2)|endometrium(9)|kidney(3)|large_intestine(16)|lung(15)|ovary(4)|pancreas(1)|prostate(1)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	60	Breast(7;2.97e-12)	Breast(25;0.0101)|Ovarian(249;0.15)				TCCTGCCTCCCACAGACACAC	0.557																																						dbGAP											1	Substitution - Nonsense(1)	breast(1)											114.0	118.0	117.0					17																	36485058		2036	4198	6234	-	-	-	SO:0001587	stop_gained	0				CCDS42308.1	17q21.1	2014-05-06	2006-02-16	2006-02-16	ENSG00000188888	ENSG00000277399		"""GPCR / Class C : Orphans"""	31371	protein-coding gene	gene with protein product		614515	"""GPR158-like 1"", ""GPR179"""	GPR158L1			Standard	NM_001004334		Approved	CSNB1E	uc002hpz.3	Q6PRD1	OTTHUMG00000188545	ENST00000342292.4:c.4394G>A	17.37:g.36485058C>T	ENSP00000345060:p.Trp1465*	Somatic		WXS	Illumina GAIIx	Phase_IV		Nonsense_Mutation	SNP	pfam_GPCR_3_C,superfamily_Growth_fac_rcpt,pfscan_GPCR_3_C	p.W1465*	ENST00000342292.4	37	c.4394	CCDS42308.1	17	.	.	.	.	.	.	.	.	.	.	C	39	7.682588	0.98431	.	.	ENSG00000188888	ENST00000342292	.	.	.	4.48	1.35	0.21983	.	1.585230	0.03553	N	0.225835	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	1.4021	5.6453	0.17586	0.0:0.6559:0.1612:0.1829	.	.	.	.	X	1465	.	ENSP00000345060:W1465X	W	-	2	0	GPR179	33738584	0.948000	0.32251	0.641000	0.29422	0.125000	0.20455	2.001000	0.40825	0.153000	0.19213	-0.391000	0.06502	TGG	GPR179	-	NULL	ENSG00000188888		0.557	GPR179-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR179	HGNC	protein_coding	OTTHUMT00000255329.2	103	0.00	0	C			36485058	36485058	-1	no_errors	ENST00000342292	ensembl	human	known	69_37n	nonsense	59	42.16	43	SNP	0.975	T
GRM3	2913	genome.wustl.edu	37	7	86415883	86415883	+	Missense_Mutation	SNP	G	G	C			TCGA-A2-A04R-01A-41D-A117-09	TCGA-A2-A04R-10B-01D-A10G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f8e4326-dfc7-4635-a9b7-a9207a392748	6234c5ee-14f2-427c-9ebc-4911da27a849	g.chr7:86415883G>C	ENST00000361669.2	+	3	1874	c.775G>C	c.(775-777)Gtg>Ctg	p.V259L	AC005009.2_ENST00000418031.1_RNA|GRM3_ENST00000394720.2_Missense_Mutation_p.V257L|AC005009.2_ENST00000452471.1_RNA|GRM3_ENST00000546348.1_Intron|GRM3_ENST00000439827.1_Missense_Mutation_p.V259L|GRM3_ENST00000536043.1_Missense_Mutation_p.V131L	NM_000840.2	NP_000831.2	Q14832	GRM3_HUMAN	glutamate receptor, metabotropic 3	259					adenylate cyclase-inhibiting G-protein coupled glutamate receptor signaling pathway (GO:0007196)|negative regulation of adenylate cyclase activity (GO:0007194)|regulation of synaptic transmission, glutamatergic (GO:0051966)|synaptic transmission (GO:0007268)	astrocyte projection (GO:0097449)|axon (GO:0030424)|dendritic spine (GO:0043197)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)	calcium channel regulator activity (GO:0005246)|G-protein coupled receptor activity (GO:0004930)|glutamate receptor activity (GO:0008066)|group II metabotropic glutamate receptor activity (GO:0001641)	p.V259L(1)		NS(2)|breast(6)|central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(9)|lung(43)|ovary(3)|pancreas(2)|prostate(4)|skin(25)|upper_aerodigestive_tract(5)	109	Esophageal squamous(14;0.0058)|all_lung(186;0.132)|Lung NSC(181;0.142)					CTACGACAGCGTGATCCGAGA	0.647																																					GBM(52;969 1098 3139 52280)	dbGAP											1	Substitution - Missense(1)	breast(1)											48.0	51.0	50.0					7																	86415883		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS5600.1	7q21.1-q21.2	2012-08-29			ENSG00000198822	ENSG00000198822		"""GPCR / Class C : Glutamate receptors, metabotropic"", ""Glutamate receptors"""	4595	protein-coding gene	gene with protein product		601115				8824806	Standard	NM_000840		Approved	GPRC1C, mGlu3, MGLUR3	uc003uid.3	Q14832	OTTHUMG00000022884	ENST00000361669.2:c.775G>C	7.37:g.86415883G>C	ENSP00000355316:p.Val259Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q2PNZ6|Q75MV4|Q75N17|Q86YG6|Q8TBH9	Missense_Mutation	SNP	pfam_ANF_lig-bd_rcpt,pfam_GPCR_3_C,pfam_GPCR_3_9-Cys_dom,prints_GPCR_3,prints_GPCR_3_mtglu_rcpt_3,prints_GPCR_3_mtglu_rcpt,prints_GPCR_3_mtglu_rcpt_2,prints_GPCR_3_GABA_rcpt_B,pfscan_GPCR_3_C	p.V259L	ENST00000361669.2	37	c.775	CCDS5600.1	7	.	.	.	.	.	.	.	.	.	.	G	16.70	3.196900	0.58126	.	.	ENSG00000198822	ENST00000361669;ENST00000454217;ENST00000536043;ENST00000439827;ENST00000394720	D;D;D;D;D	0.85629	-2.01;-2.01;-2.01;-2.01;-2.01	6.07	6.07	0.98685	Extracellular ligand-binding receptor (1);	0.054026	0.64402	D	0.000001	D	0.85695	0.5756	L	0.45581	1.43	0.58432	D	0.999999	P;P;B	0.35908	0.5;0.527;0.412	B;B;B	0.43082	0.396;0.132;0.407	T	0.82557	-0.0398	10	0.34782	T	0.22	.	19.6475	0.95784	0.0:0.0:1.0:0.0	.	131;259;259	F5GYZ2;G5E9K2;Q14832	.;.;GRM3_HUMAN	L	259;131;131;259;257	ENSP00000355316:V259L;ENSP00000405427:V131L;ENSP00000441407:V131L;ENSP00000398767:V259L;ENSP00000378209:V257L	ENSP00000355316:V259L	V	+	1	0	GRM3	86253819	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.617000	0.74210	2.885000	0.99019	0.655000	0.94253	GTG	GRM3	-	pfam_ANF_lig-bd_rcpt,prints_GPCR_3_mtglu_rcpt_3,prints_GPCR_3_mtglu_rcpt	ENSG00000198822		0.647	GRM3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GRM3	HGNC	protein_coding	OTTHUMT00000253362.2	14	0.00	0	G			86415883	86415883	+1	no_errors	ENST00000361669	ensembl	human	known	69_37n	missense	10	44.44	8	SNP	1.000	C
MTG2	26164	genome.wustl.edu	37	20	60770921	60770921	+	Missense_Mutation	SNP	A	A	C			TCGA-A2-A04R-01A-41D-A117-09	TCGA-A2-A04R-10B-01D-A10G-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f8e4326-dfc7-4635-a9b7-a9207a392748	6234c5ee-14f2-427c-9ebc-4911da27a849	g.chr20:60770921A>C	ENST00000370823.3	+	3	286	c.268A>C	c.(268-270)Agc>Cgc	p.S90R	MTG2_ENST00000536470.1_5'UTR|MTG2_ENST00000436421.2_Missense_Mutation_p.S90R	NM_015666.3	NP_056481.1	Q9H4K7	MTG2_HUMAN	mitochondrial ribosome-associated GTPase 2	90	Localized in the mitochondria.|Not localized in the mitochondria.				GTP catabolic process (GO:0006184)|regulation of mitochondrial translation (GO:0070129)|regulation of respiratory system process (GO:0044065)|ribosome biogenesis (GO:0042254)	mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrial ribosome (GO:0005761)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|magnesium ion binding (GO:0000287)	p.S90R(1)									CGCTGGGGCAAGCTGCTTCCA	0.572																																						dbGAP											1	Substitution - Missense(1)	breast(1)											96.0	77.0	83.0					20																	60770921		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK001603	CCDS13492.1	20q13.33	2013-05-24	2013-05-24	2013-05-24	ENSG00000101181	ENSG00000101181			16239	protein-coding gene	gene with protein product		610919	"""GTP-binding protein 5 (putative)"", ""GTP binding protein 5 (putative)"""	GTPBP5		17054726, 23396448	Standard	NM_015666		Approved	FLJ10741, dJ1005F21.2, ObgH1		Q9H4K7	OTTHUMG00000032897	ENST00000370823.3:c.268A>C	20.37:g.60770921A>C	ENSP00000359859:p.Ser90Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NDR3|B4DR85|Q96I17|Q9NVG9|Q9UFR4	Missense_Mutation	SNP	pfam_GTP1_OBG_dom,pfam_GTP_binding_domain,pfam_Fe2_transport_prot_B_N,pfam_Small_GTPase_ARF/SAR,superfamily_GTP1_OBG_dom,pirsf_GTP-bd_Obg/CgtA,prints_GTP_binding_domain,tigrfam_GTP-bd_Obg/CgtA,tigrfam_Small_GTP-bd_dom	p.S90R	ENST00000370823.3	37	c.268	CCDS13492.1	20	.	.	.	.	.	.	.	.	.	.	A	17.49	3.403582	0.62288	.	.	ENSG00000101181	ENST00000436421;ENST00000370823;ENST00000448254	T;T;T	0.21932	1.98;1.98;1.98	5.7	5.7	0.88788	GTP1/OBG subdomain (3);	0.576980	0.21321	N	0.076473	T	0.44561	0.1299	M	0.84948	2.725	0.47584	D	0.999462	D;D;P	0.61080	0.981;0.989;0.855	P;P;P	0.61658	0.756;0.892;0.492	T	0.49925	-0.8887	10	0.87932	D	0	-57.5072	8.0109	0.30353	0.7252:0.1482:0.0:0.1266	.	90;90;90	Q5JXJ0;E7EU10;Q9H4K7	.;.;GTPB5_HUMAN	R	90	ENSP00000392267:S90R;ENSP00000359859:S90R;ENSP00000414693:S90R	ENSP00000359859:S90R	S	+	1	0	GTPBP5	60204316	0.973000	0.33851	0.919000	0.36401	0.634000	0.38068	2.340000	0.43974	2.182000	0.69389	0.459000	0.35465	AGC	GTPBP5	-	pfam_GTP1_OBG_dom,superfamily_GTP1_OBG_dom,pirsf_GTP-bd_Obg/CgtA,tigrfam_GTP-bd_Obg/CgtA	ENSG00000101181		0.572	MTG2-008	KNOWN	basic|appris_principal|CCDS	protein_coding	GTPBP5	HGNC	protein_coding	OTTHUMT00000079989.1	51	0.00	0	A	NM_015666		60770921	60770921	+1	no_errors	ENST00000370823	ensembl	human	known	69_37n	missense	62	34.74	33	SNP	0.584	C
HECW2	57520	genome.wustl.edu	37	2	197143359	197143359	+	Missense_Mutation	SNP	T	T	C			TCGA-A2-A04R-01A-41D-A117-09	TCGA-A2-A04R-10B-01D-A10G-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f8e4326-dfc7-4635-a9b7-a9207a392748	6234c5ee-14f2-427c-9ebc-4911da27a849	g.chr2:197143359T>C	ENST00000260983.3	-	15	3210	c.3028A>G	c.(3028-3030)Acc>Gcc	p.T1010A	HECW2_ENST00000409111.1_Missense_Mutation_p.T654A	NM_020760.1	NP_065811.1	Q9P2P5	HECW2_HUMAN	HECT, C2 and WW domain containing E3 ubiquitin protein ligase 2	1010	Interaction with TP73.|WW 2. {ECO:0000255|PROSITE- ProRule:PRU00224}.				protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)	p.T1010A(1)		biliary_tract(1)|breast(3)|central_nervous_system(4)|cervix(2)|endometrium(7)|kidney(4)|large_intestine(24)|lung(45)|ovary(5)|pancreas(2)|prostate(2)|skin(10)|upper_aerodigestive_tract(2)|urinary_tract(2)	113						AAAGTGGTGGTGCGGGAGTTG	0.517																																						dbGAP											1	Substitution - Missense(1)	breast(1)											167.0	133.0	145.0					2																	197143359		2203	4300	6503	-	-	-	SO:0001583	missense	0			AL390186	CCDS33354.1	2q32.3	2004-12-13			ENSG00000138411	ENSG00000138411			29853	protein-coding gene	gene with protein product						10718198, 12890487	Standard	NM_020760		Approved	KIAA1301, NEDL2	uc002utm.1	Q9P2P5	OTTHUMG00000154435	ENST00000260983.3:c.3028A>G	2.37:g.197143359T>C	ENSP00000260983:p.Thr1010Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	B8ZZB4|Q17RT5|Q68DF8|Q9NPS9	Missense_Mutation	SNP	pfam_HECT,pfam_WW_Rsp5_WWP,pfam_C2_Ca-dep,smart_C2_Ca-dep,smart_WW_Rsp5_WWP,smart_HECT,pfscan_HECT,pfscan_C2_membr_targeting,pfscan_WW_Rsp5_WWP	p.T1010A	ENST00000260983.3	37	c.3028	CCDS33354.1	2	.	.	.	.	.	.	.	.	.	.	T	5.254	0.232346	0.09969	.	.	ENSG00000138411	ENST00000409111;ENST00000260983	D;D	0.83914	-1.78;-1.78	5.02	3.87	0.44632	WW/Rsp5/WWP (6);	0.171172	0.52532	N	0.000066	T	0.74703	0.3751	L	0.52823	1.66	0.41420	D	0.987791	B	0.12013	0.005	B	0.15052	0.012	T	0.63849	-0.6544	10	0.12103	T	0.63	.	7.897	0.29712	0.0:0.1584:0.0:0.8416	.	1010	Q9P2P5	HECW2_HUMAN	A	654;1010	ENSP00000386775:T654A;ENSP00000260983:T1010A	ENSP00000260983:T1010A	T	-	1	0	HECW2	196851604	0.403000	0.25319	0.766000	0.31476	0.988000	0.76386	0.774000	0.26675	0.940000	0.37473	0.533000	0.62120	ACC	HECW2	-	pfam_WW_Rsp5_WWP,smart_WW_Rsp5_WWP,pfscan_WW_Rsp5_WWP	ENSG00000138411		0.517	HECW2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HECW2	HGNC	protein_coding	OTTHUMT00000335199.3	140	0.00	0	T	NM_020760		197143359	197143359	-1	no_errors	ENST00000260983	ensembl	human	known	69_37n	missense	72	46.67	63	SNP	0.820	C
HIST1H2AL	8332	genome.wustl.edu	37	6	27833360	27833360	+	Missense_Mutation	SNP	G	G	C	rs369844593		TCGA-A2-A04R-01A-41D-A117-09	TCGA-A2-A04R-10B-01D-A10G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f8e4326-dfc7-4635-a9b7-a9207a392748	6234c5ee-14f2-427c-9ebc-4911da27a849	g.chr6:27833360G>C	ENST00000357320.2	+	1	327	c.228G>C	c.(226-228)aaG>aaC	p.K76N		NM_003511.2	NP_003502.1	P0C0S8	H2A1_HUMAN	histone cluster 1, H2al	76						extracellular vesicular exosome (GO:0070062)|nucleosome (GO:0000786)|nucleus (GO:0005634)	DNA binding (GO:0003677)|enzyme binding (GO:0019899)	p.K76N(1)		breast(1)|endometrium(1)|large_intestine(2)|lung(3)|urinary_tract(2)	9						ACAACAAGAAGACCCGCATTA	0.667																																						dbGAP											1	Substitution - Missense(1)	breast(1)											97.0	100.0	99.0					6																	27833360		2203	4300	6503	-	-	-	SO:0001583	missense	0			X83549	CCDS4634.1	6p22.1	2011-01-27	2006-10-11	2003-02-14	ENSG00000198374	ENSG00000276903		"""Histones / Replication-dependent"""	4730	protein-coding gene	gene with protein product		602793	"""H2A histone family, member I"", ""histone 1, H2al"""	H2AFI		9439656, 9031620, 12408966	Standard	NM_003511		Approved	H2A/i, dJ193B12.9	uc003njw.3	P0C0S8	OTTHUMG00000014492	ENST00000357320.2:c.228G>C	6.37:g.27833360G>C	ENSP00000349873:p.Lys76Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	P02261|Q2M1R2|Q76PA6	Missense_Mutation	SNP	pfam_Histone_core_D,pfam_CBFA_NFYB_domain,superfamily_Histone-fold,smart_Histone_H2A,prints_Histone_H2A	p.K76N	ENST00000357320.2	37	c.228	CCDS4634.1	6	.	.	.	.	.	.	.	.	.	.	.	20.5	4.000392	0.74818	.	.	ENSG00000198374	ENST00000357320	T	0.70282	-0.47	4.57	4.57	0.56435	.	0.000000	0.31936	U	0.006836	T	0.78162	0.4240	.	.	.	0.40645	D	0.981982	.	.	.	.	.	.	T	0.82037	-0.0656	7	0.87932	D	0	.	16.7188	0.85405	0.0:0.0:1.0:0.0	.	.	.	.	N	76	ENSP00000349873:K76N	ENSP00000349873:K76N	K	+	3	2	HIST1H2AL	27941339	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	3.582000	0.53921	2.263000	0.75096	0.563000	0.77884	AAG	HIST1H2AL	-	pfam_Histone_core_D,pfam_CBFA_NFYB_domain,superfamily_Histone-fold,smart_Histone_H2A,prints_Histone_H2A	ENSG00000198374		0.667	HIST1H2AL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HIST1H2AL	HGNC	protein_coding	OTTHUMT00000040160.1	91	0.00	0	G	NM_003511		27833360	27833360	+1	no_errors	ENST00000357320	ensembl	human	known	69_37n	missense	62	39.81	41	SNP	1.000	C
HNRNPA3	220988	genome.wustl.edu	37	2	178080348	178080348	+	Nonsense_Mutation	SNP	C	C	T			TCGA-A2-A04R-01A-41D-A117-09	TCGA-A2-A04R-10B-01D-A10G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f8e4326-dfc7-4635-a9b7-a9207a392748	6234c5ee-14f2-427c-9ebc-4911da27a849	g.chr2:178080348C>T	ENST00000392524.2	+	2	391	c.154C>T	c.(154-156)Cga>Tga	p.R52*	AC079305.8_ENST00000455416.1_RNA|HNRNPA3_ENST00000435711.1_Nonsense_Mutation_p.R52*|HNRNPA3_ENST00000411529.2_Nonsense_Mutation_p.R30*|MIR4444-1_ENST00000581696.1_RNA			P51991	ROA3_HUMAN	heterogeneous nuclear ribonucleoprotein A3	52	RRM 1. {ECO:0000255|PROSITE- ProRule:PRU00176}.				gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)	catalytic step 2 spliceosome (GO:0071013)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)	p.R52*(3)		breast(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(3)|ovary(2)|urinary_tract(1)	16						TGATAGTTTACGAGAACATTT	0.428																																						dbGAP											3	Substitution - Nonsense(3)	large_intestine(1)|lung(1)|breast(1)											66.0	66.0	66.0					2																	178080348		2203	4295	6498	-	-	-	SO:0001587	stop_gained	0			AF517524	CCDS2273.1	2q31.2	2013-02-12		2008-04-18	ENSG00000170144	ENSG00000170144		"""RNA binding motif (RRM) containing"""	24941	protein-coding gene	gene with protein product		605372		HNRPA3		11886857, 15776420	Standard	XM_005246380		Approved		uc002ulc.1	P51991	OTTHUMG00000132529	ENST00000392524.2:c.154C>T	2.37:g.178080348C>T	ENSP00000376309:p.Arg52*	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DPF4|Q53RW7|Q6URK5	Nonsense_Mutation	SNP	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	p.R52*	ENST00000392524.2	37	c.154	CCDS2273.1	2	.	.	.	.	.	.	.	.	.	.	A	37	6.504984	0.97620	.	.	ENSG00000170144	ENST00000392524;ENST00000411529;ENST00000416446;ENST00000420139;ENST00000435711	.	.	.	4.22	4.22	0.49857	.	0.000000	0.50627	U	0.000108	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	11.1344	0.48367	0.8447:0.1553:0.0:0.0	.	.	.	.	X	52;30;30;30;52	.	ENSP00000376309:R52X	R	+	1	2	HNRNPA3	177788594	1.000000	0.71417	1.000000	0.80357	0.951000	0.60555	2.529000	0.45632	0.615000	0.30124	-0.824000	0.03097	CGA	HNRNPA3	-	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	ENSG00000170144		0.428	HNRNPA3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	HNRNPA3	HGNC	protein_coding	OTTHUMT00000255729.3	54	0.00	0	C	NM_194247		178080348	178080348	+1	no_errors	ENST00000392524	ensembl	human	known	69_37n	nonsense	26	38.10	16	SNP	1.000	T
LMNTD1	160492	genome.wustl.edu	37	12	25679085	25679085	+	Missense_Mutation	SNP	T	T	G			TCGA-A2-A04R-01A-41D-A117-09	TCGA-A2-A04R-10B-01D-A10G-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f8e4326-dfc7-4635-a9b7-a9207a392748	6234c5ee-14f2-427c-9ebc-4911da27a849	g.chr12:25679085T>G	ENST00000282881.6	-	5	832	c.683A>C	c.(682-684)aAg>aCg	p.K228T	IFLTD1_ENST00000413632.2_Intron|IFLTD1_ENST00000445693.1_Missense_Mutation_p.K165T|IFLTD1_ENST00000458174.2_Missense_Mutation_p.K249T|IFLTD1_ENST00000539744.1_Missense_Mutation_p.K131T	NM_152590.3	NP_689803.2	Q8N9Z9	LMTD1_HUMAN		228	LTD.				cell proliferation (GO:0008283)	cytoplasm (GO:0005737)|intermediate filament (GO:0005882)|nuclear envelope (GO:0005635)	structural molecule activity (GO:0005198)	p.K228T(1)|p.K249T(1)		breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(6)|lung(7)|ovary(2)|skin(1)|upper_aerodigestive_tract(2)	22	all_lung(3;2.75e-22)|Lung NSC(3;1.77e-21)|all_hematologic(7;0.00656)|Colorectal(261;0.0847)					TGCTCTAAACTTGTCTTGTTC	0.373																																						dbGAP											2	Substitution - Missense(2)	breast(2)											121.0	112.0	115.0					12																	25679085		2203	4300	6503	-	-	-	SO:0001583	missense	0																														ENST00000282881.6:c.683A>C	12.37:g.25679085T>G	ENSP00000282881:p.Lys228Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DL27|B4DY70|Q8IY38	Missense_Mutation	SNP	pfam_Lamin_tail_dom	p.K249T	ENST00000282881.6	37	c.746	CCDS8704.1	12	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	12.09|12.09	1.834506|1.834506	0.32421|0.32421	.|.	.|.	ENSG00000152936|ENSG00000152936	ENST00000282881;ENST00000539744;ENST00000458174;ENST00000445693;ENST00000545543|ENST00000543629	D;D;D;D;D|.	0.98207|.	-4.79;-4.79;-4.79;-4.79;-4.79|.	5.81|5.81	-6.26|-6.26	0.02033|0.02033	Intermediate filament, C-terminal (1);|.	.|.	.|.	.|.	.|.	T|T	0.30417|0.30417	0.0764|0.0764	L|L	0.31664|0.31664	0.95|0.95	0.32000|0.32000	N|N	0.603527|0.603527	B;B;B|.	0.33073|.	0.222;0.396;0.134|.	B;B;B|.	0.32928|.	0.117;0.155;0.091|.	T|T	0.39375|0.39375	-0.9617|-0.9617	9|5	0.40728|.	T|.	0.16|.	2.3457|2.3457	5.4488|5.4488	0.16550|0.16550	0.1256:0.5268:0.1282:0.2195|0.1256:0.5268:0.1282:0.2195	.|.	165;249;228|.	Q8N9Z9-3;Q8N9Z9-5;Q8N9Z9|.	.;.;ILFT1_HUMAN|.	T|H	228;131;249;165;58|2	ENSP00000282881:K228T;ENSP00000443132:K131T;ENSP00000407353:K249T;ENSP00000407043:K165T;ENSP00000443596:K58T|.	ENSP00000282881:K228T|.	K|Q	-|-	2|3	0|2	IFLTD1|IFLTD1	25570352|25570352	0.000000|0.000000	0.05858|0.05858	0.080000|0.080000	0.20451|0.20451	0.917000|0.917000	0.54804|0.54804	-1.208000|-1.208000	0.03005|0.03005	-1.221000|-1.221000	0.02591|0.02591	0.533000|0.533000	0.62120|0.62120	AAG|CAA	IFLTD1	-	pfam_Lamin_tail_dom	ENSG00000152936		0.373	IFLTD1-008	KNOWN	basic|appris_candidate|CCDS	protein_coding	IFLTD1	HGNC	protein_coding	OTTHUMT00000402279.1	104	0.00	0	T			25679085	25679085	-1	no_errors	ENST00000458174	ensembl	human	known	69_37n	missense	84	42.86	63	SNP	0.238	G
IL1RAPL1	11141	genome.wustl.edu	37	X	29935650	29935650	+	Missense_Mutation	SNP	G	G	T			TCGA-A2-A04R-01A-41D-A117-09	TCGA-A2-A04R-10B-01D-A10G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f8e4326-dfc7-4635-a9b7-a9207a392748	6234c5ee-14f2-427c-9ebc-4911da27a849	g.chrX:29935650G>T	ENST00000378993.1	+	7	1521	c.848G>T	c.(847-849)tGg>tTg	p.W283L	IL1RAPL1_ENST00000302196.4_Missense_Mutation_p.W283L	NM_014271.3	NP_055086.1	Q9NZN1	IRPL1_HUMAN	interleukin 1 receptor accessory protein-like 1	283	Ig-like C2-type 3.				calcium ion transmembrane transport (GO:0070588)|heterophilic cell-cell adhesion (GO:0007157)|negative regulation of exocytosis (GO:0045920)|neuron differentiation (GO:0030182)|positive regulation of dendrite morphogenesis (GO:0050775)|presynaptic membrane assembly (GO:0097105)|regulation of neuron projection development (GO:0010975)|signal transduction (GO:0007165)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	receptor binding (GO:0005102)|voltage-gated calcium channel activity (GO:0005245)	p.W283L(2)		biliary_tract(1)|breast(1)|endometrium(5)|large_intestine(9)|lung(38)|ovary(3)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	62						TTAATTTACTGGATGAAAGGA	0.363																																						dbGAP											2	Substitution - Missense(2)	breast(2)											59.0	57.0	58.0					X																	29935650		2202	4300	6502	-	-	-	SO:0001583	missense	0			AJ243874	CCDS14218.1	Xp22.1-p21.3	2013-01-29	2004-02-13		ENSG00000169306	ENSG00000169306		"""Interleukins and interleukin receptors"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5996	protein-coding gene	gene with protein product		300206	"""mental retardation, X-linked 34"", ""mental retardation, X-linked 21"", ""mental retardation, X-linked 10"""	IL1RAPL, MRX34, MRX21, MRX10		10471494, 10757639	Standard	NM_014271		Approved	OPHN4, TIGIRR-2, IL1R8	uc004dby.2	Q9NZN1	OTTHUMG00000021317	ENST00000378993.1:c.848G>T	X.37:g.29935650G>T	ENSP00000368278:p.Trp283Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	A0AVG4|Q9UJ53	Missense_Mutation	SNP	pfam_TIR_dom,pfam_Ig_I-set,pfam_Immunoglobulin,superfamily_TIR_dom,smart_Ig_sub,smart_Ig_sub2,smart_TIR_dom,prints_IL1_rcpt_1,pfscan_TIR_dom,pfscan_Ig-like	p.W283L	ENST00000378993.1	37	c.848	CCDS14218.1	X	.	.	.	.	.	.	.	.	.	.	G	29.2	4.986546	0.93106	.	.	ENSG00000169306	ENST00000378993;ENST00000302196	T;T	0.81078	-1.45;-1.45	5.78	5.78	0.91487	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	D	0.91043	0.7182	M	0.85197	2.74	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.91378	0.5125	9	.	.	.	.	18.9267	0.92548	0.0:0.0:1.0:0.0	.	283	Q9NZN1	IRPL1_HUMAN	L	283	ENSP00000368278:W283L;ENSP00000305200:W283L	.	W	+	2	0	IL1RAPL1	29845571	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.476000	0.97823	2.417000	0.82017	0.600000	0.82982	TGG	IL1RAPL1	-	pfam_Ig_I-set,pfam_Immunoglobulin,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	ENSG00000169306		0.363	IL1RAPL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IL1RAPL1	HGNC	protein_coding	OTTHUMT00000056155.1	137	0.00	0	G	NM_014271		29935650	29935650	+1	no_errors	ENST00000302196	ensembl	human	known	69_37n	missense	72	43.41	56	SNP	1.000	T
KCND2	3751	genome.wustl.edu	37	7	119915612	119915612	+	Missense_Mutation	SNP	G	G	T			TCGA-A2-A04R-01A-41D-A117-09	TCGA-A2-A04R-10B-01D-A10G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f8e4326-dfc7-4635-a9b7-a9207a392748	6234c5ee-14f2-427c-9ebc-4911da27a849	g.chr7:119915612G>T	ENST00000331113.4	+	1	1891	c.926G>T	c.(925-927)gGc>gTc	p.G309V		NM_012281.2	NP_036413.1	Q9NZV8	KCND2_HUMAN	potassium voltage-gated channel, Shal-related subfamily, member 2	309					action potential (GO:0001508)|protein homooligomerization (GO:0051260)|synaptic transmission (GO:0007268)	dendritic spine (GO:0043197)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	A-type (transient outward) potassium channel activity (GO:0005250)|metal ion binding (GO:0046872)|voltage-gated potassium channel activity (GO:0005249)	p.G309V(1)		NS(2)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(8)|kidney(2)|large_intestine(11)|lung(35)|ovary(3)|pancreas(1)|prostate(4)|skin(3)|upper_aerodigestive_tract(1)	75	all_neural(327;0.117)				Amitriptyline(DB00321)|Dalfampridine(DB06637)|Disopyramide(DB00280)|Imipramine(DB00458)	CACTCTCAAGGCCTGCGCATC	0.522																																						dbGAP											1	Substitution - Missense(1)	breast(1)											94.0	79.0	84.0					7																	119915612		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ010969	CCDS5776.1	7q31	2012-07-05			ENSG00000184408	ENSG00000184408		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6238	protein-coding gene	gene with protein product		605410				10551270, 16382104	Standard	NM_012281		Approved	Kv4.2, RK5, KIAA1044	uc003vjj.1	Q9NZV8	OTTHUMG00000156989	ENST00000331113.4:c.926G>T	7.37:g.119915612G>T	ENSP00000333496:p.Gly309Val	Somatic		WXS	Illumina GAIIx	Phase_IV	O95012|O95021|Q2TBD3|Q9UBY7|Q9UN98|Q9UNH9	Missense_Mutation	SNP	pfam_K_chnl_volt-dep_Kv4_C,pfam_T1-type_BTB,pfam_Ion_trans_dom,pfam_Shal-type,pfam_Ion_trans_2,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,prints_K_chnl,prints_K_chnl_volt-dep_Kv4,prints_K_chnl_volt-dep_Kv4.2,prints_K_chnl_volt-dep_Kv,prints_K_chnl_volt-dep_Kv3	p.G309V	ENST00000331113.4	37	c.926	CCDS5776.1	7	.	.	.	.	.	.	.	.	.	.	G	22.0	4.227549	0.79576	.	.	ENSG00000184408	ENST00000331113	D	0.98835	-5.17	5.4	5.4	0.78164	Ion transport (1);	0.000000	0.85682	D	0.000000	D	0.99281	0.9749	M	0.89214	3.015	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.99239	1.0884	9	.	.	.	.	19.5371	0.95257	0.0:0.0:1.0:0.0	.	309	Q9NZV8	KCND2_HUMAN	V	309	ENSP00000333496:G309V	.	G	+	2	0	KCND2	119702848	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.813000	0.99286	2.706000	0.92434	0.557000	0.71058	GGC	KCND2	-	pfam_Ion_trans_dom,prints_K_chnl	ENSG00000184408		0.522	KCND2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCND2	HGNC	protein_coding	OTTHUMT00000346996.1	97	0.00	0	G	NM_012281		119915612	119915612	+1	no_errors	ENST00000331113	ensembl	human	known	69_37n	missense	39	52.94	45	SNP	1.000	T
KRTAP11-1	337880	genome.wustl.edu	37	21	32253424	32253424	+	Silent	SNP	G	G	C			TCGA-A2-A04R-01A-41D-A117-09	TCGA-A2-A04R-10B-01D-A10G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f8e4326-dfc7-4635-a9b7-a9207a392748	6234c5ee-14f2-427c-9ebc-4911da27a849	g.chr21:32253424G>C	ENST00000332378.4	-	1	450	c.420C>G	c.(418-420)gtC>gtG	p.V140V		NM_175858.2	NP_787054.1	Q8IUC1	KR111_HUMAN	keratin associated protein 11-1	140	4 X 10 AA approximate repeats.					keratin filament (GO:0045095)	structural molecule activity (GO:0005198)	p.V140V(1)		breast(1)|cervix(1)|endometrium(1)|large_intestine(2)|lung(12)|pancreas(1)	18						CTGGCTGGCAGACAGTAGAGA	0.587																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											55.0	57.0	57.0					21																	32253424		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AJ457065	CCDS13608.1	21q22.1	2003-03-11			ENSG00000182591	ENSG00000182591		"""Keratin associated proteins"""	18922	protein-coding gene	gene with protein product		600064				12359730	Standard	NM_175858		Approved	KAP11.1	uc002yov.3	Q8IUC1	OTTHUMG00000057773	ENST00000332378.4:c.420C>G	21.37:g.32253424G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	A1L4I8	Silent	SNP	pfam_PMG	p.V140	ENST00000332378.4	37	c.420	CCDS13608.1	21																																																																																			KRTAP11-1	-	pfam_PMG	ENSG00000182591		0.587	KRTAP11-1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRTAP11-1	HGNC	protein_coding	OTTHUMT00000128225.1	39	0.00	0	G			32253424	32253424	-1	no_errors	ENST00000332378	ensembl	human	known	69_37n	silent	33	36.54	19	SNP	0.785	C
LCE2A	353139	genome.wustl.edu	37	1	152671581	152671581	+	Frame_Shift_Del	DEL	C	C	-			TCGA-A2-A04R-01A-41D-A117-09	TCGA-A2-A04R-10B-01D-A10G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f8e4326-dfc7-4635-a9b7-a9207a392748	6234c5ee-14f2-427c-9ebc-4911da27a849	g.chr1:152671581delC	ENST00000368779.1	+	2	255	c.204delC	c.(202-204)tgcfs	p.C68fs		NM_178428.3	NP_848515.1	Q5TA79	LCE2A_HUMAN	late cornified envelope 2A	68	Cys-rich.				keratinization (GO:0031424)			p.L69fs*1(1)		breast(1)|large_intestine(1)|liver(2)|lung(4)	8	Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.206)			GCGGCTGCTGCCTGAGCCACC	0.677																																						dbGAP											1	Deletion - Frameshift(1)	breast(1)											34.0	45.0	41.0					1																	152671581		2201	4297	6498	-	-	-	SO:0001589	frameshift_variant	0				CCDS1021.1	1q21.3	2008-02-05			ENSG00000187173	ENSG00000187173		"""Late cornified envelopes"""	29469	protein-coding gene	gene with protein product		612609				11698679	Standard	NM_178428		Approved	LEP9	uc001faj.3	Q5TA79	OTTHUMG00000012392	ENST00000368779.1:c.204delC	1.37:g.152671581delC	ENSP00000357768:p.Cys68fs	Somatic		WXS	Illumina GAIIx	Phase_IV	A4QMZ9	Frame_Shift_Del	DEL	NULL	p.L69fs	ENST00000368779.1	37	c.204	CCDS1021.1	1																																																																																			LCE2A	-	NULL	ENSG00000187173		0.677	LCE2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LCE2A	HGNC	protein_coding	OTTHUMT00000034512.1	72	0.00	0	C	NM_178428		152671581	152671581	+1	no_errors	ENST00000368779	ensembl	human	known	69_37n	frame_shift_del	39	56.18	50	DEL	0.182	-
LRIT1	26103	genome.wustl.edu	37	10	85993929	85993929	+	Silent	SNP	G	G	A			TCGA-A2-A04R-01A-41D-A117-09	TCGA-A2-A04R-10B-01D-A10G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f8e4326-dfc7-4635-a9b7-a9207a392748	6234c5ee-14f2-427c-9ebc-4911da27a849	g.chr10:85993929G>A	ENST00000372105.3	-	3	816	c.795C>T	c.(793-795)tcC>tcT	p.S265S		NM_015613.2	NP_056428.1	Q9P2V4	LRIT1_HUMAN	leucine-rich repeat, immunoglobulin-like and transmembrane domains 1	265						integral component of endoplasmic reticulum membrane (GO:0030176)		p.S265S(1)		breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(13)|skin(1)	23						CACCCAAAAGGGACCTGATGC	0.632																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											75.0	74.0	74.0					10																	85993929		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB031547	CCDS7373.1	10q23	2013-02-11	2007-06-19	2007-06-19	ENSG00000148602	ENSG00000148602		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	23404	protein-coding gene	gene with protein product	"""fibronectin type III, immunoglobulin and leucine rich repeat domains 9"""		"""leucine rich repeat containing 21"""	LRRC21		10777785	Standard	NM_015613		Approved	PAL, DKFZP434K091, FIGLER9	uc001kcz.1	Q9P2V4	OTTHUMG00000018632	ENST00000372105.3:c.795C>T	10.37:g.85993929G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q0QD41|Q9Y4N7	Silent	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,pfam_Leu-rich_rpt,superfamily_Fibronectin_type3,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C,smart_Ig_sub,smart_Ig_sub2,pfscan_Fibronectin_type3,pfscan_Ig-like	p.S265	ENST00000372105.3	37	c.795	CCDS7373.1	10																																																																																			LRIT1	-	smart_Ig_sub,pfscan_Ig-like	ENSG00000148602		0.632	LRIT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRIT1	HGNC	protein_coding	OTTHUMT00000049109.1	37	0.00	0	G	NM_015613		85993929	85993929	-1	no_errors	ENST00000372105	ensembl	human	known	69_37n	silent	24	35.14	13	SNP	0.698	A
MAL	4118	genome.wustl.edu	37	2	95691433	95691433	+	5'UTR	SNP	C	C	T			TCGA-A2-A04R-01A-41D-A117-09	TCGA-A2-A04R-10B-01D-A10G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f8e4326-dfc7-4635-a9b7-a9207a392748	6234c5ee-14f2-427c-9ebc-4911da27a849	g.chr2:95691433C>T	ENST00000309988.4	+	0	5				MAL_ENST00000489399.1_3'UTR|MAL_ENST00000353004.3_5'Flank|MAL_ENST00000354078.3_5'Flank|AC103563.8_ENST00000448734.1_RNA|MAL_ENST00000349807.3_5'Flank	NM_002371.3	NP_002362.1	P21145	MAL_HUMAN	mal, T-cell differentiation protein						apical protein localization (GO:0045176)|apoptotic process (GO:0006915)|cell differentiation (GO:0030154)|central nervous system development (GO:0007417)|membrane raft polarization (GO:0001766)|myelination (GO:0042552)|positive regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902043)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extrinsic component of membrane (GO:0019898)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)	channel activity (GO:0015267)|lipid binding (GO:0008289)|peptidase activator activity involved in apoptotic process (GO:0016505)|structural constituent of myelin sheath (GO:0019911)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(4)|prostate(2)	10				STAD - Stomach adenocarcinoma(1183;0.18)		TCTTAACCCGCGCGCGGGGGC	0.796																																						dbGAP											0																																										-	-	-	SO:0001623	5_prime_UTR_variant	0				CCDS2006.1, CCDS2007.1, CCDS2008.1, CCDS2009.1	2q11.1	2008-07-29			ENSG00000172005	ENSG00000172005			6817	protein-coding gene	gene with protein product		188860					Standard	NM_002371		Approved		uc002stx.2	P21145	OTTHUMG00000132011	ENST00000309988.4:c.-105C>T	2.37:g.95691433C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q6FH77	RNA	SNP	-	NULL	ENST00000309988.4	37	NULL	CCDS2006.1	2																																																																																			MAL	-	-	ENSG00000172005		0.796	MAL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAL	HGNC	protein_coding	OTTHUMT00000254982.3	26	0.00	0	C	NM_002371		95691433	95691433	+1	no_errors	ENST00000489399	ensembl	human	known	69_37n	rna	2	75.00	6	SNP	0.916	T
LRP2	4036	genome.wustl.edu	37	2	170177381	170177381	+	Silent	SNP	C	C	T			TCGA-A2-A04R-01A-41D-A117-09	TCGA-A2-A04R-10B-01D-A10G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f8e4326-dfc7-4635-a9b7-a9207a392748	6234c5ee-14f2-427c-9ebc-4911da27a849	g.chr2:170177381C>T	ENST00000263816.3	-	2	378	c.93G>A	c.(91-93)gcG>gcA	p.A31A	LRP2_ENST00000443831.1_Silent_p.A31A	NM_004525.2	NP_004516.2	P98164	LRP2_HUMAN	low density lipoprotein receptor-related protein 2	31	LDL-receptor class A 1. {ECO:0000255|PROSITE-ProRule:PRU00124}.				cell proliferation (GO:0008283)|endocytosis (GO:0006897)|forebrain development (GO:0030900)|lipid metabolic process (GO:0006629)|phototransduction, visible light (GO:0007603)|protein glycosylation (GO:0006486)|receptor-mediated endocytosis (GO:0006898)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|vitamin D metabolic process (GO:0042359)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|coated pit (GO:0005905)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)	p.A31A(1)		biliary_tract(1)|breast(16)|central_nervous_system(6)|cervix(2)|endometrium(24)|haematopoietic_and_lymphoid_tissue(2)|kidney(17)|large_intestine(70)|liver(1)|lung(117)|ovary(19)|pancreas(1)|prostate(2)|skin(17)|upper_aerodigestive_tract(7)|urinary_tract(13)	315				STAD - Stomach adenocarcinoma(1183;0.000766)|COAD - Colon adenocarcinoma(177;0.0101)	"""""""Insulin(DB00071)|Gentamicin(DB00798)|Insulin Regular(DB00030)|Urokinase(DB00013)"""	AGCGAAAATGCGCACTGTCAC	0.388																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											113.0	96.0	102.0					2																	170177381		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS2232.1	2q31.1	2013-05-28	2010-01-26		ENSG00000081479	ENSG00000081479		"""Low density lipoprotein receptors"""	6694	protein-coding gene	gene with protein product	"""megalin"""	600073				7959795	Standard	NM_004525		Approved	gp330, DBS	uc002ues.3	P98164	OTTHUMG00000132179	ENST00000263816.3:c.93G>A	2.37:g.170177381C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	O00711|Q16215	Silent	SNP	pfam_LDrepeatLR_classA_rpt,pfam_LDLR_classB_rpt,superfamily_Growth_fac_rcpt,superfamily_LDrepeatLR_classA_rpt,superfamily_TIL_dom,smart_LDrepeatLR_classA_rpt,smart_EGF-like,smart_EGF-like_Ca-bd,smart_LDLR_classB_rpt,pfscan_EG-like_dom,pfscan_LDrepeatLR_classA_rpt,pfscan_LDLR_classB_rpt	p.A31	ENST00000263816.3	37	c.93	CCDS2232.1	2																																																																																			LRP2	-	pfam_LDrepeatLR_classA_rpt,superfamily_LDrepeatLR_classA_rpt,smart_LDrepeatLR_classA_rpt,pfscan_LDrepeatLR_classA_rpt	ENSG00000081479		0.388	LRP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRP2	HGNC	protein_coding	OTTHUMT00000255231.2	122	0.00	0	C	NM_004525		170177381	170177381	-1	no_errors	ENST00000263816	ensembl	human	known	69_37n	silent	68	43.33	52	SNP	0.000	T
MASTL	84930	genome.wustl.edu	37	10	27454445	27454445	+	Missense_Mutation	SNP	A	A	T			TCGA-A2-A04R-01A-41D-A117-09	TCGA-A2-A04R-10B-01D-A10G-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f8e4326-dfc7-4635-a9b7-a9207a392748	6234c5ee-14f2-427c-9ebc-4911da27a849	g.chr10:27454445A>T	ENST00000375940.4	+	6	845	c.788A>T	c.(787-789)tAt>tTt	p.Y263F	MASTL_ENST00000375946.4_Missense_Mutation_p.Y263F|MASTL_ENST00000342386.6_Missense_Mutation_p.Y263F			Q96GX5	GWL_HUMAN	microtubule associated serine/threonine kinase-like	263	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cellular response to DNA damage stimulus (GO:0006974)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|negative regulation of protein phosphatase type 2A activity (GO:0034048)|regulation of cell cycle (GO:0051726)	centrosome (GO:0005813)|cleavage furrow (GO:0032154)|cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|kinase activity (GO:0016301)|protein phosphatase 2A binding (GO:0051721)|protein serine/threonine kinase activity (GO:0004674)	p.Y263F(1)		breast(3)|cervix(2)|endometrium(2)|large_intestine(7)|lung(9)|ovary(1)|pancreas(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	29						ACTACGCCTTATTCTAGCAAA	0.453																																						dbGAP											1	Substitution - Missense(1)	breast(1)											103.0	97.0	99.0					10																	27454445		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC009107	CCDS7153.1, CCDS53502.1, CCDS53503.1	10p12.1	2005-11-03			ENSG00000120539	ENSG00000120539			19042	protein-coding gene	gene with protein product		608221					Standard	NM_001172303		Approved	FLJ14813, THC2	uc001itm.3	Q96GX5	OTTHUMG00000017855	ENST00000375940.4:c.788A>T	10.37:g.27454445A>T	ENSP00000365107:p.Tyr263Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5T8D5|Q5T8D7|Q8NCD6|Q96SJ5	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.Y263F	ENST00000375940.4	37	c.788	CCDS53502.1	10	.	.	.	.	.	.	.	.	.	.	A	6.491	0.458797	0.12342	.	.	ENSG00000120539	ENST00000375946;ENST00000342386;ENST00000375940	D;D;D	0.88818	-2.43;-2.43;-2.43	5.58	3.23	0.37069	Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	1.239420	0.05093	N	0.485629	D	0.86209	0.5878	M	0.65975	2.015	0.09310	N	1	P;P;P	0.40000	0.646;0.698;0.646	B;B;B	0.42282	0.382;0.111;0.218	T	0.70121	-0.4959	10	0.09843	T	0.71	-11.5498	1.5729	0.02618	0.5655:0.1326:0.1579:0.1439	.	263;263;263	Q96GX5-2;Q96GX5;Q96GX5-3	.;GWL_HUMAN;.	F	263	ENSP00000365113:Y263F;ENSP00000343446:Y263F;ENSP00000365107:Y263F	ENSP00000343446:Y263F	Y	+	2	0	MASTL	27494451	0.176000	0.23096	0.950000	0.38849	0.422000	0.31414	0.390000	0.20768	0.968000	0.38212	0.397000	0.26171	TAT	MASTL	-	superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,pfscan_Prot_kinase_cat_dom	ENSG00000120539		0.453	MASTL-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MASTL	HGNC	protein_coding	OTTHUMT00000047320.1	92	0.00	0	A	NM_032844		27454445	27454445	+1	no_errors	ENST00000375940	ensembl	human	known	69_37n	missense	38	50.00	38	SNP	0.204	T
MEGF8	1954	genome.wustl.edu	37	19	42861080	42861080	+	Missense_Mutation	SNP	A	A	T	rs564045592		TCGA-A2-A04R-01A-41D-A117-09	TCGA-A2-A04R-10B-01D-A10G-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f8e4326-dfc7-4635-a9b7-a9207a392748	6234c5ee-14f2-427c-9ebc-4911da27a849	g.chr19:42861080A>T	ENST00000251268.6	+	27	4777	c.4777A>T	c.(4777-4779)Acc>Tcc	p.T1593S	MEGF8_ENST00000334370.4_Missense_Mutation_p.T1526S	NM_001271938.1	NP_001258867.1	Q7Z7M0	MEGF8_HUMAN	multiple EGF-like-domains 8	1593					BMP signaling pathway (GO:0030509)|cell migration involved in gastrulation (GO:0042074)|craniofacial suture morphogenesis (GO:0097094)|determination of digestive tract left/right asymmetry (GO:0071907)|determination of heart left/right asymmetry (GO:0061371)|embryonic heart tube left/right pattern formation (GO:0060971)|embryonic heart tube morphogenesis (GO:0003143)|embryonic limb morphogenesis (GO:0030326)|embryonic skeletal system morphogenesis (GO:0048704)|epiboly involved in gastrulation with mouth forming second (GO:0055113)|fasciculation of sensory neuron axon (GO:0097155)|left/right pattern formation (GO:0060972)|limb morphogenesis (GO:0035108)|positive regulation of axon extension involved in axon guidance (GO:0048842)|regulation of gene expression (GO:0010468)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|receptor activity (GO:0004872)	p.T1526S(1)|p.T1134S(1)|p.T1593S(1)		breast(2)|cervix(1)|endometrium(11)|kidney(2)|large_intestine(9)|lung(20)|ovary(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	50		Prostate(69;0.00682)				TGGAGGCGTCACCCGTGATTT	0.662																																						dbGAP											3	Substitution - Missense(3)	breast(3)											46.0	38.0	41.0					19																	42861080		2203	4299	6502	-	-	-	SO:0001583	missense	0			AB011541	CCDS12604.2, CCDS62693.1	19q13.2	2011-11-24	2006-03-31	2006-03-31	ENSG00000105429	ENSG00000105429			3233	protein-coding gene	gene with protein product	"""HBV pre s2 binding protein 1"""	604267	"""EGF-like-domain, multiple 4"", ""chromosome 19 open reading frame 49"""	EGFL4, C19orf49		9693030	Standard	NM_001410		Approved	SBP1, FLJ22365	uc002otm.5	Q7Z7M0	OTTHUMG00000150342	ENST00000251268.6:c.4777A>T	19.37:g.42861080A>T	ENSP00000251268:p.Thr1593Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	A8KAY0|O75097	Missense_Mutation	SNP	pfam_CUB,pfam_EGF_laminin,pfam_Plexin_repeat,superfamily_Gal_Oxase/kelch_b-propeller,superfamily_CUB,superfamily_Plexin-like_fold,smart_CUB,smart_EGF-like,smart_Plexin-like,smart_EGF-like_Ca-bd,smart_EGF_laminin,pfscan_CUB,pfscan_EG-like_dom,pfscan_EGF_laminin	p.T1593S	ENST00000251268.6	37	c.4777		19	.	.	.	.	.	.	.	.	.	.	A	6.162	0.398109	0.11696	.	.	ENSG00000105429	ENST00000334370;ENST00000251268	T;T	0.62105	0.05;0.05	5.32	-2.84	0.05751	Galactose oxidase/kelch, beta-propeller (1);Kelch-type beta propeller (1);	0.502662	0.19234	N	0.119323	T	0.32041	0.0816	N	0.05306	-0.075	0.80722	D	1	B;B	0.24920	0.004;0.114	B;B	0.24541	0.005;0.054	T	0.08932	-1.0698	10	0.12430	T	0.62	-1.5607	10.3877	0.44150	0.1636:0.0:0.7015:0.135	.	1593;1526	Q7Z7M0;Q7Z7M0-2	MEGF8_HUMAN;.	S	1526;1593	ENSP00000334219:T1526S;ENSP00000251268:T1593S	ENSP00000251268:T1593S	T	+	1	0	MEGF8	47552920	0.004000	0.15560	0.128000	0.21923	0.885000	0.51271	-0.173000	0.09854	-0.454000	0.07066	0.460000	0.39030	ACC	MEGF8	-	superfamily_Gal_Oxase/kelch_b-propeller	ENSG00000105429		0.662	MEGF8-002	KNOWN	basic|appris_candidate_longest	protein_coding	MEGF8	HGNC	protein_coding	OTTHUMT00000463854.1	40	0.00	0	A	NM_001410		42861080	42861080	+1	no_errors	ENST00000251268	ensembl	human	known	69_37n	missense	16	52.94	18	SNP	0.601	T
MPO	4353	genome.wustl.edu	37	17	56348081	56348081	+	Missense_Mutation	SNP	C	C	T			TCGA-A2-A04R-01A-41D-A117-09	TCGA-A2-A04R-10B-01D-A10G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f8e4326-dfc7-4635-a9b7-a9207a392748	6234c5ee-14f2-427c-9ebc-4911da27a849	g.chr17:56348081C>T	ENST00000225275.3	-	12	2350	c.2174G>A	c.(2173-2175)cGg>cAg	p.R725Q	MPO_ENST00000340482.3_Missense_Mutation_p.R757Q	NM_000250.1	NP_000241.1	P05164	PERM_HUMAN	myeloperoxidase	725					aging (GO:0007568)|defense response (GO:0006952)|defense response to fungus (GO:0050832)|hydrogen peroxide catabolic process (GO:0042744)|hypochlorous acid biosynthetic process (GO:0002149)|low-density lipoprotein particle remodeling (GO:0034374)|negative regulation of apoptotic process (GO:0043066)|negative regulation of growth of symbiont in host (GO:0044130)|oxidation-reduction process (GO:0055114)|removal of superoxide radicals (GO:0019430)|respiratory burst involved in defense response (GO:0002679)|response to food (GO:0032094)|response to lipopolysaccharide (GO:0032496)|response to mechanical stimulus (GO:0009612)|response to oxidative stress (GO:0006979)|response to yeast (GO:0001878)	azurophil granule (GO:0042582)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|lysosome (GO:0005764)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|secretory granule (GO:0030141)	chromatin binding (GO:0003682)|heme binding (GO:0020037)|heparin binding (GO:0008201)|metal ion binding (GO:0046872)|peroxidase activity (GO:0004601)	p.R725Q(1)		breast(4)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(8)|liver(1)|lung(13)|ovary(2)|pancreas(1)|skin(4)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(4)	46					Aminosalicylic Acid(DB00233)|Bivalirudin(DB00006)|Calcipotriol(DB02300)|Carboplatin(DB00958)|Cefaclor(DB00833)|Cefdinir(DB00535)|Cisplatin(DB00515)|Cysteamine(DB00847)|Dapsone(DB00250)|Enoxaparin(DB01225)|Human Serum Albumin(DB00062)|L-Carnitine(DB00583)|Melatonin(DB01065)|Mesalazine(DB00244)|Nabumetone(DB00461)|Octreotide(DB00104)|Oxaliplatin(DB00526)|Propylthiouracil(DB00550)|Ticlopidine(DB00208)|Tolmetin(DB00500)	GACAAAGTCCCGGGGATATGA	0.547																																						dbGAP											1	Substitution - Missense(1)	breast(1)											193.0	157.0	169.0					17																	56348081		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS11604.1	17q21.3-q23	2014-09-17				ENSG00000005381	1.11.1.7		7218	protein-coding gene	gene with protein product		606989					Standard	NM_000250		Approved		uc002ivu.1	P05164		ENST00000225275.3:c.2174G>A	17.37:g.56348081C>T	ENSP00000225275:p.Arg725Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	A1L4B8|Q14862|Q4PJH5|Q9UCL7	Missense_Mutation	SNP	pfam_Haem_peroxidase_animal,superfamily_Haem_peroxidase,pfscan_Haem_peroxidase_animal,prints_Haem_peroxidase_animal_subgr	p.R757Q	ENST00000225275.3	37	c.2270	CCDS11604.1	17	.	.	.	.	.	.	.	.	.	.	C	4.759	0.141131	0.09083	.	.	ENSG00000005381	ENST00000340482;ENST00000225275	T;T	0.72505	-0.66;-0.66	5.76	1.19	0.21007	.	0.394546	0.29015	N	0.013407	T	0.40791	0.1131	N	0.11756	0.17	0.09310	N	1	B	0.14805	0.011	B	0.06405	0.002	T	0.28650	-1.0037	10	0.02654	T	1	-21.9921	5.5033	0.16840	0.0:0.4456:0.141:0.4134	.	725	P05164	PERM_HUMAN	Q	757;725	ENSP00000344419:R757Q;ENSP00000225275:R725Q	ENSP00000225275:R725Q	R	-	2	0	MPO	53703080	0.000000	0.05858	0.996000	0.52242	0.476000	0.33039	-0.450000	0.06803	0.377000	0.24735	-0.136000	0.14681	CGG	MPO	-	superfamily_Haem_peroxidase,pfscan_Haem_peroxidase_animal	ENSG00000005381		0.547	MPO-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MPO	HGNC	protein_coding	OTTHUMT00000443971.1	168	0.00	0	C			56348081	56348081	-1	no_errors	ENST00000340482	ensembl	human	known	69_37n	missense	140	43.55	108	SNP	0.007	T
NALCN	259232	genome.wustl.edu	37	13	101712242	101712242	+	Silent	SNP	C	C	T			TCGA-A2-A04R-01A-41D-A117-09	TCGA-A2-A04R-10B-01D-A10G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f8e4326-dfc7-4635-a9b7-a9207a392748	6234c5ee-14f2-427c-9ebc-4911da27a849	g.chr13:101712242C>T	ENST00000251127.6	-	42	4914	c.4833G>A	c.(4831-4833)ccG>ccA	p.P1611P	NALCN-AS1_ENST00000457843.1_RNA	NM_052867.2	NP_443099.1	Q8IZF0	NALCN_HUMAN	sodium leak channel, non-selective	1611					calcium ion import (GO:0070509)|calcium ion transmembrane transport (GO:0070588)|cell death (GO:0008219)|ion transmembrane transport (GO:0034220)|membrane depolarization during action potential (GO:0086010)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	sodium channel activity (GO:0005272)|voltage-gated calcium channel activity (GO:0005245)	p.P1611P(1)		NS(1)|autonomic_ganglia(2)|breast(6)|central_nervous_system(2)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(3)|kidney(10)|large_intestine(33)|liver(2)|lung(81)|ovary(8)|pancreas(3)|prostate(5)|skin(6)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	177	all_neural(89;0.0438)|Medulloblastoma(90;0.163)|Lung SC(71;0.184)					CGATGCTGGGCGGGTTCAGAA	0.552																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											142.0	111.0	122.0					13																	101712242		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AY141972	CCDS9498.1	13q32.3	2012-02-21	2007-04-26	2007-04-26	ENSG00000102452	ENSG00000102452		"""Ion channels / Sodium leak channels, non-selective"""	19082	protein-coding gene	gene with protein product		611549	"""voltage gated channel like 1"""	VGCNL1		17448995	Standard	XM_006719943		Approved	bA430M15.1, CanIon	uc001vox.1	Q8IZF0	OTTHUMG00000017295	ENST00000251127.6:c.4833G>A	13.37:g.101712242C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q6P2S6|Q6ZMI7|Q8IZZ1|Q8TAH1	Silent	SNP	pfam_Ion_trans_dom	p.P1611	ENST00000251127.6	37	c.4833	CCDS9498.1	13																																																																																			NALCN	-	NULL	ENSG00000102452		0.552	NALCN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NALCN	HGNC	protein_coding	OTTHUMT00000045663.2	63	0.00	0	C	NM_052867		101712242	101712242	-1	no_errors	ENST00000251127	ensembl	human	known	69_37n	silent	45	45.78	38	SNP	0.079	T
NOD1	10392	genome.wustl.edu	37	7	30491883	30491883	+	Missense_Mutation	SNP	G	G	T	rs562328057		TCGA-A2-A04R-01A-41D-A117-09	TCGA-A2-A04R-10B-01D-A10G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f8e4326-dfc7-4635-a9b7-a9207a392748	6234c5ee-14f2-427c-9ebc-4911da27a849	g.chr7:30491883G>T	ENST00000222823.4	-	6	1675	c.1150C>A	c.(1150-1152)Ctc>Atc	p.L384I	NOD1_ENST00000423334.2_3'UTR	NM_006092.2	NP_006083.1	Q9Y239	NOD1_HUMAN	nucleotide-binding oligomerization domain containing 1	384	NACHT. {ECO:0000255|PROSITE- ProRule:PRU00136}.				activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|activation of MAPK activity (GO:0000187)|apoptotic process (GO:0006915)|defense response (GO:0006952)|defense response to bacterium (GO:0042742)|defense response to Gram-positive bacterium (GO:0050830)|detection of bacterium (GO:0016045)|detection of biotic stimulus (GO:0009595)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|interleukin-8 biosynthetic process (GO:0042228)|intracellular signal transduction (GO:0035556)|JNK cascade (GO:0007254)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|nucleotide-binding oligomerization domain containing signaling pathway (GO:0070423)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of dendritic cell antigen processing and presentation (GO:0002606)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of JNK cascade (GO:0046330)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of tumor necrosis factor production (GO:0032760)|protein oligomerization (GO:0051259)|signal transduction (GO:0007165)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	basolateral plasma membrane (GO:0016323)|cytoplasm (GO:0005737)|cytosol (GO:0005829)	ATP binding (GO:0005524)|CARD domain binding (GO:0050700)|cysteine-type endopeptidase activator activity involved in apoptotic process (GO:0008656)|identical protein binding (GO:0042802)|peptidoglycan binding (GO:0042834)|protein homodimerization activity (GO:0042803)			breast(1)|central_nervous_system(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(17)|ovary(2)|prostate(1)|skin(2)	39						AGGCTGCAGAGGTTGGGGTTG	0.657													G|||	1	0.000199681	0.0008	0.0	5008	,	,		17873	0.0		0.0	False		,,,				2504	0.0					dbGAP											0													61.0	68.0	65.0					7																	30491883		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF126484	CCDS5427.1	7p15-p14	2006-12-08	2006-12-08	2006-12-08	ENSG00000106100	ENSG00000106100		"""Nucleotide-binding domain and leucine rich repeat containing"""	16390	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and CARD domain containing 1"", ""NLR family, CARD domain containing 1"""	605980	"""caspase recruitment domain family, member 4"""	CARD4		10224040, 10329646	Standard	NM_006092		Approved	NLRC1, CLR7.1	uc003tav.3	Q9Y239	OTTHUMG00000023923	ENST00000222823.4:c.1150C>A	7.37:g.30491883G>T	ENSP00000222823:p.Leu384Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DTU3|Q549U4|Q8IWF5	Missense_Mutation	SNP	pfam_CARD,superfamily_DEATH-like,smart_Leu-rich_rpt_RNase_inh_sub-typ,pfscan_NACHT_NTPase,pfscan_CARD	p.L384I	ENST00000222823.4	37	c.1150	CCDS5427.1	7	.	.	.	.	.	.	.	.	.	.	G	18.96	3.734679	0.69189	.	.	ENSG00000106100	ENST00000222823	D	0.84516	-1.86	5.71	4.82	0.62117	NACHT nucleoside triphosphatase (1);	0.058074	0.64402	D	0.000001	D	0.91676	0.7369	M	0.89095	3.005	0.80722	D	1	D	0.71674	0.998	P	0.62089	0.898	D	0.92340	0.5881	10	0.87932	D	0	.	10.5293	0.44967	0.1477:0.0:0.8523:0.0	.	384	Q9Y239	NOD1_HUMAN	I	384	ENSP00000222823:L384I	ENSP00000222823:L384I	L	-	1	0	NOD1	30458408	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	4.110000	0.57831	2.691000	0.91804	0.563000	0.77884	CTC	NOD1	-	pfscan_NACHT_NTPase	ENSG00000106100		0.657	NOD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NOD1	HGNC	protein_coding	OTTHUMT00000250443.2	21	0.00	0	G			30491883	30491883	-1	no_errors	ENST00000222823	ensembl	human	known	69_37n	missense	13	35.00	7	SNP	1.000	T
NOS3	4846	genome.wustl.edu	37	7	150698415	150698415	+	Missense_Mutation	SNP	G	G	A			TCGA-A2-A04R-01A-41D-A117-09	TCGA-A2-A04R-10B-01D-A10G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f8e4326-dfc7-4635-a9b7-a9207a392748	6234c5ee-14f2-427c-9ebc-4911da27a849	g.chr7:150698415G>A	ENST00000484524.1	+	10	1330	c.1330G>A	c.(1330-1332)Gac>Aac	p.D444N	NOS3_ENST00000297494.3_Missense_Mutation_p.D444N|NOS3_ENST00000467517.1_Missense_Mutation_p.D444N|NOS3_ENST00000461406.1_Missense_Mutation_p.D238N	NM_001160111.1	NP_001153583.1	P60323	NANO3_HUMAN	nitric oxide synthase 3 (endothelial cell)	0					germ cell development (GO:0007281)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic signaling pathway (GO:2001234)|oogenesis (GO:0048477)|regulation of cell cycle (GO:0051726)|regulation of translation (GO:0006417)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|cytoplasmic mRNA processing body (GO:0000932)|cytoplasmic stress granule (GO:0010494)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	RNA binding (GO:0003723)|zinc ion binding (GO:0008270)	p.D444N(1)		NS(3)|breast(3)|central_nervous_system(5)|endometrium(1)|kidney(4)|large_intestine(6)|liver(2)|lung(11)|ovary(3)|prostate(3)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	50	all_neural(206;0.219)		OV - Ovarian serous cystadenocarcinoma(82;0.0121)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)		CTGCCCTGCAGACTGGGCCTG	0.617																																						dbGAP											1	Substitution - Missense(1)	breast(1)											60.0	60.0	60.0					7																	150698415		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS5912.1, CCDS55182.1, CCDS55183.1	7q36	2007-02-15			ENSG00000164867	ENSG00000164867	1.14.13.39		7876	protein-coding gene	gene with protein product	"""endothelial nitric oxide synthase"""	163729				1379542	Standard	NM_000603		Approved	ECNOS, eNOS	uc003wif.3	P29474	OTTHUMG00000158343	ENST00000484524.1:c.1330G>A	7.37:g.150698415G>A	ENSP00000420215:p.Asp444Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	Q495E5	Missense_Mutation	SNP	pfam_NO_synthase_oxygenase_dom,pfam_FAD-binding_1,pfam_Flavodoxin/NO_synth,pfam_OxRdtase_FAD/NAD-bd,superfamily_NO_synthase_oxygenase_dom,superfamily_Riboflavin_synthase-like_b-brl,pirsf_NOS_met,pfscan_Flavodoxin/NO_synth,prints_Flavoprot_Pyr_Nucl_cyt_Rdtase,prints_Flavdoxin	p.D444N	ENST00000484524.1	37	c.1330	CCDS55182.1	7	.	.	.	.	.	.	.	.	.	.	G	31	5.102233	0.94245	.	.	ENSG00000164867	ENST00000297494;ENST00000461406;ENST00000484524;ENST00000467517	T;T;T;T	0.35421	1.31;1.31;1.31;1.31	5.03	5.03	0.67393	Nitric oxide synthase, oxygenase domain (2);	0.000000	0.64402	D	0.000007	T	0.60715	0.2290	M	0.76574	2.34	0.54753	D	0.999981	P;P;D;D;D	0.89917	0.791;0.639;1.0;1.0;0.995	P;P;D;D;D	0.97110	0.773;0.795;1.0;1.0;0.963	T	0.63976	-0.6515	10	0.56958	D	0.05	-18.4693	15.8587	0.79005	0.0:0.0:1.0:0.0	.	444;444;444;238;444	A0S0A6;E9PFR2;A0S0A8;E7ESA7;P29474	.;.;.;.;NOS3_HUMAN	N	444;238;444;444	ENSP00000297494:D444N;ENSP00000417143:D238N;ENSP00000420215:D444N;ENSP00000420551:D444N	ENSP00000297494:D444N	D	+	1	0	NOS3	150329348	1.000000	0.71417	0.930000	0.37139	0.937000	0.57800	9.863000	0.99569	2.325000	0.78763	0.561000	0.74099	GAC	NOS3	-	pfam_NO_synthase_oxygenase_dom,superfamily_NO_synthase_oxygenase_dom,pirsf_NOS_met	ENSG00000164867		0.617	NOS3-004	NOVEL	basic|exp_conf|CCDS	protein_coding	NOS3	HGNC	protein_coding	OTTHUMT00000351550.1	64	0.00	0	G	NM_000603		150698415	150698415	+1	no_errors	ENST00000297494	ensembl	human	known	69_37n	missense	25	53.70	29	SNP	1.000	A
NPAS3	64067	genome.wustl.edu	37	14	34269056	34269056	+	Missense_Mutation	SNP	G	G	A			TCGA-A2-A04R-01A-41D-A117-09	TCGA-A2-A04R-10B-01D-A10G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f8e4326-dfc7-4635-a9b7-a9207a392748	6234c5ee-14f2-427c-9ebc-4911da27a849	g.chr14:34269056G>A	ENST00000356141.4	+	12	1543	c.1543G>A	c.(1543-1545)Gac>Aac	p.D515N	NPAS3_ENST00000357798.5_Missense_Mutation_p.D502N|NPAS3_ENST00000551492.1_Missense_Mutation_p.D520N|NPAS3_ENST00000346562.2_Missense_Mutation_p.D483N|NPAS3_ENST00000548645.1_Missense_Mutation_p.D485N			Q8IXF0	NPAS3_HUMAN	neuronal PAS domain protein 3	515					locomotory behavior (GO:0007626)|maternal behavior (GO:0042711)|positive regulation of transcription, DNA-templated (GO:0045893)|startle response (GO:0001964)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|signal transducer activity (GO:0004871)	p.D515N(1)|p.D502N(1)|p.D483N(1)		breast(4)|endometrium(3)|kidney(1)|large_intestine(6)|liver(2)|lung(14)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	40	Breast(36;0.0102)|Hepatocellular(127;0.133)		LUAD - Lung adenocarcinoma(48;0.00169)|Lung(238;0.00968)	GBM - Glioblastoma multiforme(1;1.31e-09)|all cancers(1;0.000112)|OV - Ovarian serous cystadenocarcinoma(311;0.115)		GAACTGCAACGACGACGGCCA	0.632																																						dbGAP											3	Substitution - Missense(3)	breast(3)											59.0	57.0	58.0					14																	34269056		2203	4299	6502	-	-	-	SO:0001583	missense	0			AF164438	CCDS9645.1, CCDS53891.1, CCDS53892.1, CCDS55912.1	14q13.1	2013-08-23			ENSG00000151322	ENSG00000151322		"""Basic helix-loop-helix proteins"""	19311	protein-coding gene	gene with protein product		609430					Standard	NM_022123		Approved	MOP6, PASD6, bHLHe12	uc001wru.3	Q8IXF0	OTTHUMG00000140215	ENST00000356141.4:c.1543G>A	14.37:g.34269056G>A	ENSP00000348460:p.Asp515Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	Q86US6|Q86US7|Q8IXF2|Q9BY81|Q9H323|Q9Y4L8	Missense_Mutation	SNP	pfam_PAS_fold_3,pfam_PAS_fold,superfamily_HLH_DNA-bd,smart_HLH_DNA-bd,smart_PAS,pfscan_PAS,pfscan_HLH_DNA-bd	p.D515N	ENST00000356141.4	37	c.1543	CCDS53891.1	14	.	.	.	.	.	.	.	.	.	.	G	25.0	4.588545	0.86851	.	.	ENSG00000151322	ENST00000551634;ENST00000551492;ENST00000346562;ENST00000548645;ENST00000356141;ENST00000357798	T;T;T;T;T;T	0.71817	-0.6;3.37;3.37;3.37;3.36;3.23	5.31	5.31	0.75309	.	0.245199	0.42294	D	0.000734	T	0.53302	0.1788	N	0.08118	0	0.80722	D	1	P;P;P;P	0.38642	0.641;0.509;0.641;0.641	B;B;B;B	0.35607	0.206;0.102;0.206;0.206	T	0.58025	-0.7709	10	0.36615	T	0.2	.	18.9674	0.92701	0.0:0.0:1.0:0.0	.	485;515;483;502	Q8IXF0-2;Q8IXF0;Q8IXF0-4;Q8IXF0-3	.;NPAS3_HUMAN;.;.	N	489;520;483;485;515;502	ENSP00000448373:D489N;ENSP00000450392:D520N;ENSP00000319610:D483N;ENSP00000448916:D485N;ENSP00000348460:D515N;ENSP00000350446:D502N	ENSP00000319610:D483N	D	+	1	0	NPAS3	33338807	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.406000	0.73276	2.474000	0.83562	0.555000	0.69702	GAC	NPAS3	-	NULL	ENSG00000151322		0.632	NPAS3-004	KNOWN	basic|CCDS	protein_coding	NPAS3	HGNC	protein_coding	OTTHUMT00000276645.1	19	0.00	0	G			34269056	34269056	+1	no_errors	ENST00000356141	ensembl	human	known	69_37n	missense	15	54.55	18	SNP	1.000	A
NPAS4	266743	genome.wustl.edu	37	11	66191919	66191919	+	Missense_Mutation	SNP	C	C	G			TCGA-A2-A04R-01A-41D-A117-09	TCGA-A2-A04R-10B-01D-A10G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f8e4326-dfc7-4635-a9b7-a9207a392748	6234c5ee-14f2-427c-9ebc-4911da27a849	g.chr11:66191919C>G	ENST00000311034.2	+	7	1734	c.1558C>G	c.(1558-1560)Cca>Gca	p.P520A		NM_178864.3	NP_849195.2	Q8IUM7	NPAS4_HUMAN	neuronal PAS domain protein 4	520					positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|signal transducer activity (GO:0004871)	p.P520A(1)		breast(4)|endometrium(2)|kidney(3)|large_intestine(11)|liver(2)|lung(20)|ovary(1)|prostate(3)|skin(3)	49						AGCCACCTTCCCAGAGCCTCT	0.592																																						dbGAP											1	Substitution - Missense(1)	breast(1)											162.0	167.0	165.0					11																	66191919		2200	4295	6495	-	-	-	SO:0001583	missense	0			AB049469	CCDS8138.1	11q13.2	2013-05-21			ENSG00000174576	ENSG00000174576		"""Basic helix-loop-helix proteins"""	18983	protein-coding gene	gene with protein product		608554				14701734	Standard	NM_178864		Approved	PASD10, NXF, Le-PAS, bHLHe79	uc001ohx.1	Q8IUM7	OTTHUMG00000167045	ENST00000311034.2:c.1558C>G	11.37:g.66191919C>G	ENSP00000311196:p.Pro520Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	B7ZL81|Q8N8S5|Q8N9Q9	Missense_Mutation	SNP	pfam_PAS_fold_3,smart_PAS,pfscan_PAS	p.P520A	ENST00000311034.2	37	c.1558	CCDS8138.1	11	.	.	.	.	.	.	.	.	.	.	C	10.35	1.327030	0.24080	.	.	ENSG00000174576	ENST00000311034	T	0.45668	0.89	4.69	3.78	0.43462	.	0.117425	0.39274	N	0.001410	T	0.19248	0.0462	N	0.08118	0	0.34374	D	0.692321	B	0.32918	0.39	B	0.23419	0.046	T	0.26155	-1.0111	10	0.40728	T	0.16	-6.9052	8.7013	0.34327	0.0:0.8968:0.0:0.1032	.	520	Q8IUM7	NPAS4_HUMAN	A	520	ENSP00000311196:P520A	ENSP00000311196:P520A	P	+	1	0	NPAS4	65948495	0.935000	0.31712	1.000000	0.80357	0.996000	0.88848	0.285000	0.18883	1.213000	0.43380	0.655000	0.94253	CCA	NPAS4	-	NULL	ENSG00000174576		0.592	NPAS4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NPAS4	HGNC	protein_coding	OTTHUMT00000392634.1	52	0.00	0	C	NM_178864		66191919	66191919	+1	no_errors	ENST00000311034	ensembl	human	known	69_37n	missense	44	40.54	30	SNP	1.000	G
NR6A1	2649	genome.wustl.edu	37	9	127316626	127316626	+	Missense_Mutation	SNP	C	C	G			TCGA-A2-A04R-01A-41D-A117-09	TCGA-A2-A04R-10B-01D-A10G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f8e4326-dfc7-4635-a9b7-a9207a392748	6234c5ee-14f2-427c-9ebc-4911da27a849	g.chr9:127316626C>G	ENST00000487099.2	-	3	523	c.366G>C	c.(364-366)caG>caC	p.Q122H	NR6A1_ENST00000373584.3_Missense_Mutation_p.Q118H|NR6A1_ENST00000344523.4_Missense_Mutation_p.Q122H|NR6A1_ENST00000416460.2_Missense_Mutation_p.Q118H	NM_001278546.1	NP_001265475.1	Q15406	NR6A1_HUMAN	nuclear receptor subfamily 6, group A, member 1	122					cell proliferation (GO:0008283)|gamete generation (GO:0007276)|gene expression (GO:0010467)|intracellular receptor signaling pathway (GO:0030522)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|spermatogenesis (GO:0007283)|transcription initiation from RNA polymerase II promoter (GO:0006367)	nucleoplasm (GO:0005654)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|protein homodimerization activity (GO:0042803)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding (GO:0043565)|steroid hormone receptor activity (GO:0003707)|zinc ion binding (GO:0008270)	p.Q122H(1)		NS(1)|breast(1)|cervix(1)|large_intestine(4)|lung(5)|ovary(3)|prostate(1)|skin(1)	17						TCATCCCCATCTGGAGGCATT	0.498																																					Esophageal Squamous(192;272 2884 6208 20560)	dbGAP											1	Substitution - Missense(1)	breast(1)											155.0	131.0	139.0					9																	127316626		2203	4300	6503	-	-	-	SO:0001583	missense	0			U64876	CCDS35137.1, CCDS55340.1, CCDS65127.1	9q33.3	2014-01-21			ENSG00000148200	ENSG00000148200		"""Nuclear hormone receptors"""	7985	protein-coding gene	gene with protein product		602778		GCNF		9134503, 8982251	Standard	NM_001489		Approved	GCNF1, RTR, CT150	uc004bor.1	Q15406	OTTHUMG00000020661	ENST00000487099.2:c.366G>C	9.37:g.127316626C>G	ENSP00000420267:p.Gln122His	Somatic		WXS	Illumina GAIIx	Phase_IV	O00551|O00603|Q5T6F4|Q8NHQ0|Q92898|Q99802	Missense_Mutation	SNP	pfam_Nucl_hrmn_rcpt_lig-bd_core,pfam_Znf_hrmn_rcpt,superfamily_Nucl_hormone_rcpt_ligand-bd,smart_Znf_hrmn_rcpt,smart_Nucl_hrmn_rcpt_lig-bd_core,pfscan_Znf_hrmn_rcpt,prints_Str_hrmn_rcpt,prints_Znf_hrmn_rcpt	p.Q122H	ENST00000487099.2	37	c.366	CCDS35137.1	9	.	.	.	.	.	.	.	.	.	.	C	20.1	3.936321	0.73442	.	.	ENSG00000148200	ENST00000487099;ENST00000373584;ENST00000416460;ENST00000344523;ENST00000475178	D;D;D;D;D	0.97328	-4.34;-4.34;-4.34;-4.34;-4.34	5.24	4.33	0.51752	Zinc finger, NHR/GATA-type (1);Zinc finger, nuclear hormone receptor-type (4);	0.000000	0.85682	D	0.000000	D	0.97411	0.9153	M	0.63169	1.94	0.80722	D	1	P;B;D	0.63880	0.587;0.361;0.993	B;B;P	0.61592	0.338;0.309;0.891	D	0.96755	0.9557	10	0.42905	T	0.14	.	13.188	0.59693	0.0:0.9223:0.0:0.0777	.	118;122;118	F1DAM1;Q15406;Q15406-5	.;NR6A1_HUMAN;.	H	122;118;118;122;80	ENSP00000420267:Q122H;ENSP00000362686:Q118H;ENSP00000413701:Q118H;ENSP00000341135:Q122H;ENSP00000420587:Q80H	ENSP00000341135:Q122H	Q	-	3	2	NR6A1	126356447	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	3.270000	0.51600	1.174000	0.42811	0.563000	0.77884	CAG	NR6A1	-	pfam_Znf_hrmn_rcpt,smart_Znf_hrmn_rcpt,pfscan_Znf_hrmn_rcpt,prints_Str_hrmn_rcpt,prints_Znf_hrmn_rcpt	ENSG00000148200		0.498	NR6A1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NR6A1	HGNC	protein_coding	OTTHUMT00000054043.4	94	0.00	0	C			127316626	127316626	-1	no_errors	ENST00000487099	ensembl	human	known	69_37n	missense	102	31.79	48	SNP	1.000	G
NRK	203447	genome.wustl.edu	37	X	105184016	105184017	+	Nonsense_Mutation	DNP	TC	TC	AA			TCGA-A2-A04R-01A-41D-A117-09	TCGA-A2-A04R-10B-01D-A10G-09	T|C	T|C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f8e4326-dfc7-4635-a9b7-a9207a392748	6234c5ee-14f2-427c-9ebc-4911da27a849	g.chrX:105184016_105184017TC>AA	ENST00000243300.9	+	23	4253_4254	c.3950_3951TC>AA	c.(3949-3951)tTC>tAA	p.F1317*	NRK_ENST00000428173.2_Nonsense_Mutation_p.F1318*	NM_198465.2	NP_940867.2	Q7Z2Y5	NRK_HUMAN	Nik related kinase	1317	CNH. {ECO:0000255|PROSITE- ProRule:PRU00795}.				activation of JNKK activity (GO:0007256)|negative regulation of cell proliferation (GO:0008285)|parturition (GO:0007567)|regulation of spongiotrophoblast cell proliferation (GO:0060721)		ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)|small GTPase regulator activity (GO:0005083)			breast(8)|central_nervous_system(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(14)|lung(36)|ovary(3)|prostate(1)|skin(2)	76						TGTGAACACTTCAGTGTCCGTA	0.361										HNSCC(51;0.14)																												dbGAP											0																																										-	-	-	SO:0001587	stop_gained	0			BX538345	CCDS65305.1	Xq22.3	2008-02-05			ENSG00000123572	ENSG00000123572			25391	protein-coding gene	gene with protein product		300791					Standard	NM_198465		Approved	DKFZp686A17109	uc004emd.3	Q7Z2Y5	OTTHUMG00000022143	Exception_encountered	X.37:g.105184016_105184017delinsAA	ENSP00000434830:p.Phe1317*	Somatic		WXS	Illumina GAIIx	Phase_IV	Q32ND6|Q5H9K2|Q6ZMP2	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Citron,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_Citron,pfscan_Prot_kinase_cat_dom	p.F1318Y|p.F1318L	ENST00000243300.9	37	c.3953|c.3954		X																																																																																			NRK	-	pfam_Citron,smart_Citron	ENSG00000123572		0.361	NRK-001	KNOWN	non_canonical_conserved|basic|appris_candidate	protein_coding	NRK	HGNC	protein_coding	OTTHUMT00000106480.6	123|122	0.00	0	T|C	NM_198465		105184016|105184017	105184016|105184017	+1	no_errors	ENST00000428173	ensembl	human	known	69_37n	missense	54|56	55.28|54.47	68|67	SNP	1.000	A
TENM3	55714	genome.wustl.edu	37	4	183594306	183594306	+	Silent	SNP	C	C	A			TCGA-A2-A04R-01A-41D-A117-09	TCGA-A2-A04R-10B-01D-A10G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f8e4326-dfc7-4635-a9b7-a9207a392748	6234c5ee-14f2-427c-9ebc-4911da27a849	g.chr4:183594306C>A	ENST00000511685.1	+	7	1383	c.1260C>A	c.(1258-1260)atC>atA	p.I420I	TENM3_ENST00000406950.2_Silent_p.I420I			Q9P273	TEN3_HUMAN	teneurin transmembrane protein 3	420					camera-type eye morphogenesis (GO:0048593)|homophilic cell adhesion (GO:0007156)|positive regulation of neuron projection development (GO:0010976)|self proteolysis (GO:0097264)|signal transduction (GO:0007165)	cell projection (GO:0042995)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)	p.I420I(1)									AATTCAATATCTCTCTTCAGA	0.408																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											67.0	63.0	64.0					4																	183594306		1819	4092	5911	-	-	-	SO:0001819	synonymous_variant	0			AF195420	CCDS47165.1	4q35	2012-10-02	2012-10-02	2012-10-02	ENSG00000218336	ENSG00000218336			29944	protein-coding gene	gene with protein product		610083	"""odz, odd Oz/ten-m homolog 3 (Drosophila)"""	ODZ3		10331952, 10625539	Standard	NM_001080477		Approved	Ten-M3, KIAA1455	uc003ivd.1	Q9P273	OTTHUMG00000160682	ENST00000511685.1:c.1260C>A	4.37:g.183594306C>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q5XUL9|Q96SY2|Q9NV77|Q9NVW1|Q9NZJ2	Silent	SNP	pfam_Ten_N,pfam_EGF_extracell,superfamily_CarboxyPept-like_regulatory,superfamily_Cyt_c_dom,smart_EGF-like,pfscan_EG-like_dom,tigrfam_YD,tigrfam_Rhs_assc_core	p.I420	ENST00000511685.1	37	c.1260	CCDS47165.1	4																																																																																			ODZ3	-	NULL	ENSG00000218336		0.408	TENM3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ODZ3	HGNC	protein_coding	OTTHUMT00000361734.1	137	0.00	0	C			183594306	183594306	+1	no_errors	ENST00000406950	ensembl	human	known	69_37n	silent	64	51.52	68	SNP	1.000	A
OR11H4	390442	genome.wustl.edu	37	14	20711110	20711110	+	Missense_Mutation	SNP	G	G	T			TCGA-A2-A04R-01A-41D-A117-09	TCGA-A2-A04R-10B-01D-A10G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f8e4326-dfc7-4635-a9b7-a9207a392748	6234c5ee-14f2-427c-9ebc-4911da27a849	g.chr14:20711110G>T	ENST00000315409.2	+	1	213	c.160G>T	c.(160-162)Gcc>Tcc	p.A54S		NM_001004479.1	NP_001004479.1	Q8NGC9	O11H4_HUMAN	olfactory receptor, family 11, subfamily H, member 4	54						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.A54S(1)		breast(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(3)|lung(11)|ovary(1)|upper_aerodigestive_tract(1)	29	all_cancers(95;0.000888)		Epithelial(56;1.75e-06)|all cancers(55;1.22e-05)	GBM - Glioblastoma multiforme(265;0.0146)		GGGAAATGGAGCCATCATCTA	0.448																																						dbGAP											1	Substitution - Missense(1)	breast(1)											121.0	107.0	112.0					14																	20711110		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS32034.1	14q11.2	2013-09-24			ENSG00000176198	ENSG00000176198		"""GPCR / Class A : Olfactory receptors"""	15347	protein-coding gene	gene with protein product							Standard	NM_001004479		Approved		uc010tld.2	Q8NGC9	OTTHUMG00000170852	ENST00000315409.2:c.160G>T	14.37:g.20711110G>T	ENSP00000318997:p.Ala54Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RNQ4|Q6IF07	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	p.A54S	ENST00000315409.2	37	c.160	CCDS32034.1	14	.	.	.	.	.	.	.	.	.	.	G	5.206	0.223552	0.09863	.	.	ENSG00000176198	ENST00000315409	T	0.01092	5.35	4.62	2.75	0.32379	GPCR, rhodopsin-like superfamily (1);	0.268796	0.26106	N	0.026303	T	0.00906	0.0030	N	0.17872	0.535	0.09310	N	1	B	0.18968	0.032	B	0.20955	0.032	T	0.49360	-0.8948	10	0.17369	T	0.5	-0.945	7.4718	0.27353	0.0911:0.0:0.7442:0.1646	.	54	Q8NGC9	O11H4_HUMAN	S	54	ENSP00000318997:A54S	ENSP00000318997:A54S	A	+	1	0	OR11H4	19780950	0.000000	0.05858	0.868000	0.34077	0.968000	0.65278	-1.336000	0.02660	0.526000	0.28541	0.655000	0.94253	GCC	OR11H4	-	pfam_7TM_GPCR_Rhodpsn,prints_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	ENSG00000176198		0.448	OR11H4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR11H4	HGNC	protein_coding	OTTHUMT00000410678.1	68	0.00	0	G			20711110	20711110	+1	no_errors	ENST00000315409	ensembl	human	known	69_37n	missense	38	52.50	42	SNP	0.002	T
OR10G2	26534	genome.wustl.edu	37	14	22102870	22102870	+	Missense_Mutation	SNP	C	C	G			TCGA-A2-A04R-01A-41D-A117-09	TCGA-A2-A04R-10B-01D-A10G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f8e4326-dfc7-4635-a9b7-a9207a392748	6234c5ee-14f2-427c-9ebc-4911da27a849	g.chr14:22102870C>G	ENST00000542433.1	-	1	226	c.129G>C	c.(127-129)caG>caC	p.Q43H		NM_001005466.1	NP_001005466.1	Q8NGC3	O10G2_HUMAN	olfactory receptor, family 10, subfamily G, member 2	43						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			cervix(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(12)|prostate(1)|skin(2)|stomach(2)	22	all_cancers(95;0.00113)	Acute lymphoblastic leukemia(2;0.0279)		GBM - Glioblastoma multiforme(265;0.0142)		GGTTCCCCAGCTGAGTGAGGA	0.512																																						dbGAP											0													76.0	74.0	75.0					14																	22102870		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS32047.1	14q11.2	2013-09-24			ENSG00000255582	ENSG00000255582		"""GPCR / Class A : Olfactory receptors"""	8170	protein-coding gene	gene with protein product						8188290	Standard	NM_001005466		Approved		uc010tmc.2	Q8NGC3	OTTHUMG00000168890	ENST00000542433.1:c.129G>C	14.37:g.22102870C>G	ENSP00000445383:p.Gln43His	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RPD0	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.Q43H	ENST00000542433.1	37	c.129	CCDS32047.1	14	.	.	.	.	.	.	.	.	.	.	C	14.77	2.634012	0.47049	.	.	ENSG00000255582	ENST00000542433	T	0.00433	7.43	3.79	2.9	0.33743	.	0.000000	0.41194	D	0.000932	T	0.00637	0.0021	L	0.36672	1.1	0.27390	N	0.955179	D	0.76494	0.999	D	0.85130	0.997	T	0.52616	-0.8552	10	0.87932	D	0	-7.735	9.1304	0.36841	0.0:0.8884:0.0:0.1116	.	43	Q8NGC3	O10G2_HUMAN	H	43	ENSP00000445383:Q43H	ENSP00000445383:Q43H	Q	-	3	2	OR10G2	21172710	0.000000	0.05858	1.000000	0.80357	0.930000	0.56654	-1.403000	0.02497	0.791000	0.33826	0.563000	0.77884	CAG	OR10G2	-	prints_7TM_GPCR_Rhodpsn	ENSG00000255582		0.512	OR10G2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR10G2	HGNC	protein_coding	OTTHUMT00000401525.1	42	0.00	0	C			22102870	22102870	-1	no_errors	ENST00000542433	ensembl	human	known	69_37n	missense	29	53.23	33	SNP	0.994	G
OSBPL2	9885	genome.wustl.edu	37	20	60868880	60868880	+	Silent	SNP	C	C	A	rs368486901		TCGA-A2-A04R-01A-41D-A117-09	TCGA-A2-A04R-10B-01D-A10G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f8e4326-dfc7-4635-a9b7-a9207a392748	6234c5ee-14f2-427c-9ebc-4911da27a849	g.chr20:60868880C>A	ENST00000313733.3	+	14	1582	c.1380C>A	c.(1378-1380)ccC>ccA	p.P460P	OSBPL2_ENST00000471817.1_3'UTR|OSBPL2_ENST00000439951.2_Missense_Mutation_p.P327Q|OSBPL2_ENST00000358053.2_Silent_p.P448P	NM_144498.1	NP_653081.1	Q9H1P3	OSBL2_HUMAN	oxysterol binding protein-like 2	460					lipid transport (GO:0006869)		cholesterol binding (GO:0015485)	p.P460P(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(1)|large_intestine(2)|lung(8)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	17	Breast(26;7.76e-09)		BRCA - Breast invasive adenocarcinoma(19;1.33e-06)			CTGGGACCCCCGACTGGTTGT	0.602																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											59.0	55.0	56.0					20																	60868880		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB018315	CCDS13494.1, CCDS13495.1, CCDS63323.1	20q13.3	2008-08-01	2001-11-28		ENSG00000130703	ENSG00000130703		"""Oxysterol binding proteins"""	15761	protein-coding gene	gene with protein product		606731	"""oxysterol-binding protein-like 2"""			10588946, 11861666	Standard	NM_144498		Approved	KIAA0772, ORP-2	uc002yck.1	Q9H1P3	OTTHUMG00000032909	ENST00000313733.3:c.1380C>A	20.37:g.60868880C>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K736|Q6IBT0|Q9BZB1|Q9Y4B8	Missense_Mutation	SNP	pfam_Oxysterol-bd	p.P327Q	ENST00000313733.3	37	c.980	CCDS13495.1	20	.	.	.	.	.	.	.	.	.	.	C	3.479	-0.106286	0.06924	.	.	ENSG00000130703	ENST00000439951	T	0.54675	0.56	4.04	-3.88	0.04205	.	0.319059	0.34700	N	0.003749	T	0.32194	0.0821	.	.	.	0.22851	N	0.99865	B	0.02656	0.0	B	0.04013	0.001	T	0.07616	-1.0763	9	0.49607	T	0.09	-11.2654	6.1037	0.20061	0.1111:0.2837:0.0:0.6052	.	327	E7ET92	.	Q	327	ENSP00000397602:P327Q	ENSP00000397602:P327Q	P	+	2	0	OSBPL2	60302275	0.076000	0.21285	0.809000	0.32408	0.123000	0.20343	-0.400000	0.07241	-0.897000	0.03910	-1.036000	0.02392	CCG	OSBPL2	-	NULL	ENSG00000130703		0.602	OSBPL2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	OSBPL2	HGNC	protein_coding	OTTHUMT00000080021.1	82	0.00	0	C	NM_014835		60868880	60868880	+1	no_errors	ENST00000439951	ensembl	human	known	69_37n	missense	87	23.68	27	SNP	0.709	A
PEX26	55670	genome.wustl.edu	37	22	18562697	18562697	+	Missense_Mutation	SNP	G	G	A			TCGA-A2-A04R-01A-41D-A117-09	TCGA-A2-A04R-10B-01D-A10G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f8e4326-dfc7-4635-a9b7-a9207a392748	6234c5ee-14f2-427c-9ebc-4911da27a849	g.chr22:18562697G>A	ENST00000329627.7	+	3	494	c.288G>A	c.(286-288)atG>atA	p.M96I	XXbac-B476C20.9_ENST00000607927.1_RNA|PEX26_ENST00000428061.2_Missense_Mutation_p.M96I|XXbac-B476C20.9_ENST00000426483.1_RNA|PEX26_ENST00000399744.3_Missense_Mutation_p.M96I	NM_017929.5	NP_060399.1	Q7Z412	PEX26_HUMAN	peroxisomal biogenesis factor 26	96					protein import into peroxisome matrix (GO:0016558)|protein import into peroxisome membrane (GO:0045046)	integral component of peroxisomal membrane (GO:0005779)|peroxisome (GO:0005777)	ATPase binding (GO:0051117)|protein C-terminus binding (GO:0008022)|protein complex binding (GO:0032403)	p.M96I(1)		breast(1)|kidney(2)|large_intestine(3)|lung(4)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	13						TGGCAGAAATGGATCGGTGGC	0.522																																						dbGAP											1	Substitution - Missense(1)	breast(1)											162.0	142.0	149.0					22																	18562697		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB089678	CCDS13750.1, CCDS56221.1	22q11.21	2008-08-26	2008-08-26		ENSG00000215193	ENSG00000215193			22965	protein-coding gene	gene with protein product		608666	"""peroxisome biogenesis factor 26"""			12717447, 12851857	Standard	NM_017929		Approved	FLJ20695	uc002znp.4	Q7Z412	OTTHUMG00000149970	ENST00000329627.7:c.288G>A	22.37:g.18562697G>A	ENSP00000331106:p.Met96Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	F6UBB5|Q7Z413|Q7Z414|Q7Z415|Q7Z416|Q96B12|Q9NWQ0|Q9NXU0	Missense_Mutation	SNP	pfam_Pex26	p.M96I	ENST00000329627.7	37	c.288	CCDS13750.1	22	.	.	.	.	.	.	.	.	.	.	G	26.3	4.719785	0.89205	.	.	ENSG00000215193	ENST00000329627;ENST00000399744;ENST00000428061;ENST00000399746	D;D;D	0.93763	-3.28;-3.28;-3.28	5.46	5.46	0.80206	.	0.172651	0.37809	U	0.001936	D	0.96383	0.8820	M	0.75447	2.3	0.40352	D	0.979147	D;D	0.76494	0.975;0.999	P;D	0.81914	0.731;0.995	D	0.96687	0.9508	10	0.62326	D	0.03	-20.9839	16.8283	0.85937	0.0:0.0:1.0:0.0	.	96;96	F6UBB5;Q7Z412	.;PEX26_HUMAN	I	96	ENSP00000331106:M96I;ENSP00000382648:M96I;ENSP00000412441:M96I	ENSP00000331106:M96I	M	+	3	0	PEX26	16942697	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	2.110000	0.41873	2.724000	0.93272	0.491000	0.48974	ATG	PEX26	-	pfam_Pex26	ENSG00000215193		0.522	PEX26-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PEX26	HGNC	protein_coding	OTTHUMT00000314644.3	155	0.00	0	G	NM_017929		18562697	18562697	+1	no_errors	ENST00000329627	ensembl	human	known	69_37n	missense	85	43.71	66	SNP	1.000	A
PLAT	5327	genome.wustl.edu	37	8	42033530	42033530	+	Missense_Mutation	SNP	C	C	G	rs62001884		TCGA-A2-A04R-01A-41D-A117-09	TCGA-A2-A04R-10B-01D-A10G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f8e4326-dfc7-4635-a9b7-a9207a392748	6234c5ee-14f2-427c-9ebc-4911da27a849	g.chr8:42033530C>G	ENST00000220809.4	-	14	1926	c.1670G>C	c.(1669-1671)cGt>cCt	p.R557P	PLAT_ENST00000524009.1_Missense_Mutation_p.R468P|PLAT_ENST00000352041.3_Missense_Mutation_p.R511P|PLAT_ENST00000429089.2_Missense_Mutation_p.R557P|PLAT_ENST00000429710.2_Missense_Mutation_p.R431P|PLAT_ENST00000270189.6_3'UTR|PLAT_ENST00000519510.1_Missense_Mutation_p.R494P	NM_000930.3	NP_000921.1	P00750	TPA_HUMAN	plasminogen activator, tissue	557	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				blood coagulation (GO:0007596)|cellular protein modification process (GO:0006464)|fibrinolysis (GO:0042730)|negative regulation of proteolysis (GO:0045861)|plasminogen activation (GO:0031639)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive regulation of ovulation (GO:0060279)|proteolysis (GO:0006508)|regulation of synaptic plasticity (GO:0048167)|response to cAMP (GO:0051591)|response to glucocorticoid (GO:0051384)|response to hypoxia (GO:0001666)|response to peptide hormone (GO:0043434)|smooth muscle cell migration (GO:0014909)|synaptic transmission, glutamatergic (GO:0035249)	apical part of cell (GO:0045177)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|secretory granule (GO:0030141)|synapse (GO:0045202)	serine-type endopeptidase activity (GO:0004252)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(10)|skin(1)|soft_tissue(1)|urinary_tract(1)	27	all_cancers(6;3.84e-26)|all_epithelial(6;9.61e-28)|all_lung(13;7.2e-13)|Lung NSC(13;1.18e-11)|Ovarian(28;0.00438)|Prostate(17;0.0119)|Colorectal(14;0.0468)|Lung SC(25;0.211)	all_lung(54;0.000378)|Lung NSC(58;0.00145)|Hepatocellular(245;0.0524)|Renal(179;0.0822)|Esophageal squamous(32;0.0954)	BRCA - Breast invasive adenocarcinoma(8;5.23e-10)|OV - Ovarian serous cystadenocarcinoma(14;0.00135)|Colorectal(10;0.00165)|Lung(22;0.00467)|COAD - Colon adenocarcinoma(11;0.0171)|LUSC - Lung squamous cell carcinoma(45;0.024)		Aminocaproic Acid(DB00513)|Ibuprofen(DB01050)|Iloprost(DB01088)|Urokinase(DB00013)	CATGTTGTCACGAATCCAGTC	0.542																																						dbGAP											0													170.0	138.0	149.0					8																	42033530		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS6126.1, CCDS6127.1	8p11.21	2012-10-02			ENSG00000104368	ENSG00000104368			9051	protein-coding gene	gene with protein product		173370					Standard	NM_033011		Approved		uc003xos.2	P00750	OTTHUMG00000164072	ENST00000220809.4:c.1670G>C	8.37:g.42033530C>G	ENSP00000220809:p.Arg557Pro	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K022|B2R8E8|Q15103|Q503B0|Q6PJA5|Q7Z7N2|Q86YK8|Q9BU99|Q9BZW1	Missense_Mutation	SNP	pfam_Peptidase_S1_S6,pfam_Kringle,pfam_Fibronectin_type1,pfam_EGF-like_dom,superfamily_Pept_cys/ser_Trypsin-like,superfamily_Kringle-like,smart_Fibronectin_type1,smart_Kringle,smart_Peptidase_S1_S6,pfscan_EG-like_dom,pfscan_Fibronectin_type1,pfscan_Kringle,pfscan_Peptidase_S1_S6,prints_Peptidase_S1A	p.R557P	ENST00000220809.4	37	c.1670	CCDS6126.1	8	.	.	.	.	.	.	.	.	.	.	c	7.202	0.593756	0.13875	.	.	ENSG00000104368	ENST00000429089;ENST00000220809;ENST00000352041;ENST00000519510;ENST00000429710;ENST00000524009	D;D;D;D;D;D	0.89196	-2.3;-2.3;-2.48;-2.32;-2.33;-2.33	5.94	-0.687	0.11320	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (1);	0.966561	0.08691	N	0.907994	D	0.89326	0.6683	M	0.77103	2.36	0.09310	N	0.999997	B;B;B;B;P;B	0.35821	0.194;0.194;0.034;0.389;0.523;0.062	B;B;B;B;B;B	0.40199	0.069;0.069;0.053;0.254;0.322;0.069	T	0.80248	-0.1461	10	0.62326	D	0.03	.	10.8627	0.46835	0.0:0.4459:0.0:0.5541	.	431;468;494;557;511;557	B4DNJ1;B4DN26;B4DV92;B8ZX62;P00750-3;P00750	.;.;.;.;.;TPA_HUMAN	P	557;557;511;494;431;468	ENSP00000392045:R557P;ENSP00000220809:R557P;ENSP00000270188:R511P;ENSP00000428886:R494P;ENSP00000407861:R431P;ENSP00000429401:R468P	ENSP00000220809:R557P	R	-	2	0	PLAT	42152687	0.954000	0.32549	0.037000	0.18230	0.001000	0.01503	0.324000	0.19610	-0.339000	0.08401	-1.301000	0.01330	CGT	PLAT	-	superfamily_Pept_cys/ser_Trypsin-like,pfscan_Peptidase_S1_S6	ENSG00000104368		0.542	PLAT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLAT	HGNC	protein_coding	OTTHUMT00000377100.1	132	0.00	0	C	NM_000930		42033530	42033530	-1	no_errors	ENST00000220809	ensembl	human	known	69_37n	missense	81	41.43	58	SNP	0.001	G
POLH	5429	genome.wustl.edu	37	6	43578461	43578461	+	Splice_Site	SNP	G	G	T			TCGA-A2-A04R-01A-41D-A117-09	TCGA-A2-A04R-10B-01D-A10G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f8e4326-dfc7-4635-a9b7-a9207a392748	6234c5ee-14f2-427c-9ebc-4911da27a849	g.chr6:43578461G>T	ENST00000372236.4	+	10	1539		c.e10+1		POLH_ENST00000372226.1_Splice_Site|POLH_ENST00000535400.1_Splice_Site	NM_006502.2	NP_006493.1	O75417	DPOLQ_HUMAN	polymerase (DNA directed), eta						ATP catabolic process (GO:0006200)|DNA repair (GO:0006281)	nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|damaged DNA binding (GO:0003684)|DNA-directed DNA polymerase activity (GO:0003887)|single-stranded DNA-dependent ATPase activity (GO:0043142)	p.?(1)		breast(4)|endometrium(5)|kidney(1)|large_intestine(6)|lung(2)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	21	all_cancers(18;1.89e-05)|Lung NSC(15;0.00161)|all_lung(25;0.004)		all cancers(41;0.000753)|Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|STAD - Stomach adenocarcinoma(11;0.0826)|OV - Ovarian serous cystadenocarcinoma(102;0.167)			AGACAGAATGGTGAGTTCTTT	0.403								DNA polymerases (catalytic subunits)	Xeroderma Pigmentosum																													dbGAP											1	Unknown(1)	breast(1)											55.0	42.0	46.0					6																	43578461		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0	Familial Cancer Database	incl. XPA, XPB, XPC, XPD, XPE, XPF, XPG, XP Variant, XPV	AB024313	CCDS4902.1	6p21	2014-09-17			ENSG00000170734	ENSG00000170734			9181	protein-coding gene	gene with protein product		603968				10385124, 10398605	Standard	NM_006502		Approved	RAD30A, XP-V	uc003ovq.4	Q9Y253	OTTHUMG00000014743	ENST00000372236.4:c.1244+1G>T	6.37:g.43578461G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	O95160|Q6VMB5	Splice_Site	SNP	-	e9+1	ENST00000372236.4	37	c.1244+1	CCDS4902.1	6	.	.	.	.	.	.	.	.	.	.	G	26.4	4.730491	0.89390	.	.	ENSG00000170734	ENST00000372236;ENST00000535400	.	.	.	5.92	5.92	0.95590	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.5012	0.90882	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	POLH	43686439	1.000000	0.71417	1.000000	0.80357	0.973000	0.67179	8.961000	0.93122	2.813000	0.96785	0.561000	0.74099	.	POLH	-	-	ENSG00000170734		0.403	POLH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	POLH	HGNC	protein_coding	OTTHUMT00000040666.1	32	0.00	0	G	NM_006502	Intron	43578461	43578461	+1	no_errors	ENST00000372236	ensembl	human	known	69_37n	splice_site	25	30.56	11	SNP	1.000	T
POLR2B	5431	genome.wustl.edu	37	4	57888327	57888327	+	Silent	SNP	C	C	T			TCGA-A2-A04R-01A-41D-A117-09	TCGA-A2-A04R-10B-01D-A10G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f8e4326-dfc7-4635-a9b7-a9207a392748	6234c5ee-14f2-427c-9ebc-4911da27a849	g.chr4:57888327C>T	ENST00000381227.1	+	19	2843	c.2430C>T	c.(2428-2430)ttC>ttT	p.F810F	POLR2B_ENST00000441246.2_Silent_p.F803F|POLR2B_ENST00000431623.2_Silent_p.F735F|POLR2B_ENST00000314595.5_Silent_p.F810F			P30876	RPB2_HUMAN	polymerase (RNA) II (DNA directed) polypeptide B, 140kDa	810					7-methylguanosine mRNA capping (GO:0006370)|DNA repair (GO:0006281)|gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|nucleotide-excision repair (GO:0006289)|positive regulation of viral transcription (GO:0050434)|RNA splicing (GO:0008380)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription-coupled nucleotide-excision repair (GO:0006283)|viral process (GO:0016032)	DNA-directed RNA polymerase II, core complex (GO:0005665)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|DNA-directed RNA polymerase activity (GO:0003899)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|ribonucleoside binding (GO:0032549)	p.F810F(1)		breast(1)|central_nervous_system(2)|endometrium(6)|kidney(10)|large_intestine(9)|lung(17)|ovary(2)|prostate(4)|skin(1)	52	Glioma(25;0.08)|all_neural(26;0.181)					GGTCTGTTTTCTATCGCTCAT	0.348																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											86.0	83.0	84.0					4																	57888327		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS3511.1	4q12	2013-01-21	2002-08-29		ENSG00000047315	ENSG00000047315		"""RNA polymerase subunits"""	9188	protein-coding gene	gene with protein product		180661	"""polymerase (RNA) II (DNA directed) polypeptide B (140kD)"""			1518060, 8034326	Standard	NM_000938		Approved	RPB2	uc003hcl.1	P30876	OTTHUMG00000128771	ENST00000381227.1:c.2430C>T	4.37:g.57888327C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K1A8|Q8IZ61	Silent	SNP	pfam_DNA-dir_RNA_pol_su2_6,pfam_RNA_pol_bsu_protrusion,pfam_RNA_pol_Rpb2_2,pfam_RNA_pol_Rpb2_7,pfam_RNA_pol_Rpb2_4,pfam_RNA_pol_Rpb2_3,pfam_RNA_pol_Rpb2_5	p.F810	ENST00000381227.1	37	c.2430	CCDS3511.1	4																																																																																			POLR2B	-	pfam_DNA-dir_RNA_pol_su2_6	ENSG00000047315		0.348	POLR2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	POLR2B	HGNC	protein_coding	OTTHUMT00000250692.1	194	0.00	0	C	NM_000938		57888327	57888327	+1	no_errors	ENST00000314595	ensembl	human	known	69_37n	silent	117	41.50	83	SNP	1.000	T
PTCHD1	139411	genome.wustl.edu	37	X	23411288	23411288	+	Missense_Mutation	SNP	C	C	A			TCGA-A2-A04R-01A-41D-A117-09	TCGA-A2-A04R-10B-01D-A10G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f8e4326-dfc7-4635-a9b7-a9207a392748	6234c5ee-14f2-427c-9ebc-4911da27a849	g.chrX:23411288C>A	ENST00000379361.4	+	3	2513	c.1653C>A	c.(1651-1653)aaC>aaA	p.N551K		NM_173495.2	NP_775766.2	Q96NR3	PTHD1_HUMAN	patched domain containing 1	551					cognition (GO:0050890)|smoothened signaling pathway (GO:0007224)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	hedgehog receptor activity (GO:0008158)	p.N446K(1)|p.N551K(1)		NS(1)|breast(4)|endometrium(3)|kidney(3)|large_intestine(9)|lung(14)|ovary(4)|skin(2)|urinary_tract(2)	42						ACTTCAGCAACTACAGTCCTG	0.438																																						dbGAP											2	Substitution - Missense(2)	breast(2)											105.0	94.0	98.0					X																	23411288		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK054858	CCDS35215.2	Xp22.13	2008-02-05			ENSG00000165186	ENSG00000165186			26392	protein-coding gene	gene with protein product		300828					Standard	NM_173495		Approved	FLJ30296	uc004dal.4	Q96NR3	OTTHUMG00000021251	ENST00000379361.4:c.1653C>A	X.37:g.23411288C>A	ENSP00000368666:p.Asn551Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DQH0|Q0IJ60|Q6P6B8	Missense_Mutation	SNP	pfam_Patched,pfscan_SSD	p.N551K	ENST00000379361.4	37	c.1653	CCDS35215.2	X	.	.	.	.	.	.	.	.	.	.	C	9.144	1.014511	0.19277	.	.	ENSG00000165186	ENST00000379361	D	0.85088	-1.94	5.69	2.99	0.34606	.	0.161536	0.53938	D	0.000046	T	0.73401	0.3582	L	0.32530	0.975	0.34320	D	0.686492	B	0.11235	0.004	B	0.20384	0.029	T	0.63070	-0.6719	10	0.07030	T	0.85	.	9.2254	0.37402	0.0:0.7022:0.0:0.2978	.	551	Q96NR3	PTHD1_HUMAN	K	551	ENSP00000368666:N551K	ENSP00000368666:N551K	N	+	3	2	PTCHD1	23321209	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	1.409000	0.34680	0.202000	0.20498	-0.191000	0.12829	AAC	PTCHD1	-	pfam_Patched	ENSG00000165186		0.438	PTCHD1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	PTCHD1	HGNC	protein_coding	OTTHUMT00000056047.2	82	0.00	0	C	NM_173495		23411288	23411288	+1	no_errors	ENST00000379361	ensembl	human	known	69_37n	missense	42	40.85	29	SNP	1.000	A
TBC1D1	23216	genome.wustl.edu	37	4	37962151	37962151	+	Intron	SNP	C	C	T			TCGA-A2-A04R-01A-41D-A117-09	TCGA-A2-A04R-10B-01D-A10G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f8e4326-dfc7-4635-a9b7-a9207a392748	6234c5ee-14f2-427c-9ebc-4911da27a849	g.chr4:37962151C>T	ENST00000261439.4	+	3	772				TBC1D1_ENST00000508802.1_Intron|PTTG2_ENST00000504686.1_Silent_p.I32I	NM_001253914.1|NM_001253915.1|NM_015173.3	NP_001240843.1|NP_001240844.1|NP_055988.2	Q86TI0	TBCD1_HUMAN	TBC1 (tre-2/USP6, BUB2, cdc16) domain family, member 1						membrane organization (GO:0061024)|regulation of protein localization (GO:0032880)	cytosol (GO:0005829)|nucleus (GO:0005634)	Rab GTPase activator activity (GO:0005097)	p.I32I(1)		NS(1)|breast(3)|kidney(1)|large_intestine(5)|lung(19)|ovary(2)|prostate(2)|skin(2)|urinary_tract(1)	36						GACCTTCAATCAAAGCATTAG	0.463																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											67.0	72.0	70.0					4																	37962151		2202	4300	6502	-	-	-	SO:0001627	intron_variant	0			AB029031	CCDS33972.1, CCDS58897.1	4p14	2013-07-09			ENSG00000065882	ENSG00000065882			11578	protein-coding gene	gene with protein product		609850				10965142, 18258599	Standard	NM_015173		Approved	TBC, TBC1, KIAA1108	uc003gtb.3	Q86TI0	OTTHUMG00000150302	ENST00000261439.4:c.418-53979C>T	4.37:g.37962151C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B7Z3D9|E9PGH8|Q96K82|Q9UPP4	Silent	SNP	pfam_Securin_separation_inhibitor	p.I32	ENST00000261439.4	37	c.96	CCDS33972.1	4																																																																																			PTTG2	-	pfam_Securin_separation_inhibitor	ENSG00000250254		0.463	TBC1D1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PTTG2	HGNC	protein_coding	OTTHUMT00000317443.2	76	0.00	0	C	NM_015173		37962151	37962151	+1	no_errors	ENST00000504686	ensembl	human	known	69_37n	silent	10	82.76	48	SNP	0.000	T
RAPGEF6	51735	genome.wustl.edu	37	5	130785738	130785738	+	Intron	SNP	T	T	G			TCGA-A2-A04R-01A-41D-A117-09	TCGA-A2-A04R-10B-01D-A10G-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f8e4326-dfc7-4635-a9b7-a9207a392748	6234c5ee-14f2-427c-9ebc-4911da27a849	g.chr5:130785738T>G	ENST00000509018.1	-	21	3406				CTC-432M15.3_ENST00000514667.1_Intron|RAPGEF6_ENST00000296859.6_Splice_Site_p.K1068Q|RAPGEF6_ENST00000507093.1_Splice_Site_p.K1068Q|RAPGEF6_ENST00000308008.6_Intron|RAPGEF6_ENST00000307984.5_Splice_Site_p.K1073Q|RAPGEF6_ENST00000512052.1_Splice_Site_p.K783Q	NM_001164386.1|NM_016340.5	NP_001157858.1|NP_057424.3	Q8TEU7	RPGF6_HUMAN	Rap guanine nucleotide exchange factor (GEF) 6						positive regulation of GTPase activity (GO:0043547)|Ras protein signal transduction (GO:0007265)|regulation of GTPase activity (GO:0043087)|regulation of small GTPase mediated signal transduction (GO:0051056)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	GTP-dependent protein binding (GO:0030742)|guanyl-nucleotide exchange factor activity (GO:0005085)|Ras GTPase binding (GO:0017016)	p.K1073Q(1)		breast(2)|central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(7)|lung(10)|ovary(3)|skin(1)|stomach(1)	31			KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)	Lung(113;0.0721)		CACCTCTTCTTCCTGTAAGCA	0.413																																					Melanoma(168;435 1955 13113 13877 23213)	dbGAP											1	Substitution - Missense(1)	breast(1)											115.0	99.0	104.0					5																	130785738		692	1591	2283	-	-	-	SO:0001627	intron_variant	0			AF117947	CCDS34225.1, CCDS54897.1, CCDS54898.1, CCDS54899.1, CCDS54900.1	5q31.1	2008-02-05	2004-03-01	2004-03-02	ENSG00000158987	ENSG00000158987			20655	protein-coding gene	gene with protein product		610499	"""PDZ domain containing guanine nucleotide exchange factor (GEF) 2"""	PDZGEF2		11524421, 12095257	Standard	NM_016340		Approved	RA-GEF-2, PDZ-GEF2	uc010jdi.2	Q8TEU7	OTTHUMG00000162683	ENST00000509018.1:c.3200+3008A>C	5.37:g.130785738T>G		Somatic		WXS	Illumina GAIIx	Phase_IV	A3KN82|A5PLL6|B7ZML2|E9PDV7|Q8NI21|Q8TEU6|Q96PC1	Missense_Mutation	SNP	pfam_RasGRF_CDC25,pfam_PDZ,pfam_Ras-assoc,pfam_cNMP-bd_dom,pfam_Ras-like_Gua-exchang_fac_N,superfamily_Ras_GEF_dom,superfamily_PDZ,superfamily_cNMP-bd-like,smart_cNMP-bd_dom,smart_Ras-like_Gua-exchang_fac_N,smart_PDZ,smart_Ras-assoc,smart_RasGRF_CDC25,pfscan_cNMP-bd_dom,pfscan_PDZ,pfscan_Ras-assoc,pfscan_RasGRF_CDC25,pfscan_Ras-like_Gua-exchang_fac_N	p.K1073Q	ENST00000509018.1	37	c.3217	CCDS34225.1	5	.	.	.	.	.	.	.	.	.	.	T	20.7	4.033690	0.75504	.	.	ENSG00000158987	ENST00000307984;ENST00000507093;ENST00000296859;ENST00000358714;ENST00000512052	T;T;T;T	0.25912	1.85;1.85;1.93;1.77	5.56	5.56	0.83823	.	.	.	.	.	T	0.43678	0.1258	M	0.63843	1.955	0.80722	D	1	P;B;P;D	0.54207	0.941;0.129;0.82;0.965	P;B;P;P	0.62885	0.811;0.046;0.552;0.908	T	0.22417	-1.0217	9	0.11794	T	0.64	.	16.021	0.80493	0.0:0.0:0.0:1.0	.	1068;1068;783;1073	A3KN82;B7ZML2;D6RE77;Q8TEU7-3	.;.;.;.	Q	1073;1068;1068;1073;783	ENSP00000309298:K1073Q;ENSP00000426081:K1068Q;ENSP00000296859:K1068Q;ENSP00000426910:K783Q	ENSP00000296859:K1068Q	K	-	1	0	RAPGEF6	130813637	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.993000	0.88291	2.240000	0.73641	0.533000	0.62120	AAG	RAPGEF6	-	superfamily_Ras_GEF_dom,smart_RasGRF_CDC25,pfscan_RasGRF_CDC25	ENSG00000158987		0.413	RAPGEF6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RAPGEF6	HGNC	protein_coding	OTTHUMT00000370059.1	109	0.00	0	T	NM_016340		130785738	130785738	-1	no_errors	ENST00000307984	ensembl	human	known	69_37n	missense	52	43.48	40	SNP	1.000	G
RTTN	25914	genome.wustl.edu	37	18	67721498	67721498	+	Missense_Mutation	SNP	A	A	G			TCGA-A2-A04R-01A-41D-A117-09	TCGA-A2-A04R-10B-01D-A10G-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f8e4326-dfc7-4635-a9b7-a9207a392748	6234c5ee-14f2-427c-9ebc-4911da27a849	g.chr18:67721498A>G	ENST00000255674.6	-	38	5340	c.5054T>C	c.(5053-5055)cTa>cCa	p.L1685P	RTTN_ENST00000454359.1_3'UTR	NM_173630.3	NP_775901.3	Q86VV8	RTTN_HUMAN	rotatin	1685					determination of left/right symmetry (GO:0007368)	ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)		p.L1685P(1)		NS(1)|breast(3)|central_nervous_system(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(9)|lung(35)|ovary(4)|pancreas(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	80		Esophageal squamous(42;0.129)				CAAAGAGGATAGGTATTCCAG	0.413																																						dbGAP											1	Substitution - Missense(1)	breast(1)											53.0	50.0	51.0					18																	67721498		1859	4105	5964	-	-	-	SO:0001583	missense	0			AL117635	CCDS42443.1	18q22.1	2008-08-01				ENSG00000176225			18654	protein-coding gene	gene with protein product		610436				11900971	Standard	NM_173630		Approved	DKFZP434G145	uc002lkp.2	Q86VV8		ENST00000255674.6:c.5054T>C	18.37:g.67721498A>G	ENSP00000255674:p.Leu1685Pro	Somatic		WXS	Illumina GAIIx	Phase_IV	Q68CS9|Q6ZRL8|Q6ZTK3|Q86TG4|Q8N8N8|Q8TBQ4|Q96IN9|Q9UFJ4	Missense_Mutation	SNP	superfamily_ARM-type_fold	p.L1685P	ENST00000255674.6	37	c.5054	CCDS42443.1	18	.	.	.	.	.	.	.	.	.	.	A	19.51	3.840970	0.71488	.	.	ENSG00000176225	ENST00000255674	T	0.58210	0.35	5.32	5.32	0.75619	Armadillo-like helical (1);	0.077437	0.52532	D	0.000066	T	0.69070	0.3070	M	0.66939	2.045	0.80722	D	1	D	0.89917	1.0	D	0.72075	0.976	T	0.71919	-0.4447	10	0.62326	D	0.03	.	13.0891	0.59158	1.0:0.0:0.0:0.0	.	1685	Q86VV8	RTTN_HUMAN	P	1685	ENSP00000255674:L1685P	ENSP00000255674:L1685P	L	-	2	0	RTTN	65872478	0.997000	0.39634	1.000000	0.80357	0.958000	0.62258	3.866000	0.56040	2.132000	0.65825	0.482000	0.46254	CTA	RTTN	-	NULL	ENSG00000176225		0.413	RTTN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RTTN	HGNC	protein_coding	OTTHUMT00000442988.1	79	0.00	0	A	NM_173630		67721498	67721498	-1	no_errors	ENST00000255674	ensembl	human	known	69_37n	missense	51	39.29	33	SNP	0.997	G
SCN11A	11280	genome.wustl.edu	37	3	38991797	38991797	+	Missense_Mutation	SNP	G	G	T			TCGA-A2-A04R-01A-41D-A117-09	TCGA-A2-A04R-10B-01D-A10G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f8e4326-dfc7-4635-a9b7-a9207a392748	6234c5ee-14f2-427c-9ebc-4911da27a849	g.chr3:38991797G>T	ENST00000302328.3	-	1	255	c.57C>A	c.(55-57)ttC>ttA	p.F19L	SCN11A_ENST00000450244.1_Missense_Mutation_p.F19L|SCN11A_ENST00000456224.3_Missense_Mutation_p.F19L|SCN11A_ENST00000444237.2_Missense_Mutation_p.F19L	NM_014139.2	NP_054858.2	Q9UI33	SCNBA_HUMAN	sodium channel, voltage-gated, type XI, alpha subunit	19					cell death (GO:0008219)|membrane depolarization during action potential (GO:0086010)|neuronal action potential (GO:0019228)|regulation of sensory perception of pain (GO:0051930)|response to drug (GO:0042493)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	C-fiber (GO:0044299)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)	p.F19L(1)|p.F19F(1)		NS(3)|biliary_tract(1)|breast(4)|cervix(2)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(29)|lung(29)|ovary(3)|pancreas(2)|prostate(12)|skin(14)|upper_aerodigestive_tract(5)|urinary_tract(3)	119				Kidney(284;0.00202)|KIRC - Kidney renal clear cell carcinoma(284;0.00226)	Cocaine(DB00907)|Valproic Acid(DB00313)|Zonisamide(DB00909)	AGTCGGAAGTGAAGGGGCGGA	0.512																																						dbGAP											2	Substitution - Missense(1)|Substitution - coding silent(1)	upper_aerodigestive_tract(1)|breast(1)											101.0	93.0	96.0					3																	38991797		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF126739	CCDS33737.1	3p22.2	2012-02-26	2007-01-23		ENSG00000168356	ENSG00000168356		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10583	protein-coding gene	gene with protein product		604385	"""sodium channel, voltage-gated, type XI, alpha polypeptide"", ""sodium channel, voltage-gated, type XII, alpha"""	SCN12A		10444332, 16382098	Standard	NM_014139		Approved	Nav1.9, NaN, SNS-2	uc021wvy.1	Q9UI33	OTTHUMG00000048246	ENST00000302328.3:c.57C>A	3.37:g.38991797G>T	ENSP00000307599:p.Phe19Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NN05|C9JD48|C9JR31|Q68K15|Q8NDX3|Q9UHE0|Q9UHM0	Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_Na_trans_assoc,prints_Na_channel_asu	p.F19L	ENST00000302328.3	37	c.57	CCDS33737.1	3	.	.	.	.	.	.	.	.	.	.	G	22.5	4.297930	0.81025	.	.	ENSG00000168356	ENST00000302328;ENST00000450244;ENST00000456224;ENST00000444237	D;D;D;D	0.98164	-4.76;-4.76;-4.67;-4.59	5.08	3.28	0.37604	.	0.000000	0.85682	D	0.000000	D	0.96589	0.8887	M	0.79693	2.465	0.38084	D	0.936776	P	0.42409	0.779	B	0.34489	0.184	D	0.95999	0.8992	10	0.66056	D	0.02	.	10.1479	0.42776	0.1689:0.0:0.8311:0.0	.	19	Q9UI33	SCNBA_HUMAN	L	19	ENSP00000307599:F19L;ENSP00000400945:F19L;ENSP00000416757:F19L;ENSP00000408028:F19L	ENSP00000307599:F19L	F	-	3	2	SCN11A	38966801	1.000000	0.71417	1.000000	0.80357	0.968000	0.65278	3.836000	0.55813	1.151000	0.42436	-0.126000	0.14955	TTC	SCN11A	-	NULL	ENSG00000168356		0.512	SCN11A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SCN11A	HGNC	protein_coding	OTTHUMT00000109746.4	52	0.00	0	G	NM_014139		38991797	38991797	-1	no_errors	ENST00000302328	ensembl	human	known	69_37n	missense	31	43.64	24	SNP	1.000	T
SIGLEC12	89858	genome.wustl.edu	37	19	52004714	52004714	+	Silent	SNP	G	G	T	rs145312255		TCGA-A2-A04R-01A-41D-A117-09	TCGA-A2-A04R-10B-01D-A10G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f8e4326-dfc7-4635-a9b7-a9207a392748	6234c5ee-14f2-427c-9ebc-4911da27a849	g.chr19:52004714G>T	ENST00000291707.3	-	1	329	c.274C>A	c.(274-276)Cga>Aga	p.R92R	SIGLEC12_ENST00000598614.1_5'Flank	NM_053003.2	NP_443729.1	Q96PQ1	SIG12_HUMAN	sialic acid binding Ig-like lectin 12 (gene/pseudogene)	92	Ig-like V-type 1.				cell adhesion (GO:0007155)	integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)	p.R92R(1)		NS(2)|biliary_tract(1)|breast(1)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(8)|liver(1)|lung(23)|ovary(4)|prostate(2)|skin(8)|stomach(3)|upper_aerodigestive_tract(2)	61		all_neural(266;0.0199)		GBM - Glioblastoma multiforme(134;0.00161)|OV - Ovarian serous cystadenocarcinoma(262;0.0102)		AGGTGGAATCGGTCCCGAGTC	0.552																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											162.0	141.0	148.0					19																	52004714		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF282256	CCDS12833.1, CCDS59416.1	19q13.41	2013-01-29	2011-06-29	2004-10-20	ENSG00000254521	ENSG00000254521		"""Sialic acid binding Ig-like lectins"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	15482	protein-coding gene	gene with protein product		606094	"""SIGLEC-like 1"", ""sialic acid binding Ig-like lectin 12"""	SIGLECL1		11409877, 11328818, 21555517	Standard	NM_053003		Approved	SLG, S2V, Siglec-XII, Siglec-12, Siglec-L1	uc002pwx.1	Q96PQ1	OTTHUMG00000165524	ENST00000291707.3:c.274C>A	19.37:g.52004714G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q8IYH7	Silent	SNP	pfam_Ig_V-set,pfam_Ig_I-set,pfam_CD80_C2-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	p.R92	ENST00000291707.3	37	c.274	CCDS12833.1	19																																																																																			SIGLEC12	-	pfam_Ig_V-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	ENSG00000254521		0.552	SIGLEC12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SIGLEC12	HGNC	protein_coding	OTTHUMT00000384641.2	100	0.00	0	G	NM_053003		52004714	52004714	-1	no_errors	ENST00000291707	ensembl	human	known	69_37n	silent	42	48.78	40	SNP	0.039	T
SIGLEC5	8778	genome.wustl.edu	37	19	52133292	52133292	+	Missense_Mutation	SNP	A	A	G	rs1973019	byFrequency	TCGA-A2-A04R-01A-41D-A117-09	TCGA-A2-A04R-10B-01D-A10G-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f8e4326-dfc7-4635-a9b7-a9207a392748	6234c5ee-14f2-427c-9ebc-4911da27a849	g.chr19:52133292A>G	ENST00000534261.2	-	3	614	c.215T>C	c.(214-216)gTt>gCt	p.V72A	SIGLEC5_ENST00000222107.4_Intron|SIGLEC5_ENST00000599649.1_Intron|SIGLEC5_ENST00000429354.3_Missense_Mutation_p.V72A|SIGLEC5_ENST00000570106.2_Missense_Mutation_p.V72A			O15389	SIGL5_HUMAN	sialic acid binding Ig-like lectin 5	72	Ig-like V-type.		V -> A (in dbSNP:rs1973019).		cell adhesion (GO:0007155)	integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(3)|large_intestine(4)|lung(9)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)	27		all_neural(266;0.0726)		GBM - Glioblastoma multiforme(134;0.00124)|OV - Ovarian serous cystadenocarcinoma(262;0.0218)		TGTGGCCACAACCTCAGCGTA	0.577													G|||	482	0.096246	0.0121	0.1974	5008	,	,		15121	0.002		0.1988	False		,,,				2504	0.1299					dbGAP											0													6.0	6.0	6.0					19																	52133292		1790	3344	5134	-	-	-	SO:0001583	missense	0			U71383	CCDS33088.1	19q13.41	2013-01-29			ENSG00000105501	ENSG00000105501		"""Sialic acid binding Ig-like lectins"", ""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	10874	protein-coding gene	gene with protein product		604200		CD33L2		10343116	Standard	NM_003830		Approved	OB-BP2, SIGLEC-5, CD170	uc002pxe.4	O15389	OTTHUMG00000165510	ENST00000534261.2:c.215T>C	19.37:g.52133292A>G	ENSP00000473238:p.Val72Ala	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Ig_V-set,pfam_Immunoglobulin,pfam_CD80_C2-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	p.V72A	ENST00000534261.2	37	c.215	CCDS33088.1	19	.	.	.	.	.	.	.	.	.	.	a	5.405	0.259892	0.10239	.	.	ENSG00000105501	ENST00000429354	T	0.68025	-0.3	4.24	-4.0	0.04057	Immunoglobulin subtype (1);Immunoglobulin V-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.544624	0.15369	N	0.265939	T	0.46870	0.1415	N	0.25485	0.75	0.80722	P	0.0	B	0.06786	0.001	B	0.12156	0.007	T	0.27640	-1.0068	9	0.30854	T	0.27	.	10.8806	0.46935	0.6567:0.0:0.3433:0.0	.	72	O15389	SIGL5_HUMAN	A	72	ENSP00000415200:V72A	ENSP00000415200:V72A	V	-	2	0	SIGLEC5	56825104	0.000000	0.05858	0.000000	0.03702	0.006000	0.05464	-0.459000	0.06728	-0.793000	0.04475	-0.880000	0.02959	GTT	SIGLEC5	-	pfam_Ig_V-set,smart_Ig_sub,pfscan_Ig-like	ENSG00000105501		0.577	SIGLEC5-001	PUTATIVE	basic|appris_principal|CCDS	protein_coding	SIGLEC5	HGNC	protein_coding	OTTHUMT00000466897.2	16	0.00	0	A	NM_003830		52133292	52133292	-1	no_errors	ENST00000429354	ensembl	human	known	69_37n	missense	9	25.00	3	SNP	0.000	G
SPRY4	81848	genome.wustl.edu	37	5	141694299	141694299	+	Silent	SNP	T	T	A			TCGA-A2-A04R-01A-41D-A117-09	TCGA-A2-A04R-10B-01D-A10G-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f8e4326-dfc7-4635-a9b7-a9207a392748	6234c5ee-14f2-427c-9ebc-4911da27a849	g.chr5:141694299T>A	ENST00000434127.2	-	2	618	c.375A>T	c.(373-375)tcA>tcT	p.S125S	SPRY4_ENST00000344120.4_Silent_p.S148S|SPRY4_ENST00000503582.1_5'Flank	NM_001127496.1	NP_001120968.1	Q9C004	SPY4_HUMAN	sprouty homolog 4 (Drosophila)	125					multicellular organismal development (GO:0007275)|negative regulation of MAP kinase activity (GO:0043407)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)		p.S148S(1)		breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(3)|lung(7)|ovary(1)	18		all_hematologic(541;0.118)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CAGCCCTTGGTGAGGCCTGGT	0.657									Testicular Cancer, Familial Clustering of																													dbGAP											1	Substitution - coding silent(1)	breast(1)											58.0	66.0	63.0					5																	141694299		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0	Familial Cancer Database		AF227516	CCDS4274.1, CCDS47296.1	5q31.3	2010-08-05			ENSG00000187678	ENSG00000187678			15533	protein-coding gene	gene with protein product		607984				16465403	Standard	NM_030964		Approved		uc010jgi.1	Q9C004	OTTHUMG00000129663	ENST00000434127.2:c.375A>T	5.37:g.141694299T>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A4FVB2|A4FVB3|Q6QIX2|Q9C003	Silent	SNP	pfam_Sprouty	p.S148	ENST00000434127.2	37	c.444	CCDS47296.1	5																																																																																			SPRY4	-	NULL	ENSG00000187678		0.657	SPRY4-002	KNOWN	basic|appris_principal|CCDS	protein_coding	SPRY4	HGNC	protein_coding	OTTHUMT00000370652.1	39	0.00	0	T			141694299	141694299	-1	no_errors	ENST00000344120	ensembl	human	known	69_37n	silent	26	56.45	35	SNP	0.002	A
TM7SF3	51768	genome.wustl.edu	37	12	27127095	27127095	+	Nonsense_Mutation	SNP	C	C	A			TCGA-A2-A04R-01A-41D-A117-09	TCGA-A2-A04R-10B-01D-A10G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f8e4326-dfc7-4635-a9b7-a9207a392748	6234c5ee-14f2-427c-9ebc-4911da27a849	g.chr12:27127095C>A	ENST00000343028.4	-	12	1741	c.1516G>T	c.(1516-1518)Gag>Tag	p.E506*	RP11-421F16.3_ENST00000500632.1_RNA	NM_016551.2	NP_057635.1	Q9NS93	TM7S3_HUMAN	transmembrane 7 superfamily member 3	506						extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.E506*(1)		breast(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(6)|prostate(1)|stomach(1)|upper_aerodigestive_tract(2)	18	Colorectal(261;0.0847)					CGTCCTCTCTCTCTTCGAATC	0.463																																						dbGAP											1	Substitution - Nonsense(1)	breast(1)											105.0	94.0	98.0					12																	27127095		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AB032470	CCDS8710.1	12q11-q12	2012-08-10			ENSG00000064115	ENSG00000064115			23049	protein-coding gene	gene with protein product		605181				10828615	Standard	NM_016551		Approved		uc010sjl.2	Q9NS93	OTTHUMG00000169243	ENST00000343028.4:c.1516G>T	12.37:g.27127095C>A	ENSP00000342322:p.Glu506*	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KMZ3|Q9NUS4	Nonsense_Mutation	SNP	NULL	p.E506*	ENST00000343028.4	37	c.1516	CCDS8710.1	12	.	.	.	.	.	.	.	.	.	.	C	21.6	4.168408	0.78339	.	.	ENSG00000064115	ENST00000343028;ENST00000545344	.	.	.	5.58	5.58	0.84498	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.54805	T	0.06	-20.6997	19.9662	0.97271	0.0:1.0:0.0:0.0	.	.	.	.	X	506;220	.	ENSP00000342322:E506X	E	-	1	0	TM7SF3	27018362	1.000000	0.71417	1.000000	0.80357	0.728000	0.41692	7.443000	0.80521	2.793000	0.96121	0.655000	0.94253	GAG	TM7SF3	-	NULL	ENSG00000064115		0.463	TM7SF3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TM7SF3	HGNC	protein_coding	OTTHUMT00000403033.1	110	0.00	0	C	NM_016551		27127095	27127095	-1	no_errors	ENST00000343028	ensembl	human	known	69_37n	nonsense	74	43.08	56	SNP	1.000	A
TRAF3	7187	genome.wustl.edu	37	14	103336784	103336784	+	Splice_Site	SNP	G	G	T			TCGA-A2-A04R-01A-41D-A117-09	TCGA-A2-A04R-10B-01D-A10G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f8e4326-dfc7-4635-a9b7-a9207a392748	6234c5ee-14f2-427c-9ebc-4911da27a849	g.chr14:103336784G>T	ENST00000560371.1	+	2	462		c.e2+1		TRAF3_ENST00000539721.1_Splice_Site|TRAF3_ENST00000347662.4_Splice_Site|TRAF3_ENST00000392745.2_Splice_Site|TRAF3_ENST00000351691.5_Splice_Site	NM_003300.3|NM_145725.2	NP_003291.2|NP_663777.1	Q13114	TRAF3_HUMAN	TNF receptor-associated factor 3						apoptotic process (GO:0006915)|innate immune response (GO:0045087)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of type I interferon production (GO:0032480)|regulation of apoptotic process (GO:0042981)|regulation of cytokine production (GO:0001817)|regulation of defense response to virus (GO:0050688)|regulation of interferon-beta production (GO:0032648)|regulation of proteolysis (GO:0030162)|signal transduction (GO:0007165)|Toll signaling pathway (GO:0008063)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)|tumor necrosis factor-mediated signaling pathway (GO:0033209)	CD40 receptor complex (GO:0035631)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|endosome (GO:0005768)|mitochondrion (GO:0005739)	ligase activity (GO:0016874)|signal transducer activity (GO:0004871)|thioesterase binding (GO:0031996)|tumor necrosis factor receptor binding (GO:0005164)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.?(1)		breast(4)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(10)|liver(2)|lung(7)|ovary(1)|prostate(2)	30		all_cancers(154;7.87e-06)|all_epithelial(191;0.0024)		Epithelial(152;9.92e-24)|all cancers(159;2.23e-21)|OV - Ovarian serous cystadenocarcinoma(161;7.85e-12)|Colorectal(3;0.0971)		CCCTGCTGAGGTAGGCGCCCT	0.602																																						dbGAP											1	Unknown(1)	breast(1)											41.0	37.0	38.0					14																	103336784		2203	4299	6502	-	-	-	SO:0001630	splice_region_variant	0			U21092	CCDS9975.1, CCDS9976.1, CCDS55946.1	14q32.32	2014-09-17				ENSG00000131323			12033	protein-coding gene	gene with protein product		601896				7530216, 7859281	Standard	NM_145725		Approved	CAP-1, CD40bp, CRAF1, LAP1	uc001ymd.2	Q13114		ENST00000560371.1:c.245+1G>T	14.37:g.103336784G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B7Z8C4|Q12990|Q13076|Q13947|Q6AZX1|Q9UNL1	Splice_Site	SNP	-	e1+1	ENST00000560371.1	37	c.245+1	CCDS9975.1	14	.	.	.	.	.	.	.	.	.	.	G	15.89	2.965642	0.53507	.	.	ENSG00000131323	ENST00000392745;ENST00000347662;ENST00000351691;ENST00000539721	.	.	.	5.11	5.11	0.69529	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.5455	0.91044	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	TRAF3	102406537	1.000000	0.71417	0.994000	0.49952	0.233000	0.25261	8.828000	0.92047	2.372000	0.80975	0.555000	0.69702	.	TRAF3	-	-	ENSG00000131323		0.602	TRAF3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRAF3	HGNC	protein_coding	OTTHUMT00000415735.1	27	0.00	0	G	NM_145725	Intron	103336784	103336784	+1	no_errors	ENST00000392745	ensembl	human	known	69_37n	splice_site	14	41.67	10	SNP	1.000	T
TTN	7273	genome.wustl.edu	37	2	179457975	179457975	+	Missense_Mutation	SNP	C	C	A			TCGA-A2-A04R-01A-41D-A117-09	TCGA-A2-A04R-10B-01D-A10G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f8e4326-dfc7-4635-a9b7-a9207a392748	6234c5ee-14f2-427c-9ebc-4911da27a849	g.chr2:179457975C>A	ENST00000591111.1	-	249	54261	c.54037G>T	c.(54037-54039)Gtt>Ttt	p.V18013F	TTN_ENST00000342175.6_Missense_Mutation_p.V10781F|TTN-AS1_ENST00000586452.1_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000591332.1_RNA|TTN-AS1_ENST00000592750.1_RNA|TTN-AS1_ENST00000589907.1_RNA|TTN-AS1_ENST00000589234.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000590807.1_RNA|TTN_ENST00000359218.5_Missense_Mutation_p.V10714F|TTN-AS1_ENST00000590743.1_RNA|TTN-AS1_ENST00000419746.1_RNA|TTN-AS1_ENST00000456053.1_RNA|TTN_ENST00000589042.1_Missense_Mutation_p.V19654F|TTN_ENST00000342992.6_Missense_Mutation_p.V17086F|TTN_ENST00000460472.2_Missense_Mutation_p.V10589F|TTN-AS1_ENST00000590932.1_RNA|TTN-AS1_ENST00000592689.1_RNA			Q8WZ42	TITIN_HUMAN	titin	18013	Fibronectin type-III 30. {ECO:0000255|PROSITE-ProRule:PRU00316}.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)	p.V10714F(1)|p.V17084F(1)|p.V10589F(1)|p.V17086F(1)|p.V10781F(1)		NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TCTGCAGAAACCCGGAATTCA	0.378																																						dbGAP											5	Substitution - Missense(5)	breast(5)											140.0	138.0	139.0					2																	179457975		1837	4083	5920	-	-	-	SO:0001583	missense	0			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.54037G>T	2.37:g.179457975C>A	ENSP00000465570:p.Val18013Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Titin_Z,pfam_PPAK_motif,pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_cat_dom,pfscan_Ig-like	p.V17086F	ENST00000591111.1	37	c.51256		2	.	.	.	.	.	.	.	.	.	.	C	14.19	2.462217	0.43736	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	T;T;T;T	0.74002	-0.8;-0.8;-0.8;-0.8	6.16	6.16	0.99307	Fibronectin, type III (4);Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	D	0.93539	0.7938	H	0.99619	4.66	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.91635	0.999;0.999;0.999;0.999	D	0.95547	0.8617	9	0.87932	D	0	.	20.8598	0.99761	0.0:1.0:0.0:0.0	.	10589;10714;10781;18013	D3DPF9;E7EQE6;E7ET18;Q8WZ42	.;.;.;TITIN_HUMAN	F	17086;10589;10781;10714;10587	ENSP00000343764:V17086F;ENSP00000434586:V10589F;ENSP00000340554:V10781F;ENSP00000352154:V10714F	ENSP00000340554:V10781F	V	-	1	0	TTN	179166221	1.000000	0.71417	0.999000	0.59377	0.990000	0.78478	7.818000	0.86416	2.937000	0.99478	0.650000	0.86243	GTT	TTN	-	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom,smart_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000155657		0.378	TTN-019	PUTATIVE	basic	protein_coding	TTN	HGNC	protein_coding	OTTHUMT00000460310.1	167	0.00	0	C	NM_133378		179457975	179457975	-1	no_errors	ENST00000342992	ensembl	human	known	69_37n	missense	85	43.95	69	SNP	1.000	A
TUBGCP2	10844	genome.wustl.edu	37	10	135113545	135113545	+	Missense_Mutation	SNP	T	T	C			TCGA-A2-A04R-01A-41D-A117-09	TCGA-A2-A04R-10B-01D-A10G-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f8e4326-dfc7-4635-a9b7-a9207a392748	6234c5ee-14f2-427c-9ebc-4911da27a849	g.chr10:135113545T>C	ENST00000252936.3	-	2	262	c.223A>G	c.(223-225)Aca>Gca	p.T75A	TUBGCP2_ENST00000470829.1_5'UTR|TUBGCP2_ENST00000417178.2_De_novo_Start_OutOfFrame|TUBGCP2_ENST00000543663.1_Missense_Mutation_p.T75A|TUBGCP2_ENST00000368563.2_Missense_Mutation_p.T75A			Q9BSJ2	GCP2_HUMAN	tubulin, gamma complex associated protein 2	75					G2/M transition of mitotic cell cycle (GO:0000086)|microtubule nucleation (GO:0007020)|mitotic cell cycle (GO:0000278)|protein complex assembly (GO:0006461)	centrosome (GO:0005813)|cytoplasmic microtubule (GO:0005881)|cytosol (GO:0005829)|membrane (GO:0016020)|microtubule organizing center (GO:0005815)|spindle pole (GO:0000922)		p.T75A(1)		breast(2)|cervix(1)|endometrium(1)|kidney(3)|large_intestine(6)|lung(16)|ovary(2)|prostate(3)|upper_aerodigestive_tract(1)	35		all_cancers(35;1.14e-09)|all_epithelial(44;5.79e-08)|Lung NSC(174;0.00263)|all_lung(145;0.0039)|all_neural(114;0.0299)|Melanoma(40;0.123)|Colorectal(31;0.172)|Glioma(114;0.203)		OV - Ovarian serous cystadenocarcinoma(35;8.87e-06)|all cancers(32;8.98e-06)|Epithelial(32;1.15e-05)		AGGTTCCTTGTATTTTTAGAT	0.443																																						dbGAP											1	Substitution - Missense(1)	breast(1)											154.0	146.0	149.0					10																	135113545		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF042379	CCDS7676.1, CCDS58104.1, CCDS58105.1	10q26.3	2008-07-28			ENSG00000130640	ENSG00000130640			18599	protein-coding gene	gene with protein product						9566967	Standard	NM_001256617		Approved	GCP2, Spc97p, SPBC97	uc010qvc.2	Q9BSJ2	OTTHUMG00000019319	ENST00000252936.3:c.223A>G	10.37:g.135113545T>C	ENSP00000252936:p.Thr75Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DM18|B7ZKL8|F5H4E0|F5H4L0|O43632|Q5VWX7	Missense_Mutation	SNP	pfam_Spc97_Spc98,superfamily_Ocr	p.T75A	ENST00000252936.3	37	c.223	CCDS7676.1	10	.	.	.	.	.	.	.	.	.	.	T	6.422	0.446010	0.12164	.	.	ENSG00000130640	ENST00000252936;ENST00000368563;ENST00000543663	T;T;T	0.44482	0.92;0.92;0.92	5.15	-1.36	0.09085	.	0.458443	0.24838	N	0.035197	T	0.20901	0.0503	N	0.08118	0	0.20196	N	0.99992	B;B;B	0.06786	0.001;0.001;0.0	B;B;B	0.06405	0.002;0.001;0.0	T	0.14035	-1.0487	10	0.46703	T	0.11	-3.9643	12.054	0.53524	0.0:0.3398:0.0:0.6602	.	75;75;75	F5H4L0;B7ZKL8;Q9BSJ2	.;.;GCP2_HUMAN	A	75	ENSP00000252936:T75A;ENSP00000357551:T75A;ENSP00000446093:T75A	ENSP00000252936:T75A	T	-	1	0	TUBGCP2	134963535	1.000000	0.71417	0.007000	0.13788	0.641000	0.38312	2.257000	0.43240	-0.455000	0.07054	-1.751000	0.00678	ACA	TUBGCP2	-	NULL	ENSG00000130640		0.443	TUBGCP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TUBGCP2	HGNC	protein_coding	OTTHUMT00000051148.1	193	0.00	0	T			135113545	135113545	-1	no_errors	ENST00000543663	ensembl	human	known	69_37n	missense	92	38.26	57	SNP	0.070	C
USE1	55850	genome.wustl.edu	37	19	17330504	17330504	+	Missense_Mutation	SNP	G	G	A	rs189793505		TCGA-A2-A04R-01A-41D-A117-09	TCGA-A2-A04R-10B-01D-A10G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f8e4326-dfc7-4635-a9b7-a9207a392748	6234c5ee-14f2-427c-9ebc-4911da27a849	g.chr19:17330504G>A	ENST00000263897.5	+	8	709	c.662G>A	c.(661-663)cGt>cAt	p.R221H	USE1_ENST00000596136.1_3'UTR|USE1_ENST00000445667.2_Missense_Mutation_p.R221H|USE1_ENST00000379776.4_3'UTR	NM_018467.3	NP_060937	Q9NZ43	USE1_HUMAN	unconventional SNARE in the ER 1 homolog (S. cerevisiae)	221					endoplasmic reticulum tubular network organization (GO:0071786)|lysosomal transport (GO:0007041)|protein catabolic process (GO:0030163)|protein transport (GO:0015031)|regulation of ER to Golgi vesicle-mediated transport (GO:0060628)|secretion by cell (GO:0032940)|vesicle-mediated transport (GO:0016192)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)		p.R221H(1)		breast(2)|endometrium(1)|lung(3)	6						GAGTCAGAGCGTCTGGAGCAG	0.522													G|||	1	0.000199681	0.0	0.0014	5008	,	,		18307	0.0		0.0	False		,,,				2504	0.0					dbGAP											1	Substitution - Missense(1)	breast(1)											94.0	102.0	100.0					19																	17330504		2202	4299	6501	-	-	-	SO:0001583	missense	0			AF220052	CCDS46011.1	19p13.11	2007-08-20				ENSG00000053501			30882	protein-coding gene	gene with protein product	"""Q-SNARE"", ""SNARE-like tail-anchored protein 1 homolog (S. cerevisiae)"""	610675				16354670, 15029241	Standard	NM_018467		Approved	p31, SLT1, MDS032	uc002nfo.2	Q9NZ43		ENST00000263897.5:c.662G>A	19.37:g.17330504G>A	ENSP00000263897:p.Arg221His	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8NCK1|Q9BRT4	Missense_Mutation	SNP	pfam_Vesicle_transport_protein_Use1	p.R221H	ENST00000263897.5	37	c.662	CCDS46011.1	19	1	4.578754578754579E-4	0	0.0	1	0.0027624309392265192	0	0.0	0	0.0	G	23.0	4.357464	0.82243	.	.	ENSG00000053501	ENST00000263897;ENST00000445667	T;T	0.61627	0.09;0.09	4.73	4.73	0.59995	.	0.000000	0.85682	D	0.000000	T	0.76456	0.3990	M	0.78801	2.425	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.79155	-0.1920	10	0.52906	T	0.07	-31.8249	16.6941	0.85330	0.0:0.0:1.0:0.0	.	221	Q9NZ43	USE1_HUMAN	H	221	ENSP00000263897:R221H;ENSP00000390287:R221H	ENSP00000263897:R221H	R	+	2	0	USE1	17191504	1.000000	0.71417	0.995000	0.50966	0.526000	0.34562	9.729000	0.98795	2.193000	0.70182	0.491000	0.48974	CGT	USE1	-	pfam_Vesicle_transport_protein_Use1	ENSG00000053501		0.522	USE1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	USE1	HGNC	protein_coding	OTTHUMT00000463295.1	90	0.00	0	G	NM_018467		17330504	17330504	+1	no_errors	ENST00000263897	ensembl	human	known	69_37n	missense	57	35.96	32	SNP	1.000	A
USP46	64854	genome.wustl.edu	37	4	53468079	53468079	+	Silent	SNP	A	A	G			TCGA-A2-A04R-01A-41D-A117-09	TCGA-A2-A04R-10B-01D-A10G-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f8e4326-dfc7-4635-a9b7-a9207a392748	6234c5ee-14f2-427c-9ebc-4911da27a849	g.chr4:53468079A>G	ENST00000441222.3	-	7	1048	c.864T>C	c.(862-864)gaT>gaC	p.D288D	USP46_ENST00000451218.2_Silent_p.D261D|USP46_ENST00000508499.1_Silent_p.D281D	NM_022832.3	NP_073743.2	P62068	UBP46_HUMAN	ubiquitin specific peptidase 46	288	USP.				adult feeding behavior (GO:0008343)|behavioral fear response (GO:0001662)|behavioral response to ethanol (GO:0048149)|protein deubiquitination (GO:0016579)|regulation of synaptic transmission, GABAergic (GO:0032228)|righting reflex (GO:0060013)|ubiquitin-dependent protein catabolic process (GO:0006511)		ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)	p.D288D(1)		breast(1)|endometrium(2)|large_intestine(2)|lung(5)|ovary(2)	12			LUSC - Lung squamous cell carcinoma(32;0.0295)			GGTTCACTGCATCACTGGAGG	0.527																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											118.0	115.0	116.0					4																	53468079		2083	4216	6299	-	-	-	SO:0001819	synonymous_variant	0			AK022614	CCDS47053.1, CCDS47054.1	4q12	2008-02-05	2005-08-08		ENSG00000109189	ENSG00000109189		"""Ubiquitin-specific peptidases"""	20075	protein-coding gene	gene with protein product		612849	"""ubiquitin specific protease 46"""			12838346	Standard	NM_022832		Approved	FLJ12552	uc003gzn.3	P62068	OTTHUMG00000160640	ENST00000441222.3:c.864T>C	4.37:g.53468079A>G		Somatic		WXS	Illumina GAIIx	Phase_IV	B7Z3Y7|B7Z675|B7Z7S3|G8ACC7|Q80V95|Q9H7U4|Q9H9T8	Silent	SNP	pfam_Peptidase_C19,pfscan_Peptidase_C19	p.D288	ENST00000441222.3	37	c.864	CCDS47053.1	4																																																																																			USP46	-	pfam_Peptidase_C19,pfscan_Peptidase_C19	ENSG00000109189		0.527	USP46-001	KNOWN	basic|appris_principal|CCDS	protein_coding	USP46	HGNC	protein_coding	OTTHUMT00000361516.2	94	0.00	0	A	NM_022832		53468079	53468079	-1	no_errors	ENST00000441222	ensembl	human	known	69_37n	silent	43	44.87	35	SNP	0.539	G
VSTM2B	342865	genome.wustl.edu	37	19	30054804	30054804	+	Missense_Mutation	SNP	C	C	A			TCGA-A2-A04R-01A-41D-A117-09	TCGA-A2-A04R-10B-01D-A10G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f8e4326-dfc7-4635-a9b7-a9207a392748	6234c5ee-14f2-427c-9ebc-4911da27a849	g.chr19:30054804C>A	ENST00000335523.7	+	5	906	c.821C>A	c.(820-822)gCt>gAt	p.A274D		NM_001146339.1	NP_001139811.1	A6NLU5	VTM2B_HUMAN	V-set and transmembrane domain containing 2B	274						integral component of membrane (GO:0016021)		p.A274D(1)		breast(2)	2						CTCCTGTTAGCTCTGCATAAG	0.582																																						dbGAP											1	Substitution - Missense(1)	breast(1)											199.0	160.0	172.0					19																	30054804		692	1591	2283	-	-	-	SO:0001583	missense	0				CCDS46034.1	19q12	2013-01-11			ENSG00000187135	ENSG00000187135		"""Immunoglobulin superfamily / V-set domain containing"""	33595	protein-coding gene	gene with protein product							Standard	NM_001146339		Approved		uc010xrl.1	A6NLU5		ENST00000335523.7:c.821C>A	19.37:g.30054804C>A	ENSP00000335038:p.Ala274Asp	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Ig_V-set,pfam_Ig_I-set,smart_Ig_sub,pfscan_Ig-like	p.A274D	ENST00000335523.7	37	c.821	CCDS46034.1	19	.	.	.	.	.	.	.	.	.	.	C	9.866	1.197726	0.22037	.	.	ENSG00000187135	ENST00000335523	T	0.09350	2.99	5.69	4.66	0.58398	.	.	.	.	.	T	0.13030	0.0316	N	0.24115	0.695	0.31215	N	0.698145	D	0.61697	0.99	P	0.54664	0.758	T	0.05733	-1.0867	9	0.54805	T	0.06	.	7.358	0.26729	0.0:0.7437:0.0:0.2563	.	274	A6NLU5	VTM2B_HUMAN	D	274	ENSP00000335038:A274D	ENSP00000335038:A274D	A	+	2	0	VSTM2B	34746644	0.971000	0.33674	0.661000	0.29709	0.052000	0.14988	2.055000	0.41345	1.415000	0.47037	0.462000	0.41574	GCT	VSTM2B	-	NULL	ENSG00000187135		0.582	VSTM2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	VSTM2B	HGNC	protein_coding	OTTHUMT00000458601.1	164	0.00	0	C	NM_001146339		30054804	30054804	+1	no_errors	ENST00000335523	ensembl	human	known	69_37n	missense	77	47.26	69	SNP	0.982	A
ZFPM2	23414	genome.wustl.edu	37	8	106813723	106813723	+	Missense_Mutation	SNP	G	G	T			TCGA-A2-A04R-01A-41D-A117-09	TCGA-A2-A04R-10B-01D-A10G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f8e4326-dfc7-4635-a9b7-a9207a392748	6234c5ee-14f2-427c-9ebc-4911da27a849	g.chr8:106813723G>T	ENST00000407775.2	+	8	1663	c.1413G>T	c.(1411-1413)aaG>aaT	p.K471N	ZFPM2_ENST00000517361.1_Missense_Mutation_p.K339N|ZFPM2_ENST00000522296.1_3'UTR|RP11-152P17.2_ENST00000520433.1_RNA|ZFPM2_ENST00000378472.4_Missense_Mutation_p.K202N|RP11-152P17.2_ENST00000521622.1_RNA|RP11-152P17.2_ENST00000518932.1_RNA|RP11-152P17.2_ENST00000520594.1_RNA|RP11-152P17.2_ENST00000509144.2_RNA|RP11-152P17.2_ENST00000524045.2_RNA|ZFPM2_ENST00000520492.1_Missense_Mutation_p.K339N	NM_012082.3	NP_036214.2	Q8WW38	FOG2_HUMAN	zinc finger protein, FOG family member 2	471					blood coagulation (GO:0007596)|embryonic organ development (GO:0048568)|gonadal mesoderm development (GO:0007506)|in utero embryonic development (GO:0001701)|lung development (GO:0030324)|negative regulation of cell death (GO:0060548)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of female gonad development (GO:2000195)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|outflow tract septum morphogenesis (GO:0003148)|positive regulation of male gonad development (GO:2000020)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|right ventricular cardiac muscle tissue morphogenesis (GO:0003221)|vasculogenesis (GO:0001570)|ventricular septum morphogenesis (GO:0060412)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|nucleic acid binding transcription factor activity (GO:0001071)|RNA polymerase II transcription coactivator activity (GO:0001105)|transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)	p.K471N(1)		NS(4)|breast(6)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(11)|liver(2)|lung(48)|ovary(4)|prostate(5)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	99			OV - Ovarian serous cystadenocarcinoma(57;8.28e-08)			CAAAAATAAAGTCTGAGCCCT	0.448																																						dbGAP											1	Substitution - Missense(1)	breast(1)											83.0	89.0	87.0					8																	106813723		1868	4091	5959	-	-	-	SO:0001583	missense	0			AF119334	CCDS47908.1	8q23	2013-01-10	2012-11-27		ENSG00000169946	ENSG00000169946		"""Zinc fingers, C2H2-type"", ""Zinc fingers, C2HC-type containing"""	16700	protein-coding gene	gene with protein product		603693	"""zinc finger protein, multitype 2"""			9927675, 10438528	Standard	NM_012082		Approved	FOG2, hFOG-2, ZNF89B, ZC2HC11B	uc003ymd.3	Q8WW38	OTTHUMG00000164818	ENST00000407775.2:c.1413G>T	8.37:g.106813723G>T	ENSP00000384179:p.Lys471Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	Q32MA6|Q9NPL7|Q9NPS4|Q9UNI5	Missense_Mutation	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.K471N	ENST00000407775.2	37	c.1413	CCDS47908.1	8	.	.	.	.	.	.	.	.	.	.	G	15.20	2.762302	0.49468	.	.	ENSG00000169946	ENST00000407775;ENST00000520492;ENST00000517361;ENST00000378472	T;T;T;T	0.35236	1.32;1.85;1.85;3.06	5.97	3.27	0.37495	.	0.000000	0.85682	D	0.000000	T	0.49660	0.1570	L	0.55990	1.75	0.58432	D	0.999999	D	0.76494	0.999	D	0.80764	0.994	T	0.40869	-0.9540	10	0.54805	T	0.06	.	7.6949	0.28590	0.4297:0.0:0.5703:0.0	.	471	Q8WW38	FOG2_HUMAN	N	471;339;339;202	ENSP00000384179:K471N;ENSP00000430757:K339N;ENSP00000428720:K339N;ENSP00000367733:K202N	ENSP00000367733:K202N	K	+	3	2	ZFPM2	106882899	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	2.590000	0.46154	0.444000	0.26612	-0.137000	0.14449	AAG	ZFPM2	-	NULL	ENSG00000169946		0.448	ZFPM2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ZFPM2	HGNC	protein_coding	OTTHUMT00000380614.1	78	0.00	0	G			106813723	106813723	+1	no_errors	ENST00000407775	ensembl	human	known	69_37n	missense	48	63.36	83	SNP	1.000	T
ZBTB18	10472	genome.wustl.edu	37	1	244218516	244218516	+	Silent	SNP	C	C	T			TCGA-A2-A04R-01A-41D-A117-09	TCGA-A2-A04R-10B-01D-A10G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f8e4326-dfc7-4635-a9b7-a9207a392748	6234c5ee-14f2-427c-9ebc-4911da27a849	g.chr1:244218516C>T	ENST00000358704.4	+	2	1589	c.1440C>T	c.(1438-1440)tgC>tgT	p.C480C		NM_001278196.1|NM_006352.4|NM_205768.2	NP_001265125.1|NP_006343.2|NP_991331.1	Q99592	ZBT18_HUMAN	zinc finger and BTB domain containing 18	471					cerebellum development (GO:0021549)|cerebral cortex development (GO:0021987)|hippocampus development (GO:0021766)|homeostasis of number of cells (GO:0048872)|in utero embryonic development (GO:0001701)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|neuron development (GO:0048666)|regulation of cell division (GO:0051302)|skeletal muscle tissue development (GO:0007519)|transcription, DNA-templated (GO:0006351)	intercellular bridge (GO:0045171)|microtubule cytoskeleton (GO:0015630)|nuclear chromosome (GO:0000228)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.C471C(1)									GCAAGTGGTGCGAGCGCAGGT	0.597																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											63.0	62.0	62.0					1																	244218516		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			U38896	CCDS1622.1	1q44	2013-09-19	2013-01-09	2013-01-09	ENSG00000179456	ENSG00000179456		"""-"", ""BTB/POZ domain containing"", ""Zinc fingers, C2H2-type"""	13030	protein-coding gene	gene with protein product		608433	"""zinc finger protein 238"""	ZNF238		9568537, 9013868	Standard	NM_205768		Approved	C2H2-171, TAZ-1, RP58	uc031psv.1	Q99592	OTTHUMG00000040013	ENST00000358704.4:c.1440C>T	1.37:g.244218516C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K5U3|Q13397|Q5VU40|Q8N463|Q9UD99	Silent	SNP	pfam_BTB_POZ,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_Znf_C2H2-like,pfscan_BTB/POZ-like,pfscan_Znf_C2H2	p.C480	ENST00000358704.4	37	c.1440	CCDS1622.1	1	.	.	.	.	.	.	.	.	.	.	C	3.216	-0.160621	0.06502	.	.	ENSG00000179456	ENST00000366538	.	.	.	5.78	-3.6	0.04570	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.59425	D	0.04	.	13.7284	0.62771	0.0:0.29:0.0:0.71	.	.	.	.	X	469	.	ENSP00000355496:R469X	R	+	1	2	ZNF238	242285139	0.885000	0.30320	0.957000	0.39632	0.995000	0.86356	0.017000	0.13399	-0.597000	0.05813	-0.137000	0.14449	CGA	ZNF238	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000179456		0.597	ZBTB18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF238	HGNC	protein_coding	OTTHUMT00000096513.2	8	0.00	0	C	NM_205768		244218516	244218516	+1	no_errors	ENST00000358704	ensembl	human	known	69_37n	silent	7	65.00	13	SNP	0.986	T
ZNF562	54811	genome.wustl.edu	37	19	9768710	9768710	+	Missense_Mutation	SNP	C	C	G			TCGA-A2-A04R-01A-41D-A117-09	TCGA-A2-A04R-10B-01D-A10G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f8e4326-dfc7-4635-a9b7-a9207a392748	6234c5ee-14f2-427c-9ebc-4911da27a849	g.chr19:9768710C>G	ENST00000448622.1	-	4	378	c.216G>C	c.(214-216)gaG>gaC	p.E72D	ZNF562_ENST00000590155.1_Missense_Mutation_p.E72D|ZNF562_ENST00000453372.2_Missense_Mutation_p.E72D|ZNF562_ENST00000541032.1_Missense_Mutation_p.E35D|ZNF562_ENST00000587392.1_Missense_Mutation_p.E72D|ZNF562_ENST00000293648.4_Intron|ZNF562_ENST00000453792.2_Missense_Mutation_p.E3D|ZNF562_ENST00000537617.1_Intron	NM_001130031.1|NM_001130032.1	NP_001123503.1|NP_001123504.1	Q6V9R5	ZN562_HUMAN	zinc finger protein 562	72	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.E72D(1)		NS(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(7)|prostate(1)|skin(1)|urinary_tract(1)	17						TCATGTAGTTCTCCAGCATCA	0.507																																						dbGAP											1	Substitution - Missense(1)	breast(1)											73.0	71.0	72.0					19																	9768710		692	1591	2283	-	-	-	SO:0001583	missense	0			AK000086	CCDS12217.1, CCDS45956.1, CCDS74280.1	19p13.2	2013-09-20			ENSG00000171466	ENSG00000171466		"""Zinc fingers, C2H2-type"", ""-"""	25950	protein-coding gene	gene with protein product							Standard	NM_001130031		Approved	FLJ20079	uc010xks.2	Q6V9R5	OTTHUMG00000180205	ENST00000448622.1:c.216G>C	19.37:g.9768710C>G	ENSP00000411784:p.Glu72Asp	Somatic		WXS	Illumina GAIIx	Phase_IV	Q32MN2|Q9NXS5	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.E72D	ENST00000448622.1	37	c.216	CCDS45956.1	19	.	.	.	.	.	.	.	.	.	.	C	15.56	2.869375	0.51588	.	.	ENSG00000171466	ENST00000453372;ENST00000448622;ENST00000541032;ENST00000453792	T;T;T;T	0.10573	3.76;3.76;3.76;2.86	2.03	2.03	0.26663	Krueppel-associated box (4);	.	.	.	.	T	0.27384	0.0672	M	0.75615	2.305	0.80722	D	1	D;D;D	0.69078	0.979;0.997;0.992	D;D;D	0.76071	0.973;0.987;0.983	T	0.02053	-1.1222	9	0.66056	D	0.02	.	7.4586	0.27280	0.0:1.0:0.0:0.0	.	72;35;72	B4DMG0;B4DZP9;Q6V9R5	.;.;ZN562_HUMAN	D	72;72;35;3	ENSP00000410734:E72D;ENSP00000411784:E72D;ENSP00000442614:E35D;ENSP00000440451:E3D	ENSP00000411784:E72D	E	-	3	2	ZNF562	9629710	0.978000	0.34361	0.986000	0.45419	0.821000	0.46438	0.446000	0.21694	1.122000	0.41944	0.305000	0.20034	GAG	ZNF562	-	pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,pfscan_Krueppel-associated_box	ENSG00000171466		0.507	ZNF562-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZNF562	HGNC	protein_coding	OTTHUMT00000450239.1	140	0.00	0	C	NM_017656		9768710	9768710	-1	no_errors	ENST00000448622	ensembl	human	known	69_37n	missense	66	42.61	49	SNP	0.999	G
ZNF571	51276	genome.wustl.edu	37	19	38055665	38055665	+	Missense_Mutation	SNP	C	C	A			TCGA-A2-A04R-01A-41D-A117-09	TCGA-A2-A04R-10B-01D-A10G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f8e4326-dfc7-4635-a9b7-a9207a392748	6234c5ee-14f2-427c-9ebc-4911da27a849	g.chr19:38055665C>A	ENST00000328550.2	-	4	1764	c.1665G>T	c.(1663-1665)gaG>gaT	p.E555D	ZNF571-AS1_ENST00000586139.1_RNA|ZNF571_ENST00000593133.1_Missense_Mutation_p.E555D|ZNF571-AS1_ENST00000591430.1_RNA|ZNF571-AS1_ENST00000585578.1_RNA|ZNF571-AS1_ENST00000586013.1_RNA|ZNF571_ENST00000358744.3_Missense_Mutation_p.E555D|ZNF571-AS1_ENST00000589750.1_RNA|ZNF571_ENST00000451802.2_Missense_Mutation_p.E555D|ZNF571-AS1_ENST00000590838.1_RNA|ZNF571-AS1_ENST00000587121.1_RNA|ZNF571-AS1_ENST00000592392.1_RNA|ZNF571-AS1_ENST00000589802.1_RNA|ZNF540_ENST00000592533.1_Intron|ZNF571_ENST00000590751.1_Intron			Q7Z3V5	ZN571_HUMAN	zinc finger protein 571	555					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.E555D(1)		breast(1)|endometrium(3)|large_intestine(6)|lung(11)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	25			COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)			CATAGGGTTTCTCTCCAGTAT	0.433																																						dbGAP											1	Substitution - Missense(1)	breast(1)											93.0	91.0	92.0					19																	38055665		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF161544	CCDS12505.1	19q13.12	2013-09-20			ENSG00000180479	ENSG00000180479		"""Zinc fingers, C2H2-type"", ""-"""	25000	protein-coding gene	gene with protein product						11042152	Standard	XM_005258977		Approved	HSPC059	uc002ogt.3	Q7Z3V5	OTTHUMG00000182016	ENST00000328550.2:c.1665G>T	19.37:g.38055665C>A	ENSP00000333660:p.Glu555Asp	Somatic		WXS	Illumina GAIIx	Phase_IV	Q2HIY0|Q3ZCU3|Q9NZX7	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.E555D	ENST00000328550.2	37	c.1665	CCDS12505.1	19	.	.	.	.	.	.	.	.	.	.	C	17.38	3.374813	0.61735	.	.	ENSG00000180479	ENST00000328550;ENST00000451802;ENST00000358744	T;T;T	0.26810	1.71;1.71;1.71	3.78	2.74	0.32292	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.35885	0.0947	L	0.53780	1.695	0.25613	N	0.986489	P	0.43024	0.798	P	0.51415	0.669	T	0.12760	-1.0535	9	0.66056	D	0.02	.	10.2357	0.43282	0.0:0.8971:0.0:0.1029	.	555	Q7Z3V5	ZN571_HUMAN	D	555	ENSP00000333660:E555D;ENSP00000392638:E555D;ENSP00000351594:E555D	ENSP00000333660:E555D	E	-	3	2	ZNF571	42747505	0.008000	0.16893	0.977000	0.42913	0.993000	0.82548	-0.605000	0.05661	0.776000	0.33473	0.460000	0.39030	GAG	ZNF571	-	pfscan_Znf_C2H2	ENSG00000180479		0.433	ZNF571-201	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF571	HGNC	protein_coding	OTTHUMT00000458669.1	105	0.00	0	C	NM_016536		38055665	38055665	-1	no_errors	ENST00000328550	ensembl	human	known	69_37n	missense	66	50.00	66	SNP	1.000	A
ZNF592	9640	genome.wustl.edu	37	15	85325940	85325940	+	Missense_Mutation	SNP	C	C	A			TCGA-A2-A04R-01A-41D-A117-09	TCGA-A2-A04R-10B-01D-A10G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1f8e4326-dfc7-4635-a9b7-a9207a392748	6234c5ee-14f2-427c-9ebc-4911da27a849	g.chr15:85325940C>A	ENST00000560079.2	+	4	322	c.34C>A	c.(34-36)Ctt>Att	p.L12I	ZNF592_ENST00000299927.3_Missense_Mutation_p.L12I	NM_014630.2	NP_055445.2	Q92610	ZN592_HUMAN	zinc finger protein 592	12					cell death (GO:0008219)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.L12I(1)		breast(2)|endometrium(2)|kidney(1)|large_intestine(12)|lung(14)|ovary(4)|prostate(2)|skin(2)|urinary_tract(1)	40			BRCA - Breast invasive adenocarcinoma(143;0.0587)			TTTTGATGACCTTCTGGCTGC	0.542																																						dbGAP											1	Substitution - Missense(1)	breast(1)											127.0	125.0	126.0					15																	85325940		2203	4299	6502	-	-	-	SO:0001583	missense	0			D86966	CCDS32317.1	15q25.2	2011-03-15				ENSG00000166716		"""Zinc fingers, C2H2-type"""	28986	protein-coding gene	gene with protein product		613624	"""spinocerebellar ataxia, autosomal recessive 5"""	SCAR5		9039502, 12030328, 20531441	Standard	NM_014630		Approved	KIAA0211, CAMOS	uc002bld.3	Q92610		ENST00000560079.2:c.34C>A	15.37:g.85325940C>A	ENSP00000452877:p.Leu12Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	Q2M1T2|Q504Y9	Missense_Mutation	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.L12I	ENST00000560079.2	37	c.34	CCDS32317.1	15	.	.	.	.	.	.	.	.	.	.	C	20.8	4.050321	0.75846	.	.	ENSG00000166716	ENST00000299927	T	0.03801	3.8	6.17	6.17	0.99709	.	0.000000	0.85682	D	0.000000	T	0.23649	0.0572	M	0.73962	2.25	0.58432	D	0.999993	D	0.89917	1.0	D	0.85130	0.997	T	0.00005	-1.2543	10	0.87932	D	0	-18.0534	18.3732	0.90420	0.0:1.0:0.0:0.0	.	12	Q92610	ZN592_HUMAN	I	12	ENSP00000299927:L12I	ENSP00000299927:L12I	L	+	1	0	ZNF592	83126944	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	5.670000	0.68088	2.941000	0.99782	0.655000	0.94253	CTT	ZNF592	-	NULL	ENSG00000166716		0.542	ZNF592-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF592	HGNC	protein_coding	OTTHUMT00000418779.2	61	0.00	0	C	NM_014630		85325940	85325940	+1	no_errors	ENST00000299927	ensembl	human	known	69_37n	missense	42	30.00	18	SNP	1.000	A
