#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
ACTBL2	345651	genome.wustl.edu	37	5	56777892	56777892	+	Missense_Mutation	SNP	C	C	G	rs534551351	byFrequency	TCGA-A2-A04V-01A-21W-A050-09	TCGA-A2-A04V-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	89501861-2778-4b88-9a44-939fed99850d	5a514786-920b-4f35-932d-c2116fdea598	g.chr5:56777892C>G	ENST00000423391.1	-	1	744	c.643G>C	c.(643-645)Gag>Cag	p.E215Q	CTD-2023N9.1_ENST00000506106.1_RNA|AC025470.1_ENST00000584598.1_RNA	NM_001017992.3	NP_001017992.1	Q562R1	ACTBL_HUMAN	actin, beta-like 2	215						cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)	p.E215Q(2)		breast(2)|endometrium(1)|kidney(2)|large_intestine(10)|lung(7)|ovary(3)|pancreas(1)|prostate(2)	28		Lung NSC(810;0.000135)|Prostate(74;0.055)|Breast(144;0.0707)|Ovarian(174;0.182)		OV - Ovarian serous cystadenocarcinoma(10;4.24e-37)		CACAGCTTCTCTTTGACATCT	0.552													C|||	7	0.00139776	0.0	0.0	5008	,	,		22203	0.0		0.0	False		,,,				2504	0.0072					dbGAP											2	Substitution - Missense(2)	breast(2)											104.0	88.0	93.0					5																	56777892		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS34163.1	5q11.2	2014-08-08			ENSG00000169067	ENSG00000169067			17780	protein-coding gene	gene with protein product		614835					Standard	NM_001017992		Approved	DKFZp686D0972	uc003jrm.3	Q562R1	OTTHUMG00000162330	ENST00000423391.1:c.643G>C	5.37:g.56777892C>G	ENSP00000416706:p.Glu215Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RPJ1|Q562R2|Q562S9|Q562X8	Missense_Mutation	SNP	pfam_Actin-like,smart_Actin-like,prints_Actin-like	p.E215Q	ENST00000423391.1	37	c.643	CCDS34163.1	5	.	.	.	.	.	.	.	.	.	.	C	16.66	3.186098	0.57909	.	.	ENSG00000169067	ENST00000423391	D	0.96200	-3.94	4.91	4.91	0.64330	.	0.000000	0.64402	D	0.000004	D	0.98492	0.9497	H	0.97051	3.93	0.53005	D	0.999963	D	0.76494	0.999	D	0.77557	0.99	D	0.99457	1.0942	10	0.87932	D	0	.	15.6308	0.76906	0.0:1.0:0.0:0.0	.	215	Q562R1	ACTBL_HUMAN	Q	215	ENSP00000416706:E215Q	ENSP00000416706:E215Q	E	-	1	0	ACTBL2	56813649	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.645000	0.83430	2.544000	0.85801	0.655000	0.94253	GAG	ACTBL2	-	pfam_Actin-like,smart_Actin-like	ENSG00000169067		0.552	ACTBL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACTBL2	HGNC	protein_coding	OTTHUMT00000368579.1	72	0.00	0	C	NM_001017992		56777892	56777892	-1	no_errors	ENST00000423391	ensembl	human	known	69_37n	missense	44	31.25	20	SNP	1.000	G
CAT	847	genome.wustl.edu	37	11	34490057	34490058	+	Intron	INS	-	-	A	rs534253738|rs371396899		TCGA-A2-A04V-01A-21W-A050-09	TCGA-A2-A04V-10A-01W-A055-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	89501861-2778-4b88-9a44-939fed99850d	5a514786-920b-4f35-932d-c2116fdea598	g.chr11:34490057_34490058insA	ENST00000241052.4	+	11	1523					NM_001752.3	NP_001743.1	P04040	CATA_HUMAN	catalase						aerobic respiration (GO:0009060)|cellular response to growth factor stimulus (GO:0071363)|cholesterol metabolic process (GO:0008203)|hemoglobin metabolic process (GO:0020027)|hydrogen peroxide catabolic process (GO:0042744)|menopause (GO:0042697)|negative regulation of apoptotic process (GO:0043066)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|nucleobase-containing small molecule metabolic process (GO:0055086)|osteoblast differentiation (GO:0001649)|positive regulation of cell division (GO:0051781)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|protein homotetramerization (GO:0051289)|protein tetramerization (GO:0051262)|purine nucleobase metabolic process (GO:0006144)|purine nucleotide catabolic process (GO:0006195)|response to hyperoxia (GO:0055093)|response to hypoxia (GO:0001666)|response to reactive oxygen species (GO:0000302)|response to vitamin E (GO:0033197)|small molecule metabolic process (GO:0044281)|triglyceride metabolic process (GO:0006641)|ureteric bud development (GO:0001657)|UV protection (GO:0009650)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|lysosome (GO:0005764)|membrane (GO:0016020)|mitochondrial intermembrane space (GO:0005758)|peroxisomal matrix (GO:0005782)|peroxisomal membrane (GO:0005778)|peroxisome (GO:0005777)|plasma membrane (GO:0005886)	aminoacylase activity (GO:0004046)|antioxidant activity (GO:0016209)|catalase activity (GO:0004096)|enzyme binding (GO:0019899)|heme binding (GO:0020037)|metal ion binding (GO:0046872)|NADP binding (GO:0050661)|oxidoreductase activity, acting on peroxide as acceptor (GO:0016684)|protein homodimerization activity (GO:0042803)|receptor binding (GO:0005102)			breast(1)|cervix(2)|endometrium(3)|kidney(2)|large_intestine(6)|lung(5)|ovary(2)|pancreas(1)|stomach(1)|urinary_tract(3)	26		Lung NSC(402;2.76e-08)|Acute lymphoblastic leukemia(5;0.00143)|all_hematologic(20;0.0116)|Melanoma(852;0.027)		BRCA - Breast invasive adenocarcinoma(625;0.000995)	Fomepizole(DB01213)	TAAGAGAACTTAAAAAAAAAAA	0.396																																						dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			AY028632	CCDS7891.1	11p13	2012-10-02			ENSG00000121691	ENSG00000121691	1.11.1.6		1516	protein-coding gene	gene with protein product		115500					Standard	NM_001752		Approved		uc001mvm.3	P04040	OTTHUMG00000044353	ENST00000241052.4:c.1434+115->A	11.37:g.34490068_34490068dupA		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K6C0|B2RCZ9|D3DR07|Q2M1U4|Q4VXX5|Q9BWT9|Q9UC85	RNA	INS	-	NULL	ENST00000241052.4	37	NULL	CCDS7891.1	11																																																																																			CAT	-	-	ENSG00000121691		0.396	CAT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CAT	HGNC	protein_coding	OTTHUMT00000103197.2	60	0.00	0	-	NM_001752		34490057	34490058	+1	no_errors	ENST00000525707	ensembl	human	putative	69_37n	rna	31	11.43	4	INS	0.001:0.000	A
CHD9	80205	genome.wustl.edu	37	16	53190227	53190227	+	Missense_Mutation	SNP	T	T	G			TCGA-A2-A04V-01A-21W-A050-09	TCGA-A2-A04V-10A-01W-A055-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	89501861-2778-4b88-9a44-939fed99850d	5a514786-920b-4f35-932d-c2116fdea598	g.chr16:53190227T>G	ENST00000398510.3	+	1	313	c.226T>G	c.(226-228)Tca>Gca	p.S76A	CHD9_ENST00000566029.1_Missense_Mutation_p.S76A|CHD9_ENST00000447540.1_Missense_Mutation_p.S76A|CHD9_ENST00000564845.1_Missense_Mutation_p.S76A			Q3L8U1	CHD9_HUMAN	chromodomain helicase DNA binding protein 9	76					cellular lipid metabolic process (GO:0044255)|chromatin modification (GO:0016568)|regulation of transcription, DNA-templated (GO:0006355)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)	p.S76A(2)		NS(1)|breast(4)|central_nervous_system(1)|endometrium(5)|kidney(6)|large_intestine(21)|lung(32)|ovary(2)|prostate(2)|skin(2)|stomach(1)|urinary_tract(1)	78		all_cancers(37;0.0212)				TCAATTTGATTCAATAAAATT	0.363																																						dbGAP											2	Substitution - Missense(2)	breast(2)											85.0	80.0	82.0					16																	53190227		1861	4094	5955	-	-	-	SO:0001583	missense	0			AK022240	CCDS45485.1	16q12.2	2006-04-12				ENSG00000177200			25701	protein-coding gene	gene with protein product						9205841	Standard	XM_005256168		Approved	FLJ12178, KIAA0308, BC022889	uc002egy.3	Q3L8U1		ENST00000398510.3:c.226T>G	16.37:g.53190227T>G	ENSP00000381522:p.Ser76Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RTU2|B9ZVQ0|O15025|Q1WF12|Q6DTK9|Q9H9V7|Q9UHM2	Missense_Mutation	SNP	pfam_SNF2_N,pfam_BRK_domain,pfam_Chromo_domain,pfam_Helicase_C,pfam_DNA/RNA_helicase_DEAD/DEAH_N,superfamily_Chromodomain-like,smart_Chromo_domain/shadow,smart_Helicase_ATP-bd,smart_Helicase_C,smart_BRK_domain,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,pfscan_Chromo_domain/shadow	p.S76A	ENST00000398510.3	37	c.226		16	.	.	.	.	.	.	.	.	.	.	T	15.32	2.799889	0.50208	.	.	ENSG00000177200	ENST00000447540;ENST00000398510	T;T	0.72394	-0.65;-0.65	5.84	3.55	0.40652	.	0.000000	0.51477	D	0.000090	T	0.56746	0.2006	L	0.47716	1.5	0.32703	N	0.512573	B;B;P;B	0.36837	0.013;0.008;0.571;0.013	B;B;B;B	0.33454	0.023;0.01;0.164;0.023	T	0.60999	-0.7151	10	0.21014	T	0.42	-8.059	8.096	0.30829	0.1204:0.0661:0.0:0.8134	.	76;76;76;76	Q3L8U1-3;Q3L8U1;Q8NAR9;Q3L8U1-2	.;CHD9_HUMAN;.;.	A	76	ENSP00000396345:S76A;ENSP00000381522:S76A	ENSP00000381522:S76A	S	+	1	0	CHD9	51747728	1.000000	0.71417	0.997000	0.53966	0.996000	0.88848	2.113000	0.41902	1.001000	0.39076	0.528000	0.53228	TCA	CHD9	-	NULL	ENSG00000177200		0.363	CHD9-020	KNOWN	basic	protein_coding	CHD9	HGNC	protein_coding	OTTHUMT00000422345.1	140	0.00	0	T	NM_025134		53190227	53190227	+1	no_errors	ENST00000398510	ensembl	human	known	69_37n	missense	16	74.60	47	SNP	0.982	G
CPAMD8	27151	genome.wustl.edu	37	19	17131150	17131150	+	Missense_Mutation	SNP	G	G	C			TCGA-A2-A04V-01A-21W-A050-09	TCGA-A2-A04V-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	89501861-2778-4b88-9a44-939fed99850d	5a514786-920b-4f35-932d-c2116fdea598	g.chr19:17131150G>C	ENST00000443236.1	-	3	430	c.399C>G	c.(397-399)atC>atG	p.I133M	CPAMD8_ENST00000388925.4_Missense_Mutation_p.I86M	NM_015692.2	NP_056507.2	Q8IZJ3	CPMD8_HUMAN	C3 and PZP-like, alpha-2-macroglobulin domain containing 8	86						extracellular space (GO:0005615)|plasma membrane (GO:0005886)	serine-type endopeptidase inhibitor activity (GO:0004867)	p.I133M(2)		breast(11)|central_nervous_system(3)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(17)|lung(14)|ovary(7)|pancreas(2)|prostate(4)|skin(5)	82						CCTTGAGTTTGATTGTCCCTT	0.398																																						dbGAP											2	Substitution - Missense(2)	breast(2)											131.0	132.0	132.0					19																	17131150		1824	4082	5906	-	-	-	SO:0001583	missense	0			AY101765	CCDS42519.1	19p13.12	2008-02-05			ENSG00000160111	ENSG00000160111			23228	protein-coding gene	gene with protein product		608841				10574462	Standard	NM_015692		Approved	KIAA1283, VIP, K-CAP	uc002nfb.3	Q8IZJ3	OTTHUMG00000133549	ENST00000443236.1:c.399C>G	19.37:g.17131150G>C	ENSP00000402505:p.Ile133Met	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8NC09|Q9ULD7	Nonsense_Mutation	SNP	pfam_A2M_comp,pfam_A2M_N_2,pfam_Methyltransf_FA,pfam_Macroglobln_a2,pfam_A-macroglobulin_rcpt-bd,pfam_A2M_N,pfam_MacrogloblnA2_thiol-ester-bond,pfam_Kazal-type_dom,pfam_Prot_inh_Kazal,superfamily_Terpenoid_cyclase/PrenylTrfase,superfamily_A-macroglobulin_rcpt-bd,smart_Prot_inh_Kazal	p.S144*	ENST00000443236.1	37	c.431	CCDS42519.1	19	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	11.32|11.32	1.604011|1.604011	0.28534|0.28534	.|.	.|.	ENSG00000160111|ENSG00000160111	ENST00000291440;ENST00000388925|ENST00000443236	T;T|.	0.53423|.	0.62;0.63|.	2.38|2.38	1.28|1.28	0.21552|0.21552	.|.	0.093234|.	0.41396|.	U|.	0.000892|.	T|.	0.38295|.	0.1035|.	L|L	0.50333|0.50333	1.59|1.59	0.24293|0.24293	N|N	0.995159|0.995159	P|.	0.46395|.	0.877|.	B|.	0.39185|.	0.293|.	T|.	0.27123|.	-1.0083|.	10|.	0.62326|.	D|.	0.03|.	.|.	5.5075|5.5075	0.16862|0.16862	0.4027:0.0:0.5973:0.0|0.4027:0.0:0.5973:0.0	.|.	86|.	Q8IZJ3|.	CPMD8_HUMAN|.	M|X	133;86|144	ENSP00000291440:I133M;ENSP00000373577:I86M|.	ENSP00000291440:I133M|.	I|S	-|-	3|2	3|0	CPAMD8|CPAMD8	16992150|16992150	0.998000|0.998000	0.40836|0.40836	0.999000|0.999000	0.59377|0.59377	0.986000|0.986000	0.74619|0.74619	0.176000|0.176000	0.16782|0.16782	1.067000|1.067000	0.40740|0.40740	0.462000|0.462000	0.41574|0.41574	ATC|TCA	CPAMD8	-	NULL	ENSG00000160111		0.398	CPAMD8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CPAMD8	HGNC	protein_coding	OTTHUMT00000257531.2	96	0.00	0	G	NM_015692		17131150	17131150	-1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000443236	ensembl	human	known	69_37n	nonsense	56	32.53	27	SNP	1.000	C
DNM1P46	196968	genome.wustl.edu	37	15	100340123	100340125	+	RNA	DEL	AGA	AGA	-	rs368425453		TCGA-A2-A04V-01A-21W-A050-09	TCGA-A2-A04V-10A-01W-A055-09	AGA	AGA					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	89501861-2778-4b88-9a44-939fed99850d	5a514786-920b-4f35-932d-c2116fdea598	g.chr15:100340123_100340125delAGA	ENST00000341853.1	-	0	801_803					NR_003260.1		Q6ZS02	DMP46_HUMAN	DNM1 pseudogene 46							microtubule (GO:0005874)	GTPase activity (GO:0003924)										AGCAGCTCCGAGAAGATGAACTC	0.611																																						dbGAP											0																																										-	-	-			0			AJ576275		15q26.3	2013-04-25			ENSG00000182397	ENSG00000182397			35199	pseudogene	pseudogene			"""chromosome 15 open reading frame 51"""	DNM1DN14@, C15orf51			Standard	NR_003260		Approved	DNM1DN14.2, FLJ45937, DKFZp434I1020	uc021sxl.1	Q6ZS02	OTTHUMG00000149852		15.37:g.100340126_100340128delAGA		Somatic		WXS	Illumina GAIIx	Phase_IV	Q3ZCN3	RNA	DEL	-	NULL	ENST00000341853.1	37	NULL		15																																																																																			DNM1P46	-	-	ENSG00000182397		0.611	DNM1P46-002	KNOWN	basic	processed_transcript	DNM1P46	HGNC	pseudogene	OTTHUMT00000313543.1	13	0.00	0	AGA	NR_003260		100340123	100340125	-1	no_errors	ENST00000341853	ensembl	human	known	69_37n	rna	10	23.08	3	DEL	0.899:0.883:0.880	-
DRP2	1821	genome.wustl.edu	37	X	100497359	100497359	+	Missense_Mutation	SNP	G	G	A			TCGA-A2-A04V-01A-21W-A050-09	TCGA-A2-A04V-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	89501861-2778-4b88-9a44-939fed99850d	5a514786-920b-4f35-932d-c2116fdea598	g.chrX:100497359G>A	ENST00000395209.3	+	8	1401	c.874G>A	c.(874-876)Gtg>Atg	p.V292M	DRP2_ENST00000402866.1_Missense_Mutation_p.V292M|DRP2_ENST00000538510.1_Missense_Mutation_p.V292M|DRP2_ENST00000541709.1_Missense_Mutation_p.V214M	NM_001939.2	NP_001930.2	Q13474	DRP2_HUMAN	dystrophin related protein 2	292					central nervous system development (GO:0007417)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|zinc ion binding (GO:0008270)	p.V289M(1)		breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(10)|lung(10)|ovary(3)|prostate(1)|skin(2)|urinary_tract(2)	31						AGTAAAGTTGGTGAATGATCT	0.473																																						dbGAP											1	Substitution - Missense(1)	breast(1)											195.0	182.0	186.0					X																	100497359		2203	4300	6503	-	-	-	SO:0001583	missense	0			U43519	CCDS14480.2, CCDS55465.1	Xq22	2008-02-05			ENSG00000102385	ENSG00000102385			3032	protein-coding gene	gene with protein product		300052				8640231	Standard	NM_001939		Approved		uc004egz.2	Q13474	OTTHUMG00000022020	ENST00000395209.3:c.874G>A	X.37:g.100497359G>A	ENSP00000378635:p.Val292Met	Somatic		WXS	Illumina GAIIx	Phase_IV	A6ZKI5|A8K1B0|B1B1F3|B4DIZ0	Missense_Mutation	SNP	pfam_EF-hand_dom_typ1,pfam_EF-hand_dom_typ2,pfam_Znf_ZZ,pfam_Spectrin_repeat,pfam_WW_Rsp5_WWP,superfamily_WW_Rsp5_WWP,smart_Spectrin/alpha-actinin,smart_WW_Rsp5_WWP,smart_Znf_ZZ,pirsf_Dystrophin-related_2,pfscan_WW_Rsp5_WWP,pfscan_Znf_ZZ	p.V292M	ENST00000395209.3	37	c.874	CCDS14480.2	X	.	.	.	.	.	.	.	.	.	.	G	17.99	3.522093	0.64747	.	.	ENSG00000102385	ENST00000402866;ENST00000395209;ENST00000541709;ENST00000538510	T;T;T;T	0.54866	0.55;0.55;0.55;0.55	5.29	5.29	0.74685	.	0.059922	0.64402	D	0.000002	T	0.57651	0.2068	L	0.42245	1.32	0.37436	D	0.914249	P	0.42123	0.771	P	0.48738	0.588	T	0.63603	-0.6600	10	0.48119	T	0.1	-12.9237	18.0199	0.89252	0.0:0.0:1.0:0.0	.	292	Q13474	DRP2_HUMAN	M	292;292;214;292	ENSP00000385038:V292M;ENSP00000378635:V292M;ENSP00000444752:V214M;ENSP00000441051:V292M	ENSP00000362007:V292M	V	+	1	0	DRP2	100384015	1.000000	0.71417	0.995000	0.50966	0.980000	0.70556	5.203000	0.65174	2.189000	0.69895	0.594000	0.82650	GTG	DRP2	-	pfam_Spectrin_repeat,smart_Spectrin/alpha-actinin,pirsf_Dystrophin-related_2	ENSG00000102385		0.473	DRP2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	DRP2	HGNC	protein_coding	OTTHUMT00000057522.3	102	0.00	0	G	NM_001939		100497359	100497359	+1	no_errors	ENST00000395209	ensembl	human	known	69_37n	missense	80	16.67	16	SNP	1.000	A
EML3	256364	genome.wustl.edu	37	11	62371661	62371661	+	Silent	SNP	C	C	T			TCGA-A2-A04V-01A-21W-A050-09	TCGA-A2-A04V-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	89501861-2778-4b88-9a44-939fed99850d	5a514786-920b-4f35-932d-c2116fdea598	g.chr11:62371661C>T	ENST00000394773.2	-	17	2302	c.1995G>A	c.(1993-1995)ttG>ttA	p.L665L	EML3_ENST00000278845.4_Silent_p.L666L|MTA2_ENST00000527204.1_5'Flank|EML3_ENST00000529309.1_Silent_p.L665L|EML3_ENST00000531557.1_Silent_p.L448L|EML3_ENST00000494176.2_Silent_p.L637L|RP11-831H9.3_ENST00000532626.1_RNA|MTA2_ENST00000278823.2_5'Flank|EML3_ENST00000438258.1_5'Flank	NM_153265.2	NP_694997.2	Q32P44	EMAL3_HUMAN	echinoderm microtubule associated protein like 3	665						cytoplasm (GO:0005737)|microtubule (GO:0005874)		p.L665L(2)		biliary_tract(1)|breast(3)|endometrium(4)|kidney(2)|large_intestine(1)|lung(11)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	26						TCTCTGTGTCCAAAACCAACC	0.582																																						dbGAP											2	Substitution - coding silent(2)	breast(2)											84.0	70.0	74.0					11																	62371661		2202	4299	6501	-	-	-	SO:0001819	synonymous_variant	0			AK093146	CCDS8023.2	11q12.3	2013-01-10			ENSG00000149499	ENSG00000149499		"""WD repeat domain containing"""	26666	protein-coding gene	gene with protein product						15225882, 14744259	Standard	NM_153265		Approved	FLJ35827, ELP95	uc001ntu.1	Q32P44	OTTHUMG00000149817	ENST00000394773.2:c.1995G>A	11.37:g.62371661C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q6ZQW7|Q8NA55	Missense_Mutation	SNP	pfam_HELP,pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.G660R	ENST00000394773.2	37	c.1978	CCDS8023.2	11	.	.	.	.	.	.	.	.	.	.	C	5.605	0.296375	0.10622	.	.	ENSG00000149499	ENST00000394776	.	.	.	5.2	3.32	0.38043	.	.	.	.	.	T	0.59307	0.2184	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.54323	-0.8311	4	.	.	.	-12.5023	9.8276	0.40921	0.0:0.8307:0.0:0.1693	.	.	.	.	R	660	.	.	G	-	1	0	EML3	62128237	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	2.037000	0.41174	0.696000	0.31696	-0.300000	0.09419	GGA	EML3	-	superfamily_WD40_repeat_dom,pfscan_WD40_repeat_dom	ENSG00000149499		0.582	EML3-001	KNOWN	NAGNAG_splice_site|basic|appris_candidate|CCDS	protein_coding	EML3	HGNC	protein_coding	OTTHUMT00000313432.1	34	0.00	0	C	NM_153265		62371661	62371661	-1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000394776	ensembl	human	novel	69_37n	missense	16	42.86	12	SNP	1.000	T
FANCC	2176	genome.wustl.edu	37	9	98011555	98011555	+	Missense_Mutation	SNP	C	C	A			TCGA-A2-A04V-01A-21W-A050-09	TCGA-A2-A04V-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	89501861-2778-4b88-9a44-939fed99850d	5a514786-920b-4f35-932d-c2116fdea598	g.chr9:98011555C>A	ENST00000289081.3	-	2	273	c.19G>T	c.(19-21)Gat>Tat	p.D7Y	FANCC_ENST00000375305.1_Missense_Mutation_p.D7Y	NM_000136.2	NP_000127.2	Q00597	FANCC_HUMAN	Fanconi anemia, complementation group C	7					DNA repair (GO:0006281)|germ cell development (GO:0007281)|myeloid cell homeostasis (GO:0002262)|nucleotide-excision repair (GO:0006289)|protein complex assembly (GO:0006461)|removal of superoxide radicals (GO:0019430)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|Fanconi anaemia nuclear complex (GO:0043240)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)		p.D7Y(2)		kidney(1)|skin(1)|upper_aerodigestive_tract(1)	3		Acute lymphoblastic leukemia(62;0.138)				CAAGAAAGATCTACTGAATCT	0.458			"""D, Mis, N, F, S"""			"""AML, leukemia"""		Involved in tolerance or repair of DNA crosslinks	Fanconi Anemia																													dbGAP	yes	Rec		Fanconi anaemia C	9	9q22.3	2176	"""Fanconi anemia, complementation group C"""		L	2	Substitution - Missense(2)	breast(2)											82.0	74.0	77.0					9																	98011555		2203	4300	6503	-	-	-	SO:0001583	missense	0	Familial Cancer Database	Pancytopenia Dysmelia, FA (several complementation groups)	BC006303	CCDS35071.1, CCDS75861.1	9q22.3	2014-09-17			ENSG00000158169	ENSG00000158169		"""Fanconi anemia, complementation groups"""	3584	protein-coding gene	gene with protein product		613899		FACC		1303234	Standard	NM_001243743		Approved	FAC, FA3	uc004avh.3	Q00597	OTTHUMG00000020279	ENST00000289081.3:c.19G>T	9.37:g.98011555C>A	ENSP00000289081:p.Asp7Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV	B1ALR8	Missense_Mutation	SNP	pfam_Fanconi,pirsf_Fanconi,prints_Fanconi	p.D7Y	ENST00000289081.3	37	c.19	CCDS35071.1	9	.	.	.	.	.	.	.	.	.	.	C	12.98	2.099981	0.37048	.	.	ENSG00000158169	ENST00000289081;ENST00000375305;ENST00000433829	T;T;T	0.52295	0.67;0.67;0.67	5.13	0.972	0.19704	.	0.686516	0.14218	N	0.333605	T	0.34454	0.0898	L	0.34521	1.04	0.09310	N	1	P;P	0.50369	0.759;0.934	P;P	0.44732	0.454;0.459	T	0.18366	-1.0339	10	0.19590	T	0.45	-0.0894	7.7745	0.29029	0.0:0.4834:0.372:0.1446	.	7;7	B1ALR7;Q00597	.;FANCC_HUMAN	Y	7	ENSP00000289081:D7Y;ENSP00000364454:D7Y;ENSP00000406908:D7Y	ENSP00000289081:D7Y	D	-	1	0	FANCC	97051376	0.001000	0.12720	0.013000	0.15412	0.971000	0.66376	0.956000	0.29202	0.080000	0.16959	-0.181000	0.13052	GAT	FANCC	-	pfam_Fanconi,pirsf_Fanconi	ENSG00000158169		0.458	FANCC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FANCC	HGNC	protein_coding	OTTHUMT00000053219.1	102	0.00	0	C	NM_000136		98011555	98011555	-1	no_errors	ENST00000289081	ensembl	human	known	69_37n	missense	29	41.18	21	SNP	0.005	A
GPS2	2874	genome.wustl.edu	37	17	7217849	7217850	+	Frame_Shift_Ins	INS	-	-	T			TCGA-A2-A04V-01A-21W-A050-09	TCGA-A2-A04V-10A-01W-A055-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	89501861-2778-4b88-9a44-939fed99850d	5a514786-920b-4f35-932d-c2116fdea598	g.chr17:7217849_7217850insT	ENST00000380728.2	-	3	461_462	c.161_162insA	c.(160-162)aagfs	p.K54fs	GPS2_ENST00000389167.5_Frame_Shift_Ins_p.K54fs|RP11-542C16.2_ENST00000575474.1_3'UTR|GPS2_ENST00000391950.3_Frame_Shift_Ins_p.K54fs|NEURL4_ENST00000574120.1_5'Flank			Q13227	GPS2_HUMAN	G protein pathway suppressor 2	54					cell cycle (GO:0007049)|inactivation of MAPK activity (GO:0000188)|JNK cascade (GO:0007254)|negative regulation of JNK cascade (GO:0046329)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)	nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	GTPase inhibitor activity (GO:0005095)|transcription corepressor activity (GO:0003714)			breast(1)|central_nervous_system(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(1)|ovary(2)|pancreas(1)|prostate(1)|stomach(1)|urinary_tract(4)	24		Prostate(122;0.157)				cttccatctcctttttcttcct	0.45																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			U28963	CCDS11100.1	17p13.1	2006-04-29			ENSG00000132522	ENSG00000132522			4550	protein-coding gene	gene with protein product		601935				8943324	Standard	NM_004489		Approved		uc002gfx.1	Q13227	OTTHUMG00000102198	ENST00000380728.2:c.162dupA	17.37:g.7217854_7217854dupT	ENSP00000370104:p.Lys54fs	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DXA1|Q6FHM8	Frame_Shift_Ins	INS	NULL	p.E55fs	ENST00000380728.2	37	c.162_161	CCDS11100.1	17																																																																																			GPS2	-	NULL	ENSG00000132522		0.450	GPS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPS2	HGNC	protein_coding	OTTHUMT00000220048.4	114	0.00	0	-	NM_004489		7217849	7217850	-1	no_errors	ENST00000380728	ensembl	human	known	69_37n	frame_shift_ins	41	51.19	43	INS	1.000:1.000	T
GRIK5	2901	genome.wustl.edu	37	19	42566998	42566998	+	Missense_Mutation	SNP	A	A	T			TCGA-A2-A04V-01A-21W-A050-09	TCGA-A2-A04V-10A-01W-A055-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	89501861-2778-4b88-9a44-939fed99850d	5a514786-920b-4f35-932d-c2116fdea598	g.chr19:42566998A>T	ENST00000262895.3	-	3	253	c.254T>A	c.(253-255)aTc>aAc	p.I85N	GRIK5_ENST00000593562.1_Missense_Mutation_p.I85N|GRIK5_ENST00000301218.4_Missense_Mutation_p.I85N	NM_002088.4	NP_002079.3	Q16478	GRIK5_HUMAN	glutamate receptor, ionotropic, kainate 5	85					cellular response to glucose stimulus (GO:0071333)|establishment of localization in cell (GO:0051649)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|positive regulation of neuron apoptotic process (GO:0043525)|protein retention in ER lumen (GO:0006621)|receptor clustering (GO:0043113)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of synaptic vesicle fusion to presynaptic membrane (GO:0031630)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)	cell junction (GO:0030054)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|kainate selective glutamate receptor complex (GO:0032983)|perikaryon (GO:0043204)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)|terminal bouton (GO:0043195)	extracellular-glutamate-gated ion channel activity (GO:0005234)|kainate selective glutamate receptor activity (GO:0015277)	p.I85N(4)		breast(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|liver(1)|lung(11)|ovary(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	35		Prostate(69;0.059)				TTTGGGTAAGATCTGACACAC	0.617																																						dbGAP											4	Substitution - Missense(4)	breast(4)											102.0	83.0	89.0					19																	42566998		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS12595.1	19q13.2	2012-08-29			ENSG00000105737	ENSG00000105737		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4583	protein-coding gene	gene with protein product		600283		GRIK2		7527545	Standard	NM_002088		Approved	GluK5, KA2	uc002osj.2	Q16478	OTTHUMG00000044573	ENST00000262895.3:c.254T>A	19.37:g.42566998A>T	ENSP00000262895:p.Ile85Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8WWG8	Missense_Mutation	SNP	pfam_ANF_lig-bd_rcpt,pfam_Iontro_glu_rcpt,pfam_Glu_rcpt_Glu/Gly-bd,pfam_SBP_bac_3,smart_Iontro_glu_rcpt,smart_Glu_rcpt_Glu/Gly-bd,prints_NMDA_rcpt	p.I85N	ENST00000262895.3	37	c.254	CCDS12595.1	19	.	.	.	.	.	.	.	.	.	.	A	25.5	4.646474	0.87958	.	.	ENSG00000105737	ENST00000262895;ENST00000301218	T;T	0.25414	1.8;1.8	5.71	5.71	0.89125	Extracellular ligand-binding receptor (1);	0.127509	0.52532	D	0.000076	T	0.49712	0.1573	M	0.68317	2.08	0.47737	D	0.999508	D	0.71674	0.998	D	0.79784	0.993	T	0.50775	-0.8788	10	0.66056	D	0.02	.	14.9714	0.71238	1.0:0.0:0.0:0.0	.	85	Q16478	GRIK5_HUMAN	N	85	ENSP00000262895:I85N;ENSP00000301218:I85N	ENSP00000262895:I85N	I	-	2	0	GRIK5	47258838	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	8.748000	0.91615	2.191000	0.70037	0.523000	0.50628	ATC	GRIK5	-	pfam_ANF_lig-bd_rcpt	ENSG00000105737		0.617	GRIK5-002	KNOWN	basic|appris_principal|CCDS	protein_coding	GRIK5	HGNC	protein_coding	OTTHUMT00000463453.1	89	0.00	0	A			42566998	42566998	-1	no_errors	ENST00000301218	ensembl	human	known	69_37n	missense	38	44.12	30	SNP	1.000	T
MROH2B	133558	genome.wustl.edu	37	5	41058282	41058282	+	Silent	SNP	G	G	A			TCGA-A2-A04V-01A-21W-A050-09	TCGA-A2-A04V-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	89501861-2778-4b88-9a44-939fed99850d	5a514786-920b-4f35-932d-c2116fdea598	g.chr5:41058282G>A	ENST00000399564.4	-	7	1089	c.639C>T	c.(637-639)caC>caT	p.H213H	MROH2B_ENST00000506092.2_De_novo_Start_OutOfFrame	NM_173489.4	NP_775760.3	Q7Z745	MRO2B_HUMAN	maestro heat-like repeat family member 2B	213								p.H213H(2)									CCGTGGGCCCGTGGGCCTTAA	0.502																																						dbGAP											2	Substitution - coding silent(2)	breast(2)											56.0	55.0	55.0					5																	41058282		1914	4132	6046	-	-	-	SO:0001819	synonymous_variant	0				CCDS47202.1	5p13.1	2012-12-19	2012-12-19	2012-12-19	ENSG00000171495	ENSG00000171495		"""maestro heat-like repeat containing"""	26857	protein-coding gene	gene with protein product			"""HEAT repeat family member 7B2"""	HEATR7B2		12477932	Standard	NM_173489		Approved	DKFZp781F0822, FLJ40243	uc003jmj.4	Q7Z745	OTTHUMG00000162151	ENST00000399564.4:c.639C>T	5.37:g.41058282G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q68DM1|Q7Z4U4|Q8N7X3	Silent	SNP	superfamily_ARM-type_fold	p.H213	ENST00000399564.4	37	c.639	CCDS47202.1	5																																																																																			HEATR7B2	-	superfamily_ARM-type_fold	ENSG00000171495		0.502	MROH2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HEATR7B2	HGNC	protein_coding	OTTHUMT00000367558.2	143	0.00	0	G	NM_173489		41058282	41058282	-1	no_errors	ENST00000399564	ensembl	human	known	69_37n	silent	68	40.87	47	SNP	0.930	A
HIST1H2AK	8330	genome.wustl.edu	37	6	27805932	27805932	+	Silent	SNP	C	C	T			TCGA-A2-A04V-01A-21W-A050-09	TCGA-A2-A04V-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	89501861-2778-4b88-9a44-939fed99850d	5a514786-920b-4f35-932d-c2116fdea598	g.chr6:27805932C>T	ENST00000330180.2	-	1	185	c.186G>A	c.(184-186)gaG>gaA	p.E62E	HIST1H2BN_ENST00000396980.3_5'Flank|HIST1H2BN_ENST00000606613.1_5'Flank	NM_003510.2	NP_003501.1	P0C0S8	H2A1_HUMAN	histone cluster 1, H2ak	62						extracellular vesicular exosome (GO:0070062)|nucleosome (GO:0000786)|nucleus (GO:0005634)	DNA binding (GO:0003677)|enzyme binding (GO:0019899)	p.E62E(1)		breast(2)|endometrium(2)|kidney(1)|lung(3)|upper_aerodigestive_tract(2)	10						GTTCCAGGATCTCGGCGGTTA	0.662																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											66.0	69.0	68.0					6																	27805932		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			Z83739	CCDS4632.1	6p22.1	2011-01-27	2006-10-11	2003-02-28	ENSG00000184348	ENSG00000275221		"""Histones / Replication-dependent"""	4726	protein-coding gene	gene with protein product		602788	"""H2A histone family, member D"", ""histone 1, H2ak"""	H2AFD		9439656, 12408966	Standard	NM_003510		Approved	H2A/d	uc003njs.3	P0C0S8	OTTHUMG00000016382	ENST00000330180.2:c.186G>A	6.37:g.27805932C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	P02261|Q2M1R2|Q76PA6	Silent	SNP	pfam_Histone_core_D,pfam_CBFA_NFYB_domain,superfamily_Histone-fold,smart_Histone_H2A,prints_Histone_H2A	p.E62	ENST00000330180.2	37	c.186	CCDS4632.1	6																																																																																			HIST1H2AK	-	pfam_Histone_core_D,pfam_CBFA_NFYB_domain,superfamily_Histone-fold,smart_Histone_H2A,prints_Histone_H2A	ENSG00000184348		0.662	HIST1H2AK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HIST1H2AK	HGNC	protein_coding	OTTHUMT00000043814.1	128	0.00	0	C	NM_003510		27805932	27805932	-1	no_errors	ENST00000330180	ensembl	human	known	69_37n	silent	127	19.62	31	SNP	1.000	T
KANSL1	284058	genome.wustl.edu	37	17	44110510	44110511	+	Frame_Shift_Del	DEL	CA	CA	-			TCGA-A2-A04V-01A-21W-A050-09	TCGA-A2-A04V-10A-01W-A055-09	CA	CA					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	89501861-2778-4b88-9a44-939fed99850d	5a514786-920b-4f35-932d-c2116fdea598	g.chr17:44110510_44110511delCA	ENST00000262419.6	-	13	3242_3243	c.2772_2773delTG	c.(2770-2775)tgtgagfs	p.CE924fs	KANSL1_ENST00000572904.1_Frame_Shift_Del_p.CE924fs|KANSL1_ENST00000432791.1_Frame_Shift_Del_p.CE924fs|KANSL1_ENST00000574590.1_Frame_Shift_Del_p.CE924fs|KANSL1_ENST00000393476.3_Frame_Shift_Del_p.CE218fs|KANSL1_ENST00000575318.1_Frame_Shift_Del_p.CE860fs|RP11-669E14.6_ENST00000570454.1_RNA	NM_001193466.1	NP_001180395	Q7Z3B3	KANL1_HUMAN	KAT8 regulatory NSL complex subunit 1	924	Sufficient for interaction with KAT8.				chromatin organization (GO:0006325)|histone H4-K16 acetylation (GO:0043984)|histone H4-K5 acetylation (GO:0043981)|histone H4-K8 acetylation (GO:0043982)	histone acetyltransferase complex (GO:0000123)|MLL1 complex (GO:0071339)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)		p.C924fs*1(2)									TCCATCTCCTCACATTTGGCAT	0.614																																						dbGAP											2	Deletion - Frameshift(2)	breast(2)																																								-	-	-	SO:0001589	frameshift_variant	0			BX538006	CCDS11503.1, CCDS11503.2, CCDS74084.1	17q21.31	2012-02-20	2012-02-20	2012-02-20	ENSG00000120071	ENSG00000120071			24565	protein-coding gene	gene with protein product	"""centromere protein 36"""	612452	"""KIAA1267"""	KIAA1267		10574462	Standard	NM_015443		Approved	DKFZP727C091, MSL1v1, CENP-36, NSL1	uc002ikd.3	Q7Z3B3		ENST00000262419.6:c.2772_2773delTG	17.37:g.44110512_44110513delCA	ENSP00000262419:p.Cys924fs	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K5E4|Q6AW85|Q8IYH1|Q9BRH0|Q9NTE7|Q9UFT0|Q9ULF3	Frame_Shift_Del	DEL	NULL	p.C924fs	ENST00000262419.6	37	c.2773_2772	CCDS11503.1	17																																																																																			KANSL1	-	NULL	ENSG00000120071		0.614	KANSL1-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	KANSL1	HGNC	protein_coding	OTTHUMT00000440274.1	220	0.00	0	CA	NM_015443		44110510	44110511	-1	no_errors	ENST00000262419	ensembl	human	known	69_37n	frame_shift_del	114	35.91	65	DEL	1.000:1.000	-
KHDRBS1	10657	genome.wustl.edu	37	1	32495940	32495942	+	In_Frame_Del	DEL	GAG	GAG	-			TCGA-A2-A04V-01A-21W-A050-09	TCGA-A2-A04V-10A-01W-A055-09	GAG	GAG					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	89501861-2778-4b88-9a44-939fed99850d	5a514786-920b-4f35-932d-c2116fdea598	g.chr1:32495940_32495942delGAG	ENST00000327300.7	+	2	591_593	c.424_426delGAG	c.(424-426)gagdel	p.E143del	KHDRBS1_ENST00000492989.1_In_Frame_Del_p.E143del|KHDRBS1_ENST00000307714.8_3'UTR	NM_006559.1	NP_006550.1			KH domain containing, RNA binding, signal transduction associated 1											endometrium(4)|kidney(1)|large_intestine(3)|lung(5)|ovary(1)	14		Myeloproliferative disorder(586;0.0393)|all_neural(195;0.186)				AAAGGATGATGAGGAGAATTACT	0.345																																					Ovarian(173;401 1982 12359 31110 42403)	dbGAP											0																																										-	-	-	SO:0001651	inframe_deletion	0			U78971	CCDS350.1, CCDS60067.1	1p32	2008-07-18			ENSG00000121774	ENSG00000121774			18116	protein-coding gene	gene with protein product	"""GAP-associated tyrosine phosphoprotein p62 (Sam68)"""	602489				1374686, 10564820	Standard	NM_006559		Approved	Sam68, p62, FLJ34027	uc001bub.4	Q07666	OTTHUMG00000003921	ENST00000327300.7:c.424_426delGAG	1.37:g.32495943_32495945delGAG	ENSP00000313829:p.Glu143del	Somatic		WXS	Illumina GAIIx	Phase_IV		In_Frame_Del	DEL	pfam_KH_dom_type_1,smart_KH_dom,pfscan_KH_dom_type_1	p.E143in_frame_del	ENST00000327300.7	37	c.424_426	CCDS350.1	1																																																																																			KHDRBS1	-	NULL	ENSG00000121774		0.345	KHDRBS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KHDRBS1	HGNC	protein_coding	OTTHUMT00000011199.4	64	0.00	0	GAG	NM_006559		32495940	32495942	+1	no_errors	ENST00000327300	ensembl	human	known	69_37n	in_frame_del	38	28.30	15	DEL	1.000:0.998:0.666	-
KIAA0319L	79932	genome.wustl.edu	37	1	35936468	35936468	+	Missense_Mutation	SNP	G	G	A			TCGA-A2-A04V-01A-21W-A050-09	TCGA-A2-A04V-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	89501861-2778-4b88-9a44-939fed99850d	5a514786-920b-4f35-932d-c2116fdea598	g.chr1:35936468G>A	ENST00000325722.3	-	6	1343	c.1109C>T	c.(1108-1110)tCg>tTg	p.S370L	KIAA0319L_ENST00000485551.1_5'UTR	NM_024874.4	NP_079150.3	Q8IZA0	K319L_HUMAN	KIAA0319-like	370	PKD 1. {ECO:0000255|PROSITE- ProRule:PRU00151}.					cytoplasmic vesicle (GO:0031410)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)		p.S370L(2)		breast(1)|endometrium(2)|kidney(3)|large_intestine(7)|lung(12)|pancreas(1)|prostate(2)|skin(4)|stomach(1)|urinary_tract(1)	34		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0887)				ATTCACCTTCGATAGTTTGAG	0.403																																						dbGAP											2	Substitution - Missense(2)	breast(2)											153.0	141.0	145.0					1																	35936468		2203	4300	6503	-	-	-	SO:0001583	missense	0			AY163234	CCDS390.1	1p34.3	2008-10-24			ENSG00000142687	ENSG00000142687			30071	protein-coding gene	gene with protein product		613535				11347906	Standard	NM_024874		Approved	KIAA1837	uc001byx.3	Q8IZA0	OTTHUMG00000004370	ENST00000325722.3:c.1109C>T	1.37:g.35936468G>A	ENSP00000318406:p.Ser370Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	B1AN13|D3DPR8|O95010|Q6PJJ7|Q7L1C9|Q8N2B3|Q8NDA0|Q8WY39|Q8WYZ5|Q96IC3|Q96JJ0|Q9BUW6|Q9H7V0	Missense_Mutation	SNP	pfam_PKD/REJ-like,superfamily_PKD_dom,smart_PKD/Chitinase_dom,pfscan_MANSC,pfscan_PKD_dom	p.S370L	ENST00000325722.3	37	c.1109	CCDS390.1	1	.	.	.	.	.	.	.	.	.	.	G	20.7	4.034137	0.75617	.	.	ENSG00000142687	ENST00000325722;ENST00000426982;ENST00000440579	T;T;T	0.19250	2.31;2.7;2.16	6.04	6.04	0.98038	PKD/Chitinase domain (1);Fibronectin, type III (1);PKD/REJ-like protein (1);	0.101591	0.64402	D	0.000002	T	0.59046	0.2165	M	0.92122	3.275	0.80722	D	1	D;D;D	0.89917	1.0;1.0;0.997	D;D;P	0.91635	0.999;0.999;0.733	T	0.65874	-0.6062	10	0.59425	D	0.04	-12.1616	19.143	0.93452	0.0:0.0:1.0:0.0	.	370;370;370	Q8IZA0-2;B1AN14;Q8IZA0	.;.;K319L_HUMAN	L	370	ENSP00000318406:S370L;ENSP00000395883:S370L;ENSP00000407576:S370L	ENSP00000318406:S370L	S	-	2	0	KIAA0319L	35709055	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	5.770000	0.68873	2.873000	0.98535	0.561000	0.74099	TCG	KIAA0319L	-	pfam_PKD/REJ-like,smart_PKD/Chitinase_dom	ENSG00000142687		0.403	KIAA0319L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA0319L	HGNC	protein_coding	OTTHUMT00000012684.2	151	0.00	0	G	NM_024874		35936468	35936468	-1	no_errors	ENST00000325722	ensembl	human	known	69_37n	missense	121	12.32	17	SNP	1.000	A
LRIG2	9860	genome.wustl.edu	37	1	113616247	113616248	+	Frame_Shift_Ins	INS	-	-	C			TCGA-A2-A04V-01A-21W-A050-09	TCGA-A2-A04V-10A-01W-A055-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	89501861-2778-4b88-9a44-939fed99850d	5a514786-920b-4f35-932d-c2116fdea598	g.chr1:113616247_113616248insC	ENST00000361127.5	+	1	417_418	c.219_220insC	c.(220-222)cccfs	p.P74fs	RP11-31F15.2_ENST00000421157.1_lincRNA	NM_014813.1	NP_055628.1	O94898	LRIG2_HUMAN	leucine-rich repeats and immunoglobulin-like domains 2	74	LRRNT.				innervation (GO:0060384)|regulation of platelet-derived growth factor receptor signaling pathway (GO:0010640)|sensory perception of sound (GO:0007605)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(1)|endometrium(2)|kidney(7)|large_intestine(3)|lung(10)|ovary(4)|prostate(2)|stomach(1)|urinary_tract(1)	31	Lung SC(450;0.246)	all_cancers(81;1.56e-05)|all_epithelial(167;2.62e-05)|all_lung(203;0.000665)|Lung NSC(69;0.000986)		Lung(183;0.0279)|Colorectal(144;0.0885)|COAD - Colon adenocarcinoma(174;0.134)|all cancers(265;0.139)|Epithelial(280;0.143)|LUSC - Lung squamous cell carcinoma(189;0.15)		CGGGCTTGCTGCCCCCCGACAC	0.673											OREG0013684	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			AB018349	CCDS30808.1	1p13.1	2013-01-11			ENSG00000198799	ENSG00000198799		"""Immunoglobulin superfamily / I-set domain containing"""	20889	protein-coding gene	gene with protein product		608869					Standard	XM_005271369		Approved	KIAA0806	uc001edf.1	O94898	OTTHUMG00000012133	ENST00000361127.5:c.225dupC	1.37:g.113616253_113616253dupC	ENSP00000355396:p.Pro74fs	Somatic	1451	WXS	Illumina GAIIx	Phase_IV	Q9NSN2	Frame_Shift_Ins	INS	pfam_Ig_I-set,pfam_Leu-rich_rpt,pfam_Immunoglobulin,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	p.D75fs	ENST00000361127.5	37	c.219_220	CCDS30808.1	1																																																																																			LRIG2	-	NULL	ENSG00000198799		0.673	LRIG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRIG2	HGNC	protein_coding	OTTHUMT00000033549.2	13	0.00	0	-	NM_014813		113616247	113616248	+1	no_errors	ENST00000361127	ensembl	human	known	69_37n	frame_shift_ins	13	18.75	3	INS	1.000:1.000	C
MIF4GD	57409	genome.wustl.edu	37	17	73264205	73264206	+	Frame_Shift_Del	DEL	AC	AC	-			TCGA-A2-A04V-01A-21W-A050-09	TCGA-A2-A04V-10A-01W-A055-09	AC	AC					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	89501861-2778-4b88-9a44-939fed99850d	5a514786-920b-4f35-932d-c2116fdea598	g.chr17:73264205_73264206delAC	ENST00000325102.8	-	3	274_275	c.150_151delGT	c.(148-153)gtgttcfs	p.F51fs	MIF4GD_ENST00000579297.1_Frame_Shift_Del_p.F92fs|MIF4GD_ENST00000577542.1_Frame_Shift_Del_p.F92fs|MIF4GD_ENST00000245551.5_Frame_Shift_Del_p.F85fs|MIF4GD_ENST00000579119.1_Frame_Shift_Del_p.F51fs|MIF4GD_ENST00000578305.1_Intron|MIF4GD_ENST00000580571.1_Frame_Shift_Del_p.F51fs	NM_001242501.1	NP_001229430.1	A9UHW6	MI4GD_HUMAN	MIF4G domain containing	51	MIF4G.				regulation of translation (GO:0006417)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)	protein C-terminus binding (GO:0008022)|RNA binding (GO:0003723)	p.F85fs*17(2)		breast(2)|endometrium(1)|large_intestine(4)|lung(2)|ovary(1)	10	all_cancers(13;1.25e-07)|all_epithelial(9;2.63e-08)|Breast(9;1.06e-07)		all cancers(21;3.02e-07)|Epithelial(20;2.92e-06)			TCCTTGCTGAACACACAGTCCT	0.545																																						dbGAP											2	Deletion - Frameshift(2)	breast(2)																																								-	-	-	SO:0001589	frameshift_variant	0			CR605810	CCDS11719.1, CCDS56044.1, CCDS58598.1	17q25.1	2005-12-15		2005-12-15					24030	protein-coding gene	gene with protein product		612072		MIFD			Standard	NM_001242498		Approved	AD023, MGC45027	uc002jnq.3	A9UHW6		ENST00000325102.8:c.150_151delGT	17.37:g.73264209_73264210delAC	ENSP00000321625:p.Phe51fs	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DUM7|Q8N4Q5|Q9HBL5	Frame_Shift_Del	DEL	pfam_MIF4G-like_typ-3,superfamily_ARM-type_fold	p.F92fs	ENST00000325102.8	37	c.274_273	CCDS56044.1	17																																																																																			MIF4GD	-	pfam_MIF4G-like_typ-3,superfamily_ARM-type_fold	ENSG00000125457		0.545	MIF4GD-002	KNOWN	basic|appris_principal|CCDS	protein_coding	MIF4GD	HGNC	protein_coding	OTTHUMT00000446671.1	43	0.00	0	AC	NM_020679		73264205	73264206	-1	no_errors	ENST00000577542	ensembl	human	known	69_37n	frame_shift_del	33	44.44	28	DEL	1.000:0.995	-
MRGPRX3	117195	genome.wustl.edu	37	11	18158850	18158850	+	Missense_Mutation	SNP	C	C	T			TCGA-A2-A04V-01A-21W-A050-09	TCGA-A2-A04V-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	89501861-2778-4b88-9a44-939fed99850d	5a514786-920b-4f35-932d-c2116fdea598	g.chr11:18158850C>T	ENST00000396275.2	+	3	462	c.101C>T	c.(100-102)aCg>aTg	p.T34M		NM_054031.3	NP_473372.3	Q96LB0	MRGX3_HUMAN	MAS-related GPR, member X3	34						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)	p.T34M(2)		NS(1)|breast(2)|endometrium(2)|kidney(1)|large_intestine(5)|lung(10)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	27						ACGGGGCTGACGTGCATCGTT	0.567																																						dbGAP											2	Substitution - Missense(2)	breast(2)											160.0	155.0	156.0					11																	18158850		2200	4293	6493	-	-	-	SO:0001583	missense	0				CCDS7830.1	11p15.1	2013-10-10			ENSG00000179826	ENSG00000179826		"""GPCR / Class A : Orphans"""	17980	protein-coding gene	gene with protein product		607229				11551509	Standard	NM_054031		Approved	MRGX3	uc001mnu.3	Q96LB0	OTTHUMG00000166435	ENST00000396275.2:c.101C>T	11.37:g.18158850C>T	ENSP00000379571:p.Thr34Met	Somatic		WXS	Illumina GAIIx	Phase_IV	B0M0L1|Q8TDE0|Q8TDE1	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_7TM_GPCR_Rhodpsn	p.T34M	ENST00000396275.2	37	c.101	CCDS7830.1	11	.	.	.	.	.	.	.	.	.	.	C	8.720	0.914172	0.17907	.	.	ENSG00000179826	ENST00000396275;ENST00000531264	T;T	0.18657	2.2;2.2	1.46	-2.93	0.05598	.	2.510260	0.01521	N	0.018353	T	0.14570	0.0352	N	0.08118	0	0.09310	N	1	D	0.60160	0.987	P	0.51895	0.683	T	0.02596	-1.1136	10	0.33940	T	0.23	.	2.1022	0.03683	0.4878:0.2102:0.0:0.3021	.	34	Q96LB0	MRGX3_HUMAN	M	34	ENSP00000379571:T34M;ENSP00000436242:T34M	ENSP00000379571:T34M	T	+	2	0	MRGPRX3	18115426	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-0.046000	0.11983	-1.450000	0.01936	-0.450000	0.05554	ACG	MRGPRX3	-	prints_7TM_GPCR_Rhodpsn	ENSG00000179826		0.567	MRGPRX3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MRGPRX3	HGNC	protein_coding	OTTHUMT00000389767.1	172	0.00	0	C	NM_054031		18158850	18158850	+1	no_errors	ENST00000396275	ensembl	human	known	69_37n	missense	59	39.18	38	SNP	0.000	T
TENM4	26011	genome.wustl.edu	37	11	78498080	78498080	+	Missense_Mutation	SNP	G	G	T			TCGA-A2-A04V-01A-21W-A050-09	TCGA-A2-A04V-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	89501861-2778-4b88-9a44-939fed99850d	5a514786-920b-4f35-932d-c2116fdea598	g.chr11:78498080G>T	ENST00000278550.7	-	16	2690	c.2228C>A	c.(2227-2229)aCc>aAc	p.T743N		NM_001098816.2	NP_001092286.2	Q6N022	TEN4_HUMAN	teneurin transmembrane protein 4	743	EGF-like 6. {ECO:0000255|PROSITE- ProRule:PRU00076}.				cardiac cell fate specification (GO:0060912)|cardiac muscle cell proliferation (GO:0060038)|central nervous system myelin formation (GO:0032289)|gastrulation with mouth forming second (GO:0001702)|neuron development (GO:0048666)|positive regulation of gastrulation (GO:2000543)|positive regulation of myelination (GO:0031643)|positive regulation of oligodendrocyte differentiation (GO:0048714)|self proteolysis (GO:0097264)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|neuron projection (GO:0043005)|nucleus (GO:0005634)	protein homodimerization activity (GO:0042803)	p.T743N(2)									GCAGCGGCAGGTGCCCCCTAC	0.697																																						dbGAP											2	Substitution - Missense(2)	breast(2)											6.0	9.0	8.0					11																	78498080		2027	4089	6116	-	-	-	SO:0001583	missense	0			AB037723	CCDS44688.1	11q13	2012-10-02	2012-10-02	2012-10-02		ENSG00000149256			29945	protein-coding gene	gene with protein product		610084	"""odz, odd Oz/ten-m homolog 4 (Drosophila)"""	ODZ4		12000766, 10625539	Standard	NM_001098816		Approved	KIAA1302, Ten-M4	uc001ozl.4	Q6N022		ENST00000278550.7:c.2228C>A	11.37:g.78498080G>T	ENSP00000278550:p.Thr743Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	A6ND26|Q7Z3C7|Q96MS6|Q9P2P4|Q9Y4S2	Missense_Mutation	SNP	pfam_Ten_N,pfam_EGF_extracell,pfam_YD,superfamily_CarboxyPept-like_regulatory,smart_EGF-like,pfscan_EG-like_dom,tigrfam_YD,tigrfam_Rhs_assc_core	p.T743N	ENST00000278550.7	37	c.2228	CCDS44688.1	11	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	15.85|15.85	2.955101|2.955101	0.53293|0.53293	.|.	.|.	ENSG00000149256|ENSG00000149256	ENST00000533525|ENST00000278550	.|T	.|0.03358	.|3.96	5.07|5.07	5.07|5.07	0.68467|0.68467	.|EGF, extracellular (1);Epidermal growth factor-like (1);	.|0.106709	.|0.64402	.|D	.|0.000012	T|T	0.04272|0.04272	0.0118|0.0118	L|L	0.35249|0.35249	1.045|1.045	0.36469|0.36469	D|D	0.867153|0.867153	.|P	.|0.37061	.|0.58	.|B	.|0.37601	.|0.254	T|T	0.54879|0.54879	-0.8227|-0.8227	5|9	.|.	.|.	.|.	.|.	14.2704|14.2704	0.66149|0.66149	0.0:0.1486:0.8514:0.0|0.0:0.1486:0.8514:0.0	.|.	.|743	.|Q6N022	.|TEN4_HUMAN	T|N	57|743	.|ENSP00000278550:T743N	.|.	P|T	-|-	1|2	0|0	ODZ4|ODZ4	78175728|78175728	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.881000|0.881000	0.50899|0.50899	2.801000|2.801000	0.47908|0.47908	2.653000|2.653000	0.90120|0.90120	0.561000|0.561000	0.74099|0.74099	CCT|ACC	ODZ4	-	pfam_EGF_extracell,smart_EGF-like	ENSG00000149256		0.697	TENM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ODZ4	HGNC	protein_coding	OTTHUMT00000391406.2	40	0.00	0	G			78498080	78498080	-1	no_errors	ENST00000278550	ensembl	human	known	69_37n	missense	17	39.29	11	SNP	1.000	T
OR5AU1	390445	genome.wustl.edu	37	14	21623512	21623513	+	Frame_Shift_Del	DEL	CG	CG	-	rs146804671		TCGA-A2-A04V-01A-21W-A050-09	TCGA-A2-A04V-10A-01W-A055-09	CG	CG					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	89501861-2778-4b88-9a44-939fed99850d	5a514786-920b-4f35-932d-c2116fdea598	g.chr14:21623512_21623513delCG	ENST00000304418.3	-	1	709_710	c.672_673delCG	c.(670-675)gtcgtcfs	p.VV224fs		NM_001004731.1	NP_001004731.1	Q8NGC0	O5AU1_HUMAN	olfactory receptor, family 5, subfamily AU, member 1	224						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(12)|pancreas(1)	21	all_cancers(95;0.00238)		Epithelial(56;6.88e-07)|all cancers(55;6.02e-06)	GBM - Glioblastoma multiforme(265;0.0192)		AAGTGAGTGACGACATGAGCAC	0.485																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			AL157687	CCDS32042.1	14q11.2	2013-09-23			ENSG00000169327	ENSG00000169327		"""GPCR / Class A : Olfactory receptors"""	15362	protein-coding gene	gene with protein product							Standard	NM_001004731		Approved		uc010tlp.2	Q8NGC0	OTTHUMG00000170753	ENST00000304418.3:c.672_673delCG	14.37:g.21623512_21623513delCG	ENSP00000302057:p.Val224fs	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RP78|Q6IEU2|Q96R10	Frame_Shift_Del	DEL	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.V225fs	ENST00000304418.3	37	c.673_672	CCDS32042.1	14																																																																																			OR5AU1	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	ENSG00000169327		0.485	OR5AU1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR5AU1	HGNC	protein_coding	OTTHUMT00000410213.1	88	0.00	0	CG			21623512	21623513	-1	no_errors	ENST00000304418	ensembl	human	known	69_37n	frame_shift_del	88	31.25	40	DEL	0.257:0.154	-
OR5L1	219437	genome.wustl.edu	37	11	55579499	55579499	+	Missense_Mutation	SNP	G	G	T			TCGA-A2-A04V-01A-21W-A050-09	TCGA-A2-A04V-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	89501861-2778-4b88-9a44-939fed99850d	5a514786-920b-4f35-932d-c2116fdea598	g.chr11:55579499G>T	ENST00000333973.2	+	1	646	c.557G>T	c.(556-558)aGt>aTt	p.S186I		NM_001004738.1	NP_001004738.1	Q8NGL2	OR5L1_HUMAN	olfactory receptor, family 5, subfamily L, member 1	186						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.S186I(2)		NS(1)|breast(2)|central_nervous_system(2)|endometrium(2)|kidney(3)|large_intestine(4)|liver(4)|lung(36)|ovary(2)|pancreas(1)|prostate(5)|skin(9)|stomach(4)|upper_aerodigestive_tract(3)	78		all_epithelial(135;0.208)				CCTGTCTTAAGTCTTGCTTGC	0.433																																						dbGAP											2	Substitution - Missense(2)	breast(2)											251.0	223.0	232.0					11																	55579499		2200	4296	6496	-	-	-	SO:0001583	missense	0			AB065780	CCDS31509.1	11q11	2012-08-09			ENSG00000186117	ENSG00000186117		"""GPCR / Class A : Olfactory receptors"""	8350	protein-coding gene	gene with protein product							Standard	NM_001004738		Approved	OST262	uc001nhw.1	Q8NGL2	OTTHUMG00000166810	ENST00000333973.2:c.557G>T	11.37:g.55579499G>T	ENSP00000335529:p.Ser186Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RNK6|Q6IFD0	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	p.S186I	ENST00000333973.2	37	c.557	CCDS31509.1	11	.	.	.	.	.	.	.	.	.	.	g	15.89	2.965750	0.53507	.	.	ENSG00000186117	ENST00000333973	T	0.00152	8.66	4.12	-2.17	0.07059	GPCR, rhodopsin-like superfamily (1);	0.353680	0.24693	N	0.036362	T	0.00178	0.0005	L	0.47716	1.5	0.09310	N	1	P	0.35050	0.482	P	0.45577	0.486	T	0.39961	-0.9588	10	0.59425	D	0.04	-7.0474	4.8175	0.13374	0.2064:0.543:0.1607:0.0899	.	186	Q8NGL2	OR5L1_HUMAN	I	186	ENSP00000335529:S186I	ENSP00000335529:S186I	S	+	2	0	OR5L1	55336075	0.000000	0.05858	0.000000	0.03702	0.822000	0.46500	0.029000	0.13666	-0.911000	0.03843	0.428000	0.28381	AGT	OR5L1	-	pfam_7TM_GPCR_Rhodpsn,prints_Olfact_rcpt,pfscan_GPCR_Rhodpsn_supfam	ENSG00000186117		0.433	OR5L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR5L1	HGNC	protein_coding	OTTHUMT00000391514.1	145	0.00	0	G	NM_001004738		55579499	55579499	+1	no_errors	ENST00000333973	ensembl	human	known	69_37n	missense	60	36.84	35	SNP	0.000	T
PIK3CA	5290	genome.wustl.edu	37	3	178917478	178917478	+	Splice_Site	SNP	G	G	A			TCGA-A2-A04V-01A-21W-A050-09	TCGA-A2-A04V-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	89501861-2778-4b88-9a44-939fed99850d	5a514786-920b-4f35-932d-c2116fdea598	g.chr3:178917478G>A	ENST00000263967.3	+	3	510	c.353G>A	c.(352-354)gGt>gAt	p.G118D		NM_006218.2	NP_006209.2	P42336	PK3CA_HUMAN	phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit alpha	118			G -> D (in CWS5). {ECO:0000269|PubMed:23246288}.		angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|endothelial cell migration (GO:0043542)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glucose metabolic process (GO:0006006)|hypomethylation of CpG island (GO:0044029)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|insulin receptor signaling pathway via phosphatidylinositol 3-kinase (GO:0038028)|leukocyte migration (GO:0050900)|negative regulation of anoikis (GO:2000811)|negative regulation of fibroblast apoptotic process (GO:2000270)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol phosphorylation (GO:0046854)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|platelet activation (GO:0030168)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|protein kinase B signaling (GO:0043491)|regulation of genetic imprinting (GO:2000653)|regulation of multicellular organism growth (GO:0040014)|small molecule metabolic process (GO:0044281)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)|vasculature development (GO:0001944)	1-phosphatidylinositol-4-phosphate 3-kinase, class IA complex (GO:0005943)|cytosol (GO:0005829)|lamellipodium (GO:0030027)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|kinase activity (GO:0016301)|phosphatidylinositol 3-kinase activity (GO:0035004)|phosphatidylinositol-4,5-bisphosphate 3-kinase activity (GO:0046934)|protein kinase activator activity (GO:0030295)|protein serine/threonine kinase activity (GO:0004674)	p.G118D(26)		NS(16)|autonomic_ganglia(4)|biliary_tract(22)|bone(1)|breast(2150)|central_nervous_system(110)|cervix(33)|endometrium(473)|eye(1)|haematopoietic_and_lymphoid_tissue(35)|kidney(14)|large_intestine(1202)|liver(42)|lung(202)|meninges(1)|oesophagus(28)|ovary(235)|pancreas(17)|penis(8)|pituitary(12)|prostate(10)|skin(155)|small_intestine(1)|soft_tissue(18)|stomach(121)|thyroid(80)|upper_aerodigestive_tract(70)|urinary_tract(208)	5269	all_cancers(143;1.19e-17)|Ovarian(172;0.00769)|Breast(254;0.155)		OV - Ovarian serous cystadenocarcinoma(80;9.59e-28)|GBM - Glioblastoma multiforme(14;0.003)|BRCA - Breast invasive adenocarcinoma(182;0.0282)		Caffeine(DB00201)	TTTATTAAAGGTTTTGCTATC	0.338		57	Mis		"""colorectal, gastric, gliobastoma, breast"""					HNSCC(19;0.045)|TSP Lung(28;0.18)																											Colon(199;1504 1750 3362 26421 31210 32040)	dbGAP		Dom	yes		3	3q26.3	5290	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""		"""E, O"""	26	Substitution - Missense(26)	endometrium(11)|breast(4)|large_intestine(3)|central_nervous_system(3)|lung(3)|prostate(2)											93.0	87.0	89.0					3																	178917478		1809	4071	5880	-	-	-	SO:0001630	splice_region_variant	0				CCDS43171.1	3q26.3	2014-09-17	2012-07-13		ENSG00000121879	ENSG00000121879	2.7.1.153		8975	protein-coding gene	gene with protein product		171834	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""			1322797	Standard	NM_006218		Approved	PI3K	uc003fjk.3	P42336	OTTHUMG00000157311	ENST00000263967.3:c.353-1G>A	3.37:g.178917478G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q14CW1|Q99762	Missense_Mutation	SNP	pfam_PInositide-3_kin_accessory_dom,pfam_PI3/4_kinase_cat_dom,pfam_PI3K_Ras-bd_dom,pfam_PI3K_C2_dom,pfam_PI3K_adapt-bd_dom,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_PI3K_adapt-bd_dom,smart_PI3K_Ras-bd_dom,smart_PI3K_C2_dom,smart_PInositide-3_kin_accessory_dom,smart_PI3/4_kinase_cat_dom,pfscan_PI3/4_kinase_cat_dom	p.G118D	ENST00000263967.3	37	c.353	CCDS43171.1	3	.	.	.	.	.	.	.	.	.	.	G	15.85	2.954561	0.53293	.	.	ENSG00000121879	ENST00000263967	T	0.46451	0.87	5.83	5.83	0.93111	.	0.000000	0.85682	D	0.000000	T	0.58722	0.2142	M	0.63843	1.955	0.80722	D	1	D	0.61080	0.989	P	0.56398	0.797	T	0.53823	-0.8384	9	.	.	.	.	20.1236	0.97970	0.0:0.0:1.0:0.0	.	118	P42336	PK3CA_HUMAN	D	118	ENSP00000263967:G118D	.	G	+	2	0	PIK3CA	180400172	1.000000	0.71417	1.000000	0.80357	0.017000	0.09413	9.471000	0.97696	2.746000	0.94184	0.563000	0.77884	GGT	PIK3CA	-	NULL	ENSG00000121879		0.338	PIK3CA-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	PIK3CA	HGNC	protein_coding	OTTHUMT00000348409.2	97	0.00	0	G		Missense_Mutation	178917478	178917478	+1	no_errors	ENST00000263967	ensembl	human	known	69_37n	missense	43	42.67	32	SNP	1.000	A
PLEKHA2	59339	genome.wustl.edu	37	8	38809720	38809721	+	Frame_Shift_Ins	INS	-	-	C			TCGA-A2-A04V-01A-21W-A050-09	TCGA-A2-A04V-10A-01W-A055-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	89501861-2778-4b88-9a44-939fed99850d	5a514786-920b-4f35-932d-c2116fdea598	g.chr8:38809720_38809721insC	ENST00000521746.1	+	7	757_758	c.523_524insC	c.(523-525)tccfs	p.S175fs	PLEKHA2_ENST00000420274.1_Frame_Shift_Ins_p.S175fs|PLEKHA2_ENST00000388745.4_3'UTR			Q9HB19	PKHA2_HUMAN	pleckstrin homology domain containing, family A (phosphoinositide binding specific) member 2	175					positive regulation of cell-matrix adhesion (GO:0001954)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	fibronectin binding (GO:0001968)|laminin binding (GO:0043236)|lipid binding (GO:0008289)	p.H176fs*26(2)		breast(2)|endometrium(2)|kidney(2)|large_intestine(2)|lung(4)|upper_aerodigestive_tract(1)	13		all_lung(54;0.0413)|Lung NSC(58;0.115)|Hepatocellular(245;0.152)	LUSC - Lung squamous cell carcinoma(45;4.68e-08)|COAD - Colon adenocarcinoma(9;0.235)			TGAGCCCGGGTCCCACACCATC	0.594																																						dbGAP											2	Insertion - Frameshift(2)	breast(2)																																								-	-	-	SO:0001589	frameshift_variant	0			AF286164	CCDS75732.1	8p11.21	2013-01-10	2002-01-14			ENSG00000169499		"""Pleckstrin homology (PH) domain containing"""	14336	protein-coding gene	gene with protein product	"""tandem PH Domain containing protein-2"""	607773	"""pleckstrin homology domain-containing, family A (phosphoinositide binding specific) member 2"""			11001876	Standard	NM_021623		Approved	TAPP2	uc003xmi.4	Q9HB19		ENST00000521746.1:c.526dupC	8.37:g.38809723_38809723dupC	ENSP00000430938:p.Ser175fs	Somatic		WXS	Illumina GAIIx	Phase_IV		Frame_Shift_Ins	INS	pfam_Pleckstrin_homology,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	p.H176fs	ENST00000521746.1	37	c.523_524		8																																																																																			PLEKHA2	-	NULL	ENSG00000169499		0.594	PLEKHA2-002	PUTATIVE	basic	protein_coding	PLEKHA2	HGNC	protein_coding	OTTHUMT00000377068.1	212	0.00	0	-	NM_021623		38809720	38809721	+1	no_errors	ENST00000420274	ensembl	human	known	69_37n	frame_shift_ins	270	10.00	30	INS	0.486:0.798	C
SFRP1	6422	genome.wustl.edu	37	8	41166156	41166156	+	Missense_Mutation	SNP	T	T	G			TCGA-A2-A04V-01A-21W-A050-09	TCGA-A2-A04V-10A-01W-A055-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	89501861-2778-4b88-9a44-939fed99850d	5a514786-920b-4f35-932d-c2116fdea598	g.chr8:41166156T>G	ENST00000220772.3	-	1	860	c.523A>C	c.(523-525)Acc>Ccc	p.T175P	SFRP1_ENST00000379845.3_5'Flank	NM_003012.4	NP_003003.3	Q8N474	SFRP1_HUMAN	secreted frizzled-related protein 1	175					bone trabecula formation (GO:0060346)|brain development (GO:0007420)|canonical Wnt signaling pathway (GO:0060070)|cellular response to BMP stimulus (GO:0071773)|cellular response to estradiol stimulus (GO:0071392)|cellular response to estrogen stimulus (GO:0071391)|cellular response to fibroblast growth factor stimulus (GO:0044344)|cellular response to growth factor stimulus (GO:0071363)|cellular response to heparin (GO:0071504)|cellular response to hypoxia (GO:0071456)|cellular response to interleukin-1 (GO:0071347)|cellular response to prostaglandin E stimulus (GO:0071380)|cellular response to starvation (GO:0009267)|cellular response to transforming growth factor beta stimulus (GO:0071560)|cellular response to tumor necrosis factor (GO:0071356)|cellular response to vitamin D (GO:0071305)|cellular response to X-ray (GO:0071481)|convergent extension involved in somitogenesis (GO:0090246)|digestive tract morphogenesis (GO:0048546)|dorsal/ventral axis specification (GO:0009950)|female gonad development (GO:0008585)|gonad development (GO:0008406)|hematopoietic progenitor cell differentiation (GO:0002244)|hematopoietic stem cell differentiation (GO:0060218)|male gonad development (GO:0008584)|menstrual cycle phase (GO:0022601)|negative regulation of androgen receptor signaling pathway (GO:0060766)|negative regulation of apoptotic process (GO:0043066)|negative regulation of B cell differentiation (GO:0045578)|negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of bone remodeling (GO:0046851)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of canonical Wnt signaling pathway involved in controlling type B pancreatic cell proliferation (GO:2000080)|negative regulation of cell growth (GO:0030308)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of epithelial to mesenchymal transition (GO:0010719)|negative regulation of fibroblast apoptotic process (GO:2000270)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of gene expression (GO:0010629)|negative regulation of insulin secretion (GO:0046676)|negative regulation of JUN kinase activity (GO:0043508)|negative regulation of ossification (GO:0030279)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of osteoblast proliferation (GO:0033689)|negative regulation of osteoclast differentiation (GO:0045671)|negative regulation of peptidyl-tyrosine phosphorylation (GO:0050732)|negative regulation of planar cell polarity pathway involved in axis elongation (GO:2000041)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of Wnt signaling pathway (GO:0030178)|negative regulation of Wnt signaling pathway involved in dorsal/ventral axis specification (GO:2000054)|neural crest cell fate commitment (GO:0014034)|neural tube closure (GO:0001843)|osteoblast differentiation (GO:0001649)|planar cell polarity pathway involved in neural tube closure (GO:0090179)|positive regulation of apoptotic process (GO:0043065)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of cell growth (GO:0030307)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cell-matrix adhesion (GO:0001954)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902043)|positive regulation of fat cell differentiation (GO:0045600)|positive regulation of fibroblast apoptotic process (GO:2000271)|positive regulation of focal adhesion assembly (GO:0051894)|positive regulation of non-canonical Wnt signaling pathway (GO:2000052)|positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of smoothened signaling pathway (GO:0045880)|positive regulation of stress fiber assembly (GO:0051496)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of Wnt signaling pathway (GO:0030177)|prostate epithelial cord arborization involved in prostate glandular acinus morphogenesis (GO:0060527)|proteolysis (GO:0006508)|regulation of angiogenesis (GO:0045765)|regulation of branching involved in prostate gland morphogenesis (GO:0060687)|regulation of cell cycle process (GO:0010564)|response to drug (GO:0042493)|response to organic cyclic compound (GO:0014070)|somatic stem cell maintenance (GO:0035019)|stromal-epithelial cell signaling involved in prostate gland development (GO:0044345)|ureteric bud development (GO:0001657)|vasculature development (GO:0001944)|Wnt signaling pathway involved in somitogenesis (GO:0090244)	cell surface (GO:0009986)|cytosol (GO:0005829)|extracellular matrix (GO:0031012)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)	cysteine-type endopeptidase activity (GO:0004197)|drug binding (GO:0008144)|frizzled binding (GO:0005109)|heparin binding (GO:0008201)|identical protein binding (GO:0042802)|PDZ domain binding (GO:0030165)|Wnt-activated receptor activity (GO:0042813)|Wnt-protein binding (GO:0017147)			breast(1)|central_nervous_system(1)|large_intestine(2)|liver(1)|lung(1)|skin(1)	7	Breast(1;9.19e-13)|Ovarian(28;0.00769)|Colorectal(14;0.0305)|Lung SC(25;0.211)	all_lung(54;0.0034)|Lung NSC(58;0.0134)|Hepatocellular(245;0.023)|Esophageal squamous(32;0.0559)	BRCA - Breast invasive adenocarcinoma(1;1.11e-10)|LUSC - Lung squamous cell carcinoma(45;0.00894)|COAD - Colon adenocarcinoma(11;0.0174)			GAGGCTTCGGTGGCATTGGGC	0.667																																						dbGAP											0													34.0	39.0	38.0					8																	41166156		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF017987	CCDS34886.1	8p11.21	2006-12-15			ENSG00000104332	ENSG00000104332		"""Secreted frizzled-related proteins"""	10776	protein-coding gene	gene with protein product		604156				9391078, 9192640	Standard	NM_003012		Approved	SARP2, FRP, FRP-1	uc003xnt.3	Q8N474	OTTHUMG00000164074	ENST00000220772.3:c.523A>C	8.37:g.41166156T>G	ENSP00000220772:p.Thr175Pro	Somatic		WXS	Illumina GAIIx	Phase_IV	O00546|O14779	Missense_Mutation	SNP	pfam_Frizzled_dom,pfam_Netrin_module_non-TIMP,superfamily_Frizzled_dom,superfamily_TIMP-like_OB-fold,smart_Frizzled_dom,smart_Netrin_module_non-TIMP,pfscan_Frizzled_dom,pfscan_Netrin_domain	p.T175P	ENST00000220772.3	37	c.523	CCDS34886.1	8	.	.	.	.	.	.	.	.	.	.	T	14.37	2.515575	0.44763	.	.	ENSG00000104332	ENST00000220772;ENST00000535263	T	0.66099	-0.19	4.8	4.8	0.61643	Frizzled domain (1);	0.064978	0.64402	D	0.000004	T	0.41213	0.1149	N	0.08118	0	0.58432	D	0.999999	B	0.02656	0.0	B	0.04013	0.001	T	0.25467	-1.0131	10	0.25751	T	0.34	.	13.5252	0.61591	0.0:0.0:0.0:1.0	.	175	Q8N474	SFRP1_HUMAN	P	175	ENSP00000220772:T175P	ENSP00000220772:T175P	T	-	1	0	SFRP1	41285313	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.842000	0.86851	1.781000	0.52344	0.383000	0.25322	ACC	SFRP1	-	superfamily_Frizzled_dom	ENSG00000104332		0.667	SFRP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SFRP1	HGNC	protein_coding	OTTHUMT00000377132.1	70	0.00	0	T	NM_003012		41166156	41166156	-1	no_errors	ENST00000220772	ensembl	human	known	69_37n	missense	34	14.63	6	SNP	1.000	G
SPTB	6710	genome.wustl.edu	37	14	65266520	65266520	+	Missense_Mutation	SNP	C	C	T			TCGA-A2-A04V-01A-21W-A050-09	TCGA-A2-A04V-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	89501861-2778-4b88-9a44-939fed99850d	5a514786-920b-4f35-932d-c2116fdea598	g.chr14:65266520C>T	ENST00000389721.5	-	8	1041	c.1009G>A	c.(1009-1011)Gtc>Atc	p.V337I	SPTB_ENST00000556626.1_Missense_Mutation_p.V337I|SPTB_ENST00000542895.1_Missense_Mutation_p.V337I|SPTB_ENST00000389722.3_Missense_Mutation_p.V337I|SPTB_ENST00000389720.3_Missense_Mutation_p.V337I	NM_000347.5	NP_000338.3	P11277	SPTB1_HUMAN	spectrin, beta, erythrocytic	337					actin filament capping (GO:0051693)|axon guidance (GO:0007411)|hemopoiesis (GO:0030097)|plasma membrane organization (GO:0007009)|porphyrin-containing compound biosynthetic process (GO:0006779)	actin cytoskeleton (GO:0015629)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|protein complex (GO:0043234)|spectrin (GO:0008091)|spectrin-associated cytoskeleton (GO:0014731)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|ankyrin binding (GO:0030506)|structural constituent of cytoskeleton (GO:0005200)	p.V337I(2)		breast(5)|central_nervous_system(4)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(18)|lung(36)|ovary(8)|pancreas(1)|prostate(4)|skin(10)|urinary_tract(3)	106		all_lung(585;4.15e-09)		all cancers(60;4.33e-34)|OV - Ovarian serous cystadenocarcinoma(108;8.32e-20)|BRCA - Breast invasive adenocarcinoma(234;0.0628)		TGCTGCTGGACGCCCGTCAGC	0.617																																						dbGAP											2	Substitution - Missense(2)	breast(2)											73.0	65.0	68.0					14																	65266520		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS32099.1, CCDS32100.1	14q24.1-q24.2	2013-01-10	2008-07-29			ENSG00000070182		"""Pleckstrin homology (PH) domain containing"""	11274	protein-coding gene	gene with protein product	"""spherocytosis, clinical type I"""	182870				2209094	Standard	NM_001024858		Approved		uc001xhr.3	P11277		ENST00000389721.5:c.1009G>A	14.37:g.65266520C>T	ENSP00000374371:p.Val337Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	Q15510|Q15519	Missense_Mutation	SNP	pirsf_Spectrin_bsu,pfam_Spectrin_repeat,pfam_CH-domain,pfam_CAMSAP_CH,pfam_Pleckstrin_homology,superfamily_CH-domain,smart_CH-domain,smart_Spectrin/alpha-actinin,smart_Pleckstrin_homology,prints_PH_dom-spectrin-type,pfscan_CH-domain,pfscan_Pleckstrin_homology	p.V337I	ENST00000389721.5	37	c.1009	CCDS32100.1	14	.	.	.	.	.	.	.	.	.	.	C	25.4	4.636645	0.87760	.	.	ENSG00000070182	ENST00000389723;ENST00000389722;ENST00000556626;ENST00000389721;ENST00000542895;ENST00000389720	T;T;T;T;T	0.54866	0.55;0.55;0.55;0.55;0.55	5.17	4.19	0.49359	.	0.064020	0.64402	D	0.000009	T	0.63331	0.2502	L	0.58428	1.81	0.51767	D	0.999935	D;P	0.63880	0.993;0.92	P;P	0.56474	0.799;0.496	T	0.68685	-0.5343	10	0.87932	D	0	.	15.369	0.74548	0.149:0.851:0.0:0.0	.	337;341	P11277;Q59FP5	SPTB1_HUMAN;.	I	341;337;337;337;337;337	ENSP00000374372:V337I;ENSP00000451752:V337I;ENSP00000374371:V337I;ENSP00000443882:V337I;ENSP00000374370:V337I	ENSP00000374370:V337I	V	-	1	0	SPTB	64336273	1.000000	0.71417	0.983000	0.44433	0.903000	0.53119	6.066000	0.71185	2.392000	0.81423	0.563000	0.77884	GTC	SPTB	-	pirsf_Spectrin_bsu,pfam_Spectrin_repeat,smart_Spectrin/alpha-actinin	ENSG00000070182		0.617	SPTB-004	KNOWN	basic|CCDS	protein_coding	SPTB	HGNC	protein_coding	OTTHUMT00000414080.1	91	0.00	0	C			65266520	65266520	-1	no_errors	ENST00000389722	ensembl	human	known	69_37n	missense	34	37.04	20	SNP	0.995	T
SV2A	9900	genome.wustl.edu	37	1	149879682	149879682	+	Missense_Mutation	SNP	C	C	T			TCGA-A2-A04V-01A-21W-A050-09	TCGA-A2-A04V-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	89501861-2778-4b88-9a44-939fed99850d	5a514786-920b-4f35-932d-c2116fdea598	g.chr1:149879682C>T	ENST00000369146.3	-	9	1946	c.1456G>A	c.(1456-1458)Gtg>Atg	p.V486M	SV2A_ENST00000369145.1_Missense_Mutation_p.V486M	NM_001278719.1|NM_014849.3	NP_001265648.1|NP_055664.3	Q7L0J3	SV2A_HUMAN	synaptic vesicle glycoprotein 2A	486					cellular calcium ion homeostasis (GO:0006874)|neurotransmitter transport (GO:0006836)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|neuromuscular junction (GO:0031594)|neuron projection (GO:0043005)|presynaptic active zone (GO:0048786)|synaptic vesicle (GO:0008021)|synaptic vesicle membrane (GO:0030672)	protein kinase binding (GO:0019901)|receptor activity (GO:0004872)|transmembrane transporter activity (GO:0022857)	p.V486M(2)		breast(2)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(8)|lung(16)|ovary(6)|pancreas(1)|prostate(8)|skin(2)|urinary_tract(2)	55	Breast(34;0.00769)|all_hematologic(923;0.127)|Colorectal(459;0.171)		LUSC - Lung squamous cell carcinoma(543;0.221)|STAD - Stomach adenocarcinoma(528;0.247)		Levetiracetam(DB01202)	CCGGGGAACACTTTGGTGCGG	0.527																																						dbGAP											2	Substitution - Missense(2)	breast(2)											163.0	159.0	160.0					1																	149879682		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB018279	CCDS940.1	1q21.2	2008-02-05			ENSG00000159164	ENSG00000159164			20566	protein-coding gene	gene with protein product		185860				7681585, 10611374	Standard	NM_014849		Approved	SV2, KIAA0736	uc001etg.3	Q7L0J3	OTTHUMG00000012209	ENST00000369146.3:c.1456G>A	1.37:g.149879682C>T	ENSP00000358142:p.Val486Met	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DUZ7|O94841|Q5QNX8|Q7Z3L6|Q8NBJ6|Q9BVZ9	Missense_Mutation	SNP	pfam_Sub_transporter,pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom,tigrfam_SV2_chordata	p.V486M	ENST00000369146.3	37	c.1456	CCDS940.1	1	.	.	.	.	.	.	.	.	.	.	C	13.03	2.115890	0.37339	.	.	ENSG00000159164	ENST00000369146;ENST00000369145	T;T	0.69561	0.62;-0.41	5.26	2.25	0.28309	Major facilitator superfamily domain (1);	0.509560	0.18854	N	0.129313	T	0.35508	0.0934	L	0.46157	1.445	0.32858	D	0.5076	B	0.25563	0.129	B	0.19946	0.027	T	0.07616	-1.0763	10	0.31617	T	0.26	-13.8279	7.5927	0.28029	0.2908:0.3966:0.3126:0.0	.	486	Q7L0J3	SV2A_HUMAN	M	486	ENSP00000358142:V486M;ENSP00000358141:V486M	ENSP00000358141:V486M	V	-	1	0	SV2A	148146306	0.002000	0.14202	1.000000	0.80357	0.995000	0.86356	-1.096000	0.03353	0.798000	0.33994	0.555000	0.69702	GTG	SV2A	-	pfscan_MFS_dom,tigrfam_SV2_chordata	ENSG00000159164		0.527	SV2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SV2A	HGNC	protein_coding	OTTHUMT00000033754.1	196	0.00	0	C			149879682	149879682	-1	no_errors	ENST00000369146	ensembl	human	known	69_37n	missense	107	41.85	77	SNP	0.992	T
TAPT1	202018	genome.wustl.edu	37	4	16193020	16193020	+	Silent	SNP	G	G	A			TCGA-A2-A04V-01A-21W-A050-09	TCGA-A2-A04V-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	89501861-2778-4b88-9a44-939fed99850d	5a514786-920b-4f35-932d-c2116fdea598	g.chr4:16193020G>A	ENST00000405303.2	-	4	659	c.576C>T	c.(574-576)tcC>tcT	p.S192S	TAPT1_ENST00000508888.1_5'UTR|TAPT1_ENST00000399920.3_Silent_p.S81S|TAPT1_ENST00000304584.8_Silent_p.S18S	NM_153365.2	NP_699196.2	Q6NXT6	TAPT1_HUMAN	transmembrane anterior posterior transformation 1	192					embryonic skeletal system development (GO:0048706)|G-protein coupled receptor signaling pathway (GO:0007186)|in utero embryonic development (GO:0001701)|post-embryonic development (GO:0009791)	integral component of membrane (GO:0016021)	growth hormone-releasing hormone receptor activity (GO:0016520)	p.S192S(2)		NS(1)|breast(2)|cervix(1)|kidney(2)|large_intestine(2)|lung(1)|prostate(1)	10						GCTTGATGACGGACTGCCCCC	0.483																																						dbGAP											2	Substitution - coding silent(2)	breast(2)											56.0	56.0	56.0					4																	16193020		1977	4167	6144	-	-	-	SO:0001819	synonymous_variant	0			AK074494	CCDS47030.1	4p15.32	2014-01-28			ENSG00000169762	ENSG00000169762			26887	protein-coding gene	gene with protein product		612758				12477932	Standard	NM_153365		Approved	FLJ90013	uc010ied.1	Q6NXT6	OTTHUMG00000160177	ENST00000405303.2:c.576C>T	4.37:g.16193020G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q8N2S3|Q9NZK9	Missense_Mutation	SNP	pfam_Membrane_Tatp1/CMV_rcpt	p.R30C	ENST00000405303.2	37	c.88	CCDS47030.1	4																																																																																			TAPT1	-	pfam_Membrane_Tatp1/CMV_rcpt	ENSG00000169762		0.483	TAPT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TAPT1	HGNC	protein_coding	OTTHUMT00000359568.1	65	0.00	0	G	NM_153365		16193020	16193020	-1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000513782	ensembl	human	known	69_37n	missense	43	33.33	22	SNP	0.804	A
TMEM246	84302	genome.wustl.edu	37	9	104238634	104238634	+	Missense_Mutation	SNP	G	G	T	rs534012682	byFrequency	TCGA-A2-A04V-01A-21W-A050-09	TCGA-A2-A04V-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	89501861-2778-4b88-9a44-939fed99850d	5a514786-920b-4f35-932d-c2116fdea598	g.chr9:104238634G>T	ENST00000374851.1	-	4	1888	c.741C>A	c.(739-741)caC>caA	p.H247Q	TMEM246_ENST00000374848.3_Missense_Mutation_p.H247Q|RP11-490D19.6_ENST00000424154.1_RNA|RP11-490D19.6_ENST00000450109.1_RNA|TMEM246_ENST00000374847.1_Missense_Mutation_p.H247Q|RP11-490D19.6_ENST00000425734.1_RNA|RP11-490D19.6_ENST00000431507.1_RNA			Q9BRR3	TM246_HUMAN	transmembrane protein 246	247						integral component of membrane (GO:0016021)		p.H247Q(2)									GCCTCTCGGGGTGATACAGCT	0.537																																						dbGAP											2	Substitution - Missense(2)	breast(2)											86.0	85.0	86.0					9																	104238634		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC006115	CCDS6757.1	9q31.1	2012-04-02	2012-04-02	2012-04-02	ENSG00000165152	ENSG00000165152			28180	protein-coding gene	gene with protein product			"""chromosome 9 open reading frame 125"""	C9orf125		12477932	Standard	NM_032342		Approved	MGC12992	uc004bbm.3	Q9BRR3	OTTHUMG00000020381	ENST00000374851.1:c.741C>A	9.37:g.104238634G>T	ENSP00000363984:p.His247Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	Q49AQ4	Missense_Mutation	SNP	NULL	p.H247Q	ENST00000374851.1	37	c.741	CCDS6757.1	9	.	.	.	.	.	.	.	.	.	.	G	17.07	3.296070	0.60086	.	.	ENSG00000165152	ENST00000374848;ENST00000374847;ENST00000374851	.	.	.	5.69	0.953	0.19590	.	0.000000	0.85682	D	0.000000	T	0.74535	0.3729	M	0.73598	2.24	0.58432	D	0.999998	D	0.89917	1.0	D	0.87578	0.998	T	0.72903	-0.4151	9	0.66056	D	0.02	-25.7008	9.7802	0.40643	0.4537:0.0:0.5463:0.0	.	247	Q9BRR3	CI125_HUMAN	Q	247	.	ENSP00000363980:H247Q	H	-	3	2	C9orf125	103278455	0.973000	0.33851	0.994000	0.49952	0.983000	0.72400	0.057000	0.14279	-0.011000	0.14247	0.557000	0.71058	CAC	TMEM246	-	NULL	ENSG00000165152		0.537	TMEM246-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	TMEM246	HGNC	protein_coding	OTTHUMT00000053444.1	115	0.00	0	G	NM_032342		104238634	104238634	-1	no_errors	ENST00000374847	ensembl	human	known	69_37n	missense	43	38.57	27	SNP	1.000	T
TMIGD2	126259	genome.wustl.edu	37	19	4294613	4294613	+	Nonsense_Mutation	SNP	C	C	T			TCGA-A2-A04V-01A-21W-A050-09	TCGA-A2-A04V-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	89501861-2778-4b88-9a44-939fed99850d	5a514786-920b-4f35-932d-c2116fdea598	g.chr19:4294613C>T	ENST00000301272.2	-	4	558	c.513G>A	c.(511-513)tgG>tgA	p.W171*	TMIGD2_ENST00000595645.1_Nonsense_Mutation_p.W171*|TMIGD2_ENST00000600114.1_Nonsense_Mutation_p.W51*|TMIGD2_ENST00000600349.1_Intron	NM_001169126.1|NM_144615.2	NP_001162597.1|NP_653216.2	Q96BF3	TMIG2_HUMAN	transmembrane and immunoglobulin domain containing 2	171					positive regulation of activated T cell proliferation (GO:0042104)|positive regulation of cytokine production (GO:0001819)|signal transduction (GO:0007165)|T cell costimulation (GO:0031295)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	coreceptor activity (GO:0015026)	p.W171*(1)		breast(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(10)|prostate(1)|skin(2)	19				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0339)|STAD - Stomach adenocarcinoma(1328;0.18)		GGCCCCAGAACCAGGCACCCC	0.617																																						dbGAP											1	Substitution - Nonsense(1)	breast(1)											119.0	142.0	134.0					19																	4294613		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			BC015655	CCDS12126.1, CCDS59334.1	19p13.3	2014-02-12	2006-07-05					"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	28324	protein-coding gene	gene with protein product		614715					Standard	NM_144615		Approved	MGC23244	uc002lzx.2	Q96BF3		ENST00000301272.2:c.513G>A	19.37:g.4294613C>T	ENSP00000301272:p.Trp171*	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6UW59	Nonsense_Mutation	SNP	smart_Ig_sub,pfscan_Ig-like	p.W171*	ENST00000301272.2	37	c.513	CCDS12126.1	19	.	.	.	.	.	.	.	.	.	.	C	13.62	2.291369	0.40494	.	.	ENSG00000167664	ENST00000301272	.	.	.	2.94	1.8	0.24995	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.30854	T	0.27	.	7.509	0.27562	0.0:0.7303:0.2697:0.0	.	.	.	.	X	171	.	ENSP00000301272:W171X	W	-	3	0	TMIGD2	4245613	0.000000	0.05858	0.003000	0.11579	0.004000	0.04260	-0.012000	0.12699	0.517000	0.28361	0.549000	0.68633	TGG	TMIGD2	-	NULL	ENSG00000167664		0.617	TMIGD2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TMIGD2	HGNC	protein_coding	OTTHUMT00000458088.1	74	0.00	0	C	NM_144615		4294613	4294613	-1	no_errors	ENST00000301272	ensembl	human	known	69_37n	nonsense	24	26.47	9	SNP	0.007	T
TRMT12	55039	genome.wustl.edu	37	8	125463552	125463552	+	Silent	SNP	T	T	C			TCGA-A2-A04V-01A-21W-A050-09	TCGA-A2-A04V-10A-01W-A055-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	89501861-2778-4b88-9a44-939fed99850d	5a514786-920b-4f35-932d-c2116fdea598	g.chr8:125463552T>C	ENST00000328599.3	+	1	505	c.384T>C	c.(382-384)gcT>gcC	p.A128A	TRMT12_ENST00000521443.1_Intron	NM_017956.3	NP_060426.2	Q53H54	TYW2_HUMAN	tRNA methyltransferase 12 homolog (S. cerevisiae)	128					tRNA processing (GO:0008033)		transferase activity (GO:0016740)	p.A128A(2)		breast(2)|endometrium(1)|large_intestine(3)|lung(6)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	15	Ovarian(258;0.00438)|all_neural(195;0.0779)|Hepatocellular(40;0.108)		STAD - Stomach adenocarcinoma(47;0.00288)			AGTTGGAGGCTGATTTGCCCC	0.552																																						dbGAP											2	Substitution - coding silent(2)	breast(2)											71.0	70.0	70.0					8																	125463552		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF313041	CCDS6349.1	8q24.13	2011-05-09	2006-11-16		ENSG00000183665	ENSG00000183665			26091	protein-coding gene	gene with protein product	"""tRNA-yW synthesizing protein 2"""	611244	"""tRNA methyltranferase 12 homolog (S. cerevisiae)"""			16005430, 17150819	Standard	NM_017956		Approved	FLJ20772, Trm12, TYW2	uc003yra.4	Q53H54	OTTHUMG00000165022	ENST00000328599.3:c.384T>C	8.37:g.125463552T>C		Somatic		WXS	Illumina GAIIx	Phase_IV	Q6PKB9|Q96F21|Q9NWK6	Silent	SNP	pfam_tRNA_Trfase_Trm5/Tyw2	p.A128	ENST00000328599.3	37	c.384	CCDS6349.1	8																																																																																			TRMT12	-	NULL	ENSG00000183665		0.552	TRMT12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRMT12	HGNC	protein_coding	OTTHUMT00000381465.1	93	0.00	0	T	NM_017956		125463552	125463552	+1	no_errors	ENST00000328599	ensembl	human	known	69_37n	silent	69	15.85	13	SNP	0.856	C
UBAP2L	9898	genome.wustl.edu	37	1	154227320	154227320	+	Silent	SNP	C	C	T			TCGA-A2-A04V-01A-21W-A050-09	TCGA-A2-A04V-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	89501861-2778-4b88-9a44-939fed99850d	5a514786-920b-4f35-932d-c2116fdea598	g.chr1:154227320C>T	ENST00000361546.2	+	15	1905	c.1863C>T	c.(1861-1863)ttC>ttT	p.F621F	AL590431.1_ENST00000517008.1_RNA|UBAP2L_ENST00000428931.1_Silent_p.F621F|UBAP2L_ENST00000271877.7_Silent_p.F632F|UBAP2L_ENST00000343815.6_Silent_p.F621F			Q14157	UBP2L_HUMAN	ubiquitin associated protein 2-like	621					binding of sperm to zona pellucida (GO:0007339)		poly(A) RNA binding (GO:0044822)	p.F621F(4)|p.F117F(2)		NS(2)|breast(7)|central_nervous_system(1)|endometrium(7)|kidney(1)|large_intestine(8)|lung(20)|ovary(1)|prostate(1)|urinary_tract(2)	50	all_lung(78;1.09e-30)|Lung NSC(65;1.66e-28)|Hepatocellular(266;0.0877)		LUSC - Lung squamous cell carcinoma(543;0.185)			AGAATGGCTTCAGTTCTGTGC	0.398																																						dbGAP											6	Substitution - coding silent(6)	breast(6)											98.0	98.0	98.0					1																	154227320		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			BC003170	CCDS1063.1, CCDS44229.1, CCDS72925.1	1q21.3	2008-02-05			ENSG00000143569	ENSG00000143569			29877	protein-coding gene	gene with protein product						8590280, 11230159	Standard	NM_014847		Approved	NICE-4, KIAA0144	uc001fep.4	Q14157	OTTHUMG00000035983	ENST00000361546.2:c.1863C>T	1.37:g.154227320C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B4E0U8|Q5VU75|Q5VU76|Q9BTU3|Q9UGL2|Q9UGL3|Q9UGL4|Q9UGL5	Silent	SNP	pfam_DUF3697_Uba2,superfamily_UBA-like,smart_UBA/transl_elong_EF1B_N_euk,pfscan_UBA/transl_elong_EF1B_N_euk	p.F621	ENST00000361546.2	37	c.1863	CCDS1063.1	1																																																																																			UBAP2L	-	NULL	ENSG00000143569		0.398	UBAP2L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UBAP2L	HGNC	protein_coding	OTTHUMT00000087673.1	370	0.80	3	C	NM_014847		154227320	154227320	+1	no_errors	ENST00000361546	ensembl	human	known	69_37n	silent	132	40.27	89	SNP	1.000	T
ZNF843	283933	genome.wustl.edu	37	16	31447564	31447564	+	Missense_Mutation	SNP	C	C	T	rs376828436	byFrequency	TCGA-A2-A04V-01A-21W-A050-09	TCGA-A2-A04V-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	89501861-2778-4b88-9a44-939fed99850d	5a514786-920b-4f35-932d-c2116fdea598	g.chr16:31447564C>T	ENST00000315678.5	-	2	1331	c.607G>A	c.(607-609)Ggg>Agg	p.G203R	ZNF843_ENST00000564218.1_Missense_Mutation_p.G203R	NM_001136509.1	NP_001129981.1	Q8N446	ZN843_HUMAN	zinc finger protein 843	203							metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)	p.G203R(2)		breast(2)|large_intestine(1)|prostate(1)	4						AGGAAGGACCCGGGGCTCCCA	0.672													C|||	9	0.00179712	0.0068	0.0	5008	,	,		14231	0.0		0.0	False		,,,				2504	0.0					dbGAP											2	Substitution - Missense(2)	breast(2)											37.0	44.0	42.0					16																	31447564		692	1591	2283	-	-	-	SO:0001583	missense	0			BC036762	CCDS45471.1	16p11.2	2013-01-11			ENSG00000176723	ENSG00000176723		"""Zinc fingers, C2H2-type"""	28710	protein-coding gene	gene with protein product						12477932	Standard	NM_001136509		Approved	MGC46336	uc010vfm.1	Q8N446		ENST00000315678.5:c.607G>A	16.37:g.31447564C>T	ENSP00000322899:p.Gly203Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K4U8	Missense_Mutation	SNP	pfscan_Znf_C2H2	p.G203R	ENST00000315678.5	37	c.607	CCDS45471.1	16	.	.	.	.	.	.	.	.	.	.	C	10.32	1.318912	0.23994	.	.	ENSG00000176723	ENST00000315678	T	0.01560	4.77	1.12	-2.23	0.06930	.	.	.	.	.	T	0.00998	0.0033	N	0.08118	0	0.09310	N	1	B	0.18968	0.032	B	0.10450	0.005	T	0.47195	-0.9136	9	0.87932	D	0	.	2.2609	0.04067	0.4626:0.2923:0.0:0.2451	.	203	Q8N446	ZN843_HUMAN	R	203	ENSP00000322899:G203R	ENSP00000322899:G203R	G	-	1	0	ZNF843	31355065	0.001000	0.12720	0.000000	0.03702	0.324000	0.28378	-0.674000	0.05233	-0.779000	0.04560	0.205000	0.17691	GGG	ZNF843	-	NULL	ENSG00000176723		0.672	ZNF843-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF843	HGNC	protein_coding	OTTHUMT00000432843.1	116	0.00	0	C	NM_001136509		31447564	31447564	-1	no_errors	ENST00000315678	ensembl	human	known	69_37n	missense	6	57.14	8	SNP	0.001	T
ZDHHC1	29800	genome.wustl.edu	37	16	67432541	67432541	+	Missense_Mutation	SNP	A	A	C			TCGA-A2-A04V-01A-21W-A050-09	TCGA-A2-A04V-10A-01W-A055-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	89501861-2778-4b88-9a44-939fed99850d	5a514786-920b-4f35-932d-c2116fdea598	g.chr16:67432541A>C	ENST00000348579.2	-	7	1090	c.749T>G	c.(748-750)cTc>cGc	p.L250R	ZDHHC1_ENST00000566075.1_5'Flank	NM_013304.2	NP_037436.1	Q8WTX9	ZDHC1_HUMAN	zinc finger, DHHC-type containing 1	250					protein palmitoylation (GO:0018345)	endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	DNA binding (GO:0003677)|palmitoyltransferase activity (GO:0016409)|protein-cysteine S-palmitoyltransferase activity (GO:0019706)|zinc ion binding (GO:0008270)	p.L250R(2)		breast(2)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(1)|urinary_tract(1)	10		Ovarian(137;0.223)		UCEC - Uterine corpus endometrioid carcinoma (183;0.0178)|all cancers(182;5.71e-53)|Epithelial(162;4.73e-52)|OV - Ovarian serous cystadenocarcinoma(108;1.53e-29)|Kidney(780;4.37e-05)|BRCA - Breast invasive adenocarcinoma(181;5.8e-05)|GBM - Glioblastoma multiforme(240;0.0022)		CAGAAGGATGAGCAGGGCGGC	0.627																																						dbGAP											2	Substitution - Missense(2)	breast(2)											31.0	37.0	35.0					16																	67432541		2197	4300	6497	-	-	-	SO:0001583	missense	0			U90653	CCDS10836.1	16q22.1	2010-03-25	2003-01-27		ENSG00000159714	ENSG00000159714		"""Zinc fingers, DHHC-type"""	17916	protein-coding gene	gene with protein product			"""chromosome 16 open reading frame 1"""	C16orf1		10395086	Standard	NM_013304		Approved	HSU90653, ZNF377	uc010vjm.2	Q8WTX9	OTTHUMG00000137522	ENST00000348579.2:c.749T>G	16.37:g.67432541A>C	ENSP00000340299:p.Leu250Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	O15461	Missense_Mutation	SNP	pfam_Znf_DHHC_palmitoyltrfase,pfscan_Znf_DHHC_palmitoyltrfase	p.L250R	ENST00000348579.2	37	c.749	CCDS10836.1	16	.	.	.	.	.	.	.	.	.	.	A	21.3	4.131025	0.77549	.	.	ENSG00000159714	ENST00000348579	T	0.27890	1.64	5.41	5.41	0.78517	.	0.299786	0.28082	N	0.016664	T	0.54919	0.1888	M	0.74546	2.27	0.38448	D	0.946882	D	0.76494	0.999	D	0.71184	0.972	T	0.61237	-0.7103	10	0.52906	T	0.07	.	14.6234	0.68602	1.0:0.0:0.0:0.0	.	250	Q8WTX9	ZDHC1_HUMAN	R	250	ENSP00000340299:L250R	ENSP00000340299:L250R	L	-	2	0	ZDHHC1	65990042	1.000000	0.71417	0.993000	0.49108	0.945000	0.59286	6.992000	0.76238	2.058000	0.61347	0.408000	0.27601	CTC	ZDHHC1	-	NULL	ENSG00000159714		0.627	ZDHHC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZDHHC1	HGNC	protein_coding	OTTHUMT00000268845.1	77	0.00	0	A	NM_013304		67432541	67432541	-1	no_errors	ENST00000348579	ensembl	human	known	69_37n	missense	3	70.00	7	SNP	0.998	C
ZXDA	7789	genome.wustl.edu	37	X	57935544	57935544	+	Silent	SNP	C	C	A			TCGA-A2-A04V-01A-21W-A050-09	TCGA-A2-A04V-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	89501861-2778-4b88-9a44-939fed99850d	5a514786-920b-4f35-932d-c2116fdea598	g.chrX:57935544C>A	ENST00000358697.4	-	1	1523	c.1311G>T	c.(1309-1311)ctG>ctT	p.L437L		NM_007156.4	NP_009087.1	P98168	ZXDA_HUMAN	zinc finger, X-linked, duplicated A	437	Required for interaction with ZXDC.				positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	C2H2 zinc finger domain binding (GO:0070742)|metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.L437L(2)		breast(2)|endometrium(9)|kidney(1)|large_intestine(7)|lung(13)|ovary(2)|prostate(2)|skin(1)	37						GGTGAATTTTCAGCCTACAAG	0.507																																						dbGAP											2	Substitution - coding silent(2)	breast(2)											82.0	74.0	77.0					X																	57935544		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			L14787	CCDS14376.1	Xp11.21	2013-01-08			ENSG00000198205	ENSG00000198205		"""Zinc fingers, C2H2-type"""	13198	protein-coding gene	gene with protein product	"""zinc finger protein 896"""	300235				8268913	Standard	NM_007156		Approved	ZNF896	uc004dve.3	P98168	OTTHUMG00000021688	ENST00000358697.4:c.1311G>T	X.37:g.57935544C>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q9UJP7	Silent	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.L437	ENST00000358697.4	37	c.1311	CCDS14376.1	X																																																																																			ZXDA	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000198205		0.507	ZXDA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZXDA	HGNC	protein_coding	OTTHUMT00000056925.1	139	0.00	0	C	NM_007156		57935544	57935544	-1	no_errors	ENST00000358697	ensembl	human	known	69_37n	silent	84	41.26	59	SNP	0.996	A
