#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
ARHGAP23	57636	genome.wustl.edu	37	17	36626102	36626102	+	Missense_Mutation	SNP	G	G	A			TCGA-A2-A0CL-01A-11D-A10Y-09	TCGA-A2-A0CL-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a630ed59-dd23-45e1-aa16-4f7a98e32728	d7dbbf16-03d9-4e08-9fea-d4fa3d8608d0	g.chr17:36626102G>A	ENST00000431231.2	+	10	1999	c.1931G>A	c.(1930-1932)cGc>cAc	p.R644H	ARHGAP23_ENST00000437668.3_Missense_Mutation_p.R644H|ARHGAP23_ENST00000443378.1_Missense_Mutation_p.R550H	NM_001199417.1	NP_001186346.1	Q9P227	RHG23_HUMAN	Rho GTPase activating protein 23	644					regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	GTPase activator activity (GO:0005096)			breast(2)|endometrium(8)|kidney(6)|lung(1)|skin(1)|stomach(2)	20						CTGCCAAACCGCATACCCAGC	0.637																																						dbGAP											0													42.0	47.0	45.0					17																	36626102		692	1591	2283	-	-	-	SO:0001583	missense	0			AB040934	CCDS56027.1	17q12	2014-05-06			ENSG00000225485	ENSG00000275832		"""Rho GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"""	29293	protein-coding gene	gene with protein product		610590				10819331, 15254754	Standard	NM_001199417		Approved	KIAA1501	uc021twd.1	Q9P227	OTTHUMG00000188547	ENST00000431231.2:c.1931G>A	17.37:g.36626102G>A	ENSP00000393539:p.Arg644His	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_RhoGAP_dom,pfam_PDZ,pfam_Pleckstrin_homology,superfamily_Rho_GTPase_activation_prot,superfamily_PDZ,smart_PDZ,smart_Pleckstrin_homology,smart_RhoGAP_dom,pfscan_PDZ,pfscan_Pleckstrin_homology,pfscan_RhoGAP_dom	p.R644H	ENST00000431231.2	37	c.1931	CCDS56027.1	17	.	.	.	.	.	.	.	.	.	.	G	11.75	1.732066	0.30684	.	.	ENSG00000225485	ENST00000437668;ENST00000431231;ENST00000443378	T;T;T	0.16743	2.32;2.69;2.65	4.32	4.32	0.51571	.	0.393082	0.24105	N	0.041507	T	0.27594	0.0678	L	0.27053	0.805	0.27398	N	0.954939	D;D	0.89917	0.999;1.0	P;D	0.71414	0.893;0.973	T	0.06499	-1.0823	10	0.33940	T	0.23	.	15.7305	0.77800	0.0:0.0:1.0:0.0	.	644;644	Q9P227;Q9P227-2	RHG23_HUMAN;.	H	644;644;550	ENSP00000394153:R644H;ENSP00000393539:R644H;ENSP00000407333:R550H	ENSP00000393539:R644H	R	+	2	0	ARHGAP23	33879628	1.000000	0.71417	0.528000	0.27938	0.042000	0.13812	4.843000	0.62838	2.221000	0.72209	0.462000	0.41574	CGC	ARHGAP23	-	NULL	ENSG00000225485		0.637	ARHGAP23-006	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ARHGAP23	HGNC	protein_coding	OTTHUMT00000441789.1	116	0.00	0	G	XM_290799		36626102	36626102	+1	no_errors	ENST00000431231	ensembl	human	known	69_37n	missense	92	23.33	28	SNP	0.760	A
ATN1	1822	genome.wustl.edu	37	12	7045461	7045461	+	Missense_Mutation	SNP	C	C	T			TCGA-A2-A0CL-01A-11D-A10Y-09	TCGA-A2-A0CL-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a630ed59-dd23-45e1-aa16-4f7a98e32728	d7dbbf16-03d9-4e08-9fea-d4fa3d8608d0	g.chr12:7045461C>T	ENST00000356654.4	+	5	1268	c.1031C>T	c.(1030-1032)cCt>cTt	p.P344L	ATN1_ENST00000396684.2_Missense_Mutation_p.P344L	NM_001007026.1	NP_001007027.1	P54259	ATN1_HUMAN	atrophin 1	344					cell migration (GO:0016477)|central nervous system development (GO:0007417)|maintenance of cell polarity (GO:0030011)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuron apoptotic process (GO:0051402)|toxin metabolic process (GO:0009404)|transcription, DNA-templated (GO:0006351)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|nuclear matrix (GO:0016363)|nucleus (GO:0005634)	protein domain specific binding (GO:0019904)|transcription corepressor activity (GO:0003714)			breast(5)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(15)|ovary(2)|pancreas(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(2)	40						GGACTTCCTCCTGGCCCAGAG	0.617																																						dbGAP											0													117.0	120.0	119.0					12																	7045461		2203	4300	6503	-	-	-	SO:0001583	missense	0			U23851	CCDS31734.1	12p	2007-08-01	2005-03-15	2005-03-17		ENSG00000111676			3033	protein-coding gene	gene with protein product		607462	"""dentatorubral-pallidoluysian atrophy (atrophin-1)"""	D12S755E, DRPLA		8136826	Standard	NM_001940		Approved	B37	uc001qrw.1	P54259		ENST00000356654.4:c.1031C>T	12.37:g.7045461C>T	ENSP00000349076:p.Pro344Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q99495|Q99621|Q9UEK7	Missense_Mutation	SNP	pfam_Atrophin-like,prints_Atrophin-1	p.P344L	ENST00000356654.4	37	c.1031	CCDS31734.1	12	.	.	.	.	.	.	.	.	.	.	c	13.05	2.121767	0.37436	.	.	ENSG00000111676	ENST00000356654;ENST00000396684;ENST00000544325	T;T;T	0.54866	0.55;0.55;0.55	3.19	2.29	0.28610	.	0.000000	0.33732	U	0.004606	T	0.24314	0.0589	N	0.03608	-0.345	0.40728	D	0.982725	B;B	0.09022	0.002;0.002	B;B	0.04013	0.001;0.001	T	0.03493	-1.1031	10	0.33940	T	0.23	.	6.3141	0.21180	0.0:0.8583:0.0:0.1417	.	344;344	Q86V38;P54259	.;ATN1_HUMAN	L	344	ENSP00000349076:P344L;ENSP00000379915:P344L;ENSP00000441744:P344L	ENSP00000349076:P344L	P	+	2	0	ATN1	6915722	0.889000	0.30405	0.998000	0.56505	0.905000	0.53344	3.613000	0.54152	0.689000	0.31550	-0.235000	0.12190	CCT	ATN1	-	NULL	ENSG00000111676		0.617	ATN1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ATN1	HGNC	protein_coding	OTTHUMT00000401948.2	138	0.00	0	C	NM_001940		7045461	7045461	+1	no_errors	ENST00000356654	ensembl	human	known	69_37n	missense	150	16.20	29	SNP	0.995	T
MGME1	92667	genome.wustl.edu	37	20	17970619	17970619	+	Nonsense_Mutation	SNP	G	G	A			TCGA-A2-A0CL-01A-11D-A10Y-09	TCGA-A2-A0CL-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a630ed59-dd23-45e1-aa16-4f7a98e32728	d7dbbf16-03d9-4e08-9fea-d4fa3d8608d0	g.chr20:17970619G>A	ENST00000377704.4	+	3	635	c.549G>A	c.(547-549)tgG>tgA	p.W183*	MGME1_ENST00000377710.5_Missense_Mutation_p.G301E|MGME1_ENST00000467391.1_3'UTR|MGME1_ENST00000377709.1_Missense_Mutation_p.G221E					mitochondrial genome maintenance exonuclease 1																		TACAAAGATGGATCACCTGCC	0.453																																						dbGAP											0													135.0	129.0	131.0					20																	17970619		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0				CCDS13131.1	20p11.23	2013-08-29	2013-01-11	2013-01-11	ENSG00000125871	ENSG00000125871			16205	protein-coding gene	gene with protein product		615076	"""chromosome 20 open reading frame 72"""	C20orf72		23313956, 23358826, 23434322	Standard	NM_052865		Approved	bA504H3.4, DDK1	uc002wqh.3	Q9BQP7	OTTHUMG00000031955	ENST00000377704.4:c.549G>A	20.37:g.17970619G>A	ENSP00000366933:p.Trp183*	Somatic		WXS	Illumina GAIIx	Phase_IV		Nonsense_Mutation	SNP	NULL	p.W183*	ENST00000377704.4	37	c.549		20	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	16.37|16.37	3.104972|3.104972	0.56291|0.56291	.|.	.|.	ENSG00000125871|ENSG00000125871	ENST00000377710;ENST00000377709|ENST00000377704	T;T|.	0.66280|.	-0.2;-0.01|.	6.17|6.17	5.23|5.23	0.72850|0.72850	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|.	0.78432|.	0.4282|.	M|M	0.88181|0.88181	2.935|2.935	0.80722|0.80722	D|D	1|1	D|.	0.89917|.	1.0|.	D|.	0.97110|.	1.0|.	T|.	0.79045|.	-0.1964|.	10|.	0.87932|0.29301	D|T	0|0.29	-26.2404|-26.2404	14.558|14.558	0.68115|0.68115	0.0707:0.0:0.9293:0.0|0.0707:0.0:0.9293:0.0	.|.	301|.	Q9BQP7|.	CT072_HUMAN|.	E|X	301;221|183	ENSP00000366939:G301E;ENSP00000366938:G221E|.	ENSP00000366938:G221E|ENSP00000366933:W183X	G|W	+|+	2|3	0|0	C20orf72|C20orf72	17918619|17918619	1.000000|1.000000	0.71417|0.71417	0.609000|0.609000	0.28983|0.28983	0.096000|0.096000	0.18686|0.18686	9.128000|9.128000	0.94424|0.94424	1.632000|1.632000	0.50472|0.50472	-0.140000|-0.140000	0.14226|0.14226	GGA|TGG	C20orf72	-	NULL	ENSG00000125871		0.453	MGME1-003	KNOWN	basic	protein_coding	C20orf72	HGNC	protein_coding	OTTHUMT00000078141.1	263	0.00	0	G	NM_052865		17970619	17970619	+1	no_errors	ENST00000377704	ensembl	human	known	69_37n	nonsense	236	14.13	39	SNP	1.000	A
C9orf114	51490	genome.wustl.edu	37	9	131587304	131587304	+	Missense_Mutation	SNP	C	C	G			TCGA-A2-A0CL-01A-11D-A10Y-09	TCGA-A2-A0CL-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a630ed59-dd23-45e1-aa16-4f7a98e32728	d7dbbf16-03d9-4e08-9fea-d4fa3d8608d0	g.chr9:131587304C>G	ENST00000361256.5	-	8	704	c.664G>C	c.(664-666)Gag>Cag	p.E222Q		NM_016390.3	NP_057474.2	Q5T280	CI114_HUMAN	chromosome 9 open reading frame 114	222							poly(A) RNA binding (GO:0044822)			kidney(2)|large_intestine(4)|ovary(1)	7						AGCCCGGGCTCCAGGTTCTTG	0.592																																						dbGAP											0													22.0	23.0	23.0					9																	131587304		2198	4295	6493	-	-	-	SO:0001583	missense	0				CCDS6913.1	9q34.11	2014-05-29			ENSG00000198917	ENSG00000198917			26933	protein-coding gene	gene with protein product	"""centromere protein 32"""					20813266	Standard	NM_016390		Approved	HSPC109, CENP-32	uc004bwd.3	Q5T280	OTTHUMG00000020762	ENST00000361256.5:c.664G>C	9.37:g.131587304C>G	ENSP00000354812:p.Glu222Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	Q0D2P6|Q6P469|Q6PGP9|Q6PIJ1|Q6PJV9	Missense_Mutation	SNP	pfam_Put_MeTrfase,superfamily_NA-bd_OB-fold-like	p.E222Q	ENST00000361256.5	37	c.664	CCDS6913.1	9	.	.	.	.	.	.	.	.	.	.	C	8.512	0.866810	0.17250	.	.	ENSG00000198917	ENST00000361256;ENST00000372618	T	0.44083	0.93	5.6	5.6	0.85130	Nucleic acid-binding, OB-fold-like (1);	0.204049	0.52532	D	0.000068	T	0.17365	0.0417	N	0.03608	-0.345	0.33282	D	0.562418	B;B	0.22604	0.072;0.01	B;B	0.22152	0.038;0.009	T	0.29427	-1.0012	10	0.09843	T	0.71	-14.7807	7.9854	0.30210	0.0:0.749:0.1635:0.0875	.	221;222	E7ESY7;Q5T280	.;CI114_HUMAN	Q	222;221	ENSP00000354812:E222Q	ENSP00000354812:E222Q	E	-	1	0	C9orf114	130627125	1.000000	0.71417	1.000000	0.80357	0.959000	0.62525	4.579000	0.60936	2.817000	0.96982	0.549000	0.68633	GAG	C9orf114	-	pfam_Put_MeTrfase,superfamily_NA-bd_OB-fold-like	ENSG00000198917		0.592	C9orf114-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C9orf114	HGNC	protein_coding	OTTHUMT00000054500.1	51	0.00	0	C	NM_016390		131587304	131587304	-1	no_errors	ENST00000361256	ensembl	human	known	69_37n	missense	104	11.11	13	SNP	1.000	G
CARD10	29775	genome.wustl.edu	37	22	37912135	37912135	+	Nonsense_Mutation	SNP	G	G	A			TCGA-A2-A0CL-01A-11D-A10Y-09	TCGA-A2-A0CL-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a630ed59-dd23-45e1-aa16-4f7a98e32728	d7dbbf16-03d9-4e08-9fea-d4fa3d8608d0	g.chr22:37912135G>A	ENST00000403299.1	-	4	760	c.544C>T	c.(544-546)Cag>Tag	p.Q182*	CARD10_ENST00000494166.1_5'Flank|CARD10_ENST00000251973.5_Nonsense_Mutation_p.Q182*			Q9BWT7	CAR10_HUMAN	caspase recruitment domain family, member 10	182					activation of NF-kappaB-inducing kinase activity (GO:0007250)|protein complex assembly (GO:0006461)|regulation of apoptotic process (GO:0042981)	CBM complex (GO:0032449)|cytoplasm (GO:0005737)	receptor signaling complex scaffold activity (GO:0030159)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(5)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	17	Melanoma(58;0.0574)					CAGCGCTCCTGAGCCTGCTGC	0.701																																						dbGAP											0													9.0	10.0	10.0					22																	37912135		2166	4247	6413	-	-	-	SO:0001587	stop_gained	0			AF086324	CCDS13948.1	22q13.1	2008-05-22			ENSG00000100065	ENSG00000100065			16422	protein-coding gene	gene with protein product		607209				11259443, 11356195	Standard	NM_014550		Approved	CARMA3, BIMP1	uc003asu.1	Q9BWT7	OTTHUMG00000150592	ENST00000403299.1:c.544C>T	22.37:g.37912135G>A	ENSP00000384570:p.Gln182*	Somatic		WXS	Illumina GAIIx	Phase_IV	Q14CQ8|Q5TFG6|Q8NC81|Q9UGR5|Q9UGR6|Q9Y3H0	Nonsense_Mutation	SNP	pfam_CARD,superfamily_DEATH-like,pfscan_CARD	p.Q182*	ENST00000403299.1	37	c.544	CCDS13948.1	22	.	.	.	.	.	.	.	.	.	.	G	37	6.462029	0.97585	.	.	ENSG00000100065	ENST00000403299;ENST00000251973	.	.	.	5.06	5.06	0.68205	.	0.144130	0.48767	D	0.000167	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.72032	D	0.01	-32.8477	18.8043	0.92030	0.0:0.0:1.0:0.0	.	.	.	.	X	182	.	ENSP00000251973:Q182X	Q	-	1	0	CARD10	36242081	1.000000	0.71417	0.953000	0.39169	0.995000	0.86356	5.519000	0.67074	2.500000	0.84329	0.563000	0.77884	CAG	CARD10	-	NULL	ENSG00000100065		0.701	CARD10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CARD10	HGNC	protein_coding	OTTHUMT00000318997.1	27	0.00	0	G	NM_014550		37912135	37912135	-1	no_errors	ENST00000251973	ensembl	human	known	69_37n	nonsense	24	17.24	5	SNP	0.992	A
CEP135	9662	genome.wustl.edu	37	4	56883874	56883874	+	Nonsense_Mutation	SNP	C	C	T			TCGA-A2-A0CL-01A-11D-A10Y-09	TCGA-A2-A0CL-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a630ed59-dd23-45e1-aa16-4f7a98e32728	d7dbbf16-03d9-4e08-9fea-d4fa3d8608d0	g.chr4:56883874C>T	ENST00000257287.4	+	22	2987	c.2863C>T	c.(2863-2865)Cga>Tga	p.R955*		NM_025009.4	NP_079285.2	Q66GS9	CP135_HUMAN	centrosomal protein 135kDa	955					centriole replication (GO:0007099)|centriole-centriole cohesion (GO:0010457)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)	centriole (GO:0005814)|centrosome (GO:0005813)|cytosol (GO:0005829)	protein C-terminus binding (GO:0008022)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(9)|lung(26)|ovary(2)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	50	Glioma(25;0.08)|all_neural(26;0.101)					AGCCATGTCTCGATTAGAAGA	0.338																																						dbGAP											0													53.0	52.0	52.0					4																	56883874		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AB014535	CCDS33986.1	4q12	2014-02-20	2005-12-02	2005-12-02	ENSG00000174799	ENSG00000174799			29086	protein-coding gene	gene with protein product		611423	"""KIAA0635"", ""centrosomal protein 4"""	KIAA0635, CEP4		9734811, 14654843	Standard	NM_025009		Approved	FLJ13621	uc003hbi.4	Q66GS9	OTTHUMG00000160748	ENST00000257287.4:c.2863C>T	4.37:g.56883874C>T	ENSP00000257287:p.Arg955*	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RMY0|O75130|Q58F25|Q9H8H7	Nonsense_Mutation	SNP	superfamily_Prefoldin	p.R955*	ENST00000257287.4	37	c.2863	CCDS33986.1	4	.	.	.	.	.	.	.	.	.	.	C	40	8.455989	0.98820	.	.	ENSG00000174799	ENST00000257287	.	.	.	5.39	1.63	0.23807	.	0.172379	0.49916	D	0.000128	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.10636	T	0.68	.	13.2553	0.60074	0.5579:0.4421:0.0:0.0	.	.	.	.	X	955	.	ENSP00000257287:R955X	R	+	1	2	CEP135	56578631	0.210000	0.23517	0.955000	0.39395	0.994000	0.84299	1.799000	0.38824	0.050000	0.15949	-0.262000	0.10625	CGA	CEP135	-	superfamily_Prefoldin	ENSG00000174799		0.338	CEP135-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CEP135	HGNC	protein_coding	OTTHUMT00000362092.2	74	0.00	0	C	NM_025009		56883874	56883874	+1	no_errors	ENST00000257287	ensembl	human	known	69_37n	nonsense	53	10.17	6	SNP	0.970	T
DKFZp434L192	222029	genome.wustl.edu	37	7	56564210	56564210	+	lincRNA	SNP	C	C	T	rs10281482	byFrequency	TCGA-A2-A0CL-01A-11D-A10Y-09	TCGA-A2-A0CL-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a630ed59-dd23-45e1-aa16-4f7a98e32728	d7dbbf16-03d9-4e08-9fea-d4fa3d8608d0	g.chr7:56564210C>T	ENST00000566570.1	+	0	3394					NR_026929.1																						AGCTCCCATACGGCAGGGTCA	0.602													C|||	1258	0.251198	0.4614	0.3098	5008	,	,		17928	0.0109		0.2624	False		,,,				2504	0.1616					dbGAP											0																																										-	-	-			0																															7.37:g.56564210C>T		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000566570.1	37	NULL		7																																																																																			RP11-760D2.11	-	-	ENSG00000261275		0.602	RP11-760D2.11-001	KNOWN	basic	lincRNA	DKFZp434L192	Clone_based_vega_gene	lincRNA	OTTHUMT00000422602.1	8	0.00	0	C			56564210	56564210	+1	no_errors	ENST00000566570	ensembl	human	known	69_37n	rna	14	48.15	13	SNP	0.012	T
ENOX2	10495	genome.wustl.edu	37	X	129769019	129769019	+	Missense_Mutation	SNP	A	A	C			TCGA-A2-A0CL-01A-11D-A10Y-09	TCGA-A2-A0CL-10A-01D-A110-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a630ed59-dd23-45e1-aa16-4f7a98e32728	d7dbbf16-03d9-4e08-9fea-d4fa3d8608d0	g.chrX:129769019A>C	ENST00000370927.1	-	10	1466	c.1445T>G	c.(1444-1446)cTt>cGt	p.L482R	ENOX2_ENST00000370935.1_Missense_Mutation_p.L453R|ENOX2_ENST00000394363.1_Missense_Mutation_p.L453R|ENOX2_ENST00000338144.3_Missense_Mutation_p.L482R			Q16206	ENOX2_HUMAN	ecto-NOX disulfide-thiol exchanger 2	482					cell growth (GO:0016049)|oxidation-reduction process (GO:0055114)|regulation of growth (GO:0040008)|ultradian rhythm (GO:0007624)	cytosol (GO:0005829)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)	nucleic acid binding (GO:0003676)|nucleotide binding (GO:0000166)|protein disulfide oxidoreductase activity (GO:0015035)			breast(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(17)|ovary(1)|prostate(3)	33						GAGTTTTTCAAGTTCAGCTTC	0.358																																					Ovarian(101;828 1506 2951 9500 35258)	dbGAP											0													110.0	96.0	101.0					X																	129769019		2203	4298	6501	-	-	-	SO:0001583	missense	0			AF207881	CCDS14626.1, CCDS14627.1	Xq25	2013-02-12	2007-03-23	2007-03-23	ENSG00000165675	ENSG00000165675		"""RNA binding motif (RRM) containing"""	2259	protein-coding gene	gene with protein product		300282	"""cytosolic ovarian carcinoma antigen 1"""	COVA1		8150545, 11888291	Standard	NM_006375		Approved	APK1, tNOX	uc004evw.3	Q16206	OTTHUMG00000022401	ENST00000370927.1:c.1445T>G	X.37:g.129769019A>C	ENSP00000359965:p.Leu482Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K197|A8K1C2|Q5VTJ1|Q5VTJ2|Q8WUX0|Q9NTP6|Q9UH82	Missense_Mutation	SNP	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	p.L482R	ENST00000370927.1	37	c.1445	CCDS14626.1	X	.	.	.	.	.	.	.	.	.	.	A	18.73	3.685851	0.68157	.	.	ENSG00000165675	ENST00000538435;ENST00000370935;ENST00000338144;ENST00000394363;ENST00000350369;ENST00000370927	T;T	0.27557	1.66;1.66	5.05	5.05	0.67936	.	0.000000	0.64402	D	0.000001	T	0.50837	0.1639	M	0.73962	2.25	0.50467	D	0.99987	D;D	0.59357	0.985;0.985	D;D	0.65573	0.936;0.936	T	0.52003	-0.8633	9	.	.	.	-10.9558	9.9287	0.41507	1.0:0.0:0.0:0.0	.	482;510	Q16206;A4QPE1	ENOX2_HUMAN;.	R	453;453;482;453;510;482	ENSP00000337146:L482R;ENSP00000359965:L482R	.	L	-	2	0	ENOX2	129596700	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	6.536000	0.73842	1.868000	0.54150	0.486000	0.48141	CTT	ENOX2	-	NULL	ENSG00000165675		0.358	ENOX2-004	KNOWN	basic|CCDS	protein_coding	ENOX2	HGNC	protein_coding	OTTHUMT00000058277.1	207	0.00	0	A	NM_182314		129769019	129769019	-1	no_errors	ENST00000338144	ensembl	human	known	69_37n	missense	140	18.13	31	SNP	1.000	C
GLS	2744	genome.wustl.edu	37	2	191827719	191827719	+	3'UTR	SNP	C	C	G			TCGA-A2-A0CL-01A-11D-A10Y-09	TCGA-A2-A0CL-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a630ed59-dd23-45e1-aa16-4f7a98e32728	d7dbbf16-03d9-4e08-9fea-d4fa3d8608d0	g.chr2:191827719C>G	ENST00000320717.3	+	0	2275				GLS_ENST00000409428.1_3'UTR	NM_014905.4	NP_055720.3	O94925	GLSK_HUMAN	glutaminase						cellular amino acid biosynthetic process (GO:0008652)|cellular nitrogen compound metabolic process (GO:0034641)|glutamate biosynthetic process (GO:0006537)|glutamate secretion (GO:0014047)|glutamine catabolic process (GO:0006543)|neurotransmitter secretion (GO:0007269)|protein homotetramerization (GO:0051289)|regulation of respiratory gaseous exchange by neurological system process (GO:0002087)|small molecule metabolic process (GO:0044281)|suckling behavior (GO:0001967)|synaptic transmission (GO:0007268)	mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	glutaminase activity (GO:0004359)			breast(1)|cervix(1)|endometrium(1)|kidney(1)|lung(9)|ovary(1)|skin(1)|urinary_tract(1)	16			OV - Ovarian serous cystadenocarcinoma(117;0.00625)|Epithelial(96;0.0744)|all cancers(119;0.181)		L-Glutamine(DB00130)	GTAATGGTCTCAAATCCCAAG	0.348																																						dbGAP											0													63.0	61.0	62.0					2																	191827719		2203	4300	6503	-	-	-	SO:0001624	3_prime_UTR_variant	0			AB020645	CCDS2308.1, CCDS58744.1	2q32-q34	2013-01-10			ENSG00000115419	ENSG00000115419	3.5.1.2	"""Ankyrin repeat domain containing"""	4331	protein-coding gene	gene with protein product		138280				10048485	Standard	NM_014905		Approved	KIAA0838, GLS1	uc002usf.3	O94925	OTTHUMG00000132701	ENST00000320717.3:c.*7C>G	2.37:g.191827719C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	Q9UL05|Q9UL06|Q9UL07|Q9UN40	Silent	SNP	pfam_Glutaminase,superfamily_Beta-lactam/transpept-like,superfamily_Ankyrin_rpt-contain_dom,pfscan_Ankyrin_rpt-contain_dom	p.L172	ENST00000320717.3	37	c.516	CCDS2308.1	2																																																																																			GLS	-	NULL	ENSG00000115419		0.348	GLS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GLS	HGNC	protein_coding	OTTHUMT00000255999.2	33	0.00	0	C			191827719	191827719	+1	no_start_codon	ENST00000412247	ensembl	human	putative	69_37n	silent	36	16.28	7	SNP	0.001	G
HDX	139324	genome.wustl.edu	37	X	83723943	83723943	+	Missense_Mutation	SNP	C	C	T			TCGA-A2-A0CL-01A-11D-A10Y-09	TCGA-A2-A0CL-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a630ed59-dd23-45e1-aa16-4f7a98e32728	d7dbbf16-03d9-4e08-9fea-d4fa3d8608d0	g.chrX:83723943C>T	ENST00000297977.5	-	3	899	c.788G>A	c.(787-789)cGt>cAt	p.R263H	HDX_ENST00000506585.2_Missense_Mutation_p.R205H|HDX_ENST00000373177.2_Missense_Mutation_p.R263H	NM_001177479.1|NM_144657.4	NP_001170950.1|NP_653258.2	Q7Z353	HDX_HUMAN	highly divergent homeobox	263						nucleus (GO:0005634)	DNA binding (GO:0003677)			breast(1)|endometrium(6)|kidney(2)|large_intestine(12)|liver(1)|lung(19)|ovary(1)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	48						AAACACTTCACGGATTTCCAA	0.438																																					Pancreas(53;231 1169 36156 43751 51139)	dbGAP											0													92.0	88.0	90.0					X																	83723943		2203	4300	6503	-	-	-	SO:0001583	missense	0			BX538112	CCDS35342.1, CCDS55456.1	Xq21.1	2012-03-09	2007-07-13	2007-07-13	ENSG00000165259	ENSG00000165259		"""Homeoboxes / POU class"""	26411	protein-coding gene	gene with protein product			"""chromosome X open reading frame 43"""	CXorf43			Standard	NM_144657		Approved	FLJ30678	uc004eek.2	Q7Z353	OTTHUMG00000021926	ENST00000297977.5:c.788G>A	X.37:g.83723943C>T	ENSP00000297977:p.Arg263His	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K1Y5|B7ZL18|Q5JZB4|Q96NK7	Missense_Mutation	SNP	pfam_Homeodomain,superfamily_Homeodomain-like,smart_Homeodomain,pfscan_Homeodomain	p.R263H	ENST00000297977.5	37	c.788	CCDS35342.1	X	.	.	.	.	.	.	.	.	.	.	C	16.27	3.075934	0.55646	.	.	ENSG00000165259	ENST00000297977;ENST00000373177;ENST00000506585;ENST00000449553	T;T;T;T	0.55760	1.32;1.28;1.32;0.5	5.45	5.45	0.79879	.	0.125179	0.56097	D	0.000026	T	0.50137	0.1598	M	0.65498	2.005	0.53005	D	0.99996	P	0.44429	0.835	B	0.31869	0.137	T	0.61362	-0.7078	10	0.66056	D	0.02	-9.067	18.5662	0.91118	0.0:1.0:0.0:0.0	.	263	Q7Z353	HDX_HUMAN	H	263;205;263;205	ENSP00000297977:R263H;ENSP00000362272:R205H;ENSP00000423670:R263H;ENSP00000387790:R205H	ENSP00000297977:R263H	R	-	2	0	HDX	83610599	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	3.524000	0.53495	2.415000	0.81967	0.513000	0.50165	CGT	HDX	-	NULL	ENSG00000165259		0.438	HDX-003	KNOWN	basic|appris_principal|CCDS	protein_coding	HDX	HGNC	protein_coding	OTTHUMT00000057379.2	72	0.00	0	C	NM_144657		83723943	83723943	-1	no_errors	ENST00000297977	ensembl	human	known	69_37n	missense	82	14.58	14	SNP	1.000	T
HERC2P2	400322	genome.wustl.edu	37	15	23317042	23317042	+	RNA	SNP	C	C	T			TCGA-A2-A0CL-01A-11D-A10Y-09	TCGA-A2-A0CL-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a630ed59-dd23-45e1-aa16-4f7a98e32728	d7dbbf16-03d9-4e08-9fea-d4fa3d8608d0	g.chr15:23317042C>T	ENST00000560464.1	-	0	2602									hect domain and RLD 2 pseudogene 2																		CCGTCCTCTCCCAGCTCACCA	0.572																																						dbGAP											0																																										-	-	-			0			AF041080		15q11.2	2014-03-18			ENSG00000140181				4870	pseudogene	pseudogene						9730612	Standard	NR_002824		Approved	D15F37S3	uc001yvq.2		OTTHUMG00000171926		15.37:g.23317042C>T		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000560464.1	37	NULL		15																																																																																			HERC2P2	-	-	ENSG00000140181		0.572	HERC2P2-001	KNOWN	basic	processed_transcript	HERC2P2	HGNC	pseudogene	OTTHUMT00000415936.1	9	0.00	0	C			23317042	23317042	-1	no_errors	ENST00000560464	ensembl	human	known	69_37n	rna	9	35.71	5	SNP	1.000	T
KLK12	43849	genome.wustl.edu	37	19	51535184	51535184	+	Silent	SNP	G	G	A			TCGA-A2-A0CL-01A-11D-A10Y-09	TCGA-A2-A0CL-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a630ed59-dd23-45e1-aa16-4f7a98e32728	d7dbbf16-03d9-4e08-9fea-d4fa3d8608d0	g.chr19:51535184G>A	ENST00000525263.1	-	3	524	c.405C>T	c.(403-405)acC>acT	p.T135T	CTC-518B2.9_ENST00000594910.1_RNA|KLK12_ENST00000319590.4_Silent_p.T135T|KLK12_ENST00000529888.1_Intron|KLK12_ENST00000250351.4_Silent_p.T135T|KLK12_ENST00000250352.11_Intron			Q9UKR0	KLK12_HUMAN	kallikrein-related peptidase 12	135	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				proteolysis (GO:0006508)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	peptidase activity (GO:0008233)|serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)	p.T135T(1)		endometrium(1)|large_intestine(4)|lung(3)|ovary(1)|skin(1)|stomach(1)|urinary_tract(1)	12		all_neural(266;0.026)		OV - Ovarian serous cystadenocarcinoma(262;0.00328)|GBM - Glioblastoma multiforme(134;0.00399)		CGGTGCCAGCGGTTGCACAGT	0.677																																						dbGAP											1	Substitution - coding silent(1)	large_intestine(1)											62.0	66.0	65.0					19																	51535184		2203	4299	6502	-	-	-	SO:0001819	synonymous_variant	0				CCDS12820.1, CCDS12821.1, CCDS54298.1	19q13.33	2008-02-05	2006-10-27		ENSG00000186474	ENSG00000186474		"""Kallikreins"""	6360	protein-coding gene	gene with protein product		605539	"""kallikrein 12"""			16800724, 16800723	Standard	NM_019598		Approved	KLK-L5	uc002pvh.1	Q9UKR0	OTTHUMG00000165806	ENST00000525263.1:c.405C>T	19.37:g.51535184G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q9UKR1|Q9UKR2	Silent	SNP	pfam_Peptidase_S1_S6,superfamily_Pept_cys/ser_Trypsin-like,smart_Peptidase_S1_S6,prints_Peptidase_S1A,pfscan_Peptidase_S1_S6	p.T135	ENST00000525263.1	37	c.405	CCDS12821.1	19																																																																																			KLK12	-	pfam_Peptidase_S1_S6,superfamily_Pept_cys/ser_Trypsin-like,smart_Peptidase_S1_S6,pfscan_Peptidase_S1_S6	ENSG00000186474		0.677	KLK12-005	KNOWN	basic|appris_candidate|CCDS	protein_coding	KLK12	HGNC	protein_coding	OTTHUMT00000386288.1	66	0.00	0	G	NM_019598		51535184	51535184	-1	no_errors	ENST00000250351	ensembl	human	known	69_37n	silent	36	16.28	7	SNP	0.000	A
MDM2	4193	genome.wustl.edu	37	12	69233129	69233129	+	Missense_Mutation	SNP	C	C	T			TCGA-A2-A0CL-01A-11D-A10Y-09	TCGA-A2-A0CL-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a630ed59-dd23-45e1-aa16-4f7a98e32728	d7dbbf16-03d9-4e08-9fea-d4fa3d8608d0	g.chr12:69233129C>T	ENST00000350057.5	+	9	901	c.901C>T	c.(901-903)Cgt>Tgt	p.R301C	MDM2_ENST00000348801.2_Missense_Mutation_p.R100C|MDM2_ENST00000517852.1_Intron|MDM2_ENST00000356290.4_Missense_Mutation_p.R156C|MDM2_ENST00000393410.1_Missense_Mutation_p.R78C|MDM2_ENST00000360430.2_Missense_Mutation_p.R131C|MDM2_ENST00000545204.1_Intron|MDM2_ENST00000462284.1_Missense_Mutation_p.R332C|MDM2_ENST00000258149.5_Missense_Mutation_p.R271C|MDM2_ENST00000393413.3_Missense_Mutation_p.R53C|MDM2_ENST00000299252.4_Missense_Mutation_p.R156C|MDM2_ENST00000428863.2_Missense_Mutation_p.R105C|MDM2_ENST00000393412.3_Missense_Mutation_p.R53C|MDM2_ENST00000540827.1_Missense_Mutation_p.R131C|MDM2_ENST00000258148.7_Missense_Mutation_p.R277C|MDM2_ENST00000544561.1_Intron|MDM2_ENST00000478070.1_3'UTR|RP11-611O2.5_ENST00000553141.1_RNA			Q00987	MDM2_HUMAN	MDM2 proto-oncogene, E3 ubiquitin protein ligase	326	ARF-binding.|Asp/Glu-rich (acidic).|Interaction with MTBP. {ECO:0000250}.|Necessary for interaction with USP2.|Region II.				cellular response to acid chemical (GO:0071229)|cellular response to alkaloid (GO:0071312)|cellular response to antibiotic (GO:0071236)|cellular response to estrogen stimulus (GO:0071391)|cellular response to hydrogen peroxide (GO:0070301)|cellular response to hypoxia (GO:0071456)|cellular response to peptide hormone stimulus (GO:0071375)|cellular response to UV-C (GO:0071494)|cellular response to vitamin B1 (GO:0071301)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|epidermal growth factor receptor signaling pathway (GO:0007173)|establishment of protein localization (GO:0045184)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell cycle arrest (GO:0071157)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043518)|negative regulation of protein processing (GO:0010955)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-lysine modification (GO:0018205)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of mitotic cell cycle (GO:0045931)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of protein export from nucleus (GO:0046827)|protein complex assembly (GO:0006461)|protein destabilization (GO:0031648)|protein localization to nucleus (GO:0034504)|protein ubiquitination (GO:0016567)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|regulation of protein catabolic process (GO:0042176)|response to antibiotic (GO:0046677)|response to carbohydrate (GO:0009743)|response to cocaine (GO:0042220)|response to drug (GO:0042493)|response to ether (GO:0045472)|response to iron ion (GO:0010039)|response to magnesium ion (GO:0032026)|response to morphine (GO:0043278)|synaptic transmission (GO:0007268)|traversing start control point of mitotic cell cycle (GO:0007089)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endocytic vesicle membrane (GO:0030666)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|synapse (GO:0045202)	enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|ligase activity (GO:0016874)|p53 binding (GO:0002039)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(4)|liver(2)|lung(8)|prostate(1)|urinary_tract(1)	19	all_cancers(1;8.46e-121)|all_epithelial(5;3.21e-36)|Lung NSC(4;2.16e-33)|all_lung(4;3.03e-31)|Glioma(1;1.9e-09)|Breast(13;1.59e-06)|all_neural(1;1.03e-05)|Melanoma(1;0.0171)|Renal(347;0.0684)		all cancers(2;8.67e-65)|GBM - Glioblastoma multiforme(2;8.89e-62)|BRCA - Breast invasive adenocarcinoma(5;2.43e-08)|Lung(24;1.5e-05)|LUAD - Lung adenocarcinoma(15;8.5e-05)|STAD - Stomach adenocarcinoma(21;0.00372)|Kidney(9;0.143)			TTGGGCCCTTCGTGAGAATTG	0.428			A		"""sarcoma, glioma, colorectal, other"""																																	dbGAP		Dom	yes		12	12q15	4193	Mdm2 p53 binding protein homolog		"""M, O, E, L"""	0													117.0	102.0	107.0					12																	69233129		1841	4088	5929	-	-	-	SO:0001583	missense	0				CCDS8986.2, CCDS61189.1	12q13-q14	2014-06-26	2014-06-26		ENSG00000135679	ENSG00000135679			6973	protein-coding gene	gene with protein product		164785	"""mouse double minute 2, human homolog of; p53-binding protein"", ""Mdm2, transformed 3T3 cell double minute 2, p53 binding protein (mouse)"", ""Mdm2 p53 binding protein homolog (mouse)"""			1614537, 16905769	Standard	NM_002392		Approved	HDM2, MGC5370	uc001sui.4	Q00987	OTTHUMG00000142827	ENST00000350057.5:c.901C>T	12.37:g.69233129C>T	ENSP00000266624:p.Arg301Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NL51|A8K2S6|Q13226|Q13297|Q13298|Q13299|Q13300|Q13301|Q53XW0|Q71TW9|Q8WYJ1|Q8WYJ2|Q9UGI3|Q9UMT8	Missense_Mutation	SNP	pfam_SWIB_MDM2_domain,pfam_Znf_RanBP2,superfamily_SWIB_MDM2_domain,pirsf_p53_neg-reg_MDM_2/4,pfscan_Znf_RanBP2,pfscan_Znf_RING	p.R332C	ENST00000350057.5	37	c.994		12	.	.	.	.	.	.	.	.	.	.	C	23.4	4.408764	0.83340	.	.	ENSG00000135679	ENST00000462284;ENST00000544648;ENST00000258149;ENST00000356290;ENST00000540827;ENST00000428863;ENST00000393412;ENST00000311420;ENST00000258148;ENST00000393413;ENST00000350057;ENST00000393410;ENST00000299252;ENST00000360430;ENST00000348801	T;T;T;T;T;T;T;T;T;T;T;T;T	0.60040	0.22;0.22;0.22;0.22;0.22;0.22;0.22;0.22;0.22;0.22;0.22;0.22;0.22	5.5	4.59	0.56863	Zinc finger, RanBP2-type (2);	0.000000	0.85682	D	0.000000	T	0.75481	0.3855	M	0.77313	2.365	0.80722	D	1	D;D;D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D;D;D	0.97110	1.0;1.0;1.0;0.999;1.0;0.999;1.0;1.0;0.999	T	0.76244	-0.3030	9	.	.	.	-0.0928	15.3462	0.74340	0.0:0.9291:0.0:0.0709	.	281;105;53;78;156;326;277;131;332	Q00987-9;Q00987-3;Q00987-4;Q9H4C5;Q00987-5;Q00987;G3XA89;Q00987-2;Q00987-11	.;.;.;.;.;MDM2_HUMAN;.;.;.	C	332;281;271;156;131;105;53;287;277;53;301;78;156;131;100	ENSP00000417281:R332C;ENSP00000258149:R271C;ENSP00000348637:R156C;ENSP00000440932:R131C;ENSP00000410694:R105C;ENSP00000377064:R53C;ENSP00000258148:R277C;ENSP00000377065:R53C;ENSP00000266624:R301C;ENSP00000377062:R78C;ENSP00000299252:R156C;ENSP00000353611:R131C;ENSP00000335096:R100C	.	R	+	1	0	MDM2	67519396	1.000000	0.71417	1.000000	0.80357	0.714000	0.41099	4.001000	0.57046	2.754000	0.94517	0.650000	0.86243	CGT	MDM2	-	pfam_Znf_RanBP2,pirsf_p53_neg-reg_MDM_2/4,pfscan_Znf_RanBP2	ENSG00000135679		0.428	MDM2-033	NOVEL	basic|exp_conf	protein_coding	MDM2	HGNC	protein_coding	OTTHUMT00000402665.1	105	0.00	0	C	NM_006880		69233129	69233129	+1	no_errors	ENST00000462284	ensembl	human	known	69_37n	missense	112	10.40	13	SNP	1.000	T
MEP1A	4224	genome.wustl.edu	37	6	46803035	46803035	+	Silent	SNP	G	G	A			TCGA-A2-A0CL-01A-11D-A10Y-09	TCGA-A2-A0CL-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a630ed59-dd23-45e1-aa16-4f7a98e32728	d7dbbf16-03d9-4e08-9fea-d4fa3d8608d0	g.chr6:46803035G>A	ENST00000230588.4	+	13	1842	c.1833G>A	c.(1831-1833)ctG>ctA	p.L611L		NM_005588.2	NP_005579.2	Q16819	MEP1A_HUMAN	meprin A, alpha (PABA peptide hydrolase)	611					digestion (GO:0007586)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|meprin A complex (GO:0017090)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|endometrium(5)|kidney(2)|large_intestine(4)|lung(21)|ovary(1)|pancreas(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	42			Lung(136;0.192)			GCAAAAGACTGAGCCCCCAAG	0.522																																						dbGAP											0													16.0	15.0	15.0					6																	46803035		2203	4297	6500	-	-	-	SO:0001819	synonymous_variant	0				CCDS4918.1	6p12-p11	2010-10-18			ENSG00000112818	ENSG00000112818	3.4.24.18		7015	protein-coding gene	gene with protein product		600388				7774936	Standard	NM_005588		Approved	PPHA	uc010jzh.1	Q16819	OTTHUMG00000014790	ENST00000230588.4:c.1833G>A	6.37:g.46803035G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A2RRM4|B0AZP9|B2RCS2|Q8TDC9|Q9H1R1	Silent	SNP	pirsf_Pept_M12A_Meprin,pfam_Peptidase_M12A,pfam_MATH,pfam_MAM_dom,pfam_EGF-like_dom,superfamily_TRAF-like,superfamily_ConA-like_lec_gl,smart_Peptidase_Metallo,smart_MAM_dom,smart_MATH,prints_Peptidase_M12A,prints_MAM_dom,pfscan_EG-like_dom,pfscan_MATH,pfscan_MAM_dom	p.L611	ENST00000230588.4	37	c.1833	CCDS4918.1	6																																																																																			MEP1A	-	pirsf_Pept_M12A_Meprin	ENSG00000112818		0.522	MEP1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MEP1A	HGNC	protein_coding	OTTHUMT00000040803.1	52	0.00	0	G	NM_005588		46803035	46803035	+1	no_errors	ENST00000230588	ensembl	human	known	69_37n	silent	51	15.00	9	SNP	0.000	A
MRC2	9902	genome.wustl.edu	37	17	60765922	60765922	+	Nonsense_Mutation	SNP	C	C	A			TCGA-A2-A0CL-01A-11D-A10Y-09	TCGA-A2-A0CL-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a630ed59-dd23-45e1-aa16-4f7a98e32728	d7dbbf16-03d9-4e08-9fea-d4fa3d8608d0	g.chr17:60765922C>A	ENST00000303375.5	+	22	3524	c.3122C>A	c.(3121-3123)tCg>tAg	p.S1041*	MRC2_ENST00000446119.2_5'UTR	NM_006039.4	NP_006030.2	Q9UBG0	MRC2_HUMAN	mannose receptor, C type 2	1041	C-type lectin 6. {ECO:0000255|PROSITE- ProRule:PRU00040}.				collagen catabolic process (GO:0030574)|endocytosis (GO:0006897)|osteoblast differentiation (GO:0001649)	focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	carbohydrate binding (GO:0030246)|collagen binding (GO:0005518)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(2)|kidney(2)|large_intestine(11)|lung(28)|ovary(2)|prostate(1)|skin(3)	53						CTCCATGCCTCGCAGAGGGAC	0.567																																						dbGAP											0													140.0	140.0	140.0					17																	60765922		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AB014609	CCDS11634.1	17q23	2011-08-30				ENSG00000011028		"""CD molecules"", ""C-type lectin domain containing"""	16875	protein-coding gene	gene with protein product		612264				9734811, 8702911	Standard	NM_006039		Approved	KIAA0709, ENDO180, CLEC13E, CD280	uc002jad.4	Q9UBG0		ENST00000303375.5:c.3122C>A	17.37:g.60765922C>A	ENSP00000307513:p.Ser1041*	Somatic		WXS	Illumina GAIIx	Phase_IV	A6H8K4|D3DU08|Q7LGE7|Q9Y5P9	Nonsense_Mutation	SNP	pfam_C-type_lectin,pfam_FN_type2_col-bd,pfam_Herpes_UL45-like,superfamily_C-type_lectin_fold,superfamily_Ricin_B_lectin,superfamily_Kringle-like,smart_Ricin_B_lectin,smart_FN_type2_col-bd,smart_C-type_lectin,prints_AntifreezeII,pfscan_FN_type2_col-bd,pfscan_C-type_lectin,pfscan_Ricin_B_lectin	p.S1041*	ENST00000303375.5	37	c.3122	CCDS11634.1	17	.	.	.	.	.	.	.	.	.	.	C	44	10.624926	0.99439	.	.	ENSG00000011028	ENST00000303375	.	.	.	4.36	4.36	0.52297	.	0.542864	0.19421	N	0.114690	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-8.5267	17.0721	0.86577	0.0:1.0:0.0:0.0	.	.	.	.	X	1041	.	ENSP00000307513:S1041X	S	+	2	0	MRC2	58119654	0.999000	0.42202	0.974000	0.42286	0.630000	0.37929	4.347000	0.59373	2.238000	0.73509	0.462000	0.41574	TCG	MRC2	-	pfam_C-type_lectin,superfamily_C-type_lectin_fold,smart_C-type_lectin,pfscan_C-type_lectin	ENSG00000011028		0.567	MRC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MRC2	HGNC	protein_coding	OTTHUMT00000445152.1	200	0.00	0	C			60765922	60765922	+1	no_errors	ENST00000303375	ensembl	human	known	69_37n	nonsense	202	12.55	29	SNP	0.866	A
NBPF10	100132406	genome.wustl.edu	37	1	145323656	145323656	+	Missense_Mutation	SNP	A	A	T	rs75252120	byFrequency	TCGA-A2-A0CL-01A-11D-A10Y-09	TCGA-A2-A0CL-10A-01D-A110-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a630ed59-dd23-45e1-aa16-4f7a98e32728	d7dbbf16-03d9-4e08-9fea-d4fa3d8608d0	g.chr1:145323656A>T	ENST00000342960.5	+	27	3528	c.3493A>T	c.(3493-3495)Att>Ttt	p.I1165F	NBPF10_ENST00000369339.3_Intron|NBPF10_ENST00000369338.1_Intron	NM_001039703.4	NP_001034792.4	Q6P3W6	NBPFA_HUMAN	neuroblastoma breakpoint family, member 10	752						cytoplasm (GO:0005737)	poly(A) RNA binding (GO:0044822)	p.I1165F(3)		NS(3)|breast(1)|central_nervous_system(3)|endometrium(12)|kidney(23)|lung(15)|ovary(1)|prostate(7)|skin(6)|urinary_tract(2)	73	all_hematologic(923;0.032)			Colorectal(1306;1.36e-07)|KIRC - Kidney renal clear cell carcinoma(1967;0.00258)		TATTGCAGGAATTAAAAAGGA	0.473																																						dbGAP											3	Substitution - Missense(3)	endometrium(2)|kidney(1)																																								-	-	-	SO:0001583	missense	0			BC021111		1q21.1	2013-01-17			ENSG00000163386	ENSG00000271425		"""neuroblastoma breakpoint family"""	31992	protein-coding gene	gene with protein product		614000				16079250	Standard	NM_001039703		Approved	AG1		Q6P3W6	OTTHUMG00000013757	ENST00000342960.5:c.3493A>T	1.37:g.145323656A>T	ENSP00000345684:p.Ile1165Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5RHC0|Q9NWN6	Missense_Mutation	SNP	pfam_NBPF_dom	p.I1165F	ENST00000342960.5	37	c.3493	CCDS53355.1	1	.	.	.	.	.	.	.	.	.	.	.	7.524	0.657305	0.14580	.	.	ENSG00000163386	ENST00000342960	T	0.03441	3.93	.	.	.	.	.	.	.	.	T	0.02342	0.0072	M	0.67953	2.075	0.09310	N	1	.	.	.	.	.	.	T	0.44065	-0.9352	5	0.28530	T	0.3	.	.	.	.	.	.	.	.	F	1165	ENSP00000345684:I1165F	ENSP00000345684:I1165F	I	+	1	0	NBPF10	144035013	0.353000	0.24904	0.005000	0.12908	0.123000	0.20343	1.122000	0.31295	0.386000	0.24997	0.128000	0.15822	ATT	NBPF10	-	NULL	ENSG00000163386		0.473	NBPF10-201	KNOWN	basic|appris_principal|CCDS	protein_coding	NBPF10	HGNC	protein_coding		47	0.00	0	A	NM_001039703		145323656	145323656	+1	no_errors	ENST00000342960	ensembl	human	known	69_37n	missense	30	11.76	4	SNP	0.007	T
POFUT2	23275	genome.wustl.edu	37	21	46705636	46705636	+	Silent	SNP	G	G	A			TCGA-A2-A0CL-01A-11D-A10Y-09	TCGA-A2-A0CL-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a630ed59-dd23-45e1-aa16-4f7a98e32728	d7dbbf16-03d9-4e08-9fea-d4fa3d8608d0	g.chr21:46705636G>A	ENST00000349485.5	-	2	365	c.339C>T	c.(337-339)ctC>ctT	p.L113L	POFUT2_ENST00000471540.1_5'Flank|BX322557.10_ENST00000454115.2_RNA|POFUT2_ENST00000331343.7_Silent_p.L113L	NM_133635.4	NP_598368.2	Q9Y2G5	OFUT2_HUMAN	protein O-fucosyltransferase 2	113					fucose metabolic process (GO:0006004)|mesoderm formation (GO:0001707)|protein O-linked fucosylation (GO:0036066)|regulation of epithelial to mesenchymal transition (GO:0010717)|regulation of gene expression (GO:0010468)|regulation of secretion (GO:0051046)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)	peptide-O-fucosyltransferase activity (GO:0046922)			breast(1)|endometrium(1)|kidney(2)|large_intestine(2)|liver(1)|lung(9)|skin(2)|upper_aerodigestive_tract(2)	20				Colorectal(79;0.243)		TGTTTTTATTGAGACTTGGAA	0.567																																						dbGAP											0													86.0	96.0	93.0					21																	46705636		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AJ203079	CCDS13719.1, CCDS13721.1	21q22.3	2013-03-06	2004-06-07	2004-06-09	ENSG00000186866	ENSG00000186866	2.4.1.221	"""Fucosyltransferases"""	14683	protein-coding gene	gene with protein product	"""peptide-O-fucosyltransferase"", ""GDP-fucose protein O-fucosyltransferase 2"""	610249	"""chromosome 21 open reading frame 80"""	C21orf80			Standard	NM_133635		Approved	KIAA0958, FUT13	uc002zhc.3	Q9Y2G5	OTTHUMG00000084874	ENST00000349485.5:c.339C>T	21.37:g.46705636G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q6PJV1|Q7Z4N0|Q8WWU6|Q9BQS4|Q9BQS5|Q9UFY3	Silent	SNP	pfam_GDP-Fuc_O-FucTrfase,superfamily_DUF749	p.L113	ENST00000349485.5	37	c.339	CCDS13719.1	21																																																																																			POFUT2	-	pfam_GDP-Fuc_O-FucTrfase	ENSG00000186866		0.567	POFUT2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	POFUT2	HGNC	protein_coding	OTTHUMT00000192573.2	119	0.00	0	G	NM_015227		46705636	46705636	-1	no_errors	ENST00000349485	ensembl	human	known	69_37n	silent	103	10.43	12	SNP	0.998	A
POM121L9P	29774	genome.wustl.edu	37	22	24659631	24659634	+	RNA	DEL	CCGG	CCGG	-	rs117459483|rs371456034|rs117307447	byFrequency	TCGA-A2-A0CL-01A-11D-A10Y-09	TCGA-A2-A0CL-10A-01D-A110-09	CCGG	CCGG					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a630ed59-dd23-45e1-aa16-4f7a98e32728	d7dbbf16-03d9-4e08-9fea-d4fa3d8608d0	g.chr22:24659631_24659634delCCGG	ENST00000414583.2	+	0	3156_3159					NR_003714.1				POM121 transmembrane nucleoporin-like 9, pseudogene																		TGCGGCCACACCGGCCGGACACGT	0.642														31	0.0061901	0.0234	0.0	5008	,	,		24612	0.0		0.0	False		,,,				2504	0.0					dbGAP											0																																										-	-	-			0			AL040062, AL117401		22q11.22	2012-03-13	2012-03-13		ENSG00000128262	ENSG00000128262			30080	pseudogene	pseudogene			"""POM121 membrane glycoprotein-like 9, pseudogene"""				Standard	NR_003714		Approved				OTTHUMG00000150763		22.37:g.24659635_24659638delCCGG		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	DEL	-	NULL	ENST00000414583.2	37	NULL		22																																																																																			POM121L9P	-	-	ENSG00000128262		0.642	POM121L9P-001	KNOWN	basic	processed_transcript	POM121L9P	HGNC	pseudogene	OTTHUMT00000319991.1	55	0.00	0	CCGG	NM_014549		24659631	24659634	+1	no_errors	ENST00000414583	ensembl	human	known	69_37n	rna	36	10.00	4	DEL	0.995:0.996:0.997:0.998	-
PYGB	5834	genome.wustl.edu	37	20	25252034	25252034	+	Missense_Mutation	SNP	C	C	T			TCGA-A2-A0CL-01A-11D-A10Y-09	TCGA-A2-A0CL-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a630ed59-dd23-45e1-aa16-4f7a98e32728	d7dbbf16-03d9-4e08-9fea-d4fa3d8608d0	g.chr20:25252034C>T	ENST00000216962.4	+	4	550	c.440C>T	c.(439-441)tCa>tTa	p.S147L		NM_002862.3	NP_002853.2	P11216	PYGB_HUMAN	phosphorylase, glycogen; brain	147					carbohydrate metabolic process (GO:0005975)|glucose metabolic process (GO:0006006)|glycogen catabolic process (GO:0005980)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	glycogen phosphorylase activity (GO:0008184)|pyridoxal phosphate binding (GO:0030170)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(4)|lung(12)|ovary(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	31						TTCCTTGACTCAATGGCTACC	0.507																																						dbGAP											0													231.0	212.0	218.0					20																	25252034		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS13171.1	20p11.21	2013-03-01			ENSG00000100994	ENSG00000100994	2.4.1.1	"""Glycogen phosphorylases"""	9723	protein-coding gene	gene with protein product	"""glycogen phosphorylase, brain form"""	138550					Standard	NM_002862		Approved		uc002wup.3	P11216	OTTHUMG00000032117	ENST00000216962.4:c.440C>T	20.37:g.25252034C>T	ENSP00000216962:p.Ser147Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q96AK1|Q9NPX8	Missense_Mutation	SNP	pfam_Glyco_trans_35,pirsf_Glyco_trans_35,tigrfam_Glycg_phsphrylas	p.S147L	ENST00000216962.4	37	c.440	CCDS13171.1	20	.	.	.	.	.	.	.	.	.	.	C	24.1	4.489285	0.84962	.	.	ENSG00000100994	ENST00000216962	D	0.95690	-3.78	4.08	4.08	0.47627	.	0.000000	0.85682	D	0.000000	D	0.98723	0.9571	H	0.98738	4.315	0.80722	D	1	D	0.76494	0.999	D	0.78314	0.991	D	0.99437	1.0937	10	0.87932	D	0	-17.7289	16.4443	0.83913	0.0:1.0:0.0:0.0	.	147	P11216	PYGB_HUMAN	L	147	ENSP00000216962:S147L	ENSP00000216962:S147L	S	+	2	0	PYGB	25200034	1.000000	0.71417	1.000000	0.80357	0.750000	0.42670	7.525000	0.81892	2.256000	0.74724	0.563000	0.77884	TCA	PYGB	-	pfam_Glyco_trans_35,pirsf_Glyco_trans_35,tigrfam_Glycg_phsphrylas	ENSG00000100994		0.507	PYGB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PYGB	HGNC	protein_coding	OTTHUMT00000078415.2	530	0.38	2	C	NM_002862		25252034	25252034	+1	no_errors	ENST00000216962	ensembl	human	known	69_37n	missense	570	19.49	138	SNP	1.000	T
REV1	51455	genome.wustl.edu	37	2	100046338	100046338	+	Nonsense_Mutation	SNP	G	G	C			TCGA-A2-A0CL-01A-11D-A10Y-09	TCGA-A2-A0CL-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a630ed59-dd23-45e1-aa16-4f7a98e32728	d7dbbf16-03d9-4e08-9fea-d4fa3d8608d0	g.chr2:100046338G>C	ENST00000258428.3	-	9	1739	c.1511C>G	c.(1510-1512)tCa>tGa	p.S504*	REV1_ENST00000393445.3_Nonsense_Mutation_p.S503*|REV1_ENST00000465835.1_5'UTR	NM_001037872.1|NM_016316.2	NP_001032961.1|NP_057400.1	Q9UBZ9	REV1_HUMAN	REV1, polymerase (DNA directed)	504	UmuC. {ECO:0000255|PROSITE- ProRule:PRU00216}.				DNA repair (GO:0006281)|DNA replication (GO:0006260)|DNA-dependent DNA replication (GO:0006261)|error-prone translesion synthesis (GO:0042276)|response to UV (GO:0009411)	nucleoplasm (GO:0005654)	damaged DNA binding (GO:0003684)|deoxycytidyl transferase activity (GO:0017125)|DNA-directed DNA polymerase activity (GO:0003887)|magnesium ion binding (GO:0000287)			NS(1)|breast(1)|endometrium(2)|kidney(1)|large_intestine(14)|lung(12)|ovary(2)|prostate(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	39						TTCAGCCCTTGACAAAACAGA	0.299								Direct reversal of damage																														dbGAP											0													83.0	79.0	80.0					2																	100046338		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AF206019	CCDS2045.1, CCDS42722.1	2q11.1-q11.2	2012-05-18	2012-05-18	2006-11-07	ENSG00000135945	ENSG00000135945		"""DNA polymerases"""	14060	protein-coding gene	gene with protein product		606134	"""REV1 (yeast homolog)- like"", ""REV1-like (yeast)"", ""REV1 homolog (S. cerevisiae)"""	REV1L		10536157	Standard	XM_005263968		Approved		uc002tad.3	Q9UBZ9	OTTHUMG00000130636	ENST00000258428.3:c.1511C>G	2.37:g.100046338G>C	ENSP00000258428:p.Ser504*	Somatic		WXS	Illumina GAIIx	Phase_IV	O95941|Q53SI7|Q9C0J4|Q9NUP2	Nonsense_Mutation	SNP	pfam_DNA_repair_prot_UmuC-like,pfam_DNA_pol_Y-fam_little_finger,pfam_BRCT_dom,superfamily_BRCT_dom,superfamily_DNA_pol_Y-fam_little_finger,smart_BRCT_dom,pirsf_REV1,pfscan_BRCT_dom,pfscan_DNA_repair_prot_UmuC-like_N	p.S504*	ENST00000258428.3	37	c.1511	CCDS2045.1	2	.	.	.	.	.	.	.	.	.	.	G	22.6	4.313513	0.81358	.	.	ENSG00000135945	ENST00000393445;ENST00000258428;ENST00000450415	.	.	.	5.52	5.52	0.82312	.	0.058331	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.72032	D	0.01	.	19.4462	0.94847	0.0:0.0:1.0:0.0	.	.	.	.	X	503;504;141	.	ENSP00000258428:S504X	S	-	2	0	REV1	99412770	1.000000	0.71417	1.000000	0.80357	0.876000	0.50452	8.872000	0.92352	2.583000	0.87209	0.650000	0.86243	TCA	REV1	-	pfam_DNA_repair_prot_UmuC-like,pirsf_REV1,pfscan_DNA_repair_prot_UmuC-like_N	ENSG00000135945		0.299	REV1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	REV1	HGNC	protein_coding	OTTHUMT00000253123.2	121	0.00	0	G	NM_016316		100046338	100046338	-1	no_errors	ENST00000258428	ensembl	human	known	69_37n	nonsense	111	10.48	13	SNP	1.000	C
SCN2A	6326	genome.wustl.edu	37	2	166179704	166179704	+	Missense_Mutation	SNP	A	A	T			TCGA-A2-A0CL-01A-11D-A10Y-09	TCGA-A2-A0CL-10A-01D-A110-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a630ed59-dd23-45e1-aa16-4f7a98e32728	d7dbbf16-03d9-4e08-9fea-d4fa3d8608d0	g.chr2:166179704A>T	ENST00000375437.2	+	12	2000	c.1710A>T	c.(1708-1710)agA>agT	p.R570S	SCN2A_ENST00000375427.2_Missense_Mutation_p.R570S|SCN2A_ENST00000357398.3_Missense_Mutation_p.R570S|SCN2A_ENST00000283256.6_Missense_Mutation_p.R570S	NM_001040142.1	NP_001035232.1	Q99250	SCN2A_HUMAN	sodium channel, voltage-gated, type II, alpha subunit	570					intrinsic apoptotic signaling pathway in response to osmotic stress (GO:0008627)|membrane depolarization during action potential (GO:0086010)|myelination (GO:0042552)|neuron apoptotic process (GO:0051402)|neuronal action potential (GO:0019228)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	axon (GO:0030424)|integral component of plasma membrane (GO:0005887)|intercalated disc (GO:0014704)|intrinsic component of plasma membrane (GO:0031226)|node of Ranvier (GO:0033268)|paranode region of axon (GO:0033270)|plasma membrane (GO:0005886)|sodium channel complex (GO:0034706)|T-tubule (GO:0030315)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)			NS(1)|breast(7)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(27)|liver(2)|lung(49)|ovary(6)|pancreas(1)|prostate(2)|skin(8)|upper_aerodigestive_tract(1)|urinary_tract(2)	118					Lamotrigine(DB00555)|Propofol(DB00818)|Valproic Acid(DB00313)|Zonisamide(DB00909)	TCTCTCCAAGACGCAACAGTA	0.458																																						dbGAP											0													63.0	58.0	60.0					2																	166179704		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB208888	CCDS33313.1, CCDS33314.1	2q24.3	2012-02-26	2007-01-23	2007-01-23	ENSG00000136531	ENSG00000136531		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10588	protein-coding gene	gene with protein product		182390	"""sodium channel, voltage-gated, type II, alpha 2 polypeptide"", ""sodium channel, voltage-gated, type II, alpha 1 polypeptide"""	SCN2A1, SCN2A2		1317301, 16382098	Standard	XM_005246753		Approved	Nav1.2, HBSCII, HBSCI	uc002ude.3	Q99250	OTTHUMG00000044172	ENST00000375437.2:c.1710A>T	2.37:g.166179704A>T	ENSP00000364586:p.Arg570Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NC14|A6NIQ5|Q14472|Q53T77|Q9BZC9|Q9BZD0	Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_Na_trans_assoc,pfam_DUF3451,pfam_PKD1_2_channel,smart_IQ_motif_EF-hand-BS,prints_Na_channel_asu,prints_PKD_2,pfscan_IQ_motif_EF-hand-BS	p.R570S	ENST00000375437.2	37	c.1710	CCDS33314.1	2	.	.	.	.	.	.	.	.	.	.	A	21.1	4.105294	0.77096	.	.	ENSG00000136531	ENST00000375437;ENST00000357398;ENST00000283256;ENST00000375427	D;D;D;D	0.96619	-4.07;-4.07;-4.07;-4.07	5.4	4.26	0.50523	Domain of unknown function DUF3451 (1);	0.000000	0.64402	D	0.000001	D	0.97851	0.9294	M	0.91872	3.25	0.50039	D	0.999844	P;D	0.67145	0.765;0.996	P;D	0.87578	0.479;0.998	D	0.97620	1.0135	10	0.72032	D	0.01	.	4.4339	0.11542	0.7138:0.0:0.2862:0.0	.	570;570	Q99250-2;Q99250	.;SCN2A_HUMAN	S	570	ENSP00000364586:R570S;ENSP00000349973:R570S;ENSP00000283256:R570S;ENSP00000364576:R570S	ENSP00000283256:R570S	R	+	3	2	SCN2A	165887950	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	1.603000	0.36794	2.062000	0.61559	0.519000	0.50382	AGA	SCN2A	-	pfam_DUF3451	ENSG00000136531		0.458	SCN2A-202	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SCN2A	HGNC	protein_coding	OTTHUMT00000102659.2	39	0.00	0	A	NM_021007		166179704	166179704	+1	no_errors	ENST00000283256	ensembl	human	known	69_37n	missense	49	15.52	9	SNP	1.000	T
SLC2A2	6514	genome.wustl.edu	37	3	170736326	170736326	+	Silent	SNP	A	A	G			TCGA-A2-A0CL-01A-11D-A10Y-09	TCGA-A2-A0CL-10A-01D-A110-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a630ed59-dd23-45e1-aa16-4f7a98e32728	d7dbbf16-03d9-4e08-9fea-d4fa3d8608d0	g.chr3:170736326A>G	ENST00000314251.3	-	2	181	c.102T>C	c.(100-102)ccT>ccC	p.P34P	SLC2A2_ENST00000382808.4_Missense_Mutation_p.L3P	NM_000340.1	NP_000331.1	P11168	GTR2_HUMAN	solute carrier family 2 (facilitated glucose transporter), member 2	34					carbohydrate metabolic process (GO:0005975)|endocrine pancreas development (GO:0031018)|energy reserve metabolic process (GO:0006112)|glucose transport (GO:0015758)|hexose transmembrane transport (GO:0035428)|hexose transport (GO:0008645)|regulation of insulin secretion (GO:0050796)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)	brush border (GO:0005903)|cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	D-glucose transmembrane transporter activity (GO:0055056)|dehydroascorbic acid transporter activity (GO:0033300)|glucose transmembrane transporter activity (GO:0005355)|hexose transmembrane transporter activity (GO:0015149)			central_nervous_system(1)|endometrium(2)|large_intestine(9)|lung(9)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	24	all_cancers(22;1.41e-19)|all_lung(20;1.59e-15)|Lung NSC(18;7.08e-15)|Ovarian(172;0.00197)|Breast(254;0.122)		LUSC - Lung squamous cell carcinoma(14;1.1e-14)|Lung(28;2.99e-14)		Streptozocin(DB00428)	TTGCCTGTTGAGGTGCATTGA	0.463											OREG0015920	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP											0													155.0	143.0	147.0					3																	170736326		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			J03810	CCDS3215.1	3q26.2-q27	2013-05-22			ENSG00000163581	ENSG00000163581		"""Solute carriers"""	11006	protein-coding gene	gene with protein product		138160		GLUT2		1852621	Standard	NM_000340		Approved		uc003fhe.1	P11168	OTTHUMG00000158997	ENST00000314251.3:c.102T>C	3.37:g.170736326A>G		Somatic	1887	WXS	Illumina GAIIx	Phase_IV	A8K481|B2R936|B7Z547|F8W8V8|Q9UCW9	Missense_Mutation	SNP	pfam_Sub_transporter,pfam_MFS,superfamily_MFS_dom_general_subst_transpt,prints_Sugar/inositol_transpt,pfscan_MFS_dom,tigrfam_Sugar/inositol_transpt	p.L3P	ENST00000314251.3	37	c.8	CCDS3215.1	3	.	.	.	.	.	.	.	.	.	.	A	14.66	2.602233	0.46423	.	.	ENSG00000163581	ENST00000382808	D	0.82619	-1.63	5.45	0.052	0.14300	.	.	.	.	.	T	0.76176	0.3951	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.66602	-0.5882	5	.	.	.	.	2.2146	0.03956	0.5716:0.1337:0.1649:0.1298	.	.	.	.	P	3	ENSP00000372258:L3P	.	L	-	2	0	SLC2A2	172219020	0.980000	0.34600	1.000000	0.80357	0.570000	0.35934	0.093000	0.15086	0.359000	0.24239	0.533000	0.62120	CTC	SLC2A2	-	superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom	ENSG00000163581		0.463	SLC2A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC2A2	HGNC	protein_coding	OTTHUMT00000352834.1	169	0.00	0	A	NM_000340		170736326	170736326	-1	no_errors	ENST00000382808	ensembl	human	known	69_37n	missense	106	17.19	22	SNP	0.991	G
TPPP2	122664	genome.wustl.edu	37	14	21500171	21500171	+	Missense_Mutation	SNP	A	A	G			TCGA-A2-A0CL-01A-11D-A10Y-09	TCGA-A2-A0CL-10A-01D-A110-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a630ed59-dd23-45e1-aa16-4f7a98e32728	d7dbbf16-03d9-4e08-9fea-d4fa3d8608d0	g.chr14:21500171A>G	ENST00000321760.6	+	4	596	c.448A>G	c.(448-450)Act>Gct	p.T150A	TPPP2_ENST00000530140.2_Missense_Mutation_p.T150A|RP11-998D10.1_ENST00000531638.1_5'Flank|NDRG2_ENST00000403829.3_Intron|AL161668.5_ENST00000533984.1_lincRNA	NM_173846.4	NP_776245.2	P59282	TPPP2_HUMAN	tubulin polymerization-promoting protein family member 2	150						cytoplasm (GO:0005737)				endometrium(1)|large_intestine(2)|lung(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	9	all_cancers(95;0.000759)		OV - Ovarian serous cystadenocarcinoma(11;6.85e-11)|Epithelial(56;9.49e-09)|all cancers(55;3.84e-08)	GBM - Glioblastoma multiforme(265;0.0191)		GGAAGAGATGACTGACAACAC	0.547																																						dbGAP											0													212.0	159.0	177.0					14																	21500171		2203	4300	6503	-	-	-	SO:0001583	missense	0			AY072034	CCDS9566.1	14q11.2	2014-01-21	2007-05-02	2007-05-02	ENSG00000179636	ENSG00000179636			19293	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 8"""	C14orf8		15590652, 17105200	Standard	NM_173846		Approved	p25beta, p18, CT152	uc001vzh.3	P59282	OTTHUMG00000029642	ENST00000321760.6:c.448A>G	14.37:g.21500171A>G	ENSP00000317595:p.Thr150Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	Q2VYF3	Missense_Mutation	SNP	pfam_P25-alpha	p.T150A	ENST00000321760.6	37	c.448	CCDS9566.1	14	.	.	.	.	.	.	.	.	.	.	A	0.059	-1.227811	0.01518	.	.	ENSG00000179636	ENST00000321760;ENST00000530140	T;T	0.41400	1.0;1.0	4.71	3.48	0.39840	.	0.250070	0.40222	N	0.001148	T	0.19287	0.0463	N	0.11789	0.175	0.09310	N	1	B	0.33777	0.425	B	0.34931	0.192	T	0.11891	-1.0569	10	0.13108	T	0.6	-3.9563	4.5232	0.11969	0.701:0.1986:0.1004:0.0	.	150	P59282	TPPP2_HUMAN	A	150	ENSP00000317595:T150A;ENSP00000435356:T150A	ENSP00000317595:T150A	T	+	1	0	TPPP2	20570011	0.000000	0.05858	0.137000	0.22149	0.014000	0.08584	0.173000	0.16724	2.098000	0.63641	0.533000	0.62120	ACT	TPPP2	-	pfam_P25-alpha	ENSG00000179636		0.547	TPPP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TPPP2	HGNC	protein_coding	OTTHUMT00000073914.3	270	0.00	0	A	NM_173846		21500171	21500171	+1	no_errors	ENST00000321760	ensembl	human	known	69_37n	missense	243	10.33	28	SNP	0.006	G
ZC3H12C	85463	genome.wustl.edu	37	11	110035921	110035921	+	Missense_Mutation	SNP	C	C	T			TCGA-A2-A0CL-01A-11D-A10Y-09	TCGA-A2-A0CL-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a630ed59-dd23-45e1-aa16-4f7a98e32728	d7dbbf16-03d9-4e08-9fea-d4fa3d8608d0	g.chr11:110035921C>T	ENST00000278590.3	+	6	2162	c.2111C>T	c.(2110-2112)cCg>cTg	p.P704L	ZC3H12C_ENST00000453089.2_Missense_Mutation_p.P673L|ZC3H12C_ENST00000528673.1_Missense_Mutation_p.P705L	NM_033390.1	NP_203748.1	Q9C0D7	ZC12C_HUMAN	zinc finger CCCH-type containing 12C	704							endonuclease activity (GO:0004519)|metal ion binding (GO:0046872)			endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(11)|lung(16)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	37		all_cancers(61;3.24e-13)|all_epithelial(67;1.27e-07)|Melanoma(852;1.46e-05)|all_hematologic(158;3.66e-05)|Acute lymphoblastic leukemia(157;3.95e-05)|all_neural(223;0.0281)|Medulloblastoma(222;0.0425)|Breast(348;0.0544)		Epithelial(105;1.72e-06)|BRCA - Breast invasive adenocarcinoma(274;1.17e-05)|all cancers(92;9e-05)|OV - Ovarian serous cystadenocarcinoma(223;0.0279)		CCTCCTCTTCCGCACCTGGCT	0.572																																						dbGAP											0													142.0	164.0	157.0					11																	110035921		2121	4235	6356	-	-	-	SO:0001583	missense	0				CCDS44727.1	11q22.3	2012-07-05			ENSG00000149289	ENSG00000149289		"""Zinc fingers, CCCH-type domain containing"""	29362	protein-coding gene	gene with protein product	"""MCP induced protein 3"""	615001				11214970, 18178554	Standard	NM_033390		Approved	KIAA1726, MCPIP3	uc009yxw.3	Q9C0D7	OTTHUMG00000166572	ENST00000278590.3:c.2111C>T	11.37:g.110035921C>T	ENSP00000278590:p.Pro704Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DI65|B4DR47	Missense_Mutation	SNP	pfam_RNase_Zc3h12	p.P704L	ENST00000278590.3	37	c.2111	CCDS44727.1	11	.	.	.	.	.	.	.	.	.	.	C	15.08	2.728508	0.48833	.	.	ENSG00000149289	ENST00000278590;ENST00000528673;ENST00000453089	T;T;T	0.30448	1.53;1.53;1.53	5.94	5.94	0.96194	.	0.534850	0.21663	N	0.070999	T	0.34106	0.0886	L	0.53249	1.67	0.24397	N	0.994725	B;P;B	0.47302	0.384;0.893;0.384	B;B;B	0.38194	0.038;0.267;0.038	T	0.36986	-0.9725	10	0.87932	D	0	-4.8735	20.3591	0.98849	0.0:1.0:0.0:0.0	.	705;704;704	B4DR47;B4DI65;Q9C0D7	.;.;ZC12C_HUMAN	L	704;705;673	ENSP00000278590:P704L;ENSP00000431821:P705L;ENSP00000413094:P673L	ENSP00000278590:P704L	P	+	2	0	ZC3H12C	109541131	0.015000	0.18098	0.058000	0.19502	0.911000	0.54048	2.699000	0.47077	2.816000	0.96949	0.561000	0.74099	CCG	ZC3H12C	-	NULL	ENSG00000149289		0.572	ZC3H12C-001	KNOWN	basic|CCDS	protein_coding	ZC3H12C	HGNC	protein_coding	OTTHUMT00000390491.1	137	0.00	0	C	NM_033390		110035921	110035921	+1	no_errors	ENST00000278590	ensembl	human	known	69_37n	missense	143	12.27	20	SNP	0.176	T
