#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
ACTL6B	51412	genome.wustl.edu	37	7	100243916	100243916	+	Missense_Mutation	SNP	G	G	A			TCGA-A2-A0CO-01A-13D-A228-09	TCGA-A2-A0CO-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	36053173-6839-43ec-8157-75d729085e6b	fea38127-979d-4085-a9e1-6965b99458f3	g.chr7:100243916G>A	ENST00000160382.5	-	13	1262	c.1156C>T	c.(1156-1158)Cgc>Tgc	p.R386C		NM_016188.4	NP_057272.1	O94805	ACL6B_HUMAN	actin-like 6B	386					chromatin organization (GO:0006325)|chromatin remodeling (GO:0006338)|nervous system development (GO:0007399)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nBAF complex (GO:0071565)|nucleolus (GO:0005730)|nucleus (GO:0005634)|SWI/SNF complex (GO:0016514)	structural constituent of cytoskeleton (GO:0005200)|transcription coactivator activity (GO:0003713)	p.R386C(1)		endometrium(1)|large_intestine(3)|lung(7)|ovary(1)|skin(1)	13	Lung NSC(181;0.035)|all_lung(186;0.0509)|Esophageal squamous(72;0.0817)					CTGAACTTGCGCTCCATGGTG	0.607																																						dbGAP											1	Substitution - Missense(1)	endometrium(1)											75.0	63.0	67.0					7																	100243916		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB015906	CCDS5702.1	7q22	2008-02-01	2004-07-12	2004-07-14	ENSG00000077080	ENSG00000077080			160	protein-coding gene	gene with protein product		612458	"""actin-like 6"""	ACTL6		9799793	Standard	NM_016188		Approved	BAF53B	uc003uvy.3	O94805	OTTHUMG00000159661	ENST00000160382.5:c.1156C>T	7.37:g.100243916G>A	ENSP00000160382:p.Arg386Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	A4D2D0|O75421	Missense_Mutation	SNP	pfam_Actin-like,smart_Actin-like,prints_Actin-like	p.R386C	ENST00000160382.5	37	c.1156	CCDS5702.1	7	.	.	.	.	.	.	.	.	.	.	G	18.79	3.698565	0.68386	.	.	ENSG00000077080	ENST00000160382	D	0.96365	-3.99	5.71	3.73	0.42828	.	0.000000	0.64402	D	0.000002	D	0.98551	0.9516	H	0.96720	3.87	0.80722	D	1	D	0.89917	1.0	D	0.74674	0.984	D	0.98154	1.0443	10	0.87932	D	0	.	12.0302	0.53394	0.0:0.0:0.6983:0.3017	.	386	O94805	ACL6B_HUMAN	C	386	ENSP00000160382:R386C	ENSP00000160382:R386C	R	-	1	0	ACTL6B	100081852	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	3.245000	0.51407	2.710000	0.92621	0.655000	0.94253	CGC	ACTL6B	-	pfam_Actin-like,smart_Actin-like	ENSG00000077080		0.607	ACTL6B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACTL6B	HGNC	protein_coding	OTTHUMT00000356745.1	58	0.00	0	G	NM_016188		100243916	100243916	-1	no_errors	ENST00000160382	ensembl	human	known	69_37n	missense	37	33.93	19	SNP	1.000	A
ABCB8	11194	genome.wustl.edu	37	7	150737592	150737592	+	Missense_Mutation	SNP	G	G	A			TCGA-A2-A0CO-01A-13D-A228-09	TCGA-A2-A0CO-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	36053173-6839-43ec-8157-75d729085e6b	fea38127-979d-4085-a9e1-6965b99458f3	g.chr7:150737592G>A	ENST00000297504.6	+	12	1376	c.1310G>A	c.(1309-1311)cGg>cAg	p.R437Q	ABCB8_ENST00000356058.4_Silent_p.P458P|ABCB8_ENST00000498578.1_Missense_Mutation_p.R420Q|ABCB8_ENST00000358849.4_Missense_Mutation_p.R420Q|ABCB8_ENST00000542328.1_Missense_Mutation_p.R332Q			Q9NUT2	ABCB8_HUMAN	ATP-binding cassette, sub-family B (MDR/TAP), member 8	437	ABC transmembrane type-1. {ECO:0000255|PROSITE-ProRule:PRU00441}.				transmembrane transport (GO:0055085)|transport (GO:0006810)	ATP-binding cassette (ABC) transporter complex (GO:0043190)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrial envelope (GO:0005740)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|transporter activity (GO:0005215)			breast(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(8)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	26			OV - Ovarian serous cystadenocarcinoma(82;0.0121)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)	Doxorubicin(DB00997)	CAGGTGGTCCGGGGGCTGAGT	0.657																																						dbGAP											0													50.0	57.0	55.0					7																	150737592		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF047690	CCDS5913.1, CCDS64798.1, CCDS64799.1, CCDS64800.1	7q36.1	2012-05-16			ENSG00000197150	ENSG00000197150		"""ATP binding cassette transporters / subfamily B"""	49	protein-coding gene	gene with protein product	"""mitochondrial ABC protein"""	605464				8894702	Standard	NM_001282291		Approved	EST328128, M-ABC1, MABC1	uc003wik.4	Q9NUT2	OTTHUMG00000158686	ENST00000297504.6:c.1310G>A	7.37:g.150737592G>A	ENSP00000297504:p.Arg437Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	A5D8W3|B2RBL8|B3KND2|B4DG02|G3XAP3|O95787|Q53GM0	Missense_Mutation	SNP	pfam_ABC_transptr_TM_dom,pfam_ABC_transporter-like,superfamily_ABC_transptrTM_dom_typ1,smart_AAA+_ATPase,pfscan_ABC_transporter-like,pfscan_ABC_transporter_type1	p.R437Q	ENST00000297504.6	37	c.1310		7	.	.	.	.	.	.	.	.	.	.	G	24.3	4.513644	0.85389	.	.	ENSG00000197150	ENST00000358849;ENST00000360651;ENST00000297504;ENST00000542328;ENST00000498578	D;D;D;D	0.94417	-3.42;-3.42;-3.42;-3.42	4.68	4.68	0.58851	ABC transporter, transmembrane domain, type 1 (1);ABC transporter, integral membrane type 1 (1);	0.000000	0.85682	D	0.000000	D	0.96555	0.8876	M	0.75777	2.31	0.80722	D	1	D;D;D;D	0.89917	0.999;0.999;0.999;1.0	D;D;D;D	0.71414	0.973;0.96;0.941;0.973	D	0.95737	0.8780	10	0.36615	T	0.2	-0.0233	15.1554	0.72735	0.0:0.0:1.0:0.0	.	332;420;437;420	G3XAP3;A5D8W3;Q9NUT2;Q9NUT2-2	.;.;ABCB8_HUMAN;.	Q	420;403;437;332;420	ENSP00000351717:R420Q;ENSP00000297504:R437Q;ENSP00000438776:R332Q;ENSP00000418271:R420Q	ENSP00000297504:R437Q	R	+	2	0	ABCB8	150368525	1.000000	0.71417	0.998000	0.56505	0.552000	0.35366	8.947000	0.93000	2.423000	0.82170	0.561000	0.74099	CGG	ABCB8	-	superfamily_ABC_transptrTM_dom_typ1,pfscan_ABC_transporter_type1	ENSG00000197150		0.657	ABCB8-003	KNOWN	basic	protein_coding	ABCB8	HGNC	protein_coding	OTTHUMT00000351733.2	34	0.00	0	G	NM_007188		150737592	150737592	+1	no_errors	ENST00000297504	ensembl	human	known	69_37n	missense	51	26.09	18	SNP	1.000	A
ANKRD44	91526	genome.wustl.edu	37	2	197857433	197857433	+	Intron	SNP	T	T	G			TCGA-A2-A0CO-01A-13D-A228-09	TCGA-A2-A0CO-10A-01D-A22A-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	36053173-6839-43ec-8157-75d729085e6b	fea38127-979d-4085-a9e1-6965b99458f3	g.chr2:197857433T>G	ENST00000282272.8	-	26	2899					NM_001195144.1	NP_001182073.1	Q8N8A2	ANR44_HUMAN	ankyrin repeat domain 44											NS(1)|endometrium(3)|kidney(2)|large_intestine(9)|lung(20)|ovary(4)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	45			OV - Ovarian serous cystadenocarcinoma(117;0.246)			CATGCTAGGATACATGGGGCT	0.448																																						dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			AK097086	CCDS33355.1, CCDS33355.2, CCDS74619.1	2q33.1	2013-01-10			ENSG00000065413	ENSG00000065413		"""Serine/threonine phosphatases / Protein phosphatase 6, regulatory subunits"", ""Ankyrin repeat domain containing"""	25259	protein-coding gene	gene with protein product	"""protein phosphatase 6 ankyrin repeat subunit B"""						Standard	NM_153697		Approved	PP6-ARS-B	uc021vuj.1	Q8N8A2	OTTHUMG00000154411	ENST00000282272.8:c.2899+873A>C	2.37:g.197857433T>G		Somatic		WXS	Illumina GAIIx	Phase_IV	Q53SL9|Q6P480|Q86VL5|Q8IZ72|Q9UFA4	RNA	SNP	-	NULL	ENST00000282272.8	37	NULL		2																																																																																			ANKRD44	-	-	ENSG00000065413		0.448	ANKRD44-201	KNOWN	basic	protein_coding	ANKRD44	HGNC	protein_coding		39	0.00	0	T	NM_153697		197857433	197857433	-1	no_errors	ENST00000486006	ensembl	human	known	69_37n	rna	49	12.50	7	SNP	0.937	G
B4GALT6	9331	genome.wustl.edu	37	18	29246241	29246244	+	Frame_Shift_Del	DEL	TTTA	TTTA	-			TCGA-A2-A0CO-01A-13D-A228-09	TCGA-A2-A0CO-10A-01D-A22A-09	TTTA	TTTA					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	36053173-6839-43ec-8157-75d729085e6b	fea38127-979d-4085-a9e1-6965b99458f3	g.chr18:29246241_29246244delTTTA	ENST00000306851.5	-	2	503_506	c.207_210delTAAA	c.(205-210)aataaafs	p.NK69fs	B4GALT6_ENST00000383131.3_Frame_Shift_Del_p.NK69fs|B4GALT6_ENST00000237019.7_Intron	NM_004775.3	NP_004766.2	Q9UBX8	B4GT6_HUMAN	UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 6	69					carbohydrate metabolic process (GO:0005975)|cellular protein metabolic process (GO:0044267)|glycosaminoglycan metabolic process (GO:0030203)|keratan sulfate biosynthetic process (GO:0018146)|keratan sulfate metabolic process (GO:0042339)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)|small molecule metabolic process (GO:0044281)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	galactosyltransferase activity (GO:0008378)|metal ion binding (GO:0046872)			breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(6)|lung(6)|pancreas(1)	20			OV - Ovarian serous cystadenocarcinoma(10;0.00791)			GCGTACTGTTTTTATTTGTGTACA	0.377																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			AF038664	CCDS11900.1	18q11	2013-02-19			ENSG00000118276	ENSG00000118276		"""Beta 4-glycosyltransferases"""	929	protein-coding gene	gene with protein product	"""UDP-Gal:glucosylceramide beta-1,4-galactosyltransferase"""	604017				9597550, 12180132	Standard	NM_004775		Approved	beta4GalT-VI	uc002kwz.4	Q9UBX8	OTTHUMG00000131980	ENST00000306851.5:c.207_210delTAAA	18.37:g.29246241_29246244delTTTA	ENSP00000306459:p.Asn69fs	Somatic		WXS	Illumina GAIIx	Phase_IV	O60514|Q6NT09	Frame_Shift_Del	DEL	pfam_Galactosyl_T_2_met,prints_Galactosyl_T_2_met	p.N69fs	ENST00000306851.5	37	c.210_207	CCDS11900.1	18																																																																																			B4GALT6	-	NULL	ENSG00000118276		0.377	B4GALT6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	B4GALT6	HGNC	protein_coding	OTTHUMT00000254942.2	55	0.00	0	TTTA	NM_004775		29246241	29246244	-1	no_errors	ENST00000306851	ensembl	human	known	69_37n	frame_shift_del	44	27.87	17	DEL	1.000:1.000:1.000:0.987	-
C12orf73	728568	genome.wustl.edu	37	12	104345123	104345123	+	3'UTR	SNP	A	A	G	rs15805	byFrequency	TCGA-A2-A0CO-01A-13D-A228-09	TCGA-A2-A0CO-10A-01D-A22A-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	36053173-6839-43ec-8157-75d729085e6b	fea38127-979d-4085-a9e1-6965b99458f3	g.chr12:104345123A>G	ENST00000378090.4	-	0	599				C12orf73_ENST00000553183.1_3'UTR|C12orf73_ENST00000543740.2_5'UTR|C12orf73_ENST00000547975.1_3'UTR|C12orf73_ENST00000549478.1_3'UTR	NM_001135570.1	NP_001129042.1	Q69YU5	CL073_HUMAN	chromosome 12 open reading frame 73							extracellular region (GO:0005576)				prostate(1)	1						GTGCTTTGGCAGTTTTCAAGA	0.343													A|||	2289	0.457069	0.6369	0.4625	5008	,	,		17371	0.4692		0.336	False		,,,				2504	0.3221					dbGAP											0																																										-	-	-	SO:0001624	3_prime_UTR_variant	0			AK024037	CCDS44964.1	12q23.3	2008-10-01			ENSG00000204954	ENSG00000204954			34450	protein-coding gene	gene with protein product							Standard	NM_001135570		Approved	FLJ13975, DKFZp547P055	uc009zuj.2	Q69YU5		ENST00000378090.4:c.*178T>C	12.37:g.104345123A>G		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000378090.4	37	NULL	CCDS44964.1	12																																																																																			C12orf73	-	-	ENSG00000204954		0.343	C12orf73-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C12orf73	HGNC	protein_coding	OTTHUMT00000407361.1	8	0.00	0	A	NM_001135570		104345123	104345123	-1	no_errors	ENST00000543740	ensembl	human	known	69_37n	rna	8	46.67	7	SNP	0.185	G
CAMK1D	57118	genome.wustl.edu	37	10	12856243	12856243	+	Missense_Mutation	SNP	G	G	C			TCGA-A2-A0CO-01A-13D-A228-09	TCGA-A2-A0CO-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	36053173-6839-43ec-8157-75d729085e6b	fea38127-979d-4085-a9e1-6965b99458f3	g.chr10:12856243G>C	ENST00000378847.3	+	7	1028	c.691G>C	c.(691-693)Gag>Cag	p.E231Q	CAMK1D_ENST00000378845.1_Missense_Mutation_p.E231Q	NM_153498.2	NP_705718.1	Q8IU85	KCC1D_HUMAN	calcium/calmodulin-dependent protein kinase ID	231	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				inflammatory response (GO:0006954)|positive regulation of CREB transcription factor activity (GO:0032793)|positive regulation of neuron projection development (GO:0010976)|positive regulation of neutrophil chemotaxis (GO:0090023)|positive regulation of phagocytosis (GO:0050766)|positive regulation of respiratory burst (GO:0060267)|regulation of dendrite development (GO:0050773)|regulation of granulocyte chemotaxis (GO:0071622)	calcium- and calmodulin-dependent protein kinase complex (GO:0005954)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|calmodulin-dependent protein kinase activity (GO:0004683)	p.E231*(2)		endometrium(3)|kidney(2)|large_intestine(4)|lung(4)|ovary(1)|skin(1)|stomach(1)	16				GBM - Glioblastoma multiforme(1;3.16e-05)		CAAGCTCTTTGAGCAGATCCT	0.512																																						dbGAP											2	Substitution - Nonsense(2)	lung(2)											107.0	95.0	99.0					10																	12856243		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF286366	CCDS7091.1, CCDS7092.1	10p13	2003-11-05			ENSG00000183049	ENSG00000183049			19341	protein-coding gene	gene with protein product		607957				11050006	Standard	XM_006717481		Approved	CKLiK	uc001ilo.3	Q8IU85	OTTHUMG00000017683	ENST00000378847.3:c.691G>C	10.37:g.12856243G>C	ENSP00000368124:p.Glu231Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	B0YIY0|Q9HD31	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.E231Q	ENST00000378847.3	37	c.691	CCDS7091.1	10	.	.	.	.	.	.	.	.	.	.	G	16.82	3.228438	0.58777	.	.	ENSG00000183049	ENST00000378847;ENST00000378845	T;T	0.65916	-0.18;-0.18	5.46	5.46	0.80206	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.67636	0.2914	L	0.43554	1.36	0.80722	D	1	D;B	0.61080	0.989;0.011	P;B	0.61070	0.883;0.027	T	0.60475	-0.7256	10	0.10111	T	0.7	-31.2544	16.7965	0.85603	0.0:0.0:1.0:0.0	.	231;231	Q8IU85;Q5SQQ7	KCC1D_HUMAN;.	Q	231	ENSP00000368124:E231Q;ENSP00000368122:E231Q	ENSP00000368122:E231Q	E	+	1	0	CAMK1D	12896249	1.000000	0.71417	0.994000	0.49952	0.992000	0.81027	9.517000	0.98020	2.556000	0.86216	0.555000	0.69702	GAG	CAMK1D	-	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	ENSG00000183049		0.512	CAMK1D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CAMK1D	HGNC	protein_coding	OTTHUMT00000046820.1	45	0.00	0	G	NM_020397		12856243	12856243	+1	no_errors	ENST00000378847	ensembl	human	known	69_37n	missense	49	23.44	15	SNP	1.000	C
CCDC39	339829	genome.wustl.edu	37	3	180426685	180426685	+	5'UTR	SNP	C	C	T			TCGA-A2-A0CO-01A-13D-A228-09	TCGA-A2-A0CO-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	36053173-6839-43ec-8157-75d729085e6b	fea38127-979d-4085-a9e1-6965b99458f3	g.chr3:180426685C>T	ENST00000485055.1	-	0	1565				CCDC39_ENST00000273654.4_5'UTR			Q9UFE4	CCD39_HUMAN	coiled-coil domain containing 39						axonemal dynein complex assembly (GO:0070286)|cilium-dependent cell motility (GO:0060285)|determination of digestive tract left/right asymmetry (GO:0071907)|determination of liver left/right asymmetry (GO:0071910)|determination of pancreatic left/right asymmetry (GO:0035469)|epithelial cilium movement involved in determination of left/right asymmetry (GO:0060287)|heart looping (GO:0001947)|lung development (GO:0030324)	axoneme (GO:0005930)|cytoskeleton (GO:0005856)				NS(1)|breast(1)|endometrium(4)|large_intestine(9)|lung(22)|ovary(6)|prostate(2)	45	all_cancers(143;9.31e-15)|Ovarian(172;0.0212)		OV - Ovarian serous cystadenocarcinoma(80;5.62e-23)|GBM - Glioblastoma multiforme(14;0.000558)			TCCTAAGATCCATGATTTCTA	0.393																																						dbGAP											0																																										-	-	-	SO:0001623	5_prime_UTR_variant	0			BC047103	CCDS46964.1	3q26.33	2012-07-27			ENSG00000145075	ENSG00000145075			25244	protein-coding gene	gene with protein product		613798				21131972	Standard	NM_181426		Approved	DKFZp434A128, CILD14, FAP59	uc010hxe.3	Q9UFE4	OTTHUMG00000157857	ENST00000485055.1:c.-1309G>A	3.37:g.180426685C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B4E2H1	RNA	SNP	-	NULL	ENST00000485055.1	37	NULL		3																																																																																			CCDC39	-	-	ENSG00000145075		0.393	CCDC39-004	KNOWN	basic	processed_transcript	CCDC39	HGNC	protein_coding	OTTHUMT00000349890.1	71	0.00	0	C	XM_291028		180426685	180426685	-1	no_errors	ENST00000485055	ensembl	human	known	69_37n	rna	39	25.00	13	SNP	0.000	T
CDH1	999	genome.wustl.edu	37	16	68845757	68845757	+	Nonsense_Mutation	SNP	C	C	T	rs587780784		TCGA-A2-A0CO-01A-13D-A228-09	TCGA-A2-A0CO-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	36053173-6839-43ec-8157-75d729085e6b	fea38127-979d-4085-a9e1-6965b99458f3	g.chr16:68845757C>T	ENST00000261769.5	+	7	1194	c.1003C>T	c.(1003-1005)Cga>Tga	p.R335*	CDH1_ENST00000562836.1_3'UTR|CDH1_ENST00000422392.2_Nonsense_Mutation_p.R335*|RP11-354M1.2_ENST00000563916.1_RNA	NM_004360.3	NP_004351.1	P12830	CADH1_HUMAN	cadherin 1, type 1, E-cadherin (epithelial)	335	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|apoptotic process (GO:0006915)|calcium-dependent cell-cell adhesion (GO:0016339)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to amino acid stimulus (GO:0071230)|cellular response to indole-3-methanol (GO:0071681)|cellular response to lithium ion (GO:0071285)|cochlea development (GO:0090102)|epithelial cell morphogenesis (GO:0003382)|establishment of protein localization to plasma membrane (GO:0090002)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|homophilic cell adhesion (GO:0007156)|intestinal epithelial cell development (GO:0060576)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell-cell adhesion (GO:0022408)|negative regulation of epithelial cell proliferation (GO:0050680)|neuron projection development (GO:0031175)|pituitary gland development (GO:0021983)|positive regulation of transcription factor import into nucleus (GO:0042993)|positive regulation of transcription, DNA-templated (GO:0045893)|protein homooligomerization (GO:0051260)|protein localization to plasma membrane (GO:0072659)|protein metabolic process (GO:0019538)|regulation of branching involved in salivary gland morphogenesis (GO:0060693)|regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043281)|regulation of immune response (GO:0050776)|regulation of neuron migration (GO:2001222)|regulation of protein localization to cell surface (GO:2000008)|regulation of water loss via skin (GO:0033561)|response to drug (GO:0042493)|response to toxic substance (GO:0009636)|salivary gland cavitation (GO:0060662)|sensory perception of sound (GO:0007605)|single organismal cell-cell adhesion (GO:0016337)|synapse assembly (GO:0007416)|tight junction assembly (GO:0070830)|trophectodermal cell differentiation (GO:0001829)	actin cytoskeleton (GO:0015629)|aggresome (GO:0016235)|apical junction complex (GO:0043296)|apical part of cell (GO:0045177)|axon terminus (GO:0043679)|basolateral plasma membrane (GO:0016323)|catenin complex (GO:0016342)|cell junction (GO:0030054)|cell surface (GO:0009986)|cell-cell adherens junction (GO:0005913)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|endosome (GO:0005768)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|lateral loop (GO:0043219)|lateral plasma membrane (GO:0016328)|node of Ranvier (GO:0033268)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|Schmidt-Lanterman incisure (GO:0043220)|trans-Golgi network (GO:0005802)	ankyrin binding (GO:0030506)|beta-catenin binding (GO:0008013)|calcium ion binding (GO:0005509)|cell adhesion molecule binding (GO:0050839)|gamma-catenin binding (GO:0045295)|glycoprotein binding (GO:0001948)|GTPase activating protein binding (GO:0032794)	p.R335*(1)|p.?(1)		NS(6)|biliary_tract(8)|breast(161)|central_nervous_system(4)|endometrium(9)|kidney(4)|large_intestine(13)|lung(13)|oesophagus(3)|ovary(2)|prostate(3)|soft_tissue(2)|stomach(76)|thyroid(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	311		all_neural(199;0.0189)|Ovarian(137;0.0563)		Epithelial(162;8.44e-05)|all cancers(182;0.000404)|OV - Ovarian serous cystadenocarcinoma(108;0.000426)|BRCA - Breast invasive adenocarcinoma(181;0.0261)		TGGGCTGGACCGAGAGGTCAG	0.507			"""Mis, N, F, S"""		"""lobular breast, gastric"""	gastric			Hereditary Diffuse Gastric Cancer																													dbGAP	yes	Rec	yes	Familial gastric carcinoma	16	16q22.1	999	"""cadherin 1, type 1, E-cadherin (epithelial) (ECAD)"""		E	2	Substitution - Nonsense(1)|Unknown(1)	large_intestine(1)|breast(1)	GRCh37	CM022775	CDH1	M							75.0	71.0	72.0					16																	68845757		2198	4300	6498	-	-	-	SO:0001587	stop_gained	0	Familial Cancer Database	HDGC	L08599	CCDS10869.1	16q22.1	2014-09-17			ENSG00000039068	ENSG00000039068		"""CD molecules"", ""Cadherins / Major cadherins"""	1748	protein-coding gene	gene with protein product	"""E-Cadherin"""	192090		UVO		9925936	Standard	NM_004360		Approved	uvomorulin, CD324	uc002ewg.1	P12830	OTTHUMG00000137561	ENST00000261769.5:c.1003C>T	16.37:g.68845757C>T	ENSP00000261769:p.Arg335*	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K1U7|Q13799|Q14216|Q15855|Q16194|Q4PJ14|Q9UII8	Nonsense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_cytoplasmic-dom,pfam_Cadherin_pro_dom,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.R335*	ENST00000261769.5	37	c.1003	CCDS10869.1	16	.	.	.	.	.	.	.	.	.	.	C	37	6.218011	0.97385	.	.	ENSG00000039068	ENST00000261769;ENST00000379120;ENST00000268794;ENST00000422392	.	.	.	5.47	3.22	0.36961	.	0.000000	0.44688	D	0.000437	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	13.3929	0.60834	0.4318:0.5681:0.0:0.0	.	.	.	.	X	335	.	ENSP00000261769:R335X	R	+	1	2	CDH1	67403258	1.000000	0.71417	1.000000	0.80357	0.940000	0.58332	1.320000	0.33666	1.416000	0.47057	0.561000	0.74099	CGA	CDH1	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000039068		0.507	CDH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDH1	HGNC	protein_coding	OTTHUMT00000268897.2	23	0.00	0	C	NM_004360		68845757	68845757	+1	no_errors	ENST00000261769	ensembl	human	known	69_37n	nonsense	17	55.26	21	SNP	1.000	T
CNTNAP3B	728577	genome.wustl.edu	37	9	43853528	43853528	+	Silent	SNP	G	G	A			TCGA-A2-A0CO-01A-13D-A228-09	TCGA-A2-A0CO-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	36053173-6839-43ec-8157-75d729085e6b	fea38127-979d-4085-a9e1-6965b99458f3	g.chr9:43853528G>A	ENST00000377564.3	+	12	2181	c.1788G>A	c.(1786-1788)aaG>aaA	p.K596K		NM_001201380.1	NP_001188309.1	Q96NU0	CNT3B_HUMAN	contactin associated protein-like 3B	596	Fibrinogen C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00739}.				cell adhesion (GO:0007155)	integral component of membrane (GO:0016021)				central_nervous_system(1)|endometrium(2)|lung(3)|pancreas(1)|prostate(3)	10						AAGCCCACAAGCACCGAGGGA	0.468																																						dbGAP											0																																										-	-	-	SO:0001819	synonymous_variant	0			BX538190	CCDS75836.1	9p12	2007-12-14			ENSG00000154529	ENSG00000154529			32035	protein-coding gene	gene with protein product						15820314	Standard	XM_006716853		Approved		uc004abr.1	Q96NU0	OTTHUMG00000013174	ENST00000377564.3:c.1788G>A	9.37:g.43853528G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B1B0V7|B1B0V8|B1B0V9|B1B0W0|B1B0X8|B1B162|Q4VXF0|Q9H7W3	Missense_Mutation	SNP	pfam_Laminin_G,pfam_Coagulation_fac_5/8-C_type_dom,superfamily_Galactose-bd-like,superfamily_ConA-like_lec_gl,superfamily_Fibrinogen_a/b/g_C,smart_Coagulation_fac_5/8-C_type_dom,smart_Laminin_G,smart_EGF-like,pfscan_EG-like_dom,pfscan_Coagulation_fac_5/8-C_type_dom,pfscan_Laminin_G	p.S645N	ENST00000377564.3	37	c.1934	CCDS55312.1	9	.	.	.	.	.	.	.	.	.	.	G	4.109	0.018295	0.07959	.	.	ENSG00000154529	ENST00000377561	.	.	.	3.24	0.172	0.15031	.	.	.	.	.	T	0.50599	0.1625	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.38045	-0.9679	4	.	.	.	.	5.141	0.14959	0.2091:0.0:0.6223:0.1685	.	.	.	.	N	645	.	.	S	+	2	0	CNTNAP3B	43793524	1.000000	0.71417	0.822000	0.32727	0.547000	0.35210	2.159000	0.42339	0.205000	0.20568	0.420000	0.28162	AGC	CNTNAP3B	-	superfamily_Fibrinogen_a/b/g_C	ENSG00000154529		0.468	CNTNAP3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CNTNAP3B	HGNC	protein_coding	OTTHUMT00000036930.3	59	0.00	0	G			43853528	43853528	+1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000377561	ensembl	human	known	69_37n	missense	62	12.68	9	SNP	0.999	A
DMD	1756	genome.wustl.edu	37	X	32482759	32482759	+	Missense_Mutation	SNP	C	C	T			TCGA-A2-A0CO-01A-13D-A228-09	TCGA-A2-A0CO-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	36053173-6839-43ec-8157-75d729085e6b	fea38127-979d-4085-a9e1-6965b99458f3	g.chrX:32482759C>T	ENST00000357033.4	-	24	3426	c.3220G>A	c.(3220-3222)Gaa>Aaa	p.E1074K	DMD_ENST00000378677.2_Missense_Mutation_p.E1070K	NM_000109.3|NM_004006.2|NM_004011.3|NM_004012.3|NM_004014.2	NP_000100.2|NP_003997|NP_004002.2|NP_004003.1|NP_004005.1	P11532	DMD_HUMAN	dystrophin	1074					cardiac muscle cell action potential (GO:0086001)|cardiac muscle contraction (GO:0060048)|cellular protein complex assembly (GO:0043623)|cellular protein localization (GO:0034613)|extracellular matrix organization (GO:0030198)|motile cilium assembly (GO:0044458)|muscle filament sliding (GO:0030049)|muscle organ development (GO:0007517)|negative regulation of peptidyl-cysteine S-nitrosylation (GO:1902083)|negative regulation of peptidyl-serine phosphorylation (GO:0033137)|peptide biosynthetic process (GO:0043043)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of neuron projection development (GO:0010976)|positive regulation of sodium ion transmembrane transporter activity (GO:2000651)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of cellular response to growth factor stimulus (GO:0090287)|regulation of heart rate (GO:0002027)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)|regulation of ryanodine-sensitive calcium-release channel activity (GO:0060314)|regulation of skeletal muscle contraction (GO:0014819)|regulation of skeletal muscle contraction by regulation of release of sequestered calcium ion (GO:0014809)|regulation of voltage-gated calcium channel activity (GO:1901385)	cell junction (GO:0030054)|cell surface (GO:0009986)|costamere (GO:0043034)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dystrophin-associated glycoprotein complex (GO:0016010)|filopodium (GO:0030175)|filopodium membrane (GO:0031527)|membrane raft (GO:0045121)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|protein complex (GO:0043234)|sarcolemma (GO:0042383)|syntrophin complex (GO:0016013)	actin binding (GO:0003779)|calcium ion binding (GO:0005509)|dystroglycan binding (GO:0002162)|myosin binding (GO:0017022)|nitric-oxide synthase binding (GO:0050998)|structural constituent of cytoskeleton (GO:0005200)|structural constituent of muscle (GO:0008307)|vinculin binding (GO:0017166)|zinc ion binding (GO:0008270)			NS(2)|breast(3)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(17)|liver(1)|lung(25)|ovary(3)|pancreas(3)|prostate(2)|skin(1)|urinary_tract(2)	77		all_cancers(2;1.22e-16)|Acute lymphoblastic leukemia(2;4.65e-06)|all_hematologic(2;0.00108)|all_epithelial(3;0.00626)|all_neural(2;0.0189)|all_lung(315;0.182)|Glioma(3;0.203)				GCAGGCCATTCCTCCTTCAGA	0.378																																						dbGAP											0			GRCh37	CM013368	DMD	M							138.0	112.0	121.0					X																	32482759		2202	4300	6502	-	-	-	SO:0001583	missense	0			AF047505	CCDS14231.1, CCDS14232.1, CCDS14233.1, CCDS14234.1, CCDS48091.1, CCDS55394.1, CCDS55395.1, CCDS75965.1	Xp21.2	2014-09-17	2008-08-01		ENSG00000198947	ENSG00000198947			2928	protein-coding gene	gene with protein product	"""muscular dystrophy, Duchenne and Becker types"""	300377	"""dystrophin (muscular dystrophy, Duchenne and Becker types), includes DXS142, DXS164, DXS206, DXS230, DXS239, DXS268, DXS269, DXS270, DXS272"", ""mental retardation, X-linked 85"""	MRX85		3282674, 3607877, 23900271	Standard	NM_004019		Approved	BMD, DXS142, DXS164, DXS206, DXS230, DXS239, DXS268, DXS269, DXS270, DXS272	uc004dda.1	P11532	OTTHUMG00000021336	ENST00000357033.4:c.3220G>A	X.37:g.32482759C>T	ENSP00000354923:p.Glu1074Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	E9PDN1|Q02295|Q14169|Q14170|Q5JYU0|Q6NSJ9|Q7KZ48|Q8N754|Q9UCW3|Q9UCW4	Missense_Mutation	SNP	pfam_Spectrin_repeat,pfam_EF-hand_dom_typ1,pfam_EF-hand_dom_typ2,pfam_CH-domain,pfam_Znf_ZZ,pfam_WW_Rsp5_WWP,pfam_CAMSAP_CH,superfamily_CH-domain,superfamily_WW_Rsp5_WWP,smart_CH-domain,smart_Spectrin/alpha-actinin,smart_WW_Rsp5_WWP,smart_Znf_ZZ,pirsf_Dystrophin/utrophin,pfscan_CH-domain,pfscan_WW_Rsp5_WWP,pfscan_Znf_ZZ	p.E1074K	ENST00000357033.4	37	c.3220	CCDS14233.1	X	.	.	.	.	.	.	.	.	.	.	C	28.9	4.959861	0.92791	.	.	ENSG00000198947	ENST00000534884;ENST00000378677;ENST00000357033;ENST00000542849;ENST00000535280	T;T	0.52983	0.64;0.64	4.8	4.8	0.61643	.	0.000000	0.35805	U	0.002969	T	0.68007	0.2954	M	0.73598	2.24	0.80722	D	1	D;D;D	0.69078	0.996;0.997;0.997	D;D;D	0.80764	0.99;0.992;0.994	T	0.67252	-0.5717	10	0.30854	T	0.27	.	17.4184	0.87507	0.0:1.0:0.0:0.0	.	1066;1074;1070	P11532-4;P11532;E9PDN5	.;DMD_HUMAN;.	K	1066;1070;1074;1074;951	ENSP00000367948:E1070K;ENSP00000354923:E1074K	ENSP00000354923:E1074K	E	-	1	0	DMD	32392680	1.000000	0.71417	0.992000	0.48379	0.978000	0.69477	7.769000	0.85360	2.126000	0.65437	0.462000	0.41574	GAA	DMD	-	pfam_Spectrin_repeat,smart_Spectrin/alpha-actinin,pirsf_Dystrophin/utrophin	ENSG00000198947		0.378	DMD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DMD	HGNC	protein_coding	OTTHUMT00000056182.2	60	0.00	0	C	NM_004006		32482759	32482759	-1	no_errors	ENST00000357033	ensembl	human	known	69_37n	missense	56	13.85	9	SNP	1.000	T
DNAH12	201625	genome.wustl.edu	37	3	57410762	57410762	+	Intron	SNP	C	C	T			TCGA-A2-A0CO-01A-13D-A228-09	TCGA-A2-A0CO-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	36053173-6839-43ec-8157-75d729085e6b	fea38127-979d-4085-a9e1-6965b99458f3	g.chr3:57410762C>T	ENST00000351747.2	-	35	5474					NM_178504.4	NP_848599.3	Q6ZR08	DYH12_HUMAN	dynein, axonemal, heavy chain 12						microtubule-based movement (GO:0007018)	cilium (GO:0005929)|cytoplasm (GO:0005737)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			breast(3)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(4)|lung(7)|pancreas(1)|prostate(1)|skin(1)	25						AATCCAAACACGAATGTGCTT	0.348																																						dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			U53532, AK126276	CCDS33771.1	3p21.1	2009-02-04	2006-09-04		ENSG00000174844	ENSG00000174844		"""Axonemal dyneins"""	2943	protein-coding gene	gene with protein product		603340	"""dynein, axonemal, heavy polypeptide 12"", ""dynein heavy chain domain 2"", ""dynein heavy domain 2"", ""dynein, axonemal, heavy chain 12-like"", ""dynein, axonemal, heavy chain 7-like"""	DNHD2, DNAH12L, DNAH7L		8812413, 8666668	Standard	NM_198564		Approved	DLP12, Dnahc3, HL-19, hdhc3, DHC3, FLJ40427, FLJ44290	uc003dit.2	Q6ZR08	OTTHUMG00000158598	ENST00000351747.2:c.5293+3303G>A	3.37:g.57410762C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A6NGI2|Q6ZTR8|Q8N7R9|Q8WXK2|Q92816	Missense_Mutation	SNP	pfam_Dynein_heavy_dom-2,pfam_ATPase_dyneun-rel_AAA,smart_AAA+_ATPase	p.R1787H	ENST00000351747.2	37	c.5360		3	.	.	.	.	.	.	.	.	.	.	C	12.36	1.913776	0.33815	.	.	ENSG00000174844	ENST00000495027	T	0.25579	1.79	5.93	4.16	0.48862	.	.	.	.	.	T	0.27489	0.0675	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.02498	-1.1150	6	0.20046	T	0.44	.	10.7532	0.46221	0.0:0.7973:0.0:0.2027	.	.	.	.	H	1787	ENSP00000418137:R1787H	ENSP00000418137:R1787H	R	-	2	0	DNAH12	57385802	0.955000	0.32602	0.996000	0.52242	0.794000	0.44872	1.038000	0.30254	0.854000	0.35336	-0.136000	0.14681	CGT	DNAH12	-	NULL	ENSG00000174844		0.348	DNAH12-202	KNOWN	basic|appris_principal	protein_coding	DNAH12	HGNC	protein_coding		41	0.00	0	C	NM_178504		57410762	57410762	-1	no_stop_codon	ENST00000495027	ensembl	human	putative	69_37n	missense	30	11.76	4	SNP	0.999	T
ECHDC3	79746	genome.wustl.edu	37	10	11789358	11789358	+	Silent	SNP	T	T	C			TCGA-A2-A0CO-01A-13D-A228-09	TCGA-A2-A0CO-10A-01D-A22A-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	36053173-6839-43ec-8157-75d729085e6b	fea38127-979d-4085-a9e1-6965b99458f3	g.chr10:11789358T>C	ENST00000379215.4	+	2	392	c.181T>C	c.(181-183)Ttg>Ctg	p.L61L	ECHDC3_ENST00000496136.1_3'UTR	NM_024693.4	NP_078969	Q96DC8	ECHD3_HUMAN	enoyl CoA hydratase domain containing 3	61						mitochondrion (GO:0005739)	catalytic activity (GO:0003824)			breast(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)	4						GAACATCGTCTTGAGCAATCC	0.443																																						dbGAP											0													139.0	112.0	121.0					10																	11789358		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF275677	CCDS7084.1	10p14	2010-04-30	2010-04-30		ENSG00000134463	ENSG00000134463			23489	protein-coding gene	gene with protein product			"""enoyl Coenzyme A hydratase domain containing 3"""			12477932	Standard	NM_024693		Approved	FLJ20909	uc001ikw.4	Q96DC8	OTTHUMG00000017675	ENST00000379215.4:c.181T>C	10.37:g.11789358T>C		Somatic		WXS	Illumina GAIIx	Phase_IV	Q53HR9|Q5W0J7|Q8WYY8|Q9BVL8|Q9H7G4	Silent	SNP	pfam_Crotonase_core	p.L61	ENST00000379215.4	37	c.181	CCDS7084.1	10																																																																																			ECHDC3	-	pfam_Crotonase_core	ENSG00000134463		0.443	ECHDC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ECHDC3	HGNC	protein_coding	OTTHUMT00000046771.1	40	0.00	0	T	NM_024693		11789358	11789358	+1	no_errors	ENST00000379215	ensembl	human	known	69_37n	silent	30	11.76	4	SNP	0.998	C
EIF2AK3	9451	genome.wustl.edu	37	2	88889973	88889973	+	Missense_Mutation	SNP	T	T	G			TCGA-A2-A0CO-01A-13D-A228-09	TCGA-A2-A0CO-10A-01D-A22A-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	36053173-6839-43ec-8157-75d729085e6b	fea38127-979d-4085-a9e1-6965b99458f3	g.chr2:88889973T>G	ENST00000303236.3	-	6	1454	c.1153A>C	c.(1153-1155)Agt>Cgt	p.S385R	EIF2AK3_ENST00000419748.1_Missense_Mutation_p.S234R	NM_004836.5	NP_004827.4	Q9NZJ5	E2AK3_HUMAN	eukaryotic translation initiation factor 2-alpha kinase 3	385					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|activation of signaling protein activity involved in unfolded protein response (GO:0006987)|bone mineralization (GO:0030282)|calcium-mediated signaling (GO:0019722)|cellular protein metabolic process (GO:0044267)|chondrocyte development (GO:0002063)|endocrine pancreas development (GO:0031018)|endoplasmic reticulum organization (GO:0007029)|endoplasmic reticulum unfolded protein response (GO:0030968)|ER overload response (GO:0006983)|fat cell differentiation (GO:0045444)|insulin secretion (GO:0030073)|insulin-like growth factor receptor signaling pathway (GO:0048009)|intrinsic apoptotic signaling pathway in response to endoplasmic reticulum stress (GO:0070059)|lactation (GO:0007595)|negative regulation of apoptotic process (GO:0043066)|negative regulation of gene expression (GO:0010629)|negative regulation of myelination (GO:0031642)|negative regulation of translation (GO:0017148)|negative regulation of translational initiation in response to stress (GO:0032057)|ossification (GO:0001503)|positive regulation of protein binding (GO:0032092)|positive regulation of signal transduction (GO:0009967)|protein autophosphorylation (GO:0046777)|protein homooligomerization (GO:0051260)|protein phosphorylation (GO:0006468)|regulation of fatty acid metabolic process (GO:0019217)|response to endoplasmic reticulum stress (GO:0034976)|skeletal system development (GO:0001501)|SREBP signaling pathway (GO:0032933)|translation (GO:0006412)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	ATP binding (GO:0005524)|enzyme binding (GO:0019899)|eukaryotic translation initiation factor 2alpha kinase activity (GO:0004694)|identical protein binding (GO:0042802)|protein kinase activity (GO:0004672)|protein phosphatase binding (GO:0019903)|protein serine/threonine kinase activity (GO:0004674)			ovary(3)	3						AAGTAAACACTGTTTTCTGTG	0.368																																					GBM(138;671 1851 16235 39058 45249)	dbGAP											0													133.0	138.0	137.0					2																	88889973		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF110146	CCDS33241.1	2p12	2008-05-21			ENSG00000172071	ENSG00000172071			3255	protein-coding gene	gene with protein product		604032				10026192, 10575235	Standard	NM_004836		Approved	PEK, PERK	uc002stc.4	Q9NZJ5	OTTHUMG00000155046	ENST00000303236.3:c.1153A>C	2.37:g.88889973T>G	ENSP00000307235:p.Ser385Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	A0AVH1|A0AVH2|B2RCU9|O95846|Q53QY0|Q53SB1	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_Quinonprotein_ADH-like,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.S385R	ENST00000303236.3	37	c.1153	CCDS33241.1	2	.	.	.	.	.	.	.	.	.	.	T	28.3	4.908071	0.92107	.	.	ENSG00000172071	ENST00000419748;ENST00000303236;ENST00000535951;ENST00000415570	T;T;T	0.76578	-0.91;-0.88;-1.03	5.99	5.99	0.97316	.	0.000000	0.85682	D	0.000000	D	0.88599	0.6480	M	0.80746	2.51	0.58432	D	0.999999	D	0.76494	0.999	D	0.80764	0.994	D	0.89810	0.3981	10	0.72032	D	0.01	-14.5147	16.488	0.84190	0.0:0.0:0.0:1.0	.	385	Q9NZJ5	E2AK3_HUMAN	R	234;385;234;264	ENSP00000408325:S234R;ENSP00000307235:S385R;ENSP00000412076:S264R	ENSP00000307235:S385R	S	-	1	0	EIF2AK3	88671088	1.000000	0.71417	0.955000	0.39395	0.996000	0.88848	7.463000	0.80869	2.293000	0.77203	0.533000	0.62120	AGT	EIF2AK3	-	NULL	ENSG00000172071		0.368	EIF2AK3-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	EIF2AK3	HGNC	protein_coding	OTTHUMT00000338233.2	41	0.00	0	T	NM_004836		88889973	88889973	-1	no_errors	ENST00000303236	ensembl	human	known	69_37n	missense	20	23.08	6	SNP	1.000	G
ELFN2	114794	genome.wustl.edu	37	22	37769141	37769141	+	Missense_Mutation	SNP	T	T	C			TCGA-A2-A0CO-01A-13D-A228-09	TCGA-A2-A0CO-10A-01D-A22A-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	36053173-6839-43ec-8157-75d729085e6b	fea38127-979d-4085-a9e1-6965b99458f3	g.chr22:37769141T>C	ENST00000402918.2	-	3	3219	c.2434A>G	c.(2434-2436)Aag>Gag	p.K812E	ELFN2_ENST00000435824.1_5'Flank|RP1-63G5.5_ENST00000430883.1_RNA|RP1-63G5.8_ENST00000609322.1_RNA	NM_052906.3	NP_443138.2	Q5R3F8	PPR29_HUMAN	extracellular leucine-rich repeat and fibronectin type III domain containing 2	812					negative regulation of phosphatase activity (GO:0010923)	extracellular space (GO:0005615)|integral component of membrane (GO:0016021)	phosphatase binding (GO:0019902)|protein phosphatase inhibitor activity (GO:0004864)			NS(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(13)|ovary(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	35	Melanoma(58;0.0574)					GAGACCCCCTTCCAGTAATCA	0.657																																						dbGAP											0													71.0	64.0	66.0					22																	37769141		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC041596	CCDS33642.1	22q13.1	2013-02-11	2011-10-27	2011-10-27	ENSG00000166897	ENSG00000166897		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Fibronectin type III domain containing"""	29396	protein-coding gene	gene with protein product			"""leucine rich repeat containing 62"", ""extracellular leucine-rich repeat and fibronectin type III containing 2"", ""extracellular leucine-rich repeat and fibronectin type III domain containing 2"", ""protein phosphatase 1, regulatory subunit 29"""	LRRC62, PPP1R29		17868438	Standard	XR_244427		Approved	dJ63G5.3, KIAA1904	uc003asq.4	Q5R3F8	OTTHUMG00000150558	ENST00000402918.2:c.2434A>G	22.37:g.37769141T>C	ENSP00000385277:p.Lys812Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q96PY3	Missense_Mutation	SNP	superfamily_Fibronectin_type3,smart_Leu-rich_rpt_typical-subtyp,pfscan_LPXTG-motif_cell_wall_anchor	p.K812E	ENST00000402918.2	37	c.2434	CCDS33642.1	22	.	.	.	.	.	.	.	.	.	.	T	24.8	4.566647	0.86439	.	.	ENSG00000166897	ENST00000349653;ENST00000402918	T;T	0.69685	-0.42;-0.42	4.63	4.63	0.57726	.	0.000000	0.85682	D	0.000000	T	0.71913	0.3396	L	0.27053	0.805	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	T	0.76231	-0.3035	10	0.87932	D	0	-26.2682	14.3358	0.66589	0.0:0.0:0.0:1.0	.	812	Q5R3F8	PPR29_HUMAN	E	812	ENSP00000300147:K812E;ENSP00000385277:K812E	ENSP00000300147:K812E	K	-	1	0	ELFN2	36099087	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	4.985000	0.63845	1.837000	0.53436	0.459000	0.35465	AAG	ELFN2	-	NULL	ENSG00000166897		0.657	ELFN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ELFN2	HGNC	protein_coding	OTTHUMT00000318900.2	58	0.00	0	T	NM_052906		37769141	37769141	-1	no_errors	ENST00000349653	ensembl	human	known	69_37n	missense	46	36.11	26	SNP	1.000	C
FAM26F	441168	genome.wustl.edu	37	6	116784535	116784535	+	Silent	SNP	G	G	A			TCGA-A2-A0CO-01A-13D-A228-09	TCGA-A2-A0CO-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	36053173-6839-43ec-8157-75d729085e6b	fea38127-979d-4085-a9e1-6965b99458f3	g.chr6:116784535G>A	ENST00000368605.1	+	3	710	c.615G>A	c.(613-615)ctG>ctA	p.L205L	FAM26F_ENST00000368606.3_Silent_p.L33L|RP1-93H18.6_ENST00000476099.1_RNA	NM_001010919.1	NP_001010919.1	Q5R3K3	FA26F_HUMAN	family with sequence similarity 26, member F	205					ion transport (GO:0006811)	integral component of membrane (GO:0016021)				large_intestine(2)|lung(1)	3				GBM - Glioblastoma multiforme(226;0.0402)|all cancers(137;0.0627)|OV - Ovarian serous cystadenocarcinoma(136;0.0655)|Epithelial(106;0.231)		TTAGTTTTCTGCAGCTGAAAT	0.383																																						dbGAP											0													139.0	137.0	138.0					6																	116784535		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF086130	CCDS34519.1, CCDS64506.1	6q22.1	2007-06-20			ENSG00000188820	ENSG00000188820			33391	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 187"""	C6orf187			Standard	NM_001010919		Approved	RP1-93H18.5, OTTHUMP00000017061, OTTHUMP00000017062, dJ93H18.5	uc003pwv.4	Q5R3K3	OTTHUMG00000015438	ENST00000368605.1:c.615G>A	6.37:g.116784535G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B9EJB0|Q5R3K4	Silent	SNP	NULL	p.L205	ENST00000368605.1	37	c.615	CCDS34519.1	6																																																																																			FAM26F	-	NULL	ENSG00000188820		0.383	FAM26F-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM26F	HGNC	protein_coding	OTTHUMT00000041946.1	81	0.00	0	G	NM_001010919		116784535	116784535	+1	no_errors	ENST00000368605	ensembl	human	known	69_37n	silent	63	16.00	12	SNP	0.886	A
FLNC	2318	genome.wustl.edu	37	7	128496897	128496897	+	Missense_Mutation	SNP	C	C	T	rs374925943		TCGA-A2-A0CO-01A-13D-A228-09	TCGA-A2-A0CO-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	36053173-6839-43ec-8157-75d729085e6b	fea38127-979d-4085-a9e1-6965b99458f3	g.chr7:128496897C>T	ENST00000325888.8	+	45	7744	c.7483C>T	c.(7483-7485)Cgc>Tgc	p.R2495C	RP11-309L24.2_ENST00000469965.1_RNA|FLNC_ENST00000346177.6_Missense_Mutation_p.R2462C	NM_001458.4	NP_001449.3	Q14315	FLNC_HUMAN	filamin C, gamma	2495	Interaction with INPPL1.				cell junction assembly (GO:0034329)	costamere (GO:0043034)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|sarcoplasm (GO:0016528)	ankyrin binding (GO:0030506)|cytoskeletal protein binding (GO:0008092)	p.R2495S(1)		biliary_tract(1)|breast(7)|central_nervous_system(1)|cervix(1)|endometrium(19)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(19)|lung(59)|ovary(2)|pancreas(2)|prostate(1)|skin(6)|upper_aerodigestive_tract(2)	128						CTTCAAGATCCGCGTTGGGGA	0.617																																						dbGAP											1	Substitution - Missense(1)	lung(1)											74.0	80.0	78.0					7																	128496897		2176	4280	6456	-	-	-	SO:0001583	missense	0			AB208865	CCDS43644.1, CCDS47705.1	7q32-q35	2014-09-17	2009-07-23		ENSG00000128591	ENSG00000128591			3756	protein-coding gene	gene with protein product	"""actin binding protein 280"""	102565	"""filamin C, gamma (actin binding protein 280)"""	FLN2		7689010, 8088838	Standard	NM_001458		Approved	ABP-280, ABPL	uc003vnz.4	Q14315	OTTHUMG00000023627	ENST00000325888.8:c.7483C>T	7.37:g.128496897C>T	ENSP00000327145:p.Arg2495Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	B2ZZ88|O95303|Q07985|Q9NS12|Q9NYE5|Q9UMR8|Q9Y503	Missense_Mutation	SNP	pfam_Filamin/ABP280_repeat-like,pfam_CH-domain,superfamily_CH-domain,superfamily_Ig_E-set,smart_CH-domain,smart_Filamin,pfscan_CH-domain,pfscan_Filamin/ABP280_repeat-like	p.R2495C	ENST00000325888.8	37	c.7483	CCDS43644.1	7	.	.	.	.	.	.	.	.	.	.	c	33	5.195464	0.94960	.	.	ENSG00000128591	ENST00000325888;ENST00000346177	D;D	0.88586	-2.4;-2.4	5.51	5.51	0.81932	Immunoglobulin E-set (1);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	D	0.94905	0.8353	M	0.80616	2.505	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.83275	0.996;0.932	D	0.95161	0.8281	10	0.87932	D	0	.	19.4409	0.94820	0.0:1.0:0.0:0.0	.	2462;2495	Q14315-2;Q14315	.;FLNC_HUMAN	C	2495;2462	ENSP00000327145:R2495C;ENSP00000344002:R2462C	ENSP00000327145:R2495C	R	+	1	0	FLNC	128284133	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	4.923000	0.63412	2.588000	0.87417	0.552000	0.68991	CGC	FLNC	-	superfamily_Ig_E-set,smart_Filamin,pfscan_Filamin/ABP280_repeat-like	ENSG00000128591		0.617	FLNC-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FLNC	HGNC	protein_coding	OTTHUMT00000059948.3	47	0.00	0	C			128496897	128496897	+1	no_errors	ENST00000325888	ensembl	human	known	69_37n	missense	38	13.64	6	SNP	1.000	T
GIMAP8	155038	genome.wustl.edu	37	7	150164191	150164191	+	Silent	SNP	G	G	T			TCGA-A2-A0CO-01A-13D-A228-09	TCGA-A2-A0CO-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	36053173-6839-43ec-8157-75d729085e6b	fea38127-979d-4085-a9e1-6965b99458f3	g.chr7:150164191G>T	ENST00000307271.3	+	2	979	c.405G>T	c.(403-405)cgG>cgT	p.R135R		NM_175571.2	NP_783161.1	Q8ND71	GIMA8_HUMAN	GTPase, IMAP family member 8	135	AIG1-type G 1.					cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	GTP binding (GO:0005525)			breast(3)|central_nervous_system(3)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(11)|lung(26)|ovary(2)|skin(7)|stomach(1)|urinary_tract(1)	62			OV - Ovarian serous cystadenocarcinoma(82;0.0218)	UCEC - Uterine corpus endometrioid carcinoma (81;0.17)		TCTTCACTCGGAAGGATGATT	0.463																																						dbGAP											0													81.0	77.0	78.0					7																	150164191		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AL834361	CCDS34777.1	7q36.1	2014-04-04			ENSG00000171115	ENSG00000171115		"""GTPases, IMAP"""	21792	protein-coding gene	gene with protein product	"""immune-associated nucleotide-binding protein 9"""					15474311	Standard	XM_005249951		Approved	DKFZp667I133, hIAN6, IAN9	uc003whj.3	Q8ND71	OTTHUMG00000158327	ENST00000307271.3:c.405G>T	7.37:g.150164191G>T		Somatic		WXS	Illumina GAIIx	Phase_IV		Silent	SNP	pfam_AIG1	p.R135	ENST00000307271.3	37	c.405	CCDS34777.1	7																																																																																			GIMAP8	-	pfam_AIG1	ENSG00000171115		0.463	GIMAP8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GIMAP8	HGNC	protein_coding	OTTHUMT00000350701.1	26	0.00	0	G	NM_175571		150164191	150164191	+1	no_errors	ENST00000307271	ensembl	human	known	69_37n	silent	38	11.63	5	SNP	0.006	T
GOLGA6L10	647042	genome.wustl.edu	37	15	82635183	82635183	+	Missense_Mutation	SNP	A	A	C	rs62010119		TCGA-A2-A0CO-01A-13D-A228-09	TCGA-A2-A0CO-10A-01D-A22A-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	36053173-6839-43ec-8157-75d729085e6b	fea38127-979d-4085-a9e1-6965b99458f3	g.chr15:82635183A>C	ENST00000439287.4	-	9	1486	c.1387T>G	c.(1387-1389)Tgc>Ggc	p.C463G		NM_001164465.1	NP_001157937.1	A6NI86	GG6LA_HUMAN	golgin A6 family-like 10	463										endometrium(1)|kidney(4)	5						AAAGAATGGCATGCAGCCTCT	0.502																																						dbGAP											0																																										-	-	-	SO:0001583	missense	0				CCDS45325.1	15q25.2	2014-08-13	2010-02-12		ENSG00000278662				37228	protein-coding gene	gene with protein product			"""golgi autoantigen, golgin subfamily a, 6-like 10"", ""golgin A6 family-like 18"""	GOLGA6L18			Standard	XM_006720643		Approved		uc021ssn.1	A6NI86	OTTHUMG00000172580	ENST00000439287.4:c.1387T>G	15.37:g.82635183A>C	ENSP00000388606:p.Cys463Gly	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	NULL	p.C463G	ENST00000439287.4	37	c.1387	CCDS45325.1	15	.	.	.	.	.	.	.	.	.	.	.	7.797	0.712869	0.15306	.	.	ENSG00000205281	ENST00000439287	T	0.37058	1.22	.	.	.	.	.	.	.	.	T	0.25754	0.0627	N	0.22421	0.69	0.09310	N	1	.	.	.	.	.	.	T	0.29366	-1.0014	5	0.87932	D	0	.	.	.	.	.	.	.	.	G	463	ENSP00000388606:C463G	ENSP00000388606:C463G	C	-	1	0	GOLGA6L10	80422238	0.992000	0.36948	0.042000	0.18584	0.043000	0.13939	0.965000	0.29319	0.093000	0.17368	0.092000	0.15492	TGC	GOLGA6L10	-	NULL	ENSG00000205281		0.502	GOLGA6L10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GOLGA6L10	HGNC	protein_coding	OTTHUMT00000419403.2	33	0.00	0	A	NM_001164465		82635183	82635183	-1	no_errors	ENST00000439287	ensembl	human	known	69_37n	missense	66	10.81	8	SNP	0.264	C
ITIH2	3698	genome.wustl.edu	37	10	7773953	7773953	+	Silent	SNP	G	G	A	rs536759001		TCGA-A2-A0CO-01A-13D-A228-09	TCGA-A2-A0CO-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	36053173-6839-43ec-8157-75d729085e6b	fea38127-979d-4085-a9e1-6965b99458f3	g.chr10:7773953G>A	ENST00000358415.4	+	13	1807	c.1641G>A	c.(1639-1641)gcG>gcA	p.A547A	ITIH2_ENST00000379587.4_Silent_p.A536A	NM_002216.2	NP_002207.2	P19823	ITIH2_HUMAN	inter-alpha-trypsin inhibitor heavy chain 2	547					hyaluronan metabolic process (GO:0030212)|negative regulation of endopeptidase activity (GO:0010951)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	endopeptidase inhibitor activity (GO:0004866)|serine-type endopeptidase inhibitor activity (GO:0004867)			NS(2)|breast(1)|endometrium(8)|kidney(1)|large_intestine(17)|lung(25)|ovary(1)|pancreas(1)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	64						TTATCACGGCGACTTCGGTAC	0.443																																						dbGAP											0													122.0	115.0	117.0					10																	7773953		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			X07173	CCDS31141.1	10p14	2011-10-26	2011-10-26		ENSG00000151655	ENSG00000151655			6167	protein-coding gene	gene with protein product		146640	"""inter-alpha (globulin) inhibitor, H2 polypeptide"""			1385302, 10100603	Standard	NM_002216		Approved	H2P	uc001ijs.3	P19823	OTTHUMG00000017633	ENST00000358415.4:c.1641G>A	10.37:g.7773953G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q14659|Q15484|Q5T986	Silent	SNP	pfam_ITI_HC_C,pfam_VIT,pfam_VWF_A,smart_VIT,smart_VWF_A,pfscan_VWF_A	p.A547	ENST00000358415.4	37	c.1641	CCDS31141.1	10																																																																																			ITIH2	-	NULL	ENSG00000151655		0.443	ITIH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ITIH2	HGNC	protein_coding	OTTHUMT00000046678.2	14	0.00	0	G	NM_002216		7773953	7773953	+1	no_errors	ENST00000358415	ensembl	human	known	69_37n	silent	15	21.05	4	SNP	0.000	A
KCNN3	3782	genome.wustl.edu	37	1	154842330	154842330	+	Silent	SNP	T	T	C			TCGA-A2-A0CO-01A-13D-A228-09	TCGA-A2-A0CO-10A-01D-A22A-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	36053173-6839-43ec-8157-75d729085e6b	fea38127-979d-4085-a9e1-6965b99458f3	g.chr1:154842330T>C	ENST00000271915.4	-	1	426	c.111A>G	c.(109-111)caA>caG	p.Q37Q	KCNN3_ENST00000358505.2_5'Flank	NM_001204087.1|NM_002249.5	NP_001191016.1|NP_002240.3	Q9UGI6	KCNN3_HUMAN	potassium intermediate/small conductance calcium-activated channel, subfamily N, member 3	37	Gln-rich.				potassium ion transmembrane transport (GO:0071805)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	calmodulin binding (GO:0005516)|small conductance calcium-activated potassium channel activity (GO:0016286)			cervix(1)|endometrium(3)|kidney(2)|large_intestine(6)|lung(11)|prostate(4)|skin(1)	28	all_lung(78;2.29e-27)|all_hematologic(923;0.088)|Hepatocellular(266;0.108)|all_neural(408;0.245)		BRCA - Breast invasive adenocarcinoma(34;0.00819)		Miconazole(DB01110)|Procaine(DB00721)	gctgctgctgttgctgctgct	0.677																																						dbGAP											0													8.0	8.0	8.0					1																	154842330		1936	3838	5774	-	-	-	SO:0001819	synonymous_variant	0			AF031815	CCDS1072.1, CCDS30880.1, CCDS72928.1	1q21.3	2012-07-05			ENSG00000143603	ENSG00000143603		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, calcium-activated"""	6292	protein-coding gene	gene with protein product		602983				9491810, 16382103	Standard	NM_002249		Approved	KCa2.3, hSK3, SKCA3	uc021pah.1	Q9UGI6	OTTHUMG00000037260	ENST00000271915.4:c.111A>G	1.37:g.154842330T>C		Somatic		WXS	Illumina GAIIx	Phase_IV	B1ANX0|O43517|Q86VF9|Q8WXG7	Silent	SNP	pfam_K_chnl_Ca-activ_SK,pfam_CaM-bd_dom,pfam_Ion_trans_2,superfamily_CaM-bd_dom,prints_K_chnl_Ca-activ_SK	p.Q37	ENST00000271915.4	37	c.111	CCDS30880.1	1																																																																																			KCNN3	-	NULL	ENSG00000143603		0.677	KCNN3-001	NOVEL	basic|appris_principal|CCDS	protein_coding	KCNN3	HGNC	protein_coding	OTTHUMT00000090688.3	40	0.00	0	T	NM_002249		154842330	154842330	-1	no_errors	ENST00000271915	ensembl	human	known	69_37n	silent	84	10.64	10	SNP	0.893	C
MASP1	5648	genome.wustl.edu	37	3	186953629	186953629	+	Intron	SNP	C	C	T			TCGA-A2-A0CO-01A-13D-A228-09	TCGA-A2-A0CO-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	36053173-6839-43ec-8157-75d729085e6b	fea38127-979d-4085-a9e1-6965b99458f3	g.chr3:186953629C>T	ENST00000337774.5	-	10	1693				MASP1_ENST00000392472.2_Missense_Mutation_p.R564H|MASP1_ENST00000495249.1_5'Flank|MASP1_ENST00000296280.6_Missense_Mutation_p.R677H	NM_001879.5	NP_001870.3	P48740	MASP1_HUMAN	mannan-binding lectin serine peptidase 1 (C4/C2 activating component of Ra-reactive factor)						complement activation (GO:0006956)|complement activation, lectin pathway (GO:0001867)|innate immune response (GO:0045087)|negative regulation of complement activation (GO:0045916)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	calcium ion binding (GO:0005509)|calcium-dependent protein binding (GO:0048306)|peptidase activity (GO:0008233)|protein homodimerization activity (GO:0042803)|serine-type endopeptidase activity (GO:0004252)			NS(1)|breast(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(12)|liver(2)|lung(27)|ovary(2)|pancreas(1)|prostate(3)|urinary_tract(1)	60	all_cancers(143;5.33e-12)|Ovarian(172;0.0339)		OV - Ovarian serous cystadenocarcinoma(80;3.49e-18)	GBM - Glioblastoma multiforme(93;0.0366)		CACCACCCAGCGCTGGCTCAA	0.567																																						dbGAP											0													66.0	64.0	65.0					3																	186953629		2203	4300	6503	-	-	-	SO:0001627	intron_variant	0			D28593	CCDS33907.1, CCDS33908.1, CCDS33909.1	3q27-q28	2014-09-17	2005-08-17		ENSG00000127241	ENSG00000127241		"""Serine peptidases / Serine peptidases"""	6901	protein-coding gene	gene with protein product		600521	"""mannan-binding lectin serine protease 1 (C4/C2 activating component of Ra-reactive factor)"""	CRARF, PRSS5		8018603, 8240317	Standard	NR_033519		Approved	MASP	uc003fri.3	P48740	OTTHUMG00000156461	ENST00000337774.5:c.1303+5639G>A	3.37:g.186953629C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K542|A8K6M1|B4E2L7|O95570|Q68D21|Q8IUV8|Q96RS4|Q9UF09	Missense_Mutation	SNP	pfam_Peptidase_S1_S6,pfam_CUB,pfam_Sushi_SCR_CCP,pfam_EGF-like_Ca-bd,superfamily_Pept_cys/ser_Trypsin-like,superfamily_CUB,superfamily_Complement_control_module,smart_CUB,smart_EGF-like_Ca-bd,smart_Sushi_SCR_CCP,smart_Peptidase_S1_S6,prints_Peptidase_S1A,pfscan_CUB,pfscan_Sushi_SCR_CCP,pfscan_Peptidase_S1_S6	p.R677H	ENST00000337774.5	37	c.2030	CCDS33907.1	3	.	.	.	.	.	.	.	.	.	.	C	14.32	2.499696	0.44455	.	.	ENSG00000127241	ENST00000296280;ENST00000392472;ENST00000541811	D;D	0.93906	-3.31;-3.31	5.87	-4.41	0.03590	.	0.657841	0.15561	N	0.255922	D	0.87912	0.6297	M	0.64170	1.965	0.80722	D	1	B;B	0.17852	0.005;0.024	B;B	0.17722	0.008;0.019	T	0.67534	-0.5646	10	0.42905	T	0.14	.	3.6612	0.08240	0.1006:0.4663:0.0989:0.3342	.	564;677	P48740-4;P48740-2	.;.	H	677;564;31	ENSP00000296280:R677H;ENSP00000376264:R564H	ENSP00000296280:R677H	R	-	2	0	MASP1	188436323	0.991000	0.36638	0.809000	0.32408	0.915000	0.54546	0.381000	0.20619	-1.193000	0.02688	-0.140000	0.14226	CGC	MASP1	-	pfam_Peptidase_S1_S6,superfamily_Pept_cys/ser_Trypsin-like,smart_Peptidase_S1_S6,pfscan_Peptidase_S1_S6	ENSG00000127241		0.567	MASP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MASP1	HGNC	protein_coding	OTTHUMT00000344262.1	28	0.00	0	C	NM_001879		186953629	186953629	-1	no_errors	ENST00000296280	ensembl	human	known	69_37n	missense	25	19.35	6	SNP	0.988	T
KMT2D	8085	genome.wustl.edu	37	12	49443899	49443899	+	Nonsense_Mutation	SNP	C	C	A	rs199933192		TCGA-A2-A0CO-01A-13D-A228-09	TCGA-A2-A0CO-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	36053173-6839-43ec-8157-75d729085e6b	fea38127-979d-4085-a9e1-6965b99458f3	g.chr12:49443899C>A	ENST00000301067.7	-	11	3471	c.3472G>T	c.(3472-3474)Gag>Tag	p.E1158*		NM_003482.3	NP_003473.3	O14686	KMT2D_HUMAN	lysine (K)-specific methyltransferase 2D	1158	Pro-rich.				chromatin silencing (GO:0006342)|histone H3-K4 methylation (GO:0051568)|oocyte growth (GO:0001555)|oogenesis (GO:0048477)|positive regulation of cell proliferation (GO:0008284)|positive regulation of intracellular estrogen receptor signaling pathway (GO:0033148)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|response to estrogen (GO:0043627)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)	p.E885*(2)|p.E1158*(1)									GCCAGCTCCTCGGGGTCCAGG	0.602																																						dbGAP											3	Substitution - Nonsense(3)	lung(2)|upper_aerodigestive_tract(1)											45.0	49.0	47.0					12																	49443899		1917	4119	6036	-	-	-	SO:0001587	stop_gained	0			AF010403	CCDS44873.1	12q13.12	2013-05-09	2013-05-09	2013-05-09	ENSG00000167548	ENSG00000167548		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	7133	protein-coding gene	gene with protein product		602113	"""trinucleotide repeat containing 21"", ""myeloid/lymphoid or mixed-lineage leukemia 2"""	TNRC21, MLL2		9247308	Standard	NM_003482		Approved	ALR, MLL4, CAGL114		O14686	OTTHUMG00000166524	ENST00000301067.7:c.3472G>T	12.37:g.49443899C>A	ENSP00000301067:p.Glu1158*	Somatic		WXS	Illumina GAIIx	Phase_IV	O14687	Nonsense_Mutation	SNP	pfam_Znf_PHD-finger,pfam_SET_dom,pfam_FYrich_C,pfam_FYrich_N,superfamily_Znf_FYVE_PHD,superfamily_HMG_superfamily,smart_Znf_PHD,smart_Znf_RING,smart_HMG_superfamily,smart_FYrich_N,smart_FYrich_C,smart_SET_dom,smart_Post-SET_dom,pfscan_SET_dom,pfscan_Post-SET_dom,pfscan_Znf_PHD-finger,pfscan_Znf_RING	p.E1158*	ENST00000301067.7	37	c.3472	CCDS44873.1	12	.	.	.	.	.	.	.	.	.	.	C	41	9.130661	0.99075	.	.	ENSG00000167548	ENST00000301067	.	.	.	5.4	5.4	0.78164	.	0.000000	0.37348	N	0.002137	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	17.9764	0.89129	0.0:1.0:0.0:0.0	.	.	.	.	X	1158	.	ENSP00000301067:E1158X	E	-	1	0	MLL2	47730166	0.990000	0.36364	0.994000	0.49952	0.966000	0.64601	2.946000	0.49050	2.527000	0.85204	0.563000	0.77884	GAG	MLL2	-	NULL	ENSG00000167548		0.602	KMT2D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MLL2	HGNC	protein_coding	OTTHUMT00000390183.2	32	0.00	0	C			49443899	49443899	-1	no_errors	ENST00000301067	ensembl	human	known	69_37n	nonsense	46	13.21	7	SNP	1.000	A
NCOR1	9611	genome.wustl.edu	37	17	15973687	15973688	+	Frame_Shift_Del	DEL	AT	AT	-			TCGA-A2-A0CO-01A-13D-A228-09	TCGA-A2-A0CO-10A-01D-A22A-09	AT	AT					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	36053173-6839-43ec-8157-75d729085e6b	fea38127-979d-4085-a9e1-6965b99458f3	g.chr17:15973687_15973688delAT	ENST00000268712.3	-	31	4561_4562	c.4304_4305delAT	c.(4303-4305)tatfs	p.Y1435fs	NCOR1_ENST00000395851.1_Frame_Shift_Del_p.Y1451fs|NCOR1_ENST00000395857.3_Frame_Shift_Del_p.Y19fs	NM_006311.3	NP_006302.2	O75376	NCOR1_HUMAN	nuclear receptor corepressor 1	1435	Interaction with ETO.				CD4-positive, CD25-positive, alpha-beta regulatory T cell differentiation (GO:0002361)|cellular lipid metabolic process (GO:0044255)|cholesterol homeostasis (GO:0042632)|chromatin modification (GO:0016568)|circadian regulation of gene expression (GO:0032922)|definitive erythrocyte differentiation (GO:0060318)|gene expression (GO:0010467)|negative regulation of JNK cascade (GO:0046329)|negative regulation of phosphatidylinositol 3-kinase signaling (GO:0014067)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|Notch signaling pathway (GO:0007219)|positive regulation of histone deacetylation (GO:0031065)|regulation of fatty acid transport (GO:2000191)|regulation of glycolytic process by negative regulation of transcription from RNA polymerase II promoter (GO:0072362)|regulation of lipid transport by negative regulation of transcription from RNA polymerase II promoter (GO:0072368)|regulation of multicellular organism growth (GO:0040014)|small molecule metabolic process (GO:0044281)|spindle assembly (GO:0051225)|thalamus development (GO:0021794)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle microtubule (GO:0005876)|transcription factor complex (GO:0005667)|transcriptional repressor complex (GO:0017053)	chromatin binding (GO:0003682)|histone deacetylase binding (GO:0042826)|histone deacetylase regulator activity (GO:0035033)|nuclear hormone receptor binding (GO:0035257)|RNA polymerase II activating transcription factor binding (GO:0001102)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)|transcription regulatory region DNA binding (GO:0044212)			NS(2)|breast(13)|central_nervous_system(2)|cervix(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(17)|lung(26)|ovary(1)|prostate(7)|skin(2)|upper_aerodigestive_tract(6)|urinary_tract(10)	107				UCEC - Uterine corpus endometrioid carcinoma (92;0.101)		TCACATCCTCATATTTTCCCCG	0.52																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			AF044209	CCDS11175.1, CCDS54094.1, CCDS54095.1	17p11.2	2014-06-12	2010-06-10		ENSG00000141027	ENSG00000141027			7672	protein-coding gene	gene with protein product	"""thyroid hormone- and retinoic acid receptor-associated corepressor 1"", ""protein phosphatase 1, regulatory subunit 109"""	600849	"""nuclear receptor co-repressor 1"""			7566114, 9724795	Standard	NM_006311		Approved	N-CoR, hCIT529I10, TRAC1, hN-CoR, KIAA1047, MGC104216, PPP1R109	uc002gpo.3	O75376	OTTHUMG00000059309	ENST00000268712.3:c.4304_4305delAT	17.37:g.15973689_15973690delAT	ENSP00000268712:p.Tyr1435fs	Somatic		WXS	Illumina GAIIx	Phase_IV	B3DLF8|E9PGV6|Q86YY0|Q9UPV5|Q9UQ18	Frame_Shift_Del	DEL	pfam_SANT/Myb,superfamily_Homeodomain-like,smart_SANT/Myb,pfscan_Myb-like_dom	p.Y1435fs	ENST00000268712.3	37	c.4305_4304	CCDS11175.1	17																																																																																			NCOR1	-	NULL	ENSG00000141027		0.520	NCOR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NCOR1	HGNC	protein_coding	OTTHUMT00000131751.5	50	0.00	0	AT	NM_006311		15973687	15973688	-1	no_errors	ENST00000268712	ensembl	human	known	69_37n	frame_shift_del	25	35.71	15	DEL	0.288:0.998	-
PDE4DIP	9659	genome.wustl.edu	37	1	145039922	145039922	+	5'UTR	SNP	G	G	C	rs55747750	byFrequency	TCGA-A2-A0CO-01A-13D-A228-09	TCGA-A2-A0CO-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	36053173-6839-43ec-8157-75d729085e6b	fea38127-979d-4085-a9e1-6965b99458f3	g.chr1:145039922G>C	ENST00000313382.9	-	0	80				PDE4DIP_ENST00000369359.4_Intron|PDE4DIP_ENST00000493130.2_5'Flank|PDE4DIP_ENST00000478649.2_5'Flank|PDE4DIP_ENST00000369348.3_Intron|PDE4DIP_ENST00000530740.1_Intron	NM_001198832.1	NP_001185761	Q5VU43	MYOME_HUMAN	phosphodiesterase 4D interacting protein						cellular protein complex assembly (GO:0043623)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|myofibril (GO:0030016)|nucleus (GO:0005634)	enzyme binding (GO:0019899)			NS(1)|breast(3)|central_nervous_system(2)|cervix(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(12)|lung(106)|ovary(8)|prostate(7)|skin(3)|upper_aerodigestive_tract(4)|urinary_tract(2)	176				Colorectal(2;0.0829)|COAD - Colon adenocarcinoma(2;0.126)		CTGCCCGGGCGGCGGTGCGCG	0.701			T	PDGFRB	MPD																																	dbGAP		Dom	yes		1	1q12	9659	phosphodiesterase 4D interacting protein (myomegalin)		L	0																																										-	-	-	SO:0001623	5_prime_UTR_variant	0			AB007923, AB007946	CCDS72887.1, CCDS72888.1, CCDS72889.1, CCDS72890.1, CCDS72891.1, CCDS72892.1, CCDS72893.1, CCDS72894.1	1q21.1	2008-07-31	2008-07-31		ENSG00000178104	ENSG00000178104			15580	protein-coding gene	gene with protein product	"""myomegalin"""	608117	"""cardiomyopathy associated 2"""	CMYA2		9455484, 11134006	Standard	NM_022359		Approved	KIAA0477, KIAA0454, MMGL	uc021ouh.1	Q5VU43	OTTHUMG00000013846	ENST00000313382.9:c.-313C>G	1.37:g.145039922G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	A2RU15|O75042|O75065|Q2YDC1|Q5VU42|Q5VU44|Q5VU45|Q5VU46|Q5VU47|Q5VU48|Q5VU49|Q68DU2|Q6AZ93|Q6PK88|Q86T40|Q86TB2|Q8N3W0|Q8TAY9|Q9HCP2|Q9HCP3|Q9HCP4|Q9HCP5	RNA	SNP	-	NULL	ENST00000313382.9	37	NULL	CCDS55628.1	1																																																																																			PDE4DIP	-	-	ENSG00000178104		0.701	PDE4DIP-001	KNOWN	basic|CCDS	protein_coding	PDE4DIP	HGNC	protein_coding	OTTHUMT00000038856.2	9	0.00	0	G	NM_022359		145039922	145039922	-1	no_errors	ENST00000497529	ensembl	human	known	69_37n	rna	10	28.57	4	SNP	0.016	C
PITX1	5307	genome.wustl.edu	37	5	134364708	134364708	+	Missense_Mutation	SNP	C	C	T			TCGA-A2-A0CO-01A-13D-A228-09	TCGA-A2-A0CO-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	36053173-6839-43ec-8157-75d729085e6b	fea38127-979d-4085-a9e1-6965b99458f3	g.chr5:134364708C>T	ENST00000265340.7	-	3	1122	c.706G>A	c.(706-708)Ggc>Agc	p.G236S	PITX1_ENST00000506438.1_Missense_Mutation_p.G236S	NM_002653.4	NP_002644.4	P78337	PITX1_HUMAN	paired-like homeodomain 1	236	Interacts with PIT-1. {ECO:0000250}.				anatomical structure morphogenesis (GO:0009653)|branchiomeric skeletal muscle development (GO:0014707)|cartilage development (GO:0051216)|embryonic hindlimb morphogenesis (GO:0035116)|myoblast fate commitment (GO:0048625)|pituitary gland development (GO:0021983)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II transcription factor binding transcription factor activity involved in positive regulation of transcription (GO:0001190)			central_nervous_system(1)|cervix(3)|endometrium(3)|large_intestine(1)|lung(5)|ovary(1)	14			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0233)	READ - Rectum adenocarcinoma(2;0.0607)		TTGGGCATGCCAGGCACGGCG	0.652																																						dbGAP											0													79.0	77.0	78.0					5																	134364708		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF009648	CCDS4182.1	5q31.1	2011-06-20	2007-07-12		ENSG00000069011	ENSG00000069011		"""Homeoboxes / PRD class"""	9004	protein-coding gene	gene with protein product		602149	"""paired-like homeodomain transcription factor 1"""	BFT		9337397, 9070926	Standard	NM_002653		Approved	PTX1, POTX	uc010jea.3	P78337	OTTHUMG00000149983	ENST00000265340.7:c.706G>A	5.37:g.134364708C>T	ENSP00000265340:p.Gly236Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K3M0|D3DQB0|O14677|O60425|Q9BTI5	Missense_Mutation	SNP	pfam_Homeodomain,pfam_OAR_dom,superfamily_Homeodomain-like,smart_Homeodomain,pirsf_Homeobox_Pitx/unc30,pfscan_OAR_dom,pfscan_Homeodomain	p.G236S	ENST00000265340.7	37	c.706	CCDS4182.1	5	.	.	.	.	.	.	.	.	.	.	C	23.2	4.386476	0.82902	.	.	ENSG00000069011	ENST00000265340;ENST00000506438	D;D	0.90955	-2.76;-2.76	4.29	4.29	0.51040	.	0.000000	0.85682	D	0.000000	D	0.93236	0.7845	L	0.49778	1.585	0.80722	D	1	D	0.89917	1.0	D	0.78314	0.991	D	0.92779	0.6239	10	0.39692	T	0.17	.	15.7165	0.77672	0.0:1.0:0.0:0.0	.	236	P78337	PITX1_HUMAN	S	236	ENSP00000265340:G236S;ENSP00000427542:G236S	ENSP00000265340:G236S	G	-	1	0	PITX1	134392607	1.000000	0.71417	1.000000	0.80357	0.968000	0.65278	4.632000	0.61311	1.932000	0.55993	0.462000	0.41574	GGC	PITX1	-	pirsf_Homeobox_Pitx/unc30	ENSG00000069011		0.652	PITX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PITX1	HGNC	protein_coding	OTTHUMT00000251195.3	83	0.00	0	C			134364708	134364708	-1	no_errors	ENST00000265340	ensembl	human	known	69_37n	missense	62	26.19	22	SNP	1.000	T
POU3F2	5454	genome.wustl.edu	37	6	99283859	99283859	+	Missense_Mutation	SNP	G	G	C			TCGA-A2-A0CO-01A-13D-A228-09	TCGA-A2-A0CO-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	36053173-6839-43ec-8157-75d729085e6b	fea38127-979d-4085-a9e1-6965b99458f3	g.chr6:99283859G>C	ENST00000328345.5	+	1	1280	c.1110G>C	c.(1108-1110)gaG>gaC	p.E370D		NM_005604.3	NP_005595.2	P20265	PO3F2_HUMAN	POU class 3 homeobox 2	370					astrocyte development (GO:0014002)|cellular response to organic substance (GO:0071310)|cerebral cortex radially oriented cell migration (GO:0021799)|epidermis development (GO:0008544)|forebrain ventricular zone progenitor cell division (GO:0021869)|hypothalamus cell differentiation (GO:0021979)|myelination in peripheral nervous system (GO:0022011)|neurohypophysis development (GO:0021985)|neuron differentiation (GO:0030182)|positive regulation of cell proliferation (GO:0008284)|positive regulation of multicellular organism growth (GO:0040018)|regulation of axonogenesis (GO:0050770)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	identical protein binding (GO:0042802)|RNA polymerase II transcription coactivator activity (GO:0001105)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(2)|large_intestine(3)|lung(5)	10		all_cancers(76;1.56e-06)|Acute lymphoblastic leukemia(125;4.93e-10)|all_hematologic(75;3.55e-07)|all_epithelial(107;0.00893)|Colorectal(196;0.069)|Lung NSC(302;0.197)		BRCA - Breast invasive adenocarcinoma(108;0.0355)		GGGCTCTGGAGAGCCATTTCC	0.602																																						dbGAP											0													61.0	69.0	66.0					6																	99283859		2203	4300	6503	-	-	-	SO:0001583	missense	0			Z11933	CCDS5040.1	6q16.2	2011-06-20	2007-07-13		ENSG00000184486	ENSG00000184486		"""Homeoboxes / POU class"""	9215	protein-coding gene	gene with protein product		600494	"""POU domain class 3, transcription factor 2"""	OTF7		8441633	Standard	NM_005604		Approved	POUF3, BRN2, OCT7	uc003ppe.3	P20265	OTTHUMG00000015258	ENST00000328345.5:c.1110G>C	6.37:g.99283859G>C	ENSP00000329170:p.Glu370Asp	Somatic		WXS	Illumina GAIIx	Phase_IV	Q14960|Q86V54|Q9UJL0	Missense_Mutation	SNP	pirsf_Transcription_factor_POU,pfam_POU_specific,pfam_Homeodomain,superfamily_Lambda_DNA-bd_dom,superfamily_Homeodomain-like,smart_POU_specific,smart_Homeodomain,pfscan_Homeodomain,pfscan_POU_specific,prints_POU	p.E370D	ENST00000328345.5	37	c.1110	CCDS5040.1	6	.	.	.	.	.	.	.	.	.	.	G	17.66	3.443685	0.63067	.	.	ENSG00000184486	ENST00000328345;ENST00000425116	D	0.97791	-4.54	4.66	3.7	0.42460	Homeodomain-related (1);Homeobox (3);POU (1);Homeodomain-like (1);	0.000000	0.64402	U	0.000003	D	0.98720	0.9570	H	0.95402	3.665	0.58432	D	0.999991	D	0.61697	0.99	D	0.68765	0.96	D	0.98860	1.0762	10	0.87932	D	0	.	7.9561	0.30045	0.1944:0.0:0.8056:0.0	.	370	P20265	PO3F2_HUMAN	D	370;303	ENSP00000329170:E370D	ENSP00000329170:E370D	E	+	3	2	POU3F2	99390580	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.964000	0.56780	2.407000	0.81776	0.555000	0.69702	GAG	POU3F2	-	pirsf_Transcription_factor_POU,pfam_Homeodomain,superfamily_Homeodomain-like,smart_Homeodomain,pfscan_Homeodomain,prints_POU	ENSG00000184486		0.602	POU3F2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	POU3F2	HGNC	protein_coding	OTTHUMT00000041586.2	40	0.00	0	G			99283859	99283859	+1	no_errors	ENST00000328345	ensembl	human	known	69_37n	missense	23	14.81	4	SNP	1.000	C
PRKAA1	5562	genome.wustl.edu	37	5	40763109	40763109	+	Missense_Mutation	SNP	G	G	T	rs371307629		TCGA-A2-A0CO-01A-13D-A228-09	TCGA-A2-A0CO-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	36053173-6839-43ec-8157-75d729085e6b	fea38127-979d-4085-a9e1-6965b99458f3	g.chr5:40763109G>T	ENST00000397128.2	-	9	1459	c.1451C>A	c.(1450-1452)gCc>gAc	p.A484D	PRKAA1_ENST00000354209.3_Missense_Mutation_p.A499D	NM_006251.5|NM_206907.3	NP_006242.5|NP_996790.3	Q13131	AAPK1_HUMAN	protein kinase, AMP-activated, alpha 1 catalytic subunit	484					activation of MAPK activity (GO:0000187)|autophagy (GO:0006914)|cell cycle arrest (GO:0007050)|cellular response to ethanol (GO:0071361)|cellular response to glucose starvation (GO:0042149)|cellular response to hydrogen peroxide (GO:0070301)|cellular response to hypoxia (GO:0071456)|cellular response to nutrient levels (GO:0031669)|cholesterol biosynthetic process (GO:0006695)|cold acclimation (GO:0009631)|fatty acid biosynthetic process (GO:0006633)|fatty acid homeostasis (GO:0055089)|fatty acid oxidation (GO:0019395)|glucose homeostasis (GO:0042593)|glucose metabolic process (GO:0006006)|insulin receptor signaling pathway (GO:0008286)|lipid biosynthetic process (GO:0008610)|negative regulation of apoptotic process (GO:0043066)|negative regulation of glucose import in response to insulin stimulus (GO:2001274)|negative regulation of glucosylceramide biosynthetic process (GO:0046318)|negative regulation of lipid catabolic process (GO:0050995)|negative regulation of TOR signaling (GO:0032007)|positive regulation of autophagy (GO:0010508)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cholesterol biosynthetic process (GO:0045542)|positive regulation of gene expression (GO:0010628)|positive regulation of glycolytic process (GO:0045821)|protein heterooligomerization (GO:0051291)|protein phosphorylation (GO:0006468)|regulation of circadian rhythm (GO:0042752)|regulation of energy homeostasis (GO:2000505)|regulation of transcription, DNA-templated (GO:0006355)|regulation of vesicle-mediated transport (GO:0060627)|response to activity (GO:0014823)|response to caffeine (GO:0031000)|response to camptothecin (GO:1901563)|response to gamma radiation (GO:0010332)|response to hypoxia (GO:0001666)|response to UV (GO:0009411)|rhythmic process (GO:0048511)|signal transduction (GO:0007165)|transcription, DNA-templated (GO:0006351)|Wnt signaling pathway (GO:0016055)	AMP-activated protein kinase complex (GO:0031588)|apical plasma membrane (GO:0016324)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|intracellular (GO:0005622)|nucleus (GO:0005634)	[acetyl-CoA carboxylase] kinase activity (GO:0050405)|[hydroxymethylglutaryl-CoA reductase (NADPH)] kinase activity (GO:0047322)|AMP-activated protein kinase activity (GO:0004679)|ATP binding (GO:0005524)|cAMP-dependent protein kinase activity (GO:0004691)|chromatin binding (GO:0003682)|histone serine kinase activity (GO:0035174)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)|tau-protein kinase activity (GO:0050321)			breast(1)	1					Acetylsalicylic acid(DB00945)|Adenosine monophosphate(DB00131)|Adenosine triphosphate(DB00171)|Phenformin(DB00914)	CCCTGATTTGGCTTCTGTAAT	0.373																																						dbGAP											0													79.0	73.0	75.0					5																	40763109		1840	4097	5937	-	-	-	SO:0001583	missense	0				CCDS3932.2, CCDS3933.2	5p13.1	2012-10-03			ENSG00000132356	ENSG00000132356			9376	protein-coding gene	gene with protein product	"""AMPK, alpha, 1"""	602739				8557660	Standard	XM_006714481		Approved	AMPKa1	uc003jmb.3	Q13131	OTTHUMG00000162269	ENST00000397128.2:c.1451C>A	5.37:g.40763109G>T	ENSP00000380317:p.Ala484Asp	Somatic		WXS	Illumina GAIIx	Phase_IV	A8MTQ6|B2R7E1|O00286|Q5D0E1|Q86VS1|Q9UNQ4	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_Kinase-assoc_KA1,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.A499D	ENST00000397128.2	37	c.1496	CCDS3932.2	5	.	.	.	.	.	.	.	.	.	.	G	9.321	1.058041	0.19987	.	.	ENSG00000132356	ENST00000397128;ENST00000354209	T;T	0.10005	2.92;2.92	5.93	5.93	0.95920	.	0.208574	0.51477	D	0.000091	T	0.09730	0.0239	L	0.36672	1.1	0.80722	D	1	B;B	0.25772	0.134;0.068	B;B	0.23419	0.021;0.046	T	0.23691	-1.0181	10	0.19590	T	0.45	-10.3241	12.9913	0.58620	0.1148:0.0:0.8852:0.0	.	484;499	Q13131;Q13131-2	AAPK1_HUMAN;.	D	484;499	ENSP00000380317:A484D;ENSP00000346148:A499D	ENSP00000346148:A499D	A	-	2	0	AC008810.1	40798866	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	3.232000	0.51302	2.798000	0.96311	0.655000	0.94253	GCC	PRKAA1	-	NULL	ENSG00000132356		0.373	PRKAA1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	PRKAA1	HGNC	protein_coding	OTTHUMT00000253833.2	29	0.00	0	G	NM_006251		40763109	40763109	-1	no_errors	ENST00000354209	ensembl	human	known	69_37n	missense	23	14.81	4	SNP	1.000	T
PRKCG	5582	genome.wustl.edu	37	19	54403868	54403868	+	Silent	SNP	C	C	T			TCGA-A2-A0CO-01A-13D-A228-09	TCGA-A2-A0CO-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	36053173-6839-43ec-8157-75d729085e6b	fea38127-979d-4085-a9e1-6965b99458f3	g.chr19:54403868C>T	ENST00000263431.3	+	14	1722	c.1440C>T	c.(1438-1440)gaC>gaT	p.D480D	PRKCG_ENST00000540413.1_Silent_p.D480D|PRKCG_ENST00000542049.1_Silent_p.D367D	NM_002739.3	NP_002730.1	P05129	KPCG_HUMAN	protein kinase C, gamma	480	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of phospholipase C activity (GO:0007202)|blood coagulation (GO:0007596)|cell death (GO:0008219)|chemosensory behavior (GO:0007635)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|innervation (GO:0060384)|intracellular signal transduction (GO:0035556)|learning or memory (GO:0007611)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of protein catabolic process (GO:0042177)|negative regulation of protein ubiquitination (GO:0031397)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphorylation (GO:0016310)|platelet activation (GO:0030168)|positive regulation of mismatch repair (GO:0032425)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|response to morphine (GO:0043278)|response to pain (GO:0048265)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)	cell-cell junction (GO:0005911)|cytosol (GO:0005829)|dendrite (GO:0030425)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|synaptic membrane (GO:0097060)	ATP binding (GO:0005524)|calcium-dependent protein kinase C activity (GO:0004698)|protein kinase activity (GO:0004672)|protein kinase C activity (GO:0004697)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|zinc ion binding (GO:0008270)			large_intestine(1)|lung(4)|ovary(2)|pancreas(2)|skin(1)	10	all_cancers(19;0.0462)|all_epithelial(19;0.0258)|all_lung(19;0.185)|Ovarian(34;0.19)|Lung NSC(19;0.218)			GBM - Glioblastoma multiforme(134;0.0521)	Tamoxifen(DB00675)	CGTCCAGGGACCTGAAGCTGG	0.537																																						dbGAP											0													145.0	137.0	140.0					19																	54403868		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			M13977	CCDS12867.1	19q13.4	2014-09-17			ENSG00000126583	ENSG00000126583	2.7.11.1		9402	protein-coding gene	gene with protein product	"""PKC-gamma"""	176980		PKCG, SCA14		8432525, 3755548	Standard	NM_002739		Approved	PKCC, MGC57564	uc002qcq.1	P05129	OTTHUMG00000064846	ENST00000263431.3:c.1440C>T	19.37:g.54403868C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B7Z8Q0	Silent	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_Kinase_C-like_PE/DAG-bd,pfam_C2_Ca-dep,pfam_Pkinase_C,superfamily_Kinase-like_dom,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_C2_Ca-dep,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_AGC-kinase_C,pirsf_Protein_kinase_C_a/b/g,pfscan_C2_membr_targeting,pfscan_Prot_Kinase_C-like_PE/DAG-bd,pfscan_Prot_kinase_cat_dom,prints_DAG/PE-bd,prints_C2_dom	p.D480	ENST00000263431.3	37	c.1440	CCDS12867.1	19																																																																																			PRKCG	-	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pirsf_Protein_kinase_C_a/b/g,pfscan_Prot_kinase_cat_dom	ENSG00000126583		0.537	PRKCG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRKCG	HGNC	protein_coding	OTTHUMT00000139233.3	36	0.00	0	C	NM_002739		54403868	54403868	+1	no_errors	ENST00000540413	ensembl	human	known	69_37n	silent	42	12.50	6	SNP	1.000	T
SCN4A	6329	genome.wustl.edu	37	17	62045591	62045591	+	Silent	SNP	C	C	T			TCGA-A2-A0CO-01A-13D-A228-09	TCGA-A2-A0CO-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	36053173-6839-43ec-8157-75d729085e6b	fea38127-979d-4085-a9e1-6965b99458f3	g.chr17:62045591C>T	ENST00000435607.1	-	6	904	c.828G>A	c.(826-828)ctG>ctA	p.L276L	SCN4A_ENST00000578147.1_Silent_p.L276L	NM_000334.4	NP_000325.4	P35499	SCN4A_HUMAN	sodium channel, voltage-gated, type IV, alpha subunit	276					membrane depolarization during action potential (GO:0086010)|muscle contraction (GO:0006936)|neuronal action potential (GO:0019228)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)			breast(4)|central_nervous_system(3)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(23)|lung(40)|ovary(3)|pancreas(1)|prostate(6)|skin(4)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	101					Diclofenac(DB00586)|Flecainide(DB01195)|Propofol(DB00818)|Valproic Acid(DB00313)|Zonisamide(DB00909)	ACTTCTGCCTCAGGTTTCCCA	0.547																																						dbGAP											0													130.0	135.0	133.0					17																	62045591		2181	4288	6469	-	-	-	SO:0001819	synonymous_variant	0			U24693		17q23.3	2012-02-26	2007-01-23					"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10591	protein-coding gene	gene with protein product		603967		HYKPP		1654742, 1659948, 16382098	Standard	XM_005257566		Approved	Nav1.4, HYPP, SkM1	uc002jds.1	P35499		ENST00000435607.1:c.828G>A	17.37:g.62045591C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q15478|Q16447|Q7Z6B1	Silent	SNP	pfam_Ion_trans_dom,pfam_Na_trans_assoc,pfam_PKD1_2_channel,prints_Na_channel_a4su,prints_Na_channel_asu,prints_PKD_2,pfscan_IQ_motif_EF-hand-BS	p.L276	ENST00000435607.1	37	c.828	CCDS45761.1	17																																																																																			SCN4A	-	pfam_Ion_trans_dom	ENSG00000007314		0.547	SCN4A-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SCN4A	HGNC	protein_coding		42	0.00	0	C	NM_000334		62045591	62045591	-1	no_errors	ENST00000435607	ensembl	human	known	69_37n	silent	49	28.99	20	SNP	1.000	T
SLC29A1	2030	genome.wustl.edu	37	6	44197966	44197966	+	Intron	DEL	G	G	-			TCGA-A2-A0CO-01A-13D-A228-09	TCGA-A2-A0CO-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	36053173-6839-43ec-8157-75d729085e6b	fea38127-979d-4085-a9e1-6965b99458f3	g.chr6:44197966delG	ENST00000393841.1	+	7	945				SLC29A1_ENST00000313248.7_Intron|SLC29A1_ENST00000393844.1_Intron|SLC29A1_ENST00000371740.5_Intron|SLC29A1_ENST00000371713.1_Intron|SLC29A1_ENST00000371731.1_Intron|SLC29A1_ENST00000371724.1_Intron|SLC29A1_ENST00000472176.1_3'UTR|SLC29A1_ENST00000427851.2_Intron|SLC29A1_ENST00000371708.1_Intron|SLC29A1_ENST00000371755.3_Intron	NM_001078177.1	NP_001071645.1	Q99808	S29A1_HUMAN	solute carrier family 29 (equilibrative nucleoside transporter), member 1						cellular response to glucose stimulus (GO:0071333)|cellular response to hypoxia (GO:0071456)|lactation (GO:0007595)|nucleobase-containing compound metabolic process (GO:0006139)|nucleoside transmembrane transport (GO:1901642)|nucleoside transport (GO:0015858)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|sleep (GO:0030431)|transmembrane transport (GO:0055085)|uridine transport (GO:0015862)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	nucleoside transmembrane transporter activity (GO:0005337)			endometrium(3)|kidney(2)|large_intestine(4)|lung(5)|ovary(1)|skin(2)	17	all_cancers(18;3.19e-06)|Lung NSC(15;0.00108)|all_lung(25;0.00278)|Hepatocellular(11;0.00908)|Ovarian(13;0.0273)		Colorectal(64;0.00337)|COAD - Colon adenocarcinoma(64;0.00536)		Cytarabine(DB00987)|Didanosine(DB00900)|Fludarabine(DB01073)|Fluorouracil(DB00544)|Gemcitabine(DB00441)|Mercaptopurine(DB01033)|Pemetrexed(DB00642)|Ribavirin(DB00811)|Zalcitabine(DB00943)	GCAGAGAGAAGGGCAGCTCAG	0.622																																						dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			U81375	CCDS4908.1	6p21.1	2013-07-17	2013-07-17		ENSG00000112759	ENSG00000112759		"""Solute carriers"""	11003	protein-coding gene	gene with protein product		602193	"""solute carrier family 29 (nucleoside transporters), member 1"""	ENT1		8986748, 9344680	Standard	NM_004955		Approved		uc003owy.2	Q99808	OTTHUMG00000014759	ENST00000393841.1:c.455-118G>-	6.37:g.44197966delG		Somatic		WXS	Illumina GAIIx	Phase_IV	B3KQV7|B3KQY5|Q5T9W9|Q9UJY2	RNA	DEL	-	NULL	ENST00000393841.1	37	NULL	CCDS4908.1	6																																																																																			SLC29A1	-	-	ENSG00000112759		0.622	SLC29A1-202	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC29A1	HGNC	protein_coding	OTTHUMT00000040721.1	40	0.00	0	G			44197966	44197966	+1	no_errors	ENST00000472176	ensembl	human	known	69_37n	rna	46	11.54	6	DEL	0.001	-
SLC39A13	91252	genome.wustl.edu	37	11	47434951	47434952	+	Splice_Site	INS	-	-	C	rs147227015|rs35153072	byFrequency	TCGA-A2-A0CO-01A-13D-A228-09	TCGA-A2-A0CO-10A-01D-A22A-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	36053173-6839-43ec-8157-75d729085e6b	fea38127-979d-4085-a9e1-6965b99458f3	g.chr11:47434951_47434952insC	ENST00000362021.4	+	5	580_581	c.538_539insC	c.(538-540)gcc>gCcc	p.A180fs	SLC39A13_ENST00000354884.4_Splice_Site_p.A180fs|SLC39A13_ENST00000533076.1_Splice_Site_p.A180fs|SLC39A13_ENST00000529740.1_3'UTR|SLC39A13_ENST00000524928.1_Splice_Site_p.A180fs	NM_001128225.2	NP_001121697	Q96H72	S39AD_HUMAN	solute carrier family 39 (zinc transporter), member 13	180					cellular zinc ion homeostasis (GO:0006882)|connective tissue development (GO:0061448)|zinc ion transmembrane transport (GO:0071577)	Golgi apparatus (GO:0005794)|integral component of Golgi membrane (GO:0030173)|integral component of membrane (GO:0016021)|perinuclear region of cytoplasm (GO:0048471)	protein homodimerization activity (GO:0042803)|zinc ion transmembrane transporter activity (GO:0005385)			breast(1)|kidney(1)|lung(1)|prostate(1)	4				Lung(87;0.0936)		CTGGCCCTAGGCCCCCAACAAA	0.668																																						dbGAP											0																																										-	-	-	SO:0001630	splice_region_variant	0				CCDS7934.1, CCDS44592.1	11p11.2	2013-05-22			ENSG00000165915	ENSG00000165915		"""Solute carriers"""	20859	protein-coding gene	gene with protein product		608735	"""solute carrier family 39 (metal ion transporter), member 13"""			12659941	Standard	NM_001128225		Approved	FLJ25785	uc009ylq.3	Q96H72	OTTHUMG00000166890	ENST00000362021.4:c.538-1->C	11.37:g.47434956_47434956dupC		Somatic		WXS	Illumina GAIIx	Phase_IV	D3DQR6|D3DQR7|E9PLY1|E9PQV3|Q659D9|Q8N7C9|Q8WV10	Frame_Shift_Ins	INS	pfam_ZIP	p.N182fs	ENST00000362021.4	37	c.538_539	CCDS44592.1	11																																																																																			SLC39A13	-	pfam_ZIP	ENSG00000165915		0.668	SLC39A13-012	KNOWN	basic|CCDS	protein_coding	SLC39A13	HGNC	protein_coding	OTTHUMT00000395652.1	55	0.00	0	-	NM_152264	Frame_Shift_Ins	47434951	47434952	+1	no_errors	ENST00000362021	ensembl	human	known	69_37n	frame_shift_ins	50	15.25	9	INS	1.000:1.000	C
SPP1	6696	genome.wustl.edu	37	4	88902647	88902647	+	Silent	SNP	C	C	T	rs45473998	byFrequency	TCGA-A2-A0CO-01A-13D-A228-09	TCGA-A2-A0CO-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	36053173-6839-43ec-8157-75d729085e6b	fea38127-979d-4085-a9e1-6965b99458f3	g.chr4:88902647C>T	ENST00000395080.3	+	6	364	c.237C>T	c.(235-237)aaC>aaT	p.N79N	SPP1_ENST00000509659.1_3'UTR|SPP1_ENST00000360804.4_Silent_p.N52N|SPP1_ENST00000237623.7_Silent_p.N65N	NM_001040058.1|NM_001251830.1	NP_001035147.1|NP_001238759.1	P10451	OSTP_HUMAN	secreted phosphoprotein 1	79					biomineral tissue development (GO:0031214)|cell adhesion (GO:0007155)|decidualization (GO:0046697)|embryo implantation (GO:0007566)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|inflammatory response (GO:0006954)|negative regulation of collateral sprouting of intact axon in response to injury (GO:0048685)|neutrophil chemotaxis (GO:0030593)|osteoblast differentiation (GO:0001649)|positive regulation of bone resorption (GO:0045780)|positive regulation of cell-substrate adhesion (GO:0010811)|response to steroid hormone (GO:0048545)|response to vitamin D (GO:0033280)	apical part of cell (GO:0045177)|cell projection (GO:0042995)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|perinuclear region of cytoplasm (GO:0048471)	extracellular matrix binding (GO:0050840)			NS(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(4)|ovary(1)|prostate(3)|skin(1)	13		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;9.87e-05)		GTAAGTCCAACGAAAGCCATG	0.403																																						dbGAP											0													162.0	152.0	155.0					4																	88902647		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS3626.1, CCDS34027.1, CCDS43250.1	4q22.1	2014-01-30	2008-07-31		ENSG00000118785	ENSG00000118785		"""Endogenous ligands"""	11255	protein-coding gene	gene with protein product	"""early T-lymphocyte activation 1"""	166490	"""osteopontin"", ""bone sialoprotein I"""	BNSP, OPN		1575754	Standard	NM_001251829		Approved	BSPI, ETA-1	uc003hra.3	P10451	OTTHUMG00000130599	ENST00000395080.3:c.237C>T	4.37:g.88902647C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B2RDA1|Q15681|Q15682|Q15683|Q4W597|Q567T5|Q8NBK2|Q96IZ1	Silent	SNP	pfam_Osteopontin,smart_Osteopontin,prints_Osteopontin	p.N79	ENST00000395080.3	37	c.237	CCDS43250.1	4																																																																																			SPP1	-	pfam_Osteopontin,smart_Osteopontin,prints_Osteopontin	ENSG00000118785		0.403	SPP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPP1	HGNC	protein_coding	OTTHUMT00000253048.3	29	0.00	0	C			88902647	88902647	+1	no_errors	ENST00000395080	ensembl	human	known	69_37n	silent	44	13.73	7	SNP	0.082	T
TMEM63B	55362	genome.wustl.edu	37	6	44121445	44121445	+	Missense_Mutation	SNP	G	G	A			TCGA-A2-A0CO-01A-13D-A228-09	TCGA-A2-A0CO-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	36053173-6839-43ec-8157-75d729085e6b	fea38127-979d-4085-a9e1-6965b99458f3	g.chr6:44121445G>A	ENST00000259746.9	+	21	2158	c.1975G>A	c.(1975-1977)Gac>Aac	p.D659N	TMEM63B_ENST00000323267.6_Missense_Mutation_p.D659N			Q5T3F8	CSCL2_HUMAN	transmembrane protein 63B	659					ion transport (GO:0006811)	integral component of membrane (GO:0016021)	nucleotide binding (GO:0000166)			breast(3)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(9)|lung(8)|ovary(1)|pancreas(2)|prostate(2)|stomach(4)	35	all_cancers(18;1.66e-06)|Lung NSC(15;0.00108)|all_lung(25;0.00278)|Hepatocellular(11;0.00309)|Ovarian(13;0.0273)		Colorectal(64;0.00337)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.0215)			GCACCTGGTAGACAGGTACAA	0.587																																						dbGAP											0													84.0	65.0	71.0					6																	44121445		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC022095	CCDS34461.1	6p21.1	2008-02-05	2005-07-25	2005-07-25	ENSG00000137216	ENSG00000137216			17735	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 110"""	C6orf110			Standard	XM_005249211		Approved	DKFZp434P0531, dJ421H19.2	uc003owr.3	Q5T3F8	OTTHUMG00000014757	ENST00000259746.9:c.1975G>A	6.37:g.44121445G>A	ENSP00000259746:p.Asp659Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	B9EGU3|Q5T3F9|Q6AHX4|Q6P5A0|Q8N219|Q8NDE1|Q9NSG5	Missense_Mutation	SNP	pfam_DUF221	p.D659N	ENST00000259746.9	37	c.1975	CCDS34461.1	6	.	.	.	.	.	.	.	.	.	.	G	34	5.294887	0.95546	.	.	ENSG00000137216	ENST00000259746;ENST00000323267	T;T	0.30981	1.51;1.51	4.62	4.62	0.57501	Domain of unknown function DUF221 (1);	0.000000	0.85682	D	0.000000	T	0.54679	0.1873	M	0.89414	3.03	0.58432	D	0.999999	D	0.69078	0.997	D	0.68621	0.959	T	0.65026	-0.6268	10	0.72032	D	0.01	.	16.6433	0.85138	0.0:0.0:1.0:0.0	.	659	Q5T3F8	TM63B_HUMAN	N	659	ENSP00000259746:D659N;ENSP00000327154:D659N	ENSP00000259746:D659N	D	+	1	0	TMEM63B	44229423	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.263000	0.95617	2.409000	0.81822	0.655000	0.94253	GAC	TMEM63B	-	pfam_DUF221	ENSG00000137216		0.587	TMEM63B-005	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM63B	HGNC	protein_coding	OTTHUMT00000040712.2	44	0.00	0	G	XM_166410		44121445	44121445	+1	no_errors	ENST00000259746	ensembl	human	known	69_37n	missense	43	23.21	13	SNP	1.000	A
TNS4	84951	genome.wustl.edu	37	17	38638409	38638409	+	Silent	SNP	C	C	A			TCGA-A2-A0CO-01A-13D-A228-09	TCGA-A2-A0CO-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	36053173-6839-43ec-8157-75d729085e6b	fea38127-979d-4085-a9e1-6965b99458f3	g.chr17:38638409C>A	ENST00000254051.6	-	8	1802	c.1644G>T	c.(1642-1644)ctG>ctT	p.L548L		NM_032865.5	NP_116254.4	Q8IZW8	TENS4_HUMAN	tensin 4	548	Phosphatase tensin-type.|SH2. {ECO:0000255|PROSITE- ProRule:PRU00191}.				apoptotic process (GO:0006915)|protein localization (GO:0008104)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|focal adhesion (GO:0005925)				NS(2)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(3)|ovary(2)|prostate(2)|skin(10)|upper_aerodigestive_tract(1)	30		Breast(137;0.000496)	STAD - Stomach adenocarcinoma(5;5.91e-05)			GTTTGCAGGGCAGGGCCAGGG	0.582																																						dbGAP											0													54.0	50.0	51.0					17																	38638409		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF417488	CCDS11368.1	17q21.2	2013-02-14			ENSG00000131746	ENSG00000131746		"""SH2 domain containing"""	24352	protein-coding gene	gene with protein product	"""C terminal tensin like"""	608385				12154022, 12711115	Standard	NM_032865		Approved	CTEN	uc010cxb.3	Q8IZW8	OTTHUMG00000133330	ENST00000254051.6:c.1644G>T	17.37:g.38638409C>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A6NMJ7|Q71RB7|Q8WV64|Q96JV4	Silent	SNP	pfam_PTB,pfam_SH2,smart_SH2,smart_PTyr_interaction_dom,pfscan_SH2	p.L548	ENST00000254051.6	37	c.1644	CCDS11368.1	17																																																																																			TNS4	-	pfscan_SH2	ENSG00000131746		0.582	TNS4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TNS4	HGNC	protein_coding	OTTHUMT00000257154.3	20	0.00	0	C	NM_032865		38638409	38638409	-1	no_errors	ENST00000254051	ensembl	human	known	69_37n	silent	18	18.18	4	SNP	1.000	A
XIST	7503	genome.wustl.edu	37	X	73070850	73070850	+	lincRNA	SNP	G	G	T			TCGA-A2-A0CO-01A-13D-A228-09	TCGA-A2-A0CO-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	36053173-6839-43ec-8157-75d729085e6b	fea38127-979d-4085-a9e1-6965b99458f3	g.chrX:73070850G>T	ENST00000429829.1	-	0	1738					NR_001564.2				X inactive specific transcript (non-protein coding)																		AGACAGCTGCGAAGTGCCATG	0.498																																						dbGAP											0													75.0	69.0	71.0					X																	73070850		876	1991	2867	-	-	-			0			M97168		Xq13.2	2013-12-18	2013-02-07		ENSG00000229807	ENSG00000229807		"""Long non-coding RNAs"", ""-"""	12810	non-coding RNA	RNA, long non-coding	"""long intergenic non-protein coding RNA 1"""	314670	"""X (inactive)-specific transcript"", ""X (inactive)-specific transcript (non-protein coding)"""	DXS399E		1985261, 2034279	Standard	NR_001564		Approved	NCRNA00001, DXS1089, swd66, LINC00001	uc004ebm.2		OTTHUMG00000021839		X.37:g.73070850G>T		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000429829.1	37	NULL		X																																																																																			XIST	-	-	ENSG00000229807		0.498	XIST-001	KNOWN	basic	lincRNA	XIST	HGNC	lincRNA	OTTHUMT00000057239.1	49	0.00	0	G	NR_001564		73070850	73070850	-1	no_errors	ENST00000429829	ensembl	human	known	69_37n	rna	28	33.33	14	SNP	0.000	T
TSPAN6	7105	genome.wustl.edu	37	X	99891533	99891533	+	Intron	SNP	C	C	T			TCGA-A2-A0CO-01A-13D-A228-09	TCGA-A2-A0CO-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	36053173-6839-43ec-8157-75d729085e6b	fea38127-979d-4085-a9e1-6965b99458f3	g.chrX:99891533C>T	ENST00000373020.4	-	1	199				TSPAN6_ENST00000496771.1_5'UTR	NM_001278740.1|NM_001278741.1|NM_003270.2	NP_001265669.1|NP_001265670.1|NP_003261.1	O43657	TSN6_HUMAN	tetraspanin 6						negative regulation of NIK/NF-kappaB signaling (GO:1901223)|negative regulation of viral-induced cytoplasmic pattern recognition receptor signaling pathway (GO:0039532)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|signal transduction (GO:0007165)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	signal transducer activity (GO:0004871)			endometrium(2)|kidney(3)|large_intestine(6)|ovary(1)	12						GAGCTCCCGCCGCTCAGGGTC	0.642																																						dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			AF043906	CCDS14470.1, CCDS76001.1	Xq22	2013-02-14	2005-03-21	2005-03-21	ENSG00000000003	ENSG00000000003		"""Tetraspanins"""	11858	protein-coding gene	gene with protein product		300191	"""transmembrane 4 superfamily member 6"""	TM4SF6		9782095	Standard	NM_003270		Approved	T245, TSPAN-6	uc004ega.1	O43657	OTTHUMG00000022002	ENST00000373020.4:c.87+71G>A	X.37:g.99891533C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q54A42|Q6IAN9	RNA	SNP	-	NULL	ENST00000373020.4	37	NULL	CCDS14470.1	X																																																																																			TSPAN6	-	-	ENSG00000000003		0.642	TSPAN6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TSPAN6	HGNC	protein_coding	OTTHUMT00000057483.1	63	0.00	0	C			99891533	99891533	-1	no_errors	ENST00000496771	ensembl	human	known	69_37n	rna	53	10.17	6	SNP	0.000	T
ZNF74	7625	genome.wustl.edu	37	22	20760662	20760662	+	Missense_Mutation	SNP	G	G	A			TCGA-A2-A0CO-01A-13D-A228-09	TCGA-A2-A0CO-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	36053173-6839-43ec-8157-75d729085e6b	fea38127-979d-4085-a9e1-6965b99458f3	g.chr22:20760662G>A	ENST00000400451.2	+	5	1853	c.1339G>A	c.(1339-1341)Gcc>Acc	p.A447T	ZNF74_ENST00000405993.1_Missense_Mutation_p.A415T|ZNF74_ENST00000403682.3_3'UTR|ZNF74_ENST00000356671.5_Missense_Mutation_p.A447T|ZNF74_ENST00000357502.5_3'UTR	NM_003426.3	NP_003417.2	Q16587	ZNF74_HUMAN	zinc finger protein 74	447					multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	actin cytoskeleton (GO:0015629)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|RNA binding (GO:0003723)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|cervix(1)|endometrium(3)|large_intestine(4)|lung(7)|ovary(1)|skin(1)|urinary_tract(1)	19	Melanoma(16;0.000465)|Ovarian(15;0.0025)|Colorectal(54;0.0221)|all_neural(72;0.219)	Lung SC(17;0.0262)|all_lung(157;0.248)	LUSC - Lung squamous cell carcinoma(15;0.00102)|Lung(15;0.0173)			CTTCAAGTGCGCCGACTGCGG	0.652																																						dbGAP											0													34.0	40.0	38.0					22																	20760662		2197	4300	6497	-	-	-	SO:0001583	missense	0			X71623	CCDS42982.1, CCDS58794.1	22q11.2	2013-01-08	2006-05-12		ENSG00000185252	ENSG00000185252		"""Zinc fingers, C2H2-type"", ""-"""	13144	protein-coding gene	gene with protein product		194548	"""zinc finger protein 74 (Cos52)"""			1639391, 10591208	Standard	NM_003426		Approved	Cos52, Zfp520, ZNF520	uc010gsm.4	Q16587	OTTHUMG00000150687	ENST00000400451.2:c.1339G>A	22.37:g.20760662G>A	ENSP00000383301:p.Ala447Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	B5MCE3|B7Z5Y2|Q6IBV2|Q6PJP1|Q9UC04|Q9UF05|Q9UF06|Q9UF07	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.A447T	ENST00000400451.2	37	c.1339	CCDS42982.1	22	.	.	.	.	.	.	.	.	.	.	G	4.463	0.085806	0.08583	.	.	ENSG00000185252	ENST00000400451;ENST00000356671;ENST00000405993	T;T;T	0.17054	2.3;2.3;2.3	3.7	-7.39	0.01402	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	1.243300	0.05987	N	0.645358	T	0.04770	0.0129	N	0.01624	-0.795	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.41070	-0.9529	10	0.24483	T	0.36	-2.9255	6.7198	0.23325	0.6228:0.0:0.1482:0.229	.	447	Q16587	ZNF74_HUMAN	T	447;447;415	ENSP00000383301:A447T;ENSP00000349098:A447T;ENSP00000385855:A415T	ENSP00000349098:A447T	A	+	1	0	ZNF74	19090662	0.000000	0.05858	0.000000	0.03702	0.020000	0.10135	-5.305000	0.00133	-1.730000	0.01362	-0.152000	0.13540	GCC	ZNF74	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000185252		0.652	ZNF74-005	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF74	HGNC	protein_coding	OTTHUMT00000319648.2	40	0.00	0	G	NM_003426		20760662	20760662	+1	no_errors	ENST00000356671	ensembl	human	known	69_37n	missense	41	28.07	16	SNP	0.002	A
