#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
ABCA3	21	genome.wustl.edu	37	16	2349496	2349496	+	Missense_Mutation	SNP	C	C	G			TCGA-A2-A0CR-01A-11D-A228-09	TCGA-A2-A0CR-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f573c3c3-7b61-4955-8772-215b7cb9a763	3bdb54b4-1e26-4274-a1bd-800416ffbd34	g.chr16:2349496C>G	ENST00000301732.5	-	14	2349	c.1649G>C	c.(1648-1650)aGa>aCa	p.R550T	ABCA3_ENST00000382381.3_Missense_Mutation_p.R492T	NM_001089.2	NP_001080.2	Q99758	ABCA3_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 3	550	ABC transporter 1. {ECO:0000255|PROSITE- ProRule:PRU00434}.				response to drug (GO:0042493)|transmembrane transport (GO:0055085)|transport (GO:0006810)	alveolar lamellar body (GO:0097208)|alveolar lamellar body membrane (GO:0097233)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|transporter activity (GO:0005215)			breast(7)|central_nervous_system(4)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(11)|liver(1)|lung(20)|ovary(7)|prostate(5)|skin(6)|upper_aerodigestive_tract(1)	70		Ovarian(90;0.17)			Imatinib(DB00619)	GTTCAGGTCTCTGACGGCCGC	0.647																																						dbGAP											0													175.0	124.0	141.0					16																	2349496		2198	4300	6498	-	-	-	SO:0001583	missense	0			U78735	CCDS10466.1	16p13.3	2012-03-14			ENSG00000167972	ENSG00000167972		"""ATP binding cassette transporters / subfamily A"""	33	protein-coding gene	gene with protein product		601615		ABC3		8706931	Standard	NM_001089		Approved	ABC-C, EST111653, LBM180	uc002cpy.1	Q99758	OTTHUMG00000128845	ENST00000301732.5:c.1649G>C	16.37:g.2349496C>G	ENSP00000301732:p.Arg550Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RU09|Q54A95|Q6P5P9|Q92473	Missense_Mutation	SNP	pfam_ABC_transporter-like,smart_AAA+_ATPase,pfscan_ABC_transporter-like	p.R550T	ENST00000301732.5	37	c.1649	CCDS10466.1	16	.	.	.	.	.	.	.	.	.	.	C	8.032	0.762025	0.15914	.	.	ENSG00000167972	ENST00000301732;ENST00000382381	D	0.93763	-3.28	5.78	-0.592	0.11671	ABC transporter-like (1);	0.387540	0.28488	N	0.015180	D	0.88614	0.6484	L	0.56280	1.765	0.09310	N	1	B;B;B	0.24426	0.042;0.103;0.018	B;B;B	0.23574	0.039;0.047;0.039	T	0.74469	-0.3655	10	0.19147	T	0.46	.	10.502	0.44810	0.0:0.5173:0.0:0.4827	.	550;554;550	A7MBM9;Q4LE27;Q99758	.;.;ABCA3_HUMAN	T	550;554	ENSP00000301732:R550T	ENSP00000301732:R550T	R	-	2	0	ABCA3	2289497	0.003000	0.15002	0.044000	0.18714	0.004000	0.04260	0.205000	0.17356	-0.312000	0.08741	-0.781000	0.03364	AGA	ABCA3	-	pfscan_ABC_transporter-like	ENSG00000167972		0.647	ABCA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABCA3	HGNC	protein_coding	OTTHUMT00000250784.2	33	0.00	0	C	NM_001089		2349496	2349496	-1	no_errors	ENST00000301732	ensembl	human	known	69_37n	missense	54	14.29	9	SNP	0.022	G
ACPT	93650	genome.wustl.edu	37	19	51297066	51297066	+	Silent	SNP	G	G	C			TCGA-A2-A0CR-01A-11D-A228-09	TCGA-A2-A0CR-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f573c3c3-7b61-4955-8772-215b7cb9a763	3bdb54b4-1e26-4274-a1bd-800416ffbd34	g.chr19:51297066G>C	ENST00000270593.1	+	7	771	c.771G>C	c.(769-771)ctG>ctC	p.L257L	ACPT_ENST00000270594.3_Silent_p.L164L|CTD-2568A17.8_ENST00000594114.1_RNA	NM_033068.2	NP_149059.1	Q9BZG2	PPAT_HUMAN	acid phosphatase, testicular	257						integral component of membrane (GO:0016021)	acid phosphatase activity (GO:0003993)			central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|lung(6)|skin(3)	11		all_neural(266;0.057)		OV - Ovarian serous cystadenocarcinoma(262;0.00641)|GBM - Glioblastoma multiforme(134;0.028)		AGGCCCAGCTGACAGGGGGTG	0.617																																						dbGAP											0													57.0	56.0	56.0					19																	51297066		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF321918	CCDS12802.1	19q13.33	2012-10-02			ENSG00000142513	ENSG00000142513			14376	protein-coding gene	gene with protein product		606362				11414767	Standard	NM_033068		Approved		uc002pta.1	Q9BZG2		ENST00000270593.1:c.771G>C	19.37:g.51297066G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	C0H3P7|Q9BZG3|Q9BZG4	Silent	SNP	pfam_His_Pase_superF_clade-2	p.L257	ENST00000270593.1	37	c.771	CCDS12802.1	19																																																																																			ACPT	-	pfam_His_Pase_superF_clade-2	ENSG00000142513		0.617	ACPT-001	NOVEL	basic|appris_principal|CCDS	protein_coding	ACPT	HGNC	protein_coding	OTTHUMT00000464434.1	32	0.00	0	G	NM_033068		51297066	51297066	+1	no_errors	ENST00000270593	ensembl	human	known	69_37n	silent	56	16.42	11	SNP	0.997	C
ADAM7	8756	genome.wustl.edu	37	8	24348333	24348333	+	Missense_Mutation	SNP	G	G	T			TCGA-A2-A0CR-01A-11D-A228-09	TCGA-A2-A0CR-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f573c3c3-7b61-4955-8772-215b7cb9a763	3bdb54b4-1e26-4274-a1bd-800416ffbd34	g.chr8:24348333G>T	ENST00000175238.6	+	13	1371	c.1288G>T	c.(1288-1290)Gat>Tat	p.D430Y	RP11-624C23.1_ENST00000519689.1_RNA|ADAM7_ENST00000520720.1_Missense_Mutation_p.D202Y|ADAM7_ENST00000380789.1_Missense_Mutation_p.D430Y|RP11-624C23.1_ENST00000523578.1_RNA|RP11-561E1.1_ENST00000519364.1_RNA	NM_003817.3	NP_003808.2	Q9H2U9	ADAM7_HUMAN	ADAM metallopeptidase domain 7	430	Disintegrin. {ECO:0000255|PROSITE- ProRule:PRU00068}.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			NS(1)|endometrium(5)|kidney(1)|large_intestine(17)|lung(24)|ovary(1)|skin(15)	64		Prostate(55;0.0181)		Colorectal(74;0.0199)|COAD - Colon adenocarcinoma(73;0.0754)|BRCA - Breast invasive adenocarcinoma(99;0.182)		TCCTTGCTGTGATGCACACAC	0.408																																						dbGAP											0													230.0	211.0	217.0					8																	24348333		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF090327	CCDS6045.1	8p21.2	2005-08-18	2005-08-18		ENSG00000069206	ENSG00000069206		"""ADAM metallopeptidase domain containing"""	214	protein-coding gene	gene with protein product		607310	"""a disintegrin and metalloproteinase domain 7"""				Standard	NM_003817		Approved	GP-83, EAPI	uc003xeb.3	Q9H2U9	OTTHUMG00000097859	ENST00000175238.6:c.1288G>T	8.37:g.24348333G>T	ENSP00000175238:p.Asp430Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K8X7|O75959|Q6PEJ6	Missense_Mutation	SNP	pfam_Peptidase_M12B,pfam_Peptidase_M12B_N,pfam_ADAM_Cys-rich,pfam_Blood-coag_inhib_Disintegrin,superfamily_Blood-coag_inhib_Disintegrin,smart_Blood-coag_inhib_Disintegrin,smart_ADAM_Cys-rich,pfscan_Blood-coag_inhib_Disintegrin,pfscan_Peptidase_M12B,prints_Blood-coag_inhib_Disintegrin	p.D430Y	ENST00000175238.6	37	c.1288	CCDS6045.1	8	.	.	.	.	.	.	.	.	.	.	G	20.7	4.032420	0.75504	.	.	ENSG00000069206	ENST00000175238;ENST00000380789;ENST00000520720;ENST00000335595	T;T;T	0.13089	2.62;2.62;2.62	5.65	5.65	0.86999	Blood coagulation inhibitor, Disintegrin (5);	0.202682	0.34932	N	0.003578	T	0.40522	0.1120	M	0.78344	2.41	0.51767	D	0.999934	D;D	0.89917	0.999;1.0	D;D	0.72338	0.964;0.977	T	0.14282	-1.0478	10	0.72032	D	0.01	.	17.5856	0.87980	0.0:0.0:1.0:0.0	.	202;430	E5RK87;Q9H2U9	.;ADAM7_HUMAN	Y	430;430;202;245	ENSP00000175238:D430Y;ENSP00000370166:D430Y;ENSP00000430400:D202Y	ENSP00000175238:D430Y	D	+	1	0	ADAM7	24404223	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	4.654000	0.61469	2.824000	0.97209	0.655000	0.94253	GAT	ADAM7	-	pfam_Blood-coag_inhib_Disintegrin,superfamily_Blood-coag_inhib_Disintegrin,smart_Blood-coag_inhib_Disintegrin,pfscan_Blood-coag_inhib_Disintegrin	ENSG00000069206		0.408	ADAM7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADAM7	HGNC	protein_coding	OTTHUMT00000215150.1	26	0.00	0	G	NM_003817		24348333	24348333	+1	no_errors	ENST00000175238	ensembl	human	known	69_37n	missense	39	18.75	9	SNP	1.000	T
ANKRD18CP	100287922	genome.wustl.edu	37	9	99942717	99942717	+	IGR	SNP	G	G	A			TCGA-A2-A0CR-01A-11D-A228-09	TCGA-A2-A0CR-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f573c3c3-7b61-4955-8772-215b7cb9a763	3bdb54b4-1e26-4274-a1bd-800416ffbd34	g.chr9:99942717G>A								RP11-520B13.4 (98490 upstream) : RNU6-798P (12487 downstream)																							AAGTTGTTTAGTAAGCAACTC	0.368																																						dbGAP											0																																										-	-	-	SO:0001628	intergenic_variant	0																															9.37:g.99942717G>A		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL		37	NULL		9																																																																																			ANKRD18CP	-	-	ENSG00000159712	0	0.368					ANKRD18CP	HGNC			47	0.00	0	G			99942717	99942717	-1	no_errors	ENST00000354752	ensembl	human	known	69_37n	rna	33	13.16	5	SNP	0.498	A
ANKRD35	148741	genome.wustl.edu	37	1	145557076	145557076	+	Missense_Mutation	SNP	C	C	G			TCGA-A2-A0CR-01A-11D-A228-09	TCGA-A2-A0CR-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f573c3c3-7b61-4955-8772-215b7cb9a763	3bdb54b4-1e26-4274-a1bd-800416ffbd34	g.chr1:145557076C>G	ENST00000355594.4	+	4	375	c.288C>G	c.(286-288)atC>atG	p.I96M	ANKRD35_ENST00000544626.1_Missense_Mutation_p.I96M	NM_144698.3	NP_653299.4	Q8N283	ANR35_HUMAN	ankyrin repeat domain 35	96										NS(1)|biliary_tract(1)|central_nervous_system(1)|endometrium(7)|kidney(2)|large_intestine(9)|lung(16)|ovary(4)|prostate(3)|skin(2)|urinary_tract(1)	47	all_hematologic(18;0.0187)|Acute lymphoblastic leukemia(18;0.0786)					TGGCCACCATCTCCTGCCAGC	0.527																																					Melanoma(9;127 754 22988 51047)	dbGAP											0													147.0	127.0	134.0					1																	145557076		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK091120	CCDS72867.1, CCDS72868.1	1q21.1	2013-01-10			ENSG00000198483	ENSG00000198483		"""Ankyrin repeat domain containing"""	26323	protein-coding gene	gene with protein product							Standard	NM_144698		Approved	FLJ25124	uc001eob.1	Q8N283	OTTHUMG00000013743	ENST00000355594.4:c.288C>G	1.37:g.145557076C>G	ENSP00000347802:p.Ile96Met	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NEU0|B4DL62|Q3MJ10|Q96LS3	Missense_Mutation	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,prints_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	p.I96M	ENST00000355594.4	37	c.288	CCDS919.1	1	.	.	.	.	.	.	.	.	.	.	C	13.20	2.165003	0.38217	.	.	ENSG00000198483	ENST00000355594;ENST00000544626	T;T	0.64085	-0.08;-0.08	5.31	1.07	0.20283	Ankyrin repeat-containing domain (4);	0.000000	0.46758	D	0.000261	T	0.46776	0.1410	L	0.31294	0.92	0.24874	N	0.992265	D	0.76494	0.999	D	0.87578	0.998	T	0.36187	-0.9758	10	0.33141	T	0.24	-10.2782	6.4365	0.21827	0.0:0.5688:0.0:0.4312	.	96	Q8N283	ANR35_HUMAN	M	96	ENSP00000347802:I96M;ENSP00000442671:I96M	ENSP00000347802:I96M	I	+	3	3	ANKRD35	144268433	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	0.370000	0.20433	0.371000	0.24564	-0.142000	0.14014	ATC	ANKRD35	-	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	ENSG00000198483		0.527	ANKRD35-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ANKRD35	HGNC	protein_coding	OTTHUMT00000038515.1	24	0.00	0	C	NM_144698		145557076	145557076	+1	no_errors	ENST00000355594	ensembl	human	known	69_37n	missense	23	20.69	6	SNP	1.000	G
APAF1	317	genome.wustl.edu	37	12	99059461	99059461	+	Missense_Mutation	SNP	G	G	T			TCGA-A2-A0CR-01A-11D-A228-09	TCGA-A2-A0CR-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f573c3c3-7b61-4955-8772-215b7cb9a763	3bdb54b4-1e26-4274-a1bd-800416ffbd34	g.chr12:99059461G>T	ENST00000551964.1	+	8	1822	c.1086G>T	c.(1084-1086)gaG>gaT	p.E362D	APAF1_ENST00000550527.1_Missense_Mutation_p.E351D|APAF1_ENST00000549007.1_Missense_Mutation_p.E362D|APAF1_ENST00000547045.1_Missense_Mutation_p.E362D|APAF1_ENST00000552268.1_Intron|APAF1_ENST00000359972.2_Missense_Mutation_p.E351D|APAF1_ENST00000333991.1_Intron|APAF1_ENST00000339433.3_Missense_Mutation_p.E362D|APAF1_ENST00000357310.1_Missense_Mutation_p.E362D	NM_181861.1	NP_863651.1	O14727	APAF_HUMAN	apoptotic peptidase activating factor 1	362	NB-ARC.				activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|activation of cysteine-type endopeptidase activity involved in apoptotic process by cytochrome c (GO:0008635)|apoptotic process (GO:0006915)|forebrain development (GO:0030900)|intrinsic apoptotic signaling pathway (GO:0097193)|nervous system development (GO:0007399)|neural tube closure (GO:0001843)|neuron apoptotic process (GO:0051402)|positive regulation of apoptotic process (GO:0043065)|positive regulation of apoptotic signaling pathway (GO:2001235)|regulation of apoptotic DNA fragmentation (GO:1902510)|regulation of apoptotic process (GO:0042981)|response to G1 DNA damage checkpoint signaling (GO:0072432)	apoptosome (GO:0043293)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	ADP binding (GO:0043531)|ATP binding (GO:0005524)|cysteine-type endopeptidase activator activity involved in apoptotic process (GO:0008656)|nucleotide binding (GO:0000166)			breast(1)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(13)|liver(1)|lung(15)|ovary(2)|prostate(2)|skin(1)	42					Adenosine triphosphate(DB00171)	ATGATTATGAGGCTCTAGATG	0.388																																						dbGAP											0													87.0	86.0	86.0					12																	99059461		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF013263	CCDS9069.1, CCDS9070.1, CCDS9071.1, CCDS55862.1, CCDS55863.1	12q23	2013-01-10	2006-10-23			ENSG00000120868		"""WD repeat domain containing"""	576	protein-coding gene	gene with protein product		602233	"""apoptotic protease activating factor"", ""apoptotic peptidase activating factor"""			9267021, 10702682	Standard	NM_181861		Approved	CED4, APAF-1	uc001tfz.3	O14727	OTTHUMG00000170214	ENST00000551964.1:c.1086G>T	12.37:g.99059461G>T	ENSP00000448165:p.Glu362Asp	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RMX8|O43297|Q7Z438|Q9BXZ6|Q9UBZ5|Q9UGN8|Q9UGN9|Q9UGP0|Q9UJ58|Q9UJ59|Q9UJ60|Q9UJ61|Q9UJ62|Q9UJ63|Q9UJ64|Q9UJ65|Q9UJ66|Q9UJ67|Q9UNC9	Missense_Mutation	SNP	pfam_WD40_repeat,pfam_NB-ARC,pfam_CARD,superfamily_WD40_repeat_dom,superfamily_DEATH-like,smart_WD40_repeat,pirsf_Apoptotic_pept-activating_1,pfscan_CARD,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,prints_Disease_R,prints_G-protein_beta_WD-40_rep	p.E362D	ENST00000551964.1	37	c.1086	CCDS9069.1	12	.	.	.	.	.	.	.	.	.	.	G	14.22	2.471141	0.43942	.	.	ENSG00000120868	ENST00000551964;ENST00000359972;ENST00000357310;ENST00000339433;ENST00000550527;ENST00000547045;ENST00000549007	T;T;T;T;T;T;T	0.80123	-1.34;-1.34;-1.34;-1.34;-1.34;-1.34;-1.34	5.14	0.671	0.17929	NB-ARC (1);	0.094068	0.64402	D	0.000001	T	0.71584	0.3357	N	0.12637	0.245	0.80722	D	1	B;B;B;P	0.42010	0.018;0.006;0.015;0.768	B;B;B;P	0.56960	0.033;0.021;0.035;0.81	T	0.61997	-0.6947	10	0.13853	T	0.58	0.0491	7.5336	0.27697	0.5461:0.0:0.4539:0.0	.	362;351;362;351	O14727-4;O14727-3;O14727;O14727-2	.;.;APAF_HUMAN;.	D	362;351;362;362;351;362;362	ENSP00000448165:E362D;ENSP00000353059:E351D;ENSP00000349862:E362D;ENSP00000341830:E362D;ENSP00000448449:E351D;ENSP00000449791:E362D;ENSP00000448161:E362D	ENSP00000341830:E362D	E	+	3	2	APAF1	97583592	0.203000	0.23435	1.000000	0.80357	0.995000	0.86356	0.317000	0.19487	0.214000	0.20742	-0.142000	0.14014	GAG	APAF1	-	pfam_NB-ARC,pirsf_Apoptotic_pept-activating_1	ENSG00000120868		0.388	APAF1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	APAF1	HGNC	protein_coding	OTTHUMT00000408006.1	24	0.00	0	G	NM_181861.1		99059461	99059461	+1	no_errors	ENST00000551964	ensembl	human	known	69_37n	missense	18	14.29	3	SNP	0.971	T
ANO4	121601	genome.wustl.edu	37	12	101433799	101433799	+	Missense_Mutation	SNP	G	G	C			TCGA-A2-A0CR-01A-11D-A228-09	TCGA-A2-A0CR-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f573c3c3-7b61-4955-8772-215b7cb9a763	3bdb54b4-1e26-4274-a1bd-800416ffbd34	g.chr12:101433799G>C	ENST00000392977.3	+	11	1174	c.964G>C	c.(964-966)Gag>Cag	p.E322Q	ANO4_ENST00000392979.3_Missense_Mutation_p.E287Q|RP11-350G24.1_ENST00000549036.1_RNA|ANO4_ENST00000299222.9_5'UTR			Q32M45	ANO4_HUMAN	anoctamin 4	322					chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|intracellular (GO:0005622)|plasma membrane (GO:0005886)	intracellular calcium activated chloride channel activity (GO:0005229)			NS(1)|biliary_tract(1)|breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(14)|lung(33)|ovary(4)|prostate(5)|skin(7)|stomach(2)|urinary_tract(1)	78						TCTACTCTATGAGTGCTGGGC	0.433										HNSCC(74;0.22)																												dbGAP											0													134.0	138.0	137.0					12																	101433799		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK091540	CCDS31884.1, CCDS66445.1	12q23.3	2014-04-09	2008-08-28	2008-08-28	ENSG00000151572	ENSG00000151572		"""Ion channels / Chloride channels : Calcium activated : Anoctamins"""	23837	protein-coding gene	gene with protein product		610111	"""transmembrane protein 16D"""	TMEM16D		12739008, 15067359, 24692353	Standard	NM_178826		Approved	FLJ34221, FLJ34272, FLJ35277	uc001thw.2	Q32M45		ENST00000392977.3:c.964G>C	12.37:g.101433799G>C	ENSP00000376703:p.Glu322Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8NAJ0|Q8NB39|Q8NB53	Missense_Mutation	SNP	pfam_Anoctamin	p.E322Q	ENST00000392977.3	37	c.964		12	.	.	.	.	.	.	.	.	.	.	G	15.69	2.907720	0.52333	.	.	ENSG00000151572	ENST00000392979;ENST00000392977	T;T	0.63580	-0.05;-0.05	5.76	5.76	0.90799	.	0.000000	0.85682	D	0.000000	T	0.56307	0.1976	L	0.41124	1.26	0.80722	D	1	B;B	0.29590	0.235;0.25	B;B	0.31495	0.062;0.131	T	0.50742	-0.8792	10	0.15066	T	0.55	.	19.9813	0.97326	0.0:0.0:1.0:0.0	.	322;287	Q32M45;Q32M45-2	ANO4_HUMAN;.	Q	287;322	ENSP00000376705:E287Q;ENSP00000376703:E322Q	ENSP00000376703:E322Q	E	+	1	0	ANO4	99957930	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.869000	0.99810	2.726000	0.93360	0.655000	0.94253	GAG	ANO4	-	NULL	ENSG00000151572		0.433	ANO4-002	KNOWN	basic	protein_coding	ANO4	HGNC	protein_coding	OTTHUMT00000409295.1	35	0.00	0	G	NM_178826		101433799	101433799	+1	no_errors	ENST00000392977	ensembl	human	known	69_37n	missense	25	10.71	3	SNP	1.000	C
APOB	338	genome.wustl.edu	37	2	21224748	21224748	+	Missense_Mutation	SNP	C	C	T			TCGA-A2-A0CR-01A-11D-A228-09	TCGA-A2-A0CR-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f573c3c3-7b61-4955-8772-215b7cb9a763	3bdb54b4-1e26-4274-a1bd-800416ffbd34	g.chr2:21224748C>T	ENST00000233242.1	-	29	13673	c.13546G>A	c.(13546-13548)Gaa>Aaa	p.E4516K	RP11-116D2.1_ENST00000567376.2_lincRNA	NM_000384.2	NP_000375	P04114	APOB_HUMAN	apolipoprotein B	4516					artery morphogenesis (GO:0048844)|blood coagulation (GO:0007596)|cellular response to prostaglandin stimulus (GO:0071379)|cellular response to tumor necrosis factor (GO:0071356)|cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|cholesterol transport (GO:0030301)|fertilization (GO:0009566)|in utero embryonic development (GO:0001701)|leukocyte migration (GO:0050900)|lipoprotein biosynthetic process (GO:0042158)|lipoprotein catabolic process (GO:0042159)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|low-density lipoprotein particle clearance (GO:0034383)|low-density lipoprotein particle remodeling (GO:0034374)|nervous system development (GO:0007399)|phototransduction, visible light (GO:0007603)|positive regulation of cholesterol storage (GO:0010886)|positive regulation of lipid storage (GO:0010884)|positive regulation of macrophage derived foam cell differentiation (GO:0010744)|post-embryonic development (GO:0009791)|receptor-mediated endocytosis (GO:0006898)|regulation of cholesterol biosynthetic process (GO:0045540)|response to carbohydrate (GO:0009743)|response to lipopolysaccharide (GO:0032496)|response to selenium ion (GO:0010269)|response to virus (GO:0009615)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|sperm motility (GO:0030317)|spermatogenesis (GO:0007283)|triglyceride catabolic process (GO:0019433)|triglyceride mobilization (GO:0006642)|very-low-density lipoprotein particle assembly (GO:0034379)	actin cytoskeleton (GO:0015629)|chylomicron (GO:0042627)|chylomicron remnant (GO:0034360)|clathrin-coated endocytic vesicle membrane (GO:0030669)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|early endosome (GO:0005769)|endocytic vesicle lumen (GO:0071682)|endoplasmic reticulum lumen (GO:0005788)|endoplasmic reticulum membrane (GO:0005789)|endosome lumen (GO:0031904)|endosome membrane (GO:0010008)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|intermediate-density lipoprotein particle (GO:0034363)|intracellular membrane-bounded organelle (GO:0043231)|low-density lipoprotein particle (GO:0034362)|mature chylomicron (GO:0034359)|plasma membrane (GO:0005886)|very-low-density lipoprotein particle (GO:0034361)	cholesterol transporter activity (GO:0017127)|heparin binding (GO:0008201)|lipase binding (GO:0035473)|low-density lipoprotein particle receptor binding (GO:0050750)|phospholipid binding (GO:0005543)			NS(5)|autonomic_ganglia(1)|breast(6)|central_nervous_system(4)|cervix(3)|endometrium(19)|kidney(10)|large_intestine(63)|liver(5)|lung(125)|ovary(16)|pancreas(1)|prostate(5)|skin(31)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(6)	305	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					CTTTTGGATTCAGCAATAAAT	0.348																																						dbGAP											0													121.0	130.0	127.0					2																	21224748		2203	4300	6503	-	-	-	SO:0001583	missense	0			M14162	CCDS1703.1	2p24-p23	2013-05-29	2013-05-29		ENSG00000084674	ENSG00000084674		"""Apolipoproteins"""	603	protein-coding gene	gene with protein product		107730	"""apolipoprotein B (including Ag(x) antigen)"""				Standard	NM_000384		Approved		uc002red.3	P04114	OTTHUMG00000090785	ENST00000233242.1:c.13546G>A	2.37:g.21224748C>T	ENSP00000233242:p.Glu4516Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	O00502|P78479|P78480|P78481|Q13779|Q13785|Q13786|Q13787|Q13788|Q4ZG63|Q53QC8|Q7Z600|Q9UMN0	Missense_Mutation	SNP	pfam_Lipid_transpt_N,pfam_Vitellinogen_open_b-sht,pfam_ApoB100_C,pfam_Lipid_transpt_open_b-sht,superfamily_Lipid_transp_b-sht_shell,superfamily_Vitellinogen_superhlx,superfamily_ARM-type_fold,smart_Lipid_transpt_N,pfscan_Lipid_transpt_N	p.E4516K	ENST00000233242.1	37	c.13546	CCDS1703.1	2	.	.	.	.	.	.	.	.	.	.	C	17.97	3.518083	0.64634	.	.	ENSG00000084674	ENST00000233242	T	0.37058	1.22	5.68	1.78	0.24846	.	0.885612	0.09699	N	0.767281	T	0.35799	0.0944	M	0.67953	2.075	0.09310	N	0.99999	B	0.21071	0.051	B	0.25614	0.062	T	0.36529	-0.9744	10	0.48119	T	0.1	.	6.0928	0.20003	0.1205:0.6155:0.0:0.2641	.	4516	P04114	APOB_HUMAN	K	4516	ENSP00000233242:E4516K	ENSP00000233242:E4516K	E	-	1	0	APOB	21078253	0.000000	0.05858	0.010000	0.14722	0.969000	0.65631	0.691000	0.25467	0.321000	0.23259	0.591000	0.81541	GAA	APOB	-	pfam_ApoB100_C	ENSG00000084674		0.348	APOB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	APOB	HGNC	protein_coding	OTTHUMT00000207571.1	30	0.00	0	C			21224748	21224748	-1	no_errors	ENST00000233242	ensembl	human	known	69_37n	missense	30	11.76	4	SNP	0.001	T
ARID1A	8289	genome.wustl.edu	37	1	27057727	27057727	+	Nonsense_Mutation	SNP	C	C	T			TCGA-A2-A0CR-01A-11D-A228-09	TCGA-A2-A0CR-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f573c3c3-7b61-4955-8772-215b7cb9a763	3bdb54b4-1e26-4274-a1bd-800416ffbd34	g.chr1:27057727C>T	ENST00000324856.7	+	3	1806	c.1435C>T	c.(1435-1437)Cag>Tag	p.Q479*	ARID1A_ENST00000457599.2_Nonsense_Mutation_p.Q479*|ARID1A_ENST00000374152.2_Nonsense_Mutation_p.Q96*	NM_006015.4	NP_006006.3	O14497	ARI1A_HUMAN	AT rich interactive domain 1A (SWI-like)	479	Poly-Gln.				androgen receptor signaling pathway (GO:0030521)|ATP-dependent chromatin remodeling (GO:0043044)|cardiac chamber development (GO:0003205)|chromatin remodeling (GO:0006338)|chromatin-mediated maintenance of transcription (GO:0048096)|forebrain development (GO:0030900)|glucocorticoid receptor signaling pathway (GO:0042921)|intracellular estrogen receptor signaling pathway (GO:0030520)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neural tube closure (GO:0001843)|nucleosome disassembly (GO:0006337)|nucleosome mobilization (GO:0042766)|optic cup formation involved in camera-type eye development (GO:0003408)|placenta blood vessel development (GO:0060674)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nBAF complex (GO:0071565)|npBAF complex (GO:0071564)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|SWI/SNF complex (GO:0016514)	DNA binding (GO:0003677)|ligand-dependent nuclear receptor binding (GO:0016922)|transcription coactivator activity (GO:0003713)	p.Q479*(2)	ARID1A/MAST2_ENST00000361297(2)	NS(1)|autonomic_ganglia(1)|biliary_tract(1)|breast(13)|central_nervous_system(6)|cervix(2)|endometrium(56)|haematopoietic_and_lymphoid_tissue(8)|kidney(10)|large_intestine(41)|liver(31)|lung(34)|ovary(130)|pancreas(18)|prostate(8)|skin(9)|stomach(14)|upper_aerodigestive_tract(4)|urinary_tract(24)	411		all_cancers(24;6.36e-27)|all_epithelial(13;5.93e-24)|Colorectal(325;3.46e-05)|all_lung(284;4.76e-05)|Lung NSC(340;5.83e-05)|Breast(348;9.7e-05)|Renal(390;0.0007)|Ovarian(437;0.00473)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|all cancers(4;2.61e-56)|Epithelial(14;7.53e-55)|OV - Ovarian serous cystadenocarcinoma(117;4.5e-30)|Colorectal(126;2.07e-09)|COAD - Colon adenocarcinoma(152;4.29e-07)|BRCA - Breast invasive adenocarcinoma(304;4.13e-05)|STAD - Stomach adenocarcinoma(196;0.000279)|KIRC - Kidney renal clear cell carcinoma(1967;0.000794)|GBM - Glioblastoma multiforme(114;0.0132)|READ - Rectum adenocarcinoma(331;0.0469)|Lung(427;0.167)|LUSC - Lung squamous cell carcinoma(448;0.242)		TCCTCACCCTCAGCAGCAGCA	0.557			"""Mis, N, F, S, D"""		"""clear cell ovarian carcinoma, RCC"""																																	dbGAP		Rec	yes		1	1p35.3	8289	AT rich interactive domain 1A (SWI-like)		E	2	Substitution - Nonsense(2)	lung(1)|endometrium(1)											304.0	286.0	292.0					1																	27057727		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AB001895	CCDS285.1, CCDS44091.1	1p36.1-p35	2014-09-17	2006-11-08	2004-01-30	ENSG00000117713	ENSG00000117713		"""-"""	11110	protein-coding gene	gene with protein product		603024	"""SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily f, member 1"", ""AT rich interactive domain 1A (SWI- like)"""	C1orf4, SMARCF1		9630625, 9434167	Standard	NM_139135		Approved	B120, P270, C10rf4, BAF250, BAF250a	uc001bmv.1	O14497	OTTHUMG00000004004	ENST00000324856.7:c.1435C>T	1.37:g.27057727C>T	ENSP00000320485:p.Gln479*	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DPL1|Q53FK9|Q5T0W1|Q5T0W2|Q5T0W3|Q8NFD6|Q96T89|Q9BY33|Q9HBJ5|Q9UPZ1	Nonsense_Mutation	SNP	pfam_DUF3518,pfam_ARID/BRIGHT_DNA-bd,superfamily_ARID/BRIGHT_DNA-bd,superfamily_ARM-type_fold,smart_ARID/BRIGHT_DNA-bd,pfscan_ARID/BRIGHT_DNA-bd	p.Q479*	ENST00000324856.7	37	c.1435	CCDS285.1	1	.	.	.	.	.	.	.	.	.	.	C	18.73	3.687441	0.68157	.	.	ENSG00000117713	ENST00000324856;ENST00000457599;ENST00000524572;ENST00000374152	.	.	.	4.72	4.72	0.59763	.	0.190704	0.45867	D	0.000333	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.05959	T	0.93	-5.3722	17.8439	0.88724	0.0:1.0:0.0:0.0	.	.	.	.	X	479;479;96;96	.	ENSP00000320485:Q479X	Q	+	1	0	ARID1A	26930314	0.996000	0.38824	1.000000	0.80357	0.930000	0.56654	2.072000	0.41510	2.454000	0.82982	0.561000	0.74099	CAG	ARID1A	-	NULL	ENSG00000117713		0.557	ARID1A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ARID1A	HGNC	protein_coding	OTTHUMT00000011437.2	61	0.00	0	C	NM_139135		27057727	27057727	+1	no_errors	ENST00000324856	ensembl	human	known	69_37n	nonsense	79	13.19	12	SNP	1.000	T
ATP7A	538	genome.wustl.edu	37	X	77245317	77245317	+	Missense_Mutation	SNP	C	C	T	rs398123133		TCGA-A2-A0CR-01A-11D-A228-09	TCGA-A2-A0CR-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f573c3c3-7b61-4955-8772-215b7cb9a763	3bdb54b4-1e26-4274-a1bd-800416ffbd34	g.chrX:77245317C>T	ENST00000341514.6	+	4	1354	c.1199C>T	c.(1198-1200)tCa>tTa	p.S400L	ATP7A_ENST00000343533.5_Missense_Mutation_p.S400L|ATP7A_ENST00000350425.4_Intron	NM_000052.5	NP_000043.4	Q04656	ATP7A_HUMAN	ATPase, Cu++ transporting, alpha polypeptide	400	HMA 4. {ECO:0000255|PROSITE- ProRule:PRU00280}.				blood vessel development (GO:0001568)|blood vessel remodeling (GO:0001974)|cartilage development (GO:0051216)|catecholamine metabolic process (GO:0006584)|cellular copper ion homeostasis (GO:0006878)|central nervous system neuron development (GO:0021954)|cerebellar Purkinje cell differentiation (GO:0021702)|collagen fibril organization (GO:0030199)|copper ion export (GO:0060003)|copper ion import (GO:0015677)|copper ion transport (GO:0006825)|dendrite morphogenesis (GO:0048813)|detoxification of copper ion (GO:0010273)|dopamine metabolic process (GO:0042417)|elastic fiber assembly (GO:0048251)|elastin biosynthetic process (GO:0051542)|epinephrine metabolic process (GO:0042414)|extracellular matrix organization (GO:0030198)|hair follicle morphogenesis (GO:0031069)|in utero embryonic development (GO:0001701)|ion transmembrane transport (GO:0034220)|lactation (GO:0007595)|locomotory behavior (GO:0007626)|lung alveolus development (GO:0048286)|mitochondrion organization (GO:0007005)|negative regulation of metalloenzyme activity (GO:0048553)|negative regulation of neuron apoptotic process (GO:0043524)|neuron projection morphogenesis (GO:0048812)|norepinephrine biosynthetic process (GO:0042421)|norepinephrine metabolic process (GO:0042415)|peptidyl-lysine modification (GO:0018205)|pigmentation (GO:0043473)|positive regulation of catalytic activity (GO:0043085)|positive regulation of metalloenzyme activity (GO:0048554)|positive regulation of oxidoreductase activity (GO:0051353)|pyramidal neuron development (GO:0021860)|regulation of gene expression (GO:0010468)|regulation of oxidative phosphorylation (GO:0002082)|release of cytochrome c from mitochondria (GO:0001836)|removal of superoxide radicals (GO:0019430)|response to iron(III) ion (GO:0010041)|response to zinc ion (GO:0010043)|serotonin metabolic process (GO:0042428)|skin development (GO:0043588)|T-helper cell differentiation (GO:0042093)|transmembrane transport (GO:0055085)|tryptophan metabolic process (GO:0006568)|tyrosine metabolic process (GO:0006570)	basolateral plasma membrane (GO:0016323)|brush border membrane (GO:0031526)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|late endosome (GO:0005770)|membrane (GO:0016020)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|secretory granule (GO:0030141)|trans-Golgi network (GO:0005802)|trans-Golgi network transport vesicle (GO:0030140)	ATP binding (GO:0005524)|copper ion binding (GO:0005507)|copper ion transmembrane transporter activity (GO:0005375)|copper-dependent protein binding (GO:0032767)|copper-exporting ATPase activity (GO:0004008)|superoxide dismutase copper chaperone activity (GO:0016532)			breast(4)|central_nervous_system(3)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(26)|pancreas(1)|prostate(1)|urinary_tract(1)	53					Carboplatin(DB00958)|Cisplatin(DB00515)|Oxaliplatin(DB00526)	GGTGTCATATCAAAAAAGCCA	0.423																																						dbGAP											0													143.0	133.0	136.0					X																	77245317		2203	4296	6499	-	-	-	SO:0001583	missense	0			L06133	CCDS35339.1, CCDS75997.1	Xq21.1	2012-10-22	2008-07-31		ENSG00000165240	ENSG00000165240	3.6.3.4	"""ATPases / P-type"""	869	protein-coding gene	gene with protein product	"""copper pump 1"", ""copper-transporting ATPase 1"""	300011	"""Menkes syndrome"""	MNK		10079817	Standard	NM_000052		Approved		uc004ecx.4	Q04656	OTTHUMG00000021885	ENST00000341514.6:c.1199C>T	X.37:g.77245317C>T	ENSP00000345728:p.Ser400Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	B1AT72|O00227|O00745|Q9BYY8	Missense_Mutation	SNP	pfam_HeavyMe-assoc_HMA,pfam_ATPase_P-typ_ATPase-assoc-dom,pfam_Dehalogen-like_hydro,pfam_HAD-SF_hydro-like_3,superfamily_HAD-like_dom,superfamily_HeavyMe-assoc_HMA,pfscan_HeavyMe-assoc_HMA,prints_ATPase_P-typ_cat/Cu-transptr,prints_ATPase_P-typ_ion-transptr,prints_ATPase_P-typ_H-transp,prints_HG_scavenger,tigrfam_ATPase_P-typ_heavy-metal,tigrfam_ATPase_P-typ_ion-transptr,tigrfam_HMA_Cu_ion-bd	p.S400L	ENST00000341514.6	37	c.1199	CCDS35339.1	X	.	.	.	.	.	.	.	.	.	.	C	18.69	3.678264	0.68042	.	.	ENSG00000165240	ENST00000343533;ENST00000341514;ENST00000355691	D;D	0.86030	-2.06;-2.06	5.67	4.81	0.61882	Heavy metal-associated domain, HMA (3);Heavy metal-associated domain, copper ion-binding (1);Heavy-metal-associated, conserved site (1);	0.201883	0.44483	D	0.000452	D	0.90563	0.7042	M	0.64170	1.965	0.80722	D	1	D;P	0.76494	0.999;0.776	D;B	0.76071	0.987;0.413	D	0.90566	0.4519	10	0.54805	T	0.06	-3.5454	14.05	0.64730	0.0:0.9257:0.0:0.0743	.	400;410	Q04656;Q59HD1	ATP7A_HUMAN;.	L	400;400;410	ENSP00000343026:S400L;ENSP00000345728:S400L	ENSP00000345728:S400L	S	+	2	0	ATP7A	77131973	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	4.981000	0.63819	1.161000	0.42604	0.594000	0.82650	TCA	ATP7A	-	pfam_HeavyMe-assoc_HMA,superfamily_HeavyMe-assoc_HMA,pfscan_HeavyMe-assoc_HMA,tigrfam_HMA_Cu_ion-bd	ENSG00000165240		0.423	ATP7A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATP7A	HGNC	protein_coding	OTTHUMT00000057306.1	37	0.00	0	C	NM_000052		77245317	77245317	+1	no_errors	ENST00000341514	ensembl	human	known	69_37n	missense	31	22.50	9	SNP	1.000	T
ATP7B	540	genome.wustl.edu	37	13	52536020	52536020	+	Missense_Mutation	SNP	C	C	G			TCGA-A2-A0CR-01A-11D-A228-09	TCGA-A2-A0CR-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f573c3c3-7b61-4955-8772-215b7cb9a763	3bdb54b4-1e26-4274-a1bd-800416ffbd34	g.chr13:52536020C>G	ENST00000242839.4	-	6	2055	c.1899G>C	c.(1897-1899)caG>caC	p.Q633H	ATP7B_ENST00000418097.2_Missense_Mutation_p.Q633H|ATP7B_ENST00000344297.5_Intron|ATP7B_ENST00000448424.2_Missense_Mutation_p.Q633H|ATP7B_ENST00000417240.2_5'UTR|ATP7B_ENST00000482841.1_Intron|ATP7B_ENST00000542656.1_Intron|ATP7B_ENST00000400366.3_Missense_Mutation_p.Q522H|ATP7B_ENST00000400370.3_Intron	NM_000053.3	NP_000044.2	P35670	ATP7B_HUMAN	ATPase, Cu++ transporting, beta polypeptide	633					cellular copper ion homeostasis (GO:0006878)|cellular zinc ion homeostasis (GO:0006882)|copper ion import (GO:0015677)|copper ion transport (GO:0006825)|intracellular copper ion transport (GO:0015680)|ion transmembrane transport (GO:0034220)|lactation (GO:0007595)|response to copper ion (GO:0046688)|sequestering of calcium ion (GO:0051208)|transmembrane transport (GO:0055085)	Golgi membrane (GO:0000139)|integral component of plasma membrane (GO:0005887)|late endosome (GO:0005770)|membrane (GO:0016020)|mitochondrion (GO:0005739)|trans-Golgi network (GO:0005802)	ATP binding (GO:0005524)|copper ion binding (GO:0005507)|copper-exporting ATPase activity (GO:0004008)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(5)|kidney(4)|large_intestine(7)|lung(23)|ovary(1)|prostate(3)|skin(4)|stomach(2)	55		Breast(56;0.000207)|Lung NSC(96;0.000845)|Prostate(109;0.0235)|Hepatocellular(98;0.065)|all_neural(104;0.19)		GBM - Glioblastoma multiforme(99;5.25e-08)	Carboplatin(DB00958)|Cisplatin(DB00515)|Oxaliplatin(DB00526)	TGGGGTTTCTCTGGGCCAGGG	0.438									Wilson disease																													dbGAP											0													187.0	175.0	179.0					13																	52536020		1876	4102	5978	-	-	-	SO:0001583	missense	0	Familial Cancer Database		U11700	CCDS41892.1, CCDS45049.1, CCDS58293.1	13q14.3	2012-10-22	2005-11-29		ENSG00000123191	ENSG00000123191	3.6.3.4	"""ATPases / P-type"""	870	protein-coding gene	gene with protein product	"""Wilson disease"", ""copper pump 2"", ""copper-transporting ATPase 2"""	606882	"""ATPase, Cu++ transporting, beta polypeptide (Wilson disease)"""	WND		8298641, 8298639	Standard	NM_000053		Approved		uc001vfw.2	P35670	OTTHUMG00000017406	ENST00000242839.4:c.1899G>C	13.37:g.52536020C>G	ENSP00000242839:p.Gln633His	Somatic		WXS	Illumina GAIIx	Phase_IV	Q16318|Q16319|Q4U3V3|Q59FJ9|Q5T7X7	Missense_Mutation	SNP	pfam_HeavyMe-assoc_HMA,pfam_ATPase_P-typ_ATPase-assoc-dom,pfam_Dehalogen-like_hydro,pfam_HAD-SF_hydro-like_3,superfamily_HAD-like_dom,superfamily_HeavyMe-assoc_HMA,pfscan_HeavyMe-assoc_HMA,prints_ATPase_P-typ_cat/Cu-transptr,prints_ATPase_P-typ_ion-transptr,prints_ATPase_P-typ_H-transp,tigrfam_ATPase_P-typ_heavy-metal,tigrfam_ATPase_P-typ_ion-transptr,tigrfam_HMA_Cu_ion-bd	p.Q633H	ENST00000242839.4	37	c.1899	CCDS41892.1	13	.	.	.	.	.	.	.	.	.	.	C	12.83	2.055422	0.36277	.	.	ENSG00000123191	ENST00000242839;ENST00000400366;ENST00000448424;ENST00000418097	D;D;D;D	0.87412	-2.25;-2.25;-2.25;-2.25	5.46	4.61	0.57282	Heavy metal-associated domain, HMA (1);	0.271174	0.40064	N	0.001195	D	0.84288	0.5439	L	0.29908	0.895	0.80722	D	1	B;B;D;B;B	0.63046	0.025;0.001;0.992;0.444;0.0	B;B;P;B;B	0.56127	0.015;0.001;0.792;0.019;0.001	T	0.83043	-0.0156	10	0.51188	T	0.08	-6.1148	5.0813	0.14659	0.0:0.6294:0.1877:0.1829	.	633;633;633;522;633	E7ET55;B7ZLR4;F5H748;P35670-3;P35670	.;.;.;.;ATP7B_HUMAN	H	633;522;633;633	ENSP00000242839:Q633H;ENSP00000383217:Q522H;ENSP00000416738:Q633H;ENSP00000393343:Q633H	ENSP00000242839:Q633H	Q	-	3	2	ATP7B	51434021	1.000000	0.71417	1.000000	0.80357	0.857000	0.48899	2.178000	0.42519	1.278000	0.44430	0.650000	0.86243	CAG	ATP7B	-	superfamily_HeavyMe-assoc_HMA	ENSG00000123191		0.438	ATP7B-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ATP7B	HGNC	protein_coding	OTTHUMT00000045981.1	82	0.00	0	C	NM_000053		52536020	52536020	-1	no_errors	ENST00000242839	ensembl	human	known	69_37n	missense	76	10.59	9	SNP	1.000	G
C11orf54	28970	genome.wustl.edu	37	11	93493023	93493023	+	Splice_Site	SNP	C	C	G	rs534683737		TCGA-A2-A0CR-01A-11D-A228-09	TCGA-A2-A0CR-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f573c3c3-7b61-4955-8772-215b7cb9a763	3bdb54b4-1e26-4274-a1bd-800416ffbd34	g.chr11:93493023C>G	ENST00000331239.4	+	8	952	c.773C>G	c.(772-774)cCa>cGa	p.P258R	C11orf54_ENST00000528099.1_Splice_Site_p.P258R|C11orf54_ENST00000354421.3_Splice_Site_p.P258R|C11orf54_ENST00000528288.1_Splice_Site_p.P208R|C11orf54_ENST00000540113.1_Splice_Site_p.P239R			Q9H0W9	CK054_HUMAN	chromosome 11 open reading frame 54	258					metabolic process (GO:0008152)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	hydrolase activity, acting on ester bonds (GO:0016788)|zinc ion binding (GO:0008270)			NS(1)|endometrium(1)|large_intestine(1)|lung(5)	8		Acute lymphoblastic leukemia(157;2.26e-05)|all_hematologic(158;0.0123)				TCCAGAGACCCAGTAAGTCTG	0.343																																						dbGAP											0													116.0	122.0	120.0					11																	93493023		2201	4298	6499	-	-	-	SO:0001630	splice_region_variant	0			AF092133	CCDS8294.1, CCDS66204.1, CCDS73365.1, CCDS73366.1	11q21	2012-08-09			ENSG00000182919	ENSG00000182919			30204	protein-coding gene	gene with protein product		615810				16522806	Standard	NM_014039		Approved	PTD012	uc001pef.3	Q9H0W9	OTTHUMG00000167452	ENST00000331239.4:c.774+1C>G	11.37:g.93493023C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K850|Q6FI88|Q6XYB0|Q96EI3|Q96IX1|Q9Y6B4	Missense_Mutation	SNP	pfam_DUF1907	p.P258R	ENST00000331239.4	37	c.773		11	.	.	.	.	.	.	.	.	.	.	C	21.8	4.202953	0.79127	.	.	ENSG00000182919	ENST00000528288;ENST00000331239;ENST00000528099;ENST00000354421;ENST00000540113;ENST00000530620;ENST00000524485;ENST00000533154	.	.	.	5.64	5.64	0.86602	Domain of unknown function DUF1907 (1);	0.000000	0.85682	D	0.000000	D	0.82917	0.5141	.	.	.	0.80722	D	1	D;D;D	0.89917	1.0;0.999;1.0	D;D;D	0.76575	0.981;0.988;0.981	T	0.83140	-0.0109	8	0.52906	T	0.07	-7.6755	19.7643	0.96334	0.0:1.0:0.0:0.0	.	258;208;258	Q9H0W9;Q9H0W9-3;A8K718	CK054_HUMAN;.;.	R	208;258;258;258;239;239;239;147	.	ENSP00000331209:P258R	P	+	2	0	C11orf54	93132671	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.228000	0.78079	2.660000	0.90430	0.644000	0.83932	CCA	C11orf54	-	pfam_DUF1907	ENSG00000182919		0.343	C11orf54-002	KNOWN	basic|appris_principal	protein_coding	C11orf54	HGNC	protein_coding	OTTHUMT00000394671.1	68	0.00	0	C	NM_014039	Missense_Mutation	93493023	93493023	+1	no_errors	ENST00000331239	ensembl	human	known	69_37n	missense	61	15.28	11	SNP	1.000	G
CCDC175	729665	genome.wustl.edu	37	14	60031809	60031809	+	Missense_Mutation	SNP	C	C	G			TCGA-A2-A0CR-01A-11D-A228-09	TCGA-A2-A0CR-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f573c3c3-7b61-4955-8772-215b7cb9a763	3bdb54b4-1e26-4274-a1bd-800416ffbd34	g.chr14:60031809C>G	ENST00000537690.2	-	5	731	c.676G>C	c.(676-678)Gaa>Caa	p.E226Q	CCDC175_ENST00000281581.4_Missense_Mutation_p.E226Q|CCDC175_ENST00000556996.1_5'Flank	NM_001164399.1	NP_001157871.1	P0C221	CC175_HUMAN	coiled-coil domain containing 175	226																	TCTGCCCTTTCTTTTTCCATT	0.323																																						dbGAP											0													272.0	220.0	236.0					14																	60031809		692	1591	2283	-	-	-	SO:0001583	missense	0				CCDS53898.1	14q23.1	2012-09-24	2012-09-24	2012-09-24	ENSG00000151838	ENSG00000151838			19847	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 38"""	C14orf38			Standard	NM_001164399		Approved		uc021rtw.1	P0C221		ENST00000537690.2:c.676G>C	14.37:g.60031809C>G	ENSP00000453940:p.Glu226Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	G3V5J7	Missense_Mutation	SNP	superfamily_Prefoldin	p.E226Q	ENST00000537690.2	37	c.676	CCDS53898.1	14	.	.	.	.	.	.	.	.	.	.	C	4.095	0.015743	0.07959	.	.	ENSG00000151838	ENST00000555041	.	.	.	4.75	0.486	0.16836	.	0.877468	0.09852	N	0.747393	T	0.33118	0.0852	N	0.19112	0.55	0.09310	N	1	.	.	.	.	.	.	T	0.30475	-0.9977	6	.	.	.	-0.038	15.0844	0.72138	0.0:0.3666:0.6334:0.0	.	.	.	.	Q	226	.	.	E	-	1	0	C14orf38	59101562	0.000000	0.05858	0.000000	0.03702	0.032000	0.12392	-0.216000	0.09266	-0.027000	0.13873	0.561000	0.74099	GAA	C14orf38	-	NULL	ENSG00000151838		0.323	CCDC175-003	KNOWN	basic|appris_principal|CCDS	protein_coding	C14orf38	HGNC	protein_coding	OTTHUMT00000471273.1	55	0.00	0	C	NM_001164399		60031809	60031809	-1	no_errors	ENST00000281581	ensembl	human	known	69_37n	missense	39	11.36	5	SNP	0.001	G
C19orf44	84167	genome.wustl.edu	37	19	16620688	16620688	+	Missense_Mutation	SNP	C	C	T			TCGA-A2-A0CR-01A-11D-A228-09	TCGA-A2-A0CR-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f573c3c3-7b61-4955-8772-215b7cb9a763	3bdb54b4-1e26-4274-a1bd-800416ffbd34	g.chr19:16620688C>T	ENST00000221671.3	+	5	1684	c.1528C>T	c.(1528-1530)Cca>Tca	p.P510S	CTD-3222D19.2_ENST00000409035.1_Intron|C19orf44_ENST00000594035.1_Missense_Mutation_p.P510S	NM_032207.2	NP_115583.1	Q9H6X5	CS044_HUMAN	chromosome 19 open reading frame 44	510										endometrium(1)|large_intestine(5)|lung(5)|ovary(1)|skin(1)|stomach(1)|urinary_tract(2)	16						GACAGACCTTCCACAAACAGC	0.522																																						dbGAP											0													96.0	97.0	97.0					19																	16620688		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK025395	CCDS12345.1, CCDS74306.1	19p13.11	2011-11-24			ENSG00000105072	ENSG00000105072			26141	protein-coding gene	gene with protein product						12477932	Standard	NM_032207		Approved	FLJ21742	uc002neh.1	Q9H6X5		ENST00000221671.3:c.1528C>T	19.37:g.16620688C>T	ENSP00000221671:p.Pro510Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8N6Y7	Missense_Mutation	SNP	NULL	p.P510S	ENST00000221671.3	37	c.1528	CCDS12345.1	19	.	.	.	.	.	.	.	.	.	.	C	0.699	-0.791582	0.02884	.	.	ENSG00000105072	ENST00000221671	.	.	.	4.28	-2.83	0.05769	.	1.546810	0.04184	N	0.327087	T	0.17916	0.0430	N	0.25647	0.755	0.09310	N	1	B;B;B	0.15930	0.002;0.009;0.015	B;B;B	0.14578	0.005;0.01;0.011	T	0.12553	-1.0543	9	0.06757	T	0.87	-0.8121	0.5848	0.00718	0.1823:0.211:0.3104:0.2963	.	510;183;510	Q9H6X5;B4DN63;Q9H6X5-2	CS044_HUMAN;.;.	S	510	.	ENSP00000221671:P510S	P	+	1	0	C19orf44	16481688	0.000000	0.05858	0.000000	0.03702	0.005000	0.04900	-2.046000	0.01409	-0.041000	0.13558	0.650000	0.86243	CCA	C19orf44	-	NULL	ENSG00000105072		0.522	C19orf44-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	C19orf44	HGNC	protein_coding	OTTHUMT00000461218.1	33	0.00	0	C	NM_032207		16620688	16620688	+1	no_errors	ENST00000221671	ensembl	human	known	69_37n	missense	38	15.56	7	SNP	0.000	T
C5orf34	375444	genome.wustl.edu	37	5	43492913	43492913	+	Missense_Mutation	SNP	G	G	T			TCGA-A2-A0CR-01A-11D-A228-09	TCGA-A2-A0CR-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f573c3c3-7b61-4955-8772-215b7cb9a763	3bdb54b4-1e26-4274-a1bd-800416ffbd34	g.chr5:43492913G>T	ENST00000306862.2	-	9	1769	c.1394C>A	c.(1393-1395)gCc>gAc	p.A465D	RP11-159F24.3_ENST00000505645.1_RNA	NM_198566.2	NP_940968	Q96MH7	CE034_HUMAN	chromosome 5 open reading frame 34	465										breast(2)|endometrium(2)|large_intestine(2)|lung(11)|ovary(1)|prostate(1)|stomach(2)	21	Lung NSC(6;2.07e-05)					ATCAGAGTAGGCAAGAAATCT	0.378																																						dbGAP											0													99.0	100.0	100.0					5																	43492913		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK056925	CCDS3946.1	5p12	2012-02-23			ENSG00000172244	ENSG00000172244			24738	protein-coding gene	gene with protein product						12477932	Standard	XM_006714473		Approved	FLJ32363	uc003jnz.2	Q96MH7	OTTHUMG00000131151	ENST00000306862.2:c.1394C>A	5.37:g.43492913G>T	ENSP00000303490:p.Ala465Asp	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	NULL	p.A465D	ENST00000306862.2	37	c.1394	CCDS3946.1	5	.	.	.	.	.	.	.	.	.	.	G	19.41	3.822280	0.71028	.	.	ENSG00000172244	ENST00000306862	T	0.56444	0.46	5.73	3.63	0.41609	.	0.197606	0.42420	D	0.000706	T	0.65709	0.2717	M	0.67953	2.075	0.36785	D	0.884525	D	0.69078	0.997	D	0.64410	0.925	T	0.73920	-0.3830	10	0.87932	D	0	-5.3417	10.3569	0.43969	0.2209:0.0:0.7791:0.0	.	465	Q96MH7	CE034_HUMAN	D	465	ENSP00000303490:A465D	ENSP00000303490:A465D	A	-	2	0	C5orf34	43528670	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	2.982000	0.49337	1.422000	0.47177	0.650000	0.86243	GCC	C5orf34	-	NULL	ENSG00000172244		0.378	C5orf34-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C5orf34	HGNC	protein_coding	OTTHUMT00000253843.1	39	0.00	0	G	NM_198566		43492913	43492913	-1	no_errors	ENST00000306862	ensembl	human	known	69_37n	missense	31	11.43	4	SNP	1.000	T
C9orf84	158401	genome.wustl.edu	37	9	114454565	114454565	+	Missense_Mutation	SNP	G	G	A			TCGA-A2-A0CR-01A-11D-A228-09	TCGA-A2-A0CR-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f573c3c3-7b61-4955-8772-215b7cb9a763	3bdb54b4-1e26-4274-a1bd-800416ffbd34	g.chr9:114454565G>A	ENST00000318737.4	-	25	3628	c.3500C>T	c.(3499-3501)tCt>tTt	p.S1167F	C9orf84_ENST00000394777.4_Missense_Mutation_p.S1093F|C9orf84_ENST00000374287.3_Missense_Mutation_p.S1167F|C9orf84_ENST00000394779.3_Missense_Mutation_p.S1128F	NM_173521.3	NP_775792.3	Q5VXU9	CI084_HUMAN	chromosome 9 open reading frame 84	1167										breast(1)|cervix(1)|endometrium(3)|kidney(7)|large_intestine(10)|liver(1)|lung(7)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	35						CATAATGGAAGAGTTGTCATT	0.348																																						dbGAP											0													95.0	96.0	96.0					9																	114454565		2203	4300	6503	-	-	-	SO:0001583	missense	0			AL833535	CCDS6781.3, CCDS43863.1	9q32	2012-03-16			ENSG00000165181	ENSG00000165181			26535	protein-coding gene	gene with protein product							Standard	XM_005251738		Approved	FLJ32779	uc004bfr.3	Q5VXU9	OTTHUMG00000020495	ENST00000318737.4:c.3500C>T	9.37:g.114454565G>A	ENSP00000322108:p.Ser1167Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	A2A2V3|Q2M1H8|Q96M73	Missense_Mutation	SNP	superfamily_RuvA_2-like	p.S1167F	ENST00000318737.4	37	c.3500	CCDS6781.3	9	.	.	.	.	.	.	.	.	.	.	G	2.031	-0.422393	0.04734	.	.	ENSG00000165181	ENST00000394779;ENST00000394777;ENST00000394778;ENST00000374287;ENST00000318737	T;T;T;T	0.05925	3.37;3.38;3.37;3.37	5.53	1.42	0.22433	.	1.783200	0.02870	N	0.131477	T	0.06917	0.0176	L	0.32530	0.975	0.09310	N	1	B;B;B	0.21071	0.051;0.051;0.051	B;B;B	0.19391	0.025;0.025;0.025	T	0.38308	-0.9667	10	0.72032	D	0.01	0.0022	4.961	0.14066	0.2453:0.0:0.5589:0.1958	.	1093;1167;1128	A6PVK7;Q5VXU9;A2A2V3	.;CI084_HUMAN;.	F	1128;1093;781;1167;1167	ENSP00000378259:S1128F;ENSP00000378257:S1093F;ENSP00000363405:S1167F;ENSP00000322108:S1167F	ENSP00000322108:S1167F	S	-	2	0	C9orf84	113494386	0.000000	0.05858	0.035000	0.18076	0.088000	0.18126	0.174000	0.16743	0.390000	0.25115	0.563000	0.77884	TCT	C9orf84	-	NULL	ENSG00000165181		0.348	C9orf84-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	C9orf84	HGNC	protein_coding	OTTHUMT00000053656.2	31	0.00	0	G	NM_173521		114454565	114454565	-1	no_errors	ENST00000318737	ensembl	human	known	69_37n	missense	20	23.08	6	SNP	0.003	A
CAND2	23066	genome.wustl.edu	37	3	12856719	12856719	+	Missense_Mutation	SNP	G	G	C			TCGA-A2-A0CR-01A-11D-A228-09	TCGA-A2-A0CR-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f573c3c3-7b61-4955-8772-215b7cb9a763	3bdb54b4-1e26-4274-a1bd-800416ffbd34	g.chr3:12856719G>C	ENST00000456430.2	+	8	1127	c.1086G>C	c.(1084-1086)ttG>ttC	p.L362F	CAND2_ENST00000295989.5_Missense_Mutation_p.L269F	NM_001162499.1	NP_001155971.1	O75155	CAND2_HUMAN	cullin-associated and neddylation-dissociated 2 (putative)	362					positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	intracellular (GO:0005622)|nucleus (GO:0005634)				breast(3)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(10)|lung(8)|pancreas(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	37						TCGCAGCCTTGATCAGCTCGC	0.602																																					GBM(43;676 868 1633 6395 37496)	dbGAP											0													54.0	61.0	59.0					3																	12856719		2147	4253	6400	-	-	-	SO:0001583	missense	0				CCDS43053.1, CCDS54554.1	3p25.2	2008-02-05			ENSG00000144712	ENSG00000144712			30689	protein-coding gene	gene with protein product	"""TBP interacting protein"""	610403				9734811, 10441524	Standard	NM_012298		Approved	TIP120B, KIAA0667, Tp120b	uc003bxk.2	O75155	OTTHUMG00000155397	ENST00000456430.2:c.1086G>C	3.37:g.12856719G>C	ENSP00000387641:p.Leu362Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	B9EGM9|E9KL24	Missense_Mutation	SNP	pfam_TATA-bd_TIP120,pfam_HEAT,superfamily_ARM-type_fold	p.L362F	ENST00000456430.2	37	c.1086	CCDS54554.1	3	.	.	.	.	.	.	.	.	.	.	G	10.96	1.498708	0.26861	.	.	ENSG00000144712	ENST00000295989;ENST00000456430	T;T	0.74002	-0.8;-0.8	4.86	-0.664	0.11406	Armadillo-like helical (1);Armadillo-type fold (1);	0.382752	0.20642	N	0.088390	T	0.80166	0.4573	M	0.73430	2.235	0.43029	D	0.994596	P;D	0.69078	0.599;0.997	B;D	0.78314	0.284;0.991	T	0.76250	-0.3028	10	0.72032	D	0.01	-15.4042	3.4975	0.07661	0.0898:0.4006:0.2732:0.2365	.	362;269	O75155;O75155-2	CAND2_HUMAN;.	F	269;362	ENSP00000295989:L269F;ENSP00000387641:L362F	ENSP00000295989:L269F	L	+	3	2	CAND2	12831719	0.500000	0.26091	0.007000	0.13788	0.347000	0.29111	-0.395000	0.07287	0.084000	0.17077	0.561000	0.74099	TTG	CAND2	-	superfamily_ARM-type_fold	ENSG00000144712		0.602	CAND2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	CAND2	HGNC	protein_coding	OTTHUMT00000339856.4	22	0.00	0	G	XM_371617		12856719	12856719	+1	no_errors	ENST00000456430	ensembl	human	known	69_37n	missense	32	15.79	6	SNP	0.113	C
CAND2	23066	genome.wustl.edu	37	3	12856792	12856792	+	Missense_Mutation	SNP	G	G	C			TCGA-A2-A0CR-01A-11D-A228-09	TCGA-A2-A0CR-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f573c3c3-7b61-4955-8772-215b7cb9a763	3bdb54b4-1e26-4274-a1bd-800416ffbd34	g.chr3:12856792G>C	ENST00000456430.2	+	8	1200	c.1159G>C	c.(1159-1161)Gaa>Caa	p.E387Q	CAND2_ENST00000295989.5_Missense_Mutation_p.E294Q	NM_001162499.1	NP_001155971.1	O75155	CAND2_HUMAN	cullin-associated and neddylation-dissociated 2 (putative)	387					positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	intracellular (GO:0005622)|nucleus (GO:0005634)				breast(3)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(10)|lung(8)|pancreas(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	37						CCGCTTCAAAGAACGCGAGGA	0.617																																					GBM(43;676 868 1633 6395 37496)	dbGAP											0													52.0	58.0	56.0					3																	12856792		2139	4241	6380	-	-	-	SO:0001583	missense	0				CCDS43053.1, CCDS54554.1	3p25.2	2008-02-05			ENSG00000144712	ENSG00000144712			30689	protein-coding gene	gene with protein product	"""TBP interacting protein"""	610403				9734811, 10441524	Standard	NM_012298		Approved	TIP120B, KIAA0667, Tp120b	uc003bxk.2	O75155	OTTHUMG00000155397	ENST00000456430.2:c.1159G>C	3.37:g.12856792G>C	ENSP00000387641:p.Glu387Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	B9EGM9|E9KL24	Missense_Mutation	SNP	pfam_TATA-bd_TIP120,pfam_HEAT,superfamily_ARM-type_fold	p.E387Q	ENST00000456430.2	37	c.1159	CCDS54554.1	3	.	.	.	.	.	.	.	.	.	.	G	20.8	4.051162	0.75960	.	.	ENSG00000144712	ENST00000295989;ENST00000456430	T;T	0.66099	-0.19;-0.19	4.86	4.86	0.63082	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	D	0.84911	0.5577	H	0.95539	3.685	0.80722	D	1	D;D	0.89917	1.0;0.989	D;D	0.87578	0.998;0.979	D	0.89693	0.3899	10	0.87932	D	0	-10.6483	15.4782	0.75501	0.0:0.0:1.0:0.0	.	387;294	O75155;O75155-2	CAND2_HUMAN;.	Q	294;387	ENSP00000295989:E294Q;ENSP00000387641:E387Q	ENSP00000295989:E294Q	E	+	1	0	CAND2	12831792	1.000000	0.71417	0.102000	0.21198	0.553000	0.35397	9.703000	0.98714	2.231000	0.72958	0.561000	0.74099	GAA	CAND2	-	superfamily_ARM-type_fold	ENSG00000144712		0.617	CAND2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	CAND2	HGNC	protein_coding	OTTHUMT00000339856.4	22	0.00	0	G	XM_371617		12856792	12856792	+1	no_errors	ENST00000456430	ensembl	human	known	69_37n	missense	33	13.16	5	SNP	1.000	C
CASZ1	54897	genome.wustl.edu	37	1	10703221	10703221	+	Missense_Mutation	SNP	G	G	A			TCGA-A2-A0CR-01A-11D-A228-09	TCGA-A2-A0CR-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f573c3c3-7b61-4955-8772-215b7cb9a763	3bdb54b4-1e26-4274-a1bd-800416ffbd34	g.chr1:10703221G>A	ENST00000377022.3	-	19	4333	c.4016C>T	c.(4015-4017)tCc>tTc	p.S1339F	RP4-734G22.3_ENST00000606802.1_RNA	NM_001079843.2	NP_001073312.1	Q86V15	CASZ1_HUMAN	castor zinc finger 1	1339					multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(9)|large_intestine(13)|lung(18)|ovary(2)|prostate(5)|skin(2)|urinary_tract(1)	54	Ovarian(185;0.203)|all_lung(157;0.204)	Lung NSC(185;4.96e-06)|all_lung(284;1.22e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00212)|Hepatocellular(190;0.00913)|Ovarian(437;0.0229)|Myeloproliferative disorder(586;0.0255)	STAD - Stomach adenocarcinoma(5;0.0224)	UCEC - Uterine corpus endometrioid carcinoma (279;0.0265)|Colorectal(212;3.54e-08)|COAD - Colon adenocarcinoma(227;9.56e-06)|BRCA - Breast invasive adenocarcinoma(304;0.000219)|Kidney(185;0.00142)|KIRC - Kidney renal clear cell carcinoma(229;0.00381)|READ - Rectum adenocarcinoma(331;0.0419)|STAD - Stomach adenocarcinoma(132;0.0623)		TCTCACCTGGGAGGGGGGCAC	0.662																																						dbGAP											0													35.0	42.0	40.0					1																	10703221		2066	4189	6255	-	-	-	SO:0001583	missense	0			AK000328	CCDS120.2, CCDS41246.1	1p36.22	2013-01-07	2007-02-02		ENSG00000130940	ENSG00000130940		"""Zinc fingers, C2H2-type"""	26002	protein-coding gene	gene with protein product	"""zinc finger protein 693"", ""survival related gene"""	609895	"""castor homolog 1, zinc finger (Drosophila)"""			16631614, 21252912	Standard	NM_001079843		Approved	FLJ20321, ZNF693, castor, cst, SRG	uc001aro.4	Q86V15	OTTHUMG00000002035	ENST00000377022.3:c.4016C>T	1.37:g.10703221G>A	ENSP00000366221:p.Ser1339Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	Q078S9|Q2EN02|Q5T9S1|Q6ZNM8|Q8WX49|Q8WX50|Q9BT16|Q9NXC6	Missense_Mutation	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.S1339F	ENST00000377022.3	37	c.4016	CCDS41246.1	1	.	.	.	.	.	.	.	.	.	.	G	21.2	4.110767	0.77210	.	.	ENSG00000130940	ENST00000377022	.	.	.	4.77	4.77	0.60923	.	0.368595	0.18720	U	0.133037	T	0.50326	0.1609	N	0.24115	0.695	0.80722	D	1	P	0.40875	0.731	B	0.43478	0.421	T	0.54616	-0.8267	9	0.49607	T	0.09	-14.8902	16.0012	0.80294	0.0:0.0:1.0:0.0	.	1339	Q86V15	CASZ1_HUMAN	F	1339	.	ENSP00000366221:S1339F	S	-	2	0	CASZ1	10625808	1.000000	0.71417	0.999000	0.59377	0.983000	0.72400	8.899000	0.92544	2.195000	0.70347	0.561000	0.74099	TCC	CASZ1	-	NULL	ENSG00000130940		0.662	CASZ1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	CASZ1	HGNC	protein_coding	OTTHUMT00000005673.2	13	0.00	0	G	NM_017766		10703221	10703221	-1	no_errors	ENST00000377022	ensembl	human	known	69_37n	missense	21	30.00	9	SNP	1.000	A
CD300LF	146722	genome.wustl.edu	37	17	72700705	72700705	+	Silent	SNP	G	G	C	rs369611278		TCGA-A2-A0CR-01A-11D-A228-09	TCGA-A2-A0CR-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f573c3c3-7b61-4955-8772-215b7cb9a763	3bdb54b4-1e26-4274-a1bd-800416ffbd34	g.chr17:72700705G>C	ENST00000326165.6	-	2	405	c.294C>G	c.(292-294)ctC>ctG	p.L98L	CD300LF_ENST00000464910.1_Silent_p.L101L|RAB37_ENST00000340415.3_Intron|RAB37_ENST00000402449.4_Intron|CD300LF_ENST00000583937.1_Silent_p.L98L|CD300LF_ENST00000469092.1_Silent_p.L101L|CD300LF_ENST00000343125.4_Silent_p.L101L|CD300LF_ENST00000581500.1_Silent_p.L101L|CD300LF_ENST00000361254.4_Silent_p.L101L|CD300LF_ENST00000301573.9_Silent_p.L98L	NM_139018.3	NP_620587.2	Q8TDQ1	CLM1_HUMAN	CD300 molecule-like family member f	98	Ig-like V-type.				immune system process (GO:0002376)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				endometrium(2)|large_intestine(1)|lung(3)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	12						CAGTTTTCATGAGATCCTCCA	0.483																																						dbGAP											0													282.0	237.0	252.0					17																	72700705		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			BC028199	CCDS11704.1, CCDS74148.1, CCDS74149.1, CCDS74150.1, CCDS74151.1, CCDS74152.1	17q25.2	2013-01-11	2006-03-29		ENSG00000186074	ENSG00000186074		"""Immunoglobulin superfamily / V-set domain containing"""	29883	protein-coding gene	gene with protein product		609807	"""CD300 antigen like family member F"""			12975309	Standard	NM_139018		Approved	IREM1, NKIR, IGSF13, CD300f, CLM1	uc002jlg.3	Q8TDQ1	OTTHUMG00000067609	ENST00000326165.6:c.294C>G	17.37:g.72700705G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	B2RCL2|C9JDN3|Q3Y6P0|Q6UX24|Q7Z6A6|Q7Z7I4|Q7Z7I5|Q8N6D0|Q8NAF5	Silent	SNP	pfam_Ig_V-set,smart_Ig_sub,pfscan_Ig-like	p.L98	ENST00000326165.6	37	c.294	CCDS11704.1	17																																																																																			CD300LF	-	pfam_Ig_V-set,smart_Ig_sub,pfscan_Ig-like	ENSG00000186074		0.483	CD300LF-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	CD300LF	HGNC	protein_coding	OTTHUMT00000145085.1	74	0.00	0	G	NM_139018		72700705	72700705	-1	no_errors	ENST00000326165	ensembl	human	known	69_37n	silent	80	14.89	14	SNP	0.550	C
CDC42BPB	9578	genome.wustl.edu	37	14	103405981	103405981	+	Missense_Mutation	SNP	C	C	G			TCGA-A2-A0CR-01A-11D-A228-09	TCGA-A2-A0CR-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f573c3c3-7b61-4955-8772-215b7cb9a763	3bdb54b4-1e26-4274-a1bd-800416ffbd34	g.chr14:103405981C>G	ENST00000361246.2	-	34	5081	c.4793G>C	c.(4792-4794)gGc>gCc	p.G1598A	RP11-365N19.2_ENST00000560931.1_RNA	NM_006035.3	NP_006026.3			CDC42 binding protein kinase beta (DMPK-like)											NS(1)|breast(4)|central_nervous_system(1)|endometrium(6)|kidney(3)|large_intestine(11)|liver(1)|lung(14)|ovary(2)|prostate(2)|skin(3)|stomach(1)	49		Melanoma(154;0.155)		Colorectal(3;0.0129)|READ - Rectum adenocarcinoma(2;0.0419)|Epithelial(152;0.0474)|all cancers(159;0.199)		CATGCCGTCGCCTGGGCCCAT	0.607																																						dbGAP											0													140.0	139.0	139.0					14																	103405981		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF128625	CCDS9978.1	14q32.32	2010-05-12	2001-11-28		ENSG00000198752	ENSG00000198752			1738	protein-coding gene	gene with protein product		614062	"""CDC42-binding protein kinase beta (DMPK-like)"""			10198171	Standard	NM_006035		Approved	MRCKB, KIAA1124	uc001ymi.1	Q9Y5S2		ENST00000361246.2:c.4793G>C	14.37:g.103405981C>G	ENSP00000355237:p.Gly1598Ala	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Citron,pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Myotonic_dystrophy_kinase_coil,pfam_Prot_Kinase_C-like_PE/DAG-bd,pfam_Pkinase_C,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_AGC-kinase_C,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_Pleckstrin_homology,smart_Citron,smart_PAK_box_Rho-bd,prints_DAG/PE-bd,pfscan_PAK_box_Rho-bd,pfscan_Pleckstrin_homology,pfscan_Prot_Kinase_C-like_PE/DAG-bd,pfscan_Prot_kinase_cat_dom	p.G1598A	ENST00000361246.2	37	c.4793	CCDS9978.1	14	.	.	.	.	.	.	.	.	.	.	C	24.6	4.550163	0.86127	.	.	ENSG00000198752	ENST00000361246	T	0.65732	-0.17	4.36	4.36	0.52297	PAK-box/P21-Rho-binding (1);	0.000000	0.85682	D	0.000000	T	0.70710	0.3255	M	0.69248	2.105	0.80722	D	1	P	0.51653	0.947	P	0.51701	0.677	T	0.75099	-0.3437	10	0.52906	T	0.07	.	17.2562	0.87057	0.0:1.0:0.0:0.0	.	1598	Q9Y5S2	MRCKB_HUMAN	A	1598	ENSP00000355237:G1598A	ENSP00000355237:G1598A	G	-	2	0	CDC42BPB	102475734	1.000000	0.71417	0.498000	0.27564	0.982000	0.71751	7.653000	0.83643	2.125000	0.65367	0.655000	0.94253	GGC	CDC42BPB	-	smart_PAK_box_Rho-bd	ENSG00000198752		0.607	CDC42BPB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDC42BPB	HGNC	protein_coding	OTTHUMT00000415711.1	55	0.00	0	C	NM_006035		103405981	103405981	-1	no_errors	ENST00000361246	ensembl	human	known	69_37n	missense	60	17.81	13	SNP	1.000	G
CDC5L	988	genome.wustl.edu	37	6	44371709	44371709	+	Missense_Mutation	SNP	C	C	G			TCGA-A2-A0CR-01A-11D-A228-09	TCGA-A2-A0CR-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f573c3c3-7b61-4955-8772-215b7cb9a763	3bdb54b4-1e26-4274-a1bd-800416ffbd34	g.chr6:44371709C>G	ENST00000371477.3	+	6	1002	c.703C>G	c.(703-705)Ctt>Gtt	p.L235V		NM_001253.3	NP_001244.1	Q99459	CDC5L_HUMAN	cell division cycle 5-like	235	Nuclear localization signal. {ECO:0000255}.				cell cycle (GO:0007049)|mRNA splicing, via spliceosome (GO:0000398)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	catalytic step 2 spliceosome (GO:0071013)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nuclear speck (GO:0016607)|nucleolus (GO:0005730)|nucleus (GO:0005634)|Prp19 complex (GO:0000974)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)|WD40-repeat domain binding (GO:0071987)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(3)|lung(14)|ovary(1)|skin(4)	29	all_lung(25;0.00433)|Ovarian(13;0.0273)|all_hematologic(164;0.208)		Colorectal(64;0.00337)|COAD - Colon adenocarcinoma(64;0.00536)			CTACCAAGCTCTTGACGCAGA	0.388																																						dbGAP											0													68.0	72.0	70.0					6																	44371709		2203	4300	6503	-	-	-	SO:0001583	missense	0			D85423	CCDS4912.1	6p21.1	2013-01-17	2013-01-17		ENSG00000096401	ENSG00000096401			1743	protein-coding gene	gene with protein product		602868	"""CDC5 (cell division cycle 5, S. pombe, homolog)-like"", ""CDC5 cell division cycle 5-like (S. pombe)"""			9598309, 9038199	Standard	NM_001253		Approved	PCDC5RP, hCDC5, CEF1, CDC5	uc003oxl.3	Q99459	OTTHUMG00000014767	ENST00000371477.3:c.703C>G	6.37:g.44371709C>G	ENSP00000360532:p.Leu235Val	Somatic		WXS	Illumina GAIIx	Phase_IV	Q76N46|Q99974	Missense_Mutation	SNP	pfam_DUF3351,pfam_SANT/Myb,superfamily_Homeodomain-like,smart_SANT/Myb,pfscan_Myb-like_dom	p.L235V	ENST00000371477.3	37	c.703	CCDS4912.1	6	.	.	.	.	.	.	.	.	.	.	C	9.822	1.186001	0.21870	.	.	ENSG00000096401	ENST00000371477	T	0.44083	0.93	6.04	5.18	0.71444	.	0.000000	0.85682	D	0.000000	T	0.15003	0.0362	L	0.34521	1.04	0.51012	D	0.999907	B	0.33022	0.394	B	0.30401	0.115	T	0.06499	-1.0823	10	0.26408	T	0.33	-11.2483	9.2235	0.37390	0.0:0.7405:0.0:0.2594	.	235	Q99459	CDC5L_HUMAN	V	235	ENSP00000360532:L235V	ENSP00000360532:L235V	L	+	1	0	CDC5L	44479687	0.969000	0.33509	1.000000	0.80357	0.723000	0.41478	2.312000	0.43726	1.572000	0.49736	0.563000	0.77884	CTT	CDC5L	-	NULL	ENSG00000096401		0.388	CDC5L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDC5L	HGNC	protein_coding	OTTHUMT00000040743.1	26	0.00	0	C			44371709	44371709	+1	no_errors	ENST00000371477	ensembl	human	known	69_37n	missense	26	18.75	6	SNP	0.980	G
CDH1	999	genome.wustl.edu	37	16	68835596	68835596	+	Nonsense_Mutation	SNP	C	C	T	rs587783047		TCGA-A2-A0CR-01A-11D-A228-09	TCGA-A2-A0CR-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f573c3c3-7b61-4955-8772-215b7cb9a763	3bdb54b4-1e26-4274-a1bd-800416ffbd34	g.chr16:68835596C>T	ENST00000261769.5	+	3	378	c.187C>T	c.(187-189)Cga>Tga	p.R63*	CDH1_ENST00000422392.2_Nonsense_Mutation_p.R63*|CDH1_ENST00000562836.1_3'UTR	NM_004360.3	NP_004351.1	P12830	CADH1_HUMAN	cadherin 1, type 1, E-cadherin (epithelial)	63					adherens junction organization (GO:0034332)|apoptotic process (GO:0006915)|calcium-dependent cell-cell adhesion (GO:0016339)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to amino acid stimulus (GO:0071230)|cellular response to indole-3-methanol (GO:0071681)|cellular response to lithium ion (GO:0071285)|cochlea development (GO:0090102)|epithelial cell morphogenesis (GO:0003382)|establishment of protein localization to plasma membrane (GO:0090002)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|homophilic cell adhesion (GO:0007156)|intestinal epithelial cell development (GO:0060576)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell-cell adhesion (GO:0022408)|negative regulation of epithelial cell proliferation (GO:0050680)|neuron projection development (GO:0031175)|pituitary gland development (GO:0021983)|positive regulation of transcription factor import into nucleus (GO:0042993)|positive regulation of transcription, DNA-templated (GO:0045893)|protein homooligomerization (GO:0051260)|protein localization to plasma membrane (GO:0072659)|protein metabolic process (GO:0019538)|regulation of branching involved in salivary gland morphogenesis (GO:0060693)|regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043281)|regulation of immune response (GO:0050776)|regulation of neuron migration (GO:2001222)|regulation of protein localization to cell surface (GO:2000008)|regulation of water loss via skin (GO:0033561)|response to drug (GO:0042493)|response to toxic substance (GO:0009636)|salivary gland cavitation (GO:0060662)|sensory perception of sound (GO:0007605)|single organismal cell-cell adhesion (GO:0016337)|synapse assembly (GO:0007416)|tight junction assembly (GO:0070830)|trophectodermal cell differentiation (GO:0001829)	actin cytoskeleton (GO:0015629)|aggresome (GO:0016235)|apical junction complex (GO:0043296)|apical part of cell (GO:0045177)|axon terminus (GO:0043679)|basolateral plasma membrane (GO:0016323)|catenin complex (GO:0016342)|cell junction (GO:0030054)|cell surface (GO:0009986)|cell-cell adherens junction (GO:0005913)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|endosome (GO:0005768)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|lateral loop (GO:0043219)|lateral plasma membrane (GO:0016328)|node of Ranvier (GO:0033268)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|Schmidt-Lanterman incisure (GO:0043220)|trans-Golgi network (GO:0005802)	ankyrin binding (GO:0030506)|beta-catenin binding (GO:0008013)|calcium ion binding (GO:0005509)|cell adhesion molecule binding (GO:0050839)|gamma-catenin binding (GO:0045295)|glycoprotein binding (GO:0001948)|GTPase activating protein binding (GO:0032794)	p.?(2)|p.R63G(1)|p.R63*(1)		NS(6)|biliary_tract(8)|breast(161)|central_nervous_system(4)|endometrium(9)|kidney(4)|large_intestine(13)|lung(13)|oesophagus(3)|ovary(2)|prostate(3)|soft_tissue(2)|stomach(76)|thyroid(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	311		all_neural(199;0.0189)|Ovarian(137;0.0563)		Epithelial(162;8.44e-05)|all cancers(182;0.000404)|OV - Ovarian serous cystadenocarcinoma(108;0.000426)|BRCA - Breast invasive adenocarcinoma(181;0.0261)		TTGCACCGGTCGACAAAGGAC	0.448			"""Mis, N, F, S"""		"""lobular breast, gastric"""	gastric			Hereditary Diffuse Gastric Cancer																													dbGAP	yes	Rec	yes	Familial gastric carcinoma	16	16q22.1	999	"""cadherin 1, type 1, E-cadherin (epithelial) (ECAD)"""		E	4	Unknown(2)|Substitution - Missense(1)|Substitution - Nonsense(1)	breast(3)|central_nervous_system(1)	GRCh37	CM980317	CDH1	M							164.0	153.0	156.0					16																	68835596		2198	4300	6498	-	-	-	SO:0001587	stop_gained	0	Familial Cancer Database	HDGC	L08599	CCDS10869.1	16q22.1	2014-09-17			ENSG00000039068	ENSG00000039068		"""CD molecules"", ""Cadherins / Major cadherins"""	1748	protein-coding gene	gene with protein product	"""E-Cadherin"""	192090		UVO		9925936	Standard	NM_004360		Approved	uvomorulin, CD324	uc002ewg.1	P12830	OTTHUMG00000137561	ENST00000261769.5:c.187C>T	16.37:g.68835596C>T	ENSP00000261769:p.Arg63*	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K1U7|Q13799|Q14216|Q15855|Q16194|Q4PJ14|Q9UII8	Nonsense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_cytoplasmic-dom,pfam_Cadherin_pro_dom,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.R63*	ENST00000261769.5	37	c.187	CCDS10869.1	16	.	.	.	.	.	.	.	.	.	.	C	28.3	4.910855	0.92178	.	.	ENSG00000039068	ENST00000261769;ENST00000379120;ENST00000268794;ENST00000422392	.	.	.	5.43	4.37	0.52481	.	0.335920	0.20846	N	0.084609	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.05525	T	0.97	.	14.645	0.68754	0.1811:0.8189:0.0:0.0	.	.	.	.	X	63	.	ENSP00000261769:R63X	R	+	1	2	CDH1	67393097	0.000000	0.05858	0.219000	0.23793	0.537000	0.34900	1.123000	0.31308	2.707000	0.92482	0.561000	0.74099	CGA	CDH1	-	pfam_Cadherin_pro_dom,superfamily_Cadherin-like	ENSG00000039068		0.448	CDH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDH1	HGNC	protein_coding	OTTHUMT00000268897.2	31	0.00	0	C	NM_004360		68835596	68835596	+1	no_errors	ENST00000261769	ensembl	human	known	69_37n	nonsense	43	12.24	6	SNP	0.175	T
CELF1	10658	genome.wustl.edu	37	11	47494730	47494730	+	Nonsense_Mutation	SNP	G	G	A			TCGA-A2-A0CR-01A-11D-A228-09	TCGA-A2-A0CR-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f573c3c3-7b61-4955-8772-215b7cb9a763	3bdb54b4-1e26-4274-a1bd-800416ffbd34	g.chr11:47494730G>A	ENST00000358597.3	-	11	1242	c.1243C>T	c.(1243-1245)Cag>Tag	p.Q415*	CELF1_ENST00000395292.2_Nonsense_Mutation_p.Q412*|CELF1_ENST00000532048.1_Nonsense_Mutation_p.Q441*|CELF1_ENST00000361904.3_Nonsense_Mutation_p.Q412*|CELF1_ENST00000310513.5_Nonsense_Mutation_p.Q411*|CELF1_ENST00000531165.1_Nonsense_Mutation_p.Q443*|CELF1_ENST00000539455.1_5'UTR|CELF1_ENST00000395290.2_Nonsense_Mutation_p.Q414*			Q92879	CELF1_HUMAN	CUGBP, Elav-like family member 1	415	RRM 3. {ECO:0000255|PROSITE- ProRule:PRU00176}.				embryo development (GO:0009790)|germ cell development (GO:0007281)|mRNA processing (GO:0006397)|mRNA splice site selection (GO:0006376)|negative regulation of translation (GO:0017148)|positive regulation of multicellular organism growth (GO:0040018)|regulation of RNA splicing (GO:0043484)|RNA interference (GO:0016246)|spermatid development (GO:0007286)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	BRE binding (GO:0042835)|mRNA binding (GO:0003729)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|translation repressor activity, nucleic acid binding (GO:0000900)			central_nervous_system(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(8)|ovary(2)	18						AGCAGGTCCTGATCACCAAAC	0.478																																					Pancreas(163;1949 1966 9906 43218 43785)	dbGAP											0													112.0	98.0	103.0					11																	47494730		2201	4298	6499	-	-	-	SO:0001587	stop_gained	0			U63289	CCDS7938.1, CCDS7939.1, CCDS31482.1, CCDS53622.1, CCDS53623.1	11p11	2013-02-12	2010-02-19	2010-02-19				"""RNA binding motif (RRM) containing"""	2549	protein-coding gene	gene with protein product	"""CUG RNA-binding protein"", ""nuclear polyadenylated RNA-binding protein, 50-kD"", ""bruno-like 2"", ""embryo deadenylation element binding protein"""	601074	"""CUG triplet repeat, RNA-binding protein 1"", ""CUG triplet repeat, RNA binding protein 1"""	CUGBP1		8948631, 9371827	Standard	NM_006560		Approved	CUG-BP, hNab50, BRUNOL2, NAB50, CUGBP, NAPOR, EDEN-BP	uc001nfl.3	Q92879		ENST00000358597.3:c.1243C>T	11.37:g.47494730G>A	ENSP00000351409:p.Gln415*	Somatic		WXS	Illumina GAIIx	Phase_IV	B4E2U5|D3DQS0|F8W940|Q4LE52|Q9NP83|Q9NR06	Nonsense_Mutation	SNP	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	p.Q441*	ENST00000358597.3	37	c.1321	CCDS31482.1	11	.	.	.	.	.	.	.	.	.	.	G	36	5.782912	0.96937	.	.	ENSG00000149187	ENST00000395290;ENST00000358597;ENST00000395292;ENST00000310513;ENST00000361904;ENST00000531165;ENST00000532048	.	.	.	6.07	6.07	0.98685	.	0.053337	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.07813	T	0.8	-7.2311	20.6593	0.99626	0.0:0.0:1.0:0.0	.	.	.	.	X	414;415;412;411;412;443;441	.	ENSP00000308386:Q411X	Q	-	1	0	CELF1	47451306	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	9.869000	0.99810	2.885000	0.99019	0.655000	0.94253	CAG	CELF1	-	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	ENSG00000149187		0.478	CELF1-024	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CELF1	HGNC	protein_coding	OTTHUMT00000398352.1	36	0.00	0	G	NM_006560		47494730	47494730	-1	no_errors	ENST00000532048	ensembl	human	known	69_37n	nonsense	28	17.65	6	SNP	1.000	A
CHD4	1108	genome.wustl.edu	37	12	6701124	6701124	+	Missense_Mutation	SNP	C	C	G			TCGA-A2-A0CR-01A-11D-A228-09	TCGA-A2-A0CR-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f573c3c3-7b61-4955-8772-215b7cb9a763	3bdb54b4-1e26-4274-a1bd-800416ffbd34	g.chr12:6701124C>G	ENST00000357008.2	-	20	3211	c.3048G>C	c.(3046-3048)aaG>aaC	p.K1016N	CHD4_ENST00000309577.6_Missense_Mutation_p.K1016N|CHD4_ENST00000544040.1_Missense_Mutation_p.K1009N|CHD4_ENST00000544484.1_Missense_Mutation_p.K1013N	NM_001273.2	NP_001264.2	Q14839	CHD4_HUMAN	chromodomain helicase DNA binding protein 4	1016					ATP-dependent chromatin remodeling (GO:0043044)|DNA duplex unwinding (GO:0032508)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|spindle assembly (GO:0051225)|transcription, DNA-templated (GO:0006351)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|NuRD complex (GO:0016581)|protein complex (GO:0043234)	ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|DNA binding (GO:0003677)|RNA polymerase II repressing transcription factor binding (GO:0001103)|zinc ion binding (GO:0008270)			central_nervous_system(2)	2						TGCAGCACTTCTTAAGATCCA	0.498																																					Colon(32;586 792 4568 16848 45314)	dbGAP											0													165.0	145.0	152.0					12																	6701124		2203	4300	6503	-	-	-	SO:0001583	missense	0			X86691	CCDS8552.1	12p13	2013-01-28				ENSG00000111642		"""Zinc fingers, PHD-type"""	1919	protein-coding gene	gene with protein product		603277				7575689, 8843877	Standard	XM_006718958		Approved	Mi-2b, Mi2-BETA	uc001qpo.3	Q14839		ENST00000357008.2:c.3048G>C	12.37:g.6701124C>G	ENSP00000349508:p.Lys1016Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8IXZ5	Missense_Mutation	SNP	pfam_CHD_C2,pfam_DUF1086,pfam_SNF2_N,pfam_CHD_N,pfam_DUF1087,pfam_Znf_PHD-finger,pfam_Chromo_domain,pfam_Helicase_C,pfam_HDA_complex_subunit-2/3,pfam_Helicase/UvrB_dom,superfamily_Chromodomain-like,superfamily_Znf_FYVE_PHD,superfamily_HMG_superfamily,superfamily_Homeodomain-like,smart_Znf_PHD,smart_Chromo_domain/shadow,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Znf_PHD-finger,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,pfscan_Chromo_domain/shadow	p.K1016N	ENST00000357008.2	37	c.3048	CCDS8552.1	12	.	.	.	.	.	.	.	.	.	.	C	15.61	2.883151	0.51908	.	.	ENSG00000111642	ENST00000544484;ENST00000544040;ENST00000309577;ENST00000357008;ENST00000537464	T;T;T;T	0.76968	-1.06;-1.06;-1.06;-1.06	4.86	1.75	0.24633	SNF2-related (1);	0.000000	0.85682	D	0.000000	D	0.86037	0.5837	M	0.79123	2.44	0.58432	D	0.999999	D;D;D	0.89917	1.0;1.0;0.999	D;D;D	0.91635	0.997;0.999;0.994	D	0.86337	0.1702	10	0.87932	D	0	.	11.3666	0.49675	0.0:0.7638:0.0:0.2362	.	1016;1016;1009	Q14839-2;Q14839;F5GWX5	.;CHD4_HUMAN;.	N	1013;1009;1016;1016;990	ENSP00000440392:K1013N;ENSP00000440542:K1009N;ENSP00000312419:K1016N;ENSP00000349508:K1016N	ENSP00000312419:K1016N	K	-	3	2	CHD4	6571385	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.402000	0.44521	0.622000	0.30249	0.655000	0.94253	AAG	CHD4	-	pfam_SNF2_N,pfam_HDA_complex_subunit-2/3	ENSG00000111642		0.498	CHD4-202	KNOWN	basic|appris_principal|CCDS	protein_coding	CHD4	HGNC	protein_coding		18	0.00	0	C	NM_001273		6701124	6701124	-1	no_errors	ENST00000309577	ensembl	human	known	69_37n	missense	21	36.36	12	SNP	1.000	G
CHKA	1119	genome.wustl.edu	37	11	67821388	67821388	+	3'UTR	SNP	G	G	A			TCGA-A2-A0CR-01A-11D-A228-09	TCGA-A2-A0CR-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f573c3c3-7b61-4955-8772-215b7cb9a763	3bdb54b4-1e26-4274-a1bd-800416ffbd34	g.chr11:67821388G>A	ENST00000265689.4	-	0	1467				RP11-802E16.3_ENST00000529934.1_RNA|CHKA_ENST00000356135.5_3'UTR|CHKA_ENST00000533728.1_5'UTR|RP11-802E16.3_ENST00000526897.1_RNA|RP11-802E16.3_ENST00000534517.1_RNA	NM_001277.2	NP_001268.2	P35790	CHKA_HUMAN	choline kinase alpha						CDP-choline pathway (GO:0006657)|choline metabolic process (GO:0019695)|glycerophospholipid biosynthetic process (GO:0046474)|lipid metabolic process (GO:0006629)|lipid transport (GO:0006869)|phosphatidylcholine biosynthetic process (GO:0006656)|phosphatidylethanolamine biosynthetic process (GO:0006646)|phospholipid metabolic process (GO:0006644)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	ATP binding (GO:0005524)|choline binding (GO:0033265)|choline kinase activity (GO:0004103)|cholinesterase activity (GO:0004104)|drug binding (GO:0008144)|ethanolamine kinase activity (GO:0004305)|signal transducer activity (GO:0004871)			central_nervous_system(1)|endometrium(1)|large_intestine(4)|lung(5)|ovary(1)|skin(1)	13					Choline(DB00122)	TCGAAGCACAGAGGGGACCCC	0.537																																						dbGAP											0													73.0	71.0	72.0					11																	67821388		692	1591	2283	-	-	-	SO:0001624	3_prime_UTR_variant	0			D10704	CCDS8178.1, CCDS8179.1	11q13.1	2008-02-05	2004-04-19	2004-04-21	ENSG00000110721	ENSG00000110721	2.7.1.32		1937	protein-coding gene	gene with protein product		118491	"""choline kinase"""	CHK		1618328, 15003397	Standard	NM_001277		Approved	CKI	uc001onj.3	P35790	OTTHUMG00000167424	ENST00000265689.4:c.*67C>T	11.37:g.67821388G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q8NE29	RNA	SNP	-	NULL	ENST00000265689.4	37	NULL	CCDS8178.1	11																																																																																			CHKA	-	-	ENSG00000110721		0.537	CHKA-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CHKA	HGNC	protein_coding	OTTHUMT00000394570.1	25	0.00	0	G	NM_001277		67821388	67821388	-1	no_errors	ENST00000533728	ensembl	human	putative	69_37n	rna	23	17.86	5	SNP	0.018	A
CLEC7A	64581	genome.wustl.edu	37	12	10277955	10277955	+	Missense_Mutation	SNP	T	T	G			TCGA-A2-A0CR-01A-11D-A228-09	TCGA-A2-A0CR-10A-01D-A22A-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f573c3c3-7b61-4955-8772-215b7cb9a763	3bdb54b4-1e26-4274-a1bd-800416ffbd34	g.chr12:10277955T>G	ENST00000304084.8	-	4	587	c.433A>C	c.(433-435)Aaa>Caa	p.K145Q	CLEC7A_ENST00000298523.5_Missense_Mutation_p.K99Q|CLEC7A_ENST00000533022.1_Missense_Mutation_p.K145Q|CLEC7A_ENST00000353231.5_Missense_Mutation_p.K99Q|CLEC7A_ENST00000396484.2_Missense_Mutation_p.K66Q	NM_197947.2	NP_922938.1	Q9BXN2	CLC7A_HUMAN	C-type lectin domain family 7, member A	145	C-type lectin. {ECO:0000255|PROSITE- ProRule:PRU00040}.				carbohydrate mediated signaling (GO:0009756)|cell recognition (GO:0008037)|defense response to protozoan (GO:0042832)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|pattern recognition receptor signaling pathway (GO:0002221)|phagocytosis, recognition (GO:0006910)|T cell activation (GO:0042110)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)|MHC protein binding (GO:0042287)|signaling pattern recognition receptor activity (GO:0008329)			central_nervous_system(1)|endometrium(1)|large_intestine(3)|lung(1)|upper_aerodigestive_tract(1)	7						CATTGTCTTTTACTTCCATCC	0.398																																						dbGAP											0													111.0	107.0	108.0					12																	10277955		2203	4300	6503	-	-	-	SO:0001583	missense	0			AY009090	CCDS8613.1, CCDS8614.1, CCDS8617.1, CCDS41753.1, CCDS41754.1, CCDS53744.1	12p13.2-p12.3	2014-09-17		2005-02-09	ENSG00000172243	ENSG00000172243		"""C-type lectin domain containing"""	14558	protein-coding gene	gene with protein product		606264	"""C-type (calcium dependent, carbohydrate-recognition domain) lectin, superfamily member 12"""	CLECSF12			Standard	XM_005253468		Approved	dectin-1, hDectin-1	uc001qxg.2	Q9BXN2	OTTHUMG00000133597	ENST00000304084.8:c.433A>C	12.37:g.10277955T>G	ENSP00000302569:p.Lys145Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R861|B7Z494|B7Z5A9|B7Z5B9|Q6IPS7|Q96D32|Q96DR9|Q96LD3|Q96PA4|Q96PA5|Q96PA6|Q96PA7|Q96PA8|Q9H1K3	Missense_Mutation	SNP	pfam_C-type_lectin,superfamily_C-type_lectin_fold,smart_C-type_lectin,prints_AntifreezeII,pfscan_C-type_lectin	p.K145Q	ENST00000304084.8	37	c.433	CCDS41753.1	12	.	.	.	.	.	.	.	.	.	.	T	12.68	2.011782	0.35511	.	.	ENSG00000172243	ENST00000353231;ENST00000298523;ENST00000396484;ENST00000304084;ENST00000533022	T;T;T;T;T	0.15487	2.42;2.42;2.42;2.42;2.42	4.68	3.51	0.40186	C-type lectin fold (1);C-type lectin-like (1);C-type lectin (3);	0.252075	0.28442	N	0.015328	T	0.24509	0.0594	L	0.35341	1.055	0.19775	N	0.999951	D;D;D;D;D;D;D	0.89917	1.0;1.0;0.999;1.0;1.0;0.995;0.998	D;D;D;D;D;D;D	0.74348	0.983;0.983;0.923;0.983;0.983;0.91;0.916	T	0.06144	-1.0843	10	0.23891	T	0.37	.	8.4546	0.32890	0.0:0.0:0.1973:0.8027	.	99;145;66;145;99;145;99	Q9BXN2-6;Q9BXN2-4;Q9BXN2-5;Q9BXN2-3;Q9BXN2-7;Q9BXN2;Q9BXN2-2	.;.;.;.;.;CLC7A_HUMAN;.	Q	99;99;66;145;145	ENSP00000266456:K99Q;ENSP00000298523:K99Q;ENSP00000379743:K66Q;ENSP00000302569:K145Q;ENSP00000431461:K145Q	ENSP00000298523:K99Q	K	-	1	0	CLEC7A	10169222	0.973000	0.33851	0.137000	0.22149	0.036000	0.12997	3.383000	0.52471	1.078000	0.41014	0.528000	0.53228	AAA	CLEC7A	-	pfam_C-type_lectin,superfamily_C-type_lectin_fold,smart_C-type_lectin,prints_AntifreezeII,pfscan_C-type_lectin	ENSG00000172243		0.398	CLEC7A-013	KNOWN	basic|appris_principal|CCDS	protein_coding	CLEC7A	HGNC	protein_coding	OTTHUMT00000390772.1	22	0.00	0	T	NM_197954		10277955	10277955	-1	no_errors	ENST00000304084	ensembl	human	known	69_37n	missense	30	18.92	7	SNP	0.212	G
CNTRL	11064	genome.wustl.edu	37	9	123912453	123912453	+	Missense_Mutation	SNP	G	G	A			TCGA-A2-A0CR-01A-11D-A228-09	TCGA-A2-A0CR-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f573c3c3-7b61-4955-8772-215b7cb9a763	3bdb54b4-1e26-4274-a1bd-800416ffbd34	g.chr9:123912453G>A	ENST00000373855.1	+	25	3915	c.3655G>A	c.(3655-3657)Gac>Aac	p.D1219N	CNTRL_ENST00000373850.1_Missense_Mutation_p.D667N|CNTRL_ENST00000373847.1_Missense_Mutation_p.D667N|CNTRL_ENST00000238341.5_Missense_Mutation_p.D1219N			Q7Z7A1	CNTRL_HUMAN	centriolin	1219					cell division (GO:0051301)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)				haematopoietic_and_lymphoid_tissue(2)|large_intestine(9)|lung(2)|ovary(4)|skin(3)	20						TGAAGATGCAGACAGTGGAGG	0.418																																						dbGAP											0													112.0	93.0	100.0					9																	123912453		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF513978	CCDS35118.1	9q33.2	2014-02-20	2011-05-23	2011-05-23	ENSG00000119397	ENSG00000119397			1858	protein-coding gene	gene with protein product		605496	"""centrosomal protein 1"", ""centrosomal protein 110kDa"""	CEP1, CEP110		10688839	Standard	XM_005251679		Approved		uc004bkx.1	Q7Z7A1	OTTHUMG00000020581	ENST00000373855.1:c.3655G>A	9.37:g.123912453G>A	ENSP00000362962:p.Asp1219Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	A2A2Y1|B2RP67|Q3MN79|Q5FWF8|Q5JVD0|Q6MZR3|Q6PKC1|Q8TEP3|Q9Y489	Missense_Mutation	SNP	pfam_Leu-rich_rpt,superfamily_Prefoldin,superfamily_tRNA-bd_arm,smart_Leu-rich_rpt_typical-subtyp	p.D1219N	ENST00000373855.1	37	c.3655	CCDS35118.1	9	.	.	.	.	.	.	.	.	.	.	G	17.78	3.473386	0.63737	.	.	ENSG00000119397	ENST00000373855;ENST00000238341;ENST00000454238;ENST00000373851;ENST00000373850;ENST00000373847	T;T;T;T	0.28666	1.6;1.6;1.6;1.6	5.2	5.2	0.72013	.	.	.	.	.	T	0.36635	0.0974	L	0.57536	1.79	0.29143	N	0.878876	P;P	0.51933	0.949;0.915	P;B	0.46543	0.52;0.321	T	0.34925	-0.9809	9	0.56958	D	0.05	.	11.5478	0.50702	0.0916:0.0:0.9084:0.0	.	1219;1219	F5GZN0;Q7Z7A1	.;CNTRL_HUMAN	N	1219;1219;1219;701;667;667	ENSP00000362962:D1219N;ENSP00000238341:D1219N;ENSP00000362956:D667N;ENSP00000362953:D667N	ENSP00000238341:D1219N	D	+	1	0	CNTRL	122952274	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	3.390000	0.52523	2.607000	0.88179	0.655000	0.94253	GAC	CNTRL	-	NULL	ENSG00000119397		0.418	CNTRL-010	KNOWN	basic|appris_principal|CCDS	protein_coding	CNTRL	HGNC	protein_coding	OTTHUMT00000250216.1	35	0.00	0	G	NM_007018		123912453	123912453	+1	no_errors	ENST00000238341	ensembl	human	known	69_37n	missense	19	20.83	5	SNP	0.999	A
COL22A1	169044	genome.wustl.edu	37	8	139712383	139712383	+	Missense_Mutation	SNP	G	G	A			TCGA-A2-A0CR-01A-11D-A228-09	TCGA-A2-A0CR-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f573c3c3-7b61-4955-8772-215b7cb9a763	3bdb54b4-1e26-4274-a1bd-800416ffbd34	g.chr8:139712383G>A	ENST00000303045.6	-	32	3010	c.2564C>T	c.(2563-2565)tCc>tTc	p.S855F	COL22A1_ENST00000435777.1_Missense_Mutation_p.S855F|COL22A1_ENST00000341807.4_5'UTR	NM_152888.1	NP_690848.1	Q8NFW1	COMA1_HUMAN	collagen, type XXII, alpha 1	855	Gly-rich.|Pro-rich.				extracellular matrix organization (GO:0030198)	collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)				breast(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(14)|large_intestine(29)|lung(107)|ovary(13)|pancreas(1)|prostate(3)|skin(12)|upper_aerodigestive_tract(15)|urinary_tract(4)	211	all_epithelial(106;1.55e-12)|Lung NSC(106;1.67e-05)|all_lung(105;3.39e-05)|Ovarian(258;0.00672)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0517)			TGTGAACAGGGATGTCTGAAA	0.512										HNSCC(7;0.00092)																												dbGAP											0													92.0	83.0	86.0					8																	139712383		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF406780	CCDS6376.1	8q24.3	2013-01-16			ENSG00000169436	ENSG00000169436		"""Collagens"""	22989	protein-coding gene	gene with protein product		610026					Standard	NM_152888		Approved		uc003yvd.3	Q8NFW1	OTTHUMG00000150035	ENST00000303045.6:c.2564C>T	8.37:g.139712383G>A	ENSP00000303153:p.Ser855Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	B7ZMH0|C9K0G4|Q8IVT9	Missense_Mutation	SNP	pfam_Collagen,pfam_VWF_A,superfamily_ConA-like_lec_gl,smart_VWF_A,smart_Laminin_G,pfscan_VWF_A	p.S855F	ENST00000303045.6	37	c.2564	CCDS6376.1	8	.	.	.	.	.	.	.	.	.	.	G	14.71	2.615481	0.46631	.	.	ENSG00000169436	ENST00000303045;ENST00000435777;ENST00000545577	D;D	0.93426	-3.22;-3.22	4.15	4.15	0.48705	.	0.656368	0.13275	U	0.400186	D	0.94503	0.8230	L	0.39898	1.24	0.25953	N	0.98273	P;D	0.71674	0.828;0.998	P;D	0.79784	0.653;0.993	D	0.87618	0.2508	10	0.72032	D	0.01	.	12.2343	0.54505	0.0:0.0:1.0:0.0	.	855;855	Q8NFW1-2;Q8NFW1	.;COMA1_HUMAN	F	855;855;568	ENSP00000303153:S855F;ENSP00000387655:S855F	ENSP00000303153:S855F	S	-	2	0	COL22A1	139781565	0.315000	0.24571	0.892000	0.35008	0.934000	0.57294	4.073000	0.57570	2.589000	0.87451	0.563000	0.77884	TCC	COL22A1	-	NULL	ENSG00000169436		0.512	COL22A1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	COL22A1	HGNC	protein_coding	OTTHUMT00000315905.2	22	0.00	0	G	XM_291257		139712383	139712383	-1	no_errors	ENST00000303045	ensembl	human	known	69_37n	missense	27	22.86	8	SNP	0.902	A
COL6A1	1291	genome.wustl.edu	37	21	47412129	47412129	+	Missense_Mutation	SNP	G	G	C			TCGA-A2-A0CR-01A-11D-A228-09	TCGA-A2-A0CR-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f573c3c3-7b61-4955-8772-215b7cb9a763	3bdb54b4-1e26-4274-a1bd-800416ffbd34	g.chr21:47412129G>C	ENST00000361866.3	+	17	1348	c.1234G>C	c.(1234-1236)Gag>Cag	p.E412Q		NM_001848.2	NP_001839.2	P12109	CO6A1_HUMAN	collagen, type VI, alpha 1	412	Triple-helical region.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|cellular response to amino acid stimulus (GO:0071230)|collagen catabolic process (GO:0030574)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|osteoblast differentiation (GO:0001649)|protein heterotrimerization (GO:0070208)	collagen type VI trimer (GO:0005589)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|protein complex (GO:0043234)|proteinaceous extracellular matrix (GO:0005578)|sarcolemma (GO:0042383)	platelet-derived growth factor binding (GO:0048407)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|lung(18)|ovary(1)|prostate(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	33	all_hematologic(128;0.24)			Colorectal(79;0.0265)|READ - Rectum adenocarcinoma(84;0.0649)		GGCGGGCGACGAGGTGAGTGA	0.627																																						dbGAP											0													55.0	62.0	59.0					21																	47412129		2199	4300	6499	-	-	-	SO:0001583	missense	0			M20776	CCDS13727.1	21q22.3	2014-09-17			ENSG00000142156	ENSG00000142156		"""Collagens"""	2211	protein-coding gene	gene with protein product		120220					Standard	XM_006723964		Approved		uc002zhu.1	P12109	OTTHUMG00000090440	ENST00000361866.3:c.1234G>C	21.37:g.47412129G>C	ENSP00000355180:p.Glu412Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	O00117|O00118|Q14040|Q14041|Q16258|Q7Z645|Q9BSA8	Missense_Mutation	SNP	pfam_VWF_A,pfam_Collagen,smart_VWF_A,pfscan_VWF_A	p.E412Q	ENST00000361866.3	37	c.1234	CCDS13727.1	21	.	.	.	.	.	.	.	.	.	.	G	13.53	2.264982	0.40095	.	.	ENSG00000142156	ENST00000361866;ENST00000538397	D	0.93366	-3.21	4.7	4.7	0.59300	.	0.065418	0.64402	D	0.000012	D	0.90584	0.7048	N	0.03238	-0.38	0.58432	D	0.999996	D	0.76494	0.999	D	0.74023	0.982	D	0.88937	0.3377	10	0.15952	T	0.53	-29.2493	16.2255	0.82286	0.0:0.0:1.0:0.0	.	412	P12109	CO6A1_HUMAN	Q	412	ENSP00000355180:E412Q	ENSP00000355180:E412Q	E	+	1	0	COL6A1	46236557	1.000000	0.71417	0.993000	0.49108	0.138000	0.21146	7.123000	0.77176	2.162000	0.67917	0.467000	0.42956	GAG	COL6A1	-	pfam_Collagen	ENSG00000142156		0.627	COL6A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL6A1	HGNC	protein_coding	OTTHUMT00000206877.1	43	0.00	0	G	NM_001848		47412129	47412129	+1	no_errors	ENST00000361866	ensembl	human	known	69_37n	missense	71	10.13	8	SNP	1.000	C
CRLF3	51379	genome.wustl.edu	37	17	29130962	29130962	+	Silent	SNP	G	G	C			TCGA-A2-A0CR-01A-11D-A228-09	TCGA-A2-A0CR-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f573c3c3-7b61-4955-8772-215b7cb9a763	3bdb54b4-1e26-4274-a1bd-800416ffbd34	g.chr17:29130962G>C	ENST00000324238.6	-	2	418	c.294C>G	c.(292-294)ctC>ctG	p.L98L	CRLF3_ENST00000577725.1_5'Flank|CRLF3_ENST00000544695.1_Intron	NM_015986.3	NP_057070.3	Q8IUI8	CRLF3_HUMAN	cytokine receptor-like factor 3	98					G1/S transition of mitotic cell cycle (GO:0000082)|negative regulation of cell growth (GO:0030308)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of JAK-STAT cascade (GO:0046427)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)	cytoplasm (GO:0005737)				endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(7)|prostate(1)|upper_aerodigestive_tract(1)	17		all_hematologic(16;0.014)|Acute lymphoblastic leukemia(14;0.0236)|Myeloproliferative disorder(56;0.0255)				CGTGTTCTATGAGCTTCTGGC	0.502																																					Pancreas(30;346 881 29244 33464 41299)	dbGAP											0													189.0	174.0	179.0					17																	29130962		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF120151	CCDS32607.1	17q11.2	2008-05-02				ENSG00000176390			17177	protein-coding gene	gene with protein product		614853					Standard	NM_015986		Approved	CREME9, CYTOR4	uc002hfr.4	Q8IUI8		ENST00000324238.6:c.294C>G	17.37:g.29130962G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	A6NJF3|B2R8C3|Q2MLY7|Q9UNI3|Q9Y6M8	Silent	SNP	superfamily_Fibronectin_type3,pfscan_Fibronectin_type3	p.L98	ENST00000324238.6	37	c.294	CCDS32607.1	17																																																																																			CRLF3	-	NULL	ENSG00000176390		0.502	CRLF3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CRLF3	HGNC	protein_coding	OTTHUMT00000444354.1	70	0.00	0	G			29130962	29130962	-1	no_errors	ENST00000324238	ensembl	human	known	69_37n	silent	64	13.51	10	SNP	1.000	C
DNAJC14	85406	genome.wustl.edu	37	12	56221820	56221820	+	Missense_Mutation	SNP	C	C	A			TCGA-A2-A0CR-01A-11D-A228-09	TCGA-A2-A0CR-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f573c3c3-7b61-4955-8772-215b7cb9a763	3bdb54b4-1e26-4274-a1bd-800416ffbd34	g.chr12:56221820C>A	ENST00000357606.3	-	3	912	c.623G>T	c.(622-624)cGg>cTg	p.R208L	TMEM198B_ENST00000478241.1_RNA|DNAJC14_ENST00000317287.5_Missense_Mutation_p.R208L|RP11-762I7.5_ENST00000546837.1_5'Flank|DNAJC14_ENST00000317269.3_Missense_Mutation_p.R208L			Q6Y2X3	DJC14_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 14	208					protein transport (GO:0015031)	endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)				breast(2)|kidney(1)|large_intestine(8)|lung(7)|ovary(3)|prostate(1)|skin(1)	23						TCCACCCTCCCGAGTATCCTC	0.587																																						dbGAP											0													59.0	56.0	57.0					12																	56221820		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF141342	CCDS8894.1	12q12	2011-09-02				ENSG00000135392		"""Heat shock proteins / DNAJ (HSP40)"""	24581	protein-coding gene	gene with protein product		606092				11331877, 11984006	Standard	NM_032364		Approved	DNAJ, DRIP78, HDJ3, LIP6, FLJ32792	uc001shu.2	Q6Y2X3		ENST00000357606.3:c.623G>T	12.37:g.56221820C>A	ENSP00000350223:p.Arg208Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	A5YM67|Q17RY2|Q66K17|Q96N59|Q96T63	Missense_Mutation	SNP	pfam_DnaJ_N,superfamily_DnaJ_N,smart_DnaJ_N,pfscan_DnaJ_N,prints_Hsp_DnaJ	p.R208L	ENST00000357606.3	37	c.623	CCDS8894.1	12	.	.	.	.	.	.	.	.	.	.	C	11.12	1.544915	0.27652	.	.	ENSG00000135392	ENST00000357606;ENST00000317269;ENST00000317287	T;T;T	0.38077	1.16;1.16;1.16	5.2	4.3	0.51218	.	0.245753	0.34338	N	0.004051	T	0.21468	0.0517	L	0.27053	0.805	0.32895	D	0.512343	P;P	0.43024	0.798;0.649	B;B	0.35073	0.195;0.149	T	0.27571	-1.0070	9	.	.	.	-6.4488	9.9709	0.41754	0.0:0.9054:0.0:0.0946	.	208;208	Q6Y2X3;A8K5A7	DJC14_HUMAN;.	L	208	ENSP00000350223:R208L;ENSP00000316240:R208L;ENSP00000317500:R208L	.	R	-	2	0	DNAJC14	54508087	0.953000	0.32496	0.994000	0.49952	0.104000	0.19210	1.081000	0.30791	1.325000	0.45301	0.650000	0.86243	CGG	DNAJC14	-	NULL	ENSG00000135392		0.587	DNAJC14-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	DNAJC14	HGNC	protein_coding	OTTHUMT00000409095.1	26	0.00	0	C	NM_032364		56221820	56221820	-1	no_errors	ENST00000317269	ensembl	human	known	69_37n	missense	30	16.67	6	SNP	0.985	A
DYNC1I1	1780	genome.wustl.edu	37	7	95661999	95661999	+	Missense_Mutation	SNP	T	T	A			TCGA-A2-A0CR-01A-11D-A228-09	TCGA-A2-A0CR-10A-01D-A22A-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f573c3c3-7b61-4955-8772-215b7cb9a763	3bdb54b4-1e26-4274-a1bd-800416ffbd34	g.chr7:95661999T>A	ENST00000324972.6	+	12	1381	c.1188T>A	c.(1186-1188)aaT>aaA	p.N396K	DYNC1I1_ENST00000447467.2_Missense_Mutation_p.N379K|DYNC1I1_ENST00000437599.1_Missense_Mutation_p.N376K|DYNC1I1_ENST00000457059.1_Missense_Mutation_p.N379K|DYNC1I1_ENST00000497626.1_3'UTR|DYNC1I1_ENST00000359388.4_Missense_Mutation_p.N359K|DYNC1I1_ENST00000537881.1_Missense_Mutation_p.N359K	NM_004411.4	NP_004402.1	O14576	DC1I1_HUMAN	dynein, cytoplasmic 1, intermediate chain 1	396					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|metabolic process (GO:0008152)|vesicle transport along microtubule (GO:0047496)	cytoplasmic dynein complex (GO:0005868)|cytoplasmic ribonucleoprotein granule (GO:0036464)|cytosol (GO:0005829)|kinetochore (GO:0000776)|microtubule (GO:0005874)|perinuclear region of cytoplasm (GO:0048471)|spindle pole (GO:0000922)|vesicle (GO:0031982)	microtubule binding (GO:0008017)|microtubule motor activity (GO:0003777)|motor activity (GO:0003774)|spectrin binding (GO:0030507)			NS(2)|autonomic_ganglia(1)|breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(10)|lung(27)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	54	all_cancers(62;9.39e-10)|all_epithelial(64;2.28e-09)|Lung NSC(181;0.165)|all_lung(186;0.191)		STAD - Stomach adenocarcinoma(171;0.0957)			ACTGTGTAAATGTTGTTGGGA	0.443																																						dbGAP											0													277.0	229.0	246.0					7																	95661999		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF063228	CCDS5644.1, CCDS47645.1, CCDS47646.1, CCDS64718.1	7q21.3-q22.1	2013-01-18	2005-11-24	2005-11-24	ENSG00000158560	ENSG00000158560		"""Cytoplasmic dyneins"", ""WD repeat domain containing"""	2963	protein-coding gene	gene with protein product		603772	"""dynein, cytoplasmic, intermediate polypeptide 1"""	DNCI1		10049579, 16260502	Standard	NM_004411		Approved	DNCIC1	uc003uoc.4	O14576	OTTHUMG00000153983	ENST00000324972.6:c.1188T>A	7.37:g.95661999T>A	ENSP00000320130:p.Asn396Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DME3|F5H050|G5E9K1|Q8TBF7|Q9Y2X1	Missense_Mutation	SNP	pfam_Dynein_IC_1/2,pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat_dom	p.N396K	ENST00000324972.6	37	c.1188	CCDS5644.1	7	.	.	.	.	.	.	.	.	.	.	T	12.04	1.817684	0.32145	.	.	ENSG00000158560	ENST00000447467;ENST00000324972;ENST00000537881;ENST00000437599;ENST00000359388;ENST00000457059	T;T;T;T;T;T	0.05717	3.4;3.4;3.4;3.4;3.4;3.4	4.47	3.28	0.37604	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.03651	0.0104	N	0.16903	0.455	0.54753	D	0.999989	B;B;B;B;B	0.17852	0.008;0.014;0.014;0.024;0.007	B;B;B;B;B	0.21708	0.016;0.036;0.036;0.016;0.01	T	0.27123	-1.0083	10	0.02654	T	1	-10.0118	10.8664	0.46858	0.0:0.0763:0.0:0.9237	.	379;376;379;396;359	Q7Z6M0;G5E9K1;O14576-2;O14576;O14576-3	.;.;.;DC1I1_HUMAN;.	K	379;396;359;376;359;379	ENSP00000392337:N379K;ENSP00000320130:N396K;ENSP00000438377:N359K;ENSP00000398118:N376K;ENSP00000352348:N359K;ENSP00000412444:N379K	ENSP00000320130:N396K	N	+	3	2	DYNC1I1	95499935	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	2.680000	0.46918	1.009000	0.39289	0.459000	0.35465	AAT	DYNC1I1	-	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat_dom	ENSG00000158560		0.443	DYNC1I1-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	DYNC1I1	HGNC	protein_coding	OTTHUMT00000333432.1	67	0.00	0	T	NM_004411		95661999	95661999	+1	no_errors	ENST00000324972	ensembl	human	known	69_37n	missense	81	13.83	13	SNP	1.000	A
EIF3A	8661	genome.wustl.edu	37	10	120810767	120810767	+	Missense_Mutation	SNP	C	C	T			TCGA-A2-A0CR-01A-11D-A228-09	TCGA-A2-A0CR-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f573c3c3-7b61-4955-8772-215b7cb9a763	3bdb54b4-1e26-4274-a1bd-800416ffbd34	g.chr10:120810767C>T	ENST00000369144.3	-	15	2390	c.2263G>A	c.(2263-2265)Gaa>Aaa	p.E755K	EIF3A_ENST00000541549.1_Missense_Mutation_p.E721K	NM_003750.2	NP_003741.1	P56537	IF6_HUMAN	eukaryotic translation initiation factor 3, subunit A	0					mature ribosome assembly (GO:0042256)|ribosomal large subunit biogenesis (GO:0042273)|ribosomal subunit export from nucleus (GO:0000054)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|lamin filament (GO:0005638)|nucleus (GO:0005634)	ribosomal large subunit binding (GO:0043023)|ribosome binding (GO:0043022)|translation initiation factor activity (GO:0003743)			endometrium(8)|kidney(4)|large_intestine(14)|lung(22)|prostate(1)|skin(4)|urinary_tract(3)	56		Lung NSC(174;0.094)|all_lung(145;0.123)		all cancers(201;0.0236)		TCTCTGTCTTCAAGCATTCGT	0.383																																						dbGAP											0													158.0	142.0	147.0					10																	120810767		2203	4300	6503	-	-	-	SO:0001583	missense	0			U78311	CCDS7608.1	10q26.11	2007-08-03	2007-07-27	2007-07-27	ENSG00000107581	ENSG00000107581			3271	protein-coding gene	gene with protein product		602039	"""eukaryotic translation initiation factor 3, subunit 10 theta, 150/170kDa"""	EIF3, EIF3S10		9054404, 8590280	Standard	NM_003750		Approved	eIF3-theta, eIF3-p170, KIAA0139, eIF3a, TIF32	uc001ldu.3	Q14152	OTTHUMG00000019144	ENST00000369144.3:c.2263G>A	10.37:g.120810767C>T	ENSP00000358140:p.Glu755Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	B7ZBG9|Q6IBN8|Q96TD5	Missense_Mutation	SNP	pfam_PCI_dom,smart_PCI_dom	p.E755K	ENST00000369144.3	37	c.2263	CCDS7608.1	10	.	.	.	.	.	.	.	.	.	.	C	17.48	3.399228	0.62177	.	.	ENSG00000107581	ENST00000369144;ENST00000541549	T;T	0.52526	0.66;0.66	5.36	5.36	0.76844	.	0.000000	0.37136	U	0.002239	T	0.41558	0.1164	L	0.47716	1.5	0.80722	D	1	P	0.37525	0.598	B	0.34824	0.19	T	0.27054	-1.0085	10	0.12103	T	0.63	-26.8606	19.1466	0.93471	0.0:1.0:0.0:0.0	.	755	Q14152	EIF3A_HUMAN	K	755;721	ENSP00000358140:E755K;ENSP00000438178:E721K	ENSP00000358140:E755K	E	-	1	0	EIF3A	120800757	1.000000	0.71417	1.000000	0.80357	0.965000	0.64279	7.423000	0.80229	2.523000	0.85059	0.405000	0.27470	GAA	EIF3A	-	NULL	ENSG00000107581		0.383	EIF3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EIF3A	HGNC	protein_coding	OTTHUMT00000050634.1	29	0.00	0	C	NM_003750		120810767	120810767	-1	no_errors	ENST00000369144	ensembl	human	known	69_37n	missense	32	11.11	4	SNP	1.000	T
EMR2	30817	genome.wustl.edu	37	19	14875317	14875317	+	Missense_Mutation	SNP	C	C	T			TCGA-A2-A0CR-01A-11D-A228-09	TCGA-A2-A0CR-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f573c3c3-7b61-4955-8772-215b7cb9a763	3bdb54b4-1e26-4274-a1bd-800416ffbd34	g.chr19:14875317C>T	ENST00000315576.3	-	11	1463	c.1012G>A	c.(1012-1014)Gag>Aag	p.E338K	EMR2_ENST00000346057.1_Missense_Mutation_p.E289K|EMR2_ENST00000392965.3_Missense_Mutation_p.E338K|EMR2_ENST00000596991.2_Missense_Mutation_p.E338K|EMR2_ENST00000594294.1_Missense_Mutation_p.E289K|EMR2_ENST00000353005.1_Missense_Mutation_p.E196K|EMR2_ENST00000392967.2_Missense_Mutation_p.E338K|EMR2_ENST00000595839.1_Missense_Mutation_p.E196K|EMR2_ENST00000594076.1_Missense_Mutation_p.E245K|EMR2_ENST00000601345.1_Missense_Mutation_p.E338K|EMR2_ENST00000392964.3_Missense_Mutation_p.E77K|EMR2_ENST00000353876.1_Missense_Mutation_p.E245K	NM_013447.3	NP_038475.2	Q9UHX3	EMR2_HUMAN	egf-like module containing, mucin-like, hormone receptor-like 2	338					cell adhesion (GO:0007155)|cell migration (GO:0016477)|G-protein coupled receptor signaling pathway (GO:0007186)|granulocyte chemotaxis (GO:0071621)|inflammatory response (GO:0006954)|neuropeptide signaling pathway (GO:0007218)	cell projection (GO:0042995)|integral component of membrane (GO:0016021)|leading edge membrane (GO:0031256)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|chondroitin sulfate binding (GO:0035374)|G-protein coupled receptor activity (GO:0004930)			breast(1)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(8)|lung(19)|ovary(1)|prostate(2)|skin(6)|upper_aerodigestive_tract(1)	48						AGGACATCCTCTAGGCCATCC	0.607																																						dbGAP											0													63.0	57.0	59.0					19																	14875317		2203	4299	6502	-	-	-	SO:0001583	missense	0			AF114491	CCDS32935.1, CCDS59361.1	19p13.1	2014-08-08	2003-11-26			ENSG00000127507		"""CD molecules"", ""-"", ""GPCR / Class B : Orphans"""	3337	protein-coding gene	gene with protein product		606100	"""egf-like module containing, mucin-like, hormone receptor-like sequence 2"""				Standard	NM_013447		Approved	CD312	uc002mzp.2	Q9UHX3		ENST00000315576.3:c.1012G>A	19.37:g.14875317C>T	ENSP00000319883:p.Glu338Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DQ96|E7ESD7|E9PBR1|E9PEL6|E9PFQ5|E9PG91|Q8NG96|Q9Y4B1	Missense_Mutation	SNP	pfam_GPCR_2_secretin-like,pfam_EGF-like_Ca-bd,pfam_GPS_dom,pfam_EGF-like_dom,smart_EGF-like,smart_EGF-like_Ca-bd,smart_GPS_dom,prints_GPCR_2_CD97,prints_GPCR_2_EMR1_rcpt,prints_GPCR_2_secretin-like,pfscan_EG-like_dom,pfscan_GPS_dom,pfscan_GPCR_2-like	p.E338K	ENST00000315576.3	37	c.1012	CCDS32935.1	19	.	.	.	.	.	.	.	.	.	.	C	17.87	3.495139	0.64186	.	.	ENSG00000127507	ENST00000315576;ENST00000392967;ENST00000346057;ENST00000353876;ENST00000353005;ENST00000392965;ENST00000392964;ENST00000392962	T;T;T;T;T;D;T;D	0.81739	-1.11;-1.27;-0.66;0.13;0.83;-1.53;0.77;-1.53	3.77	3.77	0.43336	.	.	.	.	.	D	0.88976	0.6584	M	0.82323	2.585	0.80722	D	1	D;D;D;D;D;D;P;D	0.89917	0.958;0.998;0.999;1.0;0.988;0.989;0.803;0.985	P;D;D;D;P;P;B;D	0.79784	0.471;0.985;0.972;0.993;0.891;0.829;0.397;0.918	D	0.90238	0.4284	9	0.87932	D	0	.	11.8635	0.52480	0.0:1.0:0.0:0.0	.	338;245;338;196;289;338;338;338	E7ESD7;Q9UHX3-4;A0JNV7;Q9UHX3-5;Q9UHX3-3;A8K6W1;Q9UHX3;Q9UHX3-2	.;.;.;.;.;.;EMR2_HUMAN;.	K	338;338;289;245;196;338;77;289	ENSP00000319883:E338K;ENSP00000376694:E338K;ENSP00000263380:E289K;ENSP00000319454:E245K;ENSP00000319838:E196K;ENSP00000376692:E338K;ENSP00000376691:E77K;ENSP00000376689:E289K	ENSP00000319883:E338K	E	-	1	0	EMR2	14736317	0.105000	0.21958	0.069000	0.20011	0.016000	0.09150	2.485000	0.45250	2.050000	0.60909	0.508000	0.49915	GAG	EMR2	-	prints_GPCR_2_CD97	ENSG00000127507		0.607	EMR2-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	EMR2	HGNC	protein_coding	OTTHUMT00000466502.2	34	0.00	0	C			14875317	14875317	-1	no_errors	ENST00000315576	ensembl	human	known	69_37n	missense	42	12.50	6	SNP	0.355	T
EPC1	80314	genome.wustl.edu	37	10	32561961	32561961	+	Missense_Mutation	SNP	C	C	A			TCGA-A2-A0CR-01A-11D-A228-09	TCGA-A2-A0CR-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f573c3c3-7b61-4955-8772-215b7cb9a763	3bdb54b4-1e26-4274-a1bd-800416ffbd34	g.chr10:32561961C>A	ENST00000263062.8	-	12	2182	c.1913G>T	c.(1912-1914)gGt>gTt	p.G638V	EPC1_ENST00000319778.6_Intron|EPC1_ENST00000375110.2_Intron	NM_025209.2	NP_079485.1	Q9H2F5	EPC1_HUMAN	enhancer of polycomb homolog 1 (Drosophila)	638					chromatin organization (GO:0006325)|histone H2A acetylation (GO:0043968)|histone H4 acetylation (GO:0043967)|negative regulation of gene expression, epigenetic (GO:0045814)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of growth (GO:0040008)|transcription, DNA-templated (GO:0006351)	NuA4 histone acetyltransferase complex (GO:0035267)|nuclear membrane (GO:0031965)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|Piccolo NuA4 histone acetyltransferase complex (GO:0032777)				breast(2)|central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(3)|lung(8)|ovary(5)|urinary_tract(1)	24		Prostate(175;0.0199)				TCTTTCTAAACCCTGTATATT	0.393																																						dbGAP											0													146.0	138.0	141.0					10																	32561961		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF277374	CCDS7172.1, CCDS60511.1, CCDS73083.1	10p11	2005-12-12			ENSG00000120616	ENSG00000120616			19876	protein-coding gene	gene with protein product		610999				10976108	Standard	NM_025209		Approved	Epl1	uc001iwg.2	Q9H2F5	OTTHUMG00000017925	ENST00000263062.8:c.1913G>T	10.37:g.32561961C>A	ENSP00000263062:p.Gly638Val	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DSC3|D3DRX7|Q5VW54|Q5VW56|Q5VW58|Q8NAQ4|Q8NE21|Q96LF4|Q96RR6|Q9H7T7	Missense_Mutation	SNP	pfam_Enhancer_polycomb_C,pfam_Enhancer_polycomb-like_N	p.G638V	ENST00000263062.8	37	c.1913	CCDS7172.1	10	.	.	.	.	.	.	.	.	.	.	C	10.20	1.285360	0.23478	.	.	ENSG00000120616	ENST00000263062	.	.	.	5.86	4.95	0.65309	.	0.080321	0.49916	D	0.000131	T	0.40222	0.1108	N	0.08118	0	0.40545	D	0.981065	B	0.13594	0.008	B	0.20955	0.032	T	0.31586	-0.9938	9	0.56958	D	0.05	-14.1273	14.6664	0.68910	0.1456:0.8544:0.0:0.0	.	638	Q9H2F5	EPC1_HUMAN	V	638	.	ENSP00000263062:G638V	G	-	2	0	EPC1	32601967	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	4.719000	0.61937	1.457000	0.47850	0.585000	0.79938	GGT	EPC1	-	pfam_Enhancer_polycomb_C	ENSG00000120616		0.393	EPC1-004	KNOWN	basic|CCDS	protein_coding	EPC1	HGNC	protein_coding	OTTHUMT00000047484.1	62	0.00	0	C			32561961	32561961	-1	no_errors	ENST00000263062	ensembl	human	known	69_37n	missense	69	11.54	9	SNP	1.000	A
FAM21C	253725	genome.wustl.edu	37	10	46238914	46238914	+	Missense_Mutation	SNP	G	G	A			TCGA-A2-A0CR-01A-11D-A228-09	TCGA-A2-A0CR-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f573c3c3-7b61-4955-8772-215b7cb9a763	3bdb54b4-1e26-4274-a1bd-800416ffbd34	g.chr10:46238914G>A	ENST00000336378.4	+	6	723	c.605G>A	c.(604-606)gGa>gAa	p.G202E	FAM21C_ENST00000540872.1_Missense_Mutation_p.G202E|FAM21C_ENST00000374362.2_Missense_Mutation_p.G202E|FAM21C_ENST00000537517.1_Missense_Mutation_p.G202E|FAM21C_ENST00000359860.4_Missense_Mutation_p.G146E	NM_015262.2	NP_056077.2	Q9Y4E1	FA21C_HUMAN	family with sequence similarity 21, member C	202	Glu-rich.				retrograde transport, endosome to Golgi (GO:0042147)	early endosome (GO:0005769)|endosome (GO:0005768)|plasma membrane (GO:0005886)|WASH complex (GO:0071203)				central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(6)|lung(8)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	28						GTAGGTCTTGGAGAGCTGTCC	0.318																																						dbGAP											0													81.0	79.0	80.0					10																	46238914		1790	4063	5853	-	-	-	SO:0001583	missense	0				CCDS44374.1, CCDS44374.2, CCDS53528.1, CCDS53529.1	10q11.22	2014-05-09			ENSG00000172661	ENSG00000172661			23414	protein-coding gene	gene with protein product		613631				20498093	Standard	NM_015262		Approved	Em:AC012044.3, KIAA0592	uc001jcu.3	Q9Y4E1	OTTHUMG00000018089	ENST00000336378.4:c.605G>A	10.37:g.46238914G>A	ENSP00000337541:p.Gly202Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DZQ6|B9EK53|F5H0J6|F5H871|Q5SQU4|Q5SQU5|Q7L521|Q9UG79	Missense_Mutation	SNP	NULL	p.G202E	ENST00000336378.4	37	c.605		10	.	.	.	.	.	.	.	.	.	.	G	17.91	3.504265	0.64410	.	.	ENSG00000172661	ENST00000336378;ENST00000540872;ENST00000537517;ENST00000374362;ENST00000399588;ENST00000359860;ENST00000420848;ENST00000436993	.	.	.	3.69	3.69	0.42338	.	0.000000	0.85682	D	0.000000	T	0.76926	0.4056	M	0.73598	2.24	0.58432	D	0.999999	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;1.0;1.0;1.0	T	0.79308	-0.1857	9	0.54805	T	0.06	-18.714	13.2917	0.60274	0.0:0.0:1.0:0.0	.	202;202;202;147	F5H871;Q9Y4E1-4;Q9Y4E1;Q9Y4E1-3	.;.;FA21C_HUMAN;.	E	202;202;202;202;202;146;147;114	.	ENSP00000337541:G202E	G	+	2	0	FAM21C	45558920	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	8.951000	0.93025	2.052000	0.61016	0.557000	0.71058	GGA	FAM21C	-	NULL	ENSG00000172661		0.318	FAM21C-201	KNOWN	basic|appris_candidate	protein_coding	FAM21C	HGNC	protein_coding		205	0.00	0	G			46238914	46238914	+1	no_errors	ENST00000374362	ensembl	human	known	69_37n	missense	233	11.74	31	SNP	1.000	A
FGF18	8817	genome.wustl.edu	37	5	170876186	170876186	+	Missense_Mutation	SNP	C	C	G			TCGA-A2-A0CR-01A-11D-A228-09	TCGA-A2-A0CR-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f573c3c3-7b61-4955-8772-215b7cb9a763	3bdb54b4-1e26-4274-a1bd-800416ffbd34	g.chr5:170876186C>G	ENST00000274625.5	+	4	830	c.286C>G	c.(286-288)Caa>Gaa	p.Q96E		NM_003862.2	NP_003853.1	O76093	FGF18_HUMAN	fibroblast growth factor 18	96					anatomical structure morphogenesis (GO:0009653)|angiogenesis (GO:0001525)|cell-cell signaling (GO:0007267)|chondrocyte development (GO:0002063)|endochondral ossification (GO:0001958)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|intramembranous ossification (GO:0001957)|lung development (GO:0030324)|nervous system development (GO:0007399)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cell proliferation (GO:0008284)|positive regulation of chondrocyte differentiation (GO:0032332)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030949)|signal transduction (GO:0007165)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|nucleolus (GO:0005730)	growth factor activity (GO:0008083)|type 1 fibroblast growth factor receptor binding (GO:0005105)|type 2 fibroblast growth factor receptor binding (GO:0005111)			endometrium(2)|large_intestine(1)|lung(4)|prostate(1)|skin(1)	9	Renal(175;0.000159)|Lung NSC(126;0.011)|all_lung(126;0.0175)	Medulloblastoma(196;0.0208)|all_neural(177;0.0416)	Kidney(164;7.24e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000516)			CTTCGGTAGTCAAGTCCGGAT	0.527																																						dbGAP											0													117.0	96.0	103.0					5																	170876186		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB007422	CCDS4378.1	5q34	2008-02-05			ENSG00000156427	ENSG00000156427			3674	protein-coding gene	gene with protein product		603726				9660775, 9742123	Standard	NM_003862		Approved	FGF-18, ZFGF5	uc003mbk.3	O76093	OTTHUMG00000130464	ENST00000274625.5:c.286C>G	5.37:g.170876186C>G	ENSP00000274625:p.Gln96Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DQL7|Q6UWF1	Missense_Mutation	SNP	pfam_IL1_HBGF,superfamily_Cytokine_IL1-like,smart_IL1_HBGF,prints_IL1_HBGF	p.Q96E	ENST00000274625.5	37	c.286	CCDS4378.1	5	.	.	.	.	.	.	.	.	.	.	c	13.81	2.347333	0.41599	.	.	ENSG00000156427	ENST00000274625	D	0.88201	-2.35	3.4	3.4	0.38934	.	0.242934	0.35466	N	0.003198	T	0.76765	0.4033	N	0.11427	0.14	0.32119	N	0.588276	B	0.06786	0.001	B	0.10450	0.005	T	0.75266	-0.3378	10	0.37606	T	0.19	-0.2082	10.1297	0.42672	0.2003:0.7997:0.0:0.0	.	96	O76093	FGF18_HUMAN	E	96	ENSP00000274625:Q96E	ENSP00000274625:Q96E	Q	+	1	0	FGF18	170808791	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	5.367000	0.66127	1.763000	0.52060	0.450000	0.29827	CAA	FGF18	-	pfam_IL1_HBGF,superfamily_Cytokine_IL1-like,smart_IL1_HBGF,prints_IL1_HBGF	ENSG00000156427		0.527	FGF18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FGF18	HGNC	protein_coding	OTTHUMT00000252857.2	36	0.00	0	C	NM_033649, NM_003862		170876186	170876186	+1	no_errors	ENST00000274625	ensembl	human	known	69_37n	missense	43	10.42	5	SNP	1.000	G
FLG	2312	genome.wustl.edu	37	1	152283647	152283647	+	Missense_Mutation	SNP	C	C	T			TCGA-A2-A0CR-01A-11D-A228-09	TCGA-A2-A0CR-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f573c3c3-7b61-4955-8772-215b7cb9a763	3bdb54b4-1e26-4274-a1bd-800416ffbd34	g.chr1:152283647C>T	ENST00000368799.1	-	3	3750	c.3715G>A	c.(3715-3717)Gaa>Aaa	p.E1239K	FLG-AS1_ENST00000420707.1_RNA|FLG-AS1_ENST00000392688.2_RNA|FLG-AS1_ENST00000593011.1_RNA	NM_002016.1	NP_002007.1	P20930	FILA_HUMAN	filaggrin	1239	Ser-rich.				establishment of skin barrier (GO:0061436)|keratinocyte differentiation (GO:0030216)|multicellular organismal development (GO:0007275)	cytoplasmic membrane-bounded vesicle (GO:0016023)|intermediate filament (GO:0005882)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|structural molecule activity (GO:0005198)			autonomic_ganglia(1)|breast(13)|central_nervous_system(5)|cervix(2)|endometrium(38)|haematopoietic_and_lymphoid_tissue(1)|kidney(16)|large_intestine(57)|lung(211)|ovary(13)|pancreas(1)|prostate(15)|skin(24)|stomach(5)|upper_aerodigestive_tract(10)|urinary_tract(12)	424	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			GAGGCAGCTTCATGGTGACGT	0.562									Ichthyosis																													dbGAP											0													299.0	287.0	291.0					1																	152283647		2203	4300	6503	-	-	-	SO:0001583	missense	0	Familial Cancer Database	X-linked Ichthyosis, Steroid Sulfatase Deficiency, Ichthyosis Vulgaris	XM_048104	CCDS30860.1	1q21.3	2013-01-10			ENSG00000143631	ENSG00000143631		"""EF-hand domain containing"""	3748	protein-coding gene	gene with protein product		135940				2740331, 2248957, 16444271	Standard	NM_002016		Approved		uc001ezu.1	P20930	OTTHUMG00000012202	ENST00000368799.1:c.3715G>A	1.37:g.152283647C>T	ENSP00000357789:p.Glu1239Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q01720|Q5T583|Q9UC71	Missense_Mutation	SNP	pfam_Filaggrin,pfam_S100_Ca-bd_sub,pfscan_EF_HAND_2,prints_Filaggrin	p.E1239K	ENST00000368799.1	37	c.3715	CCDS30860.1	1	.	.	.	.	.	.	.	.	.	.	C	5.590	0.293703	0.10567	.	.	ENSG00000143631	ENST00000368799	T	0.03860	3.78	1.35	-2.71	0.05986	.	.	.	.	.	T	0.01421	0.0046	M	0.77103	2.36	0.09310	N	1	B	0.32245	0.361	B	0.28305	0.088	T	0.47328	-0.9126	9	0.07175	T	0.84	.	6.4298	0.21790	0.0:0.3922:0.6078:0.0	.	1239	P20930	FILA_HUMAN	K	1239	ENSP00000357789:E1239K	ENSP00000357789:E1239K	E	-	1	0	FLG	150550271	0.022000	0.18835	0.000000	0.03702	0.002000	0.02628	0.553000	0.23391	-0.442000	0.07190	0.123000	0.15791	GAA	FLG	-	pfam_Filaggrin	ENSG00000143631		0.562	FLG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FLG	HGNC	protein_coding	OTTHUMT00000033742.1	142	0.00	0	C	NM_002016		152283647	152283647	-1	no_errors	ENST00000368799	ensembl	human	known	69_37n	missense	134	16.77	27	SNP	0.000	T
FLG	2312	genome.wustl.edu	37	1	152287821	152287821	+	Missense_Mutation	SNP	C	C	G			TCGA-A2-A0CR-01A-11D-A228-09	TCGA-A2-A0CR-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f573c3c3-7b61-4955-8772-215b7cb9a763	3bdb54b4-1e26-4274-a1bd-800416ffbd34	g.chr1:152287821C>G	ENST00000368799.1	-	2	147	c.112G>C	c.(112-114)Gaa>Caa	p.E38Q	FLG-AS1_ENST00000420707.1_RNA|FLG-AS1_ENST00000392688.2_RNA|FLG-AS1_ENST00000593011.1_RNA	NM_002016.1	NP_002007.1	P20930	FILA_HUMAN	filaggrin	38	EF-hand 1. {ECO:0000255|PROSITE- ProRule:PRU00448}.				establishment of skin barrier (GO:0061436)|keratinocyte differentiation (GO:0030216)|multicellular organismal development (GO:0007275)	cytoplasmic membrane-bounded vesicle (GO:0016023)|intermediate filament (GO:0005882)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|structural molecule activity (GO:0005198)			autonomic_ganglia(1)|breast(13)|central_nervous_system(5)|cervix(2)|endometrium(38)|haematopoietic_and_lymphoid_tissue(1)|kidney(16)|large_intestine(57)|lung(211)|ovary(13)|pancreas(1)|prostate(15)|skin(24)|stomach(5)|upper_aerodigestive_tract(10)|urinary_tract(12)	424	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			AATTCCTTTTCCAGAAGTTCC	0.333									Ichthyosis																													dbGAP											0													172.0	176.0	175.0					1																	152287821		2203	4300	6503	-	-	-	SO:0001583	missense	0	Familial Cancer Database	X-linked Ichthyosis, Steroid Sulfatase Deficiency, Ichthyosis Vulgaris	XM_048104	CCDS30860.1	1q21.3	2013-01-10			ENSG00000143631	ENSG00000143631		"""EF-hand domain containing"""	3748	protein-coding gene	gene with protein product		135940				2740331, 2248957, 16444271	Standard	NM_002016		Approved		uc001ezu.1	P20930	OTTHUMG00000012202	ENST00000368799.1:c.112G>C	1.37:g.152287821C>G	ENSP00000357789:p.Glu38Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	Q01720|Q5T583|Q9UC71	Missense_Mutation	SNP	pfam_Filaggrin,pfam_S100_Ca-bd_sub,pfscan_EF_HAND_2,prints_Filaggrin	p.E38Q	ENST00000368799.1	37	c.112	CCDS30860.1	1	.	.	.	.	.	.	.	.	.	.	C	12.92	2.082279	0.36758	.	.	ENSG00000143631	ENST00000368799	T	0.10960	2.82	5.2	5.2	0.72013	S100/CaBP-9k-type, calcium binding, subdomain (1);EF-hand-like domain (1);	.	.	.	.	T	0.17109	0.0411	L	0.49699	1.58	0.25843	N	0.984032	D	0.76494	0.999	D	0.74348	0.983	T	0.01925	-1.1246	9	0.62326	D	0.03	-24.8286	14.167	0.65483	0.0:1.0:0.0:0.0	.	38	P20930	FILA_HUMAN	Q	38	ENSP00000357789:E38Q	ENSP00000357789:E38Q	E	-	1	0	FLG	150554445	1.000000	0.71417	0.997000	0.53966	0.371000	0.29859	1.976000	0.40579	2.711000	0.92665	0.558000	0.71614	GAA	FLG	-	pfam_S100_Ca-bd_sub	ENSG00000143631		0.333	FLG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FLG	HGNC	protein_coding	OTTHUMT00000033742.1	75	0.00	0	C	NM_002016		152287821	152287821	-1	no_errors	ENST00000368799	ensembl	human	known	69_37n	missense	63	18.18	14	SNP	1.000	G
FLT4	2324	genome.wustl.edu	37	5	180056359	180056359	+	Silent	SNP	C	C	T			TCGA-A2-A0CR-01A-11D-A228-09	TCGA-A2-A0CR-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f573c3c3-7b61-4955-8772-215b7cb9a763	3bdb54b4-1e26-4274-a1bd-800416ffbd34	g.chr5:180056359C>T	ENST00000261937.6	-	7	963	c.885G>A	c.(883-885)ctG>ctA	p.L295L	FLT4_ENST00000424276.2_5'UTR|FLT4_ENST00000502649.1_Silent_p.L295L|FLT4_ENST00000393347.3_Silent_p.L295L	NM_182925.4	NP_891555.2	P35916	VGFR3_HUMAN	fms-related tyrosine kinase 4	295	Ig-like C2-type 3.				blood vessel morphogenesis (GO:0048514)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|lymph vessel development (GO:0001945)|lymphangiogenesis (GO:0001946)|negative regulation of apoptotic process (GO:0043066)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of cell proliferation (GO:0008284)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of JNK cascade (GO:0046330)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of protein kinase C signaling (GO:0090037)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation vascular endothelial growth factor production (GO:0010575)|protein autophosphorylation (GO:0046777)|regulation of blood vessel remodeling (GO:0060312)|sprouting angiogenesis (GO:0002040)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)|vascular endothelial growth factor signaling pathway (GO:0038084)|vasculature development (GO:0001944)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|growth factor binding (GO:0019838)|protein phosphatase binding (GO:0019903)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)|vascular endothelial growth factor-activated receptor activity (GO:0005021)			NS(1)|breast(3)|central_nervous_system(2)|endometrium(1)|kidney(6)|large_intestine(5)|liver(2)|lung(37)|ovary(6)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	71	all_cancers(89;2.21e-05)|all_epithelial(37;5.29e-06)|Renal(175;0.000159)|Lung NSC(126;0.00199)|all_lung(126;0.00351)|Breast(19;0.114)	all_cancers(40;0.00245)|Medulloblastoma(196;0.0133)|all_neural(177;0.0199)|all_hematologic(541;0.163)|Ovarian(839;0.238)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	all cancers(165;0.134)	Axitinib(DB06626)|Pazopanib(DB06589)|Regorafenib(DB08896)|Sorafenib(DB00398)|Sunitinib(DB01268)	TGTGGATGGTCAGGATGCTGG	0.632																																					Colon(97;1075 1466 27033 27547 35871)	dbGAP											0													157.0	135.0	143.0					5																	180056359		2201	4298	6499	-	-	-	SO:0001819	synonymous_variant	0			X68203	CCDS4457.1, CCDS43412.1	5q34-q35	2013-01-29			ENSG00000037280	ENSG00000037280	2.7.10.1	"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	3767	protein-coding gene	gene with protein product		136352				1319394	Standard	NM_002020		Approved	VEGFR3, PCL	uc003mlz.4	P35916	OTTHUMG00000130931	ENST00000261937.6:c.885G>A	5.37:g.180056359C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K6L4|B5A926|Q16067|Q86W07|Q86W08	Silent	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,pfam_Ig_I-set,superfamily_Kinase-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom,pfscan_Ig-like,prints_Tyr_kinase_VEGFR3_rcpt_N,prints_Tyr_kinase_VEGFR_rcpt_N	p.L295	ENST00000261937.6	37	c.885	CCDS4457.1	5																																																																																			FLT4	-	pfam_Ig_I-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	ENSG00000037280		0.632	FLT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FLT4	HGNC	protein_coding	OTTHUMT00000253527.4	36	0.00	0	C			180056359	180056359	-1	no_errors	ENST00000261937	ensembl	human	known	69_37n	silent	48	11.11	6	SNP	1.000	T
FMN2	56776	genome.wustl.edu	37	1	240370934	240370934	+	Missense_Mutation	SNP	G	G	C	rs71170718|rs4997328|rs562038978	byFrequency	TCGA-A2-A0CR-01A-11D-A228-09	TCGA-A2-A0CR-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f573c3c3-7b61-4955-8772-215b7cb9a763	3bdb54b4-1e26-4274-a1bd-800416ffbd34	g.chr1:240370934G>C	ENST00000319653.9	+	5	3052	c.2822G>C	c.(2821-2823)gGa>gCa	p.G941A		NM_020066.4	NP_064450.3	Q9NZ56	FMN2_HUMAN	formin 2	941	FH1.|Pro-rich.				cellular response to DNA damage stimulus (GO:0006974)|cellular response to hypoxia (GO:0071456)|establishment of meiotic spindle localization (GO:0051295)|formin-nucleated actin cable assembly (GO:0070649)|homologous chromosome movement towards spindle pole involved in homologous chromosome segregation (GO:0051758)|intracellular signal transduction (GO:0035556)|intracellular transport (GO:0046907)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic process (GO:0043066)|negative regulation of protein catabolic process (GO:0042177)|oogenesis (GO:0048477)|polar body extrusion after meiotic divisions (GO:0040038)|protein transport (GO:0015031)|vesicle-mediated transport (GO:0016192)	cell cortex (GO:0005938)|cytoplasmic vesicle membrane (GO:0030659)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|microvillus (GO:0005902)|nucleolus (GO:0005730)|plasma membrane (GO:0005886)|spindle (GO:0005819)	actin binding (GO:0003779)			NS(1)|breast(7)|central_nervous_system(6)|cervix(1)|endometrium(14)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(13)|lung(87)|ovary(6)|pancreas(3)|prostate(12)|skin(7)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(2)	178	Ovarian(103;0.127)	all_cancers(173;0.013)	OV - Ovarian serous cystadenocarcinoma(106;0.0106)			CCCGGAGCGGGAATACCTCCT	0.706													G|||	1385	0.276558	0.3616	0.1902	5008	,	,		7542	0.3115		0.2276	False		,,,				2504	0.2372					dbGAP											0													25.0	31.0	29.0					1																	240370934		2135	4205	6340	-	-	-	SO:0001583	missense	0			AF218942	CCDS31069.2	1q43	2008-02-05			ENSG00000155816	ENSG00000155816			14074	protein-coding gene	gene with protein product		606373				10781961	Standard	NM_020066		Approved		uc010pyd.2	Q9NZ56	OTTHUMG00000039883	ENST00000319653.9:c.2822G>C	1.37:g.240370934G>C	ENSP00000318884:p.Gly941Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	B0QZA7|B4DP05|Q59GF6|Q5VU37|Q9NZ55	Missense_Mutation	SNP	pfam_FH2_actin-bd,pfam_Formin_homology_1,superfamily_FH2_actin-bd,smart_Actin-bd_FH2/DRF_autoreg,pfscan_DEP_dom	p.G941A	ENST00000319653.9	37	c.2822	CCDS31069.2	1	510	0.23351648351648352	149	0.30284552845528456	59	0.16298342541436464	154	0.2692307692307692	148	0.19525065963060687	G	6.179	0.401283	0.11696	.	.	ENSG00000155816	ENST00000319653	T	0.51574	0.7	3.52	2.6	0.31112	Actin-binding FH2/DRF autoregulatory (1);Formin Homology 1 (1);	.	.	.	.	T	0.00012	0.0000	L	0.47716	1.5	0.80722	P	0.0	B	0.28291	0.206	B	0.31869	0.137	T	0.28618	-1.0038	7	.	.	.	.	8.7591	0.34663	0.0:0.2724:0.5786:0.149	rs4997328	941	Q9NZ56	FMN2_HUMAN	A	941	ENSP00000318884:G941A	.	G	+	2	0	FMN2	238437557	0.024000	0.19004	0.019000	0.16419	0.001000	0.01503	0.529000	0.23019	1.071000	0.40834	-0.415000	0.06103	GGA	FMN2	-	pfam_Formin_homology_1,smart_Actin-bd_FH2/DRF_autoreg	ENSG00000155816		0.706	FMN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FMN2	HGNC	protein_coding	OTTHUMT00000096217.2	13	0.00	0	G	XM_371352		240370934	240370934	+1	no_errors	ENST00000319653	ensembl	human	known	69_37n	missense	14	30.00	6	SNP	0.001	C
GAL3ST1	9514	genome.wustl.edu	37	22	30951295	30951295	+	Missense_Mutation	SNP	T	T	G			TCGA-A2-A0CR-01A-11D-A228-09	TCGA-A2-A0CR-10A-01D-A22A-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f573c3c3-7b61-4955-8772-215b7cb9a763	3bdb54b4-1e26-4274-a1bd-800416ffbd34	g.chr22:30951295T>G	ENST00000402321.1	-	3	1234	c.917A>C	c.(916-918)cAc>cCc	p.H306P	GAL3ST1_ENST00000402369.1_Missense_Mutation_p.H306P|GAL3ST1_ENST00000406361.1_Missense_Mutation_p.H306P|GAL3ST1_ENST00000338911.5_Missense_Mutation_p.H306P|GAL3ST1_ENST00000406955.1_Missense_Mutation_p.H306P|GAL3ST1_ENST00000401975.1_Missense_Mutation_p.H306P|GAL3ST1_ENST00000443111.2_Missense_Mutation_p.H306P			Q99999	G3ST1_HUMAN	galactose-3-O-sulfotransferase 1	306					galactosylceramide biosynthetic process (GO:0006682)|glycosphingolipid metabolic process (GO:0006687)|myelination (GO:0042552)|protein N-linked glycosylation (GO:0006487)|small molecule metabolic process (GO:0044281)|spermatogenesis (GO:0007283)|sphingolipid metabolic process (GO:0006665)	Golgi membrane (GO:0000139)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)	galactosylceramide sulfotransferase activity (GO:0001733)|sulfotransferase activity (GO:0008146)			NS(1)|breast(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(8)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	21						GCGGTAGAGGTGGGAGTCCAG	0.701																																						dbGAP											0													18.0	23.0	21.0					22																	30951295		2198	4292	6490	-	-	-	SO:0001583	missense	0			D88667	CCDS13879.1	22q12.2	2007-04-02			ENSG00000128242	ENSG00000128242		"""Sulfotransferases, membrane-bound"""	24240	protein-coding gene	gene with protein product	"""cerebroside (3' phosphoadenylylsulfate:galactosylceramide 3') sulfotransferase"""	602300				9847074, 9030544	Standard	NM_004861		Approved	CST	uc003aii.1	Q99999	OTTHUMG00000151200	ENST00000402321.1:c.917A>C	22.37:g.30951295T>G	ENSP00000385735:p.His306Pro	Somatic		WXS	Illumina GAIIx	Phase_IV	Q96C63	Missense_Mutation	SNP	pfam_Gal-3-0_sulfotransfrase	p.H306P	ENST00000402321.1	37	c.917	CCDS13879.1	22	.	.	.	.	.	.	.	.	.	.	T	11.38	1.621434	0.28889	.	.	ENSG00000128242	ENST00000406955;ENST00000402321;ENST00000402369;ENST00000401975;ENST00000338911;ENST00000406361;ENST00000443111	T;T;T;T;T;T;T	0.14640	2.49;2.49;2.49;2.49;2.49;2.49;2.49	5.55	-2.15	0.07102	.	0.377651	0.30455	N	0.009593	T	0.06234	0.0161	N	0.17082	0.46	0.40178	D	0.977252	B	0.09022	0.002	B	0.04013	0.001	T	0.28933	-1.0028	10	0.31617	T	0.26	-12.3476	6.7124	0.23284	0.5427:0.2902:0.0:0.1671	.	306	Q99999	G3ST1_HUMAN	P	306	ENSP00000385825:H306P;ENSP00000385735:H306P;ENSP00000384122:H306P;ENSP00000384388:H306P;ENSP00000343234:H306P;ENSP00000385207:H306P;ENSP00000402587:H306P	ENSP00000343234:H306P	H	-	2	0	GAL3ST1	29281295	0.987000	0.35691	0.949000	0.38748	0.765000	0.43378	0.315000	0.19451	-0.005000	0.14395	-1.643000	0.00768	CAC	GAL3ST1	-	pfam_Gal-3-0_sulfotransfrase	ENSG00000128242		0.701	GAL3ST1-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	GAL3ST1	HGNC	protein_coding	OTTHUMT00000321745.1	78	0.00	0	T	NM_004861		30951295	30951295	-1	no_errors	ENST00000338911	ensembl	human	known	69_37n	missense	29	35.56	16	SNP	0.539	G
GANAB	23193	genome.wustl.edu	37	11	62406907	62406907	+	Missense_Mutation	SNP	G	G	A			TCGA-A2-A0CR-01A-11D-A228-09	TCGA-A2-A0CR-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f573c3c3-7b61-4955-8772-215b7cb9a763	3bdb54b4-1e26-4274-a1bd-800416ffbd34	g.chr11:62406907G>A	ENST00000356638.3	-	3	192	c.176C>T	c.(175-177)cCa>cTa	p.P59L	GANAB_ENST00000346178.4_Missense_Mutation_p.P59L|GANAB_ENST00000534779.1_Intron|GANAB_ENST00000534422.1_5'UTR|GANAB_ENST00000540933.1_Intron	NM_198334.1	NP_938148.1	Q14697	GANAB_HUMAN	glucosidase, alpha; neutral AB	59					cellular protein metabolic process (GO:0044267)|post-translational protein modification (GO:0043687)|protein folding (GO:0006457)|protein N-linked glycosylation via asparagine (GO:0018279)	endoplasmic reticulum lumen (GO:0005788)|extracellular vesicular exosome (GO:0070062)|glucosidase II complex (GO:0017177)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)	carbohydrate binding (GO:0030246)|glucan 1,3-alpha-glucosidase activity (GO:0033919)|poly(A) RNA binding (GO:0044822)			central_nervous_system(1)|cervix(2)|endometrium(2)|kidney(2)|large_intestine(6)|lung(14)|ovary(3)|skin(2)|urinary_tract(3)	35					Miglitol(DB00491)	GGCTCGGTATGGAGAGAGGCC	0.537																																					Melanoma(23;1005 1074 15747 18937)	dbGAP											0													99.0	91.0	93.0					11																	62406907		2202	4299	6501	-	-	-	SO:0001583	missense	0			AF144074	CCDS8026.1, CCDS41656.1, CCDS60817.1, CCDS60818.1	11q12.3	2012-10-02			ENSG00000089597	ENSG00000089597	3.2.1.20		4138	protein-coding gene	gene with protein product		104160				10764838, 6342981	Standard	NM_198335		Approved	GluII, G2AN, KIAA0088	uc001nua.4	Q14697	OTTHUMG00000167696	ENST00000356638.3:c.176C>T	11.37:g.62406907G>A	ENSP00000349053:p.Pro59Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NC20|Q8WTS9|Q9P0X0	Missense_Mutation	SNP	pfam_Glyco_hydro_31,superfamily_Glycoside_hydrolase_SF,superfamily_Glyco_hydro-type_carb-bd	p.P59L	ENST00000356638.3	37	c.176	CCDS8026.1	11	.	.	.	.	.	.	.	.	.	.	G	14.22	2.471823	0.43942	.	.	ENSG00000089597	ENST00000346178;ENST00000356638	D;D	0.89485	-2.52;-2.38	4.79	4.79	0.61399	Glycoside hydrolase-type carbohydrate-binding (1);	0.057671	0.64402	D	0.000001	D	0.87696	0.6242	M	0.66297	2.02	0.80722	D	1	B;B	0.31383	0.01;0.321	B;B	0.31547	0.005;0.132	D	0.86643	0.1893	10	0.41790	T	0.15	-10.0114	15.4273	0.75061	0.0:0.0:1.0:0.0	.	59;59	Q14697;Q14697-2	GANAB_HUMAN;.	L	59	ENSP00000340466:P59L;ENSP00000349053:P59L	ENSP00000340466:P59L	P	-	2	0	GANAB	62163483	1.000000	0.71417	0.976000	0.42696	0.946000	0.59487	5.013000	0.64023	2.496000	0.84212	0.556000	0.70494	CCA	GANAB	-	superfamily_Glyco_hydro-type_carb-bd	ENSG00000089597		0.537	GANAB-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	GANAB	HGNC	protein_coding	OTTHUMT00000395689.1	28	0.00	0	G	NM_198334		62406907	62406907	-1	no_errors	ENST00000346178	ensembl	human	known	69_37n	missense	30	18.92	7	SNP	0.998	A
GLRA4	441509	genome.wustl.edu	37	X	102962273	102962273	+	Silent	SNP	C	C	T			TCGA-A2-A0CR-01A-11D-A228-09	TCGA-A2-A0CR-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f573c3c3-7b61-4955-8772-215b7cb9a763	3bdb54b4-1e26-4274-a1bd-800416ffbd34	g.chrX:102962273C>T	ENST00000372617.4	-	9	1673	c.1253G>A	c.(1252-1254)tGa>tAa	p.*418*		NM_001024452.2	NP_001019623.2	Q5JXX5	GLRA4_HUMAN	glycine receptor, alpha 4	0						cell junction (GO:0030054)|chloride channel complex (GO:0034707)|integral component of plasma membrane (GO:0005887)|postsynaptic membrane (GO:0045211)	chloride channel activity (GO:0005254)|extracellular ligand-gated ion channel activity (GO:0005230)|glycine binding (GO:0016594)|transmitter-gated ion channel activity (GO:0022824)			cervix(1)|endometrium(2)|large_intestine(2)|lung(13)|upper_aerodigestive_tract(2)|urinary_tract(1)	21						TCTCTTGGCTCAGTCCACGTA	0.483																																						dbGAP											0													89.0	87.0	87.0					X																	102962273		1919	4122	6041	-	-	-	SO:0001819	synonymous_variant	0			Z93848	CCDS43980.2	Xq22.2	2012-01-16			ENSG00000188828	ENSG00000188828		"""Ligand-gated ion channels / Glycine receptors"""	31715	protein-coding gene	gene with protein product							Standard	NM_001024452		Approved		uc011mse.2	Q5JXX5	OTTHUMG00000022110	ENST00000372617.4:c.1253G>A	X.37:g.102962273C>T		Somatic		WXS	Illumina GAIIx	Phase_IV		Silent	SNP	pfam_Neur_chan_lig-bd,pfam_Neurotrans-gated_channel_TM,superfamily_Neur_chan_lig-bd,superfamily_Neurotrans-gated_channel_TM,prints_GABAA_rcpt,prints_Glycine_rcpt_A,prints_Neur_channel,tigrfam_Neur_channel	p.*418	ENST00000372617.4	37	c.1253	CCDS43980.2	X																																																																																			GLRA4	-	NULL	ENSG00000188828		0.483	GLRA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GLRA4	HGNC	protein_coding	OTTHUMT00000057742.2	58	0.00	0	C	NM_001024452		102962273	102962273	-1	no_errors	ENST00000372617	ensembl	human	known	69_37n	silent	65	10.96	8	SNP	0.995	T
GREB1L	80000	genome.wustl.edu	37	18	19088440	19088440	+	Missense_Mutation	SNP	C	C	G			TCGA-A2-A0CR-01A-11D-A228-09	TCGA-A2-A0CR-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f573c3c3-7b61-4955-8772-215b7cb9a763	3bdb54b4-1e26-4274-a1bd-800416ffbd34	g.chr18:19088440C>G	ENST00000580732.2	+	27	5004	c.4623C>G	c.(4621-4623)atC>atG	p.I1541M	GREB1L_ENST00000424526.1_Missense_Mutation_p.I1541M|GREB1L_ENST00000269218.6_Missense_Mutation_p.I1432M|GREB1L_ENST00000400483.4_3'UTR			Q9C091	GRB1L_HUMAN	growth regulation by estrogen in breast cancer-like	1541						integral component of membrane (GO:0016021)				breast(5)|endometrium(4)|kidney(6)|lung(1)|skin(1)	17						TGGAGGGCATCAGCCACCTTC	0.512																																						dbGAP											0													66.0	56.0	59.0					18																	19088440		692	1591	2283	-	-	-	SO:0001583	missense	0			AK023749	CCDS45836.1	18q11.2	2009-09-08	2009-09-08	2009-09-08					31042	protein-coding gene	gene with protein product			"""KIAA1772"""	KIAA1772		11214970	Standard	NM_001142966		Approved	FLJ13687, C18orf6	uc010xam.2	Q9C091		ENST00000580732.2:c.4623C>G	18.37:g.19088440C>G	ENSP00000464162:p.Ile1541Met	Somatic		WXS	Illumina GAIIx	Phase_IV	A4QN17|Q9H8F1	Missense_Mutation	SNP	NULL	p.I1541M	ENST00000580732.2	37	c.4623	CCDS45836.1	18	.	.	.	.	.	.	.	.	.	.	C	26.2	4.710525	0.89018	.	.	ENSG00000141449	ENST00000424526;ENST00000269218	T;T	0.46063	0.88;0.88	5.83	5.83	0.93111	.	0.168425	0.40640	N	0.001050	T	0.51007	0.1649	L	0.50333	1.59	0.80722	D	1	P;P;P	0.44946	0.755;0.547;0.846	P;B;P	0.48141	0.568;0.444;0.568	T	0.48714	-0.9011	10	0.59425	D	0.04	-0.5516	20.1111	0.97911	0.0:1.0:0.0:0.0	.	1432;1541;915	Q9C091-3;Q9C091;B4DDS9	.;GRB1L_HUMAN;.	M	1541;1432	ENSP00000412060:I1541M;ENSP00000269218:I1432M	ENSP00000269218:I1432M	I	+	3	3	GREB1L	17342438	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	3.680000	0.54641	2.741000	0.93983	0.655000	0.94253	ATC	GREB1L	-	NULL	ENSG00000141449		0.512	GREB1L-003	KNOWN	not_organism_supported|upstream_uORF|basic|appris_principal|CCDS	protein_coding	GREB1L	HGNC	protein_coding	OTTHUMT00000443782.2	35	0.00	0	C	NM_024935		19088440	19088440	+1	no_errors	ENST00000424526	ensembl	human	known	69_37n	missense	48	11.11	6	SNP	1.000	G
ICAM1	3383	genome.wustl.edu	37	19	10394723	10394723	+	Missense_Mutation	SNP	C	C	T			TCGA-A2-A0CR-01A-11D-A228-09	TCGA-A2-A0CR-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f573c3c3-7b61-4955-8772-215b7cb9a763	3bdb54b4-1e26-4274-a1bd-800416ffbd34	g.chr19:10394723C>T	ENST00000264832.3	+	4	977	c.652C>T	c.(652-654)Ccc>Tcc	p.P218S	ICAM4_ENST00000340992.4_5'Flank|ICAM4_ENST00000380770.3_5'Flank|ICAM1_ENST00000423829.2_Intron|CTD-2369P2.5_ENST00000592893.1_RNA|ICAM4_ENST00000393717.2_5'Flank|CTD-2369P2.8_ENST00000589379.1_RNA	NM_000201.2	NP_000192.2	P05362	ICAM1_HUMAN	intercellular adhesion molecule 1	218					adhesion of symbiont to host (GO:0044406)|cell adhesion (GO:0007155)|cell adhesion mediated by integrin (GO:0033627)|cell aging (GO:0007569)|cellular response to alkaloid (GO:0071312)|cellular response to glucose stimulus (GO:0071333)|cellular response to hypoxia (GO:0071456)|cellular response to interleukin-1 (GO:0071347)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to nutrient levels (GO:0031669)|cellular response to tumor necrosis factor (GO:0071356)|cytokine-mediated signaling pathway (GO:0019221)|establishment of endothelial barrier (GO:0061028)|extracellular matrix organization (GO:0030198)|heterophilic cell-cell adhesion (GO:0007157)|interferon-gamma-mediated signaling pathway (GO:0060333)|leukocyte cell-cell adhesion (GO:0007159)|leukocyte migration (GO:0050900)|membrane to membrane docking (GO:0022614)|negative regulation of calcium ion transport (GO:0051926)|negative regulation of endothelial cell apoptotic process (GO:2000352)|negative regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902042)|ovarian follicle development (GO:0001541)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of cellular extravasation (GO:0002693)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of Rho GTPase activity (GO:0032321)|positive regulation of vasoconstriction (GO:0045907)|receptor-mediated virion attachment to host cell (GO:0046813)|regulation of cell adhesion (GO:0030155)|regulation of cell shape (GO:0008360)|regulation of immune response (GO:0050776)|regulation of leukocyte mediated cytotoxicity (GO:0001910)|regulation of ruffle assembly (GO:1900027)|response to amino acid (GO:0043200)|response to amphetamine (GO:0001975)|response to copper ion (GO:0046688)|response to drug (GO:0042493)|response to ethanol (GO:0045471)|response to gonadotropin (GO:0034698)|response to ionizing radiation (GO:0010212)|response to organic cyclic compound (GO:0014070)|response to sulfur dioxide (GO:0010477)|T cell activation via T cell receptor contact with antigen bound to MHC molecule on antigen presenting cell (GO:0002291)|T cell antigen processing and presentation (GO:0002457)	cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|immunological synapse (GO:0001772)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	integrin binding (GO:0005178)|receptor activity (GO:0004872)|transmembrane signaling receptor activity (GO:0004888)|virus receptor activity (GO:0001618)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(4)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	14			OV - Ovarian serous cystadenocarcinoma(20;1.39e-09)|Epithelial(33;2.81e-06)|all cancers(31;6.56e-06)		Hyaluronan(DB08818)|Natalizumab(DB00108)	GCCAGCGACTCCCCCACAACT	0.627																																						dbGAP											0													80.0	83.0	82.0					19																	10394723		2202	4299	6501	-	-	-	SO:0001583	missense	0				CCDS12231.1	19p13.3-p13.2	2014-01-30	2008-07-18			ENSG00000090339		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Endogenous ligands"""	5344	protein-coding gene	gene with protein product	"""human rhinovirus receptor"""	147840				2453850, 3871395	Standard	NM_000201		Approved	BB2, CD54	uc002mnq.2	P05362		ENST00000264832.3:c.652C>T	19.37:g.10394723C>T	ENSP00000264832:p.Pro218Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R6M3|Q5NKV7|Q96B50	Missense_Mutation	SNP	pfam_ICAM_N,smart_Ig_sub,prints_ICAM_VCAM_N,prints_ICAM	p.P218S	ENST00000264832.3	37	c.652	CCDS12231.1	19	.	.	.	.	.	.	.	.	.	.	C	8.025	0.760446	0.15914	.	.	ENSG00000090339	ENST00000264832	T	0.03004	4.08	4.18	-8.36	0.00980	Immunoglobulin-like fold (1);	3.397540	0.01146	N	0.006304	T	0.03095	0.0091	N	0.21373	0.66	0.21020	N	0.999806	B	0.31752	0.338	B	0.36959	0.237	T	0.30416	-0.9979	10	0.07990	T	0.79	0.0027	11.2639	0.49099	0.3081:0.1584:0.5336:0.0	.	218	P05362	ICAM1_HUMAN	S	218	ENSP00000264832:P218S	ENSP00000264832:P218S	P	+	1	0	ICAM1	10255723	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-3.445000	0.00468	-1.912000	0.01081	-0.438000	0.05819	CCC	ICAM1	-	NULL	ENSG00000090339		0.627	ICAM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ICAM1	HGNC	protein_coding	OTTHUMT00000451207.1	34	0.00	0	C			10394723	10394723	+1	no_errors	ENST00000264832	ensembl	human	known	69_37n	missense	38	17.39	8	SNP	0.000	T
KIAA0319	9856	genome.wustl.edu	37	6	24559335	24559335	+	Silent	SNP	G	G	C			TCGA-A2-A0CR-01A-11D-A228-09	TCGA-A2-A0CR-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f573c3c3-7b61-4955-8772-215b7cb9a763	3bdb54b4-1e26-4274-a1bd-800416ffbd34	g.chr6:24559335G>C	ENST00000378214.3	-	17	3164	c.2640C>G	c.(2638-2640)ctC>ctG	p.L880L	KIAA0319_ENST00000537886.1_Silent_p.L880L|KIAA0319_ENST00000535378.1_Silent_p.L871L|KIAA0319_ENST00000543707.1_Silent_p.L880L|KIAA0319_ENST00000430948.2_Silent_p.L835L	NM_001168375.1|NM_014809.3	NP_001161847.1|NP_055624.2	Q5VV43	K0319_HUMAN	KIAA0319	880					negative regulation of dendrite development (GO:2000171)|neuron migration (GO:0001764)	early endosome (GO:0005769)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(3)|endometrium(6)|kidney(3)|large_intestine(11)|lung(19)|ovary(1)|prostate(3)|skin(6)|upper_aerodigestive_tract(1)	53						CAGCAGCTTTGAGAACCTTGA	0.507																																						dbGAP											0													76.0	67.0	70.0					6																	24559335		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB002317	CCDS34348.1, CCDS54969.1, CCDS54970.1, CCDS54971.1, CCDS75409.1	6p22.3	2013-12-13			ENSG00000137261	ENSG00000137261			21580	protein-coding gene	gene with protein product	"""neuronal migration"""	609269				9205841, 15514892	Standard	NM_014809		Approved	NMIG	uc003neh.1	Q5VV43	OTTHUMG00000014358	ENST00000378214.3:c.2640C>G	6.37:g.24559335G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	A7MD37|B2RTU7|B4DHA7|B4DK75|B7ZML3|F5H123|Q9UJC8|Q9Y4G7	Silent	SNP	pfam_PKD/REJ-like,superfamily_PKD_dom,smart_MANSC_N,smart_Fibronectin_type3,smart_PKD/Chitinase_dom,pfscan_MANSC,pfscan_PKD_dom	p.L880	ENST00000378214.3	37	c.2640	CCDS34348.1	6																																																																																			KIAA0319	-	NULL	ENSG00000137261		0.507	KIAA0319-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA0319	HGNC	protein_coding	OTTHUMT00000040009.1	34	0.00	0	G	NM_014809		24559335	24559335	-1	no_errors	ENST00000378214	ensembl	human	known	69_37n	silent	53	15.87	10	SNP	0.997	C
KIAA1644	85352	genome.wustl.edu	37	22	44681447	44681447	+	Missense_Mutation	SNP	G	G	A			TCGA-A2-A0CR-01A-11D-A228-09	TCGA-A2-A0CR-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f573c3c3-7b61-4955-8772-215b7cb9a763	3bdb54b4-1e26-4274-a1bd-800416ffbd34	g.chr22:44681447G>A	ENST00000381176.4	-	4	592	c.460C>T	c.(460-462)Cgg>Tgg	p.R154W		NM_001099294.1	NP_001092764.1	Q3SXP7	K1644_HUMAN	KIAA1644	154						integral component of membrane (GO:0016021)		p.R154W(1)		breast(1)|endometrium(1)|large_intestine(2)|lung(3)|ovary(1)|skin(1)	9		all_neural(38;0.0762)|Ovarian(80;0.105)|Glioma(61;0.222)				CGAGGGGCCCGAGCGGGGTTC	0.687																																						dbGAP											1	Substitution - Missense(1)	large_intestine(1)											43.0	47.0	46.0					22																	44681447		1887	4120	6007	-	-	-	SO:0001583	missense	0			AB051431	CCDS43025.1	22q13	2009-02-06	2009-02-06		ENSG00000138944	ENSG00000138944			29335	protein-coding gene	gene with protein product						11258795	Standard	NM_001099294		Approved		uc003bet.2	Q3SXP7	OTTHUMG00000030991	ENST00000381176.4:c.460C>T	22.37:g.44681447G>A	ENSP00000370568:p.Arg154Trp	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NHP0|A9Z1Z0|Q3SXP8|Q5JZ71|Q9BYB5	Missense_Mutation	SNP	NULL	p.R154W	ENST00000381176.4	37	c.460	CCDS43025.1	22	.	.	.	.	.	.	.	.	.	.	G	12.49	1.953160	0.34471	.	.	ENSG00000138944	ENST00000381176	.	.	.	4.28	3.24	0.37175	.	0.651810	0.13564	N	0.378521	T	0.29817	0.0745	N	0.08118	0	0.33797	D	0.626183	D	0.64830	0.994	P	0.47744	0.556	T	0.43893	-0.9363	8	0.87932	D	0	-14.4147	10.899	0.47040	0.0:0.0:0.7996:0.2004	.	154	Q3SXP7	K1644_HUMAN	W	154	.	ENSP00000370568:R154W	R	-	1	2	KIAA1644	43012780	1.000000	0.71417	0.947000	0.38551	0.264000	0.26372	2.294000	0.43567	0.889000	0.36185	0.561000	0.74099	CGG	KIAA1644	-	NULL	ENSG00000138944		0.687	KIAA1644-006	PUTATIVE	basic|appris_principal|exp_conf|CCDS	protein_coding	KIAA1644	HGNC	protein_coding	OTTHUMT00000075879.2	30	0.00	0	G	NM_001099294		44681447	44681447	-1	no_errors	ENST00000381176	ensembl	human	putative	69_37n	missense	25	16.67	5	SNP	0.998	A
KIF1B	23095	genome.wustl.edu	37	1	10318573	10318573	+	Missense_Mutation	SNP	C	C	T			TCGA-A2-A0CR-01A-11D-A228-09	TCGA-A2-A0CR-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f573c3c3-7b61-4955-8772-215b7cb9a763	3bdb54b4-1e26-4274-a1bd-800416ffbd34	g.chr1:10318573C>T	ENST00000377086.1	+	4	408	c.206C>T	c.(205-207)tCt>tTt	p.S69F	KIF1B_ENST00000263934.6_Missense_Mutation_p.S69F|KIF1B_ENST00000377093.4_Missense_Mutation_p.S69F|KIF1B_ENST00000377083.1_Missense_Mutation_p.S69F|KIF1B_ENST00000377081.1_Missense_Mutation_p.S69F			O60333	KIF1B_HUMAN	kinesin family member 1B	69	Kinesin motor. {ECO:0000255|PROSITE- ProRule:PRU00283}.				anterograde axon cargo transport (GO:0008089)|apoptotic process (GO:0006915)|cytoskeleton-dependent intracellular transport (GO:0030705)|microtubule-based movement (GO:0007018)|mitochondrion transport along microtubule (GO:0047497)|neuromuscular synaptic transmission (GO:0007274)|neuron-neuron synaptic transmission (GO:0007270)|vesicle-mediated transport (GO:0016192)	cytoplasmic vesicle (GO:0031410)|cytoplasmic vesicle membrane (GO:0030659)|kinesin complex (GO:0005871)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|mitochondrion (GO:0005739)|neuron projection (GO:0043005)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|kinesin binding (GO:0019894)|microtubule motor activity (GO:0003777)|plus-end-directed microtubule motor activity (GO:0008574)			breast(2)|endometrium(7)|kidney(8)|large_intestine(9)|lung(29)|ovary(3)|prostate(3)|skin(5)|stomach(3)|upper_aerodigestive_tract(2)	71	Ovarian(185;0.203)	all_lung(284;1.31e-05)|Lung NSC(185;2.2e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Hepatocellular(190;0.00913)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0259)|Colorectal(212;9.79e-07)|COAD - Colon adenocarcinoma(227;0.000143)|BRCA - Breast invasive adenocarcinoma(304;0.000413)|Kidney(185;0.00134)|KIRC - Kidney renal clear cell carcinoma(229;0.0037)|STAD - Stomach adenocarcinoma(132;0.0113)|READ - Rectum adenocarcinoma(331;0.0642)		TGTTTTGCATCTCAAAACCGT	0.373																																						dbGAP											0													135.0	127.0	130.0					1																	10318573		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF257176	CCDS111.1, CCDS112.1	1p36.22	2014-09-17			ENSG00000054523	ENSG00000054523		"""Kinesins"", ""Pleckstrin homology (PH) domain containing"""	16636	protein-coding gene	gene with protein product		605995		CMT2A, CMT2		11389829, 10762626	Standard	NM_015074		Approved	KIAA0591, KLP, HMSNII	uc001aqw.4	O60333	OTTHUMG00000001817	ENST00000377086.1:c.206C>T	1.37:g.10318573C>T	ENSP00000366290:p.Ser69Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NFS8|A6NKQ4|Q4VXC3|Q4VXC4|Q4VXC5|Q4VXC6|Q96Q94|Q9BV80|Q9P280	Missense_Mutation	SNP	pfam_Kinesin_motor_dom,pfam_Kinesin-like,pfam_Pleckstrin_homology,pfam_KIF1B,pfam_FHA_dom,superfamily_SMAD_FHA_domain,smart_Kinesin_motor_dom,smart_FHA_dom,smart_Pleckstrin_homology,pfscan_FHA_dom,pfscan_Pleckstrin_homology,pfscan_Kinesin_motor_dom,prints_Kinesin_motor_dom	p.S69F	ENST00000377086.1	37	c.206		1	.	.	.	.	.	.	.	.	.	.	C	27.7	4.853221	0.91355	.	.	ENSG00000054523	ENST00000355249;ENST00000263934;ENST00000377093;ENST00000377086;ENST00000377083;ENST00000377081	D;D;D;D;D	0.89875	-2.58;-2.58;-2.58;-2.58;-2.58	5.5	5.5	0.81552	Kinesin, motor domain (4);	0.000000	0.85682	D	0.000000	D	0.95714	0.8606	M	0.90483	3.12	0.80722	D	1	D;D;D;D;D;D;D	0.89917	0.999;0.998;1.0;1.0;0.999;1.0;0.999	D;D;D;D;D;D;D	0.80764	0.981;0.974;0.966;0.985;0.956;0.994;0.982	D	0.96207	0.9150	10	0.87932	D	0	.	19.4076	0.94655	0.0:1.0:0.0:0.0	.	69;69;69;69;69;69;69	Q4R9M9;Q4R9M7;Q4VXC4;Q4R9M8;O60333;O60333-2;O60333-3	.;.;.;.;KIF1B_HUMAN;.;.	F	69	ENSP00000263934:S69F;ENSP00000366297:S69F;ENSP00000366290:S69F;ENSP00000366287:S69F;ENSP00000366284:S69F	ENSP00000263934:S69F	S	+	2	0	KIF1B	10241160	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.747000	0.85070	2.586000	0.87340	0.460000	0.39030	TCT	KIF1B	-	pfam_Kinesin_motor_dom,smart_Kinesin_motor_dom,pfscan_Kinesin_motor_dom	ENSG00000054523		0.373	KIF1B-001	NOVEL	basic	protein_coding	KIF1B	HGNC	protein_coding	OTTHUMT00000005102.1	38	0.00	0	C			10318573	10318573	+1	no_errors	ENST00000263934	ensembl	human	known	69_37n	missense	36	23.40	11	SNP	1.000	T
KRT83	3889	genome.wustl.edu	37	12	52710344	52710344	+	Missense_Mutation	SNP	C	C	T			TCGA-A2-A0CR-01A-11D-A228-09	TCGA-A2-A0CR-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f573c3c3-7b61-4955-8772-215b7cb9a763	3bdb54b4-1e26-4274-a1bd-800416ffbd34	g.chr12:52710344C>T	ENST00000293670.3	-	6	1011	c.949G>A	c.(949-951)Ggg>Agg	p.G317R		NM_002282.3	NP_002273.3	P78385	KRT83_HUMAN	keratin 83	317	Coil 2.|Rod.				aging (GO:0007568)|epidermis development (GO:0008544)|hair cycle (GO:0042633)	extracellular space (GO:0005615)|keratin filament (GO:0045095)	structural molecule activity (GO:0005198)			NS(1)|central_nervous_system(1)|endometrium(4)|large_intestine(4)|lung(9)|prostate(1)|skin(4)|stomach(7)|upper_aerodigestive_tract(1)	32	Myeloproliferative disorder(4;0.0484)|all_hematologic(5;0.088)			BRCA - Breast invasive adenocarcinoma(357;0.189)		AGGGTCTCCCCGTGCCTGATC	0.562																																					GBM(41;747 834 12702 24089 39393)|Esophageal Squamous(97;805 1414 12559 28198 31861)	dbGAP											0													120.0	91.0	101.0					12																	52710344		2203	4300	6503	-	-	-	SO:0001583	missense	0			X99141	CCDS8823.1	12q13.13	2013-06-20	2006-07-17	2006-07-17	ENSG00000170523	ENSG00000170523		"""-"", ""Intermediate filaments type II, keratins (basic)"""	6460	protein-coding gene	gene with protein product	"""hard keratin type II"""	602765	"""keratin, hair, basic, 3"""	KRTHB3		9084137, 16831889	Standard	NM_002282		Approved	Hb-3	uc001saf.2	P78385	OTTHUMG00000169632	ENST00000293670.3:c.949G>A	12.37:g.52710344C>T	ENSP00000293670:p.Gly317Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	A1A4S9|B2RC21|Q6NT21|Q9NSB3	Missense_Mutation	SNP	pfam_F,superfamily_Prefoldin,prints_Keratin_II	p.G317R	ENST00000293670.3	37	c.949	CCDS8823.1	12	.	.	.	.	.	.	.	.	.	.	C	19.10	3.762373	0.69763	.	.	ENSG00000170523	ENST00000293670	T	0.76839	-1.05	3.89	3.89	0.44902	Filament (1);	0.000000	0.44688	D	0.000430	T	0.81527	0.4841	M	0.74881	2.28	0.41954	D	0.990674	P	0.50710	0.938	P	0.51297	0.665	D	0.84034	0.0361	10	0.66056	D	0.02	.	10.984	0.47513	0.0:0.9068:0.0:0.0932	.	317	P78385	KRT83_HUMAN	R	317	ENSP00000293670:G317R	ENSP00000293670:G317R	G	-	1	0	KRT83	50996611	0.999000	0.42202	0.975000	0.42487	0.785000	0.44390	4.822000	0.62686	1.901000	0.55032	0.462000	0.41574	GGG	KRT83	-	pfam_F,superfamily_Prefoldin,prints_Keratin_II	ENSG00000170523		0.562	KRT83-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRT83	HGNC	protein_coding	OTTHUMT00000405182.1	69	0.00	0	C	NM_002282		52710344	52710344	-1	no_errors	ENST00000293670	ensembl	human	known	69_37n	missense	71	12.35	10	SNP	0.987	T
LCN2	3934	genome.wustl.edu	37	9	130912858	130912858	+	Intron	SNP	G	G	A			TCGA-A2-A0CR-01A-11D-A228-09	TCGA-A2-A0CR-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f573c3c3-7b61-4955-8772-215b7cb9a763	3bdb54b4-1e26-4274-a1bd-800416ffbd34	g.chr9:130912858G>A	ENST00000373017.1	+	3	512				LCN2_ENST00000540948.1_Intron|LCN2_ENST00000470902.1_Intron|LCN2_ENST00000372998.1_Intron|LCN2_ENST00000277480.2_Intron|LCN2_ENST00000373013.2_Intron			P80188	NGAL_HUMAN	lipocalin 2						apoptotic process (GO:0006915)|innate immune response (GO:0045087)|ion transport (GO:0006811)|iron ion homeostasis (GO:0055072)|siderophore transport (GO:0015891)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	iron ion binding (GO:0005506)|small molecule binding (GO:0036094)|transporter activity (GO:0005215)			central_nervous_system(1)|lung(3)|prostate(2)|skin(1)|urinary_tract(1)	8						ATGCACAGTCGTTAGAAAACA	0.537																																						dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0				CCDS6892.1	9q34	2011-10-24	2007-12-18		ENSG00000148346	ENSG00000148346		"""Lipocalins"""	6526	protein-coding gene	gene with protein product	"""oncogene 24p3"", ""neutrophil gelatinase-associated lipocalin"", ""siderocalin"""	600181	"""lipocalin 2 (oncogene 24p3)"""			7683678	Standard	NM_005564		Approved	NGAL, 24p3	uc004bto.1	P80188	OTTHUMG00000020734	ENST00000373017.1:c.275+205G>A	9.37:g.130912858G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A6NII8|B4DWV4|B7ZAA2|P30150|Q5SYV9|Q5SYW0|Q6FGL5|Q92683	RNA	SNP	-	NULL	ENST00000373017.1	37	NULL	CCDS6892.1	9																																																																																			LCN2	-	-	ENSG00000148346		0.537	LCN2-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	LCN2	HGNC	protein_coding	OTTHUMT00000054375.1	26	0.00	0	G	NM_005564		130912858	130912858	+1	no_errors	ENST00000487719	ensembl	human	known	69_37n	rna	25	16.67	5	SNP	0.000	A
LTN1	26046	genome.wustl.edu	37	21	30365148	30365148	+	5'UTR	SNP	C	C	G			TCGA-A2-A0CR-01A-11D-A228-09	TCGA-A2-A0CR-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f573c3c3-7b61-4955-8772-215b7cb9a763	3bdb54b4-1e26-4274-a1bd-800416ffbd34	g.chr21:30365148C>G	ENST00000361371.5	-	0	58				LTN1_ENST00000389194.2_Missense_Mutation_p.Q39H|LTN1_ENST00000389195.2_Missense_Mutation_p.Q39H			O94822	LTN1_HUMAN	listerin E3 ubiquitin protein ligase 1						protein ubiquitination (GO:0016567)		ligase activity (GO:0016874)|zinc ion binding (GO:0008270)			NS(1)|central_nervous_system(1)|endometrium(4)|kidney(5)|large_intestine(12)|lung(19)|ovary(5)|pancreas(1)|prostate(2)|skin(6)|stomach(2)|upper_aerodigestive_tract(2)	60						CAGCTGTACTCTGAGCACTCA	0.642																																						dbGAP											0													69.0	55.0	60.0					21																	30365148		2203	4300	6503	-	-	-	SO:0001623	5_prime_UTR_variant	0			AK001915	CCDS33527.1, CCDS33527.2	21q21.3	2013-01-09	2010-09-17	2010-09-17	ENSG00000198862	ENSG00000198862		"""RING-type (C3HC4) zinc fingers"""	13082	protein-coding gene	gene with protein product	"""listerin"""	613083	"""chromosome 21 open reading frame 98"", ""zinc finger protein 294"", ""ring finger protein 160"""	C21orf98, C21orf10, ZNF294, RNF160		20835226, 19196968	Standard	NM_015565		Approved	KIAA0714, FLJ11053, LISTERIN	uc002ymr.2	O94822	OTTHUMG00000078803	ENST00000361371.5:c.-22G>C	21.37:g.30365148C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	A6NL41|A7E2D0|B2RTS0|C9J7U3|J3KPL4|Q05C47|Q9H8M4|Q9NUY5|Q9P0E9	Missense_Mutation	SNP	pfam_Znf_C3HC4_RING-type,superfamily_ARM-type_fold,smart_Znf_RING-CH,pfscan_Znf_RING	p.Q39H	ENST00000361371.5	37	c.117		21	.	.	.	.	.	.	.	.	.	.	C	11.48	1.651721	0.29336	.	.	ENSG00000198862	ENST00000389194;ENST00000389195	T;T	0.23950	2.24;1.88	4.93	3.08	0.35506	.	.	.	.	.	T	0.13798	0.0334	N	0.08118	0	0.22081	N	0.999372	.	.	.	.	.	.	T	0.19582	-1.0301	7	0.56958	D	0.05	.	5.8382	0.18619	0.1565:0.6871:0.0:0.1563	.	.	.	.	H	39	ENSP00000373846:Q39H;ENSP00000373847:Q39H	ENSP00000373846:Q39H	Q	-	3	2	LTN1	29287019	0.000000	0.05858	0.005000	0.12908	0.035000	0.12851	0.391000	0.20784	0.647000	0.30713	0.655000	0.94253	CAG	LTN1	-	NULL	ENSG00000198862		0.642	LTN1-008	NOVEL	basic|appris_principal	protein_coding	LTN1	HGNC	protein_coding	OTTHUMT00000472108.1	39	0.00	0	C	NM_015565		30365148	30365148	-1	no_errors	ENST00000389194	ensembl	human	putative	69_37n	missense	52	20.00	13	SNP	0.002	G
LYPD6B	130576	genome.wustl.edu	37	2	150017281	150017281	+	Intron	SNP	G	G	A			TCGA-A2-A0CR-01A-11D-A228-09	TCGA-A2-A0CR-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f573c3c3-7b61-4955-8772-215b7cb9a763	3bdb54b4-1e26-4274-a1bd-800416ffbd34	g.chr2:150017281G>A	ENST00000409029.1	+	3	207				LYPD6B_ENST00000409876.1_Intron|LYPD6B_ENST00000409642.3_Silent_p.L3L|LYPD6B_ENST00000450639.1_Silent_p.L3L|LYPD6B_ENST00000280115.7_Silent_p.L3L|LYPD6B_ENST00000498249.1_3'UTR			Q8NI32	LPD6B_HUMAN	LY6/PLAUR domain containing 6B							anchored component of membrane (GO:0031225)|plasma membrane (GO:0005886)				endometrium(3)|large_intestine(2)|lung(4)|ovary(1)|upper_aerodigestive_tract(1)	11						CTGGTAGGCTGATTACTCTGA	0.443																																						dbGAP											0													76.0	67.0	70.0					2																	150017281		1855	4088	5943	-	-	-	SO:0001627	intron_variant	0				CCDS46423.1	2q23.2	2012-07-20			ENSG00000150556	ENSG00000150556			27018	protein-coding gene	gene with protein product	"""cancer/testis antigen 116"""					18360792	Standard	NM_177964		Approved	CT116, LYPD7	uc002twv.1	Q8NI32	OTTHUMG00000153743	ENST00000409029.1:c.5+29814G>A	2.37:g.150017281G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	D3DP90|Q53TK0|Q7Z747|Q8IXK7	Silent	SNP	NULL	p.L3	ENST00000409029.1	37	c.9		2																																																																																			LYPD6B	-	NULL	ENSG00000150556		0.443	LYPD6B-003	KNOWN	alternative_5_UTR|basic	protein_coding	LYPD6B	HGNC	protein_coding	OTTHUMT00000332299.2	30	0.00	0	G	NM_177964		150017281	150017281	+1	no_errors	ENST00000280115	ensembl	human	known	69_37n	silent	44	10.20	5	SNP	0.454	A
LYST	1130	genome.wustl.edu	37	1	235922444	235922444	+	Nonsense_Mutation	SNP	G	G	A			TCGA-A2-A0CR-01A-11D-A228-09	TCGA-A2-A0CR-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f573c3c3-7b61-4955-8772-215b7cb9a763	3bdb54b4-1e26-4274-a1bd-800416ffbd34	g.chr1:235922444G>A	ENST00000389794.3	-	23	6883	c.6709C>T	c.(6709-6711)Cag>Tag	p.Q2237*	LYST_ENST00000389793.2_Nonsense_Mutation_p.Q2237*			Q99698	LYST_HUMAN	lysosomal trafficking regulator	2237					blood coagulation (GO:0007596)|defense response to bacterium (GO:0042742)|defense response to protozoan (GO:0042832)|defense response to virus (GO:0051607)|endosome to lysosome transport via multivesicular body sorting pathway (GO:0032510)|leukocyte chemotaxis (GO:0030595)|lysosome organization (GO:0007040)|mast cell secretory granule organization (GO:0033364)|melanosome organization (GO:0032438)|microtubule-based process (GO:0007017)|natural killer cell mediated cytotoxicity (GO:0042267)|neutrophil mediated immunity (GO:0002446)|phospholipid homeostasis (GO:0055091)|phospholipid metabolic process (GO:0006644)|pigmentation (GO:0043473)|positive regulation of natural killer cell activation (GO:0032816)|response to drug (GO:0042493)|secretion of lysosomal enzymes (GO:0033299)|T cell mediated immunity (GO:0002456)	cytosol (GO:0005829)|microtubule cytoskeleton (GO:0015630)				NS(1)|breast(13)|central_nervous_system(3)|cervix(3)|endometrium(17)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(27)|lung(66)|ovary(7)|pancreas(1)|prostate(4)|skin(4)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	162	Ovarian(103;0.0634)|Breast(184;0.23)	all_cancers(173;0.00246)|Prostate(94;0.0771)|Acute lymphoblastic leukemia(190;0.228)	OV - Ovarian serous cystadenocarcinoma(106;0.000674)			TGGCTTCGCTGGAAGGAGGCC	0.527																																						dbGAP											0													87.0	85.0	86.0					1																	235922444		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			U70064	CCDS31062.1	1q42.1-q42.2	2014-09-17	2004-12-09	2004-12-10	ENSG00000143669	ENSG00000143669		"""WD repeat domain containing"""	1968	protein-coding gene	gene with protein product		606897	"""Chediak-Higashi syndrome 1"""	CHS1		8717042, 8896560	Standard	NM_000081		Approved	CHS	uc001hxj.3	Q99698	OTTHUMG00000040527	ENST00000389794.3:c.6709C>T	1.37:g.235922444G>A	ENSP00000374444:p.Gln2237*	Somatic		WXS	Illumina GAIIx	Phase_IV	O43274|Q5T2U9|Q96TD7|Q96TD8|Q99709|Q9H133	Nonsense_Mutation	SNP	pfam_BEACH_dom,pfam_WD40_repeat,superfamily_BEACH_dom,superfamily_WD40_repeat_dom,superfamily_ARM-type_fold,smart_WD40_repeat,pfscan_BEACH_dom,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.Q2237*	ENST00000389794.3	37	c.6709	CCDS31062.1	1	.	.	.	.	.	.	.	.	.	.	G	46	12.920286	0.99706	.	.	ENSG00000143669	ENST00000389794;ENST00000389793	.	.	.	4.93	4.01	0.46588	.	0.385276	0.29707	N	0.011410	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.27082	T	0.32	.	8.5182	0.33259	0.0783:0.0:0.7696:0.1521	.	.	.	.	X	2237	.	ENSP00000374443:Q2237X	Q	-	1	0	LYST	233989067	1.000000	0.71417	0.990000	0.47175	0.992000	0.81027	6.946000	0.75953	1.209000	0.43321	0.558000	0.71614	CAG	LYST	-	superfamily_ARM-type_fold	ENSG00000143669		0.527	LYST-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LYST	HGNC	protein_coding	OTTHUMT00000097533.5	24	0.00	0	G			235922444	235922444	-1	no_errors	ENST00000389793	ensembl	human	known	69_37n	nonsense	20	13.04	3	SNP	1.000	A
MED24	9862	genome.wustl.edu	37	17	38189363	38189363	+	Silent	SNP	C	C	T			TCGA-A2-A0CR-01A-11D-A228-09	TCGA-A2-A0CR-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f573c3c3-7b61-4955-8772-215b7cb9a763	3bdb54b4-1e26-4274-a1bd-800416ffbd34	g.chr17:38189363C>T	ENST00000394128.2	-	8	849	c.768G>A	c.(766-768)ctG>ctA	p.L256L	MED24_ENST00000394127.2_Silent_p.L243L|MED24_ENST00000394126.1_Silent_p.L281L|MED24_ENST00000501516.3_Silent_p.L275L|MED24_ENST00000356271.3_Silent_p.L243L|MED24_ENST00000479829.1_5'Flank	NM_014815.3	NP_055630.2	O75448	MED24_HUMAN	mediator complex subunit 24	256					androgen receptor signaling pathway (GO:0030521)|gene expression (GO:0010467)|intracellular steroid hormone receptor signaling pathway (GO:0030518)|positive regulation of transcription, DNA-templated (GO:0045893)|protein heterooligomerization (GO:0051291)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|stem cell maintenance (GO:0019827)|transcription initiation from RNA polymerase II promoter (GO:0006367)	mediator complex (GO:0016592)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	histone acetyltransferase activity (GO:0004402)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|receptor activity (GO:0004872)|RNA polymerase II transcription cofactor activity (GO:0001104)|thyroid hormone receptor binding (GO:0046966)|transcription cofactor activity (GO:0003712)|vitamin D receptor binding (GO:0042809)			autonomic_ganglia(1)|breast(2)|endometrium(9)|large_intestine(10)|lung(14)|ovary(1)|prostate(2)|skin(1)|urinary_tract(1)	41	Colorectal(19;0.000442)					TCTCGCCTGTCAGGTTCATGG	0.637																																						dbGAP											0													61.0	52.0	55.0					17																	38189363		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF055995	CCDS11359.1, CCDS42315.1	17q21.2	2007-07-30	2007-07-30	2007-07-30	ENSG00000008838	ENSG00000008838			22963	protein-coding gene	gene with protein product		607000	"""thyroid hormone receptor associated protein 4"", ""cofactor required for Sp1 transcriptional activation, subunit 4, 100kDa"""	THRAP4, CRSP4			Standard	NM_001079518		Approved	TRAP100, KIAA0130, DRIP100, CRSP100	uc002htt.3	O75448	OTTHUMG00000133329	ENST00000394128.2:c.768G>A	17.37:g.38189363C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K4S5|B3KMR9|Q14143|Q9NNY5	Silent	SNP	pfam_Mediator_Med24_N	p.L256	ENST00000394128.2	37	c.768	CCDS11359.1	17																																																																																			MED24	-	pfam_Mediator_Med24_N	ENSG00000008838		0.637	MED24-006	KNOWN	basic|appris_principal|CCDS	protein_coding	MED24	HGNC	protein_coding	OTTHUMT00000257147.2	25	0.00	0	C	NM_014815		38189363	38189363	-1	no_errors	ENST00000394128	ensembl	human	known	69_37n	silent	35	22.22	10	SNP	1.000	T
MAP3K3	4215	genome.wustl.edu	37	17	61771096	61771096	+	Missense_Mutation	SNP	G	G	C			TCGA-A2-A0CR-01A-11D-A228-09	TCGA-A2-A0CR-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f573c3c3-7b61-4955-8772-215b7cb9a763	3bdb54b4-1e26-4274-a1bd-800416ffbd34	g.chr17:61771096G>C	ENST00000361733.3	+	16	2160	c.1840G>C	c.(1840-1842)Gag>Cag	p.E614Q	MAP3K3_ENST00000584573.1_Missense_Mutation_p.E641Q|MAP3K3_ENST00000577395.1_Missense_Mutation_p.E610Q|MAP3K3_ENST00000579585.1_Missense_Mutation_p.E645Q|MAP3K3_ENST00000361357.3_Missense_Mutation_p.E645Q	NM_002401.3	NP_002392.2	Q99759	M3K3_HUMAN	mitogen-activated protein kinase kinase kinase 3	614	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of MAPKK activity (GO:0000186)|intracellular signal transduction (GO:0035556)|MAPK cascade (GO:0000165)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|protein autophosphorylation (GO:0046777)	cytosol (GO:0005829)	ATP binding (GO:0005524)|MAP kinase kinase kinase activity (GO:0004709)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)			breast(1)|endometrium(4)|kidney(2)|large_intestine(6)|lung(10)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	28						ACCTTCAGCTGAGGAGCTGCT	0.612																																						dbGAP											0													73.0	70.0	71.0					17																	61771096		2203	4300	6503	-	-	-	SO:0001583	missense	0			U78876	CCDS32701.1, CCDS32702.1	17q	2011-06-09				ENSG00000198909		"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	6855	protein-coding gene	gene with protein product	"""MAP/ERK kinase kinase 3"", ""MAPK/ERK kinase kinase 3"""	602539		MEKK3		9006902	Standard	NM_002401		Approved	MAPKKK3	uc002jbf.3	Q99759		ENST00000361733.3:c.1840G>C	17.37:g.61771096G>C	ENSP00000354485:p.Glu614Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RCW2|D3DU15|Q5BKZ6|Q8N3I9	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_OPR_PB1,superfamily_Kinase-like_dom,smart_OPR_PB1,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.E645Q	ENST00000361733.3	37	c.1933	CCDS32702.1	17	.	.	.	.	.	.	.	.	.	.	G	16.50	3.141129	0.56936	.	.	ENSG00000198909	ENST00000361357;ENST00000361733	T;T	0.66815	-0.23;-0.23	4.69	4.69	0.59074	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.56426	0.1984	L	0.27975	0.815	0.80722	D	1	P;B;B;B	0.38395	0.629;0.372;0.425;0.22	B;B;B;B	0.38921	0.285;0.285;0.139;0.141	T	0.56505	-0.7968	10	0.29301	T	0.29	.	17.6147	0.88064	0.0:0.0:1.0:0.0	.	610;582;614;645	Q1PBM3;Q96HN9;Q99759;Q99759-2	.;.;M3K3_HUMAN;.	Q	645;614	ENSP00000354927:E645Q;ENSP00000354485:E614Q	ENSP00000354927:E645Q	E	+	1	0	MAP3K3	59124828	1.000000	0.71417	0.998000	0.56505	0.998000	0.95712	9.835000	0.99442	2.148000	0.66965	0.561000	0.74099	GAG	MAP3K3	-	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	ENSG00000198909		0.612	MAP3K3-004	KNOWN	basic|CCDS	protein_coding	MAP3K3	HGNC	protein_coding	OTTHUMT00000443867.1	63	0.00	0	G	NM_002401		61771096	61771096	+1	no_errors	ENST00000361357	ensembl	human	known	69_37n	missense	55	17.91	12	SNP	1.000	C
MGAM	8972	genome.wustl.edu	37	7	141793306	141793306	+	Intron	SNP	T	T	C	rs113458049	byFrequency	TCGA-A2-A0CR-01A-11D-A228-09	TCGA-A2-A0CR-10A-01D-A22A-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f573c3c3-7b61-4955-8772-215b7cb9a763	3bdb54b4-1e26-4274-a1bd-800416ffbd34	g.chr7:141793306T>C	ENST00000549489.2	+	39	4713				MGAM_ENST00000475668.2_Silent_p.N2376N	NM_004668.2	NP_004659.2	O43451	MGA_HUMAN	maltase-glucoamylase (alpha-glucosidase)						carbohydrate metabolic process (GO:0005975)|polysaccharide digestion (GO:0044245)|small molecule metabolic process (GO:0044281)|starch catabolic process (GO:0005983)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	alpha-1,4-glucosidase activity (GO:0004558)|amylase activity (GO:0016160)|carbohydrate binding (GO:0030246)|catalytic activity (GO:0003824)|glucan 1,4-alpha-glucosidase activity (GO:0004339)|maltose alpha-glucosidase activity (GO:0032450)			cervix(1)|endometrium(1)|large_intestine(4)|lung(3)|ovary(2)|skin(2)	13	Melanoma(164;0.0272)				Acarbose(DB00284)|Miglitol(DB00491)|Voglibose(DB04878)	AGCACTACAATGTGCACAACC	0.582													N|||	141	0.028155	0.0968	0.0187	5008	,	,		16488	0.0		0.0	False		,,,				2504	0.0					dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			AF016833	CCDS47727.1	7q34	2012-10-03			ENSG00000257335	ENSG00000257335			7043	protein-coding gene	gene with protein product		154360				9446624	Standard	NM_004668		Approved	MGA	uc003vwy.3	O43451	OTTHUMG00000158395	ENST00000549489.2:c.4619-1114T>C	7.37:g.141793306T>C		Somatic		WXS	Illumina GAIIx	Phase_IV	Q0VAX6|Q75ME7|Q86UM5	Silent	SNP	pfam_Glyco_hydro_31,pfam_P_trefoil,superfamily_Glycoside_hydrolase_SF,superfamily_Glyco_hydro-type_carb-bd,smart_P_trefoil	p.N2377	ENST00000549489.2	37	c.7131	CCDS47727.1	7																																																																																			MGAM	-	pfam_Glyco_hydro_31,superfamily_Glycoside_hydrolase_SF	ENSG00000257335		0.582	MGAM-001	KNOWN	basic|CCDS	protein_coding	MGAM	HGNC	protein_coding	OTTHUMT00000351244.3	30	0.00	0	T			141793306	141793306	+1	no_errors	ENST00000475668	ensembl	human	putative	69_37n	silent	36	10.00	4	SNP	0.140	C
MTPAP	55149	genome.wustl.edu	37	10	30653864	30653864	+	Silent	SNP	A	A	C			TCGA-A2-A0CR-01A-11D-A228-09	TCGA-A2-A0CR-10A-01D-A22A-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f573c3c3-7b61-4955-8772-215b7cb9a763	3bdb54b4-1e26-4274-a1bd-800416ffbd34	g.chr10:30653864A>C	ENST00000358107.4	-	2	317	c.318T>G	c.(316-318)ggT>ggG	p.G106G	MTPAP_ENST00000488290.1_5'UTR|AL161651.1_ENST00000408070.1_RNA|RN7SL241P_ENST00000482973.2_RNA			Q9NVV4	PAPD1_HUMAN	mitochondrial poly(A) polymerase	0					cell death (GO:0008219)|histone mRNA catabolic process (GO:0071044)|mRNA polyadenylation (GO:0006378)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|identical protein binding (GO:0042802)|magnesium ion binding (GO:0000287)|manganese ion binding (GO:0030145)|poly(A) RNA binding (GO:0044822)|polynucleotide adenylyltransferase activity (GO:0004652)|protein homodimerization activity (GO:0042803)|UTP binding (GO:0002134)			breast(1)|endometrium(5)|kidney(1)|large_intestine(8)|lung(13)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	33						ccccacccccacccccacAGA	0.652																																						dbGAP											0																																										-	-	-	SO:0001819	synonymous_variant	0			AL122121	CCDS7165.1	10p12.1	2014-01-30	2009-01-12	2009-01-12	ENSG00000107951	ENSG00000107951			25532	protein-coding gene	gene with protein product	"""TUTase1"""	613669	"""PAP associated domain containing 1"""	PAPD1		12239557, 15769737, 15547249	Standard	NM_018109		Approved	FLJ10486, mtPAP, SPAX4	uc001iva.4	Q9NVV4	OTTHUMG00000017895	ENST00000358107.4:c.318T>G	10.37:g.30653864A>C		Somatic		WXS	Illumina GAIIx	Phase_IV	D3DRX0|Q659E3|Q6P7E5|Q9HA74	Silent	SNP	pfam_PAP_assoc	p.G106	ENST00000358107.4	37	c.318		10																																																																																			MTPAP	-	NULL	ENSG00000107951		0.652	MTPAP-201	KNOWN	basic	protein_coding	MTPAP	HGNC	protein_coding		50	0.00	0	A	NM_018109		30653864	30653864	-1	no_errors	ENST00000358107	ensembl	human	known	69_37n	silent	22	52.08	25	SNP	0.011	C
MUC16	94025	genome.wustl.edu	37	19	9059907	9059907	+	Missense_Mutation	SNP	G	G	A			TCGA-A2-A0CR-01A-11D-A228-09	TCGA-A2-A0CR-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f573c3c3-7b61-4955-8772-215b7cb9a763	3bdb54b4-1e26-4274-a1bd-800416ffbd34	g.chr19:9059907G>A	ENST00000397910.4	-	3	27742	c.27539C>T	c.(27538-27540)tCa>tTa	p.S9180L		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	9182	Ser-rich.|Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						CACCAGCCCTGAGGTGAGAAG	0.507																																						dbGAP											0													100.0	94.0	96.0					19																	9059907		2020	4187	6207	-	-	-	SO:0001583	missense	0			AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.27539C>T	19.37:g.9059907G>A	ENSP00000381008:p.Ser9180Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6ZQW5|Q96RK2	Missense_Mutation	SNP	pfam_SEA,smart_SEA,pfscan_SEA	p.S9180L	ENST00000397910.4	37	c.27539	CCDS54212.1	19	.	.	.	.	.	.	.	.	.	.	g	6.131	0.392479	0.11638	.	.	ENSG00000181143	ENST00000397910	T	0.22945	1.93	2.47	-2.93	0.05598	.	.	.	.	.	T	0.09024	0.0223	N	0.03608	-0.345	.	.	.	B	0.12013	0.005	B	0.10450	0.005	T	0.26430	-1.0103	8	0.87932	D	0	.	2.0885	0.03651	0.1269:0.2648:0.4341:0.1743	.	9180	B5ME49	.	L	9180	ENSP00000381008:S9180L	ENSP00000381008:S9180L	S	-	2	0	MUC16	8920907	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	0.076000	0.14712	-0.520000	0.06435	-0.476000	0.04901	TCA	MUC16	-	NULL	ENSG00000181143		0.507	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MUC16	HGNC	protein_coding	OTTHUMT00000402806.1	46	0.00	0	G	NM_024690		9059907	9059907	-1	no_errors	ENST00000397910	ensembl	human	known	69_37n	missense	45	15.09	8	SNP	0.000	A
MYH2	4620	genome.wustl.edu	37	17	10450932	10450932	+	Silent	SNP	G	G	A			TCGA-A2-A0CR-01A-11D-A228-09	TCGA-A2-A0CR-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f573c3c3-7b61-4955-8772-215b7cb9a763	3bdb54b4-1e26-4274-a1bd-800416ffbd34	g.chr17:10450932G>A	ENST00000245503.5	-	4	592	c.208C>T	c.(208-210)Ctg>Ttg	p.L70L	CTC-297N7.11_ENST00000587182.2_RNA|MYH2_ENST00000397183.2_Silent_p.L70L|MYH2_ENST00000532183.2_Silent_p.L70L	NM_017534.5	NP_060004.3	Q9UKX2	MYH2_HUMAN	myosin, heavy chain 2, skeletal muscle, adult	70					Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|membrane organization (GO:0061024)|metabolic process (GO:0008152)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|plasma membrane repair (GO:0001778)|response to activity (GO:0014823)	A band (GO:0031672)|actomyosin contractile ring (GO:0005826)|cell-cell junction (GO:0005911)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|muscle myosin complex (GO:0005859)|myofibril (GO:0030016)|myosin filament (GO:0032982)|protein complex (GO:0043234)|sarcomere (GO:0030017)	ATP binding (GO:0005524)|microfilament motor activity (GO:0000146)			NS(1)|biliary_tract(1)|breast(9)|central_nervous_system(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(16)|lung(99)|ovary(6)|pancreas(4)|prostate(3)|skin(8)|upper_aerodigestive_tract(2)|urinary_tract(4)	176						TTCACTGTCAGAGTCTGGTAA	0.428																																						dbGAP											0													254.0	225.0	235.0					17																	10450932		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS11156.1	17p13.1	2014-02-04	2006-09-29		ENSG00000125414	ENSG00000125414		"""Myosins / Myosin superfamily : Class II"""	7572	protein-coding gene	gene with protein product		160740	"""myosin, heavy polypeptide 2, skeletal muscle, adult"", ""inclusion body myopathy 3, autosomal dominant"""	IBM3		7545970, 11889243	Standard	NM_001100112		Approved	MYH2A, MYHSA2, MyHC-IIa, MYHas8, MyHC-2A	uc010coi.3	Q9UKX2	OTTHUMG00000130363	ENST00000245503.5:c.208C>T	17.37:g.10450932G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A0AVL4|Q14322|Q16229|Q567P6|Q86T56	Silent	SNP	pfam_Myosin_tail,pfam_Myosin_head_motor_dom,pfam_Myosin_N,superfamily_Prefoldin,superfamily_Ribosomal_L29,superfamily_t-SNARE,smart_Myosin_head_motor_dom,smart_IQ_motif_EF-hand-BS,pfscan_IQ_motif_EF-hand-BS,prints_Myosin_head_motor_dom	p.L70	ENST00000245503.5	37	c.208	CCDS11156.1	17																																																																																			MYH2	-	pfam_Myosin_N	ENSG00000125414		0.428	MYH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYH2	HGNC	protein_coding	OTTHUMT00000252726.3	62	0.00	0	G	NM_017534		10450932	10450932	-1	no_errors	ENST00000245503	ensembl	human	known	69_37n	silent	42	12.50	6	SNP	0.025	A
NF1	4763	genome.wustl.edu	37	17	29528088	29528088	+	Nonsense_Mutation	SNP	A	A	T			TCGA-A2-A0CR-01A-11D-A228-09	TCGA-A2-A0CR-10A-01D-A22A-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f573c3c3-7b61-4955-8772-215b7cb9a763	3bdb54b4-1e26-4274-a1bd-800416ffbd34	g.chr17:29528088A>T	ENST00000358273.4	+	10	1479	c.1096A>T	c.(1096-1098)Aga>Tga	p.R366*	NF1_ENST00000356175.3_Nonsense_Mutation_p.R366*|NF1_ENST00000431387.4_Nonsense_Mutation_p.R366*	NM_001042492.2	NP_001035957.1	P21359	NF1_HUMAN	neurofibromin 1	366					actin cytoskeleton organization (GO:0030036)|adrenal gland development (GO:0030325)|artery morphogenesis (GO:0048844)|brain development (GO:0007420)|camera-type eye morphogenesis (GO:0048593)|cell communication (GO:0007154)|cerebral cortex development (GO:0021987)|cognition (GO:0050890)|collagen fibril organization (GO:0030199)|extracellular matrix organization (GO:0030198)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|forebrain astrocyte development (GO:0021897)|forebrain morphogenesis (GO:0048853)|heart development (GO:0007507)|liver development (GO:0001889)|MAPK cascade (GO:0000165)|metanephros development (GO:0001656)|myelination in peripheral nervous system (GO:0022011)|negative regulation of angiogenesis (GO:0016525)|negative regulation of astrocyte differentiation (GO:0048712)|negative regulation of cell migration (GO:0030336)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of endothelial cell proliferation (GO:0001937)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of neurotransmitter secretion (GO:0046929)|negative regulation of oligodendrocyte differentiation (GO:0048715)|negative regulation of osteoclast differentiation (GO:0045671)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of Rac protein signal transduction (GO:0035021)|negative regulation of Ras protein signal transduction (GO:0046580)|negative regulation of transcription factor import into nucleus (GO:0042992)|neural tube development (GO:0021915)|osteoblast differentiation (GO:0001649)|peripheral nervous system development (GO:0007422)|phosphatidylinositol 3-kinase signaling (GO:0014065)|pigmentation (GO:0043473)|positive regulation of adenylate cyclase activity (GO:0045762)|positive regulation of apoptotic process (GO:0043065)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001241)|positive regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902043)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of Ras GTPase activity (GO:0032320)|Ras protein signal transduction (GO:0007265)|regulation of angiogenesis (GO:0045765)|regulation of blood vessel endothelial cell migration (GO:0043535)|regulation of bone resorption (GO:0045124)|regulation of cell-matrix adhesion (GO:0001952)|regulation of glial cell differentiation (GO:0045685)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of Ras GTPase activity (GO:0032318)|regulation of synaptic transmission, GABAergic (GO:0032228)|response to hypoxia (GO:0001666)|Schwann cell development (GO:0014044)|skeletal muscle tissue development (GO:0007519)|smooth muscle tissue development (GO:0048745)|spinal cord development (GO:0021510)|sympathetic nervous system development (GO:0048485)|visual learning (GO:0008542)|wound healing (GO:0042060)	axon (GO:0030424)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|membrane (GO:0016020)|nucleus (GO:0005634)	phosphatidylcholine binding (GO:0031210)|phosphatidylethanolamine binding (GO:0008429)|Ras GTPase activator activity (GO:0005099)	p.0?(8)|p.?(6)	NF1/ACCN1(2)	autonomic_ganglia(12)|breast(11)|central_nervous_system(72)|cervix(6)|endometrium(12)|haematopoietic_and_lymphoid_tissue(59)|kidney(9)|large_intestine(39)|liver(1)|lung(80)|ovary(20)|pancreas(2)|prostate(2)|skin(8)|soft_tissue(249)|stomach(2)|thyroid(1)|upper_aerodigestive_tract(5)|urinary_tract(9)	599		all_cancers(10;1.29e-12)|all_epithelial(10;0.00347)|all_hematologic(16;0.00556)|Acute lymphoblastic leukemia(14;0.00593)|Breast(31;0.014)|Myeloproliferative disorder(56;0.0255)|all_lung(9;0.0321)|Lung NSC(157;0.0659)		UCEC - Uterine corpus endometrioid carcinoma (4;4.38e-05)|all cancers(4;1.64e-26)|Epithelial(4;9.15e-23)|OV - Ovarian serous cystadenocarcinoma(4;3.58e-21)|GBM - Glioblastoma multiforme(4;0.00146)		GCCATTCTCAAGAGGCAGTCA	0.388			"""D, Mis, N, F, S, O"""		"""neurofibroma, glioma"""	"""neurofibroma, glioma"""			Neurofibromatosis, type 1	TCGA GBM(6;<1E-08)|TSP Lung(7;0.0071)|TCGA Ovarian(3;0.0088)																												dbGAP	yes	Rec	yes	Neurofibromatosis type 1	17	17q12	4763	neurofibromatosis type 1 gene		O	14	Whole gene deletion(8)|Unknown(6)	soft_tissue(7)|autonomic_ganglia(3)|central_nervous_system(3)|lung(1)	GRCh37	CM900171	NF1	M							73.0	69.0	70.0					17																	29528088		2203	4299	6502	-	-	-	SO:0001587	stop_gained	0	Familial Cancer Database	NF1, von Recklinghausen disease, incl.: Hereditary Spinal Neurofibromatosis, Neurofibromatosis-Noonan syndrome		CCDS11264.1, CCDS42292.1, CCDS45645.1	17q11.2	2014-09-17	2008-07-31		ENSG00000196712	ENSG00000196712			7765	protein-coding gene	gene with protein product	"""neurofibromatosis"", ""von Recklinghausen disease"", ""Watson disease"""	613113				1715669	Standard	NM_000267		Approved		uc002hgg.3	P21359	OTTHUMG00000132871	ENST00000358273.4:c.1096A>T	17.37:g.29528088A>T	ENSP00000351015:p.Arg366*	Somatic		WXS	Illumina GAIIx	Phase_IV	O00662|Q14284|Q14930|Q14931|Q9UMK3	Nonsense_Mutation	SNP	pfam_RasGAP,superfamily_Rho_GTPase_activation_prot,superfamily_ARM-type_fold,superfamily_CRAL-TRIO_dom,smart_RasGAP,smart_CRAL-TRIO_dom,pfscan_CRAL-TRIO_dom,pfscan_RasGAP	p.R366*	ENST00000358273.4	37	c.1096	CCDS42292.1	17	.	.	.	.	.	.	.	.	.	.	A	35	5.552470	0.96501	.	.	ENSG00000196712	ENST00000431387;ENST00000358273;ENST00000356175;ENST00000456735	.	.	.	5.63	5.63	0.86233	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	15.8344	0.78787	1.0:0.0:0.0:0.0	.	.	.	.	X	366;366;366;32	.	ENSP00000348498:R366X	R	+	1	2	NF1	26552214	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	4.281000	0.58965	2.147000	0.66899	0.482000	0.46254	AGA	NF1	-	superfamily_ARM-type_fold	ENSG00000196712		0.388	NF1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NF1	HGNC	protein_coding	OTTHUMT00000256351.2	63	0.00	0	A	NM_000267		29528088	29528088	+1	no_errors	ENST00000358273	ensembl	human	known	69_37n	nonsense	44	10.20	5	SNP	1.000	T
NOTO	344022	genome.wustl.edu	37	2	73429814	73429814	+	Missense_Mutation	SNP	G	G	A			TCGA-A2-A0CR-01A-11D-A228-09	TCGA-A2-A0CR-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f573c3c3-7b61-4955-8772-215b7cb9a763	3bdb54b4-1e26-4274-a1bd-800416ffbd34	g.chr2:73429814G>A	ENST00000398468.3	+	1	429	c.20G>A	c.(19-21)cGa>cAa	p.R7Q		NM_001134462.1	NP_001127934.1	A8MTQ0	NOTO_HUMAN	notochord homeobox	7	Pro-rich.				cilium morphogenesis (GO:0060271)|determination of left/right symmetry (GO:0007368)|dorsal/ventral pattern formation (GO:0009953)|embryonic pattern specification (GO:0009880)|notochord development (GO:0030903)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)			endometrium(2)	2						CCCAGGCCGCGAGGCAGCCCG	0.711																																						dbGAP											0													1.0	3.0	2.0					2																	73429814		417	1142	1559	-	-	-	SO:0001583	missense	0				CCDS46335.1	2p13.2	2011-06-20	2007-02-15		ENSG00000214513	ENSG00000214513		"""Homeoboxes / ANTP class : NKL subclass"""	31839	protein-coding gene	gene with protein product			"""notochord homolog (Xenopus laevis)"""			15231714	Standard	NM_001134462		Approved		uc010yrd.2	A8MTQ0	OTTHUMG00000164128	ENST00000398468.3:c.20G>A	2.37:g.73429814G>A	ENSP00000381486:p.Arg7Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DJ59|B7ZAU5	Missense_Mutation	SNP	pfam_Homeodomain,superfamily_Homeodomain-like,smart_Homeodomain,pfscan_Homeodomain	p.R7Q	ENST00000398468.3	37	c.20	CCDS46335.1	2	.	.	.	.	.	.	.	.	.	.	G	6.832	0.522718	0.13066	.	.	ENSG00000214513	ENST00000398468	D	0.92048	-2.96	1.81	-1.46	0.08800	.	.	.	.	.	T	0.73273	0.3566	N	0.08118	0	0.09310	N	1	P	0.49090	0.919	B	0.26517	0.07	T	0.69435	-0.5146	9	0.33141	T	0.24	.	5.0524	0.14514	0.0:0.4396:0.3371:0.2233	.	7	A8MTQ0	NOTO_HUMAN	Q	7	ENSP00000381486:R7Q	ENSP00000381486:R7Q	R	+	2	0	NOTO	73283322	0.000000	0.05858	0.000000	0.03702	0.011000	0.07611	-0.748000	0.04818	-0.477000	0.06832	-2.591000	0.00164	CGA	NOTO	-	NULL	ENSG00000214513		0.711	NOTO-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NOTO	HGNC	protein_coding	OTTHUMT00000377385.2	23	0.00	0	G	XM_292889		73429814	73429814	+1	no_errors	ENST00000398468	ensembl	human	known	69_37n	missense	18	28.00	7	SNP	0.000	A
NUP85	79902	genome.wustl.edu	37	17	73204681	73204681	+	Silent	SNP	G	G	A			TCGA-A2-A0CR-01A-11D-A228-09	TCGA-A2-A0CR-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f573c3c3-7b61-4955-8772-215b7cb9a763	3bdb54b4-1e26-4274-a1bd-800416ffbd34	g.chr17:73204681G>A	ENST00000245544.4	+	2	164	c.93G>A	c.(91-93)gaG>gaA	p.E31E	NUP85_ENST00000449421.2_Intron|NUP85_ENST00000579298.1_Silent_p.E31E|NUP85_ENST00000541827.1_Intron|NUP85_ENST00000579324.1_Intron|NUP85_ENST00000447371.2_De_novo_Start_OutOfFrame	NM_024844.3	NP_079120.1	Q9BW27	NUP85_HUMAN	nucleoporin 85kDa	31					carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|lamellipodium assembly (GO:0030032)|macrophage chemotaxis (GO:0048246)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|protein transport (GO:0015031)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|kinetochore (GO:0000776)|membrane (GO:0016020)|nuclear envelope (GO:0005635)|nuclear pore outer ring (GO:0031080)				endometrium(1)|kidney(1)|large_intestine(4)|lung(4)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	16	all_lung(278;0.14)|Lung NSC(278;0.168)		all cancers(21;3.45e-06)			GTCCAGGGGAGATGCTGGTAT	0.363																																						dbGAP											0													165.0	180.0	175.0					17																	73204681		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF514995	CCDS32730.1	17q25	2006-11-29	2005-11-03	2005-11-03		ENSG00000125450			8734	protein-coding gene	gene with protein product		170285				8124707	Standard	XM_005257690		Approved	NUP75, FLJ12549	uc002jng.1	Q9BW27		ENST00000245544.4:c.93G>A	17.37:g.73204681G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B4DMQ3|B4DPW1|Q8NDI4|Q9H9U1	Silent	SNP	pfam_Nucleoporin_Nup85	p.E31	ENST00000245544.4	37	c.93	CCDS32730.1	17																																																																																			NUP85	-	NULL	ENSG00000125450		0.363	NUP85-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NUP85	HGNC	protein_coding	OTTHUMT00000446619.1	55	0.00	0	G	NM_024844		73204681	73204681	+1	no_errors	ENST00000245544	ensembl	human	known	69_37n	silent	46	14.81	8	SNP	1.000	A
OR52E4	390081	genome.wustl.edu	37	11	5906158	5906158	+	Silent	SNP	G	G	C	rs145588560		TCGA-A2-A0CR-01A-11D-A228-09	TCGA-A2-A0CR-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f573c3c3-7b61-4955-8772-215b7cb9a763	3bdb54b4-1e26-4274-a1bd-800416ffbd34	g.chr11:5906158G>C	ENST00000316987.2	+	1	658	c.636G>C	c.(634-636)gtG>gtC	p.V212V		NM_001005165.1	NP_001005165.1	Q8NGH9	O52E4_HUMAN	olfactory receptor, family 52, subfamily E, member 4	212						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			autonomic_ganglia(1)|endometrium(1)|kidney(1)|large_intestine(7)|liver(2)|lung(13)|ovary(2)|prostate(1)|skin(2)	30		Medulloblastoma(188;0.00776)|all_neural(188;0.0652)|Breast(177;0.114)		Epithelial(150;1.24e-08)|BRCA - Breast invasive adenocarcinoma(625;0.135)		TTGTGGATGTGATCTTAATTG	0.453																																						dbGAP											0													327.0	279.0	295.0					11																	5906158		2201	4296	6497	-	-	-	SO:0001819	synonymous_variant	0			AB065817	CCDS31401.1	11p15.4	2012-08-09			ENSG00000180974	ENSG00000180974		"""GPCR / Class A : Olfactory receptors"""	15213	protein-coding gene	gene with protein product							Standard	NM_001005165		Approved		uc010qzs.2	Q8NGH9	OTTHUMG00000168804	ENST00000316987.2:c.636G>C	11.37:g.5906158G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	Q6IFG0	Silent	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	p.V212	ENST00000316987.2	37	c.636	CCDS31401.1	11																																																																																			OR52E4	-	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,prints_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	ENSG00000180974		0.453	OR52E4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR52E4	HGNC	protein_coding	OTTHUMT00000401146.1	54	0.00	0	G	NM_001005165		5906158	5906158	+1	no_errors	ENST00000316987	ensembl	human	known	69_37n	silent	67	10.67	8	SNP	0.016	C
OR1S2	219958	genome.wustl.edu	37	11	57971579	57971579	+	Silent	SNP	G	G	A			TCGA-A2-A0CR-01A-11D-A228-09	TCGA-A2-A0CR-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f573c3c3-7b61-4955-8772-215b7cb9a763	3bdb54b4-1e26-4274-a1bd-800416ffbd34	g.chr11:57971579G>A	ENST00000302592.6	-	1	74	c.75C>T	c.(73-75)ttC>ttT	p.F25F		NM_001004459.1	NP_001004459.1	Q8NGQ3	OR1S2_HUMAN	olfactory receptor, family 1, subfamily S, member 2	25						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(11)|kidney(1)|large_intestine(4)|lung(23)|ovary(2)|skin(2)|stomach(2)|urinary_tract(1)	46		Breast(21;0.0589)				CCAGGAGAATGAATTCAGTGA	0.423																																						dbGAP											0													153.0	151.0	152.0					11																	57971579		2201	4296	6497	-	-	-	SO:0001819	synonymous_variant	0			BK004297	CCDS31545.1	11q12.1	2012-08-09			ENSG00000197887	ENSG00000197887		"""GPCR / Class A : Olfactory receptors"""	15141	protein-coding gene	gene with protein product							Standard	NM_001004459		Approved		uc010rkb.2	Q8NGQ3	OTTHUMG00000167541	ENST00000302592.6:c.75C>T	11.37:g.57971579G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q6IFG5|Q96R85	Silent	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.F25	ENST00000302592.6	37	c.75	CCDS31545.1	11																																																																																			OR1S2	-	NULL	ENSG00000197887		0.423	OR1S2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR1S2	HGNC	protein_coding	OTTHUMT00000394703.2	77	0.00	0	G	NM_001004459		57971579	57971579	-1	no_errors	ENST00000302592	ensembl	human	known	69_37n	silent	72	11.11	9	SNP	0.996	A
PCDHGC5	56097	genome.wustl.edu	37	5	140871163	140871163	+	Missense_Mutation	SNP	G	G	A			TCGA-A2-A0CR-01A-11D-A228-09	TCGA-A2-A0CR-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f573c3c3-7b61-4955-8772-215b7cb9a763	3bdb54b4-1e26-4274-a1bd-800416ffbd34	g.chr5:140871163G>A	ENST00000252087.1	+	1	2356	c.2356G>A	c.(2356-2358)Gac>Aac	p.D786N	PCDHGA6_ENST00000517434.1_Intron|PCDHGA10_ENST00000398610.2_Intron|PCDHGA8_ENST00000398604.2_Intron|PCDHGC4_ENST00000306593.1_Intron|PCDHGA7_ENST00000518325.1_Intron|PCDHGC3_ENST00000308177.3_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGB1_ENST00000523390.1_Intron|PCDHGB2_ENST00000522605.1_Intron|PCDHGA11_ENST00000518882.1_Intron|PCDHGB7_ENST00000398594.2_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGA9_ENST00000573521.1_Intron|PCDHGB6_ENST00000520790.1_Intron|PCDHGA12_ENST00000252085.3_Intron|PCDHGA4_ENST00000571252.1_Intron|PCDHGA11_ENST00000398587.2_Intron|PCDHGA5_ENST00000518069.1_Intron|PCDHGA3_ENST00000253812.6_Intron|PCDHGB4_ENST00000519479.1_Intron|PCDHGB3_ENST00000576222.1_Intron	NM_018929.2|NM_032403.2|NM_032407.1	NP_061752.1|NP_115779.1|NP_115783.1	Q9Y5F6	PCDGM_HUMAN	protocadherin gamma subfamily C, 5	786					homophilic cell adhesion (GO:0007156)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(2)|central_nervous_system(2)|endometrium(6)|kidney(4)|large_intestine(4)|lung(10)|ovary(4)|prostate(1)|urinary_tract(2)	35			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GGACGGCAGTGACTTCACTTT	0.632																																						dbGAP											0													38.0	40.0	40.0					5																	140871163		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF152526	CCDS4263.1, CCDS75350.1	5q31	2010-01-26			ENSG00000240764	ENSG00000240764		"""Cadherins / Protocadherins : Clustered"""	8718	other	protocadherin		606306				10380929	Standard	NM_018929		Approved	PCDH-GAMMA-C5	uc003lla.2	Q9Y5F6	OTTHUMG00000129624	ENST00000252087.1:c.2356G>A	5.37:g.140871163G>A	ENSP00000252087:p.Asp786Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	Q9Y5C2	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.D786N	ENST00000252087.1	37	c.2356	CCDS4263.1	5	.	.	.	.	.	.	.	.	.	.	G	20.5	4.002653	0.74932	.	.	ENSG00000240764	ENST00000252087	T	0.52754	0.65	5.38	4.5	0.54988	.	0.000000	0.49305	D	0.000151	T	0.58878	0.2153	M	0.75085	2.285	0.44595	D	0.997568	D;P	0.53312	0.959;0.846	P;B	0.50659	0.647;0.221	T	0.65656	-0.6115	10	0.72032	D	0.01	.	14.4133	0.67132	0.0721:0.0:0.9279:0.0	.	786;786	Q9Y5F6-2;Q9Y5F6	.;PCDGM_HUMAN	N	786	ENSP00000252087:D786N	ENSP00000252087:D786N	D	+	1	0	PCDHGC5	140851347	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	6.195000	0.72088	1.260000	0.44134	0.505000	0.49811	GAC	PCDHGC5	-	NULL	ENSG00000240764		0.632	PCDHGC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHGC5	HGNC	protein_coding	OTTHUMT00000251819.1	37	0.00	0	G	NM_018929		140871163	140871163	+1	no_errors	ENST00000252087	ensembl	human	known	69_37n	missense	55	15.38	10	SNP	1.000	A
PCSK5	5125	genome.wustl.edu	37	9	78973680	78973680	+	Missense_Mutation	SNP	G	G	C			TCGA-A2-A0CR-01A-11D-A228-09	TCGA-A2-A0CR-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f573c3c3-7b61-4955-8772-215b7cb9a763	3bdb54b4-1e26-4274-a1bd-800416ffbd34	g.chr9:78973680G>C	ENST00000545128.1	+	37	5963	c.5425G>C	c.(5425-5427)Gag>Cag	p.E1809Q		NM_001190482.1	NP_001177411.1	Q92824	PCSK5_HUMAN	proprotein convertase subtilisin/kexin type 5	1809	AC 1. {ECO:0000250}.				anterior/posterior pattern specification (GO:0009952)|cell-cell signaling (GO:0007267)|cytokine biosynthetic process (GO:0042089)|embryo implantation (GO:0007566)|embryonic digestive tract development (GO:0048566)|embryonic skeletal system development (GO:0048706)|heart development (GO:0007507)|kidney development (GO:0001822)|limb morphogenesis (GO:0035108)|nerve growth factor processing (GO:0032455)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptide biosynthetic process (GO:0043043)|peptide hormone processing (GO:0016486)|protein processing (GO:0016485)|renin secretion into blood stream (GO:0002001)|respiratory tube development (GO:0030323)|signal peptide processing (GO:0006465)|viral life cycle (GO:0019058)	extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|secretory granule (GO:0030141)	peptidase activity (GO:0008233)|peptide binding (GO:0042277)|serine-type endopeptidase activity (GO:0004252)			NS(1)|breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(7)|liver(2)|lung(25)|ovary(2)|pancreas(1)|prostate(2)|skin(3)	55						TCAGGTGATTGAGTACAGGGA	0.483																																						dbGAP											0													331.0	294.0	305.0					9																	78973680		876	1991	2867	-	-	-	SO:0001583	missense	0				CCDS6652.1, CCDS55320.1	9q21.13	2013-09-24			ENSG00000099139	ENSG00000099139			8747	protein-coding gene	gene with protein product		600488				7782070	Standard	NM_001190482		Approved	PC5, PC6, SPC6	uc004akc.2	Q92824	OTTHUMG00000020039	ENST00000545128.1:c.5425G>C	9.37:g.78973680G>C	ENSP00000446280:p.Glu1809Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	F5H2G7|Q13527|Q96EP4	Missense_Mutation	SNP	pfam_Peptidase_S8/S53,pfam_PrprotnconvertsP,superfamily_Peptidase_S8/S53,superfamily_Galactose-bd-like,superfamily_Growth_fac_rcpt,superfamily_Prot_inh_propept,smart_Furin_repeat,smart_EGF-like,prints_Peptidase_S8_subtilisin-rel	p.E1809Q	ENST00000545128.1	37	c.5425	CCDS55320.1	9	.	.	.	.	.	.	.	.	.	.	G	27.4	4.828720	0.90955	.	.	ENSG00000099139	ENST00000545128;ENST00000376754;ENST00000424854	T;T	0.52057	0.68;1.53	5.78	5.78	0.91487	.	0.304429	0.31884	N	0.006910	T	0.65637	0.2710	M	0.66939	2.045	0.58432	D	0.999995	.	.	.	.	.	.	T	0.64309	-0.6438	8	0.52906	T	0.07	-29.1038	19.6001	0.95559	0.0:0.0:1.0:0.0	.	.	.	.	Q	1809;1539;1509	ENSP00000446280:E1809Q;ENSP00000411654:E1509Q	ENSP00000365945:E1539Q	E	+	1	0	PCSK5	78163500	1.000000	0.71417	0.998000	0.56505	0.978000	0.69477	6.724000	0.74747	2.739000	0.93911	0.561000	0.74099	GAG	PCSK5	-	NULL	ENSG00000099139		0.483	PCSK5-201	KNOWN	basic|appris_principal|CCDS	protein_coding	PCSK5	HGNC	protein_coding		39	0.00	0	G			78973680	78973680	+1	no_errors	ENST00000545128	ensembl	human	known	69_37n	missense	37	21.28	10	SNP	1.000	C
PEX11A	8800	genome.wustl.edu	37	15	90233925	90233925	+	5'UTR	SNP	C	C	G			TCGA-A2-A0CR-01A-11D-A228-09	TCGA-A2-A0CR-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f573c3c3-7b61-4955-8772-215b7cb9a763	3bdb54b4-1e26-4274-a1bd-800416ffbd34	g.chr15:90233925C>G	ENST00000300056.3	-	0	88				WDR93_ENST00000558000.1_5'Flank|PEX11A_ENST00000561224.1_5'UTR|PEX11A_ENST00000561257.1_5'Flank|WDR93_ENST00000268130.7_5'Flank|WDR93_ENST00000560294.1_5'Flank|PEX11A_ENST00000557982.1_5'UTR|PEX11A_ENST00000559170.1_5'UTR	NM_001271573.1	NP_001258502.1	O75192	PX11A_HUMAN	peroxisomal biogenesis factor 11 alpha						brown fat cell differentiation (GO:0050873)|cellular lipid metabolic process (GO:0044255)|peroxisome fission (GO:0016559)|peroxisome membrane biogenesis (GO:0016557)|peroxisome organization (GO:0007031)|regulation of peroxisome size (GO:0044375)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	integral component of peroxisomal membrane (GO:0005779)|peroxisomal membrane (GO:0005778)|peroxisome (GO:0005777)|protein complex (GO:0043234)	protein homodimerization activity (GO:0042803)			endometrium(2)|large_intestine(2)|lung(3)	7	Lung NSC(78;0.0237)|all_lung(78;0.0478)		KIRC - Kidney renal clear cell carcinoma(17;0.0286)|Kidney(142;0.0514)|BRCA - Breast invasive adenocarcinoma(143;0.128)			TGGGGCCCGTCGGATCCCCAG	0.662																																						dbGAP											0													16.0	19.0	18.0					15																	90233925		689	1589	2278	-	-	-	SO:0001623	5_prime_UTR_variant	0			AF093668	CCDS10354.1, CCDS61751.1	15q	2008-08-26	2008-08-26		ENSG00000166821	ENSG00000166821			8852	protein-coding gene	gene with protein product		603866	"""peroxisomal biogenesis factor 11A"""			9792670	Standard	NM_003847		Approved	PEX11-ALPHA, MGC119947, MGC138534	uc002boi.4	O75192	OTTHUMG00000149809	ENST00000300056.3:c.-62G>C	15.37:g.90233925C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	B4DV88	RNA	SNP	-	NULL	ENST00000300056.3	37	NULL	CCDS10354.1	15																																																																																			PEX11A	-	-	ENSG00000166821		0.662	PEX11A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PEX11A	HGNC	protein_coding	OTTHUMT00000313420.1	36	0.00	0	C	NM_003847		90233925	90233925	-1	no_errors	ENST00000557982	ensembl	human	known	69_37n	rna	48	11.11	6	SNP	0.000	G
PIK3CA	5290	genome.wustl.edu	37	3	178936082	178936082	+	Missense_Mutation	SNP	G	G	A	rs121913273		TCGA-A2-A0CR-01A-11D-A228-09	TCGA-A2-A0CR-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f573c3c3-7b61-4955-8772-215b7cb9a763	3bdb54b4-1e26-4274-a1bd-800416ffbd34	g.chr3:178936082G>A	ENST00000263967.3	+	10	1781	c.1624G>A	c.(1624-1626)Gaa>Aaa	p.E542K		NM_006218.2	NP_006209.2	P42336	PK3CA_HUMAN	phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit alpha	542	PIK helical. {ECO:0000255|PROSITE- ProRule:PRU00878}.		E -> K (in CLOVE, KERSEB, CRC and BC; also found in glioblastoma multiforme and endometrial carcinoma; shows an increase in lipid kinase activity; oncogenic in vivo; occurs in the interface between the PI3K helical domain and the nSH2 (N- terminal SH2) region of the p85 regulatory subunit and may reduce the inhibitory effect of p85; requires interaction with RAS to induce cellular transformation). {ECO:0000269|PubMed:15289301, ECO:0000269|PubMed:15784156, ECO:0000269|PubMed:15924253, ECO:0000269|PubMed:15994075, ECO:0000269|PubMed:16322209, ECO:0000269|PubMed:16353168, ECO:0000269|PubMed:16533766, ECO:0000269|PubMed:17673550, ECO:0000269|PubMed:22658544}.|E -> Q (found in an endometrial carcinoma sample; unknown pathological significance). {ECO:0000269|PubMed:16322209}.|E -> V (in BC; unknown pathological significance). {ECO:0000269|PubMed:16353168}.		angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|endothelial cell migration (GO:0043542)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glucose metabolic process (GO:0006006)|hypomethylation of CpG island (GO:0044029)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|insulin receptor signaling pathway via phosphatidylinositol 3-kinase (GO:0038028)|leukocyte migration (GO:0050900)|negative regulation of anoikis (GO:2000811)|negative regulation of fibroblast apoptotic process (GO:2000270)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol phosphorylation (GO:0046854)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|platelet activation (GO:0030168)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|protein kinase B signaling (GO:0043491)|regulation of genetic imprinting (GO:2000653)|regulation of multicellular organism growth (GO:0040014)|small molecule metabolic process (GO:0044281)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)|vasculature development (GO:0001944)	1-phosphatidylinositol-4-phosphate 3-kinase, class IA complex (GO:0005943)|cytosol (GO:0005829)|lamellipodium (GO:0030027)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|kinase activity (GO:0016301)|phosphatidylinositol 3-kinase activity (GO:0035004)|phosphatidylinositol-4,5-bisphosphate 3-kinase activity (GO:0046934)|protein kinase activator activity (GO:0030295)|protein serine/threonine kinase activity (GO:0004674)	p.E542K(545)|p.E542Q(10)		NS(16)|autonomic_ganglia(4)|biliary_tract(22)|bone(1)|breast(2150)|central_nervous_system(110)|cervix(33)|endometrium(473)|eye(1)|haematopoietic_and_lymphoid_tissue(35)|kidney(14)|large_intestine(1202)|liver(42)|lung(202)|meninges(1)|oesophagus(28)|ovary(235)|pancreas(17)|penis(8)|pituitary(12)|prostate(10)|skin(155)|small_intestine(1)|soft_tissue(18)|stomach(121)|thyroid(80)|upper_aerodigestive_tract(70)|urinary_tract(208)	5269	all_cancers(143;1.19e-17)|Ovarian(172;0.00769)|Breast(254;0.155)		OV - Ovarian serous cystadenocarcinoma(80;9.59e-28)|GBM - Glioblastoma multiforme(14;0.003)|BRCA - Breast invasive adenocarcinoma(182;0.0282)		Caffeine(DB00201)	TCCTCTCTCTGAAATCACTGA	0.333	E542K(BT483_BREAST)|E542K(CAL51_BREAST)|E542K(HGC27_STOMACH)|E542K(IM95_STOMACH)|E542K(JHUEM1_ENDOMETRIUM)|E542K(NCIH1341_LUNG)|E542K(SW948_LARGE_INTESTINE)|E542K(T84_LARGE_INTESTINE)|E542K(VMCUB1_URINARY_TRACT)	57	Mis		"""colorectal, gastric, gliobastoma, breast"""					HNSCC(19;0.045)|TSP Lung(28;0.18)																											Colon(199;1504 1750 3362 26421 31210 32040)	dbGAP		Dom	yes		3	3q26.3	5290	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""		"""E, O"""	555	Substitution - Missense(555)	breast(176)|large_intestine(166)|urinary_tract(45)|endometrium(37)|skin(19)|lung(18)|stomach(16)|ovary(16)|thyroid(14)|upper_aerodigestive_tract(9)|central_nervous_system(7)|cervix(6)|liver(6)|oesophagus(5)|penis(4)|kidney(3)|soft_tissue(2)|haematopoietic_and_lymphoid_tissue(2)|prostate(2)|biliary_tract(1)|pituitary(1)											56.0	56.0	56.0					3																	178936082		1809	4069	5878	-	-	-	SO:0001583	missense	0				CCDS43171.1	3q26.3	2014-09-17	2012-07-13		ENSG00000121879	ENSG00000121879	2.7.1.153		8975	protein-coding gene	gene with protein product		171834	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""			1322797	Standard	NM_006218		Approved	PI3K	uc003fjk.3	P42336	OTTHUMG00000157311	ENST00000263967.3:c.1624G>A	3.37:g.178936082G>A	ENSP00000263967:p.Glu542Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q14CW1|Q99762	Missense_Mutation	SNP	pfam_PInositide-3_kin_accessory_dom,pfam_PI3/4_kinase_cat_dom,pfam_PI3K_Ras-bd_dom,pfam_PI3K_C2_dom,pfam_PI3K_adapt-bd_dom,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_PI3K_adapt-bd_dom,smart_PI3K_Ras-bd_dom,smart_PI3K_C2_dom,smart_PInositide-3_kin_accessory_dom,smart_PI3/4_kinase_cat_dom,pfscan_PI3/4_kinase_cat_dom	p.E542K	ENST00000263967.3	37	c.1624	CCDS43171.1	3	.	.	.	.	.	.	.	.	.	.	G	34	5.360420	0.95877	.	.	ENSG00000121879	ENST00000263967	T	0.62105	0.05	5.78	5.78	0.91487	Phosphoinositide 3-kinase, accessory (PIK) domain (3);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.69287	0.3094	L	0.41356	1.27	0.80722	D	1	D	0.65815	0.995	D	0.63192	0.912	T	0.60296	-0.7291	10	0.09843	T	0.71	-23.9623	20.0024	0.97423	0.0:0.0:1.0:0.0	.	542	P42336	PK3CA_HUMAN	K	542	ENSP00000263967:E542K	ENSP00000263967:E542K	E	+	1	0	PIK3CA	180418776	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	9.476000	0.97823	2.722000	0.93159	0.467000	0.42956	GAA	PIK3CA	-	pfam_PInositide-3_kin_accessory_dom,superfamily_ARM-type_fold,smart_PInositide-3_kin_accessory_dom	ENSG00000121879		0.333	PIK3CA-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	PIK3CA	HGNC	protein_coding	OTTHUMT00000348409.2	44	0.00	0	G			178936082	178936082	+1	no_errors	ENST00000263967	ensembl	human	known	69_37n	missense	48	12.73	7	SNP	1.000	A
PPFIA2	8499	genome.wustl.edu	37	12	81762938	81762938	+	Missense_Mutation	SNP	C	C	G			TCGA-A2-A0CR-01A-11D-A228-09	TCGA-A2-A0CR-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f573c3c3-7b61-4955-8772-215b7cb9a763	3bdb54b4-1e26-4274-a1bd-800416ffbd34	g.chr12:81762938C>G	ENST00000549396.1	-	12	1462	c.1302G>C	c.(1300-1302)atG>atC	p.M434I	PPFIA2_ENST00000541570.2_Start_Codon_SNP_p.M1I|PPFIA2_ENST00000333447.7_Missense_Mutation_p.M416I|PPFIA2_ENST00000550584.2_Missense_Mutation_p.M434I|PPFIA2_ENST00000549325.1_Missense_Mutation_p.M416I|PPFIA2_ENST00000443686.3_Missense_Mutation_p.M335I|PPFIA2_ENST00000552948.1_Missense_Mutation_p.M434I|PPFIA2_ENST00000545296.2_Intron|PPFIA2_ENST00000407050.4_Missense_Mutation_p.M360I|PPFIA2_ENST00000541017.1_5'UTR|PPFIA2_ENST00000548586.1_Missense_Mutation_p.M434I|PPFIA2_ENST00000550359.2_Missense_Mutation_p.M281I	NM_001220476.1|NM_001282536.1|NM_003625.3	NP_001207405.1|NP_001269465.1|NP_003616.2	O75334	LIPA2_HUMAN	protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), alpha 2	434	Glu-rich.				cell-matrix adhesion (GO:0007160)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|presynaptic active zone (GO:0048786)				NS(1)|autonomic_ganglia(1)|central_nervous_system(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(15)|lung(37)|ovary(3)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(5)	85						CTAAATGTCTCATACGTTCTT	0.323																																						dbGAP											0													110.0	101.0	104.0					12																	81762938		1824	4077	5901	-	-	-	SO:0001583	missense	0			AF034799	CCDS55850.1, CCDS55851.1, CCDS55852.1, CCDS55853.1, CCDS55854.1, CCDS55855.1, CCDS55856.1, CCDS55857.1, CCDS59236.1, CCDS73503.1	12q21.31	2013-01-10						"""Sterile alpha motif (SAM) domain containing"""	9246	protein-coding gene	gene with protein product	"""Liprin-alpha2"""	603143				9624153	Standard	NM_003625		Approved		uc031qis.1	O75334		ENST00000549396.1:c.1302G>C	12.37:g.81762938C>G	ENSP00000450337:p.Met434Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KVT5|B3KXA0|B7Z2A6|B7Z3U9|B7Z663|B7ZKZ5|E7ERB8|E7ETG6|F8VP68|Q2M3G8	Missense_Mutation	SNP	pfam_SAM_type1,pfam_SAM_2,superfamily_SAM/pointed,smart_SAM,pfscan_SAM	p.M434I	ENST00000549396.1	37	c.1302	CCDS55857.1	12	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	10.19|10.19	1.282003|1.282003	0.23392|0.23392	.|.	.|.	ENSG00000139220|ENSG00000139220	ENST00000549396;ENST00000549325;ENST00000541570;ENST00000407050;ENST00000541501;ENST00000333447;ENST00000548586;ENST00000443686;ENST00000552948;ENST00000553058;ENST00000548670|ENST00000548790	T;T;T;T;T;T;T;T;T|.	0.76060|.	1.27;1.27;2.04;1.27;-0.99;1.27;1.27;1.27;1.27|.	5.39|5.39	5.39|5.39	0.77823|0.77823	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|.	0.47340|.	0.1440|.	N|N	0.05487|0.05487	-0.04|-0.04	0.80722|0.80722	D|D	1|1	P|.	0.35872|.	0.525|.	P|.	0.45428|.	0.48|.	T|.	0.41893|.	-0.9483|.	10|.	0.15952|.	T|.	0.53|.	-20.6706|-20.6706	19.5383|19.5383	0.95264|0.95264	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	434|.	O75334|.	LIPA2_HUMAN|.	I|S	434;416;1;360;445;416;434;335;434;15;1|273	ENSP00000450337:M434I;ENSP00000450298:M416I;ENSP00000438337:M1I;ENSP00000385093:M360I;ENSP00000327416:M416I;ENSP00000449338:M434I;ENSP00000388373:M335I;ENSP00000447868:M434I;ENSP00000448941:M15I|.	ENSP00000327416:M416I|.	M|X	-|-	3|2	0|2	PPFIA2|PPFIA2	80287069|80287069	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.990000|0.990000	0.78478|0.78478	4.970000|4.970000	0.63742|0.63742	2.691000|2.691000	0.91804|0.91804	0.563000|0.563000	0.77884|0.77884	ATG|TGA	PPFIA2	-	NULL	ENSG00000139220		0.323	PPFIA2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PPFIA2	HGNC	protein_coding	OTTHUMT00000408030.1	36	0.00	0	C			81762938	81762938	-1	no_errors	ENST00000549396	ensembl	human	known	69_37n	missense	47	11.32	6	SNP	1.000	G
PRC1	9055	genome.wustl.edu	37	15	91524812	91524812	+	Missense_Mutation	SNP	C	C	T			TCGA-A2-A0CR-01A-11D-A228-09	TCGA-A2-A0CR-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f573c3c3-7b61-4955-8772-215b7cb9a763	3bdb54b4-1e26-4274-a1bd-800416ffbd34	g.chr15:91524812C>T	ENST00000361188.5	-	5	1800	c.589G>A	c.(589-591)Gaa>Aaa	p.E197K	PRC1_ENST00000442656.2_Missense_Mutation_p.E156K|PRC1_ENST00000556129.1_5'Flank|PRC1_ENST00000394249.3_Missense_Mutation_p.E197K|PRC1-AS1_ENST00000554388.1_RNA|PRC1_ENST00000361919.3_Missense_Mutation_p.E197K					protein regulator of cytokinesis 1									p.E197Q(1)		endometrium(1)|kidney(2)|large_intestine(7)|lung(9)|ovary(3)|prostate(1)|skin(2)	25	Lung NSC(78;0.0987)|all_lung(78;0.175)					ACATCTCTTTCAAAGCTTGTG	0.413																																						dbGAP											1	Substitution - Missense(1)	lung(1)											151.0	132.0	139.0					15																	91524812		2198	4298	6496	-	-	-	SO:0001583	missense	0			AF044588	CCDS32334.1, CCDS45352.1, CCDS45353.1, CCDS45353.2	15q26.1	2013-05-29		2006-07-07	ENSG00000198901	ENSG00000198901			9341	protein-coding gene	gene with protein product	"""anaphase spindle elongation 1 homolog (S. cerevisiae)"""	603484				9885575	Standard	NM_003981		Approved	ASE1	uc002bqm.4	O43663	OTTHUMG00000171685	ENST00000361188.5:c.589G>A	15.37:g.91524812C>T	ENSP00000354679:p.Glu197Lys	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Microtubule-assoc_MAP65_ASE1	p.E197K	ENST00000361188.5	37	c.589	CCDS45352.1	15	.	.	.	.	.	.	.	.	.	.	C	36	5.799457	0.96960	.	.	ENSG00000198901	ENST00000394249;ENST00000361919;ENST00000361188;ENST00000442656	T;T;T;T	0.43294	0.95;0.95;0.95;0.95	5.26	5.26	0.73747	.	0.000000	0.85682	D	0.000000	T	0.66127	0.2758	M	0.78916	2.43	0.80722	D	1	D;D;D;D;D	0.89917	0.998;1.0;1.0;1.0;1.0	D;D;D;D;D	0.83275	0.974;0.986;0.986;0.976;0.996	T	0.62412	-0.6860	10	0.30854	T	0.27	.	18.6588	0.91465	0.0:1.0:0.0:0.0	.	145;156;197;197;197	B4E238;O43663-3;F8W9B5;O43663-2;O43663	.;.;.;.;PRC1_HUMAN	K	197;197;197;156	ENSP00000377793:E197K;ENSP00000354618:E197K;ENSP00000354679:E197K;ENSP00000409549:E156K	ENSP00000354679:E197K	E	-	1	0	PRC1	89325816	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.271000	0.65553	2.746000	0.94184	0.655000	0.94253	GAA	PRC1	-	pfam_Microtubule-assoc_MAP65_ASE1	ENSG00000198901		0.413	PRC1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	PRC1	HGNC	protein_coding	OTTHUMT00000414760.1	53	0.00	0	C	NM_003981		91524812	91524812	-1	no_errors	ENST00000394249	ensembl	human	known	69_37n	missense	53	10.17	6	SNP	1.000	T
PTH1R	5745	genome.wustl.edu	37	3	46939404	46939404	+	Missense_Mutation	SNP	G	G	C			TCGA-A2-A0CR-01A-11D-A228-09	TCGA-A2-A0CR-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f573c3c3-7b61-4955-8772-215b7cb9a763	3bdb54b4-1e26-4274-a1bd-800416ffbd34	g.chr3:46939404G>C	ENST00000313049.5	+	4	576	c.373G>C	c.(373-375)Gag>Cag	p.E125Q	PTH1R_ENST00000449590.1_Missense_Mutation_p.E125Q|PTH1R_ENST00000418619.1_Missense_Mutation_p.E125Q|PTH1R_ENST00000490109.1_3'UTR|PTH1R_ENST00000430002.2_Missense_Mutation_p.E125Q			Q03431	PTH1R_HUMAN	parathyroid hormone 1 receptor	125					adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|aging (GO:0007568)|bone mineralization (GO:0030282)|bone resorption (GO:0045453)|cell maturation (GO:0048469)|chondrocyte differentiation (GO:0002062)|G-protein coupled receptor signaling pathway (GO:0007186)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|negative regulation of cell proliferation (GO:0008285)|osteoblast development (GO:0002076)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of inositol phosphate biosynthetic process (GO:0060732)|skeletal system development (GO:0001501)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|brush border membrane (GO:0031526)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	parathyroid hormone receptor activity (GO:0004991)|peptide hormone binding (GO:0017046)|protein self-association (GO:0043621)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(3)|liver(1)|lung(5)|skin(2)|stomach(1)|urinary_tract(2)	19					Preotact(DB05829)|Teriparatide(DB06285)	GGCACCAGGTGAGGTGGTGGC	0.602																																						dbGAP											0													57.0	55.0	56.0					3																	46939404		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS2747.1	3p22-p21.1	2012-08-10	2008-11-18	2008-11-18	ENSG00000160801	ENSG00000160801		"""GPCR / Class B : Parathyroid hormone receptors"""	9608	protein-coding gene	gene with protein product		168468	"""parathyroid hormone receptor 1"""	PTHR, PTHR1		8020952	Standard	NM_001184744		Approved		uc021wxg.1	Q03431	OTTHUMG00000133515	ENST00000313049.5:c.373G>C	3.37:g.46939404G>C	ENSP00000321999:p.Glu125Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	Q2M1U3	Missense_Mutation	SNP	pfam_GPCR_2_secretin-like,pfam_GPCR_2_extracellular_dom,smart_GPCR_2_extracellular_dom,pfscan_GPCR_2_extracellular_dom,pfscan_GPCR_2-like,prints_GPCR_2_secretin-like,prints_GPCR_2_parathyroid_rcpt	p.E125Q	ENST00000313049.5	37	c.373	CCDS2747.1	3	.	.	.	.	.	.	.	.	.	.	G	8.631	0.893577	0.17613	.	.	ENSG00000160801	ENST00000449590;ENST00000418619;ENST00000427125;ENST00000430002;ENST00000313049	T;T;T;T;T	0.64991	-0.13;-0.13;-0.13;-0.13;-0.13	5.13	3.06	0.35304	GPCR, family 2, secretin-like, conserved site (1);GPCR, family 2, extracellular hormone receptor domain (3);	.	.	.	.	T	0.42086	0.1187	N	0.21240	0.645	0.33096	D	0.53853	B	0.24258	0.1	B	0.22880	0.042	T	0.45056	-0.9287	9	0.16420	T	0.52	.	7.0571	0.25106	0.2681:0.0:0.7319:0.0	.	125	Q03431	PTH1R_HUMAN	Q	125	ENSP00000402723:E125Q;ENSP00000411424:E125Q;ENSP00000400977:E125Q;ENSP00000413774:E125Q;ENSP00000321999:E125Q	ENSP00000321999:E125Q	E	+	1	0	PTH1R	46914408	0.079000	0.21365	0.981000	0.43875	0.998000	0.95712	0.477000	0.22196	1.164000	0.42652	0.561000	0.74099	GAG	PTH1R	-	pfam_GPCR_2_extracellular_dom,smart_GPCR_2_extracellular_dom,pfscan_GPCR_2_extracellular_dom	ENSG00000160801		0.602	PTH1R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PTH1R	HGNC	protein_coding	OTTHUMT00000257481.1	27	0.00	0	G	NM_000316		46939404	46939404	+1	no_errors	ENST00000313049	ensembl	human	known	69_37n	missense	42	12.50	6	SNP	0.958	C
RAB29	8934	genome.wustl.edu	37	1	205739862	205739862	+	Splice_Site	SNP	T	T	G			TCGA-A2-A0CR-01A-11D-A228-09	TCGA-A2-A0CR-10A-01D-A22A-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f573c3c3-7b61-4955-8772-215b7cb9a763	3bdb54b4-1e26-4274-a1bd-800416ffbd34	g.chr1:205739862T>G	ENST00000367139.3	-	5	802	c.499A>C	c.(499-501)Aga>Cga	p.R167R	RAB7L1_ENST00000437324.2_Splice_Site_p.R95R|RAB7L1_ENST00000414729.1_Splice_Site_p.R167R|RAB7L1_ENST00000446390.2_Splice_Site_p.R143R|RAB7L1_ENST00000235932.4_Splice_Site_p.R167R|RAB7L1_ENST00000468887.1_5'UTR	NM_003929.2	NP_003920.1	O14966	RAB7L_HUMAN		167					cell differentiation (GO:0030154)|Golgi organization (GO:0007030)|GTP catabolic process (GO:0006184)|positive regulation of intracellular protein transport (GO:0090316)|protein transport (GO:0015031)|retrograde transport, plasma membrane to Golgi (GO:0035526)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)|trans-Golgi network (GO:0005802)|vacuole (GO:0005773)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)			endometrium(1)|large_intestine(3)|lung(4)|ovary(1)|urinary_tract(1)	10	Breast(84;0.0799)		BRCA - Breast invasive adenocarcinoma(75;0.0194)			GCTACTTACCTCATAGCCTCA	0.453																																					Pancreas(25;658 872 27763 34889 38531)	dbGAP											0													166.0	117.0	134.0					1																	205739862		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0																														ENST00000367139.3:c.500+1A>C	1.37:g.205739862T>G		Somatic		WXS	Illumina GAIIx	Phase_IV	B4E1K3|C9JE77	Silent	SNP	pfam_Small_GTPase,pfam_MIRO-like,pfam_Small_GTPase_ARF/SAR,pfam_Gtr1_RagA,smart_Small_GTPase_Ras,smart_Small_GTPase_Rab_type,smart_Small_GTPase_Rho,smart_Ran_GTPase,prints_Small_GTPase,tigrfam_Small_GTP-bd_dom	p.R167	ENST00000367139.3	37	c.499	CCDS1459.1	1																																																																																			RAB7L1	-	pfam_Small_GTPase,pfam_Small_GTPase_ARF/SAR,smart_Small_GTPase_Ras,smart_Small_GTPase_Rab_type,smart_Small_GTPase_Rho,smart_Ran_GTPase,prints_Small_GTPase,tigrfam_Small_GTP-bd_dom	ENSG00000117280		0.453	RAB7L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RAB7L1	HGNC	protein_coding	OTTHUMT00000087732.1	35	0.00	0	T		Silent	205739862	205739862	-1	no_errors	ENST00000235932	ensembl	human	known	69_37n	silent	55	15.38	10	SNP	1.000	G
RASAL3	64926	genome.wustl.edu	37	19	15563552	15563552	+	Silent	SNP	C	C	T			TCGA-A2-A0CR-01A-11D-A228-09	TCGA-A2-A0CR-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f573c3c3-7b61-4955-8772-215b7cb9a763	3bdb54b4-1e26-4274-a1bd-800416ffbd34	g.chr19:15563552C>T	ENST00000343625.7	-	16	2830	c.2745G>A	c.(2743-2745)ctG>ctA	p.L915L	WIZ_ENST00000263381.7_5'Flank|WIZ_ENST00000389282.4_5'Flank	NM_022904.1	NP_075055.1	Q86YV0	RASL3_HUMAN	RAS protein activator like 3	915					negative regulation of Ras protein signal transduction (GO:0046580)|positive regulation of Ras GTPase activity (GO:0032320)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|membrane (GO:0016020)	Ras GTPase activator activity (GO:0005099)			breast(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(10)|skin(1)	18						TTTGGGTGCTCAGCGACTCCA	0.652																																						dbGAP											0													17.0	21.0	20.0					19																	15563552		2121	4229	6350	-	-	-	SO:0001819	synonymous_variant	0				CCDS46006.1	19p13.12	2008-12-18			ENSG00000105122	ENSG00000105122			26129	protein-coding gene	gene with protein product						12477932	Standard	NM_022904		Approved	FLJ21438	uc002nbe.2	Q86YV0		ENST00000343625.7:c.2745G>A	19.37:g.15563552C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q8N2T9|Q9H735	Silent	SNP	pfam_RasGAP,superfamily_Rho_GTPase_activation_prot,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_RasGAP,pfscan_RasGAP	p.L915	ENST00000343625.7	37	c.2745	CCDS46006.1	19																																																																																			RASAL3	-	NULL	ENSG00000105122		0.652	RASAL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RASAL3	HGNC	protein_coding	OTTHUMT00000461331.3	31	0.00	0	C	NM_022904		15563552	15563552	-1	no_errors	ENST00000343625	ensembl	human	known	69_37n	silent	48	21.31	13	SNP	0.248	T
RAVER2	55225	genome.wustl.edu	37	1	65210970	65210970	+	Missense_Mutation	SNP	G	G	A			TCGA-A2-A0CR-01A-11D-A228-09	TCGA-A2-A0CR-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f573c3c3-7b61-4955-8772-215b7cb9a763	3bdb54b4-1e26-4274-a1bd-800416ffbd34	g.chr1:65210970G>A	ENST00000294428.3	+	1	193	c.115G>A	c.(115-117)Gag>Aag	p.E39K	RAVER2_ENST00000371072.4_Missense_Mutation_p.E39K			Q9HCJ3	RAVR2_HUMAN	ribonucleoprotein, PTB-binding 2	39						cytoplasm (GO:0005737)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			breast(2)|endometrium(2)|kidney(1)|large_intestine(7)|lung(6)|prostate(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	24						CGAAGCGCACGAGGGCGCCCC	0.796																																						dbGAP											0													1.0	2.0	1.0					1																	65210970		722	1733	2455	-	-	-	SO:0001583	missense	0			AB046799	CCDS41345.1	1p31.3	2013-02-12			ENSG00000162437	ENSG00000162437		"""RNA binding motif (RRM) containing"""	25577	protein-coding gene	gene with protein product		609953				16051233	Standard	NM_018211		Approved	KIAA1579, FLJ10770	uc001dbs.2	Q9HCJ3	OTTHUMG00000009102	ENST00000294428.3:c.115G>A	1.37:g.65210970G>A	ENSP00000294428:p.Glu39Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6P141|Q9NPV7	Missense_Mutation	SNP	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	p.E39K	ENST00000294428.3	37	c.115		1	.	.	.	.	.	.	.	.	.	.	G	12.36	1.913580	0.33815	.	.	ENSG00000162437	ENST00000371072;ENST00000294428	T;T	0.29397	1.57;1.57	3.61	1.7	0.24286	.	1.380740	0.04972	N	0.464102	T	0.04452	0.0122	N	0.08118	0	0.19300	N	0.999973	B	0.02656	0.0	B	0.01281	0.0	T	0.32188	-0.9916	10	0.08381	T	0.77	-13.2828	9.0604	0.36431	0.1415:0.0:0.8585:0.0	.	39	Q9HCJ3-2	.	K	39	ENSP00000360112:E39K;ENSP00000294428:E39K	ENSP00000294428:E39K	E	+	1	0	RAVER2	64983558	0.073000	0.21202	0.002000	0.10522	0.195000	0.23768	0.801000	0.27055	0.212000	0.20703	0.449000	0.29647	GAG	RAVER2	-	NULL	ENSG00000162437		0.796	RAVER2-201	KNOWN	basic	protein_coding	RAVER2	HGNC	protein_coding		13	0.00	0	G	NM_018211		65210970	65210970	+1	no_errors	ENST00000294428	ensembl	human	known	69_37n	missense	15	21.05	4	SNP	0.002	A
RBMS3	27303	genome.wustl.edu	37	3	29529937	29529937	+	Missense_Mutation	SNP	G	G	T			TCGA-A2-A0CR-01A-11D-A228-09	TCGA-A2-A0CR-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f573c3c3-7b61-4955-8772-215b7cb9a763	3bdb54b4-1e26-4274-a1bd-800416ffbd34	g.chr3:29529937G>T	ENST00000383767.2	+	3	590	c.254G>T	c.(253-255)gGa>gTa	p.G85V	RBMS3_ENST00000383766.2_Missense_Mutation_p.G84V|RBMS3_ENST00000273139.9_Missense_Mutation_p.G85V|RBMS3_ENST00000452462.1_Missense_Mutation_p.G85V|RBMS3_ENST00000396583.3_Missense_Mutation_p.G85V|RBMS3_ENST00000434693.2_Missense_Mutation_p.G84V|RBMS3_ENST00000456853.1_Missense_Mutation_p.G85V|RBMS3_ENST00000445033.1_Missense_Mutation_p.G85V			Q6XE24	RBMS3_HUMAN	RNA binding motif, single stranded interacting protein 3	85	RRM 1. {ECO:0000255|PROSITE- ProRule:PRU00176}.				positive regulation of translation (GO:0045727)	cytoplasm (GO:0005737)	mRNA 3'-UTR binding (GO:0003730)|nucleotide binding (GO:0000166)			breast(1)|central_nervous_system(1)|large_intestine(3)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)	11		Ovarian(412;0.0956)				TTCAGGTATGGAAAAATTGTA	0.393																																						dbGAP											0													96.0	97.0	97.0					3																	29529937		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF023259	CCDS33724.1, CCDS33725.1, CCDS33726.1, CCDS54557.1, CCDS54558.1	3p24-p23	2013-02-12	2010-04-20		ENSG00000144642	ENSG00000144642		"""RNA binding motif (RRM) containing"""	13427	protein-coding gene	gene with protein product	"""RNA-binding protein"""	605786	"""RNA binding motif, single stranded interacting protein"""			10675610	Standard	NM_001003793		Approved		uc003cel.3	Q6XE24	OTTHUMG00000155699	ENST00000383767.2:c.254G>T	3.37:g.29529937G>T	ENSP00000373277:p.Gly85Val	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K9S4|B7ZL17|G5E9J9|O75876|Q17RI0|Q6XE23	Missense_Mutation	SNP	pfam_RRM_dom,smart_RRM_dom,prints_Hud_Sxl_RNA,pfscan_RRM_dom	p.G85V	ENST00000383767.2	37	c.254	CCDS33724.1	3	.	.	.	.	.	.	.	.	.	.	G	26.3	4.725165	0.89298	.	.	ENSG00000144642	ENST00000434693;ENST00000396583;ENST00000383767;ENST00000445033;ENST00000273139;ENST00000383766;ENST00000452462;ENST00000456853	T;T;T;T;T;T;T;T	0.47177	0.85;0.85;0.85;0.85;0.85;0.85;0.85;0.85	6.07	6.07	0.98685	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (3);	0.000000	0.85682	D	0.000000	T	0.79616	0.4476	H	0.94771	3.58	0.80722	D	1	D;D;D;D	0.89917	0.999;1.0;0.999;1.0	D;D;D;D	0.91635	0.998;0.998;0.998;0.999	D	0.83863	0.0269	9	.	.	.	.	20.6525	0.99598	0.0:0.0:1.0:0.0	.	85;85;84;85	G5E9J9;Q6XE24-2;Q6XE24-3;Q6XE24	.;.;.;RBMS3_HUMAN	V	84;85;85;85;85;84;85;85	ENSP00000395592:G84V;ENSP00000379828:G85V;ENSP00000373277:G85V;ENSP00000391934:G85V;ENSP00000273139:G85V;ENSP00000373276:G84V;ENSP00000397926:G85V;ENSP00000400519:G85V	.	G	+	2	0	RBMS3	29504941	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	8.555000	0.90693	2.890000	0.99128	0.585000	0.79938	GGA	RBMS3	-	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	ENSG00000144642		0.393	RBMS3-001	KNOWN	basic|CCDS	protein_coding	RBMS3	HGNC	protein_coding	OTTHUMT00000341306.1	27	0.00	0	G	NM_001003792		29529937	29529937	+1	no_errors	ENST00000383767	ensembl	human	known	69_37n	missense	24	20.00	6	SNP	1.000	T
RTL1	388015	genome.wustl.edu	37	14	101348427	101348427	+	Missense_Mutation	SNP	C	C	T			TCGA-A2-A0CR-01A-11D-A228-09	TCGA-A2-A0CR-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f573c3c3-7b61-4955-8772-215b7cb9a763	3bdb54b4-1e26-4274-a1bd-800416ffbd34	g.chr14:101348427C>T	ENST00000534062.1	-	1	2757	c.2699G>A	c.(2698-2700)aGa>aAa	p.R900K	MIR433_ENST00000384837.1_RNA|MIR136_ENST00000385207.1_RNA|MIR432_ENST00000606207.1_RNA|MIR127_ENST00000384876.1_RNA|MIR431_ENST00000385266.1_RNA	NM_001134888.2	NP_001128360.1	A6NKG5	RTL1_HUMAN	retrotransposon-like 1	900					multicellular organismal development (GO:0007275)	integral component of membrane (GO:0016021)				breast(1)|endometrium(5)|kidney(4)|large_intestine(1)|lung(5)|pancreas(1)|prostate(2)|skin(2)	21						GCAGCAGGCTCTCTTGCCGGT	0.577																																						dbGAP											0													30.0	29.0	30.0					14																	101348427		692	1591	2283	-	-	-	SO:0001583	missense	0				CCDS53910.1	14q32.2	2012-04-18			ENSG00000254656	ENSG00000254656			14665	protein-coding gene	gene with protein product		611896				16155747, 15854907, 12796779	Standard	NM_001134888		Approved	PEG11, MART1, Mar1	uc010txj.1	A6NKG5	OTTHUMG00000167573	ENST00000534062.1:c.2699G>A	14.37:g.101348427C>T	ENSP00000435342:p.Arg900Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	E9PKS8	Missense_Mutation	SNP	pfam_Retrotrans_gag,superfamily_Peptidase_aspartic	p.R900K	ENST00000534062.1	37	c.2699	CCDS53910.1	14	.	.	.	.	.	.	.	.	.	.	C	0.005	-2.234209	0.00277	.	.	ENSG00000254656	ENST00000534062	T	0.41758	0.99	3.33	-2.13	0.07144	.	0.234015	0.20303	N	0.094995	T	0.15652	0.0377	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.06405	0.002	T	0.09443	-1.0674	10	0.26408	T	0.33	.	3.2407	0.06779	0.4592:0.2201:0.0:0.3207	.	900	E9PKS8	.	K	900	ENSP00000435342:R900K	ENSP00000435342:R900K	R	-	2	0	RTL1	100418180	0.000000	0.05858	0.000000	0.03702	0.017000	0.09413	0.353000	0.20130	-0.488000	0.06726	0.561000	0.74099	AGA	RTL1	-	NULL	ENSG00000254656		0.577	RTL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RTL1	HGNC	protein_coding	OTTHUMT00000395127.1	22	0.00	0	C	NM_001134888		101348427	101348427	-1	no_errors	ENST00000534062	ensembl	human	known	69_37n	missense	53	14.52	9	SNP	0.000	T
SCMH1	22955	genome.wustl.edu	37	1	41540970	41540970	+	Missense_Mutation	SNP	G	G	A			TCGA-A2-A0CR-01A-11D-A228-09	TCGA-A2-A0CR-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f573c3c3-7b61-4955-8772-215b7cb9a763	3bdb54b4-1e26-4274-a1bd-800416ffbd34	g.chr1:41540970G>A	ENST00000326197.7	-	8	1168	c.869C>T	c.(868-870)tCc>tTc	p.S290F	SCMH1_ENST00000372597.1_Missense_Mutation_p.S243F|SCMH1_ENST00000372596.1_Missense_Mutation_p.S229F|SCMH1_ENST00000397174.2_Missense_Mutation_p.S270F|SCMH1_ENST00000402904.2_Missense_Mutation_p.S290F|SCMH1_ENST00000361191.5_Missense_Mutation_p.S229F|SCMH1_ENST00000397171.2_Missense_Mutation_p.S229F|SCMH1_ENST00000361705.3_Missense_Mutation_p.S243F|SCMH1_ENST00000337495.5_Missense_Mutation_p.S300F|SCMH1_ENST00000372595.1_Missense_Mutation_p.S229F|SCMH1_ENST00000456518.2_Missense_Mutation_p.S132F					sex comb on midleg homolog 1 (Drosophila)											breast(1)|endometrium(2)|kidney(2)|large_intestine(5)|lung(2)|pancreas(2)|upper_aerodigestive_tract(1)	15	Ovarian(52;0.00769)|all_hematologic(146;0.0977)|Acute lymphoblastic leukemia(166;0.155)|Breast(333;0.162)	Myeloproliferative disorder(586;0.0393)				GATGGGATGGGAAATTAGGGT	0.527																																						dbGAP											0													152.0	144.0	146.0					1																	41540970		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF149045	CCDS461.1, CCDS30688.1, CCDS53301.1, CCDS53302.1, CCDS53303.1, CCDS53304.1	1p34	2013-01-10			ENSG00000010803	ENSG00000010803		"""Sterile alpha motif (SAM) domain containing"""	19003	protein-coding gene	gene with protein product						10524249	Standard	NM_012236		Approved	Scml3	uc001cgs.3	Q96GD3	OTTHUMG00000005720	ENST00000326197.7:c.869C>T	1.37:g.41540970G>A	ENSP00000318094:p.Ser290Phe	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Mbt,pfam_DUF3588,pfam_SAM_type1,pfam_SAM_2,superfamily_SAM/pointed,smart_Mbt,smart_SAM,pfscan_Mbt,pfscan_SAM	p.S290F	ENST00000326197.7	37	c.869	CCDS30688.1	1	.	.	.	.	.	.	.	.	.	.	G	14.11	2.438168	0.43326	.	.	ENSG00000010803	ENST00000361705;ENST00000456518;ENST00000402904;ENST00000397174;ENST00000397171;ENST00000361191;ENST00000372597;ENST00000372596;ENST00000337495;ENST00000372595;ENST00000326197	T;T;T;T;T;T;T;T;T;T;T	0.23950	2.21;1.88;2.21;2.22;2.22;2.22;2.21;2.22;2.22;2.21;2.21	5.78	4.76	0.60689	.	0.243553	0.39274	N	0.001406	T	0.19604	0.0471	L	0.29908	0.895	0.23459	N	0.997639	B;B;B;B	0.19935	0.006;0.011;0.018;0.04	B;B;B;B	0.21917	0.012;0.027;0.037;0.017	T	0.11421	-1.0588	10	0.56958	D	0.05	.	11.0118	0.47667	0.0:0.0:0.7443:0.2557	.	132;300;243;290	B4DRQ8;Q96GD3-2;Q96GD3-4;Q96GD3	.;.;.;SCMH1_HUMAN	F	243;132;290;270;229;229;243;229;300;229;290	ENSP00000354996:S243F;ENSP00000403974:S132F;ENSP00000386079:S290F;ENSP00000380359:S270F;ENSP00000380356:S229F;ENSP00000354656:S229F;ENSP00000361678:S243F;ENSP00000361677:S229F;ENSP00000337352:S300F;ENSP00000361676:S229F;ENSP00000318094:S290F	ENSP00000318094:S290F	S	-	2	0	SCMH1	41313557	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	3.391000	0.52530	2.894000	0.99253	0.655000	0.94253	TCC	SCMH1	-	NULL	ENSG00000010803		0.527	SCMH1-005	KNOWN	basic|appris_principal|CCDS	protein_coding	SCMH1	HGNC	protein_coding	OTTHUMT00000015656.1	79	0.00	0	G			41540970	41540970	-1	no_errors	ENST00000326197	ensembl	human	known	69_37n	missense	87	11.22	11	SNP	1.000	A
SETD1B	23067	genome.wustl.edu	37	12	122255275	122255275	+	Splice_Site	SNP	G	G	C			TCGA-A2-A0CR-01A-11D-A228-09	TCGA-A2-A0CR-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f573c3c3-7b61-4955-8772-215b7cb9a763	3bdb54b4-1e26-4274-a1bd-800416ffbd34	g.chr12:122255275G>C	ENST00000604567.1	+	9	3045		c.e9-1		SETD1B_ENST00000542440.1_Splice_Site|SETD1B_ENST00000267197.5_Splice_Site			Q9UPS6	SET1B_HUMAN	SET domain containing 1B						histone H3-K4 methylation (GO:0051568)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	chromosome (GO:0005694)|histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)|Set1C/COMPASS complex (GO:0048188)	histone-lysine N-methyltransferase activity (GO:0018024)|nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			NS(1)|endometrium(6)|kidney(2)|prostate(2)	11						CCTTCCTGCAGAGTCCGAGCG	0.682																																						dbGAP											0													32.0	45.0	41.0					12																	122255275		692	1591	2283	-	-	-	SO:0001630	splice_region_variant	0			AB028999	CCDS53838.1	12q24.31	2013-02-12			ENSG00000139718	ENSG00000139718		"""Chromatin-modifying enzymes / K-methyltransferases"", ""RNA binding motif (RRM) containing"""	29187	protein-coding gene	gene with protein product		611055				10470851, 17355966	Standard	NM_015048		Approved	KIAA1076, Set1B, KMT2G	uc001ubi.3	Q9UPS6	OTTHUMG00000169080	ENST00000604567.1:c.2978-1G>C	12.37:g.122255275G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	F6MFW1	Splice_Site	SNP	-	e8-1	ENST00000604567.1	37	c.2978-1		12	.	.	.	.	.	.	.	.	.	.	G	9.201	1.028523	0.19512	.	.	ENSG00000139718	ENST00000542440;ENST00000267197	.	.	.	4.62	4.62	0.57501	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	17.0555	0.86532	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	SETD1B	120739658	1.000000	0.71417	0.933000	0.37362	0.033000	0.12548	4.113000	0.57851	2.121000	0.65114	0.591000	0.81541	.	SETD1B	-	-	ENSG00000139718		0.682	SETD1B-002	PUTATIVE	non_canonical_U12|basic|appris_candidate_longest	protein_coding	SETD1B	HGNC	protein_coding	OTTHUMT00000468264.1	18	0.00	0	G	XM_037523	Intron	122255275	122255275	+1	no_errors	ENST00000267197	ensembl	human	known	69_37n	splice_site	15	21.05	4	SNP	1.000	C
SHARPIN	81858	genome.wustl.edu	37	8	145154965	145154965	+	Missense_Mutation	SNP	C	C	G			TCGA-A2-A0CR-01A-11D-A228-09	TCGA-A2-A0CR-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f573c3c3-7b61-4955-8772-215b7cb9a763	3bdb54b4-1e26-4274-a1bd-800416ffbd34	g.chr8:145154965C>G	ENST00000398712.2	-	3	820	c.384G>C	c.(382-384)aaG>aaC	p.K128N	SHARPIN_ENST00000533948.1_5'UTR	NM_030974.3	NP_112236.3	Q9H0F6	SHRPN_HUMAN	SHANK-associated RH domain interactor	128	Self-association. {ECO:0000250}.				apoptotic nuclear changes (GO:0030262)|brain development (GO:0007420)|keratinization (GO:0031424)|mitochondrion organization (GO:0007005)|negative regulation of inflammatory response (GO:0050728)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|protein homooligomerization (GO:0051260)|protein linear polyubiquitination (GO:0097039)|regulation of CD40 signaling pathway (GO:2000348)|regulation of tumor necrosis factor-mediated signaling pathway (GO:0010803)	cell junction (GO:0030054)|cytosol (GO:0005829)|dendrite (GO:0030425)|LUBAC complex (GO:0071797)|postsynaptic density (GO:0014069)	polyubiquitin binding (GO:0031593)|zinc ion binding (GO:0008270)			breast(1)|endometrium(1)|kidney(1)|lung(2)|ovary(2)	7	all_cancers(97;2.87e-11)|all_epithelial(106;2.16e-09)|Lung NSC(106;5.89e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;4.1e-42)|Epithelial(56;1.58e-40)|all cancers(56;6.12e-36)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.105)			GTGAGTTGCTCTTGCTGCCTA	0.607																																						dbGAP											0													231.0	240.0	237.0					8																	145154965		2172	4265	6437	-	-	-	SO:0001583	missense	0			AL136816	CCDS43777.1	8q24.3	2005-08-09				ENSG00000179526			25321	protein-coding gene	gene with protein product		611885				11178875, 12753155	Standard	NM_030974		Approved	DKFZP434N1923, SIPL1	uc003zba.3	Q9H0F6		ENST00000398712.2:c.384G>C	8.37:g.145154965C>G	ENSP00000381698:p.Lys128Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NEG3|C0L3L2|D3DWL3|Q8IXF5|Q8IXF6|Q8N2E7|Q8TB25|Q9BUE4	Missense_Mutation	SNP	pfam_Znf_RanBP2,smart_Znf_RanBP2,pfscan_Znf_RanBP2	p.K128N	ENST00000398712.2	37	c.384	CCDS43777.1	8	.	.	.	.	.	.	.	.	.	.	G	0.008	-1.899527	0.00517	.	.	ENSG00000179526	ENST00000398712;ENST00000359551	D;T	0.85339	-1.97;1.49	2.8	1.91	0.25777	.	2.628300	0.01925	N	0.040838	T	0.67581	0.2908	N	0.03608	-0.345	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.58629	-0.7603	10	0.16896	T	0.51	.	4.2415	0.10650	0.138:0.2384:0.6236:0.0	.	128	Q9H0F6	SHRPN_HUMAN	N	128	ENSP00000381698:K128N;ENSP00000352551:K128N	ENSP00000352551:K128N	K	-	3	2	SHARPIN	145226953	0.000000	0.05858	0.010000	0.14722	0.013000	0.08279	-0.311000	0.08124	0.258000	0.21686	-0.357000	0.07601	AAG	SHARPIN	-	NULL	ENSG00000179526		0.607	SHARPIN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SHARPIN	HGNC	protein_coding	OTTHUMT00000382901.1	42	0.00	0	C	NM_030974		145154965	145154965	-1	no_errors	ENST00000398712	ensembl	human	known	69_37n	missense	45	16.67	9	SNP	0.012	G
SLC36A1	206358	genome.wustl.edu	37	5	150867671	150867671	+	Missense_Mutation	SNP	G	G	C			TCGA-A2-A0CR-01A-11D-A228-09	TCGA-A2-A0CR-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f573c3c3-7b61-4955-8772-215b7cb9a763	3bdb54b4-1e26-4274-a1bd-800416ffbd34	g.chr5:150867671G>C	ENST00000243389.3	+	11	1510	c.1287G>C	c.(1285-1287)atG>atC	p.M429I	SLC36A1_ENST00000520701.1_Missense_Mutation_p.M429I	NM_078483.2	NP_510968.2	Q7Z2H8	S36A1_HUMAN	solute carrier family 36 (proton/amino acid symporter), member 1	429					amino acid transport (GO:0006865)|ion transport (GO:0006811)|transmembrane transport (GO:0055085)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|plasma membrane (GO:0005886)	glycine transmembrane transporter activity (GO:0015187)|hydrogen ion transmembrane transporter activity (GO:0015078)|L-alanine transmembrane transporter activity (GO:0015180)|L-proline transmembrane transporter activity (GO:0015193)|symporter activity (GO:0015293)			endometrium(5)|kidney(9)|lung(8)|skin(2)|urinary_tract(1)	25		Medulloblastoma(196;0.091)|all_hematologic(541;0.103)|all_neural(839;0.138)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)		Acamprosate(DB00659)|Glycine(DB00145)|Hydroxyproline(DB08847)|L-Alanine(DB00160)|Spaglumic Acid(DB08835)|Vigabatrin(DB01080)	CAGAGGGCATGAGCCCCCTCA	0.607																																					Melanoma(151;1534 1860 12947 32979 37872)	dbGAP											0													96.0	83.0	87.0					5																	150867671		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK057340	CCDS4316.1	5q33.1	2013-05-22			ENSG00000123643	ENSG00000123643		"""Solute carriers"""	18761	protein-coding gene	gene with protein product		606561				11959859, 11390972	Standard	NM_078483		Approved	LYAAT-1, PAT1, TRAMD3	uc003luc.3	Q7Z2H8	OTTHUMG00000130125	ENST00000243389.3:c.1287G>C	5.37:g.150867671G>C	ENSP00000243389:p.Met429Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	C9JI34|Q1LZ56|Q7Z7C0|Q86YK4|Q96M74	Missense_Mutation	SNP	pfam_AA_transpt_TM	p.M429I	ENST00000243389.3	37	c.1287	CCDS4316.1	5	.	.	.	.	.	.	.	.	.	.	G	13.70	2.315206	0.40996	.	.	ENSG00000123643	ENST00000520701;ENST00000243389	T;T	0.02121	4.44;4.44	5.53	1.19	0.21007	.	0.553924	0.22068	N	0.065068	T	0.01489	0.0048	N	0.20574	0.59	0.80722	D	1	B	0.06786	0.001	B	0.11329	0.006	T	0.54262	-0.8320	10	0.19147	T	0.46	.	5.7884	0.18347	0.0682:0.1164:0.5629:0.2526	.	429	Q7Z2H8	S36A1_HUMAN	I	429	ENSP00000428140:M429I;ENSP00000243389:M429I	ENSP00000243389:M429I	M	+	3	0	SLC36A1	150847864	1.000000	0.71417	0.987000	0.45799	0.929000	0.56500	1.291000	0.33330	0.614000	0.30107	0.455000	0.32223	ATG	SLC36A1	-	pfam_AA_transpt_TM	ENSG00000123643		0.607	SLC36A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC36A1	HGNC	protein_coding	OTTHUMT00000252433.1	49	0.00	0	G	NM_078483		150867671	150867671	+1	no_errors	ENST00000243389	ensembl	human	known	69_37n	missense	62	18.42	14	SNP	1.000	C
SLCO5A1	81796	genome.wustl.edu	37	8	70588895	70588895	+	Missense_Mutation	SNP	C	C	T			TCGA-A2-A0CR-01A-11D-A228-09	TCGA-A2-A0CR-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f573c3c3-7b61-4955-8772-215b7cb9a763	3bdb54b4-1e26-4274-a1bd-800416ffbd34	g.chr8:70588895C>T	ENST00000260126.4	-	9	2744	c.2038G>A	c.(2038-2040)Gag>Aag	p.E680K	SLCO5A1_ENST00000524945.1_Intron|SLCO5A1_ENST00000530307.1_Missense_Mutation_p.E625K	NM_030958.2	NP_112220.2	Q9H2Y9	SO5A1_HUMAN	solute carrier organic anion transporter family, member 5A1	680						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	transporter activity (GO:0005215)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(11)|lung(24)|ovary(3)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	53	Breast(64;0.0654)		Epithelial(68;0.0141)|OV - Ovarian serous cystadenocarcinoma(28;0.0315)|all cancers(69;0.0594)			GGTCTCTCCTCATCTTCTACG	0.433																																						dbGAP											0													149.0	124.0	132.0					8																	70588895		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF205075	CCDS6205.1, CCDS55242.1, CCDS55243.1	8q13.1	2013-05-22	2003-11-25	2003-11-26	ENSG00000137571	ENSG00000137571		"""Solute carriers"""	19046	protein-coding gene	gene with protein product		613543	"""solute carrier family 21 (organic anion transporter), member 15"""	SLC21A15		12507753	Standard	NM_030958		Approved	OATPRP4, OATP-J, OATP5A1	uc003xyl.3	Q9H2Y9	OTTHUMG00000165121	ENST00000260126.4:c.2038G>A	8.37:g.70588895C>T	ENSP00000260126:p.Glu680Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	A4QPC2|B2RPF7|B3KMU7|E9PKK5|G3V1C0	Missense_Mutation	SNP	pfam_OA_transporter,pfam_MFS,pfam_Kazal-type_dom,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom,tigrfam_OA_transporter	p.E680K	ENST00000260126.4	37	c.2038	CCDS6205.1	8	.	.	.	.	.	.	.	.	.	.	C	16.12	3.031996	0.54790	.	.	ENSG00000137571	ENST00000260126;ENST00000530307	T;T	0.41065	1.01;1.01	6.17	6.17	0.99709	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.287283	0.39615	N	0.001309	T	0.41259	0.1151	L	0.27944	0.81	0.47511	D	0.999444	P;P	0.41673	0.669;0.759	B;B	0.44315	0.138;0.446	T	0.06180	-1.0841	10	0.36615	T	0.2	.	20.8794	0.99867	0.0:1.0:0.0:0.0	.	625;680	E9PKK5;Q9H2Y9	.;SO5A1_HUMAN	K	680;625	ENSP00000260126:E680K;ENSP00000431611:E625K	ENSP00000260126:E680K	E	-	1	0	SLCO5A1	70751449	0.996000	0.38824	0.968000	0.41197	0.428000	0.31595	4.184000	0.58323	2.941000	0.99782	0.655000	0.94253	GAG	SLCO5A1	-	pfam_OA_transporter,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom,tigrfam_OA_transporter	ENSG00000137571		0.433	SLCO5A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLCO5A1	HGNC	protein_coding	OTTHUMT00000381990.3	40	0.00	0	C	NM_030958		70588895	70588895	-1	no_errors	ENST00000260126	ensembl	human	known	69_37n	missense	19	20.83	5	SNP	1.000	T
SLMAP	7871	genome.wustl.edu	37	3	57817203	57817203	+	Missense_Mutation	SNP	C	C	G			TCGA-A2-A0CR-01A-11D-A228-09	TCGA-A2-A0CR-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f573c3c3-7b61-4955-8772-215b7cb9a763	3bdb54b4-1e26-4274-a1bd-800416ffbd34	g.chr3:57817203C>G	ENST00000428312.1	+	2	386	c.292C>G	c.(292-294)Ctt>Gtt	p.L98V	SLMAP_ENST00000416870.1_5'UTR|SLMAP_ENST00000295952.3_Missense_Mutation_p.L98V|SLMAP_ENST00000295951.3_Missense_Mutation_p.L98V|SLMAP_ENST00000449503.2_Missense_Mutation_p.L98V|SLMAP_ENST00000383718.3_Missense_Mutation_p.L98V			Q14BN4	SLMAP_HUMAN	sarcolemma associated protein	98	Necessary for targeting to centrosomes. {ECO:0000250}.				muscle contraction (GO:0006936)	cytoskeleton (GO:0005856)|integral component of plasma membrane (GO:0005887)|smooth endoplasmic reticulum (GO:0005790)				endometrium(5)|kidney(1)|large_intestine(3)|lung(7)|urinary_tract(2)	18				BRCA - Breast invasive adenocarcinoma(55;0.000271)|KIRC - Kidney renal clear cell carcinoma(284;0.0602)|Kidney(284;0.0754)|OV - Ovarian serous cystadenocarcinoma(275;0.182)		ATGTGAAATTCTTTCCGGTGA	0.368																																						dbGAP											0													85.0	86.0	86.0					3																	57817203		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF100750	CCDS33774.1	3p21.2-p14.3	2008-07-18			ENSG00000163681	ENSG00000163681			16643	protein-coding gene	gene with protein product	"""Sarcolemmal-associated protein"""	602701				9405447, 11042152	Standard	NM_007159		Approved	SLAP, KIAA1601	uc003djd.1	Q14BN4	OTTHUMG00000133764	ENST00000428312.1:c.292C>G	3.37:g.57817203C>G	ENSP00000398661:p.Leu98Val	Somatic		WXS	Illumina GAIIx	Phase_IV	Q14C95|Q6AI54|Q6UXC9|Q6ZVQ8|Q8NCW9|Q9H297|Q9HCH1|Q9Y681	Missense_Mutation	SNP	pfam_FHA_dom,pfam_PFD_beta-like,superfamily_SMAD_FHA_domain,superfamily_Prefoldin,smart_FHA_dom,pfscan_FHA_dom	p.L98V	ENST00000428312.1	37	c.292		3	.	.	.	.	.	.	.	.	.	.	C	12.49	1.953161	0.34471	.	.	ENSG00000163681	ENST00000295951;ENST00000295952;ENST00000383718;ENST00000428312;ENST00000449503	D;D;D;D;D	0.86230	-2.09;-2.09;-2.09;-2.09;-2.09	5.82	5.82	0.92795	Forkhead-associated (FHA) domain (2);SMAD/FHA domain (1);	0.080433	0.51477	D	0.000083	T	0.70325	0.3211	N	0.08118	0	0.80722	D	1	B;P;B;B	0.38395	0.071;0.629;0.082;0.125	B;B;B;B	0.34038	0.075;0.174;0.058;0.098	T	0.70171	-0.4945	10	0.17369	T	0.5	-4.2436	9.6998	0.40180	0.1511:0.7754:0.0:0.0734	.	98;98;98;98	Q14BN4-2;Q14BN4;Q14BN4-3;Q14BN4-6	.;SLMAP_HUMAN;.;.	V	98	ENSP00000295951:L98V;ENSP00000295952:L98V;ENSP00000373224:L98V;ENSP00000398661:L98V;ENSP00000412945:L98V	ENSP00000295951:L98V	L	+	1	0	SLMAP	57792243	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	4.028000	0.57246	2.751000	0.94390	0.650000	0.86243	CTT	SLMAP	-	pfam_FHA_dom,superfamily_SMAD_FHA_domain	ENSG00000163681		0.368	SLMAP-013	KNOWN	basic	protein_coding	SLMAP	HGNC	protein_coding	OTTHUMT00000351584.1	55	0.00	0	C	NM_007159		57817203	57817203	+1	no_errors	ENST00000428312	ensembl	human	known	69_37n	missense	51	16.39	10	SNP	1.000	G
SMARCA2	6595	genome.wustl.edu	37	9	2039815	2039815	+	Silent	SNP	G	G	A	rs574062756	byFrequency	TCGA-A2-A0CR-01A-11D-A228-09	TCGA-A2-A0CR-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f573c3c3-7b61-4955-8772-215b7cb9a763	3bdb54b4-1e26-4274-a1bd-800416ffbd34	g.chr9:2039815G>A	ENST00000382203.1	+	4	914	c.705G>A	c.(703-705)caG>caA	p.Q235Q	SMARCA2_ENST00000382194.1_Silent_p.Q235Q|RP11-264I13.2_ENST00000426860.1_RNA|SMARCA2_ENST00000491574.1_3'UTR|SMARCA2_ENST00000357248.2_Silent_p.Q235Q|SMARCA2_ENST00000349721.2_Silent_p.Q235Q			P51531	SMCA2_HUMAN	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 2	235	Poly-Gln.				aortic smooth muscle cell differentiation (GO:0035887)|ATP catabolic process (GO:0006200)|chromatin remodeling (GO:0006338)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|nervous system development (GO:0007399)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)	intermediate filament cytoskeleton (GO:0045111)|intracellular membrane-bounded organelle (GO:0043231)|nBAF complex (GO:0071565)|npBAF complex (GO:0071564)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|SWI/SNF complex (GO:0016514)	ATP binding (GO:0005524)|DNA-dependent ATPase activity (GO:0008094)|helicase activity (GO:0004386)|RNA polymerase II transcription coactivator activity (GO:0001105)|transcription coactivator activity (GO:0003713)|transcription regulatory region DNA binding (GO:0044212)			breast(1)|central_nervous_system(1)|endometrium(7)|kidney(3)|large_intestine(11)|liver(2)|lung(19)|ovary(3)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	56		all_lung(10;2.06e-09)|Lung NSC(10;2.43e-09)		GBM - Glioblastoma multiforme(50;0.0475)		agcagcagcagcaacagcagc	0.587													G|||	41	0.0081869	0.0151	0.0029	5008	,	,		10366	0.0089		0.0	False		,,,				2504	0.0102					dbGAP											0													10.0	13.0	12.0					9																	2039815		2161	4205	6366	-	-	-	SO:0001819	synonymous_variant	0			D26155	CCDS34977.1, CCDS34978.1, CCDS75807.1, CCDS75808.1	9p24.3	2008-11-11	2006-11-09		ENSG00000080503	ENSG00000080503			11098	protein-coding gene	gene with protein product		600014		SNF2L2		8012116	Standard	NM_003070		Approved	BAF190, hSNF2a, hBRM, Sth1p, SNF2LA, BRM, SNF2, SWI2	uc003zhc.3	P51531	OTTHUMG00000019445	ENST00000382203.1:c.705G>A	9.37:g.2039815G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B1ALG3|B1ALG4|D3DRH4|D3DRH5	Silent	SNP	pfam_SNF2_N,pfam_Bromodomain,pfam_BRK_domain,pfam_HSA,pfam_Helicase_C,pfam_Gln-Leu-Gln_QLQ,superfamily_Bromodomain,superfamily_RNaseH-like_dom,smart_Gln-Leu-Gln_QLQ,smart_HAS_subgr,smart_BRK_domain,smart_Helicase_ATP-bd,smart_Helicase_C,smart_Bromodomain,prints_Bromodomain,pfscan_Helicase/SANT-assoc_DNA-bd,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,pfscan_Bromodomain	p.Q235	ENST00000382203.1	37	c.705	CCDS34977.1	9																																																																																			SMARCA2	-	NULL	ENSG00000080503		0.587	SMARCA2-003	KNOWN	basic|CCDS	protein_coding	SMARCA2	HGNC	protein_coding	OTTHUMT00000051505.1	26	0.00	0	G	NM_003070		2039815	2039815	+1	no_errors	ENST00000349721	ensembl	human	known	69_37n	silent	22	18.52	5	SNP	0.004	A
SMPD4	55627	genome.wustl.edu	37	2	130915062	130915062	+	Intron	SNP	T	T	C			TCGA-A2-A0CR-01A-11D-A228-09	TCGA-A2-A0CR-10A-01D-A22A-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f573c3c3-7b61-4955-8772-215b7cb9a763	3bdb54b4-1e26-4274-a1bd-800416ffbd34	g.chr2:130915062T>C	ENST00000409031.1	-	12	2217				SMPD4_ENST00000339679.7_Intron|SMPD4_ENST00000473720.1_Intron|SMPD4_ENST00000453750.1_Intron|SMPD4_ENST00000431183.2_Intron|SMPD4_ENST00000443958.2_Intron|SMPD4_ENST00000452225.2_Intron|SMPD4_ENST00000426662.2_Intron|SMPD4_ENST00000351288.6_Intron	NM_017951.4	NP_060421.2	Q9NXE4	NSMA3_HUMAN	sphingomyelin phosphodiesterase 4, neutral membrane (neutral sphingomyelinase-3)						cellular response to tumor necrosis factor (GO:0071356)|ceramide biosynthetic process (GO:0046513)|glycerophospholipid catabolic process (GO:0046475)|glycosphingolipid metabolic process (GO:0006687)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)|sphingomyelin catabolic process (GO:0006685)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|trans-Golgi network (GO:0005802)	metal ion binding (GO:0046872)|sphingomyelin phosphodiesterase activity (GO:0004767)|sphingomyelin phosphodiesterase D activity (GO:0050290)			breast(2)|central_nervous_system(1)|endometrium(3)|large_intestine(2)|lung(17)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	29	Colorectal(110;0.1)				Phosphatidylserine(DB00144)	CCTGAGCCAGTTGCTCTGCTG	0.667																																						dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			AF052134	CCDS2156.2, CCDS42751.1, CCDS54398.1	2q21.1	2009-11-06			ENSG00000136699	ENSG00000136699			32949	protein-coding gene	gene with protein product		610457				16517606	Standard	NM_001171083		Approved	FLJ20297, FLJ20756, nSMase-3, KIAA1418, NSMASE3, NET13	uc002tqr.2	Q9NXE4	OTTHUMG00000131624	ENST00000409031.1:c.1069-93A>G	2.37:g.130915062T>C		Somatic		WXS	Illumina GAIIx	Phase_IV	B4DM23|B4DQ31|B4DRB8|B4DWK7|B4E0L6|E7ESA2|E9PCE6|Q6FI76|Q6P1P7|Q6ZT43|Q9H0M2|Q9NW20|Q9NWL2|Q9P2C9	RNA	SNP	-	NULL	ENST00000409031.1	37	NULL	CCDS42751.1	2																																																																																			SMPD4	-	-	ENSG00000136699		0.667	SMPD4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SMPD4	HGNC	protein_coding	OTTHUMT00000254516.3	44	0.00	0	T	NM_017751		130915062	130915062	-1	no_errors	ENST00000455548	ensembl	human	putative	69_37n	rna	43	14.00	7	SNP	0.000	C
SMUG1	23583	genome.wustl.edu	37	12	54576104	54576104	+	Missense_Mutation	SNP	C	C	T			TCGA-A2-A0CR-01A-11D-A228-09	TCGA-A2-A0CR-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f573c3c3-7b61-4955-8772-215b7cb9a763	3bdb54b4-1e26-4274-a1bd-800416ffbd34	g.chr12:54576104C>T	ENST00000508394.2	-	3	651	c.589G>A	c.(589-591)Gcc>Acc	p.A197T	SMUG1_ENST00000505128.1_3'UTR|SMUG1_ENST00000506595.1_Intron|SMUG1_ENST00000514196.1_Intron|SMUG1_ENST00000513838.1_Intron|SMUG1_ENST00000514685.1_Intron|SMUG1_ENST00000505662.1_5'UTR|SMUG1_ENST00000401977.2_Missense_Mutation_p.A197T|SMUG1_ENST00000243112.5_Intron|SMUG1_ENST00000337581.3_Missense_Mutation_p.A197T	NM_001243787.1|NM_001243788.1|NM_014311.2	NP_001230716.1|NP_001230717.1|NP_055126.1	Q53HV7	SMUG1_HUMAN	single-strand-selective monofunctional uracil-DNA glycosylase 1	197					base-excision repair (GO:0006284)|base-excision repair, AP site formation (GO:0006285)|depyrimidination (GO:0045008)|DNA repair (GO:0006281)	nucleolus (GO:0005730)|nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|DNA N-glycosylase activity (GO:0019104)|oxidized pyrimidine nucleobase lesion DNA N-glycosylase activity (GO:0000703)|single-strand selective uracil DNA N-glycosylase activity (GO:0017065)|uracil DNA N-glycosylase activity (GO:0004844)			kidney(1)|large_intestine(4)|lung(1)	6						CGGCAGAGGGCTGCATCACAG	0.657								Base excision repair (BER), DNA glycosylases																														dbGAP											0													57.0	63.0	61.0					12																	54576104		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF125182	CCDS8874.1, CCDS58239.1	12q13.13	2013-10-28			ENSG00000123415	ENSG00000123415			17148	protein-coding gene	gene with protein product		607753				10074426, 11526119	Standard	NM_014311		Approved	UNG3, FDG, HMUDG	uc009znf.2	Q53HV7	OTTHUMG00000160068	ENST00000508394.2:c.589G>A	12.37:g.54576104C>T	ENSP00000424191:p.Ala197Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K2K9|O95862|Q0D2M0|Q8NB71|Q9BWC8	Missense_Mutation	SNP	pfam_Uracil-DNA_glycosylase-like,superfamily_Uracil-DNA_glycosylase-like	p.A197T	ENST00000508394.2	37	c.589	CCDS8874.1	12	.	.	.	.	.	.	.	.	.	.	C	17.12	3.309476	0.60414	.	.	ENSG00000123415	ENST00000337581;ENST00000508394;ENST00000401977	T;T;T	0.44482	0.92;0.92;0.92	4.71	2.86	0.33363	Uracil-DNA glycosylase-like (3);	0.049752	0.85682	D	0.000000	T	0.43853	0.1266	L	0.43554	1.36	0.80722	D	1	D	0.57899	0.981	P	0.56163	0.793	T	0.18777	-1.0326	10	0.20519	T	0.43	.	9.6775	0.40050	0.0:0.8252:0.0:0.1748	.	197	Q53HV7	SMUG1_HUMAN	T	197	ENSP00000338606:A197T;ENSP00000424191:A197T;ENSP00000384828:A197T	ENSP00000338606:A197T	A	-	1	0	SMUG1	52862371	0.973000	0.33851	0.806000	0.32338	0.647000	0.38526	2.476000	0.45171	1.119000	0.41883	0.563000	0.77884	GCC	SMUG1	-	pfam_Uracil-DNA_glycosylase-like,superfamily_Uracil-DNA_glycosylase-like	ENSG00000123415		0.657	SMUG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SMUG1	HGNC	protein_coding	OTTHUMT00000359074.3	27	0.00	0	C	NM_014311		54576104	54576104	-1	no_errors	ENST00000337581	ensembl	human	known	69_37n	missense	32	20.00	8	SNP	0.992	T
SPARCL1	8404	genome.wustl.edu	37	4	88415285	88415285	+	Missense_Mutation	SNP	C	C	G			TCGA-A2-A0CR-01A-11D-A228-09	TCGA-A2-A0CR-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f573c3c3-7b61-4955-8772-215b7cb9a763	3bdb54b4-1e26-4274-a1bd-800416ffbd34	g.chr4:88415285C>G	ENST00000282470.6	-	4	1137	c.667G>C	c.(667-669)Gaa>Caa	p.E223Q	SPARCL1_ENST00000418378.1_Missense_Mutation_p.E223Q|SPARCL1_ENST00000503414.1_Missense_Mutation_p.E98Q	NM_004684.4	NP_004675.3	Q14515	SPRL1_HUMAN	SPARC-like 1 (hevin)	223					signal transduction (GO:0007165)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)			breast(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(7)|ovary(1)|skin(2)|stomach(2)	21				OV - Ovarian serous cystadenocarcinoma(123;0.00118)		CTGGGCAATTCTGTCTTTCTT	0.418																																						dbGAP											0													315.0	318.0	317.0					4																	88415285		2203	4300	6503	-	-	-	SO:0001583	missense	0			X86693	CCDS3622.1	4q22-q25	2013-01-10	2008-08-29		ENSG00000152583	ENSG00000152583		"""EF-hand domain containing"""	11220	protein-coding gene	gene with protein product		606041	"""SPARC-like 1 (mast9, hevin)"""			8488563, 7600298, 16844696	Standard	NM_001128310		Approved	MAST9	uc003hqs.4	Q14515	OTTHUMG00000130605	ENST00000282470.6:c.667G>C	4.37:g.88415285C>G	ENSP00000282470:p.Glu223Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	B4E2Z0|E7ESU2|Q14800	Missense_Mutation	SNP	pfam_SPARC/Testican_Ca-bd-dom,pfam_Prot_inh_Kazal,pfam_Kazal-type_dom,pfam_Follistatin/Osteonectin_EGF,smart_Fol_N,smart_Prot_inh_Kazal,pirsf_SPARC-like_p1,pfscan_EF_HAND_2	p.E223Q	ENST00000282470.6	37	c.667	CCDS3622.1	4	.	.	.	.	.	.	.	.	.	.	C	11.17	1.558681	0.27827	.	.	ENSG00000152583	ENST00000282470;ENST00000418378;ENST00000438050;ENST00000503414	T;T;T	0.34859	1.87;1.87;1.34	4.95	3.2	0.36748	.	0.731745	0.13633	N	0.373584	T	0.30727	0.0774	L	0.34521	1.04	0.09310	N	1	D;D	0.57899	0.981;0.981	P;P	0.48368	0.575;0.575	T	0.06409	-1.0828	10	0.36615	T	0.2	-8.4415	6.8545	0.24032	0.0:0.7972:0.0:0.2028	.	223;223	Q8N4S1;Q14515	.;SPRL1_HUMAN	Q	223;223;98;98	ENSP00000282470:E223Q;ENSP00000414856:E223Q;ENSP00000422903:E98Q	ENSP00000282470:E223Q	E	-	1	0	SPARCL1	88634309	0.006000	0.16342	0.010000	0.14722	0.013000	0.08279	1.310000	0.33551	1.403000	0.46800	0.655000	0.94253	GAA	SPARCL1	-	pirsf_SPARC-like_p1	ENSG00000152583		0.418	SPARCL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPARCL1	HGNC	protein_coding	OTTHUMT00000253059.2	61	0.00	0	C			88415285	88415285	-1	no_errors	ENST00000282470	ensembl	human	known	69_37n	missense	47	14.55	8	SNP	0.005	G
SPOP	8405	genome.wustl.edu	37	17	47696471	47696471	+	Splice_Site	SNP	C	C	T			TCGA-A2-A0CR-01A-11D-A228-09	TCGA-A2-A0CR-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f573c3c3-7b61-4955-8772-215b7cb9a763	3bdb54b4-1e26-4274-a1bd-800416ffbd34	g.chr17:47696471C>T	ENST00000393328.2	-	6	718		c.e6-1		SPOP_ENST00000347630.2_Splice_Site|SPOP_ENST00000504102.1_Splice_Site|SPOP_ENST00000513080.1_5'Flank|SPOP_ENST00000503676.1_Splice_Site|SPOP_ENST00000393331.3_Splice_Site	NM_003563.3	NP_003554.1	O43791	SPOP_HUMAN	speckle-type POZ protein						glucose homeostasis (GO:0042593)|positive regulation of endoplasmic reticulum stress-induced intrinsic apoptotic signaling pathway (GO:1902237)|positive regulation of type B pancreatic cell apoptotic process (GO:2000676)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	Cul3-RING ubiquitin ligase complex (GO:0031463)|nuclear speck (GO:0016607)|nucleus (GO:0005634)	ubiquitin protein ligase binding (GO:0031625)			endometrium(18)|kidney(1)|large_intestine(3)|liver(1)|lung(4)|ovary(3)|prostate(33)	63						CGTTGACTCTCTGGGGTGGGG	0.428										Prostate(2;0.17)																												dbGAP											0													107.0	112.0	110.0					17																	47696471		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			AJ000644	CCDS11551.1	17q21.33	2013-01-09			ENSG00000121067	ENSG00000121067		"""BTB/POZ domain containing"""	11254	protein-coding gene	gene with protein product		602650				9414087	Standard	NM_001007227		Approved	TEF2, BTBD32	uc002ipg.3	O43791	OTTHUMG00000161496	ENST00000393328.2:c.353-1G>A	17.37:g.47696471C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B2R6S3|D3DTW7|Q53HJ1	Splice_Site	SNP	-	e4-1	ENST00000393328.2	37	c.353-1	CCDS11551.1	17	.	.	.	.	.	.	.	.	.	.	C	20.4	3.988723	0.74589	.	.	ENSG00000121067	ENST00000393328;ENST00000393331;ENST00000347630;ENST00000504102;ENST00000503536;ENST00000503676;ENST00000513872;ENST00000509079;ENST00000505581;ENST00000507970;ENST00000514121	.	.	.	5.52	5.52	0.82312	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.2223	0.93803	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	SPOP	45051470	1.000000	0.71417	1.000000	0.80357	0.862000	0.49288	7.647000	0.83462	2.873000	0.98535	0.563000	0.77884	.	SPOP	-	-	ENSG00000121067		0.428	SPOP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPOP	HGNC	protein_coding	OTTHUMT00000365154.2	25	0.00	0	C	NM_003563	Intron	47696471	47696471	-1	no_errors	ENST00000347630	ensembl	human	known	69_37n	splice_site	16	20.00	4	SNP	1.000	T
SPTA1	6708	genome.wustl.edu	37	1	158592794	158592794	+	Missense_Mutation	SNP	C	C	G			TCGA-A2-A0CR-01A-11D-A228-09	TCGA-A2-A0CR-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f573c3c3-7b61-4955-8772-215b7cb9a763	3bdb54b4-1e26-4274-a1bd-800416ffbd34	g.chr1:158592794C>G	ENST00000368147.4	-	43	6279	c.6099G>C	c.(6097-6099)gaG>gaC	p.E2033D		NM_003126.2	NP_003117.2	P02549	SPTA1_HUMAN	spectrin, alpha, erythrocytic 1	2033					actin filament capping (GO:0051693)|actin filament organization (GO:0007015)|axon guidance (GO:0007411)|hemopoiesis (GO:0030097)|lymphocyte homeostasis (GO:0002260)|plasma membrane organization (GO:0007009)|porphyrin-containing compound biosynthetic process (GO:0006779)|positive regulation of protein binding (GO:0032092)|positive regulation of T cell proliferation (GO:0042102)|regulation of cell shape (GO:0008360)	actin cytoskeleton (GO:0015629)|cuticular plate (GO:0032437)|cytosol (GO:0005829)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|spectrin (GO:0008091)|spectrin-associated cytoskeleton (GO:0014731)	actin filament binding (GO:0051015)|calcium ion binding (GO:0005509)|structural constituent of cytoskeleton (GO:0005200)			NS(3)|breast(7)|cervix(1)|endometrium(22)|kidney(9)|large_intestine(29)|liver(2)|lung(183)|ovary(5)|prostate(18)|skin(11)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(9)|urinary_tract(6)	307	all_hematologic(112;0.0378)					GCAGCTGTTTCTCCAGCAATT	0.443																																						dbGAP											0													147.0	148.0	148.0					1																	158592794		1893	4119	6012	-	-	-	SO:0001583	missense	0			M61877	CCDS41423.1	1q21	2014-06-23	2014-06-23		ENSG00000163554	ENSG00000163554		"""EF-hand domain containing"""	11272	protein-coding gene	gene with protein product	"""elliptocytosis 2"""	182860	"""spectrin, alpha, erythrocytic 1 (elliptocytosis 2)"""				Standard	NM_003126		Approved	EL2	uc001fst.1	P02549	OTTHUMG00000019636	ENST00000368147.4:c.6099G>C	1.37:g.158592794C>G	ENSP00000357129:p.Glu2033Asp	Somatic		WXS	Illumina GAIIx	Phase_IV	Q15514|Q5VYL1|Q5VYL2|Q6LDY5	Missense_Mutation	SNP	pfam_Spectrin_repeat,pfam_EF-hand_Ca_insen,pfam_SH3_domain,pfam_SH3_2,superfamily_SH3_domain,smart_Spectrin/alpha-actinin,smart_SH3_domain,pfscan_EF_HAND_2,pfscan_SH3_domain,prints_Spectrin_alpha_SH3	p.E2033D	ENST00000368147.4	37	c.6099	CCDS41423.1	1	.	.	.	.	.	.	.	.	.	.	C	10.98	1.503553	0.26949	.	.	ENSG00000163554	ENST00000368148;ENST00000368147	T;T	0.54675	0.56;0.56	4.78	0.703	0.18116	.	.	.	.	.	T	0.34483	0.0899	M	0.69823	2.125	0.33002	D	0.526313	B	0.29115	0.233	B	0.39465	0.3	T	0.17837	-1.0356	9	0.33141	T	0.24	.	5.977	0.19385	0.132:0.6418:0.0:0.2262	.	2033	P02549	SPTA1_HUMAN	D	2033;2030	ENSP00000357130:E2033D;ENSP00000357129:E2030D	ENSP00000357129:E2030D	E	-	3	2	SPTA1	156859418	1.000000	0.71417	0.654000	0.29608	0.052000	0.14988	0.987000	0.29603	-0.018000	0.14079	-0.169000	0.13324	GAG	SPTA1	-	pfam_Spectrin_repeat	ENSG00000163554		0.443	SPTA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPTA1	HGNC	protein_coding	OTTHUMT00000051851.3	47	0.00	0	C	NM_003126		158592794	158592794	-1	no_errors	ENST00000368148	ensembl	human	known	69_37n	missense	62	13.89	10	SNP	1.000	G
SRPX2	27286	genome.wustl.edu	37	X	99921786	99921786	+	Missense_Mutation	SNP	G	G	T			TCGA-A2-A0CR-01A-11D-A228-09	TCGA-A2-A0CR-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f573c3c3-7b61-4955-8772-215b7cb9a763	3bdb54b4-1e26-4274-a1bd-800416ffbd34	g.chrX:99921786G>T	ENST00000373004.3	+	8	1245	c.817G>T	c.(817-819)Ggc>Tgc	p.G273C		NM_014467.2	NP_055282.1	O60687	SRPX2_HUMAN	sushi-repeat containing protein, X-linked 2	273	Sushi 3. {ECO:0000255|PROSITE- ProRule:PRU00302}.				angiogenesis (GO:0001525)|cell motility (GO:0048870)|positive regulation of cell migration involved in sprouting angiogenesis (GO:0090050)|positive regulation of synapse assembly (GO:0051965)|regulation of phosphorylation (GO:0042325)|single organismal cell-cell adhesion (GO:0016337)|vocalization behavior (GO:0071625)	cell junction (GO:0030054)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|excitatory synapse (GO:0060076)|extracellular space (GO:0005615)|synaptic membrane (GO:0097060)	hepatocyte growth factor binding (GO:0036458)|identical protein binding (GO:0042802)|receptor binding (GO:0005102)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(1)|lung(10)|ovary(2)|upper_aerodigestive_tract(1)	19						TCCGCAGCACGGCTACCTCAC	0.552																																						dbGAP											0													59.0	52.0	55.0					X																	99921786		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF393649	CCDS14471.1	Xq21.33-q23	2011-01-25	2011-01-25		ENSG00000102359	ENSG00000102359			30668	protein-coding gene	gene with protein product		300642	"""sushi-repeat-containing protein, X-linked 2"""			9864177	Standard	NM_014467		Approved	SRPUL	uc004egb.3	O60687	OTTHUMG00000022003	ENST00000373004.3:c.817G>T	X.37:g.99921786G>T	ENSP00000362095:p.Gly273Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KQT3|Q8WW85	Missense_Mutation	SNP	pfam_Hyalin,pfam_Sushi_SCR_CCP,superfamily_Complement_control_module,superfamily_Thioredoxin-like_fold,smart_Sushi_SCR_CCP,pfscan_Hyalin,pfscan_Sushi_SCR_CCP	p.G273C	ENST00000373004.3	37	c.817	CCDS14471.1	X	.	.	.	.	.	.	.	.	.	.	G	27.8	4.867328	0.91511	.	.	ENSG00000102359	ENST00000373004	T	0.70399	-0.48	5.59	5.59	0.84812	Complement control module (2);Sushi/SCR/CCP (3);	0.000000	0.85682	D	0.000000	D	0.92071	0.7487	H	0.99650	4.68	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.95781	0.8817	9	.	.	.	-15.6325	18.6034	0.91257	0.0:0.0:1.0:0.0	.	273	O60687	SRPX2_HUMAN	C	273	ENSP00000362095:G273C	.	G	+	1	0	SRPX2	99808442	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	7.363000	0.79516	2.337000	0.79520	0.600000	0.82982	GGC	SRPX2	-	pfam_Sushi_SCR_CCP,superfamily_Complement_control_module,smart_Sushi_SCR_CCP,pfscan_Sushi_SCR_CCP	ENSG00000102359		0.552	SRPX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SRPX2	HGNC	protein_coding	OTTHUMT00000057486.1	37	0.00	0	G	NM_014467		99921786	99921786	+1	no_errors	ENST00000373004	ensembl	human	known	69_37n	missense	32	15.79	6	SNP	1.000	T
SSH2	85464	genome.wustl.edu	37	17	28088351	28088351	+	Intron	SNP	G	G	A	rs569894145		TCGA-A2-A0CR-01A-11D-A228-09	TCGA-A2-A0CR-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f573c3c3-7b61-4955-8772-215b7cb9a763	3bdb54b4-1e26-4274-a1bd-800416ffbd34	g.chr17:28088351G>A	ENST00000269033.3	-	2	259				SSH2_ENST00000540801.1_Intron|SSH2_ENST00000324677.7_5'UTR|RP11-82O19.1_ENST00000577846.1_RNA	NM_001282129.1|NM_033389.2	NP_001269058.1|NP_203747.2	Q76I76	SSH2_HUMAN	slingshot protein phosphatase 2						actin cytoskeleton organization (GO:0030036)|protein dephosphorylation (GO:0006470)|regulation of actin polymerization or depolymerization (GO:0008064)|regulation of axonogenesis (GO:0050770)|regulation of lamellipodium assembly (GO:0010591)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular space (GO:0005615)	actin binding (GO:0003779)|DNA binding (GO:0003677)|phosphoprotein phosphatase activity (GO:0004721)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)		SSH2/SUZ12(2)	breast(1)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(5)|lung(16)|ovary(1)|prostate(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	39						GCTCCGGCACGAGGCGCAGGC	0.741													G|||	1	0.000199681	0.0008	0.0	5008	,	,		9781	0.0		0.0	False		,,,				2504	0.0					dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			AB072359	CCDS11253.1, CCDS74024.1	17q11.2	2013-03-05	2013-03-05		ENSG00000141298	ENSG00000141298		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Slingshots"""	30580	protein-coding gene	gene with protein product		606779	"""slingshot homolog 2 (Drosophila)"""			11832213, 11214970	Standard	XM_005258059		Approved	KIAA1725	uc002heo.1	Q76I76	OTTHUMG00000132752	ENST00000269033.3:c.107+32560C>T	17.37:g.28088351G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q8TDB5|Q8WYL1|Q8WYL2|Q96F40|Q96H36|Q9C0D8	RNA	SNP	-	NULL	ENST00000269033.3	37	NULL	CCDS11253.1	17																																																																																			SSH2	-	-	ENSG00000141298		0.741	SSH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SSH2	HGNC	protein_coding	OTTHUMT00000256116.1	24	0.00	0	G	NM_033389		28088351	28088351	-1	no_errors	ENST00000580327	ensembl	human	known	69_37n	rna	17	26.09	6	SNP	0.000	A
SYCP1	6847	genome.wustl.edu	37	1	115537679	115537679	+	3'UTR	SNP	G	G	A			TCGA-A2-A0CR-01A-11D-A228-09	TCGA-A2-A0CR-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f573c3c3-7b61-4955-8772-215b7cb9a763	3bdb54b4-1e26-4274-a1bd-800416ffbd34	g.chr1:115537679G>A	ENST00000369522.3	+	0	3210				SYCP1_ENST00000369518.1_3'UTR|SYCP1_ENST00000477590.1_3'UTR	NM_001282541.1|NM_003176.2	NP_001269470.1|NP_003167.2	Q15431	SYCP1_HUMAN	synaptonemal complex protein 1						chiasma assembly (GO:0051026)|lateral element assembly (GO:0051878)|meiotic DNA repair synthesis (GO:0000711)|reciprocal meiotic recombination (GO:0007131)|regulation of protein localization (GO:0032880)|sperm chromatin condensation (GO:0035092)|spermatogenesis (GO:0007283)|synaptonemal complex assembly (GO:0007130)	central element (GO:0000801)|male germ cell nucleus (GO:0001673)|transverse filament (GO:0000802)	DNA binding (GO:0003677)		RGS22/SYCP1(2)	NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(17)|lung(20)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	48	Lung SC(450;0.211)	all_cancers(81;8.65e-08)|all_epithelial(167;3.32e-07)|all_lung(203;6.55e-06)|Lung NSC(69;1.11e-05)|Acute lymphoblastic leukemia(138;0.221)		Lung(183;0.0234)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|all cancers(265;0.112)|Epithelial(280;0.124)|LUSC - Lung squamous cell carcinoma(189;0.133)		CTAATAACGTGAAACTTATAG	0.274																																						dbGAP											0													16.0	18.0	17.0					1																	115537679		2116	4234	6350	-	-	-	SO:0001624	3_prime_UTR_variant	0			D67035	CCDS879.1, CCDS72840.1	1p13-p12	2009-03-12			ENSG00000198765	ENSG00000198765			11487	protein-coding gene	gene with protein product	"""cancer/testis antigen 8"""	602162				9560255	Standard	XM_005271154		Approved	HOM-TES-14, SCP1, CT8	uc001efr.3	Q15431	OTTHUMG00000012057	ENST00000369522.3:c.*39G>A	1.37:g.115537679G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	O14963|Q5VXJ6	RNA	SNP	-	NULL	ENST00000369522.3	37	NULL	CCDS879.1	1																																																																																			SYCP1	-	-	ENSG00000198765		0.274	SYCP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SYCP1	HGNC	protein_coding	OTTHUMT00000033386.1	37	0.00	0	G	NM_003176		115537679	115537679	+1	no_errors	ENST00000477590	ensembl	human	known	69_37n	rna	33	13.16	5	SNP	0.000	A
SYMPK	8189	genome.wustl.edu	37	19	46347318	46347318	+	Missense_Mutation	SNP	C	C	T			TCGA-A2-A0CR-01A-11D-A228-09	TCGA-A2-A0CR-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f573c3c3-7b61-4955-8772-215b7cb9a763	3bdb54b4-1e26-4274-a1bd-800416ffbd34	g.chr19:46347318C>T	ENST00000245934.7	-	8	1061	c.817G>A	c.(817-819)Gag>Aag	p.E273K		NM_004819.2	NP_004810.2	Q92797	SYMPK_HUMAN	symplekin	273					cell adhesion (GO:0007155)|mRNA polyadenylation (GO:0006378)|positive regulation of protein dephosphorylation (GO:0035307)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|tight junction (GO:0005923)				breast(3)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(7)|liver(1)|lung(25)|ovary(1)|urinary_tract(1)	45		all_neural(266;0.0299)|Ovarian(192;0.0308)		OV - Ovarian serous cystadenocarcinoma(262;0.00509)|GBM - Glioblastoma multiforme(486;0.0593)		TGGATCACCTCAGACATGAAC	0.537																																						dbGAP											0													106.0	89.0	95.0					19																	46347318		2203	4300	6503	-	-	-	SO:0001583	missense	0			U49240	CCDS12676.2	19q13.3	2008-02-05			ENSG00000125755	ENSG00000125755			22935	protein-coding gene	gene with protein product		602388				9330635	Standard	NM_004819		Approved	SYM, SPK	uc002pdn.3	Q92797	OTTHUMG00000150151	ENST00000245934.7:c.817G>A	19.37:g.46347318C>T	ENSP00000245934:p.Glu273Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	O00521|O00689|O00733|Q59GT5|Q8N2U5	Missense_Mutation	SNP	pfam_DUF3453,pfam_Symplekin_C,superfamily_ARM-type_fold	p.E273K	ENST00000245934.7	37	c.817	CCDS12676.2	19	.	.	.	.	.	.	.	.	.	.	C	16.89	3.248248	0.59103	.	.	ENSG00000125755	ENST00000245934	T	0.32272	1.46	5.63	5.63	0.86233	Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.19805	0.0476	N	0.14661	0.345	0.54753	D	0.99998	B;B	0.25206	0.12;0.077	B;B	0.21917	0.037;0.018	T	0.07927	-1.0747	10	0.15066	T	0.55	.	17.1808	0.86854	0.0:1.0:0.0:0.0	.	288;273	Q4LE61;Q92797	.;SYMPK_HUMAN	K	273	ENSP00000245934:E273K	ENSP00000245934:E273K	E	-	1	0	SYMPK	51039158	0.996000	0.38824	0.960000	0.40013	0.995000	0.86356	3.424000	0.52764	2.638000	0.89438	0.557000	0.71058	GAG	SYMPK	-	pfam_DUF3453,superfamily_ARM-type_fold	ENSG00000125755		0.537	SYMPK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SYMPK	HGNC	protein_coding	OTTHUMT00000316581.1	48	0.00	0	C	NM_004819		46347318	46347318	-1	no_errors	ENST00000245934	ensembl	human	known	69_37n	missense	43	15.69	8	SNP	0.998	T
TCP11L1	55346	genome.wustl.edu	37	11	33102667	33102667	+	Missense_Mutation	SNP	G	G	C			TCGA-A2-A0CR-01A-11D-A228-09	TCGA-A2-A0CR-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f573c3c3-7b61-4955-8772-215b7cb9a763	3bdb54b4-1e26-4274-a1bd-800416ffbd34	g.chr11:33102667G>C	ENST00000324357.9	+	6	863	c.851G>C	c.(850-852)aGa>aCa	p.R284T				Q9NUJ3	T11L1_HUMAN	t-complex 11, testis-specific-like 1	0						microtubule (GO:0005874)				kidney(1)|liver(2)|lung(2)|skin(1)	6						ACAGGAAAAAGATGGATATCT	0.353																																						dbGAP											0																																										-	-	-	SO:0001583	missense	0			BC041696	CCDS7882.1	11p13	2014-08-12	2012-09-20		ENSG00000176148	ENSG00000176148			25655	protein-coding gene	gene with protein product			"""t-complex 11 (mouse) like 1"""				Standard	NM_001145541		Approved	FLJ11336	uc010rei.2	Q9NUJ3	OTTHUMG00000165303	ENST00000324357.9:c.851G>C	11.37:g.33102667G>C	ENSP00000316279:p.Arg284Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DR01|Q8IVX4	Missense_Mutation	SNP	pfam_Tcp11	p.R505T	ENST00000324357.9	37	c.1514		11	.	.	.	.	.	.	.	.	.	.	G	9.427	1.084641	0.20309	.	.	ENSG00000176148	ENST00000324357	T	0.23754	1.89	3.0	-2.98	0.05513	.	.	.	.	.	T	0.17323	0.0416	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.33189	-0.9878	6	0.59425	D	0.04	.	0.2876	0.00253	0.1998:0.2421:0.1851:0.373	.	.	.	.	T	284	ENSP00000316279:R284T	ENSP00000316279:R284T	R	+	2	0	TCP11L1	33059243	0.003000	0.15002	0.000000	0.03702	0.633000	0.38033	-0.683000	0.05179	-0.571000	0.06014	-1.263000	0.01449	AGA	TCP11L1	-	NULL	ENSG00000176148		0.353	TCP11L1-201	KNOWN	basic	protein_coding	TCP11L1	HGNC	protein_coding		47	0.00	0	G	NM_018393		33102667	33102667	+1	no_errors	ENST00000527661	ensembl	human	known	69_37n	missense	40	16.67	8	SNP	0.000	C
TFB2M	64216	genome.wustl.edu	37	1	246729197	246729197	+	Missense_Mutation	SNP	C	C	T			TCGA-A2-A0CR-01A-11D-A228-09	TCGA-A2-A0CR-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f573c3c3-7b61-4955-8772-215b7cb9a763	3bdb54b4-1e26-4274-a1bd-800416ffbd34	g.chr1:246729197C>T	ENST00000366514.4	-	1	429	c.244G>A	c.(244-246)Gag>Aag	p.E82K	CNST_ENST00000366513.4_5'Flank|TFB2M_ENST00000544618.1_Missense_Mutation_p.E82K|CNST_ENST00000366512.3_5'Flank	NM_022366.2	NP_071761.1	Q9H5Q4	TFB2M_HUMAN	transcription factor B2, mitochondrial	82					gene expression (GO:0010467)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription from mitochondrial promoter (GO:0006390)|transcription initiation from mitochondrial promoter (GO:0006391)	mitochondrial matrix (GO:0005759)|mitochondrial nucleoid (GO:0042645)	poly(A) RNA binding (GO:0044822)|rRNA (adenine-N6,N6-)-dimethyltransferase activity (GO:0000179)|transcription cofactor activity (GO:0003712)			breast(1)|endometrium(1)|kidney(12)|large_intestine(3)|lung(5)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	28	all_cancers(71;4.25e-05)|all_epithelial(71;4.92e-06)|Ovarian(71;0.0254)|all_lung(81;0.0272)|Breast(184;0.0318)|Lung NSC(105;0.0376)		OV - Ovarian serous cystadenocarcinoma(106;0.00358)			GCCAGGGTCTCAGCCAATCTC	0.517																																						dbGAP											0													91.0	94.0	93.0					1																	246729197		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK026835	CCDS1627.1	1q44	2008-02-05			ENSG00000162851	ENSG00000162851			18559	protein-coding gene	gene with protein product		607055					Standard	NM_022366		Approved	FLJ23182, FLJ22661, Hkp1	uc001ibn.3	Q9H5Q4	OTTHUMG00000040091	ENST00000366514.4:c.244G>A	1.37:g.246729197C>T	ENSP00000355471:p.Glu82Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q9H626	Missense_Mutation	SNP	pfam_rRNA_Ade_methylase_transferase,smart_rRNA_Ade_methylase_Trfase_N,pirsf_Mt_di-Me-Ado_Trfase_2_prcur	p.E82K	ENST00000366514.4	37	c.244	CCDS1627.1	1	.	.	.	.	.	.	.	.	.	.	C	7.324	0.617474	0.14129	.	.	ENSG00000162851	ENST00000366514;ENST00000544618	T;T	0.30448	1.53;1.53	4.18	-4.96	0.03038	.	1.028430	0.07729	N	0.944971	T	0.16685	0.0401	L	0.34521	1.04	0.09310	N	1	B	0.10296	0.003	B	0.16289	0.015	T	0.40701	-0.9549	10	0.06494	T	0.89	0.1719	7.6655	0.28428	0.0:0.2041:0.1377:0.6582	.	82	Q9H5Q4	TFB2M_HUMAN	K	82	ENSP00000355471:E82K;ENSP00000442426:E82K	ENSP00000355471:E82K	E	-	1	0	TFB2M	244795820	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	-0.017000	0.12590	-1.097000	0.03042	-0.362000	0.07510	GAG	TFB2M	-	smart_rRNA_Ade_methylase_Trfase_N,pirsf_Mt_di-Me-Ado_Trfase_2_prcur	ENSG00000162851		0.517	TFB2M-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TFB2M	HGNC	protein_coding	OTTHUMT00000096673.1	53	0.00	0	C	NM_022366		246729197	246729197	-1	no_errors	ENST00000366514	ensembl	human	known	69_37n	missense	42	10.64	5	SNP	0.000	T
TFE3	7030	genome.wustl.edu	37	X	48887846	48887846	+	Silent	SNP	G	G	A			TCGA-A2-A0CR-01A-11D-A228-09	TCGA-A2-A0CR-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f573c3c3-7b61-4955-8772-215b7cb9a763	3bdb54b4-1e26-4274-a1bd-800416ffbd34	g.chrX:48887846G>A	ENST00000315869.7	-	10	1810	c.1551C>T	c.(1549-1551)ttC>ttT	p.F517F	TFE3_ENST00000487451.1_5'Flank	NM_006521.4	NP_006512.2	P19532	TFE3_HUMAN	transcription factor binding to IGHM enhancer 3	517					humoral immune response (GO:0006959)|positive regulation of cell adhesion (GO:0045785)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of osteoclast differentiation (GO:0045670)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)		NONO/TFE3(2)|PRCC/TFE3(25)|SFPQ/TFE3(6)|CLTC/TFE3(2)|ASPSCR1/TFE3(167)	central_nervous_system(1)	1						GCCCCAGGTGGAAGGGGTCTC	0.682			T	"""SFPQ, ASPSCR1, PRCC, NONO, CLTC"""	"""papillary renal, alveolar soft part sarcoma, renal"""																																	dbGAP		Dom	yes		X	Xp11.22	7030	transcription factor binding to IGHM enhancer 3		E	0													43.0	44.0	43.0					X																	48887846		2203	4296	6499	-	-	-	SO:0001819	synonymous_variant	0			X96717	CCDS14315.3	Xp11.22	2013-05-21			ENSG00000068323	ENSG00000068323		"""Basic helix-loop-helix proteins"""	11752	protein-coding gene	gene with protein product	transcription factor E family, member A	314310				1672758, 1685140	Standard	NM_006521		Approved	TFEA, bHLHe33	uc004dmb.3	P19532	OTTHUMG00000022690	ENST00000315869.7:c.1551C>T	X.37:g.48887846G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A8MZL6|Q5JU74|Q92757|Q92758|Q99964	Silent	SNP	pfam_bHLH_ZIP_TF_MiT/TFE,pfam_HLH_DNA-bd,superfamily_HLH_DNA-bd,smart_HLH_DNA-bd,pfscan_HLH_DNA-bd	p.F517	ENST00000315869.7	37	c.1551	CCDS14315.3	X																																																																																			TFE3	-	pfam_bHLH_ZIP_TF_MiT/TFE	ENSG00000068323		0.682	TFE3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TFE3	HGNC	protein_coding	OTTHUMT00000058872.2	35	0.00	0	G	NM_006521		48887846	48887846	-1	no_errors	ENST00000315869	ensembl	human	known	69_37n	silent	51	15.00	9	SNP	0.993	A
THAP11	57215	genome.wustl.edu	37	16	67876823	67876824	+	In_Frame_Ins	INS	-	-	CAG	rs28647874|rs377516180|rs34213159	byFrequency	TCGA-A2-A0CR-01A-11D-A228-09	TCGA-A2-A0CR-10A-01D-A22A-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f573c3c3-7b61-4955-8772-215b7cb9a763	3bdb54b4-1e26-4274-a1bd-800416ffbd34	g.chr16:67876823_67876824insCAG	ENST00000303596.1	+	1	611_612	c.366_367insCAG	c.(367-369)cag>CAGcag	p.123_123Q>QQ	CENPT_ENST00000562787.1_Intron	NM_020457.2	NP_065190.2	Q96EK4	THA11_HUMAN	THAP domain containing 11	123	Gln-rich.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|intercellular bridge (GO:0045171)|nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			cervix(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(2)|urinary_tract(1)	8		Acute lymphoblastic leukemia(13;0.000299)|all_hematologic(13;0.0184)|Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.00412)|Epithelial(162;0.018)|all cancers(182;0.118)		agcagcagcaacagcagcagca	0.678																																						dbGAP											0																																										-	-	-	SO:0001652	inframe_insertion	0			AB015338	CCDS10847.1	16q22.1	2013-01-25			ENSG00000168286	ENSG00000168286		"""THAP (C2CH-type zinc finger) domain containing"""	23194	protein-coding gene	gene with protein product		609119				12575992, 8325628	Standard	NM_020457		Approved	HRIHFB2206, CTG-B45d, CTG-B43a	uc002euo.3	Q96EK4	OTTHUMG00000137546	ENST00000303596.1:c.394_396dupCAG	16.37:g.67876830_67876832dupCAG	ENSP00000304689:p.Gln132dup	Somatic		WXS	Illumina GAIIx	Phase_IV	A4UCT5|A8K002|O94795	In_Frame_Ins	INS	pfam_Znf_C2CH,smart_Znf_C2CH,pfscan_Znf_C2CH	p.126in_frame_insQ	ENST00000303596.1	37	c.366_367	CCDS10847.1	16																																																																																			THAP11	-	NULL	ENSG00000168286		0.678	THAP11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	THAP11	HGNC	protein_coding	OTTHUMT00000268879.1	16	0.00	0	-	NM_020457		67876823	67876824	+1	no_errors	ENST00000303596	ensembl	human	known	69_37n	in_frame_ins	18	30.77	8	INS	0.001:0.009	CAG
TMEM33	55161	genome.wustl.edu	37	4	41946820	41946820	+	Missense_Mutation	SNP	C	C	T			TCGA-A2-A0CR-01A-11D-A228-09	TCGA-A2-A0CR-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f573c3c3-7b61-4955-8772-215b7cb9a763	3bdb54b4-1e26-4274-a1bd-800416ffbd34	g.chr4:41946820C>T	ENST00000504986.1	+	5	772	c.407C>T	c.(406-408)tCa>tTa	p.S136L	TMEM33_ENST00000325094.5_Missense_Mutation_p.S136L|TMEM33_ENST00000513702.1_Missense_Mutation_p.S136L	NM_018126.2	NP_060596.2	P57088	TMM33_HUMAN	transmembrane protein 33	136						extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|melanosome (GO:0042470)				endometrium(1)|large_intestine(3)|lung(4)|ovary(1)	9						GCAAGGGGCTCAAATAGTTTA	0.343																																						dbGAP											0													74.0	72.0	73.0					4																	41946820		2203	4299	6502	-	-	-	SO:0001583	missense	0			BC000948	CCDS3464.1	4p14	2008-02-05			ENSG00000109133	ENSG00000109133			25541	protein-coding gene	gene with protein product						12477932	Standard	NM_018126		Approved	FLJ10525	uc003gwi.2	P57088	OTTHUMG00000099381	ENST00000504986.1:c.407C>T	4.37:g.41946820C>T	ENSP00000422473:p.Ser136Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KSS8|Q9H953	Nonsense_Mutation	SNP	pfam_UPF0121	p.Q70*	ENST00000504986.1	37	c.208	CCDS3464.1	4	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	12.62|12.62	1.993859|1.993859	0.35131|0.35131	.|.	.|.	ENSG00000109133|ENSG00000109133	ENST00000513558|ENST00000504986;ENST00000508448;ENST00000513702;ENST00000325094	.|.	.|.	.|.	5.12|5.12	5.12|5.12	0.69794|0.69794	.|.	.|0.065103	.|0.64402	.|D	.|0.000005	.|T	.|0.37758	.|0.1015	N|N	0.08118|0.08118	0|0	0.50039|0.50039	D|D	0.999847|0.999847	.|B	.|0.02656	.|0.0	.|B	.|0.04013	.|0.001	.|T	.|0.26538	.|-1.0100	.|9	.|0.10902	.|T	.|0.67	-7.3319|-7.3319	18.584|18.584	0.91182|0.91182	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|136	.|P57088	.|TMM33_HUMAN	X|L	70|136	.|.	.|ENSP00000441455:S136L	Q|S	+|+	1|2	0|0	TMEM33|TMEM33	41641577|41641577	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.992000|0.992000	0.81027|0.81027	4.632000|4.632000	0.61311|0.61311	2.399000|2.399000	0.81585|0.81585	0.655000|0.655000	0.94253|0.94253	CAA|TCA	TMEM33	-	pfam_UPF0121	ENSG00000109133		0.343	TMEM33-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM33	HGNC	protein_coding	OTTHUMT00000216834.2	34	0.00	0	C	NM_018126		41946820	41946820	+1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000513558	ensembl	human	putative	69_37n	nonsense	36	18.18	8	SNP	1.000	T
TMEM33	55161	genome.wustl.edu	37	4	41946834	41946834	+	Missense_Mutation	SNP	C	C	A			TCGA-A2-A0CR-01A-11D-A228-09	TCGA-A2-A0CR-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f573c3c3-7b61-4955-8772-215b7cb9a763	3bdb54b4-1e26-4274-a1bd-800416ffbd34	g.chr4:41946834C>A	ENST00000504986.1	+	5	786	c.421C>A	c.(421-423)Ctg>Atg	p.L141M	TMEM33_ENST00000325094.5_Missense_Mutation_p.L141M|TMEM33_ENST00000513702.1_Missense_Mutation_p.L141M	NM_018126.2	NP_060596.2	P57088	TMM33_HUMAN	transmembrane protein 33	141						extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|melanosome (GO:0042470)				endometrium(1)|large_intestine(3)|lung(4)|ovary(1)	9						TAGTTTACCTCTGCTGAGATC	0.328																																						dbGAP											0													80.0	79.0	79.0					4																	41946834		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC000948	CCDS3464.1	4p14	2008-02-05			ENSG00000109133	ENSG00000109133			25541	protein-coding gene	gene with protein product						12477932	Standard	NM_018126		Approved	FLJ10525	uc003gwi.2	P57088	OTTHUMG00000099381	ENST00000504986.1:c.421C>A	4.37:g.41946834C>A	ENSP00000422473:p.Leu141Met	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KSS8|Q9H953	Missense_Mutation	SNP	pfam_UPF0121	p.L141M	ENST00000504986.1	37	c.421	CCDS3464.1	4	.	.	.	.	.	.	.	.	.	.	C	14.22	2.470088	0.43839	.	.	ENSG00000109133	ENST00000504986;ENST00000508448;ENST00000513702;ENST00000325094	.	.	.	5.44	3.73	0.42828	.	0.055636	0.64402	D	0.000001	T	0.33904	0.0879	L	0.38531	1.155	0.32289	N	0.566599	B	0.13145	0.007	B	0.14578	0.011	T	0.32534	-0.9903	9	0.34782	T	0.22	-6.8626	6.9026	0.24291	0.0:0.614:0.0:0.386	.	141	P57088	TMM33_HUMAN	M	141	.	ENSP00000441455:L141M	L	+	1	2	TMEM33	41641591	1.000000	0.71417	0.999000	0.59377	0.995000	0.86356	3.147000	0.50639	0.691000	0.31592	0.655000	0.94253	CTG	TMEM33	-	pfam_UPF0121	ENSG00000109133		0.328	TMEM33-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM33	HGNC	protein_coding	OTTHUMT00000216834.2	33	0.00	0	C	NM_018126		41946834	41946834	+1	no_errors	ENST00000325094	ensembl	human	known	69_37n	missense	39	17.02	8	SNP	1.000	A
TNKS	8658	genome.wustl.edu	37	8	9413850	9413850	+	Missense_Mutation	SNP	C	C	T			TCGA-A2-A0CR-01A-11D-A228-09	TCGA-A2-A0CR-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f573c3c3-7b61-4955-8772-215b7cb9a763	3bdb54b4-1e26-4274-a1bd-800416ffbd34	g.chr8:9413850C>T	ENST00000310430.6	+	1	427	c.401C>T	c.(400-402)tCc>tTc	p.S134F	RP11-375N15.2_ENST00000607598.1_RNA|TNKS_ENST00000522110.1_Missense_Mutation_p.S134F|TNKS_ENST00000520408.1_Missense_Mutation_p.S134F	NM_003747.2	NP_003738.2	O95271	TNKS1_HUMAN	tankyrase, TRF1-interacting ankyrin-related ADP-ribose polymerase	134	Poly-Ser.				mitotic nuclear division (GO:0007067)|mitotic spindle organization (GO:0007052)|mRNA transport (GO:0051028)|negative regulation of DNA binding (GO:0043392)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of telomere maintenance via telomerase (GO:0032212)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein ADP-ribosylation (GO:0006471)|protein auto-ADP-ribosylation (GO:0070213)|protein localization to chromosome, telomeric region (GO:0070198)|protein poly-ADP-ribosylation (GO:0070212)|protein polyubiquitination (GO:0000209)|protein transport (GO:0015031)|regulation of telomere maintenance via telomerase (GO:0032210)|spindle assembly (GO:0051225)|Wnt signaling pathway (GO:0016055)	chromosome, centromeric region (GO:0000775)|chromosome, telomeric region (GO:0000781)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|nuclear chromosome, telomeric region (GO:0000784)|nuclear membrane (GO:0031965)|nuclear pore (GO:0005643)|nucleus (GO:0005634)|pericentriolar material (GO:0000242)	NAD+ ADP-ribosyltransferase activity (GO:0003950)|zinc ion binding (GO:0008270)			NS(1)|endometrium(10)|kidney(6)|large_intestine(4)|lung(17)|ovary(2)|prostate(4)|skin(3)|upper_aerodigestive_tract(2)	49				COAD - Colon adenocarcinoma(149;0.0467)		TCCTCTTCTTCCCCGACTTCT	0.637																																						dbGAP											0													171.0	166.0	168.0					8																	9413850		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF082556	CCDS5974.1	8p23.1	2013-01-10			ENSG00000173273	ENSG00000173273		"""Poly (ADP-ribose) polymerases"", ""Sterile alpha motif (SAM) domain containing"", ""Ankyrin repeat domain containing"""	11941	protein-coding gene	gene with protein product		603303				9822378, 10198177	Standard	XM_006716263		Approved	TIN1, TINF1, TNKS1, PARP-5a, PARP5A, pART5	uc003wss.3	O95271	OTTHUMG00000090481	ENST00000310430.6:c.401C>T	8.37:g.9413850C>T	ENSP00000311579:p.Ser134Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	O95272|Q4G0F2	Missense_Mutation	SNP	pfam_Ankyrin_rpt,pfam_Poly(ADP-ribose)pol_cat_dom,pfam_SAM_2,pfam_SAM_type1,superfamily_Ankyrin_rpt-contain_dom,superfamily_SAM/pointed,smart_Ankyrin_rpt,smart_SAM,prints_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_SAM,pfscan_Poly(ADP-ribose)pol_cat_dom	p.S134F	ENST00000310430.6	37	c.401	CCDS5974.1	8	.	.	.	.	.	.	.	.	.	.	C	19.51	3.840485	0.71488	.	.	ENSG00000173273	ENST00000520408;ENST00000310430;ENST00000522110	T;T	0.65178	-0.14;-0.11	4.78	4.78	0.61160	.	0.360318	0.28577	N	0.014850	T	0.54806	0.1881	N	0.24115	0.695	0.80722	D	1	D;B	0.55385	0.971;0.346	P;B	0.46049	0.502;0.248	T	0.62263	-0.6891	10	0.66056	D	0.02	.	16.9009	0.86113	0.0:1.0:0.0:0.0	.	134;134	E7EWY6;O95271	.;TNKS1_HUMAN	F	134	ENSP00000428299:S134F;ENSP00000311579:S134F	ENSP00000311579:S134F	S	+	2	0	TNKS	9451260	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	5.141000	0.64814	2.631000	0.89168	0.655000	0.94253	TCC	TNKS	-	NULL	ENSG00000173273		0.637	TNKS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TNKS	HGNC	protein_coding	OTTHUMT00000206935.1	70	0.00	0	C	NM_003747		9413850	9413850	+1	no_errors	ENST00000310430	ensembl	human	known	69_37n	missense	75	10.71	9	SNP	1.000	T
TRIM28	10155	genome.wustl.edu	37	19	59057200	59057200	+	Missense_Mutation	SNP	G	G	A			TCGA-A2-A0CR-01A-11D-A228-09	TCGA-A2-A0CR-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f573c3c3-7b61-4955-8772-215b7cb9a763	3bdb54b4-1e26-4274-a1bd-800416ffbd34	g.chr19:59057200G>A	ENST00000253024.5	+	3	812	c.523G>A	c.(523-525)Gag>Aag	p.E175K	TRIM28_ENST00000341753.6_Intron|RN7SL525P_ENST00000579267.1_RNA	NM_005762.2	NP_005753.1	Q13263	TIF1B_HUMAN	tripartite motif containing 28	175	RBCC domain.				convergent extension involved in axis elongation (GO:0060028)|DNA repair (GO:0006281)|embryonic placenta morphogenesis (GO:0060669)|epithelial to mesenchymal transition (GO:0001837)|gene expression (GO:0010467)|innate immune response (GO:0045087)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of viral release from host cell (GO:1902187)|positive regulation of DNA repair (GO:0045739)|positive regulation of transcription factor import into nucleus (GO:0042993)|positive regulation of transcription, DNA-templated (GO:0045893)|protein autophosphorylation (GO:0046777)|protein oligomerization (GO:0051259)|protein sumoylation (GO:0016925)|protein ubiquitination (GO:0016567)|transcription initiation from RNA polymerase II promoter (GO:0006367)	nuclear euchromatin (GO:0005719)|nuclear heterochromatin (GO:0005720)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromo shadow domain binding (GO:0070087)|DNA binding (GO:0003677)|Krueppel-associated box domain binding (GO:0035851)|ligase activity (GO:0016874)|poly(A) RNA binding (GO:0044822)|protein kinase activity (GO:0004672)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			biliary_tract(1)|breast(2)|endometrium(2)|kidney(2)|large_intestine(3)|lung(7)|ovary(1)|urinary_tract(1)	19		all_cancers(17;4.4e-22)|all_epithelial(17;2.15e-16)|Lung NSC(17;1.24e-06)|all_lung(17;5.41e-06)|Colorectal(82;3.46e-05)|Renal(17;0.00179)|all_neural(62;0.00607)|Ovarian(87;0.0443)|Breast(46;0.0928)|Medulloblastoma(540;0.184)		UCEC - Uterine corpus endometrioid carcinoma (67;0.0434)|all cancers(4;1.39e-13)|Epithelial(4;1.01e-10)|OV - Ovarian serous cystadenocarcinoma(4;2.34e-09)|GBM - Glioblastoma multiforme(193;0.0102)|Lung(386;0.179)		GCCTCTGTGTGAGACCTGTGT	0.577																																						dbGAP											0													80.0	75.0	77.0					19																	59057200		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS12985.1	19q13.4	2014-06-13	2011-01-25			ENSG00000130726		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"", ""Zinc fingers, PHD-type"""	16384	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 157"""	601742	"""tripartite motif-containing 28"""			11331580, 11226167	Standard	NM_005762		Approved	TIF1B, KAP1, TF1B, RNF96, PPP1R157	uc002qtg.1	Q13263		ENST00000253024.5:c.523G>A	19.37:g.59057200G>A	ENSP00000253024:p.Glu175Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	O00677|Q7Z632|Q93040|Q96IM1	Missense_Mutation	SNP	pfam_Znf_B-box,pfam_Znf_PHD-finger,superfamily_Znf_FYVE_PHD,superfamily_Bromodomain,smart_Znf_RING,smart_Znf_B-box,smart_Bbox_C,smart_Znf_PHD,smart_Bromodomain,pfscan_Znf_B-box,pfscan_Znf_PHD-finger,pfscan_Znf_RING	p.E175K	ENST00000253024.5	37	c.523	CCDS12985.1	19	.	.	.	.	.	.	.	.	.	.	G	7.679	0.688701	0.14973	.	.	ENSG00000130726	ENST00000253024	T	0.47177	0.85	4.89	3.85	0.44370	Zinc finger, B-box (3);	0.000000	0.52532	D	0.000061	T	0.37598	0.1009	L	0.42632	1.34	0.80722	D	1	B	0.33883	0.43	B	0.38954	0.286	T	0.15954	-1.0419	10	0.02654	T	1	-36.6752	11.2675	0.49118	0.0906:0.0:0.9094:0.0	.	175	Q13263	TIF1B_HUMAN	K	175	ENSP00000253024:E175K	ENSP00000253024:E175K	E	+	1	0	TRIM28	63749012	1.000000	0.71417	1.000000	0.80357	0.353000	0.29299	1.708000	0.37899	1.200000	0.43188	0.558000	0.71614	GAG	TRIM28	-	pfam_Znf_B-box,smart_Znf_B-box,pfscan_Znf_B-box	ENSG00000130726		0.577	TRIM28-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRIM28	HGNC	protein_coding	OTTHUMT00000467074.1	59	0.00	0	G	NM_005762		59057200	59057200	+1	no_errors	ENST00000253024	ensembl	human	known	69_37n	missense	81	19.00	19	SNP	1.000	A
TSN	7247	genome.wustl.edu	37	2	122520632	122520632	+	Nonsense_Mutation	SNP	C	C	G			TCGA-A2-A0CR-01A-11D-A228-09	TCGA-A2-A0CR-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f573c3c3-7b61-4955-8772-215b7cb9a763	3bdb54b4-1e26-4274-a1bd-800416ffbd34	g.chr2:122520632C>G	ENST00000389682.3	+	5	672	c.425C>G	c.(424-426)tCa>tGa	p.S142*	TSN_ENST00000536142.1_Intron|TSN_ENST00000498545.1_3'UTR|TSN_ENST00000409193.1_Nonsense_Mutation_p.S137*	NM_001261401.1|NM_004622.2	NP_001248330.1|NP_004613.1	Q15631	TSN_HUMAN	translin	142					DNA recombination (GO:0006310)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|endonuclease activity (GO:0004519)|mRNA binding (GO:0003729)|sequence-specific DNA binding (GO:0043565)	p.S142L(2)		NS(1)|autonomic_ganglia(1)|breast(2)|endometrium(2)|large_intestine(1)|liver(1)|lung(3)|skin(1)	12		Ovarian(717;0.0563)|Prostate(154;0.116)				GATTATCTCTCAGGAGTTCTA	0.358																																						dbGAP											2	Substitution - Missense(2)	breast(2)											81.0	82.0	81.0					2																	122520632		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			X78627	CCDS33284.1, CCDS58723.1	2q21.1	2008-05-23			ENSG00000211460	ENSG00000211460			12379	protein-coding gene	gene with protein product	"""recombination hotspot associated factor"""	600575				7947454, 9244443	Standard	NM_004622		Approved	TRSLN, BCLF-1, REHF-1	uc002tnl.3	Q15631	OTTHUMG00000153334	ENST00000389682.3:c.425C>G	2.37:g.122520632C>G	ENSP00000374332:p.Ser142*	Somatic		WXS	Illumina GAIIx	Phase_IV	B7Z3X8|Q5U0K7	Nonsense_Mutation	SNP	pfam_Translin,superfamily_Translin	p.S142*	ENST00000389682.3	37	c.425	CCDS33284.1	2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	39|39	7.347532|7.347532	0.98228|0.98228	.|.	.|.	ENSG00000211460|ENSG00000211460	ENST00000455432|ENST00000389682;ENST00000413418;ENST00000409193	.|.	.|.	.|.	5.74|5.74	5.74|5.74	0.90152|0.90152	.|.	.|0.062556	.|0.64402	.|D	.|0.000004	T|.	0.47248|.	0.1435|.	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|.	0.36138|.	-0.9760|.	4|.	.|0.02654	.|T	.|1	-26.438|-26.438	18.8971|18.8971	0.92427|0.92427	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|.	.|.	.|.	E|X	148|142;108;137	.|.	.|ENSP00000374332:S142X	Q|S	+|+	1|2	0|0	TSN|TSN	122237102|122237102	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	7.128000|7.128000	0.77217|0.77217	2.709000|2.709000	0.92574|0.92574	0.591000|0.591000	0.81541|0.81541	CAG|TCA	TSN	-	pfam_Translin,superfamily_Translin	ENSG00000211460		0.358	TSN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TSN	HGNC	protein_coding	OTTHUMT00000330767.1	41	0.00	0	C	NM_004622		122520632	122520632	+1	no_errors	ENST00000389682	ensembl	human	known	69_37n	nonsense	33	10.81	4	SNP	1.000	G
TTBK1	84630	genome.wustl.edu	37	6	43227338	43227338	+	Missense_Mutation	SNP	G	G	A			TCGA-A2-A0CR-01A-11D-A228-09	TCGA-A2-A0CR-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f573c3c3-7b61-4955-8772-215b7cb9a763	3bdb54b4-1e26-4274-a1bd-800416ffbd34	g.chr6:43227338G>A	ENST00000259750.4	+	12	1401	c.1318G>A	c.(1318-1320)Gac>Aac	p.D440N	TTBK1_ENST00000304139.5_Missense_Mutation_p.D389N	NM_032538.1	NP_115927.1	Q5TCY1	TTBK1_HUMAN	tau tubulin kinase 1	440					substantia nigra development (GO:0021762)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			breast(2)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(10)|liver(1)|lung(21)|ovary(3)|prostate(3)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	53			Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.0125)|OV - Ovarian serous cystadenocarcinoma(102;0.0399)			TGCCCCCCCAGACTCCCCCAC	0.672																																						dbGAP											0													23.0	24.0	23.0					6																	43227338		2201	4299	6500	-	-	-	SO:0001583	missense	0			AB058758	CCDS34455.1	6p21.1	2008-02-05			ENSG00000146216	ENSG00000146216			19140	protein-coding gene	gene with protein product						11347906	Standard	XM_006715229		Approved	KIAA1855	uc003ouq.1	Q5TCY1	OTTHUMG00000014725	ENST00000259750.4:c.1318G>A	6.37:g.43227338G>A	ENSP00000259750:p.Asp440Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	A2A2U5|Q2L6C6|Q6ZNH0|Q8N444|Q96JH2	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.D440N	ENST00000259750.4	37	c.1318	CCDS34455.1	6	.	.	.	.	.	.	.	.	.	.	G	20.0	3.930663	0.73327	.	.	ENSG00000146216	ENST00000393984;ENST00000259750;ENST00000304139	T	0.58506	0.33	5.12	5.12	0.69794	.	0.242408	0.41396	D	0.000889	T	0.50343	0.1610	L	0.36672	1.1	0.37878	D	0.930307	D	0.57257	0.979	P	0.52554	0.702	T	0.58584	-0.7611	10	0.87932	D	0	.	15.4743	0.75465	0.0:0.0:1.0:0.0	.	440	Q5TCY1	TTBK1_HUMAN	N	389;440;389	ENSP00000259750:D440N	ENSP00000259750:D440N	D	+	1	0	TTBK1	43335316	1.000000	0.71417	1.000000	0.80357	0.877000	0.50540	8.004000	0.88535	2.383000	0.81215	0.555000	0.69702	GAC	TTBK1	-	NULL	ENSG00000146216		0.672	TTBK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TTBK1	HGNC	protein_coding	OTTHUMT00000040584.3	58	0.00	0	G			43227338	43227338	+1	no_errors	ENST00000259750	ensembl	human	known	69_37n	missense	70	12.50	10	SNP	1.000	A
UBR4	23352	genome.wustl.edu	37	1	19484363	19484363	+	Silent	SNP	G	G	C			TCGA-A2-A0CR-01A-11D-A228-09	TCGA-A2-A0CR-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f573c3c3-7b61-4955-8772-215b7cb9a763	3bdb54b4-1e26-4274-a1bd-800416ffbd34	g.chr1:19484363G>C	ENST00000375254.3	-	40	5733	c.5706C>G	c.(5704-5706)ctC>ctG	p.L1902L	UBR4_ENST00000375267.2_Silent_p.L1902L|UBR4_ENST00000375226.2_Silent_p.L1902L|UBR4_ENST00000375217.2_Silent_p.L1902L	NM_020765.2	NP_065816.2	Q5T4S7	UBR4_HUMAN	ubiquitin protein ligase E3 component n-recognin 4	1902					protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|viral process (GO:0016032)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(7)|central_nervous_system(1)|cervix(2)|endometrium(23)|kidney(25)|large_intestine(25)|liver(2)|lung(47)|ovary(10)|pancreas(2)|prostate(7)|skin(5)|stomach(5)|upper_aerodigestive_tract(4)|urinary_tract(6)	171		Colorectal(325;3.46e-05)|Renal(390;0.000147)|all_lung(284;0.000328)|Lung NSC(340;0.000406)|Breast(348;0.000814)|Ovarian(437;0.00774)|Myeloproliferative disorder(586;0.0256)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00674)|BRCA - Breast invasive adenocarcinoma(304;5.43e-05)|Kidney(64;0.000337)|KIRC - Kidney renal clear cell carcinoma(64;0.00426)|STAD - Stomach adenocarcinoma(196;0.00715)|READ - Rectum adenocarcinoma(331;0.0816)		GGGGAGAGGAGAGCACACACA	0.547																																						dbGAP											0													148.0	140.0	142.0					1																	19484363		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF348492	CCDS189.1	1p36.13	2008-06-23	2007-06-19	2007-06-19	ENSG00000127481	ENSG00000127481		"""Ubiquitin protein ligase E3 component n-recognins"""	30313	protein-coding gene	gene with protein product		609890	"""zinc finger, UBR1 type 1"""	ZUBR1		14702039, 10718198, 16055722	Standard	XM_005245802		Approved	KIAA1307, KIAA0462, RBAF600	uc001bbi.3	Q5T4S7	OTTHUMG00000002498	ENST00000375254.3:c.5706C>G	1.37:g.19484363G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	A8MPT2|A8MQ33|A8MQB1|O60646|O75050|Q4QRK5|Q5T4S8|Q5T4S9|Q5TBN8|Q5TBP2|Q6DKH8|Q6P4A4|Q7L8P7|Q8IXJ4|Q8TDN5|Q8WV67|Q9HA46|Q9P2N9|Q9UG82	Silent	SNP	superfamily_WD40_repeat_dom,superfamily_ARM-type_fold,smart_Znf_N-recognin_met,pfscan_Znf_N-recognin	p.L1902	ENST00000375254.3	37	c.5706	CCDS189.1	1																																																																																			UBR4	-	superfamily_WD40_repeat_dom,superfamily_ARM-type_fold	ENSG00000127481		0.547	UBR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UBR4	HGNC	protein_coding	OTTHUMT00000007085.1	28	0.00	0	G	NM_020765		19484363	19484363	-1	no_errors	ENST00000375267	ensembl	human	known	69_37n	silent	28	15.15	5	SNP	0.985	C
UGT1A6	54578	genome.wustl.edu	37	2	234681046	234681046	+	Silent	SNP	C	C	T			TCGA-A2-A0CR-01A-11D-A228-09	TCGA-A2-A0CR-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f573c3c3-7b61-4955-8772-215b7cb9a763	3bdb54b4-1e26-4274-a1bd-800416ffbd34	g.chr2:234681046C>T	ENST00000305139.6	+	5	1579	c.1440C>T	c.(1438-1440)ctC>ctT	p.L480L	UGT1A1_ENST00000609637.1_Silent_p.L478L|UGT1A10_ENST00000344644.5_Silent_p.L478L|UGT1A6_ENST00000373424.1_Silent_p.L213L|UGT1A1_ENST00000373450.4_Silent_p.L478L|UGT1A1_ENST00000609767.1_Silent_p.L482L|UGT1A8_ENST00000305208.5_Silent_p.L481L|UGT1A1_ENST00000608381.1_Silent_p.L482L|UGT1A3_ENST00000482026.1_Silent_p.L482L|UGT1A9_ENST00000354728.4_Silent_p.L478L|UGT1A7_ENST00000373426.3_Silent_p.L478L|UGT1A4_ENST00000373409.3_Silent_p.L482L|UGT1A1_ENST00000608383.1_Silent_p.L481L|UGT1A5_ENST00000373414.3_Silent_p.L482L	NM_001072.3	NP_001063.2	P19224	UD16_HUMAN	UDP glucuronosyltransferase 1 family, polypeptide A6	480					cellular glucuronidation (GO:0052695)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	enzyme binding (GO:0019899)|glucuronosyltransferase activity (GO:0015020)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)			central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(4)|lung(10)|skin(1)|upper_aerodigestive_tract(1)	22		Breast(86;0.000765)|all_lung(227;0.00267)|Renal(207;0.00339)|all_hematologic(139;0.0116)|Acute lymphoblastic leukemia(138;0.0328)|Lung NSC(271;0.0457)|Lung SC(224;0.128)		Epithelial(121;5.86e-18)|BRCA - Breast invasive adenocarcinoma(100;0.000384)|Lung(119;0.00306)|LUSC - Lung squamous cell carcinoma(224;0.00702)	Acetaminophen(DB00316)|Deferiprone(DB08826)|Mycophenolate mofetil(DB00688)|Mycophenolic acid(DB01024)|Propofol(DB00818)|Valproic Acid(DB00313)	CCCACGACCTCACCTGGTACC	0.602																																						dbGAP											0													160.0	132.0	142.0					2																	234681046		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			M84130	CCDS2507.1, CCDS2508.1	2q37	2010-03-05	2005-07-20		ENSG00000167165	ENSG00000167165		"""UDP glucuronosyltransferases"""	12538	other	complex locus constituent		606431	"""UDP glycosyltransferase 1 family, polypeptide A6"""			9295054, 1339448	Standard	NM_001072		Approved	HLUGP, GNT1, UGT1F		P19224	OTTHUMG00000059122	ENST00000305139.6:c.1440C>T	2.37:g.234681046C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A6NKK6|B8K289|Q96TE7	Silent	SNP	pfam_UDP_glucos_trans,pfam_Glyco_trans_28_C	p.L482	ENST00000305139.6	37	c.1446	CCDS2507.1	2																																																																																			UGT1A4	-	pfam_UDP_glucos_trans	ENSG00000244474		0.602	UGT1A6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UGT1A4	HGNC	protein_coding	OTTHUMT00000130988.1	40	0.00	0	C	NM_205862		234681046	234681046	+1	no_errors	ENST00000373409	ensembl	human	known	69_37n	silent	33	15.38	6	SNP	1.000	T
UGT2B28	54490	genome.wustl.edu	37	4	70152547	70152547	+	Missense_Mutation	SNP	G	G	A			TCGA-A2-A0CR-01A-11D-A228-09	TCGA-A2-A0CR-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f573c3c3-7b61-4955-8772-215b7cb9a763	3bdb54b4-1e26-4274-a1bd-800416ffbd34	g.chr4:70152547G>A	ENST00000335568.5	+	3	950	c.948G>A	c.(946-948)atG>atA	p.M316I	UGT2B28_ENST00000511240.1_Missense_Mutation_p.M316I	NM_053039.1	NP_444267.1	Q9BY64	UDB28_HUMAN	UDP glucuronosyltransferase 2 family, polypeptide B28	316					metabolic process (GO:0008152)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	glucuronosyltransferase activity (GO:0015020)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(16)|pancreas(1)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	31						TAAGTAACATGACAGCAGAAA	0.418																																						dbGAP											0													154.0	168.0	163.0					4																	70152547		2047	4247	6294	-	-	-	SO:0001583	missense	0			AF177272	CCDS3528.1, CCDS56330.1	4q13.3	2011-02-09	2005-07-20		ENSG00000135226	ENSG00000135226		"""UDP glucuronosyltransferases"""	13479	protein-coding gene	gene with protein product		606497	"""UDP glycosyltransferase 2 family, polypeptide B28"""			11300766	Standard	NM_053039		Approved		uc003hej.3	Q9BY64	OTTHUMG00000129401	ENST00000335568.5:c.948G>A	4.37:g.70152547G>A	ENSP00000334276:p.Met316Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	B5BUM0|Q9BY62|Q9BY63	Missense_Mutation	SNP	pfam_UDP_glucos_trans,pfam_Glyco_trans_28_C	p.M316I	ENST00000335568.5	37	c.948	CCDS3528.1	4	.	.	.	.	.	.	.	.	.	.	-	0.003	-2.459020	0.00173	.	.	ENSG00000135226	ENST00000335568;ENST00000511240	T;T	0.61742	0.08;0.08	1.85	-3.66	0.04489	.	0.323433	0.25270	U	0.031884	T	0.26810	0.0656	N	0.24115	0.695	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.09377	0.004;0.002	T	0.34204	-0.9838	10	0.02654	T	1	.	2.7725	0.05338	0.4344:0.0:0.2067:0.3589	.	316;316	Q9BY64-2;Q9BY64	.;UDB28_HUMAN	I	316	ENSP00000334276:M316I;ENSP00000427399:M316I	ENSP00000334276:M316I	M	+	3	0	UGT2B28	70187136	0.000000	0.05858	0.002000	0.10522	0.000000	0.00434	-3.447000	0.00467	-0.895000	0.03920	-1.207000	0.01640	ATG	UGT2B28	-	pfam_UDP_glucos_trans	ENSG00000135226		0.418	UGT2B28-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UGT2B28	HGNC	protein_coding	OTTHUMT00000251557.2	100	0.00	0	G	NM_053039		70152547	70152547	+1	no_errors	ENST00000335568	ensembl	human	known	69_37n	missense	139	10.90	17	SNP	0.000	A
UNC45A	55898	genome.wustl.edu	37	15	91491411	91491411	+	Silent	SNP	C	C	T			TCGA-A2-A0CR-01A-11D-A228-09	TCGA-A2-A0CR-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f573c3c3-7b61-4955-8772-215b7cb9a763	3bdb54b4-1e26-4274-a1bd-800416ffbd34	g.chr15:91491411C>T	ENST00000418476.2	+	12	1675	c.1635C>T	c.(1633-1635)cgC>cgT	p.R545R	UNC45A_ENST00000394275.2_Silent_p.R530R	NM_018671.3	NP_061141.2	Q9H3U1	UN45A_HUMAN	unc-45 homolog A (C. elegans)	545					cell differentiation (GO:0030154)|chaperone-mediated protein folding (GO:0061077)|muscle organ development (GO:0007517)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)				breast(1)|endometrium(4)|kidney(1)|large_intestine(5)|lung(7)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	25	Lung NSC(78;0.0771)|all_lung(78;0.137)		Lung(145;0.189)			GCACTCGGCGCTGGGCAGTGG	0.602																																						dbGAP											0													143.0	126.0	132.0					15																	91491411		2198	4298	6496	-	-	-	SO:0001819	synonymous_variant	0				CCDS10367.1, CCDS42082.1	15q26.1	2008-02-05			ENSG00000140553	ENSG00000140553			30594	protein-coding gene	gene with protein product	"""smooth muscle cell associated protein-1"""	611219				12356907	Standard	XM_005254963		Approved	SMAP-1, GC-UNC45	uc002bqg.3	Q9H3U1	OTTHUMG00000141261	ENST00000418476.2:c.1635C>T	15.37:g.91491411C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K6F7|Q7L3Y6|Q9H3U8|Q9NSE8|Q9NSE9	Silent	SNP	pfam_UNC-45/Ring3,superfamily_ARM-type_fold,smart_TPR_repeat,pfscan_TPR_repeat,pfscan_TPR-contain_dom	p.R545	ENST00000418476.2	37	c.1635	CCDS10367.1	15																																																																																			UNC45A	-	superfamily_ARM-type_fold	ENSG00000140553		0.602	UNC45A-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	UNC45A	HGNC	protein_coding	OTTHUMT00000280406.2	32	0.00	0	C	NM_018671		91491411	91491411	+1	no_errors	ENST00000418476	ensembl	human	known	69_37n	silent	35	16.67	7	SNP	1.000	T
USP13	8975	genome.wustl.edu	37	3	179448005	179448005	+	Missense_Mutation	SNP	G	G	C			TCGA-A2-A0CR-01A-11D-A228-09	TCGA-A2-A0CR-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f573c3c3-7b61-4955-8772-215b7cb9a763	3bdb54b4-1e26-4274-a1bd-800416ffbd34	g.chr3:179448005G>C	ENST00000263966.3	+	9	1588	c.1117G>C	c.(1117-1119)Gac>Cac	p.D373H	USP13_ENST00000482333.1_3'UTR|USP13_ENST00000496897.1_Missense_Mutation_p.D308H	NM_003940.2	NP_003931.2	Q92995	UBP13_HUMAN	ubiquitin specific peptidase 13 (isopeptidase T-3)	373	USP.				autophagy (GO:0006914)|cell proliferation (GO:0008283)|melanocyte differentiation (GO:0030318)|protein K63-linked deubiquitination (GO:0070536)|protein stabilization (GO:0050821)|regulation of autophagy (GO:0010506)|regulation of transcription, DNA-templated (GO:0006355)|ubiquitin-dependent protein catabolic process (GO:0006511)		cysteine-type endopeptidase activity (GO:0004197)|omega peptidase activity (GO:0008242)|ubiquitin binding (GO:0043130)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(8)|lung(20)|ovary(1)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(3)	46	all_cancers(143;7.79e-15)|Ovarian(172;0.0338)|Breast(254;0.148)		OV - Ovarian serous cystadenocarcinoma(80;1e-25)|GBM - Glioblastoma multiforme(14;0.0169)			CAGAATATTTGACTACTCGCC	0.338																																						dbGAP											0													139.0	136.0	137.0					3																	179448005		2203	4300	6503	-	-	-	SO:0001583	missense	0			U75362	CCDS3235.1	3q26.2-q26.3	2008-04-11	2005-08-08		ENSG00000058056	ENSG00000058056		"""Ubiquitin-specific peptidases"""	12611	protein-coding gene	gene with protein product		603591	"""ubiquitin specific protease 13 (isopeptidase T-3)"""			12838346	Standard	NM_003940		Approved	IsoT-3	uc003fkh.3	Q92995	OTTHUMG00000157783	ENST00000263966.3:c.1117G>C	3.37:g.179448005G>C	ENSP00000263966:p.Asp373His	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K2S3|B4DYF3|D3DNS2|Q96B25	Missense_Mutation	SNP	pfam_Peptidase_C19,pfam_UBA/transl_elong_EF1B_N,pfam_Znf_UBP,superfamily_UBA-like,smart_Znf_UBP,smart_UBA/transl_elong_EF1B_N_euk,pirsf_Ubiquitinyl_hydrolase,pfscan_UBA/transl_elong_EF1B_N_euk,pfscan_Znf_UBP,pfscan_Peptidase_C19	p.D373H	ENST00000263966.3	37	c.1117	CCDS3235.1	3	.	.	.	.	.	.	.	.	.	.	G	18.52	3.642293	0.67244	.	.	ENSG00000058056	ENST00000263966;ENST00000496897;ENST00000497155	T;T;T	0.30714	1.52;1.52;1.52	5.53	5.53	0.82687	Peptidase C19, ubiquitin carboxyl-terminal hydrolase 2 (2);	0.000000	0.85682	D	0.000000	T	0.36608	0.0973	L	0.56769	1.78	0.80722	D	1	B;B	0.29136	0.234;0.061	B;B	0.30646	0.118;0.082	T	0.13124	-1.0521	10	0.48119	T	0.1	-26.2457	19.4703	0.94961	0.0:0.0:1.0:0.0	.	373;373	Q92995;A8K2S3	UBP13_HUMAN;.	H	373;308;19	ENSP00000263966:D373H;ENSP00000417146:D308H;ENSP00000420057:D19H	ENSP00000263966:D373H	D	+	1	0	USP13	180930699	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.869000	0.99810	2.600000	0.87896	0.561000	0.74099	GAC	USP13	-	pfam_Peptidase_C19,pirsf_Ubiquitinyl_hydrolase,pfscan_Peptidase_C19	ENSG00000058056		0.338	USP13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	USP13	HGNC	protein_coding	OTTHUMT00000349617.1	69	0.00	0	G			179448005	179448005	+1	no_errors	ENST00000263966	ensembl	human	known	69_37n	missense	59	13.24	9	SNP	1.000	C
YLPM1	56252	genome.wustl.edu	37	14	75265799	75265799	+	Missense_Mutation	SNP	G	G	A			TCGA-A2-A0CR-01A-11D-A228-09	TCGA-A2-A0CR-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f573c3c3-7b61-4955-8772-215b7cb9a763	3bdb54b4-1e26-4274-a1bd-800416ffbd34	g.chr14:75265799G>A	ENST00000325680.7	+	5	3923	c.3799G>A	c.(3799-3801)Gat>Aat	p.D1267N	YLPM1_ENST00000238571.3_Missense_Mutation_p.D1072N|YLPM1_ENST00000552421.1_Intron	NM_019589.2	NP_062535.2	P49750	YLPM1_HUMAN	YLP motif containing 1	1072					regulation of telomere maintenance (GO:0032204)	nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)			breast(4)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(12)|lung(24)|ovary(3)|pancreas(1)|prostate(1)|skin(1)|urinary_tract(1)	62			KIRC - Kidney renal clear cell carcinoma(43;0.238)	BRCA - Breast invasive adenocarcinoma(234;0.00162)		TTGGTGGGATGATTGGGAGAG	0.478																																						dbGAP											0													111.0	107.0	109.0					14																	75265799		1976	4159	6135	-	-	-	SO:0001583	missense	0			AK090435	CCDS45135.1	14q24.3	2014-06-13	2004-07-15	2004-07-15	ENSG00000119596	ENSG00000119596			17798	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 169"""		"""chromosome 14 open reading frame 170"""	C14orf170		7596406	Standard	NM_019589		Approved	ZAP, PPP1R169	uc001xqj.4	P49750	OTTHUMG00000172503	ENST00000325680.7:c.3799G>A	14.37:g.75265799G>A	ENSP00000324463:p.Asp1267Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	P49752|Q96I64|Q9P1V7	Missense_Mutation	SNP	superfamily_FH2_actin-bd	p.D1267N	ENST00000325680.7	37	c.3799	CCDS45135.1	14	.	.	.	.	.	.	.	.	.	.	G	17.69	3.451542	0.63290	.	.	ENSG00000119596	ENST00000325680;ENST00000238571;ENST00000423680	.	.	.	5.78	5.78	0.91487	.	0.000000	0.64402	D	0.000002	T	0.62036	0.2395	L	0.51422	1.61	0.34447	D	0.700243	D	0.64830	0.994	D	0.63703	0.917	T	0.64271	-0.6447	9	0.19147	T	0.46	-11.8117	13.2477	0.60031	0.0724:0.0:0.9276:0.0	.	1267	P49750-4	.	N	1267;1072;980	.	ENSP00000238571:D1072N	D	+	1	0	YLPM1	74335552	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	3.978000	0.56881	2.738000	0.93877	0.448000	0.29417	GAT	YLPM1	-	NULL	ENSG00000119596		0.478	YLPM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	YLPM1	HGNC	protein_coding	OTTHUMT00000404451.1	45	0.00	0	G	NM_019589		75265799	75265799	+1	no_errors	ENST00000325680	ensembl	human	known	69_37n	missense	31	22.50	9	SNP	1.000	A
YLPM1	56252	genome.wustl.edu	37	14	75266090	75266090	+	Missense_Mutation	SNP	G	G	C			TCGA-A2-A0CR-01A-11D-A228-09	TCGA-A2-A0CR-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f573c3c3-7b61-4955-8772-215b7cb9a763	3bdb54b4-1e26-4274-a1bd-800416ffbd34	g.chr14:75266090G>C	ENST00000325680.7	+	5	4214	c.4090G>C	c.(4090-4092)Gat>Cat	p.D1364H	YLPM1_ENST00000238571.3_Missense_Mutation_p.D1169H|YLPM1_ENST00000552421.1_Intron	NM_019589.2	NP_062535.2	P49750	YLPM1_HUMAN	YLP motif containing 1	1169					regulation of telomere maintenance (GO:0032204)	nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)			breast(4)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(12)|lung(24)|ovary(3)|pancreas(1)|prostate(1)|skin(1)|urinary_tract(1)	62			KIRC - Kidney renal clear cell carcinoma(43;0.238)	BRCA - Breast invasive adenocarcinoma(234;0.00162)		GTATGATCGAGATTTCCGTGA	0.478																																						dbGAP											0													201.0	187.0	192.0					14																	75266090		1895	4133	6028	-	-	-	SO:0001583	missense	0			AK090435	CCDS45135.1	14q24.3	2014-06-13	2004-07-15	2004-07-15	ENSG00000119596	ENSG00000119596			17798	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 169"""		"""chromosome 14 open reading frame 170"""	C14orf170		7596406	Standard	NM_019589		Approved	ZAP, PPP1R169	uc001xqj.4	P49750	OTTHUMG00000172503	ENST00000325680.7:c.4090G>C	14.37:g.75266090G>C	ENSP00000324463:p.Asp1364His	Somatic		WXS	Illumina GAIIx	Phase_IV	P49752|Q96I64|Q9P1V7	Missense_Mutation	SNP	superfamily_FH2_actin-bd	p.D1364H	ENST00000325680.7	37	c.4090	CCDS45135.1	14	.	.	.	.	.	.	.	.	.	.	G	16.42	3.117844	0.56505	.	.	ENSG00000119596	ENST00000325680;ENST00000238571;ENST00000423680	.	.	.	5.97	5.97	0.96955	.	0.000000	0.64402	D	0.000002	T	0.75932	0.3917	L	0.51422	1.61	0.46586	D	0.999112	D	0.89917	1.0	D	0.91635	0.999	T	0.69562	-0.5112	9	0.30078	T	0.28	-11.7783	20.4993	0.99208	0.0:0.0:1.0:0.0	.	1364	P49750-4	.	H	1364;1169;1077	.	ENSP00000238571:D1169H	D	+	1	0	YLPM1	74335843	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.155000	0.77445	2.855000	0.98099	0.537000	0.68136	GAT	YLPM1	-	NULL	ENSG00000119596		0.478	YLPM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	YLPM1	HGNC	protein_coding	OTTHUMT00000404451.1	29	0.00	0	G	NM_019589		75266090	75266090	+1	no_errors	ENST00000325680	ensembl	human	known	69_37n	missense	31	20.51	8	SNP	1.000	C
YLPM1	56252	genome.wustl.edu	37	14	75266123	75266123	+	Missense_Mutation	SNP	G	G	C			TCGA-A2-A0CR-01A-11D-A228-09	TCGA-A2-A0CR-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f573c3c3-7b61-4955-8772-215b7cb9a763	3bdb54b4-1e26-4274-a1bd-800416ffbd34	g.chr14:75266123G>C	ENST00000325680.7	+	5	4247	c.4123G>C	c.(4123-4125)Gag>Cag	p.E1375Q	YLPM1_ENST00000238571.3_Missense_Mutation_p.E1180Q|YLPM1_ENST00000552421.1_Intron	NM_019589.2	NP_062535.2	P49750	YLPM1_HUMAN	YLP motif containing 1	1180					regulation of telomere maintenance (GO:0032204)	nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)			breast(4)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(12)|lung(24)|ovary(3)|pancreas(1)|prostate(1)|skin(1)|urinary_tract(1)	62			KIRC - Kidney renal clear cell carcinoma(43;0.238)	BRCA - Breast invasive adenocarcinoma(234;0.00162)		GAGGATTCGAGAGTATCCAGA	0.458																																						dbGAP											0													223.0	210.0	214.0					14																	75266123		1929	4149	6078	-	-	-	SO:0001583	missense	0			AK090435	CCDS45135.1	14q24.3	2014-06-13	2004-07-15	2004-07-15	ENSG00000119596	ENSG00000119596			17798	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 169"""		"""chromosome 14 open reading frame 170"""	C14orf170		7596406	Standard	NM_019589		Approved	ZAP, PPP1R169	uc001xqj.4	P49750	OTTHUMG00000172503	ENST00000325680.7:c.4123G>C	14.37:g.75266123G>C	ENSP00000324463:p.Glu1375Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	P49752|Q96I64|Q9P1V7	Missense_Mutation	SNP	superfamily_FH2_actin-bd	p.E1375Q	ENST00000325680.7	37	c.4123	CCDS45135.1	14	.	.	.	.	.	.	.	.	.	.	G	17.00	3.277624	0.59758	.	.	ENSG00000119596	ENST00000325680;ENST00000238571;ENST00000423680	.	.	.	5.79	5.79	0.91817	.	0.088970	0.48767	D	0.000178	T	0.73125	0.3547	L	0.44542	1.39	0.40463	D	0.980268	D	0.67145	0.996	P	0.62813	0.907	T	0.73375	-0.4002	9	0.54805	T	0.06	-14.0307	20.0976	0.97857	0.0:0.0:1.0:0.0	.	1375	P49750-4	.	Q	1375;1180;1088	.	ENSP00000238571:E1180Q	E	+	1	0	YLPM1	74335876	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.155000	0.77445	2.753000	0.94483	0.537000	0.68136	GAG	YLPM1	-	NULL	ENSG00000119596		0.458	YLPM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	YLPM1	HGNC	protein_coding	OTTHUMT00000404451.1	29	0.00	0	G	NM_019589		75266123	75266123	+1	no_errors	ENST00000325680	ensembl	human	known	69_37n	missense	31	13.89	5	SNP	1.000	C
ZAN	7455	genome.wustl.edu	37	7	100349614	100349614	+	RNA	SNP	T	T	C	rs561745860	byFrequency	TCGA-A2-A0CR-01A-11D-A228-09	TCGA-A2-A0CR-10A-01D-A22A-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f573c3c3-7b61-4955-8772-215b7cb9a763	3bdb54b4-1e26-4274-a1bd-800416ffbd34	g.chr7:100349614T>C	ENST00000348028.3	+	0	2051				ZAN_ENST00000421100.1_RNA|ZAN_ENST00000449052.1_RNA|ZAN_ENST00000546292.1_RNA|ZAN_ENST00000538115.1_RNA|ZAN_ENST00000542585.1_RNA|ZAN_ENST00000443370.1_RNA|ZAN_ENST00000349350.6_RNA|ZAN_ENST00000546213.1_RNA|ZAN_ENST00000427578.1_RNA			Q9Y493	ZAN_HUMAN	zonadhesin (gene/pseudogene)						binding of sperm to zona pellucida (GO:0007339)|single organismal cell-cell adhesion (GO:0016337)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(2)|breast(3)|central_nervous_system(3)|endometrium(21)|kidney(6)|large_intestine(18)|lung(60)|ovary(4)|pancreas(3)|prostate(5)|skin(8)|stomach(3)|upper_aerodigestive_tract(3)	139	Lung NSC(181;0.041)|all_lung(186;0.0581)		STAD - Stomach adenocarcinoma(171;0.19)			CCCACCATCCTCACAGAAAAA	0.488													t|||	9	0.00179712	0.0008	0.0029	5008	,	,		17057	0.0		0.004	False		,,,				2504	0.002					dbGAP											0													243.0	271.0	263.0					7																	100349614		1861	4099	5960	-	-	-			0			U83191		7q22.1	2013-10-10	2013-10-10		ENSG00000146839	ENSG00000146839			12857	protein-coding gene	gene with protein product		602372	"""zonadhesin"""			9799793, 17033959	Standard	NM_003386		Approved		uc003uwk.3	Q9Y493	OTTHUMG00000157037		7.37:g.100349614T>C		Somatic		WXS	Illumina GAIIx	Phase_IV	A0FKC8|D6W5W4|O00218|Q96L85|Q96L86|Q96L87|Q96L88|Q96L89|Q96L90|Q9BXN9|Q9BZ83|Q9BZ84|Q9BZ85|Q9BZ86|Q9BZ87|Q9BZ88	Missense_Mutation	SNP	pfam_VWF_type-D,pfam_MAM_dom,pfam_Unchr_dom_Cys-rich,pfam_TIL_dom,superfamily_ConA-like_lec_gl,superfamily_TIL_dom,smart_MAM_dom,smart_VWC_out,smart_VWF_type-D,smart_Unchr_dom_Cys-rich,smart_EGF-like,pfscan_EG-like_dom,pfscan_MAM_dom	p.L629P	ENST00000348028.3	37	c.1886		7	.	.	.	.	.	.	.	.	.	.	t	2.081	-0.410797	0.04799	.	.	ENSG00000146839	ENST00000546292;ENST00000538115;ENST00000542585	T;T;T	0.62232	0.04;0.04;0.04	2.77	-2.7	0.06004	.	.	.	.	.	T	0.22282	0.0537	N	0.00436	-1.5	0.09310	N	0.999998	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.0	T	0.18429	-1.0337	9	0.29301	T	0.29	.	5.4271	0.16431	0.1334:0.4596:0.0:0.407	.	629;629	F5H0T8;Q9Y493	.;ZAN_HUMAN	P	629	ENSP00000445943:L629P;ENSP00000445091:L629P;ENSP00000444427:L629P	ENSP00000423579:L629P	L	+	2	0	ZAN	100187550	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-1.662000	0.01970	-1.192000	0.02691	-3.452000	0.00036	CTC	ZAN	-	NULL	ENSG00000146839		0.488	ZAN-006	KNOWN	basic	polymorphic_pseudogene	ZAN	HGNC	polymorphic_pseudogene	OTTHUMT00000347214.1	24	0.00	0	T	NM_003386		100349614	100349614	+1	no_errors	ENST00000546292	ensembl	human	known	69_37n	missense	35	20.45	9	SNP	0.000	C
ZMYM5	9205	genome.wustl.edu	37	13	20425884	20425884	+	Missense_Mutation	SNP	G	G	A			TCGA-A2-A0CR-01A-11D-A228-09	TCGA-A2-A0CR-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f573c3c3-7b61-4955-8772-215b7cb9a763	3bdb54b4-1e26-4274-a1bd-800416ffbd34	g.chr13:20425884G>A	ENST00000337963.4	-	3	701	c.437C>T	c.(436-438)aCt>aTt	p.T146I	ZMYM5_ENST00000382907.4_Missense_Mutation_p.T146I|ZMYM5_ENST00000382905.4_Missense_Mutation_p.T146I	NM_001142684.1	NP_001136156.1	Q9UJ78	ZMYM5_HUMAN	zinc finger, MYM-type 5	146						nucleus (GO:0005634)	zinc ion binding (GO:0008270)			kidney(1)|large_intestine(5)|lung(9)	15		all_cancers(29;2.96e-22)|all_epithelial(30;3.76e-20)|all_lung(29;4.38e-20)|Lung NSC(5;5.8e-17)|Lung SC(185;0.0262)|Ovarian(182;0.162)		all cancers(112;1.61e-05)|Epithelial(112;4.89e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00171)|Lung(94;0.00942)|LUSC - Lung squamous cell carcinoma(192;0.0431)		TTTGTTTTTAGTTCCAGGAAG	0.373																																						dbGAP											0													83.0	88.0	86.0					13																	20425884		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF161535	CCDS31942.1, CCDS31943.1	13q12	2013-01-08	2005-09-12	2005-09-12	ENSG00000132950	ENSG00000132950		"""Zinc fingers, MYM type"""	13029	protein-coding gene	gene with protein product			"""zinc finger protein 237"""	ZNF237			Standard	NM_001039650		Approved	ZNF198L1, MYM	uc010tcn.1	Q9UJ78	OTTHUMG00000016504	ENST00000337963.4:c.437C>T	13.37:g.20425884G>A	ENSP00000337034:p.Thr146Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R6V1|Q5T6E1|Q5T6E2|Q5T6E4|Q96IY6|Q9NZY5|Q9UBW0|Q9UJ77	Missense_Mutation	SNP	pfam_Znf_MYM,smart_TRASH	p.T146I	ENST00000337963.4	37	c.437		13	.	.	.	.	.	.	.	.	.	.	G	8.737	0.918060	0.17982	.	.	ENSG00000132950	ENST00000337963;ENST00000502168;ENST00000382907;ENST00000382905	T;T;T;T	0.35605	1.3;1.3;1.3;1.3	4.41	1.59	0.23543	.	.	.	.	.	T	0.33265	0.0857	M	0.68317	2.08	0.20764	N	0.999853	B;B;B	0.19583	0.005;0.037;0.009	B;B;B	0.15052	0.002;0.012;0.012	T	0.35251	-0.9796	9	0.72032	D	0.01	-1.0188	5.1748	0.15129	0.0828:0.3152:0.4779:0.1242	.	146;146;146	Q9UJ78;Q9UJ78-2;Q9UJ78-1	ZMYM5_HUMAN;.;.	I	146;136;146;146	ENSP00000337034:T146I;ENSP00000445779:T136I;ENSP00000372364:T146I;ENSP00000372361:T146I	ENSP00000337034:T146I	T	-	2	0	ZMYM5	19323884	1.000000	0.71417	0.543000	0.28128	0.804000	0.45430	1.310000	0.33551	0.195000	0.20347	0.491000	0.48974	ACT	ZMYM5	-	NULL	ENSG00000132950		0.373	ZMYM5-201	KNOWN	basic|appris_principal	protein_coding	ZMYM5	HGNC	protein_coding		64	0.00	0	G	NM_014242		20425884	20425884	-1	no_errors	ENST00000337963	ensembl	human	known	69_37n	missense	62	10.14	7	SNP	0.913	A
ZNF252P	286101	genome.wustl.edu	37	8	146203008	146203008	+	RNA	SNP	A	A	T			TCGA-A2-A0CR-01A-11D-A228-09	TCGA-A2-A0CR-10A-01D-A22A-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f573c3c3-7b61-4955-8772-215b7cb9a763	3bdb54b4-1e26-4274-a1bd-800416ffbd34	g.chr8:146203008A>T	ENST00000426361.2	-	0	1176					NR_023392.1				zinc finger protein 252, pseudogene											endometrium(1)	1						TGCACTTGTAAGGTTTCTCTC	0.383																																						dbGAP											0																																										-	-	-			0			BC019922		8q24.3	2012-10-05	2012-04-19	2012-04-19	ENSG00000196922	ENSG00000196922			13046	pseudogene	pseudogene			"""zinc finger protein 252"""	ZNF252			Standard	NR_023392		Approved		uc011llo.2		OTTHUMG00000165201		8.37:g.146203008A>T		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000426361.2	37	NULL		8																																																																																			ZNF252P	-	-	ENSG00000196922		0.383	ZNF252P-008	KNOWN	basic|exp_conf	processed_transcript	ZNF252P	HGNC	pseudogene	OTTHUMT00000451422.1	49	0.00	0	A	NR_023392		146203008	146203008	-1	no_errors	ENST00000426361	ensembl	human	known	69_37n	rna	54	12.90	8	SNP	0.221	T
ZNF334	55713	genome.wustl.edu	37	20	45130711	45130711	+	Missense_Mutation	SNP	G	G	T			TCGA-A2-A0CR-01A-11D-A228-09	TCGA-A2-A0CR-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f573c3c3-7b61-4955-8772-215b7cb9a763	3bdb54b4-1e26-4274-a1bd-800416ffbd34	g.chr20:45130711G>T	ENST00000347606.4	-	5	1449	c.1267C>A	c.(1267-1269)Cat>Aat	p.H423N	ZNF334_ENST00000593880.1_Missense_Mutation_p.H446N|ZNF334_ENST00000457685.2_Missense_Mutation_p.H385N	NM_018102.4	NP_060572.3	Q9HCZ1	ZN334_HUMAN	zinc finger protein 334	423					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(2)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(8)|ovary(1)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	32		Myeloproliferative disorder(115;0.0122)				CTTCTTCGATGCACATTGAGG	0.418																																						dbGAP											0													128.0	117.0	121.0					20																	45130711		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK001331	CCDS33480.1, CCDS74736.1	20q13.12	2013-09-20			ENSG00000198185	ENSG00000198185		"""Zinc fingers, C2H2-type"", ""-"""	15806	protein-coding gene	gene with protein product							Standard	NM_018102		Approved	bA179N14.1	uc002xsc.4	Q9HCZ1	OTTHUMG00000032654	ENST00000347606.4:c.1267C>A	20.37:g.45130711G>T	ENSP00000255129:p.His423Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5T6U2|Q9NVW4	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.H423N	ENST00000347606.4	37	c.1267	CCDS33480.1	20	.	.	.	.	.	.	.	.	.	.	G	20.7	4.042148	0.75732	.	.	ENSG00000198185	ENST00000457685;ENST00000347606	D;D	0.86865	-2.18;-2.18	3.3	3.3	0.37823	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	D	0.95417	0.8512	H	0.97390	3.995	0.41039	D	0.985213	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.999;0.999	D	0.96447	0.9331	9	0.87932	D	0	.	12.4699	0.55781	0.0:0.0:1.0:0.0	.	385;423;446	B3KQ93;Q9HCZ1;Q8N3P8	.;ZN334_HUMAN;.	N	385;423	ENSP00000402582:H385N;ENSP00000255129:H423N	ENSP00000255129:H423N	H	-	1	0	ZNF334	44564118	1.000000	0.71417	0.346000	0.25655	0.962000	0.63368	6.321000	0.72881	1.827000	0.53221	0.591000	0.81541	CAT	ZNF334	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000198185		0.418	ZNF334-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF334	HGNC	protein_coding	OTTHUMT00000079575.1	30	0.00	0	G			45130711	45130711	-1	no_errors	ENST00000347606	ensembl	human	known	69_37n	missense	32	11.11	4	SNP	0.972	T
ZNF653	115950	genome.wustl.edu	37	19	11597838	11597838	+	Missense_Mutation	SNP	G	G	A			TCGA-A2-A0CR-01A-11D-A228-09	TCGA-A2-A0CR-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f573c3c3-7b61-4955-8772-215b7cb9a763	3bdb54b4-1e26-4274-a1bd-800416ffbd34	g.chr19:11597838G>A	ENST00000293771.5	-	5	1443	c.1307C>T	c.(1306-1308)tCa>tTa	p.S436L	CTC-398G3.6_ENST00000585656.1_Intron	NM_138783.3	NP_620138.2	Q96CK0	ZN653_HUMAN	zinc finger protein 653	436					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(2)|kidney(3)|large_intestine(2)|lung(8)|prostate(1)|skin(1)	17						GATGATGGCTGACATGTCGCT	0.672																																					Pancreas(83;980 1446 4542 6441 43352)	dbGAP											0													47.0	50.0	49.0					19																	11597838		2203	4300	6503	-	-	-	SO:0001583	missense	0			AY072704	CCDS12261.1	19p13.2	2013-01-08						"""Zinc fingers, C2H2-type"""	25196	protein-coding gene	gene with protein product		611371				12477932	Standard	NM_138783		Approved	Zip67	uc002mrz.2	Q96CK0		ENST00000293771.5:c.1307C>T	19.37:g.11597838G>A	ENSP00000293771:p.Ser436Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q96AS7	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.S436L	ENST00000293771.5	37	c.1307	CCDS12261.1	19	.	.	.	.	.	.	.	.	.	.	G	14.81	2.646551	0.47258	.	.	ENSG00000161914	ENST00000293771	T	0.11821	2.74	4.36	4.36	0.52297	.	0.785486	0.11603	N	0.547588	T	0.09774	0.0240	N	0.14661	0.345	0.36805	D	0.885561	P	0.34724	0.465	B	0.30572	0.117	T	0.31223	-0.9951	10	0.66056	D	0.02	-17.4603	14.2263	0.65860	0.0:0.0:1.0:0.0	.	436	Q96CK0	ZN653_HUMAN	L	436	ENSP00000293771:S436L	ENSP00000293771:S436L	S	-	2	0	ZNF653	11458838	1.000000	0.71417	0.953000	0.39169	0.590000	0.36582	3.774000	0.55341	2.157000	0.67596	0.561000	0.74099	TCA	ZNF653	-	NULL	ENSG00000161914		0.672	ZNF653-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF653	HGNC	protein_coding	OTTHUMT00000458836.2	44	0.00	0	G	NM_138783		11597838	11597838	-1	no_errors	ENST00000293771	ensembl	human	known	69_37n	missense	51	10.53	6	SNP	0.988	A
ZNF710	374655	genome.wustl.edu	37	15	90611126	90611126	+	Missense_Mutation	SNP	G	G	A			TCGA-A2-A0CR-01A-11D-A228-09	TCGA-A2-A0CR-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f573c3c3-7b61-4955-8772-215b7cb9a763	3bdb54b4-1e26-4274-a1bd-800416ffbd34	g.chr15:90611126G>A	ENST00000268154.4	+	2	1008	c.757G>A	c.(757-759)Gag>Aag	p.E253K		NM_198526.2	NP_940928.2	Q8N1W2	ZN710_HUMAN	zinc finger protein 710	253					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(2)|endometrium(2)|kidney(2)|large_intestine(4)|lung(1)|ovary(2)|prostate(1)|stomach(1)|urinary_tract(3)	19	Melanoma(11;0.00551)|Lung NSC(78;0.0196)|all_lung(78;0.04)		BRCA - Breast invasive adenocarcinoma(143;0.00769)|KIRC - Kidney renal clear cell carcinoma(17;0.0286)|Kidney(142;0.0514)|STAD - Stomach adenocarcinoma(125;0.129)			GGAGGCCAGTGAGTTCGAGGC	0.652																																						dbGAP											0													34.0	41.0	39.0					15																	90611126		2185	4263	6448	-	-	-	SO:0001583	missense	0			AK094712	CCDS10358.1	15q26.1	2013-01-08			ENSG00000140548	ENSG00000140548		"""Zinc fingers, C2H2-type"""	25352	protein-coding gene	gene with protein product							Standard	XM_005254905		Approved	DKFZp547K1113, FLJ37393, FLJ00306	uc002bov.2	Q8N1W2	OTTHUMG00000149812	ENST00000268154.4:c.757G>A	15.37:g.90611126G>A	ENSP00000268154:p.Glu253Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	A0AVS3|Q6ZMK9|Q8NDU0	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.E253K	ENST00000268154.4	37	c.757	CCDS10358.1	15	.	.	.	.	.	.	.	.	.	.	G	11.41	1.631033	0.28978	.	.	ENSG00000140548	ENST00000268154	T	0.08896	3.04	5.22	3.34	0.38264	.	1.203080	0.06022	N	0.651459	T	0.08582	0.0213	L	0.36672	1.1	0.32030	N	0.599646	B	0.11235	0.004	B	0.08055	0.003	T	0.33085	-0.9882	10	0.18710	T	0.47	-42.9772	9.7593	0.40522	0.0771:0.1411:0.7818:0.0	.	253	Q8N1W2	ZN710_HUMAN	K	253	ENSP00000268154:E253K	ENSP00000268154:E253K	E	+	1	0	ZNF710	88412130	1.000000	0.71417	0.076000	0.20297	0.033000	0.12548	7.068000	0.76748	0.776000	0.33473	0.561000	0.74099	GAG	ZNF710	-	NULL	ENSG00000140548		0.652	ZNF710-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF710	HGNC	protein_coding	OTTHUMT00000313423.1	25	0.00	0	G	NM_198526		90611126	90611126	+1	no_errors	ENST00000268154	ensembl	human	known	69_37n	missense	54	12.90	8	SNP	0.706	A
ZNF710	374655	genome.wustl.edu	37	15	90611138	90611138	+	Missense_Mutation	SNP	G	G	A			TCGA-A2-A0CR-01A-11D-A228-09	TCGA-A2-A0CR-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f573c3c3-7b61-4955-8772-215b7cb9a763	3bdb54b4-1e26-4274-a1bd-800416ffbd34	g.chr15:90611138G>A	ENST00000268154.4	+	2	1020	c.769G>A	c.(769-771)Gac>Aac	p.D257N		NM_198526.2	NP_940928.2	Q8N1W2	ZN710_HUMAN	zinc finger protein 710	257					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(2)|endometrium(2)|kidney(2)|large_intestine(4)|lung(1)|ovary(2)|prostate(1)|stomach(1)|urinary_tract(3)	19	Melanoma(11;0.00551)|Lung NSC(78;0.0196)|all_lung(78;0.04)		BRCA - Breast invasive adenocarcinoma(143;0.00769)|KIRC - Kidney renal clear cell carcinoma(17;0.0286)|Kidney(142;0.0514)|STAD - Stomach adenocarcinoma(125;0.129)			GTTCGAGGCTGACACGGCGGG	0.657																																						dbGAP											0													36.0	44.0	41.0					15																	90611138		2183	4266	6449	-	-	-	SO:0001583	missense	0			AK094712	CCDS10358.1	15q26.1	2013-01-08			ENSG00000140548	ENSG00000140548		"""Zinc fingers, C2H2-type"""	25352	protein-coding gene	gene with protein product							Standard	XM_005254905		Approved	DKFZp547K1113, FLJ37393, FLJ00306	uc002bov.2	Q8N1W2	OTTHUMG00000149812	ENST00000268154.4:c.769G>A	15.37:g.90611138G>A	ENSP00000268154:p.Asp257Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	A0AVS3|Q6ZMK9|Q8NDU0	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.D257N	ENST00000268154.4	37	c.769	CCDS10358.1	15	.	.	.	.	.	.	.	.	.	.	G	9.057	0.993531	0.19043	.	.	ENSG00000140548	ENST00000268154	T	0.09350	2.99	4.96	4.96	0.65561	.	1.046150	0.07550	N	0.915200	T	0.12774	0.0310	L	0.36672	1.1	0.19575	N	0.999963	B	0.30326	0.276	B	0.24974	0.057	T	0.27673	-1.0067	10	0.44086	T	0.13	-53.7687	16.951	0.86245	0.0:0.0:1.0:0.0	.	257	Q8N1W2	ZN710_HUMAN	N	257	ENSP00000268154:D257N	ENSP00000268154:D257N	D	+	1	0	ZNF710	88412142	0.998000	0.40836	0.109000	0.21407	0.013000	0.08279	4.202000	0.58446	2.574000	0.86865	0.561000	0.74099	GAC	ZNF710	-	NULL	ENSG00000140548		0.657	ZNF710-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF710	HGNC	protein_coding	OTTHUMT00000313423.1	27	0.00	0	G	NM_198526		90611138	90611138	+1	no_errors	ENST00000268154	ensembl	human	known	69_37n	missense	54	14.29	9	SNP	0.269	A
ZP3	7784	genome.wustl.edu	37	7	76069881	76069881	+	Missense_Mutation	SNP	A	A	G	rs2906998	byFrequency	TCGA-A2-A0CR-01A-11D-A228-09	TCGA-A2-A0CR-10A-01D-A22A-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f573c3c3-7b61-4955-8772-215b7cb9a763	3bdb54b4-1e26-4274-a1bd-800416ffbd34	g.chr7:76069881A>G	ENST00000394857.3	+	7	1071	c.1013A>G	c.(1012-1014)cAt>cGt	p.H338R	ZP3_ENST00000467555.1_3'UTR|ZP3_ENST00000416245.1_Missense_Mutation_p.H162R|ZP3_ENST00000336517.4_Missense_Mutation_p.H287R	NM_001110354.1	NP_001103824.1	P21754	ZP3_HUMAN	zona pellucida glycoprotein 3 (sperm receptor)	338					binding of sperm to zona pellucida (GO:0007339)|blastocyst formation (GO:0001825)|calcium ion transmembrane transport (GO:0070588)|egg coat formation (GO:0035803)|humoral immune response mediated by circulating immunoglobulin (GO:0002455)|intracellular protein transport (GO:0006886)|intracellular signal transduction (GO:0035556)|manganese ion transmembrane transport (GO:0071421)|manganese ion transport (GO:0006828)|multicellular organism reproduction (GO:0032504)|negative regulation of binding of sperm to zona pellucida (GO:2000360)|negative regulation of transcription, DNA-templated (GO:0045892)|oocyte development (GO:0048599)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of acrosomal vesicle exocytosis (GO:2000368)|positive regulation of acrosome reaction (GO:2000344)|positive regulation of antral ovarian follicle growth (GO:2000388)|positive regulation of calcium ion import (GO:0090280)|positive regulation of humoral immune response (GO:0002922)|positive regulation of inflammatory response (GO:0050729)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of interleukin-4 production (GO:0032753)|positive regulation of leukocyte migration (GO:0002687)|positive regulation of ovarian follicle development (GO:2000386)|positive regulation of phosphatidylinositol biosynthetic process (GO:0010513)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of T cell proliferation (GO:0042102)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of type IV hypersensitivity (GO:0001809)|protein kinase C signaling (GO:0070528)|single fertilization (GO:0007338)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|multivesicular body (GO:0005771)|outer acrosomal membrane (GO:0002081)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)|secretory granule (GO:0030141)	acrosin binding (GO:0032190)|carbohydrate binding (GO:0030246)|manganese ion transmembrane transporter activity (GO:0005384)|signal transducer activity (GO:0004871)|store-operated calcium channel activity (GO:0015279)			endometrium(1)|large_intestine(3)|lung(2)|skin(1)	7						AGGCAGCCTCATGTCATGAGC	0.537																																						dbGAP											0													132.0	128.0	130.0					7																	76069881		2203	4300	6503	-	-	-	SO:0001583	missense	0			M60504	CCDS5586.1, CCDS47618.1	7q11.23	2014-07-04	2002-09-17	2002-09-20	ENSG00000188372	ENSG00000188372		"""Zona pellucida glycoproteins"""	13189	protein-coding gene	gene with protein product		182889	"""zona pellucida glycoprotein 3A (sperm receptor)"""	ZP3A, ZP3B		1478648	Standard	NM_007155		Approved	ZP3-424, ZP3-372, ZPC	uc003ufd.4	P21754	OTTHUMG00000130575	ENST00000394857.3:c.1013A>G	7.37:g.76069881A>G	ENSP00000378326:p.His338Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	Q06633|Q29RW0	Missense_Mutation	SNP	pfam_Zona_pellucida_Endoglin/CD105,smart_Zona_pellucida_Endoglin/CD105,pfscan_Zona_pellucida_Endoglin/CD105,prints_Endoglin/CD105_subgr	p.H338R	ENST00000394857.3	37	c.1013	CCDS47618.1	7	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	a|a	9.044|9.044	0.990333|0.990333	0.18966|0.18966	.|.	.|.	ENSG00000188372|ENSG00000188372	ENST00000336517;ENST00000394857;ENST00000544121;ENST00000416245|ENST00000394860	T;T;T|.	0.21031|.	2.61;2.82;2.03|.	4.68|4.68	-7.24|-7.24	0.01475|0.01475	.|.	1.306680|.	0.05708|.	N|.	0.595475|.	T|T	0.32912|0.32912	0.0845|0.0845	L|L	0.53249|0.53249	1.67|1.67	0.09310|0.09310	N|N	1|1	B;B|.	0.12013|.	0.005;0.001|.	B;B|.	0.13407|.	0.009;0.001|.	T|T	0.38908|0.38908	-0.9639|-0.9639	10|5	0.23891|.	T|.	0.37|.	2.8954|2.8954	3.3471|3.3471	0.07139|0.07139	0.1819:0.4453:0.2607:0.1121|0.1819:0.4453:0.2607:0.1121	rs2906998|rs2906998	287;338|.	P21754-3;P21754|.	.;ZP3_HUMAN|.	R|V	287;338;338;162|172	ENSP00000337310:H287R;ENSP00000378326:H338R;ENSP00000411955:H162R|.	ENSP00000337310:H287R|.	H|M	+|+	2|1	0|0	ZP3|ZP3	75907817|75907817	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.016000|0.016000	0.09150|0.09150	-1.122000|-1.122000	0.03267|0.03267	-1.144000|-1.144000	0.02862|0.02862	0.459000|0.459000	0.35465|0.35465	CAT|ATG	ZP3	-	NULL	ENSG00000188372		0.537	ZP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZP3	HGNC	protein_coding	OTTHUMT00000253004.1	44	0.00	0	A			76069881	76069881	+1	no_errors	ENST00000394857	ensembl	human	known	69_37n	missense	47	14.55	8	SNP	0.000	G
ZP3	7784	genome.wustl.edu	37	7	76069886	76069886	+	Missense_Mutation	SNP	A	A	G	rs2906997	byFrequency	TCGA-A2-A0CR-01A-11D-A228-09	TCGA-A2-A0CR-10A-01D-A22A-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f573c3c3-7b61-4955-8772-215b7cb9a763	3bdb54b4-1e26-4274-a1bd-800416ffbd34	g.chr7:76069886A>G	ENST00000394857.3	+	7	1076	c.1018A>G	c.(1018-1020)Atg>Gtg	p.M340V	ZP3_ENST00000467555.1_3'UTR|ZP3_ENST00000416245.1_Missense_Mutation_p.M164V|ZP3_ENST00000336517.4_Missense_Mutation_p.M289V	NM_001110354.1	NP_001103824.1	P21754	ZP3_HUMAN	zona pellucida glycoprotein 3 (sperm receptor)	340			M -> V (in dbSNP:rs2906997).		binding of sperm to zona pellucida (GO:0007339)|blastocyst formation (GO:0001825)|calcium ion transmembrane transport (GO:0070588)|egg coat formation (GO:0035803)|humoral immune response mediated by circulating immunoglobulin (GO:0002455)|intracellular protein transport (GO:0006886)|intracellular signal transduction (GO:0035556)|manganese ion transmembrane transport (GO:0071421)|manganese ion transport (GO:0006828)|multicellular organism reproduction (GO:0032504)|negative regulation of binding of sperm to zona pellucida (GO:2000360)|negative regulation of transcription, DNA-templated (GO:0045892)|oocyte development (GO:0048599)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of acrosomal vesicle exocytosis (GO:2000368)|positive regulation of acrosome reaction (GO:2000344)|positive regulation of antral ovarian follicle growth (GO:2000388)|positive regulation of calcium ion import (GO:0090280)|positive regulation of humoral immune response (GO:0002922)|positive regulation of inflammatory response (GO:0050729)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of interleukin-4 production (GO:0032753)|positive regulation of leukocyte migration (GO:0002687)|positive regulation of ovarian follicle development (GO:2000386)|positive regulation of phosphatidylinositol biosynthetic process (GO:0010513)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of T cell proliferation (GO:0042102)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of type IV hypersensitivity (GO:0001809)|protein kinase C signaling (GO:0070528)|single fertilization (GO:0007338)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|multivesicular body (GO:0005771)|outer acrosomal membrane (GO:0002081)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)|secretory granule (GO:0030141)	acrosin binding (GO:0032190)|carbohydrate binding (GO:0030246)|manganese ion transmembrane transporter activity (GO:0005384)|signal transducer activity (GO:0004871)|store-operated calcium channel activity (GO:0015279)			endometrium(1)|large_intestine(3)|lung(2)|skin(1)	7						GCCTCATGTCATGAGCCAGTG	0.542																																						dbGAP											0													134.0	129.0	131.0					7																	76069886		2203	4300	6503	-	-	-	SO:0001583	missense	0			M60504	CCDS5586.1, CCDS47618.1	7q11.23	2014-07-04	2002-09-17	2002-09-20	ENSG00000188372	ENSG00000188372		"""Zona pellucida glycoproteins"""	13189	protein-coding gene	gene with protein product		182889	"""zona pellucida glycoprotein 3A (sperm receptor)"""	ZP3A, ZP3B		1478648	Standard	NM_007155		Approved	ZP3-424, ZP3-372, ZPC	uc003ufd.4	P21754	OTTHUMG00000130575	ENST00000394857.3:c.1018A>G	7.37:g.76069886A>G	ENSP00000378326:p.Met340Val	Somatic		WXS	Illumina GAIIx	Phase_IV	Q06633|Q29RW0	Missense_Mutation	SNP	pfam_Zona_pellucida_Endoglin/CD105,smart_Zona_pellucida_Endoglin/CD105,pfscan_Zona_pellucida_Endoglin/CD105,prints_Endoglin/CD105_subgr	p.M340V	ENST00000394857.3	37	c.1018	CCDS47618.1	7	.	.	.	.	.	.	.	.	.	.	N	2.901	-0.227591	0.06022	.	.	ENSG00000188372	ENST00000336517;ENST00000394857;ENST00000544121;ENST00000416245	T;T;T	0.20463	2.66;2.88;2.07	4.27	-5.46	0.02608	.	2.545950	0.01889	N	0.038399	T	0.04952	0.0133	N	0.00483	-1.445	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.23368	-1.0190	10	0.29301	T	0.29	1.7081	2.1536	0.03806	0.4579:0.2402:0.1865:0.1154	rs2906997;rs2906997	289;340	P21754-3;P21754	.;ZP3_HUMAN	V	289;340;340;164	ENSP00000337310:M289V;ENSP00000378326:M340V;ENSP00000411955:M164V	ENSP00000337310:M289V	M	+	1	0	ZP3	75907822	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-2.029000	0.01430	-1.516000	0.01782	-1.163000	0.01768	ATG	ZP3	-	NULL	ENSG00000188372		0.542	ZP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZP3	HGNC	protein_coding	OTTHUMT00000253004.1	43	0.00	0	A			76069886	76069886	+1	no_errors	ENST00000394857	ensembl	human	known	69_37n	missense	45	18.18	10	SNP	0.000	G
