#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
ABCC8	6833	genome.wustl.edu	37	11	17428939	17428939	+	Missense_Mutation	SNP	G	G	A			TCGA-A2-A0CU-01A-12W-A050-09	TCGA-A2-A0CU-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a9aa68af-f5fe-4ac0-987f-8af49b85c231	f41d6d14-ad4f-49d5-a4fb-6bdd1b6dbddc	g.chr11:17428939G>A	ENST00000389817.3	-	24	2950	c.2882C>T	c.(2881-2883)tCg>tTg	p.S961L	ABCC8_ENST00000302539.4_Missense_Mutation_p.S962L			Q09428	ABCC8_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP), member 8	961					carbohydrate metabolic process (GO:0005975)|energy reserve metabolic process (GO:0006112)|potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|regulation of insulin secretion (GO:0050796)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|ion channel binding (GO:0044325)|potassium ion transmembrane transporter activity (GO:0015079)|sulfonylurea receptor activity (GO:0008281)			NS(1)|breast(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(14)|lung(38)|ovary(1)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	67				READ - Rectum adenocarcinoma(2;0.0325)|Colorectal(2;0.1)	Adenosine triphosphate(DB00171)|Chlorpropamide(DB00672)|Gliclazide(DB01120)|Glimepiride(DB00222)|Glipizide(DB01067)|Gliquidone(DB01251)|Glyburide(DB01016)|Glycodiazine(DB01382)|Mitiglinide(DB01252)|Nateglinide(DB00731)|Repaglinide(DB00912)|Tolbutamide(DB01124)	GCCATCCCTCGAGGACATGGC	0.542																																						dbGAP											0													144.0	135.0	138.0					11																	17428939		2200	4293	6493	-	-	-	SO:0001583	missense	0			L78207	CCDS31437.1, CCDS73264.1	11p15.1	2014-09-17			ENSG00000006071	ENSG00000006071		"""ATP binding cassette transporters / subfamily C"""	59	protein-coding gene	gene with protein product	"""sulfonylurea receptor (hyperinsulinemia)"""	600509		SUR, HRINS		7920639, 7716548	Standard	NM_000352		Approved	HI, PHHI, SUR1, MRP8, ABC36, HHF1, TNDM2	uc001mnc.3	Q09428	OTTHUMG00000166316	ENST00000389817.3:c.2882C>T	11.37:g.17428939G>A	ENSP00000374467:p.Ser961Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NMX8|E3UYX6|O75948|Q16583	Missense_Mutation	SNP	pfam_ABC_transptr_TM_dom,pfam_ABC_transporter-like,superfamily_ABC_transptrTM_dom_typ1,smart_AAA+_ATPase,prints_Sulphorea_rcpt,prints_Surea_rcpt-1,pfscan_ABC_transporter-like,pfscan_ABC_transporter_type1	p.S962L	ENST00000389817.3	37	c.2885	CCDS31437.1	11	.	.	.	.	.	.	.	.	.	.	G	33	5.244262	0.95272	.	.	ENSG00000006071	ENST00000389817;ENST00000302539	D;D	0.92199	-2.99;-2.98	6.17	6.17	0.99709	.	0.000000	0.85682	D	0.000000	D	0.91119	0.7204	M	0.63843	1.955	0.80722	D	1	P	0.51351	0.944	B	0.38683	0.279	D	0.91656	0.5338	10	0.66056	D	0.02	.	20.8794	0.99867	0.0:0.0:1.0:0.0	.	961	Q09428	ABCC8_HUMAN	L	961;962	ENSP00000374467:S961L;ENSP00000303960:S962L	ENSP00000303960:S962L	S	-	2	0	ABCC8	17385515	1.000000	0.71417	0.992000	0.48379	0.982000	0.71751	7.103000	0.77014	2.941000	0.99782	0.655000	0.94253	TCG	ABCC8	-	NULL	ENSG00000006071		0.542	ABCC8-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	ABCC8	HGNC	protein_coding	OTTHUMT00000389093.1	180	0.00	0	G	NM_000352		17428939	17428939	-1	no_errors	ENST00000302539	ensembl	human	known	69_37n	missense	191	14.35	32	SNP	1.000	A
CDK12	51755	genome.wustl.edu	37	17	37687471	37687472	+	Frame_Shift_Ins	INS	-	-	G			TCGA-A2-A0CU-01A-12W-A050-09	TCGA-A2-A0CU-10A-01W-A055-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a9aa68af-f5fe-4ac0-987f-8af49b85c231	f41d6d14-ad4f-49d5-a4fb-6bdd1b6dbddc	g.chr17:37687471_37687472insG	ENST00000447079.4	+	14	4408_4409	c.4375_4376insG	c.(4375-4377)tggfs	p.W1459fs	CDK12_ENST00000430627.2_Frame_Shift_Ins_p.W1450fs	NM_015083.1|NM_016507.2	NP_055898.1|NP_057591.2	Q9NYV4	CDK12_HUMAN	cyclin-dependent kinase 12	1459					mRNA processing (GO:0006397)|phosphorylation of RNA polymerase II C-terminal domain (GO:0070816)|protein autophosphorylation (GO:0046777)|regulation of MAP kinase activity (GO:0043405)|RNA splicing (GO:0008380)	cyclin K-CDK12 complex (GO:0002944)|nuclear cyclin-dependent protein kinase holoenzyme complex (GO:0019908)|nuclear speck (GO:0016607)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|cyclin binding (GO:0030332)|cyclin-dependent protein serine/threonine kinase activity (GO:0004693)|protein kinase activity (GO:0004672)|RNA polymerase II carboxy-terminal domain kinase activity (GO:0008353)			NS(4)|breast(3)|endometrium(5)|kidney(4)|large_intestine(11)|lung(23)|ovary(11)|prostate(4)|skin(2)|urinary_tract(3)	70						AGGCCTTCACTGGGGGGGCCCA	0.559			"""Mis, N, F"""		serous ovarian					TCGA Ovarian(9;0.13)																												dbGAP		Rec	yes		17	17q12	51755	cyclin-dependent kinase 12		E	0																																										-	-	-	SO:0001589	frameshift_variant	0			AF227198	CCDS11337.1, CCDS45666.1	17q12	2011-10-25	2009-12-16	2009-12-16	ENSG00000167258	ENSG00000167258		"""Cyclin-dependent kinases"""	24224	protein-coding gene	gene with protein product	"""CDC2 related protein kinase 7"""	615514	"""Cdc2-related kinase, arginine/serine-rich"""	CRKRS		10048485, 11683387, 19884882	Standard	XM_005257456		Approved	CRK7, CRKR, KIAA0904	uc010cvv.3	Q9NYV4	OTTHUMG00000133214	ENST00000447079.4:c.4382dupG	17.37:g.37687478_37687478dupG	ENSP00000398880:p.Trp1459fs	Somatic		WXS	Illumina GAIIx	Phase_IV	A7E2B2|B4DYX4|B9EIQ6|O94978	Frame_Shift_Ins	INS	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.P1463fs	ENST00000447079.4	37	c.4375_4376	CCDS11337.1	17																																																																																			CDK12	-	NULL	ENSG00000167258		0.559	CDK12-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CDK12	HGNC	protein_coding	OTTHUMT00000256941.4	34	0.00	0	-	NM_016507		37687471	37687472	+1	no_errors	ENST00000447079	ensembl	human	known	69_37n	frame_shift_ins	37	13.95	6	INS	1.000:1.000	G
CILP	8483	genome.wustl.edu	37	15	65491181	65491181	+	Missense_Mutation	SNP	G	G	T			TCGA-A2-A0CU-01A-12W-A050-09	TCGA-A2-A0CU-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a9aa68af-f5fe-4ac0-987f-8af49b85c231	f41d6d14-ad4f-49d5-a4fb-6bdd1b6dbddc	g.chr15:65491181G>T	ENST00000261883.4	-	9	1609	c.1443C>A	c.(1441-1443)agC>agA	p.S481R		NM_003613.3	NP_003604	O75339	CILP1_HUMAN	cartilage intermediate layer protein, nucleotide pyrophosphohydrolase	481					negative regulation of insulin-like growth factor receptor signaling pathway (GO:0043569)	extracellular matrix (GO:0031012)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)				breast(5)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(14)|lung(17)|ovary(4)|pancreas(2)|prostate(4)|skin(2)|urinary_tract(1)	55						ACCGCTGGCAGCTGCACTCCT	0.592																																						dbGAP											0													65.0	51.0	56.0					15																	65491181		2202	4299	6501	-	-	-	SO:0001583	missense	0			AY358904	CCDS10203.1	15q22	2013-01-14			ENSG00000138615	ENSG00000138615		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	1980	protein-coding gene	gene with protein product		603489				9722584, 9722583	Standard	NM_003613		Approved	HsT18872	uc002aon.2	O75339	OTTHUMG00000133140	ENST00000261883.4:c.1443C>A	15.37:g.65491181G>T	ENSP00000261883:p.Ser481Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R8F7|Q6UW99|Q8IYI5	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Thrombospondin_1_rpt,superfamily_Thrombospondin_1_rpt,superfamily_CarboxyPept-like_regulatory,smart_Thrombospondin_1_rpt,smart_Ig_sub,smart_Ig_sub2,pfscan_Thrombospondin_1_rpt,pfscan_Ig-like	p.S481R	ENST00000261883.4	37	c.1443	CCDS10203.1	15	.	.	.	.	.	.	.	.	.	.	G	8.187	0.795075	0.16327	.	.	ENSG00000138615	ENST00000261883	T	0.37752	1.18	5.95	5.04	0.67666	.	0.229127	0.53938	D	0.000060	T	0.29684	0.0741	L	0.40543	1.245	0.31016	N	0.718657	B	0.02656	0.0	B	0.08055	0.003	T	0.30937	-0.9961	10	0.87932	D	0	-20.8523	9.651	0.39897	0.2147:0.0:0.7853:0.0	.	481	O75339	CILP1_HUMAN	R	481	ENSP00000261883:S481R	ENSP00000261883:S481R	S	-	3	2	CILP	63278234	1.000000	0.71417	1.000000	0.80357	0.345000	0.29048	3.588000	0.53964	1.526000	0.49068	0.655000	0.94253	AGC	CILP	-	NULL	ENSG00000138615		0.592	CILP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CILP	HGNC	protein_coding	OTTHUMT00000256829.1	45	0.00	0	G	NM_003613		65491181	65491181	-1	no_errors	ENST00000261883	ensembl	human	known	69_37n	missense	41	10.87	5	SNP	1.000	T
CLP1	10978	genome.wustl.edu	37	11	57428789	57428790	+	Frame_Shift_Del	DEL	AT	AT	-			TCGA-A2-A0CU-01A-12W-A050-09	TCGA-A2-A0CU-10A-01W-A055-09	AT	AT					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a9aa68af-f5fe-4ac0-987f-8af49b85c231	f41d6d14-ad4f-49d5-a4fb-6bdd1b6dbddc	g.chr11:57428789_57428790delAT	ENST00000302731.4	+	3	1087_1088	c.967_968delAT	c.(967-969)attfs	p.I323fs	CLP1_ENST00000525602.1_Frame_Shift_Del_p.I387fs|CLP1_ENST00000529430.1_Frame_Shift_Del_p.I398fs|CLP1_ENST00000533682.1_Frame_Shift_Del_p.I387fs	NM_001142597.1|NM_006831.2	NP_001136069.1|NP_006822.1	Q5KU26	COL12_HUMAN	cleavage and polyadenylation factor I subunit 1	0					carbohydrate mediated signaling (GO:0009756)|defense response (GO:0006952)|innate immune response (GO:0045087)|pattern recognition receptor signaling pathway (GO:0002221)|phagocytosis, recognition (GO:0006910)|protein homooligomerization (GO:0051260)|receptor-mediated endocytosis (GO:0006898)	collagen trimer (GO:0005581)|endocytic vesicle membrane (GO:0030666)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	galactose binding (GO:0005534)|low-density lipoprotein particle binding (GO:0030169)|metal ion binding (GO:0046872)|scavenger receptor activity (GO:0005044)|signaling pattern recognition receptor activity (GO:0008329)			autonomic_ganglia(1)|breast(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(3)|ovary(1)|prostate(1)|stomach(1)	15						AGCTGGCTTCATTGTGGTGACC	0.545																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			BC000446	CCDS7964.1, CCDS44600.1	11q12.1	2012-10-02	2012-10-02		ENSG00000172409	ENSG00000172409	2.7.1.78		16999	protein-coding gene	gene with protein product	"""ATP/GTPbinding protein"", ""polyribonucleotide 5'-hydroxyl-kinase"""	608757	"""CLP1, cleavage and polyadenylation factor I subunit, homolog (S. cerevisiae)"""			8896421, 11060040	Standard	NM_006831		Approved	HEAB, hClp1	uc001nkw.3	Q92989	OTTHUMG00000167146	ENST00000302731.4:c.967_968delAT	11.37:g.57428789_57428790delAT	ENSP00000304704:p.Ile323fs	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6P9F2|Q8TCR2|Q8WZA4|Q9BY85|Q9BYH7	Frame_Shift_Del	DEL	pfam_Pre-mRNA_cleavage_cplxII_Clp1	p.I387fs	ENST00000302731.4	37	c.1159_1160	CCDS44600.1	11																																																																																			CLP1	-	pfam_Pre-mRNA_cleavage_cplxII_Clp1	ENSG00000172409		0.545	CLP1-003	NOVEL	basic|exp_conf|CCDS	protein_coding	CLP1	HGNC	protein_coding	OTTHUMT00000393465.1	226	0.00	0	AT	NM_006831		57428789	57428790	+1	no_errors	ENST00000525602	ensembl	human	known	69_37n	frame_shift_del	163	30.38	72	DEL	1.000:1.000	-
CPSF1	29894	genome.wustl.edu	37	8	145624997	145624997	+	Frame_Shift_Del	DEL	A	A	-			TCGA-A2-A0CU-01A-12W-A050-09	TCGA-A2-A0CU-10A-01W-A055-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a9aa68af-f5fe-4ac0-987f-8af49b85c231	f41d6d14-ad4f-49d5-a4fb-6bdd1b6dbddc	g.chr8:145624997delA	ENST00000349769.3	-	12	1317	c.1223delT	c.(1222-1224)gtcfs	p.V408fs	MIR1234_ENST00000408875.1_RNA	NM_013291.2	NP_037423.2	Q10570	CPSF1_HUMAN	cleavage and polyadenylation specific factor 1, 160kDa	408					gene expression (GO:0010467)|mRNA 3'-end processing (GO:0031124)|mRNA cleavage (GO:0006379)|mRNA export from nucleus (GO:0006406)|mRNA polyadenylation (GO:0006378)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	mRNA cleavage and polyadenylation specificity factor complex (GO:0005847)|nucleoplasm (GO:0005654)	mRNA 3'-UTR binding (GO:0003730)			NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(5)|lung(15)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	38	all_cancers(97;6.64e-12)|all_epithelial(106;2.89e-10)|Lung NSC(106;5.7e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;2.88e-41)|Epithelial(56;1.67e-40)|all cancers(56;1.2e-35)|BRCA - Breast invasive adenocarcinoma(115;0.0323)|Colorectal(110;0.055)			AGCCTCACGGACAGCACTGGC	0.642																																					NSCLC(133;1088 1848 27708 34777 35269)	dbGAP											0													20.0	23.0	22.0					8																	145624997		2196	4297	6493	-	-	-	SO:0001589	frameshift_variant	0			U37012	CCDS34966.1	8q24	2014-05-06	2002-08-29		ENSG00000071894	ENSG00000071894			2324	protein-coding gene	gene with protein product		606027	"""cleavage and polyadenylation specific factor 1, 160kD subunit"""			7651824, 7590244	Standard	NM_013291		Approved		uc003zcj.3	Q10570	OTTHUMG00000174612	ENST00000349769.3:c.1223delT	8.37:g.145624997delA	ENSP00000339353:p.Val408fs	Somatic		WXS	Illumina GAIIx	Phase_IV	Q96AF0	Frame_Shift_Del	DEL	pfam_Cleavage/polyA-sp_fac_asu_C	p.V408fs	ENST00000349769.3	37	c.1223	CCDS34966.1	8																																																																																			CPSF1	-	NULL	ENSG00000071894		0.642	CPSF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CPSF1	HGNC	protein_coding	OTTHUMT00000382422.2	21	0.00	0	A	NM_013291		145624997	145624997	-1	no_errors	ENST00000349769	ensembl	human	known	69_37n	frame_shift_del	19	62.75	32	DEL	0.026	-
CYP7B1	9420	genome.wustl.edu	37	8	65527680	65527680	+	Silent	SNP	G	G	A			TCGA-A2-A0CU-01A-12W-A050-09	TCGA-A2-A0CU-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a9aa68af-f5fe-4ac0-987f-8af49b85c231	f41d6d14-ad4f-49d5-a4fb-6bdd1b6dbddc	g.chr8:65527680G>A	ENST00000310193.3	-	4	1133	c.960C>T	c.(958-960)gaC>gaT	p.D320D	CYP7B1_ENST00000523954.1_5'UTR	NM_004820.3	NP_004811.1	O75881	CP7B1_HUMAN	cytochrome P450, family 7, subfamily B, polypeptide 1	320					bile acid biosynthetic process (GO:0006699)|bile acid metabolic process (GO:0008206)|cell death (GO:0008219)|cholesterol metabolic process (GO:0008203)|negative regulation of intracellular estrogen receptor signaling pathway (GO:0033147)|positive regulation of epithelial cell proliferation (GO:0050679)|prostate gland epithelium morphogenesis (GO:0060740)|small molecule metabolic process (GO:0044281)|sterol metabolic process (GO:0016125)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)	25-hydroxycholesterol 7alpha-hydroxylase activity (GO:0033783)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|oxysterol 7-alpha-hydroxylase activity (GO:0008396)	p.D320D(2)		endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(9)|lung(11)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	28		all_cancers(86;0.217)|Lung NSC(129;0.0521)|all_lung(136;0.0906)|all_epithelial(80;0.215)				GGTCAATTTCGTCACGCACTG	0.488																																						dbGAP											2	Substitution - coding silent(2)	large_intestine(1)|lung(1)											105.0	97.0	100.0					8																	65527680		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF029403	CCDS6180.1	8q21.3	2008-07-04	2003-01-14		ENSG00000172817	ENSG00000172817		"""Cytochrome P450s"""	2652	protein-coding gene	gene with protein product		603711	"""cytochrome P450, subfamily VIIB (oxysterol 7 alpha-hydroxylase), polypeptide 1"", ""spastic paraplegia 5A (autosomal recessive)"""	SPG5A		9802883, 18252231	Standard	NM_004820		Approved		uc003xvj.2	O75881	OTTHUMG00000164387	ENST00000310193.3:c.960C>T	8.37:g.65527680G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B2RN07|Q9UNF5	Silent	SNP	pfam_Cyt_P450,superfamily_Cyt_P450,prints_Cyt_P450_E_grp-IV,prints_Cyt_P450_E_grp-I,prints_Cyt_P450	p.D320	ENST00000310193.3	37	c.960	CCDS6180.1	8																																																																																			CYP7B1	-	pfam_Cyt_P450,superfamily_Cyt_P450	ENSG00000172817		0.488	CYP7B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CYP7B1	HGNC	protein_coding	OTTHUMT00000378550.1	123	0.00	0	G			65527680	65527680	-1	no_errors	ENST00000310193	ensembl	human	known	69_37n	silent	149	12.28	21	SNP	1.000	A
DCAF4L1	285429	genome.wustl.edu	37	4	41984183	41984183	+	Missense_Mutation	SNP	G	G	A			TCGA-A2-A0CU-01A-12W-A050-09	TCGA-A2-A0CU-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a9aa68af-f5fe-4ac0-987f-8af49b85c231	f41d6d14-ad4f-49d5-a4fb-6bdd1b6dbddc	g.chr4:41984183G>A	ENST00000333141.5	+	1	471	c.374G>A	c.(373-375)cGg>cAg	p.R125Q		NM_001029955.3	NP_001025126.2	Q3SXM0	DC4L1_HUMAN	DDB1 and CUL4 associated factor 4-like 1	125										breast(1)|endometrium(5)|kidney(6)|large_intestine(11)|lung(12)|prostate(1)|skin(1)	37						GTCCCCAACCGGAAGGTGAAG	0.562																																						dbGAP											0													105.0	100.0	102.0					4																	41984183		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC035027	CCDS33978.1	4p13	2013-01-09	2009-07-17	2009-07-17		ENSG00000182308		"""WD repeat domain containing"""	27723	protein-coding gene	gene with protein product			"""WD repeat domain 21B"""	WDR21B			Standard	NM_001029955		Approved		uc003gwk.2	Q3SXM0		ENST00000333141.5:c.374G>A	4.37:g.41984183G>A	ENSP00000327796:p.Arg125Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KVI3|Q3ZCW8|Q499Y5|Q9UFI0	Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.R125Q	ENST00000333141.5	37	c.374	CCDS33978.1	4	.	.	.	.	.	.	.	.	.	.	G	16.76	3.212385	0.58452	.	.	ENSG00000182308	ENST00000333141	T	0.70516	-0.49	0.688	0.688	0.18027	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	0.048493	0.85682	D	0.000000	T	0.73721	0.3623	L	0.57536	1.79	0.40302	D	0.978627	D	0.61697	0.99	P	0.56474	0.799	T	0.74469	-0.3655	9	0.46703	T	0.11	.	.	.	.	.	125	Q3SXM0	DC4L1_HUMAN	Q	125	ENSP00000327796:R125Q	ENSP00000327796:R125Q	R	+	2	0	DCAF4L1	41678940	1.000000	0.71417	0.823000	0.32752	0.567000	0.35839	5.366000	0.66122	0.635000	0.30488	0.313000	0.20887	CGG	DCAF4L1	-	superfamily_WD40_repeat_dom	ENSG00000182308		0.562	DCAF4L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DCAF4L1	HGNC	protein_coding	OTTHUMT00000360958.1	67	0.00	0	G	NM_001029955		41984183	41984183	+1	no_errors	ENST00000333141	ensembl	human	known	69_37n	missense	52	14.75	9	SNP	1.000	A
EHF	26298	genome.wustl.edu	37	11	34664214	34664214	+	Missense_Mutation	SNP	C	C	G	rs370092846		TCGA-A2-A0CU-01A-12W-A050-09	TCGA-A2-A0CU-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a9aa68af-f5fe-4ac0-987f-8af49b85c231	f41d6d14-ad4f-49d5-a4fb-6bdd1b6dbddc	g.chr11:34664214C>G	ENST00000533754.1	+	2	254	c.37C>G	c.(37-39)Ccc>Gcc	p.P13A	EHF_ENST00000527935.1_Missense_Mutation_p.P13A|EHF_ENST00000530286.1_Missense_Mutation_p.P13A|EHF_ENST00000531794.1_Missense_Mutation_p.P35A|EHF_ENST00000257831.3_Missense_Mutation_p.P13A|EHF_ENST00000527001.1_3'UTR|EHF_ENST00000450654.2_Missense_Mutation_p.P13A|EHF_ENST00000531728.1_Missense_Mutation_p.P13A					ets homologous factor										NFIA/EHF(2)	autonomic_ganglia(1)|cervix(1)|endometrium(3)|kidney(3)|lung(8)|upper_aerodigestive_tract(1)	17		all_hematologic(20;0.117)	Epithelial(1;0.055)|all cancers(1;0.137)|STAD - Stomach adenocarcinoma(6;0.235)			GAATCTCAACCCCGGCAACAA	0.522																																						dbGAP											0													86.0	74.0	78.0					11																	34664214		2202	4298	6500	-	-	-	SO:0001583	missense	0			AF170583	CCDS7894.1, CCDS55752.1, CCDS55753.1	11p12	2008-07-18				ENSG00000135373			3246	protein-coding gene	gene with protein product	"""epithelium-specific ets factor 3"", ""ESE3 transcription factor"""	605439				10527851	Standard	NM_012153		Approved	ESE3, ESEJ	uc021qfu.1	Q9NZC4		ENST00000533754.1:c.37C>G	11.37:g.34664214C>G	ENSP00000435837:p.Pro13Ala	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Ets,pfam_Pointed_dom,superfamily_SAM/pointed,smart_Pointed_dom,smart_Ets,pfscan_Ets,prints_Ets	p.P13A	ENST00000533754.1	37	c.37	CCDS7894.1	11	.	.	.	.	.	.	.	.	.	.	C	11.94	1.788855	0.31685	.	.	ENSG00000135373	ENST00000257831;ENST00000450654;ENST00000530286;ENST00000533754;ENST00000529527;ENST00000531728;ENST00000525253;ENST00000531794;ENST00000532302;ENST00000527935	T;T;T;T;T;T;T;T;T;T	0.29917	1.55;1.55;1.55;1.55;1.55;1.55;1.55;1.55;1.55;1.55	5.91	4.81	0.61882	Sterile alpha motif/pointed domain (1);	0.944326	0.08983	N	0.865506	T	0.19327	0.0464	N	0.12182	0.205	0.28549	N	0.911721	B;B;B	0.24483	0.003;0.081;0.104	B;B;B	0.15870	0.002;0.013;0.014	T	0.02789	-1.1110	10	0.46703	T	0.11	.	10.5251	0.44943	0.0:0.859:0.0:0.141	.	35;13;13	E9PSB2;Q9NZC4-2;Q9NZC4	.;.;EHF_HUMAN	A	13;13;13;13;13;13;13;35;13;13	ENSP00000257831:P13A;ENSP00000399733:P13A;ENSP00000433508:P13A;ENSP00000435837:P13A;ENSP00000432905:P13A;ENSP00000436357:P13A;ENSP00000434395:P13A;ENSP00000435835:P35A;ENSP00000432460:P13A;ENSP00000436158:P13A	ENSP00000257831:P13A	P	+	1	0	EHF	34620790	1.000000	0.71417	1.000000	0.80357	0.891000	0.51852	1.631000	0.37092	2.793000	0.96121	0.655000	0.94253	CCC	EHF	-	superfamily_SAM/pointed	ENSG00000135373		0.522	EHF-003	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	EHF	HGNC	protein_coding	OTTHUMT00000389855.1	111	0.00	0	C	NM_012153		34664214	34664214	+1	no_errors	ENST00000257831	ensembl	human	known	69_37n	missense	31	27.91	12	SNP	1.000	G
EML3	256364	genome.wustl.edu	37	11	62378801	62378802	+	Frame_Shift_Ins	INS	-	-	G	rs11553576	byFrequency	TCGA-A2-A0CU-01A-12W-A050-09	TCGA-A2-A0CU-10A-01W-A055-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a9aa68af-f5fe-4ac0-987f-8af49b85c231	f41d6d14-ad4f-49d5-a4fb-6bdd1b6dbddc	g.chr11:62378801_62378802insG	ENST00000394773.2	-	3	516_517	c.209_210insC	c.(208-210)ccafs	p.P70fs	ROM1_ENST00000278833.3_5'Flank|EML3_ENST00000531557.1_5'Flank|EML3_ENST00000494176.2_Frame_Shift_Ins_p.P42fs|ROM1_ENST00000534093.1_5'Flank|EML3_ENST00000278845.4_Frame_Shift_Ins_p.P71fs|EML3_ENST00000529309.1_Frame_Shift_Ins_p.P70fs	NM_153265.2	NP_694997.2	Q32P44	EMAL3_HUMAN	echinoderm microtubule associated protein like 3	70						cytoplasm (GO:0005737)|microtubule (GO:0005874)				biliary_tract(1)|breast(3)|endometrium(4)|kidney(2)|large_intestine(1)|lung(11)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	26						GTGGCAGTCCTGGGGGGGCTGC	0.604																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			AK093146	CCDS8023.2	11q12.3	2013-01-10			ENSG00000149499	ENSG00000149499		"""WD repeat domain containing"""	26666	protein-coding gene	gene with protein product						15225882, 14744259	Standard	NM_153265		Approved	FLJ35827, ELP95	uc001ntu.1	Q32P44	OTTHUMG00000149817	ENST00000394773.2:c.210dupC	11.37:g.62378808_62378808dupG	ENSP00000378254:p.Pro70fs	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6ZQW7|Q8NA55	Frame_Shift_Ins	INS	pfam_HELP,pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.G71fs	ENST00000394773.2	37	c.210_209	CCDS8023.2	11																																																																																			EML3	-	NULL	ENSG00000149499		0.604	EML3-001	KNOWN	NAGNAG_splice_site|basic|appris_candidate|CCDS	protein_coding	EML3	HGNC	protein_coding	OTTHUMT00000313432.1	17	0.00	0	-	NM_153265		62378801	62378802	-1	no_errors	ENST00000529309	ensembl	human	known	69_37n	frame_shift_ins	10	23.08	3	INS	0.982:1.000	G
FAM157B	100132403	genome.wustl.edu	37	9	141107536	141107537	+	lincRNA	INS	-	-	GCA	rs367832601|rs554298933|rs370981092		TCGA-A2-A0CU-01A-12W-A050-09	TCGA-A2-A0CU-10A-01W-A055-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a9aa68af-f5fe-4ac0-987f-8af49b85c231	f41d6d14-ad4f-49d5-a4fb-6bdd1b6dbddc	g.chr9:141107536_141107537insGCA	ENST00000446912.2	+	0	19_20							P0CG42	F157B_HUMAN	family with sequence similarity 157, member B																		CGgcagcggcggcagcagcagc	0.545																																						dbGAP											0																																										-	-	-			0					9q34	2013-01-24			ENSG00000233013	ENSG00000233013			34080	other	unknown							Standard	NM_001145249		Approved		uc011mfe.1	P0CG42	OTTHUMG00000021000		9.37:g.141107543_141107545dupGCA		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	INS	-	NULL	ENST00000446912.2	37	NULL		9																																																																																			FAM157B	-	-	ENSG00000233013		0.545	FAM157B-001	KNOWN	mRNA_end_NF|basic	lincRNA	FAM157B	HGNC	lincRNA	OTTHUMT00000055378.2	63	0.00	0	-	NM_001145249		141107536	141107537	+1	no_errors	ENST00000446912	ensembl	human	known	69_37n	rna	46	11.54	6	INS	0.033:0.036	GCA
GALNT15	117248	genome.wustl.edu	37	3	16216886	16216887	+	Frame_Shift_Del	DEL	AG	AG	-			TCGA-A2-A0CU-01A-12W-A050-09	TCGA-A2-A0CU-10A-01W-A055-09	AG	AG					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a9aa68af-f5fe-4ac0-987f-8af49b85c231	f41d6d14-ad4f-49d5-a4fb-6bdd1b6dbddc	g.chr3:16216886_16216887delAG	ENST00000339732.5	+	1	731_732	c.228_229delAG	c.(226-231)gaagagfs	p.EE76fs	GALNT15_ENST00000437509.1_Frame_Shift_Del_p.EE76fs	NM_054110.4	NP_473451.3	Q8N3T1	GLT15_HUMAN	polypeptide N-acetylgalactosaminyltransferase 15	76					cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|transport vesicle (GO:0030133)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)|polypeptide N-acetylgalactosaminyltransferase activity (GO:0004653)										ATGAGGGTGAAGAGTACAGCCC	0.609																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			AY358443	CCDS33711.1	3p25.1	2014-03-13	2014-03-13	2013-01-25	ENSG00000131386	ENSG00000131386	2.4.1.41	"""Glycosyltransferase family 2 domain containing"""	21531	protein-coding gene	gene with protein product	"""polypeptide GalNAc transferase 15"""	615131	"""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase-like 2"", ""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 15"""	GALNTL2		12975309, 14702039, 15147861	Standard	NM_054110		Approved	GALNT7, pp-GalNAc-T15	uc003car.4	Q8N3T1	OTTHUMG00000156893	ENST00000339732.5:c.228_229delAG	3.37:g.16216888_16216889delAG	ENSP00000344260:p.Glu76fs	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NMN1|B2R638|F1LIP6|Q86T60|Q96C46|Q96DJ5	Frame_Shift_Del	DEL	pfam_Glyco_trans_2,pfam_Ricin_B_lectin,superfamily_Ricin_B_lectin,smart_Ricin_B_lectin,pfscan_Ricin_B_lectin	p.E77fs	ENST00000339732.5	37	c.228_229	CCDS33711.1	3																																																																																			GALNTL2	-	NULL	ENSG00000131386		0.609	GALNT15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GALNTL2	HGNC	protein_coding	OTTHUMT00000346483.2	130	0.00	0	AG	NM_054110		16216886	16216887	+1	no_errors	ENST00000339732	ensembl	human	known	69_37n	frame_shift_del	163	35.32	89	DEL	0.263:0.860	-
GALNT15	117248	genome.wustl.edu	37	3	16216891	16216891	+	Frame_Shift_Del	DEL	A	A	-			TCGA-A2-A0CU-01A-12W-A050-09	TCGA-A2-A0CU-10A-01W-A055-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a9aa68af-f5fe-4ac0-987f-8af49b85c231	f41d6d14-ad4f-49d5-a4fb-6bdd1b6dbddc	g.chr3:16216891delA	ENST00000339732.5	+	1	736	c.233delA	c.(232-234)tacfs	p.Y78fs	GALNT15_ENST00000437509.1_Frame_Shift_Del_p.Y78fs	NM_054110.4	NP_473451.3	Q8N3T1	GLT15_HUMAN	polypeptide N-acetylgalactosaminyltransferase 15	78					cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|transport vesicle (GO:0030133)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)|polypeptide N-acetylgalactosaminyltransferase activity (GO:0004653)										GGTGAAGAGTACAGCCCTCTG	0.617																																						dbGAP											0													91.0	89.0	89.0					3																	16216891		2203	4300	6503	-	-	-	SO:0001589	frameshift_variant	0			AY358443	CCDS33711.1	3p25.1	2014-03-13	2014-03-13	2013-01-25	ENSG00000131386	ENSG00000131386	2.4.1.41	"""Glycosyltransferase family 2 domain containing"""	21531	protein-coding gene	gene with protein product	"""polypeptide GalNAc transferase 15"""	615131	"""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase-like 2"", ""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 15"""	GALNTL2		12975309, 14702039, 15147861	Standard	NM_054110		Approved	GALNT7, pp-GalNAc-T15	uc003car.4	Q8N3T1	OTTHUMG00000156893	ENST00000339732.5:c.233delA	3.37:g.16216891delA	ENSP00000344260:p.Tyr78fs	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NMN1|B2R638|F1LIP6|Q86T60|Q96C46|Q96DJ5	Frame_Shift_Del	DEL	pfam_Glyco_trans_2,pfam_Ricin_B_lectin,superfamily_Ricin_B_lectin,smart_Ricin_B_lectin,pfscan_Ricin_B_lectin	p.Y78fs	ENST00000339732.5	37	c.233	CCDS33711.1	3																																																																																			GALNTL2	-	NULL	ENSG00000131386		0.617	GALNT15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GALNTL2	HGNC	protein_coding	OTTHUMT00000346483.2	137	0.00	0	A	NM_054110		16216891	16216891	+1	no_errors	ENST00000339732	ensembl	human	known	69_37n	frame_shift_del	147	37.71	89	DEL	0.905	-
GLB1L3	112937	genome.wustl.edu	37	11	134179562	134179562	+	Missense_Mutation	SNP	C	C	T			TCGA-A2-A0CU-01A-12W-A050-09	TCGA-A2-A0CU-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a9aa68af-f5fe-4ac0-987f-8af49b85c231	f41d6d14-ad4f-49d5-a4fb-6bdd1b6dbddc	g.chr11:134179562C>T	ENST00000431683.2	+	11	1004	c.1004C>T	c.(1003-1005)tCc>tTc	p.S335F		NM_001080407.2	NP_001073876.2	Q8NCI6	GLBL3_HUMAN	galactosidase, beta 1-like 3	335					carbohydrate metabolic process (GO:0005975)		beta-galactosidase activity (GO:0004565)			endometrium(4)|kidney(1)|large_intestine(3)|lung(4)|pancreas(1)	13	all_hematologic(175;0.127)	all_cancers(12;5.52e-23)|all_epithelial(12;2.15e-16)|all_lung(97;1.19e-05)|Lung NSC(97;2.76e-05)|Breast(109;0.000162)|all_neural(223;0.0182)|Medulloblastoma(222;0.0208)|Esophageal squamous(93;0.0559)		Epithelial(10;1.3e-11)|all cancers(11;2.07e-10)|BRCA - Breast invasive adenocarcinoma(10;3.09e-10)|OV - Ovarian serous cystadenocarcinoma(99;0.000873)|Lung(977;0.222)		TATGAGATCTCCTTCAATGTA	0.438																																						dbGAP											0													92.0	87.0	88.0					11																	134179562		1890	4097	5987	-	-	-	SO:0001583	missense	0				CCDS44780.1	11q25	2008-11-06	2008-01-29		ENSG00000166105	ENSG00000166105			25147	protein-coding gene	gene with protein product						12477932	Standard	NM_001080407		Approved	FLJ90231	uc009zdf.3	Q8NCI6	OTTHUMG00000133524	ENST00000431683.2:c.1004C>T	11.37:g.134179562C>T	ENSP00000396615:p.Ser335Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NEM0|A6NN15|Q6P3S3|Q96FF8	Missense_Mutation	SNP	pfam_Glycoside_Hdrlase_35,pfam_Glyco_hydro_42_N,superfamily_Glycoside_hydrolase_SF,superfamily_Galactose-bd-like,prints_Glycoside_Hdrlase_35	p.S335F	ENST00000431683.2	37	c.1004	CCDS44780.1	11	.	.	.	.	.	.	.	.	.	.	C	20.5	4.004256	0.74932	.	.	ENSG00000166105	ENST00000431683	D	0.98105	-4.72	4.76	4.76	0.60689	Glycoside hydrolase, subgroup, catalytic domain (1);Glycoside hydrolase, superfamily (1);	.	.	.	.	D	0.99026	0.9667	H	0.95712	3.71	0.54753	D	0.999985	D	0.89917	1.0	D	0.91635	0.999	D	0.98971	1.0801	9	0.87932	D	0	.	13.4492	0.61161	0.0:1.0:0.0:0.0	.	335	Q8NCI6	GLBL3_HUMAN	F	335	ENSP00000396615:S335F	ENSP00000396615:S335F	S	+	2	0	GLB1L3	133684772	1.000000	0.71417	0.998000	0.56505	0.951000	0.60555	5.484000	0.66844	2.619000	0.88677	0.455000	0.32223	TCC	GLB1L3	-	pfam_Glycoside_Hdrlase_35,superfamily_Glycoside_hydrolase_SF,prints_Glycoside_Hdrlase_35	ENSG00000166105		0.438	GLB1L3-007	KNOWN	basic|appris_principal|CCDS	protein_coding	GLB1L3	HGNC	protein_coding	OTTHUMT00000393625.1	61	0.00	0	C	NM_138416		134179562	134179562	+1	no_errors	ENST00000431683	ensembl	human	known	69_37n	missense	46	41.77	33	SNP	1.000	T
GNB3	2784	genome.wustl.edu	37	12	6952161	6952161	+	Nonsense_Mutation	SNP	C	C	T			TCGA-A2-A0CU-01A-12W-A050-09	TCGA-A2-A0CU-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a9aa68af-f5fe-4ac0-987f-8af49b85c231	f41d6d14-ad4f-49d5-a4fb-6bdd1b6dbddc	g.chr12:6952161C>T	ENST00000229264.3	+	5	529	c.124C>T	c.(124-126)Cga>Tga	p.R42*	CDCA3_ENST00000604599.1_5'Flank|GNB3_ENST00000435982.2_Nonsense_Mutation_p.R42*	NM_002075.2	NP_002066.1	P16520	GBB3_HUMAN	guanine nucleotide binding protein (G protein), beta polypeptide 3	42					cellular response to glucagon stimulus (GO:0071377)|energy reserve metabolic process (GO:0006112)|G-protein coupled receptor signaling pathway (GO:0007186)|GTP catabolic process (GO:0006184)|regulation of blood pressure (GO:0008217)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)	cell body (GO:0044297)|extracellular vesicular exosome (GO:0070062)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)	GTPase activity (GO:0003924)|GTPase binding (GO:0051020)|signal transducer activity (GO:0004871)	p.R42*(1)		cervix(1)|endometrium(4)|kidney(1)|large_intestine(5)|lung(7)|prostate(1)|stomach(1)	20						GGTGGTGGGACGAGTCCAGAT	0.592																																						dbGAP											1	Substitution - Nonsense(1)	large_intestine(1)											96.0	77.0	84.0					12																	6952161		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0				CCDS8564.1, CCDS73427.1	12p13	2013-01-10			ENSG00000111664	ENSG00000111664		"""WD repeat domain containing"""	4400	protein-coding gene	gene with protein product		139130				11770079, 16600389	Standard	XM_005253680		Approved		uc001qrd.3	P16520	OTTHUMG00000168517	ENST00000229264.3:c.124C>T	12.37:g.6952161C>T	ENSP00000229264:p.Arg42*	Somatic		WXS	Illumina GAIIx	Phase_IV	Q96B71|Q9BQC0	Nonsense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pirsf_Guanine_nucleotide-bd_bsu,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,prints_Gprotein_B,prints_G-protein_beta_WD-40_rep	p.R42*	ENST00000229264.3	37	c.124	CCDS8564.1	12	.	.	.	.	.	.	.	.	.	.	C	25.9	4.689799	0.88735	.	.	ENSG00000111664	ENST00000229264;ENST00000541257;ENST00000541978;ENST00000435982;ENST00000537035	.	.	.	5.26	3.32	0.38043	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-15.5687	14.1076	0.65101	0.2873:0.7127:0.0:0.0	.	.	.	.	X	42	.	ENSP00000229264:R42X	R	+	1	2	GNB3	6822422	0.999000	0.42202	0.998000	0.56505	0.964000	0.63967	4.061000	0.57485	1.173000	0.42796	0.491000	0.48974	CGA	GNB3	-	superfamily_WD40_repeat_dom,pirsf_Guanine_nucleotide-bd_bsu	ENSG00000111664		0.592	GNB3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	GNB3	HGNC	protein_coding	OTTHUMT00000400006.1	219	0.00	0	C	NM_002075		6952161	6952161	+1	no_errors	ENST00000229264	ensembl	human	known	69_37n	nonsense	194	10.19	22	SNP	1.000	T
IRF2BP2	359948	genome.wustl.edu	37	1	234743301	234743302	+	Frame_Shift_Ins	INS	-	-	A			TCGA-A2-A0CU-01A-12W-A050-09	TCGA-A2-A0CU-10A-01W-A055-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a9aa68af-f5fe-4ac0-987f-8af49b85c231	f41d6d14-ad4f-49d5-a4fb-6bdd1b6dbddc	g.chr1:234743301_234743302insA	ENST00000366609.3	-	2	1375_1376	c.1345_1346insT	c.(1345-1347)tccfs	p.S449fs	IRF2BP2_ENST00000366610.3_Frame_Shift_Ins_p.S433fs|RP4-781K5.2_ENST00000436039.1_RNA|IRF2BP2_ENST00000491430.1_5'UTR	NM_182972.2	NP_892017.2	Q7Z5L9	I2BP2_HUMAN	interferon regulatory factor 2 binding protein 2	449					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(5)|skin(1)|upper_aerodigestive_tract(1)	11	Ovarian(103;0.0303)	all_cancers(173;0.0236)|Prostate(94;0.0115)	OV - Ovarian serous cystadenocarcinoma(106;2.86e-05)|Epithelial(3;6.2e-05)			CCTGGTAGTGGAGTGAACCTGG	0.589																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			AY278023	CCDS1602.1, CCDS41475.1	1q42.3	2008-02-05			ENSG00000168264	ENSG00000168264			21729	protein-coding gene	gene with protein product		615332				12799427	Standard	NM_182972		Approved	IRF-2BP2	uc001hwg.3	Q7Z5L9	OTTHUMG00000037981	ENST00000366609.3:c.1346dupT	1.37:g.234743302_234743302dupA	ENSP00000355568:p.Ser449fs	Somatic		WXS	Illumina GAIIx	Phase_IV	B1AM35|B1AM36|Q6P083|Q7Z5L8|Q8N351|Q8WUH8	Frame_Shift_Ins	INS	pfam_Interferon_reg_fac2-bd1_2_Znf	p.S449fs	ENST00000366609.3	37	c.1346_1345	CCDS1602.1	1																																																																																			IRF2BP2	-	pfam_Interferon_reg_fac2-bd1_2_Znf	ENSG00000168264		0.589	IRF2BP2-002	NOVEL	basic|CCDS	protein_coding	IRF2BP2	HGNC	protein_coding	OTTHUMT00000092705.1	71	0.00	0	-	NM_182972		234743301	234743302	-1	no_errors	ENST00000366609	ensembl	human	known	69_37n	frame_shift_ins	20	25.93	7	INS	1.000:1.000	A
KDM4C	23081	genome.wustl.edu	37	9	6793072	6793072	+	Silent	SNP	G	G	A			TCGA-A2-A0CU-01A-12W-A050-09	TCGA-A2-A0CU-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a9aa68af-f5fe-4ac0-987f-8af49b85c231	f41d6d14-ad4f-49d5-a4fb-6bdd1b6dbddc	g.chr9:6793072G>A	ENST00000381309.3	+	2	649	c.84G>A	c.(82-84)gaG>gaA	p.E28E	KDM4C_ENST00000536108.1_5'UTR|KDM4C_ENST00000543771.1_Silent_p.E28E|KDM4C_ENST00000489243.1_3'UTR|KDM4C_ENST00000401787.3_Silent_p.E28E|KDM4C_ENST00000535193.1_Silent_p.E50E|KDM4C_ENST00000442236.2_5'UTR|KDM4C_ENST00000381306.3_Silent_p.E28E	NM_015061.3	NP_055876.2	Q9H3R0	KDM4C_HUMAN	lysine (K)-specific demethylase 4C	28	JmjN. {ECO:0000255|PROSITE- ProRule:PRU00537}.				histone H3-K9 demethylation (GO:0033169)|positive regulation of cell proliferation (GO:0008284)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nuclear chromatin (GO:0000790)	androgen receptor binding (GO:0050681)|dioxygenase activity (GO:0051213)|enzyme binding (GO:0019899)|histone demethylase activity (H3-K9 specific) (GO:0032454)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(4)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(8)|lung(14)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	43						AGTTCCGGGAGTTCAACAAAT	0.478																																						dbGAP											0													116.0	117.0	116.0					9																	6793072		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB018323	CCDS6471.1, CCDS55285.1, CCDS55286.1, CCDS55287.1	9p24-p23	2013-01-23	2009-04-06	2009-04-06	ENSG00000107077	ENSG00000107077		"""Chromatin-modifying enzymes / K-demethylases"", ""Tudor domain containing"""	17071	protein-coding gene	gene with protein product	"""tudor domain containing 14C"""	605469	"""jumonji domain containing 2C"""	JMJD2C		9872452, 15138608	Standard	NM_015061		Approved	GASC1, KIAA0780, TDRD14C	uc003zkh.3	Q9H3R0	OTTHUMG00000019536	ENST00000381309.3:c.84G>A	9.37:g.6793072G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B4E1Y4|B7ZL46|F5H347|F5H7P0|O94877|Q2M3M0|Q5JUC9|Q5VYJ2|Q5VYJ3	Silent	SNP	pfam_JmjC_dom,pfam_TF_JmjN,superfamily_Znf_FYVE_PHD,superfamily_Chorismate_mutase_type_II,smart_TF_JmjN,smart_JmjC_dom,smart_Znf_PHD,smart_Tudor,pfscan_TF_JmjN,pfscan_JmjC_dom	p.E28	ENST00000381309.3	37	c.84	CCDS6471.1	9																																																																																			KDM4C	-	pfam_TF_JmjN,smart_TF_JmjN,pfscan_TF_JmjN	ENSG00000107077		0.478	KDM4C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KDM4C	HGNC	protein_coding	OTTHUMT00000051692.1	79	0.00	0	G	NM_015061		6793072	6793072	+1	no_errors	ENST00000381309	ensembl	human	known	69_37n	silent	94	16.81	19	SNP	0.431	A
KIAA2022	340533	genome.wustl.edu	37	X	73963301	73963301	+	Frame_Shift_Del	DEL	A	A	-			TCGA-A2-A0CU-01A-12W-A050-09	TCGA-A2-A0CU-10A-01W-A055-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a9aa68af-f5fe-4ac0-987f-8af49b85c231	f41d6d14-ad4f-49d5-a4fb-6bdd1b6dbddc	g.chrX:73963301delA	ENST00000055682.6	-	3	1702	c.1091delT	c.(1090-1092)ttcfs	p.F364fs		NM_001008537.2	NP_001008537.1	Q5QGS0	K2022_HUMAN	KIAA2022	364					base-excision repair, gap-filling (GO:0006287)|DNA replication proofreading (GO:0045004)|DNA replication, removal of RNA primer (GO:0043137)|nervous system development (GO:0007399)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|nucleotide-excision repair, DNA gap filling (GO:0006297)|regulation of mitotic cell cycle (GO:0007346)	delta DNA polymerase complex (GO:0043625)|nucleus (GO:0005634)	3'-5' exonuclease activity (GO:0008408)|DNA-directed DNA polymerase activity (GO:0003887)			breast(2)|central_nervous_system(2)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(23)|liver(1)|lung(41)|ovary(7)|pancreas(2)|prostate(4)|skin(9)|upper_aerodigestive_tract(2)|urinary_tract(3)	109						AGGGACCTTGAATTGGGAAAA	0.478																																						dbGAP											0													80.0	75.0	77.0					X																	73963301		2203	4300	6503	-	-	-	SO:0001589	frameshift_variant	0				CCDS35337.1	Xq13.3	2014-02-19			ENSG00000050030	ENSG00000050030			29433	protein-coding gene	gene with protein product	"""XLMR-related protein, neurite extension"""	300524				15466006, 23615299	Standard	NM_001008537		Approved	XPN, MRX98	uc004eby.3	Q5QGS0	OTTHUMG00000021860	ENST00000055682.6:c.1091delT	X.37:g.73963301delA	ENSP00000055682:p.Phe364fs	Somatic		WXS	Illumina GAIIx	Phase_IV	A7YY87|Q5JUX9|Q8IVE9	Frame_Shift_Del	DEL	NULL	p.F364fs	ENST00000055682.6	37	c.1091	CCDS35337.1	X																																																																																			KIAA2022	-	NULL	ENSG00000050030		0.478	KIAA2022-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA2022	HGNC	protein_coding	OTTHUMT00000057270.2	124	0.00	0	A	NM_001008537		73963301	73963301	-1	no_errors	ENST00000055682	ensembl	human	known	69_37n	frame_shift_del	124	15.65	23	DEL	1.000	-
LDB2	9079	genome.wustl.edu	37	4	16504298	16504298	+	Missense_Mutation	SNP	A	A	T			TCGA-A2-A0CU-01A-12W-A050-09	TCGA-A2-A0CU-10A-01W-A055-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a9aa68af-f5fe-4ac0-987f-8af49b85c231	f41d6d14-ad4f-49d5-a4fb-6bdd1b6dbddc	g.chr4:16504298A>T	ENST00000304523.5	-	8	1413	c.1090T>A	c.(1090-1092)Tca>Aca	p.S364T	LDB2_ENST00000441778.2_3'UTR|LDB2_ENST00000515064.1_Missense_Mutation_p.S362T|RP11-446J8.1_ENST00000512370.1_RNA|LDB2_ENST00000502640.1_3'UTR	NM_001290.3	NP_001281.1	O43679	LDB2_HUMAN	LIM domain binding 2	364					epithelial structure maintenance (GO:0010669)|hair follicle development (GO:0001942)|positive regulation of cellular component biogenesis (GO:0044089)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|somatic stem cell maintenance (GO:0035019)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	LIM domain binding (GO:0030274)|transcription cofactor activity (GO:0003712)			breast(1)|endometrium(4)|kidney(1)|large_intestine(3)|lung(23)|urinary_tract(1)	33						GGGTTTTCTGATTTGGTCTCT	0.527																																						dbGAP											0													172.0	189.0	183.0					4																	16504298		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF068651	CCDS3420.1, CCDS47031.1	4p16	2008-08-01			ENSG00000169744	ENSG00000169744			6533	protein-coding gene	gene with protein product		603450				9853615, 9880598, 10861853	Standard	NM_001290		Approved	CLIM1, LDB1	uc003goz.3	O43679	OTTHUMG00000048212	ENST00000304523.5:c.1090T>A	4.37:g.16504298A>T	ENSP00000306772:p.Ser364Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	O60619|O75480	Missense_Mutation	SNP	NULL	p.S364T	ENST00000304523.5	37	c.1090	CCDS3420.1	4	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	12.32|12.32	1.902829|1.902829	0.33628|0.33628	.|.	.|.	ENSG00000169744|ENSG00000169744	ENST00000507464|ENST00000515064;ENST00000304523	.|T;T	.|0.55234	.|0.53;0.53	5.48|5.48	5.48|5.48	0.80851|0.80851	.|.	.|0.000000	.|0.56097	.|D	.|0.000034	T|T	0.45935|0.45935	0.1367|0.1367	L|L	0.44542|0.44542	1.39|1.39	0.80722|0.80722	D|D	1|1	.|B;B;B;B	.|0.28636	.|0.083;0.067;0.139;0.218	.|B;B;B;B	.|0.26969	.|0.011;0.041;0.047;0.075	T|T	0.39210|0.39210	-0.9625|-0.9625	5|10	.|0.37606	.|T	.|0.19	-8.6662|-8.6662	14.7327|14.7327	0.69393|0.69393	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	.|328;362;364;338	.|B7Z6D0;G5E9Y7;O43679;O43679-3	.|.;.;LDB2_HUMAN;.	K|T	284|362;364	.|ENSP00000422552:S362T;ENSP00000306772:S364T	.|ENSP00000306772:S364T	N|S	-|-	3|1	2|0	LDB2|LDB2	16113396|16113396	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.999000|0.999000	0.98932|0.98932	4.116000|4.116000	0.57871|0.57871	2.068000|2.068000	0.61886|0.61886	0.533000|0.533000	0.62120|0.62120	AAT|TCA	LDB2	-	NULL	ENSG00000169744		0.527	LDB2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	LDB2	HGNC	protein_coding	OTTHUMT00000250321.2	146	0.00	0	A			16504298	16504298	-1	no_errors	ENST00000304523	ensembl	human	known	69_37n	missense	129	12.24	18	SNP	1.000	T
LRFN2	57497	genome.wustl.edu	37	6	40400576	40400577	+	Frame_Shift_Ins	INS	-	-	C			TCGA-A2-A0CU-01A-12W-A050-09	TCGA-A2-A0CU-10A-01W-A055-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a9aa68af-f5fe-4ac0-987f-8af49b85c231	f41d6d14-ad4f-49d5-a4fb-6bdd1b6dbddc	g.chr6:40400576_40400577insC	ENST00000338305.6	-	2	818_819	c.276_277insG	c.(274-279)cagcccfs	p.P93fs		NM_020737.1	NP_065788.1	Q9ULH4	LRFN2_HUMAN	leucine rich repeat and fibronectin type III domain containing 2	93						cell junction (GO:0030054)|integral component of membrane (GO:0016021)|postsynaptic membrane (GO:0045211)				breast(1)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(13)|lung(25)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	58	Ovarian(28;0.0418)|Colorectal(47;0.196)					AAGGAAAAGGGCTGGATGTGGC	0.609																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			AB033072	CCDS34443.1	6p21.2-p21.1	2013-02-11	2004-02-02	2004-02-04	ENSG00000156564	ENSG00000156564		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	21226	protein-coding gene	gene with protein product	"""fibronectin type III, immunoglobulin and leucine rich repeat domains 2"""	612808	"""KIAA1246"""	KIAA1246, SALM1		16495444, 16828986	Standard	NM_020737		Approved	FIGLER2	uc003oph.1	Q9ULH4	OTTHUMG00000014662	ENST00000338305.6:c.277dupG	6.37:g.40400577_40400577dupC	ENSP00000345985:p.Pro93fs	Somatic		WXS	Illumina GAIIx	Phase_IV	A5PKU3|Q5SYP9	Frame_Shift_Ins	INS	pfam_Ig_I-set,pfam_Leu-rich_rpt,pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C,smart_Ig_sub,smart_Ig_sub2,pfscan_Fibronectin_type3,pfscan_Ig-like	p.P92fs	ENST00000338305.6	37	c.277_276	CCDS34443.1	6																																																																																			LRFN2	-	smart_Leu-rich_rpt_typical-subtyp	ENSG00000156564		0.609	LRFN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRFN2	HGNC	protein_coding	OTTHUMT00000040488.1	58	0.00	0	-	XM_166372		40400576	40400577	-1	no_errors	ENST00000338305	ensembl	human	known	69_37n	frame_shift_ins	31	35.42	17	INS	1.000:1.000	C
LRIG2	9860	genome.wustl.edu	37	1	113616247	113616248	+	Frame_Shift_Ins	INS	-	-	C			TCGA-A2-A0CU-01A-12W-A050-09	TCGA-A2-A0CU-10A-01W-A055-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a9aa68af-f5fe-4ac0-987f-8af49b85c231	f41d6d14-ad4f-49d5-a4fb-6bdd1b6dbddc	g.chr1:113616247_113616248insC	ENST00000361127.5	+	1	417_418	c.219_220insC	c.(220-222)cccfs	p.P74fs	RP11-31F15.2_ENST00000421157.1_lincRNA	NM_014813.1	NP_055628.1	O94898	LRIG2_HUMAN	leucine-rich repeats and immunoglobulin-like domains 2	74	LRRNT.				innervation (GO:0060384)|regulation of platelet-derived growth factor receptor signaling pathway (GO:0010640)|sensory perception of sound (GO:0007605)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(1)|endometrium(2)|kidney(7)|large_intestine(3)|lung(10)|ovary(4)|prostate(2)|stomach(1)|urinary_tract(1)	31	Lung SC(450;0.246)	all_cancers(81;1.56e-05)|all_epithelial(167;2.62e-05)|all_lung(203;0.000665)|Lung NSC(69;0.000986)		Lung(183;0.0279)|Colorectal(144;0.0885)|COAD - Colon adenocarcinoma(174;0.134)|all cancers(265;0.139)|Epithelial(280;0.143)|LUSC - Lung squamous cell carcinoma(189;0.15)		CGGGCTTGCTGCCCCCCGACAC	0.673											OREG0013684	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			AB018349	CCDS30808.1	1p13.1	2013-01-11			ENSG00000198799	ENSG00000198799		"""Immunoglobulin superfamily / I-set domain containing"""	20889	protein-coding gene	gene with protein product		608869					Standard	XM_005271369		Approved	KIAA0806	uc001edf.1	O94898	OTTHUMG00000012133	ENST00000361127.5:c.225dupC	1.37:g.113616253_113616253dupC	ENSP00000355396:p.Pro74fs	Somatic	1451	WXS	Illumina GAIIx	Phase_IV	Q9NSN2	Frame_Shift_Ins	INS	pfam_Ig_I-set,pfam_Leu-rich_rpt,pfam_Immunoglobulin,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	p.D75fs	ENST00000361127.5	37	c.219_220	CCDS30808.1	1																																																																																			LRIG2	-	NULL	ENSG00000198799		0.673	LRIG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRIG2	HGNC	protein_coding	OTTHUMT00000033549.2	21	0.00	0	-	NM_014813		113616247	113616248	+1	no_errors	ENST00000361127	ensembl	human	known	69_37n	frame_shift_ins	18	10.00	2	INS	1.000:1.000	C
NAA38	84316	genome.wustl.edu	37	17	7760674	7760675	+	Intron	INS	-	-	C			TCGA-A2-A0CU-01A-12W-A050-09	TCGA-A2-A0CU-10A-01W-A055-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a9aa68af-f5fe-4ac0-987f-8af49b85c231	f41d6d14-ad4f-49d5-a4fb-6bdd1b6dbddc	g.chr17:7760674_7760675insC	ENST00000335155.5	-	1	81				LSMD1_ENST00000576384.1_5'Flank|LSMD1_ENST00000575771.1_Intron|CYB5D1_ENST00000571846.1_5'Flank|LSMD1_ENST00000575071.1_Intron|LSMD1_ENST00000333775.5_Frame_Shift_Ins_p.L23fs|CYB5D1_ENST00000570446.1_5'Flank|CYB5D1_ENST00000332439.4_5'Flank|LSMD1_ENST00000570555.1_5'Flank|LSMD1_ENST00000575208.1_Intron|LSMD1_ENST00000576861.1_Intron			Q9BRA0	LSMD1_HUMAN							negative regulation of apoptotic process (GO:0043066)	cytoplasm (GO:0005737)|NatC complex (GO:0031417)|nucleus (GO:0005634)				endometrium(1)|lung(2)|ovary(1)	4		all_cancers(10;0.11)|Prostate(122;0.219)				ACTGCCCCTCAGTCCCAGAACC	0.649																																					GBM(66;626 1401 29924 42527)	dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0																														ENST00000335155.5:c.81+25->G	17.37:g.7760674_7760675insC		Somatic		WXS	Illumina GAIIx	Phase_IV	Q8N4M0	Frame_Shift_Ins	INS	pfam_Ribonucl_LSM,superfamily_LSM_dom,smart_Ribonucl_LSM_euk/arc	p.L23fs	ENST00000335155.5	37	c.68_67		17																																																																																			LSMD1	-	NULL	ENSG00000183011		0.649	LSMD1-201	KNOWN	basic|appris_principal	protein_coding	LSMD1	HGNC	protein_coding		8	0.00	0	-			7760674	7760675	-1	no_errors	ENST00000333775	ensembl	human	known	69_37n	frame_shift_ins	10	33.33	5	INS	0.000:0.007	C
MAGEA8	4107	genome.wustl.edu	37	X	149013310	149013311	+	Frame_Shift_Ins	INS	-	-	G			TCGA-A2-A0CU-01A-12W-A050-09	TCGA-A2-A0CU-10A-01W-A055-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a9aa68af-f5fe-4ac0-987f-8af49b85c231	f41d6d14-ad4f-49d5-a4fb-6bdd1b6dbddc	g.chrX:149013310_149013311insG	ENST00000542674.1	+	3	785_786	c.264_265insG	c.(265-267)agcfs	p.S89fs	MAGEA8_ENST00000493910.1_3'UTR|MAGEA8_ENST00000286482.1_Frame_Shift_Ins_p.S89fs|MAGEA8_ENST00000535454.1_Frame_Shift_Ins_p.S89fs	NM_001166401.1	NP_001159873.1	P43361	MAGA8_HUMAN	melanoma antigen family A, 8	89										NS(1)|breast(2)|endometrium(2)|large_intestine(2)|lung(12)|upper_aerodigestive_tract(1)	20	Acute lymphoblastic leukemia(192;6.56e-05)					AGGGTTCCAGCAGCAATGAAGA	0.579																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0				CCDS14692.1	Xq28	2009-03-13			ENSG00000156009	ENSG00000156009			6806	protein-coding gene	gene with protein product	"""MAGE-8 antigen"", ""cancer/testis antigen family 1, member 8"""	300341		MAGE8		8575766	Standard	NM_005364		Approved	MGC2182, CT1.8	uc004fdw.2	P43361	OTTHUMG00000022635	Exception_encountered	X.37:g.149013310_149013311insG	ENSP00000443776:p.Ser89fs	Somatic		WXS	Illumina GAIIx	Phase_IV	Q9BUN9	Frame_Shift_Ins	INS	pfam_MAGE,pfam_Melanoma_ass_antigen_N,pfscan_MAGE	p.S88fs	ENST00000542674.1	37	c.264_265	CCDS14692.1	X																																																																																			MAGEA8	-	pfam_Melanoma_ass_antigen_N	ENSG00000156009		0.579	MAGEA8-202	KNOWN	basic|appris_principal|CCDS	protein_coding	MAGEA8	HGNC	protein_coding	OTTHUMT00000058728.1	66	0.00	0	-	NM_005364		149013310	149013311	+1	no_errors	ENST00000286482	ensembl	human	known	69_37n	frame_shift_ins	28	30.00	12	INS	0.001:0.002	G
MAGEA8	4107	genome.wustl.edu	37	X	149013312	149013313	+	Frame_Shift_Ins	INS	-	-	T			TCGA-A2-A0CU-01A-12W-A050-09	TCGA-A2-A0CU-10A-01W-A055-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a9aa68af-f5fe-4ac0-987f-8af49b85c231	f41d6d14-ad4f-49d5-a4fb-6bdd1b6dbddc	g.chrX:149013312_149013313insT	ENST00000542674.1	+	3	787_788	c.266_267insT	c.(265-270)agcaatfs	p.N90fs	MAGEA8_ENST00000493910.1_3'UTR|MAGEA8_ENST00000286482.1_Frame_Shift_Ins_p.N90fs|MAGEA8_ENST00000535454.1_Frame_Shift_Ins_p.N90fs	NM_001166401.1	NP_001159873.1	P43361	MAGA8_HUMAN	melanoma antigen family A, 8	90										NS(1)|breast(2)|endometrium(2)|large_intestine(2)|lung(12)|upper_aerodigestive_tract(1)	20	Acute lymphoblastic leukemia(192;6.56e-05)					GGTTCCAGCAGCAATGAAGAGG	0.589																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0				CCDS14692.1	Xq28	2009-03-13			ENSG00000156009	ENSG00000156009			6806	protein-coding gene	gene with protein product	"""MAGE-8 antigen"", ""cancer/testis antigen family 1, member 8"""	300341		MAGE8		8575766	Standard	NM_005364		Approved	MGC2182, CT1.8	uc004fdw.2	P43361	OTTHUMG00000022635	Exception_encountered	X.37:g.149013312_149013313insT	ENSP00000443776:p.Asn90fs	Somatic		WXS	Illumina GAIIx	Phase_IV	Q9BUN9	Frame_Shift_Ins	INS	pfam_MAGE,pfam_Melanoma_ass_antigen_N,pfscan_MAGE	p.N90fs	ENST00000542674.1	37	c.266_267	CCDS14692.1	X																																																																																			MAGEA8	-	pfam_Melanoma_ass_antigen_N	ENSG00000156009		0.589	MAGEA8-202	KNOWN	basic|appris_principal|CCDS	protein_coding	MAGEA8	HGNC	protein_coding	OTTHUMT00000058728.1	67	0.00	0	-	NM_005364		149013312	149013313	+1	no_errors	ENST00000286482	ensembl	human	known	69_37n	frame_shift_ins	29	29.27	12	INS	0.001:0.001	T
MAST1	22983	genome.wustl.edu	37	19	12978650	12978651	+	Frame_Shift_Ins	INS	-	-	C			TCGA-A2-A0CU-01A-12W-A050-09	TCGA-A2-A0CU-10A-01W-A055-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a9aa68af-f5fe-4ac0-987f-8af49b85c231	f41d6d14-ad4f-49d5-a4fb-6bdd1b6dbddc	g.chr19:12978650_12978651insC	ENST00000251472.4	+	20	2464_2465	c.2425_2426insC	c.(2425-2427)gccfs	p.A809fs		NM_014975.2	NP_055790.1			microtubule associated serine/threonine kinase 1											NS(1)|cervix(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(9)|lung(20)|ovary(5)|prostate(5)|skin(3)	56						CCGCTTCAGCGCCCCCCAAGAG	0.718																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			AB023190	CCDS32921.1	19p13.2	2008-02-05				ENSG00000105613			19034	protein-coding gene	gene with protein product		612256					Standard	NM_014975		Approved	SAST, KIAA0973	uc002mvm.3	Q9Y2H9		ENST00000251472.4:c.2431dupC	19.37:g.12978656_12978656dupC	ENSP00000251472:p.Ala809fs	Somatic		WXS	Illumina GAIIx	Phase_IV		Frame_Shift_Ins	INS	pfam_MA_Ser/Thr_Kinase_dom,pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_PDZ,superfamily_Kinase-like_dom,superfamily_MAST_pre-PK_dom,superfamily_PDZ,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_PDZ,pfscan_PDZ,pfscan_Prot_kinase_cat_dom	p.Q811fs	ENST00000251472.4	37	c.2425_2426	CCDS32921.1	19																																																																																			MAST1	-	NULL	ENSG00000105613		0.718	MAST1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAST1	HGNC	protein_coding	OTTHUMT00000451733.2	27	0.00	0	-	NM_014975		12978650	12978651	+1	no_errors	ENST00000251472	ensembl	human	known	69_37n	frame_shift_ins	27	10.00	3	INS	0.596:0.615	C
MST1L	11223	genome.wustl.edu	37	1	17083776	17083776	+	RNA	SNP	C	C	A	rs56318124	byFrequency	TCGA-A2-A0CU-01A-12W-A050-09	TCGA-A2-A0CU-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a9aa68af-f5fe-4ac0-987f-8af49b85c231	f41d6d14-ad4f-49d5-a4fb-6bdd1b6dbddc	g.chr1:17083776C>A	ENST00000455405.2	-	0	812							Q2TV78	MST1L_HUMAN	macrophage stimulating 1-like							extracellular region (GO:0005576)	serine-type endopeptidase activity (GO:0004252)	p.R674L(1)									CACAGAGACACGCGTGAAGAC	0.537																																						dbGAP											1	Substitution - Missense(1)	endometrium(1)																																								-	-	-			0			U28055, AF083416		1p36.33	2013-03-27	2012-11-09	2012-11-09	ENSG00000186715	ENSG00000186715			7390	other	unknown			"""macrophage stimulating, pseudogene 7"", ""macrophage stimulating, pseudogene 9"", ""macrophage stimulating 1 (hepatocyte growth factor-like) pseudogene 9"""	MSTP7, MSTP9, MST1P9		10728827	Standard	NM_001271733		Approved	D1F15S1A, MSPL7, MSPL-7	uc010ock.3	Q2TV78	OTTHUMG00000002578		1.37:g.17083776C>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B7WPB1|Q13209	Missense_Mutation	SNP	pfam_Kringle,pfam_Peptidase_S1_S6,pfam_PAN-1_domain,superfamily_Pept_cys/ser_Trypsin-like,superfamily_Kringle-like,smart_Pan_app,smart_Kringle,smart_Peptidase_S1_S6,pfscan_Pan_app,pfscan_Kringle,pfscan_Peptidase_S1_S6	p.R674L	ENST00000455405.2	37	c.2021		1	.	.	.	.	.	.	.	.	.	.	.	14.57	2.575742	0.45902	.	.	ENSG00000186715	ENST00000334998;ENST00000442552	.	.	.	.	.	.	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	0.000000	0.42172	D	0.000756	T	0.66197	0.2765	.	.	.	.	.	.	D;D	0.89917	1.0;1.0	D;D	0.97110	0.999;1.0	T	0.72117	-0.4387	6	0.87932	D	0	.	6.7402	0.23431	0.0:0.9998:0.0:2.0E-4	rs56318124	674;700	Q2TV78-2;Q2TV78	.;MSTP9_HUMAN	L	674;700	.	ENSP00000439273:R674L	R	-	2	0	MST1P9	16956363	1.000000	0.71417	0.897000	0.35233	0.000000	0.00434	4.748000	0.62148	0.502000	0.28037	0.000000	0.15137	CGT	MST1P9	-	pfam_Peptidase_S1_S6,superfamily_Pept_cys/ser_Trypsin-like,smart_Peptidase_S1_S6,pfscan_Peptidase_S1_S6	ENSG00000186715		0.537	MST1L-002	KNOWN	basic	processed_transcript	MST1P9	HGNC	pseudogene	OTTHUMT00000400328.1	30	0.00	0	C	NM_001271733		17083776	17083776	-1	no_errors	ENST00000334998	ensembl	human	known	69_37n	missense	52	14.52	9	SNP	1.000	A
NRBP1	29959	genome.wustl.edu	37	2	27656951	27656951	+	Frame_Shift_Del	DEL	G	G	-			TCGA-A2-A0CU-01A-12W-A050-09	TCGA-A2-A0CU-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a9aa68af-f5fe-4ac0-987f-8af49b85c231	f41d6d14-ad4f-49d5-a4fb-6bdd1b6dbddc	g.chr2:27656951delG	ENST00000233557.3	+	5	1261	c.429delG	c.(427-429)aagfs	p.K143fs	NRBP1_ENST00000379863.3_Frame_Shift_Del_p.K143fs|NRBP1_ENST00000379852.3_Frame_Shift_Del_p.K143fs			Q9UHY1	NRBP_HUMAN	nuclear receptor binding protein 1	143	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				ER to Golgi vesicle-mediated transport (GO:0006888)|gene expression (GO:0010467)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cell projection (GO:0042995)|endomembrane system (GO:0012505)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|perinuclear region of cytoplasm (GO:0048471)	ATP binding (GO:0005524)|protein homodimerization activity (GO:0042803)|protein kinase activity (GO:0004672)			central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(3)|lung(6)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	19	Acute lymphoblastic leukemia(172;0.155)					AAGAGAACAAGGCCAGGGTAA	0.343																																						dbGAP											0													133.0	141.0	138.0					2																	27656951		2203	4300	6503	-	-	-	SO:0001589	frameshift_variant	0			AF113249	CCDS1753.1	2p23	2008-02-05	2005-12-22	2005-12-22	ENSG00000115216	ENSG00000115216			7993	protein-coding gene	gene with protein product		606010	"""nuclear receptor binding protein"""	NRBP		10843813, 11956649	Standard	NM_013392		Approved	BCON3, MUDPNP, MADM	uc002rkp.3	Q9UHY1	OTTHUMG00000097789	ENST00000233557.3:c.429delG	2.37:g.27656951delG	ENSP00000233557:p.Lys143fs	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KV40|D6W558|Q53FZ5|Q96SU3	Frame_Shift_Del	DEL	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.A144fs	ENST00000233557.3	37	c.429	CCDS1753.1	2																																																																																			NRBP1	-	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	ENSG00000115216		0.343	NRBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NRBP1	HGNC	protein_coding	OTTHUMT00000215033.1	96	0.00	0	G	NM_013392		27656951	27656951	+1	no_errors	ENST00000233557	ensembl	human	known	69_37n	frame_shift_del	82	39.13	54	DEL	1.000	-
NYAP2	57624	genome.wustl.edu	37	2	226273793	226273793	+	Missense_Mutation	SNP	G	G	A			TCGA-A2-A0CU-01A-12W-A050-09	TCGA-A2-A0CU-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a9aa68af-f5fe-4ac0-987f-8af49b85c231	f41d6d14-ad4f-49d5-a4fb-6bdd1b6dbddc	g.chr2:226273793G>A	ENST00000272907.6	+	2	610	c.197G>A	c.(196-198)cGa>cAa	p.R66Q	NYAP2_ENST00000409269.2_Missense_Mutation_p.R66Q	NM_020864.1	NP_065915.1	Q9P242	NYAP2_HUMAN	neuronal tyrosine-phosphorylated phosphoinositide-3-kinase adaptor 2	66					neuron projection morphogenesis (GO:0048812)|phosphatidylinositol 3-kinase signaling (GO:0014065)												GAAAAACGCCGAAGACAAGAA	0.368																																						dbGAP											0													49.0	42.0	44.0					2																	226273793		1836	4082	5918	-	-	-	SO:0001583	missense	0			AB040919	CCDS46529.1	2q36.3	2011-11-30	2011-11-30	2011-11-30	ENSG00000144460	ENSG00000144460			29291	protein-coding gene	gene with protein product		615478	"""KIAA1486"""	KIAA1486		10819331, 21946561	Standard	NM_020864		Approved		uc002voe.2	Q9P242	OTTHUMG00000153450	ENST00000272907.6:c.197G>A	2.37:g.226273793G>A	ENSP00000272907:p.Arg66Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	A2RRN4|Q96NL2	Missense_Mutation	SNP	NULL	p.R66Q	ENST00000272907.6	37	c.197	CCDS46529.1	2	.	.	.	.	.	.	.	.	.	.	G	28.1	4.894860	0.91962	.	.	ENSG00000144460	ENST00000272907;ENST00000409269	T	0.43294	0.95	5.82	5.82	0.92795	.	0.000000	0.64402	D	0.000001	T	0.56470	0.1987	L	0.35487	1.065	0.48236	D	0.999616	D;D	0.89917	1.0;1.0	D;D	0.83275	0.996;0.996	T	0.49986	-0.8880	10	0.37606	T	0.19	-8.8832	20.1178	0.97943	0.0:0.0:1.0:0.0	.	66;66	Q9P242-2;Q9P242	.;K1486_HUMAN	Q	66	ENSP00000272907:R66Q	ENSP00000272907:R66Q	R	+	2	0	KIAA1486	225982037	1.000000	0.71417	0.996000	0.52242	0.995000	0.86356	7.021000	0.76425	2.759000	0.94783	0.557000	0.71058	CGA	NYAP2	-	NULL	ENSG00000144460		0.368	NYAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NYAP2	HGNC	protein_coding	OTTHUMT00000331258.1	63	0.00	0	G	NM_020864		226273793	226273793	+1	no_errors	ENST00000272907	ensembl	human	known	69_37n	missense	64	14.47	11	SNP	1.000	A
OR56A1	120796	genome.wustl.edu	37	11	6048841	6048841	+	Missense_Mutation	SNP	G	G	A			TCGA-A2-A0CU-01A-12W-A050-09	TCGA-A2-A0CU-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a9aa68af-f5fe-4ac0-987f-8af49b85c231	f41d6d14-ad4f-49d5-a4fb-6bdd1b6dbddc	g.chr11:6048841G>A	ENST00000316650.5	-	1	130	c.94C>T	c.(94-96)Cac>Tac	p.H32Y		NM_001001917.2	NP_001001917.2	Q8NGH5	O56A1_HUMAN	olfactory receptor, family 56, subfamily A, member 1	32						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(6)|lung(22)|ovary(2)	33		Medulloblastoma(188;0.00776)|all_neural(188;0.0652)|Breast(177;0.114)		Epithelial(150;7.01e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		GAGAGCCAGTGCTGCCAACTC	0.587																																						dbGAP											0													93.0	89.0	91.0					11																	6048841		2201	4296	6497	-	-	-	SO:0001583	missense	0			AB065821	CCDS31405.1	11p15.4	2012-08-09			ENSG00000180934	ENSG00000180934		"""GPCR / Class A : Olfactory receptors"""	14781	protein-coding gene	gene with protein product							Standard	NM_001001917		Approved		uc010qzw.2	Q8NGH5	OTTHUMG00000165377	ENST00000316650.5:c.94C>T	11.37:g.6048841G>A	ENSP00000321246:p.His32Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RNI2|Q6IFL0	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.H32Y	ENST00000316650.5	37	c.94	CCDS31405.1	11	.	.	.	.	.	.	.	.	.	.	G	0.133	-1.111523	0.01813	.	.	ENSG00000180934	ENST00000316650	T	0.00314	8.14	4.27	2.38	0.29361	.	0.163698	0.28754	N	0.014246	T	0.00210	0.0006	L	0.38649	1.16	0.22305	N	0.999212	B	0.29955	0.263	B	0.32090	0.14	T	0.35400	-0.9790	10	0.62326	D	0.03	.	9.0894	0.36601	0.1821:0.0:0.8179:0.0	.	32	Q8NGH5	O56A1_HUMAN	Y	32	ENSP00000321246:H32Y	ENSP00000321246:H32Y	H	-	1	0	OR56A1	6005417	0.019000	0.18553	0.909000	0.35828	0.662000	0.39071	1.126000	0.31344	0.551000	0.29008	-0.140000	0.14226	CAC	OR56A1	-	NULL	ENSG00000180934		0.587	OR56A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR56A1	HGNC	protein_coding	OTTHUMT00000383757.1	444	0.00	0	G	NM_001001917		6048841	6048841	-1	no_errors	ENST00000316650	ensembl	human	known	69_37n	missense	345	10.82	42	SNP	0.930	A
OXER1	165140	genome.wustl.edu	37	2	42991088	42991089	+	Frame_Shift_Ins	INS	-	-	C			TCGA-A2-A0CU-01A-12W-A050-09	TCGA-A2-A0CU-10A-01W-A055-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a9aa68af-f5fe-4ac0-987f-8af49b85c231	f41d6d14-ad4f-49d5-a4fb-6bdd1b6dbddc	g.chr2:42991088_42991089insC	ENST00000378661.2	-	1	312_313	c.231_232insG	c.(229-234)gggtccfs	p.S78fs		NM_148962.4	NP_683765.1	Q8TDS5	OXER1_HUMAN	oxoeicosanoid (OXE) receptor 1	78	Ser-rich.				G-protein coupled receptor signaling pathway (GO:0007186)|regulation of cAMP biosynthetic process (GO:0030817)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	5(S)-hydroxyperoxy-6E,8Z,11Z,14Z-icosatetraenoic acid binding (GO:0050648)|5-hydroxy-6E,8Z,11Z,14Z-icosatetraenoic acid binding (GO:0050647)|5-oxo-6E,8Z,11Z,14Z-icosatetraenoic acid binding (GO:0050646)|G-protein coupled receptor activity (GO:0004930)	p.S78fs*61(1)		breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(2)|prostate(1)	10						CCTCCAGAGGACCCCCCCACAG	0.634																																						dbGAP											1	Insertion - Frameshift(1)	large_intestine(1)																																								-	-	-	SO:0001589	frameshift_variant	0			AB083055	CCDS1810.1	2p22.1	2012-08-10			ENSG00000162881	ENSG00000162881		"""GPCR / Class A : Leukotriene receptors"""	24884	protein-coding gene	gene with protein product	"""5-oxo-ETE acid G-protein-coupled receptor 1"""					12065583, 15001665	Standard	NM_148962		Approved	GPCR, TG1019, GPR170	uc002rss.3	Q8TDS5	OTTHUMG00000128643	ENST00000378661.2:c.232dupG	2.37:g.42991095_42991095dupC	ENSP00000367930:p.Ser78fs	Somatic		WXS	Illumina GAIIx	Phase_IV	Q86WP7|Q8NGW4	Frame_Shift_Ins	INS	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_7TM_GPCR_Rhodpsn	p.S77fs	ENST00000378661.2	37	c.232_231	CCDS1810.1	2																																																																																			OXER1	-	NULL	ENSG00000162881		0.634	OXER1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OXER1	HGNC	protein_coding	OTTHUMT00000250514.1	41	0.00	0	-	NM_148962		42991088	42991089	-1	no_errors	ENST00000378661	ensembl	human	known	69_37n	frame_shift_ins	45	10.00	5	INS	0.000:0.001	C
PARP12	64761	genome.wustl.edu	37	7	139726015	139726015	+	Missense_Mutation	SNP	C	C	G			TCGA-A2-A0CU-01A-12W-A050-09	TCGA-A2-A0CU-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a9aa68af-f5fe-4ac0-987f-8af49b85c231	f41d6d14-ad4f-49d5-a4fb-6bdd1b6dbddc	g.chr7:139726015C>G	ENST00000263549.3	-	11	2635	c.1762G>C	c.(1762-1764)Ggc>Cgc	p.G588R		NM_022750.2	NP_073587.1	Q9H0J9	PAR12_HUMAN	poly (ADP-ribose) polymerase family, member 12	588	PARP catalytic. {ECO:0000255|PROSITE- ProRule:PRU00397}.					nucleus (GO:0005634)	metal ion binding (GO:0046872)|NAD+ ADP-ribosyltransferase activity (GO:0003950)|poly(A) RNA binding (GO:0044822)			endometrium(3)|kidney(2)|large_intestine(4)|lung(5)|ovary(3)|prostate(1)|skin(1)	19	Melanoma(164;0.0142)					TAGGAAGTGCCATGAACACCA	0.587																																						dbGAP											0													79.0	71.0	74.0					7																	139726015		2203	4300	6503	-	-	-	SO:0001583	missense	0			AL136766	CCDS5857.1	7q34	2014-01-28	2005-06-02	2005-06-02	ENSG00000059378	ENSG00000059378		"""Zinc fingers, CCCH-type domain containing"", ""Poly (ADP-ribose) polymerases"""	21919	protein-coding gene	gene with protein product		612481	"""zinc finger CCCH-type domain containing 1"""	ZC3HDC1		11230166, 12851707	Standard	NM_022750		Approved	FLJ22693, PARP-12, ZC3H1	uc003vvl.1	Q9H0J9	OTTHUMG00000157315	ENST00000263549.3:c.1762G>C	7.37:g.139726015C>G	ENSP00000263549:p.Gly588Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	Q9H610|Q9NP36|Q9NTI3	Missense_Mutation	SNP	pfam_Poly(ADP-ribose)pol_cat_dom,pfam_Znf_CCCH,smart_Znf_CCCH,pfscan_WWE-dom,pfscan_Poly(ADP-ribose)pol_cat_dom	p.G588R	ENST00000263549.3	37	c.1762	CCDS5857.1	7	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	21.1|21.1	4.100808|4.100808	0.76983|0.76983	.|.	.|.	ENSG00000059378|ENSG00000059378	ENST00000263549|ENST00000484111	T|.	0.40225|.	1.04|.	5.07|5.07	4.19|4.19	0.49359|0.49359	Poly(ADP-ribose) polymerase, catalytic domain (2);|.	0.000000|.	0.85682|.	D|.	0.000000|.	D|D	0.84502|0.84502	0.5486|0.5486	M|M	0.93808|0.93808	3.46|3.46	0.80722|0.80722	D|D	1|1	D|.	0.89917|.	1.0|.	D|.	0.87578|.	0.998|.	D|D	0.88363|0.88363	0.2989|0.2989	10|5	0.87932|.	D|.	0|.	.|.	13.6751|13.6751	0.62449|0.62449	0.0:0.9246:0.0:0.0754|0.0:0.9246:0.0:0.0754	.|.	588|.	Q9H0J9|.	PAR12_HUMAN|.	R|I	588|59	ENSP00000263549:G588R|.	ENSP00000263549:G588R|.	G|M	-|-	1|3	0|0	PARP12|PARP12	139372484|139372484	1.000000|1.000000	0.71417|0.71417	0.978000|0.978000	0.43139|0.43139	0.720000|0.720000	0.41350|0.41350	6.042000|6.042000	0.70996|0.70996	1.143000|1.143000	0.42306|0.42306	0.467000|0.467000	0.42956|0.42956	GGC|ATG	PARP12	-	pfam_Poly(ADP-ribose)pol_cat_dom,pfscan_Poly(ADP-ribose)pol_cat_dom	ENSG00000059378		0.587	PARP12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PARP12	HGNC	protein_coding	OTTHUMT00000348413.1	76	0.00	0	C	NM_022750		139726015	139726015	-1	no_errors	ENST00000263549	ensembl	human	known	69_37n	missense	31	46.55	27	SNP	1.000	G
PGA5	5222	genome.wustl.edu	37	11	61017206	61017206	+	Missense_Mutation	SNP	C	C	G			TCGA-A2-A0CU-01A-12W-A050-09	TCGA-A2-A0CU-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a9aa68af-f5fe-4ac0-987f-8af49b85c231	f41d6d14-ad4f-49d5-a4fb-6bdd1b6dbddc	g.chr11:61017206C>G	ENST00000312403.5	+	7	1024	c.839C>G	c.(838-840)aCc>aGc	p.T280S	PGA4_ENST00000422676.2_Missense_Mutation_p.T280S|CTD-2331C18.5_ENST00000537594.1_RNA|PGA5_ENST00000541528.1_Missense_Mutation_p.T20S|PGA5_ENST00000451616.2_Missense_Mutation_p.T126S	NM_014224.2	NP_055039.1	P0DJD9	PEPA5_HUMAN	pepsinogen 5, group I (pepsinogen A)	280					digestion (GO:0007586)	extracellular vesicular exosome (GO:0070062)	aspartic-type endopeptidase activity (GO:0004190)			large_intestine(1)|skin(1)	2						GACACCGGCACCTCTCTGCTG	0.612																																						dbGAP											0													133.0	135.0	134.0					11																	61017206		2202	4299	6501	-	-	-	SO:0001583	missense	0			BC029055	CCDS8001.1	11q13	2012-10-02			ENSG00000256713	ENSG00000256713	3.4.23.1		8887	protein-coding gene	gene with protein product		169730					Standard	NM_014224		Approved		uc001nqz.3	P0DJD9	OTTHUMG00000168075	ENST00000312403.5:c.839C>G	11.37:g.61017206C>G	ENSP00000309542:p.Thr280Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K749|B7ZW62|B7ZW75|P00790|Q7M4R0|Q8N1E3	Missense_Mutation	SNP	pfam_Peptidase_A1,pfam_Propep_A1,superfamily_Peptidase_aspartic,prints_Peptidase_A1	p.T280S	ENST00000312403.5	37	c.839	CCDS8001.1	11	.	.	.	.	.	.	.	.	.	.	C	27.9	4.870296	0.91587	.	.	ENSG00000229183;ENSG00000256713;ENSG00000256713;ENSG00000256713;ENSG00000256713;ENSG00000256713	ENST00000422676;ENST00000312403;ENST00000537359;ENST00000544083;ENST00000451616;ENST00000541528	T;T;T;T	0.71934	-0.61;-0.61;-0.61;-0.61	2.91	2.91	0.33838	.	0.000000	0.64402	D	0.000001	D	0.84999	0.5597	M	0.88181	2.935	0.36243	D	0.853383	D	0.89917	1.0	D	0.87578	0.998	D	0.90117	0.4196	10	0.56958	D	0.05	.	13.8637	0.63576	0.0:1.0:0.0:0.0	.	280	B7ZW62	.	S	280;280;237;139;126;20	ENSP00000395402:T280S;ENSP00000309542:T280S;ENSP00000408739:T126S;ENSP00000441981:T20S	ENSP00000395402:T280S	T	+	2	0	PGA4;PGA5	60773782	1.000000	0.71417	0.593000	0.28771	0.972000	0.66771	6.051000	0.71072	1.991000	0.58162	0.420000	0.28162	ACC	PGA5	-	pfam_Peptidase_A1,superfamily_Peptidase_aspartic,prints_Peptidase_A1	ENSG00000256713		0.612	PGA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PGA5	HGNC	protein_coding	OTTHUMT00000397972.1	154	0.00	0	C	NM_014224		61017206	61017206	+1	no_errors	ENST00000312403	ensembl	human	known	69_37n	missense	124	45.89	106	SNP	1.000	G
POTEE	445582	genome.wustl.edu	37	2	132021946	132021946	+	Missense_Mutation	SNP	G	G	A	rs62178369	byFrequency	TCGA-A2-A0CU-01A-12W-A050-09	TCGA-A2-A0CU-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a9aa68af-f5fe-4ac0-987f-8af49b85c231	f41d6d14-ad4f-49d5-a4fb-6bdd1b6dbddc	g.chr2:132021946G>A	ENST00000356920.5	+	15	3012	c.2918G>A	c.(2917-2919)gGc>gAc	p.G973D	POTEE_ENST00000358087.5_3'UTR|PLEKHB2_ENST00000303908.3_Intron|PLEKHB2_ENST00000404460.1_Intron	NM_001083538.1	NP_001077007.1	Q6S8J3	POTEE_HUMAN	POTE ankyrin domain family, member E	973	Actin-like.				retina homeostasis (GO:0001895)|substantia nigra development (GO:0021762)	blood microparticle (GO:0072562)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)											GAATCCTGTGGCATCCATGAA	0.572																																						dbGAP											0													2.0	1.0	1.0					2																	132021946		585	948	1533	-	-	-	SO:0001583	missense	0			AY462868	CCDS46414.1	2q21.1	2014-04-10	2008-11-26	2008-11-26	ENSG00000188219	ENSG00000188219		"""POTE ankyrin domain containing"", ""Ankyrin repeat domain containing"""	33895	protein-coding gene	gene with protein product	"""cancer/testis antigen family 104, member 2"""	608914	"""ANKRD26-like family C, member 1A"""	A26C1A			Standard	NM_001083538		Approved	POTE2, POTE-2, A26C1, POTE2gamma, CT104.2	uc002tsn.2	Q6S8J3	OTTHUMG00000186974	ENST00000356920.5:c.2918G>A	2.37:g.132021946G>A	ENSP00000439189:p.Gly973Asp	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6S8J4|Q6S8J5|Q6S8J8	Missense_Mutation	SNP	pfam_Actin-like,pfam_Ankyrin_rpt,smart_Ankyrin_rpt,smart_Actin-like,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,prints_Actin-like	p.G973D	ENST00000356920.5	37	c.2918	CCDS46414.1	2	.	.	.	.	.	.	.	.	.	.	.	15.99	2.994529	0.54041	.	.	ENSG00000188219	ENST00000356920	D	0.97352	-4.35	.	.	.	.	.	.	.	.	D	0.99074	0.9682	H	0.99946	5.015	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.96048	0.9029	8	0.87932	D	0	.	5.9051	0.18992	8.0E-4:0.0:0.9992:0.0	.	973	Q6S8J3	POTEE_HUMAN	D	973	ENSP00000439189:G973D	ENSP00000439189:G973D	G	+	2	0	AC131180.1	131738416	1.000000	0.71417	0.305000	0.25099	0.308000	0.27856	6.504000	0.73704	0.119000	0.18210	0.121000	0.15741	GGC	AC131180.1	-	pfam_Actin-like,smart_Actin-like	ENSG00000188219		0.572	POTEE-201	KNOWN	basic|appris_principal|CCDS	protein_coding	POTEE	Clone_based_ensembl_gene	protein_coding		8	0.00	0	G	NM_001083538		132021946	132021946	+1	no_errors	ENST00000356920	ensembl	human	known	69_37n	missense	13	43.48	10	SNP	1.000	A
PPP1R32	220004	genome.wustl.edu	37	11	61258004	61258004	+	Missense_Mutation	SNP	A	A	C			TCGA-A2-A0CU-01A-12W-A050-09	TCGA-A2-A0CU-10A-01W-A055-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a9aa68af-f5fe-4ac0-987f-8af49b85c231	f41d6d14-ad4f-49d5-a4fb-6bdd1b6dbddc	g.chr11:61258004A>C	ENST00000338608.2	+	13	1365	c.1240A>C	c.(1240-1242)Aac>Cac	p.N414H	PPP1R32_ENST00000538185.1_Missense_Mutation_p.N91H|PPP1R32_ENST00000366212.4_Missense_Mutation_p.N44H|PPP1R32_ENST00000432063.2_Missense_Mutation_p.N394H	NM_145017.2	NP_659454.2	Q7Z5V6	PPR32_HUMAN	protein phosphatase 1, regulatory subunit 32	414							phosphatase binding (GO:0019902)										CTTCTACCAGAACACACCTCA	0.607																																						dbGAP											0													182.0	158.0	166.0					11																	61258004		2202	4299	6501	-	-	-	SO:0001583	missense	0			AK057333	CCDS8008.1, CCDS53641.1	11q12.2	2012-04-17	2011-10-11	2011-10-11	ENSG00000162148	ENSG00000162148		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	28869	protein-coding gene	gene with protein product			"""chromosome 11 open reading frame 66"""	C11orf66		12477932	Standard	NM_145017		Approved	IIIG9, FLJ32771	uc001nru.2	Q7Z5V6	OTTHUMG00000168176	ENST00000338608.2:c.1240A>C	11.37:g.61258004A>C	ENSP00000344140:p.Asn414His	Somatic		WXS	Illumina GAIIx	Phase_IV	Q4G0P4|Q96M77	Missense_Mutation	SNP	NULL	p.N414H	ENST00000338608.2	37	c.1240	CCDS8008.1	11	.	.	.	.	.	.	.	.	.	.	A	9.315	1.056461	0.19907	.	.	ENSG00000162148	ENST00000432063;ENST00000338608;ENST00000542951;ENST00000535545;ENST00000366212;ENST00000538185	T;T;T;T;T;T	0.46063	0.91;1.48;1.53;1.52;0.94;0.88	4.77	-0.368	0.12537	.	0.618471	0.13969	N	0.350339	T	0.20700	0.0498	N	0.08118	0	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.001	T	0.15464	-1.0436	10	0.66056	D	0.02	-20.2022	7.5677	0.27890	0.4815:0.0:0.5185:0.0	.	394;414	Q7Z5V6-2;Q7Z5V6	.;PPR32_HUMAN	H	394;414;165;126;44;91	ENSP00000391560:N394H;ENSP00000344140:N414H;ENSP00000441053:N165H;ENSP00000437511:N126H;ENSP00000439468:N44H;ENSP00000444387:N91H	ENSP00000344140:N414H	N	+	1	0	C11orf66	61014580	0.000000	0.05858	0.000000	0.03702	0.027000	0.11550	0.100000	0.15231	-0.388000	0.07797	-0.232000	0.12228	AAC	PPP1R32	-	NULL	ENSG00000162148		0.607	PPP1R32-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPP1R32	HGNC	protein_coding	OTTHUMT00000398621.1	78	0.00	0	A	NM_145017		61258004	61258004	+1	no_errors	ENST00000338608	ensembl	human	known	69_37n	missense	83	23.85	26	SNP	0.000	C
REV1	51455	genome.wustl.edu	37	2	100019354	100019354	+	Silent	SNP	G	G	A			TCGA-A2-A0CU-01A-12W-A050-09	TCGA-A2-A0CU-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a9aa68af-f5fe-4ac0-987f-8af49b85c231	f41d6d14-ad4f-49d5-a4fb-6bdd1b6dbddc	g.chr2:100019354G>A	ENST00000258428.3	-	20	3610	c.3382C>T	c.(3382-3384)Ctg>Ttg	p.L1128L	REV1_ENST00000393445.3_Silent_p.L1127L|RP11-527J8.1_ENST00000608144.1_RNA|REV1_ENST00000465835.1_5'Flank	NM_001037872.1|NM_016316.2	NP_001032961.1|NP_057400.1	Q9UBZ9	REV1_HUMAN	REV1, polymerase (DNA directed)	1128					DNA repair (GO:0006281)|DNA replication (GO:0006260)|DNA-dependent DNA replication (GO:0006261)|error-prone translesion synthesis (GO:0042276)|response to UV (GO:0009411)	nucleoplasm (GO:0005654)	damaged DNA binding (GO:0003684)|deoxycytidyl transferase activity (GO:0017125)|DNA-directed DNA polymerase activity (GO:0003887)|magnesium ion binding (GO:0000287)			NS(1)|breast(1)|endometrium(2)|kidney(1)|large_intestine(14)|lung(12)|ovary(2)|prostate(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	39						GGAATTACCAGGGGTTTCTCT	0.403								Direct reversal of damage																														dbGAP											0													93.0	101.0	98.0					2																	100019354		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF206019	CCDS2045.1, CCDS42722.1	2q11.1-q11.2	2012-05-18	2012-05-18	2006-11-07	ENSG00000135945	ENSG00000135945		"""DNA polymerases"""	14060	protein-coding gene	gene with protein product		606134	"""REV1 (yeast homolog)- like"", ""REV1-like (yeast)"", ""REV1 homolog (S. cerevisiae)"""	REV1L		10536157	Standard	XM_005263968		Approved		uc002tad.3	Q9UBZ9	OTTHUMG00000130636	ENST00000258428.3:c.3382C>T	2.37:g.100019354G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	O95941|Q53SI7|Q9C0J4|Q9NUP2	Silent	SNP	pfam_DNA_repair_prot_UmuC-like,pfam_DNA_pol_Y-fam_little_finger,pfam_BRCT_dom,superfamily_BRCT_dom,superfamily_DNA_pol_Y-fam_little_finger,smart_BRCT_dom,pirsf_REV1,pfscan_BRCT_dom,pfscan_DNA_repair_prot_UmuC-like_N	p.L1128	ENST00000258428.3	37	c.3382	CCDS2045.1	2																																																																																			REV1	-	pirsf_REV1	ENSG00000135945		0.403	REV1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	REV1	HGNC	protein_coding	OTTHUMT00000253123.2	149	0.00	0	G	NM_016316		100019354	100019354	-1	no_errors	ENST00000258428	ensembl	human	known	69_37n	silent	86	20.37	22	SNP	0.966	A
RSBN1L	222194	genome.wustl.edu	37	7	77379331	77379331	+	Missense_Mutation	SNP	T	T	G	rs202084915	byFrequency	TCGA-A2-A0CU-01A-12W-A050-09	TCGA-A2-A0CU-10A-01W-A055-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a9aa68af-f5fe-4ac0-987f-8af49b85c231	f41d6d14-ad4f-49d5-a4fb-6bdd1b6dbddc	g.chr7:77379331T>G	ENST00000334955.8	+	3	1321	c.1294T>G	c.(1294-1296)Ttg>Gtg	p.L432V	RSBN1L_ENST00000445288.1_Missense_Mutation_p.L162V	NM_198467.2	NP_940869.2	Q6PCB5	RSBNL_HUMAN	round spermatid basic protein 1-like	432						nucleus (GO:0005634)		p.L432V(11)		central_nervous_system(1)|endometrium(12)|large_intestine(2)|lung(8)|ovary(2)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	30						AATGGAGATATTGGGAAAGAA	0.303																																						dbGAP											11	Substitution - Missense(11)	endometrium(10)|central_nervous_system(1)											80.0	74.0	76.0					7																	77379331		1801	4064	5865	-	-	-	SO:0001583	missense	0			AK124517	CCDS43607.1	7q21.11	2004-08-11			ENSG00000187257	ENSG00000187257			24765	protein-coding gene	gene with protein product						12477932	Standard	NM_198467		Approved	FLJ42526, FLJ45813, MGC71764	uc010ldt.1	Q6PCB5	OTTHUMG00000155517	ENST00000334955.8:c.1294T>G	7.37:g.77379331T>G	ENSP00000334040:p.Leu432Val	Somatic		WXS	Illumina GAIIx	Phase_IV	C9K0P1|Q6ZS58|Q6ZVI9|Q86X48	Missense_Mutation	SNP	NULL	p.L432V	ENST00000334955.8	37	c.1294	CCDS43607.1	7	.	.	.	.	.	.	.	.	.	.	T	17.88	3.498192	0.64186	.	.	ENSG00000187257	ENST00000334955;ENST00000445288	.	.	.	5.95	0.807	0.18714	.	0.000000	0.85682	D	0.000000	T	0.61702	0.2368	M	0.80982	2.52	0.46542	D	0.999093	P	0.45396	0.857	P	0.49332	0.607	T	0.60667	-0.7218	9	0.87932	D	0	-9.3611	5.4527	0.16574	0.1185:0.1929:0.0:0.6886	.	432	Q6PCB5	RSBNL_HUMAN	V	432;162	.	ENSP00000334040:L432V	L	+	1	2	RSBN1L	77217267	1.000000	0.71417	0.997000	0.53966	0.993000	0.82548	1.482000	0.35486	0.176000	0.19873	0.533000	0.62120	TTG	RSBN1L	-	NULL	ENSG00000187257		0.303	RSBN1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RSBN1L	HGNC	protein_coding	OTTHUMT00000340455.3	88	0.00	0	T	NM_198467		77379331	77379331	+1	no_errors	ENST00000334955	ensembl	human	known	69_37n	missense	33	31.25	15	SNP	0.992	G
SLC25A5	292	genome.wustl.edu	37	X	118603962	118603962	+	Frame_Shift_Del	DEL	T	T	-			TCGA-A2-A0CU-01A-12W-A050-09	TCGA-A2-A0CU-10A-01W-A055-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a9aa68af-f5fe-4ac0-987f-8af49b85c231	f41d6d14-ad4f-49d5-a4fb-6bdd1b6dbddc	g.chrX:118603962delT	ENST00000317881.8	+	2	566	c.450delT	c.(448-450)gctfs	p.A150fs	SLC25A5-AS1_ENST00000446986.1_RNA|SLC25A5_ENST00000460013.1_3'UTR	NM_001152.4	NP_001143.2	P05141	ADT2_HUMAN	solute carrier family 25 (mitochondrial carrier; adenine nucleotide translocator), member 5	150					adenine transport (GO:0015853)|chromosome segregation (GO:0007059)|energy reserve metabolic process (GO:0006112)|negative regulation of mitochondrial outer membrane permeabilization involved in apoptotic signaling pathway (GO:1901029)|positive regulation of cell proliferation (GO:0008284)|regulation of insulin secretion (GO:0050796)|small molecule metabolic process (GO:0044281)|transport (GO:0006810)|viral process (GO:0016032)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|mitochondrial inner membrane (GO:0005743)|mitochondrial nucleoid (GO:0042645)|mitochondrion (GO:0005739)|MMXD complex (GO:0071817)|nucleus (GO:0005634)	adenine transmembrane transporter activity (GO:0015207)|poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(3)|ovary(1)|prostate(1)|stomach(2)	12					Clodronate(DB00720)	AAGCTGGAGCTGAAAGGGAAT	0.537																																						dbGAP											0													83.0	85.0	84.0					X																	118603962		2203	4300	6503	-	-	-	SO:0001589	frameshift_variant	0			BC068199	CCDS14578.1	Xq24	2013-08-09			ENSG00000005022	ENSG00000005022		"""Solute carriers"""	10991	protein-coding gene	gene with protein product		300150		ANT2		2168878, 2829183	Standard	NM_001152		Approved	T2, 2F1, T3	uc004erh.4	P05141	OTTHUMG00000022715	ENST00000317881.8:c.450delT	X.37:g.118603962delT	ENSP00000360671:p.Ala150fs	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RCV1|O43350	Frame_Shift_Del	DEL	pfam_Mitochondrial_sb/sol_carrier,superfamily_Mt_carrier_dom,pfscan_Mitochondrial_sb/sol_carrier,prints_Mit_carrier,prints_Aden_trnslctor	p.E151fs	ENST00000317881.8	37	c.450	CCDS14578.1	X																																																																																			SLC25A5	-	pfam_Mitochondrial_sb/sol_carrier,superfamily_Mt_carrier_dom,pfscan_Mitochondrial_sb/sol_carrier	ENSG00000005022		0.537	SLC25A5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC25A5	HGNC	protein_coding	OTTHUMT00000058952.2	54	0.00	0	T	NM_001152		118603962	118603962	+1	no_errors	ENST00000317881	ensembl	human	known	69_37n	frame_shift_del	50	13.79	8	DEL	0.913	-
SOCS7	30837	genome.wustl.edu	37	17	36522192	36522192	+	Silent	SNP	C	C	T			TCGA-A2-A0CU-01A-12W-A050-09	TCGA-A2-A0CU-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a9aa68af-f5fe-4ac0-987f-8af49b85c231	f41d6d14-ad4f-49d5-a4fb-6bdd1b6dbddc	g.chr17:36522192C>T	ENST00000577233.1	+	5	1083	c.1083C>T	c.(1081-1083)ccC>ccT	p.P361P	SOCS7_ENST00000331159.5_Silent_p.P327P	NM_014598.2	NP_055413.1	O14512	SOCS7_HUMAN	suppressor of cytokine signaling 7	361	Mediates interaction with SORBS3.				fat cell differentiation (GO:0045444)|insulin receptor signaling pathway (GO:0008286)|intracellular signal transduction (GO:0035556)|negative regulation of signal transduction (GO:0009968)|protein ubiquitination (GO:0016567)|regulation of growth (GO:0040008)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nucleolus (GO:0005730)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	SH3 domain binding (GO:0017124)			central_nervous_system(1)|endometrium(1)|kidney(1)|prostate(1)|skin(5)	9	Breast(7;3.47e-17)					GGATTGCTCCCATCCGAGCAG	0.577																																						dbGAP											0													79.0	68.0	72.0					17																	36522192		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB005216	CCDS32637.1	17q12	2014-08-12			ENSG00000274211	ENSG00000274211		"""Suppressors of cytokine signaling"", ""SH2 domain containing"""	29846	protein-coding gene	gene with protein product	"""Nck, Ash and phospholipase C binding protein"", ""NCK-associated protein 4"""	608788				9344857, 12076535	Standard	XM_005257264		Approved	NAP4, NCKAP4	uc002hqa.3	O14512	OTTHUMG00000188546	ENST00000577233.1:c.1083C>T	17.37:g.36522192C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A2VCU2|Q0IJ63	Missense_Mutation	SNP	pfam_SH2,smart_SH2,pfscan_SH2	p.H60Y	ENST00000577233.1	37	c.178	CCDS32637.1	17																																																																																			SOCS7	-	NULL	ENSG00000174111		0.577	SOCS7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SOCS7	HGNC	protein_coding	OTTHUMT00000440486.4	133	0.00	0	C	XM_371052		36522192	36522192	+1	no_start_codon:pseudogene:no_stop_codon	ENST00000580660	ensembl	human	putative	69_37n	missense	87	33.59	44	SNP	0.997	T
SPNS1	83985	genome.wustl.edu	37	16	28986519	28986519	+	Missense_Mutation	SNP	C	C	G			TCGA-A2-A0CU-01A-12W-A050-09	TCGA-A2-A0CU-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a9aa68af-f5fe-4ac0-987f-8af49b85c231	f41d6d14-ad4f-49d5-a4fb-6bdd1b6dbddc	g.chr16:28986519C>G	ENST00000311008.11	+	1	424	c.47C>G	c.(46-48)cCg>cGg	p.P16R	RP11-264B17.3_ENST00000569969.1_RNA|SPNS1_ENST00000565975.1_Missense_Mutation_p.P61R|RP11-264B17.4_ENST00000567209.1_RNA|SPNS1_ENST00000334536.8_Missense_Mutation_p.P16R|SPNS1_ENST00000352260.7_Missense_Mutation_p.P16R|SPNS1_ENST00000323081.8_5'UTR	NM_032038.2	NP_114427.1	Q9H2V7	SPNS1_HUMAN	spinster homolog 1 (Drosophila)	16					lipid transport (GO:0006869)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|mitochondrial inner membrane (GO:0005743)				cervix(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(9)|prostate(1)|skin(2)|urinary_tract(1)	21						GCGGATGACCCGGACGACGGG	0.766																																						dbGAP											0													4.0	5.0	5.0					16																	28986519		1962	3942	5904	-	-	-	SO:0001583	missense	0			BC006156	CCDS10646.1, CCDS45452.1, CCDS45453.1, CCDS45454.1	16p11.2	2007-04-12			ENSG00000169682	ENSG00000169682			30621	protein-coding gene	gene with protein product		612583				11340170, 12815463	Standard	NM_032038		Approved	HSpin1, nrs, SPINL, PP2030, SPIN1, LAT	uc010vdi.1	Q9H2V7	OTTHUMG00000131762	ENST00000311008.11:c.47C>G	16.37:g.28986519C>G	ENSP00000309945:p.Pro16Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	B5MDM9|Q6P182|Q71RB5|Q7L541|Q86VU7|Q8N953|Q8TCS5|Q9BRN5	Missense_Mutation	SNP	pfam_MFS,pfam_Sub_transporter,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom	p.P16R	ENST00000311008.11	37	c.47	CCDS10646.1	16	.	.	.	.	.	.	.	.	.	.	C	17.24	3.339146	0.60963	.	.	ENSG00000169682	ENST00000311008;ENST00000334536;ENST00000352260	T;T;T	0.30448	1.97;1.57;1.53	4.47	4.47	0.54385	.	0.371511	0.25935	N	0.027350	T	0.17450	0.0419	N	0.14661	0.345	0.30001	N	0.816008	B;B;B;P	0.36789	0.044;0.026;0.095;0.57	B;B;B;B	0.34038	0.019;0.026;0.062;0.174	T	0.07849	-1.0751	10	0.30078	T	0.28	.	12.8117	0.57643	0.0:1.0:0.0:0.0	.	16;16;16;16	Q9H2V7-3;Q9H2V7;Q9H2V7-2;Q9H2V7-5	.;SPNS1_HUMAN;.;.	R	16	ENSP00000309945:P16R;ENSP00000335494:P16R;ENSP00000306050:P16R	ENSP00000309945:P16R	P	+	2	0	SPNS1	28894020	1.000000	0.71417	1.000000	0.80357	0.937000	0.57800	2.964000	0.49192	2.462000	0.83206	0.561000	0.74099	CCG	SPNS1	-	NULL	ENSG00000169682		0.766	SPNS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPNS1	HGNC	protein_coding	OTTHUMT00000254690.2	36	0.00	0	C	NM_032038		28986519	28986519	+1	no_errors	ENST00000311008	ensembl	human	known	69_37n	missense	34	19.05	8	SNP	0.998	G
SRCAP	10847	genome.wustl.edu	37	16	30722123	30722123	+	Missense_Mutation	SNP	C	C	T			TCGA-A2-A0CU-01A-12W-A050-09	TCGA-A2-A0CU-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a9aa68af-f5fe-4ac0-987f-8af49b85c231	f41d6d14-ad4f-49d5-a4fb-6bdd1b6dbddc	g.chr16:30722123C>T	ENST00000262518.4	+	9	1568	c.1183C>T	c.(1183-1185)Cat>Tat	p.H395Y	SNORA30_ENST00000384028.1_RNA|SRCAP_ENST00000395059.2_Missense_Mutation_p.H395Y|SRCAP_ENST00000344771.4_Missense_Mutation_p.H395Y	NM_006662.2	NP_006653.2	Q6ZRS2	SRCAP_HUMAN	Snf2-related CREBBP activator protein	395	Glu-rich.				histone acetylation (GO:0016573)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|protein complex (GO:0043234)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|histone acetyltransferase activity (GO:0004402)|transcription coactivator activity (GO:0003713)			NS(1)|breast(3)|cervix(3)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(22)|liver(3)|lung(62)|ovary(6)|pancreas(1)|prostate(4)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(5)	136			Colorectal(24;0.198)			ACAGCCTTGGCATCCAGATGA	0.478																																						dbGAP											0													137.0	117.0	124.0					16																	30722123		2197	4300	6497	-	-	-	SO:0001583	missense	0			AB002307	CCDS10689.2	16p11.2	2009-08-06			ENSG00000080603	ENSG00000080603			16974	protein-coding gene	gene with protein product	"""Swi2/Snf2-related ATPase homolog (S. cerevisiae)"", ""domino homolog 1 (Drosophila)"""	611421				10347196, 9205841	Standard	NM_006662		Approved	KIAA0309, EAF1, SWR1, DOMO1	uc002dze.1	Q6ZRS2	OTTHUMG00000132393	ENST00000262518.4:c.1183C>T	16.37:g.30722123C>T	ENSP00000262518:p.His395Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV	B0JZA6|O15026|Q7Z744|Q9Y5L9	Missense_Mutation	SNP	pfam_SNF2_N,pfam_HSA,pfam_Helicase_C,smart_HAS_subgr,smart_Helicase_ATP-bd,smart_Helicase_C,smart_AT_hook_DNA-bd_motif,pfscan_Helicase/SANT-assoc_DNA-bd,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,prints_AT_hook-like	p.H395Y	ENST00000262518.4	37	c.1183	CCDS10689.2	16	.	.	.	.	.	.	.	.	.	.	C	13.37	2.216058	0.39201	.	.	ENSG00000080603	ENST00000262518;ENST00000395059;ENST00000344771	D;D;D	0.90900	-2.75;-2.71;-2.71	5.81	5.81	0.92471	.	0.099947	0.45361	D	0.000374	D	0.88005	0.6321	L	0.36672	1.1	0.32552	N	0.532221	P;B	0.34757	0.467;0.337	B;B	0.41036	0.346;0.188	D	0.90374	0.4383	10	0.54805	T	0.06	-7.3347	12.5465	0.56203	0.1661:0.8339:0.0:0.0	.	395;395	Q6ZRS2-2;Q6ZRS2	.;SRCAP_HUMAN	Y	395	ENSP00000262518:H395Y;ENSP00000378499:H395Y;ENSP00000343042:H395Y	ENSP00000262518:H395Y	H	+	1	0	SRCAP	30629624	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	2.666000	0.46799	2.756000	0.94617	0.655000	0.94253	CAT	SRCAP	-	NULL	ENSG00000080603		0.478	SRCAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SRCAP	HGNC	protein_coding	OTTHUMT00000255523.1	357	0.00	0	C	NM_006662		30722123	30722123	+1	no_errors	ENST00000262518	ensembl	human	known	69_37n	missense	301	15.21	54	SNP	1.000	T
TMEM233	387890	genome.wustl.edu	37	12	120031840	120031840	+	Splice_Site	SNP	G	G	A			TCGA-A2-A0CU-01A-12W-A050-09	TCGA-A2-A0CU-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a9aa68af-f5fe-4ac0-987f-8af49b85c231	f41d6d14-ad4f-49d5-a4fb-6bdd1b6dbddc	g.chr12:120031840G>A	ENST00000426426.1	+	1	576		c.e1+1		RP11-768F21.1_ENST00000509470.2_lincRNA|TMEM233_ENST00000453450.2_Splice_Site	NM_001136534.1	NP_001130006.1	B4DJY2	TM233_HUMAN	transmembrane protein 233						response to biotic stimulus (GO:0009607)	integral component of membrane (GO:0016021)				endometrium(1)	1						TTCCATCATGGTGAGTGAATC	0.617																																						dbGAP											0													368.0	300.0	320.0					12																	120031840		692	1591	2283	-	-	-	SO:0001630	splice_region_variant	0				CCDS44995.1	12q24.23	2009-10-16			ENSG00000224982	ENSG00000224982			37219	protein-coding gene	gene with protein product	"""interferon induced transmembrane protein domain containing 2"""						Standard	NM_001136534		Approved	IFITMD2	uc010szd.1	B4DJY2	OTTHUMG00000168944	ENST00000426426.1:c.186+1G>A	12.37:g.120031840G>A		Somatic		WXS	Illumina GAIIx	Phase_IV		Splice_Site	SNP	-	e1+1	ENST00000426426.1	37	c.186+1	CCDS44995.1	12	.	.	.	.	.	.	.	.	.	.	G	17.19	3.327640	0.60743	.	.	ENSG00000224982	ENST00000426426	.	.	.	4.09	4.09	0.47781	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.5388	0.84380	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	TMEM233	118516223	1.000000	0.71417	1.000000	0.80357	0.724000	0.41520	7.754000	0.85163	2.134000	0.65973	0.555000	0.69702	.	TMEM233	-	-	ENSG00000224982		0.617	TMEM233-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM233	HGNC	protein_coding	OTTHUMT00000401684.1	365	0.00	0	G	NM_001136534	Intron	120031840	120031840	+1	no_errors	ENST00000426426	ensembl	human	known	69_37n	splice_site	315	21.00	84	SNP	1.000	A
TMPRSS11B	132724	genome.wustl.edu	37	4	69094493	69094493	+	Silent	SNP	A	A	T			TCGA-A2-A0CU-01A-12W-A050-09	TCGA-A2-A0CU-10A-01W-A055-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a9aa68af-f5fe-4ac0-987f-8af49b85c231	f41d6d14-ad4f-49d5-a4fb-6bdd1b6dbddc	g.chr4:69094493A>T	ENST00000332644.5	-	9	1217	c.1056T>A	c.(1054-1056)gcT>gcA	p.A352A		NM_182502.3	NP_872308.2	Q86T26	TM11B_HUMAN	transmembrane protease, serine 11B	352	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.					extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	serine-type endopeptidase activity (GO:0004252)			breast(1)|endometrium(4)|kidney(1)|large_intestine(5)|lung(14)|ovary(1)|skin(1)	27						ACATAAATCCAGCACATAACA	0.353																																						dbGAP											0													137.0	124.0	129.0					4																	69094493		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			BX537945	CCDS3521.1	4q13.2	2010-04-13			ENSG00000185873	ENSG00000185873		"""Serine peptidases / Transmembrane"""	25398	protein-coding gene	gene with protein product							Standard	NM_182502		Approved		uc003hdw.4	Q86T26	OTTHUMG00000129301	ENST00000332644.5:c.1056T>A	4.37:g.69094493A>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K4D9	Silent	SNP	pirsf_Pept_S1A_HAT/DESC1,pfam_Peptidase_S1_S6,pfam_SEA,superfamily_Pept_cys/ser_Trypsin-like,smart_Peptidase_S1_S6,prints_Peptidase_S1A,pfscan_SEA,pfscan_Peptidase_S1_S6	p.A352	ENST00000332644.5	37	c.1056	CCDS3521.1	4																																																																																			TMPRSS11B	-	pirsf_Pept_S1A_HAT/DESC1,pfam_Peptidase_S1_S6,superfamily_Pept_cys/ser_Trypsin-like,smart_Peptidase_S1_S6,pfscan_Peptidase_S1_S6	ENSG00000185873		0.353	TMPRSS11B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMPRSS11B	HGNC	protein_coding	OTTHUMT00000251431.2	188	0.53	1	A	NM_182502		69094493	69094493	-1	no_errors	ENST00000332644	ensembl	human	known	69_37n	silent	92	10.68	11	SNP	0.998	T
WIF1	11197	genome.wustl.edu	37	12	65460458	65460458	+	Missense_Mutation	SNP	G	G	C			TCGA-A2-A0CU-01A-12W-A050-09	TCGA-A2-A0CU-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a9aa68af-f5fe-4ac0-987f-8af49b85c231	f41d6d14-ad4f-49d5-a4fb-6bdd1b6dbddc	g.chr12:65460458G>C	ENST00000286574.4	-	6	1067	c.693C>G	c.(691-693)atC>atG	p.I231M		NM_007191.4	NP_009122.2	Q9Y5W5	WIF1_HUMAN	WNT inhibitory factor 1	231	EGF-like 2. {ECO:0000255|PROSITE- ProRule:PRU00076}.				multicellular organismal development (GO:0007275)|positive regulation of fat cell differentiation (GO:0045600)|signal transduction (GO:0007165)|Wnt signaling pathway (GO:0016055)	extracellular region (GO:0005576)				cervix(1)|large_intestine(4)|lung(10)|ovary(3)|skin(1)|stomach(1)|urinary_tract(1)	21			LUAD - Lung adenocarcinoma(6;0.0234)|LUSC - Lung squamous cell carcinoma(43;0.0975)	GBM - Glioblastoma multiforme(28;0.0231)		CAGGTGGGCAGATGCAGAAAC	0.378			T	HMGA2	pleomorphic salivary gland adenoma																																Esophageal Squamous(148;1595 1816 48559 49439 49664)	dbGAP		Dom	yes		12	12q14.3	11197	WNT inhibitory factor 1		E	0													89.0	86.0	87.0					12																	65460458		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF122922	CCDS8971.1	12q14.2	2008-04-11			ENSG00000156076	ENSG00000156076			18081	protein-coding gene	gene with protein product		605186				10201374	Standard	NM_007191		Approved		uc001ssk.3	Q9Y5W5	OTTHUMG00000168832	ENST00000286574.4:c.693C>G	12.37:g.65460458G>C	ENSP00000286574:p.Ile231Met	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6UXI1|Q8WVG4	Missense_Mutation	SNP	pfam_WIF,pfam_EGF_extracell,smart_WIF,smart_EGF-like,pfscan_EG-like_dom,pfscan_WIF,prints_Wnt-inh	p.I231M	ENST00000286574.4	37	c.693	CCDS8971.1	12	.	.	.	.	.	.	.	.	.	.	G	15.91	2.972795	0.53614	.	.	ENSG00000156076	ENST00000286574	T	0.03689	3.84	4.99	3.16	0.36331	Epidermal growth factor-like (1);EGF-like region, conserved site (2);Epidermal growth factor-like, type 3 (1);	0.057977	0.64402	D	0.000003	T	0.04452	0.0122	L	0.39020	1.185	0.50632	D	0.999887	B	0.32188	0.359	B	0.36989	0.238	T	0.52003	-0.8633	9	.	.	.	.	11.8363	0.52325	0.1447:0.0:0.8553:0.0	.	231	Q9Y5W5	WIF1_HUMAN	M	231	ENSP00000286574:I231M	.	I	-	3	3	WIF1	63746725	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.058000	0.49939	0.783000	0.33636	0.655000	0.94253	ATC	WIF1	-	pfam_EGF_extracell,smart_EGF-like,pfscan_EG-like_dom	ENSG00000156076		0.378	WIF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WIF1	HGNC	protein_coding	OTTHUMT00000401258.2	127	0.00	0	G			65460458	65460458	-1	no_errors	ENST00000286574	ensembl	human	known	69_37n	missense	150	11.24	19	SNP	1.000	C
YIPF7	285525	genome.wustl.edu	37	4	44626756	44626756	+	Missense_Mutation	SNP	A	A	T			TCGA-A2-A0CU-01A-12W-A050-09	TCGA-A2-A0CU-10A-01W-A055-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a9aa68af-f5fe-4ac0-987f-8af49b85c231	f41d6d14-ad4f-49d5-a4fb-6bdd1b6dbddc	g.chr4:44626756A>T	ENST00000332990.5	-	5	558	c.542T>A	c.(541-543)aTt>aAt	p.I181N	YIPF7_ENST00000415895.4_Missense_Mutation_p.I157N	NM_182592.2	NP_872398.2	Q8N8F6	YIPF7_HUMAN	Yip1 domain family, member 7	181						endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)				breast(1)|large_intestine(1)|lung(9)|upper_aerodigestive_tract(1)	12						AAGGCAGCCAATGGCACTCAT	0.507																																						dbGAP											0													64.0	69.0	67.0					4																	44626756		2061	4199	6260	-	-	-	SO:0001583	missense	0			AK096895	CCDS54766.1	4p13	2008-08-07			ENSG00000177752	ENSG00000177752		"""Yip1 domain family"""	26825	protein-coding gene	gene with protein product							Standard	NM_182592		Approved	FLJ39576, FinGER9	uc021xnx.1	Q8N8F6	OTTHUMG00000160467	ENST00000332990.5:c.542T>A	4.37:g.44626756A>T	ENSP00000332772:p.Ile181Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	Q3SY21|Q3SY22	Missense_Mutation	SNP	pfam_Yip1	p.I181N	ENST00000332990.5	37	c.542	CCDS54766.1	4	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	17.50|17.50	3.405726|3.405726	0.62288|0.62288	.|.	.|.	ENSG00000177752|ENSG00000177752	ENST00000415895|ENST00000332990	.|T	.|0.52754	.|0.65	5.1|5.1	3.92|3.92	0.45320|0.45320	.|Yip1 domain (1);	.|.	.|.	.|.	.|.	T|T	0.63022|0.63022	0.2476|0.2476	M|M	0.73217|0.73217	2.22|2.22	0.30391|0.30391	N|N	0.780957|0.780957	.|P	.|0.44195	.|0.828	.|P	.|0.60345	.|0.873	T|T	0.63193|0.63193	-0.6692|-0.6692	5|9	.|0.87932	.|D	.|0	-15.0468|-15.0468	8.8792|8.8792	0.35365|0.35365	0.8428:0.0:0.1572:0.0|0.8428:0.0:0.1572:0.0	.|.	.|181	.|Q8N8F6	.|YIPF7_HUMAN	Q|N	157|181	.|ENSP00000332772:I181N	.|ENSP00000332772:I181N	H|I	-|-	3|2	2|0	YIPF7|YIPF7	44321513|44321513	1.000000|1.000000	0.71417|0.71417	0.951000|0.951000	0.38953|0.38953	0.667000|0.667000	0.39255|0.39255	6.055000|6.055000	0.71103|0.71103	0.963000|0.963000	0.38082|0.38082	0.533000|0.533000	0.62120|0.62120	CAT|ATT	YIPF7	-	pfam_Yip1	ENSG00000177752		0.507	YIPF7-201	KNOWN	basic|CCDS	protein_coding	YIPF7	HGNC	protein_coding		219	0.00	0	A	NM_182592		44626756	44626756	-1	no_errors	ENST00000332990	ensembl	human	known	69_37n	missense	131	16.03	25	SNP	0.999	T
ZNF362	149076	genome.wustl.edu	37	1	33745932	33745933	+	Frame_Shift_Ins	INS	-	-	C			TCGA-A2-A0CU-01A-12W-A050-09	TCGA-A2-A0CU-10A-01W-A055-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a9aa68af-f5fe-4ac0-987f-8af49b85c231	f41d6d14-ad4f-49d5-a4fb-6bdd1b6dbddc	g.chr1:33745932_33745933insC	ENST00000539719.1	+	5	727_728	c.557_558insC	c.(556-561)ggccccfs	p.GP186fs	ZNF362_ENST00000373428.5_Frame_Shift_Ins_p.GP186fs	NM_152493.2	NP_689706.2	Q5T0B9	ZN362_HUMAN	zinc finger protein 362	186					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(3)|kidney(1)|large_intestine(4)|lung(2)	10		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.211)				GGCCTGCTTGGCCCCCCCAAGT	0.658																																					Pancreas(162;1431 2676 35353 38425)	dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0				CCDS377.1	1p35.1	2013-01-08			ENSG00000160094	ENSG00000160094		"""Zinc fingers, C2H2-type"""	18079	protein-coding gene	gene with protein product	"""rotund homolog (Drosophila)"""						Standard	NM_152493		Approved	FLJ25476, lin-29, RN	uc001bxc.1	Q5T0B9	OTTHUMG00000004124	ENST00000539719.1:c.564dupC	1.37:g.33745939_33745939dupC	ENSP00000446335:p.Gly186fs	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8WYU4	Frame_Shift_Ins	INS	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.K189fs	ENST00000539719.1	37	c.557_558	CCDS377.1	1																																																																																			ZNF362	-	NULL	ENSG00000160094		0.658	ZNF362-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF362	HGNC	protein_coding	OTTHUMT00000011857.2	32	0.00	0	-	NM_152493		33745932	33745933	+1	no_errors	ENST00000373428	ensembl	human	known	69_37n	frame_shift_ins	47	11.32	6	INS	1.000:1.000	C
ZNF486	90649	genome.wustl.edu	37	19	20307906	20307906	+	Silent	SNP	G	G	T	rs112152275		TCGA-A2-A0CU-01A-12W-A050-09	TCGA-A2-A0CU-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a9aa68af-f5fe-4ac0-987f-8af49b85c231	f41d6d14-ad4f-49d5-a4fb-6bdd1b6dbddc	g.chr19:20307906G>T	ENST00000335117.8	+	4	444	c.387G>T	c.(385-387)gtG>gtT	p.V129V	CTC-260E6.6_ENST00000585498.1_RNA|CTC-260E6.6_ENST00000586657.1_RNA|CTC-260E6.6_ENST00000593655.1_RNA	NM_052852.3	NP_443084.2	Q96H40	ZN486_HUMAN	zinc finger protein 486	129					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(3)|large_intestine(3)|lung(3)|ovary(1)|upper_aerodigestive_tract(1)	11						GTGAAAGTGTGGATGAGTGTA	0.333																																						dbGAP											0													84.0	90.0	88.0					19																	20307906		2174	4291	6465	-	-	-	SO:0001819	synonymous_variant	0			BC008936	CCDS46029.1	19p12	2014-02-13	2003-12-16	2003-12-17	ENSG00000256229	ENSG00000256229		"""Zinc fingers, C2H2-type"", ""-"""	20807	protein-coding gene	gene with protein product			"""KRAB domain only 2"""	KRBO2			Standard	NM_052852		Approved	MGC2396	uc002nou.3	Q96H40	OTTHUMG00000179731	ENST00000335117.8:c.387G>T	19.37:g.20307906G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q0VG00	Silent	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.V129	ENST00000335117.8	37	c.387	CCDS46029.1	19																																																																																			ZNF486	-	NULL	ENSG00000256229		0.333	ZNF486-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF486	HGNC	protein_coding	OTTHUMT00000447843.2	63	0.00	0	G	NM_052852		20307906	20307906	+1	no_errors	ENST00000335117	ensembl	human	known	69_37n	silent	99	19.51	24	SNP	0.982	T
