#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
ABCA3	21	genome.wustl.edu	37	16	2336930	2336930	+	Missense_Mutation	SNP	C	C	G			TCGA-A2-A0D0-01A-11W-A019-09	TCGA-A2-A0D0-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3f20d0fe-aaa1-40f1-b2c1-7f070f93aef5	bbf1c43d-d7b3-4574-a074-d22ad537829c	g.chr16:2336930C>G	ENST00000301732.5	-	22	3743	c.3043G>C	c.(3043-3045)Gag>Cag	p.E1015Q	ABCA3_ENST00000382381.3_Missense_Mutation_p.E957Q	NM_001089.2	NP_001080.2	Q99758	ABCA3_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 3	1015					response to drug (GO:0042493)|transmembrane transport (GO:0055085)|transport (GO:0006810)	alveolar lamellar body (GO:0097208)|alveolar lamellar body membrane (GO:0097233)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|transporter activity (GO:0005215)			breast(7)|central_nervous_system(4)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(11)|liver(1)|lung(20)|ovary(7)|prostate(5)|skin(6)|upper_aerodigestive_tract(1)	70		Ovarian(90;0.17)			Imatinib(DB00619)	CCGCCCCCCTCCACAGAAGCC	0.602																																						dbGAP											0													29.0	30.0	30.0					16																	2336930		2198	4300	6498	-	-	-	SO:0001583	missense	0			U78735	CCDS10466.1	16p13.3	2012-03-14			ENSG00000167972	ENSG00000167972		"""ATP binding cassette transporters / subfamily A"""	33	protein-coding gene	gene with protein product		601615		ABC3		8706931	Standard	NM_001089		Approved	ABC-C, EST111653, LBM180	uc002cpy.1	Q99758	OTTHUMG00000128845	ENST00000301732.5:c.3043G>C	16.37:g.2336930C>G	ENSP00000301732:p.Glu1015Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RU09|Q54A95|Q6P5P9|Q92473	Missense_Mutation	SNP	pfam_ABC_transporter-like,smart_AAA+_ATPase,pfscan_ABC_transporter-like	p.E1015Q	ENST00000301732.5	37	c.3043	CCDS10466.1	16	.	.	.	.	.	.	.	.	.	.	C	21.9	4.222848	0.79464	.	.	ENSG00000167972	ENST00000301732;ENST00000382381	D	0.87334	-2.24	4.65	4.65	0.58169	.	0.000000	0.85682	D	0.000000	D	0.88987	0.6587	M	0.73217	2.22	0.80722	D	1	B;P	0.42123	0.205;0.771	B;P	0.47528	0.139;0.549	D	0.87028	0.2133	10	0.25751	T	0.34	.	16.6353	0.85058	0.0:1.0:0.0:0.0	.	1019;1015	Q4LE27;Q99758	.;ABCA3_HUMAN	Q	1015;1019	ENSP00000301732:E1015Q	ENSP00000301732:E1015Q	E	-	1	0	ABCA3	2276931	1.000000	0.71417	1.000000	0.80357	0.859000	0.49053	5.476000	0.66793	2.569000	0.86673	0.643000	0.83706	GAG	ABCA3	-	NULL	ENSG00000167972		0.602	ABCA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABCA3	HGNC	protein_coding	OTTHUMT00000250784.2	22	0.00	0	C	NM_001089		2336930	2336930	-1	no_errors	ENST00000301732	ensembl	human	known	69_37n	missense	41	34.92	22	SNP	1.000	G
ARFGEF1	10565	genome.wustl.edu	37	8	68208734	68208734	+	Nonsense_Mutation	SNP	G	G	A			TCGA-A2-A0D0-01A-11W-A019-09	TCGA-A2-A0D0-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3f20d0fe-aaa1-40f1-b2c1-7f070f93aef5	bbf1c43d-d7b3-4574-a074-d22ad537829c	g.chr8:68208734G>A	ENST00000262215.3	-	5	960	c.571C>T	c.(571-573)Cag>Tag	p.Q191*		NM_006421.4	NP_006412.2	Q9Y6D6	BIG1_HUMAN	ADP-ribosylation factor guanine nucleotide-exchange factor 1 (brefeldin A-inhibited)	191	DCB; DCB:DCB domain and DCB:HUS domain interaction.				endomembrane system organization (GO:0010256)|exocytosis (GO:0006887)|Golgi organization (GO:0007030)|negative regulation of actin filament polymerization (GO:0030837)|negative regulation of Rho GTPase activity (GO:0034259)|positive regulation of GTPase activity (GO:0043547)|positive regulation of protein glycosylation in Golgi (GO:0090284)|positive regulation of wound healing (GO:0090303)|protein transport (GO:0015031)|regulation of ARF protein signal transduction (GO:0032012)|regulation of establishment of cell polarity (GO:2000114)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|nucleolus (GO:0005730)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|small nuclear ribonucleoprotein complex (GO:0030532)|trans-Golgi network (GO:0005802)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)|guanyl-nucleotide exchange factor activity (GO:0005085)|myosin binding (GO:0017022)|protein kinase A regulatory subunit binding (GO:0034237)			breast(1)|endometrium(14)|kidney(4)|large_intestine(17)|lung(20)|ovary(4)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	65	Breast(64;0.214)	Lung NSC(129;0.0908)|all_lung(136;0.152)	Epithelial(68;0.0043)|OV - Ovarian serous cystadenocarcinoma(28;0.00578)|all cancers(69;0.0173)|BRCA - Breast invasive adenocarcinoma(89;0.206)			GCTGTTGTCTGATTGATGAGA	0.378																																						dbGAP											0													221.0	196.0	205.0					8																	68208734		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AF084520	CCDS6199.1	8q13	2011-08-18	2011-08-18		ENSG00000066777	ENSG00000066777			15772	protein-coding gene	gene with protein product		604141				10212200, 8917509	Standard	NM_006421		Approved	DKFZP434L057, BIG1, ARFGEP1, p200	uc003xxo.2	Q9Y6D6	OTTHUMG00000164626	ENST00000262215.3:c.571C>T	8.37:g.68208734G>A	ENSP00000262215:p.Gln191*	Somatic		WXS	Illumina GAIIx	Phase_IV	Q9NV46|Q9UFV2|Q9UNL0	Nonsense_Mutation	SNP	pfam_Sec7,pfam_DUF1981_SEC7_assoc,superfamily_Sec7,superfamily_ARM-type_fold,smart_Sec7,pfscan_Sec7	p.Q191*	ENST00000262215.3	37	c.571	CCDS6199.1	8	.	.	.	.	.	.	.	.	.	.	G	40	8.297832	0.98747	.	.	ENSG00000066777	ENST00000262215	.	.	.	5.04	5.04	0.67666	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.72032	D	0.01	.	18.4027	0.90522	0.0:0.0:1.0:0.0	.	.	.	.	X	191	.	ENSP00000262215:Q191X	Q	-	1	0	ARFGEF1	68371288	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.645000	0.98471	2.350000	0.79820	0.585000	0.79938	CAG	ARFGEF1	-	superfamily_ARM-type_fold	ENSG00000066777		0.378	ARFGEF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARFGEF1	HGNC	protein_coding	OTTHUMT00000379441.4	208	0.00	0	G	NM_006421		68208734	68208734	-1	no_errors	ENST00000262215	ensembl	human	known	69_37n	nonsense	674	32.47	326	SNP	1.000	A
ARSK	153642	genome.wustl.edu	37	5	94939216	94939216	+	Missense_Mutation	SNP	C	C	G			TCGA-A2-A0D0-01A-11W-A019-09	TCGA-A2-A0D0-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3f20d0fe-aaa1-40f1-b2c1-7f070f93aef5	bbf1c43d-d7b3-4574-a074-d22ad537829c	g.chr5:94939216C>G	ENST00000380009.4	+	8	1802	c.1597C>G	c.(1597-1599)Cca>Gca	p.P533A		NM_198150.2	NP_937793.1	Q6UWY0	ARSK_HUMAN	arylsulfatase family, member K	533					cellular protein metabolic process (GO:0044267)|glycosphingolipid metabolic process (GO:0006687)|post-translational protein modification (GO:0043687)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)	endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)	arylsulfatase activity (GO:0004065)|metal ion binding (GO:0046872)			endometrium(2)|kidney(1)|large_intestine(3)|lung(8)|pancreas(1)|skin(1)	16		all_cancers(142;3.38e-06)|all_epithelial(76;6.57e-09)|all_lung(232;0.00307)|Lung NSC(167;0.00452)|Ovarian(225;0.00473)		all cancers(79;6.5e-16)		CCATATGAATCCAAGAGCAGT	0.303																																						dbGAP											0													38.0	38.0	38.0					5																	94939216		2203	4299	6502	-	-	-	SO:0001583	missense	0				CCDS4073.1	5q15	2013-02-14	2006-03-07		ENSG00000164291	ENSG00000164291		"""Arylsulfatase family"""	25239	protein-coding gene	gene with protein product		610011	"""arylsulfatase K"""			12975309, 16174644	Standard	NM_198150		Approved	DKFZp313G1735, TSULF	uc003kld.3	Q6UWY0	OTTHUMG00000121166	ENST00000380009.4:c.1597C>G	5.37:g.94939216C>G	ENSP00000369346:p.Pro533Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	A2BDE3|B4E1I4|Q3ZCW3|Q8N3Q8	Missense_Mutation	SNP	pfam_Sulfatase,superfamily_Alkaline_phosphatase_core	p.P533A	ENST00000380009.4	37	c.1597	CCDS4073.1	5	.	.	.	.	.	.	.	.	.	.	C	6.344	0.431662	0.12045	.	.	ENSG00000164291	ENST00000380009	D	0.98234	-4.81	5.34	-4.82	0.03171	.	1.526730	0.03754	N	0.257001	D	0.93779	0.8011	L	0.44542	1.39	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	D	0.89069	0.3468	10	0.02654	T	1	0.1729	2.1177	0.03718	0.3714:0.2159:0.2797:0.133	.	533	Q6UWY0	ARSK_HUMAN	A	533	ENSP00000369346:P533A	ENSP00000369346:P533A	P	+	1	0	ARSK	94964972	0.142000	0.22610	0.000000	0.03702	0.030000	0.12068	0.863000	0.27913	-0.828000	0.04273	-0.176000	0.13171	CCA	ARSK	-	NULL	ENSG00000164291		0.303	ARSK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARSK	HGNC	protein_coding	OTTHUMT00000241652.2	104	0.00	0	C	NM_198150		94939216	94939216	+1	no_errors	ENST00000380009	ensembl	human	known	69_37n	missense	26	42.22	19	SNP	0.000	G
ASTL	431705	genome.wustl.edu	37	2	96795705	96795705	+	Missense_Mutation	SNP	G	G	C			TCGA-A2-A0D0-01A-11W-A019-09	TCGA-A2-A0D0-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3f20d0fe-aaa1-40f1-b2c1-7f070f93aef5	bbf1c43d-d7b3-4574-a074-d22ad537829c	g.chr2:96795705G>C	ENST00000342380.2	-	8	731	c.732C>G	c.(730-732)agC>agG	p.S244R		NM_001002036.3	NP_001002036.3			astacin-like metallo-endopeptidase (M12 family)											endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(13)|ovary(1)|prostate(1)|skin(2)	30						GCCCACGCCGGCTGAAGGCGA	0.652																																						dbGAP											0													56.0	63.0	61.0					2																	96795705		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ537600	CCDS33249.1	2q11.1	2014-07-23	2006-10-10		ENSG00000188886	ENSG00000188886	3.4.24.21		31704	protein-coding gene	gene with protein product	"""sperm acrosomal SLLP1 binding"""	608860	"""astacin-like metalloendopeptidase (M12 family)"""			15087446	Standard	NM_001002036		Approved	ovastacin, SAS1B	uc010yui.2	Q6HA08	OTTHUMG00000155212	ENST00000342380.2:c.732C>G	2.37:g.96795705G>C	ENSP00000343674:p.Ser244Arg	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Peptidase_M12A,smart_Peptidase_Metallo,prints_Peptidase_M12A	p.S244R	ENST00000342380.2	37	c.732	CCDS33249.1	2	.	.	.	.	.	.	.	.	.	.	G	15.96	2.988126	0.53934	.	.	ENSG00000188886	ENST00000342380	T	0.69806	-0.43	4.14	3.26	0.37387	Peptidase M12A, astacin (2);Metallopeptidase, catalytic domain (1);	0.000000	0.64402	D	0.000013	D	0.84406	0.5465	H	0.95745	3.715	0.41070	D	0.98544	D	0.89917	1.0	D	0.77557	0.99	D	0.85416	0.1140	10	0.87932	D	0	-21.1207	8.2326	0.31608	0.1135:0.0:0.8865:0.0	.	244	Q6HA08	ASTL_HUMAN	R	244	ENSP00000343674:S244R	ENSP00000343674:S244R	S	-	3	2	ASTL	96159432	0.997000	0.39634	1.000000	0.80357	0.728000	0.41692	1.880000	0.39628	0.891000	0.36235	0.555000	0.69702	AGC	ASTL	-	pfam_Peptidase_M12A,prints_Peptidase_M12A	ENSG00000188886		0.652	ASTL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ASTL	HGNC	protein_coding	OTTHUMT00000338801.1	46	0.00	0	G			96795705	96795705	-1	no_errors	ENST00000342380	ensembl	human	known	69_37n	missense	127	14.77	22	SNP	0.976	C
ASXL1	171023	genome.wustl.edu	37	20	31022690	31022690	+	Silent	SNP	A	A	G			TCGA-A2-A0D0-01A-11W-A019-09	TCGA-A2-A0D0-10A-01W-A021-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3f20d0fe-aaa1-40f1-b2c1-7f070f93aef5	bbf1c43d-d7b3-4574-a074-d22ad537829c	g.chr20:31022690A>G	ENST00000375687.4	+	13	2599	c.2175A>G	c.(2173-2175)agA>agG	p.R725R	ASXL1_ENST00000306058.5_Silent_p.R720R	NM_015338.5	NP_056153	Q8IXJ9	ASXL1_HUMAN	additional sex combs like transcriptional regulator 1	725					bone development (GO:0060348)|monoubiquitinated histone H2A deubiquitination (GO:0035522)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of peroxisome proliferator activated receptor signaling pathway (GO:0035359)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of retinoic acid receptor signaling pathway (GO:0048386)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|response to retinoic acid (GO:0032526)|transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nuclear chromatin (GO:0000790)|PR-DUB complex (GO:0035517)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|peroxisome proliferator activated receptor binding (GO:0042975)|retinoic acid receptor binding (GO:0042974)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)			NS(1)|breast(2)|central_nervous_system(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(655)|kidney(5)|large_intestine(18)|liver(1)|lung(27)|ovary(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)	722						CTTCTCTGAGAAAGGAGGAAA	0.567			"""F, N, Mis"""		"""MDS, CMML"""																																	dbGAP		Rec	yes		20	20q11.1	171023	additional sex combs like 1		L	0													50.0	49.0	49.0					20																	31022690		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AJ438952	CCDS13201.1	20q11	2014-09-17	2014-06-17		ENSG00000171456	ENSG00000171456			18318	protein-coding gene	gene with protein product		612990	"""additional sex combs like 1 (Drosophila)"""			12657473	Standard	NM_015338		Approved	KIAA0978	uc002wxs.3	Q8IXJ9	OTTHUMG00000032218	ENST00000375687.4:c.2175A>G	20.37:g.31022690A>G		Somatic		WXS	Illumina GAIIx	Phase_IV	B2RP59|Q5JWS9|Q8IYY7|Q9H466|Q9NQF8|Q9UFJ0|Q9UFP8|Q9Y2I4	Silent	SNP	NULL	p.R725	ENST00000375687.4	37	c.2175	CCDS13201.1	20																																																																																			ASXL1	-	NULL	ENSG00000171456		0.567	ASXL1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ASXL1	HGNC	protein_coding	OTTHUMT00000078624.2	50	0.00	0	A	NM_015338		31022690	31022690	+1	no_errors	ENST00000375687	ensembl	human	known	69_37n	silent	64	20.00	16	SNP	0.004	G
ATP4A	495	genome.wustl.edu	37	19	36046578	36046578	+	Splice_Site	SNP	T	T	G			TCGA-A2-A0D0-01A-11W-A019-09	TCGA-A2-A0D0-10A-01W-A021-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3f20d0fe-aaa1-40f1-b2c1-7f070f93aef5	bbf1c43d-d7b3-4574-a074-d22ad537829c	g.chr19:36046578T>G	ENST00000262623.3	-	13	2034	c.2006A>C	c.(2005-2007)aAg>aCg	p.K669T		NM_000704.2	NP_000695.2	P20648	ATP4A_HUMAN	ATPase, H+/K+ exchanging, alpha polypeptide	669					ATP biosynthetic process (GO:0006754)|ATP hydrolysis coupled proton transport (GO:0015991)|ion transmembrane transport (GO:0034220)|pH reduction (GO:0045851)|regulation of proton transport (GO:0010155)|response to drug (GO:0042493)|transmembrane transport (GO:0055085)|transport (GO:0006810)	extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|hydrogen:potassium-exchanging ATPase activity (GO:0008900)|magnesium ion binding (GO:0000287)			breast(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|lung(26)|ovary(2)|prostate(2)|upper_aerodigestive_tract(1)	53	all_lung(56;1.05e-07)|Lung NSC(56;1.63e-07)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0724)		Esomeprazole(DB00736)|Lansoprazole(DB00448)|Omeprazole(DB00338)|Pantoprazole(DB00213)|Rabeprazole(DB01129)	GGGGGCTTACTTGCGATTAAC	0.647																																						dbGAP											0													94.0	93.0	93.0					19																	36046578		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0				CCDS12467.1	19q13.1	2010-04-20			ENSG00000105675	ENSG00000105675	3.6.3.10	"""ATPases / P-type"""	819	protein-coding gene	gene with protein product	"""gastric H,K-ATPase alpha subunit"", ""H(+)-K(+)-ATPase alpha subunit"", ""proton pump"""	137216				1330887	Standard	NM_000704		Approved	ATP6A	uc002oal.1	P20648	OTTHUMG00000048106	ENST00000262623.3:c.2006+1A>C	19.37:g.36046578T>G		Somatic		WXS	Illumina GAIIx	Phase_IV	O00738	Missense_Mutation	SNP	pfam_ATPase_P-typ_ATPase-assoc-dom,pfam_ATPase_P-typ_cation-transptr_C,pfam_ATPase_P-typ_H/K-transp_N,pfam_Dehalogen-like_hydro,pfam_ATPase_P-typ_cation-transptr_N,superfamily_ATPase_cation_domN,superfamily_HAD-like_dom,smart_ATPase_P-typ_cation-transptr_N,prints_ATPase_P-typ_cation-exchng_asu,prints_ATPase_P-typ_ion-transptr,tigrfam_ATPase_P-typ_cation-ex_asu_euk,tigrfam_ATPase_P-typ_ion-transptr	p.K669T	ENST00000262623.3	37	c.2006	CCDS12467.1	19	.	.	.	.	.	.	.	.	.	.	T	13.65	2.300319	0.40694	.	.	ENSG00000105675	ENST00000262623	D	0.93906	-3.31	4.97	3.9	0.45041	Haloacid dehalogenase-like hydrolase (1);HAD-like domain (1);	0.270919	0.24458	N	0.038346	D	0.87609	0.6220	L	0.35793	1.09	0.48452	D	0.999654	B	0.13594	0.008	B	0.27608	0.081	T	0.80564	-0.1326	9	.	.	.	.	5.9283	0.19124	0.0:0.1188:0.0:0.8812	.	669	P20648	ATP4A_HUMAN	T	669	ENSP00000262623:K669T	.	K	-	2	0	ATP4A	40738418	1.000000	0.71417	0.999000	0.59377	0.458000	0.32498	3.924000	0.56476	2.097000	0.63578	0.379000	0.24179	AAG	ATP4A	-	pfam_Dehalogen-like_hydro,superfamily_HAD-like_dom,tigrfam_ATPase_P-typ_cation-ex_asu_euk	ENSG00000105675		0.647	ATP4A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATP4A	HGNC	protein_coding	OTTHUMT00000109470.2	167	0.00	0	T	NM_000704	Missense_Mutation	36046578	36046578	-1	no_errors	ENST00000262623	ensembl	human	known	69_37n	missense	61	21.52	17	SNP	1.000	G
ATXN2	6311	genome.wustl.edu	37	12	111926531	111926531	+	Silent	SNP	T	T	C			TCGA-A2-A0D0-01A-11W-A019-09	TCGA-A2-A0D0-10A-01W-A021-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3f20d0fe-aaa1-40f1-b2c1-7f070f93aef5	bbf1c43d-d7b3-4574-a074-d22ad537829c	g.chr12:111926531T>C	ENST00000377617.3	-	15	2630	c.2469A>G	c.(2467-2469)agA>agG	p.R823R	ATXN2_ENST00000535949.1_Silent_p.R534R|ATXN2_ENST00000608853.1_Silent_p.R663R|ATXN2_ENST00000389153.4_Silent_p.R558R|ATXN2_ENST00000542287.2_Silent_p.R558R|ATXN2_ENST00000550104.1_Silent_p.R823R|AC002395.1_ENST00000581907.1_RNA	NM_002973.3	NP_002964.3	Q99700	ATX2_HUMAN	ataxin 2	823					cell death (GO:0008219)|cerebellar Purkinje cell differentiation (GO:0021702)|cytoplasmic mRNA processing body assembly (GO:0033962)|homeostasis of number of cells (GO:0048872)|negative regulation of multicellular organism growth (GO:0040015)|negative regulation of receptor internalization (GO:0002091)|neuromuscular process (GO:0050905)|neuron projection morphogenesis (GO:0048812)|regulation of translation (GO:0006417)|RNA metabolic process (GO:0016070)|RNA transport (GO:0050658)|stress granule assembly (GO:0034063)	cytoplasm (GO:0005737)|cytoplasmic stress granule (GO:0010494)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|polysome (GO:0005844)|ribonucleoprotein complex (GO:0030529)|trans-Golgi network (GO:0005802)	epidermal growth factor receptor binding (GO:0005154)|poly(A) RNA binding (GO:0044822)|protein C-terminus binding (GO:0008022)|RNA binding (GO:0003723)			NS(1)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(6)|kidney(5)|large_intestine(8)|lung(6)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	37						TTTCTCCCTCTCTATTTTTGT	0.318																																						dbGAP											0													47.0	45.0	46.0					12																	111926531		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			U80749	CCDS31902.1	12q23-q24.1	2014-09-17	2004-08-12	2004-08-13	ENSG00000204842	ENSG00000204842		"""Ataxins"""	10555	protein-coding gene	gene with protein product	"""trinucleotide repeat containing 13"""	601517	"""spinocerebellar ataxia 2 (olivopontocerebellar ataxia 2, autosomal dominant, ataxin 2)"""	SCA2, TNRC13		8358438, 9225980	Standard	NM_002973		Approved	ATX2	uc001tsj.3	Q99700	OTTHUMG00000133475	ENST00000377617.3:c.2469A>G	12.37:g.111926531T>C		Somatic		WXS	Illumina GAIIx	Phase_IV	A6NLD4|Q6ZQZ7|Q99493	Missense_Mutation	SNP	pfam_LsmAD_domain,pfam_Ataxin-2_C,superfamily_LSM_dom	p.E744G	ENST00000377617.3	37	c.2231	CCDS31902.1	12																																																																																			ATXN2	-	NULL	ENSG00000204842		0.318	ATXN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATXN2	HGNC	protein_coding	OTTHUMT00000257351.3	47	0.00	0	T	NM_002973		111926531	111926531	-1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000483311	ensembl	human	known	69_37n	missense	166	15.31	30	SNP	1.000	C
BIRC6	57448	genome.wustl.edu	37	2	32738164	32738164	+	Missense_Mutation	SNP	G	G	A			TCGA-A2-A0D0-01A-11W-A019-09	TCGA-A2-A0D0-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3f20d0fe-aaa1-40f1-b2c1-7f070f93aef5	bbf1c43d-d7b3-4574-a074-d22ad537829c	g.chr2:32738164G>A	ENST00000421745.2	+	54	10645	c.10511G>A	c.(10510-10512)aGt>aAt	p.S3504N		NM_016252.3	NP_057336	Q9NR09	BIRC6_HUMAN	baculoviral IAP repeat containing 6	3504					apoptotic process (GO:0006915)|labyrinthine layer development (GO:0060711)|mitotic nuclear division (GO:0007067)|negative regulation of apoptotic process (GO:0043066)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|positive regulation of cell proliferation (GO:0008284)|protein phosphorylation (GO:0006468)|protein ubiquitination (GO:0016567)|regulation of cell proliferation (GO:0042127)|regulation of cytokinesis (GO:0032465)|spongiotrophoblast layer development (GO:0060712)	endosome (GO:0005768)|membrane (GO:0016020)|microtubule organizing center (GO:0005815)|midbody (GO:0030496)|spindle pole (GO:0000922)|trans-Golgi network (GO:0005802)	acid-amino acid ligase activity (GO:0016881)|cysteine-type endopeptidase inhibitor activity (GO:0004869)|ubiquitin-protein transferase activity (GO:0004842)			NS(4)|breast(8)|central_nervous_system(3)|endometrium(21)|haematopoietic_and_lymphoid_tissue(1)|kidney(15)|large_intestine(31)|lung(65)|ovary(7)|pancreas(1)|prostate(5)|skin(5)|stomach(1)|urinary_tract(5)	172	Acute lymphoblastic leukemia(172;0.155)					CTGTGGCATAGTTATGAGCTG	0.423																																					Pancreas(94;175 1509 16028 18060 45422)	dbGAP											0													138.0	116.0	123.0					2																	32738164		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF265555	CCDS33175.2	2p22.3	2011-01-25	2011-01-25		ENSG00000115760	ENSG00000115760		"""Baculoviral IAP repeat containing"", ""Ubiquitin-conjugating enzymes E2"""	13516	protein-coding gene	gene with protein product	"""apollon"""	605638	"""baculoviral IAP repeat-containing 6"""			10544019	Standard	NM_016252		Approved	BRUCE	uc010ezu.3	Q9NR09	OTTHUMG00000150528	ENST00000421745.2:c.10511G>A	2.37:g.32738164G>A	ENSP00000393596:p.Ser3504Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	Q9ULD1	Missense_Mutation	SNP	pfam_DUF3643,pfam_UBQ-conjugat_E2,pfam_BIR,pfam_UEV_N,superfamily_UBQ-conjugating_enzyme/RWD,superfamily_Galactose-bd-like,superfamily_WD40_repeat_dom,smart_BIR,pfscan_BIR,pfscan_UBQ-conjugat_E2	p.S3504N	ENST00000421745.2	37	c.10511	CCDS33175.2	2	.	.	.	.	.	.	.	.	.	.	G	35	5.509414	0.96386	.	.	ENSG00000115760	ENST00000421745	T	0.75821	-0.97	5.29	5.29	0.74685	.	0.000000	0.85682	D	0.000000	D	0.83825	0.5338	L	0.50333	1.59	0.80722	D	1	D	0.62365	0.991	D	0.76575	0.988	D	0.84868	0.0823	10	0.72032	D	0.01	.	19.3084	0.94173	0.0:0.0:1.0:0.0	.	3504	Q9NR09	BIRC6_HUMAN	N	3504	ENSP00000393596:S3504N	ENSP00000393596:S3504N	S	+	2	0	BIRC6	32591668	1.000000	0.71417	0.997000	0.53966	0.963000	0.63663	9.804000	0.99143	2.610000	0.88304	0.555000	0.69702	AGT	BIRC6	-	pfam_DUF3643	ENSG00000115760		0.423	BIRC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BIRC6	HGNC	protein_coding	OTTHUMT00000318769.3	182	0.00	0	G	NM_016252		32738164	32738164	+1	no_errors	ENST00000421745	ensembl	human	known	69_37n	missense	391	18.37	88	SNP	1.000	A
DQX1	165545	genome.wustl.edu	37	2	74754449	74754449	+	5'Flank	SNP	C	C	G			TCGA-A2-A0D0-01A-11W-A019-09	TCGA-A2-A0D0-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3f20d0fe-aaa1-40f1-b2c1-7f070f93aef5	bbf1c43d-d7b3-4574-a074-d22ad537829c	g.chr2:74754449C>G	ENST00000404568.3	-	0	0				HTRA2_ENST00000352222.3_5'Flank|DQX1_ENST00000393951.2_5'Flank|HTRA2_ENST00000258080.3_5'Flank|AUP1_ENST00000377526.3_Missense_Mutation_p.E335Q	NM_133637.2	NP_598376.2	Q8TE96	DQX1_HUMAN	DEAQ box RNA-dependent ATPase 1							nucleus (GO:0005634)	ATP binding (GO:0005524)|helicase activity (GO:0004386)			cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(7)|ovary(2)|skin(1)	18						ACGGCCCCCTCAAGCAGATTA	0.522																																						dbGAP											0													56.0	58.0	57.0					2																	74754449		1926	4131	6057	-	-	-	SO:0001631	upstream_gene_variant	0			AK074337	CCDS1949.2	2p12	2010-04-20	2009-01-15		ENSG00000144045	ENSG00000144045			20410	protein-coding gene	gene with protein product			"""DEAQ box polypeptide 1 (RNA-dependent ATPase)"""				Standard	NM_133637		Approved	FLJ23757	uc010yrw.2	Q8TE96	OTTHUMG00000129965		2.37:g.74754449C>G	Exception_encountered	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6B017|Q8NAM8	Missense_Mutation	SNP	pfam_CUE,smart_CUE,pfscan_CUE	p.E335Q	ENST00000404568.3	37	c.1003	CCDS1949.2	2	.	.	.	.	.	.	.	.	.	.	C	17.76	3.467948	0.63625	.	.	ENSG00000115307	ENST00000377526;ENST00000258081;ENST00000412627	.	.	.	5.15	4.27	0.50696	Ubiquitin system component Cue (3);	0.052493	0.85682	D	0.000000	T	0.76891	0.4051	M	0.74467	2.265	0.53688	D	0.999978	D;B;D	0.89917	1.0;0.339;1.0	D;B;D	0.87578	0.998;0.168;0.998	T	0.79222	-0.1892	9	0.72032	D	0.01	-13.4701	11.5811	0.50891	0.0:0.8206:0.1794:0.0	.	392;401;335	E7EU18;Q9Y679;Q9Y679-2	.;AUP1_HUMAN;.	Q	335;399;337	.	ENSP00000258081:E399Q	E	-	1	0	AUP1	74607957	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	5.723000	0.68492	1.377000	0.46286	0.655000	0.94253	GAG	AUP1	-	pfam_CUE,smart_CUE,pfscan_CUE	ENSG00000115307		0.522	DQX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AUP1	HGNC	protein_coding	OTTHUMT00000252230.3	101	0.00	0	C	NM_133637		74754449	74754449	-1	no_errors	ENST00000377526	ensembl	human	known	69_37n	missense	64	14.47	11	SNP	1.000	G
C10orf12	26148	genome.wustl.edu	37	10	98743239	98743239	+	Missense_Mutation	SNP	G	G	A			TCGA-A2-A0D0-01A-11W-A019-09	TCGA-A2-A0D0-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3f20d0fe-aaa1-40f1-b2c1-7f070f93aef5	bbf1c43d-d7b3-4574-a074-d22ad537829c	g.chr10:98743239G>A	ENST00000286067.2	+	1	2199	c.2092G>A	c.(2092-2094)Gcc>Acc	p.A698T		NM_015652.2	NP_056467.2	Q8N655	CJ012_HUMAN	chromosome 10 open reading frame 12	698										NS(1)|breast(2)|endometrium(3)|kidney(1)|large_intestine(8)|lung(19)|ovary(3)|prostate(2)|skin(2)|stomach(4)	45		Colorectal(252;0.172)		Epithelial(162;6.35e-09)|all cancers(201;3.21e-07)		TGAGAGTGATGCCCCATGCAG	0.507																																						dbGAP											0													75.0	67.0	70.0					10																	98743239		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC024315	CCDS7452.1	10q24.2	2014-03-11			ENSG00000155640	ENSG00000155640			23420	protein-coding gene	gene with protein product						24550272	Standard	NM_015652		Approved	DKFZP564P1916, FLJ13022	uc001kmv.3	Q8N655	OTTHUMG00000018840	ENST00000286067.2:c.2092G>A	10.37:g.98743239G>A	ENSP00000286067:p.Ala698Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	Q9H945|Q9Y457	Missense_Mutation	SNP	NULL	p.A698T	ENST00000286067.2	37	c.2092	CCDS7452.1	10	.	.	.	.	.	.	.	.	.	.	G	6.164	0.398390	0.11696	.	.	ENSG00000155640	ENST00000286067;ENST00000539886	T	0.08102	3.13	5.67	0.577	0.17385	.	0.681194	0.11439	U	0.564011	T	0.04363	0.0120	N	0.24115	0.695	0.09310	N	1	B	0.06786	0.001	B	0.09377	0.004	T	0.46205	-0.9208	10	0.17369	T	0.5	0.0075	2.0642	0.03599	0.3595:0.1105:0.4048:0.1252	.	698	Q8N655	CJ012_HUMAN	T	698;532	ENSP00000286067:A698T	ENSP00000286067:A698T	A	+	1	0	C10orf12	98733229	0.000000	0.05858	0.000000	0.03702	0.007000	0.05969	-0.608000	0.05641	0.075000	0.16796	-0.258000	0.10820	GCC	C10orf12	-	NULL	ENSG00000155640		0.507	C10orf12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C10orf12	HGNC	protein_coding	OTTHUMT00000049627.1	109	0.00	0	G	NM_015652		98743239	98743239	+1	no_errors	ENST00000286067	ensembl	human	known	69_37n	missense	35	42.62	26	SNP	0.000	A
C16orf62	57020	genome.wustl.edu	37	16	19711758	19711758	+	Missense_Mutation	SNP	C	C	G			TCGA-A2-A0D0-01A-11W-A019-09	TCGA-A2-A0D0-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3f20d0fe-aaa1-40f1-b2c1-7f070f93aef5	bbf1c43d-d7b3-4574-a074-d22ad537829c	g.chr16:19711758C>G	ENST00000251143.5	+	31	2864	c.2852C>G	c.(2851-2853)aCg>aGg	p.T951R	C16orf62_ENST00000417362.2_Missense_Mutation_p.T858R|C16orf62_ENST00000448695.1_Missense_Mutation_p.T801R|C16orf62_ENST00000543152.1_Missense_Mutation_p.T700R|C16orf62_ENST00000542263.1_Missense_Mutation_p.T947R|C16orf62_ENST00000438132.3_Missense_Mutation_p.T1040R			Q7Z3J2	CP062_HUMAN	chromosome 16 open reading frame 62	951						integral component of membrane (GO:0016021)		p.T1040M(1)|p.T951M(1)		breast(2)|central_nervous_system(1)|endometrium(3)|kidney(5)|large_intestine(7)|liver(1)|lung(11)|ovary(1)|prostate(2)|skin(1)|urinary_tract(2)	36						ACTCATCTGACGGAGCTGGCC	0.502																																						dbGAP											2	Substitution - Missense(2)	lung(2)											95.0	94.0	95.0					16																	19711758		2197	4300	6497	-	-	-	SO:0001583	missense	0				CCDS32397.1, CCDS32397.2, CCDS73840.1	16p12.3	2012-05-30			ENSG00000103544	ENSG00000103544			24641	protein-coding gene	gene with protein product						10493829	Standard	NM_020314		Approved	MGC16824	uc002dgn.3	Q7Z3J2	OTTHUMG00000167925	ENST00000251143.5:c.2852C>G	16.37:g.19711758C>G	ENSP00000251143:p.Thr951Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K2M1|O43329|Q69YI1|Q6PDA0|Q7L371|Q86W66|Q8WXA5|Q9H0L7|Q9H7C8	Missense_Mutation	SNP	NULL	p.T1040R	ENST00000251143.5	37	c.3119		16	.	.	.	.	.	.	.	.	.	.	C	12.49	1.954330	0.34471	.	.	ENSG00000103544	ENST00000438132;ENST00000542263;ENST00000251143;ENST00000417362;ENST00000448695	T;T;T;T;T	0.34072	1.78;1.78;1.84;1.84;1.38	5.38	1.14	0.20703	.	0.378995	0.30252	N	0.010052	T	0.26702	0.0653	L	0.36672	1.1	0.19575	N	0.999969	B;B	0.28439	0.044;0.212	B;B	0.33196	0.113;0.159	T	0.20174	-1.0283	9	.	.	.	-4.994	9.2579	0.37595	0.0:0.5513:0.3537:0.095	.	947;951	F5H7K1;Q7Z3J2	.;CP062_HUMAN	R	1040;947;951;858;801	ENSP00000400815:T1040R;ENSP00000442468:T947R;ENSP00000251143:T951R;ENSP00000395973:T858R;ENSP00000398009:T801R	.	T	+	2	0	C16orf62	19619259	0.044000	0.20184	0.079000	0.20413	0.751000	0.42716	1.290000	0.33319	-0.005000	0.14395	-0.305000	0.09177	ACG	C16orf62	-	NULL	ENSG00000103544		0.502	C16orf62-201	KNOWN	basic|appris_principal	protein_coding	C16orf62	HGNC	protein_coding		151	0.00	0	C	NM_020314		19711758	19711758	+1	no_errors	ENST00000438132	ensembl	human	known	69_37n	missense	72	22.58	21	SNP	0.213	G
CA9	768	genome.wustl.edu	37	9	35675543	35675543	+	Missense_Mutation	SNP	C	C	G			TCGA-A2-A0D0-01A-11W-A019-09	TCGA-A2-A0D0-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3f20d0fe-aaa1-40f1-b2c1-7f070f93aef5	bbf1c43d-d7b3-4574-a074-d22ad537829c	g.chr9:35675543C>G	ENST00000378357.4	+	2	516	c.412C>G	c.(412-414)Cag>Gag	p.Q138E		NM_001216.2	NP_001207.2	Q16790	CAH9_HUMAN	carbonic anhydrase IX	138	Catalytic.				bicarbonate transport (GO:0015701)|cellular response to hypoxia (GO:0071456)|morphogenesis of an epithelium (GO:0002009)|one-carbon metabolic process (GO:0006730)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|response to drug (GO:0042493)|response to testosterone (GO:0033574)|secretion (GO:0046903)|small molecule metabolic process (GO:0044281)	basolateral plasma membrane (GO:0016323)|cell projection (GO:0042995)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	carbonate dehydratase activity (GO:0004089)|zinc ion binding (GO:0008270)			kidney(1)|large_intestine(3)|lung(5)|ovary(4)|prostate(1)|skin(2)|urinary_tract(1)	17	all_epithelial(49;0.217)		Lung(28;0.00276)|LUSC - Lung squamous cell carcinoma(32;0.00418)|STAD - Stomach adenocarcinoma(86;0.194)		Benzthiazide(DB00562)|Hydrochlorothiazide(DB00999)|Hydroflumethiazide(DB00774)|Zonisamide(DB00909)	AGGGGATGACCAGAGTCATTG	0.542																																						dbGAP											0													117.0	104.0	109.0					9																	35675543		2203	4300	6503	-	-	-	SO:0001583	missense	0			X66839	CCDS6585.1	9p13.3	2012-08-21			ENSG00000107159	ENSG00000107159		"""Carbonic anhydrases"""	1383	protein-coding gene	gene with protein product	"""carbonic dehydratase"", ""RCC-associated protein G250"""	603179				8661007, 9787087	Standard	NM_001216		Approved	MN, CAIX	uc003zxo.4	Q16790	OTTHUMG00000021029	ENST00000378357.4:c.412C>G	9.37:g.35675543C>G	ENSP00000367608:p.Gln138Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5T4R1	Missense_Mutation	SNP	pfam_Carbonic_anhydrase_a,superfamily_Carbonic_anhydrase_a,pfscan_Carbonic_anhydrase_a	p.Q138E	ENST00000378357.4	37	c.412	CCDS6585.1	9	.	.	.	.	.	.	.	.	.	.	C	5.697	0.313058	0.10789	.	.	ENSG00000107159	ENST00000378357;ENST00000544074	T	0.62498	0.02	4.95	4.95	0.65309	Carbonic anhydrase, alpha-class, catalytic domain (2);	0.321554	0.27048	N	0.021186	T	0.35998	0.0951	N	0.02266	-0.62	0.33858	D	0.633412	B;B	0.15141	0.007;0.012	B;B	0.08055	0.003;0.003	T	0.43861	-0.9365	10	0.28530	T	0.3	.	13.5428	0.61684	0.0:1.0:0.0:0.0	.	138;138	F5H404;Q16790	.;CAH9_HUMAN	E	138	ENSP00000367608:Q138E	ENSP00000367608:Q138E	Q	+	1	0	CA9	35665543	1.000000	0.71417	0.995000	0.50966	0.219000	0.24729	3.259000	0.51515	2.562000	0.86427	0.462000	0.41574	CAG	CA9	-	superfamily_Carbonic_anhydrase_a	ENSG00000107159		0.542	CA9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CA9	HGNC	protein_coding	OTTHUMT00000055479.1	101	0.00	0	C	NM_001216		35675543	35675543	+1	no_errors	ENST00000378357	ensembl	human	known	69_37n	missense	51	58.06	72	SNP	0.996	G
CAMTA2	23125	genome.wustl.edu	37	17	4872988	4872988	+	Silent	SNP	C	C	T			TCGA-A2-A0D0-01A-11W-A019-09	TCGA-A2-A0D0-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3f20d0fe-aaa1-40f1-b2c1-7f070f93aef5	bbf1c43d-d7b3-4574-a074-d22ad537829c	g.chr17:4872988C>T	ENST00000348066.3	-	19	3321	c.3198G>A	c.(3196-3198)cgG>cgA	p.R1066R	CAMTA2_ENST00000414043.3_Silent_p.R1089R|RP5-1050D4.3_ENST00000576752.1_RNA|CAMTA2_ENST00000572543.1_Silent_p.R1071R|SPAG7_ENST00000573366.1_5'Flank|SPAG7_ENST00000571023.1_5'Flank|SPAG7_ENST00000206020.3_5'Flank|CAMTA2_ENST00000381311.5_Silent_p.R1068R|CAMTA2_ENST00000358183.4_Silent_p.R1066R|SPAG7_ENST00000575142.1_5'Flank|CAMTA2_ENST00000361571.5_Silent_p.R1065R	NM_015099.3	NP_055914.2	O94983	CMTA2_HUMAN	calmodulin binding transcription activator 2	1066	IQ 1. {ECO:0000255|PROSITE- ProRule:PRU00116}.				cardiac muscle hypertrophy in response to stress (GO:0014898)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|histone deacetylase binding (GO:0042826)|transcription factor binding (GO:0008134)			breast(2)|central_nervous_system(1)|endometrium(6)|kidney(3)|large_intestine(6)|lung(5)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	31						GCTCCTTCAGCCGCCGGCCCT	0.542																																						dbGAP											0													124.0	116.0	119.0					17																	4872988		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB020716	CCDS11063.1, CCDS54071.1, CCDS54072.1, CCDS54073.1	17p13.3	2004-09-01			ENSG00000108509	ENSG00000108509			18807	protein-coding gene	gene with protein product		611508				11925432	Standard	NM_015099		Approved	KIAA0909	uc010cku.2	O94983	OTTHUMG00000099417	ENST00000348066.3:c.3198G>A	17.37:g.4872988C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B9EGL0|D3DTL5|E7EWU5|Q7Z6M8|Q8N3V0|Q8NDG4|Q96G17	Silent	SNP	pfam_CG-1_dom,pfam_IPT_TIG_rcpt,pfam_IQ_motif_EF-hand-BS,superfamily_Ig_E-set,superfamily_Ankyrin_rpt-contain_dom,pfscan_Ankyrin_rpt-contain_dom,pfscan_IQ_motif_EF-hand-BS	p.R1089	ENST00000348066.3	37	c.3267	CCDS11063.1	17																																																																																			CAMTA2	-	NULL	ENSG00000108509		0.542	CAMTA2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CAMTA2	HGNC	protein_coding	OTTHUMT00000216876.1	313	0.00	0	C	NM_015099		4872988	4872988	-1	no_errors	ENST00000414043	ensembl	human	known	69_37n	silent	414	35.61	229	SNP	0.974	T
CASQ2	845	genome.wustl.edu	37	1	116280890	116280890	+	Missense_Mutation	SNP	C	C	G			TCGA-A2-A0D0-01A-11W-A019-09	TCGA-A2-A0D0-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3f20d0fe-aaa1-40f1-b2c1-7f070f93aef5	bbf1c43d-d7b3-4574-a074-d22ad537829c	g.chr1:116280890C>G	ENST00000261448.5	-	4	726	c.487G>C	c.(487-489)Gac>Cac	p.D163H	CASQ2_ENST00000456138.2_Intron	NM_001232.3	NP_001223.2	O14958	CASQ2_HUMAN	calsequestrin 2 (cardiac muscle)	163					cardiac muscle contraction (GO:0060048)|cellular response to caffeine (GO:0071313)|detection of calcium ion (GO:0005513)|ion transmembrane transport (GO:0034220)|negative regulation of potassium ion transmembrane transporter activity (GO:1901017)|negative regulation of potassium ion transport (GO:0043267)|negative regulation of ryanodine-sensitive calcium-release channel activity (GO:0060315)|protein polymerization (GO:0051258)|Purkinje myocyte to ventricular cardiac muscle cell signaling (GO:0086029)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of cell communication by electrical coupling (GO:0010649)|regulation of heart rate (GO:0002027)|regulation of membrane repolarization (GO:0060306)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)|sequestering of calcium ion (GO:0051208)|striated muscle contraction (GO:0006941)|transmembrane transport (GO:0055085)	calcium channel complex (GO:0034704)|cytoplasm (GO:0005737)|intracellular (GO:0005622)|junctional sarcoplasmic reticulum membrane (GO:0014701)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum lumen (GO:0033018)|sarcoplasmic reticulum membrane (GO:0033017)|Z disc (GO:0030018)	calcium ion binding (GO:0005509)|calcium-dependent protein binding (GO:0048306)|protein homodimerization activity (GO:0042803)			breast(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(9)|skin(1)	18	Lung SC(450;0.211)	all_cancers(81;1.25e-06)|all_epithelial(167;1.02e-06)|all_lung(203;8.03e-06)|Lung NSC(69;5.01e-05)		Lung(183;0.0171)|Colorectal(144;0.0686)|LUSC - Lung squamous cell carcinoma(189;0.0903)|all cancers(265;0.108)|COAD - Colon adenocarcinoma(174;0.111)|Epithelial(280;0.12)		TTGATGTAGTCTTCAATGCGT	0.448																																						dbGAP											0													239.0	210.0	220.0					1																	116280890		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC022288	CCDS884.1	1p13.1	2014-09-17			ENSG00000118729	ENSG00000118729		"""Protein disulfide isomerases"""	1513	protein-coding gene	gene with protein product		114251				8406504	Standard	NM_001232		Approved	PDIB2	uc001efx.4	O14958	OTTHUMG00000011970	ENST00000261448.5:c.487G>C	1.37:g.116280890C>G	ENSP00000261448:p.Asp163His	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R7M6|B4DIB0|Q5T1D2|Q8TBW8	Missense_Mutation	SNP	pfam_Calsequestrin,superfamily_Thioredoxin-like_fold,prints_Calsequestrin	p.D163H	ENST00000261448.5	37	c.487	CCDS884.1	1	.	.	.	.	.	.	.	.	.	.	C	23.3	4.394814	0.83011	.	.	ENSG00000118729	ENST00000261448;ENST00000446755	T	0.80566	-1.39	5.82	5.82	0.92795	Thioredoxin-like fold (2);	0.139775	0.64402	D	0.000004	D	0.86727	0.6002	M	0.65975	2.015	0.80722	D	1	D	0.71674	0.998	D	0.67725	0.953	D	0.87080	0.2165	10	0.66056	D	0.02	-29.4429	17.8721	0.88813	0.0:1.0:0.0:0.0	.	163	O14958	CASQ2_HUMAN	H	163	ENSP00000261448:D163H	ENSP00000261448:D163H	D	-	1	0	CASQ2	116082413	1.000000	0.71417	1.000000	0.80357	0.855000	0.48748	6.290000	0.72712	2.752000	0.94435	0.655000	0.94253	GAC	CASQ2	-	pfam_Calsequestrin,superfamily_Thioredoxin-like_fold,prints_Calsequestrin	ENSG00000118729		0.448	CASQ2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CASQ2	HGNC	protein_coding	OTTHUMT00000033091.1	293	0.00	0	C	NM_001232		116280890	116280890	-1	no_errors	ENST00000261448	ensembl	human	known	69_37n	missense	476	21.38	130	SNP	1.000	G
CCDC141	285025	genome.wustl.edu	37	2	179702066	179702066	+	Missense_Mutation	SNP	A	A	C			TCGA-A2-A0D0-01A-11W-A019-09	TCGA-A2-A0D0-10A-01W-A021-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3f20d0fe-aaa1-40f1-b2c1-7f070f93aef5	bbf1c43d-d7b3-4574-a074-d22ad537829c	g.chr2:179702066A>C	ENST00000420890.2	-	23	3997	c.3880T>G	c.(3880-3882)Ttc>Gtc	p.F1294V	CCDC141_ENST00000295723.5_Missense_Mutation_p.F719V|CCDC141_ENST00000480419.1_5'UTR	NM_173648.3	NP_775919.3	Q6ZP82	CC141_HUMAN	coiled-coil domain containing 141	1294										NS(2)|breast(1)|endometrium(5)|kidney(1)|large_intestine(17)|lung(37)|ovary(8)|pancreas(2)|skin(4)|upper_aerodigestive_tract(1)	78			OV - Ovarian serous cystadenocarcinoma(117;0.0274)|Epithelial(96;0.0531)|all cancers(119;0.147)			TCAGCTTTGAACTGGAGGTAA	0.468																																						dbGAP											0													100.0	99.0	99.0					2																	179702066		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK096821		2q31.2	2013-01-14			ENSG00000163492	ENSG00000163492		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	26821	protein-coding gene	gene with protein product	"""coiled-coil protein associated with myosin II and DISC1"""					20956536	Standard	NM_173648		Approved	FLJ39502, CAMDI	uc002une.2	Q6ZP82	OTTHUMG00000132578	ENST00000420890.2:c.3880T>G	2.37:g.179702066A>C	ENSP00000395995:p.Phe1294Val	Somatic		WXS	Illumina GAIIx	Phase_IV	H7C0P1|J3KNW6|Q8N8H3	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Spectrin_repeat,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	p.F1294V	ENST00000420890.2	37	c.3880		2	.	.	.	.	.	.	.	.	.	.	A	0.025	-1.377857	0.01204	.	.	ENSG00000163492	ENST00000420890;ENST00000343876;ENST00000295723	T;T;T	0.49720	0.77;1.27;1.27	5.57	-7.37	0.01412	.	1.256550	0.05426	N	0.545145	T	0.23611	0.0571	N	0.10809	0.05	0.09310	N	1	B;B	0.14438	0.005;0.01	B;B	0.11329	0.004;0.006	T	0.19516	-1.0303	10	0.23891	T	0.37	2.4429	8.4066	0.32619	0.3713:0.3744:0.2543:0.0	.	719;719	Q6ZP82;Q6ZP82-2	CC141_HUMAN;.	V	1294;738;719	ENSP00000395995:F1294V;ENSP00000344627:F738V;ENSP00000295723:F719V	ENSP00000295723:F719V	F	-	1	0	CCDC141	179410311	0.996000	0.38824	0.000000	0.03702	0.002000	0.02628	1.993000	0.40747	-1.742000	0.01342	-1.276000	0.01395	TTC	CCDC141	-	NULL	ENSG00000163492		0.468	CCDC141-202	KNOWN	basic|appris_principal	protein_coding	CCDC141	HGNC	protein_coding		152	0.65	1	A	NM_173648		179702066	179702066	-1	no_errors	ENST00000420890	ensembl	human	known	69_37n	missense	295	12.68	43	SNP	0.001	C
COL19A1	1310	genome.wustl.edu	37	6	70866053	70866053	+	Missense_Mutation	SNP	G	G	T			TCGA-A2-A0D0-01A-11W-A019-09	TCGA-A2-A0D0-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3f20d0fe-aaa1-40f1-b2c1-7f070f93aef5	bbf1c43d-d7b3-4574-a074-d22ad537829c	g.chr6:70866053G>T	ENST00000322773.4	+	32	2216	c.2114G>T	c.(2113-2115)gGg>gTg	p.G705V	COL19A1_ENST00000393344.1_Missense_Mutation_p.G327V	NM_001858.4	NP_001849.2	Q14993	COJA1_HUMAN	collagen, type XIX, alpha 1	705	Triple-helical region 4 (COL4).				cell adhesion (GO:0007155)|cell differentiation (GO:0030154)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|single organismal cell-cell adhesion (GO:0016337)|skeletal muscle tissue development (GO:0007519)|skeletal system development (GO:0001501)	collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent (GO:0005201)|protein binding, bridging (GO:0030674)			breast(4)|central_nervous_system(3)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(5)|kidney(4)|large_intestine(8)|lung(54)|ovary(3)|prostate(2)|skin(10)|upper_aerodigestive_tract(4)|urinary_tract(2)	109						AGTGTCCCAGGGCTGAAAAGC	0.468																																						dbGAP											0													101.0	88.0	92.0					6																	70866053		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS4970.1	6q12-q13	2013-01-16			ENSG00000082293	ENSG00000082293		"""Collagens"""	2196	protein-coding gene	gene with protein product		120165				7916703, 9143499	Standard	NM_001858		Approved		uc003pfc.1	Q14993	OTTHUMG00000014987	ENST00000322773.4:c.2114G>T	6.37:g.70866053G>T	ENSP00000316030:p.Gly705Val	Somatic		WXS	Illumina GAIIx	Phase_IV	Q00559|Q05850|Q12885|Q13676|Q14DH1|Q5JUF0|Q5T424|Q9H572|Q9NPZ2|Q9NQP2	Missense_Mutation	SNP	pfam_Collagen,superfamily_ConA-like_lec_gl,smart_Laminin_G	p.G705V	ENST00000322773.4	37	c.2114	CCDS4970.1	6	.	.	.	.	.	.	.	.	.	.	G	11.94	1.788963	0.31685	.	.	ENSG00000082293	ENST00000322773;ENST00000393344	D;D	0.92249	-3.0;-2.95	5.41	4.54	0.55810	.	0.168341	0.36815	N	0.002398	D	0.96747	0.8938	H	0.97874	4.095	0.80722	D	1	D	0.64830	0.994	D	0.66351	0.943	D	0.97247	0.9895	10	0.87932	D	0	.	11.0051	0.47629	0.0865:0.0:0.9135:0.0	.	705	Q14993	COJA1_HUMAN	V	705;327	ENSP00000316030:G705V;ENSP00000377013:G327V	ENSP00000316030:G705V	G	+	2	0	COL19A1	70922774	0.940000	0.31905	1.000000	0.80357	0.487000	0.33371	1.046000	0.30354	1.293000	0.44690	0.563000	0.77884	GGG	COL19A1	-	NULL	ENSG00000082293		0.468	COL19A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL19A1	HGNC	protein_coding	OTTHUMT00000041127.1	84	0.00	0	G			70866053	70866053	+1	no_errors	ENST00000322773	ensembl	human	known	69_37n	missense	193	10.60	23	SNP	1.000	T
CNKSR3	154043	genome.wustl.edu	37	6	154754627	154754627	+	Silent	SNP	C	C	T			TCGA-A2-A0D0-01A-11W-A019-09	TCGA-A2-A0D0-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3f20d0fe-aaa1-40f1-b2c1-7f070f93aef5	bbf1c43d-d7b3-4574-a074-d22ad537829c	g.chr6:154754627C>T	ENST00000607772.1	-	5	1066	c.522G>A	c.(520-522)gcG>gcA	p.A174A	CNKSR3_ENST00000479339.1_Silent_p.A94A|CNKSR3_ENST00000433165.2_5'UTR	NM_173515.2	NP_775786.2	Q6P9H4	CNKR3_HUMAN	CNKSR family member 3	174	CRIC. {ECO:0000255|PROSITE- ProRule:PRU00621}.				negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of peptidyl-serine phosphorylation (GO:0033137)|positive regulation of sodium ion transmembrane transporter activity (GO:2000651)|positive regulation of sodium ion transport (GO:0010765)	cytoplasm (GO:0005737)|membrane (GO:0016020)				breast(2)|central_nervous_system(1)|kidney(1)|large_intestine(3)|lung(3)|ovary(2)|skin(1)|stomach(1)|urinary_tract(1)	15		Ovarian(120;0.196)		OV - Ovarian serous cystadenocarcinoma(155;5.03e-11)|BRCA - Breast invasive adenocarcinoma(81;0.00627)		CCTCCATTTCCGCTACAAAGC	0.343																																						dbGAP											0													55.0	50.0	51.0					6																	154754627		2198	4298	6496	-	-	-	SO:0001819	synonymous_variant	0			AK055911	CCDS5246.1	6q25.2	2013-01-10	2005-04-11	2005-04-11	ENSG00000153721	ENSG00000153721		"""Sterile alpha motif (SAM) domain containing"""	23034	protein-coding gene	gene with protein product			"""membrane associated guanylate kinase interacting protein-like 1"""	MAGI1			Standard	NM_173515		Approved	FLJ31349		Q6P9H4	OTTHUMG00000015873	ENST00000607772.1:c.522G>A	6.37:g.154754627C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q5SGD5|Q96N65	Silent	SNP	pfam_CNKSR2,pfam_CRIC_domain_Chordata,pfam_SAM_type1,pfam_SAM_2,pfam_PDZ,superfamily_SAM/pointed,superfamily_PDZ,smart_SAM,smart_PDZ,pfscan_PDZ,pfscan_SAM	p.A174	ENST00000607772.1	37	c.522	CCDS5246.1	6																																																																																			CNKSR3	-	NULL	ENSG00000153721		0.343	CNKSR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CNKSR3	HGNC	protein_coding	OTTHUMT00000042792.2	33	0.00	0	C	NM_173515		154754627	154754627	-1	no_errors	ENST00000367213	ensembl	human	known	69_37n	silent	182	26.61	66	SNP	0.683	T
CSPG5	10675	genome.wustl.edu	37	3	47618393	47618393	+	Missense_Mutation	SNP	C	C	T			TCGA-A2-A0D0-01A-11W-A019-09	TCGA-A2-A0D0-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3f20d0fe-aaa1-40f1-b2c1-7f070f93aef5	bbf1c43d-d7b3-4574-a074-d22ad537829c	g.chr3:47618393C>T	ENST00000383738.2	-	2	3221	c.1123G>A	c.(1123-1125)Gac>Aac	p.D375N	CSPG5_ENST00000456150.1_Missense_Mutation_p.D237N|CSPG5_ENST00000465441.1_5'Flank|CSPG5_ENST00000264723.4_Missense_Mutation_p.D375N	NM_001206943.1|NM_001206945.1	NP_001193872.1|NP_001193874.1	O95196	CSPG5_HUMAN	chondroitin sulfate proteoglycan 5 (neuroglycan C)	375	EGF-like.				axon regeneration (GO:0031103)|carbohydrate metabolic process (GO:0005975)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate catabolic process (GO:0030207)|chondroitin sulfate metabolic process (GO:0030204)|dermatan sulfate biosynthetic process (GO:0030208)|glycosaminoglycan metabolic process (GO:0030203)|intracellular transport (GO:0046907)|nervous system development (GO:0007399)|regulation of growth (GO:0040008)|regulation of synaptic transmission (GO:0050804)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|Golgi apparatus (GO:0005794)|Golgi lumen (GO:0005796)|Golgi-associated vesicle membrane (GO:0030660)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|lysosomal lumen (GO:0043202)|membrane (GO:0016020)	growth factor activity (GO:0008083)			breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(6)|ovary(2)|pancreas(1)|prostate(2)	22				BRCA - Breast invasive adenocarcinoma(193;0.000266)|KIRC - Kidney renal clear cell carcinoma(197;0.00551)|Kidney(197;0.00621)		GGGAAGAGGTCGCACACTGAC	0.607																																						dbGAP											0													121.0	128.0	126.0					3																	47618393		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF059274	CCDS2757.1, CCDS56252.1, CCDS56253.1, CCDS74930.1	3p21.3	2008-07-18			ENSG00000114646	ENSG00000114646			2467	protein-coding gene	gene with protein product		606775				9950058	Standard	NM_006574		Approved	NGC	uc003crp.4	O95196	OTTHUMG00000133518	ENST00000383738.2:c.1123G>A	3.37:g.47618393C>T	ENSP00000373244:p.Asp375Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	Q71M39|Q71M40	Missense_Mutation	SNP	pfam_Chon_Sulph_att,pfam_Neural_ProG_Cyt	p.D375N	ENST00000383738.2	37	c.1123	CCDS56253.1	3	.	.	.	.	.	.	.	.	.	.	C	24.1	4.495142	0.85069	.	.	ENSG00000114646	ENST00000456150;ENST00000383738;ENST00000264723	T;T;T	0.29142	1.68;1.63;1.58	4.63	4.63	0.57726	Epidermal growth factor-like (1);	0.000000	0.85682	D	0.000000	T	0.33904	0.0879	L	0.61218	1.895	0.52099	D	0.999949	D;P	0.58268	0.982;0.886	B;B	0.41571	0.36;0.156	T	0.38222	-0.9671	10	0.59425	D	0.04	-31.1726	16.2049	0.82120	0.0:1.0:0.0:0.0	.	375;375	O95196;O95196-2	CSPG5_HUMAN;.	N	237;375;375	ENSP00000392096:D237N;ENSP00000373244:D375N;ENSP00000264723:D375N	ENSP00000264723:D375N	D	-	1	0	CSPG5	47593397	1.000000	0.71417	1.000000	0.80357	0.874000	0.50279	6.930000	0.75858	2.385000	0.81259	0.655000	0.94253	GAC	CSPG5	-	NULL	ENSG00000114646		0.607	CSPG5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CSPG5	HGNC	protein_coding	OTTHUMT00000257489.1	130	0.00	0	C	NM_006574		47618393	47618393	-1	no_errors	ENST00000383738	ensembl	human	known	69_37n	missense	8	42.86	6	SNP	1.000	T
DDX55	57696	genome.wustl.edu	37	12	124104236	124104237	+	Frame_Shift_Del	DEL	AA	AA	-			TCGA-A2-A0D0-01A-11W-A019-09	TCGA-A2-A0D0-10A-01W-A021-09	AA	AA					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3f20d0fe-aaa1-40f1-b2c1-7f070f93aef5	bbf1c43d-d7b3-4574-a074-d22ad537829c	g.chr12:124104236_124104237delAA	ENST00000238146.4	+	13	1641_1642	c.1591_1592delAA	c.(1591-1593)aagfs	p.K533fs	SNORA9_ENST00000384170.1_RNA|DDX55_ENST00000538744.1_Frame_Shift_Del_p.K502fs|DDX55_ENST00000421670.3_Frame_Shift_Del_p.K140fs	NM_020936.1	NP_065987.1	Q8NHQ9	DDX55_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 55	533	Lys-rich.					membrane (GO:0016020)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|poly(A) RNA binding (GO:0044822)			autonomic_ganglia(1)|breast(1)|endometrium(1)|large_intestine(3)|liver(1)|lung(4)|ovary(1)|prostate(1)|skin(1)	14	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000142)|Epithelial(86;0.000637)|all cancers(50;0.00772)		aaaagaaaagaagaaaaaaatg	0.297																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			AB046815	CCDS9251.1	12q24.31	2003-06-13			ENSG00000111364	ENSG00000111364		"""DEAD-boxes"""	20085	protein-coding gene	gene with protein product						10997877	Standard	NM_020936		Approved	KIAA1595	uc001ufi.3	Q8NHQ9	OTTHUMG00000168695	ENST00000238146.4:c.1591_1592delAA	12.37:g.124104236_124104237delAA	ENSP00000238146:p.Lys533fs	Somatic		WXS	Illumina GAIIx	Phase_IV	Q658L6|Q8IYH0|Q9HCH7	Frame_Shift_Del	DEL	pfam_DNA/RNA_helicase_DEAD/DEAH_N,pfam_Helicase_C,pfam_Helicase/UvrB_dom,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,pfscan_RNA_helicase_DEAD_Q_motif	p.K531fs	ENST00000238146.4	37	c.1591_1592	CCDS9251.1	12																																																																																			DDX55	-	NULL	ENSG00000111364		0.297	DDX55-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DDX55	HGNC	protein_coding	OTTHUMT00000400616.2	168	0.00	0	AA			124104236	124104237	+1	no_errors	ENST00000238146	ensembl	human	known	69_37n	frame_shift_del	11	33.33	6	DEL	1.000:1.000	-
DLC1	10395	genome.wustl.edu	37	8	12956886	12956886	+	Missense_Mutation	SNP	C	C	G			TCGA-A2-A0D0-01A-11W-A019-09	TCGA-A2-A0D0-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3f20d0fe-aaa1-40f1-b2c1-7f070f93aef5	bbf1c43d-d7b3-4574-a074-d22ad537829c	g.chr8:12956886C>G	ENST00000276297.4	-	9	3369	c.2960G>C	c.(2959-2961)gGg>gCg	p.G987A	DLC1_ENST00000358919.2_Missense_Mutation_p.G550A|DLC1_ENST00000520226.1_Missense_Mutation_p.G476A|DLC1_ENST00000512044.2_Missense_Mutation_p.G584A	NM_182643.2	NP_872584.2	Q96QB1	RHG07_HUMAN	DLC1 Rho GTPase activating protein	987					actin cytoskeleton organization (GO:0030036)|activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|apoptotic process (GO:0006915)|focal adhesion assembly (GO:0048041)|forebrain development (GO:0030900)|heart morphogenesis (GO:0003007)|hindbrain morphogenesis (GO:0021575)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of Rho protein signal transduction (GO:0035024)|negative regulation of stress fiber assembly (GO:0051497)|neural tube closure (GO:0001843)|positive regulation of execution phase of apoptosis (GO:1900119)|positive regulation of protein dephosphorylation (GO:0035307)|positive regulation of Rho GTPase activity (GO:0032321)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of cell shape (GO:0008360)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	caveola (GO:0005901)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|nucleus (GO:0005634)	lipid binding (GO:0008289)|Rho GTPase activator activity (GO:0005100)|SH2 domain binding (GO:0042169)			NS(2)|breast(2)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(39)|lung(32)|ovary(4)|pancreas(2)|prostate(4)|skin(2)|stomach(2)|upper_aerodigestive_tract(5)|urinary_tract(1)	110						AGCCCCAACCCCAGAATCCCT	0.577																																						dbGAP											0													67.0	73.0	71.0					8																	12956886		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF035119	CCDS5989.1, CCDS5990.1, CCDS5991.1, CCDS5991.2, CCDS55201.1	8p22	2014-06-20	2014-06-20		ENSG00000164741	ENSG00000164741		"""Rho GTPase activating proteins"", ""StAR-related lipid transfer (START) domain containing"""	2897	protein-coding gene	gene with protein product	"""StAR-related lipid transfer (START) domain containing 12"""	604258	"""deleted in liver cancer 1"""			9605766, 11214970	Standard	NM_182643		Approved	HP, ARHGAP7, STARD12, DLC-1, p122-RhoGAP	uc003wwm.2	Q96QB1	OTTHUMG00000090825	ENST00000276297.4:c.2960G>C	8.37:g.12956886C>G	ENSP00000276297:p.Gly987Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DR10|B8PTI0|E9PDZ8|E9PF76|E9PGY9|O14868|O43199|Q7Z5R8|Q86UC6|Q9C0E0|Q9H7A2	Missense_Mutation	SNP	pfam_START_lipid-bd,pfam_RhoGAP_dom,pfam_SAM_2,superfamily_Rho_GTPase_activation_prot,smart_RhoGAP_dom,smart_START_lipid-bd,pfscan_START_lipid-bd,pfscan_RhoGAP_dom	p.G987A	ENST00000276297.4	37	c.2960	CCDS5989.1	8	.	.	.	.	.	.	.	.	.	.	C	24.9	4.584623	0.86748	.	.	ENSG00000164741	ENST00000276297;ENST00000358919;ENST00000512044;ENST00000520226	T;T;T;T	0.07021	3.5;3.26;3.25;3.23	5.47	5.47	0.80525	.	0.000000	0.85682	D	0.000000	T	0.33030	0.0849	M	0.78344	2.41	0.80722	D	1	P;D;D	0.89917	0.874;1.0;1.0	P;D;D	0.91635	0.449;0.999;0.999	T	0.01697	-1.1293	10	0.59425	D	0.04	.	19.7052	0.96069	0.0:1.0:0.0:0.0	.	987;584;550	Q96QB1;E9PDZ8;Q96QB1-1	RHG07_HUMAN;.;.	A	987;550;584;476	ENSP00000276297:G987A;ENSP00000351797:G550A;ENSP00000422595:G584A;ENSP00000428028:G476A	ENSP00000276297:G987A	G	-	2	0	DLC1	13001257	1.000000	0.71417	0.997000	0.53966	0.982000	0.71751	6.088000	0.71371	2.739000	0.93911	0.655000	0.94253	GGG	DLC1	-	NULL	ENSG00000164741		0.577	DLC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	DLC1	HGNC	protein_coding	OTTHUMT00000207632.2	104	0.00	0	C	NM_182643, NM_006094		12956886	12956886	-1	no_errors	ENST00000276297	ensembl	human	known	69_37n	missense	108	27.03	40	SNP	1.000	G
FAM49B	51571	genome.wustl.edu	37	8	130867866	130867866	+	Missense_Mutation	SNP	A	A	C			TCGA-A2-A0D0-01A-11W-A019-09	TCGA-A2-A0D0-10A-01W-A021-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3f20d0fe-aaa1-40f1-b2c1-7f070f93aef5	bbf1c43d-d7b3-4574-a074-d22ad537829c	g.chr8:130867866A>C	ENST00000519824.2	-	6	702	c.429T>G	c.(427-429)gaT>gaG	p.D143E	FAM49B_ENST00000401979.2_Missense_Mutation_p.D143E|FAM49B_ENST00000517654.1_Missense_Mutation_p.D143E|FAM49B_ENST00000522746.1_Missense_Mutation_p.D143E|FAM49B_ENST00000522941.1_5'UTR|FAM49B_ENST00000519110.1_Missense_Mutation_p.D143E|FAM49B_ENST00000519540.1_Missense_Mutation_p.D143E|FAM49B_ENST00000522250.1_5'UTR|FAM49B_ENST00000518879.1_5'UTR|FAM49B_ENST00000523509.1_Missense_Mutation_p.D143E	NM_016623.4	NP_057707.3	Q9NUQ9	FA49B_HUMAN	family with sequence similarity 49, member B	143						cilium (GO:0005929)|extracellular vesicular exosome (GO:0070062)				kidney(1)|large_intestine(6)|lung(4)|prostate(1)	12	Ovarian(5;0.000567)|Esophageal squamous(12;0.00693)|Acute lymphoblastic leukemia(118;0.155)		LUAD - Lung adenocarcinoma(14;0.0989)			CCTTGAGTTCATCAAACCGGA	0.408																																						dbGAP											0													75.0	78.0	77.0					8																	130867866		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF208851	CCDS6361.1	8q24	2004-08-20				ENSG00000153310			25216	protein-coding gene	gene with protein product							Standard	NM_001256763		Approved	BM-009	uc003ysu.4	Q9NUQ9		ENST00000519824.2:c.429T>G	8.37:g.130867866A>C	ENSP00000429150:p.Asp143Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q96AZ5|Q9NW21|Q9NZE7	Missense_Mutation	SNP	pfam_DUF1394	p.D143E	ENST00000519824.2	37	c.429	CCDS6361.1	8	.	.	.	.	.	.	.	.	.	.	A	24.4	4.524946	0.85600	.	.	ENSG00000153310	ENST00000522746;ENST00000523509;ENST00000401979;ENST00000519110;ENST00000519824;ENST00000517654;ENST00000519540;ENST00000311292;ENST00000519142	T;T;T;T;T;T;T;T	0.59224	0.28;0.28;0.28;0.28;0.28;0.28;0.28;0.28	6.16	3.78	0.43462	.	0.000000	0.85682	D	0.000000	T	0.77738	0.4175	M	0.90369	3.11	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	T	0.78703	-0.2101	10	0.87932	D	0	-21.4366	9.4604	0.38781	0.8532:0.0:0.1468:0.0	.	143	Q9NUQ9	FA49B_HUMAN	E	143;143;143;143;143;143;143;97;143	ENSP00000428117:D143E;ENSP00000429802:D143E;ENSP00000384880:D143E;ENSP00000429078:D143E;ENSP00000429150:D143E;ENSP00000430674:D143E;ENSP00000429499:D143E;ENSP00000430806:D143E	ENSP00000311651:D97E	D	-	3	2	FAM49B	130937048	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	1.990000	0.40717	0.556000	0.29098	-0.256000	0.11100	GAT	FAM49B	-	pfam_DUF1394	ENSG00000153310		0.408	FAM49B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM49B	HGNC	protein_coding	OTTHUMT00000380390.2	154	0.00	0	A	NM_016623		130867866	130867866	-1	no_errors	ENST00000401979	ensembl	human	known	69_37n	missense	153	33.77	78	SNP	1.000	C
FBXW7	55294	genome.wustl.edu	37	4	153247366	153247366	+	Missense_Mutation	SNP	C	C	T			TCGA-A2-A0D0-01A-11W-A019-09	TCGA-A2-A0D0-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3f20d0fe-aaa1-40f1-b2c1-7f070f93aef5	bbf1c43d-d7b3-4574-a074-d22ad537829c	g.chr4:153247366C>T	ENST00000281708.4	-	10	2665	c.1436G>A	c.(1435-1437)cGa>cAa	p.R479Q	FBXW7_ENST00000296555.5_Missense_Mutation_p.R361Q|FBXW7_ENST00000393956.3_Missense_Mutation_p.R303Q|FBXW7_ENST00000603548.1_Missense_Mutation_p.R479Q|FBXW7_ENST00000603841.1_Missense_Mutation_p.R479Q|FBXW7_ENST00000263981.5_Missense_Mutation_p.R399Q	NM_033632.3	NP_361014.1	Q969H0	FBXW7_HUMAN	F-box and WD repeat domain containing 7, E3 ubiquitin protein ligase	479					cellular response to DNA damage stimulus (GO:0006974)|cellular response to UV (GO:0034644)|lipid homeostasis (GO:0055088)|lung development (GO:0030324)|negative regulation of DNA endoreduplication (GO:0032876)|negative regulation of hepatocyte proliferation (GO:2000346)|negative regulation of Notch signaling pathway (GO:0045746)|negative regulation of SREBP signaling pathway (GO:2000639)|negative regulation of triglyceride biosynthetic process (GO:0010868)|Notch signaling pathway (GO:0007219)|positive regulation of epidermal growth factor-activated receptor activity (GO:0045741)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of oxidative stress-induced neuron intrinsic apoptotic signaling pathway (GO:1903378)|positive regulation of proteasomal protein catabolic process (GO:1901800)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000060)|positive regulation of ubiquitin-protein transferase activity (GO:0051443)|protein stabilization (GO:0050821)|protein ubiquitination (GO:0016567)|regulation of cell cycle G1/S phase transition (GO:1902806)|regulation of lipid storage (GO:0010883)|regulation of protein localization (GO:0032880)|SCF-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031146)|sister chromatid cohesion (GO:0007062)|vasculature development (GO:0001944)|vasculogenesis (GO:0001570)|viral process (GO:0016032)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|Parkin-FBXW7-Cul1 ubiquitin ligase complex (GO:1990452)|protein complex (GO:0043234)|SCF ubiquitin ligase complex (GO:0019005)	cyclin binding (GO:0030332)|identical protein binding (GO:0042802)|protein binding, bridging (GO:0030674)|sequence-specific DNA binding transcription factor activity (GO:0003700)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase activator activity (GO:0097027)	p.R479Q(29)|p.R479L(5)|p.R399Q(3)|p.R479P(2)|p.R240L(1)|p.R361P(1)|p.R399P(1)|p.?(1)|p.R361Q(1)|p.R399L(1)|p.R240Q(1)|p.R240P(1)		NS(1)|biliary_tract(8)|bone(1)|breast(5)|central_nervous_system(6)|cervix(2)|endometrium(36)|haematopoietic_and_lymphoid_tissue(159)|kidney(6)|large_intestine(155)|lung(31)|ovary(10)|pancreas(3)|prostate(2)|skin(6)|stomach(16)|upper_aerodigestive_tract(9)|urinary_tract(6)	462	all_hematologic(180;0.093)	Acute lymphoblastic leukemia(8;0.000629)|all_hematologic(8;0.067)				AGTGGCATCTCGAGAACCGCT	0.403			"""Mis, N, D, F"""		"""colorectal, endometrial, T-ALL"""																																	dbGAP		Rec	yes		4	4q31.3	55294	"""F-box and WD-40 domain protein 7 (archipelago homolog, Drosophila)"""		"""E, L"""	47	Substitution - Missense(46)|Unknown(1)	haematopoietic_and_lymphoid_tissue(16)|large_intestine(9)|endometrium(7)|urinary_tract(5)|upper_aerodigestive_tract(4)|lung(4)|stomach(1)|kidney(1)											85.0	80.0	82.0					4																	153247366		2203	4299	6502	-	-	-	SO:0001583	missense	0			AF411971	CCDS3777.1, CCDS3778.1, CCDS34078.1, CCDS64082.1	4q31.23	2013-01-09	2012-02-23					"""F-boxes / WD-40 domains"", ""WD repeat domain containing"""	16712	protein-coding gene	gene with protein product	"""archipelago homolog (Drosophila)"""	606278	"""F-box and WD-40 domain protein 7 (archipelago homolog, Drosophila)"", ""F-box and WD repeat domain containing 7"""			10531037, 11425854	Standard	NM_018315		Approved	AGO, FLJ11071, SEL-10, SEL10, FBW7, FBX30, CDC4, FBXW6	uc003ims.3	Q969H0		ENST00000281708.4:c.1436G>A	4.37:g.153247366C>T	ENSP00000281708:p.Arg479Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	B7ZLP9|Q68DR0|Q96A16|Q96LE0|Q96RI2|Q9NUX6	Missense_Mutation	SNP	pfam_WD40_repeat,pfam_F-box_dom_cyclin-like,superfamily_WD40_repeat_dom,superfamily_F-box_dom_cyclin-like,smart_F-box_dom_cyclin-like,smart_WD40_repeat,prints_G-protein_beta_WD-40_rep,pfscan_F-box_dom_cyclin-like,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.R479Q	ENST00000281708.4	37	c.1436	CCDS3777.1	4	.	.	.	.	.	.	.	.	.	.	C	33	5.283775	0.95489	.	.	ENSG00000109670	ENST00000281708;ENST00000296555;ENST00000263981;ENST00000393956	T;T;T;T	0.40756	1.02;1.02;1.02;1.02	5.72	5.72	0.89469	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40 repeat, conserved site (1);WD40-repeat-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.50222	0.1603	N	0.12527	0.23	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;1.0;1.0;1.0	T	0.56529	-0.7964	10	0.56958	D	0.05	-12.7081	20.2406	0.98372	0.0:1.0:0.0:0.0	.	303;479;361;399	B7Z2C8;Q969H0;Q969H0-4;Q969H0-2	.;FBXW7_HUMAN;.;.	Q	479;361;399;303	ENSP00000281708:R479Q;ENSP00000296555:R361Q;ENSP00000263981:R399Q;ENSP00000377528:R303Q	ENSP00000263981:R399Q	R	-	2	0	FBXW7	153466816	1.000000	0.71417	1.000000	0.80357	0.974000	0.67602	7.715000	0.84713	2.857000	0.98124	0.650000	0.86243	CGA	FBXW7	-	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,prints_G-protein_beta_WD-40_rep,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	ENSG00000109670		0.403	FBXW7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FBXW7	HGNC	protein_coding	OTTHUMT00000469956.1	139	0.00	0	C			153247366	153247366	-1	no_errors	ENST00000281708	ensembl	human	known	69_37n	missense	47	70.06	110	SNP	1.000	T
FAT1	2195	genome.wustl.edu	37	4	187627851	187627851	+	Missense_Mutation	SNP	T	T	C			TCGA-A2-A0D0-01A-11W-A019-09	TCGA-A2-A0D0-10A-01W-A021-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3f20d0fe-aaa1-40f1-b2c1-7f070f93aef5	bbf1c43d-d7b3-4574-a074-d22ad537829c	g.chr4:187627851T>C	ENST00000441802.2	-	2	3340	c.3131A>G	c.(3130-3132)aAa>aGa	p.K1044R		NM_005245.3	NP_005236.2	Q14517	FAT1_HUMAN	FAT atypical cadherin 1	1044	Cadherin 9. {ECO:0000255|PROSITE- ProRule:PRU00043}.				actin filament organization (GO:0007015)|anatomical structure morphogenesis (GO:0009653)|cell adhesion (GO:0007155)|cell migration (GO:0016477)|cell-cell signaling (GO:0007267)|establishment or maintenance of cell polarity (GO:0007163)|homophilic cell adhesion (GO:0007156)|single organismal cell-cell adhesion (GO:0016337)	cell-cell junction (GO:0005911)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|lamellipodium (GO:0030027)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(3)|central_nervous_system(3)|endometrium(38)|haematopoietic_and_lymphoid_tissue(2)|kidney(12)|large_intestine(33)|lung(88)|ovary(13)|pancreas(2)|prostate(16)|skin(2)|upper_aerodigestive_tract(11)|urinary_tract(4)	228						TGCATCTTCTTTCACTGTCCC	0.483										HNSCC(5;0.00058)																											Colon(197;1040 2055 4143 4984 49344)	dbGAP											0													132.0	132.0	132.0					4																	187627851		1998	4166	6164	-	-	-	SO:0001583	missense	0			X87241	CCDS47177.1	4q35.2	2013-05-31	2013-05-31	2008-10-30	ENSG00000083857	ENSG00000083857		"""Cadherins / Cadherin-related"""	3595	protein-coding gene	gene with protein product	"""cadherin-related family member 8"""	600976	"""FAT tumor suppressor (Drosophila) homolog"", ""FAT tumor suppressor homolog 1 (Drosophila)"""	FAT		8586420	Standard	XM_005262834		Approved	CDHF7, CDHR8	uc003izf.3	Q14517	OTTHUMG00000160320	ENST00000441802.2:c.3131A>G	4.37:g.187627851T>C	ENSP00000406229:p.Lys1044Arg	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Cadherin,pfam_Laminin_G,pfam_EGF-like_dom,pfam_EGF-like_Ca-bd,superfamily_ConA-like_lec_gl,superfamily_Cadherin-like,smart_Cadherin,smart_EGF-like,smart_Laminin_G,smart_EGF-like_Ca-bd,prints_Cadherin,pfscan_EG-like_dom,pfscan_Laminin_G,pfscan_Cadherin	p.K1044R	ENST00000441802.2	37	c.3131	CCDS47177.1	4	.	.	.	.	.	.	.	.	.	.	T	8.124	0.781528	0.16120	.	.	ENSG00000083857	ENST00000441802;ENST00000260147	T	0.51817	0.69	4.99	3.8	0.43715	Cadherin (3);Cadherin-like (1);	0.151014	0.64402	N	0.000018	T	0.25306	0.0615	N	0.10782	0.045	0.48975	D	0.999731	B	0.19935	0.04	B	0.24269	0.052	T	0.04693	-1.0933	10	0.16420	T	0.52	.	8.1197	0.30963	0.0:0.1562:0.0:0.8438	.	1044	Q14517	FAT1_HUMAN	R	1044	ENSP00000406229:K1044R	ENSP00000260147:K1044R	K	-	2	0	FAT1	187864845	1.000000	0.71417	0.497000	0.27552	0.005000	0.04900	3.402000	0.52608	0.914000	0.36822	0.482000	0.46254	AAA	FAT1	-	pfam_Cadherin,superfamily_Cadherin-like,pfscan_Cadherin	ENSG00000083857		0.483	FAT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAT1	HGNC	protein_coding	OTTHUMT00000360209.3	195	0.00	0	T	NM_005245		187627851	187627851	-1	no_errors	ENST00000441802	ensembl	human	known	69_37n	missense	49	48.42	46	SNP	0.954	C
GPR128	84873	genome.wustl.edu	37	3	100354667	100354667	+	Silent	SNP	T	T	G			TCGA-A2-A0D0-01A-11W-A019-09	TCGA-A2-A0D0-10A-01W-A021-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3f20d0fe-aaa1-40f1-b2c1-7f070f93aef5	bbf1c43d-d7b3-4574-a074-d22ad537829c	g.chr3:100354667T>G	ENST00000273352.3	+	5	862	c.594T>G	c.(592-594)ccT>ccG	p.P198P	GPR128_ENST00000475887.1_5'UTR	NM_032787.2	NP_116176.2	Q96K78	GP128_HUMAN	G protein-coupled receptor 128	198					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			NS(1)|autonomic_ganglia(1)|breast(2)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(9)|liver(2)|lung(20)|ovary(3)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(2)	56						ATGCTTCACCTGAGGTAAAAC	0.368																																					Pancreas(87;185 1975 7223 18722)	dbGAP											0													54.0	52.0	53.0					3																	100354667		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK027360	CCDS2938.1	3q12.3	2014-08-08			ENSG00000144820	ENSG00000144820		"""-"", ""GPCR / Class B : Orphans"""	19241	protein-coding gene	gene with protein product		612307					Standard	NM_032787		Approved	FLJ14454	uc003duc.3	Q96K78	OTTHUMG00000159083	ENST00000273352.3:c.594T>G	3.37:g.100354667T>G		Somatic		WXS	Illumina GAIIx	Phase_IV	Q14D94|Q86SQ2	Silent	SNP	pfam_GPCR_2_secretin-like,pfam_GPS_dom,smart_GPS_dom,prints_GPCR_2_secretin-like,pfscan_GPS_dom,pfscan_GPCR_2-like	p.P198	ENST00000273352.3	37	c.594	CCDS2938.1	3																																																																																			GPR128	-	NULL	ENSG00000144820		0.368	GPR128-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR128	HGNC	protein_coding	OTTHUMT00000353236.1	114	0.00	0	T			100354667	100354667	+1	no_errors	ENST00000273352	ensembl	human	known	69_37n	silent	125	37.50	75	SNP	0.008	G
GREB1	9687	genome.wustl.edu	37	2	11773164	11773164	+	Missense_Mutation	SNP	G	G	A			TCGA-A2-A0D0-01A-11W-A019-09	TCGA-A2-A0D0-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3f20d0fe-aaa1-40f1-b2c1-7f070f93aef5	bbf1c43d-d7b3-4574-a074-d22ad537829c	g.chr2:11773164G>A	ENST00000381486.2	+	28	5266	c.4966G>A	c.(4966-4968)Gtc>Atc	p.V1656I	GREB1_ENST00000396123.1_Missense_Mutation_p.V654I|GREB1_ENST00000234142.5_Missense_Mutation_p.V1656I	NM_014668.3	NP_055483.2	Q4ZG55	GREB1_HUMAN	growth regulation by estrogen in breast cancer 1	1656						integral component of membrane (GO:0016021)				breast(3)|central_nervous_system(2)|endometrium(2)|kidney(4)|large_intestine(9)|lung(9)|ovary(1)	30	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)			Epithelial(75;0.115)|OV - Ovarian serous cystadenocarcinoma(76;0.186)		CGTGGTGGATGTCAACTCTGC	0.567																																					Ovarian(39;850 945 2785 23371 33093)	dbGAP											0													126.0	136.0	133.0					2																	11773164		2157	4253	6410	-	-	-	SO:0001583	missense	0				CCDS33146.1, CCDS33147.1, CCDS42655.1	2p25.1	2010-02-17	2009-09-10		ENSG00000196208	ENSG00000196208			24885	protein-coding gene	gene with protein product	"""gene regulated by estrogen in breast cancer"""	611736				11103799	Standard	NM_014668		Approved	KIAA0575	uc002rbk.1	Q4ZG55	OTTHUMG00000141276	ENST00000381486.2:c.4966G>A	2.37:g.11773164G>A	ENSP00000370896:p.Val1656Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NHD0|A6NKN0|B5MDA9|O60321|Q7Z5S2|Q9H2Q6|Q9H2Q7|Q9H2Q8	Missense_Mutation	SNP	NULL	p.V1656I	ENST00000381486.2	37	c.4966	CCDS42655.1	2	.	.	.	.	.	.	.	.	.	.	G	6.293	0.422105	0.11928	.	.	ENSG00000196208	ENST00000381486;ENST00000234142;ENST00000396123	T;T;T	0.47528	0.84;0.84;0.84	5.3	2.51	0.30379	.	0.205916	0.38326	N	0.001734	T	0.36771	0.0979	L	0.39147	1.195	0.24826	N	0.992557	B	0.09022	0.002	B	0.12837	0.008	T	0.26849	-1.0091	10	0.39692	T	0.17	-16.7279	10.7177	0.46021	0.2111:0.0:0.7889:0.0	.	1656	Q4ZG55	GREB1_HUMAN	I	1656;1656;654	ENSP00000370896:V1656I;ENSP00000234142:V1656I;ENSP00000379429:V654I	ENSP00000234142:V1656I	V	+	1	0	GREB1	11690615	0.856000	0.29760	0.007000	0.13788	0.027000	0.11550	1.321000	0.33678	0.629000	0.30376	-0.262000	0.10625	GTC	GREB1	-	NULL	ENSG00000196208		0.567	GREB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GREB1	HGNC	protein_coding	OTTHUMT00000280490.1	91	0.00	0	G	NM_014668		11773164	11773164	+1	no_errors	ENST00000234142	ensembl	human	known	69_37n	missense	200	15.25	36	SNP	0.203	A
HECTD4	283450	genome.wustl.edu	37	12	112607429	112607429	+	Missense_Mutation	SNP	C	C	G			TCGA-A2-A0D0-01A-11W-A019-09	TCGA-A2-A0D0-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3f20d0fe-aaa1-40f1-b2c1-7f070f93aef5	bbf1c43d-d7b3-4574-a074-d22ad537829c	g.chr12:112607429C>G	ENST00000430131.2	-	69	11965	c.10820G>C	c.(10819-10821)tGt>tCt	p.C3607S	HECTD4_ENST00000550722.1_Missense_Mutation_p.C3883S|HECTD4_ENST00000377560.5_Missense_Mutation_p.C3857S			Q9Y4D8	HECD4_HUMAN	HECT domain containing E3 ubiquitin protein ligase 4	3607					glucose homeostasis (GO:0042593)|glucose metabolic process (GO:0006006)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)										GGCAGCCTGACAGAAGTAGGA	0.592																																						dbGAP											0													45.0	52.0	50.0					12																	112607429		2034	4190	6224	-	-	-	SO:0001583	missense	0			AK091473		12q24.13	2013-07-17	2012-08-14	2012-08-14	ENSG00000173064	ENSG00000173064			26611	protein-coding gene	gene with protein product			"""chromosome 12 open reading frame 51"""	C12orf51		21270382	Standard	NM_001109662		Approved	FLJ34154, KIAA0614	uc021reb.1	Q9Y4D8	OTTHUMG00000150719	ENST00000430131.2:c.10820G>C	12.37:g.112607429C>G	ENSP00000404379:p.Cys3607Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	L8B0P6|Q3MJD5|Q6P0A0|Q7L530|Q8NB70|Q8WU73|Q96NT9|Q9NZS4|Q9UFT6	Missense_Mutation	SNP	pfam_HECT,superfamily_HECT,superfamily_ConA-like_lec_gl,smart_HECT,pfscan_HECT	p.C3857S	ENST00000430131.2	37	c.11570		12	.	.	.	.	.	.	.	.	.	.	C	17.82	3.482099	0.63849	.	.	ENSG00000173064	ENST00000377560;ENST00000430131;ENST00000550722;ENST00000547085	T;T;T	0.44482	0.92;0.93;0.92	5.88	5.88	0.94601	.	.	.	.	.	T	0.50000	0.1590	N	0.14661	0.345	0.58432	D	0.999999	P	0.50156	0.932	D	0.63597	0.916	T	0.55224	-0.8174	9	0.72032	D	0.01	.	20.2207	0.98324	0.0:1.0:0.0:0.0	.	3607	Q9Y4D8	K0614_HUMAN	S	3857;3607;3883;72	ENSP00000366783:C3857S;ENSP00000404379:C3607S;ENSP00000449784:C3883S	ENSP00000366783:C3857S	C	-	2	0	C12orf51	111091812	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.304000	0.78882	2.790000	0.95986	0.591000	0.81541	TGT	HECTD4	-	NULL	ENSG00000173064		0.592	HECTD4-202	KNOWN	basic	protein_coding	HECTD4	HGNC	protein_coding		35	0.00	0	C	NM_173813		112607429	112607429	-1	no_errors	ENST00000377560	ensembl	human	known	69_37n	missense	9	43.75	7	SNP	1.000	G
KCNJ15	3772	genome.wustl.edu	37	21	39671648	39671648	+	Missense_Mutation	SNP	G	G	T			TCGA-A2-A0D0-01A-11W-A019-09	TCGA-A2-A0D0-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3f20d0fe-aaa1-40f1-b2c1-7f070f93aef5	bbf1c43d-d7b3-4574-a074-d22ad537829c	g.chr21:39671648G>T	ENST00000328656.4	+	4	768	c.465G>T	c.(463-465)ttG>ttT	p.L155F	KCNJ15_ENST00000398930.1_Missense_Mutation_p.L155F|KCNJ15_ENST00000398938.2_Missense_Mutation_p.L155F|KCNJ15_ENST00000398932.1_Missense_Mutation_p.L155F|KCNJ15_ENST00000398934.1_Missense_Mutation_p.L155F	NM_001276437.1|NM_001276438.1|NM_001276439.1|NM_002243.3	NP_001263366.1|NP_001263367.1|NP_001263368.1|NP_002234.2	Q99712	KCJ15_HUMAN	potassium inwardly-rectifying channel, subfamily J, member 15	155					potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	inward rectifier potassium channel activity (GO:0005242)			autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|kidney(2)|large_intestine(4)|lung(6)|ovary(2)|prostate(2)|skin(3)|urinary_tract(1)	24					Yohimbine(DB01392)	TCACGACCTTGATTGAGATCT	0.512																																						dbGAP											0													85.0	81.0	82.0					21																	39671648		2203	4300	6503	-	-	-	SO:0001583	missense	0			Y10745	CCDS13656.1	21q22.2	2011-07-05			ENSG00000157551	ENSG00000157551		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Inwardly rectifying"""	6261	protein-coding gene	gene with protein product		602106				9299242, 8995301, 16382105	Standard	NM_170736		Approved	Kir4.2, Kir1.3, IRKK	uc002ywx.4	Q99712	OTTHUMG00000090609	ENST00000328656.4:c.465G>T	21.37:g.39671648G>T	ENSP00000331698:p.Leu155Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DSH5|O00564|Q96L28|Q99446	Missense_Mutation	SNP	pfam_K_chnl_inward-rec_Kir_Cr2,superfamily_Ig_E-set,pirsf_K_chnl_inward-rec_Kir,prints_K_chnl_inward-rec_Kir1.3,prints_K_chnl_inward-rec_Kir_Cr2,prints_K_chnl_inward-rec_Kir1.1	p.L155F	ENST00000328656.4	37	c.465	CCDS13656.1	21	.	.	.	.	.	.	.	.	.	.	G	13.84	2.355714	0.41700	.	.	ENSG00000157551	ENST00000328656;ENST00000398928;ENST00000398938;ENST00000398932;ENST00000438657;ENST00000398930;ENST00000398934;ENST00000398927	D;D;D;D;D;D;D;D	0.94966	-3.57;-3.57;-3.57;-3.57;-3.57;-3.57;-3.57;-3.57	5.83	4.02	0.46733	Immunoglobulin E-set (1);Potassium channel, inwardly rectifying, Kir, conserved region 2 (1);	0.000000	0.64402	D	0.000002	D	0.94132	0.8118	L	0.39085	1.19	0.47341	D	0.999394	D	0.63880	0.993	D	0.67382	0.951	D	0.92521	0.6025	9	.	.	.	.	9.126	0.36816	0.2743:0.0:0.7257:0.0	.	155	Q99712	IRK15_HUMAN	F	155	ENSP00000331698:L155F;ENSP00000381902:L155F;ENSP00000381911:L155F;ENSP00000381905:L155F;ENSP00000414487:L155F;ENSP00000381904:L155F;ENSP00000381907:L155F;ENSP00000381901:L155F	.	L	+	3	2	KCNJ15	38593518	0.989000	0.36119	0.998000	0.56505	0.494000	0.33585	0.189000	0.17037	1.484000	0.48361	0.655000	0.94253	TTG	KCNJ15	-	pfam_K_chnl_inward-rec_Kir_Cr2,superfamily_Ig_E-set,pirsf_K_chnl_inward-rec_Kir	ENSG00000157551		0.512	KCNJ15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNJ15	HGNC	protein_coding	OTTHUMT00000207181.2	149	0.00	0	G	NM_002243		39671648	39671648	+1	no_errors	ENST00000328656	ensembl	human	known	69_37n	missense	38	64.49	69	SNP	0.988	T
KHDRBS1	10657	genome.wustl.edu	37	1	32502510	32502510	+	Splice_Site	SNP	G	G	A			TCGA-A2-A0D0-01A-11W-A019-09	TCGA-A2-A0D0-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3f20d0fe-aaa1-40f1-b2c1-7f070f93aef5	bbf1c43d-d7b3-4574-a074-d22ad537829c	g.chr1:32502510G>A	ENST00000327300.7	+	5	938		c.e5-1		KHDRBS1_ENST00000307714.8_Splice_Site|KHDRBS1_ENST00000492989.1_Splice_Site	NM_006559.1	NP_006550.1			KH domain containing, RNA binding, signal transduction associated 1											endometrium(4)|kidney(1)|large_intestine(3)|lung(5)|ovary(1)	14		Myeloproliferative disorder(586;0.0393)|all_neural(195;0.186)				TTCGTTCCCAGGATATGATGG	0.468																																					Ovarian(173;401 1982 12359 31110 42403)	dbGAP											0													148.0	138.0	141.0					1																	32502510		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			U78971	CCDS350.1, CCDS60067.1	1p32	2008-07-18			ENSG00000121774	ENSG00000121774			18116	protein-coding gene	gene with protein product	"""GAP-associated tyrosine phosphoprotein p62 (Sam68)"""	602489				1374686, 10564820	Standard	NM_006559		Approved	Sam68, p62, FLJ34027	uc001bub.4	Q07666	OTTHUMG00000003921	ENST00000327300.7:c.772-1G>A	1.37:g.32502510G>A		Somatic		WXS	Illumina GAIIx	Phase_IV		Splice_Site	SNP	-	e5-1	ENST00000327300.7	37	c.772-1	CCDS350.1	1	.	.	.	.	.	.	.	.	.	.	G	21.0	4.074483	0.76415	.	.	ENSG00000121774	ENST00000327300;ENST00000492989;ENST00000355201	.	.	.	5.06	5.06	0.68205	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	17.1359	0.86739	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	KHDRBS1	32275097	1.000000	0.71417	1.000000	0.80357	0.750000	0.42670	7.842000	0.86851	2.749000	0.94314	0.551000	0.68910	.	KHDRBS1	-	-	ENSG00000121774		0.468	KHDRBS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KHDRBS1	HGNC	protein_coding	OTTHUMT00000011199.4	195	0.00	0	G	NM_006559	Intron	32502510	32502510	+1	no_errors	ENST00000327300	ensembl	human	known	69_37n	splice_site	186	16.59	37	SNP	1.000	A
KCNN3	3782	genome.wustl.edu	37	1	154841540	154841540	+	Missense_Mutation	SNP	C	C	G			TCGA-A2-A0D0-01A-11W-A019-09	TCGA-A2-A0D0-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3f20d0fe-aaa1-40f1-b2c1-7f070f93aef5	bbf1c43d-d7b3-4574-a074-d22ad537829c	g.chr1:154841540C>G	ENST00000271915.4	-	1	1216	c.901G>C	c.(901-903)Gag>Cag	p.E301Q	KCNN3_ENST00000358505.2_5'Flank	NM_001204087.1|NM_002249.5	NP_001191016.1|NP_002240.3	Q9UGI6	KCNN3_HUMAN	potassium intermediate/small conductance calcium-activated channel, subfamily N, member 3	306					potassium ion transmembrane transport (GO:0071805)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	calmodulin binding (GO:0005516)|small conductance calcium-activated potassium channel activity (GO:0016286)			cervix(1)|endometrium(3)|kidney(2)|large_intestine(6)|lung(11)|prostate(4)|skin(1)	28	all_lung(78;2.29e-27)|all_hematologic(923;0.088)|Hepatocellular(266;0.108)|all_neural(408;0.245)		BRCA - Breast invasive adenocarcinoma(34;0.00819)		Miconazole(DB01110)|Procaine(DB00721)	AGCTCGGTCTCTATCACCATA	0.443																																						dbGAP											0													155.0	152.0	153.0					1																	154841540		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF031815	CCDS1072.1, CCDS30880.1, CCDS72928.1	1q21.3	2012-07-05			ENSG00000143603	ENSG00000143603		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, calcium-activated"""	6292	protein-coding gene	gene with protein product		602983				9491810, 16382103	Standard	NM_002249		Approved	KCa2.3, hSK3, SKCA3	uc021pah.1	Q9UGI6	OTTHUMG00000037260	ENST00000271915.4:c.901G>C	1.37:g.154841540C>G	ENSP00000271915:p.Glu301Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	B1ANX0|O43517|Q86VF9|Q8WXG7	Missense_Mutation	SNP	pfam_K_chnl_Ca-activ_SK,pfam_CaM-bd_dom,pfam_Ion_trans_2,superfamily_CaM-bd_dom,prints_K_chnl_Ca-activ_SK	p.E301Q	ENST00000271915.4	37	c.901	CCDS30880.1	1	.	.	.	.	.	.	.	.	.	.	C	20.8	4.045404	0.75846	.	.	ENSG00000143603	ENST00000271915	D	0.97430	-4.38	4.88	4.88	0.63580	Potassium channel, calcium-activated, SK, conserved region (1);	0.000000	0.48286	D	0.000190	D	0.98654	0.9549	M	0.91872	3.25	0.80722	D	1	D;D	0.89917	1.0;0.997	D;D	0.87578	0.998;0.995	D	0.99597	1.0977	10	0.87932	D	0	-29.0253	15.5798	0.76425	0.0:1.0:0.0:0.0	.	307;306	Q6JXY2;Q9UGI6	.;KCNN3_HUMAN	Q	301	ENSP00000271915:E301Q	ENSP00000271915:E301Q	E	-	1	0	KCNN3	153108164	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.428000	0.80296	2.530000	0.85305	0.655000	0.94253	GAG	KCNN3	-	pfam_K_chnl_Ca-activ_SK	ENSG00000143603		0.443	KCNN3-001	NOVEL	basic|appris_principal|CCDS	protein_coding	KCNN3	HGNC	protein_coding	OTTHUMT00000090688.3	219	0.00	0	C	NM_002249		154841540	154841540	-1	no_errors	ENST00000271915	ensembl	human	known	69_37n	missense	301	20.16	76	SNP	1.000	G
KIAA1147	57189	genome.wustl.edu	37	7	141362534	141362534	+	Missense_Mutation	SNP	G	G	C			TCGA-A2-A0D0-01A-11W-A019-09	TCGA-A2-A0D0-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3f20d0fe-aaa1-40f1-b2c1-7f070f93aef5	bbf1c43d-d7b3-4574-a074-d22ad537829c	g.chr7:141362534G>C	ENST00000536163.1	-	9	1289	c.1290C>G	c.(1288-1290)gaC>gaG	p.D430E	RP5-894A10.6_ENST00000602609.1_RNA|KIAA1147_ENST00000482493.1_Missense_Mutation_p.D326E	NM_001080392.1	NP_001073861.1	A4D1U4	LCHN_HUMAN	KIAA1147	430										breast(3)|endometrium(4)|kidney(2)|large_intestine(1)|ovary(1)|skin(1)	12	Melanoma(164;0.0171)					GAAAGCTCCGGTCTCCTTGGG	0.562																																						dbGAP											0													40.0	42.0	41.0					7																	141362534		1922	4135	6057	-	-	-	SO:0001583	missense	0			AB032973	CCDS47726.1	7q34	2012-10-04			ENSG00000257093	ENSG00000257093			29472	protein-coding gene	gene with protein product							Standard	NM_001080392		Approved	LCHN	uc003vwk.3	A4D1U4	OTTHUMG00000157539	ENST00000536163.1:c.1290C>G	7.37:g.141362534G>C	ENSP00000445768:p.Asp430Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q9ULS3	Missense_Mutation	SNP	pfam_DUF2347	p.D430E	ENST00000536163.1	37	c.1290	CCDS47726.1	7	.	.	.	.	.	.	.	.	.	.	G	20.1	3.931888	0.73442	.	.	ENSG00000257093	ENST00000536163;ENST00000482493	.	.	.	5.41	2.53	0.30540	.	0.053491	0.85682	D	0.000000	T	0.69196	0.3084	M	0.68952	2.095	0.44719	D	0.997715	D	0.76494	0.999	D	0.85130	0.997	T	0.68420	-0.5413	9	0.87932	D	0	-27.4278	7.4271	0.27105	0.2137:0.1235:0.6627:0.0	.	430	A4D1U4	LCHN_HUMAN	E	430;326	.	ENSP00000297761:D430E	D	-	3	2	KIAA1147	141009003	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	1.661000	0.37408	0.624000	0.30286	0.591000	0.81541	GAC	KIAA1147	-	NULL	ENSG00000257093		0.562	KIAA1147-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA1147	HGNC	protein_coding	OTTHUMT00000349104.1	29	0.00	0	G			141362534	141362534	-1	no_errors	ENST00000536163	ensembl	human	known	69_37n	missense	65	35.00	35	SNP	1.000	C
LILRB5	10990	genome.wustl.edu	37	19	54754872	54754873	+	Intron	INS	-	-	A			TCGA-A2-A0D0-01A-11W-A019-09	TCGA-A2-A0D0-10A-01W-A021-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3f20d0fe-aaa1-40f1-b2c1-7f070f93aef5	bbf1c43d-d7b3-4574-a074-d22ad537829c	g.chr19:54754872_54754873insA	ENST00000316219.5	-	13	1734				CTD-2337J16.1_ENST00000595133.1_lincRNA|LILRB5_ENST00000449561.2_Intron|LILRB5_ENST00000450632.1_Frame_Shift_Ins_p.R588fs|LILRB5_ENST00000345866.6_Intron	NM_001081442.1|NM_006840.3	NP_001074911.1|NP_006831.1	O75023	LIRB5_HUMAN	leukocyte immunoglobulin-like receptor, subfamily B (with TM and ITIM domains), member 5						cell surface receptor signaling pathway (GO:0007166)|defense response (GO:0006952)|immune system process (GO:0002376)	integral component of membrane (GO:0016021)	transmembrane signaling receptor activity (GO:0004888)			NS(1)|breast(1)|endometrium(3)|kidney(5)|large_intestine(12)|lung(25)|ovary(1)|pancreas(1)|prostate(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	56	all_cancers(19;0.00681)|all_epithelial(19;0.00368)|all_lung(19;0.016)|Lung NSC(19;0.0296)|Ovarian(34;0.19)			GBM - Glioblastoma multiforme(193;0.105)		GGAAAGGACTCTCTCAGTGTCC	0.609																																						dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			AF025534	CCDS12885.1, CCDS42611.1, CCDS46176.1	19q13.4	2013-01-11			ENSG00000105609	ENSG00000105609		"""Leukocyte immunoglobulin-like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6609	protein-coding gene	gene with protein product		604814				9548455	Standard	NM_006840		Approved	LIR-8, LIR8, CD85c	uc002qey.3	O75023	OTTHUMG00000066636	ENST00000316219.5:c.1627-76->T	19.37:g.54754872_54754873insA		Somatic		WXS	Illumina GAIIx	Phase_IV	Q8N760	Frame_Shift_Ins	INS	smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	p.R588fs	ENST00000316219.5	37	c.1763_1762	CCDS12885.1	19																																																																																			LILRB5	-	NULL	ENSG00000105609		0.609	LILRB5-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	LILRB5	HGNC	protein_coding	OTTHUMT00000142877.2	55	0.00	0	-			54754872	54754873	-1	no_errors	ENST00000450632	ensembl	human	known	69_37n	frame_shift_ins	48	11.11	6	INS	0.000:0.000	A
MRPL52	122704	genome.wustl.edu	37	14	23302667	23302667	+	Silent	SNP	A	A	G			TCGA-A2-A0D0-01A-11W-A019-09	TCGA-A2-A0D0-10A-01W-A021-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3f20d0fe-aaa1-40f1-b2c1-7f070f93aef5	bbf1c43d-d7b3-4574-a074-d22ad537829c	g.chr14:23302667A>G	ENST00000355151.5	+	4	228	c.198A>G	c.(196-198)agA>agG	p.R66R	MRPL52_ENST00000432849.3_Silent_p.R65R|MRPL52_ENST00000553711.1_Silent_p.R7R|MRPL52_ENST00000461594.1_3'UTR|MRPL52_ENST00000555536.1_Silent_p.R7R|MRPL52_ENST00000397496.3_Silent_p.R65R|MRPL52_ENST00000555345.1_Silent_p.R7R|MRPL52_ENST00000556840.1_Silent_p.R7R|MRPL52_ENST00000397505.2_Intron|MRPL52_ENST00000311892.6_Intron|MRPL52_ENST00000557221.1_Intron	NM_178336.2|NM_180982.2|NM_181306.2	NP_848026.1|NP_851313.1|NP_851823.1	Q86TS9	RM52_HUMAN	mitochondrial ribosomal protein L52	66					translation (GO:0006412)	mitochondrial large ribosomal subunit (GO:0005762)	structural constituent of ribosome (GO:0003735)					all_cancers(95;9.47e-05)			GBM - Glioblastoma multiforme(265;0.00551)		AGCTTCGAAGAAAAGCTGAAA	0.473																																						dbGAP											0													107.0	90.0	96.0					14																	23302667		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK000450	CCDS9575.1, CCDS9576.1, CCDS41917.1, CCDS41918.1	14q11.2	2012-09-13			ENSG00000172590	ENSG00000172590		"""Mitochondrial ribosomal proteins / large subunits"""	16655	protein-coding gene	gene with protein product		611856				11551941, 11943462	Standard	NM_178336		Approved		uc001wgw.4	Q86TS9	OTTHUMG00000028703	ENST00000355151.5:c.198A>G	14.37:g.23302667A>G		Somatic		WXS	Illumina GAIIx	Phase_IV	A6NMQ8|A8MXK5|A8MYI6|G3XCN9|Q6NVH8	Silent	SNP	NULL	p.R66	ENST00000355151.5	37	c.198	CCDS41917.1	14																																																																																			MRPL52	-	NULL	ENSG00000172590		0.473	MRPL52-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MRPL52	HGNC	protein_coding	OTTHUMT00000071657.4	154	0.00	0	A	NM_180982		23302667	23302667	+1	no_errors	ENST00000355151	ensembl	human	known	69_37n	silent	118	32.57	57	SNP	0.995	G
MRPS7	51081	genome.wustl.edu	37	17	73261941	73261941	+	Silent	SNP	G	G	A			TCGA-A2-A0D0-01A-11W-A019-09	TCGA-A2-A0D0-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3f20d0fe-aaa1-40f1-b2c1-7f070f93aef5	bbf1c43d-d7b3-4574-a074-d22ad537829c	g.chr17:73261941G>A	ENST00000245539.6	+	5	893	c.666G>A	c.(664-666)agG>agA	p.R222R	MRPS7_ENST00000579002.1_Silent_p.R251R	NM_015971.3	NP_057055.2	Q9Y2R9	RT07_HUMAN	mitochondrial ribosomal protein S7	222					translation (GO:0006412)	cytosolic small ribosomal subunit (GO:0022627)|mitochondrion (GO:0005739)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|structural constituent of ribosome (GO:0003735)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|lung(2)	6	all_cancers(13;1.25e-07)|all_epithelial(9;2.63e-08)|Breast(9;1.06e-07)		all cancers(21;3.02e-07)|Epithelial(20;2.92e-06)			TGATCAAGAGGAAGCATGACT	0.602																																						dbGAP											0													77.0	72.0	73.0					17																	73261941		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB051348	CCDS11718.1	17q25.1	2012-09-13				ENSG00000125445		"""Mitochondrial ribosomal proteins / small subunits"""	14499	protein-coding gene	gene with protein product		611974					Standard	NM_015971		Approved	MRP-S, RP-S7, RPMS7	uc002jnm.4	Q9Y2R9		ENST00000245539.6:c.666G>A	17.37:g.73261941G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B2R9N5|Q53GD6	Missense_Mutation	SNP	pfam_Ribosomal_S7_dom,superfamily_Ribosomal_S7_dom	p.E152K	ENST00000245539.6	37	c.454	CCDS11718.1	17																																																																																			MRPS7	-	pfam_Ribosomal_S7_dom,superfamily_Ribosomal_S7_dom	ENSG00000125445		0.602	MRPS7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MRPS7	HGNC	protein_coding	OTTHUMT00000446666.1	50	0.00	0	G	NM_015971		73261941	73261941	+1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000581993	ensembl	human	putative	69_37n	missense	28	24.32	9	SNP	0.899	A
MYH7B	57644	genome.wustl.edu	37	20	33575611	33575611	+	Missense_Mutation	SNP	G	G	C			TCGA-A2-A0D0-01A-11W-A019-09	TCGA-A2-A0D0-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3f20d0fe-aaa1-40f1-b2c1-7f070f93aef5	bbf1c43d-d7b3-4574-a074-d22ad537829c	g.chr20:33575611G>C	ENST00000262873.7	+	16	1528	c.1436G>C	c.(1435-1437)cGg>cCg	p.R479P	MIR499A_ENST00000384903.1_RNA	NM_020884.3	NP_065935.2	A7E2Y1	MYH7B_HUMAN	myosin, heavy chain 7B, cardiac muscle, beta	437	Myosin motor.					membrane (GO:0016020)|myosin filament (GO:0032982)	ATP binding (GO:0005524)|motor activity (GO:0003774)			NS(2)|breast(5)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(8)|lung(19)|ovary(5)|prostate(3)|upper_aerodigestive_tract(2)|urinary_tract(3)	54			BRCA - Breast invasive adenocarcinoma(18;0.00691)			ACCTATGACCGGCTGTTCAGG	0.637																																						dbGAP											0													52.0	61.0	58.0					20																	33575611		2103	4255	6358	-	-	-	SO:0001583	missense	0			AB040945	CCDS42869.1	20q11	2011-09-27	2006-09-29		ENSG00000078814	ENSG00000078814		"""Myosins / Myosin superfamily : Class II"""	15906	protein-coding gene	gene with protein product		609928	"""myosin, heavy polypeptide 7B, cardiac muscle, beta"""			11919279, 15014174	Standard	XM_006723839		Approved	KIAA1512, dJ756N5.1, MYH14, MHC14	uc002xbi.2	A7E2Y1	OTTHUMG00000032320	ENST00000262873.7:c.1436G>C	20.37:g.33575611G>C	ENSP00000262873:p.Arg479Pro	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5JVW7|Q6NT44|Q6NT57|Q6WG75|Q96I57|Q9NWE2|Q9P216	Missense_Mutation	SNP	pfam_Myosin_tail,pfam_Myosin_head_motor_dom,pfam_Myosin_N,superfamily_Myosin_S1_N,superfamily_Prefoldin,superfamily_tRNA-bd_arm,superfamily_t-SNARE,smart_Myosin_head_motor_dom,pfscan_IQ_motif_EF-hand-BS,prints_Myosin_head_motor_dom	p.R479P	ENST00000262873.7	37	c.1436	CCDS42869.1	20	.	.	.	.	.	.	.	.	.	.	G	18.18	3.567022	0.65651	.	.	ENSG00000078814	ENST00000262873	D	0.89617	-2.54	3.33	3.33	0.38152	Myosin head, motor domain (2);	0.000000	0.30109	N	0.010393	D	0.97028	0.9029	H	0.99498	4.595	0.48696	D	0.999696	D	0.89917	1.0	D	0.97110	1.0	D	0.98732	1.0713	10	0.87932	D	0	.	15.9522	0.79850	0.0:0.0:1.0:0.0	.	437	A7E2Y1	MYH7B_HUMAN	P	479	ENSP00000262873:R479P	ENSP00000262873:R479P	R	+	2	0	MYH7B	33039272	0.999000	0.42202	1.000000	0.80357	0.995000	0.86356	3.390000	0.52523	2.171000	0.68590	0.561000	0.74099	CGG	MYH7B	-	pfam_Myosin_head_motor_dom,smart_Myosin_head_motor_dom	ENSG00000078814		0.637	MYH7B-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	MYH7B	HGNC	protein_coding	OTTHUMT00000078833.2	32	0.00	0	G	NM_020884		33575611	33575611	+1	no_errors	ENST00000262873	ensembl	human	novel	69_37n	missense	56	16.42	11	SNP	1.000	C
NCDN	23154	genome.wustl.edu	37	1	36031094	36031095	+	Frame_Shift_Ins	INS	-	-	T			TCGA-A2-A0D0-01A-11W-A019-09	TCGA-A2-A0D0-10A-01W-A021-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3f20d0fe-aaa1-40f1-b2c1-7f070f93aef5	bbf1c43d-d7b3-4574-a074-d22ad537829c	g.chr1:36031094_36031095insT	ENST00000373243.2	+	7	2403_2404	c.2020_2021insT	c.(2020-2022)gtcfs	p.V674fs	NCDN_ENST00000356090.4_Frame_Shift_Ins_p.V674fs|NCDN_ENST00000373253.3_Frame_Shift_Ins_p.V657fs	NM_014284.2	NP_055099.1	Q9UBB6	NCDN_HUMAN	neurochondrin	674					bone resorption (GO:0045453)|neuron projection development (GO:0031175)|regulation of neuronal synaptic plasticity (GO:0048168)	cytosol (GO:0005829)|dendrite (GO:0030425)|membrane (GO:0016020)|neuronal cell body (GO:0043025)				breast(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(3)|pancreas(1)|skin(2)	16		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0887)				GCTAGGCAGTGTCAGCCCCAAC	0.703																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			AB011179	CCDS392.1, CCDS30672.1	1p34.3	2008-02-05			ENSG00000020129	ENSG00000020129			17597	protein-coding gene	gene with protein product		608458				15007648	Standard	NM_014284		Approved	NCDN-1, NCDN-2	uc001bza.3	Q9UBB6	OTTHUMG00000059204	ENST00000373243.2:c.2021dupT	1.37:g.36031095_36031095dupT	ENSP00000362340:p.Val674fs	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DPR9|Q9UBY2|Q9Y4A6|Q9Y4D9	Frame_Shift_Ins	INS	NULL	p.S675fs	ENST00000373243.2	37	c.2020_2021	CCDS392.1	1																																																																																			NCDN	-	NULL	ENSG00000020129		0.703	NCDN-003	KNOWN	basic|appris_principal|CCDS	protein_coding	NCDN	HGNC	protein_coding	OTTHUMT00000131298.1	9	0.00	0	-	NM_014284		36031094	36031095	+1	no_errors	ENST00000356090	ensembl	human	known	69_37n	frame_shift_ins	6	45.45	5	INS	1.000:1.000	T
OR6C2	341416	genome.wustl.edu	37	12	55846550	55846550	+	Missense_Mutation	SNP	A	A	G			TCGA-A2-A0D0-01A-11W-A019-09	TCGA-A2-A0D0-10A-01W-A021-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3f20d0fe-aaa1-40f1-b2c1-7f070f93aef5	bbf1c43d-d7b3-4574-a074-d22ad537829c	g.chr12:55846550A>G	ENST00000322678.1	+	1	553	c.553A>G	c.(553-555)Atc>Gtc	p.I185V	RP11-110A12.2_ENST00000555146.1_RNA|RP11-110A12.2_ENST00000554049.1_RNA|RP11-110A12.2_ENST00000556750.1_RNA|RP11-110A12.2_ENST00000555138.1_RNA	NM_054105.1	NP_473446.1	Q9NZP2	OR6C2_HUMAN	olfactory receptor, family 6, subfamily C, member 2	185					detection of chemical stimulus involved in sensory perception of smell (GO:0050911)|sensory perception of smell (GO:0007608)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			kidney(2)|large_intestine(5)|lung(8)|prostate(1)|skin(5)|upper_aerodigestive_tract(2)	23						TCTCCTAAAGATCTCATGCTC	0.418																																						dbGAP											0													175.0	168.0	170.0					12																	55846550		2203	4299	6502	-	-	-	SO:0001583	missense	0			AF179766	CCDS31824.1	12q13.2	2012-08-09				ENSG00000179695		"""GPCR / Class A : Olfactory receptors"""	15436	protein-coding gene	gene with protein product							Standard	NM_054105		Approved	OR6C67	uc001sgz.1	Q9NZP2	OTTHUMG00000169957	ENST00000322678.1:c.553A>G	12.37:g.55846550A>G	ENSP00000323606:p.Ile185Val	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.I185V	ENST00000322678.1	37	c.553	CCDS31824.1	12	.	.	.	.	.	.	.	.	.	.	A	17.91	3.504515	0.64410	.	.	ENSG00000179695	ENST00000322678	T	0.00099	8.73	5.42	5.42	0.78866	GPCR, rhodopsin-like superfamily (1);	0.101256	0.44097	D	0.000500	T	0.00210	0.0006	L	0.37630	1.12	0.31795	N	0.62921	B	0.31503	0.326	B	0.42087	0.375	T	0.46233	-0.9206	10	0.87932	D	0	.	10.0212	0.42044	0.7316:0.2684:0.0:0.0	.	185	Q9NZP2	OR6C2_HUMAN	V	185	ENSP00000323606:I185V	ENSP00000323606:I185V	I	+	1	0	OR6C2	54132817	0.042000	0.20092	0.840000	0.33206	0.015000	0.08874	0.519000	0.22862	2.275000	0.75901	0.496000	0.49642	ATC	OR6C2	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt	ENSG00000179695		0.418	OR6C2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR6C2	HGNC	protein_coding	OTTHUMT00000406676.1	297	0.00	0	A	NM_054105		55846550	55846550	+1	no_errors	ENST00000322678	ensembl	human	known	69_37n	missense	460	21.47	126	SNP	1.000	G
PARP9	83666	genome.wustl.edu	37	3	122274300	122274300	+	Frame_Shift_Del	DEL	T	T	-			TCGA-A2-A0D0-01A-11W-A019-09	TCGA-A2-A0D0-10A-01W-A021-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3f20d0fe-aaa1-40f1-b2c1-7f070f93aef5	bbf1c43d-d7b3-4574-a074-d22ad537829c	g.chr3:122274300delT	ENST00000360356.2	-	4	1050	c.823delA	c.(823-825)attfs	p.I275fs	PARP9_ENST00000492382.1_Intron|PARP9_ENST00000471785.1_Frame_Shift_Del_p.I240fs|PARP9_ENST00000477522.2_Frame_Shift_Del_p.I240fs|PARP9_ENST00000462315.1_Frame_Shift_Del_p.I240fs	NM_001146102.1|NM_031458.2	NP_001139574.1|NP_113646.2	Q8IXQ6	PARP9_HUMAN	poly (ADP-ribose) polymerase family, member 9	275	Macro 1. {ECO:0000255|PROSITE- ProRule:PRU00490}.				cell migration (GO:0016477)|double-strand break repair (GO:0006302)|regulation of response to interferon-gamma (GO:0060330)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	NAD+ ADP-ribosyltransferase activity (GO:0003950)			endometrium(3)|kidney(2)|large_intestine(9)|liver(1)|lung(11)|ovary(1)|pancreas(1)|prostate(2)|skin(1)|urinary_tract(3)	34				GBM - Glioblastoma multiforme(114;0.0519)		ACCAGGTGAATTTCTTTCAAA	0.438																																						dbGAP											0													168.0	165.0	166.0					3																	122274300		2203	4300	6503	-	-	-	SO:0001589	frameshift_variant	0			AF307339	CCDS3014.1, CCDS54633.1, CCDS54634.1	3q13-q21	2010-02-16			ENSG00000138496	ENSG00000138496		"""Poly (ADP-ribose) polymerases"""	24118	protein-coding gene	gene with protein product		612065				11110709	Standard	NM_031458		Approved	BAL, BAL1	uc003efi.3	Q8IXQ6	OTTHUMG00000159522	ENST00000360356.2:c.823delA	3.37:g.122274300delT	ENSP00000353512:p.Ile275fs	Somatic		WXS	Illumina GAIIx	Phase_IV	A8KA94|B2R8S9|E9PFM7|Q8TCP3|Q9BZL8|Q9BZL9	Frame_Shift_Del	DEL	pfam_A1pp,smart_A1pp,pfscan_A1pp,pfscan_Poly(ADP-ribose)pol_cat_dom	p.I275fs	ENST00000360356.2	37	c.823	CCDS3014.1	3																																																																																			PARP9	-	pfscan_A1pp	ENSG00000138496		0.438	PARP9-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PARP9	HGNC	protein_coding	OTTHUMT00000355957.1	392	0.00	0	T	NM_031458		122274300	122274300	-1	no_errors	ENST00000360356	ensembl	human	known	69_37n	frame_shift_del	347	29.60	148	DEL	1.000	-
PAX3	5077	genome.wustl.edu	37	2	223065949	223065949	+	3'UTR	SNP	T	T	C			TCGA-A2-A0D0-01A-11W-A019-09	TCGA-A2-A0D0-10A-01W-A021-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3f20d0fe-aaa1-40f1-b2c1-7f070f93aef5	bbf1c43d-d7b3-4574-a074-d22ad537829c	g.chr2:223065949T>C	ENST00000350526.4	-	0	2270				PAX3_ENST00000392070.2_3'UTR|PAX3_ENST00000464706.1_5'Flank|PAX3_ENST00000392069.2_Missense_Mutation_p.I488V|PAX3_ENST00000336840.6_Silent_p.K405K|PAX3_ENST00000344493.4_3'UTR	NM_181457.3	NP_852122.1	P23760	PAX3_HUMAN	paired box 3						apoptotic process (GO:0006915)|cell proliferation (GO:0008283)|developmental pigmentation (GO:0048066)|heart development (GO:0007507)|mammary gland specification (GO:0060594)|muscle organ development (GO:0007517)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neural crest cell migration (GO:0001755)|neural tube closure (GO:0001843)|neuron fate commitment (GO:0048663)|organ morphogenesis (GO:0009887)|positive regulation of cell proliferation (GO:0008284)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of somitogenesis (GO:0014807)|sensory perception of sound (GO:0007605)|spinal cord association neuron differentiation (GO:0021527)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)		PAX3/NCOA2(4)|PAX3/NCOA1(8)|PAX3/FOXO1(749)	NS(1)|endometrium(3)|kidney(1)|large_intestine(12)|lung(13)|ovary(4)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)	38		Renal(207;0.0183)		Epithelial(121;4.13e-10)|all cancers(144;1.85e-07)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		TTCAAAAGGATTTGAAACCAA	0.413			T	"""FOXO1A, NCOA1"""	alveolar rhabdomyosarcoma		Waardenburg syndrome; craniofacial-deafness-hand syndrome																															dbGAP		Dom	yes		2	2q35	5077	paired box gene 3	yes	M	0													111.0	108.0	109.0					2																	223065949		2203	4300	6503	-	-	-	SO:0001624	3_prime_UTR_variant	0				CCDS2449.1, CCDS2450.1, CCDS2451.1, CCDS42825.1, CCDS2448.1, CCDS42826.1, CCDS46522.1, CCDS46523.1	2q36.1	2011-06-20	2007-07-12		ENSG00000135903	ENSG00000135903		"""Paired boxes"", ""Homeoboxes / PRD class"""	8617	protein-coding gene	gene with protein product		606597	"""Waardenburg syndrome 1"", ""paired box gene 3 (Waardenburg syndrome 1)"""	WS1		1347149	Standard	NM_181461		Approved	HUP2	uc002vmt.2	P23760	OTTHUMG00000133157	ENST00000350526.4:c.*694A>G	2.37:g.223065949T>C		Somatic		WXS	Illumina GAIIx	Phase_IV	G5E9C1|Q16448|Q494Z3|Q494Z4|Q53T90|Q6GSJ9|Q86UQ2|Q86UQ3	Missense_Mutation	SNP	pfam_Paired_dom,pfam_Pax7,pfam_Homeodomain,superfamily_Homeodomain-like,smart_Paired_dom,smart_Homeodomain,pfscan_Homeodomain,pfscan_Paired_dom,prints_Paired_dom	p.I488V	ENST00000350526.4	37	c.1462	CCDS42826.1	2	.	.	.	.	.	.	.	.	.	.	T	0.224	-1.025956	0.02045	.	.	ENSG00000135903	ENST00000392069	D	0.93712	-3.27	5.77	0.531	0.17108	.	1.684320	0.03802	N	0.264657	D	0.85835	0.5789	.	.	.	0.58432	D	0.999992	B	0.02656	0.0	B	0.01281	0.0	T	0.70396	-0.4883	9	0.12766	T	0.61	.	5.338	0.15969	0.0:0.2174:0.1375:0.6451	.	488	G5E9C1	.	V	488	ENSP00000375921:I488V	ENSP00000375921:I488V	I	-	1	0	PAX3	222774193	1.000000	0.71417	0.671000	0.29857	0.051000	0.14879	1.275000	0.33144	-0.062000	0.13088	0.533000	0.62120	ATC	PAX3	-	NULL	ENSG00000135903		0.413	PAX3-006	KNOWN	not_organism_supported|basic|appris_candidate|CCDS	protein_coding	PAX3	HGNC	protein_coding	OTTHUMT00000328670.1	117	0.85	1	T			223065949	223065949	-1	no_errors	ENST00000392069	ensembl	human	known	69_37n	missense	141	29.85	60	SNP	0.908	C
PDE3B	5140	genome.wustl.edu	37	11	14853233	14853233	+	Missense_Mutation	SNP	C	C	G			TCGA-A2-A0D0-01A-11W-A019-09	TCGA-A2-A0D0-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3f20d0fe-aaa1-40f1-b2c1-7f070f93aef5	bbf1c43d-d7b3-4574-a074-d22ad537829c	g.chr11:14853233C>G	ENST00000282096.4	+	9	2357	c.2004C>G	c.(2002-2004)gaC>gaG	p.D668E	PDE3B_ENST00000455098.2_Missense_Mutation_p.D617E	NM_000922.3	NP_000913.2	Q13370	PDE3B_HUMAN	phosphodiesterase 3B, cGMP-inhibited	668					angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cAMP catabolic process (GO:0006198)|cellular response to insulin stimulus (GO:0032869)|endocrine pancreas development (GO:0031018)|glucose homeostasis (GO:0042593)|insulin receptor signaling pathway (GO:0008286)|negative regulation of angiogenesis (GO:0016525)|negative regulation of cAMP-mediated signaling (GO:0043951)|negative regulation of cell adhesion (GO:0007162)|negative regulation of cell adhesion mediated by integrin (GO:0033629)|negative regulation of lipid catabolic process (GO:0050995)|regulation of insulin secretion (GO:0050796)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|guanyl-nucleotide exchange factor complex (GO:0032045)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	3',5'-cyclic-nucleotide phosphodiesterase activity (GO:0004114)|cGMP-inhibited cyclic-nucleotide phosphodiesterase activity (GO:0004119)|metal ion binding (GO:0046872)|protein kinase B binding (GO:0043422)			NS(1)|breast(1)|endometrium(5)|kidney(3)|large_intestine(6)|lung(15)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	39					Caffeine(DB00201)	AAGAGTATGACTCATTAATAG	0.328																																						dbGAP											0													63.0	70.0	68.0					11																	14853233		2200	4287	6487	-	-	-	SO:0001583	missense	0			U38178	CCDS7817.1	11p15.2	2008-03-18			ENSG00000152270	ENSG00000152270	3.1.4.17	"""Phosphodiesterases"""	8779	protein-coding gene	gene with protein product		602047				8884271, 16395595	Standard	NM_000922		Approved	HcGIP1	uc001mln.3	Q13370	OTTHUMG00000165898	ENST00000282096.4:c.2004C>G	11.37:g.14853233C>G	ENSP00000282096:p.Asp668Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	B7ZM37|O00639|Q14408|Q6SEI4	Missense_Mutation	SNP	pfam_PDEase_catalytic_dom,smart_HD/PDEase_dom	p.D668E	ENST00000282096.4	37	c.2004	CCDS7817.1	11	.	.	.	.	.	.	.	.	.	.	C	10.37	1.332670	0.24167	.	.	ENSG00000152270	ENST00000282096;ENST00000455098	T;T	0.75589	-0.95;-0.95	5.77	-5.57	0.02521	5&apos (1);-cyclic nucleotide phosphodiesterase, catalytic domain (1);3&apos (1);	4.201060	0.01866	N	0.036918	T	0.52419	0.1733	N	0.13235	0.315	0.21652	N	0.999607	B;B	0.09022	0.002;0.002	B;B	0.12156	0.005;0.007	T	0.33445	-0.9868	10	0.28530	T	0.3	.	3.9294	0.09278	0.1548:0.2399:0.0878:0.5175	.	617;668	B7ZM37;Q13370	.;PDE3B_HUMAN	E	668;617	ENSP00000282096:D668E;ENSP00000388644:D617E	ENSP00000282096:D668E	D	+	3	2	PDE3B	14809809	0.000000	0.05858	0.946000	0.38457	0.984000	0.73092	-2.373000	0.01072	-0.706000	0.05028	0.467000	0.42956	GAC	PDE3B	-	NULL	ENSG00000152270		0.328	PDE3B-001	KNOWN	basic|CCDS	protein_coding	PDE3B	HGNC	protein_coding	OTTHUMT00000386974.1	169	0.00	0	C	NM_000922		14853233	14853233	+1	no_errors	ENST00000282096	ensembl	human	known	69_37n	missense	66	24.14	21	SNP	0.063	G
PLEKHG4B	153478	genome.wustl.edu	37	5	182269	182269	+	Missense_Mutation	SNP	C	C	T	rs147897190		TCGA-A2-A0D0-01A-11W-A019-09	TCGA-A2-A0D0-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3f20d0fe-aaa1-40f1-b2c1-7f070f93aef5	bbf1c43d-d7b3-4574-a074-d22ad537829c	g.chr5:182269C>T	ENST00000283426.6	+	18	3697	c.3647C>T	c.(3646-3648)tCc>tTc	p.S1216F		NM_052909.3	NP_443141.3	Q96PX9	PKH4B_HUMAN	pleckstrin homology domain containing, family G (with RhoGef domain) member 4B	1216	Ser-rich.						Rho guanyl-nucleotide exchange factor activity (GO:0005089)			endometrium(1)|large_intestine(2)|lung(2)|prostate(3)|skin(3)	11			all cancers(22;0.0253)|Lung(60;0.113)	Kidney(1;0.119)		CTTGTGTCCTCCAGCCCAGCC	0.622																																						dbGAP											0													69.0	66.0	67.0					5																	182269		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC008352	CCDS34124.1	5p15.33	2013-01-11			ENSG00000153404	ENSG00000153404		"""Pleckstrin homology (PH) domain containing"""	29399	protein-coding gene	gene with protein product						11572484	Standard	NM_052909		Approved	KIAA1909	uc003jak.2	Q96PX9	OTTHUMG00000161570	ENST00000283426.6:c.3647C>T	5.37:g.182269C>T	ENSP00000283426:p.Ser1216Phe	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_DH-domain,superfamily_DH-domain,superfamily_CRAL-TRIO_dom,smart_DH-domain,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology,pfscan_DH-domain	p.S1216F	ENST00000283426.6	37	c.3647	CCDS34124.1	5	.	.	.	.	.	.	.	.	.	.	C	8.723	0.914726	0.17907	.	.	ENSG00000153404	ENST00000283426	T	0.33216	1.42	3.55	3.55	0.40652	.	.	.	.	.	T	0.20373	0.0490	N	0.08118	0	0.27040	N	0.96404	P	0.44578	0.838	P	0.44990	0.466	T	0.05616	-1.0874	9	0.49607	T	0.09	.	10.6254	0.45504	0.0:1.0:0.0:0.0	.	1216	Q96PX9	PKH4B_HUMAN	F	1216	ENSP00000283426:S1216F	ENSP00000283426:S1216F	S	+	2	0	PLEKHG4B	235269	0.286000	0.24305	0.008000	0.14137	0.093000	0.18481	3.626000	0.54245	1.514000	0.48869	0.467000	0.42956	TCC	PLEKHG4B	-	NULL	ENSG00000153404		0.622	PLEKHG4B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLEKHG4B	HGNC	protein_coding	OTTHUMT00000365359.1	22	0.00	0	C	NM_052909		182269	182269	+1	no_errors	ENST00000283426	ensembl	human	known	69_37n	missense	34	24.44	11	SNP	0.672	T
POLR1A	25885	genome.wustl.edu	37	2	86327172	86327172	+	Silent	SNP	G	G	A			TCGA-A2-A0D0-01A-11W-A019-09	TCGA-A2-A0D0-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3f20d0fe-aaa1-40f1-b2c1-7f070f93aef5	bbf1c43d-d7b3-4574-a074-d22ad537829c	g.chr2:86327172G>A	ENST00000263857.6	-	2	579	c.201C>T	c.(199-201)tgC>tgT	p.C67C	POLR1A_ENST00000409681.1_Silent_p.C67C			O95602	RPA1_HUMAN	polymerase (RNA) I polypeptide A, 194kDa	67					gene expression (GO:0010467)|termination of RNA polymerase I transcription (GO:0006363)|transcription elongation from RNA polymerase I promoter (GO:0006362)|transcription from RNA polymerase I promoter (GO:0006360)|transcription initiation from RNA polymerase I promoter (GO:0006361)	cytoplasm (GO:0005737)|DNA-directed RNA polymerase I complex (GO:0005736)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|DNA-directed RNA polymerase activity (GO:0003899)|zinc ion binding (GO:0008270)			NS(1)|breast(4)|cervix(2)|endometrium(8)|kidney(3)|large_intestine(12)|liver(1)|lung(20)|ovary(3)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(5)	63						AGTCCTGCACGCAGGTGGAGC	0.557																																						dbGAP											0													85.0	90.0	88.0					2																	86327172		2011	4181	6192	-	-	-	SO:0001819	synonymous_variant	0			AK025568	CCDS42706.1	2p11.2	2013-01-21			ENSG00000068654	ENSG00000068654		"""RNA polymerase subunits"""	17264	protein-coding gene	gene with protein product						9236775	Standard	NM_015425		Approved	DKFZP586M0122, FLJ21915, RPO1-4, RPA1	uc002sqs.3	O95602	OTTHUMG00000153165	ENST00000263857.6:c.201C>T	2.37:g.86327172G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B7Z7T0|D6W5M0|Q0VG05|Q9UEH0|Q9UFT9	Silent	SNP	pfam_RNA_pol_Rpb1_5,pfam_RNA_pol_asu,pfam_RNA_pol_Rpb1_3,pfam_RNA_pol_Rpb1_4,pfam_RNA_pol_Rpb1_1,smart_RNA_pol_N	p.C67	ENST00000263857.6	37	c.201	CCDS42706.1	2																																																																																			POLR1A	-	pfam_RNA_pol_Rpb1_1	ENSG00000068654		0.557	POLR1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	POLR1A	HGNC	protein_coding	OTTHUMT00000329830.2	63	0.00	0	G	NM_015425		86327172	86327172	-1	no_errors	ENST00000263857	ensembl	human	known	69_37n	silent	175	38.38	109	SNP	0.985	A
RBM23	55147	genome.wustl.edu	37	14	23374450	23374450	+	Silent	SNP	G	G	A			TCGA-A2-A0D0-01A-11W-A019-09	TCGA-A2-A0D0-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3f20d0fe-aaa1-40f1-b2c1-7f070f93aef5	bbf1c43d-d7b3-4574-a074-d22ad537829c	g.chr14:23374450G>A	ENST00000359890.3	-	8	774	c.579C>T	c.(577-579)cgC>cgT	p.R193R	RBM23_ENST00000555209.1_Intron|RBM23_ENST00000346528.5_Silent_p.R159R|RBM23_ENST00000399922.2_Silent_p.R177R|RBM23_ENST00000556984.1_5'Flank|RBM23_ENST00000542016.2_Silent_p.R23R	NM_001077351.1	NP_001070819.1	Q86U06	RBM23_HUMAN	RNA binding motif protein 23	193	RRM 1. {ECO:0000255|PROSITE- ProRule:PRU00176}.				mRNA processing (GO:0006397)	membrane (GO:0016020)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			endometrium(3)|kidney(2)|lung(3)|prostate(1)|skin(1)	10	all_cancers(95;4.69e-05)			GBM - Glioblastoma multiforme(265;0.0128)		TACGTACATCGCGAACCTATC	0.483																																						dbGAP											0													81.0	74.0	76.0					14																	23374450		1977	4168	6145	-	-	-	SO:0001819	synonymous_variant	0			AF275678	CCDS41919.1, CCDS41920.1, CCDS41921.1	14q11.1	2014-07-03	2004-04-23	2004-04-23		ENSG00000100461		"""RNA binding motif (RRM) containing"""	20155	protein-coding gene	gene with protein product	"""coactivator of activating protein-1 and estrogen recep- tors beta"""		"""RNA-binding region (RNP1, RRM) containing 4"""	RNPC4		15694343	Standard	NM_018107		Approved	FLJ10482, CAPERbeta	uc001whg.3	Q86U06		ENST00000359890.3:c.579C>T	14.37:g.23374450G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	D3DS32|Q8ND16|Q8TB88|Q8WY40|Q9BUJ1|Q9NVV7	Silent	SNP	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom,tigrfam_CC1_SF	p.R193	ENST00000359890.3	37	c.579	CCDS41921.1	14																																																																																			RBM23	-	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom,tigrfam_CC1_SF	ENSG00000100461		0.483	RBM23-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RBM23	HGNC	protein_coding	OTTHUMT00000413545.3	160	0.62	1	G			23374450	23374450	-1	no_errors	ENST00000359890	ensembl	human	known	69_37n	silent	39	64.55	71	SNP	0.983	A
RGL1	23179	genome.wustl.edu	37	1	183816895	183816895	+	Silent	SNP	C	C	T			TCGA-A2-A0D0-01A-11W-A019-09	TCGA-A2-A0D0-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3f20d0fe-aaa1-40f1-b2c1-7f070f93aef5	bbf1c43d-d7b3-4574-a074-d22ad537829c	g.chr1:183816895C>T	ENST00000360851.3	+	3	512	c.334C>T	c.(334-336)Cta>Tta	p.L112L	RGL1_ENST00000536277.1_Silent_p.L110L|RGL1_ENST00000304685.4_Silent_p.L147L|RGL1_ENST00000539189.1_Silent_p.L112L			Q9NZL6	RGL1_HUMAN	ral guanine nucleotide dissociation stimulator-like 1	112	N-terminal Ras-GEF. {ECO:0000255|PROSITE- ProRule:PRU00135}.				cellular lipid metabolic process (GO:0044255)|positive regulation of Ral GTPase activity (GO:0032852)|small GTPase mediated signal transduction (GO:0007264)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	Ral guanyl-nucleotide exchange factor activity (GO:0008321)			breast(5)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(12)|liver(1)|lung(17)|ovary(4)|prostate(3)|stomach(1)	51						AGTGCTGGAACTACTGCTGGA	0.448																																						dbGAP											0													89.0	90.0	90.0					1																	183816895		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF186780	CCDS1359.1, CCDS72992.1	1q25.2	2008-02-05			ENSG00000143344	ENSG00000143344			30281	protein-coding gene	gene with protein product		605667				10760592, 10231032	Standard	XM_005245010		Approved	RGL	uc001gqm.3	Q9NZL6	OTTHUMG00000035328	ENST00000360851.3:c.334C>T	1.37:g.183816895C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q5SXQ2|Q5SXQ6|Q9HBY3|Q9HBY4|Q9NZL5|Q9UG43|Q9Y2G6	Silent	SNP	pfam_RasGRF_CDC25,pfam_Ras-like_Gua-exchang_fac_N,pfam_Ras-assoc,superfamily_Ras_GEF_dom,smart_Ras-like_Gua-exchang_fac_N,smart_RasGRF_CDC25,smart_Ras-assoc,pfscan_Ras-assoc,pfscan_RasGRF_CDC25,pfscan_Ras-like_Gua-exchang_fac_N	p.L147	ENST00000360851.3	37	c.439		1																																																																																			RGL1	-	pfam_Ras-like_Gua-exchang_fac_N,superfamily_Ras_GEF_dom,smart_Ras-like_Gua-exchang_fac_N,pfscan_Ras-like_Gua-exchang_fac_N	ENSG00000143344		0.448	RGL1-002	KNOWN	basic|appris_candidate	protein_coding	RGL1	HGNC	protein_coding	OTTHUMT00000085742.1	270	0.37	1	C	NM_015149		183816895	183816895	+1	no_errors	ENST00000304685	ensembl	human	known	69_37n	silent	275	26.08	97	SNP	0.990	T
RMND1	55005	genome.wustl.edu	37	6	151748625	151748625	+	Silent	SNP	T	T	A			TCGA-A2-A0D0-01A-11W-A019-09	TCGA-A2-A0D0-10A-01W-A021-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3f20d0fe-aaa1-40f1-b2c1-7f070f93aef5	bbf1c43d-d7b3-4574-a074-d22ad537829c	g.chr6:151748625T>A	ENST00000367303.4	-	6	944	c.822A>T	c.(820-822)atA>atT	p.I274I	RMND1_ENST00000336451.3_Silent_p.I63I	NM_017909.2	NP_060379.2	Q9NWS8	RMND1_HUMAN	required for meiotic nuclear division 1 homolog (S. cerevisiae)	274					translation (GO:0006412)	mitochondrion (GO:0005739)				central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	12		Ovarian(120;0.125)	BRCA - Breast invasive adenocarcinoma(37;0.146)	OV - Ovarian serous cystadenocarcinoma(155;6.8e-11)		ACTCTATTTTTATGTAGTTAA	0.328																																						dbGAP											0													97.0	93.0	94.0					6																	151748625		2201	4298	6499	-	-	-	SO:0001819	synonymous_variant	0			AK000634	CCDS5232.1, CCDS75539.1	6q25.1	2008-02-05	2006-11-24	2006-11-24	ENSG00000155906	ENSG00000155906			21176	protein-coding gene	gene with protein product		614917	"""chromosome 6 open reading frame 96"""	C6orf96			Standard	NM_001271937		Approved	bA351K16.3, FLJ20627, RMD1	uc003qoi.3	Q9NWS8	OTTHUMG00000015837	ENST00000367303.4:c.822A>T	6.37:g.151748625T>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K8H4|Q0VDG6|Q5SZ48|Q5SZ83|Q6NSC5|Q96EN7	Silent	SNP	pfam_DUF155	p.I274	ENST00000367303.4	37	c.822	CCDS5232.1	6																																																																																			RMND1	-	pfam_DUF155	ENSG00000155906		0.328	RMND1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RMND1	HGNC	protein_coding	OTTHUMT00000042718.2	57	0.00	0	T	NM_017909		151748625	151748625	-1	no_errors	ENST00000367303	ensembl	human	known	69_37n	silent	568	15.93	108	SNP	0.027	A
SGK3	23678	genome.wustl.edu	37	8	67748219	67748219	+	Silent	SNP	T	T	C			TCGA-A2-A0D0-01A-11W-A019-09	TCGA-A2-A0D0-10A-01W-A021-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3f20d0fe-aaa1-40f1-b2c1-7f070f93aef5	bbf1c43d-d7b3-4574-a074-d22ad537829c	g.chr8:67748219T>C	ENST00000396596.1	+	10	865	c.651T>C	c.(649-651)aaT>aaC	p.N217N	SGK3_ENST00000521198.2_Silent_p.N217N|SGK3_ENST00000522398.1_Silent_p.N217N|SGK3_ENST00000345714.4_Silent_p.N217N|C8orf44-SGK3_ENST00000519289.1_Silent_p.N217N|SGK3_ENST00000520976.1_Silent_p.N217N	NM_013257.4	NP_037389.4	Q96BR1	SGK3_HUMAN	serum/glucocorticoid regulated kinase family, member 3	217	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				ion transmembrane transport (GO:0034220)|protein phosphorylation (GO:0006468)|regulation of cell growth (GO:0001558)|regulation of cell migration (GO:0030334)|regulation of cell proliferation (GO:0042127)|regulation of sequence-specific DNA binding transcription factor activity (GO:0051090)|response to stress (GO:0006950)|transmembrane transport (GO:0055085)	cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|endosome (GO:0005768)	ATP binding (GO:0005524)|calcium channel regulator activity (GO:0005246)|chloride channel regulator activity (GO:0017081)|phosphatidylinositol binding (GO:0035091)|potassium channel regulator activity (GO:0015459)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|sodium channel regulator activity (GO:0017080)			breast(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(9)|ovary(1)|upper_aerodigestive_tract(1)	18	Breast(64;0.186)	Lung NSC(129;0.0908)|all_lung(136;0.152)	Epithelial(68;0.0046)|OV - Ovarian serous cystadenocarcinoma(28;0.0112)|all cancers(69;0.0141)|BRCA - Breast invasive adenocarcinoma(89;0.206)			TCTTGAAAAATGTGAAACATC	0.333																																						dbGAP											0													138.0	140.0	139.0					8																	67748219		2202	4300	6502	-	-	-	SO:0001819	synonymous_variant	0				CCDS6195.1, CCDS6196.1	8q12	2008-07-28	2005-09-13	2005-09-13		ENSG00000104205			10812	protein-coding gene	gene with protein product		607591	"""serum/glucocorticoid regulated kinase-like"""	SGK2, SGKL		10585774, 10548550	Standard	NM_013257		Approved		uc003xwr.3	Q96BR1		ENST00000396596.1:c.651T>C	8.37:g.67748219T>C		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K5W3|B3KQC2|Q9P1Q7|Q9UKG5	Silent	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Phox,pfam_Pkinase_C,superfamily_Kinase-like_dom,superfamily_Phox,smart_Phox,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_AGC-kinase_C,pfscan_Phox,pfscan_Prot_kinase_cat_dom	p.N217	ENST00000396596.1	37	c.651	CCDS6195.1	8																																																																																			SGK3	-	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	ENSG00000104205		0.333	SGK3-201	KNOWN	basic|appris_principal|CCDS	protein_coding	SGK3	HGNC	protein_coding	OTTHUMT00000379232.3	145	0.00	0	T			67748219	67748219	+1	no_errors	ENST00000262211	ensembl	human	known	69_37n	silent	247	20.00	62	SNP	1.000	C
SLC12A4	6560	genome.wustl.edu	37	16	67995581	67995581	+	Missense_Mutation	SNP	G	G	C			TCGA-A2-A0D0-01A-11W-A019-09	TCGA-A2-A0D0-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3f20d0fe-aaa1-40f1-b2c1-7f070f93aef5	bbf1c43d-d7b3-4574-a074-d22ad537829c	g.chr16:67995581G>C	ENST00000316341.3	-	3	379	c.239C>G	c.(238-240)tCg>tGg	p.S80W	SLC12A4_ENST00000338335.3_Missense_Mutation_p.S80W|SLC12A4_ENST00000576616.1_Missense_Mutation_p.S80W|SLC12A4_ENST00000541864.2_Missense_Mutation_p.S49W|SLC12A4_ENST00000537830.2_Missense_Mutation_p.S74W|SLC12A4_ENST00000572010.1_5'UTR|SLC12A4_ENST00000572037.1_Missense_Mutation_p.S32W|SLC12A4_ENST00000422611.2_Missense_Mutation_p.S82W	NM_001145961.1|NM_005072.4	NP_001139433.1|NP_005063.1	Q9UP95	S12A4_HUMAN	solute carrier family 12 (potassium/chloride transporter), member 4	80					cell volume homeostasis (GO:0006884)|chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|ion transport (GO:0006811)|potassium ion transport (GO:0006813)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|plasma membrane (GO:0005886)	potassium:chloride symporter activity (GO:0015379)|protein kinase binding (GO:0019901)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(3)|lung(2)|ovary(2)|prostate(4)|skin(2)|urinary_tract(3)	29		Ovarian(137;0.192)		OV - Ovarian serous cystadenocarcinoma(108;0.0042)|Epithelial(162;0.0185)|all cancers(182;0.121)	Bumetanide(DB00887)|Potassium Chloride(DB00761)	CAGAAGAGACGATACCTTTGG	0.637																																						dbGAP											0													112.0	100.0	104.0					16																	67995581		2198	4300	6498	-	-	-	SO:0001583	missense	0				CCDS10855.1, CCDS54030.1, CCDS54031.1, CCDS54032.1	16q22.1	2013-07-18	2013-07-18		ENSG00000124067	ENSG00000124067		"""Solute carriers"""	10913	protein-coding gene	gene with protein product		604119				8663127	Standard	NM_005072		Approved	KCC1	uc010ceu.2	Q9UP95	OTTHUMG00000137535	ENST00000316341.3:c.239C>G	16.37:g.67995581G>C	ENSP00000318557:p.Ser80Trp	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DF69|B4DR04|B4DZ82|B7ZAV0|F5H066|F5H0S9|F5H3C0|O60632|O75893|Q13953|Q96LD5	Missense_Mutation	SNP	pfam_AA-permease_dom,pfam_K/Cl_cotranspt_1/3,prints_KCL_cotranspt,prints_K/Cl_cotranspt1,tigrfam_Na/K/Cl_cotransptS	p.S82W	ENST00000316341.3	37	c.245	CCDS10855.1	16	.	.	.	.	.	.	.	.	.	.	G	28.0	4.878438	0.91740	.	.	ENSG00000124067	ENST00000422611;ENST00000541864;ENST00000537830;ENST00000338335;ENST00000316341	D;D;D;D;D	0.89681	-2.16;-2.02;-2.03;-2.55;-2.02	5.81	5.81	0.92471	.	0.000000	0.85682	D	0.000000	D	0.95010	0.8385	M	0.80982	2.52	0.80722	D	1	D;D;D;D;D;D	0.89917	1.0;0.999;1.0;1.0;1.0;1.0	D;D;D;D;D;D	0.91635	0.987;0.995;0.999;0.998;0.987;0.996	D	0.94933	0.8084	10	0.87932	D	0	.	20.0787	0.97763	0.0:0.0:1.0:0.0	.	82;80;49;74;80;80	F5H3C0;B4DF30;F5H066;F5H0S9;Q9UP95-2;Q9UP95	.;.;.;.;.;S12A4_HUMAN	W	82;49;74;80;80	ENSP00000395983:S82W;ENSP00000438334:S49W;ENSP00000445962:S74W;ENSP00000343374:S80W;ENSP00000318557:S80W	ENSP00000318557:S80W	S	-	2	0	SLC12A4	66553082	1.000000	0.71417	1.000000	0.80357	0.879000	0.50718	9.420000	0.97426	2.757000	0.94681	0.462000	0.41574	TCG	SLC12A4	-	tigrfam_Na/K/Cl_cotransptS	ENSG00000124067		0.637	SLC12A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC12A4	HGNC	protein_coding	OTTHUMT00000268864.4	37	0.00	0	G	NM_005072		67995581	67995581	-1	no_errors	ENST00000422611	ensembl	human	known	69_37n	missense	69	25.00	23	SNP	1.000	C
SLC27A4	10999	genome.wustl.edu	37	9	131115713	131115713	+	Missense_Mutation	SNP	A	A	G			TCGA-A2-A0D0-01A-11W-A019-09	TCGA-A2-A0D0-10A-01W-A021-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3f20d0fe-aaa1-40f1-b2c1-7f070f93aef5	bbf1c43d-d7b3-4574-a074-d22ad537829c	g.chr9:131115713A>G	ENST00000300456.4	+	9	1334	c.1217A>G	c.(1216-1218)aAt>aGt	p.N406S	SLC27A4_ENST00000372870.1_Intron	NM_005094.3	NP_005085.2	Q6P1M0	S27A4_HUMAN	solute carrier family 27 (fatty acid transporter), member 4	406					fatty acid transport (GO:0015908)|lipid metabolic process (GO:0006629)|long-chain fatty acid import (GO:0044539)|long-chain fatty acid metabolic process (GO:0001676)|long-chain fatty acid transport (GO:0015909)|medium-chain fatty acid transport (GO:0001579)|response to nutrient (GO:0007584)|skin development (GO:0043588)|transmembrane transport (GO:0055085)|transport (GO:0006810)|very long-chain fatty acid catabolic process (GO:0042760)	brush border membrane (GO:0031526)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|microvillus (GO:0005902)|plasma membrane (GO:0005886)	fatty acid transporter activity (GO:0015245)|long-chain fatty acid-CoA ligase activity (GO:0004467)|nucleotide binding (GO:0000166)|very long-chain fatty acid-CoA ligase activity (GO:0031957)			autonomic_ganglia(1)|kidney(1)|large_intestine(1)|lung(7)|ovary(1)|prostate(2)	13						TGTGGTTTCAATAGCCGCATC	0.617																																					Pancreas(107;1554 2241 10946 12953)	dbGAP											0													92.0	83.0	86.0					9																	131115713		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF055899	CCDS6899.1	9q34.13	2013-05-22			ENSG00000167114	ENSG00000167114		"""Acyl-CoA synthetase family"", ""Solute carriers"""	10998	protein-coding gene	gene with protein product		604194				9878842	Standard	NM_005094		Approved	FATP4, ACSVL4	uc004but.3	Q6P1M0	OTTHUMG00000020746	ENST00000300456.4:c.1217A>G	9.37:g.131115713A>G	ENSP00000300456:p.Asn406Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K2F7|O95186|Q96G53	Missense_Mutation	SNP	pfam_AMP-dep_Synth/Lig	p.N406S	ENST00000300456.4	37	c.1217	CCDS6899.1	9	.	.	.	.	.	.	.	.	.	.	A	16.27	3.077015	0.55753	.	.	ENSG00000167114	ENST00000300456	T	0.46819	0.86	5.9	5.9	0.94986	AMP-dependent synthetase/ligase (1);	0.000000	0.85682	D	0.000000	T	0.45155	0.1328	L	0.39898	1.24	0.80722	D	1	P	0.42456	0.78	P	0.45232	0.474	T	0.24548	-1.0157	10	0.18276	T	0.48	-38.6893	15.5133	0.75802	1.0:0.0:0.0:0.0	.	406	Q6P1M0	S27A4_HUMAN	S	406	ENSP00000300456:N406S	ENSP00000300456:N406S	N	+	2	0	SLC27A4	130155534	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.154000	0.77437	2.251000	0.74343	0.528000	0.53228	AAT	SLC27A4	-	pfam_AMP-dep_Synth/Lig	ENSG00000167114		0.617	SLC27A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC27A4	HGNC	protein_coding	OTTHUMT00000054432.2	38	0.00	0	A			131115713	131115713	+1	no_errors	ENST00000300456	ensembl	human	known	69_37n	missense	11	57.69	15	SNP	1.000	G
SLC2A4	6517	genome.wustl.edu	37	17	7187850	7187850	+	Silent	SNP	T	T	C			TCGA-A2-A0D0-01A-11W-A019-09	TCGA-A2-A0D0-10A-01W-A021-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3f20d0fe-aaa1-40f1-b2c1-7f070f93aef5	bbf1c43d-d7b3-4574-a074-d22ad537829c	g.chr17:7187850T>C	ENST00000317370.8	+	7	1042	c.774T>C	c.(772-774)gcT>gcC	p.A258A	RP1-4G17.2_ENST00000576271.1_RNA|SLC2A4_ENST00000424875.2_Silent_p.A248A|SLC2A4_ENST00000571308.1_Silent_p.A258A	NM_001042.2	NP_001033.1	P14672	GTR4_HUMAN	solute carrier family 2 (facilitated glucose transporter), member 4	258					amylopectin biosynthetic process (GO:0010021)|brown fat cell differentiation (GO:0050873)|carbohydrate metabolic process (GO:0005975)|cellular response to insulin stimulus (GO:0032869)|cellular response to osmotic stress (GO:0071470)|glucose homeostasis (GO:0042593)|glucose import (GO:0046323)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|membrane organization (GO:0061024)|response to ethanol (GO:0045471)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)	clathrin-coated vesicle (GO:0030136)|coated pit (GO:0005905)|endomembrane system (GO:0012505)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|insulin-responsive compartment (GO:0032593)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|multivesicular body (GO:0005771)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|trans-Golgi network transport vesicle (GO:0030140)|vesicle membrane (GO:0012506)	D-glucose transmembrane transporter activity (GO:0055056)|glucose transmembrane transporter activity (GO:0005355)			breast(1)|endometrium(3)|large_intestine(7)|lung(2)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	17						GAGTGCTGGCTGAGCTGAAGG	0.642																																						dbGAP											0													50.0	53.0	52.0					17																	7187850		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			M20747	CCDS11097.1	17p13	2013-05-22			ENSG00000181856	ENSG00000181856		"""Solute carriers"""	11009	protein-coding gene	gene with protein product		138190		GLUT4			Standard	NM_001042		Approved		uc002gfp.3	P14672	OTTHUMG00000102181	ENST00000317370.8:c.774T>C	17.37:g.7187850T>C		Somatic		WXS	Illumina GAIIx	Phase_IV	Q05BQ3|Q14CX2	Nonstop_Mutation	SNP	pfam_Sub_transporter,superfamily_MFS_dom_general_subst_transpt,prints_Glc_transpt_4,pfscan_MFS_dom	p.*220R	ENST00000317370.8	37	c.658	CCDS11097.1	17																																																																																			SLC2A4	-	NULL	ENSG00000181856		0.642	SLC2A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC2A4	HGNC	protein_coding	OTTHUMT00000220031.3	92	0.00	0	T			7187850	7187850	+1	no_errors	ENST00000570783	ensembl	human	known	69_37n	nonstop	30	33.33	15	SNP	0.732	C
SLC5A6	8884	genome.wustl.edu	37	2	27428252	27428252	+	Missense_Mutation	SNP	C	C	G	rs373951293		TCGA-A2-A0D0-01A-11W-A019-09	TCGA-A2-A0D0-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3f20d0fe-aaa1-40f1-b2c1-7f070f93aef5	bbf1c43d-d7b3-4574-a074-d22ad537829c	g.chr2:27428252C>G	ENST00000310574.3	-	7	1173	c.700G>C	c.(700-702)Gtg>Ctg	p.V234L	SLC5A6_ENST00000408041.1_Missense_Mutation_p.V234L|SLC5A6_ENST00000461319.1_5'Flank	NM_021095.2	NP_066918.2	Q9Y289	SC5A6_HUMAN	solute carrier family 5 (sodium/multivitamin and iodide cotransporter), member 6	234					biotin metabolic process (GO:0006768)|biotin transport (GO:0015878)|pantothenate metabolic process (GO:0015939)|pantothenate transmembrane transport (GO:0015887)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|transport (GO:0006810)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	brush border membrane (GO:0031526)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)|vesicle membrane (GO:0012506)	sodium-dependent multivitamin transmembrane transporter activity (GO:0008523)			endometrium(2)|kidney(2)|large_intestine(3)|lung(8)|ovary(3)|prostate(1)|skin(1)	20	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)				Biotin(DB00121)|gabapentin enacarbil(DB08872)|Lipoic Acid(DB00166)	TGGGAAGCCACGGCCCACACA	0.617																																						dbGAP											0													47.0	56.0	53.0					2																	27428252		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF069307	CCDS1740.1	2p23	2013-07-19	2013-07-19		ENSG00000138074	ENSG00000138074		"""Solute carriers"""	11041	protein-coding gene	gene with protein product		604024	"""solute carrier family 5 (sodium-dependent vitamin transporter), member 6"""			9516450, 10329687	Standard	NM_021095		Approved	SMVT	uc002rjd.3	Q9Y289	OTTHUMG00000097075	ENST00000310574.3:c.700G>C	2.37:g.27428252C>G	ENSP00000310208:p.Val234Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RB85|D6W549|Q969Y5	Missense_Mutation	SNP	pfam_Na/solute_symporter,pfscan_Na/solute_symporter,tigrfam_Na/solute_symporter_subgr	p.V234L	ENST00000310574.3	37	c.700	CCDS1740.1	2	.	.	.	.	.	.	.	.	.	.	C	3.318	-0.139405	0.06669	.	.	ENSG00000138074	ENST00000310574;ENST00000408041	D;D	0.87650	-2.28;-2.28	5.52	4.64	0.57946	.	0.215245	0.39687	N	0.001298	T	0.74816	0.3766	N	0.13235	0.315	0.37473	D	0.915697	B	0.18310	0.027	B	0.25506	0.061	T	0.69113	-0.5231	10	0.27785	T	0.31	.	7.2044	0.25899	0.1711:0.7443:0.0:0.0846	.	234	Q9Y289	SC5A6_HUMAN	L	234	ENSP00000310208:V234L;ENSP00000384853:V234L	ENSP00000310208:V234L	V	-	1	0	SLC5A6	27281756	0.132000	0.22450	0.873000	0.34254	0.043000	0.13939	0.505000	0.22642	1.308000	0.44962	0.655000	0.94253	GTG	SLC5A6	-	pfam_Na/solute_symporter,pfscan_Na/solute_symporter,tigrfam_Na/solute_symporter_subgr	ENSG00000138074		0.617	SLC5A6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC5A6	HGNC	protein_coding	OTTHUMT00000214194.1	103	0.00	0	C	NM_021095		27428252	27428252	-1	no_errors	ENST00000310574	ensembl	human	known	69_37n	missense	68	23.60	21	SNP	0.946	G
SLCO1C1	53919	genome.wustl.edu	37	12	20885886	20885886	+	Silent	SNP	G	G	C			TCGA-A2-A0D0-01A-11W-A019-09	TCGA-A2-A0D0-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3f20d0fe-aaa1-40f1-b2c1-7f070f93aef5	bbf1c43d-d7b3-4574-a074-d22ad537829c	g.chr12:20885886G>C	ENST00000266509.2	+	10	1598	c.1230G>C	c.(1228-1230)ggG>ggC	p.G410G	SLCO1C1_ENST00000381552.1_Silent_p.G410G|SLCO1C1_ENST00000545102.1_Silent_p.G292G|SLCO1C1_ENST00000545604.1_Silent_p.G410G|SLCO1C1_ENST00000540354.1_Silent_p.G361G	NM_017435.4	NP_059131.1	Q9NYB5	SO1C1_HUMAN	solute carrier organic anion transporter family, member 1C1	410					sodium-independent organic anion transport (GO:0043252)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	transporter activity (GO:0005215)			NS(1)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(9)|liver(1)|lung(28)|ovary(5)|pancreas(1)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	60	Esophageal squamous(101;0.149)				Conjugated Estrogens(DB00286)|Dextrothyroxine(DB00509)|Diclofenac(DB00586)|Digoxin(DB00390)|Dinoprostone(DB00917)|Estradiol(DB00783)|Levothyroxine(DB00451)|Liothyronine(DB00279)|Liotrix(DB01583)|Meclofenamic acid(DB00939)|Methotrexate(DB00563)|Ouabain(DB01092)|Phenytoin(DB00252)|Probenecid(DB01032)	TATTCTCTGGGGGGATAGTTA	0.388																																						dbGAP											0													110.0	107.0	108.0					12																	20885886		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF260704	CCDS8683.1, CCDS53757.1, CCDS53758.1, CCDS53759.1	12p12.2	2013-05-22	2003-11-25	2003-11-26	ENSG00000139155	ENSG00000139155		"""Solute carriers"""	13819	protein-coding gene	gene with protein product		613389	"""solute carrier family 21 (organic anion transporter), member 14"""	SLC21A14			Standard	NM_017435		Approved	OATP-F, OATP1C1, OATP1	uc010sii.2	Q9NYB5	OTTHUMG00000168966	ENST00000266509.2:c.1230G>C	12.37:g.20885886G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	B7Z251|B7Z3Q3|B7Z8P1|F5GZD6|Q5JPA4	Silent	SNP	pfam_OA_transporter,pfam_MFS,pfam_Kazal-type_dom,pfam_Sub_transporter,superfamily_MFS_dom_general_subst_transpt,tigrfam_OA_transporter	p.G410	ENST00000266509.2	37	c.1230	CCDS8683.1	12																																																																																			SLCO1C1	-	pfam_OA_transporter,pfam_MFS,pfam_Sub_transporter,superfamily_MFS_dom_general_subst_transpt,tigrfam_OA_transporter	ENSG00000139155		0.388	SLCO1C1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLCO1C1	HGNC	protein_coding	OTTHUMT00000401765.1	199	0.00	0	G	NM_017435		20885886	20885886	+1	no_errors	ENST00000381552	ensembl	human	known	69_37n	silent	236	22.73	70	SNP	0.998	C
MIEF1	54471	genome.wustl.edu	37	22	39910045	39910045	+	Missense_Mutation	SNP	T	T	C			TCGA-A2-A0D0-01A-11W-A019-09	TCGA-A2-A0D0-10A-01W-A021-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3f20d0fe-aaa1-40f1-b2c1-7f070f93aef5	bbf1c43d-d7b3-4574-a074-d22ad537829c	g.chr22:39910045T>C	ENST00000325301.2	+	6	1533	c.1109T>C	c.(1108-1110)aTa>aCa	p.I370T	MIEF1_ENST00000404569.1_Missense_Mutation_p.I370T|MIEF1_ENST00000402881.1_Missense_Mutation_p.I370T	NM_019008.4	NP_061881.2	Q9NQG6	MID51_HUMAN	mitochondrial elongation factor 1	370					mitochondrial fission (GO:0000266)|positive regulation of mitochondrial fission (GO:0090141)|positive regulation of protein targeting to membrane (GO:0090314)	integral component of membrane (GO:0016021)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)	ADP binding (GO:0043531)|GDP binding (GO:0019003)|identical protein binding (GO:0042802)										CTCAAGGCCATATGCAAGTCC	0.647											OREG0026577	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP											0													67.0	59.0	61.0					22																	39910045		2203	4300	6503	-	-	-	SO:0001583	missense	0			AL365515	CCDS13995.1	22q13.1	2013-09-23	2013-09-23	2013-09-23	ENSG00000100335	ENSG00000100335			25979	protein-coding gene	gene with protein product		615497	"""Smith-Magenis syndrome chromosome region, candidate 7-like"""	SMCR7L		21508961, 21701560	Standard	NM_019008		Approved	FLJ20232, MiD51	uc003axx.3	Q9NQG6	OTTHUMG00000151105	ENST00000325301.2:c.1109T>C	22.37:g.39910045T>C	ENSP00000327124:p.Ile370Thr	Somatic	889	WXS	Illumina GAIIx	Phase_IV	Q7L890|Q9BUI3	Missense_Mutation	SNP	NULL	p.I370T	ENST00000325301.2	37	c.1109	CCDS13995.1	22	.	.	.	.	.	.	.	.	.	.	T	17.51	3.406463	0.62399	.	.	ENSG00000100335	ENST00000402881;ENST00000325301;ENST00000404569	T;T;T	0.11385	2.78;2.78;2.78	6.07	6.07	0.98685	.	0.186362	0.64402	D	0.000020	T	0.15003	0.0362	L	0.50333	1.59	0.49389	D	0.999782	B;B	0.31752	0.322;0.338	B;B	0.33121	0.092;0.158	T	0.01093	-1.1454	10	0.87932	D	0	-6.3261	16.6288	0.85011	0.0:0.0:0.0:1.0	.	370;370	Q9NQG6;B0QY95	MID51_HUMAN;.	T	370	ENSP00000385110:I370T;ENSP00000327124:I370T;ENSP00000385191:I370T	ENSP00000327124:I370T	I	+	2	0	SMCR7L	38239991	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	6.265000	0.72534	2.326000	0.78906	0.533000	0.62120	ATA	SMCR7L	-	NULL	ENSG00000100335		0.647	MIEF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SMCR7L	HGNC	protein_coding	OTTHUMT00000321325.1	68	0.00	0	T	NM_019008		39910045	39910045	+1	no_errors	ENST00000325301	ensembl	human	known	69_37n	missense	34	20.93	9	SNP	1.000	C
SRRM1	10250	genome.wustl.edu	37	1	24975442	24975442	+	Silent	SNP	G	G	A	rs572283451		TCGA-A2-A0D0-01A-11W-A019-09	TCGA-A2-A0D0-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3f20d0fe-aaa1-40f1-b2c1-7f070f93aef5	bbf1c43d-d7b3-4574-a074-d22ad537829c	g.chr1:24975442G>A	ENST00000323848.9	+	4	642	c.327G>A	c.(325-327)ctG>ctA	p.L109L	SRRM1_ENST00000374389.4_Silent_p.L109L|SRRM1_ENST00000537199.1_Silent_p.L8L|SRRM1_ENST00000479034.1_3'UTR|SRRM1_ENST00000447431.2_Silent_p.L109L	NM_005839.3	NP_005830.2	Q8IYB3	SRRM1_HUMAN	serine/arginine repetitive matrix 1	109	Necessary for DNA and RNA-binding.|Necessary for mRNA 3'-end cleavage and cytoplasmic accumulation.|PWI. {ECO:0000255|PROSITE- ProRule:PRU00627}.				gene expression (GO:0010467)|mRNA 3'-end processing (GO:0031124)|mRNA export from nucleus (GO:0006406)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|RNA splicing, via transesterification reactions (GO:0000375)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	catalytic step 2 spliceosome (GO:0071013)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)			breast(1)|central_nervous_system(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(12)|lung(9)|ovary(2)|prostate(1)|urinary_tract(2)	36		Colorectal(325;3.46e-05)|Renal(390;0.0007)|Lung NSC(340;0.000946)|all_lung(284;0.00125)|Ovarian(437;0.00764)|Breast(348;0.0148)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.19)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0422)|OV - Ovarian serous cystadenocarcinoma(117;1.01e-24)|Colorectal(126;5.95e-08)|COAD - Colon adenocarcinoma(152;3.24e-06)|GBM - Glioblastoma multiforme(114;0.000148)|BRCA - Breast invasive adenocarcinoma(304;0.00177)|KIRC - Kidney renal clear cell carcinoma(1967;0.00348)|STAD - Stomach adenocarcinoma(196;0.00483)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.138)		GGCCCCTGCTGCTAAGTGCAC	0.393																																					Ovarian(68;897 1494 3282 17478)	dbGAP											0													134.0	143.0	140.0					1																	24975442		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF048977	CCDS255.1	1p36	2010-04-22			ENSG00000133226	ENSG00000133226			16638	protein-coding gene	gene with protein product	"""Ser/Arg-related nuclear matrix protein"", ""plenty of prolines 101-like"""	605975				9531537	Standard	NM_005839		Approved	SRM160, POP101, MGC39488	uc001bjm.3	Q8IYB3	OTTHUMG00000003320	ENST00000323848.9:c.327G>A	1.37:g.24975442G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	O60585|Q5VVN4	Silent	SNP	pfam_PWI,superfamily_PWI,smart_PWI	p.L109	ENST00000323848.9	37	c.327	CCDS255.1	1																																																																																			SRRM1	-	pfam_PWI,superfamily_PWI,smart_PWI	ENSG00000133226		0.393	SRRM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SRRM1	HGNC	protein_coding	OTTHUMT00000009292.2	628	0.00	0	G	NM_005839		24975442	24975442	+1	no_errors	ENST00000447431	ensembl	human	known	69_37n	silent	137	28.87	56	SNP	1.000	A
STC2	8614	genome.wustl.edu	37	5	172745089	172745090	+	Frame_Shift_Ins	INS	-	-	G	rs11554179		TCGA-A2-A0D0-01A-11W-A019-09	TCGA-A2-A0D0-10A-01W-A021-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3f20d0fe-aaa1-40f1-b2c1-7f070f93aef5	bbf1c43d-d7b3-4574-a074-d22ad537829c	g.chr5:172745089_172745090insG	ENST00000265087.4	-	4	1978_1979	c.669_670insC	c.(667-672)cccgagfs	p.E224fs	STC2_ENST00000520593.1_5'Flank	NM_003714.2	NP_003705.1	O76061	STC2_HUMAN	stanniocalcin 2	224					cellular calcium ion homeostasis (GO:0006874)|cellular response to hypoxia (GO:0071456)|decidualization (GO:0046697)|embryo implantation (GO:0007566)|endoplasmic reticulum unfolded protein response (GO:0030968)|negative regulation of gene expression (GO:0010629)|negative regulation of multicellular organism growth (GO:0040015)|regulation of hormone biosynthetic process (GO:0046885)|regulation of store-operated calcium entry (GO:2001256)|response to oxidative stress (GO:0006979)|response to peptide hormone (GO:0043434)|response to vitamin D (GO:0033280)	endoplasmic reticulum (GO:0005783)|extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)|perinuclear region of cytoplasm (GO:0048471)	enzyme binding (GO:0019899)|heme binding (GO:0020037)|protein homodimerization activity (GO:0042803)			endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(4)|lung(10)|ovary(1)|prostate(1)|skin(3)	25	Renal(175;0.000159)|Lung NSC(126;0.00229)|all_lung(126;0.004)	Medulloblastoma(196;0.0208)|all_neural(177;0.0416)|Ovarian(839;0.223)	Kidney(164;3.85e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000183)			GGCTGGCGCTCGGGGGGCGCCG	0.658																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			AB012664	CCDS4388.1	5q35.2	2004-05-17			ENSG00000113739	ENSG00000113739			11374	protein-coding gene	gene with protein product		603665				9723890, 9753616	Standard	NM_003714		Approved	STC-2	uc003mco.1	O76061	OTTHUMG00000130542	ENST00000265087.4:c.670dupC	5.37:g.172745095_172745095dupG	ENSP00000265087:p.Glu224fs	Somatic		WXS	Illumina GAIIx	Phase_IV		Frame_Shift_Ins	INS	pfam_Stanniocalcin	p.E223fs	ENST00000265087.4	37	c.670_669	CCDS4388.1	5																																																																																			STC2	-	NULL	ENSG00000113739		0.658	STC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STC2	HGNC	protein_coding	OTTHUMT00000252965.1	26	0.00	0	-	NM_003714		172745089	172745090	-1	no_errors	ENST00000265087	ensembl	human	known	69_37n	frame_shift_ins	14	12.50	2	INS	0.320:0.000	G
STK38L	23012	genome.wustl.edu	37	12	27450761	27450761	+	Missense_Mutation	SNP	T	T	G			TCGA-A2-A0D0-01A-11W-A019-09	TCGA-A2-A0D0-10A-01W-A021-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3f20d0fe-aaa1-40f1-b2c1-7f070f93aef5	bbf1c43d-d7b3-4574-a074-d22ad537829c	g.chr12:27450761T>G	ENST00000389032.3	+	2	277	c.108T>G	c.(106-108)atT>atG	p.I36M	STK38L_ENST00000539577.1_Intron	NM_015000.3	NP_055815.1			serine/threonine kinase 38 like									p.I36M(1)		breast(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(2)|ovary(2)|prostate(1)|skin(1)	12	Colorectal(261;0.0847)					GCAACCTAATTTTACAGCATG	0.393																																						dbGAP											1	Substitution - Missense(1)	large_intestine(1)											122.0	126.0	124.0					12																	27450761		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB023182	CCDS31761.1	12p11.23	2014-04-23			ENSG00000211455	ENSG00000211455			17848	protein-coding gene	gene with protein product	"""nuclear Dbf2-related 2"""	615836				16488889	Standard	NM_015000		Approved	KIAA0965, NDR2	uc001rhr.3	Q9Y2H1	OTTHUMG00000169284	ENST00000389032.3:c.108T>G	12.37:g.27450761T>G	ENSP00000373684:p.Ile36Met	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Pkinase_C,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_AGC-kinase_C,pfscan_Prot_kinase_cat_dom	p.I36M	ENST00000389032.3	37	c.108	CCDS31761.1	12	.	.	.	.	.	.	.	.	.	.	T	14.10	2.435353	0.43224	.	.	ENSG00000211455	ENST00000541191;ENST00000389032;ENST00000545470;ENST00000540996;ENST00000543246;ENST00000544969	T;T;T;T;T;T	0.56611	0.45;0.45;0.45;0.45;0.45;0.45	5.03	1.28	0.21552	.	0.064020	0.64402	D	0.000007	T	0.29423	0.0733	N	0.25060	0.705	0.80722	D	1	B	0.28605	0.217	B	0.31337	0.128	T	0.03403	-1.1040	10	0.11182	T	0.66	.	3.6489	0.08195	0.1732:0.2437:0.0:0.5831	.	36	Q9Y2H1	ST38L_HUMAN	M	36	ENSP00000437856:I36M;ENSP00000373684:I36M;ENSP00000439457:I36M;ENSP00000443838:I36M;ENSP00000442253:I36M;ENSP00000440279:I36M	ENSP00000373684:I36M	I	+	3	3	STK38L	27342028	0.001000	0.12720	0.975000	0.42487	0.996000	0.88848	-0.117000	0.10708	0.313000	0.23062	0.482000	0.46254	ATT	STK38L	-	NULL	ENSG00000211455		0.393	STK38L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STK38L	HGNC	protein_coding	OTTHUMT00000403297.1	176	0.00	0	T	NM_015000		27450761	27450761	+1	no_errors	ENST00000389032	ensembl	human	known	69_37n	missense	117	22.88	35	SNP	0.938	G
TCHH	7062	genome.wustl.edu	37	1	152082308	152082308	+	Missense_Mutation	SNP	C	C	T			TCGA-A2-A0D0-01A-11W-A019-09	TCGA-A2-A0D0-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3f20d0fe-aaa1-40f1-b2c1-7f070f93aef5	bbf1c43d-d7b3-4574-a074-d22ad537829c	g.chr1:152082308C>T	ENST00000368804.1	-	2	3384	c.3385G>A	c.(3385-3387)Gag>Aag	p.E1129K		NM_007113.2	NP_009044.2	Q07283	TRHY_HUMAN	trichohyalin	1129	10 X 30 AA tandem repeats.				keratinization (GO:0031424)	cytoskeleton (GO:0005856)	calcium ion binding (GO:0005509)			NS(2)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(20)|kidney(9)|large_intestine(16)|lung(33)|ovary(3)|pancreas(1)|prostate(4)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(4)	105	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			cttctcttctcccgttcctct	0.602																																						dbGAP											0													92.0	93.0	93.0					1																	152082308		1978	4145	6123	-	-	-	SO:0001583	missense	0			L09190	CCDS41396.1	1q21-q23	2013-01-10		2006-01-27	ENSG00000159450	ENSG00000159450		"""EF-hand domain containing"""	11791	protein-coding gene	gene with protein product		190370		THH		1431214	Standard	NM_007113		Approved		uc001ezp.3	Q07283	OTTHUMG00000013066	ENST00000368804.1:c.3385G>A	1.37:g.152082308C>T	ENSP00000357794:p.Glu1129Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5VUI3	Missense_Mutation	SNP	pfam_S100_Ca-bd_sub,pfscan_EF_HAND_2	p.E1129K	ENST00000368804.1	37	c.3385	CCDS41396.1	1	.	.	.	.	.	.	.	.	.	.	C	8.700	0.909442	0.17833	.	.	ENSG00000159450	ENST00000368804	T	0.06142	3.34	2.57	-1.18	0.09617	.	.	.	.	.	T	0.00998	0.0033	L	0.27053	0.805	0.09310	N	1	B	0.26081	0.141	B	0.17722	0.019	T	0.47573	-0.9107	9	0.12103	T	0.63	.	6.4822	0.22069	0.0:0.3377:0.5332:0.1292	.	1129	Q07283	TRHY_HUMAN	K	1129	ENSP00000357794:E1129K	ENSP00000357794:E1129K	E	-	1	0	TCHH	150348932	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-0.692000	0.05127	-0.170000	0.10816	0.462000	0.41574	GAG	TCHH	-	NULL	ENSG00000159450		0.602	TCHH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TCHH	HGNC	protein_coding	OTTHUMT00000036671.2	408	0.24	1	C	NM_007113		152082308	152082308	-1	no_errors	ENST00000368804	ensembl	human	known	69_37n	missense	2093	14.59	358	SNP	0.001	T
TNKS1BP1	85456	genome.wustl.edu	37	11	57081323	57081323	+	Nonsense_Mutation	SNP	G	G	C			TCGA-A2-A0D0-01A-11W-A019-09	TCGA-A2-A0D0-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3f20d0fe-aaa1-40f1-b2c1-7f070f93aef5	bbf1c43d-d7b3-4574-a074-d22ad537829c	g.chr11:57081323G>C	ENST00000532437.1	-	4	1150	c.839C>G	c.(838-840)tCa>tGa	p.S280*	TNKS1BP1_ENST00000530920.1_5'Flank|TNKS1BP1_ENST00000358252.3_Nonsense_Mutation_p.S280*			Q9C0C2	TB182_HUMAN	tankyrase 1 binding protein 1, 182kDa	280	Acidic.|Pro-rich.				gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|RNA metabolic process (GO:0016070)|telomere maintenance via telomerase (GO:0007004)	CCR4-NOT complex (GO:0030014)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|nuclear telomeric heterochromatin (GO:0005724)|nucleus (GO:0005634)	ankyrin binding (GO:0030506)|enzyme binding (GO:0019899)			breast(3)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(11)|lung(24)|ovary(3)|prostate(3)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	64		all_epithelial(135;0.21)				TCCATTCTCTGAGGAGGGGGC	0.622																																						dbGAP											0													10.0	13.0	12.0					11																	57081323		2197	4291	6488	-	-	-	SO:0001587	stop_gained	0			AB051528	CCDS7951.1	11q12.2	2008-07-21			ENSG00000149115	ENSG00000149115			19081	protein-coding gene	gene with protein product		607104				11854288	Standard	NM_033396		Approved	TAB182, KIAA1741, FLJ45975	uc001njs.3	Q9C0C2	OTTHUMG00000167022	ENST00000532437.1:c.839C>G	11.37:g.57081323G>C	ENSP00000437271:p.Ser280*	Somatic		WXS	Illumina GAIIx	Phase_IV	A7E2F8|Q6PJ35|Q6ZV74	Nonsense_Mutation	SNP	NULL	p.S280*	ENST00000532437.1	37	c.839	CCDS7951.1	11	.	.	.	.	.	.	.	.	.	.	G	37	6.093894	0.97276	.	.	ENSG00000149115	ENST00000358252;ENST00000532437	.	.	.	3.11	2.07	0.26955	.	1.288860	0.05807	N	0.613257	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.24483	T	0.36	-0.2104	9.5346	0.39216	0.0:0.2167:0.7833:0.0	.	.	.	.	X	280	.	ENSP00000350990:S280X	S	-	2	0	TNKS1BP1	56837899	0.001000	0.12720	0.076000	0.20297	0.402000	0.30811	1.048000	0.30379	1.777000	0.52277	0.462000	0.41574	TCA	TNKS1BP1	-	NULL	ENSG00000149115		0.622	TNKS1BP1-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	TNKS1BP1	HGNC	protein_coding	OTTHUMT00000392455.1	10	0.00	0	G	NM_033396		57081323	57081323	-1	no_errors	ENST00000358252	ensembl	human	known	69_37n	nonsense	12	53.85	14	SNP	0.099	C
TP53	7157	genome.wustl.edu	37	17	7578263	7578263	+	Nonsense_Mutation	SNP	G	G	A	rs397516435		TCGA-A2-A0D0-01A-11W-A019-09	TCGA-A2-A0D0-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3f20d0fe-aaa1-40f1-b2c1-7f070f93aef5	bbf1c43d-d7b3-4574-a074-d22ad537829c	g.chr17:7578263G>A	ENST00000269305.4	-	6	775	c.586C>T	c.(586-588)Cga>Tga	p.R196*	TP53_ENST00000445888.2_Nonsense_Mutation_p.R196*|TP53_ENST00000413465.2_Nonsense_Mutation_p.R196*|TP53_ENST00000359597.4_Nonsense_Mutation_p.R196*|TP53_ENST00000420246.2_Nonsense_Mutation_p.R196*|TP53_ENST00000455263.2_Nonsense_Mutation_p.R196*|TP53_ENST00000574684.1_Intron	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	196	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		R -> G (in sporadic cancers; somatic mutation).|R -> L (in sporadic cancers; somatic mutation).|R -> P (in LFS; germline mutation and in sporadic cancers; somatic mutation).|R -> Q (in sporadic cancers; somatic mutation).|R -> S (in a sporadic cancer; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.R196*(167)|p.R64*(14)|p.R103*(14)|p.0?(8)|p.R196fs*51(7)|p.?(5)|p.A189_V197delAPPQHLIRV(4)|p.P191_E198>Q(3)|p.R196R(2)|p.I195fs*50(1)|p.R64fs*>27(1)|p.R103fs*51(1)|p.P191fs*6(1)|p.I195_G199delIRVEG(1)|p.P98_E105>Q(1)|p.I195fs*12(1)|p.P59_E66>Q(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	CCTTCCACTCGGATAAGATGC	0.552		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	dbGAP	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	232	Substitution - Nonsense(195)|Deletion - Frameshift(11)|Whole gene deletion(8)|Deletion - In frame(5)|Complex - deletion inframe(5)|Unknown(5)|Substitution - coding silent(2)|Complex - frameshift(1)	large_intestine(54)|breast(29)|upper_aerodigestive_tract(22)|lung(22)|haematopoietic_and_lymphoid_tissue(17)|skin(17)|biliary_tract(11)|central_nervous_system(11)|oesophagus(11)|ovary(11)|stomach(8)|urinary_tract(7)|bone(4)|liver(3)|pancreas(3)|eye(1)|kidney(1)	GRCh37	CM941329	TP53	M							102.0	91.0	94.0					17																	7578263		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.586C>T	17.37:g.7578263G>A	ENSP00000269305:p.Arg196*	Somatic		WXS	Illumina GAIIx	Phase_IV	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Nonsense_Mutation	SNP	pfam_p53_DNA-bd,pfam_p53_tetrameristn,pfam_p53_transactivation_domain,superfamily_p53-like_TF_DNA-bd,superfamily_p53_tetrameristn,prints_p53_tumour_suppressor	p.R196*	ENST00000269305.4	37	c.586	CCDS11118.1	17	.	.	.	.	.	.	.	.	.	.	G	14.02	2.409843	0.42715	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944;ENST00000414315	.	.	.	5.41	4.44	0.53790	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-19.9531	12.3046	0.54895	0.0827:0.0:0.9173:0.0	.	.	.	.	X	196;196;196;196;196;196;185;103;64;103;64	.	ENSP00000269305:R196X	R	-	1	2	TP53	7518988	1.000000	0.71417	0.997000	0.53966	0.023000	0.10783	2.166000	0.42406	1.427000	0.47276	-0.140000	0.14226	CGA	TP53	-	pfam_p53_DNA-bd,superfamily_p53-like_TF_DNA-bd	ENSG00000141510		0.552	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	HGNC	protein_coding	OTTHUMT00000367397.1	160	0.00	0	G	NM_000546		7578263	7578263	-1	no_errors	ENST00000269305	ensembl	human	known	69_37n	nonsense	121	64.09	216	SNP	1.000	A
TTF2	8458	genome.wustl.edu	37	1	117634518	117634518	+	Silent	SNP	G	G	A			TCGA-A2-A0D0-01A-11W-A019-09	TCGA-A2-A0D0-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3f20d0fe-aaa1-40f1-b2c1-7f070f93aef5	bbf1c43d-d7b3-4574-a074-d22ad537829c	g.chr1:117634518G>A	ENST00000369466.4	+	17	2795	c.2751G>A	c.(2749-2751)ctG>ctA	p.L917L	MIR942_ENST00000401111.1_RNA	NM_003594.3	NP_003585.3	Q9UNY4	TTF2_HUMAN	transcription termination factor, RNA polymerase II	917					ATP catabolic process (GO:0006200)|DNA-templated transcription, termination (GO:0006353)|mRNA processing (GO:0006397)|regulation of transcription, DNA-templated (GO:0006355)|RNA splicing (GO:0008380)|termination of RNA polymerase II transcription (GO:0006369)	cytoplasm (GO:0005737)|spliceosomal complex (GO:0005681)|transcription elongation factor complex (GO:0008023)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|DNA binding (GO:0003677)|DNA-dependent ATPase activity (GO:0008094)|zinc ion binding (GO:0008270)			NS(1)|autonomic_ganglia(1)|breast(1)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|liver(1)|lung(24)|ovary(1)|prostate(2)|skin(2)|urinary_tract(2)	50	Lung SC(450;0.225)	all_cancers(81;4.23e-06)|all_epithelial(167;3.65e-07)|all_lung(203;2.81e-06)|Lung NSC(69;1.98e-05)		Lung(183;0.0553)|Colorectal(144;0.179)|LUSC - Lung squamous cell carcinoma(189;0.19)		TCCACATACTGTCCCAGTTGC	0.547																																						dbGAP											0													109.0	101.0	104.0					1																	117634518		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF073771	CCDS892.1	1p13.1	2014-02-18			ENSG00000116830	ENSG00000116830			12398	protein-coding gene	gene with protein product	"""zinc finger, GRF-type containing 6"""	604718				9748214	Standard	NM_003594		Approved	HuF2, ZGRF6	uc001egy.3	Q9UNY4	OTTHUMG00000012030	ENST00000369466.4:c.2751G>A	1.37:g.117634518G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K4Q2|O75921|Q5T2K7|Q5VVU8|Q8N6I8	Silent	SNP	pfam_SNF2_N,pfam_Helicase_C,pfam_Helicase/UvrB_dom,pfam_Znf_GRF,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Helicase_ATP-bd,pfscan_Helicase_C	p.L917	ENST00000369466.4	37	c.2751	CCDS892.1	1																																																																																			TTF2	-	pfam_SNF2_N	ENSG00000116830		0.547	TTF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TTF2	HGNC	protein_coding	OTTHUMT00000033277.3	122	0.00	0	G			117634518	117634518	+1	no_errors	ENST00000369466	ensembl	human	known	69_37n	silent	114	20.14	29	SNP	1.000	A
TPR	7175	genome.wustl.edu	37	1	186329484	186329484	+	Missense_Mutation	SNP	G	G	C			TCGA-A2-A0D0-01A-11W-A019-09	TCGA-A2-A0D0-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3f20d0fe-aaa1-40f1-b2c1-7f070f93aef5	bbf1c43d-d7b3-4574-a074-d22ad537829c	g.chr1:186329484G>C	ENST00000367478.4	-	11	1408	c.1112C>G	c.(1111-1113)tCt>tGt	p.S371C	TPR_ENST00000474852.1_5'UTR	NM_003292.2	NP_003283.2	P12270	TPR_HUMAN	translocated promoter region, nuclear basket protein	371					carbohydrate metabolic process (GO:0005975)|cellular response to heat (GO:0034605)|cellular response to interferon-alpha (GO:0035457)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|MAPK import into nucleus (GO:0000189)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic nuclear envelope disassembly (GO:0007077)|mitotic spindle assembly checkpoint (GO:0007094)|mRNA export from nucleus in response to heat stress (GO:0031990)|negative regulation of RNA export from nucleus (GO:0046832)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of translational initiation (GO:0045947)|nuclear pore organization (GO:0006999)|positive regulation of heterochromatin assembly (GO:0031453)|positive regulation of intracellular protein transport (GO:0090316)|positive regulation of mitotic cell cycle spindle assembly checkpoint (GO:0090267)|positive regulation of protein export from nucleus (GO:0046827)|positive regulation of protein import into nucleus (GO:0042307)|protein import into nucleus (GO:0006606)|regulation of glucose transport (GO:0010827)|regulation of mitotic sister chromatid separation (GO:0010965)|regulation of spindle assembly involved in mitosis (GO:1901673)|response to epidermal growth factor (GO:0070849)|RNA export from nucleus (GO:0006405)|RNA import into nucleus (GO:0006404)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytoplasmic dynein complex (GO:0005868)|extrinsic component of membrane (GO:0019898)|kinetochore (GO:0000776)|mitotic spindle (GO:0072686)|nuclear envelope (GO:0005635)|nuclear inclusion body (GO:0042405)|nuclear membrane (GO:0031965)|nuclear periphery (GO:0034399)|nuclear pore (GO:0005643)|nuclear pore nuclear basket (GO:0044615)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|dynein complex binding (GO:0070840)|heat shock protein binding (GO:0031072)|mitogen-activated protein kinase binding (GO:0051019)|mRNA binding (GO:0003729)|nucleocytoplasmic transporter activity (GO:0005487)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)|tubulin binding (GO:0015631)			autonomic_ganglia(1)|breast(5)|central_nervous_system(4)|cervix(2)|endometrium(9)|kidney(12)|large_intestine(23)|liver(1)|lung(45)|ovary(2)|pancreas(1)|prostate(6)|skin(3)|stomach(1)|urinary_tract(8)	123		Breast(1374;0.000659)|Lung SC(1967;0.0262)|Prostate(1639;0.157)		Colorectal(1306;1.12e-05)|KIRC - Kidney renal clear cell carcinoma(1967;0.00553)		CTCTTCTTCAGACAATATGGC	0.373			T	NTRK1	papillary thyroid																																	dbGAP		Dom	yes		1	1q25	7175	translocated promoter region		E	0													71.0	70.0	70.0					1																	186329484		1842	4096	5938	-	-	-	SO:0001583	missense	0			U69668	CCDS41446.1	1q25	2012-03-13	2012-03-13		ENSG00000047410	ENSG00000047410			12017	protein-coding gene	gene with protein product		189940	"""translocated promoter region (to activated MET oncogene)"""			1611909, 15229283	Standard	NM_003292		Approved		uc001grv.3	P12270	OTTHUMG00000035580	ENST00000367478.4:c.1112C>G	1.37:g.186329484G>C	ENSP00000356448:p.Ser371Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q15655|Q5SWY0|Q99968	Missense_Mutation	SNP	pfam_TPR_MLP1_2,superfamily_Prefoldin,superfamily_tRNA-bd_arm	p.S371C	ENST00000367478.4	37	c.1112	CCDS41446.1	1	.	.	.	.	.	.	.	.	.	.	G	27.7	4.856522	0.91355	.	.	ENSG00000047410	ENST00000367478	T	0.27104	1.69	5.62	5.62	0.85841	.	0.212861	0.49305	D	0.000145	T	0.37571	0.1008	L	0.34521	1.04	0.44316	D	0.99719	D;D	0.76494	0.999;0.99	P;P	0.61722	0.893;0.785	T	0.02358	-1.1171	10	0.38643	T	0.18	.	16.8324	0.85948	0.0:0.0:1.0:0.0	.	371;371	Q15624;P12270	.;TPR_HUMAN	C	371	ENSP00000356448:S371C	ENSP00000356448:S371C	S	-	2	0	TPR	184596107	1.000000	0.71417	0.974000	0.42286	0.937000	0.57800	9.175000	0.94831	2.660000	0.90430	0.655000	0.94253	TCT	TPR	-	NULL	ENSG00000047410		0.373	TPR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TPR	HGNC	protein_coding	OTTHUMT00000086353.2	78	0.00	0	G	NM_003292		186329484	186329484	-1	no_errors	ENST00000367478	ensembl	human	known	69_37n	missense	70	28.57	28	SNP	0.993	C
TYRO3	7301	genome.wustl.edu	37	15	41859670	41859670	+	Missense_Mutation	SNP	G	G	A			TCGA-A2-A0D0-01A-11W-A019-09	TCGA-A2-A0D0-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3f20d0fe-aaa1-40f1-b2c1-7f070f93aef5	bbf1c43d-d7b3-4574-a074-d22ad537829c	g.chr15:41859670G>A	ENST00000263798.3	+	7	1120	c.896G>A	c.(895-897)cGc>cAc	p.R299H	TYRO3_ENST00000559066.1_Missense_Mutation_p.R254H	NM_006293.3	NP_006284.2	Q06418	TYRO3_HUMAN	TYRO3 protein tyrosine kinase	299	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.				apoptotic cell clearance (GO:0043277)|cell adhesion (GO:0007155)|forebrain cell migration (GO:0021885)|natural killer cell differentiation (GO:0001779)|negative regulation of inflammatory response (GO:0050728)|negative regulation of innate immune response (GO:0045824)|negative regulation of lymphocyte activation (GO:0051250)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of toll-like receptor signaling pathway (GO:0034122)|neuron cellular homeostasis (GO:0070050)|ovulation cycle (GO:0042698)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol 3-kinase signaling (GO:0014065)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|protein autophosphorylation (GO:0046777)|protein kinase B signaling (GO:0043491)|secretion by cell (GO:0032940)|signal transduction (GO:0007165)|signal transduction by phosphorylation (GO:0023014)|spermatogenesis (GO:0007283)|substrate adhesion-dependent cell spreading (GO:0034446)|vagina development (GO:0060068)	endoplasmic reticulum membrane (GO:0005789)|integral component of plasma membrane (GO:0005887)|nuclear envelope (GO:0005635)|nucleus (GO:0005634)	ATP binding (GO:0005524)|phosphatidylinositol 3-kinase binding (GO:0043548)|protein tyrosine kinase activity (GO:0004713)|receptor signaling protein tyrosine kinase activity (GO:0004716)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)			central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(26)|ovary(3)|prostate(1)	43		all_cancers(109;7.33e-15)|all_epithelial(112;2.8e-12)|Lung NSC(122;3.48e-08)|all_lung(180;1.71e-07)|Melanoma(134;0.0262)		OV - Ovarian serous cystadenocarcinoma(18;3.31e-18)|GBM - Glioblastoma multiforme(113;9.31e-07)|BRCA - Breast invasive adenocarcinoma(123;0.117)		CTCAGGGTGCGCTGTGCCAAT	0.637																																						dbGAP											0													99.0	99.0	99.0					15																	41859670		2203	4300	6503	-	-	-	SO:0001583	missense	0			D50479	CCDS10080.1	15q15.1-q21.1	2013-02-11			ENSG00000092445	ENSG00000092445	2.7.10.1	"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12446	protein-coding gene	gene with protein product		600341		RSE		7851890	Standard	NM_006293		Approved	Dtk, Brt, Tif, Sky	uc001zof.2	Q06418	OTTHUMG00000130341	ENST00000263798.3:c.896G>A	15.37:g.41859670G>A	ENSP00000263798:p.Arg299His	Somatic		WXS	Illumina GAIIx	Phase_IV	O14953|Q86VR3	Missense_Mutation	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,pfam_Fibronectin_type3,pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_cat_dom,pfscan_Ig-like,prints_Ser-Thr/Tyr_kinase_cat_dom	p.R299H	ENST00000263798.3	37	c.896	CCDS10080.1	15	.	.	.	.	.	.	.	.	.	.	G	21.8	4.200369	0.79015	.	.	ENSG00000092445	ENST00000540218;ENST00000263798	T	0.58358	0.34	4.64	4.64	0.57946	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.000000	0.42420	D	0.000714	T	0.57051	0.2027	L	0.53249	1.67	0.40798	D	0.983314	D	0.54207	0.965	P	0.55923	0.787	T	0.54912	-0.8222	10	0.30854	T	0.27	-16.5493	8.6021	0.33751	0.1023:0.0:0.8977:0.0	.	299	Q06418	TYRO3_HUMAN	H	231;299	ENSP00000263798:R299H	ENSP00000263798:R299H	R	+	2	0	TYRO3	39646962	1.000000	0.71417	1.000000	0.80357	1.000000	0.99986	2.914000	0.48797	2.417000	0.82017	0.655000	0.94253	CGC	TYRO3	-	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000092445		0.637	TYRO3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TYRO3	HGNC	protein_coding	OTTHUMT00000252693.2	69	0.00	0	G			41859670	41859670	+1	no_errors	ENST00000263798	ensembl	human	known	69_37n	missense	40	29.31	17	SNP	1.000	A
VAMP1	6843	genome.wustl.edu	37	12	6574108	6574108	+	Splice_Site	SNP	C	C	G			TCGA-A2-A0D0-01A-11W-A019-09	TCGA-A2-A0D0-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3f20d0fe-aaa1-40f1-b2c1-7f070f93aef5	bbf1c43d-d7b3-4574-a074-d22ad537829c	g.chr12:6574108C>G	ENST00000396308.3	-	4	434		c.e4-1		VAMP1_ENST00000535180.1_Splice_Site|VAMP1_ENST00000400911.3_Splice_Site|VAMP1_ENST00000544432.1_Splice_Site|VAMP1_ENST00000361716.3_Splice_Site|TAPBPL_ENST00000545700.1_Intron	NM_014231.3|NM_199245.1	NP_055046.1|NP_954740.1	P23763	VAMP1_HUMAN	vesicle-associated membrane protein 1 (synaptobrevin 1)						neurotransmitter secretion (GO:0007269)|SNARE complex assembly (GO:0035493)|synaptic transmission (GO:0007268)	cell junction (GO:0030054)|cell surface (GO:0009986)|endocytic vesicle membrane (GO:0030666)|integral component of plasma membrane (GO:0005887)|mitochondrial outer membrane (GO:0005741)|neuron projection (GO:0043005)|synapse (GO:0045202)				endometrium(1)|large_intestine(1)|prostate(1)	3					Botulinum Toxin Type B(DB00042)	TGATCATCATCTGAGGAAACA	0.463																																						dbGAP											0													181.0	159.0	167.0					12																	6574108		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0				CCDS31731.1, CCDS41740.1, CCDS44809.1, CCDS73422.1	12p	2013-02-13			ENSG00000139190	ENSG00000139190		"""Vesicle-associated membrane proteins"""	12642	protein-coding gene	gene with protein product		185880		SYB1		1976629	Standard	XM_006719011		Approved	VAMP-1	uc001qok.3	P23763	OTTHUMG00000168269	ENST00000396308.3:c.289-1G>C	12.37:g.6574108C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	A8MVP3|D3DUR3|O75468|Q15857|Q6FG94|Q8IVC9	Splice_Site	SNP	-	e4-1	ENST00000396308.3	37	c.289-1	CCDS41740.1	12	.	.	.	.	.	.	.	.	.	.	C	24.8	4.573132	0.86542	.	.	ENSG00000139190	ENST00000400911;ENST00000361716;ENST00000535180;ENST00000355479;ENST00000396308;ENST00000396943	.	.	.	5.73	5.73	0.89815	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.8991	0.96978	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	VAMP1	6444369	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	7.818000	0.86416	2.708000	0.92522	0.655000	0.94253	.	VAMP1	-	-	ENSG00000139190		0.463	VAMP1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	VAMP1	HGNC	protein_coding	OTTHUMT00000399078.1	235	0.00	0	C		Intron	6574108	6574108	-1	no_errors	ENST00000361716	ensembl	human	known	69_37n	splice_site	194	27.07	72	SNP	1.000	G
VAV1	7409	genome.wustl.edu	37	19	6828862	6828862	+	Missense_Mutation	SNP	G	G	A			TCGA-A2-A0D0-01A-11W-A019-09	TCGA-A2-A0D0-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3f20d0fe-aaa1-40f1-b2c1-7f070f93aef5	bbf1c43d-d7b3-4574-a074-d22ad537829c	g.chr19:6828862G>A	ENST00000602142.1	+	13	1298	c.1216G>A	c.(1216-1218)Gac>Aac	p.D406N	VAV1_ENST00000596764.1_Missense_Mutation_p.D374N|VAV1_ENST00000539284.1_Missense_Mutation_p.D309N|VAV1_ENST00000304076.2_Missense_Mutation_p.D406N|VAV1_ENST00000599806.1_Missense_Mutation_p.D351N	NM_005428.3	NP_005419.2	P15498	VAV_HUMAN	vav 1 guanine nucleotide exchange factor	406	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				apoptotic signaling pathway (GO:0097190)|blood coagulation (GO:0007596)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|G-protein coupled receptor signaling pathway (GO:0007186)|innate immune response (GO:0045087)|integrin-mediated signaling pathway (GO:0007229)|neurotrophin TRK receptor signaling pathway (GO:0048011)|neutrophil chemotaxis (GO:0030593)|phosphatidylinositol-mediated signaling (GO:0048015)|platelet activation (GO:0030168)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell adhesion (GO:0045785)|reactive oxygen species metabolic process (GO:0072593)|regulation of Rac GTPase activity (GO:0032314)|regulation of small GTPase mediated signal transduction (GO:0051056)|regulation of transcription, DNA-templated (GO:0006355)|small GTPase mediated signal transduction (GO:0007264)|T cell activation (GO:0042110)|T cell costimulation (GO:0031295)	cell-cell junction (GO:0005911)|cytosol (GO:0005829)|plasma membrane (GO:0005886)	guanyl-nucleotide exchange factor activity (GO:0005085)|metal ion binding (GO:0046872)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)|sequence-specific DNA binding transcription factor activity (GO:0003700)			biliary_tract(1)|breast(3)|central_nervous_system(2)|endometrium(3)|kidney(5)|large_intestine(16)|lung(18)|ovary(5)|prostate(2)|skin(5)|upper_aerodigestive_tract(2)	62						GCCCAAGATCGACGGGGAACT	0.597																																						dbGAP											0													64.0	53.0	57.0					19																	6828862		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS12174.1, CCDS59341.1, CCDS59342.1	19p13.2	2013-02-14	2007-07-25			ENSG00000141968		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"", ""SH2 domain containing"""	12657	protein-coding gene	gene with protein product		164875	"""vav 1 oncogene"""	VAV		9438848	Standard	NM_005428		Approved		uc010xjh.2	P15498		ENST00000602142.1:c.1216G>A	19.37:g.6828862G>A	ENSP00000472929:p.Asp406Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DVK9|M0QXX6|Q15860	Missense_Mutation	SNP	pfam_DH-domain,pfam_SH3_domain,pfam_SH3_2,pfam_CAMSAP_CH,pfam_SH2,pfam_CH-domain,pfam_Prot_Kinase_C-like_PE/DAG-bd,pfam_Pleckstrin_homology,superfamily_DH-domain,superfamily_CH-domain,superfamily_SH3_domain,smart_CH-domain,smart_DH-domain,smart_Pleckstrin_homology,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_SH3_domain,smart_SH2,pfscan_CH-domain,pfscan_Pleckstrin_homology,pfscan_SH2,pfscan_SH3_domain,pfscan_Prot_Kinase_C-like_PE/DAG-bd,pfscan_DH-domain,prints_SH3_domain,prints_SH2,prints_SM22_calponin	p.D406N	ENST00000602142.1	37	c.1216	CCDS12174.1	19	.	.	.	.	.	.	.	.	.	.	G	35	5.510485	0.96386	.	.	ENSG00000141968	ENST00000304076;ENST00000539284	D;D	0.88201	-2.35;-2.35	5.25	5.25	0.73442	Pleckstrin homology-type (1);Pleckstrin homology domain (3);	0.000000	0.85682	D	0.000000	D	0.94298	0.8168	M	0.77313	2.365	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	0.997;0.999;0.996;1.0	D	0.94859	0.8020	10	0.87932	D	0	.	16.3889	0.83525	0.0:0.0:1.0:0.0	.	309;406;351;406	F5H5P4;B2R8B5;Q96D37;P15498	.;.;.;VAV_HUMAN	N	406;309	ENSP00000302269:D406N;ENSP00000443242:D309N	ENSP00000302269:D406N	D	+	1	0	VAV1	6779862	1.000000	0.71417	0.928000	0.36995	0.913000	0.54294	8.814000	0.91968	2.479000	0.83701	0.585000	0.79938	GAC	VAV1	-	pfam_Pleckstrin_homology,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	ENSG00000141968		0.597	VAV1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	VAV1	HGNC	protein_coding	OTTHUMT00000458475.1	102	0.97	1	G			6828862	6828862	+1	no_errors	ENST00000304076	ensembl	human	known	69_37n	missense	22	66.15	43	SNP	1.000	A
ZNF33B	7582	genome.wustl.edu	37	10	43088872	43088872	+	Missense_Mutation	SNP	T	T	C			TCGA-A2-A0D0-01A-11W-A019-09	TCGA-A2-A0D0-10A-01W-A021-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3f20d0fe-aaa1-40f1-b2c1-7f070f93aef5	bbf1c43d-d7b3-4574-a074-d22ad537829c	g.chr10:43088872T>C	ENST00000359467.3	-	5	1640	c.1526A>G	c.(1525-1527)aAg>aGg	p.K509R	ZNF33B_ENST00000486187.1_RNA	NM_006955.1	NP_008886.1	Q06732	ZN33B_HUMAN	zinc finger protein 33B	509					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(4)|kidney(1)|large_intestine(6)|lung(15)|skin(1)|stomach(1)	29						GAGTACTGACTTGTGGTAGAA	0.378																																					Melanoma(137;1247 1767 16772 25727 43810)	dbGAP											0													110.0	105.0	107.0					10																	43088872		2203	4300	6503	-	-	-	SO:0001583	missense	0			X68688, AJ491697	CCDS7198.1	10q11.2	2013-01-08	2005-03-18		ENSG00000196693	ENSG00000196693		"""Zinc fingers, C2H2-type"", ""-"""	13097	protein-coding gene	gene with protein product		194522	"""zinc finger protein 33b (KOX 31)"", ""zinc finger protein 11B"""	ZNF11B		2014798	Standard	NM_006955		Approved	KOX31, KOX2	uc001jaf.1	Q06732	OTTHUMG00000018014	ENST00000359467.3:c.1526A>G	10.37:g.43088872T>C	ENSP00000352444:p.Lys509Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	Q06731|Q32MA2|Q86XY8|Q8NDW3	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.K509R	ENST00000359467.3	37	c.1526	CCDS7198.1	10	.	.	.	.	.	.	.	.	.	.	T	5.942	0.357779	0.11239	.	.	ENSG00000196693	ENST00000359467;ENST00000395836	T	0.15834	2.39	2.58	2.58	0.30949	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.33217	N	0.005156	T	0.17109	0.0411	N	0.12831	0.26	0.09310	N	1	D	0.71674	0.998	D	0.74348	0.983	T	0.14952	-1.0454	10	0.11794	T	0.64	.	9.0257	0.36227	0.0:0.0:0.0:1.0	.	509	Q06732	ZN33B_HUMAN	R	509;475	ENSP00000352444:K509R	ENSP00000352444:K509R	K	-	2	0	ZNF33B	42408878	0.000000	0.05858	0.998000	0.56505	0.966000	0.64601	-1.409000	0.02483	1.449000	0.47699	0.341000	0.21757	AAG	ZNF33B	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000196693		0.378	ZNF33B-201	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF33B	HGNC	protein_coding		287	0.00	0	T	NM_006955		43088872	43088872	-1	no_errors	ENST00000359467	ensembl	human	known	69_37n	missense	333	25.67	115	SNP	0.003	C
ZNF526	116115	genome.wustl.edu	37	19	42730230	42730231	+	Frame_Shift_Ins	INS	-	-	C	rs200018551		TCGA-A2-A0D0-01A-11W-A019-09	TCGA-A2-A0D0-10A-01W-A021-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3f20d0fe-aaa1-40f1-b2c1-7f070f93aef5	bbf1c43d-d7b3-4574-a074-d22ad537829c	g.chr19:42730230_42730231insC	ENST00000301215.3	+	3	1900_1901	c.1675_1676insC	c.(1675-1677)gccfs	p.A559fs		NM_133444.1	NP_597701.1	Q8TF50	ZN526_HUMAN	zinc finger protein 526	559					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			autonomic_ganglia(1)|cervix(1)|endometrium(4)|large_intestine(3)|lung(9)|prostate(1)|skin(3)	22		Prostate(69;0.0704)				CTTTGCCCGCGCCCCCCGCCTC	0.644																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			AB075831	CCDS12598.1	19q13.31	2013-01-08				ENSG00000167625		"""Zinc fingers, C2H2-type"""	29415	protein-coding gene	gene with protein product		614387				11853319	Standard	NM_133444		Approved	KIAA1951, MGC4267	uc002osz.1	Q8TF50		ENST00000301215.3:c.1681dupC	19.37:g.42730236_42730236dupC	ENSP00000301215:p.Ala559fs	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KV29|Q69YI2|Q96E24	Frame_Shift_Ins	INS	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.R561fs	ENST00000301215.3	37	c.1675_1676	CCDS12598.1	19																																																																																			ZNF526	-	NULL	ENSG00000167625		0.644	ZNF526-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF526	HGNC	protein_coding	OTTHUMT00000463681.2	32	0.00	0	-	XM_057401		42730230	42730231	+1	no_errors	ENST00000301215	ensembl	human	known	69_37n	frame_shift_ins	20	13.04	3	INS	0.046:0.048	C
ZNF844	284391	genome.wustl.edu	37	19	12186728	12186728	+	Missense_Mutation	SNP	C	C	A			TCGA-A2-A0D0-01A-11W-A019-09	TCGA-A2-A0D0-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3f20d0fe-aaa1-40f1-b2c1-7f070f93aef5	bbf1c43d-d7b3-4574-a074-d22ad537829c	g.chr19:12186728C>A	ENST00000439326.3	+	4	968	c.793C>A	c.(793-795)Ccc>Acc	p.P265T	ZNF844_ENST00000441304.2_3'UTR	NM_001136501.1	NP_001129973.1	Q08AG5	ZN844_HUMAN	zinc finger protein 844	265					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(2)|kidney(2)|lung(1)|prostate(1)	10						ATTCGGTAGTCCCAATTCCCT	0.388																																						dbGAP											0													42.0	40.0	40.0					19																	12186728		692	1591	2283	-	-	-	SO:0001583	missense	0			AL832297	CCDS45985.1	19p13.2	2013-01-08			ENSG00000223547	ENSG00000223547		"""Zinc fingers, C2H2-type"", ""-"""	25932	protein-coding gene	gene with protein product							Standard	NM_001136501		Approved	FLJ14959	uc002mtb.2	Q08AG5	OTTHUMG00000156405	ENST00000439326.3:c.793C>A	19.37:g.12186728C>A	ENSP00000392024:p.Pro265Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5JPI8	Missense_Mutation	SNP	pfam_Krueppel-associated_box,pfam_Znf_C2H2,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.P265T	ENST00000439326.3	37	c.793	CCDS45985.1	19	.	.	.	.	.	.	.	.	.	.	C	5.785	0.329127	0.10956	.	.	ENSG00000223547	ENST00000439326;ENST00000541708;ENST00000535505	T	0.07114	3.22	2.5	-5.0	0.03001	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.03651	0.0104	N	0.20483	0.58	0.09310	N	1	B	0.20052	0.041	B	0.13407	0.009	T	0.42481	-0.9449	9	0.23302	T	0.38	.	1.6944	0.02859	0.2328:0.1449:0.1164:0.5059	.	265	Q08AG5	ZN844_HUMAN	T	265;265;240	ENSP00000392024:P265T	ENSP00000392024:P265T	P	+	1	0	ZNF844	12047728	0.000000	0.05858	0.000000	0.03702	0.223000	0.24884	-3.954000	0.00326	-1.599000	0.01605	0.205000	0.17691	CCC	ZNF844	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000223547		0.388	ZNF844-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF844	HGNC	protein_coding	OTTHUMT00000344086.2	107	0.00	0	C			12186728	12186728	+1	no_errors	ENST00000439326	ensembl	human	known	69_37n	missense	92	20.00	23	SNP	0.000	A
ZNF761	388561	genome.wustl.edu	37	19	53959767	53959767	+	RNA	SNP	A	A	T			TCGA-A2-A0D0-01A-11W-A019-09	TCGA-A2-A0D0-10A-01W-A021-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3f20d0fe-aaa1-40f1-b2c1-7f070f93aef5	bbf1c43d-d7b3-4574-a074-d22ad537829c	g.chr19:53959767A>T	ENST00000454407.1	+	0	2459							Q86XN6	ZN761_HUMAN	zinc finger protein 761						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(1)|kidney(2)|large_intestine(5)|lung(13)|ovary(1)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	30				GBM - Glioblastoma multiforme(134;0.00786)		GAGTGTGGCAAGACCTTTAGT	0.383																																						dbGAP											0													87.0	92.0	91.0					19																	53959767		2203	4300	6503	-	-	-			0			AB107355		19q13.42	2007-10-05	2006-08-11	2006-08-11	ENSG00000160336	ENSG00000160336		"""Zinc fingers, C2H2-type"""	23179	protein-coding gene	gene with protein product							Standard	NM_001008401		Approved	KIAA2033, FLJ16231, FLJ35333	uc010eqp.3	Q86XN6	OTTHUMG00000156999		19.37:g.53959767A>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q6ZNB9	RNA	SNP	-	NULL	ENST00000454407.1	37	NULL		19																																																																																			ZNF761	-	-	ENSG00000160336		0.383	ZNF761-203	KNOWN	basic	processed_transcript	ZNF761	HGNC	processed_transcript		337	0.00	0	A	NM_001008401		53959767	53959767	+1	no_errors	ENST00000334095	ensembl	human	known	69_37n	rna	73	29.81	31	SNP	0.859	T
