#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
ACTN1	87	genome.wustl.edu	37	14	69343865	69343865	+	Silent	SNP	G	G	C	rs141539823	byFrequency	TCGA-A2-A0D2-01A-21W-A050-09	TCGA-A2-A0D2-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	05656575-69e7-4745-a89d-ca0568eb5559	c830c663-95f6-40e0-9fd6-16586fa7d344	g.chr14:69343865G>C	ENST00000193403.6	-	20	2837	c.2454C>G	c.(2452-2454)cgC>cgG	p.R818R	ACTN1_ENST00000538545.2_Silent_p.R813R|ACTN1_ENST00000376839.3_Silent_p.R748R|ACTN1_ENST00000394419.4_Silent_p.R840R|ACTN1_ENST00000438964.2_Silent_p.R813R	NM_001102.3	NP_001093.1	P12814	ACTN1_HUMAN	actinin, alpha 1	818	EF-hand 2. {ECO:0000255|PROSITE- ProRule:PRU00448}.				actin crosslink formation (GO:0051764)|actin filament bundle assembly (GO:0051017)|blood coagulation (GO:0007596)|cell junction assembly (GO:0034329)|extracellular matrix organization (GO:0030198)|focal adhesion assembly (GO:0048041)|negative regulation of cellular component movement (GO:0051271)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of apoptotic process (GO:0042981)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dendritic spine (GO:0043197)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|fascia adherens (GO:0005916)|focal adhesion (GO:0005925)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|platelet alpha granule lumen (GO:0031093)|pseudopodium (GO:0031143)|Z disc (GO:0030018)	calcium ion binding (GO:0005509)|double-stranded RNA binding (GO:0003725)|integrin binding (GO:0005178)|ion channel binding (GO:0044325)|vinculin binding (GO:0017166)	p.R818R(1)		breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(5)|lung(9)|prostate(2)|urinary_tract(1)	27				BRCA - Breast invasive adenocarcinoma(234;0.00605)|all cancers(60;0.00846)|OV - Ovarian serous cystadenocarcinoma(108;0.0654)		CGGCTGTCTCGCGGGACATGA	0.577																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											127.0	84.0	99.0					14																	69343865		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			M95178	CCDS9792.1, CCDS45129.1, CCDS45130.1	14q24.1	2014-08-08			ENSG00000072110	ENSG00000072110		"""EF-hand domain containing"""	163	protein-coding gene	gene with protein product		102575				2349951	Standard	NM_001102		Approved		uc001xkm.3	P12814	OTTHUMG00000171386	ENST00000193403.6:c.2454C>G	14.37:g.69343865G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	B3V8S3|B4DHH3|B7TY16|Q1HE25|Q9BTN1	Missense_Mutation	SNP	pfam_EF-hand_Ca_insen,pfam_Spectrin_repeat,pfscan_EF_HAND_2	p.A177G	ENST00000193403.6	37	c.530	CCDS9792.1	14	.	.	.	.	.	.	.	.	.	.	G	6.193	0.403749	0.11754	.	.	ENSG00000072110	ENST00000555075	.	.	.	4.99	-9.98	0.00438	.	.	.	.	.	T	0.33644	0.0870	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.46119	-0.9214	4	.	.	.	.	2.517	0.04670	0.2457:0.3961:0.1762:0.182	.	.	.	.	G	177	.	.	A	-	2	0	ACTN1	68413618	0.000000	0.05858	0.373000	0.26003	0.872000	0.50106	-3.290000	0.00524	-3.350000	0.00181	-2.404000	0.00223	GCG	ACTN1	-	pfscan_EF_HAND_2	ENSG00000072110		0.577	ACTN1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	ACTN1	HGNC	protein_coding	OTTHUMT00000413233.3	76	0.00	0	G	NM_001102		69343865	69343865	-1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000555075	ensembl	human	putative	69_37n	missense	25	35.00	14	SNP	0.077	C
AHCTF1	25909	genome.wustl.edu	37	1	247014469	247014469	+	Silent	SNP	C	C	G			TCGA-A2-A0D2-01A-21W-A050-09	TCGA-A2-A0D2-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	05656575-69e7-4745-a89d-ca0568eb5559	c830c663-95f6-40e0-9fd6-16586fa7d344	g.chr1:247014469C>G	ENST00000391829.2	-	33	4962	c.4839G>C	c.(4837-4839)gtG>gtC	p.V1613V	AHCTF1_ENST00000366508.1_Silent_p.V1648V|AHCTF1_ENST00000470300.1_5'UTR|AHCTF1_ENST00000326225.3_Silent_p.V1622V			Q8WYP5	ELYS_HUMAN	AT hook containing transcription factor 1	1613	Disordered. {ECO:0000250}.|Mediates transcriptional activity. {ECO:0000250}.|Necessary for nuclear localization. {ECO:0000250}.				cytokinesis (GO:0000910)|mitotic cell cycle (GO:0000278)|mRNA transport (GO:0051028)|nuclear pore complex assembly (GO:0051292)|protein transport (GO:0015031)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|kinetochore (GO:0000776)|nuclear matrix (GO:0016363)|nuclear membrane (GO:0031965)|nuclear pore (GO:0005643)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.V1613V(1)		NS(1)|breast(6)|cervix(3)|endometrium(8)|kidney(6)|large_intestine(12)|liver(2)|lung(21)|ovary(5)|prostate(1)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(2)	74	all_cancers(71;3.05e-05)|all_epithelial(71;6.72e-06)|Ovarian(71;0.0173)|Breast(184;0.0318)|all_lung(81;0.0458)|Lung NSC(105;0.0518)	all_cancers(173;0.0266)	OV - Ovarian serous cystadenocarcinoma(106;0.00271)			CTTTAGGTAACACATCAGATG	0.398																																					Colon(145;197 1800 4745 15099 26333)	dbGAP											1	Substitution - coding silent(1)	breast(1)											70.0	66.0	67.0					1																	247014469		2203	4297	6500	-	-	-	SO:0001819	synonymous_variant	0				CCDS1629.1, CCDS1629.2	1q44	2008-09-09			ENSG00000153207	ENSG00000153207			24618	protein-coding gene	gene with protein product	"""ELYS transcription factor like protein TMBS62"""	610853				11952839	Standard	NM_015446		Approved	ELYS	uc001ibv.2	Q8WYP5	OTTHUMG00000040706	ENST00000391829.2:c.4839G>C	1.37:g.247014469C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	A6NGM0|A8MSG9|A8MZ86|Q7Z4E3|Q8IZA4|Q96EH9|Q9Y4Q6	Silent	SNP	superfamily_Quinonprotein_ADH-like	p.V1622	ENST00000391829.2	37	c.4866		1																																																																																			AHCTF1	-	NULL	ENSG00000153207		0.398	AHCTF1-201	KNOWN	basic|appris_candidate	protein_coding	AHCTF1	HGNC	protein_coding		107	0.00	0	C	NM_015446		247014469	247014469	-1	no_errors	ENST00000326225	ensembl	human	known	69_37n	silent	188	22.95	56	SNP	0.143	G
ANGPT4	51378	genome.wustl.edu	37	20	865877	865877	+	Missense_Mutation	SNP	G	G	C			TCGA-A2-A0D2-01A-21W-A050-09	TCGA-A2-A0D2-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	05656575-69e7-4745-a89d-ca0568eb5559	c830c663-95f6-40e0-9fd6-16586fa7d344	g.chr20:865877G>C	ENST00000381922.3	-	4	781	c.679C>G	c.(679-681)Ctg>Gtg	p.L227V	ANGPT4_ENST00000546022.1_Missense_Mutation_p.L227V	NM_015985.2	NP_057069.1	Q9Y264	ANGP4_HUMAN	angiopoietin 4	227					activation of transmembrane receptor protein tyrosine kinase activity (GO:0007171)|angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cellular response to hypoxia (GO:0071456)|leukocyte migration (GO:0050900)|negative regulation of angiogenesis (GO:0016525)|negative regulation of apoptotic process (GO:0043066)|negative regulation of blood vessel endothelial cell migration (GO:0043537)|positive regulation of angiogenesis (GO:0045766)|positive regulation of blood vessel endothelial cell migration (GO:0043536)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	receptor tyrosine kinase binding (GO:0030971)|transmembrane receptor protein tyrosine kinase activator activity (GO:0030297)	p.L227V(1)		breast(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(5)|lung(12)|ovary(2)|prostate(1)	27						TGGCGGCTCAGCGTGTTCAGC	0.677																																					Pancreas(181;481 2077 3259 31286 49856)	dbGAP											1	Substitution - Missense(1)	breast(1)											22.0	18.0	20.0					20																	865877		2200	4295	6495	-	-	-	SO:0001583	missense	0			AF074332	CCDS13009.1	20p13	2013-02-06			ENSG00000101280	ENSG00000101280		"""Fibrinogen C domain containing"""	487	protein-coding gene	gene with protein product		603705				10051567, 10218486	Standard	NM_015985		Approved		uc002wei.3	Q9Y264	OTTHUMG00000031652	ENST00000381922.3:c.679C>G	20.37:g.865877G>C	ENSP00000371347:p.Leu227Val	Somatic		WXS	Illumina GAIIx	Phase_IV	B4E3J9|Q5TFF4|Q9H4Z4	Missense_Mutation	SNP	pfam_Fibrinogen_a/b/g_C,superfamily_Fibrinogen_a/b/g_C,smart_Fibrinogen_a/b/g_C	p.L227V	ENST00000381922.3	37	c.679	CCDS13009.1	20	.	.	.	.	.	.	.	.	.	.	g	0.018	-1.477262	0.01035	.	.	ENSG00000101280	ENST00000381922;ENST00000546022	T;T	0.13901	2.55;2.55	4.69	3.69	0.42338	.	0.800615	0.11040	N	0.606173	T	0.06826	0.0174	N	0.05199	-0.095	0.25607	N	0.98653	P;B	0.37636	0.603;0.429	B;B	0.39185	0.293;0.108	T	0.03651	-1.1016	10	0.02654	T	1	.	12.6093	0.56542	0.0:0.1821:0.8179:0.0	.	227;227	B4E3J9;Q9Y264	.;ANGP4_HUMAN	V	227	ENSP00000371347:L227V;ENSP00000439605:L227V	ENSP00000371347:L227V	L	-	1	2	ANGPT4	813877	0.999000	0.42202	0.956000	0.39512	0.093000	0.18481	3.053000	0.49901	2.452000	0.82932	0.450000	0.29827	CTG	ANGPT4	-	NULL	ENSG00000101280		0.677	ANGPT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ANGPT4	HGNC	protein_coding	OTTHUMT00000077493.1	58	0.00	0	G	NM_015985		865877	865877	-1	no_errors	ENST00000381922	ensembl	human	known	69_37n	missense	8	42.86	6	SNP	0.995	C
ANKFY1	51479	genome.wustl.edu	37	17	4120392	4120392	+	Missense_Mutation	SNP	A	A	G			TCGA-A2-A0D2-01A-21W-A050-09	TCGA-A2-A0D2-10A-01W-A055-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	05656575-69e7-4745-a89d-ca0568eb5559	c830c663-95f6-40e0-9fd6-16586fa7d344	g.chr17:4120392A>G	ENST00000341657.4	-	4	379	c.344T>C	c.(343-345)aTg>aCg	p.M115T	ANKFY1_ENST00000570535.1_Missense_Mutation_p.M157T|ANKFY1_ENST00000574367.1_Missense_Mutation_p.M115T|ANKFY1_ENST00000433651.1_Missense_Mutation_p.M115T	NM_016376.3	NP_057460.3	Q9P2R3	ANFY1_HUMAN	ankyrin repeat and FYVE domain containing 1	115	BTB. {ECO:0000255|PROSITE- ProRule:PRU00037}.			M -> V (in Ref. 1; BAA90300). {ECO:0000305}.	endosomal vesicle fusion (GO:0034058)|endosome localization (GO:0032439)|Golgi to lysosome transport (GO:0090160)|positive regulation of pinocytosis (GO:0048549)|retrograde transport, endosome to Golgi (GO:0042147)	early endosome (GO:0005769)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|lysosomal membrane (GO:0005765)|macropinosome (GO:0044354)|membrane (GO:0016020)	metal ion binding (GO:0046872)|phosphatidylinositol phosphate binding (GO:1901981)|Rab GTPase binding (GO:0017137)	p.M115T(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(11)|liver(1)|lung(5)|ovary(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	32						AAGCATTGTCATCGTCACCTC	0.413																																						dbGAP											1	Substitution - Missense(1)	breast(1)											85.0	77.0	79.0					17																	4120392		1979	4167	6146	-	-	-	SO:0001583	missense	0			AB033081	CCDS42236.1, CCDS58502.1	17p13.3	2013-01-10			ENSG00000185722	ENSG00000185722		"""Zinc fingers, FYVE domain containing"", ""BTB/POZ domain containing"", ""Ankyrin repeat domain containing"""	20763	protein-coding gene	gene with protein product		607927				10940552, 17273843	Standard	NM_016376		Approved	ANKHZN, KIAA1255, ZFYVE14, BTBD23	uc002fxn.3	Q9P2R3	OTTHUMG00000177727	ENST00000341657.4:c.344T>C	17.37:g.4120392A>G	ENSP00000343362:p.Met115Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	A8KA65|Q5RKV4|Q9ULG5	Missense_Mutation	SNP	pfam_Ankyrin_rpt,pfam_Znf_FYVE,pfam_BTB_POZ,superfamily_Ankyrin_rpt-contain_dom,superfamily_BTB/POZ_fold,superfamily_Znf_FYVE_PHD,smart_BTB/POZ-like,smart_Ankyrin_rpt,smart_Znf_FYVE,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_BTB/POZ-like,pfscan_Znf_FYVE-rel,prints_Ankyrin_rpt	p.M157T	ENST00000341657.4	37	c.470		17	.	.	.	.	.	.	.	.	.	.	A	12.27	1.888362	0.33348	.	.	ENSG00000185722	ENST00000341657;ENST00000535427;ENST00000433651	T;T	0.66099	-0.19;-0.19	5.66	3.44	0.39384	BTB/POZ-like (2);BTB/POZ (1);BTB/POZ fold (2);	0.079123	0.85682	D	0.000000	T	0.44953	0.1318	L	0.31752	0.955	0.58432	D	0.999997	B;B;B;B;B;B	0.30973	0.302;0.008;0.225;0.007;0.006;0.039	B;B;B;B;B;B	0.30855	0.121;0.008;0.047;0.023;0.014;0.023	T	0.25745	-1.0123	10	0.26408	T	0.33	-12.0999	7.4644	0.27314	0.7712:0.1537:0.0751:0.0	.	115;56;115;115;115;157	B4DZ21;F5H754;Q9P2R3-3;Q9P2R3;Q9P2R3-2;Q9P2R3-4	.;.;.;ANFY1_HUMAN;.;.	T	115;56;115	ENSP00000343362:M115T;ENSP00000416005:M115T	ENSP00000343362:M115T	M	-	2	0	ANKFY1	4067141	1.000000	0.71417	1.000000	0.80357	0.928000	0.56348	6.116000	0.71571	0.973000	0.38340	0.482000	0.46254	ATG	ANKFY1	-	pfam_BTB_POZ,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,pfscan_BTB/POZ-like	ENSG00000185722		0.413	ANKFY1-008	KNOWN	basic|appris_candidate	protein_coding	ANKFY1	HGNC	protein_coding	OTTHUMT00000438702.1	86	0.00	0	A	NM_016376		4120392	4120392	-1	no_errors	ENST00000570535	ensembl	human	known	69_37n	missense	49	30.99	22	SNP	1.000	G
ANO8	57719	genome.wustl.edu	37	19	17435805	17435806	+	In_Frame_Ins	INS	-	-	GCT	rs540938848		TCGA-A2-A0D2-01A-21W-A050-09	TCGA-A2-A0D2-10A-01W-A055-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	05656575-69e7-4745-a89d-ca0568eb5559	c830c663-95f6-40e0-9fd6-16586fa7d344	g.chr19:17435805_17435806insGCT	ENST00000159087.4	-	17	3209_3210	c.3051_3052insAGC	c.(3049-3054)agcgac>agcAGCgac	p.1017_1018insS		NM_020959.2	NP_066010.1	Q9HCE9	ANO8_HUMAN	anoctamin 8	1017					chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|intracellular (GO:0005622)|plasma membrane (GO:0005886)	intracellular calcium activated chloride channel activity (GO:0005229)			autonomic_ganglia(2)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(2)|lung(7)|ovary(4)|pancreas(1)|prostate(2)|urinary_tract(3)	27						AGGCGGGTGTCGCTGCCTGTGG	0.668																																						dbGAP											0																																										-	-	-	SO:0001652	inframe_insertion	0			AB046843	CCDS32949.1	19p13.12	2014-04-09	2008-08-28	2008-08-28		ENSG00000074855		"""Ion channels / Chloride channels : Calcium activated : Anoctamins"""	29329	protein-coding gene	gene with protein product		610216	"""KIAA1623"", ""transmembrane protein 16H"""	KIAA1623, TMEM16H		10997877, 24692353	Standard	NM_020959		Approved		uc002ngf.2	Q9HCE9		ENST00000159087.4:c.3049_3051dupAGC	19.37:g.17435806_17435808dupGCT	ENSP00000159087:p.Ser1017_Ser1017dup	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NIJ0	In_Frame_Ins	INS	pfam_Anoctamin	p.1017in_frame_insS	ENST00000159087.4	37	c.3052_3051	CCDS32949.1	19																																																																																			ANO8	-	NULL	ENSG00000074855		0.668	ANO8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ANO8	HGNC	protein_coding	OTTHUMT00000462943.1	31	0.00	0	-	XM_050644		17435805	17435806	-1	no_errors	ENST00000159087	ensembl	human	known	69_37n	in_frame_ins	7	30.00	3	INS	0.998:0.200	GCT
ARHGAP35	2909	genome.wustl.edu	37	19	47422435	47422435	+	Frame_Shift_Del	DEL	G	G	-			TCGA-A2-A0D2-01A-21W-A050-09	TCGA-A2-A0D2-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	05656575-69e7-4745-a89d-ca0568eb5559	c830c663-95f6-40e0-9fd6-16586fa7d344	g.chr19:47422435delG	ENST00000404338.3	+	1	503	c.503delG	c.(502-504)aggfs	p.R168fs		NM_004491.4	NP_004482.4	Q9NRY4	RHG35_HUMAN	Rho GTPase activating protein 35	168					axon guidance (GO:0007411)|camera-type eye development (GO:0043010)|forebrain development (GO:0030900)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of vascular permeability (GO:0043116)|neural tube closure (GO:0001843)|positive regulation of Rho GTPase activity (GO:0032321)|regulation of cell shape (GO:0008360)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|transcription, DNA-templated (GO:0006351)	actin cytoskeleton (GO:0015629)|cytosol (GO:0005829)|nucleus (GO:0005634)	DNA binding (GO:0003677)|GTP binding (GO:0005525)|Rho GTPase activator activity (GO:0005100)|transcription corepressor activity (GO:0003714)										GATGTTAGCAGGGGCATGAAT	0.463																																						dbGAP											0													114.0	104.0	107.0					19																	47422435		1923	4141	6064	-	-	-	SO:0001589	frameshift_variant	0			M73077	CCDS46127.1	19q13.32	2011-06-29	2011-06-07	2011-06-07	ENSG00000160007	ENSG00000160007		"""Rho GTPase activating proteins"""	4591	protein-coding gene	gene with protein product		605277	"""glucocorticoid receptor DNA binding factor 1"""	GRLF1		1894621, 20675588	Standard	NM_004491		Approved	GRF-1, p190ARhoGAP, P190A, KIAA1722, p190RhoGAP	uc010ekv.3	Q9NRY4		ENST00000404338.3:c.503delG	19.37:g.47422435delG	ENSP00000385720:p.Arg168fs	Somatic		WXS	Illumina GAIIx	Phase_IV	A7E2A4|Q14452|Q9C0E1	Frame_Shift_Del	DEL	pfam_RhoGAP_dom,pfam_Small_GTPase,pfam_FF_domain,superfamily_Rho_GTPase_activation_prot,superfamily_FF_domain,smart_FF_domain,smart_RhoGAP_dom,pfscan_RhoGAP_dom	p.G169fs	ENST00000404338.3	37	c.503	CCDS46127.1	19																																																																																			ARHGAP35	-	NULL	ENSG00000160007		0.463	ARHGAP35-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARHGAP35	HGNC	protein_coding	OTTHUMT00000466652.1	128	0.00	0	G	NM_004491		47422435	47422435	+1	no_errors	ENST00000404338	ensembl	human	known	69_37n	frame_shift_del	91	27.20	34	DEL	1.000	-
ARHGEF5	7984	genome.wustl.edu	37	7	144061204	144061204	+	Missense_Mutation	SNP	A	A	G	rs200716588	byFrequency	TCGA-A2-A0D2-01A-21W-A050-09	TCGA-A2-A0D2-10A-01W-A055-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	05656575-69e7-4745-a89d-ca0568eb5559	c830c663-95f6-40e0-9fd6-16586fa7d344	g.chr7:144061204A>G	ENST00000056217.5	+	2	1616	c.1442A>G	c.(1441-1443)cAa>cGa	p.Q481R	ARHGEF5_ENST00000471847.2_5'Flank	NM_005435.3	NP_005426.2	Q12774	ARHG5_HUMAN	Rho guanine nucleotide exchange factor (GEF) 5	481					actin cytoskeleton organization (GO:0030036)|intracellular signal transduction (GO:0035556)|myeloid dendritic cell chemotaxis (GO:0002408)|positive regulation of podosome assembly (GO:0071803)|regulation of Rho GTPase activity (GO:0032319)		GTP binding (GO:0005525)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(1)|endometrium(6)|kidney(8)|large_intestine(9)|liver(1)|lung(8)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	40	Melanoma(164;0.14)					GAAATAGATCAAAACAGCCAG	0.537																																						dbGAP											0													17.0	15.0	16.0					7																	144061204		1415	2673	4088	-	-	-	SO:0001583	missense	0			U02082	CCDS34771.1	7q35	2012-09-20			ENSG00000050327	ENSG00000050327		"""Rho guanine nucleotide exchange factors"""	13209	protein-coding gene	gene with protein product	"""transforming immortalized mammary oncogene"", ""guanine nucleotide regulatory protein TIM"""	600888				8134109, 7656213	Standard	NM_005435		Approved	TIM, TIM1, GEF5, P60	uc003wel.3	Q12774	OTTHUMG00000158004	ENST00000056217.5:c.1442A>G	7.37:g.144061204A>G	ENSP00000056217:p.Gln481Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NNJ2|Q6ZML7	Missense_Mutation	SNP	pfam_DH-domain,pfam_SH3_domain,pfam_SH3_2,superfamily_DH-domain,superfamily_SH3_domain,smart_DH-domain,smart_Pleckstrin_homology,smart_SH3_domain,pfscan_Pleckstrin_homology,pfscan_SH3_domain,pfscan_DH-domain	p.Q481R	ENST00000056217.5	37	c.1442	CCDS34771.1	7	.	.	.	.	.	.	.	.	.	.	A	11.68	1.711258	0.30322	.	.	ENSG00000050327	ENST00000056217	T	0.75154	-0.91	3.98	1.43	0.22495	.	0.000000	0.34531	U	0.003886	T	0.59662	0.2210	L	0.43152	1.355	0.09310	N	0.999996	P	0.44877	0.845	B	0.38655	0.278	T	0.51973	-0.8637	9	.	.	.	0.0056	6.2996	0.21105	0.5943:0.0:0.0:0.4057	.	481	Q12774	ARHG5_HUMAN	R	481	ENSP00000056217:Q481R	.	Q	+	2	0	ARHGEF5	143692137	0.003000	0.15002	0.002000	0.10522	0.310000	0.27922	0.000000	0.12993	0.102000	0.17638	0.454000	0.30748	CAA	ARHGEF5	-	NULL	ENSG00000050327		0.537	ARHGEF5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARHGEF5	HGNC	protein_coding	OTTHUMT00000349981.1	22	0.00	0	A	NM_005435		144061204	144061204	+1	no_errors	ENST00000056217	ensembl	human	known	69_37n	missense	20	25.93	7	SNP	0.025	G
AWAT1	158833	genome.wustl.edu	37	X	69458163	69458163	+	Missense_Mutation	SNP	A	A	T			TCGA-A2-A0D2-01A-21W-A050-09	TCGA-A2-A0D2-10A-01W-A055-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	05656575-69e7-4745-a89d-ca0568eb5559	c830c663-95f6-40e0-9fd6-16586fa7d344	g.chrX:69458163A>T	ENST00000374521.3	+	5	603	c.562A>T	c.(562-564)Agt>Tgt	p.S188C		NM_001013579.2	NP_001013597.1	Q58HT5	AWAT1_HUMAN	acyl-CoA wax alcohol acyltransferase 1	188					lipid metabolic process (GO:0006629)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	long-chain-alcohol O-fatty-acyltransferase activity (GO:0047196)	p.S268C(1)|p.S188C(1)		breast(2)|central_nervous_system(1)|large_intestine(4)|lung(3)|ovary(4)|skin(1)	15						GGCCCTGCAAAGTGTGCCCAA	0.607																																						dbGAP											2	Substitution - Missense(2)	breast(2)											119.0	83.0	96.0					X																	69458163		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC039181	CCDS35321.1	Xq13.1	2010-01-25	2009-02-23	2009-02-23	ENSG00000204195	ENSG00000204195			23252	protein-coding gene	gene with protein product		300924	"""diacylglycerol O-acyltransferase 2-like 3"""	DGAT2L3		14970677, 15671038	Standard	NM_001013579		Approved		uc004dxy.3	Q58HT5	OTTHUMG00000021773	ENST00000374521.3:c.562A>T	X.37:g.69458163A>T	ENSP00000363645:p.Ser188Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5JT21|Q6IEE4	Missense_Mutation	SNP	pfam_DAGAT	p.S188C	ENST00000374521.3	37	c.562	CCDS35321.1	X	.	.	.	.	.	.	.	.	.	.	A	12.00	1.805187	0.31961	.	.	ENSG00000204195	ENST00000374521	T	0.15139	2.45	4.93	4.93	0.64822	.	0.069273	0.64402	D	0.000013	T	0.15349	0.0370	L	0.50993	1.605	0.41878	D	0.990301	B	0.25809	0.135	B	0.27887	0.084	T	0.07693	-1.0759	10	0.30854	T	0.27	-10.4233	7.0954	0.25307	0.6794:0.0:0.0:0.3206	.	188	Q58HT5	AWAT1_HUMAN	C	188	ENSP00000363645:S188C	ENSP00000363645:S188C	S	+	1	0	AWAT1	69374888	1.000000	0.71417	0.995000	0.50966	0.918000	0.54935	4.059000	0.57470	1.814000	0.52955	0.486000	0.48141	AGT	AWAT1	-	pfam_DAGAT	ENSG00000204195		0.607	AWAT1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	AWAT1	HGNC	protein_coding	OTTHUMT00000057066.3	411	0.00	0	A	NM_001013579		69458163	69458163	+1	no_errors	ENST00000374521	ensembl	human	known	69_37n	missense	183	23.24	56	SNP	0.996	T
BCAR3	8412	genome.wustl.edu	37	1	94054925	94054925	+	Missense_Mutation	SNP	G	G	T			TCGA-A2-A0D2-01A-21W-A050-09	TCGA-A2-A0D2-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	05656575-69e7-4745-a89d-ca0568eb5559	c830c663-95f6-40e0-9fd6-16586fa7d344	g.chr1:94054925G>T	ENST00000370244.1	-	7	826	c.538C>A	c.(538-540)Ctg>Atg	p.L180M	BCAR3_ENST00000260502.6_Missense_Mutation_p.L180M|RP5-1033H22.2_ENST00000417401.1_RNA|BCAR3_ENST00000370247.3_Missense_Mutation_p.L89M|RP5-1033H22.2_ENST00000427243.1_RNA|BCAR3_ENST00000370243.1_Missense_Mutation_p.L180M|RP5-1033H22.2_ENST00000431770.1_RNA	NM_001261408.1	NP_001248337.1	O75815	BCAR3_HUMAN	breast cancer anti-estrogen resistance 3	180	SH2. {ECO:0000255|PROSITE- ProRule:PRU00191}.				lens morphogenesis in camera-type eye (GO:0002089)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|response to drug (GO:0042493)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)		guanyl-nucleotide exchange factor activity (GO:0005085)	p.L180M(1)		breast(1)|central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(3)|lung(11)|ovary(1)|prostate(1)|skin(1)	25		all_lung(203;0.00145)|Lung NSC(277;0.00662)		all cancers(265;0.0126)|GBM - Glioblastoma multiforme(16;0.0467)|Epithelial(280;0.166)		GGGCTGGACAGAGAGTCACGA	0.507																																						dbGAP											1	Substitution - Missense(1)	breast(1)											55.0	55.0	55.0					1																	94054925		2203	4300	6503	-	-	-	SO:0001583	missense	0			U92715	CCDS745.1, CCDS58010.1	1p22.1	2013-02-14			ENSG00000137936	ENSG00000137936		"""SH2 domain containing"""	973	protein-coding gene	gene with protein product		604704				9582273	Standard	NM_001261408		Approved	NSP2, SH2D3B	uc001dpz.4	O75815	OTTHUMG00000010301	ENST00000370244.1:c.538C>A	1.37:g.94054925G>T	ENSP00000359264:p.Leu180Met	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DT43|Q5TEW3|Q6UW40|Q9BR50	Missense_Mutation	SNP	pfam_SH2,pfam_RasGRF_CDC25,superfamily_Ras_GEF_dom,smart_SH2,smart_RasGRF_CDC25,pfscan_SH2,pfscan_RasGRF_CDC25	p.L180M	ENST00000370244.1	37	c.538	CCDS745.1	1	.	.	.	.	.	.	.	.	.	.	G	24.9	4.577799	0.86645	.	.	ENSG00000137936	ENST00000370247;ENST00000260502;ENST00000370244;ENST00000370243	D;D;D;D	0.88741	-2.42;-2.42;-2.42;-2.42	4.96	4.96	0.65561	SH2 motif (4);	0.000000	0.85682	D	0.000000	D	0.93061	0.7791	M	0.69248	2.105	0.80722	D	1	D;D	0.89917	0.999;1.0	D;D	0.91635	0.992;0.999	D	0.93208	0.6597	10	0.59425	D	0.04	-0.1164	18.5655	0.91115	0.0:0.0:1.0:0.0	.	180;89	O75815;Q5TEW3	BCAR3_HUMAN;.	M	89;180;180;180	ENSP00000359267:L89M;ENSP00000260502:L180M;ENSP00000359264:L180M;ENSP00000359263:L180M	ENSP00000260502:L180M	L	-	1	2	BCAR3	93827513	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	6.347000	0.73004	2.468000	0.83385	0.561000	0.74099	CTG	BCAR3	-	pfam_SH2,smart_SH2,pfscan_SH2	ENSG00000137936		0.507	BCAR3-003	NOVEL	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	BCAR3	HGNC	protein_coding	OTTHUMT00000028420.1	67	0.00	0	G			94054925	94054925	-1	no_errors	ENST00000260502	ensembl	human	known	69_37n	missense	73	23.16	22	SNP	1.000	T
SLX4IP	128710	genome.wustl.edu	37	20	10603922	10603922	+	Silent	SNP	C	C	T			TCGA-A2-A0D2-01A-21W-A050-09	TCGA-A2-A0D2-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	05656575-69e7-4745-a89d-ca0568eb5559	c830c663-95f6-40e0-9fd6-16586fa7d344	g.chr20:10603922C>T	ENST00000334534.5	+	8	1302	c.1122C>T	c.(1120-1122)aaC>aaT	p.N374N		NM_001009608.1	NP_001009608.1	Q5VYV7	SLX4I_HUMAN	SLX4 interacting protein	374								p.N374N(1)									TGAAAAATAACCCAGGGCAGG	0.418																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											49.0	54.0	52.0					20																	10603922		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AL035456	CCDS33439.1	20p12	2012-10-30	2012-10-30	2012-10-30	ENSG00000149346	ENSG00000149346			16225	protein-coding gene	gene with protein product		615958	"""chromosome 20 open reading frame 94"""	C20orf94		19596235	Standard	XM_005260664		Approved	dJ1099D15.3	uc010zre.2	Q5VYV7	OTTHUMG00000031873	ENST00000334534.5:c.1122C>T	20.37:g.10603922C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q05CG2|Q05CT9	Silent	SNP	NULL	p.N374	ENST00000334534.5	37	c.1122	CCDS33439.1	20																																																																																			C20orf94	-	NULL	ENSG00000149346		0.418	SLX4IP-002	KNOWN	basic|appris_principal|CCDS	protein_coding	C20orf94	HGNC	protein_coding	OTTHUMT00000078000.3	118	0.00	0	C	NM_001009608		10603922	10603922	+1	no_errors	ENST00000334534	ensembl	human	known	69_37n	silent	89	18.92	21	SNP	0.997	T
UMODL1	89766	genome.wustl.edu	37	21	43523920	43523920	+	Intron	SNP	C	C	G			TCGA-A2-A0D2-01A-21W-A050-09	TCGA-A2-A0D2-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	05656575-69e7-4745-a89d-ca0568eb5559	c830c663-95f6-40e0-9fd6-16586fa7d344	g.chr21:43523920C>G	ENST00000408910.2	+	9	1299				UMODL1_ENST00000400427.1_Intron|C21orf128_ENST00000329015.2_Missense_Mutation_p.G105R|UMODL1_ENST00000400424.2_Intron|UMODL1_ENST00000408989.2_Intron	NM_001004416.2	NP_001004416	Q5DID0	UROL1_HUMAN	uromodulin-like 1						adipose tissue development (GO:0060612)|cellular response to gonadotropin-releasing hormone (GO:0097211)|multicellular organismal reproductive process (GO:0048609)|regulation of apoptotic process (GO:0042981)|regulation of gene expression (GO:0010468)|regulation of ovarian follicle development (GO:2000354)|single fertilization (GO:0007338)	cytoplasm (GO:0005737)|external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)	calcium ion binding (GO:0005509)|peptidase inhibitor activity (GO:0030414)			breast(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(5)|lung(22)|ovary(2)|prostate(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	47						CACCTGGAACCCTGCTTAATG	0.537																																					Pancreas(122;680 807 13940 14411 22888 25505 31742 36028 36332 38435)	dbGAP											0													198.0	169.0	178.0					21																	43523920		692	1591	2283	-	-	-	SO:0001627	intron_variant	0				CCDS42935.1, CCDS42936.1, CCDS56214.1, CCDS56215.1	21q22.3	2008-07-04			ENSG00000177398	ENSG00000177398			12560	protein-coding gene	gene with protein product	"""olfactorin"""	613859				16026467	Standard	NM_173568		Approved		uc002zag.1	Q5DID0	OTTHUMG00000086788	ENST00000408910.2:c.1300-58C>G	21.37:g.43523920C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	C9JCE6|Q5DIC9|Q6LA40|Q6LA41|Q8N216	Missense_Mutation	SNP	NULL	p.G105R	ENST00000408910.2	37	c.313	CCDS42936.1	21	.	.	.	.	.	.	.	.	.	.	C	8.600	0.886601	0.17540	.	.	ENSG00000184385	ENST00000329015	T	0.58940	0.3	2.02	1.12	0.20585	.	.	.	.	.	T	0.52517	0.1739	.	.	.	0.09310	N	1	P	0.44734	0.842	P	0.46275	0.51	T	0.45906	-0.9229	8	0.87932	D	0	.	4.8232	0.13403	0.0:0.8141:0.0:0.1859	.	105	Q8N2C9	CU128_HUMAN	R	105	ENSP00000328495:G105R	ENSP00000328495:G105R	G	-	1	0	C21orf128	42396989	0.000000	0.05858	0.002000	0.10522	0.005000	0.04900	-0.245000	0.08890	0.408000	0.25621	0.591000	0.81541	GGT	C21orf128	-	NULL	ENSG00000184385		0.537	UMODL1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	C21orf128	HGNC	protein_coding	OTTHUMT00000195292.2	87	0.00	0	C			43523920	43523920	-1	no_errors	ENST00000329015	ensembl	human	putative	69_37n	missense	23	43.90	18	SNP	0.002	G
CAPN13	92291	genome.wustl.edu	37	2	30987066	30987066	+	Missense_Mutation	SNP	C	C	T			TCGA-A2-A0D2-01A-21W-A050-09	TCGA-A2-A0D2-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	05656575-69e7-4745-a89d-ca0568eb5559	c830c663-95f6-40e0-9fd6-16586fa7d344	g.chr2:30987066C>T	ENST00000295055.8	-	6	807	c.631G>A	c.(631-633)Gac>Aac	p.D211N	CAPN13_ENST00000465960.2_5'UTR|CAPN13_ENST00000534090.2_Missense_Mutation_p.D211N	NM_144575.2	NP_653176.2	Q6MZZ7	CAN13_HUMAN	calpain 13	211	Calpain catalytic. {ECO:0000255|PROSITE- ProRule:PRU00239}.				proteolysis (GO:0006508)	cytoplasm (GO:0005737)	calcium ion binding (GO:0005509)|calcium-dependent cysteine-type endopeptidase activity (GO:0004198)	p.D211N(1)		NS(2)|breast(1)|central_nervous_system(1)|endometrium(5)|large_intestine(5)|lung(11)|ovary(1)|prostate(1)|stomach(2)|urinary_tract(1)	30	all_hematologic(175;0.0487)|Acute lymphoblastic leukemia(172;0.155)					TTCACCAGGTCCACAGGGGAA	0.572																																						dbGAP											1	Substitution - Missense(1)	breast(1)											63.0	65.0	64.0					2																	30987066		2111	4220	6331	-	-	-	SO:0001583	missense	0				CCDS46252.1	2p22-p21	2008-02-05			ENSG00000162949	ENSG00000162949			16663	protein-coding gene	gene with protein product		610228				11675017	Standard	NM_144575		Approved	FLJ23523	uc021vfm.1	Q6MZZ7	OTTHUMG00000152053	ENST00000295055.8:c.631G>A	2.37:g.30987066C>T	ENSP00000295055:p.Asp211Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	Q17RF0|Q580X1|Q8TE80	Missense_Mutation	SNP	pfam_Peptidase_C2_calpain_cat,pfam_Calpain_domain_III,superfamily_Calpain_domain_III,smart_Peptidase_C2_calpain_cat,pfscan_Peptidase_C2_calpain_cat,prints_Calpain_cysteine_protease	p.D211N	ENST00000295055.8	37	c.631	CCDS46252.1	2	.	.	.	.	.	.	.	.	.	.	C	11.12	1.546168	0.27652	.	.	ENSG00000162949	ENST00000295055;ENST00000534090	D;D	0.86865	-2.18;-2.18	5.44	-0.0893	0.13669	Peptidase C2, calpain, catalytic domain (3);	0.724869	0.14224	N	0.333240	T	0.75228	0.3821	N	0.25094	0.71	0.09310	N	0.999992	B	0.28324	0.207	B	0.34038	0.174	T	0.62001	-0.6946	10	0.30854	T	0.27	.	3.9643	0.09424	0.1196:0.5387:0.118:0.2237	.	211	Q6MZZ7	CAN13_HUMAN	N	211	ENSP00000295055:D211N;ENSP00000431298:D211N	ENSP00000295055:D211N	D	-	1	0	CAPN13	30840570	0.000000	0.05858	0.009000	0.14445	0.005000	0.04900	-1.022000	0.03611	0.019000	0.15079	-0.502000	0.04539	GAC	CAPN13	-	pfam_Peptidase_C2_calpain_cat,smart_Peptidase_C2_calpain_cat,pfscan_Peptidase_C2_calpain_cat	ENSG00000162949		0.572	CAPN13-001	KNOWN	basic|CCDS	protein_coding	CAPN13	HGNC	protein_coding	OTTHUMT00000325101.2	170	0.00	0	C	NM_144575		30987066	30987066	-1	no_errors	ENST00000295055	ensembl	human	known	69_37n	missense	50	28.57	20	SNP	0.002	T
CARD11	84433	genome.wustl.edu	37	7	2959046	2959046	+	Missense_Mutation	SNP	C	C	G			TCGA-A2-A0D2-01A-21W-A050-09	TCGA-A2-A0D2-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	05656575-69e7-4745-a89d-ca0568eb5559	c830c663-95f6-40e0-9fd6-16586fa7d344	g.chr7:2959046C>G	ENST00000396946.4	-	18	2873	c.2470G>C	c.(2470-2472)Gac>Cac	p.D824H		NM_032415.4	NP_115791.3	Q9BXL7	CAR11_HUMAN	caspase recruitment domain family, member 11	824					Fc-epsilon receptor signaling pathway (GO:0038095)|innate immune response (GO:0045087)|nucleotide phosphorylation (GO:0046939)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of cytokine production (GO:0001819)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interleukin-2 biosynthetic process (GO:0045086)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of T cell proliferation (GO:0042102)|regulation of apoptotic process (GO:0042981)|regulation of B cell differentiation (GO:0045577)|regulation of T cell differentiation (GO:0045580)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)|thymic T cell selection (GO:0045061)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|immunological synapse (GO:0001772)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)	CARD domain binding (GO:0050700)|guanylate kinase activity (GO:0004385)	p.D817H(1)		NS(1)|breast(3)|central_nervous_system(1)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(62)|kidney(11)|large_intestine(13)|lung(31)|ovary(4)|prostate(5)|skin(7)|upper_aerodigestive_tract(2)	150		Ovarian(82;0.0115)		OV - Ovarian serous cystadenocarcinoma(56;8.44e-14)		AGGTCATGGTCTGTGAAAGGG	0.602			Mis		DLBCL																																	dbGAP		Dom	yes		7	7p22	84433	"""caspase recruitment domain family, member 11"""		L	1	Substitution - Missense(1)	breast(1)											82.0	70.0	74.0					7																	2959046		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF322641	CCDS5336.2	7p22	2014-09-17			ENSG00000198286	ENSG00000198286			16393	protein-coding gene	gene with protein product	"""card-maguk protein 1"", ""bcl10-interacting maguk protein 3"""	607210				11278692, 11356195	Standard	NM_032415		Approved	CARMA1, BIMP3	uc003smv.3	Q9BXL7	OTTHUMG00000023023	ENST00000396946.4:c.2470G>C	7.37:g.2959046C>G	ENSP00000380150:p.Asp824His	Somatic		WXS	Illumina GAIIx	Phase_IV	A4D1Z7|Q2NKN7|Q548H3	Missense_Mutation	SNP	pfam_CARD,superfamily_DEATH-like,superfamily_PDZ,pfscan_CARD	p.D824H	ENST00000396946.4	37	c.2470	CCDS5336.2	7	.	.	.	.	.	.	.	.	.	.	C	8.123	0.781293	0.16120	.	.	ENSG00000198286	ENST00000396946	T	0.30448	1.53	4.94	3.09	0.35607	.	0.249498	0.39909	N	0.001234	T	0.18130	0.0435	N	0.08118	0	0.45307	D	0.998304	B	0.26400	0.148	B	0.32624	0.149	T	0.09207	-1.0685	10	0.45353	T	0.12	-45.5741	11.77	0.51953	0.0:0.8479:0.0:0.1521	.	824	Q9BXL7	CAR11_HUMAN	H	824	ENSP00000380150:D824H	ENSP00000380150:D824H	D	-	1	0	CARD11	2925572	0.982000	0.34865	0.561000	0.28357	0.037000	0.13140	2.580000	0.46068	1.215000	0.43411	0.561000	0.74099	GAC	CARD11	-	NULL	ENSG00000198286		0.602	CARD11-011	KNOWN	basic|appris_principal|CCDS	protein_coding	CARD11	HGNC	protein_coding	OTTHUMT00000059344.4	70	0.00	0	C	NM_032415		2959046	2959046	-1	no_errors	ENST00000396946	ensembl	human	known	69_37n	missense	24	38.46	15	SNP	0.849	G
CARD17	440068	genome.wustl.edu	37	11	104971342	104971342	+	Missense_Mutation	SNP	G	G	T			TCGA-A2-A0D2-01A-21W-A050-09	TCGA-A2-A0D2-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	05656575-69e7-4745-a89d-ca0568eb5559	c830c663-95f6-40e0-9fd6-16586fa7d344	g.chr11:104971342G>T	ENST00000375707.1	-	2	188	c.172C>A	c.(172-174)Ctt>Att	p.L58I	CARD16_ENST00000525374.1_Intron|CASP1_ENST00000594519.1_Intron|CASP1_ENST00000415981.2_Intron|CASP1_ENST00000593315.1_Intron|CASP1_ENST00000598974.1_Intron	NM_001007232.1	NP_001007233.1	Q5XLA6	CAR17_HUMAN	caspase recruitment domain family, member 17	58	CARD. {ECO:0000255|PROSITE- ProRule:PRU00046}.				regulation of apoptotic process (GO:0042981)	cytoplasm (GO:0005737)	cysteine-type endopeptidase inhibitor activity (GO:0004869)	p.L58I(1)		breast(1)|large_intestine(1)|lung(2)|ovary(1)|stomach(1)	6						ACAGAGTCAAGCAAAGCTCGG	0.468																																						dbGAP											1	Substitution - Missense(1)	breast(1)											161.0	150.0	154.0					11																	104971342		2202	4299	6501	-	-	-	SO:0001583	missense	0				CCDS31662.1	11q22.3	2009-01-13				ENSG00000255221			33827	protein-coding gene	gene with protein product	"""Inhibitory CARD"""	609490				15383541	Standard	NM_001007232		Approved	INCA	uc001pir.1	Q5XLA6		ENST00000375707.1:c.172C>A	11.37:g.104971342G>T	ENSP00000364859:p.Leu58Ile	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_CARD,superfamily_DEATH-like,smart_CARD,pfscan_CARD	p.L58I	ENST00000375707.1	37	c.172	CCDS31662.1	11	.	.	.	.	.	.	.	.	.	.	.	0.007	-1.985861	0.00443	.	.	ENSG00000255221	ENST00000375707	T	0.27720	1.65	2.92	-5.83	0.02325	DEATH-like (2);Caspase Recruitment (3);	.	.	.	.	T	0.05227	0.0139	N	0.00683	-1.26	0.09310	N	1	B	0.06786	0.001	B	0.13407	0.009	T	0.19877	-1.0292	9	0.02654	T	1	.	1.4316	0.02335	0.1551:0.1171:0.3002:0.4276	.	58	Q5XLA6	CAR17_HUMAN	I	58	ENSP00000364859:L58I	ENSP00000364859:L58I	L	-	1	0	CARD17	104476552	0.000000	0.05858	0.000000	0.03702	0.014000	0.08584	-0.398000	0.07259	-1.553000	0.01702	-1.655000	0.00754	CTT	CARD17	-	pfam_CARD,superfamily_DEATH-like,smart_CARD,pfscan_CARD	ENSG00000255221		0.468	CARD17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CARD17	HGNC	protein_coding	OTTHUMT00000388181.1	522	0.00	0	G	NM_001007232		104971342	104971342	-1	no_errors	ENST00000375707	ensembl	human	known	69_37n	missense	254	31.72	118	SNP	0.000	T
CASR	846	genome.wustl.edu	37	3	122002718	122002718	+	Missense_Mutation	SNP	C	C	A			TCGA-A2-A0D2-01A-21W-A050-09	TCGA-A2-A0D2-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	05656575-69e7-4745-a89d-ca0568eb5559	c830c663-95f6-40e0-9fd6-16586fa7d344	g.chr3:122002718C>A	ENST00000490131.1	+	7	2289	c.1917C>A	c.(1915-1917)aaC>aaA	p.N639K	CASR_ENST00000296154.5_Missense_Mutation_p.N639K|CASR_ENST00000498619.1_Missense_Mutation_p.N649K|AC068754.1_ENST00000408547.1_RNA	NM_000388.3	NP_000379	P41180	CASR_HUMAN	calcium-sensing receptor	639					anatomical structure morphogenesis (GO:0009653)|calcium ion import (GO:0070509)|cellular calcium ion homeostasis (GO:0006874)|chemosensory behavior (GO:0007635)|detection of calcium ion (GO:0005513)|G-protein coupled receptor signaling pathway (GO:0007186)|metabolic process (GO:0008152)|ossification (GO:0001503)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|phosphatidylinositol phospholipase C activity (GO:0004435)	p.N639K(1)		NS(1)|breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(13)|lung(45)|ovary(4)|prostate(3)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	84				GBM - Glioblastoma multiforme(114;0.226)	Cinacalcet(DB01012)	AGTTCCGCAACACACCCATTG	0.577																																						dbGAP											1	Substitution - Missense(1)	breast(1)											171.0	122.0	139.0					3																	122002718		2203	4300	6503	-	-	-	SO:0001583	missense	0			U20760	CCDS3010.1, CCDS54632.1	3q21.1	2012-08-29	2008-08-01		ENSG00000036828	ENSG00000036828		"""GPCR / Class C : Calcium-sensing receptors"""	1514	protein-coding gene	gene with protein product	"""severe neonatal hyperparathyroidism"""	601199	"""hypocalciuric hypercalcemia 1"""	HHC, HHC1		7677761	Standard	NM_000388		Approved	FHH, NSHPT, GPRC2A	uc003eew.4	P41180	OTTHUMG00000159491	ENST00000490131.1:c.1917C>A	3.37:g.122002718C>A	ENSP00000418685:p.Asn639Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q13912|Q16108|Q16109|Q16110|Q16379|Q2M1T0|Q4PJ19	Missense_Mutation	SNP	pfam_ANF_lig-bd_rcpt,pfam_GPCR_3_C,pfam_GPCR_3_9-Cys_dom,superfamily_Growth_fac_rcpt,pfscan_GPCR_3_C,prints_GPCR_3	p.N649K	ENST00000490131.1	37	c.1947	CCDS3010.1	3	.	.	.	.	.	.	.	.	.	.	C	14.76	2.632567	0.47049	.	.	ENSG00000036828	ENST00000490131;ENST00000498619;ENST00000296154	D;D;D	0.87887	-2.31;-2.31;-2.31	5.91	3.8	0.43715	GPCR, family 3, C-terminal (2);	0.041096	0.85682	D	0.000000	D	0.88258	0.6388	L	0.39147	1.195	0.53005	D	0.999965	D;D	0.58268	0.982;0.961	P;P	0.60236	0.871;0.468	D	0.87720	0.2572	10	0.44086	T	0.13	.	12.8155	0.57663	0.0:0.8446:0.0:0.1554	.	649;639	E7ENE0;P41180	.;CASR_HUMAN	K	639;649;639	ENSP00000418685:N639K;ENSP00000420194:N649K;ENSP00000296154:N639K	ENSP00000296154:N639K	N	+	3	2	CASR	123485408	1.000000	0.71417	1.000000	0.80357	0.943000	0.58893	1.659000	0.37387	1.498000	0.48600	0.462000	0.41574	AAC	CASR	-	pfam_GPCR_3_C,pfscan_GPCR_3_C	ENSG00000036828		0.577	CASR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CASR	HGNC	protein_coding	OTTHUMT00000355761.1	254	0.00	0	C	NM_000388		122002718	122002718	+1	no_errors	ENST00000498619	ensembl	human	known	69_37n	missense	110	30.38	48	SNP	1.000	A
CD46	4179	genome.wustl.edu	37	1	207940997	207940997	+	Splice_Site	SNP	G	G	C	rs554079785		TCGA-A2-A0D2-01A-21W-A050-09	TCGA-A2-A0D2-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	05656575-69e7-4745-a89d-ca0568eb5559	c830c663-95f6-40e0-9fd6-16586fa7d344	g.chr1:207940997G>C	ENST00000358170.2	+	7	1057		c.e7+1		CD46_ENST00000367041.1_Intron|CD46_ENST00000367047.1_Splice_Site|CD46_ENST00000480003.1_Intron|CD46_ENST00000354848.1_Intron|CD46_ENST00000322875.4_Splice_Site|CD46_ENST00000469535.1_3'UTR|CD46_ENST00000322918.5_Intron|CD46_ENST00000357714.1_Intron|CD46_ENST00000361067.1_Splice_Site|CD46_ENST00000367042.1_Intron|CD46_ENST00000441839.2_Intron|CD46_ENST00000360212.2_Intron	NM_002389.4	NP_002380.3	P15529	MCP_HUMAN	CD46 molecule, complement regulatory protein						adaptive immune response (GO:0002250)|complement activation, classical pathway (GO:0006958)|innate immune response (GO:0045087)|interleukin-10 production (GO:0032613)|negative regulation of complement activation (GO:0045916)|negative regulation of gene expression (GO:0010629)|positive regulation of gene expression (GO:0010628)|positive regulation of interleukin-10 production (GO:0032733)|positive regulation of memory T cell differentiation (GO:0043382)|positive regulation of regulatory T cell differentiation (GO:0045591)|positive regulation of T cell proliferation (GO:0042102)|positive regulation of transforming growth factor beta production (GO:0071636)|proteolysis (GO:0006508)|regulation of complement activation (GO:0030449)|regulation of Notch signaling pathway (GO:0008593)|sequestering of extracellular ligand from receptor (GO:0035581)|single fertilization (GO:0007338)|T cell mediated immunity (GO:0002456)|viral process (GO:0016032)	basolateral plasma membrane (GO:0016323)|cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|inner acrosomal membrane (GO:0002079)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	cadherin binding (GO:0045296)|receptor activity (GO:0004872)	p.?(1)		breast(2)|central_nervous_system(1)|endometrium(1)|large_intestine(7)|lung(6)|prostate(1)|skin(1)	19						AGTCATTCAGGTTTAGTAGCT	0.383																																						dbGAP											1	Unknown(1)	breast(1)											201.0	197.0	199.0					1																	207940997		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			BC030594	CCDS1479.1, CCDS1480.1, CCDS1481.1, CCDS1482.1, CCDS1484.1, CCDS1485.1, CCDS31008.1, CCDS31009.1	1q32	2014-09-17	2006-03-28	2006-02-09	ENSG00000117335	ENSG00000117335		"""CD molecules"", ""Complement system"""	6953	protein-coding gene	gene with protein product		120920	"""antigen identified by monoclonal antibody TRA-2-10"", ""membrane cofactor protein (CD46, trophoblast-lymphocyte cross-reactive antigen)"", ""CD46 antigen, complement regulatory protein"""	MIC10, MCP		7929741	Standard	NM_002389		Approved	TRA2.10, MGC26544, TLX	uc001hgj.3	P15529	OTTHUMG00000036397	ENST00000358170.2:c.901+1G>C	1.37:g.207940997G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	A0T1T0|A0T1T1|A0T1T2|Q15429|Q53GV9|Q5HY94|Q5VWS6|Q5VWS7|Q5VWS8|Q5VWS9|Q5VWT0|Q5VWT1|Q5VWT2|Q6N0A1|Q7Z3R5|Q9NNW2|Q9NNW3|Q9NNW4|Q9UCJ4	Splice_Site	SNP	-	e7+1	ENST00000358170.2	37	c.901+1	CCDS1485.1	1	.	.	.	.	.	.	.	.	.	.	G	14.43	2.533987	0.45073	.	.	ENSG00000117335	ENST00000358170;ENST00000322875;ENST00000367047;ENST00000361067	.	.	.	4.12	2.25	0.28309	.	.	.	.	.	.	.	.	.	.	.	0.47994	D	0.999561	.	.	.	.	.	.	.	.	.	.	.	.	.	.	6.7373	0.23417	0.2147:0.0:0.7853:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	CD46	206007620	0.030000	0.19436	0.488000	0.27440	0.686000	0.39977	-0.060000	0.11712	0.687000	0.31509	0.591000	0.81541	.	CD46	-	-	ENSG00000117335		0.383	CD46-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	CD46	HGNC	protein_coding	OTTHUMT00000088588.3	402	0.00	0	G	NM_172361	Intron	207940997	207940997	+1	no_errors	ENST00000322875	ensembl	human	known	69_37n	splice_site	596	19.22	142	SNP	0.606	C
CD86	942	genome.wustl.edu	37	3	121825277	121825277	+	Silent	SNP	G	G	C	rs201450972		TCGA-A2-A0D2-01A-21W-A050-09	TCGA-A2-A0D2-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	05656575-69e7-4745-a89d-ca0568eb5559	c830c663-95f6-40e0-9fd6-16586fa7d344	g.chr3:121825277G>C	ENST00000330540.2	+	4	749	c.633G>C	c.(631-633)acG>acC	p.T211T	CD86_ENST00000393627.2_Silent_p.T205T|CD86_ENST00000264468.5_Intron|CD86_ENST00000493101.1_Silent_p.T99T|CD86_ENST00000469710.1_Silent_p.T129T	NM_175862.4	NP_787058	P42081	CD86_HUMAN	CD86 molecule	211	Ig-like C2-type.				aging (GO:0007568)|B cell activation (GO:0042113)|cell-cell signaling (GO:0007267)|cellular response to cytokine stimulus (GO:0071345)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to metal ion (GO:0071248)|defense response to virus (GO:0051607)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|immune response (GO:0006955)|innate immune response (GO:0045087)|myeloid dendritic cell differentiation (GO:0043011)|negative regulation of T cell anergy (GO:0002668)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of activated T cell proliferation (GO:0042104)|positive regulation of cell proliferation (GO:0008284)|positive regulation of interleukin-2 biosynthetic process (GO:0045086)|positive regulation of interleukin-4 biosynthetic process (GO:0045404)|positive regulation of lymphotoxin A biosynthetic process (GO:0043017)|positive regulation of T-helper 2 cell differentiation (GO:0045630)|positive regulation of transcription, DNA-templated (GO:0045893)|response to drug (GO:0042493)|response to interferon-gamma (GO:0034341)|response to yeast (GO:0001878)|T cell activation (GO:0042110)|T cell costimulation (GO:0031295)|T cell proliferation involved in immune response (GO:0002309)|toll-like receptor signaling pathway (GO:0002224)|viral process (GO:0016032)	cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|plasma membrane (GO:0005886)	coreceptor activity (GO:0015026)|receptor activity (GO:0004872)	p.T211T(2)		breast(2)|endometrium(1)|kidney(1)|lung(11)|ovary(2)|pancreas(1)|prostate(1)|skin(1)|urinary_tract(3)	23				GBM - Glioblastoma multiforme(114;0.156)	Abatacept(DB01281)|Antithymocyte globulin(DB00098)|Belatacept(DB06681)	CTGATGTTACGAGCAATATGA	0.393																																					GBM(67;1379 1389 36064 39806)	dbGAP											2	Substitution - coding silent(2)	lung(1)|breast(1)											205.0	185.0	192.0					3																	121825277		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS3009.1, CCDS43138.1, CCDS56272.1, CCDS56273.1, CCDS74991.1	3q21	2013-01-29	2006-03-28		ENSG00000114013	ENSG00000114013		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	1705	protein-coding gene	gene with protein product	"""B-lymphocyte antigen B7-2"""	601020	"""CD86 antigen (CD28 antigen ligand 2, B7-2 antigen)"""	CD28LG2		7513726	Standard	NM_006889		Approved	B7.2, B7-2	uc003eet.3	P42081	OTTHUMG00000159482	ENST00000330540.2:c.633G>C	3.37:g.121825277G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	A0N0P0|B7Z2F3|B7Z702|E7ETN5|E9PC27|Q13655|Q6FHB1|Q6GTS4|Q7M4L5	Missense_Mutation	SNP	pfam_Ig_V-set,smart_Ig_sub,smart_Ig_V-set_subgr,pfscan_Ig-like	p.E207Q	ENST00000330540.2	37	c.619	CCDS3009.1	3	.	.	.	.	.	.	.	.	.	.	G	3.657	-0.070389	0.07228	.	.	ENSG00000114013	ENST00000478741	.	.	.	5.65	-3.28	0.05033	.	.	.	.	.	T	0.18087	0.0434	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.27020	-1.0086	4	.	.	.	0.3784	1.4415	0.02355	0.4399:0.184:0.2536:0.1224	.	.	.	.	Q	207	.	.	E	+	1	0	CD86	123307967	0.000000	0.05858	0.000000	0.03702	0.011000	0.07611	-0.612000	0.05616	-0.296000	0.08947	-0.290000	0.09829	GAG	CD86	-	NULL	ENSG00000114013		0.393	CD86-001	KNOWN	basic|CCDS	protein_coding	CD86	HGNC	protein_coding	OTTHUMT00000355671.1	256	0.00	0	G	NM_006889		121825277	121825277	+1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000478741	ensembl	human	novel	69_37n	missense	162	30.17	70	SNP	0.000	C
CENPK	64105	genome.wustl.edu	37	5	64850678	64850678	+	Silent	SNP	A	A	G			TCGA-A2-A0D2-01A-21W-A050-09	TCGA-A2-A0D2-10A-01W-A055-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	05656575-69e7-4745-a89d-ca0568eb5559	c830c663-95f6-40e0-9fd6-16586fa7d344	g.chr5:64850678A>G	ENST00000396679.1	-	3	271	c.57T>C	c.(55-57)aaT>aaC	p.N19N	CENPK_ENST00000242872.3_Silent_p.N19N|CENPK_ENST00000508421.1_5'UTR|CENPK_ENST00000514814.1_Silent_p.N19N|CENPK_ENST00000510693.1_5'UTR|CENPK_ENST00000506282.2_Intron|CENPK_ENST00000510354.1_Silent_p.N19N	NM_022145.4	NP_071428.2	Q9BS16	CENPK_HUMAN	centromere protein K	19					CENP-A containing nucleosome assembly (GO:0034080)|mitotic cell cycle (GO:0000278)|nucleosome assembly (GO:0006334)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	cytosol (GO:0005829)|kinetochore (GO:0000776)|nucleoplasm (GO:0005654)		p.N19N(1)		breast(1)|endometrium(1)|large_intestine(3)|lung(5)	10		Lung NSC(167;7.21e-05)|Prostate(74;0.0174)|Ovarian(174;0.186)		Lung(70;0.00466)		CTTCTTCAGTATTTGTAACAT	0.299																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											208.0	216.0	213.0					5																	64850678		2203	4297	6500	-	-	-	SO:0001819	synonymous_variant	0			BC008504	CCDS3984.1	5q12.3	2013-11-05			ENSG00000123219	ENSG00000123219			29479	protein-coding gene	gene with protein product		611502				8950979	Standard	NM_022145		Approved	FKSG14, SOLT, CENP-K	uc003jtu.3	Q9BS16	OTTHUMG00000131227	ENST00000396679.1:c.57T>C	5.37:g.64850678A>G		Somatic		WXS	Illumina GAIIx	Phase_IV	Q9H4L0	Silent	SNP	pfam_Centromere_CenpK,superfamily_Prefoldin	p.N19	ENST00000396679.1	37	c.57	CCDS3984.1	5																																																																																			CENPK	-	pfam_Centromere_CenpK	ENSG00000123219		0.299	CENPK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CENPK	HGNC	protein_coding	OTTHUMT00000253971.2	275	0.00	0	A	NM_022145		64850678	64850678	-1	no_errors	ENST00000242872	ensembl	human	known	69_37n	silent	157	32.91	77	SNP	0.007	G
CLCA1	1179	genome.wustl.edu	37	1	86951084	86951084	+	Frame_Shift_Del	DEL	A	A	-			TCGA-A2-A0D2-01A-21W-A050-09	TCGA-A2-A0D2-10A-01W-A055-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	05656575-69e7-4745-a89d-ca0568eb5559	c830c663-95f6-40e0-9fd6-16586fa7d344	g.chr1:86951084delA	ENST00000234701.3	+	7	1145	c.794delA	c.(793-795)caafs	p.Q265fs	CLCA1_ENST00000394711.1_Frame_Shift_Del_p.Q265fs			A8K7I4	CLCA1_HUMAN	chloride channel accessory 1	265					calcium ion transport (GO:0006816)|cellular response to hypoxia (GO:0071456)|chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|transport (GO:0006810)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|microvillus (GO:0005902)|zymogen granule membrane (GO:0042589)	chloride channel activity (GO:0005254)			NS(1)|breast(3)|endometrium(1)|kidney(3)|large_intestine(9)|lung(14)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	38		Lung NSC(277;0.239)		all cancers(265;0.0249)|Epithelial(280;0.0476)		AAGCAAAATCAAAAATGCAAT	0.373																																						dbGAP											0													118.0	100.0	106.0					1																	86951084		2203	4300	6503	-	-	-	SO:0001589	frameshift_variant	0				CCDS709.1	1p22.3	2012-02-26	2009-01-29		ENSG00000016490	ENSG00000016490			2015	protein-coding gene	gene with protein product		603906	"""chloride channel, calcium activated, family member 1"", ""chloride channel regulator 1"""			9828122	Standard	NM_001285		Approved	CaCC, CLCRG1	uc001dlt.3	A8K7I4	OTTHUMG00000010254	ENST00000234701.3:c.794delA	1.37:g.86951084delA	ENSP00000234701:p.Gln265fs	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RAV5|O95151|Q5TDF4|Q9UNF6|Q9UPC6	Frame_Shift_Del	DEL	pfam_Cl_channel_Ca,pfam_DUF1973,pfam_VWF_A,superfamily_Fibronectin_type3,smart_VWF_A,pfscan_VWF_A,tigrfam_CaCC_prot	p.K266fs	ENST00000234701.3	37	c.794	CCDS709.1	1																																																																																			CLCA1	-	tigrfam_CaCC_prot	ENSG00000016490		0.373	CLCA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CLCA1	HGNC	protein_coding	OTTHUMT00000028277.1	233	0.00	0	A	NM_001285		86951084	86951084	+1	no_errors	ENST00000234701	ensembl	human	known	69_37n	frame_shift_del	216	20.51	56	DEL	0.040	-
CHRM3	1131	genome.wustl.edu	37	1	240071942	240071942	+	Silent	SNP	G	G	T			TCGA-A2-A0D2-01A-21W-A050-09	TCGA-A2-A0D2-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	05656575-69e7-4745-a89d-ca0568eb5559	c830c663-95f6-40e0-9fd6-16586fa7d344	g.chr1:240071942G>T	ENST00000255380.4	+	5	1970	c.1191G>T	c.(1189-1191)ggG>ggT	p.G397G		NM_000740.2	NP_000731.1	P20309	ACM3_HUMAN	cholinergic receptor, muscarinic 3	397					cell proliferation (GO:0008283)|cellular protein modification process (GO:0006464)|energy reserve metabolic process (GO:0006112)|G-protein coupled acetylcholine receptor signaling pathway (GO:0007213)|G-protein coupled receptor signaling pathway (GO:0007186)|nervous system development (GO:0007399)|positive regulation of smooth muscle contraction (GO:0045987)|regulation of insulin secretion (GO:0050796)|regulation of vascular smooth muscle contraction (GO:0003056)|saliva secretion (GO:0046541)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|smooth muscle contraction (GO:0006939)	asymmetric synapse (GO:0032279)|axon terminus (GO:0043679)|cell junction (GO:0030054)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	acetylcholine binding (GO:0042166)|drug binding (GO:0008144)|G-protein coupled acetylcholine receptor activity (GO:0016907)|phosphatidylinositol phospholipase C activity (GO:0004435)|receptor activity (GO:0004872)	p.G397G(1)		breast(3)|endometrium(5)|kidney(2)|large_intestine(4)|lung(19)|ovary(4)|prostate(1)|skin(12)|upper_aerodigestive_tract(1)	51	Ovarian(103;0.127)	all_cancers(173;0.00567)|all_neural(198;0.203)	OV - Ovarian serous cystadenocarcinoma(106;0.00989)		Aclidinium(DB08897)|Amitriptyline(DB00321)|Amoxapine(DB00543)|Anisotropine Methylbromide(DB00517)|Aripiprazole(DB01238)|Atropine(DB00572)|Brompheniramine(DB00835)|Cevimeline(DB00185)|Chlorpromazine(DB00477)|Chlorprothixene(DB01239)|Cinnarizine(DB00568)|Clozapine(DB00363)|Cryptenamine(DB00785)|Cyproheptadine(DB00434)|Darifenacin(DB00496)|Desipramine(DB01151)|Diphemanil Methylsulfate(DB00729)|Diphenidol(DB01231)|Disopyramide(DB00280)|Doxepin(DB01142)|Fesoterodine(DB06702)|Glycopyrrolate(DB00986)|Homatropine Methylbromide(DB00725)|Hyoscyamine(DB00424)|Imipramine(DB00458)|Ipratropium bromide(DB00332)|Isopropamide(DB01625)|Ketamine(DB01221)|Loxapine(DB00408)|Maprotiline(DB00934)|Mepenzolate(DB04843)|Methacholine(DB06709)|Methotrimeprazine(DB01403)|Methylscopolamine bromide(DB00462)|Metixene(DB00340)|Mivacurium(DB01226)|Nicardipine(DB00622)|Nortriptyline(DB00540)|Olanzapine(DB00334)|Oxybutynin(DB01062)|Oxyphencyclimine(DB00383)|Pancuronium(DB01337)|Paroxetine(DB00715)|Pethidine(DB00454)|Pilocarpine(DB01085)|Pipecuronium(DB01338)|Procyclidine(DB00387)|Promazine(DB00420)|Promethazine(DB01069)|Propiomazine(DB00777)|Quetiapine(DB01224)|Scopolamine(DB00747)|Solifenacin(DB01591)|Succinylcholine(DB00202)|Tiotropium(DB01409)|Tolterodine(DB01036)|Tramadol(DB00193)|Trihexyphenidyl(DB00376)|Trimipramine(DB00726)|Tropicamide(DB00809)|Ziprasidone(DB00246)	AGGAGCTGGGGATGGTGGACT	0.567																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											40.0	34.0	36.0					1																	240071942		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			U29589	CCDS1616.1	1q43	2012-09-20			ENSG00000133019	ENSG00000133019		"""Cholinergic receptors"", ""GPCR / Class A : Cholinergic receptors, muscarinic"""	1952	protein-coding gene	gene with protein product	"""acetylcholine receptor, muscarinic 3"""	118494					Standard	XM_005273032		Approved		uc001hyp.3	P20309	OTTHUMG00000039649	ENST00000255380.4:c.1191G>T	1.37:g.240071942G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q0VAJ8|Q4QRI3|Q5VXY2|Q9HB60	Silent	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfam_7TM_GPCR_serpentine_rcpt_Srx,pfscan_GPCR_Rhodpsn_supfam,prints_Musac_M3_rcpt,prints_Musac_rcpt,prints_7TM_GPCR_Rhodpsn	p.G397	ENST00000255380.4	37	c.1191	CCDS1616.1	1																																																																																			CHRM3	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	ENSG00000133019		0.567	CHRM3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHRM3	HGNC	protein_coding	OTTHUMT00000095644.2	65	0.00	0	G	NM_000740		240071942	240071942	+1	no_errors	ENST00000255380	ensembl	human	known	69_37n	silent	62	21.52	17	SNP	0.000	T
DAB2	1601	genome.wustl.edu	37	5	39377250	39377250	+	Missense_Mutation	SNP	C	C	T			TCGA-A2-A0D2-01A-21W-A050-09	TCGA-A2-A0D2-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	05656575-69e7-4745-a89d-ca0568eb5559	c830c663-95f6-40e0-9fd6-16586fa7d344	g.chr5:39377250C>T	ENST00000320816.6	-	12	2106	c.1639G>A	c.(1639-1641)Ggt>Agt	p.G547S	DAB2_ENST00000509337.1_Missense_Mutation_p.G526S|DAB2_ENST00000545653.1_Missense_Mutation_p.G526S|DAB2_ENST00000339788.6_Missense_Mutation_p.G329S	NM_001343.3	NP_001334.2	P98082	DAB2_HUMAN	Dab, mitogen-responsive phosphoprotein, homolog 2 (Drosophila)	547					activation of JUN kinase activity (GO:0007257)|apoptotic process (GO:0006915)|cell morphogenesis involved in differentiation (GO:0000904)|cell proliferation (GO:0008283)|cellular response to transforming growth factor beta stimulus (GO:0071560)|clathrin coat assembly (GO:0048268)|endoderm development (GO:0007492)|excretion (GO:0007588)|in utero embryonic development (GO:0001701)|leading edge cell differentiation (GO:0035026)|membrane organization (GO:0061024)|myeloid cell differentiation (GO:0030099)|negative regulation of androgen receptor signaling pathway (GO:0060766)|negative regulation of apoptotic process (GO:0043066)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of protein binding (GO:0032091)|negative regulation of protein localization to plasma membrane (GO:1903077)|negative regulation of transcription, DNA-templated (GO:0045892)|pinocytosis (GO:0006907)|positive regulation of cell migration (GO:0030335)|positive regulation of clathrin-mediated endocytosis (GO:2000370)|positive regulation of early endosome to late endosome transport (GO:2000643)|positive regulation of endocytosis (GO:0045807)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of integrin-mediated signaling pathway (GO:2001046)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of receptor recycling (GO:0001921)|positive regulation of SMAD protein import into nucleus (GO:0060391)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)|positive regulation of transcription elongation from RNA polymerase II promoter (GO:0032968)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|positive regulation of Wnt signaling pathway, planar cell polarity pathway (GO:2000096)|protein transport (GO:0015031)|receptor-mediated endocytosis (GO:0006898)|Wnt signaling pathway (GO:0016055)	apical plasma membrane (GO:0016324)|clathrin coat of coated pit (GO:0030132)|clathrin-coated vesicle (GO:0030136)|coated pit (GO:0005905)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|intracellular membrane-bounded organelle (GO:0043231)|lysosomal membrane (GO:0005765)|nucleolus (GO:0005730)|plasma membrane (GO:0005886)	cargo receptor activity (GO:0038024)|clathrin adaptor activity (GO:0035615)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|protein C-terminus binding (GO:0008022)|SMAD binding (GO:0046332)	p.G547S(1)		autonomic_ganglia(1)|breast(3)|central_nervous_system(1)|endometrium(1)|kidney(5)|large_intestine(9)|lung(19)|prostate(2)|skin(4)|upper_aerodigestive_tract(2)	47	all_lung(31;0.000197)		Epithelial(62;0.137)			GGACTTGTACCAAAAATGACG	0.537											OREG0016586	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP											1	Substitution - Missense(1)	breast(1)											79.0	73.0	75.0					5																	39377250		2203	4300	6503	-	-	-	SO:0001583	missense	0			U53446	CCDS34149.1, CCDS58946.1	5p13.1	2013-10-03	2013-03-08		ENSG00000153071	ENSG00000153071			2662	protein-coding gene	gene with protein product		601236	"""disabled (Drosophila) homolog 2 (mitogen-responsive phosphoprotein)"", ""disabled homolog 2, mitogen-responsive phosphoprotein (Drosophila)"""			8660969, 9620555	Standard	NM_001343		Approved	DOC-2	uc003jlx.3	P98082	OTTHUMG00000162043	ENST00000320816.6:c.1639G>A	5.37:g.39377250C>T	ENSP00000313391:p.Gly547Ser	Somatic	885	WXS	Illumina GAIIx	Phase_IV	A6NES5|Q13598|Q9BTY0|Q9UK04	Missense_Mutation	SNP	pfam_PTyr_interaction_dom,smart_PTyr_interaction_dom,pfscan_PTyr_interaction_dom	p.G547S	ENST00000320816.6	37	c.1639	CCDS34149.1	5	.	.	.	.	.	.	.	.	.	.	C	13.26	2.184606	0.38609	.	.	ENSG00000153071	ENST00000320816;ENST00000339788;ENST00000545653;ENST00000509337	T;T;T;T	0.54479	0.57;0.96;0.75;0.75	5.57	3.21	0.36854	.	1.061900	0.07358	N	0.883614	T	0.45074	0.1324	L	0.38953	1.18	0.37183	D	0.903578	B;B	0.27068	0.167;0.163	B;B	0.28709	0.043;0.093	T	0.28073	-1.0055	10	0.30078	T	0.28	-0.6728	10.799	0.46476	0.0:0.797:0.0:0.203	.	547;526	P98082;P98082-3	DAB2_HUMAN;.	S	547;329;526;526	ENSP00000313391:G547S;ENSP00000345508:G329S;ENSP00000439919:G526S;ENSP00000426245:G526S	ENSP00000313391:G547S	G	-	1	0	DAB2	39413007	0.868000	0.29978	0.997000	0.53966	0.539000	0.34962	0.493000	0.22451	1.128000	0.42052	0.655000	0.94253	GGT	DAB2	-	NULL	ENSG00000153071		0.537	DAB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DAB2	HGNC	protein_coding	OTTHUMT00000367014.1	172	0.00	0	C	NM_001343		39377250	39377250	-1	no_errors	ENST00000320816	ensembl	human	known	69_37n	missense	112	20.57	29	SNP	1.000	T
DDX25	29118	genome.wustl.edu	37	11	125787146	125787146	+	Splice_Site	SNP	G	G	A			TCGA-A2-A0D2-01A-21W-A050-09	TCGA-A2-A0D2-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	05656575-69e7-4745-a89d-ca0568eb5559	c830c663-95f6-40e0-9fd6-16586fa7d344	g.chr11:125787146G>A	ENST00000263576.6	+	9	1193	c.1038G>A	c.(1036-1038)caG>caA	p.Q346Q	RP11-680F20.9_ENST00000533033.2_RNA|DDX25_ENST00000525943.1_3'UTR	NM_013264.4	NP_037396.3	Q9UHL0	DDX25_HUMAN	DEAD (Asp-Glu-Ala-Asp) box helicase 25	346	Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.				mRNA export from nucleus (GO:0006406)|multicellular organismal development (GO:0007275)|regulation of translation (GO:0006417)|spermatid development (GO:0007286)	chromatoid body (GO:0033391)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent RNA helicase activity (GO:0004004)|RNA binding (GO:0003723)	p.Q232Q(1)|p.Q346Q(1)		breast(2)|endometrium(2)|kidney(1)|large_intestine(2)|ovary(2)|upper_aerodigestive_tract(1)	10	all_hematologic(175;0.177)	Breast(109;0.0021)|all_lung(97;0.0203)|Lung NSC(97;0.0203)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;1.14e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.046)		TCTTCTGCCAGGTACACTCTG	0.517																																						dbGAP											2	Substitution - coding silent(2)	breast(2)											25.0	24.0	24.0					11																	125787146		2104	4220	6324	-	-	-	SO:0001630	splice_region_variant	0			AF155140	CCDS44766.1	11q24	2012-02-23	2012-02-23		ENSG00000109832	ENSG00000109832		"""DEAD-boxes"""	18698	protein-coding gene	gene with protein product	"""gonadotropin-regulated testicular RNA helicase"""	607663	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 25"", ""DEAD (Asp-Glu-Ala-Asp) box polypeptide 25"""			10608860, 15096601	Standard	NM_013264		Approved	GRTH	uc001qcz.5	Q9UHL0	OTTHUMG00000165859	ENST00000263576.6:c.1038+1G>A	11.37:g.125787146G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B2R6Z0|Q5XVN2|Q86W81|Q8IYP1	Missense_Mutation	SNP	pfam_DNA/RNA_helicase_DEAD/DEAH_N,pfam_Helicase_C,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,pfscan_RNA_helicase_DEAD_Q_motif	p.D270N	ENST00000263576.6	37	c.808	CCDS44766.1	11																																																																																			DDX25	-	pfscan_Helicase_C	ENSG00000109832		0.517	DDX25-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DDX25	HGNC	protein_coding	OTTHUMT00000386736.3	34	0.00	0	G	NM_013264	Silent	125787146	125787146	+1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000526875	ensembl	human	novel	69_37n	missense	42	20.75	11	SNP	1.000	A
DOCK4	9732	genome.wustl.edu	37	7	111846181	111846181	+	Missense_Mutation	SNP	T	T	C			TCGA-A2-A0D2-01A-21W-A050-09	TCGA-A2-A0D2-10A-01W-A055-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	05656575-69e7-4745-a89d-ca0568eb5559	c830c663-95f6-40e0-9fd6-16586fa7d344	g.chr7:111846181T>C	ENST00000437633.1	-	1	269	c.13A>G	c.(13-15)Acg>Gcg	p.T5A	DOCK4_ENST00000428084.1_Missense_Mutation_p.T5A|ZNF277_ENST00000361822.3_5'Flank|ZNF277_ENST00000450657.1_5'Flank|ZNF277_ENST00000421043.1_5'Flank|DOCK4_ENST00000476846.1_5'UTR	NM_014705.3	NP_055520.3	Q8N1I0	DOCK4_HUMAN	dedicator of cytokinesis 4	5					cell chemotaxis (GO:0060326)|positive regulation of Rac GTPase activity (GO:0032855)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|membrane (GO:0016020)|stereocilium (GO:0032420)|stereocilium bundle (GO:0032421)	guanyl-nucleotide exchange factor activity (GO:0005085)|PDZ domain binding (GO:0030165)|Rac GTPase activator activity (GO:0030675)|Rac GTPase binding (GO:0048365)|receptor tyrosine kinase binding (GO:0030971)	p.T5A(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(4)|kidney(4)|large_intestine(13)|lung(31)|ovary(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(4)	72		Acute lymphoblastic leukemia(1;0.0441)				TCGTGCTCCGTAGGTATCCAC	0.622																																						dbGAP											1	Substitution - Missense(1)	breast(1)											35.0	42.0	40.0					7																	111846181		1903	4105	6008	-	-	-	SO:0001583	missense	0				CCDS47688.1	7q31.1	2007-08-07			ENSG00000128512	ENSG00000128512			19192	protein-coding gene	gene with protein product		607679				12432077, 12628187	Standard	XM_006716188		Approved	FLJ34238, KIAA0716	uc003vfx.3	Q8N1I0	OTTHUMG00000155077	ENST00000437633.1:c.13A>G	7.37:g.111846181T>C	ENSP00000404179:p.Thr5Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	O14584|O94824|Q8NB45	Missense_Mutation	SNP	pfam_DOCK,pfam_SH3_2,superfamily_SH3_domain,superfamily_Rho_GTPase_activation_prot,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_SH3_domain,pfscan_SH3_domain	p.T5A	ENST00000437633.1	37	c.13	CCDS47688.1	7	.	.	.	.	.	.	.	.	.	.	T	12.83	2.057005	0.36277	.	.	ENSG00000128512	ENST00000428084;ENST00000437633	T;T	0.03094	4.05;4.05	5.16	5.16	0.70880	Src homology-3 domain (1);	.	.	.	.	T	0.05547	0.0146	L	0.51914	1.62	0.80722	D	1	B;B;B	0.28378	0.209;0.209;0.209	B;B;B	0.28139	0.086;0.079;0.053	T	0.35001	-0.9806	9	0.40728	T	0.16	.	13.3768	0.60743	0.0:0.0:0.0:1.0	.	5;5;5	A4D0S8;Q149N5;Q8N1I0	.;.;DOCK4_HUMAN	A	5	ENSP00000410746:T5A;ENSP00000404179:T5A	ENSP00000410746:T5A	T	-	1	0	DOCK4	111633417	1.000000	0.71417	1.000000	0.80357	0.080000	0.17528	4.685000	0.61693	2.161000	0.67846	0.379000	0.24179	ACG	DOCK4	-	superfamily_SH3_domain	ENSG00000128512		0.622	DOCK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DOCK4	HGNC	protein_coding	OTTHUMT00000338369.4	71	0.00	0	T	NM_014705		111846181	111846181	-1	no_errors	ENST00000428084	ensembl	human	known	69_37n	missense	42	23.64	13	SNP	1.000	C
FBN3	84467	genome.wustl.edu	37	19	8140058	8140058	+	Silent	SNP	A	A	G			TCGA-A2-A0D2-01A-21W-A050-09	TCGA-A2-A0D2-10A-01W-A055-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	05656575-69e7-4745-a89d-ca0568eb5559	c830c663-95f6-40e0-9fd6-16586fa7d344	g.chr19:8140058A>G	ENST00000600128.1	-	61	8013	c.7599T>C	c.(7597-7599)gaT>gaC	p.D2533D	FBN3_ENST00000601739.1_Silent_p.D2533D|FBN3_ENST00000270509.2_Silent_p.D2533D			Q75N90	FBN3_HUMAN	fibrillin 3	2533	EGF-like 42; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.					proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|extracellular matrix structural constituent (GO:0005201)	p.D2533D(1)		NS(1)|breast(9)|central_nervous_system(2)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(15)|lung(53)|ovary(7)|pancreas(2)|prostate(3)|skin(10)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	132						GGTGGGGCCCATCACATTCAT	0.602																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											55.0	62.0	60.0					19																	8140058		2203	4299	6502	-	-	-	SO:0001819	synonymous_variant	0				CCDS12196.1	19p13	2008-02-05							18794	protein-coding gene	gene with protein product		608529					Standard	NM_032447		Approved		uc002mjf.3	Q75N90		ENST00000600128.1:c.7599T>C	19.37:g.8140058A>G		Somatic		WXS	Illumina GAIIx	Phase_IV	Q75N91|Q75N92|Q75N93|Q86SJ5|Q96JP8	Silent	SNP	pfam_EGF-like_Ca-bd,pfam_TB_dom,pfam_EGF-like_dom,superfamily_TB_dom,smart_EGF-like,smart_EGF-like_Ca-bd,pirsf_Fibrillin,pfscan_EG-like_dom	p.D2533	ENST00000600128.1	37	c.7599	CCDS12196.1	19																																																																																			FBN3	-	pfam_EGF-like_Ca-bd,smart_EGF-like_Ca-bd,smart_EGF-like,pirsf_Fibrillin,pfscan_EG-like_dom	ENSG00000142449		0.602	FBN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FBN3	HGNC	protein_coding	OTTHUMT00000461428.2	103	0.00	0	A	NM_032447		8140058	8140058	-1	no_errors	ENST00000270509	ensembl	human	known	69_37n	silent	34	30.61	15	SNP	0.030	G
FHOD3	80206	genome.wustl.edu	37	18	34273180	34273180	+	Missense_Mutation	SNP	A	A	G			TCGA-A2-A0D2-01A-21W-A050-09	TCGA-A2-A0D2-10A-01W-A055-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	05656575-69e7-4745-a89d-ca0568eb5559	c830c663-95f6-40e0-9fd6-16586fa7d344	g.chr18:34273180A>G	ENST00000359247.4	+	13	1454	c.1454A>G	c.(1453-1455)tAc>tGc	p.Y485C	FHOD3_ENST00000445677.1_Missense_Mutation_p.Y464C|FHOD3_ENST00000591635.1_Intron|FHOD3_ENST00000590592.1_Missense_Mutation_p.Y677C|FHOD3_ENST00000257209.4_Missense_Mutation_p.Y502C|FHOD3_ENST00000587493.1_3'UTR	NM_001281739.1	NP_001268668.1	Q2V2M9	FHOD3_HUMAN	formin homology 2 domain containing 3	485					actin filament network formation (GO:0051639)|cardiac myofibril assembly (GO:0055003)|negative regulation of actin filament polymerization (GO:0030837)|sarcomere organization (GO:0045214)	striated muscle thin filament (GO:0005865)		p.Y502C(1)		NS(1)|breast(5)|central_nervous_system(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(25)|liver(2)|lung(29)|ovary(3)|prostate(4)|skin(5)|upper_aerodigestive_tract(1)	90		all_epithelial(2;0.0181)|Colorectal(2;0.0195)				AGATACAAATACTTGGAACAG	0.527																																						dbGAP											1	Substitution - Missense(1)	breast(1)											25.0	30.0	28.0					18																	34273180		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK091899	CCDS32816.1, CCDS62418.1, CCDS62419.1	18q12	2007-08-02				ENSG00000134775			26178	protein-coding gene	gene with protein product		609691				11214970	Standard	NM_025135		Approved	FHOS2, KIAA1695, FLJ22297, FLJ22717	uc021uiv.1	Q2V2M9		ENST00000359247.4:c.1454A>G	18.37:g.34273180A>G	ENSP00000352186:p.Tyr485Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	A8MQT4|E5F5Q0|Q642I2|Q6ZRQ7|Q86TF9|Q8N3A5|Q9C0G8|Q9H604|Q9H6G7	Missense_Mutation	SNP	pfam_FH2_actin-bd,superfamily_FH2_actin-bd,superfamily_ARM-type_fold,smart_Actin-bd_FH2/DRF_autoreg	p.Y502C	ENST00000359247.4	37	c.1505		18	.	.	.	.	.	.	.	.	.	.	A	15.39	2.818704	0.50633	.	.	ENSG00000134775	ENST00000257209;ENST00000359247;ENST00000445677	T;T;T	0.34667	1.47;1.35;1.49	5.5	5.5	0.81552	.	0.336083	0.32055	N	0.006660	T	0.56046	0.1959	M	0.62723	1.935	0.41982	D	0.990803	D;D;D;D	0.89917	0.994;0.997;1.0;0.999	P;P;D;D	0.85130	0.902;0.897;0.997;0.99	T	0.56932	-0.7897	10	0.46703	T	0.11	.	12.9811	0.58564	1.0:0.0:0.0:0.0	.	464;485;502;677	Q2V2M9-2;Q2V2M9;Q2V2M9-3;E5F5Q0	.;FHOD3_HUMAN;.;.	C	502;485;464	ENSP00000257209:Y502C;ENSP00000352186:Y485C;ENSP00000411430:Y464C	ENSP00000257209:Y502C	Y	+	2	0	FHOD3	32527178	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	6.340000	0.72973	2.088000	0.63022	0.472000	0.43445	TAC	FHOD3	-	NULL	ENSG00000134775		0.527	FHOD3-001	PUTATIVE	basic	protein_coding	FHOD3	HGNC	protein_coding	OTTHUMT00000460884.1	217	0.46	1	A	XM_371114		34273180	34273180	+1	no_errors	ENST00000257209	ensembl	human	known	69_37n	missense	128	40.19	86	SNP	1.000	G
FRAS1	80144	genome.wustl.edu	37	4	79353539	79353539	+	Missense_Mutation	SNP	G	G	C			TCGA-A2-A0D2-01A-21W-A050-09	TCGA-A2-A0D2-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	05656575-69e7-4745-a89d-ca0568eb5559	c830c663-95f6-40e0-9fd6-16586fa7d344	g.chr4:79353539G>C	ENST00000325942.6	+	38	5438	c.4998G>C	c.(4996-4998)gaG>gaC	p.E1666D	FRAS1_ENST00000264895.6_Missense_Mutation_p.E1666D	NM_001166133.1	NP_001159605.1	Q86XX4	FRAS1_HUMAN	Fraser extracellular matrix complex subunit 1	1666					cell communication (GO:0007154)|embryonic limb morphogenesis (GO:0030326)|metanephros morphogenesis (GO:0003338)|morphogenesis of an epithelium (GO:0002009)|palate development (GO:0060021)|protein transport (GO:0015031)|skin development (GO:0043588)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|sublamina densa (GO:0061618)	metal ion binding (GO:0046872)	p.E1666D(3)		breast(2)|central_nervous_system(2)|cervix(2)|endometrium(14)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(5)|lung(54)|prostate(7)|skin(2)|urinary_tract(4)	103						AGGATGTTGAGAAAAATGCTC	0.418																																						dbGAP											3	Substitution - Missense(3)	breast(3)											58.0	55.0	56.0					4																	79353539		1898	4117	6015	-	-	-	SO:0001583	missense	0			AB040933	CCDS54772.1	4q21.21	2014-06-25	2014-06-25		ENSG00000138759	ENSG00000138759			19185	protein-coding gene	gene with protein product		607830	"""Fraser syndrome 1"""			12766769, 3118036	Standard	NM_025074		Approved	FLJ22031, FLJ14927, KIAA1500	uc003hlb.2	Q86XX4	OTTHUMG00000160856	ENST00000325942.6:c.4998G>C	4.37:g.79353539G>C	ENSP00000326330:p.Glu1666Asp	Somatic		WXS	Illumina GAIIx	Phase_IV	A2RRR8|Q86UZ4|Q8N3U9|Q8NAU7|Q96JW7|Q9H6N9|Q9P228	Missense_Mutation	SNP	pfam_Calx_beta,pfam_VWF_C,superfamily_Growth_fac_rcpt,superfamily_Cadherin-like,smart_VWC_out,smart_VWF_C,smart_Furin_repeat,smart_EGF-like,smart_Calx_beta,pfscan_VWF_C	p.E1666D	ENST00000325942.6	37	c.4998	CCDS54772.1	4	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	5.138|5.138	0.211095|0.211095	0.09757|0.09757	.|.	.|.	ENSG00000138759|ENSG00000138759	ENST00000325942;ENST00000264895;ENST00000545316|ENST00000510944	T;T|T	0.26810|0.26373	1.71;1.71|1.74	5.65|5.65	0.726|0.726	0.18248|0.18248	.|.	0.362824|0.362824	0.29106|0.29106	N|N	0.013138|0.013138	T|T	0.23330|0.23330	0.0564|0.0564	L|L	0.58101|0.58101	1.795|1.795	0.58432|0.58432	D|D	0.999999|0.999999	B;P|.	0.41080|.	0.048;0.737|.	B;B|.	0.31946|.	0.012;0.138|.	T|T	0.07539|0.07539	-1.0767|-1.0767	10|8	0.19147|0.15066	T|T	0.46|0.55	.|.	3.0548|3.0548	0.06181|0.06181	0.2266:0.4051:0.2675:0.1008|0.2266:0.4051:0.2675:0.1008	.|.	1666;1666|.	E9PHH6;A2RRR8|.	.;.|.	D|Q	1666;1666;86|116	ENSP00000326330:E1666D;ENSP00000264895:E1666D|ENSP00000422221:E116Q	ENSP00000264895:E1666D|ENSP00000422221:E116Q	E|E	+|+	3|1	2|0	FRAS1|FRAS1	79572563|79572563	0.991000|0.991000	0.36638|0.36638	0.095000|0.095000	0.20976|0.20976	0.014000|0.014000	0.08584|0.08584	0.424000|0.424000	0.21330|0.21330	0.169000|0.169000	0.19679|0.19679	0.655000|0.655000	0.94253|0.94253	GAG|GAA	FRAS1	-	NULL	ENSG00000138759		0.418	FRAS1-001	NOVEL	basic|CCDS	protein_coding	FRAS1	HGNC	protein_coding	OTTHUMT00000362706.2	107	0.00	0	G			79353539	79353539	+1	no_errors	ENST00000264895	ensembl	human	known	69_37n	missense	92	31.34	42	SNP	0.769	C
GCNT4	51301	genome.wustl.edu	37	5	74325681	74325681	+	Missense_Mutation	SNP	G	G	C			TCGA-A2-A0D2-01A-21W-A050-09	TCGA-A2-A0D2-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	05656575-69e7-4745-a89d-ca0568eb5559	c830c663-95f6-40e0-9fd6-16586fa7d344	g.chr5:74325681G>C	ENST00000322348.4	-	1	1043	c.182C>G	c.(181-183)aCt>aGt	p.T61S		NM_016591.2	NP_057675.1	Q9P109	GCNT4_HUMAN	glucosaminyl (N-acetyl) transferase 4, core 2	61					carbohydrate metabolic process (GO:0005975)|cellular protein metabolic process (GO:0044267)|homeostasis of number of cells (GO:0048872)|inter-male aggressive behavior (GO:0002121)|kidney morphogenesis (GO:0060993)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|protein O-linked glycosylation (GO:0006493)|thyroid hormone metabolic process (GO:0042403)|tissue morphogenesis (GO:0048729)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	beta-1,3-galactosyl-O-glycosyl-glycoprotein beta-1,6-N-acetylglucosaminyltransferase activity (GO:0003829)|N-acetyllactosaminide beta-1,6-N-acetylglucosaminyltransferase activity (GO:0008109)	p.T61S(1)		NS(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(3)|ovary(2)|skin(1)|stomach(2)	19		all_lung(232;0.0131)|Lung NSC(167;0.0282)|Ovarian(174;0.0798)		OV - Ovarian serous cystadenocarcinoma(47;8.44e-57)		CTTAACATGAGTGTATCTGTT	0.393																																						dbGAP											1	Substitution - Missense(1)	breast(1)											118.0	113.0	115.0					5																	74325681		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF132035	CCDS4026.1	5q12	2013-02-25	2010-03-16		ENSG00000176928	ENSG00000176928	2.4.1.102	"""Glucosaminyl (N-acetyl) transferase and xylosyltransferase family"""	17973	protein-coding gene	gene with protein product	"""core 2 beta-1,6-N-acetylglucosaminyltransferase 3"", ""beta-1,3-galactosyl-O-glycosyl-glycoprotein beta-1,6-N-acetylglucosaminyltransferase 4"""		"""glucosaminyl (N-acetyl) transferase 4, core 2 (beta-1,6-N-acetylglucosaminyltransferase)"""			10753916	Standard	NM_016591		Approved	C2GNT3	uc003kdn.3	Q9P109	OTTHUMG00000131272	ENST00000322348.4:c.182C>G	5.37:g.74325681G>C	ENSP00000317027:p.Thr61Ser	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Glyco_trans_14	p.T61S	ENST00000322348.4	37	c.182	CCDS4026.1	5	.	.	.	.	.	.	.	.	.	.	.	2.044	-0.419352	0.04766	.	.	ENSG00000176928	ENST00000322348	T	0.07800	3.16	5.95	5.07	0.68467	.	0.583665	0.17411	N	0.175174	T	0.07143	0.0181	L	0.29908	0.895	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.35226	-0.9797	10	0.07644	T	0.81	-2.7901	15.3876	0.74714	0.0:0.2635:0.7365:0.0	.	61	Q9P109	GCNT4_HUMAN	S	61	ENSP00000317027:T61S	ENSP00000317027:T61S	T	-	2	0	GCNT4	74361437	0.355000	0.24921	0.818000	0.32626	0.988000	0.76386	1.223000	0.32527	1.486000	0.48398	0.655000	0.94253	ACT	GCNT4	-	NULL	ENSG00000176928		0.393	GCNT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GCNT4	HGNC	protein_coding	OTTHUMT00000254040.1	108	0.00	0	G	NM_016591		74325681	74325681	-1	no_errors	ENST00000322348	ensembl	human	known	69_37n	missense	72	31.43	33	SNP	0.129	C
GHRHR	2692	genome.wustl.edu	37	7	31014652	31014652	+	Silent	SNP	C	C	G	rs375674796		TCGA-A2-A0D2-01A-21W-A050-09	TCGA-A2-A0D2-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	05656575-69e7-4745-a89d-ca0568eb5559	c830c663-95f6-40e0-9fd6-16586fa7d344	g.chr7:31014652C>G	ENST00000326139.2	+	9	925	c.879C>G	c.(877-879)gtC>gtG	p.V293V	GHRHR_ENST00000409904.3_Silent_p.V229V|GHRHR_ENST00000461424.1_3'UTR|GHRHR_ENST00000409316.1_Missense_Mutation_p.R60G	NM_000823.3	NP_000814.2	Q02643	GHRHR_HUMAN	growth hormone releasing hormone receptor	293					activation of adenylate cyclase activity (GO:0007190)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|cAMP-mediated signaling (GO:0019933)|cell maturation (GO:0048469)|cellular response to insulin stimulus (GO:0032869)|determination of adult lifespan (GO:0008340)|growth hormone secretion (GO:0030252)|hormone metabolic process (GO:0042445)|lactation (GO:0007595)|multicellular organismal reproductive process (GO:0048609)|positive regulation of cAMP biosynthetic process (GO:0030819)|positive regulation of cell proliferation (GO:0008284)|positive regulation of growth hormone secretion (GO:0060124)|positive regulation of insulin-like growth factor receptor signaling pathway (GO:0043568)|positive regulation of multicellular organism growth (GO:0040018)|regulation of intracellular steroid hormone receptor signaling pathway (GO:0033143)|regulation of protein metabolic process (GO:0051246)|response to estrogen (GO:0043627)|response to glucocorticoid (GO:0051384)|response to insulin (GO:0032868)|somatotropin secreting cell development (GO:0060133)|water homeostasis (GO:0030104)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|nuclear inner membrane (GO:0005637)|nuclear matrix (GO:0016363)|nuclear outer membrane (GO:0005640)|plasma membrane (GO:0005886)|secretory granule (GO:0030141)	G-protein coupled receptor activity (GO:0004930)|growth factor binding (GO:0019838)|growth hormone-releasing hormone receptor activity (GO:0016520)|peptide hormone binding (GO:0017046)	p.V293V(1)		biliary_tract(1)|breast(3)|endometrium(2)|kidney(1)|large_intestine(3)|lung(18)|ovary(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	35					Sermorelin(DB00010)|Tesamorelin(DB08869)	TCCTCTCGGTCGGGGTCAGTC	0.577											OREG0017943	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP											1	Substitution - coding silent(1)	breast(1)											135.0	118.0	124.0					7																	31014652		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS5432.1	7p14	2012-08-10			ENSG00000106128	ENSG00000106128		"""GPCR / Class B : Glucagon receptors"""	4266	protein-coding gene	gene with protein product		139191				7680413, 7514564	Standard	NM_000823		Approved		uc003tbx.3	Q02643	OTTHUMG00000152801	ENST00000326139.2:c.879C>G	7.37:g.31014652C>G		Somatic	821	WXS	Illumina GAIIx	Phase_IV	Q99863	Missense_Mutation	SNP	NULL	p.R81G	ENST00000326139.2	37	c.241	CCDS5432.1	7	.	.	.	.	.	.	.	.	.	.	T	2.837	-0.241271	0.05906	.	.	ENSG00000106128	ENST00000409233;ENST00000409316	.	.	.	5.14	-6.9	0.01655	.	.	.	.	.	T	0.33585	0.0868	.	.	.	0.80722	D	1	B	0.06786	0.001	B	0.04013	0.001	T	0.03008	-1.1083	7	0.25106	T	0.35	.	6.6549	0.22982	0.0:0.2082:0.3201:0.4717	.	60	Q9HB43	.	G	81;60	.	ENSP00000386919:R81G	R	+	1	2	GHRHR	30981177	0.413000	0.25400	0.849000	0.33467	0.004000	0.04260	-0.547000	0.06055	-1.050000	0.03230	-2.795000	0.00115	CGG	GHRHR	-	NULL	ENSG00000106128		0.577	GHRHR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GHRHR	HGNC	protein_coding	OTTHUMT00000327967.2	497	0.00	0	C			31014652	31014652	+1	no_errors	ENST00000409233	ensembl	human	putative	69_37n	missense	142	32.06	67	SNP	0.780	G
GLYATL2	219970	genome.wustl.edu	37	11	58602060	58602060	+	Missense_Mutation	SNP	A	A	G			TCGA-A2-A0D2-01A-21W-A050-09	TCGA-A2-A0D2-10A-01W-A055-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	05656575-69e7-4745-a89d-ca0568eb5559	c830c663-95f6-40e0-9fd6-16586fa7d344	g.chr11:58602060A>G	ENST00000287275.1	-	6	1117	c.727T>C	c.(727-729)Tat>Cat	p.Y243H	GLYATL2_ENST00000533636.1_5'Flank|GLYATL2_ENST00000532258.1_Missense_Mutation_p.Y243H	NM_145016.3	NP_659453.3	Q8WU03	GLYL2_HUMAN	glycine-N-acyltransferase-like 2	243						endoplasmic reticulum (GO:0005783)|mitochondrion (GO:0005739)	glycine N-acyltransferase activity (GO:0047961)	p.Y243H(1)		breast(1)|kidney(1)|large_intestine(3)|lung(12)|ovary(1)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)	23		Breast(21;0.0044)|all_epithelial(135;0.0216)			Glycine(DB00145)	TCAAGATGATAACCAATTTGC	0.398																																						dbGAP											1	Substitution - Missense(1)	breast(1)											109.0	108.0	108.0					11																	58602060		1994	4165	6159	-	-	-	SO:0001583	missense	0			AF426250	CCDS41649.1	11q12.1	2008-02-05				ENSG00000156689			24178	protein-coding gene	gene with protein product		614762				12477932	Standard	NM_145016		Approved	BXMAS2-10, MGC24009	uc001nnd.4	Q8WU03		ENST00000287275.1:c.727T>C	11.37:g.58602060A>G	ENSP00000287275:p.Tyr243His	Somatic		WXS	Illumina GAIIx	Phase_IV	A5LGC7|Q86WC3|Q96AT2	Missense_Mutation	SNP	pfam_Glycine_N-acyltransferase_N,pfam_Glycine_N-acyltransferase_C,pfam_FR47,superfamily_Acyl_CoA_acyltransferase	p.Y243H	ENST00000287275.1	37	c.727	CCDS41649.1	11	.	.	.	.	.	.	.	.	.	.	A	5.436	0.265487	0.10294	.	.	ENSG00000156689	ENST00000287275;ENST00000532258	T;T	0.16597	2.33;2.33	3.73	-0.612	0.11597	Acyl-CoA N-acyltransferase (2);Glycine N-acyltransferase, C-terminal (1);	1.626520	0.03767	U	0.259108	T	0.13884	0.0336	L	0.49350	1.555	0.09310	N	1	P	0.47302	0.893	B	0.39119	0.291	T	0.31194	-0.9952	10	0.15952	T	0.53	.	4.685	0.12754	0.5095:0.3724:0.1181:0.0	.	243	Q8WU03	GLYL2_HUMAN	H	243	ENSP00000287275:Y243H;ENSP00000434277:Y243H	ENSP00000287275:Y243H	Y	-	1	0	GLYATL2	58358636	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.376000	0.07465	0.326000	0.23384	-0.479000	0.04858	TAT	GLYATL2	-	pfam_Glycine_N-acyltransferase_C,pfam_FR47,superfamily_Acyl_CoA_acyltransferase	ENSG00000156689		0.398	GLYATL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GLYATL2	HGNC	protein_coding	OTTHUMT00000394599.1	203	0.00	0	A	NM_145016		58602060	58602060	-1	no_errors	ENST00000287275	ensembl	human	known	69_37n	missense	221	27.06	82	SNP	0.000	G
HDAC9	9734	genome.wustl.edu	37	7	19035653	19035653	+	Missense_Mutation	SNP	G	G	A			TCGA-A2-A0D2-01A-21W-A050-09	TCGA-A2-A0D2-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	05656575-69e7-4745-a89d-ca0568eb5559	c830c663-95f6-40e0-9fd6-16586fa7d344	g.chr7:19035653G>A	ENST00000441542.2	+	25	3178	c.3178G>A	c.(3178-3180)Ggt>Agt	p.G1060S	HDAC9_ENST00000401921.1_Missense_Mutation_p.G1016S|HDAC9_ENST00000406451.4_Missense_Mutation_p.G1057S	NM_178425.2	NP_848512.1	Q9UKV0	HDAC9_HUMAN	histone deacetylase 9	0					B cell activation (GO:0042113)|B cell differentiation (GO:0030183)|cellular response to insulin stimulus (GO:0032869)|heart development (GO:0007507)|histone deacetylation (GO:0016575)|histone H3 deacetylation (GO:0070932)|histone H4 deacetylation (GO:0070933)|inflammatory response (GO:0006954)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|Notch signaling pathway (GO:0007219)|peptidyl-lysine deacetylation (GO:0034983)|positive regulation of cell migration involved in sprouting angiogenesis (GO:0090050)|regulation of skeletal muscle fiber development (GO:0048742)|regulation of striated muscle cell differentiation (GO:0051153)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|histone deacetylase complex (GO:0000118)|histone methyltransferase complex (GO:0035097)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	histone deacetylase activity (GO:0004407)|histone deacetylase binding (GO:0042826)|metal ion binding (GO:0046872)|NAD-dependent histone deacetylase activity (H3-K14 specific) (GO:0032041)|NAD-dependent histone deacetylase activity (H3-K18 specific) (GO:0097372)|NAD-dependent histone deacetylase activity (H3-K9 specific) (GO:0046969)|NAD-dependent histone deacetylase activity (H4-K16 specific) (GO:0046970)|protein deacetylase activity (GO:0033558)|protein kinase C binding (GO:0005080)|repressing transcription factor binding (GO:0070491)|transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)	p.G1060S(2)		breast(3)|central_nervous_system(4)|cervix(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(18)|liver(2)|lung(37)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	82	all_lung(11;0.187)				Valproic Acid(DB00313)	CAGAACTGCTGGTGAGCCTAT	0.443																																						dbGAP											2	Substitution - Missense(2)	breast(2)											142.0	145.0	144.0					7																	19035653		1962	4142	6104	-	-	-	SO:0001583	missense	0			AF124924	CCDS47553.1, CCDS47554.1, CCDS47555.1, CCDS47557.1, CCDS56465.1, CCDS56466.1, CCDS56467.1, CCDS56468.1, CCDS75565.1	7p21.1	2008-05-15			ENSG00000048052	ENSG00000048052			14065	protein-coding gene	gene with protein product		606543				10523670, 10487760	Standard	NM_178425		Approved	KIAA0744, HDAC, MITR, HD7, HDAC7B	uc003sui.3	Q9UKV0	OTTHUMG00000152487	ENST00000441542.2:c.3178G>A	7.37:g.19035653G>A	ENSP00000408617:p.Gly1060Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	A7E2F3|B7Z4I4|B7Z917|B7Z928|B7Z940|C9JS87|E7EX34|F8W9E0|O94845|O95028|Q2M2R6|Q86SL1|Q86US3	Missense_Mutation	SNP	pfam_His_deacetylse_dom,pfam_Hist_deacetylase_Gln_rich_N,pirsf_Histone_deAcase_II_euk,prints_His_deacetylse	p.G1060S	ENST00000441542.2	37	c.3178	CCDS47553.1	7	.	.	.	.	.	.	.	.	.	.	G	17.55	3.418607	0.62622	.	.	ENSG00000048052	ENST00000406451;ENST00000401921;ENST00000441542	T;T;T	0.57107	0.43;0.42;0.43	5.94	4.0	0.46444	.	0.458821	0.20081	N	0.099655	T	0.40196	0.1107	L	0.28274	0.84	0.80722	D	1	B;P;B;B	0.37330	0.215;0.59;0.288;0.288	B;B;B;B	0.33690	0.101;0.168;0.168;0.168	T	0.46005	-0.9222	10	0.66056	D	0.02	-17.2901	14.7634	0.69621	0.0:0.0:0.7369:0.2631	.	305;1016;1060;1057	Q8N926;Q9UKV0-6;Q9UKV0-7;Q9UKV0-5	.;.;.;.	S	1057;1016;1060	ENSP00000384657:G1057S;ENSP00000383912:G1016S;ENSP00000408617:G1060S	ENSP00000383912:G1016S	G	+	1	0	HDAC9	19002178	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.709000	0.68384	1.473000	0.48159	0.557000	0.71058	GGT	HDAC9	-	pirsf_Histone_deAcase_II_euk	ENSG00000048052		0.443	HDAC9-021	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	HDAC9	HGNC	protein_coding	OTTHUMT00000376088.1	592	0.00	0	G			19035653	19035653	+1	no_errors	ENST00000441542	ensembl	human	known	69_37n	missense	381	26.45	137	SNP	1.000	A
HECTD4	283450	genome.wustl.edu	37	12	112623045	112623046	+	Frame_Shift_Ins	INS	-	-	C	rs368404348		TCGA-A2-A0D2-01A-21W-A050-09	TCGA-A2-A0D2-10A-01W-A055-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	05656575-69e7-4745-a89d-ca0568eb5559	c830c663-95f6-40e0-9fd6-16586fa7d344	g.chr12:112623045_112623046insC	ENST00000430131.2	-	60	9603_9604	c.8458_8459insG	c.(8458-8460)gcgfs	p.A2820fs	HECTD4_ENST00000550722.1_Frame_Shift_Ins_p.A3096fs|HECTD4_ENST00000377560.5_Frame_Shift_Ins_p.A3070fs			Q9Y4D8	HECD4_HUMAN	HECT domain containing E3 ubiquitin protein ligase 4	2820					glucose homeostasis (GO:0042593)|glucose metabolic process (GO:0006006)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)										Accggccgccgcccccccggag	0.639																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			AK091473		12q24.13	2013-07-17	2012-08-14	2012-08-14	ENSG00000173064	ENSG00000173064			26611	protein-coding gene	gene with protein product			"""chromosome 12 open reading frame 51"""	C12orf51		21270382	Standard	NM_001109662		Approved	FLJ34154, KIAA0614	uc021reb.1	Q9Y4D8	OTTHUMG00000150719	ENST00000430131.2:c.8459dupG	12.37:g.112623052_112623052dupC	ENSP00000404379:p.Ala2820fs	Somatic		WXS	Illumina GAIIx	Phase_IV	L8B0P6|Q3MJD5|Q6P0A0|Q7L530|Q8NB70|Q8WU73|Q96NT9|Q9NZS4|Q9UFT6	Frame_Shift_Ins	INS	pfam_HECT,superfamily_HECT,superfamily_ConA-like_lec_gl,smart_HECT,pfscan_HECT	p.A3070fs	ENST00000430131.2	37	c.9209_9208		12																																																																																			HECTD4	-	NULL	ENSG00000173064		0.639	HECTD4-202	KNOWN	basic	protein_coding	HECTD4	HGNC	protein_coding		18	0.00	0	-	NM_173813		112623045	112623046	-1	no_errors	ENST00000377560	ensembl	human	known	69_37n	frame_shift_ins	9	25.00	3	INS	0.000:0.001	C
IMPG1	3617	genome.wustl.edu	37	6	76657075	76657075	+	Missense_Mutation	SNP	T	T	C			TCGA-A2-A0D2-01A-21W-A050-09	TCGA-A2-A0D2-10A-01W-A055-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	05656575-69e7-4745-a89d-ca0568eb5559	c830c663-95f6-40e0-9fd6-16586fa7d344	g.chr6:76657075T>C	ENST00000369950.3	-	14	2189	c.2000A>G	c.(1999-2001)cAa>cGa	p.Q667R	IMPG1_ENST00000369963.3_3'UTR	NM_001282368.1|NM_001563.2	NP_001269297.1|NP_001554.2			interphotoreceptor matrix proteoglycan 1									p.Q667R(1)		breast(5)|cervix(1)|endometrium(7)|kidney(2)|large_intestine(8)|lung(27)|ovary(2)|pancreas(1)|prostate(1)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	63		Acute lymphoblastic leukemia(125;0.0418)|all_hematologic(105;0.222)				CAGATGGAGTTGTTGGGCTGC	0.418																																					Pancreas(37;839 1141 2599 26037)	dbGAP											1	Substitution - Missense(1)	breast(1)											116.0	105.0	109.0					6																	76657075		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF017776	CCDS4985.1, CCDS75483.1	6q14.2-q15	2008-02-05	2004-05-25		ENSG00000112706	ENSG00000112706			6055	protein-coding gene	gene with protein product		602870	"""sialoprotein associated with cones and rods"""	SPACR			Standard	NM_001282368		Approved	IPM150, GP147	uc003pik.1	Q17R60	OTTHUMG00000015063	ENST00000369950.3:c.2000A>G	6.37:g.76657075T>C	ENSP00000358966:p.Gln667Arg	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_SEA,smart_SEA,pfscan_EG-like_dom,pfscan_SEA	p.Q667R	ENST00000369950.3	37	c.2000	CCDS4985.1	6	.	.	.	.	.	.	.	.	.	.	T	0.011	-1.722764	0.00700	.	.	ENSG00000112706	ENST00000369950	T	0.32272	1.46	5.86	3.36	0.38483	SEA (2);	0.570277	0.16508	N	0.211353	T	0.03564	0.0102	N	0.16368	0.405	0.09310	N	1	B	0.09022	0.002	B	0.09377	0.004	T	0.45026	-0.9289	10	0.02654	T	1	.	4.3373	0.11092	0.2497:0.1353:0.0:0.615	.	667	Q17R60	IMPG1_HUMAN	R	667	ENSP00000358966:Q667R	ENSP00000358966:Q667R	Q	-	2	0	IMPG1	76713795	0.000000	0.05858	0.013000	0.15412	0.010000	0.07245	-0.170000	0.09897	0.420000	0.25954	0.528000	0.53228	CAA	IMPG1	-	pfam_SEA,smart_SEA	ENSG00000112706		0.418	IMPG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IMPG1	HGNC	protein_coding	OTTHUMT00000041288.1	201	0.00	0	T	NM_001563		76657075	76657075	-1	no_errors	ENST00000369950	ensembl	human	known	69_37n	missense	164	20.00	41	SNP	0.001	C
INPP4B	8821	genome.wustl.edu	37	4	143129611	143129611	+	Missense_Mutation	SNP	G	G	C			TCGA-A2-A0D2-01A-21W-A050-09	TCGA-A2-A0D2-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	05656575-69e7-4745-a89d-ca0568eb5559	c830c663-95f6-40e0-9fd6-16586fa7d344	g.chr4:143129611G>C	ENST00000513000.1	-	15	1472	c.1039C>G	c.(1039-1041)Caa>Gaa	p.Q347E	INPP4B_ENST00000508116.1_Missense_Mutation_p.Q347E|INPP4B_ENST00000308502.4_Missense_Mutation_p.Q347E|INPP4B_ENST00000262992.4_Missense_Mutation_p.Q347E|INPP4B_ENST00000509777.1_Missense_Mutation_p.Q347E	NM_003866.2	NP_003857.2	O15327	INP4B_HUMAN	inositol polyphosphate-4-phosphatase, type II, 105kDa	347					cellular calcium ion homeostasis (GO:0006874)|inositol phosphate metabolic process (GO:0043647)|negative regulation of osteoclast differentiation (GO:0045671)|phosphatidylinositol biosynthetic process (GO:0006661)|phospholipid metabolic process (GO:0006644)|regulation of bone remodeling (GO:0046850)|regulation of nucleocytoplasmic transport (GO:0046822)|regulation of protein kinase B signaling (GO:0051896)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|Golgi apparatus (GO:0005794)	lipid binding (GO:0008289)|phosphatidylinositol trisphosphate phosphatase activity (GO:0034594)|phosphatidylinositol-3,4-bisphosphate 4-phosphatase activity (GO:0016316)|phosphatidylinositol-4,5-bisphosphate 4-phosphatase activity (GO:0034597)	p.Q347E(1)		breast(3)|central_nervous_system(1)|endometrium(7)|kidney(1)|large_intestine(8)|lung(29)|ovary(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	58	all_hematologic(180;0.158)					TGCATTCTTTGCAGATGTAGA	0.333																																						dbGAP											1	Substitution - Missense(1)	breast(1)											108.0	108.0	108.0					4																	143129611		2203	4300	6503	-	-	-	SO:0001583	missense	0			U96922	CCDS3757.1	4q31.1	2008-02-05	2002-08-29			ENSG00000109452			6075	protein-coding gene	gene with protein product		607494	"""inositol polyphosphate-4-phosphatase, type II, 105kD"""			9295334	Standard	NM_003866		Approved		uc003iiw.4	O15327		ENST00000513000.1:c.1039C>G	4.37:g.143129611G>C	ENSP00000425487:p.Gln347Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q2TAI2|Q5XLE7|Q6IN59|Q6PJB4	Missense_Mutation	SNP	superfamily_C2_Ca/lipid-bd_dom_CaLB	p.Q347E	ENST00000513000.1	37	c.1039	CCDS3757.1	4	.	.	.	.	.	.	.	.	.	.	G	22.5	4.298320	0.81025	.	.	ENSG00000109452	ENST00000513000;ENST00000262992;ENST00000308502;ENST00000543161;ENST00000508116;ENST00000509777;ENST00000511838;ENST00000542702;ENST00000510812;ENST00000514525	T;T;T;T;T;T;T;T	0.36157	1.27;1.27;1.27;1.27;1.27;1.27;1.27;1.27	5.71	5.71	0.89125	.	0.000000	0.85682	D	0.000000	T	0.62708	0.2450	M	0.76727	2.345	0.58432	D	0.999999	D;D	0.76494	0.982;0.999	D;D	0.80764	0.968;0.994	T	0.64980	-0.6279	10	0.87932	D	0	.	18.6248	0.91333	0.0:0.0:1.0:0.0	.	218;347	B7Z6T2;O15327	.;INP4B_HUMAN	E	347;347;347;218;347;347;162;162;347;218	ENSP00000425487:Q347E;ENSP00000262992:Q347E;ENSP00000308441:Q347E;ENSP00000423954:Q347E;ENSP00000422793:Q347E;ENSP00000426207:Q162E;ENSP00000427250:Q347E;ENSP00000421065:Q218E	ENSP00000262992:Q347E	Q	-	1	0	INPP4B	143349061	1.000000	0.71417	0.998000	0.56505	0.910000	0.53928	7.315000	0.78998	2.695000	0.91970	0.555000	0.69702	CAA	INPP4B	-	NULL	ENSG00000109452		0.333	INPP4B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	INPP4B	HGNC	protein_coding	OTTHUMT00000364587.1	146	0.00	0	G	NM_003866		143129611	143129611	-1	no_errors	ENST00000509777	ensembl	human	known	69_37n	missense	156	22.39	45	SNP	1.000	C
KLHL6	89857	genome.wustl.edu	37	3	183225935	183225935	+	Missense_Mutation	SNP	G	G	A	rs535540527		TCGA-A2-A0D2-01A-21W-A050-09	TCGA-A2-A0D2-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	05656575-69e7-4745-a89d-ca0568eb5559	c830c663-95f6-40e0-9fd6-16586fa7d344	g.chr3:183225935G>A	ENST00000341319.3	-	3	856	c.821C>T	c.(820-822)aCg>aTg	p.T274M		NM_130446.2	NP_569713.2	Q8WZ60	KLHL6_HUMAN	kelch-like family member 6	274	BACK.				B cell receptor signaling pathway (GO:0050853)|germinal center formation (GO:0002467)			p.T274M(2)		breast(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(7)|kidney(1)|large_intestine(6)|liver(1)|lung(16)|ovary(2)|prostate(1)|skin(2)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	44	all_cancers(143;9.2e-12)|Ovarian(172;0.0172)		all cancers(12;1.29e-44)|Epithelial(37;1.24e-38)|LUSC - Lung squamous cell carcinoma(7;2.58e-24)|Lung(8;1.79e-22)|OV - Ovarian serous cystadenocarcinoma(80;2.32e-22)			TGCTTCCACCGTCTCCACAAA	0.567													G|||	1	0.000199681	0.0	0.0014	5008	,	,		19297	0.0		0.0	False		,,,				2504	0.0					dbGAP											2	Substitution - Missense(2)	large_intestine(1)|breast(1)											127.0	118.0	121.0					3																	183225935		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF441792	CCDS3245.2	3q27.3	2013-01-30	2013-01-30		ENSG00000172578	ENSG00000172578		"""Kelch-like"", ""BTB/POZ domain containing"""	18653	protein-coding gene	gene with protein product	"""kelch-like protein KLHL6"""	614214	"""kelch-like 6 (Drosophila)"""			11214971, 12617994	Standard	NM_130446		Approved	FLJ00029	uc003flr.3	Q8WZ60	OTTHUMG00000148673	ENST00000341319.3:c.821C>T	3.37:g.183225935G>A	ENSP00000341342:p.Thr274Met	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RB31|D3DNS8|Q8N5I1|Q8N892	Missense_Mutation	SNP	pfam_Kelch_1,pfam_BACK,pfam_BTB_POZ,pfam_Kelch_2,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_BACK,smart_Kelch_1,pirsf_Kelch-like_gigaxonin,pfscan_BTB/POZ-like	p.T274M	ENST00000341319.3	37	c.821	CCDS3245.2	3	.	.	.	.	.	.	.	.	.	.	G	16.30	3.083221	0.55861	.	.	ENSG00000172578	ENST00000341319	T	0.69175	-0.38	5.24	2.16	0.27623	BTB/Kelch-associated (2);	0.424545	0.29087	N	0.013182	T	0.68044	0.2958	L	0.60957	1.885	0.31509	N	0.663815	D	0.67145	0.996	P	0.58013	0.831	T	0.66492	-0.5910	10	0.31617	T	0.26	.	5.0533	0.14520	0.2563:0.0:0.6034:0.1403	.	274	Q8WZ60	KLHL6_HUMAN	M	274	ENSP00000341342:T274M	ENSP00000341342:T274M	T	-	2	0	KLHL6	184708629	0.141000	0.22595	0.925000	0.36789	0.979000	0.70002	0.526000	0.22971	0.305000	0.22832	0.655000	0.94253	ACG	KLHL6	-	pfam_BACK,smart_BACK,pirsf_Kelch-like_gigaxonin	ENSG00000172578		0.567	KLHL6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KLHL6	HGNC	protein_coding	OTTHUMT00000309024.1	282	0.00	0	G	NM_130446		183225935	183225935	-1	no_errors	ENST00000341319	ensembl	human	known	69_37n	missense	92	49.73	92	SNP	0.924	A
LAMP2	3920	genome.wustl.edu	37	X	119562414	119562414	+	IGR	SNP	G	G	C			TCGA-A2-A0D2-01A-21W-A050-09	TCGA-A2-A0D2-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	05656575-69e7-4745-a89d-ca0568eb5559	c830c663-95f6-40e0-9fd6-16586fa7d344	g.chrX:119562414G>C	ENST00000200639.4	-	0	1867				LAMP2_ENST00000434600.2_Silent_p.G387G|LAMP2_ENST00000538785.1_Silent_p.G276G			P13473	LAMP2_HUMAN	lysosomal-associated membrane protein 2						blood coagulation (GO:0007596)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|protein stabilization (GO:0050821)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|late endosome (GO:0005770)|late endosome membrane (GO:0031902)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|membrane (GO:0016020)|phagocytic vesicle membrane (GO:0030670)|plasma membrane (GO:0005886)|platelet dense granule membrane (GO:0031088)	enzyme binding (GO:0019899)	p.G387G(1)		endometrium(4)|large_intestine(2)|lung(5)|ovary(2)|urinary_tract(2)	15						TTATAAGGAAGCCCAAGGCCA	0.388																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											80.0	66.0	70.0					X																	119562414		1568	3582	5150	-	-	-	SO:0001628	intergenic_variant	0			X77196	CCDS14599.1, CCDS14600.1, CCDS48159.1	Xq24-q25	2014-09-17			ENSG00000005893	ENSG00000005893		"""CD molecules"""	6501	protein-coding gene	gene with protein product		309060					Standard	NM_002294		Approved	CD107b	uc004ess.4	P13473	OTTHUMG00000022301		X.37:g.119562414G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K4X5|D3DTF0|Q16641|Q6Q3G8|Q96J30|Q99534|Q9UD93	Silent	SNP	pfam_Lysosome-assoc_membr_glycop,prints_Lysosome-assoc_membr_glycop	p.G387	ENST00000200639.4	37	c.1161	CCDS14599.1	X																																																																																			LAMP2	-	pfam_Lysosome-assoc_membr_glycop,prints_Lysosome-assoc_membr_glycop	ENSG00000005893		0.388	LAMP2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	LAMP2	HGNC	protein_coding	OTTHUMT00000058099.1	189	0.00	0	G			119562414	119562414	-1	no_errors	ENST00000434600	ensembl	human	known	69_37n	silent	239	21.38	65	SNP	1.000	C
LRFN2	57497	genome.wustl.edu	37	6	40400824	40400824	+	Missense_Mutation	SNP	G	G	A			TCGA-A2-A0D2-01A-21W-A050-09	TCGA-A2-A0D2-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	05656575-69e7-4745-a89d-ca0568eb5559	c830c663-95f6-40e0-9fd6-16586fa7d344	g.chr6:40400824G>A	ENST00000338305.6	-	2	571	c.29C>T	c.(28-30)gCg>gTg	p.A10V		NM_020737.1	NP_065788.1	Q9ULH4	LRFN2_HUMAN	leucine rich repeat and fibronectin type III domain containing 2	10						cell junction (GO:0030054)|integral component of membrane (GO:0016021)|postsynaptic membrane (GO:0045211)		p.A10V(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(13)|lung(25)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	58	Ovarian(28;0.0418)|Colorectal(47;0.196)					CATGCCAAACGCTAGCAGGCC	0.592																																						dbGAP											1	Substitution - Missense(1)	breast(1)											35.0	37.0	36.0					6																	40400824		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB033072	CCDS34443.1	6p21.2-p21.1	2013-02-11	2004-02-02	2004-02-04	ENSG00000156564	ENSG00000156564		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	21226	protein-coding gene	gene with protein product	"""fibronectin type III, immunoglobulin and leucine rich repeat domains 2"""	612808	"""KIAA1246"""	KIAA1246, SALM1		16495444, 16828986	Standard	NM_020737		Approved	FIGLER2	uc003oph.1	Q9ULH4	OTTHUMG00000014662	ENST00000338305.6:c.29C>T	6.37:g.40400824G>A	ENSP00000345985:p.Ala10Val	Somatic		WXS	Illumina GAIIx	Phase_IV	A5PKU3|Q5SYP9	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Leu-rich_rpt,pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C,smart_Ig_sub,smart_Ig_sub2,pfscan_Fibronectin_type3,pfscan_Ig-like	p.A10V	ENST00000338305.6	37	c.29	CCDS34443.1	6	.	.	.	.	.	.	.	.	.	.	G	10.49	1.363924	0.24684	.	.	ENSG00000156564	ENST00000338305	T	0.54675	0.56	5.67	4.79	0.61399	.	0.248012	0.40908	D	0.000995	T	0.04815	0.0130	N	0.00317	-1.655	0.31582	N	0.655039	B	0.09022	0.002	B	0.04013	0.001	T	0.36383	-0.9750	10	0.07030	T	0.85	.	6.5723	0.22545	0.2262:0.0:0.7738:0.0	.	10	Q9ULH4	LRFN2_HUMAN	V	10	ENSP00000345985:A10V	ENSP00000345985:A10V	A	-	2	0	LRFN2	40508802	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	6.229000	0.72294	2.697000	0.92050	0.655000	0.94253	GCG	LRFN2	-	NULL	ENSG00000156564		0.592	LRFN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRFN2	HGNC	protein_coding	OTTHUMT00000040488.1	38	0.00	0	G	XM_166372		40400824	40400824	-1	no_errors	ENST00000338305	ensembl	human	known	69_37n	missense	11	52.17	12	SNP	1.000	A
LRRC8C	84230	genome.wustl.edu	37	1	90178433	90178433	+	Missense_Mutation	SNP	G	G	C			TCGA-A2-A0D2-01A-21W-A050-09	TCGA-A2-A0D2-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	05656575-69e7-4745-a89d-ca0568eb5559	c830c663-95f6-40e0-9fd6-16586fa7d344	g.chr1:90178433G>C	ENST00000370454.4	+	3	559	c.304G>C	c.(304-306)Gat>Cat	p.D102H	LRRC8C_ENST00000479252.1_Intron|RP11-302M6.4_ENST00000370453.5_Intron	NM_032270.4	NP_115646	Q8TDW0	LRC8C_HUMAN	leucine rich repeat containing 8 family, member C	102					fat cell differentiation (GO:0045444)|ion transport (GO:0006811)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)		p.D102H(1)		breast(1)|central_nervous_system(1)|large_intestine(5)|lung(10)|ovary(3)|pancreas(1)|prostate(1)|skin(5)|urinary_tract(1)	28		all_lung(203;0.126)		all cancers(265;0.00756)|Epithelial(280;0.0313)		CCTGAAGACAGATTTGGACCT	0.473																																						dbGAP											1	Substitution - Missense(1)	breast(1)											121.0	113.0	115.0					1																	90178433		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS725.1	1p22.2	2011-02-10			ENSG00000171488	ENSG00000171488			25075	protein-coding gene	gene with protein product	"""hypothetical protein AD158"""	612889				11230166	Standard	NM_032270		Approved	AD158	uc001dnl.4	Q8TDW0	OTTHUMG00000010305	ENST00000370454.4:c.304G>C	1.37:g.90178433G>C	ENSP00000359483:p.Asp102His	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KXS9|Q29RV6|Q9H075	Missense_Mutation	SNP	pfam_LRR_protein-8_N,pfam_Leu-rich_rpt,smart_Leu-rich_rpt_typical-subtyp	p.D102H	ENST00000370454.4	37	c.304	CCDS725.1	1	.	.	.	.	.	.	.	.	.	.	G	16.80	3.222391	0.58560	.	.	ENSG00000171488	ENST00000370454	T	0.24538	1.85	5.96	5.05	0.67936	Leucine-rich repeat-containing protein 8, N-terminal (1);	0.086938	0.85682	D	0.000000	T	0.22781	0.0550	N	0.24115	0.695	0.34748	D	0.731462	P	0.52463	0.953	P	0.60345	0.873	T	0.12400	-1.0549	10	0.72032	D	0.01	.	15.2794	0.73770	0.0672:0.0:0.9328:0.0	.	102	Q8TDW0	LRC8C_HUMAN	H	102	ENSP00000359483:D102H	ENSP00000359483:D102H	D	+	1	0	LRRC8C	89951021	1.000000	0.71417	0.063000	0.19743	0.978000	0.69477	3.809000	0.55606	1.525000	0.49052	0.655000	0.94253	GAT	LRRC8C	-	pfam_LRR_protein-8_N	ENSG00000171488		0.473	LRRC8C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRRC8C	HGNC	protein_coding	OTTHUMT00000028435.2	156	0.64	1	G	NM_032270		90178433	90178433	+1	no_errors	ENST00000370454	ensembl	human	known	69_37n	missense	103	35.22	56	SNP	0.559	C
MAPK6	5597	genome.wustl.edu	37	15	52338804	52338804	+	Missense_Mutation	SNP	G	G	C			TCGA-A2-A0D2-01A-21W-A050-09	TCGA-A2-A0D2-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	05656575-69e7-4745-a89d-ca0568eb5559	c830c663-95f6-40e0-9fd6-16586fa7d344	g.chr15:52338804G>C	ENST00000261845.5	+	2	954	c.147G>C	c.(145-147)aaG>aaC	p.K49N		NM_002748.3	NP_002739.1	Q16659	MK06_HUMAN	mitogen-activated protein kinase 6	49	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cell cycle (GO:0007049)|MAPK cascade (GO:0000165)|protein phosphorylation (GO:0006468)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|MAP kinase activity (GO:0004707)|protein serine/threonine kinase activity (GO:0004674)	p.K49N(1)		breast(3)|endometrium(1)|kidney(3)|large_intestine(3)|lung(7)|ovary(1)|skin(2)	20				all cancers(107;0.0028)		TAGCCATCAAGAAAATTGTCC	0.388																																						dbGAP											1	Substitution - Missense(1)	breast(1)											111.0	110.0	110.0					15																	52338804		2195	4293	6488	-	-	-	SO:0001583	missense	0			L77964	CCDS10147.1	15q21	2011-06-10			ENSG00000069956	ENSG00000069956		"""Mitogen-activated protein kinase cascade / Kinases"""	6879	protein-coding gene	gene with protein product		602904		PRKM6		8875998	Standard	NM_002748		Approved	ERK3, p97MAPK, HsT17250	uc002abp.3	Q16659	OTTHUMG00000131891	ENST00000261845.5:c.147G>C	15.37:g.52338804G>C	ENSP00000261845:p.Lys49Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R945|B5BU65|Q68DH4|Q8IYN8	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom,prints_MAPK_ERK3/4	p.K49N	ENST00000261845.5	37	c.147	CCDS10147.1	15	.	.	.	.	.	.	.	.	.	.	G	18.95	3.730991	0.69074	.	.	ENSG00000069956	ENST00000261845	D	0.85339	-1.97	5.38	5.38	0.77491	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	D	0.96150	0.8745	H	0.99211	4.47	0.80722	D	1	D	0.89917	1.0	D	0.81914	0.995	D	0.98012	1.0366	10	0.87932	D	0	-20.3948	19.2084	0.93744	0.0:0.0:1.0:0.0	.	49	Q16659	MK06_HUMAN	N	49	ENSP00000261845:K49N	ENSP00000261845:K49N	K	+	3	2	MAPK6	50126096	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	5.445000	0.66594	2.556000	0.86216	0.650000	0.86243	AAG	MAPK6	-	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	ENSG00000069956		0.388	MAPK6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAPK6	HGNC	protein_coding	OTTHUMT00000254841.2	240	0.00	0	G	NM_002748		52338804	52338804	+1	no_errors	ENST00000261845	ensembl	human	known	69_37n	missense	240	26.15	85	SNP	1.000	C
MAN2C1	4123	genome.wustl.edu	37	15	75653704	75653704	+	Missense_Mutation	SNP	C	C	T			TCGA-A2-A0D2-01A-21W-A050-09	TCGA-A2-A0D2-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	05656575-69e7-4745-a89d-ca0568eb5559	c830c663-95f6-40e0-9fd6-16586fa7d344	g.chr15:75653704C>T	ENST00000267978.5	-	11	1283	c.1237G>A	c.(1237-1239)Gag>Aag	p.E413K	MAN2C1_ENST00000569482.1_Missense_Mutation_p.E413K|MAN2C1_ENST00000563539.1_5'Flank|MAN2C1_ENST00000563622.1_Missense_Mutation_p.E314K|MAN2C1_ENST00000565683.1_Missense_Mutation_p.E413K	NM_006715.3	NP_006706.2	Q9NTJ4	MA2C1_HUMAN	mannosidase, alpha, class 2C, member 1	413					mannose metabolic process (GO:0006013)		alpha-mannosidase activity (GO:0004559)|carbohydrate binding (GO:0030246)|zinc ion binding (GO:0008270)			central_nervous_system(4)|endometrium(4)|kidney(6)|large_intestine(6)|lung(20)|prostate(1)|stomach(1)|upper_aerodigestive_tract(2)	44						TCCAGGCCCTCCCAGAAAAAT	0.617																																						dbGAP											0													29.0	30.0	30.0					15																	75653704		2180	4280	6460	-	-	-	SO:0001583	missense	0			AF044414	CCDS32298.1, CCDS58389.1, CCDS58390.1, CCDS58391.1	15q24.2	2013-09-19			ENSG00000140400	ENSG00000140400	3.2.1.24		6827	protein-coding gene	gene with protein product		154580		MANA1, MANA		1757461, 752528	Standard	NM_006715		Approved		uc002bah.4	Q9NTJ4	OTTHUMG00000172698	ENST00000267978.5:c.1237G>A	15.37:g.75653704C>T	ENSP00000267978:p.Glu413Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	H3BMX2|H3BQY8|H3BUT6|Q13358|Q68EM8|Q9UL64	Missense_Mutation	SNP	pfam_Glyco_hydro_38_core,pfam_Glyco_hydro_38_C,pfam_Glyco_hydro_38_cen_dom,superfamily_Glyco_hydro-type_carb-bd,superfamily_Glyco_hydro/deAcase_b/a-brl,smart_Glyco_hydro_38_cen_dom	p.E413K	ENST00000267978.5	37	c.1237	CCDS32298.1	15	.	.	.	.	.	.	.	.	.	.	C	17.89	3.500809	0.64298	.	.	ENSG00000140400	ENST00000267978	T	0.79845	-1.31	5.33	4.21	0.49690	Glycoside hydrolase/deacetylase, beta/alpha-barrel (1);Glycoside hydrolase, family 38, core (2);	0.050242	0.85682	D	0.000000	T	0.77280	0.4107	L	0.38838	1.175	0.58432	D	0.999997	B;B;B	0.33919	0.179;0.432;0.285	B;B;B	0.42625	0.173;0.344;0.393	T	0.76828	-0.2815	10	0.41790	T	0.15	-31.8377	13.9647	0.64202	0.0:0.9128:0.0:0.0872	.	195;413;413	B4DVP6;Q68EM8;Q9NTJ4	.;.;MA2C1_HUMAN	K	413	ENSP00000267978:E413K	ENSP00000267978:E413K	E	-	1	0	MAN2C1	73440757	1.000000	0.71417	1.000000	0.80357	0.933000	0.57130	5.514000	0.67043	2.491000	0.84063	0.561000	0.74099	GAG	MAN2C1	-	pfam_Glyco_hydro_38_core,superfamily_Glyco_hydro/deAcase_b/a-brl	ENSG00000140400		0.617	MAN2C1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAN2C1	HGNC	protein_coding	OTTHUMT00000419965.1	83	0.00	0	C			75653704	75653704	-1	no_errors	ENST00000267978	ensembl	human	known	69_37n	missense	31	16.22	6	SNP	1.000	T
MCOLN1	57192	genome.wustl.edu	37	19	7598649	7598649	+	Missense_Mutation	SNP	C	C	G			TCGA-A2-A0D2-01A-21W-A050-09	TCGA-A2-A0D2-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	05656575-69e7-4745-a89d-ca0568eb5559	c830c663-95f6-40e0-9fd6-16586fa7d344	g.chr19:7598649C>G	ENST00000264079.6	+	14	1836	c.1711C>G	c.(1711-1713)Ccc>Gcc	p.P571A	PNPLA6_ENST00000414982.3_5'Flank|CTD-2207O23.10_ENST00000601870.1_Missense_Mutation_p.P22A|PNPLA6_ENST00000450331.3_5'Flank|PNPLA6_ENST00000600737.1_5'Flank|PNPLA6_ENST00000545201.2_5'Flank|PNPLA6_ENST00000221249.6_5'Flank	NM_020533.2	NP_065394.1	Q9GZU1	MCLN1_HUMAN	mucolipin 1	571					calcium ion transmembrane transport (GO:0070588)|cation transport (GO:0006812)|cellular iron ion homeostasis (GO:0006879)|ion transmembrane transport (GO:0034220)|release of sequestered calcium ion into cytosol (GO:0051209)|transferrin transport (GO:0033572)|transmembrane transport (GO:0055085)	cytoplasm (GO:0005737)|endosome membrane (GO:0010008)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	cation channel activity (GO:0005261)|NAADP-sensitive calcium-release channel activity (GO:0072345)	p.P571A(1)		breast(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(6)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	18						CTCCAGGGACCCCTCGGAGGA	0.612																																						dbGAP											1	Substitution - Missense(1)	breast(1)											58.0	52.0	54.0					19																	7598649		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF249319	CCDS12180.1	19p13.2	2011-12-16				ENSG00000090674		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	13356	protein-coding gene	gene with protein product		605248				16382100	Standard	NM_020533		Approved	TRPML1, ML4, MLIV, MST080, MSTP080, TRPM-L1	uc002mgo.3	Q9GZU1		ENST00000264079.6:c.1711C>G	19.37:g.7598649C>G	ENSP00000264079:p.Pro571Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	D6W647|Q7Z4F7|Q9H292|Q9H4B3|Q9H4B5	Missense_Mutation	SNP	pfam_PKD1_2_channel,superfamily_Glycoside_hydrolase_SF	p.P571A	ENST00000264079.6	37	c.1711	CCDS12180.1	19	.	.	.	.	.	.	.	.	.	.	C	2.600	-0.293280	0.05568	.	.	ENSG00000090674	ENST00000264079;ENST00000394321	D	0.82984	-1.67	5.51	-6.28	0.02020	.	1.332070	0.05430	N	0.545878	T	0.67221	0.2870	L	0.34521	1.04	0.09310	N	1	B;B	0.11235	0.004;0.0	B;B	0.08055	0.003;0.0	T	0.52793	-0.8528	10	0.10377	T	0.69	.	5.9541	0.19263	0.0825:0.5474:0.1648:0.2053	.	536;571	Q9GZU1-2;Q9GZU1	.;MCLN1_HUMAN	A	571;536	ENSP00000264079:P571A	ENSP00000264079:P571A	P	+	1	0	MCOLN1	7504649	0.000000	0.05858	0.139000	0.22197	0.380000	0.30137	-0.701000	0.05075	-0.596000	0.05821	-1.075000	0.02238	CCC	MCOLN1	-	NULL	ENSG00000090674		0.612	MCOLN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MCOLN1	HGNC	protein_coding	OTTHUMT00000458974.2	96	0.00	0	C	NM_020533		7598649	7598649	+1	no_errors	ENST00000264079	ensembl	human	known	69_37n	missense	18	33.33	9	SNP	0.067	G
KMT2B	9757	genome.wustl.edu	37	19	36229228	36229228	+	Missense_Mutation	SNP	G	G	T			TCGA-A2-A0D2-01A-21W-A050-09	TCGA-A2-A0D2-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	05656575-69e7-4745-a89d-ca0568eb5559	c830c663-95f6-40e0-9fd6-16586fa7d344	g.chr19:36229228G>T	ENST00000222270.7	+	37	7918	c.7918G>T	c.(7918-7920)Gac>Tac	p.D2640Y	KMT2B_ENST00000607650.1_RNA|KMT2B_ENST00000420124.1_Missense_Mutation_p.D2640Y|IGFLR1_ENST00000587101.1_5'Flank	NM_014727.1	NP_055542.1	Q9UMN6	KMT2B_HUMAN	lysine (K)-specific methyltransferase 2B	2640	SET. {ECO:0000255|PROSITE- ProRule:PRU00190}.				chromatin-mediated maintenance of transcription (GO:0048096)|gene silencing (GO:0016458)|histone H3-K4 methylation (GO:0051568)|histone H3-K4 trimethylation (GO:0080182)|oocyte differentiation (GO:0009994)|ovarian follicle development (GO:0001541)|ovulation (GO:0030728)|regulation of histone H3-K4 methylation (GO:0051569)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)	p.D2642Y(1)									TGATGTAGTGGACGCCACGAT	0.582																																						dbGAP											1	Substitution - Missense(1)	breast(1)											77.0	84.0	82.0					19																	36229228		2196	4297	6493	-	-	-	SO:0001583	missense	0			AJ007041	CCDS46055.1	19q13.1	2014-02-18			ENSG00000105663	ENSG00000272333		"""Chromatin-modifying enzymes / K-methyltransferases"""	15840	protein-coding gene	gene with protein product	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila) 4"""	606834				10409430, 10637508	Standard	XM_006723513		Approved	KIAA0304, MLL2, TRX2, HRX2, WBP7, MLL1B, MLL4		Q9UMN6	OTTHUMG00000048119	ENST00000222270.7:c.7918G>T	19.37:g.36229228G>T	ENSP00000222270:p.Asp2640Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV	O15022|O95836|Q96GP2|Q96IP3|Q9UK25|Q9Y668|Q9Y669	Missense_Mutation	SNP	pirsf_MeTrfase_trithorax,pfam_SET_dom,pfam_FYrich_C,pfam_Znf_PHD-finger,pfam_FYrich_N,pfam_Znf_CXXC,superfamily_Znf_FYVE_PHD,superfamily_Bromodomain,smart_Znf_PHD,smart_FYrich_N,smart_FYrich_C,smart_SET_dom,smart_Post-SET_dom,pfscan_SET_dom,pfscan_Post-SET_dom,pfscan_Znf_PHD-finger,pfscan_Znf_CXXC	p.D2640Y	ENST00000222270.7	37	c.7918	CCDS46055.1	19	.	.	.	.	.	.	.	.	.	.	G	14.21	2.468005	0.43839	.	.	ENSG00000105663	ENST00000222270;ENST00000420124	D;D	0.85629	-2.01;-2.01	5.42	5.42	0.78866	SET domain (3);	0.000000	0.46145	D	0.000308	D	0.96231	0.8771	H	0.99391	4.545	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.98208	1.0471	10	0.87932	D	0	.	17.9826	0.89146	0.0:0.0:1.0:0.0	.	2640	Q9UMN6	MLL4_HUMAN	Y	2640	ENSP00000222270:D2640Y;ENSP00000398837:D2640Y	ENSP00000222270:D2640Y	D	+	1	0	AD000671.1	40921068	1.000000	0.71417	1.000000	0.80357	0.538000	0.34931	9.869000	0.99810	2.551000	0.86045	0.462000	0.41574	GAC	MLL4	-	pirsf_MeTrfase_trithorax,pfam_SET_dom,smart_SET_dom,pfscan_SET_dom	ENSG00000105663		0.582	KMT2B-201	KNOWN	basic|appris_principal|CCDS	protein_coding	MLL4	Clone_based_vega_gene	protein_coding		153	0.00	0	G	NM_014727		36229228	36229228	+1	no_errors	ENST00000222270	ensembl	human	known	69_37n	missense	69	28.12	27	SNP	1.000	T
MOV10L1	54456	genome.wustl.edu	37	22	50580592	50580592	+	Missense_Mutation	SNP	C	C	G			TCGA-A2-A0D2-01A-21W-A050-09	TCGA-A2-A0D2-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	05656575-69e7-4745-a89d-ca0568eb5559	c830c663-95f6-40e0-9fd6-16586fa7d344	g.chr22:50580592C>G	ENST00000262794.5	+	16	2236	c.2153C>G	c.(2152-2154)cCc>cGc	p.P718R	MOV10L1_ENST00000540615.1_Missense_Mutation_p.P698R|MOV10L1_ENST00000395843.1_5'UTR|MOV10L1_ENST00000545383.1_Missense_Mutation_p.P718R|MOV10L1_ENST00000395858.3_Missense_Mutation_p.P718R	NM_018995.2	NP_061868.1	Q9BXT6	M10L1_HUMAN	Mov10 RISC complex RNA helicase like 1	718					ATP catabolic process (GO:0006200)|germ cell development (GO:0007281)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	intracellular (GO:0005622)	ATP binding (GO:0005524)|ATP-dependent RNA helicase activity (GO:0004004)|magnesium ion binding (GO:0000287)|RNA binding (GO:0003723)	p.P698R(1)|p.P718R(1)		breast(2)|endometrium(2)|kidney(5)|large_intestine(18)|lung(20)|ovary(3)|prostate(1)|skin(9)|stomach(4)|urinary_tract(3)	67		all_cancers(38;3.31e-11)|all_epithelial(38;5.69e-10)|all_lung(38;3.73e-05)|Breast(42;0.000525)|Lung NSC(38;0.000954)|Ovarian(80;0.0367)|Lung SC(80;0.114)		LUAD - Lung adenocarcinoma(64;0.0215)|BRCA - Breast invasive adenocarcinoma(115;0.24)		GTGCTGGCACCCTTTACTGCA	0.527											OREG0026672	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP											2	Substitution - Missense(2)	breast(2)											84.0	68.0	73.0					22																	50580592		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF285604	CCDS14084.1, CCDS54541.1, CCDS54542.1, CCDS54543.1	22q13.33	2014-07-02	2014-07-02		ENSG00000073146	ENSG00000073146			7201	protein-coding gene	gene with protein product	"""cardiac helicase activated by MEF2C protein"""	605794	"""Mov10 (mouse)-like 1"", ""Mov10l1, Moloney leukemia virus 10-like 1, homolog (mouse)"""			11279525	Standard	NM_018995		Approved	DJ402G11.8, DKFZp434B0717, CHAMP	uc003bjj.3	Q9BXT6	OTTHUMG00000044648	ENST00000262794.5:c.2153C>G	22.37:g.50580592C>G	ENSP00000262794:p.Pro718Arg	Somatic	970	WXS	Illumina GAIIx	Phase_IV	A7E211|A8MXC6|B7WPP1|B7Z7R1|F5H403|Q5TGD5|Q8NBD4|Q9NXW3|Q9UFB3|Q9UGX9	Missense_Mutation	SNP	superfamily_NA-bd_OB-fold-like	p.P718R	ENST00000262794.5	37	c.2153	CCDS14084.1	22	.	.	.	.	.	.	.	.	.	.	C	5.068	0.198271	0.09652	.	.	ENSG00000073146	ENST00000545383;ENST00000262794;ENST00000395858;ENST00000540615	D;D;T;D	0.85339	-1.77;-1.77;-1.35;-1.97	3.15	3.15	0.36227	.	1.269580	0.05104	N	0.487783	T	0.74442	0.3717	N	0.19112	0.55	0.38694	D	0.952835	P;B;B;B	0.38420	0.63;0.279;0.025;0.025	B;B;B;B	0.32211	0.142;0.055;0.016;0.016	T	0.66901	-0.5806	10	0.30854	T	0.27	-11.0578	10.0678	0.42315	0.0:1.0:0.0:0.0	.	479;698;718;718	B7Z893;F5H403;A8MXC6;Q9BXT6	.;.;.;M10L1_HUMAN	R	718;718;718;698	ENSP00000438978:P718R;ENSP00000262794:P718R;ENSP00000379199:P718R;ENSP00000438542:P698R	ENSP00000262794:P718R	P	+	2	0	MOV10L1	48922719	0.003000	0.15002	0.003000	0.11579	0.001000	0.01503	2.322000	0.43814	2.083000	0.62718	0.591000	0.81541	CCC	MOV10L1	-	NULL	ENSG00000073146		0.527	MOV10L1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MOV10L1	HGNC	protein_coding	OTTHUMT00000075009.2	117	0.85	1	C	NM_018995		50580592	50580592	+1	no_errors	ENST00000262794	ensembl	human	known	69_37n	missense	31	35.42	17	SNP	0.003	G
MSH4	4438	genome.wustl.edu	37	1	76365305	76365305	+	Silent	SNP	T	T	C			TCGA-A2-A0D2-01A-21W-A050-09	TCGA-A2-A0D2-10A-01W-A055-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	05656575-69e7-4745-a89d-ca0568eb5559	c830c663-95f6-40e0-9fd6-16586fa7d344	g.chr1:76365305T>C	ENST00000263187.3	+	19	2637	c.2533T>C	c.(2533-2535)Tta>Cta	p.L845L		NM_002440.3	NP_002431.2	O15457	MSH4_HUMAN	mutS homolog 4	845					ATP catabolic process (GO:0006200)|chiasma assembly (GO:0051026)|female gamete generation (GO:0007292)|homologous chromosome segregation (GO:0045143)|mismatch repair (GO:0006298)|ovarian follicle development (GO:0001541)|reciprocal meiotic recombination (GO:0007131)|spermatogenesis (GO:0007283)	nucleus (GO:0005634)|synaptonemal complex (GO:0000795)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA-dependent ATPase activity (GO:0008094)|mismatched DNA binding (GO:0030983)	p.L845L(1)		breast(1)|endometrium(2)|kidney(4)|large_intestine(9)|lung(26)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)	47						AATTCTAGGATTAAAAGCTGC	0.318								Mismatch excision repair (MMR)																														dbGAP											1	Substitution - coding silent(1)	breast(1)											79.0	85.0	83.0					1																	76365305		2203	4298	6501	-	-	-	SO:0001819	synonymous_variant	0			U89293	CCDS670.1	1p31	2013-09-12	2013-09-12		ENSG00000057468	ENSG00000057468			7327	protein-coding gene	gene with protein product		602105	"""mutS (E. coli) homolog 4"", ""mutS homolog 4 (E. coli)"""			9299235	Standard	NM_002440		Approved		uc001dhd.2	O15457	OTTHUMG00000009788	ENST00000263187.3:c.2533T>C	1.37:g.76365305T>C		Somatic		WXS	Illumina GAIIx	Phase_IV	Q5T4U6|Q8NEB3|Q9UNP8	Silent	SNP	pfam_DNA_mismatch_repair_MutS_C,pfam_DNA_mismatch_repair_MutS_core,pfam_DNA_mismatch_repair_MutS_connt,pfam_DNA_mismatch_repair_MutS_clamp,superfamily_DNA_mismatch_repair_MutS_core,superfamily_DNA_mismatch_repair_MutS_connt,smart_DNA_mismatch_repair_MutS_core,smart_DNA_mismatch_repair_MutS_C	p.L845	ENST00000263187.3	37	c.2533	CCDS670.1	1																																																																																			MSH4	-	pfam_DNA_mismatch_repair_MutS_C,smart_DNA_mismatch_repair_MutS_C	ENSG00000057468		0.318	MSH4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MSH4	HGNC	protein_coding	OTTHUMT00000026983.1	103	0.00	0	T	NM_002440		76365305	76365305	+1	no_errors	ENST00000263187	ensembl	human	known	69_37n	silent	115	15.44	21	SNP	0.971	C
MTMR8	55613	genome.wustl.edu	37	X	63548744	63548744	+	Missense_Mutation	SNP	C	C	A			TCGA-A2-A0D2-01A-21W-A050-09	TCGA-A2-A0D2-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	05656575-69e7-4745-a89d-ca0568eb5559	c830c663-95f6-40e0-9fd6-16586fa7d344	g.chrX:63548744C>A	ENST00000374852.3	-	12	1456	c.1389G>T	c.(1387-1389)ttG>ttT	p.L463F	MTMR8_ENST00000453546.1_Intron|MTMR8_ENST00000478487.1_5'Flank	NM_017677.3	NP_060147.2	Q96EF0	MTMR8_HUMAN	myotubularin related protein 8	463	Myotubularin phosphatase. {ECO:0000255|PROSITE-ProRule:PRU00669}.					nucleus (GO:0005634)	protein tyrosine phosphatase activity (GO:0004725)	p.L463F(1)|p.0?(1)		breast(5)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(8)|lung(10)|ovary(2)|skin(3)	37						TCCTCTGAACCAAGAAAGGCC	0.398																																						dbGAP											2	Substitution - Missense(1)|Whole gene deletion(1)	ovary(1)|breast(1)											96.0	82.0	87.0					X																	63548744		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK000133	CCDS14379.1	Xq11.2-q12	2013-01-11			ENSG00000102043	ENSG00000102043		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Myotubularins"""	16825	protein-coding gene	gene with protein product						11275328	Standard	NM_017677		Approved	FLJ20126	uc004dvs.3	Q96EF0	OTTHUMG00000021707	ENST00000374852.3:c.1389G>T	X.37:g.63548744C>A	ENSP00000363985:p.Leu463Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5JT99|Q9NXP6	Missense_Mutation	SNP	pfam_Myotub-related,smart_Tyr_Pase_cat	p.L463F	ENST00000374852.3	37	c.1389	CCDS14379.1	X	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	14.88|14.88	2.668078|2.668078	0.47677|0.47677	.|.	.|.	ENSG00000102043|ENSG00000102043	ENST00000442913|ENST00000374852;ENST00000247400	.|D	.|0.90900	.|-2.75	2.93|2.93	2.93|2.93	0.34026|0.34026	.|Myotubularin phosphatase domain (1);	.|0.000000	.|0.32901	.|U	.|0.005515	D|D	0.86719|0.86719	0.6000|0.6000	L|L	0.56396|0.56396	1.775|1.775	0.80722|0.80722	D|D	1|1	.|P	.|0.40197	.|0.706	.|B	.|0.38194	.|0.267	D|D	0.86261|0.86261	0.1655|0.1655	5|10	.|0.66056	.|D	.|0.02	.|.	8.4005|8.4005	0.32583|0.32583	0.0:0.5883:0.4117:0.0|0.0:0.5883:0.4117:0.0	.|.	.|463	.|Q96EF0	.|MTMR8_HUMAN	C|F	267|463;349	.|ENSP00000363985:L463F	.|ENSP00000247400:L349F	G|L	-|-	1|3	0|2	MTMR8|MTMR8	63465469|63465469	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.996000|0.996000	0.88848|0.88848	0.496000|0.496000	0.22499|0.22499	1.466000|1.466000	0.48025|0.48025	0.506000|0.506000	0.49869|0.49869	GGT|TTG	MTMR8	-	NULL	ENSG00000102043		0.398	MTMR8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MTMR8	HGNC	protein_coding	OTTHUMT00000056949.2	500	0.00	0	C	NM_017677		63548744	63548744	-1	no_errors	ENST00000374852	ensembl	human	known	69_37n	missense	562	22.16	160	SNP	0.998	A
OR52R1	119695	genome.wustl.edu	37	11	4825420	4825420	+	Missense_Mutation	SNP	A	A	T			TCGA-A2-A0D2-01A-21W-A050-09	TCGA-A2-A0D2-10A-01W-A055-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	05656575-69e7-4745-a89d-ca0568eb5559	c830c663-95f6-40e0-9fd6-16586fa7d344	g.chr11:4825420A>T	ENST00000356069.2	-	1	190	c.191T>A	c.(190-192)cTc>cAc	p.L64H	MMP26_ENST00000477339.1_Intron|MMP26_ENST00000380390.1_Intron|OR52R1_ENST00000380382.1_Missense_Mutation_p.L143H	NM_001005177.3	NP_001005177.3	Q8NGF1	O52R1_HUMAN	olfactory receptor, family 52, subfamily R, member 1	64						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.L143H(1)|p.L63H(1)		breast(1)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(14)|prostate(1)|skin(3)	29		Medulloblastoma(188;0.0025)|Breast(177;0.0184)|all_neural(188;0.0227)		Epithelial(150;4.77e-12)|BRCA - Breast invasive adenocarcinoma(625;0.00435)|LUSC - Lung squamous cell carcinoma(625;0.19)		GGCCAGAAAGAGGTACATGGG	0.498																																						dbGAP											2	Substitution - Missense(2)	breast(2)											105.0	93.0	97.0					11																	4825420		2201	4298	6499	-	-	-	SO:0001583	missense	0			BK004282	CCDS31360.1, CCDS31360.2	11p15.4	2012-08-09			ENSG00000176937	ENSG00000176937		"""GPCR / Class A : Olfactory receptors"""	15235	protein-coding gene	gene with protein product							Standard	NM_001005177		Approved		uc021qcs.1	Q8NGF1	OTTHUMG00000066510	ENST00000356069.2:c.191T>A	11.37:g.4825420A>T	ENSP00000348368:p.Leu64His	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6IFI0	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.L143H	ENST00000356069.2	37	c.428	CCDS31360.2	11	.	.	.	.	.	.	.	.	.	.	A	13.77	2.336286	0.41398	.	.	ENSG00000176937	ENST00000356069;ENST00000380382	T;T	0.00534	6.74;6.74	5.57	3.12	0.35913	GPCR, rhodopsin-like superfamily (1);	0.000000	0.44483	D	0.000456	T	0.00724	0.0024	M	0.69358	2.11	0.32548	N	0.532794	B	0.21225	0.053	B	0.21151	0.033	T	0.07597	-1.0764	10	0.66056	D	0.02	.	10.2145	0.43160	0.7369:0.0:0.0:0.2631	.	64	Q8NGF1	O52R1_HUMAN	H	64;143	ENSP00000348368:L64H;ENSP00000369742:L143H	ENSP00000348368:L64H	L	-	2	0	OR52R1	4781996	0.006000	0.16342	0.997000	0.53966	0.706000	0.40770	2.325000	0.43840	1.104000	0.41587	0.528000	0.53228	CTC	OR52R1	-	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam,prints_7TM_GPCR_Rhodpsn	ENSG00000176937		0.498	OR52R1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR52R1	HGNC	protein_coding	OTTHUMT00000142183.1	211	0.00	0	A	NM_001005177		4825420	4825420	-1	no_errors	ENST00000380382	ensembl	human	known	69_37n	missense	96	25.38	33	SNP	0.992	T
OR10Q1	219960	genome.wustl.edu	37	11	57995968	57995968	+	Missense_Mutation	SNP	T	T	A			TCGA-A2-A0D2-01A-21W-A050-09	TCGA-A2-A0D2-10A-01W-A055-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	05656575-69e7-4745-a89d-ca0568eb5559	c830c663-95f6-40e0-9fd6-16586fa7d344	g.chr11:57995968T>A	ENST00000316770.2	-	1	422	c.380A>T	c.(379-381)tAt>tTt	p.Y127F		NM_001004471.2	NP_001004471.1	Q8NGQ4	O10Q1_HUMAN	olfactory receptor, family 10, subfamily Q, member 1	127						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.Y127F(1)		autonomic_ganglia(1)|breast(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(26)|ovary(2)	35		Breast(21;0.0589)				GATAGCCACATAGCGGTCATA	0.607																																						dbGAP											1	Substitution - Missense(1)	breast(1)											88.0	74.0	79.0					11																	57995968		2201	4295	6496	-	-	-	SO:0001583	missense	0			AB065735	CCDS31547.1	11q12.1	2012-08-09			ENSG00000180475	ENSG00000180475		"""GPCR / Class A : Olfactory receptors"""	15134	protein-coding gene	gene with protein product							Standard	NM_001004471		Approved		uc010rkd.2	Q8NGQ4	OTTHUMG00000167542	ENST00000316770.2:c.380A>T	11.37:g.57995968T>A	ENSP00000314324:p.Tyr127Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6IFG4	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.Y127F	ENST00000316770.2	37	c.380	CCDS31547.1	11	.	.	.	.	.	.	.	.	.	.	T	7.418	0.636063	0.14386	.	.	ENSG00000180475	ENST00000316770	T	0.54675	0.56	4.45	3.3	0.37823	GPCR, rhodopsin-like superfamily (1);	0.196371	0.25172	N	0.032585	T	0.36524	0.0970	L	0.35542	1.07	0.24894	N	0.992143	B	0.27594	0.182	B	0.25291	0.059	T	0.21518	-1.0243	10	0.41790	T	0.15	.	5.8888	0.18896	0.1485:0.084:0.0:0.7675	.	127	Q8NGQ4	O10Q1_HUMAN	F	127	ENSP00000314324:Y127F	ENSP00000314324:Y127F	Y	-	2	0	OR10Q1	57752544	0.999000	0.42202	0.010000	0.14722	0.057000	0.15508	3.287000	0.51732	0.720000	0.32209	0.455000	0.32223	TAT	OR10Q1	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_7TM_GPCR_Rhodpsn	ENSG00000180475		0.607	OR10Q1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR10Q1	HGNC	protein_coding	OTTHUMT00000394706.1	372	0.00	0	T	NM_001004471		57995968	57995968	-1	no_errors	ENST00000316770	ensembl	human	known	69_37n	missense	197	23.35	60	SNP	0.985	A
PAAF1	80227	genome.wustl.edu	37	11	73627700	73627700	+	Silent	SNP	T	T	C			TCGA-A2-A0D2-01A-21W-A050-09	TCGA-A2-A0D2-10A-01W-A055-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	05656575-69e7-4745-a89d-ca0568eb5559	c830c663-95f6-40e0-9fd6-16586fa7d344	g.chr11:73627700T>C	ENST00000310571.3	+	9	983	c.930T>C	c.(928-930)agT>agC	p.S310S	PAAF1_ENST00000544552.1_Silent_p.S293S|PAAF1_ENST00000536003.1_Silent_p.S293S|PAAF1_ENST00000541951.1_Silent_p.S195S|PAAF1_ENST00000535604.1_Silent_p.S195S|PAAF1_ENST00000544909.1_Silent_p.S311S|PAAF1_ENST00000376384.5_Silent_p.S293S	NM_025155.2	NP_079431.1	Q9BRP4	PAAF1_HUMAN	proteasomal ATPase-associated factor 1	310					viral process (GO:0016032)	proteasome complex (GO:0000502)		p.S310S(1)		breast(3)|endometrium(1)|kidney(1)|large_intestine(3)|lung(9)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	24	Breast(11;7.42e-05)					ATGTGAGGAGTCCAAGGTGAG	0.403																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											117.0	104.0	108.0					11																	73627700		2200	4293	6493	-	-	-	SO:0001819	synonymous_variant	0			BC006142	CCDS8226.1, CCDS58157.1, CCDS58158.1	11q13.4	2013-05-21	2007-08-16	2007-08-16	ENSG00000175575	ENSG00000175575		"""WD repeat domain containing"""	25687	protein-coding gene	gene with protein product			"""WD repeat domain 71"""	WDR71		15831487, 17317272, 17289585	Standard	NM_001267803		Approved	FLJ11848, Rpn14	uc001ouk.2	Q9BRP4	OTTHUMG00000168062	ENST00000310571.3:c.930T>C	11.37:g.73627700T>C		Somatic		WXS	Illumina GAIIx	Phase_IV	A6NDR5|B4DPB0|B7ZAS9|Q4G165|Q53HS9|Q7Z500|Q8TBU6|Q9HAB6	Silent	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,prints_G-protein_beta_WD-40_rep	p.S310	ENST00000310571.3	37	c.930	CCDS8226.1	11																																																																																			PAAF1	-	superfamily_WD40_repeat_dom	ENSG00000175575		0.403	PAAF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PAAF1	HGNC	protein_coding	OTTHUMT00000397885.1	101	0.00	0	T	NM_025155		73627700	73627700	+1	no_errors	ENST00000310571	ensembl	human	known	69_37n	silent	102	25.00	34	SNP	0.563	C
PABPC4	8761	genome.wustl.edu	37	1	40027754	40027754	+	Silent	SNP	G	G	C	rs369911540		TCGA-A2-A0D2-01A-21W-A050-09	TCGA-A2-A0D2-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	05656575-69e7-4745-a89d-ca0568eb5559	c830c663-95f6-40e0-9fd6-16586fa7d344	g.chr1:40027754G>C	ENST00000372857.3	-	14	2628	c.1836C>G	c.(1834-1836)ctC>ctG	p.L612L	PABPC4_ENST00000372856.3_Silent_p.L599L|PABPC4_ENST00000372862.3_Silent_p.L583L|PABPC4_ENST00000372858.3_Silent_p.L628L	NM_003819.3	NP_003810.1	Q13310	PABP4_HUMAN	poly(A) binding protein, cytoplasmic 4 (inducible form)	612	PABC. {ECO:0000255|PROSITE- ProRule:PRU00641}.				blood coagulation (GO:0007596)|RNA catabolic process (GO:0006401)|RNA processing (GO:0006396)|translation (GO:0006412)	cytoplasm (GO:0005737)|cytoplasmic stress granule (GO:0010494)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	nucleotide binding (GO:0000166)|poly(A) binding (GO:0008143)|poly(A) RNA binding (GO:0044822)|poly(U) RNA binding (GO:0008266)	p.L612L(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(5)|liver(1)|lung(6)|prostate(1)|skin(3)	21	Lung NSC(20;1.55e-06)|Ovarian(52;0.00769)|all_hematologic(146;0.0501)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;2.89e-18)|Epithelial(16;6.17e-17)|all cancers(16;1.18e-15)|LUSC - Lung squamous cell carcinoma(16;0.000261)|Lung(16;0.000457)			CCTTGGAGCGGAGAGACTCGG	0.547																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											46.0	45.0	46.0					1																	40027754		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			U33818	CCDS438.1, CCDS44114.1, CCDS44115.1	1p34.2	2013-02-12	2001-11-28		ENSG00000090621	ENSG00000090621		"""RNA binding motif (RRM) containing"""	8557	protein-coding gene	gene with protein product		603407	"""poly(A)-binding protein, cytoplasmic 4 (inducible form)"""			10543404	Standard	NM_001135653		Approved	iPABP, APP-1	uc001cdl.2	Q13310	OTTHUMG00000009097	ENST00000372857.3:c.1836C>G	1.37:g.40027754G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	B1ANQ8|Q4VC03|Q6P0N3	Missense_Mutation	SNP	pfam_PABP_HYD,superfamily_PABP_HYD,smart_PABP_HYD	p.S36C	ENST00000372857.3	37	c.107	CCDS438.1	1	.	.	.	.	.	.	.	.	.	.	G	9.297	1.052093	0.19827	.	.	ENSG00000090621	ENST00000437136;ENST00000530186;ENST00000421687	.	.	.	5.86	0.379	0.16213	.	.	.	.	.	T	0.50188	0.1601	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.35025	-0.9805	4	.	.	.	.	4.5162	0.11935	0.1262:0.3348:0.4242:0.1148	.	.	.	.	C	167;36;518	.	.	S	-	2	0	PABPC4	39800341	0.999000	0.42202	0.977000	0.42913	0.998000	0.95712	0.606000	0.24194	0.056000	0.16144	0.655000	0.94253	TCC	PABPC4	-	pfam_PABP_HYD,superfamily_PABP_HYD,smart_PABP_HYD	ENSG00000090621		0.547	PABPC4-001	KNOWN	basic|CCDS	protein_coding	PABPC4	HGNC	protein_coding	OTTHUMT00000025220.1	118	0.00	0	G	NM_001135653		40027754	40027754	-1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000530186	ensembl	human	known	69_37n	missense	61	15.28	11	SNP	1.000	C
PAGE5	90737	genome.wustl.edu	37	X	55248235	55248235	+	Missense_Mutation	SNP	G	G	C			TCGA-A2-A0D2-01A-21W-A050-09	TCGA-A2-A0D2-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	05656575-69e7-4745-a89d-ca0568eb5559	c830c663-95f6-40e0-9fd6-16586fa7d344	g.chrX:55248235G>C	ENST00000289619.5	+	3	422	c.177G>C	c.(175-177)gaG>gaC	p.E59D	PAGE5_ENST00000374952.1_Missense_Mutation_p.E39D|PAGE5_ENST00000374955.3_Missense_Mutation_p.E39D	NM_130467.3	NP_569734.2	Q96GU1	PAGE5_HUMAN	P antigen family, member 5 (prostate associated)	59								p.E59D(1)		breast(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(3)	8						GTCAAGAAGAGGAACCACCAA	0.433																																						dbGAP											1	Substitution - Missense(1)	breast(1)											113.0	79.0	90.0					X																	55248235		2203	4298	6501	-	-	-	SO:0001583	missense	0			AJ344352	CCDS14368.1, CCDS35306.1	Xp11.22	2009-08-18			ENSG00000158639	ENSG00000158639			29992	protein-coding gene	gene with protein product	"""cancer/testis antigen family 16, member 1"", ""cancer/testis antigen family 16, member 2"""					11920606, 11992404	Standard	XM_006724613		Approved	PAGE-5, CT16.1, CT16.2	uc004duk.3	Q96GU1	OTTHUMG00000021650	ENST00000289619.5:c.177G>C	X.37:g.55248235G>C	ENSP00000289619:p.Glu59Asp	Somatic		WXS	Illumina GAIIx	Phase_IV	Q2NL97|Q5JUL0|Q8WWL9	Missense_Mutation	SNP	pfam_GAGE	p.E59D	ENST00000289619.5	37	c.177	CCDS14368.1	X	.	.	.	.	.	.	.	.	.	.	.	12.55	1.970589	0.34754	.	.	ENSG00000158639	ENST00000289619;ENST00000374955;ENST00000374952	T;T;T	0.12361	2.69;2.69;2.69	1.09	1.09	0.20402	.	.	.	.	.	T	0.30324	0.0761	M	0.80982	2.52	0.09310	N	1	D	0.67145	0.996	P	0.62885	0.908	T	0.06162	-1.0842	9	0.56958	D	0.05	.	5.1669	0.15090	0.0:0.0:1.0:0.0	.	59	Q96GU1	GGEE1_HUMAN	D	59;39;39	ENSP00000289619:E59D;ENSP00000364093:E39D;ENSP00000364090:E39D	ENSP00000289619:E59D	E	+	3	2	PAGE5	55264960	0.000000	0.05858	0.001000	0.08648	0.112000	0.19704	-0.178000	0.09782	0.822000	0.34565	0.279000	0.19357	GAG	PAGE5	-	pfam_GAGE	ENSG00000158639		0.433	PAGE5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PAGE5	HGNC	protein_coding	OTTHUMT00000056861.1	751	0.00	0	G	NM_130467		55248235	55248235	+1	no_errors	ENST00000289619	ensembl	human	known	69_37n	missense	513	22.74	151	SNP	0.001	C
PBRM1	55193	genome.wustl.edu	37	3	52651338	52651338	+	Missense_Mutation	SNP	C	C	T			TCGA-A2-A0D2-01A-21W-A050-09	TCGA-A2-A0D2-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	05656575-69e7-4745-a89d-ca0568eb5559	c830c663-95f6-40e0-9fd6-16586fa7d344	g.chr3:52651338C>T	ENST00000296302.7	-	14	1759	c.1758G>A	c.(1756-1758)atG>atA	p.M586I	PBRM1_ENST00000410007.1_Missense_Mutation_p.M586I|PBRM1_ENST00000356770.4_Missense_Mutation_p.M554I|PBRM1_ENST00000409767.1_Missense_Mutation_p.M601I|PBRM1_ENST00000394830.3_Missense_Mutation_p.M586I|PBRM1_ENST00000409114.3_Missense_Mutation_p.M601I|PBRM1_ENST00000409057.1_Missense_Mutation_p.M586I|PBRM1_ENST00000337303.4_Missense_Mutation_p.M586I			Q86U86	PB1_HUMAN	polybromo 1	586	Bromo 4. {ECO:0000255|PROSITE- ProRule:PRU00035}.				chromatin remodeling (GO:0006338)|heart development (GO:0007507)|mitotic nuclear division (GO:0007067)|negative regulation of cell proliferation (GO:0008285)|placenta development (GO:0001890)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	kinetochore (GO:0000776)|nuclear chromosome (GO:0000228)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)	p.M586I(2)|p.M554I(1)		breast(5)|endometrium(5)|kidney(301)|liver(1)|lung(22)|pancreas(1)	335				BRCA - Breast invasive adenocarcinoma(193;1.8e-05)|Kidney(197;0.00105)|KIRC - Kidney renal clear cell carcinoma(197;0.00122)|OV - Ovarian serous cystadenocarcinoma(275;0.0613)		TGTCTTCTATCATTCCCTCTT	0.448			"""Mis, N, F, S, D, O"""		"""clear cell renal carcinoma, breast"""																																	dbGAP		Rec	yes		3	3p21	55193	polybromo 1		E	3	Substitution - Missense(3)	breast(3)											116.0	106.0	109.0					3																	52651338		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC015323	CCDS43099.1	3p21	2007-03-29			ENSG00000163939	ENSG00000163939			30064	protein-coding gene	gene with protein product		606083				11078522, 11483580	Standard	NM_018313		Approved	BAF180, PB1	uc003der.2	Q86U86	OTTHUMG00000152663	ENST00000296302.7:c.1758G>A	3.37:g.52651338C>T	ENSP00000296302:p.Met586Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	A1L381|A1L382|A4FUJ7|Q1RMD1|Q1RMD2|Q96MS2|Q9H2T3|Q9H2T4|Q9H2T5|Q9H301|Q9H314	Missense_Mutation	SNP	pfam_Bromodomain,pfam_BAH_dom,pfam_HMG_superfamily,superfamily_Bromodomain,superfamily_HMG_superfamily,smart_Bromodomain,smart_BAH_dom,smart_HMG_superfamily,pfscan_BAH_dom,pfscan_HMG_superfamily,pfscan_Bromodomain,prints_Bromodomain	p.M586I	ENST00000296302.7	37	c.1758		3	.	.	.	.	.	.	.	.	.	.	C	16.98	3.271859	0.59649	.	.	ENSG00000163939	ENST00000356770;ENST00000394830;ENST00000296302;ENST00000337303;ENST00000409057;ENST00000410007;ENST00000409114;ENST00000409767;ENST00000423351;ENST00000446103	T;T;T;T;T;T;T;T;T;T	0.27720	1.65;1.65;1.65;1.65;1.65;1.65;1.65;1.65;1.65;1.65	5.84	5.84	0.93424	Bromodomain (5);Bromodomain, conserved site (1);	0.000000	0.85682	D	0.000000	T	0.50548	0.1622	L	0.45228	1.405	0.58432	D	0.999998	B;B;P;B;B;B;B;B;P	0.44986	0.184;0.288;0.518;0.093;0.031;0.288;0.108;0.028;0.847	B;B;P;B;B;B;B;B;D	0.67103	0.129;0.323;0.768;0.095;0.026;0.238;0.086;0.038;0.949	T	0.15752	-1.0426	10	0.34782	T	0.22	-18.2278	20.139	0.98050	0.0:1.0:0.0:0.0	.	586;586;586;586;601;601;586;554;586	Q86U86-9;Q86U86-6;Q86U86-4;Q86U86-2;Q86U86-8;Q86U86-7;Q86U86;Q86U86-3;Q86U86-5	.;.;.;.;.;.;PB1_HUMAN;.;.	I	554;586;586;586;586;586;601;601;586;545	ENSP00000349213:M554I;ENSP00000378307:M586I;ENSP00000296302:M586I;ENSP00000338302:M586I;ENSP00000386593:M586I;ENSP00000386529:M586I;ENSP00000386643:M601I;ENSP00000386601:M601I;ENSP00000387775:M586I;ENSP00000397662:M545I	ENSP00000296302:M586I	M	-	3	0	PBRM1	52626378	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	4.838000	0.62803	2.764000	0.94973	0.655000	0.94253	ATG	PBRM1	-	pfam_Bromodomain,superfamily_Bromodomain,smart_Bromodomain,pfscan_Bromodomain	ENSG00000163939		0.448	PBRM1-008	KNOWN	basic|appris_candidate_longest	protein_coding	PBRM1	HGNC	protein_coding	OTTHUMT00000327232.1	195	0.00	0	C	NM_018165		52651338	52651338	-1	no_errors	ENST00000296302	ensembl	human	known	69_37n	missense	118	28.92	48	SNP	1.000	T
PDZD4	57595	genome.wustl.edu	37	X	153068871	153068871	+	Silent	SNP	G	G	A			TCGA-A2-A0D2-01A-21W-A050-09	TCGA-A2-A0D2-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	05656575-69e7-4745-a89d-ca0568eb5559	c830c663-95f6-40e0-9fd6-16586fa7d344	g.chrX:153068871G>A	ENST00000164640.4	-	8	2438	c.2247C>T	c.(2245-2247)caC>caT	p.H749H	PDZD4_ENST00000544474.1_Silent_p.H640H|PDZD4_ENST00000393758.2_Silent_p.H674H|PDZD4_ENST00000475140.1_5'Flank	NM_032512.2	NP_115901.2	Q76G19	PDZD4_HUMAN	PDZ domain containing 4	749						cytoplasm (GO:0005737)		p.H749H(1)		breast(3)|cervix(1)|endometrium(5)|lung(13)|skin(1)	23	all_lung(58;3.39e-06)|all_hematologic(71;4.25e-06)|Lung NSC(58;4.7e-06)|Acute lymphoblastic leukemia(192;6.56e-05)					AGCGCGCGCCGTGGGCCAGCA	0.622																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											113.0	81.0	92.0					X																	153068871		2200	4298	6498	-	-	-	SO:0001819	synonymous_variant	0			AK091444	CCDS14732.1	Xq28	2008-02-05		2006-01-24	ENSG00000067840	ENSG00000067840			21167	protein-coding gene	gene with protein product		300634		PDZK4		10819331, 15077175	Standard	NM_032512		Approved	KIAA1444, LU1, FLJ34125, PDZRN4L	uc004fiz.1	Q76G19	OTTHUMG00000024209	ENST00000164640.4:c.2247C>T	X.37:g.153068871G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B3KXB1|B7ZKY3|Q8NB75|Q9BUH9|Q9P284	Silent	SNP	pfam_PDZ,superfamily_PDZ,smart_PDZ,pfscan_PDZ	p.H749	ENST00000164640.4	37	c.2247	CCDS14732.1	X																																																																																			PDZD4	-	NULL	ENSG00000067840		0.622	PDZD4-002	KNOWN	basic|appris_principal|CCDS	protein_coding	PDZD4	HGNC	protein_coding	OTTHUMT00000061013.3	19	0.00	0	G	NM_032512		153068871	153068871	-1	no_errors	ENST00000164640	ensembl	human	known	69_37n	silent	8	38.46	5	SNP	0.422	A
PHC1	1911	genome.wustl.edu	37	12	9085307	9085307	+	Silent	SNP	T	T	C			TCGA-A2-A0D2-01A-21W-A050-09	TCGA-A2-A0D2-10A-01W-A055-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	05656575-69e7-4745-a89d-ca0568eb5559	c830c663-95f6-40e0-9fd6-16586fa7d344	g.chr12:9085307T>C	ENST00000543824.1	+	9	1586	c.1254T>C	c.(1252-1254)gcT>gcC	p.A418A	PHC1_ENST00000544916.1_Silent_p.A418A|PHC1_ENST00000433847.2_3'UTR|PHC1_ENST00000433083.2_Silent_p.A373A|PHC1_ENST00000536844.1_Silent_p.A197A			P78364	PHC1_HUMAN	polyhomeotic homolog 1 (Drosophila)	418					cellular response to retinoic acid (GO:0071300)|histone ubiquitination (GO:0016574)|multicellular organismal development (GO:0007275)	nuclear body (GO:0016604)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PcG protein complex (GO:0031519)|PRC1 complex (GO:0035102)|sex chromatin (GO:0001739)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|zinc ion binding (GO:0008270)	p.A418A(1)		breast(2)|cervix(1)|endometrium(5)|large_intestine(8)|liver(2)|lung(3)|ovary(2)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)	27						TTCACACAGCTACACACCTCC	0.607																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											113.0	117.0	115.0					12																	9085307		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			U89277	CCDS8597.1	12p13	2013-01-10	2006-09-12	2002-11-15	ENSG00000111752	ENSG00000111752		"""Sterile alpha motif (SAM) domain containing"""	3182	protein-coding gene	gene with protein product		602978	"""early development regulator 1 (homolog of polyhomeotic 1)"", ""polyhomeotic-like 1 (Drosophila)"""	EDR1		9121482	Standard	XM_005253334		Approved	HPH1, RAE28	uc001qvd.3	P78364	OTTHUMG00000168275	ENST00000543824.1:c.1254T>C	12.37:g.9085307T>C		Somatic		WXS	Illumina GAIIx	Phase_IV	D3DUV4|Q8WVM3|Q9BU63	Missense_Mutation	SNP	NULL	p.L54P	ENST00000543824.1	37	c.161	CCDS8597.1	12	.	.	.	.	.	.	.	.	.	.	T	6.929	0.541113	0.13250	.	.	ENSG00000111752	ENST00000537610	.	.	.	5.18	-8.31	0.01001	.	.	.	.	.	T	0.37625	0.1010	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.42749	-0.9433	4	.	.	.	-4.6579	4.1116	0.10062	0.0838:0.4196:0.1671:0.3295	.	.	.	.	P	54	.	.	L	+	2	0	PHC1	8976574	0.930000	0.31532	0.096000	0.21009	0.939000	0.58152	-0.173000	0.09854	-1.705000	0.01406	-0.256000	0.11100	CTA	PHC1	-	NULL	ENSG00000111752		0.607	PHC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PHC1	HGNC	protein_coding	OTTHUMT00000399115.1	666	0.30	2	T	NM_004426		9085307	9085307	+1	no_start_codon:pseudogene:no_stop_codon	ENST00000537610	ensembl	human	novel	69_37n	missense	219	23.88	69	SNP	0.176	C
PIKFYVE	200576	genome.wustl.edu	37	2	209190734	209190734	+	Missense_Mutation	SNP	C	C	G			TCGA-A2-A0D2-01A-21W-A050-09	TCGA-A2-A0D2-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	05656575-69e7-4745-a89d-ca0568eb5559	c830c663-95f6-40e0-9fd6-16586fa7d344	g.chr2:209190734C>G	ENST00000264380.4	+	20	3357	c.3199C>G	c.(3199-3201)Ctt>Gtt	p.L1067V		NM_015040.3	NP_055855.2	Q9Y2I7	FYV1_HUMAN	phosphoinositide kinase, FYVE finger containing	1067					cellular protein metabolic process (GO:0044267)|intracellular signal transduction (GO:0035556)|myelin assembly (GO:0032288)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol phosphorylation (GO:0046854)|phosphatidylinositol-3-phosphate biosynthetic process (GO:0036092)|phospholipid metabolic process (GO:0006644)|protein localization to nucleus (GO:0034504)|retrograde transport, endosome to Golgi (GO:0042147)|small molecule metabolic process (GO:0044281)	cell-cell junction (GO:0005911)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|early endosome membrane (GO:0031901)|endosome membrane (GO:0010008)|Golgi membrane (GO:0000139)|late endosome membrane (GO:0031902)|membrane raft (GO:0045121)|perinuclear region of cytoplasm (GO:0048471)|vesicle membrane (GO:0012506)	1-phosphatidylinositol-3-phosphate 5-kinase activity (GO:0000285)|1-phosphatidylinositol-4-phosphate 5-kinase activity (GO:0016308)|ATP binding (GO:0005524)|phosphatidylinositol-3,5-bisphosphate 5-phosphatase activity (GO:0043813)|zinc ion binding (GO:0008270)	p.L1067V(1)		NS(1)|autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|endometrium(14)|kidney(6)|large_intestine(25)|lung(40)|ovary(7)|pancreas(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	107						AGAACCCTTTCTTTTAACTGA	0.393																																						dbGAP											1	Substitution - Missense(1)	breast(1)											75.0	80.0	78.0					2																	209190734		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB023198	CCDS2382.1, CCDS33368.1, CCDS54431.1	2q34	2014-01-15	2009-04-17	2009-04-17	ENSG00000115020	ENSG00000115020		"""Zinc fingers, FYVE domain containing"""	23785	protein-coding gene	gene with protein product	"""zinc finger, FYVE domain containing 29"""	609414	"""phosphatidylinositol-3-phosphate/phosphatidylinositol 5-kinase, type III"""	PIP5K3		9858586, 12270933	Standard	NM_015040		Approved	MGC40423, KIAA0981, PIKfyve, PIP5K, p235, ZFYVE29, FAB1	uc002vcz.3	Q9Y2I7	OTTHUMG00000132945	ENST00000264380.4:c.3199C>G	2.37:g.209190734C>G	ENSP00000264380:p.Leu1067Val	Somatic		WXS	Illumina GAIIx	Phase_IV	Q08AR7|Q08AR8|Q53ST3|Q53T36|Q8N5H0|Q8NB67	Missense_Mutation	SNP	pfam_PInositol-4-P-5-kinase_core,pfam_Cpn60/TCP-1,pfam_DEP_dom,pfam_Znf_FYVE,superfamily_Znf_FYVE_PHD,smart_Znf_FYVE,smart_DEP_dom,smart_PInositol-4P-5-kinase_core_sub,pfscan_DEP_dom,pfscan_Znf_FYVE-rel	p.L1067V	ENST00000264380.4	37	c.3199	CCDS2382.1	2	.	.	.	.	.	.	.	.	.	.	C	17.95	3.514854	0.64634	.	.	ENSG00000115020	ENST00000264380;ENST00000392200;ENST00000452564	T;T	0.53423	0.62;0.99	6.17	6.17	0.99709	.	0.000000	0.64402	D	0.000002	T	0.71375	0.3332	M	0.74258	2.255	0.80722	D	1	D;P	0.69078	0.997;0.816	D;B	0.72625	0.978;0.232	T	0.71056	-0.4703	10	0.72032	D	0.01	-18.0027	20.8794	0.99867	0.0:1.0:0.0:0.0	.	1067;1011	Q9Y2I7;E9PDH4	FYV1_HUMAN;.	V	1067;643;1011	ENSP00000264380:L1067V;ENSP00000405736:L1011V	ENSP00000264380:L1067V	L	+	1	0	PIKFYVE	208898979	1.000000	0.71417	1.000000	0.80357	0.883000	0.51084	3.895000	0.56258	2.941000	0.99782	0.655000	0.94253	CTT	PIKFYVE	-	NULL	ENSG00000115020		0.393	PIKFYVE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PIKFYVE	HGNC	protein_coding	OTTHUMT00000256477.2	75	0.00	0	C	NM_015040		209190734	209190734	+1	no_errors	ENST00000264380	ensembl	human	known	69_37n	missense	95	28.89	39	SNP	1.000	G
PLIN4	729359	genome.wustl.edu	37	19	4508875	4508875	+	Missense_Mutation	SNP	G	G	A	rs567007906		TCGA-A2-A0D2-01A-21W-A050-09	TCGA-A2-A0D2-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	05656575-69e7-4745-a89d-ca0568eb5559	c830c663-95f6-40e0-9fd6-16586fa7d344	g.chr19:4508875G>A	ENST00000301286.3	-	4	3564	c.3565C>T	c.(3565-3567)Cgc>Tgc	p.R1189C		NM_001080400.1	NP_001073869.1	Q96Q06	PLIN4_HUMAN	perilipin 4	1189						cytoplasm (GO:0005737)|lipid particle (GO:0005811)|plasma membrane (GO:0005886)		p.R1189C(1)|p.R1117C(1)		NS(2)|breast(4)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(14)|ovary(1)|skin(2)|soft_tissue(1)|stomach(2)	41						GCCCGCTGGCGGAAGCTGGGA	0.632													G|||	1	0.000199681	0.0	0.0014	5008	,	,		15733	0.0		0.0	False		,,,				2504	0.0					dbGAP											2	Substitution - Missense(2)	breast(2)											38.0	48.0	44.0					19																	4508875		2044	4182	6226	-	-	-	SO:0001583	missense	0			AB067468	CCDS45927.1	19p13.3	2009-10-06	2009-08-12	2009-08-12	ENSG00000167676	ENSG00000167676		"""Perilipins"""	29393	protein-coding gene	gene with protein product		613247	"""KIAA1881"""	KIAA1881		11572484, 19638644	Standard	NM_001080400		Approved	S3-12	uc002mar.1	Q96Q06	OTTHUMG00000167571	ENST00000301286.3:c.3565C>T	19.37:g.4508875G>A	ENSP00000301286:p.Arg1189Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NEI2	Missense_Mutation	SNP	pfam_Perilipin,superfamily_Ankyrin_rpt-contain_dom	p.R1189C	ENST00000301286.3	37	c.3565	CCDS45927.1	19	.	.	.	.	.	.	.	.	.	.	G	19.22	3.784606	0.70222	.	.	ENSG00000167676	ENST00000301286	T	0.23754	1.89	5.11	5.11	0.69529	.	0.152789	0.30686	N	0.009092	T	0.50086	0.1595	M	0.76170	2.325	0.46167	D	0.998904	D	0.89917	1.0	D	0.70716	0.97	T	0.53830	-0.8383	10	0.87932	D	0	-12.7898	14.033	0.64627	0.0:0.0:1.0:0.0	.	1189	Q96Q06	PLIN4_HUMAN	C	1189	ENSP00000301286:R1189C	ENSP00000301286:R1189C	R	-	1	0	PLIN4	4459875	0.995000	0.38212	0.998000	0.56505	0.591000	0.36615	6.216000	0.72212	2.367000	0.80283	0.555000	0.69702	CGC	PLIN4	-	pfam_Perilipin	ENSG00000167676		0.632	PLIN4-001	NOVEL	basic|appris_principal|CCDS	protein_coding	PLIN4	HGNC	protein_coding	OTTHUMT00000395095.1	30	0.00	0	G	XM_170901		4508875	4508875	-1	no_errors	ENST00000301286	ensembl	human	novel	69_37n	missense	3	62.50	5	SNP	0.997	A
POTEJ	653781	genome.wustl.edu	37	2	131390121	131390121	+	Missense_Mutation	SNP	G	G	C	rs202134345		TCGA-A2-A0D2-01A-21W-A050-09	TCGA-A2-A0D2-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	05656575-69e7-4745-a89d-ca0568eb5559	c830c663-95f6-40e0-9fd6-16586fa7d344	g.chr2:131390121G>C	ENST00000409602.1	+	9	1242	c.1190G>C	c.(1189-1191)aGt>aCt	p.S397T		NM_001277083.1	NP_001264012.1	P0CG39	POTEJ_HUMAN	POTE ankyrin domain family, member J	397					retina homeostasis (GO:0001895)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)				lung(5)	5						GAAAACCTGAGTAATGGTGTC	0.368																																						dbGAP											0																																										-	-	-	SO:0001583	missense	0				CCDS59432.1	2q21.1	2013-01-10			ENSG00000222038	ENSG00000222038		"""POTE ankyrin domain containing"", ""Ankyrin repeat domain containing"""	37094	protein-coding gene	gene with protein product						16364570	Standard	NM_001277083		Approved	POTE2beta	uc021vor.2	P0CG39	OTTHUMG00000154050	ENST00000409602.1:c.1190G>C	2.37:g.131390121G>C	ENSP00000387176:p.Ser397Thr	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Actin-like,pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,smart_Actin-like,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,prints_Actin-like	p.S397T	ENST00000409602.1	37	c.1190	CCDS59432.1	2	.	.	.	.	.	.	.	.	.	.	.	0.001	-3.281453	0.00020	.	.	ENSG00000222038	ENST00000409602	T	0.13420	2.59	0.427	-0.854	0.10705	.	.	.	.	.	T	0.02649	0.0080	N	0.01168	-0.975	0.09310	N	1	.	.	.	.	.	.	T	0.30995	-0.9959	6	0.02654	T	1	.	.	.	.	.	.	.	.	T	397	ENSP00000387176:S397T	ENSP00000387176:S397T	S	+	2	0	POTEJ	131106591	0.000000	0.05858	0.000000	0.03702	0.006000	0.05464	-1.945000	0.01537	-1.807000	0.01236	-1.041000	0.02371	AGT	POTEJ	-	NULL	ENSG00000222038		0.368	POTEJ-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	POTEJ	HGNC	protein_coding	OTTHUMT00000333665.1	18	0.00	0	G	XM_929706		131390121	131390121	+1	no_errors	ENST00000409602	ensembl	human	novel	69_37n	missense	34	30.00	15	SNP	0.000	C
PRDM7	11105	genome.wustl.edu	37	16	90124710	90124710	+	Missense_Mutation	SNP	C	C	G			TCGA-A2-A0D2-01A-21W-A050-09	TCGA-A2-A0D2-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	05656575-69e7-4745-a89d-ca0568eb5559	c830c663-95f6-40e0-9fd6-16586fa7d344	g.chr16:90124710C>G	ENST00000449207.2	-	10	1485	c.1466G>C	c.(1465-1467)gGt>gCt	p.G489A	PRDM7_ENST00000407825.1_3'UTR|PRDM7_ENST00000325921.6_3'UTR	NM_001098173.1	NP_001091643.1	Q9NQW5	PRDM7_HUMAN	PR domain containing 7	489					regulation of transcription, DNA-templated (GO:0006355)	chromosome (GO:0005694)|nucleus (GO:0005634)	histone-lysine N-methyltransferase activity (GO:0018024)|nucleic acid binding (GO:0003676)	p.G489A(1)		lung(2)|ovary(2)|stomach(1)	5		all_cancers(9;4.44e-13)|Lung NSC(15;1.56e-06)|all_lung(18;2.18e-06)|all_neural(9;0.00118)|all_hematologic(23;0.0194)		BRCA - Breast invasive adenocarcinoma(80;0.0278)		AGAGTTTGGACCTTTCTTTGA	0.473																																						dbGAP											1	Substitution - Missense(1)	breast(1)											49.0	52.0	51.0					16																	90124710		2198	4300	6498	-	-	-	SO:0001583	missense	0			AF274347	CCDS45557.1	16q24.3	2013-01-09			ENSG00000126856	ENSG00000126856		"""Zinc fingers, C2H2-type"", ""-"""	9351	protein-coding gene	gene with protein product		609759				17916234	Standard	NM_001098173		Approved	ZNF910	uc010cje.3	Q9NQW5	OTTHUMG00000138990	ENST00000449207.2:c.1466G>C	16.37:g.90124710C>G	ENSP00000396732:p.Gly489Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	A4Q9G8|Q08EM4|Q9NQW4	Missense_Mutation	SNP	pfam_SSXRD_motif,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,pfscan_SET_dom,pfscan_Krueppel-associated_box,pfscan_Krueppel-associated_box-rel	p.G489A	ENST00000449207.2	37	c.1466	CCDS45557.1	16	.	.	.	.	.	.	.	.	.	.	C	8.291	0.817671	0.16607	.	.	ENSG00000126856	ENST00000449207	T	0.15603	2.41	2.72	-0.823	0.10815	.	.	.	.	.	T	0.06234	0.0161	N	0.08118	0	0.18873	N	0.999988	B	0.29378	0.243	B	0.26094	0.066	T	0.38457	-0.9660	8	.	.	.	-2.6514	2.8206	0.05470	0.2175:0.5022:0.0:0.2803	.	489	Q9NQW5	PRDM7_HUMAN	A	489	ENSP00000396732:G489A	.	G	-	2	0	PRDM7	88652211	0.000000	0.05858	0.002000	0.10522	0.070000	0.16714	-0.879000	0.04188	-0.288000	0.09051	-0.339000	0.08088	GGT	PRDM7	-	NULL	ENSG00000126856		0.473	PRDM7-002	KNOWN	basic|appris_principal|CCDS	protein_coding	PRDM7	HGNC	protein_coding	OTTHUMT00000420560.1	232	0.00	0	C			90124710	90124710	-1	no_errors	ENST00000449207	ensembl	human	known	69_37n	missense	322	18.69	74	SNP	0.201	G
PREX1	57580	genome.wustl.edu	37	20	47309216	47309216	+	Missense_Mutation	SNP	C	C	T			TCGA-A2-A0D2-01A-21W-A050-09	TCGA-A2-A0D2-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	05656575-69e7-4745-a89d-ca0568eb5559	c830c663-95f6-40e0-9fd6-16586fa7d344	g.chr20:47309216C>T	ENST00000371941.3	-	8	1052	c.1030G>A	c.(1030-1032)Ggg>Agg	p.G344R	PREX1_ENST00000396220.1_Missense_Mutation_p.G344R	NM_020820.3	NP_065871	Q8TCU6	PREX1_HUMAN	phosphatidylinositol-3,4,5-trisphosphate-dependent Rac exchange factor 1	344	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				actin filament polymerization (GO:0030041)|G-protein coupled receptor signaling pathway (GO:0007186)|intracellular signal transduction (GO:0035556)|neutrophil activation (GO:0042119)|neutrophil chemotaxis (GO:0030593)|positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)|regulation of actin filament polymerization (GO:0030833)|regulation of dendrite development (GO:0050773)|superoxide metabolic process (GO:0006801)|T cell differentiation (GO:0030217)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|growth cone (GO:0030426)|intracellular membrane-bounded organelle (GO:0043231)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	enzyme binding (GO:0019899)|phospholipid binding (GO:0005543)|Rho GTPase activator activity (GO:0005100)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.G344R(2)		breast(3)|central_nervous_system(1)|endometrium(4)|kidney(6)|large_intestine(27)|lung(53)|ovary(3)|pancreas(1)|prostate(1)|skin(2)|stomach(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	110			BRCA - Breast invasive adenocarcinoma(12;0.0135)|Colorectal(8;0.198)			CTACCTGTCCCATCTTCCACA	0.507																																						dbGAP											2	Substitution - Missense(2)	breast(2)											150.0	117.0	128.0					20																	47309216		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB037836	CCDS13410.1	20q13.13	2013-01-10	2008-09-15		ENSG00000124126	ENSG00000124126		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	32594	protein-coding gene	gene with protein product		606905				11955434, 15545267, 16301320	Standard	NM_020820		Approved	KIAA1415, P-REX1	uc002xtw.1	Q8TCU6	OTTHUMG00000032685	ENST00000371941.3:c.1030G>A	20.37:g.47309216C>T	ENSP00000361009:p.Gly344Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	E1P5X9|Q5JS95|Q5JS96|Q69YL2|Q7Z2L9|Q9BQH0|Q9BX55|Q9H4Q6|Q9P2D2|Q9UGQ4	Missense_Mutation	SNP	pfam_DH-domain,pfam_DEP_dom,pfam_Pleckstrin_homology,superfamily_DH-domain,superfamily_PDZ,smart_DH-domain,smart_Pleckstrin_homology,smart_DEP_dom,smart_PDZ,pfscan_DEP_dom,pfscan_PDZ,pfscan_Pleckstrin_homology,pfscan_DH-domain	p.G344R	ENST00000371941.3	37	c.1030	CCDS13410.1	20	.	.	.	.	.	.	.	.	.	.	C	33	5.206893	0.95033	.	.	ENSG00000124126	ENST00000371941;ENST00000396220	D;D	0.89270	-2.49;-2.49	5.22	5.22	0.72569	Pleckstrin homology-type (1);Pleckstrin homology domain (3);	0.000000	0.56097	U	0.000039	D	0.95376	0.8499	M	0.87038	2.855	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.95834	0.8860	10	0.87932	D	0	.	19.1774	0.93607	0.0:1.0:0.0:0.0	.	344	Q8TCU6	PREX1_HUMAN	R	344	ENSP00000361009:G344R;ENSP00000379522:G344R	ENSP00000361009:G344R	G	-	1	0	PREX1	46742623	1.000000	0.71417	0.972000	0.41901	0.971000	0.66376	7.818000	0.86416	2.601000	0.87937	0.650000	0.86243	GGG	PREX1	-	pfam_Pleckstrin_homology,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	ENSG00000124126		0.507	PREX1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PREX1	HGNC	protein_coding	OTTHUMT00000079623.1	351	0.00	0	C	NM_020820		47309216	47309216	-1	no_errors	ENST00000371941	ensembl	human	known	69_37n	missense	145	27.50	55	SNP	1.000	T
PRKCB	5579	genome.wustl.edu	37	16	24135278	24135278	+	Silent	SNP	G	G	C			TCGA-A2-A0D2-01A-21W-A050-09	TCGA-A2-A0D2-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	05656575-69e7-4745-a89d-ca0568eb5559	c830c663-95f6-40e0-9fd6-16586fa7d344	g.chr16:24135278G>C	ENST00000321728.7	+	9	1216	c.1041G>C	c.(1039-1041)gtG>gtC	p.V347V	PRKCB_ENST00000303531.7_Silent_p.V347V	NM_212535.2	NP_997700.1	P05771	KPCB_HUMAN	protein kinase C, beta	347	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				apoptotic process (GO:0006915)|B cell activation (GO:0042113)|B cell receptor signaling pathway (GO:0050853)|blood coagulation (GO:0007596)|calcium ion transport (GO:0006816)|cellular calcium ion homeostasis (GO:0006874)|cellular response to carbohydrate stimulus (GO:0071322)|histone H3-T6 phosphorylation (GO:0035408)|intracellular signal transduction (GO:0035556)|lipoprotein transport (GO:0042953)|negative regulation of glucose transport (GO:0010829)|negative regulation of insulin receptor signaling pathway (GO:0046627)|platelet activation (GO:0030168)|positive regulation of angiogenesis (GO:0045766)|positive regulation of B cell receptor signaling pathway (GO:0050861)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030949)|protein phosphorylation (GO:0006468)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	androgen receptor binding (GO:0050681)|ATP binding (GO:0005524)|calcium channel regulator activity (GO:0005246)|chromatin binding (GO:0003682)|histone binding (GO:0042393)|histone kinase activity (H3-T6 specific) (GO:0035403)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|protein kinase C activity (GO:0004697)|protein kinase C binding (GO:0005080)|protein serine/threonine kinase activity (GO:0004674)|zinc ion binding (GO:0008270)	p.V347V(2)		central_nervous_system(3)|large_intestine(1)|lung(2)|ovary(3)	9					Tamoxifen(DB00675)|Vitamin E(DB00163)	TCCTAATGGTGCTGGGGAAAG	0.473																																						dbGAP											2	Substitution - coding silent(2)	breast(2)											195.0	186.0	189.0					16																	24135278		2197	4300	6497	-	-	-	SO:0001819	synonymous_variant	0			M13975	CCDS10618.1, CCDS10619.1	16p12	2009-07-10	2008-08-18	2008-08-18	ENSG00000166501	ENSG00000166501	2.7.11.1		9395	protein-coding gene	gene with protein product		176970	"""protein kinase C, beta 1"""	PRKCB2, PKCB, PRKCB1		3658678	Standard	NM_002738		Approved		uc002dme.3	P05771	OTTHUMG00000131615	ENST00000321728.7:c.1041G>C	16.37:g.24135278G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	C5IFJ8|D3DWF5|O43744|P05127|Q15138|Q93060|Q9UE49|Q9UE50|Q9UEH8|Q9UJ30|Q9UJ33	Silent	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_Kinase_C-like_PE/DAG-bd,pfam_C2_Ca-dep,pfam_Pkinase_C,superfamily_Kinase-like_dom,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_C2_Ca-dep,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_AGC-kinase_C,pirsf_Protein_kinase_C_a/b/g,prints_DAG/PE-bd,prints_C2_dom,pfscan_C2_membr_targeting,pfscan_Prot_Kinase_C-like_PE/DAG-bd,pfscan_Prot_kinase_cat_dom	p.V347	ENST00000321728.7	37	c.1041	CCDS10618.1	16																																																																																			PRKCB	-	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pirsf_Protein_kinase_C_a/b/g,pfscan_Prot_kinase_cat_dom	ENSG00000166501		0.473	PRKCB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRKCB	HGNC	protein_coding	OTTHUMT00000254504.2	669	0.00	0	G	NM_212535		24135278	24135278	+1	no_errors	ENST00000303531	ensembl	human	known	69_37n	silent	304	28.81	123	SNP	1.000	C
PTK7	5754	genome.wustl.edu	37	6	43100201	43100201	+	Missense_Mutation	SNP	C	C	A			TCGA-A2-A0D2-01A-21W-A050-09	TCGA-A2-A0D2-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	05656575-69e7-4745-a89d-ca0568eb5559	c830c663-95f6-40e0-9fd6-16586fa7d344	g.chr6:43100201C>A	ENST00000230419.4	+	7	1225	c.1004C>A	c.(1003-1005)gCt>gAt	p.A335D	PTK7_ENST00000471863.1_Missense_Mutation_p.A335D|PTK7_ENST00000349241.2_Missense_Mutation_p.A335D|PTK7_ENST00000352931.2_Missense_Mutation_p.A335D|PTK7_ENST00000481273.1_Missense_Mutation_p.A343D|PTK7_ENST00000345201.2_Missense_Mutation_p.A335D	NM_002821.4	NP_002812.2	Q13308	PTK7_HUMAN	protein tyrosine kinase 7	335	Ig-like C2-type 4.				actin cytoskeleton reorganization (GO:0031532)|axis elongation (GO:0003401)|canonical Wnt signaling pathway (GO:0060070)|cell adhesion (GO:0007155)|cell migration (GO:0016477)|cellular response to retinoic acid (GO:0071300)|cochlea morphogenesis (GO:0090103)|convergent extension (GO:0060026)|establishment of epithelial cell apical/basal polarity (GO:0045198)|establishment of planar polarity (GO:0001736)|lung-associated mesenchyme development (GO:0060484)|neural tube closure (GO:0001843)|peptidyl-tyrosine phosphorylation (GO:0018108)|planar cell polarity pathway involved in neural tube closure (GO:0090179)|positive regulation of neuron projection development (GO:0010976)|signal transduction (GO:0007165)|wound healing (GO:0042060)	cell-cell junction (GO:0005911)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)	ATP binding (GO:0005524)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)	p.A335D(1)		NS(1)|breast(4)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|lung(12)|ovary(2)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	46			Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.00784)|OV - Ovarian serous cystadenocarcinoma(102;0.0423)			GTGTTTACAGCTGGCAGCGAG	0.592																																						dbGAP											1	Substitution - Missense(1)	breast(1)											79.0	83.0	82.0					6																	43100201		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF447176	CCDS4884.1, CCDS4885.1, CCDS4886.1, CCDS4887.1, CCDS59021.1	6p21.1-p12.2	2013-02-18	2013-02-18		ENSG00000112655	ENSG00000112655	2.7.10.1	"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	9618	protein-coding gene	gene with protein product		601890	"""PTK7 protein tyrosine kinase 7"""			7478540	Standard	NM_002821		Approved	CCK4	uc011dve.2	Q13308	OTTHUMG00000014721	ENST00000230419.4:c.1004C>A	6.37:g.43100201C>A	ENSP00000230419:p.Ala335Asp	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K974|B7Z477|E9PFZ5|Q13417|Q5T650|Q6IQ54|Q8NFA5|Q8NFA6|Q8NFA7|Q8NFA8	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Immunoglobulin,pfam_Prot_kinase_cat_dom,pfam_Ig_V-set,superfamily_Kinase-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom,pfscan_Ig-like	p.A335D	ENST00000230419.4	37	c.1004	CCDS4884.1	6	.	.	.	.	.	.	.	.	.	.	C	20.4	3.988177	0.74589	.	.	ENSG00000112655	ENST00000230419;ENST00000325774;ENST00000471863;ENST00000349241;ENST00000352931;ENST00000345201;ENST00000481273;ENST00000419972;ENST00000481946	T;T;T;T;T;T;T	0.80480	-1.16;-1.38;-0.72;-0.78;-0.87;-1.16;-1.38	5.29	4.22	0.49857	Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);	0.056656	0.64402	D	0.000001	D	0.84047	0.5386	L	0.58428	1.81	0.80722	D	1	P;D;P;P;P;P;D	0.76494	0.607;0.999;0.954;0.917;0.954;0.65;0.997	P;D;P;P;P;P;D	0.72338	0.471;0.977;0.826;0.791;0.791;0.742;0.943	D	0.85488	0.1183	10	0.72032	D	0.01	.	13.0599	0.59002	0.0:0.9116:0.0:0.0884	.	343;11;335;335;335;335;335	E9PFZ5;F8W9X8;Q13308-3;Q13308-2;Q13308-4;Q13308;Q86X91	.;.;.;.;.;PTK7_HUMAN;.	D	335;11;335;335;335;335;343;343;88	ENSP00000230419:A335D;ENSP00000419037:A335D;ENSP00000325462:A335D;ENSP00000326029:A335D;ENSP00000325992:A335D;ENSP00000418754:A343D;ENSP00000420165:A88D	ENSP00000230418:A335D	A	+	2	0	PTK7	43208179	0.984000	0.35163	0.962000	0.40283	0.551000	0.35334	2.625000	0.46452	2.480000	0.83734	0.462000	0.41574	GCT	PTK7	-	smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	ENSG00000112655		0.592	PTK7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PTK7	HGNC	protein_coding	OTTHUMT00000040580.2	47	0.00	0	C			43100201	43100201	+1	no_errors	ENST00000230419	ensembl	human	known	69_37n	missense	14	36.36	8	SNP	0.958	A
PUM2	23369	genome.wustl.edu	37	2	20483175	20483175	+	Missense_Mutation	SNP	G	G	C			TCGA-A2-A0D2-01A-21W-A050-09	TCGA-A2-A0D2-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	05656575-69e7-4745-a89d-ca0568eb5559	c830c663-95f6-40e0-9fd6-16586fa7d344	g.chr2:20483175G>C	ENST00000361078.2	-	10	1386	c.1364C>G	c.(1363-1365)aCt>aGt	p.T455S	PUM2_ENST00000338086.5_Missense_Mutation_p.T455S|PUM2_ENST00000536417.1_Missense_Mutation_p.T399S|PUM2_ENST00000403432.1_Missense_Mutation_p.T455S|PUM2_ENST00000319801.5_Missense_Mutation_p.T455S			Q8TB72	PUM2_HUMAN	pumilio RNA-binding family member 2	455	Ala-rich.				regulation of translation (GO:0006417)|stress granule assembly (GO:0034063)	cytoplasm (GO:0005737)|cytoplasmic stress granule (GO:0010494)|nuclear membrane (GO:0031965)|perinuclear region of cytoplasm (GO:0048471)	poly(A) RNA binding (GO:0044822)	p.T455S(1)		breast(2)|central_nervous_system(1)|endometrium(6)|kidney(4)|large_intestine(7)|lung(13)|ovary(2)|prostate(4)|urinary_tract(3)	42	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					TCCAAGGCCAGTCCTTGCTCC	0.423																																						dbGAP											1	Substitution - Missense(1)	breast(1)											92.0	91.0	91.0					2																	20483175		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF315591	CCDS1698.1, CCDS74486.1, CCDS74487.1	2p22-p21	2013-09-02	2013-09-02		ENSG00000055917	ENSG00000055917			14958	protein-coding gene	gene with protein product		607205	"""pumilio (Drosphila) homolog 2"", ""pumilio homolog 2 (Drosophila)"""			9039502, 12459267, 12511597	Standard	XM_005262607		Approved	PUMH2, KIAA0235	uc002rds.1	Q8TB72	OTTHUMG00000122098	ENST00000361078.2:c.1364C>G	2.37:g.20483175G>C	ENSP00000354370:p.Thr455Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KSL0|B4E2B6|D6W527|O00234|Q53TV7|Q8WY43|Q9HAN2	Missense_Mutation	SNP	pfam_Pumilio_RNA-bd_rpt,superfamily_ARM-type_fold,smart_Pumilio_RNA-bd_rpt,pfscan_Pumilio_RNA-bd_rpt	p.T455S	ENST00000361078.2	37	c.1364		2	.	.	.	.	.	.	.	.	.	.	G	18.42	3.620141	0.66787	.	.	ENSG00000055917	ENST00000338086;ENST00000361078;ENST00000319801;ENST00000440577;ENST00000403432;ENST00000536417	T;T;T;T;T;T	0.18960	2.24;2.52;2.5;2.18;2.24;2.24	6.16	6.16	0.99307	.	0.094359	0.64402	D	0.000001	T	0.21103	0.0508	L	0.36672	1.1	0.58432	D	0.999999	B;B;B	0.23806	0.091;0.043;0.011	B;B;B	0.32677	0.15;0.04;0.041	T	0.06127	-1.0844	10	0.02654	T	1	-15.8848	20.8598	0.99761	0.0:0.0:1.0:0.0	.	399;455;455	B4E2B6;B7ZL34;Q8TB72-3	.;.;.	S	455;455;455;346;455;399	ENSP00000338173:T455S;ENSP00000354370:T455S;ENSP00000326746:T455S;ENSP00000409905:T346S;ENSP00000385992:T455S;ENSP00000440093:T399S	ENSP00000326746:T455S	T	-	2	0	PUM2	20346656	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	7.671000	0.83941	2.937000	0.99478	0.650000	0.86243	ACT	PUM2	-	NULL	ENSG00000055917		0.423	PUM2-202	KNOWN	basic|appris_candidate_longest	protein_coding	PUM2	HGNC	protein_coding		177	0.00	0	G	NM_015317		20483175	20483175	-1	no_errors	ENST00000361078	ensembl	human	known	69_37n	missense	90	38.10	56	SNP	1.000	C
RELN	5649	genome.wustl.edu	37	7	103113311	103113311	+	Missense_Mutation	SNP	C	C	T			TCGA-A2-A0D2-01A-21W-A050-09	TCGA-A2-A0D2-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	05656575-69e7-4745-a89d-ca0568eb5559	c830c663-95f6-40e0-9fd6-16586fa7d344	g.chr7:103113311C>T	ENST00000428762.1	-	65	10490	c.10331G>A	c.(10330-10332)gGg>gAg	p.G3444E	RELN_ENST00000343529.5_Missense_Mutation_p.G3442E|CTB-107G13.1_ENST00000422488.1_RNA|RELN_ENST00000424685.2_Missense_Mutation_p.G3444E	NM_005045.3	NP_005036.2	P78509	RELN_HUMAN	reelin	3444	Arg-rich (basic).				associative learning (GO:0008306)|axon guidance (GO:0007411)|brain development (GO:0007420)|cell adhesion (GO:0007155)|cell morphogenesis involved in differentiation (GO:0000904)|central nervous system development (GO:0007417)|cerebral cortex tangential migration (GO:0021800)|dendrite development (GO:0016358)|glial cell differentiation (GO:0010001)|hippocampus development (GO:0021766)|lateral motor column neuron migration (GO:0097477)|layer formation in cerebral cortex (GO:0021819)|long-term memory (GO:0007616)|N-methyl-D-aspartate receptor clustering (GO:0097114)|neuron migration (GO:0001764)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000969)|positive regulation of CREB transcription factor activity (GO:0032793)|positive regulation of dendritic spine morphogenesis (GO:0061003)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of lateral motor column neuron migration (GO:1902078)|positive regulation of long-term synaptic potentiation (GO:1900273)|positive regulation of neuron projection development (GO:0010976)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of protein tyrosine kinase activity (GO:0061098)|positive regulation of small GTPase mediated signal transduction (GO:0051057)|positive regulation of synapse maturation (GO:0090129)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|positive regulation of TOR signaling (GO:0032008)|postsynaptic density protein 95 clustering (GO:0097119)|receptor localization to synapse (GO:0097120)|reelin-mediated signaling pathway (GO:0038026)|regulation of behavior (GO:0050795)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|regulation of synaptic transmission (GO:0050804)|response to pain (GO:0048265)|spinal cord patterning (GO:0021511)|ventral spinal cord development (GO:0021517)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	lipoprotein particle receptor binding (GO:0070325)|metal ion binding (GO:0046872)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|serine-type peptidase activity (GO:0008236)|very-low-density lipoprotein particle receptor binding (GO:0070326)	p.G3442E(1)		NS(3)|breast(8)|central_nervous_system(3)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(4)|kidney(6)|large_intestine(43)|lung(101)|ovary(9)|pancreas(2)|prostate(4)|skin(14)|stomach(2)|upper_aerodigestive_tract(12)|urinary_tract(2)	227				COAD - Colon adenocarcinoma(1;8.98e-05)|Colorectal(1;0.00184)		ATGTCTGAGCCCATGTTGTCG	0.378																																					NSCLC(146;835 1944 15585 22231 52158)	dbGAP											1	Substitution - Missense(1)	breast(1)											179.0	167.0	171.0					7																	103113311		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS34722.1, CCDS47680.1	7q22	2008-07-18			ENSG00000189056	ENSG00000189056			9957	protein-coding gene	gene with protein product		600514				9049633	Standard	NM_005045		Approved	RL, PRO1598	uc010liz.3	P78509	OTTHUMG00000157247	ENST00000428762.1:c.10331G>A	7.37:g.103113311C>T	ENSP00000392423:p.Gly3444Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	A4D0P9|A4D0Q0|Q86UJ0|Q86UJ8|Q8NDV0|Q9UDQ2	Missense_Mutation	SNP	pfam_EGF_extracell,pfam_Reeler_dom,pfam_BNR_rpt,superfamily_Neuraminidase,superfamily_Growth_fac_rcpt,smart_EGF-like,pfscan_EG-like_dom,pfscan_Reeler_dom	p.G3444E	ENST00000428762.1	37	c.10331	CCDS47680.1	7	.	.	.	.	.	.	.	.	.	.	C	21.5	4.161118	0.78226	.	.	ENSG00000189056	ENST00000428762;ENST00000343529;ENST00000424685;ENST00000424828	D;D;D	0.81579	-1.51;-1.51;-1.51	5.75	5.75	0.90469	.	0.000000	0.85682	D	0.000000	D	0.84669	0.5523	N	0.22421	0.69	0.80722	D	1	B;D	0.89917	0.008;1.0	B;D	0.83275	0.068;0.996	D	0.86146	0.1584	10	0.66056	D	0.02	.	19.9525	0.97208	0.0:1.0:0.0:0.0	.	3442;3444	P78509-2;P78509	.;RELN_HUMAN	E	3444;3442;3444;961	ENSP00000392423:G3444E;ENSP00000345694:G3442E;ENSP00000388446:G3444E	ENSP00000345694:G3442E	G	-	2	0	RELN	102900547	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	6.220000	0.72237	2.719000	0.93026	0.655000	0.94253	GGG	RELN	-	NULL	ENSG00000189056		0.378	RELN-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RELN	HGNC	protein_coding	OTTHUMT00000348148.1	247	0.00	0	C	NM_005045		103113311	103113311	-1	no_errors	ENST00000424685	ensembl	human	known	69_37n	missense	304	31.84	142	SNP	1.000	T
ROBO3	64221	genome.wustl.edu	37	11	124742417	124742417	+	Silent	SNP	C	C	T			TCGA-A2-A0D2-01A-21W-A050-09	TCGA-A2-A0D2-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	05656575-69e7-4745-a89d-ca0568eb5559	c830c663-95f6-40e0-9fd6-16586fa7d344	g.chr11:124742417C>T	ENST00000397801.1	+	8	1491	c.1299C>T	c.(1297-1299)atC>atT	p.I433I	ROBO3_ENST00000538940.1_Silent_p.I411I	NM_022370.3	NP_071765.2	Q96MS0	ROBO3_HUMAN	roundabout, axon guidance receptor, homolog 3 (Drosophila)	433	Ig-like C2-type 4.				axon guidance (GO:0007411)|axon midline choice point recognition (GO:0016199)|neuron migration (GO:0001764)	axon (GO:0030424)|integral component of membrane (GO:0016021)		p.I433I(2)		breast(2)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(17)|ovary(1)|prostate(3)|upper_aerodigestive_tract(1)	35	all_hematologic(175;0.215)	Lung NSC(97;0.0177)|all_lung(97;0.0179)|Medulloblastoma(222;0.0425)|Breast(109;0.0481)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;1.5e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0296)		CTGGCAGCATCCTGGCCAAGG	0.552																																						dbGAP											2	Substitution - coding silent(2)	breast(2)											49.0	53.0	52.0					11																	124742417		2113	4241	6354	-	-	-	SO:0001819	synonymous_variant	0			AK024697	CCDS44755.1	11q24	2013-02-11	2001-11-28		ENSG00000154134	ENSG00000154134		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	13433	protein-coding gene	gene with protein product		608630	"""roundabout (axon guidance receptor, Drosophila) homolog 3"", ""horizontal gaze palsy with progressive scoliosis"""	HGPPS		15105459	Standard	NM_022370		Approved	RBIG1, FLJ21044, HGPS	uc001qbc.3	Q96MS0	OTTHUMG00000165934	ENST00000397801.1:c.1299C>T	11.37:g.124742417C>T		Somatic		WXS	Illumina GAIIx	Phase_IV		Silent	SNP	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Fibronectin_type3,pfam_Ig_V-set,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like	p.I433	ENST00000397801.1	37	c.1299	CCDS44755.1	11																																																																																			ROBO3	-	pfam_Ig_I-set,smart_Ig_sub,pfscan_Ig-like	ENSG00000154134		0.552	ROBO3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ROBO3	HGNC	protein_coding	OTTHUMT00000387091.1	120	0.00	0	C	XM_370663		124742417	124742417	+1	no_errors	ENST00000397801	ensembl	human	known	69_37n	silent	39	26.42	14	SNP	0.966	T
RPGR	6103	genome.wustl.edu	37	X	38160592	38160592	+	Missense_Mutation	SNP	G	G	A			TCGA-A2-A0D2-01A-21W-A050-09	TCGA-A2-A0D2-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	05656575-69e7-4745-a89d-ca0568eb5559	c830c663-95f6-40e0-9fd6-16586fa7d344	g.chrX:38160592G>A	ENST00000339363.3	-	9	1134	c.967C>T	c.(967-969)Cgc>Tgc	p.R323C	RPGR_ENST00000338898.3_Missense_Mutation_p.R323C|RPGR_ENST00000378505.2_Missense_Mutation_p.R323C|RPGR_ENST00000342811.3_Missense_Mutation_p.R323C|RPGR_ENST00000318842.7_Missense_Mutation_p.R323C|TM4SF2_ENST00000465127.1_Intron|RPGR_ENST00000309513.3_Missense_Mutation_p.R323C			Q92834	RPGR_HUMAN	retinitis pigmentosa GTPase regulator	323					cilium assembly (GO:0042384)|eye photoreceptor cell development (GO:0042462)|intracellular protein transport (GO:0006886)|intraciliary transport (GO:0042073)|response to stimulus (GO:0050896)|visual perception (GO:0007601)	centrosome (GO:0005813)|ciliary basal body (GO:0036064)|Golgi apparatus (GO:0005794)|photoreceptor outer segment (GO:0001750)|sperm flagellum (GO:0036126)	guanyl-nucleotide exchange factor activity (GO:0005085)|poly(A) RNA binding (GO:0044822)	p.R323C(2)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(9)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)	25						TTTCCGTGGCGACCATCTCCA	0.328																																						dbGAP											2	Substitution - Missense(2)	breast(2)											80.0	72.0	75.0					X																	38160592		2202	4300	6502	-	-	-	SO:0001583	missense	0			U57629	CCDS14246.1, CCDS35229.1	Xp11.4	2013-06-06	2004-02-13		ENSG00000156313	ENSG00000156313			10295	protein-coding gene	gene with protein product		312610	"""retinitis pigmentosa 15"", ""cone dystrophy 1 (X-linked)"""	CRD, RP3, RP15, COD1		8673101, 8817343	Standard	XM_005272633		Approved	CORDX1	uc004ded.1	Q92834	OTTHUMG00000021361	ENST00000339363.3:c.967C>T	X.37:g.38160592G>A	ENSP00000343671:p.Arg323Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	B1ARN3|E9PE28|O00702|O00737|Q3KN84|Q8N5T6|Q93039|Q9HD29|Q9UMR1	Missense_Mutation	SNP	pfam_Reg_chr_condens,superfamily_Reg_csome_cond/b-lactamase_inh,pfscan_Reg_chr_condens,prints_Reg_chr_condens	p.R323C	ENST00000339363.3	37	c.967		X	.	.	.	.	.	.	.	.	.	.	g	28.2	4.896493	0.91962	.	.	ENSG00000156313	ENST00000339363;ENST00000309513;ENST00000338898;ENST00000318842;ENST00000342811;ENST00000378505	D;T;D;D;D;D	0.85339	-1.97;-1.4;-1.97;-1.97;-1.97;-1.97	5.71	5.71	0.89125	.	0.000000	0.64402	D	0.000002	D	0.93324	0.7872	M	0.85630	2.765	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.992	D	0.93834	0.7130	10	0.62326	D	0.03	.	18.4879	0.90836	0.0:0.0:1.0:0.0	.	323;323	E9PE28;Q92834-2	.;.	C	323	ENSP00000343671:R323C;ENSP00000308783:R323C;ENSP00000340208:R323C;ENSP00000322219:R323C;ENSP00000339531:R323C;ENSP00000367766:R323C	ENSP00000308783:R323C	R	-	1	0	RPGR	38045536	1.000000	0.71417	0.997000	0.53966	0.990000	0.78478	5.813000	0.69201	2.407000	0.81776	0.590000	0.80494	CGC	RPGR	-	pfam_Reg_chr_condens,superfamily_Reg_csome_cond/b-lactamase_inh,pfscan_Reg_chr_condens	ENSG00000156313		0.328	RPGR-203	KNOWN	basic|appris_candidate	protein_coding	RPGR	HGNC	protein_coding		125	0.00	0	G	NM_000328		38160592	38160592	-1	no_errors	ENST00000378505	ensembl	human	known	69_37n	missense	96	20.66	25	SNP	1.000	A
SCN3A	6328	genome.wustl.edu	37	2	165997183	165997183	+	Missense_Mutation	SNP	G	G	C			TCGA-A2-A0D2-01A-21W-A050-09	TCGA-A2-A0D2-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	05656575-69e7-4745-a89d-ca0568eb5559	c830c663-95f6-40e0-9fd6-16586fa7d344	g.chr2:165997183G>C	ENST00000360093.3	-	13	2488	c.1997C>G	c.(1996-1998)cCt>cGt	p.P666R	SCN3A_ENST00000409101.3_Intron|SCN3A_ENST00000283254.7_Missense_Mutation_p.P666R	NM_001081677.1	NP_001075146.1	Q9NY46	SCN3A_HUMAN	sodium channel, voltage-gated, type III, alpha subunit	666					membrane depolarization during action potential (GO:0086010)|neuronal action potential (GO:0019228)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)	p.P666R(1)		NS(1)|breast(7)|central_nervous_system(2)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(19)|liver(2)|lung(47)|ovary(6)|prostate(3)|skin(10)|upper_aerodigestive_tract(4)|urinary_tract(3)	120					Lacosamide(DB06218)|Valproic Acid(DB00313)|Zonisamide(DB00909)	TTGTCCAGTAGGTGACGTTAG	0.483																																						dbGAP											1	Substitution - Missense(1)	breast(1)											131.0	117.0	122.0					2																	165997183		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF035685	CCDS33312.1, CCDS46440.1	2q24	2012-02-26	2007-01-23		ENSG00000153253	ENSG00000153253		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10590	protein-coding gene	gene with protein product		182391	"""sodium channel, voltage-gated, type III, alpha polypeptide"""			9589372, 16382098	Standard	NM_001081676		Approved	Nav1.3	uc002ucx.3	Q9NY46	OTTHUMG00000044171	ENST00000360093.3:c.1997C>G	2.37:g.165997183G>C	ENSP00000353206:p.Pro666Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	Q16142|Q53SX0|Q9BZB3|Q9C006|Q9NYK2|Q9P2J1|Q9UPD1|Q9Y6P4	Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_DUF3451,pfam_Na_trans_assoc,pfam_PKD1_2_channel,prints_Na_channel_asu,prints_PKD_2,pfscan_IQ_motif_EF-hand-BS	p.P666R	ENST00000360093.3	37	c.1997		2	.	.	.	.	.	.	.	.	.	.	G	20.3	3.966214	0.74131	.	.	ENSG00000153253	ENST00000360093;ENST00000283254	D;D	0.90955	-2.76;-2.76	6.07	6.07	0.98685	.	0.098855	0.45361	D	0.000365	D	0.96213	0.8765	M	0.91090	3.175	0.80722	D	1	D	0.55172	0.97	D	0.69479	0.964	D	0.93909	0.7195	10	0.19590	T	0.45	.	20.6593	0.99626	0.0:0.0:1.0:0.0	.	666	Q9NY46-3	.	R	666	ENSP00000353206:P666R;ENSP00000283254:P666R	ENSP00000283254:P666R	P	-	2	0	SCN3A	165705429	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	6.480000	0.73604	2.885000	0.99019	0.655000	0.94253	CCT	SCN3A	-	pfam_DUF3451	ENSG00000153253		0.483	SCN3A-201	KNOWN	basic|appris_candidate_longest	protein_coding	SCN3A	HGNC	protein_coding		199	0.00	0	G	NM_006922		165997183	165997183	-1	no_errors	ENST00000283254	ensembl	human	known	69_37n	missense	112	26.80	41	SNP	1.000	C
SEC14L5	9717	genome.wustl.edu	37	16	5058578	5058578	+	Frame_Shift_Del	DEL	G	G	-			TCGA-A2-A0D2-01A-21W-A050-09	TCGA-A2-A0D2-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	05656575-69e7-4745-a89d-ca0568eb5559	c830c663-95f6-40e0-9fd6-16586fa7d344	g.chr16:5058578delG	ENST00000251170.7	+	14	1909	c.1729delG	c.(1729-1731)ggcfs	p.G577fs	RP11-165E7.1_ENST00000588778.1_RNA	NM_014692.1	NP_055507.1	O43304	S14L5_HUMAN	SEC14-like 5 (S. cerevisiae)	577	GOLD. {ECO:0000255|PROSITE- ProRule:PRU00096}.					integral component of membrane (GO:0016021)|intracellular (GO:0005622)	transporter activity (GO:0005215)	p.G577fs*28(1)		NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(7)|lung(9)|ovary(1)|skin(1)	29						GATCGACAAAGGCTGGGTCCT	0.657																																						dbGAP											1	Deletion - Frameshift(1)	breast(1)											47.0	56.0	53.0					16																	5058578		1909	4113	6022	-	-	-	SO:0001589	frameshift_variant	0			AB007880	CCDS45403.1	16p13.3	2008-02-05				ENSG00000103184			29032	protein-coding gene	gene with protein product						9455477	Standard	NM_014692		Approved	KIAA0420, PRELID4B	uc002cye.2	O43304		ENST00000251170.7:c.1729delG	16.37:g.5058578delG	ENSP00000251170:p.Gly577fs	Somatic		WXS	Illumina GAIIx	Phase_IV		Frame_Shift_Del	DEL	pfam_PRELI/MSF1,pfam_CRAL-TRIO_dom,pfam_CRAL/TRIO_N_dom,superfamily_CRAL-TRIO_dom,superfamily_CRAL/TRIO_N_dom,superfamily_GOLD,smart_CRAL-TRIO_dom,pfscan_CRAL-TRIO_dom,pfscan_GOLD,pfscan_PRELI/MSF1,prints_CRAL-bd_toc_tran	p.G577fs	ENST00000251170.7	37	c.1729	CCDS45403.1	16																																																																																			SEC14L5	-	superfamily_GOLD,pfscan_GOLD	ENSG00000103184		0.657	SEC14L5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SEC14L5	HGNC	protein_coding	OTTHUMT00000434379.1	77	0.00	0	G			5058578	5058578	+1	no_errors	ENST00000251170	ensembl	human	known	69_37n	frame_shift_del	20	31.03	9	DEL	0.061	-
SLC25A38	54977	genome.wustl.edu	37	3	39436042	39436042	+	Missense_Mutation	SNP	G	G	A			TCGA-A2-A0D2-01A-21W-A050-09	TCGA-A2-A0D2-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	05656575-69e7-4745-a89d-ca0568eb5559	c830c663-95f6-40e0-9fd6-16586fa7d344	g.chr3:39436042G>A	ENST00000273158.4	+	6	1144	c.767G>A	c.(766-768)gGc>gAc	p.G256D		NM_017875.2	NP_060345.2			solute carrier family 25, member 38									p.G256D(1)		breast(1)|endometrium(1)|large_intestine(1)|lung(6)|skin(1)|stomach(1)	11				KIRC - Kidney renal clear cell carcinoma(284;0.0525)|Kidney(284;0.0661)		CAATGGATTGGCCAAGCAGTG	0.398																																						dbGAP											1	Substitution - Missense(1)	breast(1)											87.0	85.0	86.0					3																	39436042		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC013194	CCDS2685.1	3p22.1	2013-05-22			ENSG00000144659	ENSG00000144659		"""Solute carriers"""	26054	protein-coding gene	gene with protein product		610819				16949250	Standard	NM_017875		Approved	FLJ20551	uc003cjo.2	Q96DW6	OTTHUMG00000131289	ENST00000273158.4:c.767G>A	3.37:g.39436042G>A	ENSP00000273158:p.Gly256Asp	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Mitochondrial_sb/sol_carrier,superfamily_Mt_carrier_dom,pfscan_Mitochondrial_sb/sol_carrier	p.G256D	ENST00000273158.4	37	c.767	CCDS2685.1	3	.	.	.	.	.	.	.	.	.	.	g	13.96	2.392699	0.42410	.	.	ENSG00000144659	ENST00000273158	T	0.79033	-1.23	5.62	4.56	0.56223	Mitochondrial carrier domain (2);	0.342949	0.32548	N	0.005960	T	0.72914	0.3520	L	0.58510	1.815	0.41171	D	0.986169	B	0.06786	0.001	B	0.13407	0.009	T	0.69198	-0.5208	10	0.36615	T	0.2	-12.3235	12.6852	0.56944	0.0935:0.0:0.9065:0.0	.	256	Q96DW6	S2538_HUMAN	D	256	ENSP00000273158:G256D	ENSP00000273158:G256D	G	+	2	0	SLC25A38	39411046	1.000000	0.71417	0.993000	0.49108	0.952000	0.60782	4.096000	0.57734	2.639000	0.89480	0.655000	0.94253	GGC	SLC25A38	-	pfam_Mitochondrial_sb/sol_carrier,superfamily_Mt_carrier_dom,pfscan_Mitochondrial_sb/sol_carrier	ENSG00000144659		0.398	SLC25A38-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC25A38	HGNC	protein_coding	OTTHUMT00000254057.3	129	0.00	0	G	NM_017875		39436042	39436042	+1	no_errors	ENST00000273158	ensembl	human	known	69_37n	missense	70	25.53	24	SNP	0.999	A
SLC39A12	221074	genome.wustl.edu	37	10	18292185	18292185	+	Missense_Mutation	SNP	G	G	T			TCGA-A2-A0D2-01A-21W-A050-09	TCGA-A2-A0D2-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	05656575-69e7-4745-a89d-ca0568eb5559	c830c663-95f6-40e0-9fd6-16586fa7d344	g.chr10:18292185G>T	ENST00000377369.2	+	12	2118	c.1845G>T	c.(1843-1845)atG>atT	p.M615I	SLC39A12-AS1_ENST00000439319.1_RNA|SLC39A12_ENST00000377371.3_Missense_Mutation_p.M614I|SLC39A12-AS1_ENST00000445287.1_RNA|SLC39A12_ENST00000539911.1_Missense_Mutation_p.M481I|SLC39A12_ENST00000377374.4_Missense_Mutation_p.M578I	NM_001145195.1|NM_001282733.1|NM_001282734.1	NP_001138667.1|NP_001269662.1|NP_001269663.1	Q504Y0	S39AC_HUMAN	solute carrier family 39 (zinc transporter), member 12	615					regulation of microtubule polymerization (GO:0031113)|regulation of neuron projection development (GO:0010975)|signal transduction (GO:0007165)|zinc ion transmembrane import (GO:0071578)	integral component of membrane (GO:0016021)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|vesicle (GO:0031982)	zinc ion transmembrane transporter activity (GO:0005385)	p.M578I(1)		NS(1)|breast(4)|central_nervous_system(1)|cervix(1)|kidney(3)|large_intestine(5)|lung(38)|ovary(3)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	60						CTGCCTTCATGGGATTATACA	0.428																																						dbGAP											1	Substitution - Missense(1)	breast(1)											190.0	179.0	183.0					10																	18292185		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS7124.1, CCDS44362.1, CCDS60493.1, CCDS60494.1	10p12.33	2013-05-22			ENSG00000148482	ENSG00000148482		"""Solute carriers"""	20860	protein-coding gene	gene with protein product		608734	"""solute carrier family 39 (metal ion transporter), member 12"""			12659941	Standard	NM_152725		Approved	FLJ30499	uc001ipo.2	Q504Y0	OTTHUMG00000017759	ENST00000377369.2:c.1845G>T	10.37:g.18292185G>T	ENSP00000366586:p.Met615Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	B7ZL35|C9JJL4|Q49AN8|Q4G0L3|Q5VWV8|Q5VWV9|Q6NZY5|Q96NN4	Missense_Mutation	SNP	pfam_ZIP	p.M615I	ENST00000377369.2	37	c.1845	CCDS44362.1	10	.	.	.	.	.	.	.	.	.	.	G	0.943	-0.709042	0.03230	.	.	ENSG00000148482	ENST00000377369;ENST00000377374;ENST00000377371;ENST00000539911;ENST00000425219	T;T;T;T	0.37411	1.2;1.2;1.2;1.2	5.48	-1.79	0.07932	.	1.125910	0.06347	N	0.709103	T	0.09774	0.0240	N	0.01146	-0.985	0.09310	N	1	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.04013	0.0;0.001;0.0	T	0.30592	-0.9973	10	0.02654	T;T	1;1	0.0088	4.3326	0.11071	0.5084:0.0:0.1921:0.2995	.	614;615;578	Q504Y0-4;Q504Y0;Q504Y0-3	.;S39AC_HUMAN;.	I	615;578;614;481;535	ENSP00000366586:M615I;ENSP00000366591:M578I;ENSP00000366588:M614I;ENSP00000440445:M481I	ENSP00000366586:M615I;ENSP00000366586:M615I	M	+	3	0	SLC39A12	18332191	0.869000	0.29996	0.378000	0.26068	0.013000	0.08279	0.279000	0.18771	-0.142000	0.11354	-0.294000	0.09567	ATG	SLC39A12	-	pfam_ZIP	ENSG00000148482		0.428	SLC39A12-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SLC39A12	HGNC	protein_coding		237	0.00	0	G	NM_152725		18292185	18292185	+1	no_errors	ENST00000377369	ensembl	human	known	69_37n	missense	181	22.22	52	SNP	0.093	T
SUGP1	57794	genome.wustl.edu	37	19	19407862	19407862	+	Missense_Mutation	SNP	C	C	G			TCGA-A2-A0D2-01A-21W-A050-09	TCGA-A2-A0D2-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	05656575-69e7-4745-a89d-ca0568eb5559	c830c663-95f6-40e0-9fd6-16586fa7d344	g.chr19:19407862C>G	ENST00000247001.5	-	8	1526	c.1179G>C	c.(1177-1179)aaG>aaC	p.K393N	SUGP1_ENST00000585763.1_5'Flank	NM_172231.3	NP_757386.2	Q8IWZ8	SUGP1_HUMAN	SURP and G patch domain containing 1	393					gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)	nucleoplasm (GO:0005654)|spliceosomal complex (GO:0005681)	poly(A) RNA binding (GO:0044822)	p.K393N(1)		NS(1)|breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|lung(7)|ovary(1)|prostate(1)|stomach(2)|urinary_tract(2)	22						GGAGCTCTACCTTATCCTCTT	0.652																																						dbGAP											1	Substitution - Missense(1)	breast(1)											35.0	31.0	32.0					19																	19407862		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF521128	CCDS12399.1	19p13	2013-01-28	2010-08-10	2010-08-10		ENSG00000105705		"""G patch domain containing"""	18643	protein-coding gene	gene with protein product		607992	"""splicing factor 4"""	SF4		12594045	Standard	NM_172231		Approved	F23858, DKFZp434E2216, RBP	uc002nmh.3	Q8IWZ8		ENST00000247001.5:c.1179G>C	19.37:g.19407862C>G	ENSP00000247001:p.Lys393Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	O60378|Q6P3X9|Q8TCQ4|Q8WWT4|Q8WWT5|Q9NTG3	Missense_Mutation	SNP	pfam_Surp,pfam_G_patch_dom,superfamily_Surp,smart_Surp,smart_G_patch_dom,pfscan_Surp,pfscan_G_patch_dom	p.K393N	ENST00000247001.5	37	c.1179	CCDS12399.1	19	.	.	.	.	.	.	.	.	.	.	C	13.23	2.175291	0.38413	.	.	ENSG00000105705	ENST00000247001	T	0.24723	1.84	3.66	-4.69	0.03299	.	0.000000	0.85682	D	0.000000	T	0.36386	0.0965	L	0.56769	1.78	0.80722	D	1	D	0.69078	0.997	D	0.63488	0.915	T	0.12372	-1.0550	10	0.44086	T	0.13	.	12.0568	0.53540	0.0:0.404:0.0:0.596	.	393	Q8IWZ8	SUGP1_HUMAN	N	393	ENSP00000247001:K393N	ENSP00000247001:K393N	K	-	3	2	SUGP1	19268862	0.997000	0.39634	0.836000	0.33094	0.617000	0.37484	0.337000	0.19841	-1.466000	0.01897	-1.579000	0.00862	AAG	SUGP1	-	NULL	ENSG00000105705		0.652	SUGP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SUGP1	HGNC	protein_coding	OTTHUMT00000460128.4	122	0.00	0	C	NM_021164		19407862	19407862	-1	no_errors	ENST00000247001	ensembl	human	known	69_37n	missense	54	21.43	15	SNP	0.917	G
SUV420H1	51111	genome.wustl.edu	37	11	67926140	67926140	+	Missense_Mutation	SNP	G	G	T			TCGA-A2-A0D2-01A-21W-A050-09	TCGA-A2-A0D2-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	05656575-69e7-4745-a89d-ca0568eb5559	c830c663-95f6-40e0-9fd6-16586fa7d344	g.chr11:67926140G>T	ENST00000304363.4	-	11	2026	c.1673C>A	c.(1672-1674)cCa>cAa	p.P558Q		NM_017635.3	NP_060105	Q4FZB7	SV421_HUMAN	suppressor of variegation 4-20 homolog 1 (Drosophila)	558					histone H4-K20 trimethylation (GO:0034773)|muscle organ development (GO:0007517)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	condensed nuclear chromosome, centromeric region (GO:0000780)	histone methyltransferase activity (H4-K20 specific) (GO:0042799)|histone-lysine N-methyltransferase activity (GO:0018024)	p.P558Q(1)		NS(1)|breast(3)|endometrium(4)|kidney(3)|large_intestine(9)|lung(15)|ovary(2)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	46						CAACGTATTTGGTTCAAGCTT	0.542																																						dbGAP											1	Substitution - Missense(1)	breast(1)											155.0	150.0	152.0					11																	67926140		2200	4294	6494	-	-	-	SO:0001583	missense	0			AL512763	CCDS31623.1, CCDS44660.1	11q13.2	2011-07-01			ENSG00000110066	ENSG00000110066		"""Chromatin-modifying enzymes / K-methyltransferases"""	24283	protein-coding gene	gene with protein product		610881				10810093, 11401438	Standard	NM_016028		Approved	CGI-85, KMT5B	uc001onm.1	Q4FZB7	OTTHUMG00000150484	ENST00000304363.4:c.1673C>A	11.37:g.67926140G>T	ENSP00000305899:p.Pro558Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	B7WNX7|Q3SX56|Q4V775|Q6P150|Q96E44|Q9BUL0|Q9H022|Q9H2K3|Q9NXV3|Q9Y393	Missense_Mutation	SNP	pfam_SET_dom,smart_SET_dom,pfscan_SET_dom	p.P558Q	ENST00000304363.4	37	c.1673	CCDS31623.1	11	.	.	.	.	.	.	.	.	.	.	G	35	5.434742	0.96150	.	.	ENSG00000110066	ENST00000304363	T	0.56275	0.47	5.07	5.07	0.68467	.	0.219154	0.47852	D	0.000215	T	0.62925	0.2468	L	0.27053	0.805	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	T	0.67237	-0.5721	10	0.87932	D	0	-9.0965	18.63	0.91357	0.0:0.0:1.0:0.0	.	558	Q4FZB7	SV421_HUMAN	Q	558	ENSP00000305899:P558Q	ENSP00000305899:P558Q	P	-	2	0	SUV420H1	67682716	1.000000	0.71417	0.476000	0.27291	0.539000	0.34962	7.431000	0.80335	2.639000	0.89480	0.491000	0.48974	CCA	SUV420H1	-	NULL	ENSG00000110066		0.542	SUV420H1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SUV420H1	HGNC	protein_coding	OTTHUMT00000318319.1	66	0.00	0	G	NM_017635		67926140	67926140	-1	no_errors	ENST00000304363	ensembl	human	known	69_37n	missense	113	25.00	38	SNP	1.000	T
TANC2	26115	genome.wustl.edu	37	17	61473132	61473132	+	Missense_Mutation	SNP	G	G	T			TCGA-A2-A0D2-01A-21W-A050-09	TCGA-A2-A0D2-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	05656575-69e7-4745-a89d-ca0568eb5559	c830c663-95f6-40e0-9fd6-16586fa7d344	g.chr17:61473132G>T	ENST00000424789.2	+	16	2862	c.2858G>T	c.(2857-2859)tGt>tTt	p.C953F	RP11-269G24.3_ENST00000583552.1_RNA|AC015923.1_ENST00000431604.1_RNA|TANC2_ENST00000389520.4_Missense_Mutation_p.C953F	NM_025185.3	NP_079461.2	Q9HCD6	TANC2_HUMAN	tetratricopeptide repeat, ankyrin repeat and coiled-coil containing 2	953					in utero embryonic development (GO:0001701)			p.C953F(2)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(15)|ovary(2)|upper_aerodigestive_tract(3)	44						AACGGGCAGTGTGCTTTGGTT	0.502																																						dbGAP											2	Substitution - Missense(2)	breast(2)											104.0	108.0	107.0					17																	61473132		2119	4240	6359	-	-	-	SO:0001583	missense	0			AB032974	CCDS45754.1	17q23.3	2013-01-11				ENSG00000170921		"""Ankyrin repeat domain containing"", ""Tetratricopeptide (TTC) repeat domain containing"""	30212	protein-coding gene	gene with protein product	"""rolling pebbles homolog B (Drosophila)"""	615047					Standard	NM_025185		Approved	DKFZP564D166, FLJ10215, FLJ11824, KIAA1148, KIAA1636, rols, ROLSA	uc002jal.4	Q9HCD6		ENST00000424789.2:c.2858G>T	17.37:g.61473132G>T	ENSP00000387593:p.Cys953Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	Q9HAC3|Q9NW88|Q9NXY9|Q9ULS2	Missense_Mutation	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,smart_TPR_repeat,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_TPR_repeat,pfscan_TPR-contain_dom,prints_Ankyrin_rpt	p.C953F	ENST00000424789.2	37	c.2858	CCDS45754.1	17	.	.	.	.	.	.	.	.	.	.	G	21.3	4.129523	0.77549	.	.	ENSG00000170921	ENST00000389520;ENST00000424789	T;T	0.15372	2.43;2.43	5.78	5.78	0.91487	Ankyrin repeat-containing domain (4);	0.000000	0.85682	D	0.000000	T	0.31136	0.0787	N	0.20483	0.58	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.83275	0.993;0.996	T	0.10019	-1.0648	10	0.87932	D	0	.	19.9991	0.97403	0.0:0.0:1.0:0.0	.	953;953	Q9HCD6-2;Q9HCD6	.;TANC2_HUMAN	F	953	ENSP00000374171:C953F;ENSP00000387593:C953F	ENSP00000374171:C953F	C	+	2	0	TANC2	58826864	1.000000	0.71417	1.000000	0.80357	0.550000	0.35303	9.869000	0.99810	2.724000	0.93272	0.655000	0.94253	TGT	TANC2	-	superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	ENSG00000170921		0.502	TANC2-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	TANC2	HGNC	protein_coding	OTTHUMT00000444765.1	273	0.00	0	G			61473132	61473132	+1	no_errors	ENST00000424789	ensembl	human	known	69_37n	missense	130	35.00	70	SNP	1.000	T
TBCD	6904	genome.wustl.edu	37	17	80765535	80765535	+	Missense_Mutation	SNP	C	C	T			TCGA-A2-A0D2-01A-21W-A050-09	TCGA-A2-A0D2-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	05656575-69e7-4745-a89d-ca0568eb5559	c830c663-95f6-40e0-9fd6-16586fa7d344	g.chr17:80765535C>T	ENST00000355528.4	+	11	1269	c.1139C>T	c.(1138-1140)gCa>gTa	p.A380V	TBCD_ENST00000397466.2_5'UTR|TBCD_ENST00000539345.2_Missense_Mutation_p.A380V	NM_005993.4	NP_005984.3	Q9BTW9	TBCD_HUMAN	tubulin folding cofactor D	380					'de novo' posttranslational protein folding (GO:0051084)|adherens junction assembly (GO:0034333)|cellular protein metabolic process (GO:0044267)|negative regulation of cell-substrate adhesion (GO:0010812)|negative regulation of microtubule polymerization (GO:0031115)|positive regulation of GTPase activity (GO:0043547)|post-chaperonin tubulin folding pathway (GO:0007023)|protein folding (GO:0006457)|tight junction assembly (GO:0070830)	adherens junction (GO:0005912)|cytoplasm (GO:0005737)|lateral plasma membrane (GO:0016328)|microtubule (GO:0005874)|tight junction (GO:0005923)	beta-tubulin binding (GO:0048487)|chaperone binding (GO:0051087)|GTPase activator activity (GO:0005096)	p.A380V(1)				Breast(20;0.000523)|all_neural(118;0.0779)	all_cancers(8;0.0266)|all_epithelial(8;0.0696)	OV - Ovarian serous cystadenocarcinoma(97;0.0868)|BRCA - Breast invasive adenocarcinoma(99;0.18)			CGGTGGTCTGCAGCCAAGGGG	0.597																																						dbGAP											1	Substitution - Missense(1)	breast(1)											43.0	50.0	48.0					17																	80765535		2025	4168	6193	-	-	-	SO:0001583	missense	0			BC003094	CCDS45818.1	17q25.3	2006-11-21	2006-11-21			ENSG00000141556			11581	protein-coding gene	gene with protein product		604649	"""tubulin-specific chaperone d"""				Standard	NM_005993		Approved		uc002kfz.3	Q9BTW9		ENST00000355528.4:c.1139C>T	17.37:g.80765535C>T	ENSP00000347719:p.Ala380Val	Somatic		WXS	Illumina GAIIx	Phase_IV	O95458|Q7L8K1|Q8IXP6|Q8NAX0|Q8WYH4|Q96E74|Q9UF82|Q9UG46|Q9Y2J3	Missense_Mutation	SNP	pfam_Tubulin_specific_chaperoneD_C,superfamily_ARM-type_fold	p.A380V	ENST00000355528.4	37	c.1139	CCDS45818.1	17	.	.	.	.	.	.	.	.	.	.	C	18.36	3.606884	0.66558	.	.	ENSG00000141556	ENST00000355528;ENST00000269368;ENST00000334614;ENST00000536182	T	0.18338	2.22	5.01	5.01	0.66863	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.51415	0.1673	M	0.93328	3.405	0.80722	D	1	D;D;D	0.89917	0.999;1.0;0.999	D;D;D	0.73708	0.958;0.981;0.981	T	0.64041	-0.6500	9	.	.	.	.	14.188	0.65620	0.0:1.0:0.0:0.0	.	380;380;380	Q9BTW9;Q9BTW9-4;F5H8C7	TBCD_HUMAN;.;.	V	380;363;131;380	ENSP00000347719:A380V	.	A	+	2	0	TBCD	78358824	1.000000	0.71417	0.995000	0.50966	0.073000	0.16967	6.368000	0.73104	2.493000	0.84123	0.655000	0.94253	GCA	TBCD	-	superfamily_ARM-type_fold	ENSG00000141556		0.597	TBCD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TBCD	HGNC	protein_coding	OTTHUMT00000439415.1	114	0.00	0	C	NM_005993		80765535	80765535	+1	no_errors	ENST00000355528	ensembl	human	known	69_37n	missense	27	52.63	30	SNP	1.000	T
TDRD6	221400	genome.wustl.edu	37	6	46659314	46659314	+	Missense_Mutation	SNP	C	C	T			TCGA-A2-A0D2-01A-21W-A050-09	TCGA-A2-A0D2-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	05656575-69e7-4745-a89d-ca0568eb5559	c830c663-95f6-40e0-9fd6-16586fa7d344	g.chr6:46659314C>T	ENST00000316081.6	+	1	3449	c.3449C>T	c.(3448-3450)gCt>gTt	p.A1150V	TDRD6_ENST00000544460.1_Missense_Mutation_p.A1150V	NM_001010870.2	NP_001010870.1	O60522	TDRD6_HUMAN	tudor domain containing 6	1150					germ cell development (GO:0007281)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	chromatoid body (GO:0033391)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|P granule (GO:0043186)		p.A1150V(1)		NS(1)|breast(9)|central_nervous_system(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(15)|lung(25)|ovary(2)|pancreas(1)|prostate(1)|skin(5)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	80			Lung(136;0.192)			CAAATTAGTGCTAGTATTAAT	0.313																																						dbGAP											1	Substitution - Missense(1)	breast(1)											58.0	64.0	62.0					6																	46659314		2203	4295	6498	-	-	-	SO:0001583	missense	0			AF039442	CCDS34470.1, CCDS55017.1	6p12.3	2013-01-23			ENSG00000180113	ENSG00000180113		"""Tudor domain containing"""	21339	protein-coding gene	gene with protein product	"""cancer/testis antigen 41.2"", ""spermatogenesis associated 36"""	611200				9610721	Standard	NM_001010870		Approved	NY-CO-45, bA446F17.4, CT41.2, SPATA36	uc003oyj.3	O60522	OTTHUMG00000014788	ENST00000316081.6:c.3449C>T	6.37:g.46659314C>T	ENSP00000346065:p.Ala1150Val	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KWU2|F5H5M3|Q5HYB1|Q5VTS4|Q6ZMX5	Missense_Mutation	SNP	pfam_Tudor,smart_Tudor,pfscan_Tudor	p.A1150V	ENST00000316081.6	37	c.3449	CCDS34470.1	6	.	.	.	.	.	.	.	.	.	.	C	15.97	2.989997	0.54041	.	.	ENSG00000180113	ENST00000544460;ENST00000316081	T;T	0.15834	2.39;2.41	5.73	5.73	0.89815	.	0.256080	0.32343	N	0.006235	T	0.30386	0.0763	M	0.61703	1.905	0.35926	D	0.832182	D;D	0.67145	0.996;0.992	D;P	0.65987	0.94;0.873	T	0.01015	-1.1480	10	0.34782	T	0.22	-8.2159	19.8991	0.96978	0.0:1.0:0.0:0.0	.	1150;1150	F5H5M3;O60522	.;TDRD6_HUMAN	V	1150	ENSP00000443299:A1150V;ENSP00000346065:A1150V	ENSP00000346065:A1150V	A	+	2	0	TDRD6	46767273	0.998000	0.40836	0.977000	0.42913	0.410000	0.31052	3.690000	0.54713	2.708000	0.92522	0.655000	0.94253	GCT	TDRD6	-	NULL	ENSG00000180113		0.313	TDRD6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TDRD6	HGNC	protein_coding	OTTHUMT00000040800.1	59	0.00	0	C	XM_166443		46659314	46659314	+1	no_errors	ENST00000316081	ensembl	human	known	69_37n	missense	52	14.75	9	SNP	0.990	T
TET1	80312	genome.wustl.edu	37	10	70406740	70406740	+	Silent	SNP	A	A	G			TCGA-A2-A0D2-01A-21W-A050-09	TCGA-A2-A0D2-10A-01W-A055-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	05656575-69e7-4745-a89d-ca0568eb5559	c830c663-95f6-40e0-9fd6-16586fa7d344	g.chr10:70406740A>G	ENST00000373644.4	+	4	4463	c.4254A>G	c.(4252-4254)gaA>gaG	p.E1418E		NM_030625.2	NP_085128.2	Q8NFU7	TET1_HUMAN	tet methylcytosine dioxygenase 1	1418					chromatin modification (GO:0016568)|DNA demethylation (GO:0080111)|inner cell mass cell differentiation (GO:0001826)|negative regulation of methylation-dependent chromatin silencing (GO:0090310)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein O-linked glycosylation (GO:0006493)|regulation of DNA methylation (GO:0044030)|stem cell maintenance (GO:0019827)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	iron ion binding (GO:0005506)|methylcytosine dioxygenase activity (GO:0070579)|structure-specific DNA binding (GO:0043566)|zinc ion binding (GO:0008270)	p.E1418E(1)		breast(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(9)|lung(2)|ovary(5)|prostate(1)|upper_aerodigestive_tract(2)	21						AAGATTCTGAACTGCCCACCT	0.378																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											62.0	60.0	61.0					10																	70406740		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF430147	CCDS7281.1	10q21	2014-02-18	2011-09-30	2008-03-12	ENSG00000138336	ENSG00000138336			29484	protein-coding gene	gene with protein product	"""leukemia-associated protein with a CXXC domain"", ""ten-eleven translocation-1"""	607790	"""CXXC zinc finger 6"", ""tet oncogene 1"""	CXXC6		12124344, 12646957	Standard	NM_030625		Approved	LCX, KIAA1676, bA119F7.1	uc001jok.4	Q8NFU7	OTTHUMG00000018359	ENST00000373644.4:c.4254A>G	10.37:g.70406740A>G		Somatic		WXS	Illumina GAIIx	Phase_IV	Q5VUP7|Q7Z6B6|Q8TCR1|Q9C0I7	Silent	SNP	pfam_Znf_CXXC,pfscan_Znf_CXXC	p.E1418	ENST00000373644.4	37	c.4254	CCDS7281.1	10																																																																																			TET1	-	NULL	ENSG00000138336		0.378	TET1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TET1	HGNC	protein_coding	OTTHUMT00000048354.1	116	0.00	0	A	NM_030625		70406740	70406740	+1	no_errors	ENST00000373644	ensembl	human	known	69_37n	silent	55	33.73	28	SNP	0.007	G
NELFCD	51497	genome.wustl.edu	37	20	57562859	57562859	+	Missense_Mutation	SNP	C	C	A	rs202039877		TCGA-A2-A0D2-01A-21W-A050-09	TCGA-A2-A0D2-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	05656575-69e7-4745-a89d-ca0568eb5559	c830c663-95f6-40e0-9fd6-16586fa7d344	g.chr20:57562859C>A	ENST00000344018.3	+	4	437	c.410C>A	c.(409-411)aCt>aAt	p.T137N	NELFCD_ENST00000602795.1_Missense_Mutation_p.T146N			Q8IXH7	NELFD_HUMAN	negative elongation factor complex member C/D	137					gene expression (GO:0010467)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of viral transcription (GO:0050434)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|viral process (GO:0016032)	membrane (GO:0016020)|NELF complex (GO:0032021)|nucleoplasm (GO:0005654)		p.T137N(1)									TCTATTTTTACTGAAGAAGGA	0.433																																						dbGAP											1	Substitution - Missense(1)	breast(1)											98.0	97.0	98.0					20																	57562859		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF161479	CCDS13473.1, CCDS13473.2	20q13	2013-01-31	2013-01-31	2013-01-31	ENSG00000101158	ENSG00000101158			15934	protein-coding gene	gene with protein product	"""trihydrophobin 1"""	605297	"""TH1-like (Drosophila homolog)"", ""TH1-like (Drosophila)"""	TH1L		11030415, 11042152	Standard	NM_198976		Approved	HSPC130, TH1, NELF-C, NELF-D	uc002yag.4	Q8IXH7	OTTHUMG00000032861	ENST00000344018.3:c.410C>A	20.37:g.57562859C>A	ENSP00000342300:p.Thr137Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DE06|Q9BYL2|Q9H405|Q9H888|Q9H8T3|Q9NVX5|Q9P029|Q9UGN1|Q9UGN2|Q9UGN3	Missense_Mutation	SNP	pfam_TH1	p.T137N	ENST00000344018.3	37	c.410		20	.	.	.	.	.	.	.	.	.	.	C	13.83	2.354899	0.41700	.	.	ENSG00000101158	ENST00000344018	.	.	.	4.65	3.69	0.42338	.	0.000000	0.85682	D	0.000000	T	0.74382	0.3709	M	0.83118	2.625	0.58432	D	0.999994	D;B;P	0.60160	0.987;0.336;0.905	P;B;P	0.55749	0.783;0.259;0.459	T	0.78011	-0.2371	9	0.56958	D	0.05	-20.4185	12.7038	0.57049	0.1651:0.8349:0.0:0.0	.	137;146;137	B4E2K1;E1P5H4;Q8IXH7	.;.;NELFD_HUMAN	N	137	.	ENSP00000342300:T137N	T	+	2	0	TH1L	56996254	1.000000	0.71417	1.000000	0.80357	0.106000	0.19336	7.268000	0.78473	1.055000	0.40461	-0.314000	0.08810	ACT	TH1L	-	pfam_TH1	ENSG00000101158		0.433	NELFCD-201	KNOWN	basic|appris_principal	protein_coding	TH1L	HGNC	protein_coding		279	0.00	0	C	NM_198976		57562859	57562859	+1	no_errors	ENST00000344018	ensembl	human	known	69_37n	missense	246	26.92	91	SNP	1.000	A
TP63	8626	genome.wustl.edu	37	3	189608638	189608638	+	Silent	SNP	C	C	T			TCGA-A2-A0D2-01A-21W-A050-09	TCGA-A2-A0D2-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	05656575-69e7-4745-a89d-ca0568eb5559	c830c663-95f6-40e0-9fd6-16586fa7d344	g.chr3:189608638C>T	ENST00000264731.3	+	13	1802	c.1713C>T	c.(1711-1713)acC>acT	p.T571T	TP63_ENST00000440651.2_Silent_p.T567T|TP63_ENST00000449992.1_Silent_p.T392T|TP63_ENST00000392461.3_Intron|TP63_ENST00000456148.1_Silent_p.T473T|TP63_ENST00000382063.4_Silent_p.T486T|TP63_ENST00000392460.3_Intron|TP63_ENST00000320472.5_Intron|TP63_ENST00000392463.2_Intron|TP63_ENST00000354600.5_Silent_p.T477T	NM_001114978.1|NM_003722.4	NP_001108450.1|NP_003713.3	Q9H3D4	P63_HUMAN	tumor protein p63	571	SAM.				apoptotic process (GO:0006915)|cell aging (GO:0007569)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to UV (GO:0034644)|chromatin remodeling (GO:0006338)|cloacal septation (GO:0060197)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|ectoderm and mesoderm interaction (GO:0007499)|embryonic limb morphogenesis (GO:0030326)|epidermal cell division (GO:0010481)|epithelial cell development (GO:0002064)|establishment of planar polarity (GO:0001736)|establishment of skin barrier (GO:0061436)|female genitalia morphogenesis (GO:0048807)|hair follicle morphogenesis (GO:0031069)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|keratinocyte differentiation (GO:0030216)|keratinocyte proliferation (GO:0043616)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organismal aging (GO:0010259)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cellular senescence (GO:2000773)|negative regulation of keratinocyte differentiation (GO:0045617)|negative regulation of mesoderm development (GO:2000381)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|odontogenesis of dentin-containing tooth (GO:0042475)|polarized epithelial cell differentiation (GO:0030859)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of cell cycle G1/S phase transition (GO:1902808)|positive regulation of fibroblast apoptotic process (GO:2000271)|positive regulation of keratinocyte proliferation (GO:0010838)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of Notch signaling pathway (GO:0045747)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|post-anal tail morphogenesis (GO:0036342)|prostatic bud formation (GO:0060513)|protein homotetramerization (GO:0051289)|proximal/distal pattern formation (GO:0009954)|regulation of epidermal cell division (GO:0010482)|regulation of neuron apoptotic process (GO:0043523)|response to gamma radiation (GO:0010332)|response to X-ray (GO:0010165)|skeletal system development (GO:0001501)|smooth muscle tissue development (GO:0048745)|squamous basal epithelial stem cell differentiation involved in prostate gland acinus development (GO:0060529)|sympathetic nervous system development (GO:0048485)|urinary bladder development (GO:0060157)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendrite (GO:0030425)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|double-stranded DNA binding (GO:0003690)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|p53 binding (GO:0002039)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding transcription factor activity (GO:0000989)|transcription regulatory region DNA binding (GO:0044212)|WW domain binding (GO:0050699)	p.T571T(1)		breast(2)|central_nervous_system(2)|cervix(1)|endometrium(7)|kidney(5)|large_intestine(12)|lung(15)|ovary(2)|skin(9)|upper_aerodigestive_tract(6)	61	all_cancers(143;3.35e-10)|Ovarian(172;0.0925)		Lung(62;3.33e-05)	GBM - Glioblastoma multiforme(93;0.0227)		AGGGGCTGACCACCATCTATC	0.438										HNSCC(45;0.13)																												dbGAP											1	Substitution - coding silent(1)	breast(1)											114.0	102.0	106.0					3																	189608638		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB010153	CCDS3293.1, CCDS46976.1, CCDS46977.1, CCDS46978.1, CCDS46979.1, CCDS46980.1	3q27-q29	2014-09-17			ENSG00000073282	ENSG00000073282			15979	protein-coding gene	gene with protein product		603273	"""tumor protein p73-like"", ""tumor protein p53-like"", ""tumor protein p53-competing protein"""	TP73L, TP53L, TP53CP		9774969, 9662378, 11181441, 11181451	Standard	NM_003722		Approved	p51, SHFM4, EEC3, p63, p73L, OFC8, KET, p73H, NBP, p53CP	uc003fry.2	Q9H3D4	OTTHUMG00000156313	ENST00000264731.3:c.1713C>T	3.37:g.189608638C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	O75080|O75195|O75922|O76078|Q6VEG2|Q6VEG3|Q6VEG4|Q6VFJ1|Q6VFJ2|Q6VFJ3|Q6VH20|Q7LDI3|Q7LDI4|Q7LDI5|Q96KR0|Q9H3D2|Q9H3D3|Q9H3P8|Q9NPH7|Q9P1B4|Q9P1B5|Q9P1B6|Q9P1B7|Q9UBV9|Q9UE10|Q9UP26|Q9UP27|Q9UP28|Q9UP74	Silent	SNP	pfam_p53_DNA-bd,pfam_p53_tetrameristn,pfam_SAM_2,superfamily_p53-like_TF_DNA-bd,superfamily_SAM/pointed,superfamily_p53_tetrameristn,smart_SAM,prints_p53_tumour_suppressor	p.T571	ENST00000264731.3	37	c.1713	CCDS3293.1	3																																																																																			TP63	-	pfam_SAM_2,superfamily_SAM/pointed,smart_SAM	ENSG00000073282		0.438	TP63-001	KNOWN	basic|CCDS	protein_coding	TP63	HGNC	protein_coding	OTTHUMT00000343865.1	212	0.00	0	C	NM_003722		189608638	189608638	+1	no_errors	ENST00000264731	ensembl	human	known	69_37n	silent	161	30.30	70	SNP	1.000	T
TRIM55	84675	genome.wustl.edu	37	8	67062591	67062591	+	Nonsense_Mutation	SNP	C	C	G			TCGA-A2-A0D2-01A-21W-A050-09	TCGA-A2-A0D2-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	05656575-69e7-4745-a89d-ca0568eb5559	c830c663-95f6-40e0-9fd6-16586fa7d344	g.chr8:67062591C>G	ENST00000315962.4	+	7	1248	c.875C>G	c.(874-876)tCa>tGa	p.S292*	TRIM55_ENST00000276573.7_Nonsense_Mutation_p.S292*|TRIM55_ENST00000353317.5_Nonsense_Mutation_p.S292*|TRIM55_ENST00000350034.4_Intron	NM_184085.1	NP_908973.1	Q9BYV6	TRI55_HUMAN	tripartite motif containing 55	292	COS. {ECO:0000255|PROSITE- ProRule:PRU00586}.				signal transduction (GO:0007165)	cytoplasm (GO:0005737)|microtubule (GO:0005874)|nucleus (GO:0005634)	identical protein binding (GO:0042802)|signal transducer activity (GO:0004871)|zinc ion binding (GO:0008270)	p.S292*(1)		breast(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|lung(13)|ovary(1)|prostate(2)|skin(6)|upper_aerodigestive_tract(2)	39		Lung NSC(129;0.138)|all_lung(136;0.221)	Epithelial(68;0.0136)|all cancers(69;0.0582)|BRCA - Breast invasive adenocarcinoma(89;0.0628)|OV - Ovarian serous cystadenocarcinoma(28;0.0904)			TCGGAAGCATCAAAGGCATTT	0.368																																						dbGAP											1	Substitution - Nonsense(1)	breast(1)											101.0	101.0	101.0					8																	67062591		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AJ291712	CCDS6184.1, CCDS6185.1, CCDS6186.1, CCDS6187.1	8q13.1	2013-01-09	2011-01-25	2004-11-17	ENSG00000147573	ENSG00000147573		"""RING-type (C3HC4) zinc fingers"", ""Tripartite motif containing / Tripartite motif containing"""	14215	protein-coding gene	gene with protein product		606469	"""ring finger protein 29"", ""tripartite motif-containing 55"""	RNF29		11243782	Standard	NM_033058		Approved	MURF-2	uc003xvv.3	Q9BYV6	OTTHUMG00000164473	ENST00000315962.4:c.875C>G	8.37:g.67062591C>G	ENSP00000323913:p.Ser292*	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KRC0|B3KRJ3|Q53XX3|Q8IUD9|Q8IUE4|Q96DV2|Q96DV3|Q9BYV5	Nonsense_Mutation	SNP	pfam_Znf_B-box,pfam_Znf_C3HC4_RING-type,smart_Znf_RING,smart_Znf_B-box,pfscan_Znf_B-box,pfscan_Znf_RING	p.S292*	ENST00000315962.4	37	c.875	CCDS6184.1	8	.	.	.	.	.	.	.	.	.	.	C	39	7.450591	0.98292	.	.	ENSG00000147573	ENST00000315962;ENST00000353317;ENST00000276573	.	.	.	5.84	5.84	0.93424	.	0.109140	0.64402	D	0.000005	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.72032	D	0.01	.	20.1535	0.98095	0.0:1.0:0.0:0.0	.	.	.	.	X	292	.	ENSP00000276573:S292X	S	+	2	0	TRIM55	67225145	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	7.703000	0.84585	2.764000	0.94973	0.650000	0.86243	TCA	TRIM55	-	NULL	ENSG00000147573		0.368	TRIM55-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRIM55	HGNC	protein_coding	OTTHUMT00000378921.1	280	0.00	0	C	NM_184085		67062591	67062591	+1	no_errors	ENST00000315962	ensembl	human	known	69_37n	nonsense	307	24.26	99	SNP	1.000	G
USHBP1	83878	genome.wustl.edu	37	19	17370427	17370427	+	Missense_Mutation	SNP	C	C	T			TCGA-A2-A0D2-01A-21W-A050-09	TCGA-A2-A0D2-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	05656575-69e7-4745-a89d-ca0568eb5559	c830c663-95f6-40e0-9fd6-16586fa7d344	g.chr19:17370427C>T	ENST00000252597.3	-	6	1056	c.883G>A	c.(883-885)Gcc>Acc	p.A295T	USHBP1_ENST00000598570.1_5'Flank|USHBP1_ENST00000431146.2_Missense_Mutation_p.A231T	NM_031941.3	NP_114147.2			Usher syndrome 1C binding protein 1									p.A295T(1)		breast(3)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(10)|liver(1)|lung(12)|ovary(3)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)	44						TCCATCTGGGCTTCCATGATG	0.577																																						dbGAP											1	Substitution - Missense(1)	breast(1)											160.0	172.0	168.0					19																	17370427		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK096028	CCDS12353.1	19p13.11	2013-06-10			ENSG00000130307	ENSG00000130307			24058	protein-coding gene	gene with protein product		611810				11311560	Standard	XM_005260093		Approved	MCC2, AIEBP, FLJ38709	uc002nfs.1	Q8N6Y0	OTTHUMG00000182730	ENST00000252597.3:c.883G>A	19.37:g.17370427C>T	ENSP00000252597:p.Ala295Thr	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_USH1C-bd_PDZ_domain	p.A295T	ENST00000252597.3	37	c.883	CCDS12353.1	19	.	.	.	.	.	.	.	.	.	.	C	10.98	1.505388	0.26949	.	.	ENSG00000130307	ENST00000252597;ENST00000431146;ENST00000324554	T;T	0.18338	2.22;2.22	5.33	-2.88	0.05682	.	1.177620	0.06095	N	0.664402	T	0.09113	0.0225	L	0.29908	0.895	0.09310	N	1	B;B;B	0.17852	0.024;0.004;0.024	B;B;B	0.10450	0.005;0.002;0.005	T	0.36720	-0.9736	10	0.14252	T	0.57	2.3709	1.3715	0.02212	0.1381:0.3826:0.1347:0.3446	.	231;295;295	B4DUE8;Q8N8Y1;Q8N6Y0	.;.;USBP1_HUMAN	T	295;231;295	ENSP00000252597:A295T;ENSP00000407902:A231T	ENSP00000252597:A295T	A	-	1	0	USHBP1	17231427	0.000000	0.05858	0.001000	0.08648	0.552000	0.35366	-0.413000	0.07123	-0.523000	0.06409	-0.345000	0.07892	GCC	USHBP1	-	NULL	ENSG00000130307		0.577	USHBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	USHBP1	HGNC	protein_coding	OTTHUMT00000463328.1	230	0.00	0	C	NM_031941		17370427	17370427	-1	no_errors	ENST00000252597	ensembl	human	known	69_37n	missense	118	20.67	31	SNP	0.002	T
VWA3A	146177	genome.wustl.edu	37	16	22128094	22128094	+	Missense_Mutation	SNP	C	C	T			TCGA-A2-A0D2-01A-21W-A050-09	TCGA-A2-A0D2-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	05656575-69e7-4745-a89d-ca0568eb5559	c830c663-95f6-40e0-9fd6-16586fa7d344	g.chr16:22128094C>T	ENST00000389398.5	+	10	926	c.830C>T	c.(829-831)tCt>tTt	p.S277F	VWA3A_ENST00000389397.4_5'UTR	NM_173615.3	NP_775886.3	A6NCI4	VWA3A_HUMAN	von Willebrand factor A domain containing 3A	277						extracellular region (GO:0005576)		p.S277F(1)		haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(1)|skin(1)	7				GBM - Glioblastoma multiforme(48;0.0439)		GATCAGCCTTCTGAAATCCTG	0.498																																						dbGAP											1	Substitution - Missense(1)	breast(1)											82.0	79.0	80.0					16																	22128094		2054	4197	6251	-	-	-	SO:0001583	missense	0			AK128606, AK098260	CCDS45441.1	16p12.1	2008-02-05				ENSG00000175267			27088	protein-coding gene	gene with protein product						12477932	Standard	XM_006721021		Approved	FLJ46765, FLJ40941	uc010vbq.2	A6NCI4		ENST00000389398.5:c.830C>T	16.37:g.22128094C>T	ENSP00000374049:p.Ser277Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	A4QMU8|A6NNC0|Q6UTX4|Q6ZQZ9|Q8IUY6|Q8N9W1	Missense_Mutation	SNP	pfam_VWF_A,smart_VWF_A,pfscan_VWF_A	p.S277F	ENST00000389398.5	37	c.830	CCDS45441.1	16	.	.	.	.	.	.	.	.	.	.	C	11.10	1.540223	0.27563	.	.	ENSG00000175267	ENST00000310694;ENST00000389398	T	0.08807	3.05	5.54	3.58	0.41010	.	0.478263	0.19750	N	0.106901	T	0.12305	0.0299	M	0.76838	2.35	0.80722	D	1	B	0.31153	0.31	B	0.35312	0.2	T	0.03051	-1.1078	10	0.54805	T	0.06	.	4.5292	0.11997	0.1589:0.6049:0.1535:0.0827	.	277	A6NCI4	VWA3A_HUMAN	F	177;277	ENSP00000374049:S277F	ENSP00000308827:S177F	S	+	2	0	VWA3A	22035595	0.000000	0.05858	0.996000	0.52242	0.757000	0.42996	0.601000	0.24119	0.698000	0.31739	-0.165000	0.13383	TCT	VWA3A	-	NULL	ENSG00000175267		0.498	VWA3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	VWA3A	HGNC	protein_coding	OTTHUMT00000430052.1	161	0.00	0	C			22128094	22128094	+1	no_errors	ENST00000389398	ensembl	human	known	69_37n	missense	106	15.20	19	SNP	0.898	T
WDR93	56964	genome.wustl.edu	37	15	90278750	90278750	+	Missense_Mutation	SNP	G	G	A			TCGA-A2-A0D2-01A-21W-A050-09	TCGA-A2-A0D2-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	05656575-69e7-4745-a89d-ca0568eb5559	c830c663-95f6-40e0-9fd6-16586fa7d344	g.chr15:90278750G>A	ENST00000268130.7	+	14	1675	c.1574G>A	c.(1573-1575)tGt>tAt	p.C525Y	WDR93_ENST00000560294.1_Missense_Mutation_p.C497Y|WDR93_ENST00000444934.2_Missense_Mutation_p.C242Y	NM_020212.1	NP_064597.1	Q6P2C0	WDR93_HUMAN	WD repeat domain 93	525					electron transport chain (GO:0022900)		oxidoreductase activity, acting on NAD(P)H (GO:0016651)	p.C525Y(1)		NS(1)|breast(3)|endometrium(2)|kidney(4)|large_intestine(5)|liver(2)|lung(8)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	33	Lung NSC(78;0.0237)|all_lung(78;0.0478)		KIRC - Kidney renal clear cell carcinoma(17;0.0286)|Kidney(142;0.0514)|BRCA - Breast invasive adenocarcinoma(143;0.128)			AAAACCATCTGTGCCGTGGCC	0.453																																						dbGAP											1	Substitution - Missense(1)	breast(1)											125.0	119.0	121.0					15																	90278750		2200	4299	6499	-	-	-	SO:0001583	missense	0				CCDS32326.1, CCDS66862.1, CCDS73779.1	15q26.1	2012-11-02						"""WD repeat domain containing"""	26924	protein-coding gene	gene with protein product							Standard	NM_020212		Approved		uc002boj.3	Q6P2C0		ENST00000268130.7:c.1574G>A	15.37:g.90278750G>A	ENSP00000268130:p.Cys525Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8N7Y8|Q9NP89	Missense_Mutation	SNP	superfamily_WD40_repeat_dom	p.C525Y	ENST00000268130.7	37	c.1574	CCDS32326.1	15	.	.	.	.	.	.	.	.	.	.	G	4.128	0.021970	0.08006	.	.	ENSG00000140527	ENST00000268130;ENST00000444934	T;T	0.27890	1.64;2.36	5.47	3.56	0.40772	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	0.215647	0.41938	N	0.000783	T	0.23289	0.0563	L	0.43701	1.375	0.34018	D	0.652335	B;B	0.32382	0.125;0.368	B;B	0.28553	0.032;0.091	T	0.28586	-1.0039	10	0.48119	T	0.1	-4.9499	8.6939	0.34284	0.1796:0.0:0.8204:0.0	.	497;525	Q6P2C0-2;Q6P2C0	.;WDR93_HUMAN	Y	525;242	ENSP00000268130:C525Y;ENSP00000403871:C242Y	ENSP00000268130:C525Y	C	+	2	0	WDR93	88079754	0.995000	0.38212	0.953000	0.39169	0.062000	0.15995	2.266000	0.43320	0.660000	0.30964	0.650000	0.86243	TGT	WDR93	-	superfamily_WD40_repeat_dom	ENSG00000140527		0.453	WDR93-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	WDR93	HGNC	protein_coding	OTTHUMT00000416369.1	184	0.00	0	G	NM_020212		90278750	90278750	+1	no_errors	ENST00000268130	ensembl	human	known	69_37n	missense	75	46.81	66	SNP	0.998	A
ZFP41	286128	genome.wustl.edu	37	8	144332310	144332310	+	Missense_Mutation	SNP	G	G	C			TCGA-A2-A0D2-01A-21W-A050-09	TCGA-A2-A0D2-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	05656575-69e7-4745-a89d-ca0568eb5559	c830c663-95f6-40e0-9fd6-16586fa7d344	g.chr8:144332310G>C	ENST00000330701.4	+	2	666	c.297G>C	c.(295-297)aaG>aaC	p.K99N	ZFP41_ENST00000522452.1_Missense_Mutation_p.K99N|ZFP41_ENST00000520584.1_Missense_Mutation_p.K99N	NM_173832.4	NP_776193.1	Q8N8Y5	ZFP41_HUMAN	ZFP41 zinc finger protein	99					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.K99N(1)		breast(1)|endometrium(2)|lung(4)|ovary(1)	8	all_cancers(97;1.01e-10)|all_epithelial(106;4.6e-09)|Lung NSC(106;0.000167)|all_lung(105;0.000459)|Ovarian(258;0.0212)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.156)|Colorectal(110;0.173)			TTAAGCACAAGACAGACCACA	0.522																																						dbGAP											1	Substitution - Missense(1)	breast(1)											89.0	90.0	90.0					8																	144332310		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS6397.1	8q24.3	2013-01-08	2012-11-27		ENSG00000181638	ENSG00000181638		"""Zinc fingers, C2H2-type"""	26786	protein-coding gene	gene with protein product			"""zinc finger protein 41 homolog (mouse)"""			11214971	Standard	NM_173832		Approved	FLJ38705, FLJ00028, ZNF753	uc003yxw.4	Q8N8Y5	OTTHUMG00000164951	ENST00000330701.4:c.297G>C	8.37:g.144332310G>C	ENSP00000327427:p.Lys99Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DWJ5	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.K99N	ENST00000330701.4	37	c.297	CCDS6397.1	8	.	.	.	.	.	.	.	.	.	.	G	9.382	1.073258	0.20147	.	.	ENSG00000181638	ENST00000520584;ENST00000330701;ENST00000522452	T;T;T	0.40225	1.04;1.04;1.04	3.38	1.44	0.22558	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.20536	0.0494	N	0.08118	0	0.09310	N	1	D	0.55385	0.971	B	0.40444	0.329	T	0.09185	-1.0686	9	0.29301	T	0.29	-9.5737	9.1216	0.36791	0.0:0.0:0.4272:0.5728	.	99	Q8N8Y5	ZFP41_HUMAN	N	99	ENSP00000430465:K99N;ENSP00000327427:K99N;ENSP00000428966:K99N	ENSP00000327427:K99N	K	+	3	2	ZFP41	144403685	0.000000	0.05858	0.057000	0.19452	0.812000	0.45895	-0.926000	0.03988	0.211000	0.20683	0.467000	0.42956	AAG	ZFP41	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000181638		0.522	ZFP41-001	KNOWN	NMD_exception|basic|appris_principal|CCDS	protein_coding	ZFP41	Clone_based_vega_gene	protein_coding	OTTHUMT00000381114.2	80	0.00	0	G	NM_173832		144332310	144332310	+1	no_errors	ENST00000330701	ensembl	human	known	69_37n	missense	38	26.92	14	SNP	0.084	C
